Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Genetic studies of multifactorial neural tube closure defects in mice Wu, Mona Kay 2001

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2001-0553.pdf [ 6.34MB ]
Metadata
JSON: 831-1.0090253.json
JSON-LD: 831-1.0090253-ld.json
RDF/XML (Pretty): 831-1.0090253-rdf.xml
RDF/JSON: 831-1.0090253-rdf.json
Turtle: 831-1.0090253-turtle.txt
N-Triples: 831-1.0090253-rdf-ntriples.txt
Original Record: 831-1.0090253-source.json
Full Text
831-1.0090253-fulltext.txt
Citation
831-1.0090253.ris

Full Text

GENETIC STUDIES OF MULTIFACTORIAL NEURAL TUBE CLOSURE DEFECTS IN MICE  by  MONA KAY WU B.Sc, The University of Victoria, 1997  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF T H E REQUIREMENTS FOR THE DEGREE OF  MASTER OF SCIENCE  in  THE F A C U L T Y OF GRADUATE STUDIES  (Faculty of Medicine; Department of Medical Genetics)  We accept this thesis as conforming to the required standard  T H E UNIVERSITY OF BRITISH COLUMBIA OCTOBER, 2001 ©Mona Kay Wu, 2001  In  presenting  degree at the  this  thesis  in  partial  fulfilment  of  the  requirements  University  of  British  Columbia, I agree that the  freely available for reference and study. I further agree that copying  of  department  this thesis or  by  his  for scholarly or  her  purposes may be  representatives.  It  is  for  an  Library shall make it  permission for extensive  granted  by the  understood  that  publication of this thesis for financial gain shall not be allowed without permission.  Department of  tH|£-PlCflL Q^BTlCS  The University of British Columbia Vancouver, Canada Date  DE-6 (2/88)  Ofjf.  (X^OOl  advanced  head of  my  copying  or  my  written  ABSTRACT  Anencephaly and spina bifida aperta, defects in neural tube closure, are among the most common serious human birth defects. Neural tube defects (NTD) that occur in the absence of other abnormalities ("nonsyndromic") are generally regarded to be multifactorial threshold traits. Mouse models for nonsyndromic multifactorial anencephaly and spina bifida aperta include the SELH/Bc and "CT" strains. SELH/Bc has 10-30% risk of exencephaly, the equivalent of human anencephaly; the "CT strain" has -3% risk of exencephaly, 10% of spina bifida aperta, and 50% of flexed tail. For each of these models, chromosomal regions containing "risk" genes have been identified. To investigate possible interactions or interchangeability between the genetic risk factors for NTD in the SELH/Bc and "CT strain" we have crossed SELH/Bc with "CT strain" mice and generated a segregating F generation. Scoring for 2  exencephaly, spina bifida, and flexed tails in E14 embryos, results show 0% NTD (0/115) in the F] and 4.6% NTD (35/758) in the F generation: 24 exencephaly, 4 spina bifida (2 with flexed tails), and 7 flexed tails (1 with 2  exencephaly). Genotypes for SSLPs marking each "risk region" suggest an association of SELH/Bc risk loci on Chr 13 and 11 with exencephaly and a trend toward an association of a "CT strain" risk locus on Chr 4 with spina bifida and flexed tail. Although SELH/Bc and the "CT strain" are both multifactorial systems of NTD, they do not interact to increase the overall risk for NTD in an F . The "CT strain" risk factor at Chr 4 may add to the risk of SELH/Bc or 2  be interchangeable with one of the SELH/Bc factors at Chr 11 or 13 for risk of exencephaly in an F . However, a 2  hypothesis of independent SELH/Bc and "CT strain" causes for exencephaly in the F is not rejected. There was no 2  evidence of interaction between the "CT strain" factors and SELH/Bc factors for spina bifida risk. There may some contribution from the SELH/Bc risk region at Chr 11 to the risk of flexed tail.  Inositol supplementation has previously been shown to reduce the frequency of spina bifida aperta in the "CT strain". Therefore, in order to investigate a possible similarity of environmental component of risk of NTD between SELH/Bc and "CT strain", the effect of maternal administration of myo-inositol in drinking water on frequency of exencephaly in the SELH/Bc strain was assessed. There was no evidence for a protective effect of myo- inositol supplementation.  Concurrently, a small backcross study was done between the "CT strain" and normal BXA-7/Pgn strain, backcrossed to the "CT strain", to find out the frequency of spina bifida and exencephaly in BCi embryos. 19% of BC! individuals were affected (1.0% exencephaly with flexed tail, 1.0% spina bifida aperta with flexed tail, and 17% ii  with flexed tail alone). As the "CT strain" displays 40% affected, the B Q data is consistent with the cause of NTD in the "CT strain" being a single autosomal recessive gene.  Previously the Mlp gene ((MARCKS (myristoylated alanine-rich C-kinase substrate-like protein)) had been mapped to mouse Chr 4 near the ct gene. Mlp-mx\\ embryos have high risk of exencephaly, spina bifida and/or flexed tail. This study mapped Mlp relative to "Mit" SSLP Chr 4 markers and confirmed that Mlp is likely too proximal to be a candidate gene for ct.  Liability regions for exencephaly in the SELH/Bc strain on Chr 5 (near D5Mitl68)  and Chr 13 (near D13MU13)  were refined using DNA from a previous study of exencephalic F s (SELH/Bc X normal LM/Bc). An independent 2  sample of exencephalic F s (SELH/Bc X "CT strain") was found to support SELH/Bc risk genes on Chr 13 (near 2  D13MH13) and on Chr 11 (near DI lMit253).  Analysis of the relationship between percentages of exencephalic F  with sum of SELH/Bc alleles across risk loci supports the combinatorial nature of SELH/Bc risk for exencephaly.  iii  2  TABLE OF CONTENTS  Abstract Table of Contents List of Tables List of Figures List of Appendices List of Abbreviations Acknowledgments .  CHAPTER I: I. II. III. IV. V. VI. VII.  1  INTRODUCTION  Review of developmental cause of neural tube defects Mouse models of nonsyndromic exencephaly and spina bifida aperta Prevention of NTDs in humans and the folate pathway SELH/Bc genetics and embryology "CT strain" genetics and embryology The etiological relationship between anencephaly and spina bifida aperta Rationale and approach to my studies  CHAPTER II: I.  ii iv vi vii ix x xi  GENERAL MATERIALS AND METHODS  2 5 6 17 19 26 27  29  Mouse stocks and maintenance a) Mouse stocks SELH/Bc and SELHA/Bc "CT strain" LM/Bc BXA-7/Pgn b) Mouse maintenance Technical Methods : a) Observation of E14 embryos and definition of exencephaly, spina bifida aperta, and flexed tail phenotypes a) DNA extraction b) Polymerase Chain Reaction Amplification of Simple Sequence Length Polymorphism c) Visualization of PCR products d) Sources of PCR primers for SSLP markers and source of information about map locations of SSLP markers  32  CHAPTER III: EFFECT OF MATERNAL ADMINISTRATION OF 200 mg/1 MYO-INOSITOL IN DRINKING WATER ON FREQUENCY OF EXENCEPHALY IN THE SELH/Bc STRAIN  33  I. II. III. IV.  33 35 36 37  II.  Introduction Materials and Methods Results Discussion  .  '.  CHAPTER IV: FREQUENCY OF EXENCEPHALY, SPINA BIFIDA APERTA, AND FLEXED TAIL AND SEGREGATION OF SSLP ALLELES AT LIABILITY REGIONS IN SELH/Bc X "CT STRAIN" FI AND F2 POPULATIONS  iv  29 29 29 29 29 29 29 30 30 30 31 32  40  I. II. III. IV.  Introduction Materials and Methods Results Discussion  CHAPTER V:  I. II. III. IV.  40 43 47 55  FREQUENCY OF EXENCEPHALY, SPINA BIFIDA APERTA, AND FLEXED TAIL IN A FIRST BACKCROSS OF (NORMAL BXA-7/Pgn X "CT STRAIN") X "CT STRAIN"  Introduction Materials and Methods Results Discussion  70 70 70 70 71  CHAPTER VI: MAPPING MLP RELATIVE TO WELL-MAPPED SSLP LOCI AND DETERMINATION OF PLAUSIBILITY OF MLP AS A CANDIDATE GENE FOR ct ON CHR 4, USING INDIVIDUAL F2 EMBRYOS FROM THE SELH/Bc X "CT STRAIN" CROSS  73  I. II. III. IV.  73 75 77 77  Introduction Materials and Methods Results Discussion  CHAPTER VII: REFINING THE LIABILITY REGIONS FOR EXENCEPHALY IN SELH/Bc ON CHROMOSOMES 5,11, AND 13 USING EXENCEPHALIC F2 EMBRYO DNA FROM A PREVIOUS STUDY (GUNN, 1996)  83  I. II. III. IV.  83 84 87 90  Introduction Materials and Methods Results Discussion  CHAPTER VIII: REFINING THE SELH/BC EXENCEPHALY RISK REGIONS ON CHR 13, 5, AND 11 USING EXENCEPHALIC F2 EMBRYOS FROM SELH/Bc X "CT STRAIN" I. II. III. IV.  Introduction Materials and Methods Results Discussion  94 94 94 96 100  CHAPTER IX: GENERAL DISCUSSION AND CONCLUSION  103  Electronic Sources  107  Literature Cited  108  Appendices  11 5  v  LIST OF TABLES Table 1.1. Mouse mutants with isolated exencephaly that survive until birth  8  Table 1.2. Mouse strains with isolated exencephaly  11  Table 1.3. Mouse models of isolated spina bifida aperta  12  Table 1.4. Mouse models of isolated exencephaly with spina bifida aperta  13  Table 3.1. Frequency of exencephaly in E14 SELH/Bc embryos with or without myo-inositol supplementation (200 mg/I in drinking water) 37 Table 4.1. Informative SSLP markers used in the SELH/Bc X "CT strain" NTD F including PCR condition, and estimated product sizes for each strain 46 2  Table 4.2. Estimated SMC PCR product size for female and male mice showing PCR conditions  46  Table 4.3. NTD in E14 F progeny of each "CT strain" sire  50  2  Table 4.4. Number of E14 F, and F embryos with exencephaly, flexed tail, and spina bifida aperta, including number of moles 50 2  Table 4.5. Observed ratio of CC:CS:SS genotypes and % analysis of goodness of fit to 1:2:1 ratio of genotypes in three complete pooled SELH/Bc X "CT strain" E14 F litters at SSLP markers that showed deviation from random segregation in F embryos with NTD 51 2  2  2  Table 4.6. Observed ratio of females: males and % analysis of goodness of fit to 1:1 ratio of females: males in two pooled SELH/Bc X "CT strain" F litters 51 2  2  Table 5.1. Frequency of exencephaly, spina bifida aperta, and flexed tail in afirstbackcross of (BXA-7/Pgn X "CT strain") F, females X "CT strain" males 72 Table 6.1. SSLP markers used for the mapping of Mlp in three entire SELH/Bc X "CT strain" F litters including PCR conditions and estimated product sizes for SELH/Bc and "CT strain" 2  76  Table 6.2. Observed ratio of CC:CS:SS genotypes and x analysis of goodness offitto 1:2:1 ratio of genotypes at D4MU279, Mlp, D4MU65, D4MU232, and D4MU33 in three pooled litters of SELH/Bc X "CT strain" F embryos 80 2  2  Table 7.1. "High-risk" and "low-risk" SELH/Bc X LM/Bc F sire identification numbers  86  2  Table 7. 2 SSLP markers on the X chromosome, typed to complete the genome screen of SELH/Bc X LM/Bc F "high-risk" and "low-risk" sires (Gunn, 1996), including PCR condition, and estimated allele sizes for SELH/Bc and LM/Bc 86 2  Table 7. 3. SSLP markers on Chrs 5,11, and 13, typed in the 31 exencephalic SELH/Bc X LM/Bc F embryos (Gunn, 1996), including PCR conditions, and estimated allele sizes for SELH/Bc and LM/Bc 86 2  Table 8.1. SSLP markers typed in the exencephalic group of SELH/Bc X "CT strain" F embryos 2  vi  95  LIST OF FIGURES Figure 1.1. Neural tube closure  7  Figure 1. 2. Folate metabolism showing pyrimidine synthesis, purine synthesis, and methylation of DNA, proteins, and lipids  16  Figure 1. 3. Dissemination of the "CT strain"  21  Figure 3.1. Proposed model of corrective action of inositol in the defective chain of events leading to spina bifida aperta and/or flexed tail in the "CT strain"  34  Figure 4.1. Genetic liability regions for NTD in the SELH/Bc strain and the "CT strain"  41  Figure 4. 2. Representative NTD seen in the SELH/Bc X "CT strain" E13 F embryos 48 Figure 4. 3. Drawings showing position and size of caudal lesion in SELH/Bc X "CT strain" E14 F embryos with spina bifida aperta 49 Figure 4. 4. Genotypes of SELH/Bc X "CT strain" F embryos with exencephaly at SELH/Bc liability regions and "CT strain" liability regions 52 2  2  2  Figure 4. 5. Genotypes of SELH/Bc X "CT strain" F embryos with spina bifida aperta or flexed tail at SELH/Bc liability regions and "CT strain" liability regions 2  53  Figure 4. 6. Models for independence of SELH/Bc and "CT strain" factors among exencephalic SELH/Bc X "CT strain" F 59 2  Figure 4. 7. Models for substitution of a SELH/Bc and a "CT strain" factor among exencephalic SELH/Bc X "CT strain" F 60 2  Figure 4. 8. Model for compounding SELH/Bc and "CT strain" factors among exencephalic SELH/Bc X "CT strain" F 62 2  Figure 4. 9. Diagram of a proposed cause of spina bifida aperta and flexed tail in the SELH/Bc X "CT strain" F 66 2  Figure 6. 1. Genotypes of three pooled litters of SELH/Bc X "CT strain" F showing order and relative positions of Chr 4 SSLP markers and Mlp  78  Figure 6. 2. Genotypes of SELH/Bc X "CT strain" F with spina bifida aperta and flexed tail at SSLP markers on Chr 4  79  Figure 7.1. Genotypes for T. Gunn's SELH/Bc X LM/Bc "high-risk" and "low-risk" F sires on the X chromosome  88  2  2  2  Figure 7. 2. Genotypes for T. Gunn's exencephalic SELH/Bc X LM/Bc F at SSLP markers on Chrs 5,11, and 13 89 2  Figure 7. 3. Percentage of exencephalic SELH/Bc X LM/Bc F with 0,1,2, 3, or 4 SELH/Bc alleles at D5MU168 and D13Mitl3 2  91  Figure 8.1. Genotypes for exencephalic SELH/Bc X "CT strain" F embryos at SSLP markers on Chrs 5,11, and 13 98 2  Vll  Figure 8. 2. Percentage of exencephalic SELH/Bc X LM/Bc F and exencephalic SELH/Bc X "CT strain" F with 0,1,2,3, or 4 SELH/Bc alleles across three markers linked to the proposed SELH/Bc risk regions at D11MU2S3 and D13MU13 99 2  viii  2  LIST OF APPENDICES Appendix A. Data for frequency of exencephaly in E14 offspring of mjo-inositol supplemented and unsupplemented SELH/Bc dams  115  Appendix B. SSLP markers screened in the SELH/Bc X "CT strain" cross and genotypes of two or three pooled SELH/Bc "CT strain" F2 litters  116  Appendix C. Data for frequency of NTD in BC, individuals of (BXA-7/Pgn X "CT strain") X "CT strain". 123 Appendix D. SSLP markers screened in SELH/Bc X LM/Bc cross  ix  124  LIST OF ABBREVIATIONS bp BC Chr cM CT DNA EX MGD MGI Mit NAPS NTD PCR SBA SMC SSLP TF  base pair Backcross Chromosome centimorgan Curly Tail Deoxyribonucleic Acid Exencephaly Mouse Genome Database Mouse Genome Informatics Massachusetts Institute of Technology Nucleic Acid Protein Service Unit Neural Tube Defect Polymerase Chain Reaction Spina Bifida Aperta Selected Mouse cDNA on X Chromosome Simple Sequence Length Polymorphism Flexed Tail  ACKNOWLEDGEMENTS  My sincere thanks to my supervisors Drs. Diana Juriloff and Muriel Harris for accepting me as a graduate student and for providing me guidance and motivation in the course of my studies. My gratitude extends to the many teachers I have had who have encouraged my academic pursuits. I thank my fellow graduate students and coworkers for their expertise and support. Thanks to my family and friends for keeping me sane and for pretending to understand what I do.  I dedicate this work to the memory of my father who inspired me to consider study in the medical sciences in the first place.  xi  CHAPTER I: Introduction  The neural tube is the embryonic structure in mammals that gives rise to the brain and spinal cord. Malformation of the neural tube leads to neural tube defects (NTDs). NTDs are among the most common human birth defects worldwide with an incidence of 1:500 (van der Put et al, 2001). The most common types of NTD are anencephaly and spina bifida aperta (Botto et al, 1999). Anencephaly at birth is characterized by absence of the brain and cranial vault, with the cerebral hemispheres completely missing or greatly reduced in size (On-line Medical Dictionary, 1997). A lesion of the lower back where the vertebrae and overlying tissues are open and the spinal cord tissue is exposed to the external surface characterizes spina bifida aperta. As stated by DeSesso et al, 1999: "The incidence of anencephaly generally ranges from 2-6/10 000 (live and still) among industrialized nations, although higher rates are seen in Japan, Northern Ireland, and Mexico. The incidence of spina bifida aperta (in the absence of anencephaly) ranges from 3-6/10 000, although much higher rates are seen in Mexico and Northern Ireland. Variations in regional and national incidences of NTDs are likely caused by differences in genetic propensity, nutrition and health status of women, frequency of prenatal diagnosis leading to elective abortion, and possible exposure to NTD-inducing toxicants."  NTDs can appear as a part of syndrome (<20% of cases) or in isolation (>80% of cases) (Hall et al, 1988). Most human cases of isolated anencephaly or isolated spina bifida aperta appear to be genetically complex (Campbell et al., 1986; Morrison et al., 1998) and possibly genetically heterogeneous (different gene loci involved in different families) (Hall et al., 1988). As stated by Hall et al. (1988), it is valuable to classify cases of NTD that are not due to recognized chromosomal, Mendelian, or environmental causes into groups with similar underlying etiological or pathogenic factors and/or recurrence risk. To study the genetics of NTD, one strategy is to focus on cases of isolated NTD (e.g. where the only obvious primary embryonic defect is failure of the neural tube to complete closure). Isolated cases of NTD are also known as "nonsyndromic" NTDs and are generally considered to be multifactorial threshold traits (Carter, 1974). The multifactorial threshold model assumes 1) the risk of developing NTD is determined by an underlying, continuously distributed attribute which is referred to as liability; 2) liability is determined by the equal, additive, and relatively small effects of several but not an unlimited number of genetic and environmental factors and is normally distributed; and 3) the observed dichotomy in phenotypic expression is determined by a threshold beyond which individuals are affected (Falconer, 1965). There is marked geographic and temporal variability in the rate of occurrence of these conditions as well as associations with race, ethnic 1  background, and socioeconomic status (Botto et ai, 1999; Elwood and Elwood, 1980; Lary and Edmonds, 1996). Some of these findings change over time (Lary and Edmonds, 1996) or as a result of migration (Elwood and Elwood, 1980) suggesting that there are interactions between ethnic background and environmental factors.  To date, no major genes for risk of nonsyndromic human NTD have been identified (Harris, 2001). Part of the difficulty in genetic studies of human NTD is the scarcity of families with several affected members due to increased risk of spontaneous abortion, high perinatal lethality, and elective termination of affected fetuses (reviewed in Mitchell, 1997). In addition, anencephalics die at birth and the reproductive fitness of individuals with spina bifida aperta is low. The genes causing liability to human NTD are also not accessible by the methods used for simple Mendelian disorders, and systematic methods for identifying genes involved in human complex traits are still being developed (Juriloff and Harris, 1998).  One approach for looking at the genetics of human NTDs involves focusing on genes involved in normal differentiation and development of the embryonic neural tube. A second way looks for association between NTD and the genes of the folate pathway. In addition, there exist many mouse models of NTD that involve null mutations of genes that are neither involved in development of the embryonic neural tube nor folate metabolism.  I.  Review of developmental cause of neural tube defects  In humans, the development and closure of the neural tube is usually completed within 28 days of conception (Kalousek et al, 1990). Since human neural tube formation occurs at a time when the embryo is inaccessible for study (the study by Nakatsu et al., 2000 being a rare exception), most of the current knowledge comes from animal models. Much of this work has come from mouse models and the process of neural tube formation seen here is thought to be analogous in humans.  Neural tube formation can be divided, on morphological grounds, into primary and secondary neurulation.  Primary neurulation Primary neurulation relates to the transformation of the flat neural plate into a cylindrical neural tube. In mouse embryos, the neural tube forms during days 8-10 of gestation (E8-10). The first process to occur is formation of the 2  neural plate. The neural plate differentiates via induction from the underlying notochordal plate and prechordal mesoderm from the midline of the ectoderm on the dorsal side of the embryo. The neural plate continues to grow and change shape due to increase in number of epithelial cells and increase in cell height (van der Put et al., 2001). The neural plate then begins to bend upwards along its rostro-caudal axis at its lateral edges- the neural folds (Figure 1.1 A). At this point the neural folds are comprised of neuroepithelium (neuroectoderm) and underlying mesenchyme. The midline at which the neural plate folds is also known as the medial hingepoint. Factors that either generate or ease the elevation of the neural folds include: 1) formation of the medial hingepoint; 2) longitudinal extension and transversal narrowing of the neural plate (convergent extension); 3) change in cell shape; and 4) expansion of mesoderm (van der Put et al., 2001). Formation of the medial hingepoint is thought to be due to a change in the shape of cells at this location in the neural plate in response to notochord signaling (Copp et ai, 1990). The medial neural plate cells shorten and become wedge-shaped due to a shortening of their apical sides. Apical shortening may be due to basal expansion of neuroectodermal cells, which is due to the basal-positioning of their nuclei that resultsfromtheir withdrawalfromthe cell cycle (Schoenwolf and Franks, 1984). Apical shortening of cells was thought to be due to actin myosin cytoskeleton contraction (Hildebrand and Soriano, 1999; Schoenwolf and Franks, 1984) but this does not appear to be true of cells at the median hingepoint (Schoenwolf et al., 1988). In the cranial region, lateral hingepoints in the neural folds also develop prior to the apposition of the tips of the neural folds and their eventual fusion and it is in the lateral hingepoints that actin filament contraction is thought cause apical shortening of cells (Schoenwolf et al., 1988). Spinal neural tube closure does not require microfilament function (Ybot-Gonzalez and Copp, 1999) and does not have prominent dorsolateral hingepoints.  The neural folds then bend toward each other, meet at their tips, and fuse to form a tube. Closure of the neural tube is initiated at multiple sites along the rostro-caudal axis in mice (MacDonald, et al., 1989) and there is evidence for multi-site closure in humans as well (Golden and Chernoff, 1995; Nakatsu et al., 2000; Van Allen et al., 1993). Trunk neural fold elevation occurs first (Figure 1. IB Zone D), at the level of the third and fourth somites, and proceeds in a zipper-like fashion from Closure 1 both rostrally (a short distance) and caudally to the base of the tail (a long distance), requiring about a day and a half for completion in mouse. The unfiised portions at the rostral and caudal ends of the developing neural tube are known as the anterior and posterior neuropores respectively. At the time when about one-third the length of the trunk folds has elevated, regions that will form the forebrain to rostral hindbrain begin to elevate and commence fusion bidirectionallyfromClosure 2 (Figure LIB Zone B). The formation of the optic sulci coincides with elevation of the forebrain region from Closure 3 (Figure LIB Zone A) 3  while the midbrain is only half elevated. Midbrain elevation is completed before that of the most caudal region of the trunk. In normal mice there are four regions of initial contact during neural tube closure, three of them cranial (Golden and Chernoff, 1993; Macdonald et al., 1989). Fusion at Closure 4 is unique in that the neural folds remain separate and closure occurs by growth of a membrane that eventually covers the rhombencephalon (Geelen and Langman, 1977; Golden and Chernoff, 1993). The last regions of the tube to complete elevation and fuse close on day 9 at the head (15-19 somites) and during early day 10 at the base of the tail (30-34 somites) (Theiler, 1989). The neural tube formed by primary neurulation is sometimes known as the primary neural tube.  Regional differences are evident in the cellular events of initial contact and fusion of the neural folds during neural tube closure. For example, in Zone A, midline contact and fusion of neuroepithelium precedes that of surface ectoderm; in Zone B, initial midline contact and fusion involves both surface ectoderm and neuroepithelium; in Zone C, fusion of surface ectoderm precedes that of neuroepithelium (Geelen and Langman, 1977).  Secondary  neurulation  Formation of the caudal portion of the spinal cord occurs in the tail bud and follows primary neurulation in a process known as secondary neurulation or canalization. The tail bud is formed caudal to the posterior neuropore. The tail bud arises as a continuation of the organizer and is an ectoderm-covered mass of undifferentiated mesenchymal cells which gives rise to various tissues including a neural cord (Lemire et al, 1975). The peripheral cells of the neural cord arrange radially and differentiate from mesenchyme to epithelium. Between the central undifferentiated cells, caveoles develop, coalesce, and enlarge to form a canal (secondary neural tube). The lumen of the secondary neural tube then fuses with the lumen of the primary neural tube (Lemire et al., 1975; Schoenwolf and Franks, 1984). The transition pointfromprimary to secondary neurulation is thought to occur at the level of the future second sacral section in humans (Muller and O'Rahilly, 1987) and the future 2 -4 sacral element in mouse (Copp and Brook, nd  th  1989). Secondary neurulation occurs entirely at the tip of the tail bud in mouse (Copp et al., 1990). A critical event in neural tube formation in the lower spinal region is the transition between primary neurulation and secondary neurulation.  NTDs  4  Most NTDs are the result of a failure of elevation of the neural folds. Since elevation of the lateral edges of the neural plate in primary neurulation initiates at several points along the rostro-caudal axis of the embryo (Golden and Chernoff, 1993; Van Allen et al., 1993)(see Figure LIB), there can be NTDs that resultfromfailure to elevate at any or all portions of the neural plate. The clinical types of NTDs differ depending on the site at which elevation fails and it is thought that variations in the cellular mechanisms of closure at the various sites might underlie the clinical variation (Botto et al., 1999). These various sites of elevation also show variation in sensitivity to teratogenic agents (Copp et al., 1990). Failure of elevation in mouse models leads to split face (failure to elevate in Zone A), exencephaly (failure to elevate in Zone B), rachischisis (failure to elevate in all of Zone D), and spina bifida aperta (failure to elevate in caudal Zone D) (Harris and Juriloff, 1999). NTDs include open lesions such as anencephaly and myelomenigocele, and closed defects such as encephalocele (Copp, 1998). Anencephaly is incompatible with life; children with spina bifida aperta may survive but with multiple handicaps affecting musculoskeletal, gastrointestinal, and urinary systems. Spina bifida occulta, a dorsal gap in the vertebral arches over an intact neural tube, is usually genetically and developmentally unrelated to exencephaly and spina bifida aperta (Harris and Juriloff, 1999).  Mouse mutants show that there are probably different mechanisms specific to each type of NTD, as well as a few mechanisms held in common between particular types of NTD (Harris and Juriloff, 1999). Mutants displaying only exencephaly would have problems with mechanisms of elevation in Zone B only. Those with only spina bifida aperta would show problems of elevation in caudal Zone D. Finally, mutants with both exencephaly and spina bifida aperta display a shared defective mechanism of elevation between Zone B and caudal Zone D.  II.  Mouse models of nonsyndromic exencephaly and spina bifida aperta  Mutations at over 60 single gene loci have led to mouse NTD with most examples causing severe embryonic-lethal syndromes (reviewed in Harris and Juriloff, 1999; Juriloff and Harris, 2000). Some mouse models give insight into the essential steps of neural tube closure. Some probably represent genetic homologues to human NTD genes. For several, there is interaction with maternal nutrition. In addition, certain teratogenic agents affect the liability to NTD in only certain mouse models. The available mouse models for studying NTDs have been reviewed (Harris and Juriloff, 1997; Harris and Juriloff, 1999; Juriloff and Harris, 2000), so I present here only the mouse mutants with isolated exencephaly that survive until birth (Table 1.1), mouse strains with multifactorial isolated exencephaly  5  (Table 1.2), mouse models of isolated spina bifida aperta (Table 1.3), and mouse models with both exencephaly and spina bifida aperta (Table 1.4). It is interesting to note that the number of mouse mutations leading to exencephaly far exceed the number of mouse mutations leading to spina bifida aperta. It is also interesting that there are no mouse strains that have multifactorial isolated spina bifida aperta.  III.  Prevention of NTDs in humans and the folate pathway  Numerous environmental factors have been associated with risk for NTD in humans. These factors include geography, month of conception, epidemic trends, maternal age, birth order, socioeconomic class, maternal illness and drug exposure, and maternal diet (Campbell et al., 1986; Smithells et al., 1983). Considerable attention has been paid to the prevention of NTD via maternal diet supplementation.  A randomized double-blind clinical trial conducted by the Medical Research Council, UK (1991) found that there was an estimated 72% reduction in recurrent NTD among women receiving a 4 mg supplement of folic acid. Another study has shown that multivitamins (including folic acid) produced a preventative effect also on the first occurrence of NTD (Czeizel and Dudas, 1992). A later case control study found that daily periconceptional intake of 0.4 mg of folic acid also reduced the occurrence of NTD by approximately 60% (Werler et al., 1993).  In mammalian tissues, folate functions as a substrate in a series of interconnected metabolic cycles involving thymidylate and purine biosynthesis (adenosine and guanine), methionine synthesis via homocysteine remethylation, serine and glycine interconversion, and the metabolism of histidine and formate (van der Put et al., 2001). Folate is also an indirect methyl donor in many methylation reactions via S-adenosylmethionine and is therefore involved in the regulation of gene expression. A simplified version of folate metabolism is shown in Figure 1.2. Folate is directly or indirectly essential for cell function, division, and differentiation. Folate deficiency perturbs the cell cycle by shutting down DNA synthesis and adenosylmethionine synthesis, which may lead to premature cell death. Since folate cannot be synthesized de novo in eukaryotic cells, it is an essential nutrient that must be obtained from the environment.  6  •B .S IS 5 a  CL  P 1« w5 SP a o o 4= 43 CD  o  so i  u  60^  >  E  o o  .1 G •S * 2 I 43 o ~  CL)  C H  e  *  CH  P 1  -  CS  1  O  ^ >  a  I O  43  E CD S co  TJ  T3  a j w  O  ,0  ffi  *  /—\  I  2 H CJ  "S  Q,  V  c E  '  O  .B  - 1 -3  T3  1  -  a  .a >a | 21 60  P  •  '  CO  HQ  a  ra  60 •  a o  o  CS  H  CO  S 1 E 2 S "S • •g u Q  U  CO 3  4= M 3 O  O  a o o E  <o  4=  fi60  2 c2 — S - 2 cS -2 2 T3 ra 3 a ,cs 2 ncs •cp T 3 B " 3 'a  1  c  SI  CD  Cm  13 1e  a  cs  °  CH  2 ^2  • »  a  CD  co  w  8,-9 u  CO  CO  N  T3  .2  a o .2 oo .2 §  .s e, a  i CD  a  CO  CD  o  ra  a  |  ^< u  . p. -3 «  CD  r-J  CD  CO  a S i i J § 3 2 — CJ o ' 43  1  C a 2  |.s  1 03  43  O  Q  .5 g  cs o -3 5 & CO CO cs 5 60 a c ° 1 1 -a Z3 a w 1 * 60 £ S 3 CD  I  S o e .fi  .E  "w J=  ON  g 2  a.  0\  <a u  B  W  O  X  i  CD CD  3 O  KO  W  so so 6s  >/-) o  CD  3  CN  —i  ON  Q\  0O  CN  C N  —  -5  •O C C T  CT  X  C N  C T  C N  C T  C T  ©  CN  cs  ac OS  s  s  X CD  es 3  CS  ac  E ©  3 3  S  CD  rH  te  •o a.  «•> — •sf CS  <*i  1 B 3  at >•  'E 3  73  CD  CD CH  •u s  N  1>  — CS  CA  ~H  o i  N  s  .. o s OJ a o  -8  CD  OS t^H W o  ^  3  ca  s o  N  2  CH  cn  u .3 3o  *S L.  ^H  2 " CD  s  „  ca UH  co  I-  o «  O  U  8 ca <u CD  is  u <•* M °  0  °^  j_,  CO  tH  cu  ca  N  o s  a CD o  ?« O  o  JS  •4-»  u S o o  3  >^  JS  E  CD  e  CD  OH  o  Sis  o ©  3 2 «2  CD >  o  O  CD  O  3  -O  1 3  CD «  CD  c « .2  pa  S ca r> fc « 2  « ta LH  • • "ca  c S  in od  o o.  W  3  CD  "3  eo  JS  a. cu u  B  OI  •a  o  cx  O  s ca  cn  t.  o  S r* a O Ji cn CD ' C O -o o CD o  3  E  < U  B  a £  o  i>  £0  N  OJ  IA  3  O CD  '53  +o-» u<  CD  CD  "o Q. <  CO  CS  s - 72  O LH  OH  ca o  .& CS  H  CD  UH  OH O  X  CD  ca s PQ cx)  S r\  tH  CD s  O J3°  60  3  C/5  60  fc eg  o. ca  cu O  cs  o  c  ae  fc <32  CD  s o  CD  XI  4>  U  H  3  c  8  O  ^  a  H« CD  t,  u  S S o  CD  e o a  C O  o <u o ca m a ^ -i — 8 - 2 u I CD * 3 I a ca .52 g c 3 ^ 3 3 t n3 ' J2 ^ ca CD « o SII r-: .5 "a C B , ^ 3 S S o W -S CD • -  CD  Q)  4_, -rt a o  CO CD CD  X> —  O  3  3  O  O  3  0> a)  .5  O O  O.  T3 .3  IS  tn  3  C  J  0 0  7 3  sis  13  OJ  CN  3  a B  O  u  03  a. <u u c  iTi  6  o ^  V  o 6 Jo 3,  ju  "c3  s  ^  in  O  w  5 5  Se o  ill S  i  O O  S3  5  cn  CN  o u o  H—i  m  ~3  CU  a3 O CN  )  cr o  CN CN  OH  cr  3  3  O  0  h  1 -2  a  x:  o  scn nfi cu 33 S  |T3  CU IU O cn 3 cn  2 <u  S  •£ S M  -a -o  g  •a  2  O  cu  Z -2  ON  CQ  lO <U  • a  .c u 00 o u 2 W S a«2  Q N  cu  o  E E  B o (U *2  B  O  U  cu T3 i " te cu cn  |T3  CU  cu  §  o CQ v.  cu eg  B  S « o >N ,0 B O  oj  cn  B  OH  a -o  O  -  u  CQ" IU  CU  -S  .£• —i  B  \s  2  o.c*H  O.  O  u  O  ICQ  ju  cu  OH  O  OH  O  TO  3  a  cu XI  e o  CQ  Si  3  >^ cu c3 H  CQ  u a o  O  e o  H->  •a  N  ai  N  E  «J cu  N X? l-g § ICQ S •  3 ca  5  O  E  « J  O  B  u <u  em I" B 1) o  ca CU  •B te  ^  § .s  O  C o  cu .2 5 Vcu- JS 13 a "2 S -9 CQ g O.  1>  c  •2  o  = 2 <£  = Z y  a"  aU  _<u  LH  -5  § cj B  c •o  O  VO  a 3 y cu  b  o S o ero  cu  ON ON ON  N  - B cu  o  cu  OH  o  cu OH (U B n ca cq N 3 £  cn  T3  § 8  a u  W DX)  si  o  cn cu  CU  •S "H ° xl ^ 35 3 S S 3 fe te c o o O - ' C c fi.9 a X O- cu a mOH U oj „ a a se ts •S °-' fe a* S 2  -  3  2  o -B " 3 . „ B T3  3  8  OH  O  Cu  H  o B o o  JS  cu  E « £ S ta B cn c •o o > S « S S 1) E O • S3 5 o > E OH o a « x: a ca N  n S  O  CQ .cn  <U cn B 2 OH  O  I  B  O.  u ca O  CU  .5  a  o .2  CU  ao cn  a  a  ca  c  o  B  o  3 M cu  'H-»  <•>  cn  B  O '•*-»  t.  &  'C  o  o o>  c2  cn  fe  u  c  1/1  O  I-  a o CJ u,  cn  o  B •*-»  J3 c2  1  cu o B XS CU B  3  cn cn K kH  B  B  o.tS  c>  cn tj S «S  2  °  —H  B  OH O OH '42  m a  1 I | u E a  =5 &  cn • -  te u  S 53 g x5 > aa u°  O  E 2  cn  fN-i  I  a g, <u  "2  6B  u  cu  cn 3  §"3 3  D T3 O cn U  X3 T3  o  e cu  cn IU  CU IU O •a ti  CB £ 53 ^ IU xs i- j£> cn  "C " M S  s cS  I  CN  o x: (U  60 T3  IU  X! o  a o  O  HS  ,B  OJ  a c  |<2 T3 cn OJ B ti ea ca  ON ON ON  cu  CD 3 •~  U  o  it® o  ^  ON - ON ON ON  o O O  «~ CU CD  ON ON  7s  CN  s  a. cu u e  oo  cu  73 "3 <» ~~ *j >  CD"  g  CS ||  E ^  r<-i <+3  5  u  j, _ce  NO 0 -  II  cu  2  ON  ex)  © o o  ON ON ON — CN >/-)  CN  C  55  H  CD ce  CD fc O  w  V  >N!H CN cn O ^ CN - Q J£  a  ^ ,S ~S °o ON U O  2  B O  o  cs  CD JS cn  u ca  cu  CO  "S = CO  •of S M O  2  o  o  O U  2  cu  '5b  2  CD cn  O  CD  §  Bp  3  o ^  6  3 O  cx  E  JS  c. CU  c  CU  11  O  00  E 2 o ~'  00  I-  cu  _es "o  C3  3  ca 5*  CD  cu o B -a  E  CJ ON  ON ON  -a  ca  «~)  a  cu  ^ § S  o cu  cx  H  O cn CO cn  eg  X  w  1 o <  73  * u  -  r  ^  o ca  ON X  73  ^Jo  CN  ca ca  oo  oo  o E a5 o  ON  —i  _g  CN • -  v  2 o o 3 CD  2  V  CD  a S ( o p ca  u  CN CN . r  ^ 0\  73 N ON ^> Q ON  0  JS OH CJ  J3 ca  oo CD -3 SS, ^ — ' CJ -C II  c**  C3  3  ON © ON © © CN  CD ON X — CD CJ "a 53  -»-» ,cd £X<*H  CU  o cx E  r<-> CN  II  JS CN o, v CJ 0 \  ON ON  *3  ON ca  cn  CN  00  •<  §  a?.  u c  •a  ON . „ ~-< ON — f ON cu --j  §2  1= 3  x cu  „ II  A? i-» f- —  Z.ONON  « .2 H  12  O  cu  s O  7s  r a  ce  cu  1° c. cs  r  cu ~ -  o  cu  •a —  "a C3  7J cj  fe 5 •a  ON _ j  2  ON ON  ^  ON ON  Q  cu  „  O ca  "Q Y CU CN  CB H  'I , °cu  *J c  cu  ,  ON ON  6 .2  E "c3  cca x:  |w| C N  X) ca C8  12  >% X)  ,o  T3 ca  ON ON ON  fe cu  cu  X>  cu  <*-, O  NO  S £ > cu  O  ON ON  2 ^ 13  C  05  o  cu  CB  s  "b  >2  cs  ON ON  3  cn  § .3  cu  a  ca" T3  © T3 oo  «2 c—  C  3  ON  C*H  Ul  ON  I  00  °  Is  o o  •-  ca  X)  w u£ c+3  e  cs u  ^  oo  = W  a  ca £  ca  JS u o  K IS E oso  a "O  03  .2 2 & cu  CS J=  2  B.  CS T3  '3D I  cu  u  CN  m  , m  cu  o  o o  ca  u  y  =  13  cu  Q>  so  t, o a  T3 <L>  t.  oa. CD  S cu X cu  T3 cu  t, o CL  ca  C  3  N  C  "g  CQ m  T3  8£  t:  CU  oa •B oc*-•  D  4-»  oc  00  ON  •o  00 ON  «5 ca  cn  a cs  IS  c o  13  3  Ly  5 °o .2 ou 5 « S § 2  5 MC2 c T: lcoa g£ £§ +3  3 ,  SO  e. ©  &0  5  C S  < X  CQ  O S3  ON ON  II  «  ON  CU  2  X,  S? ^>  o  cs  ON  <3  cu  f-  T3 o ca  o S x> o g  cu  cs  "ca  ca  eo  * T  5 3  O  0 0  X C N  ^—' ON II ON  cs  •o  !S CS ^  m  a  s* Q.  M si  —  CS >-  « g  2 S u o  s  iot  > cu  C  ~  —  cu  CJ  o  rj  kg ac  ?-  C3  S co 00 o 3 a  |»  cJS  cS  13 u 1-  4 2  I *1  1 s O  §  cu  a CCJ CS  2 o.<2 eu  o o  3 O  Sr-  I  H  2  a  c  Q  o a a CJ a o  O  | e  ll 0 >-  *  o  1  c s  . cn  cj  S N  -  -J 33  3 .O  6^  M  2  I" 1  o 3  CJ  -a .S•3  s o a  CS  O  <N  .5  s o a  io  CS  60 >-« CJ 4 3  3  cu "o  cu  •a o  o  cu  ©  o I. CJ  2 CS  H  •2  X  iS  C4_« CJ  "o  3  cj  C3 >  cn  3  i .  <  a  oa  0  . CO +  aa  •<  CO  pa  x ft  73  w  W  1  -  vo X ~  o  ^ ^ 0 o  O  i n CQ ^ W  -  w —  M  a  cr  X  o  X OS  o\  3 60 T3 B  cs  — 1_  y cu  CS  s  c3  x: •*3  >> •Ut  "O B 03  o  cu  S o a 7 3  03  X CU  a.  cs cs  •o c  cs B  OJ  — cu  .3  83  7  3  •of iS  >  O JJ JS < U  X )  ' X3  0  II 2  5  5  O  or r<1 i£ CJ «U 2  B O  CO  7 3  1 0  O  C+H  — X ) X5 -3  c 'H5  1J  P  CO  -Tt  OJ  0> x —j  CO  o 3 =S«  CO  -  CJ  3  CO CO  ON  o.& N -j=  ca ,eu 2 fa. E cu^ I .aa o S a  PJ a  O  ,2 L  cu a cu _ CO ca cu  CJ  ra  .2  OJ  OJ  *S u CJ P < X)  CJ  ui CL  cu  •o cu  Q.  cu  cu B  CO  cu  B  « 5  T3  3 O  ca co  E  CJ  X  O °~  cu a .3  x>  £  2  CQ  £  Z  CJ 0  co 3  fa  O  co  O •*-»  o  §  2 <2  B  b  u,  3  •£ O,  co — cu  *^  13 cu  £0  c-a* +  u  B  60  60  3  2S co  a  °E  u  a  I  ca  00  3  __  .N  cu a  CU  "CJ  .S.S  XS  B  -tj a ca cu  ca oj  o .3 xi .ti S £P  X I  (U  -O  cu  II  C  e o  N  —  fa  +-H  ™ 2.  •o o  CU  cu  S -3 N oj CQ  O  CU  3=s  US*  CJ  7 3  S  XI  CU  OJ  cu u cu  T3 T3  c5o  s § .3  Z  Q,  co T 3  a.  3  O CO *-H 1 3 g iS- cu . a I 2 00 o 0 01 ga £3 3 •= 0 g •S g « a _= >>0 0 C+H a P a 3 X I W o e 00 2 u .3  OH  o ^  O  1-°c oa S-  OJ  JS  2 m  a £  S £ «<« " • S B £ § fa, - cu .3  5 g a o  c2 §  o  o  '1 a If  cu •-  eg S  ~Z  » o  ° § >,  oj  T3  CJ  a  T3  § a  o o a R e  O  IE. <u  IU  ° g  60 5 N .3 x> -3 ^ _ ^ S a 0 — 3 b,  <3 % s'S<x> cu 53 u  <£ co"  °" 3 >- U  1  x cu  u,  cu  b 2 313 83 2 1 -a ui , .  2 "« es o  o  •>-> C+H " O  7 3  T3  Q  60 60  o  Z  ON  S HH  « 60 60 O  <3 Z O  !a  co 0  CO  fa  T3  Xi  O  S  c+3  IU  ° Vr -  ^  CN  S  O  pa 00 O O  p j CQ  SO  in ^ § o —  si CN  cr  CN  ON C3\ CS  3  .a «-  s"  u e o a 2 '-5 es  ISo  fe 5  es  O  CU  o  .a  CU  s-  cu a. cs cs  IS  Z  CU  cs  ™  cu •-  a« o  =  a o CL,  00  C/3  E  5  1 S  O S * a  co O  ^ ,co1  co O ti  c2  cu o CU  a  S  5,  to" -o  CU C  a  u >, JS "u •a • JS  CU  E B  o  D00  Q.  00  o :  Mouse studies suggest that NTDs may arise if there is a defect of folate handling at some location (Seller, 1994). Low folate levels may be either maternal or fetal in humans but it is believed that NTDs are not due to maternal deficiency in uptake of folate but may be instead due to the embryo's increasing demand for folate (Seller, 1994) or due to defects in the embryo's folate metabolism (Copp, 1998).  Due to the protective effect of folic acid on NTD, much work on the genetics of NTD has revolved around the enzymes of folate metabolism, which are involved in production, and degradation of homocysteine. Slightly elevated levels of homocysteine have been observed in blood of mothers with NTD pregnancies and in the amniotic fluid surrounding their fetuses (Steegers-Theunissen et al., 1991). These enzymes include methionine synthase (MS), cystathionine B synthase (CBS), and 5,10-methylenetetrahydrofolate reductase (MTHFR) (see Figure 1.2).  The G919A allele of MS was shown to occur at a frequency that did not differ between cases and controls and a transmission test for linkage disequilibrium failed to detect significant association between this allele and NTDs (Morrison et al., 1998). Therefore, it seems unlikely that this particular polymorphism is an important genetic contributor to NTD.  The frequency of a relatively common allele of CBS was shown not to differ between NTD cases and control individuals that suggest that it is unlikely to determine susceptibility to NTD (Copp, 1998).  In humans, presence of the thermolabile C677T allele of MTHFR with low folate status and elevated homocysteine levels appears to be associated with NTDs of the spinal cord (Wenstrom et al., 2000). Frequency of the C677Tallele in certain ethnic groups roughly correlates with the incidence of NTDs: it is common among Hispanics (Mutchinick et al., 1999), less common among non-Hispanic whites, and relatively rare in blacks (Botto and Yang, 2000). However, in Italy, the C677T variant is common, but the rate of NTDs is low (Botto and Yang, 2000). Even if this association were causal, it would only account for a small fraction of cases of NTDs prevented by folic acid (Botto and Yang, 2000).  15  Several studies suggest that complex interactions may occur among genes, between alleles of the same gene, and between certain genotypes and environmental factors. The risk of NTD might vary if mutations in the gene encoding MTHFR occurred with mutations in other folate-related genes such as those involved with folate acquisition such as folate receptor-a (Antony and Hansen, 2000; Trembath et al., 1999). The risk might also be affected if two different mutations in the MTHFR gene occurred together (Trembath et al., 1999; van der Put et al., 1998). Some studies also suggest that the risk associated with certain genotypes may vary depending on maternal factors, such as the blood levels of vitamin B12 or folate (Christensen et al., 1999).  Despite the positive effect of folate supplementation for some human NTD, approximately 30% of human cases of NTD appear to be folate independent (Copp, 1998).  IV.  SELH/Bc genetics and embryology  SELH/Bc is an inbred strain at F +, non-agouti, black chinchilla (aaBBc c ). ch  It is characterized by a high (10-  ch  20  30%) frequency of exencephaly in embryos and newborns. The origins of the strain are described in detail in Juriloff et al., 1989 and are summarized more briefly here. It originated from a partially inbred stock homozygous for the lidgap-Gates (lg ) mutation on a mixed background, (BALB/cGa, 129/-, and CBA/-) that was backcrossed Ga  to N in 1977 with "random-bred BLU:Ha(ICR)" mice. A new recessive mutation, spherocytosis-2 3  Columbia (sph  2Bc  British  Unger et al., 1983) appeared at the second intercross (N X N ), at which time 87.5% of genes in 3  3  the stock would be of ICR origin, and was maintained during brother-sister inbreeding with selection against lg . Ca  Exencephaly was observed in 1981 at F . Exencephaly producing breeding pairs were selected for propagation of 5  the stock, with selection against sph , in subsequent generations. 2Bc  The SELH/Bc lineage has produced an unusually high number of independent Mendelian recessive mutations beginning with sph  2Bc  at the a-spectrin locus on Chr 1 (Unger et al., 1983), and continuing through nu  Bc  at the nude  locus on Chr 11 (Koehn et al., 1988), c , c , c , on Chr 7, warn, a recessive curly hair locus on Chr 11 (Taylor et Bc  2Bc  3Bc  ai, 2000), a recessive white belly spot at the c-kit locus on Chr 5 (D.M. Juriloff, personal communication) and an unmapped recessive lens rupture. The mechanism of apparent genetic instability is unknown. Both the c 17  Bc  and c  2Bc  mutations are the result of different large deletions (Juriloff et al., 1994). An early transposon (ETn) of 5537bp (Accession number Y17107) between exons lb and 2 in the whn gene is responsible for the nu mutations and an Bc  ETn of 5542 bp (Accession number Y17106) in exon 1 of the tyr gene is responsible for the c  3 B c  mutation (Hofmann  et al., 1998). In both ETns, the integration sites were flanked by a direct repeat of 6 bp of duplicated genomic sequence suggesting the occurrence of de novo insertions. All new mutations were purged from the main SELH/Bc lineage. Ovarian teratomas have also been observed in SELH/Bc (unpublished data in Juriloff et al, 1993).  In all SELH/Bc embryos, Closure 2 is missing (Gunn et al, 1995; Macdonald et al., 1989) (refer to Figure LIB). In addition, the cranial neural folds are abnormally flat from very early in their development, despite normal distribution of actin in the neuroepithelial cells (Gunn et ai, 1993). All SELH/Bc embryos attempt to close the cranial neural tube by caudally extending the progressive fusion initiated at Closure 3. This abnormal mechanism of cranial neural tube closure is successful in most cases but is either delayed or impeded in 10-30% of individuals to result in exencephaly with no other known unrelated defects. These exencephalics usually survive until just after birth. In mice the length of time the unclosed brain is exposed to amniotic fluid is much shorter than in humans (10 days compared with >7 months) and the degeneration and loss of brain tissue is hence very much less (Papp et al., 1986; Peters et al., 1979). Therefore, the defect is known as "exencephaly" in mouse and "anencephaly" in humans. The difference between SELH/Bc embryos that succeed in closing their anterior neuropore and those that do not may be in the accumulated small environmental effects that influence elevation of neural folds (Fraser, 1976; Gruneberg, 1952) or in the accumulation of stochastic effects (Kurnit et al., 1987). There is a ratio of females to males of 2:1 among exencephalics in SELH/Bc, which is not due to mortality of affected males (Juriloff et al., 1989).  The genetic cause of exencephaly in SELH/Bc is complex and has been attributed to two or three genetic loci that act codominantly and additively (Juriloff et al., 1989) and differ between SELH/Bc and the closely related normal strain ICR/Be (Juriloff et ai, 1989) or between SELH/Bc and the unrelated LM/Bc strain. The genes responsible for exencephaly are thought to be the same as those that cause absence of Closure 2 (Gunn et al., 1995). Embryos have some risk of exencephaly if they have any of these genes, the risk increasing with each additional liability gene (Juriloff and Harris, 1998). In this way, segregants from a cross to SELH/Bc appear to fit the multifactorial 18  threshold model of inheritance: individuals are normally distributed over a range of cumulated liability factors, both genetic and environmental, such that only those individuals whose liability is beyond a given threshold display the affected phenotype. Since human anencephaly is also thought tofitthe multifactorial threshold model (Fraser and Nora, 1986), the genetics of NTD in SELH/Bc can be said to resemble the human condition. Some of the gene loci are being mapped (in the SELH/Bc X LM/Bc cross); none is identified. At the start of my project, it was known that it is likely that one is on Chr 13 (Gunn, 1996).  Among the "normal" SELH/Bc mice, 5-10% display cleft cerebellum in embryos and 5-10% ataxia with cleft cerebellum in young adults (Harris et al., 1994; Juriloff et al., 1993). The cleft originates from a failure of fusion, during neural tube closure, of the neuroepithelial layer of the neural folds under the fused surface ectoderm (Harris et al., 1994), possibly due to the very delayed closure of the cerebellar region, and is caused by the same genes that cause the lack of Closure 2 and exencephaly (Gunn et al., 1995; Gunn et al., 1996).  In addition to multiple additive genetic loci, environmental factors also contribute to the risk of exencephaly in SELH/Bc. Environmental factors include an increased sensitivity to retinoic acid-induced (Tom et al., 1991), and to valproic acid-induced (Hall et al., 1997) exencephaly as compared to SWV/Bc and ICR/Be. The risk for exencephaly is three times higher on Purina Mouse Diet (Purina #5015, PMI Nutrition International, St. Louis, MO) than on Purina Laboratory Rodent Diet (Purina #5001, Juriloff and Harris, 2000). The relevant dietary agent that differs between these two commercial mouse rations has yet to be identified. Dietary supplementation of folic acid or methionine does not reduce the risk of exencephaly in SELH/Bc mice (D.M. Juriloff and M.J. Harris, personal communication).  V.  "CT strain" genetics and embryology  The Curly Tail strain ("CT strain") is the developmentally most well understood mouse model of nonsyndromic spina bifida aperta. The strain is characterized by a high frequency of tail flexion (50%), spina bifida aperta (10%) and exencephaly (approximately 3%) (van Straaten and Copp, 2001). The NTD arose spontaneously in the GFF stock in 1950 (Gruneberg, 1954). The GFF stock was an inbred strain carrying color genes aa bb pp (Gruneberg, 19  1954). One affected female was crossed to a male of the CBA/Gr strain and the resulting  were backcrossed to  CBA/Gr to create backcross 1 individuals (N ). N were intercrossed and their selected offspring were crossed to 2  2  CBA/Gr to create backcross 2 individuals (N ). Selected N individuals were intercrossed and the "curly tail stock" 3  3  was thus created. It was then maintained as a random-bred closed colony with selection for curly tail in which all individuals were considered to be of the genotype ct/ct (Embury et al., 1979). The dissemination of the "curly tail stock" from Gruneberg is detailed in Figure 1.3. In 1990, the Jackson Laboratory expanded the colony by mating the mice to related non-sibling mice (J. Merriam, personal communication). In 1991, the colony was maintained in two ways: sibling bred or random bred within the colony. Isozyme testing was conducted at that time and the two colonies were homozygous at the 22 marker loci tested. Since then the colony has been maintained by brother-sister inbreeding to F + and is therefore an inbred strain. 29  The "CT strain" exhibits spina bifida aperta (15-20%), flexed tail (60%; considered to be a mild form of NTD), and exencephaly (1-5%) (Neumann et al., 1994). Overall incidence of NTD has remained -50-60% over the last 50 years but large variations have occurred in the frequency of spina bifida aperta and exencephaly (van Straaten and Copp, 2001). In general, the studies that report highest exencephaly frequency tend to observe lowest spina bifida aperta frequency and vice versa. Thisfindingsuggests a general reciprocal relationship between occurrence of cranial and low spinal NTD in "CT strain" (van Straaten and Copp, 2001). Individuals with exencephaly are predominately females (4:1) (Copp and Brook, 1989; Embury et ai, 1979; Seller et al, 1979; Seller and PerkinsCole, 1987), whereas there is slight male excess in individuals with isolated spina bifida aperta (1.44, (Copp and Brook, 1989; Seller et al., 1979). The sex biases are not due to sex-specific prenatal loss (van Straaten and Copp, 2001).  20  ON ON ON  fc C3  X -a  CB TJ CS  3  ce  U U CQ D  o o CN PH PH  o  u  a  <u cd  U  00  T3  CD +-»  O  P  g-  U c  3  '  c o  I  2  CTJ  ON  " >? s| o w "a — V <u ^ M  O  cS  c  o  tH Cfl  J  H  O  <u +-  HH  CN  -S IS  & 3  u  o a o  '3 a  a CD Cfl  cfl  o ON ON  >• £  5  2 o • „ o -o. Cu °  . o  3  « X  Q  fc •a ON 00 ON  3  £  - cs  -C  ~ H ,3 SS |  1Ss£* ca —  «  O  CN  Completion of primary neurulation at the posterior neuropore is disrupted in the "CT strain" (Copp, 1993). The underlying defect involves a reduced rate of cell proliferation in the endoderm of the caudal notochord and hindgut—tissues that are attached to the ventral surface of the neural plate. This growth imbalance causes increased ventral curvature of the embryo, which opposes neural fold closure and leads to spina bifida (Copp, 1993). Posterior NTDs can be prevented in ct/ct embryos by splinting the caudal region to overcome the development of curvature (Brook et al, 1991). A defect in non-neural tissues could be responsible for the development of NTD in the "CT strain" since it has been observed that the neuroepithelium of ct/ct embryos is unaffected in its neurulation potential (van Straaten et al., 1993). It has been proposed that the ct gene may encode a protein that is involved, directly or indirectly, in control of cell proliferation in notochord and hindgut endoderm (Neumann et al., 1994). The expression of the phenotype of the strain is variable with exencephaly and lumbosacral spina bifida as the most extreme form, tail defects as a moderate form, and the remainder bearing no observable defect (Embury et al., 1979). It has been demonstrated that severe permanently delayed neuropore closure results in spina bifida aperta whereas less severe, temporary delay produces tail flexion defects (Copp, 1985). Mice with exencephaly alone or a severe lumbosacral spina bifida die shortly after birth (Embury et al., 1979). It is thought that a smaller sacral lesion may heal in the neonatal period, and the mice survive with no obvious impairment (Embury et al., 1979). The sacral defects might be related to the reduced accumulation of newly synthesized hyaluronan in the basement membrane regions beneath the neuroepithelium and surrounding the notochord in affected embryos (Copp and Bernfield, 1988).  The pathogenesis of exencephaly in the "CT strain" has not been studied but is thought to be mechanistically independent of caudal phenotypes (van Straaten and Copp, 2001).  Generally, genetic studies of the "CT strain" have focused on the flexed tail phenotype, and have not examined the segregants prenatally, when the spina bifida aperta and exencephaly traits are observable. The major gene for flexed tail liability in "CT strain", "curly tail" (ct), maps to distal Chr 4 (Neumann et al., 1994) between D4MU11 and D4MU14 (Letts et al, 1995) close to D4MU69 (Beier et al, 1995). ct also shows linkage with b, Pmv-19,  D4Nds2  and D4MU13 (Neumann, Copp, Frankel, Coffin, and Bernfield, unpublished data in Estibeiro et al, 1993). The ct gene had been considered to be recessive because affected individuals have not been reported in the F] between "CT 22  strain" and various common inbred strains: C57BL/6J, DBA/2J, BXD-8/Ty, BALB/cByJ, CAST/Ei, MOLF/Ei, and Mus spretus (Letts et al., 1995). However, the observation of a small proportion of ct/+ mice with flexed tails in segregants from many first backcrosses indicates that ct may exhibit dominance in the presence of particular combinations of modifier alleles (Neumann et ai, 1994).  Penetrance of the ct gene is influenced by genetic background. Frequency of flexed tail was highest in a backcross involving C57BL/6J (18.5%) and lowest in a backcross involving DBA/2 (0.4%) (Neumann et al., 1994). Selecting for straight tail phenotype in six generations of "curly tail stock" did not reduce the incidence of flexed tail offspring indicating incomplete penetrance of phenotype among homozygotes (Embury et al., 1979). van Straaten (van Straaten and Copp, 2001) reports average penetrance of flexed tail of 0.46% (10/2157), presumably of ct/+, in a congenic strain of ct on BALB/c. Copp (van Straaten and Copp, 2001) reports 11.9% (14/117) penetrance of flexed tail of heterozygotes in his congenic strain of ct on SWR/J.  Incidence of flexed tail in backcrosses to "CT strain" varies from 0.4-18.5% and this variability suggests recessive, "CT strain"-derived modifiers in addition to the ct locus and appropriate environmental conditions are required for highest risk (Letts et al., 1995). The "modifier of curly tail" (mctl) gene has been mapped to Chr 17 (Letts et al, 1995). When ct and mctl are both present, they seem to act additively to increase risk of flexed tail with no evidence of epistatic interaction (Letts et al., 1995). Other possible modifiers are thought to exist on Chr 3, Chr 5 (Neumann et al., 1994) and Chr 1 and 14 (Letts et al, 1995). Frequency of flexed tail in offspring is not influenced by parental phenotype (van Straaten and Copp, 2001). Genetic mapping studies using the spina bifida aperta or exencephaly phenotypes have not been done.  The ct gene product is unknown but must account for the delayed or incomplete closure of the posterior neuropore that causes spina bifida aperta and tail anomalies in the "CT strain" (Copp, 1985; Gruneberg, 1954; Neumann et al., 1994). Possible candidate genes suggested by the mapping of the ct gene include Pax7, Hspg2 (perlecan), Synd3 (syndecan-3), Fgr and Cdcll(Neumann et ai, 1994). These genes encode a putative transcription factor, a basement membrane proteoglycan, a transmembrane proteoglycan associated with neural tissues, a non-receptor tyrosine 23  kinase, and a cell division control (cdc)-related protein kinase, respectively. CDC2L1 maps to distal chromosome lp in the human genome where conservation of synteny places the ct gene, and its product appears to inhibit cell cycle progression (Eipers et al., 1991). The kinase gene Fgr, which encodes a member of the src gene family implicated in the regulation of differentiation (Sartor et al., 1992), is a suitable candidate because of the cell proliferation defect seen in affected ct/ct embryos. Syndecan-3 (or N-syndecan) is implicated in neural morphogenesis (Carey et al., 1992), has a uniquely high affinity for FGF-2, a growth factor involved in neural development (Chernousov and Carey, 1993). Perlecan is a potential candidate because of its relationship to the basement membrane, which can direct epithelial morphogenesis (Chernousov and Carey, 1993) and is the site of reduced hyaluronan accumulation in affected "CT strain" embryos (Copp and Bernfield, 1988). However, the perlecan null mutant has exencephaly and not spina bifida aperta (Table 1.1). Pax7 is a candidate because, like all other murine Pax genes except Paxl, it is expressed in the embryonic neural tube (Jostes et al., 1990). However, no evidence of protein sequence differences between Pax7 in "CT strain" and wild type mice (Beier et al., 1995) has been seen.  Penetrance of NTD in the "CT strain" is also affected by potential teratogens, including vitamin A, hydroxyurea, and mitomycin C administered during mid-gestation (Seller and Perkins, 1983; Seller and Perkins, 1986), and with embryonic growth retardation due to maternal starvation (Copp et ai, 1988) or in whole embryo cultures, to hyperthermia (Copp et al., 1988), and inositol deficiency (Cockroft et al, 1992). In the "CT strain", antimitogens such as hydroxyurea, 5-fluorouracil, mitomycin C, and cytosine arabinoside increased the frequency of exencephaly when given to pregnant females at E8.5, the critical time for cranial neurulation (Seller and Perkins, 1983). Conversely, when these same antimitogens were applied at E9.5 when caudal spinal neural folds are closing there was a decrease in frequency of spina bifida aperta and flexed tails. Subjecting pregnant "CT strain" females to hyperthermia increased exencephaly by 20% but had no effect on caudal NTD (Seller and Perkins-Cole, 1987). Therefore, environmental factors that cause embryonic growth retardation exacerbate the cranial phenotype but lessen the frequency and severity of the spinal phenotype (van Straaten and Copp, 2001).  Exogenous use of folate, Pregnavite Forte F (a folic acid preparation), and other vitamins administered at various times during gestation to ct mice did not have any effect on the incidence of NTDs in these mice (Seller, 1994; 24  Seller and Adinolfi, 1979). These results suggest either that the underlying mechanism in these mice differs from that in folate-preventable human NTDs, or that maternal handling of exogenous folate differs in the mouse and human (Copp, 1993). Methionine, an amino acid produced during folic acid metabolism (see Figure 1.2), also has no preventative effect on spina bifida aperta in "CT strain" (van Straaten et al., 1995).  RARp (retinoic acid receptor P) expression is deficient in the hindgut endoderm, which correlates with its low proliferation rate compared with normal embryos, whereas expression of RARy is deficient in the tail bud and posterior neuropore (Chen et al., 1995a). When retinoic acid is administered 10 days, 8 hours, p.c, both receptors are upregulated and there is a reduced incidence of NTD (Chen et al., 1995b). Inositol, given to embryos between E9 and E l 0.5 both in vitro and in vivo prevents up to 70% of spina bifida aperta and flexed tail by reducing the delay in posterior neuropore closure, seen as reduced posterior neuropore length (Greene and Copp, 1997; Seller, 1994). Retinoic acid may prevent the tail defects specifically by rebalancing a disturbed process of secondary neurulation (Chen et al., 1994). However, high doses of retinoic acid can induce NTD (Cohlan, 1953; Kalter and Warkany, 1961). "CT strain" shows increased liability to retinoic acid-induced NTD if retinoic acid is given before E8 when compared to mice of normal genotypes (Seller et al., 1979).  Inositol treatment appears to work by upregulating protein kinase C that leads to upregulation of RARp expression in the hindgut (Greene and Copp, 1997). Phorbol ester, which upregulates protein kinase C, also upregulates RARp and causes reduced posterior neuropore length (Greene and Copp, 1997). It is not known whether the upregulation of RARp causes or is the result of hindgut growth (Greene and Copp, 1997), and the target genes for RARP regulation in the hindgut have yet to be identified.  Due to the strong genetic background effects and the influence of environmental factors, "CT strain" is thought to be a multifactorial model of spina bifida aperta (van Straaten and Copp, 2001). The similarity between NTD in "CT strain" and humans with respect to location, pathology, associated anomalies and inheritance raises the possibility that the human homologues of ct and the modifier loci are involved in the pathogenesis of human NTD (Neumann et  25  ai, 1994). Modifier genes in the "CT strain" system could influence morphogenetic processes, which might modify effects of other mutations, or environmental influences that produce mouse NTD (Neumann et al., 1994).  VI.  The etiological relationship between anencephaly and spina bifida aperta  A major question that arises in the study of human nonsyndromic NTDs is whether or not anencephaly and spina bifida aperta represent alternate outcomes of the same genetic liability. Lemire et al. (1978) states that anencephaly and spina bifida are closely related etiologically because both are due to failure of the neural tube to close early in embryonic life, anencephaly resulting from a defect at the rostral end and spina bifida from a defect at the caudal end of the neural tube. OMIM also makes the statement that anencephaly and spina bifida are generally considered to be one entity (OMIM, 1999). Furthermore, as Carter (1974) stated, human NTDs have always been regarded as causally related because they are observed to occur within sibships.  In the 1980s, researchers began to classify NTDs into two groups: "upper" NTDs such as anencephaly, encephalocoele, and thoracic spina bifida, and "lower" NTDs such as lumbosacral spina bifida (Seller, 1990; Toriello and Higgins, 1985). This classification system was developed to separate primary neurulation defects ("upper" NTDs), from canalization defects ("lower" NTDs) using vertebrae TI 1/12 as the division point between the two (based on work of Lemire et al., 1975). The aim of this division was to facilitate the understanding of the etiology of primary neurulation defects and canalization defects. However, as the transition point from primary to secondary neurulation is probably at the second sacral segment (Muller and O'Rahilly, 1987) most cases of spina bifida are likely to be caused by abnormal primary neurulation. Therefore, there is no need for an upper/lower distinction on the basis of different closure mechanisms (Garabedian and Fraser, 1993).  Nevertheless, the implications of the NTD studies that have used the upper/lower distinction may lend insight into the plausibility of anencephaly and spina bifida aperta sharing a similar etiology in humans. In general, affected concordance studies show that when the proband has anencephaly, the affected sibling has an equal chance of developing anencephaly or spina bifida aperta; similarly, when the proband has spina bifida aperta, the affected sibling has an equal chance of developing spina bifida aperta or anencephaly (McBride, 1977; McBride, 1979; Toriello and Higgins, 1985; Keena et al., 1986; Frecker et al., 1988; Hall et al., 1988; Seller, 1990; Drainer et al.,  26  1991; Torok and Papp, 1991; Garabedian and Fraser, 1993), which suggests that these defects share a common genetic cause. However, interpretation of results is made difficult by the inclusion of spina bifida occulta (not due to neural tube defect) (includes Drainer et al, 1991 and Seller et al, 1990) in the spina bifida category.  As suggested in the introduction to NTD, mouse models of isolated exencephaly or spina bifida aperta would suggest independent genetic mechanisms for each. However, existence of gene knockout (i.e. Mlp knockout) and spontaneous mutants (i.e. "CT strain") that display both exencephaly and spina bifida aperta suggest that the two defects may share a common genetic cause. In addition, the introduction of modifiers from the DBA/2 strain to splotch (Sp2H/Sp2H; a model of cranial and caudal NTD, see Table 1.4) can reduce the frequency of cranial but not caudal NTDs (Fleming and Copp, 2000). Therefore, at least for mice, both common and independent genetic causes of exencephaly and spina bifida aperta exist.  VII.  Rationale and approach to my studies  There are two major sections in my thesis. The first section addresses the relationship between the cause of isolated exencephaly and spina bifida aperta using mouse genetic model systems. This was tested by a genetic cross between SELH/Bc and "CT strain" and by a test of the effect of inositol on risk of exencephaly in SELH/Bc embiyos. The second section deals with refining the map locations of the liability loci for exencephaly in SELH/Bc by extending the work started by T. Gunn (Gunn, 1996), and with mapping of one candidate gene for ct, the Mlp locus.  Can the liability factors for NTD in the SELH/Bc NTD and/or to produce new phenotypes?  strain and in the "CT strain" interact to increase frequency of  A study conducted by Estibeiro et al. (1993) used this approach to study the effect of interaction between splotch (Sp) and curly tail (ct) on neurulation. When "CT strain" was crossed to Splotch, an established model of folate sensitive NTD (Lakkis et al, 1999), 10% of ct/+ Sp/+, ct/+ Sp7+, and ct/+ Sp /+ 2H  individuals showed tail defects  which were not seen in single heterozygotes (Estibeiro et al., 1993). These studies suggest that ct can be semidominant given an appropriate genetic background as was also observed by Neumann et al. (1994).  27  Lakkis et al (1999) created double Nfl and Pax3 mutants to study NTDs because both Nfl and Pax3 are important for the development of neural crest-derived structures and the central nervous system (see Tables 1.1 and 1.4). Nfl encodes the intracellular signaling protein neurofibromin (see Table 1.1) and Pax3 is a transcription factor gene that is mutated in the Splotch mouse (see Table 1.4). No NTD was observed in single heterozygotes, no NTD was seen in Nfl' ' Sp , 100% NTD was seen in Nfl 1  +,+  +I+  Sp ' (55% exencephaly with spina bifida, 45% spina bifida), 6% NTD 1  was seen in Nfl ' Sp '. From this data, Lakkis et al. (1999) concluded that Nfl acted as a modifier for risk of NTD +/  +I  in Splotch.  Wallace et al. (1978) performed a cross between xn, a spontaneous mouse model of exencephaly (see Table 1.1) and "CT strain". No NTD was detected in the F, (Wallace et al., 1978). Exencephaly in the xn strain is thought to be due to a single autosomal recessive gene (xn) that has reduced penetrance (33%) that is not an allele of ct (Wallace etal., 1978).  Here I present a study using a cross between two inbred strains that developed NTD independently. It is believed to be the first study of multifactorial NTD using inbred strains of mouse rather than single gene mutants.  28  CHAPTER II: General Methods and Materials I.  Mouse stocks and maintenance  a)  Mouse stocks  SELH/Bc The history of this inbred strain has been reviewed in Chapter 1. Animals used in this study were part of the Juriloff/Harris Colony at the University of British Columbia. It is now at F +. 20  "CT strain" Six "STOCK ct/ct" males were acquired from the Jackson Laboratory (Bar Harbor, ME). The origin of this inbred mouse strain is reviewed in Chapter 1. The mice received were at F +. 29  LM/Bc LM/Bc is an inbred strain at F +. The strain was derived by brother-sister inbreeding of mice that carried 1/8 of 6)  their genes from SWV strain and 7/8 of their genes from an inbred strain that had been derived from an unpedigreed stock of "C3H" mice (Gunn Thesis, 1996). It has been used extensively in other developmental studies (Harris et al., 1984; Harris and Juriloff, 1986; Finnell et al., 1986) and has no known relationship to SELH/Bc. LM/Bc has normal neural tube closure including initiation of cranial neural tube closure at the Closure 2 site (Juriloff et al., 1991; Golden and Chernoff, 1993).  BXA-7/Pgn BXA-7/Pgn is a recombinant inbred strain originating from a cross between C57BL/6J and A/J. It is now at F  6 8  (Jackson Laboratory, Bar Harbor, ME). It was used in this study as a normal strain with respect to neural tube closure. BXA-7/Pgn has no NTD when examined prenatally (Juriloff et al, 2001a)  b)  Mouse maintenance  All experiments were done in the Medical Genetics mouse unit, Wesbrook Annex, at the University of British Columbia under standard controlled conditions. The temperature was 22 + 2 °C; the light cycle was from 0700 to 1900; acidified water (pH 3.1 by HCI) and Purina Rodent Laboratory Diet (#5001) were provided ad libitum; standard polycarbonate cages with ground corncob bedding (Bed 'O'Cobs) were used.  29  Matings were set up in the afternoon and females were killed by carbon dioxide at approximately day 14 of gestation (E14) as determined by manual palpation. Females were removedfrommales just prior to execution. E14 was chosen in order to observe all abnormal progeny that would otherwise be cannibalized shortly after birth. El4 embryos are also easily scored for NTD, as neural tube closure is complete on E10.  II.  Technical Methods  b) Observation of E14 embryos and definition of exencephaly, spina bifida aperta, and flexed tail phenotypes The abdominal cavity of pregnant dams was exposed by cutting a small lateral incision in the skin using surgical scissors. Skin was pulled toward the head of the mouse until the abdomen was completely exposed. The peritoneum was cut with surgical scissors and pulled away from the midline to reveal abdominal organs. The intestine was displaced to reveal the uterus and ovaries. The uterus was removed from the abdominal cavity by cutting the mesometrium with surgical scissors. The uterus was then pinned to Sudan black tinted paraffin substrate in a petri dish and then immersed in 0.85% NaCI. Under 0.8 X magnification of a dissecting microscope (Zeiss, Germany), artery scissors were used to cut open the uterus from the ovary end toward the cervix end to expose deciduae. Two pairs of fine forceps were used to tear the yolk sac and amnionfromeach embryo. Each embryo was examined individually in situ and all implantations including dead embryos ("moles") were recorded. Any external abnormalities, including exencephaly, spina bifida aperta, and tail flexion were recorded. For this study, exencephaly is defined as splayed neural folds in any or all of zone B of the neural tube (see Figure 1.1). Spina bifida aperta is defined as exposed unfused neural folds in zone D of the neural tube (see Figure 1.1). Tail flexion is defined as a fixed bend in the tail of at least 90 degrees. After each embryo was scored for external abnormality, it was stored in 10% buffered neutral formalin (Fisher Scientific, Nepean ON).  c)  DNA extraction  For SELH/Bc and LM/Bc control DNA for PCR amplification, DNA was preparedfromliver tissuefromone SELHA/Bc male and one LM/Bc male as follows: Approximately half of the liver was rinsed twice in ice cold IX PBS (0.13 M NaCI, 0.7 mM Na HP0 , 0.3 mM NaH PO, pH 7.2) and minced into 1 mm pieces. The liver 3  2  4  2  30  homogenate was then lysed in 4 ml of lysis buffer (100 mM NaCI, 10 mM Tris HCI, pH 8.0, 25 mM EDTA pH 8.0, 1% SDS). Proteinase K (200 ul) was added and the lysate was incubated in a 60 °C water bath with rocking at 75 rpm overnight. Phenol chloroform extraction was performed followed by ethanol precipitation of the DNA (Sambrook et al., 1989). The DNA was rinsed in 70% ethanol, then resuspended in Tris EDTA pH 8.0. Final concentration of DNA was measured on 1/100 dilutions in distilled water in an LKB UV-Spectrophotometer. DNA was then diluted to O.lug/ul in distilled water for PCR.  The procedure for DNA extraction of E14 embryos was conducted as follows: 1-3 limbs were removedfromeach embryo and rinsed three times in 1 X PBS (0.13 mM NaCI, 0.7 mM Na HP0 , 0.3 mM NaH P0 , pH 7.2) then 2  4  2  4  stored at -20 °C until use. DNA was extracted from limb tissue using the QIAmp DNA Mini Kit (QIAGEN Inc. Mississauga, ON) using the manufacturer's protocol for crude cell lysates. DNA extracted in this way was used undiluted for PCR.  2-4 mm of tail tip tissue was obtained from live adult "CT strain" males and approximately 3 cm of tail tissue was taken from dead (SELH/Bc X "CT strain") F) females. Tail tissue was rinsed in 1 X PBS and stored as described for embryonic limb tissue. DNA was extracted using the QIAmp DNA mini kit (QIAGEN Inc., Mississauga, Ont.) using their protocol for crude cell lysates. For tail tip tissue, the volume of elution buffer was reduced to 50 ul in order to obtain DNA of a concentration suitable for PCR.  d) Polymerase Chain Reaction Amplification of Simple Sequence Length Polymorphisms  Each PCR reaction was carried out in a 26 ul volume overlaid with mineral oil in a 650 ul reaction tube. Each reaction contained approximately 100 ng of target DNA; 0.13 uM of each (forward and reverse primer); dATP, dCTP, dGTP, dTTP (final concentration 48 uM each (Pharmacia)); PCR buffer (final concentration 20 mM Tris HCI pH 8.4, 50 mM KC1; (GIBCO BRL). PCR was performed in a Perkin Elmer DNA Thermal Cycler 480 usually using the following conditions: 4.5 minutes at 94 °C (denaturation) followed by 30-35 cycles of 30 seconds at 94 °C (denaturation), 30 seconds at 55 °C (annealing), 30 seconds at 72 °C (extension); ending with 7 minutes at 72 °C.  31  e)  Visualization of PCR products  5 ul of bromphenol blue-xylene cyanol FF marker dye was added to the PCR product and 10 ul of this mixture was electrophoresed on horizontal 4% 3:1 Nusieve/Agarose (FMC Bioproducts) containing 0.4 ug/ml ethidium bromide. Gels were run in 1 X TAE buffer (Sambrook et al., 1989) at 140 V for 1.25-1.5 hours then observed and photographed (Polaroid 667 film) under UV light (302 nm).  Specific SSLPs, PCR conditions and estimated product sizes are presented in the relevant thesis chapters. Summary tables of all informative and uninformative SSLP markers are presented in Appendices B and D.  f)  Sources of PCR primers for SSLP and source of information about the map locations of SSLP loci  Primers were either obtainedfromResearch Genetics ("MapPairs" Huntsville, Ala) or were made by the Nucleic Acid Protein Service Unit (NAPS, University of British Columbia, Vancouver, BC). Map positions for SSLP loci are from the Mouse Genome Database (MGD, 2001).  32  CHAPTER III: Effect of maternal administration of 200 mg/1 mjo-inositol in drinking water on frequency of exencephaly in the SELH/Bc mouse strain. I.  Introduction  Although daily periconceptional supplementation with folic acid has been shown to prevent recurrence (Copp, 1998; Wald and Kennard, 1992) and occurrence of NTD (Czeizel and Dudas, 1992), approximately 30% of human NTDs are resistant to folic acid (Copp, 1998). Other supplements have been used to attempt to decrease risk of NTD in mouse models of NTD. These supplements include thymidine (Fleming and Copp, 1998; Seller, 1994), retinoic acid (Tom et al, 1991; Chen et al, 1994; Haviland and Essien, 1990; Moase and Trasler, 1987; Seller and Adinolfi, 1979), methionine (Essien and Wannberg, 1993; Seller, 1994; Tom etal, 1991), and /nyo-inositol (Greene and Copp, 1997).  The evidence of myo-inositol involvement in NTDs consists of the following. Culturing of rat embryos in inositolfree medium has been correlated to the occurrence of cranial NTDs (Cockroft, 1988). Dietary inositol deficiency also elevated the incidence of exencephaly in the "CT strain" (Cockroft et at., 1992).  "CT stock" studies have shown that an injection of mothers with inositol at a concentration of 400 mg/kg on late E9.5 significantly reduced the frequency of spina bifida (Greene and Copp, 1997). Reduced length of neuropores (an event associated with reduced risk of spinal NTD (Copp, 1985) was seen in "CT strain" embryos grown in culture with 50 p.g/ml of inositol (Greene and Copp, 1997). Inositol uptake is normal in the "CT strain" (Greene and Copp, 1997). The proposed mechanism of action of inositol in the "CT strain" is diagrammed in Figure 3.1. Diabetic rodents (Reece et al, 1993), like diabetic humans, have an elevated frequency of NTD. In diabetic rodents exogenous inositol or arachidonic acid both in vivo and in vitro has protected against NTD (Reece et al, 1993).  Myoinositol is a water-soluble member of the B-vitamin complex. Free inositol is involved in the inositol/lipid cycle that provides metabolic intermediates for processes such as signal transduction, steroid synthesis, and intracellular calcium regulation (Greene and Copp, 1997). Inositol may control the functional states of microtubules by binding preferentially to assembly-competent tubulin oligomers and may protect microtubules against cold- and calcium-induced depolymerization (Holub, 1982). Since inositol behaves as a water-structuring compound, it may  33  a  '3  h Cfl  H  y CD  JS  x  O a  CD  O  T3 a ca ca ti CD  3,  a  ca cs  -o IS ca  o  J3  IS  O CX O 3  ca  .3  cx  T3  CD  3  00  CD  X  a •3 ca  CD  ca ti  3  a  CD  cal 3 o  > CD CD  ca  C*H  T3  o  73  .3  3 a  CD >  JS  o 3  E  o o H  T3  a  'S.  CD  M  oo  CD  o  Q  CfH  -a CD  CD  •3 .3 o a a  o T3  ca  CS  2  « C  CD  CD > CD  CD  O « CS  sI  cx cx .3  CD  0  O  _> CN • H  U  CD  ~ T  CX CX  o U  CD  -o o  a CD  -t-»  ca  cs E 3 00 CD  00 O  cs  r<"> T3 CD CD 4 -J  a cx 3  ca  ~  ca  00 T 3  stabilize microtubules and intermediate aggregate species of tubulin by affecting the hydration state of the microtubular protein (Holub, 1982).  In both SELH/Bc (Juriloff and Harris, 2000) and "CT strain" (Seller, 1994), folic acid supplementation did not influence the incidence of NTD. Injection of inositol at 400 mg/kg on the ninth day of embryo development was shown to reduce the frequency of spina bifida in "CT strain" mice by 70% (Greene and Copp, 1997). The effect of inositol supplementation on the incidence of exencephaly in SELH/Bc had not been investigated.  As an approach to investigating possible overlap in etiology of NTD in SELH/Bc and "CT strain", the effect of maternal supplementation with /wyo-inositol on frequency of exencephaly of SELH/Bc was studied. Here I present data on the frequency of exencephaly in E14 embryos of SELH/Bc strain females who were given supplemental /nyo-inositol in drinking water from 14 days before conception through the embryonic period. It is hypothesized that the SELH/Bc strain would show a decrease in frequency of exencephaly with inositol supplementation if the altered developmental pathway in this strain were similar to the altered cellular pathway leading to spina bifida aperta in "CT strain".  II.  Materials and Methods  Female nulliparous SELH/Bc mice between three and seven months of age were used and housed as described in Chapter 2. Eight litters of four females each were used. Littermates were divided equally between experimental and control groups to a maximum of four females per cage. All were given on Purina Mouse Diet #5015 for 14 days before matings began and for the duration of the experiment.  The control group was given Purina Mouse Diet #5015 and standard acidified water (pH 3.1) for 14 days before matings and for the duration of the experiment.  The experimental group was given wyo-inositol (Sigma 1-7508) dissolved in distilled water at a concentration of 200 mg/1 instead of acidified water. The concentration of myoinositol used was derivedfromSeller (1994) who used a  35  single injection of either 250 or 400 mg/kg of inositol at E9. An adult mouse weighs between ~20g so Seller (1994) would have administered a dose of 5-8 mg of inositol per mouse.  SELH/Bc mice drink approximately 0.28 + 0.01 ml/g body weight and weigh about 25 g (Hall, 1996) and therefore drink approximately 7 ml/day. In our experiment, SELH/Bc female mice receiving the 200 mg/1 inositol in their drinking water would receive -1.4 mg of inositol/day. If the critical period for effect of myoinositol on cranial neural tube development is E5-9, then pregnant SELH/Bc mice would receive 7 mg of supplementary wvo-inositol (5 days X 1.4 mg/day) over this time period. Therefore, a dose of 7 mg/mouse of this experiment might be comparable to the dose of 5-8 mg/mouse given by Seller (1994). In our experiment, the supplementation was started two weeks prior to mating and continued until E14. 50 ml test tubes with sipper tubes in stoppers were used for "inositol water" and it was made up fresh and replaced daily for the duration of the experiment.  A single SELH/Bc male was introduced into each of the cages of two females. E14 embryos were collected when SELH/Bc females were judged to be 14 days pregnant by visual inspection and manual palpation. E14 litters were collected as described in Chapter 2 and scored for exencephaly and moles.  III.  Results  20% (26/129) of embryos with the inositol supplementation had exencephaly.  24% (32/131) had exencephaly in  the control group. The contingency % was 0.695 and not significant at an a value of 0.05 and 1 degree of freedom 2  (the critical yf = 3.84). The difference in mole frequency was also not statistically significant (% =0.64). Therefore, 2  the null hypothesis that there is no difference in exencephaly frequency after supplementation with myo-inositol (200 mg/1 in the drinking water) versus non-supplemented acidified water cannot be rejected.  36  Table 3.1. Frequency of exencephaly in E14 SELH/Bc embryos with or without myoinositol supplementation (200 mg/1 in drinking water). # of litters # of implantations # of scoreable embryos Mean litter size # of moles (%) # of exencephalics (%) # of normals (%) ax = 0.695 n.s.  a  Inositol Group 13 135 129 9.9 6 (4.4%) 26 (20.2%) 103 (79.8%)  Control Group 14 140 131 9.4 9 (6.4%) 32 (24.4%) 99 (75.6%)  37  IV.  Discussion  If the protective effect of wyo-inositol in the "CT strain" is due to its interaction with microtubules (Holub, 1982), it is perhaps not surprising that it had no effect in the SELH/Bc strain as this strain does not have abnormal actin distribution in its cranial neural folds (Gunn et al., 1993).  The results of this study suggest that the use of inositol supplementation in drinking water at a concentration of 200 mg/1 does not significantly affect the frequency of exencephaly in the SELH/Bc strain. Therefore, there is no evidence that the defect that leads to exencephaly in SELH/Bc is related to the protein kinase C/RARp* pathway implicated in the pathogenesis of spina bifida aperta seen in the "CT strain"(Greene and Copp, 1997), at least with respect to response to inositol supplementation. If the cellular pathway leading to NTD in the "CT strain" and SELH/Bc is the same, it could be that they differ in the affected step in the pathway.  Greene and Copp (1997) report that supranormal doses (50 (xg/ml as compared to 5 ug/ml) of inositol in culture media were needed to stimulate increased incorporation into inositol lipids in cultured embryos. The calculated amount of inositol delivered to each mouse over the predicted critical period of cranial neural tube development (7 mg from E5-9) is comparable to that given in a single peritoneal injection experiments (8-16 mg) (Greene and Copp, 1997; Seller, 1994). However, it is unlikely that the same concentration of inositol was available for the developing embryos. It is possible that any excess inositol given to the mother in her drinking water could have been excreted rather than delivered to her developing embryos. Since the previous study by Greene and Copp (1998) employed either peritoneal injection of inositol to mothers at a critical time in neural tube closure or supplementation via culture medium, future studies of the effect of inositol on frequency of exencephaly in SELH/Bc might consider these means of delivery. It could be that these methods of myoinositol supplementation might have a different effect on frequency of exencephaly in SELH/Bc.  Alternatively, to determine if the inositol/lipid cycle is involved in the mechanism leading to exencephaly in the SELH/Bc system, one could establish whether PKC stimulation decreases the frequency exencephaly by treating embryos with the phorbol ester, 12-O-tetradecanoyl phorbol-13-acetate (TPA). Phorbol ester is a nonmetabolized analogue of diacylglycerol that constitutively activates PKC (see Figure 3.1). If frequency of exencephaly in SELH/Bc were to remain unchanged with TPA use, it would provide more support for the affected intracellular pathways leading to NTD in SELH/Bc and "CT strain" being different. If it is found that TPA does decrease the 38  frequency of exencephaly in SELH/Bc, then the NTDs in SELH/Bc and "CT strain" may be due to defect at different steps in the same cellular pathway with SELH/Bc strain having a defect in a more downstream element (e.g. protein kinase C involvement) than the "CT strain" (myoinositol involvement; see Figure 3.1).  The means of delivering supplements to developing embryos is an important issue especially when considering interpretation of mouse experiments for the human situation. Non-invasive means of supplement delivery to pregnant females (e.g. via drinking water or food) prior to matings and throughout the pregnancy rather than invasive means (e.g. via injection or via culture medium) might ultimately prove to be more useful for evaluation in the human situation. In addition, numerous concerns have been raised concerning embryo culture studies (DeSesso et al., 1999). The explanted embryo lacks the integrity of extraembryonic membranes that protect it and act as the conduit between the mother and embryo. In the absence of the maternal system, cultured embryos are not exposed to maternal nutritional or endocrine factors that contribute to normal development. Cultured embryos are exposed directly to constant, high concentrations of the test agent over a prolonged period of time, whereas embryos in utero are typically exposed to concentrations of the agent in unmetabolized and metabolized form in a cyclic fashion. Lastly, mouse embryos can be grown in culture for only a short period of time during morphogenesis (optimally E810).  A future study of effect of myo-inositol supplementation to SELH/Bc dams in the manner described here might consider incorporating a positive control such as the "CT strain" for which the effect of inositol is known to reduce the frequency of NTD.  It should be noted that there may be multigenerational effects of maternal supplementation (Wolff et al, 1998). Perhaps there would have been an effect of inositol on the oocytes of the developing embryos and not on the embryos themselves. Therefore, the effect of myo-inositol supplementation would have been seen in the second generation of SELH/Bc.  39  CHAPTER IV: Frequency of exencephaly, spina bifida aperta, and flexed tail and segregation of SSLP alleles at liability loci in SELH/Bc X "CT strain" F, and F generations. 2  I.  Introduction  Upper and lower NTDs in humans- anencephaly and spina bifida aperta respectively- are thought to share the same cause because these defects have been observed to occur in the same families (Carter, 1974; McBride et al. 1979). In general, most affected sibling pair analysis for NTD have shown that siblings of a proband with anencephaly or spina bifida aperta have an equal chance of having anencephaly or spina bifida aperta (McBride, 1977; McBride, 1979; Toriello and Higgins, 1985; Keena et ai, 1986; Frecker et ai, 1988; Hall et al., 1988; Seller, 1990; Drainer et al., 1991; Torok and Papp, 1991; Garabedian and Fraser, 1993), which suggests that these defects share a common genetic cause. In order to examine the possibility of an upper NTD sharing common genetic origins with a lower NTD, I have used classical genetic crosses of genetically complex mouse models of exencephaly (SELH/Bc) and spina bifida aperta ("CT strain") that each has its own distinct genetic liability loci.  SELH/Bc is an inbred strain of mouse that is a well-described multifactorial mouse model of nonsyndromic exencephaly (reviewed in Chapter 1). In all SELH/Bc embryos, the Closure 2 site is missing (Gunn et al., 1995; Macdonald et al., 1989). All embryos attempt to close the cranial neural tube by caudally extending the progressive fusion initiated at Closure 3. This abnormal mechanism of cranial neural tube closure is successful in most cases but is either delayed or impeded in 10-30% of individuals to result in exencephaly with no other known unrelated defects. Mouse exencephaly is the equivalent to human anencephaly (Papp et al., 1986; Peters et al., 1979). The genetic cause of exencephaly in SELH/Bc is complex and has been attributed to 2-3 loci that act codominantly and additively (Juriloff et al., 1989). The genetic liability loci appear to be on chromosome 5, 13, 11 and possibly 10 (Juriloff et al., 2001b) (see Figure 4.1.). SELH/Bc exencephalic embryos display female excess (2:1; (Juriloff et al, 1989)) that is not due to male-specific prenatal loss (Macdonald et al., 1989).  The "CT strain" is a well-studied multifactorial model of nonsyndromic spina bifida aperta (10%, van Straaten and Copp, 2001). "CT strain" is considered to show strong similarity to human NTD because of similarities in location of defect, pathology, inheritance, and influence of potential teratogens (Neumann et al., 1994). Embryos with open NTD in this strain have increased levels of amniotic fluid a fetoprotein and association with hydrocephalus and polyhydramnios (Brook et al., 1994). There is evidence of multigenic inheritance as the frequency of theflexedtail phenotype is modified by other genes that are polymorphic between inbred mouse strains  40  . o  ca T—H  .9  ca  is  m  Cfl  H  y fi o '5b  III  2  •s  cfl  2  fi ^3 i3 co C O fi  CJ C O  Q  w  cj  j  ca  53 3 /-^ fi <,  w  .  P  oo \© tn fno <N Oo <N  III  C  .fi fi  C O  co CJ  VH  CU <U  LH  3 U  C O  M  :° 1 CU •fi SO -fi T3 u  fi CB  J 3  CJ  -  ca  2  cvo  •3  3  .3 ca <«  111 Q  Q  Q  £  TJ  0'  3  H o  Si  in  c2|  >o o\ v fn  OS  fn fn fn  5 2 3  -H-4  co  "i*  60 CJ H  fi  C8  0)  c .2 •2 Z O  rfi C J •S " = ta cj o  c .3.  O  1>  ll .  ^ -  X O  So JS  (Brook et al., 1994; Embury et al., 1979; Neumann et al., 1994). The genetic liability loci for "CT strain" are on chromosome 4 (cf) (Beier et al., 1995; Neumann et al., 1994), and 17 (mctl Letts et al., 1995)(see Figure 4.1.). The ct gene is semidominant in combination with specific modifiers and has variable expression and is incompletely penetrant, with homozygotes developing exencephaly (approximately 3%), spina bifida aperta (10%), and a flexed tail (50%) (van Straaten and Copp, 2001). Other modifiers may exist at unspecified locations on Chrs 3 and 5 (Neumann et al, 1994) and 1 and 14 (Letts et ai, 1995). Exencephalics in "CT strain" also have pronounced female excess (4:1 in Copp and Brook, 1989; Embury et al, 1979). Spina bifida aperta embryos exhibit a slight male excess (Copp and Brook, 1989) (1.44 in Embury et al., 1979), which is also not due to prenatal loss of females.  In order to address the question of interaction between genetic liability factors for exencephaly from the SELH/Bc strain and those for exencephaly and spina bifida aperta from the "CT strain", I have examined the neural tube phenotype and frequency of exencephaly, spina bifida aperta, and flexed tails in a population of F[ and F embryos. 2  The presence of SELH/Bc and "CT strain" risk genes was detected by PCR amplification of linked SSLPs in the DNA of affected individuals.  If the genetic liability factors from either strain were all acting recessively and were not the same at the risk loci associated with each respective strain, then the risk for NTD in the F] is hypothesized to be low to zero.  In an F , if the "CT strain" risk factors were to act additively with an SELH/Bc risk in the cranial neural tube, the 2  frequency of exencephaly would be expected to be higher than the frequency seen in other F sets from SELH/Bc 2  outcrosses to normal strains. Similarly, if SELH/Bc risk factors were to act additively with "CT strain" risk factors, a higher frequency of flexed tail and spina bifida aperta would be seen, compared with other F sets from "CT 2  strain" outcrosses to normal strains. With additive interaction, the presence of some SELH/Bc risk factors might change the expressivity of the phenotype of ct/ct to be combined exencephaly and spina bifida aperta/flexed tail. Alternatively, more extreme NTDs (e.g. completely open neural tube as in craniorachischisis), reflecting synergistic interaction could result.  Using this cross, I have mapped the position of Mlp in relation to SSLP markers on Chr 4 and have discussed the plausibility of this gene as a candidate for cf.  42  II.  Materials and Methods  Generation  of El 4 F/S  Twelve SELH/Bc females and four "CT strain" males were used to generate F, E14 embryos. SELH/Bc females were from the breeding colony in our laboratory and were either four or ten months old. "CT strain" males were from The Jackson Laboratory, are referred to by their Jackson Laboratory identification numbers, and were approximately seven months of age. The history of SELH/Bc and "CT strain" is detailed in Chapters 1 and 2. One to two SELH/Bc females were mated to single "CT strain" males. Females were removed for collection of Fj embryos when deemed to be at E14 by manual palpation. Embryos were examined at E14 instead of postnatally so that no embryos would be missed as a result of postnatal cannibalization. Collection of embryos was as described in Chapter 2. All F i embryos were examined for exencephaly, flexed tail, and spina bifida aperta using the criteria described in Chapter 2.  Generation  of El 4 F s 2  Creation of an F population rather than a BC, was carried out because only an F generation would give potential 2  2  for individuals representing every possible combination of genotypes at the various genetic risk loci. In this way, the maximum number of combinations of SELH/Bc and "CT strain" alleles at their risk loci is possible and the study of interchangeability and additivity of loci is possible.  To generate adult F)S, one to two SELH/Bc females were mated with the singly caged "CT strain" males (the same four individuals as used above) until females were visibly pregnant. A total of 11 SELH/Bc females were used. Pregnant females were then caged singly and allowed to rear F) litters for four weeks. Weaned litters were separated by sex and held for two weeks. Following weaning, the SELH/Bc females were re-mated to "CT strain" males.  43  F]S that had been weaned for at least two weeks (e.g. six weeks old) were set up for brother-sister matings. Matings were kept within sibships in case of possible heterogeneity among different "CT strain" fathers. In the event of a litter of only females, the females were mated to half-sibling males (same "CT strain" father, different SELH/Bc mother). 140 F] animals were generated, 62 full sibling matings and two half-sibling matings were set up for the generation of F s. 2  Collection of E14 F embryos is as described in Chapter 2 with the following amendment: After removal of 2  embryos from the uterus and scoring for NTD, embryos were placed singly in 0.85% NaCI in porcelain multi-well plates on ice in preparation for limb tissue collection for DNA extraction. Embryos were examined for exencephaly, flexed tail, and spina bifida aperta under a dissecting microscope using the phenotype criteria in Chapter 2. Tail tissue from each of the F i dams was also collected and stored at -20°C.  DNA extraction Extraction of DNA was conducted on limbs from all NTD E14 embryos in addition to limbs from three entire F  2  litters, using the QiAmp DNA extraction kit as described in Chapter 2.  SSLPs A total of 113 SSLPs spanning 20 cM regions of each incorporating the liability loci were typed for informativenous between SELH/Bc and "CT strain" (see Appendix B). The best SSLPs marking proximal, mid, and distal portions of most liability regions were typed on DNA extracted from the limb of all NTD E14 individuals. A sexing primer set, SMCX-1 5'CCGCTGCCAAATTCTTTGG3' and SMC4-1 5'TGAAGCTTTTGGCTTTGAG3' (D. Threadgill, personal communication, Vanderbilt University, Nashville TN) to amplify SMCY/SMXgenes (Agulnik et al, 1994) was used to determined sex ratios in affected embryos. Females have one PCR product and males have two PCR products because of an intron difference between X and Y genes (D. Threadgill, personal communication).  Markers that displayed non-random segregation of genotypes in the NTD individuals were typed in three entire F litters to test for deviation from a 1:2:1 ratio of CC:CS:SS genotypes where C represents "CT strain" allele and S  44  2  represents SELH/Bc allele. SMC was also typed in two pooled F litters to check that there was no sex-specific 2  embryonic lethality.  PCR amplification was conducted as described in Chapter 2. The SSLPs used for this part of the study were: D4MU33, D4MU65, D4MU279, D5Mit,95, D10MU12, D10MU158, D10MU237, D11MU288, D11MU360. D11MU253, D13MU39, D13MU64, D13MU159, D17MU81, D17MU176, D17MU88, and SMC. PCR conditions are outlined in Tables 4.1 and 4.2  Data analysis Individuals were sorted into groups based on type of NTD. x analysis of goodness of fit of SSLP genotypes to 2  1:2:1, two degrees of freedom, with a significance level at a = 0.05 was calculated for each category of NTD when the sample size was large enough for this kind of analysis. % analysis of goodness of fit to expected 1:1 frequency 2  of alleles with one degree of freedom was also calculated for each SSLP when sample size was large enough.  45  Table 4.1. Informative SSLP markers used in the SELH/Bc X "CT strain" NTD F including PCR condition, and estimated product sizes for each strain. 2  Position Marker (cM)  [MgCl ] (mM)  T i * anneal (°C)  2  Allele size (bp) SELH/Bc "CT strain"  57.80 69.80 79.00  D4MU279 D4MU65 D4MU33  3.5 3.5 1.5  55 Hot start 55 Hot start 55  135 145 145  145 135 140  68.00  D5MU95  1.5  55  135  130  40.70 56.00 67.50  D10MU158 D10MU12 D10MU237  1.5 1.5 1.5  55 55 55  100 230 95  105 240 120  55.00 64.00 71.00  D11MU288 D11MU360 D11MU253  1.5 1.5 1.5  55 55 55  110 115 95  125 125 85  30.00 37.00 47.00  D13MU64 D13MU39 D13MU159  1.5 1.5 1.5  55 55 55  116 200 160  100 210 140  16.90 22.50 29.50  D17MU81 D17MU176 D17MU88  1.5 1.5 1.5  55 55 55  125 170 190  115 175 240  Table 4.2. Estimated SMC PCR product size for female and male mice showing PCR conditions. Position (cM) 64.00 on X 2.03 on Y  Marker SMCX SMCY  [MgCl ] (mM)  T  2  *  3.5 3.5  anneal  CO  Hot start 55 Hot start 55  46  Female product size  Male product size  300 -  300 280  III.  Results  EU F,s  No neural tube defects were seen in the 115 scoreable  embryos (Tables 4.4). Overall mole (dead pre-El 1  embryo) frequency was 8.7% and differed between the 10 month old cohort of SELH/Bc females (average of 10.3% for eight pooled litters) and 4 month old cohort of SELH/Bc females (average of 4.9% for four pooled litters) (% = 2  5.95 P O.05).  El 4 F s 2  The phenotypes of NTD seen in the F were the same as in the two parental strains (Figure 4.2 and 4.3). There was 2  afrequencyof 4.6% of NTD (0.1% with exencephaly and flexed tail, 3.2% with exencephaly alone, 0.3% spina bifida aperta with flexed tail, 0.4% with spina bifida aperta, 0.6% with flexed tail) in the 758 scoreable F embryos 2  (Table 4.4). Figure 4.2 shows F embryos with exencephaly, spina bifida aperta, and flexed tail. Overall mole 2  frequency for the entire F population was 2.1% (Table 4.4). Thefrequenciesof exencephaly, flexed tail, spina 2  bifida aperta, or moles did not differ among the F descendants of each of the "CT strain" sires (Table 4.3). No 2  extreme NTDs such as craniorachischisis were observed.  a) F with exencephaly 2  Segregation of genotypes in the exencephalic F embryos for the SELH/Bc liability and "CT strain" liability loci is 2  shown in Figure 4.4.  Significant deviation from expected 1:2:1 CC:CS:SS genotypes toward the SS genotype was seen for SSLP markers D13MU64 (P<0.05), D13MU159 (PO.025), and D11MU253 (PO.025) in the exencephalic F s (Figure 4.4). 2  Significant deviation from 1:1 for segregation of alleles toward an excess of SELH/Bc alleles was observed at D13MU64 (PO.01), D13MU39 (PO.05), D13MU159 (PO.01) and DUMU253 (PO.025) (Figure 4.4). There was also a significant excess of females in the exencephalic F s (p<0.001), Figure 4.4). No significant deviation from 2  the expected proportion of genotypes or segregation of alleles was observed for markers on Chrs 10, 5,4, or 17 (Figure 4.4).  47  Table 4.3. NTD in E14 F progeny of each "CT strain" sire. "CT strain" male 2572 12. # litters # scoreable embryos 138 mean litter size 11.5 # moles (%) 3 (2.1) # NTD (%) 8 (5.8) exencephaly with flexed tail (%) 0(0) exencephaly (%) 5 (3.6) spina bifida aperta with flexed tail (%) 1 (0.7) spina bifida aperta (%) 0(0) flexed tail (%) 2(1.4) # normal (%) 130 (94) 2  "CT strain" male 2586 8 105 13.1 2(1.9) 5 (4.8) 0(0) 3 (2.9) 1(1) 0(0) 1(1) 100 (95)  "CT strain" male 2587 28 337 12.0 6(1.7) 16(4.7) 1 (0-3) 11 (3.3) 0(0) 2 (0.6) 2 (0.6) 321 (95)  "CT strain" male 2588 15 172 11.9 5 (2.7) 6 (3.5) 0(0) 5 (2.8) 0(0) 0(0) 1 (0.6) 172 (97)  Table 4.4. Number of E14 F and F embryos with exencephaly, flexed tail, and spina bifida aperta, including number of moles. x  2  # litters # scoreable embryos mean litter size # moles (%) # NTD (%) exencephaly with flexed tail (%) exencephaly (%) spina bifida aperta with flexed tail (%) spina bifida aperta (%) flexed tail (%) # normal (%) '4 litters from four month old dams, 8 litters from  F, 12 115 9.6 11 (8.7) 0(0) 0(0) 0(0) 0(0) 0(0) 0(0) 115 (100) 10 month old dams a  50  F 64 758 11.8 16(2.1) 31 (4.6) 2  (o.i)  1 24 (3.2) 2 (0.3) 3 (0.4) 5 (0.6) 723 (95)  Table 4.5. Observed ratio of CC:CS:SS genotypes and analysis of goodness of fit to 1:2:1 ratio of genotypes in three complete® pooled SELH/Bc X "CT strain" E14 F litters at SSLP markers that showed deviation from random segregation in F embryos with NTD. 2  2  Marker  Observed ratio of  D4MU279 D4MU65 D4MU33  Position (MGD value, cM) 57.80 69.80 79.00  D11MU253  71.00  P value  10:24:8 7:25:10 6:26:10  % value for goodness offitto expected ratio of 10.5:21:10.5 1.0 1.9 3.1  6:29:7  6.1  PO.05  3.9 2.7 2.6  n.s. n.s. n.s.  CC:CS:SS  D13MU64 30.00 9:27:6 D13MU39 37.00 15:17:10 D13MU159 47.00 14:16:12 includes two embryos with exencephaly and one with flexed tail  n.s. n.s. n.s.  Table 4.6. Observed ratio of females: males and x analysis of goodness of fit to 1:1 ratio of females: males in two® pooled SELH/Bc X "CT strain" F litters. 2  Marker  Position Observed ratio of x value for goodness offitto (MGD value, cM) F:M expected ratio of 14.5:14.5 SMC 64.00 on X 15A4 01)34 2.03 on Y ® includes one embryo with exencephaly and one embryo with flexed tail 2  51  P value nZ  o  CN CN VO CN  CN CN vb CN  oo CN © CN  ON  CN ON  CN CN  o  to  00  ir]  cn  rt  i-H  in  rn  rt rt  o  00  ON •—  m CN  cn CN  CN  00  o  ON  in  in  TT  CN  CN  CN  CN  CN CN  cn  1  CO  cu u T3  OT OT o o o  od  518 608 655 325 175  •• 1  551 751 52 497  oo  CN  CO  1—1  OC m  cn  VO  ve  l-H l-H  <—i  o  CM  ,—i  Tf  ON  ON  Tf  rH  ESS ESS ESS L7J ESS ESS CD CD LL7J ESS l^l ESS ESS • 1 ESS LTJ H7J • 1 rm ESS ESS ESS ESS ESS ESS H7J CD ESS ESS ESS ESS ESS • • •1 ESS ESS3 ESS ESS ESS [S2  95 89 313 207 735  OO  ON  192 743 57 765 718  343 36 489 646 04  cn vo  isa  •1 •1  ™  •  •  •  ESS • CD CNT3 ESS ESS ESS ESS ESS ESS ESS ESS ESS ESS l^l ESS • 1 ESS ESS ESS ESS ESS ESS ESS ESS ESS wm • 1 • i ESS ESS ESS ESS ESS ESS ESS ESS ESS CTJ CD  CD CD  ™  "™  CN  T! 00  •CD  o  Ti  o  o  •—1  ON  ESS ESS  H7J H7J  ESS ESS ESS CD  •  CD  • •  •  •  ESS CTJ  CD CD  HI ESS ESS ESS ESS ESS  in  Tf  VO  m  in  CN  vo  in  VO  CD CD  "  rt  L_7J H7J H7J LTJ  u £• fT  CQ ttj  UH UH  u.  ESS ESS ESS ESS ESS ESS ESS • •  UH  HH BH B I • CTJ •  I—ll—I Egg Un ESS ESS ESS  ESS E 3 > = l l = I B l B l B i a i a i H i  ESS CD CD I I B I B I  ESSESSESS ESSESSESS^  Rv?a  rm  L7J  io  •n  00 VO  ^  0O  ^  ^  •  •  IN) K  m  ^ 5  q  Tf  vo r-° W)  vo  •  •  >  IIS o  •  q  q  ir,  i-H vc r~-  T f  0\ c>  ©  r-" r-'  ON fN f ) T f  ll  UH  •r; vo  C  •S w oV 3 'co 3 JrJ  .2  - ^ V p o o  Q o  o o  "S V  00 i s  1 co  IT)  6 ij  in p  H CN cj O O V £ II P H  b  q  r-  5  b  cu cu 33  UH  C^  CO  o  V  M  •£ K  G- HJ  SS S 00 00 o\ as  cu 6 > 3  •C  o 3 r*> O 60 c o  LJ  ^I^lt'  q  ©  UH «rt  <a JO  [T  3! 311 ©  i*n  1  co S  E S S B l B i a i a i E S S B i a i i f l l • • ^ • • • • • •  L7J  T3  O  UH  I—I I—I I—I CTJESSESSUH ESS ESS ESS ^ M H M ~ H HI H ~  L17J  'o  cu > o  UH  ESS ESS H C I J L~TJ n ESSESSESS C D ESS ESS B l Bl M  LTZI  ESS m ESS ESS ESS •1 •• • 1 ESS  c/l  UH  •IHBIESSESSESSBIBIBI ^ B H E S S E S S E S S B i H H ESSESSESSESSESSESSHHH ESSESSHESSESSESSHBH ESSHBlESSESSESSaiBlfll  •1  ESS ESS •i ESS •1  O CU  i ao  UH  I B ESS ESS ESS ESS •ESS CTJ ESS CD  CTJ CD  ESS ESS ESS 1 •1 • CD ESS •ESS • •ESS ESS WM • • • 1 ESS ESS ESS ESS • 1 ESS ESS ESS ESS CD CD  ca  c <u co G.  ESS • CD ESS ESS ESS ESS C T J LTZI ESS ESS ESS ESS ESS ESS  CTJ ESS ESS  ^ 3°  CJ s  ESS ESS ESS ESS ESS ESS ESS  ESS ESS ESS ESS  o ,ca  •o  a  w  o 3 CV3 X II C N cj t/1 C V co 'ca ca 3  q  B -2  o  o  in  ON oo VO 00 ON  H rt N  i t/5  X  «tH CJ  3. O  "H CH  CL>  S s O  '5b cu  o o  ON  O  PH  ro'  ON  ON  I -  ro 7!  7!  co  ro  '—i  '—i  r—i  OS  ON  ON  rn  S  rn  iri  o  u  H  OS  7!  w  <N  1—  1  ro  os  I  © '  fN  rH  u  <*>  O  i—i  ©s-  M  H  •s  o  s  .2 c r~ o  CN CN  i-H  .2  .a  H  +-»  « u  CO  o  o  ON  o  CO  o o o  ro  ro  O -H  l-H i-H  o CN cn  co  OS  f>  f>  m  1/0  I/O  ro  *~H  ^ H  o  00  T H  rH  i-H l-H  o  o  o  l-H  ^H  o  o  CN  C~l  co  «  lfNi  lO  SO  oo ON  cu  T3  CS  e  ca  2 &  CN CN ro CN CN 0 0 * co  co CN ro 1/0 -3-  s  I? 5b  I/O  S  CO  350 760  A  05  •  •1  E S  Kvsl  510 268  E S  644 181  • i  • • •E S • [S3 ESS •n WM • • • i 1=1 • n ESS S S  m  ESS  • i  •  E S  •i E S  •i  • • •• 1 •• i •  • • •• i  ESS  •  • •  •i  ESS  E S ESS ESS  ESS  E S  ESS  E S  PH  E S  PH  E S  ESS •  •  E S O  •  •  •  • • • •  cj "cu  • • ES3 • • • •  E S  • •  U  —'  •  ss  M  r  X o  • J CQ PJ  S  +->  '  ca tq — oo  PH  C3  PH PH  II 00  '3 T3  PQ  o cu  i3 cu  § ^ o  V  CN  1  231 306  <  r  ^  n ON  o  ©  *™H  CN  CN  *~  '  ES •  414* 729*  CN CN 1  1  ©  ©  CN CN CN CN CN CN  O  O  ro  —i  ro <N  • n  •  • 1  ES ES ES ESS ES ES ESS ES ESS  •  •  •  ESS ESS ESS  •  •1  •  • i  OO f N ) K iO ^ ro *-i vS <N  111  CN  Q  • • • • • oo O fo Oo S O ii-^ tNi f-o fN  -Iii •—,  q  '—,  q  •  • >  • • ON  so <so  *t»  ^  ,—i  ©  O  ©  , — 1  ©"  ©  ©  ^ '  TT'  4t-'  CN CN ro O '-'  • • • • • • •  • • •  n  S PH  m  m  PH  ES  ESS  ESS  PH  ES  PH  ESS  PH  ESS  ES  .3 ca  o  IS SS ^  is  V  ^1  C  o 'y.  <u rs J J PH 13  cu  ta  ca cu '3 i- 5 > (/i ^ ca  ^ § ^ ^  •Ni N  ^  O  OH  *-i so Oo OO K Oo  ON  ft  tfl  TT  m  n •  •  ca ^ DH ca £ » 9  ^  U  00  q  ca co  ~ *"3  X cs n u  C3  X3 CD  PJ T3  tvo c O  a o •8 '5b CD  ™  O. cu o c CJ X  cu CO ca  JS  'o3  co  H  .3  j  • -H  O C SH  O  '3b CU  o o 1=1  co  o  co co  CJ  CU T3 •-  ca  cu < <u a M a. 'Cf  CJ  Sa £• -  ^  3 O  E  00  co  CJ 60  b) F with spina bifida 2  aperta  Figure 4.5 A shows genotype data for spina bifida aperta embryos. This subgroup of F with NTD was 2  insufficiently large for % analysis of goodness of fit to either 1:2:1 segregation of genotypes or 1:1 segregation of 2  alleles at each SSLP marker.  Variation in the size and location of the lesion of each F with spina bifida aperta is shown in Figure 4.2. 2  All or the four F embryos with spina bifida aperta had a CC genotype at the SSLP markers around the ct locus on 2  Chr 4 (Figure 4.5 A). No trend in genotypes was observed for SSLP markers on Chr 13, 10, 5, 11, or 17 in the F  2  with spina bifida aperta (Figure 4.5 A).  All four F embryos with spina bifida aperta were female (Figure 4.5 A) 2  c) F with flexed tail 2  Figure 4.5 B shows genotype data for embryos with flexed tail. F embryo #760 had flexed tail and exencephaly. 2  This embryo was included in the flexed tail group because of its flexed tail and the possibility that its exencephaly was due to the genetic liability for this trait imparted by "CT strain" alleles.  This subgroup of F with NTD was insufficiently large to be analyzed for goodness of fit to 1:2:1 expected ratio of 2  genotypes but was large enough for % analysis for goodness of fit to 1:1 expected ratio of alleles at each SSLP 2  marker. Significant deviation from a 1:1 ratio of alleles toward an excess of "CT strain" alleles was observed at D10MU237  (P<0.05), D4MU279 (P<0.05), D4MU65 (P<0.01), and D4MU33 (P<0.05) (Figure 4.5 B). This deviation  at SSLPs on Chr 4 is also seen when all F2 with spina bifida with or without flexed tail are grouped together (P O.001, Figure 4.5 B). Significant deviation from 1:1 toward an excess of SELH/Bc alleles was seen 3XD11MU288 (P<0.05), D11MU360  (PO.05), and D1JMU253  (PO.05) (Figure 4.5 B).  There was a trend toward an excess of females in the F with flexed tail. 2  54  Segregation ofgenotypes in two or three pooled F litters for SSLP markers showing deviationfromexpecte ratio among affected F individuals 2  2  Genotypes for D13MU64,  D13MU39, D13MU159, DllMit253, D4MH279, D4MU65, D4MU33, D17MU88, and SM  are presented in Table 4.5 and 4.6. All of these markers show no significant deviation from expected 1:2:1 ratio of CC:CS:SS genotypes except D11MU253 (PO.05), which had an excess of heterozygotes (Table 4.5).  IV.  Discussion  Frequency ofNTD in F] vs. F embryos 2  The presence of no NTD in the F, generation is consistent with other F i data from SELH/Bc X normal strains (Gunn et al., 1992; Juriloff et al, 1989). No NTD in Y is also consistent with "CT strain" X normal CBA/Gr F! data x  (Gruneberg, 1954) and "CT strain" X xn (Wallace et al., 1978). The F i frequency is low as compared to the F 2 frequency of 4.6%, which suggests that heterozygosity at both the SELH/Bc and "CT strain" NTD liability loci is not sufficient for NTD. Therefore the SELH/Bc alleles at the "CT strain" risk loci (Chrs 4 and 17) are not equivalent to the "CT strain" alleles. Similarly, "CT strain" alleles at the SELH/Bc risk loci (Chrs 13, 5, 10, and 11) are not equivalent to SELH/Bc alleles. It is possible that maternal effects may have influenced the penetrance of NTD in the F, but maternal effects have not been reported for either SELH/Bc (Gunn et al., 1992) or the "CT strain". It might be advisable to repeat this experiment with a reciprocal F] cross (e.g. "CT strain" females X SELH/Bc males) to assess the possibility of maternal effects (e.g. uterine environment).  The mole frequency in the E14 F! population was higher than that of the E14 F 2 population (9.7% vs. 2.1% Table 4.5), possibly due to the phenomenon of" hybrid vigor" of the F, mothers of the E14 F 2 embryos (Silver, 1995) and the relatively younger age (~ six weeks old) of most of the F, females when bred. Mole frequency in the F i is similar to that seen in the SELH/Bc strain (6.6%, (Juriloff et al, 1989) but is higher than other SELH/Bc F, studies (3.3% for SELH/Bc X ICR/Be, (Juriloff et al, 1989). Closer examination of SELH/Bc dams used for the generation of E14 F]S reveals 2 cohorts: age 9-10 months and age 4 months (see Table 4.4). Since the average mole frequency of pooled litters of the age 9-10 month old dams was significantly higher than that of the 4 month old dams (10.3% versus 4.9%) it is suggested that the advanced age of the former cohort is largely responsible for the lower fecundity observed (Silver, 1995). Perhaps an age-matched mating regime (~ 2 month old dams) for generation of E14 Fis and F s would have resulted in more comparable mole frequencies. 2  55  E14 F  2  If genetic factors from the risk regions of either SELH/Bc or the "CT strain" were additive and/or interchangeable, the number of F with NTD would be expected to be greater than the sum of affected segregantsfromtwo 2  independent systems of SELH/Bc F and "CT strain" F when crossed to a normal strain. Using previous data, this 2  2  sum would be -4-7% or 28-46 embryos in an F population of 758 (2.4% exencephaly for SELH/Bc X ICR/Be F 2  2  (Juriloff et al., 1989), 3.7% exencephaly for SELH/Bc X LM/Bc F (Juriloff et al., 2001b), and 0.6% spina bifida 2  aperta for "CT strain" assuming one locus with 2.3% penetrance as derived from BC] data in Chapter 5).  If the genetic risk from any or all of the liability regions from SELH/Bc could have a combined effect with the liability regions from the "CT strain" a number of possible outcomes might be expected.  One possible outcome would be an effect on "penetrance" of the affected phenotype of F individuals with SELH/Bc 2  genotypes at the SELH/Bc risk regions and "CT strain" genotypes at the "CT strain" risk regions. That is, although a certain percentage of F are expected to be like either the SELH/Bc strain or the "CT strain" in genotype at their 2  respective risk loci (e.g. SS at the Chrs 13, 5, and 11 or CC at Chrs 4 and 17), there exists a population that is also homozygous for risk alleles from the other strain at that strain's risk locus (e.g. CC at Chr 4 in an SELH/Bc-like F ) 2  and the presence of this additional risk factor could increase the chance of these F expressing an affected phenotype 2  of the parental strain it most resembles in genotype. For example, if "CT strain" factors at the "CT strain" risk regions (e.g. CC genotype at Chr 4) were to add to the risk factors from SELH/Bc, it would be expected that the normal distribution of F with the SELH/Bc-like genotype would be shifted by a constant factor beyond the reported 2  threshold (10-30%, Juriloff et al., 1989) so that a greater percentage of these F would display exencephaly. If the 2  converse were true, the normal distribution of F with "CT strain"-like genotypes would be shifted by a constant 2  factor so that a greater number of these F individuals would beyond their reported threshold (40-60% penetrance, 2  (van Straaten and Copp, 2001)) for expression of "CT strain" affected phenotypes (e.g. more exencephaly, spina bifida aperta, and flexed tail).  A second possible outcome of the combining of factors from one strain on the other is an increased proportion of affected F embryos with combinations of NTDs (e.g. exencephaly from SELH/Bc with spina bifida aperta and/or 2  flexed tail from the "CT strain"). If all the risk factors from both the SELH/Bc (two or three factors) and "CT 56  strain" (one to three factors) were necessary for combination of defects, then 1/64, 1/256, 1/1024, or 1/4096 of the F population (12, 3, 1, or 0 embryos) would have the appropriate genotype. Therefore, if the combining factor 2  hypothesis is true, at best it could be expected that more than 12 of the F would have combinations of NTDs. 2  A third possible outcome of a combining effect of SELH/Bc and "CT strain" factors is the expression of more extreme phenotypes in the F . If presence of SELH/Bc factors (SS genotype at an SELH/Bc risk region) in a "CT 2  strain"-like (or "CT strain" predominantly) genotype or conversely "CT strain" factors in a mostly/completely SELH/Bc-like genotype were to interact, a completely open neural tube (craniorachischisis) might result. In the most extreme case, a high percentage of early embryonic lethality might occur.  If any one SELH/Bc factor (e.g. SS genotype at D13MU39) could be substituted for one "CT strain" risk factor (e.g. CC at either Chr 4 or 17), there would be an increased chance of having F embryos with an "effectively "CT strain" 2  genotype" (meaning the equivalent of CC genotypes at two or three loci) that could lead to expression of a "CT strain"-like affected. As a result, more F with exencephaly, spina bifida aperta, or flexed tail would be observed 2  due to the "effectively "CT strain"-genotype" than would be expected from a calculation of the proportion of F with 2  "CT strain" genotype at its risk loci. Similarly, if the reverse were true, an increased number of F with exencephaly 2  due to an "effectively SELH/Bc genotype" would be observed in comparison to the predicted number of F with an 2  SELH/Bc genotype at its risk loci.  In general, the frequency and type of NTD seen in the F population do not support the predicted outcomes for 2  hypotheses of SELH/Bc and "CT strain" interaction in either a combinatorial or substitutive manner. The SELH/Bc multifactorial system is therefore different from the "CT strain" multifactorial system and they appear to act independently in an F population. Nevertheless, one can study the interaction of SELH/Bc and "CT strain" factors 2  in the affected F subgroups (with exencephaly, or with spina bifida aperta, or with flexed tail) by analyzing the 2  genetic data for SELH/Bc and "CT strain" risk regions.  Exencephalic  F  2  There is a statistically significant deviation from 1:2:1 ratio of genotypes at D13MH64, D13MU159, and D11MU253 due to a lack of the CC genotype accompanied by an excess of the SS genotype for D13MU64 and D13MU159 but 57  due to an excess of the SC genotype for D11MU253 (Figure 4.4). These deviations support previous studies indicating that risk for exencephaly from the SELH/Bc strain is linked to these loci (Juriloff et al. 2001b). 21/24 embryos have at least one S allele at D13MU159 and 24/24 have at least one S allele at DUMU253.  20/24 have at  least one C allele at D4Mit65. There is no one common genotype for the risk loci that is shared by all of the exencephalic F embryos which supports a multifactorial cause for this phenotype in this cross. 2  If it is assumed that SELH/Bc factors at Chr 13 and Chr 11 can act semidominantly and that the "CT strain" factor at Chr 4 (ct) can cause exencephaly (an association that has never been studied) and can also act semidominantly (appears to be true for the flexed tail phenotype according to Neumann et ai, 1994) the following observations can be made: 17/24 have the SELH/Bc risk at Chr 11 (S ), SELH/Bc risk at Chr 13 (S, ), and the "CT strain" risk at n  3  Chr 4 (C ); 4/24 have Su and Si only; and 3/24 have Su and C . Using these categories of origin for exencephaly 4  3  4  risk, conceptual models of independence of, substitution of, and combining of factors can be used to explain the observed genotypes.  Independence of factors Two different models of independent SELH/Bc and "CT strain" causes of exencephaly can be made.  Thefirstmodel (Figure 4.6A) assumes that the SELH/Bc risk for exencephaly is linked to S and S (supported by n  13  Juriloff et al, 2001b) and that the risk for exencephaly from the "CT strain" is very low (3% in the "CT strain" itself according to van Straaten and Copp, 2001). Given these assumptions, most (21/24) of the exencephalic F had this 2  phenotype because of Sn and Si and of these, 17 have C by coincidence. The remainder, 3/24, were exencephalic 3  4  because of C and had S by coincidence. 4  n  The second model of independence of factors (Figure 4.6B) ignores previous knowledge o f SELH/Bc genetics and assumes a higher risk for exencephaly attributable to C —a more unlikely situation. With these assumptions, most 4  (20/24) exencephalic F had the phenotype because of C and a few (4/24) had the phenotype due to S and S . 2  4  58  n  13  o  CU  cS  o  CH  <U SO  * p-H  O  u  > C3  T;  ^  •a  *%  c cd  cu >  CD  s  cd  3  PH  u c o o o cl c o o  bo  o C  H y  X  u  H U  (U  • -H  -  —  + 00  O fl  o o t  JO  <N  rj cu  -a o  t o  CO  O  § 25  pq  W  H-l  CD  w ,*  ^ S3 c3 cn .3 —  c/T  "  Q,  60  CJ  Cd  CD  s o  '£  o  T3  -a-  PQ  cu  c  C3  o o 13  CO  'C o •c t-H d PQ +3 VH CO  5  M  f-H VH  OH CD  '  pr - "ccn o  VH  c3  „  m  TT  +  o  ft  T t  CN  O cn  ^  O c/T -  (H  s  3  2  -  r  o  8. .1  CD CD  CD  3  "2 g £M CH CD  T3  "3  2  .5 -S3 -<r c2 < ~ > LH  CD  CD -o B o 3 cn  cn CO  vq pq  3  60  C  s  E .fi.  o CS  &  c"  < L > cs  &-a U >  u  +  CL> <->  a  cs  m  X!  <U  OO  HH  o 3  c o at*  ^S g. 3 to CO 2 OH  3  w> £  .S  CS  £ z z  o ii M o o u a M  CU  OH  GO  O  co  o  CO  CO  M  .a o  o 2  C  O  CU f— o  1  pa  pq  w w mm  CO  H U  1-  «S u  X va O  eg  « •§  E 7J o§ W  CO  ^3  2 to X CS  & H) cj CJ CS  o  S °<  VO  * .§  OO  rH  c s o cs  P §  CO  t>  cj S  cu  o  c  * t-H O  • i-H O O  CS 1>  + 1—H  co §  H  O  CO  cs  * CQ S u CS to  CQ  —1 ^  +  CD  oo c § " = <+« 00 O H  in O  a ,o •a u  *a  • HH  1 o  3  3 co 3 t-i-.CS  cn lo MH  O  3  «  S  U  1  +->  ~H  3 c  -a  t— 3 OJ ' • X> X>  M  c3  cs  E -S E  Substitution of factors  The first substitution model assumes that the risk for exencephaly in the exencephalic F s is primarily due to S and 2  S n but that C is a weaker contributor to risk and can be substituted for S 4  ) 3  n  in a few cases (Figure 4.7A). With this  set of assumptions, most (21/24) of the exencephalic F had the phenotype because of S n and S of which 17 had 2  ] 3  C by coincidence or as weak risk factor. The few that remain (3/24) had the phenotype because they had 4  substituted C for S) . 4  3  The alternate substitution model suggests that S n and S | are contributors to risk of exencephaly but that C is an 3  4  important contributor to risk and can substitute for either S n or S  ) 3  (Figure 4.7B). In this case, most (20/24) of the  exencephalic subset of F had exencephaly due to S n / C + S , or S n + S / C and the few that remain (4/24) had this 2  4  3  13  4  phenotype due to S + S i . n  Compounding  3  of factors  This model assumes that independent SELH/Bc ( S n and S i ) and "CT strain" (C ) risks of exencephaly exist but that 3  4  the risk factors from one strain can further increase the risk of the other strain (Figure 4.8). In this situation, as few as 4/24 have exencephaly due to S + S n  1 3  but C can add more risk in as many as 17/24. The remaining 4  exencephalic F (3/24) have the phenotype due to C with a possible compounding effect from S . 2  4  u  The relatively small number of exencephalic F s available limit the ability to draw conclusions. 2  Certainly, the frequency of exencephaly in the SELH/Bc X "CT strain" F does not exceed previously reported 2  frequencies observed in F of SELH/Bc crossed to a normal strain (2.4% exencephaly for SELH/Bc X ICR/Be F 2  2  (Juriloff et al., 1989), 3.7% exencephaly for SELH/Bc X LM/Bc F (Juriloff et al., 2001b). Models that allow C to 2  4  substitute for S or S in generating risk of exencephaly predict a higher proportion of segregants "at risk" than the )3  n  F s from crosses of SELH/Bc to normal strains. These models, are therefore, not supported. 2  This group of exencephalic F provides material from which to type additional SSLP markers on Chr 13 and 11 to 2  refine the location of the SELH/Bc-exencephaly liability loci. However, as some embryos may be exencephalic due  61  s 3  'c3 LO  H  y >< o  CN CO m  J  W C/3  cd  Tf  .3  a.  M  <- u £ J3 ° cl a o o ao (V)  s-  5 '3 a o 5 ~ X X 6 w w  cu  o B cu X  cu oo 3  O  1/3  o U  GO 00  H U  A U  +  oo oo  w  c/3  cn  CO  cd  3  cm  T t  CN T t  co"  s •3 c3 O  n<  S o o  cu  o  T 3  2 so  TT  cu 3  60  CN VO  to risk factors from the "CT strain", the SELH/Bc X "CT strain" F cross is not ideal for mapping of the SELH/Bc2  exencephaly liability loci, and it was not designed to do so. Since existence of a SELH/Bc risk region on Chr 5 from the SELH/Bc X LM/Bc F study was not seen in this study, it is suggested that this is due to a genetic difference 2  between LM/Bc and the "CT strain"; that the "CT strain" does not differ from SELH/Bc in this region.  Sex bias among exencephalic  Fs 2  Significant sex bias toward females in exencephalic F (7:1, Figure 4.3) is in keeping with the sex bias observed in 2  exencephalics in the SELH/Bc strain (2:1, Juriloff et al., 1989) and in the exencephalics of the "CT strain" (4:1 in Copp and Brook, 1989) and the human situation (Garabedian and Fraser, 1993). This significant sex bias was not present in the two pooled F litters tested (Table 4.6). 2  A hypothesis proposed to account for the greater susceptibility of females to anencephaly in humans comesfromthe multifactorial threshold model (Nora et al., 1994). The hypothesis suggests that females, being retarded relative to males during early neurulation when the upper neural tube is closing; are more prone to upper NTDs. Seller (1995) suggests that a difference between the sexes in developmental stage at the time of neural tube closure may be due to their differing sex chromosome contributions. Since the mouse X chromosome is bigger than the mouse Y chromosome and cells with more DNA have slower rate of mitosis (Barlow, 1972), Seller (1995) suggests that female embryos would have slower development. On the other hand, presence of the Y chromosome could increase the number of cells in mouse blastocysts in some strains (Seller, 1995). However, although one mouse study has shown that male embryos are more advanced in growth and development relative to their female littermates at E8.510.5 perhaps due to a difference in cell division rate prior to this embryonic period, the rates of growth and development do not differ between the sexes during this period (Brook et al, 1994). Since rate of growth at the time of neurulation appears not to be the reason for the sex bias in exencephalic embryos, a number of other hypotheses have been generated.  One idea is that females undergo neurulation at a more immature stage (i.e. fewer somites) than males (Brook et al., 1994). If neural tube closure occurs at the same chronological time in both sexes, the process in females would happen at a less advanced stage when there are fewer cells in the neuroepithelium and mesoderm. Therefore, the neural folds in females might not be sufficiently large or efficient at elevating and later fusing (Seller, 1995).  63  Preliminary data for "CT strain" exencephalics does not support this theory (Brook et al., 1994) nor does preliminary data for SELH/Bc (Juriloff, unpublished data).  A second idea is that there is a maternal, time-dependent constraint on neurulation (Brook et al., 1994). A "preferred time" in pregnancy for cranial neural tube closure may exist as dictated by the maternal environment. This "preferred time" might favor males, if they undergo neurulation earlier, in chronological terms, than females. A whole embryo in vitro study (i.e. absence of maternal environment) of either SELH/Bc or SELH/Bc X "CT strain" F embryos might help resolve the issue of existence of such a maternal, time-dependent constraint on 2  neurulation. Unfortunately the F study would require a very large number of embryos if the observed frequency of 2  exencephaly were to be observed again.  A third idea is that females and males differ in a specific aspect of the cranial neurulation process (Brook et al., 1994). The hypothesis suggests that, while there are no overall differences between the sexes that can account for the susceptibility of females to cranial NTD, there may be subtle differences in the process of elevating and fusing of the neural folds. Seller (1995) suggests that in humans, females fail more often in (anterior) closure sites where growth is required to produce neural folds large enough to elevate, overarch, oppose, and fuse, while the major failure which affects males surrounds sealing the anterior neuropore. It is known that all SELH/Bc embryos are delayed in the elevation of their mesencephalic neural folds (Macdonald et al., 1989) and that caudal extension of fusion from closure site 3 compensates for lack of closure site 2 (Gunn et al., 1995; Macdonald et al., 1989). Examination of differences in size of mesencephalic folds and/or angle of fold elevation relative to horizontal between male and female SELH/Bc embryos might be considered in future work.  Frequency of exencephaly vs. frequency of spina bifida  aperta  The greater proportion of F with exencephaly than with spina bifida aperta (3.2% vs. 0.4%, Table 4.4) suggests that 2  embryos in this cross are more susceptible to cranial than to caudal NTD. If the exencephaly and spina bifida aperta share similar pathogenesis, the increased frequency of exencephaly over spina bifida aperta suggests that this cross is more susceptible to early neurulation defects (i.e. cranial NTD) than late neurulation defects (i.e. lumbosacral NTD). Given the knowledge that SELH/Bc never exhibits spina bifida aperta, the proportion of exencephaly to spina bifida aperta in the F suggests that the SELH/Bc risk of exencephaly cannot also lead to risk of spina bifida 2  when combined with "CT strain" risk factors. 64  Spina bifida aperta F s 2  Table 4.3 shows that the frequency of flexed tail did not differ between the progeny of each of the "CT strain" sires which is consistent with the expectation that this trait is fixed in the "CT strain".  The observation of four F with spina bifida aperta in an F population of 758 F is in keeping with the predicted 2  2  2  range if there is independence of SELH/Bc and "CT strain" risk factors (if there are about three necessary risk loci that differ between the strains). Since all of these individuals have the CC genotype for SSLP markers tested at Chr 4, it is suggested that these individuals had spina bifida aperta because of homozygosity for a "CT strain" factor at this locus (ct/ct). Lack of deviation from random segregation of alleles or genotypes at Chr 17 offers no support for a difference between SELH/Bc and "CT strain" for the putative met 1 modifier gene here. Lack of observed excess of SELH/Bc alleles at the risk regions on Chr 13, 11, and 5 suggests that there is no detectable additive effect of SELH/Bc risk loci on spina bifida aperta. Therefore, although the sample of F with spina bifida aperta is small, 2  none of the outcomes of a substitution of and/or compounding factor model appear to be supported. A model of the cause of spina bifida aperta in the SELH/Bc X "CT strain" F is shown in Figure 4.9. 2  The male excess of the spina bifida aperta population of the "CT strain" (Embury et al., 1979) was not seen in the SELH/Bc X "CT strain" F with spina bifida aperta which were all female (see Figure 4.5 A). The significance of 2  the difference in sex bias seen is unclear.  This study is thefirstto look specifically at frequency of spina bifida aperta in an F generation from a cross with 2  the "CT strain". Linkage studies using the "CT strain" have been restricted to examination of newborns with focus on the flexed tail phenotype rather than spina bifida aperta (Beier et ai, 1995; Letts et ai, 1995; Neumann et al, 1994) most of which die at birth (Embury et al., 1979). By examining F progeny prenatally, a more accurate count 2  of spina bifida aperta can be obtained as newborns with spina bifida aperta would likely be cannibalized. The frequency of spina bifida aperta in this F cross is low (0.4%), about 1/20 of the frequency reported for the "CT 2  strain" itself. This low frequency suggests that the SELH/Bc strain has introduced modifiers at one or two loci that suppress the spina bifida aperta as has been previously reported for the flexed tail trait in backcross segregants from crosses to DBA/2J (Neumann et al., 1994). The very low frequency of spina bifida aperta (and low frequency of 65  X cu C  -a s ca ca  •c  cu O. ca co  T3  CO  _s 'EL  3 CO  CU  •a o E cu  JS H-»  o a. >.  JS  CO  E  cu  JS CJ  cu VH  3  (50  VO  flexed tail) in this F study suggests that a cross that involves SELH/Bc is not useful for linkage/mapping study of 2  these traits. It is possible that in this cross, spina bifida aperta requires homozygosity for ct on Chr 4 and some other critical number of "CT strain" alleles at other loci for the liability to be sufficiently high to have the potential for spina bifida aperta. Since there was no support for the presence of a modifier of curly tail on Chr 17 (or that it does not differ in SELH/Bc), additional risk might be afforded by other liability loci such as Chr 1,3,5, and 14 (Beier et al., 1995; Letts et al., 1995; Neumann et al., 1994). Unfortunately, with a sample of four F with spina bifida aperta, 2  the sample is too small to determine if non-random segregation of alleles on these chromosomes is occumng in the SELH/Bc X "CT strain" F s. 2  F embryo #306 is an interesting example of spina bifida aperta since its defect was located in the thoracic area (see 2  Figure 4.3). The reports on the "CT strain" report only lumbosacral spina bifida aperta (reviewed in van Straaten and Copp, 2001). The appearance of this defect in the area observed may be the result of the combination of differing neural tube closure systems. Perhaps SELH/Bc has introduced a generalized ability for compensatory closure from adjacent sites, which, in the case of F embryo #306 was "nearly successful" but resulted in the small 2  thoracic lesion observed. The closure initiation sites in "CT strain" have not been described fully and future work on the closure sites and progression of neural fold fusion in "CT strain" might be considered but justification of such a study based on the phenotype of a single unusual embryo might not be warranted. Appearance of this thoracic spina bifida is interesting because it is also seen in East-Indian Sikh cases of spina bifida aperta (Hall et al., 1988). Perhaps the study should be replicated to see if these thoracic lesions are common in this cross in order to see if it could be a model of the East-Indian Sikh cases of spina bifida aperta.  Flexed tail F s 2  The frequency of flexed tail in the F individuals was not a factor of the "CT strain" sire from which each individual 2  was descended (Table 4.4) which supports this trait being fixed in the "CT strain".  Observation of seven F individuals with flexed tail out of 758 F individuals is not far below the expected if it were 2  2  due to a combination of "CT strain" risk factors alone (predicted 9-57). The trend toward "CT strain" alleles at all SSLP markers tested on Chr 4 in the flexed tail F embryos is consistent with the presence of a major genetic 2  liability factor for flexed tail in this region, the region of the previously mapped ct gene (Beier et al., 1995; Neumann et al., 1994). In previous studies, homozygosity for "CT strain" alleles in this region does not appear to 67  be necessary and it is hypothesized that presence of "CT strain" alleles at other loci may be required for sufficient liability for manifestation of the flexed tail phenotype (Letts et al., 1995). By the genotypes at SSLP markers on Chr 4 all flexed tail embryos had at least one copy of the ct mutation, and at least five were likely ct/ct.  Excess of SELH/Bc alleles at DI 1MU288 and DI 1MU360 (due to a lack of CC genotype) suggests that this SELH/Bc risk factor may contribute to the risk of flexed tail in ct/+ and ct/ct embryos. A compounding effect from the SELH/Bc risk at Chr 11 to increase penetrance of flexed tail due to the "CT strain" risk at Chr 4 is weakly supported because the number of F with flexed tail is below the predicted range for F with flexed tail due to the 2  2  "CT strain" factors alone. Therefore, the excess of SELH/Bc alleles at Chr 11 may be coincidental. A model of the cause of flexed tail in the SELH/Bc X "CT strain" F is shown in Figure 4.9. 2  Frequency of flexed tail (0.6%, see Table 4.4) is low as compared to the only other reported "CT strain" F data 2  ("CT strain" X LIVA F2, 6.3% in Neumann et ai, 1994). As the flexed tail trait is strongly influenced by genetic background (Neumann et al., 1994) it is possible that the SELH/Bc background has introduced two to three "less permissive" modifiers for the flexed tail phenotype. A modifier locus, mctl, was reported to be located on mid Chr 17 between D17Mitl34 and D17MU11. The data here either does not support the presence of mctl on Chr 17 or suggests that the alleles of SELH/Bc and "CT strain" are equivalent in their effect on liability toward flexed tail (Figure 4.5). It is also possible that the low frequency of flexed tail detected in this F study is due to the definition 2  of flexed tail phenotype (fixed bend of at least 90 degrees), which perhaps excluded more subtle versions of the flexed tail phenotype. The original Gruneberg (1954) study of the stock leading to "CT strain" indicated a strong association between spina bifida aperta and flexed tail. This association is not absolute as eitherflexedtail or spina bifida aperta can occur in isolation (Gruneberg, 1954). Although spina bifida aperta is a defect of primary neurulation and flexed tail follows delayed posterior neuropore closure, the region of tail that is flexed is formed during secondary neurulation (van Straaten and Copp, 2001), who suggested that flexed tail occurs as a result of an abnormal transition from primary neurulation (successful but delayed closure of the posterior neuropore) to secondary neurulation.  Interpretation of the genetics of flexed tail embryos is difficult because of the small sample offlexedtail F s. Given 2  the low frequency of flexed tail observed, the SELH/Bc X "CT strain" cross does not appear to be a good choice for linkage analysis of the flexed tail trait. 68  The excess of "CT strain" alleles at D10MU237 (Figure 4.5) is curious as it has not been identified as a risk region for "CT strain" factors of NTD. It may be useful to follow up on this marker in "CT strain" modifier mapping in an independent study.  Evaluation  of other outcomes of the compounding factor model  There was only one F with exencephaly in combination with flexed tail (embryo #760). It was placed among the F 2  2  with flexed tail because both defects could have been due to the "CT strain" risk factor(s). However, its genotype at the risk regions suggest that it may be exencephalic due to the SELH/Bc factors at Chrs 13 and 11 and/or "CT strain" factors at Chr 4 (Figure 4.5 B). Presence of a single F out of 758 individuals with a combination of defects 2  from either strain is in keeping with the expected range for four loci if the SELH/Bc and "CT strain" factors were acting independently. The hypothesis that the presence of SELH/Bc risk factors for exencephaly would markedly increase the frequency of exencephaly in ct/ct with flexed tails or spina bifida to produce embryos with combinations of cranial and caudal defects was not supported.  No new types of NTDs (e.g. craniorachischisis) were observed in the F . Mole frequency in the F was also 2  2  extremely low (Table 4.5). Therefore the presence of additive negative effects of factors from SELH/Bc and "CT strain" risk regions on neural tube closure is not supported.  69  CHAPTER V:  I.  Frequency of exencephaly, spina bifida aperta, and flexed tails in afirstbackcross of (Normal BXA-7/Pgn X "CT strain") X "CT strain".  Introduction  All previous studies used segregants observed postnatally, scoring for only the flexed tail trait (all the exencephalic and most of the spina bifida pups die at birth) andfinemapping of the ct locus has been thwarted by expression of the flexed tail trait in some ctl+ heterozygotes (see Chapter 4). Based on the hypothesis that the more severe trait, spina bifida aperta, would occur only in ct/ct homozygotes, D.M. Juriloff and M.J. Harris conducted a backcross experiment, crossing the "CT strain" with the BXA-7/Pgn strain and backcrossing to "CT strain" tofindout if the frequency of spina bifida aperta prenatally, was high enough to be used forfinermapping of the ct locus. The BC| data are presented here.  II.  Materials and Methods  M.J. Harris and D.M. Juriloff conducted all matings and data collection for this chapter. Two "CT strain" males and two BXA-7/Pgn females were used. The history of the "CT strain" is reviewed in Chapter 1 and the BXA7/Pgn strain is described in Chapter 2. F i individuals were created and F i females were backcrossed to "CT strain" males.  Animal care and collection of E14 embryos was as described in Chapter 2.  Criteria for definition of exencephaly, spina bifida aperta, and flexed tail were as described in Chapter 2.  III.  Results  A total of 88 BCi embryos were obtained (Table 5.1). The overall percentage of affected embryos was 19% with 1% with exencephaly and flexed tail, 1% with spina bifida aperta with flexed tail, and 17% with isolated flexed tail (Table 5.1).  70  IV.  Discussion  The frequency of BC, embryos with exencephaly, spina bifida and flexed tail in isolation or in any combination is much higher than that observed in the SELH/Bc X "CT strain" population of F embryos (19% vs. 4.6% see tables 2  5.1 and 4.4). Difference in the frequency of NTD might reflect an increased risk of NTD due to mostly "CT strain" factors acting additively in the BCi in comparison to risk from "CT strain" factors acting with SELH/Bc factors in the F . The frequency of flexed tail in the BC, embryos (17%) is similar to that observed in a backcross between 2  "CT strain" and C57BL/6J (12.0%-18.5%) (Neumann et al., 1994). C57BL/6J is thought to differ from the "CT strain" by only the ct locus, with respect to NTD liability.  The "CT strain" has 3% exencephaly, 10% spina bifida aperta, and 50% flexed tail (van Straaten and Copp, 2001). Since a 50% of a first backcross individuals are expected to be like the "CT strain" at the ct locus, this sample would be expected have approximately one exencephalic (3% of 44), four spina bifida aperta (10% of 44), and 22 flexed tail (50% of 44). Therefore, the observed frequencies of one exencephaly (with flexed tail), one spina bifida (with flexed tail), and 15 flexed tail alone do not differ much from the prediction and suggest that in the cross to BXA7/Pgn the risk for these defects from the "CT strain" is due only to the ct gene.  An important observation was the occurrence of exencephaly in combination with flexed tail in one of the affected embryos, supporting the interpretations that the exencephaly of the "CT strain" is may be due to the ct gene. The genetic cause of exencephaly in the "CT strain" has not been formally studied previously.  This panel could perhaps be used in combination with previous crosses to the "CT strain" to refine the map position of cf on Chr 4 using a panel of embryos displaying isolated spina bifida aperta, isolated flexed tail or spina bifida aperta with flexed tail. By using a backcross panel of affected individuals, an estimate of the best position of an SSLP linked to the causative gene is found at that SSLP for which the majority are homozygous for the "CT strain" allele. However, this backcross has the same problem as the Neumann et al. (1994) study where ct/+ may be affected. Therefore, recombinants cannot be distinguished from affected ct/+ andfinemapping cannot be done with certainty. In addition, the panel could also be used to more finely map the location of Mlp relative to other SSLP markers on Chr 4 as it is known to be informative in this cross.  71  Table 5.1. Frequency of exencephaly, spina bifida aperta, and flexed tail in a first backcross of (BXA-7/Pgn X "CT strain") Fj females X "CT strain" males. # of litters 9 # of scoreable embryos 88 mean litter size 9.8 # of moles (%) 2(2) #NTD(%) 17(19)* exencephaly and flexed tail (%) 1 (1.1) exencephaly (%) 0 (0) spina bifida aperta with flexed tail (%) 1 (1.1) spina bifida aperta (%) 0 (0) flexed tail (%) 15(17) # of normal (%) 71(81) * Significantly greater than 4.6% NTD observed in F of Chapter 4 (P<0.05, % goodness of fit, 1 degree of freedom). 2  2  72  CHAPTER VI: Mapping Mlp relative to well-mapped SSLP loci and determination of plausibility of Mlp as a candidate gene for ct on Chr 4, using individual F embryos from the SELH/Bc X "CT strain" cross 2  I.  Introduction  Mlp (MARCKS (myristoylated alanine-rich C-kinase substrate)-like protein) is a substrate for protein kinase C. Mlp is also known as F52, MacMARCKS, or MARCKS-related protein. The mouse gene was originally called Mrp (for MARCKS-related protein; (Lobach et al, 1993) but was renamed Mlp (MARCKS-like protein) due to the confusion of Mrp with the multi-drug resistance element-related protein also known as MRP (Stumpo et al., 1998). It shares structure and many biochemical features with MARCKS in having 3 domains: an N-terminal myristoylated domain that mediates binding to membranes, a highly-conserved MH2 domain of unknown function, and a basic domain containing the PKC phosphorylation sites and a calcium/calmodulin binding site (Wu et al, 1996). The basic domain of MARCKS contains an actin binding site, however such a site has not been established in Mlp. The PKC-dependent phosphorylation of MARCKS alters its ability to bind calcium/calmodulin and actin and controls its localization to different cellular compartments. Mlp, MARCKS, and GAP43 are unique in that they have a single domain that responds to extracellular signals (via PKC) and affects internal cytoskeleton events (via actin). Mlp and MARCKS differ in their subcellular distribution before and after activation by PKC and presumably have distinct functions.  A transgenic mouse bearing an Mlp promoter and Mlp fused to LacZ showed expression of MLP protein as early as E8.5 in the developing neural tube (Stumpo et al, 1998). This expression remained high after neural tube closure and during development of the brain, spinal cord, and cranial and peripheral nerves (Stumpo et al, 1998). Mlp is thought to be important for normal neural tube development because it is thought to mediate cytoskeletal change by integrating extracellular and intracellular signals that regulate morphogenesis.  A cDNA encoding human MLP was identified (Umekage and Kato, 1991). An insert of a plasmid of MLP has been used to screen a mouse NIH 3T3 genomic phage library (Lobach et al, 1993). Positive clones were purified, subcloned, and sequenced and DNA fragments were then used probes for restriction fragment length variants for chromosomal mapping on an interspecific cross (C3H/HeJ-gld X M. spretus) Y X C3H/HeJ-gld). Using these {  restriction fragment length variants, Mlp was mapped to distal mouse chromosome 4 (Lobach et al, 1993). The most likely gene order was Lmyc—14.0 + 3.3 cM—MlplLck—6.1 + 2.3 cM—Akp-2.  73  Mlp null mice have been created by two groups of researchers and these mice display neural tube defects. One Mlp knockout mutation leads to non-syndromic neural tube defects including isolated exencephaly, isolated spina bifida, exencephaly with spina bifida, as well as flexed tail (Wu et al., 1996). This knockout mouse displayed incomplete penetrance with 63.1% of Mlp -I- individuals of this study exhibiting neural tube defects (45.6% isolated exencephaly, 3.5% spina bifida, 10.5% exencephaly with spina bifida, and 3.5% flexed tail) (Wu et al., 1996). 11.8% of the Mlp +/- embryos displayed neural tube defects (7.8% of isolated exencephaly, 2.0% isolated spina bifida, and 2.0% exencephaly with spina bifida (Wu et al., 1996). Sex bias was not examined in this study. Mlp -/individuals that were born without exencephaly survived to adulthood but displayed brain abnormalities such as reduced size, enlarged ventricles, and absent corpus callosum (Wu et al., 1996). In contrast, another Mlp null mouse created by Chen et al. (1996) showed 100% penetrance in Mlp-/-, all of which had, exencephaly. In the Chen et al. (1996) experiment, Mlp+I- individuals had no observable abnormalities. The cause(s) of these differences in Mlp -/phenotype is unclear since both groups used similar targeting vectors that replaced the coding region of Mlp with the neomycin gene under control of the promoter of the mouse phosphoglycerate kinase-1 gene. These differences might include a) differences in original genomic DNA clones from which Mlp was isolated; b) differences in ES cell lines (Wu et al (1996) used D3 ES cells, Chen et al., (1996) used Jl ES cells); or c) background strain differences (Wu et al. (1996) used C57BL/6 mice and Chen et al. (1996) used C57BL/6J X 129/Sv).  Since Mlp has been provisionally placed within the chromosomal region to which ct has been mapped and one Mlp knockout mutation displays similar types of NTD as "CT strain", it seemed possible that Mlp is a candidate gene for ct. Mlp is of particular interest as there are very few mouse mutants with spina bifida aperta (reviewed in (Juriloff and Harris, 1998; Juriloff and Harris, 2000, see also Table 1.3). Therefore, it was decided to map Mlp in relation to SSLPs in the SELH/Bc X "CT strain" F cross and to determine if the Mlp allele from the "CT strain" could be 2  responsible for spina bifida aperta and tail flexion defects seen in this cross.  74  II.  Materials and Methods  Linkage analysis of D4Bcl(Mlp)  in relation to Mit SSLP markers on Chr 4  Mice were acquired and cared for as outlined in Chapter 2. Creation of SELH/Bc X "CT strain" F was conducted 2  as described in Chapter 3. Three entire F litters were used for mapping purposes and to check that Mendelian 2  segregation of alleles was occurring at the regions tested.  SSLP markers used SSLPs used for mapping Mlp include D4MU279, D4Bcl, D4MU65, D4MU232, and D4MU33. PCR conditions for these SSLPs are outlined in Table 4.1. D4BC1 is a (CA) repeat, 800 bp 5' of the potential transcription start site of 28  the mouse Mlp gene (Stumpo et al., 1998). Primers to amplify D4BC1 were 5'TACTTAAACATCTCTGCGCC3' (forward) and 5'CACAACCTAAATCCATCACCA3' (reverse) as designed by M.J. Harrisfroman unpublished genomic sequence for Mlp provided by D. Stumpo. The PCR product was found to differ between SELH/Bc and the "CT strain" and was used as a marker of Mlp in the F segregants of the SELH/Bc X "CT strain". PCR was 2  conducted and the products visualized as described in Chapter 2. To check that the alleles were segregating randomly, a x test for deviation from a 1:2:1 ratio (CC:CS:SS) was conducted. Determination of the order of 2  markers was determined by arranging them in the order that minimized the number of breakpoints. Distances between loci were estimated by D.M. Juriloff who used the Map Manager QTX software (version bl 1 5/16/01) with the Kosambi correction formula for double crossovers.  Is Mlp a candidate gene for ct? The F embryos with flexed tail and spina bifida aperta described in Chapter 3 were used to determine if Mlp could 2  be excluded as a candidate gene for ct. This group of F s were used because their phenotypes are attributed to genes 2  originating from the "CT strain" including ct. The percentage of these F segregants that had the CC genotype had 2  been calculated for various SSLP markers on Chr 4 in order to identify the SSLP marker most closely linked to ct.  In order to determine whether Mlp could be excluded by its map position as a candidate for ct, all F embryos 2  bearing either a flexed tail and/or spina bifida were analyzed for the SSLPs mentioned above. Descriptions of tail flexion and spina bifida aperta are defined in Chapter 2.  75  Table 6.1. SSLP markers used for the mapping of Mlp in 3 entire SELH/Bc X "CT strain" F litters including PCR conditions and estimated product sizes for SELH/Bc and "CT strain" 2  Marker D4MU279 D4BC1 D4MU65 D4MU232 D4MU33  [MgCl ] (mM) 3.5 1.5 3.5 1.5 1.5 2  T anneal C Q  55 55 Hot start 55 Hot start 55 Hot start 55  76  Allele size (bp) SELH/Bc "CT strain" 135 145 180 200 145 . 135 140 125 145 140  III.  Results  Linkage analysis of D4BC1 in relation to Mit SSLP markers on Chr 4 No significant deviation from the 1:2:1 ratio (CC:CS:SS) was seen in any of the SSLPs tested on chromosome 4 in the 3 pooled litters (see Table 4.2). The types of genotypes seen and the number of embryos of each genotype is presented in Figure 6.1. Placing the SSLPs in the order that minimizes the number of breakpoints resulted in the following sequence: D4MH279—2A 2.4 cM—D4Mit33  ± 1.7cM—Mlp—16.3 + 4.9 cM—D4MU65—2.4 + 1.7cM—D4MH232—4.9 +  (MGI:1934123)  Is Mlp a candidate gene for ct? Segregation of alleles in the F embryos with flexed tail and/or spina bifida aperta is presented in Figure 6.2. In both 2  the flexed tail and spina bifida aperta F s, there was a trend toward excess of "CT strain" alleles at all of the loci 2  tested. The order of the loci based on the 'minimal breakpoints' strategy in the flexed tail/spina bifida aperta subgroup of F s (Figure 6.2) is consistent with the order deduced from the three pooled F litters. The percentage of 2  2  CC genotype at each SSLP tested in the F embryos with spina bifida aperta and/or flexed tail is also presented in 2  Figure 6.2. The SSLP marker with the highest percentage of the CC genotype was D4MU65 and not Mlp.  IV.  Discussion  The order of SSLP markers found in this study is the same as what is reported by MGD(2001). Our estimation of interval distances differ somewhat from MGD, notably by estimating a larger distance between Mlp and D4Mit65 (16.3 + 4.9 cM vs. 10.8 cM) and a smaller distance between D4MU232 and D4MU33 (4.9 + 2.4 cM vs. 8.0 cM) (Figure 6.1). However, the overall distance between D4MU279 and D4MH33 is quite similar for both data sets (26.0 cM for our data vs. 21.2 cM for MGD). Therefore, the placement of Mlp in relation to SSLP markers in the following order is not unreasonable: D4Mit279-(2A ± 1.7 cM)-Mp-(16.3 + 4.9 cM)-D4Mit65-(2A ± 1.7cM)D4Mit232-(A.9 + 2.4 cM)-D4Mit33. Mlp-(14.6 cM)-D4Mit65-(2A  The interval distances without Kosambi's correction are: D4Mit279-(2A cM)-  cM)-D4Mit232-(4.9 cM)-D4Mit33 (overall distance = 24.3 cM) which is not very  much different than that with the correction factor (see above) and is therefore not the reason for the difference in overall interval distance between our data and that reported by MGD. It should be noted that the distances on the MGD map represent a composite of independent studies, and that Mlp previously has not been mapped directly against SSLPs.  77  o  02  PC HJ  w <V>  «N  oo  Cr>  eri  co  § I I i«J  "t~*  J O  r<  ^  q \  q  q  ^  4 3  2  CD  i  4 3  3  o 4 3  p. .!2  MM ESS ESS ES3. ESS MM UM UM ESS ESS ES3 UU mu mm UM • i mm mm MU • i  ESS  oo  o o S o o c  CN  cn cn  o o O, CD . >  >H T 3  •  CD  o o  •  CN  a <HHH  o  >  lH CD  v- -S  in  o  Q  " U  00 s_  o  >  ca  CN  00  CD  a o a  CD  C > ofj  GO  o  ESS  1a GO GO  CN  O CO  •3 °  h< &o  U  CH  X  O 3  a  oo  oo  _2  O  C H  CD  CD  O 40  g  I CO  » -a  "3  CN  00  ©  CN  ©  od  CN  o \  O CH CD CD  CN  ^ O °° °°. ^ 5 ^ as o o m m ^sO r-o \  3  •S  CO  vo ^ . ^ CN  CH  O 3 CD OX)  CH ^ O  3  <H °  CN  &H ~  ^s  cn  ^. CN  CD  •3 -S 8S CD  o  CH _ >  "CD  ESS • CD • r~I ESS ESS UM • ESS SS ESS • ESS ESS ESS CD •  Q O  ^H-  is is  •  Q  «  t <»  ESS ESS UM  HJ  00 PH 00 H J  •  T t  CN  CS  ~ 3 VO cn CD  H  E3 P X 00 -  •a  tu X cu  o  •e cu  Q.  00  CN  rH  00  c3 C3 T3 C  LS CO  CN  .S  350 E g g E5S [SS 7 6 0 a [_• [SS [SS 05 B5g 510 (§3 [SSI CD CD 268 CD o n n ess 644 • • 181 CD •  HH  A  pq  Xi  U c o  ca  C/! CO  729 • 414 CD • 306 231 C Z I s1  •  a  s1  <  •  •  [=• • __V  •  _EJ  * Q. 4<  Cw  CJ  o  C  CU  I  I  [SS  X  cj cS  B  CO  it? q  CU  cu xi ca 2 CO  ^  ^  m xn O xn  O O  q  1 X> C CH  = CO 7  3  X  co cu J3 tw •tt co  co  ^ X! ^ —  '3 H  y o PQ  ^  Q  2  2  ^  00  > s O  —J  00  w  0\ ON ON I^)  vO  h  CO OH  §  ^  <  N—'  O >co £  cu ^  ° -£? 2 cu C rn IU <"! U C  a  s=  Table 6.2. Observed ratio of CC:CS:SS genotypes and * analysis ofjoodness offitto£2:1ratio of genotypes at D4MU279, Mlp, D4MU65, D4MU232, and D4MU33 .n 3@® pooled l.tters of SELH/Bc X CT strain" F embryos. P value X value for goodness offitto Observed ratio of Position (MGD Marker expected ratio of 10.5:21:10.5 CC:CS:SS value, cM) n.s. 0.43 10:23:9 57.8 D4MU279 n.s. 0.048 11:21:10 59.0 Mlp n.s. 4.24 7:24:11 69.8 D4MU65 n.s. 2.57 7:26:9 71.0 D4MU232 n.s. 3.13 79.0 6:26:10 D4MU33 ^includes 2 embryos with exencephaly and 1 with tail flexion C = allele from "CT strain" S = allele from SELH/Bc strain 2  2  2  80  The gene ct is thought to map between D4Mitll(51AQ  cM) and D4MU14 (78.5 cM) (Letts et al, 1995) close to  D4MU69 (63.40 cM; (Beier et al., 1995). Neumann et al. (1994) place ct 3-4 cM proximal to D4Mitl3  (71.00 cM).  In relation to the markers used in this study, ct is most likely to be between Mlp (59 cM) and D4MU65 (69.8cM) (Figure 6.1). Although there was no SSLP on Chr 4 for which the entire group of SELH/Bc X "CT strain" F with 2  spina bifida and/or flexed tail had the CC genotype, there was an excess of CC genotypes (Figure 6.2). Since the ct gene is thought to behave semi-dominantly in some cases (Estibeiro et al., 1993; Neumann et al., 1994), it is reasonable to suppose that an affected F could be heterozygous at the position of ct. In theory, an autosomal mostly 2  recessive gene with a low frequency of expression in heterozygotes should exhibit maximum proportion of affected embryos homozygous at markers close to the gene locus and this proportion should decrease in a predictable manner at markers that are further away from the gene locus. Therefore, the maximum percentage of embryos with a CC genotype would suggest that the location of ct is more closely linked to D4MU65 (81.8% CC; Figure 4.3) than to Mlp or any of the other SSLPs tested on Chr 4.  No nucleotide sequence differences from normal within the protein-encoding regions of Mlp cDNA from "CT strain" were detected (Wu et al., 1996). Together, these observations do not support the hypothesis that Mlp is a candidate for ct.  In addition, Stumpo et al. (1998) identified a polymorphism (MLP1) in human genomic MLP, which was used to screen DNA from multiple families with lumbosacral myelomeningocele (spina bifida). Analysis of the transmission disequilibrium test showed no evidence of linkage disequilibrium between alleles at this locus and the phenotype suggesting that MLP is not a major gene for the phenotype in these families (Stumpo et al., 1998).  It is curious that of the very few mouse models of nonsyndromic spina bifida aperta, Mlp and ct map close together on the same chromosome. This observation leads to the speculation that the Mlp knockout generated by Wu et al. (1996) altered both Mlp and some other sequence vital for ct expression. If the knockout created by Wu et al (1996) interfered with ct expression, then perhaps that lack of ct expression could account for the observed spinal NTDs seen in these mice. In order to test this hypothesis, it will be necessary to sequence the ct gene when sequence becomes available, in Wu et al.'s (1996) Mlp null mice.  81  Several other candidate genes have been considered for ct including Hspg2, Synd3, Fgr, Cdc2ll, Pax7, and Glut7(Neumann et al., 1994) and these have been discussed in Chapter 1.  Often the map positions shown for spontaneous mutations on the current MGD composite map are in error within 10 cM from their actual position (D.M. Juriloff, personal communication). Approximately 129 genes have been assigned to within 10 cM of the current position of ct (MGD). Many of these genes could be considered candidate genes and other gene loci will be identified. Included in the 129 genes mentioned above is Mthfr (methylene tetrahydrofolate reductase), which has been implicated in risk of NTD in humans (Christensen et al., 1999). Although a list of these genes can be constructed and the candidacy of each gene discussed based on expression domain and/or phenotype data, it might be a better strategy to further refine the region to which ct is thought to map (within lcM) in order to more reasonably adopt a candidate gene approach.  82  CHAPTER VII: To define more clearly the liability regions for exencephaly in SELH/Bc on chromosomes 5, 11, and 13 using DNA from a previous study (Gunn, 1996).  I.  Introduction  In an earlier work, the SELH/Bc strain was crossed to the normal LM/Bc strain and frequencies of exencephaly were observed in the F BC], and F generations (Gunn, 1996; Juriloff et al, 2001b). 102 F males were individually test h  2  2  crossed by SELH/Bc females, with about 100 progeny each. The ten highest ("high-risk") and ten zero ("low-risk") exencephaly-producing F sires were typed for 109 informative SSLP marker loci in a genome screen. Following 2  data analysis for the "high-risk" and "low-risk" F sires where chromosomal regions most likely to carry 2  exencephaly-liability loci had been identified, a set of 31 exencephalic F embryos was used to test if these linkages 2  were also apparent in a second data set. Exencephalic F embryos, like the "high-risk" F sires, are expected to carry 2  2  most (but not necessarily all) of their alleles from SELH/Bc at the liability loci. The 31 exencephalic F embryos 2  were typed for SSLPs on the chromosomes that had been indicated to carry exencephalic liability loci in the analysis of "high-risk" and "low-risk" F sires. 2  The X chromosome had been omitted from the original genome screen. T. Gunn had typed only markers from Chrs 13, 10, and 2 in the F exencephalic embryos and the data supported the interpretation of risk alleles in SELH/Bc 2  only for a region of Chr 13. As there was clear evidence of involvement of more than one locus, there were one or two other regions to be found. Re-analysis of the data from the genome screen of "high-risk" and "low-risk" F sires 2  indicated that the regions mostly strongly associated with SELH/Bc risk of exencephaly, in order of strength of association, were marked by D10MU164,  D13MU39, D5MU168, DllMitlO,  and D17MU10 (Juriloff et al., 2001b).  Subsequent analysis had found no association between the Chr 17 region and exencephaly in the F embryos 2  (Juriloff, et al, 2001). My project was to test for a contribution of the Chr 5 and Chr 11 regions to exencephaly risk using the 31 F embryos. I also used this F set to refine the definition of the position of the risk locus on Chr 13. 2  2  Here I present my contribution to the genome screen of "high-risk" and "low-risk" F sires (X chromosome screen), 2  and my data for SSLPs on the 31 exencephalic F s on Chrs 5, 11, and 13. 2  83  II.  Materials and Methods  "High-risk"  and "Low-risk"  SELH/Bc  XLM/Bc  F sires 2  I received aliquots of DNA from the F "high-risk" and "low-risk" sires and F exencephalic embryos from Dr. 2  2  Juriloff. The F sire identification numbers are listed in Table 7.1. The SSLPs used to extend the genome screen for 2  F sires were DXMU73 (19 cM), DXMU16 (37 cM), DXMU80 (65 cM) and the conditions for PCR of these SSLPs is 2  shown in Table 7.2. In "high-risk" sires, genomic regions surrounding genes that contribute risk of exencephaly are marked by SELH/Bc alleles (S) and, in "low-risk" sires, these regions are marked by LM/Bc alleles (L). For the 20 sires, there are 20 copies of alleles on the X chromosome. For X-linked loci in F sires, the random allele 2  frequencies are 10S:10L. "Provisional" exencephaly gene regions were those that had allele frequencies deviating from random at a P value of <0.05.  Exencephalic  SELH/Bc  X LM/Bc  Fs 2  I received aliquots of T. Gunn's DNA for the 31 exencephalic F embryosfromDr. Juriloff. Following typing of 2  SSLP markers that had been identified as marking provisional exencephaly gene regions in the genome screen of "high-risk" and "low-risk" sires by Diana Mah in our laboratory, the 31 exencephalic F s were typed by me for 2  additional nearby informative SSLPs to further define the exencephaly gene regions. The SSLPs used for this DNA were D5MU95 (68.0 cM), D5MU122 (68.0 cM), D13MU91  (93.0 cM), D11MU14  (30.0 cM), D13MU13  (57.0 cM), Crhr (62.0 cM), D11MU258  (35.0 cM), and D13Bcl  (65.0 cM), Itgb3  (Lect2) (37.0 cM) using the conditions  described Table 7.3.  The SSLP in the leukocyte cell-derived chemotaxin 2 gene, Lect2, was newly discovered in our laboratory from genomic sequence (GenBank No. AB009689). Forward primer 5'TATGCATGGCCAGTCCCTC3' and reverse primer 5'ATGTCCTCTTGCACACAGGA3' were designed by M.J. Harris to amplify an approximately 100 bp region in intron 3 of the Lect2 gene which includes a (GT) repeat. Primers were made by NAPS and used under 2)  our laboratory's standard PCR conditions. The size of the amplified region was found to differ between SELH/Bc (95 bp) and LM/Bc (105 bp). The new SSLP is named  DBBcl.  The SSLP markers that had been previously typed by T.Gunn or D. Mah included: D5MU158, DI IMitIO, D13MU39,  D13MU193,  and  D13MU76.  84  A random or Mendelian segregation of alleles would predict a 1:2:1 ratio of SS:SL:LL genotypes where S represents SELH/Bc alleles and L represents LM/Bc alleles.  Combinatorial  Genetics  Since the risk of exencephaly in this data set comes from the SELH/Bc strain and the risk of exencephaly in SELH/Bc appears to follow additive genetic inheritance, the combined number of SELH/Bc alleles for the SSLP markers that showed statistically significant deviation from 1:2:1 ratio of genotypes was tabulated for each embryo. The relationship between percentage of exencephalic F embryos and each possible sum of SELH/Bc alleles at these 2  SSLP loci was graphed in order to further examine the combinatorial effect of SELH/Bc alleles.  Percentage of embryos with the homozygous SELH/Bc (SS) genotype at each SSLP marker was also calculated because the best location of a liability locus in an F is at that SSLP for which the majority of affected embryos is 2  homozygous for the risk strain allele.  85  Table 7.1. "High-risk" and "low-risk" SELH/Bc X LM/Bc F sire identification numbers (T.M. Gunn thesis). 2  "High-risk" F sires  "Low-risk" F sires  2  2  317  321  911  385  930  549  388  598  943  614  307  841  323  855  320  869  306  908  310  944  Table 7. 2 SSLP markers on the X chromosome, typed to complete the genome screen of SELH/Bc X LM/Bc F "high-risk" and "low-risk" sires (Gunn, 1996), including PCR condition, and estimated allele sizes for SELH/Bc and LM/Bc. 2  Marker DXMU73 DXMH16 DXMU80  Position (cM, MGD)  [M Cl ] (mM) g  T  2  anneal  CC)  Allele size (bp) SELH/Bc LM/Bc  19.00  1.5  55  110  120  37.00  1.5  55  90  120  65.40  1.5  55  140  145  Table 7. 3. SSLP markers on Chrs 5,11, and 13, typed in the 31 exencephalic SELH/Bc X LM/Bc F embryos (Gunn, 1996), including PCR conditions, and estimated allele sizes for SELH/Bc and LM/Bc 2  Marker D5MU95 D5MU122 D11MH14 D11MU258 D13MU91 D13MU13 D13BC1 (Lect2)  Position (cM, MGD)  [MgCl ] (mM)  68.00  1.5  55  135  130  85.00  1.5  55  160  165  52.00  2.5  55  140  150  65.00  1.5  55  180  185  30.00  1.5  55  100  110  35.00  2.5  55  95  105  37.00  2.5  55  95  105  2  86  T  anneal  (°C)  Allele size (bp) SELH/Bc LM/Bc  III.  Results  "High-risk" and "Low-risk" SELH/BcXLM/Bc  F sires 2  Genotypes for X-linked markers in the "high-risk" and "low-risk" F sires are presented in Figure 7.1. There was no 2  support for deviation from random segregation of alleles for any of the SSLPs tested for the X chromosome.  Exencephalic SELH/Bc X LM/Bc F s 2  Genotypes for the 31 exencephalic F s are shown in Figure 7.2. 2  Chr 5 Deviation from expected ratio of genotypes was seen at D5MU95 (PO.05) and D5MUI68 (PO.025) due to an overrepresentation of SELH/Bc alleles. There was no SSLP marker for which the entire population was SS. The maximum percentage of embryos with the SS genotype was at D5MU95 and D5MU168 (42% Figure 7.2). Chr 11 No significant deviation from random segregation of alleles was seen for the Chr 11 SSLPs tested (x values range 2  from 0.8 to 5.5, P>0.05). The maximum percentage of embryos with the SS genotype occurred at DllMitlO Figure 7.2). There was a trend toward excess of SS genotypes, with a maximum at  (42%,  DllMitlO.  Chrl3 Deviation from expected ratio of genotypes was seen at all SSLP markers tested on Chr 13 (P <0.01 for D13MU193 and DI3MH76, P<0.001 for D13MU91, D13MU13, D13Bcl{Lect2), and D13MU39, Figure 7.2). There was an overrepresentation of SELH/Bc alleles at all of these SSLP markers (P<0.005 for D13MU193, D13MU76, and P O.001 for D13MU13, D13Bcl(Lect2),  and D13MU91). The maximum percentage of embryos with the SS genotype on Chr  13 was observed D13MU13 and D13Bcl (51.6%, Figure 7.2). All embryos had either and SS or SL genotype at D13MU13 and Dl3Bcl.  Combinatorial Genetics The exencephalic SELH/Bc X LM/Bc F showed most significant deviation from 1:2:1 ratio of genotypes at 2  D5Mit95, D5MU168, and all SSLP markers on Chr 13 (Figure 7.2). D5MU168 and D13MU13 were selected as  87  cu  40  E s cu  CO  vo vo CO  _eu  73  o  CO  CD VH  • i—(  co  CN  co I  o  944 908 869 855 841 614 598 549 385 321  mm mu mm  s  PJPJ m  J  II  UM UM MU CD  _cu~  73 73 o  CD CD CD • i UM CD UM MU CD CD CD CD  W  II  MU UM MU  o  CD CD CD CD CD CD  co  o 4=  o  X cu  c o  CO  CN  CO  • ^H VH  l  -r  vb  Tf'  vb*  oo oo o  •  •  •  CD CD CD CD •  urn  60  X  • CD CD CD CD urn  <v> vo  Q O  •*-«( Oo  i-o  t«a  lH o  o  pa  w CO  0  t\  o  K-l CO  t«i  3  O  H l-H  cS  CO  cu  ft  o  cn vo  pe  tu  • f-H  vp  o & CU o a3 en  CO  943 930 911 388 323 320 317 310 307 306  ^  6 0 CO  t-^ •+-» cu CU i—t  > 3 60 o  fc  40  CS  00 00  OO =tt  OO OO  oo  in CN CN i n cn p  rH  rr  u CN  ON  fN  oo cn  l-H  cn  rH  o  r-H  f N  f N  cn  cs m  rH  f> rH  i—( ON  V!  • • VO • • vb  rH  rH  • • f •N •  CO O CN* CN 00* od cn cn cn  p  p  CN cn o cn  vo cn  o  cn  '—  m cn  NO  1  CN o  ON  ON  •  VO  rH  r-I  in  OO 0 0 ^- ^ "  cu  cu  cu  cu  -o -a  ° _e  in  h  h  in  r  TT  T t  TT  s ~  r-"  tin i r ' r - ' o \  ON  «n  ON  (  rH  m  CU  CU  CU  CU  CB  CN CN  in  VO  VO  in in  cn  ir;  in  in  in  U  Q  fe s  JJ § lj 3  W  m  o 03 X )  cn  l-H  I  oo  OO  MM  ES H  "3-  NO  (X 't  CN CN CN  • •  25 ^ E S E S 05 1=1 L Z l L Z l 18 E S E S E S ES ES 03 22 L Z l LZI CD 29 B S E S E S 17 E S E S E S 21 MM[§g E S 31 B S E S E S 14 B S E S E S 08 ™ MM MM 27 E S MM MM • i 10 E S 15 • • • 1 CD 01 • E S ES 02 B S 06 B S E S E S 20 B S E S E S 12 L Z l • 1 09 E S E S E S 04 • MM MM 19 • MM 16 ™ 30 • E S E S 26 • 13 " • 1 MM 23 B i CJ L Z l  cn  •^t  ES ES  rH  rH  rH  rH  rH  i^H  ©  O  rH  fT}  rH  I  E S B S LZl LZl  I E S B S E S LZl B S  —1 T3 u W c t/5 O.  Jr. o IU o o V  CM  B S E S B S LZl B S B S BS ES BS ES  ES ES ES BS BS  h  i-H  ES ES  LZl E S B S E S  ES ES H  n  ES ES  O  o ©  CD E S  v  ES ES ES ES  OH  ES ES ES BS ES  BS BS BS ES BS BS  ES ES ES ES BS  ES BS ES ES ES ES  S©  BS BS M  ES BS ES ES ES ES  C3  H  H  BS ES  BS BS BS BS BS BS  MM•  1  • •  •I H  MM  CD CD E S  ES ES ESBSLZI • i MM MM H HI  UM MM • 1 • • MMH  •  LZl •  Hi  H  H  H  LZl LZl  ES ES ES ES BS LZl  •CD CD  CD CD B S  LZl •  LZI LZI  LZl LZl LZl  ES ES BS ES BS ES ES BS ES BS CZI L Z l L Z l L Z l L Z l  LZl LZl •CD CD CD L Z l L Z l  ES ES ES ES ES ES ES ES BS ES ES  H  MM MM MM MM MM  BS ES BS ES BS ES ES ES ES ES ES  \y 'o  BS BS ES BS  BS BS  MM MM MM E S E S B S • MM MM MM E S E S • I MW MM MM E S E S B S H i MM MM MM MM MM MM MM MM MM E S • MM MM MM MM B S MM MM MM MM MM B S MM MM MM MM MM B S  H  S*  co u-> CJ  ©.  M ©  ON  S PH a«  CH  oo  B  J o cd cu  CNT3 IH  CQ o  ^ *s i 'a o X CQ '«  ~-i  CO  fe '3  LZl  ^3  ES  -C  ES ES ES ES BS  ©  co ra«>© c3 a. cj ° ^ r" C  being most closely linked to SELH/Bc risk regions because these markers also had the maximum percentage of SS genotypes. The sum of SELH/Bc alleles at D5MU168 and D13MU13 was tabulated for each of the exencephalic SELH/Bc X LM/Bc F s. The relationship between percentage of exencephalic SELH/Bc X LM/Bc F with a sum of 2  2  0, 1,2, 3, or 4 SELH/Bc alleles across the two loci is presented in Figure 7.3.  IV.  Discussion  "High-risk  " and "Low-risk " SELH/Bc  X LM/Bc F sires 2  Existence of an exencephaly gene on the X chromosome is not supported due to lack of significant deviation from random segregation of alleles for SSLP markers spanning the X chromosome. This finding is not surprising because a risk gene on the X would lead to either an over-representation of affected males or inviability of males, which is not seen in the SELH/Bc strain.  Exencephalic  SELH/Bc  X LM/Bc  Fs 2  Chr 5  Deviation from the expected ratio of genotypes at D5MU95 and D5MU168 due to an excess of SELH/Bc alleles in the form of an excess of SS genotypes supports existence of an SELH/Bc gene contributing to risk of exencephaly more closely linked to these markers than to D5MU122.  At the present time, it is premature to speculate which genes that have been mapped to this region might be good candidate genes for the SELH/Bc risk of exencephaly here.  Chr II  The lack of significant deviation from random segregation of genotypes on the SSLP markers tested on Chr 11(P>0.05) does not confirm the indication from the testcrossed sires, that there is a SELH/Bc-exencephaly risk locus near this location. However, the maximum percentage of exencephalic SELH/Bc X LM/Bc F embryos with 2  the SS genotype was observed at DllMitlO  and this percentage was the same as what was observed at D5MU95  (42%) and the trend of the data is consistent with the presence of an SELH/Bc risk locus. Therefore, based on the SSLP marker with the maximum percentage of SS genotypes, DllMitlO  may be most closely linked to the  SELH/Bc risk locus on Chr 11 if one is present. It is interesting that this general region of Chr 11 showed  90  significant evidence of the presence of a SELH/Bc exencephaly risk locus in the segregants from a cross to the "CT strain" (Figure 4.3), discussed previously.  Although Crhr and Itgb3 were included in the typing of SSLP markers on Chr 11, it is premature to suggest that they, or other genes mapped to this region of Chr 11 are good candidate genes for SELH/Bc risk for exencephaly. The typing of both SSLPs within Crhr and Itgb3 and previously mapped SSLPs contributes to the integration of mouse linkage maps of genes with those for SSLP markers.  Chr 13  Deviation from expected ratio of genotypes was strongest for all SSLP markers on Chr 13 in comparison to those on Chrs 5 and 11 (Figure 7.2). Observation of maximum percentage of exencephalic SELH/Bc X LM/Bc F embryos 2  with the SS genotype occurring at D13Mitl3/D13Bcl  suggests that an SELH/Bc risk for exencephaly is most  closely linked with these markers. Since the maximum percentage of exencephalic SELH/Bc X LM/Bc F s with SS 2  genotype at D13Mitl3/D13Bcl  (51.6%) was higher than at D5MU95 and DI IMitlO (42%), it is suggested the risk  afforded by the Chr 13 risk is somewhat stronger than that at Chrs 5 and 11. This observation supports the hypothesis that a strong genetic risk factor for exencephaly exists at Chr 13 in the SELH/Bc strain (Gunn, 1996). Exencephaly in heterozygotes on Chr 13 indicates semidominance (Juriloff et al. 2001). The exencephaly-risk region on Chr 13 is linked to or includes genes that cause NTD in mutants such as Tcfap2a (AP-2), jmj, Msx2, Madh5, and Ptch (reviewed in Harris and Juriloff, 1999; Juriloff and Harris, 2000 see also Table 1.1). However, unlike the nonsyndromic exencephaly in SELH/Bc, the NTD produced by alterations in the above genes are syndromic and lethal.  The chromosomal regions tested here to refine the SELH/Bc exencephaly risk regions can be used in other SELH/Bc crosses to gain more data to support or refute the existence of these risk regions.  Combinatorial  Genetics  Figure 7.3 shows that the distribution of percentage of exencephalic SELH/Bc X LM/Bc F with 0, 1,2, 3, or 4 2  SELH/Bc alleles across D5MU168  and D13MU13  follows a skewed bell-shaped distribution that is shifted to the  92  right of a distribution predicted in a random situation to suggest that the population requires more SELH/Bc alleles for display of phenotype. It is interesting that over 50% of exencephalic F had two or three out of a maximum of 2  four SELH/Bc alleles. This pattern may be indicative of the increased possibility of having the lower sums of alleles due to different combinations of heterozygosity and homozygosity for SELH/Bc alleles at these two loci. Since not all of the exencephalic SELH/Bc X LM/Bc F had the full SELH/Bc genotype, a multifactorial cause of exencephaly 2  rather than a digenic situation is supported for this cross.  93  CHAPTER VIII: Refining the SELH/Bc exencephaly risk regions on Chr 13, 5, and 11 using exencephalic SELH/Bc X "CT strain" F s 2  I.  Introduction  In Chapter 7,1 described my contribution to the definition of Chr 13, 5, and 11 SELH/Bc-exencephaly risk regions using T. Gunn's exencephalic SELH/Bc X LM/Bc F s. In Chapter 4,1 also observed deviation from random 2  segregation of alleles among the exencephalic SELH/Bc X "CT strain" F s at Chr 13 and 11 but not 5. Therefore, I 2  have used my sample of exencephalic SELH/Bc X "CT strain" F s as an independent sample of F s to parallel the 2  2  SELH/Bc X LM/Bc study in order to further define the effect and location of these SELH/Bc-exencephaly liability genes.  A comparison between the exencephalic SELH/Bc X LM/Bc F and the exencephalic SELH/Bc X "CT strain" F 2  2  data is also presented.  II.  Materials and Methods  DNA for exencephalic  SELH/Bc  X "CT strain"  Fs 2  The DNA used in this study was the same as was used in Chapter 3.  PCR  SSLPs used in the definition of SELH/Bc exencephaly genes in the exencephalic SELH/Bc X "CT strain" F s are 2  presented in Table 8.1. Amplification of product was conducted as described in Chapter 2 using the conditions presented in Table 8.1.  Comparison exencephalic  of SELH/Bc SELH/Bc  additive risk from Chrs 5, 11, and 13 in the exencephalic SELH/Bc  X LM/Bc F and 2  X "CT strain " F  2  Percentage of exencephalic SELH/Bc X LM/Bc F s with homozygous SELH/Bc genotype (SS) at Chrs 5, 11, and 13 2  was presented in Chapter 5 and is presented here for the exencephalic SELH/Bc X "CT strain" F for comparison. 2  Sum of SELH/Bc alleles at the SSLP markers that showed statistically significant deviation from 1:2:1 ratio of genotypes (PO.05) was calculated for each exencephalic SELH/BC X "CT strain" F embryo. The relationship 2  94  Table 8.1. SSLP markers typed in the exencephalic group of SELH/Bc X "CT strain" F embryos. 2  PCR conditions and estimated product size for SELH/Bc and "CT strain" is reported. Position Marker [MgCl ] T , Allele size (bp) (cM) (mM) (°C) SELH/Bc "CT strain" 68.00 D5MU95 1.5 55 135 130 85.00 D5MU122 1.5 55 160 165 2  55.00 62.00 64.00 68.00 71.00  D11MU288  30.00 30.00 35.00 37.00 47.00 57.00 61.00  a n n e a  D11MU360 Itgb3 D11MU253  1.5 1.5 1.5 1.5 1.5  55 55 55 55 55  110 400 115 350 95  125 450 125 300 '85  D13MH64 D13MU91 D13MU13 D13MU39 D13MH159 D13MU287 D13MU76  1.5 1.5 1.5 1.5 1.5 1.5 1.5  55 55 55 55 55 55 55  110 110 135 200 160 120 170  100 100 145 210 140 125 160  Crhr  95  between percentage of exencephalic F embryo and sum of SELH/Bc alleles across the selected SSLP loci was 2  graphed to analyze the role of combinatorial SELH/Bc risk in this cross.  Number of exencephalic SELH/Bc X "CT strain" F s with homozygous "CT strain" genotype (CC) at the SSLP 2  marker closest to the putative ct gene (D4MU65) is also presented to demonstrate risk of exencephaly possibly attributable to the ct allele of the "CT strain".  III.  Results  Chr 5  Genotypes for the region tested on Chr 5 for each of the exencephalic SELH/Bc X "CT strain" F s are presented in 2  Figure 8.1. There was no deviation from 1:1 in the number of SELH/Bc and "CT strain" alleles at either SSLP marker. There was no non-random pattern in the proportion of CC:CS:SS genotypes at D5MU95 or D5MU122. Maximum percentage of SS genotypes was seen at D5MU95 (29.1%). For neither SSLP marker did all affected embryos have at least one SELH/Bc allele.  Chr 11  Genotypes for the exencephalic SELH/Bc X "CT strain" F s are presented in Figure 8.1. No deviation from 2  expected proportion of CC:CS:SS genotypes was seen for DI 1MU288, Crhr, D11MU360,  or Itgb3. A significant  deviationfromthe expected 1:2:1 ratio of CC:CS:SS genotypes was seen at D11MU253  (P <0.025) which also has  an excess of SELH/Bc alleles due to a lack of individuals with the CC genotype. The locus with the maximum percentage of SS genotypes was DllMit253  (33%). All embryos had at least one SELH/Bc allele at DI 1MU253.  Throughout the region tested on Chr 11, there is a lack of CC genotypes. This region of Chr 11 does not generally show deviation from random segregation of genotypes (see Table 4.6) except D11MU253 (PO.025), which had an excess of heterozygotes in the three complete F litters. 2  Chr 13  Genotypes for the region of Chr 13 for each of the exencephalic SELH/Bc X"CT strain" F s are presented in Figure 2  8.1. Significant deviationfromexpected 1:2:1 ratio of CC:CS:SS genotypes was seen at D13MU64 (PO.05), D13MU159  (PO.025), D13MU287  (PO.025), and D13MU76 (PO.05) represented by an excess of SS genotypes  96  and lack of CC genotypes. Maximum percentage of the SS genotype was seen at D13MU159  and  D13MU287  (50%).  There was no SSLP for which the entire sample had at least one SELH/Bc allele. These SSLPs are in a region of Chr 13 that did not show deviation from expected proportion of genotypes in 3 complete F litters (see Table 4.6). 2  Combinatorial  SELH/Bc  risk at Chr 11 and Chr 13  Statistically significant deviations from 1:2:1 ratio of genotypes was observed at D11MU253, D13MU1S9,  D13MU287,  and D13MH76.  The sum of SELH/Bc alleles at D11MU253  D13MU64.  and D13MU13  was calculated  for each exencephalic SELH/Bc X "CT strain" F . D13MU13 was selected because it was most closely linked with 2  SELH/Bc risk of exencephaly in the exencephalic SELH/Bc X LM/Bc F (see Chapter 7). The relationship between 2  percentage of exencephalic SELH/Bc X "CT strain" F with 0, 1, 2, 3, or 4 SELH/Bc alleles at D11MH253 and 2  D13MU13 is presented in Figure 8.2. SELH/Bc X "CT strain" F embryos with CC genotype at D4MU65 are labeled 2  in Figure 8.2 (presumptive ct/cf).  The exencephalic SELH/Bc X "CT strain" F population approximates a bell-shaped distribution for sum of 2  SELH/Bc alleles that is skewed to the right of the distribution predicted by chance (Figure 8.2).  Number of exencephalic SELH/Bc X "CT strain" F with the CC genotype at D4MU65 was one with 1 SELH/Bc 2  allele, five with 2 SELH/Bc alleles, three with 3 SELH/Bc alleles, one with 4 SELH/Bc alleles (Figure 8.2).  97  00 ^  ^. <N  75 M  3fc rj ^  ^ —  O  C N C N  VO 0 0  C N C N  ^  ^  OV  M  r>CN  "  ^  ON  (N  O cn  ON  (N O co  O  00  £  in  OV  M  m  O cn  < N  fn  oo do do" vo  CN  00  00  O  un" in  o  O ©  u  "O  J2 C N  fn  fn  T T  V O  OO  un  in  TJ-  TJ-  ta fn fn  tS i-H  ts  « ^H  fn  fn  fn  ff) fn  iri  r-'  r-"  t^'  iri  a  CO  H ,  CO ^  U O  "  I >  cn  v b  vo  in ^j-  .o  r-- oo  i-H ^H  _  v o v©  H  ^  7!  *H  Ov  Q\  CN  ^  J= C N  ••  oo  00  Uu  "3 "c '3 4-»  —  H O  l-H  i—l  o  o  II  i-H  i—I  ••  CN  ts  C N  „  ^. OV  o  u  •• ^  TJ-  m  CD  m  C N  13 CD  743 E S E S 192ES3 ESS 57MM ESS  765 E S E S 718ES E S 5181=1 1=1 655 H ESS  ESS ESS ESS I I ESS ES ES ES i i ESS ESS I I ESS • • • •  ESS MU ES ES ES ES ESS ESS ESS UU E S  ES ES ES ES ES  UM UU UU UM MU 4891=1 E S 608 H i 1=1 343L=I • 36=] E S 04=1 ES 551£S • 646 UM ESS 89 E S B i  3131=1 =] 735 O 207 E S  • •  ES E S E S E S E S ES  ES ES ES ES  • i  MU MM MU MU  ES  ESS ESS ESS ESS  UM UM MU MM MU ES ES ES ES ES UM MU MU MU E S E S ESS ESS E S ESS E S E S E S ESS ESS E S ESS ESS ESS E S ESS ESS ESS ESS ESS ESS ESS ESS ESS ESS ESS ESS ESS ESS ESS  751=] E S 497 E S ESS 52=1 = 1  CD I  i 11  II  i  i II  i i  i i I  o p o  i HJ  ECT ESS  w  ISS ESS I I I II II II I ESS • • • ESS ESS ESS • =1 ESS ESS E S ESS E S  V  CL,  00  _ <=>. o ^  ECT E55] ESS ESS E55I ECT ESS —  ESESES ES ES ES ES E S E S £33 E S S S E S E S PJH PJB E S E S E S E S E S ES ES ES ESS ESS E S ESS ESS ESS ES ES ES • • MU MU  UM MU UM E S ESS MU B i MU UU B i MU MU B i MU UU H i UU MU UM MU UM  „  ES ES • • ESS E S H i MU ESS MU MU MU E S UU MU UM UM E S ESS ESS UM MU E S •  MU UM MU UU MU UM  MU MU MU UU MU MU  CN O  d.  2 V  co  O  CD  CL,  M  V a  0H HJ  ^  00 00  )S ^ X  UU UM ES ES MU ESS  c  ' 'S '3  .,_>  UU UU MU MU UU UM  >  CD T3  ca o  ao  rj  O S  on CD  r>  CD  s  -5  +H  s> ca  CN,  Os cx,  •  ES •  |v  o  ^  ^  oo ~5 v © oOJO un CX, fn "-H  ^  > VO  N ff) V> N  sS  it  •"ts  .**  0\  frj >  s§  ^  "^n ^  Q  °n N  Q  °n N  Q  °n N  q  §  ^  (V) ^  rn N  -  w .ca 00  : i-*  N  4  ^  CD  O , K VO >n 0 0 K " v , rvj  -  2  73 «  s.  Q  a o X  CD CD 00 tn CD CD >  Q. O  f  ^ Tj  o  <=>  00 ID vO 00  o  o  • • W CN  ©  •  o  •  00 IT) VO V5 VO T f  ©  ©  i-l  ov  •  h  •  CN  ©  ©  © m  m m  •  ©  •  m  ©  •  T T  ©  •  •  i n  U U  ©  •  — vc  •  oo t/> CD U co O MU  « CD  .2  oo H.  IV.  Discussion  Chr 5  The maximum percentage of the SS genotype at D5MU95 in this panel of exencephalic SELH/Bc X "CT strain" F s 2  is also observed in the exencephalic SELH/Bc X LM/Bc F s (compare Figures 7.2 and 8.1). This maximum 2  percentage of SS genotype for this region is also lower than that seen in the exencephalic SELH/Bc X LM/Bc F  2  panel (29.1% vs. 42%). In addition, there was no deviationfromrandom segregation of alleles for either of the SSLP markers tested on this chromosome. Together, this data may indicate that a risk for exencephaly from the SELH/Bc strain does not exist in a region linked to D5MU95 or that this risk gene does not differ between SELH/Bc and "CT strain".  Chr 11  Although the maximum percentage of the SS genotype in the exencephalic SELH/Bc X "CT strain" F was observed 2  at D11MU253 (33%), the percentage of embryos with the SS genotype is not very much lower (decreases by 1 individual to 29.1%) in the more proximal markers tested (Figure 8.1). The observed maximum percentage of SS genotypes of 33% at D11MU253  is slightly higher than the random expected percentage of 25%. There was also  significant deviation from Mendelian segregation of alleles at D11MU253 (P <0.025). Therefore, existence of an SELH/Bc exencephaly liability on mid-distal Chr 11 as suggested by the exencephalic SELH/Bc X LM/Bc F s is 2  supported by the exencephalic SELH/Bc X "CT strain" F panel. 2  If it is accepted that SELH/Bc risk factors for exencephaly exist at 68.0 cM on Chr 5 and 63.0 cM on Chr 11, it is observed that the percentage of SS genotypes at both these loci is the same within exencephalic F s for either cross 2  (42% at D5MU95 and DllMitlO  for exencephalic SELH/Bc X LM/Bc F s and 29% at D5MU95 and DUMU360 2  for  exencephalic SELH/Bc X "CT strain" F s). The pattern of deviation from the expected ratio of genotypes is 2  different for each F panel (deviation at D5MU95 but not at Chr 11 in exencephalic SELH/Bc X LM/Bc F , deviation 2  2  at D11MU253 but not at Chr 5 in SELH/Bc X "CT strain" F ) and may be due to genetic background differences 2  between LM/Bc and the "CT strain" relative to SELH/Bc alleles at Chr 5 and at Chr 11.  Chr 13  The SSLPs on Chr 13 showed the greatest percentage of embryos with the SS genotype in the exencephalic SELH/Bc X "CT strain" F as compared to that observed for SSLPs at Chr 5 and 11 (50% vs. 29.1% and 33% 2  100  respectively). This trend was also observed in the exencephalic SELH/Bc X LM/Bc F s (51.6% vs. 42% and 42% 2  respectively). Therefore, both exencephalic SELH/Bc F panels suggest that a SELH/Bc exencephaly risk factor 2  exists on Chr 13 and that this risk factor is stronger than those found at Chr 5, and 11. The 50% of exencephalic SELH/Bc X "CT strain" F s with the SS genotype at D13MU159 2  exceeds the 25% random expected value which  suggests existence of a SELH/Bc exencephaly risk factor at this locus. Again, although D13MU159 (47.0 cM) is not at the same map position as that chosen to best represent the location of the SELH/Bc exencephaly risk factor (35.0 cM for D13MU13)  from the SELH/Bc X LM/Bc F , these SSLP markers are closely linked and the percentage of 2  embryos with the SS genotype is not very much lower (45.8%) near D13MU13 in the exencephalic SELH/Bc X "CT strain" F s. Therefore, existence of an SELH/Bc exencephaly risk factor near D13MU13 (Juriloff et al., 2001b) is 2  supported in the exencephalic SELH/Bc X "CT strain" F panel. 2  The observation of a nearly 1:1 proportion of SS:SC alleles on Chr 13 implies a strong contribution to risk in heterozygotes and therefore semi-dominance of the SELH/Bc allele, which has been found in the previous cross of SELH/Bc X LM/Bc (Juriloff et al., 2001b).  The usefulness in refining the SELH/Bc exencephaly gene region on Chr 13 in SELH/Bc X "CT strain" F cross is 2  compromised by the genetic risk of exencephaly contributed by the "CT strain" (see discussion of Chapter 4). If the most influential gene for exencephaly risk in SELH/Bc is near D13MU13, as suggested by the exencephaly F panel 2  from SELH/Bc X LM/Bc, it is possible that embryos that are homozygous CC at this marker, F embryos #57, 192, 2  743, and 765, are exencephalic because, in part, of the "CT strain" risk. If we look at the genotypes of these embryos at the "CT strain" NTD liability region on Chr 4 (see Figure 8.1) we see that these embryos are either homozygous for "CT strain" alleles or heterozygous throughout the Chr 4 region. Therefore, the genetic cause of the exencephaly in these embryos is likely either due entirely to the "CT strain" cause, due to contribution of additional SELH/Bc risk at other loci, or due to a combination of the genetic risk afforded by both "CT alleles" on Chr 4 plus SELH/Bc alleles on Chr 11 and Chr 13.  Combinatorial  SELH/Bc  risk at Chrs 11 and Chr 13  Finding that Chr 13 was associated with SELH/Bc risk for exencephaly in both the exencephalic SELH/Bc X LM/Bc F and the exencephalic SELH/Bc X "CT strain" F lends more support for existence this SELH/Bc risk 2  2  region. 101  The shape of the relationship between percentage of exencephalic SELH/Bc X "CT strain" F embryos and sum of 2  SELH/Bc alleles at two putative SELH/Bc risk loci (D11MU253  and D13MU13) is not unlike that of the  exencephalic SELH/Bc X LM/Bc F cross (D5MU168 and DJ3MU13) (compare Figures 8.2 and 7.3). Therefore, it 2  is suggested that a combination of SELH/Bc alleles (as few as one, as many as four, but usually two or three) is sufficient to afford SELH/Bc risk for exencephaly in the SELH/Bc X "CT strain" F cross. Many of the 2  exencephalic SELH/Bc X "CT strain" F have two or three rather than one or four of four SELH/Bc alleles across 2  two loci which may be indicative of the increased probability of having two or three SELH/Bc alleles through different combinations of heterozygosity and homozygosity for SELH/Bc alleles at the two loci. Again, an additive genetic model rather than a digenic model for cause of exencephaly in the SELH/Bc X "CT strain" cross is supported as not all of the exencephalic individuals of this cross had the full SELH/Bc genotype.  It is interesting that Chr 5 and Chr 13 were implicated with SELH/Bc risk of exencephaly in the SELH/Bc X LM/Bc F cross whereas Chr 11 and Chr 13 were implicated with the SELH/Bc risk of exencephaly in the SELH/Bc X "CT 2  strain" F cross. It is possible that LM/Bc and "CT strain" have introduced different modifiers to influence the 2  SELH/Bc risk for exencephaly in the respective crosses.  102  CHAPTER IX: Discussion and conclusion A.  General discussion  The hypotheses of this study were: 1) that the genetic and environmental causes of NTD in the SELH/Bc strain and the "CT strain" were interchangeable and could cause NTD in new combinations in segregants; 2) that the SELH/Bc genotype would modify the ct/ct phenotype to increase penetrance of exencephaly in combination with caudal NTD; and 3) that the genetic causes of NTD in the SELH/Bc strain and the "CT strain" would interact to produce new NTD phenotypes such as craniorachischisis. For the most part, the data collected do not support these hypotheses. The following sections highlight the salient elements for these conclusions.  Myo-inositol  Although /nyo-inositol has a reductive effect on the frequency of spina bifida aperta and flexed tail in the "CT strain", it did not appear to have an effect on the frequency of exencephaly in the SELH/Bc strain when given to dams at a concentration of 200 mg/1 in drinking water. Therefore, if the defective chain of events that leads to exencephaly in SELH/Bc is similar to that which leads to caudal NTD in the "CT strain", the strains differ in the affected step in the pathway. However, difference in effect of myo-inositol may be due to differences in the manner and timing of delivery.  Neural tube phenotypes in the F  2  No craniorachischisis was seen. One embryo with exencephaly and flexed tail was observed. Therefore, there was no support for the hypotheses that the genotypes from the two parental strains would interact to produce new types of NTD or alter the expressivity of ct/ct to result in caudal NTD with exencephaly.  Exencephaly  SELH/Bc has a 10-30% risk of exencephaly due to genetic factors probably due to the cumulative effect of genes that are near the SSLP markers D13MU13, D11MU253,  and D5MU168 on chromosomes 13, 11 and 5 respectively  (see Chapters 7 and 8). This interpretation is based on the genotype segregation of two independent panels of exencephalic F s (SELH/Bc X LM/Bc F in Chapter 7 and SELH/Bc X "CT strain" F in Chapter 8). The SELH/Bc 2  2  2  risk factor near to D13MU13 appears to be the most important risk factor in both crosses. The relative strength of SELH/Bc factors on Chr 5 and 11 may be influenced by genetic background differences between SELH/Bc and LM/Bc or the "CT strain". 103  The "CT strain" has a 3% risk of exencephaly (van Straaten.and Copp, 2001) that may be due to ct linked to D4MU65.  Establishment of association of the exencephaly trait with Chr 4 in the "CT strain" has not yet been done.  Given the low frequency of exencephaly in the "CT strain" (3% in van Straaten and Copp, 2001), the linkage study that would need to be performed would be prohibitively large.  The cause of exencephaly in the SELH/Bc X "CT strain" F appears to be mostly due to a multifactorial cause from 2  the SELH/Bc strain as evidenced by the nature of the relationship between percentage of exencephalic F with sum 2  of SELH/Bc alleles at two putative SELH/Bc risk loci. There may be a combinatorial effect of "CT strain" risk at Chr 4 (ct) on SELH/Bc risk and/or this "CT strain" factor could possibly substitute for a SELH/Bc risk at Chr 11 or Chr 13 because affected embryos that had the fewest SELH/Bc risk factors were ct/+ or ct/ct. However, independence of SELH/Bc and "CT strain" cause of exencephaly in the F is also supported by this pattern. 2  Spina bifida  aperta  SELH/Bc has no risk of spina bifida aperta. The "CT strain" has a 10% risk of spina bifida aperta (van Straaten and Copp, 2001). The "CT strain" risk for flexed tail is associated with the ct locus on mid Chr 4 (Neumann et al, 1994), which appears to be most closely linked to the SSLP marker D4MU65 in this study (Chapters 4 and 6). No risk factors from SELH/Bc appear to act additively or interchangeably with the ct linked to D4MU65 to increase risk for spina bifida aperta in an F , and all four embryos with spina bifida aperta were apparently ct/ct. 2  Flexed tail  Flexed tail is a phenotype observed in the "CT strain" but not in SELH/Bc. It has been associated with delayed closure of the posterior neuropore in the "CT strain" (van Straaten and Copp, 2001). Therefore, although flexed tail may be a consequence of perturbed primary neurulation—delayed posterior neuropore closure—it itself is not a NTD. Nevertheless, risk for flexed tail is associated with a "CT strain" risk (ct) near to D4MU65 on Chr 4. The SELH/Bc risk factors at its risk regions on Chrs 5 and 13 do not appear to be additive or interchangeable with the risk for flexed tail from the "CT strain" risk at Chr 4. SELH/Bc alleles at an exencephaly risk locus at Chr 11 may add to the "CT strain" risk of the flexed tail phenotype in an F -an unexpected finding that should be confirmed in 2  independent data.  104  B.  Further definition of the ct gene and phenotype  19% of BC] individuals were affected (1.0% exencephaly withflexedtail, 1.0% spina bifida aperta withflexedtail, and 17% with flexed tail alone). As the " C T strain" displays 40% affected, the BCi data is consistent with the cause of NTD in the "CT strain" being a single autosomal recessive gene. Given this lowfrequencyof spina bifida aperta in the BC!, it would appear that a large sample would be needed to map the "CT strain" gene responsible for this trait. Thisfirstbackcross also showed that exencephaly in combination with flexed tail occurs in segregants, which indicates that ct probably is the cause of exencephaly in the "CT strain".  Mlp Mlp was considered as a candidate gene for ct because Mlp was previously mapped to Chr 4 near ct and Mlp-mx\\ mice developed NTDs that included exencephaly, spina bifida aperta, and flexed tail (Wu et al., 1996). This study mapped Mlp for thefirsttime relative to mapped SSLP markers on Chr 4 as follows: D4Mit279-(2A + 1.7 cM)-Mp(16.3 + 4.9 cM)-D4Mit65-(2A  + 1.7 cM)-D4Mit232-(4.9 + 2.4 cM)-D4Mit33 (MGI:1934123,see Chapter 6). These  results indicated that Mlp is not ct because a greater proportion of SELH/Bc X "CT strain" F with spina bifida 2  aperta or flexed tail had "CT strain" alleles at the SSLP marker D4MU65, -10 cM distal to Mlp, consistent with previous mapping studies for ct. The penetrance and distribution of type of NTD seen in the Mlp-mx\\ mice of other studies is also dissimilar to what is seen in the "CT strain" (much more exencephaly than caudal defects in Mlp-nu\\ mice in comparison to the "CT strain") (compare Chen et al. 1996 and Wu et al., 1996 with van Straaten and Copp, 2001).  General comments on the applicability of the SELH/Bc X "CT strain " study to the human situation  Bias toward female excess in the exencephalic SELH/Bc X " C T strain" F (7:1, Chapter 3) is consistent with the 2  female excess observed in the exencephalics of the SELH/Bc strain (2:1, (Juriloff et al, 1989)) and of "CT strain" (4:1, (Embury et ai, 1979)). The same sex bias is observed in human anencephalics (Garabedian and Fraser, 1993; Lemire et ai, 1978) which suggests that the mouse strains used in this study may accurately reflect the defective developmental pathways leading to anencephaly in humans.  105  Presence of an SELH/Bc X "CT strain" F with a thoracic spina bifida aperta is interesting as this type of spina 2  bifida aperta has also been seen in East-Indian Sikh cases of spina bifida aperta (Hall et al., 1988).  Exencephaly and spina bifida aperta do not appear to be due to a similar genetic cause in the SELH/Bc X "CT strain" cross which may be also true of at least some human cases. The genetic analysis of NTD in this cross between two inbred strains of mouse is complicated by the risk of exencephaly from both strains. Independence of factors versus compounding or substitution of factors between the SELH/Bc and "CT strain" factors with respect to exencephaly is difficult to interpret unequivocally in the Fi X F] cross. The vast female excess among exencephalics and the presence of an F with thoracic spina bifida aperta suggest that the SELH/Bc X "CT strain" 2  cross may be a good model for some human NTD. This study suggests that mouse models of multifactorial exencephaly and multifactorial spina bifida aperta are different from each other. If SELH/Bc and the "CT strain" can model human risk for NTD, then perhaps human multifactorial systems of NTD can also be independent. If this suggestion is correct, some families may be at risk for anencephaly and spina bifida aperta, whereas others may be at risk for only anencephaly or only spina bifida aperta. The complexity of genetic interaction and genetic heterogeneity seen in this study may partially explain why the genetics of human NTD remain unclear.  Future  studies  It is argued that a more refined position for the putative "CT strain" causative gene ct could be obtained from mapping studies that used spina bifida aperta, scored prenatally instead of flexed tail, scored postnatally.  Although the SELH/Bc X "CT strain" cross did not support a similar genetic cause for multifactorial exencephaly and spina bifida aperta, there may still exist other mouse mutants for which this idea might be true (e.g. perhaps this is the case in the "CT strain" itself and knockout mouse models with both exencephaly and spina bifida aperta, see Table 1.4). In order to test interaction of multifactorial cause of isolated exencephaly with multifactorial cause of isolated spina bifida aperta, one might consider crossing SELH/Bc with a different strain. However, at present, there are no inbred strains of mouse with isolated multifactorial spina bifida aperta.  106  Electronic Sources  Mouse Genome Database (MGD), Mouse Genome Informatics Web Site, The Jackson Laboratory, Bar Harbor, Maine. World Wide Web (URL: http://www.informatics.jax.org/). [April, 2001]. MGL1934123, Harris MJ; Wu MK; Stumpo DL; Blackshear PJ; Juriloff DM, 2001, Mapping of Mlp to mouse Chromosome 4 against "Mit" SSLP marker loci, MGI Direct Data Submission, J:69165. On-line Medical Dictionary, 1997, World Wide Web (URL: http://www.graylab.ac.uk/omd/index.html.) Online Mendelian Inheritance in Man, OMIM (TM). Johns Hopkins University, Baltimore, MD. MIM Number: {OMIM 206500}: {6/11/1999}:. World Wide Web (URL: http://www.ncbi.nlm.nih.gov/omim/)  107  Literature cited Acampora, D., Merlo, G. R., Paleari, L., Zerega, B., Postiglione, M. P., Mantero, S., Bober, E., Barbieri, O., Simeone, A., and Levi, G., 1999, Craniofacial, vestibular and bone defects in mice lacking the Distal-less related gene Dlx5, Development 126:3795-3809. Agulnik A.I., Mitchell, M.J., Lerner, J.L., Woods, D.R., and Bishop, C.E., 1994, A mouse Y chromosome gene encoded by a region essential for spermatogenesis and expression of male-specific minor histocompatibility antigens. Human Molecular Genetics. 3 (6):873-878. Anderson, J. R., 1981, The mode of development of an inherited form of anencephaly in the house mouse, Neuropathol Appl Neurobiol 7(3):229-35. Antony, A. C , and Hansen, D. K., 2000, Hypothesis: folate-responsive neural tube defects and neurocristopathies, Teratology 62(l):42-50. Armstrong, J. F., Kaufman, M. H., Harrison, D. J., and Clarke, A. R., 1995, High-frequency developmental abnormalities in p53-deficient mice, Curr Biol 5(8):931-6. Barlow, P.W., 1972, Differential cell division in human X chromosome mosaics. Humangenetik 14(2): 122-7. Baudoin, C , Goumans, M.-J., Mummery, C , and Sonnenberg, A., 1998., Knockout and knockin of the (31 exon D define distinct roles for integrin splice variants in heart function and embryonic development. Genes and Development 12: 1202-1216. Beier, D. R., Dushkin, H., and Telle, T., 1995, Haplotype analysis of intra-specific backcross curly-tail mice confirms the localization of ct to chromosome 4, Mamm Genome 6(4):269-72. Bennett, G.D., An, J., Craig, J.C, Gefrides, L.A., Calvin, J.A., and Finnell, R.H. 1998. Neurulation abnormalities secondary to altered gene expression in neural tube defect susceptible Splotch embryos. Teratology 57 : 17-29. Blackshear, P. J., Lai, W. S., Turtle, J. S., Stumpo, D. J., Kennington, E., Nairn, A. C , and Sulik, K. K., 1996, Developmental expression of MARCKS and protein kinase C in mice in relation to the exencephaly resulting from MARCKS deficiency, Brain Res Dev Brain Res 96(l-2):62-75. Botto, L. D., Moore, C. A., Khoury, M. J., and Erickson, J. D., 1999, Neural-tube defects, N Engl J Med 341(20): 1509-19. Botto, L. D., and Yang, Q., 2000, 5,10-methylenetetrahydrofolate reductase gene variants and congenital anomalies: a HuGE review, American Journal of Epidemiology 151(9):862-77. Brook, F. A., Estibeiro, J. P., and Copp, A. J., 1994, Female predisposition to cranial neural tube defects is not because of a difference between the sexes in the rate of embryonic growth or development during neurulation, J Med Gen 31(5):383-387. Brook, F. A., Shum, A. S., Van Straaten, H. W., and Copp, A. J., 1991, Curvature of the caudal region is responsible for failure of neural tube closure in the curly tail (ct) mouse embryo, Development 113(2):671-8. Bultman, S., Gebuhr, T., Yee, D., La Mantia, C , Nicholson, J., Gilliam, A., Randazzo, F., Metzger, D., Chambon, P., Crabtree, G., and Magnuson, T., 2000, A Brgl null mutation in the mouse reveals functional differences among mammalian SWI/SNF complexes, Molecular Cell 6:1287-1295. Campbell, L. R., Dayton, D. H., and Sohal, G. S., 1986, Neural tube defects: a review of human and animal studies on the etiology of neural tube defects, Teratology 34(2): 171-87. Carey, D. J., Evans, D. M., Stahl, R. C , Asundi, V. K., Conner, K. J., Garbes, P., and Cizmeci-Smith, G., 1992, Molecular cloning and characterization of N-syndecan, a novel transmembrane heparan sulfate proteoglycan, J Cell Biol 117(1): 191-201. Carter, C. O., 1974, Clues to the aetiology of neural tube malformations, Dev Med Child Neurol 16(6 Suppl 32):315. Carter, M., Ulrich, S., Oofuji, Y., Williams, D. A., and Ross, E., 1999, Crooked tail (Cd) models human folateresponsive neural tube defects, Human Molecular Genetics 8(12):2199-2204. Chen, J., Chang, S., Duncan, S. A., Okano, H. J., Fishell, G., and Aderem, A., 1996, Disruption of the MacMARCKS gene prevents cranial neural tube closure and results in anencephaly, Proc Natl Acad Sci U S^93(13):6275-9. Chen, J. Y., Penco, S., Ostrowski, J., Balaguer, P., Pons, M., Starrett, J. E., Reczek, P., Chambon, P., and Gronemeyer, H., 1995a, RAR-specific agonist/antagonists which dissociate transactivation and API transrepression inhibit anchorage-independent cell proliferation, Embo J 14(6): 1187-97. Chen, W. H., Morriss-Kay, G. M., and Copp, A. J., 1994, Prevention of spinal neural tube defects in the curly tail mouse mutant by a specific effect of retinoic acid, Dev Dyn 199(2):93-102.  108  Chen, W. H., Morriss-Kay, G. M , and Copp, A. J., 1995b, Genesis and prevention of spinal neural tube defects in the curly tail mutant mouse: involvement of retinoic acid and its nuclear receptors RAR-beta and RARgamma, Development 121(3):681-91. Chernousov, M. A., and Carey, D. J., 1993, N-syndecan (syndecan 3) from neonatal rat brain binds basic fibroblast growth factor, J Biol Chem 268(22): 16810-4. Christensen, B., Arbour, L., Tran, P., Leclerc, D., Sabbaghian, N., Piatt, R., Gilfix, B. M., Rosenblatt, D. S., Gravel, R. A., Forbes, P., and Rozen, R., 1999, Genetic polymorphisms in methylenetetrahydrofolate reductase and methionine synthase, folate levels in red blood cells, and risk of neural tube defects, Am J Med Genet 84(2): 151-7. Cockroft, D. L., 1988, Changes with gestational age in the nutritional requirements of postimplantation rat embryos in culture, Teratology 2>%(i):2U-90. Cockroft, D. L., Brook, F. A., and Copp, A. J., 1992, Inositol deficiency increases the susceptibility to neural tube defects of genetically predisposed (curly tail) mouse embryos in vitro, Teratology 45(2):223-32. Cohlan, S. Q., 1953, Excessive intake of vitamin A as a cause of congenital anomalies in the rat, Science 117:535536. Copp, A. J., 1985, Relationship between timing of posterior neuropore closure and development of spinal neural tube defects in mutant (curly tail) and normal mouse embryos in culture, J Embryol Exp Morphol 88:39-54. Copp, A. J., 1993, Neural tube defects, Trends Neurosci 16(10):381-3. Copp, A. J., 1998, Prevention of neural tube defects: vitamins, enzymes and genes, Curr Opin Neurol 11(2):97-102. Copp, A. J., and Bernfield, M., 1988, Accumulation of basement membrane-associated hyaluronate is reduced in the posterior neuropore region of mutant (curly tail) mouse embryos developing spinal neural tube defects, Dev Biol 130(2):583-90. Copp, A. J., and Brook, F. A., 1989, Does lumbosacral spina bifida arise by failure of neural folding or by defective canalisation?, J Med Genet 26(3): 160-6. Copp, A. J., Brook, F. A., Estibeiro, J. P., Shum, A. S., and Cockroft, D. L., 1990, The embryonic development of mammalian neural tube defects, ProgNeurobiol 35(5):363-403. Copp, A. J., Crolla, J. A., and Brook, F. A., 1988, Prevention of spinal neural tube defects in the mouse embryo by growth retardation during neurulation, Development 104(2):297-303. Costell, M., Gustafson, E., Aszodi, A., Morgelin, M., Bloch, W., Hunziker, E., Addicks, K., Timpl, R., and Fassler, R., 1999, Perlecan maintains the integrity of cartilage and some basement membranes, The Journal of Cell B/o/ogy 147(5): 1109-1122. Czeizel, A. E., and Dudas, I., 1992, Prevention of thefirstoccurrence of neural-tube defects by periconceptional vitamin supplementation, N Engl J Med 327(26): 1832-5. Depew, M. J., Liu, J. K., Long, J. E., Presley, R., Meneses, J. J., Pedersen, R. A., and Rubenstein, J. L. R., 1999, D/x5regulates regional development of the branchial arches and sensory capsules, Development 126:38313846. DeSesso, J. M., Scialli, A. R., and Holson, J. F., 1999, Apparent lability of neural tube closure in laboratory animals and humans, Am J Med Genet 87(2): 143-62. Drainer, E., May, H. M., and Tolmie, J. L., 1991, Do familial neural tube defects breed true?, J Med Genet 28(9):605-8. Echelard, Y., Epstein, D. J., St.-Jacques, B., Shen, L., Mohler, J., McMahon, J. A., and McMahon, A. P., 1993, Sonic hedgehog, a member of a family of putative signaling molecules, is implicated in the regulation of CNS polarity, Cell 75(1417-1430). Eicher, E., Washburn, L., 1977., research news. Mouse News Lett., 56: 43. Eipers, P. G., Barnoski, B. L., Han, J., Carroll, A. J., and Kidd, V. J., 1991, Localization of the expressed human p58 protein kinase chromosomal gene to chromosome lp36 and a highly related sequence to chromosome 15, Genomics ll(3):621-9. Elwood, J. M., and Elwood, J. H., 1980, Epidemiology of anencephalus and spina bifida, Oxford University Press, Oxford. Embury, S., Seller, M. J., Adinolfi, M., and Polani, P. E., 1979, Neural tube defects in curly-tail mice. I. Incidence, expression and similarity to the human condition, Proc R Soc Land B Biol Sci 206(1162):85-94. Essien, F. B., 1992, Maternal methionine supplementation promotes the remediation of axial defects in Axd mouse neural tube mutants, Teratology 45:205-212. Essien, F. B., and Wannberg, S. L., 1993, Methionine but not folinic acid or vitamin B-12 alters the frequency of neural tube defects in Axd mutant mice, JNutr 123(l):27-34. Estibeiro, J. P., Brook, F. A., and Copp, A. J., 1993, Interaction between splotch (Sp) and curly tail (ct) mouse mutants in the embryonic development of neural tube defects, Development 119(1): 113-21.  109  Ewart, J. L., Cohen, M. F., Meyer, R. A., Huang, G. Y., Wessels, A., Gourdie, R. G., Chin, A. J., Park, S. M., Lazatin, B. O., Villabon, S., and Lo, C. W., 1997, Heart and neural tube defects in transgenic mice overexpressing the Cx43 gap junction gene, Development 124(7): 1281-92. Falconer, D. S., 1965, The inheritance of liability to certain diseases, estimated from the incidence among relatives, Annals of Human Genetics 29:51-76. Fleming, A., and Copp, A. J., 1998, Embryonic folate metabolism and mouse neural tube defects, Science 280(5372):2107-9. Fleming, A., and Copp, A.J., 2000, A genetic risk factor for mouse neural tube defects: defining the embryonic basis, Human Molecular Genetics 9(4): 575-581. Fode, C , Gradwohl, G , Morin, X., Dierich, A., LeMeur, M., Goridis, C , and Guillemot, F., 1998, The bHLH protein NEUROGENIN 2 is a determination factor for epibranchial placode-derived sensory neurons, Neuron 20:483-494. Fraser, F. C , 1976, The multifactorial/threshold concept ~ uses and misuses, Teratology 14(3):267-80. Fraser, F. C , and Nora, J. J., 1986,, in: Genetics in Man, Lea & Febriger, Philadelphia, pp. 173-189. Frecker, M. F., Fraser, F. C , and Heneghan, W. D., 1988, Are 'upper' and 'lower' neural tube defects aetiologically different?, J Med Genet 25(7):503-4. Garabedian, B. H., and Fraser, F. C , 1993, Upper and lower neural tube defects: an alternate hypothesis, J Med Genet 30(10):849-51. Garber, E. D., 1952, "Bent-tail", a dominant, sex-linked mutation in the mouse, Proceedings of the National Academy of Sciences. U.S.A. 38:876-879. Geelen, J. A., and Langman, J., 1977, Closure of the neural tube in the cephalic region of the mouse embryo, Anat Rec 189(4):625-40. Golden, J. A., and Chernoff, G. F., 1993, Intermittent pattern of neural tube closure in two strains of mice, Teratology 47(l):73-80. Golden, J. A., and Chernoff, G. F., 1995, Multiple sites of anterior neural tube closure in humans: evidence from anterior neural tube defects (anencephaly), Pediatrics 95(4):506-10. Goulding, M.D., Chalepakis, G., Deutsch, U., Erselius, J.R., and Gruss, P. 1991, Pax-3, a novel murine DNA binding protein expressed during early neurogenesis. The EMBO Journal 10(5): 1135-1147. Gowen, L.C., Johnson, B.L., Latour, A.M., Sulik, K.K., and Koller, B.H., 1996. Brcal deficiency results in early embryonic lethality characterized by neuroepithelial abnormalities. Nature Genetics 12: 191-194. Greene, N. D., and Copp, A. J., 1997, Inositol prevents folate-resistant neural tube defects in the mouse, Nat Med 3(l):60-6. Gruneberg, H., 1952, Genetical studies on the skeleton of the mouse IV. Quasi-continuous variations, Journal of Genetics 51:95-114. Gruneberg, H., 1954, Genetical studies on the skeleton of the mouse VIII. curly-tail, Journal of Genetics 52:52-67. Gunn, T. M., 1996, Ph.D. Thesis: Genetic and developmental studies of abnormal neural tube closure in SELH/Bc mice, University of British Columbia, Vancouver. Gunn, T. M., Juriloff, D. M., and Harris, M. J., 1992, Further genetic studies of the cause of exencephaly in SELH mice, Teratology 45(6):679-86. Gunn, T. M., Juriloff, D. M., and Harris, M. J., 1995, Genetically determined absence of an initiation site of cranial neural tube closure is causally related to exencephaly in SELH/Bc mouse embryos, Teratology 52(2): 1018. Gunn, T. M., Juriloff, D. M., and Harris, M. J., 1996, Exencephaly and cleft cerebellum in SELH/Bc mouse embryos are alternative developmental consequences of the same underlying genetic defect, Teratology 54(5):230-6. Gunn, T. M., Juriloff, D. M., Vogl, W., Harris, M. J., and Miller, J. E., 1993, Histological study of the cranial neural folds of mice genetically liable to exencephaly, Teratology 48(5):459-71. Hall, J. G., Friedman, J. M., Keena, B. A., Popkin, J., Jawanda, M., and Arnold, W., 1988, Clinical, genetic, and epidemiological factors in neural tube defects, Am J Hum Genet 43(6):827-37. Hall, J. L., 1996, M.Sc. Thesis: Environmental modification of the expression of neural tube defects in SELH/Bc mice, University of British Columbia, Vancouver, pp. 154. Hall, J. L., Harris, M. J., and Juriloff, D. M., 1997, Effect of multifactorial genetic liability to exencephaly on the teratogenic effect of valproic acid in mice, Teratology 55(5):306-13. Harris, M. J., 2001, Why are the genes that cause risk of human neural tube defects so hard to find?, Teratology 63(5): 165-6. Harris, M. J., and Juriloff, D. M., 1997, Genetic landmarks for defects in mouse neural tube closure, Teratology 56(3): 177-87. Harris, M. J., and Juriloff, D. M., 1999, Mini-review: toward understanding mechanisms of genetic neural tube defects in mice, Teratology 60(5):292-305.  110  Harris, M. J., Juriloff, D. M., Gunn, T. M., and Miller, J. E., 1994, Development of the cerebellar defect in ataxic SELH/Bc mice, Teratology 50(l):63-73. Haviland, M. B., and Essien, F. B., 1990, Expression of the Axd (axial defects) mutation in the mouse is insensitive to retinoic acid at low dose, J Exp Zool 256(3):342-6; Hildebrand, J. D., and Soriano, P., 1999, Shroom, a PDZ domain-containing actin-binding protein, is required for neural tube morphogenesis in mice, Cell 99(5):485-97. Hofmann, M., Harris, M., Juriloff, D., and Boehm, T., 1998, Spontaneous mutations in SELH/Bc mice due to insertions of early transposons: molecular characterization of null alleles at the nude and albino loci, Genomics 52(1): 107-9. Hollander, M. C , Sheikh, M. S., Bulavin, D. V., Lundgren, K., Augeri-Henmueller, L., Shehee, R., Molinaro, T. A., Kim, K. E., Tolosa, E., Ashwell, J. D., Rosenberg, M. P., Zhan, Q., Fernandez-Salguero, P. M., Morgan, W. F., Deng, C.-X., and Fornace Jr., A. J., 1999, Genomic instability in Gadd4 5 a-deficknt mice, Nature Genetics 23:176-184. Holub, B. J., 1982, The nutritional significance, metabolism, and function of myo-inositol and phosphatidylinositol in health and disease, Adv Nutr Res 4:107-41. Homanics, G. E., Maeda, N., Traber, M. G., Kayden, H. J., Dehart, D. B., and Sulik, K. K., 1995, Exencephaly and hydrocephaly in mice with targeted modification of the apolipoprotein B (Apob) gene, Teratology 51(1): 110. Johnson, D.R., 1976., The interfrontal bone and mutant genes in the mouse. J. Anat 121(3): 507-513. Jostes, B., Walther, C , and Gruss, P., 1990, The murine paired box gene, Pax7, is expressed specifically during the development of the nervous and muscular system, Mech Dev 33(l):27-37. Juriloff, D. M., and Harris, M. J., 1998, Animal models of neural tube defects, Mental Retardation and Developmental Disabilities Research Reviews 4:254-263. Juriloff, D. M., and Harris, M. J., 2000, Mouse models for neural tube closure defects, Hum Mol Genet 9(6):9931000. Juriloff, D. M., Harris, M. J., Harrod, M. L., Gunn, T. M., and Miller, J. E., 1993, Ataxia and a cerebellar defect in the exencephaly-prone SELH/Bc mouse stock, Teratology 47(4):333-40. Juriloff, D. M., Macdonald, K. B., and Harris, M. J., 1989, Genetic analysis of the cause of exencephaly in the SELH/Bc mouse stock, Teratology 40(4):395-405. Juriloff, D. M., Porter, S. D., and Harris, M. J., 1994, Three spontaneous mutations at the albino locus in SELH/Bc mice, Genome 37(2): 190-7. Juriloff, D.M., Harris, M.J., and Brown, C.J., 2001a, Unraveling the complex genetics of cleft lip in the mouse model. Mammalian Genome 12: 426-435. Juriloff, D.M., Gunn, T.M., Harris, M.J., Mah, D.G., Wu, M.K., and Dewell, S.L., 2001b, Multifactorial genetics of exencephaly in SELH/Bc mice, Teratology 64(4): 189-200. Kalousek, D. K., Fitch, N., and Paradice, B. A., 1990, Central Nervous System Defects, in: Pathology of the human embryo andpreviable fetus: an atlas, Springer-Verlag, New York, pp. 66-68. Kalter, H., and Warkany, J., 1961, Experimental production of congenital malformations in strains of inbred mice by maternal treatment with hypervitaminosis A, The American Journal of Pathology 38(1): 1-21. Keena, B., Sadovnick, A.D., Baird, P.A., and Hall, J.G., 1986, Risks to sibs of probands with neural tube defects: data for clinic populations in British Columbia, American Journal of Medical Genetics 25 563-573. Klootwijk, R., Franke, B., van der Zee, C. E. E., de Boer, R. T., Wilms, W., Hoi, F. A., and Mariman, E. C. M., 2000, A deletion encompassing Zic3 in Bent tail, a mouse model for X-linked neural tube defects, Human Molecular Genetics 9(11): 1615-1622. Koehn, D., Juriloff, D. M., and Harris, M. J., 1988, Research news, Mouse Newsletter 80:151-152. Kurnit, D. M., Layton, W. M., and Matthysse, S., 1987, Genetics, chance, and morphogenesis, Am J Hum Genet 41(6):979-95. Labosky, P. A., Winnier, G. E., Jetton, T. L., Hargett, L., Ryan, A. K., Rosenfeld, M. G., Parlow, A. F., and Hogan, B. L., 1997, The winged helix gene, Mf3, is required for normal development of the diencephalon and midbrain, postnatal growth and the milk-ejection reflex, Development 124:1263-1274. Lakkis, M. M., Golden, J. A., O'Shea, K. S., and Epstein, J. A., 1999, Neurofibromin deficiency in mice causes exencephaly and is a modifier of Splotch neural tube defects, Developmental Biology 212:80-92. Lary, J. M., and Edmonds, L. D., 1996, Prevalence of spina bifida at birth-United States, 1983-1990: a comparison of two surveillance systems, Mor Mortal Wkly Rep CDC Surveill Summ 45(2): 15-26. Lemire, R. J., Beckwith, B. J., and Warkany, J., 1978, Incidences, etiology, and epidemiology, in: Anencephaly, Raven Press; New York, pp. 11-49. Lemire, R. J., Loeser, J. D., Leech, R. W., and Alvord, E. C , 1975, Normal and abnormal development of the human nervous system, Harper and Row, New York, pp. 54-83.  Ill  Letts, V. A., Schork, N. J., Copp, A. J., Bernfield, M., and Frankel, W. N., 1995, A curly-tail modifier locus, mctl, on mouse chromosome 17, Genomics 29(3):719-24. Lo, C. W., Cohen, M. F., Huang, G.-Y., Lazatin, B. O., Patel, N., Sullivan, R., Pauken, C , and Park, S. M. J., 1997, Cx43 gap junction gene expression and gap junctional communication in mouse neural crest cells, Developmental Genetics 20:119-132. Lobach, D. F., Rochelle, J. M., Watson, M. L., Seldin, M. F., and Blackshear, P. J., 1993, Nucleotide sequence, expression, and chromosomal mapping of Mrp and mapping of five related sequences, Genomics 17(1): 194-204. Lomaga, M. A., Henderson, J. T., Elia, A. J., Robertson, J., Noyce, R. S., Yeh, W.-C, and Mak, T. W , 2000, Tumor necrosis factor receptor-associated factor 6 (TRAF6) deficiency results in exencephaly and is required for apoptosis within the developing CNS, The Journal of Neuroscience 20(19):7384-7393. Macdonald, K. B., Juriloff, D. M., and Harris, M. J., 1989, Developmental study of neural tube closure in a mouse stock with a high incidence of exencephaly, Teratology 39(2): 195-213. Matsuda, M., 1990, Comparison of the incidence of 5-azacytidine-induced exencephaly between MT/Hokldr and Slc:ICR mice, Teratology 41:147-154. McBride, M. L., 1977, M.Sc. Thesis: Familial risks of anencephaly and spina bifida in British Columbia, University of British Columbia, Vancouver. McBride, M. L., 1979, Sib risk of anencephaly and spina bifida in British Columbia, Am J Med Genet 3(4):377-87. McMahon, J.A., Takada, S., Zimmerman, L.B., Fan, C.-M., Harland, R.M., and McMahon, A.P. 1998., Nogginmediated antagonism of BMP signaling is required for growth and patterning of the neural tube and somite. Genes and Development 12: 1438-1452. Miner, J. H., Cunningham, J., and Sanes, J. R., 1998, Roles for laminin in embryogenesis: exencephaly, syndactyly, and placentopathy in mice lacking the laminin alpha5 chain, J Cell Biol 143(6):1713-23. Mitchell, L. E., 1997, Genetic epidemiology of birth defects: nonsyndromic cleft lip and neural tube defects, Epidemiol Rev 19(l):61-8. Moase, C. E., and Trasler, D. G., 1987, Retinoic acid-induced selective mortality of splotch-delayed mouse neural tube defect mutants, Teratology 36(3):335-43. Moase, C.E., and Trasler, D.G., 1991, N-CAM alterations in splotch neural tube defect mouse embryos, Development 113: 1049-1058. Morrison, K., Papapetrou, C , Hoi, F. A., Mariman, E. C , Lynch, S. A., Burn, J., and Edwards, Y. H., 1998, Susceptibility to spina bifida; an association study of five candidate genes, Ann Hum Genet 62(Pt 5):37996. MRC, UK, 1991, Prevention of neural tube defects: results of the Medical Research Council Vitamin MRC Vitamin Study Research Group, Lancet 338(8760): 131-7. Muller, F., and O'Rahilly, R., 1987, The development of the human brain, the closure of the caudal neuropore, and the beginning of secondary neurulation at stage 12, Anat Embryol (Berl) 176(4):413-30. Mutchinick, O. M., Lopez, M. A., Luna, L., Waxman, J., and Babinsky, V. E., 1999, High prevalence of the thermolabile methylenetetrahydrofolate reductase variant in Mexico: a country with a very high prevalence of neural tube defects, Mol Genet Metab 68(4):461-7. Nakatsu, T., Uwabe, C , and Shiota, K., 2000, Neural tube closure in humans initiates at multiple sites: evidence from human embryos and implications for the pathogenesis of neural tube defects, Anat Embryol (Berl) 201(6):455-66. Neale, S.A., and Trasler, D.G. 1994. Early sialylation on N-CAM in Splotch neural tube defect mouse embryos. Teratology 50 : 118-124. Neumann, P. E., Frankel, W. N., Letts, V. A., Coffin, J. M., Copp, A. J., and Bernfield, M., 1994, Multifactorial inheritance of neural tube defects: localization of the major gene and recognition of modifiers in ct mutant mice, Nat Genet 6(4):357-62. Nora, J. J., Fraser, F. C , Bear, J., Greenberg, C. R., Patterson, D., and Warburton, D., 1994, Multifactorial Inheritance, in: Medical Genetics: Principles and Practice, Lea and Febriger, Malvern, Pennsylvania, pp. 260-269. Padmanabhan, R., Wasfi, I.A., Craigmyle, M.B.L., 1994, Effect of pre-treatment with aspirin on alcohol-induced neural tube defects in the TO mouse fetuses, Drug and Alcohol Dependence 36: 175-186. Papp, Z., Csecsei, K., Toth, Z., Polgar, K., and Szeifert, G. T., 1986, Exencephaly in human fetuses, Clin Genet 30(5):440-4. Park, C.-H. T., Pruitt, J. H., and Bennett, D., 1989, A mouse model for neural tube defects: the Curtailed (T~) mutation produces spina bifida occulta in 7*7+ animals and spina bifida with meningomyelocele in T°/t, Teratology 39:303-312.  112  Peeters, M. C , Geelen, J. L., Hekking, J. W., Chavannes, N., Geraedts, J. P., and van Straaten, H. W., 1998, Reduced glucose consumption in the curly tail mouse does not initiate the pathogenesis leading to spinal neural tube defects, JNutr 128(10): 1819-28. Peters, P. W., Dormans, J. A., and Geelen, J. A., 1979, Light microscopic and ultrastructural observations in advanced stages of induced exencephaly and spinal bifida, Teratology 19(2): 183-95. Raabe, M., Flynn, L. M., Zlot, C. H., Wong, J. S., Veniant, M. M., Hamilton, R. L., and Young, S. G., 1998, Knockout of the abetalipoproteinemia gene in mice: Reduced lipoprotein secretion in heterozygotes and embryonic lethality in homozygotes, Proceedings of the National Academy of Sciences. U.S.A. 95:86868691. Reece, E. A., Homko, C. J., Wu, Y. K., and Wiznitzer, A., 1993, Metabolic fuel mixtures and diabetic embryopathy, Clin Perinatol 20(3):517-32. Sah, V. P., Attardi, L. D., Mulligan, G. J., Williams, B. O., Bronson, R. T., and Jacks, T., 1995, A subset of p53deficient embryos exhibit exencephaly, Nat Genet 10(2): 175-80. Sambrook, J., Fritsch, E.F., and Maniatis, T., 1989., Molecular Cloning: A Laboratory Manual, 2 Ed. Cold Springs Harbour Laboratory Press, USA. Sartor, O., Moriuchi, R., Sameshima, J. H., Severino, M., Gutkind, J. S., and Robbins, K. C , 1992, Diverse biologic properties imparted by the c-fgr proto-oncogene, The Journal of Biological Chemistry 267(5):3460-3465. Schoenwolf, G. C , Folsom, D., and Moe, A., 1988, A reexamination of the role of microfilaments in neurulation in the chick embryo, Anat Rec 220(1):87-102. Schoenwolf, G. C , and Franks, M. V., 1984, Quantitative analyses of changes in cell shapes during bending of the avian neural plate, Dev Biol 105(2):257-72. Seller, M. J., 1990, Neural tube defects: are neurulation and canalization forms causally distinct?, Am J Med Genet 35(3):394-6. Seller, M. J., 1994, Vitamins, folic acid and the cause and prevention of neural tube defects, Ciba Found Symp 181:161-73; discussion 173-9. Seller, M. J., and Adinolfi, M., 1979, Neural tube defects in curly-tail mice. I. Incidence, expression and similarity to the human condition, Proc R Soc LondB Biol Sci 206(1162):85-94. Seller, M. J., Embury, S., Polani, P. E., and Adinolfi, M., 1979, Neural tube defects in curly-tail mice. II. Effect of maternal administration of vitamin A, Proc R Soc LondB Biol Sci 206(1162):95-107. Seller, M. J., and Perkins, K. J., 1983, Effect of hydroxyurea on neural tube defects in the curly-tail mouse, J Craniofac Genet Dev Biol 3(1): 11-7. Seller, M. J., and Perkins, K. J., 1986, Effect of mitomycin C on the neural tube defects of the curly-tail mouse, Teratology 33(3):305-9. Seller, M. J., and Perkins-Cole, K. J., 1987, Hyperthermia and neural tube defects of the curly-tail mouse, J Craniofac Genet Dev Biol 7(4):321-30. Silver, L. M., 1995, Reproduction and Breeding, in: Mouse genetics: concepts and applications, Oxford University Press, Oxford, pp. 62-73. Smithells, R. W., Nevin, N. C , Seller, M. J., Sheppard, S., Harris, R, Read, A. P., Fielding, D. W., Walker, S., Schorah, C. J., and Wild, J., 1983, Further experience of vitamin supplementation for prevention of neural tube defect recurrences, Lancet 1(8332): 1027-31. Steegers-Theunissen, R. P., Boers, G. H., Trijbels, F. J., and Eskes, T. K., 1991, Neural-tube defects and derangement of homocysteine metabolism, N Engl J Med 324(3): 199-200. Stumpo, D. J., Bock, C. B., Turtle, J. S., and Blackshear, B. J., 1995, MARCKS-deficiency in mice leads to abnormal brain development and perinatal death, Proceedings of the National Academy of Sciences. U.S.A. 92:944-948. Stumpo, D. J., Eddy, R. L., Jr., Haley, L. L., Sait, S., Shows, T. B., Lai, W. S, Young, W. S., 3rd, Speer, M. C , Dehejia, A., Polymeropoulos, M., and Blackshear, P. J., 1998, Promoter sequence, expression, and fine chromosomal mapping of the human gene (MLP) encoding the MARCKS-like protein: identification of neighboring and linked polymorphic loci for MLP and MACS and use in the evaluation of human neural tube defects, Genomics 49(2):253-64. Takeuchi, T., Yamazaki, Y., Katoh-Fukui, Y., Tsuchiya, R., Kondo, S., Motoyama, J., and Higashinakagawa, T., 1995, Gene trap capture of a novel mouse gene, jumonji, required for neural tube formation, Genes Dev 9(10):12l 1-22. Taylor, L. A., Harris, M. J., and Juriloff, D. M., 2000, Whiskers amiss, a new vibrissae and hair mutation near the Krtl cluster on mouse chromosome 11, Mamm Genome ll(4):255-9. Theiler, K., 1989, The House Mouse. Atlas of Embryonic Development., Springer-Verlag, New York. Tom, C , Juriloff, D. M., and Harris, M. J., 1991, Studies of the effect of retinoic acid on anterior neural tube closure in mice genetically liable to exencephaly, Teratology 43(l):27-40. nd  113  Toriello, H. V., and Higgins, J. V., 1985, Possible causal heterogeneity in spina bifida cystica, Am J Med Genet 21(l):13-20. Torok, O., and Papp, Z., 1991, Are the neurulation and canalization forms of neural tube defects causally distinct?, Am J Med Genet 39(2):241. Torres, M., Gomez-Pardo, E., and Grass, P., 1996, Pax2 contributes to inner ear patterning and optic nerve trajectory, Development 122:3381-3391. Trembath, D., Sherbondy, A. L., Vandyke, D. C., Shaw, G. M., Todoroff, K., Lammer, E. J., Finnell, R. H., Marker, S., Lerner, G., and Murray, J. C., 1999, Analysis of select folate pathway genes, PAX3, and human T in a Midwestern neural tube defect population, Teratology 59(5):331-41. Tyan, M. L., 1992, Effects of H-2 on neural tube defects in congenic mice, Proceedings of the Society for Experimental Biology and Medicine 200:487-489. Umekage, T., and Kato, K., 1991, A mouse brain cDNA encodes a novel protein with the protein kinase C phosphorylation site domain common to MARCKS, FEBS Lett 286(1-2): 147-51. Unger, A. E., Harris, M. J., Bernstein, S. E., Falconer, J. C , and Lux, S. E., 1983, Hemolytic anemia in the mouse. Report of a new mutation and clarification of its genetics, J Hered 74(2):88-92. Van Allen, M. I., Kalousek, D. K., Chernoff, G. F., Juriloff, D., Harris, M., McGillivray, B. C , Yong, S. L., Langlois, S., MacLeod, P. M., Chitayat, D., and et al., 1993, Evidence for multi-site closure of the neural tube in humans, Am J Med Genet 47(5):723-43. van der Put, N. M., Gabreels, F., Stevens, E. M., Smeitink, J. A., Trijbels, F. J., Eskes, T. K., van den Heuvel, L. P., and Blom, H. J., 1998, A second common mutation in the methylenetetrahydrofolate reductase gene: an additional risk factor for neural-tube defects?, Am J Hum Genet 62(5): 1044-51. van der Put, N. M., van Straaten, H. W., Trijbels, F. J., and Blom, H. J., 2001, Folate, homocysteine and neural tube defects: an overview, Exp Biol Med (Maywood) 226(4):243-70. van Straaten, H. W., Blom, H., Peeters, M. C , Rousseau, A. M., Cole, K. J., and Seller, M. J., 1995, Dietary methionine does not reduce penetrance in curly tail mice but causes a phenotype-specific decrease in embryonic growth, JNutr 125(11):2733-40. van Straaten, H. W., and Copp, A. J., 2001, Curly tail: a 50-year history of the mouse spina bifida model, Anat Embryol (Bed) 203(4):225-37. van Straaten, H. W., Hekking, J. W., Consten, C , and Copp, A. J., 1993, Intrinsic and extrinsic factors in the mechanism of neurulation: effect of curvature of the body axis on closure of the posterior neuropore, Development 117(3): 1163-72. Vogelweid, C. M., Vogt, D. W., Besch-Williford, C. L., and Walker, S. E., 1993, New Zealand white mice: an experimental model of exencephaly, Laboratory Animal Science 43(l):58-60. Wald, N. J., and Kennard, A., 1992, Prenatal biochemical screening for Down's syndrome and neural tube defects, Curr Opin Obstet Gynecol 4(2):302-7. Wallace, M. E., Knights, P. J., and Anderson, J. R., 1978, Inheritance and morphology of exencephaly, a neonatal lethal recessive with partial penetrance, in the house mouse, Genet Res 32(2): 135-49. Wenstrom, K. D., Johanning, G. L., Owen, J., Johnston, K . E . , Acton, S., Cliver, S., and Tamura, T., 2000, Amniotic fluid homocysteine levels, 5,10-methylenetetrahydrafolate reductase genotypes, and neural tube closure sites, Am J Med Genet 90(1):6-11. Werler, M. M., Shapiro, S., and Mitchell, A. A., 1993, Periconceptional folic acid exposure and risk of occurrent neural tube defects, Jama 269(10): 1257-61. Wilson, D. B., and Wyatt, D. P., 1992, Aberrant convergence of the neural folds in the mouse mutant vl, Teratology 45(1):105-12. Wolff, G. L., Kodell, R. L., Moore, S. R., and Cooney, C. A., 1998, Maternal epigenetics and methyl supplements affect agouti gene expression in A y/ mice, the FASEB Journal 19:949-957. Wu, M., Chen, D. F., Sasaoka, T., and Tonegawa, S., 1996, Neural tube defects and abnormal brain development in F52-deficient mice, Proc NatlAcadSci USA 93(5):2110-5. Yang, X.-M., and Trasler, D.G. 1991. Abnormalities of neural tube formation in pre-spina bifida Splotch-delayed mouse embryos. Teratology 432: 643-657. Yao, T. P., Oh, S. P., Fuchs, M., Zhou, N. D., Cheng, L. E., Newsome, D., Bronson, R. T., Li, E., Livingston, D. M., and Eckner, R., 1998, Gene dosage-dependent embryonic development and proliferation defects in mice lacking the transcriptional integrator p300, Cell 93(3):361-72. Ybot-Gonzalez, P., and Copp, A. J., 1999, Bending of the neural plate during mouse spinal neurulation is independent of actin microfilaments, Dev Dyn 215(3):273-83. Zhao, Q., Behringer, R. R., and de Crombrugghe, B., 1996, Prenatal folic acid treatment suppresses acrania and meroanencephaly in mice mutant for the Cartl homeobox gene, Nat Genet 13(3):275-83. v  a  114  Appendix A. Data for frequency of exencephaly in £14 offspring of myoinositol supplemented and unsupplemented SELH/Bc dams.  Table A.l. Exencephaly observed in E14 SELH/Bc collected from SELH/Bc mothers who had received 200 mg/1 myo-inositol in drinking water. SELH/Bc Number with Number Number SELH/Bc Number of Number of male # female # exencephaly normal of moles scoreable implantations embryos A7000 A7002 A6981 A6996 A6998 A6987 A6981 A6998 A6994 A6987 A6996 A7002 A7000  9454 9432 A6965 9468 9428 9443 A6967 9430 9481 9447 9458 9451 9438  4 1 3 0 4 2 1 0 1 3 1 2 4  9 12 8 8 8 4 10 9 2 10 13 6 4  1 0 0 0 0 0 0 2 0 0 0 0 3  13 13 11 8 12 6 11 9 3 13 14 8 8  14 13 11 8 12 6 11 11 3 13 14 8 11  Table A.2. Exencephaly observed in E14 SELH/Bc collected from SELH/Bc mothers who had received regular acidified (pH 3.1) drinking water. SELHA/Bc SELH(A)/Bc Number with Number Number Number of Number of male # female # exencephaly normal of moles scoreable implantations embryos A6999 A7001 A7001 A6997 A6982 A6978 A6997 A6980 A6982 A6978 A6995 A6985 A6980 A6999  9439 9452 9431 9473 A6964 9459 9429 9464 A6966 9457 9480 9477 9470 9453  3 1 6 2 5 0 1 5 4 0 4 1 0 0  6 9 8 8 2 11 11 8 8 13 2 8 2 3  115  1 1 1 0 0 1 1 0 0 0 1 1 0 2  9 10 14 10 7 11 12 13 12 13 6 9 2 3  10 11 15 10 7 12 13 13 12 13 7 10 2 5  Appendix B. SSLP markers screened in the SELH/Bc X "CT strain" cross and genotypes of two or three pooled SELH/Bc "CT strain" F2 litters. Table B.l. Chromosome 4 markers screened in SELH/Bc X "CT strain" includes PCR condition, and estimated allele sizes for each strain (= indicates that the markers were not informative between strains, but allele size is still reported) Position Marker T i Allele size (bp) [Mgcy *  (cM) 57.80 69.80 71.00 71.00 71.00 77.00 79.00  57.40 57.40 59.10 61.90 63.40 66.00 66.60 69.75 69.75 69.80 71.00 71.00 78.50 79.00  D4MU279 D4MU65 D4MU232 D4MU13 D4MU129 . D4MU49 D4MU33 D4MU308 D4MU11 D4MU16 D4MU71 D4MU69 D4MU68 D4MU170 D4MU32 D4MU64 D4MU48 D4MU234 D4MU285 D4MU14 D4MU190  anneal  (mM)  CQ  SELH/Bc  "CT strain"  3.5  55  135  145  145  135  1.5  Hot start 5 5 Hot start 5 5  1.5  3.5  140  125  55  110  100  1.5  55  135  130  2.5  55  150  145  1.5  Hot start 5 5  145  140  3.5  55  =  1.5  55  2.5  55  1.5  55  1.5  55  1.5  55  1.5  55  =  105  No product = =  235  =  130  No product = = =  1.5  55  1.5  Hot start 5 5  3.5  55  1.5  55  = = = =  100 150 150 150  No product No product No product  1.5  55  1.5  60  130  1.5  50  No product  =  Table B.2. Chromosome 5 markers screened in SELH/Bc X "CT strain" includes PCR condition, and estimated allele size for each strain (= indicates that the markers were not informative between strains allele size is still reported) Position Marker [MgCl ] Allele size (bp) T anneal 2  (cM) 68.00 85.00  68.00 69.00 69.00 78.00 78.00 78.00 80.00  D5MU95 D5MU122 D5MU160 D5MU138 D5MU426 D5MU31 D5MU98 D5MU168 D5MU99  (mM)  (°C)  SELH/Bc  "CT strain"  1.5  55  135  130  1.5  55  160  165  1.5  55  1.5  55  1.5  55  1.5  55  1.5  55  1.5  55  1.5  55  —  =  140 140  _ =  No product = = = =  116  210 170 150 200  = = = =  Table B.3. Chromosome 10 markers screened in SELH/Bc X "CT strain" includes PCR condition, and estimated allele size for each strain (= indicates that the markers were not informative between strains, but allele size is still reported) T Position Marker Allele size (bp) [Mgcy * anneal (cM) (mM) SELH/Bc (°C) "CT strain" 40.70 56.00 67.50  44.00 59.00 59.00 59.00 62.00 64.00 65.00 65.00 67.50 69.00 69.00  D10MU158 D10MU12 D10MU237 D10MU42 D10MU70 D10MU133 D10MU134 D10MH73 D10MU180 D10MU14 D10MU74 D10MU164 D10MU35 D10MU102  1.5  55  100  110  1.5  55  230  240  1.5  55  95  125  1.5  55  1.5  Hot start 5 5  1.5  55  1.5  55  1.5  55  1.5  55  1.5  55  1.5  55  1.5  55  3.5  55  1.5  55  = = =  =  200  = =  160 150  No product = = = = = = =  85  = = = = = =  200 195 200 150 250 180  Table B.4. Chromosome 11 markers screened in SELH/Bc X "CT strain" includes PCR condition, and estimated allele size for each strain (= indicates that the markers were not informative between strains, but allele size is still reported) T Position Marker [MgCl ] Allele size (bp) * anneal (cM) (mM) (°C) SELH/Bc "CT strain" 2  51.00 54.00 55.00 63.00 64.00 69.00 71.00 71.00 71.00  47.51 47.67 47.67 49.00 62.00 63.00 68.00 69.00 70.00 70.00 71.00 75.00 75.00 75.00 76.00 77.00 79.00  D11MU14 D11MU70 DUMU288 DllMitlO D11MU360 D11MU301 D11MU12 D11MU168 D11MU253 D11MU120 D11MU119 D11MU36 D11MU38 DU Mill 99 D11MU126 DllMitlOO DllMitll DUMU61 D11MU214 D11MU302 D11MU336 D11MU337 DUMU338 D11MU103 D11MU48 D11MU104  2.5  55  150  155  1.5  55  140  145  1.5  55  110  125  1.5  55  100  130  1.5  55  115  125  1.5  55  105  110  1.5  55  150  155  1.5  55  135  150  1.5  55  95  85  1.5  55  =  1.5  55  1.5  55  1.5  55  1.5  55  1.5  55  1.5  55  1.5  55  1.5  55  1.5  55  1.5  55  1.5  55  1.5  55  1.5  55  1.5  55  1.5  55  1.5  55  155  = = = = = =  _  130 .  230 150 150 180 110 240  = = = = = = =  No product No product =  110  =  No product No product = = = =  117  160 150 130 160  = = =  Table B.5. Chromosome 13 markers screened in SELH/Bc X "CT strain" includes PCR condition, and estimated allele size for each strain (= indicates that the markers were not informative between strains, but allele size is still reported) Position Marker [Mgcy Allele size (bp) T anneal (cM) (mM) SELH/Bc (°C) "CT strain" 10.00 19.00 30.00 30.00 30.00 35.00 35.00 35.00  D13MU3  37.00 39.00 40.00 40.00 43.00 47.00 49.00 57.00 61.00  D13MU39  11.00 34.00 37.00 37.00 40.00 40.00 40.00 43.00  D13MU133  44.00  D13MU69  45.00 47.00 52.00 54.00 59.00  D13MU126  59.00  1.5 3.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5 1.5  55 Hot start 55 55 55 55 55 55 55 55 55 55 55 55 55 55 55 55  200 120 110 110 100 135 160 165 200 125 150 120 165 160 105 120 170  1.5 2.5 1.5 3.5 1.5 1.5 1.5 1.5  55 55 55 55 55 55 55 55  =  55 55  D13MU45  1.5 1.5 1.5 1.5 1.5 3.5  D13MU75  3.5  D13MU117 D13MU64 D13MU91 D13MU179 D13MU13 D13MU20 D13MU21 D13MU231 D13MU99 D13MU254 D13MU41 D13MU159 D13MU147 D13MU287 D13MU76  D13MU248 D13MU66 D13MU67 D13MU11 D13MU256 D13MU257 D13MU193  D13MU110 D13MU30 D13MU51  =  ==  = = = = =  55 55 55 55 55  = =  118  160 125 100 100 110 145 170 170 210 120 180 140 170 140 110 120 160 140 No product 160 No product No product No product 120  —  =  =  150  =  170 140  = =  160 155 150 No product 160  = = = =  Table B.6. Chromosome 17 markers screened in SELH/Bc X "CT strain" includes PCR condition, and reported allele size for each strain (= indicates that the markers were not informative between strains, but allele size is still reported) T Position Marker [MgCl ] Allele size (bp) * anneal (cM) (mM) SELH/Bc (°C) "CT strain" 2  16.90 18.80 22.50 29.50  10.00 10.40 19.00 24.50 24.50 24.50 31.00  D17MU81 D17MU231 D17MU176 D17MU88 D17MU46 D17MU133 D17MU22 D17MU10 D17MU66 D17MU68 D17MU69  1.5  55  125  115  1.5  Hot start 5 5  115  125  1.5  55  170  175  1.5  55  190  240  1.5  Hot start 5 5  1.5  55  2.5  55  2.5  55  1.5  55  1.5  60  1.5  55  = = = = = = =  119  205 170 170 160 130  =  = = = =  140  =  190  =  Table B.7. Genotypes for 3 entire SELH/Bc X "CT strain" F litters for SELH/Bc and "CT strain" liability loci 2  SS cc SC SS cc SC SS SC cc SC cc SS SC SC SS SS SC SS cc SS SC SC SC cc SC cc SC SS cc SS SC SC cc cc SC SC SC cc cc cc cc cc  >•» U  SS SC cc SC cc SC SS SC SC SC cc SS cc SC SS SS SC SS cc SS SC SC SS cc SS cc SC SS cc SS SC SC SC cc SS SC SC cc cc cc cc cc  SC SS SC SC SC SS cc SS SS cc cc SS SS SC SS cc cc SS cc SC SC SC SC SS SS SC SC cc SC  to  1 a"  SC SC SC SS SC SS cc SS SS cc cc SS SS SC SS SC SC SS cc SC SC SC SC SS SC SC SC cc SC  SC cc SC SC SC SS SS SS SC cc cc SC SS SS SC SC SC SS cc SC cc SC SC SS SC SC SC SC cc  to  I  to rS  Ut  SC SC SC SC SC SS SS SC SC SC SC SC SC SS SC cc SC SC cc SC cc SS cc SS SS cc SC cc SC SC SS SC SC SC SC SC SC SC SC SC SC SC  to  to  to  1 1 1 1 u> ON  3 cc SC SC SC SC cc cc SC SS SC CC SC cc SS SC SC SC SC SC cc SC SC SS SS SS cc SC SC SC SC SC SS SC SS SC SC cc SC SS cc cc SC  to l*  cc SC SC SC SC cc cc SC SS SC cc SC cc SS SC SC SC SC SC cc SC SC SS SS SS cc SC SC SC SC SS SS SC SS SC cc cc SC SS cc cc SC  120  cc SC SC SC cc SC cc SC SS SC SC SS SC cc SC SC SC SC SC SC SS SC SS SS SS cc SC SC SC SC SS SS SC SS SC cc cc SC SS SC SC SS  Oo  ^cc SC SC SC cc SC cc SC SC SC SC SS SC cc SC SC SC SC SC SC SC SC SS SS SS SC cc SC SC SC SS SS SC SS SC CC cc SC SS SC SC SS  SC SC SC SC cc SS cc SC SC SC SC SS SC cc SC SC SC SC SC SC SS SC SS SS SC SC cc SC SC SC SS SS SC SS SC cc cc SC SS SC SC SS  SC SC SC SC SS cc SS cc SC SC cc SS cc SC cc cc SS SS cc SS SC SC cc SS SC SS SC SS cc  D17MM76  SC cc SC SS cc SC SS SC SC SC cc SC SC SC SS SS SC SC SC SC SC SC SC cc SC cc SC SS SC SS SC SC SC cc SC SC SC cc cc SC SC cc  1  to  D10MU237  1  to  D10MU158  Embryo #  01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 35 36 37 38 39 40 41 42 43  to  SC SC SC SC SS cc SS cc cc SC cc SS cc SC cc cc SS SS cc SC SC cc cc SC SC SS SC SS cc  to  1  1  Oo  SC SS SC cc SC cc SS cc cc cc cc SS cc SC cc cc SS SS cc SC SC cc SC SC SC SS SC SS cc  F M F F F M M F F F F M M M F M M M M F M F • F F M F M F M  Table B.8. (SELH/Bc X "curly tail stock") F NTD data Dam Sire #Normal #Moles #Exencephalic 02 05 13* 0 1* 03 06 14* 0 0 18 19 12* 1 1* 01 04 12 0 1 09 12 12 0 1 11 14 11 1 0 10 13 12 0 1 22 30 10 0 1 21 29 11 0 0 24 32 11 1 0 23 31 12 0 0 28 32 13 0 0 26 30 13 0 0 27 31 9 0 1 25 29 11 0 0 33 34 9 1 1 38 41 11# 0 1 39 42 10 0 0 40 43 11 0 0 48 50 10 2 0 51 53 11 0 0 49 50 12 0 0 52 54 14 0 0 56 14 (1/2 sib) 11 0 0 55 13 (1/2 sib) 11 0 0 59 63 12 0 1 65 68 12 0 1 66 68 13 0 1 + curly tail 57 61 11 0 0 58 62 13 0 0 60 64 13 0 0 67 68 14 0 0 69 71 13 0 0 70 72 11$ 1 0 76 78 12 0 0 77 78 12 0 0 81 85 11 0 0 82 85 11 1 0 80 84 12 0 0 79 84 9 0 1 83 86 8 1 1 88 91 9 0 0 87 90 9 0 1 95 98 10 1 0 96 99 9 0 0 97 100 7 1 1 89 92 14 0 0 105 111 10 0 0 104 110 12 1 0 108 113 11 0 0 109 114 9 2 1 106 111 11 0 0 107 112 10 0 0 103 110 9 0 1 116 118 11 0 1 2  121  #Spina bifida aperta 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 1 0 0 0 0 0 0 0 0 1 + curly tail 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0  #Tail Flexion 1* 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0  Table B.8. (SELH/Bc X "curly tail stock") F NTD data continued Dam Sire #Normal #Moles #Exencephalic #Spina bifida aperta 2  119  122  115 122 120 125 132  117 124 123 126 134  133  135  139  140  138  140  #Tail Flexion  12(1/12 dying) 14 12 11 11 11  0  0  0  0  0 0 1 0 0  0 0 0 1 0  0 0 0 0 0  15 (1/15 edematous) 12  0  2  0 0 0 0 1 (edematous with curly tail) 0  0  0  0  11 (1/11 dying D12)  1  2(1/2 has curly tail) 1  0  0  * used for mapping # 1 normal has blister on top of head $ 1 normal with ventrally curved body  122  0  Appendix C. Data for frequency of NTD in BQ individuals of (BXA-7/Pgn X "CT strain") X "CT strain". Table C l . Exencephaly spina bifida aperta, and flexed tail observed in E14 BC1 embryos of "CT strain" X BXA-7/Pgn to "CT strain ' collected by D.M. Juriloff and M.J. Harris. "CT strain" Fi # with # with # # # #of #of male # female EX SBA with normal moles scoreable implantations # FT embryos 2572 2578 2578 2572 2592 2572 2572 2592 2578  06 07 08 12 04 01 02 17A 17B  0 1* 0 0 0 0 0 0 0  0 0 0 0 0 0 1* 0 0  2 1 2 4 2 2 0 1 1  9 7 9 6 7 9 8 7 9  0 0 0 1 1 0 0 0 0  *also has flexed tail and not included in the number with flexed tail alone  123  11 9 11 10 9 11 9 8 10  11 9 11 11 10 11 9 8 10  Appendix D. SSLP markers screened in SELH/Bc X LM/Bc cross. Table D.l. Chromosome 11 markers screened in SELH/Bc X LM/Bc includes PCR condition, and estimated allele size for each strain (= indicates that the markers were not informative between strains, but allele size is still reported) Position Marker Allele size (bp) [MgClJ T anneal (cM) (mM) SELH/Bc LM/Bc CQ 51.00 65.00  65.00 66.00 69.00 71.00 71.00  D11MU14 D11MU258  D11MU223 D11MU224 D11MUJ301 D11MUJ253 D11MUJ302  2.5  55  140  150  1.5  55  160  165  1.5  55  1.5  55  1.5  55  1.5  55  1.5  55  = = = = =  150 160 110 100 110  = = = = =  Table D.2. Chromosome 13 markers screened in SELH/Bc X LM/Bc includes PCR condition, and estimated allele size for each strain (= indicates that the markers were not informative between strains, but allele size is still reported) T Position Marker [MgClJ Allele size (bp) anneal (cM) (mM) SELH/Bc LM/Bc CQ 1  30.00 35.00 37.00  D13MU13 D13MU91 D13Bcl(Lect2)  1.5  55  100  110  2.5  55  95  105  2.5  55  95  105  Table D.3. Chromosome X markers screened in SELH/Bc X LM/Bc includes PCR condition, and estimated allele size for each strains (= indicates that the markers were not informative between strains, but allele size is still reported) T Position Marker [MgCl ] Allele size (bp) * anneal (cM) (mM) SELH/Bc LM/Bc CC) 2  19.00 37.00 65.40  62.00 63.00 41.50  DXMU73 DXMU16 DXMU80  DXMU197 DXMU36 DXMU170  1.5  55  113  123  1.5  55  90  118  1.5  55  141  147  1.5  55  1.5  55  1.5  55  No product = =  124  146 194  = =  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0090253/manifest

Comment

Related Items