UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Transgenic approaches to improved insect resistance in poplar Gill, Rishi Indra Singh 2002

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2002-750175.pdf [ 15.32MB ]
Metadata
JSON: 831-1.0090693.json
JSON-LD: 831-1.0090693-ld.json
RDF/XML (Pretty): 831-1.0090693-rdf.xml
RDF/JSON: 831-1.0090693-rdf.json
Turtle: 831-1.0090693-turtle.txt
N-Triples: 831-1.0090693-rdf-ntriples.txt
Original Record: 831-1.0090693-source.json
Full Text
831-1.0090693-fulltext.txt
Citation
831-1.0090693.ris

Full Text

TRANSGENIC APPROACHES TO IMPROVED INSECT RESISTANCE IN POPLAR  by  Rishi Indra Singh Gill  B.Sc, Punjab Agricultural University, Ludhiana, India, 1990 M.Sc., Punjab Agricultural University, Ludhiana, India, 1992  A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF  DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Faculty of Agricultural Sciences)  We accept this thesis as conforming to the required standard • .  THE UNIVERSITY OF BRITISH COLUMBIA June 2002 © Rishi Indra Singh Gill, 2002  In presenting this thesis in partial fulfilment  of the requirements for an advanced  degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department  or by his or her  representatives.  It  is understood  that copying or  publication of this thesis for financial gain shall not be allowed without my written permission.  Department of The University of British Columbia Vancouver, Canada Date  DE-6 (2/88)  T  k  AUGUST  Z Z O0  Abstract Amines and their derivatives are known to influence insect behavior involved in feeding and reproduction. In order to examine the feasibility of improving the resistance of poplar to insect pests by the introduction of a plant-derived amine-generating transgene, explants from the hybrid poplar clone 'NC5339' (Populus alba x P. grandidentata cv. 'Crandon') and ' I N R A 717 1B4'  (P. tremula x P. alba) were  transformed with a Camptotheca acuminata tryptophan decarboxylase c D N A driven by the CaMV35S promoter. The enzyme tryptophan decarboxylase (TDC) catalyzes the decarboxylation of tryptophan to tryptamine, which, in addition to being a bio-active amine itself, is known to act as a precursor of various other indole derivatives. TDC1 transgenic tobacco plants were also generated, to allow a comparison of the TDC1 overexpression phenotype in both a herbaceous and a woody perennial species. Poplar and tobacco plants were also transformed with an 'empty' vector (pBinl9/PRT101) to use as a control in insect bioassays. Putative transgenic lines were confirmed by P C R for the TDC1 gene sequence and by the expression analysis of the transgene m R N A and encoded protein. Chemical and radiotracer analyses of the transgenic plants suggested that the primary product of tryptophan decarboxylation was tryptamine, which was not metabolized further. N o visible phenotypic changes were associated with ectopic TDC1 expression in either species. In insect bioassays, an increased accumulation of tryptamine in TDC1 transgenic lines was consistently associated with an adverse effect on feeding behavior and physiology of Malacosoma disstria (forest tent caterpillar, F T C ) and Manduca sexta (tobacco hornworm, THW). Behavior studies with FTC and T H W larvae showed that the  ii  acceptability of the leaf tissue to larvae was substantially reduced as the tryptamine levels in the tissue increased. Physiological studies with the F T C and T H W larvae showed that consumption of leaf tissue from the transgenic lines is clearly deleterious to larva growth. The growth inhibition induced by feeding on high TDC1 tissue is presumably due to a post-ingestive physiological mechanism. This work demonstrates that ectopic expression of TDC1 can allow sufficient tryptamine to accumulate in poplar and tobacco leaf tissue to adversely affect the growth of insect pests that normally feed on these plants.  iii  TABLE OF CONTENTS Abstract  ii  Table of Contents  iv  List of Tables  vii  List of Figures  '..  viii  List of Abbreviations  x  Dedication  xii  Acknowledgements  xiii  Chapter 1 Poplar Biology  1  1.1 Introduction  1  1.2 Poplar as a model perennial plant  2  1.2.1 Genetic engineering in poplar  3  1.3 Insect damage  6  1.3.1 Insect and pathogen-induced damage in poplar  6  1.3.2 Genetic resistance to pests in tree species  9  1.3.3 Existing control measures  10  1.4 Genetic engineering approach  11  1.4.1 Candidate genes for insect resistance from microorganisms  12  1.4.2 Insect resistance genes from plants  14  1.4.2.1 Insect resistance metabolites  16  1.4.3 Insect resistant genes and poplar  19  1.5 Need to find new insect resistant genes  20  1.6 Can the over-production of aromatic amino acid decarboxylase in poplar and tobacco deter insect feeding?  22  Chapter 2 Materials and Methods  30  2.1 Plant material and growth conditions  30  2.2 Transformation vector  30  2.2.1 Tryptophan decarboxylase  '.  30  2.2.2 Tyrosine decarboxylase  35  2.3 Agrobacterium-mediated transformation  36  2.3.1 Poplar hybrid 717  36  2.3.2 Poplar hybrid P39  37  2.3.3 Tobacco  38  iv  2.4 Genomic DNA extraction  39  2.5 PCR analysis of putative transformants  40  2.6 RNA extraction  41  2.6.1 RT-PCR analysis  41  2.6.2 Northern blotting  43  2.7 Protein extraction  43  2.7.1 Immunoblot analysis  44  2.7.2 Enzyme activity assay  45  2.7.2.1 Tryptophan decarboxylase  45  2.7.2.2 Tyrosine decarboxylase  46  2.8 Amino acid extraction  47  2.9 Morphology of poplar and tobacco TDC1 transgenics  47  2.10 Chemical and radiotracer analysis  48  2.10.1 Labeled tryptophan feeding  48  2.10.2 Extraction of indole compounds  49  2.10.3 Identification of indole compounds  52  2.11 Insect bioassay  53  2.11.1 Insect material  53  2.11.2 Neonate consumption and performance  54  2.11.3 Antifeedant bioassay  55  2.11.4 Nutritional analysis  56  Chapter 3 Generation and analysis of 7DC-transgenic poplar and tobacco  58  3.1 Introduction  58  3.2 Results  63  3.2.1 Transient gene expression  63  3.2.2 Generation of transgenic poplar  67  3.2.3 Generation of transgenic tobacco  77  3.2.4 Molecular analysis of gene expression in transgenic lines  81  3.2.5 TDC polypeptide in transgenics  91  3.2.6 Enhanced TDC enzyme activity in transgenic lines  95  3.2.7 Amino acid and amine profile in transgenics  99  3.2.8 Morphology of poplar and tobacco TDC1 transgenics  108  3.3 Discussion  Ill  3.3.1 Transient gene expression  Ill  3.3.2 Transformation protocol  112  v  3.3.3 Gene expression and morphology of transgenics  114  Chapter 4 Identification of indole compounds and insect bioassays  123  4.1 Introduction  123  4.2 Results  126  4.2.1 Identification of indole compounds  126  4.2.2 Insect bioassays  133  4.2.2.1 Neonate consumption and performance  133  4.2.2.2 Antifeedant bioassay  136  4.2.2.3 Nutritional analysis  139  4.3 Discussion  145  4.3.1 Identification of indole compounds  145 .  4.3.2 Insect bioassays  146  Chapter 5 Towards genetic engineering of the insect resistance in forest trees.... (Concluding remarks and future considerations)  151  Bibliography  156  Appendix A  175  vi  List of Tables  Table 1.1: Sections of Populus  and common species within each section  2  Table 1.2: Overview of some traits introduced into poplar via genetic engineering  25  Table 1.3: Overview of plant species transformed with the aromatic amino acid decarboxylase transgenes Table 2.1 Primers used to re-clone TDC1 and TyDC5 coding region  28 31  Table 2.2 Primers used for PCR screening  40  Table 2.3 Primers used for RT-PCR screening  42  Table 3.1 Comparison of three Agrobacterium co-cultivation treatments for the ability to produce transformed shoots in hybrid poplar 717 Table 3.2 Comparison of two Agrobacterium co-cultivation treatments for the ability to produce transformed shoots in hybrid poplar P39 Table 3.3 Transformation efficiency of poplar hybrid 717 leaf discs co-cultivated with empty vector pBin 19/PRT101 Table 3.4 Transformation efficiency of tobacco leaf discs co-cultivated with  71 71 73  Agrobacterium  79  Table 3.5 Transformation efficiency of tobacco leaf discs co-cultivated with empty vector pBin 19/PRT 101 Table 3.6 Comparison of gene expression, product formation, enzyme activity and tryptamine levels in different TDC1 transgenic poplar lines Table 3.7 Comparison of gene expression, product formation, enzyme activity and tryptamine levels in different TDC1 transgenic tobacco lines Table 3.8 Morphological data collected from the TDC1 transgenic poplar plants after 5 weeks growth Table 3.9 Morphological data collected from TDC1 transgenic tobacco plants after 6 weeks growth Table 4.1 Antifeedant action of 7DC7 transgenics on late 3 instar Malacosoma disstria and Manduca sexta larvae. Table 4.2 The effect of TDC1 over-expression on the growth, feeding and dietary utilization by Malacosoma disstria larvae after feeding for 4 days on the leaves of poplar TDC1 transgenic and control plants Table 4.3 The effect of TDC1 over-expression on the growth, feeding and dietary utilization by Manduca sexta larvae after feeding for 4 days on the leaves of tobacco TDC1 transgenic and control plants  79 98 99 110 110  rd  139 144 144  vii  List of Figures Figure 2.1 A simplified map of the TDC1, TyDC5 and empty vector constructs in pBinl9/PRT101 binary vector Figure 2.2 Transient transformation of tobacco by agroinfiltration  32 34  Figure 2.3 Fractionation of indole compounds  50  Figure 2.4 Indole compounds extracted in different fractions  51  Figure 3.1 Induction of transgene expression  65  Figure 3.2 Sequence alignment of re-cloned TyDC5 gene with the original TyDC5 and other members of Papaver somniferum TyDC gene family....  67  Figure 3.3 PCR analysis of transgenic poplar 717  69  Figure 3.4 PCR analysis of transgenic poplar P39  70  Figure 3.5 PCR analysis of poplar 717 transformed with empty vector (pBinl9/PRT101)  72  Figure 3.6 Different stages of the poplar hybrid 717 transformation process  74  Figure 3.7 Different stages of the poplar hybrid P39 transformation process  76  Figure 3.8 PCR analysis of transgenic Tobacco  78  Figure 3.9 PCR analysis of tobacco transformed with empty vector (pBinl9/PRT101)  80  Figure 3.10 RT-PCR analysis of the TDC1 transgenic poplar hybrid 717 lines  83  Figure 3.11 RT-PCR analysis of the TDC1 transgenic poplar hybrid P39 lines  84  Figure 3.12 RT-PCR analysis of the TDC1 transgenic tobacco  86  Figure 3.13 Northern blot analysis of TDC1 transgenic poplar hybrid 717  88  Figure 3.14 Northern blot analysis of TDC1 transgenic tobacco  90  Figure 3.15 Western blot analysis of TDC transgenic poplar hybrid 717  93  Figure 3.16 Western blot analysis of TDC transgenic poplar hybrid P39  94  Figure 3.17 TDC activity in the leaves of poplar hybrid 717 plants  96  Figure 3.18 TDC activity in the leaves of poplar hybrid P39 plants  97  Figure 3.19 TDC activity in the leaves of tobacco plants  100  Figure 3.20 Analysis of amino acids in wild type and TDC1 over-expressing poplar hybrid 717 Figure 3.21 Amino acid and amine analysis of wild type and TDC1 over-expressing tobacco  103 106 viii  Figure 3.22 TDC1 transgenic line # 3 having variegated leaves  109  Figure 4.1 Per cent recovery of C-labeled tryptophan products in the different fractions of 717 transgenic line # 12 and wild type poplar plants Figure 4.2 Comparison of labeled tryptophan products separated in the different indole fractions of wild type and transgenic poplars Figure 4.3 Comparison of tryptophan products extracted in the different indole fractions of wild type and transgenic poplars Figure 4.4 Leaf area consumed by M. disstria neonates after 2 and 4 days of feeding on leaf discs from control (EV) and TDC1 transgenic poplar lines (high # 12, medium # 7, and low #4) Figure 4.5 Larval mass of M. disstria neonates after 6 and 8 days of feeding on leaves from control (EV) and TDC1 transgenic poplar lines (high # 12, medium # 7, and low # 4) Figure 4.6 Leaf area consumed by M. sexta neonates after 2 days of feeding on leaf discs from control (EV) and TDC1 transgenic tobacco lines (high # 4, medium #11, and low #3) Figure 4.7 Larval mass of M. sexta neonates after 2, 4, 6 and 8 days of feeding on leaves from control (EV) and TDC1 transgenic tobacco lines (high # 4, medium # 11, and low # 3) Figure 4.8 Overview of poplar plants and FTC larva used for insect bioassays 14  127 130 132 134 135 137 138 141  Figure 4.9 Overview of tobacco plants and THW larva used for insect bioassays  143  ix  List of Abbreviations AD BA BSA  approximate digestibility 6-benzylamino purine bovine serum albumin  Bt  Bacillus thuringiensis  CaMV CTM CRY DEPC DMAC DTT FLAG ECD ECI EDTA EtOH EV FTC g GUS IBA 2ip Kb kDa KOAc MES min MS nkat NAA  cauliflower mosaic virus callus induction medium crystal diethyl pyrocarbonate /j-dimethylaminocinnamaldehyde dithiothreitol bacterial flagellar protein efficiency of conversion of digested food efficiency of conversion of ingested food ethylenediaminetetraacetic acid ethanol empty vector forest tent caterpillar gravitational force B-glucuronidase indole-3-butyric acid 6-(Y,Y-dimethylallyl-amino) purine kilobase kilodalton potassium acetate 2-[N-morpholino] ethanesulfonic acid minute Murashige & Skoog salt mixture nanomoles of substrate converted to product per second oc-naphthalene acetic acid neomycin phosphotransferase gene 3-morpholinopropanesulfonic acid open reading frame hybrid-poplar clone 'NC5339' (Populus alba x P. grandidentata) hybrid poplar clone 'INRA 717 1B4' (Populus tremula x P. alba) polyacrylamide gel electrophoresis polymerase chain reaction picomoles of substrate converted to product per second propagation medium polyvinylpolypyrrolidone relative consumption rate relative growth rate root induction medium revolutions per minute  NPTII  MOPS ORF P39 717 PAGE PCR pkat PM PVPP RCR/ RGR/ RIM rpm  RT RT-PCR SDS SEM SIM SSC TDZ TDC1  THW TLC TyDC5  WPM  room temperature reverse-transcriptase polymerase chain reaction sodium dodecyl sulphate shoot elongation medium shoot induction medium saline sodium citrate thidiazuron (l-phenyl-3-(l ,2,3-thiadiazol-5-YL)-urea tryptophan decarboxylase gene tobacco hornworm thin layer chromatography tyrosine decarboxylase gene Woody Plant Medium basal salt mixture  xi  xii  Acknowledgements I am indebted to my research supervisor Dr. Brian Ellis, for providing me with the opportunity to work in the area of tree biotechnology and grateful for his invaluable guidance, consistent encouragement, patience and moral support throughout the course of this study. I am thankful to my research committee members, Dr. David Ellis, Dr. Murray Isman and Dr. Carl Douglas, who always gave me precious advice and suggestions on my research and thesis. I also thank the staff at the Cellfor Inc. for helping me to learn poplar transformation. I acknowledge the financial support from the 'International Council of Canadian Studies' for providing 'Canadian Commonwealth Scholarship' and the Biotechnology laboratory for supporting my research and studies at the UBC. A special gratitude goes to my 'smart' friend Marcus Samuel who always stood with me throughout rough and smooth sailing of my degree. He always encouraged me sometimes as a scientist and sometimes just as a sincere friend. I would like to thank all the present and past members of Ellis lab, Godfrey, Lukpla, Greg, Alana, Hardy, Stef, Amrita and Madoka for their help and support. Specially, I would like to thank my cousin, Deepinder who frequently visited me and gave me homely feeling in a foreign land. I thank my parents, Dr. Ripudaman Singh and Mohinder Kaur for their moral support, encouragement and prayers that led to successful completion of my degree. Most of all, I am forever indebted to the patience, support and silent sacrifice endured by my wife Kulwinder and daughter Chitvan throughout these long four years of my study. Without their assistance, I would not have been able to accomplish this challenging target in my life.  xiii  Chapter 1 Poplar Biology 1.1 Introduction The genus Populus includes about thirty species of poplars, aspens and cottonwoods that are widely distributed over the northern hemisphere. High growth rates, short rotation, ease of vegetative propagation and a wide range of industrial and domestic uses make it one the most important trees of modern silviculture. In many countries, it is managed in short rotation using intensive culture methods that have contributed to impressive productivity, especially in agro-forestry plantations. With the systematic shrinkage of forested areas worldwide, and an expanding human population, poplars are likely to gain in importance by providing needed wood products while at the same time contributing to a more favorable carbon balance (Stettler et at, 1996). Poplars can meet many of these demands more effectively than any other tree in the temperate zone (Ranney et al, 1987; Abelson, 1991). Poplars develop as separate male and female trees (dioecious) that flower before leaf emergence in spring. The flowers are borne in pendent racemes (catkins) that vary in flower number and density among poplar species and sections, but are generally similar for males and females of the same species. The leaves are alternate, stipulate, petiolate, simple, and have glandular teeth along the margin. Poplars have both preformed (early) and neoformed (late) leaves. Preformed leaves initiate at the end of one growing season and expand at the beginning of the next growing season, whereas neoformed leaves initiate and expand in concert during a single growing season. In some poplars, cessation of growth and bud formation is induced by photoperiod (Pauley and Perry, 1954), and in others it is induced by temperature.  1  Poplars belong to the family Salicaceae. The species of Populus are divided in six broad sections (Table 1.1). The Populus section is further subdivided in two groups, the Trepidae and the Albidae. Populus grandidentata, P. tremula, and P. tremuloides belong  to the first group, whereas P. alba is the only member in the Albidae group.  Table 1.1: Sections of Populus and common species within each section.  Abaso  Turanga  Leucoides  Aigeiros  Tacamahaca  Swamp poplars Cottonwoods Balsam poplars Black poplar mexicana  euphratica pruinosa Uicifolia  lasiocarpa heterophylla  nigra deltoides fremontii  laurifolia ciliata balsamifera trichocarpa augustifolia  Populus  Aspens White poplars alba tremula grandidentata tremuloides monticola  (Eckenwalder, 1996) Interspecific poplar hybrids have become an important renewable source of biomass for energy and short-fiber for papermaking. Hybrids, whether inter- or intraspecific, result from the combination of all chromosomes of two sex cells, i.e., two complete haploid genomes. There are three main objectives of hybridization i) to combine desirable traits from different species, ii) to capture hybrid vigor or heterosis, and iii) to obtain increased developmental homeostasis i.e., better phenotypic stability in different environments. It is hybridization that has given poplars their current silvicultural prominence (Stettler et al, 1996).  2  1.2 Poplar as a model perennial plant  Populus is fast becoming a model organism for the study of tree biology. Features that make poplar attractive in this regard include: the genetic diversity in the genus and the ease with which it can be combined and recombined in hybrids; the uniform chromosome number across all species (2n = 38) and the small genome size (~5xl0 bp), 8  which facilitates studies at the molecular level; the rapid growth and expression of a wide range of trait variation in morphology, anatomy, physiology, and pest susceptibility; the early sexual maturity of at least some species and hybrids (4-6 years), permitting rapid progress in advanced generations in breeding; and most importantly, the ability to resprout and to be propagated vegetatively, which allows efficient replication in time and space (Stettler and Bradshaw, 1996). Furthermore, a few Populus clones demonstrate 'developmental plasticity' in their response to tissue culture manipulations, such as micropropagation of axillary shoots, and efficient regeneration from protoplasts, calli, leaf, stem, or root segments. In addition, a handful of Populus clones are amenable to genetic transformation using Agrobacterium tumefaciens-based systems (Chun et al, 1988). In fact, poplar was the first forest tree species to be genetically transformed (Fillatti et al., 1987). For these reasons, Populus is well suited to serve as a model system for molecular genetic studies of woody plants.  1.2.1 Genetic engineering in poplar  Tree improvement by conventional breeding is slow and laborious due to long reproductive cycles. These include long juvenile periods and may be further complicated by reproductive characteristics such as self-incompatibility. The time needed to transfer a  3  desirable trait into a crop plant through sexual crossing would depends on the source of the gene and the evolutionary distance of that source from the crop plant (Jauhar, 2001). Thus, closely-related species are better candidates for transferring a desirable gene than less-related wild species. Asexual gene transfer methods (genetic engineering) offers an alternative approach, since they overcome the above-mentioned species barriers and allow modification of valuable clones without the wholesale genetic recombination that occurs during sexual reproduction. The refined gene transfer technology referred to as genetic transformation involves gene transfer based on uptake of foreign DNA by prokaryotic and eukaryotic cells, and the subsequent recombination of part or all of that DNA into the cell's genome. In tree species, genetic transformation can potentially reduce the time necessary to obtain improved varieties, provided that the character to be modified is not controlled by too many genes. Transformation also makes it possible to transfer specific traits into selected genotypes without affecting their desirable genetic background (Pena and Seguin, 2001). Potential applications of this approach include enhancing resistance to pest and diseases, incorporating resistance to herbicides, creation of sterility and improving wood quality. It has been demonstrated that many genes isolated from model annual plants such as Arabidopsis thaliana or Nicotiana tabacum (tobacco) have counterparts (orthologous and homologous) in tree genomes (Leple et al, 1999). It also appears that gene regulation in woody plants may be similar to that in nonwoody plants (Weigel and Nilsson, 1995). Thus, one can take advantage of knowledge developed in systems where our understanding is more advanced, and apply it to trees, as exemplified by the study of ectopic expression of the Arabidopsis LEAFY gene in aspen (Douglas, 1996).  4  Transformation requires that DNA be inserted into plant cells, incorporated into chromosomes, and expressed in cells that can then be induced to regenerate plants. Various genes have been introduced to different poplar hybrids using an Agrobacteriumbased system of plant transformation (Table 1.2). Although it is mainly nopaline strains that naturally infect poplar in the field (Michel et al, 1990), successful poplar transformation has also been reported with both octopine and agropine strains. The type of explant used in Agrobacterium  co-cultivation protocols depends on the poplar  genotype and in vitro regeneration protocol. Stem internodes (De Block, 1990; Leple et al, 1992; Mohri et al, 1996;  Tzfira  et al, 1997; Han et al, 2000) and leaf segments  (Klopfenstein et al, 1991; Fladung, 1999; Han et al, 2000) are the most frequently used explants for co-cultivation. In most of these reports, kanamycin has been used to select the transformed cells. However, some recent reports have demonstrated successful use of hygromycin or an herbicide (chlorsulfuron, phosphinothricin, glyphosate or glufosinate) as a selectable marker (Malik and Saroha, 1999; Salas et al, 2001). Selectable marker genes can produce problems for several reasons: i) the selective agents can have negative effects on proliferation and differentiation of plant cells; ii) it is difficult tp pyramid desirable genes by performing recurrent transformation if the same selectable marker is to be used. The multi-auto transformation (MAT) vector system containing the isopentenyl transferase (IPT) gene in an Ac transposable element was successfully used in hybrid aspen (Populus sieboldii x P. grandidentata) to overcome the above difficulties of using a selectable marker gene (Ebinuma et al., 1997). This transposable element from maize can move to new locations within a genome. Thus, the  5  chimeric IPT gene may transpose or become 'lost' along with Ac in the transgenic cells, and produce marker-free transgenic plants without sexual crossing. Transgenic poplar plants have also been produced using direct gene transfer methodology such as protoplast electroporation (Chupeau et al, 1994) and particle acceleration (McCown et al, 1991)[Table 1.2]. Different transformation methods have their advantages and disadvantages. Using Agrobacterium, only that portion of the transformation vector within the T-DNA borders of the Ti plasmid is transferred to the host cell and, in most cases, only one copy or a few copies of this fragment are integrated into the host genome. When using direct DNA delivery, however, the whole transformation vector is introduced into the host cell and often several copies (or portions) of the delivered DNA become integrated into the host genome (Charest et al, 1997) .  1.3 Insect damage The scale of worldwide crop damage inflicted by phytophagous insects is staggering, despite widespread use of sophisticated crop protection measures. Annual losses due to pests and diseases have been estimated at 37 per cent of agricultural production world wide, of which 13 per cent is due solely to insects (Jouanin et al, 1998) . Forests are also heavily impacted. In Canada alone, roughly 0.5 per cent of total forest is lost annually due to insect attack (Hall and Moody, 1994).  6  1.3.1 Insect and pathogen-induced damage in poplar Some poplars can be easily propagated via vegetative means. This, together with the industrial demand for highly homogenous selected raw material, has led to commercial use of a limited number of poplar cultivars. The practice of this type of monoculture leaves large plantations vulnerable to pest and insect damage. Insects and other pests damage poplar clones all over the world, and limit the planting of many susceptible clones. The USDA has estimated volume losses due to insect attack on poplar at eighteen percent (Solomon, 1985). In Europe, the appearance of new physiological races of the leaf rust, Melampsora larici-populina Kleb., is thought to be directly related to massive use in plantations of a handful of poplar clones that were originally selected for their immunity to these pathogenic fungi (Pinon and Fray, 1997). In China, where large areas are planted with only a few poplar clones, two lepidopterans (the polyphagous gypsy moth, Lymantria dispar L. and the poplar looper, Apochemia cinerarius Erscheff) are reported to have damaged 40 per cent of total poplar plantations in a single year (Wang etal, 1996). Nature has provided poplars with a range of chemical defences that help protect them from insect herbivory. Phenolics are the dominant class of secondary compounds accumulated in the Salicaceae (Palo, 1984). These phenylalanine-derived compounds include phenolic glycosides, flavonoids, and tannins. For example, phenolic compounds are known to affect insect feeding, oviposition and growth, and mammalian feeding (Hemming and Lindroth, 2000). Zucker (1982) showed an inverse relationship between the concentration of total phenols in individual leaves of narrowleaf cottonwood and the distribution of leaf-galling aphids, Pemphigus betae Doane. Major phenolic glycosides  7  found in poplar include salicin, salicortin, tremuloiden, and tremulacin (Whitham et al, 1996). On the other hand, no nitrogen-based defensive compounds have been described from the genus Populus. Apart from pre-existing defensive compounds, poplars also show two major patterns of induced defenses (Whitham et al, 1996). First, herbivory can induce an increase in chemical defenses in damaged and/or adjacent plant parts. Second, these same stimuli can trigger the abscission of whole plant parts such as leaves, shoots, or small branches. More than twenty insect species are reported as major pests of Populus and as many as one hundred and fifty species are considered potentially injurious (Dickman and Stuart, 1983). Defoliation of poplar by insects reduces the growth rate of the trees and also renders them susceptible to other pests. Among the defoliators, the cottonwood leaf beetle, Chrysomela scripta F., is the most serious, since larvae and adults consume the immature foliage and kill the terminal shoots, which results in substantial reductions in growth and quality of affected trees (Harrel et al, 1982). In North America, the forest tent caterpillar Malacosoma disstria Hubner has the greatest ecological impact on poplars due to its cyclic outbreaks that occur at 6-16 year intervals and persist for 2-6 years. While native aspens, P. tremuloides and P. grandidentata, are its primary hosts in this region, it can also be a serious pest on hybrid poplars (Robison and Raffa, 1990). Among other pests, the fall webworm, Hyphantria cunea Drury is a polyphagous insect that can cause mortality of Populus branches during heavy infestation (Ostry et al, 1989), while the poplar borer (Saperda calcarata Say) is a  8  serious wood-damaging pest in aspen. Wood borers not only degrade the wood quality in large trees, but the infested trees are also subject to wind damage.  1.3.2 Genetic resistance to pests in tree species  Resistance or susceptibility to pests and diseases varies greatly among Populus species. Susceptibility of P. deltoides to Melampsora rust is highly variable and under strong genetic control (Thielges and Adams, 1975). Based on common-garden tests, a decrease in susceptibility from northern to southern provenances was observed, as well, a wide genetic variation in susceptibility has also been reported within provenances. Similarly, a range of phenotypic co-variation has been observed for P. deltoides vegetative features and the characteristics of gall-forming aphids in the genus Pemphigus, (Sokal and Unnasch, 1988). With the need to find alternative energy sources and predictable fiber supply for industry, the natural reservoirs of genetic variation in poplar species are being actively explored. By integrating this variation into breeding, selection, and genetic engineering programs-' genetic improvement has become an integral part of poplar management and cultural practices. A combination of selection, hybridization and clonal propagation in breeding programs has generally permitted the greatest gain in terms of productivity and pest resistance in poplar or aspen improvement. For example, selected hybrids of P. alba x P. grandidentata showed 86 % height improvement over pure P. grandidentata, as well as resistance to hypoxylon canker infection at age fifteen (Li and Wyckoff, 1993). Planting hybrid clones in pure clonal blocks is operationally desirable in order to achieve greater uniformity in terms of growth rate and form. This practice can also offer  9  management advantages, such as the management of disease or insect pests as a separate unit. However, it is important to deploy several clones simultaneously to minimize the risk of catastrophic loss to damaging agents. It is important to note that, in addition to innate genetic variation, the levels of resistance and susceptibility to insects may vary with the developmental stage of the tree. It was found that juvenile ramets (clonal propagules) of cottonwood clones were predominantly attacked by leaf-feeding beetles, whereas leaf-galling aphids were the dominant pest in mature ramets of the same clone (Kearsley and Whitham, 1989). Thus, management practices should be sufficiently flexible to address different problems at different life stages, with the goal of minimizing overall insect-related damage.  1.3.3 Existing control measures Chemical insecticides are generally used to control insects in agricultural crops. However, application of insecticides at the forest scale is rarely feasible nor desired as it is often too expensive to implement. Aerial spraying with microbial-based pesticides is occasionally recommended for a particular patch of pest-infested forest. Microbial-based insecticides are preferred over broad-spectrum synthetic insecticides due to their lesser effects on non-target organisms. Commercial formulations of Bacillus thuringiensis (Bt) strains are commonly used to control lepidopteran and coleopteran larvae and adult defoliators in poplar plantings. However, the short persistence of Bt preparations and the high cost associated with frequent applications limit practical use of such microbial insecticides to low-input, short-rotation biomass crops (Ramachandran et al, 1993).  10  Some success in reducing the damage caused to crops by insects has been achieved by combining conventional plant breeding and in vitro techniques. For example, somatic hybrid potato lines resistant to the Colorado potato beetle have been obtained by electrofusion of protoplasts isolated from a wild potato species, Solanum chacoense, with those from the cultivated species, S. tuberosum (Cheng et al, 1995). However, improvement of forest trees for pest resistance by conventional breeding and selection is a long-term process that requires decades. It is thus difficult to keep pace with constantly changing pest problems (Klopfenstein et al, 1993). Moreover, incorporation of genetically-based resistance derived from different species (e.g. as hybrid parents) might result in reduction in genetic improvement of other traits (Strauss, 1999). Thus, the combination of genetic engineering with advanced tree breeding programs offers an attractive alternative route to achieving advances in tree improvement (Ellis and Gilbert, 1998).  1.4 Genetic engineering approach Genetic engineering for pest resistance may provide a sustainable and environmentally safe alternative to classical breeding. In contrast to sexual breeding, genetic engineering allows addition of new genes while the genotypes of the elite clones are preserved. This can therefore reduce the time needed to produce an insect resistant commercial line. Insect-resistant transgenic crop plants (com, cotton and potato) were among the first products of agricultural plant biotechnology to be commercially released. Approximately forty different genes conferring insect resistance have been incorporated into crops on a trial basis, and several of these crops have been commercialized in various  11  countries (Schuler et al, 1998). Most of these insect-resistant transgenic plants express a single resistance gene placed under the control of a constitutive promoter. Genetic engineering of trees to increase endogenous pest resistance also has the potential to reduce pest damage and the costs of pest control (Hanover, 1975). It could simultaneously increase the feasibility of silvicultural prescriptions for maximizing biomass productivity (Robison and Raffa, 1994). A particular advantage of endogenously expressed toxins is their enhanced effectiveness at reaching target insects that are normally protected within plants. This also reduces the application and exposure of the toxins to non-target organisms.  1.4.1 Candidate genes for insect resistance from microorganisms  The expression of anti-metabolic proteins that interfere with the digestive processes in insects is a popular strategy used in the development of transgenic plant defense. The most extensively used insect resistance genes are derived from Bacillus thuringiensis (Bt). Bt is a ubiquitous spore-forming soil bacterium that produces insecticidal protein crystals called Bt toxins, 5- endotoxins or crystal (CRY) proteins. Bt toxin has been shown to bind to receptors in the insect midgut epithelium and insert into the midgut membrane, creating pores that lead to the disruption of the electrical, K and +  pH gradient. This results in irreversible damage to the midgut wall (Gill et al, 1992). At least 90 genes encoding Bt protoxins have been isolated from different strains of Bt, and these are effective against a variety of lepidopteran and coleopteran pests (Mazier et al, 1997).  12  The major advantages of using Bt Ci?7-encoding genes for creation of insectresistant transgenic crops are that the toxin is encoded by a single gene, and the Bt CRY proteins are highly specific and are largely harmless to non-related flora and fauna. In initial studies, plants transformed with native Bt CR Y genes were found to produce very low-levels of gene product (0.001 % of leaf soluble proteins), and thus the plants were not protected against insects. This low expression was suspected to be due to the prokaryotic origin of the Bt CRY gene, which resulted in an inappropriate pattern of codon usage. To improve the expression levels, modified Bt genes were constructed, in which nucleotide sequence was modified to match plant codon use preferences without changing the amino acid sequence. These resulted in higher levels of protein expression (0.02-1% of leaf soluble proteins) as compared to those with native bacterial CRY genes. In 1995, the first transgenic plants, com expressing the CrylA(b) toxin (Maximizer™ from Novartis), cotton expressing CrylA(c) toxin (Bollgard™ from Monsanto) and potato expressing the CrylllA toxin (Newleaf™ from Monsanto) were approved for commercial deployment in the U.S.A. (Jouanin et al, 1998). While the Bt genes have been intensively studied for plant genetic engineering purposes, other microbial genes have also received some attention. The isopentenyltransferase gene (IPT) from Agrobacterium tumefaciens codes for a key enzyme in the cytokinin biosynthetic pathway. The expression of IPT in tobacco, controlled by a wound-inducible promoter, resulted in a decrease in leaf consumption by the tobacco hornworm (Manduca sexta L.) (Smigocki et al, 1993). However, expression of IPT also adversely affected the root system and total chlorophyll content of the transgenic tobacco plants. The mechanism by which the cytokinin gene product induces enhanced insect  13  resistance is not clear, but may involve cytokinin induced products of secondary metabolic pathways. Cholesterol is required for the integrity and function of almost all cellular membranes in animals, and expression of a cholesterol-oxidase gene from a Streptomyces species in cotton has been reported to be effective against the boll weevil (Anthonomus grandis Boheman) (Purcell et al, 1993). Histological studies demonstrated that weevils feeding on cholesterol oxidase-expressing plants displayed lysis of the midgut epithelium, suggesting this as a mechanism of lethality.  1.4.2 Insect resistance genes from plants With the development of an efficient. transgenic technology for plants, it has become possible to elucidate the biological role of specific enzymes involved in complex plant secondary metabolism (Ellis et al, 1994). Various enzymes involved in normal plant defense mechanisms have been exploited as part of the search for candidate insect resistance genes. The plant-derived gene products can be grouped as: lectins, inhibitors of digestive enzymes such as proteinase and amylase inhibitors, chitinases, oxidative enzymes and genes encoding enzymes capable of producing insect-resistance metabolites. Lectins are carbohydrate-binding proteins, some of which display antifeedant activities against species in the insect orders Homoptera, Coleoptera, Lepidoptera and Diptera. The mechanism of action for lectins likely involves the specific binding of the lectin to glycoconjugates located in the midgut of the insect (Czapla, 1997). Lectins such as wheat germ agglutinin are found to act as antifeedants rather than having insecticidal  14  activity. Development of the use of lectins in transgenic plants as part of an insect control strategy has not yet to lead to any commercial varieties. Insect gut proteinases catalyze the hydrolysis of dietary proteins, and thus allow absorption of the nutrients crucial for growth and development. Targeting insect gut proteinases as a defense strategy, requires identification of the major proteinase(s) in a particular insect. In vitro assays were used to demonstrate that cysteine proteinase represents the major proteinase activity in the midgut of the Cottonwood leaf beetle Chrysomela tremulae F. The cDNA of a rice gene encoding cysteine proteinase inhibitors (OCI) was found to be effective against this beetle when the cDNA was introduced into poplar (Leple et al, 1995). The OCI effectively inhibits most of the digestive proteinase activity in the consuming insects, making them unable to gain access to much of the nitrogen in the leaf. While these proteinase inhibitors seem to be effective, recent evidence suggests that insects can adapt to transgenic plants expressing a particular protein inhibitor by altering the proteinase composition in their gut (Jongsma and Bolter, 1997). a-Amylase inhibitors, which form a 1:1 complex with insect amylases and thus interfere with starch hydrolysis, were also found to be effective against coleopteran insects (Altabella and Chrispeels, 1990). Expression of a bean oc-amylase inhibitor (a-AI) gene in pea conferred resistance to the bruchid beetles, Callosobruchus maculates F. and C. chinensis L. (Shade et al, 1994). However, another bruchid beetle, Acnathoscelid.es obtecutus Say., can feed successfully on plants producing a-AI, since this insect possesses a serine protease which can cleave some kinds of a-AI, thus rendering the  15  inhibitor ineffective. The long-term opportunities to use the expression of a-AI genes in plants remain to be determined (Jouanin et al, 1998). In insects, chitin (poly[l,4-(N-acetyl-B-D-glucosamine)]) is a key polysaccharide that serves to protect the delicate midgut cells present in the insect gut lumen. Chitinase, an enzyme that catalyzes the hydrolysis of chitin, could therefore potentially interfere with gut function. Although this would appear to be a general target within insects, expression of bean chitinase in potato produced no deleterious effects on a lepidopteran, Lacanobia  oleracea L., but did reduce fecundity of the aphid, Aulacorthum solani  Kaltenbach (Gatehouse et al, 1997). The basis for this selectivity is unknown. Plant defensive proteins, and oxidative enzymes in particular, are often found to be anti-nutritive rather than directly toxic to insects. In many plant species, these defensive proteins are inducible and accumulate only after insect attack (Constabel, 1999). For example, wounding of hybrid poplar (Populus trichocarpa x P. deltoides) leaves causes a strong induction of polyphenol oxidase (PPO) activity (Constabel and Ryan, 1998). During chewing and feeding, the mixing of PPO and plant phenolic substrates generates highly reactive O-quinones that can covalently modify free amino and sulfhydryl groups in dietary proteins being consumed by the insect. The resulting phenolic adducts prevent efficient assimilation of the alkylated amino acids, and thus reduce the nutritive value of the protein (Felton et al, 1992).  1.4.2.1 Insect resistance metabolites Plants produce a variety of anti-nutritive and toxic compounds to protect them against a range of herbivores. These compounds can be broadly divided into four main  16  groups (Schoonhoven et al, 1998): nitrogen-containing compounds (such as alkaloids and nonprotein amino acids), cyanogenic glycosides and glucosinolates, terpenoids, and phenolics (which include tannins and lignins). Amines and their derivatives form one class of defensive nitrogen-containing compounds, which are produced by a diverse array of plants. Many of these metabolites influence insect recognition, feeding and oviposition responses. Indole bases such as N w  methyltryptamine, 5-methoxy-Af Af-dimethyltryptamine, 5-methoxytryptamine and 3-N,Ndimethylaminomethylindole have all been shown to reduce the survival of Rhopalosiphum maydis Fitch nymphs after 48h of feeding on a synthetic diet supplemented with these compounds (2.3 to 3.5 mM) (Corcuera, 1984). Insect bioassays performed with wood extracts from Virola calophylla, which is known to accumulate 5methoxy-7V,A-dimethyltryptamine r  and  2-methyl-6-methoxytetrahydro-B-carboline,  demonstrated anti-feedant effects of these metabolites against the cotton boll weevil (Anthonomus grandis Boheman) (Miles et al, 1987). Other indole compounds may have differential effects on insect feeding activity, depending on the concentration at which they are found in plants. Indole-3-acetic acid (IAA) in high concentrations (0.5 % w/v) inhibited the feeding of the bug Lygus disponsi Linnavuori, whereas lower concentrations (0.05-0.1 %) had a tendency to stimulate insect feeding in the presence of sucrose (Hori, 1980). The simple indole amine, tryptamine, may act against insects in several ways e.g. as insect feeding and oviposition deterrents, and could therefore affect the acceptability of a host plant to insect pests. Tryptamine has been reported to inhibit development in Tetrahymena pyriformis GL. (Csaba, 1993) and Helix aspersa Muller (Vehovszky and  17  Walker, 1991), and at 75 mM tryptamine in a synthetic diet reduced reproduction of Drosophila melanogaster by 15 per cent compared to controls (Thomas et al, 1998). Aromatic amino acid decarboxylases involved in the production of bioactive amines and their metabolites have been used in a number of studies of transgenics. Preliminary data generated from these transgenic have showed some promising results. Tobacco plants transformed with a tryptophan decarboxylase gene (TDC) showed an elevated level of tryptamine and a decrease (~90 per cent) in whitefly pupa emergence in comparison to control plants (Thomas et al., 1995). Tyrosine decarboxylase (TyDC) acts on tyrosine to create tyramine, which can also act as an insect deterrent. Canola (Brassica napus) plants transformed with an opium poppy TyDC gene showed a four-fold increase in TyDC activity, accompanied by a twofold increase in cell wall bound tyramine (Facchini et al, 1999). This increase in cell wall-bound tyramine was correlated with a decreased digestibility of the cell wall material of the transgenic tissue. Earlier studies had suggested that the biosynthesis and deposition in the cell wall of amides composed of hydroxycinnamic acid derivatives and tyramine might play an important role in the defense response of many plants by reducing cell wall digestibility and/or directly inhibiting pathogen growth (Grandmaison et al, 1993; Nagrel and Javelle, 1995). The over-expression of TyDC has been proposed to provide an effective strategy for protecting crops from a broad spectrum of pathogens (Facchini, 2001). An overview of plant species transformed with aromatic amino decarboxylase transgenes involved in the synthesis of amines and their derivatives is given in Table 1.3.  18  1.4.3 Insect resistant genes and poplar In 1991, McCown et al described for the first time the transformation and expression in the hybrid Populus alba x P. grandidentata of a truncated CRYIA(a) 8endotoxin from Bacillus thuringiensis. The CRYIA(a) protein is known to be effective against larvae of both gypsy moth (Lymantria dispar L.) and forest tent caterpillar (Malacosoma disstria  Hub.J, two important pests of poplar (Robison et al.,  1994). Wang  et al, (1996) followed a similar approach and developed a transgenic P. nigra genotype resistant to Apocheima cinerarius Ersch. and L. dispar. In feeding tests, they observed insect mortality ranging from 45 to 100 per cent, as well as a reduction in the size of the surviving larvae. The expression of a Bt 8-endotoxin CRYIIIA in transgenic poplars has also been reported (Comu et al, 1996). The CRYIIIA protein is known to be effective against Coleoptera such as Chrysomela tremulae. An increase in larval mortality from 25 to 50 per cent was observed in C. tremulae feeding on these transgenic poplars, accompanied by prolonged larval development, and a reduction in growth. Plant-derived proteinase inhibitors have also been tested in transgenic poplars. The expression of the cysteine proteinase inhibitor OCI in hybrid (Populus tremula x P. tremuloides) poplar induced about 40 per cent mortality in C. tremulae larvae feeding on the transgenic poplar leaves (Leple et al, 1995). Proteinase inhibitors expressed in poplars have yielded modest levels of resistance, with increased insect mortality after a period of feeding, in contrast to agents such as Bt that have a toxic effect leading to rapid mortality. This strategy (reduced overall survival) could nevertheless be enough to control the size and the level of subsequent insect populations.  19  Since poplars transformed with Bt have shown the most promising results in terms of insect resistance, field trials of transgenic Bt poplars are now underway in several areas including China, France, and the northwestern United States (e.g., Ellis and Raffa, 1997; Yingchuane/a/., 1993; Strauss et al, 1998).  1.5 Need to find new insect resistance genes The discovery and evaluation of new insect resistance genes will be an on-going endevour if we are to keep insect populations under control on commercially grown tree and agricultural crops. Insect-resistant transgenic crops offer the potential benefits of combining increased yields with a decrease in the ecological perturbations caused by the traditional application of chemical insecticides (RSC report, 2001). In the case of forestry, increased yields could also allow us to meet the demand for wood and woodbased products through use of smaller, intensively-managed forest plantations. This would also help reduce exploitation of our natural forest resources and favor biodiversity. However, the effective lifetime of resistant plant varieties is often limited by the appearance of pest strains capable of overcoming these defences (RSC report, 2001). Thus, the indiscriminate, use of chemical insecticides in crops has resulted in the development of insecticide-resistant strains of many major pest species (Metcalf, 1980), thereby limiting the use of those insecticides as an effective control measure. The same is true of biological insecticides, since there is clear evidence that insects can evolve resistance when Bt is extensively used as a control agent (Tabashnik, 1994). It has been argued that there is no reason to expect anything different with wide-scale, intensive use of transgenic plants carrying a specific insecticidal agent, such as Bt (Gould, 1998). There  20  is a significant potential for the development of ifr-resistant insect pest biotypes if largescale transgenic poplar plantations were to be established without accompanying resistance management strategies (Raffa et al, 1997). One mechanism for delaying development of resistance would be the use of multiple genes encoding two or more toxins possessing different modes of action. This would both increase the range of pests affected and make it much less likely that insect resistance to the gene products would be selected for. The lethal effects of Bt 8endotoxins are due to toxin binding to a single receptor in the midgut. Deploying different genes that have other targets should greatly reduce the occurrence of crossresistance. It would be even more desirable to include resistance genes derived from different species, rather than having different genes from the same bacterial species (Estruch et al, 1997). This might involve the use of multiple resistance agents, such as stacking a non-plant gene (Bt, IPT etc.) with a natural insect resistance gene from a plant. Another mechanism for maintenance of insect resistance is management at the field level for resistance. This could involve using a mosaic of trees carrying different resistance traits rather than having large tracts planted with trees transformed with the same insect resistance gene (Ellis and Raffa, 1997). Such a strategy would also make it possible to separately manage different blocks planted with trees carrying different resistant traits. The preferred resistance management strategy of both industry and regulatory authorities is the 'high-dose'/ refuge strategy which aims at diluting the resistance allele and thus preventing it from becoming widespread in the insect population (EPA, 1997). This involves the use of untransformed plants (refuges) along with transgenic plants,  21  which express toxin (Bt) at a level high enough to kill heterozygous (or even homozygous) resistant insects. The untransformed plants on the other hand would allow the sensitive insects to multiply, resulting in the 'dilution' of the resistant allele through random mating of sensitive and resistant insects (Jouanin et al, 1998). Both the specificity of Bt 8-endotoxins to insects, and its fast insect killing effect led it to be commercially exploited in economically important crops (Schuler et al, 1998). However, in forest systems the life cycles of insect herbivores or microbial pathogens are shorter than that of the host tree by several orders of magnitude. As a result, pests and their descendants have many generations of mutation and natural selection to overcome the genetically fixed defense mechanism of the tree. For forest trees in particular, then, the long-term control of insect pests will require an on-going search for new sources of resistance.  1.6 Can the over-production of aromatic amino acid decarboxylase in poplar and tobacco deter insect feeding?  Plants produce a rich diversity of secondary metabolites. These chemicals do not appear to be necessary for basic metabolism, but are thought to contribute to the plant's environmental fitness and adaptability. Consistent with this role, plants often accumulate defensive compounds during the vulnerable stages of their life cycle, presumably to protect them from herbivores. The proposed protective roles for plant secondary metabolites have made them popular targets for metabolic engineering, a process generally defined as the redirection  22  of one or more enzymatic reactions to: 1) produce new compounds in an organism; 2) improve the production of existing compounds; or 3) mediate the degradation of undesirable compounds (DellaPenna, 2001). It is generally felt that the production of plant secondary metabolites could be enhanced greatly via genetic manipulation if a 'ratelimiting' enzyme in the biosynthetic pathway can be defined (Berlin et al, 1993). For a single-step reaction, of course, this question is not relevant. In order to examine the feasibility of improving the tolerance of poplar to insect pests, I decided to test the effectiveness of introducing aromatic amino acid decarboxylase transgenes. Specifically, I used the tryptophan decarboxylase (TDC) cDNA sequence from Camptotheca acuminata (Lopez-Meyer and Nessler, 1997) and tyrosine decarboxylase (TyDC) cDNA sequence from Papaver somniferum L. (Maldonado-Mendoza et al, 1996), which had previously been isolated and characterized by Dr. Craig Nessler's group at Virginia, VTU, Blacksburg,U.S.A. The enzymes TDC and TyDC convert the amino acids tryptophan and tyrosine to tryptamine and tyramine, respectively. These bio-active amines have been shown to affect insect behavior, development and physiology in some systems. To establish whether this could also work in woody perennials, I introduced the TDC1 gene into hybrid poplar clone 'NC5339' (Populus alba x P. grandidentata cv. 'Crandon') and 'INRA 717 1B4'  (P. tremula x P. alba) using an Agrobacterium-based  transformation  system. TDC transgenic tobacco (Nicotiana tabacum L. cv Xanthi) plants were also generated in order to allow a comparison of the TDC over-expression phenotype in both a herbaceous and a woody perennial crop.  23  Chapter 2 of this thesis describes the materials and methods used. Chapter 3 describes the process of generating transgenic poplar and tobacco plants. The first part of Chapter 3 describes the results of transient gene expression analysis in tobacco, which was performed to check the functionality of the TDC1 and TyDC5 genes. The second part of this chapter describes the molecular analysis of the TDC transgenic poplar and tobacco plants. The first part of Chapter 4 describes the results of chemical and radiotracer analysis, and the second part describes the results of insect bioassays performed with the larvae of forest tent caterpillar (Malacosoma disstria Hbn.^ and tobacco hornworm (Manduca sexta L.) feeding on transgenic poplar and tobacco plants, respectively. Chapter 5 consists of some concluding remarks, including consideration of the future of genetic engineering for insect resistance in forest trees.  24  £J  "* 2 o< ^ ^ O  1=1  CD  l-i  1  » c  CD  CD  CD O  "3D  d  e  03  cn  cu  a  rt  o  o .d  2  £  CD O  CD O  CD  >i  sg  CD  a ft 2 -T 3 d  .3  CD  2  d  CD  CD  rt  S  c  u  cu rt rt o cn cn d <U cn CDcn rt -B rt £ ,3.Scc3 o rt Cu OcnO cn  d  o rt aj " .23 -55 <g B «  fi 8  s  Ov  °^ os  r o  2CT\^  CN  rt cartb< ii 4-> -£S + -> O o PQ o PQ og pq U tj  s  to  » ^ r ^ -*c~u  r  s*  00 d rt  §  rt  -s«  S & | 'I ffi S  CJ J  s cu •2 ,3 3 3  cu cu  OH  K  "3 "3 ^ a a rt •2 cu cu o ° S  ^>  "3 C3  <U  C v I. cn to  S  O CJ  Co  a  a  TO  b3  &n  I  O J U  CD  B  a  •O  CD  3 •a ©  cn rt  CN  £ «->  ON  •«~»  o .a i  PQ 3  os os  CD O  v  co u  ^ 2 2 OO  "3 a a  os o o o  QQ  M)  "C v  "a © a o  CN  S » »  CD  co WD  O  m CN  cn  yi  d rt  rt  £  C<  s  O  oq oq  c< CJ ^ O O a.  5  >1  K  u  •SJ  3  e  CU  E  5?  o  N  & •2 a o  >  o  s  d  •2  o o OH OH o o  a  ri  o  o OH  O  H^ o o lH  o  1)  -X ^ ^  ww^ ^ ^3  73  H  3  «1  s  C  ^3  ft, ^ ES  a,  4^  O  cn  • SH  o d rt  'o U  CU  rt  X  H  a a a,' x x  o a a a i? S 5 •Si S £ Si  "a  I  P  CO  .1  >5J  I  X X  ft, X u o  a;  S  a;  a^a^a^a^a;^^^^  a  CJ  3 3 a a S S  s  ft, a,  a  Co  ^J -S>  X  CJ  rt  a sS a  a;  "3  ^  P .1  ^ ft, a,  a; a; § * *  & & X X ft, CJ CJ a a X o o 60  .1  S S  5i £  -G  a, a, a, a, a.  •3ON ON  ON ON ON  ON  Os  •9 cu  CD  3 S +J  fi o w 61)  o  3 CD  t-i  CD  00  co r  I*  eu  3  'E  .^j  1 I o 3 o  cu  CU  e  & o .3 co 3 O o '3 o  cu  5=1 03  —  "a. o o _g -o cu u  . rt  S •O O  co  3  cu CD  £ *<  §3  1 § §a o o 5^^  cu  cu  g ^ O CD  Q 3  o  3  (53  <3 ^  £5  03  cN  "rt-1 rt  •3 3  *  'co CO  a o  3  3  03  -0 3 1  -4—»  3  3  0  CO  CD T3  X 1)  -a  O  to  co  f2 •=>  1 >N  0 3  3 3 0  •2 ^ 3 3 3 its IS co 03 .2 o ^1 rt a g 7 3 rt O O  rt ^  M  3 «g S5  CO  03 3  U 3 6 0 6 0 3 3 ."3  .a "3  3  3 60 S O3 60 60J j J60c5  0  CD  CO I  a  a .2 .2 'co CO CO CO c  CD CD  rt  OH X X CD CD CD O  is i s  'o o CD CL, CO I CD 3 CO CO  H  CD CH CO I CD 3 CO CO  H  £5 U U  ha to  »~i  §  LSI W  1  CO 3  o  g 60 co  h  60  a u  i-i  a a  CD 3 CD  i-  o os P ON . oo § o ON C N © ON .. o rt CN ON Q CO ^ rt IT* VO  ca cd > PQ  co o o "S ^ g ^ -S S u u •gag S e a egg woo -| S S  3 CD  •2  •  a -a'  cu  3 3 rt O o3 CO •-—  H  •  r  a a  (50  coo  M  53  VO ON ON ~«S Q «3 ON ON •— .—I  0IS  e  CU  rt  3  >  ^ PQ  cu  ,C  ON £  ON  Wou nd uce xpre Xyle -sp cifi< expre Seas on peci exp ess  ON Os 00 - ON 3 O N O —  VO ON ON rt  ON  ON ON  03  ^ ^  8  v j CN  ^3-  Co  Ki,  cu  a o  , co CU  •>  ^ ^ ^  u  CU  ^  >  o  J5  >i  CN  s cu  la CO  rt o CD  ,  a  00  CD > CD T3  VH  CD  CD  ^ ****  a a S S  O  cx;o;  »0  C,  ^3  ^3  o •8 a rt  a a  s s s s  ^5 A; ^ i i « Q O H H 3 ^ ^ A ' ^ o a a '^-> H H X H S S 2 -2 «S -S -2 CD cu cu  3  <;| a; a; a;S  3  5  3  3  a;S a;S  cu cu cu cu  ^3 3  s  a cj a a  60 a i  H H ?2 X X x -2-2-2-2-2 " 3 " 3 " 3 "s "s 3 S. sU S. sU S S .. - S ^ s\> sU sU  i*.  _V  V. ^»  V  V.  cx;a,'(x;a, Cs'Cs' -  a, a;  3  cu ^  B  «  ^  a  XXX x x -2-2-2 <U -2 -2 3 3 3 rt 3 s o S S S S S a ^ Si IS IS U s a, o, a, CB; 1-  CN  tN  VO  Os Os  00  o o  CN C•  CO 60 C  03  1' • r, w  0) o  .0  03  1>  03  -o is °! 9 2 ^  o «  a .> a  '  o  -CD . r • .  CQ  Hi  5  •2  JS  CN  o  a  CH  CD  O,  '  CO  --H  O  a S ^ o •§ C ,D o  O  (in  Cr  5>  CJ 00  in  5  CI  C 0D 0 t-D « C 03  * 3 CD  ^ Is  1 «  ^3  c 04  0  .cj  03 CD O  a  CO 3  3  cu  03 CO o  a CD CD 0,  •8  3 3  I"  IS H i ft.  H5  ^  o ^ u  &5 O ft,  00 CN  © Os ON  ON Os  Cl Os OS  2CU  CJ  o ao  cu  -a CO 4->  CO 60  c o  00  3  cj 60  CJ CJ  leg  •2 60  ao  00  §  co 3  Co  co  <U  o  *3  2  cu O Sn  -R  co 3 •JC  R  R  2  C3 -R  3  2  « -R  ^H  c3  ON Os  <U  .g  PQ  a CO  o  OH  <u  cu  2  2  to  CO  a  "5 R  2  C3 -R  3  Co  ON OS  * *CJcdo  Os ON  .  C3  -»J  «S  cu  cO 43  o  TD  co  CO  >  u  a  cu co  2 §  R  2 C3  •s  •JC R  2  -R  u-i ON ON  ON ON  C  6 o  43  H  1* co a  co  a •JC R a»> «  •JC !C « C3  2  §  a  2  -R  CO Co  -5 R  2  CO co  a  •JC R  2  -R  C3  -s  3  c3  co  2 •JC R  -R  -R  H  2  CO  O  CJ  acu  CU  CU co  2  O  cu  a  a  CU co  Os Os  43  CO  CO  a  00  CO  •a o •O  cd  Os ON ON  00  O CJ CH CO CJ  s  a CJ «  e  R  •2  o  .CJ  a  CJ C3  R  •2  o  CJ  -2  C3  a CJ «  C3 -R  a R  I  R  •2  o  CJ  o>  5  a CO  3 §• R C3  .cj  co co  2  cu  5  <o  2  2  CJ C3  cu  -o a S a  cu co  a  CO  o  CO  3 •JC R  •JC  « R  R  2  R  •2  <3 •JC  -2  O  cj  cu OH  R 3  2  2  C3 -R  a  CJ  s  >s  rt  N C CJ  I-a  a CJ CJ  g  U p  P  Q  P H  O  U Q H  H on  P H  U Q H  O  p  (5 P P H  '5b  O  '+H CO CJ  O _3  1  'I il  •a cj cd cj CJ  a  o  *60  O T3  ,g  CJ CO  "3  CJ  •a CJ rt  co  *-> u a  CJ CJ 3  CJ CJ -4-» CO  ^3 CH CJ  o  . „ D  § .s  ^ ' §  «  '£ -3  «  CO O 1-  g  .2  CJ  CO CO CH CO U rt 43 *3  CJ •3  6  CJ  rt  3  •a  CJ  cj  co  •S « S T 3 .3 H CJ  CJ  2  .s  CJ  CJ 3  CO 60  c O  H  U  a g  '  2  CJ 3  g  T3 CJ CO CO CJ >-l  •a CJ  JB  ^3  o  rt  CO CO CJ lH  CJ  rt  rta  terpen oid  'co  "(0  tryp  o a  co  I £ tryp  8  •a  T3 CJ CO CO CJ »H  o c  rt( 1—  Os  ON Os Os  00 ON  O a  c .  CJ  C  o  as  cu  .e  o  CJ CJ  43  a  CD CJ  cu  Os OS OS  4o3 o cd  CN O O © CN  JD  o o  '3  O  <N  4O 3 o  CU  a cu  0X1 C  es k.  cj 1 3 cj  </>  "s  cu  ha  C3 CU  3  3 cu  S  o  3  to  CO to  s  to  to  a K  8  i<8  5 a -s  o  s  CD  CJ  CJ  o -o  to  =o  o  3 •g K  a  R 5 o  to  -JC  c3  cd  u2 to  K S  •5 § S  a v. a •ft o.  •JC  3£  cu  CU  es o  a  B es y es  a.  -ft  c? a K  <3 S  '•S o o  S  o u es  s  C3  3  'S3  © -JC  u s  C3  s .CJ  'to to  5  C  "•S o CJ  05  cu  JS CJ  cu  S u  S  (CJ3 CJ  t-H  es  CJ CJ  c '5b  Q  al  H  H  00  oo  u" Q H  o  Q H  U Q  >  U  CO  CU  .o td _  c  es  cu  o  c o o  IS s  > Ji •O co 3 .2 > •Jo3"  •a  TJ ai H i oo  .g  cd  Tl"  (N  •o o CD  es H  •O "o cd o  (3  a  '> u cu >  H Cj" Q H  Q 43 H  O  -3 co  "3  1«  "cd  1  jo  M  0  CJ C«  *^  8  T3  ° "5 C ,cj  2 to C cj  .2 is  cj-_Hd  T) 3 CJ o  rt  CO  a •5  a  CJ  2  S  CJ id S2 CJ  Chapter 2 Materials and Methods  This chapter describes all materials and methods that have been used during the course of this study.  2.1 Plant material and growth conditions  Two hybrid poplar lines, Populus tremula x P. alba, 'INRA 717 1B4' (Leple et al., 1992), and Populus alba x P. grandidentata cv. Crandon, NC5339 (Fillatti et al., 1987), as well as tobacco (Nicotiana tabacum var. xanthi) were maintained in vitro in Magenta boxes containing propagation medium [PMi, PM and PM ] (Appendix A) at 2  3  25°C. The cultures were incubated under a 16h photoperiod of cool-white fluorescent light (25-32 umole/sec/m ) unless otherwise mentioned. Plants were subcultured every 2  fourth week by aseptically transferring shoot apices to fresh medium.  2.2 Transformation vector  Aromatic amino acid decarboxylase cDNAs encoding tryptophan decarboxylase (TDC1) and tyrosine decarboxylase gene (TyDC5) were re-cloned in the binary vector pBinl9/PRT101 (Ro etal, 2001).  2.2.1 Tryptophan decarboxylase  The TDC1 cDNA sequence from Camptotheca acuminata had been previously cloned and characterized (Lopez-Meyer and Nessler, 1997). A plasmid containing the TDC1 cDNA sequence was kindly provided by Dr. Craig L. Nessler, Virginia Tech University, Blacksburg, Virginia U.S. The coding region of the TDC1 gene was PCR  30  (Polymerase chain reaction) amplified, and BamHI restriction enzyme sites were added to the 5' and 3' end of the TDCl cDNA sequence using BamHI- TDC\-Forward and BamHI-FLAG-77J)Cl -Reverse primers (Table 2.1). To monitor the level of expressed protein immunologically, a reverse primer was designed to create a carboxy terminal translational fusion of TDC1 with the 8 amino acid FLAG epitope (Table 2.1). The PCRamplified fragment was gel purified using a Gibco .'Concert Kit' and digested with the restriction enzyme BamHI.  Table 2.1 Primers used to re-clone TDCl and TyDCS coding region  Primer  Sequence  BamHI-TDClForward  5' CGGGATCCCAAATGGGTAGCCTTGATTCCAAT... . .TACGACACTGAA 3'  BamHI-FLAG77JC1-Reverse  5' CGGGATCCTCACTTGTCATCGTCGTCCTTGTAG... ..TCATCCTCTTTCAGGAGAACATCCGCTCCTTC 3'  EcoRI-7>£>C5Forward  5' GGAATTCATTATGGGCAGTCTTCCAACTGATA. . ..ACCTTGAG 3'  EcoRI-FLAG7>£>C5-Reverse  5' GGAATTCTCACTTGTCATCGTCGTCCTTGTAGT.. .. C AGC AAC AAC ACTGTC ATCC ACTGT ACC 3'  Expected amplicon size  1.54 kb  1.60 kb  The TDCl cDNA sequence was ligated into the multiple cloning site of the binary vector pBinl9/PRT101 so that the CaMV 35S promoter was at its 5' end and the CaMV polyA tail at its 3' end (Figure 2.1). The binary vector pBinl9/PRT101 was linearized by digesting with BamHI, gel purified and dephosphorylated. Vector and insert fragment were electrophoresed beside a mass ladder to quantify the amount of DNA to be used for  31  32  the ligation reaction. The ligation product was then introduced into competent E. coli cells (DH5oc) using heat shock (Sambrook et al, 1989). The cells were plated on LB medium containing kanamycin (50 mg/1) and incubated overnight at 37 °C. The following day, single colonies were picked and suspended in 3 ml LB medium containing kanamycin (50 mg/1) and incubated overnight at 37 °C in a gyratory shaker (150 rpm). Plasmid DNA was then isolated from the actively growing E. coli cells using the miniplasmid prep method of Zhou et al. (1990). The presence and orientation of the desired inserted cDNA sequence was confirmed both by restriction digestion analysis (using restriction enzymes BamHI, EcoRI and Xhol) and PCR (using 35S forward primer and TDC1 gene-specific reverse primer). The purified plasmid DNA displaying the correct orientation was then transferred to competent Agrobacterium cells [EHA105](Hood et al, 1993) using a freeze-thaw method (Holsters et al, 1978). Functionality of the TDC1 gene was confirmed by a transient gene expression assay in tobacco. Briefly, tobacco plants were grown at 25°C in a growth chamber with a 16h photoperiod of cool-white fluorescent light (32-42 umole/sec/m ). Six-week-old 2  tobacco plants were used for the infiltration experiment. Agrobacterium tumefaciens EHA105 carrying the TDC1 construct was grown overnight (28°C) in LB medium containing 50 U-g/ml each of kanamycin and rifamycin. Cells were collected by centrifugation (1413g), and resuspended to 0.4  OD600  in Murashige and Skoog medium  (MS) with 100 uM acetosyringine (3,5-dimethoxy-4-hydroxy acetophenone). The cells were induced by incubating them for 1 hour on a gyratory shaker (60 rpm; 25°C), after which they were infiltrated into the fully expanded leaves of tobacco using a 1 ml tuberculin syringe (Figure 2.2). After 3 days, soluble proteins were extracted from the  33  Figure 2.2 Transient transformation of tobacco by agroinfiltration. F u l l y expanded tobacco leaves were punctured between the main veins with a needle and A. tumefaciens cultures (~ 100 p i ) carrying the TDCl or TyDC5 construct was infiltrated into the leaf tissue using a 1ml tuberculin syringe.  34  infiltrated leaf tissue and analyzed by immune-blotting with anti-FLAG antibody and by a TDC enzyme assay (Section 2.7.2.1).  2.2.2 Tyrosine decarboxylase The TyDC5 cDNA sequence from Papaver somniferum L. was previously cloned and characterized (Maldonado-Mendoza et al, 1996). A plasmid bearing the TyDC5 cDNA sequence was kindly provided by Dr. Craig L. Nessler, Virginia Tech University, Blacksburg, Virginia, U.S.A. The coding region of the gene TyDC5 was PCR amplified, and EcoRI restriction enzyme sites were added to the 5' and 3' ends of the cDNA sequence using EcoRI- TyDCl -Forward and EcoRI-FLAG-7yDC5-Reverse primers (Table 2.1). Again, the reverse primer was designed to create a carboxy terminal translational fusion of TyDC5 with the FLAG epitope. The TyDC5 cDNA sequence was ligated into the multiple cloning site of the binary vector following the same protocol as was used for building the TDC1 construct. The functionality of the TyDC5 gene was also confirmed by a transient gene expression assay in tobacco. Agrobacterium tumefaciens EHA105 carrying the TyDC5 construct was grown overnight (28°C) in LB medium containing 50 (ig/ml each of kanamycin and rifamycin. Cells were collected by centrifugation (1413g), and resuspended to  OD600  0.4 in MS medium with 100 uM acetosyringine. The cells were  induced by growing for 1 hour on a gyratory shaker (60 rpm; 25°C) and infiltrated into the fully expanded leaves of tobacco. After 3 days, soluble proteins were extracted from the infiltrated leaf tissue and analyzed by immunoblotting with anti-FLAG antibody.  35  TyDC enzyme activity was also assayed as described in 2.7.2.2 to confirm the functionality of the TyDC5 gene. 2.3 Agrobacterium-mediated  transformation  2.3.1 Poplar hybrid 717 Agrobacterium-mediated transformation was carried out using a modification of the transformation protocol developed by Leple et al., (1992). The leaves of in vitrogrown poplar 717 are very delicate, so leaf discs could only be cut along the mid-rib, using a number 4 cork borer (8 mm diameter). Leaf discs were incubated adaxial side (top) down for 24 hours on callus induction medium (CIM) (Appendix A) before Agrobacterium co-cultivation. Agrobacterium tumefaciens strain EHA105 containing a transformation vector was grown overnight at 28°C on a gyratory shaker (200 rpm) in LB medium containing 50 |i.g/ml each of kanamycin and rifamycin. The cultured cells were collected by centrifugation for 30 min in a tabletop centrifuge at 1413g. The bacterial pellet was resuspended in CIM medium containing 100 uM acetosyringone and diluted to 0.3-0.4 OD 6o (Han et al, 2000). The cells were induced by incubation for 1 hour on a 6  gyratory shaker (60 rpm; 25°C). Explants were then placed in the induced bacterial suspension and incubated for 1 h on a gyratory shaker (60 rpm; 25°C). The leaf discs were subsequently blotted dry on sterile filter paper and incubated on CIM medium for two days in the dark. By the end of this co-cultivation, bacterial colonies could be seen growing on the explants, so they were washed four times with water and one time with 250 mg/1 cefotaxime in MS medium, and blotted dry on sterile filter paper. Explants were then cultured on CIM medium containing cefotaxime (500 mg/1) and kanamycin (50 mg/1) and incubated for 10 days in the dark. The leaf discs were then transferred to shoot  36  induction medium (SIMi) (Appendix A) and incubated in light. The leaf discs were subcultured on the same medium every 2 weeks. Once shoot buds began to develop from the edges of the leaf disc, the discs were transferred to shoot elongation medium (SEMi) (Appendix A) to allow the shoot buds to elongate. When shoots had elongated to about 2.0 cm, they were cut and cultured on root induction medium (RIMi) (Appendix A). The shoots of putative TDCl-positive plants typically rooted within 2-3 weeks.  2.3.2 Poplar hybrid P39 Agrobacterium-mediated transformation was carried out using a modification of the transformation protocol developed at BC Research, Vancouver. Leaf discs were cut from tissue cultured plants, avoiding the major leaf veins. Leaf discs were incubated adaxial (top) side down on SIM medium (Appendix A) for one day. Agrobacterium 2  tumefaciens strain EHA105 containing a transformation vector was grown overnight (28°C) in LB medium containing 50 U.g/ml each of kanamycin and rifamycin. The cultured cells were collected by centrifugation for 30 min in a tabletop centrifuge at 1413g. The bacterial pellet was resuspended in woody plant medium (WPM) containing 100 pM acetosyringine and diluted to 0.1-0.2 OD6oo- The cells were induced by incubation for 1 hour on a gyratory shaker (60 rpm; 25°C). Leaf explants were placed in the induced bacterial suspension, incubated for 1 h on a gyratory shaker (60 rpm), blotted dry on sterile filter paper and incubated for two days in the dark on SIM2 medium. Explants were then cultured on SIM2 medium  37  containing the antibiotics, carbenicillin (500 mg/1) and cefotaxime (250 mg/1) and incubated for two days under subdued light. The explants were next transferred to SIM2 medium containing carbenicillin (500 mg/1), cefotaxime (250 mg/1) and kanamycin (50 mg/1) and incubated for 2 weeks. The leaf discs were further subcultured every two weeks on  SIM2  medium until shoot buds  regenerated from the cut edges. Once the shoot buds developed, they were separated from the leaf discs and cultured on S E M 2 medium. When the shoots had elongated to about 2.0 cm, they were cut and cultured on RIM2 medium (Appendix A). The shoots of putative TDCl -positive transgenic plants usually rooted in about 2-3 weeks.  2.3.3 Tobacco Tobacco leaf discs were prepared from tissue culture-grown plants, avoiding the major leaf veins. Leaf discs were pre-incubated abaxial (bottom) side down on medium (Appendix A) for one day. Agrobacterium  SIM3  tumefaciens strain EHA105  containing a transformation vector was grown overnight (28°C) in LB medium containing 50 u.g/ml each of kanamycin and rifamycin. The cultured cells were collected by centrifugation for 30 min in a tabletop centrifuge at 1413g. The bacterial pellet was then resuspended in basal MS medium containing 100 (iM acetosyringone and diluted to 0.30.4 OD6oo- The cells were induced by incubation for 1 hour on a gyratory shaker (60 rpm: 25°C). Leaf discs were then placed in the induced bacterial suspension and incubated for 10 min on a gyratory shaker (60 rpm). The leaf discs were subsequently blotted dry on sterilefilterpaper and incubated on SIM3 medium for two days in the dark.  38  For selection, explants were cultured on SIM3 medium containing carbenicillin (500 mg/1), cefotaxime (250 mg/1) and kanamycin (100 mg/1) (SIM3CCK) (Appendix A) and incubated for 4 weeks in the light. Within two weeks, numerous shoot buds developed from the edges of the leaf discs. After four weeks, elongated shoots (2.0 cm) were cut and transferred to root induction medium containing carbenicillin (500 mg/1), cefotaxime (250 mg/1) and kanamycin (100 mg/1) (RIM3CCK) (Appendix A). The shoots of putative TDC\ positive plants usually rooted within 2-3 weeks.  2.4 Genomic DNA extraction DNA extraction was carried out using a protocol developed at BC Research, Vancouver. Leaves of in vitro-grown poplar and tobacco plantlets were ground in 500 pi extraction buffer (lOOmM Tris pH 8.0, 50mM EDTA, 500 mM NaCl, 0.2% (v/v) (3mercaptoethanol) using a fitted plastic disposable pestle in an Eppendorf tube (1.5 ml). Ten per cent SDS (66 pi) was added to the ground tissue, which was then vortexed and incubated at 65°C for 10-30 min. Cold 5M KOAc (170 pi) was added, mixed by inverting the tubes ten times and centrifuged (10 min, 15,700g). The supernatant was transferred to a new tube and 4 pi RNAse A (10 mg/ml) added. The solution was mixed by inverting the tube five times, after which it was incubated for 30 min at 37°C. To precipitate the DNA from the mixture, 400 pi isopropanol was added, mixed and incubated for 20 min at -80°C. The frozen solution was thawed and centrifuged (15 min, 15,700g). The pellet was washed with cold 70% EtOH, air-dried for 30-40 min, redissolved in 50 pi distilled water and incubated for 5 min at 65°C. The DNA concentration was determined by measuring its absorbance at 260 nm and the DNA solution was stored at -20°C. 39  2.5 PCR analysis of putative transformants In both poplar and tobacco plants, putative TDCl transgenics were detected using PCR and a forward primer specific to the 35S-CaMV promoter sequence together with a gene-specific reverse primer (Table 2.2). The PCR reaction (50 jil) contained 200 ng genomic DNA, 40 pmole each of forward and reverse primer, 1.5 ul 50 mM MgCl2, 4.0 |ll dNTP 2.5 mM, 0.3 |ll Taq DNA polymerase 5U/ul and 5 pi 10X PCR buffer (200 mM Tris-HCl, pH 8.4 and 500 mM KC1). The PCR reaction was run in a Biometra T-gradient thermo cycler, using the following thermal cycling regime: 1 cycle of 94°C for 5 min; 30 cycles of 94°C for 1 min, 57°C for 1 min; 72°C for 1 min; and 1 cycle of 72°C for 10 min. The PCR amplification product was analyzed by a 0.7% agarose gel electrophoresis (90 volts; 90 min).  Table 2.2 Primers used for PCR screening  Sequence  Expected amplicon size  Target gene  Primer  TDCl  35S1 TDC-1  ATGACGCACAATCCCACT ACGCCTACGATCTCAAAGTG  0.68 kb  TyDC5  35S1 TyDC-6  ATGACGCACAATCCCACT CTCTTGATGCGGTCAGTGTA  0.67 kb  NPTII  npt4 npt6  FLAG  35S1 Flag-R  CAAGATGGATTGCACGCAGGTTCTC GAATCGGGAGCGGCGATACCGTAAA  0.74 kb  ATGACGCACAATCCCACT CTTGTCATCGTCGTCCTTGTAGTC  1.65 kb  40  2.6 RNA extraction RNA was extracted from the leaves of poplar and tobacco TDCl transgenic lines using an RNeasy Plant Mini Kit (Qiagen). To minimize RNase contamination, all the usual precautions were taken, as described by Sambrook et al. (1989). To extract RNA, the protocol provided with the RNeasy Plant Mini Kit was followed. Leaf tissue (~200 mg) was ground to a fine powder in liquid nitrogen, using a mortar and pestle. The RLT buffer (450 pi, containing guanidine isothiocyanate) was added to the ground tissue, which was then vigorously vortexed and applied to the QIAshredder spin column and centrifuged (2 min, 15,700g). The filtrate was transferred to a new tube and 225 pi ethanol (100 per cent) added. The solution was mixed by pipetting and then applied onto an RNeasy mini spin column and centrifuged (15 sec, 9,300g). The contaminants were removed by washing the column once with RW1 buffer (700 pi) and twice with RPE buffer (500 pi) and centrifuged (2 min, 15,700g). The RNA was eluted with 35 pi RNasefree water and stored at -80°C.  2.6.1 RT-PCR analysis The reverse transcriptase reaction was carried out using a First-strand cDNA Synthesis Kit (Amersham Pharmacia Biotech). A total of 2.5 pg RNA was used in 15 pi of the first-strand cDNA reaction. The RNA solution was heated for 10 minutes at 65°C and then placed on ice. The first-strand reaction mix (5 pi containing reverse transcriptase, RNA guard, RNase/DNase-free BSA, dATP, dCTP, dGTP and dTTP in aqueous buffer) was added to the tube having denatured RNA. One pi each of DTT (200  41  mM) and oligo dT primer (0.2 pg) were also added to the reaction mix, which was then mixed by pipetting several times, and incubated for 1 hour at 37°C. The PCR reaction contained 2.6 pg of first-strand cDNA, 40 pmole each of forward and reverse TDCl gene-specific primers (Table 2.3), 4 pi 18S primer: Competimer mix (1:1), 1.5 pi 50 mM MgCl , 4.0 pi dNTP 2.5 mM, 0.3 pi Taq DNA 2  polymerase 5U/pl, 5 pi 10X PCR buffer (200 mM Tris-HCl (pH 8.4) and 500 mM KC1) and remaining water to bring it to a final volume of 50 pi. As an internal control, 18S ribosomal cDNA was amplified using a 1:1 ratio of 18S-specific primers to competimers mix (Ambion). The PCR reaction was run in a Biometra T-gradient thermo cycler, using the following thermal cycling regime: 1 cycle of 94°C for 5 min; 20 cycles of94°Cfor 1 min, 57°C for 1 min; 72°C for 1 min; and 1 cycle of 72°C for 10 min. The number of cycles was adjusted so that the amplification fell within the linear range. The PCR amplification product was analyzed by 0.7% agarose gel electrophoresis (90 volts; 90 min). Relative levels of TDCl transcript were quantified by scanning the stained gel and assessing band intensity using the Scion Image program. TDCl band values were normalized against the signals from the 18S transcript.  Table 2.3 Primers used for RT-PCR screening  Target gene  Primer  TDCl  77X71 5' TDCl 3'  Sequence GTT CTC AGC CAA GTT GAT CC CCT CTT TCA GGA GAA CAT CC  Expected amplicon size 1.35 kb  42  2.6.2 Northern analysis  To prepare a P-labeled probe, a TDCl gene fragment (1.35 Kb) was amplified 32  using gene-specific forward and reverse primers (Table 2.3). The amplified fragment was gel-purified using a GIBCO 'Concert' kit and eluted in 40 pi DEPC-treated water. The DNA was diluted to 20 ng in 45 pi TE buffer and denatured by heating to 95°C for 5 min. After denaturation, the DNA was placed on ice for 5 min. The denatured DNA and 5 pi [ P]dCTP were added to the reaction tube (provided with the random priming kit; 32  Amersham). The solution was mixed by pipetting up and down several times, incubated at 37°C for 10 min and the reaction stopped by adding 5 pi 0.2 M EDTA. Total RNA (8 pg) was resolved in a 1 % formaldehyde agarose gel (70 volts; 105 min), and blotted onto Hybond XL membrane (Amersham Pharmacia Biotech) using the capillary transfer system. RNA blots were hybridized by shaking overnight at 55°C in a Rapid-hyd buffer (Amersham Pharmacia Biotech) containing the P-labeled probe. Blots 32  were washed twice at RT with 2X SSC containing 0.1 % SDS, once with IX SSC containing 0.1 % SDS at 65°C and twice with 0.1X SSC containing 0.1 % SDS at 65°C. The membrane was then wrapped in saran wrap and incubated overnight with the phosphoimager screen. Hybridization signals were scanned and analyzed using the Storm 860 Phosphor Imager (Amersham Pharmacia Biotech) and ImageQuant software (Molecular Dynamics).  2.7 Protein extraction  Total soluble proteins were extracted from leaf tissue by grinding with disposable plastic pestles in extraction buffer [10 % v/v glycerol, 50 mM Tris-HCl pH 7.5, 5 mM  43  EDTA, 10 mM DTT and one tablet protease inhibitor cocktail (Roche)] containing 7.5 % w/v insoluble polyvinylpolypyrrolidone. The tubes were vortexed briefly, centrifuged (15,700g; 4°C; 30 min) and the supernatant was transferred to a new tube. The protein concentration was determined according, to the method of Bradford (1976), using a Protein Assay Kit (Bio-Rad, Mississauga, Ontario). The protein extracts were stored at -80°C.  2.7.1 Immunoblot analysis Denaturing polyacrylaminde gel electrophoresis (SDS-PAGE) was carried out according to the standard Laemmli (1970) procedure. Total soluble protein (15 pg per lane) was fractionated on a 10% SDS-polyacrylamide gel. Prestained SDS-PAGE low range molecular weight markers were used as molecular weight standards. After electrophoresis, proteins were electro-blotted onto Immobilon-P (Millipore) PVDF membrane. The membranes were pre-treated in blocking solution [4 % w/v BSA in IX TBST (100 mM Tris-HCl pH 7.5, 150 mM NaCl and 0.1% Tween 20)] for 2 hours at room temperature. Then the membranes were incubated overnight with a 1:5,000 dilution of primary antibody (mouse anti-FLAG antibody) in IX TBST. The membranes were washed four times (5 min each) with IX TBST solution and incubated in a 1:8,000 dilution of mouse peroxidase-conjugated secondary antibody (Mouse Immunoglobulins HRP, DAKO Diagnostics Ontario, Canada). The complexes were visualized using an enhanced chemiluminescence kit (ECL, Amersham Pharmacia Biotech, UK). Crossreacting protein levels were quantified by densitometry using the Scion Image program  44  and the band intensity values were normalized for the protein loading as determined by Coomassie staining the nitrocellulose membrane.  2.7.2 Enzyme activity assay 2.7.2.1. Tryptophan decarboxylase Soluble proteins were extracted from the leaves of transgenic poplar and tobacco lines using plastic disposable pestles and 0.1 M sodium phosphate extraction buffer (pH 7.5) containing 5 mM p-mercaptoethanol, 5mM thiourea, ImM EDTA and 0.75 % w/v insoluble polyvinyl polypyrrolidone (Sangwan et al, 1998). The crude homogenate was centrifuged (15,700g; 4°C; 30 min) and the supernatant was used for enzyme assays. An end-point assay procedure was followed for monitoring the TDC catalytic activity (Sangwan et al, 1998). The assay mixture (1.0 ml) with final pH 8.5 contained 0.1 M sodium phosphate buffer, 3.5 mM P-mercaptoethanol, 1 mM L-tryptophan, ImM pyridoxal-5'-phosphate, and 20 pg of the crude homogenate protein. The reaction mixture was incubated for 30 min in a shaking water bath adjusted to 30°C and the reaction was terminated by the addition of 2.0 ml 4 N NaOH. This raised the pH of the incubation mixture to about 11. The alkalinized reaction was extracted with 3.5 ml ethyl acetate, and the ethyl acetate phase was used directly to measure fluorescence intensity in a LS50 Luminescence spectrometer, with excitation and emission wavelengths at 280 and 350 nm, respectively. Excitation and emission shutters were set at 2.5 and 5.0 nm, respectively. In the buffer control, all steps of the enzyme assay procedure were followed except that no crude homogenate protein was added to the reaction mixture.  45  2.7.2.2. Tyrosine decarboxylase The enzyme assay for tyrosine decarboxylase was performed using ion-exchange cartridges to separate the unreacted radiolabeled amino acid substrates from the product amine, following the protocol described by Heerze et al, (1990). The aromatic amino acids yield positively charged amines as decarboxylation products and these are adsorbed onto weak cation-exchange cartridges at neutral pH. The uncharged amino acids can be removed by washing the cartridge with water and the amines by eluting with weak acid. The cation (CM) exchange Sep Pak cartridges were preconditioned by washing with 0.5 M HCI (20 ml) and then with water (40 ml) to elute any contaminants. Soluble proteins were extracted by grinding the Agrobacterium-mfiltriited  tobacco  leaves in liquid nitrogen. The crude tissue homogenate was added to 0.1 M sodium acetate extraction buffer (pH 5.7) containing 5 mM P-mercaptoethanol, ImM EDTA, and 0.75 % w/v insoluble polyvinyl polypyrrolidone. The crude homogenate was centrifuged (15,700g; 4°C; 30 min) and the supernatant was used for enzyme assays. To assay for TyDC enzyme activity, sodium acetate buffer (100 mM; pH 5.7) containing 0.25 mM pyridoxal phosphate, 0.6 mM tyrosine, 0.5 pCi DL- tyrosine (side chain-2- C; specific activity 48.8 mCi/mmol) was incubated with 500 pg extracted 14  protein in a total volume of 200 pi. The reaction was run for 20 min at 37 °C and terminated by adding 20 mM potassium phosphate buffer, pH 7.2. The resulting mixture was loaded onto a preconditioned Accell CM cation exchange Sep Pak cartridge. Unreacted tyrosine was eluted by washing the cartridge with water (25 ml), and the radiolabeled tyramine product was then eluted with 0.5 M HCI (2x5ml). The radiolabeled  46  tyramine was quantitated by measuring radioactivity in 5 ml of ACS liquid scintillation cocktail in a Beckman scintillation counter.  2.8 Amino acid extraction Amino acids were extracted from the leaves of TDCl tobacco and poplar by grinding the tissue (~ 250 mg) to a fine powder in liquid nitrogen using a mortar and pestle. A three-stage extraction of the powder was carried out by mixing it with 5 ml, 5 ml and 2 ml 10 mM sodium acetate buffer (pH 6.42). Each time after adding the extraction buffer, the slurry was vortexed for 1 min at maximum speed and centrifuged (9,300g; 4 °C; 10 min). After each spin, the supernatant was transferred to a new tube. Three rounds of freeze-thaw were performed with the clean supernatant. After every thawing step, the solution was centrifuged (9,300g; 4°C; 10 min) and the supernatant was transferred to a new Falcon tube (15 ml). An equal volume of chloroform was added to the extract solution and then briefly mixed. The aqueous phase was separated and filtered through 0.45 pm and 0.20 pm hydrophobic PTFE 4 mm Millex syringefiltersbefore being sent to the Advanced Protein Technology Center in Toronto for amino acid and amine analysis. There, the amino acids and amines in thefilteredaqueous phase (50 pi) were converted to PITC derivatives, and these were subjected to HPLC analysis (Waters Pico-Tag column and UV detector). The data was analyzed using Waters Millenium 32 Chromatography Software and each amino acid was quantified as pmoles per mg leaf tissue.  2.9 Morphology of poplar and tobacco TDCl transgenics  47  The PCR-positive poplar and tobacco transgenic lines were maintained in vitro on propagation medium (Appendix A). The shoots rooted on propagation medium were transferred to pots filled with the Redi-earth (peat: vermiculite; 8:2), Grace Horticultural Products. To maintain high humidity and to minimize desiccation, the plantlets were covered with the transparent plastic cups and placed in a mist tunnel. In about ten days, the new leaves started sprouting and then the protective covering was gradually removed. Under natural conditions, the poplars are winter deciduous, thus, to avoid the loss of leaves due to short photoperiod, the transgenic plants were maintained in growth chambers adjusted at 25°C under a 16h light/ 8h dark photoperiod. Measurements of plant height and leaf number were recorded when the transgenic poplars and tobacco plants were six weeks old.  2.10 Chemical and radiotracer analysis 2.10.1 Labeled tryptophan feeding L-(side chain-3- C)-Tryptophan (50 mCi/mmol) was purchased from NEN Life 14  Science Products Inc. and received in an ethanol: water (2:98) solution. The ethanol was removed from the labeled solution by passing a slow stream of argon through it for 30 min. One leaf each (fifth leaf from top; 10 week old plant) from JDC1 transgenic (line # 12) and wild type poplar hybrid 717 was selected for the labeled tryptophan-feeding assay. The leaf was cut from the plant and the petiole immediately dipped into the solution of labeled tryptophan (3.2 pCi) in a 1.5 ml microfuge tube. The leaf was kept in a radioactive hood under constant light at 24°C. The leaf absorbed all of the labeled  48  tryptophan solution within an hour, at which point distilled water was added to the tube and transpiration allowed to continue for another 50 min.  2.10.2 Extraction of indole compounds The tryptophan fed leaves were cut into small pieces and placed in liquid nitrogen. The frozen tissue was ground to a powder using a glass rod and the powder was stirred into 10 ml cold methanol. The mixture was kept for 24 hours at 4°C to ensure complete extraction. The solid residue was then filtered off and the filtrate was evaporated under an argon stream until about 2 ml methanol was left in the flask. To this methanol was added water (~5 ml) and Celite 503 (800 mg). The slurry was mixed thoroughly and filtered through a bed of Celite to remove precipitated chlorophyll. To improve the recovery of indole metabolites the extracts from C tryptophan-fed leaves 14  were spiked with the four standards (30 pg each tryptophan, tryptamine, 5-hydroxy tryptamine and N-methyl tryptamine) before being processed and fractionated. The filtrate was then partitioned against successive volumes of distilled ether, first at pH 7.0 to give the neutral ether fraction, then at pH 3.0 to give the acidic ether fraction, and finally at pH 11.0 to give the basic ether fraction. The aqueous phase from the basic ether fraction was divided into two aliquots, one aliquot partitioned against nbutanol and other kept as an aqueous fraction (Figure 2.3). This figure also indicates the expected indole compounds in each fraction. Chemical structures of the expected indole compounds are shown in Figure 2.4. The total radiolabeled tryptophan products recovered in different fractions were quantitated by adding 200 pi from each fraction to 5 ml of ACS liquid scintillation cocktail, and counting the disintegrations per minute in a  49  scintillation counter. Each fraction was concentrated to dryness under a slow stream of argon and subsequently redissolved in methanol (200 pi). A one-third volume from each fraction (~ 65 ul) was analyzed by thin layer chromatography.  Figure 2.3 Fractionation of indole compounds (Schneider et al, 1972) Aqueous filtrate from Celite Adjust to pH 7.0 Extract 2 times with distilled ether  i  1,  '  Aqueous phase Adjust to pH 3.0 Extract 2 times with distil ed ether  Ether phase NEUTRAL FRACTION Expected \ Indole-3-aldehyde I Tryptophol  Aqueous phase Adjust topH 11.0 Extract 2 times with distilled ether  Ether phase ACID FRACTION Indole-3-acetic acid Expected | Indole-3-lactic acid Malonylttyptophan  Aqueous phase Divide into 2 aliquots  Ether phase BASIC FRACTION Expected  Tryptamine N-Methyltryptamine  Extract with n-butanol pH 11.0  Butanol phase BUTANOL FRACTION  Aqueous phase discard  AQUEOUS FRACTION Expected I Tryptophan  Expected I 5-Hydroxytryptamine ' N-Methyl-5-hydroxytryptamine  50  Figure 2.4 Indole compounds extracted in different fractions COOH NH "N H Tryptophan  2  Neutral fraction: .CHO N H Tryptophol  OH  N H Indole -3 -aldehyde  Acidic fraction:  COOH NH-CO-CH -COOH 2  Cu  N-Malonyltryptophan COOH  \:OOH  OH N H Indole-3-lactic acid  N H Indole-3-acetic acid  Basic fraction:  NHMe N H N-Methyltryptamine  H Tryptamine Butanol fraction: HO  HO NH, 5-Hydroxytryptamine  NHMe N-Methyl-5-hydroxytryptamine 51  2.10.3 Identification of indole compounds Tentative identification of native indoles, and of radioactive tryptophan metabolites obtained in the feeding experiments was based on co-chromatography with authentic compounds on thin layer chromatograms, and on color reactions with an indolereactive reagent. Thin-layer  chromatograms  were  run on microcrystalline cellulose plates  (thickness 150 pm) and silica gel 60A-K6 plates (thickness 250 pm). The following three different solvent systems were used with both types of T L C plates. I.  B A W ; n-butanol: glacial acetic acid: water (60:15:25 v/v)  II.  IAW; isopropanol: concentrated ammonia: water (8:1:1 v/v).  III.  A A ; acetone: concentrated ammonia (100:1 v/v). Chromatograms of radiolabeled extracts were dried and then wrapped in saran  wrap and incubated overnight with a Molecular Dynamics phosphoimager screen in a Storm Phosphoimager. The image captured by the screen was scanned and analyzed using Storm 860 (Amersham Pharmacia Biotech) and ImageQuant software (Molecular Dynamics). D M A C (/7-dimethylaminocinnamaldehyde) reagent was used to detect indole compounds on T L C plates. D M A C (0.1 g) was dissolved in 10 ml concentrated HC1, and diluted to 200 ml with acetone immediately before use. The chromatograms were developed by a quick dip in this solution, followed by brief air drying and then heating for 2.5 min in an oven (65 °C).  52  2.11 Insect bioassay 2.11.1 Insect material  Egg bands of the forest tent caterpillar (FTC), Malacosoma  disstria Hub.,  (Lepidoptera, Lasiocampidae) were kindly provided by Dr. Bob McCron, Insect Production Unit, Canadian Forest Service, Sault Ste. Marie, Ontario. They had been collected from Espanola, Ontario, during October 2001 and stored at +2°C before they were shipped to Vancouver on ice during February 2002. Egg bands were surface-sterilized for 1.5 min by swirling in concentrated Javex (commercial bleach containing 5.25 per cent sodium hypochlorite) and then rinsed with cold tap water for 3-5 min. The egg bands were then washed with 1 percent Javex, air dried and placed in a petri dish near the poplar stem to hasten larvae eclosion. It is wellestablished that the caterpillars can detect poplar leaf volatiles and will modify their eclosion time based on availability of leaf material (Grisdale, 1976). Eggs hatched in 4-5 days and the neonates were maintained for about 10 days on an artificial diet [(No. 9795, BioServe Inc., Frenchtown, NJ) supplemented with finely ground alfalfa to improve acceptability, and with a vitamin mix (No. 8045, BioServe Inc., Frenchtown, NJ) for added nutritional value (Bomford and Isman, 1996)]. They were then fed cut leaves of wild type poplar 717 for the rest of their life span. Eggs of Manduca sexta L. (Lepidoptera: Sphingidae) (THW) were purchased from Carolina Biological Supply Company (Burlington, NC, USA). The eggs were placed on tobacco leaves in petri dishes lined with moist filter paper and held at room temperature under normal day light conditions, where they hatched within 2 to 3 days.  53  2.11.2 Neonate consumption and performance Equal size M. disstria neonates were selected for behavioral and physiological studies. Twenty-five neonates were placed in a petri dish containing 5 leaf discs (cut with #15 cork borer, 21 mm dia) of one of three 77JC7-expressing poplar 717 lines (high TDC # 12, medium TDC # 7, and low TDC # 4), or from a line transformed with empty vector (EV). Ten replications (5 leaf discs/ petri dish/ replication) were performed with each genotype. On day 2 and day 4, leaf discs from different treatments were collected and photographed using an IS-500 Digital Imaging System (Alpha Innotech Corporation). The leaf area consumed was quantified by using Scion Image software for Windows 98. From the fourth day onwards, eight larvae were removed from each petri dish and the remaining 17 larvae were allowed to feed on fresh leaves added from respective transgenic poplar lines. Leaves were exchanged every other day. However, instead of determining leaf area consumption (as on day 2 and day 4) larval mass was recorded on days 6 and 8. Statistical software (Statistix 7) was used for data analysis. A one-way analysis of variance (ANOVA) was conducted, and for comparison of means between different TDCl transgenic and control poplars, the least significant difference (LSD) test was applied with a 0.05 rejection level. Equal size M. sexta neonates were selected for behavioral and physiological studies on wild type and transgenic tobacco (Voelckel et al, 2001). Three neonate larvae were transferred to a single petri dish containing 5 leaf discs (cut with # 15 cork borer) of one of three 7DC/-expressing tobacco lines (high IDC # 4, medium TDC #11, and low TDC # 3) or from a line transformed with empty vector (EV). Ten replications were  54  performed with each genotype. After two days, leaf discs from different treatments were collected and photographed using an IS-500 Digital Imaging System and the leaf area consumed was quantified by using Scion Image software. From the second day onwards, two larvae were removed from each petri dish and only a single larva was allowed to feed on leaves added from the respective transgenic tobacco lines. Leaves were exchanged every other day and larval mass was recorded on days 2, 4, 6 and 8. A one-way analysis of variance (ANOVA) was conducted and for comparison of means between different TDCl transgenic and control tobaccos, the least significant difference (LSD) test was applied with a 0.05 rejection level.  2.11.3 Antifeedant bioassay  In the leaf disc choice bioassay, a larva was given a choice between transgenic and control leaf discs. Larvae of M. disstria were reared on leaves collected from wild type poplar plants. On the day of the bioassay, equal size early 4 instar larvae were th  selected and starved for 4 hours. Leaf discs from high (# 12), medium (# 7), low (# 4) TDCl-gene expressing and transformed control (EV) poplar lines were cut with a #15 cork borer. Two control and two leaf discs from one TDCl transgenic line were placed in a petri dish lined with a moistened filter paper and one larva was added to each petri dish. The petri dishes were placed in a clear plastic box on moistened paper towels and the insects were allowed to feed for 4 hours at 26 °C by which time about 50 per cent of the control leaf discs were consumed. Twelve replications were performed with each treatment. The leaf area eaten was photographed and determined as described above. A deterrence index was then calculated as (C-T)/(C+T) x 100, where C is consumption of  55  control leaf discs (EV) and Tis consumption of TDC transgenic leaf discs (lines # 12 or 7 or 4) (Isman et al, 1990). Larvae of Manduca sexta were reared on leaves collected from wild type tobacco plants. On the day of the bioassay, equal size late 3 instar larvae were selected and rd  starved for 4 hours. Leaf discs from high (# 4), medium (# 11), low (# 3) TDCl-gene expressing and transformed control (EV) plants were cut with a #15 cork borer. The leaf disc choice test was performed essentially as described above for M. disstria.  2.11.4 Nutritional analysis This bioassay was carried out in order to differentiate behavioral feeding responses from any toxic effects of the TDC gene product. Early 4 instar larvae of M. th  disstria were used to study the effect of TDCl gene expression in poplar plants on larval growth, consumption and dietary utilization. On the day of the consumption and growth assay, early 4 instar larvae were selected and starved for 4 hours. Larvae and leaf th  material were weighed and one larva was placed in a petri dish along with a known amount of leaf material from transgenic or control poplars. Larvae were then allowed to feed on leaves of transgenic and control plants for 4 days. More leaf material was added when larvae had consumed about 70 per cent of the initially added leaves. At the end of the experiment, the larvae were weighed, and the residual leaves and frass were dried at 60°C for 24 hours and also weighed. Twelve replications were performed with each genotype. All nutritional indices were calculated on a dry weight basis. To determine the fresh weight : dry weight ratios, 15 leaf samples (ca. 1.2 g each) and 15 early 4 instar th  larvae were dried for 24 hours at 60°C and weighed.  56  Once dry weights had been determined for larvae, diet and frass, and initial dry weights calculated for larvae and diet, various nutritional indices were calculated using the following formulae (Farrar et al, 1989): Relative growth rate (RGRi)  = Weight gained (mg) / initial larval weight (mg) / number days  Relative consumption rate = Leaf consumed (mg) / initial weight (mg) / number days (RCRi> Efficiency of conversion of = [Weight gained (mg) / leaf ingested (mg)] x 100 ingested food (ECI)  Efficiency of conversion of = [Weight gained (mg) / leaf ingested - frass (mg)] x 100 digested food ( E C D )  Approximate digestibility  = [Leaf ingested - frass (mg) / leaf ingested (mg)] x 100  (AD)  Data analysis was carried out using a one-way analysis of variance (ANOVA). For comparison of means between different TDCl transgenic lines and control poplars, the least significant difference (LSD) test was applied with a 0.05 rejection level. Nutritional analysis with  Manduca  sexta  feeding on control and transgenic  tobacco plants was performed essentially as described above for the  Malacosoma  disstria.  57  Chapter 3 Generation and analysis of TDC-transgenic poplar and tobacco  3.1 Introduction  Remarkable progress has been achieved in the 15 years since the first successful plant genetic transformation was reported for tobacco in 1984 (Horsch et al, 1984; Paszkowski et al, 1984). Progress has been extended to more than 120 species in at least 35 families and covers a wide range of economic crops, vegetables, ornamentals, medicinal plants, pasture plants, and forest trees. For most plant species, gene transfer is no longer the limiting factor for development and application of practical transformation system. A range of techniques is now available for plant transformation. Those derived from naturally-occurring gene transfer systems include the use of viral vectors (resulting in transient but not stable transformation) and Agrobacterium tumefaciens T-DNAmediated transformation. Different technologies have advantages and disadvantages. However, Agrobacterium-mediated  transformation is relatively efficient for many  species, and a low number of copies of intact, non-rearranged transgenes are typically integrated into the plant genome (Gelvin, 1998). Improved knowledge of the molecular biology of Agrobacterium tumefaciens, particularly the role in transformation of the Ti plasmid virulence (VIR) genes, is being used to increase the success rate of Agrobacterium-mediated transformation (Pena and Seguin, 2001). There are two main purposes of plant transformation: one is as an experimental tool, i.e. it allows direct testing of hypotheses regarding the function of genes in plant growth, development, and response to environment. Examples include analysis of the role  58  of specific enzymes in metabolic processes, role of hormones in plant development, cellular signals controlling sexual reproduction, plant-microbe interactions etc. The second use is as a practical tool for plant improvement. This includes developing plants with greater resistance to insects, viruses, herbicides, or slower post- harvest deterioration etc. (Birch, 1997). The present study was focused on the second main purpose of plant transformation, in this case to test the effectiveness of introducing aromatic amino acid decarboxylase genes as a transgenic approach to development of trees that are less susceptible to insect pest damage. To explore this idea, the tryptophan decarboxylase (TDC) gene from Camptotheca acuminata, which encodes the enzyme tryptophan decarboxylase, was tested. TDC catalyzes the conversion of tryptophan to tryptamine and thus has the potential to create a significant pool of tryptamine and/ or tryptamine metabolites in the transgenic plant. The TDC enzyme from C. roseus is a soluble protein with a molecular weight of 115,000 ± 3,000 Da, consisting of two identical subunits of 54,000 ± 1,000 Da (Noe et al, 1984). In C. roseus, the 7DC mRNA and the product enzyme have short half-lives, and both protein degradation and feedback inhibition by tryptamine have been implicated in the regulation of TDC activity (Meijer et al, 1993). Predicted amino acid analysis of C. roseus TDC did not reveal any signal sequence. This is consistent with its proposed cytoplasmic location (DeLuca and Cutler, 1987). In C. acuminata, the TDC deduced protein has a pyridoxal phosphate-binding site sequence (Pro-His-Lys) that is typical of pyridoxal phosphate-dependent decarboxylases. The lysine residue in this sequence is  59  directly involved in the binding of pyridoxal phosphate (Lopez-Meyer and Nessler, 1997). In some plants, TDC is known to supply precursors for the biosynthesis of monoterpenoid indole alkaloids (Waller and Dermer, 1981) and, in all plants it may play a role in the biosynthesis of the plant auxin, indole acetic acid (Schneider and Wightman, 1974). A dominant Arabidopsis mutant, yucca, was found to contain elevated levels of free auxin. Results from tryptophan analog feeding experiments and biochemical assays indicated that YUCCA, a flavin monooxygenase (FMO)- like enzyme, catalyzes hydroxylation of the amino group of tryptamine, and that this represents a rate-limiting step in tryptophan-dependent auxin biosynthesis (Zhao et al, 2001/ In animals, aromatic amino acid decarboxylases provide the tyramine precursor for the biosynthesis of neurotransmitters in the central nervous system and, in the case of Drosophila  melanogaster, the analogous reaction provides the building blocks for  sclerotization of insect cuticle (Hirsh, 1986). The amino acid sequences from both plant and animal aromatic amino acid decarboxylases show a high degree of similarity, pointing to an evolutionary link between the plant and animal enzymes (De Luca et al, 1989). TDC can also use substrates other than L-tryptophan, such as 4-methyltryptophan (4-mT), 4-fluorotryptophan and 5-fluorotryptophan. These compounds are toxic to plants but TDC can convert them into the corresponding tryptamine derivatives, which are nontoxic. Thus, the TDC gene can be used as a selectable marker in plant cells. For selection of TDC-transformed tobacco leaf discs, an optimum concentration of 4-mT was reported to be 0.1 mM (Goddijn et al, 1993). No morphological changes were observed in TDC  60  transgenic tobacco plants generated in this manner; However, the applicability of using 4mT as a transformation selection system in other plants will depend on their endogenous TDC activity and tolerance to enhanced tryptamine levels. In plants having high endogenous TDC activity, the 4-mT selection screen would not be absolute in differentiating the transformed cells from the wild type tissue. In Camptotheca  acuminata,  tryptophan decarboxylase is encoded by two  autonomously regulated genes: TDCl and TDC2 (Lopez-Meyer and Nessler, 1997). The open reading frames of TDCl and TDC2 are eighty-four percent identical at the nucleic acid level, but TDCl is developmentally regulated, while TDC2 activity is induced in response to pathogen attack or methyl jasmonate treatment (Lopez-Meyer and Nessler, 1997). The other aromatic amino acid decarboxylase considered for this present study was tyrosine decarboxylase (TyDC), which converts both tyrosine and dopa (3,4dihydroxyphenylalanine) to tyramine and dopamine, respectively. This is the only enzyme in the benzylisoquinoline alkaloid biosynthesis pathway that has been purified (Marques and Brodelius, 1988), and for which the corresponding cDNA has been cloned (Facchini and De Luca, 1994; Maldonado-Mendoza et al,  1996). In Papaver  somniferum, TyDC is encoded by a family of about 15 genes that can be divided into two subgroups, based on sequence identity (Facchini and De Luca, 1994). Genes encoding TyDC have also been isolated from plants that do not produce isoquinoline alkaloids, such as Arabidopsis thaliana (Trezzini et al, 1993) and parsley (Kawalleck et al, 1993), suggesting that TyDC genes have additional roles in plants. In parsley, Arabidopsis thaliana and opium poppy, TyDC mRNA transcripts were shown to be rapidly and  61  transiently induced in response to elicitor treatment (Kawalleck et al, 1993; Trezzine et al, 1993; Faccihini and De Luca, 1994) and pathogen challenge (Schmelzer etal, 1989). Despite the similarities between TyDC and TDC at the sequence level, it is clear from substrate specificity studies that the enzymes they encode them are not the same. The former showed no decarboxylase activity toward L-tryptophan while the latter did not decarboxylate L-tyrosine (Noe et al, 1984). In tobacco plants transformed with a construct containing a TyDC5 promoter sequence hooked to a GUS reporter gene, the GUS activity transiently appeared in all parts of the seedlings during germination, but was limited to the roots in older plants (Maldonado-Mendoza et al, 1996). This suggests that the TyDC5 enzyme may play an important role in providing precursors for defensive compounds in roots and germinating seedlings. Defoliating insects cause considerable damage to Populus species. Such damage often translates into a reduction of tree growth and survival. The commercially acceptable Bacillus thuringiensis (Bt) transgene has been successfully used to control insects in various economically-important crops. However, it is well established that insects have the ability to evolve resistance if a specific insecticidal agent is intensively used, so there is a need to search constantly for new sources of resistance. This study is a step towards this goal. The first part of this chapter describes the results of transient gene expression assay in tobacco to test the functionality of the tyrosine decarboxylase (TyDC5) and tryptophan decarboxylase (TDCl) genes. It also describes the process of generating transgenic poplar (hybrids 717 and P39) and tobacco plants carrying TyDC5 and TDCl  62  transgenes. The second part of this chapter describes the molecular analysis of the TDCl transgenic poplar and tobacco lines.  3.2 Results 3.2.1 Transient gene expression Leaf discs of poplar hybrid Populus tremula x P. alba, INRA clone 717 were cocultivated with Agrobacterium carrying a construct containing the TDCl or TyDC5 gene. With each gene construct, six Agrobacterium-mediated transformations (100 leaf discs each) were carried out. Although a total of 600 leaf discs were co-cultivated, only one TyDC5 and no TDCl transgene positive poplar line was detected by PCR. This raised the question, whether there was a problem with vector DNA sequence that was affecting transformation efficiency. A detailed restriction enzyme analysis was performed with both the constructs, and based on the restriction sites present in coding region of TDCl and TyDC5 genes, fragments of the expected sizes were not detected (data not shown). The coding region was PCR-amplified from both genes and cloned in binary vector pBinl9/PRT101 as described in detail in Materials and Methods. To test the in vitro functionality of the re-cloned aromatic amino acid decarboxylase constructs in stably transformed plants would have taken at least 4 to 5 months. The faster alternative was to perform transient gene expression analysis assays. Induced Agrobacterium cells containing the TDCl or TyDC5 construct, were infiltrated into fully expanded leaves of tobacco (N. tabacum cv. Xanthi). Three days later, the soluble proteins were extracted and analyzed. Since the constructs carried a carboxy terminal translational fusion of the FLAG epitope with the TDC and TyDC coding  63  region, it was possible to use imiriunoblot analysis with oc-FLAG antibody to monitor expression of the transgene. A protein of about 55 kDa was readily detected in extracts from TDCl-infiltrated leaves, while a 57 kDa protein was detected in 7yDC5-infiltrated tobacco plants. These correspond to the predicted masses of the TyDC and TDC proteins, respectively. As an infiltration positive control, tobacco leaves were also infiltrated with Agrobacterium cells containing a SIPK-FLAG  (salicylic acid-induced protein kinase)  construct. In this case, as well, a protein of 46 kDa was detected with anti-FLAG antibody. No proteins of these sizes were detected in non-transgenic control tobacco plants (Figure 3.1). These immunoblotting results confirmed that the coding region was in frame, and that the FLAG epitope was present and functional in each gene product. TDC enzyme activity assays were also performed on the protein extracts. Proteins from TDCl-infiltrated leaves gave about 6-fold higher TDC specific activity than did proteins from control tobacco leaves. The activity assays confirmed that the ectopically expressed TDCl gene and gene product were functional in vivo. When 7yDC5-infiltrated tobacco leaves were assayed for TyDC enzyme activity, no differences were observed between extracts from the TyDC5 infiltrated leaves and extracts from control tobacco leaves. Thus, although the TyDC5 gene product was readily detected in the 7yZ)C5-infiltrated leaves, the expressed protein appeared to be inactive. One reason for the loss of enzyme activity in the re-cloned TyDCS gene could have been due to base pair changes incorporated during PCR amplification of the TyDC5 coding region. To rule out this possibility, the 5' end of the re-cloned gene was sequenced twice. When the sequence of the 5' end of the recloned TyDC5 gene was compared with the database records for the TyDC5 gene, additional base pairs and base  64  H  !i  s  65  changes were consistently found in the re-cloned TyDC5 gene sequence (Figure 3.2). Interestingly, when the amino acid sequence of TyDC5 was aligned with other TyDC gene family members, most of the new amino acid residues detected in the sequence of re-cloned TyDC5 gene were found to be conserved in those locations in other members of the Papaver somniferum TyDC gene family (Figure 3.2). However, there were also three new amino acid residues, which were neither present in the original reported TyDC5 sequence nor in other members of TyDC gene family. To rule out the possibility that these base pair changes were artifacts produced during PCR amplification, the TyDC5 clone originally sent by Dr. Nessler was also sequenced and the same base pair changes were observed. Because of the uncertainty surrounding the sequence identity of the TyDC5 clone, and the failure to obtain a positive functional assay result with TyDC5, it was decided to focus on the TDCl gene for the remainder of the program.  66  Figure 3.2 Sequence alignment of re-cloned TyDCS gene with the original TyDC5 and other members of Papaver somniferum T y D C gene family * * *  1  RC-TyDC5 MGSLPTDNL. .ESMSICSQN PLDPDEFRRQ GHMIIDFLAD YYKNVESYPV ORG-TyDC5 MGSLPTDNL. .ESMSICSQN PLDPDEFRRQ GHMIIDFLAD YYKNV.KVSS  TyDCl MGSLPANNF. .ESMSLCSQN PLDPDEFRRQ GHMIIDFLAD YYKNVEKYPV TyDC2 MGSLNTEDVL ENSSAFGVTN PLDPEEFRRQ GHMIIDFLAD YYRDVEKYPV TyDC3 MGSLNTEDVL EHSSAFGATN PLDPEEFRRQ GHMIIDFLAD YYRDVEKYPV  RC-TyDC5 ORG-TyDC5 TyDCl TyDC2 TyDC3  52 ** **# RSQVEPGYLS RSQANPGS.Q RTQVDPGYLK RSQVEPGYLR RSQVEPGYLR 101 #  ** KRLPETAPNH QTLPETAPNH KRLPESAPYN KRLPETAPYN KRLPETAPYN  SESIETILQD SESIETILQD PESIETILED PESIETILQD PESIETILQD  VQNDIIPGIT VQNDIIPGIT VTNDIIPGLT VTTEIIPGLT VTSEIIPGLT  100 HWQSPNYFAY HWQSPNYFAY HWQSPNYFAY HWQSPNYYAY HWQSPNYYAY  105  RC-TyDC5 FPSSDSVAGF LGEML ORG- TyDC5 FPSSGSVAGF LGEML TyDCl FPSSGSIAGF LGEML TyDC2 FPSSGSVAGF LGEML TyDC3 FPSSGSVAGF LGEML  RC-TyDC5 : Re-cloned TyDC5 amino acid sequence ORG-TyDCS : Original TyDC5 amino acid sequence submitted to database TyDCl, TyDC2 & TyDC3. Members of Papaver somniferum TyDC gene family  * : Amino acid residues conserved in other members of TyDC gene family # : Amino acid residues not conserved in other members of TyDC gene family 3.2.2 Generation of transgenic poplar  Leaf discs from poplar hybrid lines Populus tremula x P. alba, INRA clone 717 (Leple et al., 1992) and Populus alba x P. grandidentata  cv. Crandon, NC5339 [P39] (Fillatti et  al, 1987) were co-cultivated with Agrobacterium  tumefaciens carrying the binary vector  pBinl9/PRT101. The vector contained a neomycin phosphotransferase (NPT II) selectable marker and the Camptotheca acuminata tryptophan decarboxylase  (TDCl)  coding region with a C-terminal translational fusion with a FLAG epitope (Figure 2.1). The P. tremula x P. alba hybrid was chosen because it is highly amenable to Agrobacterium-mediated  transformation (Leple et al, 1992). The Populus alba x P.  67  grandidentata hybrid was included in the study because it is an economically important poplar hybrid grown in commercial plantations. Transformed cells were selected.for kanamycin resistance on shoot induction medium containing either TDZ (717 genotype, Appendix A) or a combination of NAA, BA and TDZ (P39 genotype, Appendix A). Adventitious shoot buds formed along the wounded sides of leaf disks within 4-6 weeks. None of the control leaf disks from poplar hybrid 717 incubated without prior Agrobacterium  co-cultivation developed any  adventitious shoot buds on SIM. However, a few adventitious shoot buds did develop from control leaf disks of poplar hybrid P39. In all cases, the shoot clumps were transferred to shoot elongation medium containing BA. The cultures were transferred to fresh medium every two weeks to maintain the selection pressure of antibiotics. When the shoots were 2-3 cm long they were transferred to root induction medium containing IBA (717 genotype, Appendix A) or NAA (P39 genotype, Appendix A). The cultures were maintained under constant selection pressure, with kanamycin incorporated in all media. Within 2-3 weeks of transfer to rooting medium, 19 shoots of poplar hybrid 717 displayed vigorous root induction on medium containing kanamycin. Other elongated shoots did not develop roots on this medium. These could be 'escapes' that had survived the initial kanamycin selection through cross-protection of non-transformed cells by transformed cells. The rooted shoots were all tested by PCR for the presence of the transgene, and a total of 15 PCR-positive 717 lines were detected (Figure 3.3, Table 3.1). In poplar hybrid P39, only four shoots rooted in root induction medium with kanamycin, and only two PCR-positive lines were confirmed (Figure 3.4, Table 3.2).  68  >  > +  u  co  a  3 ^  2  ™g n  4H  n  C  Table 3.1 Comparison of three Agrobacterium co-cultivation treatments for the ability to produce transformed shoots in hybrid poplar 717  Number of explants producing TDCl Transformation PCR +ve shoots efficiency* (%) after 16 weeks 4 9 9 43 8 6 14 -78 5 8 10 57 * Number of explants producing TDCl -positive shoots per number of leaf discs cocultivated Number of leaf discs co-cultivated  Number of shoot clumps developed  Table 3.2 Comparison of two Agrobacterium co-cultivation treatments for the ability to produce transformed shoots in hybrid poplar P39  Number of explants producing TDCl Transformation efficiency* (%) +ve shoots after 15 weeks 1 1 27 82 2 1 25 56 * Number of explants producing TDCl -positive shoots per number of leaf discs cocultivated Number of leaf discs co-cultivated  Number of shoot clumps developed  The PCR-positive transgenic plants were transferred to the greenhouse to allow further growth and analysis. Figures 3.6 and 3.7 show the different stages of the poplar hybrid 717 and P39 transformation process, from Agrobacterium co-cultivation of leaf discs to growth of the transgenic plants in the greenhouse. Leaf discs from poplar hybrid 717 were also co-cultivated with Agrobacterium tumefaciens carrying an empty vector pBinl9/PRT101, following the same protocol as described above. Within 15 weeks, five shoots rooted on kanamycin-containing medium. When these were tested by PCR (Table 2.2), a total of four PCR-positive plants were recovered (Figure 3.5, Table 3.3). No PCR product was amplified either from wild-type genomic DNA or in a PCR reaction mix without DNA. 71  CD >  CD  U CU  CD j-  a!  u  S PJS  2  53 •—•  i l l •o 2 2 « * ft  I H  d  o 2  © H  y _3 22  5  d u so in  d  »-  u 03  2  u  CD  SJ  °- ? O ft  C N  in  t  a  G  C+H  O  5 eg  h  Table 3.3 Transformation efficiency of poplar hybrid 717 leaf discs co-cultivated with empty vector pBinl9/PRT101  Number of leaf discs co-cultivated  Number of shoot clumps developed  Number of explants producing NPTII PCR +ve shoots after 16 weeks  Transformation efficiency* (%)  42  11  4  10  * Number of explants producing NPTII-positive shoots per number of leaf discs cocultivated  Figure 3.6 Different stages of the poplar hybrid 717 transformation process.  A. Agrobacterium-co-cultivated leaf discs of poplar hybrid 717. B. Induction of shoot buds from leaf discs on the SIM medium. C. Development of shoot bud clumps on the SIM medium. D. Elongated shoots from the shoot bud clump on SEM medium. E. The elongated shoots rooted in vitro in the RIM medium. F. Transgenic plants in soil after 5 weeks.  73  74  Figure 3.7 Different stages of the poplar hybrid P39 transformation process.  A. Agrobacterium-co-cxxltivated leaf discs. B. Induction of shoot buds from leaf discs on the SIM medium. C. Development of shoot bud clumps on the SEM medium. D. Elongated shoots from the shoot bud clump on SEM medium. E. The elongated shoots rooted in vitro in the RIM medium. F. Transgenic plants in soil after 10 weeks.  75  76  3.2.3 Generation of transgenic tobacco TDC transgenic tobacco plants were generated as a transformation positive control, and also to allow a comparison of the TDC over-expression phenotype in both a herbaceous and a woody perennial crop. Leaf disks of Nicotiana were co-cultivated with Agrobacterium  tabacum  var. Xanthi  carrying a construct containing the TDCl coding  region translationally fused to the FLAG epitope (Figure 2.1). Transformed cells were selected for kanamycin resistance on shoot induction medium containing NAA and BA (Appendix A). Adventitious shoot buds formed along the edges of the disks within 2-3 weeks. None of the leaf disks from control tobacco plants developed any adventitious shoot buds on SIM. Shoots from the treated leaf discs elongated on the same medium over a period of 4-5 weeks. The regenerating cultures were regularly transferred to fresh medium every two weeks in order to maintain the kanamycin selection pressure. When the elongated shoots were 2-3 cm long, they were transferred to basal MS medium for rooting (Appendix A). Within 2-3 weeks, 13 shoots were well-rooted on root induction medium containing kanamycin. A total of 11 transgene-positive tobacco lines were detected by PCR, using a forward primer specific to the 35S CaMV promoter sequence and a reverse primer specific to the TDCl gene sequence (Table 2.2). No product was amplified either with wild-type genomic DNA or PCR reaction mix without DNA (Figure 3.8, Table 3.4).  77  Table 3.4 Transformation efficiency of tobacco leaf discs co-cultivated with  Agrobacterium  Number of leaf discs co-cultivated  Number of shoot clumps developed  Number of explants producing TDCl PCR +ve shoots after 10 weeks  Transformation efficiency* (%)  69  46  11  16  * Number of explants producing TDCl -positive shoots per number of leaf discs cocultivated Tobacco plants were also transformed with an empty vector pBinl9/PRT101 following the same protocol as described above. Within three weeks, 15 shoots rooted in kanamycin and were tested by PCR using NPTII gene-specific forward and reverse primers (Table 2.2). A total of 14 PCR-positive plants were recovered (Figure 3.9). No PCR product was amplified either with wild-type genomic DNA or in a PCR reaction mix without DNA (Figure 3.9, Table 3.5).  Table 3.5 Transformation efficiency of tobacco leaf discs co-cultivated with empty vector pBinl9/PRT101  Number of leaf discs co-cultivated  Number of shoot clumps developed  Number of explants producing NPTII PCR +ve shoots after 10 weeks  Transformation efficiency* (%)  60  42  14  23  * Number of explants producing NPTII-positive shoots per number of leaf discs cocultivated  79  80  3.2.4 Molecular analysis of gene expression in transgenic lines  In transgenic poplar and tobacco plants, transcript levels of TDCl mRNA were analyzed by quantitative reverse-transcription (RT)-PCR and by RNA blotting. RNA was extracted from the leaves of all poplar and tobacco transgenic lines. The reverse transcriptase reaction was performed with 2.5 pg total RNA. PCR was performed for 20 cycles using TDCl gene-specific primers and 2.6 pg first-strand cDNA as a template. The number of cycles was adjusted so that the amplification remained within the linear range. 18S rRNA-specific primers were used as an internal loading control. In order to find the optimum ratio of 18S primers to Competimers, PCR was performed using different concentrations of both, and the ratio was selected (1:1) at which the level of the 18S amplicon product was similar to the level of the TDCl gene-specific product. In the poplar hybrid 717 TDC putative transgenic lines gene expression was observed in all the lines (Figure 3.1 OA). The integral density value (IDV) ratios for all the transgenic lines were calculated by dividing the stained TDCl amplicon density values (measured by the Scion Image Program) by the 18S transcript density values (Figure 3.1 OB). The PCR analysis was carried out three times, but only data from a representative experiment is shown here. The trends of gene expression in all replications were similar. These IDV values formed the basis of a ranking of the transgenic lines, based on their apparent TDC expression level. Line # 1 showed the highest gene expression, whereas line # 9 had the lowest. A range of TDC gene expression levels was detected in transgenic lines, including plants expressing high (1,3,11, and 13), medium (2,5,6,7,12,14, and 15) or low levels (4,8,9, and 10). Wild type plants yielded no TDC amplicon.  81  Figure 3.10 RT-PCR analysis of the TDCl transgenic poplar hybrid 717 lines. RNA was extracted from the young leaves of transgenic and control poplar lines, and RT-PCR was performed as described in Materials and Methods. A. The agarose gel stained with ethidium bromide is shown. The upper (1.35 Kb) and lower bands (315 bp) correspond to the TDCl and 18S genes, respectively. B. The intensity of the TDCl and 18S bands was quantified using Scion Image software and the integral density value (IDV) ratio was calculated by dividing the ZDC7 transcript value by the 18S transcript value.  82  83  pa  y  d  >  g 9 C& D r>  co  CD  o *a3 <~d  CM  •g  S CO  cd  *  E o  s  CM  ON  i  .  Cl  w  60 co  2  CO  T3  .  u  a g §  a  CO  d  .a d  CO  s •81 u  -a  d  CU  tu so  a  ox) n ca  n .a rt VN. « d co r«"> H o ^ e -a ** 60 co 1 N C+H  Ncu C/3 O  CD CO CO OH ** C D & * - CD rt S? «•* > 53 O CO CD  JS JS  •as  CO  >>  li C> D  *ri CD  CD  OH  rt §  'co o >>  j*.  "w rtCD s 1  H  o  co O  CO  CC  -a  u  o <H  co co  U  rt,  CO  CD  d C D 60  00  CD  PM rtg «  _ r-i  CU ha  S  CO  CO  .gf CO CO  rt rd  CD  84  In poplar hybrid P39, TDC gene expression was observed in both the putative transgenic lines (Figure 3.11). No significant differences in terms of gene expression were observed between the two transgenic lines. Wild type P39 poplar plants yielded no TDC amplicon. In tobacco, TDC gene expression was detected in only nine out of a total of 11 PCR-positive transgenic lines (Figure 3.12A). The highest gene expression was observed in line # 4 and no gene expression could be detected in line # 1 and 7. Based on the IDV ratios, the tobacco transgenic lines could be ranked as high (4), medium (2,3,5,6,9,10, and 11) and low expressing lines (8) (Figure 3.12B). As expected, no TDCl transcript was detected in wild type tobacco plants.  Figure 3.12 RT-PCR analysis of the TDCl transgenic tobacco. RNA was extracted from the young leaves of transgenic and control tobacco lines, and RT-PCR was performed as described in Materials and Methods. A. The agarose gel stained with ethidium bromide is shown. The upper (1.35 Kb) and lower bands (315 bp) correspond to the TDCl and 18S genes, respectively. B. The intensity of the TDCl and 18S bands was quantified using Scion Image software and the integral density value (IDV) ratio was calculated by dividing the TDCl transcript value by the 18S transcript value.  85  >  86  Northern blot analysis was also performed on selected poplar 717 and tobacco transgenic lines, as well as their respective wild type control plants. Total RNA blots were probed with a P-labeled 1.35 Kb TDCl gene fragment. The hybridization signals 32  were quantified, normalized and plotted (Figures 3.13B & 3.14B). Among the poplar 717 transgenic lines, the highest gene expression was detected in line # 1 and the lowest in line # 9 (Figure 3.13A). No transcript was detected in total RNA isolated from nontransformed control plants. In tobacco, the highest gene expression level was detected in transgenic line # 4 and no message was detected in the transgenic line # 1 and 7 (Figure 3.14A). Similarly, no message was detected in non-transformed tobacco control. In both poplar 717 and tobacco transgenic lines, therefore, the overall expression pattern observed in Northern blot analysis was similar to the pattern obtained by RT-PCR (Table 3.6).  Figure 3.13 Northern blot analysis of TDCl transgenic poplar hybrid 717. RNA was extracted from the leaves of selected transgenic plants and northern blot analysis was performed as described in Materials and Methods. A. Leaf RNA (8 pg) was analyzed from transgenic and control poplar plants. RNA blots were probed with a P-labeled 1.35 Kb TDCl gene fragment. B. The hybridization signal intensities were measured using the Scion Image Program and normalized against the ethidium bromide staining intensity of the rRNA bands. 32  87  88  Figure 3.14 Northern blot analysis of TDCl transgenic tobacco. RNA was extracted from the leaves of selected transgenic plants and northern blot analysis was performed as described in Materials and Methods. A. Leaf RNA (8 pg) was analyzed from transgenic and control tobacco plants. RNA blots were probed with a P-labeled 1.35 Kb TDCl gene fragment. B. The hybridization signal intensities measured using the Scion Image Program and normalized against the ethidium bromide staining intensity of the rRNA bands. 32  89  90  3.2.5 TDC polypeptide in transgenics Since an antibody raised against TDCl was unavailable, poplar plants were transformed with a modified TDCl  construct consisting of a carboxy terminal  translational fusion of FLAG epitope with the TDC coding region. To test if there was a correlation between the level of TDCl mRNA and the level of protein, equivalent amounts of total soluble proteins (15 pg) were separated on 10% SDS-polyacrylamide gels and electroblotted onto nitrocellulose membrane. The membrane was probed with antibodies directed against the FLAG epitope. A prominent protein band (~ 55 kDa) was detected in almost all of the transgenic lines, while no protein of this size was detected in non-transgenic control plants (Figure 3.15A). The plotted values showed that the highest TDC protein accumulation was detected in line # 1 and the lowest in line # 9 (Figure 3.15B). The other lines generally follow the pattern that higher transcript levels parallel increased product formation. However, there were some exceptions, as observed in line # 12 and 15. In both of these transgenic lines, a relatively low transcript level was detected by RT-PCR but substantial amounts of TDCl protein were detected in immunoblot analysis. Immunoblot analysis was also conducted on the two poplar P39 PCR-positive transgenic lines. The TDC protein product was detected in both of the putative positive transgenic lines, whereas no product was detected in wild type plants (Figure 3.16). TDC protein accumulation in line # 2 was significantly higher than that in line # 1.  91  Figure 3.15 Western blot analysis of TDC transgenic poplar hybrid 717. Proteins were extracted from the leaves of transgenic and control poplar plants. SDS-PAGE and western blot analysis were performed as described in Materials and Methods. A. Each lane contained 15 pg total protein. The membrane was probed using antiFlag antibody. B. The TDCl immunoreactive bands were quantified using the Scion Image program and band intensity values were normalized for the protein loading as determined by Coomassie dye staining of the nitrocellulose membrane. The analysis was done three times, but only data from a representative experiment is shown here.  92  93  CD  T3  3  Cd  PQ 43  CJ CO  a  ON  m PH  < PH  W  00  nj  CO  . O  |0 'C  .e  o 43  O  Jj  CO  • <u  8 5  cd UH  -a  Is ^ §  60  a eg i_ ft "5S ^3 '33 O OH.S 3  CN  Q, o C  co  I J H S  U  S  a  CU  e  CD  H3>  bC CH CH cu  B  ce 1H  CD  60 co  U  Q  H  H  O  -a -d  O  co  CD cd CD 43 cd C o " CD  § •§ 60 cn  cd  co  5  xi  43  d  _  cd l-H  55 —  CD  d  2  43  B  CD  > *s C s s> cd 03 * H  CO  CD  <D ES GCD H  JO CD CD  43 43  S SCD +•>  in  (•0  CD  IT)  •4—*  E CD  IM  CO CO  o Id T3 CD  HJ3  cn  OH  CD  x  CD  a CD SP CD  d  cd  jo  d  '3  s OH  60  rt T3  B  CD  -HH CO CD  CD  d  • i—l  cd C  o  CD  3.2.6  Enhanced T D C enzyme activity in transgenic lines Total soluble proteins were extracted from the leaves of transgenic poplar and  tobacco plants and assayed for TDCl activity. TDCl activity ranging from 12.5-45.5 picokatals (pkat) per mg protein was detected in the leaves of different lines of transgenic poplar hybrid 717 (Figure 3.17). The highest enzyme activity was detected in line # 12, which accumulated five-fold higher TDCl activity than did the wild type control plants. In contrast, four-fold enhanced TDCl activity was detected in transgenic line #1, which had the highest transcript and polypeptide levels. The lowest activity was detected in line # 9, which is consistent with the partem observed in Northern and Western blot analysis (Table 3.6). Similar levels of TDCl enzyme activity were detected in the leaves of transgenic poplar hybrid P39. The highest enzyme activity (35.2 pkat/ mg protein) was detected in line # 2 and the lowest (13.0) in line # 1 (Figure 3.18). In contrast to poplar hybrid 717, no TDCl activity was detected in wild type control plants. Each enzyme activity value represents the mean of three values detected for each transgenic and control poplars.  95  o W on  5 H  -H  §  i  ON  s  a | €j rt C3 P3 co S C3 (U rt  5  C OH •9 S O t-<  00  PH  co  C  QQ  cu ™ <j "53  co  •a 00  c tr,  O  c  Cv) D)  1-H  CO  CN  C  03  a  rt cu  a~ r»  cu  a CU  of)  T-H  o E S o  ^  CO  S i-  3  cu  c 2  J2 ^ cu rt u — . s 00 a.  a x> o rt -c CN o un  to  VO  3  co  <o <u  OS co cu cj  o  03  §  cu - a  a 5 13 c5  •H cij +•* CU  i o  CU  1^  rtl  U £ Q CO  H  t-.  »-< •2  co  rt cu  rt  2 cu sS E 0 -g  I  *-  cu  CU CO  X cu  T3 3  OH  cu  1 CO  cu  M  96  C3 CO CO  co  R  5 'o  u  o  CM  R u u CO R  CU 00  co  4= (U  i s  o  o E o  -2 cc)  _t  CO  CU C  sc c3 O CN -  cu  CN  R u  M co H  a  k. ^ *  R  >>  ,  CO  S  S£  . 5>  a ^, O CU o 5 •J3 C M S3  CU  CO cd  cu CO CU  ° J3  2 © Xcu* a  es U Q  *3  M-H  o 5 g w  I  . a ta  "T•3* u  cu  B  g 6 co _  "H a | O CO  C M CO  T3 CO CO CO  CU  CO  R  cu  s cu^  H CO CO c cu 00 2 CO CO  P 3  (upicud Sui/irqd) AIIAIIOB 3QX  1I a  cu  fa  H  CU  8  am  cu J-  PH  cu  "  «  Table 3.6 Comparison of gene expression, product formation, enzyme activity and tryptamine levels in different TDCl transgenic poplar lines. Relative RT-PCR levels (IDV ratio) 0.0 Control 717 1 2.8 2 1.3 2.1 3 4 0.9 5 1.3 1.1 6 7 1.0 0.8 8 0.2 9 10 0.8 11 1.8 1.2 12 1.7 13 1.2 14 1.0 15 Control 0.0 P39 0.8 1 2 0.8 ND : Not determined.  PCRGenotype positive Iine#  Northern relative band intensity 0.0 277.5 155.8 234.5 ND 218.3 ND 142 ND 17 131.3 200.8 167.7 188.3 ND ND ND ND ND  Western relative band intensity 0.0 216.6 156.2 142.4 84.22 156.9 151.9 142.2 128.3 14.9 71.6 171.5 163.7 140.9 122.7 146.9 0.0 39.6 105.3  Enzyme activity (pkat/ mg protein) 8.6 34.4 32 30 20.8 34.7 38.3 45 23.6 12.5 21.1 39.4 .45.6 33.3 25.6 30.5 0.0 13.0 35.2  Tryptamine levels (pinoles/ mg leaf tissue) 903 868 2169 1504 1485 2115 ND 2175 ND ND 2229 ND 4002 1297 2970 1936 ND ND ND  98  In comparison to the transgenic poplar lines, a higher range of TDCl activity (32.5-186.1) was detected in the leaves of transgenic tobacco plants. The highest activity was detected in line # 4, which displayed more than eight-fold increased TDCl activity compared to wild type control plants (Figure 3.19). In lines # 1 and 7, by contrast, the TDCl activity was only slightly above that in control plants. The pattern of TDCl enzyme activity detected in different tobacco transgenic lines paralleled that observed for TDCl transcripts and protein accumulation (Table 3.7).  Table 3.7 Comparison of gene expression, product formation, enzyme activity and tryptamine levels in different TDCl transgenic tobacco lines.  Genotype  PCRpositive line#  Relative RT-PCR levels (IDV ratio)  Northern relative band intensity  Enzyme activity (pkat/ mg protein)  Tryptamine levels (pmoles/ mg leaf tissue)  0.0 0.0 0.7 0.7 0.9 0.7 0.7 0.0 0.4 0.6 0.7 0.6  0.0 0.0 51.7  21.4 32.5 69.2 61.7 186.1 90.3 58.3 33.6 43 91.7 87 133  334 400 2849 1820 8480  Control 1 2 3 4 5 6 7 8 9 10 11 ND : Not determined.  Tobacco  3.2.7  ND  78.7 ND ND  0.0 20.5 ND ND  45.7  ND ND ND ND  4182 3696 5037  Amino acid and amine profile in transgenics  Earlier reports on TDC transgenic tobacco had demonstrated that the overexpression of this gene could result in a reduction of tryptophan levels measured during seedling development. The creation of an artificial metabolic sink for tryptophan in 99  cu  I-H  3  -a  cu cu  o  CO CO CO  CO  O  a i  -o  a  cu CO  '5 CH CU  O cu CU  3 d  CU  3  cu M  co  co  -a o s CO E o  I'S  43 cu  -o  a t3 2 2^ O M 3L  CO  3  CO  £  O CU CN  o  T3  CO  CO  E  •£  3  g  CU cu '>  cu  •** _o •a Vcu  > -o CO  ecj  CO  3  cu  CU  •a e OS  co 3 cu  H •a  O  T§  CM  C  c ; •*-> cu g -H C - cu g CO  cu co  u Q H ON H  cO  J  2  cu  E  CO CO  3  «  B S  T3  rn rn cu i_  *  cu  3  cu CO CU  rt  OH  co g CO cO fa H £ CQ  J>.S (uiaioid Sui / itqd) AIIAIIOB 3QX  these plants also drastically affected the levels of phenylalanine, as well as those of the non-aromatic amino acids methionine, valine, and leucine (Guillet et al, 2000). To learn whether the transformation of poplar and tobacco with a TDCl gene in the present study had produced any effect on the overall amino acid and amine profile, soluble metabolites were extracted from the leaves of TDCl poplar and tobacco plants. The extract was sent to the Advanced Protein Technology Center in Toronto for analysis of amino acids and amines. Based on the amount of tryptamine accumulated in different transgenic lines, the transgenics are grouped into high, medium and low tryptamine producing lines. In both poplar and tobacco transgenic plants, the pattern of accumulation of tryptamine followed the pattern of TDCl  transcript expression  (Figures 3.20B and 3.2IB). In poplar, the mean amount of each amino acid accumulated in the different TDCl expressing groups was compared with the mean amount accumulated in untransformed control plants. Several of the amino acids showed a similar pattern of accumulation; namely, a higher level of the amino acid in plants belonging to the high TDCl expression group, lower levels in the low expression group and still lower accumulation in un-transformed control (Figures 3.20A and 3.20B). All the aromatic amino acids displayed this general trend of accumulation. In contrast, a reverse trend was observed in accumulation of aspartate, glutamate, asparagine and glutamine. However, the amount of these amino acids accumulated was significantly greater than that of untransformed control plants, except in the case of asparagine.  101  Figure 3.20 Analysis of amino acids in wild type and TDCl over-expressing poplar hybrid 717. Soluble metabolites were extracted from three fully expanded leaves harvested from the top of ten-weeks-old plants. The TDCl transgenic lines were divided into three groups (high, medium and low TDC) based on the level of tryptamine accumulation. Amino acid profiles in high, medium, and low TDC, and wild type poplar plants are shown in the clustered bar diagram. Values represent the means ± SE.  102  (snssri jBq §ui /sspura) junoury  104  In tobacco, a totally different profile of amino acid accumulation was observed. Most of the  amino acids followed a common pattern of accumulation, in which a low  level of the amino acid was observed in the high TDCl amounts were found in the low TDCl  expression group and higher  expression group (Figures 3.21A and 3.21B).  Generally, the level of amino acid accumulation in control plants was lower than that in the high TDCl  expressing group. However, the level of phenylalanine, aspartate,  glutamine, and glycine accumulated in the leaves of control plants was significantly higher than that of high TDCl  expressing group. The  trend of amino acid accumulation  for cysteine and histidine followed the pattern observed in poplar, with a higher level of amino acid in the high TDCl  expression group, a low level in tissues of the low  expression group and comparatively much lower accumulation observed in untransformed control plants.  Figure 3.21 Amino acid and amine analysis'of wild type and TDCl over-expressing tobacco. Soluble metabolites were extracted from two fully expanded leaves harvested from the top of ten-weeks-old plants. The TDCl transgenic lines were divided into three groups (high, medium and low TDC) based on the level of tryptamine accumulation. Amino acid profiles in high, medium, and low TDC, and wild type tobacco plants are shown in the clustered bar diagram. Values represent the means + SE.  105  (srtssp, jBaj §ui /sajouiu) junouxy  3.2.8 Morphology of poplar and tobacco TDCl transgenics Measurements of plant height and leaf number were recorded when the transgenic poplars and tobacco were five and six weeks old, respectively (Tables 3.8 and 3.9). The TDC transformed plants appeared to grow normally in the growth chamber under standard controlled environment conditions, and with one exception, no obvious abnormal morphological changes were observed in leaves or stems compared to empty vector control and untransformed controls. The exception to this pattern was TDCl tobacco line # 3, which consistently produced variegated leaves both in tissue culture and under growth chamber conditions (Figure 3.22). Tobacco transgenic plants were also grown to maturity and the seeds were collected. Except for TDCl transgenic line #10, seed set was normal in all the transgenic lines as compared to empty vector and non-transgenic control tobacco plants. TDC1-10 plants were grown to maturity three times to verify the observed reductions in seed set. These plants grew normally up to flowering stage and developed flowers but the number of mature seed capsules was markedly lower than on control plants. This seeding pattern was consistent in all the clones of this transgenic line.  108  Figure 3.22 TDCl tobacco transgenic line # 3 having variegated leaves. This is the only TDCl tobacco transgenic line which consistently produced variegated leaves under growth chamber conditions.  109  Table 3.8 Morphological data collected from the TDCl transgenic poplar plants after 5 weeks growth Poplar 717 TDC Plants  Height (cm)  Number of leaves  # 1 #2 #3 #4 #5 #6 #7 #8 #9 # 10 # 11 # 12 # 13 # 14 # 15 EV1 (control) EV2 (control)  25 30 30 26 22 25 31 32 26 29 24 26 28 34 27 30 28  15 15 16 15 12 14 15 15 14 15 13 15 15 17 15 16 16  Table 3.9 Morphological data collected from TDCl transgenic tobacco plants after 6 weeks growth  TDC tobacco plants # 1 #2 #3 #4 #5 #6 #7 #8 #9 # 10 # 11 EV1 (control) EV2 (control)  Height (cm)  Total number of leaves  50 55 55 60 53 60 58 55 60 55 55 55 65  25 25 22 29 26 31 25 26 26 28 24 26 29  110  3.3 Discussion This study was the first heterologous expression of a tryptophan decarboxylase gene in a perennial plant, although it has been extensively examined in various annual crops. In most of those systems, the TDC gene of choice has been that from Catharanthus roseus rather than the Camptotheca acuminata TDC gene used in this case. These two orthologous genes share 67 per cent amino acid identity (De Luca et al, 1989). C. roseus is known for the production of various terpenoid indole alkaloids that possess pharmaceutical properties (Farnsworth, 1985) and thus most studies employing the C. roseus have been directed at increasing the levels of these alkaloids. In this case, the goal was to establish whether changing the metabolite profile of poplar by over-expressing the C. acuminata TDC gene would influence the insect feeding pattern on the resulting transgenic trees. 3.3.1. Transient gene expression The first part of this chapter describes the results of transient expression assays of tryptophan decarboxylase and tyrosine decarboxylase genes in tobacco. Infiltration of induced Agrobacterium cells containing the TDCl  or TyDC5 construct into fully  expanded tobacco leaves, followed by immunoblot analysis and enzyme assay of soluble proteins extracted from the infiltrated leaf tissue three days later, confirmed that the TDCl  gene was functional. The efficiency  and reproducibility of the  Agrobacterium-mediated transient gene expression system (agro infiltration) has been reported earlier (Kapila et al, 1997). During the transient assays, no enzyme activity could be detected in TyDC5infiltrated leaves, in spite of accumulating high levels of the FLAG-fusion protein.  Ill  When the sequence of the 5' end of the re-cloned TyDC5 gene was compared with the database entries for the TyDC5 gene, additional base pairs and base changes were consistently found in the TyDCS gene sequence, although these still maintained the gene in frame (Figure 3.2). It seems unlikely that the observed base changes were artifacts produced during PCR amplification of the TyDCS coding region, since high fidelity Pfu-polymerase was used. Due to the failure of obtaining a functional TyDC5 protein and the uncertainty of the gene sequence associated with it, it was decided to focus on the TDCl gene for the remainder of the program.  3.3.2 Transformation protocol The latter part of this chapter describes the ectopic expression of the Camptotheca acuminata TDCl cDNA clone in hybrid poplars 717 and P39, and in tobacco. The transformation and screening for regenerants in specific economically important genotypes can still be difficult (Ellis et al., 2001), although the general process of transfer of DNA into plant cells using Agrobacterium tumefaciens, biolistics, or other physical.methods is now routine (Han et al, 1996; Jouanin et al, 1993; Kim et al, 1997). Several laboratories have reported efficient transformation systems for poplars (Leple et al, 1992; Tsai et al, 1994; Tzifra et al, 1997; Fladung et al, 1997; Han et al, 2000) but much of the work has been restricted to a few poplar species and hybrids. Transformation efficiency in poplars can be influenced by the Agrobacterium strain, explant source, genotype, physiological conditions for regeneration, and phytohormone type and combination, which means that protocol standardization is required to optimize the transformation efficiency (Han et al, 2000).  112  To achieve higher transformation rates in our system, the explants were precultured on basal medium supplemented with auxin and cytokinin for about 24 hours before the Agrobacterium co-cultivation treatment. The logic behind this is that host cell division is required for successful Agrobacterium transformation (Binns and Thomashow, 1988), and auxin can stimulate cell division in plants. Previous studies have reported pre-culturing explants in a high auxin medium (Mathis and Hinchee, 1994; Sangwan et al., 1992), or with a combination of auxin and cytokinin (Han et al., 2000) to enhance the transformation rate. To  further  Agrobacterium  increase  the  transformation  efficiency,  over-night  grown  cells were induced for one hour by the addition of 100 pM  acetosyringine, before the actual co-cultivation with poplar and tobacco leaf discs. In nature, phenolics exuded from the wounded site on the plants regulate the Agrobacterium VIR genes that initiate a set of reactions that result in transfer of the TDNA (Stachel et al, 1986; Rogowsky et al, 1987). Acetosyringone, an established phenolic signal molecule, is a component of the natural phenolic exudates from wound sites, and has been shown to improve the transformation efficiency of leaf explants in Populus nigra (Confalonieri et al, 1995). In both poplar and tobacco, the regenerants were selected on media containing kanamycin and passed through a secondary kanamycin screen to trap any escapes. To facilitate early and easy detection of putative transformants, the PCR has been extensively used in transgenic studies. However, to exclude the possibility of artifacts and contamination in PCR-generated data, proper positive and negative controls must be  113  included in the analysis. Through PCR using construct-specific primers putative, TDCl transgenic tobacco and hybrid poplar lines 717 and P39 were readily identified. Transformation efficiency varies greatly in poplar depending on a number of factors mentioned earlier (Section 3.3.2). In the present study, the transformation efficiency ranged from 9 to 10 per cent for poplar hybrid 717 transformed either with the TDCl gene or empty vector. However, the transformation frequency in poplar hybrid P39 (P. alba x P. grandidentata) was much lower (1-2%) when compared to hybrid 717. The transformation efficiency in poplar is known to range from as high as 60 per cent, reported in P. kitakamiensis (Kajita et al, 1994), to as low as 0.7 per cent, reported in Populus x euramericana and P. alba x P. grandidentata (Liang et al, 2001; McCown et  al, 1991). The transformation efficiency for other poplar lines falls between 3.5 and 20 %, as reported in P. nigra and P. trichocarpa x P. deltoides (Confalonieri et al, 1995;  Han et al, 2000).  3.3.3 Gene expression and morphology of transgenics Although PCR analysis using genomic DNA reveals the integration of the transgene, it does not provide information about the expression pattern of the transgene. Through RT-PCR and northern blot analysis, expression of the C. acuminata TDCl gene in both the poplar hybrids and tobacco was confirmed. The level of gene expression varied among the different transgenic lines (Figures 3.10, 3.11 and 3.12), a phenomenon that may be due to position effects or copy number, or both. Position effects are thought to be the variation in transgene expression resulting from variation in structure and activity of the chromatin into which the transgene has been incorporated (Gelvin, 1998).  114  Although such variable expression of transgenes in independent transgenic plants is regarded as a constraint of transformation, generation of a range of expression levels in a series of transgenic lines provides useful information on the effects of different levels of gene expression on a particular phenotype. In the extreme case, there can be an apparent absence of transgene expression. In two of the tobacco transgenic lines, no TDCl gene expression was detected by RT-PCR or Northern blot analysis (Figures 3.12 and 3.14). This could be the result of gene silencing, a phenomenon in which a functional transgene is present in the genome but its expression is turned off. Generally this silencing is posttranscriptional, resulting in failure of transgene RNA to accumulate even though transcription occurs at a rapid rate. Induction of post-transcriptional gene silencing (PTGS) may be a consequence of use of the strong viral 35S promoter, which results in marked over-production of transgene RNA. If this is pushed above a threshold level, it is thought to trigger its own irreversible degradation (Vaucheret et al, 1998). Analysis of protein expression in these transgenic lines revealed differential accumulation of TDC-FLAG protein, which was in accordance with the relative levels of the TDC-FLAG  message in these lines. However, there were some exceptions, as  observed in lines #12 and 15, in which a modest level of transcript was detected by RTPCR, but the protein levels were as high as in other lines. This could suggest there is some internal post-transcriptional regulation which might increase the stability of the transgene mRNA. Testing the functionality of the over-expressed transgene through enzyme activity assays, revealed a range of TDC activities (32.5 to 186.1 pkat per mg protein) in the TDC transgenic tobacco lines. These values are higher than those detected in earlier TDC-  115  tobacco studies (19.03-69.2 pkat per mg protein) (Poulsen et al, 1994; Sougstad et al, 1990; Goddijn et al, 1993). Such variations in enzyme activity could be due to the methodology, or to the position or age of leaf tissue used for the TDC activity assay. The enzyme activity can even vary within the leaves of the same plant, as shown in an earlier study, where the highest levels were detected at the shoot tip and the lowest near the shoot base (Songstad et al, 1990). Since wild-type tobacco plants are believed to lack a TDC gene, neither TDC activity, nor tryptamine-derived secondary products are expected to occur in wild-type tobacco plants (Songstad et al, 1990; Poulsen et al, 1994; Thomas et al, 1995b; Leech et al, 1998). Similarly, in this study, TDC gene expression was not detected in wild type tobacco plants. However, a basal level of enzyme activity similar to TDC was detected in the leaf tissues of wild type tobacco plants and a low level of tryptamine was recorded in the amine assays. This could be a UV fluorescent metabolite other than tryptamine extracted into the ethyl acetate phase (Section 2.7.2.1), whereas the assumed tryptamine peak detected in HPLC analysis could be one of the tryptamine metabolites falling within the same range as the tryptamine standards. TDC enzyme assays confirmed that the transgenic lines of both poplar hybrids expressed a functional protein. Although the same TDC assay protocol was used to measure TDC activity in wild type plants of both poplar hybrids, a low level of activity was detected in 717 plants, whereas no activity was detected in P39 plants. There is a possibility that the activity detected in wild type 717 plants is caused by a UV fluorescent metabolite other than tryptamine extracted into the ethyl acetate phase (Section 2.7.2.1). Moreover, in the RT-PCR with wild type poplar 717, no endogenous TDC gene  116  expression was observed. More importantly, in the precursor feeding studies using labeled tryptophan, the label was never detected in tryptamine in the wild type extracts. This further supports the argument that wild type poplar hybrid 717 plants do not accumulate tryptamine. Tryptophan and phenylalanine are both derived from chorismate through a branch point controlled by the key enzymes anthranilate synthase (AS) and chorismate mutase (CM). Chorismate is either converted to anthranilate and then to tryptophan, or to prephenate and then to phenylalanine or tyrosine (Yao et al, 1995). It is known that tryptophan inhibits its own synthesis through feedback inhibition of anthranilate synthase and activates chorismate mutase through feed-back activation leading to increases in phenylalanine or tyrosine levels (Bentley, 1990). The over-expression of a C. roseus TDC cDNA in tobacco was reported not to influence the specific activity of AS and CM enzymes (Poulsen et al, 1994), but other studies of TDC transgenic canola, potato and tobacco demonstrated that TDC expression resulted in a drastic reduction in the levels of tryptophan and phenylalanine accumulated in the transgenic tissues (Chavadej et al, 1994; Yao et al, 1995; Guillet et al, 2000). However, this re-direction of tryptophan into tryptamine did not influence the concentration of most non-aromatic amino acids (Yao et al, 1995). This pattern is clearly not consistent, since there are other studies that report no change in the levels of tryptophan induced by constitutive over-expression of TDC in transgenic petunia and tobacco (Thomas et al, 1999; Thomas et al, 1995b). A reduction in the level of phenylalanine was observed in the present transgenic tobacco study. However, this does not have to be correlated with the artificial metabolic  117  sink for tryptophan, since the tryptophan levels did not change in the transgenics. By contrast, no reduction in the level of any aromatic amino acid was observed in the transgenic poplar plants. The amino acid accumulation profiles in tobacco and poplar TDC transgenic plants differed in several points, suggesting that the same heterologous gene can affect the endogenous metabolic profiles differently in different species. This could be expected as different indirect homeostatic mechanisms become involved in different plants, when attempts are made to perturb cell physiology (Westerhoff, 1995). In poplar, several of the amino acids accumulated to higher levels in plants belonging to the high TDCl expression group, whereas in tobacco, a reverse trend was generally observed (Figures 3.20a and 3.20b; 3.21a and 3.21b) although exceptions were also noted. Previous studies have reported similar observations in TDC transgenic canola (Chavadej et al, 1994), potato (Yao et al, 1995) and tobacco plants (Guillet et al, 2000). However, within either genotype the recorded differences between TDCl transgenics and wild type control plants were generally small and of doubtful significance. They could be the result of minor physiological differences in leaf material used for amino acid extraction, or related to changes in HPLC analysis efficiency. In addition, the amino acid accumulation data presented in this thesis is derived from composite samples obtained from pooled tissue representing high, medium and low-TDCl  expressing lines, which makes it difficult to  reach conclusions regarding the status of individual lines. The key observations that can be extended from these analysis are that 1) the transgenic lines accumulate significant quantities of tryptamine; 2) the quantity of tryptamine accumulating is clearly correlated with the level of TDCl expression and TDCl gene product activity; and 3) expression of  118  the transgene does not have a dramatic effect on overall amino acid metabolism in the transgenic lines at the stage of growth that was examined. Given the centrality of indole metabolism for plant physiology, constitutively high TDC activity in transgenic plants could be envisioned to be detrimental to growth (Thomas et al, 1995b; Yao et al., 1995). However, despite accumulation of large amounts of tryptamine in some of the transgenic poplar and tobacco lines, all the plants appeared to grow normally and no obvious morphological changes were observed in leaves or stem. In an earlier study of TDC transgenic tobacco, blackening of wounded stems was observed in vitro and interpreted as an alteration of secondary metabolism caused by higher levels of TDC (Thomas et al, 1995b). Likewise, in TDC transgenic potato plants, high levels of TDC caused an imbalance in shikimate and phenylpropanoid pathways, rendering those potato plants susceptible to Phytophthora infection. This was attributed to modification of cell wall composition of these plants resulting from the reduced level of phenolics (Yao et al, 1995). Cell wall digestibility studies with cellulase and pectinase showed that digestion of the transgenic tuber tissue released twice as many protoplasts compared with the untransformed tubers, suggesting a more fragile cell wall structure in the transgenic lines. In the present study, TDCl tobacco line # 3 developed variegated leaves. This leaf pattern was consistent in both tissue culture and under growth chamber conditions. Since this phenotype was not found in any other lines it could be the result of an independent insertional event, where the T-DNA insertion at a particular locus resulted in perturbation of the normal phenotype.  119  Seed set was also normal in most of the transgenic tobacco lines, with the exception of transgenic line #10. This line consistently produced far fewer mature seed capsules on the three clonal lines grown to maturity. There was no other associated phenotype observed in this line. Again, it seems likely that this phenotype results from the insertion of T-DNA in one of the genes involved in the transition from flowering to seed maturity, and not a result of the TDC gene function. Previous reports also found that an increase in TDC levels does not have profound effects on plant growth, despite the fact that tryptamine is also a possible precursor of indole-3-acetic acid, and that IAA levels could be influenced by overexpression of a TDC gene. Such impacts would be predicted to affect the developmental pattern of the transgenic plant. However, when a full-length C. roseus cDNA clone encoding TDC was introduced into tobacco, the transformed plants appeared normal and demonstrated no significant difference in indole-3-acetic acid levels between transformants and controls (Songstad et al, 1990). In our study, levels of IAA were not analyzed. Similarly, when Petunia hybrida, carrying endogenous TDC gene was transformed with C. roseus TDC cDNA, the transgenic petunia plants did not show any morphological or growth abnormality, despite accumulating 8-fold more tryptamine compared to wild-type plants (Thomas et al, 1999). TDC can also adversely affect the production of glucosinolates, which are secondary products typically found in the family Brassicaceae (Fenwick et al, 1989). The biological function of these sulphur-containing compounds is not well understood, but defensive roles against pathogenic bacteria, fungi, and insect herbivores have been proposed (Fenwick et al, 1983). Canola (Brassica napus) is a member of this family, and  120  in canola plants, the over-expression. of a TDC gene resulted in the redirection of tryptophan into tryptamine rather than into indole glucosinolate biosynthesis (Chavadej et al, 1994). In mature seeds of the transgenic lines, indole glucosinolate accumulation was only three per cent of that seen in wild type plants. Endogenous tryptophan levels can play a significant role in modulating the impact of ectopic expression of the T D C enzyme. Cell cultures of Peganum harmala are known to synthesize p-carboline alkaloids and serotonin as major secondary metabolites (Berlin et al, 1993). The endogenous level of serotonin was enhanced as much as 10-fold when the Peganum harmala cell suspension and root cultures were transformed with C. roseus TDC c D N A . However, when exogenous L-tryptophan was provided, the serotonin levels in the transgenic lines were further enhanced, reaching 3-5 per cent of cell dry mass (Berlin et al, 1993). This indicates that increased product formation can be at least partially dependent on the levels of substrate available for decarboxylation by T D C . Interestingly, no change in the amount of either tryptamine or P-carboline alkaloids was observed in these transgenic lines. Thus, it is not readily predictable whether the product of the reaction of an enzyme linking primary and secondary metabolism is indeed ratelimiting, or which metabolic sequence will be affected by transgene expression (Berlin et al, 1993). In summary, in an attempt to generate transgenic poplar that can better withstand pest attack, stable Agrobacterium-mediated  transformation was performed using a C.  acuminata TDCl gene, that resulted in a large number of TDC transgenic lines in poplar hybrid 717 and tobacco. We were able to recover only two positive transgenic lines from poplar hybrid P39. The transformation efficiency reported in this study is within the  121  range normally observed for these species. Putative transgenic lines were confirmed by PCR analysis to detect the presence of TDCl gene sequence, by RT-PCR to detect the level of transgene mRNA and by western blots to detect the FLAG epitope fused at the C-terminus of the TDC protein. Amino acid and amine analysis showed a reduction in the basal levels of phenylalanine in the transgenic tobacco plants, but no reduction was observed in the level of any aromatic amino acid in transgenic poplar plants. No visible phenotypic changes were observed due to ectopic expression of TDC in either species. Thus, this study demonstrates that transgenic plants can be directed to synthesize and accumulate high levels of tryptamine without apparent adverse effects.  122  Chapter 4 Identification of indole compounds and insect bioassays 4.1 Introduction Lepidopterans known in the adult stage as butterflies and moths, form the second largest taxonomic order of organisms in the biosphere. The vast majority of caterpillars (larvae) of this group feed on plants, and populations of these phytophagous caterpillars can vary yearly, seasonally and with the plant diversity in the area. Phytophagous caterpillars function foremost as feeding machines, having basically a mouth, a gut, and an anus (Slansky, 1993). The main function of larvae is to feed and to assimilate nutrients so that they can acquire sufficient resources to complete metamorphosis to the adult and reproduce (Heinrich, 1979). Thus, they need to spend as much time as possible foraging. Generally,  foraging herbivores need to acquire critical amino acids,  carbohydrates, lipids and minerals for their normal growth and survival. One or more of these critical components is often in limiting supply in host plants, resulting in the need for the insects to eat more in order to obtain sufficient amounts of a critical food ingredient. The simultaneous intake of potentially deleterious ingredients may therefore reach toxic levels. Plants have an array of defense compounds that can play an important role in herbivore performance. For example, when gypsy moth and forest tent caterpillars were reared on several trembling aspen (Populus tremuloides) clones, it was the defensive components rather than the nutritional components that were the dominant factor accounting for variation in herbivore performance between clones (Awmack and Leather, 2002). The availability of defensive compounds usually varies with the developmental  123  stage and age of different plant parts, which may reflect an explicit defense strategy in the timing and localization of these compounds. Some plant species accumulate the indole amine, tryptamine, during the seedling stage, a pattern that is thought to protect young seedlings against insects (McKenna et al, 1984; DeLuca et al, 1988; Aerts et al, 1991; Bracher and Kutchan, 1992; Thomas et al, 1995b). The forest tent caterpillar (Malacosoma disstria Hubner), a defoliator, causes considerable damage to Canadian deciduous forests, where it feeds mainly on Populus species, particularly trembling aspen (Populus tremuloides) (Abou-Zaid et al, 2001). To control such insect predation, expression of anti-insect compounds in transgenic plants has been implemented recently. It is now well known that the expression of Bacillus thuringiensis (Bt) toxins, or protease inhibitors (Pis), in transgenic plants can greatly decrease insect damage (Hilder et al, 1987; Johnson et al, 1989; Koziel et al, 1993; Perlak et al, 1990; Thomas et al, 1995a). However, for the long-term control of insect pests there is a need to search constantly for new sources of resistance. One source of resistance could be the introduction of novel plant metabolites, while another would be increasing existing plant metabolites that provide protection. Tryptamine and its derivatives are among the array of neuroactive substances that have been found to act as insect oviposition-deterring and anti-feeding agents and/or inhibitors of larval and pupal development. In laboratory feeding trials, tryptamine itself has been reported to inhibit development in Tetrahymena pyriformis (Csaba, 1993) and Helix aspersia (a snail) (Vehovszky and Walker, 1991). In transgenic studies, tryptamine and its metabolites have been shown to act as anti-herbivore compounds. Transgenic tobacco plants over-expressing tryptophan  124  decarboxylase (TDC) accumulated elevated levels of tryptamine, which were correlated with a decrease in whitefly colonization (Thomas et al, 1995b). Normally, TDC expression would also be predicted to mediate a decrease in essential amino acids such as tryptophan (required for insect yolk production and oogenesis). However, in this case, no change in tryptophan levels was observed in leaves of the transgenic plants (Thomas et al, 1995b). Using Drosophila melanogaster as a model system, it was observed that feeding Drosophila on an artificial diet supplemented with 75 mM tryptamine reduced reproduction by 15 per cent compared to controls due to decreased oviposition rates (Thomas et al., 1998). This tryptamine concentration is similar to the concentrations found in transgenic tryptamine-accumulating plants (31 mM) (Songstad et al., 1990). However, few plants naturally produce the millimolar levels of tryptamine that is required for anti-insect activity (Songstad et al., 1990; Aerts et al, 1991; Thomas et al, 1995b; Thomas et al, 1998). This suggests that the use of tryptamine and/or its metabolites as means of protecting crop plants would require development of suitably equipped transgenic plants which can accumulate high levels of tryptamine and its metabolites. In this study, molecular analysis of TDCl-transgenic plants demonstrated that the transgenics accumulated elevated levels of tryptamine as compared to control plants (Chapter 3). To assess the impact of this modified chemistry in stably transformed poplar and tobacco plants, bioassays were performed using forest tent caterpillar and tobacco hornworm, respectively, as herbivores. This chapter describes the results of leaf disc choice bioassays and nutritional analyses performed with different transgenic poplar and tobacco lines.  125  In order to obtain some insight into the metabolic fate of tryptophan and tryptamine in the stable TDCl over-expression transgenic plant tissues, radiotracer studies were also performed.  4.2 Results 4.2.1 Identification of indole compounds Tryptophan is the metabolic precursor of many different indole compounds. Overexpression of TDC, an enzyme that decarboxylates tryptophan to tryptamine, would be expected to affect the indole metabolite composition of the plant, so it was important to establish both the profile of indole compounds in wild type plants and in TDCl transgenics. Thin layer chromatography was used to identify tentatively the native indoles and the labeled tryptophan metabolites generated in these experiments. The per cent recovery of label in different fractions demonstrated that the majority (~ 80 per cent) of label remains in the aqueous phase and aqueous discard fraction (Figure 4.1). The major compound expected in these fractions is tryptophan, which indicates that the majority of labeled precursor remained unmetabolized in the leaf tissue. In the butanol phase, no differences were observed in percent recovery of label between transgenic and wild type poplar leaf tissue. In the basic fraction, the recovery of label from transgenic tissue extracts was thirty-fold higher than in wild type tissue extracts, whereas the reverse was seen in the acidic fraction, with two-fold recovery in wild type tissue compared to transgenic tissue extracts. In preliminary experiments, chromatography conditions, were established to resolve the likely metabolites (tryptophan, tryptamine, 5-hydroxy tryptamine and N -  126  Figure 4.1 Per cent recovery of C-labeled tryptophan products in the different fractions of 717 transgenic line #12 and wild type poplar plants 14  Aqueous filtrate from Celite Adjust to pH 7.0  1 Aqueous phase Adjust to p H 3.0  Ether phase NEUTRAL FRACTION  Aqueous phase Adjust to p H 11.0  Ether phase ACID FRACTION  f Aqueous phase Divide into 2 aliquots  Ether phase BASIC F R A C T I O N  Extract with n-butanol  BUTANOL FRACTION  Aqueous phase discard  AQUEOUS FRACTION  * Empty bars: Wild type tissue; Filled bars: Transgenic tissue. Note: The recovery percentage readings (Y-axis) of aqueous phase discard and aqueous fractions do not start from zero.  127  methyl tryptamine). In all three solvent systems, one major additional radioactive product was detected in the ether soluble basic fraction extracted from the transgenic line (Figure 4.2), whereas no product of similar mobility was detected in extracts from wild type poplar plants. Based on the Rf values of standards, the new labeled product was tentatively identified as a tryptamine. These results were further verified by the color reactions with an indole reactive reagent, DMAC. Tryptamine generates a distinctive blue-purple pigment after reaction with the DMAC reagent (Schneider et al, 1972). In all three solvent systems, the new product detected in the basic fraction of transgenic line extracts reacted with DMAC exactly as tryptamine (Figure 4.3).  128  Figure 4.2 Comparison of labeled tryptophan products separated in the different indole fractions of wild type and transgenic poplars.  The different fractions of indole compounds were separated by TLC, and radioactive products labeled from [ C]-tryptophan were detected in a Storm Phosphoimager. 14  A. #12-C-BAW: Methanol-soluble assay products from transgenic line #12 separated by cellulose TLC plate in n-butanol:glacial acetic acid: water (60:15:25 v/v) solvent system. B. #12-C-IAW: Methanol-soluble assay products from transgenic line #12 separated by cellulose TLC plate in isopropanol: concentrated ammonia: water (8:1:1 v/v) solvent system. C. #12-SG-AA: Methanol-soluble assay products from transgenic line #12 separated by silica gel TLC plate in acetone: concentrated ammonia (100:1 v/v) solvent system. D. WT-C-BAW: Methanol-soluble assay products from wild type plant separated by cellulose TLC plate in BAW (60:15:25 v/v) solvent system. E. WT-C-IAW: Methanol-soluble assay products from wild type plant separated by cellulose TLC plate in IAW (8:1:1 v/v) solvent system. F. WT-SG-AA: Methanol-soluble assay products from wild type plant separated by silica gel TLC plate in AA (100:1 v/v) solvent system. N: Neutral fraction;- Ac: Acidic fraction; B: Basic fraction; Sd: Standards; Bu: Butanol phase; A: Aqueous phase; Aq: Aqueous discard; Tm: Position of tryptamine.  129  <  OQ  <  c/3  U  I  o  rt PQ  I  CN  T  PQ  H  cn PQ CJ  a  H so  •a <  <  3 PQ  I  C/3  PQ  U  CN 3fc  t  a  PQ  T3  <  <  PQ I  U  H  rt PQ C/3  PQ  3  H  130  Figure 4.3 Comparison of tryptophan products extracted in the different indole fractions of wild type and transgenic poplars.  The different fractions of indole metabolites were separated by TLC, and the chromatograms were developed by quick dip in the DMAC reagent, followed by brief air drying and then heating for 2.5 min in an oven (65 °C). A: #12-C-BAW; B: #12-C-IAW; C: #12-SG-AA; D: WT-C-BAW; E: WT-C-IAW; F: WT-SG-AA. (Abbreviations are the same as in Figure 4.2) N: Neutral fraction; Ac: Acidic fraction; B: Basic fraction; Sd: Standards; Bu: Butanol phase; A: Aqueous phase; Aq: Aqueous discard; Tm: Position of authentic tryptamine; Sr: Position of authentic 5-hydroxy tryptamine; Mtm: Position of authentic N-methyl tryptamine; Trp: Position of authentic tryptophan.  131  H oo  1H  &  T3  <  3  3 ffl  O  00  t  oo  a oo PQ H  •3 <  rt pq  I  U cs  00  < I  u  H  CQ  tt  t  t  CO  < eq l  u tt  tt  132  4.2.2 Insect bioassays Based on their tryptamine accumulation, transgenic lines of poplar hybrid 717 and tobacco had been grouped into high, medium, and low gene-expressing groups. For both poplar hybrid 717 and tobacco, one transgenic line from each group was used in the insect bioassays performed with Malacosoma disstria (FTC, forest tent caterpillar) and Manduca sexta (THW, tobacco hornworm).  4.2.2.1 Neonate consumption and performance Consumption and performance studies were carried out to assess the effect of TDCl over-expression on growth and physiology of FTC neonates. In poplar, the average leaf area consumed by FTC was determined on day 2 and day 4 from the start of the feeding experiment (Figure 4.4). On day 2, the average leaf area consumed from the high TDCl gene-expression line (# 12) was significantly lower (1.16 cm ) than from the 2  empty vector (EV) control line (1.73 cm ). The same pattern was observed on day 4, 2  where the average leaf area consumed by FTC larvae was significantly greater in both the empty vector (1.54 cm ) and the low gene-expression lines (1.53 cm ) than in the medium (1.18 cm ) and high (1.07 cm ) gene-expression lines. 2  2  On day 6 and day 8 of the experiment, the larval mass was recorded (Figure 4.5). The average larval mass varied among the TDCl transgenic lines, with the highest weight gain observed in larvae feeding on the low expression line (# 4) and the lowest in high expression line (# 12) although differences were not significantly (p>0.05) different between the transgenic lines. In contrast, the FTC larvae mass was significantly greater on EV control plants than on any of the TDCl transgenic lines. This trend continued on  133  134  00  e  s  . g  S O Df) C  / o  TT  o  A  O  CU  o  TS C CB  cu  c2  T3  ts  CU  CM  O CO  N  </">  1 '3 a  £  o !rt  "•3  J3 C U TJ 00 CN T3 rt S  £  '55  0  3fc  indicate n  ave  o >«  fte  ed VO -C Of  CO  <*i  CU  s  nat plar li  o a a, o CU  '3  OH CU M o 1—I  lH CU  '  CO  "3 g  rt O rt W  OX) c/5 (/>  -H  C  CU  >  CO CU repi  « «  tu  same  TDCl t  >  rt rt  lue  *r>W  e  mass o  G  ers  CU  s CM  CCJ  O  rt on  .3  av  sst fa  o  c O ' r t  mea  CU  w:  CO  nts  03  CO  CCJ  M  3  OJD Tt  CN O  (Sui)  00  VO  *t  SSBUI JBAJTJJ 9§BJ3AV  tN  '£  o > M  rtl  rto  con  CU  ccj  W  * o O  day 8, with significantly more weight gain on control lines (10.77 mg) as compared to medium (8.54 mg) and high (7.86 mg) expression lines. In the tobacco experiments, the average leaf area consumed by THW on day 2 from the start of the feeding experiment (Figure 4.6) was also significantly lower on the high (2.46 cm ) and medium (2.47 cm ) TDCl-gem 2  2  expression lines compared to the  empty vector (EV) control tobacco lines (2.99 cm ) and low expression line. The average THW larval mass was recorded on days 2, 4, 6 and 8 (Figure 4.7). On day 2, the average larval mass of THW feeding on control, low and medium geneexpression lines were at par and significantly higher than the mass of the larvae on the high gene-expression line. The average larval mass on day 4, was significantly lower on the high (127.1 mg) gene-expression line as compared to the low (157.7 mg) and control (148.8 mg) tobacco line. This pattern continued on days 6 and 8. Based on these results, it appears that the larval consumption of the leaf tissue, as well as larval weight gain resulting from that consumption, are inversely correlated with the level of TDCl gene-expression. These adverse effects of TDCl enzyme activity on larval growth could either be behavioral (feeding deterrent) or physiological (postingestive). To explore these possibilities, antifeedant bioassays and nutritional analysis were conducted with 4 instar larvae of FTC and THW. th  4.2.2.2 Antifeedant bioassay The leaf disc choice bioassay is a short-term assay that reports effects on larval feeding, not on growth or vitality of the insect. The assay was carried out using 3 instar rd  M. disstria and M. sexta larvae because it is generally observed that later instar larvae  136  o  BO  -d  *•  "I  •O -ft  i  J  ' I—I  co O  a CN  Q c3  u  o> a  2 § § 8 J a  5  W  a -3 t->  OH  a o -a d • i—i  CO  3  1 -'Mi J "o d  ^ d© *  5 w *  T3 ±5  S  • co CJ  N H  a  u  g " a Rt ^  o  I CO  CJ co 43 4H  2 ^ OH 00 ^ -a «T' g is " > c3  in  <N  (jUIO) pSUItlSUOO  in o JB9J 3§BJ9AV  3 « S  O B  CO  43 cu Jco 3 H-H  ° ^3 "o Q u m > £  SD © a ch UJ  u-  137  & o s  to  o u  -t—' Q  o  .s-  u  5  I  cu cu  .2  C  •ct  Q  ° "B  •a  E3  •  CO cO cd  o o  00  o o  o o  o o  CN  (Sui)  o o o  o o  o o  00  SSBUI JBAiBT 3§BJ9AV  o o  Q  o o  tN fa c3  138  generate less variable results in choice bioassays as compared to neonates (Xie and Isman, 1992; Kleiner et al, 1995). The assay was performed using either one of high (# 12), medium (# 7) or low (# 4) gene-expression line as a treatment and empty vector (EV) poplar hybrid 717 line as a control, and the results expressed as a deterrence index (Section 2.11.3). The highest average deterrence (16.97 ± 7.97 %) was observed with the high gene-expression line (# 12) and the lowest (9.15 ± 6.05 %) with the low gene-expression line (# 4, Table 4.1). A similar gradient of deterrence was observed in leaf disc choice bioassays carried out with transgenic and control tobacco plants. The high gene expression line (# 4) showed the highest (33.58 ± 12.51 %) and low gene expression line (# 3) the lowest average deterrence (6.54 ± 10.42) (Table 4.1).  Table 4.1 Antifeedant action of TDCl transgenics on late 3 disstria and Manduca sexta larvae  Poplar 717 transgenic lines  # 12 (high-77jg #7 (medium- TDC) # 4 (low- TDC)  Average deterrence (%) 16.97 ±7.97 12.48 ±7.85 9.15 ±6.05  r  instar Malacosoma  Tobacco transgenic lines  #4 (high-77JQ #11 (medium- TDC) #3 (low-TDQ  Average deterrence (%) 33.56 ± 12.51 27.09 ±9.95 6.54 ± 10.42  Each value represents mean ± S.E. of 12 replications  4.2.2.3 Nutritional analysis  The results of nutritional experiments on 4 instar FTC and THW larvae are th  presented in Tables 4.2 and 4.3. This experiment involved weighing the larvae and diet  139  before the assay, and weighing the larvae, diet and frass at the end of the assay. Based on these measurements, five nutritional indices were calculated: RGR/ (relative growth rate), RCR/ (relative consumption rate), ECI (efficiency of conversion of ingested food), ECD (efficiency of conversion of digested food) and AD (approximate digestibility). Mean values of all nutritional indices are presented in Tables 4.2 and 4.3. The RGR/, ECI and ECD of FTC larvae feeding on the leaves of high  TDC1-  expressing poplar line (# 12) were significantly reduced in comparison to larvae feeding on leaves of empty vector control (EV) line (Table 4.2). However, no significant reductions in the RCR/ and AD were observed. Similarly, the RGR/, ECI and ECD of THW larvae feeding on the leaves of high 7DCi-expressing tobacco line (# 4) were significantly lower as compared to larvae feeding on leaves of empty vector (EV) line, whereas the AD was in a reverse order (Table 4.3). No significant differences in the RCR/ were observed between transgenic and control lines.  Figure 4.8 Overview of poplar plants and FTC larva used for insect bioassays. A. Egg bands of forest tent caterpillar before and after eclosion. B. Fourth instar larvae of FTC feeding on poplar leaf. C. TDC transgenic lines (# 12, 7 and 4) and empty vector control poplar line (EV) used to collect leaves for insect bioassays performed with FTC larvae.  140  Figure 4.9 Overview of tobacco plants and THW larva used for insect bioassays. A. Eggs of tobacco hornworrn larvae. B. Fifth instar larva of THW. D. TDCl  transgenic lines (#4, 11 and 3) and empty vector control tobacco line (EV)  used to collect leaves for insect bioassays performed with THW larvae.  142  143  Table 4.2 The effect of TDCl over-expression on the growth, feeding and dietary utilization by Malacosoma disstria larvae after feeding for 4 days on the leaves of poplar TDCl transgenic and control plants  Transgenic plants  Tryptamine (pmole/ mg leaf tissue)  EV (Control) #4 (Low) #7 (Medium) #12(High)  903 1485 2175 4002  RCR/ RGR/ (mg/mg/day) (mg/mg/day) 2.93 2.97 2.26 2.70  0.37* 0.30 0.27 0.21  ab  c  a  a  ab  a  a  bc  65.20" 60.94" 72.62 64.03  a  a  a  ab  24.70 19.48 19.05 13.87"  14.09 10.74 12.82 8.33  a  a  AD (%)  ECD (%)  ECI (%)  ab  b  a  ab  Abbreviations: RGR/ (relative growth rate); RCR/ (relative consumption rate); ECI (efficiency of conversion of ingested food); AD (approximate digestibility); ECD (efficiency of conversion of digested food). Each value represents mean of 12 replications *Means followed by the same letters within columns indicate no significant difference (P>0.05) in LSD test.  Table 4.3 The effect of TDCl over-expression on the growth, feeding and dietary utilization by Manduca sexta larvae after feeding for 4 days on the leaves of tobacco TDCl transgenic and control plants  Transgenic plants  EV (Control) #3 (Low) # 11 (Medium) #4 (High)  RCR/ ECI Tryptamine RGR/ (pmole/ mg (mg/mg/day) (mg/mg/day) (%) leaf tissue) 334 1820 5037 8480  2.05* 1.71" 1.52" 1.02" a  a  a  5.55 5.04 5.15 5.59 a  a a a  ECD (%)  32.07" 33.57 26.03 23.40 a  a  bc  c  AD (%)  80.93 61.77 46.20 35.29 a  ab  b  b  48.46 57.45 61.39 67.13 a  ab b b  Abbreviations are the same as in Table 4.2 Each value represent mean of 12 replications *Means followed by the same letters within columns indicate no significant difference (P>0.05) in LSD test.  144  4.3 Discussion 4.3.1 Identification of indole compounds Feeding experiments using labeled precursors have been successfully used to reveal the complexities of various pathways. For example, in vivo labeling of TDC transgenic potato tubers with C-shikimic acid demonstrated that the transgenics 14  accumulated lower amounts of tryptophan, phenylalanine, and chlorogenic acid. The incorporation of labeled shikimate into these three metabolites decreased by more than 50 per cent in transgenic tubers compared with untransformed controls (Yao et al, 1995). In the present study, labeling of TDC transgenic poplar leaves with C 14  tryptophan identified a newly labeled product tentatively identified as tryptamine. In the basic fraction of transgenic line extracts, a thirty-fold higher percentage of the label was recovered in comparison to the basic fraction of wild type plant extracts (Figure 4.2). Since the indole compounds expected to be recovered in the basic fraction are tryptamine and N-methyltryptamine (Schneider et al, 1972), this distribution of label suggests that tryptophan is being actively converted to one or both of these metabolites. Analysis by thin layer chromatography and color reactions performed with the different fractions revealed no incorporation of label into compounds behaving like either 5-hydroxy tryptamine or N-methyltryptamine. These results are in agreement with several previous reports on the overexpression of TDC, which demonstrated an increase in accumulation of tryptamine in transgenic lines without further metabolism (Songstad et at., 1990; Poulsen et al, 1994; Goddijn et al, 1995). This is not always the case, however, since an increase in 5hydroxytryptamine was observed in 77JC transgenic root cultures of Peganum harmala  145  with no change in the level of tryptamine (Berlin et al, 1993). Cell cultures of wild type P. harmala were able to accumulate basal levels of tryptamine, as well as serotonin as a major secondary metabolite. The biosynthetic pathway for the production of serotonin involves tryptamine, so it is not surprising that the TDC transgenics accumulated increased levels of serotonin rather than simply accumulating tryptamine, as was observed in other TDC transgenic plants having no endogenous TDC activity.  4.3.2 Insect bioassays The interaction between indole derivatives and insects has been shown to result in altered insect behaviors, including feeding and reproduction (Argandona et al, 1980; Corcuera, 1984; Aerts et al, 1992). In this study, we used a molecular approach to generate poplar and tobacco TDCl transgenics with elevated levels of tryptamine. The transgenic lines with the highest accumulation of tryptamine consistently showed an adverse effect on feeding behavior as well as the physiology of forest tent caterpillars (FTC) and tobacco hornworms (THW) in insect bioassays performed with both neonates and 4 instar larvae. Increased levels of tryptamine in TDC transgenic tobacco plants had th  previously been correlated to a decreased whitefly pupa emergence of iipto 97 per cent when comparison to wild type plants (Thomas et al, 1995b). In 'no choice' feeding assays conducted over several days, both FTC and THW neonates consumed significantly less leaf tissue and gained less mass on the foliage of plants with high-TDC expression and high tryptamine levels as compared to empty vector control plants. This demonstrates that the transgenics with elevated levels of tryptamine had anti-insect activity, although it does not distinguish between feeding deterrence and  146  toxicity. In insect bioassays conducted with transgenic anti-sense putrescine N-methyl transferase (AS-PMT) tobacco plants, in which lower levels of nicotine were produced, THW neonates also consumed more leaf area and gained more mass on the foliage of the plants with reduced PMT expression and low nicotine levels as compared to plants with high PMT expression and high nicotine levels (Voelckel et al., 2001). The mode of action of the anti-insect effect in the transgenics was investigated with 4 instar FTC and THW larvae. Leaf disc choice assays make it possible to dissect th  out potential antifeedant activity (Schoonhoven, 1982; Xie et al, 1994), while measurement of the nutritional indices reveals possible toxic effects. These results show that the acceptability of the leaf tissue to FTC and THW larvae was substantially reduced as the tryptamine levels in the tissue increase. The deterrence indices of high and low 77_)C-expression lines of both poplar and tobacco were also consistent in this regard (Table 4.1). It is interesting that Drosophila can detect tryptamine at 75 mM concentration and avoided it (Thomas et al, 1998), whereas the concentration of tryptamine in the high 77J>C-expressing lines used here was maximally 8 mM and 4 mM in tobacco and poplar lines, respectively. Feeding trials with tryptamine and its derivatives have shown that these indole metabolites can act as insect antifeedants in other, non-transgenic plants. The indole metabolites, tryptamine, 5-hydroxytryptamine or methoxytryptamine, when applied to female brown planthopper, Nilaparvata lugens, adults were found to possess antifeedant properties (Sogawa, 1971). In insect bioassays with wood extracts from Virola calophylla, known to accumulate 5-methoxy-N, N-dimethyltryptamine and 2-methyl-6-  147  methoxytetrahydro-P-carboline, antifeedant effects of these metabolites were also shown against the cotton boll weevil (Anthonomus grandis) (Miles et al, 1987). In contrast to the choice test, no differences were detected in the relative rate of consumption (RCR/) in the nutritional experiments. Since these were no choice experiments, the lack of RCR/ differences implies that the insects (FTC and THW) will avoid feeding on transgenic tissue only if they are given a choice between transgenic and control leaf tissue. This indicates that the larvae will eat even poor tasting food rather than starve. However, a significant reduction was observed in the efficiency of conversion of ingested food (ECI) in FTC larvae feeding on the leaves of high transgenic lines as compared to control lines.  These differences were large enough also to reduce  significantly the growth rate of the insects, as suggested by the RGR/. The ECI is an overall measure of an insect's ability to utilize the food for growth that is ingested and it is a product of both the AD and ECD. The AD represents the portion of ECI that measures the efficiency with which the food is assimilated, while the ECD is the portion that measures the efficiency with which the assimilated food is converted to body substance. The FTC larvae feeding on high IDC-expression poplar plants showed a significantly lower ECD than those feeding on control plants. However, no differences were observed in the AD between the same larvae. This demonstrates that the differences in ECI were due to a significantly lower efficiency of conversion of the digested food to body tissues i.e. growth, rather than any problem with digestion and absorption from the gut. The lower growth rate of larvae feeding on high TDC plants may be due to a higher  148  metabolic cost encountered when feeding on the leaves of transgenic plants having higher levels of the bio-active amine tryptamine. The development times and growth rates of gypsy moth larvae feeding on diet containing phenolic glycosides were more strongly affected than those of forest tent caterpillars, again suggesting a role for higher metabolic cost in dealing with toxic metabolites (Hemming and Lindroth, 2000). It is not only the toxic metabolites that can affect the growth rate of insects but also physical factors and bioavailability of plant nutrients. Comparative behavior studies of Chrysomela scripta (Coleoptera: Chrysomelidae) adults feeding on mature and immature leaves of Populus x euramericana, illustrated that low nitrogen content and high amounts of fiber and tannins in mature leaves resulted in longer developmental times and lower prepupal weights in larvae feeding on mature leaves (Harrell et al, 1982). The situation observed in tobacco differed somewhat from the poplar results. THW larvae feeding on the leaves of high-77_)C tobacco plants suffered a significant reduction in their larval growth rate (RGRi), ECI and ECD, but the approximate digestibility was significantly increased in insects feeding on the high-TDC line. This implies that the differences in ECI must be due to a marked reduction in the efficiency with which the digested food was converted to body substance, especially since digestion and adsorption were not factors, and thus must actually have enhanced the nutrient availability in the high TDC feed. The higher AD could be attributed to the fact that highTDC line accumulated about twice the amount of tryptamine as poplar line thus the insects might require more energy to metabolize this bio-active amine. Although the food  149  digestibility was greater, it appears that a major portion of it was utilized for energy rather than for growth. Since the FTC and THW larvae did not reject the transgenic leaf tissue, in the non-choice test, even though it is clearly deleterious to their growth, the growth inhibition induced by feeding on high TDC tissue is presumably due to a post-ingestive physiological mechanism. Other indole bases, such as TVcu-methyltryptamine, 5-methoxyA^/Y-dimethyltryptamine, 5-methoxytryptamine and 3-A^Af-dimethylaminomethylindole (gramine) have all been shown to reduce the survival of nymphs of Rhopalosiphum maydis (com aphid) 48h after feeding on a synthetic diet supplemented with these compounds (Corcuera, 1984). These compounds possessed LD o values ranging from 2.3 5  to 3.8 mM in these tests. For the first time, we have demonstrated that a tryptophan decarboxylase transgene can be stably integrated and expressed as a functional enzyme in poplar hybrid. The ectopic expression of Camptotheca acuminata TDC was shown to allow sufficient tryptamine to accumulate in poplar and tobacco leaf tissues to adversely affect the growth rate of specific herbivore insects, and the behavioral and physiological studies suggest that the origin of this effect is probably a form of chronic toxicity, at least under laboratory conditions. However, the long-term stability of the transgene needs to be confirmed under field conditions. It is well-known that small differences in feeding rates can translate into major differences in survivorship under field conditions (Eigenbrode et al, 1990). Thus, TDC could be considered as a putative insect-resistance gene.  150  Chapter 5  Towards genetic engineering of the insect resistance in forest trees (Concluding remarks and future considerations)  Canadian deciduous forests, particularly in the northern boreal region, are often dominated by poplar and aspen, which are subject to severe defoliation by forest tent caterpillars (FTC). FTCs are certainly one of the major defoliators of deciduous trees in the interior of British Columbia. This insect occurs in cyclic outbreaks which persists for 2-6 years on a 6-16 year interval (Robinson and Raffa, 1990). During 1990, a heavy infestation of forest tent caterpillars in northeastern BC caused defoliation of trembling aspen stands covering 206,000 ha (Wood, 1992). Heavy defoliation by insects not only reduces the growth rate of trees and but also renders them susceptible to other insects and diseases. Although Nature has provided trees with a range of chemical defences that help protect them from insect predation, increasing the harvestable output from this forest system will require incorporation of pest management strategies. Unlike agricultural crops, crop protection measures involving application of insecticides on a forest scale are not always feasible. A practicable alternative in trees could be the incorporation of genetic-based resistance against insects. The refined gene transfer technology that allows new, qualitative changes to trees to improve productivity and pest management traits may provide a sustainable and environmentally safe alternative to classical breeding. It is already established that the expression of Bacillus thuringiensis (Bt) toxins, or protease inhibitors (Pis), in  151  transgenic annual crops can greatly decrease insect damage, but for long-term control of insect pests it would be regularly essential to develop new sources of resistance. The work presented in this thesis is a step towards this goal. The enzyme TDC catalyzes the decarboxylation of tryptophan to tryptamine in a single-step, irreversible reaction, and the resultant accumulation of tryptamine has been shown to negatively affect insect behavior, development and physiology. Although it appears that gene regulation in woody plants may be similar to that in herbaceous plants, we cannot always predict or.anticipate similar results in perennial plants based on the results of model herbaceous plants. This fact was supported by the profile of amino acids detected in TDCl transgenic poplar and tobacco plants. In transgenic poplars, the level of most of the amino acids varied with the 77JCi-expression level, while a reverse trend of accumulation was observed for most of the amino acids in transgenic tobacco plants. This demonstrates that a given transgene can indirectly influence different endogenous mechanisms in different genetic backgrounds. Tryptophan has been shown to be a feedback inhibitor of its own biosynthetic pathway and a feedback activator of the pathway leading to phenylalanine and tyrosine synthesis (Bentley, 1990). Over-expression studies of TDC in canola, potato and tobacco had earlier demonstrated a drastic reduction in the basic levels of tryptophan and of phenylalanine in the transgenic plants (Chavadej et al, 1994; Yao et al, 1995; Guillet et al, 2000). In agreement with several previous studies, phenylalanine levels were reduced in the TDCl transgenic tobacco lines, but ectopic expression of TDCl did not result in the alteration of tryptophan concentrations. The latter outcome has also been reported in transgenic petunia (Thomas et al, 1999) and tobacco plants (Thomas et al, 1995).  152  In transgenic poplar plants, increased tryptamine accumulation did not adversely affect the levels of any of the aromatic amino acids investigated, while Guillet et al, (2000) observed drastic reductions in aromatic amino acids during the seedling stage of 7DC-transgenic tobacco plants. This discrepancy in results could be due to the age of leaf tissue used to extract amino acids, since in our study, amino acid analysis was performed using leaf tissue collected from 10 week-old poplar and tobacco plants. It would be interesting to study the amino acid profile in younger transgenic poplar plants to verify whether over-expression of TDC has any adverse effect on the level of aromatic amino acids. Over-expression of TDCl in poplar plants resulted in an increase in accumulation of tryptamine without further metabolism, as demonstrated by radiotracer studies. These results are consistent with several previous reports on TDC over-expression in herbaceous crops that have no endogenous TDC activity. However, this is not the case in plants that already possess an endogenous TDC gene, and which accumulate tryptamine metabolites rather than tryptamine. Since the channel for the indole alkaloid pathway is already established in these plants, whatever tryptamine is produced by the engineered reaction can be immediately used for enhanced biosynthesis of tryptamine metabolites. Different lines of evidence suggest that the adverse effects of TDC-transgenics on the larvae of FTC and THW are due to increased levels of tryptamine in transgenic plants. However, I cannot rule out the possibility that alterations in other unmeasured metabolites might have contributed to the toxicity of transgenics. Earlier studies with different insects have demonstrated that tryptamine can act as an antifeedant and growth inhibitory compound  (Sogawa, 1971; Vehovsky and Walker, 1991; Csaba, 1993;  153  Thomas et al, 1998), but this has not been directly tested with FTC and THW. Feeding trials with a synthetic diet supplemented with the different concentrations of tryptamine would be useful to confirm the direct effect of this compound on the growth and development of these insect species. Once toxicity of tryptamine towards larvae of FTC and THW is established, it would be interesting to investigate the mode of action of tryptamine. We were unable to recover a sufficient number of positive transgenic lines in the economically important poplar hybrid P39. Although around 150 leaf discs were cocultivated with Agrobacterium harboring TDCl  gene, only two positive lines were  recovered. High sensitivity of P39 cultures to kanamycin could be the reason for low recovery of transgenic lines, but this was not explored systematically. Further studies are needed to improve the transformation efficiency of the P39 genotype. The presence of changed bases in the TyDC5 gene sequence and absence of any activity associated with the transiently expressed protein, forced a focus on TDCl transgenics in the time available. It would be interesting to study the effect of ectopic expression of the TyDC gene in poplar with regard to incorporation of resistance against pests and pathogens, since this has been demonstrated to improve plant survival in other species. At least under laboratory conditions, this study has demonstrated the growth inhibitory effects of TDCl transgenic leaf tissue against FTC and THW larvae. Although the inhibition is not dramatic, small differences in feeding rates could have important ecological consequences. For example, in a comparative study with larvae of the diamondback moth (Plutella xylostella), survival of larvae confined on leaf disks of 2518  154  (Cabbage genotype) in the laboratory was much greater (80% of controls) than it was on whole plants in the field (0.36% of controls) (Eigenbrode et al, 1990). Non-preference of leaf tissue in combination with environmental stresses to larvae could contribute towards their increased mortality under field conditions. Whether or not this gene should be considered as an effective insect resistance gene will depend upon maintenance of resistance under field conditions. Possible differences between gene expression in juvenile and mature tissues need to be explored, and further studies are required to test the long-term stability of this transgene under field conditions. Extensive long-term field trials with transgenic poplars and spruce at different locations have demonstrated that transgene expression can be very stable in trees over time (reviewed in Ellis et al, 2001). Thus, the future looks promising for economically important trees that are engineered with TDC to resist the assault by damaging insects.  155  Bibliography Abe K, Emori E, Kondo H, Suzuki K and Arai S 1987. Molecular cloning of cystein proteinase inhibitor of rice (oryzacystatin). J. Biol. Chem. 262: 16793-16797. Abelson P 1991. Improved yields of biomass. Science 252: 1469. Abou-Zaid MM, Helson BV, Nozzolillo C and Arnason JH 2001. Ethyl m-digallate from red maple Acer rubrum L., as a major resistance factor to forest tent caterpillar, Malacosoma disstria Hbn. J. Chem. Ecol. 27: 2517-2527. Aerts RJ, van der Leer T, van der Heijden R and Verpoorte R 1990. Developmental regulation,of alkaloid production in Cinchona seedlings. J. Plant Physiol. 13: 86-91. Aerts RJ, Snoeijer W, Aerts-Teerlink O, van der Meijder E and Verpoorte R 1991. Control and biological implications of alkaloid synthesis in Cinchona seedlings. Phytochemistry 30: 3571-3577. Aerts RJ, Stoker A, Beishuizen M, Jaarsma I, van der Heuvel M, van der Meijden E and Verpoorte R 1992. Detrimental effects of Cinchona leaf alkaloids on larvae of the polyphagous insect Spodoptera exigua. J. Chem. Ecol. 18: 1955-1964. Ahuja MR and Fladung M 1996. Stability and expression of chimeric genes in Populus. In: Ahuja MR, Boerjan W and Neal DB (eds), Somatic cell genetics and molecular genetics of trees. Kluwer, Dordrecht, pp. 159-163. Altabella T and Chrispeels MJ 1990. Tobacco plants transformed with the bean a-ai gene express an inhibitor of insect a-Amylase in their seeds. Plant Physiol. 93: 805-810. Alvarez-Fernandez J, Owen TG, Kurz WGW and De Luca V 1989. Immunological detection and quantitation of tryptophan decarboxylase in developing Catharanthus roseus seedlings. Plant Physiol. 91: 79-84. Argandona VH, Luza JG, Niemeyer HM and Corcuera LJ 1980. Role of hydroxamic acids in the resistance of cereals to aphids. Phytochemistry 19: 1665-1668. Arisi AC, Noctor G, Foyer CH and Jouanin L 1997. Modification of thiol contents in poplar (Populus tremula x P. alba) expressing enzymes involved in glutathione synthesis. Planta203: 362-372. Awmack CS and Leather SR 2002. Host plant quality and fecundity in herbivorous insects. Annu. Rev. Entomol. 47: 817-844. Baucher M, Chabbert B, van Doorsselaere J, Pilate G, Comu D, Petit-Conil M, Monties B, van Montagu M, Inzu D, Jouanin L and Boerjan W 1996. Higher extractability of lignin in poplar (Populus tremula x P. alba) by reducing cinnamyl alcohol  156  dehydrogenase. In: Ahuja MR, Boerjan W and Neal DB (eds), Somatic cell genetics and molecular genetics of trees. Kluwer, Dordrecht, pp. 153-158. Bentley R 1990.The shikimate pathway- A metabolic tree with many branches. Crit. Rev. Biochem. Mol. Biol. 25: 307-384. Berlin J, Rugenhagen C, Dietze P, Frecker LF, Goddijn OJM and Hoge JHC 1993. Increased production of serotonin by suspension and root cultures of Peganum harmala transformed with a tryptophan decarboxylase cDNA clone from Catharanthus roseus. Transgenic Res. 2: 336-344. Berlin J, Rugenhagen C, Kuzovkina IN, Fecker LF and Sasse F 1994. Are tissue cultures of Peganum harmala a useful model system for studying how to manipulate the formation of secondary metabolites? Plant Cell Tiss. Org. Cult. 38: 289-297. Binns AN and Thomashow MF 1988. Cell biology of Agrobacterium infection and transformation of plants. Annu. Rev. Microbiol. 42: 575-606. Birch RG 1997. Plant transformation: problems and strategies for practical applications. Annu. Rev. Plant Physiol. Plant Mol. Biol. 48: 297-326. Bomford MK and Isman MB 1996. Desensitization of fifth instar Spodoptera litura to azadirachtin and neem. Entomologia Experimentalis et Applicata 81: 307-313. Bracher D and Kutchan TM 1992. Strictosidine synthase from Rauvolfia serpentina: analysis of a gene involved in indole alkaloid biosynthesis. Arch. Biochem. Biophys. 294:717-723. Bradford MM 1976. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 54: 484-489. Brasileiro ACM, Toumeur C, Leple J-C, Combes V and Jouanin L 1992. Expression of the mutant Arabidopsis thaliana acetolactase synthase gene confers chlorsulfuron resistance to transgenic poplar plants.' Transgenic Res. 1: 133-141. Brunner AM, Mohamed R, Meilan R, Sheppard LA, Rottman WH and Strauss SH 1998. Genetic engineering of sexual sterility in shade trees. J. Arboric. 24: 263-272. Canel C, Lopes-Cardoso MI, Whitmer S, van der Fits L, Pasquali G, van der Heijder R, Hoge HC and Verpoorte R 1998. Effect of over-expression of strictosidine synthase and tryptophan decarboxylase on alkaloid production by cell cultures of Catharanthus roseus. Planta 205:414-419. Charest PJ, Devantier Y, Jones C, Sellmer JC, McCown BH and Ellis DD 1997. Direct gene transfer in poplar. In: Klopfenstein NB, Chun YW, Kim MS, Ahuja MR (eds),  157  Micropropagation, Genetic Engineering, and Molecular Biology of Populus. USDA Forest Service, General Technical Report RM-GTR-297. pp 173-177. Chavadej S, Brisson N, McNeil IN and DeLuca V 1994. Redirection of tryptophan leads to production of low indole glucosinolate canola. Proc. Natl. Acad. Sci. (USA) 91: 21662170. Cheng J, Saunders JA and Sinden SL 1995. Colorado potato beetle resistant somatic hybrid potato plants produced via protoplast electrofusion. In Vitro Cell. Dev. Biol. 31: 90-95. Chilton S 1997. Genetic engineering of plant secondary metabolism for insect resistance. In: Carozzi N and Koziel M (eds), Advances in insect control: The role of transgenic plants. Taylor and Francis, London, pp: 237-269. Chun YW, Klopfenstein NB, McNabb HS and Hall RB 1988. Transformation Populus species by an Agrobacterium binary vector system. Journal of the Korean Forestry Society 77: 199-207. Chupeau M-C, Paulot V and Chupeau Y 1994. Recovery of transgenic trees after electroporation of poplar protoplasts. Transgenic Res. 3: 13-19. Confalonieri M, Balestrazzi A, Bisoffi S and Cella R 1995. Factors affecting Agrobacterium tumefaciens-msdiaied transformation in several black poplar clones. Plant Cell Tiss. Org. Cult. 43: 215-222. Constabel CP 1999. A survey of herbivore-inducible defensive proteins and phytochemicals. In: Agrawal AA, Tuzun S and Bent E (eds), Induced plant defenses against herbivores and pathogens. APS Press, St. Paul, pp: 137-166. Constabel CP and Ryan CA 1998. A survey of wound- and methyl jasmonate-induced leaf polyphenol oxidase in crop plants. Phytochemistry 47: 507-511. Corcuera LJ 1984. Effects of indole alkaloids from gramineae on aphids. Phytochemistry 23: 539-541. Comu D, Leple J-C, Bonnade-Bottino M, Ross A, Augustin S, Delplangue A, Jouanin L and Pilate G 1996. Expression of a proteinase inhibitor and a Bacillus thuringiensis 5endotoxin in transgenic poplars. In: Ahuja MR, Boerjan W and Neal DB (eds), Somatic cell genetics and molecular genetics of trees. Kluwer, Dordrecht, pp. 131-136. Crosby DG 1971. Minor insecticides of plant origin. In: Jacobson M and Crosby DG (eds), Naturally occurring insecticides. Marcel Dekker, NY pp: 177-239. Csaba G 1993. Presence in and effects of pineal indoleamines at very low level of phylogeny. Experientia 49: 627-634.  158  Czapla TM 1997. Plant lectins as insect control proteins in transgenic plants. In: Carozzi N and Koziel M (eds), Advances in insect control: The role of transgenic plants. Taylor and Francis, London, pp: 123-138. De Block M 1990. Factors influencing the tissue culture and the Agrobacterium tumefaciens mediated transformation of hybrid aspen and poplar clones. Plant Physiol. 93: 1110-1116. DellaPenna D 2001. Plant metabolic engineering. Plant Physiol. 125: 160-163. De Luca V and Cutler AJ 1987. Subcellular localization of enzymes involved in indole alkaloid biosynthesis in Catharanthus roseus. Plant Physiol. 85: 1099-1102. De Luca V, Alvarez-Fernandez F, Campbell D and Kurz WGW 1988. Developmental regulation of enzymes of indole alkaloid biosynthesis in Catharanthus roseus. Plant Physiol. 86: 447-450. De Luca V, Marineau C and Brisson N 1989. Molecular cloning and analysis of cDNA encoding a plant tryptophan decarboxylase: Comparison with animal decarboxylase. Proc. Natl. Acad. Sci. (USA) 86: 2582-2586. Devillard C 1992. Genetic transformation of aspen (Populus tremula x P. alba) by Agrobacterium rhizogenes and regeneration of plants tolerant to herbicide. CR Acad. Sci. (Paris) 314: 291-298. Dickman DI and Stuart KW 1983. The culture of poplars in eastern North America. Michigan State University, E. Lansing, MI. Donahue RA, Davis TD, Michler CH, Riemenschneider DE, Carter DR, Marquardt PE, Sankhla N, Sankhla D, Haissig BL and Isebrands BE 1994. Growth, photosynthesis and herbicide tolerance of genetically modified hybrid poplar. Can. J. For. Res. 24: 23772383. Douglas CJ 1996. Phenylpropanoid metabolism and lignin biosynthesis: from weeds to trees. Trends Plant Sci. 1: 171-178. Ebinuma H, Sugita K, Matsunaga E and Yamakado M 1997. Selection of marker-free transgenic plants using the isopentenyl transferase gene. Proc. Natl. Acad. Sci. (USA) 94: 2117-2121. Eckenwalder JE 1996. Systematics and evolution of Populus. In: Stettler RF, Bradshaw HD Jr, Heilman PE and Hinckley TM (eds), Biology of Populus and its implication for management and conservation. National Research Council Canada, Ottawa, Ont. pp: 732.  159  Eilert U, Constabel F and Kurz WGW 1986. Elicitor-stimulation of monoterpene indole alkaloid formation in suspension cultures of Catharanthus roseus. J. Plant Physiol. 126: 11-22. Eigenbrode SD, Shelton AM and Dickson MH 1990. Two types of resistance to the diamondback moth (Lepidoptera: Plutellidae) in cabbage. Environ. Entomol. 19: 10861090. Ellis BE, Kuroki GW and Stafford HA 1994. Genetic engineering of plant secondary metabolism. Recent advances in phytochemistry Vol. 28. Plenum Press NY. pp: 357. Ellis DD and Raffa KF 1997. Expression of transgenic Bacillus thuringiensis deltaendotoxin in poplar. In: Klopfenstein NB, Chun YW, Kim M-S, Ahuja MR (eds), Micropropagation, Genetic Engineering, and Molecular Biology of Populus. USDA Forest Service, General Technical Report RM-GTR-297. pp 178-186. Ellis D and Gilbert M 1998. Deep rooted strategies for the deployment of transgenic trees. In: Schiemann J (ed), The Biosafety Results of Field Tests of Genetically Modified Plants and Microorganisms - 5 International Symposium, Braunschweig, Germany, 610 September, pp: 26-32. th  Ellis D, Meilan R, Pilate G and Skinner JS 2001. Transgenic trees: Where are we now? In: Strauss SH and Bradshaw HD (eds), Proceedings of the First International Symposium on Ecological and Societal Aspects of Transgenic Plantations, Oregon State University, US. pp: 113-123. Environ. Prot. Agency 1997. Plant pesticides resistance management. Fed. Regist. (USA) 62(36). Eriksson ME, Israelsson M, Olsson O and Moritz T 2000. Increased gibberellin biosynthesis in transgenic trees promotes growth, biomass production and xylem fiber length. Nature Biotechnol. 18: 784-788. Estruch JJ, Carozzi NB, Desai N, Duck NB, Warren GW and Koziel MG 1997. Transgenic plants: An emerging approach to pest control. Nature Biotechnol. 15: 137141. Facchini PJ and De Luca V 1994. Differential and tissue-specific expression of a gene family for tyrosine/ dopa decarboxlase in opium poppy. J. Biol. Chem. 269: 2668426690. Facchini PJ, Yu M and Penzes-Yost C 1999. Decreased cell wall digestibility in canola transformed with chimaeric tyrosine decarboxylase genes from opium poppy. Plant Physiol. 120: 653-663.  160  Facchini PJ 2001. Alkaloid biosynthesis in plants: Biochemistry, cell biology, molecular regulation, and metabolic engineering applications. Annu. Rev. Plant Physiol. Plant Mol. Biol. 52: 29-66. Farnsworth NR 1985. The role of medicinal plants in drug development. In: KroogsgardLarsen P, Brogger CS and Koford H (eds), Natural products and drug development, Munksgaard, Copenhagen, pp: 17-30. Farrar RR, Barbour JD and Kennedy GG 1989. Quantifying food consumption and growth in insects. Annals of the Entomological Society of America 82: 593-598. Felton GW, Donato KK, Broadway RM and Duffey SS 1992. Impact of oxidized plant phenolics on the nutritional quality of dietary protein to a noctuid herbivore, Spodoptera exigua. J. Insect Physiol. 38: 277-285. Fenwick GR, Heaney RK and Mullin WK 1983. Glucosinolates and their breakdown products in food and food plants. CRC Crit. Rev. Food Sci. Nutr. 18: 123-148. Fenwick GR, Heaney RK and Mawson R 1989. Glucosinolates. In: Cheeke PR (ed), Toxicants of plant origin. CRC, Boca Roton. Vol. 2. pp: 1-44. Fernandez JA, Kurz WGW and De Luca V 1989. Conformation-dependent inactivation of tryptophan decarboxylase from Catharanthus roseus. Biochem. Cell Biol. 67: 730734. Feuillet C, Lauvergeat V, Deswarte C, Pilate G, Boudet A and Grima-Pettenati J 1995. Tissue- and cell-specific expression of a cinnamyl alcohol dehydrogenase promoter in transgenic poplar plants. Plant Mol. Biol. 27: 651-667. Fillatti JJ, Sellmer J, McCown B, Haissig B and Comai L 1987. Agrobacterium-mediated transformation and regeneration of Populus. Mol. Gen. Genet. 206:192-199. Fladung M, Kumar S and Ahuja MR 1997. Genetic transformation of Populus genotypes with different chimaeric gene constructs: transformation efficiency and molecular analysis. Transgenic Res. 6: 111-121. Fladung M 1999. Gene stability in transgenic aspen (Populus). I. Flanking DNA sequences and T-DNA structure. Mol. Gen. Genet. 260: 574-581. Forest Research Report 1987. Ontario Tree Improvement and Forest Biomass Institute. Ontario Ministry of Natural Resources, Canada. Foyer CH, Souriau N, Perret S, Lelandais M, Kunert KJ, Pruvost C and Jouanin L 1995. Overexpression of glutathione reductase but not glutathione synthetase leads to increase in antioxidant capacity and resistant to photoinhibition in poplar trees. Plant Physiol. 109: 1047-1057.  161  Franke R, McMichael CM, Meyer K, Shirley AM, Cusumano JC and Chappie C 2000. Modified lignin in tobacco and poplar plants over-expressing the Arabidopsis gene encoding ferulate 5-hydroxylase. Plant J. 22: 223-234. Gatehouse AMR, Davidson GM and Newell CA 1997. Transgenic potato plants with enhanced resistance to the tomato moth Laconobia oleracea: growth room trials. Mol. Breed. 3: 1-15. Geerlings A, Hallard D, Martinez Caballero A, Lopes Cardoso I, van der Heijden R and Verpoorte R 1999. Alkaloid production by a Cinchona officinalis 'Ledgeriana' hairy root culture containing constitutive expression constructs of tryptophan decarboxylase and strictosidine synthase cDNAs from Catharanthus roseus. Plant Cell Rep. 19: 191-196. Gelvin SB 1998. The introduction and expression of transgenes in plants. Curr. Opinion Biotechnol. 9: 227-232. Gill SS, Cowles EA and Pietrantonio PV 1992. The mode of action of Bacillus thuringiensis. Annu. Rev. Entomol. 37:615-636. Goddijn OJM, van der Duyn Schouten PM, Schilperoort RA and Hoge JHC 1993. A chimaeric tryptophan decarboxylase gene as a novel selectable marker in plant cells. Plant Mol. Biol. 22: 907-912. Goddijn OJM, Pennings EJ, van der Helm P, Schilperoort RA, Verpoorte R and Hoge JHC 1995. Overexpression of tryptophan decarboxylase cDNA in Catharanthus roseus crown gall calluses results in increased tryptamine levels but not in increased terpenoid indole alkaloid production. Transgenic Res. 4: 315-323. Gould F 1998. Sustainability of transgenic insecticidal cultivars: integrating pest genetics and ecology. Annu. Rev. Entomol. 43: 701-726. Grandmaison J, Olah GM, van Calsteren MR and Furlan V 1993. Characterization and localization of plant phenolics likely involved in the pathogen resistance expressed by endomycorrhizal roots. Mycorrhiza 3: 155-164. Gray-Mitsumune M, Molitor EK, Cukovic D, Carlson JE and Douglas CJ 1999. Developmentally regulated patterns of expression directed by poplar PAL promoters in transgenic tobacco and poplar. Plant Mol. Biol. 39: 657-669. Grisdale DG 1976. Laboratory methods for rearing the forest tent caterpillar. Can. Forestry Serv. Bi-monthly Res. Notes. 32: 1. Guillet G, Poupart J, Basurco J and De Luca V 2000. Expression of tryptophan decarboxylase and tyrosine decarboxylase genes in tobacco results in altered biochemical and physiological phenotypes. Plant Physiol. 122: 933-943.  162  Hall PJ and Moody B 1994. Forest insect and disease survey information report ST-X-8. Canadian Forest Service, NRC, Ottawa. Han K-H, Gordon MP and Strauss SH 1996. Cellular and molecular biology of Agrobacterium-mediated transformation of plants and its application to genetic transformation of Populus. In: Bradshaw HD Jr, Stettler RF, Heilman PE and Hinckley TM (eds), Biology of Populus and its implication for management and conservation. NRC, Ottawa, Ont., Canada, pp: 201-222. Han K-H, Meilan R, Ma C and Strauss SH 2000. An Agrobacterium tumefaciens transformation protocol effective on a variety of Cottonwood hybrids (genus Populus). Plant Cell Rep. 19: 315-320. Hanover JW 1975. Physiology of trees resistance to insects. Ann. Rev. Entomol. 20: 7595. Harrell MO, Benjamin DM, Berbee JG and Burkot TR 1982. Consumption and utilization of leaf tissue of tissue-cultured Populus x euramericana by the Cottonwood leaf beetle, Chrysomela scripta (Coleoptera: Chrysomelidae). Can. Entomol. 114: 743749. Heerze LD, Kang YJ and Palcic MM 1990. Assays for amino acid decarboxylase enzymes using ion-exchange cartridges. Anal. Biochem. 185: 201-205. Hemming JDC and Lindroth RL 2000. Effects of phenolic glycosides and proteins on gypsy moth (Lepidoptera: Lymantriidae) and forest tent caterpillar (Lepidoptera: Lasiocampidae) performance and detoxication activities. Environ. Entomol. 29(6): 11081115. Henchelin SA, Jouanin L and Klopfenstein NB 1997. Potential of proteinase inhibitors for enhanced resistance to Populus arthropod and pathogen pests. In: Klopfenstein NB, Chun YW, Kim M-S, Ahuja MR (eds), Micropropagation, Genetic Engineering, and Molecular Biology of Populus. USDA Forest Service, General Technical Report RMGTR-297. pp 173-177. Heinrich B 1979. Foraging strategy of caterpillars: leaf damage and possible predator avoidance strategies. Oecologia 42: 325-337. Hilder VA, Gatehouse AMR, Sheerman SE, Barker RF and Boulter D 1987. A novel mechanism of insect resistance engineered in tobacco. Nature 330: 160-163. Hirsh J 1986. The Drosophila melanogaster dopa decarboxylase gene: progress in understanding the in vitro regulation of a higher eukaryotic gene. Molecular Developmental Biology. Alan R. Liss, Inc., New York, pp. 103-114.  163  Holsters M, de Waele D, Depicker A, Messens E, van Montagu M and Schell J 1978. Transfection and transformation of A. tumefaciens. Mol. Gen. Genet. 163: 181-187. Hood EE, Gelvin SB, Melchers S and Hoekema A 1993. New Agrobacterium helper plasmid for gene transfer to plants (EHA105). Transgenic Res. 2: 208-218. Hori K 1980. Metabolism of ingested auxins in the bug Lygus disponsi: Indole compounds appearing in excreta of bugs fed with host plants and the effect of indole-3acetic acid on the feeding. Appl. Ent. Zool. 15: 123-128. Horsch RB, Fraley RT, Rogers SG, Sanders PR, Lloyd A and Hoffmann N 1984. Inheritance of functional foreign genes in plants. Science 223: 496-498. Hu WJ, Harding SA, Lung J, Popko JL, Ralph J, Stokke DD, Tsai CJ and Chiang VL 1999. Repression of lignin biosynthesis promotes cellulose accumulation and growth in transgenic trees. Nature Biotechnol. 17: 808-812. Islas I, Loyola-Vargas VM and Miranda-Ham ML 1994. Tryptophan decarboxylase activity in transformed roots from Catharanthus roseus and its relationship to tryptamine, ajmalcine, and catharanthine accumulation during the culture cycle. In Vitro Cell Dev. Biol. 30P: 81-83. Isman MB, Koul O, Luczynski A and Kaminski J 1990. Insecticidal and antifeedant bioactivities of neem oils and their relationship to azadirachtin content. J. Agric. Food Chem. 38: 1406-1411. Jauhar PP 2001. Genetic engineering and accelerated plant improvement: Opportunities and challenges. Plant Cell Tiss. Org. Cult. 64: 87-91. Johnson R, Narvaez J, An G and Ryan CA 1989. Expression of proteinase inhibitors I and II in transgenic tobacco plants: effects on natural defense against Manduca sexta larva. Proc. Natl. Acad. Sci. (USA) 86: 9871-9875. Jongsma MA and Bolter C 1997. The adaptation of insects to plant protease inhibitors. J Insect Physiol 43: 885-895. Jouanin L, Brasileiro ACM, Leple JC, Pilate G and Cornu D 1993. Genetic transformation: a short review of methods and their applications, results and perspectives for forest trees. Ann. Sci. For. 50: 325-336. Jouanin L, Bottino MB, Girard C, Morrot G and Giband M 1998. Transgenic plants for insect resistance. Plant Sci. 131: 1-11. Joudrier PE, Foard DE, Floener LA and Larkins BA 1987. Isolation and sequence of cDNA encoding the soybean protease inhibitors PI IV and CII. Plant Mol. Biol. 10: 3542.  164  Kajita S, Osakabe K, Katayama Y, Kawai S, Matsumoto Y, Hata K and Morohoshi N 1994. Agrobacterium-mediated transformation of poplar using a disarmed binary vector and the overexpression of a specific member of a family of poplar peroxidase genes in transgenic poplar cell. Plant Sci. 103: 231-239. Kapila J, Rycke RD, Montagu MV and Angenon G 1997. An Agrobacterium-mediated transient gene expression system for intact leaves. Plant Sci. 122: 101-108. Kawalleck P, Keller H, Hahlbrock K, Scheel D and Somssich IE 1993. A pathogen responsive gene of parsley encodes tyrosine decarboxylase. J. Biol. Chem. 268: 21892194. Kearsley MJC and Whitham TG 1989. Developmental changes in resistance to herbivory: implications for individuals and populations. Ecology 70: 422-434. Kim M-S, Klopfenstein NB and Chun YW 1997. Agrobacterium-mediated transformation of Populus species. In: Klopfenstein NB, Chun YW, Kim M-S, Ahuja MR (eds), Micropropagation, genetic engineering, and molecular biology of Populus. USDA Forest Service, Gen. Tech. Rep. RM-GTR-297. pp: 51-59. Kleiner KW, Ellis DD, McCown BH and Raffa KF 1995. Field evaluation of transgenic poplar expressing a Bacillus thuringiensis crylA(a) <5-endotoxin gene against forest tent caterpillar (Lepidoptera: Lasiocampidae) and gypsy moth (Lepidoptera: Lymantriidae) following winter dormancy. Environ. Entomol. 24(5): 1358-1364. Klopfenstein NB, Shi NQ, Keman A, McNabb HS, Hall RB, Hart ER and Thornburg RW 1991. Transgenic populus hybrid express a wound inducible potato proteinase inhibitorCAT gene fusion. Can. J. For. Res. 21: 1321-1328. Klopfenstein NB, McNabb Jr HS, Hart ER,.Hall RB, Hanna RD, Heuchelin SA, Allen KK, Shi NQ and Thomburg RW 1993. Transformation of Populus hybrids to study and improve pest resistance. Silvae Genetica 42: 86-90. Koziel MG, Beland GL and Bowman C 1993. Field performance of elite transgenic maize plants expressing an insecticidal protein derived from Bacillus thuringiensis. Bio/Technology 11: 194-200. Laemmli UK 1970. Cleavage of structural proteins during the assembly of the head of the bacteriophage T4. Nature 277: 680-685. Leech MJ, May K, Hallard D, Verpoorte R, De Luca V and Christou P 1998. Expression of two consecutive genes of a secondary metabolic pathway in transgenic tobacco: molecular diversity influences levels of expression and product accumulation. Plant Mol. Biol. 38: 765-774.  165  Leple JC, Brasileiro A, Michel M, Delmotte F and Jouanin L 1992. Transgenic poplars: expression of chimeric genes using different constructs. Plant Cell Rep. 11: 137-141. Leple JC, Bonade-Bottino M, Augustin S, Pilate G, Letan VD, Delplanque A, Comu D and Jouanin L 1995. Toxicity of Chrysomela tremulae (Coleoptera: Chrysomelidae) of transgenic poplars expressing a cysteine proteinase inhibitor. Mol. Breed. 1: 319-328. Leple JC, Pilate G and Jouanin L 1999. Transgenic Poplar trees (Populus species). In: Bajaj YPS (ed), Biotechnology in Agriculture and Forestry, Vol. 44 Transgenic Trees. Springer-Verlag Berlin Heidelberg, pp: 221-244. Li B and Wyckoff GW 1993. Hybrid poplar performance and genetic gains. North. J. Appl. For. 10: 117-122. Liang H, Maynard CA, Allen RD and Powell WA 2001. Increased Septoria musiva resistance in transgenic hybrid poplar leaves expressing a wheat oxalate oxidase gene. Plant Mol. Biol. 45: 619-629. Liu YB, Tabashnik BE, Dennehy TJ, Patin AL and Bartlett AC 1999. Developmental time and resistance to BT crops. Nature 400: 519. Lopez-Meyer M and Nessler CL 1997. Tryptophan decarboxylase is encoded by two autonomously regulated genes in Camptotheca acuminata which are differentially expressed during development and stress. Plant J. 11: 1167-1175. Maldonado-Mendoza IE, Lopez-Meyer M, Galef JR, Burnett RJ and Nessler CL 1996. Molecular analysis of a new member of a opium poppy tyrosine/3,4dihydroxyphenylalanine decarboxylase gene family. Plant Physiol. 110: 43-49. Malik VS and Saroha MK 1999. Marker gene controversy in transgenic plants. J. Plant Biochem. Biotechnol. 8: 1-13. Marques IA and Brodelius PE 1988. Elicitor-induced L-tyrosine decarboxylase from plant cell suspension cultures: I. Induction and purification. Plant Physiol. 88: 47-51. Mathis NL and Hinchee MAW 1994. Agrobacterium inoculation techniques for plant tissues. In: Gelvin SB, Schilperoort RA (eds), Plant Molecular Biology Manual. Kluwer Academic Publ. Boston, pp: 1-9. Mazier M, Pannetier C, Tourneur J, Jouanin L and Giband M 1997. The expression of Bacillus thuringiensis toxin genes in plant cells. Biotechnol. Annu. Rev. 3: 313-347. McCown BH, McCabe DE, Russell DR, Robison DJ, Barton KA and Raffa KF 1991. Stable transformation of Populus and incorporation of pest resistance by electric discharge particle acceleration. Plant Cell Rep. 9: 590-594.  166  McGaughey WH and Whalon ME 1992. Managing insect resistance to Bacillus thuringiensis toxin. Science 258: 1451-1455. McKenna DJ, Towers GHN and Abbott F 1984. Monoamine oxidase inhibitors in South American hallucinogenic plants: tryptamine and beta-carboline constituents of Ayahuasca. J. Ethnopharmacol. 10: 195-223. Meijer AH, Verpoorte R and Hoge JHC 1993. Regulation of enzymes and genes involved in terpenoid indole alkaloid biosynthesis in Catharanthus roseus. J. Plant Res. (Special issue) 3: 145-164. Meilan R, Ma C, Cheng S, Eaton JA, Miller LK, Crockett RP, DiFazio SP and Strauss SH 2000. High levels of Roundup™ and leaf-beetle resistance in genetically engineered hybrid cottonwoods. In: Blatner KA, Johnson JD and Baumgartner DM (eds), Hybrid poplars in the Pacific Northwest: Culture, Commerce and Capability. Washington State University Cooperative Extension Bulletin MISC0272, Pullman, WA, pp. 29-38. Metcalf RL 1980. Changing role of insecticides in crop production. Ann. Rev. Entomol. 25: 219-256. Michel MF, Brasileiro ACM, Depicrreux C, Otten I, Delmotte F and Jouanin L 1990. Identification of different Agrobacterium strains isolated from the same forest nursery. App. Env. Microbiol 56: 3537-3545. Mijnsbrugge KW, van Montagu M, Inze D and Boerjan W 1996. Tissue specific expression conferred by the S-adenosyl-L-methionine synthetase promoter of Arabidopsis thaliana in transgenic poplars. Plant Cell Physiol. 37: 1108-1115. Miles DH, Ly AM, Randle SA, Hedin PA and Burks ML 1987. Alkaloidal insect antifeedants from Virola calophylla Warb. J. Agric. Food Chem. 35: 794-797. Mohri T, Yamamoto N and Shinohara K 1996. Agrobacterium-mediated transformation of Lombardy poplar (Populus nigra L. var. italica Koehne) using stem fragments. J. For. Res. 1: 13-16. Murashige T and Skoog F 1962. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Plant Physiol. 15: 473-497. Nagrel J and javelle F 1995. Induction of phenylpropanoid and tyramine metabolism in pectinase- and pronase-elicited cell suspension cultures of tobacco (Nicotiana tabacum). Plant Physiol. 95: 569-574. Nilsson O, Moritz T, Sundberg B, Sandberg G and Olsson O 1996. Expression of the Agrobacterium rhizogenes rolC gene in deciduous forest tree alter growth and development and leads to stem fasciation. Plant Physiol. 112: 493-502.  167  Noe W, Mollenschott C and Berlin J 1984. Tryptophan decarboxylase Catharanthus roseus cell suspension cultures purification, molecular and kinetic data of the homogeneous proteins. Plant Mol. Biol. 3: 281-288. Noe W and Berlin J 1985. Induction of de novo synthesis of tryptophan decarboxylase in cell suspension of Catharanthus roseus. Planta 166: 500-504. Ostry ME, Wilson LF, McNabb HS and Moore LM 1989. A guide to insect, disease and animal pests of poplars. USDA Agricultural Handbook 677. Ostry ME and McNabb HS 1990. Minimizing disease injury to hybrid poplars. J. Environ. Hort. 8(2): 96-98. Palo RT 1984. Distribution of birch (Betula spp.), willow (Salix spp.), and poplar (Populus spp.) secondary metabolites and their potential role as chemical defense against herbivores. J. Chem. Ecol. 10: 499-520. Pasquali G, Goddijn OJM, De Waal A, Verpoorte R, Schilperoort RA, Hoge JHC and Memelink J 1992. Coordinated regulation of two indole alkaloid biosynthetic genes from Catharanthus roseus. Plant Mol. Biol. 18: 1121-1131. Paszkowski J, Shillito RD, Saul M, Mandak V, Hohn T, Hohn B and Potrykus I 1984. Direct gene transfer to plants. EMBO J. 3: 2717-2722. Pauley SS and Perry TO 1954. Ecotypic variation of the photoperiodic response in Populus. J. Arnold Arbor. Harv. Univ. 35: 167-188. Perlak FJ, Deaton RW, Armstrong TA, Fuchs RL, Sims SR, Greenblate JT and Fischoff DA 1990. Insect resistant cotton. Bio/Technology 8: 939-943. Peferoen M 1997. Progress and prospects for field use of B. thuringiensis genes in crops. Trends Biotechnol. 15: 173-177. Pena L and Seguin A 2001. Recent advances in the genetic transformation of trees. Trends Biotechnol. 19: 500-506. Perlak FJ, Fuchs RL, Dean DA, McPherson SL and Fischhoff DA 1991. Modification of the coding sequence enhances plant expression of insect control protein genes. Proc. Natl. Acad. Sci. USA 88: 3324-3328. Pinon J and Frey P 1997. Structure of Melampsora larici-populina populations on wild and cultivated poplar. Eur. J. Plant Pathol. 103:159-173. Poulsen C, Goddijn OJM, Hoge JHC and Verpoorte R 1994. Anthranilate synthase and chorismate mutase activities in transgenic tobacco plants overexpressing tryptophan decarboxylase from Catharanthus roseus. Transgenic Res. 3: 43-49.  168  Portillo HE and Pitre HN 1992. Effect of four soybean genotypes on the development and fecundity of Heliothis virescens and Pseudoplusia includens (Lepidoptera: Noctuidae),  Fla. Entomol. 75: 386-390. Purcell IP, Greenplate JT and Jennings MG 1993. Cholesterol oxidase: a potent insecticidal protein active against boll weevil larvae. Biochem. Biophys. Res. Commun. 196: 1406-1413. Raffa KF, Kleiner KW, Ellis DD and McCown BH 1997. Environmental risk assessment and deployment strategies for genetically engineered insect-resistant Populus. In: Klopfenstein NB, Chun YW, Kim M-S, Ahuja MR (eds), Micropropagation, Genetic Engineering, and Molecular Biology of Populus. USDA Forest Service, General Technical Report RM-GTR-297. pp 249-263. Ramachandran R, Raffa KF, Bradley D, Miller M, Ellis DD and McCown BH 1993. Activity of an insecticidal protein from Bacillus thuringiensis subsp. thuringiensis HD290-1 strain to Coleopteran and Lepidopteran defoliators of poplars. Environ. Entomol. 22(1): 190-196. Ranney JW, Wright LL and Layton PA 1987. Hardwood energy crops: the technology of intensive culture. J. For. 85: 17-28. Ro DK, Mah N, Ellis BE and Douglas CJ 2001. Functional characterization and subcellular localization of poplar (Populus trichocarpa x Populus deltoides) cinnamate 4hydroxylase. Plant Physiol. 126: 317-329. Robinson DJ and Raffa KF 1990. Hybrid poplar productivity and suitability for the forest tent caterpillar: a framework for evaluation. In: Adams RD (ed), Aspen Symposium '89. Proceedings of Symposium. USDA Forest Service. General Technical Report. NC-140. pp:155-162. Robinson DJ and Raffa KF 1994. Characterization of hybrid poplar clones for resistance to the forest tent caterpillar. For. Sci. 40: 686-714. Robinson DJ, McCown BH and Raffa KF 1994. Responses of gypsy moth (Lepidoptera: Lymantridae) and forest tent caterpillar (Lepidoptera: Lasiocampidae) to transgenic poplar, Populus spp., containing a Bacillus thuringiensis 5-endotoxin gene. Environ. Entomol. 23: 1030-1041. Rogowsky PM, Close TJ, Chimera JA, Shaw JJ and Kado CI. 1987. Regulation of the vir genes of Agrobacterium tumefaciens plasmid pTiCS8. J. Bacteriol. 169: 5101-5112. RSC (The Royal Society of Canada) report on the future of food biotechnology 2001. Elements of precaution: recommendations for the regulation of food biotechnology in Canada, pp: 242.  169  Sangwan RS, Bourgeois Y, Brown S, Vasseur G and Sangwan NB 1992. Characterization of competent cells and early events of Agrobacterium-mediated genetic transformation in Arabidopsis thaliana. Planta 188: 439-456. Sangwan RS, Mishra S and Kumar S 1998. Direct fluorometry of phase-extracted tryptamine-based fast quantitative assay of L-tryptophan decarboxylase from Catharanthus roseus leaf. Anal. Biochem. 255: 39-46. Salas MG, Park SH, Srivatanakul M and Smith RH 2001. Temperature influence on stable T-DNA integration in plant cells. Plant Cell Rep. 20: 701-705. Sambrook J, Fritsch EF and Maniatis T 1989. Molecular cloning. A laboratory manual. Second Edition. Cold Spring Harbor Laboratory Press, New York. Schneider EA, Gibson RA and Wightman F 1972. Biosynthesis and metabolism of Indole-3yl-acetic acid. J. Exp. Bot. 23: 152-170. Schneider EA and Wightman F 1974. Amino acid metabolism in plants. V. Changes in basic indole compounds and the development of tryptophan decarboxylase activity in barley during germination and seedling growth. Annu. Rev. Plant Physiol. 25: 487-513. Schmeller T, Latz-Bruning B and Wink M 1997. Biochemical activities of berberine, palmitine and sanguinarine mediating chemical defense against microorganisms and herbivores. Phytochemistry 44: 257-266. Schmelzer E, Kruger-Lebus S and Hahlbrock K 1989. Temporal and spatial patterns of gene expression around sites of attempted fungal infection in parsley leaves. Plant Cell 1: 993-1001. Schoonhoven LM 1982. Biological aspects of antifeedants. Entomol. Exp. Appl. 31: 5769. Schoonhoven LM, Jenny T and van Loon JA 1998. Insect-plant biology. London: Chapman & Hall, pp: 409. Schuler TH, Poppy GM, Kerry BR and Denholm 1998. I: Insect resistant transgenic plants. Trends in Biotechnol. 16: 168-174. Shade RE, Schroeder HE, Pueyo JJ, Tabe LM, Murdock LL, Higgins TJV and Chrispeels MJ 1994. Transgenic pea seeds expressing the cc-amylase inhibitor of the common bean are resistant to bruchid beetles. Bio/Technology 12: 793-796. Slansky F 1993. Nutritional ecology: The fundamental quest for nutrients. In: Stamp NE and Casey TM (eds), Caterpillars, ecological and evolutionary constraints on foraging. Chapman and Hall, NY. pp: 29-91.  170  Smigocki A, Neal JW, McCanna I and Douglas L 1993. Cytokinin-mediated insect resistance in Nicotiana plants transformed with the ipt gene. Plant Mol. Biol. 23: 325335. Sogawa K 1971. Preliminary assay of antifeeding chemicals for the brown planthopper, Nilaparvata lugens (Stal.) (Hemiptera: Delphacidae). Applied Entomology and Zoology 6: 215-218. Sokal RR and Unnasch RS 1988. Geographic covariation of hosts and parasites: evidence from Populus and. Pemphigus. Z. Zool. Syst. Evolutionsforsch. 26: 73-88. Soloman JD 1985. Impact of insects on growth and development of young cottonwood plantations. USDA Forest Service. Southern Forest Expt. station Res. Paper SO-217. Songstad DD, De Luca V, Brisson N, Kurz WGW and Nessler CL 1990. High levels of tryptamine accumulation in transgenic tobacco expressing tryptophan decarboxylase. Plant Physiol. 94: 1410-1413. Songstad DD, Kurz WGW and Nessler CL 1991. Tyramine accumulation in Nicotiana tabacum transformed with a chimeric tryptophan decarboxylase gene. Phytochemistry 30: 3245-3246. Stachel SE, Nester EW and Zambryski PC 1986. A plant cell factor induces Agrobacterium tumefaciens vir gene expression. Proc. Natl. Acad. Sci. USA 83: 379-383. Stettler RF, Bradshaw HD Jr, Heilman PE and Hinckley TM (eds) 1996. Biology of Populus and its implication for management and conservation. National Research Council Canada, Ottawa, Ont. pp: 539. Stettler RF, Zsuffa L and Wu R 1996. The role of hybridization in the genetic manipulation of Populus. In: Stettler RF, Bradshaw HD Jr, Heilman PE and Hinckley TM (eds), Biology of Populus and its implication for management and conservation. National Research Council Canada, Ottawa, Ont. pp: 87-112. Stettler RF and Bradshaw HD Jr 1996. Evolution, Genetics, and Genetic manipulation. Overview. In: Stettler RF, Bradshaw HD Jr, Heilman PE and Hinckley TM (eds), Biology of Populus and its implication for management and conservation. National Research Council Canada, Ottawa, Ont. pp: 1-6. Strauss SH, Meilan R, DiFazio S, Mohamed R, Brunner A, Leonardi S, Skinner J and Krutovskii K 1998. Tree genetic engineering research cooperative (TGERC) Annual report: 1997-1998. Forest Research Laboratory, Oregon State University, Corvallis.  171  Strauss SH 1999. Report of the poplar working group. In: Traynor PL and Westwood JH (eds), Proceedings of a workshop on 'Ecological Effects of Pest Resistance Genes in Managed Ecosystems. Bethesda, Maryland, pp 105-112. Tabashnik BE 1994. Evolution of resistance to Bacillus thuringiensis. Annu. Rev. Entomol. 39: 47-79. Tabashnik BE, Liu YB, Finson N, Masson L and Heckel DG 1997. One gene in diamondback moth confers resistance to four Bacillus thuringiensis toxins. Proc. Natl. Acad. Sci. USA 94: 1640-1644. Tang JD, Gilboa S, Roush RT and Shelton AM 1997. Inheritance, stability, and lack of fitness costs of field-selected resistance to Bacillus thuringiensis in Diamondback moth (Lepidoptera: Plutellidae) from Florida. J. Econ. Entomol. 90: 732-741. Thielges BA and Adams JC 1975. Genetic variation and heritability of Melampsora leaf rust in eastern cottonwood. For. Sci. 21: 278-282. Thomas JC, Adams DG, Keppenne VD, Wasmann CC, Brown JK, Kanost MR and Bohnert HJ 1995a. Manduca sexta encoded proteinase inhibitors expressed in Nicotiana tabacum provide protection against insects. Plant Physiol. Biochem. 33: 611-614. Thomas JC, Adams DG, Nessler CL, Brown JK and Bohnert HJ 1995b. Tryptophan decarboxylase, tryptamine and reproduction of the whitefly (Bemisia tabaci). Plant Physiol. 109: 717-720. Thomas JC 1997. Anti-insect strategies in the engineered cotton crop. In: Bajaj YPS (ed), Biotechnology in Agriculture and Forestry. Vol. 42, Springer-Verlag, Berlin, pp. 271290. Thomas JC, Saleh EF, Alammar N and Akroush AM 1998. The indole alkaloid tryptamine impairs reproduction in Drosophila melanogaster. J. Econ. Entomol. 91: 841846. Thomas JC, Akroush AM and Adamus G 1999. The indole alkaloid tryptamine produced in transgenic Petunia hybrida. Plant Physiol. Biochem. 37: 665-670. Topfer R, Matzeit V, Gronenbom B, Schell J and Hans-Henning S 1987. A set of plant expression vectors for transcriptional and translational fusions. Nucleic Acids Res. Vol. 15(4): 5890. Trezzini GF, Horrichs A and Sommssich IE 1993. Isolation of putative defense-related genes from Arabidopsis thaliana and expression in fungal elicitor-treated cells. Plant Mol. Biol. 21: 385-389.  172  Tsai C-J, Podila GK and Chiang VL 1994. Agrobacterium-mediated transformation of quaking aspen (Populus tremuloides) and regeneration of transgenic plants. Plant Cell Rep. 14: 94-97. Tuominen H, Sitbon F, Jacobsson C, Sandberg G, Olsson O and Sundberg B 1995. Altered growth and wood characteristics in transgenic hybrid aspen expressing Agrobacterium tumefaciens T-DNA indole acetic acid biosynthetic genes. Plant Physiol. 109:1179-1189. Tzfira T, Jenesen CS, Vainstein A and Altman A 1997. Transformation and regeneration of transgenic aspen plants via shoot formation from stem explants. Plant Physiol. 99: 554-561. van Doorsselaere J, Baucher M, Chognot F, Chabbert B, Tollier MT, Petitconil M, Leple JC, Pilate G, Comu D, Monties B, van Montagu M, Inzu D, Boerjan W and Jouanin L 1995. A novel lignin in poplar trees with a reduced caffeic acid/ 5-hydroxyferulic acid Omethyltransferase activity. Plant J. 8: 855-864. van Schwartzenberg K, Doumas P, Jouanin L and Pilate G 1994. Enhancement of endogenous cytokinin concentration in poplar by transformation with Agrobacterium TDNA gene ipt. Tree Physiol. 14: 27-35. Vaucheret H, Christophe B, Elmayan T, Feuerbach F, Godon C, Morel JB, Mourrain P, Palauqui JC and Vernhettes S 1998. Transgene-induced gene silencing in plants. Plant J. 16:651-659. Vehovszky A and Walker RJ 1991. An analysis of the 5-hydroxytryptamine (serotonin) receptor subtypes of central neurons of Helix aspersa. Comp. Biochem. Physiol. C. 100: 463-476. Voelckel C, Krugel T, Gase K, Heidrich N, van Dam NM, Winz R and Baldwin IT 2001. Anti-sense expression of putrescine N-methyltransferase confirms defensive role of nicotine in Nicotiana sylvestris against Manduca sexta. Chemoecology 11: 121-126. Waller GR and Dermer OC 1981. Enzymology of alkaloid metabolism in plants and microorganism. In: Conn EE (ed), The Biochemistry of plants. Vol. VII. Academic Press New York. pp. 351-358. Wang G, Castiglion S, Chen Y, Li L, Han Y, Tian Y, Gabriel DW, Mang K and Sala F 1996. Poplar (Populus nigra L.) plants transformed with a Bacillus thuringiensis toxin gene: insecticidal activity and genomic analysis. Transgenic Res. 5: 289-301. Weigel D and Nilsson O 1995. A developmental switch sufficient for flower initiation in diverse plants. Nature 377: 495-500. Westerhoff HV 1995. Subtlety in control-metabiolic pathway. Trends Biotechnol 13: 242-244.  173  Whitham TG, Floate KD, Martinsen GD, Driebe EM and Keim P 1996. Ecological and evolutionary implications of hybridization: Populus-herbivore interactions. In: Stettler RE, Bradshaw HD Jr, Heilrnan PE and Hinckley TM (eds), Biology of Populus and its implication for management and conservation. National Research Council Canada, Ottawa, Ont. pp: 247-275. Wood CS 1992. Forest tent caterpillar. Forestry Canada, Forest Insect and Disease Survey. Forest Pest Leaflet No. 17 pp: 4. Xie YS and Isman MB 1992. Antifeedant and growth inhibitory effects of tall oil and derivatives against the variegated cutworm, Peridroma saucia Hubner (Lepidoptera: Noctuidae). Can. Entomol. 124: 861-869. Xie YS, Isman MB, Gunning P, Mackinnon S, Arnason JT, Taylor DR, Sanchez P, Hasbun C and Towers GHN 1994. Biological activity of extracts of Trichilia species and the limonoid hirtin against lepidopteran larvae. Biochem. Syst. Ecol. 22 (2): 129-136. Yao K, De Luca V and Brisson N 1995. Creation of metabiolic sink for tryptophan alters the phenylpropanoid pathway and the susceptibility of potato to Phytophthora infectans. Plant Cell 7: 1787-1799. Yingchuan T, Taiyuan L, Keqiang M, Yifan H, Ling L, Xuepin W, Mengzhu L, Lianyun D, Yinong H, Jingjun Y and Gabriel D 1993. Insect tolerance of transgenic Populus nigra plants transformed with Bacillus thuringiensis toxin gene. Chinese Journal of Biotechnology 9: 219-227. Zhao Y, Christensen SK, Fankhauser C, Cashman JR, Cohen JD, Weigel D and Chory J 2001. A role of Flavin Monooxygenase-like enzymes in auxin biosynthesis. Science 291: 306-309. Zhong R, Morrison III WH, Himmelsbach DS, Poole II FL and Ye ZH 2000. Essential role of caffeoyl coenzyme A N-methyltransferase in lignin biosynthesis in woody poplar plants. Plant Physiol. 124: 563-577. Zhou C, Yang Y and Jong AY 1990. Mini-prep in ten minutes. Bio/Techniques 8: 172173. Zucker WV 1982. How aphids choose leaves: the role of phenolics in host selection by a galling aphid. Ecology. 63: 972-981.  174  Appendix A  Culture media for micropropagation of hybrid poplar clone 717  MS salts* MES buffer Myo-inositol L-Glutamine _  CIM 4.3 0.250 0.100 0.200 10.0 ml 30.0 2.0 3.0  SIMj 4.3 0.250 0.100 0.200 10.0 ml 30.0 2.0 •3.0  SEM, 4.3 0.250 0.100 0.200 10.0 ml 30.0 1.1 3.0  RIM, 2.15 0.250 0.100 0.200 10.0 ml 20.0  Vitamin mix Sucrose Phytagel Phyta agar 7.0 Agar BA(1.0mg/ml) 100 pi 5.0 ml 2ip (1 mM) TDZ (0.5 mM) 400 pi 1.0 ml IBA (0.5 mM) NAA (10 mM) 1.0 ml 5.8 5.8 5.8 5.8 pH (w/ IN NaOH) 0.025 0.100 0.100 Kanamycin 0.500 0.250 0.500 Cefotaxime le table are in grams unless otherwise indicated All values given in t  PM, 2.15 0.250 0.100 0.200 10.0 ml 20.0 4.0  5.8  PM: Propagation medium; CIM: Callus induction medium; SIM: Shoot induction medium; SEM: Shoot elongation medium; RIM: Root induction medium MS salts*: Murashige & Skoog salt mixture (Gibco BRL) TDZ: Thidiazuron (l-phenyl-3-(l,2,3-thiadiazol-5-YL)-urea 2ip: 6-(y,Y-dimethylallyl-amino) purine; BA: 6-benzylamino purine NAA: a-naphthalene acetic acid; IBA: Indole-3-butyric acid Vitamin mix : Vitamin stock (100X) 500 ml stock solution Chemicals 50 mg Nicotinic acid 50 mg Pyridoxine HC1 Calcium pantothenate 50 mg 50 mg Thiamin HC1 5 ml Biotin* 50 mg L-cysteine HC1 Biotin*: Dissolve 5 mg in 50 ml water Filter sterilized the vitamin stock solution, aliquot in 15 ml falcon tubes and freeze #  175  Culture media for micropropagation of hybrid poplar clone P39 SIM 2.3 1.0 ml 0.200 20.0 3.0 1.1 100 pi 1.0 ml 200 pi 5.6 2  WPM salts* Vitamin mix" Glycine Sucrose Agar Phytagel NAA (1.0 mM) BA (0.1 mM) TDZ (0.5 mM) pH (w/ IN KOH) Kanamycin Carbenicillin Cefotaxime  SEM 2.3 1.0 ml 0.200 20.0 3.0 1.1 2  -  RIM  2  2.3 1.0 ml 0.200 20.0 3.0 1.1 10 pi  PM 2.3 1.0 ml 0.200 20.0 3.0 1.1 2  -  100 pi  -  -  5.6 0.050 0.200 0.200  5.6 0.050 0.200 0.200  5.6  100 pi  -  All values given in table are in grams unless otherwise indicated WPM salts*: Lloyd and McCown Woody Plant Medium basal salt mixture (Phytotechnology laboratories, Mission, KS) SIM: Shoot induction medium; SEM: Shoot elongation medium RIM: Root induction medium; PM: Propagation medium NAA: a-naphthalene acetic acid; BA: 6-benzylamino purine TDZ: Thidiazuron (l-phenyl-3-(l,2,3-thiadiazol-5-YL)-urea Vitamin mix*: MS vitamins (1000X) For 1 L of stock Chemical 100.0 g myo-Inositol 100.0 mg Thiamine-HCl 500.0 mg Nicotinic acid 500.0 mg Pyridoxine-HCl Aliquot into 1.0 ml centrifuge tubes and stored at -20°C  176  Culture media for micropropagation of tobacco SIM  3  SIM3CCK  RIM3CCK  4.3 1.0 ml Vitamin mix 0.200 Glycine 30.0 Sucrose 3.0 Agar 1.1 Phytagel N A A (1 mg/ml) 100 pi 2.0 ml BA (1 mg/ml) 5.6 pH (w/ IN KOH) 0.100 Kanamycin 0.500 Carbenicillin 0.250 Cefotaxime All values given in t te table are in grams unless otherwise MS salts*  #  4.3 1.0 ml 0.200 30.0 3.0 1.1 100 pi 2.0 ml 5.6  PM3  4.3 1.0 ml 0.200 20.0 3.0 1.1  4.3 1.0 ml 0.200 20.0 3.0 1.1  -  -  5.6 0.100 0.500 0.250 indicated.  5.6 -  MS salts*: Murashige & Skoog salt mixture (Gibco BRL) NAA: oc-naphthalene acetic acid; BA: 6-benzylamino purine Vitamin mix": MS vitamins (1000X) Chemical  For 1 L of stock  100.0 g myo-Inositol 100.0 mg Thiamine-HCl 500.0 mg Nicotinic acid 500.0 mg Pyridoxine-HCl Aliquot into 1.0 ml centrifuge tubes and store at -20°C  177  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0090693/manifest

Comment

Related Items