Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Investigating mating system of white pine weevil, Pissodes strobi (Coleoptera: Curculionaidae) using… Liewlaksaneeyanawin, Cherdsak 2000

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2001-0063.pdf [ 5.53MB ]
Metadata
JSON: 831-1.0089683.json
JSON-LD: 831-1.0089683-ld.json
RDF/XML (Pretty): 831-1.0089683-rdf.xml
RDF/JSON: 831-1.0089683-rdf.json
Turtle: 831-1.0089683-turtle.txt
N-Triples: 831-1.0089683-rdf-ntriples.txt
Original Record: 831-1.0089683-source.json
Full Text
831-1.0089683-fulltext.txt
Citation
831-1.0089683.ris

Full Text

INVESTIGATING MATING SYSTEM OF WHITE PINE WEEVIL, Pissodes strobi (COLEOPTERA: CURCULIOMDAE) USING MICROSATELLITE D N A MARKERS. by CHERDSAK LIE WLAKS A N E E Y A N A WLN B.Sc, Kasetsart University, 1994 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF T H E REQUIREMENTS FOR T H E D E G R E E OF MASTER OF SCIENCE in T H E F A C U L T Y OF G R A D U A T E STUDIES (Department of Forest Sciences) We accept this thesis as conforming To the required standard T H E UNIVERSITY OF BRITISH COLUMBIA November 2000 © Cherdsak Liewlaksaneeyanawin, 2000 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of The University of British Columbia Vancouver, Canada Date 7 DE-6 (2/88) 11 Abstract White pine weevil is one of the most destructive and economically important forest pests in British Columbia because it causes damage to natural forest and plantation. The mating system, which is essential information for assessing possibility of sterile insect release programs and determining genetic diversity of insect populations, was studied from breeding experiments with varying number of females and males. Four polymorphic microsatellite markers were used for the mating system analysis. All microsatellite loci segregated in a Mendenlian fashion. The results of 1 Female: 2 Males mating showed that sperm precedence occurs in 82% of the studied replications. The 1 Female: 4 Males mating revealed not only mixed paternity, but supported the occurrences of sperm precedence as well. In this experiment, female weevils mated to four different males had a mean paternity of 2.8. The existences of sperm mixing were observed in both 1 Female: 2 Males and 1 Female: 4 Males matings. In addition, the possibility of sperm depletion was also observed in both of the 2 Females: 1 Male and 4 Females: 1 Male matings. The evidences of sperm precedence and multiple paternity will influence the style of "the Integrated Pest Management". Sperm precedence has important implications on the ability of sterile insect techniques. Also, the incidence of multiple paternity seems likely to affect the long-term outcome of tree breeding program via the adaptation of white pine weevils to overcome resistant trees. iii TABLE OF CONTENTS Abstract ii List of Tables v List of Figures vii Acknowledgments x Chapter 1. Introduction 1 1.1 Biology of white pine weevil 1 1.2 Mating system and genetic diversity 3 1.3 Sperm competition 4 1.4 Studying mating success and parentage in insects using molecular markers 8 1.4.1 Isozymes 8 1.4.2 Random amplified polymorphic DNA (RAPD) 9 1.4.3 Microsatellites 10 1.5 Pest management in relation to mating system and genetic diversity 18 1.5.1 Pest management and mating system 18 1.5.2 Pest management and genetic diversity 19 1.6 Study objective 20 Chapter 2. Materials and Methods 21 2.1 Caging experiment of white pine weevils 22 2.2 Extraction and Purification DNA 24 2.3 Primer screening 24 2.4 Amplification of microsatellite 25 2.5 Measuring genetic diversity and probability of exclusion 27 2.6 Mendelian and linkage analysis .'28 2.7 Sperm competition and multiple paternity analyses 29 2.7.1 Parentage determination 37 2.7.2 Statistical analysis 37 iv Chapter 3. Results 38 3.1 Primer screening and characterization of Pissodes strobi microsatellites 38 3.1.1 Primer screening 38 3.1.2 Polymorphism of microsatellites 40 3.1.3 Inheritance of Microsatellite markers 45 3.1.3.1 Microsatellite locus we 2-7.2 47 3.1.3.2 Microsatellite locus we 2-19 47 3.1.3.3 Microsatellite locus we 3-18 51 3.1.3.4 Microsatellite locus we 3-16 53 3.1.4 Linkage analysis 56 3.2 Sperm competition and multiple mating by males and females 58 3.2.1 Sperm competition and multiple paternity 58 3.2.2 Sperm quantity and female reproductive success 66 Chapter 4. Discussion 72 4.1 Characterizations of Pissodes strobi microsatellites 72 4.2 Inheritance and linkage of Pissodes strobi microsatellites 72 4.2.1 Null alleles 73 4.2.2 Gene duplication 76 4.3 Sperm competition in white pine weevil 76 4.4 Multiple paternity in white pine weevil 78 4.5 Sperm quantity and female reproductive success 86 4.6 Implications for integrated pest management 88 Chapter 5. Conclusions and Recommendations 89 Bibliography 91 Appendix 105 V L I S T O F T A B L E S T A B L E P A G E 1. Comparison of the three molecular techniques (isozymes, RAPD and microsatellites) for measuring reproductive success (adapted from Jarne and Lagoda, 1996; Scott and Williams, 1998). 13 2. Pissodes strobi Breeding experiment with its different female : male combinations caged on individual Sitka spruce trees in 1997 and 1998. 22 3. Primer sequence and characterization of Pissodes strobi microsatellites. 26 4. Number and sex of the offspring weevils from the 1 Female : 1 Male mating caged on Sitka spruce trees in 1997. 30 5. Number and sex of offspring from 4 female : male mating combinations (1F:2M, 1F:4M, 2F:1M, and 4F:1M) conducted in 1997 and 1998 seasons used to study sperm competition and multiple mating. 31 6. Polymorphism and null allele frequency of Pissodes strobi microsatellites. 41 7. Inheritance of four microsatellite markers in Pissodes strobi from four controlled crosses with 1 Female : 1 Male mating. 46 8. Linkage analysis of three microsatellite markers from the 1 Female : 1 Male mating over four replications. 57 9. The number of detectable and indistinguishable offspring by visual comparison and the percentage of parentage assignment by CERVUS in 13 replications from four mating designs. 60 10. The number of offspring sired by each male and analysis of G-test for goodness-of-fit of sperm precedence from the 1 Female : 2 Males mating design in Pissodes strobi. 62 11. The number of offspring sired by each male and analysis of G-test for goodness-of-fit of sperm precedence from the 1 Female : 4 Males mating design in Pissodes strobi. 64 12. The number of offspring produced by each female and analysis of G-test for goodness-of-fit from the 2 Females : 1 Male mating design in Pissodes strobi. 68 13. The number of offspring produced by each female and analysis of G-test for goodness of fit from the 4 Females : 1 Male mating design in Pissodes strobi. 70 vi T A B L E P A G E 14. Null alleles and duplicated loci at microsatellite markers from various organisms. 74 15. Patterns of sperm precedence of insects in the order Coleoptera (adapted from Simmons and Siva-Jothy, 1998). 79 vii L I S T O F F I G U R E S F I G U R E P A G E 1. Breeding (caging) experiment of white pine weevils at the Saanich Forestry Centre (Pacific Forest Products Ltd.) in 1997. Courtesy of Kornelia Lewis. 23 2. The polymorphism between parent pairs of six microsatellite markers from 12 replications of single cross mating (1F:1M), M = male and F = female, (a) we 3-18, we 2-5, and we 2-7.2 were run on the same gel. Primer set we 2-5 (2a) and 3-18 (3a) were coamplified PCR products and then mixed . with primer set we 2-7.2 (al). (b) primer set we 3-16 (bl) and we 2-19 (b2) were analysed on the same gel using multiplex PCR. (c) primer set we.3-14. Primer we 2-5 showed possible homozygotes for nonamplifying alleles despite successful coamplification at we 3-18. Similarly, primer we 3-16 and we 2-19 exhibited possible null allele homozygotes. No we 3-16 or we 2-19 bands were observed in the test panel in which one was successful amplification DNA. Note all allelic size have LiCor primer tails. Numbers in the bottom represents the replication number in Table 4. 32 3. The polymorphism among parents of four microsatellite markers from 12 replications of 1F:2M mating design, M = male and F = female, (a) we 3-18 and (b) we 2-7.2 were run on the same gel using mixed reactions, (c) we 3-16 and (d) we 2-19 were analyzed on the same gel using multiplex PCR. Note all allelic size have LiCor primer tails. Numbers in the bottom represents the replication number in Table 5. 33 4. The polymorphism among parents of four microsatellite markers from 8 replications of 1F:4M mating design, M = male and F = female, (a) we 3-18 and (b) we 2-7.2 were run on the same gel using mixed reactions, (c) we 3-16 and (d) we 2-19 were analyzed on the same gel using multiplex PCR. Note all allelic size have LiCor primer tails. Numbers in the bottom represents the replication number in Table 5. 34 5. The polymorphism among parents of four microsatellite markers from 8 replications of 2F:1M mating design, M = male and F = female, (a) we 3-18 and (b) we 2-7.2 were run on the same gel using mixed reactions, (c) we 3-16 and (d) we 2-19 were analyzed on the same gel using multiplex PCR. Note all allelic size have LiCor primer tails. Numbers in the bottom represents the replication number in Table 5. 35 6. The polymorphism among parents of four microsatellite markers from 8 replications of 4F:1M mating design, M = male and F = female, (a) we 3-18 and (b) we 2-7.2 were run on the same gel using mixed reactions, (c) we 3-16 and (d) we 2-19 were analyzed on the same gel using multiplex PCR. Note all allelic size have LiCor primer tails. Numbers in the bottom represents ™ the replication number in Table 5. 36 viii F I G U R E P A G E 7. Preliminary testing on microsatellite primers and their banding patterns observed at nine of the 12 primer pairs in 15 white pine weevils from unrelated weevils. Note all allelic sizes have LiCor primer tails see Table 6 for the range of actual size. 39 8. Allele frequency of seven microsatellite loci for male and female parents from IF: 1M, 1F:2M, and 1F:4M mating designs. 42 9. Inheritance of microsatellite locus we 2-7.2 from the 1 Female : 1 male mating. M and F indicate male and female, respectively. The first two lanes contained amplifications products from the parents and followed by their offspring, (a) and (b) are the examples of banding segregation indicating the Mendenlian inheritance from replications number 18 and 20. Note all allelic size have LiCor primer tails. 48 10. Inheritance of microsatellite locus we 2-19 from the 1 Female : 1 Male mating. M and F indicate male and female, respectively. The presences of null alleles are indicated by *. (a) Male parent had homozygotes for null alleles; therefore, all offspring showed the heterozygotes for null alleles, (b) and (c) Male parents had heterozygotes for null alleles; therefore, some offspring showed the heterozygotes for null alleles, (d) Both male and female parents had heterozygotes for null alleles; therefore, some offspring showed homozygotes and heterozygotes for null alleles. However, null allele heterozygotes could not be distinguished from homozygous genotypes due to identical banding patterns. Note all allelic size have LiCor primer tails. 49 11. Inheritance of microsatellite locus we 3-18 from the 1 Female : 1 Male (b-d) and 4 Females : 1 Male (a) matings. M and F indicate male and female, respectively. The thick arrow at left side indicates the fixed alleles, which was discarded from the scoring, (a) The segregation of two alleles below the fixed allele indicated that this locus could not be scored for two loci, (b) The banding patterns of this locus without the null allele segregated as Mendenlian inheritance when the fixed alleles were ignored, (c) and (d) showed the presences of heterozygotes for the null alleles (*) from 1 Female : 1 Male mating when male parents had null allele homozygote (c) and null allele heterozygote (d). Note all allelic size have LiCor primer tails. 52 12. Inheritance of microsatellite locus we 3-16 from the 1 Female : 1 Male (b-d) and 1 Female : 4 Males (a) matings. M and F indicate male and female, respectively, (a) and (b) showed the incidences of duplicated loci. The thick arrow at left side indicates duplicate locus, (b) and (c) showed the presences of homozygotes and heterozygotes for the null alleles (*) from the 1 Female : 1 Male mating. Segregation of the null allele homozygotes at this locus was confirmed by the mutilplexing reactions of we 2-19 and we 3-16 (c). Many individuals failed to amplify at locus we 3-16 (300-325 bp) while successful amplifications were observed at locus we 2-19 (200-215 bp). Note all allelic size have LiCor primer tails. 54 ix F I G U R E P A G E 13. An example of paternity assignment in 1 Female : 4 Males using four microsatellite loci including we 3-18, we 2-7.2, we 2-19, and we 3-16. F and M indicate female and male, respectively. Primer set we 2-19 and we 3-16 were analyzed on the same gel using multiplex PCR. Primer set we 3-18 and 2-7.2 were analyzed on the same gel using mixed PCR reactions. Arrows indicate the allele used to assign paternity. The number of offspring sired by male number 1, 2, 3, and 4 were 7, 0, 6, and 14, respectively. Null alleles also appeared in we 3-18, we 2-19, and we 3-16. Note all allelic sizes have LiCor primer tails. 59 14. The percentage of offspring sired by each male from the 1F:2M mating design. 61 15. The percentage of offspring sired by each male from the 1F:4M mating design. 65 16. The percentage of offspring produced by each female from the 2F:1M mating design. 69 17. The percentage of offspring produced by each female from the 4F:1M the mating design. 71 18. Patterns of Pissodes strobi offspring emergence from the 1F:2M mating design. 85 X Acknowledgements I am very grateful to my supervisory committee. Dr. Yousry El-Kassaby, my supervisor, provided me with research assistantship and research advice. Also, he was very patient with my English and progress of this study. Dr. Kermit Ritland for partial financial support and statistical advice. Dr. Carol Ritland, who provided me with space in the Genetic Data Centre, who significantly contributed to my knowledge of molecular markers, specifically microsatellite marker, and for her editorial help to my research proposals and the first draft of my thesis. Dr. Rene Alfaro for his wealth of knowledge about my research organism, the white pine weevil, and for kindly serving on my research committee. I would like to thank Ms. Kornelia Lewis who was my first teacher of my DNA work and who provided me with weevil samples for this thesis. I am grateful for her knowledge of molecular DNA makers, as well as her industrious and meticulous work on the breeding experiments that made my work a very pleasant experience. Apart from enormous help above, I would like to thank Tip Placzeks and Andy Benowich who have helped me since I arrived to Canada; Shirley Pang for helping with the LiCor automated sequencer; Paul Sewell and Mohd Nazip Suratman, who helped during my initial adaptation to the Canadian educational system. I also want to thank Dr. Kermit Ritland students for providing excellent intellectual environment and friendship: Dilara Ally, Lisa O'Connell, Marissa LeBlanc, Mohammed Iddrisu, Charles Chin-Lin Chen, Bryan Ie, Hugh Wellman, and Yanik Berube. A special thanks to the late Sampson Yaw Bennuah, who was my company in the GDC and always walked home with me after long working nights, for his help, discussions, suggestions, and friendship. xi I am indebted to Niwat Taepavarapruk, Pornnarin Taepavarapruk, Piti Sukontasukkul and his family, and other Thai students at UBC for their help. It was enjoyable speaking in Thai language during my M.Sc. study term. I am sincerely grateful to my boss, Dr. Kowit Chaisurisri, (Director of Forest Tree Seed Centre, Thailand), who has managed and encouraged me to study at UBC. My thanks to the Faculty of Forestry and the Faculty of Graduate Studies (University of British Columbia) for the partial tuition fee awards. Finally, I would like to acknowledge my parents, my sisters and brother, and my cousins for listening, understanding, and encouraging me during my study and beyond. I dedicate this thesis to all of them. 1 Chapter 1. Introduction 1.1 Biology of White Pine Weevil White pine weevil {Pissodes strobi Peck; Coleoptera: Curculionidae) is the most serious and economically important forest pests of reforestation and natural regeneration in British Columbia. The weevil can cause stem deformation that decreases the plantation productivity (Alfaro, 1994). The distribution of white pine weevil occurs throughout North America. (Wallace and Sullivan, 1985; Humble et al., 1994). The white pine weevil shows distinct host preferences in different regions. In British Columbia white pine weevil preferentially attacks spruce species including Sitka spruce {Picea sitchensis (Bong.) Carr), Engelmann spruce {P. engelmannii Parry), and White spruce {P. glauca (Moench) Voss). In contrast, in eastern Canada, it predominantly attacks eastern white pine {P. strobes L.). White pine weevil has one generation per year and adults may live up to 4 years and reproduce each season (McMullen and Condrashoff, 1973). The life history and development of white pine weevil were observed by Silver (1968). Early in the spring, adults emerge from hibernation and fly or crawl to young spruce terminals and begin feeding and mating. The eggs are laid from late April to June at the tip of the leader. As soon as the larvae hatch, they feed on the phloem around the circumference of the leader and then larvae pupate in chip cocoons under the bark. Newly developed adults emerge from the leaders in late August and September and they feed for a while on the phloem of the trunk and branches. When winter comes, they go into hibernation in the soil. The following spring, adults emerge from hibernation and start feeding and mating again. Because the emerging adults had full abdomen in spite of a lack of feed on leader tissue, Retnakaran and Jobin (1994) suggested 2 that they might have fed on the roots underground in order to facilitate rapid mating and oviposition. Gara et al. (1971) found that ambient temperature, humidity, and insulation could affect the mating and ovipositional activity of spring adults. They reported that mating occurs when stem temperature reaches about 18.3 °C and maximum mating activity is about 29.4 °C. In addition, two pairs of adults were observed by Silver (1968) to have mate on the same leader several times and similar results were studied by Overhulser and Gara (1975). In their study, it was common to find 5 to 8 adults on a single Sitka spruce leader and up to 15 adults have been counted at one time on one leader during severe infestation. Moreover, Silver (1968) also reported that newly emerged adults suddenly mate in the fall. On the other hand, Wallace and Sullivan (1985) suggested that newly emerged adults do not gain full reproductive maturity immediately and they must survive at least one winter in hibernation before they can reproduce offspring. To date, however, no evidence has been provided that newly emerged adults can produce offspring. Harman and Kulman (1967) reported that newly emerged females reach sexual maturity slower than older females in the spring. Overhulser and Gara (1975) observed that adults emerge rapidly from hibernation when air temperature exceeds 21.1 °C and that males were active early in the flight season, while females were found during the latter half of the flight season. They also concluded that the aggregation of adults on leaders early during the flight season was to ensure that females could find mates and host material for sexual maturation and oviposition. Using mark and release methods, Godwin et al. (1957) reported that few weevils moved far and concluded that white pine weevil dispersal appears to be restricted. Similarly, 3 Mcintosh et al. (1996) studied the dispersal of white pine weevil in putatively resistant white spruce and reported that males and females moved less than 0.24 m from the adjacent tree throughout the season after mating and oviposition. In addition, Stevenson (1967) found that newly emerged adults of Pissodes engelmanii (now a synonym of P. strobi) could not fly because the large flight muscles were not well developed. The knowledge of the dispersal habits of old and newly emerged adults shed some light on the possibility of inbreeding in white pine weevil population. Many approaches have been attempted to reduce the damage from this pest including leader clipping (Rankin and Lewis, 1994), chemical insecticides (de Groot and Helson, 1994; Retnakaran and Jobin, 1994), silvicutural methods (McLean, 1994), biological control agents (Stevenson, 1967; Alfaro et al, 1985; Humble, 1994), and resistant trees (King, 1994, Ying and Ebata, 1994; Carlson et al., 1994; Namkoong, 1994). However, the sterile insect techniques, which has been used in human disease and agricultural pest control, have not been proposed for this pest. Understanding the mating system and genetic diversity of this insect are prerequisites for the long-term success of controlling this pest. 1.2 Mating system and Genetic diversity There are two meanings of mating system used by behavioural ecologists and geneticists. First, in terms of behavioural ecology a mating system is defined as the pattern of mating behaviour shown by a population (Davie, 1991). The second meaning is described by geneticists as the relatedness of males and females that mate, the position a population occupy within the spectrum from inbred to outbred, and the variances in mating success of 4 each sex (Polmin et al., 1980). There is evidence that the mating system influences the genetic diversity of insect populations. Insect mating systems are divided into two types: (1) single and (2) multiple mating systems. Many insect species have shown that both males and females may mate more than once. There are two hypotheses for genetic benefits of multiple mating: (1) acquisition of good genes and (2) increase genetic diversity within clutches (reviewed in Yasui, 1998). Genetic diversity of offspring with multiple mating would be higher if two or more unrelated males have contributed genetically to the offspring (multiple paternity). Sugg and Chesser (1994) demonstrated that multiple paternity plays an important role for determining rates of change in gene diversity and inbreeding in a population. Multiple mating that results in multiple paternity have been found in many insect species, such as leafcutter ants (Fjerdingstad et al., 1998; Boomsma et al., 1999), ground crickets (Gregory and Howard, 1996), grasshoppers (Lopez-Leon et al., 1995), honey bees (Estoup et al., 1995; Moritz et al., 1995; Oldroyd et al., 1996) and, sweat bees (Kukuk et al., 1987). In addition, there are two species in the order Coleoptera: milkweed leaf beetles (Dickinson, 1988) and willow leaf beetles (McCauley et al., 1988) that always demonstrate multiple mating resulting in multiple paternity. Conversely, female multiple mating may not always lead to multiple paternity because of sperm competition, behavioural mechanisms employed by males to monopolise females and female choice. 1.3 Sperm competition Sperm competition is defined as competition between the sperms from two or more males for the fertilization of a given set of ova (Parker, 1998). The outcome of sperm 5 competition is measured as the proportion of offspring fathered by the last male to mate and often referred to as the P 2 value (Boorman and Parker, 1976). Thus, P 2 value ranges from 0 to 1. Values of P 2 equals to 0.5 indicating complete sperm mixing, and P 2 values between 0.5 and 1.0 indicate some level of last male sperm precedence (Gwynne, 1984). There are two mechanisms, which could reduce sperm competition in insects. They are sperm displacement and sperm precedence. Simmons and Siva-Jothy (1998) developed the definitions of sperm displacement and precedence. Sperm precedence is defined as the non-random utilization of sperm from one of several males in the fertilization of the ova. This could be explained by three phenomena: (1) sperm stratification define as the layered disposition of the sperm of several males within a female's sperm-storage organ, (2) sperm loading, and (3) sperm selection by female. Sperm displacement is defined as the spatial displacement of sperm derived from a female's previous mates by the current copulating male,with the consequence that his sperm is more likely to fertilize the ova, while displaced sperm is less likely to do so. Although the terms sperm precedence and sperm displacement refer to distinct mechanisms of sperm transfer, storage, and utilization, they are often used synonymously (Simmons and Siva-Jothy, 1998). The mechanisms by which sperm displacement occurs have been extensively studied. Waage (1979) demonstrated that male damselfly {Ischnura elegans (Vander Linden)) use their penis, which is covered with stiff hairs to entrap, stored sperms and remove them from the female's sperm-storage organs. Helversen and Helversen (1991) also found that male bushcrickets {Metaplastes ornatus) remove the female's sperm stores using a subgenital plate. In addition, a study using tree crickets (Truljalia hibinonsis) found that males remove 6 previously stored sperm by flushing the female's sperm-storage organ with his own ejaculate (Ono etal., 1989). Moreover, recent studies on the insect in the order Coleoptera have found a novel mechanism of sperm displacement. For example, male rove beetles (Aleochara curtula) use their spermatophore, which functions as surrogate intromitten organs to displace rival sperm back to the spermathecal duct (Gack and Peschke, 1994). In addition, Haubruge et al. (1999) studied rival sperm removal and translocation in flour beetles (Trilobium castaneum) and found that males removed stored sperms from the female's sperm-storage organs using its genitalia. They also reported that non-self sperms on the flour beetles genitalia could be translocated into the reproductive tracts of subsequent females. Most studies of sperm precedence in insects are based on sterile male techniques or phenotypic markers, and based on mating designs, in which females are mated to only two males. With the tools of molecular genetics, Zeh and Zeh (1994) using minisatellite markers studied sperm precedence in harlequin beetle-riding pseudoscorpion {Cordyloch.ern.es scorpioides) with females mated to three males. They found that the patterns of last-male sperm precedence broke down completely when females mate with three males due to mechanism of sperm mixing. However, Eady and Tubman (1996), using tan and black colour morphs, studied the patterns of last-male sperm precedence from double- and triple-mated females in bruchid beetle (Callosobruchus maculatus) and showed that the patterns of last-male sperm precedence from double-mated females are similar to those from triple-mated females. Therefore, Eady and Tubman (1996) concluded that last-male sperm precedence does not break down when females mate with three males. In addition, they also suggested that the findings of Zeh and Zeh (1994) are not universal and require empirical study on the 7 movement and storage of sperm in order to support that sperm mixing affects the patterns of sperm precedence. However, by using high magnification video analysis, Zeh and Zeh (1997) provided the evidence that highly mixed paternity in harlequin beetle-riding pseudoscorpions, resulted from a female mating strategy. Females received only one sperm packet while males often produced three sperm packets during a single mating event. Therefore, with this strategy females can collect sperm across matings from several different males, resulting in highly mixed paternity. In addition, there are many factors affecting the patterns of sperm precedence in insects, such as time since final copulation, copulation duration of second male, remating interval, relative number of copulations, size of first male and second male, spermatophore size, number of sperm transferred by second male, and resistance by first male (Simmons and Siva-Jothy, 1998). At present, many studies have reported high levels of sperm precedence for many insect species. In the order Coleoptera, it has been reported that last-male sperm is predominance for the following insects: Trilobium confusum (Tenebrionidae), Trilobium castaneum (Tenebrionidae), Trogoderma inclusum (Dermestidae), Ephilachana varivestis (Coccinellidae), Anthonomus grandis (Curculionidae), and Conotrachelus nenuphar (Curculionidae) (reviewed in Gwynne, 1984). Also, last-male sperm precedence in the order Coleoptera has been reported in Anthonomus grandis grandis (Nilakhe and Villavaso, 1979), Tetraopes tetraophthalmus (McCauley and Rielly 1984); Callosobruchus maculatus (Eady, 1991); Adalia bipunctata (Jong et al., 1993), Aleochara curtula (Gack and Peschke, 1994), and Tenebrio molitor (Siva-Jothy et al., 1996). 8 1.4 Studying mating success and parentage in insects using molecular markers Molecular genetic techniques such as isozyme, randomly amplified polymorphic DNA (RAPD), and microsatellite (SSR) provide powerful tools for the study of insect biology, ecology, and population genetics both in natural populations and in the laboratory. 1.4.1 Isozymes Isozymes have been used to analyse multiple mating (Woyciechowski and Lomnicki 1987; Yuval and Fritz, 1994), inbreeding (Chapman and Stewart, 1996), genetic diversity, and population structure (Archie et al., 1985; Pashley 1986; Gasperi et ah, 1991). In addition, isozyme was used to estimate the genetic relatedness of colony members in many social insect species including wasps, bees, ants, and tent caterpillars. By using isozyme markers for studying genetic divergence among populations of white pine weevil, it was found that only four out of nine enzyme systems were highly polymorphic (Phillips and Lanier, 1985). There are, however, evidence that isozyme markers underestimate the amount of variation in insect populations, detecting only 30% of the genetic diversity (Hoy, 1994). Another drawback of using isozymes is in the identification of paternity when there are many potential fathers. The amount of variation among individual parent is often too low, hence isozyme is not the preferred tool to estimate multiple paternity. In addition, the limitation of isozymes in studying sperm precedence for species with known genotypes (usually determined from laboratory strains) was reported by McCauley and Reilly (1984). In their study on milkweed beetles (Trtraopes tetraophthalmus), they found that in many crosses the parental genotypes could not be unambiguously assigned using one isozyme marker due to similarity of male genotypes. However, isozymes can be quite useful in 9 measuring the reproductive success in laboratory strains with known phenotypes (reviewed in Scott and Williams, 1998). Studies of sperm precedence in insects from laboratory strains have been reported in plum curculios (Conotrachelus nenuphar) (Huettel et ah, 1976), and Colorado potato beetles (Leptinotarsa decemlineata) (Alyokhin and Ferro, 1999). Huettel et al. (1976) showed by using 4 enzyme systems they could genotype the parents and larvae from 23 crosses. They also found that first-, last-male sperm precedence and sperm mixing occurred in 26, 30, and 17% of 23 studied crosses, respectively. Isozyme markers were applied to a study of sperm precedence from laboratory strains of Colorado potato beetles (Alyokhin and Ferro, 1999). In this study the genotype of parents was determined from one middle leg of individuals and unique genotypes were selected for their multiple mating study. In this study, they performed 15 controlled crosses by allowing each female to mate with two different males, with a 24 h remating interval. They found that the presence of last-male sperm precedence existed; however, the degrees of sperm precedence varied highly among crosses with the second male siring offspring ranging from 17 to 100%. 1.4.2 Random amplified polymorphic DNA (RAPD) Random amplified polymorphic DNA markers have been used to identify individuals within a population and species in many insects. RAPD markers have been used to study paternity in dragonflies (Orthetrum coerulescens) (Hadrys et al., 1993) and honey bees (Apis mellifera) (Fondrk et al., 1993). However, the RAPD technique is particularly sensitive to initial deoxyribonucleic acid (DNA) content during amplification. Thus, bands may vary in their intensities even when present in different individuals. Another difficulty with RAPD is that all bands are inherited as dominant alleles and heterozygotes normally cannot be 10 identified (Hoy, 1994). Moreover, Scott and Williams (1998) pointed out that the non-specific nature of the RAPD primers contribute to the errors and limitations of these markers specifically when contamination occurs. It should be noticed that insect DNA isolation often uses the whole organism; therefore, it is possible that when DNA samples are extracted, DNA from parasites and gut contents may be simultaneously extracted as well. 1.4.3 Microsatellites Microsatellites are short, tandemly repeated sequences whose core sequences range in size between one and five base pairs in length, but can reach a length of up to 150 base pairs (Schlotterer and Pemberton 1998). Microsatellite arrays may be composed of di-, tri- or tetra-nucleotide repeats such as (AC) n, (AAT) a or (GATA) n . They may be divided into three groups: (1) perfect or pure repeats, (2) compound repeats, and (3) imperfect or interrupted repeats (Jarne and Lagoda, 1996; Rosenbaum and Deinard, 1998). These markers are superior to other markers in molecular genetic analysis, such as mini satellites and RAPDs, because they are co-dominant and provide the greatest information when studying paternity, relatedness, and diversity. In addition, the advantageous characteristics of microsatellites is that primers developed in one species can be used in related species and material or analysis can be sampled non-invasively from free-living populations (reviewed in Bruford and Wayne, 1993; Bruford et al., 1996). Furthermore, several microsatellite loci can be analyzed concurrently on the same gel when they have different allelic sizes. One of the problems of microsatellites for analysis among closely related individuals, and individuals within the same population is size homoplasy. Size homoplasy is defined as the co-occurrence of alleles that are identical in states. Homoplasy among alleles would tend 11 to cause incorrect paternity exclusion of putative fathers (Rosenbaum and Deinard, 1998). Furthermore, they also suggested that the limitation of microsatellites for study of reproductive success is the common presence of null alleles. Null alleles may reduce the informativeness of a microsatellite locus. The presence of null alleles could result in apparent non-Mendenlian inheritance and can lead to mis-interpretation for population level studies, due to erroneous of allele frequency and heterozygosity, as well as overestimates of the inbreeding coefficient in a population. In the parentage analysis, null alleles can produce mismatched genotypes, resulting in the erroneous of paternity exclusion. In addition, in a study of kinship, null alleles can effect the interpretation of the degree of relatedness between individuals. Studies on insects using microsatellites have been reported the presence of null alleles in bees (Oldroyd et al., 1996), damselflies (Cooper et al., 1996), wasps (Vanlerberghe-Masutti and Chavigny, 1997), and mosquitoes (Kamau et al., 1999). A comparison among the three molecular techniques (isozymes, RAPD and microsatellites) for measuring reproductive success in insects is presented in Table 1. Microsatellite markers were first applied as a tool for genetic analysis in humans (Litt and Luty, 1989; Weber and May, 1989). In recent years, this tool has been most exploited in diverse organisms for many purposes, such as construction of genetic linkage maps, identification of quantitative trait loci, and estimation of neutral mutation rate, genetic diversity, phylogenetic relationships, hybridization, and paternity. The applications of microsatellite markers in population genetics studies have been widely reviewed elsewhere (Bruford and Wayne, 1993; Ashley and Dow, 1994; Schlbtterer and Pemberton, 1998; Jarne and Lagoda, 1996; Rosenbaum and Deinard, 1998; Beaumont and Bruford, 1998). Studies on 12 insects using microsatellites have been reported for several insect species such as ants (Gertsch et al, 1995; Chapuisat, 1996; Foitzik et al, 1997; Herbers and Mouser, 1998; Boomsma et al, 1999), bees (Estoup et al, 1995; Paxton et al, 1996; Rowe et al, 1997), wasps (Thoern et al, 1995; Strassman et al, 1996; Vanlerberghe-Masutti and Chavigny, 1997), and moths (Traut et al, 1992; Bogdanowicz et al, 1997). The application of microsatellites for estimating parentage and reproductive success was first developed in pilot whales (Amos et al, 1993), and chimpanzees (Morin et al, 1994a,b). Recently, the use of microsatellites in the area of parentage and reproductive biology of insects has started over the past few years (Cooper et al, 1996; Sunnucks et al, 1996; Chapuisat, 1998; Fjerdingstad et al, 1998; Imhof et al, 1998; Harshman and Clark, 1998; Simon et al, 1999; Simmons and Achmann, 2000). 13 Table 1. Comparison of the three molecular techniques (isozymes, RAPD and microsatellites) for measuring reproductive success (adapted from Jarne and Lagoda, 1996; Scott and Williams, 1998). Isozymes RAPD Microsatellites Attributes Dominance/co-dominance co-dominance dominance co-dominance Number of alleles per locus 1-5 2 1-50 Identification of allelic states yes no yes Inference of parentage without - - + + all potential fathers Number of potential parents few many many Ease of use + + + + + + + + Quantity of DNA template no Pg-M-g Pg-Hg needed for analysis Degraded template no possible possible Molecular information rarely rarely available (structure, mutation) (mutation rate 0.1% per generation) Relative cost per individual low low high Application Direct fitness Parental inclusion - + + + + + Parental exclusion + - + + + Indirect fitness Average within group + + + + + relatedness 14 The first study of sperm competition and multiple mating in insects using microsatellite markers was reported by Cooper et al. (1996) in damselfly (Ischnura elegans). A total of 13 alleles from two microsatellite loci were used to assign paternity to more than 3,000 larvae from doubly and triply mated females, in laboratory cages and wild-caught females. They found that the last male to mate had a large proportion of siring offspring, with a mean value for last-male sperm precedence, P 2 , of 0.77 and 0.79 for double and triple mating, respectively. In addition, analysis of microsatellite data from offspring damselflies produced by wild-caught females showed that females mated with up to six different males. Microsatellite markers are also used for investigation of parthenogenetic organisms. Sunnucks et al. (1996) suggested that microsatellite is the most efficient method for detecting genetic recombination, discriminating parthenogenetic lineages and elucidating relationships between parthenogenetic lineages in Sitobion aphids. Another application of microsatellites was carried out by Chapuisat (1998) to reveal mating frequency of ant queens {Formica paralugubris). In this study, the sperms stored in the spermatheca from 166 queens were tested using four microsatellite loci and the validity of sperm-typing method was confirmed by establishing laboratory colonies with a single queen, and by analysing mother-offspring combination. The results of sperm-typing and mother-offspring combination were similar in effective mating frequency. He also suggested that the sperm analysis to detect the frequency of multiple mating in ant queens, is a reliable method because fertile males of Hymenoptera are haploid. Therefore, the estimate of the number of males that mated with a queen can be easily detected at any locus in the sperm stored by females. However, this method may be affected by contamination of the sperms with the queen's DNA during insect dissection, or by the non-detection of multiple mates 15 when they share identical genotypes, or by non-detection of the males that contributed only a small fraction of the sperm due to non-amplification of their rarer DNA haplotype. Fjerdingstad et al. (1998) studied the degree of multiple paternity in leafcutter ants, an eusocial Hymenoptera (Atta colombica) by using two microsatellite loci and pointed out that microsatellite markers provided accurate information on the patterns of multiple paternity. Twenty-eight alleles of two microsatellite loci (13 and 15 alleles, respectively) were used to identify 36 colonies of leafcutter ants and the results showed that in 33 out of 36 colonies, two or more males had contributed genetically to the offspring. Microsatellites were used for investigation of multiple mating in wild fruit flies {Drosophila melanogaster) (Imhof et al., 1998). In their study, seven highly polymorphic X-linked microsatellite loci were used to analyse 356 female offspring from four wild-caught females. The results showed that female fruit files had mated with four to six different males. They also suggested that the high number of parental genotypes detected in their study were due to the use of highly polymorphic, X-linked microsatellite loci and hence provided a much more powerful system to test for paternity than other molecular markers. Harshman and Clark (1998) developed mathematical model using Monte Carlo simulations for estimating multiple mating and sperm competition from broods of field-caught Drosophila melanogaster using microsatellite markers. Two highly heterozygous microsatellite loci were used to analyze the mother and eight to 18 offspring for each of 19 broods. The female genotypes were observed and the genotype frequencies of each male in each brood were calculated at each locus, in order to estimate maximum-likelihood parameters for the mean number of matings per female and the proportion of offspring sired 16 by the second or subsequent mating males. In their study, the mean number of mating per female was 1.82 and the sperm displacement of doubly mated females was 0.83. They concluded that this technique could be used to generate precise estimates of multiple mating by females and sperm competition in brood samples from natural populations because microsatellites provide high level of polymorphism that helps investigators differentiate alleles from different males. Simon et al. (1999) used microsatellite and phenotypic markers to study reproductive mode and population genetic structure in cereal aphids (Sitobion avenae). A total of 277 lineages from different regions were examined at five microsatellite loci. They found significant difference between reproductive modes and genetic relatedness among lineages. Obligately asexual lines were genetically differentiated from sexual lineages; however, they still shared many alleles with their sexual counterparts, indicating their recent origins. In addition, they also found that the correlation between reproductive mode and geographic distances was strong in cereal aphids; with lineages producing sexual forms restricted to the north, while obligately asexual lines restricted to the south. Thus, they suggested that the genetic differences between northern and southern populations of cereal aphids probably result from selection for mode of reproduction rather than from limited dispersal and restricted gene flow. A study of sperm utilizations using microsatellites was reported by Simmons and Achmann (2000) in bushcrickets (Requena verticalis) from 24 controlled crosses. With only one highly polymorphic microsatellite locus, paternity could be assigned to the specific males for most crosses. Upon analysis of their data, they confirmed that last-male sperm precedence does not occur in bushcrickets because the first male to mate gained the majority 17 of fertilizations in all studied replications similar to the results of previous studies using isozymes and sterile male techniques. However, they suggested that microsatellite markers have more advantages than other techniques for studying female multiple mating with more than two males and for examining paternity in natural populations. In summary, molecular markers have proven to be a reliable method for studies of parentage and mating success of insects, especially in the area of parentage and reproductive biology. The main advantage of molecular markers for studying the mating system in insects is that the experiment can be done without prior knowledge of mates genotypes (i.e., the dependence on laboratory strains such as phenotypic markers (colour morphs), is not necessarily). Before the use of molecular markers, most sperm competition studies used either sterile-males or phenotypic marker techniques limiting the number of males used to only two in any mating event. These techniques may also reduce male reproductive success via reducing production and viability of sperm and/or fertilization capacity (Parker, 1970). Information on mating system obtained from these approaches is valuable for applications to pest management. To date, no information on multiple mating and sperm competition of white pine weevil is available. Knowledge of multiple mating and sperm competition is necessary for assessing the possibility of sterile-insect release program and for evaluating genetic diversity. The latter may plays a significant role in determining evolutionary response of insect pest population to pest management and control. 18 1.5 Pest management in relation to mating system and genetic diversity 1.5.1 Pest management and mating system Patterns of mating system influence not only the genetic diversity of insect populations as stated earlier, but also the outcome of the sterile-insect technique. The sterile insect technique consists of mass rearing, sterilizing, and releasing large numbers of sterile insects to mate with the natural wild populations (Knipling, 1955). Dent (1995) suggested that this technique is appropriate for pests that characteristically have low fecundities, long generation times, low migration and make a greater investment in host specialization. Therefore, a large amount of information is required for the success of sterile-insect technique including knowledge of the pest's ecology and behaviour, an ability to successfully sterilize the insects without reducing its natural competitiveness and methods for monitoring the quality of the reared insects. The behavioural mating system of pest species affects its population dynamics, and is important to determine a strategy before and during release, as well as the effectiveness of released sterile males in sterile-insect technique programs (Brower, 1975; Calkins et al., 1981). Brower (1975) pointed out that the pattern of sperm precedence could affect the efforts of sterile release technique when controlling Indian meal moths (Polia interpunctella). The number of sterile males, therefore, should be very high so that almost all-fertile female could mate with sterile males. Calkins et al. (1981) also described how a mating scheme such as the lek mating system (Emlen and Oring (1977) defined lek as the communal display area where males congregate for the sole purpose of attracting and courting females and to which females come for mating) could have large effects on the success of the sterile-insect 19 technique for pest management. They explained that males in lek have the potential for mating many times and females that visit the lek for mating have the opportunity to choose their mates; thus, the competition between males for a limited number of females is strong. This might help to explain why the ratios of sterile to wild males should be extremely bias towards sterile males to maintain low pest populations. Ito and Yamagishi (1989) reported that in addition to sperm precedence, mating competitiveness between sterile and wild males, in the mating with wild females is essential for the success of sterile insect technique. Proverbs (1972) suggested that the reduction of fitness or vigour of the released insects results from rearing, sterilizing, and handling in laboratory. In recent years, studies on the mating competitiveness of released sterile males has been carried out both in laboratory and field experiments. Bloem et al. (1999) found that using radiation to sterile males had a negative impact on mating competitiveness in codling moths (Cydia pomonella). Similarly, the mating successes of sterile males were lower than that of wild males in fruit flies (Shelly and Whittier, 1996; Liimatainen et al., 1997). 1.5.2 Pest management and genetic diversity In the past several years, knowledge of genetics has been applied to pest management and pest control. However, information regarding the use of genetic diversity knowledge in pest management and pest control is rare. Mitter and Schneider (1987) reviewed genetic change in outbreak areas in agriculture insect species and reported that Greenbug (Schizahhis graminun), which feeds on wheat and many other graminaceous species, was genetically adapted to new biotypes so that these putative new genetic entities differ in several features from theirs ancestors on wheat. Additionally, they reported that hessian fly (Mayetiola 20 destructor) has developed a tolerance to the resistant strains of wheat used. It was interesting to notice that biotypes which overcome resistance had an unusual breeding system, because male hessian files transmit only the maternal chromosomes in their sperms. Lorimer (1978) presented a simple model of pest population outbreaks and crashes in relation to genetic causes. This model described how genetic and environmental factors interact leading to fluctuations in population size. He also explained that pest control methods such as pesticide application, plant resistance, and biological control could affect the genetic structure of insect populations. Hence, pest control methods may result in changing insect ecology: host plant preferences, feeding behaviour, dispersal, and mating patterns this could lead to change in genetic diversity and size as well as the dynamics of insect population; possibly defeating investments of pest management. Kennedy (1993) demonstrated that the uniformity in the long-term evolutionary response of a pest population to a pest management method could be determined by genetic variation within a population. Pest management success is against all populations, could predict by determining the genetic variation among population. Therefore, an effective insect pest management should be based on knowledge of potential changes in genetic diversity of insect population. 1.6 Study objective 1. To determine the genetics of microsatellite markers in white pine weevil, and 2. To use microsatellite markers for study the multiple mating, sperm competition, degree of multiple paternity, as well as the possibility of sperm depletion in white pine weevils from different experimental mating combinations. 21 Chapter 2. Materials and Methods 2.1 Breeding (caging) experiment of white pine weevils Two sets of adult and offspring weevils were obtained from caging experiment done by Ms. K. Lewis at the Saanich Forestry Centre (Pacific Forest Products Ltd.) in 1997 and 1998. Briefly, virgin adult weevils were collected from a site near Benson River on Vancouver Island in 1996. The method of Harman and Kulman (1966) was used to determine the gender of the collected weevils. Male and female weevils were caged on six year-old Sitka spruce trees in different mating combinations. The breeding experiments involved eight different female : male combinations. These were: 1-1 female : 1 male, 2- 1 female : 2 males, 3- 1 female : 4 males, 4- 2 females : 1 male, 5- 4 females : 1 male, 6- 4 females : 4 males, 7- 1 female : no male, and 8- no female : 1 male. The breeding experiments were conducted over two years (1997 and 1998). The number of replications conducted for each female : male combination and the year in which the breeding was conducted is summarized in Table 2. To simulate natural conditions for mating and oviposition, trees were individually covered with nylon mesh (Fig. 1) and weevils were caged for three months. Adults and spruce leaders were retrieved when the successful attack occurred on spruce leaders. Adults were retrieved and placed at -80 °C. Spruce leaders were trimmed of lateral branches and placed in rearing tubes following the method reported in Lewis (1995). Offspring of each treatment were collected from the rearing tubes daily as they emerged. Offspring also were sexed, placed individually in 1.5 ml sterile plastic tube (Eppendorph®) and frozen at -80 °C until DNA extraction. 22 Table 2. Pissodes strobi Breeding experiment with its different female : male combinations caged on individual Sitka spruce trees in 1997 and 1998. Mating design Year Number of Remarks replications 1 Female 1 Male 1997 30 Pre-mating in the lab 1 Female OMale 1997 10 No offspring 0 Female 1 Male 1997 10 No offspring 4 Females 4 Males 1997 20 1 Female : 4 Males 1997 20 1 Female : 2 Males 1997 20 1 Female 1 Male 1997 30 No Pre-mating in the lab 1 Female 1 Male 1998 10 1 Female : 2 Males 1998 10 1 Female : 4 Males 1998 10 2 Females : 1 Male 1998 10 4 Females : 1 Male 1998 10 4 Females : 4 Males 1998 10 Figure 1. Breeding (caging) experiment of white pine weevils at the Saanich Forestry Centre (Pacific Forest Products Ltd.) in 1997. Courtesy of K. Lewis. 24 2.2 Extraction and Purification DNA ' The method of extraction and purification of weevil DNA developed by Lewis (1995) was used for isolating the total genomic DNA. Genomic DNA was isolated from individual weevil. A whole weevil was ground in liquid nitrogen with plastic pestles in sterile 1.5 ml microcentrifuge tubes. The 4X CTAB extraction buffer pH 8.3 (0.2 M Tris, pH 8.0; 0.04 M EDTA; 2.8 M NaCl; 0.2 % (3-Mercapthoethanol [vol:vol]) was added immediately to the grindate. Samples were incubated at 65 °C for 1 hour and tubes were spun at 12,000 rpm for 10 minutes. The supernatant in each tube was transferred to a sterile 1.5 ml microcentrifuge tubes, followed by the addition of 20 ul RNase (500 p,g/ml). Samples were then placed at 37 °C for 45 minutes. Following incubation, genomic DNA was extracted with equal volumes of chloroform:isoamyl alcohol (24:1). A Vi volume of ice-cold isopropanol was added to precipitate DNA and then samples were kept at -20 °C for a minimum of 30 minutes. Samples were centrifuged at 12,000 rpm at 4 °C for 30 minutes. The DNA pellet was washed twice with of 70 % ethanol and air dried in the fume hood. DNA pellet was resuspended in 100 \il of autoclaved water at 65 °C for 1 hour. The DNA was then quantified with a spectrophotometer and diluted to 10 ng/pl in autoclaved water. 2.3 Primer screening A total of 12 primer sets obtained from Dr. C. H. Newton (BCRI, Vancouver, British Columbia) (Table 3) were selected for testing genetic polymorphism from 30 unrelated weevils. Three of the 12 primer pairs (we 2-3, we 2-16.2, and we 2-11) were not successful in amplifying DNA and one primer (we 3-18) produced five bands for all testing samples (see details in the result section). Therefore, only eight of the 12 primers (we 2-5, we 2-7.2, 25 we 2-18, we 2-19, we 3-14, we 3-16, we 3-18, and we 3-24) were selected to examine the pattern of polymorphism between the parents and were used in the present study. 2.4 Amplification of microsatellite Initial microsatellite screening, primer design, and PCR conditions were developed by Dr. C H . Newton (see Appendix I). PCR reactions were carried out in 10 ul final volume using an MJ Research PTC-100 thermal cycler (Waltham, Mass) with some modifications from Newton (1998: Appendix 1). Each reaction is composed of 10 ng of total genomic DNA, 1 pmol of each primer, 2 mM each of dATP, dCTP, dGTP, and dTTP, 10X Buffer (Boehringer Mannheim), 0.25 U of Taq DNA (Boehringer Mannheim), and 0.2 ul of M13 Infrared Label (LiCor Inc., Lincoln, NE). Samples were amplified as follow: 5 min at 94 °C, followed by 35 cycles of 1 min at 94 °C, 45 sec at the annealing temperature (see Table 3), 45 sec at 72 °C, and then followed by a long denaturation cycle of 5 min at 72 ° C PCR conditions were not changed for multiplex reactions. Two ul of stop dye buffer (lOmM EDTA; 95 % formamide [vol:vol]; 0.005 mg of fuschin red) were added to each PCR reaction tube and PCR reactions were kept at -20°C in the dark until electrophoresis. The amplification products were electrophoresed on 5% Long Ranger polyacrylamide gels using a LiCor 4200 automated sequencer (LiCor Inc.). Sequencing gel (30 x 30 cm; 0.4 mm thick; 48 or 64 well comb) was pre-run until the temperature reached 50 °C. The amplification products were denatured at 90 °C for 3 minutes. The maximum volume of 1.0 ul (64 well comb) or 1.5 ul (48 well comb) of PCR amplifications were then loaded per well and run at 26 Table 3. Primer sequence and characterization of Pissodes strobi microsatellites. Locus Sequences (5' - 3') Type of Annealing repeat Temp. (°C) we 1-8 F : G T T G G T C C T T G T T T A C A C G G (AC)„ 55-65 R : A C T T C G T A A C G G T A C G T C G G (AC)„ we 3-24 F : A T T C A C A C A C A G G A T G C C A C (AC) n 55 R : A C C A A C G C G T C A A T C C C G G A (AC) n we 3-14 F : G T T T G T T A A T G G A G T C T T G C T G C (AC)„ 60 R : C G C A C T C T T G C C C T A C T A C A (AC) n we 3-16 F : GGCATCAGATTAATGAAGGTTC (AC) n 60 R : GCGRCACAATTTGGTCCTATTC (AC) n we 3-18 F : GCTATCCTATGCAAGAATGTATC (AC) n 60 R T C G G T T G T G A T G G G A A A T T C (AC)„ we 2-5 F : G C C C A A G A C T A G T T G A A A T C (GATA)n 60 R GGTGTCTAGATAGAGATTTCC (GATA) n we 2-18 F : G G C C C A A G A C T A G T T G A A A T C (GATA) n 60 R : G A G G C A G T C A C T G C C T G G T C (GATA) n we 2-19 F : GGCCCCAATATAGTATATTATC (GATA) n 60 R G G T C T T C C G T T T A A A T G T A C (GATA) n we 2-7.2 F : A A T G C T T G C G T A A G T A A C G A (GATA) n 55 R . G C C C A C T T T T A T G A A T G G G A (GATA) n we 2-3 F : G A G C C T A C T A C A A G C T A T C C (GATA) n 55 R : GCGCTGATAAGTATCACTCGC (GATA) n we 2-11 F : T T T C A C T G C G G T G C C G G A T C (GATA) n 55 R : A G A G A G G A A A G A C A G A G G G T (GATA) n we 2-16.2 F : C T T G C G G C G T T T G T G A C T T A (GATA) n 55 R . C G C T G A C G T C G G G G T T C G A C (GATA) n * Primer design by Dr. C H . Newton (see Appendix I: Initial report of development of weevil microsatellite markers).(Note F = Forward primer and R = Reverse primer) 27 2000 V, 35 mA, 70 W. Standard markers (LiCor Inc.) were run along with the samples at left and right hand sides of the gel to determine the size of the alleles. 2.5 Measuring genetic diversity and probability of exclusion Several genetic parameters including allele frequency, observed and expected heterozygosity, polymorphic information content (PIC), probability of exclusion and null allele frequency were calculated using CERVUS 1.0 (Marshall et al., 1998) as follow. (a) Heterozygosity Observed heterozygosity (Ho) is the proportion of all genotypes that are heterozygous. Expected heterozygosity (He) was calculated for each locus according to Nei (1978): He^l-Qp2) 1=1 where P i is the frequency of ith allele. (b) Polymorphic information content (PIC) was estimated for each locus using the expressions given by Botstein et al. (1980): p/c=i-(5>2)-2S 2Phf i=i i=i ;=i+i where P i and pj are the population frequencies of the z t h and/ h alleles. (c) The probability of exclusion was calculated for each locus (Pi) according to Chakravarti and Li (1983) and the average probability of exclusion (P) was calculated for overall loci as 28 p = i - r j [ i - P ' ] i=i where P/ is the probability of exclusion at locus / and n is the number of loci. (d) Null allele frequency (f0) was calculated for each locus using an iterative algorithm based on the difference between observed and expected frequency of homozygotes according to Summers and Amos (1997): _ YXxa JO = (2nxx + n„) where n„ and n„ is the total number of null/normal heterozygotes and true homozygotes, respectively (for more details in calculating n» and n« see Summers and Amos (1997)). 2.6 Mendelian inheritance and linkage analysis As a result of the characterization of the 8 Pissodes strobi microsatellites, four primer sets (we 2-7.2, we 2-19, we 3-18, and we 3-16) were selected to use in this study. Four out of the 10 replications from single cross-mating, which showed different patterns of polymorphism between parental pair with at least three out of the four microsatellite markers (see Fig. 2) and had high number of offspring, were selected to determine the mode of inheritance. Table 4 represents the number of offspring (male and female) for the 10 replications from the 1F:1M mating design used for screening the polymorphisms between parental pairs. Four replications were selected for the inheritance analysis (Table 4). In each replication, the female and male parents as well as all offspring were analyzed. All observed progeny ratios of each primer set were tested against the expected 1:1 Mendelian segregation 29 ratio using chi-square analysis. Linkage between loci for each replication was also examined according to Weir (1996) using Genetic Data Analysis software (Lewis and Zaykin, 1999). 2.7 Sperm competition and multiple paternity analyses The weevil samples from the caging experiments were used to examine the degree of sperm competition and multiple mating in white pine weevil. Twelve replications of the 1F:2M and eight replications of each of the 1F:4M, 2F:1M, and 4F:1M mating designs were selected for the study. The criterion for replications selection was based on the number of offspring available. The parental female : male combinations and number of offspring in each replication are shown in Table 5. The polymorphism among parents in each mating experiment (1F:2M, 1F:4M, 2F:1M, and 4F:1M) are shown in Figures 3, 4, 5, and 6, respectively. Once again, these experiments allowed families to be mated under competition so that female can choose her mates. 30 Table 4. Number and sex of the offspring weevils from the 1 Female : 1 Male mating caged on Sitka spruce trees in 1997. Replication Number of offspring number Male Female Total 2* 25 27 52 6 25 17 42 15 16 16 32 16* 18 18 36 18* 23 20 43 20* 26 17 43 23 23 19 42 25 16 22 38 27 18 22 40 29 30 24 54 Replications were used for inheritance analysis. 31 Table 5. Number and sex of offspring from 4 female : male mating combinations (1F:2M, 1F:4M, 2F:1M, and 4F:1M) conducted in 1997 and 1998 seasons used to study sperm competition and multiple mating. Mating Replication Year Number of parent Number of offspri ng Design Number Female Male Female Male Total 1F:2M 1 1997 1 2 40 27 67 1F:2M 2 1997 1 2 19 22 41 1F:2M 6 1997 1 2 32 25 57 1F:2M 10 1997 1 2 24 20 44 1F:2M 11 1997 1 2 32 29 61 1F:2M 14 1997 1 2 16 17 33 1F:2M 16 1997 1 2 • 21 19 40 1F:2M 18 1997 1 2 30 27 57 1F:2M 3 1998 0 a 2 38 33 71 1F:2M 7 1998 1 2 34 24 58 1F:2M 8 1998 1 2 6 16 22 1F:2M 9 1998 1 2 21 26 47 1F:4M 5 1997 1 4 14 13 27 1F:4M 6 1997 1 4 20 19 39 1F:4M 9 1997 1 4 b 35 25 60 1F:4M 13 1997 1 4 b 34 26 60 1F:4M 17 1997 1 4 9 18 27 1F:4M 19 1997 1 4 b 24 27 51 1F:4M 1 1998 1 4 23 19 42 1F:4M 8 1998 1 4 19 30 49 2F:1M 1 1988 2 1 27 19 46 2F:1M 2 1988 2 1 42 45 87 2F:1M 3 1988 l a 1 24 36 60 2F:1M 4 1988 2 1 78 80 158 2F:1M 5 1988 2 1 27 25 52 2F:1M 8 1988 2 1 21 27 48 2F:1M 9 1988 2 1 25 21 46 2F:1M 10 1988 2 1 26 19 45 4F:1M 1 1988 4 1 32 38 70 4F:1M 3 1988 4 0 a 34 39 73 4F:1M 4 1988 3 a 1 20 31 51 4F:1M 5 1988 4 b 1 31 22 53 4F:1M 6 1988 4 1 20 16 36 4F:1M 7 1988 2 a 1 41 31 72 4F:1M 8 1988 4 1 16 14 30 4F:1M 10 1988 4 51 56 107 a : Some parents were not retrieved. b : Some parents were found dead during the retrieval of parents. 32 C 530 bp 500 bp mm 460 bp 400 bp we 3-14 b 350 bp 325 bp 300 bp we 3-16 is** 255 bp 230 bp 204 bp 200 bp 175 bp we 2-19 a 255 bp 230 bp we 2-7.2 204 bp 200 bp 175 bp w e 2-5 145 bp 120 bp 105 bp we 3-18 M F 2 M F 6 M F 15 M F 16 M F 18 M F 20 M F 23 M F M 25 F 27 M F 29 Figure 2. The polymorphism between parent pairs of six microsatellite markers from 12 replications of single cross mating (1F:1M), M = male and F = female, (a) we 3-18, we 2-5, and we 2-7.2 were run on the same gel. Primer set we 2-5 (2a) and 3-18 (3a) were multiplex PCR products and then mixed with primer set we 2-7.2 (al). (b) primer set we 3-16 (bl) and we 2-19 (b2) were analysed on the same gel using multiplex PCR. (c) primer set we 3-14. Primer we 2-5 showed possible homozygotes for nonamplifying alleles despite successful coamplification at we 3-18. Similarly, primer we 3-16 and we 2-19 exhibited possible null allele homozygotes. None of the we 3-16 or we 2-19 bands were observed in the test panel in which one was successful amplification DNA. Note all allelic size have LiCor primer tails. Numbers in the bottom represents the replication number in Table 4. 33 d we 3-16 350 bp - | H| ' ( 1 325 b p - -1 | • I I I f 1 •« • 300 bp tig ^ «4 n i • • • • § -c we 2-19 255 bp — m 230 bp ""» ** * * 204 bp _ - m m Z 200 bp — m m • • i 175 bp — mm — we 2-7.2 2 5 5 b p l$0 §m 230 bp w a 145 bp _ 120 bp « 105 bp -• we 3-18 F M M F M M F M M F M M F M M F M M F M M F M M F M M F M F M M F M M I—1 —I—2 —1—6 —I—10 —I—11 —1—14 -1—16 —I—18 H—3 —t-7-r— 8 ~+~ 9~1 Figure 3. The polymorphism among parents of four microsatellite markers from 12 replications of 1F:2M mating design, M = male and F = female, (a) we 3-18 and (b) we 2-7.2 were run on the same gel using mixed reactions, (c) we 3-16 and (d) we 2-19 were analyzed on the same gel using multiplex PCR. Note all allelic size have LiCor primer tails. Numbers in the bottom represents the replication number in Table 5. 34 d we 3-16 3 5 0 b P " i f - . 325 bp <m 300 bp ** • f mm w * 1 1 * « ' § 4 1 | | * f - » C we 2-19 255 bp - m •» m m 230 bp - ~ • ~ • m m 204 bp „ m m " m — „ * * _ _ 200 bp • • • » 175 bp -we 2-7.2 255 b P « - » UJ p p m * # • • » • # • »*» » §^SP^  '^Hl MBfc liBt :' - • - * Wm I f • V « * * » * M • 230 bp -a we 3-18 • I I 11 i l l 145 bp 120 bp 105 bp F M M M M F M M M M F M M M M F M M M M F M M M M F M M M M F M M M M F M M M M •5 1 6 1 9 1 13 1 17 1 19 1 1 1 Figure 4. The polymorphism among parents of four microsatellite markers from 8 replications of 1F:4M mating design, M = male and F = female, (a) we 3-18 and (b) we 2-7.2 were run on the same gel using mixed reactions, (c) we 3-16 and (d) we 2-19 were analyzed on the same gel using multiplex PCR. Note all allelic size have LiCor primer tails. Numbers in the bottom represents the replication number in Table 5. 35 we 3-16 350 bp nm 325 bp .... m 300 bp im%it m 3 c 255 bp 230 bp 204 bp . 200 bp *" 175 bp — we 2-19 we 2-7.2 255 bp 230 bp _ a 145 bp 120 bp 105 bp we 3-18 M F F M F F M F F M F F M F F M F F M F F M F F I 1 1 2 1 3 1 4 1 5 1 8 1 9 1 10 Figure 5. The polymorphism among parents of four microsatellite markers from 8 replications of 2F:1M mating design, M = male and F = female, (a) we 3-18 and (b) we 2-7.2 were run on the same gel using mixed reactions, (c) we 3-16 and (d) we 2-19 were analyzed on the same gel using multiplex PCR. Note all allelic size have LiCor primer tails. Numbers in the bottom represents the replication number in Table 5. 36 we 3-16 350 bp 325 bp 300 bp r 3 * * « f * mm » • c 255 bp ' 230 bp 204 bp 200 bp 175 bp • we 2-19 255 bpw_ 230 bp -• mm we 2-7.2 a 145 bp | 120 bp -> 1 105 bp we 3-18 M F F F F M F F F F M F F F F M F F F F M F F F F M F F F F M F F F F M F F F F 10-Figure 6. The polymorphism among parents of four microsatellite markers from 8 replications of 4F:1M mating design, M = male and F = female, (a) we 3-18 and (b) we 2-7.2 were run on the same gel using mixed reactions, (c) we 3-16 and (d) we 2-19 were analyzed on the same gel using multiplex PCR. Note all allelic size have LiCor primer tails. Numbers in the bottom represents the replication number in Table 5. 37 2.7.1 Parentage determination Because of the known parental genotypes, parentage assignment was done by visual comparison of offspring and putative parental bands. In case that some offspring were indistinguishable because their parents shared one or more alleles in common, the likelihood-based paternity inference program CERVUS (Marshall et al., 1998) was used for parentage assignment using 3 of 4 microsatellite loci (we 2-7.2, we 2-19, and we 3-18). Locus we 3-16 was excluded from the analysis due to the problems of duplicated loci. 2.7.2 Statistical analysis For 1F:2M experiment, G-test for goodness-of-fit was applied to test the statistical differences in the degree of sperm competition. Similarly, G-test for goodness-of-fit to a 1:1:1:1 ratio of offspring was used to determine the number of offspring sired by each male for four-male experiment. The assumption is that there is complete sperm mixing. Thus, offspring are equally sired by each male. Similar to 1F:2M and 1F:4M mating designs, log-likelihood ratio G-tests were use to examine the hypothesis of sperm quantity from 2F:1M and 4F:1M mating designs, assuming that the number of offspring produced by each female are equal when there is no sperm depletion. Log-likelihood ratio G-tests was calculated according to Sakol and Rohlf (1995): G = 2 -n Inn K1" ) where ft is the observed frequency, pi is the expected proportion of class /, n is sample size, and a is the number of class. 38 Chapter 3. Results 3.1 Primer screening and characterization of Pissodes strobi microsatellites 3.1.1 Primer screening Using 30 samples from unrelated weevils, an initial screening of nine of the 12 primer pairs (we 1-8, we 2-5, we 2-7.2, we 2-18, we 2-19, we 3-14, we 3-16, we 3-18, and we 3-24) were successful in DNA amplification. The remaining three primer pairs (we 2-3, we 2-16.2, and we 2-11) were not consistent across all samples tested in that bands were not observed in many samples. The banding patterns of nine microsatellite loci are shown in Figure 7. The allelic banding patterns of two primer sets (we 2-5 and we 2-18) were similar although they were different in size range (Fig. 7b and c). A one-primer pair (we 1-8) produced five bands for all samples, thus making scoring unreliable (Fig. 7a) and was not included in the study. Additionally, a complex pattern was observed for two primers we 3-14 and we 3-18 that produced four or fewer alleles with one fixed allele was observed in all samples (Fig. 7f and h), respectively. 39 e we 2-19 255 bp — 230 bp — S 204 bp „ , <S 200 bp - — mg m -175 bp - ** ""* * • " " i we 3-24 175 bp _ | | | | m I I kg 145 bp ~ -d ta ta ta ta 230 bp -we 2-7.2 mm • w h we 3-18 145 bp - | | 105 bp — c 230 bp " 1 204 bp — we 2-18 M '* Il g we 3-16 325 bp ' • * " * aa ta i 300 bp - 1 jf b 200 bp - , 175 bp we 2-5 N a 350 bp * • 3 2 5 bp -1 I \ l: ' I 300 bp — we 1-8 f we 3-14 495 bp 460 bp - * M , -1 • » ' H 400 bp -364 bp — Figure 7. Preliminary testing on microsatellite primers and their banding patterns observed at nine of the 12 primer pairs in 15 white pine weevils from unrelated weevils. Note all allelic sizes have LiCor primer tails see Table 6 for the range of actual size. 40 3.1.2 Polymorphism of microsatellites The polymorphism of eight microsatellite loci (we 2-5, we 2-7.2, we 2-18, we 2-19, we 3-14, we 3-16, we 3-18, and we 3-24) was studied in more detail on parents from three different mating designs (1F:1M, 1F:2M, and 1F:4M) (Table 6). Preliminary testing on co-amplifications was also successful in multiplexing for two sets of primers: (1) we 2-19 and we 3-16 (Fig. 2b) and (2) we 3-18 and we 2-5 (Fig. 2a). In addition, one primer set (we 2-7.2) can be pooled with the multiplexing reactions of set 2 (see Fig. 2a). The number of allele per locus ranged from 5 at loci we 2-5 and we 2-18 to 16 alleles at locus we 3-16 with a mean value of 9. The mean polymorphic information content (PIC) was 0.718 with locus we 3-14 had the highest PIC (0.789) and locus we 2-5 and we 2-18 had the lowest PIC (0.270). The probabilities of exclusion had similar rank to PIC values with an average across loci of 0.96. Size range, number of alleles, observed and expected heterozygosity, polymorphic information content, probability of exclusion and null allele frequency at each locus are shown in Table 6. The distributions of allele frequency at the seven loci (we 2-19, we 2-7.2, we 2-5, we 2-18, we 3-24, we 3-18, and we 3-14) based on various sample sizes listed in Table 6 are shown in Figure 8. Primers we 2-5 and we 2-18 showed similar patterns of band segregating in all samples. The product size of we 2-5 is between 156-172 base pairs while the product size of we 2-18 ranges from 201 to 217 base pairs. Five alleles were recorded at both loci. Allele 169 of we 2-5 and allele 214 of we 2-18 had the highest allele frequency (0.7109). The remaining four alleles of these two primers had allele frequencies ranging from 0.234 to 0.1484 (Fig. 8a and b). The percentage of non-amplifying reaction was 28 % (25 out of 89 reactions). Observed and expected heterozygosity at both loci we 2-5 and we 2-18 were 41 Table 6. Polymorphism and null allele frequency of Pissodes strobi microsatellites. Locus Sample %of No. of Size Heterozygosity b PIC Probability Null allele size NAR a Allele range(bp) Obs. Expt. of exclusion frequency we 3-14 99 26.26 13 418-511 0.219 0.902 0.886 0.789 0.607 we 3-16c 99 12.12 16 279-347 - - - - -we 3-18 99 4.04 10 63-136 0.495 0.805 0.773 0.612 0.235 we 3-24 77 42.90 6 138-160 0.200 0.741 0.696 0.512 0.570 we 2-5 89 28.00 5 156-172 0.078 0.469 0.453 0.270 0.729 we 2-7.2 99 0.00 7 210-242 0.697 0.747 0.703 0.518 0.028 we 2-18 89 28.00 5 201-217 0.078 0.469 0.453 0.270 0.729 we 2-19 99 26.26 10 159-239 0.329 0.839 0.813 0.673 0.433 a NAR = Non-amplifying Reaction. b The values based on the parents from 1F:1M, 1F:2M, and 1F:4M mating designs. 0 locus we 3-16 was excluded from the study due to its complex pattern. 42 0.30 0.40 0.35 0.30 H 0.25 0.20 0.15 0.10 0.05 0.00 we 2-7.2 0.35 0.30 0.25 0.20 0.15 0.10 H 0.05 0.00 i we 3-18 TTTTTTTTTTTTT Figure 8. Allele frequency of seven microsatellite loci for male and female parents from 1F:1M, 1F:2M, and 1F:4M mating designs. 43 0.078 and 0.469, respectively. These two loci, we 2-5 and we 2-18, provided the lowest PIC and probability of exclusion of 0.435 and 0.270, respectively, and had the highest null allele frequency estimates of 0.729 for both loci. Primer we 2-7.2 showed clear bands (see Fig. 7d). This primer had 7 alleles with the lowest estimate of null allele frequency (0.028). The allele size is between 210 and 242 base pairs. The allele frequencies for alleles 210, 222, 226, 230, 234, 238, and 242 were 0.0051, 0.0354, 0.1818, 0.2525, 0.3788, 0.1212, and 0.0253, respectively (Fig. 8c). Non-amplifying reactions were not observed in any of the reactions tested. Observed and expected heterozygosities at this locus were 0.697 and 0.747, respectively. Polymorphic information content (0.703) and probability of exclusion (0.518) ranked 4 t h among the other studied loci (see Table 6). This primer represented the highest fidelity of microsatellite in white pine weevil for studying population genetics. Primer we 2-19 displayed clearly distinct banding with 10 alleles. The number of alleles was similar to that of primer we 3-18. The allele size ranges from 159 to 239 base pairs. Allele 159 had the highest allele frequency (0.2671). Allele 188 and 184 ranked 2 n d and 3 r d for allele frequencies of 0.2260 and 0.1370, respectively. Four other alleles 180, 194, 212, and 227 were similar and produced allele frequencies of 0.0753, 0.0753, 0.0890, and 0.0685, respectively. The allele frequencies of the remaining three alleles 200, 216, and 239 were low and were 0.068, 0.0411, and 0.0137, respectively (Fig. 8d). Non-amplifying reactions were also observed in 26 out of the 99 reactions (26.26%). Observed and expected heterozygosities at this locus were 0.329 and 0.839, respectively, providing the heterozygote deficiency with null allele frequency estimate of 0.433. Locus we 2-19 ranked 2 n d for PIC and probability of exclusion (Table 6). 44 Primer we 3-14 had two loci with three alleles for the first of which one was fixed while the second had 13 alleles. The allele size ranged between 418 and 511 base pairs. Five alleles 437, 441, 445, 448, and 452 had allele frequencies > 0.1 with values of 0.1164, 0.1575, 0.1438, 01096, and 0.1301, respectively. The remaining eight alleles had allele frequencies ranging from 0.0205 to 0.0685 (Fig. 8e). Non-amplifying reactions were observed in 26 out of the 73 reactions (26.26%). Observed and expected heterozygosities at this locus were 0.219 and 0.902, respectively. Locus we 3-14 ranked 1st for PIC (0.886) and probability of exclusion (0.789), but estimate of null allele frequency was high (0.607) (Table 6). Primer we 3-16 had the highest number of alleles (16 alleles); however, this primer also produced three or four bands, possibly complex loci. Further analysis of multiple paternity confirmed that this microsatellite locus produced duplicated alleles. Because of the complex pattern of heterozygosity, allele frequency, PIC and probability of exclusion were not calculated. Primer we 3-18 produced four or fewer alleles with one fixed allele. Further analysis of Mendelian inheritance and multiple paternity (Fig. 11a and b) provided evidence that the fixed allele (91 base pairs) of we 3-18 could be ignored and thus considered as one locus. There were 10 alleles with product sizes ranging form 63 to 136 base pairs at this locus. Allele 101 had the highest frequency of 0.3053 while alleles 89, 99, and 126 were similar in their allele frequencies with values of 0.1895, 0.1737, and 0.1895, respectively. The allele frequencies of the remaining six alleles 63, 95, 97, 106, 117, and 136 were 0.0105, 0.0158, 0.0421, 0.0105, 0.0263, and 0.0368, respectively (Fig. 8f). Non-amplifying reactions were only 4.04 %. Observed and expected heterozygosities were 0.495 and 0.805, respectively, 45 indicating that null allele is present. However, the estimate of null allele frequency was only 0.235. Locus we 3-18 ranked 3 r d for PIC (0.773) and probability of exclusion (0.612) (Table 6). Primer we 3-24 displayed six alleles with product size ranging from 138 to 160 and had the highest percentage of non-amplifying reactions (42.9%). The most common allele was allele 142 with frequency of 0.425. The allele frequencies of remaining five alleles 138, 144, 152, 156, and 160 ranged from 0.0125 to 0.1875 (Fig. 8g). Observed and expected heterozygosities were 0.200 and 0.741, respectively, indicating that the deficit of heterozygotes with the estimate of null allele frequency of 0.570. Locus we 3-24 ranked 5 t h for PIC (0.696) and probability of exclusion (0.512) (Table 6). By considering the characterizations of the eight microsatellite loci (number of allele, PIC, probability of exclusion, percentage of non-amplifying reaction, and null allele frequency) and the uses of multiplexing and pooling reactions, primers we 2-7.2, we 2-19, we 3-18, and we 3-16 were selected for further work in the present study. 3.1.3 Inheritance of Microsatellite markers Mendelian inheritance was studied for four of the eight microsatellite markers (we 2-7.2, we 2-19, we 3-18, and we 3-16). The examination of offspring from the controlled cross with known male and female genotypes permitted the detection of null alleles. Chi-square test provided different results for each primer set in each replication. However, by considering null alleles, there were no significant different between observed and expected progeny ratios (based on the Mendelian law of inheritance) for we 3-18, we 2-7.2, we 2-19, and we 3-16 in all families (P>0.05). 46 Table 7. Inheritance of four microsatellite markers in Pissodes strobi from four controlled crosses with 1 Female : 1 Male mating. Rep. No. Primer Genotype No. of offspring x2 P Male Female F l observed expected 2 we 2-7.2 234 / 234 230/234 230 / 234 27 26 0.077 0.782 234 / 234 25 26 we 2-19 null / null 180/ 194 180/null 27 26 0.077 0.782 194/null 25 26 we 3-16 289 / null null / null 289 / null 20 26 2.769 0.096 null / null 32 26 we 3-18 89/99 97 / 126 89/97 13 13 0.615 0.893 89/126 11 13 97/99 15 13 99 / 126 13 13 16 we 2-7.2 234 / 234 226 / 234 226 / 234 18 18 0.000 1.000 234 / 234 18 18 we 2-19 212/null 227 / 227 212/227 22 18 1.778 0.182 227 / null 14 18 we 3-16 306/306 291/306 291/306 13 18 2.778 0.096 306 / 306 23 18 we 3-18 null / null 101/126 101 / null 20 18 0.444 0.505 126 / null 16 18 18 we 2-7.2 230/230 226 / 234 226/230 21 21.5 0.023 0.879 230/234 22 21.5 we 2-19 159/null 180/200 159/180 15 10.75 7.744 0.052 159/200 7 10.75 180/null 5 10.75 200 / null 15 10.75 we 3-16 289 / 295 289 / 289 289/289 23 21.5 3.614 0.306 289 / 295 17 21.5 we 3-18 101 / null 99 /126 99/101 16 21.5 6.169 0.104 101/126 14 10.75 99 / null 5 10.75 126/null 8 10.75 20 we 2-7.2 230 / 234 226 / 230 226 / 230 16 10.75 3.605 0.307 226 / 234 10 10.75 230/230 8 10.75 230 / 234 9 10.75 we 2-19 188/null 188/null null / null 8 10.75 0.938 0.333 188/null 35 32.25 188/188 we 3-16 289 / null 295 / null 289 / 295 10 10.75 1.372 0.712 289 / null 8 10.75 295 / null 13 10.75 null / null 12 10.75 we 3-18 101 / 126 106/126 101 / 106 11 10.75 2.674 0.445 101/126 8 10.75 106/126 15 10.75 126/126 9 10.75 P Significant probability 47 3.1.3.1 Microsatellite locus we 2-7.2 Locus we 2-7.2 represented the "perfect" microsatellite in white pine weevil. Inheritance analysis from four single cross matings indicated the absence of null alleles (Fig. 9). Chi-square analyses showed no significant differences between observed and expected ratio of progeny based on Mendelian inheritance for all four replications (Table 7). 3.1.3.2 Microsatellite locus we 2-19 Locus we 2-19 showed the presence of null allele in both homozygotes and heterozygotes (Fig. 10). Null allele homozygotes were observed in the male parent in replication number 2 (Fig. 10a). These parent pairs were selected for study to confirm the non-amplifying homozygotes at this locus (26.26%) as discussed earlier. The female parent had a genotype of 180 / 194. The analysis of this replication of all 52 offspring produced 25 individuals with 180 / null and 27 individuals with 194 / null genotypes. Chi-square analysis showed that there was no deviation from the expected genotype 1:1 ratio (%2 = 0.077, df = 1, P = 0.782) (Table 7). Heterozygotes for null alleles were also observed in male parents of the other three replications (number 16, 18, and 20) and one female parent in replication 20 (Table 7). For replication number 16, both male and female parents were assumed to be homozygous at different allele size with male and female parents of possible genotype of 212/212 and 227 / 227, respectively. Therefore, the offspring genotype is expected to be 212 / 227 only. However, two genotypes were produced. These were the expected 212 / 227 with 22 offspring and the unexpected 227 / 227 with 14 offspring (Fig. 10b). Assuming that the male parent was heterozygous for null allele (212 / null), then the unexpected offspring genotype 48 a Rep. no. 18 2 5 5 P B » \ * S * - S J i i i * w « i i * « • * • * i • mm m)m M • mmm m m I g • » • » • • » 230 pb " M F M F M F M F M F M F M F M F M F M F M F M F M F M F M F M F M F M F M F M F M F M M M , parent"^ offspring ^ D Rep. no. 20 255 pb ^ "2 **m — " * mm **• • • • ** ««vwtm •«««tf«fj.fajM| „ # w*mmmm*m mm m • «• « . » « ^ „ | | „ , „ «• . # w > « « * - • « mm mmmmmmm 230 pb . M F M F M F M F M F F M F M F M F M F M F M F M F M F M F M F M F M F M M M M M M M M M M M parent offspring ^ Figure 9. Inheritance of microsatellite locus we 2-7.2 from the 1 Female : 1 male mating. M and F indicate male and female, respectively. The first two lanes contained amplifications products from the parents and followed by their offspring, (a) and (b) are the examples of banding segregation indicating the Mendenlian inheritance from replications number 18 and 20. Note all allelic size have LiCor primer tails. 49 d 230 bp Rep. no. 20 204 bp , r * * * * * * * * * * 200 bp M F parent-< offspring C R e p . n o . 18 230 bp «•»*•<«» m m »» m m t -mm * » « * « # • • « • « • • « n o 204 bp 200bp " » « • » « • <* -»aw aa « » ««• *»«»•«>«# «* » ™ * a» I75bp * « • * * « § « • • < * « • « - «i - - -* * * * * * * * * * * * * * * * * * * * * M F parent ^ offspring b Rep . no. 16 255 bp — * * * * * * * * * * * * * * M F parent offspring 3 Rep . no. 2 230 bp « • ««««« wwmw m m m •« • » „ . 200 bp - • • » 1 • * « f t s 4 . -* * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * ** * * * * ** M F parent-^ offspring Figure 10. Inheritance of microsatellite locus we 2-19 from the 1 Female : 1 Male mating. M and F indicate male and female, respectively. The presences of null alleles are indicated by *. (a) Male parent had homozygotes for null alleles; therefore, all offspring showed the heterozygotes for null alleles, (b) and (c) Male parents had heterozygotes for null alleles; therefore, some offspring showed the heterozygotes for null alleles, (d) Both male and female parents had heterozygotes for null alleles; therefore, some offspring showed homozygotes and heterozygotes for null alleles. However, null allele heterozygotes could not be distinguished from homozygous genotypes due to identical banding patterns. Note all allelic size have LiCor primer tails. 50 should be considered as 227 / null. Chi-square analyses for these two combinations showed that there was no significant difference from the expected genotype 1:1 ratio with the hypothesis of a null allele heterozygous in the male parent (%2 = 1.788, df = 1, P = 0.182) (Table 7). Similarly, replication 18 produced offspring genotypes indicating that the male parent was heterozygotes for 159 / null genotype (Fig. 10c). Two unexpected offspring genotypes were observed these were 180 / null and 200 / null (Table 7) with five and 15 offspring, respectively (Fig. 10c). Following this model, the chi-square analysis showed that there was no significant difference from the expected genotype 1:1:1:1 ratio with the hypothesis of a null allele heterozygous in male parent (%2 = 7.744, df = 3, P = 0.052) (Table 7). Replication number 20 (Fig. lOd) had both male and female parents with a single homozygous genotype with the same allele size (188). In this situation, it is expected that all offspring genotypes will be identical to both parents. Segregation analysis of this parental combination produced two genotypes one of them is indicative of a null / null genotype, indicating that both parents are heterozygotes for a null allele. This was confirmed by the presence of eight offspring with homozygotes for non-amplifying alleles confirmed the expectation of offspring genotype null / null. Under this model, it is expected that offspring would segregate following the 1:2:1 ratio for 188 / 188, 188 / null, and null / null genotypes, respectively. Because the genotypes 188 / 188 and 188 / null cannot be distinguished from each other the chi-square analysis was performed to test the deviation from the expected genotype 3:1 ratio. There was no significant difference from the expected genotype 3:1 ratio (X2 =0.938, df= 1,P = 0.333) (Table 7). 51 3.1.3.3 Microsatellite locus we 3-18 It is important to note that we 3-18 produced three or fewer bands with one fixed allele (91 base pair). Evidences from further analysis of the 4F:1M combination indicated that this fixed allele should be ignored for scoring and this marker was considered as one locus (see section 3.1.2). There were no more than two alleles observed in the test panel when the fixed alleles were ignored (see Fig. 11a). In addition, the inheritance analysis in replication number 2 also supported this decision (see Table 7 and Fig. lib). Male and female parents had genotype 89 / 99 and 97 / 126 based on the hypothesis of ignoring fixed alleles. Thus, the expected offspring genotypes are 89 / 97, 89 / 126, 97 / 99, and 99 / 126. The inheritance analysis showed that there was no significant difference from the expected genotype 1:1:1:1 ratio when the fixed alleles were discarded (%2 = 0.615, df = 3, P = 0.893). Locus we 3-18 also showed the presences of null alleles for two out of the four replications studied. Homozygotes and heterozygotes for non-amplifying alleles were detected in male parent from replication number 16 and 18, respectively. For replication number 16, the male and female parents had possible genotypes of null / null and 101 / 126, respectively (Fig. 11c). Then the expected offspring genotypes should be 101 / null and 126 / null. In the analysis of all offspring (n = 36) there were 20 and 16 individuals that showed genotypes of 101 / null and 126 / null, respectively. Chi-square analysis showed that there was no deviation from the expected genotype 1:1 ratio according to the hypothesis of male parent null allele homozygote genotype (%2 = 0.444, df = 1, P = 0.505). Segregation pattern of replication number 18 (see Fig. lid), is indicative of the presence of male parent genotype of 101 / null. The genotypic combinations observed for the 52 145 bp w I • Rep. no. 18 t • -** «* at • S « » 8 3 i § 4 * i " * - , ~ 3 — • <f — * * "* * • 3 S H 8 •» 105 bp *** ^ ,. „ * * * * * * * * * * * * * * M F parent-*^ offspring C Rep. no. 16 1 4 5 b p ~ 120 bp * -1 05 bp *•* * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * M F p a r e n t - ^ offspring \) Rep . no. 2 145 bp . . ft J I 120bp as, 105 bp • M F » parent ^ offspring 3 Rep . no. 6 I 4 5 b p - * - f _ Figure l l . Inheritance of microsatellite locus we 3-18 from the l Female : l Male (b-d) and 4 Females : l Male (a) matings. M and F indicate male and female, respectively. The thick arrow at left side indicates the fixed allele, which was discarded from the scoring, (a) The segregation of two alleles below the fixed allele indicated that this locus could not be scored for two loci, (b) The banding patterns of this locus without the null allele segregated as Mendenlian inheritance when the fixed alleles were ignored, (c) and (d) showed the presences of heterozygotes for the null alleles (*) from l Female : l Male mating when male parents had null allele homozygote (c) and null allele heterozygote (d). Note all allelic size have LiCor primer tails. 53 confirmed this observation (Table 7 and Fig. lid). Assuming male parent was heterozygous for the null allele (101 / null), the expected offspring genotypes are 99 / 101, 101 / 126, 99 / null, and 126 / null. Therefore, the unexpected parent-offspring combinations were considered as 99 / null and 126 / null. Chi-square analysis showed that there was no significant difference from the expected genotype 1:1:1:1 ratio with the hypothesis of a null allele heterozygous in male parent (%2 = 6.169, df = 3, P = 0.104). Replication 20 produced the expected segregation of 1:1:1:1 due to the fact that both male and female parents were heterozygotes for 101 / 126 and 106 / 126 genotypes, respectively (Table 7). Offspring produced four genotypes that segregated according to expectation with no significant differences (x2 = 2.674, df = 3, P = 0.445) (Table 7). 3.1.3.4 Microsatellite locus we 3-16 Microsatellite locus we 3-16 exhibited expected Mendelian segregation in all replications studied (Table 7). However, the problem for scoring microsatellite primer set we 3-16 was that this primer produced four or fewer bands (see section 3.1.2). The analysis of multiple paternity from the 1F:4M combination indicated that we 3-16 produced the duplicated loci. In the test panel, female parent had genotype 289 / null and male 2 had genotype 305 / 321. Duplicate loci were clearly observed in 10 out of 19 offspring sired by male 2 because this male contributed both alleles (305 and 321) to his offspring (Fig. 12a). The results of inheritance analysis in this study also supported the presence of duplicated loci in microsatellite locus we 3-16. Inheritance analysis from replication number 16 (Fig. 12b) indicated that in the test panel 22 out of 36 offspring exhibited three bands in which male and 54 d Rep . no. 20 325 bp -300 bp jj. jj. # * * * #1 * * * * * * * * * * * 1 * 4 * * * * * * 1 * * * * * * * * * * * I l M F p a r e n t ^ offspring ^ C Rep. no. 2 325 bp -• mm m « tr • »* 0 - »» « i * 300 bp -255 bp -230 bp „ 2 0 0 B P M F p a r e n t ^ offspring b Rep . no. 16 350 bp 325 bp «. - W - » . * - - . V 9 4 I |^j§- | -300 bp - «M«f M F parent ^ offspring a Rep. no. 19 350 b p - - • 1 N 325 bp - f | ' N , « * , m « <* .. - „ HSlP !*B(p' n^i*5 ''wi? "ilW <*M(Pi?ifw* "Wits. **** 300 bp — — F M M M M ^ - p a r e n t <; offspring ^ Figure 12. Inheritance of microsatellite locus we 3-16 from the 1 Female : 1 Male (b-d) and 1 Female : 4 Males (a) matings. M and F indicate male and female, respectively, (a) and (b) showed the incidences of duplicated loci. The thick arrow at left side indicate duplicates locus, (b) and (c) showed the presences of homozygotes and heterozygotes for the null alleles (*) from the 1 Female :1 Male mating. Segregation of the null allele homozygotes at this locus was confirmed by the mutilplexing reactions of we 2-19 and we 3-16 (c). Many individuals failed to amplify at locus we 3-16 (300-325 bp) while successful amplifications were observed at locus we 2-19 (200-215 bp). Note all allelic size have LiCor primer tails. 55 female parents had genotype 306 / 331 and 291 / 306, respectively. It was assumed that the parent has duplicate loci at 331 base pairs. Therefore, the male parent genotype is 306 / 306 and the expected offspring genotypes are 291 / 306 and 306 / 306. Chi-square analysis showed that there was no significant difference from the expected genotype 1:1 ratio (x = 2.778, df = 1, P = 0.096) (Table 7). In addition to duplicated loci, null alleles were also observed for we 3-16 in two out of the four replications. Homozygotes and heterozygotes for non-amplifying alleles were detected in this marker. Parent pairs from replication number 2 were selected for study to confirm the non-amplifying homozygotes. Female parent had possible homozygote for non-amplifying allele (null / null) while male parent had genotype 289 / 289. If the assumed genotype of the female parent is true, then only one genotype (289 / null) is expected in all offspring. In the analysis of all offspring (n = 52), segregation for the presence and absence of the band in the offspring was observed (Fig. 12c) with only 20 offspring with the 289 / null genotype. The remaining 32 offspring did not show any bands, indicating that the male parent is heterozygote for a null allele producing a parental genotypes of 289 / null. Therefore, it is expected the offspring genotypes will be either 289 / null or null / null. Chi-square analysis showed that there was no deviation from the expected genotype 1:1 ratio according to these assumptions (x2 = 2.769, df = 1, P - 0.096) (Table 7). Replication number 20 (Fig. 12d) represented the null allele heterozygotes for both parents. If male and female parents genotype are 289 / 289, and 295 / 295, respectively. Then only one genotype should be observed in all offspring (289 / 295, n = 43). However, two unexpected genotypes 289 / 289 and 295 / 295 were detected in 21 of 43 offspring as well as 56 12 individuals with no bands (Fig. 12d). Therefore, it should be assumed that both male and female parents were heterozygous for the null alleles with genotypes of 289 / null and 295 / null, respectively. The expected offspring genotypes are 289 / 295, 289 / null, 295 / null, and null / null with 1:1:1:1 ratio. Chi-square analysis showed that there was no significant difference from the expected genotype 1:1:1:1 ratio with the hypothesis of a null allele heterozygous in both parents (%2 = 1.372, df = 3, P = 0.712)(Table 7). 3.1.4 Linkage analysis A total of three different pairs of loci were tested for four replications from the 1 Female : 1 Male mating. Two-locus combinations (we 3-18-we 2-19 and we 2-7.2-we 2-19) in replication number 20 were excluded from the analysis because the offspring genotypes 188 / null heterozygotes were identical to that of 188 / 188 homozygotes at we 2-19 locus. Pairwise exact tests for linkage disequilibrium revealed no significant deviations from expectation for all studied families (P>0.05), indicating that these loci were not linked (Table 8). 57 Table 8. Linkage analysis of three microsatellite markers from the 1 Female : 1 Male mating over four replications. Pair of loci P Rep. # 2 Rep. # 16 Rep. # 18 Rep. # 20 we 3-18-we 2-7.2 0.11 1.00 0.38 0.88 we 3-18-we 2-19 0.71 0.74 0.46 -we 2-7.2-we 2-19 0.60 0.31 0.36 -P: Significant probability 58 3.2 Sperm competition and multiple mating by males and females Sperm competition, multiple paternity and maternity were studied using four microsatellite loci with confirmed Mendenlian inheritance (see above). A total of 1,987 weevil offspring from four different mating designs were used. Paternity assignment was first done by visual comparison of offspring and putative parental bands. With the combinations of four microsatellite loci and known parental genotypes, offspring could be assigned exclusively to specific males or females in most replications (see example Figure 13). Only 153 out of 1,987 offspring (mostly in the 4F:1M mating design) could not be assigned parentage by visual comparison. In these cases, the computer program CERVUS was used to examine paternity or maternity. Table 9 represents the number of indistinguishable offspring by visual comparison and the percentage of parentage assignment by CERVUS in 13 replications for four mating designs. 3.2.1 Sperm competition and multiple paternity A total number of 12 replications were evaluated from the 1F:2M mating design. The results showed that the offspring of two replications (6 and 14) were exclusively sired by one male while the remaining 10 replications produced offspring that were sired by both males (Fig. 14). Replication 10 showed multiple paternity producing 12 out of the 44 offspring were not sired by either of the two males used in the experiment. This replication was excluded from the study. The most likely reasons for this is a misplacement of samples during DNA extraction. The percentage of offspring sired by one male ranged from 14.63 to 86.89% (Table 10). 59 we 3-16 350 bp l | I f ^ 1 f * -325 bp — 300 bp F M M M M M F -M F M F • M F VI F M F M F M F m -m*m* M F M F M F M •mt F i i M F F i : 3 4 1 2 1 4 5 6 7 8 9 • 1 1 1 2 13 14 15 16 17 1819 20 21 22 23 24 25 26 27 we 2-19 255 bp — 230 bp — - — 204 bp 200 bp - mm — - — - — 175 bp F M M M M M F M F M F M F M F M F M F M F M F M F M F M F M F F 1 2 3 4 1 2 3 4 5 6 7 S 9 1 0 1 1 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 we 2-7.2 255 bp m m • — — mm my mt — S -mm""" - --z - rnrm* mt mm •mt mr mtmW mm mw-rn* «* — — — mm — 230 bp — F M M M M M F M F M F M F M F M F M F M F M F M F M F M F M F F * * 1 2 3 4 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 we 3-18 145 bp i * " 120 bp - mm mm -- • - » - -mymt- - -105 bp -F M M M M M F M F M F M F M F M F M F M F M F M F M F M F M F F 1 2 3 4 1 2 3 4 5 6 7 S 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 U 1 1 S[J 1 1 11 £ Figure 13. An example of paternity assignment in 1 Female : 4 Males using four microsatellite loci including we 3-18, we 2-7.2, we 2-19, and we 3-16. F and M indicate female and male, respectively. Primer set we 2-19 and we 3-16 were analyzed on the same gel using multiplex PCR. Primer set we 3-18 and 2-7.2 were analyzed on the same gel using mixed PCR reactions. Arrows indicate the allele used to assign paternity. The number of offspring sired by male number 1, 2, 3, and 4 were 7, 0, 6, and 14, respectively. Null alleles also appeared in we 3-18, we 2-19, and we 3-16. Note all allelic sizes have LiCor primer tails. 60 Table 9. The number of detectable and indistinguishable offspring by visual comparison and the percentage of parentage assignment by CERVUS in 13 replications from four mating designs. Mating Replication Year Number of offspring % of parentage Design Number Detectable Indistinguishable Total assignment 1F:2M 2 1997 34 7 41 100 1F:2M 6 1997 55 2 57 100 1F:2M 7 1998 56 2 58 100 1F:2M 9 1998 43 4 47 100 1F:4M 1 1998 35 7 42 100 1F:4M 8 1998 45 4 49 100 2F:1M 2 1988 76 11 87 100 2F:1M 3 1988 57 3 60 95 (3)1 4F:1M 1 1988 67 3 70 96(3) 4F:1M 3 1988 49 24 73 84(12) 4F:1M 7 1988 31 41 72 39(54) 4F:1M 8 1988 27 3 30 90(3) 4F:1M 10 1988 65 42 107 100 1 Number of indistinguishable offspring analyzed by CERVUS. Figure 14. The percentage of offspring sired by each male from the 1F:2M mating design. 62 Table 10. The number of offspring sired by each male and analysis of G-test for goodness-of-fit of sperm precedence from the 1 Female : 2 Males mating design in Pissodes strobi. Rep No. Number of offspring G-value1 Male 1 Male 2 Total 1 13 54 67 26.952 * * 2 6 35 41 22.701 * * 6 0 57 57 79.019 * * 11 53 8 61 37.159 * * 14 33 0 33 45.748 * * 16 9 31 40 12.799 * * 18 15 42 57 13.317 * * 3 27 44 71 4.110 * 7 23 35 58 2.501 n s 8 19 3 22 12.973 * * 9 26 21 47 0.533 n s Significant G-values indicating deviation from the expected 1:1 paternity ratio. ** Significant at P < 0.01. * Significant at P < 0.05. n s Not significant. 6 3 The G-values differed indicating that different patterns of sperm precedence are present in white pine weevil. Two out of the 11, 1F:2M mating replications (7 and 9) showed no significant deviation from the expected 1:1 ratio supporting the hypothesis of sperm mixing while the remaining nine replications produced significant results (Table 10). Two replications (6 and 14) showed exclusive contribution of sperms from one male only indicating either 100% sperm precedence or that the other male was not successful in mating (Table 10). Seven out of the nine significant replications provided strong evidence for the presence of sperm precedence (Table 10). The present study indicated that there might be some levels of last male sperm precedence and the presence of various levels of variations of sperm competition in white pine weevil. Because of the lack of information on mating behavior and mating order during the experiment, the last male sperm precedence cannot be confirmed; however, from these results would suggest that nine out of the 11 replications (82%) showing sperm precedence for white pine weevils. The results from the 1F:4M mating designs showed that all of eight replications studied had offspring that were sired by more than one male (Table 11). The number of males successfully mated with female ranged from two to four. However, these results are likely an under-estimation of the number of multiple-sired families for some replications (in particular 9, 13, and 19) because one of the four male parents used was found dead during the retrieval of parents. Similar to 1F:2M mating experiment, the proportions of offspring sired by each male were variable among replications (Table 11). With the exception of replication number one, most replications showed that paternity was not equally shared among the four males (Fig. 15). Seven out of the eight replications revealed significant differences from sperm mixing based on 1:1:1:1 ratio of offspring (Table 11). 64 Table 11. The number of offspring sired by each male and analysis of G-test for goodness-of-fit of sperm precedence from the 1 Female : 4 Males mating design in Pissodes strobi. Rep. No. Number of offspring G -value' Multiple Male 1 Male 2 Male 3 Male 4 Total paternity 9 0 56 0 4 60 136.964 ** Yes 17 0 19 0 6 25 41.761 ** Yes 19 0 47 4 0 51 113.360 ** Yes 5 7 0 6 14 27 19.522 ** Yes 6 1 24 14 0 39 48.813 ** Yes 13 27 0 2 31 60 68.689 ** Yes 1 13 6 13 10 42 3.415 ns Yes 8 10 25 10 4 49 18.596 ** Yes Significant G-values indicating significant deviation from a 1:1:1:1 paternity ratio. ** Significant at P < 0.01. n s Not significant. 65 Figure 15. The percentage of offspring sired by each male from the 1F:4M mating design 66 3.2.2 Sperm quantity and female reproductive success In the 2F:1M mating design, the results showed that all of eight replications had offspring that were produced by two females. The proportions of offspring produced by each female can be divided into two groups. The first group includes five replications (2, 4, 5, 8, and 9) indicating that the number of offspring produced by each female were similar and showing no significant deviation from the expected 1:1 ratio (Table 12 and Fig. 16). The second group includes three replications (1, 3, and 10) indicating that offspring were not shared equally between the two females and producing significant log likelihood G-test indicating that the possibility of sperm depletion exists (Table 12 and Fig. 16). The eight replications of the 4F:1M mating design were also used to examine sperm depletion. Because the parental genotypes had one allele shared in common for the five replications (1, 3, 7, 8, and 10) some offspring could not be assigned paternity by visual comparison (Table 9). However, using the CERVUS program, maternity was assigned to four out of these five replications (1, 3, 8, and 10) with percentage of 84, 96, 90, and 100, respectively. The remaining one replication (7) could be assigned maternity only for 54% of its offspring; therefore, this replication was excluded from this study (Table 9). Thus, only 7 replications were used for data analysis (Table 13). The results showed that all seven replications had offspring that were produced by more than one female (Figure 17). The proportions of offspring produced by each female varied among replications producing different G-values (Table 13). Contrary to the case of 2F:1M mating design, the preliminary analysis showed that only two replications (1 and 3) showed no significant deviation from 1:1:1:1 ratio while the remaining five (4, 5 , 6, 8, and 10) revealed significant differences based on 1:1:1:1 ratio of offspring (Table 13). It was 67 clear that in three replications (5, 6, and 10) the observed significant differences were present because one or two of the female parents did not produced any offspring indicating either the presence of sperm depletion or that the females were not successful in mating. Data were reanalyzed for those replications base on the number of offspring producing females. This analysis, similar to the 2F:1M mating design, produced five replications (1, 3, 5, 6, and 10) with no significant deviation from the expectations. The remaining two replications produced significant deviation from 1:1:1:1 ratio. Possible explanations for these differences will be discussed below. Table 12. The number of offspring produced by each female and analysis of G-test for goodness-of-fit from 2 Females : 1 Male mating design in Pissodes strobi. Rep. No. Number of offspring G value1 Female 1 Female 2 Indistin guishable Total 1 40 6 0 46 28.146 ** 2 51 36 0 87 2.599 n s 3 44 13 3 60 17.808 ** 4 78 80 0 158 0.025 n s 5 23 29 0 52 0.694 n s 8 25 23 0 48 0.083 n s 9 27 19 0 46 1.398 n s 10 36 9 0 45 17.347 ** Significant G-values indicate significant deviation from a 1:1 maternity ratio. ** Significant at P < 0.01. n s Not significant. 69 OJ CJ -a o •— o c o o l H 100 80 60 40 20 ] Female 1 • Female 2 I Indistinguishable I I h 4 5 Replication number 10 Figure 16. The percentage of offspring produced by each female from the 2F:1M mating design. 70 Table 13. The number of offspring produced by each female and analysis of G-test for goodness-of-fit from the 4 Females : 1 Male mating design in Pissodes strobi. Rep. Number of offspring G -value1 ( a ) G value1 ( b ) No. Female 1 Female 2 Female 3 Female 4 Indistinguishable Total 1 19 11 23 14 3 70 5.10 n s 5.10 n s 3 20 18 10 13 12 73 4.22 n s 4.22 n s 4 19 6 19 6 1 51 14.21 * * 14.21 * * 5 25 0 28 0 0 53 73.64 * * 0.17 n s 6 0 14 14 8 0 36 22.86 * * 2.14 n s 8 7 12 6 2 3 30 8.04 * 8.04 * 10 38 26 43 0 0 107 66.02 * * 4.46 n s 1 Significant G-values indicating significant deviation from a 1:1:1:1 maternity ratio. ** Significant atP < 0.01. * Significant at P< 0.05. n s Not significant. ( a ) First analysis based on all number of females. ( b ) Second analysis based on the offspring producing females. 71 gure 17. The percentage of offspring produced by each female from the 4F:1M mating design. 72 Chapter 4. Discussion 4.1 Characterizations of Pissodes strobi microsatellites Pissodes strobi microsatellites revealed high polymorphism, which is a common finding with microsatellites in the majority of the organisms studied. Allelic diversity was quite high (five to 16 alleles with a mean of nine per locus) comparable to that of some insect species such as bumble bees (Estoup et al., 1995) and forest ants (Herbers and Mouser, 1998). This value is slightly higher than that reported for some insect species such as stingless bees (Paxton et al., 1999), aphids (Simon et al., 1999), and flies (England et al., 1996). However, this could be an underestimation due to the limited number of populations studied. The observed heterozygosities were significantly less than the expected for most of the studied loci due to the presence of null alleles, which were confirmed by the inheritance analysis. 4.2 Inheritance and linkage of Pissodes strobi microsatellites The results of inheritance analysis from 1 Female : 1 Male matings in white pine weevil indicated that three of the four polymorphic microsatellite loci segregated as expected in a Mendelian fashion, in accordance with the hypothesis of null alleles. The sometimes unreliable scoring of microsatellites was only observed in one locus (we 3-16) due to the presence of duplicated loci. No linkage was detected between any of the studied loci (see Table 8). These results indicate that there are some limitations of the use of microsatellite markers for population genetics study in white pine weevil. These limitations are similar to those reported in previous studies conducted on various organisms and are discuss below. 73 4.2.1 Null alleles Null alleles result from mutations such as substitutions, insertions, or deletions in one or both priming sites preventing the binding of the DNA strand and oligoprimers (Callen et al, 1993). Similar to this study, inheritance analysis from controlled crosses and study on parentage analysis from mother-offspring known genotypes revealed the presence of null alleles at microsatellite loci in various organisms. Null alleles have been reported in humans (Callen et al, 1993), deers (Pemberton et al, 1995; Slate et al, 2000), bears (Paetkau and Strobeck, 1995), plants (Falque et al, 1998; Fisher et al, 1998), fish (Arden et al, 1999; Banks et al, 1999; Spruell et al.', 1999) and insects (Oldroyd et al, 1996; Cooper et al, 1996) (see Table 14, for review). In the present study, null alleles were observed in three out of the four loci examined from controlled cross (75%). The estimates of null allele frequency based on the heterozygote deficiency were 0.235 and 0.433 for we 3-18 and we 2-19, respectively. Similarly, the null allele frequency of we 3-18 and we 2-19 were re-analyzed by the known genotypes of parents and were 0.188 ± 0.71 and 0.387 ± 0.081, respectively. The percentage of null alleles found in this study was higher than that reported for two insect species in which the mother-offspring genotypes were known. Oldroyd et al. (1996) and Copper et al. (1996) reported 33% of three studied loci and 50% of two studied loci displaying null alleles in honey bees and damselfly, respectively. In general, the percentage of null alleles found in insects was higher than any other organisms (see Table 14, for review). The explanation for this discrepancy is likely that insects may have high mutation rate than those organisms. 74 Table 14. Null alleles and duplicated loci at microsatellite markers from various organisms. Organism Scientific name loci used Microsatellites loci with null allele (%) duplicated loci References Humans Homo sapain" 23 7 (30%) 1 Callen etal., 1993 Deers Cervus elaphusb 16 3 (19%) Pemberton etal, 1995 84 13 (16%) Slate er al, 2000 Bears Urus thibetanus, U. americanus" 8 1(13%) Paetkau and Strobeck, 1995 Fishes Oncorhynchus tschawytschad 18 1(6%) 2 Scribner etal, 1996 Oncorhynchus tschawytschac 10 2 (20%) Banks etal, 1999 Oncorhynchus gorbuschcf 7 1(14%) 1 Spruell etal, 1999 Oncorhynchus mykissc 12 2 (17%) 1 Arden et al., 1999 Plants Taraxacum officinale0 8 1 (13%) Falqueefa/., 1998 Pinus radiata" 11 2 (18%) 6 Fisher et al., 1998 Insects Anopheles arabiensisd 7 7 (100%) Kamau et al, 1999 Anopheles gambied 7 7 (100%) Apis dorsatab 3 1(33%) Oldroyd etal, 1996 Ischnura elegansb 2 1(50%) Cooper etal, 1996 a pedigree analysis * known mother-offspring genotypes c Inheritance analysis d based on heterozygote deficiency 75 Null allele is one of the major drawbacks found in the use of microsatellite markers for population genetics studies or parentage assignment (Pemberton et al, 1995; Schlottefer and Pemberton, 1998; Jones et al., 1998). The miss-identification of null alleles could lead to distortion in segregation analyses resulting in errors in inheritance results, errors of parameter estimations in population studies such as allele frequency and inbreeding coefficient and false paternity exclusion in parentage assignment (Jones et al., 1998). To overcome this problem, primers must be re-designed by avoiding the mutation occurred within the priming site. Re-designing primers, resulting in the success of amplification for original null alleles, has been reported in several organisms including humans (Callen et al., 1993), black bears (Paetkau and Strobeck, 1995), horses (Eggleston-Stott et al., 1997), and white sands pupfish (Jones et al., 1998). For example, Jones et al. (1998) re-designed one of the original primers by developing it externally to the original primer and then tested with the original samples, which failed to amplify DNA or had homozygotes at this locus. They found that the original samples were successful in DNA amplifications without changing microsatellite genotypes, but changing in allelic size. With the re-designed primer, some samples which were homozygotes using original primer displayed heterozygotes and original null alleles displayed up to five distinct alleles. The molecular basis, causing null alleles at microsatellite loci reported by these authors, are point mutations (Paetkau and Strobeck, 1995; Eggleston-Stott et al, 1997), 4-bp deletion (Jones et al, 1998), and 8-bp deletion (Callen et al, 1993). At present, the molecular basis of null alleles at microsatellite loci is still unknown for white pine weevil. 76 4.2.2 Gene duplication Gene duplications are the cause of observing more than two alleles in diploid tissues or more than one allele in haploid tissues (duplicated loci) resulting in non-Mendelian inheritance. Gene duplications have been reported in some insects such as fruit flies, aphids, silk moths, and mosquitoes (reviewed in Hoy, 1994). In the present study, duplicated loci were observed only in primer set we 3-16. Presently, there are not many reports of duplicated microsatellite loci in literature. In the past several years, Callen et al. (1992) reported the presence of a duplicated locus in human Chromosome 16 markers that had null alleles too. Re-designing of the original primer was attempted to solve the null allele problem. However, the successful DNA amplification resulted in overlapping of the duplicated loci, thus making uninterpretable distribution of alleles (Phillips et al., 1993). At present, the duplicated loci have been reported in salmonid species including chinook (Scribner et al., 1996), pink (Spruell et al., 1999), and steelhead trouts (Arden et al, 1999). Spruell et al. (1999) and Arden et al. (1999) suggested that duplicated microsatellite loci should not be used in population genetic analysis; however, in the case of mode of inheritance, there is confirmation that it is possible to use duplicated microsatellite loci in other applications such as paternity and kinship analysis. 4.3 Sperm competition in white pine weevil Results from the present study provided evidence for sperm precedence and sperm mixing in white pine weevil. The level of sperm precedence highly varied among replications, which is a common finding in sperm competition studies in insects. In the 77 1F:2M mating, two replications showed that the offspring were sired by only one male. A possible reason for this is that there might be complete last- or first-male sperm precedence. However, due to unknown mating order, it is difficult to make the conclusion that 100% of last- or first-male sperm precedence occurred in this experiment, if female mated to two males. Other possible reasons are the possible failure of sperm transfer by the other male during copulation or that the female might fail to re-mate with the second male (Matings were not observed). The different levels of sperm precedence were shown in nine of the 11 replications (82%) (Table 10). There was also evidence of some level of sperm mixing in two of the 11 replications (Fig. 14). Similarly, to this study, sperm mixing was reported for other insect species in the order Coleoptera (Vick et al., 1972; McCauley and Reilly, 1984; Boiteau, 1988; Conner, 1995; Alyokhin and Ferro, 1999). In the family Curculionidae sperm mixing was found in two species e.g., boll weevil {Anthonomus grandis) (Bartlett et al., 1968), and plum curculio (Conotrachelus nenuphar) (Huettel et al., 1976). Previous studies of sperm precedence using phenotypic markers in the boll weevil by Bartlett et al. (1968) showed that the offspring sired by the last-male ranged from 10 to 90 percent. Huettle et al. (1976) also reported that 73.99% (17 of 23 crosses) of sperm precedence occurred in plum curculio, which is slightly lower than the level of sperm precedence in this study (82.00%). The mean proportion of offspring sired by the second male to mate (P2) in their study was 0.50, indicating sperm mixing. Unfortunately, P 2 values were not estimated in our study because of unknown mating order since observations of mating order were not recorded. However, our results indicate the existence of sperm mixing similar to the two previously mentioned studies. 78 Ten of the 23 different insect orders that have been studied in sperm competition, revealed the presence of sperm precedence (see Table 15, which represents the patterns of sperm precedence of insects in the order Coleoptera). Many studies also revealed the presence of sperm mixing. With these evidences, it is likely that some levels of last-male sperm precedence may have occurred in white pine weevil. 4.4 Multiple paternity in white pine weevil The present study demonstrates multiple paternity in white pine weevil using four microsatellite loci. All replications showed that the number of males siring the offspring of each female ranged from two to four with a mean number of 2.8 males. The level of multiple paternity observed in white pine weevil was similar to that reported in some insect species using microsatellite markers such as damselflies (Cooper et al., 1996) and leafcutter ants (Fjerdingstad et al., 1998; Boomsma et al., 1999). For example, Cooper et al. (1996) reported that female damselflies mated with up to six different males with a mean paternity of 2.33. In addition, the degree of multiple paternity observed in the present study was similar to that reported on harlequin beetle-riding pseudoscorpions using single-locus minisatellite (Zeh and Zeh, 1994). They reported a high level of multiple paternity with at least four males siring offspring. Compared to other insects in the same family Curculionidae, our results showed slightly higher rates of multiple paternity when compared to the finding of Dickinson (1988) who, studied multiple paternity of milkweed beetles in the field using six polymorphic allozymes. The reasons for multiple paternity in Pissodes strobi are unclear. In general, two reasons have been hypothesized to explain why females often mate with several males 79 Table 15. Patterns of sperm precedence of insects in the order Coleoptera (adapted from Simmons and Siva-Jothy, 1998). Species Family MeanP2 Range Method of study Reference Callosobruchus maculatusBmclach& 0.82 Sterile male Eady, 1991 (Bruchid beetle) 0.85 Colour morphs Trtraopes tetraophthalmus Cerar±>ycidae 0.72 0.33-1.00 Isozyme McCauley and Reilly, 1984 (Milkweed beetle) Labidomera clivicollis Chrysomelidae 0.65-0.87 0.29-1.00 Isozyme Dickinson, 1988 (Milkweed leaf beetle) Leptinotarsa decemlineataChrysomelidae 0.32-0.53 Colour morphs Boiteau, 1988 (Colorado potato beetle) 0.72 0.17-1.00 Isozyme Alyokhin and Ferro, 1999 Adeliabipunctata Coccinellidae 0.60 0.00-1.00 Colour morphs Jong et al., 1993 (Ladybird beetle) Epilachnavarivestis Coccinellidae 0.70 Sterile male Webb and Smith, 1968 (Mexican bean beetle) Anthonomus grandis Curculionidae 0.52-0.90 0.10-0.90 Colour morphs Bartlett et al., 1968 (Boll weevil) Conotrachelus nenuphar Curculionidae 0.5 0.02-0.90 Isozyme Huettel et al., 1976 (Plum curculio) Trogoderma inclusum Dermestidae 0.52 Sterile male Vick et al., 1972 Popilliajaponica Scarabaeidae 0.85 Sterile male Ladd, 1966 (Japanese beetle) Necrophorus orbicollis Silphidae 0.94 Colour morphs Trumbo and Fiore, 1991 (Burying beetle) Necrophorus vespilloides Silphidae 0.11-0.92 0.00-1.00 Colour morphs Muller and Eggert, 1989 (Burying beetle) Aleochara curtula Staphylinidae 1.0 Observation of Gack and Peschke, 1994 (Rove beetle) sperm removal Onymacris unguicularis Tenebrionidae 0.82 Sterile male De Villiers and Hanrahan, (Namib desert beede) 1 9 9 1 Tenebrio molitor Tenebrionidae 0.91 Sterile male Siva-Jothy et ah, 1996 (Yellow mealworm) Trilobium castaneum Tenebrionidae 0.62 0.40-0.86 Colour morphs Lewis and Austad, 1990 (Red flour beetle) Trilobium confusum Tenebrionidae 0.82 Colour morphs Vardell and Browser, 1978 (Confused flour beetle) Bolitotherus cornutus Tenebrionidae 0.57 0.00-1.00 Isozyme Conner, 1995 (Fungus beede) P2 values of < 0.5 and > 0.5 indicating some level of first- and last-male sperm precedence, respectively. P2 value equals 0.5 indicating complete sperm mixing. 80 (MMler, 1998). The first hypothesis suggests that females obtain direct benefits, including increasing reproductive success, reducing infanticide, obtaining nutrient from spermatophore for developing eggs, and parental care. The second hypothesis suggests that females obtain indirect genetic benefits by increased genetic viability, diversity, or resistance in offspring. Based on the study of Lewis, Alfaro, and El-Kassaby (pers. comm.) the hypothesis of direct benefits seems unlikely explanation. The mean number of offspring weevils produced by double mated female were higher than that of four male mated to two females (40, and 36, respectively). Females mating with four males reduced not only their reproductive successes, but also the growth rates of their offspring due to time lost foraging or ovipositing for females. This confirm findings that females mated with several males do not increase their fitness (Byrne and Roberts, 1999). Why would female weevils still mate with several males in spite of increased costs as described above? Lewis, Alfaro, and El-Kassaby (pers. comm.) suggested that the possible reason for female multiple mating may be due to forced copulation when population levels are high. However, there is no reason to ignore the hypothesis of indirect genetic benefits because it can increase genetic diversity of their offspring (Tregenza and Wedell, 1998; Imhof et al., 1998; Archer and Elgar, 1999). Two factors are used to hypothesize genetic benefits: (1) the predictability of the environment in which the offspring will develop and (2) the ability of the female to discriminate a particular male possessing a fit gene for the offspring's environment (Yasui, 1998). These factors may play an important role in adaptation to new environments and in developing tolerance to resistant trees. 81 The high level of multiple paternity in the present study can also explain the low level of inbreeding (0.011) and high level of genetic variation in white pine weevil (91.6%) (Lewis et al., 2000a). In addition, the results of 1F:4M mating design also supported the existences of sperm precedence and sperm mixing in white pine weevil. Sperm precedence was observed in seven out of eight replications (87.5%) examined with multiple replications showing that offspring were sired by two, three, and four males, however, one male showed dominance in siring most of the offspring. The remaining replication (12.5%) showed highly mixed paternity among four males, indicating sperm mixing. At present, there are few studies of sperm precedence in the field and laboratory experiment for female mated to more than two males. Zeh and Zeh (1994) found that by allowing females to mate with three males the patterns of last-male sperm precedence broke down completely resulting in highly mixed paternity and completely eliminating mating order affects. In contrast to the finding of Zeh and Zeh (1994), Eady and Tubman (1996) found that the last male to mate gained a large proportion of offspring in double and triple mating experiments. Similar results were obtained by the laboratory experiments in multiple mated red flour beetles using color morphs (Lewis and Jutkiewicz, 1998) and multiple mated damselflies using microsatellites (Cooper et al., 1996). They also found that both 1F:2M and 1F:3M mating designs exhibited high level of last-male sperm precedence. It is important to note that caging experiments were carried out to maximize the natural mating conditions. Therefore, it was difficult to observe the mating behavior and mating order during the mating events. Without this information, it is difficult to compare the results of this experiment to those of others. However, information in these studies can be use to discuss the mating system in white pine weevil. 82 The reasons for the results of the 1F:4M mating experiment in which offspring were sired by two and three males are (1) the failures of sperm transfer by some males during copulations (2) the lack of opportunity to mate with female. The second reason may be possible explanation because one of the four males was found dead during the retrieval of parents, hence it may not have mated at all. However, both of these reasons may be unlikely explanations because male and female weevils can mate many times during the day (Silver, 1968); therefore, three or four males are likely to have a chance to encounter and mate with females that have been previously mated. Therefore, assuming that some males had an opportunity to mate with females more than one time, it is likely that sperms from some previously mated males were removed from the sperm-storage organs (see the hypothesis below). Another possible reason for the different patterns of sperm precedence may be explained by the timing of sperms stored in spermatheca and by spermathecal capacity (Lewis and Jutkiewicz, 1998), or by selective use of sperm by females. Selective use of sperm by females is one of the possible reasons to explain the variability of sperm precedence. There is evidence that female muscular activity can also influence the number of stored sperms in spermatheca (Bloch Qazi, 1999; Hellriegel and Bernasconi, 2000). However, in this study there was no information to clarify female control of sperm usage. The hypotheses for which timing of sperms stored in spermatheca, spermathecal capacity, and sperm displacement or extrusion influence on sperm precedence in multiple mated females as described by Lewis and Jutkiewicz (1998) are likely explanation for the different patterns of sperm precedence in the present study. Lewis and Jutkiewicz (1998) found that in red flour beetles, doubly mated and triply mated females showed high last-male 83 sperm precedence, but if sperms remained in the spermatheca for a long time (one and two weeks), then the level of last male sperm precedence declined, resulting in sperm being mixed randomly in female's spermatheca for both mating designs. In addition, using direct estimates of sperm number they found that female sperm storage organs received only two-thirds of sperm from the first male and reached their full capacity after the second mating. After the completion of the third mating, the number of sperm in the spermatheca remained constant. Therefore, they suggested that one-third of stored sperm from the female spermatheca must be removed by the mechanism of sperm displacement or extrusion after the second and third mating. Sperm displacement has been reported in damselfly (Waage, 1979), tree crickets (Ono et al., 1989), bushcrickets (Helversen and Helversen, 1991), rove beetles (Gack and Peschke, 1994), and flour beetles (Haubruge et al., 1999). Retnakaran (1974) first described the hypothesis of spermathecal capacity and re-mating interval in Lepidoptera. He proposed three mechanisms of first- and last-male sperm precedence and sperm mixing in 1F:2M mating design. First, he proposed that sperm-storage organs reached their capacity after the first mating; therefore, there was no space for the sperm from the second male, resulting in first-male sperm precedence. Second, he suggested that a short re-mating interval could result in last-male sperm precedence because the sperm from the first male did not have a chance to migrate to sperm-storage organs. Third, he proposed that partial filling of the spermathecae by the first male could result in sperm mixing. To date, the effects of re-mating interval on last-male sperm precedence when female mated to two males has been reported for 15 species. Eleven of the 15 species studied showed that the long interval between successive mating increased the level of last-male 84 sperm precedence while only four of the 15 species showed that the long re-mating interval decreased the level of last-male sperm precedence (reviewed in Simmons and Siva-Jothy, 1998). The possible explanation for the mating success of last male increasing with time in storage was the depletion of first male's sperm from sperm storage organs by loss of sperms or female's use (Tsubaki and Yamagishi, 1991; Yamagishi and Tsubaki, 1992) and the decrease of competitive ability of first's male sperm (Eady, 1994). In white pine weevils, it is unlikely that females use sperms for fertilization and ovoposit their eggs immediately after copulations. This is supported by the observation of Silver (1968) that female weevils started to lay their eggs two weeks after copulation. In addition, the patterns of emergence of offspring from 1F:2M showed that the offspring sired by both males emerged from leaders within the same periods for most replications (Fig. 18). Therefore, it is possible that females store sperms from different males before using them to fertilize their eggs. In addition, Lewis et al. (2000b) found that no reduction in fertility of inseminated females of white pine weevil occurred within at least one year after copulation. If the re-mating interval was long enough between the mating events allowing for sperm mixing. That would result in similar reductions in fertilization success for previous males after female re-mated again, as shown in replication number 1 (Fig. 15). On the other hand, if the mating events occurred before mixing of previous stored sperm it would result in different reductions in fertilization success as shown in replication number 6 (Fig. 15). The combinations of these assumptions are shown in three replications (5, 8, and 13) (Fig. 15). 85 8/1/97 8/6/97 8/1 1/97 8/16/97 8/21/97 Date of emergence 7/27/98 7/31/98 8/4/98 8/8/98 8/12/98 Date of emergence 7/27/98 7/31/98 8/4/98 8/8/98 8/12/9 Date of emergence 25 7/29/98 8/2/98 8/6/98 8/10/98 8/14/98 Date of emergence 25 A Rep 11 ' \ ^ \ 1 \ ' \ / \ — ^ 7/27/98 8/2/98 8/8/98 8/14/98 8/20/98 Date of emergence 25 20 15 10 5 0 8/4/97 8/9/97 8/14/97 8/19/97 8/24/97 Date of emergence 25 3/3/97 3/7/97 3/1 1/97 3/15/97 3/19/97 Date of emergence 8/6/97 8/9/97 8/12/97 8/15/97 8/1 8/97 Date of emergence — Male 1 Male 2 Figure 18. Patterns of Pissodes strobi offspring emergence from the 1F:2M mating design. 86 Based on the assumptions of no mating order effects, as described by Zeh and Zeh (1994) there was only one out of eight replications showing sperm mix randomly in sperm-storage organs while there were seven out of eight replications showing one male dominance in siring offspring. Therefore, this hypothesis is an unlikely explanation for the mating system in the present study. Because, if the last-male sperm precedence breaks down when female mate with more than two males, then there should be more than one replication displaying sperm mixing. In contrast, four replications (5, 6, 13, and 18) showing mixed paternity displayed distinctively in the proportions of offspring sired (Fig. 15). In addition, Zeh and Zeh (1997) found that the multiple mated females produced offspring more than the singly mated females due to a higher rate of embryo failure in singly mated females. Similar to the finding of Lewis, Alfaro, and El-Kassaby (pers. comm.), the number of offspring weevils produced by multiple mated females (1F:2M and 1F:4M mating design) were higher than that of the singly mated females (1F:1M). Interestingly, the four male mated to one female produced less offspring than the two male mated to one female treatments. 4.5 Sperm quantity and female reproductive success Results of this study provided evidence that sperm depletion may influence the variation of sperm precedence in white pine weevil. From the eight replications of 2F:1M mating design, five (63%) showed that offspring were equally produced by each female. The remaining three replications showed that each female did not equally produce offspring (Table 15). The results of 4F:1M mating design showed that offspring produced by females in seven replications ranged from two to four males. Five of the seven replications revealed 87 significant differences from 1:1:1:1 ratio. However, three of the five replications showed significant deviation because only two or three females produced offspring. The possible explanations for differences in female reproductive success of 2F:1M and F4:1M mating designs are discussed below. Results of the present study differ from the findings of Zeh (1997) for the harlequin-beetle-riding pseudoscorpion. In Zeh's study, males were allowed mating to two females with interval between successive mating of at least two days. Zeh (1997) found no correlation between the numbers of nymphs produced by each female because the entire brood of one female failed while the other successful hatched nymphs. Due to the time interval between successive matings and no significant difference between the numbers of nymphs produced by both females, Zeh (1997) suggested that the finding did not support the hypothesis of declining sperm quantity. However, under natural conditions it is likely that males mate consecutively with the same or new females, resulting in decrease in number of sperms (Bloch Qazi et al., 1996). Alternatively, if males transfer more sperm to their first mate they might not sustain sperm to subsequent mating (reviewed in Yeh, 1997). Observed by Silver (1968), caged adult weevils mated frequently during the day as stated earlier. It seems likely that female reproductive success is dependent on how often and which female to male re-mate. Therefore, a hypothesis of declining sperm quantity is likely reasonable explanation for the differences of female reproductive success for 2F: IM and 4F: IM mating designs. In addition to the hypothesis of declining sperm quantity, the possible explanations of highly different female reproductive success in 4F:1M mating design are: (1) failure in 88 mating of some females; and (2) male and female choices. The first reason is a more likely explanation. Thus far, male and female choices are unknown for this species. Study in flour beetles found that males prefer to mate with virgin females (Lewis and Iannini, 1995). In this study, there was no evidence to explain male and female choice. 4.6 Implications for integrated pest management This finding provided the evidence of sperm precedence in white pine weevil. Sperm precedence has important implications for the ability of sterile insect techniques. The use of this technique for control of this pest must address the effects of sperm precedence on sterile male's reproductive success. The success of this technique is based not only on the effects of sperm precedence, but also the mating competitiveness between sterile and wild males (Ito and Yamagishi, 1989). In addition, the incidence of multiple paternity would affect the breeding program of resistant trees to white pine weevils because of the high possibility of their adaptations to overcome resistant trees. The caging experiments designed for this study optimized the natural conditions allowing families to be mated under competition so that female can choose her mates. It can be argued that caging experiment might force females to mate with different males many times; however, in the fields this is possible during high infestation. In this study, sperm precedence was observed in 1F:2M and 1F:4M mating experiments, indicating high possibility of sperm precedence in natural populations. However, more information of mating behavior in natural populations is required before sterile insect technique can be recommended. 89 Chapter 5. Conclusions and Recommendations The results of characterizations of Pissodes strobi microsatellites clearly demonstrate that one advantage of microsatellite markers for parentage assignment is the high level of polymorphism, providing good resolution for examining multiple paternity. However, some drawbacks such as null alleles and duplicated loci must be taken into account before using these markers for future study, especially for natural populations. Null alleles are difficult to detect if controlled crosses are not performed. One way to predict null alleles at particular locus is the presence of high frequency of non-amplifying alleles. However, in the case of a null allele heterozygote, it is difficult to detect the null alleles. Therefore, researchers should conduct inheritance analysis for their studies whenever possible. For future study, we highly recommend that seven out of the eight Pissodes strobi microsatellites should be re-designed before using them in field study. If the re-designed primers are successful in amplifying the original homozygotes or heterozygotes for null alleles, then there will be an increase in the polymorphic information content (PIC), especially increasing the fidelity of Pissodes strobi microsatellites. The preliminary testing of co-amplification reactions has been done in four loci with successful multiplex PCR for two sets of primers. In addition, one locus can be pooled with the multiplex PCR prior to loading. Hence, three loci can be scored at once. The applications of these techniques can considerably reduce the costs and labour. These will be useful for studying multiple paternity and genetic relatedness of white pine weevil in the field. Detailed knowledge and understanding of the multiple paternity and genetic relatedness in natural populations are important for determination and understanding the genetic structure and evolutionary potential. Lorimer (1978) suggested that many approaches 90 of pest controls such as pesticide application, biological control, silvicultural method, or plant resistance may result in changing genetic structure of insect populations. Genetic variation within and between populations are important for predicting the long-term response of a pest population and determining the effectiveness of an Integrated Pest Management against all populations (Kennedy, 1993). Microsatellite markers are one of the candidate markers to obtain this information for the success of Integrated Pest Management. The results of multiple mating in this study and of Lewis et al. (2000) showed that the chance for male weevils to increase their own reproductive successes may be hypothesized by sperm removal while female weevils also influence sperm utilization and increase their own reproductive successes via sperm storage. Many male and female mechanisms have influence on sperm precedence, resulting in possible first- and last-male sperm precedence and mixed paternity. I predict the possibility of last-male sperm precedence and hypothesize possible male and female mechanisms influencing sperm precedence in white pine weevils. In addition, the results of this study have confirmed the incidence of multiple paternity. However, last-male sperm precedence and the male and female mechanisms such as sperm transfer and sperm utilization in determining the variation of sperm precedence as well as the benefits of female multiple mating in white pine weevils remain to be further investigated. 91 B I B L I O G R A P H Y Alfaro, R.I. 1994. The white pine weevil in British Columbia. Pp. 7-22 in: The white pine weevil: Biology, Damage and Management. FRDA Report 226, R.L Alfaro, G. Kiss, and R.G. Fraser (eds.). Proceedings of a symposium held January 19-21, 1994 in Richmond, BC. Pacific Forestry Centre, Victoria, BC. Alfaro, R.I., M.A. Hulme, and J.W.E. Harris. 1985. Insects associated with the Sitka spruce weevil, Pissodes strobi (Coleoptera: Curculionidae) in Sitka spruce, Picea sitchensis in British Columbia, Canada. Entomophaga. 30:415-418. Alyokhin, A.V. , and D.N. Ferro. 1999. Electrophoretic confirmation of sperm mixing in mated Colorado potato beetles (Coleoptera: Chrysomelidae). Annals of the Entomological Society of America. 92: 230-235. Amos, B., C. Schlotterer, and D.Tautz. 1993. Social structure of pilot whales revealed by analytical DNA profiling. Science. 260: 670-672. Archer, M.S., and K.A. Elgar. 1999. Female preference for multiple partners: sperm competition in the hide beetle, Dermestes maculates (DeGeer). Animal Behaviour. 58: 669-675. Archie, N., C. Simon, and D. Wartenberg. 1985. Geographic patterns and population structure in periodical cicadas based on spatial analysis of allozyme frequencies. Evolution. 39:1261-1274. Arden, W.R., S. Borer, F. Thrower, J.E. Joyce, and A.R. Kapuscinski. 1999. Inheritance of 12 microsatellite loci in Oncorhynchus mykiss. Journal of Heredity. 90: 529-536. Ashley, M.V. , and B.D. Dow. 1994. The use of microsatellite analysis in population biology: Background, methods, and potential applications. Pp. 185-201 in: Molecular Ecology and Evolution: Approaches and Applications, B. Schierwater, B. Streit, G.P. Wanger, and R. DeSalle(eds.). Birkhauser, Berlin, Germany. Banks, M . A., M.S. Blouin, B.A. Baldwin, V.K. Rashbrook, H.A. Fitzgerald, S.M. Blankenship, D. Hedgecock. 1999. Isolation and inheritance of novel microsatellites in chinook salmon (Oncorhynchus tshawytscha). Journal of Heredity. 90: 281-288. Bartlett, A .C. , E.B. Mattix, and N.M. Wilson. 1968. Multiple matings and use of sperm in the boll weevil, Anthonomus grandis. Annals of the Entomological Society of America. 61: 1148-1155. Beaumont, M.A., and M.W. Bruford. 1998. Microsatellites in Conservation genetics. Pp. 165-182 in: Microsatellites: Evolution and Applications, D.B., Goldstein and C. Schlotterer (eds.). Oxford University Press, New York. Bloch Qazi, M.C. 1999. Sperm precedence in a flour beetle. Ph.D. Thesis. Tufts University. 92 Bloch Qazi, M.C. , J.T. Herbeck, and S.M. Lewis. 1996. Mechanisms of sperm transfer and storage in the red flour beetle (Coleoptera: Tenebrionidae). Annals of the Entomological Society of America. 89: 892-897. Bloem, S., K.A. Bloem, J.E. Carpenter, C O . Calkins. 1999. Inherited sterility in codling moth (Lepidoptera: Tortricidae): effect of substerilizing doses of radiation on field competitiveness. Environmental Entomology. 28: 669-674. Bogdanowicz, S.M., V .C. Mastro, D.C. Prasher, and R.G. Harrison. 1997. Microsatellite DNA variation among Asian and North American gypsy moths (Lepidoptera: Lymantriidae). Annals of the Entomological Society of America. 90: 768-775. Boiteau, G. 1988. Sperm utilization and post-copulatory female-guarding in the Colorado potato beetle, Leptinotarsa decemlineata. Entomologia Experimental!s et Applicata. 47: 183-187. Boomsma, J.J., E.J. Fjerdingstad. and J. Frydenberg. 1999. Multiple paternity, relatedness and genetic diversity in Acromyrex leaf-cutter ants. Proceeding of the Royal Society of London B, Biological Sciences. 265: 1749-1753. Boorman, E. , and G.A. Parker. 1976. Sperm (ejaculate) competition in Drosophila melanogaster, and the reproductive value of females to males in relation to female age and mating status. Ecological Entomology. 1: 145-155. Botstein, D., R.L. White, M . Skolnick, R.W. Davis. 1980. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. American Journal of Human Genetics. 32:314-331. Brower, J. H. 1975. Sperm precedence in the Indian meal moth, Plodia interpunctella. Annals of the Entomological Society of America. 68: 78-80. Bruford, M.W., and R.K. Wayne. 1993. Microsatellites and their application genetic studies. Current Opinion in Genetics and Development. 3: 939-943. Bruford, M.W., D.J. Cheesman, T. Coote, H.A.A Green, S.A. Haines, C. O'ryan, and T.R. Williams. 1996. Microsatellites and their application to conservation genetics. Pp. 278-297 in: Molecular Genetic Approaches in Conservation, T.B. Smith and R.K. Wayne (eds.). Oxford University Press, Inc., New York, New York. Byrne P.G., and J.D. Roberts. 1999. Simultaneous mating with multiple males reduces fertilization success in the myobatrachid frog Crinia georgiana. Proceeding of the Royal Society of London B, Biological Sciences. 266: 717-721. Calkins, C O . , D.L. Chambers, and E.F. Boiler. 1981. Ouanlity control of fruit files in a sterile insect release programme. Pp. 341-352 in: Sterile insect technique and radiation in insect control. Proceedings of the international symposium on the sterile insect technique and the use of radiation in genetic insect control held 29 June - 3 July 1981 in Neuherberg, Vienna. 93 Callen, D.F., A.D. Thompson, Y. Shen, H.A., Phillips, R.L Richards, J.C. Mulley, and G.R. Sutherland. 1993. Incidence and origin of "null" alleles in the (AC) n microsatellite Markers. American Journal of Human Genetics. 52: 922-927. Callen, D.F., N.A. Doggett, R.L. Stallings, L.Z. Chen, S.A. Whitmore, S.A. Lane, J.K. Nancarrow, S. Apostolou, A.D., Thompson, N.M. Lapsys, H.J. Eyre, E.G. Baker, Y. Shen, K. Holman, H. Phillips, R.I. Richards, and G.R. Sutherland. 1992. High-resolution cytogenetic-based physical map of human chromosome 16. Genomics. 13: 1178-1185. Carlson, J., Y.-P. Hong, and G. Kiss. 1994. DNA markers associated with weevil resistance in interior spruce. Pp. 158-168 in: The white pine weevil: Biology, Damage and Management. FRDA Report 226, R.I. Alfaro, G. Kiss, and R.G. Fraser (eds.). Proceedings of a symposium held January 19-21, 1994 in Richmond, BC. Pacific Forestry Centre, Victoria, BC. Chakravarti, A. , and C C . Li . 1983. The effect of linkage on paternity calculations. Pp. 411-422 in: Inclusion Probabilities in Parentage Testing, R.H. Walker (ed.). American Association of Blood Banks, Arlington, Virginia. Chapman, T.W. and S.C.Stewart. 1996. Extremely high levels of inbreeding in a natural population of the free-living wasp Ancistrocerus antilope (Hymenoptera: Vespidae: Eumeninae). Heredity. 76: 65-69. Chapuisat, M . 1996. Characterization of microsatellite loci in Formica lugubris and their variability in other ant species. Molecular Ecology. 5: 599-601. Chapuisat, M . 1998. Mating frequency of ant queens with alternative dispersal strategies, as revealed by microsatellite analysis of sperm. Molecular Ecology. 7: 1097-1105. Conner, J.K. 1995. Extreme variability in sperm precedence in the fungus beetle, Bolitotherus cornutus (Coleoptera Tenebrionidae). Ethnology Ecology and Evolution. 7: 277-280. Cooper, G., P.L. Miller, and P.W.H Holland. 1996. Molecular genetic analysis of sperm competition in the damselfly Ischura elegans (Vander Linden). Proceeding of the Royal Society of London B, Biological Sciences. 265: 1343-1349. Davies, N.B. 1991. Mating systems. Pp. 263-294 in: Behavioural Ecology, an Evolutionary, J.R. Kerbs and N.B. Davies (eds.). Blackwell, Oxford. de Groot, P., and B.V. Helson. 1994. A review of chemical insecticides for control of Pissodes strobi (Peck). Pp. 270-284 in: The white pine weevil: Biology, Damage and Management. FRDA Report 226, R.I. Alfaro, G. Kiss, and R.G. Fraser (eds.). Proceedings of a symposium held January 19-21, 1994 in Richmond, BC. Pacific Forestry Centre, Victoria, BC. 94 De Villiers, P.S., and S.A. Hanrahan. 1991. Sperm competition in the namib desert beetle, Onymacris unguicularis. Journal of insect physiology. 37: 1-8. Dent, D. 1995. Integrated Pest Management. Chapman&Hall, London. 356 pp. Dickinson, J.L. 1988. Determinants of paternity in the milkweed leaf beetle. Behavioral Ecology and Sociobiology. 23: 9-19. Eady, P, and S. Tubman. 1996. Last-male sperm precedence does not break down when females mate with three males. Ecological Entomology. 21: 303-304. Eady, P.E. 1991. Sperm competition in Callosobruchus maculatus (Coleoptera: Bruchidae): a comparison of two methods used to estimate paternity. Ecological Entomology. 16: 45-53. Eady, P.E. 1994. Intraspecific variation in sperm precedence in the bruchid beetle Callosobruchus maculates. Ecological Entomology. 19:11-16. Eggleston-Stott, M.L. , A. Delvalle, S. Dileanis, E. Wictum, and A.T. Bowling. 1997. A single base transversion in the flanking region of an equine microsatellite locus affects amplification of one allele. Animal Genetics. 28: 438-440. Emlen S.T., and L.T. Oring. 1977. Ecology, sexual selection, and the evolution of mating systems. Sciences. 197: 215-223. England, P.R, D.A. Briscoe, and R. Frankham. 1996. Microsatellite polymorphism in a wild population of Drosophila melanogaster. Genetical Research. 67: 285-290. Estoup, A., A. Scholl, A. Pouvreau, and M . Solignac. 1995. Monoandry and polyandry in bumble bees (Hymenoptera; Bombinae) as evidenced by highly variable microsatellites. Molecular Ecology. 4: 89-93. Falque, M . , J. Keurentjes, J.M.T. Bakx-Schotman, and P.J.van. Dijk. 1998. Development and characterization of microsatellite markers in the sexual-apomictic complex Taraxacum officinale (dandelion). Theoretical and Applied Genetics. 97: 283-292. Fisher, P. J., T.E. Richardson, and R.C. Gardner. 1998. Characteristics of single- and multi-copy microsatellites from Pinus radiata. Theoretical and Applied Genetics. 96: 969-979. Fjerdingstad, E.J., J.J Boomsma, and P. Thoren. 1998. Multiple paternity in the leafcutter ant Atta colombica - a microsatellite DNA study. Heredity. 80:118-126. Foitzik, S., M . Haberl, J. Gadau, and J. Heinze. 1997. Mating frequency of Leptothorax nylanderi ant queens determined by microsatellite analysis. Insect Sociaux. 44: 219-227. Fondrk, M.K. , R.E. Page Jr, and G.J. Hunt. 1993. Paternity analysis of worker honeybees using random amplified polymorphic DNA. Naturwissenschaften. 80: 226-231. 95 Gack, C , and K. Peschke. 1994. Spermathecal morphology, sperm transfer and a novel mechanism of sperm displacement in the rove beetle, Aleochara curtula (Coleoptera, Staphylinidae). Zoomorphology. 1 4 4 : 227-237. Gara, R.L, R.L. Carlson, and B.F. Hrutfiord. 1971. Influence of some physical and host factors on the behavior of the Sitka spruce weevil in southwestern Washington. Annals of the Entomological Society of America. 6 4 : 467-471. Gasperi, G., C R . Guglielmino, A.R. Malacrida, and R. Milani. 1991. Genetic variability and gene flow in geographic populations of Ceratitis capitata (Wied.) (medfly). Heredity. 6 7 : 347-356. Gertsch, P., P. Pamilo, and S.L. Varvio. 1995. Microsatellites reveal high genetic diversity within colonies of Camponotus ants. Molecular Ecology. 4 : 257-260. Godwin, P.A., H.A. Jaynes, and J.M. Davis. 1957. The dispersion of radioactively white pine weevils in small populations. Journal of Economic Entomology. 5 0 : 264-266. Gregory, P.G., and D.J. Howard. 1996. Multiple maturing in natural populations of ground crickets. Entorhologia Experimentalis et Applicata. 7 8 : 353-356. Gwynne, D.T. 1984. Male Mating Effort, Confidence of Paternity, and Insect Sperm Competiton. Pp. 117-144 in: Sperm Competition and the Evolution of Animal Mating Systems, R. Smith (eds.). Academic Press, Inc., Orlando, Florida. Hadrys, H. , B. Schierwater, S.L. Dellaporta, R. DeSalle, and L.W.Buss. 1993. Determination of paternity in dragonflies by random amplified polymorphic DNA fingerprinting. Molecular Ecology. 2 : 79-87. Harman, D .M, and and H.M. Kulman. 1966. A technique for sexing live white pine weevil, Pissode strobi. Annals of the Entomological Society of America. 5 9 : 315-317. Harman, D.M. and H.M. Kulman. 1967. Flight and dispersal of white pine weevil. Journal of Economic Entomology. 6 0 : 1682-1687. Harshman, L .G. , and A.G. Clark. 1998. Inference of sperm competition from broods of field-caught Drosophila. Evolution. 5 2 : 1334-1341. Haubruge, E . , and L. Arnaud, J. Mignon, and M.J.G. Gage. 1999. Fertilization by proxy: rival sperm removal and translocation in a beetle. Proceeding of the Royal Society of London B, Biological Sciences. 2 6 6 : 1183-1187. Hellriegel, B. and G. Bernasconi. 2000. Female-mediated differential sperm storage in a fly with complex spermathecae, Scatophaga stercoraria. Animal behaviour. 5 9 : 311-317. 96 Helverson, D.V., and O.V. Helverson. 1991. Pre-mating sperm removal in the brush cricket Metaplastes ornatus Ramme (Orthoptera, Tettigoniidae, Phaneropteridae). Behavioral Ecology and Sociobiology. 28: 391-396. Herbers, J.M., and R.L. Mouser. 1998. Microsatellite DNA markers reveal details of social structure in forest ants. Molecular Ecology. 7:299-306. Hoy, M.A. 1994. Insect Molecular Genetics: An Introduction to Principles and Applications. Academic Press, Inc., San Diego, California. 546 pp. Huettel, M.D., C O . Calkins, and A.J. Hill. 1976. Allozyme markers in the study of sperm precedence in the plum curculio, Conotrachelus nenuphar. Annals of the Entomological Society of America. 69: 465-468. Humble, L . M . , N. Humphries, and G.A. Van Sickle. 1994. Distribution and hosts of the white pine weevil, Pissodes strobi (Peck), in Canada. Pp. 68-75 in: The white pine weevil: Biology, Damage and Management. FRDA Report 226, R.I. Alfaro, G. Kiss, and R.G. Fraser (eds.). Proceedings of a symposium held January 19-21, 1994 in Richmond, BC. Pacific Forestry Centre, Victoria, BC. Humule, M.A. 1994. The potential of Allodorus crassigaster for the biological control of Pissodes strobi. Pp. 294-300 in: The white pine weevil: Biology, Damage and Management. FRDA Report 226, R.I. Alfaro, G. Kiss, and R.G. Fraser (eds.). Proceedings of a symposium held January 19-21, 1994 in Richmond, BC. Pacific Forestry Centre, Victoria, BC. Imhof, M . , B. Harr, G. Brem, and C. Schlbttgerer. 1998. Multiple mating in wild Drosophila melanogaster revisited by microsatellite analysis. Molecular Ecology. 7: 915-917. Ito, Y., and M . Yamagishi. 1989. Sperm competition in the melon fly, Dacus cucurbitae (Diptera: Tephritidae):effects of sequential matings with normal and virgin or non-virgin sterile males. Applied Entomology and Zoology. 24: 466-477. Jarne, P., and P.J.L Lagoda. 1996. Microsatellites, from molecules to populations and back. Trend in Ecology and Evolution. 11: 424-429. Jones, A.G. , C A . Stockwell, D. Walker, and J . C Avise. 1998. The molecular basis of a microsatellite null alleles from the white sands pupfish. Journal of Heredity. 89: 339-342. Jong, P.W.DE., D.V. Michelle, and P.M. Brakefield. 1993. Sperm competition and melanic polymorphism in the 2-spot ladybird, Adalid bipunctata (Coleoptera: Coccinellidae). Heredity. 70: 172-178. Kamau, L. , W.R. Mukabana, W.A. Hawley, T. Lehmann, L.W. Irungu, A.A.S. Orago, and F.H. Collins. 1999. Analysis of genetic variability in Anopheles arabiensis and Anopheles gambiae using microsatellite loci. Insect Molecular Ecology. 8: 287-297. 97 Kennedy, G.G. 1993. Impact of intraspecific variation on integrated pest management. Pp. 425-452 in: Evolution of Insect Pests: Patterns of Variation, K.C. Kim and B.A. McPheron (eds.). John Wiley & Sons, Inc., New York. King, J.N. 1994. Delivering durable resistant Sitka spruce for plantations. Pp. 134-139 m: The white pine weevil: Biology, Damage and Management. FRDA Report 226, R.I. Alfaro, G. Kiss, and R.G. Fraser (eds.). Proceedings of a symposium held January 19-21, 1994 in Richmond, BC. Pacific Forestry Centre, Victoria, BC. Knipling E.F. 1955. Possibilities of insect control of eradication through the use of sexual sterile males. Journal of Economic Entomology. 48: 459-462. Kukuk, P.F., G.C. Eickwort, and B. May. 1987. Multiple maternity and multiple paternity in first generation brood from single foundress colonies of the sweat bee Dialictus zephyrus (Hymenoptera: Halictidae). Insectes Sociaux. 34: 131-135. Ladd, L.T. 1966. Egg viability and longevity of Japanese beetles treated with tepa, apholate, andmetepa. Journal of Economic Entomology. 59:422-425. Lewis, K.G. 1995. Genetic variation among populations of Pissodes strobi (White pine weevil) reared from Picea and Pinus hosts as inferred from RAPD markers. M.Sc. Thesis. The university of British Columbia. Lewis, K.G. , Y.A. El-Kassaby, R.I. Alfaro, and S. Barnes. 2000a. Population structure of Pissodes strobi (Coleoptera: Curculionidae) in British Columbia, Canada. Annals of the Entomological Society of America. 93: 807-818. Lewis, K.G. , C. Liewlaksaneeyanawin, R.I. Alfaro, C. Ritland, K. Ritland, and Y.A. El-Kassaby. 2000b. Sexual reproduction in the white pine weevil, Pissodes strobi (peck) (Coleoptera: Curculionidae): Implications for population genetic diversity. Submitted. Lewis, P.O., and D. Zaykin. 1999. Genetic Data Analysis Program, GDA. North Carolina State University. Lewis, S.M., and S.N. Austad. 1990. Sources of intraspecific variation in sperm precedence in red flour beetles. American Naturalist. 135: 351-359. Lewis, S.M., and E. Jutkiewicz. 1998. Sperm precedence and sperm storage in multiply mated red flour beetles. Behavioral Ecology and Sociobiology. 43: 365-369. Lewis, S.M., and J. Iannini. 1995. Fitness consequences of differences in male mating behaviour in relation to female reproductive status in flour beetles. Animal Behaviour. 50: 1157-1160. Liimatainen, J., A. Hoikkala, and T. Shelly. 1997. Courtship behavior in Ceratitis capitata (Diptera: Tephritidae): comparison of wild and mass-reared males. Annals of the Entomological Society of America. 90: 836-843. 9 8 Litt, M . , and J.A. Luty. 1989. A hypervariable microsatellite revealed by in vitro amplification of dinucleotide repeats within the cardiac muscle actin gene. American Journal of Human Genetics. 44: 397-401. Lopez-Leon, M.D., M.C. Pardo, J. Cabrero, and J.P.M. Camacho. 1995. Evidence for multiple paternity in two natural populations of the grasshopper Eyprepocnemis plorans. Hereditas (Landskrona). 123: 89-90. Lorimer, N. 1978. Genetic causes of pest population outbreaks and crashes. Pp. 50-54 in: Genetics in Relation to Insect Management, M.A. Hoy and J.J. McKelvey (eds.). A Rockefeller Foundation Conference. March 31-April 5, 1978 in Bellagio, Italy. M0ller, A.P. 1998. Sperm competition and sexual selection. Pp. 55-90 in: Sperm Competition and Sexual Selection, T.R. Birkhead and A.P. M0ller (eds.). Academic Press, London. Marshall, T.C. , J. Slate, L.E.B. Kruuk, and J.M. Pemberton. 1998. Statistical confidence for likelihood-based paternity inference in natural populations. Molecular ecology. 7: 639-655. McCauley, D.E., and L.A. Reilly. 1984. Sperm storage and sperm precedence in the milkwood beetle Tetraopes tetraophthalmus (Forster) (Coleoptera: Cerambycidae). Annals of the Entomological Society of America. 77: 526-530. McCauley, D.E., M.J. Wade, F.J. Breden, and M . Wohltman. 1988. Spatial and temporal variation in group relatedness: evidence from the imported willow leaf beetle. Evolution. 42: 184-192. Mcintosh, R.L., J.A. McLean, R.I. Alfaro, and G.K. Kiss. 1996. Dispersal of Pissodes strobi in putatively resistant white spruce in Vernon, BC. Forestry Chronicle. 72: 381-387. McLean, J.A. 1994. Silvicultural control of the white pine weevil at the U B C Malcolm Knapp Research Forest. Pp. 248-253 in: The white pine weevil: Biology, Damage and Management. FRDA Report 226, R.I. Alfaro, G. Kiss, and R.G. Fraser (eds.). Proceedings of a symposium held January 19-21, 1994 in Richmond, BC. Pacific Forestry Centre, Victoria, BC. McMullen, L .H. , and S.F. Condrashoff. 1973. Notes on dispersal, longevity and overwintering of adult Pissodes trobi (Peck) (Coleoptera: Curculionidae) on Vancouver Island. Journal of entomological Society of British Columbia. 70: 22-26. Mitter, C , and J.C. Schneider. 1987. Genetic Change and Insect Outbreaks. Pp. 505-527 in: Insect Outbreaks, P. Barbosa and J.C. Schultz (eds.). Academic Press, Inc., San Diego, California. 99 Morin, P.A., J. Walli, J.J. Moore, and D.S. Woodruff. 1994b. Paternity exclusion in a community of wild chimpanzees using hypervariable simple sequence repeats. Molecular Ecology. 3:469-478. Morin, P.A., J.J. Moore, R. Chakraborty, L. Jin, J. Goodall, and D.S. Woodruff. 1944a. Kin selection, social structure, gene flow and the evolution of chimpanzees. Science. 265: 1193-1201. Moritz, R.F.A., P. Kryger, G. Koeniger, N. Koeniger, A. Estoup, and S. Tingek. 1995. High degree of polyandry in Apis dorsata queens detected by DNA microsatellite variability.Behavioral Ecology & Sociobiology. 37: 357-363. Muller, J.K., and A.K. Eggert. 1989. Paternity assurance by "helpful" males: adaptations to sperm competition in burying beetles. Behavioral Ecology and Sociobiology. 24: 245-249. Namkoong, G. 1994. Breeding strategies of resistance. Pp. 218-221 in: The white pine weevil: Biology, Damage and Management. FRDA Report 226, R.I. Alfaro, G. Kiss, and R.G. Fraser (eds.). Proceedings of a symposium held January 19-21, 1994 in Richmond, BC. Pacific Forestry Centre, Victoria, BC. Nei, M . 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics. 89: 583-590. Newton, C H . 1998. Development of weevil microsatellite markers. Project No: 3-11-155. BCRI, Vancouver, BC. 10 pp. Nilakhe, S.S., and E.J. Villavaso. 1979. Measuring sperm competition in the boll weevil by the use of females whose spermathecae have been surgically removed. Annals of the Entomological Society of America. 72: 500-502. Oldroyd, B.P., A.J. Smolenski, J.M. Cornuet, S. Wongsiri, A. Estoup, T.E. Rinderer, and R.H. Crozier. 1996. Levels of polyandry and intracolonial genetic relationships in Apis dorsata (Hymenoptera: Apidae). Annals of the Entomological Society of America. 89:271-283. Ono, T., M.T. Siva-Jothy, and A. Kato. 1989. Removal and subsequent ingestion of rival's semen during copulation in a tree cricket. Physiological Entomology. 14: 195-202. Overhulser, D., and R.L Gara. 1975. Spring flight and adult activity of the white pine weevil, Pissodes strobi (Coleoptera: Curculionidae), on Sitka spruce. Annals of the Entomological Society of America. 107: 251-256. Paetkau, D., and C. Strobeck. 1995. The molecular basis and evolutionary history of a microsatellite null allele in bears. Molecular Ecology. 4:519-520. Parker, G. A. 1970. Sperm competition and its evolutionary consequences in the insects. Biological reviews. 45: 525-267. 100 Parker, G.A. 1998. Sperm competition and the evolution of ejaculate: towards a theory base. Pp. 3-49 in: Sperm competition and Sexual Selection, T.R. Brikhead and A.P. M0ller (eds.). Academic press, London. Pashley, D.P. 1986. Host-associated genetic differentiation in fall armyworm (Lepidoptera: Noctudae: A sibling species complex? ). Annals of the Entomological Society of America. 79:989-904. Paxton, R.J., N. Weieschuh, and J.J.G. Quezada-Euan. 1999. Characterization of dinucleotide microsatellite loci for stingless bees. Molecular Ecology. 8: 685-702. Paxton, R.J., P.A. Thoren, J. Tengo, A. Estoup, and P. Pamilo. 1996. Mating structure and nested relatedness in communnal bee, Andrena jacobi (Hymenoptera, Audrenidae), using microsatellites. Molecular ecology. 5:511-519. Pemberton, J.M., J. Slate, D.R. Bancroft, and J.A. Barrett. 1995. Nonamplifying alleles at microsatellite loci: a caution for parentage and population studies. Molecular Ecology. 4:249-252. Philips H.A., A.D. Thompson, H.M. Kozman, G.R. Sutherland, and J.C. Mulley. 1993. A microsatellite marker within the duplicated D16S79 locus has a null allele: significance for linkage mapping. Cytogenetics and Cell Genetics. 64: 131-132. Phillips,T.W. and G.N. Lanier. 1985. Genetic divergence among populations of the white pine weevil, Pissodes strobi (Coleoptera: Curculionidae). Annals of the Entomological Society of America. 78: 744-750. Polmin, R., J.C. DeFries, and G.E. McClearn. 1980. Behavioral Genetics: A Primer. Freeman, San Francisco. Proverbs, M.D. 1972. Sterile insect technique in codling moth control. Pp. 85-99 in: Sterile insect technique and radiation in insect control. Proceedings of the international symposium on the sterile insect technique and the use of radiation in genetic insect control held 29 June - 3 July 1981 in Neuherberg, Vienna. Rankin, L.J., and K. Lewis. 1994. Effectiveness of leader clipping for control of the white pine weevil, Pissodes strobi, in the Cariboo Forest Region of British Columbia. Pp. 262-269 in: The white pine weevil: Biology, Damage and Management. FRDA Report 226, R.L Alfaro, G. Kiss, and R.G. Fraser (eds.). Proceedings of a symposium held January 19-21, 1994 in Richmond, BC. Pacific Forestry Centre, Victoria, BC. Retnakaran, A. 1974. The mechanism of sperm precedence in the spruce budworm, Choristoneura fumiferana (Lepidoptera: Tortricidae). Canadian Entomologist. 106: 1189-1994. Retnakaran, A., and L. Jobin. 1994. New observations on adult behaviour of the white pine weevil and implications on control with diflubenzuron. Pp. 270-284 in: The white pine weevil: Biology, Damage and Management. FRDA Report 226, R.L Alfaro, G. Kiss, and R.G. Fraser (eds.). Proceedings of a symposium held January 19-21, 1994 in Richmond, BC. Pacific Forestry Centre, Victoria, BC. 101 Rosenbaum, H.C., and A.S. Deinard. 1998. Caution before claim: an overview of microsatellite analysis in ecology and evolutionary biology. Pp. 87-106 in: Molecular Approaches to Ecology and Evolution, R. DeSalle and B. Schierwater (eds.). Birkhauser, Berlin, Germany. Rowe, D.J., T.E. Rinderer, J.A. Stelzeer, B.P. Oldroyd, and R.H. Crozier. 1997. Seven polymorphic microsatellite loci in honeybees (Apis mellifera). Insects Sociaux. 44: 85-93. Sakol, R.R., and F.J. Rohlf. 1995. Biometry. Third Edition. W.H. Freeman and Company, New York. Schlotterer, C. and J. Pemberton. 1998. The use of microsatellites for genetic analysis of natural populations - a critical review. Pp. 71-86 in: Molecular Approaches to Ecology and Evolution, R. DeSalle and B. Schierwater (eds.). Birkhauser, Berlin, Germany. Scott, M.P., and S.M. Williams. 1998. Molecular measures of insect fitness. Pp. 55-69 in: Molecular Approaches to Ecology and Evolution, R. DeSalle and B. Schierwater (eds.). Birkhauser, Berlin, Germany. Scribner, K.T. , J.R. Gust, and R.L. fields. 1996. Isolation and characterization of novel salmon microsatellite loci: cross-species amplification and population genetic applications. Canadian Journal of Fisheries Aquatic Sciences. 53: 833-841. Shelly, T. E. , and T.S. Whittier. 1996. Mating competitiveness of sterile male Mediterranean fruit flies (Diptera: Tephritidae) in male-only releases. Annals of the Entomological Society of America. 89: 754-758. Silver, G.T. 1968. Studies on the Sitka spruce weevil, Pissodes sitchensis, in British Columbia. The Canadian Entomologist. 100:93-110. Simmons, L.W. and M.T. Siva-Jothy. 1998. Sperm competition in insects: mechanism and the potential for selection. Pp. 341-432 in: Sperm competition and Sexual Selection, T.R. Brikhead and A.P. M0ller (eds.). Academic press, London. Simmons, L.W. and R. Achmann. 2000. Microsatellite analysis of sperm-use patterns in the bushcricket Requena verticalis. Evolution. 54: 942-952. Simon, J . - C , S. Baumann, P. Sunnucks, P.D.N. Herbert, J.-S. Pierre, J.-S. Le Gallic, and C -A. Dedryver. 1999. Reproductive mode and population genetic structure of the cereal aphid Sitobion avenae studied using phenotypic and microsatellite markers. Molecular Ecology. 8:531-545. Siva-Jothy, M.T., D.E. Blake, J. Thompson, and J.J. Ryder. 1996. Short- and long-term sperm precedence in the beetle Tenebrio molitor: a test of the 'adaptive sperm removal'hypothesis. Physiological Entomology. 21:313-316. 102 Slate J., T. Marshall, and J. Pemberton. 2000. A retrospective assessment of the accuracy of the paternity inference program CERVUS. Molecular Ecology. 9:801-808. Spruell, P., K.L. Pilgrim, B.A. Greene, C. Habicht, K.L. Knudsen, K.R. Lindner, J.B. Olsen, G.K. Sage, J.E. Seeb, and F.W. Allendorf. 1999. Inheritance of nuclear DNA markers in gynogenetic haploid pink salmon. Journal of Heredity. 90: 289-296. Stevenson, R.E. 1967. Notes on the biology of the Engelmann spruce weevil, Pissodes engelmannii (Curculionidae: Coleoptera) and its parasites and predators. The Canadian Entomologist. 99: 201-213. Strassmann, J.E., C.R. Soils, K. Barefield, and D.C. Queller. 1996. Trinucleotide microsatellite loci in a swarm-founding neotropical wasp, Parachartergis colobopterus, and their usefulness in other social wasps. Molecular ecology. 5: 459-461. Sugg, D.W., and R.K. Chesser. 1994. Effective population size with multiple paternity. Genetics. 137: 1147-1155. Summers, K., and W.Amos. 1997. Behavioral, ecological and molecular genetic analyses of reproductive strategies in the Amazonian dart-poison frog, Dendrobates ventrimaculatus. Behavioral Ecology. 8: 260-267. Sunnucks, P., P.R. England, A.C. Taylor, and D.F. Hales. 1996. Microsatellite and chromosome evolution of parthenogenetic Sitobion aphids in Australia. Genetics. 144: 747-756. Thoren, P.A., R.J. Paxton, and A. Estoup. 1995. Unusually high frequency of (CT) n and (GT) n microsatellite loci in a yellowjacket wasp, Vespula rufa (L.) (Hymenoptera: Vespidae). Insect Molecular Biology. 4: 141-148. Traut, W., J.T. Epplen, D. Weichenhan, and J. Rohwedel. 1992. Inheritance and mutation of hypervariable (GATA) n microsatellite loci in moth, Ephestia kuehniella. Genome. 35: 659-666. Tregenza, T. and N. Wedell. 1998. Benefits of multiple mates in the cricket Gryllus bimaculatus. Evolution. 52: 1726-1730. Trumbo, S.T., and A.J. Fiore. 1991. A genetic marker for investigating paternity and maternity in the burying beetle Nicrophorus orbicollis (Coleoptera: Silphidae). Journal of New York Entomology Society. 99: 637-642. Tsubaki, Y., and M.Yamagishi. 1991. 'Longevity' of sperm within the female of the melon fly, Dacus cucurbitae (Diptera: Tephritidae), and its releevence to sperm competition. Journal of Insect Behavior. 4: 243-250. 103 Vanlerberghe-Masutti, F., and P. Chavigny. 1997. Characterization of a microsatellite locus in the parasitoid wasp Aphelinus abdominalis (Hymenoptera: Aphelinidae). Bulletin of Entomological Research. 87:313-318. Vardell, H.H, and J.H. Browser. 1978. Sperm precedence in Trilobium confusum (Coleopters: Tenebrionidae). Journal of the Kansas Entomological Society. 51: 187-190. Vick, K.W., W.E. Burkholder, and B.J. Smittle. 1972. Duration of mating refractory period and frequency of second matings in female Trogoderma inclusum (Coleoptera: Dermestidae). Annals of the Entomological Society of America. 65: 790-793. Waage, J.K. 1979. Dual function of the damselfly penis: sperm removal and transfer. Science. 203: 916-918. Wallace, D.R., and C R . Sullivan. 1985. The white pine weevil, Pissodes strobi (Coleoptera: Curculionidae): a review emphasizing behaviour and development in relation to physical factors. Proceeding of the Entomological Society of Ontario. 116: 39-62. Webb, R.E., and F.F. Smith. 1968. Fertility of eggs of Mexican bean beetles from females mated alternately with normal and Apholate-treated males. Journal of Economic Entomology. 61: 521-523. Weber, J.L., and P.E. May. 1989. Abundant class of human DNA polymorphisms which can be typed using polymerase chain reaction. American Journal of Human Genetics. 44: 388-396. Weir, B.S. 1996. Genetic data analysis U. Sinauer Associates, Sunderland, Massachusetts. Woyciechowski, M . , and A. Lomnicki. 1987. Multiple mating of queens and the sterility of workers among eusocial Hymenoptera. Journal of Theoretical Biology. 128:317-327. Yamagishi, M . , and Y. Tsubaki. 1992. Sperm competition in the melon fly, Bactrocera cucurbitae (Diptera: Tephritidae): effects of sperm 'longevity' on sperm precedence. Journal of Insect Behavior. 5: 559-608. Yasui, Y. 1998. The 'genetic benefits' of female multiple mating reconsider. Trend in Ecology and Evolution. 13: 246-250. Ying, C C , and T. Ebata. 1994. Provenance variation in weevil attack in Sitka spruce. Pp. 98-109 in: The white pine weevil: Biology, Damage and Management. FRDA Report 226, R.I. Alfaro, G. Kiss, and R.G. Fraser (eds.). Proceedings of a symposium held January 19-21, 1994 in Richmond, BC. Pacific Forestry Centre, Victoria, BC. Yuval, B., and G.N. Fritz. 1994. Multiple mating in female mosquitoes - evidence from a field population of Anopheles freeborni (Diptera: Culicidae). Bulletin of Entomological Research. 84: 137-139. 104 Zeh, J.A. 1997. Polyandry and enhanced reproductive success in the harlequin-beetle-riding pseudoscorpion. Behavioral Ecology and Sociobiology. 40:111-118. Zeh, J.A., and D.W. Zeh. 1994. Last-male sperm precedence breaks down when females mate with three males. Proceeding of the Royal Society of London B, Biological Sciences. 257:287-292. APPENDIX I DEVELOPMENT OF WEEVIL MICROSATELLITE MARKERS Prepared for: Dr. Yousry El-Kassaby Prepared by: Craig H. Newton BCRI 3650 Wesbrook Mall Vancouver, B.C. V6S 2L2 Project No: 3-11-155 September, 20,1998 ©1997 BCRI All rights reserved. 106 ISOLATION OF MICROSATELLITE MARKERS FROM WEEVIL The following describes the development of microsatellite markers specific for weevil species. The first steps describe an enrichment process that starts with total weevil genomic DNA and ends up with a fraction that is highly enriched (ca. 1000X) for genomic sequences containing the microsatellite DNA marker of interest. From these enriched libraries, clone isolation and DNA sequencing analysis are done in relatively few steps, followed by PCR primer design and testing on weevil genomic DNAs. The report, albeit preliminary, will show that microsatellite markers are readily abundant in weevil and should fulfill the DNA marker criteria required for this species. However some unanticipated results were observed (library over-representation, artificial microsatellites or hybrids) and will be discussed. 1. Digestion and adapter addition to weevil genome DNA. Total genomic DNA from a single male spruce weevil (organism #2) was obtained from Dr. Carol Ritiand (UBC). Approximately 10 [xg of total genomic DNA was obtained from this single individual. Microsatellite markers were isolated from genomic DNA using modifications of published biotin-enrichment strategies (Kijas et. al. (1994) BioTechniques 16:657-662). Approximately 0.5-1.0 fig of total weevil genomic DNA was added to a 60 jul reaction mixture containing 10 mM Tris-acetate (pH 7.5), 10 mM magnesium acetate, 50 mM potassium acetate, 0.5 mM adenosine triphosphate (rATP), 5 mM dithiothreitol, 20 uglmi bovine serum albumin (BSA), 30 units (Pharmacia) Hae m, 10 units PsbAl (New England Biolabs), 600 units (New Engalnd Biolabs) T4 DNA ligase, and 60 pmoles of an equimolar mixture of the oligonucleotides M28 and M29 (Table 1). The reaction was incubated overnight at 37°C. A portion of the reaction (0.2) was then analysed on a 2% agarose minigel to check for the expected distribution of digestion/ligation products. 2. Enrichment using biotin labelled oligonucleotides. Three sets of 5' biotin labeled oligonucleotides were used to enrich the above weevil genomic DNA (Table 1). The A C n specific oligonucleotide TGI was used alone while the tetranucleotide specific oligonucleotides (GATA6 and GACAe) were used as a 1:1 mixture. Under a droplet of oil 5-10 microlitres of the above digestion/ligation reaction mixture were mixed with 0.5 to 1 pmole of biotin labeled oligonucleotide(s) and were denatured for 5 minutes at 95 °C followed by incubation at 55°C for 15 minutes. The hybridization was terminated by quick chilling on ice water and either used immediately or stored at -20°C. For selection, 10 /til of washed Dynal M280 streptavidin-magnetic beads (10 mg/ml) were added to the thawed hybridization mixture in a total volume of 150 /xl T E N buffer (10 mM trishydrochloride pH 7.5, 1 mM EDTA, and 1 M sodium chloride). Beads were washed 3X in 150 /il T E N buffer containing 1 mg/ml denatured sonicated salmon sperm DNA and then resuspended in 140 jul T E N buffer alone prior to adding the hybridization mix. The beads/weevil DNA were then incubated at room temperature for 30 minutes with gentle shaking and occasional finger flicking. A 1.5 ml tube size magnetic separator stand (Promega) was used to wash the beads/DNA with 150jul fresh prewarmed (55°C) TEN buffer and 0.5% sodium lauryl sulfate (LS). Between each of five subsequent washes the beads 107 were gently resuspended and incubated at 55°C for 2-5 minutes. The final wash was in 0.1 X T E N buffer at room temperature and the beads were then resuspended in 50 /il PCR grade water. 3. Amplification and cloning into bacterial plasmid vectors. Approximately 1-2 [il of the above bead/DNA mixture was added to a 25 \i\ amplification reaction composed of 20 mM ammonium suifate, 75 mM Tris-hydrochioride (pH 8.8), 0.01% Tween 20, 1.5 mM magnesium chloride, 200 uM each deoxynucleotide triphosphate, 0.5 uM oligonucleotide M30 (Table 1), 0.1 units 'Ultratherm' DNA polymerase (Biocan Scientific) and 0.025 units V E N T DNA polymerase (New England Biolabs). Amplification was in a MJ Research PTC-100 thermocycler using 20-25 cycles at 94°C (30 see), 55°C (30 sec) and 72°C (2 minutes) preceded first by a 2 minute denaturation at 94°C and then ended with a 5 minute incubation at 72°C. A portion of the amplification reaction (1/5) was then tested on a 2% agarose gel and blotted to Hybond N membranes for hybridization with 3 2 P labeled microsatellite specific oligonucleotides (Table 1). For cloning into plasmid vectors, the remaining amplification mixture was first purified using silica-based retention columns (FMC or Quaigen) and then digested with 20 units EcoRI in a 50 jul reaction containing 20 mM Tris-acetate (pH 7.5), 20 mM magnesium acetate, 100 mM potassium acetate for 2-4 hours at 37°C. The digestion reaction was purified as before or by room temperature precipitation with 1.5 volumes ethanol in 2.2 M ammonium acetate. Approximately 1-10% of the resulting products (determined by electrophoresis) were ligated to 10 ng of phosphatased, EcoRI digested pGEM3Z+ in a 10 u\ reaction using 150 units (New England Biolabs) T4 DNA ligase for 6 hours at 15°C. After dilution with 50 a\ of water, l/10th of the ligation reaction were transformed into 60-100 /xl competent E. coli (strain S U R E T T m , Stratagene) and plated onto Y T media containing 100 jug/ml ampicillin. Depending on the particular ligation, this usually gave rise to greater than 1-3 x 103 ampicillin resistant colonies per microlitre ligation reaction. Approximately 10-100 fold greater number of clones are obtained if ligated DNAs are electroporated into bacteria (GibcoBRL, strain DHIOB). 4. Analysis of microsatellite containing clones. Bacterial colonies from the above primary enrichment libraries were screened using 2224mer 3 2 P labeled oligonucleotides complementary to the microsatellite motif of interest (Figure 1). Depending on the stringency of hybridization and washes (2X SSC 45-65°C), between 10-20% of the total clones hybridized to the respective probes. Individual hybridizing colonies were then picked and diluted in 0.1-0.2 ml T E buffer, or for long term viable storage, in Y T media containing 15% glycerol. For amplification of template DNA for D N A sequencing, usually 1-2 jul of the above bacterial stocks were added to the 25 /ul amplification reaction described above (section 1.3), except 1) the M30 primer was replaced with 0.5 iiM each forward and reverse M13/LacZ primers, 2) the number of thermocycles was 25 and 3) the annealing temperature was 60°C. The amplification reactions were then purified by ethanol precipitation and redissolved in 10-15 a\ TE. Sequence reactions were performed using a GibcoBRL double stranded cycle sequencing kit (at half scale) with 5' labelled 32P forward or reverse LacZ/M13 primers. Chain termination products were fractionated using 6% poiyacryiamide/8M urea gels. After 108 electrophoresis the gels were dried and exposed to autoradiography with Biomax film (Kodak) for 6-60 hrs. 5. Dinucieotide (AC„) microsatellite markers. An initial A C n library (WE.l) was prepared as described above and a total of 19 clones were sequenced: 12 from both ends (forward and reverse) and 7 clones from one end only. Examination of these sequences showed that at least 13 of the 19 clones were made up of between 2-3 abundant sequence classes on one side (5' end) of the SSR motif linked to unrelated flanking sequence on the other side of the SSR motif (3' end). Only one clone, (we. 1-14) had flanking sequences unique to itself. Two clones (we. 1-8, we. 1-12) where homologous at both 5' and 3' ends but differed substantially through nucleotide polymorphisms. In fact, no two abundant classes of the SSR flanking sequence were identical in the approximately 200 bp available for comparison. All showed polymorphisms ranging from as little as one nucleotide difference to several suggesting that many divergent copies of these sequences exist in the weevil genome. The fact that these abundant sequences are found linked via SSR motifs to a wide range of sequences raises the possibility that these 'hybrid' clones may be artifacts of amplification during the enrichment process. One of these clones (we. 1-8) was used to design oligonucleotide primers for testing with weevil genomic DNAs (Table 2). As expected from the sequence data Multiple amplification products were obtained in the size range expected from the cloned DNA (Figure 3) and no polymorphism was observed between genomic DNAs from 6 unrelated individuals (C. Ritiand. personal communication). In light of the high representation of only a few sequences classes in the W E . l library, a second library (WE.3) was constructed where the amplification step was reduced considerably (20 PCR cycles versus 25-30 cycles and 1/4 starting template) in an attempt to minimize the potential for hybrids arising from incomplete amplification cycles or for over representation of abundant clones as amplification proceeds. From this library 12 clones were sequenced from both ends and compared as above. In this case now only 3 of the 12 clones were potentially hybrids (we.3-8, -9, -19). One of these clones is similar to both flanks of a clone from the original library (we.l-12), suggesting they both correspond to authentic genomic products. However they also are divergent in flanking sequences and thus are likely to be paralogous sequences. Three of the apparent hybrid clones from this second library were tested to determine if they gave rise to corresponding amplification products using weevil genomic DNA. Primers were designed to amplify hybrids using one universal printer (Ul, Table 2) for amplification from the side of the SSR motif where sequences were related and 3 primers on the other side of the SSR motif specific to 3 different sequences (8.1 R, 9. 1 F, 19,1 F). In each case the expected amplification products were observed (Figure 3) and imply that these sequences may in fact exist in weevil genomic DNA. As expected form higher copy genomic sequences, multiple products were observed for each of the three primer sets. Although the presence of amplification products suggest the cloned DNAs may be authentic, similar products would be observed by the same mechanism proposed for hybrid formation during enrichment amplification. In fact the smear of 109 products obtained is consistent with ragged hybrid formation instead of, for instance, arising from divergent parologous sequences. Further experiments are necessary to distinguish these possibilities unambiguously. For example, if hybrid formation is relatively efficient then single primers of putative authentic clones should also give rise to amplification products when they are combined together in 'hybrid' reactions. These tests are in progress. The remaining clones from WE.3 did not appear to be hybrids based on comparison between all sequences from both libraries. Primers were designed to a number of these (Table 3) and were tested on single weevil genomic DNAS. In each case the expected products were observed. Tests to determine whether these products show population polymorphism are in progress. 6. Tetranucleotide microsatellite DNA markers. An enriched weevil library was prepared using a mixture of GATA6 and GACA6 biotin labeled 32 oligonucleotides (WE.2). Transformed cells were then plated and screened using individual P labeled oligonucleotides and 6 positive clones from each were sequenced from both ends. In the 6 G A C A clones, three were identical (we.2-16, -20, -21), while the remaining three were unique. With the exception of we.2-2, all these, clones contained only short degenerate G A C A motif with the longest where n=5 (we.2-16, -20, -21). Although some longer clones were not sequenced completely, there was no evidence of additional, more extensive repetitive regions, in the unreadable portions of the autoradiograms. This is usually easily detectable with other SSR motifs. The exception, we2.2 (1050 bp), did appear to have potential more extensive repeat motif in an unreadable portion of the gel. Characterization of this region is in progress. No primers have yet been designed for these G A C A clones. The high representation of a single clone and the short degenerate SSR motifs in the others indicate that G A C A may not be an easily useful SSR motif in weevil. The G A T A motif however does appear to be more useful. Of the 6 clones analyzed only 2 were identical and (we.2-5, -17) and all contained extensive G A T A repetitive regions where n= 16-25. Interestingly 4 of the 5 G A T A motifs are preceded directly by a polyadenylate (An) tract where n= 20-25. Amplification primers were designed to the 5 unique clones (Table 3) and, with the exception of we.2-18FR, were tested using the 6 different weevil genomic DNAs (Figure 3). All 5 sets gave rise to amplification products of the predicted size, and in 3 of 4 cases, (we.2-5, -11, -19FR) examined, gave rise to polymorphism between the 6 individual originally supplied, we-2.18.was only tested using a single DNA and although it works, the polymorphism content has not been determined. In all cases the amplification products are relatively simple compared to A C n SSR clones, suggesting they are at lower copy in the genome. 7. Work in progress Remaining effort on this project will focus on: 1) design 5 additional AC„ primer pairs using the unique clones from the we.3 library (table). 2) sequence the G A C A clone we.2-2 to characterize a potential G A C A motif contained within. 3) sequence 6 more G A T A clones and design primers to between 3-4 clones and the above G A C A clone if appropriate (total 4-5). 4) test all primer sets using up to 10 genomic DNAs from a controlled cross (if available) or more range wide individuals. 5) test hybrid formation with hybrid A C n amplification reactions. Expected completion date Nov. 1998. I l l Table 1: Oligonucleotides used for microsatellite enrichment. name Sequence (5'-3') B-TG12 5' biotin-TGTGTGTGTGTGTGTGTGTGTGTGC B-GATA6 S' biotin-G A T A G AT A G A T A G AT A G A T A G AT A B-GACA6 5' b io t in -GACAGACAGACAGACAGACAGACA M28 5' C T C T T G C T T G A A T T C G G A C T A M29 5' p T A G T C C G A A T T C A A G C A A G A G C A C A M30 5' C T C T T G C T T G A A T T C G G A C T A C C Forward S' C G C C A G G G T T T T C C C A G T C A C G A C Reverse 5' T C A C A C A G G A A A C A G C T A T G A C Table 2: Oligonucleotides for microsatellite analysis in weevil. Library name 5'-3'sequence SSR W E . l we.l-8F 5' G T T G G T C C T T G T T T A C A C G G (AC) N we.l-8R 5' A C T T C G T A A C G G T A C G T C G G tf WE.3 we.3-Ul 5' C T T T C T A T A G G G C G A G A C C A n we.3-8F 5' G T C G C T G G C T T C A A A A T T G C G A it we.3-9R 5' GTGTGTCCTCGCtTTGCTAC it we.3-19R 5' T G T C G C A G G T G G T A A T T C G G a we.3-14F 5' G T T T G T T A A T G G A G T C T T G C T G C n we.3-14R 5' C G C A C T C T T G C C C T A C T A C A a we.3-16F 5' G G C A T C A G A T T A A T G A A G G T T C n we.3-16R 5' G C G T C A C A A T T T G G T C C T A T T C a we.3-18F 5' G C T A T C C T A T G C A A G A A T G T A T C n we.3-18R 5' T C G G T T G T G A T G G G A A A T T C a WE.2 we.2-3F 5' G A G C C T A C T A C A A G C T A T C C (GATA) N we.2-3R 5' G C G C T G A T A A G T A T C A C T C G C n we.2-5F 5' G C C C A A G A C T A C T T G A A A T C n we.2-5R 5' G G T G T C T A G A T A G A G A T T T C C a we.2-HF 5' T T T C A C T G C G G T G C C G G A T C n we.2-HR 5' A G A G A G G A A A G A C A G A G G G T a we.2-18F 5' G G C C C A A G A C T A G T T G A A A T C a we.2-18R 5' G A G G C A G T C A C T G C C T G G T C a we.2-19F 5' G G C C C C A A T A T A G T A T A T T A T C a we.2-19R 5' G G T C T T C C G T T T A A A T G T A C a 112 Figure 1: Screening enriched weevil microsatellite bacterial libraries. Transformed E. coli were grown on filters and then hybridized with P labelled oligonucleotide probes corresponding to the SRR motif used for enrichment: a) Colonies from library WE.3 screened with 3 2 P labelled AC24, (wash = 2X sec, 58°C; b) Colonies from library WE.2 screened with 3 2 P G A C A 6 (2X sec, 58°C); c) Colonies from library WE.2 screened with 3 2 P G A C A 6 (2X sec, 45°C). 0. m 0* B 1 * A C 1 2 GACAH C GATA 6 113 Figure 2: DNA sequence analysis of weevil A C n clones (WE .3). Bacterial template DNAs were analysed cycle sequencing using 3 2 P labelled reverse M13 primer. Sequencing reactions are from left to right G, A, T, C. Microsatellite clones from the A C n enrichment library WE.3 are indicated above each reaction set. 114 Figure 3: Amplification of weevil genomic DNA using the A C n microsatellite primers we.1-8 F/R. The autoradiogram shows 6 different DNAs (lanes 2-9) with we.l-8F/R and analysed on urea/polyacrylamide sequencing gels. Lane 1 shows the products obtained using the cloned we.l-8 DNA as a template. 1 2 3 4 5 6 7 8 9 we .1 -8FR 115 Figure 4: DNA sequence analysis of weevil G A C A n and GATA„ clones (WE.2). Bacterial template DNAs were analysed cycle sequencing using 3 2 P labelled reverse M l 3 primer. Sequencing reactions are from left to right G, A, T, C. Microsatellite clones are indicated above each reaction set. G A C ^ ,%-% ,2-t .M6 .2-17 .2-30 .2-21 .2-3 G A T J \ .2-5 -2-11 .2-1B .2-19 116 Figure 5: Amplification of weevil genomic DNA using the G A T A n microsatellite primers. The autoradiogram shows 7 different weevil D N A s (lanes 1-7) amplified with microsatellite primers indicated above each set. wc.2-1 1 w e . 2 - 3 w e , 2 - 1 9 1 2 3 4 5 6 7 w e . 2-5 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0089683/manifest

Comment

Related Items