UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Genetic variation and adaptation in the Quechua, a high altitude native population Rupert, James L. 2000

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2000-487059.pdf [ 6.97MB ]
Metadata
JSON: 831-1.0089649.json
JSON-LD: 831-1.0089649-ld.json
RDF/XML (Pretty): 831-1.0089649-rdf.xml
RDF/JSON: 831-1.0089649-rdf.json
Turtle: 831-1.0089649-turtle.txt
N-Triples: 831-1.0089649-rdf-ntriples.txt
Original Record: 831-1.0089649-source.json
Full Text
831-1.0089649-fulltext.txt
Citation
831-1.0089649.ris

Full Text

Genetic variation and adaptation in the Quechua, a high altitude native population. b y J a m e s L . R u p e r t B . S c , T h e U n i v e r s i t y o f G u e l p h , 1 9 8 4 M . S c , U n i v e r s i t y o f T o r o n t o , 1 9 8 8 A T H E S I S S U B M I T T E D I N P A R T I A L F U L F I L M E N T O F T H E R E Q U I R E M E N T S F O R T H E D E G R E E O F D O C T O R O F P H I L O S O P H Y i n T H E F A C U L T Y O F G R A D U A T E S T U D I E S D e p a r t m e n t o f Z o o l o g y W e a c c e p t t h j s - t h e s j s a s , c o n f o r m i n g t o t h e r e q u i r e d s t a n d a r d . T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A A p r i l 2 0 0 0 © J a m e s L . R u p e r t In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. 1 further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of Zcology The University of British Columbia Vancouver, Canada D a t e 25/04/2000 DE-6 (2/88) ABSTRACT H u m a n a d a p t a t i o n t o h i g h a l t i t u d e i n v o l v e s a s u i t e o f p h y s i o l o g i c a l a n d a n a t o m i c a l c h a r a c t e r i s t i c s d e s i g n e d to f a c i l i t a t e t h e u p t a k e , t r a n s p o r t a n d u t i l i z a t i o n o f o x y g e n , t h e r e b y c o m p e n s a t i n g f o r t h e d i m i n i s h e d o x y g e n a v a i l a b i l i t y i n h e r e n t to h i g h a l t i t u d e . W h i l e m a n y o f t h e s e c h a r a c t e r i s t i c s m a y b e a c c l i m a t o r y o r d e v e l o p m e n t a l i n nature, t h e r e i s e v i d e n c e t h a t s o m e a r e i n f l u e n c e d b y t h e g e n e t i c b a c k g r o u n d o f t h e p o p u l a t i o n . T h e s t u d i e s p r e s e n t e d i n t h i s t h e s i s a r e d e s i g n e d t o e x a m i n e t h e i n f l u e n c e o f g e n o t y p e b y c o m p a r i n g t h e f r e q u e n c i e s o f v a r i a n t s i n a n u m b e r o f c a n d i d a t e g e n e s b e t w e e n t h e Q u e c h u a , a h i g h a l t i t u d e p o p u l a t i o n i n d i g e n o u s t o A n d e a n a l t i p l a n o , a n d t w o l o w a l t i t u d e p o p u l a t i o n s : N a - D e n e f r o m t h e w e s t c o a s t o f C a n a d a a n d C a u c a s i a n s o f w e s t e r n E u r o p e a n d e s c e n t . G e n e s w e r e c h o s e n b e c a u s e t h e y h a d p r e v i o u s l y c h a r a c t e r i z e d p o l y m o r p h i s m s w i t h p h e n o t y p e s that a priori w e r e j u d g e d t o b e o f p o t e n t i a l b e n e f i t at a l t i t u d e a n d i n c l u d e : 1) t h e B 2 - a d r e n e r g i c r e c e p t o r , t h e p r i n c i p l e p u l m o n a r y c a t e c h o l a m i n e r e c e p t o r ; 2) a n g i o t e n s i n c o n v e r t i n g e n z y m e , a r e g u l a t o r o f s y s t e m i c b l o o d f l o w ; 3) B - f i b r i n o g e n , a c o m m o n p l a s m a p r o t e i n a n d p r i m a r y d e t e r m i n a n t o f p l a s m a v i s c o s i t y ; 4 ) e r y t h r o p o i e t i n , a h o r m o n e i n v o l v e d i n t h e s y n t h e s i s o f r e d b l o o d c e l l s a n d 5) h y p o x i a i n d u c i b l e f a c t o r 1 - a l p h a , a m a j o r c o m p o n e n t i n o x y g e n - d e p e n d e n t g e n e r e g u l a t i o n . G i v e n t h e t h e o r e t i c a l r e q u i r e m e n t s o f h i g h a l t i t u d e p o p u l a t i o n s a n d t h e p h e n o t y p e s a s s o c i a t e d w i t h t h e s e a l l e l e s o f t h e s e g e n e s , p r e d i c t i o n s w e r e m a d e as to w h i c h a l l e l e s s h o u l d h a v e b e e n s e l e c t e d f o r , a n d t h e r e f o r e c u r r e n t l y b e o v e r - r e p r e s e n t e d , i n t h e Q u e c h u a . A s e x p e c t e d , g i v e n t h e d i v e r s e o r i g i n s o f the p o p u l a t i o n s e x a m i n e d , t h e r e w e r e s i g n i f i c a n t d i f f e r e n c e s i n h a p l o t y p e s t r u c t u r e a n d a l l e l e f r e q u e n c i e s . W h i l e s o m e o f t h e s e d i f f e r e n c e s m a y h a v e r e s u l t e d f r o m t h e r a n d o m d i v e r g e n c e o f s e p a r a t e d p o p u l a t i o n s o v e r t i m e , o t h e r s , s u c h as t h e u n d e r - r e p r e s e n t a t i o n o f a l l e l e s a s s o c i a t e d w i t h i n c r e a s e d f i b r i n o g e n m a y r e f l e c t a n a d a p t i v e c h a n g e i n t h e Q u e c h u a . S u c c e s s f u l e x p a n s i o n i n t o a d e m a n d i n g e n v i r o n m e n t w i l l o f t e n b e r e f l e c t e d i n t h e g e n e t i c m a k e - u p o f a p o p u l a t i o n . P r e v i o u s s t u d i e s i n v e s t i g a t i n g t h e r o l e o f g e n e t i c s i n h i g h a l t i t u d e a d a p t a t i o n h a v e c o n c e n t r a t e d o n t h e h e r i t a b i l i t y o f c o m p l e x traits. T h e w o r k p r e s e n t e d i n t h i s t h e s i s r e p r e s e n t s a n a l t e r n a t e a p p r o a c h , o n e i n w h i c h t h e f o c u s i s o n t h e f r e q u e n c i e s o f v a r i a n t s i n i n d i v i d u a l g e n e s i n a n a l t i t u d e - a d a p t e d p o p u l a t i o n . ii Table of Contents P a g e A b s t r a c t i i T a b l e o f c o n t e n t s i i i L i s t o f F i g u r e s i v L i s t o f T a b l e s v A c k n o w l e d g m e n t s v i i i P r e f a c e i x Chapter 1 I n t r o d u c t i o n 1 1.1 P r o j e c t o v e r v i e w 1 1.2 H u m a n h i g h a l t i t u d e a d a p t a t i o n i n t h e A n d e s 4 1.3 T h e P e o p l i n g o f t h e N e w W o r l d 15 1.4 T h e S o u t h A m e r i c a n h i g h l a n d s 2 0 1.5 T h e Q u e c h u a 2 2 1.6 S u m m a r y 2 5 1.7 R a t i o n a l e 2 7 Chapter 2 M a t e r i a l s a n d M e t h o d s 2 9 Chapter 3 B - f i b r i n o g e n a l l e l e f r e q u e n c i e s i n t h e Q u e c h u a 3 5 Chapter 4 A n g i o t e n s i n c o n v e r t i n g e n z y m e ( A C E ) a n d a n g i o t e n s i n 2 4g r e c e p t o r 1 a l l e l e f r e q u e n c i e s i n t h e Q u e c h u a Chapter 5 B e t a - a d r e n e r g i c r e c e p t o r a l l e l e f r e q u e n c i e s i n t h e Q u e c h u a 6 0 Chapter 6 T h e s e q u e n c e o f t h e e r y t h o p o i e t i n a n d H I F - l a g e n e s i n t h e Quechua... 7 3 Chapter 7 D i s c u s s i o n , c o n c l u s i o n s a n d f u t u r e c o n s i d e r a t i o n s 8 5 A b b r e v i a t i o n s 9 3 R e f e r e n c e s 94 A p p e n d i c e s 1 12 i) C o n s e n t f o r m 1 12 ii ) P r i m e r s e q u e n c e s 113 i i i ) D N A s e q u e n c e s 1 1 5 i i i List of Figures Page T w o Quechua women in Ol lantaytambo, Peru v i 1.1 The relationship between altitude and atmospheric pressure 5 1.2 Hematocr i t s in A n d e a n native populations 14 1.3 B e r i n g i a and Pleistocene glaciat ion patterns 16 1.4 Changes in allele frequencies over 600 generations o f selection 20 1.5 M a p s o f South A m e r i c a and Peru 21 1.6 A summary o f human adaptation to altitude 26 3.1 F ib r inogen concentration and viscosi ty 36 3.2 The role o f f ibr inogen in the clot t ing cascade 37 3.3 A s s a y for R F L P s in the B-fibrinogen gene 39 3.4 Rela t ive p lasma viscosi ty in Quechua and Caucasians 41 4.1 The A C E - m e d i a t e d vasomodulat ion system 49 4.2 A C E I7D alleles P C R ampl i f ica t ion assay 53 4.3 A s s a y for po lymorphisms in t h e A C E and A T 2 - R 1 genes 55 5.1 The structure o f the 6 2 -adrenerg ic receptor 62 5.2 A s s a y for R F L P s in the B 2 - A R gene 65 6.1 Ery thropoie t in and the product ion o f red b lood cells 75 6.2 Regula tory regions o f the erythropoietin gene , 76 6.3 L o c a t i o n o f erythropoietin gene P C R primers 77 6.4 A s s a y for R F L P S in the erythropoietin gene 79 6.5 P o l y m o r p h i c sites in erythropoietin gene 80 iv List of Tables Page 1.1 Hematocr i t values for Andean populations 12 1.2 E a r l y archeological sites in the Andes 18 1.3 Predic ted change in allele frequencies after 600 and 1650 generations .. 25 2.1 A g e and hematocrit o f the Quechua who donated b lood samples 31 3.1 8-fibrinogen P C R primers 40 3.2 8-fibrinogen genotype and allele frequencies 42 3.3 L i n k a g e d i sequ i l ib r ium between the B-fibrinogen alleles 43 4.1 A C E and A T 2 - R 1 genotype and allele frequencies 54 4.2 Pub l i shed allele frequencies for the A C E I /D p o l y m o r p h i s m 56 5.1 L o c a t i o n and product size o f B 2 - A R P C R primers 64 5.2 B 2 - A R genotype and allele frequencies 68 5.3 L i n k a g e d i sequ i l ib r ium between the B 2 - A R alleles 69 6.1 Ery thropoie t in al lele genotype and frequencies 81 v T w o Q u e c h u a w o m e n i n O l l a n t a y t a m b o , P e r u . v i T h e f o u n d a t i o n s o f t h e g r e a t c i t y o f C u s c o o n c e l a y o n a v a s t , o p e n pampas. A s Inkariy t o i l e d t o b u i l d h i s c i t y , t h e w i n d h o w l e d a n d b l e w a c r o s s t h e p l a i n s , b u f f e t i n g h i m as h e l a b o r e d a n d b l o w i n g o v e r t h e w a l l s as f a s t a s h e c o u l d p u t t h e m up. A n g r y , Inkariy l o c k e d a w a y t h e w i n d s i n a g r e a t c o r r a l . A s h e d i d Inka Qulla, w h o o w n e d t h e w i n d s a p p e a r e d a n d d e m a n d e d t o k n o w w h y h i s w i n d s w e r e l o c k e d a w a y . Inkariy t o l d h i m that, i f h e w a s t o b u i l d h i s c i t y , t h e w i n d s c o u l d n o t b e f r e e . Inka Qulla a g r e e d t o t h i s , b u t o n l y f o r o n e d a y . T h e c u n n i n g Inkariy t h e n t i e d a r o p e a r o u n d t h e s u n a n d k e p t i t f r o m s a i l i n g a c r o s s t h e s k y s o th a t t h e d a y h e b u i l t C u s c o w a s v e r y l o n g i n d e e d . W h e n h e f i n i s h e d , h i s w i s e w i f e t o l d h i m t o r a i s e g r e a t m o u n t a i n s a r o u n d h i s n e w c i t y b e c a u s e , w h e n t h e y w e r e f r e e d , t h e a n g r y w i n d s w o u l d s u r e l y t r y t o k n o c k i t d o w n . Inkariy d i d a n d s o C u s c o , t h e g r e a t c a p i t a l o f t h e I n c a E m p i r e , l i e s h i g h i n t h e m o u n t a i n s , s a f e f r o m t h e w i n d s ' 1 A Quechua tale adapted Andean Lives. (Ricardo Valderrama Fernandez and Carmen Escalante Gutierrez eds., The University of Texas Press, 1996). For the purposes of this thesis it will be assumed that the mountains antecede the people. v i i Acknowledgments F i r s t a n d f o r e m o s t , I w o u l d l i k e t o t h a n k D r . P e t e r H o c h a c h k a . I n h i s c a p a c i t y a s m y Ph.D. s u p e r v i s o r , h i s s u g g e s t i o n s d u r i n g t h e c o n c e p t i o n , e x e c u t i o n , a n a l y s i s a n d p u b l i c a t i o n o f t h e w o r k p r e s e n t e d i n t h i s t h e s i s w e r e i n v a l u a b l e . I n h i s c a p a c i t y as a f r i e n d a n d c o l l e a g u e , h e w a s a c o n s t a n t r e m i n d e r o f h o w m u c h w e k n o w , h o w l i t t l e w e k n o w a n d h o w m u c h f u n s c i e n c e c a n be. I w o u l d a l s o l i k e t o t h a n k my. c o - s u p e r v i s o r , D r . D a n a D e v i n e , w h o i n i t i a l l y s u g g e s t e d th a t I c o n s i d e r fl-fibrinogen as a c a n d i d a t e g e n e a n d e n c o u r a g e d m e to l o o k t o t h e H e a r t a n d S t r o k e F o u n d a t i o n o f C a n a d a f o r s u p p o r t ; a n d D r s . D a v i d J o n e s , L i n d a M a t s u u c h i , J o h n G o s l i n e , D o n M c K e n z i e a n d B i l l M i l s o m , a l l o f w h o m s e r v e d at s o m e p o i n t o n m y s u p e r v i s o r y a n d / o r e x a m i n a t i o n c o m m i t t e e s . F o r t h e i r c o n t r i b u t i o n s to t h i s p r o j e c t , I w o u l d l i k e t o t h a n k D r . V i c k y M o n s a l v e f o r d o i n g m u c h o f t h e w o r k i n v o l v e d i n o b t a i n i n g t h e Q u e c h u a b l o o d s a m p l e s , t o S a r a h B a l d r y f o r m a i n t a i n i n g m y t i s s u e c u l t u r e l i n e s a n d f o r p r e p a r i n g t h e D N A s a n d R N A s tha t w e r e i n t e g r a l t o t h e w o r k p r e s e n t e d i n c h a p t e r 6, t o D r . W e n d y R o b i n s o n f o r s t a t i s t i c a l a d v i c e , t o D r . M a r i a I s s a f o r p a t i e n t l y t e a c h i n g m e h o w to q u a n t i t a t e f i b r i n o g e n ; a n d to D r s . D o n B r o o k s a n d J o h e n J a n s e n f o r a p p a r a t u s a n d a d v i c e r e g a r d i n g v i s c o m e t e r y . A l s o , t h a n k s a r e d u e to o u r P e r u v i a n a s s o c i a t e s , C h a r o T a p i a a n d D r . M a r i a R i v e r a C h i r a , f o r t h e i r a s s i s t a n c e i n a r r a n g i n g t h e b l o o d g a t h e r i n g e x p e d i t i o n t o t h e A n d e a n altiplano. A l l o f t h e U.B.C. d e p a r t m e n t s i n w h i c h I w a s f o r t u n a t e to s p e n d t i m e o v e r t h e l a s t f i v e y e a r s a r e f u l l o f f u n a n d i n t e r e s t i n g p e o p l e , m a n y o f w h o m c o n t r i b u t e d t o b o t h t h e w o r k a n d p l a y th a t c o m p r i s e d m y t e n u r e as a g r a d u a t e student. T h i s l i s t i s l o n g a n d i n c l u d e s , a m o n g o t h e r s , D r s . ( o r D r s . t o b e ) A m a n d a S o u t h w o o d , M a n u e l a G a r d n e r , R u s s A n d r e w s , S h e i l a T h o r n t o n , G a r y B u r n e s s , G r a n t M c C l e l l a n d , K e v i n C a m p b e l l , C h a r l e s D a r v e a u , B e t h Z i m m e r , L o w e l l M c P h a i l , S u s a n S h i n n a n d T h u a n N g u y e n . T h i s p r o j e c t c o u l d n e v e r h a v e b e e n c o m p l e t e d , a n d l i k e l y n e v e r w o u l d h a v e b e e n i n i t i a t e d ( a t l e a s t b y me ) , w i t h o u t t h e s u p p o r t o f m y l e a r n e d a n d e x t r e m e l y c o m p e t e n t w i f e , D r . C a r o l y n B r o w n who, i n u n o f f i c i a l c a p a c i t i e s , s e r v e d v a r i o u s l y as a d v i s o r , assistant, r e v i e w e r , e d i t o r , c r i t i c , p r o o f - r e a d e r , d e - b u n k e r a n d s u p p o r t e r ; a n d w h o w a s a l w a y s w i l l i n g t o t u r n a b l i n d e y e to m y f r e q u e n t u s e o f h e r l a b ( i n c l u d i n g , b u t n o t l i m i t e d to, e q u i p m e n t , p e r s o n n e l , s u p p l i e s a n d r e s o u r c e s ) . L a s t l y , t h a n k s t o N i m u e , w h o p a t i e n t l y s i t t i n g t h r o u g h ( a n d o c c a s i o n a l l y o n ) t h e p r e p a r a t i o n o f y e t a n o t h e r t h e s i s , k e p t m e c o m p a n y d u r i n g t h o s e l a t e n i g h t s e s s i o n s o f c o m p o s i t i o n a n d d e c o m p o s i t i o n . T h i s w o r k w a s s u p p o r t e d b y th e N a t u r a l S c i e n c e a n d E n g i n e e r i n g R e s e a r c h C o u n c i l i n t h e f o r m o f o p e r a t i n g g r a n t s t o P e t e r H o c h a c h k a a n d as a s c h o l a r s h i p t o m y s e l f . I w a s a l s o f o r t u n a t e t o r e c e i v e a H e a r t a n d S t r o k e F o u n d a t i o n o f C a n a d a R e s e a r c h T r a i n e e s h i p o v e r t h e l a s t t w o y e a r s o f m y t e n u r e as a g r a d u a t e student. T o b o t h o f t h e s e o r g a n i z a t i o n s , I w o u l d l i k e to e x t e n d m y t h a n k s f o r t h e i r s u p p o r t . J i m R u p e r t 20/4/00 v m Preface P o r t i o n s o f t h e m a t e r i a l p r e s e n t e d i n t h i s t h e s i s h a v e p r e v i o u s l y b e e n p u b l i s h e d as t h e f o l l o w i n g : R u p e r t , J.L., D e v i n e , D.V., M o n s a l v e , M . V . a n d H o c h a c h k a , P.W. ( 1 9 9 9 ) A n g i o t e n s i n -c o n v e r t i n g e n z y m e ( A C E ) a l l e l e s i n t h e Q u e c h u a , a h i g h a l t i t u d e S o u t h A m e r i c a n n a t i v e p o p u l a t i o n . A n n . H u m a n B i o l . 26 (4) 3 7 5 - 3 8 0 . R u p e r t , J.L., D e v i n e , D.V., M o n s a l v e , M . V . a n d H o c h a c h k a , P.W. ( 1 9 9 9 ) B e t a - f i b r i n o g e n a l l e l e f r e q u e n c i e s i n P e r u v i a n Q u e c h u a , a h i g h - a l t i t u d e n a t i v e p o p u l a t i o n . A m . J. P h y s . A n t h r o p o l . 1 0 9 ( 2 ) : 181-6. R u p e r t , J.L, M o n s a l v e , M.V., D e v i n e , D.V. a n d H o c h a c h k a , P.W. ( 2 0 0 0 ) B e t a 2 - a d r e n e r g i c r e c e p t o r a l l e l e f r e q u e n c i e s i n t h e Q u e c h u a , a h i g h a l t i t u d e n a t i v e p o p u l a t i o n . A n n . H u m . G e n e t . I n p r e s s . T h i s w o r k w a s p e r f o r m e d i n D r . P e t e r H o c h a c h k a ' s l a b i n t h e D e p a r t m e n t o f Z o o l o g y at T h e U n i v e r s i t y o f B r i t i s h C o l u m b i a . D r s . D e v i n e a n d M o n s a l v e ( D e p a r t m e n t o f P a t h o l o g y a n d L a b o r a t o r y M e d i c i n e , U.B.C.) w e r e i n v o l v e d i n t h e p r o c u r e m e n t o f s o m e o f t h e s a m p l e s a n d m a d e c o n c e p t u a l c o n t r i b u t i o n s t o t h e p r o j e c t . E x p e r i m e n t a l d e s i g n a n d e x e c u t i o n a n d as w e l l as d a t a a n a l y s i s a n d m a n u s c r i p t p r e p a r a t i o n w e r e t h e r e s p o n s i b i l i t y o f J i m R u p e r t , a Ph.D. c a n d i d a t e u n d e r t h e s u p e r v i s i o n o f D r . H o c h a c h k a . P e t e r H o c h a c h k a D e p a r t m e n t o f Z o o l o g y U.B.C. 22/4/00 i x Chapter 1 Introduction 1.1 Project overview W h e r e o r d e r i n v a r i e t y w e see, A n d w h e r e , t h o u g h a l l t h i n g s d i f f e r , a l l agree. ( A l e x a n d e r P o p e , 1713) H u m a n b e i n g s h a v e l i v e d o n the h i g h p l a t e a u s o f t h e A n d e s M o u n t a i n s f o r h u n d r e d s o f g e n e r a t i o n s . T h e s t u r d y , b a r r e l c h e s t e d A n d e a n v i l l a g e r h a s b e c o m e a n o f t - c i t e d p a r a d i g m o f the a b i l i t y o f m a n t o a d a p t t o h a r s h a n d s e e m i n g l y i n h o s p i t a b l e e n v i r o n m e n t s . T h e n a t u r e o f t h e s e a d a p t a t i o n s h a s l o n g i n t r i g u e d r e s e a r c h e r s and, o v e r the l a s t c e n t u r y , m u c h h a s b e e n l e a r n e d a b o u t t h e p h y s i o l o g i c a l a n d a n a t o m i c a l c h a r a c t e r i s t i c s o f t h e s e p e o p l e . M u c h o f t h e w o r k ha s f o c u s e d o n a d a p t a t i o n s that s e r v e to m a x i m i s e the u p t a k e a n d u t i l i s a t i o n o f o x y g e n w h i c h , at the a l t i t u d e o f t h e P e r u v i a n altiplano ( 3 2 0 0 - 4 0 0 0 m), i s r e d u c e d b y a t h i r d . O n e i s s u e that o f t e n a r i s e s i n t h e s e s t u d i e s i s w h e t h e r t h e c h a r a c t e r i s t i c c a n b e a c c o u n t e d f o r s o l e l y b y a c c l i m a t o r y o r d e v e l o p m e n t a l r e s p o n s e s w i t h i n a n i n d i v i d u a l o r w h e t h e r it i s i n f l u e n c e d b y g e n e t i c b a c k g r o u n d . H e r i t a b i l i t y s t u d i e s h a v e s h o w n that, i n s o m e case s , e t h n i c h e r i t a g e c o n t r i b u t e s t o t h e a c q u i s i t i o n o f a n a d a p t i v e t r a i t a n d t h u s s u g g e s t that the A n d e a n n a t i v e s , w h o s e a n c e s t o r s f i r s t a s c e n d e d to the h i g h p l a t e a u s m i l l e n n i a ago, h a v e e v o l v e d , at f i r s t p e r h a p s j u s t t o s u r v i v e b u t e v e n t u a l l y to t h r i v e , i n t h e c o l d , t h i n a i r o f t h e altiplano. T h i s p r o j e c t d e s c r i b e s f u r t h e r s t u d i e s i n t o the r o l e o f g e n e t i c s i n h i g h a l t i t u d e a d a p t a t i o n u s i n g a s s o c i a t i o n a n a l y s i s . T h e f r e q u e n c i e s o f v a r i a n t s i n c a n d i d a t e genes, c h o s e n b e c a u s e t h e y p o t e n t i a l l y e f f e c t the u p t a k e , t r a n s p o r t o r u t i l i s a t i o n o f o x y g e n , w e r e c o m p a r e d b e t w e e n h i g h a l t i t u d e a n d l o w a l t i t u d e p o p u l a t i o n s to d e t e r m i n e w h e t h e r a n y o f t h e a l l e l e s w e r e o v e r -r e p r e s e n t e d i n t h e h i g h l a n d e r s . S u c h a c o r r e l a t i o n w o u l d b e c o n s i s t e n t w i t h s e l e c t i o n f a v o u r i n g that p a r t i c u l a r v a r i a n t ( o r o n e to w h i c h it i s t i g h t l y l i n k e d ) i n that p o p u l a t i o n a n d m a y r e f l e c t a d a p t i v e c h a n g e s at the p o p u l a t i o n l e v e l . T h i s is e s s e n t i a l l y a v a r i a t i o n o f m o l e c u l a r a s s o c i a t i o n a n a l y s i s , a m e t h o d o l o g y c o m m o n l y u s e d t o l o o k f o r g e n e t i c c o n t r i b u t i o n s t o t h e a e t i o l o g y o f c o m p l e x d i s e a s e s . 1 E a c h o f t h e f o u r d a t a c h a p t e r s d e s c r i b e s a n i n d e p e n d e n t set o f e x p e r i m e n t s u s i n g s i m i l a r t e c h n i q u e s a n d s a m p l e s b u t a s s a y i n g a l l e l e s o f d i f f e r e n t g e n e s . T h e g e n e s a n d p o l y m o r p h i s m s e x a m i n e d a r e d e s c r i b e d b r i e f l y b e l o w a n d i n d e t a i l i n the e n s u i n g c h a p t e r s . T h e y i n c l u d e : 1) fi-fibrinogen B - f i b r i n o g e n is a c o m p o n e n t o f f i b r i n o g e n , a c o m m o n p l a s m a p r o t e i n that i s t h e p r e c u r s o r t o f i b r i n . T h r e e p o l y m o r p h i s m s w e r e e x a m i n e d i n the B - f i b r i n o g e n gene, a l l o f w h i c h h a d p r e v i o u s l y b e e n s h o w n t o h a v e a l l e l e s a s s o c i a t e d w i t h r e d u c e d f i b r i n o g e n c o n c e n t r a t i o n s . T w o are u p s t r e a m o f t h e c o d i n g s e q u e n c e a n d are b e l i e v e d t o a f f e c t t r a n s c r i p t i o n o f t h e gene; the t h i r d i s a m i s s e n s e m u t a t i o n w i t h i n t h e c o d i n g s e q u e n c e o f t h e gene. It w a s h y p o t h e s i s e d that the a l l e l e s a s s o c i a t e d w i t h i n c r e a s e d l e v e l s o f p r o t e i n w o u l d h a v e b e e n s e l e c t e d a g a i n s t i n t h e Q u e c h u a as f i b r i n o g e n c o n c e n t r a t i o n i s c o r r e l a t e d w i t h p l a s m a v i s c o s i t y a n d i n c r e a s e d v i s c o s i t y m a y e x a c e r b a t e t h e r h e o l o g i c a l a n d p h y s i o l o g i c a l p r o b l e m s a s s o c i a t e d w i t h e l e v a t e d h e m a t o c r i t s . 2) angiotensin converting enzyme (ACE) A C E i s a c o m p o n e n t o f t h e r e n i n - a n g i o t e n s i n s y s t e m that acts p r o t e o l y t i c l y t o c o n v e r t a n g i o t e n s i n 1 i n t o t h e p o t e n t v a s o c o n s t r i c t o r a n g i o t e n s i n 2. T h e l o c u s e x a m i n e d i n t h i s g e n e w a s the c o m m o n l y s t u d i e d Alu i n s e r t i o n / d e l e t i o n p o l y m o r p h i s m i n i n t r o n 16. T h e i n s e r t i o n a l l e l e , w h i c h c o r r e l a t e s w i t h l o w e r A C E l e v e l s , h a s b e e n a s s o c i a t e d w i t h r e d u c e d s u s c e p t i b i l i t y t o c a r d i o v a s c u l a r d i s e a s e , i n c r e a s e d p h y s i c a l p e r f o r m a n c e and, o f p a r t i c u l a r r e l e v a n c e t o t h i s study, h a s b e e n s h o w n t o b e o v e r - r e p r e s e n t e d i n e l i t e B r i t i s h c l i m b e r s . B e c a u s e o f t h i s l a s t o b s e r v a t i o n , a n d b e c a u s e o f its e n h a n c i n g e f f e c t o n m a x i m u m o x y g e n u p t a k e , t h i s a l l e l e w a s p r e d i c t e d to b e o v e r - r e p r e s e n t e d i n the Q u e c h u a . A c o m m o n p o l y m o r p h i s m i n t h e a n g i o t e n s i n 2 r e c e p t o r t y p e 1 g e n e w a s a l s o a s s a y e d b e c a u s e g e n o t y p e at t h i s l o c u s w a s r e p o r t e d t o a f f e c t the p h e n o t y p e o f t h e A C E i n s e r t i o n / d e l e t i o n a l l e l e s . 3) the fi2-adrenergic receptor. T h i s r e c e p t o r i s t h e p r i m a r y p u l m o n a r y c a t e c h o l a m i n e r e c e p t o r a n d i n f l u e n c e s the f l o w o f b o t h a i r a n d b l o o d t h r o u g h the l u n g s . F i v e p o l y m o r p h i s m s w e r e e x a m i n e d i n t h i s gene, a l l o f w h i c h a r e i n t h e c o d i n g s e q u e n c e o f the gene. T h r e e o f th e s e are m i s s e n s e m u t a t i o n s that a l t e r r e c e p t o r s t r u c t u r e a n d h a v e b e e n a s s o c i a t e d w i t h m u l t i p l e p h e n o t y p e s i n c l u d i n g a l t e r e d r e c e p t o r 2 s e n s i t i v i t y , s u s c e p t i b i l i t y t o c o n g e s t i v e h e a r t f a i l u r e a n d b o d y f a t d e p o s i t i o n . A s r e d u c e d b a r o m e t r i c p r e s s u r e i s t h e d e f i n i n g c h a r a c t e r i s t i c o f the h i g h a l t i t u d e e n v i r o n m e n t , a l l e l e s w i t h the p o t e n t i a l t o i n c r e a s e a i r f l o w w e r e h y p o t h e s i s e d t o b e o v e r - r e p r e s e n t e d i n t h e Q u e c h u a . T h e o t h e r t w o p o l y m o r p h i s m s w e r e s i l e n t a n d w e r e a n a l y s e d as p o t e n t i a l m a r k e r s f o r f u n c t i o n a l l o c i . 4) erythropoietin (Epo) and hypoxia inducible factor 1-alpha (HIF-la) E p o i s a r e g u l a t o r y p r o t e i n that i s e s s e n t i a l f o r t h e m a t u r a t i o n o f r e d b l o o d c e l l s . H I F - l a is a c o m p o n e n t o f t h e t r a n s c r i p t i o n a l r e g u l a t o r y f a c t o r H I F - 1 , w h i c h is i n v o l v e d i n o x y g e n -d e p e n d e n t g e n e r e g u l a t i o n . I n c r e a s e d r e d b l o o d c e l l p r o d u c t i o n i s a h a l l m a r k o f h y p o x i a a c c l i m a t i o n a n d m a y ( o r m a y not) p l a y a r o l e i n a d a p t a t i o n . H I F - 1 i s i n v o l v e d i n t h e o x y g e n -m e d i a t e d e x p r e s s i o n o f E p o as w e l l as o t h e r g e n e s . T h e r e w e r e n o r e p o r t s i n t h e l i t e r a t u r e o f f u n c t i o n a l m u t a t i o n s i n e i t h e r o f t h e s e g e n e s i n h u m a n s , a l t h o u g h a d o w n s t r e a m p o l y m o r p h i s m n e a r t h e H I F - 1 b i n d i n g r e g i o n h a d b e e n f o u n d i n E p o . W h i l e t h i s v a r i a n t m a y n o t b e f u n c t i o n a l per se, i t m a y b e a m a r k e r f o r o n e that i s , a n d w a s t h e r e f o r e i n c l u d e d i n t h e a n a l y s i s . B o t h o f t h e s e g e n e s w e r e c o n s i d e r e d t o b e s t r o n g c a n d i d a t e g e n e s f o r a r o l e i n h i g h a l t i t u d e a d a p t a t i o n a n d w e r e t h e r e f o r e s e q u e n c e d i n t h r e e Q u e c h u a i n a s e a r c h f o r p o l y m o r p h i s m s c o m m o n i n that p o p u l a t i o n . S u c h p o l y m o r p h i s m s c o u l d r e p r e s e n t e i t h e r a m p l i f i c a t i o n o f e x t r e m e l y r a r e p o l y m o r p h i s m s that h a d n o t y e t b e e n d e t e c t e d i n o t h e r p o p u l a t i o n s o r v a r i a n t s that h a d a r i s e n i n the a n c e s t r a l Q u e c h u a . G e n o t y p e s w e r e d e t e r m i n e d f o r e a c h p o l y m o r p h i s m and, i n c a s e s w h e r e t h e r e w e r e m u l t i p l e p o l y m o r p h i c l o c i i n t h e s a m e gene, the p o s s i b i l i t y o f the a l l e l e s b e i n g i n l i n k a g e d i s e q u i l i b r i u m w a s a d d r e s s e d . T h e h i g h a l t i t u d e n a t i v e s w h o p a r t i c i p a t e d i n t h i s s t u d y are Q u e c h u a - s p e a k i n g A m e r i n d i a n s o f t h e A n d e a n altiplano. B l o o d a n d b u c c a l s p e c i m e n s c o l l e c t e d f r o m i n f o r m e d v o l u n t e e r s i n r u r a l v i l l a g e s l y i n g b e t w e e n 3 4 0 0 a n d 4 2 0 0 m e t e r s i n the C e n t r a l P e r u v i a n h i g h l a n d s . D N A w a s p r e p a r e d f r o m t h e s e s a m p l e s a n d g e n o t y p e s at t h e p o l y m o r p h i c l o c i d e t e r m i n e d b y p o l y m e r a s e c h a i n r e a c t i o n a m p l i f i c a t i o n , f o l l o w e d b y d i a g n o s t i c r e s t r i c t i o n e n d o n u c l e a s e d i g e s t i o n i f n e c e s s a r y . In a d d i t i o n , f i v e Q u e c h u a d e r i v e d l y m p h o b l a s t c e l l l i n e s w e r e o b t a i n e d f r o m t h e C o r i e l l C e l l R e p o s i t o r y . T h e Q u e c h u a , w h o a r e t h e d e s c e n d a n t s o f the 3 o n c e v a s t I n c a e m p i r e , are b e l i e v e d t o h a v e l i v e d h i g h i n t h e A n d e s f o r o v e r 12,000 ye a r s . T h i s i s s u f f i c i e n t t i m e f o r e v e n a m i n o r s e l e c t i v e a d v a n t a g e c o n f e r r e d b y a n a l l e l e t o m a n i f e s t i t s e l f as a m e a s u r a b l e i n c r e a s e i n f r e q u e n c y i n the e x t a n t p o p u l a t i o n . F o r c o m p a r a t i v e p u r p o s e s , a l l e l e f r e q u e n c i e s w e r e a l s o d e t e r m i n e d i n t w o l o w a l t i t u d e p o p u l a t i o n s : A t h a b a s k a n s p e a k i n g N a - D e n e A m e r i n d i a n s o f t h e C a n a d i a n n o r t h w e s t a n d C a u c a s i a n s o f w e s t e r n E u r o p e a n d e s c e n t . W h i l e t h e s e p o p u l a t i o n s a r e n o t c l o s e l y r e l a t e d t o t h e Q u e c h u a , t h e y s e r v e , a l o n g w i t h p r e v i o u s l y p u b l i s h e d data, t o p r o v i d e s o m e i n d i c a t i o n o f the f r e q u e n c i e s o f t h e s e g e n e t i c v a r i a n t s i n p o p u l a t i o n s t h a t a r e p r e s u m e d n o t t o h a v e a d a p t e d t o l i f e i n h i g h a l t i t u d e e n v i r o n m e n t s . 1.2 Human high altitude adaptation in the Andes R e d u c e d b a r o m e t r i c p r e s s u r e a n d the r e s u l t a n t h y p o x i a ( f i g u r e 1.1) i s o n e o f the f e w u n a l t e r a b l e e n v i r o n m e n t a l s t r e s s e s e n c o u n t e r e d b y h u m a n s d u r i n g t h e c o u r s e o f o u r h i g h l y s u c c e s s f u l e x p a n s i o n a c r o s s t h e f a c e o f the p l a n e t . F l u c t u a t i o n s i n t e m p e r a t u r e , a v a i l a b i l i t y o f w a t e r a n d f o o d , p r e d a t i o n a n d c l i m a t i c e x t r e m e s c o u l d l a r g e l y b e o v e r c o m e b y o u r b u r g e o n i n g t e c h n o l o g y but, b e y o n d s m a l l a n d e x p e n s i v e p r e s s u r e c h a m b e r s , a t m o s p h e r i c p r e s s u r e r e m a i n s b e y o n d o u r c o n t r o l . D e s p i t e t h e i n e v i t a b l e d i s c o m f o r t e x p e r i e n c e d b y m i g r a n t s to h i g h a l t i t u d e , h u m a n s h a v e a d a p t e d t o t h e t h i n a i r a n d as t h e y d i d , s e t t l e m e n t s t h r i v e d on, a n d e v e n t u a l l y e m p i r e s r u l e d , t h e g r e a t p l a t e a u s o f the A n d e s a n d the H i m a l a y a . C u r r e n t l y , a b o u t o n e p e r c e n t o f t h e w o r l d ' s p o p u l a t i o n l i v e s p e r m a n e n t l y b e t w e e n 3 3 0 0 m a n d 4 5 0 0 m ( S a m a j a , 1997). B e y o n d 4 5 0 0 m h y p o x i c stress p r e c l u d e s l o n g t e r m h a b i t a t i o n a l t h o u g h a b o u t 2 6 0 p e o p l e l i v e at b e t w e e n 4 8 5 0 - 5 4 5 0 m i n P h a l a , T i b e t A u t o n o m o u s R e g i o n , P e o p l e s R e p u b l i c o f C h i n a a n d t h e r e a r e m i n i n g c o m m u n i t i e s , s u c h as M o r o c o c h a ( 4 5 4 0 m ) a n d M i n a A q u i l a r ( 4 5 1 5 m ) h i g h i n the A n d e s . T h e r e i s a n e x t e n s i v e b o d y o f l i t e r a t u r e d o c u m e n t i n g the i n v e s t i g a t i o n i n t o h u m a n a d a p t a t i o n t o h i g h a l t i t u d e ( s e e r e v i e w s b y M o n g e a n d L e o n - V e l a r d e , 1991; M o o r e et al, 1994; R a m i r e z et al, 1999). It i s b e y o n d the s c o p e o f t h i s i n t r o d u c t i o n ' t o s u m m a r i z e t h e h u n d r e d s o f p a p e r s t h a t h a v e b e e n p u b l i s h e d s i n c e 1889, w h e n P a u l B e r t f i r s t e n c o u r a g e d F r a n c o i s V i a u l t to m o n i t o r h i s o w n h e m a t o c r i t as h e t r a v e l e d f r o m L i m a , o n t h e c o a s t o f P e r u , to M o r o c o c h a at 4 4 5 4 0 m i n t h e A n d e s m o u n t a i n s . M o s t o f t h e s e s t u d i e s a r e e i t h e r i n A n d e a n n a t i v e s o r i n H i m a l a y a n p o p u l a t i o n s s u c h as t h e S h e r p a o f N e p a l o r T i b e t a n s . T h e r e s e a r c h p o r t i o n o f t h i s t h e s i s c e n t e r s o n t h e Q u e c h u a o f t h e P e r u v i a n altiplano a n d t h e r e f o r e t h i s i n t r o d u c t i o n w i l l f o c u s o n t h e r e s e a r c h d o n e o n A n d e a n p o p u l a t i o n s . T h e p r i m a r y g o a l o f t h i s i n t r o d u c t i o n i s t o p r o v i d e a n o v e r v i e w o f w h a t i s k n o w n a b o u t h i g h a l t i t u d e a d a p t a t i o n i n A n d e a n n a t i v e s w i t h a p a r t i c u l a r e m p h a s i s o n t h e c h a r a c t e r i s t i c s f o r w h i c h t h e r e i s e v i d e n c e o f a g e n e t i c c o n t r i b u t i o n . Figure 1.1. The relationship between altitude and atmospheric pressure. Altitude and atmospheric pressure are shown on the right. Partial pressure of oxygen is shown on the left. The shaded box indicates the range over which high altitude human populations live in the Andes. The asterisk indicates the point above which long term human habitation is considered impossible. Various high points are indicated for reference. 1: Denver, USA (1600 m); 2: Cusco, Peru (home to almost a half million people, 3200 m); 3) Mt. Baker (a perennially snow capped peak visible from U.B.C, 3320 m); 4: The Matterhorn (4480 m); 5: Mt. Logan, highest mountain in Canada (6050 m); 6: Aconcagua, highest mountain in the Andes (6960 m) and 7: Mt. Everest, highest mountain in the world (8848 m). 5 Acclimation, development or adaptation? T h e f l o w o f o x y g e n f r o m the e x t e r n a l e n v i r o n m e n t t h r o u g h t h e b o d y t o its u l t i m a t e d e s t i n a t i o n i n t h e m i t o c h o n d r i a o c c u r s t h r o u g h a s e r i e s o f s t e p w i s e m o v e m e n t s f r o m a r e g i o n o f h i g h e r p a r t i a l p r e s s u r e o f o x y g e n ( P 0 2 ) t o a r e g i o n o f l o w e r P 0 2 . A s t h e p r e s s u r e o f a t m o s p h e r i c o x y g e n i s r e d u c e d , t h e d r i v i n g f o r c e f o r t h i s t r a n s f e r i s c o r r e s p o n d i n g l y d i m i n i s h e d . M o s t o f t h e c h a r a c t e r i s t i c s a s s o c i a t e d w i t h h i g h a l t i t u d e e x i s t e n c e s e r v e t o o v e r c o m e t h i s b y e i t h e r i n c r e a s i n g t h e P 0 2 i n the l u n g s o r b y f a c i l i t a t i n g t h e t r a n s p o r t o f o x y g e n f r o m t h e l u n g s t o t h e t i s s u e s . S o m e o f t h e s e c h a n g e s o c c u r w i t h i n m i n u t e s o f e x p o s u r e w h e r e a s o t h e r s t a k e d a y s o r m o n t h s t o a p p e a r . T h e m o r e p r o f o u n d c h a n g e s s e e m t o r e q u i r e p r o l o n g e d e x p o s u r e d u r i n g d e v e l o p m e n t and, i n s o m e case s , m a y r e p r e s e n t p h y l o g e n e t i c a d a p t a t i o n s c h a r a c t e r i s t i c o f the p o p u l a t i o n . T h e l i t e r a t u r e i s s o m e t i m e s i n c o n s i s t e n t i n t h e t e r m s u s e d to c a t e g o r i z e t h e s e c h a n g e s . F o r t h e p u r p o s e s o f t h i s t h e s i s , a c c l i m a t i o n w i l l r e f e r e x c l u s i v e l y t o t r a n s i e n t , r e v e r s i b l e c h a n g e s w h e r e a s a d a p t a t i o n , i n w h i c h c h a n g e s are p e r m a n e n t , w i l l b e s u b d i v i d e d i n t o d e v e l o p m e n t a l a n d g e n e t i c , the latter r e f e r r i n g t o h e r i t a b l e c h a r a c t e r i s t i c s . O n e o f t e n d i s c u s s e d i s s u e i n h u m a n h i g h a l t i t u d e b i o l o g y i s w h e t h e r t h e r e i s a g e n e t i c c o m p o n e n t t o a d a p t a t i o n o r w h e t h e r a l l o f t h e c h a n g e s m a n i f e s t e d i n t h e h i g h a l t i t u d e n a t i v e c a n b e a c c o u n t e d f o r b y t h e p l a s t i c i t y o f t h e h u m a n p h e n o t y p e . A c c l i m a t i o n o c c u r s i n l o w l a n d e r s t r a v e l i n g to a l t i t u d e a n d d e v e l o p m e n t a l c h a n g e s w i l l o c c u r to s o m e e x t e n t r e g a r d l e s s o f g e n e t i c o r i g i n {e.g. i n c r e a s e d c h e s t d i m e n s i o n s r e p o r t e d i n d e M e e r et al, 1995). P h e n o t y p i c p l a s t i c i t y c a n m e d i a t e t h e e f f e c t s o f s e l e c t i v e p r e s s u r e o n g e n o t y p e . I f a b e n e f i c i a l c h a r a c t e r i s t i c c a n b e a c q u i r e d u p o n e x p o s u r e , t h e n the r e l a t i v e a d v a n t a g e o f b e i n g g e n e t i c a l l y p r e d i s p o s e d to the trait w i l l b e b l u n t e d , t h e e x t e n t o f w h i c h w i l l d e p e n d o n the r e l a t i v e c o s t o f a c q u i r i n g t h e c h a r a c t e r i s t i c . F u r t h e r c o n f o u n d i n g t h i s i s t h e p o s s i b i l i t y that t h e h e r i t a b l e p o t e n t i a l m a y n o t b e f o r the t r a i t per se b u t f o r t h e d e v e l o p m e n t a l a b i l i t y to a c q u i r e the trait. F o r a d i s c u s s i o n o f t h e i n t e r p l a y o f g e n o t y p e a n d p h e n o t y p i c p l a s t i c i t y (see H o c h a c h k a et al, 1999). Pulmonary function and ventilation I n t h e 1920s, J o u r d a n n e t , a n e a r l y r e s e a r c h e r i n t h e A n d e s , d e s c r i b e d h i g h a l t i t u d e 6 n a t i v e s as h a v i n g a " v a s t c h e s t [that] m a k e s h i m c o m f o r t a b l e i n t h e m i d s t o f t h i s t h i n a i r " ( q u o t e d b y H o u s t o n , 1987). T h i s i s o n e o f t h e e a r l i e s t d e s c r i p t i o n s o f w h a t m a y t h e m o s t c o m m o n l y c i t e d c h a r a c t e r i s t i c s o f h i g h a l t i t u d e n a t i v e s : t h e " b a r r e l c h e s t " . H u r t a d o ( 1 9 3 2 ) c o m m e n t e d o n t h i s a n d p o s t u l a t e d that t h e e n l a r g e d c h e s t m i g h t a l l o w f o r i n c r e a s e d l u n g v o l u m e s , t h e r e b y i n c r e a s i n g o x y g e n i n t a k e . N u m e r o u s a n t h r o p o m e t r i c s t u d i e s h a v e b e e n u n d e r t a k e n t o d e t e r m i n e t o w h a t e x t e n t t h i s p u t a t i v e a d a p t a t i o n i s g e n e t i c a l l y d e t e r m i n e d . S e v e r a l t h o r a c i c p a r a m e t e r s w e r e m e a s u r e d i n P e r u v i a n A y m a r a I n d i a n s n a t i v e t o 3,900 m ( K r a m e r , 1992). S t e r n a l l e n g t h , a n t e r i o r - p o s t e r i o r d e p t h a n d c h e s t c i r c u m f e r e n c e h a d h e r i t a b l e c o m p o n e n t s a c c o u n t i n g f o r a p p r o x i m a t e l y 3 0 % o f the v a r i a t i o n o b s e r v e d f o r t h e s e p a r a m e t e r s ( b y c o m p a r i s o n , a b o u t 5 0 % o f t h e v a r i a t i o n i n s t a t u r e w a s s h o w n t o i n h e r i t e d ) . M e l t o n ( 1 9 9 2 ) c o m p a r e d d e v e l o p m e n t i n t w o g r o u p s o f c h i l d r e n o f h i g h a l t i t u d e h e r i t a g e ( a m i x o f A y m a r a a n d Q u e c h u a ) w h o w e r e b o r n i n e i t h e r T a c n a ( 5 6 0 m ) o r P u n a ( 3 9 0 0 m), P e r u . T h e p a r e n t s o f t h e l o w a l t i t u d e c h i l d r e n w e r e r e c e n t m i g r a n t s f r o m P u n a . D e s p i t e h a v i n g b e e n r a i s e d at a r e l a t i v e l o w a l t i t u d e , the T a c n a c h i l d r e n h a d the l e n g t h e n e d s t e r n u m c h a r a c t e r i s t i c o f h i g h a l t i t u d e p o p u l a t i o n s a n d c h e s t s as l a r g e as t h o s e o f the c h i l d r e n r a i s e d at 3 9 0 0 m. T h i s s t u d y i s p a r t i c u l a r l y i n f o r m a t i v e as i t e x a m i n e d a p o p u l a t i o n w i t h i n o n e g e n e r a t i o n o f m o v e m e n t , e l i m i n a t i n g t h e p o s s i b i l i t y o f l o w l a n d a d m i x t u r e . P a r a m e t e r s o f l u n g f u n c t i o n s u c h as f o r c e d v i t a l c a p a c i t y ( F V C ) a r e c o r r e l a t e d w i t h t h o r a c i c d i m e n s i o n s ( W h i t t a k e r , 1992). I n a n e x t e n s i v e s t u d y o f l u n g f u n c t i o n , M u e l l e r et al, ( 1 9 7 8 ) c o m p a r e d l u n g f u n c t i o n i n A y m a r a , n o n - A y m a r a a n d M e s t i z o ( m i x e d ) n a t i v e s l i v i n g at t h r e e a l t i t u d e r a n g e s ( c o a s t a l , 2 5 0 0 - 3 5 0 0 m a n d 4 0 0 0 - 4 5 0 0 m) i n t h e D e p a r t m e n t o f A r i c a i n C h i l e . T h e y c o n c l u d e d that, w h i l e a l t i t u d e o f r e s i d e n c e c l e a r l y a f f e c t e d l u n g f u n c t i o n , the r o l e o f e t h n i c i t y w a s u n c l e a r . I n m a l e c h i l d r e n l i v i n g at 4 0 0 0 m, A y m a r a h a d s i g n i f i c a n t l y h i g h e r v a l u e s t h a n d i d M e s t i z o s ; h o w e v e r ; the o p p o s i t e w a s s e e n i n f e m a l e c h i l d r e n . I n a d u l t s , t h e r e w a s e v i d e n c e f o r e t h n i c e f f e c t s b u t a g a i n the e f f e c t w a s g e n d e r d e p e n d e n t w i t h s i g n i f i c a n c e n o t s e e n i n m a l e s . D e s p i t e t h e a m b i g u i t y o f the data, the a u t h o r s c o n c l u d e d that e t h n i c i t y w a s i m p o r t a n t i n a d u l t l u n g f u n c t i o n v a r i a t i o n i n t h e A y m a r a a l t h o u g h t h i s e f f e c t w a s s e c o n d a r y t o t h e d e v e l o p m e n t a l e f f e c t s o f l o n g t e r m h y p o x i c e x p o s u r e . I n t h e s a m e p o p u l a t i o n , ( G r e k s a et al, 7 1988) s h o w e d that A y m a r a c h i l d r e n h a d a g r e a t e r f o r c e d v i t a l c a p a c i t y ( r e l a t i v e to stature) t h a n d i d E u r o p e a n c h i l d r e n r a i s e d at t h e s a m e a l t i t u d e ( 3 8 0 0 m). A l t h o u g h t h e s e s t u d i e s s u p p o r t t h e h y p o t h e s i s that g e n e t i c h e r i t a g e c o n t r i b u t e s t o e n h a n c e d l u n g d e v e l o p m e n t i n h i g h a l t i t u d e n a t i v e s , o t h e r s d o not. F o r e x a m p l e , F r i s a n c h o ( 1 9 7 5 ) r e p o r t e d that s e a l e v e l n a t i v e s w h o h a d a c c l i m a t e d t o a l t i t u d e d u r i n g g r o w t h d e v e l o p e d f o r c e d v i t a l c a p a c i t i e s ( a d j u s t e d f o r stature) e q u a l t o t h o s e o f h i g h a l t i t u d e n a t i v e s . I n a s t u d y s p e c i f i c a l l y d e s i g n e d t o test w h e t h e r t h e r e w a s g e n e t i c c o n t r i b u t i o n t o l u n g c a p a c i t y i n t h e A y m a r a , G r e k s a et al, ( 1 9 9 6 ) u s e d s k i n r e f l e c t a n c e as a n i n d i r e c t m e a s u r e o f g e n e t i c c o m p o s i t i o n . S k i n r e f l e c t a n c e i s h i g h l y h e r i t a b l e a n d i s u s e f u l i n e s t i m a t i n g t h e d e g r e e o f a d m i x t u r e b e t w e e n t w o p o p u l a t i o n s , e s p e c i a l l y w h e n t h e y s t r o n g l y d i f f e r i n c o m p l e x i o n . I n the c a s e o f A y m a r a a n d E u r o p e a n s , t h e d a r k e r the s k i n , t h e g r e a t e r t h e A y m a r a c o n t r i b u t i o n t o the a d m i x t u r e ( G r e k s a , 1992). T h e r e s u l t s o f t h e 1 9 9 6 s t u d y s h o w a s i g n i f i c a n t a s s o c i a t i o n b e t w e e n s k i n c o l o u r a n d t o t a l l u n g c a p a c i t y l e a v i n g the a u t h o r s t o c o n c l u d e that, w h i l e e n v i r o n m e n t a l f o r c e s c o n t r i b u t e d t o e n h a n c e d l u n g c a p a c i t y i n the A y m a r a , g e n e t i c f a c t o r s a l s o i n f l u e n c e the d e v e l o p m e n t o f t h i s c h a r a c t e r i s t i c . Performance M a x i m u m ra t e o f o x y g e n c o n s u m p t i o n ( V 0 2 m a x ) i s a n i n d i c a t o r o f a e r o b i c c a p a c i t y a n d i s a s t r o n g i n d e x o f c a p a c i t y f o r s u s t a i n e d w o r k . T h e V 0 2 m a x f o r " a v e r a g e " m a l e s i s a b o u t 4 5 m l kg" 1 min" 1 a l t h o u g h v a l u e s c a n e x c e e d 9 0 m l k g ' m i n " 1 i n e l i t e e n d u r a n c e a t h l e t e s ( N e w s h o l m e et al, 1994). A l t h o u g h V 0 2 m a x v a l u e s v a r y c o n s i d e r a b l y w i t h a g e a n d t r a i n i n g , s e v e r a l r e s e a r c h e r s h a v e d e m o n s t r a t e d a h e r i t a b l e c o m p o n e n t c o n t r i b u t i n g t o t h i s i m p o r t a n t p h y s i o l o g i c a l p a r a m e t e r ( B o u c h a r d et al, 1 9 9 8 ) . V 0 2 m a x d r o p s w i t h e x p o s u r e t o a l t i t u d e at a r a t e o f a b o u t 1 0 % p e r 1 0 0 0 m a s c e n d e d b e y o n d 1 5 0 0 m ( D u a a n d S e n G u p t a , 1980) a n d r e m a i n s d e p r e s s e d e v e n a f t e r y e a r s o f e x p o s u r e . T h i s r e d u c t i o n i n f i t n e s s i s l e s s p r o n o u n c e d i n h i g h a l t i t u d e n a t i v e s . I n 1969, B a k e r a s s e s s e d V 0 2 m a x v a l u e s i n Q u e c h u a s t u d e n t s a n d age/sex m a t c h e d " w h i t e " s t u d e n t s . B o t h g r o u p s h a d l i v e d a l l o f t h e i r l i v e s at 3 8 3 0 m. A v e r a g e V 0 2 m a x ( i n m l k g ^ m i n " 1 ) w a s a b o u t 1 0 % h i g h e r i n t h e Q u e c h u a t h a n i n t h e C a u c a s i a n s . I n t h e s a m e s t u d y , V 0 2 m a x v a l u e s m e a s u r e d 8 i n Q u e c h u a n a t i v e t o 4 0 0 0 m w e r e c l o s e t o t h o s e o f " r e a s o n a b l y f i t w h i t e r e s e a r c h e r s " (49.1 m l kg' 1min" 1 vs. 50.4 m l k g ' m i n " 1 ) w h e n th e l a t t e r w e r e at s e a l e v e l a n d m u c h h i g h e r w h e n the C a u c a s i a n s w e r e at 4 0 0 0 m (49.1 m l k g ' m i n " 1 vs. 38.1 m l k g ' m i n " 1 ) . T h e a u t h o r c o n c l u d e d t h a t t h e " Q u e c h u a h e r i t a g e c o n f e r s a s p e c i a l c a p a c i t y f o r o x y g e n c o n s u m p t i o n at 4 0 0 0 m e t e r s " . T h i s c a p a c i t y s e e m s to b e m a i n t a i n e d e v e n a f t e r s i x w e e k s o f d e a c c l i m a t i o n at s e a l e v e l s u g g e s t i n g that i t i s e i t h e r d e v e l o p m e n t a l l y o r g e n e t i c a l l y i n f l u e n c e d ( H o c h a c h k a et al, 1991). A d d i t i o n a l e v i d e n c e f o r a g e n e t i c c o m p o n e n t to s u p e r i o r p h y s i c a l p e r f o r m a n c e at a l t i t u d e c o m e s f r o m s t u d i e s o f Q u e c h u a , b o r n o r r a i s e d at s e a l e v e l , w h o w e r e t r a n s p o r t e d t o h i g h a l t i t u d e ( 4 0 0 0 m). T h e r e s u l t a n t r e d u c t i o n i n V 0 2 m a x w a s l e s s t h a n h a l f o f that e x p e r i e n c e d b y C a u c a s i a n s e x p o s e d t o t h e s a m e c o n d i t i o n s ( B u s k i r k , 1976). A v a r i a n t i n t h e g e n e e n c o d i n g a n g i o t e n s i n c o n v e r t i n g e n z y m e ( A C E ) h a s b e e n r e p o r t e d to b e a s s o c i a t e d w i t h i n c r e a s e d V 0 2 m a x a n d w i t h p h y s i c a l p e r f o r m a n c e at e x t r e m e a l t i t u d e . T h e p o t e n t i a l r o l e o f t h i s g e n e i n a l t i t u d e a d a p t a t i o n a n d t h e f r e q u e n c y o f t h e s o c a l l e d " p e r f o r m a n c e " a l l e l e i n t h e Q u e c h u a a r e d i s c u s s e d i n c h a p t e r 4. Ventilation E x p o s u r e t o r e d u c e d o x y g e n a v a i l a b i l i t y t r i g g e r s a n i n c r e a s e i n v e n t i l a t i o n . I n s e a l e v e l n a t i v e s t r a n s l o c a t e d to 3 5 0 0 m, t o t a l v e n t i l a t i o n i n c r e a s e d b y - 4 0 % o v e r t h e f i r s t t w o w e e k s at a l t i t u d e , p r i m a r i l y d u e t o a n i n c r e a s e i n v e n t i l a t o r y rate ( C h i o d i , 1950). T h e s a m e s t u d y f o u n d that v e n t i l a t i o n w a s a b o u t 1 0 % g r e a t e r i n l o n g t e r m n o n - n a t i v e r e s i d e n t s . T h e i n i t i a l v e n t i l a t o r y r e s p o n s e t o h y p o x i a i s m e d i a t e d b y t h e c a r o t i d a n d a o r t i c b o d i e s , w h i c h d e t e c t the r e s u l t i n g d r o p i n b l o o d o x y g e n c o n t e n t a n d s i g n a l the r e s p i r a t o r y c o n t r o l c e n t e r i n t h e m e d u l l a t o i n c r e a s e rate o f i n s p i r a t i o n . P r o l o n g e d e x p o s u r e t o h y p o b a r i c c o n d i t i o n s a p p e a r s t o b l u n t t h e h y p o x i c v e n t i l a t o r y r e s p o n s e ( H V R ) t o f u r t h e r h y p o x i a i n s o m e p o p u l a t i o n s , r e s u l t i n g i n a r e l a t i v e h y p o v e n t i l a t i o n c o m p a r e d t o s e a l e v e l n a t i v e s u n d e r the s a m e c o n d i t i o n s ( C h i o d i , 1957). T h i s p h e n o m e n a i s m o r e p r o n o u n c e d i n A n d e a n s t h a n i n H i m a l a y a n p o p u l a t i o n s ( M o o r e et al, 1992) a n d s o m e r e s e a r c h e r s h a v e p o s t u l a t e d that t h i s i s e v i d e n c e f o r s u p e r i o r a d a p t a t i o n i n t h e h i g h a l t i t u d e p o p u l a t i o n s i n T i b e t {e.g. B e a l l et al, 1997; M o o r e et al, 1992). 9 A b l u n t e d h y p o x i c r e s p o n s e m a y b e m a l a d a p t i v e . H y p o v e n t i l a t i o n c a n l e a d to l o w a r t e r i a l 0 2 p r e s s u r e ( P a 0 2 ) that w i l l , i n t u r n , s t i m u l a t e e r y t h r o p o i e s i s . W h i l e t h e r e s u l t a n t i n c r e a s e i n h e m a t o c r i t ( % p a c k e d c e l l v o l u m e o f b l o o d ) m a y f a c i l i t a t e o x y g e n t r a n s p o r t , t h e c o n c o m i t a n t i n c r e a s e i n b l o o d v i s c o s i t y i n t e r f e r e s w i t h b l o o d f l o w a n d c a n c o n t r i b u t e t o h y p e r t e n s i o n a n d o t h e r m e d i c a l c o m p l i c a t i o n s ( D i n t i n f a s s , 1981). T h e p o t e n t i a l b e n e f i t s o f r e d u c i n g f a c t o r s o t h e r t h a n h e m a t o c r i t that c o n t r i b u t e t o b l o o d v i s c o s i t y i n h i g h a l t i t u d e p o p u l a t i o n s are d i s c u s s e d i n c h a p t e r 3. T w i n s t u d i e s h a v e d e m o n s t r a t e d that t h e r e are h e r i t a b l e a s p e c t s o f the v e n t i l a t o r y r e s p o n s e t o r e d u c e d 0 2 . A s i g n i f i c a n t c o r r e l a t i o n w a s r e p o r t e d f o r t h e r e s p i r a t o r y r e s p o n s e to r e d u c e d 0 2 ( b u t n o t i n c r e a s e d C O z ) i n m o n o z y g o t i c t w i n s that w a s a b s e n t i n s e x m a t c h e d d i z y g o t i c t w i n s ( C o l l i n s et al., 1978). I n a c o m p a r a t i v e s t u d y o f h i g h a l t i t u d e n a t i v e s f r o m t h e H i m a l a y a s ( T i b e t a n ) a n d the A n d e s ( A y m a r a ) , B e a l l et al, 1997 r e p o r t e d that t h e r e w a s a h e r i t a b l e c o n t r i b u t i o n t o H V R v a r i a n c e i n the A y m a r a (21 % ) b u t n o t i n t h e i r r e s t i n g v e n t i l a t o r y rate. In c o n t r a s t , b o t h p a r a m e t e r s w e r e g e n e t i c a l l y i n f l u e n c e d i n the H i m a l a y a n s . H e r i t a b l e f a c t o r s a c c o u n t e d f o r 3 5 % o f t h e v a r i a n c e i n r e s t i n g v e n t i l a t o r y rate ( w h i c h w a s 5 0 % h i g h e r t h a n that o f t h e A y m a r a ) a n d 3 1 % o f that i n H V R . A s h e r i t a b i l i t y i s r e q u i r e d f o r p h y l o g e n e t i c c h a n g e , the a u t h o r s c o n c l u d e that t h e r e is m o r e p o t e n t i a l f o r e v o l u t i o n to m o d i f y t h e s e c h a r a c t e r i s t i c s i n T i b e t a n s t h a n i n t h e A n d e a n s . V e n t i l a t o r y r e s p o n s e t o a c u t e h y p o x i a w a s c o m p a r e d i n A y m a r a n e o n a t e s (< 5 d.o.) a n d w a s s i m i l a r t o that o f l o w l a n d b a b i e s ( p r i m a r i l y m e s t i z o ) . N o s u b s t a n t i a l d i f f e r e n c e w a s r e p o r t e d b e t w e e n h i g h l a n d e r s a n d l o w l a n d e r s u n t i l m i d - c h i l d h o o d ( 1 2 y.o) ( L a h i r i etal., 1976) s u g g e s t i n g that t h e r e i s a s i g n i f i c a n t d e v e l o p m e n t a l e f f e c t . Pulmonary diffusion O n c e i n t o t h e l u n g s , o x y g e n p a s s e s f r o m the a l v e o l i t o t h e b l o o d b y p a s s i v e d i f f u s i o n a c r o s s t h e p u l m o n a r y - v a s c u l a t u r e i n t e r f a c e . T h i s f l o w c a n b e d e f i n e d b y t h e F i c k e q u a t i o n as: V 0 2 = G L 0 2 ( P A 0 2 - P a 0 2 ) 10 w h e r e V 0 2 i s t h e f l o w , G L 0 2 i s t h e d i f f u s i n g c a p a c i t y a n d ( P A 0 2 - P a 0 2 ) i s t h e p a r t i a l p r e s s u r e d i f f e r e n t i a l b e t w e e n t h e l u n g s a n d t h e b l o o d . W h e n th e l a t t e r i s r e d u c e d d u e t o a l o w e r a t m o s p h e r i c P 0 2 , t h e f l o w c a n m a i n t a i n e d b y i n c r e a s i n g t h e d i f f u s i o n c a p a c i t y . B y d e t e r m i n i n g t h e d i f f u s i o n rate f o r c a r b o n m o n o x i d e ( C O ) , V i n c e n t et al, ( 1 9 7 8 ) d e m o n s t r a t e d t h a t d i f f u s i o n w a s h i g h e r a c r o s s a r a n g e o f i n s p i r e d P 0 2 v a l u e s i n h i g h a l t i t u d e n a t i v e s c o m p a r e d t o a c c l i m a t i z e d s e a l e v e l n a t i v e s d u e t o a n i n c r e a s e d m e m b r a n e d i f f u s i n g c o m p o n e n t . I n a s t u d y o f Q u e c h u a n a t i v e s e x e r c i s i n g at v e r y h i g h a l t i t u d e ( 6 0 0 0 m), S c h o e n e et al(1990), s h o w e d that s u b j e c t s m a i n t a i n e d a r e l a t i v e l y h i g h l e v e l o f b l o o d o x y g e n s a t u r a t i o n d e s p i t e t h e l o w P A 0 2 / P a 0 2 r a t i o . T h e v e n t i l a t o r y r e s p o n s e w a s s i m i l a r t o s e a l e v e l n a t i v e s e x p o s e d t o s i m i l a r c o n d i t i o n s h o w e v e r c a r b o n m o n o x i d e d i f f u s i o n rates w e r e s i g n i f i c a n t l y h i g h e r a n d the a u t h o r s c o n c l u d e d t h a t t h e A n d e a n n a t i v e s h a d a n i n c r e a s e d p u l m o n a r y d i f f u s i n g c a p a c i t y f o r o x y g e n . Hematocrit and erythropoiesis O x y g e n i s t r a n s p o r t e d t h r o u g h t h e b l o o d s t r e a m b o u n d t o h e m o g l o b i n p a c k a g e d i n c i r c u l a t i n g e r y t h r o c y t e s , o r r e d b l o o d c e l l s ( R B C s ) . B o t h t h e b l o o d h e m o g l o b i n c o n c e n t r a t i o n a n d t h e p e r c e n t a g e o f t h e b l o o d v o l u m e o c c u p i e d b y R B C s ( h e m a t o c r i t ) a r e e l e v a t e d f o l l o w i n g e x p o s u r e t o h i g h a l t i t u d e . D u r i n g the i n i t i a l a c c l i m a t o r y r e s p o n s e , h e m a t o c r i t s w i l l c l i m b f r o m t h e a v e r a g e ( m a l e ) o f a b o u t 4 4 % t o o v e r 5 0 % i n a b o u t 2 0 d a y s ( H a n n o n et al, 1969). T h i s i s d u e t o i n c r e a s e d r e l e a s e o f e r y t h r o p o i e t i n ( E p o ) b y the k i d n e y i n r e s p o n s e to t h e r e d u c t i o n i n P a 0 2 . E p o i s a g l y c o p r o t e i n h o r m o n e that a c c e l e r a t e s r e d c e l l m a t u r a t i o n . A s a c c l i m a t i o n c o n t i n u e s t o i m p r o v e o x y g e n d e l i v e r y , t h e P a 0 2 b e g i n s to r i s e , i n h i b i t i n g E p o s y n t h e s i s a n d t h e r e f o r e l i m i t i n g f u r t h e r e r y t h r o c y t e p r o l i f e r a t i o n . H o w e v e r , as t h e l i f e s p a n o f a R B C i s a b o u t 1 2 0 d a y s , t h e e f f e c t s o f h y p e r b a r i c e x p o s u r e c a n b e e v i d e n t l o n g a f t e r a r e t u r n t o n o r m o x i a . T h i s p h e n o m e n a i s s o m e t i m e s e x p l o i t e d b y a t h l e t e s who, w i t h the h o p e o f i n c r e a s i n g t h e i r o x y g e n c a r r y i n g c a p a c i t y , s l e e p at a l t i t u d e w h i l e t r a i n i n g at s e a l e v e l ( B a i l e y a n d D a v i e s , 1997). N u m e r o u s m e a s u r e m e n t s o f h e m a t o c r i t s and/or h e m o g l o b i n c o n c e n t r a t i o n s h a v e b e e n m a d e i n h i g h a l t i t u d e p o p u l a t i o n s ( t a b l e 1.1, f i g u r e 1.2). A n i n i t i a l i m p r e s s i o n is that h i g h a l t i t u d e p o p u l a t i o n s h a v e e l e v a t e d h e m a t o c r i t s ( p o l y c y t h e m i a ) , as d o a c c l i m a t e d l o w l a n d e r s . 11 W h i l e p o l y c y t h e m i a m a y i n c r e a s e t h e o x y g e n c a r r y i n g c a p a c i t y o f t h e b l o o d , i t a l s o i n c r e a s e s b l o o d v i s c o s i t y ( D i n t i n f a s s , 1985). I n c r e a s e d v i s c o s i t y i m p e d e s b l o o d f l o w a n d h a s b e e n i m p l i c a t e d i n t h e d e v e l o p m e n t o f h y p e r t e n s i o n , c a r d i o v a s c u l a r d i s e a s e a n d c a n c e r ( D i n t i n f a s s , 1 981). E x c e s s i v e p o l y c y t h e m i a i s t h e b a s i s o f c h r o n i c m o u n t a i n s i c k n e s s ( M o n g e ' s d i s e a s e ) , w h i c h h a s b e e n d e s c r i b e d as the l o s s o f a d a p t a t i o n t o h i g h a l t i t u d e ( M o n g e a n d L e o n - V e l a r d e , 1 9 9 1 ) . Table 1.1. Hematocrits in Andean native populations. A summary of values reported for Quechua and Aymara populations living at various altitudes. A l t i t u d e ( m ) h e m a t o c r i t (%) S e x P o p u l a t i o n L o c a t i o n R e f . 4 5 0 38.1 M , F A y m a r a A z a p a , C h i l e 1 4 5 0 42.1 M Q u e c h u a S a n t a C r u z , B o l i v i a 2 4 5 0 41.6 M A y m a r a S a n t a C r u z , B o l i v i a • 2 5 5 0 41.0 M , F A y m a r a L l u t a , C h i l e 1 3 2 0 0 45.6 M , F A y m a r a T i g n a m a r , C h i l e 1 3 6 0 0 50.5 M Q u e c h u a L a P a z , B o l i v i a 2 3 6 0 0 52.0 M A y m a r a L a P a z , B o l i v i a 2 3 7 0 0 43.3 F Q u e c h u a C e n t r a l P e r u 3 3 7 0 0 45.7 M Q u e c h u a C e n t r a l P e r u 3 3 7 0 0 52.2 M Q u e c h u a O l l a g u e , C h i l e 4 4 0 0 0 53.1 M Q u e c h u a N u f i o a , P e r u 5 4 1 0 0 49.9 M , F A y m a r a V i s v i r i , C h i l e 1 4 2 0 0 51.4 M Q u e c h u a N u f i o a , P e r u 5 4 2 6 0 51.8 M , F A y m a r a G u a l l a t i r a , C h i l e 1 4 3 5 5 52.9 M A y m a r a N o r t h e r n C h i l e * * 6 4 3 5 5 50.6 F A y m a r a N o r t h e r n C h i l e * * 6 4 4 0 0 53.1 M Q u e c h u a M a c u s a n i , P e r u 7 4 4 6 0 54.3 M , F A y m a r a P a r i n a c o t a , C h i l e 1 4 5 0 0 59.5 M * M i n a A g u i l a r , A r g . 8 4 5 4 0 59.5 M Q u e c h u a M o r o c o c h a , P e r u 9 4 5 4 0 71.1 M " I n d i a n " M o r o c o c h a , P e r u 10 4 6 0 0 54.3 M , F A y m a r a C a q u e n a , C h i l e 1 Data is presented graphically in figure 1.2. * referred to only as "high altitude natives" ** average for four villages References: 1) Clench et al, (1982); 2) Arnaud et al, (1985); 3) Rupert, this study; 4) Winslow and Monge (1987); 5) Garruto (1976); 6) Chakraborty et ai, (1983); 7) Garruto and Dutt (1983); 8) Chiodi (1950); 9) in Heath and Williams (1995) and 10) Hurtado (1932). 12 T h i s c o n d i t i o n p r i m a r i l y a r i s e s i n A n d e a n m a l e s a n d i s c h a r a c t e r i z e d b y a n e l e v a t e d h e m a t o c r i t that i n e x t r e m e c a s e s c a n e x c e e d 7 0 % . S u f f e r e r s c o m p l a i n o f a v a r i e t y o f p h y s i c a l s y m p t o m s i n c l u d i n g d y s p n e a , i n s o m n i a , d i z z i n e s s a n d h e a d a c h e s as w e l l as i m p a i r e d m e n t a l f a c u l t i e s ( W i n s l o w a n d M o n g e , 1987). C o n g e s t i v e h e a r t f a i l u r e c a n d e v e l o p i n o l d e r p a t i e n t s . T r e a t m e n t c a n i n v o l v e p h l e b o t o m y b u t u s u a l l y r e q u i r e s that the a f f e c t e d i n d i v i d u a l m o v e to l o w e r a l t i t u d e s . S e v e r a l s t u d i e s o n h i g h a l t i t u d e n a t i v e s h a v e r e p o r t e d v e r y h i g h h e m a t o c r i t s ( t a b l e 1.1; f i g u r e 1.2) a n d s o m e r e s e a r c h e r s b e l i e v e that v a l u e s t h i s h i g h n o l o n g e r r e p r e s e n t a n a d a p t i v e r e s p o n s e b u t r a t h e r a r e a p a t h o l o g i c a l m a n i f e s t a t i o n o f h y p o x i c stress e x a c e r b a t e d b y l i f e s t y l e a n d e n v i r o n m e n t . B a l l e w et al, ( 1 9 8 9 ) p o i n t o u t s e v e r a l f a c t o r s that m a y h a v e m i s l e a d r e s e a r c h e r s i n t o c o n c l u d i n g that v e r y h i g h h e m a t o c r i t s a r e a c h a r a c t e r i s t i c o f h i g h a l t i t u d e p o p u l a t i o n s : 1) m a n y s t u d i e s are d o n e i n m i n i n g c e n t e r s w h i c h t e n d t o b e p o p u l a t e d b y t r a n s i e n t w o r k e r s , o f t e n f r o m l o w e r a l t i t u d e s ; 2) s m o k i n g a n d c h r o n i c r e s p i r a t o r y d i s e a s e s , b o t h o f w h i c h r e d u c e P a 0 2 a n d c o n t r i b u t e t o i n c r e a s e d h e m a t o c r i t s , are c o m m o n i n u r b a n c e n t e r s s u c h as C u s c o a n d L a P a z a n d m a y i n f l u e n c e v a l u e s m e a s u r e d i n p e o p l e w h o w o r k o r l i v e c l o s e i n t h e s e v i c i n i t i e s . H e m a t o c r i t s t a k e n i n t r a d i t i o n a l , a g r o p a s t o r a l i s t c o m m u n i t i e s , b o t h A n d e a n a n d H i m a l a y a n , a r e n o t s u b s t a n t i a l l y h i g h e r t h a n l o w a l t i t u d e p o p u l a t i o n s ( B a l l e w et al, 1989) s u g g e s t i n g that p o l y c y t h e m i a m a y n o t b e a n i n e v i t a b l e r e s u l t o f p r o l o n g e d a l t i t u d e e x p o s u r e . It is l i k e l y that i t i s a t r e n d t o w a r d s e a l e v e l h e m a t o c r i t v a l u e s , d e s p i t e l i v i n g i n h y p o x i c c o n d i t i o n s , that r e f l e c t s a d a p t a t i o n . T h e p o s s i b l e r o l e o f v a r i a n t s i n g e n e s i n v o l v e d i n the e r y t h r o p o i e t i c r e s p o n s e t o h y p o x i a i s d i s c u s s e d i n c h a p t e r 6. O t h e r r e d b l o o d c e l l i n d i c e s i n Q u e c h u a l i v i n g at 4 0 0 0 - 4 4 0 0 m ( i n c l u d i n g m e a n c o r p u s c u l a r v o l u m e ( M C V ) , m e a n c o r p u s c u l a r h e m o g l o b i n c o n t e n t ( M C H ) a n d m e a n c o r p u s c u l a r h e m o g l o b i n c o n c e n t r a t i o n ( M C H C ) ) h a v e b e e n s h o w n t o b e c o n s i s t e n t w i t h s e a l e v e l s t a n d a r d s ( G a r r u t o , 1976). T h i s d i f f e r s f r o m h i g h a l t i t u d e a n i m a l s s u c h as l l a m a s a n d v i c u n a s t h a t h a v e a l o w M C V a n d M C H (the r e s u l t a n t M C H C r e m a i n s c l o s e t o t h a t o f h u m a n s ) ( H e a t h a n d W i l l i a m s , 1995). T h e s e a n i m a l s h a v e a l o w h e m a t o c r i t ( % p a c k e d c e l l v o l u m e ) b u t a h i g h R B C c o u n t . T h i s a l l o w s a g r e a t e r s u r f a c e a r e a f o r o x y g e n e x c h a n g e w i t h o u t t h e v i s c o s i t y 13 p r o b l e m s i n h e r e n t w i t h h i g h h e m a t o c r i t s . C u r i o u s l y , t h i s o s t e n s i b l e a d a p t a t i o n a p p e a r s t o b e a p r i m i t i v e f e a t u r e o f t h e c a m i l i d f a m i l y a n d n o t a n e v o l u t i o n a r y c h a n g e i n t h e i r h i g h a l t i t u d e r e l a t i v e s . H i g h 0 2 a f f i n i t y h e m o g l o b i n v a r i a n t s h a v e b e e n r e p o r t e d i n s o m e h y p o x i a - a d a p t e d a n i m a l s s u c h as B a r - h e a d e d g e e s e ( l e s s e n et al, 1991); h o w e v e r , w h i l e s i m i l a r h u m a n v a r i a n t s d o e x i s t (e.g. H b A n d r e w M i n n e a p o l i s ; H e b b e l et al, 1978), t h e r e is n o e v i d e n c e that t h e y are c o m m o n i n h i g h a l t i t u d e h u m a n n a t i v e s . 8 0 n 7 0 A t60 ho-D 4 0 J 3 0 r > • f e m a l e —' m a l e 0 1 0 0 0 2 0 0 0 . 3 0 0 0 A l t i t u d e ( m ) 1 1 1 4 0 0 0 5 0 0 0 Figure 1.2. Hematocrits in Andean native populations. This is a graphic depiction of the published data summarized in table 1.1. Solid squares are male, solid circles are female and open squares are mixed male and female. Standard sea level values (Thomas, 1993) for males and females are indicated by dashed lines and the corresponding range is bracketed. Metabolism and fuel preference O x y g e n i s r e q u i r e d t o s u s t a i n m e t a b o l i c p r o c e s s e s . M o s t o f t h e a f o r e m e n t i o n e d a d a p t a t i o n s a l l e v i a t e t h e e f f e c t s o f r e d u c e d o x y g e n a v a i l a b i l i t y b y i m p r o v i n g t h e e f f i c a c y o f its u p t a k e . A n o t h e r p o s s i b l e r e s p o n s e i s t o r e d u c e o x y g e n r e q u i r e m e n t s . M o s t p e o p l e t r a v e l i n g t o h i g h a l t i t u d e a r e a d v i s e d to r e s t a n d r e f r a i n f r o m e x e r t i n g t h e m s e l v e s f o r a c o u p l e o f d a y s , t h e r e b y r e d u c i n g t h e m e t a b o l i c d e m a n d f o r o x y g e n w h i l e t h e y a c c l i m a t e . S t u d i e s o f f u e l c o n s u m p t i o n s u g g e s t t h a t t h e b r a i n , w h i c h is h i g h l y h y p o x i a s e n s i t i v e , m a i n t a i n s a s i g n i f i c a n t l y l o w e r m e t a b o l i c rate i n h i g h a l t i t u d e n a t i v e s c o m p a r e d w i t h s e a l e v e l n a t i v e s ( H o c h a c h k a et al, 14 1994). T h i s c o n s t i t u t i v e h y p o m e t a b o l i s m i s m a i n t a i n e d f o r w e e k s a f t e r e x p o s u r e t o s e a l e v e l o x y g e n l e v e l s s u g g e s t i n g that i t m a y b e i n f l u e n c e d b y e i t h e r d e v e l o p m e n t a l o r g e n e t i c f a c t o r s . It i s a l s o p o s s i b l e t o m i n i m i z e the i m p a c t o f r e d u c e d o x y g e n a v a i l a b i l i t y b y p r e f e r e n t i a l l y u t i l i z i n g f u e l s w i t h a h i g h e r A T P y i e l d p e r o x y g e n c o n s u m e d . W h i l e t h e o x i d i z a t i o n o f f a t t y a c i d s p r o d u c e s m o r e e n e r g y p e r g r a m b u r n e d , i t r e q u i r e s 2 5 - 5 0 % m o r e o x y g e n t h a n c a t a b o l i z i n g c a r b o h y d r a t e s ( D a u t a n d E l z i n g a , 1989). I n m y o c a r d i a l t i s s u e , w h i c h i s h i g h l y m e t a b o l i c a l l y a c t i v e , t h e p r e f e r r e d f u e l s o u r c e a f t e r a 6-20 h o u r f a s t are f a t t y a c i d s ; h o w e v e r i n Q u e c h u a the r e a p p e a r s t o b e a s i g n i f i c a n t l y g r e a t e r c a r d i a c r e l i a n c e o n g l u c o s e as f u e l ( H o l d e n et al, 1995). A l t h o u g h t h e r e w a s a d e c r e a s e i n c a r d i a c g l u c o s e u t i l i z a t i o n a f t e r a t h r e e - w e e k e x p o s u r e t o n o r m o x i c c o n d i t i o n s , t h e rate o f g l u c o s e u p t a k e r e l a t i v e to p l a s m a g l u c o s e l e v e l s r e m a i n e d s i g n i f i c a n t l y d i f f e r e n t i n Q u e c h u a c o m p a r e d to l o w l a n d e r s . T h i s m a y r e f l e c t a n a d a p t i v e c h a n g e i n m y o c a r d i a l f u e l p r e f e r e n c e ; h o w e v e r w h e t h e r th i s i s d u e to d e v e l o p m e n t a l o r g e n e t i c f a c t o r s ( o r b o t h ) i s c u r r e n t l y u n k n o w n . It m a y a l s o b e a r e f l e c t i o n o f l i f e - s t y l e . D i e t a r y a n a l y s e s o f Q u e c h u a l i v i n g e i t h e r at a l t i t u d e o r at s e a l e v e l f o u n d that t h e h i g h l a n d e r s ate a g r e a t e r p e r c e n t a g e o f c a r b o h y d r a t e s t h a n d i d t h e l o w l a n d g r o u p a n d h a d h i g h e r s e r u m t r i g l y c e r i d e s ( W a t t et al, 1976). C a l o r i e c o n s u m p t i o n a n d p e r c e n t b o d y f a t w a s the s a m e f o r b o t h g r o u p s . T h e f r e q u e n c i e s o f g e n o t y p e s that e f f e c t f a t u t i l i z a t i o n i n t h e Q u e c h u a ar e d i s c u s s e d i n c h a p t e r 5. 1.3 The Peopling of the New World T h e r e i s a g e n e r a l c o n s e n s u s that t h e e a r l i e s t h u m a n i n h a b i t a n t s o f t h e N e w W o r l d w e r e n o m a d i c t r i b e s w h o h a d m i g r a t e d f r o m n o r t h e a s t e r n S i b e r i a i n t o A l a s k a a c r o s s w h a t is n o w k n o w n as t h e B e r i n g S t r a i t . T h i s c r o s s i n g w a s m a d e p o s s i b l e b y t h e e x p o s u r e t h e c o n t i n e n t a l s h e l f d u e t o g l a c i a l e f f e c t s o n s e a l e v e l . T h i s l a n d b r i d g e , k n o w n as B e r i n g i a , h a s s u r f a c e d n u m e r o u s t i m e s o v e r t h e l a s t 2 m i l l i o n y e a r s ( f i g u r e 1.3a), m o s t r e c e n t l y d u r i n g t h e l a s t m a j o r g l a c i a l a d v a n c e that o c c u r r e d b e t w e e n 13,000 a n d 23,000 y b p ( y e a r s b e f o r e p r e s e n t ) . D u r i n g t h i s p e r i o d a n i c e f r e e c o r r i d o r e x i s t e d b e t w e e n the L a u r e n t i d e g l a c i e r , w h i c h c o v e r e d m u c h o f t h e n o r t h e r n h a l f o f t h e c o n t i n e n t e a s t o f the R o c k y M o u n t a i n s , a n d t h e C o r d i l l a r i a n g l a c i e r , 15 Figure 1.3. Beringia and Pleistocene glaciation patterns, a) The ebb and flow of glacial ice during the last 800 centuries. Dark blocks are periods of glacial advance during which Beringia was exposed and overland travel between Asia and North America was possible. Adapted from Jennings, 1978. b) The approximate extent of glaciation (stippled areas) in North and South America 15,000 years before present (ybp). The gap between the northern ice fields is thought to have served as a passageway to the inviting south. Adapted from Cavelli-Sforza et al, 1996 and Jennings, 1983. 16 w h i c h s p r e a d d o w n f r o m t h e m o u n t a i n s o f the w e s t c o a s t ( f i g u r e 1.3b). O n e t h e o r y i s that t h e m i g r a n t s m o v e d d o w n t h i s c o r r i d o r , i n t o t h e W e s t e r n p l a i n s a n d t h e n s p r e a d s o u t h a n d east, o c c u p y i n g m u c h o f t h e N e w W o r l d i n a r e l a t i v e l y s h o r t p e r i o d o f t i m e . A n a l t e r n a t e t h e o r y i s that the i n i t i a l m i g r a t i o n f o l l o w e d a l o n g t h e w e s t c o a s t b y boat. T h i s l a t t e r t h e o r y c o u l d a c c o u n t f o r the r a p i d i t y o f t h e s p r e a d ; h o w e v e r , as m u c h o f the c o a s t l i n e that t h e y w o u l d h a v e f o l l o w e d i s n o w s u b m e r g e d , it i s u n l i k e l y that e v i d e n c e o f s u c h a p a s s a g e w i l l e v e r b e u n c o v e r e d . T h e e x a c t t i m e o f t h i s m i g r a t i o n i s u n k n o w n a n d i s s u b j e c t t o s o m e d e b a t e i n t h e p a l e o a n t h r o p o l o g i c a l c o m m u n i t y . J e n n i n g s ( 1 9 8 3 ) c o n c l u d e s that t h e e v i d e n c e s u p p o r t s a n i n i t i a l c o l o n i z a t i o n at a r o u n d 35,000 y b p ( o v e r a B e r i n g i a e x p o s e d b y t h e s e c o n d M i d - W i s c o n s i n a d v a n c e ) that w a s f o l l o w e d b y m o v e m e n t s o u t h a b o u t 25,000 y e a r s ago. A p p a r e n t b o n e t o o l s d a t i n g f r o m 2 7,000 +/- 3 0 0 0 y b p h a v e b e e n f o u n d i n w e s t e r n A l a s k a at O l d C r o w f l a t s . S e v e r a l a r t i f a c t s d a t i n g t o a r o u n d 20,000 y b p h a v e b e e n r e c o v e r e d f r o m t h e M e a d o w c r a f t S h e l t e r i n P e n n s y l v a n i a a n d d a t e s e x c e e d i n g 20,000 y e a r s y b p h a v e b e e n p r o p o s e d f o r s i t e s i n P e r u , C h i l e a n d B r a z i l i n c l u d i n g a r t i f a c t s a l l e g e d l y b e i n g as o l d as 30,000 y e a r s . T h e g r e a t a n t i q u i t y o f s o m e o f t h e s e s i t e s i s c o n t e n t i o u s a n d s o m e au t h o r s , s u c h as C a v a l l i - S f o r z a m a i n t a i n t h a t t h e i n c o n t r o v e r t i b l e e v i d e n c e o f h u m a n h a b i t a t i o n d o e s n o t a n t e c e d e 15,000 y b p ( C a v a l l i - S f o r z a et al, 1994), c o n s i s t e n t w i t h a c r o s s i n g f r o m A s i a d u r i n g t h e l a s t g l a c i a l p e r i o d ( a s e r i e s o f a d v a n c e s a n d ret r e a t s that l a s t e d a b o u t 10,000 y e a r s a n d e n d e d a b o u t 13,000 y b p ) . C o n c o m i t a n t l y , t h e i c e f r e e p a s s a g e t o t h e i n v i t i n g s o u t h w a s o p e n a n d t h e r e a r e n u m e r o u s a r c h e o l o g i c a l s i t e s d a t i n g b e t w e e n 14,000 a n d 12,000 y b p t h r o u g h o u t t h e A m e r i c a s i n c l u d i n g the W i l s a l l ( A n z i c k ) s i t e i n M o n t a n a w h e r e c a r b o n - 1 4 d a t i n g h a s d a t e d h u m a n r e m a i n s t o 10,000 +/-3 0 0 y b p ( G r e e n b e r g et al, 1986). I n a d d i t i o n , d e n t a l d i v e r g e n c e s u p p o r t s a n A m e r i n d i a n / A s i a n s e p a r a t i o n at a b o u t 14,000 y b p ( G r e e n b e r g et al, 1986) w i t h a l l n a t i v e A m e r i c a n s d e s c e n d i n g f r o m a s i n g l e n o r t h e a s t A s i a n a n c e s t r a l s t o c k . R e c e n t a n a l y s i s o f m i t o c h o n d r i a l D N A ( m t D N A ) v a r i a t i o n ( S t a r i k o v s k a y a et al, 1998); h o w e v e r , s u p p o r t s a n e a r l y e x p a n s i o n o f A s i a t i c p o p u l a t i o n s i n t o B e r i n g i a . D i v e r g e n c e b e t w e e n m t D N A h a p l o g r o u p s A , C a n d D s u g g e s t s that a s e p a r a t i o n o f A m e r i n d i a n s a n d S i b e r i a n a b o r i g i n a l p o p u l a t i o n s ( C h u k c h i a n d S i b e r i a n E s k i m o s ) o c c u r r e d a p p r o x i m a t e l y 34,000 y b p , a p e r i o d w h e n b o t h B e r i n g i a a n d t h e A l b e r t a c o r r i d o r w e r e 17 i c e f r e e . A m o r e r e c e n t d i v e r g e n c e t i m e f o r h a p l o g r o u p B (13,500 - 17,700 y b p ) i s p r o p o s e d t o b e e v i d e n c e f o r a s e c o n d w a v e o f p a l e o - I n d i a n i n f l u x . D i v e r s i t y w i t h i n h a p l o t y p e A i n d i c a t e s that the n o r t h - w e s t c o a s t A m e r i n d i a n s ( i n c l u d i n g the N a - D e n e ) , t h e E s k i m o a n d t h e C h u k c h i s e p a r a t e d a p p r o x i m a t e l y 7 0 0 0 -13,000 y b p , p r o b a b l y c o i n c i d i n g w i t h t h e m o s t r e c e n t e x p o s u r e o f B e r i n g i a . T h e i n i t i a l m i g r a n t s , the f i r s t p e o p l e to c o l o n i z e w h a t l o n g a f t e r c a m e t o b e c a l l e d the N e w W o r l d , w e r e t h e A m e r i n d i a n a n c e s t o r s o f m o s t e x t a n t N a t i v e A m e r i c a n p o p u l a t i o n s . D e n t a l , l i n g u i s t i c a n d g e n e t i c d a t a s u g g e s t that t h i s o c c u p a t i o n w a s o n l y t h e f i r s t o f t h r e e p r e - C o l u m b i a n w a v e s o f c o l o n i z a t i o n ( r e v i e w e d b y G r e e n b e r g et al, 1986) a n d that a s e c o n d m i g r a t i o n , o c c u r r i n g s h o r t l y a f t e r t h e f i r s t , i n t r o d u c e d t h e a n c e s t o r s o f the N a - D e n e s p e a k i n g n a t i v e s to t h e N e w W o r l d . T h e N a - D e n e l a n g u a g e f a m i l y i n c l u d e s A t h a b a s k a n s p e a k i n g g r o u p s s u c h as t h e D o g r i b a n d t h e S l a v e ; n o n - A t h a b a s k a n s p e a k e r s s u c h as the H a i d a a n d T l i n g i t o f t h e n o r t h w e s t c o a s t a n d S o u t h e r n N a - D e n e s u c h as t h e A p a c h e a n d the N a v a j o o f the A m e r i c a n south-west. A th i r d w a v e f o l l o w e d a r o u n d 10,000 y e a r s ago, s p r e a d i n g a c r o s s t h e n o r t h as f a r as G r e e n l a n d , g i v i n g r i s e t o t h e I n u i t and, t o the w e s t o f A l a s k a , t h e A l e u t . Table 1.2. Early archeological sites in the Andes S i t e P r o p o s e d a g e ( y b p ) * A l t i t u d e L o c a t i o n R e f e r e n c e P i k i m a c h a y 2 2 , 0 0 0 + 2 8 5 0 m S o u t h C e n t r a l P e r u 1 H u a r g o C a v e 13,460 + 4 0 5 0 m C e n t r a l P e r u 2 P a c h a m a c h a y 11,800 4 3 0 0 m W e s t C e n t r a l P e r u 3 J a y a m a c h a y 10,750 3 4 0 0 m C e n t r a l P e r u 1 P i k a m a c h a y 12,000 2 8 5 0 m S o u t h C e n t r a l P e r u 4 P a n a u l a u c a C a v e 10,000 4 1 5 0 m W e s t C e n t r a l P e r u 2 L a u r i c o c h a 9,500 4 0 5 0 m N o r t h e r n P e r u 2 E l I n g a 9,030 2 8 0 0 m N o r t h e r n E q u a d o r 5 For the location of some of these sites, see inset map in figure 1.5. *earliest evidence of occupancy +these dates are not universally excepted (see Lynch, 1990) References: 1) MacNeish (1971); 2) Bruhns (1994); 3) Lynch (1990); 4) Wenke (1984) and 5) MacNeish (1976). T h e o c c u p a t i o n o f S o u t h A m e r i c a i s b e l i e v e d t o h a v e c o m m e n c e d s h o r t l y a f t e r the a r r i v a l o f A m e r i n d i a n s i n t o t h e N e w W o r l d ( t a b l e 1.2). It m a y h a v e b e e n b y a s i n g l e g r o u p o f p a l e o -18 I n d i a n s ( s e e R o t h h a m m e r a n d S i l v a , 1989); h o w e v e r the r e i s n o e v i d e n c e o f a m a j o r g e n e t i c b o t t l e n e c k o c c u r r i n g d u r i n g t h e m o v e m e n t a c r o s s the I s t h m u s o f P a n a m a ( M o n s a l v e et ai, 1994). O n c e a g a i n , t h e r e i s l i t t l e c o n s e n s u s as t o w h e n t h i s o c c u r r e d ( s e e L y n c h ( 1 9 9 0 ) f o r a c r i t i c a l e v a l u a t i o n o f t h e e v i d e n c e f o r e a r l y (> 12,000 y b p ) o c c u p a n c y o f S o u t h A m e r i c a ) . M a c N e i s h ( 1 9 7 6 ) r e v i e w e d t h e a r c h e o l o g i c a l e v i d e n c e f r o m t h e A y a c u c h o V a l l e y a n d p o s t u l a t e d t h i s r e g i o n as " b e i n g t h e e a r l i e s t s t a g e i n man's a p p e a r a n c e i n S o u t h A m e r i c a " . H e p r o p o s e d that a r t i f a c t s f r o m c a v e s i t e s i n t h i s v a l l e y s p a n a c o n t i n u o u s p e r i o d f r o m 2 2 ,000 t o 1 5 0 0 y b p , e n c o m p a s s i n g the e n t i r e p r e - C o l u m b i a n h i s t o r y o f the P e r u v i a n h i g h l a n d s f r o m the e a r l i e s t c u l t u r e s t o t h e i m p e r i a l r e i g n o f t h e I n c a . O t h e r a u t h o r s (i.e. L y n c h , 1 9 9 0 ) a r e s k e p t i c a l o f b o t h t h e d a t i n g o n w h i c h t h e s e c l a i m s are b a s e d a n d o n t h e a u t h e n t i c i t y o f t h e s o m e o f t h e e a r l y a r t i f a c t s , s u c h as t h e p u t a t i v e l i t h i c t o o l s f r o m the A y a c u c h o V a l l e y , as m a n m a d e o b j e c t s . M a r t i n ( 1 9 7 3 ) p r o p o s e d a n i n t e r e s t i n g m o d e l o f the o c c u p a t i o n o f t h e A m e r i c a s . H e t h e o r i s e d that h u m a n s c r o s s e d t h e i s t h m u s o f B e r i n g i a i n t o A l a s k a a b o u t 11,700 y b p . T h e y t h e n t r a v e l e d d o w n th e i c e f r e e c o r r i d o r to the a r e a p r e s e n t l y o c c u p i e d b y E d m o n t o n , a r r i v i n g t h e r e a b o u t t w o c e n t u r i e s later. F r o m t h e r e t h e y e x p a n d e d r a p i d l y , s p r e a d i n g s o u t h a c r o s s b o t h c o n t i n e n t s at a rate o f a b o u t 16 k i l o m e t e r s p e r y e a r . T h i s r a p i d rate o f e x p a n s i o n w a s p o s s i b l e b e c a u s e o f a n a b u n d a n c e o f " n a i v e " m e g a f a u n a tha t p r o v i d e d t h e i n v a d e r s w i t h a m p l e f o o d . T h e p o p u l a t i o n d e n s i t y b e h i n d t h i s w a v e f r o n t w a s l o w (0.04 p e r s o n / k m 2 ) . A c c o r d i n g t o M a r t i n ' s t h e o r y , t h i s r a p i d e x p a n s i o n c o u p l e d w i t h l o w d e n s i t y w o u l d a c c o u n t f o r t h e d e a r t h o f p a l e o - I n d i a n s i t e s d a t i n g t o t h e p e r i o d o f e a r l i e s t e x p a n s i o n . E v e n t u a l l y , t h e m e g a f a u n a g r e w w a r y ( o r e x t i n c t ) a n d t h e n o w d i s p e r s e p a l e o - I n d i a n s b e g a n t o s e t t l e i n r e g i o n s o f b e t t e r h u n t i n g a n d t o d e v e l o p the c l a s s i c b i g g a m e h u n t i n g c u l t u r e s , s u c h as the C l o v i s p o i n t t r a d i t i o n , that s u d d e n l y a p p e a r o n t h e p r e h i s t o r i c h o r i z o n a r o u n d 10,000 y e a r s ago, s c a t t e r e d t h r o u g h o u t N o r t h A m e r i c a . S u p p o r t e r s o f t h e e a r l i e r a p p e a r a n c e o f m a n {e.g. M a c N e i s h , 1976) q u e s t i o n m a n y o f the a s s u m p t i o n s m a d e i n t h i s m o d e l , e s p e c i a l l y the date o f f i r s t a r r i v a l . H o w e v e r , the m o d e l i s c o n s i s t e n t w i t h m o s t o f t h e u n d i s p u t e d a r c h e o l o g i c a l data. It i s b e y o n d t h e s c o p e o f t h i s t h e s i s ( a n d t h e a b i l i t y o f its a u t h o r ) t o e v e n b e g i n t o c r i t i c a l l y e x a m i n e t h e data, t h e o r i e s a n d d i s p u t e s that c o m p r i s e c u r r e n t A m e r i c a n 19 p a l e o a n t h r o p o l o g y . F o r t h e p u r p o s e o f t h i s t h e s i s , a c o n s e r v a t i v e d a t e o f o c c u p a t i o n o f t h e A n d e a n altiplano o f 12,000 y b p h a s b e e n c h o s e n as i t b e s t a c c o m m o d a t e s t h e u n d i s p u t e d a r c h e o l o g i c a l d a t a ( t a b l e 1.2). A s s u m i n g a g e n e r a t i o n t i m e o f 2 0 y e a r s , t h e s e p o p u l a t i o n s h a v e h a d a p p r o x i m a t e l y 6 0 0 g e n e r a t i o n s to a d a p t t o the c o n d i t i o n s f o u n d at t h e s e a l t i t u d e s , i n c l u d i n g t h e a p p r o x i m a t e l y 3 0 % r e d u c t i o n i n a v a i l a b l e o x y g e n . A s s h o w n i n f i g u r e 1.4, t h i s i s s u f f i c i e n t t i m e f o r e v e n s m a l l a d v a n t a g e s t o i n f l u e n c e the g e n e t i c m a k e u p o f a p o p u l a t i o n . 0 1 0 0 2 0 0 3 0 0 4 0 0 5 0 0 6 0 0 G e n e r a t i o n s 0 1 0 0 2 0 0 3 0 0 4 0 0 5 0 0 6 0 0 G e n e r a t i o n s Figure 1.4. Predicted changes in allele frequencies over 600 generations (approximately 12,000 years) in response to selective advantage. Initial frequencies of allele A are 0.10, 0.25, 0.50 or 0.75. Fitness of genotypes: a) AA = 1.0, Aa = 0.995 and aa = 0.99; b) AA = 1.0, Aa = 0.9975 and aa = 0.995. Model assumes random breeding in an unlimited population. Models generated with PopBio. 1.4 The South American highlands T h e A n d e s , w h i c h e x t e n d f r o m C e n t r a l A m e r i c a t o T e r r a d e l F u e g o , i s t h e world's l o n g e s t m o u n t a i n r a n g e . M u c h o f A n d e a n p r e h i s t o r y c e n t e r s a r o u n d t h e b r o a d p l a t e a u s o f t h e c e n t r a l r e g i o n o f t h i s v a s t c h a i n o f m o u n t a i n s that s t r e t c h f r o m s o u t h e r n C o l u m b i a t o t h e n o r t h e r n r e a c h e s o f C h i l e ( f i g u r e 1.5). I n E q u a d o r , t h e A n d e s s p l i t i n t o t w o p a r a l l e l r a n g e s , t h e C o r d i l l e r a O r i e n t a l t o t h e w e s t a n d t h e t o w e r i n g , s n o w c a p p e d C o r d i l l e r a O c c i d e n t a l t o t h e east. I n b e t w e e n , at b e t w e e n 2 0 0 0 a n d 3 6 0 0 m, l i e the cuencas, f e r t i l e h i g h l a n d v a l l e y s w a t e r e d b y g l a c i a l r u n - o f f f r o m t h e a d j o i n i n g p e a k s . A s t h e m o u n t a i n s p r o g r e s s s o u t h i n t o P e r u , t o p o g r a p h y g r o w s m o r e c o m p l e x as a t h i r d r a n g e , the C o r d i l l e r a C e n t r a l , s p l i t s t h e c e n t r a l v a l l e y , e v e n t u a l l y j o i n i n g the O c c i d e n t a l r a n g e at C e r r o d e P a s c o . T h e s l o p e s o f t h i s c e n t r a l r a n g e a n d t h e v a l l e y s s e p a r a t i n g i t 2 0 21 f r o m the o t h e r t w o r a n g e s a r e t e m p e r a t e , w e l l w a t e r e d a n d f e r t i l e . I n t h e s e h i g h b a s i n s ( w h i c h i n c l u d e the v a l l e y o f A y a c u c h o ( f i g u r e 1.5), si t e o f m a n y o f the e a r l y a r c h e o l o g i c a l sites) a n d the altiplano i n t o w h i c h t h e y m e r g e are f o u n d m a j o r c e n t e r s o f i n d i g e n o u s p o p u l a t i o n , b o t h c o n t e m p o r a r y a n d h i s t o r i c , i n c l u d i n g the I n c a c a p i t a l o f C u s c o . T h e n a t u r a l v e g e t a t i o n o f t h i s r e g i o n c o n s i s t s o f a c o m b i n a t i o n o f t r o p i c a l m o u n t a i n a n d paramo. T h e f o r m e r , d e p e n d i n g o n a l t i t u d e , r a n g e s f r o m s u b - t r o p i c a l f o r e s t s t o s h r u b a b o v e the 3 5 0 0 m tree l i n e w h i l e t h e paramo a r e h i g h a l t i t u d e g r a s s l a n d s . M u c h o f the n a t u r a l v e g e t a t i o n i n t h e r e g i o n s h a s b e e n r e p l a c e d b y a g r i c u l t u r e , w i t h e x t e n s i v e t e r r a c i n g that a l l o w s i m p r o b a b l y s t e e p f i e l d s t o a s c e n d h i g h a b o v e the g r e e n v a l l e y f l o o r s . T o t h e e a s t o f the m o u n t a i n s the l a n d f a l l s a w a y to the A m a z o n r a i n f o r e s t , to the west, t o t h e d r y c o a s t a l p l a i n s . S o u t h o f t h e c e n t r a l A n d e s , w h e r e th e r a n g e s a r e the m o s t s e p a r a t e d , i s t h e f l a t , a r i d altiplano. L y i n g b e t w e e n 3 6 0 0 a n d 4 0 0 0 m, t h i s v a s t p l a t e a u s t r e t c h e s f r o m S o u t h e r n P e r u i n t o B o l i v i a a n d i n c l u d e s L a k e T i t i c a c a a n d L a P a z , the c a p i t a l o f B o l i v i a ( b o t h at 3 8 0 0 m). F u r t h e r s o u t h , t h i s p l a t e a u t r a n s f o r m s i n t o t h e a r i d e x p a n s e o f d e s e r t a n d s a l t f l a t s c a l l e d t h e puna, a t h i n l y i n h a b i t e d , i n h o s p i t a b l e p l a i n that e x t e n d s s o u t h t o A r g e n t i n a . A t t h i s p o i n t t h e t w o A n d e a n r a n g e s c o a l e s c e i n t o a s i n g l e r a n g e w h i c h e x t e n d s s o u t h to e v e n t u a l l y m e r g e w i t h t h e h i g h l a n d s o f P a t a g o n i a . 1.5 The Quechua T h e n a t i v e c u l t u r e s o f S o u t h A m e r i c a h a v e b e e n c l a s s i f i e d i n t o f i v e d i s t i n c t s o c i o c u l t u r a l s y s t e m s . T h e Q u e c h u a a n d t h e A y m a r a r e p r e s e n t t h e C e n t r a l A n d e a n s y s t e m , w h i c h i s c h a r a c t e r i z e d b y d o m e s t i c a t i o n o f a n i m a l s a n d p l a n t s , i r r i g a t i o n , c l a s s s t r u c t u r e , state f o r m a t i o n , e l a b o r a t e b u i l d i n g s a n d r o a d c o n s t r u c t i o n (see S a l z a n o a n d C a l l e g a r i - J a c q u e s , 1988). T h e y are a l s o g r o u p e d t o g e t h e r b y t h e i r l a n g u a g e s , b o t h o f w h i c h a r e c l a s s i f i e d as S o u t h C e n t r a l A n d e a n h o w e v e r the g e n e t i c d i s t a n c e b e t w e e n the t w o g r o u p s ( C a v a l l i - S f o r z a et al, 1994) s u g g e s t s that t h e y m a y b e m o r e c l o s e l y r e l a t e d t o o t h e r C e n t r a l a n d S o u t h A m e r i c a n p o p u l a t i o n s d e s p i t e t h e i r c u r r e n t p r o x i m i t y . 2 2 Q u e c h u a w a s t h e l a n g u a g e o f t h e I n c a , t h e d i v i n e l y s e l f - a p p o i n t e d r u l i n g c l a s s w h o g o v e r n e d Tawantinsuyu, t h e v a s t I n c a e m p i r e that g r e w o u t o f t h e f e r t i l e h i g h l a n d v a l l e y s o f S o u t h C e n t r a l P e r u . I r r i g a t i o n a n d t e r r a c i n g g r e a t l y i m p r o v e d t h e p r o d u c t i v i t y o f t h e r e g i o n and, i n c o n j u n c t i o n w i t h the g r e a t v a r i e t y o f a v a i l a b l e r e s o u r c e s , s u p p o r t e d r a p i d p o p u l a t i o n g r o w t h . In 1438, i n a b a t t l e n e a r t h e i r c a p i t a l c i t y o f C u s c o , t h e I n c a d e f e a t e d t h e i r n e i g h b o r i n g state a n d b e g a n e x p a n d i n g i n t o a n e m p i r e that e v e n t u a l l y s t r e t c h e d f r o m S o u t h e r n C o l o m b i a to S o u t h C e n t r a l C h i l e a n d e n c o m p a s s e d 12 m i l l i o n p e o p l e . T h e I n c a e m p i r e l a s t e d o n l y a b o u t 1 0 0 y e a r s b e f o r e f a l l i n g t o P i z a r r o a n d h i s 2 6 0 conquistadores w h o , m o r e t h r o u g h p o l i t i c a l c u n n i n g t h a n b y f o r c e o f a r ms, m a n a g e d t o d e f e a t a n e m p i r e l a r g e r t h a n t h e i r h o m e l a n d S p a i n . I n 1 5 3 5 P i z a r r o f o u n d e d L i m a , t h e c a p i t a l o f T h e V i c e r o y s h i p o f P e r u . D e s p i t e s e v e r a l I n c a r e b e l l i o n s a g a i n s t t h e E u r o p e a n c o n q u e r o r s , the S p a n i s h m a i n t a i n e d c o n t r o l o f the h i g h l a n d s but, as t h e h i g h a l t i t u d e m a d e t h e m u n c o m f o r t a b l e a n d b e c a u s e t h e i r p r i m a r y i n t e r e s t w a s s h i p p i n g t h e w e a l t h o u t o f t h e c o l o n y , t h e S p a n i s h t e n d e d to s t a y o n t h e c o a s t and, as L i m a ' s i m p o r t a n c e g rew, C u s c o ' s f a d e d . T o s o m e e x t e n t t h i s m a y h a v e s e r v e d t o p r e s e r v e t h e n a t i v e A n d e a n h e r i t a g e as the i n f l u x o f E u r o p e a n b l o o d i n t o t h e i r r e g i o n w a s p e r h a p s l e s s t h a n it w o u l d h a v e b e e n i f the altiplano h a d b e e n m o r e h o s p i t a b l e . T h e i n d i g e n o u s p e o p l e o f t h e A n d e s , t h o u g h d e c i m a t e d b y the d i s e a s e s i m p o r t e d , a l o n g w i t h g u n p o w d e r a n d s t e e l , b y t h e conquistadores, s u r v i v e d t h e o n s l a u g h t o f E u r o p e a n c i v i l i z a t i o n b e t t e r t h a n t h e i r N o r t h A m e r i c a n c o u n t e r p a r t s . A s o f 1990, t h e r e w e r e a n e s t i m a t e d 6.2 m i l l i o n Q u e c h u a s p e a k i n g p e o p l e l i v i n g p r i m a r i l y i n the h i g h l a n d s o f E q u a d o r , P e r u , B o l i v i a a n d A r g e n t i n a ( C a v i e d e s a n d K n a p p , 1995). T h e e x t e n t o f t h e I n c a e m p i r e i s s t i l l s e e n t o d a y . F i v e h u n d r e d y e a r s a f t e r its d e m i s e h a l f o f t h e s p e a k e r s o f n a t i v e A m e r i c a n l a n g u a g e s s p e a k l a n g u a g e s c l a s s i f i e d as A n d e a n ( C a v a l l i - S f o r z a et al, 1994) a n d t h e Q u e c h u a ar e t h e l a r g e s t l i n g u i s t i c a l l y d e f i n e d n a t i v e p o p u l a t i o n i n the N e w W o r l d . A d d i t i o n a l l y , t h e r e a r e a b o u t 1.6 m i l l i o n (as o f 1990) A y m a r a s p e a k e r s , l i v i n g p r i m a r i l y b e t w e e n L a k e T i t i c a c a a n d L a P a z , B o l i v i a . C u r r e n t l y , m a n y o f the A n d e a n I n d i a n s a r e a g r o p a s t o r a l i s t s , h e r d i n g l l a m a s a n d c u l t i v a t i n g p o t a t o e s , q u i n o a a n d s o m e g r a i n c r o p s ; h o w e v e r s o m e h a v e l e f t t h i s l i f e s t y l e f o r w o r k i n t h e m i n e s o r i n t h e c i t i e s . 2 3 T h e Q u e c h u a ar e d e f i n e d b y l a n g u a g e a n d m a y n o t n e c e s s a r i l y r e p r e s e n t a h o m o g e n e o u s p o p u l a t i o n . A s J. A . V e l l a r d s u c c i n c t l y e x p r e s s e d i t : " T h e r e i s n o e x i s t i n g r a c e t h a t c o r r e s p o n d s t o t h e a c t u a l d i s t r i b u t i o n o f t h e Q u e c h u a l a n g u a g e " ( q u o t e d i n C o m a s , 1971). A s t h e I n c a e m p i r e e x p a n d e d , i t w a s t h e p r a c t i c e o f t h e c o n q u e r o r s t o d i s t r i b u t e t h e v a n q u i s h e d t h r o u g h o u t t h e i m p e r i a l r e a l m , a l t h o u g h i t i s r e c o r d e d that the I n c a w e r e a w a r e o f t h e p r o b l e m s i n t r a n s p l a n t i n g l o w l a n d e r s t o t h e h i g h r e a c h e s o f the e m p i r e . T h e r e s u l t o f t h i s p r a c t i c e i s that the e x t a n t Q u e c h u a m a y h a v e h e t e r o g e n e o u s a n c e s t o r s i n c l u d i n g l o w l a n d n a t i v e s . S u b s e q u e n t i n t e r b r e e d i n g w i t h E u r o p e a n s c o n t r i b u t e d t o t h i s h e t e r o g e n i e t y , a l t h o u g h i t i s b e l i e v e d that a c o m b i n a t i o n o f p h y s i c a l a n d c u l t u r a l f a c t o r s m a y h a v e l i m i t e d the i n f l u x o f C a u c a s i a n g e n e s i n t o the n a t i v e A n d e a n g e n e p o o l . A r e c e n t e s t i m a t e o f a v e r a g e C a u c a s i a n a d m i x t u r e i n c o n t e m p o r a r y Q u e c h u a i s 0.247 ( S a l z a n o a n d C a l l e g a r i - J a c q u e s , 1988). A s w a s d i s c u s s e d e a r l i e r , t h e Q u e c h u a s h o w c o n s i d e r a b l e a d a p t a t i o n t o h i g h a l t i t u d e . T h e i r a n c e s t o r s h a v e i n h a b i t e d t h e h i g h p l a t e a u s o f the A n d e s f o r o v e r 12,000 y e a r s , s u f f i c i e n t t i m e t o i n c u r d e t e c t a b l e c h a n g e s i n a l l e l e f r e q u e n c i e s e v e n w i t h m i n o r d i f f e r e n t i a l f i t n e s s ( f i g u r e 1.4). T h e r e i s s o m e b e l i e f that t h e H i m a l a y a n s m a y b e b e t t e r a d a p t e d t o a l t i t u d e t h a n the A n d e a n s ( M o o r e et al, 1992), p e r h a p s d u e t o t h e i r l o n g e r h i s t o r y o f e x p o s u r e ( s u r m i s e d t o b e a b o u t 30,000-35,000 y e a r s o r a l m o s t t h r i c e that o f the A n d e a n s ) . I n m o s t c a s e s , the c h a n g e i n a l l e l e f r e q u e n c i e s i n r e s p o n s e t o s e l e c t i o n i s r a p i d at f i r s t ( e s p e c i a l l y w h e n th e i n i t i a l f r e q u e n c y o f the f a v o u r e d a l l e l e i s l o w ) and, w h i l e c h a n g e s w o u l d b e m o r e p r o n o u n c e d a f t e r 1 6 5 0 g e n e r a t i o n s , t h e y s h o u l d s t i l l b e e v i d e n t a f t e r s i x h u n d r e d ( t a b l e 1.3). O u r p r i n c i p l e r e a s o n f o r c h o o s i n g A n d e a n n a t i v e s o v e r H i m a l a y a n h i g h l a n d e r s (e.g. T i b e t a n s a n d S h e r p a s ) f o r t h i s s t u d y w a s a p r a c t i c a l c o n s i d e r a t i o n p e r t a i n i n g t o t h e a c q u i s i t i o n o f s a m p l e s . A c o n f o u n d i n g i s s u e i n i d e n t i f y i n g a d a p t i v e c h a n g e s i n t h e g e n e t i c c o m p o s i t i o n o f a p o p u l a t i o n i s t h e b a c k g r o u n d o f c h a n g e s r e s u l t i n g f r o m s t o c h a s t i c f o r c e s s u c h as g e n e t i c d r i f t . G e n e t i c d r i f t o c c u r s w h e n p o p u l a t i o n s a r e s u f f i c i e n t l y s m a l l that t h e r e i s a s i g n i f i c a n t p r o b a b i l i t y that a l l e l e s w i l l b e l o s t d u e t o c h a n c e a l o n e ( C a v a l l i - S f o r z a et al, 1994). F o u n d e r e f f e c t , i n w h i c h the g e n e t i c c o m p o s i t i o n o f a e x t a n t p o p u l a t i o n r e f l e c t s c h a n g e s that o c c u r r e d b y c h a n c e i n a s m a l l p r o g e n i t o r p o p u l a t i o n , i s a n e x a m p l e o f t h i s . 2 4 T h e r e s u l t a n t l o s s o f a l l e l e s w i l l r e d u c e g e n e t i c v a r i a t i o n i n a p o p u l a t i o n and, as p r e f e r e n t i a l s e l e c t i o n o f s u c h v a r i a n t s i s t h e b a s i s o f e v o l u t i o n , p o p u l a t i o n h o m o g e n e i t y w i l l s l o w t h e e v o l u t i o n a r y p r o c e s s . G i v e n that the a m o u n t o f t i m e a v a i l a b l e f o r e v o l u t i o n t o h a v e o c c u r r e d i n the A n d e a n p o p u l a t i o n s i s , b y e v o l u t i o n a r y s t a n d a r d s , b r i e f , t h e a r g u m e n t s f o r s u c h c h a n g e s h a v i n g o c c u r r e d w i l l b e s t r e n g t h e n e d i f t h e r e i s e v i d e n c e f o r h e t e r o g e n e i t y i n t h e f o u n d i n g p o p u l a t i o n s ( s ) . K i d d et al, ( 1 9 9 1 ) c o n c l u d e d that, g i v e n the h e t e r o g e n e i t y o f n u c l e a r p o l y m o r p h i s m s , t h e r e w a s n o t a n e x c e s s i v e l o s s o f h e t e r o z y g o s i t y d u r i n g t h e p o p u l a t i n g o f the A m e r i c a s . F u r t h e r m o r e , t h e r e i s m t D N A e v i d e n c e that a s i g n i f i c a n t g e n e t i c b o t t l e n e c k d i d n o t o c c u r d u r i n g t h e h u m a n e x p a n s i o n i n t o S o u t h A m e r i c a ( M o n s a l v e et al, 1994) a r g u i n g that t h i s v a r i a b i l i t y m a y h a v e b e e n m a i n t a i n e d as h u m a n s s p r e a d t o w a r d t h e A n d e s . Table 1.3. A comparison of predicted change in allele frequencies after 600 and 1650 generations (approximately 12,000 and 33,000 years respectively). I n i t i a l f r e q u e n c y o f A F i n a l f r e q u e n c y o f A a f t e r 6 0 0 g e n e r a t i o n s F i n a l f r e q u e n c y o f A a f t e r 1 6 5 0 g e n e r a t i o n s 0.10 0.69 >0.99 0.25 0.87 >0.99 0.50 0.95 1.0 0.75 0.98 1.0 0.90 0.99 1.0 Based a co-dominant inheritance pattern with genotypic fitness of 0.99 for aa, 0.995 for Aa and 1.0 for AA. Model assumes unlimited population and an inbreeding coefficient = 0.0. 1.6 Summary T h e r e i s l i t t l e d o u b t that h u m a n s c a n s u c c e s s f u l l y a d a p t t o t h e h y p o x i c c o n d i t i o n s m a n i f e s t at h i g h a l t i t u d e s . M i l l i o n s o f p e o p l e l i v e b e t w e e n 3 0 0 0 a n d 4 5 0 0 m i n t h e h i g h A n d e a n p l a t e a u s a n d h a v e d o n e s o f o r c e n t u r i e s . W h i l e a c c l i m a t i o n w i l l a l l o w l o w l a n d e r s to f u n c t i o n c o m f o r t a b l y at t h e s e a l t i t u d e s , it i s e v i d e n t that h a v i n g b e e n b o r n and/or r a i s e d i n t h e h i g h l a n d s c o n f e r s a s u b s t a n t i a l a d v a n t a g e . W h i l e i t h a s n o t b e e n c o n c l u s i v e l y p r o v e n that h i g h a l t i t u d e A n d e a n p o p u l a t i o n s are g e n e t i c a l l y a d a p t e d t o h y p o x i a , t h e r e i s s u b s t a n t i a l e v i d e n c e f o r h e r i t a b l e c o m p o n e n t s c o n t r i b u t i n g to s o m e o f the a n a t o m i c a l a n d p h y s i o l o g i c a l c h a n g e s t h a t a r e b e l i e v e d to f a c i l i t a t e t h e u p t a k e , t r a n s p o r t a n d u t i l i z a t i o n o f o x y g e n ( s u m m a r i z e d f i g u r e 1.6). 2 5 Chest and Lungs Pulmonary capillaries Blood oxygen transport Tissue mitochondria increased lung volumes increased chest dimensions altered hypoxic ventilatory response - increased rates of pulmonary difusion hematocrit (?) - hypometabolism - increased preference for carbohydrates as fuel Figure 1.6. A summary of human adaptation to altitude. Some of the proposed physiological and anatomical adaptations to chronic hypoxia that characterize high altitude Andean populations. These characteristics, which contribute to the uptake, transport and utilization of oxygen, are thought to ameliorate the effects of chronic hypoxia. Although these traits can be acquired during development to some extent, there is evidence that indigenous high altitude populations of the Andes (the Quechua and the Aymara) are genetically predisposed to their acquisition. The Quechua are an excellent population in which to search for evidence of selective pressures altering allele frequencies in genes that may be involved in high altitude adaptation. They live high in the mountains, breathing air with 33% less oxygen than that to which sea level natives are accustomed. The archeological evidence supports an occupation of the altiplano for at least 600 generations, ample time for selection to favour alleles conferring even a nominal advantage, and molecular evidence suggests that the ancestral population was genetically heterogeneous so that there was variation on which selection could act. 26 / . 7 Rationale F o r a s p e c i e s t h a t h a s s p r e a d t h r o u g h v i r t u a l l y e v e r y t e r r e s t r i a l e n v i r o n m e n t o n the p l a n e t h u m a n s are r e m a r k a b l y i n v a r i a n t , m i n o r c h a n g e s i n p i g m e n t a t i o n a n d stature n o t w i t h s t a n d i n g . W e h a v e h o w e v e r , a l w a y s b e e n m o r e i n t e r e s t e d i n o u r s l i g h t d i f f e r e n c e s r a t h e r t h a n o u r g r e a t c o m m o n a l t i e s and, f o r b o t h g o o d a n d b a d , t h e q u a n t i f i c a t i o n o f h u m a n d i v e r s i t y h a s a l o n g h i s t o r y i n s c i e n c e . I n t e r e s t i n v a r i e t y a c c e l e r a t e d i n the l a t e n i n e t e e n t h c e n t u r y w i t h t h e p u b l i c a t i o n o f D a r w i n ' s t h e o r i e s o f n a t u r a l s e l e c t i o n as p e o p l e b e g a n t o r e a l i s e that g i v e n e v o l u t i o n a r y t i m e s c a l e s , a p p a r e n t l y t r i v i a l d i f f e r e n c e s i n i n d i v i d u a l s c o u l d e v e n t u a l l y a l t e r the m a k e u p o f e n t i r e p o p u l a t i o n s , p r o v i d e d that the v a r i a t i o n c o u l d b e p a s s e d o n t o s u b s e q u e n t g e n e r a t i o n s . T r a n s - g e n e r a t i o n a l t r a n s m i s s i o n s e p a r a t e s h e r i t a b l e c h a r a c t e r i s t i c s f r o m t h o s e a c q u i r e d d u r i n g a n i n d i v i d u a l ' s l i f e t i m e t h u s e s t a b l i s h i n g t h e d i c h o t o m y o f n u r t u r e a n d n a t u r e that, u l t i m a t e l y , i s the s o u r c e o f a l l b i o l o g i c a l d i v e r s i t y . T h e w o r k p r e s e n t e d i n t h i s t h e s i s r e p r e s e n t s o n e a p p r o a c h t o u n d e r s t a n d i n g t h e r o l e o f g e n e t i c s i n t h e a d a p t a t i o n o f h u m a n s to t h e h y p o x i c c o n d i t i o n s f o u n d at h i g h a l t i t u d e ( 3 0 0 0 -4 0 0 0 m). W h i l e p r e v i o u s w o r k i n t h i s f i e l d h a s f o c u s e d o n t h e h e r i t a b l e c o m p o n e n t o f c o n t i n u o u s t r a i t s , s u c h as c h e s t m o r p h o l o g y a n d b l o o d o x y g e n s a t u r a t i o n , t h i s p r o j e c t f o c u s e s o n c h a n g e s i n t h e f r e q u e n c i e s o f v a r i a t i o n s w i t h i n s i n g l e genes. G i v e n t h e e s t a b l i s h e d ( o r p o t e n t i a l ) p h e n o t y p e s o f t h e s e v a r i a n t s a n d t h e c h a r a c t e r i s t i c s , o r t h e o r e t i c a l r e q u i r e m e n t s , o f h i g h a l t i t u d e p o p u l a t i o n s , i t i s p o s s i b l e t o m a k e t e s t a b l e p r e d i c t i o n s a b o u t t h e s e f r e q u e n c i e s i n t h e s e p o p u l a t i o n s . E s s e n t i a l l y , t h i s i s a v a r i a t i o n o f m o l e c u l a r a s s o c i a t i o n a n a l y s i s , a t e c h n i q u e that has b e e n u s e d s u c c e s s f u l l y t o i d e n t i f y p o t e n t i a l g e n e t i c f a c t o r s i n t h e d e v e l o p m e n t o f c o m p l e x d i s e a s e s s u c h as A l z h e i m e r ' s d i s e a s e a n d m y o c a r d i a l i n f a r c t i o n as w e l l as n u m e r o u s c o n d i t i o n s that h a v e b e e n a s s o c i a t e d w i t h h u m a n l e u k o c y t e a n t i g e n ( H L A ) g e n o t y p e s ( s e e L a n d e r a n d S c h o r k , 1994). C l i n i c a l a s s o c i a t i o n s t u d i e s test w h e t h e r a p a r t i c u l a r a l l e l e o c c u r s at a h i g h e r f r e q u e n c y a m o n g a f f e c t e d t h a n u n a f f e c t e d i n d i v i d u a l s ( L a n d e r a n d S c h o r k , 1994). In t h i s s t u d y , t h e c o m p a r i s o n i s b e t w e e n i n d i v i d u a l s w h o r e p r e s e n t a p o p u l a t i o n that i s p r o p o s e d t o b e a d a p t e d t o a p a r t i c u l a r e n v i r o n m e n t a n d i n d i v i d u a l s f r o m p o p u l a t i o n s n o t e x p o s e d t o t h o s e c o n d i t i o n s . I f a n a s s o c i a t i o n i s o b s e r v e d i t m a y b e d u e to: 1) the o v e r - r e p r e s e n t e d a l l e l e h a v i n g b e e n s e l e c t e d 2 7 f o r i n t h e p o p u l a t i o n b e c a u s e i t c o n f e r s s o m e b e n e f i t ; 2) a n a l l e l e t o w h i c h t h e o v e r - r e p r e s e n t e d v a r i a n t i s i n l i n k a g e d i s e q u i l i b r i u m h a s b e e n s e l e c t e d f o r ; o r 3) r a n d o m v a r i a t i o n i n the p o p u l a t i o n . T h e l a t t e r p o s s i b i l i t y i s d i s c u s s e d f u r t h e r i n t h e f i n a l c h a p t e r o f t h i s t h e s i s . T e s t i n g l a r g e n u m b e r s o f p o l y m o r p h i s m s r a i s e s t h e i s s u e o f o b s e r v i n g c h a n c e a s s o c i a t i o n s . T h i s c a n b e c o r r e c t e d f o r b u t m a y i n v o l v e s u c h l o w P v a l u e s ( X u et al., 1999) that u n r e a l i s t i c a l l y l a r g e s a m p l e s i z e s are r e q u i r e d t o d e t e c t s i g n i f i c a n t c h a n g e s . O n e w a s t o c i r c u m v e n t t h i s i s t o c h o s e c a n d i d a t e g e n e s that, b y d e f i n i t i o n , h a v e a p r i o r p r o b a b l y o f b e i n g i n v o l v e d i n t h e g e n o t y p e ( C o x a n d B e l l , 1989). T h e c a n d i d a t e g e n e s f o r t h i s s t u d y w e r e c h o s e n b e c a u s e t h e y h a v e v a r i a n t s a s s o c i a t e d w i t h p h e n o t y p e s o f p o t e n t i a l b e n e f i t at a l t i t u d e o r b e c a u s e t h e y e n c o d e p r o t e i n s d i r e c t l y i n v o l v e d i n the r e s p o n s e t o c h a n g e s i n o x y g e n a v a i l a b i l i t y . T h e y are: 1) the 8 - f i b r i n o g e n gene, t h e p r o d u c t o f w h i c h i s a m a j o r d e t e r m i n a n t o f p l a s m a v i s c o s i t y ; 2) the a n g i o t e n s i n c o n v e r t i n g e n z y m e ( A C E ) gene, v a r i a n t s o f w h i c h h a v e b e e n a s s o c i a t e d w i t h h i g h a l t i t u d e p e r f o r m a n c e a n d 3) the B 2-a d r e n e r g i c r e c e p t o r g e n e ( B 2 - A R ) , w h i c h e n c o d e s a m a j o r p u l m o n a r y c a t e c h o l a m i n e r e c e p t o r . A l l o f t h e s e g e n e s h a v e p r e v i o u s l y c h a r a c t e r i s e d p o l y m o r p h i s m s a n d w i l l b e d i s c u s s e d f u r t h e r i n s u b s e q u e n t c h a p t e r s . I n a d d i t i o n , t h e g e n e s e n c o d i n g e r y t h r o p o i e t i n a n d h y p o x i a i n d u c i b l e f a c t o r l a w e r e e x a m i n e d . A s o f t h i s w r i t i n g n o r e p o r t s o f f u n c t i o n a l p o l y m o r p h i c sites i n th e s e g e n e s h a v e b e e n p u b l i s h e d ; h o w e v e r , t h e i r f u n c t i o n s i n the p r o d u c t i o n o f r e d b l o o d c e l l s a n d i n o x y g e n s e n s i t i v e g e n e r e g u l a t i o n m a k e t h e m p r i m e c a n d i d a t e s f o r a r o l e i n t h e d e v e l o p m e n t o f h y p o x i a t o l e r a n c e . T h e h i g h a l t i t u d e p o p u l a t i o n c h o s e n f o r s t u d y a r e Q u e c h u a I n d i a n s o f the c e n t r a l A n d e s . A s p r e v i o u s l y d i s c u s s e d , t h e s e h a r d y h i g h l a n d p e o p l e h a v e i n h a b i t e d t h e altiplano f o r m o r e t h a n 120 c e n t u r i e s a n d s h o w c o n s i d e r a b l e a d a p t a t i o n t o l i f e o n the h i g h p l a t e a u s . A d d i t i o n a l l y , h a v i n g b e e n the s u b j e c t o f s c i e n t i f i c i n v e s t i g a t i o n f o r a l m o s t a c e n t u r y , t h e y are a r e l a t i v e l y w e l l s t u d i e d p o p u l a t i o n a n d t h e r e is a l a r g e b o d y o f l i t e r a t u r e d e s c r i b i n g t h e a n a t o m i c a l a n d p h y s i o l o g i c a l c h a r a c t e r i s t i c s that s e e m t o m i t i g a t e t h e d e l e t e r i o u s e f f e c t s o f l i f e l o n g e x p o s u r e t o h y p o b a r i c h y p o x i a . 2 8 Chapter 2 Materials and Methods1 General methodology D N A s a m p l e s r e p r e s e n t i n g t h r e e p o p u l a t i o n s 1) Q u e c h u a s p e a k e r s l i v i n g at a b o v e 3 2 0 0 m o n t h e P e r u v i a n altiplano, 2) N a - D e n e s p e a k i n g A m e r i n d i a n s f r o m t h e c o a s t a l r e g i o n s o f B r i t i s h C o l u m b i a a n d 3) C a u c a s i a n s o f W e s t e r n E u r o p e a n d e s c e n t , w e r e p r e p a r e d f r o m p e r i p h e r a l b l o o d l e u k o c y t e s a n d / o r b u c c a l e p i t h e l i a l c e l l s . T h e s e s a m p l e s w e r e g e n o t y p e d f o r k n o w n p o l y m o r p h i s m s b y p o l y m e r a s e c h a i n r e a c t i o n ( P C R ) a m p l i f i c a t i o n u s u a l l y f o l l o w e d b y d i g e s t i o n w i t h a d i a g n o s t i c r e s t r i c t i o n e n d o n u c l e a s e . T h e g e n e s a s s a y e d w e r e s e l e c t e d f o r a n a l y s i s b e c a u s e t h e y e n c o d e p r o d u c t s that are i n v o l v e d i n the u p t a k e , t r a n s p o r t o r u t i l i z a t i o n o f o x y g e n and, i n m o s t case s , t h e y c o n t a i n e d k n o w n p o l y m o r p h i s m s w i t h p r e v i o u s l y c h a r a c t e r i z e d p h e n o t y p e s . A l l e l e f r e q u e n c i e s at t h e s e l o c i w e r e d e t e r m i n e d a n d c o m p a r e d b e t w e e n the p o p u l a t i o n s . I n c a s e s w h e r e t h e r e w e r e m u l t i p l e p o l y m o r p h i s m s i n t h e s a m e gene, i t w a s d e t e r m i n e d i f t h e a l l e l e s at t h e s e l o c i w e r e i n h e r i t e d i n d e p e n d e n t l y o f o n e a n o t h e r o r w h e t h e r t h e y w e r e i n l i n k a g e d i s e q u i l i b r i u m a n d t h e r e f o r e w e r e m o v i n g b e t w e e n g e n e r a t i o n s as h a p l o t y p e s (sets o f c o - s e g r e g a t i n g a l l e l e s at l i n k e d l o c i ) r a t h e r t h a n as i n d e p e n d e n t a l l e l e s . It w a s h y p o t h e s i s e d that, d u e to s e l e c t i o n f a v o u r i n g t h e m a i n t e n a n c e , a n d t h e r e f o r e the i n t e r - g e n e r a t i o n a l t r a n s f e r o f a n y a l l e l e that c o n t r i b u t e d t o a n a d v a n t a g e o u s p h e n o t y p e at a l t i t u d e , s u c h a l l e l e s w o u l d b e o v e r - r e p r e s e n t e d i n t h e Q u e c h u a . A s s o c i a t i o n b e t w e e n g e n o t y p e a n d p h e n o t y p e h a s b e e n u s e d f o r y e a r s t o c h a r a c t e r i z e t h e r o l e o f g e n e t i c s i n t h e d e v e l o p m e n t o f p h y s i c a l c h a r a c t e r i s t i c s , a n d i t h a s b e e n p r o p o s e d that s u c h a s s o c i a t i o n a n a l y s i s i s t h e m o s t e f f e c t i v e m e t h o d o f u n r a v e l i n g t h e g e n e t i c b a s i s o f c o m p l e x d i s e a s e s ( R i s c h a n d M e r i k a n g a s , 1996). I n t h e r e s e a r c h p r e s e n t e d h e r e i n , t h e p h e n o t y p e i n q u e s t i o n i s a d a p t a t i o n t o h i g h a l t i t u d e e x i s t e n c e i n t h e Q u e c h u a , a n d t h e a s s o c i a t i o n s b e i n g t e s t e d are b e t w e e n t h i s a n d t h e g e n o t y p e at a 1 The materials and methods described in the following section apply to all subsequent chapters. Specific assay techniques, including PCR conditions are detailed in each chapter as necessary. All PCR primers were prepared by N.A.P.S. at U.B.C. Primer sequences are given in appendix ii. 2 9 n u m b e r o f c a n d i d a t e g e n e s s e l e c t e d f o r t h e i r r o l e ( a l b e i t s o m e t i m e s i n d i r e c t ) i n o x y g e n u t i l i z a t i o n . Sample collection The Quechua B l o o d a n d / o r b u c c a l e p i t h e l i a l s a m p l e s w e r e o b t a i n e d w i t h i n f o r m e d c o n s e n t f r o m Q u e c h u a l i v i n g i n f o u r s m a l l c o m m u n i t i e s ( H u i l l o c , P a t a c a n c h a , P l a t e r y l l o q a n d Q q e l c q a n q a ) l o c a t e d b e t w e e n 3 2 0 0 - 4 2 0 0 m a b o v e s e a l e v e l n e a r t h e t o w n o f O l l a n t a y t a m b o , P e r u (see f i g u r e 1.5). T h e f i r s t t w o sets o f b l o o d s a m p l e s (9 i n O c t o b e r , 1 9 9 7 a n d 13 i n A p r i l , 1 9 9 8 ) w e r e c o l l e c t e d n e a r P a t a c a n c h a b y C h a r o T a p i a ( D p t o . d e C i e n c i a s F i s i o l o g i c a s , U n i v e r s i d a d C a y e t a n o H e r e d i a , L i m a , P e r u ) a n d s h i p p e d t o t h e U n i v e r s i t y o f B r i t i s h C o l u m b i a (U.B.C.) i n V a n c o u v e r , B.C., C a n a d a f o r D N A p r e p a r a t i o n a n d a n a l y s i s . I n O c t o b e r o f 1998, a s m a l l e x p e d i t i o n , c o n s i s t i n g o f t h e a u t h o r a n d D r . V i c k y M o n s a l v e o f t h e D e p a r t m e n t o f A n t h r o p o l o g y (U.B.C.) t r a v e l e d t o P e r u w h e r e t h e y m e t M s . T a p i a a n d c o l l e c t e d a n a d d i t i o n a l 6 6 b l o o d s a m p l e s a n d 17 b u c c a l s a m p l e s . T h e s e s a m p l e s w e r e s t o r e d at 4° C u n t i l t h e y c o u l d b e s h i p p e d t h r o u g h L i m a to V a n c o u v e r . T h e a g e a n d g e n d e r o f e a c h d o n o r w a s r e c o r d e d as w e l l as i n f o r m a t i o n p e r t a i n i n g to s m o k i n g h i s t o r y a n d r e c e n t t r a v e l t o h i g h e r o r l o w e r a l t i t u d e s ( s e e a p p e n d i x i ) . S u b j e c t r e l a t e d n e s s w a s e s t a b l i s h e d b y i n t e r v i e w o r b y s u r n a m e c o m p a r i s o n . T h e i n i t i a l b l o o d s a m p l e s w e r e d r a w n f r o m t h e a n t i c u b i d a l v e i n i n t o 2 0 m l s y r i n g e s . T h e s a m p l e s t a k e n i n O c t o b e r o f 1998 w e r e i n i t i a l l y i n t e n d e d t o b e d r a w n i n t o V a c u t a i n e r t u b e s ( B e c t o n - D i c k i n s o n , F r a n k l i n L a k e s , N J ) b u t i n s t e a d w e r e c o l l e c t e d i n 2 0 m l s y r i n g e s a n d t h e n t r a n s f e r r e d t o t h e V a c u t a i n e r t u b e s ( c o n t a i n i n g e i t h e r N a - C i t r a t e o r E D T A as a n a n t i - c o a g u l a n t ) . T h i s s t e p p r o v e d t o b e . e s s e n t i a l as, at 4 2 0 0 m, t h e p r e s s u r e d i f f e r e n t i a l b e t w e e n a m b i e n t a n d t h e i n t e r i o r o f t h e V a c u t a i n e r t u b e w a s i n s u f f i c i e n t to d r a w b l o o d e f f e c t i v e l y . B u c c a l s a m p l e s w e r e o b t a i n e d u s i n g t h e s u g a r m o u t h w a s h p r o c e d u r e d e s c r i b e d i n ( S p i t z et al, 1996). S u b j e c t s w e r e a s k e d t o v i g o r o u s l y s w i s h a 4 % s u c r o s e s o l u t i o n i n t h e i r m o u t h f o r a m i n u t e b e f o r e s p i t t i n g it i n t o a s t e r i l e c o l l e c t i o n c u p . I n e x c h a n g e f o r t h e i r t i m e a n d c o o p e r a t i o n , b l o o d d o n o r s w e r e g i v e n 3 0 $10.00 (U.S.) w o r t h o f f o o d s t u f f s (e.g. p a s t a , c o o k i n g o i l , f l o w e r , r i c e a n d b e a n s ) that h a d b e e n p u r c h a s e d i n O l l a n t a y t a m b o . H e m a t o c r i t s w e r e d e t e r m i n e d b y c e n t r i f u g a t i o n o f 10 ul o f b l o o d i n a h e m a t o c r i t c a p i l l a r y t u b e f o r f i v e m i n u t e s at a p p r o x i m a t e l y 12,000 g f o l l o w e d b y m e a s u r e m e n t o f t h e p a c k e d c e l l v o l u m e a n d t h e t o t a l v o l u m e . T h e p e r c e n t - r a t i o o f t h e s e t w o v a l u e s i s t h e h e m a t o c r i t . F o r 13 o f t h e i n i t i a l s a m p l e s , t h i s w a s p e r f o r m e d i n D r . D a n a D e v i n e ' s l a b i n t h e D e p a r t m e n t o f P a t h o l o g y a n d L a b o r a t o r y M e d i c i n e at U.B.C. F o r the s a m p l e s c o l l e c t e d i n O c t o b e r o f 1998, h e m a t o c r i t s w e r e d e t e r m i n e d i n t h e c l i n i c i n O l l a n t a y t a m b o u s i n g e q u i p m e n t g e n e r o u s l y p r o v i d e d b y the s t a f f . G e n d e r f r e q u e n c i e s , a v e r a g e a g e a n d a v e r a g e h e m a t o c r i t f o r Q u e c h u a b l o o d d o n o r s a r e g i v e n i n t a b l e 2.1. N o t a l l s a m p l e s w e r e u s e d f o r g e n o t y p e a n a l y s i s d u e t o l a c k o f f a m i l y h i s t o r y o r b e c a u s e t h e d o n o r h a d a f i r s t - d e g r e e r e l a t i v e a l r e a d y r e p r e s e n t e d i n t h e a n a l y s i s . Table 2.1. Age and hematocrit of the Quechua who donated blood samples. n a v e r a g e a g e ( y e a r s ) a v e r a g e h e m a t o c r i t F e m a l e 61 31.4 + 13.5 4 3 . 3 % + 5 . 0 % M a l e 21 33.2 + 11.4 4 5 . 7 % + 4 . 4 % T o t a l 8 2 31.8 + 13.0 4 4 . 3 % + 5 . 4 % Table includes individuals who were excluded from subsequent genotype analysis due to lack of family history or because they had a first degree relative already included in the analysis. ± standard deviation I n a d d i t i o n t o t h e b l o o d a n d b u c c a l s a m p l e s , f i v e Q u e c h u a l y m p h o b l a s t c e l l l i n e s ( G M 1 1 1 9 7 , G M 1 1 1 9 8 , G M 1 1 1 9 9 , G M 1 1 2 0 0 , G M 1 1 2 0 1 ) w e r e p u r c h a s e d f r o m t h e C o r i e l l C e l l R e p o s i t o r y H u m a n D i v e r s i t y C o l l e c t i o n ( C o r i e l l C e l l R e p o s i t o r i e s , C a m d e n , N.J.). T h e s e c e l l l i n e s , w h i c h w e r e e s t a b l i s h e d f r o m Q u e c h u a l i v i n g i n c e n t r a l P e r u , w e r e o r i g i n a l l y d e p o s i t e d b y D r . K e n K i d d ( Y a l e U n i v e r s i t y , C T ) a n d w e r e a m o n g t h o s e d e s c r i b e d b y B a r r a n d K i d d ( 1 9 9 3 ) . T h e o r i g i n a l b l o o d s a m p l e s f r o m w h i c h t h e c e l l l i n e s w e r e d e r i v e d w e r e o b t a i n e d f r o m u n r e l a t e d i n d i v i d u a l s ( L . A . G i u f f r a , W a s h i n g t o n U n i v e r s i t y , p e r s o n a l c o m m u n i c a t i o n ) . 31 The Na-Dene N a - D e n e is a f a m i l y o f n a t i v e A m e r i c a n l a n g u a g e s c o m p r i s i n g H a i d a , T l i n g i t , E y a k a n d t h e A t h a b a s k a n f a m i l y . T h e f i r s t t h r e e a r e s i n g l e l a n g u a g e s o f n a t i v e s f r o m t h e N o r t h w e s t c o a s t o f C a n a d a a n d t h e s o u t h e r n c o a s t o f A l a s k a . T h e A t h a b a s k a n l a n g u a g e s a r e c o n s i d e r a b l y m o r e d i s p e r s e a n d a r e s p o k e n b y m a n y b a n d s i n A l a s k a a n d w e s t e r n C a n a d a as w e l l as b y t h e A p a c h e a n d N a v a j o o f t h e A m e r i c a n S o u t h w e s t . N a - D e n e is r e l a t e d t o K e t , a c e n t r a l S i b e r i a n l a n g u a g e ( R u h l e n , 1998), a n d n o t t o o t h e r n a t i v e A m e r i c a n l a n g u a g e s . It i s b e l i e v e d t o h a v e d e r i v e d f r o m t h e l a n g u a g e s p o k e n b y t h e s e c o n d w a v e o f A s i a n m i g r a n t s w h o e n t e r e d N o r t h A m e r i c a a p p r o x i m a t e l y 10,000 y e a r s ago. T h e D N A s a m p l e s u s e d i n t h i s p r o j e c t w e r e p r o v i d e d b y D r . M . V . M o n s a l v e ( D e p a r t m e n t o f A n t h r o p o l o g y , U.B.C.) a n d h a v e b e e n p r e v i o u s l y d e s c r i b e d ( M o n s a l v e e f a/., 1998). Caucasians B l o o d a n d / o r b u c c a l s a m p l e s w e r e o b t a i n e d w i t h c o n s e n t f r o m v a r i o u s u n r e l a t e d m e m b e r s o f t h e u n i v e r s i t y c o m m u n i t y at S t a n f o r d U n i v e r s i t y , C a s e W e s t e r n R e s e r v e U n i v e r s i t y a n d U.B.C. T h e s u b j e c t s w e r e p r i m a r i l y A m e r i c a n o r C a n a d i a n o f W e s t e r n E u r o p e a n d e s c e n t h o w e v e r d e t a i l e d f a m i l y h i s t o r i e s w e r e n o t o b t a i n e d . DNA and RNA preparation L y m p h o c y t e s w e r e p r e p a r e d f r o m t h e b l o o d s a m p l e s b y h y p o t o n i c c e l l l y s i s . F i v e v o l u m e s o f h y p o t o n i c R B C l y s i s b u f f e r ( 1 3 0 m M N H 4 C 1 , 0.9 m M N H 4 C 0 3 , p H 8.0) w a s c o m b i n e d w i t h t h e b l o o d s a m p l e i n a 5 0 m l t u b e a n d c e n t r i f u g e d f o r 5 m i n . at 6 0 0 0 g i n a J o u a n M R 1 8 1 2 c e n t r i f u g e . T h e p e l l e t ( p r i m a r i l y w h i t e b l o o d c e l l s ) w a s w a s h e d w i t h 5 m l o f l y s i s b u f f e r , c e n t r i f u g e d a g a i n , r i n s e d w i t h 5 m l o f i s o t o n i c s a l i n e ( 0 . 8 5 % N a C l ) and, f o l l o w i n g a f i n a l c e n t r i f u g a t i o n , w e r e r e s u s p e n d e d i n 3 m l o f s a l i n e / E D T A ( 7 5 m M N a C l , 2 4 m M E D T A ) , 1 % s o d i u m d o d e c y l s u l f a t e a n d 1 m g p r o t e i n a s e K ( E . M e r c k D a r m s t a d t , G e r m a n y ) a n d i n c u b a t e d o v e r n i g h t at 5 6 ° C . D N A w a s i s o l a t e d b y p h e n o l / c h l o r o f o r m e x t r a c t i o n as f o l l o w s . T h e l y s a t e 3 2 w a s m i x e d t h o r o u g h l y w i t h o n e v o l u m e o f T r i s - b u f f e r e d p h e n o l ( p H 8.0) a n d c e n t r i f u g e d at m a x i m u m s p e e d i n a I n t e r n a t i o n a l C l i n i c a l C e n t r i f u g e ( m o d e l C L ) f o r 5 m i n . T h e a q u e o u s p h a s e ( u p p e r ) w a s t h e n t r a n s f e r r e d t o a f r e s h t u b e a n d t h i s p r o c e s s r e p e a t e d o n c e w i t h a 50:50 m i x t u r e o f p h e n o l / c h l o r o f o r m a n d t w i c e w i t h c h l o r o f o r m . T w o v o l u m e s o f e t h a n o l w e r e a d d e d t o t h e f i n a l l y s a t e t o p r e c i p i t a t e the D N A that w a s t h e n r e m o v e d e i t h e r b y m a n u a l s p o o l i n g a r o u n d t h e t i p o f a P a s t e u r p i p e t t e o r b y c e n t r i f u g a t i o n . T h e D N A w a s a l l o w e d t o d r y a n d t h e n r e s u s p e n d e d i n 4 0 0 ul H 2 0 . D N A w a s p r e p a r e d f r o m b u c c a l s a m p l e s i n a s i m i l a r m a n n e r ( S p i t z et al, 1996). P u r i f i e d D N A w a s q u a n t i f i e d at 2 6 0 n m o n a P h a r m a c i a B i o T e c h s p e c t r o p h o t o m e t e r . D N A y i e l d f r o m a s i n g l e t u b e o f b l o o d w a s a p p r o x i m a t e l y 2 0 0 ug a n d a v e r a g e r e c o v e r y f r o m the b u c c a l s a m p l e s w a s a p p r o x i m a t e l y 8 8 ug a l t h o u g h t h i s r a n g e d w i d e l y ( 1 2 - 3 2 0 ug). F o l l o w i n g q u a n t i f i c a t i o n , t h e D N A w a s a l i q u o t e d i n t o 10-100 ng /ul s a m p l e s f o r P C R a n d t h e r e m a i n d e r s t o r e d at -70° C . L y m p h o b l a s t c e l l l i n e s w e r e p r o p a g a t e d a n d m a i n t a i n e d i n D r . C . J. B r o w n ' s l a b i n t h e D e p t . o f M e d i c a l G e n e t i c s , U.B.C. b y S a r a h B a l d r y . D N A , R N A a n d c D N A w e r e p r e p a r e d f r o m t h e s e c e l l l i n e s u s i n g e s t a b l i s h e d t e c h n i q u e s ( M i l l e r et al, 1988; C h o m c z y n s k i , 1989). C h i m p a n z e e D N A w a s k i n d l y p r o v i d e d b y D r . C . J. B r o w n . Genotyping M o s t o f t h e p o l y m o r p h i s m s w e r e a s s a y e d b y r e s t r i c t i o n f r a g m e n t l e n g t h p o l y m o r p h i s m ( R F L P ) a n a l y s i s . T h e d e t a i l s o f s p e c i f i c a n a l y s e s are g i v e n i n t h e a p p r o p r i a t e c h a p t e r s . I n g e n e r a l , t h e r e g i o n s p a n n i n g t h e p o l y m o r p h i c sit e w a s a m p l i f i e d b y P C R a n d t h e p r o d u c t d i g e s t e d w i t h a d i a g n o s t i c r e s t r i c t i o n e n z y m e . D i g e s t i o n p r o d u c t s w e r e e l e c t r o p h o r e s e d o n 8 % p o l y a c r y l a m i d e g e l s r u n i n T r i s - b o r a t e - E D T A b u f f e r ( 8 9 m M T r i s , 8 9 m M b o r i c a c i d , 2 m M E D T A ) a n d v i s u a l i z e d b y e t h i d i u m b r o m i d e ( E t B r ) s t a i n i n g . T h e s i z e s o f a m p l i f i c a t i o n a n d d i g e s t i o n p r o d u c t s w e r e e s t i m a t e d b y c o m p a r i s o n t o a 100 b a s e p a i r l a d d e r ( G i b c o B R L , G a i t h e r s b u r g , M D ) r u n o n t h e s a m e g e l . F o r d a t a p r e s e n t a t i o n , p h o t o g r a p h s w e r e d i g i t i z e d u s i n g a n A g f a A r c u s II s c a n n e r a n d i n c o r p o r a t e d i n t o A d o b e P h o t o s h o p i m a g e s . 3 3 DNA Sequencing D N A s e q u e n c i n g w a s p e r f o r m e d b y the N u c l e i c A c i d - P r o t e i n S e r v i c e U n i t ( N A P S ) at the U.B.C. P C R p r o d u c t w a s u s e d as a t e m p l a t e . C o n d i t i o n s f o r P C R a m p l i f i c a t i o n a r e d e s c r i b e d i n s u b s e q u e n t c h a p t e r s . F o u r i d e n t i c a l 2 5 ul a m p l i f i c a t i o n r e a c t i o n s w e r e p o o l e d , e l e c t r o p h o r e s e d o n a 2 % a g a r o s e g e l r u n i n t r i s - a c e t a t e - E D T A b u f f e r ( 4 0 m M T r i s acetate, 2 m M E D T A ) a n d t h e p r o d u c t v i s u a l i z e d b y E t B r s t a i n i n g . T h e a m p l i f i c a t i o n p r o d u c t w a s c u t o u t o f t h e g e l a n d p u r i f i e d o v e r Q i a Q u i c k c o l u m n s ( Q i a g e n Inc., O N , C a n a d a ) . N i n e t y t o 2 0 0 n g o f t h i s p r o d u c t a n d a n a p p r o p r i a t e p r i m e r (3.2 p m o l / u l ) w a s t h e n s e n t t o N A P S f o r d i - d e o x y s e q u e n c i n g . D N A s e q u e n c e d a t a w e r e a n a l y z e d u s i n g a n u m b e r o f s e q u e n c e p r o g r a m s i n c l u d i n g D N A S t r i d e r 1.0 ( I n s t i t u t d e R e c h e r c h e F o n d a m e n t a l e , F r a n c e ) that w a s u s e d f o r r e s t r i c t i o n e n z y m e s i t e m a p p i n g a n d B L A S T ( B a s i c L o c a l A l i g n m e n t S e a r c h T o o l ) that w a s u s e d f o r s e q u e n c e a l i g n m e n t . B L A S T i s a v a i l a b l e t h r o u g h t h e N a t i o n a l C e n t e r f o r B i o l o g i c a l I n f o r m a t i o n ( N C B I ) at http://www.ncbi. nlm.nih.gov/. S e q u e n c e s u s e d f o r c o m p a r i s o n w e r e o b t a i n e d o n - l i n e t h r o u g h G e n B a n k , w h i c h w a s a l s o a c c e s s e d t h r o u g h t h e N C B I site. A m b i g u o u s b a s e s w e r e r e s o l v e d b y r e - s e q u e n c i n g a n e w t e m p l a t e p r e p a r a t i o n , u s u a l l y o n t h e o t h e r s t r a n d . Statistical analysis C h a n g e s i n a l l e l e f r e q u e n c i e s o v e r t i m e w e r e e s t i m a t e d u s i n g P o p B i o 2.4, P o p u l a t i o n b i o l o g y s i m u l a t i o n s f o r M a c i n t o s h ( © E r i c B o w m a n a n d t h e R e e d I n s t i t u t e , 1990-1995, a v a i l a b l e at h ttp://web.reed.edu/academic/departments/biology/software.html). A l l e l e f r e q u e n c i e s w e r e e s t a b l i s h e d b y g e n e c o u n t i n g a n d c o m p a r e d e i t h e r b y t w o w a y c o n t i n g e n c y t a b l e s u s i n g S t a t V i e w S E s o f t w a r e ( A b a c u s C o n c e p t s Inc., B e r k e l e y , C A ) or, i f e x p e c t e d v a l u e s w e r e l e s s t h a n f i v e , b y F i s h e r ' s e x a c t test ( S i e g e l a n d C a s t e l l a n Jr., 1988). T e s t s f o r H a r d y W e i n b e r g e q u i l i b r i u m ( m o d i f i e d M a r k o v - c h a i n r a n d o m w a l k a l g o r i t h m ) and, w h e n m u l t i p l e p o l y m o r p h i s m s w e r e e x a m i n e d i n a s i n g l e gene, l i n k a g e d i s e q u i l i b r i u m a n a l y s i s ( l i k e l i h o o d - r a t i o test f o r p h a s e u n k n o w n g e n o t y p i c data) w e r e p e r f o r m e d u s i n g A r l e q u i n s o f t w a r e ( S c h n e i d e r et al, 1997) a v a i l a b l e at http://anthropologie.unige.ch/arlequin/). 3 4 Chapter 3 B-fibrinogen allele frequencies in the Quechua1 Introduction E l e v a t e d h e m a t o c r i t s are a c h a r a c t e r i s t i c r e s p o n s e t o h i g h a l t i t u d e h y p o x i a i n h u m a n s . T h i s i s t r u e f o r b o t h r e c e n t l y a c c l i m a t e d l o w - l a n d e r s a n d f o r n a t i v e s w h o h a v e s p e n t t h e i r l i v e s i n t h e m o u n t a i n s . R e p o r t e d h e m a t o c r i t v a l u e s i n Q u e c h u a m e n l i v i n g at o v e r 3 0 0 0 m o f t e n e x c e e d 5 0 % ( t a b l e 1.1 a n d f i g u r e 1.2). W h i l e t h e s e v a l u e s a r e n o t o u t s i d e o f t h e n o r m a l r a n g e f o r m a l e s at s e a l e v e l ( 4 0 % - 5 4 % ) , t h e y t e n d t o b e h i g h e r t h a n t h e s e a l e v e l a v e r a g e ( 4 7 % ; T h o m a s , 1993). T h e a d v a n t a g e t o h a v i n g a h i g h h e m a t o c r i t i n h y p o x i c c o n d i t i o n s i s that the r e s u l t a n t i n c r e a s e i n h e m o g l o b i n c o n c e n t r a t i o n i n c r e a s e s the o x y g e n c a r r y i n g c a p a c i t y o f t h e b l o o d , t h e r e b y f a c i l i t a t i n g o x y g e n t r a n s p o r t t o t h e t i s s u e . T h e r e i s h o w e v e r a p o t e n t i a l d i s a d v a n t a g e to t h i s s t r a t e g y : i n c r e a s e d h e m a t o c r i t s r e s u l t i n e l e v a t e d b l o o d v i s c o s i t y ( f i g u r e 3.1) w h i c h i n t u r n h a s b e e n a s s o c i a t e d w i t h a n u m b e r o f c a r d i o v a s c u l a r d i s o r d e r s i n c l u d i n g m y o c a r d i a l i n f a r c t i o n , a n d c o r o n a r y t h r o m b o s i s as w e l l as c i r c u l a t o r y p r o b l e m s s u c h as h y p e r t e n s i o n ( D i n t i n f a s s , 1981). H y p e r v i s c o s i t y m a y a l s o c o n t r i b u t e t o t h e e t i o l o g y o f c h r o n i c m o u n t a i n s i c k n e s s , a p o l y c y t h e m i c c o n d i t i o n that o c c u r s i n h i g h a l t i t u d e n a t i v e s ( p r i m a r i l y A n d e a n ) f o r w h i c h the o n l y l o n g t e r m c u r e i s d e s c e n t t o l o w e r a l t i t u d e s ( W i n s l o w a n d M o n g e , 1987). W h o l e b l o o d is a n o n -N e w t o n i a n f l u i d a n d its v i s c o s i t y i s d e p e n d e n t o n b o t h i n t r i n s i c f a c t o r s , s u c h as h e m a t o c r i t a n d p l a s m a c o m p o s i t i o n as w e l l as o n e x t r i n s i c c o n d i t i o n s s u c h as t h e s i z e o f t h e v e s s e l s t h r o u g h w h i c h i t i s f l o w i n g . F u r t h e r m o r e , b l o o d c e l l s are f l e x i b l e f l u i d f i l l e d s t r u c t u r e s a n d d o n o t b e h a v e as r i g i d p a r t i c l e s i n a f l o w i n g s o l u t i o n ( f i g 3.1). T h e s e c h a r a c t e r i s t i c s a l l o w b l o o d t o f l o w at h e m a t o c r i t s a b o v e 6 5 % w h e n , i f i t w e r e a s u s p e n s i o n o f r i g i d p a r t i c l e s , i t w o u l d , as D i n t i n f a s s e x p r e s s e d i t , " a c h i e v e t h e c o n s i s t e n c y o f c o n c r e t e " ( D i n t i n f a s s , 1985). D e s p i t e t h e s e c h a r a c t e r i s t i c s , t h e i n c r e a s e i n v i s c o s i t y a s s o c i a t e d w i t h h i g h h e m a t o c r i t s i m p e d e s b l o o d f l o w b y 1 Much of the material presented in this chapter has previously been published as: J. L. Rupert, D. V. Devine, M. V. Monsalve, P. W. Hochachka. 1999.13-fibrinogen allele frequencies in Peruvian Quechua, a high-altitude native population. Am. J. Phys. Anthro. 109 181-186.. 3 5 i n c r e a s i n g r e s i s t a n c e . T h i s p h e n o m e n o n m a y b e e x a c e r b a t e d at a l t i t u d e d u e to the d e c r e a s e i n v e s s e l d i a m e t e r r e s u l t i n g f r o m h y p o x i c v a s o c o n s t r i c t i o n . H e m a t o c r i t (%) Figure 3.1. a) Relative viscosity (nr) as a function of particle concentration. The solid line shows the viscosity for a hypothetical solid particle. The shaded area is the range for blood, b) The effect of fibrinogen concentration on plasma viscosity, c) The effect of fibrinogen concentration on total blood viscosity (with a hematocrit of 45%). Adapted from Dintinfass, 1985. B l o o d v i s c o s i t y i s a l s o a f f e c t e d b y the c o n c e n t r a t i o n o f v a r i o u s p l a s m a p r o t e i n s . T h e m a j o r d e t e r m i n a n t o f p l a s m a v i s c o s i t y is f i b r i n o g e n ( L o w e et al, 1993), a c o m m o n p l a s m a p r o t e i n (1.9 - 4.5 m g / m l ) that i s t h e p r e c u r s o r t o f i b r i n , t h e p r i m a r y c o m p o n e n t o f b l o o d c l o t s ( f i g u r e 3.1). F i b r i n o g e n l e v e l s are g e n e t i c a l l y r e g u l a t e d , a n d s e v e r a l p o l y m o r p h i s m s a f f e c t i n g t h e s e l e v e l s a r e l o c a t e d i n , o r near, the g e n e e n c o d i n g the b e t a c h a i n o f f i b r i n o g e n ( B - f i b r i n o g e n ) . 3 6 T h i s p o l y p e p t i d e i s o n e o f t h r e e ( a l o n g w i t h a n a l p h a a n d g a m m a ) that c o m p r i s e f i b r i n o g e n a n d i s t h e r a t e d e t e r m i n i n g c o m p o n e n t i n h o l o p r o t e i n a s s e m b l y ( Y u et al, 1984). A g u a n o s i n e ( G ) to a d e n o s i n e ( A ) t r a n s i t i o n at b a s e -455 ( s o m e t i m e s r e p o r t e d as b e i n g at b a s e -453) i s a s s o c i a t e d w i t h a n - 1 0 % i n c r e a s e i n f i b r i n o g e n i n b o t h A / A h o m o z y g o t e s a n d A / G h e t e r o z y g o t e s ( T h o m a s et al, 1991). A s e c o n d u p s t r e a m m u t a t i o n , a c y t o s i n e ( C ) t o t h y m i d i n e ( T ) t r a n s i t i o n at b a s e -148, i s a s s o c i a t e d w i t h a s i m i l a r i n c r e a s e ( + 1 0 % i n T / T h o m o z y g o t e s , + 6 % i n h e t e r o z y g o t e s ( H e i n r i c h et al, 1995). W i t h i n t h e gene, a G to A t r a n s i t i o n at b a s e 448, w h i c h s u b s t i t u t e s a n a r g i n i n e r e s i d u e f o r a l y s i n e ( S c h m e l z e r et al, 1988) h a s b e e n a s s o c i a t e d w i t h a 3 3 % i n c r e a s e i n p l a s m a f i b r i n o g e n c o n c e n t r a t i o n i n p o o l e d h o m o z y g o t e s a n d h e t e r o z y g o t e s ( C a r t e r et al, 1997). T h e p h e n o t y p e v a r i e s ( s o m e s t u d i e s , s u c h as C o n n e r et al, ( 1 9 9 2 ) f o u n d n o s i g n i f i c a n t e f f e c t ) a n d a p p e a r s t o b e i n f l u e n c e d b y g e n d e r ( C a r t e r et al, 1997; d e M a a t et al, 1995) a n d b y e n v i r o n m e n t a l c o n d i t i o n s s u c h as e x e r c i s e ( M o n t g o m e r y etal, 1995). T h e a l l e l e s a s s o c i a t e d w i t h i n c r e a s e d f i b r i n o g e n a r e f a i r l y c o m m o n i n m o s t o f t h e p o p u l a t i o n s t e s t e d t h u s far, r a n g i n g f r o m 1 1 % i n t h e I n u i t t o o v e r 3 0 % i n s o m e C a u c a s i a n g r o u p s ( d e M a a t et al, 1995). intrinsic pathway extrinsic pathway p r o t h r o m b i n pro-thrombin activator t h r o m b i n Factor Xllla • r: -> fibrinogen (a, 8, y subunits) FPB, FPA „ > fibrin monomer fibrin polymer Figure 3.2 The role of fibrinogen in the clotting cascade. Fibrinogen is the precursor to fibrin, the actual clot forming substance. The beta subunit of the fibrinogen multimer is the limiting component in fibrinogen assembly. 3 7 S e l e c t i v e p r e s s u r e i n h i g h a l t i t u d e p o p u l a t i o n s t o a m e l i o r a t e t h e d e t r i m e n t a l e f f e c t s o f h i g h e r h e m a t o c r i t s o n b l o o d v i s c o s i t y m a y b e r e f l e c t e d i n a l o w f r e q u e n c y o f the a l l e l e s a s s o c i a t e d w i t h i n c r e a s e d f i b r i n o g e n r e l a t i v e t o p o p u l a t i o n s r e s i d i n g at, o r near, s e a l e v e l . T o test t h i s h y p o t h e s i s , t h e B - f i b r i n o g e n g e n o t y p e s o f 6 0 Q u e c h u a w e r e d e t e r m i n e d as w e r e th e g e n o t y p e s o f t h e t w o l o w l a n d p o p u l a t i o n s . R e l a t i v e p l a s m a v i s c o s i t y w a s a l s o d e t e r m i n e d f o r a s u b s e t o f t h e Q u e c h u a a n d a s m a l l s a m p l e o f C a u c a s i a n s . Materials and Methods Genotyping P o l y m o r p h i s m s i n t h e B - f i b r i n o g e n g e n e w e r e i d e n t i f i e d b y r e s t r i c t i o n e n d o n u c l e a s e d i g e s t i o n o f P C R a m p l i f i e d D N A . P r i m e r p r o d u c t s i z e a n d d i a g n o s t i c e n z y m e s are s h o w n i n t a b l e 3.1. I n a d d i t i o n , t h e g e n o t y p e f o r a Rsa I p o l y m o r p h i s m i n t h e H 1 9 g e n e w a s d e t e r m i n e d i n a s u b s e t o f t h e Q u e c h u a as a test o f h e t e r o g e n e i t y . P r i m e r s e q u e n c e s a r e g i v e n i n a p p e n d i x i i . P r i m e r s F i b - B 6 a n d F i b - B 7 h a v e p r e v i o u s l y b e e n d e s c r i b e d ( B a u m a n n a n d H e n s c h e n , 1993a). T h e p r i m e r s i n H I 9 w e r e a g i f t f r o m D r . C . B r o w n (U.B.C.) a n d h a v e b e e n p r e v i o u s l y d e s c r i b e d ( J i n n o et al, 1995). D N A ( 5 0 - 2 0 0 n g ) w a s a m p l i f i e d i n a P e r k i n E l m e r D N A T h e r m a l C y c l e r u s i n g 0.033 n m o l e s o f e a c h p r i m e r a n d 0.625 u n i t s Taq p o l y m e r a s e ( G i b c o B R L , G a i t h e r s b u r g , M D ) . T h e f i n a l r e a c t i o n m i x t u r e ( 2 5 ul) w a s 0.2 m M d N T P s , 1.5 m M M g C l 2 , 2 0 m M T r i s / C l p H 8.4 a n d 5 0 m M K C 1 . A m p l i f i c a t i o n c o n d i t i o n s w e r e 9 4 ° C , 1 min.; 5 8 ° C , 1 min.; 7 2 ° C , 2 m i n . f o r 4 0 c y c l e s . A m p l i f i e d p r o d u c t ( 1 0 p i ) w a s t h e n d i g e s t e d u s i n g 0.2 -1.0 u n i t s o f t h e a p p r o p r i a t e r e s t r i c t i o n e n d o n u c l e a s e u n d e r the c o n d i t i o n s p r e s c r i b e d b y t h e m a n u f a c t u r e r s a n d s e p a r a t e d o n 8 % p o l y a c r y l a m i d e g e l s ( f i g u r e 3.3). C h i m p a n z e e (Pan troglodytes ) D N A w a s a m p l i f i e d u s i n g t h e s a m e p r i m e r p a i r s a n d s i m i l a r c o n d i t i o n s t o t h o s e u s e d f o r h u m a n g e n o t y p i n g ( a n n e a l i n g t e m p e r a t u r e w a s l o w e r e d to 5 6 ° C ) . A m p l i f i c a t i o n p r o d u c t w a s p u r i f i e d a n d s e q u e n c e d o n b o t h s t r a n d s u s i n g t h e p r i m e r s F i b - 1 A , F i b - I B , F i b - l C , F i b - l A r e v , F i b - B 6 a n d F i b - B 7 . 38 G / G G / A A / A C / C C / T T / T G / G G / A A / A G/ A " 4 5 5 (Hae III) CfT-l4\Hind III) G / A + 4 4 8 (Mn/1) F i g u r e 3.3. A s s a y f o r R F L P s i n t h e 8 - f i b r i n o g e n g e n e . R e p r e s e n t a t i v e p o l y a c r y l a m i d e g e l s s h o w i n g s e p a r a t i o n o f d i g e s t i o n p r o d u c t s f o r t h e R F L P s u s e d t o i d e n t i f y a l l e l e s o f t h e 6 - f i b r i n o g e n g e n e . G e n o t y p e s a r e g i v e n a c r o s s t h e t o p o f e a c h p a n e l . T h e p o l y m o r p h i s m a n d t h e r e s t r i c t i o n e n d o n u c l e a s e u s e d t o c h a r a c t e r i z e i t a r e g i v e n a c r o s s t h e b o t t o m . T h e b a n d i n d i c a t e d b y * is a p r i m e r a r t e f a c t t h a t d i d n o t i n t e r f e r e i n t h e d e t e r m i n a t i o n o f g e n o t y p e . F r a g m e n t s i z e s a r e i n b a s e p a i r s . 39 Table 3.1: fi-fibrinogen PCR primers. Product size and location of primers used for sequencing and polymorphism analysis of the fi-fibrinogen gene. Primer* Product size Polymorphism F i b - l C : F i b - l A r e v 2 0 4 b p G / A 4 5 5 ( / 7 a e I I I ) F i b - I A : F i b - I B 3 3 9 b p C / T 1 4 8 {Hind III) F i b - B 6 : F i b - B 7 3 1 4 b p G / A 4 4 8 {Mnl I) *Primer sequences are given in appendix ii. Viscosity measurements R e l a t i v e p l a s m a v i s c o s i t y w a s d e t e r m i n e d u s i n g a C a n o n 100 v i s c o m e t e r ( k i n d l y p r o v i d e d b y D r . D . B r o o k s , D e p t . o f C h e m i s t r y , U.B.C.) s u s p e n d e d i n a f i v e g a l l o n w a t e r b a t h . T e m p e r a t u r e w a s m a i n t a i n e d at b e t w e e n 2 5 ° C a n d 2 7 ° C, a l t h o u g h r e l a t i v e v i s c o s i t y i s n o t s i g n i f i c a n t l y a f f e c t e d b y t e m p e r a t u r e s b e t w e e n 1 5 ° C a n d 4 0 ° C ( D u c k , 1990). A f t e r b e i n g s e p a r a t e d f r o m the b l o o d c e l l s b y c e n t r i f u g a t i o n ( 2 0 0 0 r p m , 10 min.), a s a m p l e o f p l a s m a w a s l o a d e d i n t o the v i s c o m e t e r a n d a l l o w e d t o e q u i l i b r a t e f o r 2 m i n . p r i o r t o t e s t i n g . T h e s a m p l e w a s t h e n d r a w n u p i n t o t h e v i s c o m e t e r r e s e r v o i r b y m a n u a l s u c t i o n , r e l e a s e d a n d t i m e d as i t f l o w e d t h r o u g h t h e a p p a r a t u s . T h r e e s e p a r a t e m e a s u r e m e n t s w e r e m a d e a n d a v e r a g e d f o r e a c h s a m p l e . R e l a t i v e v i s c o s i t y w a s d e t e r m i n e d b y c o m p a r i n g the e l a p s e d t i m e o f f l o w t h r o u g h t h e v i s c o m e t e r to that o f d i s t i l l e d w a t e r m e a s u r e d u n d e r i d e n t i c a l c o n d i t i o n s . T o a v o i d d i l u t i o n o f t h e p l a s m a , s a m p l e s f o r w h i c h v i s c o s i t y w a s to b e m e a s u r e d w e r e c o l l e c t e d i n V a c u t a i n e r t u b e s w i t h d r y a n t i c o a g u l a n t ( E D T A p o w d e r ) . A l l o f the v i s c o s i t y m e a s u r e m e n t s w e r e m a d e i n t h e R e g i o n a l H o s p i t a l i n C u s c o , P e r u w h e r e l a b o r a t o r y s p a c e a n d e q u i p m e n t h a d k i n d l y b e e n m a d e a v a i l a b l e b y D r . J. P o n c e d e L e o n o f t h e L a b o r a t o r i o C l i n i c o . Results fi-fibrinogen genotypes G e n o t y p e a n d a l l e l e f r e q u e n c i e s f o r t h e t h r e e 6 - f i b r i n o g e n p o l y m o r p h i s m s i n t h e Q u e c h u a , N a - D e n e a n d C a u c a s i a n s a r e g i v e n i n t a b l e 3.2. I n the Q u e c h u a , t h e a l l e l e f r e q u e n c i e s f o r a l l t h r e e p o l y m o r p h i s m s d i f f e r s i g n i f i c a n t l y f r o m t h o s e o f b o t h t h e N a - D e n e a n d t h e 4 0 C a u c a s i a n s a f t e r c o r r e c t i o n f o r n u m b e r o f p o l y m o r p h i s m s t e s t e d (3) (i.e. P < 0 . 0 1 7 f o r 1 d.f.). T h e f r e q u e n c i e s i n t h e C a u c a s i a n s a m p l e are n o t s i g n i f i c a n t l y d i f f e r e n t f r o m t h o s e o f the N a -D e n e o r f r o m t h o s e p r e v i o u s l y r e p o r t e d i n t h e l i t e r a t u r e f o r C a u c a s i a n s (e.g. T h o m a s et al, 1994; M o n t g o m e r y et al, 1995; C a r t e r et al, 1997). G e n o t y p e f r e q u e n c i e s w e r e i n H a r d y - W e i n b e r g e q u i l i b r i u m i n a l l t h r e e s a m p l e s . T h e r e w a s s i g n i f i c a n t l i n k a g e d i s e q u i l i b r i u m b e t w e e n a l l e l e s at a l l t h r e e l o c i ( t a b l e 3.3) c o n s i s t e n t w i t h t h e h a p l o t y p e s G ^ V C ^ / G 4 4 8 a n d A ^ / T ^ / A 4 4 8 . T h e a l l e l e f r e q u e n c i e s f o r t h e Rsa I p o l y m o r p h i s m i n t h e H 1 9 g e n e i n a s u b s e t o f t h e Q u e c h u a ( n = 1 4 ) w a s 0.64 ( T ) : 0.36 ( C ) . A l l e l e f r e q u e n c i e s f o r t h e B - f i b r i n o g e n p o l y m o r p h i s m s a r e a v a i l a b l e o n l i n e t h r o u g h T h e A l l e l e F r e q u e n c y D a t a b a s e ( A l f r e d ) , w h i c h i s m a i n t a i n e d b y D r . K e n K i d d ' s l a b at Y a l e U n i v e r s i t y ( N e w H a v e n , C T ) . T h e U R L f o r t h i s s i t e i s : http://alfred.med.yale.edu/alfred/index.asp. S e v e n h u n d r e d a n d s i x b a s e s o f the c h i m p a n z e e B - f i b r i n o g e n g e n e w e r e s e q u e n c e d (see a p p e n d i x iiia). T h e c h i m p a n z e e h a d a G at b a s e -455, a T at b a s e -148 a n d a n A at b a s e 448. T h e s e q u e n c e s w e r e h i g h l y c o n s e r v e d ; a s i d e f r o m the h u m a n p o l y m o r p h i c sites t h e r e w e r e o n l y t w o d i s c r e p a n c i e s b e t w e e n t h e s e q u e n c e s . S e q u e n c e d a t a are a v a i l a b l e t h r o u g h G e n B a n k ( a c c e s s i o n N u m b e r s A F 2 0 0 3 5 4 , A F 2 0 0 3 5 5 a n d A F 2 0 0 3 5 6 ) . T h e r e l a t i v e p l a s m a v i s c o s i t i e s o f 3 4 Q u e c h u a p l a s m a s a m p l e s w e r e d e t e r m i n e d a n d c o m p a r e d w i t h t h o s e o f t h r e e C a u c a s i a n r e s e a r c h e r s s a m p l e d a n d a s s a y e d u n d e r t h e s a m e c o n d i t i o n s ( f i g u r e 3.4). T h e v a l u e s b e t w e e n the t w o g r o u p s w e r e s i m i l a r ( Q u e c h u a : 1.85, s = 0.08; C a u c a s i a n s : 1.81, s = 0.08). B o t h w e r e l o w e r t h a n t h e n o r m a l m e a n (2.01) b u t f e l l w i t h i n the n o r m a l r a n g e (1.76 - 2.35; D u c k , 1990). Figure 3.4. Relative plasma viscosity of Caucasians (n = 3) and Quechua (n=34). The normal mean (thick dashed line) and range (95%, thin dashed line) are shown (Duck, 1990). C a u c a s i a n Q u e c h u a o o •> a > '3 8. n 41 Table 3.2. fi-fibrinogen genotype and allele frequencies for the Quechua, Na-Dene and Caucasian samples G / A " 4 5 5 genotype Population G/G G/A A / A Quechua 58 2 0 Na-Dene 37 10 3 Caucasian 21 10 0 G / A " 4 5 5 allele frequencies Quechua Na-Dene Caucasian C/T" 1 4 8 genotype Population C/C C/T T/T Quechua 58 2 0 Na-Dene 37 10 3 Caucasian 21 10 0 G / A 4 4 8 genotype Population G/G G/A A / A Quechua 58 2 0 Na-Dene 37 10 3 Caucasian 22 9 0 C/T" 1 4 8 allele frequencies Quechua Na-Dene Caucasian G / A 4 4 8 allele frequencies Quechua Na-Dene Caucasian l rThe Quechua are significantly lower than both the Caucasians and the North American natives (Na-Dene) (P<0.016 for 1 df). 2 T h e North American (Na-Dene) native frequencies are not significantly different from Caucasians (P<0.05 for 1 df). 4 2 Table 3.3: Linkage disequilibrium between polymorphisms in the fi-fibrinogen gene in Quechua, Na-Dene and Caucasians. Quechua P o l y m o r p h i c G / A " 4 5 5 C / T 1 4 8 G / A l o c u s G / A * + + C / T " 1 4 8 + * + G / A 4 4 8 + + * Na-Dene P o l y m o r p h i c l o c u s G / A " 4 5 5 C / T " 1 4 8 G / A G/A" 4 5 5 * + + C / T - 1 4 8 + * + G / A 4 4 8 + + * Caucasian P o l y m o r p h i c G / A " 4 5 5 C / T 1 4 8 G / A l o c u s G / A " 4 5 5 * + + C / T " 1 4 8 + * + G / A 4 4 8 + + * Pairs denoted by + are in significant linkage disequilibrium (p<0.01). Discussion T h e f r e q u e n c i e s o f t h e B - f i b r i n o g e n a l l e l e s A* 4 5 5, T " 1 4 8 a n d A 4 4 8 w e r e s i g n i f i c a n t l y l o w e r i n t h e Q u e c h u a s a m p l e t h a n i n b o t h t h e N a - D e n e a n d th e C a u c a s i a n s a m p l e s . A s t h e s e a l l e l e s are a s s o c i a t e d w i t h h i g h e r l e v e l s o f f i b r i n o g e n , t h i s u n d e r - r e p r e s e n t a t i o n m a y s e r v e t o m i t i g a t e the d e l e t e r i o u s e f f e c t s o f t h e c h r o n i c p o l y c y t h e m i a c h a r a c t e r i s t i c o f h i g h a l t i t u d e p o p u l a t i o n s b y l i m i t i n g t h e c o n t r i b u t i o n o f f i b r i n o g e n to b l o o d v i s c o s i t y . R e d u c e d f i b r i n o g e n l e v e l s w o u l d b e p a r t i c u l a r l y b e n e f i c i a l i n t h e s e p o p u l a t i o n s as the e f f e c t s o f h i g h f i b r i n o g e n l e v e l s o n b l o o d v i s c o s i t y ( M a y e r et al, 1966) a n d o n e r y t h r o c y t e a g g r e g a t i o n ( T a n a h a s h i et al, 1989) are e x a c e r b a t e d b y h i g h r e d b l o o d c e l l c o u n t s . H i g h f i b r i n o g e n c o n c e n t r a t i o n s and, t o s o m e extent, f i b r i n o g e n g e n o t y p e h a v e b e e n i m p l i c a t e d i n the d e v e l o p m e n t o f c a r d i o v a s c u l a r d i s e a s e ( H e i n r i c h a n d A s s m a n n , 1995; C a r t e r et al, 1997). A p a u c i t y o f t h e a l l e l e s a s s o c i a t e d w i t h h i g h e r c o n c e n t r a t i o n s o f f i b r i n o g e n m a y a l s o c o n t r i b u t e to t h e r e l a t i v e l y l o w i n c i d e n c e o f s y s t e m i c 4 3 h y p e r t e n s i o n ( H e a t h a n d W i l l i a m s , 1995) a n d h e a r t d i s e a s e ( W a y , 1976) r e p o r t e d i n t h e Q u e c h u a . I n i t i a l l y , i t w a s a c o n c e r n that t h e l i m i t e d v a r i a t i o n at t h e 6 - f i b r i n o g e n l o c u s that w a s o b s e r v e d i n t h e Q u e c h u a w a s s i m p l y d u e to g e n e t i c h o m o g e n e i t y i n t h e s a m p l e p o p u l a t i o n . T o a d d r e s s t h i s p o s s i b i l i t y , t h e f r e q u e n c y o f a c o m m o n p o l y m o r p h i s m i n H I 9 , a g e n e that e n c o d e s a f u n c t i o n a l R N A e x p r e s s e d i n the f e t u s a n d p l a c e n t a ( Z h a n g a n d T y c k o , 1992) a n d is n o n -s y n t e n i c t o t h e 6 - f i b r i n o g e n gene, w a s d e t e r m i n e d . T h e s u b s e t o f Q u e c h u a D N A s that w a s a n a l y z e d w a s h e t e r o g e n e o u s f o r t h i s p o l y m o r p h i s m , s u g g e s t i n g that t h e l o w f r e q u e n c y o f a s u b s e t o f B - f i b r i n o g e n a l l e l e s i n o u r Q u e c h u a w a s n o t s i m p l y d u e to g e n e t i c h o m o g e n e i t y . A d d i t i o n a l l y , h e t e r o g e n e i t y w a s s u b s e q u e n t l y d e m o n s t r a t e d i n t w o o t h e r g e n e s ( t h o s e e n c o d i n g a n g i o t e n s i n c o n v e r t i n g e n z y m e a n d the 6 2 - a d r e n e r g i c r e c e p t o r ) f o r the s a m e s a m p l e p o p u l a t i o n ( R u p e r t et al, 1999; see c h a p t e r s 4 a n d 5). E a c h o f t h e a l l e l e s a s s o c i a t e d w i t h i n c r e a s e d f i b r i n o g e n w a s q u i t e r a r e i n o u r Q u e c h u a s a m p l e ( t w o c o p i e s i n 1 2 0 c h r o m o s o m e s ) . A s s u m i n g th a t C a u c a s i a n a d m i x t u r e i n the s a m p l e w a s s i m i l a r t o t h a t p r e v i o u s l y r e p o r t e d f o r c o n t e m p o r a r y Q u e c h u a (0.247; S a l z a n o a n d C a l l e g a r i -J a c q u e s , 1 9 8 8 ) a n d a f r e q u e n c y o f t h e l e s s c o m m o n a l l e l e s i n C a u c a s i a n s o f 0.16, o n e w o u l d e x p e c t a p p r o x i m a t e l y f o u r r a r e a l l e l e s i n o u r s a m p l e d u e to g e n e t i c a d m i x t u r e a l o n e . T h i s r a i s e s t h e p o s s i b i l i t y t h a t t h e s e a l l e l e s w e r e a p o s t - C o l o m b i a n a d d i t i o n t o t h e Q u e c h u a g e n e p o o l o r that s e l e c t i o n i s s u f f i c i e n t t o e l i m i n a t e t h e m as t h e y a r e i n t r o d u c e d . I f t h e l a t t e r w e r e true, o n e w o u l d e x p e c t t h a t t h e a l l e l e s w o u l d a l s o b e rare i n H i s p a n i c s w h o s e a n c e s t o r s h a v e b e e n l i v i n g o n the a l t i p l a n o . C l e a r l y , m o r e d a t a are n e e d e d to a d d r e s s t h i s i s s u e , e s p e c i a l l y p e r t a i n i n g to a d m i x t u r e i n t h e c o m m u n i t i e s f r o m w h i c h t h e Q u e c h u a v o l u n t e e r s l i v e d a n d t h e f r e q u e n c y o f t h i s a l l e l e i n o t h e r S o u t h A m e r i c a n p o p u l a t i o n s , b o t h o f i n d i g e n o u s a n d c o l o n i a l d e s c e n t . B o t h o u r d a t a f o r the N a - D e n e a n d d a t a p u b l i s h e d f o r t h e I n u i t ( d e M a a t et al, 1995) s u g g e s t that the B - f i b r i n o g e n a l l e l e f r e q u e n c i e s that w a s o b s e r v e d i n t h e Q u e c h u a are n o t c h a r a c t e r i s t i c o f N a t i v e N o r t h A m e r i c a n s i n g e n e r a l . It i s p o s s i b l e t h a t s e l e c t i o n h a s a c t e d o n th e Q u e c h u a , s u b s e q u e n t t o t h e i r o r i g i n a l m i g r a t i o n i n t o t h e h i g h l a n d s , to r e d u c e the f r e q u e n c i e s o f the a l l e l e s a s s o c i a t e d w i t h h i g h e r f i b r i n o g e n s o as t o m i t i g a t e the d e l e t e r i o u s e f f e c t s o f e l e v a t e d 4 4 h e m a t o c r i t s o n b l o o d v i s c o s i t y . A l t h o u g h s e v e r a l s t u d i e s h a v e r e p o r t e d e l e v a t e d h e m a t o c r i t s i n A n d e a n n a t i v e s ( s e e t a b l e 1.1 a n d f i g u r e 1.2), as d i s c u s s e d i n t h e i n t r o d u c t i o n a n d i n c h a p t e r 6 s o m e r e s e a r c h e r s b e l i e v e that v e r y h i g h h e m a t o c r i t s c a n b e a c c o u n t e d f o r b y f a c t o r s o t h e r t h a n a l t i t u d e ( s e e G a r r u t t o a n d D u t t , 1983; B a l l e w et al, 1989). T h e h e m a t o c r i t s m e a s u r e d f o r t h e i n d i v i d u a l s w h o d o n a t e d b l o o d f o r t h i s s t u d y ( t a b l e 2.1) w e r e c l o s e t o a v e r a g e s e a l e v e l v a l u e s . W h i l e t h i s o b v i o u s l y b l u n t s t h e s e l e c t i v e p r e s s u r e that w e p o s t u l a t e d t o h a v e f a v o u r e d t h e a l l e l e s t h a t w e r e o v e r - r e p r e s e n t e d i n t h e Q u e c h u a , i t d o e s n o t e x c l u d e t h e p o s s i b i l i t y o f s e l e c t i o n . It i s p o s s i b l e o t h e r c o m p e n s a t o r y m e c h a n i s m s h a v e a r i s e n i n t h e A n d e a n s that l i m i t t h e n e e d f o r s e c o n d a r y p o l y c y t h e m i a b u t that, p r i o r t o t h i s event, t h e r e d u c e d f i b r i n o g e n p h e n o t y p e w a s a d v a n t a g e o u s a n d t h u s s e l e c t e d f o r . T h e i s s u e o f w h e t h e r t h e p r e v a l e n c e o f t h e s e a l l e l e s are c h a r a c t e r i s t i c o f t h e Q u e c h u a a n d n o t o f S o u t h A m e r i c a n n a t i v e s i n g e n e r a l c a n n o t a d d r e s s e d w i t h o u t c o m p a r i n g t h e Q u e c h u a t o c l o s e l y r e l a t e d , l o w a l t i t u d e c o n t r o l p o p u l a t i o n s . T h e a n c e s t o r s o f b o t h t h e N a - D e n e a n d t h e I n u i t are b e l i e v e d t o h a v e a r r i v e d i n N o r t h A m e r i c a d u r i n g d i f f e r e n t m i g r a t i o n w a v e s f r o m that w h i c h i n c l u d e d t h e Q u e c h u a a n t e c e d e n t s ( C a v a l l i - S f o r z a et al, 1994) a n d t h e s e t w o g r o u p s m a y g e n e t i c a l l y q u i t e d i s t a n t f r o m t h e Q u e c h u a . I f so, s i g n i f i c a n t d i f f e r e n c e s i n a l l e l e f r e q u e n c i e s d u e t o s t o c h a s t i c f o r c e s w o u l d t o b e e x p e c t e d . C o u n t e r i n g t h i s , r e c e n t a n a l y s i s o f H L A g e n o t y p e s ( M o n s a l v e et al, 1999) h o w e v e r , s u g g e s t s that the c o l o n i z a t i o n m a y h a v e b e e n a s i n g l e event, a n d t h e r e f o r e , t h e d i v e r g e n c e i n t h e p o p u l a t i o n s m a y n o t b e as g r e a t as i n i t i a l l y t h o u g h t . T h e m e c h a n i s m s b y w h i c h t h e p o l y m o r p h i s m s a f f e c t B - f i b r i n o g e n s y n t h e s i s are u n k n o w n . B o t h u p s t r e a m m u t a t i o n s a r e i n t h e p u t a t i v e 5' r e g u l a t o r y r e g i o n o f t h e g e n e a n d h a v e b e e n r e p o r t e d t o a l t e r p r o t e i n : D N A i n t e r a c t i o n s in vitro s u g g e s t i n g t h a t t h e y m a y a f f e c t t r a n s c r i p t i o n a l r e g u l a t i o n ( B a u m a n n a n d H e n s c h e n , 1993b; L a n e et al, 1993). A l l t h r e e p o l y m o r p h i s m s h a v e b e e n r e p o r t e d t o b e i n s t r o n g l i n k a g e d i s e q u i l i b r i u m i n v a r i o u s p o p u l a t i o n s ( d e M a a t et al, 1995; C a r t e r et al, 1997; T h o m a s et.al, 1994; t h i s s t u d y ) m a k i n g it d i f f i c u l t to c o r r e l a t e a n y s i n g l e a l l e l e w i t h a n o b s e r v e d p h e n o t y p e . It i s p o s s i b l e that t h e r e i s a n a d d i t i v e e f f e c t a n d p h e n o t y p e i s d e t e r m i n e d m o r e b y h a p l o t y p e t h a n b y i n d i v i d u a l a l l e l e s ; h o w e v e r , as b o t h o u r d a t a a n d t h a t o f d e M a a t et al, ( 1 9 9 5 ) ar e c o n s i s t e n t w i t h c o m p l e t e l i n k a g e 4 5 d i s e q u i l i b r i u m i n N a t i v e A m e r i c a n s , t h i s m a y n o t b e a s o u r c e o f p h e n o t y p i c v a r i a t i o n i n t h e s e p o p u l a t i o n s . It i s a l s o p o s s i b l e that n o n e o f t h e a l l e l e s at t h e s e l o c i a r e r e s p o n s i b l e f o r t h e p h e n o t y p e . T h e r e m a y b e a n as y e t u n c h a r a c t e r i z e d v a r i a n t e l s e w h e r e i n t h e g e n e that i s a f f e c t i n g f i b r i n o g e n l e v e l s . L i n k a g e d i s e q u i l i b r i u m b e t w e e n t h e a l l e l e s a s s a y e d i n t h i s s t u d y a n d t h i s p u t a t i v e si t e w o u l d a c c o u n t f o r t h e r e p o r t e d a s s o c i a t i o n b e t w e e n f i b r i n o g e n l e v e l s a n d g e n o t y p e at t h e s e t h r e e l o c i . G i v e n t h e d e s i g n o f t h e s e a n a l y s e s , t h e o v e r - r e p r e s e n t a t i o n o f a l l e l e s i n the Q u e c h u a m a y n o t r e p r e s e n t s e l e c t i o n f o r t h e s e a l l e l e s at a l t i t u d e b u t r a t h e r s e l e c t i o n a g a i n s t t h e s e a l l e l e s at l o w a l t i t u d e . T h i s i s s u e w a s a d d r e s s e d b y g e n o t y p i n g c h i m p a n z e e D N A at t h e s e l o c i o n t h e a s s u m p t i o n t h a t t h e c h i m p g e n o t y p e w o u l d r e p r e s e n t t h e a n c e s t r a l h u m a n g e n o t y p e . T h e r e s u l t s o f t h i s w e r e a m b i g u o u s . T h e a l l e l e s c o m m o n i n t h e Q u e c h u a ( G 455, C 1 4 8 a n d G 4 4 8 ) m a t c h e d t h e c h i m p at b a s e -455 b u t n o t at b a s e s -148 o r + 4 4 8 a n d th e t h r e e - l o c i h a p l o t y p e s that w e r e c o m m o n i n a l l t h r e e h u m a n p o p u l a t i o n s w e r e n o t r e p r e s e n t e d i n t h e c h i m p . D e s p i t e t h e o v e r - r e p r e s e n t a t i o n o f t h e a l l e l e s a s s o c i a t e d w i t h l o w e r f i b r i n o g e n i n the Q u e c h u a t h e r e w a s n o e v i d e n c e o f l o w e r p l a s m a v i s c o s i t y i n that p o p u l a t i o n c o m p a r e d w i t h C a u c a s i a n s ( f i g u r e 3.4). H o w e v e r , t h e r e a r e s o m e caveats to b e c o n s i d e r e d b e f o r e d r a w i n g a n y f i r m c o n c l u s i o n s f r o m t h e s e data. A s i t w a s n o t p o s s i b l e t o s e p a r a t e t h e p l a s m a i m m e d i a t e l y a f t e r e x t r a c t i o n , s a m p l e q u a l i t y w a s n o t o p t i m a l . A n y s u b s e q u e n t r e m i x i n g o f the b l o o d a f t e r e x t r a c t i o n ( i n e v i t a b l e u n d e r the c o n d i t i o n s i n w h i c h o u r s a m p l e s w e r e o b t a i n e d ) s h o u l d b e a v o i d e d as i t w i l l c o n t r i b u t e t o a r t i f i c i a l l y i n c r e a s e d v i s c o s i t y ( H a r k n e s s , 1971). A s the C a u c a s i a n b l o o d s a m p l e s w e r e t a k e n i n t h e f i e l d ( t h e r e b y s u f f e r i n g t h e s a m e a b u s e as the Q u e c h u a s a m p l e s ) c o m p a r i s o n s b e t w e e n t h e C a u c a s i a n a n d the Q u e c h u a p l a s m a s h o u l d b e i n d e p e n d e n t o f t h e s e p o t e n t i a l s o u r c e s o f v a r i a t i o n . U n f o r t u n a t e l y , t h e C a u c a s i a n s a m p l e s i z e i s q u i t e s m a l l ( n = 3). T h e d a t a p r e s e n t e d a b o v e ar e c o n s i s t e n t w i t h s e l e c t i o n a c t i n g t o f a v o u r t h e a l l e l e s a s s o c i a t e d w i t h r e d u c e d f i b r i n o g e n i n t h e Q u e c h u a . H o w e v e r , s e l e c t i o n acts o n p h e n o t y p e s a n d n o t o n g e n o t y p e s . T o d e t e r m i n e i f r e d u c e d p l a s m a v i s c o s i t y i s a n a d a p t i v e c h a r a c t e r i s t i c o f t h i s p o p u l a t i o n , e x t e n s i v e a n a l y s i s o f t h e r h e o l o g i c a l p r o p e r t i e s o f Q u e c h u a b l o o d a n d the i n f l u e n c e 4 6 o f f i b r i n o g e n g e n o t y p e o n t h e s e p r o p e r t i e s w o u l d b e r e q u i r e d . S u c h a s t u d y c o u l d p r o v i d e i n s i g h t s i n t o a p o t e n t i a l a d a p t i v e m e c h a n i s m that, d e s p i t e h a v i n g o n l y a n i n d i r e c t e f f e c t o n o x y g e n u t i l i z a t i o n , m a y c o n f e r a s e l e c t i v e a d v a n t a g e i n h i g h a l t i t u d e p o p u l a t i o n s . 4 7 Chapter 4 Angiotensin converting enzyme (ACE) and angiotensin 2 receptor type 1 allele frequencies in the Quechua1 Introduction I n 1997, M o n t g o m e r y a n d c o - w o r k e r s r e p o r t e d a s t r i k i n g a s s o c i a t i o n b e t w e e n a l l e l e s i n the g e n e e n c o d i n g a n g i o t e n s i n c o n v e r t i n g e n z y m e ( A C E ) a n d h i g h a l t i t u d e p e r f o r m a n c e i n B r i t i s h m o u n t a i n e e r s ( M o n t g o m e r y et al, 1997a). A l l e l e d i s t r i b u t i o n s w e r e c o m p a r e d b e t w e e n a c o n t r o l g r o u p o f h e a l t h y , u n r e l a t e d B r i t i s h m a l e s a n d 3 3 u n r e l a t e d B r i t i s h c l i m b e r s w h o h a d a s c e n d e d b e y o n d 7,000 m. A n i n t r o n i c i n s e r t i o n a l l e l e ( A C E - I ) i n t h e A C E g e n e w a s s i g n i f i c a n t l y o v e r - r e p r e s e n t e d i n t h e c l i m b e r s and, i n a n e l i t e s u b s e t o f t h e c l i m b e r s w h o h a d a t t a i n e d m o r e t h a n 8,000 m, t h e r e w e r e n o h o m o z y g o t e s f o r t h e d e l e t i o n a l l e l e ( A C E - D ) . T h e a u t h o r s s u g g e s t e d that t h e A C E - I a l l e l e m i g h t c o n t r i b u t e t o p e r f o r m a n c e at h i g h a l t i t u d e . I n a d d i t i o n t h e y r e p o r t e d that t h e t r a i n i n g r e s p o n s e f o r a s i m p l e r e p e t i t i v e m u s c l e m o t i o n ( e l b o w f l e x i o n ) w a s s i g n i f i c a n t l y b e t t e r i n i n d i v i d u a l s c a r r y i n g at l e a s t o n e c o p y o f t h e i n s e r t i o n a l l e l e . T h e a u t h o r s m a i n t a i n that, as. t h e t i m e c o u r s e f o r t h i s i m p r o v e m e n t ( 1 0 w e e k s ) is t o o s h o r t f o r m u s c l e g r o w t h to a c c o u n t f o r t h e i m p r o v e m e n t , t h e i n c r e a s e d p e r f o r m a n c e i s d u e t o i m p r o v e d e n d u r a n c e c h a r a c t e r i s t i c s . O t h e r s t u d i e s h a v e s h o w n a n a s s o c i a t i o n b e t w e e n A C E I/D g e n o t y p e a n d p h y s i c a l p e r f o r m a n c e . T h e A C E - I a l l e l e w a s r e p o r t e d t o b e o v e r - r e p r e s e n t e d i n A u s t r a l i a n O l y m p i c l e v e l r o w e r s ( G a y a g a y et al, 1998) a n d H a g b e r g et al, ( 1 9 9 8 ) r e p o r t e d that a m o n g a c o h o r t o f p h y s i c a l l y m a t c h e d p o s t m e n o p a u s a l w o m e n , t h o s e w i t h a n I/I g e n o t y p e h a d a s i g n i f i c a n t l y h i g h e r V 0 2 m a x ( + 6.3 m l kg" 1 min" 1) t h a n D / D h o m o z y g o t e s . H e t e r o z y g o t e s h a d a n i n t e r m e d i a t e v a l u e (+ 3.3 m l kg" 1 min" 1). T h i s w a s a t t r i b u t e d t o a n i n c r e a s e d a r t e r i o v e n o u s 0 2 d i f f e r e n t i a l , 2 7 % o f w h i c h c o u l d b e a c c o u n t e d f o r b y A C E (I/D) g e n o t y p e . E x e r c i s e - i n d u c e d l e f t v e n t r i c u l a r h y p e r t r o p h y i s a l s o i n f l u e n c e d b y A C E g e n o t y p e w i t h the A C E - I a l l e l e a s s o c i a t e d w i t h r e d u c e d c o r o n a r y e n l a r g e m e n t ( M o n t g o m e r y et al, 1997b). 1 Much of the material presented in this chapter has been published as: J. L . Rupert, D. V. Devine, M . V. Monsalve, P. W. Hochachka. 1999. Angiotensin-converting enzyme (ACE) alleles in the Quechua, a high altitude South American native population. Ann. Human Biol. 26 (4) 375-380. 4 8 A C E i s a c o m p o n e n t o f t h e r e n i n - a n g i o t e n s i n s y s t e m ( f i g u r e 4.1). It i s a p r i m a r i l y a m e m b r a n e b o u n d m e t a l l o p r o t e a s e , a l t h o u g h s o m e c i r c u l a t i n g a c t i v i t y c a n b e d e t e c t e d . A C E r e m o v e s t w o p e p t i d e s f r o m t h e d e c a p e p t i d e a n g i o t e n s i n I ( a w e a k v a s o c o n s t r i c t o r ) g e n e r a t i n g a n g i o t e n s i n 2 ( A T - 2 ) , a n e i g h t a m i n o a c i d p o l y p e p t i d e w i t h p o t e n t v a s o c o n s t r i c t i n g p r o p e r t i e s . A T - 2 h a s a l i f e s p a n o f o n l y a c o u p l e o f m i n u t e s b e f o r e i t i s d e g r a d e d b y a n g i o t e n s i n a s e t h u s t h e s y s t e m a l l o w s r a p i d , r e v e r s i b l e c h a n g e s i n v a s c u l a r tone. T h e i m p o r t a n c e o f t h e r o l e o f A C E a n d t h e a n g i o t e n s i n s y s t e m i n t h e r e g u l a t i o n o f c a r d i o v a s c u l a r f u n c t i o n i s r e f l e c t e d i n t h e e f f i c a c y o f v a r i o u s A C E i n h i b i t o r s a n d A T - 2 r e c e p t o r b l o c k e r s i n t r e a t i n g h e a r t f a i l u r e a n d p o s t - m y o c a r d i a l i n f a r c t ( B u t l e r et al, 1997). O n e s u c h i n h i b i t o r ( c a p t o p r i l ) h a s a l s o b e e n s h o w n t o b e e f f i c a c i o u s i n t h e t r e a t m e n t o f h i g h a l t i t u d e p u l m o n a r y h y p e r t e n s i o n ( N i a z o v a et al, 1996). T h i s r a i s e s the i n t r i g u i n g p o s s i b i l i t y that t h e o v e r r e p r e s e n t a t i o n o f the A C E - I a l l e l e i n c l i m b e r s m a y n o t b e d u e t o p e r f o r m a n c e e n h a n c e m e n t per se, b u t r a t h e r d u e t o a r e d u c e d s u s c e p t i b i l i t y t o h i g h a l t i t u d e p u l m o n a r y e d e m a . V A S O D I L A T I O N V A S O C O N S T R I C T I O N Figure 4.1. ACE mediated vasoconstriction. ACE inactivates the vasodilator bradykinin while activating the potent vasoconstrictor angiotensin 2. Adapted from Opie, 1999. 4 9 T h e i n s e r t i o n / d e l e t i o n p o l y m o r p h i s m i n the A C E g e n e w a s f i r s t r e p o r t e d b y R i g a t et al. i n 1990. I n t h a t s t u d y , D / D h o m o z y g o t e s h a d a 6 5 % i n c r e a s e i n A C E a c t i v i t y c o m p a r e d to I/I h o m o z y g o t e s , w h i l e I/D h e t e r o z y g o t e s h a d a n i n t e r m e d i a t e p h e n o t y p e ( + 3 1 % ) . T h e p o l y m o r p h i s m w a s s u b s e q u e n t l y c h a r a c t e r i z e d as a 2 8 7 b a s e Alu r e p e a t i n s e r t i o n i n i n t r o n 16 ( s e e G e n B a n k , A c c e s s i o n n u m b e r X 6 2 8 5 5 ) a n d v a r i o u s s t u d i e s h a v e s h o w n 1 4 - 2 8 % o f t h e v a r i a n c e i n e n z y m a t i c a c t i v i t y t o b e a s s o c i a t e d w i t h the g e n o t y p e at t h i s l o c i ( T i r e t et al, 1992; r e v i e w e d i n S c h u n k e r t , 1997). T h i s p h e n o t y p e m a y b e d e p e n d e n t o n g e n e t i c b a c k g r o u n d . B l o e m et al. ( 1 9 9 6 ) r e p o r t e d a c o r r e l a t i o n b e t w e e n A C E I/D p h e n o t y p e a n d e n z y m e a c t i v i t y i n C a u c a s i a n , b u t n o t A f r o - C a r i b b e a n , c h i l d r e n . T h e A C E d e l e t i o n a l l e l e h a s b e e n p r o p o s e d t o b e a r i s k f a c t o r f o r c a r d i o v a s c u l a r d i s e a s e ; h o w e v e r , t h e e v i d e n c e f o r s u c h a r o l e i s c o n t r o v e r s i a l . C a m b i e n et al. ( 1 9 9 2 ) a n d E v e n s et al. ( 1 9 9 4 ) r e p o r t e d a n o v e r - r e p r e s e n t a t i o n o f the D a l l e l e i n p a t i e n t s w i t h m y o c a r d i a l i n f a r c t . T h i s o b s e r v a t i o n w a s c o r r o b o r a t e d b y s t u d i e s i n E u r o p e , A m e r i c a a n d J a p a n a n d t h e p h e n o t y p e e x p a n d e d t o i n c l u d e i s c h e m i c h e a r t d i s e a s e ( I H D ) a n d c o r o n a r y a r t e r y d i s e a s e ( C A D ) ( s u m m a r i z e d i n B u t l e r et al, 1997). H o w e v e r , s t u d i e s i n a n u m b e r o f o t h e r p o p u l a t i o n s , i n c l u d i n g C a u c a s i a n s ( A g e r h o l m - L a r s e n etal, 1997), P i m a I n d i a n s ( N a g i etal, 1998), C h i n e s e ( C h u a n g etal, 1997) ( S a h a etal, 1996), J a p a n e s e ( I s h i g a m i etal, 1995) a n d S o u t h e a s t A s i a n s ( S a h a et al, 1996), h a v e f a i l e d t o d e t e c t t h i s a s s o c i a t i o n . It w o u l d a p p e a r that t h e c a r d i o v a s c u l a r p h e n o t y p e o f t h e A C E I/D i s a f f e c t e d b y g e n e t i c b a c k g r o u n d a n d t h u s b e d e p e n d e n t , t o s o m e extent, o n r a c e a n d g e n d e r (e.g. S a g n e l l a etal, 1999). A T - 2 b i n d s t o t w o s u b t y p e s o f c e l l s u r f a c e r e c e p t o r s , the t y p e 1 r e c e p t o r ( A T 2 - R 1 ) , w h i c h p r e d o m i n a t e s i n t h e v a s c u l a r s m o o t h m u s c l e a n d c a r d i o m y o c y t e s ; a n d t h e t y p e 2 r e c e p t o r s f o u n d i n t h e b r a i n , u t e r u s a n d a d r e n a l m e d u l l a . O f t h e s e A T 2 - R 1 , a G p r o t e i n - c o u p l e d , s e v e n t r a n s - m e m b r a n e d o m a i n c e l l s u r f a c e r e c e p t o r , is t h e m o s t p h y s i o l o g i c a l l y a c t i v e ( O p i e , 1999). U s i n g s i n g l e s t r a n d e d c o n f o r m a t i o n a l p o l y m o r p h i s m a n a l y s i s , B o n n a r d e a u x et al, ( 1 9 9 4 ) d e t e c t e d t h r e e p o l y m o r p h i s m s i n , o r near, the s i n g l e e x o n e n c o d i n g t h i s r e c e p t o r . O n e o f these, a n A to C t r a n s v e r s i o n at b a s e 1 1 6 6 i n t h e 3' f l a n k i n g r e g i o n ( A / C 1 1 6 6 ) , w a s a s s o c i a t e d w i t h b l o o d p r e s s u r e w i t h t h e C a l l e l e o v e r - r e p r e s e n t e d i n h y p e r t e n s i v e C a u c a s i a n s u b j e c t s . A s the 5 0 m u t a t i o n i t s e l f d o e s n o t a p p e a r t o b e f u n c t i o n a l , the m e c h a n i s m b y w h i c h i t m a n i f e s t s t h e p u t a t i v e p h e n o t y p e i s u n k n o w n . T h e a u t h o r s p o s t u l a t e that i t m a y b e i n d i s e q u i l i b r i u m w i t h a y e t u n c h a r a c t e r i z e d v a r i a n t t h a t i s r e s p o n s i b l e f o r t h e p h e n o t y p e . A s i s t h e c a s e f o r A C E I/D p o l y m o r p h i s m , t h e r e s u l t s o f s t u d i e s i n v e s t i g a t i n g t h i s a s s o c i a t i o n a r e o f t e n i n c o n s i s t e n t . W a n g et al, ( 1 9 9 7 ) r e p o r t e d a o v e r - r e p r e s e n t a t i o n o f the C a l l e l e i n C a u c a s i a n h y p e r t e n s i v e s (0.40 vs. 0.29 i n n o r m o t e n s i v e s ) . S z o m b a t h y et al, 1998 r e p o r t e d n o s i g n i f i c a n t f r e q u e n c y d i f f e r e n c e b e t w e e n n o r m o t e n s i v e s a n d h y p e r t e n s i v e s b u t d i d f i n d a n a s s o c i a t i o n b e t w e e n the C a l l e l e a n d h i g h e r s y s t o l i c b l o o d p r e s s u r e i n o l d e r o r o v e r w e i g h t h y p e r t e n s i v e s . C o n v e r s e l y , C a s t e l l a n o et al, ( 1 9 9 6 ) r e p o r t e d l o w e r b l o o d p r e s s u r e s i n C / C h o m o z y g o t e s . T h e s e i n c o n s i s t e n c i e s c o u l d b e a c c o u n t e d f o r b y l i n k a g e d i s e q u i l i b r i u m b e t w e e n t h e A / C 1 1 6 6 p o l y m o r p h i s m a n d a f u n c t i o n a l m u t a t i o n . I f t h e s t r e n g t h o f t h e d i s e q u i l i b r i u m v a r i e d b e t w e e n t h e p o p u l a t i o n s u n d e r e x a m i n a t i o n , t h e a s s o c i a t i o n b e t w e e n the m a r k e r (the A / C g e n o t y p e ) a n d t h e p h e n o t y p e w o u l d v a r y . A l l o f the s t u d i e s d e s c r i b e d a b o v e w e r e i n C a u c a s i a n s , b u t t h i s d o e s n o t g u a r a n t e e a c o m m o n g e n e t i c b a c k g r o u n d . A s yet, n o f u n c t i o n a l m u t a t i o n i n t h e A T 2 - R 1 g e n e h a s b e e n r e p o r t e d , a n d w h i l e a s e a r c h a r o u n d t h e A T 2 - R 1 l o c u s i d e n t i f i e d s e v e n p o l y m o r p h i c sites, n o n e o f t h e a l l e l e s w e r e i n d i s e q u i l i b r i u m w i t h A 1 1 6 6 o r C 1 1 6 6 ( P o i r e r et al, 1998). A s e c o n d p o s s i b i l i t y i s a n i n t e r a c t i o n b e t w e e n the A T 2 - R 1 m u t a t i o n ( o r t h e p u t a t i v e l i n k e d f u n c t i o n a l p o l y m o r p h i s m ) a n d a v a r i a n t at a n o t h e r gene. T h e r e i s e v i d e n c e f o r s u c h a n i n t e r a c t i o n b e t w e e n t h e A / C 1 1 6 6 a n d t h e A C E I/D p o l y m o r p h i s m s . H a v i n g t h e C 1 1 6 6 a l l e l e e n h a n c e s t h e e f f e c t o f h a v i n g t h e D a l l e l e at t h e A C E I7D l o c u s o n the d e v e l o p m e n t o f m y o c a r d i a l i n f a r c t ( T i r e t et al, 1 9 9 4 ) . T h e m e c h a n i s m b y w h i c h t h e A C E - I a l l e l e e n h a n c e s p h y s i c a l p e r f o r m a n c e i s u n c l e a r , b u t as i t a p p e a r s t o f a c i l i t a t e o x y g e n e x c h a n g e ( H a g b e r g et al, 1998), i t m a y b e p a r t i c u l a r l y b e n e f i c i a l i n h i g h a l t i t u d e p o p u l a t i o n s . I f that w e r e the case, a n d a s s u m i n g that t h e a l l e l e w a s p r e s e n t i n t h e p o p u l a t i o n that i n i t i a l l y m i g r a t e d to t h e A n d e s , s e l e c t i o n m a y h a v e r e s u l t e d i n a n o v e r - r e p r e s e n t a t i o n o f t h e i n s e r t i o n a l l e l e i n the Q u e c h u a . A s t h e p h e n o t y p e o f t h i s m u t a t i o n m a y b e i n f l u e n c e d b y t h e A / C 1 1 6 6 m u t a t i o n i n the A T 2 - R 1 gene, t h e r e m a y b e c o - s e l e c t i o n i n f l u e n c i n g a l l e l e f r e q u e n c i e s at that l o c u s as w e l l . T o a d d r e s s t h e s e i s s u e s , a l l e l e f r e q u e n c i e s f o r 51 t h e A C E I/D a n d A T 2 - R 1 A / C 1 1 6 6 p o l y m o r p h i s m s w e r e d e t e r m i n e d i n a g r o u p o f u n r e l a t e d Q u e c h u a l i v i n g at o v e r 3 5 0 0 m o n the P e r u v i a n altiplano a n d c o m p a r e d w i t h l o w a l t i t u d e p o p u l a t i o n s . Materials and Methods Genotyping 1) A C E p o l y m o r p h i s m D N A w a s p r e p a r e d as d e s c r i b e d e a r l i e r a n d a s s a y e d u s i n g a t h r e e p r i m e r P C R b a s e d a s s a y ( E v a n s et al, 1994; s e e f i g u r e 4.2). P r i m e r s e q u e n c e s are g i v e n i n a p p e n d i x i i . I n the a b s e n c e o f t h e Alu i n s e r t i o n , t h e p r i m e r p a i r A C E - 1 : A C E - 3 a m p l i f i e s a n 8 4 b a s e p r o d u c t . I n t h e p r e s e n c e o f t h e i n s e r t i o n , t h e p r i m e r p a i r A C E - 2 : A C E - 3 a m p l i f i e s a 6 5 b a s e p r o d u c t . B o t h p r o d u c t s a r e a m p l i f i e d i n h e t e r o z y g o t e s . C o m p e t i t i o n f o r p r i m e r s l i m i t s a m p l i f i c a t i o n o f t h e l a r g e ( 3 7 2 b p ) A C E - 1 : A C E - 3 p r o d u c t . 1 0 0 n g D N A w a s P C R a m p l i f i e d i n a r e a c t i o n c o n t a i n i n g 2 5 u M o f A C E - 1 a n d A C E - 3 , 7.5 u M A C E - 2 , 0.2 m M d N T P s , 1.5 m M M g C l 2 , 2 0 m M T r i s / C l p H 8.4 a n d 5 0 m M K C 1 . A m p l i f i c a t i o n c o n d i t i o n s w e r e 9 4 ° C , 1 min.; 5 5 ° C , 1 min.; 7 2 ° C , 2 m i n . f o r 4 0 c y c l e s i n a P e r k i n E l m e r D N A T h e r m a l C y c l e r . P r o d u c t s w e r e e l e c t r o p h o r e s e d o n 8 % p o l y a c r y l a m i d e g e l s , s t a i n e d w i t h E t B r a n d r e c o r d e d u s i n g a P o l a r o i d p h o t o - d o c u m e n t a t i o n s y s t e m . S a m p l e P C R p r o d u c t s a r e s h o w n i n f i g u r e 4.3a. 2) A T 2 - R 1 p o l y m o r p h i s m T h e A / C 1 1 6 6 p o l y m o r p h i s m i n A T 2 - R I w a s d e t e c t e d b y Dde I d i g e s t i o n o f P C R a m p l i f i e d p r o d u c t . D N A w a s a m p l i f i e d w i t h the p r i m e r s A T R - 3 : A T R - 4 (see a p p e n d i x i i ) . D N A ( 5 0 - 2 0 0 n g ) w a s a m p l i f i e d i n a P e r k i n E l m e r D N A T h e r m a l C y c l e r u s i n g 0.033 n m o l e s o f e a c h p r i m e r a n d 0.625 u n i t s Taq p o l y m e r a s e ( G i b c o B R L , G a i t h e r s b u r g , M D ) . T h e f i n a l r e a c t i o n m i x t u r e ( 2 5 u l ) w a s 0.2 m M d N T P s , 1.0 m M M g C l 2 , 2 0 m M T r i s / C l p H 8.4 a n d 5 0 m M K C 1 . A m p l i f i c a t i o n c o n d i t i o n s w e r e 9 4 ° C , 1 min.; 5 5 ° C , 1 min.; 7 2 ° C , 2 m i n . f o r 4 0 c y c l e s . A m p l i f i e d p r o d u c t ( 1 0 p i ) w a s t h e n d i g e s t e d u s i n g 0.2 -1.0 u n i t s Dde I u n d e r t h e c o n d i t i o n s p r e s c r i b e d b y 5 2 t h e m a n u f a c t u r e r ( B R L ) . D i g e s t s w e r e a n a l y s e d as d i s c u s s e d a b o v e a n d e x a m p l e s are s h o w n i n f i g u r e 4.3b. A C E - 1 A C E - 2 5' | | I I 3' i n s e r t i o n (I) a l l e l e H ^ - A C E - 3 A C E - 1 - ^ 0 basepairs 3 0 0 5' I I I 3' d e l e t i o n ( D ) a l l e l e j * * A C E - 3 Figure 4.2: PCR based assay for the insertion/deletion polymorphism in the angiotensin converting enzyme (ACE) gene. The alu insertion is shown in gray. ACE-1 , ACE-2 and ACE-3 are primers. Diagnostic amplification products are shown in black. The large product potentially amplified by ACE-1: ACE-3 (striped) in the presence of the insertion is rarely seen. Results ACE polymorphism T h e A C E I/D g e n o t y p e w a s d e t e r m i n e d f o r 6 3 Q u e c h u a , 5 0 N a - D e n e a n d 3 4 C a u c a s i a n s . A l l e l e a n d g e n o t y p e f r e q u e n c i e s f o r e a c h a r e p r e s e n t e d i n T a b l e 4. l a . G e n o t y p e f r e q u e n c i e s are i n H a r d y - W e i n b e r g e q u i l i b r i u m i n a l l t h r e e g r o u p s . T h e f r e q u e n c i e s o f t h e i n s e r t i o n a l l e l e are s i g n i f i c a n t l y h i g h e r i n the b o t h the Q u e c h u a a n d t h e N a - D e n e c o m p a r e d w i t h C a u c a s i a n s {P< 0.001); h o w e v e r , t h e r e i s n o s i g n i f i c a n t d i f f e r e n c e b e t w e e n t h e t w o A m e r i n d i a n g r o u p s . O u r a l l e l e f r e q u e n c i e s f o r C a u c a s i a n s f a l l w i t h i n t h e r a n g e o f v a l u e s p r e v i o u s l y r e p o r t e d ( T a b l e 4.2). AT2-R1 polymorphism T h e A / C 1 1 6 6 g e n o t y p e w a s d e t e r m i n e d f o r 6 0 Q u e c h u a a n d 31 C a u c a s i a n s . A l l e l e a n d g e n o t y p e f r e q u e n c i e s f o r e a c h a r e p r e s e n t e d i n T a b l e 2. l b . G e n o t y p e f r e q u e n c i e s f o r b o t h g r o u p s a r e i n H a r d y - W e i n b e r g e q u i l i b r i u m a n d a l l e l e f r e q u e n c i e s d o n o t s i g n i f i c a n t l y d i f f e r b e t w e e n t h e t w o g r o u p s . O u r a l l e l e f r e q u e n c y f o r C a u c a s i a n s d o e s n o t d i f f e r f r o m l i t e r a t u r e v a l u e s {e.g. H i n g o r a n i a n d B r o w n , 1995). N o a s s o c i a t i o n w a s f o u n d b e t w e e n a l l e l e s at the t w o l o c i . 5 3 Allele frequencies for both the A C E and the AT2-R1 polymorphisms are available through The Allele Frequency Database (Alfred), which is maintained by Dr. Ken Kidd's lab at Yale University (New Haven, CT). The URL for this site is http://alfred.med.yale.edu/ alfred/index.asp. Table 4.2: ACE and AT2-R1 genotype and allele frequencies, a) Results for the 287 base insertion (I)Zdeletion (D) polymorphism in intron 16 of the angiotensin converting enzyme (ACE) gene for sample populations of Quechua, Na-Dene and Caucasians, b) Results for the A/C1166 polymorphism in the angiotensin 2 receptor I gene in Quechuas and Caucasians. a) b) Population ACE-I/D Genotype D/D I/D I/I Quechua 2 24 37 Na-Dene 5 16 29 Caucasian 9 21 4 Allele frequencies of both native American (at/xO.001). Population A / C 1 166 genotype A / A A/C C/C Quechua 34 20 6 Caucasian 14 16 1 A C E allele frequencies Quechua Na-Dene Caucasian AT2-R1 allele frequencies 100 Quechua Caucasian Alle le frequencies do not significantly differ between the two samples. Discussion The mechanisms by which variants in A C E influence human performance are unknown however the association between A C E I/D genotype and V 0 2 m a x (Hagberg et al, 1998) suggests that the ACE-I allele (or an allele to which it is linked) may facilitate oxygen uptake. V 0 2 m a x is a measure of the maximal rate of oxygen consumption achievable by an organism and is a strong indicator of aerobic performance. It has been proposed that successful adaptation to hypoxic environments would be reflected in V 0 2 m a x values close to sea level values (Baker, 1971). 54 D/D D/I I/I C/C A7A C/A a) b) F i g u r e 4.3 a,b. A s s a y f o r p o l y m o r p h i s m s i n t h e A C E a n d A T 2 - R 1 g e n e s . R e p r e s e n t a t i v e p o l y a c r y l a m i d e g e l s d e m o n s t r a t i n g a) t h e i n s e r t i o n (I) a n d d e l e t i o n ( D ) a l l e l e s o f t h e a n g i o t e n s i n c o n v e r t i n g e n z y m e g e n e ( A C E ) a n d b) t h e A / C 1 1 6 6 Ddel R F L P i n t h e a n g i o t e n s i n 2 r e c e p t o r 1 g e n e . G e n o t y p e s a r e g i v e n a c r o s s t h e t o p o f e a c h p a n e l . S i z e s o f t h e b a n d s a r e g i v e n i n b a s e p a i r s . 55 C o n s i s t e n t w i t h t h i s h y p o t h e s i s , s e v e r a l s t u d i e s h a v e r e p o r t e d r e l a t i v e l y h i g h V 0 2 m a x v a l u e s i n b o t h S o u t h A m e r i c a n a n d A s i a n h i g h a l t i t u d e n a t i v e p o p u l a t i o n s ( r e v i e w e d i n B a k e r , 1 9 7 6 Table 4.2. Published allele frequencies for the ACE I/D polymorphism in various populations. P o p u l a t i o n F r e q u e n c y R e f e r e n c e P o p u l a t i o n F r e q u e n c y R e f e r e n c e A f r o -C a r i b b e a n 1: 0.38 D : 0.62 ( B a r l e y et ai, 1 9 9 6 ) I n u i t 1: 0.60 D : 0.40 ( d e M a a t e r al, 1 9 9 9 ) A f r i c a n ( d e s c e n t ) 1: 0.44 D : 0.56 ( S a g n e l l a et ai,1999) S o u t h A s i a n 1: 0.61 D : 0.39 ( S a g n e l l a et al, 1 9 9 9 ) C a u c a s i a n 1: 0.43 D : 0.57 ( S a g n e l l a et ai, 1999) N e p a l e s e 1: 0.66 D : 0.34 ( U m e m u r a al, 1 9 9 8 ) C a u c a s i a n 1: 0.44 D : 0.56 ( B e i g e et al, 1 9 9 8 ) C h i n e s e 1: 0.70 D : 0.30 ( L e e , 1994) C a u c a s i a n 1: 0.48 D : 0.52 ( B a r l e y et al, 1 9 9 6 ) P i m a 1:0.71 D : 0.29 ( F o y etal, 1996) A s i a n - I n d i a n 1: 0.55 D : 0.45 ( S a h a et al, 1 9 9 6 ) Y a n o m a m a 1: 0.85 D : 0 . 1 5 ( B a r l e y et al, 1 9 9 4 ) J a p a n e s e 1: 0.59 D : 0.41 ( I s h i g a m i et al, 1995) A u s t r a l i a n A b o r i g i n e s 1: 0.97 D : 0.03 ( L e s t e r et al, 1 9 9 9 ) I m m e d i a t e l y f o l l o w i n g t r a v e l t o h i g h a l t i t u d e , l o w l a n d e r s e x p e r i e n c e a r e d u c t i o n i n V 0 2 m a at a rate o f a b o u t 1 0 % p e r 1 0 0 0 m a s c e n d e d b e y o n d 1 5 0 0 m ( D u a a n d S e n G u p t a , 1980), a n d a l t h o u g h t h e r e m a y b e s o m e i m p r o v e m e n t w i t h t i m e , V 0 2 m a x r e m a i n s d e p r e s s e d e v e n a f t e r p r o l o n g e d r e s i d e n c e . F o r e x a m p l e , a n i n i t i a l d r o p i n V 0 2 m a x o f 2 6 % i n I n d i a n s o l d i e r s t r a n s f e r r e d t o 4 1 0 0 m i m p r o v e d t o a b o u t a 2 1 % r e d u c t i o n a f t e r t w o y e a r s ( D u a a n d S e n G u p t a , 1980). A l t i t u d e - i n d u c e d V 0 2 m a x d e p r e s s i o n i s n o t as p r o n o u n c e d i n h i g h a l t i t u d e n a t i v e s , a n d v a l u e s i n t h e s e p o p u l a t i o n s h a v e b e e n r e p o r t e d to e q u a l t h o s e f o u n d i n s e a l e v e l p o p u l a t i o n s (see B a k e r , 1976). T h e r e m a y b e a g e n e t i c c o m p o n e n t to t h i s i m p r o v e d r e s p o n s e t o h y p o x i c e x p o s u r e . W h i l e V 0 2 m a x i s i n f l u e n c e d b y g e n d e r , age, B M I a n d l e v e l o f a c t i v i t y , t h e r e i s c l e a r l y a l s o a h e r i t a b l e g e n e t i c c o m p o n e n t . I n f a m i l y a g g r e g a t i o n s t u d i e s , the h e r i t a b i l i t y (the p e r c e n t o f v a r i a n c e that i s d u e t o g e n e t i c b a c k g r o u n d ) o f i n c r e a s e d V 0 2 m a x i n r e s p o n s e t o t r a i n i n g w a s e s t i m a t e d at 0.47 ( B o u c h a r d et al, 1998). I n t w i n s t u d i e s h e r i t a b i l i t y o f V 0 2 m a x r a n g e d f r o m 5 6 0.25 - 0.79 d e p e n d i n g o n m e t h o d o f m e a s u r e m e n t a n d a n a l y s i s ( r e v i e w e d i n K l i s s o u r a s , 1997). T h e d i m i n i s h m e n t o f V02max f o l l o w i n g t r a n s l o c a t i o n f r o m s e a - l e v e l t o 4 0 0 0 m w a s l e s s i n Q u e c h u a b o r n o r r a i s e d at s e a l e v e l t h a n i n C a u c a s i a n l o w l a n d e r s ( B u s k i r k , 1976), a n d the a u t h o r s u g g e s t s t h a t t h i s m a y r e p r e s e n t t h e i n f l u e n c e o f s o m e g e n e t i c f a c t o r o n t h e i m p a c t o f h y p o x i a o n t h e w o r k c a p a c i t y o f p e o p l e o f Q u e c h u a h e r i t a g e r e g a r d l e s s o f t h e i r a l t i t u d e o f r e s i d e n c e . G i v e n t h e a s s o c i a t i o n b e t w e e n the A C E - I a l l e l e a n d V 0 2 m a x ( H a g b e r g et al, 1998), a n d the o b s e r v a t i o n s that h i g h a l t i t u d e p o p u l a t i o n s h a v e r e l a t i v e l y h i g h V 0 2 m a x v a l u e s ( B a k e r , 1976), i t w a s h y p o t h e s i z e d that the A C E - I a l l e l e s h o u l d b e o v e r - r e p r e s e n t e d i n t h e Q u e c h u a c o m p a r e d t o s e a l e v e l p o p u l a t i o n s . T h i s w a s t e s t e d b y c o m p a r i n g the f r e q u e n c y o f t h i s a l l e l e i n Q u e c h u a , N a -D e n e a n d C a u c a s i a n s ; h o w e v e r , o u r d a t a d o n o t s u p p o r t t h e h y p o t h e s i s . W h i l e t h e f r e q u e n c y o f t h e A C E - I a l l e l e i n t h e Q u e c h u a (0.78) w a s h i g h e r t h a n i n o u r C a u c a s i a n s a m p l e (0.43), i t d i d n o t d i f f e r s i g n i f i c a n t l y f r o m that i n o u r N a - D e n e s a m p l e (0.74), a l o w l a n d n a t i v e A m e r i c a n p o p u l a t i o n a n d f u r t h e r m o r e , w a s l e s s c o m m o n i n t h e Q u e c h u a t h a n i n t h e Y a n o m a m a (0.85; B a r l e y et al, 1994), a l o w l a n d S o u t h A m e r i c a n p o p u l a t i o n w i t h w h o m the Q u e c h u a p r e s u m a b l y s h a r e a r e l a t i v e l y r e c e n t c o m m o n a n c e s t r y . T h e r e a r e a n u m b e r o f r e a s o n s w h y the o v e r - r e p r e s e n t a t i o n o f t h e A C E i n s e r t i o n a l l e l e s e e n i n t h e B r i t i s h c l i m b e r s m i g h t n o t b e s e e n i n t h e Q u e c h u a . T h e r e i s c o n s i d e r a b l e d i f f e r e n c e b e t w e e n t h e c o n d i t i o n s f o u n d at 7 0 0 0 m a n d t h o s e at 3 0 0 0 m; a n d t h e b e n e f i t s c o n f e r r e d b y the i n s e r t i o n a l l e l e m a y b e n e g l i g i b l e at the l o w e r a l t i t u d e . It i s a l s o p o s s i b l e that t h e a l l e l e e n h a n c e s i n d i v i d u a l , b u t n o t p o p u l a t i o n f i t n e s s . G i v e n the a s s o c i a t i o n b e t w e e n t h e A C E - D a l l e l e a n d h e a r t d i s e a s e , t h e f a c t that t h e A C E - I a l l e l e i s n o t m o r e h i g h l y r e p r e s e n t e d g l o b a l l y s u g g e s t s that i t m a y h a v e s o m e n e g a t i v e e f f e c t s ( o r c o n v e r s e l y the D a l l e l e m a y h a v e u n k n o w n b e n e f i c i a l e f f e c t s ) . R e c e n t l y i t w a s r e p o r t e d that t h e A C E - I a l l e l e m i g h t b e a r i s k f a c t o r f o r A l z h e i m e r d i s e a s e ( K e h o e et al, 1 9 9 9 ) 1 . G e n e t i c b a c k g r o u n d o f t h e p o p u l a t i o n s c o u l d b e a f a c t o r as w e l l . T h e i n t r o n i c A C E I/D p o l y m o r p h i s m i t s e l f a p p e a r s n o t t o b e r e s p o n s i b l e f o r t h e p h e n o t y p e ( R o s a t t o et al, 1999). T h i s s u g g e s t s that t h e I/D p o l y m o r p h i s m i s a c t i n g as a m a r k e r f o r a n o t h e r ' ACE is alternatively known as dipeptidyl carboxypeptidase 1, encoded by the gene DCP 1 5 7 m u t a t i o n e l s e w h e r e i n , o r p r o x i m a l to, t h e g e n e a n d t h e e x t e n t o f a s s o c i a t i o n b e t w e e n th e I/D g e n o t y p e a n d t h e p h e n o t y p e w o u l d d e p e n d o n t h e d e g r e e o f l i n k a g e d i s e q u i l i b r i u m b e t w e e n th e t w o l o c i . T h e e x t e n t o f l i n k a g e d i s e q u i l i b r i u m b e t w e e n a n y t w o l o c i c a n v a r y b e t w e e n p o p u l a t i o n s and, i f l i n k a g e d i s e q u i l i b r i u m b e t w e e n th e I/D m a r k e r a n d t h e p e r f o r m a n c e p h e n o t y p e w a s a b s e n t i n N a t i v e A m e r i c a n s , s e l e c t i o n f o r t h e p h e n o t y p e w o u l d n o t b e r e f l e c t e d i n t h e f r e q u e n c y o f t h e A C E - I / D a l l e l e s . R e c e n t l y , ( R i e d e r et al, 1999) s c a n n e d 2 4 k i l o b a s e s o f s e q u e n c e a r o u n d t h e A C E g e n e i n 11 i n d i v i d u a l s ( A f r i c a n a n d E u r o p e a n A m e r i c a n ) a n d f o u n d 7 8 p o l y m o r p h i c s i t e s . O f t h e s e s i t e s , w h i c h s e g r e g a t e d i n t o 13 h a p l o t y p e s o f v a r y i n g c o m m o n a l i t y , 17 w e r e i n a b s o l u t e d i s e q u i l i b r i u m w i t h t h e A C E I/D p o l y m o r p h i s m i n i n t r o n 16. T h e s e h a p l o t y p e s c a n b e g r o u p e d i n t o t h r e e c l a d e s , t w o o f w h i c h i n c l u d e t h e A C E Alu d e l e t i o n a l l e l e . P l a s m a A C E l e v e l s a r e 2 5 % h i g h e r i n t h e s e t w o c l a d e s t h a n i n the c l a d e m a r k e d b y the d e l e t i o n a l l e l e ( F a r r a l l etal, 1999). T h e r e a r e f e w s t u d i e s o f A C E a l l e l e f r e q u e n c i e s i n n a t i v e A m e r i c a n s . B o t h o u r d a t a f o r t h e N a - D e n e a n d that o f F o y et al, ( 1 9 9 6 ) i n t h e P i m a i n d i c a t e that t h e f r e q u e n c y o f t h e A C E i n s e r t i o n a l l e l e i s h i g h e r i n N a t i v e A m e r i c a n p o p u l a t i o n s t h a n i n C a u c a s i a n s . A s t h e f r e q u e n c y o f t h e A C E - I a l l e l e a l s o t e n d s t o b e h i g h e r i n A s i a n p o p u l a t i o n s ( T a b l e 3.1) t h a n i n C a u c a s i a n s , t h i s m a y r e f l e c t t h e a n c e s t r a l a l l e l e f r e q u e n c i e s o f the m i g r a n t s w h o c r o s s e d f r o m A s i a t o N o r t h A m e r i c a . T h e i n t e r a c t i o n b e t w e e n A C E - I / D a n d A T 2 - R 1 A / C 1 1 6 6 g e n o t y p e s r e p o r t e d i n s t u d i e s o n c a r d i o p a t h o l o g y ( T i r e t et al, 1994) r a i s e s t h e p o s s i b i l i t y that t h e A C E I/D p h e n o t y p e m a y b e i n f l u e n c e d b y A / C 1 1 6 6 g e n o t y p e . T h e f r e q u e n c y o f the A / C 1 1 6 6 w a s d e t e r m i n e d i n t h e Q u e c h u a a n d i t w a s f o u n d t h a t n e i t h e r a l l e l e w a s u n c o m m o n . It is u n l i k e l y , t h e r e f o r e , that the a p p a r e n t l a c k o f s e l e c t i o n f o r t h e A C E - I a l l e l e i n the Q u e c h u a c o u l d b e a t t r i b u t e d t o t h e a b s e n c e o f a n a l l e l e at t h e A T 2 - R 1 l o c u s that i s i n v o l v e d i n g e n e r a t i n g the b e n e f i c i a l p h e n o t y p e . A s t h e t w o g e n e s are o n d i f f e r e n t c h r o m o s o m e s ( A C E : 1 7 q 3 3 ; A R 2 - R 1 : 3 q 2 2 ) , l i n k a g e i s n o t at i s s u e h o w e v e r s e g r e g a t i o n d i s t o r t i o n i s f o r m a l l y p o s s i b l e . I n d e p e n d e n t a s s o r t m e n t w a s t e s t e d f o r a n d n o a s s o c i a t i o n w a s f o u n d b e t w e e n g e n o t y p e s at the t w o l o c i . 5 8 Conclusions T h e r e s u l t s o f t h i s s t u d y d o n o t s u p p o r t the h y p o t h e s i s that t h e r e i s s i g n i f i c a n t s e l e c t i v e p r e s s u r e a c t i n g i n f a v o u r o f t r a n s g e n e r a t i o n a l t r a n s m i s s i o n o f t h e A C E i n s e r t i o n a l l e l e i n t h e Q u e c h u a . T h e f r e q u e n c y o f t h e A C E - I a l l e l e i s h i g h e r i n the Q u e c h u a t h a n i n C a u c a s i a n s b u t t h i s i s t r u e f o r o t h e r N a t i v e A m e r i c a n p o p u l a t i o n s a n d t h e r e f o r e m a y r e p r e s e n t a n a n c e s t r a l trait b r o u g h t w i t h t h e s e p o p u l a t i o n s d u r i n g t h e i n i t i a l c o l o n i z a t i o n o f the A m e r i c a s . It is p o s s i b l e that the r e l a t i v e l y h i g h f r e q u e n c y o f t h i s a l l e l e i n the a n t e c e d e n t s o f the Q u e c h u a m a y h a v e f a c i l i t a t e d c o l o n i z a t i o n o f the h i g h l a n d s , b u t t h e r e i s n o e v i d e n c e f o r s u b s e q u e n t s e l e c t i o n f a v o u r i n g t h i s a l l e l e o n c e t h e y w e r e s e p a r a t e d f r o m t h e i r l o w l a n d r e l a t i v e s . 5 9 Chapter 5 Beta2-adrenergic receptor allele frequencies in the Quechua1 Introduction T h e b e t a - a d r e n e r g i c r e c e p t o r s are a f a m i l y o f G - p r o t e i n c o u p l e d c e l l s u r f a c e c a t e c h o l a m i n e r e c e p t o r s ( J o h n s o n , 1998; see f i g u r e 5.1). T h e y are f o u n d i n v i r t u a l l y a l l t i s s u e s a n d are i n v o l v e d i n t h e s y m p a t h e t i c m e d i a t i o n o f d i v e r s e p h y s i o l o g i c a l r e s p o n s e s ( r e v i e w e d i n B i l e z i k i a n , 1987). O n e m e m b e r o f the f a m i l y , the b e t a - a d r e n e r g i c r e c e p t o r ( 6 2 - A R ) , i s p a r t i c u l a r l y i m p o r t a n t i n r e g u l a t i n g l u n g f u n c t i o n . I n r e s p o n s e t o c a t e c h o l a m i n e s t i m u l a t i o n t h e s e r e c e p t o r s a f f e c t d i l a t a t i o n o f b o t h the p u l m o n a r y a n d b r o n c h i a l v a s c u l a t u r e as w e l l as r e l a x a t i o n o f t h e b r o n c h i a l s m o o t h m u s c l e . T h e 8 2 - A R is a l s o i n v o l v e d i n r e g u l a t i n g s m o o t h m u s c l e t o n e i n a n u m b e r o f t i s s u e s , c a r d i a c f u n c t i o n ( w h e r e i t i s s e c o n d a r y t o t h e 6 r A R ) a n d f a t m e t a b o l i s m ( A r n e r a n d H o f f s t e d t , 1999). A n u m b e r o f p o l y m o r p h i s m s h a v e b e e n c h a r a c t e r i z e d i n t h e h u m a n B 2 - A R g e n e ( R e i h s a u s et al, 1 9 9 3 ) ( f i g u r e 5.1). T h e s e i n c l u d e : a n A to G t r a n s i t i o n at b a s e 4 6 ( A / G 4 6 ) w h i c h s u b s t i t u t e s a g l y c i n e ( g l y ) f o r a n a r g i n i n e (arg) at r e s i d u e 16, a G to C t r a n s v e r s i o n at b a s e 7 9 ( G / C 7 9 ) w h i c h s u b s t i t u t e s a g l u t a m i n e ( g i n ) f o r a g l u t a m i c a c i d ( g l u ) at r e s i d u e 2 7 a n d a C to T t r a n s i t i o n at b a s e 4 9 1 ( C / T 4 9 1 ) w h i c h s u b s t i t u t e s a n i s o l e u c i n e ( i l e ) f o r a t h r e o n i n e (thr) at r e s i d u e 164. I n a d d i t i o n , t h e r e are s e v e r a l s i l e n t m u t a t i o n s , w h i c h d o n o t a l t e r p r o t e i n s e q u e n c e . T h e m i s s e n s e m u t a t i o n s at b a s e s 4 6 a n d 7 9 a r e b o t h i n t h e N H 2 t e r m i n a l e x t r a c e l l u l a r d o m a i n b u t a r e p h e n o t y p i c a l l y d i s t i n c t . A l t h o u g h n e i t h e r a p p e a r t o a f f e c t a g o n i s t b i n d i n g o r G s c o u p l i n g , b o t h a l t e r a g o n i s t p r o m o t e d r e g u l a t i o n o f the r e c e p t o r (see r e v i e w b y L i g g e t t a n d R a y m o n d , 1995). T h e g l y 16 v a r i a n t i n c r e a s e s d o w n r e g u l a t i o n o f t h e r e c e p t o r s u b s e q u e n t t o a g o n i s t e x p o s u r e , w h e r e a s th e g l n 2 7 v a r i a n t r e d u c e s d o w n r e g u l a t i o n . W h e n c o m b i n e d , the g l y 16 p h e n o t y p e a p p e a r s t o d o m i n a t e t h e g l n 2 7 p h e n o t y p e . In vivo e f f e c t s o f t h e s e m u t a t i o n s h a v e p r i m a r i l y b e e n s t u d i e d w i t h r e s p e c t t o t h e i r e f f e c t s o n a i r w a y r e s p o n s i v e n e s s a n d i n a s t h m a 1 Much of the material presented in this chapter has been published as: Rupert, J.L, Monsalve, M.V., Devine, D.V. and Hochachka, P.W. (2000) Beta2-adrenergic receptor allele frequencies in the Quechua, a high altitude native population. Ann. Hum. Genet. In press. 6 0 (e.g. H a l l et al, 1995; T u r k i et al, 1995; M a r t i n e z et al, 1997; D ' a m a t o et al, 1998); h o w e v e r , l i n k a g e d i s e q u i l i b r i u m b e t w e e n the a l l e l e s c o m p l i c a t e s a n a l y s i s o f t h e i n d i v i d u a l a c t i o n s o f the m u t a t i o n s . T h e r a r e T a l l e l e at b a s e 4 9 1 l o w e r s a f f i n i t y f o r a v a r i e t y o f a g o n i s t s ( G r e e n et al, 1993) a n d h a s b e e n a s s o c i a t e d w i t h the p r o g r e s s i o n o f c o n g e s t i v e h e a r t d i s e a s e ( L i g g e t t et al, 1 9 9 8 ) . H i g h a l t i t u d e n a t i v e s are c h a r a c t e r i z e d b y i n c r e a s e d l u n g c a p a c i t y , f o r w h i c h a g e n e t i c c o m p o n e n t h a s b e e n d e m o n s t r a t e d ( G r e k s a , 1996), a n d b y i n c r e a s e d t h o r a c i c b l o o d v o l u m e ( V e l a s q u e z , 1976). I n a d d i t i o n , i n c r e a s e d t i d a l v o l u m e s a n d V 0 2 m a x h a v e b e e n r e p o r t e d i n h i g h a l t i t u d e n a t i v e s c o m p a r e d t o a c c l i m a t e d l o w l a n d e r s o f s i m i l a r f i t n e s s l e v e l ( S u n et al, 1990). P r e s u m a b l y t h e s e a d a p t a t i o n s f a c i l i t a t e b l o o d o x y g e n a t i o n i n a n e n v i r o n m e n t w h e r e a v a i l a b l e o x y g e n i s r e d u c e d b y as m u c h as a t h i r d . G i v e n t h e r o l e that t h e 6 2 - A R p l a y s i n r e g u l a t i n g the f l o w o f a i r a n d b l o o d i n t h e l u n g s , i t i s p o s s i b l e that t h e v a r i a n t s o f t h e s e r e c e p t o r s that i n c r e a s e a i r w a y r e s p o n s i v e n e s s t o a g o n i s t s ( A 4 6 , G 7 9 , C 4 9 1 ) , a n d t h e r e f o r e m a y c o n t r i b u t e t o i n c r e a s e d a i r a n d b l o o d f l o w i n t h e l u n g s , w o u l d b e f a v o u r e d i n t h e s e p o p u l a t i o n s . R e c e p t o r d e s e n s i t i z a t i o n , a n d t h e r e f o r e r e d u c e d r e s p o n s i v e n e s s t o a g o n i s t s , h a s b e e n s h o w n to b e a s s o c i a t e d w i t h the d e v e l o p m e n t o f h i g h a l t i t u d e p u l m o n a r y h y p e r t e n s i o n i n h i g h l a n d e r s ( A l d a s h e v etal, 1989). I n a d d i t i o n t o p u l m o n a r y f u n c t i o n c o r r e l a t e s , B 2 - A R g e n o t y p e h a s b e e n a s s o c i a t e d w i t h b o d y c o m p o s i t i o n . S e d e n t a r y m a l e s ( b u t n o t p h y s i c a l l y a c t i v e m a l e s ) w h o w e r e h o m o z y g o u s f o r C at b a s e 7 9 w e r e s i g n i f i c a n t l y h e a v i e r a n d h a d a g r e a t e r b o d y m a s s i n d e x ( B M I ) t h a n e i t h e r h e t e r o z y g o t e s o r G / G h o m o z y g o t e s ( M e i r h a e g h e etal, 1 9 9 9 ) s u g g e s t i n g r e d u c e d f a t m e t a b o l i s m i n C / C h o m o z y g o t e s . T h i s e f f e c t a p p e a r s t o b e g e n d e r i n f l u e n c e d as L a r g e et al, ( 1 9 9 7 ) f o u n d t h a t t h e G 7 9 a l l e l e w a s a s s o c i a t e d w i t h i n c r e a s e d b o d y m a s s a n d f a t d e p o s i t i o n i n f e m a l e s a n d I s h i y a m a - S h i g e m o t o et al, ( 1 9 9 9 ) s h o w e d a c o r r e l a t i o n b e t w e e n t h e G 4 6 a n d G 7 9 g e n o t y p e s a n d o b e s i t y , w i t h t h e f o r m e r a s s o c i a t i o n u n i q u e t o f e m a l e s . It m a y b e a d v a n t a g e o u s at h i g h a l t i t u d e to m i n i m i z e l i p i d m e t a b o l i s m as the A T P y i e l d p e r 0 2 c o n s u m e d is l o w e r t h a n i n c a r b o h y d r a t e u t i l i z a t i o n ( H o l d e n et al, 1995), a n d i f th e c o r r e l a t i o n b e t w e e n B 2 - A R g e n o t y p e a n d b o d y f a t w a s d u e t o t h e r e c e p t o r v a r i a n t e f f e c t i n g f a t m e t a b o l i s m , t h e n s o m e g e n o t y p e s m a y b e o v e r - r e p r e s e n t e d i n h i g h a l t i t u d e p o p u l a t i o n s . 61 <NH2 E X T R A C E L L U L A R SPACE • mis-sense mutation (alters amino acid) • silent mutation (no effect on amino acid) C e l l M e m b r a n e C Y T O P L A S M ound agonist A ATP c A M P P K A • protein phosphorylation COOH Figure 5.1. The structure of the human 62 adrenergic receptor. The polymorphic sites assayed in this chapter are indicated as gray or black bases. Resultant amino acid changes are shown if applicable. Residue 6 and 15 are phosphorylated. Residue 341 is glycosylated. Insert: Mechanism of action in smooth muscle cells. Agonist bound receptor is coupled to adenlyl cyclase (AC) via a stimulatory guanine nucleotide regulatory protein (Gs). Increased AC activity increases cAMP that activates protein kinase that in turn phosphorylates proteins involved in airway relaxation. Adapted from Liggett and Raymond (1995) and Barnes (1995). Because of the roles of the 8 2 -AR in pulmonary function and fat metabolism, allele frequencies for this gene in the Quechua were determined so as to ascertain whether any of the receptor variants were over-represented in this population compared with lowland populations. While such a finding could be explained by stochastic changes in populations due to genetic 62 d r i f t , i t c o u l d a l s o r e p r e s e n t s e l e c t i o n f a v o u r i n g the a l l e l e , d u e e i t h e r t o its p h e n o t y p e o r t o l i n k a g e w i t h a b e n e f i c i a l v a r i a n t at a n o t h e r l o c u s . T h e f r e q u e n c i e s o f t h e t h r e e m i s s e n s e m u t a t i o n s d i s c u s s e d a b o v e a n d t w o c o m m o n s i l e n t m u t a t i o n s ( G / A 2 5 2 a n d C / A 5 2 3 ) w e r e c o m p a r e d i n t h e Q u e c h u a , N a - D e n e a n d C a u c a s i a n s a m p l e s . It w a s h y p o t h e s i z e d that i f t r a n s - g e n e r a t i o n a l a d a p t a t i o n s t o h i g h a l t i t u d e p o p u l a t i o n s i n v o l v e d B 2 - A R f u n c t i o n , t h e n t h e f r e q u e n c i e s o f a l l e l e s i n t h e g e n e e n c o d i n g t h e r e c e p t o r m i g h t d i f f e r i n t h e s e p o p u l a t i o n s w h e n c o m p a r e d t o l o w l a n d e r s . In a d d i t i o n , b o t h C a u c a s i a n a n d Q u e c h u a D N A s w e r e a s s a y e d f o r t h e p o t e n t i a l Rsa I R F L P r e p o r t e d i n ( E m o r i n e et ai, 1987), a n d s e q u e n c e d t h e c o d i n g s e q u e n c e o f t h e g e n e i n t h r e e Q u e c h u a t o d e t e r m i n e i f t h e r e w e r e a n y as y e t u n r e p o r t e d p o l y m o r p h i s m s c o m m o n i n t h i s p o p u l a t i o n . Methods and Materials Genotyping F i v e p o l y m o r p h i s m s i n t h e B 2 - A R g e n e w e r e a s s a y e d b y r e s t r i c t i o n e n d o n u c l e a s e d i g e s t i o n o f P C R a m p l i f i e d D N A : G / A 4 6 , C / G 7 9 , G/A 2 5 2, C / T 4 9 1 and C / A 5 2 3 . P C R p r o d u c t s i z e a n d d i a g n o s t i c r e s t r i c t i o n e n d o n u c l e a s e s a r e s h o w n i n T a b l e 5.1 a n d p r i m e r s e q u e n c e s are g i v e n i n a p p e n d i x i i . T h e G / A t r a n s i t i o n at b a s e 4 6 d i d n o t a l t e r a n y k n o w n r e s t r i c t i o n e n d o n u c l e a s e r e c o g n i t i o n sit e . A p r i m e r ( 8 2 A R - 4 6 N c o ) w a s d e s i g n e d w i t h a C r e p l a c i n g a n A at the t h i r d to l a s t p o s i t i o n s u c h t h a t a m p l i f i c a t i o n o f D N A w i t h the G a l l e l e at b a s e 4 6 g e n e r a t e d a Nco I r e c o g n i t i o n sit e . A p o t e n t i a l p o l y m o r p h i s m , C A / A C 422,3 ( E m o r i n e et al, 1987), w h i c h c o u l d b e d e t e c t e d b y Rsa I d i g e s t i o n o f B 2 A R - P 1 : 8 2 A R - P 2 p r o d u c t , w a s a l s o a s s a y e d i n a s u b s e t o f t h e C a u c a s i a n s a m p l e . D N A ( 1 0 0 - 2 0 0 n g ) w a s a m p l i f i e d u s i n g 0.033 n m o l e s o f e a c h p r i m e r a n d 0.625 u n i t s Taq p o l y m e r a s e ( G i b c o B R L , G a i t h e r s b u r g , M D ) . T h e f i n a l r e a c t i o n m i x t u r e ( 2 5 u l ) w a s 0.2 m M d N T P s , 1.5 m M M g C l 2 , 2 0 m M T r i s / C l p H 8.4 a n d 5 0 m M K C 1 . R e a c t i o n s w e r e o v e r l a i d w i t h 2 d r o p s o f l i g h t m i n e r a l o i l ( F i s h e r S c i e n t i f i c ) a n d P C R w a s p e r f o r m e d i n a P e r k i n E l m e r D N A T h e r m a l C y c l e r . A m p l i f i c a t i o n c o n d i t i o n s w e r e 9 4 ° C , 1 m i n ; 5 8 ° C , 1 m i n ; 7 2 ° C , 2 m i n f o r 6 3 4 0 c y c l e s . F o l l o w i n g a m p l i f i c a t i o n the o i l o v e r l a y w a s e x t r a c t e d b y th e a d d i t i o n o f 2 0 u l c h l o r o f o r m a n d 2 0 u l o f H 2 0 f o l l o w e d b y a 10 s c e n t r i f u g a t i o n at 12,000 x g. A m p l i f i c a t i o n w a s c o n f i r m e d b y r u n n i n g 8 u l o f t h e r e a c t i o n o n a 2% a g a r o s e g e l a n d E t B r s t a i n i n g . P C R p r o d u c t ( 1 0 u l ) w a s t h e n d i g e s t e d i n a 2 0 u l r e a c t i o n u s i n g 0.2 -1.0 u n i t s o f t h e a p p r o p r i a t e r e s t r i c t i o n e n d o n u c l e a s e a n d th e c o n d i t i o n s p r e s c r i b e d b y the m a n u f a c t u r e r s . D i g e s t s w e r e t h e n e l e c t r o p h o r e s e d o n 8 % p o l y a c r y l a m i d e g e l s , s t a i n e d w i t h E t B r a n d r e c o r d e d u s i n g a P o l a r o i d p h o t o - d o c u m e n t a t i o n s y s t e m ( s e e f i g u r e 5.2). Table 5.1: Location and product size offi2-AR PCR primers. Primer pair Product size Polymorphism B , A R - 4 6 N c o ( 2 8 ) : 6 , A R - P 2 a ( 1 4 3 ) 135 b p G / A 4 6 ( A f c o I ) B ? A R - P 1 (-59) : B , A R - P 1 A ( 1 4 2 ) 2 2 1 b p C / G 7 9 ( S 6 v I ) B , A R - P 1 (-59) : 6 9 A R - P 2 ( 3 5 5 ) 4 3 3 b p C / T 2 5 2 ( M v a I ) B 2 A R - P 3 ( 2 7 5 ) : B 2 A R - P 4 ( 6 9 5 ) 4 4 0 b p C / T 4 9 1 (Mnll) C/A525 (BanI) 6 , A R - P 5 ( 6 4 1 ) : B , A R - P 6 ( 1 0 5 4 ) 4 3 2 b p * B , A R - P 7 ( 8 9 8 ) : 6 , A R - P 8 ( 1 2 8 0 ) 4 0 2 b p * Location of the 5' end of the primer is given in parentheses in the first column and is relative to the translation start site. Primer sequences are given in appendix ii. Diagnostic restriction endonuclease used for RFLP analysis is given in parentheses in the last column. The cytosine shown in bold face in 62AR-46Nco replaces an adenosine such that a Nco I site is generated in the presence of the G allele at the polymorphic site. * primers used for sequencing only. 6 4 G/G A/A A/G C/C G/G C/G A / G 4 6 (A/col) C / G 7 9 (56v I) A/A G/G A/G C/C C/T A / C 5 2 3 (flo/iT) F i g u r e 5 . 2 . A s s a y f o r R F L P s i n t h e 6 2 - A R g e n e . R e p r e s e n t a t i v e p o l y a c r y l a m i d e g e l s s h o w i n g s e p a r a t i o n o f d i g e s t i o n p r o d u c t s f o r t h e R F L P s u s e d t o i d e n t i f y a l l e l e s o f t h e 6 2 - a d r e n e r g i c r e c e p t o r g e n e . S m a l l d i g e s t i o n p r o d u c t s n o t s h o w n . Mnl I d i g e s t i o n a l s o g e n e r a t e s c o n s t a n t 5 0 a n d 4 9 b p p r o d u c t s . G e n o t y p e s a r e g i v e n a c r o s s t h e t o p o f e a c h p a n e l . T h e p o l y m o r p h i s m a n d t h e d i a g n o s t i c r e s t r i c t i o n e n d o n u c l e a s e a r e g i v e n a c r o s s t h e b o t t o m . F r a g m e n t s i z e s a r e i n b a s e p a i r s . T h e Nco I p o l y m o r p h i s m i s g e n e r a t e d u s i n g a p r i m e r w i t h a s i n g l e m i s m a t c h b a s e . A T / T h o m o z y g o t e at b a s e 4 9 1 w a s n e v e r o b s e r v e d . 6 5 A l l e l e f r e q u e n c i e s w e r e e s t a b l i s h e d b y g e n e c o u n t i n g a n d c o m p a r e d b y C h i - s q u a r e (%2) a n a l y s i s u s i n g S t a t V i e w S E s o f t w a r e ( A b a c u s C o n c e p t s Inc., B e r k l e y , C A ) . T o c o r r e c t f o r t h e n u m b e r o f tests ( 2 0 ) s i g n i f i c a n c e w a s a c c e p t e d at a P v a l u e o f < 0.0025 f o r 1 d e g r e e o f f r e e d o m . L i n k a g e d i s e q u i l i b r i u m a n a l y s i s ( l i k e l i h o o d - r a t i o test f o r p h a s e u n k n o w n g e n o t y p i c data) a n d tests f o r H a r d y - W e i n b e r g e q u i l i b r i u m ( m o d i f i e d M a r k o v - c h a i n r a n d o m w a l k a l g o r i t h m ) w e r e p e r f o r m e d u s i n g A r l e q u i n s o f t w a r e ( S c h n e i d e r et al, 1997). DNA sequencing T h e 6 2 - A R g e n e w a s s e q u e n c e d i n t h r e e Q u e c h u a . T h e e n t i r e c o d i n g r e g i o n o f t h e g e n e w a s a m p l i f i e d f r o m t o t a l g e n o m i c D N A i n f o u r P C R r e a c t i o n s u s i n g t h e f o l l o w i n g p r i m e r p a i r s : 6 2 A R - P 1 : P 2 , 6 2 A R - P 3 : P 4 , B 2 A R - P 5 : P 6 a n d 6 2 A R - P 7 : P 8 (s e e a p p e n d i x i i ) . A m p l i f i e d D N A w a s s e p a r a t e d o n 2 % a g a r o s e g e l s , p u r i f i e d w i t h Q I A q u i c k c o l u m n s ( Q i a g e n , M i s s i s s a u g a , O N ) a n d s e q u e n c e d u s i n g p r i m e r s 6 2 A R - P 1 t h r o u g h B 2 A R - P 8 . P r i m e r s y n t h e s i s a n d d i d e o x y D N A s e q u e n c i n g w e r e p e r f o r m e d b y N A P S at U.B.C. Results G e n o t y p e a n d a l l e l e f r e q u e n c i e s f o r t h e Q u e c h u a , N a - D e n e a n d C a u c a s i a n s a m p l e s are g i v e n i n f i g u r e 5.2. F o r t h e G / A t r a n s i t i o n at b a s e 46, a l l e l e f r e q u e n c i e s i n t h e N a - D e n e d i f f e r e d f r o m b o t h t h e Q u e c h u a a n d t h e C a u c a s i a n s . A l l e l e f r e q u e n c i e s f o r C / G 7 9 d i f f e r e d a m o n g a l l t h r e e s a m p l e s w i t h t h e C a l l e l e b e i n g s i g n i f i c a n t l y m o r e c o m m o n i n t h e N a t i v e A m e r i c a n s . T h e Q u e c h u a w e r e m o n o m o r p h i c f o r t h i s a l l e l e . A l l e l e f r e q u e n c i e s o f b o t h s i l e n t m u t a t i o n s ( G / A 2 5 2 , C / A 5 2 3 ) w e r e ' d i f f e r e n t i n t h e Q u e c h u a c o m p a r e d w i t h b o t h the N a - D e n e a n d t h e C a u c a s i a n s . T h e f r e q u e n c y o f t h e r e l a t i v e l y r a r e T a l l e l e at b a s e 4 9 1 d i d n o t d i f f e r b e t w e e n t h e t h r e e s a m p l e s . T h e r e w a s n o s i g n i f i c a n t d i f f e r e n c e i n a l l e l e f r e q u e n c i e s b e t w e e n t h e g r o u p t h a t d o n a t e d b l o o d a n d t h e g r o u p t h a t d o n a t e d b u c c a l c e l l s o r b e t w e e n g r o u p s f r o m the d i f f e r e n t v i l l a g e s . I n b o t h N a t i v e A m e r i c a n s a m p l e s t h e r e w a s s t r o n g l i n k a g e d i s e q u i l i b r i u m ( t a b l e 5.3) b e t w e e n A / G 4 6 , G / A 2 5 2 a n d C / A 5 2 3 ( P < 0 . 0 1 ) c o n s i s t e n t w i t h t h e h a p l o t y p e s A 4 6 G 2 5 2 C 5 2 3 / G 4 6 A 2 5 2 A 5 2 3 . I n t h e C a u c a s i a n s t h e r e w a s s i g n i f i c a n t l i n k a g e d i s e q u i l i b r i u m b e t w e e n A / G 4 6 a n d G / C 7 9 ( P < 0.01) w i t h t h e f o l l o w i n g h a p l o t y p e f r e q u e n c i e s i n i n f o r m a t i v e g e n o t y p e s : 0.28 A ^ C 7 9 , 6 6 0.00 A 4 6 G 7 9 , 0.25 G 4 6 C 7 9 a n d 0.47 G 4 6 G 7 9 . T h e r e w a s a l s o s t r o n g l i n k a g e d i s e q u i l i b r i u m b e t w e e n G / A 2 5 2 a n d C / A 5 2 3 ( P < 0.01) c o n s i s t e n t w i t h t h e h a p l o t y p e s G 2 5 2 C 5 2 3 / A 2 5 2 A 5 2 3 . A l l t h r e e s a m p l e s w e r e e i t h e r m o n o m o r p h i c o r i n H a r d y - W e i n b e r g e q u i l i b r i u m at a l l f i v e l o c i . A l l e l e f r e q u e n c i e s i n t h e C a u c a s i a n s a m p l e d i d n o t s i g n i f i c a n t l y d i f f e r f r o m p r e v i o u s l y p u b l i s h e d C a u c a s i a n v a l u e s ( R e i h s a u s etal, 1993). A l l e l e f r e q u e n c i e s f o r t h e B 2 - A R p o l y m o r p h i s m s are a v a i l a b l e t h r o u g h T h e A l l e l e F r e q u e n c y D a t a b a s e ( A l f r e d ) , w h i c h is m a i n t a i n e d b y D r . K e n K i d d ' s l a b at Y a l e U n i v e r s i t y ( N e w H a v e n , C T ) . T h e U R L f o r t h i s s i t e i s http://alfred.med.yale.edu/alfred/index.asp. I n a d d i t i o n t o t h e a f o r e m e n t i o n e d p o l y m o r p h i s m s , a s u b s e t o f t w e n t y C a u c a s i a n D N A s w a s a n a l y z e d f o r a p o t e n t i a l Rsa I p o l y m o r p h i s m at b a s e s 422,423. A l l s a m p l e s w e r e A C / A C s u g g e s t i n g that t h e C A s e q u e n c e r e p o r t e d i n ( E m o r i n e et al, 1987) w a s e i t h e r a s e q u e n c i n g a r t i f a c t o r a r a r e v a r i a n t . T h e c o d i n g r e g i o n o f t h e g e n e e n c o d i n g t h e B 2 - A R w a s s e q u e n c e d i n t h r e e Q u e c h u a . N o n e w p o l y m o r p h i s m s w e r e d e t e c t e d a n d s e q u e n c e d a t a w e r e c o n s i s t e n t w i t h R F L P a n a l y s i s . S e q u e n c e d a t a h a v e b e e n s u b m i t t e d t o G e n B a n k ( a c c e s s i o n n u m b e r s A F 1 6 9 2 2 5 , A F 2 0 2 3 0 5 a n d A F 2 0 3 3 8 6 ) . Discussion A l l e l e f r e q u e n c i e s o f f o u r o f t h e f i v e B 2 - a d r e n e r g i c r e c e p t o r p o l y m o r p h i s m s a s s a y e d i n t h e Q u e c h u a , t h e N a - D e n e a n d t h e C a u c a s i a n s a m p l e s v a r i e d b e t w e e n t h e t h r e e s a m p l e s , w h e r e a s t h e T 4 9 1 a l l e l e w a s u n i f o r m l y r a r e . T h e G / A 4 6 m i s s e n s e m u t a t i o n a n d t h e t w o s i l e n t m u t a t i o n s G / A 2 5 2 a n d C / A 523 w e r e i n s t r o n g l i n k a g e d i s e q u i l i b r i u m i n b o t h n a t i v e A m e r i c a n p o p u l a t i o n s s u g g e s t i n g t h a t t h e G 4 6 G 2 5 2 C 5 2 3 / A 4 6 A 2 5 2 A 5 2 3 h a p l o t y p e p r e d o m i n a t e d i n t h e A s i a t i c a n t e c e d e n t s o f n a t i v e A m e r i c a n s ; h o w e v e r h a p l o t y p e f r e q u e n c i e s d i f f e r e d s i g n i f i c a n t l y b e t w e e n th e Q u e c h u a a n d t h e N a - D e n e . T h e Q u e c h u a a n d t h e N a - D e n e are t h o u g h t t o h a v e d e s c e n d e d f r o m d i f f e r e n t w a v e s o f m i g r a t i o n i n t o the N e w W o r l d ( C a v a l l i - S f o r z a et al, 1994) a n d h a v e b e e n d i v e r g i n g f o r at l e a s t 14,000 y e a r s . T h e d i f f e r e n c e i n h a p l o t y p e f r e q u e n c i e s b e t w e e n the t w o N e w W o r l d g r o u p s m a y h a v e r e s u l t e d f r o m g e n e t i c d r i f t o c c u r r i n g s u b s e q u e n t 6 7 Table 5. 2. fi2-adrenergic receptor genotype and allele frequencies for the Quechua, Na-Dene and Caucasian samples G / A 4 6 g e n o t y p e P o p u l a t i o n G / G G / A A / A Q u e c h u a 2 4 2 8 11 N a - D e n e 4 14 32 C a u c a s i a n 11 16 3 G / C 7 9 g e n o t y p e P o p u l a t i o n G / G G / C C / C Q u e c h u a 0 0 63 N a - D e n e 0 9 41 C a u c a s i a n 7 15 8 G / A 2 5 2 g e n o t y p e P o p u l a t i o n G / G G / A A / A Q u e c h u a 11 2 8 24 N a - D e n e 3 5 12 3 C a u c a s i a n 2 3 6 1 C / T 4 9 1 g e n o t y p e P o p u l a t i o n C / C C / T T / T Q u e c h u a 6 3 0 0 N a - D e n e 4 9 1 0 C a u c a s i a n 2 9 1 0 C / A 5 2 3 g e n o t y p e P o p u l a t i o n C / C C / A A / A Q u e c h u a 11 2 8 24 N a - D e n e 3 5 13 2 C a u c a s i a n 2 3 7 0 100 G / A 4 6 a l l e l e f r e q u e n c i e s 0 6 0 % ' 2 2 % * 6 3 % G Q u e c h u a N a - D e n e C a u c a s i a n G / C 7 9 a l l e l e f r e q u e n c i e s Q u e c h u a N a - D e n e C a u c a s i a n 1 0 0 8 7 % 4 0 % ' - 8 2 % Q u e c h u a N a - D e n e C a u c a s i a n 1 0 0 0 C / T 4 9 1 a l l e l e f r e q u e n c i e s Q u e c h u a N a - D e n e C a u c a s i a n C / A 5 2 3 a l l e l e f r e q u e n c i e s Q u e c h u a N a - D e n e C a u c a s i a n 1 indicates significant difference from the Na-Dene;2 indicates significant difference from the Caucasians (P<0.0025). Caucasian frequencies did not differ from those previously published (see text for references). G/A 2 5 2 and C/A 5 2 3 are silent polymorphisms and thus do not alter protein structure. 68 Table 5.3: Linkage disequilibrium between the fi -AR allele. Allele association in the Quechua, Na-Dene and Caucasians. Quechua P o l y m o r p h i c l o c u s G / A 4 6 C / G 7 9 G / A 2 5 2 C / T 4 9 1 C / A 5 2 3 g / a 4 6 * nt + nt + C / G 7 9 * nt nt nt G / A 252 * nt + C / T 4 9 1 * n t C / A 523 * Na-Dene P o l y m o r p h i c l o c u s G / A 4 6 C / G 7 9 G / A 2 5 2 C / T 4 9 1 C / A 5 2 3 + - + G / A 4 6 * C / G 7 9 * G / A 252 * . + C / T 4 9 1 * C / A 523 * Caucasian P o l y m o r p h i c l o c u s G / A 4 6 C / G 7 9 G / A 2 5 2 C / T 4 9 1 C / A 5 2 3 G / A 4 6 * + C / G 7 9 * G / A 2 5 2 * . + C / T 4 9 1 * C / A 523 * All pairs denoted by + are in significant linkage disequilibrium (P<0.01). The polymorphisms at bases 79 and 491 are monomorphic in the Quechua and were not tested (nt). 6 9 t o t h e a n c e s t r a l s e p a r a t i o n o r p o s s i b l y f r o m s e l e c t i o n f a v o u r i n g o n e h a p l o t y p e . T w o o f the l i n k e d m u t a t i o n s ( G / A 2 5 2 a n d C / A 5 2 3 ) are s i l e n t a n d p r e s u m a b l y h a v e n o f u n c t i o n a l p h e n o t y p e o n w h i c h s e l e c t i o n c o u l d act; h o w e v e r t h e A / G 4 6 p o l y m o r p h i s m i s r e p o r t e d t o b e a s s o c i a t e d w i t h s e v e r a l p h e n o t y p e s . A s t h e G 4 6 a l l e l e i s t h e l e s s c o m m o n a l l e l e i n t h e N a - D e n e a n d o t h e r A s i a n p o p u l a t i o n s ( W e i r et al, 1998; I s h i y a m a - S h i g e m o t o et al, 1999), t h e r e l a t i v e l y h i g h f r e q u e n c y o f t h e G 4 6 a l l e l e i n t h e Q u e c h u a m a y h a v e a r i s e n a f t e r t h e i r a n c e s t o r s s e p a r a t e d f r o m t h o s e o f t h e N a - D e n e . T h e Q u e c h u a w e r e m o n o m o r p h i c f o r the C 7 9 a l l e l e ; h o w e v e r , t h e d i f f e r e n c e i n f r e q u e n c y b e t w e e n t h e Q u e c h u a a n d the N a - D e n e , w h i l e s i g n i f i c a n t , i s n o t l a r g e a n d c o u l d b e a c c o u n t e d f o r b y g e n e t i c d r i f t . F u r t h e r m o r e , t h e f r e q u e n c y o f C 7 9 i s h i g h i n C h i n e s e (0.80; W e i r et al, 1998) a n d i n J a p a n e s e (0.93; I s h i y a m a - S h i g e m o t o et al, 1999), s u g g e s t i n g that a r e l a t i v e l y h i g h f r e q u e n c y o f t h e C 7 9 a l l e l e m a y b e c h a r a c t e r i s t i c o f p e o p l e o f A s i a n o r i g i n . I f t h e i n c r e a s e d f r e q u e n c y o f t h e C 7 9 a l l e l e t h a t w a s o b s e r v e d i n the Q u e c h u a a n d t h e N a - D e n e w a s a c h a r a c t e r i s t i c o f A m e r i n d i a n p o p u l a t i o n s , i t m a y a c c o u n t f o r the r e d u c e d v e n o d i l a t o r y r e s p o n s e t o i s o p r o t e r e n o l i n N a t i v e A m e r i c a n s c o m p a r e d to C a u c a s i a n s ( V a j o et al, 1 9 9 8 ) . T h e c o m p l e t e a b s e n c e o f t h e G 7 9 a l l e l e i n o u r Q u e c h u a s a m p l e w a s s o m e w h a t s u r p r i s i n g . A s s u m i n g a n a v e r a g e r a c i a l a d m i x t u r e o f 0.247 b e t w e e n Q u e c h u a a n d C a u c a s i a n s ( S a l z a n o a n d C a l l e g a r i -J a c q u e s , 1 9 8 8 ) , a n d a n G 7 9 f r e q u e n c y o f 0.27 i n H i s p a n i c C a u c a s i a n s ( M a r t i n e z et al, 1997), o n e w o u l d e x p e c t e i g h t G 7 9 a l l e l e s i n t h e Q u e c h u a s a m p l e d u e t o a d m i x t u r e a l o n e . H o w e v e r , g i v e n o u r r e l a t i v e l y s m a l l s a m p l e s i z e , w e l a c k e d the s t a t i s t i c a l p o w e r t o d e t e r m i n e w h e t h e r th i s w a s s i g n i f i c a n t . T h e a b s e n c e o f t h e G 7 9 a l l e l e m a y r e f l e c t s e l e c t i o n f a v o u r i n g t h e C 7 9 a l l e l e i n t h e Q u e c h u a ; h o w e v e r m o r e d a t a a r e n e e d e d t o a d d r e s s t h i s i s s u e , e s p e c i a l l y p e r t a i n i n g to a d m i x t u r e i n the c o m m u n i t i e s i n w h i c h o u r Q u e c h u a v o l u n t e e r s l i v e d a n d t h e f r e q u e n c y o f t h i s a l l e l e i n o t h e r S o u t h A m e r i c a n p o p u l a t i o n s . N u m e r o u s s t u d i e s h a v e s h o w n that c a t e c h o l a m i n e l e v e l s i n c r e a s e w i t h a l t i t u d e (see W a r d et al, 1995). W o l f e l et al, ( 1 9 9 4 ) r e p o r t e d a s i g n i f i c a n t i n c r e a s e i n n o r e p i n e p h r i n e , a n d a c o n c o m i t a n t i n c r e a s e i n s y s t e m i c h y p e r t e n s i o n , at 4 3 0 0 m. C h r o n i c a g o n i s t e x p o s u r e c a n r e d u c e t h e r e c e p t o r r e s p o n s e b y b o t h r e d u c i n g r e c e p t o r d e n s i t y a n d b y d e s e n s i t i z i n g t h e r e c e p t o r i t s e l f . 7 0 A l d a s h e v et al, ( 1 9 8 9 ) f o u n d that t h i s d e s e n s i t i z a t i o n w a s a s s o c i a t e d w i t h p u l m o n a r y h y p e r t e n s i o n i n K y r g y z h i g h l a n d e r s l i v i n g at b e t w e e n 3 6 0 0 - 4 2 0 0 m i n E a s t e r n P a m i r ( C e n t r a l A s i a ) . B o t h t h e A 4 6 a n d C 7 9 a l l e l e s a r e a s s o c i a t e d w i t h i n c r e a s e d r e c e p t o r d o w n - r e g u l a t i o n a n d t h e r e b y i n c r e a s e d r e c e p t o r s e n s i t i v i t y t o c a t e c h o l a m i n e s ( G r e e n et al, 1994). It w a s a n t i c i p a t e d that s e l e c t i o n m i g h t f a v o u r t h i s p h e n o t y p e at h i g h a l t i t u d e as i t c o u l d f a c i l i t a t e a i r a n d b l o o d f l o w i n t h e l u n g s . O u r r e s u l t s w e r e o p p o s i t e t o o u r e x p e c t a t i o n s a n d s h o w e d r e d u c e d f r e q u e n c i e s o f t h e s e a l l e l e s i n t h e Q u e c h u a . C a t e c h o l a m i n e s e f f e c t d i v e r s e s y s t e m s a n d i n c r e a s e d a d r e n e r g i c r e s p o n s e , w h i l e e x p e c t e d t o b e a d v a n t a g e o u s at a l t i t u d e i n p u l m o n a r y t i s s u e m a y b e d e t r i m e n t a l e l s e w h e r e . T h e d e c r e a s e i n 8 - a d r e n e r g i c r e c e p t o r d e n s i t y that h a s b e e n r e p o r t e d i n h i g h a l t i t u d e p o p u l a t i o n s h a s b e e n p o s t u l a t e d t o r e d u c e m y o c a r d i a l o x y g e n c o n s u m p t i o n b y l i m i t i n g h e a r t r a t e ( A n t e z a n a et al, 1992). E v e n i f c a r d i a c a d r e n e r g i c r e s p o n s e i s p r i m a r i l y m e d i a t e d b y Bj r e c e p t o r s , s o m e r o l e f o r B 2 - A R h a s b e e n r e p o r t e d ( B i l e z i k i a n , 1987). S e v e r a l s t u d i e s h a v e r e p o r t e d a s s o c i a t i o n s b e t w e e n G / A 4 6 a n d G / C 7 9 g e n o t y p e a n d b o d y fat. I f t h e Q u e c h u a p r e f e r e n t i a l l y m e t a b q l i z e c a r b o h y d r a t e s as a m e t a b o l i c s t r a t e g y t o i m p r o v e t h e a m o u n t o f A T P o b t a i n a b l e p e r m o l e o f o x y g e n , a l l e l e s a s s o c i a t e d w i t h i n c r e a s e d f a t d e p o s i t i o n m a y b e b e n e f i c i a l . T h e a b s e n c e o f t h e G 7 9 e n c o d e d g l y 2 7 s u p p o r t s t h i s h y p o t h e s i s g i v e n t h e d a t a o f M e i r h a e g h e et al, ( 1 9 9 9 ) w h i c h s h o w t h i s a l l e l e t o b e a s s o c i a t e d w i t h i n c r e a s e d b o d y f a t i n C a u c a s i a n m a l e s . H o w e v e r o t h e r s r e p o r t that i t i s t h e a l t e r n a t e a l l e l e ( C 7 9 ) that i s a s s o c i a t e d w i t h i n c r e a s e d f a t d e p o s i t i o n ( L a r g e et al, 1997; I s h i y a m a - S h i g e m o t o et al, 1999). T h i s a p p a r e n t d i s c r e p a n c y m a y b e d u e t o d i f f e r e n t g e n e t i c b a c k g r o u n d s , i n c l u d i n g g e n d e r , as t h e L a r g e et al, 1 9 9 7 ) s t u d y f o c u s e s o n i n f e m a l e s a n d t h e ( I s h i y a m a - S h i g e m o t o et al, 1999) s t u d y i s w i t h A s i a n s . T h e i d e a that t h e a b s e n c e o f the G 7 9 a l l e l e m a y r e f l e c t f u e l u s e p r e f e r e n c e i n h i g h a l t i t u d e n a t i v e s i s i n t r i g u i n g a n d b e a r s f u r t h e r i n v e s t i g a t i o n . A n a l t e r n a t e e x p l a n a t i o n f o r the v a r i a t i o n i n h a p l o t y p e f r e q u e n c i e s b e t w e e n t h e Q u e c h u a a n d t h e N a - D e n e i s s e l e c t i o n h a v i n g a c t e d o n a n u n c h a r a c t e r i z e d v a r i a n t l i n k e d t o the l o c i that w a s e x a m i n e d . T h e c o d i n g r e g i o n o f t h e B 2 - A R g e n e i n t h r e e Q u e c h u a w a s s e q u e n c e d a n d n o n e w m u t a t i o n s w e r e d e t e c t e d . T h e p r o b a b i l i t y o f m i s s i n g a p o l y m o r p h i s m p r e s e n t at the 71 f r e q u e n c y o f t h e l e s s c o m m o n h a p l o t y p e ( 4 0 % ) i n s i x c h r o m o s o m e s i s l e s s t h a n 5 % h o w e v e r , i t i s n o t n e c e s s a r y f o r s u c h a m u t a t i o n t o b e i n t h e c o d i n g s e q u e n c e o r e v e n i n t h e s a m e gene. T h e r e is e v i d e n c e t h a t s o m e o f t h e p h e n o t y p i c e f f e c t s o f B 2 - A R p o l y m o r p h i s m s are h a p l o t y p i c r a t h e r t h a n a l l e l i c . I n a s t u d y o f b r o n c h i a l h y p e r - r e s p o n s i v e n e s s i n n o r m a l s u b j e c t s ( D ' a m a t o et al, 1 9 9 8 ) s h o w e d a n a s s o c i a t i o n w i t h t h e G 4 6 C 7 9 ( g l y 16, g l n 2 7 ) h a p l o t y p e b u t n o t w i t h i n d i v i d u a l a l l e l e s . O u r d a t a s u g g e s t that t h e s e a l l e l e s are i n l i n k a g e d i s e q u i l i b r i u m i n C a u c a s i a n s b u t n o t i n t h e N a - D e n e . T h e Q u e c h u a w e r e n o t t e s t e d as t h e s a m p l e w a s m o n o m o r p h i c f o r t h e C 7 9 a l l e l e . A s t h e s t r o n g l i n k a g e d i s e q u i l i b r i u m b e t w e e n t w o l o c i c a n c o n f o u n d p h e n o t y p i c a n a l y s i s o f s i n g l e a l l e l e s , the Q u e c h u a c o u l d p r o v e t o b e a v a l u a b l e p o p u l a t i o n i n w h i c h t o s t u d y t h e c l i n i c a l e f f e c t s o f the A / G 4 6 p o l y m o r p h i s m i n a i r w a y d i s o r d e r s . T h e r e a r e s i g n i f i c a n t d i f f e r e n c e s i n b o t h a l l e l e f r e q u e n c i e s a n d i n h a p l o t y p e s t r u c t u r e i n the p o p u l a t i o n s that w e e x a m i n e d . It i s p o s s i b l e t h a t s e l e c t i o n h a s a c t e d t o f a v o u r v a r i a n t s i n the 6 2 - A R i n t h e Q u e c h u a as a n a d a p t i v e r e s p o n s e t o h y p o x i c e n v i r o n m e n t i n w h i c h t h e i r a n c e s t o r s c h o s e t o l i v e . T h i s i s s u e h o w e v e r c a n n o t b e a d d r e s s e d w i t h o u t c o m p a r i n g t h e Q u e c h u a to c l o s e l y r e l a t e d , l o w a l t i t u d e c o n t r o l p o p u l a t i o n s . A s t h e a n c e s t o r s o f t h e N a - D e n e a n d Q u e c h u a m a y h a v e a r r i v e d i n N o r t h A m e r i c a as p a r t o f d i f f e r e n t m i g r a t i o n w a v e s ( C a v a l l i - S f o r z a et a l . 1994), t h e t w o g r o u p s m a y b e g e n e t i c a l l y distant. H o w e v e r , r e c e n t H L A a n a l y s i s ( M o n s a l v e et al 1999) s u p p o r t s a s i n g l e w a v e o f m i g r a t i o n s u g g e s t i n g that t h e s e t w o p o p u l a t i o n s m a y b e m o r e s i m i l a r t h a n that p r e v i o u s l y s u s p e c t e d . T h e d i v e r g e n c e b e t w e e n t w o p o p u l a t i o n s as t e m p o r a l l y a n d g e o g r a p h i c a l l y s e p a r a t e as E u r o p e a n C a u c a s i a n s a n d t h e Q u e c h u a w o u l d b e e v e n m o r e p r o n o u n c e d t h a n t h a t b e t w e e n the n a t i v e A m e r i c a n g r o u p s . W h i l e c o m p a r i s o n s b e t w e e n t h e s e p o p u l a t i o n s m a y b e o f l i m i t e d v a l u e i n d e t e r m i n i n g t h e b a s i s f o r t h e o b s e r v e d d i f f e r e n c e s i n a l l e l e f r e q u e n c y a n d h a p l o t y p e s t r u c t u r e , t h e d a t a d o d e m o n s t r a t e that s o m e a l l e l e s i n the 6 2-a d r e n e r g i c g e n e a r e g r e a t l y o v e r - r e p r e s e n t e d i n the h i g h a l t i t u d e n a t i v e s a n d r a i s e s the p o s s i b i l i t y that t h e s e a l l e l e s , o r a l l e l e s t o w h i c h t h e y are l i n k e d , m a y p l a y s o m e r o l e i n t h e a d a p t i v e r e s p o n s e t o l o n g t e r m h y p o x i a . 7 2 Chapter 6 Sequence of the erythropoietin and the HIF-la genes in the Quechua Introduction E x p o s u r e t o h y p o x i a t r i g g e r s a r a p i d h e m a t o l o g i c a l r e s p o n s e c h a r a c t e r i z e d b y a n i n c r e a s e i n h e m a t o c r i t that c o m p e n s a t e s f o r t h e r e d u c t i o n i n o x y g e n a v a i l a b i l i t y b y i n c r e a s i n g t h e o x y g e n c a r r y i n g c a p a c i t y o f t h e b l o o d . E l e v a t e d h e m a t o c r i t s b e c o m e a p p a r e n t w i t h i n a w e e k o f e x p o s u r e t o h i g h a l t i t u d e a n d v a l u e s o f 6 0 % a r e c o n s i d e r e d n o r m a l f o r s e a l e v e l s o j o u r n e r s ( W a r d et al, 1995). A l t h o u g h t h e s e v a l u e s t e n d t o d e c l i n e s o m e w h a t f r o m a n i n i t i a l p e a k , s o m e d e g r e e o f s e c o n d a r y p o l y c y t h e m i a c a n b e m a i n t a i n e d f o r y e a r s i n l o n g t e r m m i g r a n t s ( H e a t h a n d W i l l i a m s , 1 9 9 5 ) . A l t h o u g h t h e r e a r e s o m e r e p o r t s o f v e r y h i g h v a l u e s i n h i g h a l t i t u d e n a t i v e s (e.g. 7 1 . 1 % ; H u r t a d o , 1932), n o t a l l s t u d i e s a g r e e that s e c o n d a r y p o l y c y t h e m i a i s a u n i v e r s a l c h a r a c t e r i s t i c o f t h e s e p o p u l a t i o n s . A n d e a n v a l u e s t e n d t o b e s o m e w h a t h i g h e r t h a n t h o s e r e p o r t e d f o r H i m a l a y a n s l i v i n g at t h e s a m e a l t i t u d e s , a n d s o m e a u t h o r s (e.g. B e a l l et al, 1987) p o s t u l a t e that t h i s m a y b e d u e t o g r e a t e r h y p o x a e m i c s t i m u l u s o f e r y t h r o p o i e s i s , p o s s i b l y r e f l e c t i n g l e s s e f f e c t i v e a d a p t a t i o n i n t h e A n d e a n s . I n 1983, G a r r u t t o a n d D u t t , r e c o g n i z i n g t h a t d i v e r s e s o c i o -e n v i r o n m e n t a l f a c t o r s c a n c o n t r i b u t e t o p o l y c y t h e m i a , e x a m i n e d a n u m b e r o f h e m a t o l o g i c a l p a r a m e t e r s i n t r a d i t i o n a l , a g r o - p a s t o r a l Q u e c h u a c o m m u n i t i e s l o c a t e d at 4 2 0 0 m ne a r P u n o , P e r u . T h e y f o u n d that t h e m e a n h e m a t o c r i t i n m a l e s 6-21 y e a r s o l d w a s o n l y 1 0 % h i g h e r t h a n a g e m a t c h e d s e a l e v e l v a l u e s , that r e t i c u l o c y t e c o u n t s ( a m e a s u r e o f e r y t h r o p o i e t i c a c t i v i t y ) w e r e n o t s i g n i f i c a n t l y i n c r e a s e d a n d that the a v e r a g e h e m a t o c r i t i n a d u l t m a l e s w a s 5 1 . 4 % , w e l l w i t h i n the n o r m a l r a n g e f o r m e n at s e a l e v e l (e.g. 4 0 % - 5 4 % T h o m a s , 1993). T h e a u t h o r s c o n c l u d e d that e x c e s s i v e s e c o n d a r y p o l y c y t h e m i a i s n o t n e c e s s a r i l y a c h a r a c t e r i s t i c o f A n d e a n n a t i v e p o p u l a t i o n s a n d s u g g e s t e d t h a t the h i g h v a l u e s r e p o r t e d i n s o m e s t u d i e s w e r e d u e t o e n v i r o n m e n t a l a n d d e m o g r a p h i c f a c t o r s i n t r o d u c e d b y s a m p l i n g i n m i n i n g c o m m u n i t i e s ( G a r r u t t o a n d D u t t , 1983; see a l s o B a l l e w etal, 1989). 7 3 S t u d i e s o f Q u e c h u a o r A y m a r a r e s i d i n g at l o w e r a l t i t u d e s a r e u n c o m m o n ; h o w e v e r , s o m e h e m a t o l o g i c a l d a t a h a s b e e n p u b l i s h e d . A r n a u d et al, 1 9 8 5 m e a s u r e d h e m a t o c r i t s o f b o t h Q u e c h u a a n d A y m a r a m a l e s l i v i n g i n S a n t a C r u z , B o l i v i a at 4 5 0 m. A v e r a g e h e m a t o c r i t s f o r b o t h g r o u p s ( 4 2 . 1 % , 4 1 . 6 % ) w e r e e i t h e r near, o r b e l o w , the l o w e n d o f n o r m a l s e a l e v e l r a n g e ( 4 0 % i n T h o m a s , 1993; 4 2 % i n S p r a y c a r , 1995). A n o t h e r s t u d y o f A y m a r a l i v i n g at a r o u n d 5 0 0 m i n c o a s t a l C h i l e a l s o r e p o r t e d a r e l a t i v e l y l o w a v e r a g e h e m a t o c r i t ( 3 9 . 6 % ; C l e n c h et al, 1982). A l t h o u g h t h i s s t u d y c o m b i n e d m a l e a n d f e m a l e data, t h e a v e r a g e h e m a t o c r i t w a s s t i l l i n the l o w e n d o f t h e n o r m a l f e m a l e r a n g e ( 3 7 % - 4 7 % ; S p r a y c a r , 1995). O n t h e w h o l e , t h e d a t a s u g g e s t that d e s p i t e c h r o n i c e x p o s u r e t o h y p o x i c c o n d i t i o n s , A n d e a n h i g h l a n d e r s t e n d n o t t o h a v e e x c e s s i v e c o m p e n s a t o r y p o l y c y t h e m i a w h e n r e s i d e n t at a l t i t u d e a n d h a v e r e l a t i v e l y l o w h e m a t o c r i t s w h e n l i v i n g at l o w e r a l t i t u d e s . T h e e a r l y s t e p s o f e r y t h r o p o i e s i s , the p r o c e s s b y w h i c h h e m a t o p o i e t i c s t e m c e l l s d i f f e r e n t i a t e i n t o m a t u r e R B C s , i s m e d i a t e d b y t h e g l y c o p r o t e i n h o r m o n e e r y t h r o p o i e t i n ( E p o ) . E p o , w h i c h i s s y n t h e s i z e d i n the a d u l t k i d n e y , i n t e r a c t s w i t h a c e l l s u r f a c e r e c e p t o r o n m a t u r e e r y t h r o i d p r o g e n i t o r c e l l s ( C F U - E c e l l s ) a n d s t i m u l a t e s t h e i r m a t u r a t i o n i n t o p r o - e r y t h r o b l a s t s t h a t s u b s e q u e n t l y d i v i d e i n t o 16 R B C s ( f i g u r e 6.1). I n t h e a b s e n c e o f E p o , t h e C F U - E c e l l s e v e n t u a l l y d i e w i t h o u t d i f f e r e n t i a t i n g f u r t h e r ( E r s l e v a n d C a r o , 1988). S y n t h e s i s o f E p o i s s t i m u l a t e d b y r e d u c e d P a 0 2 ( K l a u s e n , 1 9 9 8 ) . T h i s c a n r e s u l t f r o m a n u m b e r o f f a c t o r s i n c l u d i n g : i m p a i r e d h e m o g l o b i n f u n c t i o n , r e d u c e d h e m o g l o b i n c o n c e n t r a t i o n and, as i n t h e c a s e o f h y p o x i c s t i m u l a t i o n o f e r y t h r o p o i e s i s , l o w S a 0 2 s e c o n d a r y t o r e d u c e d o x y g e n a v a i l a b i l i t y . W i t h i n 1 - 2 d a y s f o l l o w i n g e x p o s u r e t o 3 5 0 0 - 4 5 0 0 m, t h e r e i s a s u b s t a n t i a l i n c r e a s e i n i m m u n o r e a c t i v e E p o l e v e l s ( M i l l e d g e a n d C o t e s , 1985). I n s u b j e c t s w h o r e m a i n e d at t h e s e a l t i t u d e s , E p o l e v e l s d e c l i n e d t o s e a l e v e l v a l u e s a f t e r a p p r o x i m a t e l y t h r e e w e e k s , w h e r e a s t h e y c o n t i n u e d t o r i s e i n s u b j e c t s w h o w e n t o n t o h i g h e r a l t i t u d e s . E p o l e v e l s r e m a i n e l e v a t e d u n t i l P a 0 2 r e t u r n s t o n o r m a l , at w h i c h p o i n t t h e y b e g i n t o d e c l i n e ( E r s l e v a n d C a r o , 1988). F a i l u r e o f t h i s n e g a t i v e f e e d b a c k c o n t r o l i s s u s p e c t e d t o p l a y a r o l e i n t h e d e v e l o p m e n t o f c h r o n i c m o u n t a i n s i c k n e s s , o r M o n g e ' s d i s e a s e , a c o n d i t i o n that i s c h a r a c t e r i z e d b y e x t r e m e s e c o n d a r y p o l y c y t h e m i a . 7 4 approximately 5 days reticulocytes <Q»<£)-K?-»*g>»-®-**©*-(D s t e m c e l l | B F U - E C F U - E || (2) (4) ( 8 ) | ( 1 6 ) p r o g e n i t o r c e l l m a t u r e R B C s Figure 6.1. Erythropoietin and the production of red blood cells. The transformation of CFU-E cells to erythroblasts is dependent on erythropoietin. In the absence of erythropoietin, most CFU-E cells die prior to differentiation. One CFU-E cell can differentiate into 16 mature RBCs. Adapted from (Erslev and Caro, 1988). E p o p r o d u c t i o n i s r e g u l a t e d at t h e R N A l e v e l b y h y p o x i a i n d u c i b l e f a c t o r - 1 ( H I F - 1 ) , a n o x y g e n s e n s i t i v e t r a n s c r i p t i o n c o m p l e x that b i n d s t o t h e 3' e n h a n c e r r e g i o n o f t h e E p o g e n e ( f i g u r e 6.2) a n d t r i g g e r s e x p r e s s i o n o f t h e g e n e (see r e v i e w b y B u n n etal., 1998). H I F - 1 i s c o m p r i s e d o f a n a l p h a ( H I F - l a ) a n d a b e t a s u b u n i t ( H I F - 1 - 6 , a l s o k n o w n as a r y l h y d r o c a r b o n r e c e p t o r n u c l e a r t r a n s l o c a t o r ( A R N T ) ) w i t h t h e a l p h a s u b u n i t r e s p o n s i b l e f o r t h e o x y g e n m e d i a t e d a c t i v i t y o f t h e f a c t o r . I n a d d i t i o n t o E p o , H I F - 1 r e g u l a t e s a n u m b e r o f h y p o x i a i n d u c e d g e n e s i n c l u d i n g v a s c u l a r e n d o t h e l i a l g r o w t h f a c t o r , t y r o s i n e k i n a s e a n d s o m e g l y c o l y t i c e n z y m e s . T h e c r i t i c a l r o l e s o f e r y t h r o p o i e t i n a n d H I F - l a i n t h e r e s p o n s e t o h y p o x i a m a k e th e g e n e s e n c o d i n g t h e m p r i m e c a n d i d a t e s f o r t h i s s t u d y . A s u r v e y o f t h e l i t e r a t u r e ( P u b M e d , N o v . 1999) f a i l e d l o c a t e a n y r e f e r e n c e s t o f u n c t i o n a l p o l y m o r p h i s m s i n e i t h e r o f t h e s e gene. W h i l e t h i s u n f o r t u n a t e l y p r e c l u d e s t h e t y p e o f a n a l y s i s e m p l o y e d p r e v i o u s l y , it d o e s n o t e x c l u d e the p o s s i b i l i t y that t h e r e a r e as y e t u n i d e n t i f i e d v a r i a n t s i n t h e s e g e n e s that a r e u n i q u e t o h i g h a l t i t u d e p o p u l a t i o n s . T h i s p o s s i b i l i t y w a s a d d r e s s e d b y s e q u e n c i n g t h e c o d i n g r e g i o n o f b o t h g e n e s a n d the d o w n s t r e a m r e g u l a t o r y r e g i o n o f t h e E p o g e n e i n t h r e e u n r e l a t e d Q u e c h u a . I n a d d i t i o n , a l l e l e f r e q u e n c i e s o f a p o l y m o r p h i s m i n t h e 3' r e g i o n o f the E P O gene, p r o x i m a l to, b u t n o t i n , the H I F - 1 b i n d i n g s e q u e n c e ( P e r c y et al, 1997), w e r e d e t e r m i n e d i n t h e Q u e c h u a a n d t h e C a u c a s i a n s . £ & . 2 o & b o si < % CH PJ 75 5 ' g g g c c c c a c g t g c t g t c t c a c a c a g c c t g t c t c f a c f j t c t c ^ a £ ^ a c c g g +680 c c t a g g c c a c a a g c t c t g c c 3' y f V H I F - I N Figure 6.2. Regulatory regions of the erythropoietin gene. Top: Sequence of the hypoxia sensitive 3' enhancer region of the erythropoietin gene. The HIF-1 binding site (box), the hormone response element (HRE) (thick underline) and the short CA repeat sequence (thin underline) are required for hypoxia regulated gene expression. Numbering is from the termination codon. Bottom: Cartoon of the proposed transcription complex showing the interaction between the sequence elements shown in 6b and transcription factors. Diagram is not to scale. Adapted from Bunn et. al, (1998). Materials and methods DNA sequencing 1) E r y t h r o p o i e t i n G e n o m i c D N A w a s p r e p a r e d as d e s c r i b e d i n c h a p t e r 2. T h e c o m p l e t e c o d i n g r e g i o n o f t h e e r y t h r o p o i e t i n g e n e w a s a m p l i f i e d f r o m t w o Q u e c h u a D N A s a m p l e s a n d o n e Q u e c h u a l y m p h o b l a s t l i n e ( G M 1 1 1 9 7 ) b y P C R u s i n g b o t h e x o n i c a n d i n t r o n i c p r i m e r s ( s e e f i g u r e 6.3 a n d a p p e n d i x i i ) . P C R ( 2 5 ul) w e r e 0.2 m M d N T P s , 1.5 m M M g C l 2 , 2 0 m M T r i s / C l p H 8.4 a n d 5 0 m M K C 1 a n d c o n d i t i o n s w e r e 9 4 ° C , 1 min.; 5 8 ° C , 1 min.; 7 2 ° C , 2 m i n . f o r 4 0 c y c l e s . D N A s e q u e n c i n g w a s p e r f o r m e d b y N A P S . U s i n g B L A S T , t h e f i n a l c o n t i g u o u s s e q u e n c e s w e r e a l i g n e d t o a p u b l i s h e d h u m a n E p o s e q u e n c e ( K o b i l k a et al, 1987; G e n B a n k a c c e s s i o n n u m b e r M 1 5 1 6 9 ) a n d t o E p o s e q u e n c e s i n t h e n o n - r e d u n d a n t G e n B a n k d a t a b a s e . T h e r e s u l t i n g a l i g n m e n t s w e r e c h e c k e d f o r m i s m a t c h e s that c o u l d b e i n d i c a t i v e o f p o l y m o r p h i c l o c i . 7 6 E p o l E p o 11 E p o 1 0 E p o 9 E p o 7 <- <- <- <- <-E p o l 5 E p o 1 2 E p o 2 E p o 8 E p o 4 1 0 0 0 b p Figure 6.3. Location of erythropoietin gene PCR primers used for amplification and sequencing of the coding regions (black) of the erythropoietin (Epo) gene. The 3' enhancer region is shaded 2) H I F - l o c T o t a l R N A w a s p r e p a r e d f r o m t h r e e Q u e c h u a l y m p h o b l a s t c e l l l i n e s ( G M 1 1 1 9 7 , G M 1 1 1 9 8 , G M 1 1 2 0 1 ) a n d c D N A p r e p a r e d b y r e v e r s e t r a n s c r i p t i o n as d e s c r i b e d i n c h a p t e r 2. T h e c D N A w a s u s e d as a t e m p l a t e f o r P C R a m p l i f i c a t i o n o f t h e c o d i n g s e q u e n c e o f t h e H I F - l a g e n e . P C R s ( 2 5 ul) w e r e 0.2 m M d N T P s , 1.5 m M M g C l 2 , 2 0 m M T r i s / C l p H 8.4 a n d 5 0 m M K C 1 a n d c o n d i t i o n s w e r e 9 4 ° C , 1 min.; 5 8 ° C , 1 min.; 7 2 ° C , 2 m i n . f o r 4 0 c y c l e s u s i n g t h e f o l l o w i n g p r i m e r p a i r s : H I F - l o c - S l : H I F - l a - S 2 , H I F - l a - S 3 : H I F - l a - S 4 , H I P - l a - S 5 : H I F -l a-S6, H I F - l a - S 7 : H I F - l a - S 8 ( s e e a p p e n d i x i i ) . T h e s a m e p r i m e r s w e r e u s e d i n d i v i d u a l l y t o s e q u e n c e t h e s e a m p l i f i c a t i o n p r o d u c t s . D N A s e q u e n c i n g w a s p e r f o r m e d b y N A P S at U.B.C. T h e f i n a l c o n t i g u o u s s e q u e n c e s w e r e a l i g n e d a n d c h e c k e d f o r m i s m a t c h e s as d e s c r i b e d a b o v e . T h e r e f e r e n c e s e q u e n c e w a s f r o m W a n g et al, 1 9 9 5 ( G e n B a n k a c c e s s i o n n u m b e r U 2 2 4 3 1 ) . Genotyping T h e f r e q u e n c i e s o f b o t h t h e C / T + 6 6 2 a n d t h e n e w l y i d e n t i f i e d T / G + 7 6 9 p o l y m o r p h i s m s w e r e d e t e r m i n e d i n Q u e c h u a a n d C a u c a s i a n s . T h e r e g i o n e n c o m p a s s i n g t h e C / T 4 * 6 2 w a s a m p l i f i e d u s i n g t h e p r i m e r s E p o M a e : E p o - 4 ( c o n d i t i o n s d e s c r i b e d a b o v e ) . E p o M a e i s a d e g e n e r a t e p r i m e r d e s i g n e d s u c h that a Mae III r e s t r i c t i o n e n d o n u c l e a s e r e c o g n i t i o n s i t e i s g e n e r a t e d i n t h e p r e s e n c e o f the C a l l e l e . A m p l i f i c a t i o n p r o d u c t w a s d i g e s t e d w i t h Mae III u n d e r t h e c o n d i t i o n s p r e s c r i b e d b y the m a n u f a c t u r e r ( G i b c o B R L , G a i t h e r s b u r g , M D ) a n d v i s u a l i z e d as d e s c r i b e d i n c h a p t e r 2. S a m p l e d i g e s t p r o d u c t s a r e s h o w n i n f i g u r e 6.4a. T h e T / G + 7 6 9 p o l y m o r p h i s m w a s a s s a y e d u s i n g a d e g e n e r a t e p r i m e r ( E p o B b v ) th a t g e n e r a t e d a d i a g n o s t i c Bbv I s i t e w h e n th e G a l l e l e w a s p r e s e n t . T h i s a s s a y w a s c h o s e n o v e r 7 7 u s i n g the n a t u r a l l y v a r i a n t M a I V sit e b e c a u s e M a I V d o e s n o t f u n c t i o n e f f i c i e n t l y i n the p r e s e n c e o f K C 1 a n d t h e r e f o r e r e q u i r e s e x t r a p u r i f i c a t i o n s t ep p r i o r t o d i g e s t i o n t o r e m o v e K C 1 c a r r i e d o v e r f r o m t h e P C R r e a c t i o n . D N A w a s P C R a m p l i f i e d u s i n g t h e p r i m e r s E p o - 7 : E p o B b v ( r e a c t i o n s as d e s c r i b e d a b o v e ) . A m p l i f i c a t i o n c o n d i t i o n s w e r e 9 4 ° C , 1 min.; 6 0 ° C , 1 min.; 7 2 ° C , 2 m i n . f o r 3 0 c y c l e s . P C R p r o d u c t s w e r e t h e n d i g e s t e d w i t h t h e r e s t r i c t i o n e n d o n u c l e a s e Bbv I u n d e r t h e c o n d i t i o n s p r e s c r i b e d b y t h e m a n u f a c t u r e r ( N e w E n g l a n d B i o l a b s , B e v e r l y , M A ) a n d a s s a y e d as d e s c r i b e d i n c h a p t e r 2. S a m p l e d i g e s t i o n p r o d u c t s are s h o w n i n f i g u r e 6.4b. A l l e l e f r e q u e n c y d a t a w e r e a n a l y z e d as d e s c r i b e d i n c h a p t e r 2. S i g n i f i c a n c e w a s a c c e p t e d at p <0.025 t o c o r r e c t f o r t h e n u m b e r o f tests. Results 1) S e q u e n c e a n d p o l y m o r p h i s m s i n t h e e r y t h r o p o i e t i n g e n e T h e g e n o m i c s e q u e n c e o f t h e e r y t h r o p o i e t i n g e n e w a s d e t e r m i n e d i n t h r e e Q u e c h u a (see a p p e n d i x i i i ) . S e q u e n c e d a t a a r e a v a i l a b l e t h r o u g h G e n B a n k ( G e n B a n k , a c c e s s i o n n u m b e r s A F 2 0 2 3 0 6 , A F 2 0 2 3 0 7 , A F 2 0 2 3 0 8 ( Q u e c h u a 1); A F 2 0 2 3 0 9 , A F 2 0 2 3 1 0 , A F 2 0 2 3 1 1 ( Q u e c h u a 2) ; A F 2 0 2 3 1 2 , A F 2 0 2 3 1 3 a n d A F 2 0 2 3 1 4 ( Q u e c h u a 3)). O n e o f t h e Q u e c h u a s e q u e n c e d w a s h e t e r o z y g o u s f o r a n p r e v i o u s l y u n r e p o r t e d p o l y m o r p h i s m , a T t o G t r a n s v e r s i o n 7 6 9 b a s e s d o w n s t r e a m o f t h e t e r m i n a t i o n c o d o n ( T / G + 7 6 9 ) ( f i g u r e 6.5). A l l o t h e r s e q u e n c e w a s i d e n t i c a l i n t h e t h r e e Q u e c h u a . A l i g n m e n t s w i t h v a r i o u s E p o s e q u e n c e s i n t h e n o n - r e d u n d a n t D N A d a t a b a s e d e t e c t e d a v a r i a n t b a s e p r o x i m a l t o T / G + 7 6 9 , a C t o T t r a n s i t i o n at b a s e 6 6 2 ( C / T + 6 6 2 ) ( f i g u r e 6.5). T h i s p o l y m o r p h i s m h a d p r e v i o u s l y b e e n r e p o r t e d i n t h e l i t e r a t u r e ( P e r c y et al, 1997). A l l t h r e e Q u e c h u a s e q u e n c e d w e r e h o m o z y g o u s f o r the C a l l e l e . 7 8 G/G T/G T/T 291 > 151 > 130 > C / T + 6 6 2 (Mae I) X / G + 7 6 9 ( £ £ y T) F i g u r e 6.4. A s s a y f o r R F L P S i n the e r y t h r o p o i e t i n g e n e . R e p r e s e n t a t i v e p o l y a c r y l a m i d e g e l s s h o w i n g s e p a r a t i o n o f d i g e s t i o n p r o d u c t s f o r t h e R F L P s u s e d t o i d e n t i f y a l l e l e s o f t h e 3' r e g i o n o f t h e e r y t h r o p o i e t i n g e n e . I n a d d i t i o n t o t h e p r o d u c t s m a r k e d b y t h e a r r o w s , b o t h r e a c t i o n s a l s o g e n e r a t e a s m a l l ( > 3 0 b a s e ) p r o d u c t w h e n t h e r e i s d i g e s t i o n at t h e p o l y m o r p h i c s i t e . G e n o t y p e s a r e g i v e n a c r o s s t h e t o p o f e a c h p a n e l . T h e p o l y m o r p h i s m a n d t h e d i a g n o s t i c r e s t r i c t i o n e n d o n u c l e a s e a r e g i v e n a c r o s s t h e b o t t o m . F r a g m e n t s i z e s a r e i n b a s e p a i r s . A T / T h o m o z y g o t e at C / T + 6 6 2 w a s n e v e r o b s e r v e d . T h e a p p a r e n t d o u b l e t b a n d s i n t h e t h e r i g h t - h a n d i m a g e a r e g e l a r t e f a c t s . 79 ^C/T+662 5'aggtccggga aaygaggggt ggagggggct gggccctacg t a c t j t c t c a +650 cacagcctgt c tc^acc^ctc^r^cctaccgg cctaggccac aagctctgcc tacgctggtc aataaggtgk c tccat tcaa ggcctcaccg cagtaaggca T G / T + 7 6 9 gctgccaacc ctgcccaggg caaggctgca3' +829 Figure 6.5 Polymorphic sites in the Epo gene. Regulatory regions are as described in figure 6.1. Neither of the 3' polymorphisms (degenerate bases, boldface) alters the sequence of any known functional element. G e n o t y p e s a n d a l l e l e f r e q u e n c i e s f o r b o t h p o l y m o r p h i s m s i n Q u e c h u a a n d C a u c a s i a n s a r e g i v e n i n t a b l e s 6.6 a,b. A l l e l e f r e q u e n c i e s o f t h e T / G + 7 6 9 p o l y m o r p h i s m d i d n o t s i g n i f i c a n t l y d i f f e r b e t w e e n t h e Q u e c h u a a n d the C a u c a s i a n s . T h e Q u e c h u a w e r e m o n o m o r p h i c f o r the C al l e l e at C / T + 6 6 2 a n d a l l e l e f r e q u e n c i e s d i f f e r e d s i g n i f i c a n t l y (p=0.007) f r o m t h e C a u c a s i a n s at t h i s site. T h e r e w a s n o s i g n i f i c a n t l i n k a g e d i s e q u i l i b r i u m b e t w e e n a l l e l e s at t h e t w o l o c i i n the C a u c a s i a n s a m p l e a n d g e n o t y p e f r e q u e n c i e s at b o t h l o c i w e r e i n H a r d y - W e i n b e r g e q u i l i b r i u m . 2) S e q u e n c e o f t h e h y p o x i a i n d u c i b l e f a c t o r - l a gene. T h e c o d i n g s e q u e n c e o f the H I F - l a g e n e w a s d e t e r m i n e d i n t h r e e Q u e c h u a (see a p p e n d i x i i i ) . N o v a r i a n t s w e r e d e t e c t e d w i t h i n the Q u e c h u a s e q u e n c e s o r b e t w e e n t h e Q u e c h u a a n d s e q u e n c e s i n t h e G e n B a n k d a t a b a s e . A s i n g l e r e p r e s e n t a t i v e s e q u e n c e i s g i v e n i n a p p e n d i x i i i . A l l Q u e c h u a H I F - l a s e q u e n c e s a r e a v a i l a b l e t h r o u g h G e n B a n k , a c c e s s i o n n u m b e r s A F 2 0 7 6 0 1 , A F 2 0 7 6 0 2 a n d A F 2 0 8 4 8 7 . Discussion 1) E r y t h r o p o i e t i n N o v a r i a t i o n w a s d e t e c t e d b e t w e e n t h e c o d i n g s e q u e n c e s o f the E p o g e n e i n t h e thr e e Q u e c h u a tha t w e r e s e q u e n c e d o r b e t w e e n t h e Q u e c h u a s e q u e n c e s a n d the E p o c o d i n g 8 0 Table 6.1: Erythropoietin allele genotype and frequencies, a) Genotypes and allele frequencies for the C/T+662polymorphism in the erythropoietin gene in Quechua and Caucasian samples, b) Genotypes and allele frequencies for the T/G+76ipolymorphism in the erythropoietin gene in Quechua and Caucasian samples. a) P o p u l a t i o n C / T + 6 6 2 g e n o t y p e s C / C C / T T Y T Q u e c h u a 52 0 0 C a u c a s i a n 27 5 0 *Allele frequencies differ significantly (P C^r+662 aiieie Q u e c h u a C a u c a s i a n i.025). b) P o p u l a t i o n X/G+769 g e n o t y p e s 100 T / T T / G G / G Q u e c h u a 29 13 4 C a u c a s i a n 14 9 6 0 T / G + 7 6 9 a l l e l e f r e q u e n c i e s ** **Allele frequencies do not differ significantly. 77.2 % 63 ML Q u e c h u a C a u c a s i a n 81 s e q u e n c e s a v a i l a b l e t h r o u g h G e n B a n k . T h i s d o e s n o t p r e c l u d e t h e e x i s t e n c e o f s u c h v a r i a n t s ; h o w e v e r , i n a s c r e e n o f s i x c h r o m o s o m e s , th e p r o b a b i l i t y o f m i s s i n g a n a l l e l e p r e s e n t at a f r e q u e n c y o f 5 0 % i s l e s s t h a n f i v e p e r c e n t . O n e v a r i a n t i n t h e 3' u n t r a n s l a t e d r e g i o n ( C / T * 6 6 2 ) w a s d e t e c t e d d u r i n g a l i g n m e n t o f E p o s e q u e n c e s a l i g n e d t o E p o s e q u e n c e s i n t h e G e n B a n k d a t a b a s e . T h i s p o l y m o r p h i s m h a d p r e v i o u s l y b e e n d e s c r i b e d ( P e r c y et al, 1997). It i s p r e s u m e d n o t t o h a v e a n y e f f e c t i n the s y n t h e s i s o r f u n c t i o n o f E p o a n d w a s n o t o v e r - r e p r e s e n t e d i n p a t i e n t s w i t h p o l y c y t h e m i a ( P e r c y et al, 1997). T h e T a l l e l e at t h i s l o c i w a s a b s e n t i n t h e Q u e c h u a that w e r e a s s a y e d , a n d at 9 % , w a s s i g n i f i c a n t l y m o r e f r e q u e n t i n t h e C a u c a s i a n s . A s e c o n d p o l y m o r p h i s m , T / G +769, wa s d e t e c t e d i n o n e o f t h e t h r e e Q u e c h u a s e q u e n c e d . T h i s p o l y m o r p h i c s i t e i s d o w n s t r e a m o f the H I F - 1 b i n d i n g s i t e a n d d o e s n o t a l t e r t h e s e q u e n c e o f a n y o f t h e r e g i o n s k n o w n to b e i n v o l v e d i n h y p o x i c i n d u c t i o n o f t h e gene. A l l e l e f r e q u e n c i e s f o r t h i s l o c u s d i d n o t d i f f e r s i g n i f i c a n t l y b e t w e e n t h e Q u e c h u a a n d C a u c a s i a n s . G i v e n t h e i r l o c a t i o n s , i t i s u n l i k e l y that e i t h e r o f t h e s e p o l y m o r p h i s m s a f f e c t the s y n t h e s i s o f E p o . T h e d i f f e r e n c e i n a l l e l e f r e q u e n c i e s b e t w e e n the Q u e c h u a a n d t h e C a u c a s i a n s at CAT"" 6 6 2 c o u l d b e a c c o u n t e d f o r b y g e n e t i c d r i f t . A s e c o n d p o s s i b l e e x p l a n a t i o n i s t h a t a l l e l e s at t h i s l o c i a r e l i n k e d t o a l l e l e s at a n o t h e r l o c i that are u n d e r s e l e c t i o n . R e s t r i c t i o n f r a g m e n t l e n g t h p o l y m o r p h i s m s d e t e c t a b l e w i t h Xba I ( S e m e n z a et al, 1987) a n d Bgl II ( B e r u a n d P a y t o n , 1991) h a v e b e e n r e p o r t e d i n t h e E p o gene. N o p h e n o t y p e h a s b e e n d e s c r i b e d f o r e i t h e r o f t h e s e a n d the a c t u a l p o l y m o r p h i c b a s e h a s n o t b e e n i d e n t i f i e d . C h r o n i c m o u n t a i n s i c k n e s s i s a c o n d i t i o n t h a t p r i m a r i l y o c c u r s l a t e r i n l i f e i n s o m e l o n g t e r m h i g h a l t i t u d e r e s i d e n t s . It i s m o r e c o m m o n i n A n d e a n p o p u l a t i o n s t h a n i n H i m a l a y a n s , p o s s i b l y d u e t o t h e l o w e r v e n t i l a t o r y r e s p o n s e t o h y p o x i a i n t h e f o r m e r p o p u l a t i o n . T h e d i s e a s e i s c h a r a c t e r i z e d b y e x t r e m e p o l y c y t h e m i a s e c o n d a r y t o c h r o n i c h y p o x e m i a a n d m a y i n v o l v e a l o s s o f h o m e o s t a t i c r e g u l a t i o n o f e r y t h r o p o i e s i s . T h e u n d e r l y i n g m e c h a n i s m i s u n k n o w n b u t a n o v e r - r e a c t i o n o f e r y t h r o p o i e t i c t i s s u e t o h y p o x e m i c s t i m u l u s h a s b e e n p r o p o s e d as a p o s s i b l e c u l p r i t ( M o n g e - C et al., 1992). 8 2 E p o l e v e l s i n P e r u v i a n n a t i v e s l i v i n g i n L i m a ( s e a l e v e l ) o r C e r r o d e P a s c o ( 4 3 0 0 m ) w e r e m e a s u r e d b y L e o n - V e l a r d e et al, ( 1 9 9 1 ) . T h e y r e p o r t e d s i g n i f i c a n t l y h i g h e r l e v e l s o f i m m u n o r e a c t i v e E p o i n t h e C e r r o d e P a s c o r e s i d e n t s . C u r i o u s l y , w h e n t h e y c o m p a r e d h i g h a l t i t u d e n a t i v e s w i t h a n d w i t h o u t e x c e s s i v e e r y t h r o c y t o s i s , t h e y f o u n d n o d i f f e r e n c e i n E p o l e v e l s , d e s p i t e t h e p o l y c y t h e m i c n a t i v e s h a v i n g a 2 0 % g r e a t e r b l o o d h e m o g l o b i n c o n c e n t r a t i o n . A s i m i l a r p h e n o m e n o n w a s r e p o r t e d b y D a i n i a k et al, ( 1 9 8 8 ) i n p a t i e n t s n a t i v e t o L a P a z , B o l i v i a ( 3 6 0 0 m ) w h o h a d b e e n d i a g n o s e d w i t h c h r o n i c m o u n t a i n s i c k n e s s . O f th e e i g h t p a t i e n t s tested, o n l y t w o h a d s i g n i f i c a n t l y e l e v a t e d l e v e l s o f E p o (-250 m U / m l ) . T h e r e m a i n i n g s i x , d e s p i t e h a v i n g h e m a t o c r i t s r a n g i n g f r o m 6 4 - 7 9 % , h a d E p o l e v e l s s i m i l a r t o c o n t r o l s (-25 m U / m l ) w h o h a d b e e n r e c r u i t e d at t h e s a m e a l t i t u d e . O n e p o s s i b l e e x p l a n a t i o n f o r t h i s i s t h a t t h e r e a r e v a r i a n t s i n E p o that a l t e r its h e m a t o p o i e t i c a c t i v i t y . It w o u l d b e i n t e r e s t i n g t o s e q u e n c e the E p o g e n e s o f p a t i e n t s w i t h M o n g e ' s d i s e a s e , e s p e c i a l l y c o m p a r i n g t h o s e w i t h a n d w i t h o u t e l e v a t e d E p o . It i s i n t r i g u i n g t o s p e c u l a t e that t h e r e m i g h t b e a g e n e t i c c o n t r i b u t i o n t o t h e e t i o l o g y o f M o n g e ' s d i s e a s e ; h o w e v e r , I a m n o t a w a r e o f a n y e v i d e n c e f o r a f a m i l i a l p a t t e r n o f t r a n s m i s s i o n h a v i n g b e e n r e p o r t e d f o r t h i s c o n d i t i o n . 2 ) H I P - l a H I F - 1 c o n s i s t s o f t w o s u b u n i t s , H I F - l a a n d H I F - 1 6 . T h e 8 s u b u n i t i s p r e s e n t i n t h e c e l l u n d e r n o r m o x i c c o n d i t i o n s a n d a c t i v a t i o n o f t h e f a c t o r i s d e t e r m i n e d b y th e a v a i l a b i l i t y o f the a s u b u n i t , w h i c h a p p e a r s t o b e o x y g e n d e p e n d e n t . T h e s t e a d y state l e v e l s o f t r a n s c r i p t s f o r b o t h s u b u n i t s a r e u n a f f e c t e d b y o x y g e n t e n s i o n , t h e r e f o r e r e g u l a t i o n o f t h e a s u b u n i t i s p r e s u m e d t o b e at t h e p r o t e i n l e v e l . T h i s s u g g e s t s that m u t a t i o n s a f f e c t i n g H I F - l a a c t i v i t y w o u l d m o r e l i k e l y b e l o c a t e d i n t h e c o d i n g s e q u e n c e o f t h e g e n e t h a n i n t h e t r a n s c r i p t i o n a l r e g u l a t o r y r e g i o n s . N o p o t e n t i a l v a r i a n t s w e r e i d e n t i f i e d i n a n y o f t h e t h r e e Q u e c h u a H I F - l a c D N A s e q u e n c e s . A s d i s c u s s e d e a r l i e r , t h i s d o e s n o t p r e c l u d e t h e e x i s t e n c e o f s u c h a p o l y m o r p h i s m , b u t t h e p r o b a b l y o f m i s s i n g a c o m m o n (i.e. > 5 0 % ) v a r i a n t i n s u c h a s c r e e n i s l e s s t h a n 5 % . 83 Conclusions A s e q u e n c i n g s c r e e n o f s i x c h r o m o s o m e s f a i l e d t o l o c a t e a n y v a r i a n t s i n t h e c o d i n g r e g i o n s o f e i t h e r t h e E p o o r H I F - l a g e n e s i n t h e Q u e c h u a . O n e p r e v i o u s l y u n r e p o r t e d p o l y m o r p h i s m ( T / G + 7 6 9 ) w a s f o u n d i n t h e 3' r e g i o n o f t h e E p o g e n e . T h i s t r a n s v e r s i o n d i d n o t a l t e r a n y k n o w n r e g u l a t o r y s e q u e n c e s a n d t h e r e w a s n o s i g n i f i c a n t d i f f e r e n c e i n a l l e l e f r e q u e n c i e s b e t w e e n t h e Q u e c h u a a n d the C a u c a s i a n s . A s e c o n d d o w n s t r e a m p o l y m o r p h i s m ( C / T + 6 6 2 ) th a t w a s p r o x i m a l to, b u t n o t i n , t h e H I F - 1 b i n d i n g s i t e w a s a l s o a s s a y e d i n t h e Q u e c h u a a n d t h e C a u c a s i a n s . A l l e l e f r e q u e n c i e s at t h i s l o c i d i d d i f f e r s i g n i f i c a n t l y b e t w e e n t h e t w o p o p u l a t i o n s . W h e t h e r t h i s i s d u e t o n o n - d i r e c t i o n a l p o p u l a t i o n d i v e r g e n c e o r d u e t o s e l e c t i o n f a v o u r i n g a n a l l e l e at a l i n k e d l o c u s c a n n o t b e d e t e r m i n e d f r o m t h e s e data. 8 4 Chapter 7 Discussion, conclusions and future considerations I n o r d e r t o i d e n t i f y p o t e n t i a l g e n e t i c c o n t r i b u t i o n s t o h i g h a l t i t u d e a d a p t a t i o n i n h u m a n s , the f r e q u e n c i e s o f a l l e l i c v a r i a n t s o f a n u m b e r o f c a n d i d a t e g e n e s , c h o s e n b e c a u s e o f t h e i r p o t e n t i a l t o i n f l u e n c e o x y g e n d e l i v e r y , w e r e d e t e r m i n e d i n Q u e c h u a - s p e a k i n g A m e r i n d i a n s w h o w e r e l i v i n g at o v e r 3 2 0 0 m o n t h e A n d e a n altiplano i n P e r u . B a s e d o n t h e p h e n o t y p e s a s s o c i a t e d w i t h t h e s e a l l e l e s a n d the t h e o r e t i c a l r e q u i r e m e n t s o f h i g h a l t i t u d e p o p u l a t i o n s , h y p o t h e s e s w e r e m a d e a b o u t t h e r e l a t i v e f r e q u e n c i e s o f t h e s e v a r i a n t s i n t h e Q u e c h u a c o m p a r e d w i t h t w o l o w a l t i t u d e p o p u l a t i o n s : N a - D e n e s p e a k i n g A m e r i n d i a n s f r o m c o a s t a l B.C. a n d C a u c a s i a n s o f W e s t e r n E u r o p e a n d e s c e n t . T h e f o u r p r e c e d i n g c h a p t e r s d e s c r i b e t h e r e s u l t s o f t h e s e a n a l y s e s , a n d a l t h o u g h t h e g e n e r a l m e t h o d o l o g y a n d t h e s a m p l e s a n a l y z e d a r e i n c o m m o n , e a c h c h a p t e r r e p r e s e n t s a n i n d e p e n d e n t s t u d y a n d t h e r e f o r e i n c o r p o r a t e s its o w n d i s c u s s i o n . T h e f o l l o w i n g s e c t i o n p r e s e n t s a b r i e f s u m m e r y o f t h e r e s u l t s f o l l o w e d b y a g e n e r a l d i s c u s s i o n o f t h e i s s u e s t h a t s h o u l d b e c o n s i d e r e d i n t h e i r i n t e r p r e t a t i o n . T h e g e n e s e x a m i n e d i n c l u d e d t h e B - f i b r i n o g e n gene, t h e B 2 - a d r e n e r g i c r e c e p t o r g e n e a n d t w o g e n e s i n v o l v e d i n a n g i o t e n s i n - m e d i a t e d v a s o m o d u l a t i o n . V a r i a n t s i n t h e B - f i b r i n o g e n g e n e that h a v e b e e n p r e v i o u s l y a s s o c i a t e d w i t h l o w e r l e v e l s o f f i b r i n o g e n w e r e s i g n i f i c a n t l y o v e r -r e p r e s e n t e d i n t h e Q u e c h u a c o m p a r e d t o b o t h l o w l a n d s a m p l e s . T h e s e d a t a s u p p o r t t h e h y p o t h e s i s that, b e c a u s e o f t h e i r p o t e n t i a l t o r e d u c e p l a s m a v i s c o s i t y , t h e s e a l l e l e s m a y h a v e b e e n s e l e c t e d f o r i n the Q u e c h u a . P r e l i m i n a r y d a t a d i d n o t d e m o n s t r a t e l o w e r p l a s m a v i s c o s i t y i n t h e Q u e c h u a t h a n i n C a u c a s i a n s m e a s u r e d u n d e r t h e s a m e c o n d i t i o n s ; h o w e v e r , t h e C a u c a s i a n s a m p l e s i z e w a s q u i t e s m a l l . P l a s m a v i s c o s i t y i s q u i t e v a r i a b l e a n d i s i n f l u e n c e d b y a l a r g e n u m b e r o f e n v i r o n m e n t a l a n d b e h a v i o r a l c o n d i t i o n s . A l a r g e - s c a l e a n a l y s i s o f p l a s m a v i s c o s i t y a n d f i b r i n o g e n c o n c e n t r a t i o n i n t h e Q u e c h u a , as w e l l as i n o t h e r h i g h a l t i t u d e p o p u l a t i o n s , w o u l d b e a n i n t e r e s t i n g f o l l o w - u p t o t h e g e n e t i c d a t a p r e s e n t e d i n t h i s t h e s i s . T h e i n s e r t i o n a l l e l e i n t h e A C E gene, w h i c h h a d b e e n p r e v i o u s l y a s s o c i a t e d w i t h h i g h -a l t i t u d e e n d u r a n c e ( M o n t g o m e r y et ai, 1997), w a s n o t o v e r - r e p r e s e n t e d i n t h e Q u e c h u a 85 c o m p a r e d t o l o w l a n d e r s . A s w a s d i s c u s s e d i n c h a p t e r 4, w h i l e the g e n o t y p i c d a t a s u g g e s t that c h a n g e s i n t h e A C E g e n e are n o t a s s o c i a t e d w i t h h i g h a l t i t u d e a d a p t a t i o n i n t h e Q u e c h u a , a r o l e f o r t h e e n z y m e i n h i g h a l t i t u d e a d a p t a t i o n c a n n o t b e e x c l u d e d b y t h e s e data. G i v e n t h e e f f i c a c y o f A C E b l o c k e r s i n t h e t r e a t m e n t o f h i g h a l t i t u d e p u l m o n a r y h y p e r t e n s i o n ( N i a z o v a et al, 1996), i t w o u l d b e i n t e r e s t i n g to d e t e r m i n e the A C E I/D g e n o t y p e i n i n d i v i d u a l s w h o h a v e s u f f e r e d f r o m H A P E . A n a s s o c i a t i o n b e t w e e n t h e A C E - d e l e t i o n a l l e l e a n d s u s c e p t i b i l i t y t o H A P E c o u l d a c c o u n t f o r t h e u n d e r - r e p r e s e n t a t i o n o f t h i s v a r i a n t i n e l i t e c l i m b e r s r e p o r t e d b y M o n t g o m e r y a n d c o - w o r k e r s . F u r t h e r m o r e , i d e n t i f i c a t i o n o f a p o t e n t i a l g e n e t i c p r e d i s p o s i t i o n t o H A P E c o u l d b e o f c l i n i c a l i m p o r t a n c e i n t h e p r e v e n t i o n o f t h i s p o t e n t i a l l y f a t a l c o n d i t i o n . S i g n i f i c a n t d i f f e r e n c e s i n a l l e l e f r e q u e n c i e s w e r e o b s e r v e d f o r s e v e r a l p o l y m o r p h i c sites i n t h e B 2 - A R gene. T h e m o s t s u b s t a n t i a l c h a n g e s w e r e i n s i l e n t m u t a t i o n s . T h e s e c o u l d b e a c t i n g as l i n k e d m a r k e r s f o r as y e t u n c h a r a c t e r i z e d f u n c t i o n a l m u t a t i o n s , a l t h o u g h s e q u e n c e d a t a p r e s e n t e d i n t h i s t h e s i s s u g g e s t s t h a t t h e r e a r e n o c o m m o n m u t a t i o n s i n t h e c o d i n g s e q u e n c e i n t h e Q u e c h u a (as r e p r e s e n t e d b y o u r s a m p l e ) . F u t u r e s t u d i e s c o u l d u n d e r t a k e a l a r g e - s c a l e p o l y m o r p h i s m s c r e e n i n , a n d a r o u n d , t h i s gene, as t h e r e m a y b e f u n c t i o n a l c h a n g e s i n the r e g u l a t o r y r e g i o n s f l a n k i n g t h e c o d i n g s e q u e n c e , o r u n d e t e c t e d v a r i a n t s i n t h e b o d y o f the gene. A s o f t h i s w r i t i n g , n o p o l y m o r p h i s m s i n t h e c o d i n g r e g i o n o f t h e g e n e e n c o d i n g H I F - l a h a v e b e e n r e p o r t e d i n t h e l i t e r a t u r e . H I F - l a c D N A f r o m t h r e e Q u e c h u a w a s s e q u e n c e d a n d n o v a r i a n t s w e r e d e t e c t e d . A g a i n , w h i l e t h i s d o e s n o t p r e c l u d e the e x i s t e n c e o f s u c h v a r i a n t s , i t d o e s s u g g e s t that t h e y a r e n o t c o m m o n i n t h e Q u e c h u a c o m m u n i t i e s t h a t w e r e s a m p l e d i n t h i s study. L a s t l y , t h e E p o g e n e w a s e x a m i n e d . O n c e a g a i n , n o f u n c t i o n a l p o l y m o r p h i s m s h a d b e e n r e p o r t e d i n t h e l i t e r a t u r e . S e q u e n c i n g the g e n e i n t h r e e Q u e c h u a d e t e c t e d a p r e v i o u s l y u n r e p o r t e d p o l y m o r p h i s m i n t h e 3' u n t r a n s l a t e d r e g i o n o f t h e g e n e , n e a r t h e r e g u l a t o r y r e g i o n s t h a t c o n t r o l h y p o x i a - m e d i a t e d e x p r e s s i o n . T h e a l l e l e f r e q u e n c i e s o f t h i s p o l y m o r p h i s m d i d n o t d i f f e r b e t w e e n Q u e c h u a a n d C a u c a s i a n s , a l t h o u g h a l l e l e f r e q u e n c i e s f o r a p r e v i o u s l y r e p o r t e d p o l y m o r p h i s m i n t h e 3' u n t r a n s l a t e d r e g i o n d i d d i f f e r b e t w e e n t h e t w o p o p u l a t i o n s . N e i t h e r o f t h e s e p o l y m o r p h i s m s a l t e r s t h e c o d i n g s e q u e n c e o r a n y k n o w n r e g u l a t o r y s i t e s a n d t h e r e f o r e i s u n l i k e l y t o g e n e r a t e a p h e n o t y p e . H o w e v e r , as d i s c u s s e d b e l o w , t h e y c o u l d b e l i n k e d t o o t h e r 8 6 v a r i a n t s that d o a l t e r a c t i v i t y . B e c a u s e o f the r o l e o f E p o i n h a e m a t o p o i e s i s , i t w o u l d b e i n t e r e s t i n g t o e x t e n d t h e s e a r c h f o r m u t a t i o n s i n the E p o g e n e t o p a t i e n t s d i a g n o s e d w i t h c h r o n i c m o u n t a i n d i s e a s e , p a r t i c u l a r l y i n c a s e s w h e r e E p o c o n c e n t r a t i o n s are n o r m a l d e s p i t e p a t h o l o g i c a l l y h i g h h e m a t o c r i t s . O n e a d v a n t a g e t o e x a m i n i n g t h e g e n e t i c c h a r a c t e r i s t i c s o f a p o p u l a t i o n (as o p p o s e d t o p h y s i o l o g i c a l c h a r a c t e r i s t i c s ) i s that, w i t h i n a g e n e r a t i o n , g e n o t y p e i s i n d e p e n d e n t o f e n v i r o n m e n t . M e a s u r i n g t h e a c t u a l c o n c e n t r a t i o n o r a c t i v i t y o f t h e p r o d u c t s o f the g e n e s that w e r e e x a m i n e d i n t h i s p r o j e c t w o u l d b e s u b s t a n t i a l l y m o r e d i f f i c u l t as m o s t o f t h e m v a r y w i t h the p h y s i c a l c o n d i t i o n , age, g e n d e r , h e a l t h a n d l i f e s t y l e o f the s u b j e c t s . T h e d i s a d v a n t a g e o f w o r k i n g e x c l u s i v e l y at t h e D N A l e v e l i s that s e l e c t i o n acts o n p h e n o t y p e , n o t g e n o t y p e , a n d t h e r e l a t i o n s h i p b e t w e e n g e n o t y p e a n d p h e n o t y p e m a y v a r y f o r a n u m b e r o f r e a s o n s i n c l u d i n g e n v i r o n m e n t , g e n e t i c b a c k g r o u n d a n d h a p l o t y p e s t r u c t u r e ( l i n k a g e d i s e q u i l i b r i u m ) . A n e x a m p l e o f t h e c o m p l e x i n t e r a c t i o n s b e t w e e n g e n o t y p e a n d e n v i r o n m e n t i s the r e l a t i o n s h i p b e t w e e n t h e f r e q u e n c y o f the h e m o g l o b i n a l l e l e that c a u s e s s i c k l e c e l l a n e m i a a n d the p r e v a l e n c e o f m a l a r i a . T h e a b n o r m a l r e d b l o o d c e l l s a r i s i n g f r o m the h e m o g l o b i n v a r i a n t are l e s s e f f i c i e n t o x y g e n c a r r i e r s , a n d t h e r e f o r e d e l e t e r i o u s , b u t t h e y a l s o c o n f e r r e s i s t a n c e t o m a l a r i a , a b e n e f i c i a l t r a i t i n r e g i o n s w h e r e th e d i s e a s e is c o m m o n . P r e d i c t i o n s a b o u t t h e p r e v a l e n c e o f the a l l e l e that c a u s e s s i c k l i n g w o u l d h a v e t o t a k e i n t o c o n s i d e r a t i o n w h e r e th e s u b j e c t p o p u l a t i o n l i v e d . A n o t h e r e x a m p l e i s t h e c o m m o n C / T 6 7 7 p o l y m o r p h i s m i n m e t h y l e n e t e t r a h y d r o f o l a t e r e d u c t a s e ( M T H F R ) . T h i s a l l e l e i s a s s o c i a t e d w i t h v a s c u l a r d e f i c i e n c i e s , n e u r a l t u b e d e f e c t s a n d c a n c e r . H o w e v e r , as t h e s e p h e n o t y p e s o n l y m a n i f e s t i n i n d i v i d u a l s w h o s e d i e t s are l a c k i n g i n f o l i c a c i d ( s e e r e v i e w b y B a i l e y a n d G r e g o r y 3 r d, 1999), t h e s e l e c t i v e p r e s s u r e t o r e m o v e t h i s o b v i o u s l y d e l e t e r i o u s a l l e l e w o u l d b e c o n s i d e r a b l y b l u n t e d i n p o p u l a t i o n s w i t h a d i e t that i n c l u d e d s u f f i c i e n t a m o u n t s o f t h i s v i t a m i n . T h i s p r o j e c t f o c u s e d o n l y o n a s i n g l e e n v i r o n m e n t a l c o n d i t i o n : h y p o b a r i c h y p o x i a . W h i l e t h i s i s a p e r v a s i v e a n d i m m u t a b l e stress, i t i s u n l i k e l y t o b e th e o n l y e n v i r o n m e n t a l v a r i a b l e d i f f e r e n t i a t i n g t h e t h r e e s t u d y p o p u l a t i o n s , a n d v a r i a b l e s o t h e r t h a n a l t i t u d e o f r e s i d e n c e w e r e n o t c o n t r o l l e d f o r i n t h e s e e x p e r i m e n t s ( a l t h o u g h b o t h n a t i v e A m e r i c a n p o p u l a t i o n s w e r e s a m p l e d 87 f r o m n o n - u r b a n are a s ) . It i s p o s s i b l e that a d d i t i o n a l e n v i r o n m e n t a l v a r i a b l e s c o u l d b l u n t , o r e x a c e r b a t e , t h e s e l e c t i v e p r e s s u r e s that w e r e p r e d i c t e d to r e s u l t f r o m h y p o x i a . A C E a n d B-f i b r i n o g e n g e n o t y p e s h a v e b e e n a s s o c i a t e d w i t h c a r d i o v a s c u l a r d i s e a s e , a n d a n y c o n s i d e r a t i o n o f s e l e c t i o n a c t i n g u p o n a l l e l e s i n t h e s e g e n e s s h o u l d t a k e i n t o a c c o u n t t h e m y r i a d o t h e r e n v i r o n m e n t a l f a c t o r s , s u c h as d i e t a n d l i f e s t y l e , that i n f l u e n c e c a r d i o v a s c u l a r h e a l t h a n d t h e r e f o r e c o u l d a f f e c t s e l e c t i v e p r e s s u r e s . A s i m i l a r a r g u m e n t c o u l d b e m a d e f o r t h e a l l e l e s o f the B 2 A R g e n e that i n f l u e n c e ( v a r i a b l y ) f a t d e p o s i t i o n . P h e n o t y p e m a y a l s o v a r y b e t w e e n p o p u l a t i o n s d u e to d i f f e r e n c e s i n g e n e t i c b a c k g r o u n d . I n the c a s e o f t h e A C E I/D p o l y m o r p h i s m , c o r r e l a t i o n s w e r e r e p o r t e d b e t w e e n th e d e l e t i o n a l l e l e a n d c a r d i o v a s c u l a r d i s e a s e i n E u r o p e a n , A m e r i c a n a n d J a p a n e s e s t u d i e s ( r e v i e w e d i n B u t l e r et al, 1 9 9 7 ) b u t n o t P i m a I n d i a n s ( N a g i et al, 1998), C h i n e s e ( C h u a n g et al, 1997; S a h a et al, 1996) o r S o u t h e a s t A s i a n s ( S a h a et al, 1996). A g a i n , t h i s c o u l d b e d u e to e n v i r o n m e n t a l d i f f e r e n c e s b u t c o u l d a l s o r e f l e c t i n t r i n s i c d i f f e r e n c e s i n t h e p o p u l a t i o n s . T h e i n t e r a c t i o n b e t w e e n A C E a n d the A C E r e c e p t o r d e m o n s t r a t e s that A C E p h e n o t y p e m a y n o t b e p r e d i c t a b l e w i t h o u t k n o w i n g r e c e p t o r g e n o t y p e ( T i r e t et al, 1994). A p o p u l a t i o n m o n o m o r p h i c f o r t h e l a t t e r m a y b e i n v a r i a n t at t h e f o r m e r r e g a r d l e s s o f g e n o t y p e . It w a s o n l y a s s u m e d that t h e r e w a s a n a s s o c i a t i o n b e t w e e n A C E I/D g e n o t y p e a n d A C E l e v e l s t h i s p o p u l a t i o n . I f t h e r e w a s not, t h e n t h e r e w o u l d n o t b e s e l e c t i v e p r e s s u r e f a v o u r i n g the A C E a l l e l e e v e n i f r e d u c e d A C E l e v e l s w e r e a d v a n t a g e o u s . G i v e n t h e c o m p l e x i t y o f h u m a n p h y s i o l o g y , c h a n g e s i n the f u n c t i o n o f a s i n g l e g e n e m a y i m p a c t u p o n m o r e t h a n o n e c h a r a c t e r i s t i c . P r e d i c t i o n s o f p o s i t i v e s e l e c t i v e v a l u e , as w e r e m a d e i n t h i s p r o j e c t , c a n b e e a s i l y c o n f o u n d e d i f t h e a l l e l e h a s a n o v e r - r i d i n g d e l e t e r i o u s e f f e c t e l s e w h e r e . A g a i n , the A C E i n s e r t i o n / d e l e t i o n p o l y m o r p h i s m s e r v e s as a n e x a m p l e . W h i l e the i n s e r t i o n a l l e l e a p p e a r s t o c o n f e r s o m e c a r d i o v a s c u l a r a d v a n t a g e , i t is a l s o a s s o c i a t e d w i t h the d e v e l o p m e n t o f n e u r o l o g i c a l p a t h o l o g y ( K e h o e etal, 1999), a n d s e l e c t i o n w i l l f a v o u r t h e a l l e l e that i s o f m o s t o v e r a l l b e n e f i t t o t h e p o p u l a t i o n . T h i s c a n b e d i f f i c u l t t o p r e d i c t . L a t e o n s e t d i s e a s e s s u c h as A l z h e i m e r ' s t e n d t o b e p o s t - r e p r o d u c t i v e , a n d a p r e d i s p o s i t i o n t o t h e s e c o n d i t i o n s w i l l n o t b e s e l e c t e d a g a i n s t u n l e s s t h e r e i s s o m e s o c i a l r o l e f o r a g e d i n d i v i d u a l s that e n h a n c e s t h e r e p r o d u c t i v e f i t n e s s o f t h e p o p u l a t i o n . T h i s r a i s e s a n i m p o r t a n t p o i n t : t o b e s e l e c t e d f o r a n a l l e l e 8 8 m u s t c o n f e r a r e p r o d u c t i v e a d v a n t a g e . I f t h e e l i t e c l i m b e r s i n w h o m M o n t g o m e r y a n d c o -w o r k e r s ( 1 9 9 7 ) r e p o r t e d a h i g h f r e q u e n c y o f the A C E i n s e r t i o n a l l e l e s p e n d a l l t h e i r t i m e c l i m b i n g m o u n t a i n s a n d n e v e r settle d o w n t o h a v e f a m i l i e s , the a l l e l e , r e g a r d l e s s o f h o w b e n e f i c i a l i t m i g h t be, c o u l d l i k e l y b e c o m e l e s s c o m m o n i n the p o p u l a t i o n . F o r s e v e r a l o f t h e p o l y m o r p h i s m s e x a m i n e d i n t h i s p r o j e c t t h e p h e n o t y p e s a r e b a s e d o n a s s o c i a t i o n r a t h e r t h a n d e m o n s t r a t e d f u n c t i o n a l c h a n g e s , a n d i t m u s t b e c o n s i d e r e d that the a l l e l e s m a y n o t b e d i r e c t l y r e s p o n s i b l e f o r the p h e n o t y p e . I n f a c t , t w o o f t h e f i v e B 2 - A R a l l e l e s e x a m i n e d d i d n o t a l t e r t h e p r o t e i n c o d i n g s e q u e n c e , b o t h p o l y m o r p h i s m s i n E p o w e r e d o w n s t r e a m o f t h e c o d i n g r e g i o n a n d n o t i n d e f i n e d r e g u l a t o r y r e g i o n s , a n d t h e p o l y m o r p h i s m i n A C E w a s w i t h i n a n i n t r o n . A s t h e s e c h a n g e s w o u l d n o t b e a n t i c i p a t e d t o h a v e a p h e n o t y p i c e f f e c t , t h e a s s o c i a t i o n w i t h a p h e n o t y p e m a y w e l l b e d u e t o l i n k a g e d i s e q u i l i b r i u m w i t h as y e t u n r e p o r t e d a l l e l e s t h a t d o c a u s e the p h e n o t y p i c e f f e c t s . L i n k a g e d i s e q u i l i b r i u m i s s e e n w h e n a l l e l e s at a d j a c e n t p o l y m o r p h i c l o c i d o n o t a s s o r t i n d e p e n d e n t l y d u r i n g m e i o s i s a n d a r e t r a n s m i t t e d b e t w e e n g e n e r a t i o n s as h a p l o t y p e s (sets o f c o - s e g r e g a t i n g a l l e l e s at l i n k e d l o c i ) r a t h e r t h a n as i n d i v i d u a l a l l e l e s . F o r e x a m p l e , t h e d a t a p r e s e n t e d i n c h a p t e r 4 s h o w that t h e a l l e l e s at the t h r e e B - f i b r i n o g e n l o c i a p p e a r t o b e i n h e r i t e d as t h e s a m e t w o h a p l o t y p e s i n a l l t h r e e p o p u l a t i o n s e x a m i n e d . T h e t h r e e s i t e s a r e q u i t e c l o s e t o g e t h e r ( w i t h i n 1 0 0 0 b a s e s ) a n d p r e s u m a b l y , i n s u f f i c i e n t t i m e h a s p a s s e d s i n c e t h e s e m u t a t i o n s a r o s e f o r r e c o m b i n a t i o n t o " s h u f f l e " t h e a l l e l e s s u c h t h a t t h e y a r e t r a n s m i t t e d i n d e p e n d e n t l y o f o n e a n o t h e r . T h e e x t e n t o f l i n k a g e d i s e q u i l i b r i u m b e t w e e n l o c i c a n v a r y b e t w e e n p o p u l a t i o n s . T h i s w a s e v i d e n t i n t h e p u t a t i v e 6 2 - A R h a p l o t y p e s that v a r i e d b e t w e e n the t w o A m e r i n d i a n p o p u l a t i o n s a n d t h e C a u c a s i a n s . O n c e a m u t a t i o n o c c u r s , its s e p a r a t i o n f r o m s y n t e n i c (i.e. o n the s a m e c h r o m o s o m e ) a l l e l e s r e q u i r e s a r e c o m b i n a n t e v e n t b e t w e e n t h e t w o l o c i , a n d t h e p r o b a b i l i t y o f t h i s o c c u r r i n g d e p e n d s o n t h e d i s t a n c e s e p a r a t i n g t h e m . P o p u l a t i o n s c a n d i f f e r d u e t o r e c o m b i n a t i o n e v e n t s that o c c u r r e d e x c l u s i v e l y i n t h e i r a n c e s t o r s , b e c a u s e o f u n e q u a l d i s t r i b u t i o n s o f h a p l o t y p e s d u r i n g s u b s e q u e n t p o p u l a t i o n d i v i s i o n s , o r d u e t o g e n e t i c d r i f t o n c e p o p u l a t i o n s w e r e s e p a r a t e d . S u p e r i m p o s e d o n t h e s e r a n d o m s o u r c e s o f v a r i a t i o n i s t h e p o s s i b i l i t y that a n y o f t h e a s s o c i a t e d a l l e l e s c o n f e r s a s e l e c t i v e a d v a n t a g e , i n w h i c h c a s e the 8 9 f r e q u e n c y o f a l l o f t h e l i n k e d a l l e l e s w i l l i n c r e a s e . P o t e n t i a l d i f f e r e n c e s i n p o p u l a t i o n s c a n c o m p l i c a t e a s s o c i a t i o n s t u d i e s b e c a u s e i f t h e a l l e l e that i s b e i n g a s s a y e d i s o n l y a m a r k e r f o r a f u n c t i o n a l a l l e l e , t h e n t h e a s s o c i a t i o n w i l l o n l y b e o b s e r v e d i n p o p u l a t i o n s i n w h i c h the t w o l o c i are i n d i s e q u i l i b r i u m . T h e a d v a n t a g e t o l i n k a g e d i s e q u i l i b r i u m i n g e n e t i c a n a l y s i s i s t h a t i t i n c r e a s e s the p r o b a b i l i t y o f d e t e c t i n g f u n c t i o n a l v a r i a n t s , b e c a u s e c h a n g e s i n t h e f r e q u e n c i e s o f t h e s e ( w h i c h t e n d t o f a r l e s s c o m m o n t h a n i n e r t m u t a t i o n s ) w i l l b e m i r r o r e d i n a n y a l l e l e t o w h i c h t h e y are t i g h t l y l i n k e d . F o r e x a m p l e , t w o s i l e n t m u t a t i o n s w e r e a s s a y e d i n the B 2 - A R gene, n e i t h e r o f w h i c h w o u l d b e e x p e c t e d to h a v e a n y e f f e c t o n r e c e p t o r f u n c t i o n . O f t h e f i v e a l l e l e s e x a m i n e d , t h e s e t w o ( a c t u a l l y o n e h a p l o t y p e ) v a r i e d the m o s t b e t w e e n t h e Q u e c h u a a n d the t w o l o w l a n d p o p u l a t i o n s . T h i s c o u l d b e d u e t o t h e m b e i n g i n d i s e q u i l i b r i u m w i t h a l l e l e s at l o c u s that h a s b e e n s e l e c t e d f o r i n t h e Q u e c h u a . S e q u e n c i n g t h e c o d i n g r e g i o n o f t h r e e Q u e c h u a f a i l e d t o f i n d t h i s p o t e n t i a l l y i n t e r e s t i n g site, b u t t h a t d o e s n o t r u l e o u t s e l e c t a b l e v a r i a t i o n s i n r e g u l a t o r y r e g i o n s o f t h e g e n e ( o r e v e n i n p r o x i m a l g e n e s ) . G e n e t i c v a r i a t i o n b e t w e e n p o p u l a t i o n s i s n o t s o l e l y t h e r e s u l t o f s e l e c t i o n . W h i l e d i f f e r i n g a l l e l e f r e q u e n c i e s m a y b e c o n s i s t e n t w i t h s e l e c t i o n f a v o u r i n g o n e a l l e l e o v e r the a l t e r n a t i v e , t h e y m a y a l s o h a v e a r i s e n f r o m the n o n - d i r e c t i o n a l g e n e t i c d i v e r g e n c e that i n e v i t a b l y o c c u r s w h e n p o p u l a t i o n s are r e p r o d u c t i v e l y s e p a r a t e d f o r l o n g p e r i o d s o f t i m e . S o m e o f t h i s v a r i a t i o n w i l l o c c u r d u e t o r a n d o m c h a n g e s i n f r e q u e n c y c o m m o n l y r e f e r r e d t o as g e n e t i c d r i f t . T h i s u s u a l l y o c c u r s w h e n a b r e e d i n g p o p u l a t i o n i s s u f f i c i e n t l y s m a l l that s i g n i f i c a n t c h a n g e s i n a l l e l e f r e q u e n c y m a y o c c u r b y c h a n c e a l o n e . A s i m p l e e x a m p l e i n v o l v e s a p o p u l a t i o n o f t w o i n d i v i d u a l s , b o t h o f w h o m are h e t e r o z y g o u s at a l o c u s f o r w h i c h t h e r e a r e t w o a l l e l e s (i.e. A a x A a ) . I f t h e y h a v e t w o o f f s p r i n g , t h e r e i s a o n e i n e i g h t ( 1 2 . 5 % ) c h a n c e t h a t t h e s e o f f s p r i n g w i l l h o m o z y g o u s f o r t h e s a m e a l l e l e (i.e. A A , A A o r aa, aa) a n d t h e r e f o r e o n e a l l e l e w i l l h a v e b e e n e l i m i n a t e d f r o m t h e p o p u l a t i o n . O b v i o u s l y , t h i s i s a n e x t r e m e case, b u t i t s e r v e s t o i l l u s t r a t e that s i g n i f i c a n t c h a n g e c a n o c c u r b y c h a n c e a l o n e , e s p e c i a l l y i f t h e p o p u l a t i o n i s s m a l l ( i f t h e r e w e r e f i v e c o u p l e s , t h e c h a n c e s o f l o s i n g a n a l l e l e i n o n e g e n e r a t i o n w o u l d b e l e s s t h a n 0 . 0 0 5 % ) . E v e n i n l a r g e p o p u l a t i o n s , g e n e t i c d r i f t c a n s i g n i f i c a n t l y e f f e c t the d i s t r i b u t i o n o f a l l e l e s . T h i s i s 9 0 e s p e c i a l l y t r u e i f t h e a l l e l e s are u n c o m m o n to b e g i n b e c a u s e , o n c e l o s t w i t h i n a p o p u l a t i o n , a n a l l e l e i s u n l i k e l y t o b e r e p l a c e d . T h e a b s e n c e o f t h e T a l l e l e o f t h e E p o C / T 6 5 9 p o l y m o r p h i s m i n t h e Q u e c h u a c o u l d w e l l b e d u e t o d r i f t as t h e a l l e l e m a y n o t h a v e b e e n that c o m m o n t o b e g i n w i t h ( i t w a s f o u n d t o b e at 9 % i n t h e C a u c a s i a n s a m p l e ) . T h e s a m e i s t r u e f o r t h e G 7 9 a l l e l e i n t h e 8 2 A R g e n e , w h i c h i s p r e s e n t at 9 % i n t h e N a - D e n e b u t a b s e n t i n t h e Q u e c h u a . C a u s e s o f m o n o m o r p h i s m are d i f f i c u l t t o a s s e s s b e c a u s e t h e r e i s n o w a y o f e s t i m a t i n g t h e t i m e s c a l e o v e r w h i c h t h e l o s s o c c u r r e d . F o u n d e r e f f e c t , w h e r e a p o p u l a t i o n i s d e s c e n d e d f r o m a s m a l l p r o g e n i t o r g r o u p i s a s p e c i a l c a s e o f g e n e t i c d r i f t . A n a l y s i s o f m i t o c h o n d r i a l g e n o t y p e s i n S o u t h A m e r i c a n p o p u l a t i o n s ( M o n s a l v e et al, 1994) s u g g e s t s that t h e t h e r e w a s n o t a s i g n i f i c a n t f o u n d e r e f f e c t i n t h e c o l o n i z i n g o f S o u t h A m e r i c a , a n d t h e Q u e c h u a s a m p l e d f o r t h i s p r o j e c t w e r e h e t e r o g e n e o u s at m o s t o f t h e l o c i e x a m i n e d , c o n s i s t e n t w i t h s u b s t a n t i a l v a r i a t i o n t h e i r a n c e s t r a l p o p u l a t i o n . T h e r e w i l l a l w a y s b e s o m e v a r i a t i o n b e t w e e n p o p u l a t i o n s d u e t o c h a n c e . I f l a r g e n u m b e r s o f r a n d o m l y s e l e c t e d p o l y m o r p h i s m s ar e e x a m i n e d , t h e p r o b a b i l i t y o f d e t e c t i n g s i g n i f i c a n t d i f f e r e n c e s i n a l l e l e f r e q u e n c i e s b y c h a n c e a l o n e c a n b e c o m e q u i t e h i g h (the n u m b e r o f tests c a n b e c o r r e c t e d f o r b u t m a y r e q u i r e p r o h i b i t i v e l y l a r g e s a m p l e s i z e s ) . F o c u s i n g o n c a n d i d a t e g e n e s i s o n e w a y o f a d d r e s s i n g t h i s i s s u e . T h e c h a n c e o f s p u r i o u s a s s o c i a t i o n s c a n b e r e d u c e d , w h i l e t h e c h a n c e o f d e t e c t i n g a v a l i d a s s o c i a t i o n i s i n c r e a s e d (to t h e e x t e n t t h a t t h e " c a n d i d a c y " i s l e g i t i m a t e ) . A n o t h e r w a y t o a d d r e s s the p o s s i b i l i t y o f o b s e r v e d d i f f e r e n c e s b e i n g d u e t o c h a n c e is t o e x a m i n e o t h e r p o p u l a t i o n s that f a c e s i m i l a r s e l e c t i v e p r e s s u r e s . R a n d o m v a r i a t i o n w o u l d b e e x p e c t e d t o d i f f e r b e t w e e n t h e p o p u l a t i o n s , w h e r e a s s i m i l a r t r e n d s s h o u l d b e s e e n i f t h e c h a n g e s are d i r e c t i o n a l and, as m o s t r e s e a r c h e r s c o n s i d e r c o n s i s t e n t r e p l i c a t i o n t o b e t h e b e s t e v i d e n c e f o r t r u e a s s o c i a t i o n ( X u et al, 1998), t h e m o s t o b v i o u s f o l l o w - u p to t h i s p r o j e c t w o u l d b e a s i m i l a r a n a l y s i s i n A s i a n h i g h a l t i t u d e p o p u l a t i o n s , s u c h as S h e r p a s o r T i b e t a n s . T h e a f o r e m e n t i o n e d caveats n o t w i t h s t a n d i n g , t h e a n a l y s i s o f a s s o c i a t i o n b e t w e e n g e n o t y p e a n d p h e n o t y p e i s a p o t e n t t o o l i n s e p a r a t i n g t h e e f f e c t s o f n a t u r e a n d n u r t u r e . H e r i t a b i l i t y s t u d i e s a n d f a m i l y a n a l y s i s a r e u s e f u l t e c h n i q u e s w i t h w h i c h t o e s t a b l i s h w h e t h e r t h e r e i s a g e n e t i c c o m p o n e n t c o n t r i b u t i n g t o the d e v e l o p m e n t o f c o m p l e x traits a n d a d a p t i v e 91 p h e n o t y p e s ; h o w e v e r , u l t i m a t e e l u c i d a t i o n m a y r e q u i r e t e a s i n g o u t g e n e t i c f a c t o r s o n a g e n e b y g e n e b a s i s ( R i s c h a n d M e r i k a n g a s , 1996). A s t h e r e a r e a n e s t i m a t e d 50,000-100,000 g e n e s i n t h e h u m a n g e n o m e , s o m e a priori r e a s o n t o s u s p e c t t h e g e n e p r o d u c t o f p l a y i n g a r o l e i n the p h e n o t y p e w o u l d b e n e e d e d t o p r e - s c r e e n g e n e s f o r a n a l y s i s . E v e n w i t h g e n e c a n d i d a c y , s u c h a n a n a l y s i s w o u l d b e a l o n g a n d e x p e n s i v e p r o c e s s , g i v e n the i m m e n s e c o m p l e x i t y o f m a n y p h y s i o l o g i c a l p r o c e s s e s (e.g. t h e c l o t t i n g r e a c t i o n , t h e o s t e n s i b l y s t r a i g h t f o r w a r d h a e m o s t a t i c r e s p o n s e , i n v o l v e s m o r e t h a n 5 0 0 g e n e p r o d u c t s ) . A f u r t h e r c o n f o u n d i n g f a c t o r i s that a g e n e t i c v a r i a n t m a y n e e d t o b e s u p e r i o r i n o n l y o n e t i s s u e , f o r o n e m o m e n t , p r i o r t o r e p r o d u c t i o n i n o r d e r to c o n f e r a s e l e c t i v e a d v a n t a g e . T h a t t h e b e n e f i t c o n f e r r e d b y a n a l l e l e m a y n o t b e a p p a r e n t i n the e x t a n t o r g a n i s m g r e a t l y c o m p l i c a t e s t h e t a s k o f p r e d i c t i n g w h a t w o u l d , o r w o u l d n o t be, u n d e r s e l e c t i v e p r e s s u r e . W h i l e t h i s s t u d y w a s n e v e r i n t e n d e d t o b e a n e x t e n s i v e a n a l y s i s o f g e n e f r e q u e n c i e s i n t h e Q u e c h u a o r t h e N a - D e n e , th e d a t a that i t g e n e r a t e d s h o u l d b e o f i n t e r e s t t o r e s e a r c h e r s w h o s t u d y h u m a n o r i g i n s , d i s t r i b u t i o n a n d d i v e r s i t y . T h e r e m a y b e a f i n i t e w i n d o w o f o p p o r t u n i t y t o c o l l e c t d a t a o f t h i s s o r t as a d v a n c e s i n c o m m u n i c a t i o n a n d t r a n s p o r t a t i o n , as w e l l as c h a n g i n g a t t i t u d e s t o w a r d c u l t u r a l b o u n d a r i e s , t e n d t o l e a d t o a h o m o g e n i z a t i o n o f t h e r a c e . A s e m i n e n t p o p u l a t i o n g e n e t i c i s t L u c a C a v a l l i - S f o r z a e x p r e s s e d it i n 1991, the f o u n d i n g y e a r o f T h e H u m a n G e n o m e D i v e r s i t y P r o j e c t , : " T h e g e n e t i c d i v e r s i t y o f p e o p l e n o w l i v i n g h a r b o u r s c l u e s t o the e v o l u t i o n o f o u r s p e c i e s , b u t t h e g a t e t o p r e s e r v e t h e s e c l u e s i s c l o s i n g r a p i d l y . " E v e n t u a l l y , t h e f u l l e x t e n t o f h u m a n d i v e r s i t y m a y b e k n o w n . T h e e m e r g i n g t e c h n o l o g y o f m i c r o a r r a y s , c o m b i n e d w i t h t h e s o o n t o b e c o m p l e t e d h u m a n g e n o m e p r o j e c t ( a n d t h e s i n g l e n u c l e o t i d e p o l y m o r p h i s m p r o j e c t ) o f f e r s t h e p r o m i s e o f d e t e r m i n i n g t h e e n t i r e m o l e c u l a r p h e n o t y p e o f a n i n d i v i d u a l i n a s i n g l e e x p e r i m e n t . T h i s p o w e r f u l m e t h o d o l o g y m a y e v e n t u a l l y a l l o w r e s e a r c h e r s t o c h a r a c t e r i s e t h e g e n e t i c c o m p o s i t i o n o f e n t i r e p o p u l a t i o n s , a n d p e r h a p s f i n a l l y r e s o l v e t h e i s s u e o f w h e t h e r , o v e r t h e c o u r s e o f the p a s t h u n d r e d c e n t u r i e s , t h e s t u r d y a n d v i g o r o u s p e o p l e w h o l i v e h i g h i n t h e t h i n a i r o f the A n d e s m o u n t a i n s h a v e e v o l v e d i n r e s p o n s e t o t h e d e m a n d s o f l i f e o n t h e altiplano. consumatum est Jim Rupert 21/4/00 9 2 Abbreviations T h e f o l l o w i n g i s a l i s t o f a b b r e v i a t i o n s that a p p e a r m o r e t h a n o n c e i n the text. E a c h a b b r e v i a t i o n i s a l s o d e f i n e d a f t e r its i n i t i a l u s a g e . S t a n d a r d c h e m i c a l a n d m e t r i c a b b r e v i a t i o n s n o t d e f i n e d . ACE angiotensin converting enzyme MCH mean corpuscular hemoglobin content AT-2 angiotensin 2 MCHC mean corpuscular hemoglobin cone. AT2-R1 angiotensin 2,receptor type 1 mtDNA mitochondrial DNA AT2-R2 angiotensin 2, receptor type 2 NAPS nucleic acid and protein services BMT body mass index Pa0 2 partial pressure of oxygen, arterial bp base pair P A 0 2 partial pressure of oxygen, alveolar B2-AR beta 2 adrenergic receptor PCR polymerase chain reaction dNTPs deoxynucleotides PI0 2 partial pressure of oxygen, inspired Epo erythropoietin P 0 2 partial pressure of oxygen Epo-R erythropoietin receptor RBC red blood cell EtBr ethidium bromide RFLP restriction fragment length polymorphism FVC forced vital capacity RT room temperature GRE glucocorticoid response element Sa0 2 arterial 0 2 saturation HAPE high altitude pulmonary edema U.B.C. University of British Columbia HIF hypoxia inducible factor vo 2 m a x 0 2 uptake, maximal rate HRE hormone response element ybp years before present HVR hypoxic ventilatory response WBC white blood cell MCV mean corpuscular volume 9 3 References A g e r h o l m - L a r s e n , B., N o r d e s t g a a r d , B . G., S t e f f e n s e n , R., S o r e n s e n , T. I., J e n s e n , G . a n d T y b j a e r g - H a n s e n , A . ( 1 9 9 7 ) . A C E g e n e p o l y m o r p h i s m : i s c h e m i c h e a r t d i s e a s e a n d l o n g e v i t y i n 10,150 i n d i v i d u a l s . A c a s e - r e f e r e n t a n d r e t r o s p e c t i v e c o h o r t s t u d y b a s e d o n t h e C o p e n h a g e n C i t y H e a r t S t u d y . C i r c u l a t i o n 95 ( 1 0 ) , 2 3 5 8 - 2 3 6 7 . A l d a s h e v , A . A., B o r b u g u l o v , U . M., D a v l e t o v , B . A . a n d M i r r a k h i m o v , M . M . ( 1 9 8 9 ) . H u m a n a d r e n o c e p t o r s y s t e m r e s p o n s e t o t h e d e v e l o p m e n t o f h i g h a l t i t u d e p u l m o n a r y a r t e r i a l h y p e r t e n s i o n . J. M o l . C e l l C a r d i o l . 21 ( S u p p l . 1) 175-179. A n t e z a n a , A . M., R i c h a l e t , J. P., A n t e z a n a , G., S p i e l v o g a l , H . a n d K a c i m i , R. ( 1 9 9 2 ) . A d r e n e r g i c s y s t e m i n h i g h a l t i t u d e r e s i d e n t s . Int. J. S p o r t s M e d . 13, S 9 6 - S 1 0 0 . A r n a u d , J., G u t i e r r e z , N., T e l l e z , W. a n d V e r g n e s , H . ( 1 9 8 5 ) . H a e m a t o l o g y a n d e r y t h r o c y t e m e t a b o l i s m i n m a n at h i g h a l t i t u d e : a n A y m a r a - Q u e c h u a c o m p a r i s o n . A m . J. P h y s . A n t h r o . 67, 2 7 9 - 2 8 4 . A r n e r , P. a n d H o f f s t e d t , J. ( 1 9 9 9 ) . A d r e n o c e p t o r g e n e s i n h u m a n o b e s i t y . J. Int. M e d . 245, 6 6 7 -672. B a i l e y , L . B . a n d G r e g o r y 3 r d, J.F. ( 1 9 9 9 ) . P o l y m o r p h i s m s o f m e t h y l e n e t e t r a h y d r o f o l a t e r e d u c t a s e a n d o t h e r e n z y m e s : m e t a b o l i c s i g n i f i c a n c e , r i s k s a n d i m p a c t o n f o l a t e r e q u i r e m e n t . J. N u t r . 129 ( 5 ) 9 1 9 - 9 2 2 . B a i l e y , D.M. a n d D a v i e s , B . ( 1 9 9 7 ) P h y s i o l o g i c a l i m p l i c a t i o n s o f a l t i t u d e t r a i n i n g f o r e n d u r a n c e p e r f o r m a n c e at s e a l e v e l : a r e v i e w . B r . J. S p o r t s M e d 31 183-190. B a k e r , P. T. ( 1 9 7 1 ) . A d a p t a t i o n p r o b l e m s i n A n d e a n I n d i a n p o p u l a t i o n s . I n T h e o n g o i n g e v o l u t i o n o f L a t i n A m e r i c a n p o p u l a t i o n s . , F . M . S a l z a n o , ed. ( S p r i n g f i e l d : C h a r l e s C. T h o m a s ) , p p . 4 7 5 - 5 0 8 . B a k e r , P. T. ( 1 9 7 6 ) . W o r k p e r f o r m a n c e o f h i g h l a n d n a t i v e s . I n M a n i n t h e A n d e s , P. T. B a k e r a n d M . A . L i t t l e , eds. ( S t r o u d s b u r g , P e n n s y l v a n i a : D o w d e n , H u c h i n s o n a n d R o s s , Inc.), pp. 3 0 0 -314. 9 4 B a l l e w , C , G a r r u t o , R. M . a n d H a a s , J. ( 1 9 8 9 ) . H i g h a l t i t u d e h e m a t o l o g y : p a r a d i g m o r e n i g m a . I n H u m a n P o p u l a t i o n B i o l o g y , M . A . L i t t l e a n d J. D . H a a s , eds.: O x f o r d U n i v e r s i t y P r e s s ) , pp. 2 3 9 - 2 6 2 . B a r l e y , J., B l a c k w o o d , A., C a r t e r , N . D., C r e w s , D. E., C r u i c k s h a n k , J. K., J e f f e r y , S., O g u n l e s i , A . O. a n d S a g n e l l a , G. A . ( 1 9 9 4 ) . A n g i o t e n s i n c o n v e r t i n g e n z y m e i n s e r t i o n / d e l e t i o n p o l y m o r p h i s m : a s s o c i a t i o n w i t h e t h n i c o r i g i n . J. H y p e r t e n s i o n 12, 9 5 5 - 9 5 7 . B a r l e y , J., B l a c k w o o d , A., M i l l e r , M., M a r k a n d u , N . D., C a r t e r , N . D., J e f f e r y , S., C a p p u c c i o , F. P., M a c G r e g o r , G . A . a n d S a g n e l l a , G. A . ( 1 9 9 6 ) . A n g i o t e n s i n c o n v e r t i n g e n z y m e g e n e I/D p o l y m o r p h i s m , b l o o d p r e s s u r e a n d th e r e n i n - a n g i o t e n s i n s y s t e m i n C a u c a s i a n a n d A f r o -C a r i b b e a n p e o p l e s . J. H u m . H y p e r t e n s . 10 (1), 31-35. B a r n e s , P. J. ( 1 9 9 5 ) . B e t a - a d r e n e r g i c r e c e p t o r s a n d t h e i r r e g u l a t i o n . A m . J. R e s p i r . C r i t . C a r e M e d . 152, 8 3 8 - 8 6 0 . B a r r , C . L . a n d K i d d , K . ( 1 9 9 3 ) . P o p u l a t i o n f r e q u e n c i e s o f t h e A l a l l e l e at t h e d o p a m i n e D2 r e c e p t o r l o c u s . B i o l . P s y c h i a t r y 34, 2 0 4 - 2 0 9 . B a u m a n n , R. E . a n d H e n s c h e n , A . H . ( 1 9 9 3 a ) . H u m a n f i b r i n o g e n p o l y m o r p h i c s i t e a n a l y s i s b y r e s t r i c t i o n e n d o n u c l e a s e d i g e s t i o n a n d a l l e l e - s p e c i f i c p o l y m e r a s e c h a i n r e a c t i o n a m p l i f i c a t i o n : i d e n t i f i c a t i o n o f p o l y m o r p h i s m s at p o s i t i o n s A o c 3 1 2 a n d B B 4 4 8 . B l o o d 82 (7), 2 1 1 7 - 2 1 2 4 . B a u m a n n , R. E . a n d H e n s c h e n , A . H . ( 1 9 9 3 b ) . G e n e t i c v a r i a t i o n i n h u m a n B f i b r i n o g e n g e n e p r o m o t e r i n f l u e n c e s f o r m a t i o n o f a s p e c i f i c D N A - p r o t e i n c o m p l e x w i t h t h e i n t e r l e u k i n r e s p o n s e e l e m e n t . T h r o m b . H a e m o s t . 69,961, A b s t r a c t . B e a l l , C . M., G o l d s t e i n , M . C . a n d T h e T i b e t a n A c a d e m y o f S o c i a l S c i e n c e s . ( 1 9 8 7 ) . H e m o g l o b i n c o n c e n t r a t i o n o f p a s t o r a l n o m a d s p e r m a n e n t l y r e s i d e n t at 4 8 5 0 - 5 4 5 0 m i n T i b e t . A m . J. P h y s . A n t h r o . 73 (4), 4 3 3 - 4 3 8 . B e a l l , C . M., S t r o h l , K. P., B l a n g e r o , J., W i l l i a m s - B l a n g e r o , S., A l m a s y , L . A., D e c k e r , M . J., W o r t h m a n , C . M., G o l d s t e i n , M . C , V a r g a s , E., V i l l e n a , M., S o r i a , R., A l a r c o n , A . M . a n d G o n z a l e s , C. ( 1 9 9 7 ) . V e n t i l a t i o n a n d h y p o x i c v e n t i l a t o r y r e s p o n s e o f T i b e t a n a n d A y m a r a h i g h a l t i t u d e n a t i v e s . A m . J. P h y s . A n t h r o . 104 (5), 4 2 7 - 4 4 7 . 9 5 B e i g e , J., O f f e r m a n n , G., D i s t l e r , A . a n d S h a r m a , A . M . ( 1 9 9 8 ) . A n g i o t e n s i n - c o n v e r t i n g - e n z y m e i n s e r t i o n / d e l e t i o n g e n o t y p e a n d l o n g - t e r m r e n a l a l l o g r a f t s u r v i v a l . N e p h r o l . D i a l . T r a n s p l a n t 13 ( 1 3 ) , 7 3 5 - 7 3 8 . B e r u , N . a n d P a y t o n , M . N . ( 1 9 9 1 ) . Bgl II p o l y m o r p h i s m at t h e h u m a n e r y t h r o p o i e t i n gene. N u c l . A c i d s R e s . 19 ( 1 9 ) , 1717. B i l e z i k i a n , J. P. ( 1 9 8 7 ) . D e f i n i n g t h e r o l e o f a d r e n e r g i c r e c e p t o r s i n h u m a n p h y s i o l o g y . I n A d r e n e r g i c r e c e p t o r s i n man, P. A . I n s e l , ed. ( N e w Y o r k : M a r c e l D e k k e r , Inc.), pp. 37-68. B l o e m , L . J., M a n a t u n g a , A . K. a n d Pratt, J. H . ( 1 9 9 6 ) . R a c i a l d i f f e r e n c e i n t h e r e l a t i o n s h i p o f a n a n g i o t e n s i n I - c o n v e r t i n g e n z y m e g e n e p o l y m o r p h i s m t o s e r u m a n g i o t e n s i n I - c o n v e r t i n g e n z y m e a c t i v i t y . H y p e r t e n s i o n 2 7 (1), 62-66. B o n n a r d e a u x , A., D a v i e s , E., J e u n e m a i t r e , X., F e r y , I., C h a r r u , A., C l a u s e r , E., T i r e t , L., C a m b i e n , F., C o r v o l , P. a n d S o u b r i e r , F. ( 1 9 9 4 ) . A n g i o t e n s i n II t y p e 1 r e c e p t o r g e n e p o l y m o r p h i s m s i n h u m a n e s s e n t i a l h y p e r t e n s i o n . H y p e r t e n s i o n 24 (1), 63-69. B o u c h a r d , C., D a w , E . W., R i c e , T., P e r u s s e , L., G a g n o n , J., P r o v i n c e , M . A., L e o n , A . S., R a o , D. C., S k i n n e r , J. S. a n d W i l m o r e , J. H . ( 1 9 9 8 ) . F a m i l i a l r e s e m b l a n c e f o r V 0 2 m a x i n t h e s e d e n t a r y state: t h e H E R I T A G E f a m i l y s t u d y . M e d . S c i . S p o r t s E x e r c . 30 (2) 252-8. B r u h n s , K.O. ( 1 9 9 4 ) A n c i e n t S o u t h A m e r i c a . ( C a m b r i d g e : C a m b r i d g e U n i v e r s i t y P r e s s ) B u n n , H. F., G u , J., H u a n g , L . E., P a r k , J. W. a n d Z h u , H . ( 1 9 9 8 ) . E r y t h r o p o i e t i n : a m o d e l s y s t e m f o r s t u d y i n g o x y g e n - d e p e n d e n t g e n e r e g u l a t i o n . J. E x p . B i o l . 2 0 7 ( 8 ) , 1 1 9 7 - 1 2 0 1 . B u s k i r k , E . R. ( 1 9 7 6 ) . W o r k p e r f o r m a n c e o f n e w c o m e r s t o t h e P e r u v i a n h i g h l a n d s . I n M a n i n t h e A n d e s , P. T. B a k e r a n d M . A . L i t t l e , eds. ( S t r o u d s b u r g , P e n n s y l v a n i a : D o w d e n , H u c h i n s o n a n d R o s s , Inc.). B u t l e r , R., M o r r i s , A . D . a n d S t r u t h e r s , A . D. ( 1 9 9 7 ) . A n g i o t e n s i n - c o n v e r t i n g e n z y m e g e n e p o l y m o r p h i s m a n d c a r d i o v a s c u l a r d i s e a s e . C l i n . S c i . 93, 391-400. C a m b i e n , R, P o i r i e r , O., L e c e r f , L., E v a n s , A., C a m b o u , J. P., A r v e i l e r , D., L u c , G., B a r d , J. M., B a r a , L., R i c a r d , S., T i r e t , L., A m o u y e l , P., A l h e n c - G e l a s , F. a n d S o u b r i e r , F. ( 1 9 9 2 ) . D e l e t i o n p o l y m o r p h i s m i n t h e g e n e f o r a n g i o t e n s i n - c o n v e r t i n g e n z y m e i s a p o t e n t r i s k f a c t o r f o r m y o c a r d i a l i n f a r c t i o n . N a t u r e 359, 641-644. 9 6 C a s t e l l a n o , M., M u i e s a n , M . L., B e s c h i , M., R i z z o n i , D., C i n e l l i , A., S a l v e t t i , M., P a s i n i , G., P o r t e r i , E., B e t t o n i , G., Z u l l i , R. a n d A g a b i t i - R o s e i , E . ( 1 9 9 6 ) . A n g i o t e n s i n II t y p e 1 r e c e p t o r A / C l 1 6 6 p o l y m o r p h i s m . R e l a t i o n s h i p s w i t h b l o o d p r e s s u r e a n d c a r d i o v a s c u l a r s t r u c t u r e . H y p e r t e n s i o n 28 ( 6 ) , 1 0 7 6 - 8 0 C a r t e r , A . M., C a t t o , A . J., B a m f o r d , J. M . a n d G r a n t , P. J. ( 1 9 9 7 ) . G e n d e r - s p e c i f i c a s s o c i a t i o n s o f t h e f i b r i n o g e n B 6 4 4 8 p o l y m o r p h i s m , f i b r i n o g e n l e v e l s a n d a c u t e c e r e b r o v a s c u l a r d i s e a s e . A r t e r i o . T h r o m b . V a s e . B i o l . 7 7 ( 3 ) 5 8 9 - 5 9 4 . C a v a l l i - S f o r z a , L . L., M e n o z z i , P. a n d P i a z z a , A . ( 1 9 9 4 ) . T h e h i s t o r y a n d g e o g r a p h y o f h u m a n g e n e s ( P r i n c e t o n , N.J.: P r i n c e t o n U n i v e r s i t y P r e s s ) . C a v i e d e s , C . a n d K n a p p , G. ( 1 9 9 5 ) . S o u t h A m e r i c a ( E n g l e w o o d C l i f f s , N J : P r e n t i c e H a l l ) . C h a k r a b o r t y , R., C l e n c h , J., F e r r e l l , R. E., B a r t o n , S. A . a n d S c h u l l , W. J. ( 1 9 8 3 ) . G e n e t i c c o m p o n e n t s o f v a r i a t i o n s o f r e d c e l l g l y c o l y t i c i n t e r m e d i a t e s at t w o a l t i t u d e s a m o n g th e S o u t h A m e r i c a n A y m a r a . A n n . H u m . B i o l . 10 (2), 173-184 C h i o d i , H . ( 1 9 5 0 ) . B l o o d p i c t u r e at h i g h a l t i t u d e . J. A p p l . P h y s i o l . 2 , 4 3 1 - 4 3 6 . C h i o d i , H . ( 1 9 5 7 ) . R e s p i r a t o r y a d a p t a t i o n s t o c h r o n i c h i g h a l t i t u d e h y p o x i a . J. A p p l . P h y s i o l . 10 (1), 81-87. C h o m c z y n s k i , P. ( 1 9 8 9 ) . T h e R N A z o l m e t h o d . C i n n a / B i o t e c x B u l l . no. 3. C h u a n g , L . M., C h i u , K. C , C h i a n g , F. T., L e e , K. C , W u , H . P., L i n , B . J. a n d T a i , T. Y . ( 1 9 9 7 ) . I n s e r t i o n / d e l e t i o n p o l y m o r p h i s m o f the a n g i o t e n s i n I - c o n v e r t i n g e n z y m e g e n e i n p a t i e n t s w i t h h y p e r t e n s i o n , n o n - i n s u l i n - d e p e n d e n t d i a b e t e s m e l l i t u s a n d c o r o n a r y h e a r t d i s e a s e i n T a i w a n . M e t a b o l i s m 46 ( 1 0 ) , 1 2 1 1 - 1 2 1 4 . C l e n c h , J., F e r r e l l , R. F. a n d S c h u l l , W. J. ( 1 9 8 2 ) . E f f e c t o f c h r o n i c h y p o x i a o n h e m a t o l o g i c a n d g l y c o l y t i c p a r a m e t e r s . A m . J. P h y s i o l . 242, R 4 4 7 - R 4 5 1 . C o l l i n s , D. D., S c o g g i n , C. H., Z w i l l i c h , C. W. a n d W e i l , J. V . ( 1 9 7 8 ) . H e r e d i t a r y a s p e c t s o f d e c r e a s e d h y p o x i c r e s p o n s e . J. C l i n . I n v e s t . 62 (1), 105-110. 9 7 C o m a s , J. ( 1 9 7 1 ) . A n t h r o p o m e t r i c s t u d i e s i n L a t i n A m e r i c a n I n d i a n p o p u l a t i o n s . I n T h e o n g o i n g e v o l u t i o n o f L a t i n A m e r i c a n p o p u l a t i o n s . , F. M . S a l z a n o , ed. ( S p r i n g f i e l d : C h a r l e s C. T h o m a s ) , pp. 3 3 3 - 4 0 4 . C o n n e r , J. M., F o w k e s , F. G. R., W o o d , J., S m i t h , F. B., D o n n a n , P. T. a n d L o w e , G. D . O. ( 1 9 9 2 ) . G e n e t i c v a r i a t i o n at f i b r i n o g e n l o c i a n d p l a s m a f i b r i n o g e n l e v e l s . J. M e d . G e n e t . 2 9 (7), 4 8 0 - 4 8 2 . C o x , N.J. a n d B e l l , G.I. ( 1 9 8 9 ) . D i s e a s e a s s o c i a t i o n s . C h a n c e , a r t i f a c t , o r s u s c e p t i b i l i t y g e n e s ? D i a b e t e s 38 ( 8 ) , 9 4 7 - 9 5 0 . D'amato, M., V i t i a n i , L . R., P e t r e l l i , G., F e r r i g n o , L., d i P i e t r o , A., T r e z z a , R. a n d M a t r i c a r d i , P. M . ( 1 9 9 8 ) . A s s o c i a t i o n o f p e r s i s t e n t b r o n c h i a l h y p e r r e s p o n s i v e n e s s w i t h 8 2 - a d r e n o c e p t o r h a p l o t y p e s . A m . J. R e s p i r . C r i t . C a r e M e d . 158, 1 9 6 8 - 1 9 7 3 . D a i n i a k , N., S p i e l v o g e l , H., S o r b a , S. a n d C u d k o w i c z , L . ( 1 9 8 8 ) . E r y t h r o p o i e t i n a n d p o l y c y t h e m i a o f h i g h a l t i t u d e d w e l l e r s . I n M o l e c u l a r b i o l o g y o f e r y t h r o p o i e s i s , J. L . A s c e n c o , E . D. Z a n j a n i , M . T a v a s s o l i , A . S. L e v i n e a n d F. R. M a c i n t o s h , eds. ( N e w Y o r k : P l e n u m P r e s s ) , pp. 17-22. D a u t , J. a n d E l z i n g a , G . ( 1 9 8 9 ) . S u b s t r a t e d e p e n d e n c e o f e n e r g y m e t a b o l i s m i n i s o l a t e d g u i n e a -p i g c a r d i a c m u s c l e : a m i c r o c a l o r i m e t r i c s t u d y . J. P h y s i o l . ( L o n d ) 413, 3 7 9 - 3 9 7 . d e M a a t , M . P. M., d e K n i j f f , P., G r e e n , F., T h o m a s , A . E., J e s p e r s e n , J. a n d K l u f t , C. ( 1 9 9 5 ) . G e n d e r - r e l a t e d a s s o c i a t i o n b e t w e e n B - f i b r i n o g e n g e n o t y p e a n d p l a s m a f i b r i n o g e n l e v e l s a n d l i n k a g e d i s e q u i l i b r i u m at t h e f i b r i n o g e n l o c u s i n G r e e n l a n d I n u i t . A r t e r i o s c l e r . T h r o m b . V a s e . B i o l . 15, 8 5 6 - 8 6 0 . d e M a a t , M . P., B l a d b j e r g , E . M., J o h a n s e n , L . G., d e K n i j f f , P., G r a m , J., K l u f t , C. a n d J e s p e r s e n , J. ( 1 9 9 9 ) . D N A - p o l y m o r p h i s m s a n d p l a s m a l e v e l s o f v a s c u l a r d i s e a s e r i s k f a c t o r s i n G r e e n l a n d I n u i t - i s t h e r e a r e l a t i o n w i t h the l o w r i s k o f c a r d i o v a s c u l a r d i s e a s e i n the I n u i t ? T h r o m b . H a e m o s t . 81 (4), 5 4 7 - 5 5 2 . d e M e e r , K., H e y m a n s , H. S. A . a n d Z i l j l s t r a , W. G. ( 1 9 9 5 ) . P h y s i c a l a d a p t a t i o n o f c h i l d r e n t o l i f e at h i g h a l t i t u d e . E u r . J. P e d i a t r . 154, 263-272. 9 8 D i n t i n f a s s , L . ( 1 9 8 1 ) . E v o l u t i o n o f t h e c o n c e p t s o f h y p e r v i s c o s i t y o f b l o o d i n v a s c u l a r d i s e a s e . I n B l o o d v i s c o s i t y i n h e a r t d i s e a s e a n d c a n c e r , L . D i n t i n f a s s a n d G . V . F. S e a m a n , eds. ( O x f o r d : P e r g a m o n P r e s s ) . D i n t i n f a s s , L . ( 1 9 8 5 ) . B l o o d v i s c o s i t y , h y p e r v i s c o s i t y a n d h y p e r v i s c o s a e m i a ( L a n c a s t e r : M T P P r e s s L t d . ) . D u a , G . L . a n d S e n G u p t a , J. ( 1 9 8 0 ) . A s t u d y o f p h y s i c a l w o r k c a p a c i t y o f s e a l e v e l r e s i d e n t s o n p r o l o n g e d s t a y at h i g h a l t i t u d e a n d c o m p a r i s o n w i t h h i g h a l t i t u d e n a t i v e r e s i d e n t s . I n d i a n J. P h y s i o l . P h a r m a c o l . 24, 15-24. D u c k , F. A . ( 1 9 9 0 ) . P h y s i c a l p r o p e r t i e s o f t i s s u e ( L o n d o n : A c a d e m i c P r e s s ) . E m o r i n e , L . J., M a r u l l o , S., D e l a v i e r - K l u t c h k o , C., K a v e r i , S. V., D u r i e u - T r a u t m a n n , O. a n d S t r o s b e r g , A . D . ( 1 9 8 7 ) . S t r u c t u r e o f t h e g e n e f o r h u m a n 6 2 - a d r e n e r g i c r e c e p t o r : E x p r e s s i o n a n d p r o m o t e r c h a r a c t e r i z a t i o n . P r o c . N a t l . A c a d . S c i . 84, 6 9 9 5 - 6 9 9 9 . E r s l e v , A . J. a n d C a r o , J. ( 1 9 8 8 ) . E r y t h r o p o i e t i n : F r o m m o u n t a i n t o p t o b e d s i d e . I n M o l e c u l a r b i o l o g y o f e r y t h r o p o i e s i s , J. L . A s c e n c o , E . D . Z a n j a n i , M . T a v a s s o l i , A . S. L e v i n e a n d F. R. M a c i n t o s h , eds. ( N e w Y o r k : P l e n u m P r e s s ) , pp. 1-8. E v a n s , A . E., P o i r i e r , O., K e e , F., L e c e r f , L., E., M., F a l c o n e r , T., C r a n e , J., O ' R o u r k e , D. F. a n d C a m b i e n , F. ( 1 9 9 4 ) . P o l y m o r p h i s m s o f the a n g i o t e n s i n - c o n v e r t i n g - e n z y m e g e n e i n s u b j e c t s w h o d i e f r o m c o r o n a r y h e a r t d i s e a s e . Q. J. M e d . 87, 2 1 1 - 2 1 4 . F a r r a l l , M., K e a v n e y , B., M c K e n z i e , C , D e l e p i n e , M., M a t s u d a , F. a n d L a t h r o p , G. M . ( 1 9 9 9 ) . F i n e - m a p p i n g o f a n a n c e s t r a l r e c o m b i n a t i o n b r e a k p o i n t i n DCP1. N a t . G e n e t . 2 5 , 2 70-271. F o y , C . A., M c C o r m a c k , L . J., K n o w l e r , W. C , B a r r e t t , J. H., C a t t o , A . a n d G r a n t , P. J. ( 1 9 9 6 ) . T h e a n g i o t e n s i n - I c o n v e r t i n g e n z y m e ( A C E ) g e n e I/D p o l y m o r p h i s m a n d A C E l e v e l s i n P i m a I n d i a n s . J. M e d . G e n e t . 33, 3 3 6 - 3 3 7 . F r i s a n c h o , A . R. ( 1 9 7 5 ) . F u n c t i o n a l a d a p t a t i o n t o h i g h a l t i t u d e h y p o x i a . S c i e n c e 187, 313-319. G a r r u t o , R. M . ( 1 9 7 6 ) . H e m a t o l o g y . I n M a n i n t h e A n d e s , P. T. B a k e r a n d M . A . L i t t l e , eds. ( S t r o u d s b u r g , P e n n s y l v a n i a : D o w d e n , H u c h i n s o n a n d R o s s , Inc.), pp. 2 6 1 - 2 8 2 . 9 9 G a r r u t o , R. M . a n d D u t t , J. S. ( 1 9 8 3 ) . L a c k o f p r o m i n e n t c o m p e n s a t o r y p o l y c y t h e m i a i n t r a d i t i o n a l n a t i v e I n d i a n s l i v i n g at 4,200 me t e r s . A m . J. P h y s . A n t h r o . 61 (3), 355-366. G a y a g a y , G., Y u , B., H a m b l y , B., B o s t o n , T., H a h n , A., C e l e r m a j e r , D. S. a n d T r e n t , R. J. ( 1 9 9 8 ) . E l i t e e n d u r a n c e a t h l e t e s a n d the A C E I a l l e l e - t h e r o l e o f g e n e s i n a t h l e t i c p e r f o r m a n c e . H u m . G e n e t . 103(1), 48-50. G l o c k n e r , G., S c h e r e r , S., S c h a t t e v o y , R., B o r i g h t , A., W e b e r , J.,and T s u i , L . C . a n d R o s e n t h a l , A . ( 1 9 9 8 ) . L a r g e - s c a l e s e q u e n c i n g o f t w o r e g i o n s i n h u m a n c h r o m o s o m e 7 q 2 2 : a n a l y s i s o f 6 5 0 k b o f g e n o m i c s e q u e n c e a r o u n d t h e E P O a n d C U T L 1 l o c i r e v e a l s 17 g e n e s . G e n o m e R e s . 8 (10), 1 0 6 0 - 1 0 7 3 . G r e e n , S. A., C o l e , G., J a c i n t o , M., I n n i s , M . a n d L i g g e t t , S. B . ( 1 9 9 3 ) . A p o l y m o r p h i s m o f the h u m a n B 2 - a a , r e n e r g i c r e c e p t o r w i t h i n t h e f o u r t h t r a n s m e m b r a n e d o m a i n a l t e r s l i g a n d b i n d i n g a n d f u n c t i o n a l p r o p e r t i e s o f t h e r e c e p t o r . J. B i o l . C h e m . 268, 2 3 1 1 6 - 2 3 1 2 1 . G r e e n , S. A., T u r k i , J., I n n i s , M . a n d L i g g e t t , S. B . ( 1 9 9 4 ) . A m i n o - t e r m i n a l p o l y m o r p h i s m s o f t h e h u m a n 6 2 - a d r e n e r g i c r e c e p t o r i m p a r t d i s t i n c t a g o n i s t - p r o m o t e d r e g u l a t o r y p r o p e r t i e s . B i o c h e m i s t r y 33, 9 4 1 4 - 9 4 1 9 . G r e e n b e r g , J. H., T u r n e r II, C . G . a n d Z e g u r a , S. L . ( 1 9 8 6 ) . T h e s e t t l e m e n t o f t h e A m e r i c a s : a c o m p a r i s o n o f t h e l i n g u i s t i c , d e n t a l a n d g e n e t i c e v i d e n c e . C u r r . A n t h r o p . 2 7 ( 5 ) , 4 7 7 - 4 9 7 . G r e k s a , L . P., S p i e l v o g e l , H., P a z - Z a m o r a , M., C a c e r e s , E . a n d P a r e d e s - F e r n a n d e z , L . ( 1 9 8 8 ) . E f f e c t o f a l t i t u d e o n t h e l u n g f u n c t i o n o f h i g h a l t i t u d e r e s i d e n t s o f E u r o p e a n a n c e s t r y . A m . J. P h y s . A n t h r o p o l . 7 5 ( 1 ) , 77-85. G r e k s a , L . P. ( 1 9 9 2 ) . S u r n a m e s as i n d i c a t o r s o f E u r o p e a n a d m i x t u r e i n A n d e a n I n d i a n s . Int. J. A n t h r o . 7 ( 1 ) , 41-49. G r e k s a , L . P. ( 1 9 9 6 ) . E v i d e n c e f o r a g e n e t i c b a s i s t o t h e e n h a n c e d t o t a l l u n g c a p a c i t y o f A n d e a n h i g h l a n d e r s . H u m . B i o l . <5S (1) 119-129. H a g b e r g , J. M., F e r r e l l , R. E., M c C o l e , S. D., W i l u n d , K. R. a n d M o o r e , G . E . ( 1 9 9 8 ) . V 0 2 m a x is a s s o c i a t e d w i t h A C E g e n o t y p e i n p o s t m e n o p a u s a l w o m e n . J. A p p l . P h y s i o l . 85 (5), 1842-1846. 1 0 0 H a l l , I. P., W h e a t l y , A., W i l d i n g , P. a n d L i g g e t t , S. B . ( 1 9 9 5 ) . A s s o c i a t i o n o f G l u 2 7 62-a d r e n o c e p t o r p o l y m o r p h i s m w i t h l o w e r a i r w a y r e a c t i v i t y i n a s t h m a t i c s u b j e c t s . L a n c e t 345, 1213-1214. H a n n o n , J. P., C h i n n , K . S. a n d S h i e l d s , J. L . ( 1 9 6 9 ) . E f f e c t s o f a c u t e h i g h - a l t i t u d e e x p o s u r e o n b o d y f l u i d s . F e d . P r o c . 28 ( 3 ) , 1 1 7 8 - 1 1 8 4 . H a r k n e s s , J. ( 1 9 7 1 ) . T h e v i s c o s i t y o f h u m a n b l o o d p l a s m a ; its m e a s u r e m e n t i n h e a l t h a n d d i s e a s e . B i o r h e o l o g y 8 ( 3 ) , 171-193. H e a t h , D . a n d W i l l i a m s , D . R. ( 1 9 9 5 ) . H i g h a l t i t u d e m e d i c i n e a n d p a t h o l o g y ( O x f o r d : O x f o r d U n i v e r s i t y P r e s s ) . H e b b e l , R. P., E a t o n , J. W., K r o n e n b e r g , R. S., Z a n j a n i , E . D., M o o r e , L . G. a n d B e r g e r , E . M . ( 1 9 7 8 ) . H u m a n L a m a s : A d a p t a t i o n t o a l t i t u d e i n s u b j e c t s w i t h h i g h h e m o g l o b i n o x y g e n a f f i n i t y . J. C l i n . I n v e s t . 62 ( 3 ) , 5 9 3 - 6 0 0 . H e i n r i c h , J . a n d A s s m a n n , G . ( 1 9 9 5 ) . F i b r i n o g e n a n d c a r d i o v a s c u l a r r i s k . J. C a r d i o v a s c u l a r R i s k 2, 197-205. H e i n r i c h , J., F u n k e , H., R u s t , S., S c h u l t e , H., S c h o n f e l d , R., K o h l e r , E . a n d A s s m a n n , G. ( 1 9 9 5 ) . I m p a c t o f p o l y m o r p h i s m s i n the a l p h a - a n d b e t a - f i b r i n o g e n g e n e o n p l a s m a f i b r i n o g e n c o n c e n t r a t i o n s o f c o r o n a r y h e a r t d i s e a s e . T h r o m b . R e s . 7 7 (3), 2 0 9 - 2 1 5 . H i n g o r a n i , A . D. a n d B r o w n , M . J. ( 1 9 9 5 ) . A s i m p l e m o l e c u l a r a s s a y f o r t h e C I 1 6 6 v a r i a n t o f t h e a n g i o t e n s i n II t y p e 1 r e c e p t o r g e n e . B i o c h e m . B i o p h y s . R e s . C o m m . 213, 7 2 5 - 7 2 9 . H o c h a c h k a , P. W., S t a n l e y , C , M a t h e s o n , G. O., M c K e n z i e , D . C , A l l e n , P. S. a n d P a r k h o u s e , W. S. ( 1 9 9 1 ) . M e t a b o l i c w o r k e f f i c i e n c i e s d u r i n g e x e r c i s e i n A n d e a n n a t i v e s . J. A p p l . P h y s i o l . 7 0 ( 4 ) , 1 7 2 0 - 1 7 3 0 . H o c h a c h k a , P. W., C l a r k , C. M., B r o w n , W. D., S t a n l e y , C , S t o n e , C . K., N i c k l e s , J., A l l e n , P. S. a n d H o l d e n , J. E . ( 1 9 9 4 ) . T h e b r a i n at h i g h a l t i t u d e : H y p o m e t a b o l i s m as a d e f e n s e a g a i n s t c h r o n i c h y p o x i a ? J. C e r e . B l o o d F l o w M e t . 14, 6 7 1 - 6 7 9 . H o c h a c h k a , P. W., R u p e r t , J. L . a n d M o n g e , C. ( 1 9 9 9 ) . A d a p t a t i o n a n d c o n s e r v a t i o n o f p h y s i o l o g i c a l s y s t e m s i n t h e e v o l u t i o n o f h u m a n h y p o x i a t o l e r a n c e . C o m p . B i o c h e m . P h y s i o l 124A ( 1 ) , 1-17. 101 H o l d e n , J. E., S t o n e , C . K., C l a r k , C . M., B r o w n , W. D., N i c k l e s , J., S t a n l e y , C . a n d H o c h a c h k a , P. W. ( 1 9 9 5 ) . E n h a n c e d c a r d i a c m e t a b o l i s m o f p l a s m a g l u c o s e i n h i g h a l t i t u d e n a t i v e s : a d a p t a t i o n a g a i n s t c h r o n i c h y p o x i a . J. A p p l . P h y s i o l . 79 (1), 2 2 2 - 2 2 8 . H o u s t o n , C . S. ( 1 9 8 7 ) . G o i n g H i g h e r ( B o s t o n : L i t t l e , B r o w n a n d C o m p a n y ) . H u r t a d o , A . ( 1 9 3 2 ) . R e s p i r a t o r y a d a p t a t i o n i n t h e I n d i a n n a t i v e s o f t h e P e r u v i a n A n d e s : S t u d i e s at h i g h a l t i t u d e . A m . J. P h y s . A n t h r o . 16, 137-165. I s h i g a m i , T., I w a m o t o , T., T a m u r a , K., Y a m a g u c h i , S., I w a sawa, K., U c h i n o , K., U m e m u r a , S. a n d I s h i i , M . ( 1 9 9 5 ) . A n g i o t e n s i n I c o n v e r t i n g e n z y m e ( A C E ) g e n e p o l y m o r p h i s m a n d e s s e n t i a l h y p e r t e n s i o n i n J a p a n . E t h n i c d i f f e r e n c e o f A C E g e n o t y p e . A m . J. H y p e r t e n s . 8 (1), 95-97. I s h i y a m a - S h i g e m o t o , S., Y a m a d a , K., Y u a n , X., I c h i k a w a , F. a n d N o n a k a , K. ( 1 9 9 9 ) . A s s o c i a t i o n o f p o l y m o r p h i s m s i n t h e b e t a 2 - a d r e n e r g i c r e c e p t o r g e n e w i t h o b e s i t y , h y p e r t r i g l y c e r i d a e m i a a n d d i a b e t e s m e l l i t u s . D i a b e t o l o g i a 42 (1), 98-101. J e n n i n g s , J. D . ( 1 9 8 3 ) . O r i g i n s . I n A n c i e n t N o r t h A m e r i c a n s , J. D. J e n n i n g s , ed. ( N e w Y o r k : W.H. F r e e m a n a n d C o . ) , pp. 25-68. J e s s e n , T. H., W e b e r , R. E., F e r m i , G., T a m e , J. a n d B r a u n i t z e r , G. ( 1 9 9 1 ) . A d a p t a t i o n o f b i r d h e m o g l o b i n s t o h i g h a l t i t u d e s : d e m o n s t r a t i o n o f m o l e c u l a r m e c h a n i s m b y p r o t e i n e n g i n e e r i n g . P r o c . N a t l . A c a d . S c i . ( U S A ) 88 ( 1 5 ) , 6 5 1 9 - 6 5 2 2 . J i n n o , Y., I k e d a , Y., Y u n , K., M a w , M., M a s u z k i , H., F u k u d a , H., I n u z u k a , K., F u j i s h i t a , A., O h t a n i , Y., O k i m o t o , T., I s h i m a r u , T. a n d N i i k a w a , N . ( 1 9 9 5 ) . E s t a b l i s h m e n t o f f u n c t i o n a l i m p r i n t i n g i n t h e H19 g e n e i n h u m a n d e v e l o p i n g p l a c e n t a e . N a t . G e n e t . 10, 318-324. J o h n s o n , M . ( 1 9 9 8 ) . T h e 6 - a d r e n o c e p t o r . A m . J. R e s p i r . C r i t . C a r e M e d . 158, S 1 4 6 - S 1 5 3 . K e h o e , P. G., R u s s , C , M c l l r o y , S., W i l l i a m s , H., H o l m a n s , P., H o l m e s , C , L i o l i t s a , D., V i h i d a s s r , D., P o w e l l , J., M c G l e e n o n , B., L i d d e l l , M., P l o m i n , R., D y n a n , K., W i l l i a m s , N., N e a l , J., C a i r n s , N . J., W i l c o c k , G., P a s s m o r e , P., L o v e s t o n e , S., W i l l i a m s , J. a n d O w e n , M . J. ( 1 9 9 9 ) . V a r i a t i o n i n D C P 1 , e n c o d i n g A C E , i s a s s o c i a t e d w i t h s u s c e p t i b i l i t y t o A l z h e i m e r d i s e a s e . N a t . G e n e t . 2 7 , 7 1 - 7 2 . K i d d , J. R., B l a c k , F. L., W e i s s , K. M . a n d K i d d , K. K. ( 1 9 9 1 ) . S t u d i e s o f t h r e e A m e r i n d i a n p o p u l a t i o n s u s i n g n u c l e a r D N A p o l y m o r p h i s m s . H u m . B i o l . 63 ( 6 ) , 7 7 5 - 7 9 4 . 1 0 2 K l a u s e n , T . ( 1 9 9 8 ) . T h e f e e d - b a c k r e g u l a t i o n o f e r y t h r o p o i e t i n p r o d u c t i o n i n h e a l t h y h u m a n s . D a n . M e d . B u l l . 45 ( 4 ) , 345-53. K l i s s o u r a s , V . ( 1 9 9 7 ) . H e r i t a b i l i t y o f a d a p t i v e v a r i a t i o n : a n o l d p r o b l e m r e v i s i t e d - J S p o r t s M e d P h y s F i t n e s s 1 9 9 7 3 7 ( 1 ) , 1-6. K o b i l k a , R. K., F r i e l l e , T., D o h l m a n , H., B o l a n o w s k i , M . A., D i x o n , R., K e l l e r , P., C a r o n , M . G. a n d L e f k o w i t z , R. J. ( 1 9 8 7 ) . D e l i n e a t i o n o f the i n t r o n l e s s n a t u r e o f t h e g e n e s f o r t h e h u m a n a n d h a m s t e r R2- a d r e n e r g i c r e c e p t o r a n d t h e i r p u t a t i v e p r o m o t e r r e g i o n s . J. B i o l . C h e m . 262 (15), 7 3 2 1 - 7 3 2 7 . K r a m e r , A . A . ( 1 9 9 2 ) . H e r i t a b i l i t y e s t i m a t e s o f t h o r a c i c s k e l e t a l d i m e n s i o n s f o r a h i g h - a l t i t u d e P e r u v i a n p o p u l a t i o n . I n P o p u l a t i o n s t u d i e s o n h u m a n a d a p t a t i o n a n d e v o l u t i o n i n t h e P e r u v i a n A n d e s , R. B . E c k h a r d t a n d T. W. M e l t o n , eds. ( U n i v e r s i t y P a r k : P e n n s y l v a n i a S t a t e U n i v e r s i t y ) , p p . 25-49. L a h i r i , S., D e L a n e y , R.G., B r o d y , J.S., S i m p e r , M., V e l a s q u e z , T., M o t o y a m a , E.K. a n d P o l g a r , C . ( 1 9 7 6 ) R e l a t i v e r o l e o f e n v i r o n m e n t a l a n d g e n e t i c f a c t o r s i n r e s p i r a t o r y a d a p t a t i o n to h i g h a l t i t u d e . N a t u r e 261, 133-135. L a n d e r , E.S. a n d S c h o r k , N.J. ( 1 9 9 4 ) . G e n e t i c d i s s e c t i o n o f c o m p l e x tr a i t s . S c i e n c e 265, 2 0 3 7 -2 0 4 8 . L a n e , A., H u m p h r i e s , S. a n d G r e e n , F. R. ( 1 9 9 3 ) . E f f e c t o n t r a n s c r i p t i o n o f t w o c o m m o n g e n e t i c p o l y m o r p h i s m s a d j a c e n t t o t h e p r o m o t e r r e g i o n o f t h e 13-fibrinogen gene. T h r o m b . H a e m o s t . 69, 962, A b s t r a c t . L a r g e , V., H e l l s t r o m , L., R e y n i s d o t t i r , S., L b n n q v i s t , F., E r i k s s o n , P., L a n n f e l t , L . a n d A r n e r , P. ( 1 9 9 7 ) . H u m a n beta - 2 a d r e n o c e p t o r g e n e p o l y m o r p h i s m s ar e h i g h l y f r e q u e n t i n o b e s i t y a n d a s s o c i a t e w i t h a l t e r e d a d i p o c y t e beta-2 a d r e n o c e p t o r f u n c t i o n . J. C l i n . I n v e s t . 100 (12) 3 0 0 5 -3 0 1 3 . L e e , E . J. D. ( 1 9 9 4 ) . P o p u l a t i o n g e n e t i c s o f the a n g i o t e n s i n - c o n v e r t i n g e n z y m e i n C h i n e s e . B r . J. C l i n . P h a r m a c . 37, 221-214. L e o n - V e l a r d e , F., M o n g e , C , V i d a l , A., C a r c a g n a , M., C r i s c u o l o , M . a n d B o z z i n i , C. E . ( 1 9 9 1 ) . S e r u m i m m u n o r e a c t i v e e r y t h r o p o e t i n i n h i g h a l t i t u d e n a t i v e s w i t h a n d w i t h o u t e x c e s s i v e e r y t h r o c y t o s i s . E x p . H e m a t o l . N Y 19, 257-260. 103 L e s t e r , S., H e a t l e y , S., B a r d y , P., B a h n i s c h , J., B a n n i s t e r , K., F a u l l , R. a n d C l a r k s o n , A . ( 1 9 9 9 ) . T h e D D g e n o t y p e o f t h e a n g i o t e n s i n - c o n v e r t i n g e n z y m e g e n e o c c u r s i n v e r y l o w f r e q u e n c y i n A u s t r a l i a n A b o r i g i n a l s . N e p h r o l . D i a l . T r a n s p l a n t . 14 (4), 8 8 7 -890. L i g g e t t , S. B . a n d R a y m o n d , J. R. ( 1 9 9 5 ) . P h a r m a c o l o g y a n d m o l e c u l a r b i o l o g y o f a d r e n e r g i c r e c e p t o r s . B a i l l i e r e ' s C l i n . E n d o c r i n . M e t . 7 (2), 2 7 9-306. L i g g e t t , S. B., W a g o n e r , L . E., C r a f t , L . L., H o r n u n g , R. W., H o i t , B . D., M c i n t o s h , T. C. a n d W a l s h , R. A . ( 1 9 9 8 ) . T h e I l e l 6 4 8 2 - a d r e n e r g i c r e c e p t o r p o l y m o r p h i s m a d v e r s e l y a f f e c t s t h e o u t c o m e o f c o n g e s t i v e h e a r t f a i l u r e . J. C l i n . I n v e s t . 102 (8), 1 534-1539. L o w e , G . D. O., F o w k e s , F. G. R., D a w e s , J., D o n n a n , P. T., L e n n i e , M . I. a n d H o u s l e y , E . ( 1 9 9 3 ) . B l o o d v i s c o s i t y , f i b r i n o g e n a n d a c t i v a t i o n o f c o a g u l a t i o n a n d l e u k o c y t e s i n p e r i p h e r a l a r t e r i a l d i s e a s e a n d t h e n o r m a l p o p u l a t i o n i n t h e E d i n b u r g h A r t e r y S t u d y . C i r c u l a t i o n #7(6) 1 9 1 5 - 1 9 2 0 . L y n c h , T . F . ( 1 9 8 3 ) . T h e P a l e o - I n d i a n s . I n A n c i e n t S o u t h A m e r i c a n s , J. D . J e n n i n g s , ed. ( N e w Y o r k : W.H. F r e e m a n a n d C o . ) , pp. 87-138. L y n c h , T. F. ( 1 9 9 0 ) . G l a c i a l - a g e m a n i n S o u t h A m e r i c a ? A c r i t i c a l r e v i e w . A m . A n t i q u i t y 55, 12-36. M a c N e i s h , R. S. ( 1 9 7 6 ) . E a r l y m a n i n t h e N e w W o r l d . A m . S c i e n t i s t 64, 3 1 6 - 3 2 7 . M a c N e i s h , R.S. ( 1 9 7 1 ) . E a r l y m a n i n t h e A n d e s . S c i . A m . 224, 34-46. M a r t i n , P. S. ( 1 9 7 3 ) . T h e d i s c o v e r y o f A m e r i c a . S c i e n c e 179, 969-91A. M a r t i n e z , F. D., G r a v e s , P. E., B a l d i n i , M., S o l o m o n , S. a n d E r i c k s o n , R. ( 1 9 9 7 ) . A s s o c i a t i o n b e t w e e n g e n e t i c p o l y m o r p h i s m s o f t h e 8 2 - a d r e n o c e p t o r a n d r e s p o n s e t o a l b u t e r o l i n c h i l d r e n w i t h a n d w i t h o u t a h i s t o r y o f w h e e z i n g . J. C l i n . I n v e s t . 100 (12), 3 1 8 4 - 3 1 8 8 . M a y e r , G . A., F r i d r i c h , J., N e w e l l , J. a n d S z i v e k , J. ( 1 9 6 6 ) . P l a s m a c o m p o n e n t s a n d b l o o d v i s c o s i t y . B i o r h e o l o g y 3, 177-182. M e i r h a e g h e , A., H e l b e c q u e , N , C o t t e l , D. a n d A m o u y e l , P. ( 1 9 9 9 ) . 8 2 - a d r e n o c e p t o r g e n e p o l y m o r p h i s m , b o d y w e i g h t a n d p h y s i c a l a c t i v i t y . L a n c e t 253, 896. 104 M e l t o n , T. W. ( 1 9 9 2 ) . C o m p a r i s o n o f g r o w t h a n d d e v e l o p m e n t i n t w o P e r u v i a n p o p u l a t i o n s o f h i g h a l t i t u d e a n c e s t r y . I n P o p u l a t i o n s t u d i e s o n h u m a n a d a p t a t i o n a n d e v o l u t i o n i n t h e P e r u v i a n A n d e s , R. B . E c k h a r d t a n d T. W. M e l t o n , eds. ( U n i v e r s i t y P a r k : P e n n s y l v a n i a S t a t e U n i v e r s i t y ) , pp. 1 9 2 - 2 1 9 . M i l l e d g e , J. S. a n d C o t e s , P. M . ( 1 9 8 5 ) . S e r u m e r y t h r o p o i e t i n i n h u m a n s at h i g h a l t i t u d e a n d its r e l a t i o n t o p l a s m a r e n i n . J. A p p l . P h y s i o l . 59 (2), 3 60-364. M i l l e r , S. A., D y k e s , D . D. a n d P o l e s k y , H. F. ( 1 9 8 8 ) . A s i m p l e s a l t i n g o u t p r o c e d u r e f o r e x t r a c t i n g D N A f r o m h u m a n n u c l e a t e d c e l l s . N u c l . A c i d s R e s . 16, 1215. M o n g e , C . a n d L e o n - V e l a r d e , F. ( 1 9 9 1 ) . P h y s i o l o g i c a l a d a p t a t i o n t o h i g h a l t i t u d e : o x y g e n t r a n s p o r t i n m a m m a l s a n d b i r d s . P h y s i o l . R e v . 71 (4), 1135-1172. M o n g e - C , C , A r r e g u i , A . a n d L e o n - V e l a r d e , F. ( 1 9 9 2 ) . P a t h o p h y s i o l o g y a n d e p i d e m i o l o g y o f c h r o n i c m o u n t a i n s i c k n e s s . Int. J. S p o r t s . M e d . 13 ( s u p p l . 1), S 7 9 - S 8 1 M o n s a l v e , M . V., G r o o t d e R e s t r e p o , H., E s p i n e l , A., C o r r e a l , G . a n d D e v i n e , D. V . ( 1 9 9 4 ) . E v i d e n c e o f m i t r o c h o n d r i a l D N A d i v e r s i t y i n S o u t h A m e r i c a n a b o r i g i n a l s . A n n . H u m . G e n e t . 58, 2 6 5 - 2 7 3 . M o n s a l v e , M . V., E d i n , G . a n d D e v i n e , D. V . ( 1 9 9 8 ) . A n a l y s i s o f H L A c l a s s I a n d c l a s s II i n N a -D e n e a n d A m e r i n d i a n p o p u l a t i o n s f r o m B r i t i s h C o l u m b i a , C a n a d a . H u m . I m m u n o . 59 (1), 4 8 -55. M o n s a l v e , M . V., H e l g a s o n , A . a n d D e v i n e , D. V . ( 1 9 9 9 ) . L a n g u a g e s , g e o g r a p h y a n d H L A h a p l o t y p e s i n N a t i v e A m e r i c a n a n d A s i a n p o p u l a t i o n s . Proc. R. Soc. Lond. B. 266, 2 2 0 9 - 2 2 1 6 . M o n t g o m e r y , H. M., C l a r k s o n , P., N w o s e , O. M., M i k a i l i d i s , D . P., J a g r o o p , I. A., D o l l e r y , C , M o u l t , J., B e n h i z i a , F., D e a n f i e l d , J., J u b b , M., W o r l d , M., M c E w a n , J. R., W i n d e r , A . a n d H u m p h r i e s , S. ( 1 9 9 5 ) . T h e a c u t e r i s e i n p l a s m a f i b r i n o g e n c o n c e n t r a t i o n w i t h e x e r c i s e i s i n f l u e n c e d b y t h e G - 4 5 3 - A p o l y m o r p h i s m i f t h e 6 - f i b r i n o g e n gene. A r t e r i o s c h l e r . T h r o m b . V a s e . B i o l . 7 6 , 3 6 8 - 3 9 1 . M o n t g o m e r y , H. M., M a r s h a l l , R., H e m i n g w a y , H., M y e r s o n , S., C l a r k s o n , P., D o l l e r y , C , H a y w a r d , M., H o l l i m a n , D. E., J u b b , M., W o r l d , M., T h o m a s , E . L., B r y n e s , A . E., S a e e d , N., B a r n a r d , M., B e l l , J. D., P r a s a d , K., R a y s o n , M., T a l m u d , P. J. a n d H u m p h r i e s , S. ( 1 9 9 7 a ) . H u m a n g e n e f o r p h y s i c a l p e r f o r m a n c e . N a t u r e 393, 221-222. 105 M o n t g o m e r y , H. M., C l a r k s o n , P., D o l l e r y , C , P r a s a d , K., L o s i , M.-A., H e m i n g w a y , H., Statters, D., J u b b , M., G i r v a i n , M., V a m a v a , A., W o r l d , M., D e a n f i e l d , J., T a l m u d , P., M c E w a n , J. R., M c K e n n a , W. J. a n d H u m p h r i e s , S. ( 1 9 9 7 b ) . A s s o c i a t i o n o f a n g i o t e n s i n - c o n v e r t i n g e n z y m e g e n e I/D p o l y m o r p h i s m w i t h c h a n g e i n l e f t v e n t r i c u l a r m a s s i n r e s p o n s e t o p h y s i c a l t r a i n i n g . C i r c u l a t i o n 96 (3), 7 4 1 - 7 4 7 . M o o r e , L . G., Q u r a n - E v e r e t t , L., D r o m a , T. S., G r o v e s , B . M., M c C u l l o u g h , R. E., M c C u l l o u g h , R. G., S u n , S. F., S u t t o n , J. R., Z a m u d i o , S. a n d Z h u a n g , J. G. ( 1 9 9 2 ) . A r e T i b e t a n s b e t t e r a d a p t e d ? Int. J. S p o r t s M e d . 13, S 8 6 - S 8 8 . M o o r e , L . G., Z a m u d i o , S., C u r r a n - E v e r e t t , L., T o r r o n i , A., J o r d e , L . B., S h o h e t , R. V., T h u p t e n a n d D r o l k a r , T. ( 1 9 9 4 ) . G e n e t i c a d a p t a t i o n t o h i g h a l t i t u d e . I n A d v a n c e s i n E x e r c i s e a n d S p o r t s M e d i c i n e , S. W o o d a n d R. R o a c h , eds. ( N e w Y o r k : M a r c e l D e k k e r Inc. P u b l i s h e r s ) , pp. 2 2 5 -2 6 2 . M u e l l e r , W. H., Y e n , F., R o t h h a m m e r , F. a n d S c h u l l , W. J. ( 1 9 7 8 ) . A m u l t i n a t i o n a l A n d e a n g e n e t i c a n d h e a l t h p r o g r a m : I V . P h y s i o l o g i c a l m e a s u r e m e n t s o f l u n g f u n c t i o n i n a n h y p o x i c e n v i r o n m e n t . H u m . B i o l . 50 ( 4 ) , 4 8 9 - 5 1 3 . N a g i , D. K., F o y , C . A., M o h a m e d - A l i , V., Y u d k i n , J. S., G r a n t , P. J. a n d K n o w l e r , W. C. ( 1 9 9 8 ) . A n g i o t e n s i n - 1 - c o n v e r t i n g e n z y m e ( A C E ) g e n e p o l y m o r p h i s m , p l a s m a A C E l e v e l s a n d t h e i r a s s o c i a t i o n w i t h t h e m e t a b o l i c s y n d r o m e a n d e l e c t r o c a r d i o g r a p h i c c o r o n a r y a r t e r y d i s e a s e i n P i m a I n d i a n s . M e t a b o l i s m 47, 622-626. N e w s h o l m e , E., L e e c h , T. a n d D u e s t e r , G. ( 1 9 9 4 ) . K e e p o n r u n n i n g , t h e s c i e n c e o f t r a i n i n g a n d p e r f o r m a n c e . ( C h i c h e s t e r : J o h n W i l e y a n d S o n s ) . N i a z o v a , Z. A., B a t y r a l i e v , T. A., A i k i m b a e v , K. S., K u d a i b e r d i e v a , G. Z., A k g u l , F., S o o d a n b e k o v a , Y . K. a n d B i r a n d , A . ( 1 9 9 6 ) . H i g h - a l t i t u d e p u l m o n a r y h y p e r t e n s i o n : e f f e c t s o f c a p t o p r i l o n p u l m o n a r y a n d s y s t e m i c a r t e r i a l p r e s s u r e s . J. H u m . H y p e r t e n s . 10 ( S u p p l 3), S 1 4 1 -1422. O p i e , L . H . ( 1 9 9 9 ) . A n g i o t e n s i n c o n v e r t i n g e n z y m e i n h i b i t o r s , 3 r d E d i t i o n ( C a p e T o w n : U n i v e r s i t y o f C a p e T o w n P r e s s ) . P e r c y , M . J., M c M u l l i n , M . F. a n d L a p p i n , T. R. J. ( 1 9 9 7 ) . S e q u e n c e a n a l y s i s o f t h e 3' h y p o x i a -r e s p o n s e e l e m e n t o f t h e h u m a n e r y t h r o p o i e t i n g e n e i n p a t i e n t s w i t h e r y t h r o c y t o s i s . B i o c h e m . M o l . M e d . 62, 132-134. 10 6 P o i r e r , O., G e o r g e s , J.-L., R i c a r d , S., A r v e i l e r , D., R u i d a v e t s , J. B., L u c , G., E v a n s , A., C a m b i e n , F. a n d T i r e t , L . ( 1 9 9 8 ) . N e w p o l y m o r p h i s m s o f t h e a n g i o t e n s i n II t y p e 1 r e c e p t o r g e n e a n d t h e i r a s s o c i a t i o n s w i t h m y o c a r d i a l i n f a r c t i o n a n d b l o o d p r e s s u r e : t h e E C T I M s t u d y . J. H y p e r t e n s i o n 16, 1 4 4 3 - 1 4 4 7 . R a m i r e z , G., B i t t l e , P. A., R o s e n , R., R a b b , H . a n d P i n e d a , D . ( 1 9 9 9 ) . H i g h a l t i t u d e l i v i n g : g e n e t i c a n d e n v i r o n m e n t a l a d a p t a t i o n . A v i a t . S p a c e E n v i r o n . Med.7 0 ,73-81. R e i h s a u s , M., I n n i s , M., M a c l n t y r e , N . a n d L i g g e t , S. B . ( 1 9 9 3 ) . M u t a t i o n s i n t h e g e n e e n c o d i n g f o r t h e B 2 - a d r e n e r g i c r e c e p t o r i n n o r m a l a n d a s t h m a t i c s u b j e c t s . A m . J. R e s p i r . C e l l M o l . B i o l . 8 ( 1 ) , 3 3 4 - 3 3 9 . R i e d e r , M . J., T a y l o r , S. L., C l a r k , A . G. a n d N i c k e r s o n , D . A . ( 1 9 9 9 ) . S e q u e n c e v a r i a t i o n i n t h e h u m a n a n g i o t e n s i n c o n v e r t i n g e n z y m e . N a t . G e n e t . 22, 59-62. R i g a t , B., H u b e r t , C , A l h e n c - G e l a s , F., C a m b i e n , F., C o r v o l , P. a n d S o u b r i e r , F. ( 1 9 9 0 ) . A n i n s e r t i o n / d e l e t i o n i n t h e a n g i o t e n s i n I - c o n v e r t i n g e n z y m e g e n e a c c o u n t i n g f o r h a l f t h e v a r i a n c e o f s e r u m e n z y m e l e v e l s . J. C l i n . I n v e s t . 86, 1343-1346. R i s c h , N . a n d M e r i k a n g a s , K . ( 1 9 9 6 ) . T h e f u t u r e o f g e n e t i c s t u d i e s o f c o m p l e x h u m a n d i s e a s e s . S c i e n c e 273, 1 5 1 6 - 1 5 1 7 . R o s a t t o , N., P o n t r e m o l i , R., D e F e r r a r i , G . a n d R a v a z z o l o , R. ( 1 9 9 9 ) . I n t r o n 16 i n s e r t i o n o f t h e a n g i o t e n s i n c o n v e r t i n g e n z y m e g e n e a n d t r a n s c r i p t i o n a l r e g u l a t i o n . N e p h r o l . D i a l . T r a n s p l a n t . 14 ( 4 ) 8 6 8 - 7 1 . R o t h h a m m e r , F. a n d S i l v a , C . ( 1 9 8 9 ) . P e o p l i n g o f A n d e a n S o u t h A m e r i c a . A m . J. P h y s . A n t h r o . 78, 4 0 3 - 4 1 0 . R u h l e n , M . ( 1 9 9 8 ) . T h e o r i g i n o f t h e N a - D e n e . P r o c . N a t . A c a d . S c i . ( U S A ) 95, 1 3 9 9 4 - 1 3 9 9 6 . R u p e r t , J. L., D e v i n e , D . V., M o n s a l v e , M . V . a n d H o c h a c h k a , P. W. ( 1 9 9 9 ) . A n g i o t e n s i n -c o n v e r t i n g e n z y m e ( A C E ) a l l e l e s i n t h e Q u e c h u a , a h i g h a l t i t u d e S o u t h A m e r i c a n n a t i v e p o p u l a t i o n . A n n . H u m . B i o l . 26 (4), 3 7 5 - 3 8 0 . S a g n e l l a , G . A., R o t h w e l l , M . J., O n i p i n l a , A . K., W i c k s , P. D., C o o k , D. G. a n d C a p p u c c i o , F. P. (1 9 9 9 ) . A p o p u l a t i o n s t u d y o f e t h n i c v a r i a t i o n s i n t h e a n g i o t e n s i n - c o n v e r t i n g e n z y m e I/D 107 p o l y m o r p h i s m : r e l a t i o n s h i p s w i t h g e n d e r , h y p e r t e n s i o n a n d i m p a i r e d g l u c o s e m e t a b o l i s m . J. H y p e r t e n s . 7 7 ( 5 ) , 6 5 7 - 6 6 4 . S a h a , N., T a l m u d , P. J., H u m p h r i e s , S. E . a n d B a s i a r , J. ( 1 9 9 6 ) . L a c k o f a s s o c i a t i o n o f a n g i o t e n s i n - c o n v e r t i n g e n z y m e (ACE). G e n e i n s e r t i o n / d e l e t i o n p o l y m o r p o h i s m w i t h C A D i n t w o A s i a n p o p u l a t i o n s . C l i n . G e n e t . 5 0 , 121-125. S a l z a n o , F. a n d C a l l e g a r i - J a c q u e s , S. M . ( 1 9 8 8 ) . S o u t h A m e r i c a n I n d i a n s : A c a s e s t u d y i n e v o l u t i o n ( O x f o r d : C l a r e n d o n P r e s s ) . S a m a j a , M . ( 1 9 9 7 ) . B l o o d g a s t r a n s p o r t at h i g h a l t i t u d e . R e s p i r a t i o n 64, 4 2 2 - 4 2 8 . S c h m e l z e r , C . H., E b e r t , R. F. a n d B e l l , W.R. ( 1 9 8 8 ) . A p o l y m o r p h i s m at BBug o f f i b r i n o g e n i d e n t i f i e d d u r i n g s t r u c t u r a l s t u d i e s o f f i b r i n o g e n B a l t i m o r e H. T h r o m b . R e s . 52, 113-171. S c h n e i d e r , S., K u e f f e r , J.-M., R o e s s l i , D. a n d E x c o f f i e r , L . ( 1 9 9 7 ) . A r l e q u i n , ver. 1.1 ( G e n e v a , S w i t z e r l a n d : G e n e t i c s a n d B i o m e t r y L a b o r a t o r y U n i v e r s i t y o f G e n e v a ) . S c h o e n e , R. B., R o a c h , R. B., L a h i r i , S., P e t e r s Jr., R.M., H a c k e t t , P.H. a n d S a n t o l a y a , R. ( 1 9 9 0 ) . I n c r e a s e d d i f f u s i o n c a p a c i t y m a i n t a i n s a r t e r i a l s a t u r a t i o n d u r i n g e x e r c i s e i n t h e Q u e c h u a I n d i a n s o f C h i l e a n A l t i p l a n o . A m . J. H u m . B i o l . 2, 663-668. S c h u n k e r t , H . ( 1 9 9 7 ) . P o l y m o r p h i s m o f t h e a n g i o t e n s i n - c o n v e r t i n g e n z y m e g e n e a n d c a r d i o v a s c u l a r d i s e a s e . J. M o l . G e n . 75, 8 6 7 - 8 7 5 . S e m e n z a , G . L., L a d i a s , J. A . A . a n d S., A . ( 1 9 8 7 ) . A n Xba I p o l y m o r p h i s m 3' t o t h e h u m a n e r y t h r o p o i e t i n ( E P O ) g e n e . N u c l . A c i d s R e s . 7 5 ( 1 6 ) , 6 7 6 8 . S i e g e l , S. a n d C a s t e l l a n Jr., N . J. ( 1 9 8 8 ) . N o n p a r a m e t r i c s t a t i s t i c s f o r t h e b e h a v i o r a l s c i e n c e s , 2 n d E d i t i o n ( N e w Y o r k : M c G r a w - H i l l B o o k C o m p a n y ) . S p i t z , E., M o u t i e r , R., R e e d , T., B u s n e l , M . C , M a r c h a l a n d , C , R o u b e r t o u x , P. L . a n d C a r l i e r , M . ( 1 9 9 6 ) . C o m p a r a t i v e d i a g n o s i s o f t w i n z y g o s i t y b y S S L P v a r i a n t a n a l y s i s , q u e s t i o n n a i r e a n d d e r m a t o g l y p h i c a n a l y s i s . B e h a v i o r G e n . 26(1), 55-63. S p r a y c a r , M . ( 1 9 9 5 ) . Stedman's M e d i c a l D i c t i o n a r y ( B a l t i m o r e : W i l l i a m s a n d W i l k i n s ) . 108 S t a r i k o v s k a y a , Y . B., S u k e r n i k , R. I., S c h u r r , T. G., K o g e l n i k , A . M . a n d W a l l a c e , D . C. (1 9 9 8 ) . m t D N A d i v e r s i t y i n C h u k c h i a n d S i b e r i a n E s k i m o s : I m p l i c a t i o n s f o r t h e g e n e t i c h i s t o r y o f a n c i e n t B e r i n g i a a n d t h e p e o p l i n g o f t h e N e w W o r l d . A m . J. H u m . G e n e t . 63, 1473-1491. S u n , S., D r o m a , T., Z h a u n g , J. G., T a o , J. X., H u a n g , S. Y., M c C u l l o u g h , R. G., M c C u l l o u g h , R. E., R e e v e s , C. S., R e e v e s , J. T. a n d M o o r e , L . G . ( 1 9 9 0 ) . G r e a t e r m a x i m a l 0 2 u p t a k e s a n d v i t a l c a p a c i t i e s i n T i b e t a n t h a n H a n r e s i d e n t s o f L h a s a . R e s p . P h y s i o l . 79, 151-162. S z o m b a t h y , T., S z a l a i , C , K a t a l i n , B., P a l i c z , T., R o m i c s , L . a n d C s a s z a r , A . (1 9 9 8 ) . A s s o c i a t i o n o f a n g i o t e n s i n II t y p e 1 r e c e p t o r p o l y m o r p h i s m w i t h r e s i s t a n t e s s e n t i a l h y p e r t e n s i o n . C l i n i c a . C h i m i c a . A c t a 269,91-100. T a n a h a s h i , N., G o t o h , F., T o m i t a , M., S h i n o h a r a , T., T e r a y a m a , Y., M i h a r a , B., O h t a , K. a n d N a r a , M . ( 1 9 8 9 ) . E n h a n c e d e r y t h r o c y t e a g g r e g a b i l i t y i n o c c l u s i v e c e r e b r o c a s c u l a r d i s e a s e . S t r o k e 20 ( 9 ) , 1 2 0 2 - 1 2 0 7 . T h o m a s , A., G r e e n , F., C r u i k s h a n k , K. a n d H u m p h r i e s , S. ( 1 9 9 1 ) . T h e Hae U J a n d HinD IH p o l y m o r p h i s m s o f t h e 8 f i b r i n o g e n g e n e : r a c i a l d i f f e r e n c e s i n f r e q u e n c y a n d a s s o c i a t i o n . X U I C o n g . Int. S o c . T h r o m b . a n d H e a m . A b s t r a c t 709, 897. T h o m a s , A., L a m l u m , H., H u m p h r i e s , S. a n d G r e e n , F. ( 1 9 9 4 ) . L i n k a g e d i s e q u i l i b r i u m a c r o s s t h e f i b r i n o g e n l o c u s as s h o w n b y f i v e g e n e t i c p o l y m o r p h i s m s , G / A - 4 5 5 (HaeHl), C / T - 1 4 8 (HindllUAlul), T / G ( A v a i l ) a n d Bell ( 8 - f i b r i n o g e n ) a n d Taql ( a - f i b r i n o g e n ) a n d t h e i r d e t e c t i o n b y P C R . H u m . M u t . 3, 79-81. T h o m a s , C . L . ( 1 9 9 3 ) . T a b e r ' s C y c l o p e d i c M e d i c a l D i c t i o n a r y ( P h i l a d e l p h i a : F.A. D a v i s C o m p a n y ) . T i r e t , L., R i g a t , B., V i s v i k i s , S., B r e d a , C , C o r v o l , P., C a m b i e n , F. a n d S o u b r i e r , F. ( 1 9 9 2 ) . E v i d e n c e , f r o m c o m b i n e d s e g r e g a t i o n a n d l i n k a g e a n a l y s i s , that a v a r i a n t o f t h e a n g i o t e n s i n 1 -c o n v e r t i n g e n z y m e ( A C E ) g e n e c o n t r o l s p l a s m a A C E l e v e l s . A m . J. H u m . G e n e t . 51,197-205. T i r e t , L., B o n n a r d e a u x , A., P o i r i e r , O., R i c a r d , S., M a r q u e s - V i d a l , P., E v a n s , A., A r v e i l e r , D., L u c , G., K e e , F., D u c i m e t i e r e , P., S o u b r i e r , F. a n d C a m b i e n , F . ( 1 9 9 4 ) . S y n e r g i s t i c e f f e c t s o f a n g i o t e n s i n - c o n v e r t i n g e n z y m e a n d a n g i o t e n s i n - ! ! t y p e 1 r e c e p t o r g e n e p o l y m o r p h i s m s o n r i s k o f m y o c a r d i a l i n f a r c t i o n . L a n c e t 344 ( 8 9 2 7 ) , 9 1 0 - 9 1 3 . 1 0 9 T u r k i , J., P a k , J., G r e e n , S., M a r t i n , R. a n d L i g g e t t , S. B . ( 1 9 9 5 ) . G e n e t i c p o l y m o r p h i s m s o f t h e 8 2 - a d r e n e r g i c r e c e p t o r i n n o c t u r n a l a n d n o n n o c t u r n a l a s t h m a . A m . J. C e l l M o l . B i o l . 13, 25-33. U m e m u r a , S., K a w a s a k i , T., I s h i g a m i , T., F u j i t a , T., H i b i , K., K a w a s a k i , M., Itoh, K., Y o s h i m i z u , Y., O g a k i , T., A c h a r y a , G . P. a n d I s h i i , M . ( 1 9 9 8 ) . A n g i o t e n s i n - c o n v e r t i n g e n z y m e g e n e p o l y m o r p h i s m i n N e p a l . J. H u m . H y p e r t e n s . 12 (8) 5 2 7 - 3 1 . V a j o , Z., C r u z , E., S z e k a c s , B . a n d D a c h m a n , W. ( 1 9 9 8 ) . D e c r e a s e d b e t a 2 a d r e n e r g i c m e d i a t e d v e n o d i l a t a t i o n i n N a t i v e A m e r i c a n s . Int. A n g i o l . 17 (4), 276-281. V e l a s q u e z , T. ( 1 9 7 6 ) . P u l m o n a r y f u n c t i o n a n d o x y g e n t r a n s p o r t . I n M a n i n t h e A n d e s , P. T. B a k e r a n d M . A . L i t t l e , eds. ( S t r o u d s b u r g , P e n n s y l v a n i a : D o w d e n , H u c h i n s o n a n d R o s s , Inc.), pp. 2 3 7 - 2 6 0 . V i n c e n t , J., H e l l o t , M . F., V a r g a s , E., G a u t i e r , H., P a s q u i s , P. a n d L e F r a n c o i s , R. ( 1 9 7 8 ) . P u l m o n a r y g a s e x c h a n g e , d i f f u s i n g c a p a c i t y i n n a t i v e s a n d n e w c o m e r s at h i g h a l t i t u d e . R e s p . P h y s i o l . 5-4,219-231. W a n g , G. L., J i a n g , B.-H., R u e , E . A . a n d S e m e n z a , G. L . ( 1 9 9 5 ) . H y p o x i a - i n d u c i b l e f a c t o r 1 i s a b a s i c - h e l i x - l o o p - h e l i x - P A S h e t e r o d i m e r r e g u l a t e d b y c e l l u l a r o x y g e n t e n s i o n . P r o c . N a t l . A c a d . S c i . ( U S A ) 9 2 (1 2 ) , 5 5 1 0 - 5 5 1 4 . W a n g , W. Y . S., Z e e , R. Y . L . a n d M o r r i s , B . J. ( 1 9 9 7 ) . A s s o c i a t i o n o f a n g i o t e n s i n II t y p e 1 r e c e p t o r g e n e p o l y m o r p h i s m w i t h e s s e n t i a l h y p e r t e n s i o n . C l i n . G e n e t . 57, 31-34. W a r d , M . P., M i l l e d g e , J. S. a n d W e s t , J. B . ( 1 9 9 5 ) . H i g h a l t i t u d e m e d i c i n e a n d p h y s i o l o g y , 2 n d E d i t i o n ( L o n d o n : C h a p m e n a n d H a l l M e d i c a l ) . W a t t , E . W., P i c o n - R e a t e g u i , E., G a h a g a n , H . E . a n d B u s k i r k , E . R. ( 1 9 7 6 ) . D i e t a r y i n t a k e a n d c o r o n a r y r i s k f a c t o r s i n P e r u v i a n Q u e c h u a I n d i a n s . J. A m . D i e t . A s s o c . 68 ( 6 ) , 5 3 5 - 5 3 7 . W a y , A . B . ( 1 9 7 6 ) . M o r b i d i t y a n d p o s t n e o n a t a l m o r t a l i t y . I n M a n i n t h e A n d e s , P. T. B a k e r a n d M . A . L i t t l e , eds. ( S t r o u d s b u r g , P e n n s y l v a n i a : D o w d e n , H u c h i n s o n a n d R o s s , Inc.). W e i r , T. D., M a l l e k , N., S a n d f o r d , A . J., B a i , T. R., A w a d h , N., F i t z g e r a l d , J. M., C o c k c r o f t , D., Ja m e s , A., L i g g e t t , S. B . a n d P a r e , P. D . ( 1 9 9 8 ) . 6 2 - a d r e n e r g i c r e c e p t o r h a p l o t y p e s i n m i l d , m o d e r a t e a n d f a t a l / n e a r f a t a l a s t h m a . A m . J. C r i t . C a r e M e d . 158,787-791. 11 0 W e n k e , R. J. ( 1 9 8 4 ) . P a t t e r n s i n P r e h i s t o r y ( O x f o r d : O x f o r d U n i v e r s i t y P r e s s ) . W h i t t a k e r , K. L . ( 1 9 9 2 ) . T h e r e l a t i o n s h i p o f f o r c e d v i t a l c a p a c i t y t o m o r p h o l o g y a n d f a t - f r e e m a s s i n h i g h a l t i t u d e a d u l t A y m a r a m e n . I n P o p u l a t i o n s t u d i e s o n h u m a n a d a p t a t i o n a n d e v o l u t i o n i n t h e P e r u v i a n A n d e s , R. B . E c k h a r d t a n d T. W. M e l t o n , eds. ( U n i v e r s i t y P a r k : P e n n s y l v a n i a S t a t e U n i v e r s i t y ) , pp. 50-62. W i n s l o w , R. M . a n d M o n g e , C . ( 1 9 8 7 ) . H y p o x i a , p o l y c y t h e m i a a n d c h r o n i c m o u n t a i n s i c k n e s s ( B a l t i m o r e : J o h n H o p k i n s U n i v e r s i t y ) . W o l f e l , E . E., S e l l a n d , M . A., M a z z e o , R. S. a n d R e e v e s , J. T. ( 1 9 9 4 ) . S y s t e m i c h y p e r t e n s i o n at 4,300 m i s r e l a t e d t o s y m p a t h o a d r e n a l a c t i v i t y . J. A p p l . P h y s i o l . 76 (4), 1643-1650. X u , J., W i e s c h , D.G. a n d M e y e r s , D.A. ( 1 9 9 8 ) G e n e t i c s o f c o m p l e x h u m a n d i s e a s e s : g e n o m e s c r e e n i n g , a s s o c i a t i o n s t u d i e s a n d f i n e m a p p i n g . C l i n . E x p . A l l e r g y 28 ( s u p p l . 5), 1-5. Y u , S., S h e r , B., K u d r y k , B . a n d R e d m a n , C . M . ( 1 9 8 4 ) . F i b r i n o g e n p r e c u r s o r s : O r d e r o f a s s e m b l y o f f i b r i n o g e n c h a i n s . J. B i o l . C h e m . 259 (16), 1 0 5 7 4 - 1 0 5 8 1 . Z h a n g , Y . a n d T y c k o , B . ( 1 9 9 2 ) . M o n o a l l e l i c e x p r e s s i o n o f t h e h u m a n H19 gene. N a t . G e n e t . 1, 40-44. I l l Appendix i. I n f o r m a t i o n f o r m Questionnaire for High Altitude Native Study Donor Information Name: L.I.N. Last First • M.I. Sex: | | | Age: [J~J M F Years Is the Donors General Health Good?: | | | [ Yes No Does the donor have a history of heart disease?: | | | | Smoking history: Non-smoker: | | Yes No Smokes: | | Former smoker - years since stopped smoking: | | 1-5 cigarettes per day: [~| 5-15 cigarettes per day: ("J (check one box) more than 15 cigarettes per day: • Place of residence: Place of birth: Occupati on: Has the donor spent more than 24 hours at an altitude greater than 1000M above their home in the last year?: | | | How much time?: [ | yes no days Has the donor spent more than 24 hours at an altitude greater than 1000M below | || | How much time?: | | yes no days their home in the last year?: Sample volume: Date taken: Time taken: | | | | mis. Day Mo. Year Hour AM/PM To be filled out in lab. Lab identification number: Comments: Date recieved: J.L.R 30/4/98 112 Appendix i i . P C R p r i m e r s e q u e n c e s . A l t e r n a t e b a s e s i n d e g e n e r a t e p r i m e r s a r e u n d e r l i n e d a n d i n b o l d f a c e . A l l p r i m e r s w e r e p r e p a r e d b y N A P S at U.B.C. A n g i o t e n s i n 2 r e c e p t o r t y p e 1 g e n e P r i m e r S e q u e n c e P r i m e r S e q u e n c e A T 2 R 1 - 3 5' A T A A T G T A A G C T C A T C C A C C 3 ' A T 2 R 1 - 4 5' G A G A T T G C A T T T C T G T C A G T 3 ' A n g i o t e n s i n c o n v e r t i n g e n z y m e ( A C E ) g e n e P r i m e r S e q u e n c e P r i m e r S e q u e n c e A C E - 1 5' C A T C C T T T C T C C C A T T T C T C 3 ' A C E - 2 5' T G G G A T T A C A G G C G T G A T A C A G 3 ' A C E - 3 5' A T T T C A G A G C T G G A A T A A A A T T 3* E r y t h r o p o i e t i n g e n e P r i m e r S e q u e n c e P r i m e r S e q u e n c e E p o - l 5 ' G C G C C C C A G G T C G C T G A G 3' E p o - 2 5' C A C C A A C A T T G C T T G T G C C A C 3' E p o - 3 5' A C C A G G T G T G T C C A C C T G G 3 ' E p o - 4 5' C C C A G G G C A A G G C T G C A G 3' E p o - 5 5' C C T G G C C C T G C T G T C G G A A 3 ' E p o - 6 5' A A C T C T T C C C A G C C G T G G G 3 ' E p o - 7 5 ' T A C C T G T T T T C G C A C C T A C C 3' E p o - 8 5 ' G G A G A A C T T A G G T G G C A A G C 3' E p o - 9 5' A A G C T G A A G C T G T A C A C A G G 3' E p o - 1 0 5' A G G A G G G A G A G G G T G A C A T 3' E p o - l 1 5 ' T C C C T C C C C G C C T G A C T C T 3 ' E p o - l 2 5 ' A T C T C A T T T G C G A G C C T G A T 3 ' E p o - 1 3 5' C A G G G C C C G G G A G C A G C C 3' E p o - 1 4 5' G G T C C C T G T T T G A G C G G G 3' E p o - 1 5 5' G A T T T A G C G C C C C G G C T A TV 3 ' E p o - 1 6 5' A G T T C C T T T T T T T T T T T T T T T C C 3 ' E p o - 1 7 5' G A T G G A G G T G A G T T C C T T T T 3 ' E p o - N l a 5' T C C A A A T C C C C T G G C T C T G 3' E p o - B b v 5 ' C T G C A T T C A A G G C C T C A C C C 3 ' E p o - M a e 5' C A G G T C C A G G T C C G G G T A A 3 ' 113 A p p e n d i x i i ( c o n t i n u e d ) . P C R p r i m e r s e q u e n c e s B 2 - a d r e n e r g i c r e c e p t o r g e n e P r i m e r S e q u e n c e P r i m e r S e q u e n c e fi2AR-46Nco 5' CCTTCT TGC TGG CAC CCC AT 3' 62AR-P2a 5' CCA GCA CAT TGC CAA ACA CG 3' 62AR-P1 5' CGT GGG TCC GCC TGC TGA 3' 62AR-P1A 5' ACC AGC ACA TTG CCA AAC AC 3' 62AR-P2 5' CAC AGG GTC TCA ATG CTG GC 3' B2AR-P3 5' CCC ATA TTC TTA TGA AAA TG 3' 62AR-P4 5' GCC CTC AGA TTTGTC AAT CT 3' B2AR-P5 5' CAT GGT CTT CGT CTA CTC CA 3' 62AR-P6 5' CCG TTG CTG GAG TAG CCA TT 3' B2AR-P7 5' GAT AAC CTC ATC CGT AAG GA 3' B2AR-P8 5' TTA GTC TGT TTA GTG TTC TGT 3' B - f i b r i n o g e n g e n e P r i m e r S e q u e n c e P r i m e r S e q u e n c e Fib-1A 5' ATT GAG TCA CGA TTT TAG TG 3' Fib-IB 5' GAA ATG GTT ACC TTT CCT TA 3' Fib-1 Arev 5' CAC TAA AAT CGT GAC TCA TT 3' Fib-lC 5' AAG GGT CTT TCT GAT GTG TA 3' Fib-B6 5' GGG ACA TGG CAA AGC ATG G 3' Fib-B7 5' GGT GAG CAA GAG AAA TGA AG 3' H y p o x i a i n d u c i b l e f a c t o r - 1 a l p h a ( H I F - l a ) g e n e P r i m e r S e q u e n c e P r i m e r S e q u e n c e HIF-la-Sl 5' GTG AAG ACA TCG CGG GGA 3' HIF-la-S2 5' CAG GAT GCT TGC CAA AAG AG 3' HIF-la-S3 5' TCA TGC TTT GGA CTC TGA TC 3' HIF-ltx-S4 5' TTC CAG TTA CGT TCC TTC GA 3' HIF-la-S5 5' CTC AGG ACA CAG ATT TAG AC 3' HIF-la-S6 5' CTC ACT ACC TAA AGC AGT CT 3' HIF-la-S7 5' CAA ACT GAG TTA ATC CCA TG 3' HIF-la-S7rev 5' CAT GGG ATT AAC TCA GTT TG 3' HIF-la-S8 5' GCA ACT TGA GGA AGT ACC AT 3' HIF-la-S8rev 5' GCA ACT TGA GGA AGT ACC AT 3' HIF-la-S9 5' ACT ACA GTT CCT GAG GAA GA 3' HIF-la-S9rev 5' ACT ACA GTT CCT GAG GAA GA 3' HIF-la-SlO 5' CTT ACC ATC AGC TAT TTG CG 3' HIF-la-Sll 5' GAC AAA CTT AAG AAG GAA CC 3' 114 A p p e n d i x i i i . D N A s e q u e n c e s a) A l i g n m e n t o f t h e D N A s e q u e n c e o f t h r e e r e g i o n s o f t h e B - f i b r i n o g e n g e n e s e q u e n c e d f r o m a c h i m p a n z e e (Pan troglodytes) c e l l l i n e a n d p r e v i o u s l y p u b l i s h e d h u m a n s e q u e n c e s . V e r t i c a l b a r s i n d i c a t e c o n s e n s u s b e t w e e n b o t h s e q u e n c e s . S m a l l c a s e d e n o t e s u n t r a n s l a t e d s e q u e n c e (5' r e g i o n ) w h e r e a s l a r g e c a s e i s c o d i n g s e q u e n c e . T h e s i t e s o f t h e G/C" 4 5 5, C / T " 1 4 8 a n d G / A 4 4 8 p o l y m o r p h i s m s a r e s h o w n . H u m a n s e q u e n c e s a r e 1) h u m a n f i b r i n o g e n b e t a g e n e 5' r e g i o n a n d e x o n 1 ( G e n B a n k a c c e s s i o n n u m b e r X 0 5 0 1 8 ) a n d 2) h u m a n f i b r i n o g e n b e t a - c h a i n m R N A , ( G e n B a n k a c c e s s i o n n u m b e r J 1 0 0 1 2 9 ) , e x o n 8. C h i m p a n z e e s e q u e n c e s a r e a v a i l a b l e t h r o u g h G e n B a n k : a c c e s s i o n n u m b e r s A F 2 0 0 3 5 4 , A F 2 0 0 3 5 5 a n d A F 2 0 0 3 5 6 . Chimp 1 t t c a t a g a a t a g g g t a t g a a t t t g t t a t t t t g t t a t t t t g a t t a a t g t c t a a a a c a a a a g 1 1 1 1 1 1 111111 1 1 1 1 1 1 1 1 1 1 1 1 1 11111111 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1II111111 1 1 1 1 1 60 Humanl 946 1 1 II 1 1 1 1 1 1 1 1 1 1 II 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 t t c a t a g a a t a g g g t a t g a a t t t g t t a t t t t g t t a t t t t g a t t a a t g t c t a a a a c a a a a g 1005 Chimp: 61 a t a a a c a c a t t a t g a t a t a a c a t t a c t a t t g a t t t t a a t g g c c c c t t t t g a a a t a g a a t t 1 1 1 1 1 1 1 1 11 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 II 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 120 Humanl 1006 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 a t a a a c a c a t t a t g a t a t a a c a t t a c t a t t g a t t t t a a t g g c c c c t t t t g a a a t a g a a t t 1065 o/c""5T Chimp: 121 a t g t c a t t g t c a g a a a a c a t a a g c a t t t a t g g t a t a t c a t t 161 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 Humanl 1066 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 a t g t c a t t g t c a g a a a a c a t a a g c a t t t a t g g t a t a t c a t t 1106 Chimp: 1 t t g c c t t g t g a g t a g g t c a a a t t t a c t a a g c t t a g a t t t g t t t t c t c a c a t a t t c t t t c g 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 11 1 1 1 1 II 1 II 1 1 1 1 1 1 60 Humanl 1128 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 t t g c c t t g t g a g t a g g t c a a a t t t a c t a a g c t t a g a t t t g t t t t c t c a c a t a t t c t t t c g 1187 Chimp: 61 g a g c t t g t g t a g t t t c c a c a t t a a t t t a c c a g a a a c a a g a t a c a c a t c t c t c t t t g a g g a 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 120 Humanl 1188 1 1 1 1 1 1 11111111 1 1 1 1 1 1 1 1 1 1 1 1 1 1111111 II 1 1 1 1 1 1 1 1 1 1 1 1 1 1 111111 1 1 1 1 g a g c t t g t g t a g t t t c c a c a t t a a t t t a c c a g a a a c a a g a t a c a c a t c t c t c t t t g a g g a 1247 Chimp: 121 a t g c c c t a a c t t c c c a t c a t t t t g t c c a a t t a a a t g a a t t g a a g a a a t t t a a a g t t t c t a 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 180 Humanl 1248 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 g t g c c c t a a c t t c c c a t c a t t t t g t c c a a t t a a a t g a a t t g a a g a a a t t t a a t g t t t c t a 1307 Chimp: 181 a a c t a g a c c a a c a a a g a a t a a t a g t t g t a t g a c a a g t a a a t a a g t t t t g c t g g g a a g a t g 111111 1 1 1 1 1 1 1 1 1 1 1 1 1 1II1111 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 111 1 1 1 1111111 1 1 1 1 1 240 Humanl 1308 1 1 II II II 1 II II II II II I 1 1 II 1 1 1 1 II I 1 II II II II II II 1 1 II II II 1 1 II II 1 a a c t a g a c c a a c a a a g a a t a a t a g t t g t a t g a c a a g t a a a t a a g c t t t g c t g g g a a g a t g 1367 C/T" 1"? Chimp: 241 t t g c t t a a a t g a t a a a a t g g t t c a g c c a a c a a g t g a a c c a a a a a t t a a a t a t t a a c 296 1 1 1 1 1 1 1 1 1 1 II 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 M 1 1 1 1 1 1 1 Humanl 1368 III i i i i i i i i i i i i i i i i i 1 1 1 1 1 1 1 1 1 1 1 1 l l 1 I I I I I t t g c t t a a a t g a t a a a a t g g t t c a g c c a a c a a g t g a a c c a a a a a t t a a a t a t t a a c 1423 Chimp: 1 GATGATGGTGTAGTATGGATGAATTGGAAGGGGTCATGGTACTCAATGAAGAAGATGAGT 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 60 Human2 1360 1 II 1 II II 1 1 II II II II 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 II II II II II 1 II 1 1 1 1 1 1 1 II 1 GATGATGGTGTAGTATGGATGAATTGGAAGGGGTCATGGTACTCAATGAGGAAGATGAGT 1419 G / A " 8 t 115 A p p e n d i x i i i a c o n t i n u e d . Chimp: 61 ATGAAGATCAGGCCCTTCTTCCCACAGCAATAGTCCCCAATA7AGTAGATTTTTGCTCTTC 120 Mlll l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l l I II I I I II ! M I I I I Human2: 1420 ATGAAGATCAGGCCCTTCTTCCCACAGCAATAGTCCCC^TACGTAGATTTTTGCTCTTC 1479 Chimp: 121 TGTATGTGACAACATTTTTGTACATTATGTTATTGGAATTTTCTTTCATACATTATATTC 180 MIMIMIIIIIMIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIMIIIIII Human2: 1480 TGTATGTGACAACATTTTTGTACATTATGTTATTC 1539 Chimp: 181 CTCTAAAACTCTCAAGCAGACGTGAGTGTGACTTTTTGAAAAAAGTATAGGATAAATTAC 240 Ml IIII Ml II111 lllll liiil I lliil Nil 11II11 III 11 Mil 111 III III Human2: 1540 CTCTAAAACTCTCAAGCAGACGTGAGTGTGACTTTT^ 1599 Chimp: 241 ATTAAAATA 249 lllllllll Human2: 1600 ATTAAAATA 1608 116 A p p e n d i x i i i . D N A s e q u e n c e s ( c o n t i n u e d ) b ) S e q u e n c e o f t h e G 2 - a d r e n e r g i c r e c e p t o r g e n e i n t h r e e Q u e c h u a s p e a k i n g n a t i v e s . D N A s e q u e n c e o f t h r e e Q u e c h u a are a l i g n e d w i t h t h e s e q u e n c e d p u b l i s h e d i n ( K o b i l k a et al, 1987) ( G e n B a n k a c c e s s i o n n u m b e r M l 5 1 6 9 ) . N u m b e r i n g starts at t h e t r a n s l a t i o n start site, t h e c o d i n g s e q u e n c e i s i n u p p e r c a s e l e t t e r s . T h e i n i t i a t i o n c o d o n a n d t e r m i n a t i o n c o d o n s ar e i n b o l d f a c e . K n o w n p o l y m o r p h i c s i t e s a r e u n d e r l i n e d a n d t h o s e d e s c r i b e d i n t h e t e x t a r e i n d i c a t e d b y a n a r r o w . A l l d i s c r e p a n c i e s b e t w e e n s e q u e n c e s o c c u r at k n o w n p o l y m o r p h i c s i t e s . H e t e r o z y g o s i t y i s i n d i c a t e d u s i n g D N A d e g e n e r a t e c o d e ( R = A / G , M = A / C a n d Y = T / C ) P o l y m o r p h i s m s n o t d e s c r i b e d i n t h e t e x t a r e d e s c r i b e d i n ( R e i h s a u s et al, 1993). Q u e c h u a s e q u e n c e s are a v a i l a b l e t h r o u g h G e n B a n k , a c c e s s i o n n u m b e r s A F 1 6 9 2 2 5 , A F 2 0 2 3 0 5 a n d A F 2 0 3 3 8 6 . K o b i l k a , 87: Quechua 1 Quechua 2 Quechua 3 -30 ccagtgcgcttacctgccagactgcgcgccATGGGGCAACCCGGGAACGGCAGCGCCTTC 30 1111111111111 M 1111111 M 11111IIMI111:<1: m:| 111! 1111:1111 c c a g t g c g c t t a c c t gccagac tgcgcgccATGGGGCAACCCGGGAACGGCAGCGCCTTC tgc cagac t gc gc gc cATGGGGCAACCCGGGAACGGCAGCGCCTTC gcgcttacctgccagactgcgcgccATGGGGCAACCCGGGAACGGCAGCGCCTTC K o b i l k a , 87: 31 T T G C T G G C A C C a ^ T A G A A G C C A T G C G C C G G A C C A C G A C G T C A C G C A G C A A A G G G A C G A G 90 Quechua 1 Quechua 2 Quechua 3 TTGCTGGCACCCAATRGAAGCCATGCGCCGGACCACGACGTCACGCAGCAAAGGGACGAG TTGCTGGCACCCAATGGAAGCCATGCGCCGGACCACGACGTCACGCAGCAAAGGGACGAG TTGCTGGCACCCAATGGAAGCCATGCGCCGGACCACGACGTCACGCAGCAAAGGGACGAG A / G 1 £ T C / G 7 9 T K o b i l k a , 87: 91 GTGTGGGTGGTGGGCATGGGCATCGTCATGTCTCTCATC 150 Quechua 1 Quechua 2 Quechua 3 GTGTGGGTGGTGGGCATGGGCATCGTC^TGTCTC GTGTGGGTGGTGGGCATGGGCATCGTC^TGTCTCTCATCGTCCTGGCCATCGTC GTGTGGGTGGTGGGCATGGGCATCGTCATGTCTCTCATC K o b i l k a , 87: 151 AATGTGCTGGTCATCACAGCCATTGCCAAGTTCGAGCGTCTGCAGACGGTCACCAACTAC 210 Quechua 1 Quechua 2 Quechua 3 AATGTGCTGGTCATCACAGCCATTGCCAAGTTCGAGCGTCTGCAGACGGTCACCAACTAC AATGTGCTGGTCATCACAGCCATTGCCAAGTTCGAGCGTCTGCAGACGGTCACCAACTAC AATGTGCTGGTCATCACAGCCATTGCCAAGTTCGAGCGTCTGCAGACGGTCACCAACTAC K o b i l k a , 87 : 211 TTCATCACTTCACTGGCCTGTGCTGATCTG^ 270 Quechua 1 Quechua 2 Quechua 3 TTCATCACTTCACTGGCCTGTGCTGATCTGGTCA TTCATCACTTCACTGGCCTGTGCTGATCTGGTCATGGGCCTAGCAGTGGTGCC TTCATCACTTCACTGGCCTGTGCTGATCTGGTC^ G / A 2 5 2 T 117 A p p e n d i x i i i b c o n t i n u e d Kobilka, 87: 271 GCCGCCCATATTCTTATGAAAATGTGGACTTTTGGCAACTTCTGGTGCGA 330 Quechua 1 Quechua 2 Quechua 3 GCCGCCCATATTCTTATGAAAATGTGGACTTTTGG^ GCCGCCCATATTCTTATGAAAATGTGGAC^ GCCGCCCATATTCTTATGAAAATGTGGACTTTTGGCAACTT^ Kobilka, 87: 331 TCCATTGATGTGCTGTGCGTCACGGCCAGCATTGAGACCCTGTGCGTGATCGCAGTGGAT 390 Quechua 1 Quechua 2 Quechua 3 TCCATTGATGTGCTGTGCGTCACGGCCAGCATTGAGACCCTGTGCGTGATCGCAGTGGAT TCCATTGATGTGCTGTGCGTCACGGCCAGCATTGAGACCCTGTGCGTGATCGCAGTGGAT TCCATTGATGTGCTGTGCGTCACGGCCAGCATTGAGACCCTGTGCGTGATCGCAGTGGAT Kobilka, 87: 391 CGCTACTTTGCCATTACTTCACCTTTCAAGT^CAGAGCCTGCTGACCAAGAATAAGGCC 450 Quechua 1 Quechua 2 Quechua 3 CG<:TACTTTGCCATTACTTCACCTTTCAAGT^CAGAGCCTGCTGACCAAGAATAAGGCC CGCTACTTTGCCATTACTTCACCTTTCAAGT^CAGAGCCTGCTGACCAAGAATAAGGCC CGCTACTTTGC(^TTACTTCACCTTTCAAGT^CAGAGCCTGCTGACCAAGAATAAGGCC AC/CA422'3T Kobilka, 87: 451 CGGGTGATCATTCTGATGGTGTGGATTGTGTCAG<X:CTTACCTCCTTCTTGCCCATTCAG 510 Quechua 1 Quechua 2 Quechua 3 CGGGTGATCATTCTGATGGTGTGGATTGTGTCAGGCCTTACCTCCTTCTTG^ CGGGTGATCATTCTGATGGTGTGGATTGTGTCAGGrc CGGGTGATCATTCTGATGGTGTGGATTGTGTCAGGCCTTACCTCCTTCT^ C/T 4"? Kobilka, 87: 511 ATGCACTGGTACCGGGCCACCCACCAGGAAGCCATCAACTGCTATGCCAATGAGACCTGC 570 Quechua 1 Quechua 2 Quechua 3 ATGCACTGGTACMGGGCCACCCACCAGGAAGCCATCAACTGCTATGCCAATGAGACCTGC ATGCACTGGTACAGGGCCACCCACCAGGAAGCCATCAACTGCTATGCCAATGAGACCTGC ATGCACTGGTACAGGGCCACCCACCAGGAAGCCATCAACTGCTATGCCAATGAGACCTGC C/A523t Kobilka, 87: 571 TGTGACTTCTTCACGAACCAAGCCTATGCCaTTGCCTCTTCCATCGTGTCCTTCTACGTT 630 Quechua 1 Quechua 2 Quechua 3 TGTGACTTCTTCACGAACCAAGCCTATGCCATTGCCTCTTCCATCGTGTCCTTCTACGTT TGTGACTTCTTCACGAACCAAGCCTATGCCATTG^ TGTGACTTCTTCACGAACCAAGCCTATGCCATTGCCTCTTCCATCGTGTCCTTCTACG Kobilka, 87: 631 CCCCTGGTGATCATGGTCTTCGTCTACTCCAGGX3TCTTTCAGGAGGCCAAAAGGCAGCTC 690 Quechua 1 Quechua 2 Quechua 3 CCCCTGGTGATCATGGTCTTCGTCTACTCCAGGGTCTTTCAGGAGGCCAAAAGGCAGCTC CCCCTGGTGATCATGGTCTTCGTCTACTCCAGGGTCTTTCAGGAGGCCAAAAGGCAGCTC CCCCTGGTGATCATGGTCTTCGTCTACTCCAGGGTCTTTCAGGAGGCCAAAAGGCAGCTC Kobilka, 87: 691 CAGAAGATTGACAAATCTGAGGGCCGCTTCCATGTCCAGAACCTTAGCCAGGTGGAGCAG 750 Quechua 1 Quechua 2 Quechua 3 CAGAAGATTGACAAATCTGAGGGCCGCTTCCATGTCCAGAACCTTAGCCAGGTGGAGCAG CAGAAGATTGACAAATCTGAGGGCCGCTTCCATGTCCAGAACCTTAGCCAGGTGGAGCAG CAGAAGATTGACAAATCTGAGGGCCGCTTCCATGTCCAGAACCTTAGCCAGGTGGAGCAG 118 A p p e n d i x i i i b c o n t i n u e d . Kobilka, 87: 751 GATGGGCGGACGGGGCATGGACTCCGCAGATCTTCCAAGTTCT^ 810 Quechua 1 Quechua 2 Quechua 3 GATGGGCGGACGGGGCATGGACTCCGCAGATCTTCCAAGTTCTGCTTGAAGGAGCAC GATGGGCGGACGGGGCATGGACTCCGCAGATCTTCCAA GATGGGCGGACGGGGCATGGACTCCGCAGATCTTCCAAGTTCTGCTTGAAGGAGCACAAA Kobilka, 87: 811 GCCCTCAAGACGTTAGGCATCATCATGGGCACTTTCACCCTCTGCTGGCTGCCCTTCTTC 870 Quechua 1 Quechua 2 Quechua 3 GCCCTCAAGACGTTAGGCATCATCATGGGCACTTTCACCCTCTGCTGGCTGCCCTTCTTC GCCCTCAAGACGTTAGGCATCATCATGGGCACTTTCACCCTCTGCTGGCTGCCCTTCTTC GCCCTCAAGACGTTAGGCATCATCATGGGCACTTTCACCCTCTGCTGGCTGCCCTTC Kobilka, 87: 871 ATCGTTAACATTGTGCATGTGATCCAGGATAACCTCATCCGTAAGGAAGTTTACATCCTC 930 Quechua 1 Quechua 2 Quechua 3 ATCGTTAACATTGTGCATGTGATCCAGGATAACCTCATCCGTAAGGAAGTTTACATCCTC ATCGTTAACATTGTGCATGTGATCCAGGATAACCTCATCCGTAAGGAAGTTTACATCCTC ATCGTTAACATTGTGCATGTGATCCAGGATAACCTCATCCGTAAGGAAGTTTACATCCTC Kobilka, 87: 931 CTAAATTGGATAGGCTATGTCAATTCTGGTTTCAATCCCCTTATCTACTGCCGGAGCCCA 990 Quechua 1 Quechua 2 Quechua 3 CTAAATTGGATAGGCTATGTCAATTCTGGTTTCAATCCCCTTATCTACTGCCGGAGCCCA CTAAATTGGATAGGCTATGTCAATTCTGGTTTCAATCCCCTTATCTACTGCCGGAGCCCA CTAAATTGGATAGGCTATGTCAATTCTGGTTTCAATCCCCTTATCTACTGCCGGAGCCCA Kobilka, 87: 991 GATTTCAGGATTGCCTTCCAGGAGCTTCTGTGCCTGCGCAGGTCTTCTTTGAAGGCCTAT 1050 Quechua 1 Quechua 2 Quechua 2 GATTTCAGGATTGCCTTCCAGGAGCTTCTGTGCCTGCGCAGGTCTTCTTTC GATTTCAGGATTGCCTTCCAGGAGCTTCTGTGCCTGCGCAGGTCTTCTTTGAAGGCCTAT GATTTGAGGATTGCCTTCCAGGAGCTTCTGTGCCTG^ Kobilka, 87: 1051 GGGAATGGCTACTCCAGCAACGGCAACACAGGGGAGCAGAGTGGATATCACGTGGAACAG 1110 Quechua 1 Quechua 2 Quechua 3 GGCAATGGCTACTCCAGCAACGGCAACACAGGGGAGCAGAGTGGATATCACGTGGAACAG GGCAATGGCTACTCCAGCAACGGCAACACAGGGGAGC^GAGTGGATATCACGTGGAACAG GGCi^TGGCTACTCCAGCAACGGCAACACAGGGGAGCAGAGTGGATATCACGTGGAACAG Kobilka, 87: 1111 GAGAAAGAAAATAAACTGCTGTGTGAAGACCTCCCAGGCACGGAAGACTTTGTGGGCCAT 1170 Quechua 1 Quechua 2 Quechua 3 GAGAAAGAAAATAAACTGCTGTGTGAAGACCTCCCAGGCACGGAAGACTTTGTGGGCCAT GAGAAAGAAAATAAACTGCTGTGTGAAGACCTCCCAGGCACGGAAGACTTTGTGGGCCAT GAGAAAGAAAATAAACTGCTGTGTGAAGACCTCCCAGGCACGGAAGACTTTGTGGGCCAT Kobilka, 87: 1171 CAAGGTACTGTGCCTAGCGATAACATTGATTCACAAGGGAGGAATTGTAGTACAAATGAC 1230 Quechua 1 Quechua 2 Quechua 3 CAAGGTACTGTGCCTAGCGATAACATTGATTCACAAGGGAGGAATTGTAGTACAAATGAC CAAGGTACTGTGCCTAGCGATAACATTGATTCaCAAGGGAGGAATTGTAGTACAAATGAC CAAGGTACTGTGCCTAGCGATAACATTGATTCaCAAGGGAGGAATTGTAGTACAAATGAC Kobilka, 87: 1231 TCACTGCTGTAAagcagtttttctacttttaaaga 1265 Quechua 1 Quechua 2 Quechua 3 TCACTGCTATAAagcagtttttctacttttaaaga TCACTGCTATAAagcagtttttctacttttaaaga TCACTGCTATAAagcagtttttctacttttaaaga 119 A p p e n d i x i i i . D N A s e q u e n c e s ( c o n t i n u e d ) c ) . E r y t h r o p o i e t i n g e n e s e q u e n c e d f r o m t h r e e Q u e c h u a . R e f e r e n c e s e q u e n c e ( u p p e r ) i s a r e g i o n o f c h r o m o s o m e 7 q 2 2 s e q u e n c e ( G e n B a n k a c c e s s i o n n u m b e r N u m b e r A F 0 5 3 3 5 6 ; s e e G l o c k n e r a n d T s u i , 1 9 9 8 ) . T h e T / A + 6 6 2 a n d t h e T / G + 7 6 9 p o l y m o r p h i s m s i n t h e t h r e e p r i m e u n t r a n s l a t e d r e g i o n a r e u n d e r l i n e d . V e r t i c a l b a r s i n d i c a t e c o n s e n s u s b e t w e e n a l l f o u r s e q u e n c e s . T h e c o d i n g s e q u e n c e i s n u m b e r e d a n d the i n i t i a t i o n a n d t e r m i n a t i o n c o d o n s a r e b o l d f a c e d . Q u e c h u a s e q u e n c e s a r e a v a i l a b l e t h r o u g h G e n B a n k w i t h t h e f o l l o w i n g a c c e s s i o n n u m b e r s A F 2 0 2 3 0 6 , A F 2 0 2 3 0 7 , A F 2 0 2 3 0 8 ( Q u e c h u a 1); A F 2 0 2 3 0 9 , A F 2 0 2 3 1 0 , A F 2 0 2 3 1 1 ( Q u e c h u a 2); A F 2 0 2 3 1 2 , A F 2 0 2 3 1 3 a n d A F 2 0 2 3 1 4 ( Q u e c h u a 3). E x o n 1 1 13 7q22 s e q . : cccggccaggcgcggagATGGGGGTGCACGgtgagtactcgcgggctgggcgctcccgcc Mill iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiimiiiiiM Quechua 1: cccggccaggcgcggagATGGGGGTGCACGgtgagtactcgcgggctgggcgctcccgcc Quechua 2: ccggccaggcgcggagATGGGGGTGCACGgtgagtactcgcgggctgggcgctcccgcc Quechua 3: cccggccaggcgcggagATGGGGGTGCACGgtgagtactcgcgggctgggcgctcccgcc 7q22 s e q . : c g c c c g g g t c c c t g t t t g a g c g g g Quechua 1 Quechua 2 Quechua 3 c g c c c g g g t c c c t g t t t g a g c g g g c g c c c g g g t c c c t g t t t g a g c g g g c g c c c g g g t c c c t g t t t g a g c g g g E x o n s 2 a n d 3 14 7q22 s e q . : cctggctatctgttctagAATGTCCTGCCTGGCTGTGGCTTCTCCTGTCCCTGCTGTCGC Quechua 1 Quechua 2 Quechua 3 CCtggctatctgttCtagAATGTCCTGCCTGGCTGTGGCTTCTCCTGTCCCTGCTGTCGC cctggctatctgttctagAATGTCCTGCCTGGCTGTGGCTTCTCCTGTCCCTGCTGTCGC gctatctgttctagAATGTCCTGCCTGGCTGTGGCTTCTCCTGTCCCTGCTGTCGC 7q22 s e q . : TCCCTCTGGGCCTCCCAGTCCTGGGCGCCCCACCACGCCTCATCTGTGACAGCCGAGTCC llllllllllllllllllllllllllllllllllllllllllllllllllllllllllll Quechua 1: TCCCTCTGGGCCTCCCAGTCCTGGGCGCCCCACCACGCCTCATCTGTGACAGCCGAGTCC Quechua 2: TCCCTCTGGGCCTCCCAGTCCTGGGCGCCCCACCACGCCTCATCTGTGACAGCCGAGTCC Quechua 3: TCCCTCTGGGCCTCCCAGTCCTGGGCGCCCCACCACGCCTCATCTGTGACAGCCGAGTCC 159 7q22 s e q . : TGGAGAGGTACCTCTTGGAGGCCAAGGAGGCCGAGAATATCACGgtgagaccccttcccc llllllllllllllllllllllllllllllllllllllllllllllllllllllllllll Quechua 1: TGGAGAGGTACCTCTTGGAGGCCAAGGAGGCCGAGAATATCACGgtgagaccccttcccc Quechua 2: TGGAGAGGTACCTCTTGGAGGCCAAGGAGGCCGAGAATATCACGgtgagaccccttcccc Quechua 3: TGGAGAGGTACCTCTTGGAGGCCAAGGAGGCCGAGAATATCACGgtgagaccccttcccc 1 2 0 A p p e n d i x i i i c c o n t i n u e d . 7g22 s e q . : a g c a c a t t c c a c a g a a c t c a c g c t c a g g g c t t c a g g g a a c t c c t c c c a g a t c c a g g a a c c Quechua 1 Quechua 2 Quechua 3 a g c a c a t t c c a c a g a a c t c a c g c t c a g g g c t t c a g g g a a c t c c t c c c a g a t c c a g g a a c c a g c a c a t t c c a c a g a a c t c a c g c t c a g g g c t t c a g g g a a c t c c t c c c a g a t c c a g g a a c c a g c a c a t t c c a c a g a a c t c a c g c t c a g g g c t t c a g g g a a c t c c t c c c a g a t c c a g g a a c c 7q22 s e q . : t g g c a c t t g g t t t g g g g t g g a g t t g g g a a g c t a g a c a c t g c c c c c c t a c a t a a g a a t a a g Quechua 1 Quechua 2 Quechua 3 t g g c a c t t g g t t t g g g g t g g a g t t g g g a a g c t a g a c a c t g c c c c c c t a c a t a a g a a t a a g t g g c a c t t g g t t t g g g g t g g a g t t g g g a a g c t a g a c a c t g c c c c c c t a c a t a a g a a t a a g t g g c a c t t g g t t t g g g g t g g a g t t g g g a a g c t a g a c a c t g c c c c c c t a c a t a a g a a t a a g 7q22 s e q . : t c t g g t g g c c c c a a a c c a t a c c t g g a a a c t a g g c a a g g a g c a a a g c c a g c a g a t c c t a c g Quechua 1 Quechua 2 Quechua 3 t c t g g t g g c c c c a a a c c a t a c c t g g a a a c t a g g c a a g g a g c a a a g c c a g c a g a t c c t a c g t c t g g t g g c c c c a a a c c a t a c c t g g a a a c t a g g c a a g g a g c a a a g c c a g c a g a t c c t a c g t c t g g t g g c c c c a a a c c a t a c c t g g a a a c t a g g c a a g g a g c a a a g c c a g c a g a t c c t a c g 7q22 s e q . : g c c t g t g g g c c a g g g c c a g a g c c t t c a g g g a c c c t t g a c t c c c c g g g c t g t g t g c a t t t c Quechua 1 Quechua 2 Quechua 3 g c c t g t g g g c c a g g g c c a g a g c c t t c a g g g a c c c t t g a c t c c c c g g g c t g t g t g c a t t t c g c c t g t g g g c c a g g g c c a g a g c c t t c a g g g a c c c t t g a c t c c c c g g g c t g t g t g c a t t t c g c c t g t g g g c c a g g g c c a g a g c c t t c a g g g a c c c t t g a c t c c c c g g g c t g t g t g c a t t t c 160 7q22 s e q . : agACGGGCTGTGCTGAAC&CTGCAGC Quechua 1 Quechua 2 Quechua 3 agACGGGCTGTGCTGAACACTGCAGCTTGAATGAGAATATCACTGTCCCAGACACCAAAG agACGGGCTGTGCTGAACACTGClAGCTTGAATGAGAATATCACTGTCCCAGACACCAAAG agACGGGCTGTGCTGAACACTGCAGCTTGAATGAGAATATCACTGTCCCAGACACCAAAG 246 7q22 s e q . : TTAATTTCTATGCCTGGAAGAGGATGGAGgtgagttccttt i i i i i i m i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i i Quechua 1: TTAATTTCTATGCCTGGAAGAGGATGGAGgtgagttccttt Quechua 2: TTAATTTCTATGCCTGGAAGAGGATGGAG Quechua 3: TTAATTTCTATGCCTGGAAGAGGATGGAG Exons 4 and 5 and 3' untranslated region 247 7q22 s e q . : ggtcagctgactcccagagtccactccctgtagGTCGGGCAGCAGGCCGTAGAAGTCTGG I I I IMI imil l l l l l l l l l l l l l l l l l l l l l l l l l l l l lMI I I I I IMI I I I IMI Quechua 1: ggtcagctgactcccagagtccactccctgtagGTCGGGCAGCAGGCCGTAGAAGTCTGG Quechua 2: ggtcagctgactcccagagtccactccctgtagGTCGGGCAGCAGGCCGTAGAAGTCTGG Quechua 3: ggtcagctgactcccagagtccactccctgtagGTCGGGCAGCAGGCCGTAGAAGTCTGG 7q22 s e q . : CAGGGCCTGGCCCTGCTGTCGGAAGCTGTCCTGCGGGGCCAGGCCCTC I III! Ml Ml 111 IM M I Mil 1111II11 III I IMil III 111II111 Mill II Quechua 1: C A G G G C C T G G C C C T G < : T G T C G G A A G C T C ^ Quechua 2: CAGGGCCTGGCCCTGCTGTCGGAAGCTGTCCTGCGGGGCCAGGCCCTGTTGGTC Quechua 3: CAGGGCCTGGCCCHXJCTGTCGGAAGCTGTCCTGCGGGGC 121 A p p e n d i x i i i c c o n t i n u e d . 7q22 s e q . : TCCCAGCCGTGGGAGCCCCTGCAGCTGCATGTGGATA7AAGCCGTCAGTGGCCTTCGCAGC MM 111111111: M 1111II11111! 111 IN 111| 1111| 111 Ml 111IIMII M Quechua 1: TCCCAGCCGTGGGAGCCCCTGCAGCTGCATGTGGATAAAGCCGTCAGTGGCCTTCGCAGC Quechua 2: TCCCAGCCGTGGGAGCCCCTGCAGCTGCATGTGGATAAAGCCGTCAGTGGCCTTCGCAGC Quechua 3: TCCCAGCCGTGGGAGCCCCTGCAGCTGCATGTGGATAAAGCCGTCAGTGGCCTTCGCAGC 7q22 s e q . : c c c t t t c t g t a a g a a g g g g a g a a g g g t c t t g c t a a g g a g t a c a g g a a c t g t c c g t a t t c c 111II IM Mill 111II111 III M I M 1 M II1111II11 Ml I III M 111 IM I Quechua 1: c c c t t t c t g t a a g a a g g g g a g a a g g g t c t t g c t a a g g a g t a c a g g a a c t g t c c g t a t t c c Quechua 2: c c c t t t c t g t a a g a a g g g g a g a a g g g t c t t g c t a a g g a g t a c a g g a a c t g t c c g t a t t c c Quechua 3: c c c t t t c t g t a a g a a g g g g a g a a g g g t c t t g c t a a g g a g t a c a g g a a c t g t c c g t a t t c c 426 7q22 s e q . : CTCACCACTCTGCTTCGGGCTCTGGGAGCCCAGgtgagtaggagcggacacttctgcttg II111111111 M M 11IIIIIII IM III III M M I M M I IM 111 MM 11111 Quechua 1: CTCACCACTCTGCTTCGGGCTCTGGGAGCCCAGgtgagtaggagcggacacttctgcttg Quechua 2: CTCACCACTCTGCTTCGGGCTCTGGGAGCCCAGgtgagtaggagcggacacttctgcttg Quechua 3: CTCACCACTCTGCTTCGGGCTCTGGGAGCCCAGgtgagtaggagcggacacttctgcttg 427 7q22 s e q . : t t c c c t t t c t g t g g c a c t g c a g c g a c c t c c t g t t t t c t c c t t g g c a g A A G G A A G C C A T C T Quechua 1 Quechua 2 Quechua 3 t t c c c t t t c t g t g g c a c t g c a g c g a c c t c c t g t t t t c t c c t t g g c a g A A G G A A G C C A T C T t t c c c t t t c t g t g g c a c t g c a g c g a c c t c c t g t t t t c t c c t t g g c a g A A G G A A G C C A T C T t t c c c t t t c t g t g g c a c t g c a g c g a c c t c c t g t t t t c t c c t t g g c a g A A G G A A G C C A T C T 7q22 s e q . : CCCCTCCAGATGCGGCCTCAGCTGCTCCACTCCGAACAATCACTGCTGACACTTTCCGCA II111111111IMI1111II111II1111IIIIIIII MM I III 111 MM III11 Quechua 1: CCCCTCCAGATGCGGCCTCAGCTGCTCCACTCCGAAC^TCACTGCTGACACTTTCCGC^ Quechua 2: CCCCTCCAGATGCGGCCTCAGCTGCTCCACTCCGAACAATCACTGCTGACACTTTCCGCA Quechua 3: CCCCTCCAGATGCGGCCTCAGCTGCTCCACTCCGAAC^TCACTGCTGACACTTTCCGCA 7q22 s e q . : AACTCTTCCGAGTCTACTCCAATTTCCTCCGGGGAAAGCTGAAGCTGTACACAGGGGAGG 111 M IIIIMMIIII M M I MMI I M M M !! 11II111II11IIII1111111 Quechua 1: AACTCTTCCGAGTCTACTCCAATTTCCTCCGGGGAAAGCTGAAGCTGTACACAGGGGAGG Quechua 2: AACTCTTCCGAGTCTACTCCAATTTCCTCCGGGGAAAGCTGAAGCTGTACACAGGGGAGG Quechua 3: AACTCTTCCGAGTCTACTCCAATTTCCTCCGGGGAAAGCTGAAGCTGTACACAGGGGAGG 582 7q22 s e q . : CCTGCAGGACAGGGGACAGATG&ccaggtgtgtccacctgggcatatccaccacctccct IMM MMIMMMMIMMMMMMMMMMMMMMMMIMIMM Quechua 1: CCTGCAGGACAGGGGACAGATGAccaggtgtgtccacctgggcatatccaccacctccct Quechua 2: CCTGCAGGACAGGGGACAGATGAccaggtgtgtccacctgggcatatccaccacctccct Quechua 3: CCTGCAGGACAGGGGACAGATGAccaggtgtgtccacctgggcatatccaccacctccct 7q22 s e q . : c a c c a a c a t t g c t t g t g c c a c a c c c t c c c c c g c c a c t c c t g a a c c c c g t c g a g g g g c t c t Quechua 1 Quechua 2 Quechua 3 c a c c a a c a t t g c t t g t g c c a c a c c c t c c c c c g c c a c t c c t g a a c c c c g t c g a g g g g c t c t c a c c a a c a t t g c t t g t g c c a c a c c c t c c c c c g c c a c t c c t g a a c c c c g t c g a g g g g c t c t c a c c a a c a t t g c t t g t g c c a c a c c c t c c c c c g c c a c t c c t g a a c c c c g t c g a g g g g c t c t 122 A p p e n d i x i i i c c o n t i n u e d . 7q22 s e q . : c a g c t c a g c g c c a g c c t g t c c c a t g g a c a c t c c a g t g c c a g c a a t g a c a t c t c a g g g g c c Quechua 1 Quechua 2 Quechua 3 c a g c t c a g c g c c a g c c t g t c c c a t g g a c a c t c c a g t g c c a g c a a t g a c a t c t c a g g g g c c c a g c t c a g c g c c a g c c t g t c c c a t g g a c a c t c c a g t g c c a g c a a t g a c a t c t c a g g g g c c c a g c t c a g c g c c a g c c t g t c c c a t g g a c a c t c c a g t g c c a g c a a t g a c a t c t c a g g g g c c 7q22 s e q . : agaggaac tg tccagagagcaac tc tgaga tc taaggatg tcacagggccaac t tgaggg II111111111 MM 11IIII111II1111II111 ll I M M I MMI11 Ml 11111 Quechua 1: agaggaac tg tccagagagcaac tc tgaga tc taaggatg tcacagggccaac t tgaggg Quechua 2: agaggaac tg tccagagagcaac tc tgaga tc taaggatg tcacagggccaac t tgaggg Quechua 3: agaggaac tg tccagagagcaac tc tgaga tc taaggatg tcacagggccaac t tgaggg 7q22 s e q . : cccagagcaggaagcat tcagagagcagc t t taaac tcagggacagagccatgc tgggaa I I I I I I I I I I M I I I I I I I I I I I I I I I I I l l l l l l l l l l l l l l l l l l i n i l l l l l M I I Quechua 1: cccagagcaggaagcat tcagagagcagc t t taaac tcagggacagagcca tgc tgggaa Quechua 2: cccagagcaggaagcat tcagagagcagc t t taaac tcagggacagagcca tgc tgggaa Quechua 3: cccagagcaggaagcat tcagagagcagc t t taaac tcagggacagagcca tgc tgggaa 7q22 s e q . : g a c g c c t g a g c t c a c t c g g c a c c c t g c a a a a t t t g a t g c c a g g a c a c g c t t t g g a g g c g a II111II111111II1111II111 Ml M III111II111III MMI I MM 11111 Quechua 1: g a c g c c t g a g c t c a c t c g g c a c c c t g c a a a a t t t g a t g c c a g g a c a c g c t t t g g a g g c g a Quechua 2: g a c g c c t g a g c t c a c t c g g c a c c c t g c a a a a t t t g a t g c c a g g a c a c g c t t t g g a g g c g a Quechua 3: g a c g c c t g a g c t c a c t c g g c a c c c t g c a a a a t t t g a t g c c a g g a c a c g c t t t g g a g g c g a 7q22 s e q . : t t t a c c t g t t t t c g c a c c t a c c a t c a g g g a c a g g a t g a c c t g g a g a a c t t a g g t g g c a a g Quechua 1 Quechua 2 Quechua 3 t t t a c c t g t t t t c g c a c c t a c c a t c a g g g a c a g g a t g a c c t g g a g a a c t t a g g t g g c a a g t t t a c c t g t t t t c g c a c c t a c c a t c a g g g a c a g g a t g a c c t g g a g a a c t t a g g t g g c a a g t t t a c c t g t t t t c g c a c c t a c c a t c a g g g a c a g g a t g a c c t g g a g a a c t t a g g t g g c a a g 7q22 s e q . : c t g t g a c t t c t c c a g g t c t c a c g g g c a t g g g c a c t c c c t t g g t g g c a a g a g c c c c c t t g a Quechua 1 Quechua 2 Quechua 3 c t g t g a c t t c t c c a g g t c t c a c g g g c a t g g g c a c t c c c t t g g t g g c a a g a g c c c c c t t g a c t g t g a c t t c t c c a g g t c t c a c g g g c a t g g g c a c t c c c t t g g t g g c a a g a g c c c c c t t g a c t g t g a c t t c t c c a g g t c t c a c g g g c a t g g g c a c t c c c t t g g t g g c a a g a g c c c c c t t g a 7q22 s e q . : caccggggtgg tgggaacca tgaagacaggatgggggc tggcc tc tggc tc tca tggggt 11111111111 INI 1111II111II1111II111 M I MM III1111 l l l l 11111 Quechua 1: c a c a c a g c c t g t c t g a c c t c t c g a c c c t a c c g g g c c t g a g g c c a c a a g c t c t g c c t a c g c Quechua 2: c a c a c a g c c t g t c t g a c c t c t c g a c c c t a c c g g g c c t g a g g c c a c a a g c t c t g c c t a c g c Quechua 3: c a c a c a g c c t g t c t g a c c t c t c g a c c c t a c c g g g c c t g a g g c c a c a a g c t c t g c c t a c g c 7q22 s e q . : c c a a g t t t t g t g t a t t c t t c a a c c t c a t t g a c a a g a a c t g a a a c c a c c a a t a t g a c t c t t Quechua 1 Quechua 2 Quechua 3 c a c a c a g c c t g t c t g a c c t c t c g a c c c t a c c g g g c c t g a g g c c a c a a g c t c t g c c t a c g c c a c a c a g c c t g t c t g a c c t c t c g a c c c t a c c g g g c c t g a g g c c a c a a g c t c t g c c t a c g c c a c a c a g c c t g t c t g a c c t c t c g a c c c t a c c g g g c c t g a g g c c a c a a g c t c t g c c t a c g c 7q22 s e q . : g g c t t t t c t g t t t t c t g g g a a c c t c c a a a t c c c c t g g c t c t g t c c c a c t c c t g g c a g c a g Quechua 1: g g c t t t t c t g t t t t c t g g g a a c c t c c a a a t c c c c t g g c t c t g t c c c a c t c c t g g c a g c a g Quechua 2: g g c t t t t c t g t t t t c t g g g a a c c t c c a a a t c c c c t g g c t c t g t c c c a c t c c t g g c a g c a g Quechua 3: g g c t t t t c t g t t t t c t g g g a a c c t c c a a a t c c c c t g g c t c t g t c c c a c t c c t g g c a g c a g 123 A p p e n d i x i i i c c o n t i n u e d . iC/T* 6 6 2 7q22 s e q . : tgcagcaggtccaggtccgggaaacgaggggtggagggggctgggccc tacgtgc tg tc t Quechua 1 Quechua 2 Quechua 3 tgcagcaggtccaggtccgggaaacgaggggtggagggggctgggccc tacgtgc tg tc t tgcagcaggtccaggtccgggaaacgaggggtggagggggctgggccc tacgtgc tg tc t tgcagcaggtccaggtccgggaaacgaggggtggagggggctgggccc tacgtgc tg tc t 7q22 s e q . : c a c a c a g c c t g t c t g a c c t c t c g a c c c t a c c g g g c c t g a g g c c a c a a g c t c t g c c t a c g c Quechua 1 Quechua 2 Quechua 3 c a c a c a g c c t g t c t g a c c t c t c g a c c c t a c c g g g c c t g a g g c c a c a a g c t c t g c c t a c g c c a c a c a g c c t g t c t g a c c t c t c g a c c c t a c c g g g c c t g a g g c c a c a a g c t c t g c c t a c g c c a c a c a g c c t g t c t g a c c t c t c g a c c c t a c c g g g c c t g a g g c c a c a a g c t c t g c c t a c g c 7q22 s e q . : t g g t c a a t a a g g t g t c t c c a t t c a a g g c c t c a c c g c a g t a a g g c a g c t g c c a a c c c Quechua 1 Quechua 2 Quechua 3 t g g t c a a t a a g g t g t c t c c a t t c a a g g c c t c a c c g c a g t a a g g c a g c t g c c a a c c c t g g t c a a t a a g g t g t c t c c a t t c a a g g c c t c a c c g c a g t a a g g c a g c t g c c a a c c c t g g t c a a t a a g g t g k c t c c a t t c a a g g c c t c a c c g c a g t a a g g c a g c t g c c a a c c c 124 A p p e n d i x i i i . D N A s e q u e n c e s ( c o n t i n u e d ) d). R e p r e s e n t a t i v e Q u e c h u a h y p o x i a i n d u c i b l e f a c t o r l a ( H I P - l a ) c D N A s e q u e n c e . S e q u e n c e s w e r e o b t a i n e d f o r t h r e e Q u e c h u a l y m p h o b l a s t c e l l l i n e s ( G M 1 1 1 9 7 - G M 1 1 2 0 1 ) a n d n o v a r i a n t s w e r e d e t e c t e d . R e f e r e n c e s e q u e n c e ( u p p e r ) i s f r o m ( W a n g et al, 1 9 9 5 ) ( G e n B a n k a c c e s s i o n n u m b e r U 2 2 4 3 1 ) . V e r t i c a l b a r s i n d i c a t e c o n s e n s u s . C o d i n g s e q u e n c e i s i n u p p e r c a s e . T h e i n i t i a t i o n c o d o n a n d t e r m i n a t i o n c o d o n s are b o l d f a c e d . Q u e c h u a s e q u e n c e s a r e a v a i l a b l e t h r o u g h G e n B a n k ( a c c e s s i o n n u m b e r s A F 2 0 7 6 0 1 , A F 2 0 7 6 0 2 a n d A F 2 0 8 4 8 7 ) . Wang,95: gattcaccATGGAGGGCGCCGGCGGCGCGAACGACAAGAAAAAGATAAGTTCTGAACGTC IUIMIIIIIMIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII Quechua: gattcaccATGGAGGGCGCCGGCGGCGCGAACGACAAGAAAAAGATAAGTTCTGAACGTC Wang,95: GAAAAGAAAAGTCTCGAGATGCAGCCAGATCTCGGCGAAGTAAAGAATCTGAAGTTTTTT IIII IM MM 11111 III 11 M II111II11 Ml I Ml 11II111 Ml MMI111II Quechua: GAAAAGAAAAGTCTCGAGATGCAGCCAGATCTCGGCGAAGTAAAGAATCTGAAGTTTTTT Wang,95: ATGAGCTTGCTCATCAGTTGCCACTTCCACA 111111111 IM II111 IM M I IM 11 IM M II1111II11-II III 11 MMI I Quechua: ATGAGCTTGCTCATCAGTTGCCACTTCCACA Wang,95: CTGTGATGAGGCTTACGATCAGCTATTTG^ MM Ml Ml 111 III IIIII III M M 1 M 11! 11 Ml | n ; | 11| > 11 IM II111 M Quechua: CTGTGATGAGGCTTACCATCAGCTATTTGCGTGTG Wang,95: TGGATATTGAAGATGACATGAAAGCACAGATGAATTGCT I IM IM M M 11111 M I M : M M Ml I M 11II111IIIIMM M'M 111II Quechua: TGGATATTGAAGATGACATGAAAGCACAGATGAATTGCTTTTATTTGAAAGCCTT Wang,95: GTTTTGTTATGGTTCTCACAGATGATGGTGACATGATTTACATTTCTC MM II Ml M 1111 MM I M;:M IM'M I IM 11II111III MM III1111111 Quechua: GTTTTGTTATGGTTCTCACAGATGATGGTGACATGATTT Wang,95: AATACATGGGATTAACTCAGTTTGAACTAACTGGACACAGTGTGTTTC MMMIMIMMMMMMMMMIMIMMIMMIMMMIMMMIMI Quechua: AATACATGGGATTAACTCAGTTTGAACTAACTGGACAC^ Wang,95: CATGTGACC^TGAGGAAATGAGAGAAATGCTTACACA MM III MM 1111 MM I M Ml M Ml I MM I III 11II11 M II IM II111 M Quechua:CATGTGACCATGAGGAAATGAGAGAAATGCTTACACACAGAAATGGCCTTGTGAAAAAGG Wang,95: GTAAAGAACAAAACACACAGCGAAGCTTTTTTCTCAGAATGAAGTGTACCCTAACTAGCC MIMIMMMMMMMIMMIMMMMMIMMMMIMMIMIIMM Quechua: GTAAAGAACAAAACACACAGCGAAGCTTTTTTCTCAGAATGAAGTGTACCCTAACTAGCC Wang,95: GAGGAAGAACTATGAAC&TAAAGTCTGCAACATG^ Ml Ml Ml 111111II111IIIII III 111II111III MM III111II1111 Ml Quechua: GAGGAAGAACTATGAACATAAAGTCTG<:AACATGGAAGGTATTGCACTGCACAGGCCAC^ Wang,95: TTCACGTATATGATACCAACAGTAACCAACCTCAGTGTGGGTATAAGAAACCACCTATGA M 11111111111 M Ml 111II111II1111II M M 11II111III MM 1111III Quechua: TTCACGTATATGATACCAACAGTAACCAACCTCAGTGTGGGTATAAGAAACCACCTATGA 125 A p p e n d i x i i i d c o n t i n u e d . Wang,95: CCTGCTTGGTGCTGATTTGTGAACCCATTCCTCACCCATCAAATATTGAAATO I IM IM MM I II I I Ml I I I I III I I M ' M Ml l | | | | | | | | | | MM II II MM Quechua: CCTGCTTGGTGCTGATTTGTGAACCCATTCCTCACCCATCAAATATTGAA^ Wang,95: ATAGCAAGACTTTCCTCAGTCGACACAGCCTGGATATGAAATTTTCTTATTGTGATGAAA M IIIIII M 111 IM II111IIIII IM M I IM | | Ml | | Ml M MM M Ml | | M Quechua: ATAGCAAGACTTTCCTGAGTCGACACAGCCTGGATATG^ Wang,95: GAATTACCGAATTGATGGGATATGAGCCAGAAGAACTTTTAGGCCGCTCAATTO 1111IIIII Mill 111 MMI I Mil I Mill MM 11 III I Ml I MM 1111 IM Quechua: GAATTACCGAATTGATGGGATATGAGCCAGAAGAACTTTTAGGCCGCTCAATT^ Wang,95: ATTATCATGCTTTGGACTCTGATCATCTGACCAAAACTCATCATGATATGTTTACTAAAG Ml MM II M 1111 M M 111 MM 11II111III M M IM 111II111 III M I Quechua: ATTATCATGCTTTGGACTCTGATCATCTGACCAAAACTCATCATGATATGTTTACTAAAG Wang,95: GACAAGTCACCACAGGACAGTACAGGATGCTTGCCAAAAGAGGTGGATATGTCTGGGTTC 11111III III Ml 111 IM M I M M I M M MM II MM | | | | I MMI II MM Quechua: GACAAGTCACCACAGGACAGTACAGGATGCTTGCCAAAAGAGGTGGATATGTCTGGGTTG Wang,95: AAACTCAAGCAACTGTCATATATAACACCAAGAATTCTCAACCACAGTGCATTGTATGTG 111111111111 M MM 111| 111 M II11IIIIIII11 Ml I l ; ; M I ^ M 111 Ii Quechua: AAACTCAAGCAACTGTCATATATAACACCAAGAATTCTCAACCACAGTGCATTGTATGTG Wang,95: TGAATTACGTTGTGAGTGGTATTATTCAGC IIIIIII M 1111IIIIIII MM M MMI 11 M III111II1111IIIIIIII M I Quechua: TGAATTACGTTGTGAGTGGTATTATTCT^^ Wang,95: AATGTGTCCTTAAACCGGTTGAATCTTCAGATATGAAAATGACTCAGCTATTCACCAAAG Ml Ml MM 11111 M M I MMM I M M 11 11 Ml M III III III II III M I Quechua: AATGTGTCCTTAAACCGGTTGAATCTTCAGATATGAAAATGACTCAGCTATTCACCAAAG Wang,95: TTGAATCAGAAGATACAAGTAGCCTCTTTGACAAACTTAAGAAGGAACCTGATGCTOT 111111111 IM III M IM M 11 Ml 11 M M I :M III111II111II1111 Ml Quechua: TTGAATCAGAAGATACAAGTAGCCTCTTTGACAAACTTAAGAAGG Wang,95: CTTTGCTGGCCCCAGCCGCTGGAGACACAATCATATCTTT 111111111 III III M 11 ill 111II1111II11 M| I IM 11II111 III II11II Quechua: CTTTGCTGGCCCCAGCCGCTCGAGACACAATCATATCTTTAGATTTTGGCAGCAACGACA Wang,95: C^GAAACTGATGACCAGCAACTTGAGGAAGTACCATTATATAATGATGTAATGCTCCCCT MMMMMMMMMMMMMMMMMMMMMMMMMMMIMM Quechua: CAGAAACTGATGACCAGCAACTTGAGGAAGTACCATTATATAATGATGTAATGCTCCCCT Wang,95: CACCCAACGAAAAATTACAGAATATAAATTTGGCAATGTCTCCATTACCCACCGCTGAAA IIIIIIIIIIIIIIMIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII Quechua: CACCCAACGAAAAATTACAGAATATAAATTTGGCAATGTCTCCATTACCCACCGCTGAAA Wang,95: CGCCAAAGCCACTTCGAAGTAGTGCTGACCCTGCACTCAATCAAGAAGTTGCATTAAAAT Ml IMMMMMMMMMMMMMMMMMMMM MMMMIMM Quechua: CGCCAAAGCCACTTCGAAGTAGTGCTGACCCTGCACTCAATCAAGAAGTTGCATTAAAAT Wang,95: TAGAACCAAATCCAGAGTCACTGGAACTTTCTTTTACCATGCCCCAGATTCAGGATCAGA MMMMMMMMMMMMMMMMMMIMMMMMMIMMMM Quechua: TAGAACCAAATCCAGAGTCACTGGAACTTTCTTTTACCATGCCCCAGATTCAGGATCAGA 1 2 6 A p p e n d i x i i i d c o n t i n u e d . Wang,95: CACCTAGTCCTTCCGATGGAAGCACTAGAI^AAAGTTCACCTGAGCCTAATAGTCCCAGTG i i i i i i iMii i i i i i i i i i i i i i i i i i i i i i i i i i i imii i i i i i i i i i i i i i i i i i Quechua: CACCTAGTCCTTCCGATGGAAGCACTAGACAAAGTTCACCTGAGCCTAATAGTCCCAGTG Wang,95: AATATTGTTTTTATGTGGATAGTGATATGGTCAATGAATTCAAGT^ 111111111 IM II IM I: Ml 11 III 11 M III M M I MM III111II1111 Ml Quechua: AATATTGTTTTTATGTGGATAGTGATATGGTC Wang,95: AACTTTTTGCTGAAGACACAGAAGC^AAGAACCCATTTTCTACTCAGGACACAGATT^ III Ml M:|| 111| | M 11 M ; M 11 Ml 11 Ml I MM M III IIIII111II Ml I Quechua: AACTTTTTGCTGAAGACACAGAAGCAAAGAACCCATTTTCTACTCAGGACACAGATTTAG Wang,95: ACTTGGAGATGTTAGCTCCCTATATCCCAATGGATGATGACTTCCAGTTACGTTCCTTCG M 11111111 III IM M 111II111II M || Ml 11II11 Ml 11: MM IM, il 111 M Quechua: ACTTGGAGATGTTAGCTCCCTATATCCCAATGGATGATGACTTCCAGTTACGTTCCTO Wang,95: ATCAGTTGTCACCATTAGAAAGCAGTTCCGCAAGC IIIIIIIIIIIIIIIMIIIIIIIIIIIIIIIIIIIIIIIIIilllllHIIIIIIIIII Quechua: ATCAGTTGTCACCATTAGAAAGCAGTTCCGCAAGCCCTGAAAGCGCAAGTCCTCAAAGCA Wang,95: CAGTTACAGTATTCCAGCAGACTCAAATACAAGAACCTACTGCTAATGCCACCACTACCA M 111111111111 M II111II M I IM IIIII111II11 Ml 11 I IM || 1111 Quechua: CAGTTACAGTATTCCAGCAGACTCAAATACAAGAACCTACTGCTAATGCCACCACTACCA Wang,95: CTGCCACCACTGATGAATTAAAAAC^GTGACAAAAGACCGTATGGAAGACATTAAAATAT MM M I MM Ml 111 IM 111 M M 11" M II M Mil I nM IIMII IM MM Quechua:: CTGCCACCACTGATGAATTAAAAACAGTGACAAAAGACCGTATGGAAGACATTAAAATAT Wang,95: TGATTGCATCTCCATCTCCTACCCACATACATAAAGAAACTACTAGTGCCACATCATCAC 111111111 IM IIIII M M 11 Ml I M :M I M I IM 11II11 III 11111 M Quechua: TGATTGCATCTCCATCTCCTACCCACATACATAAAGAAACTACTAGTGCCACATCATCAC Wang,95: CATATAGAGATACTCAAAGTCGGACAGCCTCACCAAACAGAGCAGGAAAAGGAGTCATAG 111111111 M III M 1111II11 Ml 11IIII11 III I MM I III IIIMM 1111 Quechua: CATATAGAGATACTCAAAGTCGGACAGCCTCACCAAACAGAGCAGGAAAAGGAGTCATAG Wang,95: AACAGACAGAAAAATCTCATCCAAGAAGCCCTAACGTGTTATCTGTCGCTTTGAGTCAAA MMIMMIMM MIIIIIIIIIIIIIIIIIIIIIIIIMIIIMMM Mlllll Quechua: AACAGACAGAAAAATCTCATCCAAGAAGCCCTAACGTGTTATCTGTCGCTTTGAGTCAAA Wang,95: GAACTACAGTTCCTGAGGAAGAACTAAATCCAAAGATACTAGCTTTGCAGAATGCTCAGA II11111111111 MMI111II111 IM IIIII111II111III MiM IM II111 M Quechua: GAACTACAGTTCCTGAGGAAGAACTAAATCCAAAGATACTAGCTTTGCAGAATGCTCAGA Wang,95: GAAAGCGAAAAATGGAACATGATGGTTCACTTTTTCAAGCAGTAGGAATTG^ IMIIIIMIIIIIIIIIMIIMIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIMII Quechua: GAAAGCGAAAAATGGAACATGATGGTTCACTTTTTCAAGCAGTAGGAATTGGAACATTAT Wang,95: TACAGCAGCCAGACGATCATGCAGCTACTACATCACTTTCTTGGAAACGTGTAA II I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Quechua: TACAGCAGCCAGACGATCATGCAGCTACTACATCACTTTCTTGGAAACGTGTAAAAGGAT Wang,95: GCAAATCTAGTGAACAGAATGGAATGGAGCAAAAGACAATTATTTTAATACCCTC 111111111 IM IM M M M | 1111| 11111| 11 IM ||: M 11: M IMM 111 M Quechua: GCAAATCTAGTGAACAGAATGGAATGGAGCAAAAGACAATTATTTTAATACCCTCTGATT 127 A p p e n d i x i i i d c o n t i n u e d . Wang,95: TAGCATGTAGACTGCTGGGGCAATCAATGGATGAAAGTGGATTACCACA I IM IM II M I I I I I III I I I I II I I I II I I I II I I I I II I I I II I MM I I I I II M Quechua: TAGCATGTAGACTGCTGGGGCAATCAATGGATGAAAGTGGATTACC^CAGCTGACCAGTT Wang,95: ATGATTGTGAAGTTAATGCTCCTATAGAAGGC^ I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Quechua: ATGATTGTGAAGTTAATGCTCCTATACAAGGCAGCAGAAACCTACTGCA Wang,95: TACTCAGAGCTTTGGATCAAGTTAACTGAgctttttcttaatttcattcc 1111111 M 11 M 111111' 111.; M I':: 11 .' 111!! 11111111 Quechua: TACTCAGAGCTTTGGATCAAGTTAACTGAgctttttcttaatttcattcc 128 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0089649/manifest

Comment

Related Items