UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The Caenorhabditis elegans homologue of huntingtin interacting protein 1 has multiple roles in development 2001

You don't seem to have a PDF reader installed, try download the pdf

Item Metadata


ubc_2001-61154X.pdf [ 5.85MB ]
JSON: 1.0090415.json
JSON-LD: 1.0090415+ld.json
RDF/XML (Pretty): 1.0090415.xml
RDF/JSON: 1.0090415+rdf.json
Turtle: 1.0090415+rdf-turtle.txt
N-Triples: 1.0090415+rdf-ntriples.txt

Full Text

THE CAENORHABDITIS ELEGANS HOMOLOGUE OF HUNTINGTIN INTERACTING PROTEIN 1 HAS MULTIPLE ROLES IN D E V E L O P M E N T by JODEY A L E X A N D E R P A R K E R B. Sc., University of British Columbia in Association with the University-College of the Cariboo, 1994 A THESIS SUBMITTED IN PARTIAL F U L F I L L M E N T OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY THE F A C U L T Y OF G R A D U A T E STUDIES Department of Medical Genetics Genetics Graduate Program We accept this thesis as conforming to the required standards THE UNIVER^T^f OJFBRITI5B C O L U M B I A March 2001 © Jodey Alexander Parker, 2001 in In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of The University of British Columbia Vancouver, Canada Date DE-6 (2/88) A b s t r a c t Endocytosis is an essential process in all eukaryotes and is involved in biological processes such as nutrient uptake and neurotransmitter recycling. Mammalian cell culture and yeast genetic studies have implicated the HIP1/SLA2 family of genes in linking the actin cytoskeleton to endocytosis. The contribution of the cytoskeleton to endocytic events is not well understood. Human HIP1 is of medical importance as it has been shown to interact with huntingtin, and may be important to the etiology of Huntington disease. Analysis of this family of genes in a metazoan animal system, such as C. elegans or Drosophila is an area that has been largely unexplored. As endocytosis is a mechanism by which cells interact with their environments, the use of an animal system may be particularly informative as it may illustrate differences between unicellular and multicellular systems. Through a combination of gene disruption and molecular characterization techniques, I have studied the function of CeHIPl, the C elegans member of the HIP1/SLA2 gene family. CeHIPl displays postembryonic, tissue-specific expression, and has several functions in the adult animal. CeHIPl has a role in maintaining proper morphology and function of the pharynx, the nematode feeding structure. CeHIPl is required for promoting fertilization; gene silencing results in reduced fecundity. The locus is dose sensitive. CeHIPl is haploinsufficient, and overexpression results in reduced viability and death of the animals. C. elegans is an excellent model to interpret the function of the human homolog HIP1. Both CeHIPl and HIP1 show restricted expression and display dose sensitive toxic effects, inferring a shared mode of action. This thesis describes the establishment of a simple animal model that may be used to delineate pathways common to both genes. These findings may reflect the situation in humans, and perhaps point out avenues of potential treatment for Huntington disease. Table of Contents Abstract i i Table of contents i i i List of tables viii List of figures ix Dedication xi Acknowledgements xii Chapter I Introduction 1 1.1C. elegans as a Model Animal System 1 1.1.1 The C. elegans Sequencing Projects 1 1.2 Huntington Disease, HIP1 and C. elegans 3 1.2.1 Huntington Disease 3 1.2.2 Significant Background H1P1, SLA2 and CeHIPl 6 1.2.3 Yeast SLA2 7 1.2.4 Human HIP I and Mouse HIP1R 10 1.2.5 The Actin Cytoskeleton and Endocytosis 12 1.3 Forward and Reverse Genetics in C. elegans 15 1.4 Functional Approaches to Study CeHIPl 21 Chapter II Methods and Materials 22 2.1 Foreword 22 2.2 Nematode Strains and Culture Conditions 22 2.2.1 Transgenic Strains 22 2.2.2 Integration of Transgenic Arrays 23 2.3 Microscopy 23 2.4 Preparation of Cloned D N A 24 2.4.1 Plasmid and Cosmid Isolation from Bacteria 24 2.4.2 Plasmid isolation from Saccharomyces cerevisiae 24 2.5 Transformation 25 in 2.5.1 E. coli DH5ct 25 2.5.2 E. coli SURE cells 26 2.5.3 E. co//DH10B 26 2.5.4 S. cerevisiae Y190 27 Yeast Selection 28 2.6 D N A Sequencing 29 2.7 Electrophoresis • 30 2.7.1 Agarose Gel Electrophoresis 30 2.7.2 Polyacrylamide Gel Electrophoresis 30 2.8 D N A Analysis 32 2.9 Polymerase Chain Reaction 32 2.10 Restriction Digests 32 2.11 Subcloning 33 2.11.1 Cloning of the CeHIPl cDNA 33 Preparing cDNA Clones 33 Cloning the Full Length CeHIPl cDNA 35 2.11.2 Construction of CeHIPl::GFP Reporter 35 2.11.3 CeHIPl::GST Fusion Protein 37 2.11.4 CeHIPl Overexpression Construct 37 2.11.5 R N A Interference Constructs 40 2.11.6 Yeast Two-Hybrid Constructs 40 2.12 PCR Mapping of Deficiencies 44 2.12.1 Preparation of Template D N A from Embryos 44 2.12.2 PCR Mapping of Deficiency Homozygotes 45 2.13 Site Selected Mutagenesis Screen 46 2.13.1 Growth and Synchronization for Mutagenesis 46 2.13.2 Mutagenesis 47 2.13.3 Library Plating 47 2.13.4 Library Harvest 48 2.13.5 PCR Screening 48 2.13.6 Identification of Deletion Candidates and Sib-Selection 49 iv 2.13.7 Sib-Selection 50 2.14RT-PCR 50 2.15 Protein Work 51 2.15.1 Expression and Protein Purification of CeHIPl 51 2.15.2 Antibody Production 52 2.15.3 Western Analysis 52 2.15.4 Immunocytochemistry 54 Whole Worm Fixation 54 Staining 56 Mounting 56 2.15.5 Dissection and Staining of Gonads 57 Gonad Dissection 57 Gonad Fixation 57 Antibody Staining of Dissected Gonads 58 Mounting 58 2.16 Overexpression Analysis 59 2.17 R N A Interference 60 2.17.1 R N A i Clones for in vitro Transcription 60 2.17.2 Preparation of Double Stranded R N A for Injection and Soaking 60 2.17.3 Injection of dsRNA 61 2.17.4 Soaking Animals with dsRNA 61 2.17.5 in vivo RNA Interference 62 2.17.6 Outcrossing of R N A i Animals 62 2.18 Yeast Two-Hybrid Analysis 63 2.19 Yeast Two-Hybrid Screen 63 Chapter III Results 65 3.1 CeHIPl Gene Structure 65 3.2 Homology Studies 67 3.3 Expression of CeHIPl 77 3.3.1 RT-PCR 77 v 3.3.2 GFP Reporter 77 3.4 Protein Localization of CeHIPl 78 3.5 PCR Mapping of Deficiencies 83 3.6 Reverse Genetic Screen 91 3.7 Overexpression Analysis 91 3.8 R N A Interference Analysis 98 3.8.1 Fertilization Effects 101 3.8.2 Egg Laying Deficiency Observed after CeHIPl R N A i 106 3.8.3 CeHIPl R N A i Deforms the Mature Pharynx 107 3.9 Testing for CeHIPl Interaction with Human Huntingtin 113 3.10 Yeast Two-Hybrid Screen 113 3.10.1 Mutants Obtained 116 Chapter I V Discussion 117 4.1 Introduction 117 4.2 CeHIPl and the Nematode 117 4.2.1 CeHIPl and Fertilization 118 Anatomy of the Adult Gonad 118 The Spermatheca 120 Fertilization Errors 122 Receptor Mediated Endocytosis in the Oocyte 123 Sperm Depletion 124 Outcrossing Rescues the R N A i Phenotype; Therefore, Not a Sperm Defect 125 CeHIPl Promotes Fertilization in C. elegans 129 4.2.2 Egg Laying and CeHIPl 130 4.2.3 The Role of CeHIPl in Pharynx Development and Function 132 CeHIPl and the Cytoskeleton 134 Endocytosis and Pharynx Function 136 4.3 CeHIPl, A Dose Sensitive Gene? 138 4.3.1 CeHIPl and Haploinsufficiency 138 vi 4.3.2 Overexpression of Ce#ZP7 139 4.4 CeHIPl and Interacting Proteins 141 4.4.1 Yeast Two-Hybrid Screen 141 T05C12.10 and C. elegans Hedgehog-Like Genes 141 F45E12.2 and R N A Turnover in C. elegans 144 4.5 Is CeHIPl the nematode homologue of human HIP11 145 4.6 Conclusion 146 4.7 Model 148 Bibliography 150 vii List of Tables Table 3.1 Summation of Pairwise Sequence Alignment 73 Table 3.2 PCR Deficiency Mapping Data 93 Table 3.3 Comparison of R N A Interference Methods; Injection, Soaking and in vivo 102 Table 3.4 Outcrossing of CeHIPl R N A i Hermaphrodites 103 Table 3.5 Additional Phenotypes of CeHIPl R N A i 108 viii List of Figures Figure 2.1 Cloning of pCeh350, pCeh.351, and pCeh352 36 Figure 2.2 Cloning of the CeHIP 1 ::GF? Reporter Construct pCeh353.... 38 Figure 2.3 Cloning of the CeHIPl ::GST Fusion Construct pCeh365 39 Figure 2.4 Cloning of the R N A i Construct pCeh389 41 Figure 2.5 Construction of Clones for Yeast Two-Hybrid Mapping 43 Figure 3.1 CeHIPl Gene Structure 66 Figure 3.2 Predicted Protein Structure of CeHIPl 68 Figure 3.3 Predicted Hydrophobicity of CeHIPl 69 Figure 3.4 Stage Specific Expression of CeHIPl 70 Figure 3.5 Pairwise Sequence Alignment of CeHIPl and Homologs 71-72 Figure 3.6 Predicted Coiled-Coil Domains 75 Figure 3.7 Pairwise Sequence Alignment of CeHIPl and F08A8.6 76 Figure 3.8 The C. elegans Hermaphrodite Gonad 79 Figure 3.9 The C. elegans Male Gonad 80 Figure 3.10 CeHIPl Expression 81-82 Figure 3.11 Detection of CeHIPl Protein 84 Figure 3.12 CeHIPl Protein Localization in Developing Embryos 85-86 Figure 3.13 CeHIPl Protein Localization in the Adult Hermaphrodite 87-88 Figure 3.14 CeHIPl Protein Localization in the Adult Hermaphrodite and Male Gonad 89-90 Figure 3.15 Map of Deficiency Breakpoints in Relation to CeHIPl 92 Figure 3.16 PCR Mapping of sDfllO 94 Figure 3.17 PCR Mapping of nDfl7 94 Figure 3.18 PCR Mapping oinDflO 95 Figure 3.19 PCR Mapping oinDfH 95 Figure 3.20 PCR Mapping of hDfil 96 Figure 3.21 Reverse Genetic Screen Deletions 97 Figure 3.22 Overexpression of CeHIPl 99-100 ix Figure 3.23 The Effect of R N A i on CeHIPl Protein Localization in the Gonad 104-105 Figure 3.24 The Effect of R N A i on Egg Laying 109-110 Figure 3.25 R N A i Effects on Pharyngeal Morphology 111-112 Figure 3.26 Two-Hybrid Analysis 114 Figure 3.27 Two-Hybrid Screen Positives 114 Figure 3.28 Mapping of the Two-Hybrid Interaction 115 Figure 3.29 Mapping of the Two-Hybrid Interaction 115 Figure 4.1 Depletion of CeHIPl from the Gonad Results in the Production of Unfertilized Oocytes 127-129 x Dedication For my father, Robert L. Parker. xi A c k n o w l e d g e m e n t s I wish to extend my gratitude to a number of people. Foremost, I thank Dr. Ann M . Rose for opening a door into a rich and rewarding world. Thank you for the opportunity to work with you in your laboratory. I thank my thesis committee, Dr. Peter Candido, Dr. Phil Hieter, and Dr. Steve Wood for keeping me on the right track once through the door. I would like to extend additional thanks to Dr. Steve Wood for the opportunity to teach as well as learn. I wish to thank Dr. Colin Thacker for a great many things, but mainly for his magnanimity and patience. I thank the members of the Rose laboratory, past and present for their support. I would like to extend thanks to Dr. Mairi MacKay for the opportunity to try things I had only read about. To my family, I extend thanks for their love and understanding. Lastly, I thank Leah DeBella. Thank you for the generosity, love and honesty you gave. My work was supported in part by a U B C Graduate Fellowship and the UCC Robert Frazier Memorial Fellowship. xn Chapter I Introduction 1.1 C. elegans as a Model Animal System The C. elegans system has proven to be an amenable and successful model to study many aspects of biology. The nematode is a free living, self-fertilizing hermaphrodite, which can be easily grown and maintained in a laboratory setting (Brenner, 1974). The great power of the nematode system is its potential for genetic analysis, in part due to its rapid (3-day) life cycle, and small size (reviewed in Riddle, 1997). Additionally, the natural mode of C. elegans inbreeding by the self-fertilizing hermaphrodite, combined with the ability to cross hermaphrodites with males offers great advantages, as selling or crossing can be manipulated at will. The animal's simple anatomy, transparent body, constancy in cell number and cell position has added to its usefulness as a model system. The complete cell lineage is known (Sulston and Horvitz, 1977) and the complete structure of the nervous system has been determined through serial section electron microscopy (White et al., 1986). Mutations in genes involved in virtually all aspects of development are allowing for the molecular genetic analysis of these processes at a very fine level. 1.1.1 The C. elegans Sequencing Projects C. elegans is unique among animal systems as essentially its entire genome has been cloned into cosmid and yeast artificial chromosome contigs constituting the physical map of the genome (Coulson, 1988; Coulson, 1991; Coulson, 1995). The physical map 1 has been correlated with the genetic map at points where genetic loci have been cloned and ordered in relation to overlapping cosmids (Janke et al., 1997). This resource allowed for an inquiry into the feasibility of obtaining the complete genomic sequence. The early success of the initial sequencing efforts led to the completion of the entire genomic sequence in 1998 (Consortium, 1998; Sulston et al., 1992; Wilson etal., 1994). Examination of the sequence reveals that 42% of the predicted protein coding genes have matches outside of Nematoda. 36% of the predicted genes in C. elegans have significant matches in humans, including many genes involved in human disease. The acquisition of a sequenced genome has provided researchers with new opportunities. Researchers can peer into the C. elegans genome to find genes of particular interest to their studies. C. elegans offers an attractive place in which to study evolutionary conserved genes in a simple eukaryotic system (Consortium, 1998). Comparative genomic approaches and multi-organism biology are valuable tools for genetic analysis. Connections across species between genes mutated in human disease states, and homologs in model organisms can be particularly powerful, as model organism gene function data and experimental approaches can help reveal the molecular mechanisms defective in disease (Bassett et al., 1997; Clark et al., 1999; Ploger et al., 2000). Such approaches have already proven informative for a number of human diseases. Studies of the S. cerevisiae MEC1 and TEL1 genes, for example have provided valuable insight into the function of the human ATM gene, (mutated in ataxia telangiectasia, Morrow et al., 1995). Both C. elegans and Drosophila have been used as models for the polyglutamine mediated neurodegeneration observed in a group of human 2 diseases including Huntington disease and the spinocerebellar ataxias (Faber, 1999; HDCRG. , 1993; Kawaguchi et a l , 1994; Satyal et al., 2000; Warrick et al., 1998; Warrick et al., 1999). Model organisms have made numerous contributions to the field of human disease research. As more of the human genome is sequenced and studied, the call upon the model organisms to generate insights will be even greater. 1.2 Hunt ington Disease, HIP1 and C. elegans 1.2.1 Hunt ington Disease Huntington's chorea is one of a group of human neurodegenerative diseases caused by nucleotide triplet repeat expansion within the protein coding region of the gene (Andrew et al., 1997; Reddy et al., 1997; Ross et al., 1997). These diseases share the feature of a normal, non-pathological range of repeats, with the disease manifesting if the repeat expands above the normal range. Typically, this results in specific neuronal degeneration. It is probable that these diseases share a common pathological mechanism at the protein level. The expansion confers a dominant, toxic phenotype to these proteins. The larger the repeat, the more severe the disease, and the earlier the age of onset over successive generations. This phenomenon is called anticipation. Several investigations suggest that it is the expanded polyglutamine tract itself causing neurodegeneration. The introduction of polyglutamine tracts has been shown to cause neurodegeneration in transgenic mice, and cell death in transfected cells (Davies et al., 1997; Ikeda et al., 1996; Mangiarini et al., 1996; Paulson et al., 2000; Saudou et al., 1998). Neuronal nuclear inclusions have recently been identified as a unifying feature in the pathology of all of these disease (Ross, 1997). Currently, it is unclear i f the nuclear 3 inclusions cause the disease or are a component of the disease process (Sisodia et al., 1998). The inclusions are found preferentially in susceptible neurons and are linked to disease progression. A study of brains from HD patients reveals the presence of fibrils within the nuclear inclusion consistent with amyloid-like fibrils (DiFiglia et al., 1997). Individually introduced expanded polyglutamine repeats have been found to form insoluble amyloid-like fibrils as well. It is suggested that the aggregation of expanded polyglutamine repeats is the underlying cause of neurodegeneration in these diseases and the nucleus may be the primary site of action (Saudou et al., 1998; Sisodia et al., 1998). However, these groups of diseases display an overlapping, yet distinct pattern of neuronal degeneration. Selective neuronal degeneration occurs despite the fact that the disease proteins are expressed widely in the brain, and throughout the body (Reddy and Housman, 1997; Ross, 1997). Additional factors may contribute to cell specific pathology. Interaction with a subset of proteins, which are temporally and/or spatially restricted, may confer cellular specificity (Matilla et al., 1997). Indeed, recent investigations have shown the presence of nuclear inclusions is not sufficient to cause cell degeneration (Saudou et al., 1998; Warrick et al., 1999). Different cell types inherently differ in their sensitivity to the presence of expanded polyglutamine tracts. Again, this suggests that additional genes may be involved. Several investigators have proposed that HD is caused by a toxic gain-of-function attributable to an abnormal protein-protein interaction modulated by the expanded polyglutamine tract (Barinaga et al., 1996; Ona et al., 1999; Saudou et al., 1998). Thus, the binding of distinct proteins to the expanded polyglutamine sequence could either bestow a new function on huntingtin, or alter its normal interactions with other proteins. 4 It is possible that the binding of a specific complement of proteins particular to certain cell types could confer a selective vulnerability to the effects of mutant huntingtin (Kalchman et al., 1997; Wanker et al., 1997). Two groups have independently identified a protein that interacts with huntingtin (Kalchman et al., 1997; Wanker et al., 1997). The protein, designated HIP1, for Huntingtin Interacting Protein 1, shows considerable sequence identity to Sla2p, the gene product of SLA 2 (Synthetic Lethal with Actin binding protein 1 #2) in Saccharomyces cerevisiae (Holtzman, 1993). In S. cerevisiae Sla2p is known to be essential for the assembly and function of the cortical cytoskeleton (Li et al., 1995; Yang et al., 1999). HIP1 also shares significant identity with the protein encoded by the gene CeHIPl of Caenorhabditis elegans (figure 3.5). A related gene has been isolated from mouse, mHIPIR (Mouse HIP1 Related) and has been implicated in clathrin coated pit endocytic events in addition to its cytoskeletal role (Engqvist-Goldstein, 2000; Seki, 1998). Immunohistochemistry, electron microscopy, and subcellular fractionations have demonstrated that huntingtin is primarily a cytoplasmic protein associated with vesicles and/or microtubules (Velier et al., 1998; Wood et al., 1996). This suggests that that it may be involved in cytoskeletal anchoring, transport of mitochondria, vesicles or other organelles in the cell. HIP1 is enriched in the central nervous system where it colocalizes with the membrane fractions of human brain cells. An important observation is that the expanded polyglutamine tract disrupts the interaction between huntingtin and HIP1 . The restricted expression of HIP I, along with its localization pattern, limits its interaction with huntingtin to the central nervous system, and specifically, to the membrane. This 5 interaction, along with HIP1 's homology to Sla2p and CeHIPl suggests that the huntingtin-HIPl interaction may be essential for the normal function of membrane cytoskeleton of brain cells (Kalchman et al., 1997). Additionally, the role of HIP1, and homologues, may be evolutionary conserved and important to all eukaryotes. 1.2.2 Significant Background HIP1, SLA2 and CeHIPl CeHIPl is a member of a growing family of genes that includes human HIP I, human and mouse HIP1R, yeast SLA2, and the putative Drosophila protein CGI0972 (Adams et al., 2000; Holtzman et al., 1993; Kalchman et al., 1997; Seki et al., 1998). These proteins show identity to one another, and they share a similar arrangement of three predicted coiled-coil regions, as well as a C-terminal region similar to the C- terminus of the mammalian membrane associated protein talin (Hemmings, 1996; Yang et al., 1999). Talin contains at least three actin binding domains, one of which, amino acids 2269-2541, shares homology to a domain possessed by the family of CeHIPl related proteins (Hemmings et al., 1996). This domain is an F-actin binding motif, the I/LWEQ module and has been shown to bind filamentous actin in vitro (McCann and Craig, 1997). Analysis of these genes in their respective systems has outlined a role for this family. CeHIPl and homologs possess another motif, the ENTH (Epsin N-terminal homology) domain (Kay, 1999). This protein segment of approximately 140 amino acids, usually starting within the first 20 residues of the protein has been found in all eukaryotes. Although many of the proteins with this sequence share little homology 6 outside of the E N T H domain, many of the proteins are involved in endocytosis and/or regulation of cytoskeletal organization (Kay, 1999). The rat protein Epsin is known to bind to the E H (Epsl5 Homology) domains of Epsl5, a substrate for the epidermal growth factor tyrosine kinase with three E H domains (Tebar et al., 1996). Epsl5 is involved in clathrin-mediated endocytosis. Epsl5 localization has been observed in nerve terminals where clathrin-mediated endocytosis of synaptic vesicles takes place (Benmerah et a l , 1998; Chen et al., 1998). Thus, proteins with an ENTH domain have been placed amongst the milieu of proteins involved in clathrin-mediated endocytic events. 1.2.3 Yeast SLA2 Studies in yeast have shown that SLA2 is essential for correct organization of the cortical actin cytoskeleton (Holtzman et al., 1993). SLA2 (also known as END4 and MOP2) is also required for endocytosis and the accumulation and maintenance of a plasma membrane ATPase at the cell surface (Na et al., 1995; Raths et a l , 1993). Yeast cells lacking Sla2p display a temperature sensitive growth defect, being unable to grow at higher temperatures (Yang et al., 1999). The cells exhibit a disorganized actin cytoskeleton, their cell surface is disorganized and their cell surface growth is depolarized (Holtzman et al., 1993; Yang et al., 1999). Normally, cortical actin patches are spatially restricted to growing domains within the cell cortex. SLA2 null mutants no longer show this, instead actin patches are distributed evenly across the surface of the mother and the bud. Lastly, SLA2 mutants accumulate post-Golgi vesicles, possess an abnormally thick cell wall, and do not undergo the wild-type bipolar budding pattern. 7 Many of these defects are observed in mutants affecting the cortical actin cytoskeleton (Holtzman et al., 1993; Na et al., 1995; Raths et al., 1993). Deletion mutations of SLA2 are synthetically lethal with null alleles of several genes encoding components of the cortical actin cytoskeleton, ABP1, SRV2, SAC6, and GCS1. ABP1 encodes a protein containing a C-terminal Src homology 3 domain and an N-terminal A D F homology domain (Drubin et al., 1988; Lappalainen et al., 1997). SRV2 codes for a protein that binds to actin monomers as well as to adenyl cyclase, a component of the Yeast Ras signaling pathway (Lila et al., 1997). SAC6 encodes the actin filament-bundling protein fimbrin (Holtzman et al., 1993). GCS1 is a GTPase- activating protein for Ar f proteins in yeast that appear to have a direct effect on actin dynamics (Blade et al.r, 1999). The interactions of these genes suggest that Abplp, Gcslp, Sla2p, Sac6p, and Srv2p promote cytoskeletal dynamics (Yang et al., 1999). Sla2p is a component of the cortical actin cytoskeleton. Sla2p localizes to a subset of cortical actin patches, as well as to cortical patches that are free of actin. This pattern is in contrast to other actin binding proteins, such as Abplp or cofilin, which are present in all actin patches, but absent from patches devoid of actin. Additionally, treatment of cells with the actin depolymerizing drug latrunculin A (latA) displayed a cytoplasmic distribution of Abplp and cofilin, while Sla2p maintained cortical localization, and exhibited correct polarization in ~ 20% of the treated cells. These data suggest that Sla2p distribution is not wholly dependent on the F-actin binding domain (Yang etal., 1999). The introduction of different SLA2 deletion mutants into a null background has outlined a role for distinct regions of the protein. Sla2p appears to have a high level of 8 redundancy. N or C terminal deletions (separate, not both) of Sla2p do not greatly perturb functional activity, as localization to cortical patches is maintained. Both the Isl- and C-terminal domains of Sla2p contain a cortical patch localization signal, and it is likely this localization is responsible for viability. Additionally, the N-terminus of Sla2p, containing the E N T H domain, appears to localize to the cortex independently of actin. This domain displays cortical localization in cells lacking filamentous actin (Yang et al., 1999). Sla2p deletion mutants lacking the central coiled-coil domain exhibited no functional activity; the cytoskeleton was disorganized, but Sla2p was still localized at the periphery. The central coiled-coil domain is thought to bind other proteins and is believed to mediate Sla2p dimerization (Lupas, 1991; Yang et al., 1999). There is evidence for Sla2p existing in the cytoplasm in an inactive state, and through a series of unidentified signals activates Sla2p and promotes its localization to the cortex (Yang et al., 1999). It is worth noting that overexpression of the Sla2p talin-like domain results in death in SLA2 deletion cells. The cells display a disorganized cytoskeleton, and the filamentous actin of the cell appears to form large, cable-like structures (Yang et al., 1999). This may represent a titration of available filamentous actin to the F-actin binding module of Sla2p. This data sketches a complex cellular role for Sla2p; it has many functions in maintaining cortical actin cytoskeleton dynamics and when Sla2p is perturbed, the result is one of numerous defects to cell functioning. 9 1.2.4 H u m a n HIP1 and Mouse HIP1R Work from higher animal systems has suggested additional functions for the Sla2p related proteins. HIP1 was initially identified as a protein that interacted with human huntingtin. The strength of the interaction is inversely related to the size of the polymorphic polyglutamine tract of huntingtin. Thus, mutant huntingtin with a large polyglutamine repeat (greater than 35 repeats) interacts weakly with HIP1. The conserved central putative coiled coil domain of HIP 1 mediates this interaction (Kalchman et al., 1997). Thus, a model linking polyglutamine length, the pathogenesis of HD, and the interaction of huntingtin with HIP1 requires that their association be crucial for normal cellular function. Theoretically, the altered association of huntingtin with HIP1, as effected through the increased polyglutamine tracts, could lead to a disruption of biochemical events at the membrane causing premature cell death, and ultimately the clinical manifestations of HD (Kalchman et al., 1997). The function of HIP 1 is unknown, but its characterization has shown that it is enriched in the central nervous system and testes. HIP1 shows overlap with the areas of the brain that undergo neurodegeneration in HD (Kalchman et al., 1997). The identification of related gene products, HIP1R, and mouse HIP1 Related (mHIPIR), has led to the discovery of a link between the actin cytoskeleton and components of the endocytic machinery (Engqvist-Goldstein et al., 2000; Seki et al., 1998). mHIPIR can bind F-actin in vitro and colocalizes with F-actin in vivo, and this interaction is mediated through the I/LWEQ module. mHIPIR shows punctate immunolocalization and is enriched at the cell cortex and in the perinuclear region 10 (Engqvist-Goldstein, 2000). Additionally, mHIPIR colocalizes with markers for receptor-mediated endocytosis. First, mHIPIR is observed to colocalize with the coat protein clathrin, which is involved in budding of vesicles from the plasma membrane and the trans Golgi network (Hirst, 1998). mHIPIR and clathrin showed a similar subcellular distribution and were enriched at the cortex and perinuclear region. Colocalization was also observed for mHIPIR and the adaptor protein AP2, which is involved in budding from the plasma membrane during clathrin-mediated endocytosis (Hirst, 1998). The two proteins could be observed at the cell cortex, but AP-2 was absent from the perinuclear region. The last marker tested was transferrin, a component of endocytic vesicles (Hirst, 1998). mHIPIR colocalized with transferrin in early endocytic compartments. The colocalization of mHIPIR with components of the endocytic machinery is dependent on the N-terminal region, containing the ENTH domain, and the central coiled-coil domain. Expression of either the N-terminal or the central coiled-coil domain alone resulted in cytosolic, non-vesicular staining. Expression of constructs containing the talin-like domain with either the N-terminal or the central coiled-coil region resulted in colocalization with F-actin (Engqvist-Goldstein et al., 2000). 11 1.2.5 The Actin Cytoskeleton and Endocytosis Thus, from studies of this gene family, a network of physical and genetic interactions involving cortical patch proteins, kinases and components of clathrin-coated pit endocytosis is beginning to emerge. Both receptor-bound ligands and extracellular fluid enter animal cells through clathrin-coated pits (Mellman, 1996). The clathrin cage is composed of clathrin heavy and light chains and forms repeated triskelions that self-assemble into planar lattices. This structure is associated with clathrin adaptor complexes called AP2, which are associated with clustered transmembrane receptors. The planar lattices are thought to round up to form pits, which pinch off to form coated vesicles (Hirst, 1998). Dynamin, another pit-associated protein, is required for pinching off clathrin-coated vesicles from the plasma membrane (de Camilli et al.„ 1995). A combination of mammalian biochemistry and yeast genetics has furthered our understanding of endocytic trafficking (Rothman et al.„ 1996; Schekman et al.„ 1996). Endocytosis has been extensively studied through biochemical methods, mostly using physical association and copurification techniques (Mellman, 1996). Progress has been made using in vitro functional assays, such as early endosome fusion, but many parts of the pathway have not been reconstituted (Mukherjee et al., 1997). Genetic analysis, mainly from yeast, has made important contributions to the understanding of endocytosis, including the identification of connections between the endocytic pathway and the actin cytoskeleton (Drubin et al., 1988; Engqvist-Goldstein et al., 2000; Wendland et al., 1998; Yang et al., 1999). Genetic analysis in metazoan animals such as C. elegans and Drosophila has not been explored fully as of yet. As endocytosis is a mechanism that 12 allows a cell to interact with its environment, important aspects of endocytosis may differ between unicellular and multicellular organisms. One example is lipoprotein uptake, such as L D L or yolk endocytosis, which is an adaptation required for nutrient uptake and cellular homeostasis within multicellular organisms (Grant et al., 1999). Additional examples include growth factor receptor regulation during development, synaptic vesicle recycling in the nervous system, and antigen processing in the immune system (Mellman, 1996). Genetic analysis in Drosophila and C. elegans has provided insights into endocytic events. The Drosophila dynamin homologue shibire mutants, which were originally identified because of their generally impaired nervous system, demonstrated the importance of dynamin in pinching off clathrin-coated vesicles (de Camilli et al., 1995). Likewise, the study of general synaptic function genetically in C. elegans led to the discovery of the role of synaptotagmin in synaptic vesicle recycling (Jorgensen et al., 1995; Nonet et al., 1993). Most recently, a role for rme-2 (receptor mediated endocytosis), a member of the L D L receptor superfamily in receptor mediated endocytosis has been outlined for yolk uptake in the C. elegans oocyte (Grant et al., 1999). The contribution of the actin cytoskeleton, and accessory proteins to endocytosis is not known. There are numerous steps at which one can envisage their participation. The cytoskeletal components may localize the endocytic machinery to areas of the plasma membrane by physically restraining the machinery, or by directly associating with the components. The actin cytoskeleton may deform or invaginate the plasma membrane, which would aid the endocytic machinery in pinching off the plasma membrane 13 (Qualmann et al., 2000). Alternatively, the cortical cytoskeleton may need to be removed to allow endocytosis to proceed. The actin cytoskeleton is a rigid structure that inhibits membrane traffic, which could be overcome by localized actin turnover (Trifaro, 1993). The cytoskeleton may help drive detached endocytic vesicles through the cytoplasm, a theory supported by the visualization of various vesicle structures with actin comet tails (Merrifield et al., 1999). Thus, there are numerous ways in which the cytoskeleton could participate in endocytosis. The cytoskeletal contributions need not be mutually exclusive, or be common to all cell types and participate in all forms of vesicle formation (Qualmann et al., 2000). mHIPIR has been shown to colocalize with components of the endocytic machinery (clathrin and AP2) and has been shown to bind F-actin. Thus, mHIPIR may represent a link between F-actin and clathrin-coated endocytic structures. This may promote proper spatial organization of endocytosis, or actin dependent movement of newly formed vesicles, or both. (Qualmann et al., 2000). Perhaps CeHIPl is involved in this process. Further understanding into the role of HIP 1 in the normal and disease states in mammalian cells can be derived from studies of its yeast homologue, SLA2, its C. elegans homolog, CeHIPl, and from the mouse mHIPIR. Although the yeast and cell culture systems are excellent in which to study the respective gene's cellular function, C. elegans could provide insights into its potential developmental and tissue specificity. Even though the cell biology of the CeHIPl family of genes is likely to be conserved, CeHIPl's role may be dependent on when and where it is found in the developing animal. 14 Huntingtin has been shown to be essential for development in mice as the mouse huntingtin knockout is embryonic lethal, and is required through adulthood (Dragatsis et al., 2000; Nasir et al., 1995). Thus, it is suggested that HIP I may have a developmental role as well. Developmental questions are well suited to the C. elegans system, where several important issues can be addressed. What is the null mutation of CeHIPl! At what time, and where in development is the gene expressed? What interacting partners exist for CeHIPl? I have used a combination of gene disruption and molecular characterization techniques to study the role of CeHIPl in the context of animal development. This approach has allowed for an examination of CeHIPl's role in the nematode. This, in conjunction with the cellular and molecular findings from the aforementioned studies has allowed for a description of the function of CeHIPl in a simple animal system. This approach has implicated yet more unanticipated pathways, and may provide insights into the etiology of Huntington disease. 1.3 Forward and Reverse Genetics in C. elegans Genetic research can be thought to be of two schools, forward and reverse genetics. The directionality refers to whether one is moving from a phenotype to an associated sequence (forward) or from a sequence to an associated phenotype (reverse). Classical or forward genetics requires no prior knowledge of the gene or the gene product. It relies on the identification of genes based on phenotype. The phenotype can then be mapped and sequence correlated to it. The development of the second approach was contingent on the advent of sequencing technologies and the growing amounts of 15 sequence made available by the genomic and cDNA sequencing projects. Reverse genetics moves from a sequence of interest to the production of a mutant phenotype associated with said sequence. Forward genetic approaches laid the groundwork, demonstrating that specific sequence could give rise to a certain phenotype. The sequencing projects then demonstrated that there exist many sequences that are similar to well characterized genes, but had no mutants associated with them. Thus there has been a strong need to develop technologies that will allow one to proceed from sequence to phenotype. Both forward and reverse genetic procedures are available to researchers; the usage depends largely on the question one is asking. The reverse genetic techniques available to the nematode system are not as robust as that in other organisms. At the present time, there exists no method to generate a targeted mutation in the C. elegans. Homologous recombination based gene targeting systems have been highly successful in yeast and mouse systems, and it has recently been reported that the approach had been extended to Drosophila melanogaster (Niedenthal et al., 1999; Rong et al., 2000; Winzeler et al., 1999). It is hopeful that this method will soon be available to the nematode system. Reverse genetics in the worm consists of random mutagenesis followed by complementation to transgenic animals, site-selected mutagenesis and R N A interference (RNAi) (Fire et al., 1998; Janke et al., 1997; Moulder et al., 1998; Zwaal et al., 1993). Correlation of the physical and genetic maps is one method to ascribe phenotype to sequence. A successful application of this has come from screens for essential genes followed by transgenic rescue of the phenotype (Janke et al., 1997). As the gene 16 sequence is known, a transgenic animal carrying an extra copy of the gene can be constructed. The transgenic strain can then be tested for complementation against mutations in the vicinity. Another method consists of random mutagenesis of a population of animals followed by PCR screening to identify chromosomal rearrangements in the desired gene. At present there are two variations on the PCR based screen. The first makes use of transposon insertion and deletion to produce rearrangements (Ketting et al., 1997; Plasterk et al., 1999; Zwaal et al., 1993). Transposons are mobile genetic elements that integrate at various regions on chromosomes. When transposons are mobilized, they can insert into a gene, which may cause a mutation. Alternatively, a frameshift mutation can result through imperfect excision of the transposon, creating a small deletion or insertion in the gene. This rearrangement can be detected and followed by PCR. Primers flanking the gene of interest produce a discrete band in a wild-type background. Insertion or excision of a transposon will result in a respective increase or decrease in band size. The PCR based screen is sensitive enough to allow for large populations of animals to be assayed. Upon identification of a potential rearrangement, it is selected for from the siblings of the animals used in the assay through successive rounds of PCR and subdividing the population from whence it came. Ultimately, successful sibling selection results in the isolation of a single worm bearing the chromosomal rearrangement (Zwaal et a l , 1993). This method is not without caveats however, which have to do with the behavior of transposons. Transposon insertion is nonrandom as they will insert into A T rich sequence more frequently (Ketting et al., 1997; Plasterk et al., 1999). As most genes are 17 GC rich this means that transposons often insert into noncoding regions. Additionally, i f a transposon does insert into a gene, it can be spliced out of the message as if it were an intron (Rushforth et al., 1993). The major problem with this method is that i f the transposon inserts into a noncoding region of the gene and cannot be forced to undergo imperfect excision, no mutation of the gene is created. This procedure is labor intensive with no guarantee of a mutant phenotype even if a single worm bearing a PCR defined chromosomal rearrangement has been isolated. The second approach is a modification of the first. Transposons are replaced by chemical mutagenesis (Jansen et al., 1997; Moulder et al., 1998). In this approach oligonucleotides specific to the gene of interest are synthesized to generate a product of 3-4 kb. Nested PCR is used to screen mutagenized populations of animals for PCR products that are smaller than wild type, implying that a region of D N A between the primers has been deleted. As PCR is a sensitive technique, smaller products can be detected amidst wild type. Smaller products will be favored over larger ones through successive rounds of amplification. Thus, deletion bands can be followed and selected for until a single animal is identified. The obvious advantage of this approach over the transposon-based method is that animals isolated will bear a deletion in the gene of interest. The choice of mutagen is very important and several considerations must be made. The type of lesion induced by the mutagen is of utmost importance. Single nucleotide substitutions, small deletions, or chromosomal rearrangements can be generated with different mutagens. The frequency of mutation is also important; i f the frequency is too high, the production of accessory, or second site, mutations can 18 complicate the recovery and analysis of the desired mutant. Of course, if the frequency is too low, then the number of genomes that must be screened to recover a mutant may become prohibitive. For the PCR based screens, the mutagen must generate deletions small enough to fall between the primer sets, but large enough to be distinguished from wild type. The mutagen most often used in this procedure is ultraviolet light in the presence of trimethylpsoralen (UV-TMP). TMP is a D N A cross-linking agent which is activated by ultraviolet light (Cinibo et al., 1985). The cross-links are thought to be repaired by sequential nucleotide excision and recombinational repair. An error in this process can result in a deletion mutant. U V - T M P mutagenesis followed by inefficient repair generates mutations of various sizes, but they fall into three categories: very large deletions in excess of hundreds of kilobases, medium size deletions between 500 and 3000 nucleotides and small deletions ranging from 50 to 500 nucleotides (Gengyo-Ando et al., 2000; Yandell et al., 1994 and Dr. Erin Gilchrist, personal communication). This method has been used to generate numerous C. elegans deletion mutants (Dr. Don Moerman, personal communication). R N A i is a relatively new technique that is being used widely to study gene function in C. elegans (Fire et al., 1998). The introduction of double-stranded R N A into C. elegans often results in sequence specific gene silencing. In many instances R N A i results in a phenocopy of a null mutation in the targeted gene (Fire et al., 1998; Ketting et al., 1999). There are several methods to deliver dsRNA into the worm. A n early method consisted of synthesizing dsRNA in vitro and either introducing it into the worm through microinjection, or by soaking the animals in a dsRNA solution (Fire, 1998). Two 19 additional methods have been described recently. Worms can be fed bacteria expressing sense and antisense R N A under the control of an inducible promoter. The worms ingest the dsRNA along with the bacteria (Timmons et al., 1998). In the last approach, a transgenic strain of worms is created that contains a transgene that can produce dsRNA under the control of an inducible promoter (Tavernarakis et al., 2000). The methods are not equivalent in disrupting endogenous gene function. There is considerable anecdotal evidence suggesting that genes respond better to different delivery methods. There is evidence that R N A i phenotypes may differ from mutations in the same gene (Fire et al., 1998; Frase et al.r, 2000). The effectiveness of R N A i may be dependent on the spatial and temporal action of the gene of interest (Tavernarakis et al., 2000). Genes that are active early are particularly susceptible to R N A i , and the injection of dsRNA is very effective. Late acting genes, especially neuronally expressed genes, are refractory to R N A i for as of yet undetermined reasons (Fraser, 2000). The use of transgenes to generate R N A i in vivo has been successful in generating phenotypes for many, but not all, genes that had been otherwise resistant to R N A i from other delivery methods. While R N A i can be a powerful and forthright approach to determine gene function, the main disadvantage is that it is not a true genetic method. R N A i functions to deplete endogenous message, and this situation does not always recapitulate a null mutation. The effects of R N A i are transient, and do not often persist beyond the first generation. 20 1.4 Functional Approaches to Study CeHIPl With this information at hand, I will outline the approach I have taken to study the function of CeHIPl in C. elegans. When I initiated the study of CeHIPl, R N A i had not been described. Studies of SLA2 described defects in the cortical actin cytoskeleton and endocytic events. It was difficult to predict how a CeHIPl loss of function would manifest itself in C. elegans. A reverse genetic approach was undertaken to study the function of CeHIPl. Site selected mutagenesis screens of CeHIPl, following the U V - T M P protocol, in concert with the examination of preexisting mutants, were conducted in hopes of identifying a mutation of the CeHIPl locus (Moulder et al., 1998). Molecular characterization of CeHIPl was performed. Experiments were designed to study the temporal and spatial characteristics of CeHIPl, including gene expression and protein localization. These experiments were highly successful and provided valuable information about the role of CeHIPl in an animal system. Also, a screen was performed to identify potential interacting proteins of CeHIPl. This too was successful as it identified potential pathways in which CeHIPl may function outside of what had been described from other systems. The advent of R N A i ultimately allowed for the study of CeHIPl function. With this technique, I developed a system that identified multiple roles for CeHIPl in the nematode. The information provided within describes the function of an evolutionarily conserved gene with importance to human disease in a simple eukaryotic system. It is hoped that the understanding of CeHIPl will provide insights into the function of the related gene HIP I, and into the etiology of Huntington disease. 21 CHAPTER II Methods and Materials 2.1 Foreword The C. elegans research community is a cooperative and generous group. There are several resources available to all members (ACeDB, and the CGC) that were invaluable aids in my studies. Additional resources were gifts kindly donated by individual researchers. 2.2 Nematode Strains and Culture Conditions Caenorhabditis elegans strains were maintained on petri plates containing nematode growth medium (NGM) streaked with Escherichia coli OP50 as a food source (Brenner, 1974). The genetic nomenclature used follows that of (Horvitz, 1979). The wild-type N2 strain and mutant strains used were obtained from our laboratory or the C. elegans Genetic Stock Center unless otherwise noted. 2.2.1 Transgenic Strains Heritable lines of transgenic worms carrying various constructs were created by injecting the constructs along with pCeh361, which contains a wild type rescuing copy of dpy-5 into CB907 dpy-5 (e907) hermaphrodites following transformation methods described elsewhere (Fire, 1986; Mello, 1991). Strains made and injection conditions used: marker plasmid pCeh361 was injected at a concentration of 75 ng/ul. Test plasmids pCeh353, pCeh389, and pCeh391 were injected at various concentrations until stable integrants were obtained. Typically, I would start at a concentration of 20 ng/ul, 22 for a final concentration of 100 ng/ul with the marker plasmid. If no transformants could be obtained, the concentration of test plasmid was dropped from 10 to 5 and sometimes to 1 ng/pl until transformants were obtained. The final concentration of plasmid D N A was adjusted to 100 ng/ul with pBluescript SK+ D N A (Stratagene). 2.2.2 Integration of Transgenic Arrays Arrays were integrated by exposing 30-40 young adult hermaphrodites to 3500 rads from a 6 0 Co source. Animals were let grow to starvation, upon which pieces of agar were cut out of the petri dishes to new plates. Numerous (500 to 1000) animals carrying the wild type marker were picked individually to new plates and the segregation patterns of their progeny were observed. Animals giving rise to 100% wild type progeny were kept as candidates for successful integration. Strains were outcrossed several times, and assayed either through PCR, GFP fluorescence, or both. 2.3 Microscopy Microscopy was conducted at the Biosciences Electron Microscopy Facility at the University of British Columbia. Light microscopy was conducted on a Zeiss Axioscope, and recorded on a D V C Spot Camera. Confocal microscopy was performed on a Zeiss Axioscope with the Bio-Rad Radiance Plus system. 23 2.4 Preparation of Cloned DNA 2.4.1 Plasmid and Cosmid Isolation from Bacteria Preparation of D N A follows that of Sambrook et al. (1989). Briefly: 1.5 ml of an overnight culture was transferred to a microfuge tube and spun at 13,000 rpm for 1 minute. The supernatant was aspirated and the pellet resuspended in 100 ul of ice cold Solution I (50 m M glucose, 25 mMTrisCl (pH 8.0), and 10 m M ethylenediaminetetracetic acid (EDTA) pH 8.0). To this was added 200 ul Solution II (0.2 M N a O H , and 1% SDS). The tube was gently inverted several times and incubated on ice for 5 minutes. 150 ul of cold Solution III (3 M potassium acetate, 5 M glacial acetic acid) was added, the tube gently inverted and incubated on ice for 5 minutes. The tube was then spun at 13,000 rpm for 5 minutes. The supernatant was transferred to a fresh tube containing 900 ul cold 95% ethanol, and spun at 13,000 rpm for 5 minutes. The supernatant was aspirated, leaving behind a pellet, which was washed once with 150 ul of cold 70% ethanol. The pellet was air dried and resuspended in 20 ul TE (pH 8.0) with RNase A (25 ug/ml) and stored at -20°C. D N A for microinjection was purified with a Qiagen Spin Miniprep Kit following the manufacturer's protocol. 2.4.2 Plasmid isolation from Saccharomyces cerevisiae A 5 ml culture (with appropriate selection) was inoculated with a single colony and grown overnight at 30°C. The cells were pelleted in a microfuge (13,000 rpm), and 200 ul of lysis solution (2% Triton X-100,1% SDS, 100 mMNaCl , 10 mMTris pH 8.0, and 1.0 m M E D T A ) was added. To this was added 200 ul phenol/chloroform and 0.3 g 24 of 425-600 micron diameter glass beads (Sigma). The mixture was vortexed for 5-10 minutes, and placed in a microfuge and spun at 13,000 rpm for 5 minutes. The supernatant was removed to a fresh tube and the D N A was precipitated with 500 u.1 95% EtOH and 10 u4 of 7.5 m M ammonium acetate. The supernatant was removed and the pellet resuspended in 20 pi dFLO. 1 u4 was used for subsequent transformations into electrocompetent DH10B cells. 2.5 Transformation Strains used include: Escherichia coli strains DH5a, DH10B (GIBCO-BRL), and Epicurian coli SURE (Stratagene). The S. cerevisiae strain Y190 was used in all yeast experiments. 2.5.1 E. coli DH5ct Chemical transformation competent DH5a cells were thawed on ice, and 50 ul aliquots were transferred to pre-chilled 15 ml tubes. An appropriate amount of the ligation mix was added to each tube, gently swirled, and incubated for 30 minutes on ice. The tubes were heat-shocked for 45 seconds at 37°C, and quickly returned to ice for 2 minutes. 400 ul of L B media was added to each tube and each tube was incubated, with shaking for 60 minutes at 37°C. 120 ui of the transformed competent cells were transferred onto L B plates with the appropriate selection agents (Ampicillin at 30 ug/ml, or Kanamycin at 50 u.g/ml) and let grow overnight at 37°C. Colonies that appeared were picked individually into 2ml L B with the appropriate antibiotic and grown overnight at 37°C. Negative controls included transforming with 25 vector alone and positive controls consisted of transforming with a known concentration of plasmid DNA. D N A was prepared following as described above. 2.5.2 E. coli SURE cells Chemical transformation competent E. coli SURE cells are used to clone D N A with problematic secondary structure, such as inverted repeats (Stratagene). Cell aliquots were thawed on ice and gently mixed. 100 ul of the competent cells was transferred to prechilled 15 ml tubes. 1.7 ul 1.25 M (3-mercaptoethanol was added to the cells. The cells were placed on ice gently swirled every 2 minutes over the next 10 minutes. Approximately 50 ng of D N A was added to the cells and gently mixed. The mixture was incubated on ice for 30 minutes. The cells were heatshocked at 42°C for 30 seconds and returned to ice for 2 minutes. 900 ul of preheated (37°C) was added to the cells and incubated at 37°C with shaking for 60 minutes. 200 u,l of the transformation mix was plated onto L B plates with the appropriate selection. 2.5.3 E. coli DH10B Electrocompetent E. coli DH10B cells were used to recover plasmids from minipreparation from yeast cells. Transformation was done using a BioRad Micropulser Electroporation Apparatus (BioRad). The electrocompetent cells were thawed on ice. A fresh 1.5 ml microfuge tube and a 0.2 cm electroporation cuvette were also placed on ice. 40 ul of the competent cells was mixed with 1-2 ul of D N A in a cold microfuge tube. The solution was mixed well and incubated on ice for 1 minute. The micropulser was set to Ec2, the setting for 26 the 0.2 cm cuvette. The mixture was transferred to a cold cuvette, and the suspension was tapped to the bottom. The cuvette was placed in the electroporation apparatus and pulsed once. 1 ml of SOC medium was added to the cuvette. The cells were gently resuspended with a Pasteur pipette and transferred to a 15 ml polypropylene tube and incubated with shaking at 37°C for 1 hour. 100-200 ul of the transformation mix was plated on selective medium. 2.5.4 S. cerevisiae Y190 The yeast strain Y190 was used for transformations and assays. Yeast transformations were performed using a modified lithium acetate transformation protocol (Gietz and Schiestl, 1995). 5 ml of liquid Y P A D was inoculated with a single yeast colony, and grown overnight, with shaking at 30°C. The growth of the culture was measured (its optical density measured) and used to inoculate 50 ml of warm Y P A D to a cell density of OD600 = 0.05. The culture was incubated at 30°C with shaking until it reached a density of OD600 = 0.2-0.3. The culture was harvested in a sterile 50 ml centrifuge tube at 5,000 rpm for 5 minutes. The supernatant was poured off, and the cells resuspended in 25 ml of sterile dFLO and centrifuged again. The supernatant was poured off and the cells were resuspended in 1.0 ml 100 mM lithium acetate and transferred to a 1.5 ml microfuge tube. The cells were pelleted at top speed for 15 seconds, and the lithium acetate was removed with a pipette. The cells were resuspended in a final volume of 500 pi of 100 mM lithium acetate. A 1.0 ml sample of salmon sperm carrier D N A (2.0 mg/ml, Sigma, S3126) was boiled for 5 minutes, and quickly chilled in ice water. The cell suspension 27 was vortexed and distributed in 50 ul aliquots and stored on ice. The cells were pelleted and the lithium acetate removed. The transformation mix consists of 240 ul PEG (50% w/v), 36 pi 1.0 Mlithium acetate, 25 ul salmon sperm D N A (2.0 mg/ml), and 50 pi water and plasmid D N A (0.1-10 pg). The ingredients were added in the order listed. The tubes were vortexed vigorously until the pellet had been completely mixed. The tubes were then incubated at 30°C for 30 minutes. The samples were then heat-shocked in a water bath at 42°C for 20 - 25 minutes, and then placed in a microfuge and spun down at 6,000 rpm for 15 seconds. The transformation mix was removed with a pipette and 1.0 ml of sterile dH^O was added and the pellet was resuspended by gently pipetting up and down. Between 100-200 pi of the transformation mix was plated onto the appropriate synthetic dropout (SD) plates. The plates were incubated at 30°C for 2-4 days. Yeast Selection Synthetic dropout is a minimal media used in yeast transformations to select and test for specific phenotypes. SD medium is prepared by combining a minimal SD base (nitrogen base and a carbon source) with a stock of dropout solution that contains a specific mixture of amino acids and nucleosides. SD medium is prepared as follows: 6.7 g Yeast nitrogen base without amino acids, 20 g Agar (for plates only), 850 ml H 2 O , 100 ml of the appropriate sterile lOx dropout solution or the required amount of DO Supplement powder (CSM -HIS-LEU-TRP, BIO 101, Inc.). Adjust pH to 5.8 if necessary, and autoclave. Allow medium to cool to ~ 55°C before adding 3-AT, or X-gal. Add the appropriate sterile carbon source, usually dextrose (glucose) to 2%. Adjust final volume to 1 L. 28 The three selection markers used in this study were tryptophan, leucine, and histidine. pGBT9 G A L 4 binding domain vectors contain the TRPT marker, allowing for selection on SD media missing tryptophan (SD - TRP + L E U + HIS). The pACT2 and pGADIO GAL4 activation domain vectors contain the LEU2 marker, which allows for selection on media without leucine (SD + TRP - L E U + HIS). Selection for transformants containing both plasmids, pGBT9 with either pACT2 or pGADIO was done with media missing tryptophan and leucine (SD - TRP - L E U + HIS). The yeast two-hybrid screen relies on the activation of the HIS3 (or lacZ) reporter gene to allow for growth on media missing histidine. If the two fusion proteins, the GAL4 binding domain fusion protein and the activation domain fusion protein, interact, the HIS3 gene will be activated through the reconstitution of a functional G A L 4 protein. Thus, potential interacting proteins can be identified as transformants able to grow on media without tryptophan, leucine and histidine (SD - TRP - L E U -HIS). 2.6 D N A Sequencing D N A to be sequenced was prepared by various methods depending on the source. A typical sequencing reaction consisted of: template D N A (250-500 ng), 8.0 ul terminator premix (PCR buffer, dinucleotide triphosphates (dNTPs), and D N A polymerase), 3.2 pmol primer, and dH20 to 20 ul. The thermal cycling program used was: 25 cycles of 96°C for 30 seconds, 50°C for 15 seconds, 60°C for 4 minutes, followed by incubation at 4°C. D N A was precipitated in ethanol and dried in a vacuum centrifuge. Sequencing was carried out with an automated sequencer (Applied Biosystems) at the Nucleic Acids Protein Services Unit, University of British Columbia. 29 2.7 Electrophoresis 2.7.1 Agarose Gel Electrophoresis Agarose gel electrophoresis was used to determine the size of restriction fragments, PCR products and estimate the concentration of D N A samples. Gel concentrations ranged from 0.6-1.5 % w:v agarose in 0.5_ TBE electrophoresis buffer (1_ TBE: 0.045M Tris, 0.045M boric acid, 0.001M EDTA pH8.0) with 0.1 ug/ml ethidium bromide. Samples were loaded with a one-sixth volume of 6_ loading buffer (40% w:v sucrose in water, 0.25% bromophenol blue, 0.25% xylene cyanol). The mixed samples were loaded with a pipette into wells of the agarose gel. Electrophoresis was performed at 80-120V for one to two hours in 0.5_ TBE running buffer containing 0.1 ug/ml ethidium bromide. An ultraviolet transilluminator (300nm wavelength) was used to visualize the D N A . Size and concentration estimates were made by comparison to known molecular weight and concentration standards run alongside the samples 2.7.2 Polyacrylamide Gel Electrophoresis Polyacrylamide electrophoresis was used to for the analysis of proteins. 8 - 10% polyacrylamide gels were made by combining 30% acrylamide mix (29.2% acrylamide and 0.8% N, N'- methylene-bis-acrylamide), 1.5 MTris pH 8.8, 10% sodium dodecyl sulfate (SDS), 10% ammonium persulfate (APS), and TV, N, N', N', tetramethylethylenediamine (TEMED) and dT^O to get a final concentration of 8-10% polyacrylamide, 0.38 MTr i s pH 8.8, 0.1% SDS, 0.1% APS, and 0.8% TEMED. This gel, the resolving gel, was cast using the BioRad Gel Cast system. Briefly, the mixture was poured between two glass plates separated by a spacer. A volume of isopropanol was 30 overlain to promote solidification of the gel. Once set, the isopropanol was washed out and the stack was poured. The stack was made by combining 30% acrylamide mix, 1.0 MTr i s pH 6.8, 10% SDS, 10% APS, and TEMED and d H 2 0 to get a final concentration of 5% polyacrylamide, 0.125 MTris pH 6.8, 0.1% SDS, 0.1% APS, and 0.01% T E M E D , and pouring over top of the running gel. A comb was inserted into the stack and the gel was allowed to solidify before use. After the gel had polymerized, it was placed in a vertical electrophoresis chamber and filled with l x running buffer (10x Laemmeli Running buffer: 30.3 g Tris base, 144.2 g glycine, 10 g SDS, pH to 8.3, and volume to 1 L). Protein samples were loaded with an equal volume of 2x sample buffer (62.5 m M Tris pH 6.8, 2% SDS, and 10% glycerol) along with the appropriate molecular weight marker. The samples were run at 80-90 V through the stack, and 110-120 V through the resolving gel. The gel was run until the marker dyes had migrated to the bottom of the resolving gel. Separation was visualized with a staining solution (0.25% Brilliant Blue G, Sigma, 50% methanol, and 10% acetic acid). The gel was stained for 10-15 minutes before being washed with a destaining solution (7% glacial acetic acid, and 5% methanol). The gel was destained until the desired resolution was obtained. Gels were dried by mounting onto Whatman filter paper and dried for approximately 45 minutes in a vacuum gel drier at 80°C. 31 2.8 D N A Analysis Analysis of D N A sequence was conducted with the following computer programs: D N A Strider, Amplify, B L A S T (ncbi.nlm.nih.org), ClustalW (Thompson, 1994), wwvv.sgi.com/chembio/resources/clustalw/parallel^clustalw.html), Boxshade (Huffman and Baron , www.isrec.isb-sib.ch/pub/), COILS (Lupas, 1991), at http://dot.imgen.bcm.tmc.edu:9331/) ACeDB (AC. elegans Database, documentation, code, and data available from anonymous FTP servers at lirrnm.lirmm.fr, cele.mrc- lmb.cam.ac.uk and ncbi.nlm.nih.gov), and WormBase (www.wormbase.org). 2.9 Polymerase Chain Reaction PCR was optimized on single worms. A typical reaction consisted of: 5 pi template D N A , 2.5 pi 10_ PCR buffer, 2.5 ul 25 m M M g C l 2 , 4 pi 1.25 mMdNTPs (Pharmacia), 100 ng forward primer, 100 ng reverse primer, 2.5 Units Taq D N A polymerase (Qiagen), and d H 2 0 to 25 pi. Thermal profiles for all amplification was: 40 seconds at 94°C, followed by 30 cycles of 30 seconds at 94°C, 30 seconds at primers averaged T m (54-64°C), 2 minutes at 72°C, followed by a final extension of 7 minutes at 72°C, and cooling and holding at 4°C. To estimate melting temperature (Tm) for an oligo, the following formula was used: T m = (2°C _ (A+T)) + (4°C _ (G+C)). 2.10 Restriction Digests Restriction digests were used to check the integrity of plasmid clones, to provide D N A for molecular cloning procedures, and to provide template for R N A transcription experiments. Restriction enzymes were obtained from either Gibco-BRL or New 32 England Biolabs. The amount of D N A digested was dependent on the application. The buffers used were those recommended by the manufacturer. A l l restriction digests were carried out for at least one hour at the appropriate temperature with at least a two-fold excess of enzyme. 2.11 Subcloning 2.11.1 Cloning of the CeHIPl cDNA EST clone yk5hl2, which encodes the near full length CeHIPl coding region, was obtained form Yuji Kohara (National Institute of Genetics, Japan). Isolation of cDNA clones is presented below: Preparing cDNA Clones A 2 ml culture of XL-1 Blue M R F ' (Stratagene) cells was grown overnight n L B supplemented with 0.2% maltose and 10 m M MgS04. The next day, 5 ml of supplemented L B was inoculated with 0.1 ml of the overnight culture and grown to an OD600 = 0.5. The culture was then stored at 4°C. Phage stocks were diluted in suspension media (SM, 100 mMNaCl , 10 m M M g S 0 4 , 50 m M Tris-Cl, pH 7.5) to concentrations of 1/100, 1/1,000, and 1/10,000. 200 ul of.the XL1 Blue M R F ' cells was added to each dilution and incubated at 37°C for 15 minutes. 3.5 ml of N Z Y top agar was added to each tube and plated on N Z Y plates (NZY, 0.5 L, 5 g N Z amine, 2.5 g NaCl, 2.5 g bacto-yeast extract, and 1 g MgSC»4x7 H2O, with 3.5 g agarose for the N Z Y top agar). The plates were incubated at 37°C overnight. The next day the plates were examined for the presence of plaques. Individual plaques were cored with a Pasteur 33 pipette and dispersed in 1.0 ml of SM. To this was added two drops of chloroform, and the mixture was stored at 4°C. To prepare for phage excision 2 ml overnight cultures of XL-1 Blue M R F ' and X L O L R (pRF', Stratagene) were grown in supplemented L B . The next day separate 25 ml of L B was inoculated with 0.5 ml of the overnight cultures and grown until OD600 = 1.0, and then stored at 4°C. In a 50 ml tube was added 200 pi XL1 Blue M R F ' cells, 250 pi of the phage stock, and 1.0 pi ExAssist Helper Phage (Stratagene). The mixture was incubated at 37°C for 15 minutes. To this was added 3.0 ml of L B , and the mixture was further incubated at 37°C for 2.5 hours to overnight. The tube was then heated at 70°C for 15 minutes to kill the cells, and centrifuged at 4,000g for 15 minutes to pellet the debris. The supernatant, which contains the excised filamentous phagemid, was transferred to a sterile tube and stored at 4°C. 200 pi of the X L O L R cells were transferred into 1.7 ml microfuge tubes. To these was added 10 pi and 100 pi aliquots of the excised phagemids, and the mixture was incubated at 37°C for 15 minutes. 50 pi of each mixture was plated onto L B ampicillin plates and incubated overnight at 37°C. The next day, individual colonies were picked and streaked onto new plates and again incubated overnight at 37°C. Several of the resultant colonies were picked into 2 ml L B ampicillin cultures and grown overnight at 37°C. D N A was prepared as described elsewhere and used to transform DH5a cells (also described elsewhere). Restriction digests and sequencing of miniprepared D N A was conducted to confirm the identity and integrity of the clones. 34 Cloning the Full Length CeHIPl cDNA Clone yk5hl2 is 8 bp short of the full length CeHIPl message at its 5' end. Oligonucleotides (provided by Dr. M Hayden, University of British Columbia) were synthesized to amplify the full length CeHIPl cDNA off of yk5hl2 and add in the missing 5' end. Specifically, PCR was done using CeHIP-f 5' gagcccggggatggatcatcgtgctcaagcgcgcgaggtatt (Smal site underlined) and CeHIP-r 5' gccactactggatccttaaaaactaaccttgttcgcaac (BamHl site underlined) with a long range PCR kit (Expand Long Template PCR System, Boerhinger Mannheim). The 2.9 kb fragment was gel purified (QiaQuick Gel Extraction Kit, Qiagen, Germany) and digested with Smal and BamHl. The fragment was cloned into pBluescript-SK using Smal and BamHl ligation sites following standard molecular biology protocols (Sambrook et al. 1989). A typical ligation reaction consisted of l x T4 D N A ligase buffer, 50-100 ng vector D N A , 100-200 ng insert DTsfA, 400 Units T4 D N A ligase, and dH 20 to 10 pi. The mixture was incubated overnight at 4°C, and transformed into the appropriate competent cells. This clone, named pCeh352, was sequenced on both strands to confirm its identity (figure 2.1). 2.11.2 Construction of CeHIPl::GFP Reporter Oligonucleotides KRp 244 5' cgctgcagttctcctctctgcccatttc (Pstl site underlined) and KRp 245 5' ccggggatocgcttgagcacgatgatccat (BamHl site underlined) were synthesized to amplify the putative CeHIPl promoter region and some coding elements (from -1067 To +18, with the initiation of transcription site being +1). This fragment was amplified with Pfu Turbo (Stratagene) and cloned in frame with the pPD95.70 GFP 35 C e H I P - f 1 k b C e H I P - r Long range PCR C e H I P - f 5' gagcccggggatggatcatcgtgctcaagcgcgcgaggtatt (Smals'rte underl ined) C e H I P - r 5' g c c a c t a c t g ^ a t c c t t a a a a a c t a a c c t t g t t c g c a a c (BamHIsite under l ined) L igat ion into p G B T 9 [BamHl, Smal] Clone p C e h 3 5 0 L igat ion into p A C T 2 [BamHI, Smal] Clone pCeh.351 L igat ion into p B S S K [BamHL, Smal] Clone pCeh.352 Figure 2.1 Cloning of pCeh350, pCeh351, and pCeh352. 36 genomic transformation vector (provided by Dr. Andy Fire, Carnegie Institute of Washington, Baltimore, MD). The resulting clone was named pCeh353 (figure 2.2). 2.11.3 CeHIPl ::GST Fusion Protein A portion of the CeHIPl cDNA, from clone pCeh352, was amplified with oligonucleotides KRp300 5' gcggatecgcagaattgaaagcaacggcag (BamHl site underlined) and KRp301 5' tcgcccgggtgattggcgtgtgattctcg (Smal site underlined) with Pfu Turbo polymerase. The 357 nucleotide fragment (which corresponds to nucleotides 1224 to 1560 of the CeHIPl coding region and amino acids 408 to 520 of the polypeptide) was purified and digested with BamHl and Smal, gel purified and ligated in frame into the multiple cloning site of pGEX-4T-l (GST Gene Fusion System, Pharmacia Biotech). The pGEX-4T-l vector generates recombinant proteins with a carboxy-terminal GST tag. The resulting clone was named pCeh365 (figure 2.3). 2.11.4 CeHIPl Overexpression Construct Clone pCeh391 was constructed by amplifying the full length CeHIPl cDNA with primers KRp355 5' gcttaggctagcatggatcatcgtgctcaagcg (Nhel site underlined), and KRp356 5' cggggtaccccttgttcgcaaccaactgagcc (Kpnl site underlined), with Pfu Turbo polymerase. The PCR product was digested with Nhel and Kpnl, gel purified and ligated into the corresponding sites of the heat shock vector pPD49.78 (provided by Dr. Andy Fire). 37 2.11.5 RNA Interference Constructs Clone pCeh352 was digested BamHl and Eco47lll, which cuts twice within the CeHIPl coding region. The resulting 3443 base pair fragment was gel purified and religated. The resulting clone, named pCeh372, contains the first 1309 base pairs of the CeHIPl cDNA. In vivo R N A interference constructs were cloned in a two step process. First, oligonucleotides CeHIP-f and KRp328 5' cgtggtacctcggaatctggaacgatgac (Kpnl site underlined) were used to amplify a 732 bp fragment of the CeHIPl cDNA off pCeh352 using Pfu Turbo polymerase. The fragment was purified and cloned into the Smal and Kpnl ligation sites of the heat shock promoter 16.2 vector pPD49.78. The resulting clone was named pCeh386. Secondly, to produce an inverted repeat of the CeHIPl cDNA, pCeh386 was digested with Smal and Kpnl to remove the 732 nucleotide fragment, which was then subcloned into a fresh pCeh386 that had been cut with Kpnl and EcoRV, and transformed with SURE cells (Stratagene). The resulting clone contained an inverted repeat of the 732 nucleotide CeHIPl cDNA, and was named pCeh389. The integrity of the clone was confirmed through multiple restriction digests (figure 2.4). 2.11.6 Yeast Two-Hybrid Constructs The full length CeHIPl cDNA was amplified by long range PCR with CeHIP-f and CeHIP-r, gel purified, digested with BamHI and Smal and cloned into the multiple cloning site of the yeast two-hybrid binding domain pGBT9 vector (Clontech). The resulting clone was sequenced to confirm its identity and named pCeh350. 40 CcHIP-f KRp328 pCeh.352 High fidelity PCR (Pfu Turbo) CeHTP-f f 5' gagcccggggatggatcatcgtgctcaagcgcgcgaggtatt (Smal site underlined) KRp328 328 5' cgtggtacctcggaatctggaacgatgac (Kpnl site underlined) Digestion with Smal and Kpnl Ligation into pPD49.78 [Smal, Kpnl] Clone pCeh386 / hspl6-2 / S m a l Kpnl ' EcoRV pCeh386 pCeh386 digested with Kpnl and Smal and CeHIPl fragment [Kpnl, Smal] ligated into new pCeh386 [EcoRV, Kpnl] Clone pCeh389 Smal/EcoW destroyed pCeh.389 Figure 2.4 Cloning of the RNAi Construct pCeh389. The CeHIPl cDNA was subcloned into the yeast two-hybrid activation domain vector pACT2 (Clontech), at the BamHl and Smal sites. The resulting clone was sequenced to confirm its identity and named pCeh351. Clones used to map the protein-protein interactions of CeHIPl were generated through restriction digests and subsequent religation of pCeh350. Clone pCeh374 was made by digesting pCeh350 with Smal and Styl, which removes the first 1628 nucleotides of the 2779 nucleotide CeHIPl cDNA. The protruding 5' end left by digestion with Styl was filled in with 1 Unit of the large fragment of D N A Polymerase I, or the Klenow fragment, along with 0.5 m M dNTPs, and incubated at room temperature for 30 minutes. The large fragment (~ 7.1 kb) was gel purified, to which was added D N A ligase, and the ligated circular vector was transformed into DH5ci cells (methods described previously) (figure 2.5). Clone pCeh375 was generated through digestion of pCeh350 with BamHl and Styl, which removed the last 1151 nucleotides of the CeHIPl cDNA. Protruding 5' ends were filled as described, and the larger fragment (~ 6.6 kb) was gel purified, religated, and transformed into DH5a cells. Dr. Michael Hayden kindly provided human huntingtin and HIP1 clones. Clones include 16pGBT9, which contains the coding sequence for the first 540 amino acids of human huntingtin with 16 glutamine repeats, ligated at the Smal site of the GAL4-DNA- binding domain of the yeast two-hybrid vector pGBT9. The HIP1 clone contained nucleotides 714 to 1871 of the full length HIP1 cDNA cloned into the GAL4 activation domain of the yeast two-hybrid vector pGADIO. 42 ) 2.12 PCR Mapping of Deficiencies 2.12.1 Preparation of Template DNA from Embryos Animals homozygous for the deficiencies used in this experiment were embryonic lethals. Heterozygous adult hermaphrodites were allowed to lay eggs for 12-16 hours and removed to a new plate. The embryos were let hatch for 12-16 hours at 20°C. Animals that failed to hatch were presumed to be homozygous for their respective deficiency, and were used in the subsequent PCR mapping experiments. Arrested embryos were transferred to an area of the plate without bacteria, to which was added 3-4 ul of chitinase solution (20 mg/ml chitinase, Sigma, 50 mMNaCl , 70 m M K C l , 2.5 m M M g C b , and 2.5 m M CaCL). The eggs were let sit for 5 minutes, or until the solution had absorbed into the agar. Single eggs were picked with a piece of fishing line that had been cut to be of a length smaller than a microfuge tube. The fishing line was cut with blunt scissors to provide a rough, frayed end, which facilitates egg transfer. A pair of tweezers was used to pick up the fishing line. Transfer was observed under the dissecting microscope. The fishing line and single egg were transferred into a microfuge tube containing 5 pi lysis buffer (1_ PCR buffer, Qiagen, 1.5 m M M g C l 2 , and 60 pg/ml Proteinase K, Gibco-BRL). Mineral oil was added along the length of the fishing line to help wash the egg into the lysis buffer. The samples were briefly spun at full speed in the microfuge, and placed at -70°C for 10-15 minutes. The samples were placed in thermocycler (Perkin Elmer-Cetus D N A Themal Cycler), and the eggs were digested at 65°C for 60 minutes, followed by inactivation of the enzyme at 95°C for 15 minutes. The lysed embryos were stored at - c 44 70°C. To prepare template D N A from single worms, the chitinase digestion was omitted, and animals were transferred to the lysis solution with a worm pick. 2.12.2 P C R Mapping of Deficiency Homozygotes Two primer sets were used in each PCR for deficiency mapping experiments. A l l reactions were run in duplicate with multiple samples. Mapping experiments consisted of PCR with test primers, and positive and negative controls in all combinations. Positive controls were primer sets used to amplify D N A from LGI that should not be deleted as the deficiencies being studied mapped to LGIII. Negative controls were primer sets amplifying D N A predicted to be deleted by genetic mapping experiments. Test primers that produced no PCR product, along with the appropriate controls, indicated that the deficiency in question deleted the D N A from which the test oligonucleotides were designed. Amplification of the test primers demonstrated that the deficiency did not delete the D N A in question. Oligonucleotides used in the mapping experiments include: KRp 47 5' attctatccgaatcctccga, and KRp94 5' ggtttcgatacttctggcgt, which amplify a 275 nucleotide fragment corresponding to the bli-4 (LGI) coding region, K R p l 12 5' ctgcatgtttctgggtcc, and K R p l 13 5'caggcgtctttcagtgcg, which amplify a 360 nucleotide fragment corresponding to the C. elegans rad-3 homologue, (LGI), K R p l 76 5' cccaatgccaaaatacttgg, and KRpl77 5' gtctggtcactcaatgattc, which amplify a 270 nucleotide fragment corresponding to the dpy-19 (F22B7.10, LGIII) coding region, KRp 178 5' gtcactagatggacgatctg, and K R p l 79 5' cggcaatatatcacatgagg which amplify a 674 nucleotide fragment corresponding to the sma-2 (ZK370.2, LGIII) coding region, KRp 45 300 and KRp301 which amplify a 976 nucleotide fragment corresponding to CeHIPl (LGIII), and KRp347 5' gcaggatctggaggactttc, and KRp348 5' cggcataggcattgaagtaa, which amplify a 442 nucleotide fragment corresponding to unc-32 (ZK637.10, LGIII) coding region. 2.13 Site Selected Mutagenesis Screen This methods follows that described by Moulder and Barstead (http://snmc01.omrf.uokhsc.edu/revgen/RevGen.html, 1997). 2.13.1 Growth and Synchronization for Mutagenesis N2 worms were grown on 5-10 150mm rich N G M (RNGM, equivalent to 3_ N G M ) agarose plates until a large population of gravid adults was obtained. The animals were washed off of the plate with M9 buffer (22 m M K H 2 P 0 4 , 22 i r iMNa 2 HP0 4 , 85 m M NaCl, 1 mMMgS04), and briefly spun in a clinical centrifuge (1100 rpm, 5 minutes). To the worms was added 10 volumes of basic hypochlorite (0.25 m M K O H , 1-1.5% hypochlorite, made fresh), and incubated at room temperature for 10-15 minutes with occasional mixing. The extracted eggs were washed 4-5 times with 10 volumes of M9 buffer. The eggs were distributed over 15-20 R N G M plates seeded with E. coli. The animals were let grow until the majority was at the late L4 or young adult stage (approximately 52 hours at 20°C). 46 2.13.2 Mutagenesis To the suspension of worms in M9 was added an equal volume of M9 containing 4, 5', 8-trimethylpsoralen (Sigma) at 60 ug/ml (from a stock at 3 mg/ml in dimethyl sulfoxide). The worm suspension was incubated for 15 minutes, in the dark at room temperature. The worms were then transferred, in the dark, to a sterile 15 cm petri dish and the suspension was irradiated with 360 nm U V light for 90 seconds at 340 \i W/cm 2 with gentle shaking. The U V source was assembled from a Blak Ray UVL-21 clamped to a ring stand and calibrated to the desired dosage. The mutagenized worms were collected by washing with M9 and distributed over 10-15 R N G M plates seeded with E. coli. and allowed to grow for 24 hours in the dark at 20°C. The F l eggs were collected by treating the worms with basic hypochlorite, as previously described. The eggs were allowed to hatch overnight on a R N G M plate without E. coli. 2.13.3 Library Plating The worms were collected with M9 buffer and an estimate of the number of worms was made from spotting several volumes of the suspension onto plates and counting. The worm suspension was adjusted to make a concentration of 500 worms/0.25 ml. The worms were then distributed in aliquots of 500 worms over 1152 60 mm OP50 seeded R N G M plates using a repeating pipettor. The plates were stored in groups of 96, and allowed to grow at 20°C for 5 days. 47 2.13.4 Library Harvest The plates were numbered in groups of 96 and placed in stacks of 6. To each plates in the stack was added 1.5 ml of sterile dH20 containing streptomycin (100 u,g/ml, Sigma) and mycostatin (12.5 ug/ml, Sigma). The plates were gently rocked to dislodge the worms, and 200 u.1 of the suspension was transferred to a well of a deep, 96 well microtiter plate (DyNa Block 1000 deep well microplates, Midwest Scientific) containing 200 | i l of lysis solution (2_ PCR buffer, 3 m M M g C l 2 , and 200 ug/ml Proteinase K ,Gibco-BRL). The worm plates were stored at 10°C to slow development. The blocks were sealed with a flexible mat lid (Flexible mat lid, 96 well, Midwest Scientific), and taped down to prevent mixing between wells. The worms were frozen at -70°C for 20-30 minutes. The blocks were incubated, with occasional mixing, overnight at 65°C. The blocks were spun down in a clinical centrifuge equipped with bucket carriers at 1,100 rpm for 30 seconds. A 50 ul aliquot from the well of each block was transferred to a single 0.2 ml PCR tube, arranged in strips of 12. The tubes were capped and incubated at 94°C for 20 minutes to inactivate the Proteinase K. The blocks and template D N A were stored at -70°C. 2.13.5 P C R Screening Nested PCR was used to screen for deletions of CeHIPl. The primer sets used to screen for deletions were approximately 3000-3500 nucleotides apart. Oligonucleotides include KRpl57 5' gaggtattcgttcgagctca, KRpl63 5' agccagaaccttcttgcact, KRpl64 5' gtgccaagtcatatctcctc, KRpl65 5' ctgacaagagtccttctgtc, KRp228 5' ttcatagtcaagttcctcca, KRp229 5' catttcttctttcttcgcag, KRp230 5' agagccacaacaagcgagtc, KRp233 5' 48 aaccgagagagcgtccaatc. The PCR reactions were done in 96 well PCR trays (MJ Research) sealed with dimpled rubber mats (Perkin Elmer). First Round PCR: Each reaction was 25 pi in volume and contained: 5 pi template D N A , 2.5 pi M g C l 2 , 4 pi 1.25 mMdNTPs, 100 ng forward outside primer, 100 ng reverse outside primer, 2.5 Units Taq D N A polymerase, and dF^O to 25 pi. Thermocycling conditions were: 2 minutes at 94°C, followed by 30 cycles of 40 seconds at 94°C, 30 seconds at 58°C, 2 minutes at 72°C, followed by a final extension of 7 minutes at 72°C, and cooling and holding at 4°C. Second Round PCR: Each reaction was 25 pi in volume and contained: 2.5 pi MgCb, 4 pi 1.25 m M dNTPs, 100 ng forward inside primer, 100 ng reverse inside primer, 2.5 Units Taq D N A polymerase, and dFbO to 25 pi. Template D N A for second round amplification was transferred from the first round reaction using a 96-pin replicator (Boekel Replicator). The volume transferred was not considered significant. 2.13.6 Identification of Deletion Candidates and Sib-Selection 1,152 nested PCR reactions were conducted and visualized through standard gel electrophoresis configured for the analysis of samples in microtiter arrays. Equipment used included: 12 channel pipettors (Eppendorf) and an electrophoresis system capable of handling 200 samples at a time (Owl Scientific). Samples that show bands smaller than wild type were selected for further analysis. Five PCR's were set up for each putative deletion. If the same size band resampled, it was considered a valid candidate and sib selection was initiated. 49 2.13.7 Sib-Selection Plates that had given putative deletion candidates were taken from the 10°C incubator, and a portion of the population was distributed over 96 new 60mm R N G M plates seeded with E. coli at a concentration of 50 worms/plate. The plates were let grow for 4-5 days at 20°C and the population was harvested, template D N A prepared, and PCR screening conducted as described previously. No candidates resampled after the first round of selection. Several of the putative deletion bands were sequenced, which confirmed they were indeed deletions of CeHIPl. 2.14 R T - P C R Developmental stage specific RNA (obtained from V. Vijayaratnam) was used to make first strand cDNA (RT-PCR Kit, Life Technologies). The procedure is as follows: 1.3 pi of R N A (1.5 pg/pl), 1.0 pi of 10 p M adaptor primer KRp75 5'- ggccacgcgtcgactagtacttttttttttttttttt, and dLLO to 15.5 pi was added to a microfuge tube. The mixture was placed at 70°C for 10 minutes, on ice for 1 minute, and quickly spun down in a microfuge. Next was added 2.5 pi of 10 x PCR buffer, 2.5 pi of 25 m M M g C l 2 , 1.0 pi of 10 mMdNTP mix, and 2.5 pi of 0.1 M D T T , to a total of 24 pi. The tube was gently mixed, briefly microfuged, and incubated at 42°C for 1 minute. To the tube was added 1.0 pi of Reverse Transcriptase (5 Units/pl). The tube was then incubated at 42°C for 50 minutes. The tube was placed at 70°C for 15 minutes, and then briefly spun down. The tube was placed at 37°C for several minutes, to which was added 1.0 pi of RNase mix, and the mixture was incubated at 37°C for 30 minutes. The tube was spun down and stored at -20°C. 50 PCR amplification was performed with either oligonucleotide KRp59 5' ataagaatgcg gccg gggttttaacccagttactca (splice leader sequence SL2 underlined) or KRp60 5' ataagaatgcggccgcggtttaattacccaagtttg (splice leader sequence SL1 underlined) with the CeHIPl specific primer K R p l 55 5' gaggtattcgttcgagctca. The results were visualized with standard agarose gel electrophoresis techniques. 2.15 Protein Work 2.15.1 Expression and Protein Purification of CeHIPl pCeh365 was transformed into DH5a cells and cultured in 500 ml L B medium with 50 ug/ml ampicillin, and soluble protein was expressed following induction of log phase cells with 0.5 m M isopropyl-l-thio-(3-D-galactopyranoside (IPTG). Bacterial cell pellets were suspended in 5 ml lysis buffer (50 mMTris pH 7.5, 150 m M N a C l , 1% Triton X-100) with 2 mg/ml lysozyme, 0.2 mg/ml DNase I, 2 m M phenylmethylsulfonyl fluoride (Sigma), and 2 ug/ml leupeptin (Sigma). The suspension was incubated on ice for 30 minute, and then sonicated for 20 seconds, 3 times. The cell lysate was then centrifuged at 12,000 x g for 10 minutes. The supernatant was transferred to a fresh tube and stored at -70°C. The supernatant was transferred to a fresh tube containing a 200 u.1 bed volume of activated glutathione-sepharose beads (Pharmacia). The tube was incubated for 1 hour at 4°C with rocking. The tube was centrifuged at 1,600 rpm for 5 min. The flow through was set aside and the beads were washed with l x PBS, and centrifuged as previous, for a total of 3 washes. Half of the bed volume (100 ul) of 20 m M glutathione was added to the beads and bound fusion protein, which was gently mixed and incubated at RT for 15 min. The mixture was spun at 500 x g for 3 minutes. 51 The elutant was transferred to a fresh tube. A total of 3 elutants was collected into one tube. To visualize the relative fusion protein content, SDS-PAGE was performed using samples of the uninduced and induced cultures, soluble and insoluble fractions, the flow through, the beads and the elutant. The fusion protein was concentrated with a Centriprep-10 centrifugal concentrator (Centriprep). The concentration of the protein was measured with the Bradford Assay, and by comparing to concentration standards through SDS-PAGE. 2.15.2 Antibody Production Purified recombinant protein was used to raise polyclonal antisera in rabbits (Covance, Pennsylvania). Polyclonal antibody BC33 was the one used in all experiments to study the protein localization of CeHIPl. Prior to use the antisera was treated with a bacterial acetone powder, using a strain expressing the pGEX-4T-l vector alone (Miller, 1995). 2.15.3 Western Analysis The antibodies were tested for specificity by immunoblot analysis against the fusion protein. Bacterial lysate filters were prepared by separating the proteins on 10% SDS-PAGE gels and transferred to a nitrocellulose membrane by electroblotting at 2.5 mA for 60 min. Transfer was confirmed by staining the gel with Brilliant Blue G (Sigma) and a portion of the filter with Ponceau S (Sigma). Membranes were probed with antibodies BC33 and chaperonin antibody (kindly provided by Dr. Candido, University of British Columbia), 1/10,000 dilution, followed by secondary antibodies at 52 1:10,000 dilution (donkey anti-rabbit horseradish peroxidase-conjugated secondary antibody, Promega). Protein-antibody complexes were detected by enhanced chemiluminescence system (ECL, Amersham Pharmacia Biotech), or Super Signal Chemiluminescent System (Pierce). Whole worm filters were prepared as follows: 5 plates of N2 worms were grown for 2-3 days, until a mixed population was established. The worms were washed off of the plates with M9 into 200 ml S medium (1 litre S basal, with 10 ml 1 M potassium citrate pH 6, 10 ml trace metals solution, 1 M C a C l 2 , 1 M M g S 0 4 ; S basal: 0.1 M N a C l , 0.05 M potassium phosphate pH 6, 5 mg cholesterol; trace metals solution: 5 m M disodium EDTA, 2.5 mMFeS0 4 x 7H 2 0, 1 m M M n C l 2 x 4H 2 0 , 1 m M Z n S 0 4 x 7H 2 0, 0.1 m M C u S 0 4 x 5H 2 0) with 4 g of C600 bacterial pellet in a 500 ml fluted flask. The worms were let grow for 5-6 days. The worms were poured into a 250 ml graduated cylinder and let settle overnight at 4 °C. The supernatant was removed leaving approximately 10-15 ml that was transferred to a 15 ml tube. The worms were spun for 5 min at 2,000 rpm in a clinical benchtop centrifuge. The supernatant was removed and 3 ml cold dH 20 was added to the pellet. The worms were spun as described and the supernatant removed. 10 ml of 40% sucrose was added to the pellet, and gently mixed. The worms were spun for 6 min at 2,000 rpm, and the top layer of worms was carefully removed to a fresh tube containing 10 ml 40% sucrose, and spun as before. The upper phase was removed to a fresh tube containing 10 ml of 0.1 M N a C l , and spun for 5 min at 2,000 rpm. This wash was repeated once. The pellet was transferred in 50 u.1 aliquots to microfuge tubes to which was added 50 ul 3x SDS sample buffer (New England BioLabs), 50 ul M9, and 30 ul 425-600 micron diameter glass beads. The samples were 53 frozen in ethanol/dry ice, and stored at -70°C. An aliquot was thawed, vortexed and incubated at 90°C for 10 min. The sample was spun down at 13,200 rpm for 1 minute, and incubated at 100°C. The sample was loaded onto a 9% SDS-PAGE gel for protein separation. The protein was transferred to a nitrocellulose filter by electroblotting at 70 mA, ON at 4°C. The efficiency of the transfer was monitored through the use of prestained markers, staining of the gel with Brilliant Blue G, and a portion of the filter with Ponceau S. The membrane was probed with BC33 preimmune, BC33 antisera, BC33 antisera that had been depleted with the bacterial acetone powder, and the chaperonin antibody, all at 1/1,000 dilution. The depleted BC33 antibody detected a single 100 kDa band, approximately the size of the predicted 104 kDa CeHIPl protein. This band was not present in the preimmune. The signal was cleaned up considerably after treatment with the bacterial acetone powder. 2.15.4 Immunocytochemistry Staining of whole worms is a modification of Finney, 1990 and Miller, 1995. Whole Worm Fixation 3 to 4 100 mm N G M plates seeded with OP50 were used to grow worms until the plates were full, but not starved or crowded. The worms were washed off the plates with M9 buffer into a 15 ml sterile tube. The worms were briefly spun down at 1,100 rpm for 30 seconds. The supernatant was removed and 7 ml of 4% sucrose was added to the worm pellet. The worms were gently rocked at room temperature for 30-45 minutes to remove bacteria from their guts. The worms were briefly spun down as described, and 54 transferred to a 1.7 ml microfuge tube. The worms were spun down and liquid removed to a final volume of 0.5 ml. The worms were chilled on ice for 10 minutes. To the worms was added ice cold 2x Ruvkun fixation buffer (160 m M K C L , 40 mMNaCl , 20 mM disodium ethlyene glycol bis ((3-aminoethyl ether)-7Y, JV'-tetracetic acid (Na 2 EGTA), 10 mM spermidine-HCL, 30 mMNa, 1,4-piperazinediethanesulfonic acid (Pipes), pH 7.4 and 50% methanol) to a final concentration of lx . 16% paraformaldehyde was added to a final concentration of 2%. The worms were mixed well and frozen in dry ice/ethanol. The worms were thawed under a stream of tap water, and subsequently refrozen. A total of 4 freeze/thaw cycles was used. Worms were incubated on ice for 30 minutes with occasional mixing after the final thaw. The worms were then washed twice with Tris- Triton buffer (TTB, 100 mMTris-HCl, pH 7,4, 15 Triton X-100, or Nonidet P-40, and 1 m M E D T A ) . Worms were incubated overnight in TTB with 1% (3-mercaptoethanol at 37°C on a rocker platform. The worms were then washed with lx BO3 (diluted fresh from 20x B 0 3 Buffer, 1 M H 3 B O 3 , 0.5 M N a O H , and pH adjusted to 9.5) 0.01% Triton, and then incubated in l x B 0 3 , 0.01% Triton, 10 mMdithiothreitol (DTT) for 15 minutes at room temperature with gentle agitation. The worms were then washed with l x BO3, 0.01% Triton and incubated in lx B 0 3 , 0.01% Triton, 0.3% H 2 0 2 for 15 minutes at room temperature. The lids of the microfuge tubes were sealed with lid closures to ensure that any escaping oxygen did not cause the lids to pop open. The worms were then washed with lx BO3, 0.01% Triton and once with AbB ( lx PBS, 0.1% bovine serum albumin, 0.5% Triton X-100 or Nonidet P-40, 0.05% sodium azide, and 1 m M E D T A ) buffer for 15 minutes. The fixed animals were stored in AbA ( lx PBS, 1% bovine serum albumin, 55 0.5% Triton X-100 or Nonidet P-40, 0.05% sodium azide, and 1 m M EDTA) buffer, at 4°C for up to a month. Staining A 25 ul aliquot of worms was transferred with a wide bore pipette to a new microfuge tube. Antibody was diluted in AbA (antibodies used: BC33 1/200, HSP25 1/250) to a final volume of 100 ul. The samples were wrapped in foil and incubated overnight at 4°C on a rocking platform. The worms were pelleted and washed with several changes of AbB for 15 minutes at RT. Three 30 minute washes with AbB were followed by a 1.5 hour wash, all at room temperature. The samples were rinsed once AbA, and an appropriate dilution of secondary antibody was added (1/200) in 100 ul of AbA. The secondary antibody used was FITC-conjugated AffiniPure Donkey Anti- Rabbit IgG (Jackson Laboratories). The samples were wrapped in foil and incubated overnight at 4°C on a rocking platform. The worms were pelleted and washed with AbB as described above. At this point either 4', 6-diamidino-2-phenylindole (DAPI, Sigma) was added (to a final concentration of 2 ug/ml), or Propidium Iodide (Sigma) was added (final concentration of 1 ug/ml, with 100 ug/ml RNaseA in lx PBS). Care was taken to minimize the sample exposure to light. Mounting 2% agarose pads on slides were prepared (Mello, 1995). Equal volumes of the sample and 2x mounting media (20 m M Tris-HCl, pH 8.0, 0.2 M l,4-diazabicyclo-2,2,2- octance (DABCO), 90% glycerol) were mixed in a microfuge tube, and 10 ul was 56 transferred to the agarose pad. A coverslip was gently overlaid, and after settling, was sealed with nail polish. The worms were observed by either light or confocal microscopy (Biosciences Electron Microscopy Facility,University of British Columbia). 2.15.5 Dissection and Staining of Gonads Dissection and staining of gonads follows that of Francis, 1995. Gonad Dissection 200-300 late L4 and adult N2 hermaphrodites were transferred to an unseeded N G M plate. The worms were suspended in 1-3 ml of lx PBS/0.2 M levamisole (Sigma) and transferred to a 5 cm diameter watchglass. The heads of the worms were cut off with two 25-gauge syringe needles. The worms were decapitated by placing their heads between the syringe tips and moving them in a scissor-like motion. Excess liquid was removed with a Pasteur pipette. Gonad Fixation The dissected gonads were fixed in a methanol/formaldehyde solution, made by mixing 10 ml of 16% paraformaldehyde, 3.3 ml of 0.1 M K 2 H P 0 4 (pH 7.2), and 40 ml methanol. The solution was stored at -20°C until use. The dissected gonads were transferred to a glass tube, or a siliconized microfuge tube (Sigmacote, Sigma). The tube was spun at 1,100 rpm for 2 minutes and the supernatant removed. The gonads were washed once with l x PBS. 57 Antibody Staining of Dissected Gonads The fixed gonads were incubated in AbB for several hours at 4°C, and incubated with the primary antibody (BC33) at a concentration of 1:500 in AbA overnight at 4°C. The gonads were then washed 3 times with lx PBS, 0.1% Tween-20 with a 5 minute incubation time. The gonads were incubated with secondary antibody (as above) at a concentration of 1:250 in AbA overnight at 4°C. The gonads were then washed for 5 minutes, 3 times with lx PBS, 0.1% Tween-20. The gonads were incubated with lx PBS, 0.1%o Tween-20 containing 1 pg/ml propidium iodide and 100 ug/ml RNaseA. Mounting The gonads were washed lx PBS, 0.1% Tween-20 and an equal volume of mounting media was added to the tube. The gonads were drawn out with a wide bore pipette and transferred onto a 2% agarose pad on a slide. After the gonads had settled, a finely drawn hair was used to push the gonads and carcasses away from one another. A coverslip was overlain and let settle by gravity. A few moments were allowed for evaporation of the liquid on the slide (to improve image resolution) before the coverslip was sealed with nail polish. 58 2.16 Overexpression Analysis Germ line transformation was used to produce a transgenic strain carrying clone pCeh391 (and the dpy-5 marker, pCeh361) as an extrachromosomal array. pCeh391 contains the CeHIPl cDNA behind the heatshock promoter hspl6-2. There exist a number of heat inducible loci in C. elegans. The genes encoding the 16 kDa heat shock polypeptides are found at two loci. Locus A contains the 16-1 and 16-48 genes, while locus B contains the 16-2 and 16-41 genes. The two loci are differentially regulated with locus B producing up to seven fold more mRNA during heat induction than locus A (Jones, 1989). While induction of the heat shock genes occurs throughout the animal, the two loci display spatially distinct expression. The 16-1/16-48 genes show greater expression in the muscle and hypodermis, while the 16-2/16-41 genes have increased expression in intestine and pharyngeal tissue (Stringham, 1992). As CeHIPl was found to be expressed in the pharynx, the hsp 16-2 promoter was chosen for CeHIPl overexpression and R N A interference experiments. To analyze the effect of increased CeHIPl expression, transgenic L4 animals were heatshocked for 60 minutes at 30°C. Animals were allowed to recover for 12-24 hours and examined for a phenotype. 15-20 animals were used per trial, and 7 trials were scored for phenotypes. 59 2.17 RNA Interference Several approaches were used to deliver dsRNA into C. elegans. 2.17.1 RNAi Clones for in vitro Transcription To prepare template for transcription, two separate reactions were set up. In the first, pCeh372 was cut with PstI to linearize the plasmid, and R N A was transcribed with T3 polymerase. The second aliquot of pCeh372 was digested with Xbal to linearize the plasmid, and complementary R N A was transcribed with T7 polymerase. 2.17.2 Preparation of Double Stranded RNA for Injection and Soaking The R N A transcription reaction was as follows: 1 pg of cut template DNA, 5 ul 5x transcription buffer, 1.0 pi each of 10 mMrATP, rCTP, rGTP, and rUTP, 1.0 pi 0.75 M D T T , 1.0 pi of T3 or T7 polymerase (5 Units/pl), and diethyl pyrocarbonate (Sigma) treated dH^O to 25 pi. The mixture was incubated at 37°C for 30 minutes. To each reaction was added 1.0 pi of Dextran T-500 (20 mg/ml), 75 pi dfbO. The D N A was purified through phenol/chloroform extraction and precipitated in ethanol. The pellet was resuspended in 10 pi of RNase-free TE pH 7.4. 1.0 pi of each reaction was run on a standard T A E agarose gel to determine their relative concentrations. To make dsRNA, equal volumes (5.0 pi) of sense ssRNA, antisense ssRNA, and 3x Injection buffer (3xIM: 20 m M K P 0 4 pH 7.5, 3 m M K citrate pH 7.5, and 2% PEG 6000) were mixed together and incubated at 68°C for 10 minutes, and then shifted to 37°C for 30 minutes. 1.0 pi of the template, each ssRNA and the dsRNA was run on a 1.0% T A E agarose gel to examine the efficacy of the synthesis. 60 2.17.3 Injection of dsRNA dsRNA was injected into the distal arm of the gonads of young adult N2 hermaphrodites after the method of Mello, 1991. The animals were let recover overnight and were subsequently transferred every 16-20 hours and their progeny examined for phenotypes. Typically, 10-20 animals were injected with a specific dsRNA for each trial. At least 4 trials were conducted for each dsRNA to be tested. Injected dsRNAs include CeHIPl dsRNA made from pCeh372 and dpy-5 dsRNA made from pCeh377. Clone pCeh377 was used as a positive control in these experiments. It contains the complete coding region for the dpy-5 gene. The dpy-5 phenotype is readily observable in maturing animals. The negative control was the administration of the injection buffer alone. 2.17.4 Soaking Animals with dsRNA 20-30 L4 animals to be treated with dsRNA were picked into a microfuge tube containing 10 pi of DEPC treated dFL-O, and spun in a microfuge at 1,000 rpm for 1 minute. The majority of the dFLO was removed and the 5 pi of the appropriate dsRNA solution was added to the tube. The worms were placed at 20°C overnight. The next day the animals were transferred individually to seeded N G M plates. The worms were transferred every 16-20 hours and their progeny examined for any defects. This would be considered a single trial, and at least 4 trials would be conducted for each dsRNA tested. ssRNAs used included: CeHIPl prepared from pCeh372 and dpy-5 prepared from pCeh377. 61 2.17.5 in vivo RNA Interference Several transgenic strains were established carrying clone pCeh389 as a transgene. Strain KR3761 (carrying pCeh389, with the dpy-5 marker pCeh361, as an extrachromosomal array) and strain KR3792 (with the array integrated into the genome) was used for the in vivo R N A i studies. In vivo R N A interference experiments were conducted as outlined elsewhere (Tavernarakis, 2000). Specifically, L I to L3 stage hermaphrodites were heat shocked at 35°C for 4 hours. After heat shock, animals were allowed to recover overnight at 20°C, and transferred every day and assayed for various defects. 2.17.6 Outcrossing of RNAi Animals Animals to be used in mating experiments were allowed to recover overnight and subsequently transferred to a plate with the appropriate male strain: heatshocked and non- heatshocked N2 males or KR3792 males. L I to L3 animals were heat shocked at 35°C for 4 hours and allowed to recover at 20°C until the males reached sexual maturity (when they could be easily distinguished from hermaphrodites in the population). A typical trial would consist of placing 15-20 R N A i treated animals with an excess of males (~ 3 males for every hermaphrodite) over several N G M dot plates and allowing for mating overnight at 20°C. Hermaphrodites would be transferred individually to new N G M plates and subsequently transferred every 16-24 hours and scored for the unfertilized oocyte phenotype. 62 2.18 Yeast Two-Hybrid Analysis To determine i f CeHIPl protein could interact with human huntingtin, a two- hybrid approach was taken. The human huntingtin clone, 16pGBT9, was transformed into yeast Y190 cells to produce strain A P I . Clone pCeh351 (CeHIPl in pACT2) was transformed into API producing strain AP6. Strain AP6 was grown on SD - TRP - L E U -HIS plates to test for protein-protein interaction. The positive control was yeast strain AP3 (16pGBT9 and the clone carrying human HIP1, HIPlpGADIO). Negative controls included yeast strains AP5 (pCeh351, and pGBT9 vector), AP4 (HD16pGBT9 and pGADIO), AP5 (CeHIPlpACT2 and pGBT9). 2.19 Yeast Two-Hybrid Screen The yeast strain Y190 was used for all transformations and assays. Yeast transformations were performed using a modified lithium acetate transformation protocol. Y190 competent cells were transformed with pCeh350 (CeHIPl in pGBT9). The resulting strain was named AP7. A C. elegans cDNA library cloned into pACT2 (kindly provided by Dr. Barstead, Oklahoma Medical Research Foundation) was transformed into A P I . The transformants were plated on sixty 150 mm SC media plates deficient in tryptophan, leucine, and histidine. The herbicide 3-amino-triazole (3-AT) was used to limit the number of false His + positives. The transformants were placed at 30°C for 5 days and (3-galactosidase filter assays were performed on all colonies found. Primary His+/(3-galactosidase clones were replated and assayed again for His + and the ability to turn blue with the filter assay. 63 The (3-galactosidase chromogenic filter assays were conducted by transferring the yeast colonies onto Whatman filters. To lyse the cells the filters were submerged for 20 seconds in liquid nitrogen. The filters were dried at room temperature for at least 5 minutes and placed onto filter papers presoaked with Z-buffer (100 mMNaPCM pH 7.0, 10 m M K C l , 1 mMMgSC>4) supplemented with 50 mM 2-mercaptoethanol and 0.07 mg/ml 5-bromo-4-chloro-3-indolyl (3-D-galactoside. Filters were placed at 37°C for up to 8 hours. Colonies that turned blue were streaked on fresh plates, and let grow at 30°C for 2-5 days. Individual colonies were picked into liquid media and let grow overnight at 30°C. Plasmid D N A was isolated and prepared as described elsewhere. 64 Chapter III Results 3.1 CeHIPl Gene Structure The gene structure of CeHIPl was determined to allow for subsequent study through a combination of gene disruption and molecular characterization techniques. The physical map location of CeHIPl is ZK370.3, on chromosome III. CeHIPl spans 4808 nucleotides of genomic DNA. It codes for a 2798 nucleotide transcript that is trans spliced to the splice leader sequence SL1 (figures 3.1 and 3.4). For the construction of a green fluorescent protein (GFP) transcriptional reporter, it was necessary to learn i f CeHIPl possessed its own regulatory elements. trans splicing is the process by which an identical short leader sequence is spliced onto the 5' end of multiple mRNAs. Some transcription in C. elegans is polycistronic, with many open reading frames being transcribed into a single large transcript, trans splicing is responsible for separating the long polycistronic transcripts into monocistronic units. Genes that are first in the unit are usually trans spliced to the SL1 sequence, with the genes making up the remainder of the polycistronic unit being trans spliced to the SL2 sequence. Thus, trans splicing to SL1 is usually indicative of a gene possessing its own promoter region directly upstream (Blumenthal, 1988; Evans, 2000; Krause, 1987). This was important to know, as it allowed for analysis of the region directly upstream from CeHIPl to be the putative promoter region. The putative CeHIPl promoter region contains two potential PHA-4 binding sites: TGTTTGC at -898 nucleotides, and TGTTTGT at -290 nucleotides (Gaudet and Mango, personal communication, figure 2.2). 65 PHA-4 is a transcription factor of the forkhead/HNF3 variety, and is expressed in all pharyngeal cells (Horner, 1998; Kalb, 1998). The identification of the possible CeHIPl promoter region allowed for the construction of a promoter-GFP reporter construct predicted to display pharyngeal expression. 3.2 Homology Studies The translated CeHIPl protein is 927 amino acids in length and has a molecular weight of approximately 104 kDa (figures 3.2 and 3.11). Comparison of CeHIPl to proteins from other species identified regions that are conserved through evolution and are presumed to have shared, important functions. CeHIPl shows similarity to human HIP1, mouse HIP1R, and yeast Sla2p (table 3.1, figure 3.5). Computer based analysis of CeHIPl reveals several distinct domains in the family of CeHIPl proteins. This group of proteins also share identity with the mammalian cytoskeletal protein talin. Talin is a mammalian cytoskeletal protein found in focal adhesions, protein assemblies mediating interactions between the actin cytoskeleton and the extracellular environment (Burridge, 1983; Hemmings, 1996). The carboxy terminus of each of these proteins contains an actin-binding motif, the I/LWEQ module, which has been shown to bind F-actin in vitro (McCann, 1997; McCann, 1999). CeHIPl , and the related proteins have another sequence in common, the ENTH (Epsin N-terminal homology) domain (Kay, 1999). This protein sequence has been found in many eukaryotes, including plants, fungi and animals. The majority of proteins with ENTH 67 Kyte - Dool ittle Hydropathy Figure 3.3 Predicted Hydrophobicity of CeHIPl. The hydropathy of CeHIPl was predicted using Gene Runner Software based on Kyte, 1982. The X-axis measures the length of the CeHIPl protein (927 amino acids). The Y-axis is a measure of the relative hydropathy of the protein over a discrete interval (Kyte, 1982). This information was used to locate hydrophilic and potentially antigenic areas of CeHIPl. Amino acids 408 to 520 appeared to be hydrophilic and non-homologous to any predicted C. elegans proteins. This region was used to raise the polyclonal CeHIPl antibody. 69 CeHIPl HIP1 mHIPIR Sla2p 31/49 31/48 21/42 Table 3.1 Summation of Pairwise Sequence Alignment. T h e percent i den t i t y and s im i l a r i ty of t h e homologs w i th C e H I P l is l i s t e d . T h e f i r s t number r e f e r s t o percent i dent i ty , t h e second r e f e r s t o percent s im i l a r i ty . HIP1, human Hunt ingt in I n t e r a c t i n g Prote i n 1. m H I P I R , mouse HIP1 Re l a ted prote i n . Sla2p, y eas t homolog of C e H I P l . 73 domains appear to have functions in endocytosis and regulation of cytoskeleton organization (Kay, 1999). CeHIPl related proteins posses potential coiled-coil domains, which may be important for protein-protein interaction (Lupas, 1991; Lupas, 1997). CeHIPl also shows similarity to the putative ORF F08A8.6 in C. elegans. F08A8.6 spans 2486 nucleotides of genomic DNA, with a 1089 nucleotide transcript, and coding for a 362 amino acid protein. Pairwise sequence analysis of CeHIPl and F08A8.6 reveals that F08A8.6 matches up with the first third of CeHIPl (figure 3.7). It was important to determine i f F08A8.6 was an active gene, as it may have had redundant functions which would complicate analysis of CeHIPl. Additionally, it was important to design a polyclonal antibody that would recognize a non-homologous region of CeHIPl in the event that F08A8.6 was functional. However, there are no ESTs mapping to F08A8.6, and RT-PCR with mixed stage RNA detects no transcript. It is probable that F08A8.6 is a pseudogene. This information was used to design pCeh365, a CeHIPl fusion construct outside of the region of homology to F08A8.6. pCeh365 corresponds to residues 408-520 of the CeHIPl protein, a region that is non-homologous to any protein in C. elegans. Hydropathy analysis of the segment predicts it to be hydrophilic, and thus may promote antigenicity in raising an antibody (figure 3.3). 74 C o i l s output f o r C«HIP1 C o i l * output f o r HIP1 0 tee see 309 CeHIPl HIP1 C o i l s output for HIP1R C o i l s output for SLaSp mHIPIR iliriTlljplb, G ?0O B0Q 90S Sla2p Figure 3.6 Predicted Coiled-Coil Domains. The COILS program (Lupas et al. 1991) was used to predict potential coiled-coil domains of CeHIPl and its homologs in humans (HIP1), mouse (mHIPIR), and yeast (Sla2p). The probability of coiled coil formation is plotted as function of the amino acid position in the protein. 7 5 3.3 Expression of CeHIPl Several approaches were used to determine the spatial and temporal localization of CeHIPl in the nematode. 3.3.1 RT-PCR RT-PCR experiments reveal that CeHIPl is expressed from the first larval stage into adulthood. Transcription could not be detected in embryos (figure 3.4). 3.3.2 GFP Reporter The CeHIPl promoter::GFP reporter, pCeh353, was used to construct several transgenic strains. Fluorescence was detected in the pharynx of fully formed young larvae ready to hatch, and persisted through all successive stages. Fluorescence was also be detected in late larval development during the L4 stage, in the spermatheca, vulva and anal depressor muscles. These structures maintained fluorescence through adulthood (figures 3.8, 3.9, and 3.10). To see if CeHIPl was expressed in male specific structures, the GFP reporter was crossed into KR1088 dpy-5 (e61) him-1 (e879) background, and animals from this cross were examined for fluorescence. The him-1 (e879) mutation produces males at a frequency greater than the wild type frequency of 1:1000. Hermaphrodites from the newly constructed strain displayed fluorescence identical to previously constructed CeHIPl ::GFP strains. Males displayed fluorescence in the pharynx, as well as the vas deferens and cloaca (figure 3.10). 77 3.4 Protein Localization of C e H I P l With GFP reporter constructs, transcription does not always equal protein localization, and the reporter may not be expressed exactly like the endogenous gene. Most transgenes are silenced in the C. elegans germline, which could potentially mask a site of gene action. I produced a polyclonal antibody to study the spatial and temporal localization of CeHIPl protein in the worm. The polyclonal antibody raised to CeHIPl recognized a single band of approximately 104 kDa in Westerns of whole worm extracts (figure 3.11). This is the size of the predicted CeHIPl protein. Immunofluorescence with a CeHIPl polyclonal antibody showed a pattern of protein localization that was in agreement with the spatial and temporal expression of the CeHIP7::GFP reporter constructs. CeHIPl protein was observed in the pharynx in young animals, and in the spermatheca and vulval muscles of adult animals (figures 3.12 and 3.13). Protein could not be detected in the anal depressor muscles. This suggests the GFP expression in the anal depressor muscles may be artefactual. Staining was detected also in the gonad of hermaphrodites. The intensity of the staining was weaker relative to that of the somatic gonad. The intensity of staining was greatly improved upon dissection of the gonads from the hermaphrodites (figure 3.14). Staining of male animals revealed CeHIPl protein localization in the pharynx as well as the vas deferens and cloaca (figure 3.14). Staining could be detected from just prior to hatching for the pharynx, and from later larval stages (L4) for the vas deferens and cloaca. No staining was observed with preimmune sera, and staining could be extinguished with the inclusion of CeHIPl protein in immunostaining experiments (data not shown). 78 Figure 3.10 CeHIPl Expression. Transgenic strains expressing a CeHIPl-'-G?? reporter construct were examined. A. DIC image of the head of an adult hermaphrodite. B. GFP fluorescence can be observed in the pharynx. C. Merged image of A and B. D. DIC image of the tail of an adult male. E. GFP fluorescence can be observed in the vas deferens and cloaca. F. Merged image of D and E. G. Fluorescence image of a young adult hermaphrodite. GFP can be detected in the spermathecae (large arrowheads), vulval muscles (small arrow), and the anal depressor muscles (barbed arrow). Scale bar is 50 pm. 82 3.5 P C R Mapping of Deficiencies Our laboratory possesses a number of lethal mutations mapping approximately to the same area as CeHIPl on LGIII. I decided to use complementation analysis to test i f any of these mutations mapped to CeHIPl. The first step was to identify deletions that uncovered CeHIPl, which would subsequently be used for mapping experiments against the lethal point mutations in our collection. None of the deficiencies tested deleted the CeHIPl locus. Except for nDfl 7, the deficiencies tested behaved in accordance with the genetic mapping data. Analysis of nDfl 7 reveals that it is not a contiguous deletion, but a complex rearrangement containing coding sequence for CeHIPl. I was able to place the left breakpoint of sDfllO to somewhere between CeHIPl and sma-2, a region of approximately 30 kb. The results of the PCR mapping of homozygous deficiency embryos are presented in figures 3.15-20, and table 3.2. The data suggest that it may not be possible to maintain a strain with a deletion of the CeHIPl region. 83 Figure 3.12 CeHIPl Protein Localization in Developing Embryos. Polyclonal CeHIPl antibody was used to stain developing embryos. CeHIPl protein can be detected in the mature pharynx. Embryo ages are given after Sulston, 1983. 1A. Immunofluorescence of a 700 minute embryo stained with CeHIPl. CeHIPl can be detected in a pharynx that is nearing maturation. The pharyngeal bulbs are indicated with arrows. IB. Nucleic acid staining of embryo in 1A with propidium iodide. 2A. 800 minute embryo on the left, 525 minute embryo on the right (visible in 2B). CeHIPl protein in a mature pharynx. The pharyngeal bulbs are indicated with arrows. 2B. Nucleic acid staining of embryo in 2A with propidium iodide. Scale bar is 10 pm. 86 Figure 3.13 CeHIPl Protein Localization in the Adult Hermaphrodite. Polyclonal CeHIPl antibody was used to a stain an adult hermaphrodite. A. DIC image of the head of an adult hermaphrodite. B. Immunofluorescence of a same animal as in (A) stained with a CeHIPl antibody. CeHIPl is present in the pharynx. C. Immunofluorescence image of CeHIPl staining in the spermatheca D. Immunofluorescence image of CeHIPl staining in the vulva. 88 Figure 3.14 CeHIPl Protein Localization in the Adult Hermaphrodite and Male Gonad. CeHIPl antibody was used to stain dissected hermaphrodite gonads in A - C. A. Immunofluorescence image of CeHIPl antibody staining, which in the gonad appears to be non-nuclear and may be specific to developing oocytes. B. DNA staining of the gonad in A. C. Merged image. CeHIPl antibody was used to stain males D - F . D. CeHIPl staining can be observed in the vas deferens and cloaca of the male gonad. E. DNA staining of the gonad in D. F. Merged image. Scale bar is 20 \xn\. 9 0 3.6 Reverse Genetic Screen As it was not possible to map existing mutations to CeHIPl, I decided to use a reverse genetics approach to produce a mutation. Three libraries with a total of 1.6 x 106 F1 progeny were screened with 4 CeHIPl primer sets. 31 putative deletions were identified in first round screening, 4 of which faithfully resampled. No worms could be isolated bearing these deletions through sib selection. Three of the deletion bands were sequenced: deletion 203 removed 3174 nucleotides, deletion 573 removed 262 nucleotides, and deletion 831 removed 2956 nucleotides. These data are presented in figure 3.21. These deletions were predicted to result in premature stop mutations. 3.7 Overexpression Analysis The previous data suggested that it may not be possible to recover a null, or hypomorphic mutation of CeHIPl. An alternate approach was to engineer a dominant mutation. Overexpression of CeHIPl was studied with strain KR3793 that contains the full length CeHIPl cDNA behind the heat shock promoter hspl6-2 (Jones, 1989; Stringham, 1992). Upon heat shock, the animals (40% ± 12) would fail to thrive, and subsequently die. The animals appeared sickly and often contained vacuoles (figure 3.22). Control animals included: heat shocked N2, CB907 dpy-5, and a strain carrying the (3-galactosidase gene behind the hspl6-2 promoter, did not display any adverse effects. Thus, CeHIPl may be a dose sensitive locus, with negative effects on viability of the expression level is perturbed. 91 L G I I I zk370 dpy-19 CeHIPl sma-2 I I /A unc-32 - j n0f20 nbf21 h0f21 sbfllO nbfl7 Figure 3.15 Map of Deficiency Breakpoints in Relation to CeHIPl. A map of the endpoints of the deficiencies studies in the PCR mapping experiments is presented. The thick black line represents genomic DNA. DNA deleted by a deficiency is indicated by a dashed line, with dotted lines indicating DNA not deleted by the deficiency. 92 D e f i c i e n c y P r i m e r s ht>f21 nbfl7 nbf20 nbf21 sbfllO K R p 4 7 / 9 4 bli-4 LGI • • • • • K R p 1 1 2 / 1 1 3 rad-3 LGI • • • • K R p 1 7 6 / 1 7 7 dpy-19 LGII I • X X • K R p 1 7 8 / 1 7 9 . sma-2 LGII I • X • X K R p 3 0 0 / 3 0 1 CeHIPl LGII I • • • • • K R p 3 4 7 / 3 4 8 unc-32 LGII I • X • • X Table 3.2 PCR Deficiency Mapping Data. The results of the mapping of deficiency homozygotes with several primer sets is presented. / indicates amplification, X indicates no amplification 93 3.8 R N A Interference Analysis R N A i is a method that allowed for cursory examination of a predicted null phenotype of CeHIPl. There is evidence that the method of dsRNA delivery into the worm can affect the efficiency of R N A i (Fraser, 2000; Tavernarakis, 2000; Timmons, 1998). Late acting, and especially neuronally expressed genes, are often resistant to dsRNA injection methods. Methods that allow for the delivery of dsRNA to later stages of development can alleviate this resistance. Several R N A i approaches were used to determine the function of CeHIPl. The methods used included the injection of dsRNA into young adult animals, soaking young animals in dsRNA, and creating an inducible transgene capable of producing dsRNA in vivo. The administration of dsRNA by injection and soaking was less successful than transgene expression in generating phenotypes. The presence of a greater than average number of unfertilized oocytes was the only phenotype common to all three approaches (summarized in table 3.3). Additional phenotypes were observed using the transgene- generated dsRNA. This method was used for the analysis of CeHIPl function. 98 Figure 3.22 Overexpression of CeHIPl. Overexpression of CeHIPl was studied with transgenic strain KR3793, containing the full length CeHIPl cDNA behind the hsp 16-2 promoter. L4 hermaphrodites were heat shocked at 30°C for 60 minutes and let recover for 12-24 hours at 20°C before examination. 40% (± 12%) of heat shocked KR3793 animals would fail to thrive and would often die. A. This worm appears sickly and contains vacuoles. B. Close-up of A. Vacuoles are indicates with arrowheads. C. The head of an adult hermaphrodite, vacuoles are also present. Control animals included: heat shocked N2, CB907 dpy-5, and a strain carrying the p-galactosidase gene behind the hspl6-2 promoter, displayed no adverse effects. Scale bar is 50 urn. 3.8.1 Fertilization Effects R N A i treated animals displayed an increase in the number of unfertilized oocytes laid, which is summarized in table 3.3. This effect is most pronounced approximately 48 hours after the first egg is laid. Immunostaining of wild type animals shows CeHIPl protein is localized to the spermatheca. CeHIPl antibody does not stain sperm. R N A i treated animals show a loss of CeHIPl staining in the spermatheca, and have a decreased sperm count, with fewer sperm residing in the spermatheca. Control animals have staining of the spermatheca, and a normal sperm count. Additionally, staining of the hermaphrodite germline is also lost after R N A i treatment (figure 3.23). The appearance of unfertilized oocytes often indicates a sperm defect. In efforts to identify the nature of the fertilization error, several outcross experiments were conducted. If the hermaphrodite sperm were defective, then outcrossing should rescue the unfertilized oocyte phenotype. Partial, or no rescue would occur if the hermaphrodite oocytes were defective. Mating of CeHIPl R N A i treated hermaphrodites with wild type and CeHIPl R N A i treated males rescued the unfertilized oocyte phenotype. Thus, male sperm is capable of fertilizing the oocytes of R N A i treated animals. The defect resides in some aspect of hermaphrodite sperm function (table 3.4). 101 Gene Disruption Approach Unfertilized oocytes Number of trials KR3761 hspl6-2pCeHIPl (IR) transgene + heat shock 68 ± 13 10 KR3792 hspl6-2pCeHIPl (IR) integrated + heat shock 67 ± 11 5 dsRNA CeHIPl injection 13 ± 5 8 dsRNA dpy-5 injection 80 ± 10 4 dsRNA CeHIPl soaking 8 ± 4 6 dsRNA dpy-5 soaking 64 ± 13 4 Controls lx IM Buffer injection 3 ± 1 4 lx IM Buffer soaking 2 ± 1 4 KR3761 hspl6-2pCeHIPl (IR) transgene - heat shock 3.0 ± 0.5 4 KR3792 hspl6-2p<;eHZP2 (IR) integrated - heat shock 2.0 ± 1.5 4 N2 + heat shock 15 ± 6 4 CB907 (e907) + heat shock 20 ± 8 4 hspl6-2p -galactosidase + heat shock 8 ± 2 4 Table 3.3 Comparison of RNA Interference Methods; Injection, Soaking and in vivo. Unfertilized oocytes laid are given as percentage of total progeny. The Dpy-5 phenotype was scored for dpy-5 RNAi. For heat shock experiments, LI to L3 larvae were heat shocked at 35°C for 4 hours. After heat shock, animals were allowed to recover overnight at 20°C, and transferred every day and assayed for various defects. 10-15 animals were used per trial. 102 Mating Condition Percentage Unfertilized Oocytes Number of trials KR3761 hspl6-2pCeHIPl (IR) transgene + heatshock x N2 males - heatshock 2 ± 1 3 KR3761 hspl6-2pCeHIPl (IR) transgene + heatshock x N2 males + heatshock 3 ± 1 3 KR3792 hspl6-2pCeHIPl (IR) integrated + heatshock x KR3792 males - heatshock 2 ± 1 3 KR3792 hsp\6-2pCeHIPl (IR) integrated + heatshock x KR3792 males + heatshock 2 ± 1 3 Table 3.4 Outcrossing of CeHIPl RNAi Hermaphrodites. CeHIPl RNAi treated hermaphrodites were mated to either N2 or KR3792 males (± heatshock) and scored for the presence of unfertilized oocytes, presented here as a percentage of progeny laid. Heatshock conditions: LI to L3 animals were heat shocked at 35°C for 4 hours and allowed to recover at 20°C until the males reached sexual maturity. 15-20 separately RNAi treated hermaphrodites were plated with an excess of males (~ 3 males for every hermaphrodite) over several NGM dot plates and incubated overnight at 20°C to allow for mating. Hermaphrodites were transferred individually to new NGM plates and subsequently transferred every 16-24 hours and scored for the unfertilized oocyte phenotype. 1 0 3 Figure 3.23 The Effect of RNAi on CeHIPl Protein Localization in the Gonad. To assess the effects of CeHIPl RNAi, LI to L3 hermaphrodites transgenic KR3792 animals were heatshocked at 35 °C for 4 hours and let recover at 20 °C until mature. The spermathecae in A through F were fixed and stained as described in 2.15.4. The gonads in G through L were dissected, fixed and stained as described in 2.15.5. A . Wild type spermatheca stained with CeHIPl antibody. B. DNA staining of sperm nuclei with propidium iodide. C. Merged image. D. Spermatheca of a RNAi treated animal stained with CeHIPl antibody. E. DNA staining of sperm nuclei with propidium iodide. F. Merged image. G. Wild type hermaphrodite gonad stained with CeHIPl antibody. H. DNA staining of germline nuclei with propidium iodide. I. Merged image. J . Gonad staining of a RNAi treated animal with CeHIPl antibody. K. DNA staining of germline nuclei with propidium iodide. L. Merged image. 105 To determine if the loss of CeHIPl after R N A i treatment was due to depletion of CeHIPl protein or a loss of the spermatheca, treated animals were stained with a polyclonal antibody to HSP25. HSP25 is a small heat shock protein that is associated with the dense bodies of C. elegans muscle, the lining of the pharynx and to the junctions between cells of the spermafhecal wall of adult animals (Ding and Candido, 2000). Staining of R N A i treated animals with the HSP25 polyclonal antibody shows that the spermatheca is still present (not shown). The loss of CeHIPl staining is due to R N A i treatment and not to a failure in the development of the spermatheca. 3.8.2 Egg Laying Deficiency Observed after CeHIPl R N A i Another phenotype observed after R N A i treatment of young hermaphrodites is an egg laying deficiency, which is summarized in table 3.5. The animals retain a greater number of embryos than in either wild type or controls. Embryos are not retained indefinitely and larvae have not been observed to hatch within the hermaphrodite. Immunostaining of wild type animals shows CeHIPl protein localization in the vulval muscles, shown in figure 3.24, which is subsequently lost in R N A i treated animals (not shown). Control animals do not display an egg laying phenotype or a loss of vulval staining. 106 3 . 8 . 3 CeHIPl R N A i Deforms the Mature Pharynx The pharynxes of R N A i treated animals are malformed, which is summarized in table 3.5. The pharynxes are often recurved and show a loss of structural integrity. They do not display the typical smooth, dual bulbs. Instead, they appear rough and loose. This phenotype can be observed through DIC optics, and is readily apparent through immunostaining (figure 3.25). This phenotype is not observed in any of the controls. 107 Gene Disruption Approach Phenotype scored Frequency Observed Trials KR3761 hspl6-2pCeHIPl (IR) transgene + heat shock Egg laying defect 58 +/- 7 5 KR3761 hspl6-2pCeHIPl (IR) transgene - heat shock Egg laying defect 10 +/- 2 4 N2 + heat shock Egg laying defect 8+/- 2 4 CB907 (e907) + heat shock Egg laying defect 8+/- 3 4 hspl6-2p|3-galactosidase + heat shock Egg laying defect 6+/- 2 4 KR3761 hspl6-2pCeHIPl (IR) transgene + heat shock Malformed pharynx 54 +/- 12 7 KR3761 hsp\6-2pCeHIPl (IR) transgene - heat shock Malformed pharynx 0 4 N2 + heat shock Malformed pharynx 0 4 CB907 (e907) + heat shock Malformed pharynx 0 4 hspl6-2p(3-galactosidase + heat shock Malformed pharynx 0 4 Table 3.5 Additional Phenotypes of CeHIPl RNAi. Phenotypes observed are given as percentage of animals tested. LI to L3 hermaphrodites were heat shocked at 35°C for 4 hours and let recover overnight at 20°C. The animals were transferred every 12-16 hours and examined for defects. 10-15 animals were used per trial. 108 Figure 3.24 The Effect of CeHIPl RNAi on Egg Laying. LI to L3 hermaphrodites were heat shocked at 35°C for 4 hours and allowed to recover overnight at 20°C. The animals were transferred every 12-16 hours and examined for retention of embryos. A. Heatshocked N2 hermaphrodite. This animal does not display any defects. B. RNAi treated animal. This animal displays an egg laying deficiency as it is retaining a greater of embryos than wild type. Scale bar is 100 \xm. Figure 3.25 RNAi Effects on Pharyngeal Morphology. To assess the effects of CeHIPl RNAi, LI to L3 hermaphrodites transgenic KR3792 animals were heatshocked at 35 °C for 4 hours and let recover at 20 °C until mature. The animals in A and B were examined with DIC optics (2.3). The animals in D through I were fixed, stained, and examined as described in 2.3 and 2.15.4. A. Wild type pharynx of a N2 adult hermaphrodite. B. The deformed pharynx of a CeHIPl RNAi treated adult hermaphrodite. The dashed line outlines the pharynx. C. Diagram of a wild type pharynx. D. Immunofluorescence image of a wild type pharynx stained with CeHIPl antibody. E. DNA staining of cell nuclei with propidium iodide. F. Merged image of D and E. &. Immunofluorescence image of a CeHIPl RNAi treated animal stained with CeHIPl antibody. H. DNA staining of cell nuclei with propidium iodide. I. Merged image of & and H. 3.9 Testing for CeHIPl Interaction with Human Huntingtin I wanted to determine if CeHIPl was functionally equivalent to human HIP1 its ability to bind huntingtin. A two-hybrid system was used to test for a potential interaction between CeHIPl and human huntingtin. CeHIPl does not interact with human huntingtin (figure 3.26). 3.10 Yeast Two-Hybrid Screen When this experiment was conducted, the C. elegans genome sequence was not complete. There existed the possibility of the nematode possessing a version of huntingtin. A yeast two-hybrid screen was conducted to identify interacting protein partners of CeHIPl. A C. elegans huntingtin homologue was not found. To date, the various sequencing projects have shown that huntingtin may be an evolutionary addition to vertebrates alone. Approximately 5 x 105 clones of a C. elegans cDNA library were screened for interacting protein partners of CeHIPl. Seventeen positive clones were isolated from the screen. Upon retransformation and partial sequencing, 2 positive clones were identified (figure 3.27). The first clone corresponds to ORF F45E12.2 (represented twice). F45E12.2 maps to LGII, spanning 2558 nucleotides, with 7 exons coding for a 2280 nucleotide message and a 759 amino acid protein. It shows homology to TFIIB, a member of the class of general transcription initiation factors (Conaway, 1999). The second clone represents ORF T05C12.10 (isolated nine times). T05C12.10 spans 4859 nucleotides of genomic DNA, and contains 12 exons coding for a 3624 nucleotide transcript and a 1207 amino acid protein. A portion of the protein shares 113 homology with the autocatalytic domain of Drosophila hedgehog protein (Hammerschmidt, 1997). T05C12.10 is a member of a large family of genes in the nematode with homology to hedgehog (Aspock, 1999; Burglin, 1996). The interaction between CeHIPl and the interacting proteins was mapped to the carboxy terminus of CeHIPl (figures 3.28 and 3.29). 3.10.1 Mutants Obtained There were no known mutations mapping to the two ORFs. As a result, the two ORFs were submitted to the C. elegans Gene K O Consortium for gene knockout. Two strains were isolated bearing deletions of the ORFs. Strain VC28 gkl 7 contains a 1333 nucleotide deletion of F45E12.2. Animals homozygous for this mutation arrest in the second larval stage. The second strain, VC42 gk32 contains a deletion of 119 nucleotide of T05C12.10. Homozygous deletion animals arrest in the second larval stage. 116 Chapter IV Discussion 4.1 Introduction The goal of this thesis was to determine the function of the HIP1 related gene CeHIPl in a simple animal system. Through understanding the role of CeHIPl in C. elegans, it may be possible to understand what human HIP1 does, and to determine its relationship to Huntington disease. In this thesis I have presented evidence supporting the following conclusions that CeHIPl may be a dose sensitive locus and that CeHIPl has multiple functions in the nematode, including roles in fertilization, egg laying, and promoting pharyngeal morphology. In this discussion I will examine the basis of these conclusions. I will finish with an examination of the knowledge gained from this thesis and its contribution to the study of the related genes in other species. 4.2 CeHIPl and the Nematode CeHIPl appears to have multiple roles in the nematode. It is not ubiquitously expressed like mHIPIR, but is found in distinct tissue types and appears more similar to HIP1 in this respect. As CeHIPl is found in different tissues, and has multiple effects as assayed through R N A i , I will examine each function in turn. 117 4.2.1 CeHIPl and Fertilization CeHIPl protein can be detected in the germline and somatic structures of the C. elegans gonad. Staining can be observed in developing oocytes, where CeHIPl is found to be non-nuclear. CeHIPl is abundant in the spermatheca, a structure that houses mature sperm and facilitates ovulation and fertilization. In males, CeHIPl can be observed in the vas deferens and the cloaca. Among other things, CeHIPl R N A i hermaphrodites have a decreased sperm count, and lay a large number of unfertilized oocytes. It would appear that the coordination of events is perturbed when CeHIPl protein has been depleted from the gonad. I will present a brief overview of C. elegans germline development and fertilization. Anatomy of the Adult Gonad The adult hermaphrodite reproductive system is composed of two tubular ovotestes, anterior and posterior. They are joined centrally by two spermathecae and a uterus. The uterus opens mid-ventrally to the exterior through the vulva (figure 3.8). The adult male reproductive system consists of a tubular testis that is connected to the cloaca through the seminal vesicle and vas deferens (figure 3.9). The hermaphrodite ovotestis and the male testis are essentially U-shaped tubes possessing distal and proximal arms. The distal-proximal axis refers to the relative position along the tubular gonad. A distal structure is defined as being further from the gonadal opening than a proximal structure. The gonadal opening is the vulva in hermaphrodites, and the cloaca in males (Hirsh et al., 1976; Kimble et al., 1979; Klass et al., 1976). 118 The distal arm, for both sexes, is composed primarily of immature germline tissue. The germline nuclei of the distal arm are composed of mitotic nuclei most distally and meiotic nuclei more proximally. The nuclei in meiosis progress from leptotene distally through diplotene of meiotic prophase I proximally. In both sexes, gametogenesis occurs in the proximal arm. For hermaphrodites, a somatic contractile sheath, or oviduct encapsulates the germline of this arm. In males, the germline is partially ensheathed by the distal cells of the seminal vesicle (Kimble and White, 1981; Wolfet al., 1978). Sperm are generated continuously in males, whereas they are produced only briefly in hermaphrodites. Approximately 150 sperm are produced at the proximal edge of the proximal arm of each ovotestis. Once this is done, germ cell differentiation switches to oogenesis, thereafter only oocytes are produced (Klass et al., 1976). Oocyte maturation, ovulation and successful fertilization require careful coordination of the somatic gonad and the germ cells to ensure that proper embryonic development occurs. Oocytes in mature wild type hermaphrodites mature in an assembly line manner, and undergo several stereotyped events (McCarter et al., 1999). The first noticeable change in the oocyte is breakdown of the nucleolus. As the oocyte moves to the proximal region of the gonad, its volume increases and the nucleus moves distally. Just prior to ovulation, the oocyte nuclear membrane breaks down, and the gonadal sheath cells increase their contractions. Ovulation now occurs and the spermathecal valve dilates and the oocyte passes into the spermatheca where it is fertilized (McCarter e ta l , 1999). 119 Oocytes will arrest at diakinesis of prophase I i f there are no sperm present for fertilization. This occurs normally in older hermaphrodites that have exhausted their supply of sperm, or in mutant animals that are feminized and produce no sperm. The rate of ovulation for a worm lacking sperm is 1:40 of that of a worm containing sperm (McCarter et al., 1999). Oocytes can be released from arrest by the introduction of sperm through mating; the oocyte will complete maturation, ovulate and be fertilized. The signals to mature and ovulate occur independently of fertilization. It may be that the signal to arrest maturation and ovulation is mediated through the somatic gonad. Depletion of CeHIPl from the hermaphrodite gonad results in a fertilization error. A number of oocytes are not fertilized and escape the signal to arrest, and instead pass through the uterus and are laid. R N A i treated hermaphrodites also appear to contain fewer sperm within the spermatheca when compared to control animals. As CeHIPl protein is found in both germline and somatic structures, there are multiple interpretations of the R N A i phenotype. Depletion of CeHIPl protein may result in an impairment of cytoskeletal or endocytic funcioning. I will examine each of these components in turn. The Spermatheca The 24 cells that make up the spermatheca are born in the middle of the fourth larval stage. The cells form two groups: 8 distal cells aligned in two rows form a narrow corridor to the gonad arm, while 16 proximal cells form a wider bag-like chamber (Hirsh, 1976; Kimble, 1979). Sperm become located within the spermatheca adjacent to its inner membrane. The structure has a constriction at the distal end connecting the oviduct, and a complex valve at the proximal end connecting to the uterus. When an oocyte matures 120 in the oviduct, it is pushed up against the constriction by contractions of the oviduct sheath, and is ultimately pushed through by stronger contractions from the sheath. Multiple sperm make contact with the oocyte as it enters the spermatheca, but only one sperm penetrates and fertilizes the egg (Ward and Carrel, 1979). Fertilization of the egg can be recognized by a sudden increase in granule movement in the egg cytoplasm followed by formation of the eggshell. The fertilized egg remains in the spermatheca for several minutes. To enter the uterus, the egg must pass through an elaborate valve at the proximal end of the spermatheca. The valve consists of a single cell with 4 nuclei. The cytoplasm of this cell contains an annulus of filamentous material, which has elaborate folds of plasma membrane on the inside surface of the plasma membrane (Hirsh et al., 1976; Kimble and Hirsh, 1979). The valve opening expands to several times its diameter as an egg passes through. Often, a few sperm are swept along with the egg through to.the uterus. These sperm usually migrate back through the valve and resume lodging within the spermatheca (Hirsh et al., 1976; Ward and Carrel, 1979). Spermafhecal cells contain actin, but myosin, however, has not been detected (Strome, 1986). The microfilaments of the cells are predominantly circumferential, which is suited to the task of dilation during ovulation, rather than longitudinal contraction (as exhibited by the sheath cells, whose microfilaments run longitudinally). 121 Fertilization Errors A number of oocytes that are made in aged hermaphrodites depleted of sperm, or in mutants with defective sperm, undergo partial maturation as they pass through the spermatheca. The oocytes lose their nuclear membrane and resume meiosis. No eggshell is formed, and the characteristic movements of the cytoplasmic granules are reduced or absent, implying that sperm contact is required for these processes (McCarter et al., 1999). Upon entering the uterus, the oocyte undergoes nuclear division without cytokinesis or karyokinesis to produce a highly polyploid cell, which is expelled through the vulva. The appearance of such oocytes from young hermaphrodites is often an indication of a sperm defect (L'Hernault et al., 1988). A related phenotype, Emo (endomitotic in the gonad arm) is an indication of defective ovulation. Mutants with polyploid oocytes due to endomitosis arise frequently in recessive sterile screens and are now beginning to be characterized. Some Emo mutants include: ceh-18 (mg57) which encodes a POU-domain homeobox (Greenstein et al., 1994), certain alleles of emo-1 which encodes a homolog of Sec61 y (Iwasaki et al., 1996), lin-3 which encodes a protein similar to the EGF family (Hill et al., 1992; Katz et al., 1995), let-23 which encodes an EGF-receptor class tyrosine kinase (Aroian et al., 1991; Aroian et al., 1994), and mup-2 which encodes a troponin T homolog (Myers et al., 1996). The Emo phenotype can arise from germ-line or somatic defects; mosaic analysis of emo-1 indicates a germ-line focus, where CEH-18 is found in the sheath cell nuclei. Laser ablation of certain cells of the somatic gonad can result in the Emo phenotype. Ablation of cells in mid L4 of the fourth and fifth pairs of sheath cells, and of the distal spermathecal cells results in an Emo phenotype (McCarter et al., 1997). 122 These results indicated that the cells along the narrow corridor linking the oviduct to the spermatheca are essential to prevent Emo sterility into L4 and possibly adulthood. A current hypothesis is that the maturing oocyte signals the surrounding sheath and spermathecal cells to trigger ovulation. Failure of this process traps the mature oocyte in the gonad where it undergoes mitotic cycling (McCarter et al., 1997; McCarter et al., 1999). Receptor Mediated Endocytosis in the Oocyte CeHIPl protein can be detected in developing oocytes in the gonad. The localization is non-nuclear but it is difficult to determine the cellular localization beyond that. The role of CeHIPl in the oocyte is unclear, but it may have a structural role as suggested from its cytoskeletal contribution in other systems (Engqvist-Goldstein et al., 2000; Holtzman et al., 1993). Receptor mediated endocytosis has recently been described as an important mechanism of yolk-protein uptake in oocytes (Grant et al., 1999). C. elegans yolk is secreted from the intestine into the pseudocoelomic space and is ultimately taken up into vesicles within the developing oocytes (Kimble and Sulston, 1983; Sharrock et al., 1983). A combination of GFP tagged proteins and R N A i was used to demonstrate the role of orthologs of several proteins involved in the secretory and endocytic pathways of other organisms. These included homologs of the clathrin heavy chain, dynamin, adaptins, and subunits of the adaptor complex AP2. A screen was developed using transgenic strains expressing vitellogenin::GFP to monitor yolk endocytosis, and several mutants were isolated. Vitellogenins are one of the most abundant proteins in developing embryos 123 (Sharrock et al., 1983). One mutant identified was rme-2, a new member of the low- density lipoprotein receptor superfamily which is the C. elegans yolk receptor (Grant et al., 1999). CeHIPl may contribute to a receptor mediated endocytosis pathway to coordinate signaling necessary for fertilization. The effect of CeHIPl R N A i may have several components that add up to the laying of unfertilized oocytes as a phenotype. The amount of sperm present in the spermatheca is depleted, which would ordinarily result in a signal to halt ovulation. This signal is missing, and oocytes continue to mature but are not fertilized and are expelled from the animal. As CeHIPl protein is present in the spermatheca and developing oocytes, it may be a component of this signaling pathway to promote fertilization. Sperm Depletion The reason for the reduction in the number of sperm housed in the spermatheca is not understood. One possibility is that the sperm are not crawling back into the spermatheca after they have been swept into the uterus by a passing fertilized egg. These sperm would be ultimately lost as they are expelled through the vulva as eggs are laid. Hermaphrodite and male spermatozoa both crawl to locate themselves properly in the spermatheca. The signal that attracts the sperm to the spermatheca is unknown. There are several mutants (spe-8 and spe-12) in which sperm are rapidly displaced from the spermatheca into the uterus by passing oocytes, and have great difficulty returning to the spermatheca afterwards (L'Hernault et al., 1988). CeHIPl may be involved in presenting and maintaining the signal on the spermathecal membrane. This is not without 124 precedent, as SLA2 had been identified as Mop2p, a protein essential for the presentation and maintenance of an ATPase on the surface of the plasma membrane (Na et al., 1995). Thus, it is possible that the signal which would ordinarily direct spermatozoa to the spermatheca, and retain them, is depleted in CeHIPl R N A i animals. As fertilized oocytes pass through the spermatheca, a number of sperm would be swept into the uterus. The signal for the sperm to return to the spermatheca may be compromised, and as a result over successive rounds of ovulation, fertilization and egg laying, the normal number of hermaphrodite sperm could be reduced. As well, the signal to halt ovulation may also be damaged with the end result being the laying of unfertilized, endomitotic oocytes. A model for the fertilization error is presented in figure 4.1. Outcrossing Rescues the RNAi Phenotype; Therefore, Not a Sperm Defect An experiment that lends support to this model is the outcrossing of R N A i treated hermaphrodites. Successful mating with both wild type and CeHIPl R N A i treated males rescues the unfertilized oocyte phenotype. A new batch of sperm is introduced, and can now fertilize the oocytes. Male sperm is functionally, but not morphologically distinct from hermaphrodite sperm (LaMunyon et al., 1995). When a male copulates with a hermaphrodite, the sperm is deposited through the vulva among the fertilized eggs in the uterus. The sperm then crawl among the eggs the length of the uterus, navigate past the valve and into the spermatheca. Male sperm will outcompete any hermaphrodite sperm present and preferentially fertilize the oocytes 125 Figure 4.1 Depletion of CeHIPl from the Gonad Results in the Production of Unfertilized Oocytes. A model for the series of events that leads to the appearance of unfertilized oocytes after CeHIPl RNAI treatment is presented. A. A maturing oocyte is pushed into the spermatheca by sheath contractions. B. Multiple sperm contact the oocyte, one of which will successfully fertilize the oocyte. C. The proximal spermathecal valve opens and the fertilized oocyte moves into the uterus and number of sperm are swept along with it. D. The spermathecal valve closes and the sperm within the uterus that would ordinarily swim back to the spermatheca, fail to do so. E. The sperm within the uterus are swept out of the animal as the eggs are laid. F. After successive rounds of fertilization and egg laying, the normal complement of hermaphrodite sperm is depleted. This would normally result in a halting of ovulation. This does not occur, perhaps because of the loss of a CeHIPl mitigated signal. Ovulation continues and the oocytes are pushed through into the spermatheca. &. The lack of sperm results in a failure to fertilize. H. The unfertilized oocyte is pushed into the uterus. I. A number of unfertilized oocytes are laid. 128 (LaMunyon et al., 1999). Predominantly outcross progeny are produced until the male sperm are depleted, at which time self-progeny will appear. The basis of male sperm competitive superiority is unknown; fertilization is not required, but motility is (Singson etal., 1999). The male sperm may follow a different signal, which allows them to take up a more favorable position in the spermatheca. Male sperm are not affected by the loss of CeHIPl in R N A i hermaphrodites, and rescue the unfertilized oocyte phenotype. The phenotype recurs upon the depletion of male sperm. Additionally, the integrity of the spermatheca may be compromised; it can no longer hold maturing oocytes back, and they are pushed through the spermatheca by continued sheath contractions and into the uterus. CeHIPl Promotes Fertilization in C. elegans CeHIPl has a role in the somatic gonad to facilitate signaling required for coordination of the events necessary to produce an embryo. In this case, CeHIPl would be responsible for presenting, maintaining, and recycling the appropriate signals and receptors. This would explain why there are several, apparently separate consequences of the removal of CeHIPl. Mature sperm may not faithfully recognize the spermatheca, resulting in their random loss. The oocytes may not receive the signal that the system is in error, and continue maturation and ovulation, and after fertilization has failed may be subsequently ejected as endomitotic oocytes. 129 4.2.2 Egg Laying and CeHIPl Egg laying is a complex behavior that is controlled by 16 specialized muscle cells: 8 uterine muscle cells and 8 vulval muscle cells. The uterine muscles are aligned circumferentially around the uterus and presumably squeeze eggs toward the vulva. The vulval muscle cells are arranged in a cross and contract to expand the uterus and open the vulva, facilitating egg laying (Hirsh et al., 1976; Kimble and Sulston, 1979; Sulston and Horvitz, 1977). Two types of neurons synapse onto the sex muscles: the two HSN cells and the six V C motor neurons. Laser ablation of both HSN neurons results in animals that fail to lay eggs. The eggs are retained in the uterus and the animals become severely bloated (Trent et al., 1983). Dominant mutations of the egl-1 gene cause the HSN's to undergo programmed cell death in hermaphrodites, causing an egg-laying defect (Conradt et al., 1998). Ablation of the six V C , or just one of the HSN neurons does not result in any noticeable effect on egg laying. Numerous stimuli can affect the rate of egg laying, including the presence of food; hermaphrodites will lay more eggs in the presence of bacteria. Several pharmacological agents have been identified that stimulate egg laying in the absence of food. These include acetylcholine, octopamine, and serotonin. Cholinergic activity stimulates egg laying, and octopamine inhibits egg laying. Serotonin stimulates egg laying, as does imipramine, a drug that potentiates endogenous serotonin by preventing serotonin reuptake (Horvitz et a l , 1982). The source of the endogenous serotonin activity is likely the HSN neurons. The HSN neurons stain with an antiserotonin 130 antibody, and when the HSN neurons have been ablated, egg laying can be reestablished in response to serotonin, but not imipramine. R N A i treated animals display an egg laying (Egl) defective phenotype. The animals retain a greater number of embryos than either wild type or controls. Embryos are not retained indefinitely and larvae have not been observed to hatch within the hermaphrodite. CeHIPl protein can be observed in the vulval muscles through immunostaining. This staining is subsequently lost in R N A i treated animals. It is likely that CeHIPl has a role in vulval muscle contraction to promote proper egg laying. When CeHIPl protein' is depleted the animals display a hindered egg laying behavior. It may be that the embryos are simply pushed out when there are too many within the uterus. Egg laying is a redundant process, and it is obvious that R N A i of CeHIPl does not shut the process down, but results in an inefficiency. Numerous egg laying defective mutants in the three basic components of the egg- laying system (vulva, sex muscles, and neurons) have been identified from various screens (Trent et al., 1983). CeHIPl seems to be present in the vulval muscles. At this point it is not clear what role CeHIPl has in these cells, but the depletion of the protein can impair normal egg laying. CeHIPl may contribute to the structural integrity of the vulval muscles, which is compromised in the R N A i animals leading to impaired muscle function. The putative endocytic function of CeHIPl may also be important. As may be similar for the pharynx, the vulval muscles may have a requirement for endocytosis for signaling or the recycling of, as yet, unidentified molecules for proper functioning. 131 4.2.3 The Role of CeHIPl in Pharynx Development and Function C. elegans is an obligatory predator, and it uses its pharynx to ingest anything smaller than the opening of its buccal cavity. The pharynx is a self-contained neuromuscular pump, and is a prominent feature of the C. elegans head (reviewed in Wood, 1988). It is composed of 80 nuclei: 5 belonging to gland cells, 18 to miscellaneous structures, 37 to muscle cells, and 20 to pharyngeal neurons (Albertson and Thomson, 1975; Avery, 1993). The cells are arranged into 4 distinct regions: the anterior procorpus, a bulb shaped metacorpus, a cylindrical isthmus, and a terminal bulb. See figure 3.25 A and C. The structural organization of the pharynx shows triradiate symmetry; cross sectioning shows a central lumen with three muscles arranged around it. The entire structure is surrounded by a basement membrane, isolating it from the rest of the animal. The 20 neurons constitute the pharyngeal nervous system, which is self- contained. There is one bilaterally symmetric pair of connections between the pharyngeal nervous system and the extrapharyngeal nervous system, but this connection is dispensable for normal feeding (Avery and Horvitz, 1989; Avery, 1993). Of the 20 pharyngeal neurons, only M4 is essential for viability (Avery and Horvitz, 1989). A worm lacking the remaining 19 neurons is viable and fertile, although many do not display normal growth rates and fertility levels (Avery, 1993). The pharynx undergoes an orchestrated set of motions to take up food, grind it, add digestive enzymes and transport the food through a valve into the intestine. The nematode feeds almost constantly during its life cycle, except during the molt, or when it enters the resistant dauer larval stage. At these times, a mechanism for the inhibition of pharyngeal pumping is required (reviewed in Riddle, 1997 and Wood, 1988). 132 The development of the pharynx is complex. It is not clear how multiple cell types from distinct cell lineages are specified and assembled into a functioning organ. Organogenesis depends on complex patterns of morphogenesis and differentiation, often arising from interactions between adjacent tissues. The C. elegans pharynx is generated by two early blastomeres, ABa and MS (Sulston et al., 1983). Each blastomere gives rise to multiple cell types within the pharynx, but they use different genetic programs. Cells from the ABa-derived pathway depend on intercellular signaling mediated by the GLP-1 (germline proliferation) receptor. GLP-1 is a transmembrane receptor closely related to LIN-12 (lineage abnormal) and Drosophila Notch (Berry et al., 1997; Greenwald et al., 1994). Pharynx production from MS appears to be cell autonomous. The putative transcription factors, SKN-1 (skin) and POP-1 (posterior pharynx defective), are required for the MS developmental program, including the generation of pharyngeal cells (Bowerman et al., 1993; Horner et al., 1998; Lin et al., 1995). The genetic networks involving glp-l,pop-l, and skn-1 are beginning to be understood, but very little is known about the mechanisms that act downstream of these genes to mediate pharyngeal organogenesis (Horner et al., 1998). A point of convergence for pharyngeal development is pha-4 (pharynx development abnormal). Animals lacking zygotic pha-4 activity fail to generate pharyngeal cells from either ABa or MS lineages. Most other cells appear to be produced normally in pha-4 mutant embryos, including cells from ABa and MS that are non pharyngeal (Horner et al., 1998). pha-4 encodes transcription factor of the winged helix variety, and is a forkhead/T/TVF-i homolog, that is expressed in all pharyngeal precursors and establishes 133 their fate (Horner et al., 1998; Kalb et al., 1998; Weinstein et al., 1994). A consensus PHA-4 binding site has been identified, and all pharyngeally expressed genes examined to date possess this sequence (Gaudet and Mango, personal communication). GFP reporter and immunocytochemistry studies I have conducted show that CeHIPl is found in the pharynx. CeHIPl possesses two potential PHA-4 binding sites in its putative promoter region, making it a candidate for PHA-4 activity (figure 2.2). CeHIPl cannot be detected in early development, it is first observed in animals around the time the pharynx first starts pumping (~ 750 minutes after the first cell cleavage, after Sulston et al., 1983). CeHIPl can be detected in the pharynx through all subsequent stages. A reduction of CeHIPl message in young animals, as assayed through R N A i , results in deformation of the pharynx of older animals. C e H I P l and the Cytoskeleton CeHIPl is necessary to maintain proper pharyngeal morphogenesis. CeHIPl is a putative actin binding protein, with its homologs being important for the maintenance of the cortical actin cytoskeleton among other things. The pharynx is an organ that undergoes considerable physical stress, as it is a near continuously active organ. If it stops pumping, the animals will cease to feed and will presently die. It is likely that the pharynx has to undergo considerable cellular rearrangement to facilitate continuous pumping. If a component of the cytoskeleton is depleted, the pharynx may not be able to maintain its normal shape, and will ultimately deform under the force of continuous pumping. 134 There are numerous mutants with defective pharyngeal morphology and function, including pha-2,pha-3, and phm-2 (pharyngeal muscle abnormal, Avery, 1993). These mutations have not been cloned as of yet. The misshapen pharynxes observed as an effect of CeHIPl R N A i are visible under Nomarski optics and are easily observed through immunostaining. The isthmus of the deformed pharynx is not straight, it appears to curve and sometimes folds back on itself. The procorpus seems to be reduced in length, and from immunostaining it looks as i f it is lost to an increase in size of the metacorpus. It sometimes appears as if the metacorpus structure is repeating itself at the expense of the procorpus. Overall, the pharynx looks as i f it has lost structural integrity, and the animals look slightly starved, indicating inefficient feeding. The R N A i phenotype is similar in some aspects to the phenotypes observed for the aforementioned mutants, pha-2 mutants have misshapen pharynxes in which the cells of the terminal bulb and isthmus appear to have mixed; the resulting being a smaller bulb and a thicker isthmus (Avery, 1993). These animals become extremely starved adults. pha-3 mutant animals have a deformed isthmus (Avery, 1993). The isthmus, which is normally of a constant diameter throughout its length is instead tapered from the terminal bulb becoming quite thin where it joins the metacorpus. In phm-2 worms, the grinder is unable to move to its full forward position, and the muscle fibers of the terminal bulb appear shorter than normal (Avery, 1993). In C. elegans, 5 genes encode actin, three of which, act-1,2,3, are arranged in a cluster on L G V (Krause et al., 1989; Landel et al., 1984). The act (ad468 ad767sd) double mutation was isolated in an F l screen for dominant mutations; this turned out to be semi-dominant as many ad468 ad767I/+ heterozygotes were slightly starved. ad468 135 ad767 homozygotes displayed a pharyngeal muscle defect, with barely detectable contractions of the pharynx. ad468 ad767 mutants contain point mutations in act-2 and act-3, and are unique among actin mutants in that the worm's motility is normal. A l l previously known actin mutations were isolated by their effects on body wall muscle, suggesting that ad468 ad767 specifically affects pharyngeal muscle. ad468 is the first known mutation of act-2 suggesting act-2 may function specifically in pharyngeal muscle, while act-1 and act-3 may function in both pharyngeal and body wall muscle (Avery, 1993). Thus, as is demonstrated by ad468 ad767 and CeHIPl R N A i , the pharynx is a structure that requires an intact cytoskeletal complex to function. Perturbation of any component can result in deformity of the pharynx. At this point it is still unclear what the specific contribution CeHIPl makes to maintain pharynx structure and function. CeHIPl does not seem to be involved in early development in the context of pharyngeal development. It may be one of a host of genes that are activated by PHA-4, and acts once the mature pharynx has been generated to maintain its structure and promote its function. Endocytosis and Pharynx Function It is not known what the role of receptor mediated endocytosis is in the pharynx. CeHIPl appears to be present in all parts of the pharynx, including the pharyngeal nervous system. Endocytic trafficking may be important to maintain the structure of the pharynx, or it could be involved in the recycling of signaling components. Several neurotransmitters are known to be active in the pharynx, including serotonin and glutamate (reviewed in Riddle, 1997). A simplified account of synaptic transmission is 136 as follows: Synaptic vesicles are synthesized in the soma and transported to the synaptic terminals. Along the way they are loaded with neurotransmitter synthesized from cellular metabolites. Loaded vesicles are translocated and docked at specific release sites, and become poised for fusion. Calcium influx initiates a rapid fusion of the vesicle with the plasma membrane and the neurotransmitter is released. The neurotransmitter diffuses across the synaptic cleft and interacts with receptors on the surface of the postsynaptic cell. Neurotransmission is terminated through destruction of the neurotransmitter, or the transmitter is transported back into the presynaptic cell through a transmitter uptake transporter. At this point, vesicle membrane that had been incorporated into the plasma membrane is recycled by endocytosis. Vesicular components are known to be sequestered into clathrin-coated pits, and these membrane patches bud off of the plasma membrane as coated vesicles. Perhaps CeHIPl is involved in this process. The unc-101 gene codes for a clathrin adaptor protein, an ortholog of mouse AP47 (Lee et al., 1994). The distribution of CeHIPl protein appears normal in unc-101(ml) animals (data not shown). This would be expected i f CeHIPl is recruited to the later stages of endocytosis, once clathrin and the accessory proteins have set up the scaffold from which the membrane will bud. Further investigation is required to determine what contribution CeHIPl may have to endocytosis and pharynx function. 137 4.3 CeHIPl, A Dose Sensitive Gene? Null mutations in most diploid organisms appear recessive in heterozygotes as no phenotypes are observed under cursory examination. The reduced viability of animals heterozygous for deletions of chromosomal regions can be interpreted as a deleterious effect caused by the cumulative dosage reduction of independent gene products. Aneuploid analysis in Drosophila has shown several instances where relatively small deletions that are lethal in only one copy (Lefevre et al., 1972; Lindsley et al., 1972; Prado et al., 1999). Although most of the seven haplolethal regions contain a muscle or cytoskeletal protein, a direct relationship with haplolethality has only been demonstrated for dpp (which codes for the Drosophila homolog of bone morphogenic protein 2, Padgett et al., 1987) and wupA (which codes for troponin I, Barbas et al., 1991). Thus, haplolethality may result from an imbalance of muscle or cytoskeletal proteins. 4.3.1 CeHIPl and Haploinsufficiency There are several regions and loci in C. elegans suspected of demonstrating haploinsufficiency. This includes mutation ct45, which maps between dpy-28 and unc-49 on LGIII (Mains and Wood, personal communication). ct45 shows maternal effect, dominant embryonic lethality, which can be rescued by a duplication of the region (mnDp37). The heterochronic gene lin-41, which codes for a RBC (Ring finger-B box- Coiled coil) protein, is a haploinsufficient locus (Slack and Ruvkun, personal communication). The map location of CeHIPl was suspicious from the outset of this work. Many well characterized deficiencies appeared to break upon either side of the region. Only 138 one deficiency, nDfl 7, appeared to span CeHIPl. None of the deficiencies tested deleted CeHIPl. These data suggest that this gene may not be tolerated in one copy by the animal; the region is haploinsufficient. Additional evidence for haploinsufficiency comes from the inability to recover animals bearing deletions of CeHIPl from reverse genetic screens. Multiple deletions were generated, but no animals with these chromosomal alterations could be isolated. It may not be possible to recover a gene knockout of CeHIPl by conventional means. CeHIPl may be dose sensitive as it is required in large amounts in the gonad for fertilization. When this is perturbed, through R N A i or genetic lesion, fertilization will not occur and no affected progeny will be present in the next generation. CeHIPl has a role in late development in pharyngeal morphology and egg laying, which can only be seen in silencing the gene after fertilization. 4.3.2 Overexpression of CeHIPl Evidence from other systems indicated that the overexpression of the CeHIPl related proteins mitigated a toxic effect in the respective systems. There are several examples of the overexpression of various genes leading to reduced viability in C. elegans, including gain of function and dominant negative mutations of let-60 ras (Sternberg and Han, 1998). High level expression of the talin-like domain of Sla2p in a SLA2 deletion background resulted in cell death (Yang et al., 1999). Likewise, overexpression of HIP1 in mammalian cell culture caused the cells to undergo apoptosis 139 (Hackam et al., 2000). Thus, this family of proteins may display dosage sensitivity, a hypothesis supported by my attempts to generate a deletion of CeHIPl in C. elegans. Transgenic strains were generated that contained inducible CeHIPl expression constructs. Elevated CeHIPl expression resulted in animals becoming sickly, and often dying. These animals fail to thrive, and upon examination under Nomarski optic would often contain vacuoles. The toxic effect may be due to a titration of proteins away from their proper interacting partners. CeHIPl possesses several domains predicted to bind other proteins, including an actin binding motif, an ENTH domain and several putative coiled-coil domains (Engqvist-Goldstein, 2000; Kay, 1999; Lupas, 1991; McCann, 1997; Yang, 1999). The flooding of cells with CeHIPl may in effect mop up the normal complement of interacting proteins from fulfilling their normal function. Potential interacting proteins include filamentous actin, and endocytic machinery components such as clathrin and AP2. Massive disregulation of the cytoskeleton and endocytic pathways may be the effect of excess CeHIPl in the cell. This is detrimental not only to the cell, but the animal as well. Although it is enticing to consider the appearance of vacuoles as an indication of CeHIPl's supposed endocytic function, more work is necessary to confirm this. It is evident, however, that an increase in endogenous CeHIPl hinders viability of the animal and the locus may indeed display dosage sensitivity. It is not known if the toxic effect from the overexpression of CeHIPl follows an apoptotic pathway, as is the case for HIP1 (Hackam et al., 2000). Apoptosis in C. elegans requires the caspase 3 CED-3 (Horvitz paper). It would be informative to see if the toxic effect of CeHIPl overexpression is ced-3 dependent. Additionally, sick animals could be examined for markers of apoptosis. 140 4.4 CeHIPl and Interacting Proteins Several experiments were conducted to learn more about potential interacting protein partners of CeHIPl. As HIP1 was identified as a specific interacting partner of huntingtin, I addressed whether CeHIPl displayed a similar interaction and found that CeHIPl does not associate with huntingtin. At this point, the various sequencing projects have identified huntingtin homologues only in vertebrates. Thus huntingtin may be an addition late in evolution, coinciding with the appearance of vertebrates. In lieu of genetically identifying interacting genes of CeHIPl, a molecular approach was used. A yeast two-hybrid screen identified two clones that potentially associate with CeHIPl. These interactions have not been confirmed through independent means. 4.4.1 Yeast Two-Hybrid Screen T05C12.10 and C. elegans Hedgehog-Like Genes The first interacting protein is T05C12.10, a protein that shows sequence similarity to Drosophila hedgehog (hh). hh genes encode a family of secreted signaling molecules with functions in anteroposterior patterning as well as differentiation of neurons and many other cell types in flies and vertebrates (Hammerschmidt, 1997). A single member exists in Drosophila, whereas vertebrates possess multiple related genes. These genes all possess a highly conserved amino-terminal signaling domain that is cleaved off and anchored to a cholesterol moiety by the protein's own carboxy-terminal protease domain (Goodrich and Scott, 1998). 141 A survey of the C. elegans genome sequencing and EST projects revealed several genes that encode a hh-\\ke autocleavage domain at their carboxyl terminus (Aspock, 1999; Burglin, 1996; Porter, 1996). This domain has been termed the Hog domain, due to its sequence similarity to hedgehog (Aspock et al., 1999). The part that shares similarity with intein domains of prokaryotes is also referred to as the Hint domain (Hedgehog/intein Hall). With the complete C. elegans genome available for scrutiny, there does not exist an obvious hh homolog outside of the genes containing Hog domains (Aspock et al., 1999; Ruvkun et al., 1998). The region amino-terminal to the Hog domains of several of these genes contain novel domains, which have been termed Wart and Ground. Genes that encode these domains but lack the Hog domain have also been found. These gene families have been named warthog (wrt) and groundhog (grd) regardless of their association with a Hog domain. Greater than 50 genes in C. elegans have been classified under this nomenclature (Aspock, 1999). Initial characterization of a handful of these genes has revealed a diverse expression pattern, including the hypodermis, seam cells, the excretory cell, sheath and socket cells, and different neurons. T05C12.10 (also known as M l 10,(Aspock et al., 1999)) contains a Hog domain, but its amino-terminus is unlike the related genes. It contains no wrt or grd domains, and instead possesses a large ORF upstream of the Hog domain. The first 250 residues show a unique, diverse composition, whereas the central region consists of repeated amino acids. The amino terminus matches no other proteins with any significance. T05C12.10 is considered an orphan hog gene. Initial analysis of T05C12.10 has outlined a role for the gene in molting. R N A i of T05C12.10 results in larval lethality, as the animals are unable to molt effectively (Wang 142 and Seydoux, personal communication). In many cases a cuticular plug can be seen obstructing the mouth region, which presumably interferes with feeding. A T05CT2.10::GFP reporter construct shows expression in several regions, including the hypodermis and pharynx. A T05C12.10 deletion mutant, VC42 (gk32) was obtained from the C. elegans K O Core Facility (UBC). Animals homozygous for gk32 arrest at the second larval stage. Postembryonically, all nematodes progress through four larval stages characterized by different cuticle structures. Molting permits growth, but is not necessary as nematodes increase in size between molts and after the final molt (Singh and Sulston, 1978). Molting is thought to be important for parasitic nematodes that need to alter their surface composition to survive changing environments, but not for most free-living species. It is likely that the molting cycle activates basic developmental programs, and the linkage between molting and development has been maintained through nematode evolution. At each molt, the animal enters a period of lethargus, lasting approximately 2 hours, during which pharyngeal pumping and movement is suppressed. Connections between the hypodermis and cuticle are broken at the beginning of lethargus and a new cuticle is formed. About 30 minutes before the old cuticle is shed (known as ecdysis), the animals can be observed to spin or flip about their axis. Just prior to ecdysis, the pharynx will begin spasmodic contractions (Singh, 1978). The cuticle lining the pharynx breaks, and the old cuticle distends around the head. The animal will repeatedly pull back to dislodge the cuticle remaining in the pharynx. The animal will continue to push with its head until the old cuticle breaks, upon which it will crawl out of the remains. The cuticle is often ingested by the animal (Albertson, 1975). 143 Thus, T05C12.10 seems to be essential for molting and viability. The involvement of CeHIPl is less clear. The overlap of gene expression in the pharynx may indicate a functional interaction between the two gene products. Depletion of CeHIPl does not result in a molting defect. The interaction between CeHIPl and T05C12.10 maps to the carboxy 1 terminus of CeHIPl, containing both the large central coiled-coil domain and the talin-like region. CeHIPl has a putative role in cytoskeletal and endocytic function. T05C12.10 may act through these pathways to initiate molting. It is difficult to interpret the significance of the interaction at this point. Additionally, the interaction of CeHIPl and T05C12.10 has not been confirmed by independent means. F45E12.2 and RNA Turnover in C. elegans The second protein identified was F45E12.2, which shows similarity to R N A transcription initiation factor type IIB (TFIIB). TFIIB is one of a group of general initiation factors (TFIIB, TFIID, TFIIE, TFIIF, and TFIIH) which function in association with R N A polymerase II and are required for selective binding of polymerase to its promoters (Conaway and Conaway, 1999). A deletion mutant of F45E12.2, strain VC28 (gkl 7) was obtained from the C. elegans K O Core Facility (UBC). Animals homozygous for gkl 7 arrest in the second larval stage. A screen for factors involved in mRNA turnover in yeast identified four strains with defects in the decay of several mRNAs (Zuk et al., 1999). One of the mutations identified was allelic to SLA2. The mutation, ts942, stabilized several mRNAs that would have ordinarily decayed. The putative link between R N A stability and cytoskeletal and endocytic event is not self-evident. There is evidence for a link between the cytoskeleton 144 and the stability of specific mRNAs. Disruption of the cytoskeleton with cytochalisin leads to the stabilization of lymphokine mRNAs in human peripheral blood lymphocytes (Henics et al., 1997). Thus, Sla2p may have yet another role, linking the cytoskeleton to mRNA stability. It is not known if CeHIPl has a similar function; mRNA stability was not assayed in CeHIPl R N A i experiments. CeHIPl may contribute to mRNA turnover in the tissues in which it is found. It is worth considering that endogenous CeHIPl protein may have an effect on the stability of R N A species, and what this may contribute to R N A i experiments. CeHIPl may be involved in promoting turnover of RNA, which would hinder R N A i techniques. Further investigation is required to determine if CeHIPl is involved with R N A stability in C. elegans. 4.5 Is CeHIPl the nematode homologue of human HIP11 C. elegans does not possess a homologue of huntingtin. An obvious and important question then is whether or not CeHIPl is the worm ortholog of HIP 1, A second candidate is HIP 12 (Chopra et al, 2000). CeHIPl and HIP1 both show restricted expression, while HIP 12 is widely expressed. CeHIPl and HIP1 show dose sensitive toxic effects. Overexpression of HIP 1 causes cell death through an apoptotic pathway, and this effect is wholly dependent on a novel death effector domain (DED) within HIP1 (Hackam et al., 2000). This domain is not present in HIP 12, and HIP 12 has no toxic effects (Chopra et al., 2000). CeHIPl has a region with weak similarity to the DED of HIP1. The potential DED of CeHIPl is closely related to the predicted DED's of CED-4 (CED-4 reference). A test to resolve between these two candidates would be to 145 determine if the toxic effects observed from overexpression of CeHIPl follows an apoptotic mechanism. If it does, this would argue in favor of CeHIPl being the true homologue of human HIP1. A cursory examination of the human genome reveals that humans often posses multiple versions of a gene, with lower organisms containing just one or two (human genome paper). Lastly, it cannot be ignored that perhaps F08A8.6 is not a pseudogene. Its absence from EST databases, and my inability to detect it reflecting its low abundance or specialized expression. If this is the case then there exists the possibility that F08A8.6 may contribute to the function of CeHIPl. 4.6 Conclusion CeHIPl encodes a gene that shares sequence identity with a family of genes in many eukaryotes, ranging from yeast to humans. Studies of these genes have ascribed numerous, seemingly disparate roles to this family of proteins. The protein has a role in maintaining the cortical actin cytoskeleton (Holtzman et al., 1993). It also has a role in endocytic events, and may represent a link between the actin cytoskeleton and endocytic events (Engqvist-Goldstein et al., 2000; Na et al., 1995; Raths et al., 1993) as well as role in R N A stability (Zuk et al., 1999). Most recently, human HIP1 has been shown to have a proaptotic function. Cultured cells transfected with HIP1 undergo programmed cell death (Hackam et al., 2000). For the most part, the role of this protein has been described in cellular terms. The endocytic function illustrates that the cell is actively receiving input from neighbors. Thus, the protein will have functions outside of its immediate cellular environment. What is the role of this conserved gene in the context of the development of a complex, multicellular eukaryotic system? 146 In this thesis I have begun to answer this question. CeHIPl is a protein that seems to have multiple functions in C. elegans. CeHIPl may have a function in cytoskeletal structural integrity, as well as endocytosis and vesicle trafficking. CeHIPl shows tissue specific expression in the nematode, and likewise, tissue specific function. There is precedence for multiple function for a single protein. The C. elegans patched homolog PTC-1 is proposed to retain a signaling role in the germ line as a receptor for one of the Hh-related molecules, and has additional roles in vesicle trafficking and membrane deposition and cellular structural integrity (Kuwabara et al., 2000). CeHIPl possesses an ENTH domain, which has been found in proteins with endocytic and cytoskeletal functions (Kay, 1999). The I/LWEQ domain ascribes F-actin as an interacting protein (McCann and Craig, 1999). The putative coiled-coil domains of CeHIPl suggest that it is likely to have multiple protein partners (Lupas, 1997). Thus, the function of CeHIPl may largely depend on its local cellular context. CeHIPl may contribute to cytoskeleton dynamics, and thus have a structural role. This can be observed from the pharyngeal deformities observed after CeHIPl R N A i treatment of young animals. The depletion of CeHIPl message, and ultimately protein results in a loss of structural integrity of the pharynx. CeHIPl has a role in maintaining morphology and subsequent functioning of very different organs. An exhaustive examination of the components of the gonad for structural defects has not been conducted. These structures do show imperfect functioning however. Errors in ovulation and fertilization are contingent upon CeHIPl R N A i . This defect may reflect a structural deficit of the gonad, but it may also point out a signaling function. The signal to halt ovulation is lost and oocytes continue to mature even though the 147 system is in error. It is known that somatic structures of the gonad are required to prevent the Emo phenotype perhaps this is facilitated through CeHIPl (McCarter et al., 1997). The signal from the somatic gonad may be received by the oocytes through a receptor mediated endocytosis system utilizing CeHIPl. The reduction in the number of mature sperm housed within the spermatheca of R N A i animals may be a consequence of a loss of signaling as well. It is unknown what directs sperm to the spermatheca. CeHIPl may have role in presenting and maintaining molecules in the surface of the spermatheca to coordinate sperm movements to the structure. Depletion of CeHIPl within the vulval muscles results in an egg-laying defect. This phenotype can be attributed to either a structural or signaling deficiency. It is easy to envisage how either situation could lead to a defect in the function of these muscles. 4.7 Model C. elegans provides a good model to interpret the role of the human homolog, HIP1. The two genes, CeHIPl and HIP I show restricted expression. CeHIPl in the pharynx, vulval muscles and spermatheca of the worm and HIP1 is enriched in the brain and testes of humans. The expression of HIP1 in the brain, specifically the cortex, is one of the features which has implicated it strongly in the specific neuropathology of HD. Thus, the tissue-restricted expression of CeHIPl may be useful to identify the specific cellular context in which it functions. Likewise, the two proteins also display dose sensitive toxic effects. Overexpression of human HIP I results in cellular death through an apoptotic pathway (Hackam et al., 2000). Overexpression of CeHIPl results in negative consequences in 148 terms of viability of the worm. It may be possible to use this system to delineate the toxic effect in nematodes, and establish genetic screens for suppression of the phenotype. These findings may reflect the situation in humans, and perhaps point out avenues of potential treatment. The family of CeHIPl related genes have multiple functions, with new ones sprouting up like heads of the mythical hydra. Careful examination is revealing phenotypes not anticipated. It is an exciting family of genes to study as it is uncovering connections between previously distinct cellular pathways. The study of CeHIPl has been particularly informative as it has outlined the multiple roles this protein has in the development of an animal system, which in turn may shed light on the functioning of HIP1 in the pathogenesis of Huntington disease. This thesis describes the characterization of a member of a family of genes becoming recognized for connecting different aspects of cell biology. 149 Bibliography Adams, M.D. , Celniker, S. E., Holt, R. A. , Evans, C. A. , Gocayne, J. D., Amanatides, P. G., Scherer, S. E., L i , P. W., Hoskins, R. A. , Galle, R. F., and et al. 2000. The Genome Sequence of Drosophila melanogaster. Science. 287. Albertson, D.G., and Thomson, J. N . 1975. The Pharynx of Caenorhabditis elegans. Phil. Trans. R. Soc. Lond. B. 275:299-325. Andrew, S.E., Goldberg, Y . P., and Hayden, M . R. 1997. Rethinking Genotype and Phenotype Correlations in Polyglutamine Expansion Disorders. Hum. Mol. Genet. 6:2005-10. Aroian, R.V., and Sternberg, P. W. 1991. Multiple Functions of let-23, a Caenorhabditis elegans Receptor Tyrosine Kinase GeneRequired for Vulval Induction. Genetics. 128:251-67. Aroian, R.V., Lesa, G. M . , and Sternberg, P. W. 1994. Mutations in the Caenorhabditis elegans let-23 EGFR-like Gene Define Elements Important for Cell-type Specification and Function. EMBO J. 13:360-6. Aspock, G., Kagoshima, H. , Niklaus, G., and Burglin, T. R.,. 1999. Caenorhabditis elegans has Scores of Hedgehog-related Genes: Sequence and Expression Analysis. Genome research. 9:909-23. Avery, L. , and Horvitz, H . R. 1989. Pharyngeal Pumping Continues after Laser Killing of the Pharyngeal Nervous System of C. elegans. Neuron. 3:473-85. Avery, L . 1993. The Genetics of Feeding in Caenorhabditis elegans. Genetics. 133:897- 917. 150 Barbas, J.A., Galceran, J., Krah-Jentgens, I., DE L A Pompa, J. L. , and Canal, I. 1991. Troponin I is Encoded in the Haplolethal Region of the Shaker Gene Complex of Drosophila. Genes Dev. 5:132-40. Barinaga, M . 1996. An Intriguing New Lead on Huntington's Disease. Science. 271. Bassett, D.E.J., Boguski, M . S., Spencer, F., Reeves, R., Kim, S., Weaver, T., and Hieter, P. 1997. Genome Cross-referencing and XREFdb: Implications for the Identification and Analysis of Genes Mutated in Human Disease. Nat. Genet. 15:339-44. Benmerah, A. , Lamaze, C , Begue, B. , Schmid, S. L. , Dautry-Varsat, A. , and Cerf- Bensussan, N . 1998. AP-2/Epsl5 Interaction is Required for Receptor-mediated Endocytosis. J. Cell Biol. 140:1055-62. Berry, L.W., Westlund, B., and Schedl, T. 1997. Germ-line Tumor Formation Caused by Activation of glp-1, a Caenorhabditis elegans Member of the Notch Family of Receptors. Development. 124:925-36. Blader, I.J., Cope, M . J., Jackson, T. R., Profit, A . A. , Greenwood, A . F., Drubin, D. G., Prestwich, G. D., and Theibert, A . B. 1999. GCS1, an Arf Guanosine Triphosphatase-activating Protein in Saccharomyces cerevisiae, is Required for Normal Actin Cytoskeletal Organization in vivo and Stimulates Actin Polymerization in vitro. Mol. Biol. Cell. 10:581-96. Blumenthal, T., and Thomas, J. 1988. Cis and trans mRNA Splicing in C. elegans. Trends Genet. 4:305-8. 151 Bowerman, B., Draper, B. W., Mello, C. C , and Priess, J. R. 1993. The Maternal Gene skn-1 Encodes a Protein that is Distributed Unequally in Early C. elegans Embryos. Cell. 74:443-52. Brenner, S. 1974. The Genetics of Caenorhabditis elegans. Genetics. 115:71-94. Burglin, T.R. 1996. Warthog and Groundhog, Novel Families Related to Hedgehog. Curr. Biol. 6:1047-50. Burridge, K. , and Connel, L . 1983. Talin: A Cytoskeletal Component Concentrated in Adhesion Plaques and Other Sites of Actin-membrane Interaction. Cell Motil. 3:405-17. Chen, H. , Fre, S., Slepnev, .V, Capua, M . , Takei, K. , Butler, M . , Di Fiore, P., and De Camilli, P. 1998. Epsin, an E H Domain Binding Protein Implicated in Clathrin- mediated Endocytosis. Nature. 394:793-7. Chopra, V . S., Metzler, M . , Rasper, D. M . , Engqvist-Goldstein, A. E., Singaraja, R., Gan, L. , Fichter, K . M . , McCutcheon, K., Drubin, D., Nicholson, D. W., and Hayden M . R. 2000. HIP 12 is a Non-proapoptotic Member of a Gene Family Including HIP1, an Interacting Protein with Huntingtin. Mamm Genome 11:1006-15 Cinibo, G.D., Gamper, H. B., Isaacs, S. T., and Hearst, J. E. 1985. Psoralens as photoactive probes of nucleic acid structure and function: organic chemistry, photochemistry, and biochemistry. Annu. Rev. Biochem. 54. Clark, M.S. 1999. Comparative Genomics: the Key to Understanding the Human Genome Project. BioEssays. 21:121-30. Conaway, J.W., and Conaway, R. C. 1999. Transcription Elongation and Human Disease. Annu. Rev. Biochem. 68:301-19. 152 Conradt, B., and Horvitz, H. R. 1998. The C. elegans Protein EGL-1 is Required for Programmed Cell Death and Interacts with the Bcl-2-like Protein CED-9. Cell. 93:519-29. Consortium, T.C.e.S.p.e.a.i.SJ.a.M.a.S. 1998. Genome Sequence of the Nematode C. elegans: A Platform for Investigating Biology. Science. 282:2012-2018. Coulson, A. , Waterston, R., Kiff, J., Sulston, J., and Kohara, Y . 1988. Genome Linking with Yeast Artificial Chromosomes. Nature. 335:184-6. Coulson, A. , Kozono, Y. , Lutterbach, B., Shownkeen, R., Sulston, J. and Waterston, R. 1991. Y A C S and the C. elegans Genome. Bioessays. 13:413-7. Coulson, A. , Huynh, C , Kozono, Y. , and Shownkeen, R. 1995. The Physical Method of the Caenorhabditis elegans Genome. Methods Cell Biol. 48:533-50. Davies, S.W., Turmaine, M . , Cozens, B.A. , DiFiglia, M . , Sharp, A . H. , Ross, C. A. , Scherzinger, E., Wanker, E. E., Mangiarini, L., and Bates, G. P. 1997. Formation of Neuronal Intranuclear Inclusions Underlies the Neurological Dysfunction in Mice Transgenic for the HD Mutation. Cell. 90:537-48. de Camilli, P., Takei, K. , and McPherson, P. S. 1995. The Function of Dynamin in Endocytosis. Curr, Opin. Neurobiol. 5:559-65. DiFiglia, M . , Sapp, E., Chase, K . O., Davies, S. W., Bates, G. P., Vonsattel, J. P., and Aronin, N . 1997. Aggregation of Huntingtin in Neuronal Intranuclear Inclusions and Dystropic Neurites in Brain. Science. 277:1990-3. Ding, L. , and.Candido, E. P. M . 2000. HSP25, a Small Heat Shock Protein Associated with Dense Bodies and M-lines of Body Wall Muscle in Caenorhabditis elegans. The Journal of Biological Chemistry. 275:9510-7. 153 Dragatsis, I., Levine, M . S., and Zeitlin, S. 2000. Inactivation of Hdh in the Brain and Testis Results in Progressive Neurodegeneration and Sterility in Mice. Nature Genet. 26:300-6. Drubin, D.G., Miller, K . G., and Botstein, D. 1988. Yeast Actin-binding Proteins: Evidence for a Role in Morphogenesis. J. Cell Biol. 144:1203-18. Engqvist-Goldstein, A.E . , Kessels, M . M . , Chopra, V . S., Hayden, M . R. and Drubin, D. G. 2000. A n Actin-binding Protein of the Sla2/Huntingtin Interacting Protein 1 Family is a Novel Component of Clathrin-coated Pits and Vesicles. J. Cell Biol. 147:1503-18. Evans, D., and Blumenthal, T. 2000. Trans Splicing of Polycistronic Caenorhabditis elegans Pre-mRNAs: Analysis of the SL2 RNA. Mol. Cell. Biol. 20:6659-67. Faber, P.W., Alter, J. R., MacDonald, M . E., and Hart, A . C. 1999. Polyglutamine- mediated Dysfunction and Apoptotic Death of a Caenorhabditis elegans Sensory Neuron. PNAS. 96:179-84. Finney, M . , and Ruvkun, G. 1990. The unc-86 Gene Product Couples Cell Lineage and Cell Identity in C. elegans. Cell. 63:895-905. Fire, A . 1986. Integrative Transformation of Caenorhabditis elegans. EMBO. 5:2673-80. Fire, A . , Xu . S., Montgomery, M . K. , Kostas, S. A. , Driver, S. E., and Mello, C. C. 1998. Potent and Specific Genetic Interference by Double-stranded RNA in Caenorhabditis elegans. Nature. 391:806-11. Francis, R., Barton, M . K. , Kimble, J., and Schedl, T. 1995. gld-1, a Tumor Suppressor Gene Required for Oocyte Development in Caenorhabditis elegans. Genetics. 139:579-606. 154 Fraser, A . G . , Kamath, R. S., Zipperlen, P., Martinez-Campos, M . , Sohrmann, M . , and Ahringer, J . 2000. Functional Genomic Analysis of C. elegans Chromosome I by Sytematic R N A Interference. Nature. 408:325-30. Gengyo-Ando, K. , and Mitani, S. 2000. Characterization of Mutations Induced by Ethyl Methanesulfonate, U V , and Trimethylpsoralen in the Nematode Caenorhabditis elegans. Biochemical and Biophysical Research Communications. 269:64-9. Gietz, R.D., and Schiestl, R. H. 1995. Transforming Yeast with DNA. Methods in Molecular Cellular Biology. 5:255-69. Goodrich, L .V . , and Scott, M . P. 1998. Hedgehog and Patched in Neural Development and Disease. Neuron. 21:1243-7. Grant, B., and Hirsh, D. 1999. Receptor-mediated Endocytosis in the Caenorhabditis elegans Oocyte. Mol. Biol. Cell. 10:4311-26. Greenstein, D.H., S., Plasterk, R. H. A. , Andachi, Y. , Wang, B., Finney, M . , and Ruvkun, G. 1994. Targeted Mutations in the Caenorhabditis elegans POU Homebox Gene ceh-18 cause Defects in Oocyte Cell Cycle Arrest, Gonad Migration, andEpidermal Differentiation. Genes Dev. 8:1935-48. Greenwald, I. 1994. Structure/function Studies of lin-12/Notch proteins. Curr. Opin. Genet. Devel. 4:556-62. Hackam, A.S., Yassa, A. S., Singaraja. R., Metzler, M . , Gutekunst. C.-A., Gan, L. , Warby. S., Wellington, C. L. , Vaillancourt, J., Nansheng,, and G. C , F. G. Raymond, L. , Nicholson, D. W. and Hayden, M . R. 2000. Huntingtin Interacting Protein 1 (HIP-1) Induces Apoptosis via a Novel Caspase-dependent Death Effector Domain. J. Biol. Chem. in press. 155 Hammerschmidt, M . , Brook, A. , and McMahon, A . P. 1997. The World According to Hedgehog. Trends Genet. 13:14-21. HDCRG. 1993. A Novel Gene Containing a Trinucleotide Repeat that is Expanded and Unstable on Huntington's Disease Chromosomes.. Cell:971-83. Hemmings, L. , Rees, D. J. C , Ohanian, V. , Botton, S. J., Gilmore, A. P., Patel, B., Priddle, H. , Trevithick, J. E., Hynes, R. O. and Critchley, D. R. 1996. Talin Contains Three Actin-binding Sites Each of which is Adjacent to a Vinculin- binding Site. J. Cell Sci. 109:2715-26. Henics, T.E., Nagy, J., and Szekeres-Bartho, J. 1997. Interaction of AU-rich Sequence Binding Proteins with Actin: Possble Involvement of the Actin Cytoskeleton in Lymphokine mRNA Turnover. J. Cell. Physiol. 173:19-27. Hi l l , R.J.and.Sternberg., P. W. 1992. The Gene lin-3 Encodes an Inductive Signal for Vulval Development in C. elegans. Nature. 358:470-6. Hirsh, D., Oppenheim, D., and Klass, M . 1976. Development of the Reproductive System of Caenorhabditis elegans. Dev. Biol. 49:200-19. Hirst, J.a.R., M . J. 1998. Clathrin and Adaptors. Biochim. Biophys. Acta. 1404:173-93. Holtzman, D.A., Yang, S. and Drubin, D. G. 1993. Synthetic-lethal Interactions Identify Two Novel Genes, SLA1 and SLA2, That Control Membrane Cytoskeleton Assembly in Saccharomyces cerevisiae. J. Cell Biol. 3:635-44. Horner, M.A . , Quintin, S., Domeier, M . E., Kimble, J., Labouesse, M . , and Mango, S. E. 1998. pha-4, an HNF-3 Homolog, Specifies Pharyngeal Organ Identity in Caenorhabditis elegans. Genes & Development. 12:1947-52. 156 Horvitz, H.R., Brenner, S., Hodgkin, J., and Herman, R. K. 1979. A Uniform Genetic Nomenclature for the Nematode Caenorhabditis elegans. Mol. Gen. Genet. 175:129-33. Horvitz, H.R., Chalfie, M . , Trent, C., Sulston, J. and Evans, P. D. 1982. Serotonin and Octopamine in the Nematode Caenorhabditis elegans. Science. 216:1012-14. Ikeda, H. , Yamaguchi, M . , Sugai, S., Aze, Y. , Narumiya, S., and Kakizuka, A . 1996. Expanded Polyglutamine in the Machado-Joseph Disease Protein Induces Cell Death in vitro and in vivo. Nature Genet. 13:196-202. Iwasaki, K. , McCarter, J., Francis, R., and Schedl, T. 1996. emo-1, a Caenorhabditis elegans Seclp Gamma Homologue, is Required for Oocyte Development and Ovulation. J. Cell Biol. 134:699-714. Janke, D.L., Schein, J. E., Ha, T., Franz, N . , O'Neil, N . J., Vatcher, G. P., Stewart, H. I., Kuervers, L . M . , Baillie, D. L . and Rose, A . M . 1997. Interpreting a Sequenced Genome: Toward a Cosmid Transgenic Library of Caenorhabditis elegans. Genome Research. 7:974-85. Jansen, G., Hazendonk, E., Thijssen, K. L. , and Plasterk, R. H. A . 1997. Reverse Genetics by Chemical Mutagenesis in Caenorhabditis elegans. Nature Genet. 17:119-21. Jones, D., Dixon, D. K. , Graham, R. W., and Candido, E. P. M . 1989. Differential Regulation of Closely Related Members of the hspl6 Gene Family in Caenorhabditis elegans. DNA. 8:481-90. 157 Jorgensen, E .M. , HArtwieg, E., Schuske, K. , Nonet, M . L. , Jin, Y. , and Horvitz, H . R. 1995. Defective Recycling of Synaptic Vesicles in Synaptotagmin Mutants of Caenorhabditis elegans. Nature. 378:196-99. Kalb, J .M., Lau, K. K , Goszczynski, B., Fukushige, T., Moons, D., Okkema, P. G. and McGhee, J. D. 1998. pha-4 is Ce-fkh-1, a Forkhead/HNF-3a,B,y Homolog that Functions in Organogenesis of the C. elegans Pharynx. Devel. 125:2171-80. Kalchman, M.A. , Koide, B. H., McCutcheon, K., Graham, R. K., Nichol, K. , Nishiyama, K., Lynn, F., Kazemi-Esfaranji, P., Metzler, M . , Goldberg, Y . P., Kanazawa, I., Gietz, R. D. and Hayden, M . R. 1997. HIP1, a Human Homologue of S. cerevisiae Sla2p, Interacts with Membrane-Associated Huntingtin in the Brain. Nature Genetics. 16:44-53. Katz, W.S., Hi l l , R. J., Clandinin, T. R., and Sternberg, P. W. 1995. Different Levels of the C. elegans Growth Factor LIN-3 Promote Distinct Vulval Precursoe Fates. Cell. 82:297-307. Kawaguchi, Y. , Okamoto, T., Taniwaki, M . , Aizawa, M . , Inoue, M . , Katayama, H. , Nakamura, S., Nishimura, M . , Akigichi, I., Kimura, J., Narumiya, S., and Kakizuka, A . 1994. C A G Expansions in a Novel Gene for Machado-Joseph Disease at Chromosome 14q32.1. Nature Genet. 8:221-8. Kay, B.K. , Yamabhai, M . , Wendland, B.,and Emr, S. D. 1999. Identification of a Novel Domain Shared by Putative Components of the Endocytic and Cytoskeletal Machinery. Protein Sci. 8:435-8. Ketting, R.F., Fischer, S. E. J., and Plasterk, R. H. 1997. Target choice determinants of the Tel transposon of Caenorhabditis elegans. Nucleic Acids Res. 25:4041-7. 158 Ketting, R.F., Haverkamp T. H . , van Luenen H. G., Plasterk R. H. 1999. Mut-7 of C. elegans, Required for Transposon Silencing and RNA Interference, is a Homolog of Werner Syndrome Helicase and RNaseD. Cell. 99:133-41. Kimble, J., and Hirsh, D. 1979. The Post-embryonic Cell Lineages of the Hermaphrodite and Male Gonads in Caenorhabditis elegans. Dev. Biol. 70:396-417. Kimble, Land .Sulston, J. 1983. Tissue-specific Synthesis of Yolk Proteins in C. elegans. Dev. Biol. 96:189-96. Kimble, Land White, J. G. 1981. On the Control of Germ Cell Development in Caenorhabditis elegans. Dev. Biol. 81:208-19. Klass, M . , Wolf, N . , and Hirsh, D. 1976. Development of the Male Reproductive System and Sexual Transformation in the Nematode Caenorhabditis elegans. Dev. Biol. 52:1-18. Krause, M . , Wild, M . , Rosenzweig, B., and Hirsh, D. 1989. Wild type and Mutant Actin Genes in Caenorhabditis elegans. J. Mol. Biol. 208:381-92. Krause, M.a.H., D. 1987. A trans-Spliced Leader Sequence on Actin mRNA in C. elegans. Cell. 49:753-61. Kuwabara, P.E., Lee, M . Schedl, T., and Jefferis, S. X . E. G. 2000. A C elegans Patched gene, ptc-1, functions in germ-line cytokinesis. Genes & Development. 14:1933- 1944. Kyte, J., and Doolittle, R. F. 1982. A Simple Method for Displaying the Hydropathic Character of a Protein. J. Mol. Biol. 157:105-32. 159 LaMunyon, C.W.a.W., S. 1995. Sperm precedence in a hermaphroditic nematode (Caenorhabditis elegans) is due to competitive superiority of male sperm. Experiential. 58:817-23. LaMunyon, C.W.a.W.S. 1999. Evolution of sperm size in nematodes: sperm competition favours larger sperm. P.N.A.S. 266:263-7. Landel, C P . , Krause, M . , Waterston, R. H., Hirsh, D. 1984. D N A Rearrangements of the Actin Gene-cluster in C. elegans Accompany Reversion of 3 Muscle Mutants. J. Mol. Biol. 180:497-513. Lappalainen, P.a.D., D. G. 1997. Cofilin Promotes Rapid Actin Filament Turnover in vivo [published erratum appears in Nature 389:211]. Nature. 388:78-82. Lee, Y . H . , Jongeward, G., and Sternberg, P. W. 1994. unc-101, a Gene Required for Many Aspects of C. elegans Development and Behavior, Encodes a Clathrin- associated Protein. Genes Dev. 8. Lefevre, G., and Johnson, T. K. 1972. Evidence for a Sex Linked Haplo Inviable Locus in the cut-singed Region of Drosophila melanogaster. Genetics. 74:633-45. L'Hernault, S.W., Shakes, D. C. and Ward, S. 1988. Developmental Genetics of Chromosome I Spermatogenesis-defective Mutants in the Nematode Caenorhabditis elegans. Genetics. 120:435-52. L i , P., Zheng, Y. , and Drubin, D. G. 1995. Regulation of Cortical Actin Cytoskeleton Assembly during Polarized Cell Growth in Budding Yeast. J. Cell Biol. 4:599- 615. 160 Lila, T., and Drubin, D. G. 1997. Evidence for Physical and Functional Interaction Among Two Saccharomyces cerevisiae SH3 Domain Proteins, an Adenyl Cyclase-associated Protein and the Actin Cytoskeleton. Mol. Biol. Cell. 8:367-85. Lin, R.L., Thompson, S., and Priess, J. R. 1995.pop-] Encodes an H M G Box Protein Required for the Specification of a Mesoderm Precursor in Early C. elegans Embryos. Cell. 83:599-609. Lindsley, D.L., Sandler, L. , Baker, B. S., Carpenter, A . T. C , and Denell, R. E. 1972. Segmental Aneuploidy and the Genetic Gross Structure of the Drosophila Genome. Genetics. 71:157-84. Lupas, A. , Van Dyke, M . , and Stock, J. 1991. Predicting Coiled Coils from Protein Sequences. Science. 252:1162-4. Lupas, A . 1997. Predicting Coiled-coil Regions in Proteins. Curr. Opin. Struct. Bio. 7:388-93. Mangiarini, L. , Sathasivam, K. , Seller, M . , Cozens, B., Harper, A. , Heterington, C , Lawton, M . , Trottier, Y . , Lehrach, H. , Davies, S. W., and Bates, G. P. 1996. Exon 1 of the HD Gene with an Expanded C A G Repeat is Sufficient to Cause a Progressive Neurological Phenotype in Transgenic Mice. Cell. 87:493-506. Matilla, A . , Koshy, B, T., Cummings, C. J., Isobe, T., Orr, H. T., and Zoghbi, H. Y . 1997. The Cerebellar Leucine-Rich Acidic Nuclear Protein interacts with Ataxin-1. Nature. 389:974-8. McCann, R.O., and Craig S. W. 1997. The I/LWEQ Module: a Conserved Sequence that Signifies F-actin Binding in Functionally Diverse Proteins from Yeast to Mammals. Proc Natl Acad Sci USA. 94:5679-84. 161 McCann, R.O., and Craig, S. W. 1999. Functional Genomic Analysis Reveals the Utility of the I/LWEQ Module as a Predictor of ProteimActin Interaction. Biochem. Biophys. Res. Comm. 266:135-40. McCarter, J., Bartlett, B., Dang, T., and Schedl, T. 1997. Soma-Germ Cell Interactions in Caenrhabditis elegans: Multiple Events of Hermaphroditic Germline Development Require the Somatic Sheath and Spermathecal Lineages. Developmental Biology. 181:121-43. McCarter, J., Bartlett, B. , Dang, T., and Schedl, T. 1999. On the Control of Oocyte Meiotic Maturation and Ovulation in Caenorhabditis elegans. Dev. Biol. 205:111- 28. Mellman, I. 1996. Endocytosis and Molecular Sorting. Annu. Rev. Cell Dev. Biol. 12:575- 625. Mello, C.a.F., A . 1995. D N A Transformation. In Methods in Cell Biology. Caenorhabditis elegans: Modern Biological Analysis of an Organism. Vol . 48. H.F.a.S. Epstein, D. C , editor. Academic Press, Inc., San Diego. 451-82. Mello, C C , Kramer, J .M., Stinchcomb, D., and Ambros, V . 1991. Efficient Gene Transfer in C. elegans: Extrachromosomal Maintenance and Integration Transformiong Sequences. EMBO. 10:3959-70. Merrifield, C L , Moss, S. E., Ballestrem, C , Imhof, B. A. , Giese, G., Wunderlich, I., and Aimers, W. 1999. Endocytic Vesicles Move at the Tips of Actin Tails in Cultured Mast Cells. Nat. Cell Biol. 1:72-4. Miller, D .M. , and Shakes, D. C. 1995. Immunofluorescence Microscopy. In Methods in Cell Biology. Caenorhabditis elegans: Modern Biological Analysis of an 162 Organism. Vol . 48. H.F.a.S. Epstein, D. C , editor. Academic Press, Inc., San Diego. 365-94. Morrow, D.M.T., D. A. , Shiloh, Y. , Collins, F.S., and Heiter, P. 1995. TEL1, an S. cerevisiae Homolog of the Human Gene Mutated in Ataxia Telangiectasia, Is Functionally Related to the Yeast Checkpoint Gene MEC1. Cell. 82:831-40. Moulder, G., and Barstead, R. 1998. Reverse Genetics: Isolating Deletions in PCR Screens of Mutagenized Populations. http://snmc01.omrf.uokhsc.edu/revgen/RevGen.html. Mukherjee, S., Ghosh, R. N . , and Maxfield, F. R. 1997. Endocytosis. Physiol. Rev. 77:759-803. Myers, C D . , Goh, P. -Y . , Allen, T. S., Bucher, E. A. , and Bogaert, T. 1996. Developmental Genetic Analysis of Troponin T Mutations in Striated and Nonstriated Muscle Cells of Caeorhabditis elegans. J. Cell Biol. 132:1061-77. Na, S., Hincapie, M . , McCusker, J. H. , and Haber, J. E. 1995. MOP2 (SLA2) Affects the Abundance of the Plasma membrane H+-ATPase of Saccharomyces cerevisiae. PNAS-.6818-23. Nasir, J., Floresco, S. B., O'Kusky. J. R., Diewert, V . M . , Richman, J. M . , Zeisler, J., Borowski, A. , Marth, J. D., Phillips, A . G., and Hayden, M . R. 1995. Targeted Disruption of the Huntington's Disease Gene Results in Embryonic Lethality and Behavioural and Morphological Changes in Heterozygotes. Cell. 81:811-23. Niedenthal, R., Riles, L. , Guldener, U . , Klein, S., Johnston, M . , and Hegemann, J. H . 1999. Systematic Analysis of S. cerevisiae Chromosome VIII Genes. Yeast. 15:1775-96. 163 Nonet, M.L . , Grundahl, K. , Meyer, B. J., and Rand, J. B. 1993. Synaptic Function is Impaired but not Eliminated in C. elegans Mutants Lacking Synaptotagmin. Cell. 73:1291-1305. Ona, V.O., L i , M . , Vonsattel, J. P. G., Andrews, L. J., Khan, S. Q., Chung, W. M . , Frey, A . S., Menson, A . S., L i , X . , -J., Stieg, P. E. et al. 1999. Inhibition of Caspase-1 Slows Disease Progression in a Mouse Model of Huntington's Disease. Nature. 399:263-7. Padgett, R.W., St. Johnston, R. D., and Gelbart, W. M . 1987. A Transcript from a Drosophila Pattern Gene Predicts'a Protein Homologous to the Transforming Growth Factor-beta Family. Nature. 325:81-4. Paulson, H.L., Bonini, N . M . , and Roth, K. A . 2000. Polyglutamine Disease and Neuronal Cell Death. PNAS. 97:12957-8. Plasterk, R.H., Izsvak, Z., Ivies, Z. 1999. Resident aliens: the Tel/mariner superfamily of transposable elements. Trends Genet. 15:326-32. Ploger, R., Zhang, J., Bassett, D., Reeves, R., Hieter, P., Boguski, M . , and Spencer, F. 2000. XREFdb: Cross-referencing the Genetics and Genes of Mammals and Model Organisms. Nuc. Acid. Res. 28:120-2. Porter, J.A., Young, K . E., and Beachy, P. A . 1996. Cholesterol Modification of Hedgehog Signaling Proteins in Animal Development. Science. 274:255-9. Prado, A . C , I., and Ferrus, A. 1999. The Haplolethal Region at the 16F Gene Cluster of Drosophila melanogaster: Structure and Function. Genetics. 151:163-75. Qualmann, B., Kessels, M . M . , and Kelly, R. B. 2000. Molecular Links between Endocytosis and the Actin Cytoskeleton. The Journal of Cell Biology. 150:111-6. 164 Raths, S., Rohrer, J., Crausaz, F., and Riezman, H. Raths, S., Rohrer, J., Crausaz, F., and Riezman, H. 1993. end3 and end4: Two Mutants Defective in Receptor-mediated and Fluid-phase Endocytosis in Saccharomyces cerevisiae. J. Cell Biol. 120:55- 65. Reddy, P.S., and Housman, D. E. 1997. The Complex Pathology of Trinucleotide Repeats. Current Opinion in Cell Biology. 9:364-72. Riddle, D.L., Blumenthal, T., Meyer, B. J., and Priess, J. R. 1997. C. elegans II. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N Y . Rong, Y.S. , and Golic K. G. 2000. Gene Targeting by Homologous Recombination in Drosophila. Science. 288:2013-8. Ross, C. 1997. Intranuclear Neuronal inclusions: a Common Pathogenic Mechanism for Glutamine-Repeat Neurodegenerative Disease? Neuron. 19:1147-50. Rothman, J.E., and Wieland, F. T. 1996. Protein Sorting by Transport Vesicles. Science. 272:227-34. Rushforth, A . M . , Saari, B. , and Anderson, P. 1993. Site-selected Insertion of the Transposon Tel into a Caenorhabditis elegans Myosin Light Chain Gene. Mol. Cell Biol. 13:902-10. Ruvkun, G.a.H., O. 1998. The Taxonomy of Developmental Control in Caenorhabditis elegans. Science. 282:2033-41. Satyal, S.H., Schmidt, E., Kitagawa, K., Sondheimer, N . , Lindquist, S., Kramer, J. M . , and Morimoto, R. I. 2000. Polyglutamine Aggregates Alter Protein Folding Hoeostasis in Caenorhabditis elegans. PNAS. 97:5750-55. 165 Saudou, F., Finkbeiner, S., Devys, D., and Greenberg, M . 1998. Huntingtin Acts in the Nucleus to Induce Apoptosis but Death does not Correlate with the Formation of Intranuclear Inclusions. Cell. 95:55-66. Schekman, R., and Orci, L . 1996. Coat Proteins and Vesicle Budding. Science. 271:1526- 33. Seki, N . , Muramatsu, M . , Sugano, S., Suzuki, Y. , Nakagawara, A. , Ohhira, M . , Hayashi, A. , Hori, T., and Saito, T. 1998. Cloning, Expression Analysis, and Chromosomal Localization of HIP1R, an isolog of Huntingtin Interacting Protein (HIP1). J. Hum. Gen. 43:268-71. Seshagiri, S., Chang, W. T., and Miller, L. K. 1998. Mutational Analysis of Caenorhabditis elegans CED-4. FEBS Lett 22:71-4 Sharrock, W.J. 1983. Yolk Proteins of C. elegans. Dev. Biol. 96:182-8. Singh, R.N., and Sulston, J. E. 1978. Some Observations on Molting in C. elegans. Nemtologica. 24:63-71. Singson, A. , Hi l l K. L. , and L'Hernault S. W. 1999. Sperm Competition in the Absence of Fertilization in Caenorhabditis elegans. Genetics. 152:201-8. Sisodia, S.S. 1998. Nuclear Inclusions in Glutamine Repeat Disorders: Are They Pernicious, Coincidental, or Beneficial? Cell. 95:1-4. Sternberg, P., and Han, M . 1998. Genetics of RAS Signaling in C. elegans. Trends in Genetics. 14:466-72. Stringham, E.G., Dixon, D. K. , Jones, D., and Candido, E. P. M . 1992. Temporal and Spatial Expression Patterns of the Small Heat Shock (hspl6) Genes in Transgenic Caenorhabditis elegans. Molecular Biology of the Cell. 3:221-33. 166 Strome, S. 1986. Fluorescence Visualization of the Distribution of Microfilaments in Gonads and Early Embryos of the Nematode Caenorhabditis elegans. J. Cell Biol. 103:2241-52. Sulston, J. E. Schierenberg, J. G., White, J. G., and Thomson, J.N. 1983. The Embryonic Cell Lineage of the Nematode Caenorhabdits elegans. Dev. Biol. 100:64-119. Sulston, J., Du, Z., Thomas, K. , Wilson, R., Hillier, L . , Staden, R., Halloran, N . , Green, P., Thierry-Mieg, J., Qiu and et al. 1992. The C. elegans Genome Sequencing Project: A Beginning . Nature. 356:37-41. Sulston, J.E., and Horvitz, H. R. 1977. Post-embryonic Cell Lineages of the Nematode Caenorhabditis elegans. Dev. Biol. 56:110-56. Tavernarakis, N.W., S. L. , Dorovkov, M . , Ryazanov, A. and Driscoll, M . 2000. Heritable and Inducible Genetic Interference by Double-Stranded R N A Encoded by Transgenes. Nature Genetics. 24:180-3. Tebar, F., Sorkin, T., Sorkin, A. , Ericsson, M . , and Kirchausen, T. 1996. Epsl5 is a Component of Clathrin-coated Pits and Vesicles and is Located at the Rim of Coated Pits. J. Biol. Chem. 271:28727-30. Thompson, J.D., Higgins, D.G. and Gibson, T.J. 1994. C L U S T A L W: Improving the Sensitivity of Progressive Multiple Sequence Alignment through Sequence Weighting, Positions-specific Gap Penalties and Weight Matrix Choice. Nuc. Ac. Res. 22:4673-80. Timmons, L. , Fire A. 1998. Specific Interference by Ingested dsRNA. Nature. 395:854. Trent, C , Tsung, N . , and Horvitz, H. R. 1983. Egg-laying Defective Mutants of the Nematode Caenorhabditis elegans. Genetics. 104:619-47. 167 Trifaro, J.-M., and Vitale, M . L . 1993. Cytoskeleton Dynamics During Neurotransmitter Release. Trends Neurosci. 16:466-72. Velier, J., Kim, M . , Schwarz, C.„ Kim, T. W., Sapp, E., Chase, K. , Aronin, N . , and DiFiglia, M . 1998. Wild-Type and Mutant Huntingtins Function in Vesicle Trafficking in the Secretory and Endocytic Pathways. Exp. Neurol. 152:34-40. Wanker, E.E., Rovira, C , Scherzinger, E., Hasenbank, R., Walter, S., Tait, D., Colicelli, J., and Lehrach, H . 1997. HIP1: A Huntingtin Interacting Protein Isolated by the Yeast Two-Hybrid System. Hum. Mol. Genet. 6:487-95. Ward, S., and Carrel J. S. 1979. Fertilization and Sperm Competition in the Nematode C. elegans. Dev. Biol. 73:304-21. Warrick, J .M., Paulson, H . L. , Gray-Board, G. L. , Bui, Q. T., Fischbeck, K . H. , Pittman, R. N . , and Bonini, N . M . 1998. Expanded Polyglutamine Protein Forms Nuclear Inclusions and Causes Neural Degeneration in Drosophila. Cell. 93:939-49. Warrick, J .M., Chan, H . Y . E., Gray-Board, G. L. , Chai, Y. , Paulson, H . L. , and Bonini, N . M . 1999. Suppression of Polyglutamin-mediated Neurodegeneration in Drosophila by the Molecular Chaperone HSP70. Nat. Genet. 23:425-8. Weinstein, D . C , Ruiz, I., Altaba, A. , Chen, W. S., Hoodless, P., Prezioso, V . R , Jessell, T. M . , and Darnell, J. E. Jr. 1994. The Winged-helix Transcription Factor HNF-3 Beta is Required for Notochord Development in the Mouse Embryo. Cell. 78:575-88. Wendland, B. , Emr, S. D., and Reizman, H. 1998. Protein Traffic in the Yeast Endocytic and Vacuolar Protein Sorting Pathways. Curr. Opin. Cell Biol. 10:513-22. 168 White, J. G., Southgate, E., Thomson, J. N . , and Brenner, S. 1986. The Structure of the Nervous System of the Nematode C. elegans. Phil. Trans. R. Soc. Lond. B. 314:1- 340. Wilson, R., Ainscough, R., Anderson, K., Baynes, C., Berks, M . , Bonfield, J., Burton, J., Connel, M . , Copsey, T., Cooper, J. and et al. 1994. 2.2 Mb of Contiguous Nucleotide Sequence from Chromosome III of C. elegans. Nature. 368:32-8. Winzeler, E.A., Shoemaker, D. D., Astromonoff, A. , Liang, EL, Anderson, K. , Andre, B. , Bangham, R., Benito, R., Boeke, J. D., Bussey, H. and et al. 1999. Functional Characterization of the S. cerevisiae Genome by Gene Deletion and Parallel Analysis. Science. 285:901-6. Wolf, N . , Hirsh, D., and Mcintosh, J. R. 1978. Spermatogenesis in Males of the Free- living Nematode, Caenorhabditis elegans. J. Ultrastruct. Res. 63:155-69. Wood, J.D., MacMillan, J. C , Harper, P. S., Lowenstein, P. R., and Jones, A . L . 1996. Partial Characterisation of Murine Huntingtin and Apparent Variations in the Subcellular Localisation of Huntingtin in Human, Mouse and Rat Brain. Hum. Mol. Genet. 5:481-7. Wood, W.B. 1988. The Nematode Caenorhabditis elegans. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N Y . Yandell, M.D. , Edgar, L . G., and Wood, W. B. 1994. Trimethylpsoralen Induces Small Deletion Mutations in Caenorhabditis elegans. PNAS. 91:1381-85. Yang, S., Cope, M . J. T. V. , and Drubin, D. G. 1999. Sla2p Is Associated with the Yeast Cortical Actin Cytoskeleton via Redundant Localization Signals. Mol. Biol. Cell. 10:2265-83. 169 Zuk, D., Belk, J. P., and Jacobson, A . 1999. Temperature-Sensitive Mutations in the Saccharomyces cerevisiae MRT4, GRC5, SLA2 and 77757 Genes Result in Defects in mRNA Turnover. Genetics. 153:35-47. Zwaal, R.R., Broeks, A. , van Muers, J., Groenen, J. T. M . , and Platerk, R. H . A . 1993. Target-selected Gene Inactivation in Caenorhabditis elegans by Using a Frozen . Transposon Insertion Bank. P.N.A.S. 90:7431-35. 170


Citation Scheme:


Usage Statistics

Country Views Downloads
China 24 7
United States 3 1
Canada 2 0
City Views Downloads
Beijing 24 0
Redmond 2 0
Vancouver 2 0
Washington 1 0

{[{ mDataHeader[type] }]} {[{ month[type] }]} {[{ tData[type] }]}


Share to:


Related Items