Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Hox genes in early hematopoietic development and leukemia Pineault, Nicolas 2001

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2001-715191.pdf [ 8.94MB ]
Metadata
JSON: 831-1.0090726.json
JSON-LD: 831-1.0090726-ld.json
RDF/XML (Pretty): 831-1.0090726-rdf.xml
RDF/JSON: 831-1.0090726-rdf.json
Turtle: 831-1.0090726-turtle.txt
N-Triples: 831-1.0090726-rdf-ntriples.txt
Original Record: 831-1.0090726-source.json
Full Text
831-1.0090726-fulltext.txt
Citation
831-1.0090726.ris

Full Text

HOX G E N E S IN E A R L Y H E M A T O P O I E T I C D E V E L O P M E N T A N D L E U K E M I A By NICOLAS PINEAULT B.Sc. Biochemistry, Universite Laval, 1995 A THESIS SUBMITTED IN PARTIAL F U L F n X M E N T OF T H E R E Q U I R E M E N T S FOR THE D E G R E E O F D O C T O R O F PHILOSOPHY In T H E F A C U L T Y OF G R A D U A T E STUDIES Genet ics Graduate Program We accept this thesis as^conforming to the required standard T H E UNP/ERSITY OF BRITISH COLUMBIA September, 2001 © Nicolas Pineault, 2001 B C Special Collections - Thesis Authorisation Form In presenting t h i s thesis i n p a r t i a l f u l f i l m e n t of the requirements for an advanced degree at the Univ e r s i t y of B r i t i s h Columbia, I agree that the Li b r a r y s h a l l make i t f r e e l y a v ailable for reference and study. I further agree that permission f o r extensive copying of th i s thesis f o r sc h o l a r l y purposes may be granted by the head of my department or by his or her representatives. It i s understood that copying or p u b l i c a t i o n of t h i s th|esis for f i n a n c i a l gain s h a l l not be allowed without my written permission. Department of The U n i v e r s i t y of B r i t i s h Columbia Vancouver, Canada Date Se ^ t S | T ~ > \ :tp://www.library.ubc.ca/spcoll/thesauth.html ABSTRACT Hematopoiesis is a complex process by which billions of mature cells are produced from a small pool of primitive cells found in the bone marrow (BM) known as hematopoietic stem cells (HSC). The Hox homeobox gene family of transcription factors (TF) first recognized as key regulators of embryogenesis has recently been implicated in the regulation of normal hematopoiesis and in leukemogenesis. To gain further insights into possible roles of Hox genes in hematopoiesis, three line of investigation were pursued in this thesis work. First, Hox gene expression and that of their co-factors Pbxl and Meisl was assessed at different stages of hematopoietic development in functionally distinct hematopoietic subpopulations. Hox genes were preferentially expressed in HSC-enriched subpopulations in both adult and fetal stages of hematopoiesis, and downregulated following differentiation and maturation. The Pbxl and Meisl genes had important differences in their expression pattern, but were both detected in Hox expressing subpopulations. Together, these results further support the notion that Hox genes are involved in the regulation of early hematopoietic cells at all stages of hematopoietic ontogeny. The transcriptional regulation of Hox genes in hematopoietic cells was investigated by taking advantage of a recently cloned novel human cDNA for HOXB3 from purified CD34 + B M cells. Functional characterization of the upstream genomic D N A led to the discovery of a novel HOXB3 transcriptional regulatory element in intron 2 with enhancer-like properties when tested in hematopoietic cell lines. These results point to the i i existence of specific hematopoietic-active transcriptional regulatory elements important for regulating Hox gene expression in primitive hematopoietic cells. The recent identification of a second translocation involving a Hox gene and the NUP98 gene in acute myeloid leukemia (AML) further suggested that deregulated and/or mutant Hox genes might be directly involved in the leukemic process. To test this hypothesis, the leukemogenic potential of the NUP98-HOXD13 t(2;l 1) fusion gene, alone or in concert with a candidate collaborating gene, Meisl, was studied in the murine B M transplantation model. Overexpression of NUP98-HOXD13 in vivo led to mild myeloproliferation, whereas co-expression with Meisl resulted in the development of myelomonocytic leukemia, closely re-capitulating human myelomonocytic NUP98-associated leukemia. iii TABLE OF CONTENTS ABSTRACT ii TABLE OF CONTENTS iv LIST OF FIGURES vii LIST OF TABLES ix ABBREVIATIONS x ACKNOWLEDGMENTS xii CHAPTER 1 Introduction 1 1.1 Overview 1 1.2 Hematopoiesis 3 1.2.1 Hematopoietic stem cells 3 1.2.2 Hematopoietic hierarchy 6 1.2.3 Ontogeny of the murine hematopoietic system 9 1.3 Regulation of hematopoiesis 10 1.3.1 Regulation of hematopoietic cells by extracellular factors 12 1.3.1.1 Extracellular matrix and ligands 12 1.3.1.2 Growth factors 13 1.3.2 Intrinsic Regulators 14 1.3.2.1 Transcription factors 15 1.3.2.2 Transcription factors in the regulation and development of hematopoiesis.. 17 1.4 The Hox genes 20 1.4.1 The mammalian homeobox genes 22 1.4.1.1 Definition and classification 22 1.4.1.2 Chromosomal organization 24 1.4.1.3 Transcriptional regulation of Hox genes during embryogenesis 25 1.4.1.3.1 Cis-regulatory elements 26 1.4.1.3.2 Trans-regulators of Hox genes 27 1.4.1.4 Hox protein structure and Hox co-factors 31 1.4.1.5 Functions in mammals 36 1.4.1.5.1 Function in embryogenesis 36 1.4.1.5.2 Hox gene expression in adult tissues 37 1.4.2 Hox genes in hematopoiesis 37 1.4.2.1 Expression and induction in hematopoietic cells 37 1.4.2.2 Function of Hox genes in hematopoiesis 41 1.4.2.3 Regulation of Hox genes in hematopoietic cells 45 1.4.2.4 Involvement of Hox genes in leukemia.. 47 1.4.2.5 The mammalian Polycomb and Trithorax genes 53 1.5 Targets of Hox genes 55 1.6 Thesis objectives 59 iv CHAPTER 2 Materials and methods 62 2.1 Hematopoietic B M subpopulations, cell lines and clonogenic progenitors assays62 2.1.1 Cell lines 62 2.1.2 Isolation of murine hematopoietic cell subpopulations 63 2.1.3 Clonogenic progenitor assays 63 2.1.4 Embryonic stem cell culture and differentiation 64 2.2 Global cDNA amplification, RT-PCR, Southern and northern blots 65 2.2.1 cDNA amplification 65 2.2.2 Southern blot analysis of RT-PCR products 65 2.2.2.1 Probes used for Hox gene expression study 66 2.2.2.2 Probes used for expression of HOXB3 in human B M cells 67 2.2.3 Specific RT-PCR for exon 3a' of human HOXB3 gene 67 2.2.4 RT-PCR for Meisl and NUP98-HOXD13 proviral expression 67 2.2.5 Genomic Southern blots 68 2.2.6 Northern blots 69 2.3 Isolation of a novel HOXB3 cDNA in CD34 + B M cells library 69 2.3.1 Construction of a human B M CD34 + cells cDNA library 69 2.3.2 Isolation and characterization of a human HOXB3 cDNA 70 2.4 Transcriptional assays using the C A T gene reporter assay 72 2.4.1 Isolation and characterization of the human and murine genomic DNA contained between exon 2 and exon 3 of HOXB3 72 2.4.2 Assays for testing transcriptional regulatory activity 73 2.5 DNA sequence analysis 74 2.6 Analysis of transduced murine bone marrow cells in vitro and in vivo 75 2.6.1 cDNA constructs and retroviral vectors 75 2.6.2 Retrovirus production, B M infection and isolation of transduced B M cells. 76 2.6.2.1 Mice and retroviral infection of primary bone marrow cells 76 2.6.2.2 Bone marrow transplantation and assessment of mice 77 2.6.3 In vitro and in vivo assay of transduced B M 78 2.6.3.1 In vitro assays 78 2.6.3.2 In vivo assay- CFU-S assay 79 2.7 Statistical analysis 79 CHAPTER 3 Differential Expression of Hox, Meisl and Pbxl Genes in Primitive Cells Throughout Hematopoietic Ontogeny 80 3.1 Summary 80 3.2 Introduction 81 3.3 Results ., 84 3.4 Discussion 96 v CHAPTER 4 A novel HOXB3 transcript and transcriptional regulatory region identified and characterised in human hematopoietic 102 4.1 Summary 102 4.2 Introduction 103 4.3 Results 106 4.4 Discussion 118 CHAPTER 5 Induction of acute myeloid leukemia in mice by the human leukemia-specific fusion gene NUP98-HOXD13 in concert with Meisl 123 5.1 Summary 123 5.2 Introduction 124 5.3 Results 127 5.4 Discussion 142 CHAPTER 6 General Discussion and Conclusions 148 6.1 Conserved Hox gene expression program throughout hematopoiesis development 148 6.2 Transcriptional regulation of Hox genes in hematopoietic cells 151 6.3 Hox gene leukemogenic potential 153 6.4 Closing perspectives 155 CHAPTER 7 References 157 vi LIST O F F IGURES Figure 1.1 Schematic representation of the hematopoietic hierarchy 7 Figure 1.2 Schematic representation of transcription factors implicated in the regulation of hematopoiesis 19 Figure 1.3 Genomic organisation of the Drosophila HOM-C and mammalian Hox genes. 23 Figure 1.4 Schematic representation of a Hox protein 31 Figure 1.5 Involvement of Hox genes and related genes in leukemia 52 Figure 3.1 Linear correlation between HoxalO expression and the number of HoxalO expressing cells in total amplified cDNAs 86 Figure 3.2 Hox gene expression in adult murine B M subpopulations isolated by FACS and analyzed by Southern blot of total amplified cDNAs 88 Figure 3.3 Hox gene expression in adult murine FL day 14.5 subpopulations isolated by FACS and analyzed by Southern blot of total amplified cDNAs 89 Figure 3.4 Expression of Pbxl, Pbxl and Meisl in functionally distinct hematopoietic subpopulations 92 Figure 3.5 Hox gene expression in undifferentiated ES cells and differentiating EB 94 Figure 4.1 Structure and alternative transcripts from the human HOXBS gene 108 Figure 4.2 Detection of a novel HOXBS sequence in RNA from CD34 + bone marrow cells and K562 erythroid cell line 109 Figure 4.3 Nucleotide sequence for HOXBS second intron 112 Figure 4.4 HOXBS intron 2 sequence can promote transcription in the K562 but not HL60 cell lines and the 5' end of intron 2 is essential for the transcriptional activity 114 Figure 4.5 Detection of enhancer activity of HOXBS intron 2 in K562 cells 117 vn Figure 5.1 NUP98, HOXD13 and chimeric gene and retroviral constructs 128 Figure 5.2 Transduced peripheral blood cells of mice transplanted with B M expressing NUP98-HOXD13 or GFP 129 Figure 5.3 Survival curve of primary and secondary mice 133 Figure 5.4 Morphology of the PB obtained from a diseased NUP98-HOXD13 mouse and a diseased NUP98-HOXD13/Meisl mouse 137 Figure 5.5 Detailed analysis of hematopoietic cells from B M , spleen and PB of diseased mice 138 Figure 5.6 Southern blot analysis of proviral integration in primary and secondary NUP98-HOXD13 and GFP transplanted mice 139 Figure 5.7 Expression of proviral NUP98-HOXD13 and Meisl transcripts in co-transduced B M cells 140 Figure 5.8 Functional characterization of the NUP98 region of the NUP98-HOXD13 fusion gene using the CFU-S in vitro expansion assay 141 viii L I S T O F T A B L E S Table 1.1 Summary of the effects upon hematopoiesis of overexpression of Hox genes in murine bone marrow 44 Table 3.1 Summary (n=3) of Hox gene expression in adult bone marrow cells 88 Table 3.2 Summary (n=2) of Hox gene expression in fetal liver day 14.5 cells 90 Table 3.3 Hematopoietic clonogenic progenitor frequency in EB cells 95 Table 5.1 Characteristics of sacrificed primary and secondary NUP98-HOXD13 mice or GFP mice 132 ix A B B R E V I A T I O N S a.a. Amino acid abd-A Abdominal-A genes abd-B Abdominal-B genes A L L Acute lymphoblastic leukemia A M L Acute myeloid leukemia a- Antisense oligomer antp Antennapedia A T C C American type culture collection BFU-E Burst-forming unit-erythroid bHLH Basic helix-loop-helix B M Bone marrow BMP Bone morphogenetic proteins bp Base pair C Cervical vertebrae C A M Cell-adhesion molecules C A T Chloramphenicol acetyl transferase assay cDNA Complementary DNA strand CDI Cyclin kinase inhibitor COOH Carboxyl terminal end CRU Competitive repopulating assay CFC Colony-forming-cells CSF Colony stimulating factor DNA Deoxyribonucleotide DEPC Diethyl pyrocarbonate Dpc Days post-coitus EB Embryoid bodies ES Embryonic stem cells Exd Extradentical FACS Fluorescent activated cell sorter FCS Fetal calf serum F G Phenylalanine-glycine repeats FGF Fibroblast growth factor FL Fetal liver 5-FU 5-fluorouracil G-CSF Granulocyte colony stimulating factor G M Granulomonocytic GM-CSF Granulocyte-macrophage colony stimulating factor GF Growth factor HSC Hematopoietic stem cell LAP Intracisternal A-particle ICAM Intercellular cellular-adhesion molecules IL Interleukin LIF Leukemia inhibiting factor Lin Lineage LRC Leukemia-repopulating cell LTC-IC Long-term culture initiating cells assay M-CSF Macrophage colony stimulating factor mRNA Messenger RNA M S C V Murine stem cell virus ND13 NUP98-HOXD13 N - C A M Neuronal cell-adhesion molecules N H 2 Amino terminal end NOD Nonobese diabetic NPC Nuclear pore complex O T M Oncostatin M PB Peripheral blood PcG Polycomb genes PHA Phytohemagglutinin PKA Protein kinase A PRE Polycomb response element SF Steel factor (stem cell factor) TF Transcription factors T A D Transcription activation domain trxG Trithorax genes r Rhombomere Rho123 Rhodamine 123 RAR Retinoic acid receptors RNA Ribonucleic acid RT Reverse transcriptase S Spleen S A M Substrate-adhesion molecules SCID Severe immunodifficient mice SEM Standard error of the mean SD Standard error STAT Signal transduction activation transcription factors T A D Transcriptional activation domain t-AML Therapy-related A M L t-MPS Therapy-related myelodysplastic syndrome USF upstream stimulating factor UTR Untranslated region A C K N O W L E D G M E N T S I wish to thank my supervisor Dr. Keith Humphries, which provided constant support, advice and interesting conversations, all of which made this work possible. I am also grateful for his constant support and contribution of knowledge that helped me in the writing of this thesis. I must also point and sincerely thanks two other individuals who greatly help me throughout my whole Ph.D., Patty Rosten and Cheryl Helgason, which provided me with all the required information and knowledge for the molecular and biological works, respectively. My sincere thanks to all the members of the Keith's laboratory (Jennifer, Thilo, Carolina, Sharlene and Rewa) for their constant help and pleasant times spend together. I also want to thanks Gayle Thornbury for her assistance during cells sorting, Rob Kay and Patrick Medstram for interesting discussions. Finally I would like to dedicate this work to my mother, who, through good and hard times never stopped helping me and believing in me. I also want to thank my family and Fernand Bonenfant for help and support. Also special thanks to Sharlene Faulkes, who made my life more meaningful and supported me through the most difficult times of this work. xii CHAPTER 1 INTRODUCTION 1.1 Overview Among hematopoietic cells, the stem cells (HSC) are unique in their capacity to maintain lifelong blood cell production and to reconstitute the hematopoietic system. The existence and characteristics of such cells has made possible transplantation based treatment of several diseases and make them attractive targets for long lasting gene-therapy treatment of hematological hereditary disorders such as sickle-cell anemia. Moreover, HSCs are also a key target of genetic alterations that lead to serious hematological disorders ranging from bone marrow failure to hematopoietic malignancies. Thus, it is of major interest to understand the biological and molecular regulation of HSC properties such as self-renewal and multipotential differentiation. The elaborate mechanisms which control these cells are exerted through the coordinated action of external factors found in the bone marrow (BM) environment, such as growth factors (GF), coupled to regulatory networks within the hematopoietic cells themselves. Among the latter, transcription factors (TF), which control the repertoire of genes expressed in hematopoietic cells and ultimately their key properties, have emerged as major regulators. Direct support for TFs as important intrinsic regulators of hematopoiesis originates from their frequent involvement in leukemia, through chromosomal translocation, and marked hematopoietic abnormalities observed in mice bearing deletion of such genes. While a large majority of these factors have hematopoietic-restricted functions, increasing evidence points to several families of evolutionarily conserved TFs involved in morphogenesis, as potent regulators of 1 hematopoiesis. Among these, and representing the main focus of this thesis are the class I homeobox genes and their co-factors. The overall objective of this thesis was to gain further insight into the possible involvement of Hox genes in normal hematopoiesis and leukemia. To achieve this aim, three lines of investigation were pursued. First, I examined the expression of multiple Hox genes and their known co-factors in functionally distinct purified hematopoietic subpopulations at various stages of hematopoietic ontogeny to further resolve the spectrum of Hox gene expression and potential stages of hematopoietic development in which they might play a role. Second, following the discovery of a novel HOXB3 transcript in a progenitor-enriched subpopulation of human B M cells, I investigated the transcriptional regulation of this Hox gene to gain insight into the regulation of Hox gene expression in hematopoietic cells. Finally, the direct involvement of Hox genes in leukemogenesis was analyzed through the functional characterization of a chimeric Hox gene isolated from a patient with acute myeloid leukemia (AML). As a background to these studies, the following sections provide a brief overview of the known organization and regulation of the hematopoietic system. This is then followed by a detailed examination of the homeobox gene family of TFs and evidence linking them to the regulation of hematopoiesis that guided these studies. 2 1.2 Hematopoiesis Hematopoiesis is a complex process by which billions of mature blood cells are produced daily from a small pool of primitive cells known as the HSCs. Through differentiation, the HSCs produces a series of progenitor cells which in turn can differentiate into more committed progenitor cells that ultimately leads to the production of specialized cell types with specific functions but with a relatively short life span and therefore must be continuously replenished. 1.2.1 Hematopoietic stem cells Historically, C. E. Ford et al. were among the first to demonstrate that injection of B M could rescue animals who had received lethal doses of irradiation (Ford et al., 1956) and two years later the first B M transplant (in the U.S.A.) was performed in man. These studies provided the seminal evidence that cells existed in the B M that were capable of reconstituting the whole hematopoietic system and provided radioprotection and/or survival in animals against strong irradiation doses (Micklem and Loutit, 1966). Early direct evidence that these cells were in fact multipotent cells was provided by the findings of Wu et al. in 1968 (Wu et al., 1968) and Abramson et al. (Abramson et al., 1977), who used irradiation to introduce unique chromosomal markers and show the clonal derivation of both lymphoid and myeloid cells. More recently retroviral marking strategies have been used to document the multipotential differentiation and self-renewal potential of HSC (Keller et al., 1985). 3 Operationally, a HSC can be defined as a cell capable of contributing to the long-term maintenance and reconstitution of both the lymphoid and myeloid compartments. To achieve these functions, HSCs must possess two key properties: 1) the capacity through differentiation to produce any of the 8 major hematopoietic lineages and 2) through self-renewal to produce progeny with the same proliferative, differentiation and functional characteristics (reviewed in (Orkin, 2000)). The HSCs compromises less than 0.05 % of the whole marrow, making their study extremely difficult. Hence, the development of purification methods has been instrumental for the study of the biological and molecular properties of HSCs. The development of monoclonal antibodies and cell-separation technologies in the 80's made it possible to achieve high level enrichment of HSCs. In 1988, Spangrude et al. published a combination of positive and negative cell sorting that yielded a murine B M subpopulation phenotypically characterized as Sca-l + LinThy-l l 0 , which was 1000 fold enriched in HSCs, as evident by the reconstitution of 50% of lethally irradiated mice by only 30 cells (Spangrude et al., 1988). The lineage depletion (Lin) included the following antigens: B220 for B cells, CD4 and CD8 for T cells, Gr-1 for granulocytes and Mac-1 for macrophages/monocytes. To date the Sca-1 antigen or the stem cell antigen-1 remains the most efficient antigen used to positively sort for HSCs (Hodgson and Bradley, 1979). Additional antigens that have also been used include the AA4.1, c-kit, CD38 and CD34 (Jordan et al., 1990; Okada et al., 1991; Osawa et al., 1996; Zhao et al., 2000) cell surface molecules. Interestingly, expression of the CD34 antigen commonly used to purified human HSCs varies during murine development, such as HSCS are found in CD34 negative fraction in adult mouse (>10 weeks) (Matsuoka et al., 2001). Other purification 4 techniques rely on the use of specific dyes, such as Rhodamine 123 and Hoechst 33342, which are poorly retained by HSCs (Goodell et al , 1996). Using the Sca-1 antigen and lineage depletion strategy one can easily isolate B M subpopulations with different functional and phenotypic properties that can be utilized to explore the expression and function of genes involved in primitive stages of hematopoiesis. Another key advance in understanding HSCs has been the relatively recent development of assays that allow rigorous and quantitative detection of cells with long-term lympho-myeloid repopulation capacity. Two such assays in the murine model are the competitive repopulation assay (Harrison et al., 1988) and a limiting dilution assay for competitive repopulating cells (or CRU) (Szilvassy et al., 1990). In both assays, the major readout is the detection of long term contributions of cells derived from distinguishable test cells to both lymphopoiesis and myelopoiesis in myeloablated transplant recipient mice. The contributions of mixed starting sources of HSCs can be distinguished by the use of phenotypic (Ly5-1, Ly5-2), genomic (Y chromosome markers) or biochemical markers (protein isoforms). In the CRU assay, small numbers of normal B M (helper cells) cells sufficient to ensure survival of the recipient are transplanted along with varying numbers of test cells. Animals with >1% contribution from the test cells in both lymphoid and myeloid peripheral blood, or bone marrow cells are scored positive and from the proportions of negative animals at various doses and application of Poisson statistics the frequency of CRU can be determined. A variation of this can also be used to determine the frequency of a "leukemia-repopulating cell" (LRC) in a heterogeneous population. The readout is whether the irradiated recipients do or do not develop leukemia following 5 injection of leukemic B M cells; the dose of cells is varied to determine the frequency of the B M cells with foil leukemic potential. Analogous assays have also been recently developed for the detection of primitive human cells with long term lympho-myeloid repopulating ability in immunocompromised recipient mice (eg SCID or NOD/SCID strains) (Bosma et al., 1983; Lowry et al., 1996; Pflumio et al., 1996). Such assays extend previous efforts to detect primitive human cells based on their ability to support extended production of clonogenic progenitors in various in vitro culture systems (eg the long term culture-initiating cells assay, or LTC-IC assay (Dexter et al., 1977)). 1.2.2 Hematopoietic hierarchy Our current understanding of the organization of the hematopoietic system places the HSCs at the top of the "hematopoietic hierarchy" (see figure 1.1), with their ability to differentiate and give rise to two major multipotential progenitor classes: the common lymphoid progenitor (CLP) and the common myeloid progenitor (CMP) (Akashi et al., 2000). The CLP can differentiate into specific progenitors for B, T and natural killer (NK) cells whereas the CMP can differentiate into erythroid, eosinophil, basophil, granulocyte, macrophage, monocyte and megakaryocyte progenitors. Between the CLP/CMP and the specialized end-cells are a series of intermediate progenitors capable of producing one, two or more lineages and are known as uni-, bi- or multipotent progenitors, respectively. It is important to note that both the self-renewal and proliferation capacity decreases with differentiation. This hierarchical structure is shown by the ability to isolate purified 6 subpopulations of cells highly enriched for CLP or CMP but lacking in long term repopulating ability. A great deal of work has been done to elaborate in vitro and in vivo assays that can rigorously measure the frequency of the different progenitors found at distinct levels of hematopoietic maturation/differentiation, from the HSCs to the lineage-specific progenitors. The assays and the corresponding progenitors that they specifically monitor are shown in Fig. 1 . 1 . These assays have been invaluable tools to understand the cellular and molecular biology of hematopoiesis and are commonly used to comprehend the function and importance that GFs, TFs and other molecules have on the development and regulation of hematopoiesis. 9 ° •c .5 E2 c o B -g o g D, 60 V, 52 o a oo 3 = 03 « s ° Self-renewal, C R U assay Competitive repopulation o i Differentiation LTC-IC CLPO) 1 © © © 1 1 1 (C5) CMP CFU-S dayl2 CFC assay ( D O C S ) Lymphoid Myeloid Figure 1.1 Schematic representation of the hematopoietic hierarchy. HSCs can undergo self-renewal and/or differentiate into the 2 major hematopoietic lineages, the lymphoid and myeloid. Shown on the left is the stage of differentiation/maturation and on the right various assays used to measure the different populations of hematopoietic cells. HSC, hematopoietic stem cell; C R U , competitive 7 repopulation assay; LTC-IC, long term culture initiating cells assay; CFU-S dl2, colony-forming unit day 12; CFC, colony-forming cell assay. One of the first quantitative assays to detect primitive cells with stem cell properties was the spleen colony assay developed by Till and McCulloch (Till and McCulloch, 1961). This assay consists of injecting B M cells intravenously into myeloablated (lethally irradiated) histocompatible mice and 8-12 days later the spleen is isolated and macrocolonies on the surface are counted. These colonies, known as colony forming unit spleen or CFU-S, were shown to arise from clonal progenitors with both self-renewal and multilineage myeloid differentiation potential. Although subsequent studies have shown that the majority of the CFU-S occur later in the hierarchy than true long-term repopulating cells (Jones et al., 1989), the assay was pivotal to the development of many key concepts regarding the organization and regulation of early hematopoiesis. For example, characterization of CFU-S self-renewal highlighted the likely key role of intrinsic mechanisms controlling the probability of self-renewal versus differentiation decisions (Ogawa, 1993; Till et al., 1964). The more mature progenitors can be assayed using the colony-forming cell assay (CFC), which consists of semi-solid culture supplemented by various cytokines required for cell proliferation and differentiation. The cells detected in such assays are derived from clonogenic progenitors. Although these assays are most commonly used to monitor myeloid progenitors, a few are also available for lymphocyte lineages, such as pre-B progenitors (reviewed in (Eaves, 1995)). 8 1.2.3 Ontogeny of the murine hematopoietic system The hematopoietic system originates from the mesodermal cell layer in the developing embryo during gastrulation, and ventralizing factors (that favor mesoderm formation) such as BMP-4, have been shown to induce hematopoiesis in developing embryoid bodies derived from differentiating embryonic stem cells (ES) (Johansson and Wiles, 1995; Li et al., 2001; Orkin, 1995). The first sign of hematopoietic activity in mice is detected at day 7.5 of gestation in the extra-embryonic blood island of the yolk sac (Russell and Bernstein, 1966) (reviewed in (Palis and Yoder, 2001)). This first wave of hematopoiesis is also known as "primitive hematopoiesis" and is characterized mostly by the production of nucleated erythrocytes expressing embryonic globin genes such as £ e, and B-Hl (Shivdasani and Orkin, 1996). At this early stage in development, no HSC activity is yet detected. After much initial controversy, it is now generally accepted that the origin of definitive hematopoiesis (second wave, enucleated erythrocytes expressing P-globin) is intra-embryonic, originating from the dorsal aorta, gonads, and mesonephros (AGM) region (Medvinsky and Dzierzak, 1996; Muller et al., 1994). Muller and his colleagues elegantly demonstrated by a repopulation assay that the first verifiable HSCs in mouse are found by day 10 in the A G M region (Muller et al., 1994) (reviewed in (Marshall and Thrasher, 2001)). Subsequently, the fetal liver (FL), following the migration of hematopoietic cells and HSCs becomes the main site of hematopoiesis by day 14 post-coitus (dpc) and until birth. After birth, the bone marrow is the main site of hematopoiesis. Except for the bone marrow, the spleen and thymus are two other organs essential for normal hematopoiesis, being the maturation sites for the developing B and T lymphocyte cells, respectively. In humans, recent studies have also pointed to an early 9 intraembryonic source for hematopoietic cells with lympho-meyloid stem cell potential (Tavian et al., 2001). Interestingly, although HSCs derived from FL and adult B M share many functional and phenotypic characteristics, like long-term lympho-myeloid reconstitution capacity, they also possess some important differences. For example, FL (day 14.5) HSCs have increased repopulating capacity over that of B M HSC as well as greater proliferation capacity (Pawliuk et al., 1996; Rebel et al., 1996; Rebel et al., 1996). Moreover, phenotypic differences have also been reported such as the expression of the Mac-1 antigen by the FL HSC population but not by B M (Morrison et al., 1995). Whether these differences are intrinsic or rather result from the influence of the different microenvironments (FL vs BM) is unknown yet, but an analysis of gene expression may indicate common and putative differences in the expression of regulator genes. With this view in mind and the desire to elucidate Hox expression in other stages of hematopoiesis than B M , we isolated various fractions from murine hematopoietic FL at day 14.5, and used the ES differentiation model to mimic embryonic stages of hematopoiesis. 1.3 Regulation of hematopoiesis The hematopoietic system must be tightly regulated to assure normal development and health to the individual and any perturbations can lead to life-threatening conditions such as anemia or leukemia. Such regulatory systems must enable continuous blood cell production throughout life, be responsive to increased needs and also enable preservation/regeneration of HSCs. The molecules involved in such regulation can be 10 simplistically classified into two major categories based on whether they are present in the environment or on and in the cells. Examples of the former "external" or "extrinsic" regulators are the secreted GFs, the cellular matrix and other cells. Among the latter "internal" or "intrinsic" regulators are molecules such as cell cycle regulators, TFs and signal transduction-related molecules, to name a few. Although both classes of regulator categories are clearly important, the relative and unique roles of one versus the other are of great interest. For example, do the intracellular regulators only mediate the regulatory action of external regulators or are they also dictating or "priming" the cells for their response (differentiation/self-renewal/ apoptosis/quiescence), to external stimuli? Such questions are linked to two proposed models for hematopoiesis and HSCs differentiation/commitment/self-renewal- the instructive versus probabilistic models (Morrison et al., 1997). Historically the instructive model received much support from extensive cell biology research directed towards the identification and characterization of hematopoietic GFs and may be most relevant to later committed progenitor cells, such as erythroid progenitors which required erythropoietin (Epo) for their survival and complete differentiation. However, HSCs and multipotent progenitors were shown in vitro and in vivo to follow a pattern of behavior better described by a stochastic model (reviewed in (Morrison et al., 1997; Ogawa, 1993)). The exact molecular machinery and mechanisms governing self-renewal and differentiation of HSCs remains enigmatic. However progress has been made in identifying cytokines which govern the survival and/or proliferation of HSCs and multipotent progenitors. Indeed there has been considerable progress in defining 11 appropriate cocktails of GFs that favor self-renewal/expansion of primitive cells rather than differentiation thus supporting a more directive or instructive role to GFs than had previously been apparent (Ema et al., 2000; Miller and Eaves, 1997). Characterization of the downstream pathways involved in mediating their action will further our understanding on how such processes are controlled (Audet et al., 2001). Much success has also been made in characterizing "intrinsic" or "cell-autonomous" factors that display regulatory activities in differentiation, survival and self-renewal of HSCs and other progenitor cells. In the next section I will review some of these points in more detail with emphasis on the emerging role of transcription factors. 1.3.1 Regulation of hematopoietic cells by extracellular factors 1.3.1.1 Extracellular matrix and ligands The microenvironment of the bone marrow is a complex one where numerous contacts are established between the hematopoietic cells and the stromal environment. The stroma is composed of many different cell types such as adipocytes, endothelial cells, fibroblasts and reticular cells that produce and secrete a vast number of different molecules (e.g. collagens, glycoproteins (such as fibronectin), and glycosaminoglycan) that make up the extracellular matrix. The HSCs have been shown to reside in the adherent part of this microenvironment (Coulombel et al., 1983). Direct interaction via cell surface receptors and ligands on the stromal and HSC cells have been shown to be essential for proper "homing" of the HSCs (Hirsch et al., 1996), as well as in the regulation of HSCs and 12 progenitor self-renewal and differentiation (Arroyo et al., 1999; Dexter et al., 1977; Simmons et al., 1992). 1.3.1.2 Growth factors The large number of hematopoietic GFs recognized (n>25) can be subdivided into 3 major categories based on their specificity of action: 1) late-acting lineage-specific factors such as Epo.; 2) the intermediate-acting lineage non-specific factors, that support the proliferation of multipotent progenitors, such as interleukin-3 (e.g. IL-3); 3) finally those affecting HSCs and multipotent progenitor proliferation and survival such as steel factor (SF), IL-6 and Flt-3 ligand (reviewed by (Metcalf, 1993; Metcalf, 1998; Ogawa, 1993)). The role of GFs in the regulation of HSC survival and proliferation is well documented (Fortunel et al., 2000; Kaushansky, 1998; Miller and Eaves, 1997)]. However, their participation in HSC fate, of either self-renewal or differentiation is still unclear (Fairbairn et al., 1993; Mayani et al., 1993) although there is evidence that some GFs may be involved (Ema et al., 2000; Metcalf, 1991). Possibly, the functions of GFs is to establish the adequate condition in the B M microenvironment required for HSCs survival and functions (Lansdorp, 1997). The plethora of GFs with often overlapping target cells and activities raises interesting questions regarding their unique versus potentially redundant functions, an issue Dr. Metcalf has introduced as redundancy or subtlety (Metcalf, 1993). Interestingly, this same issue now arises in the context of TFs often belonging to the same family as will be discussed in later sections in the context of homeobox genes. 13 The involvement of GFs in the establishment of the hematopoietic system during embryogenesis is also unclear, since knockout mouse models of single or even some compound knockout of GFs receptors often showed minimal or lineage specific impairment of hematopoietic functions (Broudy, 1997; Nishinakamura et al., 1996; Nishinakamura et al., 1995). Despite this, it is possible that other GFs are actively involved in early stages of ontogeny. Interestingly, recently recognized candidate genes are GFs involved in early embryo development such as bone morphogenetic proteins (BMP) and Wnt (Austin et al., 1997; Carlesso et al., 1999; Orkin, 1995). 1.3.2 Intrinsic Regulators As mentioned previously, numerous classes of molecules present within hematopoietic cells themselves are recognized as playing key regulatory roles in cell survival, division and differentiation. These include molecules expressed on the surface of hematopoietic cells, such as receptors for GFs and other ligands, which link the cell to its environment. The functions of such receptors vary depending on their nature but in general they mediate cell interactions and import the information provided by the environment into the cells. Cell surface receptors can be divided into two major categories; the first is composed of receptors with intrinsic tyrosine or serine/threonine kinase activity, such as c-kit, and the second class, such as the Epo receptor, which lack intrinsic kinase activity. Ligand-binding activation of both types of receptor usually leads to a cascade of protein phosphorylation inside the cell, a process known as signal transduction. This is a mode of communication used by cells to relay the informative signal into the cells. Following 14 phosphorylation and upon dimerization, molecules such as members of the Smad and STAT families, are translocated from the cytoplasm into the nucleus, where they can act as TFs. Other receptors (steroid) can directly move from the extracellular membrane into the nucleus and act as TFs following ligand-mediated activation. The TF(s) that are activated then regulate the expression of various genes including that of GF receptors. Other important intracellular molecules which have also been implicated in the regulation of HSCs include: cell cycle regulators (p21 (Cheng T, 2000)), regulators of apoptosis (Bcl-2 (Domen J, 2000)), ABC transporters (MDR-1 (Bunting et al, 2000)) and an increasing host of TFs. 1.3.2.1 Transcription factors Cell-specific gene expression programs are achieved in part by the ability of cells to specifically turn genes on and off through the coordinate action of TFs. TFs can be classified into 3 major groups, the general TF, the chromatin regulating TF and the "specific TF". The first group is composed of proteins ubiquitously expressed, such as the TFIIA, TFIIE and TATA binding protein that are major components of the pre-initiation complex of transcription whose principal function is to recruit the RNA DNA-dependent polymerase II (POL II), to gene promoters and initiate transcription (reviewed in (Orphanides et al., 1996)). The second class is composed of a variety of proteins that have in common a function in the regulation of the chromatin state, as to whether it is in a transcriptionally active or 15 inactive form (reviewed in (Bjorklund et al., 1999)). These include the histone acetyltransferases (e.g. CBP and p300), histone deacetylase (e.g. HDAC1) and the chromatin-remodeling complexes (e.g. SW1/SNF, Polycomb and Trithorax gene families) (Kornberg, 1999). In brief, lysine acetylation of the histones is associated with transcriptionally competent chromatin whereas hypoacetylated histone is usually associated with transcriptionally inactive chromatin, due to more compact nucleosomes on the DNA blocking access to other TFs (reviewed in (Struhl, 1998). More recently, reports have emerged establishing an unexpected link between such molecules and "specific TF", suggesting that they could also be involved in the regulation of gene-specific target (Li et al., 2000). This was demonstrated for HOXB7 which was shown to directly interact with CBP in vitro and in vivo leading to an increase in HOXB7 transactivation potential (Chariot et al., 1999). The final class, the "specific TF", is composed of a large variety of proteins which usually have a DNA-binding motif that regulates their activity to a limited set of gene-targets. The latter class can be sub-divided into families based on their DNA-binding motifs. The most important families include the basic helix-loop-helix (bHLH) (e.g. Myc, Myb, SCL) the basic leucine-zipper (e.g. Jun, Fos), the zinc-finger (e.g. GATA-1, Krox20), the basic helix-turn-helix (e.g. ETS family (ETS-1, Pu.l), homeobox gene) (Ernst and Smale, 1995; Shivdasani and Orkin, 1996) etc. 16 1.3.2.2 Transcription factors in the regulation and development of hematopoiesis Numerous genes involved in the regulation of hematopoiesis were first identified in leukemic cells following the molecular characterization of recurrent chromosomal translocations and more specifically of the resulting fusion sites. The results are either aberrant expression of a gene when juxtaposed next to a strong transcriptionally active element (such as T or B cell receptors), the formation of chimeric gene with novel activity, or a combination of both (Look, 1997). A classic example of the former is the t(8;14), which leads to aberrant expression of c-myc due to its translocation near the transcriptionally active immunoglobulin gene in B lymphocytes (Rubnitz and Look, 1998), and of the latter, the t(9;22) involving bcr-abl (de Groot et al., 1999). Interestingly, many of the translocations now characterized have been shown to involve TFs. A striking example is AML1, which is the TF found most frequently rearranged in de novo cases of A M L , mainly through t(8;21) and inv(16), leading to the formation of AML1-ETO and AML1-MYH11 respectively (reviewed in (Tenen et al., 1997)). Following its cloning, the function and importance of the AML1 gene in hematopoiesis was directly tested in vivo by gene-targeting technology. Although the AML1 null-mice had normal yolk sac-derived erythropoiesis, they were totally unable to establish definitive hematopoiesis. The block was shown to be intrinsic to AML1 deficient cells, since they failed to contribute to hematopoiesis in chimeric mice and AML1 -/- ES cells failed to produce any myeloid or erythroid progenitors of definitive hematopoietic origin (Okuda et al., 1996). AML1 fusion genes may have in part dominant negative AML1 activity since transgenic mice expressing AML1-ETO have a block in definitive hematopoiesis (Okuda et al., 1998). More recently, using an inducible transgenic mouse model, 17 Rhoades et al. demonstrated that expression of this AML1 fusion gene in B M did not directly lead to leukemia, suggesting that additional mutations are required (Rhoades et al., 2000). Similar to AML1, the SCL and LM02 genes were first characterized in leukemic cells and both are absolutely required for the establishment of definitive hematopoiesis. However unlike AML1 deficient mice, primitive hematopoiesis was also impaired completely in LM02 and SCL null-mice (Shivdasani RA, 1995; Yamada et al., 1998). Interestingly, and somewhat expectedly given the similarities in these two knockout mice, the two proteins were shown to physically interact together (Wadman et al., 1994). More recently, LM02 and SCL proteins and GATA-1 were shown to synergistically act together and induce mesoderm differentiation in Xenopus transgenic embryos (expanding blood island) (Mead et al., 2001), thus further implicating these TFs as important regulators of hematopoietic development. Identification of putative targets for these genes may provide important clues to the molecular mechanisms involved in the establishment of hematopoiesis. The spectrum of regulation of TFs on hematopoiesis is not restricted to HSC establishment and/or regulation. Other factors act at later stages of hematopoiesis differentiation, such as GATA-2 and Pu.l. The loss of GATA-2 function in mice led to numerous hematopoietic defects including severe anemia (Tsai et al., 1994) and deficient lymphopoiesis (Shivdasani and Orkin, 1996). Moreover it also resulted in a marked reduction in all hematopoietic precursors, indicating that GATA-2 plays an important role in the maintenance and proliferation of early and committed progenitor cells (Tsai et al., 1994; Weiss and Orkin, 1995). Pu.l, a member of the ETS family is expressed in 18 monocytes/macrophages, B cells, erythroblast and granulocytes. As expected from the pattern of Pu.l expression, null-mice lacked mature B cells, macrophages and neutrophils, but had normal erythrocytes and megakaryocytes (McKercher et al., 1996). In addition Pu.l was implicated in the regulation of HSC homing and/or migration, since it was shown that Pul -/- FL HSCs failed to repopulate irradiated recipients and showed lower or no expression of some integrins (Fisher et al., 1999). Altogether, these results indicate complex roles for GATA-2 and Pu.l in the regulation of hematopoiesis, which is not restricted to one unique lineage. Figure 1.2 Schematic representation of transcription factors implicated in the regulation of I 1 Adapted from (Orkin, \<^^/ 1995). I Finally, some TFs are restricted to the regulation of one particular lineage. These include GATA-1 which was identified and isolated from nuclear erythroid extracts, based on its capacity to specifically bind numerous erythroid regulatory elements such as the globin locus control region (Evans and Felsenfeld, 1989; Goodwin et al., 2001; Tsai et al., 1989). Although GATA-1 is also expressed in megakaryocytes, eyrthroids, eosinophils, hematopoiesis. A non-exhaustive list of transcription factors shown to be required for the establishment of hematopoiesis, maintenance and/or expansion of HSCs and multipotent progenitors, lymphoid and myeloid development, and erythroid differentiation. 19 mast cells and multipotent progenitors (Martin et al., 1990; Tsai et al., 1994), the major defect in mice homozygous for GATA-1 null-mutation is the complete lack of erythrocytes leading to in utero death (Tsai et al., 1994). Subsequently using GATA-1 -/-ES cells, GATA-1 was shown to be required for the survival and terminal differentiation of erythroblast cells (Weiss et al., 1994). The list of known TFs implicated in hematopoiesis is quite extensive but likely still incomplete. Shown in Fig. 1.2, are some of the different TFs and their position in the hematopoietic hierarchy at which they show the highest degree of effects and/or regulation. During embryogenesis, limbs, brain and other body parts are formed as a result of massive cell proliferation, migration and differentiation of one fertilized egg. Similar to embryogenesis, hematopoiesis is also a developments process where HSCs are the primitive cells giving rise to several types of progenitors and ultimately to specialized end cells. The regulation of these distinct processes may not be as divergent as previously envisaged, especially with the recent evidence that the Notch, Wnt and Hox gene families, all implicated during embryogenesis, are also candidate regulators of hematopoiesis. A brief introduction to Hox genes and their involvement in both normal hematopoiesis and leukemia will be the subject of the next sections. 1.4 The Hox genes The homeobox genes were first described by E. B. Lewis (Lewis, 1978) when he identified a gene complex genetically-linked to the development of the thorax and abdomen in the fruit fly Drosophila melanogaster, which he called the bithorax complex. 20 Eventually a second cluster responsible for the anterior body half portion was identified, the Antennapedia (Kaufman et al., 1990), also found on chromosome 3. The discovery of the homeobox genes was principally due to the strong phenotypes observed when these were mutated in the fly. For example, the Antennapedia mutant fly has an extra pair of legs on its head instead of antennas resulting from the mis-expression of the Antennapedia gene in the forming insect's head. Such mutations are referred to as "homeotic mutations", with the Greek word homeo meaning "alike", thus a homeotic mutation leads to the transformation of one body part into another one. In addition, common to all Hox genes was a well conserved sequence of 180 bp dubbed the homeobox, latter found to encode a helix-turn-helix DNA binding domain, the homeodomain. Altogether, eight Drosophila clustered Hox genes were identified and are referred to as the HOM-C genes (Fig. 1.3) (Kaufman et al., 1990; Lewis, 1978). Using the Drosophila HOM-C genes as probes, 39 mammalian clustered Hox genes were eventually identified (Krumlauf, 1994; McGinnis and Kuziora, 1994; Stelnicki et al., 1998). The latter shared a very high degree of conservation with the HOM-C genes, especially in the homeobox sequence (reviewed in (Krumlauf, 1994). In the next section, I will present the Hox genes and their co-factors, their principal characteristics, functions, and most importantly the accumulating evidence for Hox genes playing roles in regulation of hematopoiesis and leukemia. 21 1.4.1 The mammalian homeobox genes 1.4.1.1 Definition and classification Homeobox-containing genes are classified into two major categories. The class I Hox genes include the 39 mammalian clustered Hox genes, for which loss-of-function in mice usually results in homeotic mutations (Krumlauf, 1994) and these share a very high degree of conservation with the Drosophila HOM-C genes in their homeobox. The Hox genes are found in 4 clusters (A-D) on 4 different chromosomes and are subdivided into 13 groups, the so-called paralogous groups (Fig. 1.3), based on high sequence homology within the homeobox and their respective order in the Hox gene cluster (Acampora et al., 1989; Krumlauf, 1994). The name given to a Hox gene, such as Hoxbl, gives the information on the cluster (letter) and paralogous group (number) to which it belongs. Moreover, to identify the origin of the Hox gene, capital letters are used for human Hox gene (e.g.HOXBl) and small caps for murine (Hoxbl). The class I genes will be referred to as Hox genes in this thesis. The discovery of Hox genes as "master regulators of body plan design" is principally due to two aspects of these genes. First are the homeotic mutations observed following null-mutation or aberrant expression in the developing insect or mammalian embryo. A second guiding observation is the sequential activation of Hox expression/function in a defined spatial and temporal order which corresponds to their position in the cluster (Fig 1.3). 22 drosophila Bithorax Antennapedia HOM-C Abd-B Abd-A Ubx Antp Scr Dfd pb lab 1 mammalian 1 3 12 n 1 1 1 1 10 9 8 7 6 5 4 3 2 1 Paralogous Group Posterior Late activation Retinoic acid activation 3' Anterior Early activation Trunk Caudal Sacral Lumbar Thoracic Cervical Vertebrae Limb Figure 1.3 Genomic organisation of the Drosophila HOM-C and mammalian Hox genes. The Drosophila antennapedia and bithorax homeotic gene complexes are shown on top of the 4 mammalian Hox gene clusters A, B, C and D. The vertebrate Hox genes are subdivided in 13 groups, the paralogous groups, based on sequence identity and order in the cluster. The mammalian and Drosophila complexes can be vertically aligned based on sequence homology within the homeobox and functional homology. No vertebrate homologues have been found for Antennapedia (Antp), ultrabithorax (Ubx) and abdominal-B (Abd-B) genes. Also shown under the clusters are the anterior-posterior colinear expression of Hox genes during embryogenesis and the colinear activation of Hox genes to retinoic acid. Abd-A, abdominal A; Scr, sex combs reduced; Dfd, deformed; Pb, proboscipedia; Lab, labial. 23 The second major category of homeobox genes are the so-called class II homeobox genes. These comprise divergent gene families that do not necessarily demonstrate "homeotic mutation" following gene deletion, possess a more divergent homeodomain and are distributed throughout the mammalian genome. Genes found in the second class include the Pbx genes (Kamps et al., 1990; Monica et al., 1991); the Meis genes (Nakamura et al., 1996); the orphan HOXll/Tlx gene (Dube et al., 1991); the Pax genes involved in the formation of multiple organs during embryogenesis (Mansouri et al., 1999); the En family (En-1, En-2), which are closely related to the Drosophila engrailed gene, which are involved in the specification of the central nervous system (Joyner and Martin, 1987), to name a few. The Pbx and Meis gene families will be discussed in detail later, as they represent the most important known co-factors of Hox genes. 1.4.1.2 Chromosomal organization An intriguing aspect of the mammalian Hox and the Drosophila HOM-C genes is their genomic organization. In both species, the Hox genes are found in clusters and the vertebrate Hox genes can be aligned with the Drosophila HOM-C genes based on sequence homology of the homeobox and functional relationship (Fig. 1.3). A dramatic example of this is the recapitulation of sex comb reduced induced mutation by the murine Hoxa5 gene in Drosophila upon constitutive expression (Zhao et al., 1993). The 39 vertebrate Hox genes are found in 4 genetically unlinked clusters each of approximately 100-125 kb in length. The origin of the vertebrate Hox gene clusters is believed to be the result of two rounds of duplication of an ancestral cluster followed by 24 gene loss, since none of the clusters have the same and/or all the paralogue group members (Kappen et al., 1989; Schughart et al., 1989). The conservation through evolution of the Hox gene clustering from vertebrates to simple organisms such as Caenorhabditis elegans, which has 4 Hox genes (Wang et al., 1993), suggest that close physical association of the Hox genes is an important requirement for their function (Duboule, 1998). 1.4.1.3 Transcriptional regulation of Hox genes during embryogenesis Early in situ hybridization studies of developing embryos and subsequently gene targeting investigation revealed a fascinating characteristic of Hox and HOM-C genes: their time and domain of expression/function within the developing embryo correspond to the order of the Hox genes in the cluster (see Fig. 1.3) (Dolle et al., 1989; Duboule and Dolle, 1989; Graham et al., 1989). In vertebrates, this remarkable correlation is observed in the developing skeletal-axis, limbs and hindbrain and is refereed to as the "spatial" and "temporal" colinearity of expression (reviewed in (Krumlauf, 1994)). The outcome is a wave of Hox gene expression with 3' located Hox genes, such as paralogue group 1, expressed anteriorly and earlier than 5' genes such as group 5. Colinear Hox expression is achieved by the complex contribution of both cis (enhancers and promoters) and trans-acting (trans-regulators) regulatory elements. These include the action of i) retinoic acid, which induces Hox gene expression in a colinear 3' —> 5' fashion, with 3' genes more strongly induced (Krumlauf, 1994); ii) the auto and cross-regulation of Hox genes 25 (Krumlauf, 1993; Maconochie et al., 1997); and iii) the use of multiple enhancers and promoters (Duboule, 1998; Simeone et al., 1990). 1.4.1.3.1 Cis-regulatory elements The recent completion of the human genome revealed that the four Hox gene clusters are unique loci based on the recognition that they contained less than 2% of interspersed repeats (Lander et al., 2001). The latter strongly supports the well-accepted notion that clustering of Hox genes is an essential feature for normal Hox gene function. This possibly indicates that large-scale cis-regulatory sequences are to be found throughout all four Hox gene clusters. Prior to the human genome project, the use of transgenic mice with reporter genes such as lacZ and in situ hybridization techniques was instrumental for the identification of Hox gene enhancers/promoters and has revealed a complex network of cis-acting regulatory elements dispersed throughout the Hox clusters (Duboule, 1998; Patel et al., 1999; van der Hoeven et al., 1996). Interestingly, enhancers have been identified as critical elements in the regulation of Hox genes throughout embryogenesis (Duboule, 1998). Such enhancers have been localized within introns, upstream and downstream of the Hox genes and in many instances may be shared between Hox genes (Gerard et al., 1996; Gould et al., 1997). Some of these enhancers have been shown to be tissue specific while others appear to be used in multiple tissues (Whiting et al., 1991). Likewise, several Hox genes have been described with multiple promoters (Patel et al., 1999; Sham et al., 1992) and 26 sometime share a common promoter, such as HOXC4, C5 and C6 in embryonic tissue (Simeone et al., 1988). Interestingly, some of the regulatory sequences found for members of a paralogous group have been conserved through evolution. This is well illustrated by the conservation of DNA sequence and location of mesodermal and neural enhancers mediating proper anterior limits of expression in the hindbrain for Hox genes from paralog group 4 (Morrison et al., 1997). Although some Hox genes appear to have sufficient cis-regulatory sequences in close proximity to their loci, as judged by correct expression in transgenic mice (Becker et al., 1996; Sham et al., 1992; Whiting et al., 1991), long range shared regulatory sequences have also been implicated in Hox gene regulation. This was shown for the spatial and temporal expression of Hox D genes, which is dependent on the progressive derepression of the D cluster from a "master" repressive element located upstream (5'end) of the complex (Kmita et al., 2000; Kondo and Duboule, 1999; van der Hoeven et al., 1996). Thus, the transcriptional control of Hox genes is complex and mediated by numerous regulatory sequences. 1.4.1.3.2 Trans-regulators of Hox genes In the developing fruit fly embryo, the first step towards HOM-C activation is the establishment of gradients of the maternal-genes such as bicoid and oskar (bicoid is strong in the anterior and oskar in the posterior). This leads to the activation of the zygotic segmentation genes such as the pair-rule genes (eg. fushi tarazu, even-skipped), the gap-genes (eg. krueppel, hunchback) and the segment polarity genes (eg. 27 decapentaplegic {dpp), wingless and hedgehog) in the forming parasegments (n=14) which will eventually form the head, thorax and abdomen. The concentration of the different segmentation genes is responsible for the activation of numerous cascades of events, including the activation of the HOM-C genes (reviewed in (Lawrence and Morata, 1994)). Contrary to Drosophila, the human embryo does not show an overall parasegment like structure during early development, except for the forming hindbrain which can be subdivided into 8 segments known as rhombomeres (r) (Lumsden and Keynes, 1989). A few mammalian homologues for segmentation genes have been identified, such as the bone morphogenetic proteins (BMP) which are members of the TGF-f3 family for dpp (Hogan, 1996), the EVX genes for even-skipped (D'Esposito et al., 1991; Faiella et al , 1991), sonic hedgehog for hedgehog (Roberts et al., 1995), En family for engrailed (Joyner and Martin, 1987) and the Wnt gene family for wingless (Austin et al., 1997). Although a direct link between Hox gene regulation has not been established for all, some have been shown to be direct regulators of Hox genes, such as Sonic hedgehog and Bmp-4 which have been implicated in the regulation of Hox genes in early limb development (Roberts et al., 1995). Interestingly, several members of the Wnt gene family are expressed in hematopoietic cells, but a direct link with the up-regulation of Hox genes has not yet been established (Van Den Berg et al., 1998). The transcriptional regulation of Hox genes in mammals during embryogenesis has been most extensively studied in the developing hindbrain where a few direct upstream regulators have been identified. These include krox-20, which positively regulates Hoxb2 28 expression in r3-r5 (Sham et al., 1993) and Kreisler (Maf), which binds to Hoxa3 and Hoxb3 enhancers and directs their expression in r5 and r6 (Manzanares et al., 1999). As previously mentioned, retinoic acid, which acts through the retinoic acid response elements found in numerous Hox gene cis-regulatory elements, is a potent inducer of Hox gene transcription in developing embryos and in embryonal carcinoma cell lines (Arcioni et al., 1992; Krumlauf, 1994; Simeone et al., 1990). Finally, one important class of Hox gene regulators identified so far is the Hox genes themselves, which can regulate their own expression and that of others (Krumlauf, 1994; Manzanares et al., 2001). For example, Hoxbl positively regulates its expression in r4 by binding to its promoter as a trimer with the T A L E genes Pbxl and Prepl (Ferretti et al., 1999). Moreover, Hoxbl (with Pbxl) was also shown to positively regulate Hoxbl in the same rhombomere segment (Maconochie et al., 1997). Such cross-regulation is not restricted to Hox genes from the same cluster, as it was shown that HOXC5 can be transactivated by HOXC6, HOXD9 and HOXD10 (Arcioni et al., 1992). It is also not restricted to activation since Hoxd8 was shown to repress the transcription of HOXD9. Prior to the apparent nested pattern of Hox gene expression in developing tissues, there is upregulation of Hox gene expression in the somites. It now appears that Hox genes are upregulated in the presomitic mesoderm (forming somites) by upstream molecules which have oscillating levels of expression in the developing somites and are encoded by so-called "segmentation clock genes" (Tabin and Johnson, 2001). Two recent studies have shed some light on how this may be orchestrated. One model implicates Notch pathways since the burst of Hox gene expression parallels that of Notch signaling molecules and RJSPjk mutant mice (mutant for a downstream effector of Notch signaling pathways) fail 29 to appropriately activate some Hox genes in the developing somites (Zakany et al., 2001). The second study demonstrated a link between fibroblast growth factor 8 (FGF8) and the upregulation of several Hox genes in the presomitic mesoderm (Dubrulle et al., 2001). Thus it would be of interest to determine whether Notch and FGF related genes are also responsible for the regulation of Hox genes in hematopoietic cells. 30 1.4.1.4 Hox protein structure and Hox co-factors Pentapeptide motif paraiogue 1-8 ANWL motif paraiogue 9-10 v mediates HOX-PBX Figure 1.4 Schematic representation of a Hox protein. The various conserved motifs and regions regulating and/or mediating Hox gene functions are depicted along with their proposed functions. No pentapeptide or A N W L motifs are found for Hox proteins from paralogous group 11-13. Hox protein from paralogous group 1-8 can interact with Pbxl, group 11-13 with Meisl and group 9-10 with both. A representation of a homeodomain and its recognition helix (III) making direct contact with the major groove of the DNA is also shown (adapted from (Gehring et al., 1994)). T A D , transcriptional activation domain. Fig. 1.4 illustrates the typical structure of a Hox protein. The two most conserved motifs or sequences are the homeodomain, which is 60 a.a. long, and the pentapetide (IYPWM) motif (also know as the Pbx interaction motif), present in Hox proteins from paraiogue group 1-8. A distinct motif (ANWL) with the same function is also found for paraiogue group 9-10 whereas paraiogue groups 11-13 lack such motif. The function of the 31 pentapeptide is to mediate interaction between the Hox and the Pbx proteins (Chang et al., 1995; Mann and Chan, 1996; Popped et al., 1995). The three dimensional structure of the homeodomain bound to DNA was resolved by both x-ray crystallography and NMR spectroscopy studies (reviewed in (Gehring et al., 1994)). It is composed of four cx-helices (I-IV) of which the helices II and III, separated by a loop, form the conserved DNA binding motif helix-turn-helix. The most important residues that make direct contact with the DNA in its major groove are found in helix III, of which residues 50 and 51 are known to be crucial for DNA sequence recognition. Substitution of amino acid (a.a.) 50 has been shown to change the DNA target specificity of one Hox gene to another (Hanes and Brent, 1991), whereas substitution of asparagine-51 to a serine abolishes DNA binding (Shanmugam et al., 1999). The DNA binding specificity of the Hox protein as a monomer is relatively simple as it was shown that most Hox proteins recognize the four basepair (bp) consensus nucleotide sequence TNNT in vitro, although the specificity and affinities varies slightly among the different paralogous groups (Laughon, 1991). Hox genes have both redundant and gene-specific functions in vivo. Redundancy among Hox genes may be interpreted as a result of overlapping domains of expression and recognition of almost identical DNA sequences. The question then is how do Hox proteins achieve gene-specific functions? Target specificity (ie gene regulated by Hox proteins) may be achieved through two levels of regulation. First, one can assume that subtle differences in DNA binding affinities and specificity among Hox proteins observed in vitro may have strong influences in vivo. Second, Hox proteins gain a great deal of sequence specificity through the association with co-factors, which interestingly have been found also to be other homeobox containing proteins belonging to the non-clustered 32 families. Since the latter shares a three a.a. loop extension in their homeodomain, they are referred to as T A L E genes. The class II homeobox Pbxl gene, the orthologue of extradenticle (exd) in Drosophila, was isolated in pre-B lymphoblastic leukemic cells bearing the chromosomal translocation t(l;19) (Kamps et al., 1990). Subsequently two other members of the Pbx family, Pbxl and Pbx3, were characterized and found to be highly homologous relative to Pbxl and exd (Monica et al., 1991). Most recently, a novel member, Pbx4, was isolated in mouse and its expression found restricted to the testis (Wagner et al., 2001). As found in Drosophila, the Pbx genes have since been shown to be important co-factors for Hox gene functions (for paralogous groups 1-10) by increasing their DNA binding affinity and specificity, through the formation of heterodimers (Chang et al., 1996; Chang et al., 1995). The interaction between Pbxl and Hox proteins is mediated by the Hox cooperation motif (HCM) of Pbxl, which is composed of Pbxl's homeodomain and 24 adjacent a.a. at the carboxyl side (COOH) of the homeobox (Chang et al., 1997; Lufkin, 1997; Mann, 1995). Meisl, a founding member of a second family of Hox co-factors, was identified in the BXH-2 recombinant inbred mouse based on its capacity to induce myeloid leukemia with Hoxa7 and Hoxa9 (Nakamura et al., 1996). Subsequently two other un-linked members of the Meis family, Meisl and Meis3, were also isolated (Nakamura et al., 1996). Meis proteins can interact and form heterodimers on DNA with AbdB-like Hox proteins from paralogue groups 9 to 13, and such interaction is mediated by the region carboxyl terminal to the Meis homeodomain and NH2 end of Hox proteins (Shen et al., 1997). In 33 addition, expression of Meis proteins and Prepl, a divergent Meisl-related gene, leads to the nuclear translocation of cytoplasmic Pbx proteins (Mercader et al., 1999). The first working model for Hox protein interactions was that Hox proteins from group 1-10 would gain DNA binding specificity with Pbx members, whereas Hox proteins from groups 10 to 13 would do the same with the Meis proteins. The DNA sequence recognized then includes the juxtaposition of the Pbx or Meis recognition sequence, 5'-TGAT-3' and 5'-TGACAG-3' respectively, to that of Hox proteins (Chan et al., 1994; Shen et al., 1997). In this way the complexity of the recognized DNA sequences is increased, which in turn increases the specificity of Hox proteins. However, the proposed model of Hox-Pbx and Hox-Meis dimers was soon challenged when gel shift assays demonstrated that Hox, Pbx and Meis proteins could in fact form stable DNA bound heterotrimers, thus pointing to trimer formation as a possible mode of action for Hox proteins (Shanmugam et al., 1999; Shen et al., 1999). In addition, Pbxl and Meisl proteins have also been shown to physically interact together without Hox proteins, forming heterodimers with DNA binding capacity in the erythroid cell line K562 (Chang et al , 1997). The interaction between Pbxl and Meisl is mediated through different portions of Pbxl and Meisl than those regulating interaction with Hox proteins; the first 89 a.a. of Pbxl, and through the amino terminus end of Meisl (Shen et al., 1997). Thus in the most recent proposed model, Hox proteins bind to their recognized DNA sequence through heterotrimers; where the Hox protein with either Pbx or Meis protein directly bind to the DNA, and the third partner (Pbx if Meis bind with Hox, or vice-versa) does not make contact with the DNA but with the two other proteins (Shanmugam et al., 1999). 34 Unlike Hox proteins, both Meis and Pbx proteins lack transcriptional activation domains (TAD) which instead is provided by the Hox proteins and is usually found in the N H 2 side of the Hox homeodomain (Chariot et al., 1999; Schnabel et al., 2000; Vigano et al., 1998) (Fig. 1.4). However, in some cases, depending on the interaction or not with Pbxl, the T A D position in the Hox protein may vary. For example, HOXB3 alone draws its transcriptional activity from both the N H 2 and COOH terminal end, but in a complex with Pbxl, only the COOH end is active (Vigano et al., 1998). Most Hox proteins have been shown to positively regulate DNA targets, but repression activity has also been reported (Schnabel and Abate-Shen, 1996; Shi et al., 2001). The exact mechanisms by which Hox genes regulate transcription is not well understood and direct interaction between Hox proteins and members of the general transcription machinery have not yet been described. Their mode of action may be more subtle, such as interaction with chromatin remodeling molecules, thereby enhancing transcription by creating a better environment to enhance access of other TFs to the regulatory elements of genes. Such a scenario is supported by the work of Chariot et al. who showed a direct interaction between the N H 2 side of HOXB7 and HOXD4, and the histone acetyltransferase protein CBP/p300 (Chariot et al., 1999; Salehetal., 2000). 35 1.4.1.5 Functions in mammals 1.4.1.5.1 Function in embryogenesis Supported by numerous genetic studies using knockout and transgenic technologies, the first function assigned to Hox genes is "cell-fate specification along the anterior-posterior (A-P) axis" of various structures including the vertebral column (Rancourt et al., 1995), hindbrain (Lufkin et al., 1991) and limbs (Davis et al., 1995) (reviewed in (Krumlauf, 1994)). In general, the loss of one Hox gene will cause homeotic mutations in the region near the Hox gene's anterior expression boundaries. This is known as the "posterior prevalence rule" (St-Jacques and McMahon, 1996). Moreover, the lack of and/or mild homeotic mutations in some knockout mice is due to both the overlapping expression profile of paralogous genes and their redundant functions (Greer et al., 2000; Krumlauf, 1994). This was elegantly demonstrated by the use of paralogous gene compound knockouts, and with neighboring gene compound knockouts. For example, single mutants for Hoxall or Hoxdll exhibit mild homeotic transformation of the radius and ulna, whereas the combination of both mutations leads to increased homeotic transformation in the radius and ulna in a dose dependent manner, with the complete loss of both bones in the double knockout mice (Davis et al., 1995). This compound mutant also showed severe kidney defects not seen in either single mutant. This example and others demonstrate that Hox genes have some degree of functional redundancy but not entirely and also brought forward the hypothesis that Hox gene dosage maybe an important parameter for their functions (Condie and Capecchi, 1994; Rancourt et al., 1995). 36 1.4.1.5.2 Hox gene expression in adult tissues The discovery of Hox gene expression in normal and often malignant adult tissues has since implicated this large gene family in the regulation of non-embryonic tissues. These include reports of Hox expression in somatic and germ cells in testis (Watrin and Wolgemuth, 1993), normal and malignant colon (Barba et al., 1993), kidney (De Vita et al., 1993), skin (Care et al., 1996) and lung cells (Calvo et al., 2000). Moreover, Hox genes have also been shown to play a significant regulatory role in endothelial cells (Boudreau et al., 1997), wounds healing (Uyeno et al., 2001), osteoblasts (Shi et al., 2001), hematopoietic cells (Lawrence et al., 1996) and in mammary gland development (Chen and Capecchi, 1999). Hence, Hox genes are not only required for normal embryogenesis, but appear to be involved in the regulation of multiple adult tissues. Furthermore, the frequent observations of aberrant Hox gene expression in malignant cells suggest that they may be involved in the neoplastic transformation of these tissues. The exact function for Hox genes in adult somatic tissue is not fully understood, but numerous reports are now emerging with putative Hox targets, which will be discussed in the section "Hox target". 1.4.2 Hox genes in hematopoiesis 1.4.2.1 Expression and induction in hematopoietic cells The first indications of Hox gene involvement in the regulation of hematopoiesis came in the late 80's when Hox genes were found expressed in human hematopoietic cell lines and in murine cell lines, including the myeloid cell line WEHI3B. The latter was found to 37 constitutively express Hoxb8 and IL-3, through the insertion of an intracisternal A-particle (IAP) (Kongsuwan et al., 1989) and overexpression of both genes in BM was shown to directly lead to the development of leukemia (Perkins et al., 1990). Soon after the class II Hox genes, Pbxl and HOX11, were directly implicated in human leukemia through chromosomal translocations (Dube et al., 1991; Hatano et al., 1991; Kamps et al., 1990). Such discoveries prompted scientists to further analyze Hox gene expression in various hematopoietic cell lines which led to the observation that most Hox genes from cluster A, B and C were found expressed in a lineage-dependent manner. In general it was discovered that lymphoid cell lines expressed Hox C genes (Celetti et al., 1993; Lawrence et al., 1993), erythroid cell lines mainly expressed the B cluster (Magli et al., 1991; Mathews et al., 1991) and cell lines with myeloid features expressed Hox A genes (Vieille-Grosjean et al., 1992) (reviewed in (Lawrence et al., 1996)). Shortly after, Hox genes were also shown to be expressed in normal human BM cells (Lowney et al., 1991; Moretti etal., 1994). A major hurdle faced in such studies is the very low level at which Hox genes are expressed rendering them almost undetectable by northern blot analysis. As found in subsequent studies, this is compounded by the fact that expression appears limited to rare primitive hematopoietic cells. One early approach to obtain a more comprehensive profile of Hox gene expression was to use degenerate primers to amplify by RT-PCR the homeobox region of the Hox genes expressed which could then be specifically identified by subsequent cloning and sequencing of the amplified fragments. Such analyses revealed that Hox genes from the A, B and C cluster and none from the D cluster were found expressed in progenitor enriched CD34+ BM fractions (Moretti et al., 1994). 38 The development of more efficient RT-PCR based protocols which allow analysis with far fewer cells, such as global cDNA amplification (Brady et al., 1990) and the refinement of HSC purification strategies greatly improved the resolution of Hox gene expression in rare human B M hematopoietic subpopulations. A more detailed analysis carried out in our laboratory, revealed that Hox genes from cluster A, B and C were preferentially expressed in the most primitive subpopulation of human B M cells enriched in stem cells. Differentiation of the HSCs enriched fraction into committed cells, such as CD34", was paralleled with the downregulation of Hox genes. Moreover, 3' located Hox genes, such as HOXB3, were expressed at higher level in the most primitive fraction of CD34 + cells and downregulated earlier than 5' Hox genes such as HOXA10 (Sauvageau et al., 1994). Such Hox gene expression patterns in primitive B M cells led to the hypothesis that Hox genes were part of the intrinsic regulators of the HSCs and primitive progenitors. Hox gene expression analysis in murine hematopoietic cells has not been as extensively examined. However, Hoxa9 was reported to be expressed in the Sca-1+Lin" and not in Sca-l"Lin+ (depleted of HSCs) fractions, suggesting that Hox genes may also be preferentially expressed in HSCs enriched murine B M cells (Lawrence et al., 1997). Little is also known about Hox gene expression in earlier stages of hematopoietic development. In the mouse, expression of Hoxb5, b6, b7 and c8 was reported in whole fetal livers (FL) between 12.5 to 16.5 dpc (Shimamoto et al., 1999; Zimmermann and Rich, 1997), and members of the Hox A, B and C cluster genes have also been reported to be expressed in the murine yolk sac (Palis et al., 1994). However a more detailed analysis of cell fractions is needed to resolve which cells actually express these genes. To gain 39 further insight into Hox gene function in hematopoietic cells, we have analyzed the expression of several Hox genes and that of Pbxl and Meisl in various functionally distinct murine BM and FL hematopoietic subpopulations. If Hox genes were found expressed in similar patterns in murine BM cells as observed in human, and if such patterns were also present at various stages of hematopoietic development, it would considerably reinforce the hypothesis that these genes are important regulators of primitive hematopoietic cells. A second interesting aspect of Hox gene expression in hematopoiesis is their induction during GF stimulation of proliferation and/or differentiation. This topic was studied in detail by Peschle and his colleagues. In their first report, they showed by RT-PCR and RNase protection assays that activation of purified human T cells by phytohemagglutinin (PHA) led to increased proliferation which was accompanied by the rapid colinear (3'—> 5') activation of Hox B gene transcripts previously undetected, but reverted to silence 3 hours post-treatment (Care et al., 1994). In a second study, similar results were also observed following activation of purified human NK cells with IL-2 and IL-lp\ although the activation took place over a few days as opposed to hours as seen in T cells (Quaranta et al., 1996). Stimulation of Hox B gene expression in differentiating primitive human BM progenitor cells along the erythroid (E) and granulomonocytic (GM) differentiation pathways was also assayed. They found up-regulation of HOXB2-B6, in both pathways, while HOXB7-B8 remained mostly silent (Giampaolo et al., 1994). Expression of Hox genes from other clusters was however not tested. Thus, these studies establish that several Hox B genes are activated following cytokine induction of lymphocyte activation and myeloid differentiation. 40 1.4.2.2 Function of Hox genes in hematopoiesis The recent advances in gene targeting and retroviral infection of primary B M cell technologies have provided new tools to assess the function of Hox genes in hematopoiesis. Although numerous Hox knockout mice have been engineered in the last decade, very few have been carefully analyzed for possible hematopoietic defects. The first hematological report of a Hox knockout mice indicated that loss of Hoxa9 alleles resulted in multiple abnormalities including a 30-40% reduction in total leukocytes and lymphocytes and reduction in myeloid, erythroid and pre-B clonogenic progenitors in their marrow (Lawrence et al., 1997). Recent analysis of these mice also revealed impaired HSC functions, as evident by death of the recipients receiving Hoxa9 -/- marrow 10-12 months post-transplant of B M failure (Mamo et al., 1999). Analysis of Hoxc8 null-mice also revealed a reduction in B M and F L clonogenic progenitors (Shimamoto et al., 1999). Since many Hox genes are found expressed in the same subpopulations, it is likely that the loss of one gene may in part be compensated by the expression of other paralogue member(s) and/or neighboring genes. This is supported by the recent demonstration that Hoxa3 and Hoxd3 can functionally replace one another in vivo (Greer et al., 2000). Thus, the study of compound Hox knockout mice may reveal more severe hematopoietic abnormalities. A n important role for Hox genes in early hematopoiesis is further supported by the recent study of Pbxl null-mice; the latter die in utero by day 15 of severe anemia and showed several defects in fetal hematopoiesis including reduced numbers of colony-forming cells and common myeloid progenitors. Moreover, the HSCs are unable to repopulate mice in competitive experiments suggesting a defect in HSC function (DiMartino et al., 2001). 41 The functional contribution of Hox gene expression in hematopoietic cells was also tested using antisense oligonucleotides (a-) to specifically reduce Hox transcript levels. Using this technique, it was demonstrated that suppression of HOXB2 and B4 transcripts resulted in decreased T cell proliferation in cell lines and freshly isolated cells and similar effects were also observed in NK cells with a-B2 (Care et al., 1994; Quaranta et al., 1996). In purified human progenitors cells, suppression of HOXB6 selectively inhibited G M differentiation, consistent with its restricted G M expression, whereas a-B3 resulted in strong inhibition of both E and G M colony formation, suggesting that the latter acts in early stages of differentiation (Giampaolo et al., 1994). These studies link Hox genes to basic hematopoietic processes of differentiation and proliferation. Moreover, the different effects observed for a-B3 and a-B6 also point to gene-specific functions for Hox genes in hematopoiesis. The development of genetically modified retroviruses to constitutively express genes in B M provided a new powerful approach to study gene function in hematopoiesis, in vitro and in vivo through B M reconstitution (transplantation). Our laboratory has used this model to dissect the role of several Hox genes in hematopoietic cells. Although overexpression of several Hox genes in murine B M results in mostly distinctive effects (summarized in Table 1), there are also some common abnormalities, thus arguing that Hox genes in hematopoietic cells, as seen in embryogenesis, may have both redundant and specific functions. The common phenotypes observed for many Hox expressing transplanted recipients include impairment of B cell development, as seen with Hoxb3 and HoxalO and the development of myeloproliferation syndrome and/or A M L seen with Hoxa9, HoxalO and Hoxb3. 42 In more detail, constitutive expression of Hoxb3 resulted in impaired B and T lymphocyte development as evident by a 24 fold decrease in double positive thymocytes (CD4 +CD8 +) and virtual absence of IL-7 responsive pre-B cell progenitors (Sauvageau et al., 1997). In contrast, constitutive expression of its neighboring gene, Hoxb4, had no reported abnormalities in any lineages, but rather resulted in an increase of self-renewal capacity of the HSC by almost 50 fold as evident by serial transplantation (Antonchuk et al., 2001; Sauvageau et al., 1995). Interestingly, activation of the HOXB4 promoter with cytokines promoting self-renewal was recently reported (Giannola et al., 2000). Overexpression of Hoxa9 leads to several effects, such as immortalization of myeloid progenitors in vitro (Schnabel et al., 2000). However there is some controversy as to whether or not this requires the interaction of Pbxl and/or Meisl, as one group suggested (Schnabel et al., 2000). Calvo and colleagues found that such immortalization was also achieved using a mutated Hoxa9 protein unable to interact with Hox genes (Calvo et al., 2000). Finally, overexpression of HoxalO completely blocked B cell lymphopoiesis, led to the expansion of blast-megakaryocyte like progenitors and led to an almost complete loss of unilineage macrophage progenitors (CFC-M) (Thorsteinsdottir et al., 1997). Inhibition of differentiation by forced expression of Hox genes has also been demonstrated using more simple systems such as hematopoietic cell lines with differentiation capacity (reviewed in (van Oostveen et al., 1999)). For example expression of Hoxa9, b8, Meisl and Meis2 were found to be downregulated in differentiating 32Dcl3 cells, and enforced expression led to a strong block in terminal differentiation (Fujino et al., 2001). Other Hox genes have also been subjects of similar studies in vitro using human enriched progenitor cells. In such studies, constitutive expression of HOXA5 blocked erythropoiesis and enhanced 43 myelopoiesis (Crooks et al., 1999), whereas that of HOXB7 led to increased proliferation of LTC-IC cells and increased the number of myeloid clonogenic progenitors (Care et al., 1999). Altogether, overexpression studies have shown that Hox genes need to be downregulated for normal differentiation of a given lineage(s) to occur. When inappropriately expressed, these genes can lead to a partial or complete differentiation block, expansion of early and/or late progenitors and sometimes to the development of A M L and myeloproliferation syndromes. Table 1.1 Summary of the effects upon hematopoiesis of overexpression of Hox genes in murine bone marrow. Genes Effects Leukemia in vitro in vivo Hoxa.9* aWMeisl* None reported None reported A M L > 6 months A M L < 3 months Hoxal& I C F C - M , C F C - G E M M , C F C - G M T abnormal CFC-Mega-Blast colonies T Maintenance of day 12 CFU-S Tmyeloid progenitors in spleen/BM T 35X abnormal CFC-Mega-Blast LostofCFC-M Impaired B lymphopoiesis A M L > 5 months Hoxb3c None reported Tgranulocytes in B M T 3 X myeloid progenitors Impaired B and T lymphopoiesis 1 C F C - G E M M in B M No effect on CRU cells A M L > 210 days b3/Meisld A M L - 110 days Hoxb4e Hoxb4e T C F C - G M , Secondary plating efficiency T Maintenance of day 12 CFU-S T myeloid progenitors BM/spleen T pre-B progenitors T 5-7 X day 12 CFU-S T 47X CRU frequency compared to Neo control None reported 44 HOXlli% T establishment of myeloid cell lines T - A L L * >7 months a (Kroon et al., 1998); b (Thorsteinsdottir et al., 1997);0 (Sauvageau et al ., 1997); d (Thorsteinsdottir et al., 2001);e (Sauvageau et al., 1995);f (Hawley et al., 1994)g (Hawley et al., 1997) * T-cell acute lymphoblastic leukemia Altogether, there is a large body of evidence supporting important roles for these genes in the regulation of early hematopoietic cell proliferation and differentiation. These include loss of HSC function in Hoxa9 knock out mice, increased HSC number and primitive progenitors in B M overexpressing Hoxb4 and B7 respectively, loss of hematopoietic progenitor function in Hox antisense oligomer treated B M cells and finally frequent loss of homeostasis and/or differentiation blocks when Hox genes are constitutively expressed. As previously observed in development, Hox genes appear to have both redundant and specific functions in hematopoiesis. Distinct biological function for Hox genes may be attributed in part to differences in expression as observed for GATA-1, GATA-2 and GATA-3, which are highly homologous but have significant differences in their expression profile in hematopoietic cells (Weiss and Orkin, 1995). Finally, Hox genes like many TF involved in the regulation of hematopoiesis, have also directly and indirectly been implicated in murine and human leukemia. 1.4.2.3 Regulation of Hox genes in hematopoietic cells Based on observations from overexpression and antisense oligomer studies, it appears that Hox genes must be appropriately expressed to assure overall homeostasis of the hematopoietic system. The non-ubiquitous but rather preferential expression of Hox genes 45 in primitive B M hematopoietic cells (Pineault, 2001; Sauvageau et al., 1994) suggest that regulatory sequences, such as HSC-specific sequences, could mediate their transcriptional regulation. In the context of hematopoiesis, only a few trans-regulators and cis-regulatory elements have so far been identified and characterized for Hox genes. Vieille-Grosjean et al. have shown that the zinc-finger GATA-1 protein binds to and activates the human HOXB2 promoter in the erythroleukemic cell line K562 (Vieille-Grosjean and Huber, 1995). This is particularly interesting considering the preferential expression of Hox B genes in erythroid cell lines, the late activation of HOXB2 during erythroid differentiation and the critical role of GATA-1 during erythropoiesis (Giampaolo et al., 1994; Magli et al., 1991; Weiss and Orkin, 1995). D. M . Giannola et al. showed that stimulation of CD34 + human progenitor cells with thrombopoietin/SF and Flt3-ligand led to a 3-10 fold increase in the activity of HOXB4 promoter. Using a gel-shift assay and site-directed mutagenesis, they demonstrated that the upstream stimulation factor (USF)-l and USF-2 were responsible for this activation (Giannola et al., 2000). Although retinoic acid receptors (RAR) are expressed by hematopoietic progenitors cells, and RARoc is involved in promyelocytic leukemias, a direct link between these and Hox genes has not yet been reported (Chen et al., 1996; Look, 1997). Another important issue that remains unaddressed is whether the cis-elements, such as enhancers, identified as critical for establishing Hox gene expression during embryogenesis are also important regulators of Hox genes in adult tissue cells including hematopoietic cells. Toward this end, we have isolated and characterized a novel cis-regulatory element of HOXB3 with transcriptional regulatory activity in hematopoietic cells, work that is presented in chapter 4 of this thesis. 46 1.4.2.4 Involvement of Hox genes in leukemia The first indications of Hox gene involvement in leukemia came from work done with the murine myeloid cell line WEHI3B. Both Hoxb8 and IL-3 genes were found aberrantly expressed due to the insertion of an LAP particle in their gene locus (Kongsuwan et al., 1989) . Provocatively, it was demonstrated that co-expression of Hoxb8 and IL-3 in B M using retroviruses, directly led to the development of leukemia in mice (Perkins et al., 1990) . Such studies coupled with the observation of Hox gene expression in hematopoietic cell lines derived from leukemic patients led to the hypothesis that Hox genes could also play pivotal roles in leukemia. This hypothesis was further supported by the discovery in the early 90's that several class II homeobox genes, such as Pbxl and HOX11, were directly implicated in human leukemias through chromosomal translocations. HOX11, not normally expressed in T cells, was isolated in leukemic T-cells following the characterization of t(10;ll), which juxtaposes HOX11 to the T cell receptor locus and lead to its aberrant expression (Dube et al., 1991; Hatano et al., 1991; Lu et al., 1991). Subsequent studies revealed that HOX11 disrupts the G2/M cell cycle checkpoint, by interacting with and inhibiting the protein phosphatase 2A and 1 (Kawabe et al., 1997), and thus provides a possible mechanism for its involvement in leukemia. HOX11 leukemogenic potential was directly tested through retroviral-mediated expression in B M cells which lead to T - A L L after a latency period of at least 7 months (Hawley et al., 1994). Transgenic mice engineered to express HOX11 in B cells, developed B lymphoma 47 at a high frequency in their second year (Hough et al., 1998). These mice provide a model to identify the genetic and molecular events leading to the progression of a premalignant phase characterized by hyperplasia to a lethal invasive lymphoma. This model was recently employed to demonstrate that the T-cell immunogenetic response is intact in sick HOX11 Tg mice, thus supporting the possible use of an immunotherapeutic approach to cure lymphoblastic/leukemic diseases (Rosic-Kablar et al., 2000). Of further interest, the chimeric E2A-PBX1 protein was shown to induce A M L and lymphomas in the mouse transplantation model and transgenic mice, respectively (Dedera et al., 1993; Kamps and Wright, 1994). Importantly, Hox appeared to play a pivotal role in the transformation potential of E2A-PBX1, since the loss of Pbx l's Hox cooperative motif completely abolished the transforming potential of the chimeric gene (Chang et al., 1997; Kamps, 1997). Moreover, it was shown that co-expression of E2A-PBX1 with Hoxa9 can rapidly induce A M L in mice (Thorsteinsdottir et al., 1999). Thus these studies strongly support the involvement of Hox genes in E2A-PBX1 induced leukemias. A second intriguing observation linking Hox genes to leukemia is their aberrant expression in leukemic cells freshly isolated from patients. H. Kawagoe reported that A M L B M cells do not down-regulate Hox (HOXB3, B4, A9 and A10) and Meisl expression following maturation from CD34+CD38" into CD34" as normal human B M cells do (Kawagoe et al., 1999). Moreover, a study focusing on HOXA9 and MEIS1 expression in A M L found frequent co-expression of the two genes in all subtypes, except in promyelocytic leukemia, in a large collection of samples (m=80) (Lawrence et al., 1999). Co-expression of HOXA7 and MEIS1 in acute myeloid leukemia was also recently reported (Afonja et al., 2000). Upregulation of HOXA9 and Meisl transcript has also been 48 reported in 13/14 patients suffering from acute lymphoblastic leukemia and all bearing t(4;ll) (Fujino et al., 2001). Interestingly, this translocation involves the MLL gene, a well-known upstream regulator for Hox genes. These studies further implicate A cluster Hox genes and Meisl in leukemogenesis, and are consistent with results found in the BXH-2 mice strain (see below). HOXA9 oncogenic potential is further supported by the recent work of Golub et al. who analyzed the expression of over 6800 genes using DNA microarray technology in 38 human acute leukemia samples. They found that HOXA9 expression had the highest correlation of all genes for poor prognosis of acute leukemia (Golub etal., 1999). The transduction of primary B M cells, with Hox and/or co-factor genes, followed by transplantation to conditioned recipients has been a very productive model used to study Hox leukemogenecity in vivo (summarized Table 1). Using this model, Humphries and his colleagues demonstrated the development of myeloproliferation syndrome and A M L in mice constitutively expressing Hoxb3 and HoxalO respectively, after a long period of latency (Sauvageau et al., 1997; Thorsteinsdottir et al., 1997). As previously mentioned the Hox co-factor Meisl was isolated based on its ability to cause myeloid leukemia with Hoxa7 or a9 in the BXH-2 mice. More specifically, of 20 BXH-2 myeloid leukemias with pro viral activated Meisl, 95% showed viral co-activation of either Hoxa7 or Hoxa9 (Nakamura et al., 1996). Since then, Meisl has been identified as a strong inducer of Hox-induced leukemia. It was demonstrated using retroviral gene transfer that Meisl, but not Pbxl, can considerably reduce the latency time required for the development of AML/myeloproliferation syndrome in mice overexpressing Hoxb3 (Thorsteinsdottir et al., 2001), Hoxa9 (Kroon et al., 1998) and the fusion gene NUP98-HOXA9 (Kroon et al., 49 2001). In all cases, Meisl was reported to shorten the latency time but not the type of leukemia, which was dictated by the Hox gene (Thorsteinsdottir et al., 2001). Hoxa9 induced transformation has since then been demonstrated to require the formation of a trimer, between HOX, PBX and MEIS proteins (Schnabel et al., 2000). Distinctively, constitutive expression of Meisl alone has little effect on hematopoiesis and does not promote the development of leukemia (Thorsteinsdottir et al., 2001). The role of Meisl in enhancing the leukemic potential of Hox genes may result from the interaction of exogenous MEIS1 with endogenous PBX1 proteins, which is expressed in primitive hematopoietic cells (DiMartino et al., 2001; Pineault, 2001). Such interaction would lead to increased nuclear concentration of PBX1 (Mercader et al., 1999), which could lead to increased HOX activity through the formation of HOX-PBX dimers and likely HOX-PBX-MEIS1 trimers. Finally like many other TFs, clustered homeobox genes have also been directly implicated in A M L through recurrent chromosomal translocations. The first report was from A M L patients bearing the t(7;ll)(pl5;pl5), which lead to the fusion of the amino terminal half of NUP98 to HOXA9, preserving the homeodomain and Pbx interaction motif of A9 (Borrow et al., 1996; Nakamura et al., 1996). Since then, the t(7;l 1) has been observed in more A M L patients as well as in a chronic myelogenous leukemic patient (Wong et al., 1999). In 1998 a second member of the clustered Hox genes, HOXD13, was found fused to the same portion of NUP98 following t(2;ll)(q31;pl5) in a patient with therapy related A M L (t-AML) and has since been reported in more A M L patients (Arai et al., 2000; Raza-Egilmez et al., 1998; Shimada et al., 2000). Intriguingly, both Hox fusion genes contain the exact same NUP98 portion and retain the full homeobox coding 50 sequences. NUP98 fusion genes involving members of the Hox B and Hox C cluster may also exist, since translocation involving NUP98 loci and that of both genes clusters have recently been reported. These reports add to a growing list of novel NUP98 fusion genes isolated in patients suffering from t-AML and/or de novo A M L (Kakazu et al., 2001). Interestingly, the NUP98 and M L L genes both located on chromosome 11 shows a high rate of rearrangement following cytotoxic chemotherapy with topoisomerase II inhibitors, suggesting that chromosome 11 is highly sensitive to such genotoxic drug (Ahuja et al., 2001; Andersen et al., 2001; Arai et al., 1997). The NUP98 gene is fused to several distinct genes in leukemic patients such as the TOPI gene (Ahuja et al., 1999), the class II PMX1 Hox gene (Nakamura et al., 1999), the helicase DDX10 gene (Arai et al., 1997), a novel gene NSD1 (Jaju et al., 2001), and the transcriptional co-activators LEDGF (Ahuja et al., 2000). The majority of these NUP98 containing fusion genes have been isolated in myeloid leukemia except for the t(4;ll), which fuses the guanidine exchange factor RAP1GDS1 to NUP98 in T-cell acute lymphocytic leukemia (Cimino et al., 2001; Hussey et al., 1999). Thus, balanced translocations involving the NUP98 gene may predispose and/or induce A M L in human B M cells. Support for such hypothesis is reinforced by the recent demonstration that constitutive expression of NUP98-HOXA9 can lead to A M L in a murine B M transplantation model (Kroon et al., 2001). To further understand the role of the NUP98 genes and that of Hox genes in leukemia, we studied the leukemogenic potential of the NUP98-HOXD13 in mice in vivo; the results are presented in chapter 5. 51 Figure 1.5 Involvement of Hox genes and related genes in leukemia. Simplistic summary of Hox genes, their regulators and co-factors involvement in leukemia based on direct evidences from chromosomal translocations found in leukemic patients and/or experimental demonstration of in vivo leukemogenecity. The arrow connecting the co-factors and regulators to Hox genes is based on experimental demonstration of direct Hox gene involvement. The arrow connecting the upstream regulators to leukemia is for AML1 and RARa fusion genes, for which Hox gene involvement has not yet been established. Additional genetic mutations may also be required for full-blown leukemogenic potentials. Leukemia A schematic representation summarizing the evidence linking Hox genes to leukemia is shown in Fig. 1.5. Consistent with Hox as important regulators of hematopoiesis and inducers of leukemia, are the direct involvements of upstream regulators of Hox genes such as MLL and Bmi-1 in leukemia. These will be discussed in the next section. Whether Hox genes are involved in the neoplastic transformation of hematopoietic cells by retinoic acid receptor (RARoc) and AML1 fusion genes has not yet been resolved yet. AML1, or the core binding factor-(3 (CBFff), is a close counterpart of the pair-rule gene runt found in Drosophila, and as previously mentioned, the latter are upstream regulators of the HOM-C genes (Look, 1997; Okuda et al., 1996). 52 The usual long latency period required before the onset of myeloproliferation syndrome and A M L in mice overexpressing Hox genes strongly argue Hox on their own do not cause leukemia but that a second "genetic hit" must be required to acquire strong uncontrolled proliferation capacity. It would appear that a mutation leading to increased Meisl expression could be the target of such second hit. However, there are numerous pathways that can be envisaged as synergistic-candidates with Hox genes, such as GFs, as observed between Hoxb8 and IL-3. 1.4.2.5 The mammalian Polycomb and Trithorax genes Common to the Drosophila and vertebrates is the mechanism by which Hox gene expression is maintained following induction by specific trans-activators. Two gene families heterogeneous in nature and with antagonist functions have been identified through the analysis of homeotic mutated flies that showed no signs of mutation in the HOM-C genes, but abnormal HOM-C expression. These are the Polycomb (PcG) and Trithorax (trxG) gene families, which negatively and positively regulate Hox gene expression respectively (Gould, 1997). More than 13 vertebrate homologues have been cloned so far, and data provided from biochemistry and genetic studies indicate that more are likely to be found (Gould, 1997; Schumacher and Magnuson, 1997). Mice heterozygous and homozygous for null-mutations of PcG and trxG have been shown to have major posterior and anterior transformations of several body parts respectively, consistent with mis-expression of Hox genes (van der Lugt et al., 1994; Yu et al., 1995). 53 Furthermore, in addition to homeotic mutations observed in the PcG and trxG null-mice has been the discovery of some hematopoietic abnormalities. MLL (mixed-lineages leukemia), the mammalian homologue of trithorax, is in fact one of the most frequently rearranged genes through chromosomal translocations at its locus (llq23) in human leukemia (Gu et al., 1992; Schreiner et al., 2001). Direct functional evidence of M L L fusion genes causing leukemia has been demonstrated for several M L L fusion genes; with overexpression of both MLL-CBP and M L L - E L L leading to A M L in mice (Lavau et al., 2000; Lavau et al., 2000). Null-MLL embryos die in utero of severe anemia and further studies of FL hematopoietic cells revealed growth disturbances such as, reduced hematopoietic cell numbers, reduced hematopoietic precursors and progenitors (Hess et al., 1997; Yagi et al., 1998). Importantly, Yagi et al. demonstrated that FL M L L -/- cells had reduced levels of Hoxa7, a9 and alO, suggesting that the abnormalities may be caused in part by the aberrant expression of certain Hox genes. Moreover, hematopoietic defects have also been reported in Mel-18, Eed, M33, Rae-28 and Bmi-1 PcG knockout mice (Akasaka et al., 1997; Core et al., 1997; Lessard et al., 1999; van der Lugt et al , 1994). These include impaired IL-7 induced proliferation response of lymphocyte precursors (Akasaka et al., 1997) in both mel-18 and bmi-1 mutant mice, which is often observed in Hox overexpressing mice. Recently, J. Lessard et al. described in detail the expression of nine PcG genes in human hematopoietic B M subpopulations and found that the expression of 8 of the 9 genes was increased in more mature subpopulations, except for Bmi-1 which was the unique PcG member to be expressed higher in the HSC enriched fraction (Lessard et al., 1998). Since PcG genes are negative regulators of Hox genes, these results 54 are consistent with the preferential expression of Hox gene in the HSC enriched fractions and their downregulation following differentiation (Sauvageau et al., 1994). PcG genes may also have Hox independent functions, since the PcG complexes are not only observed bound to Hox gene clusters but throughout the genome (Pirrotta, 1997). Interestingly, Bmi-1 (B_cell-specific Mo-MLV integration site 1) was isolated based on its ability to induce murine lymphoma in synergy with the bHLH TF c-Myc. Jacobs et al. recently demonstrated that in Bmi-1 deficient mice, the tumor suppressors (TS) pi 6 and pi9Arfare markedly increased, and that primary fibroblasts undergo premature senescence. Re-introduction of Bmi-1 corrected this early senescence and also reduced the level of the TS genes, strongly arguing that part of Bmi-1 function is to regulate these two important TS genes (Jacobs et al., 1999). However, it remains unknown whether Bmi-1 regulation of the ink4a locus is direct, or indirectly mediated through Hox genes. This may provide important clues on how HSCs cell cycle is regulated, since HSCs are usually quiescent or in slow cycle and that Bmi-1 is found expressed at higher levels in the HSC fraction. 1.5 Targets of Hox genes To fully understand the functions of Hox genes in mammalian development and adult somatic cells, we must identify and functionally characterize the genes that are directly regulated by Hox genes. Given the variety of functional divergent cells in which Hox genes are expressed there will likely be some common and non-common Hox target groups, regulating basic processes such as proliferation. 55 A major approach for the discovery of Hox targets has been through the identification of Hox putative binding sites in the promoter of genes, followed by gene reporter assays to determine whether the regulatory element is responsive or not to Hox gene expression. The latter step is usually achieved by co-transfection of cell lines with a reporter gene (CAT, luciferase), under the regulation of the gene's promoter, and various Hox expressing plasmids. Additional evidence may include gel-shift assays and site-directed mutagenesis. Using such strategies, Jones et al. in 1992 reported the first putative target of mammalian Hox genes, the neuronal-cell-adhesion molecules (N-CAM) gene, which is involved in neuronal development. They showed that the promoter of N - C A M could be bound and activated by the protein products of HOXB8, B9 and C6 (Jones et al., 1993; Jones et al., 1992) and the class II Pax6 and Pax8 proteins (Edelman and Jones, 1992). A correlation between Hox genes and cell-adhesion molecules was also observed in various cell types. For example, following treatment with the basic fibroblast growth factor (bFGF), endothelial cells undergo proliferation and upregulate Hoxd3 which was shown to lead to the upregulation of integrin 03 (Boudreau et al., 1997). Other putative C A M targets include 0uTbp3 (a surface fibronectin receptor), E-cadherin and liver-CAM which are regulated in part by HOXD3, Hoxa9 and HOXD9, respectively (Goomer et al., 1994; Izon et al., 1998; Taniguchi et al., 1995). This link between Hox and cell adhesion molecules is of interest given the importance of such molecules in fundamental developmental processes of cell migration and proliferation. However, new Hox target genes have also been recently identified that do not belong to the cell-surface molecule category or Hox genes. Recent genetic experiments with mice have identified Hoxbl as a direct upstream regulator of GATA-2 in r4 during hindbrain 56 development (Pata et al., 1999). Another TF, the thyroid transcription factor-1, was also shown to be selectively activated by HOXB3 among all Hox proteins tested (Guazzi et al., 1994). In breast cancer cell lines, V. Raman et al. observed a correlation between p53 and HOXA5 mRNA levels. Thereafter, they showed that transient expression of HOXA5 but not HOXB4, B5 and B7 resulted in the up-regulation of p53 and apoptosis in epithelial cancer cells (Raman et al., 2000). Thus they suggested that loss of p53 in breast cancer cells may be a result of the loss of HOXA5 expression. In regard to Hox targets in hematopoietic cells, only a handful have thus far been identified. These include the recent demonstration that HOXA10 positively regulates p21 expression, a cyclin kinase inhibitor, in the myeloid cell line U937 and thus provides a direct link between the regulation of hematopoietic cell proliferation mediated by Hox genes. This discovery originates from studies directed toward the characterization of the molecular mechanisms involved in the induction of myeloid differentiation of the U937 myeloid cell line by 1,25-Dihydroxyvitamin D 3 . Treatment of U937 cells with vitamin D 3 resulted in the direct upregulation of HOXA10 (Rots et al., 1998). Subsequently, HOXA10 was shown to bind as a trimeric complex with PBX1 and MEIS1, to the p21 promoter and activate its expression, stopping U937 cell proliferation and inducing differentiation as observed with constitutive expression of HOXA10 or p21 in this cell line (Bromleigh and Freedman, 2000). Interestingly, HSCs are not usually found to be actively cycling but are rather quiescent and/or slowly cycling (Cheshier et al., 1999; Spangrude et al., 1988). The importance of such cell cycle regulators on hematopoiesis is highlighted by the following reports on p21, where researchers directly tested its 57 importance in respect to HSC regulation using p21 null-mice. Not surprisingly, the p21-null HSC enriched fraction had a higher proportion of cells active in cell cycle compared to the control. The total number of HSCs in these mice were also increased but most importantly found to be severely compromised in their self-renewal capacity, when challenged by genotoxic drug and serial-transplantation (Cheng T, 2000). These studies point to p21, and likely other cell cycle regulators, as an important manager of HSC self-renewal and identifies HOXA10 as a likely direct regulator of p21. It will be of great interest to determine whether other Hox genes can regulate p21 and/or other important cell-cycle regulators. Some putative targets for class II Hox genes in hematopoietic cells have also been identified, most of which are cell-adhesion molecules. For example, overexpression of DLX-7 led to increased expression of ICAM-1 and ICAM-2 molecules and decreased apoptosis of the murine BaF3 cell line, which was shown to be ICAM-1-dependant (Shimamoto et al., 2000). The regulation of Hox genes by GFs has also been established, such as the colinear activation of Hox genes by retinoic acid, etc. (see "Expression and induction in hematopoietic cells"). But can the reverse be true? Could Hox genes specifically regulate important GFs such as SF and IL-3, or GF receptors such as c-kit? The answer may likely be yes, since it was recently demonstrated that HOXA5 can directly activate transcription of the progesterone receptor in the breast cancer cell line MCF-7 (Raman et al., 2000). Further to this, Hoxa9 and Hoxc8 were linked to the regulation of the secreted factor osteopontin, which is involved in the regulation of bone resorbtion (Sambrook. J, 1989; Shi et al., 2001; Shi et al., 1999). Finally, HOXB7 which is constitutively expressed in all 58 melanoma cell lines tested (n>20) was shown to induce melanoma proliferation through the activation of the bFGF (Care et al., 1996). Recent studies have implicated HOXB7 as a proangiogenic stimuli (Care et al., 2001). Although no such direct link in hematopoietic cells has yet been established, it is an exciting field of research that needs to be addressed. The availability of the whole human genomic sequence and upcoming murine genome sequence coupled with more efficient bio-infomatic tools will certainly help in finding new putative and evolutionary-conserved Hox binding sites in cis-regulatory elements of candidate gene, such as hematopoietic GFs. 1.6 Thesis objectives The guiding hypothesis of this work was that Hox genes are intrinsic regulators of hematopoietic cells. To address this, I pursued three lines of investigation that addressed the expression of Hox genes in normal hematopoietic cells, possible hematopoietic specific regulatory elements controlling their expression, and the direct involvement of a novel Hox fusion gene in leukemia. In more detail, my specific objectives were as follow. My first aim was to survey the expression of Hox genes and their co-factors in functionally distinct subpopulations at various stages of murine hematopoietic development. Two major rationales drove this study. First, although much progress had been made using the mouse model to study Hox gene function in hematopoiesis, little was known about the expression of endogenous Hox genes in murine B M and even less about their co-factors, which have since been shown to be major co-effectors of Hox gene 59 function. Secondly, we extended our survey to early stages of hematopoietic development, such as fetal liver and embryonic hematopoiesis (using the ES model) to determine whether Hox genes could be involved in the regulation of hematopoietic cells at all stages of development. To achieve these objectives we used a global cDNA amplification technique, which allowed us to assess expression of Hox genes using a small number of cells (~lxl0 4) of various fractions with functionally distinct properties, such as HSC enriched or deprived fractions. The second objective was to characterize a putative HOXB3 transcriptional cis-regulatory element in the HOXB3 second intron, which became evident following the recent isolation of a new HOXB3 transcript in CD34 + B M cells. Using hematopoietic cell lines of various lineages and the chloramphenicol acetyl transferase (CAT) gene reporter assay, we directly tested the second intron for promoter and enhancer activity. The results presented in chapter 4, represent the first characterization of a Hox gene enhancer that may be implicated in the regulation of HOXB3 in hematopoietic cells. Importantly, enhancers have been shown to be significant regulators of Hox genes during embryogenesis. To date only two recurrent chromosomal translocations involving class I Hox genes have been reported, both involving the same fusion partner NUP98. These add to a growing list of NUP98-associated fusion genes (n > 5) that have been reported in A M L , for which, homeobox genes are the most common fusion partner. Although NUP98-Hox fusion genes seem to be involved in numerous cases of A M L , no work was yet published 60 describing whether Hox fusion genes, or other NUP98-fusion genes, have deleterious effect on hematopoiesis and whether or not they can directly lead to leukemia. The final objective of my research was aimed at answering these unresolved questions. To achieve this end, we used the murine BM transplantation model to functionally characterize the leukemogenic potential of the Hox fusion gene NUP98-HOXD13. This novel chimeric gene provided an opportunity to address how deregulated Hox expression, since HOXD13 is not normally expressed in BM cells, can lead to leukemia and also assess the functional importance and contribution of the NUP98 portion. 61 CHAPTER 2 MATERIALS AND METHODS 2.1 Hematopoietic BM subpopulations, cell lines and clonogenic progenitors assays 2.1.1 Cell lines Hematopoietic cell lines used in this study were obtained from the American Type Culture Collection (ATCC) unless specified otherwise. Human cell lines included HL-60 cells derived from a patient suffering from acute myeloid leukemia (Collins et al., 1977); K562 cells established by Lozzio and Lozzio and obtained from the pleural effusion of a patient in blast phase of chronic myelogeneous leukemia (Lozzio and Lozzio, 1975); U937 cells obtained from the pleural effusion of a patient with B cell lymphoma (Sundstorm and Nilsson, 1976); MOLT-4 cells established from the peripheral blood of a patient with acute T-cell leukemia (Minowada et al., 1972); K G - l a cells obtained from a patient with acute myeloid leukemia and DHL-4 derived from a cell lymphoma (Avanzi G. C , 1988). Murine cell lines used included multipotential 32D (Valtieri et al., 1987); myeloid FDC-P1 cells derived from long-term bone marrow cultures of DBA-2 mice (Dexter et al., 1980); Ba/F3 pro-B cells, DA-ER and FEL-745 Friend erythroleukemic cells. All cell lines were maintained in RPMI with 10% fetal calf serum (FCS) (Gibco, Canadian Life Technologies, Burlington, Canada) except for FDC-P1, 32D, and Ba/F3, which, in addition, required 5 ng/ml of interleukin-3 (11-3) (produced in the Terry Fox Laboratory) for growth. 62 2.1.2 Isolation of murine hematopoietic cell subpopulations Bone marrow cells were harvested from the femurs of 3-monfh-old C57Bl/6J:Pep3b mice. Fetal livers were isolated at the embryonic day 14.5 (dl4.5) from C57Bl/6J:Pep3b fetuses. Erythrocytes were lysed using a buffered ammonium chloride solution and cells were rinsed with Hank's balanced salt solution containing 2% fetal calf serum (FCS). Unless otherwise indicated, all solutions were obtained from StemCell Technologies inc. (STI) (Vancouver, Canada). Cells were pre-incubated for 30 min. on ice with 3 pg/ml anti-Fc receptor antibody (2.4G2, produced from hybridoma, provided by Dr. S. Szilvassy) to prevent non-specific binding. The isolation of cell subpopulations was based on work previously described by V. Rebel (Rebel et al., 1996). Cells were stained for 1 hour on ice with an appropriate concentration of phycoerythrin (PE) conjugated Sca-1 antibody, and fluoroscein isothiocyanate (FITC) conjugated antibody for lineage B220, Gr-1, Mac-1, Ter-119 and Ly-1 (CD5). All antibodies were purchased from SIGMA (Sigma Chemical Co., St. Louis MO). Cells were then rinsed, stained with propidium iodide, and viable cells were fractionated using a FACStarP^u s, Beckton Dickenson, CA). The lineage positive fraction was defined as B220+, Gr-1 +, Mac-1+, Ter-119+ and L y - U for B M , and B220+, Gr-1 +, Ter-119+ and Ly-1 + for FL. 2.1.3 Clonogenic progenitor assays Cells were plated (ranging from 8x102 to 10 xlO 3 /ml, 1ml per dish) in methylcellulose (MethoCult MC-3224, STI) with rmSF (50 ng/ml), rmIL-3 (10 ng/ml), rhIL-6 (10 ng/ml) and mErythropoetin (3 U/ml). For spleen cells, 5 to 250x103 cells were plated per ml. All cytokines were supplied as supernatants from transfected Cos cells (Terry Fox 63 Laboratories), except for rmEpo (STI). Colonies were counted 9 days post-plating and classified using standard criteria as derived from, C F U - G E M M , C F U - G M and BFU-E. 2.1.4 Embryonic stem cell culture and differentiation C C E ES cells (kindly provided by Dr. G. Keller, National Jewish Center, Denver, CO.) were maintained on gelatinized dishes in Dulbecco's modified essential medium (DMEM) supplemented with 10% selected FCS (STI, #6901), 4 mM glutamine, 2x non-essential amino acids, 150 LiM monothioglycerol (MTG; Sigma), and leukemia inhibitory factor (LIF) supplied as a supernatant (prepared at the Terry Fox Lab) from Cos cells transfected with a LIF expression vector. Unless otherwise stated, all reagents for cell culture and in vitro differentiation of ES cells were purchased from StemCell Technologies Inc. The methods utilised for the differentiation of ES cells and the quantitation of progenitors within the embryoid bodies (EBs) were essentially as described previously (Helgason etal., 1996). Methylcellulose (MC-3220) for differentiation consisted of 0.9% Iscove's methylcellulose supplemented with 15% selected FCS (STI, #6900), 450uM M T G (Sigma), 40 ng/ml mSF, and LMDM to volume. ES cells were added to the methylcellulose to yield a final density of 300 cells per ml and 1.0 ml aliquots were distributed into 35 mm petri-style dishes (STI). At various stages (day 0, 5, 9, 13, 17) of the primary differentiation EBs were harvested for replating in secondary methylcellulose (MC-3220, with 3 U/ml Epo, 160 ng/ml SF, 30 ng/ml IL-3 and 30 ng/ml IL-6) cultures to detect hematopoietic progenitors and an aliquot was kept for gene expression analysis. Day 9 EB cells were stained with c-kit antibody (SIGMA) on ice for 45 min., cells were then rinsed, stained with propidium iodide, and viable cells 64 were fractionated in c-kit+ and c-kit" using a FACStarP m s . As with the B M and FL colonies were counted after 9 days using standard criteria. 2.2 Global cDNA amplification, RT-PCR, Southern and northern blots 2.2.1 cDNA amplification The RT-PCR technique used was based on that described by Brady et al (Brady et al., 1990), and subsequently modified by Sauvageau et al (Lawrence et al., 1995). In brief, a total of l x l0 4 cells were used as original source of RNA per PCR sample. The cells were lysed using guanidine isothiocyanate (Gibco) solution and the RNA was then precipitated using ammonium acetate and 25 p:g of glycogen (Boehringer Mannheim, Laval, Canada) used as carrier. cDNA was synthesized with Superscriptll and a special 60 mers oligo-dt ((dt)24-36-mers(Brady et al., 1990)) was used as primer. The reverse transcription was done as described by manufacturer instructions. A poly A tail was then added at the 5' end of the purified cDNAs using the terminal deoxynucleotidyl transferase enzyme (TdT), then the TdT was heat inactivated at 70 °C for 15 min. PCR conditions used were identical to the one described by Kawagoe (Kawagoe et al., 1999). All enzymes and nucleotides obtained from Canadian Life Technologies, Gibco, Burlington, Canada. 2.2.2 Southern blot analysis of RT-PCR products Globally amplified cDNAs from the purified hematopoietic subpopulations were used to produce 4 identical membranes, each lane containing 10 |il of the final PCR products. In brief, the samples were electrophoresed on a 1% agarose (GIBCO) gel, and transferred to 65 a nylon membrane (Zetaprobe, Bio-Rad) using 10X SSC as previously described (Kawagoe et al., 1999). The membrane were then hybridized and washed as described by Sauvageau et al (Sauvageau et al., 1994). Specificity of the probes was ensured by exclusion of the homeobox and confirmed by DNA comparison search using the BLAST program, from NCBI. The probes were labeled by random priming with radioactive dATP (p32-a-ATP). The intensity for each signal was measured using a phosphorimager STORM 860 and the ImageQuant software from Molecular Dynamics (Sunnyvale, Ca, USA). The expression for each gene was normalized to actin by dividing the value for the gene by the one found with actin. 2.2.2.1 Probes used for Hox gene expression study Murine Hoxa4, a.9, bl, b2 and b9 probes were kindly provided by Dr. J. Lawrence (University of California V A Medical Center, San Francisco, CA), and were all fragments 3' of the homeobox and of length of 350, 500, 800, 400 and 360 bp respectively. HoxAS probe was a 375 bp boxless fragment. Probes for Hoxb4 and alO consisted of the 3' fragments from the restriction sites (Hindlll and BamYtt respectively) past the homeobox in the murine cDNAs, and of 1050 and 680bp in length respectively. Human Pbxl (accession number M86546) probe consisted of a 560 bp Apal- Dra\ fragment; human Pbx2 (accession number X59842) of a 536 bp Pvull- Pvull fragment; and murine Meisl (accession number U33629) of a 740 bp Pvull- BamHI fragment. Murine brachyury probe was a 212 bp fragment corresponding to nucleotides 285-496 (accession number X51683). P-Actin, GATA-1, fl -HI and (5-globin probes were as previously described in 66 (Metzler et al., 2000). Human probes shared >85% nucleotides identity with murine sequence, as determined with the BLAST program (http://www.ncbi.nlm.nih.gov). 2.2.2.2 Probes used for expression of HOXB3 in human BM cells Probes used included a 600 bp Pstl fragment for HOXB3 exon 3a' (from the cDNA described in here); a 575 bp fragment, excluding the homeobox, downstream of the BamHI site for exon 4; the chicken $-actin gene and human CD34 gene as discussed above. 2.2.3 Specific RT-PCR for exon 3a' of human HOXB3 gene First strand cDNA was synthesized using 6 p:g of total RNA isolated from K562 cells, an antisense primer specific to exon 3b from position 1304 in our cDNA (5'-CTCTGCCCCCCTCCTCCGGGGTCTGTT-3 ' ) and Superscript II reverse transcriptase as recommended by manufacturer (Gibco). Each PCR sample used 1/20 of the final cDNA product, dNTPs at 0.2 mM, primers for exon 3a' (sense at bp 91; 5' - G T T G G G A G A G A T G G A G G G A A - 3 ' and antisense at bp 500, 5 ' -GTGACAT-TTGGCCAGGTCTCTCCCCGGA-3 ' ) at 40 ng/ul and 2mM MgCl 2 and PCR buffer and 2.5 U of Platinum Taq polymerase from (Gibco). PCR conditions were of 30 sec. at 94, 40 sec. at 58 and 30 sec. at 72°C for 35 cycles. 2.2.4 RT-PCR for Meisl and NUP98-HOXD13 proviral expression Reverse transcription done as described above with RNA isolated from co-transduced B M cells (NUP98-HOXD13/Meisl) using the anti-sense primers used for PCR. PCR: 67 sense primer common to both, starting at bp 1345 (-80 bp upstream of multiclonal site) in packaging signal sequence of the MSCV vector (5' - C T T G A A C C T C C T C G T T C G A C -3'). Antisense primer started at bp 446 in NUP98 (AB_040538) (5'-GACTGGTCCCTGTGCTTGCA-3 ' ) for NUP98-HOXD13, and at bp 449 in Meisl (NM_010789) (5 ' -TTCACCGAGGAACCCATGCT-3') . PCR essentially identical to the described above except for the cycle conditions; 30 cycles at 94°C/30 sec, 60°C/30 sec. and 72°C. 2.2.5 Genomic Southern blots The genomic DNA, from peripheral, spleen, spleen colonies (CFU-S) and B M cells was isolated using the reagent DNAzol and the recommendation provided by the manufacturer (Gibco). 5 to 10 p:g of genomic DNA were digested using the appropriate restriction digest enzyme. The DNA fragments were fractionated on a 0.90 % agarose gel, the gel was then treated for 10 min with a 0.1M HCI solution to break large fragments of DNA into smaller more transferable one and the DNA was then denatured using a 0.5M NaOH 1.5 M NaCl for 30 min. The DNA was then transferred by (using 10X SSC) and fixed (by vaccum-heat) onto a nylon membrane (Zetaprobe, Bio-Rad) as previously described (Sauvageau et al., 1995). Hybridization and washes as previously described in Maniatis at al (Sambrook. J, 1989) 68 2.2.6 Northern blots Genomic free RNA was isolated using RNAzol and following the recommendation provided by the manufacturer (Gibco). 10 (Lig (5|il) of RNA mixed with 8.7 u\l of loading buffer (6LI1 of formamide, 2LI1 of formaldehyde, 0.6LI1 of MOPS and O.ljxl of ethydium bromide (10mg/ml)) for each sample was then loaded onto a 1% agarose gel containing IX MOPS. 10X MOPS (84g. NaMOPS, 3.8 g. NaEDTA, 11 ml Glacial Acetic acid, top to 1 L with water). The gel was run for 2.5 hour and then transferred onto a nylon membrane (Zetaprobe, Bio-Rad) using 10X SSC as described above (Southern blot). Hybridization and washes as previously described in Maniatis at al (Sambrook. J, 1989) 2.3 Isolation of a novel HOXB3 cDNA in CD34+ BM cells library1 2.3.1 Construction of a human BM CD34+ cells cDNA library Human mononuclear bone marrow cells were obtained from vertebrae of a human organ donor and frozen in 7% DMSO after Ficoll-Paque separation (Pharmacia, LKB). When needed, cells were quickly thawed at 37°C and washed in Hank's buffered solution containing 2% FCS. CD34 + cells were then purified by positive magnetic selection using tetrameric anti-CD34 (8G10 hybridoma) antibody linked to dextran-iron particles as described (Lansdorp et al., 1990). After purification, cellular viability was 69% as 1 The CD34+cDNA library, the isolation of the HOXB3 cDNA and the cloning of HOXB3 intron 2 were carried out by a technician, Patty Rosten (chapter 4). 69 assessed by incorporation of propidium iodide (Sauvageau et al., 1995). A total of 3.4 x 10 viable cells were obtained and lysed in 5 ml of TRIzol (Gibco) as described by the supplier for RNA extraction. Total cellular RNA (110 jig) was resuspended in 200 jxl of DEPC-treated autoclaved water and polyA RNA was isolated using a polyA extraction chromatography column according to the supplier's recommendation (Messenger RNA Isolation Kit, Stratagene, La Jolla, CA, USA). A total of 4.3 |ig of polyA mRNA was obtained and precipitated overnight using 100 Lig of glycogen as carrier (Boehringer, Laval, Canada). Methylated first strand (5-methyl- dCTP) cDNA synthesis was prepared with random primers containing a Xhol restriction site (Stratagene) to be used later for unidirectional cloning. Second strand synthesis, generation of blunt cDNA ends, ligation of EcoRl adaptors, kinasing of EcoRl ends, digestion of methylated double-strand cDNA, size fractionation of cDNA (Sephacryl S-400), ligation into EcoRl-XhoI dephosphorylated Uni-Zap phage arms, packaging of the phage, infection, titration and expansion of the cDNA library was done according to the manufacturer's recommendations (Stratagene ZAP-cDNA synthesis kit). The library was maintained as 5 sublibraries (A to E) with -200,000 pfu per sublibrary. Background (i.e., empty phages) evaluated by X-gal staining was below 2%. 2.3.2 Isolation and characterization of a human HOXB3 cDNA In order to decrease the number of phage to be screened, a PCR-based strategy was used to identify which sublibraries contained potential HOXB3 cDNAs. 5 Lil of phage stock from sublibraries A to E (2 x 106 pfu/Lil) were added to 100 pi of a PCR solution containing 100 (aM of each deoxyribonucleotide (dNTP) together with 50 pmol of each 70 primer directed at a region immediately 5' to the homeobox sequence of HOXB3 (5'primer: 5 -GGCAGCAATGGCTTCGGCT-3 ' and 3' primer: 5'-TCAGCTTGGACGTTTGCCT-3' ) and 0.5 mM MgCl2 with 5 units of Taq polymerase (Gibco). Amplification was carried out for 40 cycles (30 sec. at 95,1 min. at 55 and 30 sec. at 72°C). An amplicon of 370 bp was detected in sublibrary E only. This sublibrary was plated (300,000 pfu) as suggested (Stratagene) at high density and duplicate nylon membranes (Zeta probe GT, BioRad, Hercules, CA) obtained by successive lifts. The two membranes were respectively hybridized to a probe representing bp 420 to 790 of the published human HOXB2> cDNA (accession number: XI6667) and to a full-length HOXB3 cDNA probe obtained by PCR amplification of cDNA obtained from K562 cells (coding region only, G.S. and unpublished results). Excision of a bluescript SK (+) plasmid containing the insert from a positive phage was carried out as recommended by Stratagene. After restriction mapping of the insert, a Sacl fragment of 1.6 kb representing the 5' portion of the cDNA was excised and subcloned into Bluescript KS. DNA sequence of this Sacl-Sacl subclone and the remaining 1.4 kb fragment was obtained using T3 or T7 primers with a series of deletions and primer walk (primer sequences available on request). All sequencing was performed by PCR with 3 5 SdATP as recommended by the manufacturer (AmpliCycle, Perkin Elmer, Branchburg, NJ). 71 2.4 Transcriptional assays using the CAT gene reporter assay 2.4.1 Isolation and characterization of the human and murine genomic DNA contained between exon 2 and exon 3 of HOXB3 Human genomic DNA (K562 cells) sequence corresponding to the region between the previously identified exon 2 and 3 of HOXB3 was amplified from DNA isolated from K562 by PCR using the Expand long template PCR system (Beohringer). Amplification was carried out in a 25 pj reaction containing dNTPs adjusted to 350 u\M, 15 pmol of each primer, and 5 pj of Boehringer buffer mix no.l and 0.75 pd of enzyme mix provided by the manufacturer. Conditions for PCR amplification were 30 sec. at 93, 1 min. at 60 and 1 min. at 68°C for 40 cycles. Primers used for these experiments were (5'->3', see Figure 2A): sense, T G A A A T A T A T A T T A T G T C T G C C T G T T C T (exon 2) and anti-sense, T C C C A A C T C T T C A C C A T C A C T T T T C A T (exon 3 a', position 71); exon 3 a', at position 500 (see above section); A C A A C A G C C T G A C C T A G A A A C T T C C T G (exon 3a, position 681) and exon 3b, at position 1304 (see section above). A PCR generated fragment of 1.77 kb obtained with the combination of sense and exon IIIa'-71 primers was subcloned into Bluescript KS (+) (Stratagene) and sequenced by PCR using automated sequencing (ABI, Perkin Elmer). Sequence comparisons between human and murine DNA were carried out using the G C G FASTA program. Since no sequence data from exon 2 were known in mouse, isolation of the corresponding murine genomic fragment was carried out using a 3' primer based on the human sequence and a 5' primer based on recently published murine sequence immediately flanking exon 3a (accession number: U022278). Primer sequences were as follow (5'->3'): sense, C G C G C T G - G G G C T C G A T G T G A A T A 72 and anti-sense, A T A C T C A C A A A A C A A T T T G A A C A C - T A T T . With these primers, a 2.0 kb fragment was obtained and then cloned in Bluescript and partially sequenced as described above. 2.4.2 Assays for testing transcriptional regulatory activity The genomic DNA between exon 2 and 3 and sub-fragments were tested for putative regulatory activity using the chloramphenicol acetyltransferase (CAT) gene reporter kit from Promega (Madison, WI, USA). HOXBS genomic sequence (bp 143-1730) between exon 2 and 3 was subcloned in pCAT-enhancer and pCAT-basic (promoter less) vectors as illustrated in Fig. 4.4 for promoter tests. Additional subfragments were subcloned into the pCAT-basic vectors using existing restriction enzymes sites in the 1.59 kb genomic DNA as well by PCR strategies. The details for the cloning are available upon request. The same fragments subcloned into the pCAT basic vector were also subcloned into the pCAT-promoter vector, in both possible orientations, to test for enhancer activity. The different constructs used for transfection were purified by cesium chloride gradient using standard procedure (Davis et al., 1994). Electroporation was used to transfect the cell lines. The electroporation conditions, using Gene Pulser (Bio-Rad), were optimized in K562 and HL60 cells using the pEGFP-Cl vector, a GFP-expression plasmid from Clontech (Palo Alto, Ca, USA) and FACS analysis to detect GFP+ cells 48 hours after transfection. Final conditions were set at 960 LiFa and 330 volts for a volume of electroporation of 800 ui for 4-5 xlO 6 cells in RPMI 1640 and 20 [ig of DNA: using 10 |ig of pEGFP-Cl DNA this yielded transfection efficiencies of 65 and 30% for K562 and HL60. Gene transfer efficiency was monitored by co-electroporation of pEGFP-Cl , at a 73 ratio of 5 to 1 for the C A T and GFP vector respectively, and subsequent flow cytometry. To measure C A T activity, cells were lysed using the lysis buffer supplied by the manufacturer (Promega). Assays were carried out as recommended by Promega's instruction with equal protein concentrations evaluated using the Bio-Rad Protein assay (Bio-Rad). Final products were separated by thin-layer chromatography using silica gel IB2 (J.T Baker Inc., Phillipsburg, NJ) as recommended by Promega. The intensity of the C A T derived signals were analyzed using a densitometer (Molecular Dynamics, model#PDSI-P90) and the software Image Quant supplied by Molecular Dynamics (Sunnyvale, Ca, USA). All C A T vectors were tested in a minimum of 3 independent experiments and values were normalized using the pCAT-promoter vector, containing the SV40 promoter (without an enhancer), which was set at a value of 1. 2.5 D N A sequence analysis The genomic DNA and cDNA sequences were entered into the G C G sequence analysis package (Devereux et al., 1984). Identification of putative transcription factor consensus sequences was done using FINDPATTERNS with TF Sites, from G C G , and also with Matlnspector (www.genomatix.gsf.de) (Quandt et al., 1995). Sequence comparisons were done using the Blast (basic 2.1) and Blast 2 sequences programs available at the NCBI web site (http://wvm.ncbi.nlm.nih.gov/BLAST/). 74 2.6 Analysis of transduced murine bone marrow cells in vitro and in vivo 2.6.1 cDNA constructs and retroviral vectors The NUP98-HOXD13 fusion gene was constructed by ligation of the 5'end of the NUP98 cDNA (kindly provided by J. Borrow, Massachusetts Institute of Technology, Cambridge, MA) to the Apal site upstream of the breakpoint region of the NUP98-HOXD13 cDNA fragment isolated from a patient with t-MDS (Raza-Egilmez et al., 1998). The 1.2 kb coding sequence of Meisl was kindly provided by G. Sauvageau, Montreal, Canada. The AHOXD13 construct, consisting of the conserved HOXD13 portion of the NUP98-HOXD13 fusion gene, was obtained from the NUP98-HOXD13 cDNA fragment by PCR (sense primer 5'-A G T C G G A T C C T T T A A C A A A T C A T T T G G A A C A C C C T T - 3 ' ; antisense primer 5'-A G T C T C T A G A T C A G G A G A C A G T A T C T T T G A G C T T - 3 ' ) and subcloned in frame 3 1 to the Flag-site of the pSC plasmid (Clonetech, Palo Alto, CA). The transactivation domain of VP 16 (Clontech, Palo Alto, CA) was fused to the AHOXD13 cDNA in frame by overlap PCR following standard procedures (same primers used as for AHOXD13). The 2.6-kb coding sequence of the NUP98 - HOXD13 fusion gene, the AHOXD13 and the VP16-HOXD13 cDNA were subcloned into the multicloning site of the M S C V 2.1 vector (kindly provided by Dr. R. Hawley, American Red Cross, Rockville, MD, USA) upstream of the internal ribosomal entry site (IRES) sequence from the E C M virus linked to the gene encoding an enhanced green fluorescent protein (EGFP, Clontech, Palo Alto, CA)(ND13, AD13 and VP16-D13 virus, respectively). As a control the M S C V vector carrying only the IRES GFP cassette (kindly provided by P. Leboulch (Massachusetts 75 Institute of Technology, Cambridge, Cambridge, MA) (GFP virus) was used. The Meisl cDNA was subcloned into the multicloning site of the M S C V 2.1 backbone with the enhanced yellow fluorescence protein (YFP, Clontech, Palo Alto, CA) as the selectable marker (Meisl virus). 2.6.2 Retrovirus production, BM infection and isolation of transduced B M cells 2.6.2.1 Mice and retroviral infection of primary bone marrow cells Production of high-titre helper-free retrovirus was carried out by standard procedures (Pawliuk et al., 1994), using high-titre supernatants from transfected amphotropic Phoenix packaging cell lines (Kinsella and Nolan, 1996) to infect the ecotropic packaging cell line GP +E86 (Markowitz et al., 1988). The presence of full-length provirus integrants or the integrated proviral copy number was determined by cutting the provirus twice with Nhel or once with EcoRI, respectively, followed by Southern blot analysis using standard techniques (Sauvageau et al., 1995). Expression of full-length NUP98-HOXD13 transcripts and Meisl transcripts was demonstrated by northern blot analysis of total cellular RNA, as described previously (Sauvageau et al., 1995). Parental strain mouse breeders were originally purchased from The Jackson Laboratory (Bar Harbour, ME) and subsequently bred and maintained at the British Columbia Cancer Research Centre joint animal facility. Donors of primary B M cells were > 12-week-old (C57Bl/6Ly-Pep3b x C3H/HeJ) F l (PepC3) mice and recipients were > 8 - 12-week old (C57B1/6J x C3H/HeJ) F1(B6C3) mice. Primary mouse B M cells were transduced as previously described (Kalberer et al., 2000; Sauvageau et al., 1995). Briefly, B M cells were harvested from mice treated 4 days previously with 150 mg/kg 5-flourouracil 76 (Faulding) and pre-stimulated for 48 hrs in D M E M supplemented with 15% FBS, 10 ng/ml hIL-6, 6 ng/ml mIL-3, and 100 ng/ml mSF (all growth factors expressed in COS cells and purified in the Terry Fox Laboratory). The cells were then co-cultured with irradiated (1500 cGy X-ray) GP+E86 viral producer cells in the same medium with the addition of 5 p:g/ml protamine sulfate (Sigma, Oakville, ON, Canada) (with NUP98-HOXD13/GFP or Meisl/YFP producers or with a mixture of 70% Meisl/YFP and 30% NUP98-HOXD13/GFP producers in co-transfection experiments). Loosely adherent and nonadherent cells were harvested from the co-cultures and cultured for 48 hrs in the same medium without protamine sulfate to allow expression of GFP or/and YFP. 2.6.2.2 Bone marrow transplantation and assessment of mice Retrovirally-transduced B M cells were highly purified based on expression of GFP or YFP or both fluorescent proteins using a FACStar (Becton Dickinson, Mississauga, ON, 137 Canada). Recipient F1(B6C3) mice were irradiated with 900 cGy of Cs y-radiation. B M cells were then injected into the tail vein of irradiated recipient mice. Peripheral blood cell progeny of transduced cells were tracked by expression of GFP or YFP or expression of both proteins. Engraftment and lineage differentiation were analyzed by aspiration of cells from the femurs of the mice under light anesthesia. Mice were sacrificed for analysis or diseased mice were euthanized. B M cells were obtained from both femurs and tibias and the total number of B M cells per mouse was calculated based on the recovered cells obtained from both femurs and tibias representing 25% of the total marrow. Single cell suspensions of the splenic hematopoietic cell population were prepared by passing the tissue through a pre-wetted nylon mesh (Becton Dickinson, New 77 Jersey, USA). The lineage distribution was determined by FACS analysis as previously described (25). Briefly, 100 jxl of cell suspensions was lysed with ammonium chloride (StemCell Technologies Inc (STI), Vancouver, BC, Canada). B M , spleen, or PB cells suspended at a density of 5-10 x 106 cells/ml in Hank's balanced salt solution (STI) with 2% FBS (HF) were incubated with PE - labeled antibodies on ice for 30 min, washed twice with HF, and resuspended in HF containing 1 u.g/ml propidium iodide (Sigma Chemicals, St. Louis, USA). Flow cytometric analysis was performed using a FACSort; cells were sorted with a FACStar flow cytometer. Monoclonal antibodies (MAbs) were all purchased from Pharmingen (PE-labeled Grl , Macl, B220, Terll9, Ly5.1). Morphological analysis of PB, B M and spleen cells was determined by staining cytospin preparations with modified Wright-Giemsa stain. For the histological analysis selected organs were fixed in a buffered 4% paraformaldehyde solution, dehydrated in ethanol, and embedded in paraffin for sectioning. Sections were prepared and H & E stained at the Academic Pathology Laboratory, University of British Columbia, Vancouver, using standard protocols. 2.6.3 In vitro and in vivo assay of transduced BM 2.6.3.1 In vitro assays Cell proliferation was assessed in D M E M supplemented with 15% FBS, 10 ng/ml hIL-6, 6 ng/ml mIL-3, and 100 ng/ml mSF by viable cell counting. Differentiation of clonogenic progenitors was analyzed by plating appropriate cell numbers in 1 ml methylcellulose culture media per Petri dish in standard conditions (MethoCult M3434, STI), containing 10 ng/ml rmIL-3,10 ng/ml rhIL-6, 50 ng/ml rmSF, and 3 U/ml rhEpo) after 8-10 days. 78 B M pre-B progenitors were detected by culture in methylcellulose media containing 10 ng/ml IL7 for 5 to 7 days (MethoCult M3630, STI). All colonies were scored microscopically using standard criteria. 2.6.3.2 In vivo assay- CFU-S assay Day 4 5-FU mobilized primary B M cells from F l (PepC3) donor mice were transduced with the different viruses and highly purified fluorescent protein positive cells isolated by FACS were cultured 7 days in D M E M supplemented with 15% FBS, 10 ng/ml hIL-6, 6 ng/ml mIL-3, and 100 ng/ml mSF. The day 0 equivalent of 1875 to lx l0 5 cells was then injected into lethally irradiated F l (B6C3) recipient mice. The recovery of CFU-S cells was quantified by determining the number of macroscopic colonies on the spleen at day 12-post injection after fixation in Telleyesnickzky's solution. 2.7 Statistical analysis Data were statistically tested using the t-test for dependent or independent samples (software STATISTICA 5.1, StatSoft Inc, Tulsa, USA) and Microsoft excel (Microsoft office 98). Differences with p-values < 0.05 were considered statistically significant. 79 CHAPTER 3 DIFFERENTIAL EXPRESSION OF HOX, MEIS1 AND PBX1 GENES IN PRIMITIVE CELLS THROUGHOUT HEMATOPOIETIC ONTOGENY2 3.1 Summary The Hox gene family of transcription factors is thought to be involved in the regulation of primitive hematopoietic cells, including stem cells and early committed progenitors. Here, we have investigated the expression pattern of these genes and two of their known co-factors, Pbxl and Meisl, in functionally distinct subpopulations of murine hematopoietic cells in the bone marrow and fetal liver (day 14.5). We found that Hox genes are preferentially expressed in hematopoietic stem cell enriched subpopulations and are downregulated following differentiation and maturation. This profile of expression was observed at both adult and fetal stages of hematopoiesis. The Pbxl and Meisl genes had important differences in their expression pattern, but were both detected in Hox expressing subpopulations. In particular, Meisl consistently showed an expression profile closely resembling that of Hox genes. Finally, using the in vitro embryonic stem cell differentiation model to mimic embryonic hematopoiesis, we found co-expression of Hox genes and their co-factors coincided with the appearance of hematopoietic progenitor cells. Together, these results further support the notion that Hox genes are involved in the regulation of early hematopoietic cells at all stages of hematopoietic ontogeny. Based on a manuscript soon to be submitted at the Journal of Experimental Hematology. "Differential Expression of Hox, Meisl and Pbxl Genes in Primitive Cells Throughout Hematopoietic Ontogeny" by; N. Pineault, C. D. Helgason, H. Jeffrey Lawrence and R. K. Humphries 80 3.2 Introduction Hematopoiesis is a highly complex and ordered process that involves the generation of a large spectrum of specialized end cells from a small pool of HSCs with self-renewal and multi-differentiation potential. Defining genes that initiate these processes during early ontogeny and/or are involved in the long-term regulation of hematopoiesis is of critical importance. Among intrinsic regulatory genes so far identified, a significant proportion are transcription factors. Some of these, such as Pu.l and GATA-1, show hematopoietic-restricted expression and activity as evident by the phenotypic abnormalities in knockout mice (Pevny et al., 1991; Scott et al., 1994). Another intriguing group of regulators are those first identified as important in early embryogenesis, and subsequently shown to be expressed and involved in the regulation of hematopoietic cells, such as the Notch (Carlesso et al., 1999; Singh et al., 2000), Wtn (Austin et al., 1997) and Hox homeobox genes (reviewed in (van Oostveen et al., 1999)). The class I Hox homeobox genes are a highly conserved family of transcription factors homologous to the homeotic gene clusters in Drosophila involved in cell fate-specification during development. In humans and mice, there are 39 Hox genes organized in four clusters (A, B, C and D) on different chromosomes (Acampora et al., 1989). The Hox genes are characterized in part by a well-conserved helix-turn-helix DNA binding motif of 60 a.a. referred to as the homeodomain (reviewed in (Krumlauf, 1994)). Roles for Hox in embryogenesis are well established, particularly in axial-skeleton, hindbrain and limb formation, as shown by in situ expression studies (Gaunt SJ, 1988) and developmental abnormalities seen in mice deficient for single or multiple Hox gene 81 (Davis et al., 1995; Horan et al., 1995). However, Hox genes are also found expressed in various adult tissues including hematopoietic cells (Barba et al., 1993; Watrin and Wolgemuth, 1993). Hox expression was first documented in leukemic cell lines of both myeloid and lymphoid origins (reviewed in (Lawrence and Largman, 1992)). Subsequently Hox genes were also found expressed in normal human bone marrow (BM) cells (reviewed in (van Oostveen et al., 1999)). Important clues to their potential roles have emerged from more detailed analysis of their expression pattern which revealed that members of the A, B, C but none of the D Hox genes were most highly expressed in highly purified subpopulations of human B M cells enriched in stem cells and primitive progenitors and their expression was extinguished or sharply reduced in latter cells (Sauvageau et al., 1994). In addition, several members of the Hox B cluster were shown to be upregulated following cytokine-induced differentiation of human B M progenitors in liquid culture (Giampaolo et al., 1994). In contrast to human, little is yet known about expression of Hox genes in murine hematopoietic cells, except for Hoxa9 which has been reported expressed in Sca-1+Lineage" (Lin) fraction of B M enriched for primitive cells, and not in more differentiated Sca-l"Lin + fraction (Lawrence et al., 1997). Such expression patterns strongly suggest that the Hox transcription factors play regulatory roles at the earliest stages of hematopoiesis. Additional support for this comes from results of engineered over-expression of several Hox genes in murine B M which reveal multiple effects upon hematopoiesis (reviewed in (Buske and Humphries, 2000)). Intriguingly, several of these studies point to Hox-gene specific effects. Thus for example Hoxb4 enhanced stem cell regeneration (Sauvageau et 82 al., 1995), Hoxb3 causes myeloproliferation coupled to impaired lymphopoiesis (Sauvageau et al., 1997) and other such as a9 or alO lead to frank leukemia (Kroon et al., 1998; Thorsteinsdottir et al., 1997). As observed for many transcription factors expressed in hematopoietic cells, the Hox genes and their co-factors have been linked to leukemia. In humans, HOXA9 and HOXD13 have both been directly implicated in A M L by their involvement in chromosomal translocations, t(7;ll) (Nakamura et al., 1996) and t(2;ll) (Raza-Egilmez et al., 1998) respectively, at their loci. Also, abnormal Hox gene expression patterns have been reported in leukemic cells of both myeloid (Kawagoe et al., 1999; Lawrence et al., 1995; Lawrence et al., 1996) and lymphoid (van Oostveen et al., 1999) origins. To gain further insight into Hox gene functions in hematopoietic cells, we have focused on the murine model. The mouse is a useful and commonly used model to explore Hox gene function but little is yet known about Hox gene expression in murine hematopoiesis. Moreover expression studies have to date focused on adult B M , and thus little is known about Hox expression in earlier ontogenic stages. Of exception, expression of Hoxb5, b6 and b7 have been reported in whole murine fetal liver from day 12.5 to 16.5, but the exact nature of the cells expressing these genes remain unsolved (Zimmermann and Rich, 1997). To address these issues, we have analyzed the expression patterns of selected members of the Hox and co-factor gene families in functionally distinct hematopoietic subpopulations derived from adult B M and from day 14.5 fetal liver cells. In addition, we have exploited the murine embryonic stem (ES) cell model to mimic the earliest stages of hematopoietic 83 development through in vitro differentiation. Our results reveal that multiple Hox genes are expressed in both fetal and adult hematopoietic cells. Moreover, at both stages, expression is most elevated in subpopulations enriched for primitive hematopoietic cells with down regulation or extinction in late maturing cells. Furthermore we show that Pbxl and Meisl, important co-factors for Hox functions, are both found expressed in subpopulations expressing Hox genes but also have important gene specific differences in their expression pattern throughout hematopoiesis. Finally, we observed up regulation of Hox genes and their co-factors in differentiating ES cells coincident with hematopoiesis and directly demonstrate their expression in an enriched hematopoietic cell fraction, thus supporting a role for Hox in the earliest stages of hematopoietic ontogeny. 3.3 Results Hox genes are preferentially expressed in murine subpopulations of both fetal liver and adult bone marrow enriched for primitive hematopoietic cells In utero, the principal site of hematopoiesis at day 14 (d 14) of embryogenesis is the fetal liver (FL). Subsequently the bone marrow becomes the main hematopoietic site in newborn and adult mice. We first examined the expression of selected Hox genes in 4 phenotypically distinct B M subpopulations from adult mice (age>3 months). The different fractions were purified using FACS and cell surface antigens commonly used to enrich for HSCs and primitive clonogenic progenitors (Spangrude et al., 1988). The Sca-1 + Lineage (Lin)" (B220", Gr-1", Mac-1", Ter-119" and Ly-1") fraction is comprised in part of pluripotent progenitors and has been shown by others to be highly enriched in 84 HSCs (Rebel et al., 1996). The Sca-1 + Lin + consists mostly of maturing cells and committed progenitors and has a much lower stem cell frequency than the previous fraction. The Sca-l"Lin + consists of mature cells such as granulocytes, and is relatively depleted of progenitors and HSCs. Finally, non-fractionated B M (TBM) was used as a control population consisting predominantly of late precursors and containing a low frequency of HSC (<1 in 16,000) and progenitors (Rebel et al., 1996). As expected the Sca-1+Lin" fraction, representing ~0.1% of total B M , was the rarest subpopulation while the Sca-1+Lin+ fraction had a frequency of 3.80 + 1.80% (SD) and Sca-l"Lin + cells composed the majority of B M cells (94.1 ± 1.90 %). Following cell purification, the fractions were functionally tested in vitro using the colony forming cell (CFC) assay. The highest frequency of clonogenic progenitors (number of colonies/number of plated cells x 100) was found in the Sca-1+Lin" fraction (3.98 ± 0.11% (SD)) whereas progenitors frequencies were 10 and 60-fold lower in the Sca-1 + Lin + and the Sca-l"Lin+fractions, respectively (data not shown). Because of the anticipated low level of Hox gene expression and the limited number of cells available for some enriched fractions, we used a global cDNA amplification technique and Southern blot analysis to investigate the expression of these genes. This technique has been used by a number of groups for similar studies (Kawagoe et al., 1999; Lessard et al., 1998; Sauvageau et al., 1994). Control experiments set up with mixtures of cells from the murine DA-ER line which expresses HoxalO and from the Ba/F3 line which does not, revealed a linear correlation between HoxalO expression and the number 85 Hoxa4, a5, bl, b2 and b4 as representative o f the 3 ' located genes, and Hoxa9, alO and b9 as representative o f 5 ' end located Hox genes. Number of DA-ER cells HoxalO Actin 12 o o > _ '4-* in ro — c 3 c >. 0 ro V) in a> n i_ 1-a ro X 0) G 0 0 ro ro X 0 I Figure 3.1 Linear correlation between A HoxalO expression and the number of HoxalO expressing cells in total amplified cDNAs A ) Southern blot analysis o f total ampl i f i ed c D N A s f rom m i x e d samples conta in ing Hoxa 10 g expressing ( D A - E R ) and non-expressing ( B a F 3 ) cel ls . V a r i o u s numbers o f D A - E R and B a F 3 cel ls were m i x e d , reverse transcript ion ( R T ) reactions was used to produce the complementary c D N A ( c D N A ) w h i c h were then ampl i f ied b y polymerase cha in reaction ( P C R ) and ana lyzed b y Southern blot technique. B ) E x p r e s s i o n of HoxalO relative to $-actin as a funct ion o f the number o f D A - E R ce l l s . The Southern blot intensity o f HoxalO for each m i x e d fraction was measured us ing a phosphoimager S T O R M 860 and no rma l i zed by the value found wi th B-act in. A r b i t r a r y units used on y -axis . E r r o r bars represent the S D , f rom the value obtained f rom 4 membranes obtained f rom one R T - P C R experiment. N o t shown are the negative cont ro l for each samples, w h i c h had not rece ived reverse transcriptase and were negative for both HoxalO and act in expression. Best-fit curve 5 10 Number of DA-ER cells (x103) 15 A s shown i n F i g . 3.2a and summarized i n Table 3.1, expression o f most Hox genes ranged f rom l o w to undetectable levels i n unfractionated B M . H o w e v e r , expression o f the same Hox genes was read i ly detected in the progenitor- and stem ce l l -enr iched Sca-86 As shown in Fig. 3.2a and summarized in Table 3.1, expression of most Hox genes ranged from low to undetectable levels in unfractionated BM. However, expression of the same Hox genes was readily detected in the progenitor- and stem cell-enriched Sca-1+Lin~ subpopulation. Expression levels were in comparison decreased in the HSC-low and -depleted subpopulations (Sca-1+Lin+ and Sca-l"Lin+). Of exception, Hoxbl was found expressed at similar levels in the Sca-1+Lin+, Sca-l~Lin+ and TBM cell populations. Hox expression was also assessed in purified late cell populations including monocytes/macrophages (Mac-1+), granulocytes (Gr-1+) and erythroid (Ter-119+) cells. Interestingly, Hoxbl and Hoxb4 were expressed in most myeloid fractions, such as Gr-1 and Mac-1 positive cells (Fig. 3.2b), whereas Hoxa4 and Hoxa5 could only be detected at low level in the most immature fraction, Gr- l l o w . The low levels of expression in Gr-1+ and Mac-1+ fractions are consistent with Hox gene expression in primitive hematopoietic cells and downregulation upon differentiation/maturation. Neither Hoxbl nor b9 were detected at significant levels in any of the bone marrow subpopulations tested (data not shown). 87 Figure 3.2 Hox gene expression in adult murine BM subpopulations isolated by FACS and analyzed by Southern blot of total amplified cDNAs Total amplified c D N A s were produced by R T - P C R from l x l O 4 cells as described in Material and Methods. Each sample with and without reverse transcriptase (RT + or -) was sequentially hybridized to specific probes. Results for a representative experiment are shown. A ) Expression of RT a4 a5 a9 alO bl b4 actin + S i j P9 + + H oo oo CO + - + - + + 0.02 0.13 0.22 1.0 HP 0.0 0.07 0.28 1.0 t 0.0 0.05 0.15 1.0 t 0.0 0.12 0.06 1.0 0.17 0.89 0.77 1.0 0.43 0.76 0.76 1.0 B RT a4 a5 a9 alO bl b4 actin —' CJ O £ o a S S H + . + . + . + . + . It • • Hoxa4, a5, a9, alO, bl and M in non-fractionated bone marrow ( T B M ) , H S C deprived (Sca- l"Lin + ) , low (Sca-1 + Lin + ) and enriched (Sca-1 +Lin") subpopulations. B ) Expression in subtraction of more mature B M cells expressing granulocyte ( G r - l , o w , G r - l h l g h ) , monocyte/macrophage (Mac-1 + , M a c - l h l g h ) and erythroid (Ter-119 +) markers. Table 3.1 Summary (n=3) of Hox gene expression in adult bone marrow cells. Summary (n=3) of Hox gene expression" in adult bone marrow cells. Sca-l+Lin" Sca-1+Lin+ Sca-l"Lin+ TBM a4 b 1.0 0.22 0.02 0.13 a5 c 1.0 0.20 ± 0.08 0.045 ± 0.045 0.11 ±0.04 a9 1.0 0.12 ±0.03 0 0.077 ± 0.03 alO 1.0 0.082 ± 0.047 0.008 ± 0.006 0.10 ±0.02 b l c 1.0 0.75 ± 0.02 0.91 ±0.74 0.445 ± 0.44 b4 1.0 0.50 ±0.22 0.34 ±0.073 0.32 ±0.22 a Expression normalized to actin and to the Sca-1 + Lin" subpopulation, ± S E M . b n = l c n - 2 88 In utero at day 14 the F L is the main site of hematopoiesis. H S C s derived from F L been have distinctive phenotypic and functional properties such as the expression o f the Mac-1 antigen and a higher repopulating capacity than their B M counterparts (Morrison et al., 1995; Rebel et al., 1996). Moreover, at this time in development the H S C s undergo a great expansion as evident by their higher proliferation status than B M H S C s (Rebel et al., 1996). It was thus of interest to determine whether Hox genes would be expressed and whether the pattern observed in adult B M would be conserved in the fetal liver dl4.5 stage o f hematopoietic ontogeny. The population examined included non-fractionated fetal liver (TFL) , the H S C enriched Sca- l+Lhr (Gr-1 ' , B220", Ly -1" and T e r l l 9 - ) fraction (Morrison et al., 1995), the S c a - 1 + L i n + fraction and the S c a - l " L i n + . A s shown in Fig. 3.3 and summarized in Table 3.2, Hox gene expression in F L subpopulations closely resembled that observed in B M . Most Hox genes were found expressed at their highest level in the F L Sca -1 + Lin" subpopulation, and at lower to undetectable levels in the Sca-1 + L i n + and unfractionated F L cells. A s previously seen in B M , Hoxbl was an exception being more broadly expressed. Figure 3.3 Hox gene expression in adult murine FL day 14.5 subpopulations isolated by FACS and analyzed by Southern blot of total amplified cDNAs Total amplified c D N A s were produced by R T - P C R from l x l O 4 cells as described in Material and Methods. Each sample with and without reverse transcriptase (RT + or -) was sequentially hybridized to specific probes. Results for a representative experiment are shown. j RT H oo oo -1- — -t- — 4- — a4 T T — T — • a9 alO b l • | b4 actin • •• 89 From these results we conclude that Hox genes from cluster A and B are preferentially expressed in the primitive cell fraction in B M and FL hematopoietic cells, and that their expression is significantly decreased upon differentiation/maturation of multipotent progenitors and HSCs. Interestingly, low but detectable levels of Hoxbl and Hoxb4 expression persisted into more mature B M fraction (e.g. Sca-l"Lin+ and G r - l H l g h ) in which expression of Hox A genes were extinguished. Table 3.2 Summary (n=2) of Hox gene expression in fetal liver day 14.5 cells. Summary (n=2) of Hox gene expression3 in fetal liver day 14.5 cells. Sca-l+Lin" Sca-1+Lin+ Sca-l"Lin + b ~zA* LO (X54 ND" a9 LO 0.14 ±0.08 0.05 alO 1.0 0.28 ±0.19 0.05 b l b 1.0 0.46 4.90 b4 1.0 0.37 ±0.31 0.31 a Expression normalized to actin and to the Sca-1+Lin" subpopulation, ± SD. b n=l Expression of Hox gene co-factors Meisl, Pbxl and Pbx2 in hematopoietic subpopulations Hox gene functions are regulated in part through interaction with co-factors belonging to the Pbx and Meis families of class II homeobox genes (Schnabel et al., 2000; Shen et al., 1996). Pbxl, which interacts with Hox proteins from paraiogue groups 1 to 10, was identified through its involvement in pre-B leukemia, as part of the E2A-Pbxl fusion gene associated with t(l;19) (Jonveaux and Berger, 1991; Shen et al., 1996). Meisl, which interacts with Hox from group 9-13, was identified in the BXH-2 mice strain based on its 90 capacity to cause A M L along with overexpression of Hoxa7 or Hoxa9 (Nakamura et al., 1996; Shen et al., 1997). To date, little is known about the expression of Meisl and Pbx genes in hematopoietic cells. Given their association with Hox gene functions (Bromleigh and Freedman, 2000; Chang et al., 1996) and leukemias (Krosl et al., 1998; Thorsteinsdottir et al., 2001), we analyzed the expression of 3 representative genes in various B M and dl4.5 FL hematopoietic fractions. Consistent with their function as Hox co-factors, Pbxl, Pbx2 and Meisl like Hox genes were all found expressed at their highest level in the Sca-1+Lin" fraction, in both B M (Fig. 3.4a) and FL (Fig. 3.4b). In contrast with Hox genes, the Pbx genes were readily detected in the more mature Sca-1 + Lin + and Sca-l"Lin + fractions . Significant differences between Meisl and Pbxl expression profiles were also apparent. In contrast to Pbxl, Meisl expression in adult B M and FL was strongly reduced in Sca-1 + Lin + and undetectable in Sca-l~Lin + subpopulations. Furthermore, Meisl expression in myeloid cells was higher in the G r - l l o w compared to the G r - l h l g h fraction as observed for most Hox genes but, contrary to Pbxl (Fig. 3.4c). Altogether, these results demonstrate co-expression of Hox and co-factor genes in hematopoietic subpopulations but also reveal differences in Pbxl and Meisl expression, consistent with possible Hox independent roles for Pbxl. 91 Figure 3.4 Expression of Pbxl, Pbx2 and Meisl in functionally distinct hematopoietic subpopulations. Southern blot analysis shown, see Figure 1 and 2 for more details. Results for 1 representative experiment are shown. A) In adult bone marrow, B) fetal liver day 14.5 cells and C) myeloid and erythroid committed B M cells. B RT i s i S 00 t-l 00 00 +- +- +- +-RT + TFL + in + + , + + OO 00 . + - + -Pbxl l 1 : 1 Pbxl • • Pbx2 • • • Pbx2 Meisl • Meisl 1 Actin • • • • Actin • • • • c i i ta ca o a S S RT + - + - + - + . Pbxl Meisl actin | • I • M 1 • •• • -Onset of Hox gene expression coincides with the appearance of hematopoietic cells in differentiating embryoid bodies In an effort to look at earlier stages of hematopoietic ontogeny, we exploited the ES in vitro differentiation model. Following removal of leukemia inhibiting factor and under appropriate conditions, ES cells undergo spontaneous differentiation forming embryoid bodies (EB) which consist in part of hematopoietic precursors and progenitor cells. The emergence of hematopoietic activity in the developing EBs parallels that observed of hematopoiesis in the developing embryo (reviewed in (Keller, 1995)), from primitive hemopoiesis, as shown by the presence of nucleated erythrocytes and expression of fetal globin (J3-H1), to definitive hematopoiesis as observed by enucleated erythrocytes expressing adult B-globin and the appearance of various myeloid progenitors. This model 92 thus provides an avenue to explore possible roles of Hox genes in the regulation and/or establishment of embryonic hematopoiesis. None of the 6 Hox genes examined were expressed at significant levels in undifferentiated ES cells, as shown in Fig. 3.5a. However, by day 5 of differentiation Hox a4, a5, alO, bl and b4 were found expressed and their level peaked by day 13 for all, except b4, which peaked at day 9 (Fig. 3.5a, 3.5b). Of exception, Hoxa9 was not found expressed at significant level. The Pbxl, Pbx2 and Meisl genes were also found up regulated during EB formation, with Pbxl and Pbx2 detected as early as day 5 and Meisl at day 9. The increased levels of Hox gene expression also correlated with the expression of hematopoietic-specific genes within the EBs, as shown by the up-regulation of GATA-1 and of globin gene switching from high level B-Hl expression over day 5 to day 9, to adult P-globin expression from day 9 and onward (Fig. 3.5b). The expression of hematopoietic genes also correlated with the hematopoietic progenitor content observed in the developing EBs with only primitive erythroid progenitors at day 5; the appearance of G M , definitive erythroid and multilineage progenitors at day 9; and an increased proportion of myeloid progenitors at day 13 and 17 (Table 3). Thus there is a close correlation between the onset of Hox gene expression in EB development with the appearance of hematopoietic cells. 93 Figure 3.5 Hox gene expression in undifferentiated ES cells and differentiating EB A) Southern blot analysis of total amplified cDNAs from undifferentiated ES cells and differentiating EBs. Total cDNAs were amplified using RT-PCR from 1.5 xlO 4 cells as described in Material and Methods. Each sample with and without reverse transcriptase (RT + or -) was sequentially hybridized to specific probes as indicated. B) Expression of Hox, Pbxl, Meisl, B-Hl, B-globin and GATA-1 as a function of time in ES cells and differentiating EBs (next page). Expression level relative to actin is shown as a percentage of the maximum level observed over time course. The Southern blot intensity for each gene and subpopulation was measured using a phosphoimager STORM 860 and normalized by the value found with B-actin probe. Arbitrary units used on y-axis. (n=l) A • g - n -0 >, >, >N -CO b « PJ Q Q Q Q D RT + - + - + - + - + - + - + -Hoxa4 Hoxa5 1 • HoxalO | | | • Hoxbl • Hoxb4 ft 1 Meisl • • • i 1 Pbxl H I • Pbx2 PH-1 l • ft P-Globin 1 1 Actin I I I ! 1 • i To more specifically assess gene expression in hematopoietic cells following ES differentiation, we used the c-Kit receptor to positively enrich for hematopoietic progenitors in day 9 EB cells. The overall frequency of hematopoietic clonogenic progenitors in the c-Kit + fraction, representing 8.1% of day 9 EB cells, was more than 17 fold higher than that of c-Kit" cells (Table 3.3). Interestingly, all Hox genes, Pbx2 and Meisl were found expressed at higher level in the day 9 EB c-Kit + cells (Fig.3.5a) compared to the c-Kit" fraction. In contrast, Pbxl expression was higher in the c-Kit" fraction. Thus these results demonstrate that multiple Hox genes are expressed in early hematopoietic cells derived from differentiating EB and are consistent with a role in the regulation of hematopoiesis and possibly in its early establishment. 94 Fig.3.5b Table 3.3 Hematopoietic clonogenic progenitor frequency in EB cells Frequency in %, ± SD calculated from the duplicate plating of the cells, (n-1) Erythroid G M G E M M Total Day 5 0.56 ± 0.02 a 0 0 0.56 ± 0.02 Day 9 0.33 ± 0.05 b 0.11 ±0.03 0.03 ±0.005 0.47 ± 0.03 Day 13 0.54 ± 0.05 c 0.31 ±0.04 0.02 ±0.01 0.87 ±0.10 Day 17 0.04 ± 0.005 c 0.93 ±0.08 0.02 ±0.01 0.99 ± 0.06 Day 9 c-Kif 0.036 + 0.005 0.01 3 ±0.007 0.001 ±0.002 0.050 ±0.011 Day 9 c-Kit+ 0.650 ±0.165 0.783 ±0.071 0.033 ±0.001 0.867 ±0.236 a Al l primitive erythroid progenitors b Include the sum of both primitive and definitive erythroid progenitors c Al l definitive erythroid progenitors 3.4 Discussion As a step towards understanding the role of Hox genes in hematopoiesis, we have explored the expression of multiple Hox genes from the A and B cluster and their co-factors at different stages of hematopoietic ontogeny. Hox genes were found preferentially expressed in the most primitive subpopulation at both adult and fetal stages of hematopoietic development, suggesting key roles for Hox genes in primitive hematopoiesis throughout ontogeny. This is reinforced and extended by the discovery that Hox gene expression is upregulated concurrent with the onset of hematopoiesis in forming embryoid bodies. This latter observation further suggests that Hox genes may play roles in early development of the hematopoietic system. These findings together with the documentation of similar expression patterns for several Hox co-factors, belonging to the Pbx and Meis families, provide an enlarged framework for future functional studies. Hox genes from the A and B clusters were both found expressed at their highest level in the subpopulation enriched for HSCs and progenitor cells and reduced by several fold (up to 12 fold) in fractions composed of more differentiated cells. However, in contrast to Hox A genes, Hox B genes were also found expressed in B M fraction comprised of more mature myeloid cells in which expression of Hox A genes was not detected. These results thus suggest possible divergent lineage- or stage-specific functions for these genes in the regulation of hematopoiesis. This pattern of preferential Hox gene expression in primitive hematopoietic subpopulations strikingly parallels results from human adult primitive B M subpopulations (Sauvageau et al., 1994). Extension of these observations to the murine 96 model and to both adult and fetal stages of hematopoiesis strongly reinforce a model in which these genes play key roles in the regulation of primitive hematopoietic cell properties. Our expression analysis failed to reveal any 3'—» 5' (3' Hox genes such as HOXB3 are extinguished earlier than 5' genes such as HOXA10) wave of Hox genes inactivation following differentiation of the most immature fraction into more mature fractions as observed by Sauvageau et al. in human CD34 + cells (Sauvageau et al., 1994). This may be due in part to a further fractionating of the HSC compartment as done in their studies and/or the relative purity and content of HSC enriched human vs murine subpopulations. The observed co-expression of multiple Hox genes (6 out of 8 examined) in primitive murine hematopoietic cells along with similar findings in human studies (Moretti et al., 1994; Sauvageau et al., 1994) highlight a probable complex combinatorial role of Hox genes in the regulation of hematopoiesis. Since these analyses were not carried out on single cells, some of this complexity might represent heterogeneous expression patterns within the subpopulations examined. However, co-expression within hematopoietic cells is consistent with co-expression seen in embryonic development (Dolle et al., 1989; Graham et al., 1989) and also documented in cloned hematopoietic cell lines (Celetti et al., 1993; Magli et al., 1991). This raises intriguing questions as to what extent the different Hox genes confer unique versus overlapping functions. A degree of functional redundancy, particularly for members belonging to the same paralogous group has been documented for several Hox genes (Greer et al., 2000; Horan et al., 1995) and led to a proposed "additive model" for Hox gene function during embryogenesis (Davis et al., 1995; Rancourt et al., 1995). The latter was proposed following the discovery of more 97 severe homeotic mutations in paralogous Hox compound knockouts mice and new mutations which were not observed in the single knockout mice. The relative paucity of hematopoietic abnormalities so far documented or reported in single Hox knockout mouse models may thus reflect compensation/complementation by other expressed Hox genes. Overlapping function might also exist between members within a cluster (Rancourt et al., 1995) and thus examination of compound knockout within a cluster and/or paralogue knockout mice (eg. mice with complete deletion of a Hox paralogue group) will be of interest and may exhibit more severe hematological anomalies. Another possibility is that some Hox genes have evolved with more important functions in the regulation of hematopoiesis, the loss of such genes would then be expected to have more severe abnormalities, such as Hoxa9 null mice (Lawrence et al., 1997). Given the large number of Hox genes from the A - C cluster potentially expressed in hematopoietic cells, the combination of those expressed ("Hox code") may ultimately determine the functional outcome on hematopoietic cells. Taken together, our data suggest that multiple members of Hox genes have regulatory roles in primitive hematopoietic cells. One interesting possibility is that they act to enhance the proliferation/self-renewal of primitive cells perhaps in part by impairing differentiation. Results from overexpression studies in the murine model and recently the human model are consistent with such a model. Thus for example, overexpression of several different Hox genes including Hoxb3, B7, A5, a9 and alO are associated with myeloproliferative responses and varying overt blocks in differentiation (Care et al., 1999; Crooks et al., 1999; Kroon et al., 1998; Sauvageau et al., 1997; Thorsteinsdottir et al., 1997). Hoxb3 and alO for example are both associated with impaired B lymphocyte 98 development, but HoxB3 also leads to a major block in early T- lymphocyte development and HoxlO block macrophage progenitor development. Hoxb4 on the other hand appears to have a restricted effect on enhancing the proliferation of early cells, including HSC, but does not alter differentiation profiles (Sauvageau et al., 1995). Hoxa9 deficient mice in contrast have reduced hemopoiesis, particularly under certain stress conditions and have markedly impaired HSC regeneration capacity (Lawrence et al., 1997; Mamo et al., 1999). Thus, Hox genes could potentially, directly or indirectly, regulate HSC self-renewal and/or differentiation, or simply shelter HSCs from differentiation. Hox gene mediated regulation of proliferation is further supported by the recent demonstration that HOXA10 can directly upregulate the cyclin kinase inhibitor p21 in U937 cells (Bromleigh and Freedman, 2000). Thus, these studies and our expression analysis support a model in which downregulation of Hox genes is required for normal hematopoietic differentiation/maturation program to occur. In addition to the preferential expression in primitive hematopoietic cells, intriguing gene-specific differences in expression pattern were also observed. Most notably, of all Hox genes looked at, Hoxbl showed the largest spectrum of expression in hematopoietic cells, suggesting that Hoxbl might have a special role in hematopoietic cells. Interestingly, HOXB1 was also reported to be the only member of the HOXB genes found expressed in non-activated human NK and T cells (Care et al., 1994; Quaranta et al., 1996). In contrast to Hoxbl, both Hoxb2 and Hoxb9 were undetected in all subpopulations and these results are consistent with those showing no or very low level of expression for these two genes in non stimulated human progenitors cells (Giampaolo et al., 1994). 99 As previously mentioned, Hox proteins do not bind with high affinity and specificity to DNA but this is rather achieved by the formation of heterodimers and trimers with co-factors from the Pbx and Meis gene families (Chang et al., 1995; Mann and Chan, 1996; Schnabel et al., 2000). Consistent with this model, we found Pbxl and Meisl also expressed at their highest levels in the most primitive subpopulations in both BM and FL, as observed with Hox genes. However, Pbxl was also detected in more mature subpopulations in which Hox genes were poorly expressed suggesting possible Hox-independent functions. It should be noted that the probe used to detect Pbxl recognized both isoforms, i.e. Pbxla and Pbxlb and thus whether the different isoforms are differentially expressed at the level of primitive versus more mature cells remains undetermined (Monica et al., 1991). In contrast to Pbxl, the expression pattern of Mesil closely matched that observed for Hox genes in BM, FL and differentiating ES cells. These results are consistent with Meisl playing a major role in normal hematopoiesis as a Hox co-factor, which is further supported by the reported aberrant expression of these genes in AML cells (Afonja et al., 2000; Kawagoe et al., 1999; Lawrence et al., 1999) and the strong inducing effect of Meisl on Hox-leukemogenesis in mice (Kroon et al., 1998; Thorsteinsdottir et al., 2001). The functional consequence of the interaction between these three gene families is highlighted by the recent demonstration that trimer formation is required for Hoxa9 induced immortalization of myeloid progenitor cells (Schnabel et al., 2000). Altogether, these suggest that Hox gene functions in hematopoiesis could be modulated at different stages by the presence of Meisl alone, Pbxl alone or with the presence of both. 100 In this study we have also used the ES differentiation model as an approach to assess the expression of Hox and co-factor genes in the earliest stages of hematopoiesis development (Elefanty et al , 1997; Keller et al., 1993). Coincident with the appearance of progenitors and hematopoietic cells in differentiating EB, was the upregulation of multiple Hox genes along with Meisl, Pbx2 and Pbxl. In addition, expression levels were found higher in the hematopoietic clonogenic progenitor-enriched c-Kit + fraction of day 9 EB cells, providing further direct evidence for a role of Hox gene in early stages of hematopoietic development. These results provide further impetus to study the possible involvement of Hox genes in the establishment of hematopoiesis. Additionally, these findings further support the use of the ES differentiation model to functionally characterize Hox genes as previously reported with Hoxb4 and the non clustered Hox genes Hoxll, both of which perturbed hematopoiesis in differentiating ES cells (Helgason et al , 1996; Keller et al., 1998). In conclusion, these gene expression analyses have revealed that the Hox gene expression program is conserved between the FL and adult B M stages of hematopoiesis. The observed preferential expression of multiple Hox genes in primitive populations at different stages of hematopoietic development reinforces the hypothesis that these TFs are potent regulators of HSCs and multipotent progenitors. Finally, our results employing the ES model suggest a possible involvement for these genes in the establishment and/or regulation of early embryonic hematopoiesis. 101 CHAPTER 4 A NOVEL HOXBS TRANSCRIPT AND TRANSCRIPTIONAL REGULATORY REGION IDENTIFIED AND CHARACTERISED IN HUMAN HEMATOPOIETIC CELLS 3 4.1 Summary The Hox gene family of transcription factors has been implicated in the regulation of normal hematopoiesis and leukemogenesis in addition to its known roles in early embryonic development. An intriguing aspect of Hox genes is their preferential expression in hematopoietic subpopulations enriched for progenitors and stem cells suggesting that they are involved in the regulation of the earliest stages of hematopoiesis. Here, we report the cloning of a novel human cDNA for HOXB3 from purified CD34 + bone marrow cells. This cDNA derives from a transcript with a unique 5' untranslated region encoded by genomic DNA immediately adjacent to the previously described exon 3. Sequencing of genomic DNA upstream of this new 5' UTR revealed well-conserved putative binding sites for a number of hematopoietic transcription factors including GATA-1, STAT members, H O X and PBX. Functional characterization of this region led to the identification of a novel HOXB3 transcriptional regulatory element in intron 2 with enhancer-like properties when tested in hematopoietic cell lines. The 3' region of this element confers erythroid- specific activity whereas the 5' region has strong non-specific transcriptional activity. Our results delineate a novel HOXB3 enhancer that provides new insights into the Hox gene regulation in hematopoiesis. 3 Based on a manuscript recently submitted to Journal of Biological Chemistry. "A Novel HOXB3 Transcript and Transcriptional Regulatory Region Identified and Characterised in Human Hematopoietic Cells" By; Nicolas Pineault, Guy Sauvageau, Patricia Rosten, Terry Thomas, Peter M . Lansdorp, and R. Keith Humphries. Construction of the cDNA library, isolation of the HOXB3 transcript and HOXB3 intron 2 was done by P. Rosten. 102 4.2 Introduction The Hox genes are a family of evolutionary conserved TFs implicated in the regulation of embryogenesis (Mathews et al., 1991) as well as regulation of multiple adult tissues including hematopoietic cells. In man and mouse, there are 39 Hox genes found in four different clusters (A, B, C and D). Multiple members of the A, B and C clustered Hox genes, including HOXB3, are preferentially expressed in human HSC enriched subpopulations in the bone marrow. Some Hox genes have been directly linked to leukemia through their observed involvement in chromosomal translocations (Nakamura et al., 1996; Raza-Egilmez et al., 1998). Abnormal expression of numerous Hox genes has also been documented in leukemic patients (Kawagoe et al., 1999). Retrovirally engineered overexpression of specific Hox genes such as HOXB3 in bone marrow transplantation models has also been shown to result in severe perturbation of hematopoiesis (Lawrence et al., 1996) including induction of myeloproliferation and ultimately leukemia, suggesting that regulated expression is required for normal hematopoietic development. HOXB3 has attracted our interest since its expression is restricted to very primitive bone marrow cells. More specifically, HOXB3 is expressed at high level in the stem cell enriched CD34 + CD38 l o w subpopulation, downregulated in differentiating CD34 + cells and extinguished in stem cell depleted CD34" B M cells (Sauvageau et al., 1994). This suggested to us the presence of hematopoietic stem cell-specific regulatory elements in the promoter and or enhancer region of this gene. Studies focused on expression and regulation of Hox genes in early embryonic development have revealed a complex network of cis-acting promoter and enhancer 103 elements throughout the Hox clusters (Duboule, 1998; Patel et al., 1999; van der Hoeven et al., 1996). This is in part believed to be responsible for the so-called spatial-temporal colinearity of expression found for Hox genes in developing embryos, along the anterior-posterior axis (Duboule and Dolle, 1989; Graham et al., 1989). Hox gene promoters have been characterized with and without a classical T A T A box motif (T. Kondo, 1992; Vieille-Grosjean and Huber, 1995). Moreover, some Hox genes have been shown to have more than one promoter. For example, a second HOXA9 promoter has recently been identified and characterized in endothelial cells. Interestingly this promoter gives rise to a novel HOXA9 transcript, containing a novel exon specific to endothelial cells (Patel et al., 1999). The novel promoter was isolated directly upstream of the new exon, which is, located 3.7 kb downstream of the originally defined HOXA9 first exon. Enhancers have also been identified as critical elements in the regulation of Hox genes throughout embryogenesis (Duboule, 1998). Such enhancers have been localized within introns, upstream and downstream of the Hox genes and in many instances may be shared between Hox genes (Gerard et al., 1996; Gould et al., 1997). Some of these enhancers have been shown to be tissue specific while others appear to be used in multiple tissues. Hoxb4 for example has been shown to contain an intronic enhancer mediating proper expression in the mesodermal and posterior neural domain and also a second enhancer located downstream of its polyadenylation signal, regulating anterior neural expression. This latter enhancer is also shared with its neighboring gene Hoxb3 (Whiting et al., 1991). The transcriptional regulation of Hox genes in hematopoietic cells remains poorly defined to this date. One published study described the binding of GATA-1 to the HOXB2 promoter in the K562 erythroleukemic cell line with the resultant up-regulation of the 104 HOXB2 promoter (Vieille-Grosjean and Huber, 1995). More recently, a 97 bp fragment containing the HOXB4 promoter has been characterized that can be positively activated (3-8 fold) following stimulation of cells by hematopoietic cytokines favoring self-renewal (Giannola et al., 2000). Together, these reports support the possibility of hematopoietic-specific transcriptional regulatory domains in Hox genes. Here we report the identification of a novel HOXBS cDNA that was isolated in a hematopoietic library prepared from human bone marrow CD34+ cells enriched for primitive progenitors and stem cells. This cDNA corresponds to a transcript not previously recognized that contains a longer 5' untranslated region, comprising a 1.2 kb sequence directly upstream of the previously defined exon 3 but is otherwise 100% identical in its coding region to the published HOXBS sequence. Genomic DNA adjacent to this novel transcribed region was sequenced and analyzed. Numerous putative hematopoietic transcription factor-binding sites and a TATA box were found. The functional search for possible regulatory roles for this DNA region led to the discovery of a previously unrecognized HOXBS transcriptional regulatory element that is active in hematopoietic cells and shows preferential activity in erythroid cells. 105 4.3 Results Isolation of a novel HOXB3 cDNA from CD34+ human bone marrow As part of a continuing effort to characterize Hox gene expression and function in hematopoietic cells, we screened a human hematopoietic cDNA library prepared from CD34 + bone marrow (BM) cells for potentially novel HOXB3 transcripts. A single HOXB3 cDNA clone containing an insert of 3.1 kb was isolated following screening of -200,000 plaques and subsequently sequenced (Acc. U59298). A schematic representation of this sequence in comparison to the previously described cDNA from human embryo and proposed genomic structure is shown in Figure 4.1a. The cDNA recovered from B M CD34 + cells had 100% sequence identity throughout the predicted coding sequence contained in exons 3 and 4 as originally reported for the transcript isolated from a human teratocarcinoma cDNA library. Major differences were however observed between these 2 transcripts in the 5' UTR. This region is short and composed of sequences from exons 1 and 2 and part of exon 3 (indicated as exon 3b in Fig. 4.1a) in the transcript from embryonic cells. In contrast, the HOXB3 cDNA from CD34 + bone marrow contained some 1.27 kb of sequences 5' to the putative A T G initiation codon; moreover this extended 5' UTR (Fig. 4.1b) did not contain sequences from exons 1 or 2. Based on sequence identity (77% identical), the first 270 bp immediately 5' to the translation initiation sequence in the CD34 + B M HOXB3 cDNA correspond to 270 nt of novel sequence immediately 5' to exon 3b reported in a murine transcript by Sham et al (1992) and referred to as exon 3a (see Fig. 4.1a). This finding suggested that at least part of the sequence found in the long 5' UTR of the clone isolated from our cDNA library was 106 contiguous to exon 3 a since no evident splice donor-acceptor sites were found at the 5' end of exon 3 a. Further evidence that all of the sequence found in the 5' UTR is contiguous to exon 3 (a and b) was obtained by using genomic DNA and specific primers for exon 2, 3 a, and 3b, with the PCR product matching the expected size. Final confirmation that the entire 5' UTR of the novel B M transcript is derived from genomic DNA directly upstream of the previously described exon 3 a, was obtained by comparing the 5 'UTR sequence to the newly released genomic draft sequence of HOXB3 (Acc. AC009789), which revealed over 97% identity over the entire sequence with no gap in the 5'UTR compared to the genomic sequence. The remaining sequence of 1002 bp present in the novel transcript and upstream of the previously described exon 3a contains two putative splice sites and will be referred to as exon 3 a'. Thus, this human bone marrow derived HOXB3 transcript represents a novel transcript or a longer human version of the murine transcript previously described by Sham et al. (1992). The latter mRNA was identified in a murine embryo day 8.5 dpc cDNA library and appears to initiate several kilobases downstream between exon 2 and 3, from promoter 1 (PI), as depicted in Fig. 4.1a (Sham et al., 1992). The CD34 + B M transcript could be generated either by alternative splicing occurring in a previously unrecognized exon and/or be initiated from a different promoter than that reported for the human teratocarcinoma-derived HOXB3 message, which is initiated from P2, upstream of exon 1 (Acampora et al., 1989). 107 1 G C T G A A T G A G A T T A A A G T T T T C C A A A C A C A C A T G A C A G T A T G G A G G T T T T A T G A A A A G T G V 61 A T GGT GAAGAGT T GGGAGAGAT GGAGGGAAAAAAAT GC AGT CAGAAGTT T C A G A A C A A A T 121 A C A C A A A A T C C T A T G T T A G T T T G A A T C T T T A T T T T T C T G G C A C A C T T T T A A A A G G C T G T A 181 T T A A A A T A G T G A T T T T T T T T T T T T T G C C T C A G G G A A C C T C A G T C A A C A G G A A T A C C T C T G 2! 241 T T T C T A A C C T A G A G A A T A A T A T T G T T A A A A T T G C T T T G T T A A T T T T T T T T T C C T C A G G A A 9 301 T A A T T T T C T C T T T T G G A A A G C A C T T T C C C C G T C T C A G T A G A A A A G T C T A G C A G T T G T A A C % 361 T T C T T G T T T C T T A T T T G C T T T G G G G G A A A T C A A A G A A A A C A G A C G G T G A A G G A A G G G T G G C 421 GAAAAT TAAGT C T CAT GAAAAAAAAAAAAC AGGT C C GGGAGAGAC C T GGC CAAAT GT CAC % 481 AGC AC C A A C T GC GT GC C C AGAAAT T GAC AC A A T C C T GCT C C A T GT GGGGC C C C A C AGGGC g Kpnl 1 541 CACTGGCTGCCCGATCCCAG£XTTGGCTGAGCAAACACAAGGGCTGGAGGTGGTGGTACC O . 601 TGC AGC AGGGC C A T G G A C A G A T G A G T C T C G G T T C A G C T G G C T C T T G A G G T T A A A A A T C A T ^ 661 C AGGAAGT T T C T AGGT C AGGC T G T T G T T G T C T T C C T GGT GGGAGAGT GGT GGGAAGT GGA § 721 G A G G A T A C C T C A C A A G A G A A G C T T C T C T G C T G A A C T T G C T T C T C C T G C C T G T T G C T T T T A ^ 7 81 G G A G A C C T T T G G T T T T C C T T C A G G C T A G A C T T T G C T T G G G C A A G A G A C C T A A A C C G A C T T 8 41 GGAAGGAGGCAAAGGCTGGAAGCATAGAAGCCTCTGGGCTCAGAGGAGGGTGTTGATGAT 901 G C T T T T A T T T T G G A G T C T C C T A G T G T C C C C T C C C T T G A G C C A T C C T A T C C C A G A G T T G G G J GAGGAGAGATGGACGAGAGGGACTAGGGGAGGCTCAGGGGCTAGTGCACAGGCAGGCACG " 961 1021 AGAAC GGC A A T GGC C T T T G C C A C TAGAT T C T A C AT C T AGGC AGT C T T GAAAGGCATAT A G | g 1081 T C T T T A T T T A T T T T T T T A T T T T T T A G T G G A A A T G A A A A C T G G T G G G C T T T T T T T T C T C A G 1141 C A T C T G C T T T G G A G A T G T T G G G G A G G G G A A A A G A A A A A A C C C T A T T G A T G T C A G T T C C C T 1201 T T T C A G T T C C T A A G A T G G A T T C G A G C C C C A G T C C T C T T C T C C C C C T T G T G T C T C T T C T C T 1261 C GC C T C GC AGGT C AGC C GC T T GGAAC AGAC C CC GGAGGAGGGGGGC AGAGAGGGGAGGT G 1 W 1321 GGGGGGGGGGGGTCCGGCGTGTCACGTGACCCCCAGGGTTGCCAATGTCCGGTCCTGAGG ! g 1381 G T A T C A G G C C T T T C C A A G T T G C C A C C C A C T G C C C A G G C C T C A C C C A G C G A T G C A G A A A G C j £ M Q K A Figure 4.1 Structure and alternative transcripts from the human HOXB3 gene. A) Genomic organization and comparison of cDNAs derived from human embryo (Acampora, 1992) and CD34 + bone marrow cells. The putative promoter P2 (Acampora et al., 1989) and murine promoter Pl (Sham et al., 1992) are also indicated. B) Nucleotide sequence of the 5'UTR of the novel HOXB3 cDNA derived from a bone marrow cDNA library. The X and II- indicate the boundary between exon 3 a' and 3 a and between exon3a and 3b, respectively. Also shown are the first 4 predicted amino acids. 108 An exon 3a'-containing HOXB3 transcript is expressed in human bone marrow cells and in an erythroid leukemic cell line Attempts to detect the presence of exon 3a' sequence in HOXB3 transcripts derived from human bone marrow cells (CD34 + or CD34") by northern blot were unsuccessful likely due to the very low level of HOXB3 message expressed in these cells. Clear evidence of its expression was, however, evident by semi-quantitative RT-PCR (total cDNA amplification). A n exon 3a' specific probe revealed a strong signal in the K562 erythroleukemic cells (positive control for expression of HOXB3 (Sauvageau et al., 1994)) and a faint but significant signal in CD34 + bone marrow cells. Importantly, no signal was detected in CD34" B M cells or in HL60 promyelocytic cells previously shown to be negative for HOXB3 expression (Sauvageau et al., 1994). Similar expression patterns were obtained when a probe specific for exon 4 (excluding the conserved homeobox) was used (Fig. 4.2a). Figure 4.2 Detection of a novel HOXB3 sequence in S 8 2 ^ % B R N A from CD34 + bone E x o n 3 a >" I + " + I + = bp RT + -marrow cells and K562 1 1000 — — i IMP erythroid cell line. Exon 4 A) Southern blot analysis of CD34 | £ globally amplified cDNA from CD34 + and CD34" P"A c t i n human B M cells, K562 and HL60 cell lines using HOXB3 exon 3 a' and HOXB3 exon 4, CD34 or B -actin specific probes. The CD34 probe is used as control of cell purification, and B-actin as an amplification control. B) Detection of exon 3 a' specific sequence in K562 R N A by RT-PCR using exon 3 a' primers, with and without reverse transcriptase in lane 2 and 3 respectively (DNA ladder in lane 1). 109 650 400 300 The presence of exon 3 a' in some HOXB3 mRNAs expressed in K562 cells was also confirmed by RT-PCR where specific primers for exon 3 a' produced the expected 410 bp PCR product (Fig. 4.2b). Northern blot analysis using K562 polyA RNA and exon 4 and 3a' probes revealed the presence of multiple transcripts, but the exon 3a' containing transcript did not appear to be the major transcript for HOXB3 (data not shown). Together, these results confirm the expression of a novel exon 3a'-containing transcript of HOXB3 that is expressed in cells of hematopoietic origin. Intronic region between exon 2 and exon 3a' of HOXB3 contains several consensus-binding sequences for transcription factors To gain further insight into the possible origin of the novel HOXB3 transcript, the genomic DNA upstream of the 5' UTR of this transcript (between exon 2 and 3a') was isolated and sequenced (Acc. AF01629). Sequence analysis revealed the presence of numerous potential transcription factor bindings site including ones for G A G A , STATs, GATA-1 and HOX and PBX (Fig. 4.3a). Several GAGA-binding consensus sites characterized by the presence of CT-rich sequences were identified in the upstream region (see bp 150 to 395 underlined in Fig. 4.3a). G A G A is a member of the Trithorax family (Wilkins and Lis, 1997) of gene products which are known regulators of Hox gene expression in Drosophila (Gould, 1997). Three conserved sites for the signal transducer and activator of transcription (STATs) proteins (consensus sequence TT(N)sAA (Seidel et al., 1995)) which are expressed in hematopoietic cells are present at bp 398, 867 and 110 1497. In addition, numerous candidate GATA-1 binding sites (GATAA) are also present, a finding of interest given GATA-Ts essential role in erythropoiesis (Weiss and Orkin, 1995) and the previous reports describing the restricted expression of HOXB3 in erythroid cell lines (Mathews et al., 1991). Furthermore, GATA-1 has been shown to activate HOXB2 (Vieille-Grosjean and Huber, 1995) in K562 cells. A candidate site (TGGT) for AML1, the mammalian homologue of the Drosophila runt gene (Daga et al., 1992) and putative regulator of Hox genes is found at bp 1322. Finally, as often found in promoters of Hox genes, several core binding sequences for HOX proteins were found (n > 11 A T T A sites, all between bp 1200-1500) (Gould et al., 1997; Popperl et al., 1995; Zappavigna et al., 1991). Sites for PBX proteins known to increase DNA-binding affinity and specificity of HOX proteins (Chang et al., 1995) are also found within this same region including a typical PBX-HOX site (i.e., TGATTNATNN) at position 1255. To further evaluate the intron 2 putative binding sites, we sequenced the first 280 bp of murine genomic DNA (Acc. AF16030) upstream of exon 3 a'. Significantly, some of the Hox sites were conserved in the murine sequence (Fig. 4.3b) as well as the putative STAT site at bp 1497. A C C A A T and T A T A box motif were identified at position 1518 and 1545, respectively in the human sequence but only the C C A A T box was found conserved (Fig. 4.3b). Together, these results indicate that numerous conserved binding sites for TFs active in hematopoietic cells are present in this region of the HOXB3. I l l Figure 4.3 Nucleotide sequence for HOXB3 second intron. A) Sequence and putative TF binding sites within intron 2. Dashed lines correspond to CT rich regions and bold characters to GATA-1 putative binding sites. B) Comparison between human and mouse genomic DNA for the first 280 bp upstream of exon 3 a'. Bold characters indicate HOX putative binding sites, italic underlined characters indicate STAT site and the CCAAT and TATA box are also underlined. A B i 51 101 151 201 251 301 351 401 451 501 551 601 651 701 751 801 851 901 951 1001 1051 1101 1151 1201 1251 1301 1351 140 1 1451 150 1 1551 160 1 1 6 5 1 170 1 Exon 2 I T G T C T G C C T G T T C T C C C C T C G T C G G T G G C T A A G I G T A A G C T G G A C T G A A A T A G G C T A T C A G T T T G T G A A T G G C G G A G A G T A T G T C T C A A T G A T T T A T G G C C C A T A T G A C T C C A A T C T C G G T T C A A G A A G A G T T C A C A A G C T T T A A G C T T C C T T C £ A C £ C A G _ C G A C T C T C T C _ T C T C J ^ J T C C C _ T C C £ T C C C T C ^ C C T C T C T C T C C C T C T C T C T C _ T C T C T C T C T C _ T C C C T C T C T C T C T C C C C T C T _ G T C J £ F £ T _ G _ C _ _ _ _ _ _ _ _ _ _ _ _ "Etg. ! T T C T C T C C T C T T T T C T C C T C T C T C T C T T T T C T T T C A G C A G C C A G A T C C A G G G C T G A A T T T T C T C C G C G G C T G C T A A G A A A G T C T C A A C C T T T C T C T G T C T T C C T T T C T T G T T A T T T T T C T T T C T C C C A T T A A T T T T T T T A A G T C C T G G A A Hox - ~ STAT A G A T G G C C T A T C C C C T C T C T C G G G G C T T C C C C A G C T A T T G T T A C T C T C C T G G C T C T C C C T G G G G T G T G C T T G G C A A A G G T G G G G T T C T T G C G G G G G G C T C A T C T C C C T T C T C C A G C G A C A C C C T G G G G G G A A G C C G G C A G C C A C C G T C T C C C T C C C T C C C T C C C G A G G G A A C C A T A T G G A A C C T G A A T T T T T C C A A C A T G G A G G C A A G G G A A A T A G A T C T G T T T G G C T T G G T A A A A T T G T T C C C C A C C C C C T C T T G T T C T G G A T C C C A G A T C T T G G G T C C C T T A G C A C T T T C T C T C T T C C C A C T G T C C C G T C C G C C A G G C C T C G G C G C C C T C C A A C C C G G A G C C C T G C T G A G C A A A G T C C C G A A G C G G A G T T T C T A A G G C G C C T T T T A A T T C G G T T A C C T HOX C C A G C T C C C A A A A C T T G C T G C C G C C C G C G G G G C T C G G C C C T C G G C C G G C T G G T G T G C T G G G A A C C T G C C T C C O A T A A C C G T T T T G G T G T C C T G A T C G C T T S T A T G C T C T T C T T C G C C T C C T T G G G C C A T C G T A G G T G G C T G G T A G C T T G T C G C C A G T C G C C G C G G C A G C A G C G A C C G G C T G A G G C A G C C T G G C A G C A G C A G C C A G G G A C T A C C C G G G T G C A C A A A C C T T T C C C A G C C C T G T C T G C A C C A C C G G C G G A G T C T C C A T T C T T T C C T A T C G C G T C T C T G G C T C C T T C G C T T T C C A C A C T C G C C T G G C C T C C G T C C C G C G A T G G T T T G G G G T T T A T T G C A A G G G G A G C G G C A G G A A T T T C G G C C C C A G G C A T C T A G T T A A A T T A T T G T T T T A T T A T T A T Pbxl HOX Hox T A r T A ^ r A T C A T C C C T C G T C AT^CAT^TA^TTA T T G C T G T A A C A A | C J^G ny-T a A A T A A A G C C A G G G C T A G C C A G C C A A C C C C T T C C A A C G T T T G T A T T T C A T T Pbx C T C T T C T C T A T T A A T A A C A A C C A C A A C T A A T G C C T G T T A A T T A A T T C C C C Hox Amll HOX C T T C A G C C C A G G G C T G C T T G G A A G C T A A T T T T G G T T A A A T C A G C A G A G G C Hox Pbxl 1 A A X G G T A A T A A J _ A J A A A G G G A T T G G G T C A G C C T G G T C G A T T G A A C T C T Hox Hox HOX G G T T C T C C C C T G G A A G G A C C T G C T G C T T T G C A G A C C C A T G T G T A T T T C C A S T A T G A A A C C A A T C G G A A C T C A G G G T T A C A C T G A T T C C C T T T T G A G T A T A A A T C TA ' l 'A box T G T G C C A T G A A G A A G G G G A T T T A T G T G A G G G A G G G A C T T T T C T T C A C C T G C A C T C C T T T T A T T T T A T T T T C C T A T G T T T A G T T T T C T T T G G A G T T G A A C A G C T A G J G C T G A A T G A G A T T A A A G T T T T C C A A A C A C A C A T G G C A G T A T G G A G I I G T T T T A T G A A A A G T G A T G G T GAAGAGTT} Exon 3a' mouse 1 CGGTTAAT TAATT CTCC- TTCAGCA GGCT GCTCG - -AG CTA- - TTTGT T- -AATCAT human 1334 CTGTTAATTAATTCCCCCTTCAGCCCAGGGCTGCTTGGAAGCTAATTTTGGTTAAATCAG 60 CAGAAGCTAAT GGTAATAATAATAAAGGGATTGG-TCAGCCTGGTCAATTGAACTCCAGT 1394 CAGAGGCTAATGGTAATAATAATAAAGGGATTGGGTCAGCCTGGTCGATTGAACTCTGGT 120 CCTCCC-TGGAAGGACCTGCTGCTTTTGCACACCCGTGTGTAITTCCAGA/4ACAAAAATT 1454 TCTCCCCTGGAAGGACCTGCTGCTTT -GCAGACCCATGTGTA__2_____ STAT 180 TCCCAGAAACC___TG GAACTA--GGCTACATCATCTCCCCTTTAAGTACAGGGATCTGT 1514 - _ A C _ _ _ _ C G GAACT CAGGGTTACACTGATTCCCTTTTGAGTATAA--ATCTGT CCAAT boK TATA boK 240 GTCATAAGGGCAGCG-TTTGCGTGTGGGAGGGG-TTCACCCCACCTGAAGTTTTTTT 1574 GCCATGAAGAAGGGGATTTATGTGAGGGAGGGACTTTTCTTCACCTGCACTCCTTTT 112 The H0XB3 genomic DNA between exon 2 and exon 3a' (intron 2) contains a transcriptional regulatory element active in hematopoietic cells Functional tests for promoter and/or enhancer activity of the genomic sequence upstream of the novel HOXB3 transcript were carried out using a reporter gene assay. The DNA sequence between exon 2 and 3a' (bp 143-1730) was subcloned into the pCAT-basic and pCAT-enhancer vectors as shown in Fig. 4.4a. The various constructs were first tested in the erythroid cell line K562 which expresses endogenous HOXB3 and in the promyelocyte cell line HL-60 which does not (Sauvageau et al., 1994). The full-length DNA segment, bp 143-1730, was found to promote reporter gene transcription in K562 cells, with or without the presence of the SV40 enhancer, as demonstrated by C A T activity comparable to that found with the SV40 promoter (Fig. 4.4a). In contrast, no C A T activity was detectable in HL60 cells with the same test vectors although C A T expression was, clearly present with the control vector containing the SV40 promoter and enhancer. No C A T activity was detected with a promoter less-C A T vector, lacking both promoter and enhancer (basic vector), in either cell line. 113 Promoter (SV40 or B3 intron 2) CAT ( SV40 Poly A enhancer K562 HL60 promoter less SV40 enhancer SV40 promoter pl43-1730- basic! pl43-1730- SV40 enhancer [ SV40 promoter and enhancer ^ r ^ r m m • # B MOLT4 K G l a DHL4 • • FDC-P1 # BaF3 • 32D • FEL 745 # m • kb 0 1 1 0.4 1 0.8 E2 Intron 2 C A T PEJI activity p C A T 143- 1730 400-1730 728-1730 1010-1730 1361-1730 CAT ++ Figure 4.4 HOXB3 intron 2 sequence can promote transcription in the K562 but not HL60 cell lines and the 5' end of intron 2 is essential for the transcriptional activity. A ) On the left are depicted the different vectors tested and on the right the C A T activity obtained for each vector in K562 or H L 6 0 cells. Results for a representative experiment are shown (n=4). B) C A T activity found in other hematopoietic cell lines when the 143-1730 bp fragment and SV40 enhancer containing vector was tested (n=3). C) Schematic representation of the original vector and the deletion vectors engineered to characterize the transcriptional activity. The C A T activity found in K562 cells for each vector is depicted on the right (n=4). 114 To assess whether this transcriptional regulatory element was specific to cell lines with erythroid characteristics, we tested the pCAT 143-1730 SV40 enhancer vector in hematopoietic cell lines of various origins. As shown in Fig. 4.4b, reporter transcriptional activity was readily detected in the erythroid cell line FEL 745 and at lower level in the lymphoid cell line DHL-4. Although significant gene transfer (ranging from 10-30%) was achieved in all cell lines, no C A T activity was detected in the myeloid KG-1, 3 2D and FDC-P1 or lymphoid Ba/F3, MOLT-4 and U937 cell lines. C A T activity was however detected in 4 out of 5 lines tested with the C A T gene under the regulation of the SV40 promoter and enhancer (data not shown). Together, these results suggest that the transcriptional regulatory element present between exon 2 and 3 a' is preferentially active in erythroid cells. Functional characterization of the transcriptional regulatory activity of intron 2 revealed at least two distinct functional regions In an effort to characterize further this regulatory region and to isolate the minimal region responsible for the promoter like activity, four deletion vectors were constructed containing varying fragments of intron 2 (bp 400-1730, 728-1730, 1010-1730 and 1361-1730) and were tested for promoter activity in K562 cells, without the SV40 enhancer. Surprisingly, all of the deletion vectors were incapable of inducing any significant expression of the C A T reporter gene in four independent experiments (Fig. 4.4c). These 115 results indicate that the 5' end portion of the 1.61 kb intronic sequence is essential for the transcriptional activity observed. To further characterize this regulatory domain, we tested it for enhancer activity. The 1.61 kb intronic sequence (bp 143-1730) was inserted downstream of the C A T gene with the SV40 promoter upstream of the C A T gene (Fig. 4.5a). The C A T activity found for each construct was normalized to the proportion of GFP + cells (internal control for transfection efficiencies) and the value found with the SV40 promoter. As seen in Fig. 5b, the C A T activity was increased up to 2-fold with the presence of the 143-1730 bp fragment compared to the vector with only the SV40 promoter. The activity was comparable to that achieved by the vector with the SV40 enhancer which caused an increase in C A T activity up to 3.0-fold. Most, if not all of the enhancer activity was further localized to the 5' region of intron 2 (sequence 143-400) consistent with the results found with the previous promoter tests. Both the 143-728 and 143-400 bp DNA segments enhanced transcription in an orientation independent manner consistent with enhancer properties (Fig. 4.5b). Of note, a reduction in C A T activity was also detected when the bp 400-728 segment was tested for enhancer activity suggesting that it may contain binding sites for transcriptional repressors (data not shown). The capacity of the 5' half (bp 143-728) of intron 2 to activate expression of the C A T reporter gene was also tested in non-erythroid cell lines to determine whether sequences 3' to this region are required for the erythroid specificity of the full-length (i.e., 143-1730) intronic region. Interestingly, bp 143-728 drove significant C A T activity in all cell lines tested including the myeloid BaF3, FDC-P1 and U937 cells whereas the full-length vector did not (data not shown). 116 SV40 promoter CAT Intron II fragments 143- 1730 E5' 143-728 E5' 143- 400 E5' [ B & 3 1 2 > ~ 1 S3 % V 0 SV40 P. SV40 P+E 143-1650 E5' 143-725 E5' 143-725 E3' 143-400 E5' 143-400 E3' Figure 4.5 Detection of enhancer activity of HOXB3 intron 2 in K562 cells. A) Schematic representation of the full-length and deletion vectors engineered to characterize the transcriptional activity. E5' and E3' indicates that the fragments were cloned in the 5'—>3' and 3 ' -»5 ' orientation respectively. B) Summary of the C A T activity found for each vector in K562 cells. The C A T activity found for each vector was first normalized to the transfection efficiency, as measured by co-electroporation with a GFP expressing plasmid, and then normalized to that found with the SV40 promoter-containing vector, which was then arbitrarily set a value one. Error bars indicates S E M (n=3). These results suggest that a strong positive but non-specific transcriptional regulatory element is present in the 5' region (i.e., region 143-400) of the HOXB3 genomic sequence isolated in this study and further that the specificity of activation in erythroid cells with the full sequence of intron 2 is regulated by sequences found in the 3' region (bp 730-117 1730). Interestingly, this 3' region contains some erythroid-specific GATA-1 DNA-binding sites. 4.4 Discussion Transcription factors, through the activation or repression of target genes, are important regulators of hematopoietic cell properties such as commitment and proliferation. Among the many such genes now implicated, Hox genes have emerged as key regulators based on preferential expression in primitive hematopoietic cells (Sauvageau et al., 1994), disordered expression in leukemic cells (Kawagoe et al., 1999), their involvement in translocations associated with leukemia (Nakamura-et al., 1996; Raza-Egilmez et al., 1998) and observed perturbations of hematopoiesis in engineered overexpression bone marrow transplantation models. In this study, we have isolated a novel HOXB3 cDNA, derived from human CD34 + bone marrow cells, that has led to the identification of a novel transcriptional regulatory region in the second intron of HOXB3. This region is composed of at least two functionally distinct elements: one conferring erythroid specific activity and a second conferring strong but non-specific transcriptional activity. Hox genes commonly give rise to several different transcripts through multiple mechanisms including differential splicing (Baron et al., 1987). Previous studies have described at least two different HOXB3 transcripts in both mouse and human. The transcript characterized in the CD34 + cDNA library differs only in its 5'UTR, consisting in part of a novel portion of exon 3 named 3a', and is identical in its coding region. The very low abundance of HOXB3 messages in the primitive CD34 + bone marrow cell limited our study of this transcript in bone marrow cells. Results of RT-PCR assays 118 confirmed the presence of the novel sequence of exon 3 a' in HOXB3 transcript in both primary CD34 + bone marrow cells and the erythroleukemia, K562, cell line although Northern blot (data not shown) analysis carried out on the latter cells, indicate that it is does not appear to be present in the principal HOXB3 mRNA. Intriguingly a BLAST search (Altschul et al., 1990; Zhang and Madden, 1997) of the expressed sequence tag (EST) database (NCBI) using the entire 5'UTR of the novel transcript also indicates expression of the exon 3 a' sequence in B-cell chronic lymphocytic leukemia cells (see Acc. BE676812) and in several non-hematopoietic malignant tissues including kidney (Acc. BE349975), colon (Acc. AW135928) and endometrial tumors (Acc. AI554404). Thus exon 3a'-containing HOXB3 transcripts are present in certain normal and malignant hematopoietic cells and appear also to be present in other non-hematopoietic cell types. Interestingly, the novel exon 3a', described in this study, encompasses the putative murine promoter PI described by Sham et al in 1992 and further studied by Brown et al in 1994 (Brown and Taylor, 1994). Sham and his colleagues using transgenic mice and a vector spanning 9 kb of the Hoxb3 gene were able to reproduce the expected embryonic Hoxb3 expression pattern. From their results, they deduced that a promoter (designated PI in Fig. 4.1a) was present between the Kpnl site and exon 3a. Relative to the human sequence, the 5'end of their vector started at bp 599 of our cDNA (Kpnl site in Fig. 4.1b). The presence of this DNA segment in our cDNA (3' end of exon 3 a' and exon 3 a) argues against the origin of this B3 transcript from a similar position; rather, it suggests that either this novel transcript is generated through the use of the distal promoter P2 (upstream exon 1) and differential splicing or a novel promoter located within intron 2. 119 We challenged the second possibility by using C A T reporter gene assay and hematopoietic cell lines to test intron 2 for possible promoter and enhancer activity. By testing the full-length and sub-region of intron 2 in different cell lines, we showed that the full length intron 2 could drive C A T expression specifically in erythroid cell lines; and moreover, the erythroid specificity appeared to derive from the 3' region from bp 730-1730, with no or low detectable activity in myeloid and lymphoid cell lines. Subsequently, we showed that the intron 2 had enhancer activity, with most of the activity mapped to the 5' end of intron 2 between bp 143-400. This regulatory element found in intron 2 most likely constitutes a novel HOXB3 enhancer with most of the positive transcriptional activity located at the 5' end of intron 2. Interestingly, the region conferring erythroid specificity (bp 730-1730) contains 2 putative binding sites for GATA-1 and STATs proteins. GATA-1 is known to be essential for the regulation of many erythroid specific genes (Weiss and Orkin, 1995) and is also known to be expressed in the K562 cells. Given the preferential expression of HOX B genes in erythroid cells (Mathews et al., 1991) and the regulation of HOXB2 by GATA-1 (Vieille-Grosjean and Huber, 1995), this raises the possibility that GATA-1 is implicated in the regulation of other B cluster Hox genes in hematopoietic cells. Furthermore, it was recently reported that STAT5 is constitutively activated in K562 cells due to the BCR-A B L fusion protein (de Groot et al., 1999), raising STAT5 as a possible candidate regulator. Finally, the 3' region also contains numerous putative binding sites for H O X and PBX proteins, which could indicate that this element is in part regulated by H O X proteins. Hox genes have been previously shown to both positively and negatively cross-regulate their own expression and that of other Hox genes (Gould et al., 1997; Krumlauf, 120 1994; Maconochie et al., 1997; Popperl et al., 1995). The second region (bp 143-730) with strong enhancer activity in K562 cells, and in non-erythroid cell lines, contains multiple putative binding sites for the Trithorax-like G A G A protein. Since no mammalian homologue genes have yet been identified for GAGA, its involvement in the regulation of this element is not clear. This region also contain a well-conserved consensus binding sites for STAT binding (bp 398), two closely located Krueppel-like factor (at bp 190 and 200) and, finally, one putative Ets site (bp 246). The putative T A T A box motif present at the 3' end of the intron was found not to be conserved in murine DNA which strongly suggests that this motif is not functional given the high degree of conservation usually observed for Hox gene regulatory elements between species (Anderson et al., 1998; Manzanares et al., 1997; Popperl et al., 1995). For this reason, we propose that intron 2 most likely contains an enhancer element involved in the regulation of HOXB3 in hematopoietic cells. We could not discriminate whether the transcript identified in this study originated from the distal promoter P2 (see Fig. 4.1a), through differential splicing, or possibly from somewhere within intron 2. HOXB3, like many Hox genes, contains a number of candidate enhancer elements including a kreisler responsive element upstream of Hoxb3 gene that drives expression in the fifth rhombomere (r5) along with a Ets site (Manzanares et al., 1997) and a Hox-Pbx responsive neural enhancer regulating Hoxb3 and HoxM expression in the posterior hindbrain located upstream of promoter P2 (Gould et al., 1997). It remains unknown whether this new regulatory region is specific to the HOXB3 gene and if its involved in the regulation of this gene in early stages of embryonic development. 121 In summary, we have isolated a novel HOXB3 cDNA derived from human bone marrow cells and novel HOXB3 transcriptional regulatory elements. Hox genes are not ubiquitously expressed in hematopoietic cells but are rather found expressed in functionally distinct primitive subpopulations (Sauvageau et al., 1994) and can also be induced by growth factor stimulation (Giampaolo et al., 1994). Herein, we present evidence that the Hox gene restricted expression in hemopoiesis could be controlled in part by specific hematopoietic TFs interacting with Hox gene regulatory elements. These results provide new insights into the regulation of Hox genes in hematopoietic cells. 122 CHAPTER 5 INDUCTION OF ACUTE MYELOID LEUKEMIA IN MICE BY THE HUMAN LEUKEMIA-SPECIFIC FUSION GENE NUP98-HOXD13 IN CONCERT WITH MEIS? 5.1 Summary Recent data have described a novel group of t-AML/MDS with mostly myelomonocytic features, characterised by balanced translocations involving the nucleoporin gene NUP98 and homeobox genes such as HOXD13. We have now tested directly the leukemogenic potential of the NUP98-HOXD13 t(2;ll) fusion gene, alone or in concert with a candidate collaborating gene, the T A L E Homeobox gene Meisl, in the murine bone marrow (BM) transplantation model. NUP98-HOXD13 and Meisl expressed in total B M by retroviral gene transfer resulted in a rapidly fatal myelomonocytic leukemia in recipient mice closely re-capitulating human myelomonocytic NUP98-associated leukemia. NUP98-HOXD13 was necessary but not sufficient for the induction of A M L , since by itself it caused myeloproliferation in vitro and in vivo without moribund conditions in the majority of animals. The NUP98 region was essential for the hematopoietic effect of the fusion gene on CFU-S cells and could be partially replaced by the heterologous transactivation domain of VP 16, indicating that NUP98 potentially provides a transcriptional activation function to the NUP98-HOXD13 chimeric protein. In summary, the model demonstrates the transforming potential of a NUP98-associated fusion gene in vivo, and emphasizes the relevance of secondary alterations in the pathogenesis of human NUP98-Hox gene associated A M L . 4 This project was done in full collaboration with C. Buske and the chapter this based on a manuscript presently under revision submitted to the Journal of Clinical Investigation by; Christian Buske*, Nicolas Pineault*, Michaela Feuring - Buske, Carolina Abramovich, Peter D. Apian, Donna E. Hogge, and R. Keith Humphries- *co-first authors. N. Pineault and C. Buske participated in all experimental design, BM transductions, mice injections and analysis. Additional vectors (VP16-HOXD13 and AHOXD13) were engineered by C. Abramovich. 123 5.2 Introduction Therapy - related myelodysplastic syndrome (t-MDS) and A M L (t-AML) have emerged as serious poor prognosis long - term complications of genotoxic high-dose chemo- or radiotherapy in patients with cancer (Pedersen-Bjergaard et al., 2000). Recent data have described a novel group of t-MDS/t-AML with mostly myelomonocytic features, which are characterized by balanced translocations involving the nucleoporin NUP98 gene on chromosome l i p 15. In all cases the chromosomal translocations involving l i p 15 create a chimeric gene fusing the N-terminal portion of NUP98 in frame to one of multiple potential partner genes. Among those most frequently observed have been homeobox genes such as HOXA9, HOXD13 or PMX1, which were originally identified as master genes of body formation during embryogenesis and also in the case of HOXA9 as direct regulators of hematopoietic development (Borrow et al., 1996; Nakamura et al., 1996; Nakamura et al., 1999; Nigg, 1997; Raza-Egilmez et al., 1998). The NUP98 gene is the second member of the nucleoporin gene family implicated in human leukemogenesis beside NUP214 (or CAN), which is found in the t(6;9)(p23;q34) in patients with A M L (von Lindern et al., 1992). So far the role of the nucleoporins in malignant transformation is only partly understood: NUP98 regulates the uni- and bi-directional transport of proteins and RNA-protein complexes between cytoplasm and nucleus. It belongs to a subgroup of nuclear pore complex proteins (NPC) characterized by a common sequence motif, the phenylalanine-glycine (FG) repeat, that functions as a putative docking site for imported substrates (Nigg, 1997; Radu et al., 1995). Of note, all the chimeric genes preserve the F G repeats of the N - terminal half of NUP98, and recent data suggest that 124 the FG repeats act as potent transactivators in the chimeric NUP98-HOXA9 gene (Kasper etal., 1999). The involvement of homeobox genes as partner genes of NUP98 is of interest given the growing evidence linking Hox genes to leukemia. Molecular characterization of chromosomal breakpoints in patients with acute leukemia has demonstrated that the homeobox gene HOX11 is activated by juxtaposition to the TCR loci in the translocation t(10;14) in human T - cell A L L (Ffatano et al., 1991). Furthermore, deregulated expression of AbdB - like clustered Hox genes such as HOXA9 and HOXA10 were shown to be leukemogenic in murine bone marrow transplantation models and to induce severe perturbations of normal human hematopoietic development (Buske et al., 2001; Kroon et al., 1998; Thorsteinsdottir et al., 1997). The relevance of Hox genes in human leukemogenesis was further underlined by gene expression monitoring of acute leukemias using the DNA microarray technique, correlating the expression of HOXA9 to treatment failure in patients with A M L (Golub et al., 1999). The involvement of HOXD13 is however striking because Hox D cluster genes unlike that of Hox A cluster genes are not normally expressed in human bone marrow cells (Sauvageau et al., 1994). NUP98-HOXD13 is thus the first example of a human leukemia - specific fusion gene, which results in de novo and aberrant expression of a clustered Hox gene in human hematopoietic cells (Arai et al., 2000; Raza-Egilmez et al., 1998; Shimada et al., 2000). Recent studies have emphasized that the Hox co-factor Meisl, which itself is a homeodomain - containing protein characterized by a three amino acid loop extension of the homeodomain (TALE), can accelerate Hox gene induced leukemogenesis in animal models. In the B X H - 2 mouse strain 95 % of the A M L characterized by virally activated 125 expression of Meisl also had viral activation of Hoxa9 or Hoxa7 (Nakamura et al., 1996; Shen et al., 1997). Furthermore, murine transplantation models have demonstrated that co-expression of Meisl can accelerate the development of A M L induced by Hoxa9 (Kroon etal., 1998). We now have established a murine model to test directly the impact of the human leukemia - specific fusion gene NUP98-HOXD13 on hematopoietic development. Here we report that the NUP98-HOXD13 chimeric gene is sufficient to induce myeloproliferation in vivo. Strikingly, NUP98-HOXD13 together with deregulated expression of Meisl induces acute myelomonocytic leukemia with high frequency. A critical role for the NUP98-derived activity of the fusion gene is demonstrated and its function can at least partially be replaced by the transactivation domain of VP 16. Together, these findings establish a novel murine model for NUP98-associated human myelomonocytic A M L and characterize the transforming potential of a NUP98-associated fusion gene in vivo. This model should facilitate further elucidation of the pathogenesis of this poor prognosis leukemia. 126 5.3 Results NUP98 - H0XD13 enhances growth of myeloid clonogenic progenitors and CFU-S in vitro As an initial test to determine whether the expression of NUP98-HOXD13 (ND13) can perturb the normal hematopoietic differentiation and proliferation program we introduced the fusion gene into primary murine B M cells by retroviral gene transfer using an M S C V - based construct linking the ND13 cDNA to GFP as a selectable marker by an IRES element (ND13 virus). As a control we used the virus carrying GFP alone (Fig. 5.1a/b). An effect of ND13 on transduced clonogenic progenitors was first revealed when freshly infected and purified B M cells were plated into methylcellulose: ND13 transduced cells generated a 2.3-fold higher number of myeloid colonies with an average of 176 colonies (+ 57) versus 78 colonies (+ 39) in the control per 600 cells initially plated (n = 3, p < 0.02). This growth enhancing effect was confirmed in liquid culture assays where the total cell recovery from ND13 transduced B M was 4.7-fold of that of the GFP control after 7 days. Even larger effects of ND13 were observed in the liquid culture expansion of the more primitive hematopoietic cells detectable as day 12 CFU - S cells: ND13 increased the frequency of CFU-S cells 43-fold with an average of 17 (+ 7) versus 0.4 CFU-S cells ( ± 0 . 1 ) in the GFP control (p < 0.002; n = 18 for NUP98-HOXD13/GFP, n = 20 for GFP) (Fig. 5.8). These data provided initial evidence that NUP98-HOXD13 can enhance the growth of myeloid progenitors and more primitive multipotent C F U - S cells in vitro even after a very limited time period of gene expression. 127 A H0XD13 N H * NUP98 NH2 IBP Exonl • Exon2 COOH HD _1 COOH FG FG FG NUP98-HOXD13 t(2;11)(q31;p15) m RNA BS COOH FG FG FG B NUP98-HOXD13/GFP virus RI NUP98-HOXD13 HOXD13A/GFP virus iN RI HOXD13 A VP16-HOXD13/GFP virus Meis1/YFP virus VP16-HOXD13 Meisl GFP virus ,N GFP YFP Figure 5.1 NUP98, HOXD13 and chimeric gene and retroviral constructs. A) Structures of the NUP98, HOXD13 and NUP98-HOXD13 fusion gene illustrating the conserved FG repeats of NUP98 gene and the homeodomain of HOXD13. B) Retroviral constructs were designed and used for gene transfer in BM cells. BP = translocation break point; RNA BS; RNA binding site; FG; phenylalanine-glycine repeats; HD; homeodomain; LTR; long terminal repeats; GFP; green fluorescent protein; YFP; yellow fluorescent protein; IRES; internal ribosomal entry site. RI; EcoRl ite, N; Nhel sites. The DNA fragment used as a GFP probe for the genomic Southern also shown . 128 NUP98-HOXD13 alone induces myeloproliferation and impairs early B cell development in vivo To further assess the effect of ND13 expression on hematopoietic development mice were transplanted with primary B M cells infected singly with the ND13 virus (ND13 mice, n = 16) or with the GFP virus (GFP mice, n = 12), in 3 independent experiments. Careful examination of B M and PB at defined time points post transplant, obtained by femoral bone marrow aspirates and tail bleeding, respectively, confirmed that ND13 induced severe perturbations of both normal myeloid and B - lymphoid development. As early as 4 weeks post transplant ND13 mice showed significant alterations of lineage distribution in the PB: the proportion of myeloid cells was increased by =50 % (p < 0.005), whereas the proportion of B cells was reduced by half (p = 0.01) compared to the GFP mice (Fig. 5.2). Figure 5.2 Transduced peripheral blood cells of mice transplanted with BM expressing NUP98-HOXD13 or GFP. Transplanted mice were analyzed for the proportion of B220+ B - lymphoid cells and G r l + or M a c l + myeloid cells 4 weeks post transplant by FACS analysis (ND13 (n = 16) or GFP(n= 12)). GFP ND13 GFP ND13 GFP ND13 p<0.02 p< 0.005 p< 0.005 100 c o r o Q. O 10 129 These alterations in proportions were further reflected in the increased absolute numbers of circulating myeloid cells to 4.1 x 106/ml in ND13 mice compared to 2.6 x 106/ml in GFP mice, and reduced numbers of B cells to 1.3 x 106/ml versus 4.2 x 106/ml B220+ cells in the controls (p < 0.004). The impact of ND13 expression on lineage distribution was also observed in B M aspirates 12 weeks post transplant (ND13: n = 16; GFP: n = 5) with a 35 % decrease in the proportion of B220+ B lymphoid cells (p < 0.01) and a 27 % increase in the proportion of Gr-1 + myeloid cells (p < 0.01), compared to the GFP mice. At this time point IL-7 - responsive clonogenic B-cell progenitors were significantly reduced (>50 %) in ND13 recipient mice (ND13: 35 pre-B cells/lxlO5 B M cells; GFP: 72 pre-B cells/lxlO5 B M cells; p<0.04). This was further evident at the time of sacrifice of primary and secondary recipients, when most of the tested ND13 mice had no detectable pre - B cells in the B M (Table 5.1). The induction of myeloproliferation by NUP98-HOXD13 was highlighted by one mouse which developed a lethal myeloproliferative syndrome with highly elevated peripheral white blood count and the massive accumulation of differentiated myeloid cells in the PB, B M and spleen (Table 5.1, Fig.5.3, Fig.5.4). In contrast, all GFP mice remained alive and free of disease over 1 year post transplant. To assess further the degree of NUP98-HOXD13 induced myeloproliferation, two ND13 mice with no visible signs of morbidity from two independent experiments and the diseased ND13 mouse were sacrificed. All three mice showed a high cellularity of the B M and one mouse without obvious disease as well as the diseased mouse were characterized by an accumulation of myeloid cells in the spleen, compared to sacrifice GFP controls (Table 5.1). A lethal myeloproliferative syndrome followed transplantation of B M cells from the diseased ND13 mouse and 130 strikingly also from one ND13 mouse without obvious disease in all secondary recipients between 9 and 20 weeks post transplant, indicating that at least in some animals the myeloproliferation accelerated over time (Fig.5.3, Table 5.1). Histological analysis showed myeloid infiltration in lymph nodes and spleen with the eradication of the normal follicular architecture. However, there was no tissue damage in the liver, kidney or lung caused by myeloid infiltration in the ND13 primary or secondary animals. 131 cu OH O ki o CU CU ro o a 0 0 OS D cs T J fl o u cu cn T 3 fl CS CS s u a X I cu o s *c o cs U Vi *E CU w cs u CS -el u cu es H fl cu a, «3 cu cs « &8I <N CN ro vs •f VO CN OS •a ts m C CN CN T3 © r-C CN Ol ^ ^ O CN CO in •—i ro O N cn ro r~ ro ro »—i CN Os 00 O 0 a °> ° CN , -H vq ^ o CN vo rt vs OS vo ^cl-VS oo PQ o sEL U 2 CO x i u-> CU — s - n a . <N IS •a oo a r->o V S vi os ro CN "fr rt o rt o o rt fN o VO rt <N t Os ^ -a © § ro PJ CN O ^ rt «N t « O oo co o i rt rt CN VO CN OS rt OO CN T f CN OS CN —; CN O O oo Os CN OO VO CN TJ- CN rt a OJ ecS c3 CO <rt O •s £ O H o =5 + + -a § pa PM oo vq ro vq -<r vi •O ro O ro co <N oo O "* CN 2 VS ^ —I OS VO rt ro CU O ° £ ;> CS !> CO o fl cu CS CU cn as 2 2 cu ce S © PH a .cu CN 8 s .cu rt CN ro S, CN CN oi Si . PH 52 « .cu _ rt CN • SH % * + + + + + + ^ 2 rt s cu rt CN ro S, oi oi oi Si + + + + ro ro Figure 5.3 Survival curve of primary and secondary mice. A) Mice transplanted with B M transduced with NUP98-HOXD13, the GFP, Meisl or both the NUP98-HOXD13 and the Meisl viruses. B) Survival curves of secondary mouse recipients transplanted with B M of NUP98-HOXD13, NUP98-HOXD13/Meisl or GFP control primary mice are shown. (2nd Tx = secondary transplants). 1.0 0.8 > E 0.6 0.4-I 0.2 H o«l—©•—o © o o © o o o ND13 -T- Meisl - V - ND13/Meis1 - • - GFP 4-B 10 0.8 > E 0.6 3 0.4 A 0.2 A 1 10 20 30 40 50 60 weeks GFP 2 n d TX ND13 2 n d Tx • ND13/Meis1 2 n d Tx 10 20 30 40 50 60 weeks Clonal analysis of genomic DNA of B M cells showed one specific pattern of viral integration in all primary and secondary animals tested, and the clonality was confirmed 133 using DNA from CFU-S dl2 colonies derived from the B M of one secondary animal (Fig.5.6). Taken together, the data demonstrate that NUP98-HOXD13 alone is sufficient to induce myeloproliferation, although mostly without causing moribund conditions in affected mice. However, none of the primary and secondary recipient animals developed acute leukemia as shown by the lack of circulating blasts in the PB and the low percentage of blasts in the B M (< 10 %). NUP98-HOXD13 in collaboration with Meisl induces fatal acute myeloid leukemia in vivo As the homeobox gene Meisl has previously been implicated in Hox-associated leukemogenesis, we wanted to assess whether NUP98-HOXD13 causes hematological disease in vivo and would be augmented by Meisl. In addition to transplantations with B M infected singly with the ND13 virus or GFP virus, mice were transplanted with B M cells infected singly with the Meisl virus (Meisl mice, n = 5), or with B M cells co-infected with the ND13 virus and the Meisl virus (ND13/Meisl mice, n = 3). All Meisl mice remained alive and free of disease at 1 year of post transplant. In striking contrast, all mice transplanted with ND13-GFP7 Meisl-YFP + B M cells developed fatal acute leukemia after 15-20 weeks (Fig. 5.3). Two of the mice showed severe cachexia with 19 and 15 g body weight, respectively, and all mice had splenomegaly as evident by a 3.6 to 8-fold increase of the spleen weight compared to the control (0.32 - 0.8 g). The rapid induction of terminal disease by ND13 in concert with Meisl sharply contrasted with the impact of ND13 alone, which induced overt disease only in one of 16 transplanted 134 animals (Fig.3). Moreover, in contrast to ND13 mice, the PB of all diseased ND13/Meisl mice showed a primitive myeloid blast cell population (on average 36 %) (Fig. 5.4). Together these findings reveal, that NUP98-HOXD13 combined with Meisl overexpression can cause A M L with high frequency, whereas NUP98-HOXD13 alone causes a myeloproliferative condition. NUP98-HOXD13/Meisl induced A M L is transplantable and differentiates into the monocytic lineage Detailed hematological analyses of the leukemic mice revealed a high percentage of blasts in the B M and spleen with an average of 61 % and 49 %, respectively. Immunophenotypic analysis of the PB confirmed . a predominance of myeloid cells exceeding 85 % in the PB and 55 % in the spleen (Fig. 5.5a). In contrast, mice transplanted with Meisl infected B M cells (n = 3) showed no alteration of lineage distribution in the PB and the majority of cells were B - lymphoid (69%) as in the GFP control (61%). In contrast to the myeloproliferation seen in mice transplanted with B M transduced only with ND13, histopathological analysis of the leukemic mice showed a massive perivascular infiltration in the lungs, kidneys and liver by primitive myeloid cells (Fig. 5.4). The ND13/Meisl induced leukemia was transplantable and all secondary recipients developed aggressive fatal acute myelomonocytic leukemia with a greatly shortened disease latency of 4 weeks compared to 20 weeks in the primary recipients, suggesting that additional genetic hits occurred during the development of A M L (Fig. 5.3). In order to assess the competitive growth advantage of the leukemic cells and to determine the 135 frequency of the leukemia-repopulating cell (LRC), we performed in vivo limiting dilution assays. Normal B M cells were co-injected with B M cells from one diseased secondary recipient at different ratios and engraftment of both populations was analyzed. As few as 1 x 104 cells from the diseased animal had a competitive growth advantage at a ratio of 1:100 to normal B M cells with over 98 % GFP + /YFP + engrafted cells 30 days post transplant, causing leukemia in all recipients. Furthermore, the limiting dilution assay determined the frequency of the LRC as 1 in 1.7 x 104 cells (95% confidence interval: 1 in 2.5 - 0.5 x 104). The differentiation capacity of the leukemic cells was tested ex vivo by plating B M into methylcellulose. Virtually all (>95%) of the colonies formed were of the C F U - M type. Macrophage morphology was confirmed by staining individually plucked colonies and over 90 % of the cells expressed the monocytic antigen Mac-1 (Fig. 5.5b). B M cells were able to form mixed blast/monocyte colonies in methylcellulose without cytokines, which were further re-platable and differentiated into macrophage colonies in methylcellulose supplemented with cytokines. IL-3 dependent cell lines established from the leukemic bulk population conserved the myelomonocytic antigen profile and the monocytic differentiation capacity of the original leukemic cell population and induced terminal disease with massive accumulation of blasts in PB and B M in lethally irradiated recipients. These data underline the myelomonocytic character of the leukemia and demonstrate partial cytokine independence of the leukemic population. Expression of Meisl and ND13 was confirmed by RT-PCR (Fig. 5.7) and clonality of the disease was proven by the single provirus integration in the leukemic cell population in the B M , PB and spleen of primary and secondary recipients (data not shown). 136 Figure 5.4 Morphology of the PB obtained from a diseased NUP98-HOXD13 mouse and a diseased NUP98-HOXD13/Meisl mouse. A) The PB of the NUP98-HOXD13 shows accumulation of differentiated myeloid cells. B) PB of the NUP98-HOXD13/Meisl mouse is characterized by a predominant blast population. Morphology was assessed by cytospin preparation and Wright - Giemsa staining (x625). Sections of selected organs of diseased NUP98-HOXD13/Meisl mice were H & E stained for histological analysis. Lung (panel C), kidney (panel D), liver and spleen (not shown) were affected by a massive infiltration of primitive myeloid cells (156x) C Figure 5.5 Detailed analysis of hematopoietic cells from BM, spleen and PB of diseased mice. A A) Diseased leukemic mice (n-3) transplanted with B M expressing both NUP98-HOXD13 and Meisl were sacrificed for detailed analysis. The absolute number of B -lymphoid (B220+), myeloid (Gr l + or Macl + ) cells was calculated for the PB (per ml), for the B M and spleen (per mouse). In comparison the absolute numbers of the different populations are presented for GFP control mice (n = 3). PB BM Spleen PB BM Spleen per ml (Per Mouse) per ml (Per Mouse) ND13/Meis1 GFP B) Clonogenic progenitors from the leukemic cell population were tested ex vivo by plating B M into methylcellulose supplemented with cytokines (rmlL-3,rhIL-6, rmSF, and rhEpo), and macrophage morphology was confirmed by staining individually plucked colonies with Wright - Giemsa (800x). 138 Figure 5.6 Southern blot analysis of proviral integration in primary and secondary NUP98-HOXD13 and GFP transplanted mice. A) Nhel digestion was used to confirm intact provirus integration in transplanted mice. B) EcoRl digestion of genomic DNA from B M and spleen (s) was performed to assess the clonality of the reconstituted mice (see figure 5.1 for the location of the restriction sites on the vectors and the source of the GFP probe). The arrows indicate the common clonality of the reconstitution. The membranes were hybridized with a GFP probe. 2°-TX 2°-TX *ND13 provirus (5.2kb) #MIG provirus (2.6kb) Nhel B 2°-TX 2°-TX 3°-TX fN Tt; T f T f T f rO ro ro ro ci ro ro ro ro ro Q Q 0 Q Q Z; Z z; Z fN T f cs fN cs c l to m o o o HH CS ro a T f ro ro 5 z T f ro ro 5 z B S B S B B S B B B S B B B S C F U - S colonies from B M of ND13 3.4.1 — CM ro N % =*fc =tfc * * n n n ° ° s s s § I 2 g g *W Hum Hm 2 n Derived EcoRI from single cells 139 Figure 5.7 Expression of proviral NUP98-HOXD13 and Meisl transcripts in co-transduced BM cells. RT-PCR using sense primer specific for the M S C V vectors and antisense primer specific fortheNUP98 or Meisl cDNAs (see materials and methods for more details). 525bp4^ NUP98-HOXD13 Meisl 280 bp The NUP98 portion of the NUP98-HOXD13 fusion gene is essential for hematopoietic effects and can be replaced by the transactivation domain VP16 In an effort to determine the functional contribution of the NUP98 portion to the hematopoietic effects of the NUP98-HOXD13 fusion gene, we deleted the NUP98 portion of the NUP98-HOXD13 construct (AHOXD13, n = 6, Fig. 5.1b) and determined the C F U - S day 12 recovery after 7d of liquid culture. Deletion of the NUP98 portion resulted in a complete loss of the increased CFU-S recovery observed with the complete chimeric protein, yielding CFU-S numbers equivalent to that observed with the GFP control, thus indicating that the NUP98 derived activity is essential (Fig. 5.8). We next asked whether the NUP98 portion can act as a transcriptional activator by exchanging the NUP98 portion for the transactivation domain of VP16 (VP16-D13, n = 16)(Fig. 5.1b). The VP16-D13 construct yielded a CFU-S recovery significantly greater than the AHOXD13 construct or the GFP control, thus arguing that NUP98 may be providing a transcriptional 140 activation function to the NUP98-HOXD13 chimeric protein (Fig. 5.8). However, substitution of the NUP98 portion by the transactivation domain of VP 16 resulted in a 70% loss of the hematopoietic activity of the intact NUP98 - HOXD13 chimeric gene, suggesting that the NUP98 portion may have additional functions in the hybrid gene. We also tried to investigate whether Pbxl and NUP98-HOXD13 could also have synergistic effects. However, the use of the CFU-S assay fail to reveal any effects with co-transduced ND13/Meisl and ND13/Pbxlb B M cells, both of which were indistinguishable with ND13 transduced B M cells (data not shown). 100 Figure 5.8 Functional characterization of the NUP98 region of the NUP98-HOXD13 fusion gene using the CFU-S in vitro expansion assay. The functional contribution of the NUP98 portion to the hematopoietic effects of the NUP98-HOXD13 fusion gene was analyzed by deleting the NUP98 portion of the NUP98-HOXD13 construct (AHOXD13, n - 6). A potential role of the NUP98 portion as a transcriptional activator was tested by exchanging the NUP98 portion for the transactivation domain of VP16 (VP16-D13, n = 16). The hematopoietic activity of the different constructs was determined by quantifying the C F U - S recovery of B M cells transduced with the different viruses after 7d of liquid culture. in O i— X T— fc. CO a to I 3 u. o CM Difference to GFP: p<0.0001 141 5.4 Discussion Chromosomal rearrangements involving the member of the nuclear pore complex protein NUP98 on chromosome 1 lpl5 have defined a novel group of t-MDS/AML and de novo A M L . Although NUP98 is fused to multiple partner genes, homeobox genes have emerged as the most frequently involved in NUP98-associated translocations (Borrow et al., 1996; Nakamura et al., 1999; Raza-Egilmez et al., 1998). We now have directly tested the impact of the NUP98-HOXD13 fusion gene on hematopoietic development in the murine hematopoietic model and demonstrate that NUP98-HOXD13 itself can induce marked myeloproliferation evident both in vitro and in vivo, impair early B-lymphoid development and is leukemogenic in concert with co-expression of Meisl. Intriguingly, both the in vitro and in vivo hematopoietic effects of the NUP98-HOXD13 fusion gene are reminiscent of the effects of retrovirally overexpressed Hox genes. Hoxb3 for example causes a transplantable myeloproliferation and impairs B cell development with the virtual absence of pre - B colony-forming cells in the B M similar to that in diseased ND13 mice (Sauvageau et al., 1997). Overexpression oi HoxalO also induces an increase in the proliferative capacity of myeloid progenitors, impairs B cell development and can induce A M L (Thorsteinsdottir et al., 1997). The striking similarities between our results and those strongly suggest that the effects of NUP98-HOXD13 are at least partially mediated by aberrant activation of HOXD13 dependent target genes that in turn may overlap with gene targets or pathways controlled by other Hox genes. This is supported by the fact that the translocation t(2;ll) results in an aberrant expression of HOXD13 in hematopoietic cells, which normally do not transcribe Hox genes of the D cluster 142 (Sauvageau et al., 1994), and conserves the complete homeodomain, which is required for activation of //ox-dependent target genes. The potential relevance of aberrant HOXD13 expression in the hematopoietic system is further underlined by recent reports on the additional aberrant expression of the wild-type HOXD13 in two A M L patients with the NUP98-HOXD13 fusion gene (Arai et al., 2000; Shimada et al., 2000). Moreover, the homeodomain of HOXD13 is 47 and 56% identical to that of HOXB3 and HOXA9 respectively. Thus it is possible that NUP98-HOXD13 may also bind to deregulate expression of other Hox regulated genes. The role of NUP98 in the fusion gene is also intriguing. That NUP98 is not an adventitious target in A M L is highlighted by the involvement of another member of the NPC family, the NUP214 in the translocation t(6;9) (von Lindern et al., 1992). Interestingly, both nucleoporins maintain the FG amino acids repeats in the leukemia -specific hybrid genes, pointing to the potential relevance of these motifs for the oncogenicity of these chimeric proteins. Using fluorescent microscopy, Kasper et al. showed that the NUP98-HOXA9 fusion protein do not co-localize with wild-type NUP98 proteins but are rather found inside the nucleus, thus suggesting that the transforming potential of the chimeric gene is not linked to aberrant nucleo-cytoplasmic transport induced by the latter (Kasper et al., 1999). Using an assay for growth enhancing effects on CFU-S we observed that the NUP98 portion of the NUP98-HOXD13 fusion gene is essential for the hematopoietic effects. Moreover, the transcriptional activation domain of VP 16 could at least partially substitute for the NUP98 region in this assay, suggesting that the NUP98 region may provide transcriptional activation function in the chimeric protein. Our findings parallel those from structure-function analysis of the NUP98-HOXA9 fusion 143 gene, showing that the NUP98-derived activity is essential for the transforming activity (on fibroblasts) of the NUP98-HOXA9 chimeric gene and can be partially re-placed by the VP 16 transactivation domain (Kasper et al., 1999). The observation in both models that the VP 16 transactivation domain restores only 30-40% of the activity of the intact chimeric genes suggest, that the NUP98 region may have additional important functions in the chimeric gene besides its potential role as a transcriptional transactivator. A possible mechanisms for NUP98 de novo transcriptional activity was proposed following the discovery that the F G repeats of NUP98 mediates the interaction between the fusion protein with the CBP (CREB binding protein) and p300 (Kasper et al., 1999), both of which act as coactivators of a variety of gene-specific activators including HOXB7 and have also been implicated in transformation processes such as leukemias (Chariot et al., 1999; Goodman and Smolik, 2000). Although very early progenitor cells are likely involved in NUP98-HOXD13 induced myeloproliferation, the fusion gene as a single factor seems not to block myeloid differentiation as indicated by the accumulation of excessive amounts of mature neutrophils and macrophages, but not blasts, in the diseased primary and secondary recipient mice. This observation supports the concept that NUP98-HOXD13 as a single factor is sufficient to induce a myeloproliferative syndrome, but that additional events are necessary for the induction of A M L . Interestingly, NUP98-associated leukemias frequently emerge after extensive pre-treatment with genotoxic chemotherapy or develop from t-MDS, which indicates that at least in some of these leukemias the NUP98 fusion gene acts together with other collaborating genes to unfold its full transforming potential (Ahuja et al., 2000; Nishiyama et al., 1999). One of the intriguing findings of this study is 144 that Meisl can act as a collaborating gene to switch the NUP98-HOXD13 induced myeloproliferation to frank A M L . This A M L is characterized by high expression of Gr-1 and Mac-1 and myelomonocytic differentiation capacity, closely recapitulating myelomonocytic NUP98-associated human leukemias. The relative long latency period required for the development of NUP98-HOXD13/Meisl A M L (ranging from 3-4 months) and much shortened time observed in secondary suggest that additional events may also be required for full-blown ND13/Meisl induced A M L . So far the mode of interaction between Meisl and the NUP98-HOXD13 fusion gene in this model is unclear. Functional cooperativity between Meisl and other Hox genes has previously been seen in A M L models (Kroon et al., 1998; Nakamura et al., 1996). HOXD13 as a AbdB-like Hox gene can directly interact with Meisl, forming heterodimeric DNA binding complexes on consensus Meisl-Abd-like Hox DNA binding site (Benson et al., 1995; Shanmugam et al., 1999; Shen et al., 1997). Although relevant target genes for the hematopoietic activity of Meisl, Abd-B like Hox genes or Meisl /Hox heterodimers are not yet identified, these changes in the stability and binding preference of the two partnering genes might be responsible for the altered hematopoietic activity of Meisl and Abd-like Hox genes when co-expressed in appropriate models. However, the Meisl interacting site of HOXA9 is located in the first N-terminal 61 amino acids (Shen et al., 1997). This raises the question, how the NUP98-HOXD13 fusion gene can interact with Meisl, because the N-terminal part of HOXD13 is lost. It might be, that other so far not identified Meisl-interacting sites exist and/or that there are differences in the localization sites between AbdB-like genes of the paralogue group 9 and 13, which show major differences in their N-terminal portions or it is also possible that NUP98 provide a 145 docking site for Meisl. Pull down assays using transfected cell lines could rapidly provide a direct proof of whether or not the two proteins interact together, and transcriptional reporter-gene assay would also provide further proof of synergism activity between both proteins. Another explanation for the synergistic effect of NUP98-HOXD13 and Meisl expression is that both activate independent pathways, which combine to lead to acute leukemia. Meisl on its own has considerable DNA binding activity and AbdB-like Hox genes demonstrate strong DNA binding activity without Meisl. Furthermore, Meisl as a non-DNA binding partner can bind Pbxl, which itself directly interacts with Hox genes of the paraiogue groups 1-10 (Shanmugam et al., 1999). This may result in the activation of more 3' located Hox genes by Meisl overexpression. Interestingly, the normal downregulation of Meisl expression in differentiating normal cells, is not seen in patients with different subtypes of A M L (Kawagoe et al., 1999). Thus, it is conceivable that the perturbed prolonged expression pattern of Meisl plays a role in the pathogenesis of the NUP98-HOXD13 positive A M L (Afonja et al., 2000; Kawagoe et al., 1999). Our results with NUP98-HOXD13 closely parallel those of NUP98-HOXA9 induced leukemia; constitutive expression of the latter in mice using the same model used in this study also leads to myeloproliferation followed by A M L , and co-expression with Meisl significantly reduce the latency time (Kroon et al., 2001). As found with NUP98-HOXD13, the NUP98-HOXA9 chimeric protein is devoid of the residues involved in HOXA9-Meisl interaction. This study now provides a murine model of NUP98-Hox gene associated leukemia demonstrating the transforming potential of a NUP98-associated fusion gene in vivo. This 146 model will facilitate further elucidation of the molecular pathobiology of the growing family of NUP98-Hox associated human leukemias. 147 CHAPTER 6 GENERAL DISCUSSION AND CONCLUSIONS The precise molecular mechanisms regulating primitive hematopoietic cell functions such as self-renewal and differentiation/commitment remains largely unknown. However, considerable progress has been made in the identification of candidate regulators belonging to various families of TFs, such as the clustered Hox genes. In this thesis, I present findings on the expression of Hox genes throughout hematopoietic development, the existence of a cis-regulatory element potentially involved in HOXB3 expression in hematopoietic cells and the effect of deregulated Hox expression on hematopoiesis in vivo by constitutively expressing a novel Hox fusion gene in B M . 6.1 Conserved Hox gene expression program throughout hematopoiesis development One can assume and expect important regulators of hematopoiesis to be involved throughout HSC development and have conserved expression/function among mammalian species. To test whether Hox genes fit into this category, I assessed the expression of 8 representative genes from cluster A and B at different stages of murine hematopoietic development, which included functionally distinct hematopoietic subpopulations purified from B M , FL and early embryonic hematopoietic cells. The results provide evidence of conserved expression patterns at different stages of hematopoietic development. Of further significance, these patterns are conserved between 148 human and mouse, as apparent by preferential expression in primitive hematopoietic subpopulations enriched in HSCs and multipotent progenitors in both species. The expression of multiple Hox genes in murine and human primitive subpopulations suggests that a "Hox code" may regulate processes such as self-renewal and/or differentiation, and their downregulation is likely required for normal myeloid and lymphoid differentiation programs to occur. These findings further support the development of whole cluster knockout mice to decipher how Hox genes function in hematopoiesis and highlights the complex role that Hox genes may have in hematopoiesis. Differences in expression between Hox A and Hox B genes, where the latter were found expressed in more mature fractions in which Hox A genes were undetectable, was also observed. Possibly, these genes have acquired different regulatory functions in hematopoiesis through distinct domains of expression, which may become apparent as distinct hematopoietic abnormalities between Hox A versus Hox B knock out mice. In parallel, the expression of the Hox co-factors Pbxl and Meisl was also assessed, since these genes are important in specifying Hox gene functions and both have also been implicated in Hox induced leukemia. Pbxl and Meisl were found expressed in Hox-expressing subpopulations; however intriguing differences were also observed such as Meisl expression more closely resembled that of Hox genes whereas Pbxl was also found expressed in more mature fractions in which Hox genes were poorly expressed. Thus, the availability of either factor in a given lineage may in part regulate the functional outcome of Hox genes. 149 The recent characterization of non-hematopoietic stem cells for several tissues including fetal brain, skeletal muscle, skin and blood vessel (Weissman, 2000) raises the intriguing possibility that all somatic tissues have stem cells, sharing similar properties found in HSCs. This in turn raises interesting questions; are Hox genes expressed in these multipotent non-hematopoietic stem cells? Might Hox genes be universal regulators of stem cells for all tissues? Comparative gene-expression studies on these different tissues-related stem cells would address such questions and may lead to the isolation of universal stem-cell specific genes (Phillips RL, 2000). However, our results indicated that Hox genes, at least those looked at, are not expressed in the totipotent ES cells, thus Hox genes may be involved in the regulation of stem cells downstream from more primitive totipotent cells. This raises the intriguing question to the nature of the upstream regulators of Hox genes that may be involved in their regulation in such totipotent cells. Thus, this expression analysis provides a framework to further study and dissect the biological functions of Hox gene in normal hematopoiesis. Low levels of Hox gene expression and the rarity of Hox expressing cells still make their expression analysis difficult. However, the constant improvement in cell-purification strategies and high speed sorter coupled with improved expression techniques, such as real-time RT-PCR and microchip DNA arrays could be used to further resolve the expression of Hox gene in more refined hematopoietic subpopulations and possibly at the single-cell level. Moreover, our gene expression analysis has focused on hematopoietic cells under normal homeostatic conditions, how these patterns may change as a function of external 150 influences such as GFs stimulation (promoting self-renewal or diffferentiation) and/or stress situations may provide additional insight into their potential roles. 6.2 Transcriptional regulation of Hox genes in hematopoietic cells The interaction of Hox proteins with co-factors sheds some light on possible mechanisms used to specify Hox protein specificity and functions post-translationally. Equally important for the regulation of Hox functions is their transcriptional regulation, which represents the first level of regulation, upstream from post-translation modification and interaction with other proteins. Given their non-ubiquitous expression in hematopoietic cells as shown in this study, but rather preferential expression in primitive cells and their frequent deregulation in leukemic cells, it is of interest to characterize Hox gene transcriptional regulation in hematopoietic cells. We directly addressed this issue by characterizing a novel HOXB3 transcriptional regulatory element, which was isolated following the characterization of a new HOXB3 transcript derived from human CD34 + B M cells and have identified what functionally appears to be a novel enhancer element active in hematopoietic cells. Further characterization of the tissue specificity of this regulatory element in normal hematopoietic cells would be of interest. Alternative approaches include the use of the ES in vitro differentiation model and/or transgenic mice with this element linked to a reporter gene such as GFP or LacZ. Numerous putative binding sites for a variety of TFs have also been identified in this novel regulatory element, further functional mapping followed 151 by gel-shift assay coupled with site-directed mutagenesis could be used to single out the active trans-regulator controlling this element in hematopoietic cells. The availability of genomic sequences for all 4 human Hox gene clusters and imminent availability of the murine counterparts, provide invaluable information and a great opportunity to search for conserved regulatory domains in Hox genes. Given that the regulatory sequences of Hox genes have been generally well conserved over evolution, sequence comparisons among different species such as human, chicken and mouse represent a very productive avenue that has been used and could be further exploited to identify novel Hox regulatory sequences (Frasch et al., 1995; Manzanares et al., 2000). Such strategies coupled with reporter gene transgenic model could be employed to characterize hematopoietic-specific sequences and possibly HSC-restricted elements. Given the expression of Hox genes in multiple adult tissues it is also possible that transcriptional regulatory elements may be involved in their regulation in more than one tissue. Furthermore, it will be interesting to determine whether cross-regulation among Hox genes actually takes place in hematopoietic cells. Much support for such mechanisms comes from numerous studies reporting such processes during embryogenesis (Ferretti et al., 1999; Maconochie et al., 1997), expression studies including ours, that showexpression of multiple Hox genes in purified cell subpopulations (Moretti et al., 1994; Sauvageau et al , 1994) and collinear activation of Hox B genes in lymphocytes cells (Care et al., 1994; Giampaolo et al., 1994). Given the multiple putative Hox binding 152 sites in the regulatory element isolated in intron 2 of HOXBS described in this thesis, this novel element could potentially be used to test such a hypothesis. 6.3 Hox gene leukemogenic potential Hox gene regulation of hematopoiesis became apparent following the discovery of their expression in leukemic cells. As observed for many TFs involved in the regulation of hematopoiesis, Hox genes have also been the targets of recurrent chromosomal translocations in A M L patients. Using the murine B M transplantation model, we provided direct evidence that the NUP98-HOXD1S fusion gene causes mild myeloproliferation, sometimes leading to lethal myeloproliferation syndrome after a long latency, period. Moreover, co-expression with the Hox co-factor Meisl leads to the development of A M L after a shorter latency time. Thus, these observations indicate that additional events (genetic hits) are required for full blown neoplastic transformation. In addition, we showed that the NUP98 portion is absolutely required for the chimeric gene activity in hematopoietic cells (at least in CFU-S cells) and presumably acts as a transactivation domain. Hence, we suggest that the fusion gene acts as an aberrant Hox protein, which perturbs hematopoiesis by deregulating Hox targets; binding to Hox targets through the well-conserved HOXD1S homeodomain and activating and/or repressing transcription via NUP98 de novo transactivation activity. 153 The murine system used in this study could potentially provide an attractive model towards identifying new candidate collaborating genes that lead to the rapid development of leukemia with NUP98-Hox fusion genes. A possible approach will be the use of retrovirus to activate or mutate genes (through random insertion) in NUP98-HOXD13 transplanted mice and/or in transgenic NUP98-HOXD13 mice. Likewise, the yeast-2-hybrid system could also be employed to identify other proteins that interact with the chimeric and/or Hox proteins. Such a technique was efficiently used in our laboratory to isolate a novel Pbxl-interacting protein, HPIP (Abramovich et al., 2000). Other outstanding issues include a better understanding of how NUP98-HOXD13 impacts on hematopoietic cells: does it perturb important physiological pathways such as proliferation, differentiation and/or apoptosis? How do Meisl and NUP98-HOXD13 cooperate together to induce AML? Do they physically interact together or are they acting on two distinct pathways complementing each other for the development of AML? Biochemical studies such as co-immunoprecipitation could quickly solve this important question. Structure-function studies and mutagenesis experiments on well-conserved motifs found in Meisl and NUP98-HOXD13, such as Meisl and HOXD13 homeodomain would also provide additional informations on the mechanisms involved to induce A M L . Finally, identification of putative target genes for such chimeric genes would provide an alternative approach to further understand the leukemogenic pathway used by such aberrant genes and maybe learn more on normal Hox gene targets. 154 6.4 Closing perspectives Central to a better understanding of Hox gene functions in hematopoiesis and other processes such as development is the identification of genes directly regulated by Hox proteins. Identification of Hox targets could also provide valuable information on the unique vs overlapping functions of Hox genes, and should further our understanding on how Hox genes contribute to leukemic processes. Given the preferential expression of Hox genes in HSCs and multipotent progenitors, and the discovery that cell-adhesion molecules represent one of the biggest category of Hox-regulated genes, it is possible that one function for these genes is the regulation of various cell-adhesion molecules involved in the "homing", cell-interaction and migration of these cells. Other candidate genes include the cell-cycle regulators and possibly apoptotic related genes and GFs. The completion of the human genome sequence and the development of improved bio-informatic tools should further help in their identification. How Hox genes regulate transcription and how they are regulated post-translationally are two other outstanding issues that remained poorly resolved at this point. Evidence from a number of laboratories now suggest that the Hox genes may positively activate transcription through interaction with the histone acetyltransferase genes such as CBP and p300 (Chariot et al., 1999; Saleh et al., 2000), whereas Pbxl negatively regulates transcription through interaction with antagonist proteins of the histone deacetyltransferase family. Given the ubiquitous expression of these two proteins and their involvement in multiple processes such as development, cell-growth and leukemia for which Hox genes have been associated as well, their interactions with Hox proteins 155 may reveal an important mechanism by which Hox proteins achieved their functions (Goodman and Smolik, 2000). Of even greater interest is the possibility that such interaction might be regulated by external stimuli. Indeed it was recently demonstrated that cell-aggregation was required to induce transcriptional activity of the HOXB1-PBX1 complex in the embryonal carcinoma PI9 cells and the induction was linked to increased protein kinase A activity (PKA) (Saleh et al., 2000). Likewise, little is known about how phosphorylation may regulate the function of Hox proteins, such regulation is well known for hematopoietic TF proteins such as the STAT members. Numerous reports have showed high level of phosphorylation in homeobox containing proteins, including a study demonstrating that phosphorylation of a threonine residue by PKA on Fushi tazaru is required for its normal in vivo function in Drosophila (Dong et al., 1998). Thus, further characterization of the transduction pathway such as those leading to the activation of PKA in hematopoietic cells, may yield valuable clues on how Hox genes are regulated and how they regulate transcription. 156 CHAPTER 7 REFERENCES Abramovich, C , Shen, W. F., Pineault, N., Imren, S., Montpetit, B., Largman, C , and Humphries, R. K. (2000). Functional cloning and characterization of a novel nonhomeodomain protein that inhibits the binding of PBX1-HOX complexes to DNA. J Biol Chem 275, 26172-26177. Abramson, S., Miller, R. G., and Phillips, R. A. (1977). The identification in adult bone marrow of pluripotent and restricted stem cells of the myeloid and lymphoid systems. J Exp Med 145, 1567-1579. Acampora, D., D'Esposito, M . , Faiella, A., Pannese, M . , Migliaccio, E. , Morelli, F., Stornaiuolo, A., Nigro, V., Simeone, A., and Boncinelli, E. (1989). The human HOX gene family. Nucleic Acids Res 17, 10385-10402. Afonja, O., Smith, J. E. , Cheng, D. M . , Goldenberg, A. S., Amorosi, E. , Shimamoto, T., Nakamura, S., Ohyashiki, K., Ohyashiki, J., Toyama, K., and Takeshita, K. (2000). MEIS1 and HOXA7 genes in human acute myeloid leukemia. Leuk Res 24, 849-855. Ahuja, H. G., Felix, C. A., and Apian, P. D. (2000). Potential role for DNA topoisomerase II poisons in the generation of t(l l;20)(pl5;ql 1) translocations. Genes Chromosomes Cancer 29, 96-105. Ahuja, H. G., Felix, C. A., and Apian, P. D. (1999). The t(l l;20)(pl5;ql 1) chromosomal translocation associated with therapy-related myelodysplastic syndrome results in an NUP98-TOP1 fusion. Blood 94, 3258-3261. Ahuja, H. G., Hong, J., Apian, P. D., Tcheurekdjian, L., Forman, S. J., and Slovak, M . L. (2000). t(9;l I)(p22;pl5) in acute myeloid leukemia results in a fusion between NUP98 and the gene encoding transcriptional coactivators p52 and p75-lens epithelium-derived growth factor (LEDGF). Cancer Res 60, 6227-6229. Ahuja, H. G., Popplewell, L. , Tcheurekdjian, L., and Slovak, M . L. (2001). NUP98 gene rearrangements and the clonal evolution of chronic myelogenous leukemia. Genes Chromosomes Cancer 30, 410-415. Akasaka, T., Tsuji, K., Kawahira, H., Kanno, M . , Harigaya, K., Hu, L. , Ebihara, Y. , Nakahata, T., Tetsu, O., Taniguchi, M . , and Koseki, H. (1997). The role of mel-18, a mammalian Polycomb group gene, during IL-7-dependent proliferation of lymphocyte precursors. Immunity 7, 135-146. Akashi, K., Traver, D., Miyamoto, T., and Weissman, I. L. (2000). A clonogenic common myeloid progenitor that gives rise to all myeloid lineages. Nature 404,193-197. 157 Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990). Basic local alignment search tool. J Mol Biol 215, 403-410. Andersen, M . K., Christiansen, D. FL, Jensen, B. A., Ernst, P., Ffauge, G., and Pedersen-Bjergaard, J. (2001). Therapy-related acute lymphoblastic leukaemia with M L L rearrangements following DNA topoisomerase II inhibitors, an increasing problem: report on two new cases and review of the literature since 1992. Br J Haematol 114, 539-543. Anderson, K. P., Crable, S. C , and Lingrel, J. B. (1998). Multiple proteins binding to a G A T A - E box-GATA motif regulate the erythroid Kruppel-like factor (EKLF) gene. J Biol Chem 273, 14347-14354. Antonchuk, J., Sauvageau, G., and Humphries, R. K. (2001). HOXB4 overexpression mediates very rapid stem cell regeneration and competitive hematopoietic repopulation. Exp Hematol 29, 1125-1134. Arai, Y. , Hosoda, F., Kobayashi, H., Arai, K., Hayashi, Y. , Kamada, N., Kaneko, Y. , and Ohki, M . (1997). The inv(l I)(pl5q22) chromosome translocation of de novo and therapy-related myeloid malignancies results in fusion of the nucleoporin gene, NUP98, with the putative RNA helicase gene, DDX10. Blood 89, 3936-3944. Arai, Y. , Kyo, T., Miwa, H., Arai, K., Kamada, N., Kita, K., and Ohki, M . (2000). Heterogenous fusion transcripts involving the NUP98 gene and HOXD13 gene activation in a case of acute myeloid leukemia with the t(2;l I)(q31;pl5) translocation. Leukemia 14, 1621-1629. Arcioni, L. , Simeone, A., Guazzi, S., Zappavigna, V., Boncinelli, E. , and Mavilio, F. (1992). The upstream region of the human homeobox gene HOX3D is a target for regulation by retinoic acid and HOX homeoproteins. Embo J / / , 265-277. Arroyo, A. G., Yang, J. T., Rayburn, H., and Hynes, R. O. (1999). Alpha4 integrins regulate the proliferation/differentiation balance of multilineage hematopoietic progenitors in vivo. Immunity 11, 555-566. Audet, J., Miller, C. L., Rose-John, S., Piret, J. M . , and Eaves, C. J. (2001). Distinct role of gpl30 activation in promoting self-renewal divisions by mitogenically stimulated murine hematopoietic stem cells. Proc Natl Acad Sci U S A 98, 11'57-1762. Austin, T. W., Solar, G. P., Ziegler, F. C , Liem, L., and Matthews, W. (1997). A role for the Wnt gene family in hematopoiesis: expansion of multilineage progenitor cells. Blood 89, 3624-3635. Avanzi G. C , L. P., Giovinazzo B., Miniero R., Saglio G., Benetton G., Cattoretti G., and Pegoraro L. (1988). Selective growth response to 11-3 of a human leukaemic cell line with megakaryoblastic features. British journal of hematology 69, 359-366. 158 Barba, P., Magli, M . C , Tiberio, G , and Cillo, C. (1993). HOX gene expression in human cancers. Adv Exp Med Biol 348, 45-57. Baron, A. , Featherstone, M . S., Hill, R. E. , Hall, A., Galliot, B., and Duboule, D. (1987). Hox-1.6: a mouse homeo-box-containing gene member of the Hox-1 complex. Embo J 6, 2977-2986. Becker, D., Jiang, Z., Knodler, P., Deinard, A. S., Eid, R., Kidd, K. K., Shashikant, C. S., Ruddle, F. H., and Schughart, K. (1996). Conserved regulatory element involved in the early onset of Hoxb6 gene expression. Dev Dyn 205, 73-81. Benson, G. V., Nguyen, T. H., and Maas, R. L. (1995). The expression pattern of the murine Hoxa-10 gene and the sequence recognition of its homeodomain reveal specific properties of Abdominal B-like genes. Mol Cell Biol 15, 1591-1601. Bjorklund, S., Almouzni, G., Davidson, I., Nightingale, K. P., and Weiss, K. (1999). Global transcription regulators of eukaryotes. Cell 96, 759-767. Borrow, J., Shearman, A. M . , Stanton, V. P., Jr., Becher, R., Collins, T., Williams, A. J., Dube, I., Katz, F., Kwong, Y. L., Morris, C , Ohyashiki, K., Toyama, K., Rowley, J., and Housman, D. E. (1996). The t(7;l I)(pl5;pl5) translocation in acute myeloid leukaemia fuses the genes for nucleoporin NUP98 and class I homeoprotein HOXA9 [see comments]. Nat Genet 12, 159-167. Bosma, G. C , Custer, R. P., and Bosma, M . J. (1983). A severe combined immunodeficiency mutation in the mouse. Nature 301, 527-530. Boudreau, N., Andrews, C , Srebrow, A., Ravanpay, A., and Cheresh, D. A. (1997). Induction of the angiogenic phenotype by Hox D3. J Cell Biol 139, 257-264. Brady, G., Barbara, M . , and Iscove, N. (1990). Representative in vitro cDNA amplification from individual hematopoietic cells and colonies. Methods Mol. Cell. Biol. 2, 1-9. Bromleigh, V. C , and Freedman, L. P. (2000). p21 is a transcriptional target of HOXA10 in differentiating myelomonocytic cells [In Process Citation]. Genes Dev 14, 2581-2586. Broudy, V. C. (1997). Stem cell factor and hematopoiesis. Blood 90,1345-1364. Brown, W. M . , and Taylor, G. R. (1994). The 5'-sequence of the murine Hox-b3 (Hox-2.7) gene and its intron contain multiple transcription-regulatory elements. Int J Biochem 26, 1403-1409. 159 Bunting, K. D., Zhou, S., Lu, T., and Sorrentino, B. P. (2000). Enforced P-glycoprotein pump function in murine bone marrow cells results in expansion of side population stem cells in vitro and repopulating cells in vivo. Blood 96, 902-909. Buske, C , Feuring-Buske, M . , Antonchuk, J., Rosten, P., Hogge, D. E. , Eaves, C. J., and Humphries, R. K. (2001). Overexpression of HOXA10 perturbs human lymphomyelopoiesis in vitro and in vivo. Blood 97, 2286-2292. Buske, C , and Humphries, R. K. (2000). Homeobox genes in leukemogenesis. Int J Hematol 71, 301-308. Calvo, K. R., Sykes, D. B., Pasillas, M . , and Kamps, M . P. (2000). Hoxa9 immortalizes a granulocyte-macrophage colony-stimulating factor-dependent promyelocyte capable of biphenotypic differentiation to neutrophils or macrophages, independent of enforced meis expression. Mol Cell Biol 20, 3274-3285. Calvo, R., West, J., Franklin, W., Erickson, P., Bemis, L., Li , E. , Helfrich, B., Bunn, P., Roche, J., Brambilla, E. , Rosell, R., Gemmill, R. M . , and Drabkin, H. A. (2000). Altered HOX and WNT7A expression in human lung cancer. Proc Natl Acad Sci U S A 97, 12776-12781. Care, A., Felicetti, F., Meccia, E., Bottero, L., Parenza, M . , Stoppacciaro, A., Peschle, C , and Colombo, M . P. (2001). HOXB7: a key factor for tumor-associated angiogenic switch. Cancer Res 61, 6532-6539. Care, A., Silvani, A., Meccia, E. , Mattia, G., Stoppacciaro, A., Parmiani, G., Peschle, C , and Colombo, M . P. (1996). HOXB7 constitutively activates basic fibroblast growth factor in melanomas. Mol Cell Biol 16, 4842-4851. Care, A., Testa, U., Bassani, A., Tritarelli, E. , Montesoro, E. , Samoggia, P., Cianetti, L. , and Peschle, C. (1994). Coordinate expression and proliferative role of HOXB genes in activated adult T lymphocytes. Mol Cell Biol 14, 4872-4877. Care, A., Valtieri, M . , Mattia, G., Meccia, E. , Masella, B., Luchetti, L. , Felicetti, F., Colombo, M . P., and Peschle, C. (1999). Enforced expression of HOXB7 promotes hematopoietic stem cell proliferation and myeloid-restricted progenitor differentiation. Oncogene 18, 1993-2001. Carlesso, N., Aster, J. C , Sklar, J., and Scadden, D. T. (1999). Notch 1-induced delay of human hematopoietic progenitor cell differentiation is associated with altered cell cycle kinetics. Blood 93, 838-848. Celetti, A., Barba, P., Cillo, C , Rotoli, B., Boncinelli, E. , and Magli, M . C. (1993). Characteristic patterns of HOX gene expression in different types of human leukemia. Int J Cancer 55, 237-244. 160 Chan, S. K., Jaffe, L., Capovilla, M . , Botas, J., and Mann, R. S. (1994). The DNA binding specificity of Ultrabithorax is modulated by cooperative interactions with extradenticle, another homeoprotein. Cell 78, 603-615. Chang, C. P., Brocchieri, L. , Shen, W. F., Largman, C , and Cleary, M . L. (1996). Pbx modulation of Hox homeodomain amino-terminal arms establishes different DNA-binding specificities across the Hox locus. Mol Cell Biol 16, 1734-1745. Chang, C. P., de Vivo, I., and Cleary, M . L. (1997). The Hox cooperativity motif of the chimeric oncoprotein E2a-Pbxl is necessary and sufficient for oncogenesis. Mol Cell Biol 17, 81-88. Chang, C. P., Jacobs, Y., Nakamura, T., Jenkins, N. A., Copeland, N. G., and Cleary, M . L. (1997). Meis proteins are major in vivo DNA binding partners for wild-type but not chimeric Pbx proteins. Mol Cell Biol 17, 5679-5687. Chang, C. P., Shen, W. F., Rozenfeld, S., Lawrence, H. J., Largman, C , and Cleary, M . L. (1995). Pbx proteins display hexapeptide-dependent cooperative DNA binding with a subset of Hox proteins. Genes Dev 9, 663-6"/'4. Chariot, A., van Lint, C , Chapelier, M . , Gielen, J., Merville, M . P., and Bours, V. (1999). CBP and histone deacetylase inhibition enhance the transactivation potential of the HOXB7 homeodomain-containing protein. Oncogene 18, 4007-4014. Chen, F., and Capecchi, M . R. (1999). Paralogous mouse Hox genes, Hoxa9, Hoxb9, and Hoxd9, function together to control development of the mammary gland in response to pregnancy. Proc Natl Acad Sci U S A 96, 541-546. Chen, Z., Tong, J. H , Dong, S., Zhu, J., Wang, Z. Y. , and Chen, S. J. (1996). Retinoic acid regulatory pathways, chromosomal translocations, and acute promyelocytic leukemia. Genes Chromosomes Cancer 15,147-156. Cheng T, R. N., Shan H, Yang Y, Dombkowski D, Sykes M , Scadden DT (2000). Hematopoietic stem cell quiescence maintained by p21cipl/wafl. Science 287,1804-1808. Cheshier, S. H. , Morrison, S. J., Liao, X., and Weissman, I. L. (1999). In vivo proliferation and cell cycle kinetics of long-term self-renewing hematopoietic stem cells. Proc Natl Acad Sci U S A 96, 3120-3125. Cimino, G., Sprovieri, T., Rapanotti, M . C , Foa, R., Mecucci, C , and Mandelli, F. (2001). Molecular evaluation of the NUP98/RAP1GDS1 gene frequency in adults with T-acute lymphoblastic leukemia. Haematologica 86,436-437. 161 Collins, S. J., Gallo, R. C , and Gallagher, R. E. (1977). Continuous growth and differentiation of human myeloid leukaemic cells in suspension culture. Nature 270, 347-349. Condie, B. G., and Capecchi, M . R. (1994). Mice with targeted disruptions in the paralogous genes hoxa-3 and hoxd-3 reveal synergistic interactions. Nature 370, 304-307. Core, N., Bel, S., Gaunt, S. J., Aurrand-Lions, M . , Pearce, J., Fisher, A., and Djabali, M . (1997). Altered cellular proliferation and mesoderm patterning in Polycomb-M33-deficient mice. Development 124, 721-729. Coulombel, L., Eaves, A. C , and Eaves, C. J. (1983). Enzymatic treatment of long-term human marrow cultures reveals the preferential location of primitive hemopoietic progenitors in the adherent layer. Blood 62, 291-297. Crooks, G. M . , Fuller, J., Petersen, D., Izadi, P., Malik, P., Pattengale, P. K., Kohn, D. B., and Gasson, J. C. (1999). Constitutive HOXA5 expression inhibits erythropoiesis and increases myelopoiesis from human hematopoietic progenitors. Blood 94, 519-528. Daga, A., Tighe, J. E. , and Calabi, F. (1992). Leukaemia/Drosophila homology. Nature 356, 484. Davis, A. P., Witte, D. P., Hsieh-Li, H. M . , Potter, S. S., and Capecchi, M . R. (1995). Absence of radius and ulna in mice lacking hoxa-11 and hoxd-11. Nature 375, 791-795. Davis, L. , Kuehl, M . , and Battey, J. (1994). Basic methods in molecular biology, 2nd Edition, A. a. Lange, ed. (Norwalk. de Groot, R. P., Raaijmakers, J. A., Lammers, J. W., Jove, R., and Koenderman, L. (1999). STAT5 activation by BCR-Abl contributes to transformation of K562 leukemia cells. Blood 94, 1108-1112. De Vita, G., Barba, P., Odartchenko, N., Givel, J. C , Freschi, G., Bucciarelli, G., Magli, M . C , Boncinelli, E. , and Cillo, C. (1993). Expression of homeobox-containing genes in primary and metastatic colorectal cancer. Eur J Cancer 29A, 887-893. Dedera, D. A., Waller, E. K., LeBrun, D. P., Sen-Majumdar, A., Stevens, M . E. , Barsh, G. S., and Cleary, M . L. (1993). Chimeric homeobox gene E2A-PBX1 induces proliferation, apoptosis, and malignant lymphomas in transgenic mice. Cell 74, 833-843. D'Esposito, M . , Morelli, F., Acampora, D., Migliaccio, E., Simeone, A., and Boncinelli, E. (1991). EVX2, a human homeobox gene homologous to the even-skipped segmentation gene, is localized at the 5' end of HOX4 locus on chromosome 2. Genomics 10, 43-50. 162 Devereux, J., Haeberli, P., and Smithies, O. (1984). A comprehensive set of sequence analysis programs for the V A X . Nucleic Acids Res 12, 387-395. Dexter, T. M . , Allen, T. D., and Lajtha, L. G. (1977). Conditions controlling the proliferation of haemopoietic stem cells in vitro. J Cell Physiol 91, 335-344. Dexter, T. M . , Garland, J., Scott, D., Scolnick, E. , and Metcalf, D. (1980). Growth of factor-dependent hemopoietic precursor cell lines. J Exp Med 152, 1036-1047. Dexter, T. M . , Wright, E. G., Krizsa, F., and Lajtha, L. G. (1977). Regulation of haemopoietic stem cell proliferation in long term bone marrow cultures. Biomedicine 27, 344-349. DiMartino, J. F., Selleri, L. , Traver, D., Firpo, M . T., Rhee, J., Warnke, R., O'Gorman, S., Weissman, I. L. , and Cleary, M . L. (2001). The Hox cofactor and proto-oncogene Pbxl is required for maintenance of definitive hematopoiesis in the fetal liver. Blood 98, 618-626. Dolle, P., Izpisua-Belmonte, J. C , Falkenstein, H., Renucci, A., and Duboule, D. (1989). Coordinate expression of the murine Hox-5 complex homoeobox-containing genes during limb pattern formation. Nature 342, 767-772. Domen J, C. S., Weissman IL (2000). The role of apoptosis in the regulation of hematopoietic stem cells: Overexpression of Bcl-2 increases both their number and repopulation potential. J Exp Med 191, 253-264. Dong, J., Hung, L. H. , Strome, R., and Krause, H. M . (1998). A phosphorylation site in the ftz homeodomain is required for activity. Embo J 17, 2308-2318. Dube, I. D., Kamel-Reid, S., Yuan, C. C , Lu, M . , Wu, X., Corpus, G., Raimondi, S. C , Crist, W. M . , Carroll, A. J., Minowada, J., and et al. (1991). A novel human homeobox gene lies at the chromosome 10 breakpoint in lymphoid neoplasias with chromosomal translocation t(10;14). Blood 78, 2996-3003. Duboule, D. (1998). Vertebrate hox gene regulation: clustering and/or colinearity? Curr Opin Genet Dev 8, 514-518. Duboule, D., and Dolle, P. (1989). The structural and functional organization of the murine H O X gene family resembles that of Drosophila homeotic genes. Embo J 8, 1497-1505. Dubrulle, J., McGrew, M . J., and Pourquie, O. (2001). FGF signaling controls somite boundary position and regulates segmentation clock control of spatiotemporal Hox gene activation. Cell 106, 219-232. 163 Eaves, C. J. (1995). In vitro assays for quantitating hematopoietic progenitors cells, W. J. William, ed.: McGraw Hill inc.). Edelman, G. M . , and Jones, F. S. (1992). Cytotactin: a morphoregulatory molecule and a target for regulation by homeobox gene products. Trends Biochem Sci 17, 228-232. Elefanty, A. G., Robb, L., Birner, R., and Begley, C. G. (1997). Hematopoietic-specific genes are not induced during in vitro differentiation of scl-null embryonic stem cells. Blood 90, 1435-1447. Ema, H , Takano, H., Sudo, K., and Nakauchi, H. (2000). In vitro self-renewal division of hematopoietic stem cells. J Exp Med 192, 1281-1288. Ernst, P., and Smale, S. T. (1995). Combinatorial regulation of transcription. I: General aspects of transcriptional control. Immunity 2, 311-319. Evans, T., and Felsenfeld, G. (1989). The erythroid-specific transcription factor Eryfl: a new finger protein. Cell 58, 877-885. Faiella, A., D'Esposito, M . , Rambaldi, M . , Acampora, D., Balsofiore, S., Stornaiuolo, A. , Mallamaci, A., Migliaccio, E. , Gulisano, M . , and Simeone, A. (1991). Isolation and mapping of EVX1, a human homeobox gene homologous to even-skipped, localized at the 5' end of HOX1 locus on chromosome 7. Nucleic Acids Res 19, 6541-6545. Fairbairn, L. J., Cowling, G. J., Reipert, B. M . , and Dexter, T. M . (1993). Suppression of apoptosis allows differentiation and development of a multipotent hemopoietic cell line in the absence of added growth factors. Cell 74, 823-832. Ferretti, E. , Schulz, H , Talarico, D., Blasi, F., and Berthelsen, J. (1999). The PBX-regulating protein PREP1 is present in different PBX-complexed forms in mouse. Mech Dev 83, 53-64. Fisher, R. C , Lovelock, J. D., and Scott, E. W. (1999). A critical role for PU.l in homing and long-term engraftment by hematopoietic stem cells in the bone marrow. Blood 94, 1283-1290. Ford, C. E. , Hamerton, J. L. , Barnes, W. H., and Loutit, J. F. (1956). Nature 177,452. Fortunel, N. O., Hatzfeld, A., and Hatzfeld, J. A. (2000). Transforming growth factor-beta: pleiotropic role in the regulation of hematopoiesis. Blood 96, 2Q22-2(ft6. Frasch, M . , Chen, X., and Lufkin, T. (1995). Evolutionary-conserved enhancers direct region-specific expression of the murine Hoxa-1 and Hoxa-2 loci in both mice and Drosophila. Development 121, 951-91 A. 164 Fujino, T., Yamazaki, Y. , Largaespada, D. A., Jenkins, N. A., Copeland, N. G., Hirokawa, K., and Nakamura, T. (2001). Inhibition of myeloid differentiation by Hoxa9, Hoxb8, and Meis homeobox genes. Exp Hematol 29, 856-863. Gaunt SJ, S. P., Duboule D (1988). Spatially restricted domains of homeo-gene transcripts in mouse embryos: relation to a segmented body plan. Development 104, 169-179. Gehring, W. J., Qian, Y. Q., Billeter, M . , Furukubo-Tokunaga, K., Schier, A. F., Resendez-Perez, D., Affolter, M . , Otting, G., and Wuthrich, K. (1994). Homeodomain-D N A recognition. Cell 78, 211-223. Gerard, M . , Chen, J. Y. , Gronemeyer, H., Chambon, P., Duboule, D., and Zakany, J. (1996). In vivo targeted mutagenesis of a regulatory element required for positioning the Ffoxd-11 and Hoxd-10 expression boundaries. Genes Dev 10, 2326-2334. Giampaolo, A., Sterpetti, P., Bulgarini, D., Samoggia, P., Pelosi, E. , Valtieri, M . , and Peschle, C. (1994). Key functional role and lineage-specific expression of selected HOXB genes in purified hematopoietic progenitor differentiation. Blood 84, 3637-3647. Giannola, D. M . , Shlomchik, W. D., Jegathesan, M . , Liebowitz, D., Abrams, C. S., Kadesch, T., Dancis, A., and Emerson, S. G. (2000). Hematopoietic expression of HOXB4 is regulated in normal and leukemic stem cells through transcriptional activation of the HOXB4 promoter by upstream stimulating factor (USF)-l and USF-2. J Exp Med 192, 1479-1490. Golub, T. R., Slonim, D. K., Tamayo, P., Huard, C , Gaasenbeek, M . , Mesirov, J. P., Coiler, H. , Loh, M . L., Downing, J. R., Caligiuri, M . A., Bloomfield, C. D., and Lander, E. S. (1999). Molecular classification of cancer: class discovery and class prediction by gene expression monitoring. Science 286, 531-537. Goodell, M . A., Brose, K., Paradis, G., Conner, A. S., and Mulligan, R. C. (1996). Isolation and functional properties of murine hematopoietic stem cells that are replicating in vivo. J Exp Med 183, 1797-1806. Goodman, R. H., and Smolik, S. (2000). CBP/p300 in cell growth, transformation, and development. Genes Dev 14, 1553-1577. Goodwin, A. J., Mclnerney, J. M . , Glander, M . A., Pomerantz, O., and Lowrey, C. H. (2001). In vivo formation of a human beta-globin locus control region core element requires binding sites for multiple factors including GATA-1, NF-E2, erythroid Kruppel-like factor, and Spl. J Biol Chem 276, 26883-26892. 165 Goomer, R. S., Hoist, B. D., Wood, I. C., Jones, F. S., and Edelman, G. M . (1994). Regulation in vitro of an L - C A M enhancer by homeobox genes HoxD9 and HNF-1. Proc Natl Acad Sci U S A 91, 7985-7989. Gould, A. (1997). Functions of mammalian Polycomb group and trithorax group related genes. Curr Opin Genet Dev 7, 488-494. Gould, A., Morrison, A., Sproat, G., White, R. A., and Krumlauf, R. (1997). Positive cross-regulation and enhancer sharing: two mechanisms for specifying overlapping Hox expression patterns. Genes Dev 11, 900-913. Graham, A., Papalopulu, N., and Krumlauf, R. (1989). The murine and Drosophila homeobox gene complexes have common features of organization and expression. Cell 57, 367-378. Greer, J. M . , Puetz, J., Thomas, K. R., and Capecchi, M . R. (2000). Maintenance of functional equivalence during paralogous Hox gene evolution. Nature 403, 661-665. Greer, J. M . , Puetz, J., Thomas, K. R., and Capecchi, M . R. (2000). Maintenance of functional equivalence during paralogous Hox gene evolution. Nature 403, 661-665. Gu, Y. , Nakamura, T., Alder, H., Prasad, R., Canaani, O., Cimino, G., Croce, C. M . , and Canaani, E. (1992). The t(4;l 1) chromosome translocation of human acute leukemias fuses the ALL-1 gene, related to Drosophila trithorax, to the AF-4 gene. Cell 71, 701-708. Guazzi, S., Lonigro, R., Pintonello, L., Boncinelli, E. , Di Lauro, R., and Mavilio, F. (1994). The thyroid transcription factor-1 gene is a candidate target for regulation by Hox proteins. Embo J 13, 3339-3347. Hanes, S. D., and Brent, R. (1991). A genetic model for interaction of the homeodomain recognition helix with DNA. Science 251, 426-430. Harrison, D. E. , Astle, C. M . , and Lerner, C. (1988). Number and continuous proliferative pattern of transplanted primitive immunohematopoietic stem cells. Proc Natl Acad Sci U S A 85, 822-826. Hatano, M . , Roberts, C. W., Minden, M . , Crist, W. M . , and Korsmeyer, S. J. (1991). Deregulation of a homeobox gene, HOX11, by the t(10;14) in T cell leukemia. Science 253, 79-82. Hawley, R. G., Fong, A. Z., Lu, M . , and Hawley, T. S. (1994). The HOX11 homeobox-containing gene of human leukemia immortalizes murine hematopoietic precursors. Oncogene 9, 1-12. 166 Hawley, R. G., Fong, A. Z., Reis, M . D., Zhang, N., Lu, M . , and Hawley, T. S. (1997). Transforming function of the HOX11/TCL3 homeobox gene. Cancer Res 57, 337-345. Helgason, C. D., Sauvageau, G., Lawrence, H. J., Largman, C , and Humphries, R. K. (1996). Overexpression of HOXB4 enhances the hematopoietic potential of embryonic stem cells differentiated in vitro. Blood 87, 2740-2749. Hess, J. L. , Yu, B. D., Li , B., Hanson, R., and Korsmeyer, S. J. (1997). Defects in yolk sac hematopoiesis in Mil-null embryos. Blood 90, 1799-1806. Hirsch, E. , Iglesias, A., Potocnik, A. J., Hartmann, U., and Fassler, R. (1996). Impaired migration but not differentiation of haematopoietic stem cells in the absence of betal integrins. Nature 380, 171-175. Hodgson, G. S., and Bradley, T. R. (1979). Properties of haematopoietic stem cells surviving 5-fluorouracil treatment: evidence for a pre-CFU-S cell? Nature 281, 381-382. Hogan, B. L. (1996). Bone morphogenetic proteins in development. Curr Opin Genet Dev 6, 432-438. Horan, G. S., Ramirez-Solis, R., Featherstone, M . S., Wolgemuth, D. J., Bradley, A., and Behringer, R. R. (1995). Compound mutants for the paralogous hoxa-4, hoxb-4, and hoxd-4 genes show more complete homeotic transformations and a dose-dependent increase in the number of vertebrae transformed. Genes Dev 9, 1667-1677. / Hough, M . R., Reis, M . D., Singaraja, R., Bryce, D. M . , Kamel-Reid, S., Dardick, I., Breitman, M . L. , and Dube, I. D. (1998). A model for spontaneous B-lineage lymphomas in IgHmu-HOXl 1 transgenic mice. Proc Natl Acad Sci U S A 95,13853-13858. Hussey, D. J., Nicola, M . , Moore, S., Peters, G. B., and Dobrovic, A. (1999). The (4;11)(q21;pl5) translocation fuses the NUP98 and RAP1GDS1 genes and is recurrent in T-cell acute lymphocytic leukemia. Blood 94, 2072-2079. Izon, D. J., Rozenfeld, S., Fong, S. T., Komuves, L., Largman, C , and Lawrence, H. J. (1998). Loss of function of the homeobox gene Hoxa-9 perturbs early T-cell development and induces apoptosis in primitive thymocytes. Blood 92, 383-393. Jacobs, J. J., Kieboom, K., Marino, S., DePinho, R. A., and van Lohuizen, M . (1999). The oncogene and Polycomb-group gene bmi-1 regulates cell proliferation and senescence through the ink4a locus. Nature 397,164-168. Jaju, R. J., Fidler, C , Haas, O. A., Strickson, A. J., Watkins, F., Clark, K., Cross, N. C , Cheng, J. F., Apian, P. D., Kearney, L., Boultwood, J., and Wainscoat, J. S. (2001). A novel gene, NSD1, is fused to NUP98 in the t(5;l I)(q35;pl5.5) in de novo childhood acute myeloid leukemia. Blood 98,1264-1267. 167 Johansson, B. M . , and Wiles, M . V. (1995). Evidence for involvement of activin A and bone morphogenetic protein 4 in mammalian mesoderm and hematopoietic development. Mol Cell Biol 15, 141-151. Jones, F. S., Hoist, B. D., Minowa, O., De Robertis, E. M . , and Edelman, G. M . (1993). Binding and transcriptional activation of the promoter for the neural cell adhesion molecule by HoxC6 (Hox-3.3). Proc Natl Acad Sci U S A 90, 6557-6561. Jones, F. S., Prediger, E. A., Bittner, D. A., De Robertis, E. M . , and Edelman, G. M . (1992). Cell adhesion molecules as targets for Hox genes: neural cell adhesion molecule promoter activity is modulated by cotransfection with Hox-2.5 and -2.4. Proc Natl Acad Sci U S A 89, 2086-2090. Jones, R. J., Celano, P., Sharkis, S. J., and Sensenbrenner, L. L. (1989). Two phases of engraftment established by serial bone marrow transplantation in mice. Blood 73, 397-401. Jonveaux, P., and Berger, R. (1991). Rearrangement of the E2A gene in the t (1; 19) acute lymphoblastic leukemia. Nouv Rev Fr Hematol 33, 547-549. Jordan, C. T., McKearn, J. P., and Lemischka, I. R. (1990). Cellular and developmental properties of fetal hematopoietic stem cells. Cell 61, 953-963. Joyner, A. L. , and Martin, G. R. (1987). En-1 and En-2, two mouse genes with sequence homology to the Drosophila engrailed gene: expression during embryogenesis. Genes Dev 1, 29-38. Kakazu, N., Shinzato, I., Arai, Y. , Gotoh, S., Matsushita, A., Ishikawa, T., Nagai, K., Takahashi, T., Ohno, T., Tsuchiya, T., Ohki, M . , and Abe, T. (2001). Involvement of the NUP98 gene in a chromosomal translocation t(l 1 ;20)(pl5;ql 1.2) in a patient with acute monocytic leukemia (FAB-M5b). Int J Hematol 74, 53-57. Kalberer, C. P., Pawliuk, R., Imren, S., Bachelot, T., Takekoshi, K. J., Fabry, M . , Eaves, C. J., London, I. M . , Humphries, R. K., and Leboulch, P. (2000). Preselection of retrovirally transduced bone marrow avoids subsequent stem cell gene silencing and age-dependent extinction of expression of human beta-globin in engrafted mice. Proc Natl Acad Sci U S A 97, 5411-5415. Kamps, M . P. (1997). E2A-Pbxl induces growth, blocks differentiation, and interacts with other homeodomain proteins regulating normal differentiation. Curr Top Microbiol Immunol 220, 25-43. 168 Kamps, M . P., Murre, C , Sun, X. FL, and Baltimore, D. (1990). A new homeobox gene contributes the DNA binding domain of the t(l ;19) translocation protein in pre-B A L L . Cell 60, 547-555. Kamps, M . P., and Wright, D. D. (1994). Oncoprotein E2A-Pbxl immortalizes a myeloid progenitor in primary marrow cultures without abrogating its factor-dependence. Oncogene 9, 3159-3166. Kappen, C , Schughart, K., and Ruddle, F. H. (1989). Two steps in the evolution of Antennapedia-class vertebrate homeobox genes. Proc Natl Acad Sci U S A 86, 5459-5463. Kasper, L. FL, Brindle, P. K., Schnabel, C. A., Pritchard, C. E. , Cleary, M . L., and van Deursen, J. M . (1999). CREB binding protein interacts with nucleoporin-specific F G repeats that activate transcription and mediate NUP98-HOXA9 oncogenicity. Mol Cell Biol 19, 764-776. Kaufman, T. C , Seeger, M . A., and Olsen, G. (1990). Molecular and genetic organization of the antennapedia gene complex of Drosophila melanogaster. Adv Genet 27, 309-362. Kaushansky, K. (1998). Thrombopoietin and the hematopoietic stem cell. Blood 92, 1-3. Kawabe, T., Muslin, A. J., and Korsmeyer, S. J. (1997). HOX11 interacts with protein phosphatases PP2A and PP1 and disrupts a G2/M cell-cycle checkpoint. Nature 385, 454-458. Kawagoe, FL, Humphries, R. K., Blair, A., Sutherland, H. J., and Hogge, D. E. (1999). Expression of HOX genes, HOX cofactors, and M L L in phenotypically and functionally defined subpopulations of leukemic and normal human hematopoietic cells. Leukemia 13, 687-698. Keller, G., Kennedy, M . , Papayannopoulou, T., and Wiles, M . V. (1993). Hematopoietic commitment during embryonic stem cell differentiation in culture. Mol Cell Biol 13, 473-486. Keller, G., Paige, C , Gilboa, E. , and Wagner, E. F. (1985). Expression of a foreign gene in myeloid and lymphoid cells derived from multipotent haematopoietic precursors. Nature 318, 149-154. Keller, G., Wall, C , Fong, A. Z., Hawley, T. S., and Hawley, R. G. (1998). Overexpression of HOX 11 leads to the immortalization of embryonic precursors with both primitive and definitive hematopoietic potential. Blood 92, 877-887. Keller, G. M . (1995). In vitro differentiation of embryonic stem cells. Curr Opin Cell Biol 7, 862-869. 169 Kinsella, T. M . , and Nolan, G. P. (1996). Episomal vectors rapidly and stably produce high-titer recombinant retrovirus. Hum Gene Ther 7, 1405-1413. Kmita, M . , van Der Hoeven, F., Zakany, J., Krumlauf, R., and Duboule, D. (2000). Mechanisms of Hox gene colinearity: transposition of the anterior Hoxbl gene into the posterior HoxD complex. Genes Dev 14, 198-211. Kondo, T., and Duboule, D. (1999). Breaking colinearity in the mouse HoxD complex. Cell 97, 407-417. Kongsuwan, K., Allen, J., and Adams, J. M . (1989). Expression of Hox-2.4 homeobox gene directed by proviral insertion in a myeloid leukemia. Nucleic Acids Res 17, 1881-1892. Kornberg, R. D. (1999). Eukaryotic transcriptional control. Trends Cell Biol 9, M46-49. Kroon, E. , Krosl, J., Thorsteinsdottir, U., Baban, S., Buchberg, A. M . , and Sauvageau, G. (1998). Hoxa9 transforms primary bone marrow cells through specific collaboration with Meislabut not Pbxlb. Embo J 17, 3714-3725. Kroon, E. , Thorsteinsdottir, U., Mayotte, N., Nakamura, T., and Sauvageau, G. (2001). NUP98-HOXA9 expression in hemopoietic stem cells induces chronic and acute myeloid leukemias in mice. Embo J 20, 350-361. Krosl, J., Baban, S., Krosl, G., Rozenfeld, S., Largman, C , and Sauvageau, G. (1998). Cellular proliferation and transformation induced by HOXB4 and HOXB3 proteins involves cooperation with P B X L Oncogene 16, 3403-3412. Krumlauf, R. (1993). Hox genes and pattern formation in the branchial region of the vertebrate head. Trends Genet 9, 106-112. Krumlauf, R. (1994). Hox genes in vertebrate development. Cell 78, 191-201. Lander, E. S., Linton, L. M . , Birren, B., Nusbaum, C , Zody, M . C , Baldwin, J., Devon, K., Dewar, K., Doyle, M . , FitzHugh, W., Funke, R., Gage, D., Harris, K., Heaford, A., Howland, J., Kann, L. , Lehoczky, J., LeVine, R., McEwan, P., McKernan, K., Meldrim, J., Mesirov, J. P., Miranda, C , Morris, W., Naylor, J., Raymond, C , Rosetti, M . , Santos, R., Sheridan, A., Sougnez, C , Stange-Thomann, N., Stojanovic, N., Subramanian, A., Wyman, D., Rogers, J., Sulston, J., Ainscough, R., Beck, S., Bentley, D., Burton, J., Clee, C , Carter, N., Coulson, A., Deadman, R., Deloukas, P., Dunham, A., Dunham, I., Durbin, R., French, L., Grafham, D., Gregory, S., Hubbard, T., Humphray, S., Hunt, A., Jones, M . , Lloyd, C , McMurray, A., Matthews, L., Mercer, S., Milne, S., Mullikin, J. C , Mungall, A., Plumb, R., Ross, M . , Shownkeen, R., Sims, S., Waterston, R. H., Wilson, R. K., Hillier, L. W., McPherson, J. D., Marra, M . A., Mardis, E. R., Fulton, L. A. , 170 Chinwalla, A. T., Pepin, K. H., Gish, W. R., Chissoe, S. L., Wendl, M . C, Delehaunty, K. D., Miner, T. L., Delehaunty, A., Kramer, J. B., Cook, L. L. , Fulton, R. S., Johnson, D. L., Minx, P. J., Clifton, S. W., Hawkins, T., Branscomb, E. , Predki, P., Richardson, P., Wenning, S., Slezak, T., Doggett, N., Cheng, J. F., Olsen, A., Lucas, S., Elkin, C , Uberbacher, E. , Frazier, M . , et al. (2001). Initial sequencing and analysis of the human genome. International Human Genome Sequencing Consortium. Nature 409, 860-921. Lansdorp, P. M . (1997). Self-renewal of stem cells. Biol Blood Marrow Transplant 3, 171-178. Lansdorp, P. M . , Sutherland, H. J., and Eaves, C. J. (1990). Selective expression of CD45 isoforms on functional subpopulations of CD34+ hemopoietic cells from human bone marrow. J Exp Med 172, 363-366. Laughon, A. (1991). DNA binding specificity of homeodomains. Biochemistry 30, 11357-11367. Lavau, C , Du, C , Thirman, M . , and Zeleznik-Le, N. (2000). Chromatin-related properties of CBP fused to M L L generate a myelodysplastic-like syndrome that evolves into myeloid leukemia. Embo J 19, 4655-4664. Lavau, C , Luo, R. T., Du, C , and Thirman, M . J. (2000). Retrovirus-mediated gene transfer of M L L - E L L transforms primary myeloid progenitors and causes acute myeloid leukemias in mice. Proc Natl Acad Sci U S A 97, 10984-10989. Lawrence, H. J., Helgason, C. D., Sauvageau, G., Fong, S., Izon, D. J., Humphries, R. K., and Largman, C. (1997). Mice bearing a targeted interruption of the homeobox gene HOXA9 have defects in myeloid, erythroid, and lymphoid hematopoiesis. Blood 89, 1922-1930. Lawrence, H. J., and Largman, C. (1992). Homeobox genes in normal hematopoiesis and leukemia. Blood 80, 2445-2453. Lawrence, H. J., Rozenfeld, S., Cruz, C , Matsukuma, K., Kwong, A., Komuves, L., Buchberg, A. M . , and Largman, C. (1999). Frequent co-expression of the HOXA9 and MEIS1 homeobox genes in human myeloid leukemias. Leukemia 13,1993-1999. Lawrence, H. J., Sauvageau, G., Ahmadi, N., Lopez, A. R., LeBeau, M . M . , Link, M . , Humphries, K., and Largman, C. (1995). Stage- and lineage-specific expression of the HOXA10 homeobox gene in normal and leukemic hematopoietic cells. Exp Hematol 23, 1160-1166. Lawrence, H. J., Sauvageau, G., Humphries, R. K., and Largman, C. (1996). The role of HOX homeobox genes in normal and leukemic hematopoiesis. Stem Cells 14, 281-291. 171 Lawrence, H. J., Stage, K. M . , Mathews, C. H., Detmer, K., Scibienski, R., MacKenzie, M . , Migliaccio, E. , Boncinelli, E. , and Largman, C. (1993). Expression of HOX C homeobox genes in lymphoid cells. Cell Growth Differ 4, 665-669. Lawrence, P. A., and Morata, G. (1994). Homeobox genes: their function in Drosophila segmentation and pattern formation. Cell 78, 181-189. Lessard, J., Baban, S., and Sauvageau, G. (1998). Stage-specific expression of polycomb group genes in human bone marrow cells. Blood 91, 1216-1224. Lessard, J., Schumacher, A., Thorsteinsdottir, U., van Lohuizen, M . , Magnuson, T., and Sauvageau, G. (1999). Functional antagonism of the Polycomb-Group genes eed and Bmil in hemopoietic cell proliferation. Genes Dev 13, 2691-2703. Lewis, E. B. (1978). A gene complex controlling segmentation in Drosophila. Nature 276, 565-570. Li , F., Lu, S., Vida, L., Thomson, J. A., and Honig, G. R. (2001). Bone morphogenetic protein 4 induces efficient hematopoietic differentiation of rhesus monkey embryonic stem cells in vitro. Blood 98, 335-342. Li , S., Aufiero, B., Schiltz, R. L., and Walsh, M . J. (2000). Regulation of the homeodomain C C A A T displacement/cut protein function by histone acetyltransferases p300/CREB-binding protein (CBP)-associated factor and CBP. Proc Natl Acad Sci U S A 97,7166-7171. Look, A. T. (1997). Oncogenic transcription factors in the human acute leukemias. Science 278,1059-1064. Lowney, P., Corral, J., Detmer, K., LeBeau, M . M . , Deaven, L., Lawrence, H. J., and Largman, C. (1991). A human Hox 1 homeobox gene exhibits myeloid-specific expression of alternative transcripts in human hematopoietic cells. Nucleic Acids Res 19, 3443.3449. Lowry, P. A., Shultz, L. D., Greiner, D. L., Hesselton, R. M . , Kittler, E. L. , Tiarks, C. Y. , Rao, S. S., Reilly, J., Leif, J. H., Ramshaw, H., Stewart, F. M . , and Quesenberry, P. J. (1996). Improved engraftment of human cord blood stem cells in NOD/LtSz-scid/scid mice after irradiation or multiple-day injections into unirradiated recipients. Biol Blood Marrow Transplant 2, 15-23. Lozzio, C. B., and Lozzio, B. B. (1975). Human chronic myelogenous leukemia cell line with positive Philadelphia chromosome. Blood 45, 312-317. 172 Lu, M , Gong, Z. Y. , Shen, W. F., and Ho, A. D. (1991). The tcl-3 proto-oncogene altered by chromosomal translocation in T-cell leukemia codes for a homeobox protein. Embo J 10, 2905-2910. Lufkin, T. (1997). Transcriptional regulation of vertebrate Hox genes during embryogenesis. Crit Rev Eukaryot Gene Expr 7, 195-213. Lufkin, T., Dierich, A., LeMeur, M . , Mark, M . , and Chambon, P. (1991). Disruption of the Hox-1.6 homeobox gene results in defects in a region corresponding to its rostral domain of expression. Cell 66, 1105-1119. Lumsden, A., and Keynes, R. (1989). Segmental patterns of neuronal development in the chick hindbrain. Nature 337, 424-428. Maconochie, M . K., Nonchev, S., Studer, M . , Chan, S. K., Popperl, H , Sham, M . H , Mann, R. S., and Krumlauf, R. (1997). Cross-regulation in the mouse HoxB complex: the expression of Hoxb2 in rhombomere 4 is regulated by Hoxbl. Genes Dev 11, 1885-1895. Magli, M . C , Barba, P., Celetti, A., De Vita, G., Cillo, C , and Boncinelli, E . (1991). Coordinate regulation of HOX genes in human hematopoietic cells. Proc Natl Acad Sci U S A 88, 6348-6352. Mamo, A., Thorsteinsdottir, U., Kroon, E. , Bijl, J., Lawrence, H. J., Largman, C , Humphries, R. K., and Sauvageau, G. (1999). HOXA9: A key regulator of proliferation of primitive hematopoietic cells. Blood Supplement 1, 250a. Mann, R. S. (1995). The specificity of homeotic gene function. Bioessays 17, 855-863. Mann, R. S., and Chan, S. K. (1996). Extra specificity from extradenticle: the partnership between HOX and PBX/EXD homeodomain proteins. Trends Genet 12, 258-262. Mansouri, A., Goudreau, G., and Gruss, P. (1999). Pax genes and their role in organogenesis. Cancer Res 59,1707s-1709s; discussion 1709s-1710s. Manzanares, M . , Bel-Vialar, S., Ariza-McNaughton, L., Ferretti, E. , Marshall, H , Maconochie, M . M . , Blasi, F., and Krumlauf, R. (2001). Independent regulation of initiation and maintenance phases of Hoxa3 expression in the vertebrate hindbrain involve auto- and cross-regulatory mechanisms. Development 128, 3595-3607. Manzanares, M . , Cordes, S., Ariza-McNaughton, L., Sadl, V., Maruthainar, K., Barsh, G., and Krumlauf, R. (1999). Conserved and distinct roles of kreisler in regulation of the paralogous Hoxa3 and Hoxb3 genes. Development 126, 759-769. Manzanares, M . , Cordes, S., Kwan, C. T., Sham, M . H., Barsh, G. S., and Krumlauf, R. (1997). Segmental regulation of Hoxb-3 by kreisler. Nature 387,191-195. 173 Manzanares, M . , Wada, H., Itasaki, N., Trainor, P. A., Krumlauf, R., and Holland, P. W. (2000). Conservation and elaboration of Hox gene regulation during evolution of the vertebrate head. Nature 408, 854-857. Markowitz, D., Goff, S., and Bank, A. (1988). A safe packaging line for gene transfer: separating viral genes on two different plasmids. J Virol 62,1120-1124. Marshall, C. J., and Thrasher, A. J. (2001). The embryonic origins of human haematopoiesis. Br J Haematol 112, 838-850. Martin, D. I., Zon, L. I., Mutter, G., and Orkin, S. H. (1990). Expression of an erythroid transcription factor in megakaryocytic and mast cell lineages. Nature 344, 444-447. Mathews, C. H., Detmer, K., Boncinelli, E. , Lawrence, H. J., and Largman, C. (1991). Erythroid-restricted expression of homeobox genes of the human HOX 2 locus. Blood 78, 2248-2252. Matsuoka, S., Ebihara, Y. , Xu, M . , Ishii, T., Sugiyama, D., Yoshino, H , Ueda, T., Manabe, A., Tanaka, R., Dceda, Y. , Nakahata, T., and Tsuji, K. (2001). CD34 expression on long-term repopulating hematopoietic stem cells changes during developmental stages. Blood 97, 419-425. Mayani, H , Dragowska, W., and Lansdorp, P. M . (1993). Lineage commitment in human hemopoiesis involves asymmetric cell division of multipotent progenitors and does not appear to be influenced by cytokines. J Cell Physiol 157, 579-586. McGinnis, W., and Kuziora, M . (1994). The molecular architects of body design. Sci Am 270,58-61,64-56. McKercher, S. R., Torbett, B. E. , Anderson, K. L., Henkel, G. W., Vestal, D. J., Baribault, H. , Klemsz, M . , Feeney, A. J., Wu, G. E. , Paige, C. J., and Maki, R. A. (1996). Targeted disruption of the PU.l gene results in multiple hematopoietic abnormalities. Embo J 15, 5647-5658. Mead, P. E. , Deconinck, A. E. , Huber, T. L., Orkin, S. H , and Zon, L. L (2001). Primitive erythropoiesis in the Xenopus embryo: the synergistic role of LMO-2, SCL and G A T A -binding proteins. Development 128, 2301-2308. Medvinsky, A., and Dzierzak, E. (1996). Definitive hematopoiesis is autonomously initiated by the A G M region. Cell 86, 897-906. Mercader, N. , Leonardo, E. , Azpiazu, N., Serrano, A., Morata, G., Martinez, C , and Torres, M . (1999). Conserved regulation of proximodistal limb axis development by Meisl/Hth. Nature 402, 425-429. 174 Metcalf, D. (1993). Hematopoietic regulators: redundancy or subtlety? Blood 82, 3515-3523. Metcalf, D. (1998). Lineage commitment and maturation in hematopoietic cells: the case for extrinsic regulation. Blood 92, 345-347; discussion 352. Metcalf, D. (1991). Lineage commitment of hemopoietic progenitor cells in developing blast cell colonies: influence of colony-stimulating factors. Proc Natl Acad Sci U S A 88, 11310-11314. Metzler, M . , Helgason, C. D., Dragatsis, I., Zhang, T., Gan, L., Pineault, N., Zeitlin, S. O., Humphries, R. K., and Hayden, M . R. (2000). Huntingtin is required for normal hematopoiesis. Hum Mol Genet 9, 387-394. Micklem, H. S., and Loutit, J. F. (1966). Tissue Grafting and Radiation (New York: New York Academy of Sciences Press). Miller, C. L. , and Eaves, C. J. (1997). Expansion in vitro of adult murine hematopoietic stem cells with transplantable lympho-myeloid reconstituting ability. Proc Natl Acad Sci U S A 94, 13648-13653. Minowada, J., Onuma, T., and Moore, G. E. (1972). Rosette-forming human lymphoid cell lines. I. Establishment and evidence for origin of thymus-derived lymphocytes. J Natl Cancer Inst 49, 891-895. Monica, K., Galili, N., Nourse, J., Saltman, D., and Cleary, M . L. (1991). PBX2 and PBX3, new homeobox genes with extensive homology to the human proto-oncogene P B X L Mol Cell Biol 11, 6149-6157. Moretti, P., Simmons, P., Thomas, P., Haylock, D., Rathjen, P., Vadas, M . , and D'Andrea, R. (1994). Identification of homeobox genes expressed in human haemopoietic progenitor cells. Gene 144, 213-219. Morrison, A., Ariza-McNaughton, L., Gould, A., Featherstone, M . , and Krumlauf, R. (1997). HOXD4 and regulation of the group 4 paralog genes. Development 124, 3135-3146. Morrison, S. J., Hemmati, H. D., Wandycz, A. M . , and Weissman, I. L. (1995). The purification and characterization of fetal liver hematopoietic stem cells. Proc Natl Acad Sci U S A 92, 10302-10306. Morrison, S. J., Shah, N. M . , and Anderson, D. J. (1997). Regulatory mechanisms in stem cell biology. Cell 88, 287-298. 175 Muller, A. M., Medvinsky, A., Strouboulis, J., Grosveld, F., and Dzierzak, E. (1994). Development of hematopoietic stem cell activity in the mouse embryo. Immunity 7, 291-301. Nakamura, T., Jenkins, N. A., and Copeland, N. G. (1996). Identification of a new family of Pbx-related homeobox genes. Oncogene 13, 2235-2242. Nakamura, T., Largaespada, D. A., Lee, M. P., Johnson, L. A., Ohyashiki, K., Toyama, K., Chen, S. J., Willman, C. L., Chen, I. M., Feinberg, A. P., Jenkins, N. A., Copeland, N. G., and Shaughnessy, J. D., Jr. (1996). Fusion of the nucleoporin gene NUP98 to HOXA9 by the chromosome translocation t(7;l I)(pl5;pl5) in human myeloid leukaemia. Nat Genet 12, 154-158. Nakamura, T., Largaespada, D. A., Shaughnessy, J. D., Jr., Jenkins, N. A., and Copeland, N. G. (1996). Cooperative activation of Hoxa and Pbxl-related genes in murine myeloid leukaemias. Nat Genet 12, 149-153. Nakamura, T., Yamazaki, Y., Hatano, Y., and Miura, I. (1999). NUP98 is fused to PMX1 homeobox gene in human acute myelogenous leukemia with chromosome translocation t(l;ll)(q23;pl5). Blood 94, 741-747. Nigg, E. A. (1997). Nucleocytoplasmic transport: signals, mechanisms and regulation. Nature 386, 779-787. Nishinakamura, R., Miyajima, A., Mee, P. J., Tybulewicz, V. L., and Murray, R. (1996). Hematopoiesis in mice lacking the entire granulocyte-macrophage colony-stimulating factor/interleukin-3/interleukin-5 functions. Blood 88, 2458-2464. Nishinakamura, R., Nakayama, N., Hirabayashi, Y., Inoue, T., Aud, D., McNeil, T., Azuma, S., Yoshida, S., Toyoda, Y., Arai, K., and et al. (1995). Mice deficient for the IL-3/GM-CSF/IL-5 beta c receptor exhibit lung pathology and impaired immune response, while beta IL3 receptor-deficient mice are normal. Immunity 2, 211-222. Nishiyama, M., Arai, Y., Tsunematsu, Y., Kobayashi, H., Asami, K., Yabe, M., Kato, S., Oda, M., Eguchi, H., Ohki, M., and Kaneko, Y. (1999). Ilpl5 translocations involving the NUP98 gene in childhood therapy-related acute myeloid leukemia/myelodysplastic syndrome. Genes Chromosomes Cancer 26, 215-220. Ogawa, M. (1993). Differentiation and proliferation of hematopoietic stem cells. Blood 81, 2844-2853. Okada, S., Nakauchi, H., Nagayoshi, K., Nishikawa, S., Miura, Y., and Suda, T. (1991). Enrichment and characterization of murine hematopoietic stem cells that express c-kit molecule. Blood 78, 1706-1712. 176 Okuda, T., Cai, Z., Yang, S., Lenny, N., Lyu, C. J., van Deursen, J. M . , Harada, H. , and Downing, J. R. (1998). Expression of a knocked-in AML1-ETO leukemia gene inhibits the establishment of normal definitive hematopoiesis and directly generates dysplastic hematopoietic progenitors. Blood 91, 3134-3143. Okuda, T., van Deursen, J., Hiebert, S. W., Grosveld, G., and Downing, J. R. (1996). AML1, the target of multiple chromosomal translocations in human leukemia, is essential for normal fetal liver hematopoiesis. Cell 84, 321-330. Orkin, S. H. (2000). Diversification of haematopoietic stem cells to specific lineages. Nature Reviews 1, 57-64. Orkin, S. H. (1995). Hematopoiesis: how does it happen? Curr Opin Cell Biol 7, 870-877. Orphanides, G., Lagrange, T., and Reinberg, D. (1996). The general transcription factors of RNA polymerase II. Genes Dev 10, 2657-2683. Osawa, M . , Hanada, K., Hamada, H., and Nakauchi, H. (1996). Long-term lymphohematopoietic reconstitution by a single CD34-low/negative hematopoietic stem cell. Science 273, 242-245. Palis, J., Kingsley, P. D., McGrath, K. E. , and Silver-Morse, L. (1994). Gene expression during early mouse yolc sac development. Blood 84. Palis, J., and Yoder, M . C. (2001). Yolk-sac hematopoiesis: the first blood cells of mouse and man. Exp Hematol 29, 927-936. Pata, I., Studer, M . , van Doorninck, J. H., Briscoe, J., Kuuse, S., Engel, J. D., Grosveld, F., and Karis, A. (1999). The transcription factor G A T A3 is a downstream effector of Hoxbl specification in rhombomere 4. Development 126, 5523-5531. Patel, C. V. , Sharangpani, R., Bandyopadhyay, S., and DiCorleto, P. E. (1999). Endothelial cells express a novel, tumor necrosis factor-alpha- regulated variant of HOXA9. J Biol Chem 274, 1415-1422. Pawliuk, R., Eaves, C , and Humphries, R. K. (1996). Evidence of both ontogeny and transplant dose-regulated expansion of hematopoietic stem cells in vivo. Blood 88, 2852-2858. Pawliuk, R., Kay, R., Lansdorp, P., and Humphries, R. K. (1994). Selection of retrovirally transduced hematopoietic cells using CD24 as a marker of gene transfer. Blood 84, 2868-2877. 177 Pedersen-Bjergaard, J., Andersen, M . K., and Christiansen, D. H. (2000). Therapy-related acute myeloid leukemia and myelodysplasia after high-dose chemotherapy and autologous stem cell transplantation. Blood 95, 3273-3279. Perkins, A., Kongsuwan, K., Visvader, J., Adams, J. M , and Cory, S. (1990). Homeobox gene expression plus autocrine growth factor production elicits myeloid leukemia. Proc Natl Acad Sci U S A 87, 8398-8402. Pevny, L. , Simon, M . C , Robertson, E. , Klein, W. H., Tsai, S. F., DAgati, V., Orkin, S. H. , and Costantini, F. (1991). Erythroid differentiation in chimaeric mice blocked by a targeted mutation in the gene for transcription factor GATA-1. Nature 349, 257-260. Pflumio, F., Izac, B., Katz, A., Shultz, L. D., Vainchenker, W., and Coulombel, L. (1996). Phenotype and function of human hematopoietic cells engrafting immune-deficient CB17-severe combined immunodeficiency mice and nonobese diabetic-severe combined immunodeficiency mice after transplantation of human cord blood mononuclear cells. Blood «?<?, 3731-3740. Phillips RL, E. R., Brunk B, Ivanova N, Mahan MA, Deanehan JK, Moore K A , Overton GC, Lemischka IR (2000). The genetic program of hematopoietic stem cells. Science 28, 1635-1640. Pineault, N. (2001). Chapter 3 of this thesis. Pirrotta, V. (1997). PcG complexes and chromatin silencing. Curr Opin Genet Dev 7, 249-258. Popperl, H. , Bienz, M . , Studer, M . , Chan, S. K., Aparicio, S., Brenner, S., Mann, R. S., and Krumlauf, R. (1995). Segmental expression of Hoxb-1 is controlled by a highly conserved autoregulatory loop dependent upon exd/pbx. Cell 81, 1031-1042. Quandt, K., Freeh, K., Karas, H., Wingender, E. , and Werner, T. (1995). Matlnd and Matlnspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res 23, 4878-4884. Quaranta, M . T., Petrini, M . , Tritarelli, E. , Samoggia, P., Care, A., Bottero, L., Testa, U., and Peschle, C. (1996). HOXB cluster genes in activated natural killer lymphocytes: expression from 3'~>5' cluster side and proliferative function. J Immunol 157, 2462-2469. Radu, A., Moore, M . S., and Blobel, G. (1995). The peptide repeat domain of nucleoporin Nup98 functions as a docking site in transport across the nuclear pore complex. Cell 81, 215-222. 178 Raman, V., Martensen, S. A., Reisman, D., Evron, E. , Odenwald, W. F., Jaffee, E. , Marks, J., and Sukumar, S. (2000). Compromised HOXA5 function can limit p53 expression in human breast tumours. Nature 405, 974-978. Raman, V. , Tamori, A., Vali, M . , Zeller, K., Korz, D., and Sukumar, S. (2000). HOXA5 regulates expression of the progesterone receptor. J Biol Chem 275, 26551-26555. Rancourt, D. E. , Tsuzuki, T., and Capecchi, M . R. (1995). Genetic interaction between hoxb-5 and hoxb-6 is revealed by nonallelic noncomplementation. Genes Dev 9, 108-122. Raza-Egilmez, S. Z., Jani-Sait, S. N., Grossi, M . , Higgins, M . J., Shows, T. B., and Apian, P. D. (1998). NUP98-HOXD13 gene fusion in therapy-related acute myelogenous leukemia. Cancer Res 58, 4269-4273. Rebel, V. I., Miller, C. L., Eaves, C. J., and Lansdorp, P. M . (1996). The repopulation potential of fetal liver hematopoietic stem cells in mice exceeds that of their liver adult bone marrow counterparts. Blood 87, 3500-3507. Rebel, V. I., Miller, C. L., Thornbury, G. R., Dragowska, W. H., Eaves, C. J., and Lansdorp, P. M . (1996). A comparison of long-term repopulating hematopoietic stem cells in fetal liver and adult bone marrow from the mouse. Exp Hematol 24, 638-648. Rhoades, K. L. , Hetherington, C. J., Harakawa, N., Yergeau, D. A., Zhou, L. , Liu, L. Q., Little, M . T., Tenen, D. G., and Zhang, D. E. (2000). Analysis of the role of AML1-ETO in leukemogenesis, using an inducible transgenic mouse model. Blood 96, 2108-2115. Roberts, D. J., Johnson, R. L., Burke, A. C , Nelson, C. E. , Morgan, B. A., and Tabin, C. (1995). Sonic hedgehog is an endodermal signal inducing Bmp-4 and Hox genes during induction and regionalization of the chick hindgut. Development 121, 3163-3174. Rosic-Kablar, S., Chan, K., Reis, M . D., Dube, I. D., and Hough, M . R. (2000). Induction of tolerance to immunogenic tumor antigens associated with lymphomagenesis in HOX11 transgenic mice. Proc Natl Acad Sci U S A 97,13300-13305. Rots, N. Y. , Liu, M . , Anderson, E. C , and Freedman, L. P. (1998). A differential screen for ligand-regulated genes: identification of HoxAlO as a target of vitamin D3 induction in myeloid leukemic cells. Mol Cell Biol 18, 1911-1918. Rubnitz, J. E. , and Look, A. T. (1998). Molecular basis of leukemogenesis. Curr Opin Hematol 5, 264-270. Russell, E. S., and Bernstein, S. E. (1966). Blood and blood formation, 2 Edition, E. L. Green, ed. (New York: McGraw-Hill). 179 Saleh, M . , Rambaldi, I., Yang, X. J., and Featherstone, M . S. (2000). Cell signaling switches HOX-PBX complexes from repressors to activators of transcription mediated by histone deacetylases and histone acetyltransferases. Mol Cell Biol 20, 8623-8633. Sambrook. J, F. E. F., and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Sauvageau, G., Lansdorp, P. M . , Eaves, C. J., Hogge, D. E. , Dragowska, W. H., Reid, D. S., Largman, C , Lawrence, H. J., and Humphries, R. K. (1994). Differential expression of homeobox genes in functionally distinct CD34+ subpopulations of human bone marrow cells. Proc Natl Acad Sci U S A 91, \22T3-\2221. Sauvageau, G., Thorsteinsdottir, U., Eaves, C. J., Lawrence, H. J., Largman, C , Lansdorp, P. M . , and Humphries, R. K. (1995). Overexpression of HOXB4 in hematopoietic cells causes the selective expansion of more primitive populations in vitro and in vivo. Genes Dev 9, 1753-1765. Sauvageau, G., Thorsteinsdottir, U., Hough, M . R., Hugo, P., Lawrence, H. J., Largman, C , and Humphries, R. K. (1997). Overexpression of HOXB3 in hematopoietic cells causes defective lymphoid development and progressive myeloproliferation. Immunity 6, 13-22. Schnabel, C. A., and Abate-Shen, C. (1996). Repression by HoxA7 is mediated by the homeodomain and the modulatory action of its N-terminal-arm residues. Mol Cell Biol 16, 2678-2688. Schnabel, C. A., Jacobs, Y. , and Cleary, M . L. (2000). HoxA9-mediated immortalization of myeloid progenitors requires functional interactions with T A L E cofactors Pbx and Meis. Oncogene 19, 608-616. Schreiner, S., Birke, M . , Garcia-Cuellar, M . P., Zilles, O., Greil, J., and Slany, R. K. (2001). M L L - E N L causes a reversible and myc-dependent block of myelomonocytic cell differentiation. Cancer Res 61, 6480-6486. Schughart, K., Kappen, C , and Ruddle, F. H. (1989). Duplication of large genomic regions during the evolution of vertebrate homeobox genes. Proc Natl Acad Sci U S A 86, 7067-7071. Schumacher, A., and Magnuson, T. (1997). Murine Polycomb- and trithorax-group genes regulate homeotic pathways and beyond. Trends Genet 13,167-170. Scott, E. W., Simon, M . C , Anastasi, J., and Singh, H. (1994). Requirement of transcription factor PU.l in the development of multiple hematopoietic lineages. Science 265, 1573-1577. 180 Seidel, H. M . , Milocco, L. H., Lamb, P., Darnell, J. E. , Jr., Stein, R. B., and Rosen, J. (1995). Spacing of palindromic half sites as a determinant of selective STAT (signal transducers and activators of transcription) DNA binding and transcriptional activity. Proc Natl Acad Sci U S A 92, 3041-3045. Sham, M . H. , Hunt, P., Nonchev, S., Papalopulu, N., Graham, A., Boncinelli, E. , and Krumlauf, R. (1992). Analysis of the murine Hox-2.7 gene: conserved alternative transcripts with differential distributions in the nervous system and the potential for shared regulatory regions. Embo J 11, 1825-1836. Sham, M . H. , Vesque, C., Nonchev, S., Marshall, H., Frain, M . , Gupta, R. D., Whiting, J., Wilkinson, D., Charnay, P., and Krumlauf, R. (1993). The zinc finger gene Krox20 regulates HoxB2 (Hox2.8) during hindbrain segmentation. Cell 72, 183-196. Shanmugam, K., Green, N. C , Rambaldi, I., Saragovi, H. U., and Featherstone, M . S. (1999). PBX and MEIS as non-DNA-binding partners in trimeric complexes with H O X proteins. Mol Cell Biol 19, 7577-7588. Shen, W. F., Chang, C. P., Rozenfeld, S., Sauvageau, G., Humphries, R. K., Lu, M . , Lawrence, H. J., Geary, M . L., and Largman, C. (1996). Hox homeodomain proteins exhibit selective complex stabilities with Pbx and DNA. Nucleic Acids Res 24, 898-906. Shen, W. F., Montgomery, J. C , Rozenfeld, S., Moskow, J. J., Lawrence, H. J., Buchberg, A. M . , and Largman, C. (1997). AbdB-like Hox proteins stabilize DNA binding by the Meisl homeodomain proteins. Mol Cell Biol 17, 6448-6458. Shen, W. F., Rozenfeld, S., Kwong, A., Kom ves, L. G., Lawrence, H. J., and Largman, C. (1999). HOXA9 forms triple complexes with PBX2 and MEIS1 in myeloid cells. Mol Cell Biol 19, 3051-3061. Shen, W. F., Rozenfeld, S., Lawrence, H. J., and Largman, C. (1997). The Abd-B-like Hox homeodomain proteins can be subdivided by the ability to form complexes with Pbx la on a novel DNA target. J Biol Chem 272, 8198-8206. Shi, X., Bai, S., Li , L. , and Cao, X. (2001). Hoxa-9 Represses Transforming Growth Factor-beta -induced Osteopontin Gene Transcription. J Biol Chem 276, 850-855. Shi, X., Yang, X., Chen, D., Chang, Z., and Cao, X. (1999). Smadl interacts with homeobox DNA-binding proteins in bone morphogenetic protein signaling. J Biol Chem 274,13711-13717. Shimada, H. , Arai, Y. , Sekiguchi, S., Ishii, T., Tanitsu, S., and Sasaki, M . (2000). Generation of the NUP98-HOXD13 fusion transcript by a rare translocation, t(2;l I)(q31;pl5), in a case of infant leukaemia. Br J Haematol 110, 210-213. 181 Shimamoto, T., Ohyashiki, K., and Takeshita, K. (2000). Overexpression of the homeobox gene DLX-7 inhibits apoptosis by induced expression of intercellular adhesion molecule-1. Exp Hematol 28, 433-441. Shimamoto, T., Tang, Y. , Naot, Y. , Nardi, M . , Brulet, P., Bieberich, C. J., and Takeshita, K. (1999). Hematopoietic progenitor cell abnormalities in Hoxc-8 null mutant mice. J Exp Zool 283, 186-193. Shivdasani RA, M . E. , Orkin SH (1995). Absence of blood formation in mice lacking the T-cell leukaemia oncoprotein tal-l/SCL. Nature 373, 432-434. Shivdasani, R. A., and Orkin, S. H. (1996). The transcriptional control of hematopoiesis. Blood 87, 4025-4039. Simeone, A., Acampora, D., Arcioni, L. , Andrews, P. W., Boncinelli, E. , and Mavilio, F. (1990). Sequential activation of HOX2 homeobox genes by retinoic acid in human embryonal carcinoma cells. Nature 346, 763-766. Simeone, A., Pannese, M . , Acampora, D., D'Esposito, M . , and Boncinelli, E. (1988). At least three human homeoboxes on chromosome 12 belong to the same transcription unit. Nucleic Acids Res 16, 5379-5390. Simmons, P. J., Masinovsky, B., Longenecker, B. M . , Berenson, R., Torok-Storb, B., and Gallatin, W. M . (1992). Vascular cell adhesion molecule-1 expressed by bone marrow stromal cells mediates the binding of hematopoietic progenitor cells. Blood 80, 388-395. Singh, N. , Phillips, R. A., Iscove, N. N., and Egan, S. E. (2000). Expression of notch receptors, notch ligands, and fringe genes in hematopoiesis. Exp Hematol 28, 527-534. Spangrude, G. J., Heimfeld, S., and Weissman, I. L. (1988). Purification and characterization of mouse hematopoietic stem cells. Science 241, 58-62. Stelnicki, E. J., Arbeit, J., Cass, D. L. , Saner, C , Harrison, M . , and Largman, C. (1998). Modulation of the human homeobox genes PRX-2 and HOXB13 in scarless fetal wounds. J Invest Dermatol 111, 57-63. St-Jacques, B., and McMahon, A. P. (1996). Early mouse development: lessons from gene targeting. Curr Opin Genet Dev 6, 439-444. Struhl, K. (1998). Histone acetylation and transcriptional regulatory mechanisms. Genes Dev 12, 599-606. Sundstorm, C , and Nilsson, K. (1976). Establishement and characterization of a human lymphoma cell line (U-937). International journal of cancer 17. 182 Szilvassy, S. J., Humphries, R. K., Lansdorp, P. M . , Eaves, A. C , and Eaves, C. J. (1990). Quantitative assay for totipotent reconstituting hematopoietic stem cells by a competitive repopulation strategy. Proc Natl Acad Sci U S A 87, 8736-8740. T. Kondo, N. T., M . Muramastu (1992). The regulation of the murine Hox 2.5 gene expression during cell differentiation. Nucleic Acid Researsh 20, 5729-5735. Tabin, C. J., and Johnson, R. L. (2001). Developmental biology: clocks and hox. Nature 422,780-781. Taniguchi, Y. , Komatsu, N., and Moriuchi, T. (1995). Overexpression of the HOX4A (HOXD3) homeobox gene in human erythroleukemia HEL cells results in altered adhesive properties. Blood 85, 2786-2794. Tavian, M . , Robin, C , Coulombel, L. , and Peault, B. (2001). The human embryo, but not its yolk sac, generates lympho-myeloid stem cells, mapping multipotent hematopoietic cell fate in intraembryonic mesoderm. Immunity 15,487-495. Tenen, D. G., Hromas, R., Licht, J. D., and Zhang, D. E. (1997). Transcription factors, normal myeloid development, and leukemia. Blood 90, 489-519. Thorsteinsdottir, U., Kroon, E. , Jerome, L., Blasi, F., and Sauvageau, G. (2001). Defining roles for HOX and MEIS1 genes in induction of acute myeloid leukemia. Mol Cell Biol 21, 224-234. Thorsteinsdottir, U., Krosl, J., Kroon, E. , Haman, A., Hoang, T., and Sauvageau, G. (1999). The oncoprotein E2A-Pbxla collaborates with Hoxa9 to acutely transform primary bone marrow cells. Mol Cell Biol 19, 6355-6366. Thorsteinsdottir, U., Sauvageau, G., Hough, M . R., Dragowska, W., Lansdorp, P. M . , Lawrence, H. J., Largman, C , and Humphries, R. K. (1997). Overexpression of HOXA10 in murine hematopoietic cells perturbs both myeloid and lymphoid differentiation and leads to acute myeloid leukemia. Mol Cell Biol 17, 495-505. Till, J. E. , and McCulloch, E. A. (1961). A direct measurement of the radiation sensitivity of normal mouse bone marrow cells. Radiat. Res. 14, 213-222. Till, J. E. , McCulloch, E. A., and Siminovitch, L. (1964). A stochastic model of stem cell proliferation, based on the growth of spleen colony-forming cells. Proc Natl Acad Sci U S A 51, 29. Tsai, F. Y. , Keller, G., Kuo, F. C , Weiss, M . , Chen, J., Rosenblatt, M . , Alt, F. W., and Orkin, S. H. (1994). An early haematopoietic defect in mice lacking the transcription factor GATA-2. Nature 371,221-226. 183 Tsai, S. F., Martin, D. I., Zon, L. I., D'Andrea, A. D., Wong, G. G., and Orkin, S. H. (1989). Cloning of cDNA for the major DNA-binding protein of the erythroid lineage through expression in mammalian cells. Nature 339, 446-451. Uyeno, L. A., Newman-Keagle, J. A., Cheung, I., Hunt, T. K., Young, D. M . , and Boudreau, N. (2001). Hox D3 expression in normal and impaired wound healing. J Surg Res 100, 46-56. Valtieri, M . , Santoli, D., Caracciolo, D., Kreider, B. L., Altmann, S. W., Tweardy, D. J., Gemperlein, I., Mavilio, F., Lange, B., and Rovera, G. (1987). Establishment and characterization of an undifferentiated human T leukemia cell line which requires granulocyte-macrophage colony stimulatory factor for growth. J Immunol 138, 4042-4050. Van Den Berg, D. J., Sharma, A. K., Bruno, E. , and Hoffman, R. (1998). Role of members of the Wnt gene family in human hematopoiesis. Blood 92, 3189-3202. van der Hoeven, F., Zakany, J., and Duboule, D. (1996). Gene transpositions in the HoxD complex reveal a hierarchy of regulatory controls. Cell 85, 1025-1035. van der Lugt, N. M . , Domen, J., Linders, K., van Roon, M . , Robanus-Maandag, E. , te Riele, H. , van der Valk, M . , Deschamps, J., Sofroniew, M . , van Lohuizen, M . , and et al. (1994). Posterior transformation, neurological abnormalities, and severe hematopoietic defects in mice with a targeted deletion of the bmi-1 proto-oncogene. Genes Dev 8, 757-769. van Oostveen, J., Bijl, J., Raaphorst, F., Walboomers, J., and Meijer, C. (1999). The role of homeobox genes in normal hematopoiesis and hematological malignancies. Leukemia 13, 1675-1690. Vieille-Grosjean, I., and Huber, P. (1995). Transcription factor GATA-1 regulates human HOXB2 gene expression in erythroid cells. J Biol Chem 270, 4544-4550. Vieille-Grosjean, I., Roullot, V. , and Courtois, G. (1992). Lineage and stage specific expression of HOX 1 genes in the human hematopoietic system. Biochem Biophys Res C o m m u n i s , 1124-1130. Vigano, M . A., Di Rocco, G., Zappavigna, V., and Mavilio, F. (1998). Definition of the transcriptional activation domains of three human HOX proteins depends on the DNA-binding context. Mol Cell Biol 18, 6201-6212. von Lindern, M . , Fornerod, M . , van Baal, S., Jaegle, M . , de Wit, T., Buijs, A., and Grosveld, G. (1992). The translocation (6;9), associated with a specific subtype of acute myeloid leukemia, results in the fusion of two genes, dek and can, and the expression of a chimeric, leukemia-specific dek-can mRNA. Mol Cell Biol 12,1687-1697. 184 Wadman, I., Li , J., Bash, R. O., Forster, A., Osada, FL, Rabbitts, T. FL, and Baer, R. (1994). Specific in vivo association between the bHLH and LIM proteins implicated in human T cell leukemia. Embo J 13, 4831-4839. Wagner, K., Mincheva, A., Korn, B., Lichter, P., and Popperl, H. (2001). Pbx4, a new Pbx family member on mouse chromosome 8, is expressed during spermatogenesis. Mech Dev 103, 127-131. Wang, B. B., Muller-Immergluck, M . M . , Austin, J., Robinson, N. T., Chisholm, A., and Kenyon, C. (1993). A homeotic gene cluster patterns the anteroposterior body axis of C. elegans. Cell 74, 29-42. Watrin, F., and Wolgemuth, D. J. (1993). Conservation and divergence of patterns of expression and lineage-specific transcripts in orthologues and paralogues of the mouse Hox-1.4 gene. Dev Biol 156, 136-145. Weiss, M . J., Keller, G., and Orkin, S. H. (1994). Novel insights into erythroid development revealed through in vitro differentiation of GATA-1 embryonic stem cells. Genes Dev.?, 1184-1197. Weiss, M . J., and Orkin, S. H. (1995). G A T A transcription factors: key regulators of hematopoiesis. Exp Hematol 23, 99-107. Weiss, M . J., and Orkin, S. H. (1995). Transcription factor GATA-1 permits survival and maturation of erythroid precursors by preventing apoptosis. Proc Natl Acad Sci U S A 92, 9623-9627. Weissman, I. L. (2000). Translating stem and progenitor cell biology to the clinic: barriers and opportunities. Science 287, 1442-1446. Whiting, J., Marshall, H , Cook, M . , Krumlauf, R., Rigby, P. W., Stott, D., and Allemann, R. K. (1991). Multiple spatially specific enhancers are required to reconstruct the pattern of Hox-2.6 gene expression. Genes Dev 5, 2048-2059. Wilkins, R. C , and Lis, J. T. (1997). Dynamics of potentiation and activation: G A G A factor and its role in heat shock gene regulation. Nucleic Acids Res 25, 3963-3968. Wong, K. F., So, C. C , and Kwong, Y. L. (1999). Chronic myelomonocytic leukemia with t(7;lI)(pl5;pl5) and NUP98/HOXA9 fusion. Cancer Genet Cytogenet 115, 70-72. Wu, A. M . , Till, J. E. , Siminovitch, L., and McCulloch, E. A. (1968). Cytological evidence for a relationship between normal hematopoietic colony-forming cells and cells of the lymphoid system. J. Exp. Med. 127, 455-464. 185 Yagi, H. , Deguchi, K., Aono, A., Tani, Y., Kishimoto, T., and Komori, T. (1998). Growth disturbance in fetal liver hematopoiesis of Mil-mutant mice. Blood 92,108-117. Yamada, Y. , Warren, A. J., Dobson, C., Forster, A., Pannell, R., and Rabbitts, T. H. (1998). The T cell leukemia LIM protein Lmo2 is necessary for adult mouse hematopoiesis. Proc Natl Acad Sci U S A 95, 3890-3895. Yu, B. D., Hess, J. L. , Horning, S. E. , Brown, G. A., and Korsmeyer, S. J. (1995). Altered Hox expression and segmental identity in Mil-mutant mice. Nature 378, 505-508. Zakany, J., Kmita, M . , Alarcon, P., de la Pompa, J. L. , and Duboule, D. (2001). Localized and transient transcription of Hox genes suggests a link between patterning and the segmentation clock. Cell 106, 207-217. Zappavigna, V. , Renucci, A., Izpisua-Belmonte, J. C , Drier, G., Peschle, C , and Duboule, D. (1991). HOX4 genes encode transcription factors with potential auto- and cross-regulatory capacities. Embo J 10, 4177-4187. Zhang, J., and Madden, T. L. (1997). PowerBLAST: a new network BLAST application for interactive or automated sequence analysis and annotation. Genome Res 7, 649-656. Zhao, J. J., Lazzarini, R. A., and Pick, L. (1993). The mouse Hox-1.3 gene is functionally equivalent to the Drosophila Sex combs reduced gene. Genes Dev 7, 343-354. Zhao, Y. , Lin, Y. , Zhan, Y. , Yang, G., Louie, J., Harrison, D. E. , and Anderson, W. F. (2000). Murine hematopoietic stem cell characterization and its regulation in B M transplantation. Blood 96, 3016-3022. Zimmermann, F., and Rich, I. N. (1997). Mammalian homeobox B6 expression can be correlated with erythropoietin production sites and erythropoiesis during development, but not with hematopoietic or nonhematopoietic stem cell populations. Blood 89,2723-2735. 186 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0090726/manifest

Comment

Related Items