Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

A novel mechanism for RNase E-initiated decay of 5’-protected mRNA in Escherichia coli Baker, Kristian Eileen 2002

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2002-731278.pdf [ 8.62MB ]
Metadata
JSON: 831-1.0090574.json
JSON-LD: 831-1.0090574-ld.json
RDF/XML (Pretty): 831-1.0090574-rdf.xml
RDF/JSON: 831-1.0090574-rdf.json
Turtle: 831-1.0090574-turtle.txt
N-Triples: 831-1.0090574-rdf-ntriples.txt
Original Record: 831-1.0090574-source.json
Full Text
831-1.0090574-fulltext.txt
Citation
831-1.0090574.ris

Full Text

A N O V E L MECHANISM FOR RNASE E-INITIATED DECAY OF 5'-PROTECTED M R N A IN ESCHERICHIA COLI by KRISTIAN E I L E E N B A K E R B.Sc. (Hons.), University of Regina, 1992 M.Sc, University of Regina, 1994 A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES Genetics Graduate Program We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA April 2002 © Kristian Eileen Baker, 2002 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. The University of British Columbia Vancouver, Canada Department DE-6 (2/88) A B S T R A C T In Escherichia coli, 5'-terminal RNA stem-loop structures are major impediments to the rate-determining initiation of mRNA degradation catalyzed by the endonuclease RNase E. Protected RNAs do, nonetheless, decay at appreciable rates, and factors which enforce the initial barrier to decay or modulate an alternative decay pathway are unknown. A prosthetic RNA hairpin at the extreme 5'-terminus of a model mRNA substrate, r/w7mRNA, stabilized this RNA 6-fold against a decay-initiating RNase E cleavage. Altering the efficiency of translation or introducing premature-termination codons demonstrated that stem-loop-mediated stabilization of rpsT mRNA depended on efficient translational initiation and ribosome passage through the rate-determining RNase E cleavage site within the coding sequence. Introduction of sequences encompassing characterized RNase E cleavage sites, referred to here as 'portable' RNase E cleavage sites, from either the me mRNA leader or 9S rRNA into rpsT mRNA significantly reduced the stabilizing effects of the terminal stem-loop. Destabilization by the 'portable' cleavage sequences required active RNase E, and cleavage-site mapping demonstrated endonucleolytic cleavage within the inserted sequences. Furthermore, the efficiency of destabilization by 'portable' RNase E cleavage sites was dependent on both the primary sequence of the insert as well as its position within the 5' UTR or ORF of the stem-loop-protected rpsT mRNA. This work has led to the proposal of a model for RNase E-mediated degradation of 5'-protected mRNA involving bypass of the preferred interaction with the 5' terminus and 'internal' recognition of the mRNA substrate. Moreover, the efficiency of'internal' entry appears to be determined by the intrinsic susceptibility of the rate-limiting cleavage site alone. Finally, the involvement of the arginine-rich RNA binding domain of RNase E in the internal entry mechanism of RNA degradation is discussed. ii T A B L E O F C O N T E N T S A B S T R A C T ii T A B L E O F CONTENTS ii i LIST O F T A B L E S viii LIST O F FIGURES ix LIST O F A B B R E V I A T I O N S xi A C K N O W L E D G E M E N T S xiii C H A P T E R O N E M R N A DECAY IN ESCHERICHIA COLI 1 1.1 INTRODUCTION... 1 1.2 CURRENT M O D E L OF M R N A DECAY IN E. COLI 2 1.3 TRANS-ACTING FACTORS OF M R N A D E C A Y - T H E RIBONUCLEASES 6 1.3.1 The endonucleases 6 1.3.1.1 RNase E 6 1.3.1.2 RNase IE 15 1.3.1.3 RNase G 18 1.3.2 The Exonucleases 19 1.3.2.1 Polynucleotide phosphorylase 20 1.3.2.2 RNase II and RNase R 22 1.3.2.3 Oligoribonuclease 24 1.4 O T H E R ENZYMES OF M R N A DECAY 25 1.4.1 Poly(A) polymerase 25 1.4.2 R N A helicases 30 1.5 O T H E R PROTEIN FACTORS REGULATING M R N A DEGRADATION 30 1.6 R O L E OF TRANSLATION IN M R N A DECAY 33 1.7 RPSTMRNA AS A M O D E L SYSTEM TO EVALUATE M R N A D E C A Y 39 1.8 EXPERIMENTAL RATIONALE AND SCOPE OF THIS WORK 44 i i i C H A P T E R T W O MATERIALS AND EXPERIMENTAL PROCEDURES 46 2.1 BACTERIAL STRAINS AND PLASMID VECTORS 46 2.2 M E D I A AND C U L T U R E CONDITIONS 46 2.2.1 Induction of gene expression from pB AD-derived plasmids in vivo 49 2.3 GENETIC TECHNIQUES 49 2.3.1 Transduction 49 2.3.2 Transformation 50 2.4 RECOMBINANT D N A TECHNIQUES 50 2.4.1 Enzymes and chemicals 50 2.4.2 Molecular biological methods 51 2.4.3 Construction of plasmid vectors 54 2.5 POLYMERASE CHAIN REACTION 54 2.6 SYNTHESIS OF RADIOLABELLED R N A BY IN VITRO TRANSCRIPTION 57 2.7 ANALYSIS OF R N A BY NORTHERN HYBRIDIZATION 58 2.7.1 R N A isolation 58 2.7.2 Analysis o f R N A by Northern Hybridization 60 2.8 SITE-DIRECTED MUTAGENESIS 61 2.9 ANALYSIS OF C E L L U L A R PROTEIN 64 2.9.1 Protein sampling and separation 64 2.9.2 Western Blotting and Protein Detection 64 2.10 R N A 5' END DETECTION AND STRUCTURE MAPPING 65 2.10.1 Radiolabelling of PE-1 by polynucleotide kinase 65 2.10.2 Primer Extension 65 2.10.3 RNase T I digestion of R N A 66 2.11 ANALYSIS OF D N A BY DlDEOXY NUCLEOTIDE SEQUENCING 66 2.11.1 Automated D N A sequencing 66 2.11.2 Manual D N A sequencing 66 iv CHAPTER THREE INFLUENCE OF 5'-TERMINAL SECONDARY STRUCTURE ON T H E STABILITY OF RPSTMRNAW ESCHERICHIA COLI 68 3.1 INTRODUCTION 68 3.1.1 Expression of recombinant rpsT rnRNAs in vivo 68 3.1.2 An arabinose-inducible gene expression system 70 3.1.2.1 Molecular mechanism for regulation of the araBAD promoter 72 3.2 RESULTS 76 3.2.1 Expression of rpsTmRNA from pBAD28 76 3.2.2 Cloning of rpsT sequences into pKEB106 78 3.2.3 Stability of pKEB107-encoded rpsT mRNA 79 3.2.4 Influence of a 5-terminal stem-loop structure on rpsT mRNA decay 81 3.2.4.1 Construction of plasmid-based rpsT encoding a 5'-terminal stem-loop . . 84 3.2.4.2 Verification of rpsT(\ 10) mRNA 5' secondary structure by primer extension analysis 84 3.2.4.3 Stability of rpsT mRNA possessing a 5'-terminal stem-loop 88 3.2.5 Degradation of rpsT{\ 1.0) mRNA in E. coli cells mutant for mRNA decay 88 3.2.5.1 Decay of rpsT{\ 10) mRNA in rne-1 strain SK5665 88 3.2.5.2 Decay of rpsT(\ 10) mRNA in additional decay mutants 92 3.2.6 Degradation of 5-truncated rpsT mRNA possessing a terminal stem-loop 98 3.3 DISCUSSION 101 CHAPTER FOUR PORTABLE R N A S E E C L E A V A G E SITES DESTABILIZE 5'-TERMINAL STEM-LOOP-PROTECTED RPSTMKNA IN VIVO 109 4.1 INTRODUCTION 109 4.2 RESULTS 110 4.2.1 Stability of rpsT genes encoding sequences of the me 5' leader region 110 4.2.1.1 Construction of rpsT genes encoding sequences of the me 5* UTR . . . Ill 4.2.1.2 Stability of rpsT mRNA incorporating me 5' leader sequences 114 4.2.2 Stability of stem-loop-protected rpsT mRNA containing small 'portable' RNase E cleavage sites 116 4.2.3 Mapping of putative RNase E cleavage sites 117 4.2.5 Decay of rpsT mRNAs containing a 9Sa 'portable' cleavage site requires RNase E 128 4.2.6 Directed mutagenesis of sequences within RNase E 'portable' cleavage sites . . . 129 4.2.7 Insertion of a 'portable' cleavage site within the rpsTopen reading frame 131 v 4.3 DISCUSSION 136 4.3.1 Destabilization of rpsTmRNA by rne leader sequences 138 4.3.2 Destabilization of rpsTmRNA by the rne 'portable' RNase E cleavage site . . . . 140 4.3.3 Destabilization of rpsTmRNA by a 9Sa 'portable' RNase E cleavage site 141 4.3.4 Destabilization of rpsTmRNA by a 'portable' RNase E cleavage site is altered by its location 143 C H A P T E R F I V E INFLUENCE OF TRANSLATION ON RECOMBINANT RPSTMRNA D E C A Y IN VIVO . . . . 144 5.1 INTRODUCTION 144 5.2 RESULTS 145 5.2.1 Degradation of 5-protected rpsT mRNA is sensitive to translational efficiency 145 5.2.2 Stability of stem-loop-protected rpsTmRNA is dependent on the position of a premature stop-codon 149 5.2.3 mRNA destabilization by a 'portable' cleavage site in rpsT'mRNA is sensitive to translation 154 5.2.4 Efficient translation initiation stabilizes 5' truncated rpsT'mRNA possessing a terminal stem-loop 159 5.3 DISCUSSION 162 5.3.1 A 5-terminal stem-loop stabilizes rpsTmRNA only when coupled with efficient translation 162 5.3.2 The efficiency of'portable' cleavage sites to destabilize rpsT mRNA is sensitive to translation 168 5.3.3 Modulation of translational repression influences the biphasic decay kinetics observed for recombinant rpsT mRNAs 169 C H A P T E R Six PERSPECTIVE A N O V E L PATHWAY FOR R N A S E E-INITIATED D E C A Y OF 5*-PROTECTED M R N A I N ESCHERICHIA COLI 171 6.1 STABILIZATION OF RPSTMRNA BY A 5' TERMINAL STEM-LOOP REQUIRES EFFICIENT TRANSLATION 171 6.2 ' P O R T A B L E ' R N A S E E C L E A V A G E SITES PROMOTE EFFICIENT BYPASS OF 5' STEM-LOOPS TO DESTABILIZE M R N A 172 vi 6.3 HIERARCHICAL MODEL FOR R N A S E E ACTION ON M R N A S 173 6.4 Is T H E ARGININE-RICH R N A BINDING DOMAIN OF R N A S E E INVOLVED IN RPST M R N A DECAY BY INTERNAL ENTRY? 177 REFERENCES isi vii L I S T O F T A B L E S Table 1.1 Several Character ized R N a s e E Cleavage Sites i n E. coli 11 Table 1.2 Exonucleases i n E. coli 20 Table 2.1 Bac te r ia l strains 47 Table 2.2 P rev ious ly constructed p lasmids 48 Table 2.3 Ol igodeoxyr ibonucleo t ides 52 Table 2.4 P lasmids constructed dur ing the course o f this w o r k 55 Table 3.1 Ha l f - l i ve s o f Recombinan t rpsTmRNA i n Escherichia coli 102 Table 4.1 Ha l f - l i ve s o f rpsTmRNA Harbour ing R N a s e E Cleavage Sequences i n Escherichia coli 139 Table 5.1 Influence o f Transla t ion Ini t iat ion or E longa t ion o n the Ha l f - l i ve s o f Recombinan t rpsT m R N A i n Escherichia coli 164 v i i i L I S T O F F I G U R E S Figure 1.1 Current Model for mRNA Decay in E. coli 4 Figure 1.2 Domain Features of RNase E from E. coli 8 Figure 1.3 Schematic of the E. coli RNA Degradosome 10 Figure 1.4 RNase E-mediated Degradation is Sensitive to the 5' Terminus of its RNA Substrates 14 Figure 1.5 RNase III Cleavage of the Intergenic rpsO-pnp Stem-loop Facilitates PNPase Autoregulation 17 Figure 1.6 Polyadenylation Facilitates Exonucleolytic Digestion of Highly Structured RNAs 28 Figure 1.7 Model for Growth Rate-Regulated ompA mRNA Translation and Stability byHfq 32 Figure 1.8 Mechanisms of mRNA Protection by Ribosomes During Translation 37 Figure 1.9 Schematic of E. coli rpsT mRNAs and the Proposed Secondary Structure for rpsTVl mRNA 41 Figure 2.1 In Vitro Directed mutagenesis by the QuikChange™ Site-Directed Mutagenesis System (Stratagene Cloning Systems) 63 Figure 3.1 Low-copy Number Expression Plasmid pBAD28 71 Figure 3.2 The araBAD Regulatory Region and Mechanism for Regulated Gene Expression 75 Figure 3.3 Construction of Plasmid Expression Vector pKEB106 77 Figure 3.4 Genetic Map of rpsT Harboured on pKEB107 80 Figure 3.5 Decay of Plasmid-encoded r j^rmRNA 83 Figure 3.6 Construction of pKEBl 10 and Secondary Structure of rpsT(\ 10) mRNA 85 Figure 3.7 Detection of 5' Termini and Secondary Structure of rpsT(l07) and rpsT(\ 10) mRNA by Primer Extension Analysis 87 Figure 3.8 Decay of Stem-loop-Protected rpsT mRNA is Initiated by RNase E 89 Figure 3.9 Induction of Expression of Plasmid-encoded rpsT mRNA is Dependent on Temperature and Carbon Source 91 Figure 3.10 Decay of rpsTmRNA is Not Initiated by PNPase 94 Figure 3.11 Decay of rpsT(\ 10) mRNA is Not Initiated by an RNase G-dependent Mechanism 97 Figure 3.12 A 5'-terminal Stem-loop Does Not Protect 5'-truncated rpsT mRNA 100 ix Figure 4.1 Insertion of cat mRNA Sequences into the 3' UTR of ompA mRNA Destabilizes the Chimeric RNA in vivo 109 Figure 4.2 Cloning of the rne Leader PCR Fragment into the rpsTGem of pKEBl 10 113 Figure 4.3 Stability of Stem-loop-protected rpsT mRNA Containing rne Leader Sequences Within the 5'UTR 115 Figure 4.4 rpsTmRNA Encoding 'Portable' RNase E Cleavage Sites Within the 5' UTR ..118 Figure 4.5 Effect of 'Portable' RNase E Cleavage Sequences on rpsTmRNA Stability. . . . 120 Figure 4.6 Detection of RNase E Cleavages by Primer Extension Analysis 123 Figure 4.7 Structure Mapping of the 5' UTR of rpsTmRNA Harbouring 'Portable' RNase Cleavage Sites 127 Figure 4.8 Destabilization of rpsTmRNA Containing the 9Sa 'Portable' Cleavage Sequence Requires RNase E 130 Figure 4.9 Stability of Stem-loop-protected r/?srmRNA Encoding Mutated 'Portable' RNase E Cleavage Sites 132 Figure 4.10 Insertion of the rne 'Portable' Cleavage Site into the rpsT Coding Region 135 Figure 4.11 Stability of Stem-loop-protected ^ r m R N A Containing a 'Portable' Cleavage site in the ORF 137 Figure 5.1 Introduction of Mutations Influencing Translation Initiation Efficiency of Stem-loop-protected rpsT mRNA 147 Figure 5.2 Influence of Translation on rpsT mRNA Protected by a 5'-terminal Stem-loop . . 148 Figure 5.3 Introduction of Premature Termination Codons within Stem-loop-protected rpsT mRNA 151 Figure 5.4 Influence of Premature Stop Codons on the Stability of Stem-loop-protected rpsTmRNA 153 Figure 5.5 Introduction of Mutations Influencing Translational Initiation into Stem-loop-protected rpsT mRNA Possessing a 'Portable' Cleavage Sequence in its ORF 155 Figure 5.6 Influence of Translation on rpsT mRNA Stability in the Presence of a 'Portable' Cleavage Sequence in its ORF 157 Figure 5.7 Influence of Translation on rpsT mRNA Destabilization by a 'Portable' Cleavage Sequence Present in its 5' UTR 158 Figure 5.8 Efficient Translation Stabilizes 5'-truncated rpsT mRNA Possessing a Terminal Stem-loop 161 Figure 6.1 A Bimodal Model for RNase E-mediated Cleavage of RNA 175 Figure 6.2 RNase E-Substrate Interaction Through Either a Putative Phosphate Binding Pocket or the AR-RBD 179 L I S T O F A B B R E V I A T I O N S ATP adenosine 5'-triphosphate bp base pair BSA bovine serum albumin °C degree Celsius cm centimetre C-terminal carboxyl-terminal CTP cytidine 5'-triphosphate dATP 2'-deoxyadenosine 5'-triphosphate DEAD (aspartate-glutamate-alanine-aspartate) DEPC diethyl pyrocarbonate DNA deoxyribonucleic acid DNase deoxyribonuclease DTT 1,4-dithiothreitol EDTA ethylenediamine tetraacetic acid g gravity gDNA genomic DNA GTP guanosine 5-triphosphate h hour IPTG isopropyl- P -D-thiogalactopyrano side kbp kilobase pair kDa kiloDalton LB Luria-Bertani broth M molar min minute(s) mg milligram |lCi microCurie Ug microgram \lL microlitre MCS multiple cloning site min minutes mL millilitre mM millimolar mRNA messenger RNA MW molecular weight ng nanogram nt nucleotide N-terminal amino-terminal ORF open reading frame PAGE polyacrylamide gel electrophoresis PAP poly(A) polymerase PBS phosphate-buffered saline PCI phenol/chloroform/isoamyl alcohol xi PCR polymerase chain reaction pmol picomole PNPase polynucleotide phosphorylase poly(A) polyadenylate RBD RNA binding domain RhlB RhlB helicase RNA ribonucleic acid RNase ribonuclease rRNA ribosomal RNA SCI single colony isolate SD Shine Dalgarno sequence SDS sodium dodecyl sulfate SSC standard saline citrate TAE tris-acetate-sodium EDTA TBE tris-borate-sodium EDTA tris tris(hydroxymethyl)aminomethane tRNA transfer RNA UTP uridine 5-triphosphate UTR untranslated region UV ultraviolet V volt v/v volume/volume w/v weight/volume Xll A C K N O W L E D G E M E N T S I would like to extend my appreciation to Dr. George Mackie for providing an exceptional scientific environment and for always leaving his door open (even when you saw me coming). I approached you as a scientific orphan in need, and you provided a good home, indeed. In addition, I would like to thank Dr. Pat Dennis for the guidance and insight that was invariably offered, and eagerly accepted, during our interaction. My gratitude is also extended to the members of my PhD Thesis committee, Dr. Dixie Mager and Dr. George Spiegelman, for the encouragement and guidance extended throughout the course of this work, and particularly their commitment to see this to the end. A particularly important acknowledgement of appreciation is extended to Drs. Tony Warren, Rob Kay, Jerry Krystal, Caroline Brown, and Rod Kelln, who, together, provided critical encouragement many years ago that ultimately resulted in the completion of this endeavour. I wish to acknowledgement the generous financial support offered by the Government of Canada, the Sir Isaak Walton Killam Endowment Foundation, and the Faculty of Graduate Studies and Research in the form of NSERC, Killam Pre-Doctoral, and University of British Columbia Graduate Fellowships, respectively. I would also like to offer my appreciation to Dr. George Mackie for additional financial support supplied from an MRC/CIHR operating grant. My gratitude is extended to Dr. Hugh Brock and Monica Deutsch of the Genetics Graduate Program, as well as the administrative members of the Department of Biochemistry & Molecular Biology for guidance and assistance during my studies. For the scientific complementarity and camaraderie, my appreciation is offered to members of the Mackie laboratory, past and present. I would also like to recognize the laboratories of Drs. xiii Ivan Sadowski, Phil Hieter, Caroline Astell and Pat Dennis, for allowing extensive use of laboratory equipment. In addition, I would like to thank the members of these labs for the assistance they advanced to me in the course of this study; the discussions and materials that have been shared have been invaluable. Numerous scientific colleagues both within and outside of the University of British Columbia must also be acknowledged for their generosity. For providing bacterial strains, plasmids, transducing lysates, and/or valuable scientific advice, I would like to thank Drs. Sidney Kushner, Marc Dreyfus, Murray Deutscher, Rod Kelln, Jon Beckwith, Robert Schleif, Leif Isaakson* Gerhard Wagner, Tom Beatty, George Spiegelman, Jeffery Coller, and Ms. Mary Berlin. Finally, I am most grateful to several people whose role in this achievement has been more significant then they are aware. To my parents, Douglas and Janice Baker, I thank you for the unlimited support and encouragement you have extended throughout this, and all of my past endeavours. To my biggest cheerleader, my brother Brett...remember, prefixes are everything. Finally, a heartfelt thank you to Andrew Daniel, for believing, and making me believe too. xiv C H A P T E R O N E M R N A DECAY IN ESCHERICHIA COLI 1.1 INTRODUCTION Levels of gene expression are determined by the rates of transcription, translation and decay of messenger RNA (mRNA). Over several decades, a plethora of information has been gathered detailing the former two processes (McCarthy and Gualerzi, 1990; Ishihama, 2000); however, many aspects involving the regulation of mRNA degradation are yet to be uncovered. The bacterium, Escherichia coli, remains a useful experimental system in which to dissect and evaluate RNA decay processes, although, recently, mRNA turnover in the model eukaryotic organism, Saccharomyces cerevisiae, has gained widespread attention (reviewed in Mitchell and Tollervey, 2000). \nE. coli, mRNAs lifetimes vary greatly, ranging from less than 30 seconds to more than 20 minutes (Belasco and Higgins, 1988; Higgins et al, 1992). Such differential rates of mRNA degradation allow the cell to establish varying steady state levels of mRNA, differentially regulate expression from polycistronic mRNAs (Belasco et al, 1985; Newbury et al, 1987), respond rapidly to negative regulatory signals (Singer and Nomura, 1985; Cole and Nomura, 1986), and, salvage and recycle ribonucleotides, thereby lowering the energy demands on the cell (Danchin, 1996). It is presumed that differential rates of mRNA decay are dictated by cz's-acting sequences and/or structures within a given mRNA substrate. While the past decade has uncovered many of the fr-aws-acting factors involved in mRNA degradation (reviewed Coburn and Mackie, 1999), an understanding of the mechanisms determining substrate susceptibility and, similarly, governing the regulation of mRNA longevity, lags behind. 1 It is believed that most, if not all, of the ribonucleases (RNases) involved in R N A processing and degradation have been identified and the genes cloned (Deutscher and Li , 2001). The endoribonuclease, RNase E , has been implicated in various events of rRNA and tRNA processing, and also acts as the major determinant of mRNA stability (reviewed in Cohen and McDowall, 1997). In contrast, while RNase III also participates in R N A processing and mRNA decay, its substrates are limited. Several exonucleases, including polynucleotide phosphorylase, RNase II, and oligoribonuclease act during later stages of the decay pathway rather than at a point of initiation. Finally, additional frans-acting factors such as the R N A helicase, RhlB, poly(A) polymerase, and various RNA binding proteins, including ribosomes, have been demonstrated to participate at various stages of mRNA degradation (Coburn and Mackie, 1999; Grunberg-Manago, 1999; Rauhut and Klug, 1999; Regnier and Arraiano, 2000). 1.2 CURRENT M O D E L OF M R N A DECAY IN E. COLI An early model for mRNA decay in E. coli was presented by David Apirion in 1972, who predicted that R N A decay was initiated by a rate-limiting endonucleolytic cleavage followed by rapid scavenging of R N A intermediates by 3' - 5' exonucleases (Apirion, 1972). Furthermore, successive endonucleolytic cleavages were suggested to produce a net 5' - 3' vectoral disappearance of the mRNA. Many aspects of this early model remain valid today; the major additions have included the identification of many of the enzymes and factors involved in mRNA decay, cloning of the respective genes, and characterization of their activities (Coburn and Mackie, 1999). The major events involved in mRNA degradation are depicted in Figure 1.1 and will be described below; events or factors influencing the various steps will be further presented during the subsequent detailed discussion of the individual /raws-acting factors (also reviewed in 2 Figure 1.1 Current Model for mRNA Decay in E. coli. RNase E catalyzes the initial, rate-limiting endonucleolytic cleavage of a mRNA substrate, generating a 5'-proximal RNA fragment that is rapidly scavenged by the 3' -» 5' exonuclease activities of polynucleotide phosphorylase and RNase II (left side). The 5'-distal fragment generated by RNase E cleavage is 5'-monophosphorylated and is a preferred substrate for a rapid, sequential endonucleolytic cleavage catalyzed by RNase E (right panel). RNA fragments terminating in strong secondary structure, such as a Rho-independent transcriptional terminator, are resistant to 3' - 5' exonucleolytic activity due to the absence of single-stranded RNA extensions. Polyadenylation of structured RNA fragments facilitates exonuclease binding to the RNA, and digestion through the secondary structure can be aided by the unwinding activity of RhlB helicase. RNA degradation produces mononucleotides and limit oligonucleotides, the latter being substrates for oligoribonuelease (not indicated). 3 4 Bermetal, 2002). The initiating event in the decay of most mRNA is an endonucleolytic cleavage catalyzed by RNase E. Although RNase E is single-strand specific and frequently cleaves 5' to AU dinucleotides, the specific sequence and/or structural context influencing the enzyme's specificity and efficiency remains unclear (Mackie, 1991; Ehretsmann et al, 1992; Mackie and Genereaux, 1993; McDowall et al, 1994). Rate-determining RNase E cleavage sites have been mapped to diverse regions of particular mRNA substrates (i.e. 5' UTR, coding region, or 3' UTR), and cleavage may, or may not, inactivate the mRNA for translation. Following the initial endonucleolytic cleavage of an mRNA, a new 3' end is generated on the 5' proximal, or upstream, cleavage product. This and subsequently formed 3* ends are rapidly attacked by one or more 3' -* 5' exonucleases. The two major exonucleases in E. coli, polynucleotide phosphorylase (PNPase) and RNase II are both processive and appear to act almost interchangeably (Spickler and Mackie, 2000). PNPase and RNase II remain bound to the RNA intermediates during the process of degradation until substrates are shortened to less than 15 residues, or until they encounter a structural barrier such as a stem loop, at which point they dissociate from their substrate. Polyadenylation of the RNA's 3' terminus by poly(A) polymerase provides a new, single-stranded extension on which PNPase or RNase II bind and reinitiate 3' - 5* decay. In some cases, localized melting of a stable secondary structure facilitates processive exonucleolytic digestion to result in removal of the mRNA fragment. Alternatively, the ATP-dependent RNA helicase, RhlB, aids in 3' degradation by unwinding secondary structures allowing the advancement of PNPase. The action of the 3' exonucleases results in the accumulation of limit oligonucleotides of 12-20 residues. These fragments are degraded to nucleoside-5'-monophosphates by the hydrolytic action of the aptly named 3' - 5' exonuclease, oligoribonuclease. 5 A single endonucleolytic cleavage is insufficient to inactivate most mRNAs and especially those which are polycistronic, and therefore, distal endonucleolytic cleavages necessarily follow the initial event. The initial endonucleolytic cleavage by RNase E yields not only the upstream product but also a distal product terminating with a 5' monophosphate. This monophosphorylated substrate is preferred by RNase E resulting in more rapid cleavage of the degradative intermediate than the initial mRNA (Mackie, 1998; Spickler et al, 2001). The strong preference for mono- versus tri-phosphorylated RNA substrates by RNase E ensures complete degradation of a substrate once decay has been initiated, accounting for the difficulty in identifying decay intermediates (i.e. the 'all-or-none' nature of RNA decay). In addition, the 5' end preference also provides a mechanism for the 5* -3' vectoral nature of RNA decay. 1.3 T/MAW-ACTING FACTORS OF M R N A D E C A Y - T H E RIBONUCLEASES While over 15 ribonuclease activities have been identified mE. coli (Deutscher and Li, 2001), only RNase E, RNase III, RNase G, PNPase, RNase II and oligoribonuclease are known to contribute to the degradation of mRNA. All of the additional ribonucleases in the cell are involved in rRNA or tRNA processing and maturation, with the exception of the periplasmic exonuclease, RNase I. The following introduction will review only the major players involved in mRNA decay and will attempt to give an overview of the structure, function, and mechanism of action of each enzyme. 1.3.1 The endonucleases 1.3.1.1 RNase E Originally characterized as an activity required for the processing of 9S ribosomal RNA (rRNA) to the precursor to 5S rRNA (pre5S rRNA; Ghora and Apirion, 1978; Misra and Apirion, 6 1979), RNase E has since been shown to be the major determinant of mRNA stability (reviewed in Cohen and McDowall, 1997 and Coburn and Mackie, 1999). The degradation of many, if not most, mRNAs is initiated by an endonucleolytic cleavage event catalyzed by RNase E. In addition to mRNA substrates, RNase E cleaves RNA I, the anti sense regulator of ColEl plasmid replication, thereby contributing to plasmid copy number control (Tomcsanyi and Apirion, 1985). Furthermore, RNase E is also important for processing 16S rRNA (Li et al, 1999), tmRNA (Lin-Chao et al, 1999), M l RNA (the catalytic subunit of RNase P; Kim et al, 1999), and most tRNAs (Li and Deutscher, 2002). The discovery of two temperature-sensitive mutations in the me gene (rwe-3071 and rne-l) which inhibit 9S processing (Ghora and Apirion, 1978) and significantly stabilize the half-life of bulk mRNA (Ono and Kuwano, 1979) was ultimately instrumental in implicating RNase E not only as a player in rRNA processing but also as a critical factor in the decay of mRNA in E. coli (Mudd et al, 1990). RNase E is an essential protein of 1061 amino acids in E. coli and is encoded by the me gene. The protein has been shown in vitro to be capable for the endonucleolytic activity observed in vivo (Cormack et al, 1993). RNase E can be divided into three major domains (Figure 1.2): an amino-terminal domain (N-terminal; residues 1-500); a central domain (500-750); and, a carboxyl-terminal domain (C-terminal; 750-1061). The N-terminal domain of the protein encodes the catalytic site for RNase E as C-terminally truncated versions of RNase E as small as 498 amino acids are enzymatically active (McDowall and Cohen, 1996). In addition, the N-terminal domain of the protein contains the two temperature-sensitive alleles, encoded by me-\ and r«e-3071, which map to codons 66 and 68, respectively (McDowall et al, 1993). Although these particular mutations do not appear to define the active site of the enzyme (Coburn et al, 1999), they do lie within an SI RNA binding domain (residues 35-125). A second domain, including an arginine-7 E. coli RNase E N-terminal region Central region C-terminal region <— X X > S1 domain Arginine-rich RNA binding domain rne-1 rne-3071 RhIB (734-738) Enolase (739-845) PNPase (844-1045) Figure 1.2 Domain Features of RNase E from E. coli. RNase E is composed of three regions: an N-terminal, central and C-terminal domain. The relative positions of the SI and arginine-rich RNA binding domains within RNase E are denoted. The two temperature sensitive mutations corresponding to amino acid residues 66 and 68 (rne-1 and rne-3071, respectively) are indicated. Positions of interaction between the C-terminal domain of RNase E and RhIB, enolase, and PNPase, based on Vanzo et al. (1998), are shown. 8 rich RNA binding domain, has been mapped to the central portion of the protein (600-750) by deletion analysis (X. Miao and G. Mackie, unpublished observations). The role of the RNase E arginine-rich RNA binding domain in vivo remains unsettled; however, recent reports suggest that this domain is important in the degradation of mRNA but is dispensable for rRNA processing (Lopez et al, 1999; Ow et al, 2000). The C-terminal tail of RNase E, while not required for catalytic function or RNA binding, provides the platform for the assembly of additional proteins, which together, comprise the RNA degradosome (see below; Kido et al, 1996; Vanzo et al, 1998; Kaberdin et al, 1998). Mutations encoding a truncated RNase E lacking the C-terminal portion are tolerated by the cell and, surprisingly, render mRNA turnover largely unaffected (Kido etal, 1996). During the purification of RNase E, separate laboratories discovered that the enzyme copurifies with a number of additional proteins as part of a high molecular weight complex referred to as the RNA degradosome (reviewed in Carpousis et al, 1999; Figure 1.3). As mentioned previously, it has now been determined that RNase E serves as the scaffold to which the additional proteins associate (Vanzo et al, 1998). The RNA degradosome consists of stoichiometric amounts of RNase E, the 3' exonuclease, PNPase, RhIB, a demonstrated DEAD-box containing RNA helicase activity, and enolase, a glycolytic enzyme of unknown significance in mRNA decay (Carpousis et al, 1994; Py et al, 1994; Py etal, 1996, Miczak et al, 1996). Sub-stoichiometric quantities of DnaK, GroEL and polyphosphate kinase (Blum et al, 1997) have also been detected by various methods; however, the physiological significance of these proteins is unknown and further work is required to confirm the presence and function of these minor components. While in vivo, the role of the RNA degradosome remains undefined, the ' degradosome can be reconstituted physically and functionally in vitro (Coburn et al, 1999). 9 E. coli R N A D e g r a d o s o m e RhlB Enolase PNPase O O P RNase E < >< > N-terminal and C-terminal scaffold arginine-rich domains domain Figure 1.3 Schematic of the E. coli RNA Degradosome. The RNA degradosome of E. coli is depicted according to Vanzo et al. (1998). The globular N-terminal catalytic and arginine-rich binding domains of RNase E (grey half circle) interact to form a dimer. The C-terminal domains (horizontal line) interact each with a putative dimer of RhlB (light grey circle, left), a dimer of enolase (middle), and a homotrimer of PNPase (dark grey circle, right). The endonucleolytic catalytic site and a putative phosphate binding pocket of RNase E are shown as separate sites within the N-terminal domain of the protein (oval and round cutouts, respectively). 10 Supporting its role in bulk R N A decay, RNase E cleavage specificity is broad enough to allow cleavage of a large number of RNAs as the sequence required for cleavage is not rigidly defined. RNase E is specific for single-stranded R N A and tends to favour A U rich sequences, presumably because these sequences are more likely to be in a single-stranded conformation (Mackie, 1992). Based on the primary nucleotide sequence of several characterized RNase E cleavage sites (see Table 1.1, below), a loose consensus sequence for RNase E cleavage has been proposed: (A/G) 1 AUU(AAJ). Table 1.1 Several Character ized RNase E Cleavage Sites in E. coli RNA Site Cleavage Sequence Reference ompA ' C site AAGG 1 AUUU Nilsson etal., 1988 ompA 'D' site GCGU 1 AUUU Nilsson etal., 1988 rne 5' UTR ACCC 1 AUUU Jain and Belasco, 1995 rpsO M2 site CGAG 1 UUUC Braun etal., 1998 rpsT 190 nt site AAGC 1 ACAA Mackie, 1991 rpsT 300 nt site ACCG 1 AUCG Mackie, 1991 9S rRNA 'a' site CAGA I AUUU Ghora and Apirion, 1978 9S rRNA 'b' site UCAA 1 AUAA Ghora and Apirion, 1978 RNA I CAGU 1 AUUU Tomcsanyi and Apirion, 1985 T4 gene 32, -71 nt site GCGA i AUUA Ehretsmann et al., 1992 CONSENSUS (A/G) i AUU(AAJ) Ehretsmann et al., 1992 However, cleavage sites exhibit variability in primary sequence suggesting that RNase E does not show absolute specificity (Mackie, 1991; Ehretsmann et al, 1992). In particular, not all cleavage sites conform to the consensus and not all single-stranded A U sequences are cleaved by RNase E. These observations lead to the suggestion that cleavage efficiency might vary widely depending 11 on the exact sequence of the cleavage site (Ehretsmann et al, 1992). Finally, cleavage site selection might be much more complex than the recognition of a specific sequence of nucleotide residues, and selection may, in fact, involve RNA secondary structure or other determinants. The role of RNA secondary structure in modulating endonucleolytic cleavage by RNase E has been extensively studied in vivo and in vitro. RNA secondary structure can inhibit cleavages by RNase E either by occlusion of potential cleavage sites through base pairing or by steric hindrance (Mackie, 1992). Conversely, RNA structure can also play a role in anchoring cleavage sites in a single stranded conformation (Cormack and Mackie, 1992). Characterization of the decay of the long lived ompA mRNA (half-life-18 min) clearly implicated a 5'-terminal RNA stem-loop in protecting the mRNA against initiating cleavage events (Emory and Belasco, 1990; Emory et al, 1992; Arnold et al, 1998). Subsequent findings demonstrated that heterologous mRNA possessing 5' terminal secondary structures impede endonucleolytic attack at internal single-stranded cleavage sites by RNase E up to 6-fold (Bouvet and Belasco, 1992; Hansen et al, 1994). While the primary sequence of the stem-loop was deemed unimportant, the addition of as few as 2-4 unpaired nucleotides to the 5' arm of the stem-loop structure restored rapid RNase E cleavage at internal sites (Emory et al, 1992; Bouvet and Belasco, 1992). Therefore, RNAs with several unpaired nucleotides at the 5' terminus provide preferential targets for RNase E. The dependence of RNase E activity on an available 5* terminus was elegantly demonstrated using covalently closed, circularized RNA substrates (Mackie, 1998). Circularized derivatives of 9S rRNA and rpsTmRNA are up to 30-fold more resistant to RNase E-mediated cleavage in vitro than the linear, parental RNAs. The resistance of circular RNA to RNase E-mediated attack has now been confirmed in vivo (Mackie, 2000). Additionally, annealing of oligodeoxynucleotides complementary to the 5'-end of linear RNA to create 12 heteroduplex substrates significantly impairs RNase E attack in distal regions of the substrates (Mackie, 1998). Furthermore, even the phosphorylation status of the 5' terminal residue can contribute to the efficiency of RNase E-mediated degradation; 5' monophosphorylated RNAs are much more susceptible to RNase E cleavage than 5-triphosphorylated species (Lin-Chao and Cohen, 1991; Mackie, 1998). These findings are summarized in Figure 1.4 and led to the unexpected conclusion that RNase E is a 5'-end-dependent endonuclease (Mackie, 1998, 2000). As a consequence of the 5-end-dependent nature of RNase E, initial endonucleolytic cleavage events on transcribed RNAs which, by nature, possess a triphophate group at their 5' termini, represent the rate^ limiting step in mRNA decay (Mackie, 1998). However, endonucleolytic cleavage by RNase E generate distal products which contain a 5'-monophosphorylated terminus that facilitate rapid, secondary RNase E cleavages (Spickler et al, 2001). The 5'-end-dependence of RNase E provides a mechanism to explain the apparent 5' - 3' vectorial nature of mRNA decay as well as the 'all-or-none' phenomena of mRNA degradation in E. coli (Nierlich and Murakawa, 1996; Mackie, 1998). It is noteworthy that the preference for a 5'-monophosphate is the property of the N-terminal region of the RNase E, with the C-terminal portion of the protein being dispensable for this activity. (Jiang et al, 2000; Tock et al, 2000). RNase E regulates its own synthesis by reducing the concentration of me mRNA in vivo (Mudd and Higgins, 1993; Jain and Belasco, 1995; Sousa et al, 2001). The autoregulation of me expression is mediated in cis by a conserved stem-loop structure in the 5' UTR of the me transcript (Diwa et al, 2000). While RNase E cleavages have been mapped to residues within the me 5' UTR, these appear to be dispensable for autoregulation, and the precise mechanism of me mRNA destabilization by RNase E remains unknown (Jain and Belasco, 1995; Diwa et al, 2000). 13 A 5'-terminal stemloop 5' 1 I B Oligo hybridization 5" — — — — 5' C Circular mRNA D Phosphorylation of 5'-terminal nucleotide - monophosphate versus triphosphate Figure 1.4 RNase E Activity is Sensitive to the 5 ' Terminus of its RNA Substrate. Several R N A substrates characterized both in vivo and in vitro have proven to be relatively resistant to initial decay events catalyzed by RNase E (Section 1.3.1.1). The natural ompA mRNA (A) and heterologous R N A substrates are protected by a stem-loop structure at their 5! terminus (Emory and Belasco, 1990; Emory et al, 1992; Bouvet and Belasco, 1992; Hansen et al, 1994). Linear RNAs containing characterized internal RNase E cleavage sites can be stabilized against RNase E-mediated cleavage in vitro by D N A oligonucleotides hybridized to their extreme 5' ends (B; Mackie, 1998). Circularization of RNase E substrates (C) in vitro or in vivo dramatically stabilizes RNAs relative to their linear counterparts (Mackie, 1998, 2000). The interdependence between RNase E activity and an RNA's 5' terminus is emphasized by up to 30-fold more efficient cleavage of 5-monophosphorylated versus triphosphorylated substrates (D; Lin-Chao and Cohen, 1991; Mackie, 1998; Spickler et al, 2001). 14 Surprisingly, in comparison to the full length protein, the N-terminal portion of RNase E harbouring the catalytic domain is relatively ineffective at feedback control (Jiang etal, 2000). The requirement of the G-terminal domain of RNase E to mediate efficient autoregulation may be due to the absence of the arginine-rich RNA binding domain (Jiang et al, 2000). 1.3.1.2 RNase III The double strand-specific endoribonuclease, RNase III, serves a primary role in the maturation of ribosomal RNA by cleaving sequences within stem-loop structures in 3OS rRNA to liberate the 16S, 23 S and 5S rRNA precursors (reviewed in Nicholson, 1999). Moreover, RNase III activity is also important in the processing of bacteriophage RNAs including phage T7, phage T4 and lambda (reviewed in Court, 1993 and Nicholson, 1999). Furthermore, through cleavage of sense-antisense hybrids, RNase III plays an important role in IS70 transposition (Case et al, 1990; Wanger and Simons, 1994). Although clearly involved in many cellular processing events, RNase III activity is not essential to the cell, and an rne null mutant displays only a mild phenotype (Babitzke et al, 1993). RNase III plays a limited role in bulk mRNA turnover and its minimal importance has been explained simply by the absence of susceptible double-stranded stem-loop structures within most mRNAs (Nicholson, 1996). Nonetheless, RNase III initiates the decay of a number of polycistronic mRNAs in E. coli including: rnc-era-recO, rpsO-pnp, and the metY-nusA-infB operons (Regnier and Grunberg-Manago, 1990). Natural substrates of RNase III consist of =20 bp of double-stranded RNA, and cleavage proceeds through a coordinated double cleavage releasing products with a 3' hydroxyl termini possessing a two nucleotide 3' overhang (Sun et al, 2001 and references therein). The action of RNase III has been demonstrated to remove stabilizing stem-loop elements 15 to yield 5'-monophosphorylated products, and thereby trigger the decay of mRNA by other ribonucleases (putatively RNase E; Jarrige et al, 2001). For example, cleavage within the rne mRNA by RNase III exerts feedback autoregulation of gene expression by removing a stem-loop structure which acts as a barrier to mRNA decay (Matsunaga et al, 1996 a,b). In addition, RNase III activity regulates PNPase expression from the bicistronic rpsO-pnp operon. In the absence of RNase III, PNPase expression is greatly elevated due to stabilization of the pnp mRNA (Robert-Le Meur and Portier, 1994). RNase III cleavage within a long stem-loop in the rpsO-pnp mRNA intergenic region, 81 nucleotides upstream of the initiation codon, triggers pnp mRNA instability and results in a decrease in the synthesis of PNPase (Robert-Le Meur and Portier, 1992). However, the means of pnp mRNA destabilization, while dependent on both RNase III and PNPase, was unclear until recently, when an elegant mechanism of post-transcriptional regulation was described (Jarrige etal, 2001; Figure 1.5). The staggered cleavage of the rpsO-pnp intergenic hairpin by RNase III removes the uppermost part of the stem-loop structure and produces a duplex with a short 3' extension (Figure 1.5, Step 2). RNase III cleavage of the stem-loop, however, is not alone sufficient to disrupt the duplex, and in the absence of PNPase, the bottom half of the cleaved stem-loop remains double stranded. The 'dangling' 3' end of the duplex created by RNase III constitutes an entry site for PNPase which binds to and progressively degrades the upstream half of the duplex releasing a pnp mRNA with a single-stranded 5-monophosphorylated end. The monophosphorylated pnp mRNA is subjected to rapid degradation by another cellular nuclease yet to be identified. An endonucleolytic cleavage catalyzed by RNase E at a position downstream of the pnp mRNA initiation codon has been previously observed (Hajnsdorf et al, 1994). The strong preference of RNase E for monophosphorylated substrates supports a role for RNase E in the decay of the processed pnp 16 Figure 1.5 RNase III Cleavage of the Intergenic rpsO-pnp Stem-loop Facilitates PNPase Autoregulation. Schematic diagram illustrating the mechanism proposed by Jarrige et al. (2001) for the destabilization of the pnp mRNA leader by RNase III and PNPase. Cleavage of the stable stem-loop structure in the rpsO-pnp intergenic region by RNase III generates an accessible 3-hydroxyl RNA terminus (Steps 1 and 2). The new, 'dangling' 3' end of the duplex is a target for PNPase 3' -> 5' exonuclease activity (Step 3) which degrades the upstream half of this duplex (Step 4). PNPase digestion of the 5' portion of the stem generates an accessible single-stranded, monophosphorylated pnp mRNA terminus (Step 5) which is subject to rapid degradation by an activity predicted to be RNase E. 17 mRNA. It is important to note, that while RNase III is required for the autoregulation of pnp expression, cleavage does not, itself, remove a barrier to degradation since pnp mRNA is stable in the absence of active PNPase (Robert-Le Meur and Portier, 1994). Therefore, autocontrol of pnp expression is the direct result of 3' - 5' exonuclease activity by PNPase on the RNase Ill-cleaved transcript, and expression of pnp is inversely correlated to the amount of PNPase in the cell. Gene silencing in plants and numerous metazoans through RNA interference has drawn new found attention to the RNase III family of proteins (Sharp, 1999; Bass, 2000; Carthew, 2001). Dicer, a member of the RNase III family, is critical in the generation of small, 21-22 nucleotide RNAs fragments required to repress gene expression (reviewed in Bernstein et al, 2001). 1.3.1.3 RNase G A protein homologue with 34% sequence identity to the catalytic N-terminus of RNase E was described mE. coli by McDowall and colleagues (1993). Recently, this homologue, RNase G (previously named CafA; encoded by mg) has been shown to be an endonuclease activity involved in the maturation of the 5' end of 16S rRNA (Li et al, 1999; Wachi et al, 1999). In an mg mutant, a 16.3S precursor of 16S rRNA accumulates with an additional 66 residues at the 5' end of the molecule due to a deficiency in processing (Wachi et al, 1999). Inactivation of RNase G retards in vivo maturation of 16S RNA, which is similarly slowed by a mutation inactivating RNase E (Li et al, 1999). In the absence of both RNase E and RNase G, 5' maturation of 16S rRNA is completely blocked while 3' maturation is unaffected. These findings suggest that both RNase E and RNase G are required for a two step, sequential maturation of the 5* end of 16S rRNA, thereby explaining the functional relationship between the two enzymes in vivo (Wachi et al, 1991 ;U etal, 1999). 18 RNase G was originally described as having a role in E. coli cell division and chromosomal segregation due to observations that over-expression of mg under conditions of slow growth cause the formation of chained cells and minicells (Okada et al, 1994). Further evaluation determined that in multiple copies, mg can partially suppress the temperature-sensitive growth of the rne-1 strain, while introduction of a mg mutation leads to an enhancement of the temperature-sensitivity of the double mutant, reminiscent once again of a functional interaction between these two proteins (Wachi et al, 1997). Recently, a role for RNase G in RNA turnover in vivo was uncovered by the discovery of a mRNA substrate for RNase G-mediated decay. In an mg mutant strain, fermentative alcohol dehydrogenase is overproduced due to a 2.5 fold increase in the stability of adhE mRNA; however, this observation appears to be dependent on the genetic background of the E. coli strain (Umitsuki et al, 2001; Wachi et al, 2001). Highly purified preparations of RNase G are catalytically active against several non-physiological RNA substrates in vitro (Tock et al, 2000). In a similar manner to RNase E, RNase G cleavage site specificity is broad but is also regulated by the context of sites within structured RNAs and the efficiency of cleavage is sensitive to phosphorylation status of the 5' end of the RNA (Tock et al, 2000; Jiang et al, 2000). 1.3.2 The Exonucleases Exonucleases play an important role in every aspect of cellular RNA catabolism, including initiating the decay of several mRNAs, conversion of RNA precursors to their mature forms, and end-turnover of certain RNAs (reviewed in Deutscher and Li, 2001). Although eight distinct 3'-5' exoribonucleases have been characterized in E. coli (see Table 1.2, below), only 3 function in mRNA decay: PNPase; RNase II; and, oligoribonuclease. Sequence analysis has failed to identify any E. coli genes related to those encoding eukaryotic 5' - 3' exoribonucleases, in keeping with 19 biochemical studies suggesting that such activities are not present in bacteria (Yuo and Deutscher, 2001). Table 1.2 Exonucleases in E. coli RNase Subunit (KDa) Gene (map position) Preferred substrate (in vitro) Suggested functions (in vivo) II 73 rnb (29.0) Unstructured RNAs mRNA degradation; stable RNA maturation R 92 rnr (95.0) RNA, homopolymers unknown D 43 rnd (40.6) Denatured tRNAs, tRNA Denatured tRNA degradation; stable RNA maturation T 23 rnt (37.2) tRNA-CCA tRNA end turnover; stable RNA maturation OligoRNase 21 orn (94.6) Oligoribonucleotides mRNA degradation PNPase 78 pnp (71.3) Unstructured RNAs mRNA degradation PH 26 rph (82.2) tRNA Stable RNA maturation; ribosome biogenesis BN 33 rbn (87.8) tRNA Stable RNA maturation 1.3.2.1 Polynucleotide phosphorylase (PNPase) Although originally identified as a polymerizing enzyme able to synthesize R N A oligoribonucleotides with a 3',5'-phosphodiester bond, it is now clear that the primary role of PNPase in vivo is the rapid 3' - 5' degradation of R N A molecules. PNPase is a single strand-specific exonuclease and catalyzes the phosphorolysis of R N A to release nucleoside 5'-diphosphates (reviewed in Guarneros and Portier, 1991). PNPase is a homotrimer with an apparent molecular weight by S D S - P A G E analysis of 85 k D a subunits, and a portion of the PNPase population purifies with RNase E in the R N A degradosome. The percentage o f cellular PNPase localized in the degradosome is estimated at 30-40% (Liou etal, 2001); however, to 20 what extent the subunits of PNPase in the degradosome are exchangeable with free PNPase is not clear (Coburn and Mackie, 1999). On unstructured RNA, purified PNPase carries out rapid, processive 3' -5' removal of single ribonucleotides, but its activity is strongly retarded by RNA secondary structure resulting in protein-RNA dissociation (Coburn and Mackie, 1998; Goodrich and Steege, 1999). PNPase utilizes small oligonucleotides poorly, presumably because of its weak binding of such molecules. In vivo, the properties of PNPase do not impede its ability to serve as a major RNA degradative enzyme, as secondary structure in the RNA can be disrupted by a RNA helicase, such as RhIB, also found within the RNA degradosome. In addition, polyadenylation of RNA and of RNA fragments has been shown to facilitate the action of PNPase on structured RNAs (Xu and Cohen, 1995; Spickler and Mackie, 2000). Polyadenylation apparently provides a site for repeated binding of the enzyme and enables multiple attempts for proceeding through the structured region (Coburn and Mackie, 1996b, 1998). Multiple rounds of polyadenylation of the 3' end of rpsT mRNA are required to facilitate its degradation by PNPase in vitro (Coburn and Mackie, 1998). Moreover, oligo- or polyadenylation of the 3' end of a number of RNAs, including RNA I, stimulates their chemical decay in vivo (Xu et al., 1993; Xu and Cohen, 1995; Goodrich and Steege, 1999). PNPase is encoded by the pnp gene, part of the dicistronic rpsO-pnp operon, and expression ofpnp is subject to autoregulation as described above (see Section 1.3.1.2). Transcription from the pnp gene is driven largely (>80%) by the PI promoter upstream of the rpoS gene and transcription terminates at a Rho-independent terminator within the intercistronic region. The effect of the operon architecture is suspected to link the expression of PNPase to the accumulation of ribosomes and to overall rates of growth. PNPase expression may also be 21 modulated by the levels of cellular RNase II, but the mechanism of this effect is not understood (Zilhao et al, 1996). Elimination of E. coli PNPase activity by interruption of pnp with a Tn5 insertion slightly slows growth, but cells remain viable (McMurry and Levy, 1987). In addition, PNPase-deficient cells display increased sensitivity to tetracycline, suggesting a role in regulating some aspect of the bacterial membrane or cell surface. In strains made deficient in PNPase and RNase II, another 3' 5' exonuclease important in mRNA decay, large fragments of mRNA accumulate and cells lose viability, indicating that both of these enzymes contribute to degradation (Donovan and Kushner, 1986). In a few cases, the rate-limiting step in decay of several mRNAs depends on PNPase; the half-lives of the rpsT mRNAs increase 2.5 fold in a pnp-7 mutant (Mackie, 1989). PNPase also plays a role in ribosome metabolism; cells devoid of PNPase and RNase PH are unable at lowered temperature (31 °C) to assemble ribosomes previously synthesized at 42 °C (Zhou and Deutscher, 1997). However, it is not known whether the role of PNPase and RNase PH is a direct one or whether their absence might affect the processing or stability of a mRNA for a protein required for ribosome assembly. Finally, PNPase is a cold-shock protein and is required for cold adaptation (Yamanaka and Inouye, 2001). 1.3.2.2 RNase H and RNase R Ribonuclease II (RNase II) is a single-strand specific 3' - 5' exoribonuclease, and like PNPase has been implicated in the terminal stages of mRNA decay (Guarneros and Portier, 1991; Goodrich and Steege, 1999). RNase II is the major exoribonuclease present in E. coli cell extracts, and accounts for more than 95% of the hydrolytic activity and approximately 90% of the total activity in extracts with poly(A) as substrate (Deutscher and Reuven, 1991). The primary physiological role of RNase II appears to be in the degradation of mRNA; however, in the absence of other exoribonucleases, RNase II also functions in the maturation of tRNA and other 22 stable R N A species (Deutscher and L i , 2001). RNase II processively removes mononucleotides hydrolytically from R N A 3' ends to release 5' monophosphates. Similar to PNPase, the progress of RNase II is sensitive to secondary structure and it is retarded by stable duplex structures within R N A (Coburn and Mackie, 1996a). Upon encountering secondary structure in vitro, RNase II dissociates from the RNA, leaving up to 10 unpaired residues at the 3' end of the substrate (Spickler and Mackie, 2000). However, since it can generate mature 3' termini on tRNA in vivo, RNase II must be able to approach as close as four nucleotides to the aminoacyl stem (Deutscher and L i , 2001). RNase II is capable of removing poly(A) tails from mRNAs that are so modified, and therefore RNase II activity indirectly inhibits the action of PNPase, since the R N A product of RNase II activity cannot bind either RNase II or PNPase. At first glance, this would seem to promote futile cycles of polyadenylylation and deadenylation, but the efficient removal of poly(A) tails by RNase II has been postulated to drive mRNA decay into an RNase E-dependent mode, promoting 5' - 3' decay (Coburn and Mackie, 1999). While a mutation in rnb, the gene encoding RNase II, leaves cells seemingly unaffected, double mutants deficient in PNPase and RNase II are inviable, as mentioned above (Donovan and Kushner, 1986). The lethality of the pnp, rnb mutations has been interpreted to indicate that these exonucleases are functionally redundant. However, in vitro data indicate that RNase II and PNPase are slightly differentially sensitive to R N A secondary structure (Spickler and Mackie, 2000). In addition, RNase II and PNPase also differ with regard to their subcellular organization; whereas at least some PNPase functions as a component of the R N A degradosome, RNase II is apparently an unassociated enzyme in the cell. RNase II levels have been found to vary over a five-fold range dependent on the amount 23 of PNPase present in the cell (Zilhao et al, 1996). In PNPase-deficient strains, RNase II levels are increased, whereas over-expression of PNPase leads to a reduction in rnb mRNA and in RNase II protein levels (Zilhao et al, 1996). These data suggest a regulatory interrelationship between the expression of these two exoribonucleases, and may also help to explain how each of the enzymes can adequately substitute for the other in mutant strains despite the significant differences in their catalytic properties. Recently, a homologue of RNase II, RNase R, has been identified and characterized as the major hydrolytic 3' - 5' exonuclease activity in extracts deficient in RNase II (Cheng et al, 1998 and references therein). Originally described in Shigella flexneri as vacB, a gene required for expression of virulence genes carried on this organism's large plasmid (Tobe et al, 1992), the cloning of the E. coli vacB gene revealed that it encoded RNase R (Cheng et al, 1998). An E. coli mutant strain devoid of RNase R is unaffected for growth; however in keeping with its similarity to RNase II, double mutant strains lacking RNase R and PNPase are inviable (Cheng et al, 1998). Furthermore, despite the marked structural and functional similarities between RNase II and RNase R, a double mutant strain lacking both of these enzymes is essentially normal. The role of RNase R in establishing virulence in Shigella and enteroinvasive E. coli remains unknown. 1.3.2.3 Oligoribonuclease Oligoribonuclease is a 3' -5' exonuclease highly specific for short oligonucleotides, thereby distinguishing it from PNPase and RNase II (Niyogi and Datta, 1975; Zhang et al, 1998). Oligoribonuclease is a processive enzyme that initiates attack at a free 3' hydroxyl group on single-stranded RNA, releasing 5' mononucleotides in a sequential manner (Zhang et al, 1998). Interruption.of the gene encoding oligoribonuclease, orn, has revealed that the protein is required for cell viability, the only one of the 8 exoribonucleases so required in E. coli (Ghosh and 24 Deutscher, 1999). In the absence of oligoribonuclease, cells accumulate oligoribonucleotides 2 to 5 residues in length, showing that oligoribonuclease is required to complete the degradation of RNA to mononucleotides. The requirement for oligoribonuclease has been suggested to be a consequence of its unique substrate specificity, which does not overlap with that of any of the other cellular RNases (Ghosh and Deutscher, 1999). Whether the action of oligoribonuclease eliminates small oligonucleotides that are detrimental to the cell, or generates required monoribonucleotides for rNMP recycling by purine and pyrimidine salvage pathways in the cell is not known. 1.4 OTHER ENZYMES OF M R N A DECAY 1.4.1 PoIy(A) polymerase (PAP I) Although well established for its role in mRNA stability in eukaryotes, polyadenylation of the 3' termini of RNA has only recently gained acceptance as modulating the degradation of both untranslated and mRNA in E. coli (reviewed in Sarkar, 1997; Mohanty and Kushner, 1999a). Polyadenylation is catalyzed mainly by poly(A) polymerase I (PAP I) whose activity sequentially adds adenylate residues to the 3' hydroxyl groups of an RNA molecule. \nE. coli, PAP I typically polymerizes 15-60 A residues on to a substrate (compared to 80-200 in eukaryotes). Poly(A) polymerase is encoded by the pcnB gene, which is non-essential (Cao and Sarkar, 1992). Nonetheless, in the absence of PAP I, the antisense regulator of ColEI-type replicons, RNA I, is stabilized and plasmid copy-number is reduced (Xu et al, 1993; O'Hara et al, 1995). Overproduction of PAP I leads to slower growth and under extreme conditions, cell death (Mohanty and Kushner, 1999a). In addition, total RNA and several specific mRNAs are destabilized in cells overexpressing PAP I; however, the mRNAs encoding RNase E and PNPase 25 are stabilized. Notwithstanding, not all mRNAs are polyadenylated in vivo, and therefore, its infrequent occurrence has made it difficult to determine the precise role of polyadenylation in RNA metabolism. A current model for mRNA decay hypothesizes that polyadenylylation serves to provide a binding site for multiprotein complexes such as the RNA degradosome to initiate mRNA decay by RNase E (Kushner, 1996). Nonetheless, it is likely that the major role for PAP I is to generate exoribonuclease accessible substrates by adding poly(A) tails to transcripts that have stem-loop structures at their 3' ends (for example, molecules derived from Rho-independent transcription termination; Figure 1.6; Coburn and Mackie, 1999; Blum et al, 1999). These transcripts possess only very short single stranded regions downstream of the terminating stem, often insufficient for the binding of RNase II and/or PNPase (Coburn and Mackie, 1996b; Spickler and Mackie, 2000). Therefore, polyadenylation of the 3' end of the mRNA by PAP I, by nature of its activity, provides an unstructured substrate for the 3' exonucleases. Processive digestion through the stable secondary structure by the exonuclease activity can be facilitated by localized melting of the base of the stem. This premise is supported by the stimulation of degradation by polyadenylation of RNA substrates generated as either a termination product or degradation intermediate with a limited single stranded 3* terminus (Coburn et al., 1999; Goodrich and Steege, 1999). In situations involving extremely stable secondary structures, for example the malEF REP sequence, digestion of the structure requires the action of RhIB, an ATP-dependent RNA helicase (Cobum et al, 1999). The coordinated activity of RhIB and PNPase, both components of the RNA degradosome, facilitates 3' exonucleolytic digestion of the stable structure. RNA fragments that do not have secondary structures at their 3' ends are probably not polyadenylated in vivo since both PNPase and RNase II exist in considerable excess over PAP I and are both processive once 26 Figure 1.6 Polyadenylation Facilitates Exonucleolytic Digestion of Highly Structured RNAs. The Rho-independent terminator stem-loop of an mRNA can offer a formidable barrier to 3' - 5' exonucleolytic decay (uppermost panel). The addition of a poly(A) tail to the stem-loop, catalyzed by PAP I, can provide a single-strand extension for binding of PNPase or RNase II. However, digestion of the poly(A) tail and exonuclease stalling can generate a potential futile cycle of polyadenylation and tail removal (middle panel). Unwinding of the stem-loop structure by an RNA helicase, such as RhlB, facilitates processive exonuclease digestion and removal of the structural barrier (bottom panel). 27 o Exonucleolytic attack RNase II and/or PNPase 5'. 3' o Polyadenylation poly(A) polymerase I + ATP AAAA(A)„ Exonucleolytic attack RNase II and/or PNPase RNA helicase unwinding of stem "RhIB helicase (degradosome) Exonucleolytic attack PNPase (degradosome ?) 5" RNA helicase 28 they initiate degradation. Poly(A) tails may also be cleaved endonucleolytically in vitro by the action of RNase E within the A-rich sequence (Haung et al, 1998; Walsh et al, 2001). In a strain overproducing PAP I, the additional poly(A) tails appear to provide added targets for RNase E, leading to its overproduction by relief of its autoregulation (Mohanty and Kushner 1999a). The increase in RNase E levels in the cell could explain the observation that half-lives of bulk mRNA are decreased in the strain overproducing PAP I (Mohanty and Kushner, 1999a). Polyadenylation sites are not restricted to true 3' ends of mRNA, as sites are found within the 3' UTR or in the coding sequence, resulting from endonucleolytic or exonucleolytic processing (Haugel-Nielsen et al, 1996; Mohanty and Kushner, 2000). Curiously, the polyadenylation of small stable mRNAs such as 5S rRNA, M l RNA and tmRNA can be detected in a multiple exonuclease-deficient background. Under conditions in which many RNA processing enzymes are absent, the RNAs are not properly matured and are rapidly degraded by a process assisted by polyadenylation (Li et al, 1998). The degradation of the improperly processed RNAs assisted by PAP I activity suggests that polyadenylation serves to remove structured RNA fragments that have been damaged, misfolded or partially degraded (Beran et al, 2002; Li et al, 2002). Although PAP I accounts for 90-95% of the poly(A) tails in wild-type E. eoli, residual polyadenylation in strains deficient in pcnB is detectable ((Mohanty and Kushner, 1999b, 2000). In addition, unlike nuclear encoded eukaryotic mRNAs, poly(A) tails occasionally contain C, U, and G residues (Johnson et al, 1998; Mohanty and Kushner, 2000). Recently, it was proposed that PNPase accounts for both residual polyadenylation and the incorporation of non-adenylate residues into poly(A) tails (Mohanty and Kushner, 2000). The intracellular level of inorganic phosphate in E. coli previously led to the assumption that PNPase functions exclusively as an 29 exoribonuclease. However, the enzyme has a highly reversible reaction mechanism and transiently reduced levels of inorganic phosphate are postulated to favour synthesis by PNPase (Mohanty and Kushner, 2000). It is still unclear whether this proposed role for PNPase in polyadenylation is physiologically significant. 1.4.2 R N A helicases The ATP-dependent RNA helicase, RhIB (a DEAD-box helicase; Schmid and Linder, 1992), copurifies with the E. coli RNA degradosome, thereby implicating RhIB in mRNA decay (Miczak et al, 1996; Py et al, 1996). RhIB activity is required, in vitro, to assist digestion of highly structured RNAs (e.g. the malEFKEP RNA) by PNPase within a reconstituted degradosome (Coburn et al, 1999). Furthermore, the interaction with RNase E stimulates RhIB helicase activity 15-fold in vitro (Vanzo et al, 1998). The current model simply suggests that the RNA helicase activity of RhIB serves to unwind RNA secondary structure facilitating the processive action of the single strand-specific 3' exoribonuclease, PNPase (Py et al, 1996; Coburn etal, 1999). Several additional DEAD-box helicases exist inE. coli (e.g. SrmB, CsdA, DbpA, RhlE); however, a role for these proteins in general mRNA decay has not been established. 1.5 O T H E R PROTEIN FACTORS REGULATING M R N A DEGRADATION As more and more details regarding specific mRNA decay mechanisms are uncovered, a greater number of non-nucleolytic protein factors are being implicated in regulating the stability of mRNAs. In one instance, the carbon storage regulator protein, CsrA, which down regulates enzymes involved in glycogen biosynthesis, specifically binds to the glgCAP mRNA and facilitates its decay (Liu and Romeo, 1997). While the mechanism of glgCAP regulation by CsrA is unknown, the CsrA protein, in turn, is controlled by a novel mechanism which involves an RNA 30 molecule, CsrB (Liu et al, 1997). CsrB RNA is postulated to antagonize the effects of CsrA on glgCAP gene expression by sequestering the CsrA protein into an RNA-protein complex (Liu et al, 1997). OmpA protein expression is an excellent example of adaptation of mRNA stability to environmental changes through the regulated binding activity of the non-nucleolytic protein, Hfq (Vytvytska etal, 2000). ompA mRNA stability is correlated inversely with bacterial growth rate thereby facilitating expression to meet the physiological needs of the cell to the rate of cell division (Nilsson et al, 1984; Georgellis et al, 1992). The ompA 5' UTR is the stability determinant and the target for the initiation of RNase E-mediated degradation. Hfq is an RNA binding protein originally recognized for its function in phage Q B phage RNA replication (host factor for OJ3; Franze de Fernandez et al, 1968). Recently, Hfq has been shown to exhibit ompA mRNA-binding activity that parallels its cellular concentration, which is elevated in bacteria cultured at slow growth rate (Georgellis et al, 1995; Vytvytska et al, 1998). In cells mutant for hfq the ompA mRNA binding activity is absent, and ompA mRNA growth rate-dependent degradation is lost; in addition, the ompA mRNA half-life is prolonged (Vytvytska et al, 1998). Therefore, Hfq was deemed to play a role as a destabilizing factor. Recently, 30S ribosomes bound to the ompA 5' UTR have been shown to protect the transcript from RNase E cleavage in vitro; however, 30S protection is abrogated in the presence of Hfq (Vytvytska et al, 2000). A mechanism by which Hfq regulates the stability of ompA mRNA by competing with 3 OS ribosomes for binding to the ompA 5' UTR has been proposed (Vytvytska et al, 2000; Figure 1.7). Interestingly, Hfq may have additional, more complicated roles in gene expression, as it has been implicated in the negative post-transcriptional regulation of several global regulators such as mutS, dsrA, and hfq itself (Tsui etal, 1997; Sledjeski etal, 2001). 31 A B Figure 1.7 Model for Growth Rate-Regulated ompA mRNA Translation and Stability by Hfq. Under conditions of fast cellular growth (A), 3 OS ribosomal subunits are in excess over Hfq which results in preferential 3 OS binding to the ompA mRNA Shine-Dalgarno sequence (grey box). Frequent translation of ompA mRNA prevents initiation of degradation by RNase E cleavage within the ompA mRNA 5' UTR. In slow growth conditions (B), the elevated levels of Hfq outcompete 30S for binding to the ompA mRNA leader and the lack of translation facilitates RNase E cleavage and mRNA destabilization (figure adapted from Vytvytska et al., 2000). The mechanism by which RNase E recognizes the site for initial cleavage is unknown. 3 2 Transfer of F-like conjugative plasmids in E. coli is positively regulated by the expression of traJ, which in turn is negatively controlled post-transcriptionally through binding of a 79 residue antisense RNA (FinP) to the 5' UTR of the fra/mRNA (Jerome et al, 1999). Binding of FinP to the traJ leader sequesters the ribosomal binding site to prevent its translation and thereby represses plasmid transfer. The FinP antisense-fra/ mRNA duplex is bound both in vivo and in vitro by FinO protein (Jerome and Frost, 1999). In addition to promoting duplex formation between FinP and traJ mRNA, FinO binding protects FinP from degradation mediated by RNase E (Jerome et al, 1999). In vivo, the FinP RNA is stabilized 7-fold in the absence of RNase E activity; therefore, FinO stabilization of FinP effectively increases its cellular concentration and inhibits plasmid transfer. 1.6 ROLE OF TRANSLATION IN M R N A DECAY Since the initiating event in the decay of most mRNA in E. coli is endonucleolytic cleavage, it is anticipated that translation must play a role in modulating of the stability of some, if not many, mRNAs. However, the relationship between translation and mRNA stability is very complex and remains poorly understood. Nonetheless, as an understanding of mRNA decay mechanisms grows, so does the comprehension of this intricate interrelationship. Early experiments demonstrated that antibiotics such as puromycin and kasugamycin, which promote polypeptide chain release and deplete mRNA of ribosomes, cause destabilization of mRNA. In contrast, translational inhibitors, such as chloramphenicol and tetracycline, which inhibit peptidyl transferase and stall ribosomes on mRNA, lead to overall mRNA stabilization (reviewed in Petersen, 1993). Taken together, these results were interpreted to mean that ribosomes protect mRNA against degradation. However, certain mRNAs are known to be 33 relatively stable even in the complete absence of translation (Russel et al, 1976; von Gabain et al, 1983). Therefore, no universal correlation between translation frequency and mRNA stability exists. Moreover, the relationship varies from gene to gene depending on the location and intrinsic vulnerability of the nucleolytic target sites, the range of translation, and the method used to modulate translation frequency (Petersen, 1993). Moreover, alternate decay pathways are suspected to be modulated by translation differently. There are numerous examples where the introduction of a premature stop codon leads to mRNA destabilization in E. coli; for example, trp mRNA, pnp mRNA, rpsO mRNA, and the mRNA of the Tn/0 transposon (reviewed in Petersen, 1993; Hiraga and Yanofsky, 1972; Robert-Le Meur and Portier, 1994; Braun et al, 1998; Jain and Kleckner, 1993, respectively). The negative effects of early arrest of translation by termination codons on mRNA stability suggest that some mRNAs become less stable upon depletion of ribosomes. Furthermore, many mRNA manifest a parallel between mRNA stability and the efficiency of their ribosome binding sites (Cho and Yanofsky, 1988; Parsons etal, 1988; Yarchuk etal, 1991; Jain and Kleckner, 1993; McCormick et al, 1994; Rapaport and Mackie, 1994; Braun et al, 1998). In a somewhat artificial system, uncoupling of transcription and translation in vivo by use of T7 RNA polymerase gives rise to labile mRNAs by generating naked regions of RNA behind the RNA polymerase (lost and Dreyfus, 1995; Makarova et al., 1995). Likewise, the mRNAs for several ribosomal proteins whose translation is autoregulated by a translational repressor are rapidly destabilized upon conditions of repression (Olsson and Gausing, 1980; Singer and Nomura, 1985; Cole and Nomura, 1986). Ribosomes are suspected to protect mRNA from decay by blocking both endonucleolytic cleavage and exonucleolytic digestion (Belasco and Higgins, 1988; Higgins etal, 1992). In 34 particular, since the rate-determining event in mRNA decay usually involves RNase E cleavage, ribosomes must efficiently mask the recognition of cleavages sites (Figure 1.8). Indeed, for the rpsO mRNA of E. coli, steric hindrance caused by ribosomes pausing at the termination codon inhibits the rate-limiting RNase E cleavage at the 'M2' site located 10 nucleotides downstream of the coding sequence (Braun et al, 1998; Figure 1.8 B). For some mRNAs whose stability is not dependent on translation or translation frequency, it is postulated that these mRNAs lack a rate-limiting ribonuclease cleavage site in the coding sequence or in its vicinity (Petersen, 1993). Furthermore, highly structured RNAs may not need to be translated to be stable. Hok mRNA of plasmid Rl is very stable even though its translation is efficiently repressed in plasmid-bearing cells to avoid killing (Gerdes et al, 1990). In the complete absence of translation, 5'-protective barriers such as stem-loop structures are inefficient in protecting against degradation of the mRNA (Nilsson et al, 1987; Arnold et al, 1998; Joyce and Dreyfus, 1998). This situation is unlike that in Gram-positive bacteria such as Bacillus subtillis, where ribosome stalling in an untranslated region protects the mRNA from initial events in decay and stabilizes the entire downstream mRNA (Bechhoffer, 1993; Hue et al, 1995; Agaisse and Lereclus, 1996). Generally, ribosomes are postulated to be required only for the protection of specific nucleolytic target sites where mRNA degradation is be initiated. The finding that long stretches of mRNA can be unprotected by ribosomes without being excessively unstable suggests that such sites are generally rare in bacterial coding sequences (Pedersen, 1993). In the case of rpsT mRNA, introduction of a stop at codon 15 does not lead to destabilization of the mRNA in vivo (Rapaport and Mackie, 1994), although the rate-limiting cleavage event occurs two-thirds into the coding region (Mackie, 1992). A model in which initiation of translation of rpsTmRNA by ribosomes competes for early an step in mRNA turnover such as the binding of 35 Figure 1.8 Mechanisms of mRNA Protection by Ribosomes During Translation. Dense ribosome packing on an mRNA is implicated in promoting steric inhibition of rate-determining endonucleolytic cleavage events catalyzed by RNase E (A). In the case of the rpsO mRNA, ribosomes stalled at the termination codon (ribosome with octagon) are sufficient to prevent an RNase E-mediated initial cleavage at a site 10 residues downstream, thereby stabilizing the message (B). A decrease in the efficiency of translational initiation will introduce a higher kinetic opportunity for RNA cleavage by RNase E leading to reduced mRNA stability (C). Ribosomes may protect mRNA 'at a distance' (D). A premature termination codon introduced at the 15* position of rpsTmRNA does not significantly destabilize the mRNA even though rate-determining RNase E cleavages are present within the coding region (Rapaport and Mackie, 1994). Competition between translational initiation and initial events in mRNA degradation such as RNase E binding at, or near, the 5' mRNA terminus may account for the stability of the rpsT mRNA. 36 Stable Stable Unstable Stability unchanged RNase E at, or near, the 5' end has been offered to explain these somewhat confounding observations (Rapaport and Mackie, 1992; Figure 1.8 D). The unchanged stability of the rpsT mRNA containing the mutant stop codon clearly does not reflect an absence of target for endonucleases, and therefore, the mRNA may be stabilized from endonucleolytic cleavage 'at a distance' by ribosomes located elsewhere (i.e. at the region of initiation) on the mRNA. Protection by ribosomes may occur through steric inhibition of endonucleolytic cleavage as is the case for rpsO mRNA. Additionally, ribosomes might interfere with endonucleases such as RNase III and RNase E by removing secondary structures essential for substrate recognition. Alternatively, the passage of ribosomes may modulate the secondary structure of the transcript to expose target sites that would not otherwise be accessible to attack. Finally, translation might also directly interfere with exonucleases travelling in the 3' - 5' direction. Mutations which allow ribosomes to read past the normal termination codon and through downstream secondary structures which normally protect against 3'-exonucleolytic attack are destabilizing (Chen and Belasco, 1990; Klug and Cohen, 1991). In certain cases ribosomes may play an active role in mRNA degradation, perhaps by binding nucleases, so that translation, in fact, facilitates mRNA cleavage. The polycistronic ddaA-E mRNA which encodes the F1845 fimbriae, is processed endonucleolytically within a small open reading frame which lies upstream of the last gene of the operon (Bilge et al, 1993). The presence of translating ribosomes over the sequence is mandatory for cleavage, and translation of the beginning of the small ORF plays a major but undefined role in cleavage (Loomis et al, 2001). While the endonuclease(s) involved in translation-dependent destabilization of daaA-E mRNA has not been identified, the observations provide support for a 'killing' capacity of the E. coli ribosome. 38 Decades after their use in establishing a role for translation in mRNA decay, the effects of drugs that inhibit global translation have been reassessed for how they influence the process of RNA decay (Lopez et al, 1998; Sousa et al, 2001). It has been recently shown that drugs that produce a translational block can stabilize bulk RNA, including untranslated RNAs, by acting directly on the mRNA degradation machinery itself (Lopez et al, 1998). When protein synthesis is blocked, the synthesis of rRNA is stimulated but the RNA is unstable due to the absence of ribosomal protein binding and assembly. The abundance of unassembled rRNA is hypothesized to effectively titrate the degradation machinery, explaining bulk mRNA stabilization (Lopez et al, 1998). Furthermore, a transient increase in rne mRNA, an efficient substrate for RNase E, also results in titration of RNase E and the apparent inhibition of this enzyme after a translational block (Sousaetal, 2001). 1.7 RPSTMRNA AS A M O D E L SYSTEM TO EVALUATE M R N A D E C A Y The monocistronic rpsTgene located at 0.5 minutes on the£. coli chromosome encodes two mRNAs of 447 and 356 residues transcribed from tandem promoters (i.e PI and P2) separated by 90 bp (Mackie, 1981, 1986). As a consequence of this promoter architecture, the rpsTT>\ and P2 mRNAs share: part of a common 5' UTR, a common coding region, and a common terminus generated by a Rho-independent terminator (Mackie and Parsons, 1983; Mackie, 1986; Figure 1.9 A). Transcriptional initiation from the downstream of the two promoters, P2, occurs at a higher frequently (70-90%). Additionally, the initiating nucleotide is either a CTP, GTP, or CTP residue corresponding to position 90, 91, 92 (in the RNA sequence; Mackie, 1992), and occurs with a 2Q%, 60% and 20% frequency, respectively (Mackie and Parsons, 1983). Although the rpsT mRNAs are relatively abundant in vivo and harbour a Shine-39 Figure 1.9 Schematic of E. coli rpsT mRNAs and the Proposed Secondary Structure for rpsTVl mRNA. A. A schematic of the two endogenously-encoded rpsT mRNAs in E. coli. Also shown is the RNA decay fragment, rpsT¥0, generated by RNase E cleavage 3' to nucleotide 300. B. A model of the secondary structure of the rpsTVl mRNA is shown (figure and numbering adapted from Mackie, 1992). The Shine-Dalgarno sequence (GGGAG) is positioned at residues 121 through 125. Translation is initiated at the UUG codon beginning at residue 133 and terminated at the UAA codon beginning at residue 394. Transcription of rpsT mRNAs is terminated at the Rho-independent transcriptional terminator (Stem VII). The major sites of RNase E cleavage are shown with arrowheads; the rate-determining cleavage site has been mapped 3' to residue 300. 40 rpsT P1 mRNA PPP rpsT P2 mRNA 5' UTR (132 nt) rpsT coding region (264 nt) 3' UTR (51 nt) 5' UTR (41 nt) ppp. rpsTP0 RNA fragment (147 nt) 41a < li > « « o 7 D CJ 1 p » < o — CJ . . . . _ < CJ P <J CJ D O O K * I o 10 o P O O * i 6 6 D O in m D CJ I o o CO CO D 9 D U D S D 6 O O rt 6 13 P CJ CJ * CJ << O O D O U I -o _ cn CJ o * u • < a »-CJ o P CJ * CJ o < * < p o CO I O O CJ • - -a << O P 0 o P P R < U U ( 9 «< , I o o p CO p p p p p I u u o u u D O O O O I o * cj CJ o CJ rt « : D o o D O i ( ( I U o C O o D * P CJ (9 << O CJ «9 «<(<>< O CJ P P P CJ <uoo<< D O O O O O O O O rt o D 6 O 6 D O CO i o < u O D _ D < a cj • 6 (3 o o - s o u MS 6 6 O N O o * * O D D O C O O O CJ CJ O rt rt 19 rt CJ <* o o rt rt u >< CJ-o rt rt cj CJ o CJ cj < CJ I o o rt rt rt CJ I ><P rt (3 O D rt rt O D rt D C I O O D D U rt | rt o o 3 CJ o 0 s III a o> D o< O o rt a rt o o-o o 0 D 9 o 0 D 0 CJ o> CJ rt M l D rt S rt-S C9 •< rt CJ rt CJ < D ° O P - c j O O 41b Dalgarno sequence with an average consensus, translational initiation occurs at a noncanonical UUG initiation codon (Mackie, 1981). The rpsT gene is not essential in vivo; however, a deletion of rpsT renders cells unable to grow at 42 °C (Ryden-Aulin et al, 1993). In addition, the deletion of rpsT causes increased misreading of all three nonsense codons and influences the modification pattern of 16S rRNA (Ryden-Aulin et al, 1993), emphasizing the role of the rpsT gene product, small ribosomal protein S20, in ribosome biogenesis and function (Moore, 1988). Consistent with its important role, the amino acid sequence of S20 is highly conserved from a number of Gram-negative bacteria (Nemec et al, 1995). It is noteworthy that the specific interactions between S20 and 16S rRNA have been mapped (Cormack and Mackie, 1991), and that removal of as few as 6 residues in the C-terminus of S20 results in a sharp loss of S20 binding to 16S rRNA in vitro (Donly and Mackie, 1988). The half-lives of the two rpsT mRNAs have been determined in vivo and are typical of most mRNAs from E. coli (PI rpsT mRNA, 90 sec and P2 rpsTmRNA, 118 sec; Mackie, 1989). The observation that rpsT half-lives increase 2.5 fold in strains deficient in PNPase suggests that rpsT mRNA degradation can be initiated by PNPase (Mackie, 1989). In addition, in the absence of PNPase, a 3' fragment corresponding to highly folded sequences distal to the most 3' RNase E site at nucleotides 300 and 301 in the rpsTmRNA accumulate (P0 RNA fragment, Figure 1.9 A; Mackie, 1989). Moreover, the 147 residue fragment coterminal with the 3' end of the rpsT mRNAs is highly stabilized by apcnB deletion (Coburn and Mackie, 1998). Continuous polyadenylation catalyzed by PAP I is sufficient to permit PNPase (alone or in the degradosome), to catalyze the complete degradation of a full-length rpsT mRNA in vitro, without the requirement of the RNA helicase, RhIB (Coburn and Mackie, 1996a). Notwithstanding, data 42 obtained in vivo and in vitro are consistent with the use of an RNase E-dependent pathway to initiate decay and degrade the 5' two thirds of the rpsTmRNA (Mackie, 1989, Mackie 1992, Mackie and Genereaux, 1993; Mackie etal., 1997). The synthesis of S20 has been documented to be regulated posttranscriptionally. In vivo, an increase in rpsT copy number leads to increased mRNA in proportion to copy number, however, synthesis of S20 protein is elevated no more then 2.1 fold (Mackie, 1987). Further, S20 acts as a repressor of its own synthesis in a coupled transcription-translation system in vitro (Wirth et al, 1982). It has been proposed that S20 itself is the regulatory agent and that binding of S20 to its own mRNA in regions homologous in sequence with 16S rRNA can account for these results (Parsons and Mackie, 1983). Therefore, rpsT autoregulation by a feedback mechanism is similar to other ribosqmal protein genes in E. coli, providing a means for coordinated synthesis of ribosomal proteins to obtain stoichiometrically equivalent levels (Fallon etal, 1979). Curiously, translational repression of rpsT mRNA has also been shown to be accompanied by an increase in mRNA stability (Mackie, 1987). In vivo, moderate posttranscriptional repression of S20 synthesis is accompanied by a substantial increase in the half-lives of both S20 mRNAs. These findings suggested that translation repression of the synthesis of S20 is not obligatorily accompanied by an accelerated decay of its mRNA. However, the published observations were highly dependent on the plasmid-encoded gene construct. Notwithstanding, the reason for this remarkable inverse correlation between translation frequency and mRNA stability is unclear, but S20 binding could protect a nucleolytic target site. The rpsT mRNA may also be protected by active translation; mutations which increase the translation efficiency by changing the suboptimal initiation codon UUG to the canonical AUG reduce translational repression and stabilize the mRNA (Parsons et al, 1988). Furthermore, a 43 double mutation at residues -3 and T4 relative to the initiation eodon reduces translational efficiency in vitro and mRNA stability in vivo. The observation that the stability of rpsT mRNA possessing a premature stop at codon 15 was unchanged led to the model that ribosomes effectively inhibit initial events in mRNA decay at or near the 5' end of the message (Rapaport and Mackie, 1994; also demonstrated in Figure 1.8 D). The major product of RNase E cleavage on rpsT mRNA is a 147 nucleotide fragment coterminal with the 3' end of the RNA due to a rate-determining cleavage at residues 300 or 301 within the mRNA (Mackie, 1989; Mackie 1991). However, additional products are also detectable indicating several RNase E cleavage sites are present within rpsT mRNA. The secondary structure for rpsT mRNA has been determined by chemical probing in vitro and in vivo (Mackie 1992; Figure 1.9 B); the 5' one third of mRNA is relatively unstructured whereas the 3' one third is extensively folded. Not unexpectedly, prominent sites of cleavage by RNase E were mapped to single-stranded regions of the RNA (Mackie, 1992). The plethora of information regarding rpsT mRNA expression, regulation, structure, and mechanism of degradation makes this RNA extremely attractive for advancing the understanding of mRNA decay in vivo. With the exception of lacZ mRNA and perhaps rpsO, no other E. coli message is as well suited for a detailed analysis of mRNA decay as rpsT mRNA. In addition, the rpsT mRNA offers the clear advantage in the detailed characterization of its decay in vitro (Coburn and Mackie, 1999; Steege, 2000). 1.8 EXPERIMENTAL RATIONALE AND SCOPE OF T ins WORK While many of the /raws-acting factors mediating decay of mRNA in E. coli have been identified and well characterized, the c/'s-acting sequences or structural RNA elements regulating 44 their activity, and, therefore, mRNA longevity, are poorly defined. This work attempted to evaluate the influence of 5'-terminal stem-loop structures on regulating RNase E-mediated degradation of RNA in vivo, using rpsT mRNA as a model substrate. While mRNA protection by stem-loop structures was known, the dependence of RNase E on RNA 5* termini had yet to be demonstrated (Mackie, 1998). This work was specifically directed to provide an understanding of the mechanism by which RNase E initiates the decay of 5'-terminally-protected messages. To achieve this goal, insertions or substitutions were introduced into a plasmid-borne copy of rpsT and the kinetics of mRNA decay evaluated. The effect of such mutations in E. coli strains deficient in one or more of the enzymes involved in RNA degradation, possible through the use of available mutants, was also investigated to gain additional insight as to how these frans-acting factors interact with the various structural determinants to mediate decay. Furthermore, the perplexing observation that RNase E and PNPase are each able to influence the rate of rpsT mRNA decay lead to a re-investigation into the role of PNPase in the decay of rpsTmRNA. At the time of initiating this investigation, strong experimental evidence implicating ribosomes in the steric hindrance of RNase E cleavage on mRNA substrates was lacking (Braun et al, 1998; Vytvytska et al, 2000). In addition, evidence existed that translation along a majority of the rpsT coding region was not required for mRNA stability (Rapaport and Mackie, 1994), even though rate-determining RNase E cleavage sites are determined to be present deep within the rpsT coding region (Mackie, 1992). By manipulating plasmid-borne rpsT gene sequences, a detailed evaluation of the effect of translation on the stability of 5' stem-loop-protected rpsT mRNA was undertaken in an attempt to unravel the somewhat controversial influence of translation on rpsT mRNA decay. 45 CHAPTER TWO MATERIALS AND EXPERIMENTAL PROCEDURES 2.1 BACTERIAL STRAINS AND PLASMID VECTORS Bacterial strains employed were derivatives of Escherichia coli K-12 and are listed along with their relevant genotypes in Table 2.1. Included in Table 2.1 are isogenic strains constructed during this course of this work utilizing transduction (Section 2.3.1). Table 2.2 lists previously constructed plasmid vectors utilized as cloning or expression vehicles, or during additional molecular procedures, and includes their important characteristics. 2.2 M E D I A AND C U L T U R E CONDITIONS Luria-Bertani (LB) Broth (Bertani, 1951) was the complex medium for growth of bacterial strains and was routinely supplemented with glucose and MgS0 4 to 0.2% (v/v) and 1 mM, respectively. Media were supplemented with the following as required (final concentrations); casamino acids, 0.2% (w/v), thymidine, 10 |ig/mL, or uridine, 25 |lg/mL. When employed, antibiotics were added at the following final concentrations: ampicillin (Ap), 50 p,g/mL (low-copy-number plasmids) or 100 |ig/mL (higher-copy-number plasmids); tetracycline (Tc), 20 Hg/mL; kanamycin (Km), 30 Jig/mL; chloramphenicol (Cm), 25 |lg/mL. Solid media were prepared by the addition of agar to 1.5% (w/v). Organisms were routinely grown at 37 °C, while temperature-sensitive bacteria were maintained by culturing at 30 °C. Liquid cultures were incubated on a gyratory shaker operating at 250 rpm and growth monitored by measuring cell suspension turbidity spectrophotometrically at 600 nm. 46 Table 2.1 Bacterial strains Strain Genotype BZ31Tn/0 mukB106 smbBBl zee726::TnlO; (Lopez et al., 1999) CA244 lacZ trp relA spoT; (Li et al., 1999) CA244rHg lacZ trp relA spoT mg: :cat; (Li et al., 1999) DH50C endAl hsdR17 thi-1 glnV44 recAl gyrA96spoTl A(lacIZYA-argF) ul69 deoR ($80 d IacZ58AM\5) k GM48 thr-1 glnV44 JhuA31 leuB6 thi-1 lacYl galK2 galT22 araC14 tsx-78 dam-3 dcm-6 k JM109 el4~ A(lac-proAB) thi-1 gyrA96 endAl hsdR17 relAl glnV44 recAl IF' traD36 proA+B+ lacI*ZAM\5 JM110 thr-1 leuB6 thi-1 lacYgalKgalT ara tonA tsx dam dcm glnV44/¥' traD36proA+B+ lacPZAM\5 KL463 lacZ105 relA 1 rpsL221 thi-1 PlCm,clr-100; (CGSC#7536) KUR1305 AQac-pro) glnV44 thi-1 hsdkS IF' proA+B+ lacFZAMIS LM160 F leuB6 trp-31 hisGl argG6 metBl lacYl gal-6 malAl xyl-7 mtl-2 strA104 tonA2 tsx-1 A R k glnV44pnp::Tn5; (McMurry and Levy, 1987) MG1693 F thyA 7145 rph-1 k; (Arraiano et al, 1988) MRA10 F" rph-1 rpsT147 k (Ryden-Aulin et al., 1993) RD100 mapnp-13 glnV44 met relA-1 trpD9778 lacZ SK5665 F thyA 7145 rph-1 rne-1 k; (Arraiano et al., 1988) SK5689 F thyA 7145 rph-1 mb-500 k; (Arraiano et al., 1988) SK5691 F thyA 7145 rph-1 pnp-7 k; (Arraiano et al., 1988) SK7988 F thyA 715 rph-1 />cn£A::miniKan k; (Arraiano et al., 1988) XL2Blue MacrecA 1 endA 1 gyrA96 thi-1 hsdRl7ginV44relA 1 IF' proA +B+ lacPZ&Ml5 KBC1008 F thyA7145 rph-1 k rnel31::TnlO; (this study) KBC1009 F thyA 7145 rph-1 k mgv.cat; (this study) 47 Table 2.2 Previously constructed plasmids Plasmid Relevant Characteristics pBAD28 Low-copy number expression vector; Amp\ CmR; 5800 bp (Guzman et al, 1995) pGM49 Source of plasmid-encoded rpsT for synthesis of rpsT complementary RNA; AmpR (Mackie, 1987) pGM87 Source of plasmid-encoded rpsT'for gene cloning; AmpR (Mackie and Genereaux, 1993) pRC9S Source of plasmid-encoded 9S rRNA (rrnB) for synthesis of 5S complementary RNA; parental plasmid pSP65; AmpR; 3.5 kbp (Cormack and Mackie, 1992) pUC19 High-copy number cloning vector; lacZa complementation; AmpR; 2686 bp (Yanisch-Perron etal., 1985) 48 2.2.1 Induction of gene expression from pBAD-derived plasmids in vivo Cells harbouring pBAD28-derived plasmids were grown logarithmically in LB supplemented with glucose to an ODsoo^O.8. Cells from 25 mL of the culture were then collected on a 1.2 |lm Millipore filter by vacuum filtration and washed by the addition of 25 mL unsupplemented LB. The filter was used to innoculate a 300 mL culture of LB supplemented with 0.05% arabinose (w/v) to induce transcription from the plasmid-based P B A D promoter. Cells were grown for 60 min, at which time, cells density was routinely between 0.2 and 0.3 OD 6 0 0 . 2.3 GENETIC TECHNIQUES 2.3.1 Transduction Bacteriophage lysates were derived from PlCm,clr-100, a P I phage mutant possessing a defective integration function preventing stable lysogen formation and an additional mutation responsible for increased generalized transduction efficiency (Rosner, 1972). A 100 \iL aliquot of logarithmically growing E. coli cells (ODSOQ^O.S) was mixed with either 5 pX or 50 | lL of P I bacteriophage lysate, and incubated at 30 °C for 20-25 min. A 50 \iL aliquot of the celklysate mixture was deposited at on a single location of an LB plate containing chloramphenicol (Cm), streaked for single colonies, and incubated at 30 °C for 24-36 hours. Colonies were screened for lysogeny by testing for cell growth at both 30 °C and 42 °C on media containing Cm. An isolate growing well at 30 °C but not 42 °C after 16 hours was selected. The lysogen was cultured in 15 mL LBCm at 30 °C to an O D ^ O . 3 and then shifted to 42 °C for 20 min to induce lytic growth. Following heat shock, the culture was further grown at 37 °C for 60-90 min. Culture supernatants were collected by centrifugation and bacteriophage lysates were sterilized by the addition of a saturating volume of chloroform and stored at 4 °C. 49 PI-phage mediated transductions were achieved by mixing log-phase bacterial cells (OD600=0.4-6) grown in LB with bacteriophage lysate at a functional cell-to-phage particle ratio of approximately one (achieved by serial dilution of lysates). Cell:lysate mixtures were incubated at 37 °C with aeration for 20-45 min before plating on media required by the recipient and selective for transductants, and incubation at 37 °C. 2.3.2 Transformation Bacterial cells competent for transformation were prepared by the CaCl2 method (Cohen etal, 1972). Briefly, 100 mL of logarithmically grown cells (ODgnn^O.S) were placed on ice for 10 min prior to centrifugation at 4,500 rpm for 5 min at 4 °C. Harvested cells were resuspended in 100 mL 0.1 M CaCl2 using gentle manipulation, and incubated on wet ice for 30 min. Following incubation, cells were harvested by centrifugation as above and resuspended in 5 mL of 0.1 mL CaCl2 containing glycerol (15%; v/v). Resuspended cells were rapidly frozen by placing aliquots in an ethanol bath containing dry ice prior to storage at -80 °C. Competent cells were transformed with plasmid D N A according to Sambrook et al. (1989), or according to the manufacturer's instructions when commercially prepared competent cells (e.g. Subcloning-Efficiency Competent DH5a; Life Technologies) were used. Selection for transformants was achieved by adding the appropriate antibiotic to the growth medium. 2.4 RECOMBINANT DNA TECHNIQUES 2.4.1 Enzymes and chemicals Restriction endonucleases, modifying enzymes, DNA and RNA polymerases were purchased from various sources and employed according to the individual manufacturer's specifications unless otherwise indicated. Procedures requiring specific modification will be 50 detailed below or described at the appropriate location within the text. Radioactively labelled [a35S]-dATP (1250 Ci/mmol) for DNA sequencing and [<X32P]-CTP (3000 Ci/mmol) or [y32P]-ATP (3000 Ci/mmol) for the generation of radiolabeled RNA or DNA, respectively, were purchased from NEN Life Science Products. Growth media and supplements were purchased from Difco Laboratories or Bio-Rad Laboratories. All other chemicals were of reagent grade and were purchased from various commercial sources. Oligodeoxynucleotides were synthesized by either the NAPS Facility (University of British Columbia) or Life Technologies and are listed under their function in Table 2.3. Oligonucleotides from either source were routinely desalted by resuspension in 150 [LL TE containing 150 mM NaOAc with agitation at room temperature for 60 min, and precipitation with 400 | lL of 95% ethanol at -80 °C for 90 min. DNA was collected by centrifugation at 14,000 rpm for 15 min at 4 °C and washed with 80 % EtOH. Oligonucleotides were dried in vacuuo, redissolved in 150 \iL TE, and quantified spectrophotometrically by absorbance at 260 nm. 2.4.2 Molecular biological methods Recombinant DNA methodology was primarily as described in the laboratory manual of Sambrook etal. (1989). Procedures drawn from this manual include: large scale and rapid small-scale isolation of plasmid DNA; cesium chloride gradient isolation of plasmid DNA; restriction endonuclease digestion and ligation of DNA; phosphatase treatment of vector DNA, blunt-ending of DNA overhangs by T4 DNA polymerase; and, agarose gel electrophoresis. When required plasmid DNA fragments were purified through the removal of the gel slice containing the DNA from preparative agarose or polyacrylamide gels and electroelution into sterile dialysis tubing followed by ethanol precipitation. 51 Table 2.3 Oligodeoxyribonucleotides Name Nucleotide sequence PCR amplification a rnb5' 5' CTGTCAGCCGCTCTAATG rnby 5' AATCCACGCGGTTGGATC rpsTS'Kpnl 5' G G G G Z 4 CC1T1GAATTGTCCATATGGAACACATTTGGG rpsTVXbaX 5' GCrC7>tG-4GCATCACAAAAGCAGCAGGC rpsTDell 5" CGGGGTA CCATTTGGGAGTTGGACC rpsTDe\2 5' CGGGGE4CCATATGGAACACATTTGGGAG rneL5' 5' AGAATCTAGT4TTAArCCGTGTCCATCCTTGTTAAAAC meLV 5' AGAATCTAGT4 TTAA 7TGCTGCGTGGATGATCGGTCG rng5' 5' GGTGATGACAGCAGTGGCGTTGG rngV 5' GTGACTCAAAAACCCTTTGCCGG rpsTXhol5' 5' TG AGGCCTCG4 G A AAGC ATTT AACG AAATGC AACCG rpsTXhoYS' 5' ACTCCGCrCG/l GAGCCAGCTTTGTCGCCAGCTTCG XhoVrneV 5' TGAGGCCrCG /tGACCAlTlTGCCCAAAGCATTTAACGAAATGCAACCG Xholrne5' 5' ACTCCGC7m4 GAGCAGCTTTGTCGCCAGCTTCG XhoJrne3\opp) 5* TG AGGCC7/CG4 GGGGC AAAATGGT AAAGC ATTTAACGAAATGCAACCG Complementary oligonucleotides for direct cloning StemlA 5' CATCGCCACCGGGAGACCGGTGGCGATGGTAC StemlB 5' CATCGCCACCGGTCTCCCGGTGGCGATGGTAC rne\5K 5' TAACCCATTTTGCCC rne\5B 5' TAGGGCAAAATGGGT 9Sa-A 5' TACAGAA'ITITGCGA 9Sa-B 5' TATCGCAAAATTCTG Site-directed mutagenesisb Kpnll 5' GCCCAAAAAAACGGGTACCGAGAAACAGTAGAGAG Kpnll 5' CTCTCTACTGTTTCTCGGTACCCGri'ri'l'rrGGGC continued... 52 Startl 5' GGGAGTTGGACCATGGCTAATATCAAATC Start2 5' GATTTGATATTAGCCATGGTCGAACTCCC SD1 5' CACATTTGGGAGTTGCTCCTTGGCTAATATC SD2 5' GATATTAGCCAAGGAGCAACTCCCAAATGTG Stop3 5' GGTCTGATCCACTAAAACAAAGCTGCACGTC Stop4 5' GACGTGCAGCTTTGITTTAGTGGATCAGACC rneSDMl 5' GAATTGTCCATAACCCCTCTTGCCCTATGGAAC r«eSDM2 5' GTTCCATAGGGCAAGAGGGGTTATGGAGAATTC 9SaSDMl 5' GGTACCTTTGAATTGTCCATACTGJTITITGCGATATGGAACACATTTGGG 9SaSDM2 5 'CCAAATGTGTTCCATATCGCAAAAAACAGTATGGACAATTCAAAGGTACC DNA Sequencing & Primer Extension Analysis BADFOR 5' GCGG4rCCTACCTGACGC PE-1 5' CGGCTTGCGTTGTGCTTACGAG "Restriction endonuclease sites utilized in cloning of DNA fragments are italicised. ""Mutations introduced by directed mutagenesis are underlined 53 2.4.3 Construction of plasmid vectors Recombinant plasmids constructed in the course of this study are listed in Table 2.4, and are further described within the text where appropriate. The presence of DNA inserts in vector DNA was verified by the isolation of plasmid DNA, digestion with relevant restriction endonucleases, and analysis by agarose gel electrophoresis. Recombinant plasmids were further verified by sequence analysis (see Section 2.11) using the method of Sanger et al. (1977), or by an automated method using an ABB 100 sequencer. Ligation of hybridized, complementary oligonucleotides into linearized plasmid DNA was achieved following treatment of the oligonucleotides as follows. Oligonucleotides were phosphorylated in a 20 |J.L reaction containing 25 pmol oligonucleotide, 1 X T4 PNK buffer (70 mM Tris-HCl, pH 7.6, 10 mM MgCl2, 5 mM DTT), 0.1 mM ATP, and 10 U T4 polynucleotide kinase and incubated at 37 °C for 30 min. Following extraction of the reaction mixture with an equal volume of phenol:cholorform:isoamyl alcohol (20:19:1; PCI), oligonucleotides were precipitated with the addition of sodium acetate to 0.3 M and 2.5 volumes of 95% ethanol. Previously end-labelled, complementary oligonucleotides (2 pmol) were annealed in a 20 p,L reaction volume containing 1 X TE (10 mM Tris-HCl, pH 8.0, 1 mM EDTA) and 100 mM NaCl by heating at 50 °C for 5 min and further incubation at 37 °C for 30 min. A 6 p.L portion of the annealed mixture was ligated with linearized plasmid DNA. 2.5 POLYMERASE CHAIN REACTION Gene sequences were amplified from either genomic or plasmid DNA by the polymerase chain reaction (PCR) using a Hypercell Biologicals PTC-100 thermocycler. PCR reactions were typically assembled in a 25 |lL volume containing 0.5 mM in each of the four deoxyribonucleoside 54 Table 2.4 Plasmids constructed during the course of this work Plasmid Parental plasmid; construction details* pKEB102 pUC19; Kpnl-Xbal PCR-amplified fragment (375 bp; rpsT) pKEB105 pBAD28; unique Kpnl restriction endonuclease site removed pKEB106 pKEB105; new, unique Kpnl restriction site introduced by site-directed mutagenesis pKEB107 pKEB106; Kpnl-Xbal fragment (382 bp; rpsT) from pKEB102 pKEBl 10 pKEB107; Stemloop oligonucleotides ligated into Kpnl site pKEB 118 pKEB 110; Asel 'rndeader' PCR fragment (78 nt) ligated into Ndel site; + orientation pKEBl 19 pKEB106; Kpnl-Xbal V/wrS'deletionl' PCR fragment (360 bp; rpsT) pKEB120 pKEB106; Kpnl-Xbal V/w7*5'deletion2' PCR fragment (370 bp; rpsT) pKEB121 pKEBl 19; Stemloop oligonucleotides ligated into Kpnl site pKEB122 pKEB120; Stemloop oligonucleotides ligated into Kpnl site pKEB124 pKEB 110; Asel Vndeader' PCR fragment (78 bp) ligated in Ndel site; - orientation pKEB127 pKEBHO; rnel5 oligonucleotides ligated into Ndel site, + orientation pKEB128 pKEBl 10; r«el5 oligonucleotides ligated into Ndel site, - orientation pKEB136 pBAD28; BamHl-Xhol '5V/>s7/stemloopA77or andXhol-Xbal 'XholrpsT3" PCR fragments, Xhol site introduced into stemloop protected rpsT ORF to introduce PTC pKEB138 pBAD28; BamHl-Xhol '5V^rstemloopA7joIrne' andXhol-Xbal 'XholrnerpsTi" PCR fragments, Xhol and rne sequences introduced into stemloop-protected rpsT ORF pKEB142 pBAD28; BamHl-Xhol '5'rpsTstem\oopXholrne' andXhol-Xbal 'XhoIrnedoppypsTS" PCR fragments, Xhol and rne sequences introduced into stemloop-protected rpsT ORF pKEB 143 pKEB 110; mutation of Shine-Dalgarno sequence using SD oligonucleotides pKEB 144 pKEB 110; mutation of translation initiation codon using Start oligonucleotides pKEB145 pKEB138, mutation of Shine-Dalgarno sequence using SD oligonucleotides pKEB146 pKEB138; mutation of translation initiation codon using Start oligonucleotides pKEB147 pKEBl 10; premature stop codon at nt 338 introduction by mutagenesis using Stop oligonucleotides pKEB 148 pEKB 122; mutation of translation initiation codon using Start oligonucleotides continued... 55 pKEB149 pKEB127; mutation on rne insert sequence using rweSDM oligonucleotides pKEB152 pKEBl 10; 9Sa oligonucleotides ligated into Ndel site, + orientation pKEB154 pKEBl 10; 9Sa oligonucleotides ligated into Ndel site, - orientation pKEB161 pKEB152; SDM of translation initiation codon using Start oligonucleotides pKEB162 pKEB154; SDM of translation initiation codon using Start oligonucleotides pKEB163 pKEB152; SDM of 9Sa sequence using 9SaSDM oligonucleotides * Orientation of desired nucleotide sequence relative to rpsT coding region; (+), correct/desired orientation, or (-), opposite orientation. 56 triphosphates, 0.5 \lg of genomic or 50-100 ng plasmid DNA, 2 U.M of each oligonucleotide primer, and 2.5 U Taq DNA polymerase (Life Technologies) in a buffer containing 10 mM Tris-HC1, pH 9.0, 1.5 mM MgCl2, 0.2% (v/v) Tween 20. The amplification was routinely carried out for 30 cycles which consisted of the following three steps: denaturation, 95 °C for 1 min; annealing, 55 °C for 2 min; and, extension, 72 °C for 1-4 min. PCR amplification of DNA directly from single bacterial colonies or cell cultures was achieved by the method of Marion Coulter-Mackie (personal communication). Either an entire single bacterial colony or cells harvested from 500 U.L of a liquid culture were resuspended in 50 UL of lysis buffer containing 1% Triton-X-100 (v/v), 20 mM Tris-HCl, pH 8.5, and 2 mM EDTA, and heated at 95 °C for 10 min. Samples were centrifuged at 14,000 rpm for 30 sec to remove cell debris, and supernatants (2uL) were used as the source of DNA in a 25 UL PCR reaction as described above. Amplified DNA products were purified by separation through either 1% agarose gels containing IX TAE (40 mM Tris-HCl, pH 8.0, 20 mM NaOAc, 1 mM EDTA) at 100 V, or 6% polyacrylamide (29:1 acrylamide:bisacrylamide) containing IX TBE (90 mM Tris, 90 mM boric acid, 2 mM EDTA). DNA was stained with 0.5 |J,g/mL ethidium bromide and visualized under UV light. 2.6 SYNTHESIS OF R A D I O L A B E L E D R N A BY IN VITRO TRANSCRIPTION Synthesis of uniformly radiolabeled RNA complementary to either rpsTmRNA or 9S RNA for use in Northern blot hybridization was directed in vitro from the SP6 promoter harboured on pGM49 or pRC9S (see Table 2.2) for 90 min at 37 °C. Transcription reactions contained: 50 ng/plL of £coiiT-linearized pGM49 or/f/wcilll-linearized pRC9S plasmid DNA; 5 57 mMDTT; 1 mM each of ATP, GTP, and, UTP; 50 \iM CTP; 500 \lCi [a-32P]CTP (3000Ci/mmol); 100 U RNAGuard; and, 40 U SP6 RNA polymerase (Promega) in a 100 \lL reaction volume. Reactions were buffered with 40 mM Tris-HCl, pH 7.5, 6 mM MgCl2, 2 mM spermidine and 10 mM NaCl (Promega). Ten units of DNase I were added and the reaction mixture was incubated for an additional 15 min at 37 °C. Ammonium acetate was added to the transcription reaction to a final concentration of 2 M, and the mixture was extracted with an equal volume of PCI and precipitated with the addition of 2.5 volumes of 95% ethanol. The RNA was collected by centrifugation at 14,000 rpm at 4 °C, washed with 80% ethanol and dried at room temperature under vacuum in a Speed-Vac (Savant). The RNA was redissolved in 200 p;L 0.25 MNaOAc pH 5.2 and reprecipitated in 2.5 volumes 95% ethanol as described above. The RNA was then dissolved in 100 uX DEPC-treated dH20 and stored at -20 °C until use. Samples were counted in a Beckman LS6000 IC scintillation counter. The efficiency of 3 2P incorporation into RNA was determined by calculating the percentage of radiolabeled nucleotide incorporated into RNA collected from TCA (5%; w/v) precipitation of a 5 \iL aliquot of the completed synthesis reaction versus a similar volume of unprecipitated synthesis reaction (representing total radioactivity in the reaction). 2.7 ANALYSIS OF R N A BY NORTHERN HYBRIDIZATION 2.7.1 R N A i so l a t ion Bacterial cultures were grown with aeration to an OD 6 0 0 of 0.2-0.3 prior to the removal of samples. When required for mRNA decay kinetic analysis, cultures were poisoned with rifampicin at a final concentration of 200 |lg/mL. A 25 mL culture aliquot was diluted into 12.5 mL of ice cold 12.5 mMNaNj containing 200 \Lg/mL of chloramphenicol. Bacteria were collected by 58 centrifugation at 3,500 rpm for 8 min at 4 °C and RNA was prepared either by the phenol extraction method of Dennis and Nomura (1975) or as described below. Samples were dissolved in DEPC-treated dFf20 and RNA was quantified and analysed for purity spectrophotometrically by absorbance at 260 nm and 280 nm prior to storage at -70 °C. RNA sample absorbance was consistently between OD 2 6 0 /OD 2 g 0 of 1.85 and 2.00. Isolation of cellular RNA was also achieved using the method described by Nikolaj Dam Mikkelsen (Odense University, Denmark; personal communication). Harvested cell samples were resuspended in 450 uL of 10 mM MgCl2, 10 mM DTT, and 80 mM Tris-HCl, pH 7.5, and transferred to a 1.5 mL microcentrifuge tube. Cells were lysed with the addition of 550 U.L 0.5% SDS (w/v), 10 mM EDTA, 0.2 mg/mL heparin, and 200 |lg proteinase K (Sigma Chemicals) and vigorous agitation at room temperature for 20 min. Samples were then centrifuged through a matrix of packed glass wool at 14,000 rpm for 10 min at 4 °C and the eluant collected and transferred to a microcentrifuge tube containing 500 \iL isopropanol. A 25 UL aliquot of RNATack® resin (Biotecx Laboratories, Inc., Houston, TX) was then added and the mixture vortexed for 10 sec. Samples were centrifuged at 1,000 rpm for 10 sec to separate pelletted resin from contaminants remaining in suspension. Supernatants were removed and the resin was washed with 1 mL of 75% ethanol by vortexing for 10 sec followed by centrifugation at l,000rpm for 10 sec at 4 °C. A second wash was repeated as above followed by centrifugation of the sample at 14,000 rpm for 10 min at 4 °C. The resin was dried in vacuuo for 5 min in the absence of heat and resuspended in 60 uL TE, pH 7.5, for 20 min on ice. The resin was seperated from the RNA present in the supernatant by centrifugation at 14,000 rpm for 10 min at 4 °C. When necessary, RNA samples were treated with DNase I as follows. In a final volume of 100 UL, 20 U-g of RNA was incubated with 2 U DNase I (Promega), 5 mM MgCl and 50 mM 59 Tris-HCl, pH 8.0, for 30 min at 37 °C. After incubation, RNA was extracted once with an equal volume of PCI and precipitated with 2 M NH 4 OAc and 2.5 volumes of 95% ethanol. RNA was collected by centrifugation at 14,000 rpm for 10 min at 4 °C, washed with 80% ethanol and dried in vacuuo. 2.7.2 Analysis of RNA by Northern Hybridization R N A (5 [Lg) was boiled for 1 minute in a buffer containing 90% formamide and bromphenol blue prior to separation by electrophoresis through a 5-6% polyacrylamide (29:1 acrylamide:bisacrylamide) gel containing 8 M urea. Following electrophoresis the gels were soaked briefly in 0.5X T B E to remove excess urea and the RNA was transferred to Hybond-NX nylon membranes (Amersham Pharmacia Biotech.) using a Trans-Blot Cell (Bio-Rad Laboratories). Transfers were performed in 0.5X T B E for 60 min at a constant current of 200 mA. The R N A was immobilized to the membrane by U V photocrosslinking (150 mJoules) using a GC Gene Linker (Bio-Rad Laboratories). R N A blots were prehybridized at 55 °C for 60 min in a Micro-4 Hybaid hybridization oven in an annealing solution (8.0 mL) containing 50% deionized formamide, 5X SSC (750 mMNaCl, 75 mM sodium citrate, pH 7.0), 5X Denhardt's solution (0.05% Ficoll, 0.05% polyvinylpyrolidone, 0.05% bovine serum albumin), 250 |lg/mL yeast RNA, 0.1% SDS, and 60 |Xg/mL sheared salmon sperm DNA. Membranes were subsequently hybridized in fresh annealing solution containing 1 x 107 cpm [a-32P]-labelled cRNA probe overnight at 55 °C. R N A blots were washed four times with 50 mL IX SSC and 0.1% SDS (w/v) for 15 min and the hybridized R N A was visualized and quantified with a Molecular Dynamics Phosphorlmager system. Half-lives were deduced from the initial slope of a semi-logarithmic plot of the fraction of mRNA remaining versus time of sampling after rifampicin addition. Quoted mRNA half-life values within 60 the text are those obtained from the experiments shown in the accompanying figures. Half-life values offered in Tables 3.1, 4.1 and 5.1 are the average of at least four Northern blot experiments, and include standard deviation values. For mRNA half-lives where no standard deviation value is given, the value represents the most accurate value of at least two trials. When necessary, hybridized RNA was removed from the membrane using a solution of 0.1% SDS at 100 °C. RNA loading was periodically verified by reprobing the membranes for 5S rRNA. 2.8 SITE-DIRECTED MUTAGENESIS Site-specific mutations were introduced into plasmid DNA using the QuikChange™ Site-Directed Mutagenesis methodology by Stratagene Cloning Systems (La Jolla, CA) as briefly described below and schematically illustrated in Figure 2.1. Plasmid DNA (5-50 ng) was added into a 50 U.L mutagenesis mixture containing 10 mM KC1, 10 mM (NH4)2S04, 20 mM Tris-HCl, pH 8.8, 2 mM MgS04, 0.1% Triton-X-100, 1 mg/mL bovine serum albumin (BSA), 125 ng of each mutagenic oligonucleotide, 200 \iM of each dATP, dCTP, dGTP and dTTP, and 2.5 U PfuTurbo DNA polymerase (Stratagene). Oligonucleotide primers containing the desired mutation were incorporated into nascent DNA during PCR amplification utilizing supercoiled DNA as template to generate mutated plasmid containing staggered nicks (Figure 2.1). Following amplification, mixtures were treated with 10 U of methylation-sensitive endonuclease, Dpnl, at 37 °C for 60 min to digest parental, methylated DNA. An portion of the Dpnl digestion was routinely analysed on 1% agarose gels to quantify linear, amplified DNA and compared to supercoiled, template DNA. The amplified, £>/wI-digested DNA was used to transform high-efficiency competent cells (i.e. Subcloning Efficiency Competent DH5a; Life Technologies) and transformation mixtures were plated onto a selective medium. 61 Figure 2.1 In Vitro Directed mutagenesis by the QuikChange™ Site-Directed Mutagenesis System (Stratagene Cloning Systems). Supercoi led , double-stranded p l a s m i d (black circles) harbouring a gene insert o f interest and target site for mutat ion (starburst) is used as template D N A (Step 1). U p o n denaturation o f the template p l a smid D N A , two synthetic, complementary ol igonucleot ide pr imers containing the desired mutat ion (grey bars) are annealed to opposite D N A strands o f the target site w i t h i n the p l a smid template (Step 2). P / w T u r b o ™ D N A polymerase extends the mutagenic pr imers wi thout d i sp lac ing the nascent strand result ing i n incorporat ion o f the pr imers and generation o f n i cked c i rcular D N A (grey circles) complementary to each strand o f the parental, template D N A (Step 3). F o l l o w i n g several rounds o f temperature c y c l i n g and ampl i f ica t ion o f nascent, mutant-containing D N A by P C R , the react ion is digested w i t h restr ict ion endonuclease, Dpnl, specif ic for methylated and hemimethyla ted template D N A , and used to remove the parental D N A template and for select ion o f mutat ion-containing in vitro synthesized D N A (Step 4). The n i c k e d vector D N A incorporat ing the desired mutat ion is then transformed into competent cel ls , w h i c h repair the n icks i n the mutated p l a smid and permit p l a smid repl ica t ion in vivo (not shown). P l a s m i d D N A is isolated and screened for the incorporat ion o f the desired mutat ion. F igure adapted from Instruction M a n u a l Ca ta log #200518, Stratagene C l o n i n g Systems ( L a J o l l a , C A ) . 62 Stepl Step 2 Step 3 Step 4 2.9 ANALYSIS OF CELLULAR PROTEIN 2.9.1 Protein sampling and separation Samples (1 mL) of cultured E. coli cells were collected in microcentrifuge tubes by centrifugation at 14,000 rpm for 5 min at room temperature. Cells were resuspended in 200 \iL of 2X sample buffer (120 mM Tris-HCl, pH 6.8, 10% glycerol (v/v), 3% SDS, 50 mM DTT, and 0.1% bromphenol blue) and boiled for 5 min with occasional vortexing. Cell lysates were analysed by electrophoresis (SDS-PAGE) through 4.5% polyacrylamide stacking and 10-12% polyacrylamide running gels (36:1 acrylamide:bisacrylamide) containing 0.1% SDS in Laemmli's running buffer (25 mM Tris, 192 mM glycine, and 0.1% SDS; Laemmli, 1970). The proteins were visualized by staining with a Coomassie Brilliant-blue solution containing 0.05% (w/v) Coomassie Brilliant-blue R-250, 45% methanol, and 10% acetic acid. Gels were destained with a solution of 5% ethanol and 5% acetic acid. 2.9.2 Western Blotting and Protein Detection Proteins were transferred electrophoretically to pretreated Immobilon-P PVDF membranes with 0.45 l^m pore size (Millipore) at a constant current of 250 mA for 90 min. Membranes were blocked with 20 mL PBTN (145 mM NaCl, 20 mM NaP0 4 , 0.1% bovine serum albumin, 1 mM NaNH 3 , pH 7.4) with 5% casein for 60 min at room temperature with gentle shaking, and probed in a fresh 20 mL aliquot of PBTN with 5% casein containing an appropriate dilution of rabbit polyclonal antibody directed against the protein of interest by incubation at room temperature for 60 min. Membranes were washed four times with 25 mL PBS (140 mM NaCl, 2.5 mM KC1, 10 mM NajHPCv 2 mM K H 2 P 0 4 , pH 7.4) for 15 min each. A horse radish peroxidase-conjugated antirabbit monoclonal antibody was added to the membrane in 10 mL PBS and incubated for 60 min, and membranes were then washed as described above. Proteins were 64 visualized by the addition of ECL Western Blotting Detection reagent (Amersham Pharmacia Biotech.) according to manufacturer's instructions followed by exposure by fluorography. 2.10 RNA 5' E N D D E T E C T I O N A N D S T R U C T U R E M A P P I N G 2.10.1 Radiolabelling of PE-1 by polynucleotide kinase Oligonucleotide PE-1 (10 pmol) was phosphorylated in a final volume of 25 U.L containing the following components: 70 mM Tris-HCl, pH 7.6; 10 mM MgCl2; 100 mM KC1; 1 mM 2-mercaptoethanol; 3 UL [y32P]-ATP; and, 10 U polynucleotide kinase (Life Technologies). Reaction mixtures were incubated at 37 °C for 10 min followed by a 10 min incubation at 65 °C. Reaction mixtures were brought to a volume of 200 UL and extracted with an equal volume of PCI followed by the addition of 15 UL 8MNH 4OAc and 1.5 UL glycogen (5 mg/mL; Ambion Inc.) and precipitation with 600 uL of 95% ethanol at -20 C overnight. Radiolabeled PE-1 was collected by centrifugation at 14,000 for 15 min at 4 °C, washed with 80% ethanol and redissolved in dH20 to 0.5 pmol/piL. 2.10.2 Primer Extension Total cellular RNA (3 U-g) extracted from MRA10 cells (ArpsT; Ryden-Aulin et al., 1993) transformed with the appropriate pBAD28-derived plasmid was combined with 2 pmol labelled PE-1 in 50 mM Tris-HCl, pH 8.3, 75 mM KC1 and 10 mM DTT in a total volume of 10 UL and incubated at 60 °C for 5 min. Synthesis of cDNAs was initiated by the addition of (final concentrations) 50 mM Tris-HCl, pH 8.3, 75 mM KC1, 3 mM MgCl2, 10 mM DTT, 5 mM each of dATP, dCTP, dGTP and dTTP, and 100 U M-MLV Reverse Transcriptase (Life Technologies) in a final volume of 20 \iL followed by incubation at 37 °C for 45 min. Extension products were resolved alongside sequence ladders, generated using the same primer, on 6% sequencing gels 65 containing 8 M urea and exposed to x-ray film to allow visualization by autoradiography. 2.10.3 RNase T I digestion of RNA Cellular RNA (10-50 \ig) isolated from MRA10 transformed with either pKEB127, 128, 152, or 154 was heated for 5 min at 60 °C, cooled to 37 °C, and digested with diluted ribonuclease TI (Amersham Pharmacia Biotech.) In 20 mM Tris-HCl, pH 8.3, 5 mM MgCl, and 150 mM KC1, for various time intervals at 37 °C. Reaction aliquots were stopped by extraction with PCI and the RNA was precipitated with 95% ethanol in the presence of 500 mM NH 4 OAc and 100 Hg/mL glycogen (Ambion Inc.). RNA was redissolved in 8 | l L of 50 mM Tris-HCl, pH 8.3, 75 mM KC1, and 10 mM DTT for use in primer extension reactions (described above). 2.11 ANALYSIS OF DNA BY DIDEOXY NUCLEOTIDE SEQUENCING 2.11.1 Automated DNA sequencing Supercoiled template D N A for automated sequence analysis was purified from agarose gels by electroelution into dialysis bags. D N A sequence was determined as a service of the University of British Columbia NAPS Facility or the Department of Biochemistry and Molecular Biology Sequencing Service, using an Applied Biosystems 3100 automated D N A Sequencer. Automated sequencing utilized utilizing non-radioactive, dye-labelled nucleotide analogues and PCR technology to generate nascent D N A fragments terminated with one of four dye-labelled dideoxynucleotides. 2.11.2 Manual DNA sequencing D N A from plasmid templates prepared by rapid alkaline lysis were sequenced using the dideoxy method of Sanger et al. (1977). Plasmid D N A (2 \ig) was mixed with 20 ng of oligonucleotide primer in accordance with the method of the Amersham Pharmacia T7 66 Sequencing Protocol and extension products were generated using T7 DNA Sequenase™ (Amersham Pharmacia Biotech.). The 35S-labelled samples were heat-denatured in 40% (v/v) formamide and separated on 6% polyacrylamide (19:1 acrylamide:bisacrylamide) sequencing gels containing 8 M urea and electrophoresed through TBE (90 mM Tris, 90 mM boric acid, 2 mM EDTA) running buffer. Products were visualized by autoradiography. 67 CHAPTER THREE INFLUENCE OF 5'-TERMINAL SECONDARY STRUCTURE ON THE STABILITY OF . RPSTMRNA WESCHERICHIA COLI 3.1 INTRODUCTION 3.1.1 Expression of recombinant rpsT mRNAs in vivo An evaluation of the influence of sequence or RNA structural modifications on the kinetics of mRNA degradation requires that the gene encoding the mRNA under analysis can be manipulated, easily expressed in vivo, and the products monitored. While recombinant DNA technology has greatly facilitated in vitro DNA manipulation, the controlled expression of gene sequences for the analysis of mRNA decay in the cell requires thoughtful consideration. Although there are numerous mechanisms by which recombinant DNA can be introduced into the cell, there are only two ways by which the cell can maintain the introduced gene as part of its inheritable genetic material: as an integrate in the bacterial chromosome; or, as a component of an autonomously replicating episome. Each mechanism of transgene maintenance has advantages over the other. For example, integration of transgene sequences into the chromosome by homologous recombination can ensure that the recombinant gene is present at a single copy, thereby maintaining physiologically levels of gene expression and avoiding potential deleterious effects to the cell often associated with chronic expression from multiple gene copies. However, chromosomal integration mediated by bacteriophage transduction or transformation often requires specialized cloning vehicles and/or bacterial strains (for examples, see Kulakauskas etal, 1991; Yu and Court, 1998; Yu etal, 2000). In contrast, introduction of a recombinant gene harboured on a selectable DNA plasmid is easily achieved by transformation, and offers the advantage of 68 recovery of the episomal DNA from the cell by simple methods. As discussed previously (Section 1.7), the RNA secondary structure and mechanism for rpsT mRNA decay in vitro are well established, and, therefore, rpsT mRNA is a powerful substrate for an analysis of mRNA degradation in vivo. Nevertheless, an in vivo analysis of rpsT mRNA catabolism requires that consideration be given to the rpsTgene itself and its role in cellular metabolism, particularly when alterations in gene expression (i.e. mRNA levels) are expected. While rpsT'is not essential for cell growth, the protein product, S20, plays a role in ribosome biogenesis and function, and in its absence, cells are temperature-sensitive for growth (Ryden-Aulin et al, 1993). As a consequence, a strategy in which recombinant r/wJgenes, which may encode mRNA with either elevated or reduced steady-state levels, are recombined into the chromosome and replace the endogenous copy of rpsT could predictably lead to changes in cell growth due to altered S20 production. Such potential consequences of altered S20 expression may include pleiotropic effects that influence mRNA decay mechanisms and kinetics, and, therefore, should be avoided. Similarly, integration of recombinant rpsT at chromosomal positions distinct from the endogenous rpsT'map position can result in position-dependent transgene expression (Sousa et al, 1997), therefore making an evaluation of mRNA decay difficult. Furthermore, the sustained expression from the resulting meridiploid cell is a concern due to the perplexing influence of S20 on rpsT mRNA stability. Ideally, an analysis of rpsT mRNA decay requires a genetic system in which the expression of endogenous rpsT mRNA is preserved, and recombinant rpsT mRNAs are transiently expressed at physiologically relevant levels. A characteristic important to such an inducible expression system is its ability to be tightly repressed, but rapidly and efficiently derepressed to facilitate expression of moderate levels of transgene mRNA. In addition, it is critical that the process of 69 induction of transgene expression does not also influence additional cellular processes, in particular, RNA degradation. The presence of the inducible regulatory system on an autonomously replicating expression vector greatly facilitates genetic manipulation, and avoids any potential alterations to chromosomal rpsT expression. 3.1.2 An arabinose-inducible gene expression system The araBAD promoter harboured on the plasmid expression vector, pBAD28 (Figure 3.1), provides an ideal mechanism to achieve regulated expression of rpsTmRNA for the in vivo analysis of RNA degradation mechanisms. In addition to the araBAD promoter/regulatory region, pBAD28 also harbours araC, the gene required for regulated expression from the araBAD promoter, P B A D . Induction of expression from P B A D is achieved using the inducer, L-arabinose, and is linear over a wide range of inducer concentrations, thereby permitting modulation of expression from P B A D (Lee et al, 1974; Guzman et al, 1995). Importantly, in the absence of arabinose, transcription from P B A D is tightly repressed, and can be further reduced to extremely low levels by the presence of glucose, through catabolite repression. The very low level of uninduced expression can be efficiently maintained over long periods of time and provides a major advantage over other commonly used inducible expression systems, such as the hybrid trp-lac promoter. Expression from P T A C under uninduced conditions has been demonstrated to be considerable (Diederich et al, 1994). In addition, unlike promoters requiring a temperature shift for induction (i.e. lambda promoter PL and its temperature-sensitive repressor, cl), the kinetics of induction (and repression) for P B A D are very rapid, and the conditions of induction do not exert global cellular consequences. While expression from P B A D can be both positively or negatively regulated (i.e. derepressed or repressed, respectively), transient induction of transgene expression from P B A D is favourable for the analysis of rpsT mRNA degradation in vivo. 70 a c c c g t t t t t t t g g g c t a g c g a a t t c g a g c t c g g t a c c c g g g g a t c c t c t a g a g t c g a c c t g c a g g c a t g c a a g c t t +1 Figure 3.1 Low-copy Number Expression Plasmid pBAD28. A. Plasmid map of pBAD28 vector adapted from Guzman et al. (1995) with the relevant genetic features highlighted. B. Nucleotide sequence of the P B A D transcription initiation site (+1; indicated) and multiple cloning site (MCS) of pBAD28. Indicated above the sequence are unique restriction endonuclease cleavage sites available for gene cloning. 71 In addition to the ability to modulate expression from P B A D through inducer concentration, the PI5A replicon harboured on pBAD28 maintains the plasmid at a moderate copy number in the cell (approximately 20 copies; Chang and Cohen, 1978) facilitating expression of physiologically relevant levels of the transgene. Furthermore, the P15 A origin of replication is compatible for coexpression with additional plasmid vectors (i.e. ColEl derivatives). Additional features of pBAD28 include a fairly extensive multiple cloning site (MCS) downstream of PB A D, and the genes encoding resistance to antibiotics, ampicillin and chloramphenicol (Figure 3.1). It should be noted that this particular expression vector does not harbour sequences between P B A D and the MCS directing translation, and, therefore, cloned DNA sequences must include a ribosomal-binding site to permit translation (i.e. Shine-Dalgarno sequence). 3.1.2.1 Molecular mechanism for regulation of the araBAD promoter The specific nature of the P B A D promoter necessitates positive regulation of araBAD for efficient gene expression, as regions of P B A D important for RNA polymerase binding display only moderate consensus, predicting a low level of polymerase binding and transcription from this promoter. Promoter position (relative to site of transcription initiation, +1) -35 -10 consensus TTGACA TATAAT PBAD CTGACG TACTGT The regulator of P B A D transcription, AraC (arabinose-responsive transcription activator protein) acts both positively and negatively (Greenblatt and Schleif, 1971; reviewed in Schleif, 1996). In the presence of the inducer L-arabinose, AraC activates transcription from P B A D and two 72 additional arabinose operons in E. coli (araE and araFGH), while in the absence of arabinose, AraC is responsible for repression of transcription, a state that can be further reduced by CRP (cAMP-receptor protein) in the presence of glucose through catabolite repression. Divergently oriented araC and araBAD promoters encode operator sites, aral and ara02, that are required for P B A D regulation (Figure 3.2 A). Ara l l and ara0 2 contain 17 bp D N A half sites separated by 211 bp, and in the absence of arabinose, binding of a AraC homodimer at aral t and ara0 2 mediates gene repression by D N A looping. In the presence of arabinose, AraC undergoes a ligand-induced conformation change causing reorientation of the homodimer subunits from the distal ara0 2 site to the previously unoccupied aral2 half site, resulting in the disruption of the D N A loop (Soisson et al., 1997; Figure 3.2 B). In addition to unlooping of the D N A between the aral and araO operator sites, arabinose is believed to induce a 50-fold increase in affinity in AraC for its D N A site (Johnson and Schleif, 1995). Contact between AraC and the two adjacent aral half sites are thought also to release or unmask a functional domain within the araI2-bound subunit promoting interaction with R N A polymerase (Bustos and Schleif, 1993; Carra and Schleif, 1993). Since aral overlaps the R N A polymerase -35 binding region by 4 bp, AraC is believed to interact directly with R N A polymerase through its sigma factor, causing rapid derepression of P B A D (Figure 3.2 C). The P B A D promoter is also regulated by cAMP receptor protein (CRP). P B A D contains a CRP-binding site and displays catabolite sensitivity, however, this binding site is not adjacent to the R N A polymerase binding sequences. CRP binds within a region between araO! and aral and is thought to stimulate transcription not through direct interaction with RNAP, but by assisting in the unlooping of the D N A loop between aralj and ara02. It is believed that only when this loop is open can the DNA-binding domain of AraC bind efficiently to aral2. 73 Figure 3.2 The araBAD Regulatory Region and Mechan ism for Regulated Gene Expression. A . Schematic of the araBAD promoter/operator region adapted from Lobell and Schleif (1990). The relative nucleotide positions of the 5' region of the araB gene (grey continued box), position of P B A D transcription initiation (+1) and upstream regulatory regions are shown. The 17 nt D N A half-sites (horizontal arrows) present in the aral, araO, and ara0 2 regulatory regions (coloured boxes) and position of catabolite repressor protein (CRP) binding (grey spotted box) are emphasized. The promoter-proximal aral 2 half site overlaps by 4 bp with R N A polymerase -35 binding sequence (not detailed). B . Mechanism of A r a C gene repression by D N A looping. In the absence of inducer, L-arabinose, AraC homodimer (indicated) is bound to the a r a 0 2 and aral x D N A half sites to induce D N A looping and repress gene expression from P B A D . With the addition of arabinose, AraC dimer undergoes a conformational change and reorients its binding position to occupy the aral x and aral 2 D N A half sites, disrupting the D N A loop (homodimer binding to araOj also occurs). Binding of C R P in the absence of glucose facilitates D N A unlooping. Figure adapted from Lobell and Schleif (1990). C . Molecular mechanism of araB induction by AraC interaction with R N A polymerase. The C-terminal D N A binding domain of AraC bound to the two aral half sites interacts with R N A polymerase to promote derepression of araB gene expression (Figure adapted from Reeder and Schleif, 1993). 74 75 3.2 RESULTS 3.2.1 Expression of rpsTmRNA from pBAD28 The low copy-number expression vector, pBAD28 (Figure 3.1), was obtained from Dr. Jonathan Beckwith (Department of Microbiology and Molecular Genetics, Harvard Medical School, Boston, MA) for the regulated expression of recombinant rpsT genes. The construction of pBAD28, however, is not completely satisfactory for this purpose. The MCS in pBAD28 is positioned such that ligation of D N A into the vector occurs at least 25 residues downstream from the position of transcriptional initiation of P B A D (Figure 3.1). As a consequence, expression from P B A D results in a chimeric mRNA with 5' terminal, vector-encoded sequences present upstream of residues encoded by the cloned gene. An analysis of the influence of specific 5' mRNA sequences and structure on mRNA decay requires that mRNA be devoid of such vector-encoded 5' sequences, as such, cloned rpsT D N A must be present at the exact position of P B A D transcriptional initiation. Consequently, it was necessary to modify the vector to allow for the cloning of rpsT gene sequences at the exact point of transcription initiation. A restriction endonuclease site was introduced into pBAD28 to facilitate insertion of recombinant rpsT DNA at the site of P B A D transcriptional initiation. Inspection of sequences surrounding both the rpsT and araBAD transcriptional initiation sites suggested that introduction of a Kpn\ restriction site would retain both sequences important for P B A D transcription initiation while also maintaining wildtype rpsT 5' residues. To facilitate the introduction of a Kpnl site at the P B A D +1 site, the unique Kpnl site within the MCS of pBAD28 was first removed. The procedures involved in this process are shown in Figure 3.3. Briefly, pBAD28 was linearized with Kpnl, treated with T4 polymerase to remove single-stranded residues created by the endonucleolytic cleavage, and religated. Ligation 76 pBAD28 P Xma\ Sma\ BAD r .TCCATACCCGI I I I I I IGG +1 Sac\ Kpn\ Xba\ GCTAGCGAATTCGAGCTCGGTACCCGGGGATCGTCTAGAGT: pKEB105 Kpn\ digestion, T4 polymerase 'blunt-ending', and ligation BAD Sad Xba\ T C C A T A C C C G I I I I I I I G G +1 G C T A G C G A A T T C G A G C T C G C C G G G G A T C C T C T A G A G T . pKEB106 Pp BAD Introduction of Kpnl at P B A D by site-directed mutagenesis Sad Xba\ TCGGTACCCGTI I I I I IGG Kpnl G C T A G C G A A T T C G A G C T C G C C G G G G A T C C T C T A G A G T Figure 3.3 Construction of Plasmid Expression Vector pKEB106. The nucleotide sequence of the P B A D transcription initiation region (+1) and multiple cloning site (MCS; shaded) within pBAD28 are shown. The unique Kpnl restriction site in the MCS of pBAD28 was eliminated in pKEB105 prior to reintroduction of the site by directed mutagenesis to generate pKEB106, as described within the text. 77 reactions were used to transform competent E. coli cells and transformants were selected by antibiotic resistance. Plasmid DNA was isolated from single colony isolates and screened for the absence of a Kpnl site by digestion with Kpnl. One candidate, pKEB105, was sequenced to confirm that the Kpnl site was destroyed. In addition, the unique Smal restriction site, whose recognition sequence overlaps that of Kpnl within the MCS of pBAD28, was also destroyed by the T4 polymerase treatment (Figure 3.3). A new, unique Kpnl site was introduced at the exact position of P B A D transcription initiation by site-directed mutagenesis as described in Materials and Experimental Procedures using mutagenic oligonucleotides Kpnll and Kpnll. Putative mutant plasmids were screened by digestion with Kpnl, and a single isolate, pKEB106 (Figure 3.3), was sequenced to verify the introduction of unique Kpnl site. 3.2.2 Cloning of rpsT sequences into pKEB106 Oligonucleotides rpsTS'Kpnl and rpsTVXbal were used as primers in the amplification of wildtype rpsT sequences from pGM87 (Table 2.2) by PCR. The amplified DNA product contains residues 91-477 of the rpsTgene (sequence coordinates of the rpsTmRNA are described in Mackie, 1992; Figure 1.9), beginning at the site of transcription initiation from the more downstream of the tandem promoters (i.e. P2), and includes the native, rho-independent transcription terminator at the 3' end. In addition, a unique Ndel restriction site harboured in oligonucleotide rpsTS'Kpnl was simultaneously introduced into the 5' UTR of the rpsTgene. Digestion of the purified DNA fragment with Kpnl and Xbal, whose sites were incorporated into the sequence of the oligonucleotide primers, generated a product that was then ligated into pUC19 at its Kpnl and Xbal restriction sites. Ligated DNA was used to transform DH5a, and 78 the mixture was grown on selective media containing the chromogenic substrate, 5-bromo-4-chloro-3-indolyl-P-D-galactopyranoside (X-gal). Transformants harbouring pUC19 plasmids with a disruption in the lacZ coding sequence were identifiable as white colonies. Recombinant plasmids were isolated and further analysed by restriction digestion with Kpnl and Xbal. A single isolate containing the amplified rpsT gene sequence, pKEB102, was selected. The 386 nt rpsT gene fragment was recovered from pKEB102 by digestion with Kpnl and Xbal, and the purified fragment was ligated into pKEB106 (previously digested with Kpnl and Xbal). Recombinant plasmids from DH5a transformed with the ligation mixture were analysed by restriction digestion using several endonuclease pairs. A particular isolate generating the correctly sized DNA fragment upon digestion was selected and subjected to sequence analysis using oligonucleotide primer, BADFOR, which anneals to a region of pBAD28 upstream from P B A D . Sequence analysis verified the cloning of the rpsT gene sequence, its correct orientation relative to P B A D , and also maintenance of all wildtype rpsT residues (i.e. complete integrity of the cloned rpsT gene sequence). This plasmid, pKEB107, directs transcription of rpsTmRNA from the P B A D promoter with no inclusion of vector-encoded sequences, and is the parental plasmid for all further gene constructions (Figure 3.4). The rpsTmRNA expressed from P B A D in pKEB107 is indistinguishable in size from the chromosomally-encoded rpsTVl mRNA of 356 nt. 3.2.3 Stability of pKEB107-encoded rpsTmRNA The growth and induction parameters required for transient and moderate expression of rpsT under control of P B A D were determined empirically. Growth of MG1693 (wildtype) cells harbouring pBAD28-derived plasmids in 0.05% arabinose for 60 min achieved moderate levels of plasmid-encoded rpsT'mRNA as determined by Northern blot analysis (data not shown). 79 BAD Figure 3.4 Genetic Map of rpsT Harboured on pKEB107. Schematic of rpsT cloned at the position of P B A D transcription initiation in pKEB107, the parental plasmid for all rpsT gene constructions. The Shine-Dalgarno sequence (SD; grey box), coding region (black box), and Ndel restriction endonuclease site introduced into the 5' UTR are shown. The rho-independent transcriptional terminator (T) and experimentally determined secondary structure (Mackie, 1992) for the transcribed mRNA (356 nt) are detailed. 80 R N A was isolated at various time intervals from MG1693 cells grown in 0.05% arabinose for 60 min after the addition of rifampicin to block transcriptional initiation. rpsT mRNA expressed from MG1693 harbouring PKEB107 1 was visualized by Northern blot analysis and the kinetics of mRNA degradation were determined. A n increase in expression of a 365 nt rpsT mRNA was not detectable in MG1693 containing pKEB107 grown in the presence of glucose. In contrast, expression of the 365 nt rpsTmRNA was elevated 2-5 fold relative to the endogenous rpsTPl mRNA when cells were grown in 0.05% arabinose for 60 min (Figure 3.5 A , * compare lanes 1 and 2), indicative of induction upon cell growth in arabinose. The half-life for the coincident P2 and rpsT(\Ql) mRNA was 2 min (Figure 3.5B, and compared in C), a rate that does not differ from chromosomally-encoded P2 rpsT'mRNA in untransformed MG1693 cells grown in glucose or previously published results (Mackie, 1987). In addition, the endogenous rpsTYl mRNA from MG1693/pKEB107 decays with a half-life of 1.5 min, also comparable to untransformed MG1693 (Figure 3.5 C) and previously published results. Maintenance of wild-type kinetics for the decay of rpsT mRNAs from MG1693/pKEB107 suggests that neither the brief growth of MG1693 cells in arabinose, nor the accumulated level of rpsT(\01) mRNA titrates the decay machinery and/or alters the rate or rpsT mRNA degradation within the experimental time frame. 3.2.4 Influence of a 5'-terminal stem-loop structure on rpsT mRNA decay The unusual stability of the ompA mRNA provides a striking example of R N A secondary structure modulating the initiation of mRNA decay (Belasco et al, 1986; Melefors et al, 1988). 1 Recombinant rpsT mRNAs transcribed from the P B A D promoter will hereafter be designated according to the plasmid template; thus, rpsT(107) mRNA is the rpsTmRNA encoded by pKEB107. 81 Figure 3.5 Decay of Plasmid-encoded rpsT mRNA. Northern blot analysis was performed on 5 U-g samples of R N A isolated from MG1693/pKEB107 (A) or MG1693 (B) extracted at various time intervals (in min; above each panel) after the addition of rifampicin and separated on a 5.5% denaturing polyacrylamide gel. A radiolabeled RNA complementary to the entire rpsTmRNA (P2) was used to hybridize r ^ r m R N A species. Positions of the chromosomally-encoded rpsT mRNAs, PI (447 nt) and P2 (356 nt), or plasmid-encoded rpsT(\01) mRNA (*) are indicated at left. A. The decay of rpsTmRNA from MG1693/pKEB107 in the presence of glucose (lane 1) or arabinose (lanes 2-9). The plasmid-encoded rpsT(107) mRNA and P2 rpsTmRNA comigrate ( P 2 & * ) . B. Decay of rpsT mRNA from MG1693. C. Plot of the first-order decay of rpsT mRNAs versus time. Symbols used for each mRNA are indicated right of panel A. 82 A 3 MG1693/pKEB107 rpsTmRNA P1 o- 0" V 2' 3" 4" 5' 6' 7" - - -P2& * - > • m 1 2 3 4 5 6 7 8 9 B MG1693 0* r 2' 31 4' 51 61 7' 2 3 4 5 Time (min) 83 The 5'-terminal stem-loop of the ompA mRNA is necessary and sufficient to confer stability to the entire mRNA, or to heterologous labile mRNAs to which it has been fused (Emory and Belasco, 1990; Hansen et al, 1994). To evaluate the influence of a 5'-terminal stem-loop on the decay of rpsT mRNA, a recombinant stem-loop-rpsT gene, harboured on pBAD28, was constructed and the stability of the chimeric mRNA was assessed in vivo. 3.2.4.1 Construction of plasmid-based rpsT encoding a S'-terminal stem-loop Sequences encoding a stem-loop structure based on a stabilizing hairpin characterized by Bouvier and Belasco (1992) were cloned as complementary deoxyoligonucleotides into the unique Kpnl site at the extreme 5' end of the rpsT gene in pKEB107 as described in Materials and Experimental Procedures and illustrated in Figure 3.6 A. Briefly, pKEB107 DNA was linearized with Kpnl and dephosphorylated using calf intestinal alkaline phosphatase. Complementary oligonucleotides, Steml A and Stem2A, were phosphorylated and annealed, and an aliquot of the annealed mixture was ligated into the prepared pKEB107 DNA. Isolated transformants were screened for insertion of the 32 bp oligonucleotide sequence by restriction endonuclease digestion and analysis on 12% polyacrylamide gels. Subsequent sequence analysis established that plasmid isolate, pKEBl 10, harboured the inserted oligonucleotides. The resulting chimeric rpsTgene (harboured on pKEBl 10) is predicted to encode a transcript possessing a 14 base pair stem-loop with a stable GNRA tetraloop (Jucker et al, 1996) at the extreme 5' terminus of the rpsT mRNA (Figure 3.6 B) 3.2.4.2 Verification of rpsT(110) mRNA 5' secondary structure by primer extension analysis To determine if pKEBl 10 directs the formation of a stable 5' stem-loop structure within the rpsTCl 10) mRNA, total RNA was analysed by primer extension analysis. To eliminate the 84 A Complementary oligonucleotides Stem 1A and StemlB 5' CATCGCCACCGGGAGACCGGTGGCGATGGTAC 3' O S D Q f l f l D f l Q D Q O D B D D O f l l l B Q O O O D E I D D B n B n Q O D O D f l D D O O O D D D D O n f l f l D 3' CATGGTAGCGGTGGCCCTCTGGCCACCGCTAC . 5' Phosphorylated and annealed Stem 1A and Stem 1B oligonucleotides ligated into Kpnl site of pKEB107 pKEB107 5' TCGGTACCTTTGAATTGTCCATATGGAACACATTTGGGAGTTGGACC TTG... 3' AGCCATGGAAACTTAACAGGTATACCTTGTGTAAACCCTCAACCTGG AAC... Kpnl A/del B A G G A G C G C C G C G A U C G C G G C C G U A A U C G I Kpnl C G '—— , , 5' A UACCUUUGAAUUGUCCAUAUGGAACACAUUUlGGGArjUUGGACC UUG GCU AAU . Nde\ RBS Star t . . . Figure 3.6 Construction of pKEBllO and Secondary Structure of r/wTTllO) mRNA. A. Oligonucleotides Stem 1A and StemlB were ligated into the Kpnl restriction site at the 5' end of the rpsT gene in pKEB107 as described in detail within the text. B. The nucleotide sequence and predicted stem-loop structure at the extreme 5' terminus of rpsT(l 10) mRNA. Indicated above or below the sequence are the ribosomal binding site (RBS; shaded), translational start codon (Start), and the position of restriction endonuclease sites located in the corresponding DNA sequence. 85 interference from endogenously-encoded rpsT mRNA, E. coli strain MRA10, deleted for chromosomal rpsT (Ryden-Aulin et al., 1993), was transformed with pKEB107 and p K E B l 10, and cellular R N A was isolated from arabinose-induced cultures. Primer extension analysis of rpsT(\07) mRNA revealed, in addition to many minor cDNA products, a predominant extension product with a 5' terminus corresponding to the A residue predicted to be the position of transcriptional initiation from P B A D (Figure 3.7, FL-107; compare lane 9 to corresponding sequence ladder in lanes 1-4). Formation of this cDNA product provides evidence that cloned rpsT sequences are expressed from the same location within the promoter as wildtype araBAD, and that manipulation of this region during construction of pKEB107 does not alter residues important for transcriptional initiation. Analysis of cDNAs obtained from M R A l O / p K E B l 10 mRNA revealed a number of major products (Figure 3.7, lane 10). The predominant cDNA products (SS-110) terminate at positions corresponding approximately to residues surrounding the base of the 3' arm of the 5'-terminal stem-loop predicted to form within rpsT(\ 10) mRNA. A second, larger cDNA is detectable (FL-110), and presumably corresponds to the 5' terminus of the rpsT(\ 10) mRNA; exact determination of the nucleotide position corresponding to the 5' terminus of this cDNA is, however, difficult due to the compression of DNA sequencing products generated from p K E B l 10 using the same primer (Figure 3.7, lanes 5-8). Preferential termination of reverse transcriptase at positions corresponding to the 3' base of the predicted 5'-terminal stem-loop strongly suggests the formation of the desired secondary structure. In addition, the strong compression observed for D N A sequencing products terminating within this stem-loop-encoded region of p K E B l 10 is strongly supportive of secondary structure influencing gel mobility. 86 Figure 3.7 Detection of 5' Termini and Secondary Structure of rpsT(l07) and rpsT(H0) mRNA by Primer Extension Analysis. R N A was isolated from MRA10 transformed with either pKEBT07 or p K E B l 10 and grown in arabinose. Primer extension was performed using radiolabeled oligonucleotide PE-1 complementary to rpsT residues corresponding to rpsT codons 17-42 and as described in Methods and Experimental Procedures. A schematic representation of rpsT(\ 10) mRNA is shown in the left margin; the positions of the 5' terminal stem-loop and ribosome binding site (RBS; grey box) correspond to their position in the sequence ladder. The position of full length cDNAs (FL) or cDNAs terminated at the base of the 5' terminal stem (SS; strong stop) are indicated by corresponding arrows. Extension products are shown alongside the corresponding sequence ladders (mRNA seqeuence indicated) in lanes 1-4 (pKEB107) and lanes 5-8 (pKEBl 10). 87 3.2.4.3 Stability of rpsT mRNA possessing a 5'-terminal stem-loop Northern blot analysis of R N A from MG1693/pKEB 110 revealed an rpsT mRNA of intermediate size [388 nt; rpsT(\ 10) mRNA] that depends on expression from the plasmid-encoded rpsTgeriQ, and, at reduced levels, the two chromosomally-encoded rpsT transcripts of 447 nt and 356 nt (PI and P2, respectively; Figure 3.8 A). The initial rate of disappearance of rpsT{\ 10) mRNA yielded a half-life of 12 min in vivo, denoting at least a 6-fold stabilization of the R N A by the 5'-terminal secondary structure. The 6-fold stabilization observed for rpsTil 10) mRNA is consistent with results obtained with similar heterologous fusions of stem-loops to the 5* terminus of bla mRNA (Emory and Belasco, 1990) and RNA I (Bouvet and Belasco, 1992). In addition to increased stability, the stem-loop-protected rpsT(\ 10) mRNA decayed with biphasic kinetics (Figure 3.8 C). The second, more rapid phase was observed for the degradation of rpsTQ. 10) mRNA in MG1693. One possible interpretation for the more rapid rate of decay would be the accumulation of S20 from translation of the sustained level of rpsT(l 10) mRNA and, subsequently, autogenous translation repression and destabilization of rpsT mRNA (Wirth et al., 1982; Parsons and Mackie, 1983; additional experimental support is provided in Chapter Five). Consistent with this explanation, rpsT mRNA expressed from the endogenous rpsTgene were also reduced and display a slightly accelerated rate of decay (data not shown). To eliminate the complexity associated with biphasic decay, only the initial rates of decay of rpsT(\ 10) mRNA and all subsequent recombinant rpsT mRNAs were followed. 3.2.5 Degradation of rpsT(H0) mRNA in E. coli cells mutant for mRNA decay 3.2.5.1 Decay of rpsT(110) mRNA in rne-1 strain SK5665 To determine if stem-loop-protected rpsTmRNA is degraded by an RNase E-mediated 88 A EH S MG1693/pKEB11ol I 0' 2" 4" 6' 8' 10' 12' 14' Time (min) Figure 3.8 Decay of Stem-loop-Protected rpsT mRNA is Initiated by RNase E. Northern blot analysis was performed as described in Figure 3.5. RNA was extracted at various time intervals (in min) after the addition of rifampicin from E. coli transformed with pKEBl 10 (strain and schematic of the 5' end of the rpsT(\ 10) is given above each panel). The plasmid-encoded rpsT(\ 10) mRNA (•; 388 nt) is intermediate in size to that of endogenously expressed rpsTVX (447 nt) and P2 (356 nt) mRNAs. A. Decay of rpsT m R N A from MG1693/pKEB 110. B. Decay of rpsT mRNA from SK5665/pKEBl 10 (rne-1). C . Plot of the first-order decay of plasmid-encoded rpsT versus time. Symbols used for each rpsT(l 10) mRNA are indicated in panels A and B. 8 9 mechanism, as established for both chromosomally-encoded rpsT mRNAs (Mackie, 1991), the decay of rpsT(\ 10) mRNA was evaluated in an isogenic rne-1 strain (SK5665), temperature-sensitive for RNase E activity. Mid-log phase SK5665/pKEBl 10 cells were cultured for 60 min in 0.05% arabinose at 30 °C and then to the restrictive temperature, 44 °C, for 15 min prior to the addition of rifampicin and sampling. Northern blot analysis of RNA isolated from SK5665/pKEBl 10 demonstrated that endogenously-encoded rpsTVl mRNA decayed with a half-life of 5 min, a 3-fold stabilization of the mRNA by the heat inactivation of RNase E, as anticipated (Figure 3.8 B; Mackie, 1991). In contrast, rpsT(\ 10) mRNA decayed with a half-life of 13 min. Thus, inactivation of RNase E does not lead to an increase in the stability of rpsT(\ 10) mRNA. However, the decay of rpsT(\ 10) in SK5665 was monophasic rather than biphasic as was observed for RNA isolated from wildtype MG1693 (Figure 3.8 C). The more rapid decay phase for rpsT(\ 10) mRNA was lost in SK5665/pKEBl 10 in the absence of active RNase E. The observed change in the decay of rpsT(\ 10) mRNA from SK5665 implicates RNase E in the decay of stem-loop-protected rpsT mRNA. During the course of experimentation with the temperature-sensitive strain, SK5665, it was observed that PBAD-driven expression was not efficient from arabinose-induced cells grown at 30 °C. Consequently, an evaluation of P B A D induction was undertaken and it was determined that induction from P B A D is dependent on both temperature and, as anticipated, the carbon source provided to the growth medium. These findings are demonstrated by a Northern blot of RNA isolated from MG1693/pKEBl 10 grown initially in glucose and then exposed to either glucose, arabinose, or unsupplemented media (no carbon source) for 60 min at various growth temperatures (Figure 3.9). No transgene expression (i.e. rpsT(\ 10) mRNA) is observed from cells grown at 30 °C, even in the presence of arabinose. This result is in agreement with the 90 37 °C 42 °C 30 °C Figure 3.9 Induction of Expression of Plasmid-encoded rpsT mRNA is Dependent on Temperature and Carbon Source. Northern blot analysis of rpsT mRNA isolated from MG1693/pKEBl 10 grown for 60 min in either arabinose (A), glucose (G) or no carbon source (no sugar; NS) at various temperatures (indicated above panel). Position of endogenous rpsTmRNA (PI and P2) and the plasmid-encoded rpsT{\ 10) mRNA (•; 388 nt) is indicated at left of autoradiograph. 9 1 inability to detect transgene expression from SK5665/pKEBl 10 induced at 30 °C. As anticipated, induction of transgene expression at 37 °C requires the addition of arabinose, as no transgene expression was observed from cells provided with glucose or no carbon source for 60 min. This observation also verifies the strong repressed nature of P B A D in the presence of glucose and absence of its inducer, arabinose. When MG1693/pKEBl 10 cells were grown at 42 °C for 60 min, rpsT(\ 10) mRNA was expressed to elevated levels in the presence of arabinose. Strikingly, rpsT{\ 10) mRNA were also discernible from RNA isolated from cells grown in either glucose or in the absence of a sugar at 42 °C, demonstrating that gene expression from P B A D is detectable in the absence of inducer at 42 °C. 3.2.5.2 Decay of rpsT(110) mRNA in additional decay mutants To further verify the major role of RNase E in initiating the decay of stem-loop-protected rpsTmRNA, the kinetics of decay of rpsT(\ 10) in isogenic strains mutated for pnp (SK5691), rnb (SK5689), ovpcnB (SK7988) genes, encoding PNPase, RNase II, and poly(A) polymerase, respectively, were determined. RNA was isolated from aliquots of cells harvested from these strains and analysed on Northern blots. For all RNA samples examined, the decay of rpsT( 110) mRNA was not altered from that observed in MG1693 (data not shown). The half-life of stem-loop-protected rpsTmRNA from the three isogenic E. coli strains tested was 11-13 min, and biphasic decay kinetics were observed for rpsT(\ 10) mRNA in all cases. These data reinforce the observation that a stable 5' stem-loop significantly stabilizes rpsT'mRNA from decay relative to its unprotected counterpart. Furthermore, none of the enzymes encoded by the mutant alleles were, alone, responsible for the rate-initiating step of decay of rpsT(\ 10) mRNA. Experimentation to determine the influence of PNPase on the decay of stem-loop-protected rpsT mRNA indicated that rate of decay of rpsT{\ 10) mRNA was not altered in a strain 92 in which polynucleotide phosphorylase was inactivated by thepnp-7 mutation (i.e. SK5691). In addition, a 147 nt decay fragment (PJ, coterminal with the 3' end of the PI and P2 rpsT mRNAs, was not detected by Northern blot analysis of RNA isolated from SK5665, in contrast to published observations utilizing this mutant allele in a different E. coli genetic background (Mackie, 1989). This discrepancy in observations led to a further investigation into the influence of the pnp-7 allele on the decay of endogenous rpsTmRNA. Previous work suggested that the decay of rpsTmRNA can be initiated by PNPase (Mackie, 1989). In order to more clearly establish the role of PNPase on rpsTmRNA in vivo, the abundance of PNPase in a newly acquired isolate of SK5691 (kindly, provided by Dr. S.R. Kushner, University of Athens, Athens, GA) was first determined by western blot analysis (described in Materials and Experimental Procedures). In addition to the readily observable (and anticipated) slow-growth phenotype for SK5691 incubated at 37 °C, PNPase levels in SK5691 were <5% of those observed for its isogenic counterpart, MG1693 (data not shown), as reported earlier (Mohanty and Kushner, 2000). Northern blot analysis of RNA isolated from MG1693 and SK5691 (pnp-7) indicated no significant difference in the rate of decay of rpsT mRNAs between the two strains (Figure 3.10 A, and compared in B). In addition, the previously observed 147 nt P 0 fragment representing the 3* terminal portion of the rpsT mRNA was not detected in samples isolated from either strain (Figure 3.10, A), a result that was verified by testing several isolates of SK5691. Under the conditions used here to evaluate the role of PNPase in rpsT'mRNA decay, no influence could be established, differing from previously published results (Mackie, 1989). The recent discovery that a homologue of RNase E, RNase G (previously denoted CafA and encoded by cqfAlrng; Wachi et al, 1997), is involved both in the processing of 16S rRNA (Li et al, 1999; Wachi et al, 1999) as well as the decay of at least one mRNA in E. coli, adhE 93 MG1693 0' 1' 2' 3' 4' 5' 6' T SK56591 (pnp-7) 0' T 2' 3' 4' 5' 6 7' O o B 100 2 3 4 Time (min) Figure 3.10 Decay of rpsT mRNA is Not Initiated by PNPase. A. Northern blot analysis of rpsT mRNA from MG1693 (left panel) or SK5691 (pnp-7; right panel) grown in glucose at 37 °C. RNA was extracted at various time intervals (in min; above each panel) after the addition of rifampicin. Position of endogenously-encoded rpsT mRNAs (PI and P2) is indicated. B. Plot of the first-order decay of plasmid-encoded rpsT mRNA versus time. Symbols used for each mRNA are indicated alongside autoradiographs in A. 94 (Umitsuki et al, 2001), suggested that RNase G may play a role in the degradation of additional mRNAs in E. coli. In addition, the demonstration that RNase G cleavage of RNA is sensitive to secondary structure and that the phosphorylation status of the 5' terminus of a synthetic RNA substrate also modulates RNase G activity in vitro (Tock et al, 2000), led to the evaluation of the role of RNase G in the decay of rpsT(\ 10) mRNA. To construct an mg mutant strain isogenic to MG1693, the mgv.cat allele was transduced from CA244rng (kindly provided by Dr. M.P. Deutscher, University of Miami, Miami, FL; Li et al, 1999) to MG1693 by Pl-mediated transduction as described in Materials and Experimental Procedures to generate KBC1009 (Table 2.1). Disruption of mg by the cat insertion guarantees 100% linkage of the mutant allele and chloramphenicol resistance during transduction; however, to confirm the loss of the wildtype mg in KBC1009, DNA from KBC1009 was analysed by PCR amplification. Several chloramphenicol-resistant isolates of MG1693 transduced with aPJCm,clr-J00 lysate generated from CA244mg were used as the source of DNA for PCR amplification and compared to both MG1693 and CA244>«gDNA samples using primers (mg5' and rng3'; Table 2.3) designed to anneal to the 5' and 3' ends of the mg gene. As a control for PCR amplification, primers complementary to the mb gene (mb5' and rnb3') were also included in the PCR reaction. A 742 bp DNA fragment of the mb gene was amplified from the DNA of all putative transductants (Figure 3.11; lanes 4-9) as well as from control DNA samples MG1693 (lane 1), CA244rwg (lane 2) and CA244 (lane 3; Brenner and Beckwith, 1965). In contrast, amplification of the 1577 bp mg gene sequence was observed for MG1693 and CA244 input DNA only (Figure 3.11 A; 1577 bp band, compare lane 1 and 3 to others). Amplification of mg sequences disrupted by the cat insertion was unsuccessful using DNA from all putative MG1693 CmR transductants as well as 95 Figure 3.11 Decay of r/w71(110) mRNA is Not Initiated by an RNase G-dependent Mechanism. A. An E. coli strain mutant for mg (encoding RNase G), was constructed by Pl-mediated transduction of the mg: :cat allele of CAlAAmg to MG1693 as described within the text. Disruption of the mg allele in several chloramphenicol-resistant transductants was confirmed by amplification of mg and, as a control, rnb DNA sequences by PCR. Products of the PCR amplification were separated on a 1% agarose gel and visualized by ethidium bromide staining. The source of input DNA for the PCR reaction was MG1693 (lane 1); CA244rng (lane 2), CA244 (lane 3), and six putative transductants (lanes 4-9). Lane 10 represents a no-DNA control PCR reaction. A schematic of the rnb and mg (wildtype and mg::CmR) genes and the relative position of annealing for the oligonucleotide primers is shown. The position of the DNA products representing 742 bp and 1577 bp products from the amplification of rnb and rng gene sequences, respectively, are indicated by corresponding arrows. Estimation of fragment sizes was facilitated by the addition of a ///>rauTI-digested lambda DNA molecular weight marker (lane M; corresponding fragment sizes indicated at right). B. Northern blot analysis of rpsT mRNA isolated from KBC1009 (rng..cat) harbouring pKEBl 10 (see Figure 3.5 for details). The time of sampling (in min), the source of the mRNA and a schematic of the 5' end of the plasmid-encoded rpsTmRNA are shown (above the panel). Position of the endogenously-encoded rpsT mRNAs (PI and P2) and the rpsT(\ 10) mRNA (*) are indicated at left of the autoradiograph. C. Plot of the first-order decay of rpsT(\ 10) mRNA isolated from KBC1009/pKEBl 10. 96 M 1 2 3 4 5 6 7 8 9 10 M mg -1,577 nt-mb - 742 nt —I mg' P Cm" | Vgfl )— B ^ KBC1009/pKEB110 4 6 8 10 Time (min) 97 the control CA244rng DNA, indicating that the larger, disrupted mg allele was not a suitable substrate for DNA amplification under these conditions (i.e. a 2 min extension step). No amplification products were observed for the PCR reaction with input DNA omitted (Figure 3.11 A, lane 10). The failure to amplify a wild-type mg allele from the DNA of the chloramphenicol-resistant transductants supports replacement of the mg allele by mgv.cat in these isolates, and a single transductant, KBC 1009, was selected for further use. The decay of rpsT(\ 10) mRNA was evaluated by Northern blot analysis employing RNA isolated from KBC 1009/pKEB 110 cells grown in arabinose (Figure 3.11 B). The half-life of the 388 nt rpsT(\ 10) mRNA was 11 min, not significantly different to that observed in MG1693 cells (Figure 3.11 C), and displayed biphasic decay kinetics. In addition, the decay of endogenously-expressed rpsT mRNAs was not altered from that observed in MG1693 cells harbouring pKEBl 10 (data not shown). Evidently, the absence of RNase G from E. coli KBC1009 cells does not influence the decay of rpsTmRNA, suggesting that neither endogenous rpsT, nor, 5'-stem-loop protected rpsT [i.e. rpsT(\ 10)] mRNAs are substrates for initial cleavage events catalyzed by RNase G. 3.2.6 Degradation of 5'-truncated rpsT mRNA possessing a terminal stem-loop Several RNase E cleavage sites have been identified within the 5' UTR of rpsT by primer extension analysis of in vitro generated decay intermediates (Mackie, 1991). While an analysis of the decay of rpsT mRNA devoid of these cleavage sequences has not been previously undertaken, removal of nucleotides encompassing these sites might be predicted to influence the stability of the rpsTmRNA. Two 5-truncated rpsT gene deletion constructs were generated in pKEB106 and further manipulated to include stem-loop-encoded sequences at the extreme 5' termini of the 98 truncated genes, effectively removing several RNase E cleavage sites from the 5' UTR of rpsT mRNA, and evaluated for mRNA stability in vivo. Recombinant rpsT genes encoding 5-truncated rpsT mRNAs were amplified and cloned into pKEB106 as described in 3.2.2 above. Oligonucleotide pairs rpsTDzM & rpsWXbdl and rpsTDell & rpsT3'Xbal were used in the amplification of the rpsT UNA fragments by PCR. The plasmid isolate, pKEBl 19, encodes an rpsTmRNA (dell) with 26 nt removed from the 5* end, while pKEB120-encoded mRNA (del2) lacks the 5'-terminal 15 nt. rpsTgem sequences harboured on pKEBl 19 and pKEB120 were further modified by the addition of DNA oligonucleotides Steml A and StemlB, encoding the stable stem-loop present within rpsT(\ 10) mRNA, at the 5' terminus of the genes. StemlA and StemlB complementary oligonucleotides were ligated into the Kpnl site of pKEBl 19 and pKEB120, and recombinant plasmids were screened by endonuclease digestion followed by DNA sequence analysis. Two isolates, pKEB121 and pKEB122, encoding rpsT(dell) and rpsT(de\2) genes harbouring 5'-terminal stem-loop sequences were selected. MG1693 transformed with either pKEB121 or pKEB122 was grown in the presence of arabinose and aliquots were removed after the addition of rifampicin to block transcription initiation. RNA isolated from these aliquots was resolved on 5.5% denaturing polyacrylamide gels and detected by Northern blot analysis. A distinct signal for rpsT(l2l) mRNA was not detected on the autoradiograph, presumably due to the inability to separate the rpsT{\2\) mRNA from the endogenously-encoded rpsTV2 transcript (Figure 3.12 A), which differs in size by only 8 residues. The half-lives of the coincident P2 and rpsT(\2X) mRNAs were determined to be 2 min, which does not differ from the 2 min half-life of P2 rpsTmRNA in MG1693 previously reported (Mackie, 1987). Further, the kinetics of decay of rpsT(\22) mRNA were determined, and the 99 Figure 3.12 A 5'-terminal Stem-loop Does Not Protect 5'-truncated rpsTmRNA. Northern blot analysis was performed as described in Figure 3.5. RNA extracted at various time intervals (in min; above each panel) from MG1693 transformed with either pKEB121 or pKEB121 (schematic of the 5' end of the plasmid-encoded mRNA with the number of nt between the 3' base of the stem-loop and the beginning of the Shine-Dalgarno sequence is indicated above each panel). A. Decay of rpsT(\21) mRNA. The plasmid-encoded rps7/(121) mRNA (•) is 363 nt and is not distinguishable from the 356 nt endogenously-expressed P2 mRNA. B. Decay of rps7(122) mRNA. C. Plot of the first-order decay of plasmid-encoded rpsT versus time. Symbols used for each mRNA are indicated in panels A and B. 100 initial rate of disappearance of the rpsT(\22) mRNA was 2 min (Figure 3.12 B). The inability of the 5'-terminal stem-loop structure present within rpsT( 121) and rpsT(\22) mRNAs to stabilize the chimeric RNA is in contrast to the 6-fold stabilization observed for rpsT(\\Qi) mRNA harbouring a complete 5' UTR. 3.3 DISCUSSION The promoter/operator region of the arabinose-inducible operon, araBAD, harboured on the low-copy-number expression vector pBAD28, provided a proficient means to regulate the expression of recombinant rpsT mRNAs for the evaluation of c/s-acting sequence and structural changes on mRNA decay in vivo. Importantly, growth of wildtype E. coli in the presence of the inducer, arabinose, did not alter the kinetics of decay of endogenous rpsT mRNA, as might not be true for the induction conditions required for alternative regulatory systems, such as by heat shock. The regulated, transient expression of recombinant rpsT genes from pB AD-derived plasmids yielded physiological levels of mRNA under the experimental conditions, and allowed for an analysis of the kinetics of RNA degradation without obvious consequence to the cell. In particular, expression of rpsT(107) mRNA, a transcript that is identical to endogenously-expressed rpsTP2 mRNA, did not alter the rates of decay of either the 447 nt rpsTVX mRNA or the coincident plasmid-encoded and chromosomally-encoded 356 nt rpsT mRNAs (Figure 3.5; Table 3.1, entry 1 versus 2). Maintenance of wild-type half-lives strongly suggests that the low level of transgene expression neither altered the mechanism for rpsT degradation, nor titrated the decay machinery within the experimental time frame. Manipulation of residues surrounding the P B A D initiation site facilitated the construction of a plasmid vector for gene cloning at the exact site of transcription initiation, thereby avoiding the 101 Table 3.1 Half-lives of Recombinant rpsT mRNA in Escherichia coli Entry Strain Plasmid Recombinant mRNA feature Length (nt) 5' Stem-loop Half-life (min)a 1 MG1693 — PI (447) — 1.5" P2 (356) — 2.0 2 MG1693 pKEB107 356 — 2.0 ±0.2° 3 MG1693 pKEBHO 388 + 12 ± 2 4 SK5665 (rne-1) pKEBllO 388 + 1 3 ± 2 d 5 KBC1009 (rngv.cat) pKEBHO 388 + 11 ± 2 6 MG1693 pKEB121 363 + 2 e 7 MG1693 pKEB122 372 + 2 "Half-life values given with a standard deviation represent the average of at least 4 trials (additional half-life values represent a single experimental value selected from one of at least 2 trials). bChromosomally-encoded rpsT mRNA half-life in wildtype E. coli cells (Mackie, 1987). The value represents the half-life for the coincident rpsT(l07) and endogenously-encoded rpsTVl mRNA. dThe value represents the half-life in SK5665 (rne-1) cells at the non-permissive temperature. 'The value represents the half-life for the coincident rpsT(\2\) and endogenously-encoded rpsTYl mRNA. 102 inclusion of vector-encoded residues in mRNAs transcribed from P B A D . Primer extension data verified that mutation of residues surrounding the initiation site during the introduction of the unique restriction endonuclease site, Kpnl, did not alter of the position of transcription initiation from P B A D (Figure 3.7), or the ability of P B A D to regulate expression in vivo. In addition, recreation of the Kpnl restriction site in pKEB107 after the cloning of the rpsTgene into pKEB106, greatly facilitated the subsequent cloning of oligonucleotides that encode a terminal stem-loop structure at the extreme 5' end of the rpsTmRNA (expressed from pKEBl 10). The precise positioning of the terminal stem-loop in pKEBl 10 is important since the inclusion of as few as 3-4 unpaired residues 5' to a stem-loop abolish the stabilizing effect of the structure (Emory, et al., 1992; Bouvet and Belasco, 1992; Arnold et al., 1998). Primer extension analysis provided support for the formation of the stem-loop at the extreme 5' terminus of the rpsTCl 10) mRNA (Figure 3.7), and the chimeric stem-loop-r/wTmRNA was stabilized 6-fold in vivo (Figure 3.8 A; Table 3.1, entry 2 versus 3). The construction of an expression system facilitating the cloning of 5'-terminal stem-loop sequences to provide protection of expressed mRNA has additional practicality. If placed on a multicopy plasmid, this modified expression system may offer an advantage for protein overexpression purposes; to my knowledge, a similarly, commercially prepared vector for such an objective is not currently available. Stabilization of rpsT mRNA by a stable stem-loop is consistent with results obtained with similar heterologous fusions of hairpin structures to the 5' terminus of b l a mRNA (Emory and Belasco, 1990) and RNA I (Bouvet and Belasco, 1992). Additionally, the 6-fold stabilization of rpsT mRNA by the prosthetic stem-loop is similar to that observed for circular rpsT mRNA versus a linear counterpart in vivo (Mackie, 2000). The sequestration of an accessible 5' terminus in both stem-loop-protected and circular rpsT mRNA implies that decay of these substrates can be 103 initiated by a mechanism in which RNase E bypasses its preferred interaction with the 5' end and interacts 'internally' with the mRNA. However, the extended longevity displayed by these mRNA suggests that a 'internal' entry is relatively inefficient. The stable, stem-loop protected rpsT(\ 10) mRNA decayed with biphasic kinetics (Figure 3.8). A possible interpretation for the second, more rapid decay phase is that it arises from S20 accumulation due to the persistance of rpsT(\\0) mRNA and, subsequently, autogenous translational repression and destabilization of rpsT mRNA devoid of ribosomes (Wirth etal., 1982; Parsons and Mackie, 1983; additional experimental data are presented in Chapter Five that support this hypothesis). The details of this proposed mechanism is as follows: elevated levels of free S20 protein are predicted to accumulate in the cell due to continued expression from the stable rpsT(\ 10) mRNA and a dearth of its preferred substrate for binding, 16S rRNA. As the S20 concentration reaches a threshold level sufficient to repress translation of the rpsT mRNA, the non-translated, mRNA becomes a target for rapid decay by RNase E (Parsons and Mackie, 1983). In support of this explanation, moderate expression of rpsT(\ 10) mRNA led to reduced steady state levels and a slightly accelerated rate of decay of the two chromosomally-encoded rpsT mRNAs. A mechanism of autogenous translational repression of rpsT mRNAs and subsequent RNA destabilization would be similar to that observed for the alpha operon and other ribosomal protein mRNAs (Brot et al, 1980; Singer and Nomura, 1985; Cole and Nomura, 1986). The data presented here differs, however, from previous results where posttranscriptional repression of S20 synthesis was accompanied by a 2rfold increase in the half-lives of both rpsT mRNAs (Mackie, 1987). It is noted that in the previous study, the rpsTgene dosage was much higher and expression of rpsTmRNA could not be regulated as in the present work, both of which might contribute to the disparity of the results. Furthermore, in the results of Mackie 104 (1987), stabilization Of the rpsT mRNAs was dependent on the inclusion of the rpsTrho-independent transcriptional terminator within the plasmid-encoded rpsT gene. In the absence of the transcriptional terminator, the half-life of total rpsT mRNA was reduced two-fold relative to wild-type. The latter observation might now be predicted to occur from rapid 3' - 5' exonucleolytic decay by RNase II and/or PNPase initiating digestion at the 3'-unprotected terminus of the mRNA. An analysis of the degradation of rpsTCi 10) mRNA in SK5665, temperature-sensitive for RNase E activity at 44 °C, did not indicate an overall increase in the half-life of the plasmid-encoded mRNA (Table 3.1, entry 4). Decay of rpsT(\ 10) mRNA isolated from SK5665 did, however, display a monophasic decay curve. The altered decay kinetics of rpsT(\ 10) mRNA from SK5665 at the non-permissive temperature implicates RNase E in the degradation of the stem-loop-protected rpsT mRNA. In considering the hypothesis that elevated levels of S20 protein accumulated in cells harbouring pKEBl 10 leads to translational repression of rpsT mRNAs and, subsequently, the second, more rapid phase ofrpsT(l 10) mRNA decay, the loss of biphasic decay for rpsT(\ 10) mRNA in SK5665 indicates that the postulated translational repression fails to lead to rapid mRNA destabilization in the absence of active RNase E. The stabilization of untranslated mRNA in the absence of active RNase E has been previously demonstrated for stem-loop-protected lacZ mRNA devoid of translating ribosomes (Joyce and Dreyfus, 1998). A typical control experiment to evaluate the role of RNase E in the decay of mRNA includes an evaluation of stability at 30 °C, the permissive temperature for RNase E in SK5665. However, several attempts to evaluate rpsT(\ 10) mRNA from SK5665 grown at 30 °C indicated that expression from the P B A D promoter was inefficient at that temperature. The subsequent 105 demonstration of a temperature dependence for P B A D gene induction (Figure 3.9) might be a consequence of the molecular mechanism of araBAD gene regulation. As the data in Figure 3.9 suggest, activation from P B A D at 30 °C was inefficient, possibly due to poor unlooping of the DNA necessary for P B A D derepression. In contrast, low constitutive expression from P B A D at 42 °C in the absence of inducer suggests that repression of P B A D by DNA looping may not be stringent at this temperature. The kinetics of decay of rpsT{\ 10) mRNA in isogenic strains mutated for several genes whose products have a definitive role in mRNA degradation, pnp (PNPase), mb (RNase II), pcnB (poly(A) polymerase) and rng (RNase G), was not altered from that observed in wildtype MG1693 cells (compare Figure 3.8A and Figure 3.11). These data supports the model that the decay of rpsTil 10) mRNA is, in fact, mediated by RNase E. Construction of the mgv.cat strain, KBC 1009, allowed for the first analysis of rpsTmRNA decay in E. coli deficient for RNase G. Northern blot analysis suggested that in the absence of RNase G, neither the rate of rpsTmRNA decay nor the biphasic kinetics of rpsT(\ 10) mRNA were altered from that observed in the isogenic MG1693 strain background (Table 3.1, entry 5). This was the first demonstration that initiation of decay of the stem-loop-protected rpsT'mRNA or of either of the endogenous rpsT mRNAs is not mediated by an RNase G-dependent mechanism in vivo. Under the conditions used to evaluate the role of PNPase on initiating the decay of rpsT mRNA, no influence could be established, unlike previously published results (Mackie, 1989). A possible explanation for this discrepancy stems from the two different pnp-7 strain backgrounds used in the studies. In the previous study, the /wp-7-containing strain, SK5006, also contained a mutant mb allele complemented by the temperature-sensitive rnb-500 allele harboured on a multicopy plasmid (Donovan and Kushner, 1986). A 2.5-fold increase in rpsT mRNA stability 106 was measured in strain SK5006 at temperatures non-permissive for RNase II activity (Mackie, 1989; note, half-lives were not measured in a strain containing only pnp-7). In the absence of both PNPase and RNase II, the rpsTV0 fragment would be resistant to decay (Coburn and Mackie, 1999), explaining its detection in RNA isolated from SK5006. Moreover, the poly(A) tails added to the 3' end of cellular RNA by poly(A) polymerase would not be removed. As poly(A) tails have been shown to be substrates for endonucleolytic cleavage by RNase E (Walsh et al, 2001), the presence of additional substrate perhaps effectively titrates RNase E from initiating events of mRNA degradation. A titration of the decay machinery has been observed with the transient overexpression of another RNase E substrate, namely rne (Sousa et al, 2001), and may explain the previously observed 2.5-fold stabilization of rpsT mRNAs (Mackie, 1989). The kinetics of decay of rpsT(\2\) and rpsT{\22) mRNA indicate that a 5'-terminal stem-loop does not stabilize rpsTmRNA with 5' terminal truncations (Table 3.1, entries 6 and 7). Truncation of the 5' terminus of rpsT effectively removed several characterized RNase E cleavage sites present within the rpsT 5' UTR (Mackie, 1991), and it was anticipated that decay of the 5'-truncated, stem-loop-protected rpsT mRNAs might be altered by the deletion of these sites. The inability of the 5'-terminal stem-loop to stabilize these deletion rpsT mRNAs was, however, unexpected. Inspection of the sequences encoding these transcripts revealed that rpsT{\2\) mRNA (i.e. deletion 1) encodes only 7. nt prior to the Shine-Dalgarno (SD) sequence, while rpsT( 122) mRNA (deletion 2) possesses 18 nt separating the 3' base of the stem and the beginning of the SD sequence. Although the experiments performed here do not rule out a unique mechanismfor decay of these 5'-truncated rpsTmRNA, it is plausible that the proximal position of the stem-loop structure relative to the Shine-Dalgarno sequence precludes ribosome binding and compromises translation of the mRNA. This hypothesis suggests that efficient translation of 107 stem-loop-protected rpsTvnRNA is required for efficient stabilization of the transcript, and it shown in Chapter Five that this is, indeed, the case. 108 CHAPTER FOUR PORTABLE R N A S E E C L E A V A G E SITES DESTABILIZE 5 ' -TERMINAL STEM-LOOP-PROTECTED RPSTMRNA IN VIVO 4.1 INTRODUCTION As demonstrated in Chapter Three, rpsT mRNA is significantly stabilized by the presence of a 5'-terminal stem-loop. Despite the presence of a stable 5' stem-loop, many native and chimeric mRNAs, including rpsT(\ 10), are still degraded in vivo at a measurable rate by an RNase E-dependent mechanism. Moreover, circularized rpsT mRNA which lacks entirely a 5' (and 3') end is also degraded, albeit inefficiently, by RNase E in vitro (Mackie, 1998) and in vivo (Mackie, 2000). It can be envisioned that decay of these mRNAs must be initiated by a mechanism in which RNase E 'bypasses' its preferred interaction with the 5' end of the mRNA and interacts 'internally' with its substrate. Furthermore, the efficiency of RNase E-mediated decay via an internal interaction might be controlled by the ability of the endonuclease to recognize a cleavage site within the mRNA. An important precedent suggests that this may, in fact, be the case. A 287 nt sequence from the 3' end of the cat gene inserted into the 3' UTR of ompA has been shown to display a dominant, orientation-dependent destabilizing influence on the RNase E-mediated decay of the chimeric mRNA in E. coli (Meyer et al., 1996). 3' UTRcat y ' ' ' otupH • Figure 4.1 Insertion of cat mRNA Sequences into the 3' UTR of ompA mRNA Destabilizes the Chimeric RNA in vivo. 109 Furthermore, decay of the fusion mRNA was determined to be initiated within this 287 nt inserted sequence. The orientation dependence of the cat instability/destabilizing element strongly suggests that primary nucleotide sequence rather than structure is responsible for the destabilizing influence, and strikingly, several endonuclease cleavage sites have been mapped within this region (Meyer and Schottel, 1992). Accordingly, it was postulated that a sequence containing a known or potential RNase E cleavage site might be sufficient to destabilize a stem-loop-protected rpsT mRNA if inserted at a site available for recognition. Such a sequence is referred to here as a 'portable' RNase E cleavages site, and as prototypes, sequences encompassing two well characterized RNase E cleavages sites were used. One represents a defined cleavage site within the rne leader (Jain and Belasco, 1995) and the other, the ribosomal 9S RNA RNase E 'a' cleavage site (Ghora and Apirion, 1978). The influence of these 'portable' cleavage sequences on the kinetics of mRNA decay when present within stem-loop-protected rpsT mRNA was evaluated. 4.2 R E S U L T S 4.2.1 Stability of rpsT genes encoding sequences of the rne 5' leader region RNase E regulates its own synthesis by reducing the cellular concentration of the rne mRNA through controlling its decay rate. Autoregulation is achieved through modulation of the longevity of the 3.6 kbp rne mRNA in response to the level of RNase E activity in the cell and thereby helps to protect cells from the debilitating effects of RNase E levels that are excessively high or low (Jain and Belasco, 1995). The 5'-terminal 361 residues within the rne 5' UTR are essential for autoregulation, and primer extension analysis of in vivo RNA has identified an endonuclease cleavage within the rne 5' UTR at a position near the 5' end of the mRNA (48 nt 110 downstream of the 5' terminus of the intact transcript; Jain and Belasco, 1995). The AU-rich sequence immediately downstream of this cleavage site (AUUUU) resembles the corresponding sequence of several known RNase E cleavage sites (Ehretsmann et al, 1992), and it has been suspected that RNase E cleavage at this characterized site mediates rne autoregulation (Jain and Belasco, 1995). Recent work has established that the characterized RNase E cleavage site at nt 48 is dispensable for autoregulation, and that an evolutionarily conserved stem-loop is essential for autoregulation (hairpin 2 in Diwa et al, 2000). Nonetheless, sequences encompassing the characterized RNase E cleavage site from rne mRNA were tested for their influence on mRNA decay when inserted into the 5' UTR of genes encoding stem-loop protected rpsT mRNA. 4.2.1.1 Construction of rpsT genes encoding sequences of the rne 5' UTR DNA fragments encoding approximately 80 residues corresponding to sequences within the rne leader region and containing the previously characterized RNase E cleavage site (Jain and Belasco, 1995; Figure 4.2 A) were amplified by PCR using chromosomal DNA as template and rneL5' and rneL3' oligonucleotide primers (Table 2.3). The 106 bp DNA product generated from the amplification was purified from a 6% nondenaturing polyacrylamide gel and digested with restriction endonuclease Asel to produce a 78 nt DNA fragment with compatible ends for cloning. The prepared DNA fragment was ligated into Afcfel-digested pKEBl 10, and the mixture was used to transform competent E. coli cells. Putative recombinant DNA constructs were screened by restriction endonuclease digestion using several pairs of nucleases to determine the presence of the DNA insert as well as the orientation of the insert with respect to the rpsT gene sequence (the design of the DNA amplification and cloning did not allow for directional insertion of the DNA fragment into pKEBl 10). Sequencing of putative recombinant plasmids confirmed the insertion of the PCR-generated DNA fragment into pKEBl 10 and determined that one isolate, pKEBl 18, 111 Figure 4.2 Cloning of the rne Leader PCR Fragment into the rpsT Gene of pKEBHO. A. Schematic o f the exper imental ly determined secondary structure o f the rne 5' U T R (adapted from D i w a et al, 2000); the three ha i rp in (hp) structures and r ibosome b i n d i n g site ( R B S ) are label led. Reg ions i n l ight grey refer to the corresponding rne gene sequences ampl i f i ed by P C R and c loned into the 5' U T R o f stem-loop-protected r p s T m R N A . The R N A sequence o f the ampl i f i ed rne fragment is shown be low, w i t h regions i n v o l v e d i n R N A duplexes underl ined. The pos i t ion o f the characterized R N a s e E cleavage site is indicated ( ' E ' and ver t ical arrow). B. Schemat ic o f rpsT encoding a 5'-terminal s tem-loop c loned at the pos i t ion o f P B A D t ranscript ion in i t ia t ion i n p K E B l 10. D N A fragments corresponding to sequences encoded w i t h i n the 5 ' U T R o f the rne leader and harbouring a w e l l characterized R N a s e E cleavage site (see text and Ja in and Be la sco , 1995) were ampl i f i ed by P C R and c loned into the Ndel site w i t h i n the 5 ' U T R o f rpsT harboured o n p K E B l 10. The c lon ing strategy d i d not facilitate di rect ional c l o n i n g o f the P C R fragment, and therefore the D N A was l igated into p K E B l 10 to generate p K E B l 18, encoding insert sequences i n the orientat ion found w i t h i n the native rne 5' U T R (direct ion indicated by hor izonta l arrows), and p K E B 1 2 4 (reverse-complement orientation). The Shine-Dalgarno sequence ( S D ; grey box) and rpsT cod ing region (black box) are shown. In addi t ion, p rev ious ly characterized major R N a s e E cleavage sites ( ' E ' ver t ical arrows; M a c k i e , 1991), the rho-independent transcriptional terminator (T) and exper imental ly determined secondary structure ( M a c k i e , 1992) w i t h i n the transcribed m R N A are detailed. 112 113 encoded the insert sequence in the orientation also found within the rne 5' UTR (i.e. correct or native orientation; Figure 4.2 B). An additional isolate, pKEB124, was found to encode the insert sequence in the reverse-complement orientation (opposite orientation) with respect to the orientation found within the rne leader (Figure 4.2 B). 4.2.1.2 Stability of rpsT mRNA incorporating rne 5' leader sequences The influence of the 78 residues from the rne 5' UTR on the stability of rpsT mRNA protected by a stable 5'-terminal stem-loop was determined by Northern blot analysis. RNA was isolated from cultures of MG1693 harbouring either pKEBl 18 or pKEB124 grown in arabinose for 60 min and treated with rifampicin. RNA was separated on a 5.5% polyacrylamide gel, transferred to membrane and probed with a 32P-radiolabelled RNA probe complementary to the entire rpsTVl mRNA. The half-life for the rpsTCi 18) mRNA was between 1 and 2 min (Figure 4.3 A and C). In addition, the rpsT(\24) mRNA encoding the rne leader sequence in the reverse-complement orientation also demonstrated a reduced half-life compared to the parental, rpsT(l\0) mRNA (2 min; Figure 4.3 B and G). The profound destabilization of the rpsT(\ 18) and rpsT(\24) mRNAs as compared to the parental rpsT(\ 10) mRNA clearly demonstrate that the presence of the 78 residues from the rne 5* UTR containing a known RNase E cleavage site prevailed over the strongly stabilizing influence of the 5' terminal stem-loop protecting the rpsTmRNA. Unlike the ompA-cat chimeric mRNA (Meyer et al, 1996), however, the presence of the insert sequence in the reverse-complement orientation also led to destabilization of rpsT{\24) mRNA. Therefore, while the rne leader insert could overwhelm the stabilizing influence of stem-loop with rpsT mRNA, its effect was not orientation-dependent. 114 ft PKEB118 B si pKEB124 Time 0' 1' 2' 3' 4' 5' 6' 7' 1 m -P1 0' 2' 41 8' 10' 12' 14' j g j M U ' ^ . .... ^ . : 100 c "E "<5 E o or < 10 i 6 8 10 Time (min) 12 14 Figure 4.3 Stability of Stem-loop-protected rpsT mRNA Containing rne Leader Sequences Within the 5' UTR. RNA was extracted at various time intervals (in min) after the addition of rifampicin to MG1693 transformed with pKEBl 18 or pKEB124 and subjected to Northern blot analysis as described in Figure 3.5. The source of plasmid-encoded rpsTmRNA and schematic of the 5' end of the mRNA (as illustrated in Figure 4.2) is given above each panel. A. The plasmid-encoded rpsTCi 18) mRNA (•; 464 nt) is 18 residues larger than chromosomally-encoded rpsTVX mRNA (PI; indicated). B. Decay of rpsT(\24) mRNA. mRNA sizes are identical to those in A; however, chromosomally-encoded rpsTPl mRNA is not visible in this autoradiograph. C. Plot of the first-order decay of plasmid-encoded rpsT versus time. Symbols used for each rpsT mRNA are indicated in panels A and B. 115 4.2.2 Stability of stem-loop-protected rpsTmRNA containing small 'portable' RNase E cleavage sites The data presented above demonstrate that residues from the rne leader can destabilize the stem-loop-protected rpsT mRNA. However, the mechanism by which the insert sequences mediate destabilization of the chimeric mRNA is not apparent and can not be determined by simple Northern blot analysis. Furthermore, the observed orientation independence contrasts with results obtained with ompA mRNA destabilization by cat insertion sequences (Meyer et al, 1996). However, the consensus sequence for RNase E cleavage is weak (Ehretsmann et al, 1992), and its requirement for single-stranded cleavage sites, which, by default, are often AU rich, suggests that such sequences may be present in the 78 nt insert when existing in the reverse-complement orientation. Therefore, it is conceivable that the inserted sequences, in both orientations, may be destabilizing the stem-loop-protected rpsT mRNA by providing a cleavage site and facilitating 'internal' entry by RNase E. In an attempt to avoid the unintentional presence of RNase E recognition/cleavage sequences, smaller 'portable' cleavage sites encompassing only 15 residues from two characterized RNase E cleavage sites were evaluated for their influence on the decay of stem-loop-protected rpsTmRNA. Complementary oligonucleotide pairs, rne\5A & rnelSB, or 9SaA & 9SaB, encompassing the characterized RNase E cleavage within rne leader or the 9Sa RNase E cleavage site, respectively, were phosphorylated, annealed and ligated into the Ndel site in the 5' UTR of rpsT'm pKEBl 10. Putative recombinant plasmids were initially screened by restriction endonuclease digestion followed by sequence analysis. Sequencing confirmed the cloning of both oligonucleotide insertion sequences in both a native and reverse-complement orientation. Plasmid pairs pKEB127 (rne - native orientation) and pKEB128 (rne - reverse-complement orientation), 116 and pKEB152 (9Sa - native orientation) and pKEB154 (9Sa - reverse-complement orientation) were generated (Figure 4.4). The influence of these sequences encoding characterized RNase E cleavage sites on the decay of stem-loop-protected rpsT mRNA was evaluated by Northern blot analysis. Figure 4.5 shows that insertion of the rne cleavage sequence in its native orientation into the single-stranded 5' UTR of stem-loop-protected rpsT (rpsT(\21) mRNA) resulted in a mRBA that decayed with a half-life of 1 min (Figure 4.5 A & E ) . In contrast, in the reverse-complement orientation, the rne insert had no effect on the rate of decay of the rpsT(l2S) mRNA which demonstrated biphasic decay and whose half-life is 13 min (Figure 4.5 B & E), comparable to the parental rpsT(\ 10) mRNA. Similarly, the presence of the 9Sa cleavage sequence (native orientation) destabilized the rpsT( 152) mRNA (Figure 4.5 C & E; half-life=3 min), although not to the same extent as for rpsT(\21) mRNA. Somewhat surprisingly, the 9Sa sequence present in rpsT(l54) mRNA (reverse-complement orientation) led to greater destabilization of this mRNA (half-life=l min) relative to its presence in the native orientation (Figure 4.5D& E). Taken together, the data demonstrate that the presence of these 'portable' RNase E cleavage sequences in the 5' UTR of rpsT mRNA can act dominantly to overcome the stability conferred by the 5'-stem-loop. While the portable rne insertion displays orientation dependence, the 9Sa cleavage insert does not. Notably, the stability of rpsT(\2%) mRNA was unaffected by insertion of the 15 residue sequence (reverse-complement orientation). 4.2.3 Mapping of putative RNase E cleavage sites If sequences within the 'portable' cleavage sites are recognized and cleaved by RNase E 117 5' UAACCCAUUUUGCCC (pKEB127; rne, native orientation) 5' UAGGGCAAAAUGGGU (pKEB128; rne, reverse-complement orientation) 5' UACAGAAUUUUGCGA (pKEB152; 9Sa, native orientation) 5' UAUCGCAAAAUUCUG (pKEB154; 9Sa, reverse-complement orientation) 5" A UACCUUUGAAUUGUCCAUAUGGAACACAUUUGGGAGIUUGGACC UUG GCU AAU . A/del RBS Star t . . . Figure 4.4 rpsTmRNA Encoding 'Portable' RNase E Cleavage Sites Within the 5» UTR. The nucleotide sequence of the 5' UTR of stem-loop-protected rpsT mRNA containing the 15 nt 'portable' RNase E cleavage sequences is shown. Complementary oligonucleotides (Table 2.3) were ligated into the Ndel restriction site (shown) of the rpsT gene in pKEBl 10 to generated plasmids harbouring the rne or 9Sa insertion sequence in the native orientation (i.e. as found within the respective RNase E substrate; pKEB127 and pKEB152, respectively), or as reverse complements (pKEB128 and pKEB154, respectively). The characterized site of endonucleolytic cleavage by RNase E is depicted (vertical arrows). The location of the rpsT ribosome-binding site (RBS) and initiation codon (Start) within the mRNA are indicated. 118 Figure 4.5 Effect of 'Portable' RNase E Cleavage Sequences on rpsT mRNA Stability. RNA extracted from MG1693 harbouring pKEB127 (A), pKEB128 (B), pKEB152 (C), or pKEB154 (D) was analyzed on Northern blots as described in Figure 3.5 and probed for rpsT mRNA. The time of sampling (in min), the source of the mRNA and a schematic of the 5' end of the plasmid-encoded rpsT mRNA are indicated above each panel. The origin and orientation of the 'portable' cleavage element (wide, hatched arrow) within the rpsT 5' UTR are highlighted in the schematic representations. The position of the plasmid-encoded rpsTmRNA is intermediate in size to the chromosomally-encoded rpsTVl and P2 mRNAs, and is indicated (*k) at left of the autoradiographs. E . Plot of first-order decay of plasmid-encoded rpsT mRNA. Symbols used for each recombinant mRNA are indicated beside the schematics in A-D. 119 E Time (min) 120 as is predicted, novel degradative intermediates should arise with 5'-termini located within the sequence of the inserted sites. Although such decay intermediates will be ephemeral due to their 5-monophosphorylated termini, an attempt to detect them using primer extension analysis was undertaken. To eliminate interference from endogenously-encoded rpsTmRNA, E. coli strain MRA10, deleted for chromosomal rpsT(Ryden-Aulin etal, 1993), was transformed with plasmids pKEB127, 128, 152 or 154, and cellular RNA was isolated from arabinose-induced cultures. cDNAs were generated from the extension of radiolabeled oligonucleotide primer PE-1 as described in detail in Section 2.10.2 of Materials and Experimental Procedures, and separated on a 6% sequencing gel alongside an appropriate sequence ladder. Analysis of cDNA products generated by extension of PE-1 annealed to rpsT(\21) and rpsT(\2%) mRNAs revealed anticipated products terminating at a position corresponding to the 5' end of full length mRNA (Figure 4.6 A, lanes 5 and 6, FL ), as well as products terminating at residues corresponding to the 3' base of the 5'-terminal stem-loop (strong stop, SS), as previously observed in for stem-loop-protected rpsTQ. 10) mRNA in Figure 3.7. In addition, numerous cDNA products of varying sizes were detectable. The background level of most of these cDNA products, and their occurrence among the products during extension analysis of both rpsT(\21) and rpsT(\2$) mRNA suggest that they were generated through Reverse Transcriptase dissociation during primer extension and do not represent true termination of extension events. Products that were present at levels above the background were analysed as potential sites of cleavage by RNase E. One single cDNA product (Figure 4.6, arrow A) was significantly more abundant in the extension analysis of rpsT(\21) mRNA than in r/w7/(128) mRNA (comparing lanes 5 and 6, Figure 4.6 A). This extension fragment corresponds to the position of the 5'-proximal fusion site of the rne 'portable' cleavage sequence into the rpsT 5' UTR. Inspection of 121 Figure 4.6 Detection of RNase E Cleavages by Primer Extension Analysis. RNA was isolated from MRA10 transformed with either pKEB127, pKEB128, pKEB152, or pKEB154 and grown in arabinose (see Methods and Experimental Procedures). Primer extension was performed using a radiolabeled oligonucleotide PE-1, complementary to rpsT codons 17-42. A schematic representation of rpsT( 127) or rpsT(\S2) mRNA is shown in the left margin of each panel; the positions of the 5' terminal stem-loop; rne or 9Sa 'portable' cleavage sequence (broad, striped arow), and ribosome binding site (RBS; grey box) correspond to their positions in the sequence ladder. The position of full length cDNAs (FL) or cDNAs terminated at the base of the 5' terminal stem (SS; strong stop) are indicated by corresponding arrows. 'E' and 'E*' arrows denote extension products corresponding to previously characterized RNase E cleavage sites (Mackie, 1991). A. Determination of 5' termini within rpsT mRNA encoding the rne 'portable' cleavage site. Lanes 1-4, pKEB127 sequence ladder (labelled as corresponding RNA sequence); lane 5, cDNAs from rpsT{\21) mRNA (rne native orientation); lanes 6, cDNAs from rpsT(\2%) mRNA (rne reverse-complement orientation). Extension products obtained only from rpsT(\21) mRNA analysis are highlighted by an 'A'-labelled arrow. B. Determination of 5' termini within rpsTmRNA encoding the 9Sa 'portable' cleavage site. Lanes 1-4, pKEB152 sequence ladder (labelled as corresponding RNA sequence); lane 5, cDNAs from rpsT(l52) mRNA (9Sa native orientation); lanes 6, cDNAs from rpsT(\54) mRNA (9Sa reverse-complement orientation). Extension products obtained exclusively from either rpsT(\52) or rpsT(\5A) mRNA are highlighted by an 'A' or 'B'-labelled arrow, respectively. 122 B 1 2 3 4 5 6 1 2 3 4 5 6 123 the sequence within this region indicates that the cDNA 5' terminus corresponds to an endonucleolytic cleavage 5* to the AU dinucleotide within the rpsT(\21) mRNA generated as a consequence of the fusion of the rne oligonucleotides into the Ndel site during cloning. cDNA products corresponding to positions of several previously characterized RNase E cleavage sites within the rpsT5' UTR (Mackie, 1991) were also detected above background levels as products generated from both rpsT(\21) and r/w 7/(128) mRNAs (Figure 4.6 A, 'E' arrows in lanes 5 and 6). It is noteworthy that a cDNA product terminating at a particular characterized RNase E cleavage site (Figure 4.6 A, E*) is generated during the analysis of r/w 7/(128) mRNA and is absent for rpsT(\21) mRNA (Figure 4.6, compare lanes 5 and 6). Analysis of rpsT(\52) mRNA (9Sa - native orientation) revealed a 5' terminus corresponding to the exact site within the 9Sa insert sequence characterized in 9S rRNA processing by RNase E (AGA i AUUUUG; Figure 4.6 B, lane 5, arrow A; Ghora and Apirion, 1978). Primer extension analysis of rpsT(\54) mRNA revealed an extension fragment corresponding to an endonucleolytic cleavage 5' to an AU dinucleotide in the reverse-complement 9Sa insertion sequence (Figure 4.6, lane 6, arrow B). As observed for rpsT(\21) mRNA, this AU dinucleotide is the consequence of fusion of the insert sequence into the rpsT 5' UTR during cloning. Products corresponding to sequences of the several previously characterized RNase E cleavage sites within the rpsT5' UTR (Mackie, 1991) were also detected as termination products generated from both rpsT(\S2) and /ps7/(154) mRNAs (Figure 4.6, 'E' arrows in lanes 5 and 6). Furthermore, also visible in Figure 4.6 B are cDNAs representing premature termination at the base of the terminal stem-loop (SS) and full-length extension products (FL). As previously stated, products of endonucleolytic cleavage in vivo are 5' monophosphorylated and, therefore, are efficient substrates for subsequent attack by RNase E and 124 as a consequence, are difficult to detect. Primer extension analysis of rpsTmRNA harbouring RNase E 'portable' cleavage sequences revealed several putative cDNAs with 5' termini corresponding to positions within the inserted regions and may represent the mapping of genuine RNase E cleavage events. While caution should be taken in over interpreting the data presented in Figure 4.6, mapping data of rpsT(152) mRNA indicates that an endonucleolytic cleavage occurs at the exact position characterized in pre-5S rRNA processing. 4.2.4 Structure mapping of the 5' U T R of recombinant rpsT mRNA To establish the influence of the 15 nt rne leader or 9Sa 'portable' insertion sequences on the secondary structure of the chimeric rpsT mRNAs, an analysis of RNA structure within the 5' UTR of these mRNAs was undertaken. RNA isolated from MRA10 transformed with pKEB127, pKEB128, pKEB152 or pKEB154 was digested with RNase TI at 37 °C for various times as described in Materials and Experimental Procedures prior to primer extension analysis. RNase TI cleaves 3' to single stranded guanine residues (i.e. pNpGp 1 NpN), and is one of several ribonucleases typically used to determine the presence of secondary structure within RNA sequences. Three observations from the TI digestion pattern are consistent with the formation of the predicted 5'-terminal stem-loop structure in all derivatives of rpsTCllG) mRNAs (Figure 4.7 A and B). First, in the untreated sample, there is a strong stop to reverse transcription of rpsTCill), rpsT(\28), rpsT(\52), and rpsT(\5A) mRNAs at a position corresponding to the 3' base of the stem-loop (Figure 4.7 A and B: SS, lanes 5 and 7). Second, an RNase TI cleavage corresponding to the unpaired G residue in the loop of the terminal hairpin is detectable in all four RNAs (Figure 4.7 A and B: Loop, lanes 6 and 8). Finally, none of the G residues predicted to be paired in the 125 Figure 4.7 Structure Mapping of the 5' UTR of rpsT mRNA Harbouring 'Portable' RNase Cleavage Sites. RNA was prepared from arabinose-induced cultures of MRA10 containing the appropriate plasmid and subjected to partial digestion at 37 °C with RNase TI. Primer extension analysis using radiolabeled PE-1 was performed as described in Figure 4.5. Extension products are shown in lanes 5-8 (panels A and B) alongside the appropriate sequence ladders (labelled as the corresponding RNA sequence) in lanes 1-4 and 9-12 (panels A and B). Regions of interest in lanes 5-8 are boxed and/or indicated in the left margin with the following symbols: FL, full length cDNA; SS, strong stop; Loop, position of the GAGA tetraloop; Insert, 'portable' RNase E cleavage site sequence; RBS, ribosome binding site (5' GGGAG). A. Primer extension products generated from intact (lanes 5 and 7) or partially RNase TI digested (lanes 6 and 8) stem-loop-protected rpsTmRNA containing the rne cleavage sequence in the native (rpsT(\21); lanes 5 and 6) or reverse-complement orientation (rpsT(\2<V); lanes 7 and 8). B. Primer extension products generated from intact (lanes 5 and 7) or partially RNase TI digested (lanes 6 and 8) stem-loop-protected rpsT'mRNA containing the 9Sa cleavage sequence in the native (rpsT(l52); lanes 5 and 6) or reverse-complement orientation (rpsT(\54); lanes 7 and 8). 126 t Q . CO O CO o 127 terminal stem-loop is susceptible to TI cleavage (Figure 4.7 A and B, lanes 6 and 8; note the absence of extension products between FL and SS, other than 'Loop'). Structure mapping data for rpsT(\21) mRNA demonstrated that the single G residue within the rne insert region present in the native orientation (insert region boxed in Figure 4.7) remained single stranded and available for cleavage by RNase TI (Figure 4.7 A, lane 6). Similarly, all G residues within the rne insert region of rpsT(l2$) were accessibe to RNase TI (Figure 4.7 A, lane 8). However, the data also showed that the G residues in the ribosome binding site (5' GGGAG) of rpsT(\21) mRNA were less susceptible to RNase TI cleavage than these same residues in rpsT(\2%) mRNA (Figure 4.7 A, lane 6 versus 8, lower boxed products). Thus, the 5' UTR of rpsT(\2%) mRNA distal to the 5' stem-loop remained single-stranded, while the 15 nt rne insertion in rpsT(\21) mRNA somehow altered the secondary structure in a manner that reduced the single-strandedness of the Shine-Dalgarno sequence. RNA structure analysis of rpsTmRNA harbouring the 9Sa 'portable' cleavage sequence demonstrated that all G residues within the 5' UTR of rpsT(\52) or rpsT(l54) mRNA, outside of those within the 5'-terminal hairpin, were equivalently sensitive to cleavage by RNase TI, including those in the insertion region and ribosomal binding site (Figure 4.7 B, lanes 6 and 8). Therefore, the presence of the 9Sa 'portable' cleavage sequences in either orientation did not contribute to any apparent secondary structure within the 5' UTR of stem-loop-protected rpsT mRNA. 4.2.5 Decay of rpsT mRNAs containing a 9Sa 'portable' cleavage site requires RNase E The cleavage site mapping data for rpsT mRNA harbouring the 9Sa 'portable' cleavage sequences displayed in Figure 4.6 was consistent with the hypothesis that RNase E cleavage 128 occurs within these inserted sites. However, these data did not establish whether cleavage within these sites by RNase E leads to the observed destabilization of the chimeric mRNA. Therefore, to confirm the role of RNase E in the accelerated decay of rpsT mRNAs possessing the 9Sa 'portable' cleavage sequences, the kinetics of decay of rpsT(\S2) and rpsT(154) mRNA in SK5665 (rne-1) were evaluated by Northern blot analysis (Figure 4.8 A and B). Thermal inactivation of RNase E in SK5665 led to significant stabilization (3-6-fold) of both rpsT(\52) and rpsT(154) mRNA, which both decayed with half-lives of approximately 9 min (Figure 4.8 C). The data demonstrate that the destabilizing influence of the 9Sa 'portable' cleavage sequence in the 5' UTR of rpsTmRNA requires functional RNase E activity. 4.2.6 Directed mutagenesis of sequences within RNase E 'portable' cleavage sites To gain further evidence that the 'portable' cleavage sequences in stem-loop-protected rpsT mRNAs leads to mRNA destabilization, residues predicted to be important for RNase E recognition and cleavage were altered. In particular, since RNase E cleavage within the me leader and 9Sa sequences have been characterized to occur 5' to the AU dinucleotides incorporated within the 'portable' sites, these residues were substituted by site-directed mutagenesis. Directed mutagenesis was used to alter residues within the me leader 'portable' cleavage site, encoded by pKEB127, as described in detail in Materials and Experimental Procedures (Section 2.8) using mutagenic oligonucleotides rweSDMl and r«eSDM2 (Table 2.3). Substitution of residues within the 9Sa 'portable' cleavage site of pKEB152 was accomplished using oligonucleotides 9SaSDMl and 9SaSDM2. Mutation of the intended residues in pKEB127 resulted in the generation of pKEB149, while mutation of pKEB152 yielded pKEB163 (mutations 129 Time 0' 2' 4' 6' 8' 10' 12' 14" 0' 2' 4' 6' 8' 10" 12" 14' JB • • —• * * 4 k A <«. * ... 0 2 4 6 8 10 12 14 Time (min) Figure 4.8 Destabilization of rpsT mRNA Containing the 9Sa 'Portable' Cleavage Sequence Requires RNase E. Nor the rn blot analysis o f R N A isolated f rom S K 5 6 6 5 (rne-1) harbouring either p K E B 1 5 2 (9Sa, native orientation; A) or p K E B 1 5 4 (reverse-complement orientation; B). R N a s e E was thermal ly inactivated as descr ibed i n Ma te r i a l s and Exper imen ta l Procedures and R N A was extracted at var ious t ime intervals ( in min ) after the addi t ion o f r i f ampic in . The source o f the m R N A and a schematic o f the 5' end o f the p lasmid-encoded rpsT m R N A inc lud ing the orientat ion o f the 9 S a sequence inser t ion (wide , hatched arrow) are indicated above each panel . The pos i t ion o f the p lasmid-encoded rpsTmRNA is indicated ( * ) at left o f the autoradiographs. C. P lo t o f the first-order decay o f p lasmid-encoded rpsT versus t ime. S y m b o l s used for each rpsTmRNA are indicated i n panels A and B . n& (MHt *•<• 130 detailed in Figure 4.9), both of which were verified by sequence analysis. Figure 4.9 B shows that mutation of the me leader 'portable' cleavage site in pKEB149 did not lead to the stabilization of the rpsT(\49) mRNA, which decayed with a half-life of 1 min by Northern blot analysis. Similarly, mutation of residues encompassing the 9Sa 'portable' cleavage site within pKEB163 failed to stabilize rpsT(l63) mRNA (half-life=2 min). Therefore, the substitution of residues important for RNase recognition and cleavage within the me leader and 9Sa 'portable' cleavage sequences did not abolish the destabilizing influence of these insertions on stem-loop-protected rpsT mRNA. 4.2.7 Insertion of a 'portable' cleavage site within the rpsT open reading frame If'portable' cleavage sites within the 5' UTR of rpsT serve to destabilize stem-loop-protected mRNA through recognition and cleavage by RNase E, it is reasonable to hypothesize that events in cis that would impede recognition of the 'portable' site by RNase E would lead to less efficient destabilization of the corresponding mRNA. For example, the presence of ribosomes on coding regions during active translation might present an formidable barrier to cleavage site recognition by RNase E if the 'portable' site were present within the open reading frame. Such a mechanism appears to operate in the decay of rpsO mRNA in E. coli. Ribosomes positioned at the termination codon of rpsO sterically inhibit RNase E and interfere with the rate-limiting cleavage event 10 nt downstream of the coding sequence during mRNA decay (Braun et al, 1998). To examine the ability of a 'portable' cleavage site to destabilize stem-loop-protected rpsT mRNA when positioned within the rpsT open reading frame (ORF), recombinant rpsT genes were constructed containing 12 residues of the me leader cleavage sequence cloned into a position 131 pKEB127 | RBS ....uuguccaUAACCC AUUUUGCCCuauggaacacauuu gggag pKEB149 ^ ^ RBS ....uuguccaUAACCC CUCUUGCCCuauggaacacauuu gggag PKEB152 I RBS .. ..uuguccaU AC AG A AUUUUGCG Auauggaacacauuu [gggag pKEB163 * # * RBS .uuguccaUACUGU UUUUUGCGAuauggaacacauuu gggag B pKEB149 O 9Sa* pKEB163 Time 0" r 2' 3' 4" 5' 6' 7' -> IM 0' 2" 4' 6' 8' 10' 12' 14" * * -Figure 4.9 Stability of Stem-loop-protected rpsT mRNA Encoding Mutated 'Portable' RNase E Cleavage Sites. A. Nucleotide sequences of the rpsTmRNA 5' UTR residues encompassing the rne leader or 9Sa 'portable' RNase E cleavage sites (capital letters) encoded by pKEB127 and pKEB152, respectively, are shown. The position of the characterized RNase E cleavage site (vertical ' E ' arrow), ribosome binding site (RBS, boxed), and residues altered (#) by site-directed mutagenesis (depicted by curved arrow) are highlighted. B. Northern blot analysis of RNA isolated at various time intervals (in min) after the addition of rifampicin to MG1693 harbouring pKEB149 (left panel) or pKEB163 (right panel). A schematic of the rpsTmRNA including the source of the mutated (*) 'portable' cleavage site (broad, hatched arrows) is detailed above the autoradiographs. The position of the plasmid-encoded rpsT mRNA is indicated (•). 132 corresponding to a single-stranded region of the rpsTmRNA coding region (Figure 4.10 A). The insert was cloned 145 residues downstream of the start codon (between stem III and stem IV) into pKEBl 10, in both native (pKEB138) and reverse-complement (pKEB142) orientations. Insertion of the cleavage sequence at this position of the mRNA, well removed from known RNase E cleavage sites, does not disrupt the translational reading frame or any known secondary structure within the mRNA (Mackie, 1992). As a consequence of the absence of a unique restriction endonuclease site at the proposed insertion site, the rne cleavage sequence was 'inserted' into the rpsT ORF by amplification of two rpsT 'half sequences' (Figure 4.10 B). Using plasmid pKEB 110 as template, DNA fragments were amplified encoding the araBAD promoter/operator region and 5'-proximal portion of the stem-loop-protected rpsT gene, including the rne insert sequence in the native (amplified using oligonucleotides pBAD28-5' & XhoIrneS') or reverse-complement (2ta/wMpBAD28-5' & Xholrne(opp)5') orientations. Insertion of the 12 residues of the rne cleavage sequence was achieved by incorporating residues encoding the cleavage sequence, at the 3* end of the XhoIrneS' and Xholrne(opp)5' oligonucleotides. In addition, a DNA fragment was amplified from primer pairs Xholrney & rpsTi'Xbal encoding the 5-distal portion of the rpsTgene (see Figure 4.10 B). The 5' proximal rpsT half sequences were digested with BamHl and Xhol while the 5' distal rpsT half sequence was digested with Xhol and Xbal, and digested DNA fragments were ligated into BamHl and Jftal-digested pKEB106. Putative recombinant plasmids were screened by digestion analysis and DNA sequencing. The decay rates of mRNA harbouring the rne 'portable' cleavage sequence in the ORF, encoded by pKEB138 (native orientation) and pKEB142 (reverse-complement orientation), were determined by Northern blot analysis (Figure 4.11). The half-life of rpsT(l3S) mRNA, containing 133 Figure 4.10 Insertion of the rne 'Portable' Cleavage Site into the rpsT Coding Region. A. Schematic o f rpsT encoding a 5'-terminal s tem-loop c loned at the pos i t ion o f P B A D t ranscript ion in i t ia t ion i n p K E B l 10. The Shine-Dalgarno sequence ( S D ; grey box) and rpsT cod ing reg ion (black box) are shown as are the p rev ious ly characterized major R N a s e E cleavage sites ( ' E ' , ver t ical arrows; M a c k i e , 1991), the rho-independent transcriptional terminator (T) and exper imental ly determined secondary structure ( M a c k i e , 1992). The pos i t ion and orientat ion o f the 'portable ' rne leader cleavage sequences w i t h i n the m R N A , inserted into the cod ing sequence o f the rpsT gene, are indicated by w i d e hatched arrows. B. Insertion o f the 'portable ' cleavage sequence into the rpsT ORF by P C R ampl i f ica t ion . U s i n g p K E B l 10 p l a s m i d D N A as template, a 5 ' -proximal D N A fragment was ampl i f i ed that encompassed the a r a B A D promoter/operator region and 5' por t ion o f the rpsT gene harbouring stem-loop-encoded sequences. ' Insert ion ' o f the 12 residues o f the rne cleavage sequence (hatched box) into this fragment was achieved by incorporat ing into the downstream P C R primer , sequences encoding the rne cleavage site either i n the native orientat ion (using ol igonucleot ide p r imer Xho\rne5') or reverse-complement orientat ion (Xholrne(o\yp)5'). The 5'-distal D N A fragment was ampl i f i ed from pr imer pairs Xholrne3' and rpsTi'Xbal and encoded the 5'-distal por t ion o f the rpsT gene. PCR-genera ted 5 ' -proximal and 5'-distal D N A fragments were digested w i t h BamHl & Xhol and Xhol & Xbal, respectively, and l igated into BamHl & .Y&al-digested p K E B 1 0 6 (not shown). 134 A BAD RBS rpsT Kpn\ Ndel Xbal (191) ^ / \ ^ (300/301) ^ ^ p K E B 1 3 8 O pKEB142 B 5'-proximal PCR fragment BamHlpBAD28-5' 'Portable' rne cleavage S t ^ s ^ sequence Xho\me3' or X/7olme(opp)3' 5'-distal PCR fragment Xho\rne5' Aps7X6al3' 135 the insert sequence in the native orientation was 3 min, significantly reduced relative to rpsT{\ 10) mRNA (Figure 4.11 A and C). In contrast, rpsT(\42) mRNA (reverse-complement orientation) decayed with a half-life was 10 min and also demonstrated biphasic decay kinetics, similar to the parental mRNA (Figure 4.11 C). These data show that insertion of a 'portable' RNase E cleavage site into the rpsT coding region can effected destabilization of the mRNA. However the efficacy of the 'portable' cleavage site appears to be sensitive to translation, since the destabilization by the inserted sequence observed for rpsT(\3S) mRNA is less marked than that observed for rpsT(A21), where the site is present in the 5' UTR of the mRNA (compare 3 min versus 1 min half-lives). 4.3 DISCUSSION The orientation-dependent destabilization of ompA mRNA by an 'enhancer' from the 3' UTR of the cat mRNA is a paradigm for the destabilization of mRNA possessing a 5'-terminal, protective stem-loop (Meyer et al., 1996). Although the precise mechanism of ompA mRNA destabilization was never clearly established, the decay of the chimeric mRNA was determined to be initiated within the cat insert sequence, where endonuclease cleavage sites were also mapped (Meyer and Schottel, 1992). Accordingly, it was postulated that the insertion of known, characterized RNase E cleavage sites into a region of stem-loop-protected rpsT mRNA available for recognition would be sufficient to destabilize the recombinant mRNA. Data presented within this chapter demonstrate that such sites, present either within the rpsT 5* UTR or ORF, do, indeed, lead to mRNA destabilization. Additional findings presented here support the model that cleavage of sequences encompassed within these sites by RNase E is instrumental in the mechanism that leads to mRNA instability. 136 ft pKEB138 rne B Time 0' 1' 2' 3' 4" 5" 6" T ft pKEB142 rne 0' 2' 4' 6' 8' 10" 12' 14' 100 Figure 4.11 Stability of Stem-loop-protected rpsT m R N A Containing a 'Portable' Cleavage Site in the O R F . Northern blot analysis of RNA extracted from MG1693 harbouring pKEB138 (ORF rne, native orientation; A ) or pKEB142 (ORF rne, reverse-complement orientation; B) at various time intervals (in min) after the addition of rifampicin. A schematic of the rpsTmRNA including the orientation of the rne insert sequence (broad, hatched arrow) within the coding region is detailed above each panel. The position of the plasmid-encoded rpsTmRNA is indicated (•) and is intermediate in size to the two chromosomally-encoded rpsT mRNA (PI and P2, not indicated). C . Plot of the first-order decay of plasmid-encoded rpsT mRNA versus time. Symbols used for each mRNA are indicated in panels A and B. 137 4.3.1 Destabi l ization of rpsT mRNA by rne leader sequences The relatively large (78 nt) sequence incorporating a characterized RNase E cleavage site from the rne leader present within the 5' UTR of rpsT mRNA bypasses the protective effect of the 5* terminal stem-loop and leads to mRNA destabilization. In contrast to the instability conferred upon ompA mRNA by the cat RNA insertion, destabilization by the rne leader sequences was not orientation dependent, as both rpsT( 118) and rpsT(\24) mRNA displayed significantly reduced half-lives compared to rpsT(\ 10) mRNA (Table 4.1; entries 3 and 4). The mechanism of mRNA destabilization as a consequence of the rne leader insertions was not explored for these recombinant mRNAs. However, due to the size of the inserted sequences and a poorly defined consensus cleavage site for RNase E, it is reasonable to suggest that the rne leader insert sequence in the reverse-complement orientation presented appropriate residues for RNase E recognition and cleavage, thereby mediating rpsT(\24) mRNA destabilization. While this thesis was in progress, Belasco and colleagues presented a detailed secondary structure analysis of the 5' UTR of the rne mRNA resolved during an investigation of the autoregulatory mechanism of RNase E gene expression (Diwa et al, 2000; Figure 4.2 A). They provided data suggesting that stem-loop elements within the evolutionarily conserved, extensive secondary structure of the rne leader region are essential for autoregulation. Residues amplified and inserted into the rpsTgene did not include those necessary for the formation of the stem-loop (i.e. hairpin 2 in Diwa et al, 2000) deemed critical for auto regulation. However, the insertion did include residues encoding a hairpin dispensable for autoregulation (hairpin 1) and additional residues encoding only the 5' stem of hairpin 2 (Figure 4.2 A). Although the precise mechanism by which hairpin 2 mediates rne mRNA autoregulation by RNase E has yet to be determined, it can now be acknowledged that the 78 nt rne leader inserts within rpsTmRNA used in this work 138 Table 4.1 Half-lives of rpsT mRNA Harbouring RNase E Cleavage Sequences in Escherichia coli Entry Plasmid Insert element2 Recombinant mRNA feature Length (nt) Insert Position Half-life (min)b 1 NA NA PI (447) NA 1.5C P2 (356) NA 2.0 2 pKEBllO NA 388 NA 12 ± 2 3 pKEB118 rne (76 nt); + 464 5'UTR 1 4 pKEB124 rne (76 nt); — 464 5'UTR 2 5 pKEB127 me (15 nt); + 403 5'UTR 1.0 ±0.2 6 pKEB128 rne (15 nt); — 403 5'UTR 13 ± 2 7 pKEB152 9Sa (15 nt); + 403 5'UTR 3.0 ± 1.0 g pKEB154 9Sa (15 nt); - 403 5'UTR 1.0 ±0.5 9 pKEB152 9Sa (15 nt); + 403 5'UTR 9 (rne-If 10 pKEB154 9Sa (15 nt); - 403 5'UTR 9 (rne-If 11 pKEB138 rne (15 nt); + 403 ORF 2.5 ±0.5 12 pKEB142 rne (15 nt); - 403 ORF 10 ± 1.0 13 pKEB149 rne* (15 nt); + e 403 5'UTR 1 14 pKEB163 9Sa* (15 nt); + 403 5'UTR 2 "Insert elements represent the source and size of the RNase E cleavage sequences present within the stem-loop-protected rpsT mRNA in either the native (+) or reverse-complement (-) orientations. bHalf-life values given with a standard deviation represent the average of at least 4 trials (additional half-life values represent a single experimental value selected from one of at least 2 trials). 'Chromosomally-encoded rpsTmRNA half-life in wildtype E. coli cells (Mackie, 1987). dThe value represents the half-life in SK5665 (rne-1) cells at the non-permissive temperature. 'Asterisk denotes mutated 'portable' cleavage sites (see text and Figure 4.9 for details). 139 fail to encompass all the elements necessary for RNase E-mediated autoregulation of rne mRNA. Nonetheless, the inserted residues (native orientation) encode both a structural element that may form within the 5' UTR of the recombinant rpsT mRNA, and residues from the me leader normally sequestered within hairpin 2. It is conceivable that in addition to the characterized RNase E cleavage site, either the R N A structural element or exposure of sites perhaps recognizable by RNase E but previously duplexed within a stem-loop may have played a role in the observed instability of rpsT(\ 18) mRNA. 4.3.2 Destabilization of rpsT mRNA by the rne 'portable' RNase E cleavage site The introduction of the small (15 nt), 'portable' RNase E cleavage-site sequence from the me leader into the 5' UTR rpsT'mRNA demonstrates that a defined R N A element can promote mRNA destabilization and 'override' the protective influence of a S'-terminal stem-loop. Key features of the rne leader (and 9Sa) 'portable' cleavage site characterized in this study include the presence of a 'consensus' RNase E cleavage sequence and single strandedness (in their native environments; Diwa et al, 2000; Ghora and Apirion, 1978). The data exemplifying the stability of rpsT(\2$) mRNA (Table 4.1; entry 6) validate that the insertions do not operate through simple expansion of the 5' UTR or separation of the 5' stem-loop structure and the ribosomal binding site/coding sequence. The presence of the rne leader 'portable' cleavage site in rpsT(\21) directed, in addition to mRNA destabilization, undefined secondary structural changes within the rpsT 5' UTR (Figure 4.7 A). It is noteworthy that in addition to inefficient RNase TI digestion within the ribosomal binding site of rpsT(\21) mRNA, RNase E cleavage at a previously characterized site within the rpsT5' UTR (Mackie, 1992) was not detected for the degradation of this mRNA (Figure 4.7 A, 140 lane 5, arrow E*). Nonetheless, a putative RNase E cleavage site 5' to an A U dinucleotide was mapped at the fusion position of the rne insert sequence in rpsT(\21) mRNA (Figure 4.7 A, lane 5, arrow A). Based on the data presented, it is difficult to establish the influence of the suspected secondary structural changes on cleavage within this region by RNase E. Any influence may, however, contribute to the absence of an anticipated RNase E cleavage at the position characterized by Jain and Belasco (1995). In addition to establishing the essential nature of hairpin 2 of the rne 5' U T R in autoregulation of RNase E sysnthisis, Diwa et al, (2000) also determined that the single-stranded R N A segment containing the characterized RNase E cleavage site is dispensable for RNase E-mediated feedback regulation. Accordingly, while substitution of residues within this site in the rne leader abolish cleavage at this site, they fail to impair the ability of the 5' UTR to respond to changes in cellular RNase E activity (Jain and Belasco, 1995). Therefore, this particular characterized cleavage site may be functionally redundant with other RNase E cleavage sites within the 5' UTR of the rne transcript: A parallel situation may explain the stability of rpsTCiH) mRNA. The context of the A U dinucleotide within rpsT( 111) mRNA generated during the cloning procedure might offer a preferred recognition site for RNase E. As a consequence, RNase E cleavage at the characterized site would be redundant, while an alternative site might be preferred (as was mapped by primer extension). This may also explain the failure of nucleotide substitutions within the characterized rne cleavage sequence to abrogate the destabilizing effect of the insert within rpsT(\49) mRNA (Figure 4.9; Table 4.1, entry 5 versus 13). 4.3.3 Destabilization of rpsT mRNA by a 9Sa 'portable' RNase E cleavage site An RNase E cleavage site in rpsT(\52) mRNA was mapped precisely to sequences 141 analogous to the 'a' site utilized during 9S rRNA processing (Figure 4.6 B). This suggests that the 9Sa 'portable' site functions, as a direct target for RNase E cleavage during destabilization of rpsT(\52) mRNA. Furthermore, the destabilizing influence of the 9Sa insertion was dependent on RNase E activity in vivo (Figure 4.8), and was not a consequence of secondary structure changes within the rpsT 5' UTR (Figure 4.7 B). These data represent the first demonstration of a defined RNA determinant leading to mRNA destabilization through RNase E-mediated cleavage. It is dissatisfying that mutation of residues at the RNase cleavage site failed to diminish the destabilizing influence of the 9Sa 'portable' sequence in rpsT(\63) mRNA (Figure 4.9 and Table 4.1, entry 14). However, as pointed out above, this site may be redundant within the context of additional putative sites within the insert region. The 9Sa cleavage insert promotes mRNA destabilization to a different extent depending on its orientation (Table 4.1; entries 7 and 8), presumably due to the differential recognition of primary sequences within the cleavage sequence by RNase E. Inspection of the reverse-complement 9Sa insertion sequence (5' UAUCGCAAAAUUCUG) reveals AU dinucleotides commonly found in consensus RNase E cleavage sites (Ehretsmann et al, 1992; McDowall et al, 1994). In addition, an RNase E endonucleolytic cleavage 5' to the AU dinucleotide generated by fusion of the 9Sa insert sequence in the reverse-complement orientation within the rpsT 5* UTR was putatively mapped by primer extension analysis (Figure 4.6 B), and may contribute to rpsT(l54) mRNA destabilization. Cleavage within the reverse-complement 9Sa 'portable' site is not entirely unexpected; efficient RNase E-medicated cleavage of antisense 9S rRNA containing this sequence has been previously demonstrated in vitro (Cormack and Mackie; 1992). 142 4.3.4 Destabilization of rpsT mRNA by a 'portable' RNase E cleavage site is altered by its location The efficiency of a 'portable' cleavage site in destabilizing stem-loop-protected rpsT mRNA depends on its position within the targeted mRNA. While insertion of the me leader 'portable' cleavage sequence into the rpsTmRNA ORF led to mRNA destabilization in an orientation-dependent manner (Table 4.1; entries 11 and 12), the destabilizing influence was diminished compared to that observed when the 'portable' site was present in the 5' U T R of the rpsT mRNA. These data support the premise that translating ribosomes transiently mask RNase E-cleavage site recognition (Braun etal., 1998), as additional experimental evidence presented in Chapter Five will further validate. It is important, nonetheless, to address the cleavage and structure mapping data for the rpsTmRNA 5' UTR encoding the me 'portable' cleavage sequence. These data indicate that while the inserted residues, themselves, remained single stranded, they effected the RNA structure. It is conceivable that the me 'portable' cleavage insert harboured in the rpsTORF in rpsT(\38) mRNA could also change the R N A structure that influenced its stability, this is unlikely. Movement of ribosomes along the rpsT coding region during rounds of translation would lead to continued disruption of any secondary structure formed between the insert sequence and distal residues. Therefore, it is improbable that the me 'portable' insert directs structural changes to the mRNA; rather, it provides an RNase E recognition/cleavage site to promote rpsT'mRNA destabilization. 143 C H A P T E R F I V E INFLUENCE OF TRANSLATION ON RECOMBINANT RPSTMRNA D E C A Y IN VIVO 5.1 INTRODUCTION The functional association of mRNA with polysomes necessarily implicates translation in modulating the longevity of some, if not most, mRNA; however, the nature of the relationship remains obscure. Various observations correlate translational efficiency and the stabilization of mRNA against RNase E-mediated degradation (Petersen, 1993; reviewed in Section 1.6). Notwithstanding, a few mRNAs (or regions of an mRNA) are stable in the absence of translation, and therefore, protection of mRNA by ribosomes is not universal. Presently, the most elegant example implicating translation in the stability of an mRNA stability occurs for the rpsO mRNA. The initiation of the degradation of rpsO mRNA by RNase E is retarded by ribosomes positioned at the termination codon, 10 nucleotides upstream of the rate^ limiting endonucleolytic cleavage site (Braun et al, 1998). Inhibition of RNase E-mediated cleavage at this site leads to 3-fold greater stability of the entire rpsO mRNA. This result clearly establishes that ribosomes can sterically inhibit, or 'mask', endonucleolytic cleavage site recognition to inhibit RNase Ermediated mRNA decay. Despite the protection conferred to an RNA by a 5'-terminal stem-loop, translation appears to also be required for stabilization of the mRNA from decay. For example, stem-loop-protected lacZ mRNA is no longer stabilized against RNase E-mediated decay in the absence of translation (Lopez and Dreyfus, 1996; Joyce and Dreyfus, 1998). Additionally, although only periodic passage of ribosomes through the protein coding region of ompA mRNA is required for 144 stabilization, a high degree of ribosome occupancy at the Shine-Dalgarno site (achieved through perfect complementarity between the ribosome binding site and 16S rRNA) is necessary for mRNA stability (Arnold et al, 1998). In light of the fact that the rate-limiting RNase E cleavage occurs in the 5' UTR oiompA (Vytvytska et al, 2000), this latter observation suggests that occupation of the Shine-Dalgarno sequence by ribosomes is critical in inhibiting an initial event in the decay of ompA mRNA. Indeed, this is consistent with in vitro data demonstrating 30S ribosomal subunit protection of the ompA 5' UTR from cleavage by RNase E (Vytvytska et al.., 2000). Data presented in Chapters Three and Four, including: the inability of a stem-loop to protect the rpsTmRNA possessing a 5-terminal truncation; the apparent reduced efficiency of a 'portable' cleavage site when present in the rpsTORF; and the postulated destabilization of rpsT mRNA by translational repression, suggest that translation plays a significant role in the stability of several of the chimeric rpsT mRNAs studied here. In an attempt to assess the relationship between translation and the stability of recombinant rpsT mRNA, an evaluation of the influence of translation on the rate of decay of rpsT'mRNA possessing a 5'-terminal stem-loop with or without a 'portable' cleavage site was undertaken. Modulation of translation initiation or the range of ribosome elongation was achieved by introducing czs-acting mutations into plasmid-encoded rpsT. 5.2 RESULTS 5.2.1 Degradation of 5'-protected rpsT mRNA is sensitive to translational efficiency To determine whether the stability of rpsT(\ 10) mRNA was sensitive to translation, previously characterized mutations which modulate the efficiency of initiation of translation of the rpsTmRNA (Parsons etal, 1988) were introduced into the stem-loop-containing rpsTgtne in 145 pKEBHO by site-directed mutagenesis. Altering the context three and four residues 5' of the U U G initiation codon (i.e. -3,-4) was achieved using mutagenic oligonucleotide primers SD1 & SD2 (Table 2.3). Putative recombinant plasmids were screened for the introduced nucleotide substitutions (GA - CU) initially by the loss of the Avail restriction endonuclease site at this position (recognition sequence GGWCC), followed by sequence analysis. The resulting mutant plasmid, pKEB143, encodes a rpsTmRNA with a predicted 6-fold decrease in translation efficiency (Parsons et al, 1988; Figure 5.1). Modifying the U U G initiation codon in rpsTto A U G was achieved using oligonucleotide primers Start 1 & Start2. The U - A substitution generated a Ncol restriction endonuclease site (recognition sequence CCATGG) which was exploited during the screening of transformants. The resulting recombinant plasmid, pKEB144, encodes an rpsT'mRNA that is predicted to be translated 2.5-fold more efficiently as a consequence of the mutation (Parsons et al, 1988; Figure 5.1). The rates of decay of the rpsT(\44) and rpsT( 143) mRNAs were measured by Northern blot analysis (Figure 5.2 A & B). The mutations in pKEB143, which are predicted to reduce translational efficiency, resulted in a half-life for rpsT(\4s) mRNA of 1.5 min, and thereby abolish any protective effect of the 5' stabilizing secondary structure (Figure 5.2 C). In contrast, the rpsT(I44) mRNA containing the U U G - A U G mutation was almost completely stable during the course of a typical experiment (Figure 5.2 B and C). An accurate half-life could not be measured, but by extrapolation, it must be £25 min, substantially greater than the parental rpsT(\ 10) mRNA (Table 5.1; page 164). Therefore, the protective effect of the terminal 5' stem-loop on rpsT mRNA stability correlates with the efficiency of translation initiation. Interestingly, onset of the second phase of the decay curve observed for rpsT(\44) mRNA degradation occurs at a later time in comparison to rpsT(l 10) mRNA (11-12 min versus 8-9 min). 146 A G G G C C A C C G C U A C C C C G G U G G C G A U G G AUG pKEB144 - Increased translational efficiency 5' A UACCUUUGAAUUGUCCAUAUGGAACACAUUUlGGGAGiUUGGACC UUG GCU AAU . . . R B S | CU I pKEBl 43 - Decreased translational efficiency Figure 5.1 Introduction of Mutations Influencing Translation Initiation Efficiency of Stem-loop-protected rpsT mRNA. Previously characterized mutations which modulate the efficiency of rpsT translation initiation (Parsons et al, 1988) were introduced into the 5' leader or initiation codon of rpsT encoded by pKEBl 10 by site-directed mutagenesis. The 5' portion of the stem-loop-protected mRNA encoded by pKEBl 10, the introduced nucleotide substitutions and the resulting recombinant plasmids are shown schematically. The position of the ribosome binding site (RBS) is boxed. 147 Time (min) Figure 5.2 Influence of Translation on r p s T m R N A Protected by a 5'-terminal Stem-loop. R N A extracted from MG1693 harbouring pKEB143 (A) or pKEB144 (B) was analyzed on Northern blots as described in Figure 3.5. The time of sampling (in min), the source of the mRNA, and a schematic of the 5' end of the plasmid-encoded rpsT mRNA are indicated above each panel. The nucleotide changes introduced into the 5' leader (-3,-4) or initiation codon (AUG) are highlighted in the schematic representations. The position of the plasmid-encoded rpsT mRNA is intermediate in size to the chromosomally-encoded rpsTYl and P2 mRNAs, and is indicated (•) at left of the autoradiographs. C. Plot of the first-order decay of plasmid-encoded rpsTmRNA. Symbols used for each recombinant mRNA are indicated beside the schematics in A and B. 148 In addition to influencing the efficiency of translation, the introduction of the AUG initiation codon has also been shown to reduce the autoregulatory repression of rpsT expression by S20 (Parsons et al, 1988). An hypothesis rationalizing the influence of increased translational initiation from the AUG start codon on the biphasic decay of rpsT( 144) mRNA will be offered in the discussion section of this chapter. 5.2.2 Stability of stem-loop-protected rpsT mRNA is dependent on the position of a premature stop-codon. To evaluate whether the correlation between translational initiation and stem-loop protected rpsTmRNA observed in Figure 5.2 is due to ribosomes initiating translation per se, or to ribosome movement through the rpsT mRNA coding region, an in-frame stop codon was introduced into pKEBl 10 either upstream or downstream of the major RNase E cleavage sites at nucleotide positions 300 and 301 (Mackie, 1991; Figure 5.3 A). The introduction of the 'upstream' stop, at codon 52, was achieved as a consequence of PCR amplification of two rpsT 'half sequences (Figure 5.3 B). Amplification of pKEBl 10 template DNA using oligonucleotide primers BamHlpBADS' & rpsTXhol5' generated a 5'-proximal rpsT 'half gene fragment in which nucleotide modifications were incorporated into the rpsTXholS' primer to introduce a single nucleotide (C) insertion and an Xhol restriction site at the 3' end of the fragment. The single nucleotide insertion resulted in the introduction of this residue at position 269 in the amplified 5'-proximal rpsT 'half gene, and resulted in a -1 shift in the translational reading frame and introduction of a premature stop codon 18 residues downstream of the insertion (at codon 52; Figure 5.3 C). Amplification of the 5-distal rpsTgene sequences was achieved using oligonucleotides rpsTXhoiy & rpsT3Xbal and also introduced nucleotide substitutions 149 Figure 5.3 Introduction of Premature Termination Codons within Stem-loop-protected rpsT mRNA. A. Schematic of rpsT(\ 10) mRNA transcribed from P B A D (indicated) and highlighting the 5'-terminal stem-loop, ribosomal binding site (RBS), and gene coding region (black box). The experimentally determined secondary structure for the rpsT mRNA (Mackie, 1992) is enlarged to show the position of the rate-determining RNase E cleavage sites ('E' at residues 300 and 301; Mackie, 1991) and the positions of premature termination codons (octagons at nucleotide positions 285 and 337) engineered into rpsT harboured on pKEBl 10 relative to the natural termination site (*). The numbering of several of the stem-loop structures present within the rpsT mRNA (Roman numerals) is also indicated. B. PCR amplification of the 5'-proximal and 5'-distal rpsT gene 'half sequences using oligonucleotide primers 5a/wMpBAD28-5' & rpsTXhoWA and rpsTXhol5' & rpsTXbal, respectively, and pKEBl 10 as template DNA. Introduction of a premature termination codon upstream of sequences corresponding to the major RNase E cleavage site (mRNA residues 300 and 301) was the consequence of the insertion of a single nucleotide into the rpsTXhoW primer and incorporation of this residue at position 269 of the amplified rpsT gene. C. DNA sequence of a region of the coding strand of the rpsT gene harboured on pKEBl 10 (top) and pKEB136 (bottom). The single nucleotide insertion (C residue, boxed) within the rpsTXhoYi' oligonucleotide primer introduces a -1 frameshift of the coding sequence which results in a stop codon 16 residues upstream of the RNase E cleavage site at residues 300 and 301 ('E' vertical arrow). The design of the oligonucleotide primers also introduced nucleotide substitutions which generate an Xhol restriction site (CGTGTC to G A G C T C ; shaded box) which was used to facilitate ligation of the two rpsT 'half genes during cloning. 150 BAD +1 B f t RBS o rpsT pKEB136 Via i_ E1?ST'o 1 1 3 U VI (300/301) vii O * — * Vlb 5'-proximal PCR fragment 8amHlpBAD28-5' IIIIIIIIIIIIIL/ Nucleotide insertion introduced here rps TXho\3' 5'-distal PCR fragment rps T X 7 T O I 5 ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ ^ rpsTXbaW , rpsTXhoW rpsTXho\5\ CGA CCG CTG TTT CGA CGAlCGT GTCl TTT CGT AAA TTG CTT TAC GTT GGC TAG CAC Ala Gly Asp Lys Ala Ala Ala Gin Lys Ala Phe Asn Glu Met Gin Pro Me Val CGA CCG CTG TTT CGA[CJCG AGA GCT CfTT TCG TAA ATT GCT TTA CGT TGG CTA GCA C Ala Gly Asp Lys Ala Gly Cys Thr Glu Ser lie STOP 151 generating an Xhol restriction site (at the 5* terminus of the 5-distal rpsT fragment). Ligation of the two rpsTPCR framents into prepared pKEB106 generated pKEB136, which harboured an mRNA with a termination codon 16 nt upstream of the RNase E cleavage site and encoded a polypeptide with a 36 amino acid carboxy-terminal truncation. Introduction of the premature termination codon at nucleotide position 337 (codon 69), downstream of the RNase E cleavage sites at 300, 301, was achieved by site-directed mutagenesis using oligonucleotide primers Stop3 & Stop4 (Table 2.3) and pKEBl 10 as template DNA. The A - T nucleotide substitution at nucleotide position 337 is 36 nt downstream of the major RNase E cleavage sites, and resulted in the conversion of an AAA triplet (encoding lysine, codon 69) to a UAA triplet, directing translational termination. The mutated plasmid, pKEB147, was verified by sequence analysis, and encodes a polypeptide with a 19 amino acid carboxy-terminal truncation. Neither the newly introduced single nucleotide change in pKEB147 nor the nucleotide substitutions in the creation of XhtXhol site in pKEB136 was predicted to alter the secondary structure of the rpsTmRNA (Mackie, 1992). The influence of the position of the premature stop codon on the stability of the stem-loop-protected rpsT mRNA in MG1693 (harbouring either pKEB136 or pKEB147) was evaluated by Northern blot analysis (Figure 5.4 A and B). In the ease of the rpsT(\36) mRNA (where translation terminates 5' to the RNase E cleavage sites), the half-life was reduced to 2 min (Figure 5.4 C), a 6-fold decrease relative to the parental mRNA, rpsTCl 10). For pKEB147, where the stop codon lies 3' to the 300,301 cleavage sites, the half-life of the rpsT(\47) mRNA was 7 min (Figure 5.4 C). The rpsT(\41) mRNA is still quite stable and its half-life represents less than a 2-fold reduction relative to rpsT(\ 10) mRNA. These data suggest that stability of rpsT mRNA possessing a 5'-terminal hairpin is affected by translation through the coding region of the 152 Si pKEB136 P (285 nt) "I • B Si (337 nt) pKEB147 Time 0' 1" 2" 3' 41 5' 6" T 0" 2' 41 6" 8' 10" 12" 14 m —. iflHr •'S'WS 0 2 4 6 8 10 12 14 Time (min) Figure 5.4 Influence of Premature Stop Codons on the Stability of Stem-loop-protected rpsTmRNA. R N A extracted from MG1693 harbouring pKEB136 (A) or pKEB147 (B) was analyzed on Northern blots as described in Figure 3.5. The time of sampling (in min), the source of the mRNA, and a schematic of the 5' end of the plasmid-encoded rpsT mRNA are indicated above each panel. The position of the premature termination codon (octagon) either upstream (i.e. at nucleotide position 285) or downstream (nucleotide position 337) of the rate-limiting RNase E cleavage sites at positions 300 and 301 (Mackie, 1992) is shown. The position of the plasmid-encoded rpsTmRNA is intermediate in size to the chromosomally-encoded rpsT PI and P2 mRNAs, and is indicated (•) at left of the autoradiographs. C. Plot of the first-order decay of plasmid-encoded rpsTmRNA. Symbols used for each recombinant mRNA are indicated beside the schematics in A and B. 153 mRNA containing an efficient RNase E cleavage site (Mackie, 1991). The stability of the RNA was not dependent on highly efficient translational initiation, as the wildtype UUG initiation codon was maintained within rpsT(l36) and rpsT(\A7) mRNAs. 5.2.3 mRNA destabilization by a 'portable' cleavage site in rpsT mRNA is sensitive to translation Destabilization of stem-loop-protected rpsT mRNA by the insertion of the rne 'portable' cleavage sequence in the ORF was previously demonstrated (Section 4.2.7). The inability of a portable RNase E cleavage sequence positioned in the rpsT ORF to destabilize the mRNA to the same extent as when positioned in the 5' UTR led to the hypothesis that translation through the coding region precludes RNase E cleavage of the inserted site. Therefore, altering the frequency of translation through the rpsT coding region might be expected to modulate the efficiency of the insert sequence. To evaluate this hypothesis, the effect of altered translational efficiency on the stability of chimeric rpsT mRNA containing the 'portable' cleavage site within the rpsTmRNA coding region was assessed. The previously characterized mutations that alter the efficiency of rpsT mRNA translation initiation were introduced into pKEB138 [encoding rpsT(\3Z) mRNA harbouring the rne 'portable' cleavage site insertion between codons 48 and 49 in the ORF; native orientation] by site-directed mutagenesis. Both the GA - CU, or UUG - AUG, mutations (Parsons et al, 1988) were introduced using oligonucleotide primer pairs SD1 & SD2 or Start 1 & Start2 to generate pKEB145 and pKEB146, respectively (Figure 5.5). Nucleotide substitutions within the recombinant plasmids were verified by DNA sequencing. The half-life of the rpsT(\A5) mRNA, containing the -3,-4 mutations which is predicted 154 A G G A AUG RBS t pKEB146 - Increased translational efficiency 5' A UACCUUUGAAUUGUCCAUAUGGAACACAUUUPGGAGlUUGGACC r q . D M ^ 3 1 M C J ! S 5 pKEB145 - Decreased translational efficiency CU Figure 5 . 5 Introduction of Mutations Influencing Translational Initiation into Stem-loop-protected rpsT mRNA Possessing a 'Portable' Cleavage Sequence in its ORF. Previously characterized mutations which modulate the efficiency of rpsT translation initiation (Parsons et al, 1988) were introduced into the 5' leader or initiation codon of rpsT harbouring the rne 'portable' cleavage sequence in its coding region (pKEB138) by site-directed mutagenesis. Substitution of residues three and four nucleotides 5' to the start codon (GA - » CU; pKEB145) or alteration of the U U G initation codon to A U G (pKEB146) were made as described within the text. The nucleotide sequence of the 5' terminus of rpsT mRNA encoded by pKEB138 (coding region shaded), the ribosome binding site (RBS), and the introduced nucleotide substitutions are shown. The predicted influence on the efficiency of translational initiation of mRNA encoded by the recombinant plasmids is indicated. The experimentally determined secondary structure for rpsTmRNA detailing the position of RNase E cleavage sites ('E', vertical arrows) and the inserted rne 'portable' cleavage sequence (broad hatched arrow) is shown in the expansion. 155 to decrease translational efficiency, was 1.5 min (Figure 5.6 A & C), a two-fold reduction compared to the parental rpsT(l3S) mRNA (half-life=3 min). Conversely, rpsT(l46) mRNA displayed a 15 min half-life (Figure 5.6 B and C), a 5-fold stabilization. In addition, the more rapid phase of the biphasic kinetics observed for the decay of rpsT{\46) mRNA appeared between 10 and 11 minutes, somewhat later than for other stable recombinant rpsT mRNAs. An increase in translational efficiency, therefore, stabilized the mRNA containing the 'portable' rne cleavage sequence inserted into the rpsT coding region. It is noteworthy, however, that the half-life of rpsT(\46) mRNA containing the internal 'portable' cleavage sequence, although increased by the AUG substitution, was still less than that observed for rpsT(144) mRNA (AUG initiation codon lacking a 'portable' cleavage site; compare half-lives of 15 min versus >25 min; Table 5.1). Increased translational efficiency of stem-loop-protected rpsT mRNA correlated with a reduced ability of the rne 'portable' cleavage sequence to destabilize the mRNA when positioned within the RNA ORF. A second test for the influence of translation on the ability of a 'portable' cleavage sequence to affect RNA stability, the impact of increased translation initiation frequency on the stability of rpsTmRNA harbouring a 9Sa 'portable' cleavage sequence in the 5* UTR was evaluated. The AUG start codon was introduced into pKEB152 (9Sa, native orientation) and pKEB154 (9Sa, reverse-complement orientation) by site-directed mutagenesis using oligonucleotide primers Start! & Start2, to generate pKEB161 (parental plasmid pKEB152) and pKEB162 (parental plasmid pKEB154). The stability of the recombinant rpsT mRNAs was evaluated by Northern blot analysis (Figure 5.7 A and B). Mutation of the UUG initiation codon to AUG in rpsT(\6\) mRNA resulted in a 5 min half-life, compared to 2.5 min for the parental rpsT(\54) mRNA (i.e. a 2-fold stabilization of the mRNA; Table 5.1, page 164). In addition, biphasic decay kinetics were also observed for rpsT(\6X) mRNA (Figure 5.7 C). The AUG 156 0 2 4 6 8 10 12 14 Time (min) Figure 5.6 Influence of Translation on rpsT mRNA Stability in the Presence of a 'Portable' Cleavage Sequence in its ORF. Northern blot analysis was performed as described in Figure 3.5. RNA was extracted from cells removed at various time intervals (in min) after the addition of rifampicin from arabinose-induced cultures of M G 1693 transformed with either pKEB145 (A) or pKEB146 (B). A schematic of the 5' end of the rpsTmRNA is given above each panel and details the nature of the mutation influencing translational initiation and the insertion of the me 'portable' cleavage sequence in the rpsT coding region (native orientation; broad hatched arrow). The position of the plasmid-encoded recombinant rpsTmRNA is indicated (•) to the left of the autoradiographs. C. Plot of the first-order decay of plasmid-encoded rpsT versus time. Symbols used for each rpsTmRNA are indicated in panels A and B. 157 PKEB162 Time o" 2' 4' 6' 8' 1Q1 12' 14 0' 2' 4 6' 8' 10" 12' 14' • i» «» 100 » 6 8 Time (min) 10 12 14 Figure 5.7 Influence of Translation on rpsT mRNA Destabilization by a 'Portable' Cleavage Sequence Present in its 5' UTR. Northern blot analysis was performed as described in Figure 3.5. RNA was extracted from cells removed at various time intervals (in min) after the addition of rifampicin from arabinose-induced cultures of M G 1693 transformed with either pKEB161 (A) or pKEB162 (B). A schematic of the 5' end of the rpsTmRNA is given above each panel and details the orientation of the 9Sa 'portable' cleavage sequence (broad hatched arrow). The position of the plasmid-encoded rpsT mRNA is indicated (•) to the left of the autoradiographs. C. Plot of the first-order decay of plasmid-encoded rpsT versus time. Symbols used for each rpsTmRNA are indicated in panels A and B. 158 initiation codon introduced into pKEB162 led to a half-life of 2 min for rpsTCi 62) mRNA, also a 2-fold stabilization compared to the parental mRNA. Increased translational initiation, therefore, leads to a modest stabilization of rpsTmRNA possessing a 9Sa 'portable' cleavage site within the 5* leader. However, the A U G mutation does not overcome the destabilizing influence of the 9Sa insert to the same extent to that observed when the 'portable' site was present in the rpsTORF (see Table 5.1). 5.2.4 Efficient translation initiation stabilizes 5' truncated rpsT mRNA possessing a terminal stem-loop As demonstrated in Section 3.2.6, the addition of a stable stem-loop structure to the 5' terminus of rpsTmRNA that also had a deletion of 5' terminal residues did not stabilize the corresponding mRNA. In view of the positive effects of increased translational efficiency on the stability of other recombinant mRNAs, the stability of a 5' truncated rpsTmRNA was evaluated when the U U G initiation codon was mutated to AUG. The U U G initiation codon encoded within pKEB122 (harbouring a twelve residue 5-terminal deletion) was modified to A U G by site-directed mutagenesis (utilizing mutagenic oligonucleotides Start 1 & Start2) to generate pKEB148 (Figure 5.8 A). The influence of the A U G mutation, predicted to increase translation efficiency of rpsT{\4%) mRNA, on RNA stability was determined by Northern blot analysis (Figure 5.8 B). The half-life of rpsT(\4&) mRNA was approximately 15 min, a significant stabilization compared to the 1 min half-life of the parental rpsT(\22) mRNA (Figure 5.8 B and C). It is noteworthy that, the steady-state level of endogenously-expressed rpsTVl and P2 mRNA is reduced in MG1693 cells harbouring pKEB148 (Figure 5.8 B, right panel), as has often been observed with 159 Figure 5.8 Efficient Translation Stabilizes 5'-truncated rpsT mRNA Possessing a Terminal Stem-loop. A. Sequence of the 5' region of rpsT{\22) mRNA emphasizing the nucleotide substitution (U - A) introduced to generate pKEB148. Also shown is the sequence of the 12 residues deleted from the stem-loop-protected rpsT{\22) mRNA [and rps7/(148) mRNA] leader. B. Northern blot analysis of RNA isolated from MG1693 harbouring either pKEB122 (left panel; as also shown in Figure 3.10) or pKEB148 (right panel) at various time intervals (in min) after the addition of rifampicin. A schematic of the 5' end of the rpsTmRNA emphasizing the sequence of the translation initiation codon is shown above each autoradiograph. The position of the plasmid-encoded rpsTmRNA (*) and chromosomally-encoded rpsTVX and P2 mRNA are indicated at left of panel C. Plot of the first-order decay of plasmid-encoded rpsT versus time. Symbols used for each rpsTmRNA are indicated in panel B. Note, the zero time point sample of RNA isolated from MG1693 harbouring pKEB148 was considerably degraded, and was not included in the analysis. 160 A G G A G C G C C G C G A U C G C G G C C G U A A U AUG C G A C G T 5' A UACQAUAUGGAACACAUUUGGGAGlUUGGACC UUG GCU AAU RBS pKEB148 - Increased translational efficiency <\ UACCAUAUGG UUUGAAUUGUCC Sequence absent in 5' deletion c Time (min) 161 stable recombinant rpsT mRNA. 5.3 DISCUSSION While the role(s) of translation in mediating regulation of mRNA stability is not fully understood, ribosomes usually serve to protect E. coli mRNAs from decay initiated by RNase E (Petersen, 1993). Currently, the best mechanism proposed for translation-mediated protection of mRNA occurs through the direct shielding of rate-limiting endonucleolytic cleavage sites from RNase E by ribosomes, elegantly demonstrated for rpsO mRNA in E. coli (Braun et al, 1998; Figure 1.8 B). However, additional mechanisms have been suggested for the function of ribosomes in stabilizing, or destabilizing, mRNA (Petersen, 1993; Rapaport and Mackie, 1994; Loomis et al, 2001). The lack of intimate knowledge regarding RNA secondary structure, the mechanism of mRNA degradation, and the precise location of critical RNase E cleavage sites for many mRNA substrates has compromised attempts to correlate mRNA stability with data accumulated through modulation of translational efficiency or stop codon position. The extensive characterization of rpsT mRNA expression, regulation, and decay makes this mRNA a useful substrate for a systematic evaluation of the influence of translation on stability, and, in fact, it has been the focus of an earlier in vivo study (Rapaport and Mackie, 1994). 5.3.1 A 5'-terminal stem-loop stabilizes rpsT mRNA only when coupled with efficient translation The direct correlation demonstrated here between the stability of 5' stem-loop-protected rpsTmRNA and the predicted efficiency of translational initiation establishes that in the absence of efficient translation, a stable stem-loop structure placed at the 5' terminus of rpsTmRNA is not 162 sufficient to stabilize the chimeric mRNA (Section 5.2.1; Table 5.1, entries 2 and 3). These findings are consistent with those for lacZ mRNA; stem-loop-protected lacZ mRNA is no longer stabilized against RNase E-mediated decay in the absence of translation (Lopez and Dreyfus, 1996; Joyce and Dreyfus, 1998). Therefore, while RNase E displays a strong 5'-end dependence (Mackie, 1998), a 5* terminal stem-loop does not, alone, act as a barrier to initiating events in mRNA decay. In contrast, when efficiently translated, rpsT{\44) mRNA (AUG initiation codon) displayed greatly increased stability, and decayed with an extraordinary half-life approaching 30 minutes (Table 5.1; entry 4). We have proposed that RNase E must initiate degradation of stem-loop-protected (and circular) rpsTmRNA by a 'internal' entry mechanism by which RNase E bypasses its preferred interaction with the 5' terminus of its substrate. A direct implication of these findings is that ribosomes protect rpsT mRNA possessing a terminal stem-loop by blocking endonucleolytic cleavage by RNase E involved in an internal pathway of decay. A stable stem-loop fused to the 5' end of rpsT( 122) mRNA, deleted for 12 nucleotides at the 5' terminus, was unable to stabilize the chimeric mRNA (see Section 3.2.6). However, mutation of the inefficient UUG translational initiation codon (to AUG) effectively rescued the mRNA from decay, as rpsT(\48) mRNA displayed a half-life of 15 min (Table 5.1, entry 12 versus 13). One possible interpretation of these findings is that rpsT(122) mRNA instability was a consequence of inefficient translation. The juxtaposition of the stem-loop structure in rpsT{\22) mRNA close to sequences important for ribosome binding may have precluded efficient translation initiation from the UUG start codon. The increase in translational initiation from rpsT(\4%) mRNA as a consequence of the AUG start codon was sufficient to overcome the postulated steric obstacle presented by the 5'-proximal stem-loop. These data further demonstrate a role not only for a 51 hairpin, but also for efficient translation in the stabilization of the 163 Table 5.1 Influence of Translation Initiation or Elongation on the Half-lives of Recombinant rpsT mRNA in Escherichia coli. Entry* Plasmid Insert elementb Recombinant mRNA feature Half-life (min)c Length (nt) Tin feature11 1 N A N A PI (447) U U G 1.5* P2 (356) U U G 2.0 2 p K E B H O N A 388 U U G 12 ± 2 3 pKEB143 N A 388 -3,-4 1.5 ±0 .2 4 pKEB144 N A 388 A U G >25 5 pKEB136 N A 389 Stop @ 285 nt 2.0 ±0 .5 6 pKEB147 N A 388 Stop @ 337 nt 7.0 ± 1.5 7 pKEB138 rne; +; ORF 403 U U G 2.5 ±0.5 8 pKEB145 rne; +; ORF 403 -3,-4 1.5 ±0 .5 9 pKEB146 rne; +; ORF 403 A U G 15 ± 1 10 pKEB161 9Sa; +; 5' UTR 403 A U G 5 11 pKEB162 9 S a ; - ; 5 ' U T R 403 A U G 2 12 pKEB122 5'Al2nt 366 U U G 1 13 pKEB148 5'Al2nt 366 A U G 15 "mRNAs encoded by D N A listed in entries 2 through 13 possess a 5'-terminal stem-loop (see Figure 5.1). bInsert elements refers to the source of the RNase E 'portable' cleavage sequences present within the coding region (ORF) or the 5' leader (5' UTR) within the stem-loop-protected rpsT mRNA in the native (+) or reverse-complement (-) orientation. A 5' truncation of the rpsT mRNA is also indicated (5' Al2nt). cHalf-life values given with a standard deviation represent the average of at least 4 trials (additional half-life values represent a single experimental value selected from one of at least 2 trials. d U U G , wild-type translational initiation sequence; A U G , mutation increasing translational initiation; -3,-4, mutation decreasing translation initiation; Stop, position of the premature stop coding (nucleotide positions based on numbering used in Mackie, 1992). 'Chromosomally-encoded rpsTmRNA half-life in wildtype E. coli cells (Mackie, 1987). 164 recombinant rpsT mRNAs against RNase E-mediated decay. Based primarily on rpsO mRNA stabilization through ribosomal masking of the rate-limiting RNase E cleavage site (Braun et al, 1998), it was hypothesized that the modulation of RNA protection observed for stem-loop-protected rpsT mRNA by translation was due to ribosome masking of the rate-limiting cleavage site at residues 300 and 301 of rpsTmRNA. The stability of rpsTmRNA possessing a premature stop codon 36 nucleotides downstream, but not 16 nucleotides upstream, of the position of the 300,301 RNase E cleavage site supports this hypothesis (Table 5.1, entries 5 and 6). The demonstration that ribosome protection extends 15 nucleotides downstream of the first nucleotide of the codon in its P site (Steitz, 1969) suggests that 4 or 5 residues upstream of the 300,301 region in rps7"(136) mRNA would be accessible for RNase E recognition and cleavage. However, the instability observed for rpsr(136) mRNA does not establish unambiguously that nucleotide substitutions introduced during construction of pKEB136 (i.e. the Xhol site) did not contribute to the reduced longevity of the message. Notwithstanding, the changes to the rpsT mRNA sequence are not predicted to alter the mRNA secondary structure, and do not resemble characterized RNase E cleavage consensus sites (Mackie, 1991; Ehretsmann et al, 1992). It is recognized, however, that direct introduction of a termination codon 16 residues upstream of the 300,301 region by site-directed mutagenesis would have avoided the introduction of the Xhol restriction site (Figure 5.3) and clarified the impact of the RNase E site on mRNA stability while removing the possibility of an influence of the nucleotide changes on mRNA stability. In addition, a stop codon introduced only 10 or 11 residues upstream of the 300,301 nucleotides which would be predicted to allow ribosome protection of the rate-limiting cleavage site, would have offered a design to provide further evaluate ribosome masking of nucleotides 300,301 during rpsTmRNA degradation. 165 While the introduction of a premature stop codon at residue 269 led to a 6-fold reduction in mRNA stability, Northern blot analysis of rpsT(\47) mRNA demonstrated that a premature stop at nucleotide position 337 resulted in only a 2-fold reduction in stability relative to rpsT(\ 10) mRNA (Table 5.1, entries 6 versus 2). The reduction in mRNA half-life for rpsT{\41) may be a consequence of temporary ribosome stalling at the premature stop codon at residue 337 leading to disruption of downstream secondary structure in the rpsT mRNA (stems V and VI, Figure 5.3 A; also see Mackie, 1992) and subsequent exposure of previously duplexed residues to the decay machinery. The demonstration that ribosome movement past the region encoding the rate-determining RNase E cleavage site rather than efficient translational initiation per se is required for mRNA stabilization differs from that observed by Rapaport and Mackie (1994), who reported that a termination signal introduced at codon 15 had no significant influence on rpsT mRNA stability. The mechanisms of degradation for rpsT and stem-loop protected rpsT mRNA are presumably disparate due to differential accessibility to the 5' terminal nucleotide and may explain this difference in experimental data. In addition, the study was based on steady state RNA values (rather than half-life determinations) accumulated from an expression system in which gene dosage was much higher and where expression of rpsT mRNAs could not be regulated as tightly as in the present work (Mackie, 1987). In considering the obvious influence of S20 production on rpsTmRNA stability, steady state RNA levels may not truly reflect the influence of translation on mRNA stability, and the influence of a stop codon at position 15 should, therefore, be reexamined. At least for stem-loop-protected rpsT'mRNA, masking of the rate-limiting cleavage site by ribosomes better explains the correlation between translational and mRNA stability than a model involving competition between initial translation events and recognition of the 5' end of 166 rpsT mRNA by RNase E. The modulation of mRNA stabilization by translation initiation efficiency and extent of ribosome movement along the rpsT mRNA strongly supports the role of ribosomes in masking RNase E recognition and cleavage at the rate-limiting cleavage site at nucleotide position 300,301. For translational masking to occur, ribosomes must sterically hinder RNase E at the rate-determining cleavage site, regardless of the location of the site within the mRNA. Consistent with this postulate, ribosome translocation to the termination codon is necessary to stabilize the rpsO mRNA since the rate-determining RNase E cleavage site occurs within the 3' UTR, 10 residues downstream of the coding region (Braun et al, 1998). For ompA mRNA, binding of a 30S ribosomal subunit precludes an initiating RNase E cleavage within the 5* UTR (Vytvytska et al, 2000). The presence of the rate-limiting RNase E cleavage site within the 5' UTR explains why high efficiency of 3OS binding (through high complementary between 16S rRNA and the Shine-Dalgarno sequence) but only occasional ribosome translocation along the ORF is crucial for ompA mRNA stability (Arnold etal, 1998). Interestingly, competition between 30S binding and the binding of the growth-rate regulated protein, Hfq, to the 5' UTR leads to reduced translational initiation facilitating RNase E cleavage and rapid ompA mRNA decay (Vytvytska et al, 1998; Vytvytska etal, 2000; Figure 1.7). Although the location of the rate-determining RNase E cleavage sites within ompA and rpsT mRNAs differ, Hfq and S20 protein binding to their respective mRNAs may act in a similar manner to regulate translational initiation and thereby modulate mRNA longevity. 167 5.3.2 The efficiency of'portable' cleavage sites to destabilize rpsTmRNA is sensitive to translation The data support the model that the destabilizing influence of the 'portable' cleavage sequence present in the rpsT mRNA coding region can be modulated by the efficiency of translation (Figure 5.6). For example, an increase in translational efficiency predicted from the introduction of the AUG initiation codon led to a 6-fold stabilization of rpsT( 146) mRNA (Table 5.1, entry 7 versus 9). In contrast, mRNA destabilization by a 'portable' site present in the 5' UTR of the recombinant rpsT mRNA was less sensitive to an increases in translation initiation frequency (Figure 5.7; Table 5.1, entries 10 and 11). It has been put forth that the ability of the 'portable' RNase E cleavage sequence to bypass the influence of a 5-terminal stem-loop may occur by providing an efficient internal entry site for mRNA recognition and cleavage by RNase E (discussed in Section 4.3). Masking of efficient internal entry by ribosome movement would be anticipated to inhibit RNase E recognition and cleavage at the 'portable' site. These data demonstrating the greater influence of translation on mRNA destabilization by a 'portable' cleavage site present in the ORF verus the 5* UTR support this expectation. However, the two-fold mRNA stabilization observed for both rpsT(\6\) and rpsT( 162) mRNAs may represent some level of'masking', through competition between RNase E recognition of the 'portable' site within the 5' UTR and efficient translational initiation at the AUG codon by ribosomes. The stability of stem-loop-protected rpsT mRNA predicted to be more efficiently translated (i.e. AUG initiation codon) was greater in the absence of a 'portable' RNase E cleavage site (Table 5.1, compare entries 4 versus 9-11). Thus, it can be envisioned that even in the presence of characterized RNase E cleavage sites such as the 300,301 sites, the rpsT mRNAs harbouring a 'portable' cleavage sequence possess a c/s-acting determinant which mediates more 168 efficient bypass of the 5-protected terminus of the mRNA by RNase E which leads to more rapid mRNA decay. Several lines of evidence suggest that a 'portable' cleavage site provides such a determinant to decay (discussed in Section 4.3), and that the context of the RNase E site within the 'portable' sequence is efficiently recognized than the characterized sites within the native rpsT mRNA. For example, rpsT(\A6) mRNA (possessing the me 'portable' sequence in the ORF) was approximately 2-fold less stable than rpsT(\ 10) mRNA, both of which harbour the rate-deterimining RNase E cleavage site at residues 300,301. It is not unanticipated that RNase E cleavage sites span a continuum of efficiencies, as determinants of cleavage site efficiency have been shown to encompass primary sequence (Mackie, 1991; Ehretsmann et al, 1992; McDowall etal, 1994). 5.3.3 Modulation of translational repression influences the biphasic decay kinetics observed for recombinant rpsT mRNAs The predicted 2.5-fold increase in translation initiation efficiency of rpsT(\AA) mRNA led both to two-fold stabilization of the mRNA and a lag in the second phase of the biphasic decay kinetics observed for many of the stable recombinant rpsTmRNA studied during the course of this work (Figure 5.2 C). The direct cause underlying the observed biphasic decay kinetics, and particularly the observed lag in the appearance of the more rapid decay phase for rpsT(\AA) mRNA, remains experimentally undetermined. A potential source of the lag could be related to the observation that the UUG to AUG mutation of the rpsT initiation codon introduced into pKEB144 has been previously shown to reduce, but not eliminate, autogenous repression of rpsT expression by S20 (Parsons et al, 1988). The greater efficiency of translation initiation from the AUG start codon is postulated to shift the competition between repression (S20 binding) and 169 translation initiation (ribosome binding) in favour of the latter. Consequently, a higher level of S20 protein accumulation would be needed to achieve translation repression and, accordingly, the rapid phase of rpsT(l44) mRNA decay would be delayed, as was observed. 170 CHAPTER SIX P E R S P E C T I V E A N O V E L PATHWAY FOR R N A S E E-INITIATED D E C A Y OF 5 '-PROTECTED M R N A IN ESCHERICHIA COLI 6.1 STABILIZATION OF RPSTMRNA BY A 5' TERMINAL STEM-LOOP REQUIRES EFFICIENT TRANSLATION Several natural and heterologous mRNAs in E. coli are stabilized by 5'-terminal hairpins, but how these structures confer relative resistance against degradation by RNase E or an alternative decay pathway has not been clearly established (Arnold et al, 1998 and references therein). The data presented here establish that the well characterized rpsTmRNA can be stabilized by a prosthetic stem-loop at its extreme 5' terminus and that RNase E is required for degradation of the chimeric mRNA. The 6-fold stabilization of rpsT{\ 10) mRNA by the terminal stem-loop is quantitatively comparable to that observed for circular rpsT mRNA compared to its linear counterpart in vivo (Mackie, 2000). The inaccessibility of a 5' terminus in both the circular and stem-loop-protected rpsT mRNA implies that RNase E-mediated decay of these substrates must initiate by a mechanism in which RNase E bypasses its preferred interaction with the 5' end and interacts 'internally' with the mRNA. This work has further demonstrated a positive correlation between the efficiency of translational initiation and the extent of stabilization of rpsT'mRNA by the protective stem-loop. A predicted increase in translation efficiency by replacing the native UUG initiation codon with AUG led to over 2-fold further stabilization of rpsT mRNA, while reducing translation initiation effectively abrogated any stabilizing influence afforded by the 5' terminal structure. The 171 requirement for translation demonstrates that a stable, 5'-protective stem-loop is, alone, insufficient to confer stability on the chimeric rpsTmRNA. Moreover, passage of ribosomes through an efficient site for RNase E cleavage within the rpsT coding region (i.e. residues 300/301), was also required for the protective effect of the terminal stem-loop. These data suggest that ribosomes act to sterically to inhibit a decay-initiating RNase E cleavage at residues 300/301 within the rpsTmRNA. Predictably, the efficiency of ribosomal masking would depend on a threshold level of ribosome loading and spacing along the ORF for the protective effect. In this regard, the -3,-4 mutation in the rpsT mRNA permits limited translation along the entire message (Parsons et al, 1988), but presumably the ribosome loading was below the minimum threshold required for stabilization of rpsT(\ 10) mRNA in vivo. 6.2 ' P O R T A B L E ' R N A S E E C L E A V A G E SITES PROMOTE EFFICIENT BYPASS OF 5' STEM-LOOPS TO DESTABILIZE M R N A The introduction of small, efficient RNase E cleavage-site sequences into the 5' UTR or ORF of rpsT mRNA demonstrates that a defined RNA element can promote mRNA decay and override the protective influence of a 5' stem-loop. Key features of the 'portable' cleavage sites characterized in this study include the presence of a 'consensus' RNase E cleavage sequence and single-strandedness. Cleavage mapping data indicated that the rne and 9Sa 'portable' sites function as direct targets for RNase E cleavage events. Moreover, the insertions do not operate through simple size expansion or structural changes to the 5' UTR of the target RNA. Care is required, however, in the design of'portable' cleavage sites, particularly to avoid alternative secondary structures which might preclude endonucleolytic cleavage or translation. The 9Sa 'portable' cleavage insert promoted RNase E-dependent mRNA destabilization to 172 a different extent depending on its orientation, presumably due to the differential recognition of primary sequences at the cleavage site by RNase E. Moreover, the efficiency of a 'portable' cleavage site depended on its position within the targeted mRNA. In particular, mRNA destabilization by a 'portable' cleavage site was more effective when positioned within the 5' UTR of rpsTmRNA than in the ORF. Consistent with transient masking of 'portable' cleavage site recognition by translating ribosomes, the efficiency of the 'portable' site located in the ORF was more sensitive to increased translational initiation. 6.3 HIERARCHICAL MODEL FOR RNASE E ACTION ON M R N A S The protective effect of 5' stem-loops, their enhanced 'bypass' by 'portable' RNase E cleavages sites and the effect of translation on mRNA stability can be explained by bimodal recognition of mRNA by RNase E involving either an mRNA's 5' end or an internal entry mechanism. The 5'-end dependence of RNase E is manifested through a hierarchy of efficiencies with which RNase E recognizes its RNA substrates through their 5' termini. RNAs with 5'-monophosphorylated termini, such as 9S rRNA and RNase E-catalyzed endonucleolytic cleavage products, are highly effective substrates for RNase E, being cleaved 25-fold faster than their triphosphorylated counterparts (Mackie, 1998; Spickler et al, 2001; Walsh et al, 2001). The strong preference of RNase E for 5'-monophosphorylated substrates, through a putative phosphate binding pocket, efficiently tethers the enzyme to its substrate. The unimolecular enzyme-RNA complex then rearranges by looping to facilitate endonucleolytic cleavage at a favourable downstream site (Coburn and Mackie, 1999; Spickler et al, 2001). The strong preference of RNase E for 5'-monophosphorylated substrates provides a mechanism to enhance processivity of mRNA decay and has been proposed to explain 5' - 3' vectoral decay. In addition, 173 the kinetic preference for an mRNA that has been previously cleaved rationalizes the phenomena of'all-or-none' decay (Mackie, 1998). An accessible, triphosphorylated, 5' terminal residue, as is present in native mRNAs in vivo, represents the next preferred substrate for RNase E. The interaction between RNase E and the 5' terminus of a triphosphorylated substrate, presumably through the same 'pocket' as for monophosphates (but with lower efficiency), weakly tethers the endonuclease to the RNA (Figure 6.1 A). As would occur with RNase E tethered to a monophosphorylated substrate, the unimolecular complex rearranges by looping to facilitate endonucleolytic cleavage at a favourable downstream site. The slowest rate of substrate recognition is observed on stem-loop-protected and circular mRNAs when the 5' terminus of the mRNA is sequestered, precluding interaction with the 5'-triphosphate and adjacent residues (Figure 6.1 B). The stabilization of rpsTmRNA by a stem-loop confirms that single-stranded, triphosphorylated 5' terminus of native rpsrmRNA actually facilitates an interaction with a subunit of RNase E, alone or within the RNA degradosome (Mackie, 1998; Spickler et al, 2001). Therefore, in contrast to a previous suggestion that accessible, triphosphorylated mRNAs are not recognized by RNase E (Jiang et al, 2000), we propose that a triphosphate moiety facilitates decay, and that initiation of mRNA decay by RNase E through 5' end-independent recognition of the mRNA accurately represents the true basal rate of RNase E cleavage. Although circular and stem-loop-protected RNAs are significantly stabilized, RNase E can initiate their degradation by bypassing the 5' end of the mRNA to interact 'internally' with a cleavage site (Figure 6.1 B). The efficiency of internal entry is determined primarily by the intrinsic susceptibility of the raterlimiting cleavage site alone, as has been demonstrated by the different stabilities observed for mRNAs possessing endogenous versus 'portable' RNase E 174 A Tethered Initial Cleavage o o o B Internal Initial Cleavage Figure 6.1 A Bi modal Model for RNase E-mediated Cleavage of RNA. The RNA degradosome is depicted according to Vanzo et al. (1998; Figure 1.3). The endonucleolytic catalytic site and a putative phosphate binding pocket are shown as separate sites (oval and round cutouts, respectively). A. Looping by RNase E from an accessible 5' end. Interaction between the phosphate binding pocket of RNase E with a single-stranded 5'-triphosphorylated terminus (black oval) would weakly tether the RNA degradosome to its substrate. Looping of the mRNA-enzyme complex facilitates recognition of a downstream cleavage site (hatched box) followed by rapid endonucleolytic cleavage (wide curved arrow). B. Internal entry by RNase E into a 5'-stem-loop-protected mRNA. Interaction between the 5' terminus of an mRNA is precluded by the duplex structure. Recognition of a cleavage site by RNase E requires bypass of the 5' terminus through a slow internal interaction (thin curved arrow). The efficiency of internal entry is dependent on the efficiency of recognition of the internal cleavage site. An intermediate binding step, not to the 5' terminus, could precede the actual cleavage (see text). 175 cleavage sites. Therefore, the data presented here show that there are two key determinants of RNase E action on the rpsTmRNA and, by implication, on other targets for RNase E. The first of these is the status of the 5' end which defines the three level hierarchy of efficiencies (discussed above). The second determinant is the cleavage site itself. Potential cleavage sites span a continuum of efficiencies, ranging from ineffective (e.g. the rne leader 'portable' sequence in the reverse-complement orientation), to those more efficient than the characterized sites in the rpsT mRNA (i.e. the 9Sa 'portable' cleavage sequences). Consistent with this concept, determinants of cleavage site efficiency are known to encompass primary sequence (Mackie, 1991; Ehrsetsmann et al, 1992; McDowall et al, 1994), position relative to secondary structure (Ehretsmann et al, 1992; Mackie, 1992; Cormack and Mackie, 1992, McDowall etal, 1995), masking by ribosomes (Braun et al, 1998), and the presence of RNA binding proteins (Jerome et al, 1999; Vytvytska et al, 2000). The models presented in Figure 6.1 do not preclude initiation of decay of an mRNA possessing an accessible 5-triphosphorylated terminus by a 'internal' entry mechanism. Bypass of a 5-triphosphorylated residue would, however, be predicted to occur only when a bimolecular reaction is very rapid, such as when cleavage sites are readily identifiable, and a unimolecular reaction through tethering of RNase E to the substrate is not required for efficient recognition and cleavage. In contrast, the highly efficient recognition of monophosphorylated substrates by RNase E would predict that a 'internal' entry mechanism for the decay of these RNAs is not required, or utilized. Finally, a slight modification of the 'internal' entry model would involve RNase E initially contacting a 'docking' site in the interior of an mRNA, then migrating or looping to the actual cleavage site. The data presented by Diwa et al. (2000) showing the importance of hairpin 2 within the rne 5' UTR (Figure 4.1) for autoregulation are consistent with 176 such an idea. However, the data for chimeric rpsT mRNA presented in this thesis can be explained without this added feature. 6.4 I S T H E A R G I N I N E - R I C H R N A B I N D I N G D O M A I N O F R N A S E E I N V O L V E D I N RPSTMRNA D E C A Y B Y I N T E R N A L E N T R Y ? The endonucleolytic activity of RNase E is carried by the N-terminal 'half of the protein, while the central and C-terminal domains contain the arginine-rich RNA binding domain (AR-RBD) and provide a scaffold for degradosome assembly, respectively (Vanzo et al, 1998; Figure 1.2). Moreover, the sensitivity to mono- versus tri-phosphorylated substrates is an intrinsic property of the N-terminal catalytic domain of RNase E , and does not require the central or C-terminal domains of the protein (Jiang et al, 2000). Recently, several reports have implicated the AR-RBD of RNase E in particular activities involving RNA decay. The C-terminal portion of RNase E , including the AR-RBD, is required for the binding of RNase E to structured regions of 9S rRNA thereby facilitating efficient cleavage of the substrate in vitro at the 'b' cleavage site (Kaberdin et al, 2000). These authors suggest that the AR-RBD recruits RNase E to structured RNAs and counteracts the inhibitory effects of a sub-optimal cleavage site sequence. Moreover, additional contacts with the substrate by RNase E through the AR-RBD were predicted to be essential for efficient cleavage of an RNA. In support of the latter concept, a deletion of the C-terminal 477 amino acids (including the AR-RBD) from RNase E leads to an approximate 2-fold stabilization of both bulk and individual mRNAs (Lopez et al, 1999; Ow et al, 2000). Interestingly, rRNA processing and cell growth remain unaffected in this mutant. Thus, the C-terminal portion of RNase E, including the AR-RBD, appears to facilitate degradation of mRNAs but is dispensable for processing rRNA. It is important to reiterate that a major difference 177 between these two substrates is the status of their 5' termini in vivo; mRNA 5' termini are triphosphorylated while 9S rRNA, created through RNase Ill-mediated processing, is monophosphorylated. A smaller C-terminal deletion of RNase E that retains the AR-RBD but eliminates the 'scaffold' domain does not impair mRNA decay, implying that assembly of all the components of the degradosome into a complete complex is not required for normal mRNA decay (Ow et al, 2000). However, a deletion of the AR-RBD alone (internal deletion of 91 amino acids) led to a slight impairment of mRNA decay and a loss of rne mRNA autoregulation by RNase E (Ow et al, 2000). Considering the requirement for a conserved hairpin structure within the rne leader for RNase E-mediated autoregulation, these data suggest that substrates which presumably follow an internal entry pathway appear to require the AR-RBD for efficient cleavage. If the RNase E AR-RBD is, indeed, required for efficient substrate recognition by mediating RNA interactions independent of the 5' terminus, it is reasonable to suspect that this domain may play a role in the decay of stem-loop-protected rpsT mRNA by internal entry (Figure 6.2). Whether the AR-RBD of RNase E is interacting specifically with a structural element within the mRNA (such as the 5'-terminal stem-loop) or non-specifically within internal regions of the mRNA is unknown. The 2-fold stabilization of bulk mRNA in cells expressing RNase E lacking the AR-RBD suggests that internal entry is, in fact, a mechanism for mRNA decay even when 5'-triphosphorylated termini are available. Despite this, the maintenance of wild-type rates of rRNA processing suggests that monophosphorylated RNA substrates are kinetically more favoured and that a 'internal' entry mechanism employing the AR-RBD of RNase E does not readily occur after an initial cleavage. Experiments to evaluate a role for the RNase E AR-RBD in a internal entry mechanism of RNase E-mediated decay have been initiated. A strain isogenic to MG1693 used in this study, KBC1008 (Table 2.1), has been constructed which harbours the rne-131 allele, and 178 Figure 6.2 RNase E-Substrate Interaction Through Either a Putative Phosphate Binding Pocket or the AR-RBD. A. RNase E, either alone, or within the RNA degradosome (shown), can interact specifically with an accessible 5'-triphosphorylated RNA substrate through a putative phosphate-binding pocket. B and C. Interaction between RNase E and an RNA substrate through the AR-RBD (black half ovals). Whether the AR-RBD may be involved in nonspecific RNA interactions (B) or in cleavage site recognition (C) is unknown. Components of the degradosome are represented as in Figure 6.1. 179 Western blot analysis has determined that it expresses an RNase E polypeptide whose size is consistent with the deletion of the C-terminal 477 amino acids (Kido et al, 1996; Lopez et al, 1999). Experiments to evaluate the kinetics of decay of circular and stem-loop-protected rpsT mRNA in KBC 1008 are underway. In the future, it can be anticipated that mutational and structural analysis of RNase E will pinpoint the identities of the putative phosphate binding pocket and the active site in RNase E. In turn, such information will permit a more detailed elaboration of the models in Figure 6.1 and 6.2. Ultimately it should be possible to predict the contribution of such domains in RNase E to its activity towards a given RNA and rationally predict the stability of any mRNA. 180 REFERENCES Agaisse,H. and Lereclus,D. (1996) STAB-SD: a Shine-Dalgarno sequence in the 5' untranslated region is a determinant of stability. Mol. Microbiol, 20, 633-643. Apirion,D. (1973) Degradation of RNA in Escherichia coli. A hypothesis. Mol. Gen. Genet, 122, 313-322. Arnold,T.E., Yu,J. and Belasco,J.G. (1998) mRNA stabilization by the ompA 5' untranslated region: Two protective elements hinder distinct pathways for mRNA degradation. RNA, 4, 319-330. Arraiano,C.M., Yancey,S.D. and Kushner,S.R. (1988) Stabilization of discrete mRNA breakdown products in ams pnp rnb multiple mutants of Escherichia coli K-12. J. Bacteriol, 170, 4625-4633. Babitzke,P., Granger,L., Olszewski,! and Kushner,S.R. (1993) Analysis of mRNA decay and rRNA processing in Escherichia coli multiple mutants carrying a deletion in RNase III. J. Bacteriol, 175, 229-239. Bass,B.L. (2000) Double-stranded RNA as a template for gene silencing. Cell, 101, 235-238. Bechhofer,D. (1993) 5' mRNA stabilizers. In Belasco,J.G. and Brawerman,G. (eds), Control of Messenger RNA Stability. Academic Press Inc., New York, pp. 31-52. Belasco,J.G., Beatty,J.T., Adams,C.W., von Gabain,A. and Cohen,S.N. (1985) Differential expression of photosynthetic genes mR. capsulata results from segmental differences in stability within the polycistronic rxcA transcript. Cell, 40, 171-181. Belasco,J.G., Nilsson,G., von Gabain,A. and Cohen,S.N. (1986) The stability of E. coli gene transcript is dependent on determinants localized to specific mRNA segments. Cell, 46, 245-251. Belasco.J.G. and Higgins,C.F. (1988) Mechanisms of mRNA decay in bacteria: a perspective. Gene, 72, 15-23. 181 Beran,R.K., Prud'homme-Genereux,A., Baker.K.E., Miao.X., Simons,R.W., and Mackie,G.A. (2002, in press) mRNA decay in Escherichia coli: enzymes, mechanisms and adaptation. In Lapointe,J. and Brakier-Gingras,L. (eds) Translation mechanisms. Landes Bioscience Molecular Biology Intelligence Unit, Chapter 9. Bernstein,E., Denli,A.M. and Hannon,G.J. (2001) The rest is silence. RNA, 1, 1509-1521. Bertani,G. (1951) Studies on lysogenesis. I The mode of phage liberation by lysogenic Escherichia coli. J. Bacteriol, 62, 293-300. Bilge,S.S., Apostol Jr.,J.M., Aldape,M.A. and Moseley,S.L. (1993) mRNA processing independent of RNase III and RNase E in the expression of the F1845 fimbrial adhesion of Escherichia coli. Proc. Natl. Acad. Sci. USA, 90, 1455-1459. Blum,E., Py,B., Carpousis,AJ. and Higgins,C.F. (1997) Polyphosphate kinase is a component of the Escherichia coli degradosome. Mol. Microbiol, 26, 387-398. Bouvet,P. and Belasco,J.G. (1992) Control of RNase E-mediated RNA degradation by 5'-terminal base pairing mE. coli. Nature, 360, 488-491. Braun,F., Le Derout,J. and Regnier,P. (1998) Ribosomes inhibit an RNase E cleavage which induces the decay of the rpsO mRNA of Escherichia coli. EMBO d., 17, 4790-4797. Brenner, S. and Beckwith,J.R. (1965) Ochre mutants, a new class of suppressive nonsense mutants. J. Mol Biol, 13, 629-6397. Brot,N, Caldwell,P. and Weissback,H. (1980) Autogenous control of Escherichia coli ribosomal protein L10 synthesis in vitro. Proc. Natl Acad. Sci. USA, 11, 2592-2595. Bustos,S.A. and Schleif,R.F. (1993) Functional domains of the AraC protein. Proc. Natl. Acad. Sci. U.S.A., 90, 5638-5642. Cao,G.J. and Sarkar,N. (1992) Identification of the gene for an Escherichia coli poly(A) polymerase. Proc. Natl Acad. Sci. USA, 89,10380-10384. Carpousis,A.J., Van Houwe,G., Ehretsmann,C. and Krisch,H.M. (1994) Copurification ofE. coli 182 RNase E and PNPase: evidence for a specific association between two enzymes important in RNA processing and degradation. Cell, 76, 889-900. Carpousis,A.J., Vanzo,N.F. and Raynal,L.C. (1999) mRNA degradation. A tale of poly(A) and multiprotein machines. Trends Genet., 15, 24-28. Carra,J.H. and Schleif,R.F. (1993) Variation of half-site organization and DNA looping by AraC protein. EMBOJ., 12, 35-44. Carthew,R.W. (2001) Gene silencing by double-stranded RNA. Curr. Opin. Cell Biol, 13, 244-248. Case,C.C, Simons,E.L. and Simons,R.W. (1990) The IS70 transposase mRNA is destabilized during antisense control. EMBOJ:, 9, 1259-1266. 8 Chang,A.C.Y. and Cohen,S.N. (1978) Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J. Bacteriol, 134, 1141-1156. Chen,C.Y. and Belasco,J.G. (1990) Degradation ofpuJLMXmRNA in Rhodobacter capsulatus is initiated by nonrandom endonucleolytic cleavage. J. Bacteriol, 111, 4578-4586. Cheng,Z-F, Zuo,Y., Li,Z., Rudd,K.E., Deutscher,M.P. (1998) The vacB gene required for virulence in Shigella flexneri and Escherichia coli encodes the exoribonuclease RNase R. J. Biol. Chem., 273, 14077-14080. Cho,K.O. and Yanofsky,C. (1988) Sequence changes preceding a Shine-Dalgarno region influence trpE mRNA translation and decay. J. Mol. Biol, 204, 51-60. Coburn,G.A. and Mackie,G.A. (1996a) Overexpression, purification, and properties of Escherichia coli ribonuclease II. J. Biol. Chem., 271, 1048-1053. Coburn, G.A. and Mackie, G.A. (1996b) Differential sensitivities of portions of the mRNA for ribosomal protein S20 to 3'-exonucleases dependent on oligoadenylation and RNA secondary structure. J. Biol Chem., Ill, 15776-15781. Coburn,G.A. and Mackie, G.A. (1998) Reconstitution of the degradation of the mRNA for 183 ribosomal protein S20 with purified enzymes. J. Mol. Biol, 279, 1061-1074. Coburn, G.A. and Mackie,G.A. (1999) Degradation of mRNA in Escherichia coli: an old problem with some new twists. Prog. Nucl Acid Res. Mol. Biol., 62, 55-108. Coburn, G.A., Miao.X., Briant,D.J. and Mackie, G.A. (1999) Reconstitution of a minimal R N A degradosome demonstrates functional coordination between a 3'-exonuclease and a DEAD-box R N A helicase. Genes Dev., 13, 2594-2603. Cohen,S.N., Chang,A.C.Y. and Hsu,L. (1972) Nonchromosomal antibiotic resistance in bacteria: Genetic transformation of Escherichia coli by R-factor DNA. Proc. Natl. Acad. Sci. U.S.A., 69, 2110-2116. Cohen,S.N. and McDowall,K.J. (1997) RNase E: still a wonderfully mysterious enzyme. Mol. Microbiol., 23, 1099-1106. Cole, JR . and Nomura,M. (1986) Changes in the half-life of ribosomal protein messenger R N A caused by translational repression, d. Mol. Biol., 188, 383-392. Cormack, R.S. and Mackie, G.A. (1991) Mapping ribosomal protein S20-16S rRNA interactions by mutagenesis, d. Biol. Chem., 266, 18525-18529. Cormack,R.S. and Mackie,G.A. (1992) Structural requirements for the processing of Escherichia coli 5S ribosomal R N A by RNase E in vitro, d. Mol. Biol., 228, 1078-1090. Cormack,R.S., Genereaux,J.L. and Mackie,G.A. (1993) RNase E activity is conferred by a single polypeptide: overexpression, purification and properties of the amslrnelhmp-1 gene product. Proc. Natl. Acad. Sci. USA, 90, 9006-9010. Court,D. (1993) R N A processing and degradation by RNase III. In BelascoJ.G. and Brawerman,G. (eds) Control of Messenger RNA Stability. Academic Press Inc., New York, pp. 71-116. Danchin,A. (1996) mRNA turnover and D N A synthesis: a lesson from bacterial genome comparisons. Mol. Microbiol, 20, 895-900. 184 Dennis,P.P. and Nomura,M. (1975) Regulation of the expression of ribosomal protein genes in Escherichia coli. J. Mol. Biol, 97, 61-76. Deutscher,M.P. and Reuven,N.B. (1991) Enzymatic basis for hydrolytic versus phosphorolytic mRNA degradation in Escherichia coli and Bacillus suhtilis. Proc. Natl Acad. Sci. USA. 88, 3277-3280. Deutscher,M.P. and Li,Z. (2001) Exoribonucleases and their multiple roles in RNA metabolism. Prog. Nucl. Acid Res. Mol Biol, 66, 67-105. Diederich,L., Roth,A. and Messer,W. (1994) A versatile plasmid vector system for the regulated expression of genes in Escherichia coli. BioTechniques, 16, 916-923. Diwa,A., Bricker,A:L., Jain,C. and Belasco,J.G. (2000) An evolutionarily conserved RNA stem-loop functions as a sensor that directs feedback regulation of RNase E gene expression. Genes Dev., 14, 1249-1260. Donly, B.C. and Mackie, G.A. (1988) Affinities of ribosomal protein S20 and C-terminal deletion mutants for 16S rRNA and S20 mRNA. Nucl. Acids Res., 16, 997-1010. Donovan,W.P. and Kushner,S.R. (1986) Polynucleotide phosphorylase and ribonuclease II are required for cell viability and mRNA turnover in Escherichia coli K12. Proc. Natl Acad. Sci. USA, 83, 120-124. Ehretsmann,C.P., Carpousis,AJ. and Krisch,H.M. (1992) Specificity of Escherichia coli endoribonuclease RNase E: in vivo and in vitro analysis of mutants in a bacteriophage T4 mRNA processing site. Genes Dev., 6, 149-159. Emory,S.A: and Belasco,J.G. (1990) The ompA 5' untranslated RNA segment functions in Escherichia coli as a growth-rate-regulated mRNA stabilizer whose activity is unrelated to translational efficiency, d. Bacteriol, 111, 4472-4481. Emory,S.A., Bouvet,P. and Belasco,J.G. (1992) A 5'-terminal stem-loop structure can stabilize mRNA in Escherichia coli. Genes Dev., 6, 135-148. Fallon,A.M., Jinks,C.S., Strycharz,G.D. and Nomura,M. (1979) Regulation of ribosomal protein 185 synthesis in Escherichia coli by selective mRNA inactivation. Proc. Natl Acad. Sci. USA. 76:3411-3415. Franze de Fernandez,M.T., Eoyang,L. and AugustJ.T. (1968) Factor fraction required for the synthesis of bacteriophage QB-RNA. Nature, 219, 588-590. Georgellis,D.,Arvidson,S. and von Gabain,A. (1992) Decay of ompA mRNA and processing of 9S RNA are immediately affected by shifts in growth rate, but in opposite manners, d. Bacteriol., 174, 5382-5390. Georgellis,D., Sohlberg,B., Hartl,F.U. and von Gabain,A. (1995) Identification of GroEL as a constituent of an rnRNA-protection complex in Escherichia coli. Mol. Microbiol., 16, 1259-1268. Gerdes,K., Thisted,T. and Martinussen,J. (1990) Mechanism of post-segregational killing by the hok/sok system of plasmid Rl: sok antisense RNA regulates formation of a hok mRNA species correlated with killing of plasmid-free cells. Mol. Microbiol, 4, 1807-1818. Ghora,B.K. and Apirion.D. (1978) Structural analysis and in vitro processing to p5 rRNA of a 9S RNA molecule isolated from an rne mutant ofE. coli. Cell, 15, 1055-1066. Ghosh,S. and Deutscher,M.P. (1999) Oligoribonuclease is an essential component of the mRNA decay pathway. Proc Natl Acad. Sci. USA, 96, 4372-4377. Goodrich, A.F. and Steege,D.A. (1999) Roles of polyadenylation and nucleolytic cleavage in the filamentous phage mRNA processing and decay pathways in Escherichia coli. RNA, 5, 972-985. Greenblatt,J. and Schleif,R. (1971) Arabinose C protein: regulation of the arabinose operon in vitro. Nat. New. Biol, 6, 166-170. Grunberg-Manago,M. (1999) Messenger RNA stability and its role in control of gene expression in bacteria and phages. Annu. Rev. Genet., 33, 193-227. Guarneros,G. and Portier,C. (1991) Different specificities of ribonuclease II and polynucleotide phosphorylase in 3' mRNA decay. Biochimie, 73, 543-549. 186 Guzman,L-M., Belin,D., Carson,M.J. and Beckwith,J. (1995) Tight regulation, modulation, and high-level expression by vectors containing the arabinose P B A D promoter. J. Bacteriol., Ill, 4121-4130. HajnsdorfE., Steier,0., Coscoy,L., Teysset,L. and Regnier,P. (1994) Roles of RNase E , RNase II and PNPase in the degradation of the rpsO transcript of Escherichia coli: stabilizing function and evidence for efficient degradation in an ams-pnp-rnb mutant. EMBO J., 13, 3368-3377. Hansen,M.J., Chen,L-H., Fejzo,M.L.S. and BelascoJ.G. (1994) The ompA 5' untranslated region impedes a major pathway for mRNA degradation in Escherichia coli. Mol. Microbiol., 12, 707-716. Haugel-Nielsen,J., HajnsdorfE. and Regnier,P. (1996) The rpsO mRNA of Escherichia coli is polyadenylated at multiple sites resulting from endonucleolytic processing and exonucleolytic degradation. EMBOJ., 15, 3144-3152. Higgins,C.F., Peltz,S.W. and Jacobson,A. (1992) Turnover of mRNA in prokaryotes and lower eukaryotes. Curr. Opin. Genet. Dev., 2, 739-747. Hiraga,S. and Yanofsky,C. (1972) Hyper-labile messenger RNA in polar mutants of the tryptophan operon of Escherichia coli. J. Mol. Biol, 72, 103-110. Huang,H., Liao,J. And Cohen,S.N. (1998) Poly(A)- and poly(U)-specific RNA 3' tail shortening by is. coli ribonuclease E. Nature, 391, 99-102. Hue,K.K., Cohen,S.D. and Bechhofer,D.H. (1995) A polypurine sequence that acts as a 5' mRNA stabilizer in Bacillus subtillis. J. Bacteriol, 111, 3465-3471. Iost,I. and Dreyfus,M. (1995) The stability of Escherichia coli lacZ mRNA depends upon the simultaneity of its synthesis and translation. EMBO J., 14, 3252-3261. Ishihama,A. (2000) Functional modulation of Escherichia coli RNA polymerase. Annu. Rev. Microbiol, 54, 499-518. Jain,C. and Kleckner,N. (1993) IS70 mRNA stability and steady state levels in Escherichia coli: indirect effects of translation and role of rne function. Mol. Microbiol, 9, 233-247. 187 Jain,C. and Belasco,J.G. (1995) RNase E autoregulates its synthesis by controlling the degradation rate of its own mRNA in Escherichia coli: unusual sensitivity of the rne transcript to RNase E activity. Genes Dev., 9, 84-96. Jarrige,A.C, Mathy,N. and Portier,C. (2001) PNPase autocontrols its expression by degrading a double-stranded structure in the pnp mRNA leader. EMBO J., 20, 6845-6855. Jerome,L.J. and Frost,L.S. (1999) In vitro analysis of the interaction between the FinO protein and FinP antisense RNA of F-like conjugative plasmids. Biol. Chem., 274:10356-10362. Jerome,L.J., van Biesen,T., Frost,L.S. (1999) Degradation of FinP antisense RNA from F-like plasmids: the RNA binding protein, FinO, protects FinP from ribonuclease E. J. Mol. Biol., 285:1457-1473. Jiang,X., Diwa,A. and Belasco,J.G. (2000) Regions of RNase E important for 5'-end-dependent RNA cleavage and autoregulated synthesis. J. Bacteriol., 182, 2468-2475. Johnson,C.M. and Schleif,R.F. (1995) In vivo induction kinetics of the arabinose promoters in Escherichia coli. J. Bacteriol., Ill, 3438-3442. Johnson,M.D., Popowski,J., Cao,G.J., Shen,P. and Sarkaf,N. (1998) Bacteriophage T7 mRNA is polyadenylated. Mol. Microbiol., 21, 23-30. Joyce, S.A. and Dreyfus,M. (1998) In the absence of translation, RNase E can bypass 5' mRNA stabilizers in Escherichia coli. J. Mol. Biol., 282, 241-254. Jucker,F.M., Heus,F£.A., Yip,P.F., Moors,E.H. and Pardi,A. (1996) A network of heterogeneous hydrogen bonds in GNRA tetraloops. J. Mol. Biol., 264, 968-980. Kaberdin,V.R., Miczak,A., Jakobsen,J.S., Lin-Chao,S., McDowall,K.J. and von Gabain,A. (1998) The endoribonucleolytic N-terminal half of Escherichia coli RNase E is evolutionarily conserved in Synechocystis sp. and other bacteria but not the C-terminal half, which is sufficient for degradosome assembly. Proc. Natl, Acad. Sci. USA, 95, 11637-11642. Kaberdin,V.R, Walsh,A.P., JakobsenJ., McDowall,K.J. and von Gabain,A. (2000) Enhanced cleavage of RNA mediated by an interaction between substrates and the arginine-rich domain of 188 E. coli ribonuclease E . d. Mol. Biol, 301, 257-264. Kido,M., Yamanaka,K., Mitani,T., Niki,H., Ogura,T. and Hiraga,S. (1996) RNase E polypeptides lacking the carboxy-terminal half suppress a mukB mutation in Escherichia coli. J. Bacteriol, 178, 3917-3925. Kim,S., Sim,S. and Lee,Y. (1999) In vitro analysis of processing at the 3'-end of precursors of M l RNA, the catalytic subunit of Escherichia coli RNase P: multiple pathways and steps for the processing. Nucl. Acids Res., 27, 895-902. Klug,G. and Cohen,S.N. (1991) Effects of translation on degradation of mRNA segments transcribed from the polycistronicpuf operon of Rhodobacter capsulatus. d. Bacteriol, 173, 1478-1484. Kulakauskas,S., Wikstrom,P.M. and Berg,D.E. (1991) Efficient introduction of cloned mutant alleles into me Escherichia coli chromosome, d. Bacteriol, 173, 2633-2638. Kushner,S.R. (1996) mRNA decay. In F.C. Neidhardt (ed in chief), Escherichia coli and Salmonella. Cellular and Molecular Biology. 2n d edn. A S M Press, Washington, pp. 849-860. Laemmli,U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 227, 680-685. Lee,N., Wilcox,G., Gielow,W., Arnold,!, Cleary,P. and Englesberg,E. (1974) In vitro activation of the transcription of araBAD operon by araC activator. Proc. Natl. Acad. Sci. USA, 71, 634-638. Li,Z., Pandit,S. and Deutscher,M.P. (1998) Polyadenylation of stable R N A precursors in vivo. Proc. Natl Acad. Sci. USA, 95, 12158-12162. Li,Z., Pandit,S. and Deutscher,M.P. (1999) RNase G (CafA protein) and RNase E are both required for the 5' maturation of 16S ribosomal RNA. EMBO d., 18, 2878-2885. Li,Z. and Deutscher,M.P. (2002) RNase E plays an essential role in the maturation of Escherichia coli tRNA precursors. RNA, 8, 97-109. 189 Li,Z., Reimers,S., Pandit,S. and Deutscher,M.P. (2002) RNA quality control: degradation of defective transfer RNA. EMBO d., 21, 1132-1138. Lin-Chao,S. and Cohen, S.N. (1991) The rate of processing and degradation of antisense RNA I regulates the replication of ColEl-type plasmids in vivo. Cell, 65, 1233-1242. Lin-Chao,S., Wei,C.L. and Lin,Y.T. (1999) RNase E is required for the maturation of ssrA RNA and normal -ssrA RNA peptide-tagging activity. Proc. Natl. Acad. Sci. USA, 96, 12406-12411. Liou,G-G., Jane,W-N, Cohen, S.N., Lin,N-S. and Lin-Chao,S. (2001) RNA degradosomes exist in vivo in Escherichia coli as multicomponent complexes associated with the cytoplasmic membrane via the N-terminal region of ribonuclease E. Proc. Natl., Acad. Sci. U.S.A., 98, 63-68. Liu,M.Y., Gui,G., Wei,B., Preston IILJF., Oakford,L., YukselJ., Giedroc,D.P. andRomeo,T. (1997) The RNA molecule CsrB binds to the global regulatory protein CsrA and antagonizes its activity in Escherichia coli. d. Biol. Chem., 272, 17502-17510. Liu,M.Y. and Romeo,T. (1997) The global regulator CsrA of Escherichia coli is a specific RNA-binding protein, d. Bacteriol, 179, 4639-4642. Lobell,R.B. and Schleif,R.F. (1990) DNA looping and unlooping by AraC protein. Science, 250, 528-532. Loomis,W.P., Koo,J.T., Cheung,T.P. and Moseley,S.L. (2001) A tripeptide sequence within the nascent DaaP protein is required for mRNA processing of a fimbrial operon in Escherichia coli. Mol. Microbiol, 39, 693-707. Lopez,P.J. and Dreyfus,M. (1996) The lacZ mRNA can be stabilized by the T7 late mRNA leader in E coli. Biochimie, 78, 408-415. Lopez,P.J., Marchand,I., Yarchuk,0. and Dreyfus,M. (1998) Translation inhibitors stabilize Escherichia coli mRNAs independently of ribosome protection. Proc. Natl. Acad. Sci. USA, 95, 6067-6072. Lopez,P.J.,Marchand,I., Joyce,S.A. and Dreyfus,M. (1999) The C-terminal half of RNase E, which organizes the Escherichia coli degradosome, participates in mRNA degradation but not 190 rRNA processing in vivo. Mol. Microbiol., 33, 188-199. Mackie, G.A. (1981) Nucleotide sequence of the gene for ribosomal protein S20 and its flanking regions. J. Biol. Chem. 256:8177-8182. Mackie,G.A. and Parsons,G.D. (1983) Tandem promoters in the gene for ribosomal protein S20. J. Biol Chem., 258, 7840-7846. Mackie, G.A. (1986) Structure of the DNA distal to the gene for ribosomal protein S20 in Escherichia coli K12: presence of a strong terminator and an IS/ element. Nucl. Acids Res., 14, 6965-6981. Mackie, G.A. (1987) Posttranscriptional regulation of ribosomal protein S20 and stability of the S20 mRNA species. J. Bacteriol, 169, 2697-2701. Mackie, G.A. (1989) Stabilization of the 3' one-third of Escherichia coli ribosomal protein S20 mRNA in mutants lacking polynucleotide phosphorylase. J. Bacteriol, 171, 4112-4120. Mackie, G.A. (1991) Specific endonucleolytic cleavage of the mRNA for ribosomal protein S20 of Escherichia coli requires the product of the ams gene in vivo and in vitro. J. Bacteriol, 173, 2488-2497. Mackie, G.A. (1992) Secondary structure of the mRNA for ribosomal protein S20. Implications for cleavage by ribonuclease E. J. Biol. Chem., 267, 1054-1061. Mackie,G.A. and Genereaux,J.L. (1993) The role of RNA structure in determining RNase E-dependent cleavage sites in the mRNA for ribosomal protein S20 in vitro. J. Mol. Biol, 234, 998-1012. Mackie, G.A., GenereauxJ.L. and Masterman,S.K. (1997) Modulation of the activity of RNase E in vitro by RNA sequences and secondary structures 5' to cleavage sites. J. Bacteriol, 272, 609-616. Mackie,G.A. (1998) Ribonuclease E is a 5'-end-dependent endonuclease. Nature, 395, 720-723. Mackie, G.A. (2000) Stabilization of circular rpsTmRNA demonstrates the 5'-end dependence of 191 RNase E action in vivo. J. Biol. Chem., 275, 25069-25072. Makarova,O.V., Makarov,E.M., Sousa,R. and Dreyfus,M. (1995) Transcribing of Escherichia coli genes with mutant T7 RNA polymerases: Stability of lacZ mRNA inversely correlates with polymerase speed. Proc. Natl. Acad. Sci. USA, 92, 12250-12254. MatsunagaJ., Dyer,M., Simons,E.L. and Simons,R. (1996a) Expression and regulation of the rne and pdxJ operons of Escherichia coli. Mol. Microbiol., 22, 977-989. Matsunaga,J., Simons,E.L. and Simons,R.W. (1996b) RNase III autoregulation; structure and function of rncO, the post-transcriptional 'operator'. RNA, 2, 1228-1240. McCarthy,J.E. and Gualerzi,C. (1990) Translational control of prokaryotic gene expression. Trends Genet., 6, 78-85. McCormick,J.R., ZengelJ.M. and Lindahl,L. (1994) Correlation of translation efficiency with the decay of lacZ mRNA in Escherichia coli. J. Mol. Biol., 239, 608-622. McDowall,KJ., Hernandez,R.G., Lin-Chao,S. and Cohen,S.N. (1993) The ams-1 and rne-3071 mutations are in close proximity to each other and cause substitutions within a domain that resembles a product of the Escherichia coli mre locus. J. Bacteriol., 175, 4245-4249. McDowall,K.J., Lin-Chao,S. and Cohen,S.N. (1994) A+U content rather than a particular nucleotide order determines the specificity of RNase E cleavage. J. Biol. Chem., 269, 10790-10796. McDowalhK.J., Kaberdin,V.R., Wu.S.W., Cohen,S.N. and Lin-Chao,S. (1995) Site-specific RNase E cleavage of oligonucleotides and inhibition by stem-loops. Nature, 374, 287-290. McDowall,K.J. and Cohen, S.N. (1996) The N-terminal domain of the rne gene product has RNase E activity and is non-overlapping with the arginine-rich RNA-binding site. J. Mol. Biol, 255, 349-355. McMurry,L.M. and Levy,S.B. (1987) Tn5 insertion in the polynucleotide phorylase (pnp) gene in Escherichia coli increases susceptibility to antibiotics. J. Bacteriol, 169, 1321-1324. 192 Melefors,0. and von Gabain,A. (1988) Site-specific endonucleolytic cleavages and the regulation of stability of E. coli ompA mRNA. Cell, 52, 893-901. Meyer,B.J. and Schottel.J.L. (1992) Characterization of cat messenger RNA decay suggests that turnover occurs by endonucleolytic digestion in a 3' to 5' direction. Mol. Microbiol, 6, 1095-1104. Meyer,B.J., Bartman,A.E. and Schottel,J.L. (1996) Isolation of a mRNA instability sequence that is c/s-dominant to the ompA stability determinant in Escherichia coli. Gene, 179, 263-270. Miczak,A., Kaberdin,V.R., Wei,C. and Lin-Chao,S. (1996) Proteins associated with RNase E in a multicomponent ribonucleolytic complex. Proc. Natl. Acad. Sci. USA, 93, 3865-3869. Misra,T.K. and Apirion,D. (1979) RNase E, an RNA processing enzyme from Escherichia coli. d. Biol Chem., 254, 11154-11159. Mitchell,P. and Tollervey,D. (2000) mRNA stability in eukaryotes. Curr. Opin. Genet. Dev., 10, 193-198. Mohanty,B.K. and Kushner, S.R. (1999a) Analysis of the function of Escherichia coli poly(A) polymerase I in RNA metabolism. Mol. Microbiol, 34, 1094-1108 Mohanty,B.K. and Kushner,S.R. (1999b) Residual polyadenylation in poly(A) polymerase (pcnB) mutants of Escherichia coli does not result from the activity encoded by the/3J0 gene. Mol. Microbiol, 34, 1109-1119. Mohanty,B.K. and Kushner,S.R. (2000) Polynucleotide phosphorylase functions both as a 3' - 5' exonuclease and a poly(A) polymerase in Escherichia coli. Proc. Natl Acad. Sci. USA, 97, 11966-11971. Moore,P.B. (1988) Structure-function correlations in the small ribosomal subunit from Escherichia coli. Annu. Rev. Biophys. Chem., 17, 349-367. Mudd,E.A. and Higgins,C.F. (1993) Escherichia coli endoribonuclease RNase E: autoregulation of expression and site-specific cleavage of mRNA. Mol Microbiol, 9, 557-568. 193 Nemec.A., Haywood-Farmer,A. and Mackie,G.A. (1995) Conserved amino acid residues in the primary structure of ribosomal protein S20 from selected gram-negative bacteria. Biochim. Biophys. Acta., 1263, 154-158. Newbury,S.F., Smith,N.H. and Higgins.C.F. (1987) Differential mRNA stability controls relative gene expression within a polycistronic operon. Cell, 51, 1131-1143. Nicholson, A.W. (1996) Structure, reactivity and biology of double-stranded RNA. Prog. Nucl. Acids Res. Mol. Biol., 52, 1-56. Nicholson,A.W. (1999) Function, mechanism and regulation of bacterial ribonucleases. FEMS Microbiol. Rev., 23, 371-390. Nierlich,D.P. and Murakawa,G.J. (1996) The decay of bacterial messenger RNA. Prog. Nucl. Acids Res. Mol. Biol., 52, 153-216. Nilsson,G., J3elasco,J.G., Cohen,S.N. and von Gabain,A. (1984) Growth-rate dependent regulation of mRNA stability in Escherichia coli. Nature, 312, 75-77. Nilsson,G., BelascoJ.G., Cohen,S.N. and von Gabain,A. (1987) Effect of premature termination of translation on mRNA stability depends on the site of ribosome release. Proc. Natl Acad. Sci. USA, 84, 4890-4894. Niyogi,S.K. and Datta,A.K. (1975) A novel oligoribonuclease of E. coli. I. Isolation and properties. J. Biol. Chem., 250, 7307-7312. 0'Hara,E.B., ChekanovaJ.A, Ingle,C.A., Kushner,Z.R., Peters,E. and Kushner.S.R. (1995) Polyadenylation helps regulate mRNA decay in Escherichia coli. Proc. Natl Acad. Sci. USA, 92, 1807-1811. Okada,Y., Wachi,M, Hirate,A., Suzuki,K., Nagai,K. and Natsuhashi,M. (1994) Cytoplasmic axial filaments in Escherichia coli cells: possible function in the mechanism of chromosome segregation and cell division. J. Bacteriol., 176, 917-922. 01sson,M.O. and Gausing,K. (1980) Post-transcriptional control of coordinated ribosomal protein synthesis in Escherichia coli. Nature, 283, 599-600. 194 Ono,M. and Kuwano,M. (1979) A conditional lethal mutation in an Escherichia coli strain with a longer chemical lifetime of messenger RNA. J. Mol. Biol, 129, 343-357. Ow,M.C, Liu,Q. and Kushner,S.R. (2000) Analysis of mRNA decay and rRNA processing in Escherichia coli in the absence of RNase E-based degradosome assembly. Mol. Microbiol, 38, 854-866. Parsons, G.D. and Mackie, G.A. (1983) Expression of the gene for ribosomal protein S20: effects of gene dosage. J. Bacteriol, 154, 152-160. Parsons,G.D., Donly,B.C. and Mackie,G.A. (1988) Mutations in the leader sequence and initiation codon of the gene for ribosomal protein S20 (rpsT) affect both translational efficiency and autoregulation. J. Bacteriol, 170, 2485-2492. Petersen,C. (1993) Translation and mRNA stability in bacteria: a complex relationship. In Belasco, J.G. and Brawerman,G. (eds), Control of Messenger RNA Stability. Academic Press Inc., New. York, pp. 117-145. Py,B., Causton,H., Mudd, E.A. and Higgins,C.F. (1994) A protein complex that mediates mRNA degradation in Escherichia coli. Mol. Microbiol, 14, 717-729. Py,B., Higgins,C.F., Krisch,H.M. and Carpousis,A.J. (1996) A DEAD-box RNA helicase in the Escherichia coli RNA degradosome. Nature, 381, 169-172. Rapaport.L.R. and Mackie, G.A. (1994) Influence of translational efficiency on the stability of the mRNA for ribosomal protein S20 in Escherichia coli. J. Bacteriol, 176, 992-998. Rauhut,R. and Klug,G. (1999) mRNA degradation in bacteria. FEMS Micro. Rev., 23, 353-370. Reeder,T. and Schleif,R. (1993) AraC protein can activate transcription from only one position and when pointed in only one direction. J. Mol. Biol, 231, 205-218. Regnier,P. and Grunberg-Manago,M. (1990) RNase III cleavages in non-coding leaders of Escherichia coli transcripts control mRNA stability and genetic expression. Biochimie, 11, 825-834. 195 Regnier,P. and Arraiano,C.M. (2000) Degradation of mRNA in bacteria: emergence of ubiquitous features. BioEssays, 22, 235-244. Robert-Le Meur,M.R. and Portier,C. (1992) E. coli polynucleotide phosphorylase expression is autoregulated through an RNase Ill-dependent mechanism. EMBO J., 11, 2633-2641. Robert-Le Meur,M.R. and Portier,C. (1994) Polynucleotide phosphorylase of Escherichia coli induces the degradation of its RNase III processed messenger by preventing its translation. Nucl. Acids Res., 22, 397-403. RosnerJ.L. (1972) Formation, induction, and curing of bacteriophage PI lysogens. Virology, 49, 679-689. Russel,M., Gold,L., Morrissett,H. and 0'Farrell,P.Z. (1976) Translational, autogenous regulation of gene 32 expression during bacteriophage T4 infection. d. Biol. Chem., 251, 7263-7270. Ryden-Aulin,M., Shaoping,Z., Kylsten,P. and Isaksson,L.A. (1993) Ribosome activity and modification of 16S R N A are influenced by deletion of ribosomal protein S20. Mol. Microbiol., 7, 983-992. Sambrook,J., Fritsch,E.F. and Maniatis,T. (1989) Molecular Cloning: A Laboratory Manual. 2 n d edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N Y . Sanger,F., Nicklen,S. and Coulson,A.R. (1977) D N A sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA, 74, 5463-5467. Sarkar,N. (1997) Polyadenylation of mRNA in prokaryotes. Mcirobiol. Rev., 66, 173-197. Schleif,R. (1996) Two positively regulated systems, ara and mal. In Neidhardt,F.C. (ed in chief) Escherichia coli and Salmonella. Cellular and Molecular Biology. 2 n d edn. A S M Press, Washington, pp. 1300-1309. Schmid,S.R. and Linder,P. (1992) D-E-A-D protein family of putative R N A helicases. Mol. Microbiol, 6, 283-292. Sharp,P.A. (1999) R N A i and double-stranded RNA. Genes Dev., 15, 139-141. 196 Singer,P. and Nomura,M. (1985) Stability of ribosomal protein mRNA and translational feedback regulation in Escherichia coli. Mol. Gen. Genet., 199, 543-546. Sledjeski,D.D., Whitman,C. and Zhang,A. (2001) Hfq is necessary for regulation by the untranslated RNA DsrA. J. Bacteriol, 183, 1997-2005. Soisson,S.M., MacDougall-Shackleton,B., SchleifR. and Wolberger,C. (1997) Structural basis for ligand-regulated oligomerization of AraC. Science, 276, 421-425. Sousa,C, de Lorenzo, V. and Cebolla,A. (1997) Modulation of gene expression through chromosomal positioning in Escherichia coli. Microbiol, 143, 2071-2078. Sousa,S., MarchandJ. and Dreyfus,M. (2001) Autoregulation allows Escherichia coli RNase E to adjust continuously its synthesis to that of its substrates. Mol. Microbiol, 42, 867-878. Spickler,C. and Mackie,G.A. (2000) Action of RNase II and polynucleotide phosphorylase against RNAs containing stem-loops of defined structure. J. Bacteriol, 182, 2422-2427. Spickler,C, Stronge,V. and Mackie,G.A. (2001) Preferential cleavage of degradative intermediates of rpsTmKNA by the Escherichia coli RNA degradosome. J. Bacteriol, 183, 1106-1109. Steege,D.A. (2000) Emerging features of mRNA decay in bacteria. RNA, 6,1079-1090. Sun,W., Jun,E. and Nicholson,A.W. (2001) Intrinsic double-stranded-RNA processing activity of Escherichia coli ribonuclease III lacking the dsRNA-binding domain. Biochemistry, 40, 14976-14984. Tobe,T., Sasakawa,C, Okada,N, Honma,Y. and Yoshikawa,M. (1992) vacB, a novel chromosomal gene required for expression of virulence genes on the large plasmid of Shigella flexneri. J. Bacteriol, 174, 6359-6367. Tock, M.R., Walsh, A.P., Carroll, G. and McDowall, K.J. (2000) The CafA protein required for the 5-maturation of 16S rRNA is a 5-end-dependent ribonuclease that has context-dependent broad sequence specificity. J. Biol. Chem., 275, 8726-8732. 197 Tomeasanyi,T. and Apirion,D. (1985) Processing enzyme ribonuclease E specifically cleaves RNA I. An inhibitor of primer formation in plasmid DNA synthesis. J. Mol. Biol, 185, 713-720. Tsui,H.-C, Feng,G. and Winkler,M.E. (1997) Negative regulation of mutS and mutH repair gene expression by the Hfq and RpoS global regulators of Escherichia coli K-12. J. Bacteriol, 179, 7476-7487. Umitsuki,G., Wachi,M., Takada,A., Hikichi,T. and Nagai,K. (2001) Involvement of RNase G in in vivo mRNA metabolism in Escherichia coli. Genes to Cells, 6, 403-410. Vanzo.N.F., Li,Y.S., Py,B., Blum,E., Higgins,C.F., Raynal,L.C., Krisch,H.M. and Carpousis,A.J. (1998) Ribonuclease E organizes the protein interactions in the Escherichia coli RNA degradosome. Genes Dev., 12, 2770-2781. von Gabain,A., BelascoJ.G., SchottelJ.L., Chang,A.C.Y. and Cohen,S.N. (1983) Decay of mRNA in Escherichia coli: investigation of the fate of specific segments of transcripts. Proc. Natl. Acad. Sci. USA, 80, 653-657. Vytvytska,0., Jakobsen,J.S., Balcunaite,G., Andersen,J.S., Baccarini,M., and von Gabain,A. (1998) Host factor I, Hfq, binds to Escherichia coli ompA mRNA in a growth rate-dependent fashion and regulates its stability. Proc. Natl Acad. Sci. USA, 95, 14118-14123. Vytvytska,0., Moll,L, Kaberdin,V.R., von Gabain,A. and Blasi,U. (2000) Hfq (HF1) stimulates ompA mRNA decay by interfering with ribosome binding. Genes Dev., 14, 1109-1118. Wachi,M., Umitsuki,G. and Nagai,K. (1997) Functional relationship between Escherichia coli RNase E and the CafA protein. Mol. Gen. Genet., 253, 515-519. Wachi,M., Umitsuki,G., Shimizu.M., Takada,A. and Nagai,K. (1999) Escherichia coli cafA gene encodes a novel RNase, designated as RNase G, involved in processing of the 5' end of 16S rRNA. Biochem. Biophys. Res. Commun., 259, 483-488. Wachi.M., Kaga,N, Umitsuki,G., Clark,D.P. and Nagai,K. (2001) A novel RNase G mutant that is defective in degradation of adhE mRNA but proficient in the processing of 16S rRNA precursor. Biochem. Biophys. Res. Commun., 289, 1301-1306. 198 Wagner.E.G. and Simons,R.W. (1994) Antisense R N A control in bacteria, phages, and plasmids. Annu. Rev. Microbiol, 48, 713-742.. Walsh,A.P., Tock,M.R., Mallen,M.H., Kaberdin,V.R., von Gabain,A. and McDowall.K.J. (2001) Cleavage of poly(A) tails on the 3'-end of R N A by ribonuclease E of Escherichia coli. Nucl Acids Res., 29, 1864-1871. Wirth,R., Littlechild,J. and B6ck,A. (1982) Ribosomal protein S20 purified under mild conditions almost completely inhibits its own translation. Mol. Gen. Genet., 188, 164-166. Xu,F., Lin-Chao,S. and Cohen,S.N. (1993) The Escherichia colipcnB gene promotes adenylylation of antisense RNAI of colEl-type plasmids in vivo and degradation of R N A I decay intermediates. Proc. Natl Acad. Sci. USA, 90, 6756-6760. Xu,F. and Cohen,S.N. (1995) R N A degradation in Escherichia coli is regulated by 3' adenylation and 5' phosphorylation. Nature, 374, 180-183. Yamanaka,K. and Inouye,M. (2001) Selective mRNA degradation by polynucleotide phosphorylase in cold shock adaptation in Escherichia coli. J. Bacteriol, 183, 2808-2816. Yanisch-Perron,C, Vieira,J. and Messing,! (1985) Improved M13 phage cloning vectors and host strains: nucleotide sequence of the M13mpl8 and pUC19 vectors. Gene, 33, 103-119 Yarchuk,0., lost,! and Dreyfus,M. (1991) The relation between translation and mRNA degradation in the lacZ gene. Bichimie, 73, 1533-1541. Yu,D. and Court,D.L. (1998) A new system to place single copies of genes, sites and lacZ fusions on the Escherichia coli chromosome. Gene, 223, 77-81. Yu,D., Ellis,H.M., Lee,E.C, Jenkins,N.A., Copeland,N.G. and Court,D.L. (2000) An efficient recombination system for chromosome engineering in Escherichia coli. Proc. Natl Acad. Sci. USA, 97, 5978-5983. Yuo,Z. and Deutscher,M.P. (2001) Exoribonuclease superfamilies: structural analysis and phylogenetic distribution. Nucl. Acids Res., 29, 1017-1026. 199 Zhang,X., Zhu,L. and Deutscher,M.P. (1998) Oligoribonuclease is encoded by a highly conserved gene in the 3-5' exonuclease superfamily. J. Bacteriol., 180, 2779-2781. Zhou,Z. and Deutscher,M.P. (1997) An essential function for the phosphate-dependent exoribonuclease RNase P H and polynucleotide phosphorylase. J. Bacteriol., 179, 4391-4395. Zilhao,R., Cairrao,F., Regnier,P. and Arraiano,C.M. (1996) PNPase modulates RNase II expression in Escherichia coli: implications for mRNA decay and cell metabolism. Mol. Microbiol, 20, 1033-1042. 200 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0090574/manifest

Comment

Related Items