UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Tuberculate ectomycorrhizae on Lodgepole Pine (Pinus contorts) and associated nitrogen fixation Paul, Leslie Robin 2002

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2002-750655.pdf [ 32.87MB ]
Metadata
JSON: 831-1.0090671.json
JSON-LD: 831-1.0090671-ld.json
RDF/XML (Pretty): 831-1.0090671-rdf.xml
RDF/JSON: 831-1.0090671-rdf.json
Turtle: 831-1.0090671-turtle.txt
N-Triples: 831-1.0090671-rdf-ntriples.txt
Original Record: 831-1.0090671-source.json
Full Text
831-1.0090671-fulltext.txt
Citation
831-1.0090671.ris

Full Text

T U B E R C U L A T E E C T O M Y C O R R H I Z A E O N L O D G E P O L E P I N E (PINUS CONTORTA) A N D A S S O C I A T E D N I T R O G E N F I X A T I O N by L E S L I E R O B I N P A U L B . S c , Simon Fraser University, 1993 A THESIS S U B M I T T E D IN P A R T I A L F U L F I L M E N T OF T H E R E Q U I R E M E N T S F O R T H E D E G R E E OF D O C T O R OF P H I L O S O P H Y in T H E F A C U L T Y OF G R A D U A T E S T U D I E S (Faculty of Agricultural Sciences, Department of Soil Science) We accept this thesis as conforming to the required standard. T H E U N I V E R S I T Y OF B R I T I S H C O L U M B I A July 2002 © Leslie Robin Paul, 2002 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of The University of British Columbia Vancouver, Canada D a ,a (OrAr I. I JOO. • DE-6 (2/88) ABSTRACT Nitrogenase activity associated with tuberculate ectomycorrhiza (TEM) on Pinus contorta in the central interior of British Columbia was investigated. In situ measurements of nitrogenase activity were conducted using a modification of the acetylene reduction assay (ARA). Nitrogenase activity, as measured by ethylene (C2H4) production from T E M revealed that average amounts of C2H4 produced per gram of Suillus tomentosus T E M for a twenty-four hour period ranged from 0.00 nmoles to 5696.77 nmoles from all sites over a two year period. The maximum amount of C2H4 produced per gram of S. tomentosus T E M for a twenty-four hour period was 25098.91 nmoles. Average nmoles CJOUg1 T E M 24h_1 differed significantly between class 2 stands (young, < 40 years old) and class 8 stands (old, >140 years old)(p=0.004). Estimated nitrogen contribution from S. tomentosus T E M could be significant to the nitrogen budget of P. contorta stands within the SBPSxc biogeoclimatic subzone of British Columbia. Using D N A sequence analysis and morphological analysis, the fungal symbiont of T E M on P. contorta was identified as the species S. tomentosus. There were two species of N2-fixing bacteria isolated from interstitial tissue of S. tomentosus T E M . Use of gas chromatographic fatty acid methyl ester analysis and 16S rDNA analysis revealed that the two species were Paenibacillus amyloyticus and Methylobacterium mesophillicum. Both species tested positive for nitrogenase activity in vitro and both species contained a nifH amplicon. S. tomentosus T E M contain a haemoprotein with a similar isoelectric point as haemoglobin that may acting in a similar physiological manner as leghaemoglobin in root nodules. This is the first report of a haemoglobin associated with a fungus. Complete formation of S. tomentosus T E M appears to be influenced by some factor from the N 2-fixing bacteria found within the interstitial tissue. S. tomentosus T E M symbiosis is a tripartite relationship which involves the N2-fixing bacteria, mycorrhizal fungus and host tree. This tripartite relationship appears to be functionally and morphologically similar to root nodules on legume and non-legume plants. Nitrogen fixation associated with S. tomentosus T E M is possibly a significant input to the nitrogen budgets of P. contorta. ii TABLE OF CONTENTS A B S T R A C T . i i T A B L E OF CONTENTS i i i LIST OF TABLES vii LIST OF FIGURES ix N O M E N A C L A T U R E A N D A C R O N Y M S xiv A C K N O W L E D G E M E N T S xv Chapter 1 Thesis Introduction 1.1 INTRODCTION 1 1.2 OBJECTIVES 6 1.3 STUDY A R E A 8 1.4 REFERENCES 13 Chapter 2 Characterisation and Identification of Tuberculate Ectomycorrhiza (TEM) on Lodgepole pine {Pinus Contorta) 2.1 INTRODUCTION 21 2.2 M A T E R I A L A N D METHODS 23 2.2.1 Study Sites and Sample Collection 23 2.2.2 Morphological Analysis: T E M Characterisation 25 2.2.3 Molecular Analysis: Sample Preparation for D N A Extraction 25 2.2.4 D N A Extraction 25 2.2.5 PCR Amplification and Gel Electrophoresis 26 2.2.6 D N A Sequencing 27 2.3 RESULTS 28 2.3.1 Gross Morphology of Tubercles and Rhizomorphs 28 2.3.2 Microscopic Morphology of Tubercles and Rhizomorphs 32 2.3.3 PCR Amplification and D N A Sequencing 38 2.4 DISCUSSION 39 2.5 REFERENCES 46 Chapter 3 Suillus tomentosus Tuberculate Ectomycorrhizal Abundance and Distribution in Pinus contorta Woody Debris 3.1 INTRODUCTION 50 3.2 M A T E R I A L S A N D METHODS 52 3.2.1 Study Sites 52 iii 3.2.2 Coarse Woody Debris Survey 53 3.2.3 Tubercle Biomass and Abundance 54 3.2.4 Soil Analysis 58 3.2.5 Statistical Analysis 59 3.3 RESULTS 60 3.3.1 Coarse Wood Debris Survey 60 3.3.2 Abundance and Biomass of Tubercles 60 3.3.3 Tubercle Distribution in CWD and Correlation to CWD Attributes 63 3.3.4 Soil Analysis 64 3.4 DISCUSSION 65 3.5 REFERENCES 69 Chapter 4 Identification of Nitrogen Fixing Bacteria within Suillus tomentosus Tuberculate Ectomycorrhiza 4.1 INTRODUCTION 77 4.2 M A T E R I A L A N D METHODS 82 4.2.1 Study Sites 82 4.2.2 Tubercle Collection 82 4.2.3 Tubercle Dissection and Tissue Extraction 83 4.2.4 Bacteria Extraction and Isolation from Tubercles 84 4.2.5 Bacteria Isolation from the Surface of Tubercles 84 4.2.6 Initial Bacteria Identification 85 4.2.6.1 BIOLOG Analysis 85 4.2.6.2 Gas Chromatograph Fatty Acid Methyl Ester (GC FAME) Analysis 85 4.2.7 PCR Amplification and Sequencing 87 4.2.7.1 Cell Preparation 87 4.2.7.2 16s PCR Amplification 87 4.2.7.3 16s rDNA Sequencing 88 4.2.7.4 NifH Gene PCR Amplification 89 4.2.7.5 NifH Gene Sequencing 90 4.2.8 Nitrogenase Activity Analysis ; 90 4.2.9 Fluorescent Microscopy of Bacteria within Suillus tomentosus Tubercles . . . 91 4.3 RESULT 92 4.3.1 Bacterial Isolation 92 4.3.2 Initial Bacterial Identification 93 4.3.3 16s rDNA Sequencing Identification 94 4.3.4 NifH Gene PCR and Sequencing 95 4.3.5 Nitrogenase Activity (Acetylene Reduction) 96 4.3.6 Fluorescent Microscopy of Bacteria within Suillus tomentosus Tubercles . . . 97 4.4 DISCUSSION 102 4.5 REFERENCES 110 iv Chapter 5 Nitrogen Fixation Associated with Suillus tomentosus Tuberculate Ectomycorrhiza (TEM) on Pinus contorta 5.1 INTRODUCTION 124 5.2 M A T E R I A L S A N D METHODS 127 5.2.1 Study Sites 127 5.2.2 Evaluation of Nitrogenase Activity 127 5.2.3 Tubercle Biomass Measurements and Nitrogenase Calculations 133 5.2.4 Statistical Analysis 134 5.3 RESULTS 134 5.4 DISCUSSION 140 5.5 REFERENCES 149 Chapter 6 Haemoprotein of Suillus tomentosus Tuberculate Ectomycorrhizae and in vitro Tubercle Re-Assembly 6.1 INTRODUCTION 159 6.2 M A T R I A L S A N D METHODS 165 6.2.1 Study Sites 165 6.2.2 Haemprotein Analysis 165 6.2.2.1 Tubercle Tissue Collection 165 6.2.2.2 Drab kin's Reagent Test for Total Haemoglobin Concentration . . . .165 6.2.2.3 Cellulose Acetate Gel Electrophoresis 166 6.2.3 Suillus tomentosus-Pinus contorta T E M Recombination in vitro 167 623A Tubercle Tissue Collection 167 6.2.3.2 Fungal and Bacteria Isolation 167 6.2.3.3 Recombination of TEM System 168 6.3 RESULTS 169 6.3.1 Haemprotein Analysis 169 6.3.1.1 Drabkin 's reagent test 169 63 A 2 Haemoglobin cellulose acetate gel electrophoresis 169 6.3.1.3 Recombination of S. tomentosus - P. contorta TEM 172 6.4 DISCUSSION 175 6.5 REFERENCES 180 Chapter 7 Conclusion 7.1 G E N E R A L CONCLUSIONS 186 7.2 FUTURE W O R K 190 7.3 REFERENCES 193 Appendices Appendix A 195 Appendix B 198 Appendix C 202 Appendix D 210 Appendix E 216 LIST OF TABLES 3.1 Site biogeoclimatic subzone classification, bedrock, parent material and soil texture from each of the study sites 53 3.2 Log decay class characteristics for coarse woody debris survey analysis 54 3.3 Cubic meters of coarse woody debris in each of the stand age classes at each of the study sites 60 3.4 Average and maximum mass of Suillus tomentosus tuberculate ectomycorrhizae per cubic meter of coarse woody debris in each of the stands at the three sample sites 62 4.1 Colony appearance of bacterial isolates from interior tissue of Suillus tomentosus tubercles (mycorrhizal root tips and interstitial hyphae) 92 4.2 Colony appearance of bacterial isolates from the surface of Suillus tomentosus tubercles 93 4.3 Identification of bacterial isolates from interior tissue of Suillus tomentosus tubercles using BIOLOG analysis and GC F A M E analysis 94 4.4 Gas chromatography Fatty Acid Methyl Ester identification analysis of surface isolated bacteria from Suillus tomentosus tubercles 95 4.5 Identification of bacterial isolates from interior tissue of Suillus tomentosus tubercles using 16s rDNA sequence analysis 96 4.6 Nitrogenase activity of bacterial isolates from Suillus tomentosus tubercles as measured by acetylene reduction analysis 98 5.1 Least significant difference results for comparisons of acetylene reduction values between Suillus tomentosus tuberculate ectomycorrhizae samples and the four treatment types 135 5.2 Average and maximum ethylene production of Suillus tomentosus tuberculate ectomycorrhizae at the three sites within the Sub Boreal Pine Spruce xeric cold biogeoclimatic zone for spring and summer of 1997 and 1998 136 5.3 Two-way A N O V A results for comparisons between sites and between stand ages for Suillus tomentosus tuberculate ectomycorrhizae for average acetylene reduction assay results 139 6.1 Haemoglobin content in tuberculate ectomycorrhizae as measured by Drabkin's reagent test 170 vii 6.2 Cellulose acetate gel electrophoresis of tuberculate ectomycorrhizae, mycorrhizal roots and nori-mycorrhizal roots stained with Ponceau S and o-dianisidine 171 6.3 Number of microcosms with tuberculate ectomycorrhizal development for recombinations with Pinus contorta, Suillus tomentosus, Paenibacillus amylolyticus and Methylobacterium mesophillicum (column 1), P. contorta and S. tomentosus (column 2) and P. contorta (column 3) 175 A - l Sub-Boreal Pine Spruce Biogeoclimatic Zone (SBPS) percent vegetation cover, British Columbia, Canada 196 B-l Pinus contorta stand age class system 201 C - l Coarse woody debris decay class classification system used for characterising log section analysis 203 C-2 Significance results from Pearson correlation analysis of the numberr of Suillus tomentosus tuberculate ectomycorrhizae and moisture content of coarse woody debris CWD, texture of CWD, amount of Pinus contorta roots in CWD and amount CWD is incorporated into the forest floor 203 C-3 A N O V A significant difference analysis of soil parameters between sites and stand age classes 206 D-l Gas Chromatography Fatty Acid Methyl Ester analysis of bacteria isolated from interstitial tissue of T E M on Pinus contorta 211 D-2 Gas Chromatography Fatty Acid Methyl Ester analysis of bacteria isolated from surface tissue of T E M on Pinus contorta 211-212 E-l Average and maximum measured ethylene (C2H4) production from Suillus tomentosus tuberculate ectomycorrhizae in situ 217 viii LIST OF FIGURES 1.1 Sub-Boreal Pine Spruce xeric cold biogeoclimatic zone study sites: Alex Graham, Puntzi Lake and Nimpo Lake 9 1.2 Understory vegetation in (A) a young stand <40 years and (B) an old stand >140 years in Sub Boreal Pine Spruce xeric cold biogeoclimatic sub zone in the interior of B.C. Canada 10 1.3 Amount of ground cover in (A) a young stand <40 years and (B) an old stand >140 years in Sub Boreal Pine Spruce xeric cold biogeoclimatic zone in the central interior of B.C. Canada 11 2.1 (A) Tuberculate ectomycorrhizal root excavated from within coarse woody debris in Pinus contorta stands of the Sub Boreal Pine Spruce xeric cold biogeoclimatic subzone in central British Columbia. (B) Tubercles found on Pinus contorta roots under woody debris on top of the mineral soil layer 24 2.2 Tuberculate ectomycorrhiza on Pinus contorta roots, external gross morphology of tubercles and rhizomorphs 28 2.3 Tuberculate ectomycorrhiza of Pinus contorta showing rhizomorphs and attachment of rhizomorphs to base of tubercle 29 2.4 External view of tuberculate ectomycorrhiza on Pinus contorta roots. (A) Showing flattened tubercles found in fissures and cracks of woody debris. (B) Showing senescing older tubercles on host root 29 2.5 External view of developing immature tubercle on Pinus contorta with mycorrhizal elements showing through hyphal veil of developing peridium. . . . . . 30 2.6 Cross section through a mature tubercle from Pinus contorta showing mycorrhizal elements and interstitial hyphae 31 2.7 Cross section through senesced tubercle from Pinus contorta 31 2.8 Tubercles of Pinus contorta showing rhizomorphs attachment at the base and growing along the surface of tubercles 32 2.9 Cross section through Pinus contorta tubercle showing two root tips joined by a common ectomycorrhizal mantle 33 2.10 Outer layer hyphae of the peridium from tubercles on Pinus contorts, roots showing exudate material associated with the hyphae 34 2.11 Cross section through ectomycorrhizal root tip from within a Pinus contorta tubercle 35 ix 2.12 Hyphae of the outer mantle showing exudates associated with the hyphae and connections without clamps 36 2.13 Cross section through ectomycorrhizal root tip from within Pinus contorta tubercle showing Hartig net surrounding three layers of cortical cells 37 2.14 Cross section through an ectomycorrhizal root tip from a Pinus contorta tubercle, showing the finger-like hyphae of the Hartig net surrounding the cortical cells 37 2.15 Cross section through a rhizomorph from Pinus contorta tuberculate ectomycorrhizae showing three layers of cellular organisation 38 2.16 Horizontal section through rhizomorph from Pinus contorta tubercle showing emanating hyphae of the outer layer, more densely packed middle layer and vessel hyphae running down the central core 39 3.1 Examples of a class 2 stand and a class 8 stand in the Sub Boreal Pine Spruce xeric cold biogeoclimatic study area 55 3.2 Typical Pinus contorta log selected at random and excavated for Suillus tomentosus tuberculate ectomycorrhizae 56 3.3 Suillus tomentosus tuberculate ectomycorrhizae exposed after sections of woody debris have been broken apart. (A) host root with T E M . (B) T E M within CWD. . . 57 3.4 Log sections taken apart showing host Pinus contorta roots with Suillus tomentosus tuberculate ectomycorrhizae exposed for collection. (A) A host root removed from within the woody debris with prolific T E M development.(B) Areas where host roots have been excised from woody debris showing T E M 58 3.5 Collection of Suillus tomentosus tubercles from dissected section of coarse woody debris of Pinus contorta stands 59 3.6 (A) Average number of Suillus tomentosus tuberculate ectomycorrhiza per cubic meter of coarse woody debris at each site, and (B) in each of the stand age classes 61 3.7 (A) Average mass of Suillus tomentosus tuberculate ectomycorrhizae in each at each of the sites and (B) combined average mass of S. tomentosus T E M in each of the stand age classes 62 3.8 Distribution of average number of Suillus tomentosus tubercles in coarse woody debris logs of Pinus contorta 63 x 3.9 Correlation analysis between the number of Suillus tomentosus tuberculate ectomycorrhizae in Pinus contorta coarse woody debris and (A) the moisture content of CWD, (B) texture of CWD, (C) amount of roots present in CWD and (D) amount that CWD is incorporated into the forest floor 64 4.1 PCR-amplified NifH genes from bacterial isolates II to 14 isolated from interior tissue of Suillus tomentosus tubercles 97 4.2 Cross section of Suillus tomentosus tubercle showing bacteria stained with acridine orange fluorescent dye amongst interstitial hyphae tubercle 99 4.3 Surface of ectomycorrhizal root tip within Suillus tomentosus tubercle stained with acridine orange fluorescent dye 100 4.4 Ectomycorrhizal root tip surface within Suillus tomentosus tubercle stained with LIVE/DEAD® fluorescent dye 100 4.5 Cross section through ectomycorrhizal root tip within Suillus tomentosus tubercle dyed with LIVE/DEAD® fluorescent bacteria dye 101 4.6 Close up of cross section through ectomycorrhizal root tip within Suillus tomentosus tubercle 101 5.1 Log section taken apart to reveal host root from Pinus contorta with attached Suillus tomentosus tuberculate ectomycorrhizal 128 5.2 Pinus contorta root with Suillus tomentosus tuberculate ectomycorrhizae cleaned of woody debris ready for insertion into incubation tube 129 5.3 Plunger assembly from acetylene reduction assay incubation tube showing Pinus contorta root with Suillus tomentosus tuberculate ectomycorrhizae inserted through the plunger and sealed by a septum 130 5.4 Acetylene reduction assay incubation tube showing plunger assembly inserted, gas retention vial within incubation tube, and retention vial septum placed in the vial opening 130 5.5 Acetylene reduction assay incubation tube being flushed with inert argon gas via the injection line and being vented by the evacuation needle 131 5.6 Acetylene reduction assay incubation system showing evacuation syringe, argon injection syringe and incubation tube 132 5.7 Data from spring 1997 showing calculated average nmoles C2H4 from Pinus contorta tuberculate ectomycorrhizae (TEM) per gram T E M per 24 hours from the three sample sites 137 x i 5.8 Data from summer 1997 showing calculated average nmoles C2H4 from Pinus contorta tuberculate ectomycorrhizae (TEM) per gram T E M per 24 hours from the three sample sites 138 5.9 Data from summer 1998 showing calculated average nmoles C2H4 from Pinus contorta tuberculate ectomycorrhizae (TEM) per gram T E M per 24 hours from the three sample sites 139 6.1 Composite samples of Suillus tomentosus tubercle extracts on cellulose acetate gels stained with (A) Ponceau S stain and (B) o-dianisidine stain 171 6.2 Composite samples of mycorrhizal root extracts on cellulose acetate gels stained with (A) Ponceau S stain and (B) o-dianisidine stain 172 6.3 Samples of human haemoglobin, tuberculate mycorrhizal, non-mycorrhizal root extracts and soybean peroxidase on cellulose acetate gels stained with (A) Ponceau S stain and (B) o-dianisidine stain 173 6.4 (A) Mini microcosm showing the formation of Suillus tomentosus tubercles on Pinus contorta when co-inoculated with Paenibacillus amylolyticus and Methylobacterium mesophillicum bacteria culture, (B) close up of tubercles 173 6.5 (A) Microcosm recombination of Suillus tomentosus and Pinus contorta with no bacteria inoculum, (B) close up of mycorrhizal root 174 6.6 Microcosm of Pinus contorta with no fungal or bacterial inoculum 174 A - l Mean monthly temperature and precipitation for the Sub-Boreal Pine Spruce biogeoclimatic (SBPS) zone of British Columbia, Canada 197 B - l Sequence of internal transcribed spacer region (ITS) of Pinus contorta tuberculate ectomycorrhizae compared to the ITS region of Suillus tomentosus sporocarp sample from NCBI database 199 B-2 Pasimony analysis using neighbour joining method showing P. contorta T E M phylogeny in relation to other Suillus spp 200 C - l Soil analysis data from Pinus contorta study sites in the Sub Boreal Pine Spruce biogeoclimatic zone of British Columbia. (A) average pH measurements, (B) average total carbon, (C) average total nitrogen, (D) average carbon to nitrogen ratio 207 C-2 Soil analysis data from Pinus contorta study sites in the Sub Boreal Pine Spruce biogeoclimatic zone of British Columbia. (A) average mineral nitrogen measurements, (B) average ammonium, (C) average nitrate, (D) average available phosphorus 208 C-3 Soil analysis data from Pinus contorta study sites in the Sub Boreal Pine Spruce biogeoclimatic zone of British Columbia. (A) average total sulfur xii measurements, (B) average sulfate, (C) average cation exchange capacity, (D) average base saturation 209 D-l Phylogenetic relationships of Paenibacillus species and some aerobic, rod-shaped, endospore forming bacteria based on 16s rRNA gene sequences 213 D-2 Unrooted phylogenetic tree showing the different rhizobial branches including Methylobacterium in the a-subdivision of the Proteobacteria 214 D-3 (A) Phylogenetic tree based on full length nodA gene sequences constructed by the neighbour-joining method. (B) Phylogenetic tree based on 140 amino acid mxaF (methanol oxidation structural gene) sequences constructed by neighbor-joining method 215 xiii NOMENACLATURE AND ACRONYMS A G Alex Graham A N O V A Analysis of Variance A M Arbuscular Mycorrhiza A R A Acetylene Reduction Assay C C M Nitrogen Deficient Combined Carbon Medium CWD Coarse Wood Debris d diameter of each log in centimeter D G G E Denaturing Gradient Gel Electrophoresis GC F A M E Gas Chromatography Fatty Acid Methyl Ester FID Flame Ionization Detector FISH Fluorescence In Situ Hybridization Hb Haemoglobin ITS Internal Transcribed Spacer k constant to account for length and diameter unit differences L length of the transect in meter Lb Leghaemoglobin M H B Mycorrhizal Helper Bacteria M M N Modified Melan-Norkans Media N L Nimpo Lake PCR Polymerase Chain Reaction PGPR Plant Growth Promoting Rhizobacteria PL Puntzi Lake rDNA Ribosomal D N A RFLP Restriction Fragment Length Polymorphism SBPSxc Sub-Boreal Pine Spruce xeric cold biogeoclimatic subzone Tb Tuberculate Ectomycorrhizal Haemoglobin T E M Tuberculate Ectomycorrhizae TSB Tryptic Soy Broth V volume in cubic meter per hectare xiv ACKNOWLEDGEMENTS Where to begin? I can't thank Dr. B i l l Chapman, 'Dr. B i l l " , enough for all of his inspiration, guidance, support and patience with me during this thesis. I could not have accomplished so much with out his solid belief in my abilities over the years. If I can become half as good a person and scientist as Dr. B i l l , I will have achieved an even a greater goal. Your inspirational talks (although a bit intense sometimes) as we were cruising down the highway in our work truck were more than just words of wisdom Dr. B i l l , they were entertaining as well. © P U G N A forever!!!! With all of my heart, I would like to thank my fiancee, Susanne Nordstrom. Your patience, love and sweet heart kept me going through all of the tough and miserable times during the writing of this thesis. I would not have finished without you being there and I am grateful for all the support you gave to me during those months. I am the luckiest man in the world for meeting you and I am looking forward to the rest of our lives together. Puss och Krams Blobar. © I would also like to thank my mom. She is the most beautiful person in the world, with such a big heart, always trying so hard to make everything just right for me and the rest of our family. This achievement is not only my own but I share it you mom because I would not be the person I am today if it wasn't for you. I love you with all of my soul. Thank you mom, from the bottom of my heart. A very big thank you also goes to my partner in crime Sheldan Myers. Sheldan, your courage, tolerance and determination to endure many hard days in the field and in the lab with my Scottish temper was unchallenged throughout the duration of this thesis and you deserves more thanks than can be written. I would also like to extend a thank you to Mrs. Karen Myers for all of her encouragement and love through this thesis work. Lastly, a special warm thank-you goes to our field companion, Sheba. I dedicate this thesis in memory of my father, John Paul. XV Chapter 1 Thesis Introduction 1.1 INTRODUCTION Tuberculate ectomycorrhizae (TEM) are a form of ectomycorrhiza in which the fungal component causes single host roots to branch prolifically forming coralloid-like aggregations of numerous mycorrhizal root tips (Trappe 1965, Zak 1971). The fungus of T E M envelops the dense aggregation of mycorrhizal root tips with a rind of hyphae to form a tubercle. Mycorrhizal root tips within the tubercle will also re-branch, two or more times, and in some cases it has been reported that as many as 300 mycorrhizal root tips can form within a tubercle (Trappe 1965, Randall and Grand 1986, Haug et al. 1991, Massicotte et al. 1992). This type of prolific branching is quite different from typical ectomycorrhizae in frequency and form (Trappe 1965). The rind of fungal hyphae surrounding the root tips (the peridium) effectively isolates the root tips from the surrounding soil (Trappe 1965, Grand 1971, Zak 1971, Randall and Grand 1986, Dell et al. 1990, Haug et al. 1991, Massicotte et ql. 1992). The peridium consists of continuous layers of appressed, parallel hyphae that can differ from type to type of T E M (Randall and Grand 1986, Dell et al. 1990, Haug et al. 1991). Tubercle gross morphology is similar to that of small peas or little balls attached to the host roots. Individual mycorrhizal root tips within T E M are mantled with hyphae which are tightly interwoven, similar to those of the peridium (Trappe 1965, Randall and Grand 1986, Haug et al. 1991, Massicotte et al. 1992). The hyphae grow outward from the mantle as well as from the inner surface of the peridium, completely filling the small spaces between the mycorrhizal root tips (Trappe 1965, Grand 1971, Dell et al. 1990, Haug et al. 1991, Massicotte et al. 1992). Hyphae also grow within the tissue of the root tips, penetrating between and surrounding the cortical cells to form the Hartig net. Occasionally, in some species, the Hartig net extends to the 1 endodermis of the root, similar to typical non-tuberculate ectomycorrhizae (Trappe 1965, Grand 1971, Zak 1971, Randall and Grand 1986, Dell et al. 1990, Haug et al. 1991, Massicotte et al. 1992). In tubercles of Castanopsis sp., the Hartig net only establishes between the epidermal cells (Haug et al. 1991). As the hyphae of the Hartig net grow, they separate but never actually penetrate the cortical cells (Trappe 1965, Grand 1971, Zak 1971, Randall and Grand 1986, Dell et al. 1990, Haug et al. 1991, Massicotte et al. 1992). The hyphae of the net are believed to be the exchange sites of nutrient transfer between the host plant and the fungus (Bowen 1973). Tuberculate ectomycorrhizae have been described on a number of conifer and deciduous tree species including Pseudotsuga menzesii (Mirb.) Franco (Trappe 1965, Dominik and Majchrowicz 1967, Zak 1971), Pinus strobus L. (Randall and Grand 1986), Pinus sylvestris L. (Melin 1923, Smith and Thiers 1971, Snell and Dick 1970, Chumak 1981), Castanopsis borneenis Ki.(Haug et al. 1991), Tsuga mertensiana Bo. (Zak 1973), Quercus pausidentata Fr. (Mausi 1926), Eucalyptuspilularis Sm. (Dell et al. 1990) and Engelhardtia roxburghiana Wa. (Haug et al. 1991). These studies have mainly focused on characterising T E M morphologically and not on their function. No convincing rationale for the formation of tubercles has been advanced by these studies. Some speculative suggestions for the formation of T E M from these papers have been that T E M may: (i) benefit the host during times of water stress, (ii) provide protection for the rootlets from pathogens or aphid attacks, or (iii) enhance the nutrient uptake ability of the host (Trappe 1965, Zak 1971). However, none of these possibilities satisfactorily explains how mycorrhizal root tips that are physically separated from the surrounding soil are of any value to the host plant. It is interesting to note that the speculative suggestions for the formation of T E M are often inferences based on results of tests on typical ectomycorrhizae (Harley and Smith 1983). 2 Tuberculate ectomycorrhizae are commonly found within decaying and rotting woody debris partially incorporated into the forest floor (Trappe 1965, L i et al. 1992 and Chapter 3) where ectomycorrhizae, in general, have been shown to be prolific (Zak 1971, Harvey et al. 1980, Maser and Trappe 1984, Harmon et al. 1986, Jurgensen et al. 1986). It has been speculated that mycorrhizae are abundant in decaying woody debris for a number of reasons. First, woody debris is important in moisture retention in the forest floor and, therefore, may provide a suitable habitat for mycorrhizal development. Second, woody debris may be a major source of organic matter in forests and may be an secondary source of carbon for the fungal component of mycorrhiza (Harmon et al. 1986, Edmonds 1991, Graham et al. 1994, Marra and Edmonds 1994). Third, woody debris has been recognised as a reservoir for important nutrients such as N and P, which are essential for mycorrhizal activity as well as other flora (Grier 1978, Covington 1981, Means et al. 1992). Since nitrogen is often a limiting factor for plant growth (Richards and Voigt 1964, Etter 1969, 1972, Larsen et al. 1978, Johnson et al. 1982, Bormann et al. 1993), woody debris as a reservoir of N , may be important in soil fertility in certain forest stands. Bacteria are believed to be one of the many other types of soil organisms that also benefit from decaying woody debris. The nutrient and moisture regimes within decayed woody debris are believed to be beneficial to the activity of many bacteria, in particular N 2 - fixing bacteria (Larsen et al. 1978, Harvey et al. 1989, Jurgensen et al. 1984,1989, 1991,1992). Extensive research has been conducted on nitrogenase activity within woody debris (Cornaby and Waide 1973, Sharp and Millbank 1973, Aho et al. 1974, Todd et al. 1975, Larsen et al. 1978, McNabb and Geist 1979, Roskoski 1980, Silvester et al. 1982, Jurgensen et al. 1989), using the acetylene reduction assay (Hardy et al. 1968), 1 5 N natural abundance method (Bergersen and Turner 1983, Shearer and Kohl 1986, Bolger et al. 1995, Bremer and van Kessel 1990, Sanford et al. 1993, Boddey et al. 2000), and the 15N2-isotope method (Burris and Miller 3 1941). These and other studies have confirmed that woody debris is a significant site of nitrogen fixation, with the main causative agent of this activity being various species of free living In-fixing bacteria (Jurgensen et al. 1991,1992). The presence and activity of N 2-fixing bacteria has also been well documented to occur in the various stages of woody debris decay (Larsen et al. 1978, Silvester et al. 1982, Harvey et al. 1989, Jurgensen et al. 1989). Bacterial colonisation of non-tuberculate ectomycorrhizae has been demonstrated in a number of studies (Richards and Voigt 1964, L i and Hung 1987, Linderman 1988, Richter et al. 1989, Amaranthus et al. 1990, Chanway and Holl 1991). In some cases, these root-fungal-bacterial associations are thought to be symbiotic, rendering the mycorrhiza a tripartite association. The physiological relationships between the three agents of these proposed symbioses are not well understood and require further investigation. In the only study to date on the physiological relationships between T E M and bacteria, L i et al. (1992) found symbiotic N 2-fixing bacteria in association with T E M on Pseudotsuga menziesii. The bacteria were only cultured from the surface layer of the peridium of tubercles. Bacteria were not found on the rootlets within the tubercles or within the rootlet cortical cells. Since the bacteria were only found on the surface, it was concluded that the bacteria were associative and not symbiotic. However, earlier studies on typical non-tuberculate ectomycorrhizae speculated that associated N 2-fixing bacteria might occur throughout the mycorrhizal mantle as well as within and between cortical cells of the host roots (Malajczuk 1979, L i and Hung 1987). If N 2-fixing bacteria are found within T E M , then it is possible that these associations are symbiotic (mutual benefit to host and symbiont) and not merely associative (uncertain benefit to host and associated organism), which might make T E M an important potential source of nitrogen for host plants. To date, such a relationship has not been demonstrated. While L i et al. (1992) did not report significant levels of nitrogenase activity in 4 their experiments, there are a variety of possible explanations for their findings, the age of the experimental material, localised N levels, the sensitivity of the detection assay and that they worked on a different mycorrhizal system. It has been shown that nitrogenase activity can be affected by the amount of nitrogen available in the environment (Zuberer 1998). The nitrogenase levels reported by L i et al. (1992) may have been at or below detection levels measured with the acetylene reduction assay (ARA) because of high environmental N levels in their study area. The results from L i et al. (1992) does not rule out the possibility that higher levels of nitrogenase activity could be occurring within some tubercles in soils or on other tree species. It would therefore be useful to investigate the potential of nitrogen fixation by T E M using samples taken from a forest ecosystem known to be extremely nitrogen limited. The Sub Boreal Pine Spruce xeric cold (SBPSxc) biogeoclimatic subzone of the Chilcotin, in the interior of British Columbia was selected because it is has a severe environment characterised by cold, dry winters and hot, dry summers with nitrogen deficient soils (Ballard 1986, Weetman 1988). In addition, abundant T E M were observed on Pinus contorta var. latifolia (Dougl.) Engelm., in this region (Chapman and Paul, 1995, unpublished data); the prolific association of abundant T E M on a tree species on a N limited site is consistent with TEM-associated bacterial N2-fixation as a nitrogen source. Soils that are deficient in nutrients such as nitrogen are known to cause stress in plants (Mopper et al. 1991) and inhibit shoot growth (Gehring and Whitham 1994). In addition, ectomycorrhizal abundance is known to increase in nutrient deficient soils (Boerner 1986, van Noordwijk and Hairiah 1986, Gehring and Whitham 1994), whereas in soils with higher levels of fertility, ectomycorrhizal abundance is lower (Marx et al. 1977, Gagnon et al. 1987, MacFall et al. 1990). Therefore, it is reasonable to hypothesise that trees growing in nitrogen deficient 5 soils would be a good place to look for T E M with N 2-fixing bacteria because these trees could significantly benefit from this type of symbiotic relationship. 1.2 OBJECTIVES The work conducted in this thesis was done in conjunction with a larger study titled: "The role of woody debris in soil, forest floor and long-term site productivity in SBPSxc biogeoclimatic subzone in the central interior of British Columbia" (Dr. Bi l l Chapman, B.C. Ministry of Forests, Cariboo Regional Branch, Williams Lake, B.C., Canada). Some of the objectives from this thesis relating to the study on coarse woody debris (CWD) are: (1) to evaluate the amounts of woody debris in various stand age classes, (2) to examine some of the attributes of woody debris such as decay characteristics, and (3) to describe the role of woody debris in ecosystem function. These data were used in conjunction with results found in this thesis to estimate the contribution of T E M to the nitrogen budget of P. contorta at the stand level. This thesis is an interdisciplinary study that has the following objectives: (1) To determine whether nitrogen fixation occurs in association with T E M on P. contorta roots and if so, to attempt to quantify the amount of nitrogenase activity in various stand age classes using a modification of the acetylene reduction assay (ARA) in situ. (2) To determine if T E M nitrogen fixation contributes significantly to the nitrogen budget of P. contorta. (3) To determine if N 2-fixing bacteria are present within T E M by culture isolation and identification using molecular techniques. (4) To verify nitrogenase activity of bacterial isolates by in vitro A R A tests. (5) To establish the locality of bacteria within T E M using fluorescent microscopy. 6 (6) To determine whether the majority, if not all of the nitrogenase activity associated with T E M is due to N2-fixing bacteria within tubercles and not from surface colonising bacteria by isolating, identifying and testing the surface bacteria for nitrogenase activity in vitro. (7) To identify the fungal component of T E M on P. contorta by using molecular sequence analysis and to compare and contrast the morphological characteristics of P. contorta T E M with that of other T E M species described on other conifer tree species. (8) To determine the abundance (number and biomass) of T E M in CWD on P. contorta stands and relate the abundance of T E M to woody debris characteristics such as decay class and moisture. (9) To attempt to re-assemble the T E M complex of P. contorta in the laboratory, using all of the components (N2-fixing bacteria, mycorrhizal fungi and P. contorta seedlings) to determine the roles that each organism plays in forming the tripartite symbiosis of the tubercle structure. This dissertation is organised in five sections. The first section (Chapter 2) describes T E M of P. contorta using conventional morphological analysis, and subsequent identification of T E M using D N A sequence analysis, which has not been previously reported. This chapter also considers the validity of using molecular analysis in conjunction with conventional morphological analysis to identify ectomycorrhizal species. The second section (Chapter 3) characterises the abundance and distribution of T E M within CWD and discusses the importance of CWD in the development and abundance of T E M in P. contorta stands. In the third section (Chapter 4), I discuss the isolation and identification of N2-fixing bacteria from within T E M and establish these endophytic bacteria as the source of nitrogenase activity associated with T E M of P. contorta. This section also provides genetic identification of the N2-fixing bacteria, and photographic evidence of the location of bacteria within T E M . The fourth section (Chapter 5) describes nitrogen fixation associated with T E M in situ, using A R A . Quantified amounts of 7 nitrogenase activity are discussed in relation to their importance to P. contorta nitrogen budgets. The fifth section (Chapter 6) discusses the discovery of a haemoprotein extracted from the tissue of T E M . This chapter provides evidence through comparison by cellulose gel electrophoresis, that the protein is similar to haemoglobin and discusses the implications of this similarity. This chapter also discusses the results obtained from the re-combination experiments using the host, fungus and bacteria of T E M from the study area. The conclusions of the dissertation are presented in the seventh and final chapter. A l l supplemental figures, pictures and tables are presented in Appendices at the end of the document. 1.3 S T U D Y A R E A The study area for this project was the Sub-Boreal Pine Spruce xeric cold (SBPSxc) biogeoclimatic subzone in the western central interior of British Columbia, Canada (Steen and Demarchi 1991, Steen and Coupe 1997). This subzone is part of the Chilcotin Forest District and lies west of Williams Lake, British Columbia (Fig. 1.1). Three study sites were chosen across the SBPSxc plateau: the first site, Alex Graham mountain (AG) is located 75 km west of Williams Lake, the second site, Puntzi Lake (PL) is 175 km west of Williams Lake and the third site, Nimpo Lake (NL) is located 300 km west of Williams Lake (Fig. 1.1). The climate of the SBPSxc subzone plateau is continental and characterised by cold, dry winters and warm, dry summers. The warm summers and cold winters result largely from the area being positioned in the strong rain shadow of the Coast Mountains as well as the moderately high elevation of the plateau (1100-1500 m above sea level). The combination of low precipitation, dry air and clear skies result in significant night-time radiative cooling and low overnight temperatures in contrast to the very hot, dry summer days. Mean annual temperature, ranges from 0.3 to 2.7°C with an overall mean of 1.9°C. Daily temperature 8 Source: BC Ministry of Forests, Victoria, BC, Canada Figure 1.1: Sub-Boreal Pine Spruce biogeoclimatic zone showing study sites: Alex Graham, Puntzi Lake and Nimpo Lake. Williams Lake town site is marked by " X " . 9 extremes range from +40 °C in the summer time to -30°C in the winter time. Mean annual precipitation ranges from 335 to 580 mm with an average of about 440 mm, only 30-40 % of the precipitation falls as snow (Appendix A, Fig. A-2). Substantial water deficit normally occurs during the middle and later part of the growing season from June to September (Steen and Demarchi 1991, Steen and Coupe 1997). The SBPSxc landscape is dominated by upland coniferous forest consisting mainly of lodgepole pine (P. contorta). In fact, due to the extensive fire history in this region, large areas of the forest contain no tree species other than P. contorta. Through most of the subzone, the Figure 1.2: Understory vegetation in (A) a young stand <40 years and ( B ) an old stand >140 years in Sub Boreal Pine Spruce xeric cold biogeoclimatic subzone in the interior of B.C. Canada. 10 only other coniferous tree species is Douglas-fir (Pseudotsuga menziesii), which occurs singularly or in very small patches. Occasionally, and more commonly in the very western fringes of the subzone, white spruce (Picea glauca (Moench) Voss.) can be found in small patches around moist zones. Also as a result of the extensive fire history, most stands in the subzone are young (<120 years), even-aged, dense and generally uniform in dominant size. The understory vegetation is dominated primarily by soopolallie (Shepherdia canadensis (L.) Nutt.), kinnikinnick (Arctostaphylos uva-ursi L.), pinegrass (Calamagrostis rubescens Buckl.), and lichens (Cladonia spp.)(Fig. 1.2a-1.2b, Appendix A, Fig. A - l ) . Other species that occur infrequently are short-awned ricegrass (Oryxopsis pungens), spike-like goldenrod (Solidago spathulata D C ) , common juniper (Juniperus communis L.) and Richardson's sedge (Carex richardsonii R. Br.) (Appendix A, Fig. A - l ) . The productivity of the forest is severely limited Figure 1.3: Amount of ground cover in (A) a young stand <40 years and ( B ) an old stand >140 years in Sub Boreal Pine Spruce xeric cold biogeoclimatic subzone in the central interior of B.C. Canada. Note the very limited forest floor and lack of low level shrubs. 11 by the harsh climate, and a large proportion of the soil surface lacks vegetative cover over the pine needle litter (Fig. 1.3a-1.3b) (Steen and Demarchi 1991, Steen and Coupe 1997). Soil development in the SBPSxc subzone is weak. Orthic Dystric Brunisols and Brunisolic Gray Luvisols are the most common soils, usually, base rich sandy loam morainal deposits. Soil texture in most of the soils in the subzone is sandy loam and many are quite gravely. In the most western part of the subzone, soils are derived from granitic parent material and are usually coarse textured. Also common in this area of the subzone are sandy glaciofluvial outwash deposits. The surface organic layer of the soil in the entire subzone is very thin (< 4 cm), probably due to low vegetative inputs. Within 15 to 20 cm of the surface of the Luvisols, a weakly developed clay enriched horizon is present. As a result of the poorly developed drainage patterns on the plateau surface, non-forest wetlands are present throughout the zone (Steen and Demarchi 1991, Steen and Coupe 1997). 12 1.4 R E F E R E N C E S Aho, P.E., Seidler, R.J., Evans, H.J. and Rajau, P.N. 1974. Distribution, enumeration and identification of nitrogen-fixing bacteria associated with decay in living white fir trees. Phytopathology 64: 1413-1420. Amaranthus, M.P., L i , C Y . and Perry, D.A. 1990. Influence of vegetation type and madrone soil inoculum on associative nitrogen fixation in Douglas-fir rhizosperes. Canadian Journal of Forest Research 20: 368-371. Ballard, R . M . 1986. Overview of forest nutritional problems in the B.C. interior, and methods of diagnosis. In: Proc. of Interior forest fertilization workshop. Kamloops, B.C. Feb. 4-5, 1986, B.C. Ministry of Forests. Victoria, B.C. pp. 1-9. Bergersen, F.J. and Turner, G.L. 1983. An evaluation of 1 5 N methods for estimating nitrogen fixation in a subterranean clover perennial ryegrass sward. Australian Journal of Agricultural Research 34: 391 -401. Boddey, R .M. , Peoples, M.B. , Palmer, B. and Dart, P.J. 2000. Use of the 1 5 N natural abundance technique to quantify biological nitrogen fixation by woody perennials. Nutrient Cycling in Agroecosystems 57: 235-270. Boerner, R.E.J. 1986. Seasonal nutrient dynamics, nutrient resorption and mycorrhizal infection intensity of two perennial forest herbs. American Journal of Botany. 73: 1249-1257. Bolger, T.P., Pate, J.S., Unkovich, M.J. and Turner, N.C. 1995. Estimates of seasonal nitrogen fixation of annual subterranean clover-based pastures using the 1 5 N natural abundance technique. Plant and Soil 160: 215-223. Bormann, B.T., Bormann, F.H., Bowden, W.B. Pierce, R.S., Hamburg, S.P., Wang, D., Snyder, M.C. , L i , C Y . and Ingersoll, R.C. 1993. Rapid N 2 fixation in pines, alder and locust: Evidence from the sandbox ecosystem study. Ecology 74(2): 583-598. 13 Bowen, G.D. 1973. Mineral nutrition of ectomycorrhizae. In: Ectomycorrhizae: Their Ecology and Physiology. Eds. Mark, G.C. and Kozlowski, T.T. Academic Press. New York. pp. 151-205. Bremer, E and van Kessel, C. 1990. Appraisal of the nitrogen-15 natural-abundance method for quantifying dinitrogen fixation. Soil Science Society of American Journal 54: 404-411. Burris, R.H. and Miller, C.E. 1941. Application of 1 5 N to the study of biological nitrogen fixation. Science 93: 114-115. Chanway, C P . and Holl, F.B. 1991. Biomass increase and associative nitrogen fixation of mycorrhizal Pinus contorta seedlings inoculated with a plant growth promoting Bacillus strain. Canadian Journal of Botany 69:5 07-511. Chumak, N.F. 1981. Mycorrhizae formed by fungi of the genus Suillus in Scotch p'me-Pinus sylvestris. Mikoloya i Fitopatologiya 15(3): 202-207. Cornaby, B.W. and Waide, J.B. 1973. Nitrogen fixation in decaying chestnut logs. Plant and Soil 39: 445-448. Covington, W.W. 1981. Changes in forest floor organic matter and nutrient conservation following clear cutting in northern hardwoods. Ecology 62: 41-48. Dell, B. , Malajczuk, N . and Thompson, G.T 1990. Ectomycorrhiza formation in Eucalyptus: V. A. tuberculate ectomycorrhiza of Eucalyptus pilularis. New Phytologist 114: 633-640. Dominik, T. and Majchrowicz, I. 1967. Studies on the tuberculate mycorrhizae of Douglas-fir (Pseudotsuga taxifolia Britton). Ekologia Polska Seria A. 15(3): 75-90. Edmonds, R.L. 1991. Organic matter decomposition in western United States. In: Management and productivity of western montane forest soils. USD A Forest Service General Technical Report. INT-123: 118-128. 14 Etter, H . M . 1969. Growth, metabolic components and drought survival of Lodgepole pine seedlings at three nitrate levels. Canadian Journal of Plant Science 49(4): 393-402. Etter, H . M . 1972. Effect of nitrogen nutrition upon sugar content and dry weight of juvenile Lodgepole pine and White Spruce. Canadian Journal of Forest Research 2(4): 434-440. Gagnon, J., Langois, C.G. and Fortin, J.A. 1987. Growth containerized jack pine seedlings inoculated with different ectomycorrhizal fungi under a controlled fertilization schedule. Canadian Journal of Forest Research 17:5 8-62. Gehring, C A . and Whitham, T.G. 1994. Comparisons of ectomycorrhizae on Pinyon pines (Pinus edulis; Pinaceae) across extremes of soil type and herbivory. American Journal of Botany 81(12): 1509-1516. Graham, R.T., Harvey, A.E. , Jurgensen, M.F., Jain, T.B., Tonn, J.R. and Page-Dumroese, D.S. 1994. Managing coarse woody debris in forests of the Rocky Mountains. U S D A Forest Service Research Paper. INT-RP-477 Ogden. 12 p. Grand, L.F. 1971. Tuberculate and cenoccocum mycorrhizae of photinia (Rosaceae). Mycologia 63: 1210-1212. Grier, C C . 1978. A Tsuga heterophylla-picea stichensis ecosystem of coastal Oregon: Decomposition and nutrient balances of fallen logs. Canadian Journal of Forest Research 8: 198-206. Hardy, R.W.F., Holsten, R. D., Jackson, E.K. and Burns, R.C. 1968. The acetylene-ethylene assay for ^-fixation: Laboratory and field evaluation. Plant Physiology 43: 1185-1207. Harley, J.L. and Smith, S.E. 1983. Mycorrhizal Symbiosis. Academic Press. London. 15 Harmon, M.E. , Franklin J.F., Swanson, F.J., Sollin, P., Gregory, S.V., Lattin, J.D., Anderson, N.H. , Cline, S.P., Aumen, N.G. , Sedell, J.R., Lienkamper, G.W., Cromack, K. and Cummins, K.W. 1986. Ecology of coarse woody debris in tempret ecosystems. Advances in Ecological Research 15: 133-302. Harvey, A.E. , Larsen, M.J. and Jurgensen, M . F. 1980. Ecology of ectomycorrhizae in northern Rocky Mountain forests. In: Environmental Consequences of Timber Harvesting in Rocky Mountain Coniferous Forests. USDA Forest Service General Technical Report. INT 90: 188-208. Harvey, A.E. , Larsen, M.J. , Jurgensen, M . F. and Jones, E.A. 1989. Nitrogenase activity associated with decayed wood of living northern Idaho conifers. Mycologia 81(5): 765-771. Haug, I., Weber, R., Oberwinkler, F. and Tshen, J. 1991. Tuberculate mycorrhizas of Castanopsis borneensis King and Engelhardtia roxburghiana Wall. New Phytologist 111: 25-35. Johnson, D.W., Cole, D.W., Bledsoe, C.S., Cromack, K., Edmonds, R.L., Gessel, S.P., Grier, C C , Richards, B.N. and Voigt, K . A . 1982. Nutrient cycling in forests of the Pacific Northwest. In: Analysis of coniferous forest ecosystems in the western United States. Ed. R.L. Edmonds. Hutchinson Ross. Stroudsberg, PA. pp. 186-232. Jurgensen, M.F., Graham, R.T., Larsen, M.J. and Harvey, A.E. 1992. Clear cutting , woody residue removal, and nonsymbiotic nitrogen fixation in forest soils of the Inland Pacific Northwest. Canadian Journal of Forest Research 22: 1172-1178. Jurgensen, M.F., Larsen, M.J. , Mroz, G.D. and Harvey, A.E. 1986. Timber harvesting , soil organic matter and site productivity. In: Productivity of Northern Forests Following Biomass Harvesting. U S D A Forest Service General Technical Report. NE-115. pp. 43-52. 16 Jurgensen, M.F., Larsen, M.J., Wolosiewicz, M . and Harvey, A.E. 1989. A comparison of dinitrogen fixation rates in wood litter decayed by white-rot and brown-rot fungi. Plant and Soil 115: 117-122. Jurgensen, M.F., Larsen, M.J. , Spano, S.D., Harvey, A.E. and Gale, M.R. 1984. Nitrogen fixation associated with increased wood decay in Douglas-fir residue. Forest Science 30: 1038-1044. Jurgensen, M.F., Tonn, J.R., Graham, R.T., Harvey, A.E. and Geier-Hayes, K. 1991. Nitrogen fixation in forest soils of the Inland Northwest. USD A Forest Service General Technical Report. INT-280. pp. 101-109. Larsen, M.J. , Jurgensen, M.F. and Harvey, A.E. 1978. ^-f ixat ion associated with wood decayed by some common fungi in western Montana. Canadian Journal of Forest Research 8: 341-345. L i , C Y . and Hung, L .L . 1987. Nitrogen-fixing (acetylene-reducing) bacteria associated with ectomycorrhizae of Douglas-fir. Plant and Soil 98:425-428. L i , C.Y. , Massicote, H.B. and Moore, L . V . 1992. Nitrogen fixing Bacillus sp. associated with Douglas-fir tuberculate ectomycorrhiaze. Plant and Soil 140:35-40. Linderman, R.G. 1988. Mycorrhizal interactions with the rhizosphere microflora: The mycorrhizosphere effects. Phytopathology 78:366-371. MacFall, J.S., Iyer, J., Slack, S. and Berbee, J. 1990. Mycorrhizal phosphorous interaction on red pine (Pinus resinosa). Agriculture Ecosystems and Environment 28: 321-324. Malajczuk, N . 1979. The microflora of unsuberized roots of Eucalyptus calophylla R. Br. and Eucalyptus marginata Donn ex Sm. seedlings grown in soils suppressive and conducive to Phytophthora cinnamomi Rands. II. Mycorrhizal roots and associated microflora. Australian Journal of Botany 27: 255-272. 17 Marra, J.L. and Edmonds, R.L. 1994. Coarse woody debris and forest floor respiration in an old growth coniferous forest on the Olympic Peninsula, Washington. Canadian Journal of Forest Research 24: 1811-1818. Marx, D.H., Hatch, A.B. and Mendicino, J.F. 1977. High soil fertility decreases sucrose content and susceptibility of loblolly pine roots to ectomycorrhizal infection by Pi soli thus tinctorius. Canadian Journal of Botany 55: 1569-1574. Maser, G. and Trappe, J.M. 1984. The seen and unseen world of the fallen tree. USDA Forest Service General Technical Report. PNW-164. Massicotte, H.B., Melville, L .H. , L i , C Y . and Peterson, R.L. 1992. Structural aspects of Douglas fir [Pseudotsuga menziesii (Mirb.) Franco] tuberclate ectomycorrhizae. Trees 6: 137-146. Mausi, K. 1926. The compound mycorrhiza of Quercus pausidentata. Memoirs of the College ofScience. Kyoto Imperial University Series. B2: 161-187. McNabb, D.H. and Geist, J.M. 1979. Acetylene reduction assay of symbiotic N2-fixation under field conditions. Ecology 60(5): 1070-1072. Means, J.E., MacMillan, P.C. and Cormack, K. 1992. Biomass and nutrient content of Douglas-fir logs and other detrital pools in an old growth forest, Oregon, U.S.A. Canadian Journal of Forest Research 22: 1536-1546. Melin, E. 1923. Experimentelle Untersuchungen uber die Konstitution und Okologie der Mycorrhizen von Pinus sylvestris L. und Picea abies (L.) Karst. Mycologische Untersuchungen undBerichte 2: 73-331. Mopper, S., Mitton, J.B., Whitham, T.G., Cobb, N.S. and Christensen, K . M . 1991. Genetic differentiation and heterozygosity in Pinyon pine associated with resistance to herbivory and environmental stress. Evolution 45:989-999. 18 Randall, B .L . and Grand, L.F. 1986. Morphology and possible mycobiont (Suilluspictus) of a tuberculate ectomycorrhiza on Pinus strobus. Canadian Journal of Botany 64: 2182-2191. Richards, B .N. and Voigt, G.N. 1964. Role of mycorrhizae in nitrogen fixation. Nature (London) 201: 310-311. Richter, D.L., Zuellig, T.R., Bagley, S.T. and Bruhn, J.N. 1989. Effects of red pine (Pinus resinous Ait.) mycorrhizoplane-associated actinomycetes on in vitro growth of ectomycorrhizal fungi. Plant and Soil 115: 109-116. Roskoski, J.P. 1980. Nitrogen fixation in hardwood forests of the northeastern United States. Plant and Soil 54:33-44. Sanford, P., Pate, J.S. and Unkovich, M.J. 1993. A survey of proportional dependence of subterranean clover and other pasture legumes on N 2 fixation in south-west Australia utilizing 15N natural abundance. Australian Journal of Agricultural Research 45: 165-181. Sharp, R.F. and Millbank, J.W. 1973. Nitrogen fixation in deteriorating wood. Experientia 29 895-896. Shearer, G. and Kohl, D.H. 1986. N2-fixation in field settings: Estimations based on natural 1 5 N abundance. Australian Journal of Plant Physiology 13:699-756. Silvester, W.B., Sollins, P., Verhoeven, T. and Cline, S.P. 1982. Nitrogen fixation and acetylene reduction in decaying conifer boles: Effects of incubation time, aeration and moisture content. Canadian Journal of Forest Research 12:646-652. Smith, A . H . and Thiers, H.D. Eds. 1971. The Boletes of Michigan. University of Michigan Press. Ann Arbor. Snell, W.H. and Dick, E.A. Eds. 1970. The Boleti of Northeasten North America. Verlag von J. Cramer. Lehre, Germany. 19 Steen, O. and Coupe, R.A. 1997. A Field Guide to Forest Site Identification and Interpretation for the Cariboo Forest Region. B.C. Ministry of Forests. Victoria. Steen, O. and Demarchi, D.A. 1991. Sub-boreal pine - spruce zone. In: Ecosystems in British Columbia. Eds. Meidinger, D and Pojar, J. B.C. Ministry of Forests. Victoria, B.C. pp. 195-207. Todd, R. L. , Waide, J.B. and Cornaby, B.W. 1975. Significance of biological nitrogen fixation and denitrification in a deciduous forest ecosystem. In: Mineral Cycling in Southeastern Ecosystems. Eds. Howell, F.G. Gentry, J.B. and Smith, M . H . pp. 727-735. Trappe, J.M. 1965. Tuberculate mycorrhizae of Douglas-fir. Forest Science 11:27-32. van Noordwijk, M . and Hairiah, K. 1986. Mycorrhizal infection in relation to soil pH and soil phosphorous content in a rain forest of northern Sumatra. Plant and Soil 96: 299-302. Weetman, G.F. 1988. Nutrition and fertilization of lodgepole pine. In: Procedings of The Future Forests of the Mountain West: A Stand Culture Symposium, 1986. Ed. Schmidt, W.C. U S D A Forest Service General Technical Report. INT-243. pp. 231-239. Zak, B. 1971. Characterization and classification of mycorrhizae of Douglas fir. U. Pseudotsuga menziesii + Rhizopogon vinicolor. Canadian Journal of Botany 49: 1079-1084. Zak, B. 1973. Classification of ectomycorrhizae. In: Ectomycorrhizae. Eds. Marks, G.C. and Kozlowski, T T . Academic Press. New York. pp. 43-78. Zuberer, D.A. 1998. Biological dinitrogen fixation: Introduction and nonsymbiotic. In: Principles and Applications of Soil Microbiology. Eds. Sylvia, D .M. , Fuhrmann, J.J., Hartel, P.G. and Zubrer, D.A. Prentice-Hall. New Jersey, pp. 295-321. 20 Chapter 2 Characterisation and Identification of Tuberculate Ectomycorrhizae (TEM) on Lodgepole pine (Pinus contorta). 2.1 I N T R O D U C T I O N Tuberculate ectomycorrhizae (TEM) are symbiotic relationships where an ectotrophic fungus grows on the roots of a host plant and causes the roots to split and proliferate into many rootlets. The rootlets are massed together and surrounded by a sheath layer of hyphae (peridium) (Massicotte etal. 1992, Trappe 1965, Zak 1971). The whole structure is called a tubercle and significantly differs from typical ectomycorrhizae. In superficial appearance, T E M resemble the root nodules of leguminous plants. A l l of the rootlets within tubercles have the basic characteristics of ectomycorrhizal roots, i.e., the fungal mantle and Hartig net (Trappe 1965, Zak 1971). Typically, between the rootlets are intertwining hyphae that make up the interstitial tissue of the tubercle. Tuberculate ectomycorrhizae have been described on a number of conifer species including, Pinus sylvestris L. (Melin 1923, Chumak 1981), Pinus strobusL. (Randall and Grand, 1986), Pseudotsuga sp. (Dominik 1963, Dominik and Majchrowicz, 1967, Massicotte et al. 1992, Trappe 1965, Zak 1971) and Tsuga mertensiana Bo. (Zak 1973). Tuberculate ectomycorrhizae have also been described on a number of deciduous species, including Quercus pausidentataVr. (Masui 1926), Photinia glabra Th. (Grand 1971), Eucalyptuspilularis Sm. (Dell et al. 1990), Castanopsis borneenis K i . (Haug et al. 1991) and Engelhardtia roxburghiana Wa. (Haug et al. 1991). A l l of these previous studies have, through the use of either light microscopy, scanning electron microscopy or both, described and identified T E M using morphological characteristics. Morphological analysis has been the accepted method of analysis for identification of ectomycorrhizae for the past four decades. However, morphological analysis may be questioned as a subjective and, therefore, less reliable method for identification of the fungal symbiont in 21 the association. Morphological analysis includes information that is collected and based on observations according to a researcher's perspective (Agerer 1987, 1995, 1996). Subjective observations may vary from individual to individual, rendering comparison and identification of species difficult. Furthermore, it is not always certain that different examiners will follow the established protocols, collect the same information or describe the same features when conducting morphological analysis. In response to these historical inconsistencies, a consensus was reached in 1993 affirming that after nearly 15 years of morphological identification, a concise standard set of ectomycorrhizal characteristics had to be developed to alleviate confusion in ectomycorrhizal descriptions (Goodman et al. 1998). Morphological analysis also leaves many common types of ectomycorrhizae described as unknown or as imperfect states (Agerer 1987, Ingleby et al. 1990). Such factors limit the value of morphological analyses alone as a method for reliable identification. Recent advancements in species identification using molecular methods have made these techniques more widely accepted and utilised, mainly due to their accuracy and reliability. Molecular techniques are based on genetic identifications which are less influenced by environmental factors and human bias that may affect morphological identifications. Molecular techniques do have limitations and pitfalls (Wintzingerode et al. 1997) but have increasingly become the standard for mycorrhizal species identification. None of the previous studies on T E M have used molecular techniques to confirm the identity of the species identified by morphological analysis. However, a recent study by Olsson et al. (2000) identified T E M on P. sylvestris in Sweden by using polymerase chain reaction (PCR) amplification of the internal transcribed spacer (ITS) region of rDNA with restriction fragment length polymorphism (RFLP) analysis and morphological analysis. The use of PCR and RFLP analysis to identify unknown ectomycorrhizal species has been common in the past ten years, especially to characterise community structures (Gards and Bruns 1996, Erland 1995, 22 Mahmood et al. 1999). These studies have shown that RFLP is a more accurate method for species identifications than morphological analysis alone. Although RFLP is an improvement over morphological analysis and has become more commonly used, it has a similar limitation as morphological analysis; unmatched samples are unidentified (Bruns et al. 1998). In the past few years, the use of D N A sequencing has become a more popular analytical choice and provides for a more accurate identification of the species in question (Amicucci et al. 1998, Bruns et al. 1998). Genetic sequencing identifications are essentially the same as fingerprint identifications of individuals and, therefore, are becoming the tool of preference for many researchers in various fields of research. Although sequencing of rDNA is relatively new in ectomycorrhizal identification, it is gaining recognition for its reproducibility, ease, low cost and ability to be rapidly applied to multiple samples. The purpose of this study was to identify and characterise the tuberculate ectomycorrhizae on Pinus contorta wax. latifolia (Dougl.) Engelm. (lodgepole pine) by combining morphological analysis with rDNA sequence analysis. This is the first time that sequence analysis has been combined with morphological analysis for identification and description of a T E M , and is also the first report of T E M on P . contorta. 2.2 M A T E R I A L S A N D M E T H O D S 2.2.1 Study Sites and Sample Collection Tuberculate ectomycorrhiza (TEM) were collected from roots of P. contorta between May and September of each year from 1997 to 2000 in the Sub Boreal Pine Spruce xeric cold (SBPSxc) biogeoclimatic subzone of the central interior of British Columbia, Canada (Section 1.2). Sampling occurred at three sites across the region (Section 1.2, Fig. 1) in forest stand age classes ranging from, class 2 (< 40 years old) to class 8 (> 140 years old) (Appendix B, Table B-1, Appendix C, Figs. C - l a, C-lb). Pinus contorta roots with T E M attached were excised from. 23 within and under coarse woody debris (CWD) from one of the three sampling sites during each trip (Figs. 2.1a, 2.1b). Half of the roots with attached T E M were severed from the main root systems in the CWD (approx. 10 root systems per sampling trip, roughly 5 to 10 cm in length) and kept moist in plastic bags containing damp paper towels for transport back to the laboratory. Tubercles were separated by hand from the remaining half of the roots and placed in sterile Eppendorf tubes on ice for transportation back to the laboratory. Approximately 50 tubercles were collected in this manner per sampling trip. i ' ' 0 Hi' H H HBH IHHHH : Figure 2.1: A) Tuberculate ectomycorrhizal root (arrow) excavated from within coarse woody debris in Pinus contorta stands of the Sub Boreal Pine Spruce xeric cold in central British Columbia. B) Tubercles found on Pinus contorta roots under woody debris on top of the mineral soil layer. 24 2.2.2 Morphological Analysis: TEM Characterisation Gross morphological analysis of T E M attached to roots and separated from roots was conducted using dissecting and light microscopes. Characterisation was based on T E M colour, surface texture and the presence or absence of emanating hyphae and rhizomorphs. Microscopic analysis of mycorrhizal root tips within tubercles was conducted using a compound light microscope. Characterisation of the root tips was based on colour, surface texture, mantle structure, presence of the Hartig net and presence of emanating hyphae (Agerer 1987). Morphological analysis was done once in 1997 and once in 1999 using 10 host roots with T E M clusters attached each time. 2.2.3 Molecular Analysis: Sample Preparation for DNA Extraction Fresh tubercles were surface cleaned by gently agitating in 0.1 M phosphate buffer (pH 7.0) for 1 minute to remove excess soil and woody debris particles. After surface washing, all subsequent preparation was conducted under sterile conditions in a laminar flow hood. Samples were air-dried for 15 minutes until tubercle surfaces were free of excess water droplets. Single tubercles were then dissected by teasing open, into halves, using forceps. Each half was mounted onto a microscope slide using mounting wax with the exposed inner tissue facing up. Root tips and internal hyphae were aseptically removed from each section and placed into five sterile Eppendorf tubes (Fisher Scientific). In each of the five tubes, a total wet weight of 10 mg of root tips and inner hyphae were collected from 5-10 tubercles depending upon size of each tubercle. 2.2.4 DNA Extraction Fungal D N A was extracted using the methods outlined in Gardes and Bruns (1993) with some modifications. The five composite samples of T E M tissue were homogenised in 1.5 ml 25 Eppendorf tubes with 600 pi of 2% CTAB lysis buffer (100 mM Tris-HCl, 1.4 M NaCl, 20 mM EDTA, 2% CTAB, 0.2% P-mercaptoethanoL pH 7.5) and heated to 65°C for 1.5 hours. The homogenate was centrifuged at 10,000 rpm for 5 minutes and the supernatant was collected. The supernatant was combined with an equal volume of chloroform and mixed using a vortex. The mixture was centrifuged at maximum speed for 8 minutes. The upper phase was collected and the D N A was precipitated by mixing with 2 volumes of ice-cold isopropanol, briefly vortexing and letting stand on ice for 30 minutes. To pellet the DNA, samples were centrifuged for 25 minutes. The supernatant was discarded and the pellet was washed with 200 pi of 70% ice-cold ethanol. The ethanol was poured off after centrifuging for 5 minutes at 6,500 rpm. The pellet was allowed to air-dry and then re-suspended in lOOul O.lx TE buffer (ImM Tris-HCl, 0.1 M E D T A pH 8.0). 2.2.5 PCR Amplification and Gel Electrophoresis Amplification of the fungal internal transcribed spacer (ITS) region was accomplished using the primers ITS 1 -F ( C T T G G T C A T T T A G A G G A A G T A A ) and ITS4-B ( C A G G A G A C T T G T A C A C G G T C C A G , Bruns etal. 1990). Prior to amplification, the extracted D N A templates from section 2.2.4 were diluted 1:10 with autoclaved Mil l iQ (Millipore, Bradbury, M A , USA) water before use. Of the 50ul total volume for the PCR reaction mixture, 25pl of diluted D N A template and 5^ 1 of lOx Taq polymerase buffer was used. The remaining components of the PCR mixture contained final concentrations of 200 uM of each dATP, dCTP, dGTP and dTTP (Amersham Biosciences, Sunnyvale, CA, USA), 25 mM MgCl 2,1.25 U of High Fidelity Taq polymerase (Sigma-Aldrich, St. Louis, MO, USA) and 10 uM of each primer per reaction tube. The remaining volume was made up with Mil l iQ water. A l l PCR reactions were conducted using a Gene Amp PCR 2400 cycler (Perkin Elmer, Wellesley, M A , USA). The initial denaturing temperature was 94°C for 1.5 minutes followed by 35 cycles of denaturing, 26 annealing and extension. The temperatures and times for the 35 cycles were 94°C for 15 s, 50°C for 30 s and 72°C for 60 s. Once the final cycle was complete, the samples were kept at 72°C for an additional 7 minutes. To verify amplification of fungal DNA, 5 pi of each PCR reaction were run on 1% (w/v) agarose gel in 0.5 X TBE buffer (44 mM Tris-borate (pH 8), 44 mM boric acid, 2 mM EDTA-Na 2) for 1.5 hrs at MOV. Gels were subsequently stained in ethidium bromide (0.01 pg l"1) baths for 15 min and visualised in a Gel Doc 2000 imaging cabinet (BioRad, Hercules, CA, USA) and documented using GelDoc and Quantity One 4.1.0 software (BioRad, Hercules, CA, USA). 2.2.6 DNA Sequencing The samples from section 2.2.5 were cleaned using a QIAGEN, QIAquick PCR purification kit (Qiagen Inc., Valencia, CA, USA). Once cleaned, the five samples were re-amplified by running a ABI PRISM™ Big Dye Terminator Cycle Sequencing Ready Reaction kit (PE Applied Biosystems, Foster City, CA, USA) on a Gene Amp PCR 2400 cycler using the forward (ITS1-F) and reverse (ITS4-B) primers separately. The reaction protocol used was 25 cycles of 96°C for 10 s, 50°C for 5 s and 60°C for 4 min. After the last cycle, samples were held at 4°C until ready to purify. The amplified products were purified by combining 1 pi of 3 M sodium acetate, 25 pi of 95 % ethanol and 10 pi each of the amplified products. The samples were mixed by gently vortexing, and then put on ice for 10 minutes to precipitate the extension products. Once precipitated, the samples were centrifuged for 25 minutes at maximum speed (13000 rpm). The supernatant was carefully removed and the pellet was washed with 250 pi of 70% ethanol. The samples were mixed briefly using a vortex, and the ethanol was carefully aspirated. The pellet was air-dried and re-suspended in 25 pi of Big Dye analysing buffer (PE Applied Biosystems, Foster City, CA, USA). The sequence mixtures were heated for 2 minutes at 96°C and placed back on ice. Sequencing was conducted on an ABI Prism model 310 gene 27 analyser (Perkin Elmer, Wellesley, M A , USA). The two-directional sequences from each sample were analysed and aligned using Sequence Navigator software (PE Applied Biosystems, Foster City, CA, USA). Sequences were subjected to a B L A S T search (Altschul et al. 1990) in the GenBank database (National Center for Biotechnology Information, NCBI , USA). Matches of 98% or better were considered to be positive species identification. 2.3 R E S U L T S 2.3.1 Gross Morphology of Tubercles and Rhizomorphs A l l T E M collected from P. contorta showed similar macroscopic features and are tuberculate in form (Fig. 2.2 & 2.3). Excavated roots had tubercles that varied in shape from irregularly spherical, globose, to ovoid (Fig. 2.2 & 2.3). Tubercles that develop in fissures in decayed wood or pressed between decayed wood and the soil are often flattened and ovoid in shape (Fig. 2.4a). Typical tubercle sizes range from 0.5 mm-8 mm x 0.3 mm-9 mm with an average size of 4 mm x 5 mm. On occasion, a tubercle was measured to be 12 mm in diameter. Figure 2.2: Tuberculate ectomycorrhizae on Pinus contorta roots, external gross morphology of tubercles and rhizomorphs. Brown particles are woody debris artefacts appressed to surface. Notice cottony surface texture, pink colour and rhizomorphs. Scale bar equals 5 mm. 28 Figure 2.4: External view of tuberculate ectomycorrhizae on Pinus contorta roots. (A) Showing flattened turbercles found in fissures and cracks of woody debris. (B) Showing senescing older tubercles on host root, black to dark grey in colour (1) with newly forming immature tubercles forming adjacent, white-pink in colour (2). Scale bar equals 5 mm. 29 In early development, they are white to snow white in colour, changing to white-pink, off white-rose or off white-pink when fully developed. Senescing or dead tubercles have a typical grey-black to brown-black colour (Fig. 2.4b). When the tubercle is young, the root tips are covered loosely by a thin veil of hyphae, which gives the tubercle a velvety, transparent look (Fig. 2.5). The root tips can be easily seen through the loose hyphae (Fig. 2.5). When the tubercle is more developed, the outer layers of hyphae thicken and cover the root tips by a firm sheath (peridium) of hyphae that has a cottony, smooth texture (Fig. 2.2). The root tips can no longer be seen through the hyphae and the overall appearance is somewhat like a root nodule or pea. Tubercle surfaces stain purple when exposed to 15 % K O H . The peridium can be easily separated from the tubercle, which reveals the clustered root tips and loose interstitial hyphae in the spaces between the tips (Fig. 2.6). The interstitial hyphae are white-pink to clear white and are intertwined randomly between the root tips. The texture of the interstitial hyphae is like cotton or felt. There can be anywhere from 10 to 120 root tips within a tubercle depending upon Figure 2.5: External view of developing immature tubercle on Pinus contorta with mycorrhizal elements showing through hyphal veil of developing peridium. Scale bar equals 1.5 mm. 30 the size. The internal orientation of root elements in tubercles usually show a pinnate radiated fan form, which is a derived from a single main rootlet (Fig. 2.6). Root tips are usually dichotomously branched within the tubercle with a low degree of entanglement (Fig. 2.6) and have a brown to dark orange-brown colour. A l l root tips are mycorrhizal within the tubercle and have the typical ectomycorrhizal mantle present. The mantle is usually similar in colour to that Figure 2.6: Cross section through a mature tubercle from Pinus contorta showing mycorrhizal elements (dark brown) and interstitial hyphae (arrow). Notice pinnate radiated fan form and dichotomos branching arrangement of TEM rootlets. Peridium has been peeled away. Scale bar equals 2 mm. Figure 2.7: Cross section through senesced tubercle from Pinus contorta. Desiccated mycorrhizal elements show hollowing and degeneration (1). Desiccated hyphae appear black and shrunken (2). Scale bar equals 1 mm. 3 1 of the tubercle but has a tendency to be slightly more silvery-white. The interstitial hyphae are connected between the hyphae of the root tip mantles and those of the peridium so that there is a continuous but differentiated net of hyphae from root tip to peridium. Root tips and hyphae of senescing or dead tubercles have a typical desiccated appearance with the root tips being hollow, dry and dark brown, and the hyphae are dry, shrunken and grey-black (Fig. 2.7). Rhizomorphs are common and range in size from 0.1 mm to 0.5 mm in diameter and emanate from restricted points at a flat angle from the base of tubercles (Fig. 2.2 & 2.8). Rhizomorphs branch extensively and extend along roots to neighbouring tubercles and into the surrounding soil environment (Fig 2.8). The texture of rhizomorphs is similar to that of the peridium of mature tubercles. Newly developed rhizomorphs are white to pale white and have a loose ovoid structure. More developed rhizomorphs have a firm, more dense tube like structure with a smooth, cottony surface like that of the peridium. The colour of mature rhizomorphs is off-white to cream and appears consistent along the whole length of the cords. The outer hyphal Figure 2.8: Tubercles of Pinus contorta showing rhizomorphs emanating at the base (1) of tubercles and growing along the surface (2). Transverse rhizomorphs connect tubercles along the host root (3). Scale bar equals 5 mm. 32 sheath of rhizomorphs is continuous with the peridium of tubercles (Fig. 2.2). Rhizomorphs stained deep purple when exposed to 15 % KOH. Finer mycelial strands also develop between tubercles on lateral roots and range between 0.01 to 0.1 mm in diameter. They have a white to off-white colour with a more cottony texture than rhizomorphs. 2.3.2 Microscopic Morphology of Tubercles and Rhizomorphs The peridium of tubercles on P. contorta consists of prosenchymatous hyphae that form the firm, smooth texture of the mature tubercle surface (Fig. 2.9). The peridium has two layers, the outer layer is composed of hyphae that are loosely interwoven, with some hyphae emanating from the peridium surface, giving the overall cottony appearance of tubercles (Fig. 2.9). Figure 2.9: Cross section through Pinus contorta tubercle showing two root tips (R) joined by a common ectomycorrhizal mantle (M). Interstitial hyphae (I) extend between root tips and the inner layer of the peridium (P), which covers the tubercle. Exudates (E) can be seen amongst the outer layer of hyphae of the peridium. The outer layer of hyphae extend outward from the surface of the peridium, giving the tubercle a cottony appearance. Scale bar equals 200 urn. 33 The inner layer of the peridium consists of tightly intertwining hyphae that form a dense layer of hyphae surrounding the mycorrhizal root tips. Within the inner layer of the peridium, there is a zone with extensive extracellular deposits that are brown-pink to brown-rose in colour (Fig. 2.10). This extracellular material appears to be closely related to the hyphae of the lower most layer of the peridium (Fig. 2.9 & 2.10). The peridium thickness ranges in size from 100 pm to 220 pm. Hyphae from both layers of the peridium have the same diameter, between 4 to 6 pm in thickness. Just below the peridium is the zone of interstitial hyphae that connect between the peridium and the mantles of the mycorrhizal root tips (Fig. 2.9). These hyphae resemble the hyphae of the peridium but are smaller in diameter, 2 to 3 pm in thickness and are loosely woven in an unorganised way. Occasionally, there are spaces amongst the interstitial hyphae (Fig. 2.9). Hyphae from the mantles of mycorrhizal root tips close to the surface of the tubercle may also be continuous with the hyphae of the peridium. The mantles of the mycorrhizal root tips within tubercles have two layers of organisation, the outer and inner layers. The outer mantle layer is felt prosenchyma and is 25 to Figure 2.10: Inner layer hyphae of the peridium from tubercles on Pinus contorta roots showing exudate material associated with the hyphae. Scale bar equals 20 pm 34 50 um in thickness (Fig. 2.9 & 2.11). There are many emanating hyphae from the mantle (interstitial hyphae). The hyphae of the outer mantle are 3 to 5 um in width and 17 to 21 pm in length and the presence of matrix material is low to moderate (Fig. 2.12). The matrix material appears to be composed mainly of exudates from the hyphae. The exudate is globular, gold-pink to pink-rose in colour and range in size from < 0.5 pm to 5 pm in diameter and stains purple in K O H . Septa in the outer mantle hyphae are common, and are without clamps (Fig.2.12). Hyphal junctions within the mantle are rare to common with two typical angles of connection, 30° and 120°. Anastimosis is rare to common with the typical form being "Ff" shaped without clamps. Other junctures occur having two hyphae connected to a third hyphae in a " Y " configuration. The inner mantle layer is net prosenchyma and is 30 to 55 pm in thickness (Fig. 2.9 and 2.11). The hyphae are 3 to 4 um in diameter and 15 to 20 um in length. There is no matrix material in the inner mantle. Septa are common in the inner mantle with no clamp connections. Figure 2.11: Cross section through ectomycorrhizal root tip from within a Pinus contorta tubercle. The mantle is comprised of two layers, the outer layer (OM) and the inner layer (IM). The Hartig net can be seen extending down 3 layers of the cortex (H). Scale bar equals 125 pm. 35 Figure 2 .12: Hyphae of the outer mantle showing exudates (*) associated with the hyphae and connections without clamps (C). Scale bar equals 25 pm. The well-formed fungal Hartig net extends from the epidermis through three cortical cell layers to the endodermis (Fig. 2.11 & 2.13). It does not penetrate the endodermis. The hyphae of the Hartig net surround the cortical cells and cover them with finger like projections of hyphae that fan out over the cell surface labyrinth like (Fig. 2.14). The thickness of the Hartig net between the cortical cells is 5 to 8 pm and is composed of one to several intertwined hyphal layers (Fig. 2.14). Hyphae of the Hartig net are 1 to 2 pm in thickness, have thin cell walls and do not have clamp connections (Fig. 2.14). Microscopic analysis of rhizomorphs shows that there are three levels of hyphal arrangement (Fig. 2.15 & 2.16). The outermost layer consists of prosenchymatous random hyphae that give the rhizomorphs a cottony appearance (Fig. 2.15 & 2.16). The hyphae are commonly septate and are 2 to 4 pm in diameter. There are no clamp connections or anastimosis but the junctions between hyphae are bulged or knuckled in appearance (Fig. 2.15). The middle layer consists of pseudoparenchymatous hyphae that form a dense layer between the outer hyphae and the central core hyphae (Fig. 2.15). Clamps and septa in this layer were not perceptible. The inner most layer consists of large swollen vessel hyphae massed together 36 Figure 2.13: Cross section through ectomycorrhizal root tip from within Pinus contorta tubercle, showing Hartig net surrounding three layers of cortical cells (purple) as well as outer epidermal cells. The Hartig net penetrates up to but not into the endodermis. Scale bar equals 50 pm. Figure 2.14: Cross section through an ectomycorrhizal root tip from a Pinus contorta tubercle, showing the finger-like hyphae of the Hartig net surrounding the cortical cells (arrows). Notice the dense aggregation of the Hartig net hyphae between the cortical cells. Scale bar equals 10 pm. 37 Figure 2.15: Cross section through a rhizomorph from Pinus contorta tuberculate ectomycorrhizae showing three layers of cellular organisation. Outer hyphae (O), middle hyphae (M) and vessel hyphae of the central core (V). Scale bar equals 50 pm. to form a central core (Fig. 2.15 & 2.16). These hyphae range in size from 6 to 20 pm in diameter and have thickened cell walls (Fig. 2.15). Septa are present but there were no anastimosis or clamp connections. 2.3.3 PCR Amplification and DNA Sequencing Amplification of the ITS-region of T E M from P. contorta yielded PCR products of 680 bp. Five composite tuberculate samples were analysed by sequencing. Sequences were compared to those present in GenBank using the Internet alignment search tool, B L A S T search (NCBI). Four of the five sequences were identified to species: Suillus tomentosus (Kauffm.) Singer, Snell and Dick, 99% similar to gb U74614 over 672 bp (Appendix B, Fig.B-1). The next closest matches were Suillus sp., 97% similar to emb AJ272405 over 670 bp and Suillus varigatus (Sow.: Fr.) Kuntze, 96% similar to emb AJ272418 over 668bp. One sample was identified to the genus Suillus (97% similar to emb AJ272405 over 672 bp) with the next closest match being S. tomentosus (95% similar to emb U74614 over 665 bp). 38 Figure 2.16: Horizontal section through rhizomorph from Pinus contorta tuberculate ectomycorrhizae showing emanating hyphae of the outer layer (O), more densely packed middle layer (M) and vessel hyphae running down the central core (V). Scale bar equals 250 pm Parsimony analysis of the 5 T E M sequences obtained supports the identification of the T E M on P. contorta in the study are as S. tomentosus and not other Suillus species (Appendix B , Fig. B-2). 2.4 DISCUSSION Tuberculate ectomycorrhizae on P. contorta are similar in general morphology to descriptions of T E M on E. pilularis (Dell et al. 1990), Pseudotsuga menziesii (Mirb.) Franco (Massicotte et al. 1992, Trappe 1965, Zak 1971), C. borneensis (Haug et al. 1991), E. roxburghiana (Haug et al. 1991), and P. glabra (Grand 1971). T E M of all of these species are anatomically similar in shape, size, the presence of a peridium, abundant mycorrhizal root tips enclosed by a peridium and to some degree, the presence of rhizomorphs. However, P. contorta tubercles differ in some ways from the other species. For example, the mycorrhizal root tips within tubercles of E. pilularis are arranged in an highly intertwining fashion (Dell et al. 1990) whereas mycorrhizal tips within tubercles of P. contorta are arranged in pinnate radiated fans, 39 with a low degree of entanglement, similar to that of tubercles on P. menzesii. In fact, the arrangement of mycorrhizal root tips within tubercles of E. pilularis is unique and differs from all of the other species in a similar way. The peridium of E. pilularis tubercles also differs from that of tubercles on P. contorta in hyphal arrangement and density. Hyphae of the peridium of E. pilularis tubercles are arranged in two layers with the outer layer being the most dense and tightly interwoven. The inner layer of hyphae of E. pilularis is less dense and more loosely associated. This contrasts with the peridium of P. contorta tubercles where the outer layer consists of loosely associated, emanating and less dense hyphae, whereas the inner layer consists of tightly interwoven, more dense hyphae. The peridium arrangement of P. contorta is essentially reversed compared to that of tubercles on E. pilularis. Another feature that is obviously different between T E M of P. contorta and T E M of E. pilularis is rhizomorph development. Rhizomorphs of E. pilularis tubercles are present within the tuberculate structure, usually associated roots that become a part of the rhizomorph (Dell et al. 1990). These rhizomorphs are located between mycorrhizal root tips within the interstitial tissue of the tubercle. This characteristic is a unique variation of E. pilularis T E M structure and differs from all other species of T E M including those of P. contorta. Rhizomorphs of other T E M and P. contorta tubercles are not present within the tubercle but instead originate on the surface, usually near the base of the tubercle where the host root penetrates the structure. Rhizomorphs of other T E M and of P. contorta tubercles connect between tubercles on adjacent roots and also penetrate out into the environment that surrounds the host roots. In addition, they contain large diameter hyphae, termed vessel hyphae (Foster 1981, Fox 1987), in the centre of the strands which are thought to be able to transport solutes and water between mycorrhizal elements (Duddridge et al. 1980). T E M of E. pilularis differ from P. contorta T E M rhizomorphs in that they do not contain these vessel hyphae, but more compact hyphae whose function is still uncertain. 40 From the observed differences between T E M on P. contorta and those on E. pilularis, it can be inferred that they are not the same and this most likely due to the tree species being different with different fungal symbionts. Tubercles of P. contorta also differ from Rhizopogon vinicolor A. Ff. Sm., tubercles on P. menzesii. Interstitial hyphae within tubercles of R. vinicolor contain distinctive amorphous deposits that are unique to this species (Dominik 1963, Massicotte etal. 1992, Zak 1971). The deposits are believed to be calcium oxalate crystals that may play a role in the separation of the peridium from the tubercle (Massicotte et al. 1992). Interstitial hyphae of tubercles on P. contorta do not contain calcium oxalate crystals, however, droplets, possibly hyphal exudates, were observed associated with the hyphae of the peridium. This observation appears to be unique to tubercles of P. contorta since no other species of described tubercle have this unusual characteristic. The droplets likely originate from the hyphae of the peridium but further analysis would need to be conducted to confirm this. As well, the function of these droplets is not known and also requires further research. Zak (1971) also mentions that hyphae within the interstitial space of R. vinicolor tubercles have clamp connections. Clamp connections were not observed in hyphae from any region of tubercles of P. contorta or in hyphae of the rhizomorphs. Mature R. vinicolor tubercles usually have a brown-black to black colour (Trappe 1965, Zak 1971) whereas mature tubercles of P. contorta have a cream-rose to off-white pink colour. It is therefore likely that the fungal symbiont of T E M on P. contorta is not R. vinicolor. Other species of T E M also differ in colour from P. contorta tubercles. Tubercles on P. glabra are creamy-white coloured (Grand 1971) and tubercles on C. borneensis and E. roxburghiana are brown in colour (Dell et al. 1990). Another difference between tubercles on C. borneensis and tubercles on P. contorta can be observed in the development of the Hartig net within mycorrhizal root tips within the tubercle. The Hartig net in tubercles of C. borneensis is only established between the elongated cells of the epidermis (Dell et al. 1990). This is very 41 different from the Hartig net in tubercles of P. contorta and all other tubercle mycorrhizae reported. The Hartig net of P. contorta tubercles extends two to three cell layers deep within the cortex. This type of development is more common and can vary between species by the number of cortical cell layers that are infected. One species of T E M that is similar in colour to tubercles on P. contorta is Suillus pictus (Peck) A. H. Sm. and Thiers, T E M on P. strobus. S. pictus tubercles have been described to be pale ochraceous buff to ochraceous salmon in colour (Randall and Grand 1986). This colour range is the closest to the colour range of tubercles on P. contorta, being cream-rose to off-white pink in colour. S. pictus tubercles are also similar to P. contorta tubercles with respect to the . development and structure of the peridium, interstitial hyphae, mycorrhizal mantles and the Hartig net within mycorrhizal root tips. Other features that were similar to both species are the texture qualities of tubercles, being firm and cottony or woolly and the purple staining reaction of the tubercle peridium of both species when exposed to 10 % K O H . Rhizomorph structural characteristics are also similar between the two species. Both rhizomorph types have their origin from the base of tubercles, and contained vessel hyphae covered by a layer of loosely intertwined hyphae. Rhizomorph textural qualities and staining reactions to 10% K O H were also analogous. Although P. strobus tubercles and P. contorta tubercles are broadly similar, there are a couple of differences between them. In S. pictus tubercles, clamp connections are present on interstitial hyphae, a feature which is not observed for P. contorta. Furthermore, rhizomorphs and tubercles of & pictus are the same colour, whereas rhizomorphs from P. contorta T E M are different in colour from the tubercles. Morphological analysis can be a useful tool when trying to identify T E M but it is an incomplete tool. There are enough morphological differences between P. contorta tubercles and tubercles from E. pilularis, P. menzesii, C. borneensis and E. roxbughiana to distinguish the 42 fungal symbiont of P. contorta tubercles from the fungal symbionts of those species and rule them out as possible matches. However, the limited description of tubercles on P. glabra, precludes ruling out a positive morphological match to that of tubercles on P. contorta. The only difference noted in this thesis between tubercles of P. glabra and tubercles of P. contorta is a slight variation in colour of the peridium. P. glabra has a creamy-white colour compared to the off-white pink colour of P. contorta T E M . A l l other features described for tubercles on P. glabra are similar to tubercles on P. contorta. That is, the size of the tubercles, shape, presence of peridium and number of mycorrhizal root tips within tubercles. While the absence of rhizomorphs could be used to differentiate P. glabra T E M from P. contorta T E M , Grand (1971) suggest that the lack of rhizomorphs could be correlated with the over maturity of the tubercles at the time of collection. No more information on P. glabra is available. Since most of the morphological characteristics of tubercles on P. strobus are similar to P. contorta tubercles, it would be reasonable to conclude that the T E M on P. contorta are formed by the fungal genus Suillus. It is less reasonable to suggest similarity to the species level (S. pictus), because of the noticeable differences that exist. In addition, the identification of the fungal symbiont of tubercles on P. strobus was based on morphological comparison of fungal cultures from tissue samples originating from tubercles and from fruiting bodies of S. pictus in the area where the tubercles were collected (Randall and Grand 1986). Since morphology of fungal cultures can be very similar from one fungal species to another, use of morphological analysis alone may not ensure a high degree of accuracy. The D N A sequence analysis described in this thesis supports the conclusions based on morphological inspection that the fungal symbiont of P. contorta T E M is not S. pictus. The sequence data are consistent with P. contorta T E M formation by the fungal species Suillus tomentosus. Parsimony analysis of the sequence data confirmed that all of the T E M samples sequenced in this thesis were S. tomentosus and not another species of Suillus. 43 It becomes obvious that descriptions of mycorrhizae by morphological analysis is useful and has merit for initial identification to the genus level. Due to the difficulties encountered in this thesis differentiating T E M to the species level using morphological analysis alone, I would recommend using molecular analysis to identify mycorrhizae to the species level. Morphological evaluation may be useful for relatively quick and inexpensive analysis when processing numerous samples or identifying samples in the field. If verification is necessary, molecular analysis could be performed on a few samples taken from field sites and noted along side the morphological analysis of the species. Combinations of morphological and molecular data provide a more effective basis for species identification. An example of such combination is the recent study conducted by Olsson et al. (2000), who used RFLP as the main tool for identification and combined it with a brief morphological analysis to identify the species of T E M on P. sylvestris in Sweden. However, RFLP is not the most discriminating method of molecular identification and use of D N A sequencing is replacing RFLP analysis. With current advances in D N A sequencing, it has become a viable, quick and accurate identification method that rivals most available current techniques. With automated D N A sequencing tools, the procedure has become routine and economical with a high degree of accuracy (Marlowe et al. 2000). Direct D N A sequencing is easily standardised because it is a simple enzymatic process that does not depend on living samples (Gyllensten and Allen 1995). In addition, only a single sequence needs to be determined for each sample. Computerised sequence databases have been compiled to catalogue information on numerous species of ectomycorrhizal fungi. These sequence databases are now available through the Internet and allow researchers to look for relatedness between isolates, identify sequences and translate a D N A sequence into its potential protein coding regions. A l l of these reasons have made D N A sequencing the preferred technique for identification of ectomycorrhizal species. 44 Though much more reliable than simple morphological characterisation, D N A sequencing is not a perfect technique for species identification. Individual PCR products can differ from the sequence that is to be amplified through in vitro recombination during the PCR as well as by point mutations (Saiki et al. 1988a, 1988b). This study, therefore, recommends the used of molecular analysis, with emphasis on D N A sequencing, in conjunction with morphological analysis to characterise and identify T E M . Morphological analysis should be used as tool to quickly identify ectomycorrhiza to the genus level followed by D N A sequence analysis to identify the species, when necessary. Incorporating the two methods will ensure more accurate identifications in the future and may elevate any previous and future confusion of individual specificity with host plants. Previous studies of T E M could be re-visited and have D N A sequences analysed to verify the identifications that have been based on morphological analysis. Upon identification of the fungal component of P. contorta T E M to the species S. tomentosus using D N A sequencing, further isolations of this fungus for use in the rest of the thesis work were identified by familiar growth characteristics of the fungus on growth media. A l l isolations were done from S. tomentosus T E M in a similar fashion and as isolates developed, characteristics such as color, isolate texture, and growth rate were used to identify each isolate as S. tomentosus from experience with the fungus developed during this thesis. 45 2.5 R E F E R E N C E S Agerer, R. 1987. Colour Atlas of Ectomycorrhizae. Einhorn-Verlag Eduard Dietenberger, Schwabisch Gmund. Agerer, R. 1995. Anatomical characteristics of identified ectomycorrhizas: an attempt towards a natural identification. In: Mycorrhiza: Structure, Function, Molecular Biology and Biotechnolog. Eds. Varma, A.K. and Hock, B. Springer. Berlin, pp. 685-734. Agerer, R. 1996. Ectomycorrhizae in the fungar community: with special emphasis on interactions between ectomycorrhizal fungi. In: Mycorrhizas in Intergrated Systems from Genes to Plant Development. Eds. Azcon-Aguillar, C. and Barea, J.M. Brussels, pp. 52-57. Altschul, S.F., Gish, W., Miller, W., Myers, E.W., and Lipman, D.J. 1990 Basic local alignment search tool. Journal of Molecular Biology. 215:403. Amicucci, A., Zambonelli, A., Giomaro, G., Potenza, L. and Stocchi, V. 1998. Identification of ectomycorrhizal fungi of the genus Tuber by species-specific ITS primers. Molecular Ecology 7: 273-277. Bruns, T.D., Fogel, R. and Taylor, J. W. 1990. Amplification and sequencing of D N A from fungal herbarium specimens. Mycologia. 82: 175-184. Bruns, T.D., Szaro, T.M., Gardes, M . , Cullings, K.W., Pan, J.J., Taylor, D.L., Horton, T.R., Kretzer, A. , Garbelotto, M . and Liss, Y . 1998. A sequence database for the identification of ectomycorrhizal basidomycete by phylogenetic analysis. Molecular Ecology 7: 257-272. Chumak, N.F. 1981. Mycorrhizae formed by fungi of the genus Suillus in Scotch pme-Pinus sylvestris. Mikoloya i Fitopatologiya 15(3): 202-207. 46 Dell, B., Malajczuk, N . and Thompson, G.T. 1990. Ectomycorrhiza formation in Eucalyptus. V . A . tuberculate ectomycorrhiza of Eucalyptus pilularis. New Phytologist 114: 633-640. Dominik, T. 1963. Occurrence of Douglas-fir (Pseudotuga taxifolia Britton) in various Polish stands. Prace Insty'tutu Badawczego Lesnictwa 258: 29-59. Dominik, T. and Majchrowicz, I. 1967. Studies on the tuberculate mycorrhizae of Douglas-fir (Pseudotsuga taxifolia Britton). Ekologia Polska, SeriaA 15(3): 75-90. Duddridge, J.A., Malibari, A. and Read, D.J. 1980. Structure and function of mycorrhizal rhizomorphs with special reference to their role in water transport. Nature 287: 834-836. Erland, S. 1995. Abundance of Tylospora fibrillosa ectomycorrhizas in a South Swedish spruce forest measured by RFLP analysis of the PCR-amplified rDNA ITS-region. Mycorrhizal Research 99: 1425-1428. Foster, R.C. 1981. Mycelial strands of Pinus radiata D. Don ultrastructure and histochemistry. New Phytologist 88:705-712. Fox, F . M . 1987. Ultrastructure of mycelial strands ofLeccinum scabrum, ectomycorrhizal on birch (Betula spp.). Transactions of the British Mycological Society 89(4): 551-560. Gardes, M . and Bruns, T.D. 1993. ITS primers with enhanced specificity for Basidiomycete -application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113-118. Gardes, M . and Bruns, T.D. 1996. ITS-RFLP matching for identification of fungi. In: Methods of Molecular Biology. Ed. Clapp, J. Vol. 50. Humana Press Inc. Totowa, NJ Goodman, D., Durall, D., Trofymow, T. and Berch, S. 1998. A manual of concise descriptions of North American ectomycorrhizae. Mycorrhiza 8:57-59. 47 Grand, L.F. 1971. Tuberculate and genoccocum mycorrhizae of photinia (Rosaceae). Mycologia 63: 1210-1212 Gyllensten, U.B. and Allen, M . 1995. Sequencing of in Vitro amplified DNA. In: Recombinant DNA Methodology II. Ed. Wu, R. Academic Press, San Diego, pp. 565-579. Haug, I., Weber, R., Oberwinkler, F. and Tshen, J. 1991. Tuberculate mycorrhizas of Castanopsis borneensis King and Engelhardtia roxburghiana Wall. New Phytologist 117:25-35. Ingleby, K., Mason, P.A., Last, F T . and Fleming, L .V . 1990. Identification of ectomycorrhizas. Research Publication No. 5. Institute of Terrestrial Ecology, Natural Environment Research Council, London. Mahmood, S. Finlay, R.D. and Erland, S. 1999. Effects of repeated harvesting of forest residues on the ectomycorrhizal community in a Swedish spruce. New Phytologist 142: 577-585. Marlowe, E .M. , Josephson, K . L . and Pepper, LL . 2000. Nucleic acid-based method of analysis. In: Environmental Microbiology. Eds. R . M . Maier, L L . Pepper and C P . Gerba. Academic Press. San Diego, pp. 287-318. Massicotte, H.B., Melville, L .H. , L i , C Y . and Peterson, R.L. 1992. Structural aspects of Douglas fir [Pseudotsuga menziesii (Mirb.) Franco] tuberclate ectomycorrhizae. Trees 6: 137-146. Mausi, K. 1926. The compound mycorrhiza of Quercuspausidentata. Memoirs of the College of Science. Kyoto Imperial University Series . B2: 161-187. 48 Melin, E. 1923. Experimentelle Untersuchungen uber die Konstitution und Okologie der Mycorrhizen von Pinus sylvestris L. und Picea abies (L.) Karst. Mycologische Untersuchungen und Berichte 2: 73-331. Olsson, P.A., Munzenberger, B., Mahmood, S. and Erland, S. 2000. Molecular and anatomical evidence for a three-way association between Pinus sylvestris and the ectomycorrhixal fungi Suillus bovinus and Gomphidius roseus. Mycological Research 104(11): 1372-1378. Randall, B.L. and Grand, L.F. 1986. Morphology and possible mycobiont (Suilluspictus) of a tuberculate ectomycorrhiza on Pinus strobus. Canadian Journal of Botany 64: 2182-2191. Saiki, R.K., Gelfand, D.H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G.T., Mullis K B . and Erl ichH. 1988a. Primer-Directed Enzymatic Amplification of D N A with a Thermostable D N A Polymerase. Science 239:487-491 Saiki, R.K., Gyllensten, U.B. and Erlich, H.A. 1988b. The polymerase chain reaction. In: Genome Analysis: A Practical Approach. Ed. Davies, K .E . IRL Press. Oxford, U K pp. 141-152. Trappe, J.M. 1965. Tuberculate mycorrhizae of Douglas-fir. Forest Science 11:27-32. Wintzingerode, F.v., Gobel, U.B. and Stackebrandt, E. 1997. Determination of microbial diversity in environmental samples: pitfalls of PCR-based rRNA analysis. FEMS Microbiology Reviews 21:213-229. Zak, B. 1971. Characterization and classification of mycorrhizae of Douglas fir. U. Pseudotsuga menziesii + Rhizopogon vinicolor. Canadian Journal of Botany 49: 1079-1084. Zak, B. 1973. Classification of ectomycorrhizae. In: Ectomycorrhizae. Eds. Marks, G.C. and Kozlowski 49 Chapter 3 Suillus tomentosus Tuberculate Ectomycorrhizal Abundance and Distribution in Pinus contorta Woody Debris 3.1 I N T R O D U C T I O N Coarse woody debris (CWD) has been recognised as an important structural and functional feature in various forest stands in the western boreal forests of North America (Maser and Trappe 1984, Freedman et al. 1996). In conifer forests, CWD has been reported to equal or surpass other biomass on or in the forest floor (Harmon et al. 1986). The removal of CWD from forest systems has become a concern in the last 20 years because of the removal of nutrients, energy source and habitat for various organisms (Harmon et al. 1986, Jurgensen et al. 1986). Nutrients such as N and P contained in CWD can account for 1 - 32% of the total above ground storage which can amount to 100 - 244 kg/ha and 5 -13 kg/ha respectively (Sollins et al. 1980, Harmon et al. 1986). Coarse woody debris is a conspicuous feature of these forest stands and is thought to increase biodiversity within the forest because it provides various habitats and is a source of energy during the many phases of its decomposition on the forest floor (Maser and Trappe 1984, Reynolds et al. 1992, Freedman et al. 1996). CWD is important habitat for some species of mammals, insects, fungi, bacteria as well as new seedlings trying to establish within the stand (Maser and Trappe 1984, Harmon et al. 1986, Freedman et al. 1996). Studies by Harvey et al. (1980, 1981, 1987) showed that CWD in advanced stages of decay is an excellent habitat for the establishment and formation of ectomycorrhizae (EM). In fact, the activity of ectomycorrhizae within CWD has been used as a primary indicator of healthy forest soils (Graham et al. 1994). Another form of ectomycorrhiza, tuberculate ectomycorrhizae (TEM) has been reported to commonly occur within and under decaying and rotting CWD partially incorporated into the forest floor (Harvey et al. 1980, Maser and Trappe 1984, Harmon et al. 1986, Jurgensen et al. 1986, Zak 1971). Both forms of mycorrhizae are prolific and active 50 within and under CWD (Harvey et al. 1980, Maser and Trappe 1984, Harmon et al. 1986, Jurgensen et al. 1986, Zak 1971). It has been proposed that ectomycorrhizae are abundant in decaying woody debris for a number of reasons. First, woody debris is important in moisture retention in the forest floor where it provides a suitable habitat for root development and E M formation (Edmonds 1991, Graham et. al. 1994). Second, woody debris may act as a secondary source of carbon for E M growth (Harmon et al. 1986, Edmonds 1991, Graham et al. 1994, Marra and Edmonds 1994). Finally, CWD has been recognised as a reservoir for important nutrients such as N and P, which are essential for mycorrhizal activity as well as other flora (Covington 1981, Grier 1978, Means et al. 1992). Since nitrogen is often a limiting factor for plant growth (Etter 1969,1972, Johnson et al. 1982, Larsen et al. 1978, Bormann et al. 1993), these nutrient reservoirs may be important for soil fertility. Bacteria are also believed to be one of the many types of soil organisms that benefit from CWD debris. The nutrient and moisture regimes within decayed woody debris are believed to be better than soil for the activity of some kinds of bacteria, in particular N 2 - fixing bacteria (Larsen et al. 1978, Harvey et al. 1989, Jurgensen et al. 1984, 1989, 1991, 1992). Extensive research has been conducted on the nitrogenase activity within woody debris (Cornaby and Waide 1973, Sharp and Millbank 1973, Aho et al. 1974, Larsen et al. 1978, McNabb and Geist 1979, Roskoski 1980, Silvester et al. 1982, Jurgensen et al. 1989), using the acetylene reduction assay (Hardy et al. 1968), 1 5 N natural abundance method (Bergersen and Turner 1983, Sheerer and Kohl 1978, Bremer and van Kessel 1990, Sanford et al. 1993, Bolger et al. 1995), and the 1 5 N 2 -isotope method (Burris and Miller 1941). These and other studies have confirmed that woody debris is an important site of nitrogen fixation, with the main causative agent of this fixation being various species of free living N 2-fixing bacteria (Jurgensen et al. 1991, 1992). 51 The presence and activity of N 2-fixing bacteria has also been well documented in woody debris in various stages of decay (Larsen et al. 1978, Silvester et al. 1982, Harvey et al. 1989, Jurgensen et al. 1989). Microbial colonisation of ectomycorrhizae has been demonstrated in numerous studies (Richards and Voigt 1964, L i and Hung 1987, Linderman 1988, Richter et al. 1989, Amaranthus et al. 1990). In some cases, these root-fungal-bacterial associations are thought to be symbiotic, rendering mycorrhizae a tripartite association. Results from this thesis (Chapters 4, 5 and 6) have suggested that symbiotic associations occur with Suillus tomentosus (Kauffm.) Singer, Snell and Dick, T E M and N 2-fixing bacteria within CWD in Pinus contorta var. latifolia (Dougl.) Engelm., stands within the interior of British Columbia. The relationships between the three agents of this symbiosis are not well understood. The objective of this chapter is to characterise ecological information about the occurrence and abundance of S. tomentosus T E M with CWD in P. contorta stands. A secondary objective is to determine if there are any physical features of CWD that influence the occurrence and abundance of S. tomentosus T E M . 3.2 MATERIALS AND METHODS 3.2.1 Study Sites Ecological data regarding S. tomentosus T E M were collected from 3 sites located across the Sub-Boreal Pine Spruce xeric cold (SBPSxc) biogeoclimatic subzone in the Chilcotin Forest district, west of Williams Lake, British Columbia, Canada (Fig. 1.1). This area is in the central interior of British Columbia, Canada and is approximately 1500 m above sea level. At each of the sites, each with unique soil characteristics, samples were collected from two stands of different ages (Table 3.1). This sample design was chosen to determine if either soil type or stand age class properties influenced the occurrence and abundance of S. tomentosus T E M 52 within CWD. The stand age classes sampled were a class 2 (<40 years old, Fig.3.la.), and class 8 (>140 years old, Fig.3.1b, Appendix B, Table B - l & Appendix C, Fig. C - l , C-2, C-3). Each site had unique soil characteristics from the other two sites. At the first site, Alex Graham, the soils were characterised as being dry-sandy loam textured (sub-mesic), derived from basaltic parent material (dry basaltic). Site 2, Puntzi Lake, was characterised by wet-sandy loam textured (mesic) soils derived from basaltic parent material (wet basaltic), and the third site, Nimpo Lake, was characterised by dry-sandy loam textured (sub-mesic) soils derived from granitic parent material (granitic). Data were collected during the summer months (May to September) from 1997 to 1998. As mentioned in Chapter 1, section 1.2, the SBPSxc is characterised by cold, dry winters and hot, dry summers (Mackinnon et al. 1992). Forest floors are typically thin (<4 cm) and decomposition is slow. The soils are nutrient limited with relatively low productivity (Mackinnon et al. 1992). 3.2.2 Coarse Woody Debris Survey Coarse woody debris (CWD) was surveyed in each of the age class stands at each of the sites using the line intersect method (Brown 1974, Brown and Roussopoulos 1974, McRae 1979, and Trowbridge et al. 1987). Briefly, in each of the 6 stands, three isosceles transect triangles were delineated. Each leg of the triangles was 30 m long for a total length of 90 m. Transect triangles were used because changing direction at the end of each 30 m leg eliminated any chance of following linear geographical characteristics in the stand. Table 3.1: Site, biogeoclimatic subzone classification, bedrock, parent material and soil texture from each of the study sites. SBPSxc=Sub Boreal Pine Spruce xeric cold subzone, SL=Sandy Loam. Site Biogeoclimatic Bedrock Parent Material Soil Texture Alex Graham SBPSxc Basalt Morainal SL Puntzi Lake SBPSxc Basalt Morainal SL Nimpo Lake SBPSxc Ganite Glacifluvial SL 53 This ensured a more random, unbiased sample with more representative results from the stand (Trowbridge et al. 1987). The triangle design also facilitated easier implementation of transects by allowing the surveyor to end up back where they started in the stand. Along each transect leg, when a log greater than 7 cm in diameter was encountered, its diameter was measured as well as its location along the transect. In addition, the decay class of logs encountered was assessed using the decay class system developed by Maser et al. (1979). In this system, the decay classes are defined based on rigidity of the logs, bark characteristics and amount of roots in the interior of the log (Table 3.2). The data were compiled and the cubic meters of woody debris per hectare were calculated based on the volumetric formula (A). (A) r v k V L ) where V = the volume in cubic meters/hectare. L = the length of the transect in meters. k = constant to account for length and diameter unit differences, d = the diameter of each log in centimeters. 3.2.3 Tubercle Biomass and Abundance To determine the biomass and abundance of T E M on lodgepole pine roots within CWD, ten logs were selected at random from both of the stand age classes at all three of the research sites. This was done twice during the summer months of each of the years sampled. Table 3.2: Log decay class characteristics for coarse woody debris survey analysis a Characteristics Decay Class Of CWD I n III IV V Bark Intact Intact Trace Absent Absent Texture Intact Intact to Hard large Small soft Soft, fibrous t. partially soft pieces chunky pieces to pulp Shape Round Round Round Round to oval Oval to flat Invading Roots None None Partial Sapwood Heartwood Incorporation Elevated Elevated Sagging near Heartwood on Heartwood Into ground slight sag ground ground aAdapted from Maser and Trappe (1984). 54 Only logs that were greater than 10 cm in diameter were sampled (Fig. 3.2a). This was because logs less than 10 cm in diameter were usually solid, dry and not touching the ground or incorporated into the forest floor. These logs were not favourable habitat for root development and therefore were excluded from the survey. For each of the logs that was sampled, the length and breast-height diameter was measured. Each log was also assessed for decay class attributes (Table 3.2). The logs were then divided into ten equal length sections using a chainsaw. The sections were numbered from one to ten starting at the basal end of the log. From the ten sections, three sections were chosen at random for analysis (Fig. 3.2b, c & d). The sections were characterised for decay class attributes using a modified classification scheme (Appendix B, Table B-2). Figure 3 .1 : Examples of (A) a class 2 stand and (B) a class 8 stand in the Sub Boreal Spruce Pine xeric cold biogeoclimatic subzone study area. 5 5 Length and diameter of each section were also noted. The sections were carefully taken apart to reveal P. contorta roots with T E M attached (Fig. 3.3a, b). Tubercles in each of the sections were separated from roots by hand (Fig. 3.4a, b). Tubercles were counted and collected Figure 3.2: (A) Typical Pinus contorta log selected at random and examined for Suillus tomentosus tuberculate ectomycorrhizae. (B, C & D ) Logs that had been divided into 10 equal sections and the sections being taking apart to count and collect the tuberculate ectomycorrhizae present. 56 for biomass analysis in the laboratory (Fig. 3.5). The collected tubercles from each section were dried in a convection air-drying oven at 70°C for 4 hours and then weighed. Calculations were done using the CWD data and the tuberculate biomass data to determine the biomass of T E M per cubic meter of CWD per hectare. Pearson correlation analysis was also conducted to determine what attributes of the woody debris influences T E M occurrence (Section 3.2.5). Figure 3.3: Suillus tomentosus tuberculate ectomycorrhizae exposed after sections of woody debris have been broken apart. (A) host root with T E M . (B) T E M within CWD, notice mycelia or cords connecting adjacent T E M in both pictures. 57 3.2.4 Soil Analysis Three composite samples of three sub-samples, consisting of 20 cm cores, were collected 8 times during the summer of 1997 and 1998. The samples were air-dried and sent for analysis to BC Ministry of Forest Soil Analysis Laboratory, Glyn Road, Victoria, B .C. Analyses conducted were pH in water, total C, N , S, mineral N0 3 ", NFL/ , available P, S0 4 2 ", CEC and exchangeable cations. Methods of the analysis are given in appendix C. Figure 3.4: Log sections taken apart showing host Pinus contorta roots with Suillus tomentosus tuberculate ectomycorrhizae exposed for collection. (A) a secondary host root removed from within the woody debris with prolific TEM development. ( B ) areas where host roots have been excised from woody debris showing TEM. 58 Figure 3.5: Collection of Suillus tomentosus tubercles from dissected section of coarse woody debris of Pinus contorta stands. 3.2.5 Statistical Analysis Pearson correlation analysis was conducted on the log section data set, which includes the number of tubercles per section, section moisture content, section texture, section root content, section fungal content and the amount each section was incorporated into the forest floor. A two-way (3 x 2) analysis of variance (ANOVA) was conducted to evaluate any effects attributed to site differences (granitic, dry basaltic and wet basaltic) and the two stand age classes (< 40yrs, >140yrs) on the number and biomass of S. tomentosus T E M . Follow-up tests (Post Hoc) were used to evaluate significant main effects and interactions. The least significant difference (LSD) method was used for variables with equal variances and the Dunnett's C method for variables with unequal variance. 59 3.3 R E S U L T S 3.3.1 Coarse Woody Debris Survey Coarse woody debris volumes in both stand ages on all three sites ranged from 46.11 m ha"1 to 128.89 m 3 ha"1 (Table 3.3). Overall, the class 2 stands had higher CWD volumes than the class 8 stands (Table 3.3). The Puntzi Lake site had the highest CWD volume followed by the Alex Graham site and then the Nimpo Lake site (Table 3.3) 3.3.2 Abundance and Biomass of Tubercles The average number of S. tomentosus T E M per cubic meter of CWD for the dry basaltic site, wet basaltic site and granitic site were 225, 315 and 1008 respectively (Fig. 3.6a). The average number of T E M m"3 CWD in each of the stand age classes was 654 for class 2 and 338 for class 8 (Fig. 3.6b). There was a significant difference in the average number of T E M m"3 CWD between the sites (ANOVA, F(2, 700)=8.220, p=0.000). The difference in the average number of T E M m"3 CWD was marginally significant between the stand age classes (ANOVA, F(l,712)=3.738, p=0.054). Least significant difference (LSD) analysis revealed that the observed differences between sites was between the granitic site and the dry basaltic site (p=0.000) and the granitic Table 3.3: Cubic meters of coarse woody debris in each of the stand age classes at each of the study site Site/Stand Class Coarse Woody Debris (m 3 ha-1) Alex Graham Class 2 108.66 Puntzi Lake Class 2 128.89 Nimpo Lake Class 2 90.55 Alex Graham Class 8 52.32 Puntzi Lake Class 8 60.74 Nimpo Lake Class 8 46.11 60 site and the wet basaltic site (p=0.001). The difference between the dry basaltic site and the wet basaltic site was not significant (p=0.671). The average mass of S. tomentosus T E M per cubic meter of C W D ranged from 1.42 g m"3 CWD to 11.15 g m"3 CWD (Table 3.4). The average mass of T E M m"3 C W D for the dry basaltic site, wet basaltic site and the granitic site were 1.83 g T E M m"3 CWD, 4.25 g T E M m"3 CWD and 8.54 g T E M m"3 CWD, respectively (Fig. 3.7a). There was a significant difference between sites for the average mass of T E M m"3 CWD ( A N O V A , F(2,229)=3.748, p=0.025). LSD analysis revealed that the significant difference between sites was between the granitic site and the dry basaltic site (p=0.008). There was no significant difference between the dry basaltic and the wet basaltic sites (p=0.338 ) and the difference between wet basaltic and the granitic site was marginally not significant (p=0.077). The average mass of 6.85 g T E M m"3 CWD for class 2 stands was higher than the average mass of 3.37 g T E M m" CWD for the class 8 stands (Fig. 3.7b). The difference between the average mass of T E M m" CWD in each of the stand ages was marginally not significant ( A N O V A , F(l,230)=2.19, p=0.089). B Class 2 Class 8 Stand Age Figure 3.6: (A) Average number of Suillus tomentosus tuberculate ectomycorrhizae per cubic meter of coarse woody debris at each site, and (B) in each of the stand age classes. Wet basalric= Puntzi Lake, Dry basaltic= Alex Graham, Granitic= Nimpo Lake, Class 2= Young stands <40 years, Class 8= Old stands >140 years. n=714 for sites, n=714 for stand age classes. Q o E £ HI H 2 3 1400 1200 1000 800 600 400 200 0 Wet Basaltic Dry Basaltic Granitic Site 61 Table 3.4: Average and maximum mass of Suillus tomentosus tuberculate ectomycorrhizae per cubic meter of coarse woody debris in each of the stands at the three sample sites. n=60 log sections per stand Site/Stand Class Average grams T E M nf 3 C W D Maximum grams T E M rn" Alex Graham class 2 2.20 30.78 Puntzi Lake class 2 7.53 133.33 Nimpo Lake class 2 11.15 129.51 Alex Graham class 8 1.40 22.93 Puntzi Lake class 8 1.42 11.01 Nimpo Lake class 8 6.60 40.90 Figure 3.7: (A) Average mass of Suillus tomentosus tuberculate ectomycorrhizae at each of the sites and (B) combined average mass of S. tomentosus T E M in each of the stand age classes. Wet basaltic= Puntzi Lake, Dry basaltic= Alex Graham, Granitic= Nimpo Lake, Class 2= Young stands <40 years, Class8= Old stands >140 years. n=232 for sites, n=232 for stand age classes. The maximum mass of S. tomentosus T E M per cubic meter of C W D ranged from 11.1 g m"3 C W D to 133.3 g m"3 C W D (Table 3.4). The class 2 stands had a higher maximum value (293.62 m 3 C W D ) than the class 8 stands (74.84 m"3 C W D , Table 3.4). 62 3.3.3 Tubercle Distribution in CWD and Correlation to CWD Attributes Larger numbers of Suillus tomentosus tubercles are associated with sections 1, 2 and 3 at the basal end of the log (Fig. 3.8). There was a steady decline in T E M numbers from section 4 to section 7 in the middle of the log, with the lowest number occurring in sections 8, 9 and 10 at the top end of the log (Fig. 3.8). Pearson correlation analysis revealed significant correlations between numbers of 5. tomentosus T E M in P. contorta CWD and all the CWD characteristics; moisture content, texture, amount of roots in the woody debris and the the degree to which the woody debris is incorporated in the forest floor (Appendix C, Table C-2). The correlation between the number of S. tomentosus T E M in CWD and increasing moisture content of the woody debris is positive (Fig. 3.9a). The number of S. tomentosus T E M were also positively correlated with increased degradation of the CWD as determined by debris texture (Fig. 3.9b). Numbers of S. tomentosus J8 35.0 | 30.0 1 25.0 H O 4) E 3 Z > < 20.0 15.0 10.0 5.0 0.0 5 6 Log Section 10 Log moisture: Wet (80%) Log texture: Fibrous Texture: Mushy/Pulpy — # Roots: Lots of Roots — Log position: >3/4 incorporated in forest floor Dry (<5%) One Piece Hard Pieces Low Roots •> On Top Figure 3.8: Distribution of average number of Suillus tomentosus tubercles in coarse woody debris logs of Pinus contorta. Lower text shows the general attributes of a log starting at the base of the log, the largest diameter (section 1), going to the top of the log, the smallest diameter (section 10). 63 T E M were positively correlated with amounts of P. contorta roots within C W D (Fig. 3.9c). Suillus tomentosus T E M numbers were also positively correlated with the degree to which CWD was incorporated into the forest floor (Fig. 3.9d). 3.3.4 Soil Analysis The results of the soil analysis are presented graphically in Appendix C, Fig. C - l , 2 & 3. Each graph represents a soil variable and its distribution in each site and stand age class, allowing for comparisons between sites and stand age classes. Significant difference analysis results for soil elemental comparisons between sites and stand age classes are presented in Appendix C, Table C-3. 500 -, OT 450 4) 400 -O t_ V 350 •O 3 300 1- 250 o 200 <5 o 150 E 100 3 z 50 0 R2 = 0.0975 0.0 1.0 2.0 3.0 4.0 5.0 CWD Moisture 0.0 1.0 2.0 3.0 4.0 5.0 CWD Texture 500 -, 450 - R2 « 400 2 fl> 350 £> 3 300 H 250 -O 200 -V 150 -E 100 • » 3 Z 50 | » 0 1 0.0  = 0.2388 1.0 2.0 3.0 4.0 5.0 Amount of Roots in CWD 0.0 1.0 2.0 3.0 4.0 5.0 Degree CWD Incorporated into Forest Roor Figure 3.9: Correlation analysis between the number of Suillus tomentosus tuberculate ectomycorrhizae in Pinus contorta coarse woody debris and the moisture content of CWD (A), texture of CWD (B), amount of roots present in CWD (C) and degree that CWD is incorporated into the forest floor (D). For x-axis indexes see Appendix C, Table C - l . 64 Soil analysis data showed that the soil at the granitic site (Nimpo lake) were lower in soil nutrient status, especially important nutrients such as C, N and S. Total C, N and S were generally two times lower in the soils of the granitic site and the dry basaltic (Puntzi lake) site compared to the wet basaltic (Alex Graham) sites (Appendix C, Fig. C - l , C-2, C-3). Both CEC and base saturation in the granitic soil were approximately half of the values from the dry and wet basaltic soils (Appendix C, Fig. C-3). 3.4 DISCUSSION There were lager amounts of CWD per hectare in class 2 stands than class 8 stands. This result could be expected since much of the CWD originated from the last stand-destroying event so CWD has been on the forest floor for a longer time in the older stands. My results are consistent with findings from other studies in various conifer forests (Allen et al. 1997, Harcombe et al. 1997). Additionally, if an old stand suffers a large scale disturbance like a forest fire, large amounts of woody debris will be deposited on the forest floor from the burned stand. A young stand will subsequently replace the old stand and, therefore, have large amounts of woody debris on the forest floor (Peet 1992). The distribution of Suillus tomentosus tuberculate ectomycorrhizae (TEM) within Pinus contorta stands appears to be influenced by attributes of the soil types within the study area. Significantly more T E M abundance and biomass were measured at the Nimpo Lake site with granitic parent material as compared to both sites with basaltic parent material, Alex Graham and Puntzi Lake. These differences may be due to the nutrient status of each of the soil types within the study area, though there are other differences between the sites such as topographic aspect. The soils of the Nimpo Lake site were lower in nutrient concentration, especially important nutrients such as C, S and N . Of particular interest is the amount of soil nitrogen in 65 each of the sites because it could influence the formation of S. tomentosus T E M because of their function as nitrogen fixing structures (Chapter 5). In times of lower available N or areas of lower available N , the host plant may ellicit a the mycorrhizal fungus and bacteria to form more T E M (Chapter 6) which, in turn, could increase nitrogen inputs to the host plant through increased nitrogen fixation. It has been shown that as nutrient deficiencies increase, plant roots exude more sugar (Marschner 1995). This could increase the amount of nitrogen being supplied to the host plant through increased N 2 -fixation occurring in T E M (Chapter 5). S. tomentosus T E M abundance and biomass showed was higher in younger stands than in older stands. Younger stands in their rapid growth phase may have a higher demand for nitrogen and, therefore, may encourage T E M development. This is circumstantially supported by data provided in this thesis and other studies, which have found S. tomentosus ectomycorrhizae are more prevalent in young stands of Pinus contorta and Pinus banksiana than in older stands (Visser 1995, Bradbury 1998, Bradbury et al. 1998). It has been shown that stands of P. contorta, less than 50 years old, have higher nitrogen uptake abilities and higher nitrogen content than older stands, between 100 and 200 years old (Olsson et al. 1998). Additional support comes from the point that, as P. contorta pine stands age, their nutrient requirement from the soil reduces rapidly because the nutrient "cycles" within the tree have become fully charged and the stand becomes more stable. Older trees recycle nutrients from parts of the tree tissue that have died and this process can be up to 85% efficient (Weetman 1988). Within a piece of CWD, tubercles are more abundant in the basal area of the log where the wood is moist and well degraded, than in the upper top end of the log, where the wood is hard, chunky and dry. The characteristics of CWD that are correlated with T E M distribution within CWD are the moisture content and texture of the woody debris, the amount of host roots 66 in the woody debris and the amount the woody debris that is incorporated into the forest floor (decomposition state). These characteristics are most likely linked and, therefore, it is difficult to determine which characteristic affects the distribution of T E M . One or all may be important in the distribution of T E M within CWD. It has been shown that nitrogenase activity by asymbiotic N2-fixing bacteria within CWD of various conifer forests increases with increased woody debris moisture content (Silvester et al. 1982, Jurgensen et al. 1992, Wei and Kimmins 1998). It has been suggested that the increased moisture and crumbly texture of the woody debris in these studies may facilitate better gas exchange and provide the necessary microaerophilic environment required for N2-fixation. The latter suggestion may not be so critical to S. tomentosus T E M since the T E M structure may help create the proper reduced oxygen environment needed for nitrogen fixation itself (Chapter 4 and 5). The pattern of T E M distribution within CWD could be a simple product of host roots developing in a substrate that has adequate moisture levels or the proper consistency to allow root development to occur. However, it has been shown that ectomycorrhizal development is strongly related to well humified organic matter within forest floors (Harvey et al. 1987, Graham et al. 1994). The abundant occurrence of T E M within CWD may also be a result of pH differences. The forest soils in this study were moderately acidic, having an average pH of 5.5. Since nitrogen fixing bacterial activity is reduced in acidic environments (Graham 1998), the N2-fixing bacteria may preferentially occur in the CWD because it is a more basic environment than the forest soil. As trees grow, they accumulate base cations such as K, Na, M n and especially Ca in their tissue (Kimmins 1997, Stevens 1997). When the tree dies and becomes CWD in a stand, the woody debris is high in these base cations and is less acidic than the surrounding soil environment (Waring and Running 1998, Krankina et al. 1999). Altogether, there seems to be a number of conditions and factors that influencing the formation of & tomentosus T E M in CWD of P. contorta stands. T E M also form on P. contorta 67 roots within the mineral soil but their relative abundance, in comparison to T E M abundance in CWD, is not known. The microhabitat of T E M in the mineral soil is also unknown but may resemble the microhabitat of T E M within CWD. More research on the ecology of T E M is necessary to determine the exact nature of T E M formation and abundance. Elucidation of the reasons why T E M grow where they do is still in the initial stages. 68 3.5 REFERENCES Aho, P.E., Seidler, R.J., Evans, H.J. and Rajau, P.N. 1974. Distribution, enumeration and identification of nitrogen-fixing bacteria associated with decay in living white fir trees. Phytopathology 64: 1413-1420. Allen, R. B., Clinton, P. W. and Davis, M . R. 1997. Cation storage and availability along a Nothofagus forest development sequence in New Zealand. Canadian Journal of Forest Research. 27:323-330. Amaranthus, M.P., L i , C Y . and Perry, D.A. 1990. Influence of vegetation type and madrone soil inoculum on associative nitrogen fixation in Douglas-fir rhizosperes. Canadian Journal of Forest Research 20: 368-371. Bergersen, F.J. and Turner, G.L. 1983. An evaluation of 1 5 N methods for estimating nitrogen fixation in a subterranean clover perennial ryegrass sward. Australian Journal of Agricultural Research 34: 391-401. Bormann, B.T., Bormann, F.H., Bowden, W.B., Pierce, R.S., Hamburg, S.P., Wang, D., Snyder, M . C , L i , C Y . and Ingersoll, R.C. 1993. Rapid N2-fixation in Pines, Alders, and Locust: Evidence from the sandbox ecosystem study. Ecology 74(2): 583-598. Bolger, T.P., Pate, J.S., Unkovich, M.J. and Turner, N.C. 1995. Estimates of seasonal nitrogen fixation of annual subterranean clover-based pastures using the 1 5 N natural abundance technique. Plant and Soil 160: 215-223. Bradbury, S. M . 1998. Ectomycorrhizas of lodgepole pine (Pinus contorta) seedlings originating from seed in southwestern Alberta cut blocks. Canadian Journal of Botany. 76: 213-217. Bradbury, S. M . , Danielson, R. M . and Visser, S. 1998. Ectomycorrhizas of regenerating stands of lodgepole pine (Pinus contorta). Canadian Journal of Botany. 76: 218-227. 69 Bremer, E. and van Kessel, C. 1990. Appraisal of the nitrogen-15N natural abundance method for quantifying dinitrogen fixation. Soil Science Society of American Journal 54: 404-411. Brown, J. R. 1974. Handbook for inventorying downed woody material. U S D A Forest Service General Technical Report. LNT-16. Brown, J. R. and Roussoupoulos, P. J. 1974. Eliminating liases in the planar intersect method for estimating volumes of small fuels. Forest Science. 20(4): 350-356. Burris, R.H. and Miller, C.E. 1941. Application of 1 5 N to the study of biological nitrogen fixation. Science 93: 114-115. Cornaby, B.W. and Waide, J.B. 1973. Nitrogen fixation in decaying chestnut logs. Plant and Soil 39: 445-448. Covington, W.W. 1981. Changes in forest floor organic matter and nutrient conservation following clear cutting in northern hardwoods. Ecology 62: 41-48. Edmonds, R.L. 1991. Organic matter decomposition in western United States. In: Management and productivity of western montane forest soils. U S D A Forest Service . General Technical Report, INT-123. pp. 118-128. Etter, H . M . 1969. Growth, metabolic components and drought survival of Lodgepole pine seedlings at three nitrate levels. Canadian Journal of Plant Science 49(4): 393-402. Etter, H . M . 1972. Effect of nitrogen nutrition upon sugar content and dry weight of juvenile Lodgepole pine and White Spruce. Canadian Journal of Forest Research 2(4): 434-440. Freedman, B., V. Zelazny, D. Beaudette, T. Fleming, S. Flemming, G. Forbes, J. S. Gerrow, G. Johnson and S. Woodley. 1996. Biodiversity implications of changes in the quantity of dead organic matter in managed forests. Environmental Reviews. 4:238-265. 70 Graham, P. H. 1998. Biological Dinitrogen Fixation: Symbiotic. In: Principles and Applications of Soil Microbiology. Eds. Sylvia, D. M , Furhrmann, J.J., Hartel, P. G. and Zuberer, D. A. Prentice Hall, Upper Saddle River, New Jersey. USA. pp. 322-345. Graham, R.T., Harvey, A.E. , Jurgensen, M.F., Jain, T.B., Tonn, J.R. and Page-Dumroese, D.S. 1994. Managing coarse woody debris in forests of the Rocky Mountains. USD A Forest Service Research Paper. INT-RP-477. Grier, C C . 1978. A Tsuga heterophylla-picea stichensis ecosystem of coastal Oregon: decomposition and nutrient balances of fallen logs. Canadian Journal of Forest Research 8: 198-206. Harcombe, P., Allen, R. B., Wardle, J. A. and Piatt, K. H. 1997. Spatial and temporal patterns in structure, biomass, growth and mortality in a monospecific Nothofagus solandri var. cliffortiod.es forest in New Zealand. Journal of Sustainable Forestry. 6: / Hardy, R.W.F., Holsten, R. D., Jackson, E.K. and Burns, R.C. 1968. The acetylene-ethylene assay for N2-fixation: laboratory and field evaluation. Plant Physiology 43: 1185-1207. Harmon, M . E., J. F. Franklin, F. J. Swanson, P. Sollins, S. V . Gregory, J. D. Lattin, N . H. Anderson, S. P. Cline, N . G. Aumen, J. R. Sedell, G. W. Lienkaemper, K. Cromack and K. W. Cummins. 1986. Ecology of coarse woody debris in temperate ecosystems. Advances in Ecolgical Research. 15: 133-302. Harvey, A.E. , Larsen, M.J. and Jurgensen, M . F. 1980. Ecology of ectomycorrhizae in northern Rocky Mountain forests. In: Environmental Consequences of Timber Harvesting in Rocky Mountain Coniferous Forests. USDA Forest Service General Technical Report, INT-90. pp. 188-208. 71 Harvey, A. E., M . J. Larsen and M . F. Jurgensen. 1981. Rate of woody residue incorporation into northern Rocky Mountain forest soils. USDA Forest Service Research Paper. INT-282. Harvey, A. E., M . F. Jurgensen, M . J. Larsen and R. T. Graham. 1987. Relationship among soil microsite, ectomycorrhizae and natural conifer regeneration of old-growth forests in western Montana. Canadian Journal of Forest Research. 17:58-62. Harvey, A.E. , Larsen, M.J. , Jurgensen, M . F. and Jones, E.A. 1989. Nitrogenase activity associated with decayed wood of living northern Idaho conifers. Mycologia 81(5): 765-771. Johnson, D.W., Cole, D.W., Bledsoe, C.S., Cromack, K., Edmonds, R.L., Gessel, S.P., Grier, C C , Richards, B .N. and Voigt, K . A . 1982. Nutrient cycling in forests of the Pacific Northwest. In: Analysis of coniferous forest ecosystems in the western United States. Ed. Edmonds, R.L. Hutchinson Ross. Stroudsberg, PA. pp. 186-232. Jurgensen, M.F., Larsen, M.J. , Spano, S.D., Harvey, A.E. and Gale, M.R. 1984. Nitrogen fixation associated with increased wood decay in Douglas-fir residue. Forest Science 30: 1038-1044. Jurgensen, M.F., Larsen, M.J. , Mroz, G.D. and Harvey, A.E. 1986. Timber harvesting , soil organic matter and site productivity. In: Productivity of Northern Forests Following Biomass Harvesting. USDA Forest Service General Technical Report NE-115. pp. 43-52. Jurgensen, M.F., Larsen, M.J. , Wolosiewicz, M . and Harvey, A.E. 1989. A comparison of dinitrogen fixation rates in wood litter decayed by white-rot and brown-rot fungi. Plant and Soil 115: 117-122. 72 Jurgensen, M.F., Tonn, J.R., Graham, R.T., Harvey, A.E. and Geier-Hayes, K. 1991. Nitrogen fixation in forest soils of the Inland Northwest. USDA Forest Service General Technical Report. INT-280. pp. 101-109. Jurgensen, M . F., Graham, R. T., Larsen, M . J. and Harvey, A. E. 1992. Clear-cutting, woody residue removal, and nonsymbiotic nitrogen fixation in forest soils of the Inland Pacific Northwest. Canadian Journal of Forest Research. 22:1172-1178. Kimmins, J. P. 1997. Forest Ecology. Pretence Hall. New Jersey. Krankina, O. N . , Harmon, M.E. and Griazkin, A. V. 1999. Nutrient stores and dynamics of woody detritus in a boreal forest: modelling potential implications at the stand level. Canadian Journal of Forest Research. 29: 20-32. Larsen, M.J. , Jurgensen, M.F. and Harvey, A.E. 1978. N2-fixation associated with wood decayed by some common fungi in western Montana. Canadian Journal of Forest Research 8: 341-345. L i , C Y . and Hung, L .L . 1987. Nitrogen-fixing (acetylene-reducing) bacteria associated with ectomycorrhizae of Douglas-fir. Plant and Soil 98:425-428. Linderman, R.G. 1988. Mycorrhizal interactions with the rhizosphere microflora: The mycorrhizosphere effects. Phytopathology 78:366-371. Maser, C , Anderson, R. G., Cromack, K., Williams, J. T. and Martin, R. E. 1979. Dead and down woody material. In: Wildlife habitats in managedforests: The Blue Mountains of Oregon and Washington. Eds. Thomas, J. W. pp. 78-95. Maser, C. and J.M. Trappe. 1984. The seen and unseen world of the fallen tree. U S D A Forest Service General Technical Report. PNW-164. 73 Marra, J.L. and Edmonds, R.L. 1994. Coarse woody debris and forest floor respiration in an old growth coniferous forest on the Olympic Peninsula, Washington. Canadian Journal of Forest Research 24: 1811-1818. Marschner, H. , 1995 Mineral nutrients of higher plants. Acedemic Press, London, pp. 537-595. McNabb, D.H. and Geist, J.M. 1979. Acetylene reduction assay of symbiotic N2-fixation under field conditions. Ecology 60(5): 1070-1072. McRae, D. J., Alexander, M . E. and Stocks, B. J. 1979. Measurement and description of fuels and fire behaviour on prescribed burns: A handbook. Canadian Forest Service Report. O-X-287. Means, J.E., MacMillan, P.C. and Cormack, K. 1992. Biomass and nutrient content of Douglas-fir logs and other detrital pools in an old growth forest, Oregon, U.S.A. Canadian Journal of Forest Research 22: 1536-1546. Olsson, U . , Binkley, D. and Smith, F.W. 1998. Nitrogen supply, nitrogen use, and production in an age sequence of lodgepole pine. Forest Science. 44(3): 454-457. Peet, R. K. 1992. Community structure and ecosystem function. In: Plant succession: theory and prediction. Eds. Glenn-Lewin, D . C , Peet, R. D. and Veblen, T. T. Chapman and Hall. London. Pp. 103-151. Reynolds, R. T., R. T. Graham, M . H. Reiser, P. L. Kennedy, D. A. Boyce, Jr., G. Goodwin, R. Smith, and E. L. Fisher. 1992. Management recommendations for the northern goshawk in the Southwestern United States. USDA Forest Service General Technical Report RM-217. Rocky Mountain Forest and Range Experiment Station. Fort Collins, CO. Richards, B .N. and Voigt, G.N. 1964. Role of mycorrhizae in nitrogen fixation. Nature (London) 201:310-311. 74 Richter, D.L., Zuellig, T.R., Bagley, S.T. and Bruhn, J.N. 1989. Effects of red pine (Pinus resinous Ait.) mycorrhizoplane-associated actinomycetes on in vitro growth of ectomycorrhizal fungi. Plant and Soil 115:109-116. Roskoski, J.P. 1980. Nitrogen fixation in hardwood forests of the northeastern United States. Plant and Soil 54:33-44. Sanford, P., Pate, J.S. and Unkovich, M.J. 1993. A survey of the proportional dependence of subterranean clover and other pasture legumes on N2-fixation in southwest Australia utilizing 1 5 N natural abundance. Australian Journal of Agricultural Research. 45: 165-181. Sharp, R.F. and Millbank, J.W. 1973. Nitrogen fixation in deteriorating wood. Experientia 29: 895-896. Shearer, G and Kohl, D.H. 1978. 1 5 N abundance in N-fixing and non N-fixing plants. In: Mass Spectrometry in Biochemistry and Medicine. Vol. 1. Ed. Figerio, A. Plenum Press. New York. pp. 605-622. Silvester, W.B., Sollins, P., Verhoeven, T. and Cline, S.P. 1982. Nitrogen fixation and acetylene reduction in decaying conifer boles: Effects of incubation time, aeration and moisture content. Canadian Journal of Forest Research 12:646-652. Sollins, P. J., C. C. Grier, F. M . McCorlson, K. Cromack, R. Roge. And R. L. Fredriksen. 1980. The internal element cycles of an old-growth Douglas-fir ecosystem in western Oregon. Ecological Monographs. 50: 261-285. Stevens, V. 1997. The Ecological Role of Coarse Woody Debris: An overview of the ecological importance of CWD in BC forests. Research Branch, BC Ministry of Forests, Victoria, BC. Work Paper 30. 75 Trowbridge, R. B., Hawkes, B, Macadam, A. and Parminter, J. 1987. Field handbook for prescribed fire assessments in British Columbia: Logging slash fuels. FRDA Handbook No. 1. B.C. Ministry of Forests and Lands and Canadian Forestry Service. Visser, S. 1995. Ectomycorrhizal fungal succession in jack pine stands following wildfire. New Phytologist. 129:389-401. Waring, R. H. and Running, S. W. 1998. Forest Ecosystems. Academic Press. San Diego, California, USA. Weetman, G.F. 1988. Nutrition and fertilization of lodgepole pine. In: Proceedings of The Future Forests of the Mountain West: A Stand Culture Symposium, 1986. Ed. Schmidt, W.C. U S D A Forest Service General Technical Report. INT-243. pp. 231-239. Wei, X . and Kimmins, J. P. 1998. Asymbiotic nitrogen fixation in harvested and wildfire-killed lodgepole pine forests in the central interior of British Columbia. Forest Ecology and Management. 109: 343-353. Zak, B. 1971. Characterization and classification of mycorrhizae of Douglas fir. U . Pseudotsuga menziesii + Rhizopogon vinicolor. Canadian Journal of Botany 49: 1079-1084. 76 Chapter 4 Identification of Nitrogen Fixing Bacteria within Suillus tomentosus Tuberculate Ectomycorrhizae. 4.1 INTRODUCTION The root-soil interface is a dynamic and complex environment of plant-microbe interactions which can influence the properties and maintenance of the rhizosphere (Linderman 1988). Mycorrhizal fungi have been recognised as a key group of microorganisms within the rhizosphere that are essential for plant growth and survival in natural and managed ecosystems (Read et al. 1992, Barea and Jeffries 1995, Smith and Read 1997). Mycorrhiza are of particular interest in soil microbe interactions since they may actively affect the composition of microbial populations (Malajczuk 1979, Linderman 1988, Olsson et al. 1996a, 1996b, Frey et al. 1997) and in turn, be influenced by soil microbial populations (Duponnois and Garbaye 1990, Garbaye 1994, Frey-Klett et al. 1997, Barea et al. 1998, Ravnskov et al. 1999). The influence of mycorrhiza within the rhizosphere has been termed the mycorrhizosphere effect (Linderman 1988). A wide variety of microorganisms live in the proximity of the mycorrhizosphere, but our understanding of their interactions is limited (Ingelby and Molina 1991). Soil bacteria, another important group of microorganisms in the rhizosphere, are the most common root and mycorrhiza-associated organisms (Rouatt and Katznelson 1961, Neal et al. 1964). Many of these bacteria have been shown to affect seedling growth (Linderman and Paulitz 1990, Chanway and Holl 1991). A number of different functional groups of rhizosphere bacteria have been identified including: (i) pathogenic bacteria which cause disease in numerous plant species (ii) saprophytic bacteria (iii) predatory bacteria which consume other rhizosphere bacteria (iv) plant growth promoting rhizobacteria (PGPR), which are naturally occurring, free-living soil bacteria that are capable of associating with or colonising roots and enhancing growth 77 of the host plant (Kloepper et al. 1980); and (v) mycorrhiza-associated bacteria that colonize mycorrhiza and the surrounding mycorrhizosphere and are capable of enhancing mycorrhizal root tip formation (Neal et al. 1964, Bowen and Theodorou 1979, Deoliveira and Garbaye 1989, Garbaye and Bowen 1989, Duponnois and Garbaye 1991, Frey-Klett etal. 1999). The latter group was named 'mycorrhizal helper bacteria' (MHB)(Garbaye 1994), but this name has been retracted in favour of mycorrhizal-associated bacteria (MAB) due to the inconclusive data on their role as "helper" bacteria in the rhizosphere (pers. comm. Garbaye 2001). Microbial colonisation of ectomycorrhizae has been demonstrated in numerous studies (Richards and Voigt 1964, L i and Hung 1987, Linderman 1988, Richter et al. 1989, Amaranthus et al. 1990, Timonen et al. 1998, Mogge et al. 2000). In some cases, these root-fungal-bacterial associations are thought to be symbiotic, rendering mycorrhiza a tripartite association (Li and Hung 1987, Amaranthus et al. 1990, L i et al. 1992). The relationships between these three agents of symbiosis are not well understood. PGPR stimulate plant growth through several mechanisms which can be broadly categorised as either direct or indirect (Kloepper 1993). When plant growth promotion by bacteria is direct, PGPR produce a metabolite or compound that is stimulatory to plants and results in direct uptake by the plant and growth enhancement (Chanway and Ho11 1992, Chanway 1997). Indirect plant growth effects are elicited by PGPR when bacteria affect other factors in the rhizosphere which in turn results in plant growth stimulation, for example reducing growth of competing plants or eliminating pathogens (Chanway et al. 1991, Glick 1995). In contrast, it was believed that mycorrhizal associated bacteria do not stimulate plant growth directly, that is, without the appropriate mycorrhizal fungus being present (Duponnois and Garbaye 1991, Duponnois et al. 1993). These microorganisms were thought to enhance host plant growth at least partly by enhancing the mycorrhizal growth (Duponnois and Garbaye 78 1991, Garbaye et al. 1992, Garbaye 1994, Frey-Klett et al. 1997, 1999) with a high degree of specificity to mycorrhizal fungal species (Azcon et al. 1991, Garbaye and Duponnois 1992). However, it was also shown that some M A B are capable of having an effect on the host plant without the mycorrhizal fungus being present (Shishido et al. 1996b). It has been suggested that some PGPR may be mycorrhizal-associated bacteria because Pseudomonas spp. and Bacillus spp. dominate both groups (Fitter and Garbaye 1994). Since mycorrhizae are ubiquitous in plant systems around the world, it seems probable that many PGPR interactions involve mycorrhizae and are mycorrhizal-associated bacteria. In contrast, other work suggests that certain bacterial species, even though they are associated with mycorrhizae on a host plant, influence the plant in ways that are not connected with the mycorrhizal fungus (Shishido et al. 1996a, 1996b). Therefore, it appears that the distinction between PGPRs and mycorrhizal-associated bacteria is unclear and further investigation is necessary to identify whether these two groups are distinct or i f there is some overlap by individual bacterial species within each group. The effect of mycorrhizal-associated bacteria on enhancement of root colonisation and mycorrhizal formation by specific ectomycorrhizal fungi has become of great interest in the last twenty years (reviewed by Garbaye 1994). A number of studies have focused on the bacteria Pseudomonas fluorescens and Bacillus spp. isolated from and studied in highly managed French forest nursery soils supporting exotic Douglas fir (Pseudotsuga menziesii (Mirb.) Franco) seedlings for use in reforestation (Garbaye et al. 1990, Garbaye and Duponnois 1992, Garbaye 1994, Frey et al. 1997, Frey-Klet et al. 1997). These studies mainly focused on mycorrhizal helper effects by bacteria which were isolated and enriched on artificial media. However, molecular evidence suggests that up to 95% of all soil bacteria cannot be cultured (Torsvik et al. 1990, Ovreas and Torsvik 1998) and therefore, the reported mycorrhizal-associated bacteria represent only a small proportion of the total mycorrhizosphere bacteria. 79 A number of other studies focused on ectomycorrhizal-associated bacteria from natural forest soils supporting Alnus oregona Nutt. (Neal et al. 1968), Betula lutea Michx. F. (Katznelson et al. 1962), Eucalyptus calophylla Lindl. and Eucalyptus marginata Sm. (Maljczuk 1979), Fagus sylvatica L. (Mogge et al. 2000), Larix decidua Mi l l . (Varese et al. 1996), Pinus radiata D. Don (Foster and Marks 1966), Picea engelmanii (Parry) Engelm., Picea pungens Engelm., Pinus aristata Englem. and Pinusflexilis James (Oswald and Ferchau 1968J, Pinus sylvestris L. (Dahm 1984a, 1984b, Strzelczyk et al. 1987, Sarand era/. 1998) Pinus radiata D. Don (Garbaye and Bowen 1989) and Pseudotsuga menziesii (Neal et al. 1964, L i et al. 1992). In a number of these studies, it was shown that bacteria associated with ectomycorrhizal roots were found in mucilage surrounding the root tips, in the mycorrhizal mantles and on hyphae emanating from the mantle (Schelkle et al. 1996, Sarand et al. 1998, Timonen et al. 1998, Mogge et al. 2000). Associated bacterial species identified in these studies included Pseudomonas spp., Burkholderia spp., Agrobacterium spp., Bacillus spp., Xanthomonas spp. and other proteobacteria (Sarand et al. 1998, Timonen et al. 1998, Mogge et al. 2000). It is believed that these bacteria may behave similarly to the M A B of the previously mentioned nursery studies and PGPRs, in promoting growth, specifically of ectomycorrhizae in natural systems. As nitrogen is often the limiting nutrient in forest soils, in terms of plant growth, the N 2 -fixing bacteria associated with tuberculate ectomycorrhizae (TEM) on P. menzesii are of particular interest (Li et al. 1992). L i et al. (1992) postulated that since free living N 2-fixing bacteria are abundant in woody debris of P. menzesii stands, and T E M of P. menzesii also occur abundantly in the same woody debris, N 2-fixing bacteria might reside within the T E M structure. L i et al. (1992) also suggested that if such an association did occur, T E M may be a source of significant nitrogen inputs to the nitrogen budgets of P. menzesii. L i et al. (1992), were unable to detect N 2-fixing bacteria on the rootlets or on the rootlet cortical cells within tubercles on P. 80 menzesii, but were able to isolate N2-fixing bacteria associated with the outer peridium layer of the surface of tubercles. In contrast, studies of non-tuberculate ectomycorrhizae indicate that associated N 2-fixing bacteria occur throughout the mycorrhizal mantle as well as within and between viable cortical cells of the host roots (Malajczuk 1979, L i and Hung 1987). Such results suggest that bacteria may also occur within tubercles, but so far, this has not been demonstrated. L i et al. (1992), concluded that T E M on P. menzesii were not the site of significant nitrogen inputs and the small amount of nitrogenase activity observed in the study was due to associated N 2-fixing bacteria on the T E M surface. Their inability to detect bacteria within tubercles may have been a result of trying to culture the bacteria under anaerobic conditions. Many N 2-fixing bacteria are microaerophilic and their growth may be restricted in an anaerobic environment (Zuberer 1998). Furthermore, P. menzesii often grows in environments that are not nitrogen-deficient and, therefore, tubercles of P. menzesii may not, in some circumstances, harbour large numbers of bacteria, making detection difficult. In known nitrogen fixing plants, nitrogenase activity is dramatically affected by available soil nitrogen levels (Zuberer 1998). Ectomycorrhizal abundance is known to increase in nutrient deficient soils (Boerner 1986, van Noordwijk and Hairiah 1986, Gehring and Whitham 1994), and decrease in abundance in soils that have higher levels of fertility (Marx et al. 1977, Gagnon et al. 1987, MacFall et al. 1990). Therefore, observations from a single point in time in which N2-fixation was not detected does not rule out the possibility that N 2-fixing bacteria reside within tubercles of other tree species and that they may be a significant source of fixed nitrogen to the host plant. The objective of this chapter was to test the hypothesis of L i et al. (1992) that tuberculate ectomycorrhizae are sites of nitrogen fixation by analysing trees growing in a more uniformly nutrient-deficient environment. The system studied was Suillus tomentosus (Kauff.) Sing., Snell & Dick tubercles on Pinus contorta var. latifolia (Dougl.) Engelm., where nitrogen inputs from litter and precipitation are very low and considered limiting for plant growth 81 (Ballard 1986, Weetman 1988). The main objective was to determine if bacteria, particularly N2-f ixing bacteria, associate with S. tomentosus tubercles, identify the bacterial species associated with S. tomentosus T E M and to determine where the bacteria were located (within the tubercle and/or on the surface of tubercles). 4.2 M A T E R I A L S A N D M E T H O D S 4.2.1 Study Sites The study sites for these experiments were located in the Suboreal Pine-Spruce xeric cold (SBPSxc) biogeoclimactic subzone, west of Williams Lake in the interior of British Columbia (Chapter 1). Samples were collected from three sites across the sub-zone (Fig. 1.1, Chapter 1). 4.2.2 Tubercle Collection Tuberculate samples were collected in a similar fashion to those described in Section 2.2.1, with the following exceptions. Host roots with tubercles attached were carefully exposed by gently breaking apart woody debris until tubercles could be seen clearly. Once T E M were located, with the roots still in place, tubercles of between 3 and 6 mm diameter were separated from the roots using forceps or by hand, depending upon accessibility of the tubercle. When tubercles needed to be excised by hand, sterile standard latex gloves were worn to reduce contamination or alteration of the specimens by contact with bacteria and oils present on skin. This precaution was taken even though the primary objective was to isolate and identify bacterial from inner tissue of the tubercles following surface sterilisation. Reduced contamination or alteration of the surface of tubercles was also desirable because one of the secondary objectives in this work was to isolate and identify bacterial species from the T E M surface. Each of the approximate 150 tubercles collected was transferred separately to a sterile 82 lock top Eppendorf centrifuge tube and placed on ice for transportation to the laboratory. Separate tubes were used to avoid cross contamination by contact of one tubercle with another. 4.2.3 Tubercle Dissection and Tissue Extraction A l l of the following steps were conducted in a laminar flow hood, under sterile conditions. Initially, each tubercle was separately washed by agitation in sterile, autoclaved water for three minutes to remove most debris from the surface. Each sample was then surfaced sterilised by agitation in 30% hydrogen peroxide for 45 seconds to one minute. Each sample was then washed three additional times in distilled water for one minute each time. After washing, some of the samples were passed through an open flame to determine if this further reduce any surface bacteria that may have been present. After five tubercle samples had been processed in this way, all solutions were replenished with fresh solutions to minimise cross contamination by processing large batches of tubercles in the same sterilisation solutions. Using a dissecting microscope (Zeiss, Germany) and sterile microforceps, each tubercle was carefully teased apart into two roughly equal sized parts, avoiding contact with the inner tissues. Once the halves were separated, they were placed onto a drop of mounting wax in a petri dish for dissection, with the exposed inner surfaces facing up. Hyphae between the mycorrhizal root tips within the tubercle (interstitial hyphae) along with mycorrhizal root tips were removed and placed into 1.5 ml scintillation vials (Fisher Scientific, Canada) containing lml of 0. I M phosphate buffer (pH 7.0). Approximately 10 mg of tissue was collected in each vial from three to five tubercle samples. A total of 10 vials were made up in this manner. The tissue in solution was then mashed using a glass rod for two minutes. Samples were then mixed for 30 seconds using a vortex mixer. To verify that the surface sterilisation procedure had minimised surface bacterial contaminants, intact tubercle samples were imprinted and smeared 83 onto plates containing limited nitrogen, combined carbon (Rennie 1980) agar medium (CCM) with 0.002% yeast extract and allowed to incubate for seven days (Zuberer 1987). 4.2.4 Bacteria Extraction and Isolation from Inner Tissue Tubercle To extract and isolate bacteria from the inner tissue of tubercles, a ten-fold dilution series was conducted as described by Zuberer (1994). In each series, six dilutions were done starting from the ten original extraction suspensions. Aliquots (0.1 ml) of each dilution were then plated onto C C M medium. A l l plates were incubated under aerobic, anaerobic and microaerophillic conditions. For anaerobic and microaerophillic conditions, GasPak microaerophillic and anaerobic systems (BBL Microbiology Systems, Becton Dickinson and Co., Cockeysville, M D , USA) were used (Li et al. 1992). The plates were incubated for seven days and were checked every 24 hours for new colony development. New colonies were immediately isolated as detected. Extractions were conducted twice in 1997, and three times in 1998 and 2000. Bacterial isolates were selected based on colony morphological differences. Colonies that appeared to be different in size, shape, colour and opacity were transferred using a sterile inoculation loop onto new plates containing C C M medium. Each new isolate was described according to its morphological characteristics and assigned a unique name. 4.2.5 Bacterial Isolation from the Surface of Tubercles Using microforceps, 10 groups of five tubercles were transferred from the Eppendorf tubes and placed into 1.5 ml scintillation vials containing 2 ml of 0.1 M phosphate buffer (pH 7.0). Samples were gently shaken by hand for 1 to 3 minutes. The buffer was then plated onto agar and individual bacterial colonies were isolated as described in section 4.2.4. Surface isolations were conducted twice in 1997, and three times in 1998 and 2000. 84 4.2.6 Initial Bacteria Identification 4.2.6.1 BIOLOG Analysis Preliminary identification of the interior T E M bacterial isolates was performed using BIOLOG carbon utilisation analysis (BIOLOG, Hayward, CA, USA). For the analysis, the four bacterial isolates from section 4.2.4 were transferred from the plates containing C C M medium to plates containing BIOLOG Universal Growth media (BUG)(BIOLOG, Hayward, CA, USA). Sterile cotton swabs were used to transfer the bacteria from C C M to B U G . One swab of each culture was evenly spread over the surface of the B U G plates. The plates were then incubated at 30°C for 18 to 24 hours. Isolates were then transferred to test tubes containing 25ml of BIOLOG inoculating solution and adjusted to a standard culture density using the BIOLOG turbidometric standards (BIOLOG, Hayward, CA, USA). An aliquot of 0.15ml of the bacterial suspension was added to each of the 96 wells of commercial MicroPlates (gram positive plates and gram negative plates) each of which contains a different carbon source (BIOLOG, Hayward, CA, USA). MicroPlates were then incubated at 34°C and checked for color change in the wells at 6, 12 and 18 hours. Plates were then analysed using the MicroLog 1 species identification software (BIOLOG, Hayward, CA, USA). BIOLOG analysis was not performed on isolates from the surface of T E M . For these isolates, gas chromatographic fatty acid methyl esters (GC FAME) and 16S rDNA analyses were used because these methods identify bacteria to the species level. 4.2.6.2 Gas Chromatograph Fatty Acid Methyl Ester (GC FAME) Analysis A l l GC F A M E (Sasser 1990a, 1990b) analyses were conducted by Dr. John Mclnroy at the Department of Plant Pathology, Auburn University, Auburn, Alabama. The four bacterial isolates from the interior and the eighteen bacterial isolates from the surface of T E M were transferred from C C M agar to tryptic soy agar (TSA). Cultures were incubated at 28°C for 48 85 hours (Haack et al. 1994). After incubation, 40 mg of fresh weight bacterial colonies were removed from the plates and placed in clean 13 x 100 mm culture tubes. The bacteria were then saponified by adding 1ml of saponification reagent (45g sodium hydroxide, 150 ml methanol, 150 ml distilled water) to each tube. The tubes were sealed with a teflon-lined cap and heated for 5 minutes in a 100°C water bath. After heating, the tubes were vortexed for 10 seconds and returned to the water bath for an additional 30 minutes. The tubes were allowed to cool to room temperature. To methylate the liberated fatty acid, 2 ml of methylating reagent (325 ml 6N hydrochloric acid, 275 ml methyl alcohol) were added to each tube followed by heating at 80°C for 10 minutes in a water bath. The tubes were allowed to cool to room temperature. F A M E extraction was done by adding 1.25 ml of extraction reagent (200 ml hexane, 200 ml methyl tert-bvAy\ ether) to the suspensions and turning the tubes on a clinical rotator for 10 minutes. After turning, the lower aqueous phase of the solution was removed and discarded leaving the organic phase behind. The organic phase was washed by adding 3 ml of cleanup reagent (10.8 g sodium hydroxide, 900 ml distilled water) to each tube followed by turning for 5 minutes. After washing, 2/3 of the organic phase was removed, placed into a gas chromatograph (GC) vial, and capped for analysis. Fatty acid extracts were analysed by gas-liquid chromatography on a Hewlett-Packard 6890 (Hewlett Packard, USA) using capillary column Ultra 2-HP (cross-linked 5% phenyl methyl silicone; 25 m, 0.22 mm id; film thickness, 0.33 pm), with hydrogen as the carrier gas and nitrogen as the 'makeup' gas. The temperature program ramped from 170°C to 270°C at 5°C per minute during analysis. F A M E compounds were detected by a flame ionization detector (FID) and all results were then compared to the Microbial Identification Software (Sherlock aerobe method and TSBA library version 3.9) developed by MIDI Inc (Newark, USA). 86 4.2.7 PCR Amplification and Sequencing 4.2.7A Cell Preparation Results obtained from BIOLOG and GC F A M E were also verified using PCR and D N A sequence analysis of each isolate. Bacterial isolates from the interior tissue of T E M were grown in glass test tubes containing 25 ml of tryptic soy broth on an orbital shaker at 25°C for 5 days. Cells were concentrated by centrifugation at 5000g for 10 minutes, the supernatant was decanted, and cell pellets were washed twice with 10 ml of sterile Mil l iQ (Millipore, Bradbury, M A , USA) water. Suspensions were recentrifuged 5000g for 5 minutes and the supernatant was removed. Washed pellets were then re-suspended in 10 ml of sterile Mil l iQ water and the cell densities were adjusted by light spectrophotometry to an absorbance between 0.35-0.5 A U at a wavelength of 600 nanometers (Laguerre et al. 1994). This procedure was conducted for both the 16S D N A PCR/sequencing and the nifH gene PCR/sequencing. 4.2.7.2 16SPCR Amplification The 16S region of rDNA of the four isolates from the interior tissue and four isolates from the surface (T6, T7, T13 and T14) of T E M were amplified using the primers, 1525r (51-A A G G A G G T G W T C C A R C C - 3 ' ) and 27f (5 ' -AGAGTTTGATCMTGGCTCAG-3 ' , Lane 1991), which resulted in a Polymerase Chain Reaction (PCR) product of approximately 1500bp following a modification of the procedure in Laguerre et al. (1994). Four samples of each isolate were amplified using PCR. The PCR amplification was performed in a total volume of 50 pi by combining 0.5 pi of 10 X Red Taq polymerase reaction buffer without M g C l 2 , 0.2 p M of each primer, 1.0 p M M g C l 2 , 200 p M of each deoxyribonucleoside triphosphate dATP, dCTP, dTTP, and dGTP (Amersham Biosciences, Sunnyvale, CA, USA), 2.5 Units of Red Taq Polymerase (Sigma-Aldrich, St. Louis, MO, USA), 0.5 pi of bacterial cell suspension as the template and the 87 rest of the final volume (50 ul) being made up with autoclaved Mil l iQ water. Amplifications were carried out using a PCR thermal cycler (Gene Amp PCR system 2400, Perkin Elmer, Wellesley, M A , USA) using the following program: initial cell lysis and denaturation for 3 minutes at 95°C, followed by 35 cycles of denaturation (30 sec at 94°C), annealing (1 min at 55°C), extension (2 min at 72°C) and a final extension for 10 minutes at 72°C. Quantity and quality of PCR products were evaluated on a 1% agarose gel in 0.5 X T B E buffer (44 mM Tris-borate (pH 8), 44 mM boric acid, 2 mM Na 2 -EDTA) at 140V for 1.5 hours. Gels were subsequently stained with in ethidium bromide for 15 minutes and visualised in a Gel Doc 2000 imaging cabinet (BioRad, Hercules, CA, USA) and documented using GelDoc and Quantity One 4.1.0 (BioRad, Hercules, CA, USA). 4.2.7.3 16S rDNA Sequencing The PCR products from section 4.2.7.2 were purified using the Quiquick PCR purification kit 250 (Qiagen Inc., Valencia, CA, USA) and the sequence PCR reaction was performed using the A B I PRISM™ BigDye Terminator Cycle Sequencing Ready Reaction kit (PE Applied Biosystems, Foster City, CA, USA). The sequence PCR reaction was performed in a total reaction volume of lOpl, with the final primer concentration of 0.32pM. Primers used in the initial PCR reaction were also used for the sequence PCR reaction. The sequence PCR reaction was performed with 25 cycles of denaturing (96°C for 10s), annealing (50°C for 5s) and extension (60°C for 4 minutes). The sequence products were purified by ethanol precipitation. Samples were sequenced on a ABI PRISM™ 310 Genetic Analyzer (Perkin Elmer, Wellesley, M A , USA). Consensus sequences were produced using Sequence Navigator 1.0.1 software (PE Applied Biosystems, Foster City, CA, USA). Multiple sequence alignments were performed using the ClustalW software at E M B L (Thompson et al 1994). Sequences were 88 compared to known sequences using B L A S T search (Altschul et a. 1990) in the GenBank database (National Center for Biotechnology Information, NCBI, USA). 4.2.7.4 NifH Gene PCR Amplification The four bacterial isolates from the interior tissue of T E M were screened for the presence of the nifH gene by PCR amplification using the primers, nijH forward (5' -T G Y G A Y C C N A A R G C N G A - 3 ' ) and nifH reverse (5 ' -ADNGCCATCATYTCNCC-3 ' ; where Y=T or C, R=A or G, D=A, G or T and N=A, C, G, or T, Zehr and McReynolds 1989). These primers will yield a PCR product of approximately 360bp (Braun et al. 1999, Widmer et al. 1999, Poly et al. 2001). The methods followed for the PCR reaction were similar to those outlined in Braun et al. (1999). The PCR amplification was performed in a total volume of 50 pi by combining 0.5 pi of 10 X Red Taq polymerase reaction buffer without MgCL;, 0.2 p M of each primer, 1.0 p M MgCL;, 200 p M of each deoxyribonucleoside triphosphate dATP, dCTP, dTTP, and dGTP (Amersham Biosciences, Sunnyvale, CA, USA), 2.5 Units of Red Taq Polymerase (Sigma-Aldrich, St. Louis, MO, USA) and 0.5 pi of bacterial cell suspension as the template. The final volume (50 pi) was attained with autoclaved Mil l iQ water. PCR amplifications were performed for 35 cycles of denaturation at 94°C for 1 minute, annealing at 57°C for 1 minute and extension at 72°C for 1 minute using a PCR thermal cycler (Gene Amp PCR system 2400, Perkin Elmer, Wellesley, M A , USA) A final extension for 10 minutes was at 72°C. 4.2.7.5 NijH Gene Sequencing NifH PCR products were purified using a similar procedure to that for 16S D N A as described in section 4.2.7.3. The sequence PCR reaction was performed in a total reaction 89 volume of 10 pi, with a final primer concentration of 0.32 pM. Primers used in the initial PCR reaction were also used for the sequence PCR reaction. The sequence PCR reaction was performed with 25 cycles of denaturing (96°C for 10s), annealing (50°C for 5s) and extension (60°C for 4 minutes). The sequence products were purified by ethanol precipitation. Samples were sequenced on a ABI PRISM™ 310 Genetlic Analyzer (Perkin Elmer, Wellesley, M A , USA). Consensus sequences were produced by using Sequence Navigator 1.0.1 software (PE Applied Biosystems, Foster City, CA, USA). Multiple sequence alignments were performed using the ClustralW software at E M B L (Thompson et al 1994). Sequences were compared to known sequences using B L A S T search (Altschul et al. 1990) in the GenBank database (National Center for Biotechnology Information, NCBI, USA). 4.2.8 Nitrogenase Activity Analysis Bacterial nitrogenase activity was analysed using a modification of the acetylene reduction assay (ARA) as described by Hardy et al. (1968). Briefly, the four bacterial isolates from the interior and the eighteen isolates from the surface of S. tomentosus T E M were transferred from C C M agar to 25 ml gas chromatograph vials containing 15 ml of C C M liquid media. Six vials were inoculated for each isolate, three samples with all of the components (bacteria, C C M media and acetylene, treatment A), two samples with no acetylene (bacteria and C C M media alone, treatment B), and one sample without bacteria (CCM media, acetylene and no bacteria, treatment C). The vials were sealed with caps containing inert, non-reactive Teflon coated, silicon septa. Each vial was mixed for 10 seconds using a vortex. Isolates were incubated for three days at 24°C on an orbital shaker. After the initial incubation period, 10% of the headspace volume of the test sample vials (1ml) was extracted using a gas tight chromatographic syringe and replaced with 1ml of purified acetylene (Praxair, Vancouver, 90 Canada). Acetylene added to the treatment A and C vials but was not added to the treatment B vials. A l l vials were allowed to incubate for one week after the addition of the acetylene. After the incubation period, all vials were tested for ethylene production by extracting of lml of the headspace gas and injecting it into a Hewlett Packard 5400 FID Gas Chromatograph fitted with a 2 m x 2.1 mm 80/100 mesh, Porapack R column. Nitrogen was used as the carrier gas, hydrogen and oxygen were used for flame ionization. The injection temperature was 105°C, FID temperature was 130°C and the oven maximum was 100°C. Treatment A samples were concluded to have positive acetylene reduction (nitrogenase activity) i f ethylene production exceeded background ethylene levels from the treatment B and C vials. Background ethylene levels in treatment B and C vials ranged from between 0 nmoles ml"1 to 0.635 nmoles ml"1. In contrast, positive results for bacteria samples ranged from 14.117 nmoles ml"1 to 17.728 nmoles ml"1. 4.2.9 Fluorescent Microscopy of Bacteria within Suillus tomentosus Tubercles Thirty single tubercle samples were placed in mounting wax on glass microscope slides for dissection. Samples were dissected by hand using a flat double-sided razor blade, cutting slices approximately 10 pm thick. Excess wax was removed from the slices which were transferred to clean microscope slides. The first set of samples were stained with a 1:10,000 dilution of acridine orange to distilled water for 7 minutes. Excess stain was washed off the slides and cover slips were placed over the sample tissue. A second set of samples were stained with itacLight Live/Dead fluorescent enumeration dye (Molecular Probe, Eugene, USA) for 15 minutes. ZtacLight Live/Dead fluorescent dye consists of two nucleic acid-binding stains: SYTO 9 and propidium iodide. These stains differ both in their spectral characteristics and in their ability to penetrate bacterial cells (Molecular Probe, Eugene, USA). SYTO 9 stains all live cells green while propidium iodide penetrates cells whose cell membrane has been damaged, 91 staining them red. Excess stain was washed off and a glass cover slip was placed on the samples. Slides were examined using a Zeiss, Axioplan light microscope with a mercury lamp fluorescent light source and a 35mm camera (Zeiss, Germany). Observed bacteria were characterised by their shape (rod or cocci) and their size. Photomicrographs were also taken to document the presence of bacteria. 4.3 RESULTS 4.3.1. Bacterial Isolations From all of the isolation tests performed on the interior tissue of S. tomentosus T E M , only four colony types were isolated when plated onto nitrogen deficient C C M media (Table 4.1). The isolates were initially differentiated on the basis of their colony morphological appearances (shape of colony, texture, consistency, opacity and colour). The colonies identified as white-clear, white-cloudy, yellow-cloudy and red were subsequently labelled II, 12,13 and 14. On four of the isolation sampling sessions, during mid to late summer of each year, all four colony types (II -14) were isolated. However, on two of the sample sessions, early spring in both 1998 and 2000, only three colony types were isolated (II-13) and on one occasion, late fall 2000, only one was observed (Il)(Table 4.1). Table 4.1: Colony appearance of bacteria isolates from interior tissue of Suillus tomentosus tubercles (mycorrhizal root tips and interstitial hyphae). Isolate Il-Clear, I2-Cloudy, I3-Red, and I4-Yellow Year Month Total Number Bacterial Colony Types of Isolates Identified 1997 July 4 II, 12,13,14 = = = September 4 II, 12,13,14 1998 May 3 11,12,13 July 4 II, 12,13,14 September 2 II, 12 2000 May 3 11,12,13 July 4 II, 12,13,14 October 1 II 92 In contrast, isolations from the surface of S. tomentosus T E M produced a total of eighteen isolates when plated on nitrogen deficient C C M media (Table 4.2). A l l isolates from the surface of T E M were identified in a similar manner to that for the bacteria from the inner tissue of T E M . A l l isolates were given a separate identification number even though some of the isolates appeared morphologically similar. The number of culturable isolates on the surface of T E M were lower in early spring and late fall than mid-summer months. The lowest number of isolates (two) was observed in October 1998 and the highest (eighteen) was observed in July 2000 (Table 4.2). 4.3.2 Initial Bacterial Identification Bacteria identification from interior tissue of S. tomentosus T E M by BIOLOG analysis identified colony types II and 12 to the genus Paenibacillus but not to species. The BIOLOG system did not provide identifications for colony types 13 and 14 (Table 4.3). Three different sets of bacterial isolates (II -14) were tested using BIOLOG analysis and all three sets produced the same results. GC F A M E analysis identified colony type II as Paenibacilluspabuli (ex Schie.) N . and colony type 13 as Micrococcus luteus. (Schr.) C. GC F A M E was unable to distinguish between Paenibacilluspolymyxa (Praz.) Ash et al, comb. nov. and Paenibacillus Table 4.2: Colony appearance of bacterial isolates from the surface of Suillus tomentosus tubercles Year Month Total Number Bacterial Colony Types of Isolates Identified 1997 July 16 T1-T16 ' September 9 T2-T9,T12 1998 May 11 T3-T7,T8-T13 July 18 T1-T18 September 12 T3 - T9, T13 - T18 2000 May 10 T2-T12 July 17 T2-T18 October 2 T3, T18 93 Table 4.3: Identification of bacteria isolates from interior tissue of Suillus tomentosus tubercles using BIOLQG analysis and GC FAME analysis Colony Type B I O L O G analysis G C F A M E analysis 11 Paenibacillus sp. Paenibacillus pabuli 12 Paenibacillus sp. Paenibacillus sp. 13 Unidentified Micrococcus luteus 14 Unidentified Methylobacterium sp. pabuli for colony type 12 and unable to distinguish between Methylobacterium extorquens (Urak. and Kom.) B. and G., comb. nov. and Methylobacterium mesophilicum (Aust. and Good.) G. and B., comb. nov. for colony type 14 (Table 4.3, Appendix D, Table D- l ) . GC F A M E analysis of bacteria isolates from the surface of S. tomentosus T E M revealed that most species on the surface were from the genus Pseudomonas (Table 4.4). Other genera identified were Burkholderia, Curtobacterium, Sphingobacterium, Xanthomonas and Xanthobacter. Isolates TI , T9 and TI 1 were visually identified as actinomycetes. GC F A M E . was unable to distinguish isolates T2, T3, T5, T8, T10, T13, T14, T15, T16, T17 and T18 beyond the genus level. Only three isolates were identified to the species level by GC F A M E ; T6 and T12- Pseudomonasputida (Trev.) M . , and T7- Pseudomonas fluorescens Migu. A l l isolates identified to only genus had multiple species identifications that were not distinguishable by GC F A M E analysis (Appendix D, Table D-2). None of the species identified from the surface of T E M were found in the interior tissue of T E M and none of interior species were found on the surface (Tables 4.3 and 4.4). GC F A M E analysis was also conducted three times on three different sets of bacterial isolates from the inner tissue of T E M and from the surface of T E M . 4.3.3 16S rDNA Sequencing Identification Identification of the bacterial isolates from the interior tissue of S. tomentosus T E M by 16S rDNA sequence analysis confirmed BIOLOG and GC F A M E analysis of each of the four 94 Table 4.4: Gas chromatography Fatty Acid Methyl Ester (GC FAME) identification analysis of surface isolated bacteria from Suillus tomentosus tubercles Bacteria Isolate G C F A M E analysis Bacteria Isolate G C F A M E analysis TI Actinomycete T10 Sphingobacterium spp. T2 Xanthomonas spp. T i l Actinomycete T3 Pseudomonas spp. T12 Pseudomonas putida T4 Xanthobacter spp. T13 Burkholderia spp. T5 Pseudomonas spp. T14 Bacillus spp. T6 Pseudomonas putida T15 Psuedomonas spp. T7 Pseudomonas fluorescens T16 Curtobactehum spp. T8 Pseudomonas spp. T17 Psuedomonas spp. T9 Actinomycete T18 Burkholderia spp. isolates to the genus level (Table 4.5). Isolate II was identified as Paenibacillus amylolyticus (Naka.) Ash et al., comb. nov. by sequence analysis in contrast to the GC F A M E identification as P. pabuli. Isolates 12 and 14 were further identified by sequence analysis to the species Paenibacillus amylolyticus and Methylobacterium mesophilicum, respectively. Sequence analysis confirmed GC F A M E identification of isolate 13 t o M luteus (Table 4.5). Identification of the bacterial isolates from the surface of S. tomentosus T E M by 16S rDNA sequence analysis also confirmed the GC F A M E analysis of each of the four isolates to the genus level (Table 4.5). Isolate T6 was identified as Pseudomonas costantinii by sequence analysis whereas it was identified as Pseudomonas putida by GC F A M E analysis. Isolate T14 was identified as Pseudomonas migulae by sequence analysis whereas it was identified as Bacillus spp. by GC F A M E . Sequence analysis confirmed GC F A M E analysis of isolate T7 to Pseudomonas fluorescens. Sequence analysis furthered the identity of isolate T13 to Burholderia glathei. 4.3.4 NifH Gene PCR and Sequencing Amplification of the nifH gene for P. amylolyticus (II, 12) and M. mesophilicum (14) revealed an amplicon of 370bp, consistent with reports of other nifH genes from various other 95 species of nitrogen fixing bacteria (Zehr et al. 1995, Rosado et al. 1998, Achouak et al. 1999) (Fig. 4.1). Rhizobium leguminosarum (Fran.) F., a known N 2-fixing bacteria, was used as a comparative control for the nifH gene, displayed an amplicon at the same position as isolates II, 12 and 14. Isolate 14 showed a larger, less distinct band at 370bp when compared to isolates II, 12, and R. leguminosarum. Isolate 13, M. luteus, did not show a nifH gene amplicon (Fig. 4.1). Single PCR amplification with nifH forward and nifH reverse primers produced multiple bands other than 370bp for all bacteria isolates. Sequencing of the nifH amplicons from the three isolates that showed nifH amplicon was unsuccessful due to equipment failure. 4.3.5 Nitrogenase Activity (Acetylene Reduction) Nitrogenase activity was only observed for two species of bacteria from the interior tissue of S. tomentosus tubercles, Paenibacillus amylolyticus (II, 12) and Methylobacterium mesophilicum (I4)(Table 4.6). In all three trials, isolate II of P. amylolyticus showed positive nitrogenase ability, whereas isolate 12 of P. amylolyticus showed inconsistent nitrogenase activity. Isolate 14, M. mesophilicum showed positive nitrogenase activity in two of the three trials (Table 4.6). No nitrogenase activity was detected f o r M luteus (13) in any of the trials, nor from any of the species of bacteria from the surface of S. tomentosus T E M (Table 4.6). Table 4.5: Identification of bacteria isolates from interior and surface tissue of Suillus tomentosus tubercles using 16S rDNA sequence analysis T E M Location Bacteria Isolate 16S rDNA Sequence Interior 11 Paenibacillus amylolyticus 12 Paenibacillus amylolyticus 13 Micrococcus luteus 14 Methylobacterium mesophilicum Surface T6 Pseudomonas costantinii T7 Pseudomonas fluorescens T13 Burkholderia glathei T14 Pseudomonas migulae 96 4.3.6 Fluorescent Microscopy of Bacteria within Suillus tomentosus Tubercles Fluorescent microscopy of cross sections through S. tomentosus T E M using acridine orange revealed small rod-shaped bacteria, 1 to 3 pm long by 0.2 to 1 pm wide, among the interstitial hyphae (Fig. 4.2). Bacteria were observed as conspicuous green cells next to the hyphae which also fluoresced green. Some bacteria were clustered together around a hyphal remnant, whereas others appeared attached to a hyphal strand (Fig. 4.2). Figure 4.3 shows a cross sectional view of acridine orange stained ectomycorrhizal root tip, within a S. tomentosus tubercle, showing bacteria attached to the surface of the root tip. Bacteria appear to be rod shaped, 2 to 5 pm in length and 0.3 to 1 pm in width, and are loosely scattered along the surface of the root tip. The bacteria appear to be closely associated with hyphae of the mycorrhizal mantle and surface of the root tip. The red cluster-like structures are unidentified, although they may be lOOObp Figure 4.1: PCR-amplified nifH genes from bacterial isolates II to 14 isolated from interior tissue of Suillus tomentosus tubercles. nifH gem amplicons at 370bp (arrow).Lane 1-PCR ladder, Lane 2- Rhizobium leguminosarum, Lane 3-isolate II, Lane 4-isolate 12, Lane 5-isolate 13 and Lane 6-isolate 14. 97 deformed fungal hyphae, or deformed root tip epidermal cells (Fig. 4.3). The root tip cells are out of focus in order to visualise the bacteria present in the various layers of tissue. A cross section through a S. tomentosus tubercle stained with LIVE/DEAD® fluorescent dye shows "live" bacteria, which appear green, clustered around on the surface of a mycorrhizal root tip within the tubercle (Fig. 4.4). Rod shaped and cocci-shaped bacteria are associated with Table 4.6: Nitrogenase activity of bacterial isolates from Suillus tomentosus tubercles as measured by acetylene reduction analysis (ARA). Acetylene reduction ability is indicated by "+"with a range of ethylene production from 14.117 nmoles/ml to 17.728 nmoles/ml and no acetylene reduction ability is indicated by "--" with an ethylene production value of 0 nmoles/ml. isolates 11 to 14 from interior tissue of tubercles, isolates TI to TI 8 from surface of tubercles Isolate Species Acetylene Reduction Assay Trial 1 Trial 2 Trial 3 11 Paenibacillus amylolyticus + + + 12 Paenibacillus amylolyticus + 13 Micrococcus luteus _ _ _ 14 Methylobacterium extorquens + - + TI Actinomycete - - -T2 Xanthomonas sp. - - -T3 Pseudomonas sp. - - -T4 Xanthobacter sp. _ _ _ T5 Pseudomonas sp. _ _ _ T6 Pseudomonas putida - - -T7 Psuedomonas flourescens - - -T8 Pseudomonas sp. - - -T9 Actinomycete - - -T10 Sphingobacterium sp. • - -T i l Actinomycete - - -T12 Pseudomonas putida _ T13 Burkholderia sp. -T14 Bacillus sp. _ T15 Psuedomonas sp. - - -T16 Curtobacterium sp. - - -T17 Psuedomonas sp. - - -T18 Burkholderia sp. - - -98 the surface and some appear to be attached to a hyphal element that is protruding out from the mycorrhizal mantle. Rod shaped bacteria were 2 to 4 pm in length and 0.3 to 0.5 pm in width while cocci bacteria were 0.5 to 1 pm in diameter (Fig. 4.4). Fluorescent light microscopy using LIVE/DEAD® bacterial dye of a cross section through an ectomycorrhizal root tip from within S. tomentosus tubercles, revealed rod shaped bacteria 2 to 4 pm in length and 0.5 to 1 pm in width surrounding cortical cells within the ectomycorrhizal element (Fig. 4.5). The bacteria are consistent in shape and size with descriptions of Paenibacillus spp. as described in Bergey's Manual of Determinative Bacteriology (1994) and other studies (Nakamura 1984, Shida et al. 1997). Bacteria are visualised as "live" green rods as opposed to "dead" or "dying" yellow to red rods (Fig. 4.5). The bacteria appear as attached groupings or clusters surrounding the cortical cells (Fig. 4.6), and appear to be associated with the hyphae of the ectomycorrhizal Hartig net. Figure 4.2: Cross section of Suillus tomentosus tubercle showing bacteria (white arrow) stained with acridine orange fluorescent dye amongst interstitial tubercle hyphae. Hyphae appear as green tubes, notice hyphal septa (light green bands bisecting hyphae). White scale bar equals 20 pm. 99 Figure 4.3: Surface of ectomycorrhizal root tip within Suillus tomentosus tubercle stained with acridine orange fluorescent dye. Bacteria appear as green rods (white asterisks), H-a hyphal remnant. Red cluster-like structures in upper right corner are unidentified, possibly fungal hyphae or deformed root epidermal cells. White scale bar equals 20pm. Figure 4.4: Ectomycorrhizal root tip surface within Suillus tomentosus tubercle stained with LIVE/DEAD® fluorescent dye. Bacteria appear green (white arrows), hypha of mantle (H), mycorrhizal root surface (MR). White scale bar equals 20 pm. 100 Figure 4.5: Cross section through ectomycorrhizal root tip within Suillus tomentosus tubercle dyed with LIVE/DEAD fluorescent bacteria dye. Bacteria appear as green (live) rods surrounding cortical cells of ectomycorrhizal root tip (black arrows). Dead or dying bacteria appear as yellow and red rods. Smaller cortical cells can be seen in the background (c). Black scale bar equals 20 pm. Figure 4.6: Close up of cross section through ectomycorrhizal root tip within Suillus tomentosus tubercle. Bacteria (black arrows) can be see surrounding enlarged cortical cells (within white brackets) within the mycorrhizal root. Black scale bar = 20pm. 101 4.4 DISCUSSION Mycorrhizal associated bacteria were observed with S. tomentosus T E M on Pinus contorta. The presence of bacteria from both the surface of tubercles as well as within the tubercle structure extends the findings of L i et al. (1992). Observations of the bacterial isolates able to grow on nitrogen deficient media from both the surface and the interior of T E M revealed that the number of isolates appeared to increase from a low number in the spring of each year to a maximum number of isolates during middle of the summer, followed by a decreased in late fall. Since a formal population study was not carried out, these observations, while interesting, may not reflect reproducible population dynamics for bacteria of T E M . A 'seasonal' distribution of the number of bacterial isolates would be consistent with S. tomentosus tubercle seasonal formation, development and senescence (Chapter 2). It has been shown that exudates from ectomycorrhizae on Pinus sylvestris positively influence associated bacterial community structure and development (Heinonsalo et al. 2000). It has also been demonstrated that external mycelium of ectomycorrhizae play an important role in distributing plant-derived carbohydrates into the soil of the mycorrhizosphere (Sdderstrom 1992, Bending and Read 1995). This distribution of carbohydrates by external mycelium can, in turn, result in the density of bacteria associated with mycelium being similar to that of the bacteria associated with the mycorrhizal root (Timonen et al. 1998). In contrast, bacterial activity has been shown to be reduced in the presence of specific ectomycorrhizal hyphae in the soil (Olsson et al. 1996b), suggesting a possible repressive influence of the hyphae or ectomycorrhizal exudates. These differing influences of ectomycorrhizal hyphae and exudates may be one reason why the culturable bacterial numbers differed in the interior of tubercles compared to surface isolations. Not only was the number of culturable bacteria larger on the surface but there was no overlap in the species detected between the two microhabitats. 102 It is interesting to speculate that these differences may suggest that exudates from ectomycorrhizal roots may differ from those of mycelium or hyphae, creating different microhabitats as reflected in the bacterial species composition. Furthermore, the internal tubercle environment may create a microhabitat that is conducive for growth of specific bacteria species to the exclusion of other species more commonly found in the mycorrhizosphere (chapter 5 & 6). One might also argue that the environment on the surface of tubercles is not hospitable for the bacterial species that were found in the interior tissue of tubercles. Environmental factors could be in the form of aerobic/ anaerobic/ microaerophillic growth conditions, specific nutrient needs, or higher levels of competition from more dominant bacterial species. This type of specificity directed by host plant physiology for specific bacterial species has been well documented for species of Rhizobium, Bradyrhizobium and plant growth promoting bacteria (Chanway et al. 1991). The identification of bacterial isolates from both within and on the surface of S. tomentosus tubercles was, for the most part, consistent between all of the methods used. Even though BIOLOG analysis was used only on the bacterial strains from within tubercles, it became evident that this method was the least useful because it was only able to distinguish strains II and 12 to the genus level. Although this was the case, identification of II and 12 to the genus Paenibacillus was consistent with the findings of both GC F A M E and 16S rDNA analysis. The agreement between all three methods allows for greater confidence in identification of the bacterial strains to the genus. GC F A M E analysis was able to further the findings from BIOLOG analysis by identifying some of the isolates to the species level. For example, isolate II was identified to the species Paenibacillus pabuli and 13 to the species Micrococcus luteus. GC F A M E was unable to identify all of the isolates to a single species, for example, 12 was identified as either Paenibacillus polymyxa or Paenibacillus pabuli and 14 was identified as either 103 Methylobacterium extroquens or Methylobacterium mesophilicum. GC F A M E was only able to identify two of the four isolates within tubercles and three of the eighteen isolates from the surface of tubercles to the species level. This low identification rate shows that GC F A M E is less able to identify bacteria to the species level. These results are not surprising since GC F A M E profiles are compared to a database that is not complete and many species profiles, even closely related species, are not in the database (pers. comm. Mclnroy 2001). GC F A M E is also limited because bacteria that are closely related may have profiles that are too similar to distinguish by fatty acid analysis (pers. comm. Mclnroy 2001). The results from the 16S rDNA analysis appear to confirm the limitations of GC F A M E species identification because 16S rDNA analysis revealed strains II and 12 to be Paenibacillus amylolyticus and strain 14 as Methylobacterium extroquens. GC F A M E analysis does have merit when profiling bacterial communities to determine the functional groups that are present but when identifying individual bacterial strains, confirmation of the identification using 16S rDNA sequencing is recommended. Although discrepancies exist between the identities obtained by the two methods, the species identified for strains II and 12 are very closely related (Shida et al. 1997, Achouak et al. 1999). In fact, P. pabuli and P. amylolyticus are located on the same phylogenetic arm with a bootstrap value of 923 (Appendix D, Fig. D- l ) . P. polymyxa and P. amylolyticus are less closely related phylogenetically but nonetheless, are within the same phylogenetic branch, (bootstrap value of 758)(Appendix D, Fig. D-l ) . From this, it becomes easy to understand how a discrepancy might be observed when using GC F A M E identification. More importantly, all three isolates identified by the two methods belong to the same genus of bacteria, which is Paenibacillus (Ash et al. 1993). The genus Paenibacillus represents a relatively newly described genus that is known to encompass several well-known nitrogen fixing species including Paenibacillus polymyxa, Paenibacillus macerans (Schar.) Ash et al, 104 comb. nov. and Paenibacillus azotofixans (Seld. et al. ) Ash et al, comb. nov. that used to belong to the genus Bacillus (Abdel Wahab 1975, Seldin et al. 1984). It is thought that most, if not all of the species within the genus Paenibacillus are capable of nitrogen fixation but this has yet to be demonstrated. A recent study by Achouak et al. (1999) reported nitrogenase activity in five more species of Paenibacillus, including P. larvae (White) Ash et al, comb, nov., P. latus (Naka.) Heyndrickx et al, comb, nov., emend., P. peoriae (Mont, et al.) Heyndrickx et al, comb, nov., emend., P. pabuli and P. amylolyticus. The two isolates of P. amylolyticus identified and tested for nitrogenase activity in this study showed positive results. Isolate II consistently showed in vitro nitrogenase activity whereas isolate 12 was inconsistent in this regard. The latter result is similar to the finding of Achouak et al (1999) for the single P. amylolyticus strain that they tested. Differences in nitrogenase activity have also been observed in P. polymyxa (Guemouri-Athmani et al. 2000). Inconsistent nitrogenase activity could lead to the conclusion that the species in question is not a nitrogen-fixing bacterium or at least has very limited ability. Achouak et al. (1999) suggested that in order to determine if a bacterial species is capable of nitrogen fixation, it should be tested for A R A and screened for the presence of the nifH gene, the genetic determinant of the Fe protein of nitrogenase. The nifH gene and gene product are quite conserved (Howard and Rees 1996) and have been used extensively in the past 10 years to identify nitrogen-fixing bacterial species (Zehr and McReynolds 1989, Kirshtein et al. 1991, Ueda et al. 1995, Zehr et al. 1997, 1998, Braunera/. 1999). Achouak et al. (1999) detected only a "faint" nifH amplicon with their strain of P. amylolyticus and found that it had a completely different sequence than the expected nifH sequence from P. azotofixans. From this, they suggested that obtaining an amplicon with the nifH primers is not enough to infer the presence of a «//gene, and confirmation by sequencing is necessary. An alternative explanation for the discrepancy observed by Achouak et al. (1999) 105 may be that even though the nifH gene and gene product are quite conserved, mainly at the amino acid sequence level (Young 1992), small variations in the gene sequence do occur. These observations have been used to differentiate nitrogen fixing bacterial groups (Zehr et al. 1995, Ohkuma et al. 1996, Rosado et al. 1998). The "faint" nifH amplicon observed by Achouak et al. (1999) contrasts with the results from this study, where both strains of P. amylolyticus tested for the nifH gene showed "strong" amplicons. Although the nifH amplicons in this study were not successfully sequenced, the presence of "strong" nifH amplicons combined with positive A R A results for both strains of P. amylolyticus tested, suggest that both strains are nitrogen-fixing bacteria. The observed differences in in vitro nitrogenase activity of the two strains in this study could be due to how each species is affected by factors such as; whether the isolates were shaken during the incubation, their ability to grow on C C M , the affects of acetylene on their growth, and possibly, differences in their nifH gems. Differences in this gene have been observed in other species of Paenibacillus, namely P. polymyxa and P. azotofixans where the differences have been used to distinguish between different strains (Rosado et al. 1998, Seldin et al. 1998). Seldin et al. (1998) determined that different strains of P. azotofixans occurred in the rhizosphere versus the non-rhizosphere of maize plants. They concluded that these differences might, in part, be due to genetic expression differences, which in turn, results in differential selection by the host plant. It is possible that the observed differences in nitrogenase activity in this study for P. amylolyticus strains may be affecting where each strain occurs in S. tomentosus T E M for similar reasons. The fluorescent microscopy done in this study revealed that bacteria were within ectomycorrhizal root tips as well as associated with interstitial hyphae within S. tomentosus tubercles. Finding bacteria in these two "zones" and no where else in the tubercle may indicate that these locations are beneficial to bacterial growth. These "zones" may differ somewhat 106 creating different microhabitat characteristics where selection for the bacterial species occurs. This type of "zoning" effect occurs in root nodules on legume and non-legume plants, where effective nitrogen-fixing bacteria reside within the nitrogen fixing zone close to the host plant circulatory system and non-effective bacteria reside outside of this zone close to the root/soil interface (Richards 1987, Newcomb and Wood 1987). Paenibacillus amylolyticus was not the only nitrogen fixing bacteria residing within S. tomentosus tubercles. A second species, Methylobacterium mesophilicum also showed positive A R activity. This result is somewhat surprising since bacteria from this genus are facultative methylotrophs capable of growing on a wide range of multi-carbon substrates (Green 1992). These bacteria are not known to be able to fix nitrogen. Nevertheless, a recent study has proposed that the genus Methylobacterium is a fourth branch of the rhizobial phylogenetic tree within the subclass of a-Proteobacteria (Appendix D, Fig. D-2)(Sy et al. 2001). Sy et al. (2001) proposed this relationship on the basis of a Methylobacterium species that they nameM nodulans. They determined thatM nodulans was a species of Methylobacterium previously undescribed. It contains the structural nodulation gene nodA, involved in the formation of nodules on the legume Crotalaria, and is capable of fixing nitrogen. They also propose the relatedness o f M nodulans to the other rhizobium bacterial groups based on nodA gene analysis and methanol oxidation structural gene analysis (Appendix D, Fig. D-3a, D-3b). The results from my analysis o f M amylolyticus appear to support the findings of Sy et al. (2001). The determination of a nifH amplicon within M. mesophilicum and its associated A R A suggests that M. nodulans is not the only nitrogen fixing species within the genus Methylobacterium. It is noteworthy that, although rhizobia have been studied for approximately 100 years, fewer than 50 symbionts of the 750 known legume genera have been characterised; therefore, there may be other species of bacteria within this group also capable of fixing nitrogen that have not yet been characterised. 107 This study is the first to report M. mesophilicum as a nitrogen-fixing species within the genus Methylobacterium. These findings help support that symbiotic nitrogen fixation is not restricted to species like Rhizobium, Frankia, or Azospirillum and that, potentially many unknown soil microbes are capable of contributing to nitrogen inputs in natural ecosystems. Further analysis of this species is required to determine if M. mesophilicum also processes the nodA gene and whether nodA is functionally important in the formation of S. tomentosus tubercles. The fluorescent microscopy work done in this study does not help identify the bacteria observed because the dyes used are not species-specific. Although the bacteria observed show the general morphological features of P. amylolyticus and M. mesophilicum reported in the literature (Nakamura 1984), it can not be stated for certain that the observed bacteria were P. amylolyticus orM. mesophilicum. It is possible that the bacteria observed are some other species not identified within the limitations of this study. The pictures do support the idea that, bacteria reside within S. tomentosus tubercles and that there appears to be two locations where the bacteria are found. To verify that the observed bacteria in this study are P. amylolyticus or M. mesophilicum, further research in fluorescent microscopy needs to be done using other molecular techniques such as fluorescent in situ hybridisation (FISH)(Mogge et al. 2000) or immunofluorescent antibody staining (Shishido et al. 1999). These techniques could also be applied to determine all locations of bacteria within tubercles as well as specifics on the ability of each bacterial species to fix nitrogen. This may be accomplished by combining a technique such as FISH with genetic material coding for the nifH gene. Recent work done on Lactarius rufus (Scopoli: Fr.) Fr. ectomycorrhizae on P. sylvestris has also shown that P. amylolyticus is associated with the ectomycorrhizal roots (Poole et al. 2001). In fact, P. amylolyticus was shown to enhance L. rufus mycorrhizal development more than other species of bacteria found associated with the ectomycorrhiza. In addition, 108 Paenibacillus isolates have been shown to promote establishment of arbuscular mycorrhiza (Budi et al. 1999). These findings combined with the findings of this thesis suggest that P. amylolyticus may be a commonly associated bacteria with mycorrhizae and that they may enhance development of various species of mycorrhiza around the world. Further research is needed to confirm this enhancement effect of P . amylolyticus with S. tomentosus T E M . Additionally, more research is needed to characterise the bacterial communities of mycorrhiza and the mycorrhizasphere in order to determine the nature of the relationships between soil bacteria and mycorrhizal fungi. 109 4.5 R E F E R E N C E S Abdel Wahab, A . M . 1975. Nitrogen fixation by Bacillus strains isolated from the rhizosphere of Amnophila arenaria. Plant and Soil 42:703-708. Achouak, W., Normand, P. and Ffeulin, T. 1999. Comparative phylogeny of rrs and nifH genes in the Bacillaceae. International Journal of Systematic Bacteriology 49: 961-967. Altschul, S.F., Gish, W., Miller, W., Myers, E.W. and Lipman, D.J. 1990. Basic local alignment search tool (BLAST). Journal of Molecular Biology 215(3): 403-410. Amaranthus, M.P., L i , C Y . and Perry, D.A. 1990. Influence of vegetation type and madrone soil inoculum on associative nitrogen fixation in Douglas-fir rhizospheres. Canadian Journal of Forest Research 20: 368-371. Ash, C , Priest, F.G. and Collins, M.D. 1993. Molecular identification of rRNA group 3 bacilli (Ash, Farrow, Wallbanks and Collins) using a PCR probe test. Antonie van Leeuwenhock 64: 253-260. Azcon, R., Rubio, R. and Barea, J.M. 1991. Selective interactions between different species of mycorrhizal fungi and Rhizobium meliloti strains, and their effects on growth, N 2 -fixation ( 1 5N) and nutrition ofMedicago sativa L. NewPythologist 111: 399-404. Ballard, R . M . 1986. Overview of forest nutritional problems in the B.C. interior, and methods of diagnosis. In: Proc. Interior forest fertilization workshop. Kamloops, B.C. Feb. 4-5, 1986, B.C. Ministry of Forests. Victoria, B.C. pp. 1-9. Barea, L . M . , Andrave, G., Bianciotte, V., Dowling, D., Lohrke, S., Bonfante, P., O'Gara, F. and Azcon-Agilar, C. 1998. Impact on arbuscular mycorrhiza formation of Pseudomonas strains used as inoculants for biocontrol of soil-borne fungal plant pathogens. Applied and Environmental Microbiology 64(6): 2304-2307. 110 Barea, J. M . and Jeffries, P. 1995. Arbuscular mycorrhizas in sustainable soil plant systems. In: Mycorrhiza Structure, Function, Molecular Biology and Biotechnology. Eds. Hock, B. and Varma, A. Springer-Verlag. Hedalberg. pp. 521-559. Bending, G.D. and Read, D.J. 1995. The structure and function of the vegetative mycelium of ectomycorrhizal plants: V. Foraging behaviour and translocation of nutrients from exploited litter. New Phytologist 130:401-409. Bergey, D.H., Holt, J.G., Krieg, N.R. and Sneath, P.H.A. 1994. Manual for Determinative Bacteriology, 9 t h edition. Williams and Wilkins. Baltimore. Boerner, R.E.J. 1986. Seasonal nutrient dynamics, nutrient resorption and mycorrhizal infection intensity of two perennial forest herbs. American Journal of Botany 73: 1249-1257. Bowen, G.D. and Theodorou, C. 1979. Interaction between bacteria and ectomycorrhizal fungi. Soil Biology and Biochemistry 11: 119-126. Braun, S., Proctor, L., Zani, S., Mellon, M.T. and Zehr, J.P. 1999. Molecular evidence for zooplankton-associated nitrogen-fixing anaerobes based on amplification of the nifH gene. FEMSMicrobiology Ecology 28: 273-279. Budi, S.W., van Tuinen, D., Martinotti, G. and Gianinazzi, S. 1999. Isolation from the Sorghum bicolor mycorrhizosphere of a bacterium compatible with arbuscular mycorrhiza development and antagonistic towards soilborne fungal pathogens. Applied and Environmental Microbiology 65: 5148-5150. Chanway, C P . 1997. Inoculation of tree roots with plant growth promoting soil bacteria: An emerging technology for reforestation. Forest Science 43:99-112. I l l Chanway, C P . and Holl, F.B. 1991. Biomass increase and associative nitrogen fixation of mycorrhizal Pinus contorta seedlings inoculated with a plant growth promoting Bacillus strain. Canadian Journal of Botany 69: 507-511. Chanway, C P . and Holl, F.B. 1992. Influence of soil biota on Douglas-fir (Pseudotsuga menzeisii) seedling growth: the role of rhizosphere bacteria. Canadian Journal of Botany 70: 1025-1031. Chanway, C P . , Radely, R.A. and Holl, F.B. 1991. Inoculation of conifer seed with plant growth-promoting Bacillus strains causes increased seedling emergence and biomass. Soil Biology and Biochemistry 23: 575-580. Dahm, H. 1984a. Generic composition and physiological and cultural properties of heterotrophic bacteria isolated from soil, rhizosphere and mycorrhizosphere of pine (Pinussylvestris). ActaMicrobiologicaPoland 33: 147-156. Dahm, H. 1984b. Metabolic activity of bacteria isolated from soil, rhizosphere and mycorrhizosphere of pine (Pinus sylvestris). Acta Microbiologica Poland 33: 157-162. Deoliveira, V . L . and Garbaye, J. 1989. Microogranisms stimulating the establishment of mycorrhizal symbiosis. A review. European Journal of Forest Pathology 19(1): 54-64. Duponnois, R. and Garbaye, J. 1990. Some mechanisms involved in growth stimulation of ectomycorrhizal fungi and bacteria. Canadian Journal of Botany 68: 2148-2152. Duponnois, R. and Garbaye, J. 1991. Effect of dual inoculation of Douglas-fir with the ectomycorrhizal fungus Laccaria-laccata and mycorrhizal helper bacteria (MHB) in 2 bare-root forest nurseries. Plant and Soil 138(2): 169-176. Duponnois, R., Garbaye, J., Bouchard, D. and Churin, J.L. 1993. The fungus-specificity of mycorrhization helper bacteria (MHBs) used as an alternative to soil fumigation for ectomycorrhizal inoculation of bare-root Douglas-fir planting stocks with Laccaria laccata. Plant and Soil 157:257-262. Fitter, A . H . and Garbaye, J. 1994. Intercations between mycorrhizal fungi and other soil organisms. Plant and Soil 159(1): 123-132. Foster, R. C. and Marks, G. C. 1966. The fine structure of the mycorrhizas of Pinus radiata. Australian Journal of Biological Science 19:1027-1038. Frey, P., Frey-Klett, P., Garbaye, J., Berge, O. and Ffeulin, T. 1997. Metabolic and genotypic fingerprinting of fluorescent Pseudomonads associated with Douglas Y'vr-Laccaria bicolor mycorrhizoshpere. Applied and Environmental Microbiology 63(5): 1852-1860. Frey-Klett, P., Churin, J.-L., Pierrat, J.C. and Garbaye, J. 1999. Dose effect in the dual inoculation of an ectomycorrhizal fungus and a mycorrhiza helper bacterium in two forest nurseries. Soil Biology and Biochemistry 31: 1555-1562. Frey-Klett, P., Pierrat, J.C. and Garbaye, J. 1997. Location and survival of mycorrhiza helper Pseudomonas fluorescens during establishment of ectomycorrhizal symbiosis between Laccaria bicolor and Douglas Fir. Applied and Environmental Microbiology 63(1): 139-144. Gagnon, J., Langois, C.G. and Fortin, J.A. 1987. Growth containerized jack pine seedlings inoculated with different ectomycorrhizal fungi under a controlled fertilization schedule. Canadian Journal of Forest Research 17: 58-62. Garbaye, J. 1994. Helper bacteria: a new dimension to the mycorrhizal symbiosis. New Phytologist 128: 197-210. Garbaye, J. 2000 The role of ectomycorrhizal symbiosis in the resistance of forests to water stress. Outlook on Agriculture 29:63-69. Garbaye, J and Bowen, G.D. 1989. Stimulation of ectomycorrhizal infection of Pinus radiata by some microorganisms associated with the mantle of mycorrhizas. New Phytologist 112: 383-388. 113 Garbaye, J. and Dupponnois, R. 1992. Specificity and function of mycorrhization helper bacteria (MHB) associated with the Pseudotsuga menziesii-Laccaria laccata symbiosis. Symbiosis 14: 335-344. Garbaye, J., Dupponnois, R. and Wahl, J. L. 1990. The bacteria associated with Laccaria laccata ectomycorrhizas or sporocarps: Effect of symbiosis establishment on Douglas-fir. Symbiosis 9: 267-273. Garbaye, J., Churin, J. L. and Dupponnois, R. 1992. Effects of substrate disinfection, fungicide treatments and mycorrhization helper bacteria (MHB) on ectomycorrhizal formation of pedunculate oak inoculated with Laccaria laccata in two bare-root nurseries. Biology and Fertility of Soils 13:55-57. Gehring, C A . and Whitham, T.G. 1994. Comparisons of ectomycorrhizae on Pinyon pines (Pinus edulis; Pinaceae) across extremes of soil type and herbivory. American Journal of Botany 81(12): 1509-1516. Glick, B. R. 1995. The enhancement of plant growth by free-living bacteria. Canadian Journal of Microbiology. 41:109-117. Green, P.N. 1992. The genus Methylbacterium. In: The Prokaryotes. A Handbook on the biology of bacteria: Ecophysiology, Isolation, Identification and Applications. Eds. Balows, A. , Truper, H.G., Dworkin, M . , Harder, W. and Schleofer, K . H . Springer-Verlag. New York. pp. 2342-2349. Guemouri-Athamani, S., Berge, O., Bourain, M . , Mavingui, P., Thiery, J.M. and Heulin, T. 2000. Diversity of Paenibacillus polymyxa population in the rhizosphere of wheat (Triticum durum) in Algerian soils. European Journal of Soil Biology 36:149-159. 114 Haack, S. K., Garchow, H., Odelson, D.A., Forney, L. J and Klug, M . J. 1994. Accuracy, reproducibility and interpretation of fatty acid methyl ester profiles of model bacterial communities. Applied and Environmental Microbiology. 60: 2483-2493. Hardy, R.W.F., Holsten, R. D., Jackson, E.K. and Burns, R.C. 1968. The acetylene-ethylene assay for ^-fixation: laboratory and field evaluation. Plant Physiology 43: 1185-1207. Heinonsalo, J., Jorgensen, K.S., Haahtela, K. and Sen, R. 2000. Effects of Pinus sylvestris root growth and mycorrhizosphere development on bacterial carbon source utilization and hydrocarbon oxidation in forest and petroleum-contaminated soils. Canadian Journal of Microbiology 46: 451-464. Howard, J.B. and Rees, D.C. 1996. Structural basis of biological nitrogen fixation. Chemical Reviews 96: 2965-2982. Ingleby, E.R. and Molina, R. 1991. Interactions among mycorrhizal fungi, rhizosphere organisms, and plants. In: Microbial Mediation of Plant-Herbivore Interactions. Eds. Barbosa, P., Krischik, V .A . and Jones, C.G. John Wiley and Sons. New York. pp. 169-197. Katznelson, H. , Rouatt, J.W. and Peterson, E.A. 1962. The rhizosphere effect of mycorrhizal and non-mycorrhizal roots of yellow birch seedlings. Canadian Journal of Botany. 40: 377-382. Kirshtein, J.D., Paerl, H.W. and Zehr, J. 1991. Amplification, cloning and sequencing of a nifH segment from aquatic microorganisms and natural communities. Applied and Environmental Microbiology 57(9): 2645-2650. Kloepper, J.W. 1993. Plant growth-promoting rhizobacteria as biological control agents. In: Soil Microbial Ecology- Applications in Agricultural and Environmental Management. Ed. Metting, F.B. Marcel Dekker. New York. pp. 255-274. 115 Kloepper, J.W., Leong, J., Tente, M . and Schroth, M.N. 1980. Enhanced plant growth by siderophores produced by plant growth-promoting rhizobacteria. Nature 286: 885-886. Laguerre, G., Rigottier-Gois, L. Lemanceau, P. 1994. Fluorescent Pseudomonas species categorized by using polymeras chain reaction (PCR)/restriction fragment analysis of 16S rDNA. Molecular Ecology 3:479-487. Lane, D.J. 1991. 16S/23s rRNA sequencing. In: Nucleic Acid Techniques in Bacterial Systematics. Eds. Stackebrandt, E. and Goodfellow, M . John Wiley and Sons. New York, pp. 115-175. L i , C Y . and Hung, L .L . 1987. Nitrogen-fixing (acetylene-reducing) bacteria associated with ectomycorrhizae of Douglas-fir. Plant and Soil 98:425-428. L i , C.Y., Massicotte, H.B. and Moore, L .V . 1992. Nitrogen fixing Bacillus sp. associated with Douglas-fir tuberculate ectomycorrhiaze. Plant and Soil 140:35-40. Linderman, R.G. 1988. Mycorrhizal interactions with the rhizosphere microflora: The mycorrhizosphere effects. Phytopathology 78:366-371. Linderman, R.G. and Paulitz, T . C 1990. Mycorrhizal-rhizobacterial interactions. In: Biological Control of Soil-Borne Plant Pathogens. Ed. Hornby, D. C A B International. Wallingford. pp 262-283. MacFall, J.S., Iyer, J., Slack, S. and Berbee, J. 1990. Mycorrhizal phosphorous interaction on red pine {Pinus resinosd). Agriculture Ecosystems and Environment 28: 321-324. Malajczuk, N . 1979. The microflora of unsuberized roots of Eucalyptus calophylla R. Br. and Eucalyptus marginata Donn ex Sm. seedlings grown in soils suppressive and conducive to Phytophthora cinnamomi Rands. II. Mycorrhizal roots and associated microflora. Australian Journal of Botany 27: 255-272. 116 Marx, D.H. , Hatch, A.B. and Mendicino, J.F. 1977. High soil fertility decreases sucrose content and susceptibility of loblolly pine roots to ectomycorrhizal infection by Pisolithus tinctorius. Canadian Journal of Botany 55: 1569-1574. Mogge, B., Loferer, C , Agerer, R., Hutzler, P. and Hartmann, A. 2000. Bacterial community strucutre and colonization patterns of Fagus sylvatica L. ectomycorrhizospheres as determined by fluorescence in situ hybridization and confocal laser scanning microscopy. Mycorrhiza 9: 271-278. Nakamura, L .K. 1984. Bacillus amylolyticus, sp. nov., nom. rev., Bacillus lautus sp. nov., nom. rev., Bacillus pabuli sp. nov., nom. rev., and Bacillus validus sp. nov., nom. rev. International Journal of Systematic Bacteriology 34(2): 224-226. Neal, J.L., Bollen, W.B. and Zak, B. 1964. Rhizoshpere microflora associated with mycorrhiza of Douglas-fir. Canadian Journal of Microbiology 10:259-265. Neal, J.L., Lu, K.C. , Bollen, W.B. and Trappe, J.M. 1968. A comparison of rhizosphere microfloras associated with mycorrhizae of red alder and Douglas-fir. In: Biology of Alder. Eds. Trappe, J.M., Franklin, J.F., Tarrant, R.F. and Hansen, G .M. Pacific Northwest Forest Range Experimental Station. USDA Forest Service, pp. 55-71. Newcomb, W. and Wood, S. 1987. Morphogensis and fine structure of Frankia (Actinomycetales): The Microsymbiont of Nitrogen-Fixing Actinorhizal Root Nodules. International Review of Cytology. 109: 1-88. Ohkuma, M . , Noda, S., Usami, R., Horikoshi, K. and Kudo, T. 1996. Diversity in nitrogen fixing genes in symbiotic intestinal microflora of the termite Reticulitermes speratus. Applied and Environmental Microbiology 62: 2747-2752. 117 Olsson, P. A. , Baath, E . ; Jakobsen, I. and Soderstrom, B. 1996a. Soil bacteria respond to presence of roots but not to mycelium of arbuscular mycorrhizal fungi. Soil Biology and Biochemistry 28(4/5): 463-470. Olsson, P.A., Chalot, M . , Baath, E., Findlay, R.D. and Soderstrom, B. 1996b. Ectomycorrhizal mycelia reduce bacterial activity in a sandy soil. FEMS Microbiology Ecology 21: 77-86. Oswald, E.T. and Ferchau, H.A. 1968. Bacterial associations of coniferous mycorrhizae. Plant and Soil 28: 187-192. Ovreas, L. and Torsvik, V. 1998. Microbial diversity and community structure in two different agricultural soil communities. Microbial Ecology 36:303-315. Poly, F., Ranjard, L., Nazaret, S., Gourbiere, F. and Monorozier, L.J. 2001. Comparison of nifH gene pools in soils and soil microenvironments with contrasting properties. Applied and Environmental Microbiology 67(5): 2255-2262. Poole, E.J., Bending, G.D., Whipps, J.M. and Read, D.J. 2001. Bacteria associated with Pinus sylvestris-Lactarius rufus ectomycorrhizas and their effects on mycorrhiza formation in vitro. New Phytologist 151: 743-751. Ravnskov, S., Nybroe, O. and Jakobsen, I. 1999. Influence of an arbuscular mycorrhizal fungus on Pseudomonas fluorescens DF57 in rhizosphere and hyphosphere soil. New . Phytologist 142: 113-122. Read, D.J., Lewis, D.H., Fitter, A .H. , and Alexander, I.J. 1992. Mycorrhizas in Ecosystems. C A B International. Wallingford. Rennie, R. J. 1980. A single medium for the isolation of acetylene-reducing (dinitrogen-fixing) bacteria from soils. Canadian Journal of Microbiology. 27:8-14. 118 Richards, B .N . and Voigt, G.N. 1964. Role of mycorrhizae in nitrogen fixation. Nature (London) 201:310-311. Richards, B .N . 1987. The Microbiology of Terrestrial Ecosystems. Longman Scientific & Technical. Essex, pp. 313-349. Richter, D.L., Zuellig, T.R., Bagley, S.T. and Bruhn, J.N. 1989. Effects of red pine {Pinus resinous Ait.) mycorrhizoplane-associated actinomycetes on in vitro growth of ectomycorrhizal fungi. Plant and Soil 115: 109-116. Rosado, A.S., Duarte, G.F., Seldin, L. and van Elsas, J.D. 1998. Genetic Diversity of nifH gene sequence in Paenibacillus azotofixans strain and soil samples analyzed by denaturing gradient gel electrophoresis of PCR-amplified gene fragments. Applied and Environmental Microbiology 64(8): 2770-2779. Rouatt, J. W. and Katznelson, H. 1961. A study of bacteria on the root surface and in the rhizosphere soil of crop plants. Journal of Applied Bacteriology 24: 164-171. Sarand, I., Timonen, S., Nurmiaho-Lassila, E.-L., Koivula, T., Haahtela, K., Romantschuk, M . and Sen, R. 1998. Microbial biofilm and catabolic plasmid harbouring degraditive fluorescent psedumonads in Scots pine mycorrhizosphere developed on petroleum contaminated soil. FEMSMicrobiology Ecology 27: 115-126. Sasser, M . 1990a. Identification of bacteria through fatty acid analysis. In: Methods in Phytobacteriology. Eds. Klement, Z., Rudolph, K. and Sands, D.C. Akademiai Kiado. Budapest, pp. 199-204. Sasser, M . 1990b. Identification of bacteria by gas chromatography of cellular fatty acids. MIDI Technical note #101. Schelkle, M . , Ursic, M . and Farquhar, M . 1996. The use of laser scanning confocal microscopy to characterize mycorrhizas of Pinus strobus L. and to localize associated bacteria. Mycorrhizia 6:431-440. 119 Seldin, L. , van Elias, J.D. and Penido, E.G.C. 1984. Bacillus azotofixans sp. nov., a nitrogen-fixing species from Brazilian soils and grass roots. International Journal of Systematic Bacteriology 34:451-456. Seldin, L. , Rosado, A . S , da Cruz, D.W., Nobrega, A., van Elsas, J.D. and Paiva, E. 1998. Comparison of Paenibacillus azotofixans strains isolated from rhizoplan, rhizosphere, and non-root-associated soil from maize planted in two different Brazilian soils. Applied and Environmental Microbiology 64(10): 3860-3868. Shida, O., Takagi, H. , Kadowaki, K., Nakamura, L .K. and Komagata, K. 1997. Emended describtion of Paenibacillus amylolyticus and description of Paenibacillus illinoisensis sp. nov. and Paenibacillus chibensis sp. nov. International Journal of Systematic Bacteriology 47(2): 299-306. Shishido, M , Massicotte, K B . and Chanway, C P . 1996a. Effect of plant growth promoting Bacillus strains on pine and spruce seedling growth and mycorrhizl infection. Annals of Botany 77: 433-441. Shishido, M . , Petersen, D.J., Massicotte, H.B. and Chanway, C P . 1996b. Pine and spruce seedling growth and mycorrhizal infection after inoculation with plant growth promoting Pseudomonas strains. FEMSMicrobiology Ecology 21: 109-119. Shishido, M . , Breuil, C. and Chanway, C P . 1999. Endophytic colonization of spruce by plant growth-promoting rhizobacteria. FEMS Microbiology Ecology 29: 191-196. Smith, S.E. and Read, D.J. 1997. Mycorrhizal Symbiosis. 2nd ed. Academic Press. London. Soderstrom, B. 1992. The ecological potential of the ectomycorrhizal mycelium. In: Mycorrhizas in Ecosystems. Eds. Read, D.J., Lewis, D.H., Fitter, A . H . and Alexander, I.J. C A B International. Wallingford. pp. 77-83. 120 Strzelczyk, E., Dahm, H, Kampert, M . , Pokojska, A. and Rozycki, H . 1987. Activity of bacteria and actinomycetes associated with mycorrhiza of pine (Pinus sylvestris). Angewandte Botanik 61: 53-64. Sy, A. , Giraud, E., Jourand, P., Garcia, N . , Willems, A., DeLajudie, P., Prin, Y . , Neyra, M . , Gillis, M . , Boivin-Masson, C. and Dreyfus, B. 2001. Methylotrophic Methylobacterium bacteria nodulate and fix nitrogen in symbiosis with legumes. Journal of Bacteriology 183:214-220. Thompson, J.D., Higgins, D.G. and Gibson, T.J. 1994. C L U S T A L W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Research 22: 4673-80. Timonen, S., Jorgensen, K.S., Haahtela, K. and Sen, R. 1998. Bacterial community structure at defined locations of Pinus sylvestris - Suillus bovinus and Pinus sylvestris - Paxillus involutus mycorrhizospheres in dry pine forest humus and nursery peat. Canadian Journal of Microbiology 44: 499-513. Torsvik, V. , Gorksoyr, J. and Daae, F.L. 1990. High diversity in D N A in soil bacteria. Applied and Environmental Microbiology 56: 782-787. Ueda, T., Suga, T., Yahiro, N . and Matsuguchi, T. 1995. Remarkable N2-fixing bacterial diversity detected in rice roots by molecular evolutionary analysis of nifH gene sequences. Journal of Bacteriology 177: 1414-1417. van Noordwijk, M . and Hairiah, K. 1986. Mycorrhizal infection in relation to soil pH and soil phosphorous content in a rain forest of northern Sumatra. Plant and Soil 96: 299-302. 121 Varese, G.C., Portinaro, S., Trotta, A., Scannerini, S., Luppi-Mosca, A . M . and Martinotti, G. 1996. Bacteria associated with Suillus grevillei sporcarps and ectomycorrhizae and their effects on in vitro growth of the mycobiont. Symbiosis 21: 129-147. Weetman, G.F. 1988. Nutrition and fertilization of lodgepole pine. In: Proc. Future Forests of the Mountain West: A Stand Culture Symposium, 1986. Ed. Schmidt, W.C. U S D A , Forest. Service General Technical Report. INT-243. pp. 231-239. Widmer, F., Shaffer, B.T., Porteous, L .A. and Seidler, R.J. 1999. Analysis of nifH gene pool complexity in soil and latter at a Douglas fir forest site in the Oregon Cascade mountain range. Applied and Environmental Microbiology 65(2): 374-380. Young, J.P.W. 1992. Phylogenetic classification of nitrogen-fixing organisms. In: Biological Nitrogen Fixation. Eds. Stacey, G., Burris, R. H. and Evans, H. J. Chapman and Hall. New York, NY. pp. 45-86. Zehr, J.P. and McReynolds, L .A. 1989. Use of degenerate oligonucleotides for amplification of the nifH gene from the marine cyanobacteria Trichodesmium spp. Applied and Environmental Microbiology 55: 2522-2526. Zehr, J.P., Mellon, M . , Braun, S., Litaker, W., Steppe, T. and Paerl, H.W. 1995. Diversity of heterotrophic nitrogen fixation genes in a marine cyanobacterial mat. Applied and Environmental Microbiology. 61: 2527-2532. Zehr, J.P., Mellon, M . and Hiorns, W.D. 1997. Phylogeny of cyanobacterial nifH genes: evolutionary implications and potential applications to natural assemblages. Microbiology 143: 1443-1450/ Zehr, J.P., Mellon, M . and Zani, S. 1998. New nitrogen-fixing microorganisms detected in oligotrophic oceans by amplification of nitrogenase (nifH) genes. Applied and Environmental Microbiology 64:3444-3450. 122 Zuberer, D.A. 1987. Collection, isolation, cultivation, and maintenance of associative N-fixing bacteria. In: Symbiotic Nitrogen Fixation Technology. Ed. Elkan, G.H. Marcel Dekker Inc. New York, N Y : pp. 95-125. Zuberer, D.A. 1994. Recovery and enumeration of viable bacteria. In: Methods of Soil Analysis. Part 2. Microbiological and biochemical properties. Eds. Weaver, R.W., Angle, A. and Bottomley, P. Soil Science Society of America. Madison, pp. 127-129. Zuberer, D.A. 1998. Biological Dinitrogen Fixation: Introduction and Nonsymbiotic. In: Principles and Applications of Soil Microbiology. Eds. Sylvia, D. M . , Fuhrmann, J., Ffartel, P. G. and Zuberer, D. A. Prentice-Hall. New Jersey, pp. 295-321. 123 Chapter 5 Nitrogen Fixation Associated with Suillus tomentosus Tuberculate Ectomycorrhizae (TEM) on Pinus contorta 5.1 INTRODUCTION Nitrogen is believed to be one of the most limiting nutrients in the growth of various plant species including many conifer tree species (Johnson et al. 1982, Weetman et al. 1988, Preston and Mead 1994). Due to this, research on nitrogen inputs from nitrogen fixation has been of great interest over the past 50 years. A great deal of research and knowledge has accumulated on the nitrogen fixing capabilities of nodulated legumes. Leguminous plants are typically associated with bacteria from the genera Rhizobium spp., Bradyrhizobium spp. and relatives and are able to fix large quantities of nitrogen (Kinzig and Socolow 1994, Vance 1998, Graham and Vance 2000). Some non-leguminous plants are also symbiotic with bacterial species capable of fixing nitrogen; for example AInus spp., Casuarina spp. and Parasponia spp. (Ekblad and Huss-Danell 1995, Webster etal. 1998, Tjepkema etal. 2000). The nitrogen fixing endosymbiont for bothAlnus spp. and Casuarina spp. is the bacterial genus Frankia, whereas the endosymbiont of Parasponia spp. is also a Rhizobium spp. (Trinick and Hadobas 1995, Webster etal. 1995). Recent research on the symbiotic relationships of leguminous plants has revealed a third organism involved in the symbiosis that appears to be significant in terms of overall nitrogen fixing capabilities. Many leguminous plants are mycorrhizal, specifically with species of arbuscular mycorrhizal fungi, and the inclusion of this third component makes the relationship a tripartite symbiotic system. It has been shown that arbuscular mycorrhizal fungal inoculation with either Rhizobium spp. ox Bradyrhizobium spp. onto leguminous plants significantly increases the amount of nodulation, nodule biomass, overall plant growth and most importantly, 124 nitrogen fixation, compared to plants with bacteria alone (Azcon et al. 1991, Sreenivasa et al. 1995, Singh 1996, Al i Asgharzadeh and Saleh Rastin 1997, Das et al. 1997, Zheng and Song 2000). This mycorrhizal influence is not limited to legumes with Rhizobium spp.or Bradyrhizobium spp. but has also been observed with non-leguminous plants such as Casuarina combined with Frankia spp. (Vasanthakrishna et al. 1994, Ravichandran and Balasubramanian 1999). Additionally, ectomycorrhizal fungi also show a similar influence when combined with Frankia spp. and inoculated on Alnus rubra Bong. (Miller et al. 1992). Associative nitrogen fixation has also been well established as an important nitrogen input for many plant ecosystems. Associative nitrogen fixation is where nitrogen-fixing bacteria are not in intimate symbiotic relations with the host plant roots but instead proximity to the roots and mycorrhizae. Associative nitrogen fixing bacteria with mycorrhizal roots was first suggested by Richards and Voigt (1964) and has become further established during the last 20 years (Chatarpaul and Carlisle 1983, Dawson 1983, Florence and Cook 1984, Cracknell and Lousier 1986, Amaranthus et al. 1990). In these types of relationships, bacterial species other than Rhizobium, Bradyrhizobium and Frankia have been shown to fix nitrogen which may be taken up by the host plant and mycorrhizal fungus. Some of the species that have been identified in these relationships are Azospirilium, Bacillus, and Clostridium (Florence and Cook 1984, L i and Hung 1987, Amaranthus et al. 1990, L i et al. 1992). In fact, some of these bacteria have been called plant growth promoting rhizobacteria (PGPR) and their beneficial effects have been widely researched (Shishido et al. 1996, see review Hallmann et al. 1997). Interactions between bacteria and fungi within the mycorrhizosphere of host plant roots appear to be common and may influence mycorrhizosphere establishment and maintenance (Barea and Azcon-Aguilar 1982, 1983, Linderman 1988). L i and Hung (1987) reported nitrogen-fixing Clostridium spp. and Azospirillum spp. in association with ectomycorrhizae formed by the ectomycorrhizal fungi Laccaria laccata 125 (Scop.:Fr.) Fr., Hebeloma crustuliniforme (Bull.:Fr.) Quel., Rhizopogon vinicolor A. H . Sm. and Thelephora spp. on nursery grown Pseudotsuga menziesii (Mirb.) Franco. They isolated bacteria from surface sterilised ectomycorrhizal root tips, which suggests that bacteria reside within the ectomycorrhizae. In addition, the researchers suggest that phosphorus uptake by the ectomycorrhizal fungus increases and enhances the nitrogen fixing capabilities of the associative nitrogen-fixing bacteria. In an additional study, L i et al. (1992) reported an associative nitrogen fixing Bacillus spp. in association with the T E M formed by the ectomycorrhizal fungus R. vinicolor on P. menziesii. They initially proposed that the bacteria resided within the T E M structure, similar to Rhizobium spp. and legume nodules, but were unable to verify this and concluded that the bacteria were only associated with the tubercle surface. L i et al. (1992) also evaluated the overall contribution of fixed nitrogen by R. vinicolor T E M to P. menziesii nitrogen nutrition and found it was insignificant. The work presented in this thesis (Chapter 4) has shown that nitrogen-fixing bacteria Paenibacillus amylolyticus (Nakamura) Ash et al, comb. nov. and Methylobacterium mesophilicum (Urakami and Komagata) B. and G., comb. nov. reside within T E M formed by Suillus tomentosus (Kauff.) Singer, Snell and Dick on Pinus contorta var. latifolia (Dougl.) Engelm. The presence of nitrogen-fixing bacteria within T E M suggests that T E M may make a contribution to the nitrogen budget of (in this case) P. contorta. The objective of the work described in this chapter was to measure the nitrogen fixing capability of S. tomentosus T E M on P. contorta in situ. In order to evaluate the potential nitrogen fixing capability of T E M in the Sub Boreal Pine Spruce xeric cold (SBPSxc) biogeoclimatic subzone more completely, sampling was conducted at three sites located across the subzone in two stand ages classes. Each site had unique soil characteristics and the stand ages were a young (<40 years old) and an old stand (> 140 years old). 126 5.2 M A T E R I A L S A N D M E T H O D S 5.2.1 Study Sites Nitrogenase activity of Suillus tomentosus T E M on Pinus contorta was measured at three sites located across the SBPSxc biogeoclimatic sub-zone in the Chilcotin Forest district, 150 km west of Williams Lake, B.C., Canada (Fig. 1.1). Each site had unique soil characteristics from the other two sites. At the first site, Alex Graham, the soils were characterised as being dry-sandy loam textured (sub-mesic), derived from basaltic parent material (dry basaltic). Site 2, Puntzi Lake, was characterised by wet-sandy loam textured (mesic) soils derived from basaltic parent material (wet basaltic), and the third site, Nimpo Lake, was characterised by dry-sandy loam textured (sub-mesic) soils derived from granitic parent material (granitic). At each of the sites, samples were collected from two different stand age classes. The stand age classes sampled were class 2 (young stands, < 40 years old, Fig.3.la), and class 8 (old stands, > 140 years old, Fig.3.1b)(Appendix B, Table B - l & Appendix C, Figs. C-l,C-2,C-3). Data were collected once in the spring (May - June) and once in the late summer (August - September) in both 1997 and 1998. As mentioned in Chapter 1, section 1.2, the region covered by the SBPSxc is characterised by cold, dry winters and hot, dry summers (Steen and Demarchi 1991, Steen and Coupe 1997). Forest floors are typically thin (<4 cm) and decomposition is slow. The soils are nutrient deficient with relatively low productivity (Steen and Demarchi 1991, Steen and Coupe 1997). 5.2.2 Evaluation of Nitrogenase Activity Quantitative assessment of nitrogenase activity was performed on P. contorta roots in situ by using an adaptation of the acetylene reduction assay (ARA)(Hardy et al 1968, L i et al. 1992). To conduct the A R A , coarse woody debris (CWD) logs in each stand at each site were selected at random. Each log was carefully taken apart to reveal P. contorta roots with 127 Figure 5.1: Log section taken apart to reveal host root from Pinus contorta with attached Suillus tomentosus tuberculate ectomycorrhizal (arrow). significant T E M development (Fig. 5.1). To ensure random sampling, logs were not selected close to each other to avoid sampling root systems attached to the same tree. Once an appropriate root was found, it was gently excavated from the remaining surrounding woody debris, and cleaned of excess soil and debris (Fig. 5.2, Appendix E, Fig. E - l ) . The intact root system, still attached to the tree, was gently inserted into a rubber septum, which was slotted half way through (Fig. 5.3). Care was taken to attach the septum at a point on the root system well above where the tubercles had formed and on a part of the root where there were no extending short roots or branch roots (Fig. 5.3). The roots with attached septum were then gently inserted through a hole that was cut into the rubber plunger component of a 30 cm 3 plastic syringe. The roots where pulled all the way through the rubber plunger so that the septum could be fitted into the hole that was cut in the plunger (Fig. 5.3). Before the incubation tube was assembled, a 6 ml gas chromatograph retention vial, with an butyl rubber septum placed partially in the opening of the vial, was placed at the bottom of each incubation tube to collect the gas sample for analysis once the A R A was complete (Fig. 5.4). 128 Figure 5.2: Pinus contorta root with Suillus tomentosus tuberculate ectomycorrhizae cleaned of woody debris ready for insertion into incubation tube. The incubation tubes were then completely sealed from the outside atmosphere by tightly fittingthe rubber plunger assembly with the root attached, into the mouth of the incubation tubes and applying an silicon caulking grease agent to the slot in the septum around the root (Fig. 5.4). Care had to be taken not to snap the root off from the host root system while assembling the incubation tubes. Once the system was in place, the incubation tubes were immediately flushed with inert argon gas to lower the oxygen concentration in the tubes to between 1 and 3% (Fig. 5.5). This step was necessary because many N 2-fixing bacteria are microaerophilic or anaerobic (Amaranthus et al. 1990, Aho et al. 1974, Silvester et al. 1982, L i et al. 1992) and the nitrogenase enzyme responsible for nitrogenase, undergoes rapid oxidative damage in the presence of oxygen. Processing the root samples as described above may have expose the T E M and associated bacteria to inhibitory oxygen concentrations. Once the incubation tubes were flushed, 10% of the gas headspace in the tubes was extracted using a gas tight syringe 129 Figure 5. Plunger assembly from acetylene reduction assay incubation tube showing Pinus contorta root (R) with Suillus tomentosus tuberculate ectomycorrhizae (T) inserted through the plunger (P) and sealed by a septum (S). (Chromatographic Specialists, Brockville, ON, Canada), and replaced with pure acetylene (Fig. 5.6). This created an incubation environment of 10% acetylene with microaerophilic conditions (97-99% argon, 1-3% oxygen). It has been reported that prolonged incubations (> 12 hrs) of excised roots with acetylene overestimates nitrogenase activity due to bacterial growth during the assay, which depletes root mineral N , a repressor of N2-fixation (van Berkhum and Sloger 1985, Boddey 1987). To determine if this was going to be a factor in this study, selected roots were tested to determine the appropriate incubation period. Roots were incubated for 8, 12, 14 and 16 hours and then analysed for ethylene production. Based on the data from these tests, incubation tubes during the main sample collecting periods (Spring and Summer 1997 & 1998) were incubated for 10 hrs before gas samples were collected. A controlled experiment was conducted to verify that acetylene reduction was a result of T E M and not a result from other mycorrhiza present or from the roots alone, additional root Figure 5.5: Acetylene reduction assay incubation tube being flushed with inert argon gas via the injection line (AI) and being vented by the evacuation needle (EV). Flushing with argon was done for approximately 3 minutes for each tube to ensure complete evacuation of atmospheric gases. 131 samples were excavated and incubated as described above. These samples included, roots with mycorrhizal root tips but not T E M (treatment type A) and roots with no mycorrhizal root tips or T E M , usually secondary roots (treatment type B). Ethylene oxidation is inhibited by acetylene so that any endogenous ethylene produced by root tissues will accumulate (Nohrstedt 1976, Bont 1976, Witty 1979) and may result in an overestimation of nitrogenase activity. To account for this possibility, additional incubation tubes (treatment type C) containing roots with T E M were incubated for 10 hrs with a very small concentration (0.05%) of acetylene added. This concentration is sufficient to repress the oxidation of ethylene in the absence of A R A activity and allows measurement of ethylene production by the root system (Nohrstedt 1976). Background ethylene production from the incubation apparatus was estimated using incubation tubes Figure 5.6: Acetylene reduction assay incubation system showing evacuation syringe (ES), argon injection syringe (AS) and incubation tube (IT). Ten per cent of the incubation tube volume was removed with the evacuation tube and then replaced with acetylene from the injection syringe. 132 assembled with no roots, no mycorrhiza and no tubercles (treatment type D), and incubated with 10% acetylene (96-99% argon, 1-3% oxygen) for 8 hours. Treatment D was also used to correct for air-space variations in the incubation tubes and for gas leakage (McNabb and Geist 1979). After incubation, gas samples were collected by pushing the rubber plunger down into the syringe tube, thereby closing the seal on the gas retention vial (Fig. 5.4). Once closed, the retention vials were airtight and contained a 6 ml sample of gases from within the apparatus. The vials were removed from the incubation tubes, capped and brought back to the laboratory for GC analysis. A 1 ml gas sample was extracted from each of the chromatograph sample vials and was analysed for ethylene concentration using a FTP 5400 gas chromatograph fitted with a 80-100 mesh Porapak R column. The column temperature was maintained at 70°C with nitrogen as the carrier gas. The injection temperature and flame ionization detector temperature was set at 105°C, and the flow rate of the carrier gas set at 40 cm 3 per min (Li et al. 1992). Gas analysis was conducted on all test vials incubated, treatment type A, treatment B, treatment C and treatment D. The results were calculated as nanamoles of ethylene per ml of sample. 5.2.3 Tubercle Biomass Measurements and Nitrogenase Calculations Once A R A ' s were complete, the T E M root systems in incubation tubes were severed from the host plants, removed from the incubation tubes and placed into storage containers for transport back to the laboratory for biomass measurements. A l l tubercles were removed from the root and then both the tubercles and root mass were dried at 70°C for 8 hours, and weighed. Nitrogenase activity per gram of T E M was calculated by correcting for endogenous and background ethylene production then dividing by the mass of tubercles in each incubation tube. These values were then multiplied by the total gas volume in the incubation tubes to determine total nitrogenase activity for each complete T E M system. 133 5.2.4 Statistical Analysis A two-way (3 x 2) analysis of variance (ANOVA) was conducted to evaluate the effects of the three sites (dry basaltic, wet basaltic and granitic) and the two stand age classes (class 2, class 8) on the nitrogenase activity of S. tomentosus T E M . Post Hoc tests were used to evaluate significant main effects and interactions. The least significant difference (LSD) method was used for variables with equal variances and the Dunnett's C method for variables with unequal variance. For the data sets in this thesis, most of the variables were close to normally distributed, had for the most part, equal variances and were independent of each other. A N O V A was chosen based on the fact that A N O V A is a robust method able to compensate for data that is not perfectly normally distributed and that have variances close to equal (pers. comm. Dr. Kozak 2001). Assumptions of A N O V A were not violated and therefore the use of non-parametric analysis was unnecessary. Statistical analyses were performed using SPSS® 10.1 for Windows. 5.3 RESULTS The acetylene reduction assays showed an overall significant difference between the different root treatment A R tubes in situ (ANOVA, F(4,246)=10.73, p<0.001). Post Hoc LSD analysis showed the significant differences occurred between the T E M samples and all of the non-tuberculate treatment types (A,B,C & D)(Table 5.1). The average amounts of ethylene (C2H4) produced per gram of S. tomentosus T E M for a twenty-four hour period ranged from 0.0 nmoles to 5696.7 nmoles from all sites in both years (Table 5.2, Appendix E, Table E- l ) . The lowest readings were observed in the spring of both 1997 and 1998. Average C2H4 amounts for the spring of 1997 ranged from 32.8 nmoles g"1 T E M 24h"' to 242.8 nmoles g"1 T E M 24h"' whereas in the spring of 1998, there was no observed C2H4 production (Table 5.2). The highest results were observed in the summers of both 1997 and 1998. 134 Table 5.1: Least significant difference results for comparisons of acetylene reduction (AR) values between Suillus tomentosus tuberculate ectomycorrhizal (TEM) samples and the four non-tuberculate treatment types. Treatment A= mycorrhizal roots, Treatment B= non-mycorrhizal roots, Treatment C= 0.05% acetylene and TEM roots and Treatment D= AR apparatus with no roots Treatment Type p values (Significance) T E M samples Treatment A 0.002** Treatment B 0.002** Treatment C 0.000*** Treatment D 0.000*** "-significant at alpha =0.01, * "-significant at alpha= 0.001 Average C2H4 amounts for the summer of 1997 ranged from 462.5 nmoles g"1 T E M 24h_1 to 1623.3 nmoles g"1 T E M 24h_1 (Table 5.2). The average C2H4 amounts for the summer of 1998 ranged from 129.7 nmoles g'1 T E M 24h_1to 5696.7 nmoles g"1 T E M 24h_1 (Table 5.2). In the spring of 1997, the average C2H4 amounts for the wet basaltic site (Puntzi Lake) ranged from 0.0 to 137.4 nmoles g"1 T E M 24h"', the dry basaltic site (Alex Graham) ranged from 0.0 to 242.9 nmoles g"1 T E M 24h"', and the granitic site (Nimpo Lake) ranged from 0.0 to 80.9 nmoles g"1 T E M 24h_1 (Fig. 5.7a). In the summer of 1997, the average C2H4 amounts for the wet basaltic site ranged from 0.0 to 771.9 nmoles g"1 T E M 24h_1, the dry basaltic site ranged from 0.0 to 1623.3 nmoles g"1 T E M 24h"', and the granitic site (Nimpo Lake) ranged from 0.0 to 265.0 nmoles g"1 T E M 24h_1 (Fig. 5.8a). In the summer of 1998, the average C 2 H 4 amounts for the wet basaltic site ranged from 0.0 to 3055.5 nmoles g"1 T E M 24h"1, the dry basaltic site ranged from 0.0 to 4725.5 nmoles g"1 T E M 24h"', and the granitic site (Nimpo Lake) ranged from 0.0 to 347.1 nmoles g"1 T E M 24h_1 (Fig. 5.9a). The average amounts of C2H4 for the young stands ranged from 0.0 to 190.3 nmoles g"1 T E M 24h"' in the spring of 1997 (Fig. 5.7c), from 0.0 to 1004.5 nmoles g"1 T E M 24h"' in the summer of 1997 (Fig. 5.8c) and 0.0 to 3662.3 nmoles g"1 T E M 24h"' in the summer of 1998 (Fig. 5.9c). The average amounts of C2H4 for the old stands ranged from 0.0 to 54.3 nmoles g"1 135 T E M 24b."1 in the spring 1997 (Fig. 5.7c), from 0.0 to 359.9 nmoles g"1 T E M 24h"' in the summer of 1997 (Fig. 5.8c) and 0.0 to 271.8 nmoles g"1 T E M 24h_1 in the summer of 1998 (Fig. 5.9c). No data are available for Alex Graham (AG) class 8 stands because there were insufficient T E M roots to test within this stand. The maximum C2H4 amount during the spring of 1997 was 724.5 nmoles g"1 T E M 24h' (Table 5.2). The maximum C2H4 amount during the summer of 1997 was 2580.8 nmoles g"1 Table 5.2: Average and maximum ethylene production of Suillus tomentosus tuberculate ectomycorrhizae (TEM) at three sites within the Sub Boreal Pine Spruce xeric cold biogeoclimatic zone for spring and summer of 1997 and 1998. AG= Alex Graham mountain, PL= Puntzi Lake, NP= Nimpo Lake. SE^standard error, n=5 for each average. Season/Year Site/Stand Average T E M Maximum T E M Class Activity" Activity3 (nmoles C 2H 4-g 124h *) (nmoles C 2 H 4 -g 124h *) Spring 1997 A G 2 242.9-SE 138.5 724.5 PL 2 199.1 - SE 94.4 504.0 N L 2 129.0-SE 72.3 328.4 A G 8 N / A N / A PL 8 75 .8 -SE 45.5 222.5 N L 8 32 .9 -SE 14.7 75.8 Summer 1997 A G 2 1623.4-SE 457.3 2580.8 PL 2 1143.1 - SE 306.3 2082.9 N L 2 292.0-SE 181.6 977.3 A G 8 N / A N / A PL 8 461 .5-SE 147.1 1032.1 N L 8 237.9-SE 118.3 676.0 Spring 1998 A G 2 0.0 0.0 PL 2 0.0 0.0 N L 2 0.0 0.0 A G 8 N / A N / A PL 8 0.0 0.0 N L 8 0.0 0.0 Summer 1998 A G 2 4725.5 - S E 3970.1 20577.0 PL 2 5696.8-SE 4859.1 25098.8 N L 2 564.5 - S E 181.1 1033.0 A G 8 N / A N / A PL 8 413 .9-SE 150.4 842.8 N L 8 129.7-SE 90.7 483.7 a - average of 5 measurements in each stand of nmoles of ethylene produced per gram of TEM. b - maximum nmoles of ethylene produced per gram of TEM in each stand. 136 TEM 24h"' whereas the maximum C2H4 value during the summer of 1998 was 25098.8 nmoles g"1 TEM 24h"' (Table 5.2). The maximum C2H4 amount for the wet basaltic site was 504 nmoles g"1 TEM 24h_1 in the spring 1997, 2082.8 nmoles g"1 TEM 24h"' in the summer of 1997 and 25098.8 nmoles g"1 TEM 24h"' in the summer of 1998 (Fig. 5.7b, 5.8b, 5.9b). The maximum C2H4 amount for the dry basaltic site was 724.5 nmoles g"1 TEM 24h_1 in the spring of 1997, 2841.5 nmoles g"1 TEM 24h"' in the summer of 1997 and 20577.0 nmoles g"1 TEM 24h_1 in the summer of 1998 (Fig. 5.7b, 5.8b, 5.9b). o T i/> £ Is O) T flj U) > < 500 400 300 200 100 0 X Dry Basalt ic Wet Basalt ic Site Granitic o o E oi ' ro Ol Ol > < 250 200 150 100 50 0 _I_ C l a s s 2 C lass 8 Stand age 800 B 0 5 LU Ol Dry Wet Granitic Basal t ic Basalt ic Site X CN T-o M o E c X CO CM E LU 800 600 400 I) O) 200 C l a s s 2 C l a s s 8 Stand age Figure 5.7: Data from spring 1997 showing calculated (A) avg. nmoles of C2H4 from Pinus contorta tuberculate ectomycorrhizae (TEM) per gram TEM per 24h from the three sample sites, (B) max. nmoles of C 2 H 4 g"1 TEM 24h-1 from the three sample sites, (C) avg. nmoles of C2H4 C 2 H 4 g"1 TEM 24h_1 from the two stand age classes and (D) max. nmoles of C 2 H 4 g"1 TEM 24h"' from the two stand age classes. Wet basaltic, dry basaltic and granitic are the soil parent material at each site. Wet basaltic= Puntzi Lake, Dry basaltic= Alex Graham mt., Granitic= Nimpo Lake, Class 2= Young stands <40 years, Class 8= Old stands >140 years. 137 The maximum C2H4 amount for the granitic site was 328.4 nmoles g"1 T E M 24h _ 1 in the spring of 1997, 977.24 nmoles g"1 T E M 24h _ I in the summer of 1997 and 1033.0 nmoles g"1 T E M 24h _ 1 in the summer of 1998 (Fig. 5.7b, 5.8b, 5.9b). The maximum amount of C2H4 for the young stands was 724.5 nmoles g"1 T E M 24h _ 1 in the spring of 1997, 2841.5 nmoles g"1 T E M 24h"' in the summer of 1997 and 25098.8 nmoles g"1 T E M 24h _ 1 in the summer of 1998 (Fig. 5.7d, 5.8d, 5.9d). The maximum amount of C2H4 for the old stands was 222.5 nmoles g ' 1 T E M 24h"' in the spring of 1997, 1032.1 nmoles g"1 T E M 24h' ! in the summer of 1997 and 842.8 nmoles g ' 1 T E M 24h"' in the summer of 1998 (Fig. 5.7d, 5.8d, 5.9d). O r-w a; o E c 9) 2 cu > < 3000 2500 SI 2000 S 1500 I- 1000 500 0 Hi JL Dry Wet Granitic Basalt ic Basalt ic Site =2 1500 U v i i Si 1000 i s M 'ha RJ Wt > < 500 1 C l a s s 2 C lass 8 Stand age 3000 2500 2000 cu 0 S 1500 1 ^ 1000 X 500 Dry Wet Granitic Basal t ic Basal t ic Site „ 3000 £ ^2500 w Si2000 "5 S1500 I MOOO \ o 500 0 D X ro C l a s s 2 C l a s s 8 Stand age Figure 5.8: Data from summer 1997 showing calculated (A) avg. nmoles of C2H4 from Pinus contorta tuberculate ectomycorrhizae (TEM) per gram T E M per 24h from the three sample sites, (B) max. nmoles of C 2 H 4 g"1 T E M 24h"' from the three sample sites, (C) avg. nmoles of C2H4 C2H4 g"1 T E M 24b."1 from the two stand age classes and (D) max. nmoles of C2H4 g ' 1 T E M 24h_1 from the two stand age classes. Wet basaltic, dry basaltic and granitic are the soil parent material at each site. Wet basaltic= Puntzi Lake, Dry basaltic= Alex Graham mt., Granitic= Nimpo Lake, Class 2= Young stands <40 years, Class 8= Old stands >140 years. 138 Table 5.3: Two-way A N O V A (3x2) results for comparisons between sites (Alex Graham, Puntzi Lake, Nimpo Lake) and between stand ages (class 2, class 8) for Suillus tomentosus tuberculate ectomycorrhizae of average acetylene reduction assay results (nmoles C2H4 g'1 T E M 24h"'). Year/ Season Variable Factor df F statistic p-value (significance) Spring 97 nmoles C 2 H 4 g" T E M 24h_1 Site 2 1.238 0.309 Stand age 1 3.388 0.039* Summer 97 nmoles C 2 H 4 g" T E M 24h"' Site 2 5.878 0.509 Stand age 1 5.172 0.032* Summer 98 nmoles C 2 H 4 g" T E M 24h' ! Site 2 .938 0.406 Stand age 1 5.155 0.034* * - Significant at alpha 0.05. o v a £ CU " * 0 2 h O) V co 01 Ip CU > 10000 8000 6000 4000 2000 Dry Wet Basal t ic Basalt ic Site Granitic 6000 5000 JO cn 4000 E fS 3000 co J~ 2000 J 2 M 1000 3 0 C l a s s 2 C l a s s 8 Stand age X o co O) o E c x co E CN ra 30000 25000 20000 15000 10000 5000 0 Basalt ic Wet Basal t ic Site Granitic 30000 ^ v 25000 " $20000 $ " •5 S 15000 c UJ I P10000 IS ^ 5000 s 0 1) C l a s s 2 C l a s s 8 Stand age Figure 5.9: Data from summer 1998 showing calculated (A) avg. nmoles of C 2H4 from Pinus contorta tuberculate ectomycorrhizae (TEM) per gram T E M per 24h from the three sample sites, (B) max. nmoles of C 2 H 4 g"1 T E M 24h"' from the three sample sites, (C) avg. nmoles of C 2 rL C 2 Rt g"1 T E M 24h_ 1 from the two stand age classes and (D) max. nmoles of C2H4 g"1 T E M 24h"' from the two stand age classes. Wet basaltic, dry basaltic and granitic are the soil parent material at each site. Wet basaltic= Puntzi Lake, Dry basaltic= Alex Graham mt., Granitic= Nimpo Lake, Class 2= Young stands <40 years, Class 8= Old stands >140 years. 139 There were no significant differences in the average nmoles C2H4 g"1 T E M 24h_1 between the sites (Table 5.3). However, there were significant differences in the nmoles C2H4 g"1 T E M 24h_1 between the stand ages in the spring of 1997 and the summer of both 1997 and 1998 (Table 5.3). Overall, the difference between class 2 stands and class 8 stands was significant for all seasons and both years combined (ANOVA, F(l,72)=8.965, p=0.004). 5.4 DISCUSSION Pinus contorta T E M exhibited in situ nitrogenase activity as measured by the acetylene reduction assay (ARA). The results obtained were not just simply background ethylene measurements detected in the non-tuberculate treatments. This is supported by the significant differences observed between the T E M samples and the four non-tuberculate treatments (Table 5.1). The nitrogenase activity observed may be due to N 2-fixing bacteria that reside within the tubercle structure, specifically, associated with the ectomycorrhizal root tips and interstitial hyphae (Chapter 4). The bacterial species with T E M were identified as Paenibacillus amylolyticus and Methylobacterium mesophillicum (Chapter 4). These results further the findings of L i et al. (1992) who measured nitrogenase activity from associative N2-fixing Bacillus spp. on the surface of Rhizopogon vinicolor T E M on Pseudostuga menzesii. L i et al. (1992) did not detect N 2-fixing bacteria within R. vinicolor T E M and, therefore, concluded that nitrogenase activity is only due to associative fixation and not symbiotic fixation from T E M . In contrast, the findings from this thesis suggest that S. tomentosus T E M may be sites of symbiotic nitrogen fixation and that T E M may function in a similar physiological manner as legume and non-legume roots nodules. Even though L i et al. (1992) did not find N 2-fixing bacteria within T E M on P. menzesii this does not mean that the bacteria are not there. More work on R. vinicolor T E M may reveal nitrogenase levels similar to or even higher than levels report for S. tomentosus T E M in this thesis. 140 The highest average nitrogenase activity (nmoles C2H4 g"1 T E M 241V1) measured from S. tomentosus T E M in situ is substantial when compared to values of associative nitrogenase activity measured from R. vinicolor T E M in situ (Li et al. 1992). In their study, L i et al. (1992) report an average value of 39.1 nmoles C2H4 g"1 T E M 24h"!. In comparison, the average nitrogenase activity for S. tomentosus T E M is 5696.7 nmoles C2H4 g*1 T E M 24h_1. This value is 146 times larger than that reported from R. vinicolor T E M . An explanation for this large difference may be that the environment within S. tomentosus T E M is more conducive to greater N2-fixation than is the surface of R. vinicolor T E M . The nitrogenase enzyme is oxygen sensitive and degrades at very low oxygen levels (Appleby 1984, Bergersen 1993, 1996). The oxygen level within root nodules is sufficiently low for nitrogenase activity. Additionally, Silvester et al. 1982 report that the oxygen content of between 2 and 10 % within coarse woody debris (CWD) is optimal for nitrogen fixation by asymbiotic microaerophilic N 2-fixing bacteria that reside within the woody debris. Therefore, the respiration rates of the clustered ectomycorrhizal rootlets within the tubercle along with the enclosure of the root tips and interstitial hyphae within the tubercle by the peridium (Chapter 2) may provide similar sufficiently microaerophilic conditions where the N2-fixing bacteria are able to fix nitrogen at a greater level. This would contrast the surface of R. vinicolor T E M where the I n f i x i n g bacteria would be exposed to higher oxygen levels, which would be a less favorable environment for nitrogen fixation. Nitrogen fixation is known to require large amounts of energy (Witty et al. 1983, Visser 1985, Zuberer 1998). The N2-fixing bacteria within S. tomentosus may have an ample supply of carbon from the host plant through the mycorrhizal root tips, which could also facilitate higher nitrogen fixation. Furthermore, the bacteria on the surface of R. vinicolor T E M may not have access to as much carbon as bacteria within a tubercle. An alternative explanation for the large difference between S. tomentosus T E M nitrogenase activity and R. vinicolor nitrogenase activity may be the environment in which T E M 141 occur. Mineral nitrogen availability is known to reduce nitrogen fixation rates (Sanginga et al. 1987, Sougoufara et al. 1990, Zuberer 1998) and, therefore, T E M occurring in stands with lower nitrogen availability may display higher nitrogenase activity. The soils of the SBPSxc are very nutrient deficient, especially in nitrogen (Appendix C) and, therefore, S. tomentosus T E M in this study area may be a better system on which nitrogenase activity can be measured by A R A . It is interesting to note that there were no significant differences in nitrogenase activity between the three different sites. However, there were significant differences between the stand ages. The significantly higher values for the class 2 stands over the class 8 stands could be related to a higher demand for nitrogen in class 2 stands and this may be reflected in the higher output by T E M in the class 2 stands. Since there is very low N concentration in the soils of the SBPSxc (Chapter 3), and class 2 stands are usually very densely populated, competition for a limited resource like N in the interior P. contorta range (Weetman et al. 1988, Brockley 1990, 1992, Mika et al. 1992) may be very high. It has been shown that young stands of P. contorta up to 50 years old have higher N content in needle litterfall, wood increment and have a higher N uptake than older stands between 100 and 200 years old (Kimmins 1997, Olsson et al. 1997). It was also shown that the ratio of above ground net primary production to N uptake was 40% higher in stands between ages 30-50 years compared to stands between 50-200 years (Olsson et al. 1997). This, along with higher uptake capabilities, suggests that younger stands may have a higher demand for nitrogen during their early development. Additional support comes from Kimmins (1997) who states that nutrient uptake varies during the development of a stand. It is very high during the early stages when there is a rapid accumulation of biomass of foliage and live woody tissues, and when the availability of nutrients in the soil are still relatively high. Uptake then declines somewhat as the stand becomes more dependent on internal retranslocation of nutrients from old to younger tissues. This reduces the dependency of primary production on uptake. Weetman (1988), also states that, as P. contorta pine stands age, their 142 nutrient requirement on the soil reduces rapidly because the nutrient "cycles" throughout the tree have become fully charged and the stand becomes more stable. The cycle within older trees is based on the recovery of recycled nutrients from parts of the tree tissue that has died and can be quite efficient (Weetman 1988). For nitrogen, these cycles are not as efficient and may require continual recharging from the soil, but this leads to the theory that older stands may not require as much nitrogen as younger stands and may help explain why younger stands in the SBPSxc have higher T E M nitrogen fixation values than older stands in this region. Further, it was found that young pine seedlings increased in biomass even though they were grown on forest floor material from pine stands that had extremely low nutrient contents compared to seedlings grown in forest floor material with high nutrient values (Prescott et al. 1991). Prescott et al. (1991) state that the difference could be due to the appropriate mycorrhizal inoculum present in the pine forest floor material. If the appropriate mycorrhizal inoculum was present in this forest floor material, the appropriate N 2-fixing bacteria may have also been present and contributed to the increased biomass that was observed in this study. In the study by L i et al. (1992) the overall potential contribution of R. vinicolor T E M associated nitrogen fixation to P. menzesii N budgets was not determined. L i et al. (1992) made assumptions about the potential contribution based on an arbitrary amount of T E M tissue (100g) but did not signify if this was per cubic meter or per hectare. Because of this lack of information it is difficult to evaluate the potential contribution of R. vinicolor T E M to nitrogen inputs in P. menzesii stands. The highest average nitrogenase activity of S. tomentosus T E M from this study was 5696.7 nmoles C2H4 g"1 T E M 24h_1 and the maximum nitrogenase activity was 28098.8 nmoles C2H4 g"1 T E M 24h_1. These amounts are high relative to nitrogenase activity from associative and non-symbiotic nitrogen fixing bacteria in other conifer systems. It has been reported that in a model ecosystem of Pinus resinosa Ait. and Pinus rigida Mi l l , the maximum nitrogenase 143 activity of mycorrhizal roots was 44.4 nmoles C2H4 g"1 mycorrhizal root 24h_1 (Bormann et al. 1993). This is approximately 120 times lower than the highest average nitrogenase activity of S. tomentosus T E M and is substantially lower than the potential maximum nitrogenase activity measured. Additionally, the maximum average level of non-symbiotic nitrogenase activity in CWD of P. contorta, P. menzesii, Tsuga heterophylla (Raf.) Sarg., and Thuja plicata Donn ex D. Don stands have been reported to range from 7.3 and 32.6 nmoles C2H4 g"1 CWD 24h_1 (Silvester et al. 1982, Jurgensen et al. 1987, Crawford et al. 1997, Wei and Kimmins 1998). The highest average value for S. tomentosus T E M is approximately 150 to 800 times larger than non-symbiotic nitrogenase activity in CWD from other conifer forests. The highest average nitrogenase activity of S. tomentosus T E M from this study, 5696.7 nmoles G2H4 g"1 T E M 24h_1 is approximately 10% of the average activity reported from root nodules on Alnus rubra, 51,000 nmoles G2H4 g"1 nodule 24h"', and 15.7% of the activity of Alnus sinuota, 36,100 nmoles C2H4 g"1 nodule 24h_1 (Binkley 1980). Even at these levels, the potential nitrogen contribution from S. tomentosus T E M could be important to the nitrogen budget of P. contorta stands of the SBPSxc. To evaluate the potential nitrogen contribution by S. tomentosus T E M to P. contorta stands in the SBPSxc the values measured by A R A (C2H2 reduced) have to be converted into nitrogen fixed using a conversion factor to account for the difference in the way the nitrogenase enzyme reduces the two molecules (Hardy et al. 1968, Burris 1991). There has been much debate on what the conversion factor should be and many researchers believe the factor is specific to the system being studied (Hardy et al. 1973, Burris 1974, Nohrstedt 1983, Witty 1979). To account for these concerns a range of conversion factors was used to convert the A R A results for S. tomentosus T E M to nitrogen fixed to give an idea of what the upper and lower limits of the potential nitrogen contribution from T E M could be. The lower conversion value used was 2.5 and the upper value 7.0 (Hardy et al. 1973). 144 Although acetylene reduction was only conducted on T E M within CWD in this study, T E M do occur on P. contorta roots in the mineral soil within the these stands. Therefore, to give a better overall picture of the nitrogen contribution from T E M in these stands, the assumption was made that S. tomentosus T E M occur in similar abundance on P. contorta roots within the soil (to a depth of 30 cm) to that of T E M within CWD. It is also assumed that the tubercles within the soil show similar potential nitrogenase activity as tubercles within CWD. Based on these assumptions, the highest average potential N2-fixation from S. tomentosus T E M per hectare would range from 0.199 to 0.558 kg N ha"1 y"1 and the maximum potential N 2 -fixation would range from 8.4 to 23.6 kg N ha"1 y"1. If we assume the average annual uptake of nitrogen by P. contorta stands is between 5 and 12.5 kg N ha"1 y"1 (Fahey et al. 1984), the potential nitrogen contribution from S. tomentosus T E M could be a significant input based on the maximum nitrogenase activity. Additionally, it has been reported that annual precipitation inputs of between 0.9 and 1.5 kg N ha"1 y"1 occur in conifer forests of the eastern US (Fahey et al. 1984, McNulty et al: 1990, Jurgensen et al. 1992) and that these inputs are significant to stand N budgets. Therefore, if the annual precipitation input of N is similar in P. contorta stands within the SBPSxc, the potential contribution of N from S. tomentosus T E M to P. contorta stands is important. It is important to note that the potential maximum values calculated for S. tomentosus T E M are based on two large observations of nitrogenase activity seen in the field trials (Appendix E, Table E-lg). These two large observations occurred in the summer of 1998 and were much larger than the majority of the other measurements from both years, approximately 5 times larger (Appendix E, Table E-l ) . It can be argued that these large values are outliers from the data set and are instances of overestimation of S. tomentosus T E M N 2-fixing ability. On the other hand these values may represent the true potential of S. tomentosus T E M N2-fixation. In N 2-fixing legumes, there are instances of "effective" and "ineffective" nodules (Chanway et al. 145 1991, Somasegaran and Hoben 1994). Effective nodules are nodules that fix nitrogen symbiotically. Ineffective nodules look like effective nodules but do not fix nitrogen. In addition, there can be different levels of expression of the effectiveness of root nodules, high, medium and low N2-fixation (Somasegaran and Hoben 1994). Additionally, variability in N 2 -fixation rates is seen in most N2-fixing plants. With root nodules on Alnus spp. containing Frankia spp., the variability of N2-fixation has been shown to be very high but for this tree species the potential for N2-fixation has been estimated to be up to 200 kg N ha"1 yr"1 (Newcomb and Wood 1987, Schwintzer and Tjepkema 1991). If this is similar for S. tomentosus T E M , then it may be that the majority of the measurements in the field trials for this thesis are in the low to moderate range as seen in summer 1997 and for most of the samples for summer 1998, whereas the two high observations were instances of high effectiveness in the summer of 1998. This reasoning is also supported by the results from the spring sessions of both years. Lower amounts were observed in the spring of 1997 than from both of the summer sessions and no activity was measured in the spring of 1998. This may show the lowest measurable effectiveness of S. tomentosus T E M nitrogenase activity and suggests that the range of seasonal effectiveness may occur with S. tomentosus T E M nitrogenase activity. Additionally, if the two large observations are removed from the data set, the highest average nitrogenase activity still exceeds 1600 nmoles C2H4 g"1 T E M 24h_1. This amount is 40 times larger than the value reported for associative nitrogenase activity from R. vinicolor T E M (Li et al. 1992) and 35 times larger than the value reported for ectomycorrhizal roots of P. resinosa (Bormann et al. 1993). A final point that can be considered is that the amounts of T E M nitrogenase activity measured in this thesis are potentially only a fraction of the total nitrogenase occurring on P. contorta roots. This is because, only a small portion of the host root system has been tested in this study. It is not known what proportion of the total root biomass of the host, that roots with 146 T E M in CWD constitute. It has been shown that 25-30% of P. contorta stand biomass is below ground and 55-60% of the total net primary production is allocated below ground on poor nutrient sites (Comeau and Kimmins 1989). Additionally, Wei et al. (1997) have shown that the amount of below ground woody debris can be up to 30% of the total CWD within P. contorta stands. Therefore, below ground CWD may be potential sites for T E M occurrence and, in turn, nitrogenase activity. These factors suggest that S. tomentosus T E M on P. contorta roots could account for a larger portion of the N inputs in these stands. Further research that can be considered from this thesis would be to conduct a more extensive survey of the nitrogenase activity of S. tomentosus T E M within the SBPS biogeoclimatic zone by taking more samples throughout the full growing season of P. contorta in this region. A more intensive study may be able to determine if the large values observed in this thesis were overestimated outliers or if they are common, upper range values for S. tomentosus T E M N2-fixing ability. Even though acetylene reduction has been used extensively to measure N2-fixation in various systems over the last 25 years (Aho et al. 1974, Cornaby and Waide 1973, Jurgensen et al. 1991, 1992, McNabb and Geist 1979, Roskoski 1980, Silvester et al. 1982, Sharp and Millbank 1973, Todd et al. 1975), there has been concern that the method has limitations in its usefulness for measuring nitrogenase activity accurately (reviewed in McNabb and Geist 1979, Nohrstedt 1983, 1984, Witty 1979, Vessey 1994). Considering the limitations of A R A , difficulties using this method in the field, and errors associated with using a potentially inappropriate conversion factor, A R A is not the best method to conduct quantitative measurements of nitrogen fixation. With that in mind, use of other methods to analyse nitrogen fixation is necessary to increase the confidence in acetylene reduction assays. A method that may be useful is the 1 5 N dilution technique (Fried and Broeshart 1975, Fried and Middleboe 1977, Qiao and Murray 1998, Witty 1983). Use of a modification of this method may be, to 147 establish P. contorta seedlings in vitro with S. tomentosus T E M and the appropriate N2-fixing bacteria (P. amylolyticus and M. mesophilicum) in microcosms, and exposing the system to an enriched 1 5 N gaseous environment. Analysis of the root and foliar tissue for 1 5 N / 1 4 N isotopes would allow determination of the amount of N being fixed by S. tomentosus T E M and the A amount being taken up by the root system. An alternative modification may be to add enriched 1 5 N media to the soil and again measure the root and foliar 1 5 N / 1 4 N isotope content to determine the quantity of N being taken up by the root system versus the amounts being taken up by N2-fixation from the tubercles. Use of this method could provide more accurate measurements of nitrogenase activity. 148 5.5 REFERENCES Aho, P.E., Seidler, R.J., Evans, H.J. and Rajau, P.N. 1974. Distribution, enumeration and identification of nitrogen-fixing bacteria associated with decay in living white fir trees. Phytopathology 64: 1413-1420. A l i Asgharzadeh, N . and Saleh Rastin, N . 1997. The effects of inoculation with V A M fungi and Bradyrhizobium japonicum on growth and nutrient. [Persian]. Soil and Water Journal 10(1): 1-12. Amaranthus, M.P., L i , C Y . and Perry, D.A. 1990. Influence of vegetation type and madrone soil inoculum on associative nitrogen fixation in Douglas-fir rhizosperes. Canadian Journal of Forest Research 20:368-371. Appleby, C. A. 1984. Leghemoglobin and Rhizobium respiration. Annual Review of Plant Physiology 35:443-478. Azcon, R., Rubio, R. and Barea, J.M. 1991. Selective interactions between different species of mycorrhizal fungi and Rhizobium meliloti strains, and their effects on growth, N 2 -fixation ( 1 5N) and nutrition of Medicago sativa L. New Pythologist 117: 399-404. Barea, J.M. and Aczon-Aguilar, C. 1982. Interactions between mycorrhizal fungi and soil microorgansims. In: LesMycorhizes: Biologie et Utilization. Eds. Gianinazzi, S., Gianinazzi-Pearson, V. and Trouvelot, A. INRA. Paris, pp. 181-193. Barea, J.M. and Aczon-Aguilar, C. 1983. Mycorrhiza and their significance in nodulating nitrogen-fixing plant. Advances in Agronomy 36: 1-54. Bergersen, F.J. 1993. Diffusion of oxyleghaemoglobin. Annals of Botany 72:577-582. Bergersen, F.J. 1996. Delivery of 0 2 to bacteriods in soybean nodule cells: consideration of gradients of concentration of free, dissolved 0 2 in and near symbiosomes and beneath intercellular species. Protoplasma 191:9-20. 149 Binkley, D. 1980. Nodule biomass and acetylene reduction rates of red alder and Sitka alder on Vancouver Island, B.C. Canadian Journal of Forestry Research. 11: 281-286. Boddey, R. M . 1987. Methods for quantification of nitrogen fixation with Gramineae. Critical Reviews in Plant Sciences, 5: 125-134. Bont, J.A.. 1976. Bacterial degradation of ethylene and the acetylene reduction test. Canadian Journal of Microbiology 22: 1060-1062. Bormann, B.T., Bormann, F.H., Bowden, R.S., Pierce, R.S., Hamburg, S.P., Wang, D., Snyder, M . C , L i , C. Y . and Ingersoll, R.C. 1993. Rapid N2-fixation in pines, alder and locust: evidence from the sandbox ecosystem study. Ecology 74: 583-598. Brockley, R.P. 1990. Response of thinned, immature lodgepole pine to nitrogen and boron fertilization. Canadian Journal of Forestry Research 20:579-585. Brockley, R.P. 1992. Response of thinned, immature lodgepole pine to nitrogen fertilization: six-year growth response. B.C. Ministry of Forests, Victoria. F R D A Report 184. Burris, R.H. 1974. Methodology. In: The Biology of Nitrogen Fixation. Ed. Quispel, A. American Elsevier. New York. pp. 9-33. Burris, R . H . 1991. Nitrogenase. Journal of Biological Chemistry. 286:9339-9342. Chanway, C P . , Turkington, R. and Holl, F.B. 1991. Ecological implications of specificity between plants and rhizosphere micro-organisms. Advances in Ecological Research. 21: 122-169. Chatarpaul, L. and Carlisle, A. 1983. Nitrogen fixation: a biotechnological opportunity for Canadian forestry. Forest Chronicals 59: 249-250. Comeau, P.G. and Kimmins, J.P. 1989. Aboveground and below ground production of lodgepole pine on sites with differing soil moisture regimes. Canadian Journal of Forest Research. 19(4)447-454. 150 Cornaby, B.W. and Waide, J.B. 1973. Nitrogen fixation in decaying chestnut logs. Plant and Soil 39: 445-448. Cracknell, P.C. and Lousier, J.D. 1986. Possible contribution of ^-fixing Azospirillium spp. to conifer seddling vigor. In: Conference on Roots in Forest Soils: Biology and Symbioses. (Abstracts). 4-8 Aug. 1986. University of Victoria. Victoria. Crawford, R.H., L i , C Y . and Floyd, M . 1997. Nitrogen fixation in root-colonized large woody residue of Oregon coastal forests. Forest Ecology and Management 92: 229-234. Das, P.K., Sahoo, P.N. and Jena, M.K. 1997. Effect of VA-mycorrhiza and Rhizobium inoculation on nutrient uptake, growth attributes and yield of greengram (Vigna radiata L.). Environment andEcology 15(4): 830-833. Dawson, J.O. 1983. Dinitrogen fixation in forest ecosystems. Canadian Journal of Microbiology 29: 979-992. Ekblad, A. and Huss-Danell, K. 1995. Nitrogen fixation by Alnus incana and nitrogen transfer from A. incana to Pinus sylvestris influenced by macronutrients and ectomycorrhiza. New Phytologist 131(4): 453-459. Fahey, T.J., Yavitt, J.B., Pearsson, J.A. and Knight, D.H. 1984. The nitrogen cycle in lodgepole pine forest, southeastern Wyoming. Biogeochemistry 1:257-275-Florence, L.Z. and Cook, F.D. 1984. Asymbiotic N-fixing bacteria associated with three boreal conifers. Canadian Journal of Forest Research 14:595-597. Fried, M . and Broeshart, H. 1975. An independent measurement of the amount of nitrogen fixes by a legume crop. Plant and Soil 43: 707-711. Fried, M and Middelboe, V. 1977. Measurement of amount of nitrogen fixed by legume crop. Plant and Soil 43:713-715. 151 Graham, P.H. and Vance, C P . 2000. Nitrogen fixation in perspective: an overview of research and extension needs. Field Crops Research 65:93-106. Hallmann, J., Quadt-Hallmann, A., Mahaffee, W.F., Kloepper, J.W. 1997. Bacterial endophytes in agricultural crops. Canadian Journal of Microbiology 43(10): 895-914. Hardy, R.W.F., Holsten, R. D., Jackson, E.K. and Burns, R.C. 1968. The acetylene-ethylene assay for ^-fixation: laboratory and field evaluation. Plant Physiology 43: 1185-1207. Hardy, R.W.F., Burns, R.C. and Holsten, R. D. 1973. Applications of the acetylene-ethylene assay for measurement of nitrogen fixation. Soil Biology and Biochemistry. 5: 47-81. Harvey, A.E. , Larsen, M.J. , Jurgensen, M . F. and Jones, E.A. 1989. Nitrogenase activity associated with decayed wood of living northern Idaho conifers. Mycologia 81(5): 765-771. Kimmins, J.P. 1997. Forest Ecology. Prentice-Hall, New Jersery, USA. Johnson, D.W., Cole, D.W., Bledsoe, C.S., Cromack, K., Edmonds, R.L., Gessel, S.P., Grier, C C , Richards, B .N. and Voigt, K . A . 1982. Nutrient cycling in forests of the Pacific Northwest. In: Analysis of Coniferous Forest Ecosystems in the Western United States. Ed. Edmonds, R.L. Hutchinson & Ross. Stroudsberg. pp. 186-232. Jurgensen, M.F., Larsen, M.J. , Graham, R.T. and Harvey, A. E. 1987. Nitrogen fixation in woody residue of northern Rocky Mountain conifer forests. Canadian Journal of Forestry Research. 17: 1283-1288. Jurgensen, M.F., Graham, R.T., Larsen, M.J. and Harvey, A.E . 1992. Clear cutting , woody residue removal, and nonsymbiotic nitrogen fixation in forest soils of the Inland Pacific Northwest. Canadian Journal of Forest Research 22: 1172-1178. 152 Jurgensen, M.F., Tonn, J.R., Graham, R.T., Harvey, A.E. and Geier-Hayes, K. 1991. Nitrogen fixation in forest soils of the Inland Northwest. USDA Forest Service General Technical Report, INT-280. pp. 101-109. Kinzig, A.P. and Socolow, R.H. 1994. Is nitrogen fertilizer use nearing a balance-reply. Physiology Today 47: 24-35. L i , C Y . and Hung, L .L . 1987. Nitrogen-fixing (acetylene-reducing) bacteria associated with ectomycorrhizae of Douglas-fir. Plant and Soil 98:425-428. L i , C.Y. , Massicotte, H.B. and Moore, L .V . 1992. Nitrogen fixing Bacillus sp. associated with Douglas-fir tuberculate ectomycorrhizae. Plant and Soil 140:35-40. Linderman, R.G. 1988. Mycorrhizal interactions with the rhizosphere microflora: The mycorrhizosphere effects. Phytopathology 78:366-371. McNabb, D.H. and Geist, J.M.. 1979. Acetylene reduction assay of symbiotic ^- f ixat ion under field conditions. Ecology 60(5): 1070-1072. McNulty, S.G., Aber, J.D., McLellan, T.M. and Katt, S.M. 1990. Nitrogen cycling in high elevation forests of the northeastern US in relation to nitrogen deposition. Ambio 19: 38-40. Miller, S.L., Koo, C D . and Molina, R. 1992. Early colonization of red alder and Douglas fir by ectomycorrhizal fungi and Frankia in soils from the Oregon coast range. Mycorrhiza 2(2): 53-61. Mika, P.G., Moore, J.A., Brockley, R.P. and Powers, R.F. 1992. Fertilization response by interior forests: when, where, and how much? In: Forest Fertilization: Sustaining and Improving Nutrition and Growth of Western Forests. Eds. Chapell, H . N . , Weetman, G. F. and Miller, R. E. University of Washington Institute for Resource Contributions. 73: 127-142. 153 Newcomb, W. and Wood, S. M . 1987. Morphogenesis and fine structure of Frankia (Actinomycetales): The microsymbiont of nitroge-fixing actinorhizal root nodules. International Review of Cytology. 109:1-88. Nohrstedt, H.O. 1976. Natural formation of ethylene in forest soils and methods to correct results given by the acetylene reduction assay. Soil Biology and Biochemistry 15: 281-286. Nohrstedt, H.O. 1983. Conversion factor between acetylene reduction and nitrogen fixation in soil: Effect of water content and nitrogenease activity. Soil Biology and Biochemistry 15: 3. 275-279. Nohrstedt, H.O. 1984. Carbon monoxide as an inhibitor of nitrogenase activity in control measurements of endogenous formation of ethylene by forest soils. Soil Biology and Biochemistry 16: 1. 19-22. Olsson, U . , Binkley, D. and Smith, F.W. 1997. Nitrogen supply, nitrogen use, and production in an age sequence of lodgepole pine. Forest Science 44(3): 454-457. Prescott, C.E., Corbin, J.P. and Parkinson, D. 1991. Availability of nitrogen and phosphorus in the forest floors of Rocky Mountain coniferous forests. Canadian Journal of Forest Research 22: 593-600. Preston, C M . and Mead, D.J. 1994. Growth response and recovery of 15N-fertilizer one and eight growing seasons after application to lodgepole pine in British Columbia. Forest Ecology Management 65: 219-229. Qiao, Z. and Murray, F. 1998 Improvement of the 1 5 N dilution method for estimation of absorption of N 0 2 by plants supplied with 1 5 N -labelled fertilizer. New Phytology. 138: 13-18. 154 Ravichandran, V .K . and Balasubramanian, T.N. 1999. Growth response of Casuarina equisetifolia seedlings to dual inoculation of Frankia and V A M (Glomus fasciculatum). Journal of Ecobiology 11(3): 175-179. Richards, B .N . and Voigt, G.N. 1964. Role of mycorrhizae in nitrogen fixation. Nature (London) 201:310-311. Roskoski, J.P. 1980. Nitrogen fixation in hardwood forests of the northeastern United States. Plant and Soil 54:33-44. Sanginga, N , Mulongony, K. and Ayanaha, A. 1987. Evaluation of indigenous strains of Rhizobium for Leucaena de Wit in Nigeria. In: Les Arres fixateurs d'Azote et L 'Amelioration Biologique de al Fertilite du Sol. Colloques et Seminaires. ORSTOM. Paris, pp. 416-436. Schwintzer, C.R. and Tjepkema, J.D. 1991. Actinorhizal plants: Fankia-symbiosis. In: Biology and Biochemistry of Nitrogen Fixation. Eds. Dilworth, M.J. and Glenn, A.R. Elsevier, New York. pp. 350-372. Sharp, R.F. and Millbank, J.W. 1973. Nitrogen fixation in deteriorating wood. Experientia 29: 895-896. Shishido, M . , Petersen, D. J., Massicotte, H.B. and Chanway, C P . 1996. Pine and spruce seedling growth and mycorrhizal infection after inoculation with plant growth promoting Pseudomonas strains. FEMS Microbiology Ecology 21: 109-119. Silvester, W.B., Sollins, P., Verhoeven, T. and Cline, S.P. 1982. Nitrogen fixation and acetylene reduction in decaying conifer boles: Effects of incubation time, aeration and moisture content. Canadian Journal of Forest Research 12:646-652. Singh, C.S. 1996. Arbuscular mycorrhiza (AM) in association with Rhizobium sp. improves nodulation, N 2 fixation, and N utilization of pigeon pea (Cajanus cajari), as assessed with a 1 5 N technique, in pots. Microbiological Research 151(1): 87-92. 155 Somasegaran, P. and Hoben, H.J. 1994. Handbook of Rhizobia. Springer-Verlag, New York. Sougoufara, B., Danso, S.K.A., Diem, H.G. and Dommergues, Y.R. 1990. Extimating N 2 -fixation and N derived from soil by Casurina equisetifolia using labelled 1 5 N fertilizer: Some problems and solutions. Soil Biology and Biochemistry. 22: 695-701. Sreenivasa, M . N . , Basavaraja, G.T. and Kulkarni, J.H. 1995. Vesicular-arbuscular mycorrhiza assist in nodulation and N2-fixation in soybean. Journal of Maharashtra Agricultural Universities 20(2): 292-293. Steen, O. and Coupe, R.A. 1997. A Field Guide to Forest Site Identification and Interpretation for the Cariboo Forest Region. B.C. Ministry of Forests. Victoria. Steen, O. and Demarchi, D.A. 1991. Sub-boreal pine - spruce zone. In: Ecosystems in British Columbia. Eds. Meidinger, D and Pojar, J. B.C. Ministry of Forests. Victoria, B.C. pp. 195-207. Tjepkema, J.D., Schwintzer, C.R., Burris, R.H., Johnson, G.V., and Silvester, W.B. 2000. Natural abundance of 1 5 N in actinorhizal plants and nodules. Plant and Soil 219(1/2): 285-289. Todd, R. L., Waide, J.B. and Cornaby, B.W. 1975. Significance of biological nitrogen fixation and denitrification in a deciduous forest ecosystem. In: Mineral Cycling in Southeastern Ecosystems. Eds. Howell, F.G., Gentry, J.B. and Smith, M . H . US Department of Energy, pp. 727-735. Trinick, M . J. and Hadobas, P. A. 1995. Formation of nodular structures on the non-legumes Brassica napus, B. campestris, B. juncea and Arabidopsis thalima with Bradyrhizobium and Rhizobium isolated from Parasponia spp. or legumes grown in tropical soils. Plant and Soil 172(2): 207-219. 156 van Berkhum, P. and Sloger, C. 1985. A critical evaluation of the characteristics of associative nitrogen fixation in grasses. In: Proceedings of the International Symposium on Nitrogen and. the Environment. Eds. Malik, N . Nagri, S.M. and Aleem, A. Nuclear Institute for Agriculture and Botany. Faisalabad. pp. 124-136. Vance, C P . 1998. Legume symbiotic nitrogen fixation: agronomic aspects. In: The Rhizobiaceae. Ed. Spanik, H. P. Kluwer Academic Publishers. Dordrecht, pp 509-530. Vasanthakrishna, M . , Bagyaraj, D.J. and Nirmalnath, P.J. 1994. Responses of Casuarina equisetifolia to inoculation with Glomus fasciculatum and/or Frankia. Forest Ecology and Management 68(2/3): 399-402. Vessey, J.K. 1994. Measurement of nitrogenase activity in legume root nodules: In defense of the acetylene reduction assay. Plant and Soil 158: 151 -162 Visser, R. 1985. The efficiency of respiration and energy requirements of N assimilation in roots of sativum. Physiologia Plantarum. 65:2,209-218. Webster, G., Davey, M.R. and Cocking, E . C 1995. Parasponia with rhizobia: a neglected non-legume nitrogen-fixing symbiosis. Agbiotech News & Information 7(5): 119-124. Webster, G., Davey, M.R. and Cocking, E.C. 1998. Parasponia: a nitrogen-fixing non-legume of the Ulmaceae. In: Tree biotechnology: towards the millennium. Nottingham University Press. Nottingham, UK. pp 77-86. Weetman, G.F. 1988. Nutrition and fertilization of lodgepole pine. In: Proc. Future Forests of the Mountain West: A Stand Culture Symposium, 1986. Ed. Schmidt, W . C U S D A Forest Service General Technical Report. INT-243. pp. 231-239. Weetman, G.F., Fournier, R. M . and Schnorbus, E. 1988. Lodgepole pine fertilization screening trials: four-year growth response following initial predictions. Soil Science Society of America Journal 52: 833-839. 157 Wei, X . , Kimmins, J.P., Peel, K. and Steen, 0. 1997. Mass and nutrients in woody debris in harvested and wildfire-killed lodgepole pine forests in the central interior of British Columbia. Canadian Journal of Forest Research 27: 148-155. Wei, X . and Kimmins, J.P. 1998. Asymbiotic nitrogen fixation in harvested and wildfire killed lodgepole pine forests in the central interior of British Columbia. Forest Ecology and Management 109: 343-353. Witty, J.F. 1979. Acetylene reduction assay can over-estimate nitrogen fixation in soil. Soil Biology and Biochemistry 11: 209-210. Witty, J.F. 1983. Estimation of N2-fixation in the field using biotic 1 5N-labelled fertilizer: Some problems and solutions. Soil Biology and Biochemistry 15: 631-640. Witty, J.F., Minchin, F.R. and Sheehy, J.E. 1983. Carbon costs of nitrogenase activity in legume root nodules determined using acetylene and oxygen. Journal of Experimental Botany. 34: 145, 951-963. Zheng, W.W. and Song, Y . N . 2000. Effects of V A M and Rhizobia on the growth and nitrogen fixation of wing bean. [Chinese]. Fujian Journal of Agricultural Sciences 15(2): 50-55. Zuberer, D.A. 1998. Biological Dinitrogen Fixation: Introduction and Non-symbiotic. In: Principles and Applications of Soil Microbiology. Eds. Sylvia, D .M. , Fuhrmann, J. and Hartel, P. Prentice-Hall. New Jersey, pp. 295-321. 158 Chapter 6 Haemoprotein of Suillus tomentosus Tuberculate Ectomycorrhizae and In vitro Tubercle Re-Assembly 6.1 I N T R O D U C T I O N The first report of a plant haemoprotein similar to animal haemoglobin was in leguminous Glycine max L. (soybean root) nodules (Kubo 1939). These results were later confirmed by two other independent studies also on G. max nodules (Keilin and Wang 1945, Virtanen 1945). The name "leghaemoglobin" was given to this root nodule haemoprotein, by Virtanen and his collaborators with reference to the prefix leg derived from the Latin lego. Since these early findings, leghaemoglobin (Lb) has been described in the root nodules of many other leguminous plant species including Phaseolus vulgaris L. (Dilworth 1980), Lupinus luteus L . (Dilworth 1980), Vicia faba L. (Lehtovaara and Perttila 1978), Pisum sativum L. (Uheda and Syono 1982), Medicago sativa L. (Jing et al. 1982) and Trifolium subterraneum L. (Thulborn et al. 1979). Leghaemoglobin is a monomeric haemoprotein comprised of a prosthetic group, protoporphyrin (protohaem), and a protein component (apoprotein), globin (Ellfolk 1972, Monroe et al. 1989, Martin et al. 1990, Bergersen 1993). The protoporphyrin component is comprised of four pyrrole rings in the same plane around an iron atom, which is coupled to the four nitrogen atoms. The iron, in a trivalent state, is able to combine with certain molecules, notably oxygen (Ellfolk 1972, Wittenberg 1974). Coupled to the haem molecule on the remaining two binding sites, perpendicular to its orientation, are the imidazole moiety of a histidine residue of the protein molecule, and a water molecule (Ellfolk 1972). 159 Leghaemoglobin has an extremely high affinity for O2, which is believed to be central to its biological role in legume root nodules (Appleby et al. 1988, Monroe et al. 1989, Martin et al. 1990). The high affinity of leghaemoglobin for O2 is attributed to its fast O2 combination rate constant and moderately slow O2 dissociation rate constant (Dilworth and Appleby 1979). The haem pocket of leghaemoglobin is larger than that of other monomeric haemoglobins and it is believed to be the reason for the fast O2 combination constant of leghaemoglobin (Appleby 1984). Leghaemoglobins resemble animal haemoglobins in many respects. Two of the main components of leghaemoglobin have been shown to contain only one haem group per molecule and in this way are similar to myoglobins and some primitive haemoglobins like those of Lampetra fluviatilis (L.). The pH 50% value of leghaemoglobin for the basic and acidic forms is 8.30, very close to the value for vertebrate haemoglobins (Ellfolk 1972). The most striking difference between leghaemoglobin of soybean nodules and other haemoproteins is the absence of the sulphur-containing amino acids in the peptide chain structure (Ellfolk 1972). Leghaemoglobin biosynthesis occurs in nodules through contributions from both the host plant and symbiotic bacteria residing within the nodules (Appleby 1984, Dakora et al. 1991, Fruhling et al. 1997). Numerous studies of the microsymbionts in root nodules have characterized them as microaerophilic nitrogen-fixing bacteria (Holsten et al. 1971, McRae et al. 1978, Alexander 1984, Atkins 1984,). The protohaem moiety of leghaemoglobin has been shown to originate from the bacterial symbiont (Appleby 1974, Dilworth and Appleby 1979, Keithley and Nadler 1983), whereas, the apoprotein moiety has been shown to be synthesised in the systole of the host root tissue (Verma et al. 1979, Noel et al. 1982). This relationship was first suggested when it was discovered that the pattern of leghaemoglobin isomers produced in 160 legume nodules were controlled by the plant host and not the bacterial symbiont (Ellfolk 1972, Appleby 1974, Dilworth and Appleby 1979). Before 1974, leghaemoglobin was thought to function by limiting the amount of free 02 in the nodule (Dickerson and Geis 1983, Appleby 1984) to protect the O2 intolerant nitrogenase enzyme from denaturation. The nitrogenase enzyme undergoes rapid degradation in the presence of O2 and, therefore, requires very low partial pressures of O2 to function properly (Bergersen 1993). The N2-fixing bacteria in nodules are microaerophilic, however, they still require considerable amounts of O2 (Appleby 1984, Bergersen 1993). Therefore, it was hypothesised that leghaemoglobin was synthesised in nodules to act as a regulator of O2, supplying enough for bacterial respiration without degrading nitrogenase. Further comprehensive studies on the structure and properties of leghaemoglobin have revealed that this was not entirely correct. Leghaemoglobin does act as somewhat of an 02 barrier but not in the capacity of being a true "barrier". Instead, leghaemoglobin acts as an O2 reservoir, storing O2 for future use in nodule metabolism (Appleby 1984, Becana and Klucas 1992, Bergersen 1993). More importantly, this work has shown that the main function of leghaemoglobin in root nodules is to facilitate the diffusion (flux) of O2 to the vigorously respiring N 2-fixing endosymbiotic bacteria within the nodule cortex (Appleby 1984, Becana and Klucas 1992, Bergersen 1993). The vigorous respiration of the bacteria within the nodule creates a very low O2 concentration around the bacteria. This is optimal for the normal function of the nitrogenase enzyme but creates a problematic situation for the normal respiration of these bacteria (Robson and Postgate 1980). 161 The mechanism by which facilitated delivery of O2 by leghaemoglobin to the bacteroids occurs at very low concentrations of free, dissolved O2, is multifaceted (Appleby 1974, 1984, Bergersen 1993, 1996, Kuzma et al. 1993). Oxygen from the atmosphere is initially restricted by a layer of inner cortical nodule cells (Tjepkema and Yokum 1974, Witty and Minchin 1990). The bacteria at the centre of the nodule have a very high demand for O2 due to their respiratory needs and they have a very high affinity for O2, thereby reducing the concentration of free, dissolved 0 2 to very low levels (Bergersen 1993, 1996). The low O2 concentrations cannot satisfy the high demand for O2 by the respiring bacteria. However, the cytoplasm of the host cells in the nodule contain leghaemoglobin which is capable of reverse oxygenation. This results in a net flux of oxyleghaemoglobin (Lb0 2 ) from the outer surface of the host cells to the bacteria in the innermost parts of the nodule. At every point along the pathway, leghaemoglobin, O2, and oxyleghaemoglobin are in equilibrium and the restricted flux of free, dissolved O2 is augmented by the O2 being delivered by leghaemoglobin (Appleby 1984, Bergersen 1993). The exact location of leghaemoglobin within nodules has been a topic of great debate and is still considered to be an area of some controversy. Appleby (1974) suggested that leghaemoglobin may occur both inside and outside the membrane envelopes (peribacteroid membranes) which surround either single or small groups of the N2-fixing bacteria in nodules. This proposition was supported by the work of Bergersen and Appleby (1981), who found minute amounts of leghaemoglobin within the peribacteroid membrane. Verma and Long (1983) using leghaemoglobin antibodies, however, provided strong evidence that leghaemoglobin exists only in the host cell cytoplasm and not within the peribacteroid membranes. The discrepancy among these works may be explained by differences in the peribacteroid membranes among different species of nodulated plants. For example, it is postulated that the large peribacteroid 162 membrane structures of soybean symbiotic tissue, each enclosing several bacteria in abundant free space, contain leghaemoglobin (Goodchild 1977). Due to the large spaces between the peribacteroid membrane and residing bacteria, leghaemoglobin is necessary to transport O2 to the bacteria (Appleby 1984, Goodchild 1977). In contrast, the peribacteroid membrane of other plants, such as lupine enclose only single bacteria in a very small free space and do not contain leghaemoglobin (Goodchild 1977). The proximity of bacteria to the membrane surface is sufficient for there to be no need for leghaemoglobin in this case, since the bacteria are able to access adequate O2 by diffusion through the peribacteroid membrane. Leghaemoglobin is a common component of leguminous root nodules, but is not exclusive to these symbiotic systems. It has also been detected in nodules of a number of non-leguminous plants including Casuarina spp., Parasponia spp. and Trema spp. (Appleby et al. 1983, Tjepkema 1983, Fleming et al. 1987, Christensen et al. 1991). The nodules of some of these non-leguminous plants have been shown to contain the same species of bacteria that are found in leguminous plants (Appleby 1984, Landsmann et al. 1986). Other species of N 2-fixing bacteria such as Frankia spp., have been isolated from some species of non-leguminous plants, indicating that this type of relationship is not exclusive to a single bacterial species (Tjepkema 1983, Christensen et al. 1991). Leghaemoglobin in Parasponia spp. and Trema spp. nodules has been shown to function in the same manner as in leguminous species (Appleby et al. 1983, Tjepkema 1983, Fleming et al. 1987, Bogusz et al. 1988, Christensen et al. 1991). Appleby et al. (1988) also reported the presence of leghaemoglobin genes, mRNA and leghaemoglobin protein in the root tissue of plants which do not form nodules or have symbiotic N 2-fixing bacteria. Appleby et al. (1988) proposed that leghaemoglobin may be present in all plant roots and not exclusive to plants with nodule-N2-fixing structures. They also suggested that 163 leghaemoglobin in plant roots might play a similar role to haemoglobin in mammalian muscle tissue, transporting O2 to tissues that require it. More recently, additional work has shown that the leghaemoglobin gene occurs in the tissues of an arbuscular mycorrhizal fungus (AM) in symbiosis with V. faba (Fruhling et al. 1997). Although these researchers only report the presence of a leghaemoglobin transcript common to nodules and mycorrhizal roots, one would expect that the detection of leghaemoglobin molecules in mycorrhizal roots is likely. Suillus tomentosus (Kauff.) Sing., Snell & Dick tuberculate ectomycorrhizae consist of an ectotrophic fungus growing on the roots of a host plant, with the fungus forming structures called tubercles. Tubercles are somewhat similar in external morphology to nodules on N2-fixing leguminous plants but not to N2-fixing nodules on actinorrhizal plants. The data from Chapter 4 have shown that infixing bacteria reside within S. tomentosus T E M and that nitrogen fixation occurs in association with these tubercles (Chapter 5). The function of S. tomentosus T E M may be similar to nodules on leguminous and non-leguminous plants. Furthermore, S. tomentosus T E M have a pinkish cast to them in situ on live roots (Chapter 2) similar to leguminous nodules. This colour suggests the possible presence a haemoprotein. The primary objective of this chapter is to determine i f T E M on lodgepole pine contain a haemoglobin (Hb) molecule similar to that of leghaemoglobin found in other N2-fixing symbiotic relationships. The secondary objective is to attempt to re-assemble S. tomentosus tubercles in vitro using bacteria isolated from S. tomentosus tubercles, S. tomentosus and Pinus contorta var. latifolia (Dougl.) Engelm. 164 6.2 M A T E R I A L S A N D M E T H O D S 6.2.1 Study Sites The study sites for these experiments were located in the Suboreal Pine-Spruce xeric cold (SBPSxc) biogeoclimactic subzone, 100 kilometers west of Williams Lake in the interior of British Columbia (Chapter 1). Samples were collected from three sites to across the sub-zone (Fig. 1.1, Chapter 1). 6.2.2 Haemoprotein Analysis 6.2.2.1 Tubercle Tissue Collection Live roots of Pinus contorta with T E M growing on them were excavated from within coarse woody debris (CWD) on all study sites. Al l of the tubercles associated with each root were removed from the roots and placed into 5 ml air tight gas chromatograph sample vials. Each vial was flushed using pure inert argon gas to reduce the degradation of the possible haemoprotein by oxidation reactions (pers. comm. Dr. Holl 1998). The vials were then stored in a cooler with ice packs and were immediately transported to the laboratory. A l l vials were stored in the laboratory at -40°C until they could be processed but no more than two weeks. Collections were conducted periodically between June and October of 1998,1999 and 2000. 6.2.2.2 Drabkin's Reagent Test for Total Haemoglobin Concentration The first test for haemoprotein in T E M on lodgepole pine was conducted by using the Drabkin's reagent test for total haemoglobin concentration (Sigma-Aldrich, St. Louis, M O , USA). A standard calibration curve for total haemoglobin concentration was constructed by mixing a standard methhaemoglobin prepared from human haemoglobin with Drabkin's reagent, 165 which yields a cyanmethaemoglobin solution. The cyanmethaemoglobin solution was then analysed for absorbance (at 540nm) equivalent to that of a whole blood sample containing a haemoglobin level of 18 g dl"1 that had been diluted 1:251 with Drabkin's reagent solution. T E M samples, each weighing 0.5 g from each of the 3 sample periods each year, were removed from the freezer and crushed separately using a sterile mortar and pestle. Each crushed T E M sample was then combined with 2 ml of 0.1 M phosphate buffer at pH 7.4. The slurry from each sample was centrifuged at 10,000 rpm for 4 minutes in a Difco 500 centrifuge. The supernatant was then added to 5 ml of Drabkin's reagent, mixed and left to stand at room temperature (24 °C) for 15 minutes. The absorbance of the test solutions were read at 540nm using a spectrophotometer. The results were compared to the standard curve to determine the concentration of haemoglobin in each sample. Two types of comparisons were made. The first was with non-tuberculate mycorrhizal roots and the second was with secondary roots without mycorrhiza and without T E M . Comparison samples of the same weights as that of T E M samples (0.5 g), were measured and crushed in the same fashion as with T E M samples. 6.2.2.3 Cellulose Acetate Gel Electrophoresis The second test used to determine if a haemoprotein was present in T E M on P. contorta was cellulose acetate gel electrophoresis (Holl et al. 1983). Two different stains were used in this procedure. The first was Ponceau S stain (Pall Gelman Sciences, Ann Arbor, MI, USA), which stains haemoproteins and the second was o-dianisidine stain, which specifically stains haemoglobin (Owen et al. 1958). Composite T E M tissue samples, weighing 0.2 g each, were crushed using a sterile mortar and pestle with the addition of 0.057 g of polyvinylpyrrolidone (PVP-40) and 0.5 ml of 0.1 M phosphate buffer at pH 7.4. Multiple tissue samples from each 166 collection period were tested. The polyvinylpyrrolidone was added to ensure the haemoproteins (if present) would not degrade during the extraction and to remove large organic matter from the during the assays. The slurry from each sample was then centrifuged at 10,000 rpm for 4 minutes in a Difco 500 centrifuge. From each sample, 500 (jl of the supernatant was collected and run on a cellulose acetate electrophoretic gel at 420 volts for 35 minutes (Pall Gelman Sciences, Ann Arbor, MI, USA). A 500 ul sample of human haemoglobin was run in parallel with the test samples as a standard (concentration 1 mg/ml haemoglobin). Samples of ectomycorrhizal root tissue without T E M and samples of roots with no mycorrhiza were tested in the same fashion. Soybean peroxidase was also tested to verify that the suspected haem molecule was not a peroxidase (pers. comm. Appleby 1998). A l l tissue samples were kept on ice at 4°C during processing for electrophoresis, to ensure the haemoglobin will not degrade or oxidise during the tests. 6.2.3 Suillus Tomentosus-Pinus contorta TEM Recombination In Vitro 6.2.3.1 Tubercle Tissue Collection Tubercle samples were collected as described in Section 6.2.2.1. with the exception that tubercles were removed from host roots and individually placed into 1ml retention vials to avoid cross contamination by surface contact. 6.2.3.2 Fungal and Bacteria Isolation Tubercles were surface cleaned by placing in 30% H 20 2 for 45 seconds. Each tubercle was rinsed three times in distilled, sterilised water for an additional 30 seconds each rinsing. Once surface cleaned, each tubercle was teased apart using forceps. Each half of a tubercle was placed into a petri dish containing modified Melin-Norkrans agar (MMN). The plates were 167 sealed with parafilm and allowed to incubate at 24°C for 3 to 4 weeks or until abundant fungal development occurred. Once initial development was sufficient, the fungus was re-plated on to new M M N media and allowed to incubate for 3 weeks. Bacteria were isolated as outlined in sections 4.2.2 and 4.2.3. One isolate of the nitrogen-fixing bacteria Paenibacillus amylolyticus (Nakamura) Ash et al, comb. nov. and Methylobacterium mesophilicum (Austin and Goodfellow) G. and B., comb. nov. that were identified by 16S rDNA analysis (Chapter 4) were selected. P. amylolyticus a n d M mesophilicum isolates were cultured together in liquid combined carbon media (CCM) for 4 days at 24°C on an orbital shaker. 6.2.3.3 Recombination of TEM System A l l of the following steps were performed under aseptic conditions in a laminar flow hood. Seeds of P. contorta were surface cleaned by soaking in 30% H2O2 for 30 minutes. The seeds were removed from the H2O2 and rinsed twice in distilled, sterilised water for an additional 30 minutes each. Seeds were then placed in petri dishes containing water agar (15 g agar/liter water), five per plate, with sufficient spacing between seeds to avoid cross contamination. The plates were sealed, placed in racks on edge and placed in a growth chamber (16 h light at 20°C, 8 h dark at 16°C) until main roots were approximately 1.5 cm in length (approximately 1 week). Seedlings were then transferred to new petri dishes containing a growth medium of vermiculite and peat at a ratio of 7:1, and 1 liter of dilute (1/3 concentration) M M N per 5 liters of vermiculite/peat mixture. Before the growth medium was placed in the petri dishes it was autoclaved twice for 30 minutes each time. The second autoclaving was conducted 24h after the first to kill any microbes that might have survived the first treatment through sporulation. To 168 accommodate seedlings in petri dishes, a notch was placed in one edge of each plate. Seedlings were placed on top of the growth medium and into the notch allowing the shoot to extend outwards while the root extended down into the medium. Three seedlings were placed in each petri plate and 5 agar plugs of S. tomentosus culture, 5 mm x 5 mm, were placed directly on top of the main roots and in the growth medium. One milliliter of bacterial culture from section 6.2.3.2 was then applied directly to the seedling roots. The petri dishes were covered and sealed with parafilm. The notches in the growth plates, around the seedlings, were sealed with lanolin (wool fat). Twenty petri dishes were made with the bacteria, fungus and seedlings. A second set of twenty petri dishes was made with fungus and seedlings but no bacteria (Treatment A). A third set of twenty petri dishes was made with seedlings but no fungus or bacteria (Treatment B). After innoculation, the systems were allowed to develop for ten weeks 6.3 RESULTS 6.3.1 Haemoprotein Analysis 6.3.1.1 Drabkin's Reagent Test A l l absorbance measurements from the Drabkin's reagent assay on all thirty of the T E M tissue samples yielded positive results (Table 6.1). The calculated quantity of haemoglobin from the standard curve for T E M samples, ranged from 5.6 - 9.7 g dl"1. A l l non-TEM mycorrhizal root samples and all non-mycorrhizal roots tested negative. 6.3.1.2 Haemoglobin Cellulose Acetate Gel Electrophoresis Ponceau S stained electrophoretic gels of composite tuberculate ectomycorrhizal samples revealed that 5 of the 15 samples did not have protein bands (Table 6.2). Correspondingly, these 169 Table 6.1: Haemoglobin content in tuberculate ectomycorrhizae as measured by Drabkin's reagent test. 0.5 grams of tissue was used for each test. Non-tuberculate mycorrhizal roots and non-mycorrhizal roots gave negative results for all samples tested. Sample Tuberculate Sample Tuberculate Haemoglobin Haemoglobin (gdr1) (g df1) 1998 2000 1 5.6 1 8.4 2 8.1 2 7.8 3 7.3 3 9.4 4 5.9 4 5.7 5 8.9 5 6.3 6 6.0 6 5.8 7 7.2 7 8.5 8 7.9 8 9.6 9 8.8 9 5.2 10 5.9 10 6.2 1999 1 5.7 2 7.4 3 9.7 4 6.3 5 6.9 6 5.7 7 9.8 8 7.4 9 9.0 10 8.4 samples did not stain positive with o-dianisidine stain. A l l but one of the T E M samples that stained positive in Ponceau S stain, stained positive in o-dianisidine stain. None of the electrophoretic gels with non-tuberculate mycorrhizal root samples stained positive in either the Ponceau S stain (Fig. 6.2a) or the o-dianisidine stain (Fig. 6.2b, Table 6.2). Additionally, none of the electrophoretic gels with non-mycorrhizal root samples stained positive with either of the stains (Fig. 6.2, Table 6.2). Multiple protein bands can be seen on the T E M cellulose acetate strips when stained with Ponceau S (Fig. 6.1a). The human haemoglobin standard revealed only one band when stained with Ponceau S. Positive T E M samples show a protein band close to the isoelectric point of the 170 protein band from the human haemoglobin standard (Fig. 6.1a). Counterstaining the gels with o-dianisidine revealed single bands from the human haemoglobin standard and the T E M samples Table 6.2: Cellulose acetate gel electrophoresis of tuberculate ectomycorrhizae stained with Ponceau S and o-dianisidine (+ = band stained positive on gel, - = no staining on gel). Non-tuberculate mycorrhizal roots and non-mycorrhizal roots gave negative results for all samples tested. Sample Tuberculate Sample Tuberculate Ectomycorrhizae Ectomycorrhizae Ponceau S o-dianisidine Ponceau S o-dianisidine stain stain stain stain 1998 2000 1 - - 1 + + 2 + + 2 + + 3 - - 3 + -4 - - 4 + + 5 + + 5 1999 1 + + 2 + + 3 + + 4 - -5 + + Figure 6.1: Composite samples of Suillus tomentosus tubercle extracts on cellulose acetate gels stained with (A) Ponceau S stain and (B) o-dianisidine stain. STD= human haemoglobin standard, T I -T3= S. tomentosus tuberculate ectomycorrhizae samples. 171 Start point STD M l M2 Rl Figure 6.2: Composite samples of non- tuberculate mycorrhizal root extracts on cellulose acetate gels stained with (A) Ponceau S stain and (B) o-dianisidine stain. STD= human haemoglobin standard, M l -M2= non-tuberculate mycorrhizal roots and R l= non-mycorrhizal roots. (Fig. 6.1b). The T E M bands can be seen to be at or close to the same isoelectric point as the human haemoglobin standard. T E M sample 3 shows partial staining in o-dianisidine stain, which is supported by the incomplete protein bands stained by Ponceau S for that sample (Fig. 6.1). Peroxidase samples showed a strong band on gels when stained with both Ponceau S and o-dianisidine (Fig. 6.3a, 6.3b). Peroxidase bands did not move from the origin in comparison to the human haemoglobin standard and S. tomentosus T E M samples. Non-tuberculate mycorrhizal roots did not show any banding in either stain. 6.3.1.3 Recombination ofS. tomentosus - P. contorta TEM Recombination of Suillus tomentosus, Pinus contorta and the two nitrogen fixing bacterial species P. amylolyticus and M. mesophilicum after two and a half months resulted in tubercle formation in 18 of 20 microcosms (Table 6.3, Fig. 6.4). None of the microcosms in 172 Figure 6.3: Cellulose acetate gels stained in (A) Ponceau S stain and (B) o-dianisidine stain. STD = standard human haemoglobin, TI = Suillus tomentosus tubercle, M l = non-tuberculate mycorrhizal root and Perox = soybean peroxidase. Figure 6.4: A) Microcosm showing the formation of Suillus tomentosus tubercles on Pinus contorta when co-inoculated with Paenibacillus amylolyticus and Methylobacterium mesophilicum bacteria culture. B) Close up of S. tomentosus tubercles (arrows) on P. contorta roots (R). 173 Figure 6.5: A) Microcosm recombination of Suillus tomentosus and Pinus contorta with no bacteria inoculum. B) Close up of P. contorta roots (R), showing development of fungal mycelium and non-tubercle ectomycorrhizae of S. tomentosus (arrows) without tubercle formation. Star is fungal inoculum plug. Figure 6.6: Microcosm of Pinus contorta with no fungal or bacterial inoculum. No ectomycorrhizal development or tubercle development were evident. 174 Table 6.3: Number of microcosms with tuberculate ectomycorrhizal development for recombinations with Pinus contorta, Suillus tomentosus, Paenibacillus amylolyticus and Methylobacterum mesophillicum (column 1), P. contorta and S. tomentosus (column 2) and P. contorta (column 3). Treatment A showed normal ectomycorrhizal development without tubercle development. n=20 for each treatment. Seedling + Fungus Treatment A Treatment B + Bacteria Seedling + Fungus Seedling Number of microcosms with tuberculate 18 0 0 ectomycorrhizae Number of microcosms With ectomycorrhizae 18 14 development treatment type A (seedlings with fungus and no bacteria) showed T E M formation. In 14 of 20 microcosms for this treatment type, there was fungal growth and development of non-tubercle ectomycorrhizae (Table 6.3, Fig.6.5 ). There was no T E M or mycorrhizal development in treatment type B (just seedlings) microcosms (Table 6.3, Fig. 6.6). 6.4 DISCUSSION It was necessary to use both Drabkin's reagent and cellulose acetate gel electrophoresis to determine i f a haemoglobin (Hb) was present in T E M on lodgepole pine because the Drabkin's reagent test is only a crude measurement of plant leghaemoglobin (Lb). It can react with lipids and other non-haem proteins and lead to erroneous positive results (Sigma-Aldrich, St. Louis, M O , USA). Examples of these compounds in plant tissue are lignin or other plant proteins (pers. comm. Dr. Holl 1999). Therefore, it is not surprising that all of the T E M samples tested using Drabkin's Reagent gave positive results. The root tips contained within T E M would have the normal plant proteins and lignin associated with plant tissue and these substances may have contributed to the positive observations for Drabkin's tests. 175 However, this contrasted with the observation that none of the non-tuberculate root samples tested positive. This suggests that the substances contributing to the positive results are either present in very low concentrations in non-TEM root samples or are not present in roots but exclusive to tissue of T E M . Furthermore, these substances may not be just proteins, but may be Hb, located somewhere in the fungal tissue and not associated with the host root tips. It seems unlikely that Hb would be in the fungal tissue because there are numerous studies indicating that Lb is located in the systole of the plant host cells within nodules on leguminous and non-leguminous plants (Bergersen and Appleby 1981, Verma and Long 1983, Appleby 1984). However, it is possible that the "host" in the T E M complex, when concerned with nitrogen fixation and Hb, is the fungal symbiont and not the tree species. Alternatively, it is possible that Hb production only occurs in the root tips within T E M due to the symbiotic relationship between the nitrogen fixing bacteria and 'host' plant. Roots without T E M may not have the appropriate nitrogen-fixing bacteria needed to manufacture Hb and, therefore, do not show positive results. The results from the gel electrophoresis analysis using the Ponceau S stain, seem to suggest this as well. There may be an alternative explanation to the observations in both tests. The proteins detected may not be associated with the fungal tissue but may only occur in specific types of roots (e.g. root tips in tubercles vs. non-mycorrhizal fine roots or main roots). This may explain why the root samples with no mycorrhizae did not show positive results, while the roots with T E M did. In either case there are some protein molecules within T E M that are giving compelling positive results in both tests. More interesting are the positive results from the electrophoretic tests using the o-dianisidine stain. Since this is an exclusive haemoglobin stain, and positive results were observed when compared side by side to human haemoglobin, it seems that T E M do have a form 176 of haemoglobin associated with them and I propose that this new haemoglobin be called tuberculate ectomycohaemoglobin (Tb). Even though all of the samples tested with the o-dianisidine stain did not produce positive results, the repeatable positive result from year to year with different T E M samples is quite intriguing. Positive results for Tb with all samples of T E M were not expected because it has been found that the amount of Lb within N2-fixation root nodules will vary depending upon the amount of N2-fixation and the vigour of each symbiotic combination, occurring in each nodule (Appleby 1984, Holl et al. 1989, Zhiznesvskaya et al. 1990). Therefore, if the numbers of respiring N 2-fixing bacteria are low within a tubercle, there may be a lower O2 demand and, therefore, a reduced need for Tb to transport 02 to the bacteria. The bacteria would in turn reduce the amount of photosynthate going into co-synthesis of Tb and, Tb concentrations would decrease in certain tubercle samples. In addition, the normal metabolism of bacteria, host root cells and fungal symbiont cells within a tubercle, could produce substances such as nicotinic acid, ligands, nitrate, nitrite, nitric oxide and active endopeptidases all of which degrade functional Lb in root nodules (Pfeiffer et al. 1983, Pladys and Rigaud 1985, Lahiri et al. 1993, Nandwal et al. 1993, Swaraj et al. 1993, Denison and Harter 1995). The negative Tb results observed in T E M samples from each year could also be due to the age of the tubercles. The senescence and aging of T E M (Trappe 1971) appears to be similar to that of root nodules on leguminous and non-leguminous plants. It has been shown that the senescence of root nodules on leguminous plants results in the degradation and reduction of Lb content within the nodule (Pladys and Rigaud 1985, Lahiri et al. 1993, Nandwal et al. 1993). As the metabolic activities of the nodule effectively shut down due to root demise, production of compounds such as Lb become impossible. Therefore, the concentration of Lb in older nodules becomes very low or non-existent. 177 The connection between the bacteria and the 'hosts" of T E M seems even more apparent and central to the viability of T E M when the results from the recombination experiment are considered. As mentioned earlier, with legumes and non-legumes, both Lb biosynthesis and nodule formation occur through contributions from both the host plant and symbiotic nitrogen-fixing bacteria (Appleby 1984, Dakora et al. 1991, Fruhling et al. 1997). The results from the recombination of T E M seem to show a similar phenomena. Complete T E M were only produced when the bacteria were co-inoculated with the fungus on P. contorta seedlings. The bacteria appear to be a pivotal component to T E M formation and if this is the case then the production and maintenance of Tb within T E M may also be regulated by both the bacteria and the 'hosts'. Unfortunately, the species of bacteria responsible for the observed influence on S. tomentosus tubercle formation on P. contorta was not determined in this study. However, a recent study by Sy et al. (2001), has shown that a Methylobacterium spp. (named Methylobacterium nodulans Sy et al. comb. nov. by the researchers) are responsible for the formation of nitrogen fixing nodules on the legume Crotalaria spp. The Methylobacterium mesophilicum isolated from S. tomentosus T E M may be functioning in a similar fashion to that of M. nodulans. My initial thoughts were that P. amylolyticus, belonging to a well-known group of nitrogen fixing bacteria, was responsible for the observed influence on T E M formation. With the current results from Sy et al. (2001) and the combined influence of both species observed in this study, both species need to be tested separately to determine which, i f either influence T E M formation. If M. mesophilicum isolated from S. tomentosus T E M is functioning as a co-synthesiser of tubercles, it may be the bacterial species primarily involved in Tb production and maintenance as well. Sy et al. (2001) do not report on leghaemoglobin synthesis in Crotalaria 178 spp. nodules by M. nodulans, therefore, research into Methylobacterium spp. and Lb or Tb production may reveal a novel new phenomena. Even thought the results from this study are somewhat preliminary, it appears that a haemoglobin molecule of some form does exist within the tissue of S. tomentosus T E M . This finding is quite compelling considering that the tuberculate structure contains N2-fixing bacteria and appear to be sites of nitrogenase activity that may be associated with nitrogen fixation. The term tuberculate ectomycohaemoglobin was used quite loosely in this chapter when referring to results. This was done because a haemoglobin specific stain was used in the electrophoretic tests. Further investigation is required to definitively identify the haemoprotein found as a haemoglobin molecule. Techniques that may be useful in determining the structure of Tb in T E M are n-terminal amino acid sequencing and haemoglobin immunoassay probes. As mentioned above, the Lb molecule consists of a protohaem moiety and an apoprotein moiety. The protohaem moiety of Lb has been shown to be synthesised by the bacterial symbiont of root nodules (Appleby 1974, Dilworth and Appleby 1979, Keithley and Nadler 1983), whereas, the apoprotein moiety has been shown to be synthesized in the cystol of the host root tissue (Verma et al. 1979, Noel et al. 1982). Additional studies are necessary to determine the location of Tb within T E M and to determine what organisms are involved in the synthesis of the constituents of this molecule. Furthermore additional research is need to determine the significance of this molecule in function and form. 179 6.5 R E F E R E N C E S Alexander, M . 1984. Ecology of Rhizobium. In: Biological Nitrogen Fixation, Ecology, Technology and Physiology. Ed. M . Alexander, M . Plenum. New York. pp. 39-50. Appleby, C A . 1974. Leghemoglobins. In: The Biology of Nitrogen Fixation. Ed. Quispel, A. Elsevier. New York. pp. 521-524. Appleby, C. A. 1984. Leghemoglobin and Rhizobium respiration. Annual Review of Plant Physiology 35: 443-478. Appleby, C.A., Tjepkema, J.D. and Trinick, M.J. 1983. Hemoglobin in a nonleguminous plant, Parasponia: possible genetic origin and function in nitrogen fixation. Science 220: 951-953. Appleby, C.A., Bogusz, D., Dennis, E.S. and Peacock, W.J. 1988. A role for haemoglobin in all plant roots. Plant, Cell and Environment 11:359-367. Atkins, C A . 1984. Efficiencies and inefficiencies in the legume/'Rhizobium symbiosis - a review. Plant and Soil 82:273-284. Becana, M . and Klucas, R.V. 1992. Oxidation and reduction of leghemoglobin in root nodules of leguminous plants. Plant Physiology 98:11217-1221. Bergersen, F.J. 1993. Diffusion of oxyleghaemoglobin. Annals of Botany 72:577-582. Bergersen, F.J. 1996. Delivery of O2 to bacteriods in soybean nodule cells: consideration of gradients of concentration of free, dissolved O2 in and near symbiosomes and beneath intercellular species. Protoplasma 191:9-20. Bergersen, F.J. and C A . Appleby. 1981. Leghaemoglobin within bacteroid-enclosing membrane envelopes from soybean root nodules. Planta 152: 534-543. Bogusz, D., Appleby, C.A., Landsmann, J., Dennis, E.S. and Trinick, M.J. 1988. Functioning haemoglobin genes in non-nodulating plants. Nature 331:178-180. 180 Christensen, T., Dennis, E.S., Peacock, J.W., Landsmann, J. and Marcker, K . A . 1991. Hemoglobin genes in non-legumes: cloning and characterization of a Casuarina glauca hemoglobin gene. Plant Molecular Biology 16:339-344. Denison, R.F. and Harter, B.L. 1995. Nitrate effects on nodule oxygen permeability and leghemoglobin. Nodule oximetry and computer modelling. Plant Physiology 107: 1355-1364. Dakora, F.D., Appleby, C A . and Atkins, C.A.. 1991. Effect of p 0 2 on the formation and status of leghemoglobin in nodules of cowpea and soybean. Plant Physiology 95: 723-730. Dickerson, R.E. and Geis, I. 1983. Hemoglobin: structure, function, evolution and pathology. Benjamin-Cummings. Menlo Park, CA. pp. 75-82. Dilworth, M.J. 1980. Leghemoglobins. Methods in Enzymology 69C: 812-823. Dilworth, M.J. and Appleby, C.A. 1979. Leghemoglobin and Rhizobium hemoproteins. In: A Treatise on Dinitrogen Fixation. Eds. Hardy, R.W.F., Bottomley, F. and Burns, R.C. Wiley. New York. pp. 691-764. Ellfolk, N . 1972. Leghaemoglobin, a plant haemoglobin. Endevour 31: 139-142. Fleming, A. I., Wittenberg, J.B., Wittenberg, B.A., Dudman, W.F. and Appleby, C A . 1987. The purification, characterization and ligand-binding kinetics of hemoglobins from root nodules of the non-leguminous Casuarina glauca-Frankia symbiosis. Biochemie et Biophysica Acta 911:209-220. Fruhling, M . , Roussei, H , Gianinazzi-Pearson, V., Puhler, A. and Perlick, A . M . 1997. The Vicia faba leghemoglobin gene VfLb29 is induced in root nodules and in roots colonized by the arbuscular mycorrhizal fungus Glomus fasciculatum. Molecular Plant-Microbe Interactions 10: 124-131. 181 Goodchild, D.J. 1977. The ultrastructure of root nodules in relation to nitrogen fixation. International Review of Cytology - Supplement 6: 235-288. Holl, F.B., Milliron, M . L . and Delafield, S.J. 1983. Qualitative variation in root nodule leghemoglobins: Intra-specific variation in component profiles. Plant Science Letters 32: 321-326. Holl, F.B., Somasegaran, P. and Nakao P. 1989. Genus specific microbial regulation of leghemoglobin expression in root nodules of interspecific hybrids of Phaseolus. In: Proceedings of the 12th North American Symbiotic Nitrogen Fixation Conference. Iowa State University of Science and Technology. Ames, IA. Holsten, R.D., Burns, R.C., Hardy, R.W.F. and Hebert, R R . 1971. Rhizobium-plant cell interaction: establishment of an in vitro symbiosis. Nature 232: 173-178. Jing, Y . , Paau, A.S. and Brill, W.J. 1982. Leghemoglobins from alfalfa (Medicago sativa L. Vernal) root nodules. I. Purification and in vitro synthesis of five leghemoglobin components. Plant Science 25: 119-132. Keilin, D. and Wang, Y . L . 1945. Haemoglobin in the root nodules of leguminous plants. Nature 155: 227-229. Keithley, J.H. and Nadler, K.D. 1983. Protoporphyrin formation in Rhizobium japonicum. Journal of Bacteriology 154: 838-845. Kubo, H . 1939. Plant haemoprotein analogous to animal haemoglobin. Acta Phytochimica 11: 195-200. Kuzma, M . M . , Hunt, S. and Layzell, D.B. 1993. Role of oxygen in the limitation and inhibition of nitrogenase activity and respiration rate in individual soybean nodules. Plant Physiology 101: 161-169. 182 Lahiri, K., Chattopadhyay, S., Chatterjee, S. and Ghosh, B. 1993. Biochemical changes in nodules of Vinga mungo (L.) during vegetative and reproductive stages of plant growth in the field. Annals of Botany 71:485-488. Landsmann, J., Dennis, E.S., Higgins, T.J.V., Appleby, C.A., Kortt A .A. and Peacock, W.J. 1986. Common evolutionary origin of legume and non-legume plant haemoglobins. Nature 324: 166-168. Lehtovaara, P. and Perttila, U . 1978. Bile-pigment formation from different leghaemoglobins: Methane-bridge specificity of coupled oxidation. Biochemical Journal, Cellular Aspects 176: 359-364. Martin, K. D., Saari, L. , Guang-Xin, W., Wang, T., Parkhurst, L.J. and Klucas, R.V. 1990. Kinetics and thermodynamics of oxygen, CO, and azide binding by the subcomponents of. soybean leghemoglobin. Journal of Biological Chemistry 265: 19588-19593. McRae, R.E., Hanus, J. and Evans, H.J. 1978. Properties of the hydrogenase system in Rhizobium japonicum bacteroids. Biochemical and Biophysical Research Communications 80: 384-390. Monroe, J.D., Owens, T.G. and LaRue, T.A. 1989. Measurement of the fractional oxygenation of leghemoglobin in intact detached pea nodules by reflectance spectroscopy. Plant Physiology, 91: 598-602. Nandwal, A.S., Bharti, S. and Singh, U . 1993. Application of N 0 3 - - N and NH 4 +-N affecting the leghemoglobin, N-status and dry matter accumulation in chickpea Cicer arietinum L. Indian Journal Experimental Biology 31: 93-7'5. Noel, K .D. , Stacey, G., Tandon, S.R., Silver, L E . and Brill, W.J. 1982. Rhizobium japonicum mutants defective in symbiotic nitrogen fixation. Journal of Bacteriology 155: 485-494. 183 Owen, J.A., Silberman, H.J. and Got. C. 1958. Detection of Haemoglobin, Haemoglobin-haptoglobin complexes and other substances with peroxidase activity after zone electrophoresis. Nature 182: 1373. Pfeiffer, N.E. , Makik, N.S.A. and Wagner, F.W. 1983. Reversible dark induced senescence of soybean root nodules. Plant Physiology 71:393-399. Pladys, D. and Rigaud, J. 1985. Senescence in French-bean nodules. Occurrence of different proteolytic activities. Plant Physiology 63:43-48. Robson, R. L. and Postgate, J. R. 1980. Oxygen and hydrogen in biological nitrogen fixation. Annual Review of Microbiology 34: 183-207. Swaraj, K. , Laura, J.S. and Bishnoi, N.R. 1993. Nitrate induced nodule senescence and changes in activities of enzymes scavanging H202 in clusterbean. Journal of Plant Physiology 136: 202-205. Sy, A., Giraud, E., Jourand, P., Garcia, N , Willems, A., DeLajudie, P., Prin, Y . , Neyra, M . , Gillis, M . , Boivin-Masson, C. and Dreyfus, B. 2001. Methylotrophic Methylobacterium bacteria nodulate and fix nitrogen in symbiosis with legumes. Journal of Bacteriology 183: 214-220. Thulborn, K.R., Minasian, E. and Leach, S.J. 1979. Leghemoglobin from Trifolium subterraneum. Purification and characterization. Biochemie et Biophysica Acta 578:476-483. Tjepkema, J.D. 1983. Hemoglobins in the nitrogen fixing root nodules of actinorhizal plants. Canadian Journal of Botany 63: 2924-2929. Tjepkema, J.D. and Yocum, C.S. 1974. Measurement of oxygen partial pressure within soybean nodules by oxygen microelectrodes. Planta 119:351-360. 184 Uheda, E. and Syono, K. 1982. Physiological role of leghaemoglobin heterogeneity in pea root nodule development. Plant and Cell Physiology 23:75-84. Verma, D.P.S., Ball, S., Guerin, C. and Wanamaker, L. 1979. Leghemoglobin biosynthesis in soybean root nodules. Characterization of the nascent and released peptides and the relative rate of synthesis of the major leghemoglobins. Biochemistry 18: 476-483. Verma, D.P.S. and Long, S. 1983. The molecular biology of Rhizobium legume symbiosis. International Review of Cytology - Supplement 14: 211-245. Virtanen, A.I. 1945. Plant haemoglobin, Leghaemoglobin. Nature 155:747. Wittenberg, J.B. 1974. Facilitated oxygen diffusion. Journal of Biological Chemistry 249: 4057-4066. Witty, J. F. and Minchin, F.R. 1990. Oxygen diffusion in the legume root nodule. In: Nitrogen fixation: Achievements and Objectives. Eds. Gresshoff, P .M. , Roth, L.E. , Stacey, G. and Newton, W.E. Chapman and Hall. New York. pp. 285-292 Zhiznevskaya, G.Ya., Kudryavtseva, N.N. , Grenlna, O.S. and Izmallov, S.F. 1990. Leghemoglobin content and stability, and nitrogen-fixing activity in Lupine, Soybean, and Common bean nodules. Fiziologiya Rastenii 37(2): 295-301. 185 Chapter 7 Conclusion 7.1 G E N E R A L C O N C L U S I O N S The data presented in this thesis support the hypothesis that Suillus tomentosus tuberculate ectomycorrhizae (TEM) on Pinus contorta are sites of nitrogenase activity. The fungal species involved in the formation of tuberculate ectomycorrhizae on P. contorta in the Sub Boreal Pine Spruce xeric cold (SBPSxc) biogeoclimatic subzone in the central interior of British Columbia is Suillus tomentosus. This thesis is the first study to identify a species of T E M fungus that forms tubercles on P. contorta. It is also the first study to combine D N A sequence analysis and morphological analysis to determine the species of fungus involved. The use of D N A sequencing in combination with morphological characterization provides increased confidence in the species identification. In contrast to previous studies on Pseudotsuga menzesii T E M (Li et al. 1992), N 2-fixing bacteria were found to reside within P. contorta T E M . The N2-frxing bacterial species identified were Paenibacillus amylolyticus and Methylobacterium mesophilicum. Bacteria within the genus Paenibacillus (formerly a group within the genus Bacillus) are well known for their ability to fix nitrogen, whereas, bacteria within the genus Methylobacterium are not commonly known for this ability. Nevertheless, recent findings by Sy et al. (2001) describe that a new species Methylobacterium, M. nodulans, is a N 2-fixing bacterium that nodulates and fixes nitrogen on the roots of the legume genus Crotalaria. The findings of Sy et al. (2000) support the result from this thesis, specifically, that some species of Methylobacterium are capable of fixing nitrogen. Additionally, the observed nitrogenase activity and presence of a nifH amplicon in both P. amylolyticus and M. mesophilicum further supports the hypothesis that these species 186 are capable of fixing nitrogen. This thesis is the first work to report that the bacterium Methylobacterium mesophilicum is capable of fixing nitrogen. The presence of N2-fixing bacteria within S. tomentosus tubercles lends support to the hypothesis that T E M are somewhat analogous to legume root nodules in gross form and function. The absence of bacterial species overlap between the interior tissue of T E M and the surface of T E M suggests that the interior of the tubercle may be different in microhabitat characteristics than the surface of tubercles, however, this was not tested in this thesis. The T E M recombination results showed that complete tubercle formation only occurred when the bacteria were added as a co-inoculant to P. contorta seedlings. It is very tempting to speculate that either P. amylolyticus or M. mesophilicum act in a fashion similar to that of Rhizobium sp., Bradyrhizobium sp. or other nodule-inhabiting N2-fixing bacteria, in that they are intimately involved in the initiation and formation of tubercles. Either P. amylolyticus orM. mesophilicum (or both) may be critical for the complete formation of the tubercle structure which, in turn, provides the necessary habitat for these species to be able to fix nitrogen. This study is the first to report a possible role for bacteria in the formation of T E M . The presence of haem protein similar to human haemoglobin (Hb), which I have called tuberculate ectomycohaemoglobin (Tb), within S. tomentosus tubercles suggests that there may be an intimate relationship between the N2-fixing bacteria within the tubercles and the tubercles. This may be similar in function to the relationship between Lb, Rhizobium and root nodules. It is widely accepted that the components of Lb in root nodules are formed partially by the N2-fixing bacteria within the nodules and partially by the host plant (Appleby 1974, Verma et al. 1979, Dickerson and Geis 1983). This is also the first description of a haem protein associated with a T E M and may be a very important discovery. The presence of Tb and the apparent influence of the N 2-fixing bacteria on the formation of tubercles are consistent with the apparent similarities noticed between root nodules and tubercles. 187 The presence of bacteria associated with the fungal hyphae surrounding the cortical cells of the ectomycorrhizal root tips (the Hartig net) of T E M is somewhat similar to the location of Rhizobium spp. in the inner tissue of root nodules on legumes. Even though the photographic data does not identify which species of bacteria are associated with the Hartig net, the visual evidence that bacteria are situated in this location may suggest that the bacteria, fungus and tree form an intimate symbiotic relationship. The potential nitrogenase activity from S. tomentosus T E M may be considered important to the nitrogen budget of P. contorta stands in the interior of British Columbia. Maximum extrapolated N2-fixation rates for S. tomentosus T E M on P. contorta roots within a hectare of soil suggest the potential N2-fixation rate from T E M could be significant portion of the N uptake of P. contorta stands per year in the SBPSxc. The potential average amounts of S. tomentosus T E M nitrogenase activity may also be considered important on a long-term basis because it has been calculated that the replacement of N removals, caused from disturbances such as stem only harvesting, by asymbiotic N2-fixation within CWD on P. contorta stands would take 180 years. This is considered to be a short recovery time frame and, therefore, significant in sustaining long term site productivity (Wei and Kimmins 1998). If we contrast the amounts of nitrogenase activity by asymbiotic N2- fixing bacteria in CWD to that of S. tomentosus T E M , the amounts from T E M are nearly 150 times greater, it is likely that the replacement time from T E M N2-fixation would be considerably shorter. If the biomass of T E M within P. contorta stands is much higher than what has been measured in CWD from this thesis, S. tomentosus T E M could contribute significantly to P. contorta nitrogen budgets both in the long and short term. Nitrogenase activity by S. tomentosus T E M appears to be more important in young P. contorta stands than old. This may be a result of a greater physiological demand by the young trees during their rapid growth phase which stimulate the bacteria and fungus, resulting in larger 188 numbers of T E M formation (Chapter 3) and possibly more "effective" nitrogenase activity from T E M (Chapter 5). I have used the analogy between S. tomentosus T E M and root nodules quite liberally in this discussion but there are some key differences that are unique to the tubercle structure that are important to keep in mind. The presence of two N2-fixing bacterial species within the tubercle structure is somewhat different from root nodules where multiple strains of the same species of N2-fixing bacteria are reported per plant host. This unusual feature may be reflective in the general structure of T E M . Bacteria were observed both surrounding the cortical cells of the mycorrhizal root tips and associated with the interstitial hyphae of the tubercle. It may be that one of the species of lS^-fixing bacteria is intimately involved with the mycorrhizal fungus and the host plant in forming T E M whereas, the other species takes advantage of the T E M structure and resides within the interstitial hyphae because it provides adequate environmental conditions for nitrogen fixation. A second key difference between T E M and root nodules is in the overall structure. T E M are formed by numerous ectomycorrhizal root tips branching profusely and surrounded by fungal hyphae that are continuous with the hyphae of the ectomycorrhizal root tips, all encapsulated by layers of fungal hyphae forming the outer peridium. Root nodules are formed within host root cells, which create the necessary low oxygen environment for nitrogen fixation. Due to the complexity of the T E M structure, with multiple interfaces between the different organisms, there may be several sites within the structure where there is a sufficiently low oxygen environment for nitrogen fixation to take place. This may be the reason we are able to see bacteria in different zones of the tubercle, as mentioned above. 189 7.2. FUTURE W O R K Future work that could be considered from the results of this thesis is to conduct a more extensive study to more carefully ascertain the occurrence and abundance of S. tomentosus T E M within above ground CWD, within below ground woody debris and on the rest of the host's root system. Further work needs to be done on determining the amount of N2 -fixation associated with T E M . A R A is a crude tool to quantify T E M nitrogenase activity, and use of an additional method in parallel with A R A is recommended. Use of 1 5 N dilution method in systems created in vitro may provide better more controlled conditions upon which quantification of nitrogenase activity could be measured. One such experiment may be to collect tubercle samples, removed from host roots, in gas tight vials and replace the head space gas with nitrogen gas that has a known high 1 5 N isotopic ratio (labelled 1 5 N gas). The samples could be incubated for a given time and then the tissue could be analyzed for 1 5 N content and compared to control samples. This may give more accurate quantified nitrogenase activity measurements for T E M . An alternative method would be to grow P. contorta seedlings with S. tomentosus and the appropriate bacteria in vitro. These systems could be incubated with either labeled 1 5 N gas as the ambient gaseous nitrogen source or a 1 5 N nutrient solution in the growth medium. In either case, tissue samples could be harvested and the 1 5 N / 1 4 N isotopic ratio could be determined and compared to control samples. Further physiological investigation needs to be done to show that the nitrogen is being fixed by P. amylolitcus andM. mesophiliucm in S. tomentosus T E M and is being transferred to the fungus and/or host plant. Other work than can be considered from this thesis is to determine the non-culturable bacterial populations associated with S. tomentosus T E M . Tissue samples from both the interior tissue and surface tissue of T E M could be sampled for bacterial 16s rDNA. These general samples of bacterial 16S rDNA, could then be separated by using Denaturing Gradient Gel Electrophoresis (DGGE)(Muyzer etal. 1993, Jackson and Churchill 1999). Once separated the 190 samples could be sequence analyzed to determine the identities of the bacterial species present. The data could then be compared to the known culturable identities to determine if there are any other species of bacteria that are contributing to the observed N2-fixation from S. tomentosus T E M . Additional work that could be undertaken is to sequence analyze the nifH amplicons that were detected from P. amylolyticus and M. mesophilicum. This needs to be done in order to positively identify these amplicons as the nifH gene. Obtaining these results would additionally verify that these bacteria are N 2-fixing bacteria. Further work could also be done on identifying the location of bacteria within the tubercle structure. This study did not identify the bacteria in the photographic data provided but this could be undertaken by doing similar analysis using more definitive techniques such as fluorescence in situ hybridization (FISH) using fluorescent oligonucleotide probes which target the 16S and 23S bacterial rRNA (Assmus et al. 1997, Mogge et al. 2000). These probes are designed to attach to the different types of bacterial groups and then allow detection of these bacteria by confocal laser scanning microscopy (Snaidr et al. 1997, Hartmann et al. 1998). Another method would be to use immunofluorescent antibody staining (Shishido et al. 1999). This technique develops antibodies specific to a bacterial species, which attach to the bacteria in situ, allowing for fluorescent photography. Some very important work needs to be done on furthering the identity of the haem protein discovered in association with S. tomentosus T E M . Currently, the N-terminal amino acid sequence analysis is being conducted to verify the identity of this protein. Future work could be to conduct physiological studies on the protein and determine how it originates, if the bacteria, fungus and host plant are involved in the formation of the protein, where the protein is located in the tubercle structure, does the protein function the same as leghaemoglobin in root nodules and 191 what properties does the protein have in relation to facilitating oxygen transport within the tubercle structure. Additional work could also be conducted on determining if the N2-fixing bacteria associated with S. tomentosus are involved in tubercle formation. If this is confirmed, then the mechanisms for such an interaction would need to be further researched. As well, it would be important to determine which bacterial species was responsible for the apparent influence on the formation of S. tomentosus T E M in this thesis. A similar experiment could be conducted using each bacterium as a single inoculum treatment type. Much more work needs to be done to have a more complete understanding of this type of ectomycorrhiza. This is indeed a unique form of ectomycorrhiza, and comparative research on the various species identified to date is essential for a better understanding of the importance of this type of mycorrhiza in forest ecosystems. 192 7.3. REFERENCES Appleby, C. A. 1974. Leghemoglobins. In: The Biology of Nitrogen Fixation. Ed. Quispel, A. Elsevier. New York. pp. 521-524. Assmus, B., Schloter, M . , Kirchhof, G., Hutzler, P. and Hartmann, A. 1997. Improved in situ tracking of rhizosphere bacteria using dual staining with fluorescence-labeled antibodies and rRNA-targeted oligonucleotides. Microbial Ecology 33,32-40. Dickerson, R.E. and Geis, I. 1983. Hemoglobin: structure, function, evolution and pathology. Benjamin-Cummings. Menlo Park, CA. pp. 75-82. Hartmann, A. , Lawrence, J.R., Assmus, B. and Schloter, M . 1998. Detection of microbes by laser scaning microscopy. In: Molecular Microbial Ecology Manual 4.1.10. Eds. Akkermans A.D.L. , van Elsas, J.D., and de Bruijns, F.J. Academic publishers. Dordrecht, pp. 1-34 Jackson, C R . and Churchill, P.F. 1999. Analysis of microbial communities by denaturing gradient gel electrophoresis: Applications and limitations. Recent Research and Development in Microbiology 3: 81-91. L i , C.Y. , Massicotte, H.B. and Moore, L .V . 1992. Nitrogen fixing Bacillus sp. associated with Douglas-fir tuberculate ectomycorrhiaze. Plant and Soil 140:35-40. Mogge, B., Loferer, C , Agerer, R., Hutzler, P. and Hartmann, A. 2000. Bacterial community strucutre and colonization patterns of Fagus sylvatica L. ectomycorrhizospheres as determined by fluorescence in situ hybridization and confocal laser scanning microscopy. Mycorrhiza 9: 271-278. Muyzer, G., De Waal, E . C , and Uitterlinden, A.G. 1993. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Applied and Environmental Microbiology 59: 695-700. Shishido, M . , Breuil, C. and Chanway, C P . 1999. Endophytic colonization of spruce by plant growth-promoting rhizobacteria. FEMS Microbiology Ecology 29: 191-196. Snaidr, J., Amann, R., Huber, I., Ludwig, W. and Schleifer, K. H. 1997. Phylogenetic analysis and in situ identification of bacteria in activated sludge. Applied and Environmental Micorbiology. 63:2884-2896. Sy, A. , Giraud, E., Jourand, P., Garcia, N . , Willems, A., DeLajudie, P., Prin, Y . , Neyra, M . , Gillis, M . , Boivin-Masson, C. and Dreyfus, B. 2001. Methylotrophic Methylobacterium Bacteria Nodulate and Fix Nitrogen in Symbiosis with Legumes. Journal of Bacteriology 183:214-220. Verma, D.P.S., Ball, S., Guerin, C. and Wanamaker, L. 1979. Leghemoglobin biosynthesis in soybean root nodules. Characterization of the nascent and released peptides and the relative rate of synthesis of the major leghemoglobins. Biochemistry 18: 476-483. Wei, X . and Kimmins, J. P. 1998. Asymbiotic nitrogen fixation in harvested and wildfire-killed lodgepole pine forests in the central interior of British Columbia. Forest Ecology and Management. 109: 343-353. 194 A P P E N D I X A 195 Table A - l : Sub-Boreal Pine Spruce Biogeoclimatic Zone (SBPS) percent vegetation cover, British Columbia, Canada. The two letter lower case designations refer to the sub-zones within the SBPS. Note vegetation description of sub-zone SBPSxc, which is the focus of this study SBPS Biogeoclimatic Vegetation Cover Biogeoclimatic Units: SBPS SBPS SBPS SBPS xc dc mc mk Scientific Name Oryzopsis pungens Stereocaulon spp. Solidago spalhulala Juniperus communis Carcx richardsonii Cladina spp. Cladonia spp. Pinus contorta Arctostaphylos uva-ursi Shepherdia canadensis Pleurozium schreberi Linnaea borealis Spiraea betulifolia Vaccinium caespitosum Calamagrostis rubescens Picea glauca Cornus canadensis Aster conspicuus Aster ciiiolatus Hylocomium splendens Ptilium crista-castrensis Lonicera involucrata Vaccinium membranaceum Pseudotsuga menziesii Amelanchier alnifolia Goodyera oblongifolia Lilium columbianum Rhytidiadelphus triquetrus Mean cover class ... . , « 1 • • • • • 1 Common Name short-awned ricegrass spike-like goldenrod common juniper Richardson's sedge lodgepole pine kinnikinnick soopolallie red-stemmed fcathermoss iwinflowcr birch-leaved spirea dwarf blueberry pinegrass white spruce bunchberry showy aster fringed aster step moss knight's plume black twinberry black huckleberry Douglas-fir saskatoon rattlesnake-plantain tiger lily electrified cat's-tail moss Legend: Mean percent cover - 2-5, 6-10,1 111 - 25, 99 Source: Steen and Demarchi, 1991. 196 A L E X I S C R E E K TAUTR I C R E E K (1219) 0.4 464.1 I 1 100 J F M A M J J A S O N D M O N T H Source: Steen and Demarchi, 1991. Figure A-l: Mean monthly temperature and precipitation for the Sub-Boreal Pine Spruce biogeoclimatic (SBPS) zone of British Columbia, Canada. 197 A P P E N D I X B 198 3' Query: 1 ttccgtaggtgaacctgcggaaggatcattaaagaaataatctcgagggccgatggaaag 60 Subjct: 1 ttccgtaggtgaacctgcsgaaggatcattaaagaaataatctcgagggccgatggaaag 60 Query: 61 gagagagggttgtagctggcgtaagcacgtgcacgccctctttctcgacctaggtcctta 120 Subjct: 61 gagagagggttgtagctggcgtaagcacgtgcacgccctctttctcgacctaggtcctta 120 Query: 121 tgggcgcggggcgacccgcgtcttcataagccccttcgtgtagaaagtcaatgaatgttt 180 Subjct: 121 tgggcgcggggcgacccgcgtcttcataagccccttcgtgtagaaagtcaatgaatgttt 180 Query: 181 tttaccatcatcgactcgcgacttctaggagacgcgattctttgagacaaaagttattac 240 Subjct: 181 tttaccatcatcgactcgcgacttctaggagacgcgattctttgagacaaaagttattac 240 Query: 241 aactttcagcaatggatctcttggctctcgcatcgatgaagaacgcagccgaatcgcgat 300 Subjct: 241 aactttcagcaatggatctcttggctctcgcatcgatgaagaacgcag-cgaatcgcgat 299 Query: 301 atgtaatgtgaattgcagatctacagtgaatcatcgaatctttgaacgcaccttgcgctt 360 Subjct: 300 atgtaatgtgaattgcagatctacagtgaatcatcgaatctttgaacgcaccttgcgctt 359 Query: 361 atcggtgttccgatgagcatgcctgtttgagcgtcattaaattctcaacccctctcgatt 420 Subjct: 360 atcggtgttccgatgagcatgcctgtttgagcgtcattaaattctcaacccctctcgatt 419 Query: 421 tgcttcgagagggtgcttggatagtggaggctgccggagacctgttttttcaggactcgg 480 Subjct: 420 tgcttcgagagggtgcttggatagtggaggctgccggagacctgttttttcaggactcgg 479 Query: 481 gctcctctgaaatgtattggcttgcgggtcgacttttcgactgtgcatgacaaggccttt 540 Subjct: 480 gctcctctgaaatgtattggcttgc-ggtcgac-tttcgactgtgcatgacaaggccttt 537 Query: 541 ggcgtgataatgatcgccgctcgccgaaagtgcacgaacgaatggtctcggtgcccctaa 600 Subjct: 538 ggcgtgataatgatcgccgctcgccg-aagtgcacgaacgaatggtctc-gtgcccctaa 595 Query: 601 tcagtcgatgtcttttcgaaggcgtcttccttattgacgtttgacctcaaatcaggtagg 660 Subjct: 596 tcagtcgatgtcttttcgaaggcgtcttccttattgacgtttgacctcaaatcaggtagg 655 Query: 661 actacccgctgaacttaa 678 Subjct: 656 actacccgctgaacttaa 673 5' Figure B-l: Sequence of internal transcribed spacer region of Pinus contorta tuberculate ectomycorrhiza compared to the ITS region of Suillus tomentosus sporocarp sample from NCBI database. Identities matched 672/678 (99%) with 5/678 gaps (0%). Differences are shown with a bold letter. Query - Pinus Contorta T E M this study, Subjct - Suillus tomentosus NCBI gi|1916682|gb|U74614.1|STU74614. 199 0.01 substitutions/site S. tomentosus Pc TEM S. variegatus Ps T E M S. bovinus S. granulatus S. brevipes S. luteus S. mediterraneansis S. umbonats S. spraguei R. roseolus R. vinicolor Figure B-2: Parsimony analysis using neighbour joining method to show phylogeny of of P. contorta T E M sequence data and other Suillus spp. Scale bar=0.01 substitutions/site. 200 Table B - l : Pinus contorta stand age class system based on tree age range in the SBPSxc biogeoclimatic sub-zone of British Columbia (BC Ministry of Forests,Williams Lake, BC). Tree Age Range (years) Stand Age Class 0-20 Class 1 20-40 Class 2 40-60 Class 3 60-80 Class 4 80-100 Class 5 100-120 Class 6 120-140 Class 7 140-160 Class 8 160-180 Class 9 201 A P P E N D I X C 202 Table C- l : Coarse woody debris decay class classification system used for characterising log section analysis Class Section Water Root Fungal Section incorporation into consistency content content content forest floor 0 Non-cohesive Saturated None None Above forest floor Mulch 80-100% 1 Fibrous Wet Less ^ o f Less yof On top of forest floor mulch 60%-80% area area 2 Pulpy fiber Moist y of area yz of area lA into forest floor 30-60% 3 Chunky, Damp Vi of area Vi of area y into forest floor med., large 15-30% 4 Powder, large Dry 3A of area 3/4 of area Vi into forest floor Hard pieces 10-15% 5 Hard, one Very Dry Greater Greater Greater than lA into forest piece 5% or less than 3A than 3/ 4 floor Table C-2: Significance results from Pearson correlation analysis of number of Suillus tomentosus tuberculate ectomycorrhiza and moisture content of coarse woody debris (CWD), texture of CWD, amount of Pinus contorta roots in CWD and amount CWD is incorporated into the forest floor Amount of Moisture Texture Amount of Amount of Amount of tubercles content roots fungi incorp.into forest floor Number of r 1 -0.271 ** -0.255 ** 0.502 ** 0.483 ** 0.332 ** tubercles sig. 0.000 0.000 0.000 0.000 0.000 n 697 696 697 697 697 697 Moisture r 1 0.576 ** -0.511 ** -0.512 ** -0.526 ** content sig. 0.000 0.000 0.000 0.000 n 696 696 696 696 696 Texture r sig. 1 -0.555 ** 0.000 -0.497 ** 0.000 -0.607 ** 0.000 n 697 697 697 697 Amount of r 1 0.809 ** 0.596 ** roots sig. n 697 0.000 697 0.000 697 Amount of r 1 0.555 ** fungi sig. n 697 0.000 697 Amount of r 1 incorp.into forest floor sig. n 697 Correlation is significant at the 0.01 level (2-tailed). 203 Soil analysis was conducted using the following methods: Soil pH: Saturated Paste Extract: pH This method determines the pH of soil, using a saturated paste prepared from the soil and a pH meter. It is most applicable to soils with a pH ranging from 4.0 to 9.0. It is not possible to determine the total acidity or alkalinity of the soil from pH because of the nature of the colloidal system and junction potential. This method does however provide information on the disassociated H-ions affecting the sensing electrode. The method is generally reproducible within 0.2 pH units (Richards 1954). Total Carbon, Nitrogen and Sulfur: Combustion gas analyzer method for total nitrogen and total carbon. This analytical method quantitatively determines the total amount of nitrogen and carbon in all forms in soil, botanical, and miscellaneous materials using a dynamic flash combustion system coupled with a gas chromatographic (GC) separation system and a thermal conductivity detection (TCD) system. The analytical method is based on the complete and instantaneous oxidation of the sample by "flash combustion" which converts all organic and inorganic substances into combustion gases (N2, NOx, C02, and H20). The method has a detection limit of 0.01% for carbon and 0.04% for nitrogen and is generally reproducible within 5% (Dumas 1981). Soil N 0 3 - N and N H 4 - N : Equilibrium extraction of soil for nitrate and ammonium with potassium chloride and subsequent determination by flow-injection analyzer. This method involves the quantitative extraction of nitrate (N03-N) from soils using an equilibrium extraction with 2.0 N KC1 solution. Nitrate is determined by reduction to nitrite via a copperized cadmium column. The nitrite is then determined by diazotizing with sulfanilamide followed by coupling withN-(l-naphthyl)ethlyenediaminie dihydrochloride. The absorbance of the product is measured at 520 nm. This method is also semi-quantitative for ammonium (NH4-N) in soils. Ammonia is heated with salicylate and hypochlorite in an alkaline phosphate buffer. The presence of EDTA prevents precipitation of calcium and magnesium and sodium nitroprusside is added to enhance sensitivity. The absorbance of the reaction product is measured at 630 nm and is directly proportional to the original ammonia concentration. Extracts can be stored for up to three weeks at low temperature (<40C). For long term storage, toluene or thymol should be added to the sample to prevent microbial growth. The method has detection limit of approximately 0.1 mg kg-1 (on a soil basis) and is generally reproducible within 7% (Wendt 1999). Available phosphorus: Bray-P, Extractable phosphate for acid soils (pH less than 7.0) using a dilute acid-fluoride extractant. This method estimates the relative bioavailability of inorganic ortho-phosphate (P04-P) in soils with acid to neutral pH, using a dilute acid solution of hydrochloric acid containing ammonium fluoride. The orthophosphate ion reacts with ammonium molybdate and antimony potassium tartrate under acidic conditions to form a complex. This complex is reduced with abscorbic acid to form a blue complex which absorbs light at 880 nm. The method is shown to be well correlated to crop response on neutral to acid soils. The absorbance is proportional to the concentration of orthophosphate in the sample. The method has a detection limit of approximately 0.1 mg kg-1 (soils basis) and is generally reproducible within 8% (Diamond 1995,Horneck et al. 1989). 204 Cation Exchange Capacity: Cation Exchange Capacity by barium acetate saturation and calcium replacement. The method determines the cation exchange capacity (CEC) of soil. The soil is quantitatively displaced of all exchangeable cations with Ba, followed by four deionized rinses to remove excess Ba. A known quantity of calcium is then exchanged for Ba and excess solution calcium is measured. CEC is determined by the difference in the quantity of the Ca added and the amount found in the resulting solution. The method has a detection limit of approximately 0.1 meq 100 g-1 (soil basis) and is generally reproducible within 8% (Janitzky 1986). 205 s o a) ca oo a. o aj 11 § O o a o o ca ca ° u o c ca O w 6 JS o 4) e 00 00 ca m "2 cS ca -= cn cn -o II 5 CN ca TT cn O .-s 2 o ca cS A "o II oo cn -*-» s cn cn3 cn i- ca .§ O a, ~ cn -o . O. C/J 2 ca o « .22 o cn ca ca ca O ca >. o ? 00 s 3 O II CN _ca CJ s ca o 'S 00 e . 2 3 3 ca ca in o> cn ca 3 O < S ca < 2 CQ I co : LU o O E o Q. — = E co oJ i si ro o H o o CM X X CL oo 5 o d o o o o o o c l d o o o o o o £ ° 2 <=> o o o d R o o d CN 00 d d o o o o o o o o o o o o i - 00 T 00 00 o o o o o o o d d o o o o o o d d o ^ o «o d o Q. Z d o ! S So S3 <=> co o o d o o o o o o d d o o o o o o d d o o o d T - in CN m oo d d o CD o oo o o o ^ o ™ d o T - O) 00 T J -d d d •<- o o o o o CD -j CD 00 o o o o d d o o o o o o d d o o o o o o d d b r--o oo o 0 5 d o O C D O i -o o d d T - m co r » T - oo d d o CD o co o o d d i ° 5 Id ° OO O) 00 T -o ^ d d o £ o ^ d ° b £ o 0 5 d o 5DS o d CN CN d 00 CD oo oo co LO 00 CO ro oo O tn co ro CN O o CN H O Ui CD CO "5 ai ^ to CO ^ CNI CO CO CNI o d d ci d (%) 0 |B*0± c cM5 Q CO CO m N ID (O U) IO IO ^ cd tri Hd LO co CM T - O CNI CNI CNI CNI CNI CN oo co CO ro O CM co co ro © O O) < .2 "O e to a o *; 3 ro tO g CO "* ro CQ CO CN 1- O O O O (%) N l e j o i < TJ C JS CO to « cl 3 " 32 "o CJ C O u oo to is u o •t V su s 3 O I! CN co B5 _2 o u" CQ 2 o o CJ J3 C ' o N CJ u .a eo * CS 3 U — ea p ;r-& a U M o o 5 .-6 a. c — OJ M CS o a — so & 53 o > CQ cs • § g u c J3 O .5 -a ca S -o 3 8 > X. ca O /— s 03 o v— cj CO CO +-» 3 e j- u n E 5 3 O co * g B s -a K co O. "55 <u — ca cS t-i 3 U O 3 .g •S g S JB ca o ca <o O c S X >, ? & II u .2 ta H CJ cs co cS JC ffl a . TO ° c 2 a a C3 13 !Z, o N co c ca 3 d> O H ^ II O .a CS A CO ' » « II CQ oo o CN cj 3 M • PM u. 00 CO co ro O Qi < TJ C JS oo 0) tf « CO C O N c D i n ^ t f O C M T - O (uidd) t ' H N USBOJJ IN o Ig c ro O CN (uidd) N |BJ3U!|/\| oo (/) C/) ro O Q co 0) OJ < TJ C JS CO — £ (/J o o o o o o o o N (O IO ^ O N r-(iudd) d 3|qe|;eAV 00 CO c/) ro O 0) < TJ C iS co "55 " * CO C Q CN C O ( O ^ I N O o o o o (uidd) C Q N UOBOJJIN cu < TJ C jS CO CO 1  oo CO CO jg u -o • t 5 .2 o 2 J D J 3 O * Q. to O sj * - 5 ° •Bl v £ § u M r» c g I  O CN N > CO .a rt +J —* c<3 Q O . 5 CD y *s co O f ) . . CL> l— CL> »•= -a .2 c 3 <u E u. > • — e-« z u u o E _ 3 O CQ C<H o real P E 3 Gran real P ' E Gran g Bo mo cu 3 CO 03 qn am '35 E me oo CD CD in the bo -3 nj ca s o ariabl CO CL) 03 =Alex > ;—s =Alex J 3 'cn w =Alex c_> 03 >> altic= CU -o 3 £ J C cu altic= CO a rem Bas ory a leasu b bo CU on leasu Q ca u e u X inus igen e sit ach a. nitre ak CU E nitre a o ,s- ral ' N in ro CU I € 3 3 O H c ps E I o •a lo <u bp +2 03 o >. 03 IT) l -cu c/> 03 B av CQ ye — , — , o So < I u CU u 3 E 00 o tN CQ CO in CO co O CM CO to (0 CD O o < 'E S o C JS o ite/S "53 ro co ro to CQ o Q ro m CO m i [ i i i LO CM LO t— LO C CM T- CD (uidd) ^os l e j o i (wdd) s | B ; O I (%) uoijBjnjBs e s e g CD U) < •a sz JS to s to CO Class Class CM in in to 0) O o Ui < E 2 c JS O O ite/S OJ ro CO ro CO CD o L^ Q ro co ro CD I 1 1 1 1 O 00 <D T CN C 3 (BWIOUJO) 0 3 0 2 15 E 3 CJ ca CO CO •43 00 • r ca CQ « 00 3 3 o >> II CN co CO ca b.« w cn . - CO -j 3 O IM o . t i CJ U 00 o 0 00 S .2 J •° x 3 3 B. -2 Vi ta u CJ 3 aj £ fco ° i ca g 3 _ CO 0 ca 1 E 7 3 O cd 1 'S ea co CO > CQ cj 3 OO 2 U c2 • - co cn 00 CO ea I S la <=o c co O ta x Z. <! II ca 5 >-ea tg cn M _ l b Q u 3 PQ fi" 0 £ I ea ^> J o Ti-S co K O u 18 a, £ is « r, cS 3 ea <" cn *-'cn CO 2P —- ca ca 1-3 « ea > —. ca 00 3 1 u cu c 3 5c i £ II 2 S3 ca "3 cn u ca - a 5 s ? ! CO O ea •S C ea >> I -C3 , . cn V O O CN A P P E N D I X D 210 Table D-l: Gas Chromatography Fatty Acid Methyl Ester analysis of bacteria isolated from interstitial tissue of T E M on Pinus contorta. The similarity index (SI) is a derivative of the number of standard deviations that the unknown differs from the MIR library profile. SI is not a probability. A match of 0.500 or higher with no second choice is considered to the subspecies level. A match of 0.200 or higher with no second choice is considered a match to the genus level only Isolate GC FAME Similarity Index Identification (SI) 11 Paenibacillus pabuli 0.665 12 Paenibacillus polymyxa 0.598 Paenibacillus pabuli 0.596 13 Micrococcus luteus 0.806 14 Methylobacterium extorquens 0.888 Methylobacterium mesophilicum 0.825 Table D-2: Gas Chromatography Fatty Acid Methyl Ester analysis of bacteria isolated from surface tissue of T E M on Pinus contorta. The similarity index (SI) is a derivative of the number of standard deviations that the unknown differs from the MIR library profile. SI is not a probability. A match of 0.500 or higher with no second choice is considered to the subspecies level. A match of 0.20.0 or higher with no second choice is considered a match to the genus level only Isolate GC FAME Similarity Index ^ Identification (SI) TI Actinomycete T2 Xanthomonas axonopodis 0.254 Xanthomonas sp. 0.201 T3 Pseudomonas putida 0.388 Pseudomonas chlororaphis 0.297 T4 Xanthobacter agilis 0.273 Xanthobacter spp. 0.0236 T5 Pseudomonas putida 0.536 Pseudomonas chlororaphis 0.489 T6 Pseudomonas putida 0.658 T7 Pseudomonas flourescens 0.598 T8 Pseudomonas putida 0.545 Pseudomonas flourescens 0.484 211 Isolate GC FAME Similarity Index Identification (SI) T9 Actinomycete T10 Sphingobacterium spp. 0.201 Sphingobacterium spiritivorum 0.164 T i l Actinomycete T12 Pseudomonas putida 0.358 T13 Burkholderia cepacia 0.230 Burkholderia glatheri 0.203 T14 Bacillus circulans 0.176 Bacillus halodenitrificans 0.128 T15 Pseudomonas chlororaphis 0.336 Pseudomonas syringae 0.312 T16 Curtobacterium spp. 0.129 T17 Pseudomonas putida 0.401 Pseudomonas chlororaphis 0.396 T18 Burkholderia cepacia 0.110 Burkholderia glathei 0.095 I 212 « S L cu tu 3 to +j g g'tf jJ co . H fi 3 - .3. co co cu - 3 | % bo s fl 3 o S u e CD cS H CU © T3 O | g a 5 &0 vJ (tf CD -c3 Cj "I -§ T 3 tf O OX) CD (tf tf g o tf j o a ^ 8 « CO |_ "2 fi § a .8 a 6 6 S3 ^ a 5 eg CJ C3 &fi (tf C tf csj CD J? § co co fi tu •2 a CD a t r — CD CD co 'tf CD 2 (tf C CD CD OX) O B J2 < >, iz tf 2 to 3 CO CD s CD o. to CO =3 CDcd JO '2 P H CD H C +H OJ o a • H co <D stf CD CD C+H 2 o tf CU H^ H o o J3 13 CT1 tf (H a CU VH 52) to 1 > CN CD CD V. 3 OX C-3 1 / 5 T 3 CD cd *-i a< & u ra co i_ ca % .2 =3 PQ 3 CD •g S » J H — i CO CD fi O •a S "cl, .5 ^ 4 ) o k, H 8 ° S C O O 5 1 T-l .SP 8 g S § ^ 2 | S CD o c o o cn CD CD fi <u fi CD CO <D a <u 60 o K .fi tb C a 2 o tS -o -g co is £ PQ CD £ A * CD PQ fi o -o CD CO CD CD CD CD 60 o .a o -fi CD " £ 3 fi CD <D fi 60 c O 60 .fi fi * o ^ -° £ 60 ra CD .2 fi .S -° CD "O ? 2 2 I 8 H3 co OH H O g i—l no -2 a CO CN OH CD 2 c cfi P. 00 CU i -9 WO APPENDIX E 216 ON ON T3 — 4a oo _ed 3 3 '5 o o. o « "2 'o c oo w o ON 2 o t. 00 D .2 E E Si P-ed - O R ed — - O t » 2. ^ N OS -S 2 3 & E oo B js OJ o <u 1 / 5 3 O cj - O 3 CJ •feS oo S § Co u E a 2 I 00 <u 00 C •5 t~r to ON 53 p .5 o ON M Qj oo ^ T3 00 C 3 ed 3 S ^ a t--R ON 8 2 a, fc 2 E o E y-s 3 W <" „ <u £ 5 ON jn 3 •c .2 Cu 4= M 'S ed C cd C cd bO oo ON ON 5 ON ed JJ i l O 3 00 00 o <u 2 "cd cd 1 00 CO cd -a b to ~ a oo R ON O ON CJ ~ a, g O B oo Cd ON ON CO — oo 9 u cd to a -g < •S E cd tu 2 ii -s § a o 3 T3 O CN D - fc W f-H 0) C+N c o - p it? s U Ml T3 (U 3 oo oo tu cd 3 tu 4 i E S cd R - H CJ 5 •3 R &N co § 1 ^ o O <" t-- '4= "3 ON oo " cd o o - ° •c * oo /—> _w O '5 i - ." co ON CJ ON . 3 5 O CJ c ed NN (50 g co C cd -4-* CO r-" a ON Q CJ J5 E u E a, 3 oO " 3 tu 3 CO / ^ c ^ 43 oo" to ON Cj ON t—N a tu R E y E „ • 3 a, to •P B 2 2 H - 2 co 7 O x TJ CJ CN X -§ c J I -42 O <u E p ^ V o bO > •a- CJ fN R O -° t! CJ to fd C — 'E 4§ 3? ON <J oo p J) » § M O oo g E « c cd bO cj JS ^-3 ^ -En 3 bO _ tu CJ -E "3 ^ ^ ^ S Q .2 ON N E O cd oo 00 _tu "o E c J2 ON cd oo o l-~ NO cn o CN o o o o in o o OO o ^ o r~ ON vd p CN o o o o o i—< ON m o CN cd d cn CN cn CN T-N CN o o NO O CN O O cd o CN 00 o ON O ON t-» o o o c— r— o 0\ o — o o ^ <d o o o cs m r - — oo m m CN 'd- — i — i NO m O o o o p p ci cd o c> cd cd ON o t-» cn o oo m m O —; O O T-H ^ H CN CN cd CN o V CJ ed "S C (U bO ed LN CJ > cd T3 3 cd ON i n NO o o ^ o o S O Cd m o NO o o T—i O C"| o o — O ^ H o o cd cd cd o o CN m -rf r- m NO m I O H Tf ( N J Tf ( f | ( f , o o o o o o o cd cd cd o cd o cd — o o CN r-~ o ON o m p p p o ON CN d CN d TH to tN o A cj cd CJ CJ . bo Wi cd cd ^ - CN cn "d- cn w 4-1 c/N S tu > cd 3 CN CO H ; i n « w 00 CN C U H S 8 LU 3 H -2 2 o <-r 00 > I w F - 9 1 CN - J CO OJ H co E _E "i r o £ oo > o ^ co <—> M <5 c i - o 2 o ^ E S c ^ CO 3 „ l i e E I j u S O 3 co S 5 f o cn S3 PQ E B ° 2 GO 03 CO > M CO CO CO -S -§ £ % C S Q co J 7A3?. cS OO u CO JO o j o 7A cS 00 o VO o Os o i n o cn CO © ^J- o i n CN © CN © r-» co CN © 00 CO o m o o o d o © d od vd m co •-H o o o VO © o o ON o CO o d d d d d CN vo CN m CO CN T-H CN i—i o o © o o © d d d d d d o r - o m o Os o c-» T-H o o o ON o d CN d CN CO O E cS J= cS O x CO CS CO > CS CO >—i C N ro T J - m c/0 CO s 8 rU 3 i F - c 1 oo > o I CO •—' U - 3 cfl C ° °, 3 B es o w § 00 > ^ CO CN co rt 3 co 3 > E 3 1 5 j a o D- CO co 3 co J . oo g g CO S cS 00 <u co -f= ...^ co b s Q j o J D- <N E C J cS co O0 J O O J O OH E cS OO 00 CN —4-ro 00 © 0O © i n 00 o C O r~ CN d CN CN CN ro ' — 1 Os , - , co _ C N vo m ^ § ~ o n °°. m f—: o f—; oo cN O r~ ' m ^ cn cn oo * 3 -CN vo co o vd o ^H cn d ^H t—* o vo 0 0 <= ^ e= r-d ° d ro 0 CN 0 - H CN CN r - o Os o o CN o m O co o CN o ov o cn ^—' o o o O o © o © o d d d d d d d d d d vo m i n CN oo CO CN 00 CN CN »—H CN m m CN CO CN vo m m © •—I © © © © © © ' — 1 o © © © © o © © © d © d d © © © © CN © i n © O OO i n vo © 00 ON © © 00 © ON © © Os ON © © © ON CN CN © H ^ J d CN © - H IH © V CO CS —I o OH • H N n VI * CO 00 cS t H CO > CS T3 3 cS OO co »H © A co cS —1 O a. • co co, oo o q cs cS 1- IH CO CO CS CS C N ro m rt oo oo a s o w H ' M fN O 00 JH o E 3 CU CN - ° 3 3 .3 S P H ia 7 O 00 > TT 0) M 3 V -in ed JH o 3 ~ 3 ,0 3 <+H 3 > E 1 fis? u g CJ a u m c gp o 2 E « c cd 00 <D ^ 3 ^ S3 Q " E a. 7 i E O oo JJ o JH Q. cd oo o rr o vo o 00 CN rr o CN p o ^ H O i n O m •St ro 00 rr o 27.8' ro o rr' rr p o rr' o i n rr J^ i n 00 o 27.8' O o f - o o *—< o CN O ^ H t-~ 00 r~ CN © 27.8' ON CN m CN r-- 1—1 ro CN ro 27.8' NO O CN <= rr' o »-< i l l CN o ON r o o o t— r*^  o ON o TH p p ^H © © ©' o ©' m TH oo ro ( N H H O O O p p O O O O O ON r- wo o oo © co ro © rr TH T-. 0 © T— T J CN CN O CN c/] >> o rr V csj *H a <U TH CN ro rr m oo o oo p _; p o o o ro 2 T2 § O TH O ON OO O vo O ro r -O T - o O O © © © © © CN NO CN rf m CN T H T -H cN T-H o o o o o ©'©'©'©'©' o t-» o o ON o p o p O CN O m rr r- TH ON O T-^ CN u >-> O rr V tu _*i ca —1 ' N •4-* 3 3 PH - H CN ro rr i n rf CN vo r-^  ^ vd TH co ro rT OO O O O VO o ~ CN CN C-~ O ON O TH OO O CN T H O O O O © ' © ' © ' © ' © ' NO rr ON i n i n rf CN TH TH CN f • ro O TH O O O O © ' © ' © ' © ' © ' © ' t-~ r- CN o rr i n VO rf o 00 0 ON O O ON CN TH' CN © ' H ' on u o rT V <u ^ , cd O OH ed )H CU > cd -o 3 cd CN ro rr m TO 00 2 8 IF - e cn CS E - © °, 0 +- ro E cS E 2 8 E-i -2 o > 13 S C3 OO o 00 -*r CJ X -° cn eg O cj _3 „ M 5 C 3 > E S o j E b a o CJ CJ O. CJ cn P CJ i .a 2? o oo 2 E cS 00 <u « - E - , 5 u- 00 _ CJ CJ -B - § ^ CS b B Q CJ hT-f CS oo o E E cS oo vd m i n uo CN CN CN O O o o d d : o ^ o o vo ON o o ro o vo o o — O ro O O — i o — o o d <z> d c> (Z> CN i n -*t ro m rH tN * o p p p o <6 <z> <zi <5 ci —i O TJ- O CN r-- O Os O ro p p o p os CN d CN d •—'< -H o CJ CS - J IS •—i CN ro m Os f~, 00 CN ro ^ o - : § n n m ~ o Q oo r - " i n ' ro i n oo i n Os — <-< O . o Os O O CN O ro •^ t- O Os O ro O O O O O <z> o o o <d OO ro CN 00 CN vo ro CN ro CN VO i j -p o — p p p o <z> ci <z> <zi ci in o f- o oo Os O O O Os •? d N d rn >H o ^3-CJ __ cS - 1 o a. -CN ro m « 00 © CN CN cn ed J J o o f S 8 rjj 3 L F -hr o 60 > NJ- CO cs 2 § w = H -2 v o s o > rr <L) CN -O «-. O ^ -3 > E u § O Q, O oo § M O ca t— CJ > CD 60 cj t> -En 5 s- 60 _ CJ CJ -E -3 £ 8 ^ C c Q JJ J a. CN E O cd 00 00 CJ J J " D . cd o o NO ON NO OO o 00 •—1 oq NO o p © CN rr' © ro 00 OO NHj- ro C^ rT 1 1 o CN ' 1 ' 1 CO rT CN rT ^ H CO in CO O m ro co in o CN cn r—s r~ © ^ J On m OO o © ' N O N O rT CN ro rT r--rr NO 00 © OO rr in r- in r-H l> CN r~ ON NO NO r~ oo rT OO rT rT ON —i O O0 0O OO OO ON NO 00 00 T H CN T H in ro © CN © d « 9 ro CN O rT TH t-- m ro 00 o © OO OO in © r~- © H On m N O O N r f t-- N O © ro rT © rT N O CN CN T H CN CN © © © © ' © © © © © © © © ro rT CN © ro 00 ON CN m 00 r-H CN r—< © ro rT CN CN rT ro r-H NO ro ro ro © © © © © © © © © © © © © © © © © © © © ' © © © © © ' © © © r- in CO oo © © 00 00 in r-H rT m ro ON © ro 00 ^ H © ro ro ro ON rr m CN CN © CN CN ON CN CN T J CN oi CN CN CN CN CN T H © rr V (U ^4 . cd 3 3 CU CJ 60 cd - N CJ > cd •O 3 cd CO © rr A CJ r ^ cd CN ro rr in TO 43 o o ~" N+H 3 3 CU OJ cj 60 eq cd cd - H U OJ cj > > cd cd -O OJ c .t. CN ro rr m no « 00 O0 * 8 rrl 3 60 > -5 NT cj CN ffi-S 3 IN 3 . - N U - 3 71 S C CJ J£ O o r w E-1 CJ E 3 CO • o 60 > © — CJ '—1 fN C J CO cd E co SJ -5 > . 3 o 3 _2 o E E 00 CJ J J TO 2P O o o 2 E « 3 cd J J CD L N CJ r Q 60 oj - 3 CJ -g ^ cd cj Q E J J Q. fN E C J cd CO o o J J " o 3  C cd PQ Q O J J "o. cd OO CN Q. r-~ T H m oq ro in ro © r^ ; T H ' • co OO ^ ON rr g CN in g? © oo S NO CN T H CN T H 2 P ^ CO 00 CN 00 CO CN r- ro T H o in CN CN rr T H © ' © ' © ' © ' © ' m © in T H CN m © © © © © © © ' © © © © ' © ' © cd a X cj oo ro r- ro oo On m © O N r~-CN © © T H oq CN CN CN CN T ^ 60 cd u CD CJ CN ro rT m OO CN CN B os u O w s H -E 7 O 60 > TT CO tN PC - § B cn i 3 c J i o 2 S c2 rr o j= 60 > o Tf CO — PC -§ E cn rt E o f ^ E CO ^ § "E 3 > 5 •S o J £ -b PC ^ t- ^ CL, O cn fi 0) ii rt SP O OO rt g » E rt 60 a, "~" - O 3 Q ' - 2 a? a. « E O rt cn OO J D O J D a, rt 00 IT) m i n ,—i O 00 m m r--rH o vq CN o p cn as r-» vo o Ov Os p i n p CN OS i n r~ so o *f i n d CN d as t-- r-» CN o d m so •—1 m ON CN CN VO rn '—' CN CN C O • * i n vo 0\ ON VO r- O i n i--" P m o o cn O CN r— O o CN CN o cn o •—• CN o d ci ci d ci i - - i n r-~ o oo i n CN CN ^ CN i n r - O O O O O d d d d d d rn CN CN r~ cn vo o •D- •>3> m CN Os p r-1 rn CN rH* CN CN r J >s o V CO rn cN ro •rf' cn hJ o OH co 60 rt L H a> > rt •o E C3 -r* 00 C O vo cn vo co CN cn CN rn i n •3-•sr r^ o o oo i n o- o O os rn i n as co I-- CN rn rn p d d d d d vo m oo m CN CN CN o CN oo vo oo m as CN O O CN O rn o d d d d d d d oo m r-- o r--rn m f» rH rH r~ rn p rn i n CN CN CN CN rn' cn o •* CD CD 00 00 A rt rt u u. CD a> CD ^4 > > rt rt rt —1 T3 CD O E +-» OH rH E CN cn -3- m rt oo oo Z CN CN CN "O B CS •r* <Z3 OX, 3 O o i i o CO CN 5 | 60 > o -T 0) rH rf-§.s ° 75 £ i i o o ' co 3 > E 1 S t ? OH O CO £ w i i rt gP o o o 2 E CD C rt 60 «u i i u, 60 _ CD CD -B •§ £ « C a Q CD -3" E rt 00 JD O JD Q, E rt 00 r - vo rH (JO d CN oo oo r - O —• CN oo vo o o o m r--•rj- vo ^ . oo o r - oo ^ i o - h • N h ov vo r - oo TJ- oo r - m cn oo o o rn ov m m ia- o vo d d d d d cn *t r~- CN o CN rn o ro -d-p o p p p d d d d d in m oo o rH rj- l /^ r»~J OV r n cn CJ\ i n CN CN rn' fN CN CN Ov C~- rH 00 rn in d p t> rH oo oo CV Ov in o 00 CN rH CN Ov o -a-in CN m oo CN oo m CN r - m rn o in CN CN ^ '—* d d d d d in rH cs m o rn CN O O O O O d d d d d oo m r— m oo ov m o o \ r--CN O O rH oq CN CN CN CN rH co >> O •<cj-V CD , rt fi 3 PH CN m TJ- in CO lH O E , rt ' rt I T o x CD CN tn 4 m m o in m o vo CN o o ,A r-: o in r— CN r -cn ov oo i n vo Ov OV O VO rH O ° i n V 9 m o o rH m o CN t— o •5f O CN CN O m O rH CN p d d d d d r-- m r - r - oo ov in CN CN rn cN CN rH P O O O O d d d d d d m rs tN i— m vo o m CN Os p rn m CN rn' CN CN rH* >s o V CD rt —1 O Q. E oq c? 1 H CD rn cN cn TJ- in rt 00 m C N ( N "9 a a -*-» a. •o O 2 g w = v o i DO > ^ * IB rs Cfl $ £ » o ° o ^ n v o i OO > o TJ- cu T-H ffi -S c o | : s | i CD _3 _ 3 > E •S o j -E i ^ o g O Q. O co E v M 3 M o w 2 E cu S % 60 cu JH ~ - § " 60 _ cu cu -E . - 3 ^ cu " C? E a J - K ? a. ™ E O e3 co 00 _<D O E a. E csj 00 ro rr T-H fN T-J-ro wo ro . t~~ O ON IT! 00 g NO rr CN o ro ON T-H O WO ro oo oo os o CN o od ON NO CO od °. oo oo TH ro cN O (N - H Tf H o oo oo wo o NO ON rr r- NO o CN CN T— CN CN O O © © © © © r- oo o rs io CN rT CO H NO CO O O O o o o © © © © © ' © o oo oo r-- wo r~ O CO 00 HH o CO CN CN O CN CN ON CN CN CN CN CN T-H co In >N o rT A* CD J3 —i CN CO rr wo NO O oo wo wo co ON F~- NO O ON WO t"*- NO . ON r- r- CN o o wo CN NO T-H r-H CO 00 NO CO NO NO HJ TH 00 TH CN CO rT CN rT rT rT o o oo wo r- o o ON r-H C/0 QN o r- CN TH co o ©'©'©©'© NO CO oo ro CN TH O CN OO NO OO 00 CN O O CN O O © © © © O ©' oo wo r- © r»-_ C~- r-H r-H r~- TH © ro wo CN CN CN CN TJ >H o rf CD ^4 ca —1 o D. . ca1 VH CD > ca T3 c ca CN ro rr wo W 00rj-CN CN •J5 ro g e° s <+-S 8 W 5 v o i 60 > o ffi-S s ° - e oi * C c ,o 3 i PQ 5 CD E | H — £ T o i 60 > T ? TT 1) CN ffi •§ c CJ - —' co cd 2 JH o (U cd — 3 > 2 •2 o j E i ^ o O GO CU oo 2 2 CD r-> cd 60 OJ JH l- 60 _ CD CD c-C "§ £ * H V. u Q J . IT? 2 O cd CO OO J D "o 2 JH cd OO ro oo <N od ro O VO O vo wo CN ro vd ON t--r-vd ON vo wo in CN VO o ON ' — 1 00 rf p o oq rf CN WO o ro ro rf CO wo o r—c ro 00 CN vo rf WO 00 rf WO ro 00 ro vq o rf CN C-H vd WO od o WO ON r-N r- rf rf o oo ro WO CN o ro ro o o ON rf oo ON 00 o 2 ON O rf rf O CN wo p rf O O O 00 ON CN C-H O —• — — CN O o o o* o o CN r-» CN 00 ro CN vo Os r-- rf H H CN wo ro CN C—1 ro ro ro ro t——1 ro CN ro ro p o o o O O p p o o O O O o o o o O O O O o O o © © ro wo rf CN r-OO ro CN wo ro ON 00 ON ro wo wo ro wo ON O ro ON NO CN ON CN rf CN H J CN CN CN CN CN —' NO o rf V cu ^ . cd s 3 CD 60 cd LN CD -o s ed CN ro rf wo .ed 00 co CH NO O rf A CD • cd —I 3 3 PH CD CD , 60 60 cd cd LN LN CD CU > > ed ed -O CD s .ti CN co rf wo .ed OO 00 •"5 CD , S 2 H - 2 fo 1-7 o i 60 > T ? Ni- CD CN 3 0 +H ro E c2 3 «*-< H 'eo CS co CS tu 2 J2 CO > o CD i o" " I c/-> cd E - o S3 0 ~ ro S c2 3 _. JH o CJ Cu CD co 3 CD JH 5 gf o 2 2 CD g ed O0 60 CD JJ ^ " 3 LN 60 —-CD <D - C "3 £ % H >, U C g Q JJ a? a. <N 2 CJ cd CO 00 J D O 2 JJ "H. 2 ed 00 —« O oo o o o O WO 00 ~" 1 — 1 CN ON NO wo o o o ON o o rf NO ro o © ON ro wo oo rf wo rf CN O CN WO oo O o o ro O o rf ro CN © © © ro © t O CO oo wo c--* —N CN CN rf CN CN o o o o o p © © ' © © © © CN rf ON WO NO ro OO ON CN OO vq ro vo —' CN CN wo CN o ? 2 ^ cd ^ -3 cd LN o x CD CD , gPl cd LN CD > ed CD CN ro rf WO OO WO CN CN e c3 o S 8 rrj SS r- CD C N co rt C 2 p rn c T O Js 6 0 > o CO — r_0 £ - o 2. 0 +- m £ c2 CO 1 e r f jo § (J Cu CO co P CO __ § M O oo 2 E CO P > c C3 60 <u "En 2 u, 60 — CO CO - E •§ ^ rt C J 3 ^ g Q a N E <-> CS CO 00 JO O CL, E rt 00 r f O r n m o vo m o\ \0 d O r f r f O VO m r- m ~ vo oo m Ov CN OO i n m rn m o r - vo o r -o rn vd o Os d oo r f o d C N m o m cn r r o r- r r o d r f d o m vo r r r f d r f C N m • — 1 °v o <1 O r f C N vo m o o C N m r f r f r f O O O VO i n Ov O VO C-» O Ov O vo r— cn p p <z> <z> ci <=> ci r f o i n r - O m O rH —< o o o C N rH p ci <d <z> d <=> vo o ,-H r f o CN OO CN Ov m i n ,-H r f CN CN CN m m r f m m oo m r f O O p p o o O p p o o o O d d d d d d d d d d d d d oo r f m r - CN CN r f m i n r f T-H m vo m r f Ov Ov r - m vq '—1 CN p Ov Ov Os rH o ov CN CN CN CN r^ rH r- CN CN rH o >s o r f V CO _H rt -) o Q, H C N m r f m rt CO r f CO CO 00 60 60 rt A rt rt IH u, CO CO CO CO > -> > rt 03 rt rt -o - J - O CO C O c +H rt a. — C N m r f m rt oo oo E 00 vo CN CN 00 > o irf-S.s cn is C -2 O £. 0 +- ro co *o e es s o S 8 60 > 4f CO CN ° 7 3 E H i co E 3 _3 _ rt _ > E S o CO 2 rf o CJ O CO co <_ 2 E « c CO 60 d, _ . ^ 3 « "En 2 l- 60 _ -3 ^ « H >, u c? E Q E •s rf CL IN E O cd CO oo « o E JD Q. E rt 00 o o o - ; CN o o o P r - vo i n r -o m CN o o Ov vo P Ov rf vd Ov ro i n rf m ro i n oo o CN i n O O ro O rf ro © © © O O CN c o ro co i n •—' CN CN rf CN o o p p © © d d d © CN i n oo rf VO Ov Ov ro CN —H CN CN 5§ £ d <N O rf V rt J 3 rt o x CD CN ro rf m m oo P ov CN QQ* . O O ro- S ^ P i n VO O vo i n ' CN CN Ov S O vo ro P vo ro rf O !C! ro vd Ov g ro —' ro — vo oo ro p d rf o m oo rf m ro © m ro o ro vq o rf rf O r—i rf © d vd [ ' m 00 © i n d rf d ,_• © rf r- rf rf d oo ro VO rf rf © CN CN O ro rf CN ro 1—1 Ov ST Ov © rf r - S rf © CN rf °°. i n © rf © d d d CN CN 0© ro in rn CN • - rn © © © © © © © © © © CN 00 ro i n rf ^. rf ro oo CN ro Ov i n Ov ro CN Ji, CN CN © rf V CD rt —1 c 3 0-•—i CN CO rf m © vo i n Ov © vo r- © Ov © vo <—i ro © © © d d d © vo © r- —i rf © rf cN CN CN ro ro © © © © © © d © © © © © 00 rf rn r~ CN •—> m vo i n rf vq r-< CN © ov CN CN CN CN -H' © rf V CD rt -J O OH — CN m rf i n rt OO C N C N CO •a a ct oo o 2 g UJ e H 2 T O 00 > cu CN ^ eg JH o ° t! E ,S ^ 8 [jJ s P -2 T O bO > rr CD X -° ™ 5 o r to <s JH o o + -E «§ c <+-CD J 3 . 3 1 •S o E -b JH o o. o CD CD 5 M o ID g CD 60 CD X) » J CD - ~ cd Q ' E JH E O cd to OO J D O E s cd 00 in CN VD o — OO rj- o o r f rs t n V 9 cn n io o cn oo CN vo ro oo CN —' Os —-ro cn *-H ro Ov cn ro' © © T-H Os T-H ov © 00 OS CN TH o HH T-H H^ CN © © ' © © ' © © VO Os t rf cn cn —. en CN © © © © o © ' © © ' © ' © ' in ro m ro vo in C-- Os Os CN H- HH O HH OS CN CN CN CN T-H © rf CD ^ _ cd HJ t i H CN ro d- cn C 3 CH cn cn T-H 2; © c— vo © oo 2 o cn vd <=> -J © oo © © o cn «H. RT CN Os CN rt-' CN vo in © CN © © © rr © m t-- © CO © H HH O © © CN — © © © © © © CN oo CN Os m co rf co ro oo rr © p © © © © © ' © ' © ' © ' © ' © CN rT ro in rT Os Os C • co Os Ov HH o Os HH' HH' CN CN HJ CO H. >o © rf A* CD Ti-ed —1 O D. H CN ro rf in TO 00 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0090671/manifest

Comment

Related Items