UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Ozone-induced signal transduction in tobacco Samuel, Marcus Abraham 2002

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2002-750752.pdf [ 13.34MB ]
Metadata
JSON: 831-1.0090657.json
JSON-LD: 831-1.0090657-ld.json
RDF/XML (Pretty): 831-1.0090657-rdf.xml
RDF/JSON: 831-1.0090657-rdf.json
Turtle: 831-1.0090657-turtle.txt
N-Triples: 831-1.0090657-rdf-ntriples.txt
Original Record: 831-1.0090657-source.json
Full Text
831-1.0090657-fulltext.txt
Citation
831-1.0090657.ris

Full Text

OZONE-INDUCED SIGNAL TRANSDUCTION IN TOBACCO by Marcus Abraham Samuel B . S c , Tamil Nadu Agricultural University, India, 1993 M . S c , Tamil Nadu Agricultural University, India, 1996 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE D E G R E E OF DOCTOR OF PHILOSOPHY in THE FACULTY OF G R A D U A T E STUDIES (Faculty of Agricultural Sciences) Department of Plant Science We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA July 2002 © Marcus Abraham Samuel, 2002 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of PJ-A-KfT g c l S r v o B - > The University of British Columbia Vancouver, Canada Date S£-P 3>&s DE-6 (2/88) ABSTRACT A wide array of environmental signals are sensed and processed by the plant cell, resulting in specific responses that reflect the nature, intensity and duration of the input signal. One common response to many of these biotic and abiotic insults is the rapid production of "reactive oxygen species" (ROS) by the plant cells. The level of ROS accumulation can influence the cell's protective or cell death mechanisms, leading to survival or death. However, knowledge about how ROS mediate these multiple effects is still fragmentary. To dissect this complex pattern of ROS-induced responses it is experimentally advantageous to use a stressor that can generate ROS in plants on demand. One such stressor is ozone. The similarity between ozone and pathogen-induced responses, including induction of an ROS burst and cell death, makes ozone an efficient tool in probing ROS-induced signalling pathways. Since little is known about how ozone-induced redox imbalances are sensed and transmitted within the plant cell, the general objective of this study was to investigate the potential role of MAPK modules, a major eukaryotic signalling mechanism, in ozone-induced stress signalling pathways. Brief exposure to ozone leads within minutes to activation of a -46 kD ERK-type MAP kinase in tobacco. This activation process is calcium-dependent and can be blocked both by free radical quenchers and by a specific inhibitor of MEK-1 (MAPKK). Hydrogen peroxide and superoxide anion radical can substitute for ozone as the activation stimulus, and the activation process does not appear to require salicylate as an intermediary. The properties of the ozone-induced MAPK indicate that it may be SIPK (salicylate-induced protein kinase), a tobacco i i MAPK that is activated by a variety of stress treatments. The ability of ozone to activate SIPK indicates that this protein kinase acts as a very early transducer of redox stress signals in plant cells. Through gain-of-function and loss-of-function approaches using transgenic technology I observed that both elevation and suppression of SIPK render the plant sensitive to R O S stress. However, transgenic lines over-expressing a non-phosphorylatable version of SIPK were not ROS-sensitive. Analysis of the MAP kinase activation profiles in ROS-stressed transgenic and wild type plants revealed a striking interplay between SIPK and another MAPK (Wound-Induced Protein Kinase; WIPK) in the different kinotypes. During continuous ozone exposure, abnormally prolonged activation of SIPK is seen in the SIPK-overexpression genotype, without WIPK activation, while strong and stable activation of WIPK was observed in the SIPK-suppressed lines, with concomitant accumulation of hydrogen peroxide and altered gene-induction responses. One role of activated SIPK in tobacco cells upon ROS-stimulation thus appears to be control of the inactivation of WIPK. Attempts to directly identify putative substrates for SIPK through solid-phase phosphorylation screening were unsuccessful. To my knowledge, the data presented in this thesis provide the first substantial evidence for a role of MAPKs in ozone-induced stress response and cell death pathways. The ozone-induced interplay between activated forms of SIPK and WIPK in the SIPK transgenics is the first evidence that alteration of the activity of a particular plant M A P K can lead to changes in intensity and timing of activation of another MAPK. TABLE OF CONTENTS ABSTRACT ii LIST OF TABLES AND FIGURES vii ABBREVIATIONS ix ACKNOWLEDGEMENTS xi CHAPTER 1. General Introduction 1.1 Crop Loss Due to Increased Tropospheric Ozone Pollution 1 1.2 Ozone-induced Oxidative Stress in Plant Tissues 2 1.3 Ozone as a Mimic of Pathogen-induced Cell Death 3 1.4 Oxidative Stress in Prokaryotic and Eukaryotic Organisms 1.4.1 Reactive oxygen species 6 1.4.2 Prokaryotic and eukaryotic responses to oxidative stress 8 1.5 Oxidative Burst and Signal Transduction in the Hypersensitive Response in Plants 1.5.1 Oxidative burst in plants 10 1.5.2 Oxidative burst and the hypersensitive response (HR) 12 1.5.2.1 Cross-linking of cell wall proteins 13 1.5.2.2 ROS-induced gene regulation 14 1.5.2.3 ROS and hypersensitive cell death 14 1.5.2.4 Other signal molecules in HR 16 1.6 Mitogen-activated Protein Kinases and Phosphorylation in Plant Signal Transduction 1.6.1 Mitogen-activated protein kinases 21 1.6.2 MAPKs in plants 23 1.6.3 Phosphorylation and transcriptional activation 30 1.7 Problem Statements and Thesis Objectives 35 CHAPTER 2. Ozone Treatment Rapidly Activates MAPK Signalling in Plants 2.1 Introduction 39 2.2 Materials and Methods 2.2.1 Plant growth conditions 41 2.2.2 Ozone exposure of whole plants 42 2.2.3 Ozone exposure of suspension-cultured cells of tobacco 42 2.2.4 Cell viability experiments 43 2.2.5 Protein extraction and immunoblotting 43 2.2.6 In-gel kinase assay 44 2.2.7 Immuno-precipitation and in-gel kinase assays 45 iv 2.2.8 Culture treatments 45 2.3 Results 2.3.1 Ozone rapidly activates a MAPK in tobacco leaves 46 2.3.2 Ozone induces cell death and activates MAPK in cultured cells 48 2.3.3 The p46 MAPK is activated by exposure to H 2 0 2 and 0 2~ 52 2.3.4 Activation of the p46 MAPK by ROS involves MEK and C a 2 + 53 2.3.5 p46 MAPK can be activated by inhibition of S/T phosphatase activity 54 2.3.6 ROS activation of p46 MAPK is independent of salicylate metabolism 55 2.4 Discussion 57 CHAPTER 3. Solid-phase Phosphorylation Screening for Identification of Substrates for SIPK 3.1 Introduction 66 3.2 Materials and Methods 3.2.1. Cloning of SIPK 68 3.2.1.1 RNA extraction 68 3.2.1.2 RT-PCR 68 3.2.1.3 Cloning of SIPK in pGEX 4T-3 69 3.2.2 Activation loop mutants of SIPK 70 3.2.3 Purification of recombinant fusion proteins 71 3.2.4 In vitro kinase assays 72 3.2.5 Autophosphorylation of GST-SIPK 73 3.2.6 Tobacco cDNA library screening through solid phase phosphorylation 73 3.3 Results 3.3.1 Recombinant GST-SIPK proteins are altered in their kinase activity 75 3.3.2 GST-SIPK is able to perform solid phase phosphorylation 77 3.3.3 Solid-phase phosphorylation with cDNA expression library from tobacco .. 78 3.4 Discussion 80 CHAPTER 4. Both Over-expression and Suppression of Salicylate-induced Protein Kinase (SIPK) Render Tobacco Plants Ozone-sensitive 4.1 Introduction 86 4.2 Materials and Methods 4.2.1 Plant material and treatment 88 4.2.2 Site directed mutagenesis and recombinant protein production 89 4.2.3 Rl (intron spliced hairpin loop RNA)-SIPK construct 90 4.2.4 Binary vector construction and plant transformation 92 v 4.2.5 Genomic DNA extraction and PCR analysis of putative transformants 94 4.2.6 Transient transformation using Agroinfiltration 96 4.2.7 Northern blotting and RT-PCR analysis 96 4.2.8 Protein extraction and Western blotting 98 4.2.9 In vitro kinase assays 98 4.2.10 Ion-leakage assay 98 4.2.11 In situ staining for H 2 0 2 99 4.3 Results 4.3.1 Transient over-expression of SIPK leads to cell death 99 4.3.2 Stable over-expression and suppression of SIPK render tobacco plants 101 ozone-sensitive 4.3.3 Alteration of SIPK expression levels leads to increased ROS accumulation in tobacco plants after ozone-exposure 106 4.3.4 Activation of SIPK is essential for ozone-induced cell death in SIPK over-expressing lines 108 4.3.5 SIPK suppression leads to strong activation of WIPK 110 4.3.6 SIPK and WIPK activation is prolonged upon continuous ozone-exposure in OX and Rl lines respectively 112 4.3.7 Induction of antioxidant and defense genes is altered in the OX and Rl lines 114 4.4 Discussion 116 CHAPTER 5. General Discussion 5.1 Ozone and MAPK in Plants 125 5.2 MAPK in Ozone-induced Oxidative Burst and Antioxidant Gene Induction 126 5.3 SIPK and Other Signalling Metabolites in Ozone-induced Stress 128 5.4 WIPK/SIPK Interplay and the Role of Phosphatases 129 BIBLIOGRAPHY 133 APPENDICES 161 v i LIST OF TABLES AND FIGURES Chapter 1 Figure 1.1 Diagrammatic presentation of the convergence of multiple stress 28 pathways into the MAPK cascade in plants Table 1.1 Summary of plant MAPKs activated by various elicitors 38 Chapter 2 Figure 2.1 MBP phosphorylating activity is induced by ozone exposure 47 Figure 2.2 An ERK homologue is activated by ozone exposure 47 Figure 2.3 Ozone-induced cell death in suspension-cultured cells of tobacco 50 Figure 2.4 p46 MAPK is activated by ozone in suspension-cultured cells 50 Figure 2.5 p46 MAPK is related to SIPK 51 Figure 2.6 p46 MAPK is activated by treatment with hydrogen peroxide or with a superoxide-generating system, and the activation is compromised in the presence of ROS scavengers 52 Figure 2.7 Activation of p46 MAPK is dependent on upstream MAPKK, calcium influx and protein phosphatases 54 Figure 2.8 ROS activation of p46 MAPK is independent of salicylate Metabolism 56 Chapter 3 Figure 3.1 Recombinant GST-SIPK fusion proteins 76 Figure 3.2 GST-SIPK activation loop mutants are affected in their catalytic Efficiency 76 Figure 3.3 GST-SIPK is less effective in phosphorylating immobilized Substrate 77 Figure 3.4 Solid phase phosphorylation of tobacco cDNA expression library by GST-SIPK 78 Figure 3.5 Screen for identifying SIPK substrates in total protein extracts 80 Table 3.1 Activation loop mutants of SIPK 70 Table 3.2 Mutational primers used for SIPK mutation 71 Chapter 4 Figure 4.1 PTGS-induced suppression of the cell death triggered by transient overexpression of SIPK 100 Figure 4.2 Transgenic tobacco plants overexpressing SIPK-FLAG show increased ozone sensitivity 102 Figure 4.3 SIPK-suppressed lines are also sensitive to ozone 103 Figure 4.4 Quantitation of ozone-induced cell death and hydrogen peroxide accumulation in SIPK kinotypes 105 Figure 4.5 GST-SIPK catalytic domain (K89R) mutants are inactive 107 Figure 4.6 SIPK activation is essential for transient expression-induced cell death.... 109 v i i Figure 4.7 Differential ozone-induced activation of SIPK and WIPK in SIPK-kinotypes 111 Figure 4.8 Loss of SIPK leads to hyper and prolonged activation of WIPK 113 Figure 4.9 Alteration of SIPK signalling affects gene expression 115 Figure 4.10 Schematic diagram describing construction of the SIPK-RI construct 91 Figure 4.11 Schematic diagram of binary vector constructs used for plant transformation 92 Figure 4.12 Proposed model for inactivation of WIPK by active SIPK 124 Table 4.1 Primers used for SIPK mutation and RNAi construct design 90 Table 4.2 Primers used for screening putative positives 95 Table 4.3 Primers used for RT-PCR on SIPK genotypes 97 Chapter 5 Figure 5.1 Diagrammatic presentation of the hypothetical model for mode and kinetics of SIPK and WIPK activation in wild type and SIPK-transgenics 132 viii ABBREVIATIONS APX ascorbate peroxidase bp base pair BSA bovine serum albumin CaMV cauliflower mosaic virus dATP deoxyadenosine triphosphate dCTP deoxycytidine triphosphate ddH20 double distilled water DAB diamino benzidine DEPC diethyl pyrocarbonate dGTP deoxyguanosine triphosphate DNA deoxyribonucleic acid dNTPs deoxynucleotide triphosphate DTT dithiothreitol dTTP deoxythymidine triphosphate EDTA ethylenediaminetetra acetic acid EGTA ethylene glycol tetra acetic acid EV empty vector FLAG bacterial flagellar protein FLG flagellin g gravitational force GST glutathione S-transferase HEPES N-(2-hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid) HR hypersensitive response IP immunoprecipitation JA jasmonic acid kD kiloDalton LB Luria-Bertani MAPK mitogen-activated protein kinase MeJA methyl jasmonate MS Murashige & Skoog salt mixture MOPS 3-(N-morpholino)propane-sulfonic acid mRNA messenger ribonucleic acid uE micro Einsteins NF-KB nuclear factor kappa B Nos nopaline synthase ix ORF open reading frame OX SIPK overexpressing line PAGE polyacrylamide gel electrophoresis PAL phenylalanine-ammonia-lyase PCR polymerase chain reaction ppb parts per billion PR pathogenesis-related proteins PVPP polyvinylpolypyrrolidone RH relative humidity Rl RNAi-mediated SIPK suppressed line RNA ribonucleic acid ROS reactive oxygen species rpm revolutions per minute RT room temperature SA salicylic acid SAR systemic acquired resistance S.D. standard deviation SDS sodium dodecyl sulfate SIPK salicylate-induced protein kinase SSC saline sodium citrate Taq Thermus aquaticus TMV tobacco mosaic virus U Units UTR untranslated sequences UV ultra-violet V volts WIPK wound-induced protein kinase X Acknowledgements I am deeply indebted to Dr. Brian Ellis, for providing me this opportunity to work with him and am grateful for his guidance, encouragement and his monumental support throughout the course of this study. I am thankful to my research committee members, Dr. Carl Douglas, Dr. Steve Pelech and Dr. James Kronstad, for their invaluable suggestions during the course of my research and thesis writing. I would like to acknowledge the research materials provided by Drs. Daniel Klessig, Yuko Ohashi and John Ryals. I am thankful for the financial support provided by UBC and the Biotechnology laboratory for my research and studies. I would like to thank all the present and past members of Ellis lab, Rishi, Godfrey, Lukpla, Greg, Alana, Hardy, Kim, Stef, Amrita, Monica and Madoka for their help and support. A special thanks to my good friend Rishi for all the precious time spent for my sake and Dr. Bjorn Orvar for guiding me through my rookie year. I would like to extend my gratitude to my friend Dr. Giritharan, for assisting with the microscopy and for all the support. I thank my parents Dr. Samuel Gnanadoss and Mrs. Leela Samuel for their moral support, their trust that their son could achieve this one-day and for all the encouragement and prayers that led to the successful completion of my degree. Most of all, no words can express the extent of respect and appreciation I possess for my wonderful wife Dr. Soni Rajan, for all her patience, for taking up all the frustrations when things were not going smooth, for all the sacrifices she has made and also for the lovely miracle in our life, our little girl Anna. xi CHAPTER 1 General Introduction 1.1 Crop Loss due to Increased Tropospheric Ozone Pollution The world human population is estimated to reach nine billion by 2050 (McMichael, 2001). This, together with continued economic development in today's low-income countries, has led to predictions that the total global demand for food will increase approximately three-fold over the next half-century (McMichael, 2001). To meet this demand, food production should be greatly increased by improved and intensified farm management in the coming years. A critical aspect of increasing food production is the prevention of crop loss. Crop-loss is influenced by a number of factors such as poor farm management, pests, pathogens, and air pollution. Among air pollutants, tropospheric ozone is the most potent, widespread and phytotoxic (Krupa et al., 1993). It is estimated that ozone alone causes more damage to crops than all other air pollutants combined, particularly in areas that account for a large proportion of the world's grain production (Bowler et al., 1992; Heagle, 1989; Chameides et al., 1994). Ozone, alone or in combination with other air pollutants, has been calculated to be responsible for approximately 90% of the air pollution-related crop-loss in the United States (Tingey et al., 1994). This problem is increasing in severity. Human activities have increased tropospheric ozone concentrations two- to five-fold during the past 40 years (Kley et al., 1999), leading to a global increase in ozone levels of approximately 1-2% per year (Thompson et al., 2001). In spite of the knowledge that ozone exposure 1 is generally detrimental to plant growth, it has been difficult to determine exactly whether and how much ozone affects plant growth and yield in natural environments (Krupa and Manning, 1988), since ozone concentration can fluctuate with altitude, latitude, season and hour of day (Runeckles and Krupa, 1994; Manning and Krupa, 1992). Ozone can also be transported from high ozone-concentration zones such as urban-industrial regions, to low concentration rural agricultural and forested areas (Barbo et al., 2002). Ozone can thus negatively affect not only human health in urban areas, but also agricultural crops, forests and other ecosystems (Sather et al., 2001). Ozone pollution is considered to be partly responsible for the forest decline phenomena seen in North America and Europe (Brown et al., 1995; Becker etal . , 1990; Hewitt et al., 1990; Salter and Hewitt ,1992). 1.2 Ozone-induced Oxidative Stress in Plant Tissues The phytotoxicity of ozone is due to its high oxidative capacity, which results in the induction of reactive oxygen species (ROS) in ozone-exposed plant tissue (Wu and Masten, 2002). Ozone enters the plant via the stomata and diffuses through the inner air spaces of the mesophyll layer, finally reaching the cell wall and the plasmalemma (Salter and Hewitt, 1992). In this environment, ozone has the potential to interact with water and its solutes, as well as with the plasmalemma or other cellular components. As ozone is consumed within these tissues, more ozone is drawn into the tissues in a process called reactive adsorption. Because of its highly reactive nature only a small fraction of ozone (or its derivatives) actually enters the cytosol (Luwe et al., 1993). As in the 2 apoplastic space, ozone that manages to penetrate as far as the peripheral cytoplasm will be rapidly converted to hydroxyl radicals (Grimes et al., 1983) superoxide radicals (Runeckles and Vaartnou, 1997); Singlet oxygen (Kanofsky and Sima, 1995, 2000 ) and H 2 0 2 (Schraudner, 1998; Rao and.Davis, 1999) in plant tissues. These ROS perturb the cellular redox balance, in addition to generating other R O S (i.e. lipid peroxides) by reacting with membrane lipids. These oxidizing reactions trigger a complex cascade of events that eventually leads to local or large-scale tissue injury. 1.3 Ozone as a Mimic of Pathogen-induced Cell Death Plants respond to biotic and abiotic stimuli in a number of ways, leading to general or specific cellular responses, according to the type of signal perceived, intensity of signal received, physiological state of the recipient cell and interaction with other signals. Production of ROS is one of the earliest responses known to occur during a plant's response to stress (Mehdy, 1994). Following initial perception of the stress signal, plant cells rapidly produce a burst of ROS including superoxide anion, H 2 O 2 and hydroxyl radical (Desikan et al., 1998). The link between pathogen infection and the oxidative burst has been well documented (Lamb and Dixon, 1997). The oxidative burst associated with pathogen recognition may be involved in direct antimicrobial activity, and in oxidative cross-linking of cell wall macromolecules. It can also trigger gene activation and transcription-dependent defenses, including hypersensitive cell death and systemic responses (Lamb and Dixon, 1997; Desikan et al., 1996; Olson and Varner, 1993; Yahraus et al., 1995). 3 To experimentally dissect the biological roles of reactive oxygen species, and the response of plants to general redox stress, it is convenient to be able to apply a redox stress, that can produce ROS inside the plant cell. One such abiotic stressor is ozone. Exposure to ozone has been shown to result in the formation of all three classic reactive oxygen species inside the plant cell. Ozone elicitation can be readily applied to whole plants, organs or individual cells (Manning and Krupa, 1992). Resulting injury symptoms can range from subtle biochemical changes in cell metabolism to visible damage such as chlorosis and necrotic lesions (Manning and Krupa, 1992). The ozone-derived burst of ROS is thought to mimic the oxidative burst that accompanies recognition of avirulent pathogens, and ozone-induced injury may therefore involve signalling pathways that are shared with those involved in the plant HR (hypersensitive response) (Sharma and Davis, 1997: Sandermann et al., 1998). In Arabidopsis rcdl (radical-induced cell death 1) is an R O S -responsive lesion-mimic mutant, in which ozone and extracellular superoxide and not H 2 O 2 can induce transiently spreading lesions. Upon ozone-exposure rcdl accumulated O2" in the zone ahead of the expanding lesions before appearance of visible symptoms. This response was similar to the HR triggered by an avirulent Pseudomonas syringae strain DC3000 in an incompatible interaction in the same mutant (Overmyer et al., 2000) Van Camp et al. (1998) proposed that an oxidative cell death cycle might be operating in pathogen-infected plants undergoing HR. In this model ROS, salicylic acid (SA) and cell death are involved in a self-amplifying cycle that 4 ultimately leads to visible symptom development. Similarly, transgenic tobacco plants deficient in ascorbate peroxidase (an ROS detoxifying enzyme) were more sensitive to ozone (Orvar and Ellis, 1997), while plants that cannot accumulate SA were shown to be more tolerant to ozone (Orvar et al., 1997; Rao and Davis, 1999), indicating the involvement of S A and R O S in the ozone-induced cell death process. Further evidence for ozone mimicking the pathogen-induced cell death process comes from simultaneous analysis of the ozone-sensitive poplar clone NE-245 for a programmed cell death process (PCD) induced by ozone exposure as well as by avirulent pathogen infection. Both stresses elicited similar patterns of DNA fragmentation, with concomitant PR-1 gene induction (Koch et al., 2000). Ozone exposure leads to transient accumulation of a number of stress regulated enzymes like PAL (phenylalanine ammonia lyase), C H S (chalcone synthase), and pathogenesis-related proteins (PR) PR-1 , PR-2 (31-3 glucanases, PR-3 chitinases, PR-5 proteins and a number of antioxidant genes like A P X (ascorbate peroxidase), CAT (catalase), SOD (superoxide dismutase) and GR, which play a major role in pathogen and wound induced pathways (Sharma and Davis, 1997; Rao and Davis, 2001). Ozone exposure leads to the accumulation of SA (Yalpani et al., 1994) which is an important component in stress induced pathways resulting in HR and SAR (Klessig and Malamy, 1994), and of jasmonic acid (JA), a wound-induced signal molecule. The accumulation of JA appears to offer protection against insects and plays a role in multiple signalling pathways regulating plant resistance to pathogens (Penninckx et al., 1998; Pieterse and van Loon, 1999). 5 Ozone-induced plant responses probably involve at least four different signalling pathways, including pathways that depend on ethylene, on reactive oxygen species (ROS), on salicylic acid and on methyl jasmonate (Sandermann et al.,1998; Rao and Davis, 2001). The interactions between these pathways influence relative ozone-induced lesion formation, propagation and containment of lesion formation (Overmyer et al., 2000). 1.4 Oxidative Stress in Prokaryotic and Eukaryotic Organisms Oxidative stress has been defined as an increase in the prooxidant/antioxidant ratio inside the cell, leading to potential damage (Sies, 1991). According to this definition, a simple loss in antioxidants or an increase in oxidative challenge (prooxidants), may not necessarily result in oxidative stress, as long as the cell is able to cope with the change in the prooxidant/antioxidant ratio (Sies, 1991). 1.4.1 Reactive oxygen species Reactive oxygen species (ROS) are oxygen free radicals (oxyradicals) and their reactive oxygen intermediate molecules (Feher et al., 1987). Free radicals and other ROS are generated by all aerobic cells and are known to participate in a wide variety of potentially deleterious cell-damaging reactions (Allen, 1998). These ROS include the hydroxyl radical (OH-), hydroperoxyl radical (H02-) and superoxide anion radical (02"), and the oxygen intermediates hydrogen peroxide (H2O2) and singlet oxygen OO2) (Cadenas, 1995; Feher et al., 1987). Free radicals possess unpaired electrons in their outermost orbitals and these electrons make radical species that are extremely reactive and short-lived although their stability varies substantially (Cadenas, 1995; Feher et al., 1987). 6 Ground-state molecular oxygen (O2), however, is itself a so-called biradical containing two unpaired electrons with a parallel spin, which causes it to be a relatively weak oxidant (Feher et al., 1987). ROS can be generated through the successive additions of electrons to the ground-state oxygen (02", H2O2 and OH-), or by energy-transfer reactions OO2) (Cadenas 1995). The 0 2 " radical is generated by a one-electron transfer. Superoxide is neither long-lasting nor toxic and is rapidly dismutated either enzymatically or non-enzymatically to the more stable H2O2. Protonation of 0 2 ' generates the hydroperoxy radical (HO2). In addition 0 2 " can react with nitric oxide (NO) generated by nitric oxide synthase to form a highly lethal peroxynitrite species (Bolwell, 1999). H2O2 is not a free radical and it displays a moderate reactivity (Cadenas, 1995). H2O2 reacts with divalent metal ions to generate hydroxyl radicals (OH). OH" radicals are extremely reactive with a half-life of only 10"9 seconds (Sies 1991; Feher et al., 1987). Molecular oxygen can also absorb energy (energy-transfer) to form 1 0 2 . In this process one of the unpaired electrons in ground-state oxygen is transferred to a higher energy orbital and its spin is inverted (Cadenas, 1995; Feher et al., 1987). This ROS has a half-life of 10" 6 seconds (Sies, 1991). All these toxic ROS initiate self-perpetuating cycles of peroxidation of lipids and fatty acids, damage nucleic acid and proteins and ultimately cause cellular dysfunction (Rao and Davis, 2001). 7 1.4.2 Prokaryotic and eukaryotic genetic responses to oxidative stress Bacteria have evolved adaptive responses to transitions between anaerobic and aerobic growth, and the resulting imbalances in the production and disposal of reactive oxygen species, as well as environmental free radicals generated by macrophages (Demple, 1997). Several prokaryotic proteins that respond to changes in oxygen tension, or to the presence of oxidative agents, have been identified. At least three major proteins participate in these adaptive redox responses. These are Fnr, OxyR and SoxR. The fnr system of E.coli, acts under anaerobic conditions to regulate the transcription of at least 31 genes, including repression of many genes of aerobic metabolism and activation of genes of anaerobic metabolism (Lynch and Lin, 1996). Fnr has an oxygen-sensitive [4Fe-4S] center essential for DNA binding. The current model of its activity proposes the formation of [4Fe-4S] center at low oxygen tension, that promotes dimerization and subsequent specific DNA binding and transcriptional repression or induction. Oxygen exposure would destroy this center and abolish the DNA binding (Lazazzera et al., 1996). The OxyR protein responds to cellular exposure to H 2 O 2 , while the SoxR protein is triggered by superoxide and nitric oxide to activate numerous genes responsible for antioxidant defense and antibiotic resistance. OxyR may be activated by oxidation of a key cysteine residue, while SoxR activation is dependent on the formation of a redox-sensitive [2Fe-2S] center. The redox-activated OxyR protein binds and stimulates transcription of various target promoters. The SoxR protein acts in a two-step fashion, where the activated 8 SoxR triggers the transcription of the soxS gene. The resulting SoxS protein, in turn, activates various target promoters (Demple, 1997) Higher organisms have evolved mechanisms for expressing appropriate genes to help their cells to counteract the redox imbalances created through respiration and also those due to cellular stresses. Intriguingly, higher eukaryotic organisms have also evolved enzymes that inducibly synthesize R O S . In this case, the ROS are used as weapons against invading pathogens. In mammals granulocytes and macrophages have specialized mechanisms for releasing large amounts of H2O2 and superoxide in a respiratory oxidative burst (Schulze-Osthoff et al.,1997). In addition to a direct anti-microbial effect, these R O S can act as second messengers leading to immune response, proliferation control and cell differentiation through transcriptional control of several associated genes. In yeast the HAP-1 transcription factor requires the binding of a heme group, that requires oxygen for its synthesis. The activated HAP-1 controls the transcription of catalase and superoxide dismutase gene (Zitomer and Lowry,1992). In mammalian cells, the production and perception mechanisms of ROS are less well understood. Expression of many genes is sensitive to redox stress (refer to review by Allen and Tresini, (2000) for a list of mammalian genes regulated by redox stress), but often these genes are also activated by other physiological signals. Transcription factors that are exclusively activated by ROS or that solely control expression of ROS protective and repair enzymes have not yet been identified. However the fact that the genetic response to redox stress involves numerous genes involved in general signal transduction, proliferation 9 and defense reactions, indicates a convergence and overlapping of signalling pathways by sharing signalling intermediates (Schulze-Osthoff et al., 1997; Allen and Tresini, 2000). 1.5 Oxidative Burst and Signal Transduction in the Hypersensitive Response in Plants 1.5.1 Oxidative burst in plants One of the earliest processes observed in plants in response to pathogens or elicitors is an "oxidative burst", a sudden release of R O S in the plant tissue (Bolwell, 1999; Mehdy, 1994; Legendre et al., 1993). This oxidative burst differs from the production of free radicals that occurs as a result of side reactions of metabolisms and electron leakage. Normally, free radical accumulation is controlled by a range of detoxification systems. Under stress conditions, including pathogen attack, this protective system is over-ridden by rapid production of large amounts of reactive oxygen species. In plant-pathogen interactions, this increase in ROS is usually transient and the predominant ROS are 02" , H2O2 and OH- (Mehdy, 1994). It is generally accepted that elicitors of the oxidative burst are pathogen-derived macromolecules, or host cell-wall fragments released during pathogen invasion (Yahraus et al., 1995). In plant-bacterial interactions, the oxidative burst can be divided into two distinct phases; an early, short-lived burst (Phase I) and a delayed, longer-lived accumulation (Phase II). Phase I is relatively non-specific with respect to the source of elicitation and occurs immediately after detection of either a compatible or incompatible pathogen (Baker and Orlandi, 1995). Phase II occurs 1.5 to 3 h 10 after inoculation and, in contrast to the Phase I oxidative burst, appears to be specific to genetically-defined incompatible interactions in several plant species, including tobacco (Baker and Orlandi, 1995). It is thought that ROS from the oxidative burst can act as direct toxins, as agents for construction of physical apoplastic barriers by cross-linking of extracellular components, and as second messengers through systemic signalling (Alvarez et al., 1998). Abiotic stresses such as mechanical pressure have also been shown to rapidly (in a few minutes) induce an oxidative burst in suspension cultured cells (Yahraus et al., 1995). The rapid generation of R O S has also been observed following wounding in Zinnia elegans (Olson and Varner, 1993), UV-irradiation in tobacco (Green and Fluhr, 1995), ozone-exposure in tobacco (Schraudner et al., 1998) and chilling stress in maize seedlings (Prasad et al., 1994). Although the precise molecular mechanism that generates the oxidative burst in plants is elusive, changes in the activities of membrane localized NADPH-oxidases (Keller et al., 1998), cell wall peroxidases (Bolwell, 1999) and apoplastic amine oxidases (Allan and Fluhr, 1997) have been correlated with this ROS pulse. Other signal intermediates such as C a + 2 influx, phospholipase, protein phosphatase and protein kinase activation (Hahlbrock et al., 1995; Chandra and Low, 1995; Legendre et al., 1993; Mehdy, 1994) are also known to influence the oxidative burst. While high concentrations of R O S in plant cells can lead to cell death because of their toxicity, lower concentrations of ROS can induce cellular defenses and systemic defense responses, including cell death (Jabs, 1999; Alvarez et al., 1998). 11 Despite the fact that ROS can regulate defense processes and induce cell death, it is not clear whether R O S accumulation alone is necessary and/or sufficient to orchestrate all plant defense responses, including HR cell death (Rao and Davis, 2001). It does, however, appear that R O S can mediate diverse cellular processes, perhaps through multiple pathways. 1.5.2 Oxidative burst and the hypersensitive response (HR) Plants respond to environmental assaults by biotic and abiotic stresses through a battery of defense mechanisms designed to recognize and counteract the threat. One such mechanism is the hypersensitive response (HR), a phenomenon which is central to natural disease resistance in plants (Hahlbrock et al., 1995). During an HR reaction, attempted infection by a pathogen rapidly induces programmed cell death, tissue reinforcement at the infection site, production of anti-microbial metabolites and induction of defense-associated gene expression (McDowell and Dangl, 2000). HR is frequently accompanied by induction of systemic acquired resistance (SAR). S A R is a process of establishment of secondary immunity throughout the plant, a response that provides effective resistance against a broad spectrum of pathogens (Tenhaken et al., 1995; Baker and Orlandi, 1995; Prasad et al., 1994; Malamy and Klessig, 1992). The HR response has been compared to the mammalian immune response, although the underlying mechanisms may differ. Activation of hypersensitive response to plant pathogens is contingent upon recognition of invasion. Pathogens that evoke HR are termed avirulent, or incompatible, and the plant host is said to be resistant. The interaction between 12 an incompatible pathogen and the plant host depends on "gene-for-gene"-matching between an avr (avirulence) gene in the pathogen (which might encode an elicitor) and a corresponding R (resistance) gene in the host (which might encode a receptor) (Staskawicz et al., 1995). Individually expressed R genes have a limited range of recognition capabilities and they lead to resistance only when the invading pathogen expresses the corresponding avr gene product. In the absence of the latter, the pathogen, which is now called virulent, or compatible, can evade recognition and spread throughout the plant, causing damage or even death of the host (Malamy and Klessig, 1992; McDowell and Dangl, 2000). The detailed mechanism of the HR is not fully understood but recent evidence indicates that H2O2 production and the oxidative burst play a central role in its orchestration (Bolwell, 1996; Levine et al., 1994; Alvarez et al., 1998). 1.5.2.1 Cross-linking of cell wall proteins Reactive oxygen species generation following pathogen invasion can directly modify cell wall chemistry (Baker and Orlandi, 1995). The elicitor-induced cross-linking of cell wall proteins is thought to harden the cell wall against attacks by hydrolytic enzymes secreted by the pathogen. One of the early outcomes of H2O2 generation is the immobilization of a number of cell wall proteins (Schreck et al., 1991; Bolwell, 1997) through the formation of covalent cross-linking. The resulting protein network acts as a barrier against invading pathogens, which may allow time for the plant cell to activate transcription-dependent defences (Tenhaken et al., 1995). Interestingly, recent evidence also points to the 13 presence of newly cross-linked cell wall polysaccharides in elicited cells, a pattern that would further strengthen the barrier (Fry et al., 2000). 1.5.2.2 ROS-induced gene regulation While ROS are intrinsically detrimental to cell integrity, they are now recognized as also playing a key role in modulating cellular activities (Allen and Tresini, 2000). One of the roles for the oxidative burst and R O S in environmental stress responses, for example, is regulation of gene transcription (Mehdy, 1994). H2O2 generated during the oxidative burst rapidly induces the expression of defense-related genes such as GST (a cellular protectant), PAL (an important control point enzyme in phenylpropanoid metabolism) (Kovtun et al., 2000; Desikan et al., 1998) and a number of other genes encoding pathogenesis-related proteins (Malamy and Klessig, 1992; Hahlbrock et al., 1995). H2O2 is also known to induce a number of antioxidant defense genes (Mullineaux et al., 2000). A recent Arabidopsis transcriptome analysis using Arabidopsis suspension cultured cells treated with H2O2 for 1.5 h and 3 h respectively has revealed numerous genes induced by oxidative stress (Desikan et al., 2001). 1.5.2.3 ROS and hypersensitive cell death The sign of a successful HR is the formation of restricted lesions at the site of attempted colonization of the challenged plant tissue, clearly delimited from surrounding healthy tissue (Hammond-Kosack and Jones, 1996). Associated with lesion formation is the development of immunity to a subsequent attack by a broad range of normally virulent pathogens (Ryals et al., 1994). 14 ROS generated through the oxidative burst have been proposed to play a central role in the development of cell death during HR. The use of antioxidant enzymes or R O S scavengers has been shown to interdict the cell death process during a number of incompatible plant-pathogen interactions, while inhibition of endogenous antioxidant mechanisms results in increased R O S levels and subsequently increased cell death (Levine et al., 1994; Grant and Loake, 2000). H2O2 from the oxidative burst has been shown to be both necessary and sufficient to trigger hypersensitive cell death (Tenhaken et al., 1995). A several-fold higher concentration of exogenously supplied H2O2 is, however, required to induce cell death than to induce defence gene expression (Levine et al., 1994), and unlike induction of defence gene transcription following HR, induction of hypersensitive cell death appears to show threshold dependency on H2O2 levels (Tenhaken et al., 1995). Levine et al., (1994) speculated that H2O2 can function as a mobile intercellular alarm signal, diffusing from infected cells (with high H2O2 levels and undergoing hypersensitive cell death) to adjacent cells. This, in turn, activates cellular protectant genes (but not hypersensitive cell death) in these neighbouring cells, since H2O2 has not reached the threshold levels required to trigger hypersensitive cell death. Direct application of H2O2 fails to induce S A R (Neuenschwander et al., 1995), but this may not adequately mimic endogenous ROS production. Plant cells rapidly metabolize exogenous H2O2, and a sustained oxidative burst is required for induction of hypersensitive cell death (Lamb and Dixon, 1997). Alvarez et al. (1998) have shown through continuous generation of H2O2 using infiltration of a glucose/glucose oxidase 15 mixture (G/GO) into Arabidopsis leaf tissue, a more authentic reconstruction of the oxidative burst. The H2O2 thus generated was able to recapitulate the systemic response to an incompatible pathogen, including cell death, systemic induction of defense gene, systemic micro-oxidative bursts and development of SAR. Treatment of Arabidopsis Isd1 and rcdl mutant plants with a superoxide generating system, but not with H2O2, induced cell death (Jabs et al., 1996; Alvarez et al., 1998). Despite this evidence, there is still debate whether, and which, ROS are necessary and/or sufficient to orchestrate plant defense responses, including HR cell death (Rao and Davis, 2001). For example, Dorey et al., 1999 have shown that cell death pathways that are independent of ROS also exist in plants. 1.5.2.4 Other signal molecules in HR A number of other signal molecules have been proposed to regulate R O S -induced defense gene activation and cell death processes. Molecules such as salicylic acid (Chamnongpol et al., 1998), serine proteases, calcium fluxes, protein kinases (Sasabe et al., 2000) and lipid hydroperoxides (Rusterucci et al., 1999) are known to act in concert with ROS to influence the cell death program. Calcium ions act as universal intracellular second messengers, co-ordinating characteristic intracellular responses to a wide range of extracellular stimuli (Clayton et al., 1999). Although plant cells exist in a high calcium environment, they maintain very low levels of free calcium (Ca 2 + ) in the cytosol, and uncontrolled changes in the cytosolic concentration of free C a 2 + can have 16 serious consequences for the regulation of various metabolic pathways in the cell (Castillo and Heath, 1990). Transgenic Arabidopsis plants expressing the calcium reporter protein aequorin have been used to demonstrate a rapid but transient biphasic increase in cytosolic free C a 2 + upon ozone exposure (Clayton et al., 1999). Other oxidative stresses such as H2O2 can also affect C a 2 + fluxes. In tobacco seedlings treated with 10 mM H2O2, cytosolic free C a 2 + levels showed a transient (1-2 min) increase, following a lag of 20-40 seconds (Price et al., 1994). Salicylic acid (0.5 mM) treatment of tobacco cell suspension cultures stimulated an immediate and transient burst of superoxide anion production followed by a transient increase in cytosolic free C a 2 + (Kawano et al., 1998). In parsley cell suspension cultures, a transient C a + 2 influx was observed within two to five min following elicitation, and this increase was followed by an immediate increase in H2O2 (Nurnberger et al., 1994). The importance of C a + 2 channels for the oxidative burst in plant-pathogen interactions has been demonstrated by Baker et al. (1993), who found that the C a + 2 channel-blocker L a + 3 inhibited elicitation-induced oxidative burst in tobacco cell suspensions. Another study showed that addition of EGTA (a chelator of C a + 2 ) to suspension-cultured spruce cells significantly reduced the oxidative burst following elicitation, thus confirming the importance of an extracellular source for C a + 2 (Schwacke and Hager, 1992). Specific inhibitors of C a + 2 influx blunted the cell death triggered in soybean cells by either P. syringae or H2O2, while calcium ionophores were able to induce cell death in the absence of elicitation (Levine et al., 1996). 17 C a + 2 influx has not been associated only with plant-pathogen interactions; many stimuli can initiate this influx. For example, cold-shock and mechanical stress induce C a + 2 influx (Sangwan et al., 2001; Knight, 2000) indicating that C a + 2 influx might be a general early response to environmental stress. ROS may mediate the induction of a cytoplasmic C a + 2 influx during the development of disease resistance. Using fluorescence imaging it was observed that H2O2 accumulation leads to a dose-dependent increase in cytosolic calcium levels and this increase was shown to be an important factor in the ROS-mediated cell death (Levine et al., 1996). The mechanisms by which R O S lead to increase in this influx are not known (Rao and Davis, 2001). Biosynthesis of salicylic acid (SA) is triggered by various biotic and abiotic stresses that also generate ROS (Yalpani et al., 1994; Sharma et al., 1996; Draper et al., 1997; Mur et al., 1997). SA can induce a wide array of defense reactions including changes in cellular redox state, cellular defense and cell death (Rao and Davis, 2001). Ozone challenge also induces changes in SA metabolism. Exposure of tobacco seedlings to 200 ppb ozone induced accumulation of SA, which increased 66-fold above basal levels within one day after treatment (Yalpani et al., 1994). Exogenous S A by itself can induce the production of R O S . Treatment of tobacco suspension cultures with S A induced increased levels of superoxide anion (Kawano et al., 1998). One of the proposed roles of SA relates to its inhibitory effect on H202-metabolizing enzymes such as catalase and ascorbate peroxidases. Such inhibition can potentially lead to 18 increased levels of R O S , which would function as second messengers in defense signalling pathways (Klessig et al., 2000). Jasmonic acid (JA) is another signal molecule that appears to play a central role in plant disease resistance (Penninckx et al.,1996). JA signalling can, depending on plant species and stimulus, either antagonize or synergize SA signalling and vice-versa (Dong, 1998: Pieterse and van Loon, 1999). Ozone-exposed Arabidopsis and hybrid poplar plants accumulated increased J A within several hours of treatment (Koch et al., 2000; Rao et al., 2000). Wounding or MeJA treatment of ozone-sensitive tobacco plants led to reduced ozone-induced cell death in these plants (Orvar et al., 1997), and wounding the plants led to reduced accumulation of H2O2 levels following ozone exposure (Schraudner et al., 1998). The precise mechanism by which JA regulates cell death is still unclear. Ethylene influences a broad spectrum of physiological processes, both during development and in response to stress (Kieber et al., 1997). Ethylene is a known modulator of organ senescence, a specialized form of P C D . Ethylene production is also induced by various plant pathogens, ozone and hypoxia (Moore et al., 2000; Pell et al., 1997; He et al., 1996). Ozone exposure leads to ethylene emission in pea seedlings, and this stimulation appears to be linked to the plant's sensitivity towards ozone (Mehlhorn and Welburn, 1987). When the ozone-induced ethylene emission was blocked with inhibitors of ethylene biosynthetic enzymes, there was no visible injury induced by ozone. Induction of ethylene biosynthetic enzymes by ozone was blocked by K252 A, a protein 19 kinase inhibitor, and the same enzymes were induced by calyculin A (a protein phosphatase inhibitor) in the absence of ozone. This pattern indicates that reversible phosphorylation events are an essential element of the regulation of ethylene biosynthesis induced by ozone (Tuomainen et al., 1997). In the Arabidopsis rcdl, an ROS-responsive "lesion mimic" mutant, ethylene production was necessary for propagation of the ROS-induced lesions (Overmyer et al., 1998). Both JA and SA signalling pathways are known to interact with ethylene. Co-ordinated action of both ethylene and JA were required for efficient defense responses (Pieterse and van Loon, 1999), while ethylene is believed to increase the plant sensitivity to SA (Lawton et al., 1995). ein2 (ethylene insensitive 2) / acd5 (acclerated cell death 5) double mutant had attenuated SA-dependent cell death than cell death in acd5 single mutants (Greenberg et al., 2000). Ozone-induced lesion propagation was reduced when rcd1:ein2 double mutant was exposed to ozone. It is generally accepted that the interaction between SA and ethylene signalling pathways fine-tunes the kinetics of lesion formation and propagation (Rao and Davis, 2001). All this evidence points to the fact that ROS generated from the oxidative burst can act as second messengers helping to integrate a plethora of diverse cellular processes. The extent of any given HR would depend on the type of eliciting signal, the intensity of the signal, and the levels of ROS accumulation, all integrated and co-ordinated within the multiple signalling pathways that lead to the development of cell death and systemic immunity. 20 1.6 Mitogen-activated Protein Kinases and Phosphorylation in Plant Signal Transduction 1.6.1 Mitogen-activated protein kinases Plants and animals detect and respond to a wide range of environmental stimuli, and efficiently transduce the associated signal across the cell membrane to reach appropriate intracellular components. The initial signal is amplified through a series of signal transduction mechanisms to ultimately affect one or more events. Several types of intracellular components function within eukaryotic signal transduction pathways, including protein kinases, phosphoprotein phosphatases, lipases, nucleotide exchange factors, ion channels, G proteins, lipid kinases and transcription factors (Braun and Walker, 1996). The mitogen-activated protein kinase (MAPK) pathway (MAPK cascade) often plays a key role in this signal transduction. The first mammalian member of the MAPK family was reported in 1987 by Ray and Sturgill, as a kinase that acted on a microtubule-associated protein. Since then, more than a hundred full-length sequences have been reported for various MAPKs . These sequences have been found to be highly conserved from the most primitive protozoans such as Plasmodium to highly evolved metazoans (Kultz, 1998). The activity of a MAPK cascade is transiently stimulated by a variety of input signals (Kultz, 1998). The cascade often converts a receptor-mediated signal into an amplified event that elicits a pattern of cellular responses appropriate to the input signal(s). Several different versions of the cascade have been identified. Within each version of the pathway the cascade consists of three 21 proteins, a MAPKKK, a MAPKK and a MAPK. M A P K K K s are activated by upstream signals. The activated M A P K K K is a protein-serine/threonine kinase that phosphorylates M A P K K on its -SXXXS/T - motif, making it active. The active M A P K K is a dual-specificity protein kinase that phosphorylates both threonine and tyrosine residues in the -TXY- motif of the MAPK. This activated MAPK can trigger a series of downstream events, directly or indirectly, leading in many cases to gene activation. In Saccharomyces cerevisiae (budding yeast), at least five different MAPKs have been identified. FUS3 is required for cell cycle arrest and cell fusion during mating, KSS1 is partially redundant with F U S 3 for induction of mating-specific genes by mating pheremone but also controls pseudohyphal growth, MPK1 is involved in the protein kinase C (PKC)-dependent signalling pathway, which has a role in maintenance of cell integrity, HOG1 is involved in the osmoregulatory pathway and SMK1 is required in the spore wall assembly pathway (Mizoguchi et al., 1997). In mammalian systems, MAPK cascades can be rapidly activated by ligand binding to plasma membrane growth factor receptors that display protein tyrosine kinase activity and are coupled to heterotrimeric G proteins. There are three well characterized MAPK sub-families in mammals: 1) the extracellular signal-regulated kinases (ERKs), also commonly known as MAPK, which are involved in growth factor-dependent cell proliferation, 2) the c-Jun NH2-terminal kinases/stress-activated protein kinases (JNKs/SAPKs), which are involved in stress-related pathways, and 3) the HOG1 homologue p38, which is involved in 22 responses to environmental stresses such as osmotic shock and UV radiation. There are three less understood MAP kinases - ERK3 , ERK5 and ERK7. ERK5 has been implicated in cell cycle control and cell transformation. E R K 7 may also be involved in cell proliferation (English etal . , 1999). The E R K 1/2 pathway is the most widely studied MAPK pathway. In mammals, this cascade includes enzymes designated as cRaf-1 (MAPKKK) which can phosphor/late MEK 1 and MEK 2 (MAPKK), which in turn activate E R K 1 and ERK2 (MAPK). The activated MAPK can either stay in the cytosol and activate other signal components, or translocate to the nucleus where they can activate transcriptional events. 1.6.2 MAPKs in plants Plants have protein kinases with biochemical characteristics similar to known animal and yeast MAPKs . Many cDNAs for putative M A P K s , M A P K K s and M A P K K K s have been isolated from different plant species. The number of MAPKs identified in plants is already higher than the numbers identified in animals and yeast, which indicates that MAPKs might have a wider variety of roles in plants (Mizoguchi et al., 1997). In plants, MAPK cascades are associated with various physiological, developmental and hormonal responses. MAPK activation has been correlated with stimulatory treatments such as pathogen infection, wounding, low temperature, drought, hyper- and hypo-osmolarity, high salinity, touch, and reactive oxygen species (Ichimura et al., 2002; Tena et al., 2001; Morris, 2001). 23 The Arabidopsis genome sequencing project has revealed 1072 Arabidopsis genes encoding possible protein-serine/threonine and dual-specificity kinases. Among them, there are 20 MAP kinases (MAPKs), 10 MAPK kinases (MAPKKs) and 12 MAPKK kinases (MAPKKKs) of the MEKK type. Moreover, the Arabidopsis genome also possesses 48 M A P K K K s related to the RAF family (Ichimura et al., 2002). The authors have recently proposed a more organized and systematic nomenclature for the MAPK cascade members known in Arabidopsis and other plant species. The M APKs thus far identified in plants appear to belong solely to the ERK1/2 class of MAP kinases. The strong activation of these plant ERKs in response to changes in the abiotic environment is in contrast to the pattern seen in animal cells, where stimuli other than mitogens, including environment-induced stresses, typically activate the S A P K class of MAPKs , rather than the ERK1/2 class. Thus far, no S A P K or p38 homologues have been identified in plants (Kultz, 1998). Another notable difference in response patterns is that activation of some of the plant MAPKs is also associated with transcript accumulation from the corresponding MAPK gene, unlike other phyla. MAPK cascade mutants identified thus far through have revealed a negative role for this cascade in defense signalling in Arabidopsis. Characterization of the ctrl and edrl mutants showed that they exhibited altered responses to ethylene and pathogens, respectively. Identification of the respective mutant genes revealed that their wild type alleles encode M A P K K K s related to RAF protein kinase (Kieber et al., 1993; Frye et al., 2000). One MAPK 24 (ATMPK4) mutant has been identified through forward genetics. The Arabidopsis mpk4 mutant was shown to play a negative role in regulating systemic acquired resistance, including the ability to accumulate salicylic acid (Petersen et al., 2001). Plant MAPKs have been characterized to different degrees from a range of species. Wounding resulted in a rapid and transient activation of 46 kD MAPK (wound-induced protein kinase; WIPK in tobacco) and also the accumulation of transcripts of the WIPK gene ( Seo et al., 1995, 1999 ; Usami et al., 1995). In alfalfa, wounding induced the activation and transcriptional accumulation of a 44 kD MAPK. This response was shown to be independent of abscisic acid (ABA) and methyl jasmonate (MeJA) (Bogre et al., 1997). In tomato, myelin basic protein (MBP) -kinase activity was induced by oligosaccharide elicitation, by wounding, and by systemin (a wound-induced signal molecule) (Stratmann and Ryan, 1997). Abiotic stresses are also MAPK activators. Cold and drought, but not high salt stress or heat shock, activated a 44 kD MAPK in alfalfa in an ABA-independent manner (Jonak et al., 1996). Osmotic stress also activates MAPK signalling in plants (Hoyos and Zhang, 2000; Mikolajczyk et al., 2000) Elicitors from multiple pathogens activate MAPK 's in plants. A fungal elicitor activated a 47 kD MAPK in tobacco suspension cultures (Suzuki and Sinshi, 1995), while infiltration with harpin, a proteinaceous elicitor from Pseudomonas, induced transient activation of a MAPK in a calcium-independent manner in tobacco leaves (Adam et al., 1997). A receptor- mediated MAPK (elicitor responsive MAPK, E R M kinase) was activated in an ion channel-25 dependent manner in parsley cells (Ligterink et al., 1997), while Lebrun-Garcia et al. (1998) have shown activation of 50 kD and 46 kD M A P K in tobacco suspension cultures treated with cryptogein or oligogalactouronides. More than one MAPK can be activated by a given stress. In addition to the two cryptogein-activated MAPKs reported from tobacco (see above), both SIPK (salicylate-induced protein kinase) and WIPK (wound-induced protein kinase) have been found to be activated in tobacco resisting infection by TMV (Zhang and Klessig, 1998). This response is upstream of any salicylic acid-dependent signalling steps, since the nahG genotype, which cannot accumulate salicylic acid, responded in a similar fashion. WIPK and SIPK are also activated upon elicitation by a pathogen-derived avirulence gene product (Cladosporium fulvum, AVR-9) in tobacco plants and cell cultures expressing the tomato Cf-9 resistance gene. This is a particularly interesting report, since the Cf-9/AVR-9 interaction represents a classic gene-for-gene relationship (Romeis et al., 1999). In alfalfa, MAPK activation profiles and kinetics were examined in response to a number of elicitors. Yeast cell wall-derived elicitor activated SIMK (SIPK ortholog), MMK3 and to a lesser extent MMK2 and S A M K (WIPK ortholog). Chitin mainly activated SIMK, MMK2 and MMK3 Ergosterol activated SIMK, MMK3 and SAMK, while p-glucan induced activation of all four MAPKs. (Cardinale etal . , 2000). Harpin activated two M B P kinases and induced cell death in Arabidopsis cell suspension cultures (Desikan et al., 1999). PD98059 (a M A P K K inhibitor), inhibited the harpin-induced M B P kinase activation and also inhibited harpin-26 induced cell death. PD98059 (MAPKK inhibitor) treatment also reduced the induction of PAL by harpin (Desikan et al., 1999). The harpin-activated kinases were identified as AtMPK6 and ATMPK4 (Desikan et al., 2001). Lee et al. (2001) identified a non-proteinaceous binding site for harpin in tobacco plasma membranes in tobacco. Use of U0126 (a MAPKK inhibitor) resulted in inhibition of harpin-induced SIPK activation and pathogenesis related gene expression (PR1, 2, 3, HIN-1) (Lee et al., 2001). Nuhse et al. (2000) have shown, using a C-terminus-specific antibody raised against alfalfa MMK-1, that AtMPK-6 was activated by flagellin peptide flg-22 (bacterial), xylanase (fungal), and pectin/chitin (plant) in Arabidopsis cell suspension cultures and leaf tissue. Using an Arabidopsis mesophyll protoplast transient expression system, Asai et al. (2002) demonstrated for the first time in plants, a functionally complete MAPK pathway in Arabidopsis, beginning with the signal initiated by flg-22 (elicitor) binding to FLS-2 (a kinase receptor). The message is transduced into the cell and to the nucleus through activation of a MAPK cascade (AtMEKK1-> AtMEK4/5 -» AtMPK6), leading to transcription of defense genes (FRK1, GST1) and transcription factor genes (WRKY29). 27 Pathogen* Abiotic stresses < > Non-race-specific elicitors Race-specific aviruience factors Fungi and Oomyceies Bacteria (e.g. Ptiytophthora spp.) (e.g. Erwinia amylovora. (TMV) [Cadcsponum Wounding Pseudomonas syringae) CWD elicitor Elicitins Harpins Flg22 Virus V) Fungus (O os rtu  fulvum) II \ Heiicase Avr9 High salinity Osmolarity 1 1 I 1 Drought ROS Receptor (?) FLS2 N Cf-9 . . . \ i / / Sensors (?) Secondary R e c t o r (?) \ \ / / y defense signab Receptor (?) \ ^ * * j / ^ / J*±T*£C ^ - ZL~—— and systemin) ^ MAPKKK(s) **" Specificity of response: (1) Identity and number of MAPKs involved (2) Kinetics of MAPK activation (3) Magnitude of MAPK activation Other substrates \ HR eel death Jasmonic acid biosynthesis Defense gene activation Systemic acquired resistance TRENDS rt Ptanl Science Figure 1.1 Convergence of multiple stress pathways into the MAPK cascade in plants (modified from Zhang and Klessig, 2001). Phytohormone activation of MAPK Phytohormones are also known activators of plant MAPKs. Abscisic acid (ABA) induced the activation of a MAPK in barley aleurone protoplasts (Knetsch et al., 1996) and exogenously applied salicylic acid (500 nM) strongly activated a 48 kD MAPK (salicylic acid-induced protein kinase; SIPK) in cultured tobacco cells (Zhang and Klessig, 1997). MeJA activated a yet unidentified 48 kD MAPK in tobacco (Kumar and Klessig, 2000). Arabidopsis roots treated with auxin induced MAPK activation, which was impaired in the auxin response mutant axr4 (Mockaitis and Howell, 2000). 28 MAPKs and cell death Through gain-of-function approaches MAPKs have been implicated in controlling lesion formation during the HR and defense signalling. Transient over-expression of a constitutively active form of NtMEK2 led to sustained activation of SIPK and WIPK and to cell death, with concomitant induction of PAL and HMGCoA (hydroxy methyl glutaryl CoA) reductase genes (Yang et al., 2001). Transgenic Arabidopsis plants overexpressing active forms of AtMEK4 and AtMEK5 under control of a steroid-inducible promoter led to spontaneous HR-like lesions when induced with dexamethazone. This was preceded by activation of endogenous MAPKs and generation of H 2 O 2 . When these constructs were infiltrated into tobacco they both activated SIPK and WIPK and led to HR-like lesions (Ren et al., 2001). Zhang et al. (2001) showed that transient overexpression of only SIPK led to HR-like lesions in tobacco, but these lesions appeared only in young leaves. By contrast, transient over-expression of WIPK did not lead to either its activation or cell death (Zhang et al., 2001). Through domain swapping between SIPK and WIPK, it was shown that the C-terminus of SIPK determines its activity. When the C-terminus of WIPK was fused with the N-terminus of SIPK and transiently overexpressed, the chimeric protein was not active, indicating that WIPK inactivation by negative regulators might be more potent or involve different species (Zhang et al., 2001). ROS activation of MAPKs Different ROS are known to induce MAPK activation in plants. The first report of H 2 0 2 activating MAPK was presented by Desikan et al. (1999) in Arabidopsis 29 suspension cultures. Kumar and Klessig, (2000), have shown the activation of SIPK by NO in an SA-dependent manner. Kovtun et al. (2000), through transient expression in protoplasts, provided evidence for activation of AtMPK6 and AtMPK3 by H 2 O 2 , a response that was correlated with inhibition of auxin-induced gene expression. Ectopic expression of a constitutively active form of ANP1 (MAPKKK) mimicked the H 2 0 2 effect, activating stress-responsive genes and blocking auxin-inducible gene expression. The tobacco ANP1 ortholog, NPK1, when stably overexpressed in its constitutively active form displayed tolerance to multiple stresses (Kovtun et al., 2000). AtMPK6 is also activated by a number of oxidative stresses in Arabidopsis. ATMPK6 was activated in cultured cells (T87) by H 2 O 2 and K 0 2 and in leaves by paraquat and by a catalase inhibitor (Yuasa et al., 2001). 1.6.3 Phosphorylation and transcriptional activation Gene expression in eukaryotes is ultimately controlled at the transcriptional level by transcription factors. The transcriptional regulation of any gene requires the integration of various signals, but generally does not require de novo protein synthesis, indicating that the signalling utilizes existing gene products. These proteins are capable of switching between alternate states through post-translational modifications (Schwechheimer and Bevan, 1998). The fact that many different stimuli that affect gene expression also lead to protein kinase activation indicates that some transcription factor function is very dependent on phosphorylation and dephosphorylation cycles catalyzed by protein kinases and protein phosphatases, respectively (Hunter and Karin, 1992). One likely role of 30 activated MAPKs is thus to modify transcription factors by phosphorylation, which would lead to changes in the level of transcription of the target gene. Once activated, MAPKs need to find their targets. Although it is necessary to limit the number of irrelevant substrates phosphorylated, signal integration also requires that each M A P K recognize a number of substrates so as to allow the regulation of multiple processes. All MAPKs recognize similar phospho-acceptor sites, on their target proteins. MAPKs phosphorylate serine and threonine residues followed by a proline residue. Proline at the P+1 position is the primary sequence determinant that can be utilized to identify M A P K substrates. Substrates of ERK1/2 in particular often contain a proline at P-2 position, giving the motif PX(S/T)P (Pearson et al., 2001). The amino acids surrounding this site increase the specificity of the recognition mediated by the catalytic pocket of the enzyme (Chang and Karin, 2001). Full specificity appears to be achieved through interaction of another site on the kinase with a separate distinct site on the substrate. In mammalian systems, many MAPK substrates have been identified by empirically testing logical candidates. Recently, additional novel substrates have been identified though protein phosphorylation screens (Fukunaga and Hunter, 1997) and two-hybrid screens (Waskiewicz et al., 1997). MAPKs , and specifically ERK1/2, are known to target membrane proteins (phospholipase A2), cytoplasmic proteins such as downstream kinases (Rsk, Mnk1 .MAPKAPKinase) and nuclear proteins such as transcription factors (c-Jun, c-Fos, ATF-2,Elk-1) (Pearson et al., 2001). JNK phosphorylates Jun proteins and thereby increases their DNA-binding affinity (Kallunki et al., 1996). The p38 31 proteins phosphorylate and enhance the activity of M E F 2 C and related family members (Han et al., 1997). Although numerous accounts of activation of plant M A P K s by multiple stresses have been cited, no physiological substrate for any of the known plant MAPKs has yet been identified in vivo or in vitro. Completion of the Arabidopsis genome has revealed an abundance of transcription factors that belong to different classes. The genome also possesses families of transcription factors that are redundant only to plants. Approximately 5% of the Arabidopsis genome is dedicated to code for more than 1500 transcription factors (Riechmann et al., 2000). A number of transcription factors that are phosphorylated by unidentified upstream kinases have been reported in plant systems (Schwechheimer and Bevan, 1998). Four ethylene responsive element binding proteins ( E R E B P 1-4 also known as E R F s or ethylene-inducible DNA-binding proteins), have been reported in tobacco. The E R E B P s bind or interact with an "ethylene responsive element", a 11 bp DNA sequence that is conserved in the promoters of pathogenesis-related genes (PR) (PR-1, p 1-3 glucanase and chitinase) of tobacco (Ohme-Takagi and Sinshi, 1995). Ozone exposure results both in stress ethylene formation and in accumulation of transcripts of these PR genes (Mehlhorn and Welburn, 1987; Sharma and Davis, 1997). This indicates that ozone might also be activating or inducing E R E B P s . E R E B P s are, however, also induced by wounding in an ethylene-independent manner. The induction of these E R E B P s by ethylene is prevented by staurosporine, a protein kinase inhibitor, indicating that the induction of E R E B P s by ethylene might involve a protein 32 kinase cascade (Suzuki et al., 1998). The EREBP-1 gene is also induced by SA, auxin and methyl jasmonate (Horvath et al., 1998). The fact that the E R E B P s are rapidly induced by multiple stress signals and are also targets of protein kinase cascades indicates that they should play a central role in controlling stress-induced transcriptional traffic inside the nucleus. One potential phosphorylation cascade that is transiently induced by multiple stresses and that could converge on the E R E B P s is the MAPK cascade. Consistent with this idea the tobacco E R E B P ' s possess MAPK phosphorylation signature motifs (PXS/TP) indicating that they can logically be one of the potential substrates of plant MAPKs . One known example of a plant kinase interacting with and phosphorylating a downstream transcription factor is the Pto kinase, a serine/threonine kinase in tomato that confers resistance to tomato bacterial speck disease. Pto kinase was found to interact with three tomato transcription factors (Pti 4/5/6), using the yeast two-hybrid system. These transcription factors show sequence homology to E R E B P s from tobacco (Zhou et al., 1997). Physical interaction of Pto kinase with transcription factors of the E R F family indicates that phosphorylation of these transcription factors may be involved in controlling their activity. The presence of a conserved serine and threonine residue in the putative activation domain, and two threonine residues in the DNA-binding domain of these factors is also consistent with a role for Pti phosphorylation by Pto kinase (Zhou et al., 1997). It is interesting that, through activation of members of the E R F family of transcription factors, various stress-induced signal transduction pathways overlap 33 and converge on common targets such as the promoter elements in the PR genes. A specific ozone-responsive promoter element has been described in the stilbene synthase gene of grapevine (Vitis sp.) (Schubert et al., 1997). Through 5' deletion analysis, the ozone-responsive region was localized between positions -430 and -280 bp upstream of the open reading frame. This region also included an ethylene responsive element-like motif located between positions -274 and -284 in an inverse orientation. Interruption of this motif in the -280 construct resulted in reduced transcriptional activity (Schubert et al., 1997). An analogue of this regulatory structure has been described in mammalian systems. Application of H 2 0 2 (200 u,M) to rat pleural mesothelial cells, led to ERK1/2 activation and also to accumulation of the transcription factor N F - K B in the nucleus (Milligan et al., 1998). Once in the nucleus, N F - K B binds to a specific 13 bp sequence in the promoter of target genes. Within this binding site, four conserved consecutive guanine residues have been found to be the most important for efficient binding. In Arabidopsis suspension cultures H 2 0 2 (10 mM) can induce activation of PAL and GST genes (glutathione-S-transferase) (Desikan et al., 1998) and analysis of the promoter regions of PAL and GST revealed considerable similarity to the mammalian N F - K B binding site, including the four consecutive guanine residues. This led the authors to suggest that transcription factors sensitive to cellular oxidative stress, similar to N F - K B , might be present in Arabidopsis (Desikan et al., 1998). 34 There are also four conserved guanine residues within the ethylene-responsive element-like region of the ozone-responsive promoter of grapevine stilbene synthase. These are interrupted in the -280 deletion construct that resulted in loss of transcriptional activity, consistent with the model of transcription factor-dependent gene activation during redox signalling. 1.7 Problem Statements and Thesis Objectives The study of signal transduction in plants in recent years has revealed that different stress signals, such as those associated with pathogen challenge and ROS application can converge into common, signal transduction pathways, or utilize components of the same pathway leading to similar and varied responses (Asai et al., 2002; Kovtun et al., 2000). Sandermann et al. (1998) and Rao and Davis, (2000), have reported that ozone can function as such a cross-inducer, whereby the plant's response to ozone challenge mimics the plant responses to any stress that generates an oxidative burst. However, little is known about the initial events that take place in plant cells in response during redox perturbations created by ozone. Although a number of studies have described the medium and long-term physiological responses of plants to ozone stress, there are many aspects of these response patterns that need further clarification. How is the ozone stress-signal transduced and amplified into a potentially protective or destructive response in plant cells? Within the context of this complex response, what determines the threshold of stress that triggers cell death? It is generally accepted that the plant 35 tissue response to ozone is initiated by the rapid accumulation of R O S (Rao and Davis, 1997; Schraudner et al., 1998). Protein kinases, specifically MAPKs , play a pivotal role in eukaryotic stress signalling pathways, as they control the signalling for defense mechanisms including activation of transcription factors and systemic responses. They can also function as negative regulators or desensitizors of defense responses, and of cell death pathways (Asai et al., 2002; Romeis, 2001). The fact that a multiplicity of stresses can elicit activation of MAPK, and that many of these also involve triggering of an oxidative burst, indicates that the redox stress created by ozone in plant systems is likely to activate protein kinase cascades which would be responsible for transcriptional regulation of target genes through activation of specific transcription factors. Identification of MAPK activation events induced by ozone would enable us to explore the signalling processes that precede, and that ensue from, this MAPK activation leading to downstream end-points of the cascade such as antioxidant responses and cell death. The general objective of this study was to determine the role of plant MAPK signalling responding to redox perturbations and regulating the resultant physiological adjustments. The following specific objectives have focussed on the use of ozone exposure as the experimental tool for generation of a redox stress, and on a biochemical and genetic analysis of MAPK signalling downstream of the ozone-induced R O S accumulation event. Tobacco was chosen as the biological system because of the extensive experience accumulated with this material in 36 our laboratory, because large amounts of tissue can be generated for biochemical testing, and because it is easily transformed. Specific objectives: (i) Determine the ability of ozone to activate one or more MAPKs in tobacco. (ii) Characterize the M A P K activation process, looking at the type of R O S involved, the requirement for calcium influx and the role of MAPKK, if any. (iii) Identify the ozone-activated MAPK and clone the corresponding gene ("Ozi MAPK") . (iv) Express the ozone- induced MAPK as a recombinant protein and confirm its activity in vitro. (v) Screen a tobacco cDNA expression library to identify potential substrates for the Ozi MAPK and characterize the identified clones. (vi) Generate transgenic tobacco carrying over-expression, suppression and dominant negative versions of the Ozi MAPK. (vii) Evaluate biochemical and physiological responses of these transgenic genotypes to ozone exposure. (viii) Analyse gene expression profiles in the wild type and ozi MAPK suppressed lines. 37 Table 1.1 Summary of plant MAPKs activated by various elicitors MAPK-identity Plant species Reported MW in kD Elicitor Citation S I P K T o b a c c o 48 kD and 46 kD S A T M V W o u n d i n g Funga l el ic i tors C f - 9 / A V R - 9 O s m o t i c s t ress U V Harp in N O Z h a n g and K l e s s i g , 1997 Z h a n g and K l e s s i g , 1998a Z h a n g and K l e s s i g , 1998b Z h a n g et a l . , 1998; 2000 R o m e i s et a l . , 1999 H o y o s and Z h a n g , 2 0 0 0 M i les et a l . , 2 0 0 2 L e e e t a l . , 2001 K u m a r and K l e s s i g , 2000 W I P K T o b a c c o 46 kD and 4 4 kD W o u n d i n g T M V C f - 9 / A V R - 9 S e o e t a l . , 1995 Z h a n g and K l e s s i g , 1998a R o m e i s et a l . , 1999 n/d T o b a c c o 47 kD Funga l el icitor S u z u k i and S h i n s h i , 1995 n/d T o b a c c o 48 kD M e J A K u m a r and k less ig , 2 0 0 0 A t M P K 6 A rab idops i s 46 kD Microb ia l el ic i tors Harp in H 2 0 2 Flagel l in K 0 2 , H 2 0 2 N u h s e et a l . , 2 0 0 0 D e s i k a n et a l . , 2001 Kov tun et a l . , 2000 A s a i et a l . , 2002 Y u a s a et a l . , 2001 A t M P K 3 Arab idops i s 44 kD H 2 0 2 Flagel l in Kov tun et a l . , 2000 A s a i et a l . , 2 0 0 2 A t M P K 4 A rab idops i s 44 kD Harp in Ab io t ic s t r e s s e s D e s i k a n et a l . , 2001 Ichimura et a l . , 2000 S I M K Al fa l fa 46 kD Sal t s t ress Funga l el ic i tors K ieger l et a l . , 2 0 0 0 C a r d i n a l e et a l . , 2000 M M K - 2 Al fa l fa 44 kD Chi t in C a r d i n a l e et a l . , 2 0 0 0 M M K - 3 Alfal fa 44 kD Funga l el icitor C a r d i n a l e et a l . , 2 0 0 0 S A M K Al fa l fa 44 kD C o l d and drought W o u n d i n g J o n a k et a l . , 1996 B g r e e t a l . , 1997 n/d T o m a t o 48 kD W o u n d i n g and sys tem in S t ra tmann and R y a n , 1997 n/d : not determined 38 CHAPTER 2 Ozone Treatment Rapidly Activates MAP Kinase Signalling in Plants 2.1 Introduction Reactive oxygen species are unavoidable products of the interaction of molecular oxygen with normal metabolic processes in plants, including the intense electron fluxes associated with both mitochondrial respiration and photosynthesis, and the activity of flavin-based oxidoreductases. Plant cells therefore have a continuing requirement to scavenge oxidizing species and their metabolic products, a basal demand that is met through constitutive accumulation of anti-oxidant metabolites (e.g. ascorbate, tocopherols, flavonoids, glutathione) and enzymic scavengers of ROS (e.g. ascorbate peroxidase, catalase, superoxide dismutase). These scavenging mechanisms are also inducible. Various stresses, including wounding, chilling, ozone exposure, or pathogen attack, trigger a rapid release of ROS ("oxidative burst") within the affected cells (Prasad et al., 1994; Legendre et al., 1993) and concomitantly elicit marked increases in the activities of scavenging enzymes as well as enhanced transcription of the corresponding genes (Orvar et al., 1997; O'Kane et al., 1996; Conklin and Last, 1995; for review see Lamb and Dixon, 1997). To analyse the biological roles of reactive oxygen species, and the response of plants to redox perturbations, it is necessary to use a redox stress that can produce ROS inside the plant cell. One such abiotic elicitor of oxidative burst is 39 ozone. Exposure to ozone has been shown to result in the formation of all three classic reactive oxygen species inside the plant cell. Ozone enters the plant mesophyll via the stomata and diffuses through inner air spaces to reach the cell wall and plasmalemma (Sharma et al., 1997). There it is immediately converted to reactive oxygen species (ROS) such as O V , HO*, and H 2 O 2 either by contact with water, plasmalemma or other cellular components (Pellinen et al., 1999). The outcome of an encounter with ozone is thus a rapid rise in R O S levels in the challenged tissue (Pellinen et al., 1999). Specific R O S such as superoxide anion radical have been proposed to act as early "second messengers" in the signal transduction pathway(s) that lie downstream of the initial oxidizing event, but the mechanism by which oxidative stress is detected in plants, and the nature of the signal transduction pathway that enables appropriate transcriptional and metabolic responses, remains unknown. Eukaryotic organisms possess a number of proteins whose function is sensitive to the cell's redox status, including known signal transduction components such as N F K B (Milligan et al., 1998), protein kinase C (Taher et al., 1993), p21 r a s (Lander et al., 1995), M A P K (Guyton et al., 1996), and phosphoprotein phosphatase (Caselli et al., 1998). In plants, rapid activation of MA P K s can be induced by wounding (Usami et al., 1995; Seo et al., 1995;1999), cold (Jonak et al., 1996), virus infection (Zhang and Klessig, 1998) treatment with microbial elicitors (Suzuki and Sinshi, 1995; Adam et al., 1997), and by R/Avr recognition 40 between host and pathogen (Romeis et al., 1999), all processes associated with induction of ROS accumulation. The apparent commonality of ROS generation as an immediate consequence of a range of cellular traumas that also rapidly activate M A P K s points to the possibility that ROS themselves may be responsible for triggering signalling through MAPK cascades. Since challenge with ozone immediately creates ROS in plant tissues (Pellinen et al. 1999), this model predicts that exposure to ozone should also lead to rapid MAPK activation. In the present study, exposure of tobacco tissues to ozone was found to induce activation of an ERK1/2 -type MAP kinase within minutes, both in tobacco plants and in cell cultures. This activation process is calcium-dependent, and can be blocked by free radical traps as well as by a specific inhibitor of MEK1/2, the upstream M A P K kinases. The activated kinase appears to be very similar, or identical, to the salicylate-induced protein kinase (SIPK) described previously from tobacco. 2.2 Materials and Methods 2.2.1 Plant growth conditions Plants of the Nicotiana tabacum genotypes Xanthi nc. and Xanthi nah G (courtesy of Dr. John Ryals, Agricultural Biotechnology Research Unit, CIBA-GEIGY Corp.), were grown from seeds in sterilized soil (50% Metro Mix 290, 50% soil with 3.5 kg n r 3 Osmocote 14-14-14 controlled release fertilizer (Grace Sierra)), in controlled environment growth chambers held at 25°C/20°C 41 (day/night) under 16 h photoperiod (120 - 150 oE m- 2 s - 1 , 6:00 A M - 10:00 PM) and RH 60% +/- 5%. Plants were watered daily with tap water. 2.2.2 Ozone exposure of whole plants Ozone was generated from air with a DELZONE ZO-300 Ozone Generating Sterilizer (DEL Industries) and monitored with a Dasibi 1003-AH ozone analyzer (Dasibi Environmental Corp). Ozone exposure regimes were either 500 ppb / 8 h for one day (10:00 AM - 6:00 PM), or samples were harvested at the stipulated time points after initiation of ozone exposure. Exposure levels varied no more than +/- 10% over the course of the treatment. Tissues harvested for molecular and biochemical analysis were frozen in liquid nitrogen and stored at -80° C until further analysis. 2.2.3 Ozone exposure of suspension-cultured cells of tobacco Xanthi nc. and Nah G-10 suspension cultures were established and maintained in Murashige and Skoog medium (Appendix A) supplemented with 1 mg/l 2,4-D and 0.1 mg/l of kinetin, and subcultured at weekly intervals. The flasks (250 ml) were shaken at 120 rpm (gyratory shaker) in the dark at 25° C. One-week-old cell suspension cultures were distributed on a layer of Whatman 541 filter paper in Petri plates drilled with multiple holes to allow the medium to flow through. The resulting thin cell layer was then exposed to ozone (500 ppb) for a selected period of time in a flow-through chamber (3 l/min). Control plates were exposed to ambient air in a similar chamber. After exposure, the cells were immediately harvested by vacuum filtration, frozen in liquid nitrogen and stored at -80° C to 42 await analysis. All experiments were repeated at least twice, and representative data are shown in the figures. 2.2.4 Cell viability experiments One-week-old tobacco cell suspension cultures were sieved aseptically through a 500 u.m nylon mesh and the filtrate allowed to settle to concentrate the cells. The supernatant was set aside and the sieved cells (10 ml) were plated and exposed to ozone as described above. Control plates were exposed to ambient air. The cells were then washed off the plates with the same sterile medium they had been grown in, and returned to the shaker for 6 h before assaying for cell viability. Cell samples were incubated for 30 min at 28° C with a solution of propidium iodide (10 u.g/mL; an intercalating agent that only stains the nuclei of dead cells) and bis-benzamide (10 u,g/ml_; counter-stains cell walls). Viability was scored as the number of nuclear-stained cells expressed as a percentage of the total cell population. 2.2.5 Protein extraction and immunoblotting The frozen tissue was ground in liquid nitrogen and the powder stirred with two volumes of extraction buffer (50 mM H E P E S pH 7.5, 5 mM EDTA, 5 mM EGTA, 10 mM dithiothreitol, 1 mM sodium o/t/70vanadate, 10 mM sodium fluoride, 1 mM Phenylmethanesulfonyl fluoride, 2 u.g/ml antipain, 2 u,g/ml leupeptin, 10 u,g/ml aprotinin, 5 u.g/ml pepstatin, 10% v/v glycerol, 7.5% w/v polyvinylpolypyrrolidone). The slurry was kept on a reciprocating shaker (100 oscillations/min) for 10 min, at 4° C, followed by centrifugation at 15,500 g. The supernatant was assayed 43 directly or flash-frozen and stored at -80° C. The protein content was quantified using the Bradford dye-binding assay (Bradford, 1976). Extracted proteins (80 ug total protein from leaves or 30 u,g from cell suspension cultures) or immuno-precipitated proteins were fractionated by 10% S D S - P A G E , and transferred onto PVDF (polyvinyl difluoride) membranes (Millipore). Polyclonal phosphospecific MAPK (anti-pERK, p44/42) antibody (New England Biolabs) and polyclonal p44/42 MAPK-specif ic antibody (anti-ERK) (Santa Cruz) raised against a peptide which corresponds to amino acids 305-327 of ERK-1 (p44 MAP kinase of rat origin), were used as the primary antibodies. Peroxidase-conjugated goat anti-rabbit IgG (Dako) was used as the secondary antibody. MAPKs were visualized using an enhanced chemiluminescence protocol according to the manufacturer's directions (Amersham). 2.2.6 In-gel kinase assay Six- week-old tobacco plants were exposed to ozone and crude extracts of proteins were extracted. Extracts containing 80 ug protein were electrophoresed on 10% SDS-polyacrylamide gels embedded with 0.1 mg/mL of myelin basic protein (MBP) in the separating gel as substrate for the kinase. After electrophoresis, S D S was removed by washing the gel with washing buffer (25 mM Tris, pH 7.5, 0.5 mM DTT, 0.1 mM N a 3 V 0 4 , 5 mM NaF, 0.5 mg/mL BSA, and 0.1% Triton X-100 [v/v]) three times for 30 min each at room temperature. The kinases were allowed to renature in 25 mM Tris, pH 7.5, 1 mM DTT, 0.1 mM N a 3 V 0 4 , and 5 mM NaF at 4°C overnight with three changes of buffer. The gel was then incubated at room temperature in 30 ml reaction buffer (25 mM Tris, pH 44 7.5, 2 mM EGTA, 12 mM MgCI 2 , 1 mM DTT, and 0.1 mM N a 3 V 0 4 ) with 200 nM A T P plus 50 uCi [y- 3 2P]-ATP (3000 Ci/mmol) for 60 min. The reaction was stopped by placing the gel in 5% trichloroacetic acid (w/v) /1 % NaPPi (w/v). The unincorporated [y- 3 2P]-ATP was removed by washing in the same solution for at least 6 h with five changes. The gel was dried onto Whatman 3 MM paper and exposed to Kodak XAR-5 film. Prestained size markers (Bio-Rad) were used to calculate the size of the kinases. 2.2.7 Immuno-precipitation and in-gel kinase assays Extracted protein (40 \xg) in 500 u.l volume of extraction buffer without P V P P , was used for immunoprecipitation with either 5 u,g anti-SIPK antibody or 5 u.g anti-WIPK (Ohashi.Y., personal communication, Seo et al.,1999) antibody. After incubation overnight at 4°C, the immunoprecipitates were recovered by incubation with 15 u.l of Protein-A-Sepharose for 2 h, followed by centrifugation (15,500 g) for 1 min at 4°C. The pellet was washed thrice with extraction buffer without P V P P , and 16 (al extraction buffer without P V P P and 4 u.l 5X loading buffer (0.625 M Tris-HCI pH 6.8, 5% SDS, 40% glycerol, 0.125% bromophenol blue, 40% v/v p-mercaptoethanol) were added and boiled for 5 min. The released proteins were used for an in-gel kinase assay, carried out as described above (Chapter 2.2.6) for extracted total proteins from leaves. 2.2.8 Culture treatments Cell suspension cultures (1 week after subculture) were treated with either 20 mM H 2 O 2 for 15 min, with xanthine (0.1 mM)-xanthine oxidase (0.5 U/ml) mixture 45 for 5 min, or with salicylic acid (0.5 mM) for 5 min. The cells were then harvested by vacuum filtration, frozen in liquid nitrogen and stored at -80° C until analysis. To test potential inhibitors, suspension cultured cells were pre-treated with specific reagents as follows: MEK 1 inhibitor PD98059 (100 L IM ) (New England Biolabs) for 1 hr, LaCI 3 (5 mM) for 10 min, N-acetyl cysteine (40 mM) for 45 min, N-(2-mercaptopropionyl)gIycine (5 mM) for 45 min, calyculin A (0.5 u,M) for 10 min or vanadate (1 mM) for 10 min. Unless otherwise noted, all reagents were obtained from Sigma. The inhibitor-treated cells were either plated and exposed to 500 ppb ozone as described above, or treated with 20 mM H 2 0 2 , before extraction. Following treatment with calyculin A or vanadate, or exposure to either oxidant, cells were harvested by vacuum filtration, frozen in liquid nitrogen and stored at -80°C to await analysis. 2.3 Results 2.3.1 Ozone rapidly activates a MAPK in tobacco leaves When proteins were extracted at different times from ozone-treated leaves and tested for the presence of protein phosphorylating activity using an in-gel kinase assay, a marked increase in myelin basic protein (MBP) phosphorylating activity was detected within 5 min of initiating the ozone challenge (Figure 2.1). This activity migrated as a single band with an apparent molecular mass of - 46 kD. Since the size and substrate utilization properties are consistent with those of known MAP kinases, and all plant MAPKs characterized to date belong to the ERK1/2 class of kinases, anti-ERK 1/2 antibodies were used to probe Western 46 blots of proteins from ozone-exposed leaves. Anti-ERK1/2 antibodies recognized a small number of proteins in the size range of 40 - 50 kD, including a discrete 46 T i m e ( m i n ) 0 5 10 h— 47.5 kD Figure 2.1. MBP phosphorylating activity is induced by ozone exposure. Tobacco plants were exposed to ozone for different times and extracted leaf proteins were fractionated in an SDS-polyacrylamide gel polymerized with MBP as a substrate for MAPK. After denaturation and renaturation of the gel, protein kinase activity on MBP was detected by incubating the gel with [y 3 P]-labelled ATP. Figure 2.2. An ERK homologue is activated by ozone exposure. Tobacco leaves were exposed to ozone (500 ppb) for different times and proteins were then extracted. After fractionation of total proteins (80 fig) by S D S - P A G E , the blot was probed with either an anti-ERK (2.2.A) antibody, or with an anti-phospho ERK antibody (2.2.B) which recognizes only the active forms of ERK1/2. 47 kD band (Figure 2.2A). The intensity of this band appeared to be unaffected by the 10 min ozone treatment, but when these samples were probed with anti-phosphoERK antibodies that recognize only the doubly phosphorylated (-TXY-) ERK epitope, two proteins (-46 and 44 kD) were detected in the extract from ozone-treated tissue, and none in the control treatment (Figure 2.2B). 2.3.2 Ozone induces cell death and activates MAPKs in cultured cells Studying very short-term responses to ozone in whole plants is logistically challenging, and is further complicated by the stomatal diffusion barrier which restricts the amount of sub-epidermal tissue reached by the oxidant within the leaf. Plant tissues cultured in vitro have been shown to reflect whole plant metabolism in many cases, including responses to fungal elicitors (Romeis et al., 1999). When suspension cultured tobacco cells were plated as thin layers, exposed to 500 ppb ozone for 10 min, and returned to their liquid medium, a 20% increase in cell death was measured within 6 h in the treated population (Figure 2.3). Since only a 5% increase in cell death was observed when the layers were exposed to ambient air rather than ozone, this mortality was largely due to the effect of ozone treatment rather than the handling procedure. Comparison of Western blots of proteins extracted from ozone-treated and air-treated tobacco cell layers revealed a rapid induction of the two immuno-reactive phosphoproteins by ozone treatment, consistent with the results obtained in whole plants (Figure 2.4A). A time-course analysis showed that, after a 10 min exposure to 500 ppb ozone and further culturing in liquid medium, the phosphoproteins 48 remained detectably activated in tobacco cells for at least 1 h but had returned to control levels by 3 h post-treatment (Figure 2.4C). Proteins were then extracted from control and ozone-treated tobacco cells and assayed for in-gel kinase activity. The results showed that, although anti-pERK antibodies detected two phosphoproteins in ozone-treated cells (Figure 2.4A), MBP phosphorylating activity was associated almost exclusively with the 46 kD species (Figure 2.4B). This indicates that, while the smaller phosphoprotein was readily detected by the anti-pERK antibodies, the in gel kinase assay conditions may not provide a suitable indicator of the activity of this particular kinase. A number of MAP kinases have been described from tobacco, including SIPK and WIPK. To establish whether the ozone-activated kinase(s) were related to either SIPK or WIPK, proteins from control and ozone-treated tissues were immunoprecipitated using anti-SIPK and anti-WIPK antibodies, and the precipitates analyzed for MBP-phosphorylating activity with the in-gel kinase assay. A 46 kD protein (p46 MAPK) recovered with anti-SIPK displayed strong kinase activity following 10 min of ozone treatment, whereas the protein precipitated with anti-WIPK, though detected by anti-pERK as a 44 kD phosphoprotein (data not shown) had little, if any activity (Figure 2.5). The size and immunoreactivity of the primary ozone-activated protein kinase are thus consistent with the properties of tobacco SIPK. 49 TO •o "53 o 2 5 2 0 1 5 10 0 J S.66 ±0.66 20.21 .25 Air Ozone Figure 2.3. Ozone-induced cell death in suspension-cultured cells of tobacco. Tobacco cell suspension cultures were sieved through a 500 LI mesh to remove cell clumps. The sieved cells were plated and either exposed to ozone (500 ppb) or ambient air for 10 min. After exposure, the cells were washed off the plates using the same medium they had been grown in, and assayed for cell death after 6 h of further culturing. Values represent the mean + S .E .M. (n =3). C) 10 Time (min) 30 60 120 180 4 6 k D 50 Figure 2.4. p46 MAPK is activated by ozone in suspension-cultured cells. Total proteins (20 ug) from suspension-cultured cells of tobacco plated and treated with ozone (500 ppb) were probed with anti-phospho ERK1/2 (2.4A), or subjected to an in-gel kinase assay (2.4B). Control cells were plated and exposed to ambient air for 10 min. 2.4C. Time course for activation of the p46 MAPK by ozone. Following ozone exposure the treated cells were cultured in sterile liquid medium for 3 h, and the proteins extracted at different time-points were immuno-blotted using anti-phospho ERK1/2 antibody. Figure 2.5. p46 MAPK is related to SIPK. Extracted proteins (40 ug) from 500 ppb ozone-exposed cell suspension cultures, were incubated with either anti-WIPK (5 Lig) or anti-SIPK (5 ug) antibodies. The immunoprecipitated proteins were subjected to an in-gel kinase assay, as described above for extracted total proteins from leaves. Total proteins from ozone-treated cells were used as positive control. 51 2.3.3 The p46 M A P K is activated by exposure to H 2 O 2 and 0 2 ~ Ozone reacts very rapidly within aqueous environments to create both organic and inorganic radical species, including OH* and 0 2 ~ . These can, in turn, generate longer-lived oxidants such as H 2 O 2 through dismutation reactions. The activation of the p46 MAPK by ozone could therefore involve one or more of these secondary oxidants rather than ozone itself. Cultured tobacco cells treated for 1 0 min with exogenous H 2 0 2 , or exposed to a superoxide generating system (X + XO), responded to these ROS challenges with a rapid activation of the p46 MAPK, directly analogous to the response induced by ozone (Figure 2.6A). Pre-treatment of the cells with the free radical scavenger mercaptopropionyl glycine, on the other hand, completely interdicted the response of the p46 MAPK to both ozone and H 2 O 2 (Figure 2.6B). The same protective effect was obtained by pre-incubating the cells with another free radical scavenger N-acetyl cysteine. c I LO 52 Figure 2.6. p46 MAPK is activated by treatment with H 2 0 2 or with a superoxide-generating system, and the activation is compromised in the presence of ROS scavengers. 2.6A.Total proteins (20 ug) from suspension-cultured cells of tobacco that had been treated with 20 mM H 2 0 2 for 15 min, or with superoxide generated by a xanthine (0.1 mM)-xanthine oxidase (0.5 U/ml) mixture for 5 min, were analyzed by immunoblotting with anti-phospho ERK1/2 antibody. 2.6B. Alternatively, cells were treated with NAC (40 mM) or M P G (5 mM) for 45 min, and were either plated and exposed to ozone (500 ppb) for 10 min, or treated directly with 20 mM H 2 0 2 for 15 min. Total proteins (20 ug) extracted from the treated cells were analyzed by immunoblotting with anti-phospho ERK1/2 antibody. 2.3.4 Activation of the p46 MAPK by ROS involves MEK and C a + + . Within canonical M A P K cascades, M A P kinases are normally activated by M A P K kinases (MAPKK). Mammalian MEK is one of the best characterized of the known MAPKKs , and its potential as a drug therapy target has led to the development of a highly specific MEK inhibitor, PD98059 (Alessi et al., 1995). When tobacco cells were pre-treated with 100 uM PD98059 for 1 h and then challenged with either ozone or H 2 0 2 , the activation of the p46 MAPK was strongly reduced (Figure 2.7A), indicating that the ROS-derived signal must be passing primarily through an upstream MAPKK rather than acting directly upon the MAPK itself. Pre-treatment of the cells with lanthanum chloride, a potent calcium channel blocker, also completely silenced the activation of the p46 MAPK by ROS (Figure 2.7A). 53 Figure 2.7. Activation of p46 MAPK is dependent on upstream MAPKK, calcium influx and protein phosphatases. 2.7A. Total proteins (20 uxj) from suspension-cultured cells of tobacco that had been treated with PD98059 (100 u.M) or LaCI 3 (5 mM), followed by either plating and exposure to ozone (500 ppb), or treatment with 20 mM H 2 0 2 for 15 min, were analyzed by immunoblotting with anti-phospho ERK1/2 antibody. 2.7B. Total proteins (20 u.g) from suspension-cultured cells of tobacco that had been treated with either calyculin A (0.5 u.M) or sodium orthovanadate (1 mM) for 10 min, were analyzed by immunoblotting with anti-phospho ERK1/2 antibody. 2.3.5 p46 MAPK can be activated by inhibition of S/T phosphatase activity Specific inhibition of phosphoprotein phosphatases has been shown to lead to activation of the cognate substrate kinases in many eukaryotic systems (Millward et al., 1999). Treatment of cultured tobacco cells for 10 min with 0.5 uM calyculin A, a potent protein serine-threonine phosphatase inhibitor, produced a rapid and 54 pronounced activation of the p46 MAPK (Figure 2.7B), but treatment with vanadate (1 mM), an inhibitor of protein tyrosine phosphatases, had no effect. 2.3.6 ROS activation of p46 MAPK is independent of salicylate metabolism Several reports have pointed to an interplay between salicylic acid and ozone-induced responses in plant cells. Ozone treatment induces a slow accumulation of salicylate in tobacco tissue, beginning 6 h after first exposure (Yalpani et al., 1994), and transgenic tobacco plants unable to accumulate salicylate (nahG genotype) are markedly less sensitive to ozone damage than are the wild-type plants (Orvar et al., 1997). However, cell layers of the tobacco nahG genotype, when challenged with 500 ppb ozone, showed the same pattern of rapid p46 MAPK activation as is seen in the non-transgenic Xanthi or BY2 genotypes (Figure 2.8A), indicating that the activation process has no requirement for salicylate accumulation. Exogenously-supplied salicylate (250 uM) has been reported to rapidly and strongly activate SIPK in tobacco cell cultures (Zhang and Klessig, 1997). However, treatment of Xanthi tobacco cells with exogenous salicylate (500 uM) produced a relatively weak activation of the p46 M A P K detected with the anti-pERK antibodies (Figure 2.8B) and this response faded substantially within 10 min (data not shown). In-gel kinase assays using proteins immunoprecipitated with SIPK-specific antibodies revealed that the salicylate-induced activation of SIPK was much weaker than activation of SIPK by ozone (Figure 2.8C). 55 46 kD 46 kD C) 46 kD o • c • o - < Figure 2.8. ROS activation of p46 M A P K is independent of salicylate metabol ism. Suspension- cultured cells of tobacco carrying a microbial salicylate hydroxylase gene (nahG), were plated and exposed to ozone for 10 min (2.8A). Cultured wild-type cells were treated with 500 u.M salicylic acid for 5 min (2.8B). In each case, total protein was extracted from the harvested cells and aliquots (20 u,g) were analyzed by immunoblotting with anti-phospho ERK1/2 antibody or by in-gel kinase assay (2.8C) Resul ts from Chapter 2 were publ ished in THE P L A N T J O U R N A L (2000) 22, 367-376. 56 2.4 Discussion Plant cells are bathed in a highly oxidizing milieu that arises from a combination of the atmospheric environment and their own metabolic activities. Plant survival therefore depends on possession of an array of effective antioxidant responses, coupled to mechanisms for sensing perturbations to their internal redox balance. Discrete redox sensors have been identified in a number of prokaryotic organisms (Demple, 1996), but the functional homologues of these gene products have not been reported from metazoan species. Nevertheless, it is clear that both mammals and plants are capable of detecting and rapidly responding to redox challenges such as hyperbaric oxygen, free radical generators (Ohlsson et al., 1995), nitric oxide (Nathan, 1995; Delladone et al.,1998), H 2 0 2 (Abe et al., 1998; Levine et al., 1994), superoxide anion (Graier et al., 1998; Jabs et al., 1996) and ozone (Jaspers et al., 1998; Sharma and Davis, 1997). In plant systems in particular, it has also been established that many biotic and abiotic stresses induce a rapid transient increase in cellular ROS ("oxidative burst") as one of the earliest detectable metabolic responses (Lamb and Dixon, 1997). While it is essential for plants to control the levels of potentially destructive ROS within their cells, it appears that they may also deploy these short-lived diffusable metabolites as direct signal transducers and/or generators of other systemic signal transduction components (Jabs, 1999). In this model, the oxidative burst induced in plant cells by non-oxidant stresses is envisioned as a critical step in recognition of the trauma and subsequent mobilization of an appropriate 57 response (Mittler et al., 1999). However, the molecular targets of such ROS signalling remain unknown. Whether to respond to ROS signals or to prevent excess oxidative damage, plants must be capable of monitoring the level of oxidant species in and around their cells. By analogy to other organisms, the primary sensing mechanism(s) are likely to involve protein-associated redox centres such as thiol groups or metal ions (Demple, 1996). However, the initial perturbation of the oxidation state at these centres must ultimately be transmitted to other signal transduction components that are capable of amplifying and integrating the information. In metazoan organisms, MAP kinase cascades play a central role in such "midstream" signal transduction processes. In plants, an array of different MAP kinases have recently been found to be activated by treatments (wounding, fungal elicitors) that are also known to be capable of inducing an oxidative burst in the challenged tissues ( Yaharus et al., 1995; Usami et al., 1995; Piedras et al., 1998; Romeis et al., 1999). However, in these reports the potential connection between MAPK activation and R O S generation has usually been examined from the perspective that kinases might be involved in regulating ROS formation, rather than the converse. Likewise, the possible role of MAP kinase signalling in response to direct oxidant stress has not been examined in plants, although a number of recent studies in animal cells have reported rapid changes in the phosphorylation status of protein kinases as a direct consequence of oxidant stress (Lander et al., 1995; Guyton et al., 1996; Abe et al., 1998). 58 There are many parallels between the responses induced in plants by exposure to atmospheric ozone and those resulting from other challenges to cellular integrity. Ozone-induced responses include elevated levels of antioxidant activity (Orvar et al., 1997), phenolic accumulation (Eckey-Kaltenbach et al., 1994), suppression of primary metabolic functions (Pell et al., 1992; Conklin and Last, 1995), salicylic acid accumulation, production of pathogenesis-related proteins (Yalpani et al.,1994), stimulation of ethylene (Tuomainene et al., 1997) and callose biosynthesis, and local necrosis (Schraudner et al.,1992; 1998). Some or all of these same changes can also be observed following wounding, chilling, pathogen attack or elicitor treatment, suggesting that ozone behaves as a volatile general elicitor of plant defence reactions (Sandermann et al., 1998). In this model, the parallelism in downstream responses could arise from the ability of ozone to create an oxidant stress which effectively mimics the R O S burst often induced in stressed cells. The intracellular signalling elicited in plant cells by ozone treatment would, therefore, be predicted to resemble the pathway(s) activated by other ROS-inducing stresses. Since several plant MAP kinases were known to be stress-induced, we explored the possibility of common signalling by first examining the influence of a brief exposure to ozone on the activity of MAP kinases in leaves of tobacco plants. In earlier studies it was established that exposure of tobacco to 250-500 ppb ozone for several hours was sufficient to induce phenolic accumulation and visible tissue damage within 48-72 h (Orvar et al., 1997). Assays for MBP phosphorylation activity in ozone-treated leaves demonstrated, however, that 59 induction of this hallmark reaction for MAPKs can be detected within 5 min of first contact with ozone. The protein kinase activity assayed "in-gel" is associated with a single protein band migrating at a relative mobility of -46 kD, typical of many MAPKs . Immunological probing of this response with antibodies raised against a mammalian ERK-type MAPK, and with specific anti-phospho-ERK antibodies, confirmed that the ozone-activated kinase belongs to the E R K class of MAPKs , rather than to the S A P K / JNK classes that often participate in stress-induced signalling in mammalian cells (Kyriakis et al., 1994). Interestingly, all of the MAPKs characterized from plants to date appear to belong to the ERK1/2 class (Kultz, 1998), a pattern whose significance is still unknown. A more experimentally tractable system for studying short-term responses to ozone was devised by establishing suspension cultures of tobacco cells which could be readily plated and uniformly challenged with various reagents. In this system, short-term exposure to 500 ppb ozone not only induced an increase in cell mortality (Figure 2.3), but the treatment also elicited a strong activation of two ERK-type MAP kinases (Figure 2.4), as had been seen with intact plants. Following a 10 min challenge with ozone, the p46 M A P K remained activated for at least 1 h before returning to its inactive state (or being destroyed). If the tobacco cells were treated with calyculin A, an inhibitor of protein serine/threonine phosphatases, a marked activation of the p46 MAPK was induced in the absence of any oxidative stress (Figure 2.7B). This is consistent with regular cycling of the kinase between its phosphorylated and de-phosphorylated states, whereby the relative activities of the cognate protein 60 phosphatases and upstream kinase(s) would poise the M A P K at the appropriate level of activation. Numerous recent reports have described the induction of M A P K activity in tobacco tissues by biotic and abiotic stimuli, but few of these kinases have been characterized in detail. The salicylate-induced protein kinase (SIPK) and wounding-induced protein kinase (WIPK) are not only the most extensively examined tobacco kinases, but they are notable for the range of stimuli to which they respond. Interestingly, these same stimuli are also associated with rapid ROS generation in the challenged tissue. This has led us to suggest that either SIPK, WIPK or both might be activated in response to a R O S burst, regardless of the nature of the intracellular ROS generator. In contrast to the anti-pERK analysis, which detected activation of both SIPK and WIPK by ozone, immunoprecipitation with anti-SIPK and anti-WIPK followed by in-gel kinase assays demonstrated clearly that ozone was activating almost exclusively SIPK. We suspect, therefore, that the commercial anti-pERK antibodies, which are raised against a synthetic phosphopeptide based on the rat ERK1/2 sequence, fortuitously have a much higher affinity for pWIPK than for pSIPK. Alternatively the in gel kinase activity of WIPK could be relatively weaker than SIPK. Since these proteins undergo denaturation and renaturation processes in the gel, and proper renaturation is absolutely essential for maintenance of activity, WIPK refolding might not be as effective as SIPK refolding for the catalytic function resulting in reduced in gel kinase activity. 61 Since ozone itself is destroyed almost immediately upon contact with the apoplast, damage in ozone-treated cells is thought to be a consequence of the disposition of the resulting organic ozonides and associated ROS. Ozone has been shown to elicit accumulation of H 2 O 2 (Schraudner et al., 1998; Pellinen et al., 1999), superoxide anion radical (Runeckles and Vaartnou, 1997) and hydroxyl radical (Grimes et al., 1983) in exposed plant tissues, but analysis of the physiological roles played by individual ROS species is complicated by both their intrinsic reactivity and rapid interconversion. Thus, superoxide anion dismutation rapidly produces H 2 0 2 , while superoxide and H 2 0 2 together can undergo an Fe 3 +-catalyzed reaction cycle that yields the highly destructive hydroxyl radical. In view of this interplay, any process that induces superoxide anion accumulation will also lead to a rapid increase in H 2 O 2 levels, initial events that will unleash a burst of oxidizing radicals within the cell. When cultured tobacco cells were exposed to either exogenous superoxide anion radical or H 2 O 2 , SIPK was strongly activated within the same time frame as seen with ozone treatment (Fig 2.6A). This activation was completely blocked by pre-incubation of the cells with radical trapping reagents such as mercaptopropionyl glycine (MPG) or N-acetyl cysteine (NAC), implying that the MAPK activation is a consequence of the creation of ROS by ozone. Exogenous H 2 0 2 has also recently been shown to activate ERK-type MAPKs in an MPG/NAC-sensit ive manner in animal cells (Guyton et al., 1996; Abe et al., 1998). Some insight into the sequence of events underlying this effect was provided by a recent study in mouse striatal neuron cells, where the activation of E R K by H 2 0 2 was found to 62 be blocked by the specific MEK1/2 inhibitor PD98059 (Samanta et al., 1998). A similar effect of PD98059 was found in tobacco cells treated with either ozone or H 2 0 2 in the present study (Figure 2.7A), and activation of SIPK / WIPK during the Avr9/Cf-9 interaction in transgenic tobacco plants was likewise abolished (Romeis et al., 1999). The activation of MAPKs by oxidants in both plant and animal cells therefore appears to result from an upstream redox event rather than from oxidative modification of the MAPK protein itself. The ability of a C a + + channel blocker to completely inhibit SIPK activation by H 2 0 2 or ozone indicates either that opening of C a + + channels is the critical redox-regulated upstream event, or that some step in the upstream process has an absolute requirement for elevated C a + + concentrations. Lanthanum was similarly effective in blocking SIPK / WIPK activation during the hypersensitive response (Romeis et al., 1999). Ozone exposure leads to a rapid and transient increase in internal C a + + levels in transgenic aequorin-expressing Arabidopsis plants (Clayton et al., 1999). Similar increases in internal C a + + levels have also been directly observed in transgenic aequorin-expressing tobacco cells following treatments (oligogalacturonic acid elicitor or hypo-osmotic shock) that also induced an oxidative burst (Chandra and Low 1997). C a + + channel blockers eliminated both the Ca + + t ransient and the ROS burst elicited by each treatment. C a + + fluxes also appear to be involved in activation of number of other plant MAPKs. On the one hand activation of a p47 MAPK in tobacco cells by fungal elicitor (xylanase) treatment (Suzuki et al., 1999), and of two tobacco MAPKs (46 and 50 kD) by cryptogein or oligogalacturonide elicitors (Lebrun-Garcia et al., 63 1998), was silenced by Ca + + channe l blockers. On the other hand, activation of a 49 kD tobacco protein kinase by harpin treatment (Adam et al., 1997) was not sensitive to these reagents, consistent with the observation that harpin also failed to induce a C a + + transient in aequorin-expressing tobacco cells (Chandra and Low, 1997). The nature of other upstream events that link the ozone-induced ROS burst to rapid activation of SIPK in tobacco remain to be defined. Activation by calyculin A treatment indicates the involvement of calyculin A-sensitive protein serine/threonine phosphatases in down-regulation of the kinase, a phenomenon known to occur in animal cells, where PP2A down-regulates the E R K pathway by acting at multiple points in the cascade (Millward et al., 1999). In plants, the tobacco p47 MAPK induced by fungal xylanase was also shown to be activated by treatment with calyculin A (Suzuki et al.,1999), whereas the two tobacco MAPKs (46 and 50 kD) activated by other elicitors were unaffected (Lebrun-Garcia et al., 1998). The lack of influence of vanadate, or of the nahG gene product, on SIPK activation by ozone / ROS argues against a central role for either protein tyrosine kinases or salicylate signalling between the primary oxidant species and SIPK. The latter point stands in contrast to the function implied by the name "salicylate-induced protein kinase" However, it is worth noting that SIPK activation in tobacco requires high levels of exogenously applied salicylic acid (Zhang and Klessig, 1997), and the resulting induction is far weaker than that induced by either ozone / ROS treatments (Figure 2.8 B,C) or the hypersensitive response 64 (Romeis et al., 1999). In terms of physiological relevance, therefore, this kinase might appropriately be re-named as the "ROS-induced protein kinase" (RIPK). As has been pointed out earlier (Zhang and Klessig, 1998) there are grounds to suspect that at least some of the other plant MAPKs reported to be 45 - 50 kD in size and to be elicitor- or wounding-induced represent orthologs of RIPK (SIPK). Taken together, these data point to a central and ubiquitous role for RIPK (SIPK) in transducing signals generated by any biotic or abiotic stress that triggers a burst of oxidant formation in plant cells. 65 CHAPTER 3 Solid-phase Phosphorylation Screening for Identification of Substrates for SIPK 3.1 Introduction A number of plant protein kinases have been reported that play a significant role in controlling cell growth, differentiation, development, defense and cell death. Of these kinases, MAP kinases have attracted the most attention in recent time due to their involvement in multiple pathways, and their rapid and transient activation by various stresses (Zhang and Klessig, 2001). To analyze and dissect the downstream effects of MAP kinase-catalyzed phosphorylation events, it is important to identify the immediate biochemical targets of each MAPK. Although numerous reports have recorded activation of plant MA P K s by various stresses, no physiological substrate for any of the known plant MAPKs has yet been identified in vivo or in vitro. This poses a formidable challenge for various reasons such as the low abundance of the phosphorylated proteins at physiological levels, the need for highly sensitive techniques, heterogeneous phosphorylation of the substrate and redundancy. Conventionally, substrates of specific kinases are identified through elaborate purification procedures using biochemical techniques that are time consuming and work intensive. More recently', several novel methods have emerged that use a combination of biochemical and molecular tools to identify kinase substrates or putative 66 consensus substrate motifs. (Skolnik et al., 1991; Songyang et al., 1994). Techniques such as immuno-screening of phage expression libraries with specific antibodies, and interaction cloning by using the yeast two-hybrid system are being routinely used to identify potential kinase substrates (Fazioli et al., 1993; Yang et al., 1992). To identify kinase targets more directly, Fukunaga and Hunter (1997) took advantage of the fact that proteins immobilized on a membrane can be phosphorylated by a soluble protein kinase with specificity similar to that observed in liquid-phase phosphorylation (Valtora et al., 1986). In their study, they used a phage cDNA expression library from which induced proteins were immobilized on a membrane (solid phase) and subsequently incubated with the specific kinase of interest, in the presence of radioactive ATP. A number of previously identified substrates were recovered using this procedure, as well as a novel substrate, thus validating the efficacy of the technique. In our attempt to identify putative substrates of SIPK, in situ solid phase phosphorylation screening, based on the technique of Fukunaga and Hunter, (1997) was performed using recombinant SIPK on a phage expression library prepared from tobacco leaf tissue. The results revealed that the recombinant SIPK is catalytically active, and is able to both autophosphorylate and efficiently catalyze phosphorylation of myelin basic protein (MBP) in solution. It was less effective at phosphorylating MBP immobilized on nylon filters. However solid-phase phosphorylation screening of the leaf library did not detect any positive clones after screening 30,000 plaques. 67 3.2 Materials and Methods 3.2.1. Cloning of SIPK 3.2.1.1 RNA extraction RNA was extracted from leaves of tobacco (4-6 weeks) (Xanthi nc.) using a RNeasy Plant Mini Kit (Qiagen) according to the manufacturer's protocol. Leaf tissue (~200 mg) was ground to a fine powder in liquid nitrogen, using a mortar and pestle. RLT buffer (450 uJ, containing guanidine isothiocyanate) from the kit was added to the ground tissue, which was then vigorously vortexed and applied to the QIA shredder spin column and centrifuged (2 min, 15,700 g). The filtrate was transferred to a new tube and 225 ju.l ethanol (100 per cent) added. The solution was mixed by pipetting and then applied onto an RNeasy mini spin column and centrifuged (15 sec, 9,300 g). Contaminants were removed by washing the column once with RW1 buffer (700 uJ) and twice with R P E buffer (500 uJ) followed each time by centrifugation (2 min, 15,700 g). The bound RNA was then eluted with 35 uJ RNase-free water and stored at -80°C. 3.2.1.2 RT-PCR The reverse transcriptase reaction was carried out using a First-strand cDNA Synthesis Kit (Amersham Pharmacia Biotech). A total of 2.5 - 5 u,g RNA were used in 15 uJ of the first-strand cDNA reaction. The RNA solution was heated for 10 min at 65°C and then placed on ice. The first-strand reaction mix (5 \x\ containing reverse transcriptase, RNA guard, RNase/DNase-free BSA, dATP, dCTP, dGTP and dTTP in aqueous buffer) was added to the tube containing the denatured RNA. One u.l each of DTT (200 mM) and oligo dT primer (0.2 u.g) were 68 also added to the reaction mix, which was then mixed by pipetting several times, and incubated for 1 h at 37°C. The P C R reaction contained 2.5 uJ of first-strand cDNA, 40 pmole each of forward and reverse SIPK gene-specific primers (table 3.2), 1.5 uJ 50 mM MgCI 2, 4.0 ul dNTP 2.5 mM, 0.3 uJ Taq DNA polymerase 5 U / L I I , 5 uJ 10X P C R buffer (200 mM Tris-HCI (pH 8.4) and 500 mM KCI) and sufficient water to bring the final volume to 50 ul. The P C R reaction was performed in a Biometra T-gradient thermo cycler, using the following thermal cycling regime: 1 cycle of 94°C for 5 min; 10 cycles of 94°C for 1 min, 52°C for 1 min; 72°C for 1 min; followed by 20 cycles of 94° C for 1 min, 56°C for 1 min; 72°C for 1 min; and 1 cycle of 72°C for 10 min. The P C R amplification product was analyzed by 0.7 % agarose gel electrophoresis. 3.2.1.3 Cloning of SIPK in pGEX4T-3 The PCR-amplified fragment was gel purified using a Gibco 'Concert Kit' and digested with the restriction enzymes EcoR I and Xhol. The SIPK amplicon was ligated in the multiple cloning site of the expression vector pGEX 4T-3, which was pre-processed using EcoR I and Xho I followed by dephosphorylation and gel purification. Before ligation, vector and insert fragments were each electrophoresed alongside a mass ladder to quantify the amount of DNA to be used for the ligation reaction. The ligation product was then introduced into £. coli competent cells (DH5a) using the heat shock method (Sambrook et al., 1989). The cells were plated on LB medium containing ampicillin (50 mg/l), and 69 incubated overnight at 37° C. The following day, single colonies were picked and suspended in 3 ml LB medium containing ampicillin (50 mg/l) and incubated overnight at 37 °C in a gyratory shaker (150 rpm). Plasmid DNA was then isolated from the actively growing E. coli cells using the mini-plasmid prep method of Zhou et al. (1990). The presence and orientation of the desired insert cDNA sequence was confirmed by restriction digestion analysis (using restriction enzymes EcoRI and Xhol). 3.2.2 Activation loop mutants of SIPK Mutations in the activation loop of SIPK were introduced using a PCR-mediated approach, taking advantage of the unique Nhel restriction site close to the activation loop. The mutational primers (Table 3.2) were designed so that the mutant form would code for either A E F or EED instead of T E Y at amino acid positions T218 and Y220. The SIPK mutant gene constructs were then cloned into p G E X 4T-3 through a three-piece ligation procedure. The different constructs were fully sequenced at the NAPS (Nucleic Acid and Protein Service, UBC) unit, to confirm the changes and the absence of mismatches. Table 3.1 Activation loop mutants of SIPK Mutant Template used Parent sequence Mutant sequence AEF-SIPK SIPK T218 Y220 A218 F220 EED-SIPK SIPK T218 Y220 E218 D220 70 Table 3.2 Mutational primers used for SIPK mutation Mutation Primer Sequence Wild type SIPK SIPK-forward SIPK-reverse 5' G g a a t t c C A T G G A T G G T T C T G G T C A G C A G A C G G A 3 ' 5 'CCGctcgagATTCACATATGCTGGTATTCAGGAT TAAATGC3 ' TEY to A E F SIPK (AEF) forward SIPK reverse 5 'CTAgc tagcTCGTGTCACTTCTGAAACTGAC 1 1 1 A T G G C G G A A T 7 T G T T 3' 5 'CCGctcgagATTCACATATGCTGGTATTCAGGAT TAAATGC3 ' TEY to EED SIPK (EED) forward SIPK reverse 5 'CTAgc tagcTCGTGTCACTTCTGAAACTGAC 1 1 1 A T G G A G G A A G A T G T T 3' 5 'CCGctcgagATTCACATATGCTGGTATTCAGGAT TAAATGC3 ' 3.2.3 Purification of recombinant fusion proteins The recombinant GST-fusion proteins were expressed in E. coli BL 21 cells (250 ml) by induction with 0.1 mM IPTG for 4 h at 25° C, and then extracted and purified according to the manufacturer's protocol (Amersham Pharmacia). The purification procedure is as follows. The induced cells were pelleted at 12,000 g followed by resuspension in 2.5 ml of suspension buffer (25 mM Tris-HCI pH7.5, 150 mM NaCl , 1 mM p-mercaptoethanol in the presence of one protease inhibitor cocktail tablet /10 ml of suspension buffer). Lysozyme solution (10 ul of 10 ug/ml) was added to the resuspended cells and allowed to incubate on ice for 30 min, followed by addition of 10 ul DNAse l (10 ug/ml) in the presence of 5 mM MgCI 2 . The cells were then subjected to a freeze-thaw (4X) procedure, involving 71 freezing in liquid nitrogen followed by thawing in a 37° C water bath. To the lysed cells NP-40 (100 uJ of 10% solution) was added and this mixture was allowed to rotate in a rotary shaker at 4°C for 15 min followed by pelleting the debris at 12,000 g. The cleared supernatant was subjected to batch purification using glutathione-Sepharose 4B beads provided by the manufacturer (Amersham Pharmacia Biotech). Beads (150 - 200 u.l) were added to the supernatant and allowed to rotate in a rotary shaker at 4°C for 3 h. After binding, the beads were pelleted at 12,000 g, followed by 3 washes with 1X P B S (150 mM NaCl , 10 mM sodium phosphate, 1 mM sodium dihydrogen phosphate). The bound recombinant proteins were then eluted using 400 uJ. 10 mM reduced glutathione (GSH) in Tris-HCI pH 8. The protein concentration was determined according to the method of Bradford (1976), using a Protein Assay Kit (Bio-Rad, Mississauga, Ontario). The protein extracts were stored at -80°C. 3.2.4 In vitro kinase assays GST-fusion proteins (5 u.g) of the wild type and mutant S IPK-AEF were incubated with 5 |ag MBP and 10 uCi [y-32P] labelled ATP (>5000Ci/mmol) (Amersham Pharmacia) in a 20 jJ reaction mixture (20 mM H E P E S (pH7.5), 5 mM MgCI 2, 1 mM EGTA, 5 mM p-mercaptoethanol, 2 mM N a 3 V 0 4 , 20 mM p-glycerophosphate) at 30°C for 30 min. The reaction was stopped with 5X SDS loading buffer (0.625 M Tris-HCI pH 6.8, 5% S D S , 40% glycerol, 0.125% bromophenol blue, 40% v/v p-mercaptoethanol) and the samples were resolved on a 15% polyacrylamide gel, blotted onto a nylon membrane (immobilon-P) and visualized by autoradiography. For in vitro substrate assays (Figure 3.5), either 72 crude protein extracts (40 ug) or anti-SIPK immunoprecipitated proteins extracted from untreated and ozone-treated tissues, respectively, were subjected to an in vitro kinase assay as described earlier, using 20 ug protein from untreated or ozone- treated tissue as the substrate. 3.2.5 Autophosphorylation of GST-SIPK The autophosphorylation of GST-SIPK (250 ug) was carried out in 1 ml assay buffer (20 mM H E P E S (pH7.5), 5 mM MgCI 2 , 1 mM EGTA, 5 mM p-mercaptoethanol, 2 mM N a 3 V 0 4 , 20 mM p-glycerophosphate) in the presence of 25 uM ATP, at 30°C for 30 min. The reaction mixture was then added to 10 ml assay buffer without A T P and the proteins were concentrated by centrifuging through a Centricon (10 kD cut-off) (Amersham Pharmacia Biotech) column. The concentrated proteins were quantified using Bradford assay. 3.2.6 Tobacco cDNA library screening through solid phase phosphorylation The X- Z A P II tobacco cDNA library prepared from tobacco leaves was a generous gift from Dr. Carl Douglas (UBC). The cDNA library was plated on E. coli, (XL1 Blue strain) at a density of 4 X 10 3 plaques per 90 mm agar plate. After incubation for 4 h at 37°C, when the plaques started to appear, the plates were overlaid with nitrocellulose membrane filters (BA85, Schleicher & Schuell) that had been impregnated with 10 mM inducer (isopropyl- p-thiogalactopyranoside ; IPTG). After further incubation of the plates at 37°C for another 6-10 h, the filters were peeled off without disturbing the plaques, and immersed in blocking solution (20 mM Tris-HCI (pH 8.0), 150 mM NaCl, and 3% BSA) and gently agitated at room temperature for 2 h. The blocked filters were washed three times for 20 min 73 in TWB (Triton wash buffer; 20 mM Tris-HCI (pH 7.5), 150 mM NaCl, 10 mM EDTA, 1 mM EGTA, 0.5% Triton X-100, and 1 mM dithiothreitol (DTT) One tablet of protease inhibitor cocktail (Boehringer Mannheim) was used for every 10 ml of TWB solution) and rinsed for 10 min in MRB (MAPK reaction buffer; 20 mM H E P E S - N a O H (pH 7.5), 10 mM MgCI 2 , 50 uM N a 3 V 0 4 , 5 mM p-glycerophosphate, 5 mM NaF, 2 mM DTT, 0.1% Triton X-100). The filters were then incubated for 60 min at room temperature in MRB containing 25 uM unlabelled ATP to mask proteins, that could have autophosphorylating and/or ATP binding activities. Following washing for 10 min in the MRB without ATP, filters were incubated in individual trays for 60 min at room temperature with gentle shaking in MRB (8 ml of solution per blot) containing 10 uM unlabelled ATP, 5 uCi/ml [y-32P] A T P and 10 ug/ml purified GST-SIPK. The filters were then washed six times (5 min each) in MWB (MAPK wash buffer; 20 mM Tris-HCI (pH7.5), 150 mM NaCl , 10 mM EDTA, 1 mM EGTA, 20 mM NaF) containing 0.1% Triton X-100, and then once for 10 min in MWB without Triton X-100. The washed filters were air-dried and exposed to X-ray films for 24-48 h at -70°C with intensifying screens. Putative positive clones were numbered and the corresponding plaques were scooped out using the wide end of a pipette tip and placed in 500 pi S M buffer (50 mM Tris-Hcl pH 7.5, 0.01% gelatin, 1 mM MgSO 4 .7H20, 100 mM NaCl) and 10 pi chloroform. Plaques recovered in this fashion were then titred and subjected to a secondary screen. As a preliminary reconstitution of the experiment immobilized substrate phosphorylation (Figure. 3.3) assays using MBP and GST-SIPK proteins were performed by spotting 74 various concentrations of these proteins on a nylon membrane and following the same procedure as described above for the solid phase phosphorylation screening. 3.3 Results 3.3.1 Recombinant GST-SIPK proteins are altered in their kinase activity In vitro kinase assays of recombinant GST-SIPK and its mutants (Figure 3.1.2) using M B P as the substrate, demonstrated active phosphorylation of M B P when wild type GST-SIPK was used. In contrast, substantially reduced MBP phosphorylation was observed when either the constitutively active E E D mutant or the dominant negative A E F mutant was used, with the A E F form showing least activity towards M B P (Figure.3.2). Surprisingly, all three recombinant proteins also showed autophosphorylation activity (Figure 3.2). Incorporation of labelled-phosphate was detected in the recombinant activation loop mutants in spite of changing the canonical phosphorylation sites (TEY) to either E E D or A E F . This indicates the presence of additional phosphorylation sites in SIPK. 75 c ? & 8 GST-SIPK: 10 ug 112 kD — | 82 kD k GST-SIPK 49.9 kD — 36 kD — Figure 3.1 Recombinant GST-SIPK fusion proteins. Coomassie-stained S D S -P A G E gel showing purified GST-SIPK recombinant fusion proteins. MBP 112 kD 82 kD 49.9 kD * A Cj Co GST-SIPK: 5 ug MBP : 5 ug GST-SIPK MBP Longer exposure GST-SIPK Figure 3.2 GST-SIPK activation loop mutants are affected in their catalytic eff iciency. Recombinant GST-SIPK fusion proteins were subjected to an in vitro kinase assay using MBP as the substrate, followed by separation in a 15% S D S -P A G E gel, blotting and autoradiography. 7 6 3.3.2 GST-SIPK is able to perform solid phase phosphorylation To determine whether immobilization of proteins might interfere with SIPK activity GST-SIPK and M B P proteins were spotted at various concentrations on a nylon membrane and were allowed to be phosphorylated with either GST-SIPK or phospho GST-SIPK (Figure 3.3). Autoradiography revealed that immobilized GST-SIPK served as a better substrate than MBP, and that there was no apparent difference in the phosphorylation efficiency if GST-SIPK was subjected to autophosphorylation prior to probing the substrates. Similarly spotted blots incubated with only [y3 2P]-labelled ATP did not show any signals indicating that SIPK phosphorylation is intermolecular, while M B P which is the standard substrate for MAPK, showed little or no phosphorylation. The presence of increased background signals indicated that nitrocellulose membranes might be a better alternative. SUBSTRATE MBP-4 GST-SIPK J MBP -J GST-SIPK M 2.5 1.2 0.6 0.3 0.15 0.075 Protein concentration (ug) KINASE Phospho GST-SIPK GST-SIPK Figure 3.3 GST-SIPK is less effective in phosphorylating immobilized substrate. SIPK substrates MBP and GST-SIPK were spotted at different concentrations on a nylon membrane and subjected to solid-phase phosphorylation with either GST-SIPK or phosphorylated GST-SIPK. Arrows 77 indicate positive signals. * highest concentration of MBP revealed weak signals (visible on the original image) 3.3.3 Solid-phase phosphorylation with cDNA expression library from tobacco In spite of the negative results observed with immobilized M B P phosphorylation by SIPK, it was assumed that there could be other potential substrates that could be more efficiently phosphorylated by SIPK in an immobilized form. I therefore proceeded with the solid-phase screening procedure as described in the methods. Screening of 30,000 plaques yielded a number of positive signals (-25). These plaques were isolated and phages from the most intense signals (-12) were used in a secondary screen (Figure 3.4). The secondary screen revealed a pattern of signals similar to that seen in the primary screen, in that most of the plaques turned out to be negative, with a low percentage of positive signals. Screening of membranes using the same procedure in the absence of GST-SIPK did not reveal any signals. PRIMARY S C R E E N S E C O N D A R Y S C R E E N using plaque #5 78 Figure 3.4 Solid phase phosphorylation of tobacco cDNA expression library by GST-SIPK. Proteins expressed from approximately 4000 plaques/plate from a X ZAPII tobacco cDNA expression library, were subjected to solid-state phosphorylation using 80 ug GST-SIPK/membrane, followed by autoradiography. Positive plaques from the primary screen were replated (~2000/plate) and subjected to a secondary screen. Representative blots are shown. Since use of the solid-phase screening was not helpful, I resorted to a liquid-phase phosphorylation procedure. Native SIPK from tobacco leaf protein extracts was immunoprecipitated using a SIPK-specific antibody, and used in an in-solution kinase assay. The immunoprecipitated protein was allowed to phosphorylate any putative substrate(s) that might be present in protein extracts from either stressed or un-stressed tobacco leaf tissue. This assay also did not reveal any signal. SIPK autophosphorylation was effective but the phospho-SIPK was the only major phosphorylated protein detectable in the autoradiography. In fact, the autophosphorylation of SIPK was inhibited in the presence of the crude protein extracts (Figure 3.5). 79 112 kD 82 kD 49.9 kD — 36 kD -29 kD-46 kD Figure 3.5 Screen for identifying S i P K substrates in total protein extracts. SIPK was immunoprecipitated from either untreated or ozone-treated tobacco cell cultures using SIPK-specific antibodies and subjected to an in-solution kinase assay. Protein extract (20 u.g) was incubated with immunoprecipitated SIPK and [y- 3 2 P] labelled ATP, followed by separation in a 15% S D S - P A G E gel, blotting and autoradiography. 3.4 D iscuss ion Protein phosphorylation plays an important role in plant stress response pathways although only a few protein kinases have been specifically implicated in influencing these responses. Novel protein kinases are being rapidly identified in plants through homology-based cloning, genetic screens or genome searches. However, the identification of direct targets of any of these kinases has proved to be an elusive goal. There are several reasons for this including the unavailability 80 of consensus sequences for substrates of plant kinases, redundancy of substrates, overlapping substrate specificity among protein kinases and general lack of efforts to pursue time-consuming biochemical searches for substrates. Yeast two-hybrid screening is now a standard technique for identification of putative interactors for novel proteins, including kinases. In plants, using SIPK as the bait Liu et al. (2001) reported an interacting protein that they identified as a M A P K K (SIPKK). Wounding and TMV infection transcriptionally induced SIPKK expression, and also led to rapid and transient activation of SIPK. However, although SIPKK interacted and co-immunoprecipitated with SIPK it was unable to phosphorylate SIPK in vitro (Liu et al., 2001). Similar results were observed in alfalfa where P R K K was identified as a MAPKK that interacted with SIMK (SIPK ortholog) but was unable to phosphorylate SIMK in vitro (Cardinale et al., 2002). A similar two-hybrid screen had identified a SIMK-interacting and phosphorylating M A P K K (SIMKK) (Kiegerl et al., 2000). Although these screens were useful in identifying upstream activators, they failed to recover physiological substrates for either SIPK or SIMK, indicating that the MAPK-substrate interaction might require other protein partners, or a specific pattern of upstream SIPK-activation by another kinase, or that the SIPK-substrate interaction is too transient and/or weak. To more directly identify the putative substrates of SIPK, I therefore tried a novel solid-phase phosphorylation screen using a tobacco cDNA expression library (Fukunaga and Hunter, 1997). For this purpose, I cloned and expressed SIPK as a GST-fusion protein. However, the lack of known upstream kinases for SIPK at the time of this study, 81 combined with the large amounts of active SIPK protein needed for the phosphorylation screening, meant that generating sufficient activated SIPK would be challenging. I was therefore prompted to examine the possibility that converting the SIPK phosphorylation sites (TEY) to acidic amino acids, might result in a constitutively active form of SIPK. However, when the T E Y to EED constitutively active SIPK mutant was subjected to an in vitro kinase assay it proved to be less active than the wildtype enzyme, indicating that the phosphorylation-mediated conformational change is a complex event and cannot be emulated by merely replacing the phosphorylation sites with acidic residues. It has been suggested that the flexibility and complex rearrangement of the phosphorylation lip may be the reason why substitution of the threonine and tyrosine with acidic residues does not fully activate a M A P kinase (English et al., 1999). Although the wild type GST-SIPK protein kinase activity levels were somewhat reduced, relative to the activity levels of immuno-precipitated SIPK from ozone-treated cell extracts (data not shown), they were sufficient to allow me to proceed with the solid-phase phosphorylation screen. When the procedure was tested in a simulated reconstruction of the immobilized screen using MBP, a strong in-solution substrate, there was a little or no phosphorylation of MBP, although immobilized GST-SIPK did serve as a substrate for the GST-SIPK. This negative result was unexpected, since it had been predicted that kinase substrates would behave the same way whether in solution or immobilized on a membrane (Valtora et al.,1986). Although MBP did 82 not prove to be a suitable solid-phase substrate, GST-SIPK was phosphorylated both in solution or when immobilized. Solid-phase phosphorylation screening of the expression library did yield a number of positive signals, but none of the twelve that were re-screened proved to be positive. A considerable number of plaques (-30,000) were examined in the primary screen to identify possible positives, which represents a large sampling of the library, although it was not an exhaustive survey. The absence of consistent positive signals in the secondary screen, and absence of background noise in the absence of GST-SIPK kinase probe, indicated that the primary signals might reflect phospho-GST-SIPK artefactually binding to the membrane. The reported inability to identify any MAPK substrates through yeast two hybrid screens (Liu et al., 2001), as well as my results, points to the possibility that other interacting proteins may be necessary for potentiating SIPK to interact with and phosphorylate downstream targets. A number of MAPK scaffold proteins have been reported in mammalian systems that appear to channel the signal through specific components of the cascade, a process that has been suggested to help maintain signalling specificity (Kyriakis and Avruch, 2001). Even if the SIPK-substrate interaction is weak and transient, and the yeast two-hybrid screen is not sensitive enough to detect it, the solid-phase screen should have overcome this deficiency. The technique is phosphorylation-dependent and relies on catalytic generation of radioactive signals, which in principle generates a highly sensitive assay. However, my observations concerning the suitability of immobilized substrates on the membrane indicates that the immobilization might 83 mask crucial residues and prevent them from interacting with SIPK during the screening. Finally it remains possible that the physiological targets of SIPK are only rarely represented in a leaf cDNA library. In this case, much more extensive screening of the library might have produced a true positive. Alternative approaches to identifying SIPK substrates therefore need to be explored. The classical approach would use an in vivo stimulation combined with biochemical purification monitored by direct assays with active SIPK. A more comprehensive proteomics approach would be to follow the phosphorylation pattern of different proteins in a stimulated cell through use of 2D-gel electrophoresis followed by mass spectrometry. Following flagellin (a bacterial peptide) elicitation of cells incubated in radiolabeled 3 2 P , Atphos43 was identified as a protein in Arabidopsis that was phosphorylated rapidly (Peck et al., 2001). However, since multiple kinases are involved in any stress signalling, it would be difficult to identify the phosphoprotein product synthesized by a particular kinase like SIPK using this procedure. One way to improve this approach would be to use transgenic lines where activation of SIPK is eliminated, and compare protein phosphorylation profiles between the wild type and the transgenic line. Another alternative would be to over-express a mutated version of SIPK, modified so that it can accept an analog of radiolabeled A T P that cannot be used by other kinases in the system. Such a transgenic line, if elicited in the presence of the radiolabeled A T P analog, would reveal a pattern of radiolabeled proteins after a 2D gel electrophoresis, which can only be substrates of SIPK and not of any other kinase in the system. This technique was used in a mammalian 84 system, where the A T P binding site of v-Src was mutated to allow the engineered v-Src to uniquely accept an ATP analog, t h e mutated kinase had catalytic efficiency similar to that of the wild type enzyme, which did not accept the N(6)-(cyclopentyl) A T P analog (Shah et al., 1997; Witucki et al., 2002). Approaches of this sort could directly reveal what molecules SIPK talks to as it controls the signal output from the cascade. A more indirect approach would identify gene transcription events that appear, based on rapidity of response, to be immediately controlled by the activation of SIPK. Analysis of the c/'s-element structure of the promoters of such genes might reveal common motifs that could point to known (or yet to be discovered) trans-acting regulatory proteins. Such regulators have a high possibility of being the direct targets of activated SIPK. 85 CHAPTER 4 Both Over-expression and Suppression of Salicylate-induced Protein Kinase (SiPK) Render Tobacco Plants Ozone-sensitive 4.1 Introduction MAPK modules form a key part of the eukaryotic signal transduction network that links environmental inputs to a wide range of modifications of cellular functions, ranging from cell division to cell death. In plants, M A P K signalling has been implicated in defence against pathogens and herbivores, in cellular responses to auxin, ABA, and other phytohormones, in cell cycle control, in the induction of programmed cell death and in responses to abiotic stresses such as UV and ozone (Romeis et al., 1999; Stratmann et al., 1997; Kovtun et al., 1998; Heimovaara-Dijkstra et al.,2001; Zhang and Kelssig, 1997; Nishihama et al., 2001; Yang et al., 2001; Miles et al., 2002) A variety of stress responses have been found to involve rapid activation of a specific subset of plant MAPKs, notably Arabidopsis MPK6 (Yuasa et al., 2001; Nuhse et al., 2000, Ichimura et al., 2000) and its orthologs in other species, such as SIPK (salicylic acid-induced protein kinase) in Nicotiana (Zhang and Klessig, 1998a; 1998b; Zhang et al., 2000; Romeis et al., 1999; Mikolajczyk et al., 2000) and SIMK (salt-stress-induced MAPK) in alfalfa (Cardinale et al., 2000). Since many biotic and abiotic stressors (virus infection, treatment with microbial elicitors, wounding and osmotic stress) elicit a very rapid oxidative burst in plant cells, the apparent 86 convergence of disparate stress signals upon this particular M A P K node may be related to the sensitive response of MPK6/SIPK to redox perturbation. Exposure to ozone immediately creates an oxidizing environment in plant tissues, and triggers an array of cellular responses, including accumulation of antioxidants, elicitation of pathogenesis-related proteins, deposition of phenolics, induction of ethylene synthesis, suppression of primary metabolic activities such as photosynthesis, and eventually, cell death (Darrall, 1989; Sharma and Davis, 1997, Tuomainen et al.,1997; Conklin and Last, 1995; Schraudner et al.,1992). One of the earliest responses elicited by R O S generators in plants is the activation of specific MAPKs (Desikan et al., 2001; Kovtun et al., 2000). The primary ROS-activated tobacco MAPK has been identified as the 46 kD SIPK while a second MAPK, the 44 kD WIPK (wound-induced protein kinase) usually responds more weakly (Chapter 2; Kumar and Klessig, 2000). The rapid activation of these MAPKs indicates that their action on downstream targets could be important for modulation of the cellular response to increased oxidative damage, but direct evidence for that role is lacking in plants. No intracellular substrates have been identified for either SIPK or WIPK, nor have loss-of-function genotypes been assessed for their ability to control redox stress. Stable over-expression or suppression of SIPK or WIPK in transgenic tobacco apparently did not result in alteration of its activity (Yang et al., 2001). In contrast, transient over-expression of SIPK or its upstream activator, NIMEK2, in an active form has been shown to lead to the activation of either SIPK, or both SIPK and WIPK, with associated induction of defense genes and HR-like cell 87 death (Yang et al., 2001; Zhang et al., 2001). The authors suggest that SIPK may play a role as a positive regulator in the cell death pathway. Analysis of plant signalling cascades is often difficult because the key regulators are functionally redundant, expressed at low levels or have indispensable roles for cell viability (Kovtun et al., 2000). The previously reported inability to produce SIPK-suppressed lines, and lack of phenotype or alteration of SIPK activity reported for over-expression lines (Yang et al., 2001), have indicated that normal functioning of this kinase may be essential for cell survival. However, we report here the recovery and analysis of transgenic tobacco plants in which SIPK is either ectopically over-expressed, or largely eliminated by use of RNAi technology. These plants display distinctive ozone-response phenotypes that confirm the importance of SIPK activation for effective control of ROS damage control, and also reveal an unexpected interplay between the activities of SIPK and WIPK. 4.2 Materials and Methods 4.2.1 Plant material and treatment Tobacco {Nicotiana tabacum) plants of all genotypes were grown for six weeks in soil under controlled environmental conditions (25/20° C 16h light/8h dark) and then exposed to ozone (500 ppb) as described in Chapter 2. Ozone was generated with a Delzone ZO-300 Ozone generating sterilizer (DEL industries) and monitored with a Dasibi 1003-AH ozone analyzer (Dasibi Environmental Corp.). After exposure for different times, the third and fourth leaves were 88 harvested, immediately frozen in liquid nitrogen and stored at -80° C to await analysis. 4.2.2 Site-directed mutagenesis and recombinant protein production Wild type GST-SIPK and GST-SIPK (AEF) plasmids were used as the parent plasmid templates for a site-directed mutagenesis procedure based on the Stratagene Quikchange kit. Gene-specific complementary mutational primers were designed such that they would mutate GST-SIPK to GST-SIPK (K89R) and GST-S IPK-AEF to GST-SIPK-AEF (K89R) (Table 4.1). The oligonucleotide primers, each of them complementary to opposite strands of the vector, were added to 10 ng parental plasmid DNA along with 5 ul 10X reaction buffer, 125 ng each primer, 1 ul dNTP mix, and 3 ul Quik solution. The total volume was brought up to 50 ul with nuclease-free water followed by the addition of 1 ul Pfu Turbo DNA polymerase (2.5 U/ul). P C R was performed (95°C for 1 min, 18 cycles of 95°C for 50 sec, 60°C for 50 sec, and 68°C for 18 min, followed by a final extension of 68°C for 7 min). After temperature cycling, the product was treated with Dpn I (10 U) for 1 h at 37°C, to digest the parental DNA. About 2 ul of the reaction mix were transformed into E. co//'XL1-Blue cells and plated on LB medium containing 50 ug/ml ampicillin, 80 ug/ml X-gal and 20 mM IPTG. The plates were incubated overnight at 37°C, and selected white colonies were screened for mutation through DNA sequencing. The recombinant proteins were produced as described in Chapter 3.2.1.4, after transforming the E.coli BL21 cells with the mutant plasmids. The different constructs were fully sequenced to confirm the changes and the absence of mismatches. 89 4.2.3 Rl (intron spliced hairpin loop RNA)-SIPK construct The double-stranded RNA interference construct was tailored through a P C R -mediated approach by using the N-terminal sequence of the SIPK ORF. A minimal intron based on the splice junctions and flanking regions of the fourth intron of ATMPK6 (the Arabidopsis ortholog of SIPK) was incorporated into the sense strand primer. The sense strand was then amplified using a primer combination that generated an EcoR I cleavage site and intron-Xba / sequence on the opposite ends of the product, while the antisense strand was amplified using a primer combination that added BamH I and Xba I sites on the opposite ends of the product (Table 4.1; Figure 4.10). These two products were directionally cloned into EcoR I /BamH I -processed Bin19/pRT101 through a triple ligation, which placed the RNAi construct under the control of the CaMV 35S promoter (Figure 4.3A) Table 4.1 Primers used for SIPK mutation and RNAi construct design Construct Primer Sequence SIPK (K89R) SIPK(K89R)-forward SIPK(K89R)-reverse 5 ' G T A G C G A T A A G G A A A A T C G C A A A T 3 ' 5 'ATTTGCGATTTTCCTTATCGCTAC3 ' RNAi (sense) S1:Sense-Forward S2:Sense-intron-Reverse 5' G g a a t t c C A T G G A T G G T T C T G G T C A G C A G A C G G A 3 ' 5' GCtc taqaCTATGAGCTGCAAAAACTACTTA (intron) C C T C G C T A G C C C A A A A T C A C A T A T C I I IAAA3' 90 RNAi (antisense) AS1:Antisense-Forward AS2:Antisense- . Reverse 5' C G g g a t c c A T G G A T G G T T C T G G T C A G C A G A C G G A 3' 5' GCtc tagaGCTAGCCCAAAATCACATATCTT T3' S1 p- AS1 I SIPK | | SIPK I — I ^S2 N I 1 E I X B X 1 1 SIPK |irt| I + II SIPK I I EcoR 1 Bam H 1 pBIN19/pRT101 B Bam H1 X Xba 1 E £coR1 int intron Figure 4.10 Schematic diagram describing construction of the SIPK-RI construct 91 4.2.4 Binary vector construction and plant transformation The different SIPK overexpression constructs were tagged with a C-terminal FLAG epitope through a PCR-mediated approach (Flag-SIPK-Reverse primer) 5' CGggatccTCACTTGTCA T C G r C G T C C T T G r A G T C C A T A T G C T G G T A T T C A G G A TTAAA 3'), followed by ligation (Chapter 3.2.1.3) into the plant expression vector, Bin19/pRT101, which contains an npt II selectable marker. All the constructs were sequenced to confirm the presence of appropriate changes (Figure 4.11). The recombinant binary vector was used to transform competent A. tumefaciens (EHA105) cells by a freeze-thaw transformation procedure (Holsters et al.,1978). SIPK-KI-AEFf 35S Pro TEY-AEF mmmcaMVooivA SIPK-ORF m K89R Figure. 4.11. The various SIPK constructs used in the transformation procedure are shown as seen in the multiple cloning site of the vector pBIN19/pRT101, flanked by the CaMV 35S promoter and the poly A tail. 92 >4gro£>acter/'um-mediated transformation of tobacco (Xanthi. nc.) was performed using a standard leaf disc co-cultivation procedure (Horsch et al., 1985). Tobacco leaf discs were prepared from tissue culture-grown plants, avoiding the major leaf veins. Leaf discs were pre-incubated abaxial (bottom) side down on shoot induction medium (SIM) (Appendix A) for one day. Agrobacterium tumefaciens strain EHA105 containing a transformation vector was grown overnight (28° C) in LB medium containing 50 ug/ml each of kanamycin and rifamycin. The cultured cells were collected by centrifugation for 30 min in a tabletop centrifuge at 1413 g. The bacterial pellet was then resuspended in basal MS medium containing 100 uM acetosyringone and diluted to 0.3-0.4 OD 6 oo- The cells were induced by incubation for 1 h on a gyratory shaker (60 rpm: 25°C). Leaf discs were then placed in the induced bacterial suspension and incubated for 10 min on a gyratory shaker (60 rpm). The leaf discs were subsequently blotted dry on sterile filter paper and incubated on SIM for two days in the dark. For selection, explants were cultured on SIM containing carbenicillin (500 mg/l), cefotaxime (250 mg/l) and kanamycin (100 mg/l) (SIMCCK) (Appendix A) and incubated for 4 weeks in the light. Within two weeks, numerous shoot buds developed from the edges of the leaf discs. After four weeks, elongated shoots (2.0 cm) were cut and transferred to root induction medium (RIM) containing carbenicillin (500 mg/l), cefotaxime (250 mg/l) and kanamycin (100 mg/l) (RIMCCK) (Appendix A). The shoots of putative positive plants usually rooted within 2-3 weeks. 93 Putatively transformed plantlets that rooted and tolerated this concentration of antibiotic were screened by P C R using 35S forward, and gene-specific reverse, primer combinations. Positives were then also screened through Western blots (see below) using an anti-FLAG antibody for the SIPK overexpression lines, and anti-SIPK antibodies to assess the Rl suppression lines. The confirmed transgenic lines were transferred to soil, grown to maturity and seeds collected. The T1 seeds were germinated on !4 strength MS with 50mg/litre kanamycin, and antibiotic-resistant T2 plants were then transferred to soil and grown under controlled conditions. 4.2.5 Genomic DNA extraction and PCR analysis of putative transformants Leaves of in wYro-grown tobacco plantlets were ground in 500 ul extraction buffer (100 mM Tris pH 8.0, 50 mM EDTA, 500 mM NaCl, 0.2% (v/v) p-mercaptoethanol) using a fitted plastic disposable pestle in an Eppendorf tube (1.5 ml). Ten percent S D S (66 ul) was added to the ground tissue, which was then vortexed and incubated at 65°C for 10-30 min. Cold 5 M KOAc (170 ul) was added, mixed by inverting the tubes 10 times and centrifuged (10 min, 15,500xg). The supernatant was transferred to a new tube and 4 uJ RNAse A (10 mg/ml) added. The solution was mixed by inverting the tube five times, after which it was incubated for 30 min at 37°C. To precipitate the DNA from the mixture, 400 ul isopropanol were added, mixed and incubated for 20 min at -80°C. The frozen solution was thawed and centrifuged (15 min, 15,700 g). The pellet was washed with cold 70% EtOH, air-94 dried for 30-40 min, re-dissolved in 50 u.1 distilled water and incubated for 5 min at 65°C. The DNA concentration was determined by measuring its absorbance at 260 nm and the DNA solution was stored at -20°C. Putative transgenics were detected through P C R using a forward primer specific to the CaMV 35S promoter sequence together with a gene-specific reverse primer (Table 4.2). The P C R reaction (50 u.1) contained 200 ng genomic DNA or binary vector (pBin19/pRT 101) (50 ng) carrying the appropriate construct as positive control for P C R , 40 pmole each of forward and reverse primer, 1.5 ul 50 mM MgCI 2 , 4.0 uJ dNTP (2.5 mM), 0.3 uJ Taq DNA polymerase (5 U/ul) and 5 ul 10X P C R buffer (200 mM Tris-HCI, pH 8.4 and 500 mM KCI). The P C R reaction was performed in a Biometra T-gradient thermo cycler, using the following thermal cycling regime: 1 cycle of 94°C for 5 min; 30 cycles of 94°C for 1 min, 56°C for 1 min; 72°C for 1 min; and 1 cycle of 72°C for 10 min. The P C R amplification product was analyzed by 0.7% agarose gel electrophoresis. Table 4.2 Primers used for screening putative positives Target gene Primer Sequence SIPK-overexpressors 35S-For SIPK-Rev 5 ' A T G A C G C A C A A T C C C A C T 3 ' 5 ' C C G C T C G A G A T T C A C A T A T G C T G G T A T T C A G G A TTAAATGC3 ' SIPK-RNAi 35S Intron-Rev 5 ' A T G A C G C A C A A T C C C A C T 3 ' 5' GCTCT AGACTATGAGCTGCAAAAACTACTTA C C 7 C G C T A G C C C A A A A T C A C A T A T C T T T A A A 3 ' 95 4.2.6 Transient transformation using Agroinfiltration Four to six-week old wild type tobacco plants (Xanthi nc.) were used for infiltration experiments. This involved leaf infiltration of Agrobacterium culture (0.8 OD6oo) carrying the various constructs or a mixed culture (0.4 OD6oo) of Agrobacterium EHA 105 containing the SIPK-FLAG overexpression construct plus an equal population of Agrobacterium containing either the empty vector or the RI-SIPK construct. Agrobacterium carrying different combination of constructs was grown overnight in LB medium containing 50 ug/ml rifamycin, and 50 ug/ml kanamycin. The cells were collected by centrifugation (4,OOOxgO, resuspended to O.D.6oo 0.8 in MS medium (pH 5.6; Gibco.BRL) with 100 uM acetosyringone, and infiltrated into the fully expanded leaves. At the indicated times, the infiltrated area was cut out of the leaf using a scalpel, frozen in liquid nitrogen, and stored at -80° C until further analysis. 4.2.7 Northern blotting and RT-PCR analysis Total RNA was extracted as previously described in Chapter 3.2.1.1. RNA (15 u.g) was resolved in a 1 % formaldehyde agarose gel, and blotted onto Hybond XL membrane (Amersham Pharmacia Biotech) using the capillary transfer system. RNA blots were hybridized by shaking overnight at 55°C in a Rapid-hybridization buffer (Amersham Pharmacia Biotech) containing the 3 2 P -labelled probe. Blots were washed twice at RT with 2X S S C containing 0.1 % SDS, once with 1X S S C containing 0.1 % SDS at 65°C and twice with 0.1X S S C containing 0.1% S D S at 65°C. The membrane was then wrapped in plastic film and exposed overnight to the phosphorimager screen. Hybridization signals were 96 scanned and analyzed using the Storm 860 Phosphorimager (Amersham Pharmacia Biotech) A 600 bp C-terminal fragment of the SIPK O R F was used as the probe for testing the level of suppression of SIPK (Figure 4.3C). The O R F s of cytosolic APX (ascorbate peroxidase) and GST (glutathione-S-transferase) from tobacco (Xanthi nc.) were PCR-amplified from tobacco cDNA prepared from 4 h ozone-exposed wild type tissue, using gene-specific primers, and used as probes (Table 4.2). The PAL (Xanthi nc.) probe was a gift from Monica McQuoid (UBC) while the PR-1a probe was provided by Dr. Daniel Klessig, Rutgers University, USA. For RT-PCR, cDNA synthesized (Chapter 3.2.1.2) from total RNA using a first-strand cDNA sythesis kit (Invitrogen) was employed as the amplification template. P C R was performed as described earlier (Chapter 3.2.1.2) using gene-specific primers designed to target either SIPK (25 cycles) or NTF4 (30 cycles). The number of cycles was adjusted so that the amplification was within the linear range. As an internal control, 18S ribosomal cDNA was amplified using a 1:4 ratio of 18S-specific primers to competimer oligonucleotides provided by Ambion. Table 4.3 Primers used for RT-PCR on SIPK genotypes Primer Sequence Ntf4-forward Ntf4-reverse 5' T G A T T C T A G G G T T T A C T G T T C T T C A A A 3' 5' T T T C C A A C A A C A A A T G A G T A C T C A C A T 3' APX-Forward 5' A G A A C A A T T G C T A T G G G T A A G T G 3' 97 APX-Reverse 5' G C A A G C T T A A G C T T C A G C A A A T 3' GST- Forward GST-Reverse 5' A T G G C G A T C A A A G T C C A T G G T A 3' 5' T T T T T G C A G C T T C T C C A A T C C C 3' 4.2.8 Protein extraction and Western blotting Total protein extracts were prepared as previously described (Chapter 2.2.5). Protein (40 - 80 u,g) from each sample was used for Western blotting performed as described earlier (Chapter 2.2.5). A primary antibody dilution of 1:1000 was used for anti-pERK (New England Biolabs), and of 1: 5000 for anti-SIPK, anti-WIPK (Y. Ohashi, personal communication; Seo et al., 1995) and anti-FLAG (Sigma). 4.2.9 In vitro kinase assays GST-fusion proteins (5 u.g) of the wild type and mutant SIPK (K89R) and SIPK-A E F (K89R) were incubated with 5 u.g M B P and 10 u.Ci - [y-32P] labelled ATP (>5000 Ci/mmol) (Amersham Pharmacia) in a 20 ul reaction mixture (20 mM H E P E S (pH 7.5), 5 mM MgCI 2, 1 mM EGTA, 5 mM p-mercaptoethanol, 2 mM N a 3 V 0 4 , 20 mM p-glycerophosphate at 30°C for 30 min. The reaction was stopped with 6 X S D S loading buffer and the samples were resolved on a 15% polyacrylamide gel, blotted onto a nylon membrane and visualized by autoradiography. 4.2.10 Ion-leakage assay Five leaf discs (9 mm) were cut from each of the third and fourth leaves of ozone-exposed and untreated plants of the wild type, OX and Rl lines. The 10 leaf discs 98 were incubated in 5 ml deionized water at 25°C on a gyratory shaker at 110 rpm for 4 h, and the conductivity of the incubation solution was then measured using a conductivity meter (Radiometer Analytical S.A. Copenhagen). 4.2.11 In situ staining for H 2 0 2 H 2 0 2 was visualized in situ through 3,3'-diaminobenzidine (DAB) staining. Leaf halves were collected after 8 h of ozone (500 ppb) exposure and vacuum-infiltrated with the DAB (1 mg/ml) solution. Infiltrated leaves were exposed to light for 30 min and placed under high humidity until brown precipitation was observed (5-6 h), and then fixed with a solution of ethanol/lactic acid/glycerol (3:1:1 v/v) for two days, followed by further clearing in methanol. 4.3 Results 4.3.1 Transient over-expression of SIPK leads to cell death Infiltration of fully-grown tobacco leaves with a suspension of Agrobacterium tumefaciens cells carrying the SIPK-FLAG over-expression construct resulted in accumulation of the epitope-tagged SIPK protein in the infiltrated tissue within 48 h. In unstressed cells, endogenous SIPK was not phosphorylated at the TXY motif found in the activation loop of the kinase, as indicated by the absence of any signal in the control lane of a Western blot (Figure 4.1 C) prepared using an anti-pMAPK antibody that specifically recognizes the doubly-phosphorylated protein. In the infiltrated tissue, however, at least a portion of the pool of SIPK became activated by 48 h post-infiltration, with even greater activation observed by 72 h. Increased SIPK activity was also observed by 72 h as visualized through an in gel kinase assay (Figure 4.1 D). In the same time-frame, the infiltrated 99 zones showed signs of tissue collapse, and by 96 h, these zones became completely necrotic (Figure 4.1 A). When leaves were co-infiltrated with A. tumefaciens carrying the SIPK-FLAG over-expression construct plus an RNAi construct that targeted SIPK, both expression and activation of S IPK-FLAG were completely suppressed (Figure 4. 1B,C). The cell death induced by over-expression of S IPK-FLAG in the infiltrated zones was also eliminated (Figure 4.1 A). SIPK-OX+ EV SIPK-OX + RI-SIPK B C 24h 48h 72h 96h 24h 48h 72h 96h SIPK-FLAG - p . SIPK Cell death C 24h 48h 72h 96h Crude/ in-gel IP-anti-sipk /in-gel Figure 4.1. PTGS (post transcriptional gene silencing)-induced suppression of the cell death triggered by transient overexpression of SIPK. Co-infiltration with Agrobacterium containing the SIPK-FLAG construct (SIPK-OX) along with the RNAi-SIPK construct (RI-SIPK) inhibited the cell death process induced by transient overexpression of S IPK-FLAG alone (4.1A). Protein samples extracted at different times after infiltration of the constructs were immunoblotted with either anti-FLAG antibody (4.1 B) or phospho MAPK-specif ic antibody (anti-pERK) (4.1 C) or in-gel kinase assay (4.1 D). (-, +, +++) indicates the extent of visible lesions appearing in the infiltrated zones. EV: empty vector 100 4.3.2 Stable over-expression and suppression of SIPK render tobacco plants ozone-sensitive The cell death associated with spontaneous activation of SIPK in over-expression (OX) transgenic cells indicated that it might be difficult to recover stably transformed lines using this construct, but co-cultivation of tobacco leaf discs with the appropriate A. tumefaciens culture and selection on kanamycin yielded a number of putative transgenic lines, which could be detected through P C R using gene specific primers (Figure 4.2A). These lines were found to ectopically express a range of levels of S IPK-FLAG (Figure 4.2B). No spontaneous activation of SIPK was detected in these lines, which all displayed normal growth and development phenotypes. Transformation of tobacco leaf discs with the SIPK-RNAi (Rl) construct (Figure 4. 3A) also yielded stable transgenic lines (Figure 4.3B), although with a sharply reduced frequency. In the recovered Rl lines, silencing of endogenous SIPK expression was observed to varying degrees, ranging from partial reduction in both SIPK mRNA and protein, to elimination of both products (Figure 4.3C,D). 101 OX-SIPK + 3 4 5 7 8 9 1011 12 mmm - - W +- 1.5Kb B WT3 7 8 9 10 12 46kD C Figure 4.2. Transgenic tobacco plants overexpressing SIPK-FLAG show increased ozone sensitivity 4.2A. Putative positive lines were identified through P C R , using gene-specific primers. Representative samples are shown. 1.5 Kb band represents the SIPK amplicon. *lane # 5 yielded a weak P C R signal 4.2B. Proteins (40 ug) extracted from leaves of the different T1 OX lines ectopically expressing SIPK-FLAG were immunoblotted using anti- FLAG antibody. 4.2C. Transgenic tobacco line 0 X 4 and wild type tobacco (Xanthi nc.) plants were exposed to ozone (500 ppb) for 8 h. Representative treated leaves were photographed 24 h post-exposure. 102 103 Figure 4.3. SIPK-suppressed lines are also sensitive to ozone 4. 3A. RNAi construct under the control of the CaMV 35S promoter 4. 3B. Putative SIPK-suppressed lines as analysed by P C R using gene- specific primers. The 900bp band represents the SIPK amplicon. 4. 3C.SIPK is suppressed in four of the six PCR-positive lines. Northern blots were performed using total RNA (15 ug) extracted from wild type and SIPK-RI lines, and probed with the radio-labelled C-terminal fragment of the SIPK-ORF. Autoradiography revealed essentially no SIPK mRNA in four of the six P C R -positive lines (top). Ethidium bromide staining of the gel showed equal loading of RNA (middle). Immunoblotting of protein samples from the same lines indicated the absence of detectable amounts of SIPK protein in all four SIPK-suppressed lines (bottom). Similar results were observed when R T - P C R was conducted using S/PK-specific primers (4. 3D). NTF4 gene expression in the SIPK-suppressed lines was analyzed by R T - P C R using gene-specific primers (4. 3E) 4. 3F. SIPK-suppressed lines R3 and R5 display ozone-sensitive phenotypes. Plants (T1) of SIPK-suppressed tobacco transgenic lines R3 and R5, together with the wild type, were exposed to ozone (500 ppb) 8 h per day for 2 days. Representative treated leaves were photographed 24 h after the end of 2 days' exposure. The specificity of this silencing is shown by the continued expression in most of the recovered Rl lines of the closely related NTF4 MAPK gene, whose cDNA sequence is 89% identical to that of the SIPK (Figure 4.3E). The Rl lines again showed largely normal growth and development phenotypes, although the most severely suppressed lines showed some modest tendency to dwarfing. Plants of OX and Rl lines showed no signs of spontaneous cell death under normal growth conditions. However, exposure of mature OX or Rl leaves to levels of ozone that caused no visible injury to wild type plants (500 ppb) resulted in the rapid appearance of small necrotic lesions on leaves of both the transgenic genotypes (Figures 4.2C, 4.3F). The kinetics of this oxidative stress damage were quite different on the two genotypes. Lesions consistently appeared on the leaves of OX plants as early as 4-6 h, but visually similar lesions 104 only appeared on Rl leaves approximately 24 h later. In plants challenged with lower ozone concentrations (250 ppb), the analogous pattern was observed 105 Figure 4.4. Quantitation of ozone-induced cell death and H 2 0 2 accumulation in SIPK kinotypes 4.4A. Ion-leakage from leaf discs (5 each) of the 3rd and 4th leaves of wild type, 0 X 4 and RI5 lines was assessed as an indicator of the loss of membrane integrity. Measurements were made 6 h and 12 h after initiation of ozone exposure (500 ppb). The data presented are the means and standard deviations from three independent experiments 4.4B. Leaf halves photographed 48 h after 8 h of ozone-exposure (upper panel). DAB staining of representative leaf halves from the same plants after 8hours of ozone-exposure (lower panel) 4.4C. DAB-stained regions (from 4B) of ozone-treated (8 h) leaf halves of SIPK kinotypes demonstrating H 2 0 2 accumulation except that the necrotic responses were delayed until 48 h (OX) and 72 h (Rl)(data not shown). When leaf discs prepared from the WT, OX and Rl genotypes were assayed for loss of membrane integrity and associated ion leakage resulting from ozone exposure (500 ppb), differential timing of the damage response was also observed (Figure 4.4A). 4.3.3 Alteration of SIPK expression levels leads to increased ROS accumulation in tobacco plants after ozone-exposure To assess in situ the relative levels of H 2 0 2 accumulation induced by ozone exposure, control and ozone-treated leaf halves were infiltrated with DAB solution. The staining patterns revealed no detectable levels of H 2 0 2 in untreated leaves of any of the genotypes, or in leaves of wild type plants after 8 h of ozone exposure. However, strong DAB staining was observed in both the OX and Rl lines following ozone treatment (Figure 4.4B.C). 106 *r A? *r & & & & < GST-SIPK B K A* or tJlwMlF. GST-SIPK : 5 ug MBP :5ug <- Auto-p-GST-SIPK p -MBP GST-S IPK {anti-ERK) Fig 4.5 GST-SIPK catalytic domain (K89R) mutants are inactive. Recombinant GST-SIPK fusion proteins (4.5A) were subjected to an in vitro kinase assay using M B P as the substrate followed by separation in a 15% S D S -P A G E gel, blotting and autoradiography. 4.5B The lower panel shows a Western blot of the four protein samples probed with anti-ERK antibodies. The upper panel demonstrates the degree of SIPK autophosphorylation detected in each protein, while the central panel shows the extent of M B P phosphorylation catalyzed by each SIPK form. 107 4.3.4 Activation of SIPK is essential for ozone-induced cell death in SIPK over-expressing lines The observation that over-expression of S IPK-FLAG in infiltrated leaves was accompanied by spontaneous activation of the MAPK and by cell death, raised the question whether activation of the ectopically expressed protein was necessary for induction of cell death. Site-directed mutagenesis was therefore used to create different versions of S IPK-FLAG in which either the -TEY- motif found in the activation loop of SIPK, or the crucial lysine (K89) required for catalytic activity, had been converted to -AEF- and arginine, respectively, or a combination of both (Figure 4.5A). The -AEF- mutation yielded a kinase that retained a very low level of basal activity when the recombinant protein is assayed in vitro against M B P (Figure 4.5B), but it cannot be further activated through dual phosphorylation of the activation loop by upstream MAPKKs . The K89R and K89R/AEF mutations produced kinase forms that possessed no basal activity towards MBP (Figure 4.5B). The K89R form can be activated by upstream MAPKKs , but cannot perform downstream phosphorylation, while the K89R/AEF form can neither be phosphorylated by upstream M A P K K s nor phosphorylate downstream substrates. Unlike the S IPK-FLAG construct, when transiently expressed in tobacco leaves these constructs failed to cause cell death in the infiltrated zone (Figure 4.6). Stably transformed tobacco plants expressing high levels of SIPK(AEF)-FLAG, SIPK-K89R-FLAG and SIPK-K89R-A E F - F L A G were also readily recovered following Agrobacterium co-cultivation, and these plants displayed no visibly altered phenotype. Despite accumulating 108 similar levels of the epitope-tagged kinase, the ozone sensitivity of these mutant transgenic lines did not differ from that of wild type plants (data not shown). This indicates that the heightened ozone sensitivity observed in SIPK-OX transgenics requires that the ectopically expressed kinase not only be expressed at high levels within the plant cell, but that it should have the capacity to become activated, and to catalyze protein phosphorylation. Fig 4.6 SIPK activation is essential for transient expression-induced cell death. Agrobacterium cultures containing the different S IPK-FLAG constructs were infiltrated into different sections of a single tobacco leaf and the infiltrated zones were photographed after 96 h. 109 4.3.5 SIPK suppression leads to strong activation of WIPK The activation status of both SIPK and WIPK in tobacco tissue extracts can be assessed either on Western blots using a phospho-specific antibody, or by immunoprecipitation with antibodies that discriminate between SIPK and WIPK, followed by in-gel or in vitro kinase activity assays. When the various transgenic and wild type tobacco lines were monitored over a 30 min period of ozone exposure, striking differences in the pattern of kinase activation were observed amongst these genotypes (Figure 4.7). As previously reported (Chapter 2.3), ozone treatment leads to rapid activation of SIPK in leaves of wild type plants. This is accompanied by a much weaker activation of the smaller kinase, WIPK (Figure 4.7A). In the 0 X 4 genotype, ozone exposure also leads to SIPK activation, but the level of activation appears to be depressed relative to the WT response, despite the presence of far greater amounts of ectopically expressed SIPK in the OX cells (Figure 4.7 B,C). No activation of WIPK can be detected in the OX tissue samples. The SIPK(AEF) genotype presented a kinase activation profile that was very similar to that of WT. This indicates that flooding the cell with a non-activatable version of SIPK (a potential dominant negative form) does not interfere with the ability of the upstream MAPK cascade elements to transmit oxidant-induced signals to their cognate MAPKs . Exposure of the Rl genotype to ozone, by contrast, yielded a very different MAPK activation profile. Very weak or no SIPK activation could be detected, as would be predicted for a genotype in which SIPK expression has been n o WT Rl OX AEF 0 1 0 30 0 10 30 0 10 30 0 10 30 : ozone-exposure time in min p-SIPK pwv-B p-WIPK SIPK-FLAG - - <a**^  ^Btf^ ^tH^P ^Bp^^ ^^^^ SIPK D IP-anti SIPK WT Rl OX AEF c IP-anti WIPK WT Rl OX AEF Figure 4.7. Differential ozone-induced activation of SIPK and WIPK in SIPK-kinotypes 4.7A. Crude protein extracts prepared from ozone-exposed tissues from T2 lines of the different SIPK-kinotypes (RI5, OX4, AEF8) and wildtype were resolved on a 10% polyacrylamide gel, blotted and probed with an anti-phospho-ERK antibody to recognize phospho-MAPK forms. The same blot was subsequently probed using an anti-FLAG antibody to detect ectopic expression of the transgene product in the different kinotypes (4.7B) 4.7C. A replicate Western blot was performed using a SIPK-specific antibody, revealing high expression of SIPK forms in the overexpressor lines and its absence in the SIPK-suppressed lines 4.7D,E. Protein samples prepared from ozone-exposed (30 min) tissues from the different kinotypes were immunoprecipitated with either SIPK- or WIPK-specific antibodies. The immunoprecipitates were subjected to an in-gel kinase assay as described in the Methods. i n suppressed by post-transcriptional gene silencing (Figure 4.7A.C). Instead, ozone exposure produced strong and specific activation of WIPK. The identity of these highly activated kinases in ozone-treated leaves of each genotype was confirmed through immunoprecipitation of the 30 min ozone-treated protein extracts with either SIPK or WIPK-specific antibodies, followed by in gel kinase assays (Figure 4.7 D,E). 4.3.6 SIPK and WIPK activation is prolonged upon continuous ozone-exposure in OX and Rl lines respectively Aside from the unexpected massive activation of WIPK, the stability of that activation was also strikingly different in this genetic background. When oxidants trigger a rapid activation of SIPK, this is normally a transient response. The activation is effectively lost within 1 h, even under conditions of continuous oxidant stimulus, as seen in Figure 4.8A (WT lane). However, in the Rl genotype WIPK was not only rapidly activated but the pool of this MAPK remained continuously active for up to 8 h after the initiation of the response (Figure 4.8A; Rl lane). While there is normally far less WIPK than SIPK present in tobacco leaves (Zhang and Klessig, 1998b), the high activation signal observed in the Rl tissue extracts does not appear to reflect increased levels of WIPK protein in this genotype compared to WT plants, as assessed by Western blotting (Figure 4.8C). Interestingly, kinase activation by ozone in the OX genotype was also abnormally prolonged, relative to that seen in ozone-treated WT plants, but in this case the 112 active kinase was SIPK rather than WIPK (Figure 4.8B). In addition, unlike the hyper-activated WIPK pool, the extended activation of SIPK in the OX line was more short-lived, and disappeared within 4 h. This is about the time at which visible lesions begin appearing on ozone-treated OX leaves. B WT Rl 4h 8h ozone p-SIPK p-WIPK O X AEF ozone p-SIPK p-WIPK WT O X AEF Rl 4h 4h 4h 4h — WIPK Figure 4.8 Loss of SIPK leads to hyper-activation of WIPK. 4.8A.B. Extended ozone exposure reveals strong and prolonged activation of WIPK in the Rl line. A temporal profile of the phosphorylation status of SIPK and WIPK was generated through anti-pERK immunoblotting of crude proteins extracted from tissues of either wild type and Rl lines (4.8A), or OX and A E F lines (4.8B), exposed to ozone for different times ( 0 - 8 h). 4.8C. Alteration of SIPK does not lead to changes in the amount of WIPK protein. Protein extracts from untreated and 4 h ozone-treated tissues from different kinotypes were immunoblotted with anti-WIPK antibody. 113 4.3.7 Induction of antioxidant and defense genes is altered in the OX and Rl lines Examination of the temporal response of two antioxidant genes (GST and cAPX) whose expression is strongly induced by ozone treatment revealed that loss of SIPK signalling in the Rl genotype resulted in a delayed response in the expression of both genes. In the OX line, prolonged activation of SIPK signalling was associated with suppression of GST induction, whereas APX gene expression was unaffected (Figure 4.9A.B). Analysis of the pathogen-inducible PR1a gene and a key phenylpropanoid pathway gene (PAL), in these lines revealed delayed and strong activation of PR1a in the Rl line, while its induction was completely blocked in the OX line (Figure 4.9C). PAL induction showed no difference between these lines in kinetics and intensity of transcriptional activation (Figure 4. 9D). 114 B WT O X Rl C 2h 4h 8h C 2h 4h 8h C 2h 4h 8h Hi I f M Hr H i A P X GST H T " * M M tf H «^ •* •«* * - ^^^^ ^ ^ P ' "PI* 1 t # I f T E l f 5 n PR1a Hi 1mf n . « H - P A L • • 1 t # t # H i Figure 4.9. Alteration of SIPK signalling affects ozone-induced gene expression. Northern blot analysis of accumulation of mRNAs of cytosolic ascorbate peroxidase (4.9A), glutathione-S-transferase (4.9B), pathogenesis-related protein 1a (4.9C) and phenylalanine ammmonia- lyase (4.9D) in leaves of wild-type, SIPK-overexpression (OX) and SIPK-suppressed (Rl) transgenic tobacco. Plants were exposed to ambient air (C) or 500 ppb ozone for 2, 4 and 8 h, and total RNA was harvested from the third and fourth leaves. Ethidium bromide stained rRNA are shown as loading controls. Results from Chapter 4 were published in THE PLANT CELL (2002) 14(9), 2059-2069. 115 4.4 Discussion Plant cells must constantly deal with reactive oxygen species from a range of sources, including photo-oxidation, mitochondrial electron transport, flavin oxidase by-products, and environmental insults such as UV, ozone and ionizing radiation. Against this background, ROS pulses ("oxidative bursts") can also occur within cells, usually as very early responses to localized challenges to cellular integrity such as wounding and pathogen assault. These pulses may serve multiple roles, including activation of redox protection mechanisms, modulation of intracellular signal transduction pathways, and transmission of systemic signals to neighbouring cells. A severe oxidative challenge that overwhelms local protective measures will ultimately lead to cell death. The archetype for this outcome is the hypersensitive response induced during incompatible host-pathogen interactions. Similar lesions are induced by exposure to elevated levels of ozone or UV radiation. The exact process by which cellular integrity fails is unclear, but the concept that HR represents a form of genetically programmed cell death (PCD) is supported by the identification of numerous mutants affected in the process of lesion formation (Richberg et al., 1998). The correlation of ROS pulses with the cell death process has been extensively described. Treatments such as chilling, wounding, pathogen infection, UV irradiation or ozone exposure rapidly induce ROS accumulation in plant cells, followed later by lesion development. However, despite these 116 correlative observations, a functional linkage between R O S accumulation and local lesion formation has yet to be defined. It is striking that so many stresses that elicit R O S accumulation in plant cells consistently appear to activate MAPK modules as one of their earliest effects (Orozco-Cardenas et al., 2001; Seo et al., 1995; Desikan et al., 2001; Allan et al., 2001; Zhang and Klessig, 1998b). The M A P K most consistently observed to be activated both by applied stresses and by R O S is SIPK in tobacco (Chapter 2; Miles et al., 2002), or its apparent orthologs in other species, i.e. MPK6 in Arabidopsis (Kovtun et al., 2000; Yuasa et al., 2001) and SIMK in alfalfa (Cardinale et al., 2000). This pattern indicates that SIPK activation might play an important role in determining the response and ultimate fate of the stressed cells. Linkages between ROS-associated cell death and M A P K signalling have been reported for a number of non-plant systems. H 202-induced cell death in cultured mammalian oligodendrocyte cells is inhibited by PD98059, a specific inhibitor of MEK, the upstream kinase of the ERK1/2 MAPK, (Bhat and Zhang, 1999), while delayed and prolonged activation of p44 and p42 MAPKs is critical for genistein-induced PCD in rat primary cortical neurons (Linford et al., 2001). Similarly, delayed and persistent activation of E R K 1/2 is associated with glutamate-induced oxidative cytotoxicity in neuronal cell lines (Stanciu et al., 2000) There is also evidence that ROS-activated MAPKs may play analogous roles in plant cells. Cell death induced in Arabidopsis cell suspension cultures by 117 treatment with a bacterial elicitor (harpin) is inhibited when the cells are treated with the MEK inhibitor, PD98059 (Desikan etal., 1999), while pre-treatment of tobacco cells with staurosporine, a general protein kinase inhibitor, suppresses the cell death normally induced by exposure to fungal elicitors (Suzuki et al.,1999). Contrastingly in mammalian cell lines staurosporine is routinely utilized as an apoptosis-inducing agent (S. Pelech, personal communication). Genetic manipulation experiments have also implicated M A P K activation in the cell death process. In Arabidopsis plants over-expressing constitutively-active forms of the MAPKKs , AtMEK4 or AtMEK5, under the control of a steroid inducible promoter, HR-like lesions appeared after induction with the steroid dexamethasone, and lesion formation was preceded by activation of an endogenous MAPK and accumulation of H 2 O 2 (Ren et al., 2002). Transient over-expression of a constitutively-active form of a MAPKK (NtMEK2) in tobacco also led both to sustained activation of MAPKs , identified as SIPK and WIPK, and to death of the infiltrated tissue (Yang et al., 2001). Transient overexpression of SIPK itself was subsequently shown to result in formation of HR-like lesions, but only in young leaves (Zhang and Liu, 2001). I have confirmed that ectopic SIPK over-expression leads to appearance of high levels of the activated kinase in Agrobacter/um-infiltrated tobacco tissue, and to rapid cell death (Figure 4.1A). But, when stably transformed tobacco plants were produced that over-expressed epitope-tagged SIPK (Figure 4.2), these displayed no visible phenotype. When exposed to ozone, however, the transgenic SIPK-OX plants proved to be much more sensitive than the non-118 transgenic parental line, indicating that ROS-induced cell death was being less effectively controlled in the over-expression genotype. While this pattern is consistent with the results of NtMEK2 or SIPK-OX transient expression, its physiological relevance remains uncertain, since we know little about the effects of accumulation of non-physiological levels of active signal components on cellular function. To unambiguously identify a functional relationship between ROS activation of SIPK and ROS-induced cell death, I therefore turned to creation of defined loss-of-function mutants. Modification of SIPK function in transgenic tobacco plants using either conventional gene silencing methods (co-suppression and anti-sense), or over-expression of dominant negative forms, proved ineffective (Yang et al., 2001; data not shown). However, expression of an intron-containing "hairpin RNA" (Smith et al., 2000) designed to target a unique tract within the SIPK coding sequence yielded a number of transgenic plants in which SIPK expression had been severely and specifically suppressed through post-transcriptional gene silencing. Loss of SIPK had no obvious phenotypic consequences for plants grown under normal greenhouse conditions. Given the sensitivity of SIPK-OX lines to ozone, it might have been predicted that the absence of this kinase would have no, or perhaps even positive, effects on the ozone sensitivity of the SIPK-RI lines. Instead, following ozone treatments that induced no visible damage on wild type plants, the SIPK-RI lines developed numerous lesions on their middle leaves within 24 h. The inability of the suppressed genotype to generate and activate SIPK thus 119 compromises the cell's ability to manage ROS stress and to control cell death, although apparently on a different time-scale from that observed in SIPK-OX plants. Which facet of ROS-stress management has been compromised in SIPK-OX and SIPK-RI plants is not clear. No constitutive H 2 O 2 accumulation was detected in any of the genotypes, indicating that their heightened ozone sensitivity is not the consequence of a pre-existing build-up of R O S . Instead, it appears that alteration of the normal ozone-induced M A P K activation process, either through unregulated over-expression or through suppression, creates an inability to cope with increased redox stress. Examination of the transcriptional activity of two genes whose mRNAs rapidly accumulate following ozone exposure showed that the response of both genes was differentially impacted (Figure 4.9). Expression of cAPX, which encodes a major ROS-scavenging enzyme, was less effectively induced by ozone in Rl plants, while it was unaffected in the OX line. Antisense suppression of c A P X was earlier shown to create hypersensitivity to both ozone (Orvar and Ellis, 1997) and pathogens (Mittler et al.,1999) in transgenic tobacco plants. By contrast, ozone-induced expression of GST, a general cellular protectant, was strongly suppressed in the OX line, but its expression was markedly delayed in the Rl line. In Arabidopsis, both H 2 0 2 and ozone induce G S T (glutathione S-transferase) expression (Grant et al., 2000; Clayton et al., 1999), and this expression has been demonstrated to require the activity of an unidentified 48 kD MAP kinase and calcium ion influx. 120 Calcium channel activity is also essential for ROS activation of SIPK in tobacco (Chapter 2). The delayed response of the antioxidant genes in the Rl line could result in increased early accumulation of ROS (Figure 4. 4B.C) which could potentially lead to a necrotic cell death process. In the OX line, although the cAPX gene response to ozone appears to be normal, the antioxidant response is clearly unable to contain the rising ROS levels associated with extended SIPK activation (Figure 4. 4B,C). M A P K activation has been linked previously to increased ROS accumulation in Arabidopsis (Ren et al., 2002). The lack of PR1a transcript induction in the OX line during ozone exposure and its heightened induction in the Rl line indicates that SIPK could be a negative regulator of PR1a gene activation. A broader comparison of transcript profiles using DNA microarrays should generate useful insights into other connections between transmission of redox signals by SIPK and the ability of the cell to avoid oxidative cell death. Another aspect of the link between SIPK activation and cell death is revealed in the pattern of MAPK activation in ROS-stressed plants. Activation of SIPK by ozone occurs within 10 min in SIPK-OX plants but is not reversed for 4 h, by which time cell death is already becoming visible. This outcome is similar to the association of prolonged activation of mammalian E R K with induction of PCD in neurons (Stanciu et al., 2000), and when taken together with the results of the transient expression experiments, demonstrates that unregulated continuous activity of SIPK within plant cells profoundly affects normal homeostatic mechanisms. 121 Absence of SIPK in the SIPK-RI genotype also leads to premature cell death under redox stress conditions, but in this case the hyper-activated species observed is WIPK, rather than SIPK. There have been other indications that WIPK plays a central role in plant stress signalling. This gene was originally identified on the basis of its rapid and transient induction upon wounding of tobacco leaves (Seo et al., 1995), and the gene product was later shown to be transiently activated both by wounding (Seo et al., 1999) and by various other stresses (Romeis et al., 1999; Zhang et al., 2000). WIPK activation is usually accompanied by activation of SIPK, but SIPK and WIPK do not always respond in unison; some oxidative stresses appear to preferentially activate SIPK and leave WIPK unaffected (Kumar and Klessig, 2000). WIPK activity, either alone or together with SIPK, has been suggested to be involved in induction of cell death in cultured tobacco cells by specific fungal elicitor treatments (Zhang et al., 2000). Pre-treatment of the elicited cells with staurosporine and K252A (protein kinase inhibitors) completely suppressed both WIPK activation and cell death. However, transient over-expression of WIPK did not result in its activation and failed to induce cell death in infiltrated tobacco leaves, unlike SIPK (Zhang and Liu 2001). In another study, stable over-expression of WIPK in transgenic tobacco was accompanied by constitutive expression of protease inhibitor-ll and accumulation of methyl jasmonate (Seo et al., 1999), but the oxidative stress sensitivity of the WIPK-OX lines was not reported. 122 How SIPK elimination leads to prolonged hyperactivation of WIPK is unknown, but various possibilities exist. If NtMEK2 is the sole upstream MAPKK responsible for activation of both SIPK and WIPK, these two MA P K s may normally compete for binding to NtMEK2. However, basal levels of SIPK in unstimulated tobacco cells are much higher (10-fold) than those of WIPK (Zhang and Klessig, 1998b). In the absence of competition from SIPK, activation of WIPK by NtMEK2 activation in SIPK-RI cells may be much more efficient than usual. This scenario might also explain why WIPK remains largely unactivated in ozone-treated SIPK-OX tissues where an excess of SIPK is present. However, while this model accounts for WIPK hyperactivation, it does not necessarily explain why that activation is abnormally prolonged. Alternatively, one of the normal roles of activated SIPK may be the direct or indirect regulation of WIPK activity. Both dual-specificity phosphoprotein phosphatases (MKP) and serine/threonine phosphatases have been implicated in inactivating MAPK pathways in mammalian and plant models (Brondello et al., 1997; Ulm etal . , 2001; Westermarck et al., 2001; Meskiene et al., 1998). If SIPK activity is required for induction or activation of a protein phosphatase that normally acts upon phospho-WIPK, absence of SIPK from oxidant-stressed SIPK-RI cells would create a situation in which WIPK could be activated by its cognate M A P K K but could not be subsequently inactivated. In this regard, it is interesting that Arabidopsis plants in which a dual-specificity phosphatase (AtMKP-1) has been mutated by T-DNA insertional mutagenesis display increased activation of an unidentified ~49 kD MAPK and are more susceptible to 123 ROS-generating stresses (e.g. UV) (Ulm et al., 2001). By contrast, MP2C, an alfalfa protein serine/threonine phosphatase belonging to the P P 2 C class, has been shown to be a negative regulator of the MAPK pathway involving SAMK, an Wild type Ozone UPSTREAM SIGNALS M A P K K P SIPK ~ — • SIPK P WIPK13 phosphatase Inactive WIPK phosphatase Active SIPK- SUPPRESSED (Rl) • z o n e UPSTREAM SIGNALS M A P K K P WIPKP WIPK phosphatase Inactive Figure 4.12. Proposed model for inactivation of WIPK by active SIPK (see text for details) apparent orthologue of WIPK (Meskiene et al., 1998). Both classes of protein phosphatase could therefore potentially be involved in cross-regulation mechanisms. Resolution of this question, and of the relative importance of loss of SIPK activity vs. enhancement of WIPK activity in controlling oxidant-induced cell death will require development and analysis of other relevant single and multiple loss-of-function genotypes. 124 CHAPTER 5 General Discussion The overall aim of this study was to investigate the potential involvement of MAPKs in oxidative stress-induced response pathways, using ozone as the ROS stress. The objectives were to determine which M A P K might be activated by ozone and to establish whether alteration of expression of this kinase would lead to changes in ozone stress physiology. These investigations had a wider significance, as well, since a variety of stresses that involve an oxidative burst are also activators of MAPK with kinetics similar to those seen in response to ozone. 5.1 Ozone and MAPK in Plants Ozone exposure rapidly activated a MAPK in tobacco, which was identified as SIPK through use of SIPK-specific antibodies. Inhibitor studies revealed that this activation was ROS-induced, calcium dependent and required upstream activation by at least one MAPKK. Similar activation profiles have been observed for SIPK in response to a number of other stresses, although in the case of harpin, its ability to activate SIPK was independent of calcium influx (Zhang and Klessig, 2001; Lebrun-Garcia et al., 1998) Interference with SIPK signalling through transgenic manipulation of SIPK expression weakened the ability of the plant to control ozone-induced cell death. Whether this increased sensitivity results directly from loss of signalling to the anti-oxidant defence functions, or to cell death suppression mechanisms, or to both, remains to be fully established. 125 5.2 MAPK in Ozone-induced Oxidative Burst and Antioxidant Gene Induction The heightened sensitivity in the OX and Rl lines is associated in each case with increased accumulation of ROS upon ozone-exposure, whereas wildtype plants showed no such accumulation within the same time frame. In Arabidposis, prolonged activation of MAPK following overexpression of active forms of AtMEK4 and AtMEK5 resulted in cell death preceded by increased accumulation of R O S (Ren et al., 2002). In contrast, other studies have demonstrated a lack of coupling between MAPK activation and the oxidative burst (Romeis et al., 1999). Through use of inhibitors of MAPKK, MAPK activation was shown to be independent of the oxidative burst elicited by AVR-9 in CF-9-expressing tobacco cell cultures (Romeis et al., 1999). The lack of constitutive R O S accumulation in the transgenic lines in the present study indicates that the build-up of R O S is inducible, and that it is dependent on activation status of SIPK or WIPK. Which components of the oxidative burst machinery (induction/detoxification) or the redox balance control factors, are altered in these lines as a result of alterations of SIPK levels need to be studied. One main function of an activated MAPK in eukaryotic cells is controlling gene expression through activation of downstream transcription factors, thereby linking extracellular stimuli to appropriate pattern of gene expression. On the one hand, the fact that the transcriptional responses of the antioxidant genes (GST, APX) were delayed in the Rl line indicates, that the transcription factors for these genes could be potential targets of SIPK. On the other hand, GST message 126 accumulation was completely abolished in OX line. This is a more complex phenomenon, but it may be that the temporal pattern of SIPK activation is a key element in regulation of GST transcription. The SIPK altered transgenic lines displayed heightened sensitivity to ozone, which was preceded by increased ROS accumulation and associated differences in gene expression. How changing the endogenous levels of SIPK could lead to these multiple responses is elusive. But we can speculate that prolonged activation of SIPK in the OX line leads to triggering of a cell death pathway. P C D (programmed cell death) in plant cells is usually preceded by induction of an oxidative burst that at least temporarily over-rides the cell's antioxidant defense mechanism. In the Rl line, ozone exposure in the absence of SIPK results in a delay in antioxidant gene induction, leading to an increased accumulation of ROS and necrotic cell death. It is not necessarily the case, however, that the observed phenotypes are a direct reflection of SIPK's putative ability to modulate the activity of transcription factors. In the absence of SIPK, WIPK activation is enhanced and prolonged, in comparison to wildtype, where only weak and transient activation of WIPK is observed following ozone-exposure. Whether WIPK activation is the more proximal cause for the delayed up-regulation of these genes in the absence of SIPK activation in the Rl line has yet to be determined. Since this study has not been able to distinguish the signalling specificity of the individual kinases at this point, the ozone-induced MAPK-dependent responses in the O X and Rl lines are depicted (Fig 5.1) as resulting from the combined activation intensity and kinetics 127 of both SIPK and WIPK. Construction of appropriate single and double mutants of WIPK and SIPK/WIPK would enable us to resolve this specificity question. 5.3 SIPK and Other Signalling Metabolites in Ozone-induced Stress Various signalling molecules such as SA, MeJA and ethylene have been reported to play an important role in ozone-induced stress responses, including cell death (Rao and Davis, 2001; Overmyer et al., 2000). In the transgenic SIPK lines, the significance of increased PR1a accumulation in tissue of the Rl line, and failure to accumulate PR1a in the OX line upon ozone exposure is not known, but analysis of SA accumulation pattern in these lines could provide some initial clues. SA is known to play a central role in controlling PR1a expression in most of the species tested. An increase in constitutive or inducible levels of S A has been correlated with increased PR1a gene expression. This indicates that the increased basal level of PR1a in the Rl lines could be due to increased constitutive levels of SA. Loss-of-function mutants in Arabidopsis MAPK4 were found to display increased constitutive S A accumulation and PR1a gene activity (Petersen et al., 2000). Analyzing the levels of SA, along with other signal molecules such as MeJA and ethylene, during ozone exposure in these lines could provide insight into their relationship with SIPK. Since pre-treatment of tobacco plants with MeJA was earlier shown to provide protection from ozone damage (Orvar et al., 1997), treating these lines with MeJA would help place MeJA at the appropriate position in the ozone-induced cell death pathway in relation to activation of SIPK. Future crosses of OX and Rl lines with the nahg line which carries a salicylate hydroxylase gene and does not accumulate SA will 128 create novel genotypes that will enable us to address the involvement of SA in SIPK-dependent ozone-induced cell death process. 5.4 WIPK/SIPK Interplay and the Role of Phosphatases Upon ozone exposure, SIPK activation in the OX line was prolonged, while WIPK activation was prolonged in the Rl line. Since R O S levels in both OX and Rl lines were elevated following ozone exposure, and it has been previously established that ROS stress can lead to rapid activation of these kinases, it could be envisaged that this abnormal rise in ROS might represent a form a feedback activation loop for these kinases. Such a feedback mechanism would result in prolonged activation of SIPK in the OX line upon oxidant stress and sustained WIPK activation in the Rl line that lacks SIPK (Figure 5.1#2). In this model, the absence of SIPK in the Rl line coupled with an enhanced R O S burst would be responsible for prolonged WIPK activation. However, this does not explain why no WIPK activation is seen in the OX line. It could be argued that expression of excessive SIPK might be sequestering the upstream MAPKK, and thus blocking its ability to activate WIPK (Figure 5.1#1). Alternatively, SIPK itself might be responsible for inactivating WIPK through activation of a dedicated protein phosphatase (Figure 5.1#5). In the absence of SIPK, oxidant activates a cognate MAPKK, which rapidly activates WIPK, but the inability of the cell to generate an active phosphatase leads to prolonged WIPK activity in the Rl line. De-novo synthesis of phosphatases has been proposed to be essential for the inactivation of M A P K in plants following the activation induced upon wounding or treatment with elicitors (Bogre et al., 1997; Suzuki and Shinshi, 1995). Evidence 129 from mammalian systems would support such a model. In MDCK epithelial cells, S F / H G F induced rapid and sustained activation of ERK1/2 while transiently activating JNK. The repression of JNK was preceded by expression and phosphorylation of MKP-2 (a dual-specificity M A P K phosphatase) and by E R K activation (Paumelle et al., 2000). Both of these responses were dependent on activation of MEK, the upstream kinase of ERK1/2. This pattern implies that active ERK controls the dephosphorylation of JNK (Paumelle et al., 2000). It has also been shown that several members of the MKP gene family are transiently synthesised and phosphorylated as early as 10 min after activation of MAPKs (Camps et al., 2000, Paumelle et al., 2000). MKP-1 was shown both in vivo and in vitro to be phosphorylated on Ser-359 and Ser-364 by p42 and p44 MAPK (Brondello et al., 1999). This modification resulted in stabilization of the highly labile MKP-1 protein. MKPs , as well as PP2A phosphatases, could therefore potentially influence the flow of the ozone-induced signal into SIPK and WIPK. Analysis of the gene induction profiles of both gene families, combined with biochemical analysis of direct interaction of these phosphatases with SIPK, could help to identify the pieces in this complex pathway. From our observations and previous observations of Ren et al. (2001), Yang et al. (2001), and Zhang et al. (2001), it is clear that sustained activity of either of these kinases, SIPK and WIPK, commits the cells to a cell death pathway. However, what lies between the activation of these kinases and induction of R O S and cell death remains unclear. Since our efforts to recreate the SIPK/substrate interaction in vitro were unsuccessful, future efforts to identify 130 substrates of SIPK should focus on direct identification of the phopho-protein profiles in the various transgenic genotypes, using proteomic tools such as ICAT (Isotope-Coded Affinity Tags) and 2D gel electrophoresis combined with mass spectrometry. The combination of microarray profiling and phosphoprotein profiling should enable us to delineate the molecules responsible for sensing, transmitting and responding to an oxidant stress, as the cell attempts to maintain its homeostatic balance. 131 Bibliography Abe, M.K., Kartha, S., Karpova, A.Y., Li, J., Liu, P.T., Kuo, W. and Hershenson, M.B. (1998) Hydrogen peroxide activates extracellular signal-regulated kinase via protein kinase C, Raf-1, and MEK1. Am. J. Respir. Cell Mol. Biol. 18, 562-569. Adam, A.L., Pike, S., Hoyos, M.E., Stone.J.M., Walker, J.C. and Novacky, A. (1997) Rapid and transient activation of a myelin basic protein kinase in tobacco leaves treated with harpin from Erwinia amylovora. Plant Physiol. 115, 853-861. Alessi.D.R., Cuenda, A., Cohen, P., Dudley, D. T. and Saltiel, A. R. (1995). PD 098059 is a specific inhibitor of the activation of mitogen-activated protein kinase kinase in vitro and in vivo. J . Biol. Chem. 270, 27489-27494. Allan, A.C. and Fluhr, R. (1997) Two distinct sources of elicited reactive oxygen species in tobacco epidermal cells. Plant Cell 9, 1559-1572. Allan, A.C., Lapidot, M., Culver, J.N. and Fluhr, R. (2001) An early tobacco mosaic virus-induced oxidative burst in tobacco indicates extracellular perception of the virus coat protein. Plant Physiol. 126, 97-108. Allen, R.G. (1998) Oxidative stress and superoxide dismutase in development, aging and gene regulation. Age 21, 47-76. Allen, R.G. and Tresini, M. (2000) Oxidative stress and "gene regulation. Free Radic. Biol. Med. 28, 463-499. Alvarez, M.E., Pennell, R.I., Meijer, P.J., Ishikawa, A., Dixon, R.A. and Lamb, C. (1998) Reactive oxygen intermediates mediate a systemic signal network in the establishment of plant immunity. Cell 92, 773-784. Asai, T., Tena, G., Plotnikova, J., Willmann, M.R., Chiu, W.L., Gomez-Gomez, L., Boiler, T., Ausubel, F.M. and Sheen, J. (2002). MAP kinase signalling cascade in Arabidopsis innate immunity. Nature 415, 977-983. 133 Baker, C.J. and Orlandi, E.W. (1995) Active oxygen in plant/pathogen interactions. Ann. Rev. Phytopathology 33, 304-321. Baker, C.J., Orlandi, E.W. and Mock, N.M. (1993) Harpin, an elicitor of the hypersensitive response in tobacco caused by Erwinia amylovora, elicits active oxygen production in suspension cells. Plant Physiol. 102,1341-1344. Barbo, D.N., Chappelka, A.H., Somers, G.L., Miller-Goodman, M.S. and Stolte, K. (2002) Ozone impacts on loblolly pine (Pinus taeda L.) grown in a competitive environment. Environ. Pollut. 116, 27-36. Becker, K.H., Brockmann, K.J. and Bechara, J. (1990) Production of hydrogen peroxide in forest air by reaction of ozone with terpenes. Nature 346, 256-258. Bhat, N. R. and Zhang, P. (1999) Hydrogen peroxide activation of multiple Mitogen-activated protein kinases in an oligodendrocyte cell line: role of extracellular signal-regulated kinase in hydrogen peroxide-induced cell death. J. Neurochem. 72, 112-119. Bogre, L., Ligterink, W., Meskiene, I., Barker, P.J., Heberle-Bors, E., Huskisson, N.S. and Hirt, H. (1997) Wounding induces the rapid and transient activation of a specific MAP kinase pathway. Plant Cell 9, 75-83. Bolwell, G.P. (1996) The origin of the oxidative burst in plants. Biochem. Soc. Trans. 24, 438-442. Bolwell, G.P. (1999) Role of active oxygen species and NO in plant defence responses. Curr. Opin. Plant Biol. 2, 287-294. Bowler, C , Van Montagu, M. and Inze, D. (1992) Superoxide dismutase and stress tolerance. Ann. Rev. Plant Physiol. Plant Mol. Biol. 43, 83-116. 134 Bradford, M.M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248-254. Braun, D.M. and Walker, J.C. (1996) Plant transmembrane receptors: new pieces in the signaling puzzle. Trends Biochem. Sci. 21, 70-73. Brondello, J. M., Brunet, A., Pouyssegur, J. and McKenzie, F. R. (1997) The dual specificity mitogen-activated protein kinase phosphatase-1 and -2 are induced by the p42/p44MAPK cascade. J. Biol. Chem. 272, 1368- 1376. Brondello, J.M., Pouyssegur, J. and McKenzie, F.R. (1999). Reduced MAP kinase phosphatase-1 degradation after p42/p44MAPK-dependent phosphorylation. Science 286, 2514-2517. Brown, M., Cox, R., Bull, K.R., Dyke, H., Sanders, G., Fowler, D., Smith, R. and Ashmore, M.R. (1995) Quantifying the fine scale (1KM x 1KM) exposure, dose and effects of ozone: part 2 estimating yield losses for agricultural crops. Water Air Soil Pollut. 85, 1485-1490. Bush, D.S. (1993) Regulation of cytosolic calcium in plants. Plant Physiol. 103, 7-13. Cadenas, E. (1995) Mechanisms of oxygen activation and reactive oxygen species detoxification. In Oxidative Stress and Antioxidant defenses in Biology (Ahmad, S., ed.). New York: Chapman and Hall, pp. 1-61. Camps, M., Nichols, A., Gillieron, C , Antonsson, B., Muda, M., Chabert, C , Boschert, U. and Arkinstall, S. (1998) Catalytic activation of the phosphatase MKP-3 by ERK2 mitogen-activated protein kinase. Science 280,1262-1265. Cardinale, F., Jonak, C , Ligterink, W., Niehaus, K., Boiler, T. and Hirt H. (2000) Differential activation of four specific MAPK pathways by distinct elicitors. J . Biol. Chem. 275, 36734-36740. 135 Cardinale, F., Meskiene, I., Ouaked, F. and Hirt, H. (2002) Convergence and divergence of stress-induced mitogen-activated protein kinase signaling pathways at the level of two distinct mitogen-activated protein kinase kinases. Plant Cell 14, 703-711. Caselli, A., Marzocchini, R., Camici, G., Manao, G., Moneti, G., Pieraccini, G., and Ramponi, G. (1998) The inactivation mechanism of low molecular weight phosphotyrosine-protein phosphatase by H 2 0 2 . J . Biol. Chem. 273, 32554-32560. Castillo, F.J. and Heath, R.L. (1990) Ca2+ transport in membrane vesicles from Pinto bean leaves and its alteration after ozone exposure. Plant Physiol. 94,788-795. Chameides, W.L. (1989) The chemistry of ozone deposition to plant leaves: Role of ascorbic acid. Environ. Sci. Technol 23, 595-600. Chameides, W. L. and Lodge, J.P. (1992) Tropospheric ozone: formation and fate. In surface level ozone exposures and their effects on vegetation (Lefohn, A.S., ed.). Chelsea, Ml: Lewis Publishers, pp. 5-30. Chameides, W.L., Kasibhatla, P. S., Yienger, J. and Levy II, H. (1994) Growth of continental-scale metro-agro-plexes, regional ozone pollution, and world food production. Science 264, 74-77. Chamnongpol, S., Willekens, H., Moeder, W., Langebartels, C , Sandermann, H., Jr., Van Montagu, M., Inze, D., and Van Camp, W. (1998) Defense activation and enhanced pathogen tolerance induced by H 2 0 2 in transgenic tobacco. Proc. Natl. Acad. Sci. USA 95, 5818-5823. Chandra, S. and Low, P.S. (1995) Role of phosphorilation in elicitation of the oxidative burst in cultured soybean cells. Proc. Natl. Acad. Sci. USA 92, 4120-4123. Chang, L. and Karin, M. (2001) Mammalian MAP kinase signalling cascades. Nature 410, 37-40. 136 Clayton, H., Knight, M.R., Knight, H., McAinsh, M.R. and Hetherington, A.M. (1999) Dissection of the ozone-induced calcium signature. Plant J . 17, 575-579. Conklin, P.L. and Last, R.L. (1995) Differential accumulation of antioxidant mRNAs in Arabidopsis thaliana exposed to ozone. Plant Physiol. 109, 203-212. Conklin, P.L., Williams, E.H. and Last, R.L. (1996) Environmental stress sensitivity of an ascorbic acid-deficient Arabidopsis mutant. Proc Natl Acad Sci USA 93, 9970-9974. Darrall, N.M. (1989) The effect of air pollutants on physiological processes in plants. Plant Cell Environ. 12,1-30. Delladone, M., Xia, Y., Dixon, R.A. and Lamb, C , (1998) Nitric oxide functions as a signal in plant disease resistance. Nature 394, 585-588. Demerjian, K.L. (1986) Atmospheric chemistry of ozone and nitrogen oxides. In Air pollutants and their effects on the terrestrial ecosystems (Legge, A.H. and Krupa, S.V., eds.). New York: John Wiley & Sons, pp. 105-127. Demple, B. (1997) Study of redox-regulated transcription factors in prokaryotes. Methods Enzymol. 11,267-278. Demple, B., (1996) Redox signaling and gene control in the Escherichia coli soxRS oxidative stress regulon - a review. Gene 179, 53-57. Desikan, R., Hancock, J.T., Coffey, M.J. and Neill, S.J. (1996) Generation of active oxygen in elicited cells of Arabidopsis thaliana is mediated by a NADPH oxidase-like enzyme. FEBS letters 382, 213-217. Desikan, R., Reynolds, A., Hancock, J.T. and Neill, S.J. (1998) Harpin and hydrogen peroxide both initiate programmed cell death but have differential effects on defence gene expression in Arabidopsis suspension cultures. Biochem. J . 330,115-120. 137 Desikan, R., Clarke, A. , Atherfold, P., Hancock, J. T. and Neil), S. J. (1999) Harpin induces mitogen-activated protein kinase activity during defence responses in Arabidopsis thaliana suspension cultures. Planta 210, 97-103. Desikan, R., Hancock, J.T., Ichimura, K., Shinozaki, K. and Neill S. J. (2001a) Harpin induces activation of the Arabidopsis mitogen-activated protein kinases AtMPK4 and AtMPK6. Plant Physiol. 126, 1579-1587. Desikan, R., A-H-Mackerness, S., Hancock, J.T. and Neill, S.J. (2001b) Regulation of the Arabidopsis transcriptome by oxidative stress. Plant Physiol. 127,159-72. Dietrich, A., Mayer, J.E. and Hahlbrock.K. (1990). Fungal elicitor triggers rapid, transient and specific protein phosphorylation in parsley cell suspension cultures. J . Biol. Chem. 265, 6360-6368. Dong, X. (1998) SA, JA, ethylene, and disease resistance in plants. Curr. Opin. Plant Biol. 1, 316-323. Dorey, S., Kopp, M., Geoffroy, P., Fritig, B. and Kauffmann, S. (1999) Hydrogen peroxide from the oxidative burst is neither necessary nor sufficient for hypersensitive cell death induction, phenylalanine ammonia lyase stimulation, salicylic acid accumulation, or scopoletin consumption in cultured tobacco cells treated with elicitin. Plant Physiol. 121, 163-72. Draper, J. (1997) Salicylate, superoxide synthesis and cell suicide in plant defense. Trends Plant Sci. 2,162-165. Eckey-Kaltenbach, H., Ernst, D., Heller, W. and Sandermann Jr., H. (1994) Biochemical plant responses to ozone. IV. Plant Physiol. 104, 67-74. English, J., Pearson, G., Wilsbacher, J., Swantek, J., Karandikar, M., Xu, S. and Cobb, M.H. (1999) New insights into the control of MAP kinase pathways. Exp. Cell Res. 253, 255-70. 138 Fazioli, F., Minichiello, L., Matoska, V., Castagnino, P., Miki, T., Wong, W.T. and Di Fiore, P.P. (1993) Eps8, a substrate for the epidermal growth factor receptor kinase, enhances EGF-dependent mitogenic signals. EMBO J. 12, 3799-3808. Feher, J., Csomos, G. and Vereckei, A. (1987) Free radical reactions in medicine (Feher, J . , Csomos, G. and Vereckei, A., eds.). Berlin: Springer-Verlag, pp. 19-37. Fink, S. (1991) Unusual patterns in the distribution of calcium oxalate in spruce needles and their possible relationships to the impact of pollutants. New Phytol. 119, 41-51. Fry, S.C., Willis, S.C and Paterson, A.E. (2000) Intraprotoplasmic and wall-localised formation of arabinoxylan-bound diferulates and larger ferulate coupling-products in maize cell-suspension cultures. Planta. 211, 679-692. Frye, C.A., Tang, D. and Innes, R.W. (2001) Negative regulation of defense responses in plants by a conserved MAPKK kinase. Proc. Natl. Acad. Sci. USA 98, 373-378. Fukunaga, R. and Hunter, T. (1997) MNK1, a new MAP kinase-activated protein kinase, isolated by a novel expression screening method for identifying protein kinase substrates. EMBO J. 16, 1921-33. Gaffney, T. , Friedrich, L. , Vernooij, B. , Negrotto, D. , Nye, G. , Uknes, S. , Ward, E., Kessmann, H. and Ryals, J. (1993) Requirement of salicylic acid for the induction of systemic acquired resistance. Science 261, 754 - 756. Graier, W.F., Hoebel, B.G., Paltauf-Doburzynska, J. and Kostner, G.M. (1998) Effects of superoxide anions on endothelial C a 2 + signaling pathways. Arterioscler. Thromb. Vase. Biol. 18,1470-1479. Grant, J.J. and Loake, G.J. (2000) Role of reactive oxygen intermediates and cognate redox signaling in disease resistance. Plant Physiol. 124, 21-29. 139 Grant, J. J., Yun, B. W. and Loake, G. J. (2000) Oxidative burst and cognate redox signalling reported by luciferase imaging: identification of a signal network that functions independently of ethylene, SA and Me-JA but is dependent on MAPKK activity. Plant J . 24,569-582. Green, R. and Fluhr, R. (1995) UV-B-induced PR-1 accumulation is mediated by active oxygen species. Plant Cell 7, 203-212. Greenberg, J.T., Silverman, F.P. and Liang, H. (2000) Uncoupling salicylic acid-dependent cell death and defense-related responses from disease resistance in the Arabidopsis mutant acd5. Genetics 156, 341-350. Guyton, K.Z., Liu, Y., Gorospe, M., Xu, Q. and Holbrook, N.J. (1996) Activation of mitogen-activated protein kinase by H 2 0 2 . J . Biol. Chem. 271, 4138-4142. Grimes, H. D., Perkins, K. K. and Boss, W. F. (1983) Ozone degrades into hydroxyl radical under physiological conditions. Plant Physiol. 72, 1016-1020. Guyton, K.Z., Liu, Y., Gorospe, M., Xu, Q. and Holbrook, N.J. (1996) Activation of mitogen-activated protein kinase by H2O2. J . Biol. Chem. 271, 4138-4142. Hahlbrock, K., Scheel, D., Logemann, E., Nurnberger, T., Parniske, M., Reinold, S., Sacks, W.R. and Schmelzer, E. (1995) Oligopeptide elicitor-mediated defense gene activation in cultured parsley cells. Proc. Natl. Acad. Sci. USA 92, 4150-4157. Hammond-Kosack, K.E. and Jones, J.D.G. (1996) Resistance gene-dependent plant defense responses. Plant Cell 8, 1773-1791. Han, J., Jiang, Y., Li, Z., Kravchenko, V.V. and Ulevitch, R.J. (1997). Activation of the transcription factor MEF2C by the MAP kinase p38 in inflammation. Nature 386, 296-299. 140 He C-J, Morgan, P.W. and Drew, M.C. (1996) transduction of an ethylene signal is required for cell death and lysis in the root cortex of maize during aerenchyma formation induced by hypoxia. Plant Physiol. 112, 463-472. Heagle, A.S. (1989) Ozone and crop yield. Ann. Rev. Phytopathol. 27, 397-423. Heath, R.I. (1988) Biochemical mechanisms of pollutant stress. In Assessment of crop loss from air pollutants (Heck, W.N., Taylor, 0,C. and Tingey, D.T., eds.). London: Elsevier, pp. 259-286. Heimovaara-Dijkstra, S., Testerink, C. and Wang, M. (2000) Mitogen-activated protein kinase and abscisic acid signal transduction. Results Probl. Cell Differ. 27,131-144. Hewitt, N.C., Kok, G.L. and Fall, R. (1990) Hydroperoxides in plants exposed to ozone mediate air pollution damage to alkene emitters. Nature 344, 56-58. Hirt, H. (1997) Multiple roles of MAP kinases in plant signal transduction, Trends Plant Sci. 2, 11-15. Holsters, M., de Waele, D., Depicker, A., Messens, E., van Montagu, M. and Schell, J. (1978). Transfection and transformation of A. tumefaciens. Mol. Gen. Genet. 163, 181-187. Horsch, R.B., Fry, J.E., Hoffmann, N.L., Eichholtz D, Rogers, S.G. and Fraley, R.T. (1985) A simple and general method for transferring genes into plants. Science 227, 1229-1231. Hoyos, M.E. and Zhang, S. (2000). Calcium-independent activation of salicylic acid-induced protein kinase and a 40-kilodalton protein kinase by hyperosmotic stress. Plant Physiol. 122, 1355-1363. Horvath, D.M., Huang, D.J. and Chua, N. (1998) Four classes of Salicylate-induced tobacco genes. Mol. Plant Microbe Interact. 11, 895-905. 141 Hunter, T. and Karin, M. (1992) Regulation of transcription by phosphorylation. Cell, 70, 375-387. Ichimura, K., Mizoguchi, T., Yoshida, R., Yuasa, T. and Shinozaki K. (2000) Various abiotic stresses rapidly activate Arabidopsis MAP kinases ATMPK4 and ATMPK6. Plant J. 24, 655-665. Ichimura,K., Tena, G., Henry.Y., Zhang, S., Hirt, H., Ellis, B.E., Morris, P.C., Wilson, C , Champion, A., Innes, R.W., Sheen, J., Ecker, J.R., Scheel, D., Klessig, D.F., Machida, Y., Mundy, J., Ohashi, Y., Kreis, M., Heberle-Bors, E., Walker, J.C. and Shinozaki, K. (2002) Mitogen-activated protein kinase cascades in plants.Nomenclature of Arabidopsis MAP kinases (MPKs)and MAP kinase kinases (MKKs). Trends Plant Sci. 7, 301-308. Jabs.T., Dietrich, R.A. and Dangl, J. (1996) Initiation of runaway cell death in an Arabidopsis mutant by extracellular superoxide. Science 273, 1853-1856. Jabs, T. (1999) Reactive oxygen intermediates as mediators of programmed cell death in plants and animals. Biochem. Pharmacol. 57, 231-245. Jaspers, I., Chen, L.C. and Flescher, E. (1998) Induction of interleukin-8 by ozone is mediated by tyrosine kinase and protein kinase A, but not by protein kinase C. J . Cell. Physiol. 177, 313-323. Jonak, C , Kiegerl, S., Ligterink, W., Barker, P.J., E., Huskisson, N.S. and Hirt, H. (1996) Stress signaling in plants: a mitogen-activated protein kinase pathway is activated by cold and drought. Proc. Natl. Acad. Sci. USA, 93,11274-11279. Kallunki, T., Deng, T., Hibi, M. and Karin, M. (1996) c-Jun can recruit JNK to phosphorylate dimerization partners via specific docking interactions. Cell 87, 929-939. Kangasjarvi, J., Talvinen, J., Utriainen, M. and Karjalainen, R. (1994) Plant defense systems induced by ozone. Plant Cell Environ. 17, 783-794. 142 Kanofsky, J.R. and Sima, P.D. (1995) Singlet oxygen generation from the reaction of ozone with plants. J . Biol. Chem. 270, 7850-7852. Kanofsky, J.R. and Sima, P.D. (2000) Assay for singlet oxygen generation by plant leaves exposed to ozone. Methods Enzymol. 319, 512-520. Kawano, T., Sahashi, N., Takahashi,K., Uozumi, N. and Muto, S. (1998) Salicylic Acid induces superoxide generation followed by an increase in cytosolic calcium ion in tobacco suspension culture: The earliest events in signal transduction. Plant Cell Physiol. 39, 721-730. Keller, T., Damude, H.G., Werner, D., Doerner, P., Dixon, R.A. and Lamb, C. (1998) A plant homolog of the neutrophil NADPH oxidase gp91phox subunit gene encodes a plasma membrane protein with Ca2+ binding motifs. Plant Cell 10, 255-66. Kieber, J.J., Rothenberg, M., Roman, G., Feldmann, K.A. and Ecker, J.R. (1993) CTR1, a negative regulator of the ethylene response pathway in Arabidopsis, encodes a member of the raf family of protein kinases. Cell 72, 427-441. Kieber, J.J. (1997) The ethylene response pathway in Arabidopsis. Annu. Rev. Plant Physiol. Plant Mol. Biol. 48, 277-296. Kiegerl, S., Cardinale, F., Siligan, C , Gross, A., Baudouin, E., Liwosz, A., Eklof, S., Till, S., Bogre, L, Hirt, H. and Meskiene, I. (2000) SIMKK, a mitogen-activated protein kinase (MAPK) kinase, is a specific activator of the salt stress-induced MAPK, SIMK. Plant Cell 12, 2247-2258. Klessig, D.F. and Malamy, J. (1994) The salicylic acid signal in plants. Plant Mol. Biol. 26: 1439-1458. Klessig, D.F., Durner, J., Noad, R., Navarre, D.A., Wendehenne, D., Kumar, D., Zhou, J.M., Shah, J., Zhang, S., Kachroo, P., Trifa, Y., Pontier, D., Lam, E. and 143 Silva, H. (2000) Nitric oxide and salicylic acid signaling in plant defense. Proc. Natl. Acad. Sci. USA 97, 8849-8855. Kley, D., Kleinmann, M., Sanderman, H. and Krupa, S. (1999) Photochemical oxidants: state of the science. Environ. Pollut. 100,19-42. Knight, H. (2000) Calcium signaling during abiotic stress in plants. Int. Rev. Cytol. 195, 269-324. Koch, J.R, Creelman, R.A, Eshita, S.M, Seskar, M, Mullet, J.E and Davis, K.R. (2000) Ozone sensitivity in hybrid poplar correlates with insensitivity to both salicylic acid and jasmonic acid. The role of programmed cell death in lesion formation. Plant Physiol. 123, 487-96. Knetsch, M.L.W., Wang, M., Snaar-Jagalska, B.E. and Himovaara-Dijkstra, S. (1996) Abscisic acid induces mitogen-activated protein kinase activation in barley aleurone protoplasts. Plant Cell 8,1061-1067. Koiwa, H., Bressan, R.A. and Hasegawa, P.M. (1997) Regulation of proteinase inhibitors and plant defense. Trends Plant Sci. 2, 379-384. Kovtun, Y., Chiu, W.L., Zeng, W. and Sheen, J. (1998) Suppression of auxin signal transduction by a MAPK cascade in higher plants. Nature 395, 716-720. Kovtun, Y., Chiu, W.-L., Tena, G. and Sheen, J. (2000) Functional analysis of oxidative stress-activated mitogen-activated protein kinase cascade in plants. Proc. Natl. Acad. Sci. USA 97, 2940-2945. Krupa, S.V. and Manning, W.J. (1988) Atmospheric ozone: Formation and effects on vegetation. Environ. Pollut. 50,101-137. Krupa, S.V., Manning, W.J. and Nosal, M. (1993) Use of tobacco in cultivars as biological indicators of ambient ozone pollution:.An analysis of exposure-response relationships. Environ. Pollut. 90,137-146. 144 Kiiltz, D. (1998) Phylogenetic and functional classification of mitogen- and stress-activated protein kinases. J . Mol. Evol. 46, 571-588. Kumar, D. and Klessig, D. F. (2000) Differential induction of tobacco MAP kinases by the defense signals nitric oxide, salicylic acid, ethylene, and jasmonic acid. Mol. Plant Microbe Interact. 13, 347-351. Kyriakis, J.M., Banerjee, P., Nikolakaki, E., Dai, T., Rubie, E.A., Ahmad, M.F., Avruch, J. and Woodgett, J.R. (1994) The stress-activated protein kinase subfamily of c-Jun kinases. Nature 369, 156-160. Kyriakis, J.M. and Avruch, J. (2001). Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiol. Rev. 81, 807-869. Laisk, A., Kull, O. and Moldau, H. (1989) Ozone concentration in leaf intercellular air spaces is close to zero. Plant Physiol. 90,1163-1167. Lamb , C. and Dixon, R.A. (1997) The oxidative burst in plant disease resistance. Ann. Rev. Plant Physiol. Plant Mol. Biol., 48, 251-275. Lander, H.M., Ogiste, J.S., Teng, K.K. and Novogrodsky, A. (1995) p21ras as a common signaling target of reactive free radicals and cellular redox stress. J . Biol. Chem. 270, 21195-21198. Langebartels, C , Kerner, K., Leonardi, S., Schraudner, M., Trost, M., Heller, W. and Sandermann Jr., H. (1991) Biochemical plant responses to ozone. I Differential induction of polyamine and ethylene biosynthesis in tobacco. Plant Physiol. 95, 882-889. Lawton, K., Weymann, K., Friedrich, L., Vernooij,vB., Uknes, S. and Ryals, J. (1995) Systemic acquired resistance in Arabidopsis requires salicylic acid but not ethylene. Mol. Plant Microbe Interact. 8, 863-870. 145 Lazazzera, B.A., Beinert, H., Khoroshilova, N., Kennedy, M.C. and Kiley, P.J. (1996) DNA binding and dimerization of the Fe-S-containing FNR protein from Escherichia coli are regulated by oxygen. J . Biol. Chem. 271, 2762-2768. Lebrun-Garcia, A., Ouaked, F., Chiltz, A. and Pugin, A. (1998) Activation of MAPK homologues by elicitors in tobacco cells. Plant J . 15, 773-781. Lee, J., Klessig, D.F. and Nurnberger, T. (2001) A harpin binding site in tobacco plasma membranes mediates activation of the pathogenesis-related gene HIN1 independent of extracellular calcium but dependent on mitogen-activated protein kinase activity. Plant Cell 13, 1079-1093. Legendre, L., Yuch, Y.G., Crain, R., Haddock, N. and Heinstein, P.F. (1993) Phospholipase C activation during elicitation of the oxidative burst in cultured plant cells. J. Biol. Chem. 268, 24559-24563. Levine, A., Tenhaken, R., Dixon, R. and Lamb, C. (1994) H2O2 from the oxidative burst orchestrates the plant hypersensitive disease resistance response. Cell 79, 583-593. Ligterink, W., Kroj.T., Nieden, U., Hirt, H. and Scheel, D. (1997) Receptor-mediated activation of a MAP kinase in pathogen defense of plants. Science 276, 2054-2057. Linford, N. J., Yang, Y, Cook, D. G. and Dorsa DM. (2001) Neuronal apoptosis resulting from high doses of the isoflavone genistein: role for calcium and p42/44 mitogen-activated protein kinase. J. Pharmacol. Exp. Ther. 299, 67-75. Liu, Y., Zhang, S. and Klessig, D.F. (2000) Molecular cloning and characterization of a tobacco MAP kinase kinase that interacts with SIPK. Mol. Plant Microbe Interact. 13, 118-124. Lynch, A.S. and Lin, E.C. (1996) Transcriptional control mediated by the ArcA two-component response regulator protein of Escherichia coli: characterization of DNA binding at target promoters. J . Bacteriol. 178, 6238-49. 146 Malamy, J . and Klessig, D.F. (1992) Salicylic acid and plant disease resistance. Plant J . 2, 643-654. Manning, W.J. and Krupa, S.V. (1992) Experimental methodology for studying the effects of ozone on crops and trees. In: Surface level ozone exposures and their effects on vegetation. (Lefohn, A.S., ed.). Chelsea, Ml: Lewis Publishers, pp. 93-153. McDowell, J.M. and Dangl, J.L. (2000) Signal transduction in the plant immune response. Trends Biochem. Sci. 25, 79-82. McMichael, A .J. (2001) Impact of climatic and other environmental changes on food production and population health in the coming decades. Proc. Nutr. Soc. 60,195-201. Mehdy, M. C. (1994) Active oxygen species in plant defense against pathogens. Plant Physiol. 105, 467-472. Mehdy, M.C., Sharma, Y.K., Sathasivan, K. and Bays, N.W. (1996) The role of activated oxygen species in plant disease resistance. Physiologia Plantarum, 98, 365-374. Mehlhorn, H. and Wellburn, A.R. (1987) Stress ethylene formation determines plant sensitivity to ozone. Nature 327, 417-418. Meskiene, I., Bogre, L., Glase, W., Balog, J . , Brandstotter, M., Zwerger, K., Ammerer, G. and Hirt, H. (1998) MP2C, a plant protein phosphatase 2C, functions as a negative regulator of mitogen-activated protein kinase pathways in yeast and plants. Proc. Natl. Acad. Sci. USA 95,1938-1943. Mikolajczyk, M., Awotunde, O.S., Muszynska, G., Klessig, D.F. and Dobrowolska, G. (2000) Osmotic stress induces rapid activation of a salicylic acid-induced protein kinase and a homolog of protein kinase ASK1 in tobacco cells. Plant Cell 12, 165-178. Miles, G. P., Samuel, M. A. and Ellis, B. E. (2002) Suramin inhibits oxidant-147 induced MAPK signalling in plants. Plant Cell Environ. 25, 521-527. Milligan,S.A., Owens, M.W. and Grisham, M.B.(1998) Differential regulation of Extracellular signal-regulated kinase and Nuclear factor-icB signal transduction pathways by hydrogen peorxide and tumor necrosis factor. Arch. Biochem. Biophys. 352, 255-262. Millward, T.A., Zolnierowicz, S. and Hemmings, B.A. (1999) Regulation of protein kinase cascades by protein phosphatase 2A. Trends Biochem. Sci. 24, 186-191. Mittler, R., Herr, E.H., Orvar, B.L., van Camp, W., Willekens, H., Inze, D. and Ellis, B.E. (1999) Transgenic tobacco plants with reduced capability to detoxify reactive oxygen intermediates are hyperresponsive to pathogen infection. Proc. Natl. Acad. Sci. USA, 96, 14165-70. Mizoguchi, T., Ichimura, K. and Shinozaki, K. (1997) Environmental stress response in plants: the role of mitogen-activated protein kinases. Trends Biotech. 15,15-19. Mockaitis, K. and Howell, S.H. (2000) Auxin induces mitogenic activated protein kinase (MAPK) activation in roots of Arabidopsis seedlings. Plant J . 24, 785-796. Monroy, A.F. and Dhindsa, R.S. (1995) Low-temperature signal transduction: Induction of cold acclimation-specific genes of alfalfa by calcium at 25°C. Plant Cell 7, 321-331. Moore, T., Martineau, B., Bostock, R.M., Lincoln, J.E. and Gilchrist, D.G. (2000) Molecular and genetic characterization of ethylene involvement in mycotoxin-induced plant cell death. Physiol. Mol. Plant Pathol. 54, 73-85. Morris P.C. (2001) MAP kinase signal transduction pathways in plants. New Phytol. 151,67-89. Mullineaux, P., Ball, L., Escobar, C , Karpinska, B., Creissen, G. and Karpinski, S. (2000) Are diverse signalling pathways integrated in the regulation of Arabidopsis 148 antioxidant defence gene expression in response to excess excitation energy? Philos Trans. R. Soc. Lond. B. Biol. Sci. 355, 1531-1540. Mur, L.A., Bi, Y.M., Darby, R.M., Firek, S. and Draper, J. (1997) Compromising early salicylic acid accumulation delays the hypersensitive response and increases viral dispersal during lesion establishment in TMV-infected tobacco. Plant J . 12,1113-1126. Murashige, T. and Skoog, F. (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Plant Physiol. 15 ,473-497. Nathan, C. (1995) Natural resistance and nitric oxide. Cell 82, 873-876. Neuenschwander, U., Vernooij, B., Friedrich, L, Uknes, S., Kessmann.H. and Ryals, J. (1995) Is hydrogen peroxide a second messenger of salicylic acid in systemic acquired resistance? Plant J. 8,227-233. Nishihama, R., Ishikawa, M., Araki, S., Soyano, T., Asada, T. and Machida Y. (2001) The NPK1 mitogen-activated protein kinase kinase kinase is a regulator of cell-plate formation in plant cytokinesis. Genes Dev. 15, 352-363. Nose, K. (2000) Role of reactive oxygen species in the regulation of physiological functions. Bio. Pharm. Bull. 23, 897-903. Nurnberger, T., Nennstiel, D., Jabs, T., Sacks, W.R., Hahlbrock, K. and Scheel, D. (1994) High affinity binding of a fungal oligopeptide elicitor to parsley membranes triggers multiple defense responses. Cell 78, 449-460. Niihse, T. S., Peck, S.C., Hirt, H. and Boiler, T. (2000) Microbial elicitors induce activation and dual phosphorylation of the Arabidopsis thaliana MAPK 6. J . Biol. Chem. 17, 7521-7526. Ohlsson, A.B., Berglund, T., Komlos, P. and Rydstrom, J. (1995) Plant defense metabolism is increased by the free radical-generating compound AAPH. Free Radic. Biol. Med. 19, 319-327. 149 O'Kane, D., Gill, V., Boyd, P. and Burdon, R. (1996) Chilling, oxidative stress and antioxidant responses in Arabidopsis thaliana callus. Planta 198, 371-377. Ohme-Tagkagi, M. and Shinshi, H. (1995) Ethylene-inducible DNA binding proteins that interact with an ethylene-responsive element. Plant Cell 7,173-182. Olson, P. D. and Varner, J. E. (1993) Hydrogen peroxide and lignification. Plant J. 4, 887-892. Orozco-Cardenas, M., Narvaez-Vasquez, J. and Ryan C. (2001) Hydrogen peroxide acts as a second messenger for the induction of defense genes in tomato plants in response to wounding, systemin, and methyl jasmonate. Plant Cell 13, 179-191. Orvar, B.L., McPherson, J. and Ellis, B.E. (1997) Pre-activating wounding response in tobacco prior to high-level ozone exposure prevents necrotic injury, Plant J . 11, 203-212. Orvar, B.L. and Ellis, B.E. (1997) Transgenic tobacco plants expressing antisense RNA for cytosolic ascorbate peroxidase show increased susceptibility to ozone injury. Plant J . 11, 1297-1305. Overmyer, K., Tuominen, H., Kettunen, R., Betz, C , Langebartels, C , Sandermann, H., Jr. and Kangasjarvi, J. (2000) Ozone-Sensitive Arabidopsis rcdl Mutant Reveals Opposite Roles for Ethylene and Jasmonate Signaling Pathways in Regulating Superoxide-Dependent Cell Death. Plant Cell 12, 1849-1862. Pauls, K.P. and Thompson, J.E. (1980) In vitro simulation of senescence-related membrane damage by ozone-induced lipid peroxidation. Nature 283, 504-506. Paumelle, R., Tulasne, D., Leroy, C , Coll, J. , Vandenbunder, B. and Fafeur, V. (2000) Sequential activation of ERK and repression of JNK by scatter factor/hepatocyte growth factor in Madin-Darby canine kidney epithelial cells. Mol. 150 Biol. Cell 11, 3751-3763. Pearson, G., Robinson, F., Beers Gibson, T., Xu, B.E., Karandikar, M., Berman, K. and Cobb, M.H. (2001) Mitogen-activated protein (MAP) kinase pathways: regulation and physiological functions. Endocr. Rev. 22,153-183. Peck, S.C., Nuhse, T.S., Hess, D., Iglesias, A., Meins, F. and Boiler, T. (2001) Directed proteomics identifies a plant-specific protein rapidly phosphorylated in response to bacterial and fungal elicitors. Plant Cell 13,1467-1475. Pell, E. J., Eckardt, N.A. and Enyedi, A.J. (1992) Timing of ozone stress and resulting status of ribulose bisphosphate carboxylase/oxygenase and associated net photosynthesis. New Phytol. 120, 397-405. Pell, E., Schlagnhaufe, CD. and Arteca, R.N. (1997) Ozone-induced oxidative stress: mechanisms of action and reaction. Physiol. Plant. 100, 264-273. Pellinen, R., Palva, T. and Kangasjarvi, J. (1999) Subcellular localization of ozone-induced hydrogen peroxide production in birch (Betula pendula) leaf cells. Plant J . 20, 349-356. Pennell, R.I. and Lamb, C J . (1997) Programmed cell death in plants. Plant Cell 9, 1157-1168. Penninckx, I.A., Eggermont.K., Terras,.F.R., Thomma, B.P., De Samblanx, G.W., Buchala, A., Metraux, J.P., Manners, J.M. and Broekaert, W.F. (1996) Pathogen-induced systemic activation of a plant defensin gene in Arabidopsis follows a salicylic acid-independent pathway. Plant Cell 8, 2309-2323. Petersen, M., Brodersen, P., Naested, H., Andreasson, E., Lindhart, U., Johansen, B., Nielsen, H.B., Lacy, M., Austin, M.J., Parker, J.E., Sharma, S.B., Klessig, D.F., Martienssen, R., Mattsson, O., Jensen, A.B. and Mundy, 151 J. (2000) Arabidopsis map kinase 4 negatively regulates systemic acquired resistance. Cell 103,1111-1120. Piedras, P., Hammond-Kosack, K.E., Harrison, K. and Jones, J.D.G. (1998) Rapid, Cf-9- and Avr9-dependent production of active oxygen species in tobacco suspension cultures. Mol. Plant Microbe interact. 11,1155-1166. Pieterse, C.J.M. and van Loon, L.C. (1999) Salicylic acid-independent plant defense pathways. Trends Plant Sci. 4, 52-58. Prasad, T., Anderson, M.D., Martin, B.A. and Stewart, C.R. (1994) Evidence for chilling-induced stress in maize seedlings and a regulatory role for hydrogen peroxide. Plant Cell 6, 65-74. Price, A., Knight, Taylor, A., Ripley, S.J., Griffiths, A., Trewavas, A.J. and Knight, M. (1994) Oxidative signals in tobacco increase cytosolic calcium, The Plant Cell 6, 1301-1310 Price, A., Knight, M., Knight, H., Cuin, T., Tomos, D. and Ashenden, T. (1996) Cytosolic calcium and oxidative plant stress. Biochem Soc. Trans. 24, 479-483. Rao, M.V. and Davis, K.R. (1999) Ozone-induced cell death occurs via two distinct mechanisms in Arabidopsis: the role of salicylic acid. Plant J . 17, 603-614. Rao, M.V. and Davis, K.R. (2001) The physiology of ozone induced cell death. Planta213, 682-90. Rao, M.V., Lee, H., Creelman, R. A., Mullet, J. E. and Davis, K.R. (2000) Jasmonic Acid Signaling Modulates Ozone-Induced Hypersensitive Cell Death. Plant Cell 12, 1633-1646. 152 Ray, L.B. and Sturgill, T.W. (1987) Rapid stimulation by insulin of a serine/threonine kinase in 3T3-L1 adipocytes that phosphorylates micro-tubule-associated protein 2 in vitro. Proc. Natl. Acad. Sci. USA , 84,1502-1506. Ren, D., Yang, H. and Zhang, S. (2002) Cell death mediated by MAPK is associated with hydrogen peroxide production in Arabidopsis. J . Biol. Chem. 277, 559-565. Richberg, M. H., Aviv, D. H. and Dangl, J. L. (1998) Dead cells do tell tales. Curr. Opin. Plant Biol. 1, 480-485. Riechmann, J.L., Heard, J., Martin, G., Reuber, L, Jiang, C , Keddie, J., Adam, L , Pineda, O., Ratcliffe, O.J., Samaha, R.R, Creelman, R., Pilgrim, M., Broun, P., Zhang, J.Z., Ghandehari, D., Sherman, B.K. and Yu, G. (2000) Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes. Science 290, 2105-2110. Romeis, T., Piedras, P., Zhang, S. and Klessig, D.F. Hirt, H. and Jones, J. (1999) Rapid Avr9- and Cf-9 dependent activation of MAP kinases in tobacco cell cultures and leaves: Convergence of resistance gene, elicitor, wound and salicylate response. Plant Cell, 11,273-287. Runeckles.V.C. and Chevvone, B.I. (1992) Crop response to ozone . In surface level ozone exposures and their effects on vegetation (Lefohn.A.S., ed.). Chelsea, MI:Lewis Publishers, pp. 189-270. Runeckles, V.C. and Krupa, S.V. (1994) The impact of UV-B radiation and ozone on terrestrial vegetation. Environ. Pollut. 83,191-213. Runeckles,V.C. and Vaartnou, M. (1997) EPR evidence for superoxide anion formation in leaves during exposure to low levels of ozone. Plant, Cell and Environ. 20, 306-314. 153 Rusterucci, C , Montillet, J. L., Agnel, J. P., Battesti, C , Alonso, B., Knoll, A., Bessoule, J. J., Etienne, P., Suty, L., Blein, J. P. and Triantaphylides, C. (1999) Involvement of lipoxygenase-dependent production of fatty acid hydroperoxides in the development of the hypersensitive cell death induced by cryptogein on tobacco leaves. J Biol. Chem. 274, 36446-55. Ryals, J., Uknes, S. and Ward, E. (1994) Systemic aquired resistance. Plant Physiol. 104, 1109-1112. Salter, L. and Hewitt, C.N. (1992) Ozone-hydrocarbon interactions in plants. Phytochemistry 31,4045-4050. Samanta.S., Perkinton, M.S., Morgan, M. and Williams,R.J. (1998) Hydrogen peroxide enhances signal-responsive arachidonic acid release from neurons: role of mitogen-activated protein kinase. J. Neurochem. 70, 2082-2090. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Sandermann, H., Ernst, D., Heller, W. and Langerbartels, C. (1998) Ozone: an abiotic elicitor of plant defence reactions. Trends Plant Sci. 3, 47-50. Sangwan, V., Foulds, I., Singh, J. and Dhindsa, R.S. (2001) Cold-activation of Brassica napus BN115 promoter is mediated by structural changes in membranes and cytoskeleton, and requires Ca2+ influx. Plant J. 27,1-12. Sather, M.E., Varns, J.L., Mulik, J.D., Glen, G., Smith, L. and Stallings, C. (2001) Passive ozone network of Dallas: a modeling opportunity with community involvement. Environ. Sci. Technol. 35, 4426-4435. Schaller, A. and Ryan, C.R. (1996) Systemin - a polypeptide defense signal in plants. Bio Essays 18, 27-33. 154 Schraudner, M., Ernst, D., Langerbartels, C. and Sandermann, H. (1992) Biochemical responses to ozone. III. Activation of the defense-related proteins B-1,3-glucanase and chitinase in tobacco leaves. Plant Physiol. 99,1321-1328. Schraudner, M., Langerbartels, C. and Sandermann, H. (1997) Changes in the biochemical status of plant cells induced by the environmental pollutant ozone. Physiol. Plant. 100, 274-280. Schraudner, M., Moeder.W., Wiese.C. and Camp.W.V. (1998) Ozone-induced oxidative burst in the ozone biomonitor plant, tobacco Bel W3. Plant J . 16, 235-245. Schreck, R., Rieber, P. and Baeuerle, P.A. (1991) Reactive oxygen intermediates as apparently widely used messengers in the activation of the NF -KB transcription factor and HIV-1. EMBO J. 10, 2247-2258. Schubert, R., Fischer, R., Hain, R., Schreier, P. H., Bahnweg, G., Ernst, D. and Sandermann, H. (1997) An ozone-responsive region of the grapevine resveratrol synthase promoter differs from the basal pathogen-responsive sequence, Plant Mol. Biol. 34, 417-426. Schulze-Osthoff, K., Bauer,. MK., Vog, M. and Wesselborg, S. (1997) Oxidative stress and signal transduction. Int. J . Vitam. Nutr. Res. 67, 336-342. Schwechheimer, C. and Bevan, M. (1998) The regulation of transcription factor activity in plants, Trends Plant Sci. 3, 378-383. Seo, S., Okamoto, M., Seto, H., Ishizuka, K., Sano, H. and Ohashi, Y. (1995) Tobacco MAP kinase: A possible mediator in wound signal transduction pathways. Science 270, 1988-1992. Seo, S., Sano, H. and Ohashi, Y. (1999) Jamonate-based wound signal transduction requires activation of WIPK, a tobacco mitogen-activated protein kinase, Plant Cell 11, 289-298. 155 Shah, K., Liu, Y., Deirmengian, C. and Shokat, K.M. (1997) Engineering unnatural nucleotide specificity for Rous sarcoma virus tyrosine kinase to uniquely label its direct substrates. Proc. Natl. Acad. Sci. USA 94, 3565-3570. Sharma, Y.K., Leon, J., Raskin, I. and Davis, K.R. (1996) Ozone-induced responses in Arabidopsis thaliana: The role of salicylic acid in the accumulation of defense-related transcripts and induced resistance. Proc. Natl. Acad. Sci. USA 93, 5099-5104. Sharma, Y.K. and Davis, K.R. (1997) The effects of ozone on antioxidant responses in plants. Free Radic. Biol. Med. 23,480-488. Sies, H. (1991) Oxidative stress: Introduction. In Oxidative Stress: Oxidants and Antioxidants (Sies, H., ed.). London: Academic Press, pp. xv-xxii. Skolnik, E.Y, Margolis, B., Mohammadi, M., Lowenstein, E., Fischer, R., Drepps, A., Ullrich, A. and Schlessinger, J. (1991) Cloning of PI3 kinase-associated p85 utilizing a novel method for expression/cloning of target proteins for receptor tyrosine kinases.Cell 65,83-90. Smith, N. A., Singh, S. P., Wang, M. B., Stoutjesdijk, P.A., Green, A. G. and Waterhouse, P. M. (2000) Total silencing by intron-spliced hairpin RNAs. Nature 407, 319-320. Stanciu, M., Wang, Y., Kentor, R., Burke, N., Watkins, S., Kress, G., Reynolds, l.,Klann, E., Angiolieri, M. R., Johnson, J. W. and DeFranco, D. B. (2000) Persistent activation of ERK contributes to glutamate-induced oxidative toxicity in a neuronal cell line and primary cortical neuron cultures. J. Biol. Chem. 275, 12200-12206. Staskawicz, B.J., Ausubel, F.M., BAker, B.J., Ellis, J.G. and Jones, J.D.G. (1995) Molecular genetics of plant disease resistance. Science 268, 661-667. Stratmann, J.W. and Ryan, C.A. (1997) Myelin basic protein kinase activity in tomato leaves is induced systemically by wounding and increases in response to systemin and oligosaccharide elicitors. Proc. Natl. Acad. Sci. USA 94, 11085-11089. 156 Suzuki, K. and Shinshi, H. (1995) Transient activation and tyrosine phosphorylation of a protein kinase in tobacco cells treated with a fungal elicitor. Plant Cell 7, 639-647. Suzuki, K., Suzuki, N., Ohme-Takagi, M. and Shinshi, H., (1998) Immediate early induction of mRNAs for ethylene-responsive transcription factors in tobacco leaf strips after cutting, Plant J.15, 657-665. Suzuki, K., Yano, A. and Shinshi, H. (1999) Slow and prolonged activation of the p47 protein kinase during hypersensitive cell death in a culture of tobacco cells. Plant Physiol. 119, 1465-1472. Taher, M.M., Garcia, J.G. and Natarajan, V. (1993) Hydroperoxide-induced diacylglycerol formation and protein kinase C activation in vascular endothelial cells. Arch. Biochem. Biophys. 303, 260- 266. Tena, G., Asai, T., Chiu, W.L. and Sheen, J. (2001) Plant mitogen-activated protein kinase signaling cascades. Curr. Opin. Plant. Biol. 4, 392-400. Tenhaken, R., Levine, A., Brisson, L.F., Dixon, R.A. and Lamb, C. (1995) Function of the oxidative burst in hypersensitive disease resistance. Proc. Natl. Acad. Sci. USA 92, 4158-4163. Thompson, A.M., Witte, J.C., Hudson, R.D., Guo, H., Herman, J.R. and Fujiwara, M. (2001) Tropical tropospheric ozone and biomass burning. Science 291, 2128-2132. Tingey, D.T., Olszyk, D.M., Herstrom, A.A. and Lee, E.H. (1994) Effects of ozone on crops. In tropospheric ozone: human health and agricultural impacts (McKee, D.J., ed.). Boca Raton, FL: Lewis Publishers, pp. 175-206. Torres, M.A., Dangl, J.L. and Jones, J.D.G (2002) Arabidopsis gp91 p h o x homologues AtrbohD and AtrbohF are required for accumulation of reactive oxygen intermediates in the plant defense response Proc. Natl. Acad. Sci. USA 99, 517-522. 157 Tuomainen, J., Betz, C , Kangasjarvi, J., Ernst, D., Yin, Z., Langerbartels, C. and Sandermann, H. (1997) Ozone induction of ethylene emission in tomato plants: regulation by differential transcript accumulation for the biosynthetic enzymes, Plant J. 12,1151-1162. Ulm, R., Revenkova, E., di Sansebastiano, G. P., Bechtold, N. and Paszkowski J. (2001) Mitogen-activated protein kinase phosphatase is required for genotoxic stress relief in Arabidopsis. Genes Dev. 15, 699-709. Usami, S., Banno, H., Ito, Y., Nishihama, R. and Machida, Y. (1995) Cutting activates a 46-kilodalton protein kinase in plants. Proc. Natl. Acad. Sci. USA, 92, 8660-8664. Valtorta F, Schiebler, W., Jahn, R., Ceccarelli, B. and Greengard P. (1986) A solid-phase assay for the phosphorylation of protein blotted on nitrocellulose membrane filters. Anal. Biochem. 158,130-137. Van Camp, W., Van Montagu, M. and Inze, D. (1998) H 2 0 2 and NO: redox signals in disease resistance. Trends Plant Sci.. 3, 330-334. Waskiewicz, A.J., Flynn, A., Proud, C.G. and Cooper, J.A. (1997) Mitogen-activated protein kinases activate the serine/threonine kinases Mnk1 and Mnk2. EMBO J. 16, 1909-1920. Westermarck, J., Li, S. P., Kallunki, T., Han, J. and Kahari, V. M. (2001) p38 mitogen-activated protein kinase-dependent activation of protein phosphatases 1 and 2A inhibits MEK1 and MEK2 activity and collagenase 1 (MMP-1) gene expression. Mol. Cell Biol. 21,2373-2383. Wilson, C , Anglmayer, R., Vincente, O. and Heberle-Bors, E. (1995) Molecular cloning , functional expression in Escherichia coli and characterization of multiple mitogen-activated -protein kinases from tobacco. Eur. J. Biochem. 233, 249-257. Witucki, L.A., Huang, X., Shah, K., Liu, Y., Kyin, S., Eck, M.J. and Shokat, K.M. (2002) Mutant tyrosine kinases with unnatural nucleotide specificity retain 158 the structure and phospho-acceptor specificity of the wild-type enzyme. Chem. Biol. 9, 25-33. Wu, J.J. and Masten, S.J. (2002) Oxidation kinetics of phenolic and indolic compounds by ozone: applications to synthetic and real swine manure slurry. Water Res. 36, 1513-26. Yahraus, T., Chandra, S., Legendre, L. and Low, P.S. (1995) Evidence for mechanically induced oxidative burst. Plant Physiol. 109,1259-1266. Yalpani, N., Enyedi, A.J., Leon, J. and Raskin, I. (1994) Ultraviolet light and ozone stimulate accumulation of salicylic acid, pathogenesis-related proteins and virus resistance in tobacco. Planta 193, 372-376. Yang, X., Hubbard, E.J. and Carlson,M. (1992) A protein kinase substrate identified by the two-hybrid system. Science 257, 680-682. Yang, K. Y., Liu.Y. and Zhang, S. (2001) Activation of a mitogen-activated protein kinase pathway is involved in disease resistance in tobacco. Proc. Natl. Acad. Sci. USA 98, 741-746. Yuasa, T., Ichimura, K., Mizoguchi, T. and Shinozaki K. (2001) Oxidative stress activates ATMPK6, an Arabidopsis homologue of MAP kinase. Plant Cell Physiol. 42, 1012-1016. Zhang, S. and Klessig, D.F. (1997) Salicylic acid activates a 48 kD MAP kinase in tobacco. Plant Cell 9,809-824. Zhang, S. Du, H., and Klessig, D.F. (1998) Activation of the tobacco SIP kinase by both a cell wall -derived carbohydrate elicitor and purified proteinaceous elicitins from Phytophthora spp. Plant Cell 10, 435-449. 159 Zhang, S. and Klessig, D.F. (1998a) Resistance gene N-mediated de novo synthesis and activation of a tobacco mitogen-activated protein kinase by tobacco mosaic virus infection. Proc. Natl. Acad. Sci. USA 95, 7433-7438. Zhang, S. and Klessig, D. F. (1998b) The tobacco wounding-activated mitogen-activated protein kinase is encoded by SIPK. Proc. Natl. Acad. Sci. USA 95, 7225-7230. Zhang, S, Liu, Y. and Klessig, D. F. (2000) Multiple levels of tobacco WIPK activation during the induction of cell death by fungal elicitins. Plant J . 23, 339-347. Zhang, S. and Liu, Y. (2001) Activation of salicylic acid-induced protein kinase, a mitogen-activated protein kinase, induces multiple defense responses in tobacco. Plant Cell 13, 1877-1889. Zhang, S. and Klessig, D.F. (2001) MAPK cascades in plant defense signaling. Trends Plant Sci. 6, 520-527. Zhou, C , Yang.Y. and Jong, A.Y. (1990) Mini-prep in ten minutes. Bio/Techniques 8, 172-173. Zhou, J., Tang, X. and Martin, G.B. (1997) The Pto kinase conferring resistance to tomato bacterial speck disease interacts with proteins that bind a cis-element of pathogenesis-related genes. EMBO J. 16, 3207-3218. Zitomer, R.S. and Lowry, C.V. (1992) Regulation of gene expression by oxygen in Saccharomyces cerevisiae. Microbiol. Rev. 56,1-11. 160 APPENDICES A. Culture media for micropropagation of tobacco SIM SIMCCK RIMCCK PM MS salts* 4.3 4.3 4.3 4.3 Vitamin mix* 1.0 ml 1.0 ml 1.0 ml 1.0 ml Glycine 0.200 0.200 0.200 0.200 Sucrose 30.0 30.0 20.0 20.0 Agar 3.0 3.0 3.0 3.0 Phytagel 1.1 1.1 1.1 1.1 NAA (1 mg/ml) 100 ul 100 ul - -BA (1 mg/ml) 2.0 ml 2.0 ml - -pH (w/1 N KOH) 5.6 5.6 5.6 5.6 Kanamycin 0.100 0.100 -Carbenicillin 0.500 0.500 -Cefotaxime 0.250 0.250 -All values given in the table are in grams unless otherwise indicated. MS salts*: Murashige & Skoog salt mixture (Murashige and Skoog, 1962) NAA: a-naphthalene acetic acid; BA: 6-benzylamino purine B. Vitamin mix*: MS vitamins (1000 X) Chemical For 1 L of stock myo-lnositol 100.0 g Thiamine-HCI 100.0 mg Nicotinic acid 500.0 mg Pyridoxine-HCI 500.0 mg Aliquoted into 1.0 ml centrifuge tubes and store at-20°C 161 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0090657/manifest

Comment

Related Items