UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Molecular dissection of Mitogillin, a fungal ribotoxin Kao, Richard Yi Tsun 1999

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2000-486613.pdf [ 4.2MB ]
Metadata
JSON: 831-1.0089625.json
JSON-LD: 831-1.0089625-ld.json
RDF/XML (Pretty): 831-1.0089625-rdf.xml
RDF/JSON: 831-1.0089625-rdf.json
Turtle: 831-1.0089625-turtle.txt
N-Triples: 831-1.0089625-rdf-ntriples.txt
Original Record: 831-1.0089625-source.json
Full Text
831-1.0089625-fulltext.txt
Citation
831-1.0089625.ris

Full Text

MOLECULAR DISSECTION OF MITOGILLIN, A FUNGAL RIBOTOXIN by Richard Y i Tsun Kao B. Sc. (Honours), University of British Columbia, 1993 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENT FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (DEPARTMENT OF MICROBIOLOGY AND IMMUNOLOGY) We accept this thesis as conforming to the required standard The University of British Columbia August 1999 © Richard Yi Tsun Kao, 1999 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I -agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of ^TProfc/Wpyj 4*J Y^n"*" 1^ c ) ^ The University of British Columbia Vancouver, Canada Date Iff 4 DE-6 (2/88) ABSTRACT Fungal ribotoxins, such as mitogillin and the related Aspergillus toxins restrictocin and a-sarcin, are small (~17 kDa) basic ribosome-inactivating proteins (RIPs) which catalytically inactivate the large ribosomal subunits of all organisms tested so far; they act as specific ribonucleases by hydrolyzing one single phosphodiester bond in the universally conserved a-sarcin/ricin loop (SRL) of 23 - 28S rRNAs and are among the most potent inhibitors of protein synthesis known. The site of cleavage occurs between G4325 and A4326 (rat ribosome numbering), which is conserved among the large subunit rRNAs of all living species. Amino acid sequence comparison of fungal ribotoxins and guanyl/purine ribonucleases has identified domains or residues likely to be involved in ribonucleolytic activity or cleavage specificity. The amino acid residues involved in the cytotoxic activities of mitogillin were investigated by introducing hydroxylamine-induced point mutations into a recombinant Met-mature mitogillin gene (mitogillin with a Met codon at the N-terminus and no leader sequence) constructed from an Aspergillus fumigatus cDNA clone. These constructs were cloned into a yeast expression vector under the control of the GAL1 promoter and transformed into Saccharomyces cerevisiae. Upon induction of mitogillin expression, surviving transformants revealed that substitutions of certain amino acid residues on mitogillin abolished its cytotoxicity. Non-toxic mutant genes were cloned into an E.coli expression vector, the proteins over-expressed and purified to homogeneity, and their activities examined by in vitro ribonucleolytic assays. These studies identified the His49Tyr, Glu95Lys, Argl20Lys, and Hisl36Tyr mutations as having profound impact on the i i ribonucleolytic activities of mitogillin suggesting that these residues are key components of the active site contributing to the catalytic activities of mitogillin. Fifteen deletion mutants (each 4 to 8 amino acid deletions) in motifs of mitogillin lacking amino acid sequence homology with guanyl/purine ribonucleases were constructed by site-directed mutagenesis. Analyses of the purified mutant proteins identified the lysine rich region loop 4 (L4) region and p sheet 1-loop 1-P sheet 2 (B1-L1-B2) domain in fungal ribotoxins as contributing to ribosome-targeting and modulating the catalytic activity of the toxin; these regions show strong sequence similarity to ribosomal proteins and elongation factors. Nine mutant mitogillins that were capable of digesting polyinosinic acid [poly(I)] but unable to cleave the SRL in rabbit reticulocyte ribosomal R N A were isolated after screening E. coli encoding partially degenerate oligonucleotide sequences in the lysine rich L4 region (Lys 106-Phe 107-Asp 108-Ser 109-Lys 110-Lys 111 -Pro 112-Lys 113) of the mitogillin gene. Further investigation by site-directed mutagenesis indicated that Lys l 11 plays an important role in substrate recognition; a Lys l 1 lGln change markedly reduced the ability of mitogillin to specifically cleave the rabbit ribosomal RNA or a 35-mer oligoribonucleotide mimicking the SRL. In addition, a variant mitogillin with an Asn7Ala substitution in the B1-L1-B2 domain exhibited elevated ribonucleolytic activity and reduced substrate specificity, suggesting the involvement of this domain in substrate selection. This mutational study of mitogillin taken together with the recently published X-ray structure of restrictocin (a close relative of mitogillin) supports the hypothesis that the specific cleavage properties of ribotoxins are the result of natural genetic engineering of T l -like ribonucleases in which the ribosomal targeting elements of ribosome-associated proteins i i i were inserted into nonessential regions of the nuclease protein. iv T A B L E OF C O N T E N T S A B S T R A C T i i T A B L E OF C O N T E N T S v LIST OF F I G U R E S vi i i L IST OF T A B L E S x A B B R E V I A T I O N S A N D S Y M B O L S xi A C K N O W L E D G E M E N T S xiv C H A P T E R 1 - I N T R O D U C T I O N 1 1.1 Ribosome-inactivating proteins 1 1.2 Fungal ribotoxins 5 1.3 Medical significance of fungal ribotoxins 6 1.4 Production of fungal ribotoxins 7 1.5 Applications of fungal ribotoxins 8 1.6 Mode of action of fungal ribotoxins 9 1.7 Molecular studies of fungal ribotoxins 10 1.8 Research objectives 17 C H A P T E R 2 - M A T E R I A L S A N D M E T H O D S 18 2.1 Bacterial and yeast strains and plasmids 18 2.2 Yeast methods 18 2.3 Construction of mitogillin expression vectors in yeast 19 2.4 In vivo assay for mitogillin activity 19 2.5 Hydroxylamine mutagenesis of pMIT+ve plasmid 20 2.6 pMIT+ve plasmid mutant isolation 20 v 2.7 Generation of site specific mutants from pMIT+ve plasmid 21 2.8 Nucleotide Sequencing 21 2.9 Cloning of mutated mitogillin genes into the E. coli expression vector pING3522 22 2.10 Site-directed mutagenesis 25 2.11 PCR-mediated mutagenesis of the L4 region 30 2.12 Isolation of mutants with amino acid substitutions in the L4 region of mitogillin 32 2.13 Production and purification of mutant mitogillins 32 2.14 Non-specific ribonucleolytic activity against synthetic homopolynucleotides 34 2.15 Non-specific ribonucleolytic activity on MS-2 phage RNA 34 2.16 Zymogram electrophoresis 35 2.17 Specific cleavage of rabbit ribosomal RNA (in vitro cc-fragment release) 35 a. Using purified proteins 35 b. Using induced culture supematants 36 2.18 Purification of synthetic DNA templates 37 2.19 SRL (35-mer RNA) synthesis using T7 RNA polymerase and synthetic DNA templates 37 2.20 Specific cleavage of the synthetic SRL RNA 40 CHAPTER 3 - PROBING THE ACTIVE SITE OF MITOGILLIN 41 3.1 Introduction 41 3.2 Construction of mitogillin expression vectors 42 3.3 Hydroxylamine mutagenesis of pMIT+ve plasmid and isolation of mitogillin mutants 43 3.4 Cloning of mitogillin mutants into pING3522 46 3.5 Production and purification of mutant mitogillins 46 3.6 Non-specific ribonucleolytic activity 48 3.7 Specific ribonucleolytic activity 52 3.8 Discussion 54 CHAPTER 4 - DELETION MUTANTS OF MITOGILLIN 58 4.1 Introduction 58 vi 4.2 Mitogillin deletion mutant construction and protein purification 59 4.3 Non-specific ribonucleolytic activity of mitogillin deletion mutants 62 4.4 Specific ribonucleolytic activity 67 4.5 Discussion 70 C H A P T E R 5 - POINT M U T A T I O N S A F F E C T I N G T H E SPECIFICITY O F M I T O G I L L I N 77 5.1 Introduction 77 5.2 PCR-mediated mutagenesis and the isolation of mutants in the L4 region 78 5.3 Single amino acid substitution in the B1-L1-B2 domain 79 5.4 Enzyme activity assays 84 5.5 Discussion 88 C H A P T E R 6 - CONCLUSIONS AND F U T U R E DIRECTIONS 92 R E F E R E N C E S 94 vii LIST OF F I G U R E S Figure 1.1. a-sarcin/ricin loop (SRL), the target site of RIPs 3 Figure 1.2. Synthetic SRL 14 Figure 1.3. Crystal structure of restrictocin 16 Figure 2.1. Schematic representation of the cloning of mitogillin mutants into E. coli expression vector pING3522 24 Figure 2.2. Deletion mutagenesis of mitogillin 27 Figure 2.3. PCR-mediated site-specific deletion/substitution of the mitogillin gene 29 Figure 2.4. Synthesis of the SRL using T7 RNA polymerase and synthetic D N A templates. 39 Figure 3.1. SDS-PAGE of variant mitogillins produced in E. coli 47 Figure 3.2. Non-specific ribonucleolytic activity of mitogillin against various synthetic R N A homopolymers 49 Figure 3.3. Non-specific ribonucleolytic activity of mitogillin and its variants against poly(I). 50 Figure 3.4. Zymogram electrophoretic analyses of variant mitogillins produced in E. coli... 51 Figure 3.5. Specific ribonucleolytic activity (in vitro cc-fragment release) of mitogillin and its variants 53 Figure 4.1. SDS-PAGE of deletion mutant mitogillins 61 Figure 4.2. Non-specific ribonucleolytic activity of mitogillin and its deletion mutants on poly(I) substrate 63 Figure 4.3. MS-2 Phage RNA degradation 65 Figure 4.4. Zymogram electrophoresis of deletion mutants 66 viii Figure 4.5. Specific ribonucleolytic activity (in vitro a-fragment release) of mitogillin and its deletion variants 68 Figure 4.6. Cleavage of SRL by mitogillin and its deletion variants 69 Figure 4.7. Structural comparison of restrictocin and ribonuclease T l 73 Figure 4.8. Hydrogen-bonding between (31-loop l-(32 and p6-loop 6-07 domains of restrictocin 76 Figure 5.1. RNase activity staining of a-fragment inactive mutants in L4 region of mitogillin by zymogram electrophoresis 81 Figure 5.2. Specific ribonucleolytic activity (in vitro a-fragment release) of mitogillin and its variants 82 Figure 5.3. SDS-PAGE of mutant mitogillins and their RNase activity on zymogram electrophoresis 83 Figure 5.4. Specific ribonucleolytic activity (in vitro a-fragment release from rabbit ribosomes) of mitogillin and its variants 86 Figure 5.5. Synthetic SRL cleavage assay 87 Figure 5.6. Comparison of hydrogen-bonding between B I - L I - B 2 and B6-L6-B7 domains of chain A and chain B of restrictocin 91 ix LIST OF T A B L E S Table 1.1. Representatives of ribosome-inactivating proteins (RIPs) from various sources....4 Table 1.2. Comparison of amino acid sequences of guanyl ribonucleases and ribotoxins 15 Table 2.1. Oligonucleotides used for site-directed mutagenesis of the mitogillin gene 28 Table 2.2. Oligonucleotides used for site-directed mutagenesis of the L4 region 31 Table 3.1. Mitogillin mutants obtained after hydroxylamine mutagenesis 44 Table 3.2. Yeast cytotoxicity assay and production of mutant mitogillins in E. coli 45 Table 4.1. Production of mutant mitogillin proteins 60 Table 4.2. Comparison of the ribonucleolytic activity (initial rate of cleavage) of mitogillin, deletion mutant mitogillins, and ribonuclease T l on poly(I) homopolymer 64 Table 4.3. Homologous motifs found in ribotoxins and in ribosomal protein S12 from a variety of sources 74 Table 4.4. Homologous motifs found in mitogillin and in translation elongation factors 75 Table 5.1. D N A and amino acid sequences of 9 a-fragment-inactive mutants isolated from mutagenesis of L4 region (residues 106 to 113) of mitogillin 80 Table 5.2. Comparison of the ribonucleolytic activity of mitogillin and variants (Lysl 1 lGln and Asn7Ala) against poly(I) 85 x A B B R E V I A T I O N S A N D S Y M B O L S A B P A allergic bronchopulmonary aspergillosis ATP adenosine 5'-triphosphate bp base-pair CTP cytidine 5'-triphosphate dATP deoxyadenosine 5'-triphosphate dCTP deoxycytidine 5'-triphosphate dGTP deoxyguanosine 5'-triphosphate D N A deoxyribonucleic acid dNTPs deoxynucleoside triphosphates DTT dithiothreitol dTTP deoxythymidine 5'-triphosphate EDTA ethylenediaminetetraacetate EF-1 elongation factor 1 EF-2 elongation factor 2 EF-G elongation factor G EF-Tu elongation factor Tu FPLC fast protein liquid chromatography G A L galactose G L U glucose GTP guanosine 5'-triphosphate xi IgE immunuglobulin E IPA invasive pulmonary aspergillosis kDa kilodalton N M R nuclear magnetic resonance nt nucleotide(s) NTPs nucleoside triphospates P A G E polyacrylamide gel electrophoresis PCR polymerase chain reaction PG phosphatidylglycerol poly(A) poly-(adenylic acid) poly(C) poly-(cytidylic acid) poly(G) poly-(guanylic acid) poly® poly-(inosinic acid) poly(U) poly-(uridylic acid) RIPs ribosome-inactivating proteins R N A ribonucleic acid rRNA ribosomal ribonucleic acid RNase ribonuclease SDS sodium dodecyl sulfate SRL a-sarcin/ricin loop SRP signal recognition particle T A E tris/acetate/EDTA buffer TBE tris/borate/EDTA buffer xii T E M E D N , N , N ' ,-tetramemylenediamine T L C thin layer chromatography tRNA transfer ribonucleic acid UTP uridine 5'-triphosphate U V ultraviolet Y N B yeast nitrogen base minimal media xm ACKNOWLEDGEMENTS I would like to thank my research supervisor and my mentor Dr. J. Davies for taking me into his lab and giving me the benefit of his knowledge and experience; I am grateful to him for his help, advice and especially his patience. I would also like to thank my committee members, Dr. D.G. Kilburn, Dr. J. Kronstad, and Dr. G.B. Spiegelman, for their guidance and support throughout the years. I would like to thank all the members of the Davies lab, both past and present, for their help and advice. The assistance of Rosario Bauzon and all the staff in the Departments of Microbiology and Immunology is also acknowledged. I would like to thank Drs. J. Shea and D. Holden for initiating the hydroxylamine mutagenesis of the mitogillin gene to probe the active site of fungal ribotoxins and for all their hard works on yeast in vivo assays. I would also like to thank Drs. A. Martinez del Pozo and J.G. Gavilanes for introducing me to the field of protein/membrane interactions and allowing me to visit their lab in Madrid, Spain, for experiments and collaborations. I would like to thank A. Martinez-Ruiz for sharing ideas and general discussions; he is responsible for the major portion our collaborating work on identification of ribotoxin genes in filamentous fungi (though I did not include the results in my thesis). I am indebted to Dr. R. Crameri for helping me to examine the allergenic aspects of fungal ribotoxins and allowing me to visit his lab in Davos, Switzerland, several times for experiments and collaborations. I am also indebted to Drs. S.C. Mosimann and N.C.J. Strynadka for intrducing me to the field of X-ray crystallography and molecular modeling of macromolecules. I also acknowledge the Natural Sciences and Engineering Research Council and the Medical Research Council of Canada for their financial support over the years. xiv Finally, I would like to thank my parents and my brother for their support; my lovely wife, Florence, for her unfailing love and patience (now she is the loving mother of our new born boy Enoch) throughout the years; my brothers and sisters from Chown Memorial and Chinese United Church for their prayers and support; may the name of our Lord Jesus Christ be glorified. xv C H A P T E R 1 - I N T R O D U C T I O N 1.1 Ribosome-inactivating proteins Ribosome-inactivating proteins (RIPs) are protein toxins (Table 1.1) produced by organisms ranging from bacteria to plants which specifically damage eukaryotic, archaeal, and prokaryotic ribosomes, rendering them unable to bind elongation factors, and consequently interfering with the elongation steps in translation. The RIPs are in fact, specific degradative enzymes targeting the ribosome. The target site (Figure 1.1) of most RIPs is a universally conserved region (the ct-sarcin /ricin loop, SRL) found in the 3' region of large subunit rRNAs (Endo et al., 1987; Lamy et al., 1992). Two mechanisms have been identified for their toxic action; the a-sarcin-like fungal RIPs from Aspergilli catalytically inactivate the large ribosomal subunit (Schindler and Davies, 1977) by acting as specific ribonucleases to cleave a single phosphodiester bond between G4325 and A4326 of the 28S rRNA (Endo and Wool, 1982; Fando et al, 1985), whereas bacterial and plant RIPs are N -glycosidases which hydrolyze an N-glycosidic linkage between the ribose sugar and the base of A4324 in 28S rRNA (Endo et al. 1987; Obrig et al, 1987). Such covalent modifications of the rRNA completely abolish the ability of ribosomes to carry out protein synthesis. According to their structures, RIPs from higher plants can be classified into two categories, namely type I and type II RIPs. Type I RIPs are single-chain peptide toxins of about 30 kilodaltons (kDa). Type II RIPs are proteins (ca. 60 kDa) composed of two dissimilar subunits linked by disulfide bridges. The A chain of type II RIPs is homologous to type I RIPs and acts as the toxic component whereas the B chain of type II RIPs is a lectin which facilitates the binding and uptake of the toxic A chain into the cell (Fong et al., 1991). 1 Interestingly the bacterial RIPs are produced by pathogenic gram-negative bacteria such as Shigella dysenteriae and Escherichia coll (STEC: Shiga toxin producing E. coll in particular) have caused significant problems in human health in recent years. Although fungal RIPs are not glycosidases, they can be classified as type I RIPs since they are single-chain toxins (-17 kDa) with potent ribosome-inactivating activity. 2 R i c i n • • a-sarcin A G U G • B G A • A C U C - G C C - G U - A • E F - G protection C Q • E F - T u protection G U U G C - G 2674 Figure 1.1. a-sarcin/ricin loop (SRL), the target site of RIPs. The cleavage site of a-sarcin and the depurination site of ricin A-chain are indicated. Shown also are the sites of interaction with elongation factor Tu (EF-Tu) and elongation factor G (EF-G). Modified from Moazed et al. (1988). 3 RIP Mode of action Producing organism Plant: Abrin Gelonin Ricin glycosidase glycosidase glycosidase Abrus precatorius Gelonium multiflorum Ricinus communis Bacterial: Shiga toxin Shiga-like toxin glycosidase glycosidase Shigella dysenteriae 1 Escherichia coli 0157:H7 Fungal: a-sarcin Clavin Mitogillin endonuclease endonuclease endonuclease Aspergillus giganteus Aspergillus clavatus Aspergillus re sir ictus Table 1.1. Representatives of ribosome-inactivating proteins (RIPs) from various sources (Fong et al., 1991). 4 1.2 Fungal ribotoxins The name ribotoxin was first proposed to describe a group of fungal RIPs, a-sarcin, restrictocin, and mitogillin, which are among the most potent inhibitors of translation known (Lamy et al., 1992). These toxins, produced by the Aspergilli, are basic proteins with molecular weights of ~17 kDa. Restrictocin differs from mitogillin by only one amino acid while a-sarcin and restrictocin share 86% amino acid sequence identity (Fernandez-Luna et al., 1985; Lopez-Otin et al., 1984; Rodriguez et al., 1982; Sacco et al., 1983). The discovery of the first member the fungal ribotoxins, a-sarcin, was the outcome of an antibiotic screening program carried out by the Michigan Department of Health in 1956. Burger Olson and co-workers were asked to expand the scope of the program to include the search for anticancer agents and identified a mould Aspergillus giganteus (MDH18894), isolated from a soil sample obtained from a Michigan farm, which produced a substance that potently inhibited the growth of certain tumors in rats (Olson and Goerner, 1965; Olson et al., 1965). Olson and colleagues isolated the substance and found it to be a small basic protein which was named a-sarcin (anitisarcoma activity), and soon put the newly discovered toxin into clinical testing. The results of these trials were unsuccessful due to ineffectiveness and significant nonspecific toxicity. The ribotoxins were thought to be produced exclusively in Aspergilli ( A. giganteus, A. restrictus, and A. fumigatus) but recent reports suggest that a family of a-sarcin-like ribotoxins are produced by various fungal species (Martinez-Ruiz et al., 1999; Lin et al., 1991, 1995, 1997; Gao et al, 1994). More recently, other ribotoxins from different strains of 5 A. clavatus (clavin, c-sarcin) and A. giganteus (gigantin) have been characterised (Parente et al., 1996; Huang et al., 1997; Wirth et al., 1997). Ribotoxins have also been detected in Penicillium species (Lin et al., 1997). Moreover, tricholin (~14 kDa) isolated from Trichoderma viride (Lin et al., 1991) and luffin-S, a much smaller protein toxin (-10 kDa) isolated from the seeds of the plant Luffa cylindria (Gao et al., 1994) have been reported to have similar enzymatic activities to the ribotoxins. Although amino acid sequencing and gene cloning are needed to characterize these molecules, these studies suggest that there may be a ribotoxin superfamily produced by organisms ranging from fungi to higher plants. 1.3 Medical significance of fungal ribotoxins The incidence of fungal infections, especially of aspergillosis, has increased drastically over the past decade as the number of immuno-compromised patients has risen as the result of the use of immunosuppressive agents. Invasive aspergillosis has become an important cause of hospital mortality following major surgery especially during organ and tissue replacement procedures (Hibberd and Rubin, 1994). The major pathogenic species of Aspergillus for humans is Aspergillus fumigatus, which has been well studied as an opportunistic pathogen (Bodey and Vartivarian, 1989; Walsh and Pizzo, 1988). Studies have shown that restrictocin is the major antigen detected in the urine of patients with disseminated aspergillosis (Arruda et al, 1990, 1992; Lamy et al., 1991) and antibody studies have shown the accumulation of restrictocin in the vicinity of nodes of fungal infection in experimental animals (Lamy et al., 1991). 6 Animal models have been established to study the possible role of the aspergillus ribotoxins as factors of virulence in invasive pulmonary aspergillosis (IPA) and the results from several studies indicate that restrictocin is not a significant virulence factor in A. fumigatus infections (Paris et al, 1993; Smith et al., 1993, 1994). However, the ribotoxin from A. fumigatus (mitogillin) is involved in the pathogenicity of allergic bronchopulmonary aspergillosis (ABPA) since patients with A B P A showed marked elevation of IgE antibody to ribotoxins (Kurup et al., 1994). Recently, studies have shown that fungal ribotoxins may play roles in the suppressive effect on the functions of human polymorphonuclear leukocytes (Ikegami et al., 1998). Extensive immunological studies have been carried out to characterise the roles of fungal ribotoxins in fungal hypersensitivity (Hemmann et al., 1999; Crameri, Kao, and Davies, unpublished results). 1.4 Production of fungal ribotoxins Extensive studies on the regulation, production, and localization of restrictocin in A. restrictus have been carried out by Kenealy and co-workers (Brandhorst and Kenealy 1992; Yang and Kenealy 1992b). Their findings demonstrated that restrictocin is localized on the surface of conidiophores and that the production of restrictocin is correlated with the maturation of the conidia. Studies of the biosynthesis of a-sarcin in A. giganteus showed that ct-sarcin is synthesized as an inactive precursor; after the synthesis and maturation of the toxin it is segregated into membrane compartments (Endo et al., 1993a, 1993b). The translation systems of the producing hosts are sensitive to ribotoxins with no evidence of the co-production of any inhibitor (an immunity protein) of the nuclease activity of the ribotoxin (Hobden, 1978; Miller and Bodley, 1988b), as is the case for colicin E3 (Boon, 1972; 7 Bowman, 1971). It is thought that the producing host is protected from committing suicide during ribotoxin synthesis by production of the toxin as an inactive pro-form, which becomes activated on processing through the Golgi system (Endo et al, 1993a, 1993b; Lamy and Davies, 1991). Once the toxin is secreted, fungi are unable to take up the protein and are resistant to high concentrations of exogenous toxin. Most cells are insensitive to ribotoxins, but transmembrane uptake is facilitated under certain physiological conditions (Fernandez-Puentes, 1983, 1984; Femandez-Puentes and Carrasco, 1980). 1.5 Applications of fungal ribotoxins Due to their cytotoxicity towards certain mammalian cell lines and virus-infected cells, the antitumor activity of a-sarcin, restrictocin, and mitogillin has been examined extensively (Olson and Goerner, 1965; Schindler and Davies, 1977). While ribotoxins were effective against canine cancer, they were not effective in human cancer trials due to non-specific cytotoxicity (Roga et al., 1971). Although initial interest in fungal ribotoxins was related to their use as single agents, they have more recently been analyzed extensively as immunoconjugates with monoclonal antibodies directed against cancer cell targets (Better et al, 1992; Conde et al, 1989; D'Alatri et al, 1998; Dosio et al, 1998; Ffertler and Frankel, 1989; Orlandi etal, 1988; Rathore and Batra, 1996; Rathore et al, 1997; Wawrzynczak et al, 1991). Fungal ribotoxins are attractive candidates as components of immunotoxins because of their potent activity and their relatively small size (-17 kDa). In addition, recombinant restrictocin has been used in the diagnosis of allergic bronchopulmonary aspergillosis, following the demonstration that restrictocin is the major IgE binding allergen 8 secreted by A. fumigatus (Moser et al, 1992; Crameri et al, 1996a, 1996b; Hemmann et al., 1998). Since a-sarcin specifically hydrolyzes purines in both single- and double-stranded RNA, it has also been employed as a tool to determine the tertiary structures of rRNA and to study ribosomal RNA-protein interactions (Barciszewska et al., 1990; Holmberg and Nygard, 1994; Huber and Wool, 1988; Wimberly et al, 1993). The binding sites on rRNAs for various ribosomal proteins (Huber and Wool, 1984, 1986a) and related protein/nucleic acid complexes such as signal recognition particles (SRP) (Siegel and Walter, 1988) and transcription factor IIIA (Huber and Wool 1986b) have been probed in protein-RNA footprinting studies using a-sarcin. A recent report by Brandhorst et al. (1996) demonstrated that the ribotoxin restrictocin deters insect feeding on A. restrictus, suggesting that the production and localization of restrictocin may have a natural defensive role against insect feeding at times critical to spore formation by A. restrictus, indicating a potential use of restrictocin as an insect control agent. 1.6 Mode of action of fungal ribotoxins Ribotoxins block protein synthesis by inhibiting both the elongation factor 1 or Tu (EF-1 or EF-Tu)-dependent binding of aminoacyl-tRNA and the GTP-dependent binding of elongation factor 2 or G (EF-2 or EF-G) to ribosomes. Eukaryotic ribosomes are extremely sensitive to the fungal ribotoxins; a-sarcin inhibited amino acid incorporation in wheat germ extracts at 0.1 nM (Lamy et al., 1992). The ability of ribotoxins to inhibit protein synthesis correlates with the production of the a-fragment, a 3' terminal cleavage product of 393 9 nucleotides from the rRNA of the large ribosomal subunit (Brigotti et al., 1989; Schindler and Davies, 1977). Prokaryotic large ribosomal subunits such as the Escherichia coli 50S subunit are also susceptible to catalytic inactivation by ribotoxins, but require significantly higher concentrations of the inhibitor (Sanz and Amils, 1984). In fact, all large ribosomal subunits tested in vitro, including those from ribotoxin producing species such as A. giganteus and A restrictus, are inactivated by the ribotoxins (Hobden, 1978; Miller and Bodley, 1988b). Studies by Hausner and Nierhaus (1988), Miller and Bodley (1988a), and the results from our laboratory (Kao and Davies 1995) indicate that when isolated E. coli 23S rRNA is digested with low concentrations of ribotoxins, a cleavage product identical to the cc-fragment is obtained, indicating that the tertiary structure of the SRL in large subunit rRNA is conserved even in the absence of ribosomal proteins and that ribotoxins are specifically "targeted" to the universally conserved SRL whether or not other components of the translational apparatus are present. The unusual catalytic specificity of ribotoxins, in which they recognize and cleave only one of more than 7000 phosphodiester bonds in the ribosome suggests that they evolved as targeted ribonucleases. 1.7 Molecular studies of fungal ribotoxins The genes of fungal ribotoxins have been cloned and produced in sensitive hosts such as E. coli (Better et al., 1992; Endo et al., 1992; Henze et al, 1990; Lacadena et al., 1994; Oka et al., 1992; Parente et al., 1998), A. nidulans (Lamy and Davies, 1991) or Pichia pastoris (Martinez-Ruiz et al., 1998) by using regulated expression systems. The mitogillin 10 gene used in these studies was chemically synthesized by Better et al. (1992) and cloned into E. coli W3110 employing the expression vector pING3522, an inducible E. coli secretion vector, under the control of the Salmonella typhimurium araB promoter; transcription from this promoter is very tightly regulated. Upon induction by arabinose, the produced mitogillin is released through the cytoplasmic membrane of the host into the culture medium directed by the Erwinia carotovora pelB leader sequence; the secreted mitogillin is biologically active. Such controlled heterogeneous expression of large quantities of ribotoxins has proved to be extremely valuable in molecular studies. The extraordinary specificity of ribotoxins is a property of both the ribosome and the ribotoxin. The specific cleavage site by a-sarcin in 28S rRNA was determined to be on the 3' side of G4325 (Chan et al., 1983). A 35-mer oligoribonucleotide (Figure 1.2A), which mimics the SRL of 28S rRNA, has been used to study the substrate specificity of toxins such as a-sarcin and ricin (Endo et al., 1988) and the structure of a synthetic 29-mer oligoribonucleotide (Figure 1.2B) mimicking the SRL of the 28S ribosomal R N A has been well characterized (Szewczak et al., 1993; Correll et al., 1998; Seggerson and Moore, 1998) Extensive mutational studies with the 35-mer synthetic oligoribonucleotide have shed light on the rRNA identity elements for the toxins and the results suggest that although ribotoxins and ricin act on adjacent nucleotides, their rRNA identity elements are different (Gluck et al., 1994; Endo et al, 1988, 1990; Wool, 1997). The complete amino acid sequences for a-sarcin, mitogillin, and restrictocin have been determined (Fernandez-Luna et al, 1985; Lopez-Otin et al, 1984; Rodriguez et al, 1982; Sacco et al, 1983) and the genes encoding restrictocin and a-sarcin have been cloned and characterized (Lamy and Davies, 1991; Oka et al, 1990; Wnendt et al, 1993). Based on 11 a comparison of the amino acid sequences of guanyl ribonucleases from a variety of sources with the sequences of ribotoxins (Table 1.2), motifs common to ribotoxins and other ribonucleases required for catalytic activity were identified. Additional sequences/motifs found in the ribotoxins were suggested to represent domains which determine substrate (ribosome) binding specificity (Kao and Davies, 1995). Another extraordinary characteristic of fungal ribotoxins (basic, highly polar water-soluble proteins) is their ability to interact and translocate across cellular membranes (constituted mainly of hydrophobic lipid bilayers) in the absence of any specific membrane receptors (Turnay et al., 1993). Studies by Gavilanes and colleagues have shown that the fungal ribotoxin a-sarcin changes solubility in response to its interaction with the membranes. This process involves the destabilization of the protein structure of a-sarcin induced by phospholipid binding and subsequent conformational changes of the toxin (Gasset et al, 1989, 1991, 1995; Mancheno et al, 1995). The exact mechanism of this complex membrane translocation process is currently under investigation (Mancheno et al, 1998; Onaderra et al, 1998). The structural analysis of mitogillin by X-ray crystallography was first initiated by Martinez and Smith (1991) but the project was aborted before the structure refinement was accomplished. Subsequently, Yang and Moffat (1996) solved and refined the crystal structure of restrictocin to 1.7 A (Figure 1.3). Coincidentally, the N M R structure of a-sarcin, another member of the ribotoxin family, was solved by Campos-Olivas et al. (1996); the two structures were presented at the 4 t h International Meeting on Ribonuclease : Chemistry, Biology, Biotechnology, July, 1996 (Groningen, the Netherlands). An understanding of the biology of mitogillin and related fungal ribotoxins at the 12 molecular level has become increasingly important because of their potential applications components of immunotoxins. This application may be extended by the use of fungal ribotoxin targeting domains in the development of integral single chain toxins possessing both enzyme activity and targeting functions. 13 A RTA B R T A G A*G . m i t o g i l l i n C *A ^ G A G . m i t o g i l l i n A G A G U G U G R N A 35-mer A © RNA29-mer A A A A A C C C C U C U C u — o u — o u — u o — - u p — < P — < U — C D O — u P U — O o — u < — p o — u < — p i i -o LD ro O ro i LT) Figure 1.2. Synthetic SRL. A. 35-mer. B. 29-mer. The cleavage site of mitogillin and the depurination site of ricin chain (RTA) are indicated. The SRL recognition site for fungal ribotoxins is circled. 14 B a r n a s B i n a s e S a S e F l F l l N l M s C 2 T l P b U 2 a S r e s t B a r n a s e B i n a s e S a S e F l F l l N l M s C 2 T l P b U 2 a S r e s t B a r n a s e B i n a s e S a S e F l F l l N l M s C 2 T l P b U 2 a S r e s t Q V I N T F D G V A D Y L Q T Y A V I N T F D G V A D Y L I R Y D V | D T . S T . E . . . A P C G E . S A T R C G E . . A S t J C G S T . A C M Y I C G S V . E S C E Y J T C G S T . D C D Y 1 C G S H . A C D Y 1 C G S N . A C A A g C Q T V . c m . . . . A V T W j T C L N D Q K N P A . T W J T j g i N Q Q L N P H K L . P D N Y I T K S E A Q A . . . . K R L . P N D Y I T K S . . Q A S A . . . S G . ;. T V C L S . . . S G F E Q V R L J A N Y S . A S Q V R A A . Y S . A S Q V R A A C Y S . S S A I S A A C Y H . S S D V S A A C Y S . A S A V S D A C Y S . S S D V S T A C Y T . S S A I S S 1 A E S T N C G G N V Y S N D D K . T N K Y E T K R L L Y N Q N K A E S K . T N K W E D K R L L Y S Q A K A E S . . A L P P E A . . D L P P E A . A N A A C . Q . A N A A C . Q . . L N K G Y S . . K A K G Y S . . Q S A G Y Q . . Q A A G Y Q . . Q A A G Y N L G W V A S K G N L G W V A S K G D T D T L N . L I A L A D V A P G K . . . S I G G L A E V A P G K . . . S I G G T D T Y E . L I E Y Y Q N D . D S | A Y Y Q S D . D Y Y E . D G A T l Y | 3 , Q E mi 10 20 30 L Y E S . G D | L . E S A G L H E . D G E l L Y S T N . D | I N T . A I Q G A N S H H A P . . . N S H H A P . . . 40 ID . . . G P F P . . . K G . . . . G P Y P . . G { S | T T • S T T d s . . . D D . d § . V G ( S N S S J N . L D D V A R . P D G D N j Y l P lISJD . . . G K T G S S Y P U S D . . . G K T G S S Y P . G R . . S R M D . . I D . . V D G V V D G T V T . . T . . R . . G . . Q . . K . . E . . N N R i d N R Y N j N M Y N ^ Y | Y H Y Y Y i D Y R [ N Y H | N Y E Q K EGJR E S V E G l l E G F E G F E G F E G F |E G F E G F J IDIE G F . I P G K S G R T W . R| . I P S A G S R T W . L P T Q S Y G . L P D C A E G D F I P | V D G P D F A V N G P : Q F R N . Y [ Y W G T S £ | V S G N D F S V S S P D E J p J v S G T - OjYj. T l Y j D l E l A S D O I T L C . . . C G . P G S W S . . . . . . . . . w. F T N G Y D . G I D G K L P K G R T P I K F G K S D C D R P P K H S K D G N G K T D . W . F T N G J Y J D . ( g N G K L I K G R T P I K F G K A D C D R P P K H S Q N G M G K D D D R M I | G | A | D R V I G W D R V I T R D R . . . . T G G I S ] . . S G G S . . T G G S . . T G G [ S . . N G G G . . SGGJS . . T G S S . . . Y S S R D N Y V S l P K F D S K K P K E N P GlP A I R M i l K F D |SJ K K P K E D | P J G | P A ] R ) V | l| S S D W . L I Y S S D W . L I Y I C G E A T Q E D Y R l R l F V V G D G G . E . Y D J R J v i y i N T N C . E . Y G A D R V V G A D R V I G P D R V I G W d R M v ^ F W D N D . E 90 . . K T T D | . . K T T . . Y T G F . Y T E ~ H 110 f f l Y Q . I N T S C . . Q Y F J D S H G N . . . L D M L | F I D G D D . E C G K F N E N N . . Q . F N D D D . E . . Y p T N T G E . . . T Y P N K V . . T Y P N K V . Y E S F R J . C T I V N IHH)rE[Al T H | N | T T . .T F T K I R . T F T R I R . T j E j S L I D Q T C . S H N N l F T v G i a S G T N . S G N N F V G C S N S T S G N N | F | V A C N H T G A A q G j D DV_F A | q S S S C H T G A L A G i L I T I G A . S G p G F V A ( J Y L A G J V I T H l G A . S q N K F V E q T L A ( G J V 1 I I H I G A . slgW F V A U T F C A T V T H T I G I A I A S Y D g F T T O U S F C J G | l 0 A H T K E N d 3 E . L K i q S H F q G U V A I H I Q R G N Q G I D . L R L l a S H Table 1.2. Comparison of amino acid sequences of guanyl/purine ribonucleases and ribotoxins. Ribonucleases: Barnase (Bacillus amyloliquefaciens); Binase (Bacillus intermedius); Sa (Streptomyces aureofaciens); Se (Saccharopolyspora erythreus); F l (Fusarium moniliforme) N l (Neurospora crassa); Ms (Aspergillusphoenicis); C2 (Aspergillus clavatus); T l (Aspergillus oryziae); Pb (Penicillium brevicompactum); U2 (Ustillago sphaerogena); ribotoxins: aS: alpha-sarcin (Aspergillus giganteus); rest: restrictocin (Aspergillus restrictus) Residues that are similar in eight or more sequences are boxed (Lamy et al. 1992). 15 Figure 1.3. Crystal structure of restrictocin. Secondary structures of the protein are labeled: p i , beta sheet 1; L I , loop 1; p2, beta sheet 2; HI , alpha helix 1; L2, loop 2; B3, beta sheet 3; L3, loop 3; H2, alpha helix 2; p4, beta sheet 4; L4, loop 4; P5, beta sheet 5; L5, loop 5; p6, beta sheet 6; L6, loop 6; P7, beta sheet 7. The coordinates of restrictocin are taken from PDB files 1AQZ (Yang and Moffat, 1996). 16 1.8 Research objectives Although the three-dimensional structures of restrictocin and a-sarcin have been elucidated, little biochemical information is available with regard to their functions', the domains/residues determining their ribonucleolytic activities (specific and non-specific) and interaction/translocation with cellular membranes, and their antibody-binding epitopes. The objectives of my mutational studies of the fungal ribotoxin mitogillin are: 1. Probing the catalytic site of mitogillin (presented in this thesis). 2. Identifying the ribosome-targeting elements of mitogillin (presented in this thesis). 3. Identifying the regions/residues of mitogillin which mediate membrane destabilization/translocation (ongoing collaboration with Gavilanes' group in Spain) 4. Probing the IgE-binding epitope(s) of mitogillin (ongoing collaboration with Crameri's group in Switzerland). This research will increase our understanding of the structure/function of the fungal ribotoxins, and will provide insight into the evolutionary relationship between ribonucleases, ribosome-associated proteins, and fungal ribotoxins. 17 C H A P T E R 2 - M A T E R I A L S AND M E T H O D S 2.1 Bacterial and yeast strains and plasmids E. coli strains DH5a and MH1066 {lacX74 hsr-rpslpyrF::Tn5 leuB600 trpC9830 galE galK) were used in hydroxylamine mutagenesis studies and S. cerevisiae strain BJ2168 (mat alpha, leu2, pep4-3, prBl-1122, prCl-407, trpl ura3-52) was used for mitogillin activity detection in vivo. pMW20 is a yeast replicating vector containing an ampicillin resistance gene and the URA3 gene for selection in E. coli and yeast respectively. pMIT+ve and pMIT-ve are derivatives of pMW20 with the mitogillin gene inserted in the positive and negative orientation respectively. An E. coli host (W3110) and the plasmid pING3522 were used for the production of mitogillin and mutant proteins. pING3522 is an inducible secretion vector with the expression of the inserted gene under the control of the S. typhimurium araB promoter; the secretion of recombinant proteins through the cytoplasmic membrane is directed by the E. carotovora pelB leader sequence (Better et al., 1992). 2.2 Yeast methods (done by Shea and Holden) Yeast nitrogen base (YNB) minimal medium was as described in (Guthrie and Fink, 1991) and included either 2 % glucose (YNB GLU) or 2 % galactose (YNB G A L ) as a carbon source. Media were supplemented with adenine, uracil, L-leucine and L-tryptophan at final concentrations of 20 mg/litre as required. Transformation of 5". cerevisiae was performed by the lithium acetate method (Ito et al., 1983) and replica plating was carried out using Whatman (110 mm Qualitative 1 ) filter papers and a wooden block so that an 18 approximately single layer of cells were transferred to fresh solid media. Plasmids were isolated from yeast as described by Hoffman and Winston (1987). 2.3 Construction of mitogillin expression vectors in yeast (done by Shea and Holden) A recombinant Met-mature mitogillin gene was synthesised by PCR using A. fumigatus cDNA as a template similar to that reported by Yang and Kenealy (1992a). The 5' primer (mitpri5, 5 ' - A A G A A T T C A T G G C G A C C T G G A C A - 3 ' ) contained an A T G start codon with an EcoRI site at the 5' end instead of a BamHI site. The 3' primer (mitpri3, 5'-A A G A A T T C G A G C G A A A T G T C T G C G G C - 3 ' ) was designed to be complementary to the 3' region of the mitogillin cDNA and contained an EcoRI site instead of the M l 3 universal primer employed by Yang and Kenealy. The 631 bp PCR product was digested with EcoRI and ligated into the EcoRI site of pUC18. The nucleotide sequence of the mitogillin construct was determined for both strands. Following verification of the nucleotide sequence the Met-mature mitogillin gene was isolated on an EcoRI fragment and inserted into pMW20 at the EcoRI site such that expression of the gene was placed under the control of the GAL1 promoter. The presence of an insert was confirmed by EcoRI digestion and the insert orientation determined by Bgll digestion; there are Bgll sites in both the insert and the plasmid. 2.4 In vivo assay for mitogillin activity (done by Shea and Holden) Plasmids pMIT+ve, pMIT-ve and pMW20 were used to transform S. cerevisiae strain BJ2168 to URA+ and transformants were selected on Y N B G L U solid media. Transformants 19 were then transferred to Y N B G A L solid media by replica plating; the expression of mitogillin gene was induced in the presence of galactose. 2.5 Hydroxylamine mutagenesis of pMIT+ve plasmid (done by Shea and Holden) Plasmid pMIT+ve was subjected to hydroxylamine mutagenesis using a protocol adapted from Guthrie and Fink (1991) and Rose and Fink (1987). 10 ug of pMIT+ve D N A was added to 500 ul of hydroxylamine solution (1 M hydroxylamine, 50 m M sodium pyrophosphate pH 7, 100 mM sodium chloride, 2 m M EDTA pH 8) and incubated at 75 °C for 0, 15, 30 and 60 minutes. The reaction was stopped by the addition of 12 ul of 4 M sodium chloride, 50 ul of 1 mg/ml bovine serum albumin and 1 ml of 100 % ethanol. The D N A was precipitated at -70 °C for 1 hour, recovered by centrifugation and resuspended in 400 ul TE (10 m M Tris-Cl, ImM EDTA, pH 8.0) and dialysed against TE overnight at 4 °C. Following dialysis the D N A was purified on an ElutipD column (Schleicher and Schuell), ethanol precipitated, resuspended in 25 u,l double distilled water and used to transform E. coli strain DH5a. The extensive purification steps were necessary as hydroxylamine inhibits E. coli transformation. 2.6 pMIT+ve plasmid mutant isolation (done by Shea and Holden) E. coli strain MH1066 contains an auxotrophic mutation which can be complemented by the yeast URA3 gene, thus MH1066 transformants could be used to estimate the mutation frequency of the plasmid borne URA3 gene. Accordingly, 200 MH1066 transformants from each time point (0, 15, 30, and 60 minutes) were patched onto M9 minimal medium with or 20 without uracil to determine mutagenesis levels. The pMIT+ve plasmid D N A mutagenised with hydroxylamine for 30 minutes was used to transform S. cerevisiae strain BJ2168 to URA+ and transformants were selected on Y N B G L U solid media. The resulting transformants were replica plated onto Y N B G A L solid media to identify those mutants which had lost mitogillin activity. Plasmids were isolated from viable clones and transformed into DH5a cells. Plasmid D N A was prepared and the restriction patterns analysed. Plasmids showing rearrangements were discarded and the double stranded nucleotide sequence of the mitogillin region of the remaining plasmids was then determined. 2.7 Generation of site specific mutants from pMIT+ve plasmid (done by Shea and Holden) Site-directed mutagenesis was performed using the two-step PCR approach as described by Higuchi et al. (1988). Plasmid pMIT+ve was the template for the first PCR amplification. In between the two rounds of PCR, the products from the first amplification were purified using Chromospin 100 columns (Clonetech). The final PCR products were ligated into the T A cloning vector (Novagen) according to the manufacturer's instructions. Inserts with the required mutations were identified by restriction digestion and confirmed by nucleotide sequencing. 2.8 Nucleotide Sequencing Nucleotide sequencing was performed by the dideoxy-nucleotide chain termination method using a T7 sequencing kit (Pharmacia) or Dye Terminator D N A sequencing kit (Applied Biosystems). 21 2.9 Cloning of mutated mitogillin genes into the E. coli expression vector pING3522 Since the mutagenized mitogillin genes lack a suitable leader sequence for protein expression in E. coli, PCR-mediated cloning of mutants obtained from hydroxylamine mediated mutagenesis into the E. coli expression vector pING3522 was employed. A schematic of the process is demonstrated in Figure 2.1. Briefly, three separate rounds of PCR were carried out to clone the mutated mitogillin genes into pING3522. Typical reaction conditions were 50 m M KC1, 10 m M Tris, pH 8.3, 1.5 m M M g C l 2 , 100 pmole of each primer, and 200 u M of each dNTP. First round PCR used E. coli harboring pING3522 as the D N A template. Single colonies were picked and resuspended in 100-ul reactions. RM-1 (5'-C T T G A G A C T G T G T T C T C A T T G A A G G G A G A A G - 3 ' ; underlined nucleotides denote homology to the 3' end of the pMIT+ve derived variant mitogillin genes) and RK-02 (Kao & Davies, 1995) were used as primers to amplify the 3' end and downstream sequences of the mutants. The reactions were heated at 95 °C for 7 minutes (to release D N A from the cells) followed by the addition of 2.5 units of Taq polymerase (Gibco BRL) and overlayed with paraffin oil. The amplification cycle profile was as follows: denaturation at 94 °C for 1 minute, annealing at 55 °C for 2.5 minutes, and primer extension at 72 °C for 2.5 minutes. Primer extension was carried out for 30 cycles. The same amplification cycle profile was employed for all three rounds of PCR. The reaction was separated by electrophoresis on a 1% agarose gel and the amplified D N A purified using the QIAquick Gel Extraction kit (QIAGEN). A second round of PCR used 5 ul of purified D N A fragment (~130 base pairs) from the previous round of PCR and pMIT+ve derived mutant mitogillin D N A (50 ng) as template. RM-2 ( 5 ' - G C T G C C C A A C C A G C G A T G G C G G C G A C C T G G A C A - 3 ' : underlined nucleotides denote homology to the 3' end of the pelB leader sequence) and RK-02 were 22 used as primers for amplification. The purified product (-600 base pairs D N A fragment) and a truncated synthetic mitogillin gene fragment (PCR product of primers RK-01 and RK-04; Kao & Davies, 1995) containing the pelB leader sequence were used for the next round of PCR. Primers RK-01 and RK-02 were used to "join" the pelB and upstream sequence onto the 5' end of the mutant mitogillin genes. The amplified D N A fragments were digested with Pstl and Hindlll, and the Pstl-Hindlll fragment separated by electrophoresis on a 1 % agarose gel and purified by QIAquick Gel Extraction kit (QIAGEN). The purified fragment was ligated to PstPHindlll digested pING3522 and transformed into E. coli. The nucleotide sequence of each mutant was verified. 23 Figure 2.1. Schematic representation of the cloning of mitogillin mutants into E. coli expression vector pING3522. Shown are the positions of the pelB leader, the synthetic mitogillin gene, and restriction sites (Pstl and Hindlll) used for cloning in plasmid pING3522. Also shown are the variant mitogillin genes derived from plasmid pMIT+ve after hydroxylamine-mediated mutagenesis and the primers used for different rounds of PCR: RM-1 & RK-02 in first round of PCR (PCR1), RM-2 & RK-02 in second round of PCR (PCR2), and RK-01 & RK-02 in third round of PCR (PCR3). 24 2.10 Site-directed mutagenesis Polymerase chain reaction (PCR)-mediated site-directed mutagenesis was employed to construct deletion mutants (Figure 2.2) or single amino acid substitution mutants in mitogillin . Sequences of oligonucleotides used to construct mutants are shown in Table 2.1. PCR-mediated site-specific mutagenesis is described in Figure 2.3. RK-01 (forward "universal" primer) was mixed with a reverse mutagenic oligo and RK-02 (reverse "universal" primer) was mixed with a forward mutagenic oligonucleotide; PCR was carried out directly on single E. coli colonies (with pING3522 plasmid) in two separate 100-ul reactions (50 m M KC1, 10 m M Tris-Cl, pH 8.3, 1.5 m M M g C l 2 , 100 pmole of each primer oligonucleotide, and 200 u M of each dNTP). The tubes were heated at 94 °C for 5 minutes before the addition of 2.5 units of Taq polymerase, overlaid with paraffin oil and 30 cycles of PCR carried out (94 °C for 1 min, 55 °C for 2 min, and 72 °C for 3 min). The PCR products were electrophoresed on a 1 % agarose gel and purified using QIAquick gel extraction kit (QIAGEN). Purified PCR products were mixed and the volume was brought to 100 p.1 with 50 m M KC1, 10 m M Tris-Cl, pH 8.3, 1.5 m M M g C l 2 , 200 u M of each dNTP, and 2.5 units of Taq polymerase, and incubated at 94 °C for 1 min, 55 °C for 2 min, and 72 °C for 10 min to achieve the 3' extension of the mixed PCR products. PCR amplification of the mutagenized mitogillin gene was accomplished by adding 100 pmol of each of oligomers RK-01 and R K -02, and 2.5 units of Taq polymerase, overlaid with paraffin oil and reincubated at 94 °C for 1 min, 55 °C for 2 min, and 72 °C for 3 min, for 30 cycles. The final PCR product was purified by electrophoresis followed by QIAquick extraction. The purified fragment was ligated to Pstl-Hindlll digested pING3522 and transformed into E. coli. The nucleotide sequence of each mutant was verified. Production of mutant mitogillin proteins was detected by SDS-25 P A G E (0.1 % SDS/15 % polyacrylamide) of the induced culture supernatants followed by Western blotting using rabbit anti-sera raised against mitogillin. 26 iQ.-Nn AKu-K>« AKiii-Dis AKJO-LZJ AY24-A27 AKM-SJI A | T | W | T | C | I | N | Q | Q | L N | P | K | T | N | K W | E | D | K | R | L | L | Y | N | Q | A | K | A | E | S | PI P 2 M M ADjfr-Keo AGs9-l62 N s H I H J A | P [ L [ S | D | G | K | T | G | S | S | Y | P | H | W | F | T | N | G | Y | D | G [ N | G | K | L | I J 3 _ ARTT-QU K | G | R | T | P | 1 | K | F | G | K A D C I D R | P | P | K | H | S | Q | N | G | M | G | K | D | D | H Y L _B4 L | E | F | P | T F | P | D | G | H | D | Y | K | F | D | S | K | K | P | K | E | D | P | G P [ A | R | V | I | Y | T P4 P5 u Y P ] N | K | V | F | C G | 1 | V | A ] H | Q R | G | N | Q | G D | L | R | L | C S | H | 36 F Figure 2.2. Deletion mutagenesis of mitogillin. Sites of deletion are indicated. Shown also are the secondary structures of mitogillin: p i , beta sheet 1; LI , loop 1; P2, beta sheet 2; HI, alpha helix 1; L2, loop 2; P3, beta sheet 3; L3, loop 3; H2, alpha helix 2; p4, beta sheet 4; L4, loop 4; P5, beta sheet 5; L5, loop 5; P6, beta sheet 6; L6, loop 6; P7, beta sheet 7. 27 Primer Site of Mutagenesis Sequence R K - 0 1 Universal, forward 5 ' - G C G A C T C T C T A C T G T T T C T C C A T - 3 ' R K - 0 2 Universal, reverse 5 ' - G C G T T A G C A A T T T A A C T G T G A T A - 3 ' R K - 0 5 A K | 0 6 - K | | 3 , forward 5 ' - C C A G A T G G A C A T G A C T A C G A G A A T C C A G G T C C A G C A C G - 3 ' R K - 0 6 A K | 0 6 - K | | 3 , reverse 5 ' - C G T G C T G G A C C T G G A T T C T C G T A G T C A T G T C C A T C T G G - 3 ' A U F A D 5 6 - K 6 0 , forward 5 ' - C A G T G G T T C A C G A A T G G A T A C T T A A T C A A G G G T C G T A C G C C A - 3 ' A 1 . 1 R A D 5 6 - K S 0 , reverse 5 ' - T G G C G T A C G A C C C T T G A T T A A G T A T C C A T T C G T G A A C C A G T G - 3 ' A 1 . 2 F A G 5 9 - I 6 2 , forward 5 ' - A C G A A T G G A T A C G A T G G C A A C A A G G G T C G T A C G C C A A T T A A G - 3 ' A 1 . 2 R AG59-Ic2, reverse 5 ' - C T T A A T T G G C G T A C G A C C C T T G T T G C C A T C G T A T C C A T T C G T - 3 ' A1.3F A K 6 3 - I 6 8 , forward 5' - C G A T G G C A A C G G T A A G T T A A T C A A G T T T G G T A A G G C T G A T T G T G A C C - 3 ' A 1 . 3 R A K 6 3 - I 6 8 , reverse 5 ' - G G T C A C A A T T C A G C C T T A C C A A A C T T G A T T A A C T T A C C G T T G C C A T C G - 3 A1.4F A K 6 9 - A 7 3 , forward 5 ' - C A A G G G T C G T A C G C C A A T T G A T T G T G A C C G G C C A C C T A A G - 3 ' A 1 . 4 R A K 6 9 - A 7 3 , reverse 5 ' - C T T A G G T G G C C G G T C A C A A T C A A T T G G C G T A C G A C C C T T G - 3 ' A1.5F A R 7 7 - Q 8 3 , forward 5 ' - T G G T A A G G C T G A T T G T G A C A A T G G A A T G G G T A A G G A C G - 3 ' A 1 . 5 R A R 7 7 - Q 8 3 , reverse 5 ' - C G T C C T T A C C C A T T C C A T T G T C A C A A T C A G C C T T A C C A - 3 ' A1.6F A N 8 4 - K 8 8 , forward 5 ' - C C A C C T A A G C A T T C T C A G G A C G A T C A C T A T C T A T T G G - 3 ' A 1 . 6 R A N 8 4 - K 8 8 , reverse 5' - C C A A T A G A T A G T G A T C G T C C T G A G A A T G C T T A G G T G G - 3 ' A 3 . I F A Q 8 - N | [, forward 5' - G C A A C A T G G A C C T G T A T C A A C C C T A A G A C G A A T A A G T G G - 3 ' A 3 . 1 R A Q 8 - N n , reverse 5 ' - C C A C T T A T T C G T C T T A G G G T T G A T A C A G G T C C A T G T T G C - 3 ' A3.2F A K , 3 - K i 6 , forward 5' - C A A C C A G C A A C T T A A T C C T T G G G A A G A C A A G C G T C T A C - 3 ' A 3 . 2 R A K , 3 - K i 6 , reverse 5' - G T A G A C G C T T G T C T T C C C A A G G A T T A A G T T G C T G G T T G - 3 ' A3.3F A K | 6 - D | 9 , forward 5' - G C A A C T T A A T C C T A A G A C G A A T A A G A G T C T A C T G T A C A A T C A G G - 3 ' A 3 . 3 R A K 1 6 - D | 9 , reverse 5' - C C T G A T T G T A C A G T A G A C G C T T A T T C G T C T T A G G A T T A A G T T G C - 3 ' A3.4F A K 2 o - L 2 3 , forward 5' - G A C G A A T A A G T G G G A A G A C T A C A A T C A G G C T A A G G C T G - 3 ' A 3 . 4 R AK20-U23, reverse 5' - C A G C C T T A G C C T G A T T G T A G T C T T C C C A C T T A T T C G T C - 3 ' A3.5F A Y 2 4 - A 2 7 , forward 5' - G G A A G A C A A G C G T C T A C T G A A G G C T G A A T C T A A C T C T C - 3 ' A 3 . 5 R A Y 2 4 - A 2 7 , reverse 5' - G A G A G T T A G A T T C A G C C T T C A G T A G A C G C T T G T C T T C C - 3 ' A3.6F A K 2 8 - S 3 i , forward 5' - C G T C T A C T G T A C A A T C A G G C T A A C T C T C A T C A T G C A C C G C T C - 3 ' A 3 . 6 R A K 2 8 - S 3 i , reverse 5' - G A G C G G T G C A T G A T G A G A G T T A G C C T G A T T G T A C A G T A G A C G - 3 ' A3.7F A N 3 2 - H 3 5 , forward 5' - C A G G C T A A G G C T G A A T C T G C A C C G C T C T C G G A T G G - 3 ' A 3 . 7 R A N 3 2 - H 3 5 , reverse 5 ' - C C A T C C G A G A G C G G T G C A G A T T C A G C C T T A G C C T G - 3 ' A G ! F A A 3 6 - T 4 3 , forward 5 ' - G C T G A A T C T A A C T C T C A T C A T G G A A G T T C G T A T C C T C A C - 3 ' A G 1 R A A 3 6 - T 4 3 , reverse 5 ' - G T G A G G A T A C G A A C T T C C A T G A T G A G A G T T A G A T T C A G C - 3 ' K 1 1 1 Q F L y s l 11 to G l n l l l 5 ' - C G A T T C T A A G C A A C C T A A G G A - 3 ' K 1 1 1 Q R L y s l 11 to G l n l l l 5 ' - C T C C T T A G G T T G C T T A G A A T C G - 3 ' N 7 A F A s n 7 to Ala7 5 ' - G G A C C T G T A T C G C C C A G C A A C T T A A T C - 3 ' N 7 A R A s n 7 to A l a 7 5 ' - G A T T A A G T T G C T G G G C G A T A C A G G T C C - 3 ' Table 2.1. Oligonucleotides used for site-directed mutagenesis of the mitogillin gene. Oligonucleotides RK-01 and RK-02 were "universal" primers used for site-directed mutagenesis and for D N A sequencing. RK-01 binds upstream of the mitogillin gene near the araC gene, and RK-02 binds near the tet gene in the vector region of pING3522. For detailed information on D N A sequences of plasmid pING3522 and the mitogillin gene, see Better et al. (1992). 28 RK-01 > Pstl RK-01 > Pstl Pstl P C R Forward * > Reverse P C R Js Hindll I Mitogillin RK-02 P C R Hindll i RK-02 Hindll 1 Mutant Mitogillin Figure 2.3. PCR-mediated site-specific deletion/substitution of the mitogillin gene. Shown are the PtI/Hindlll restriction enzyme sites and the relative positions of various PCR primers. The site of deletion/substitution is indicated (*). 29 2.11 P C R - m e d i a t e d mutagenes is o f the L4 r e g i o n A PCR-based mutagenic method was employed to investigate the effect of random changes in amino acid sequence of the L4 region of mitogillin. Substitutions were selected to be of similar size in order to minimize the possibility of disrupting the L4 domain structure; partially degenerate oligonucleotides were used as primers in PCR-mediated site-directed mutagenesis to generate mutants with amino acid substitution(s) in different positions. After mutagenesis, a pool of mutants with different combinations of selected amino acid substitutions was generated, ranging from the wild-type sequence (Lysl06-Phel07-Aspl08-Serl09-Lysl 10-Lysl 11-Prol 12-Lysl 13) of the L4 region to the "totally mutant" sequence (Glnl06-Leul07-Asnl08-Alal09-Glnl 10-Glnl 11-Leul 12-Glnl 13), enabling rapid elucidation of the functional importance of different amino acids. Oligonucleotides used in PCR-mediated mutagenesis are listed in Table 2.2. Mutagenized PCR fragments were cloned into plasmid pING3522 and E. coli W3110 was transformed by electroporation. 30 Oligonucleotide Sequence RK-DegF 5' - (A/C) AA(T/C)TC(G/A) AT(T/G)CT( A/C) AG(A/C) A AC(C/T)T ( A / C ) A G G A G A A T C C A G G T C C A G C A-3 ' RK-DegR 5'-CT(T/G)A(G/A)GTT(T/G)CT(T/G)AG(A/C)AT(C/T)GA(A/G) TT(T/G)GTAGTC ATGTCCATCTGG-3 ' d9KF 5' -C A A T T C T C A G A A ACTTC A G G A - 3 ' d9KR 5' -CTCCTGAAGTTTCTGAGAATTG-3 ' Table 2.2. Oligonucleotides used for site-directed mutagenesis of the L4 region. Oligonucleotides RK-DegF and RK-DegR were partially degenerate primers used to obtain amino acid substitutions in the L4 region of mitogillin. Oligonucleotides d9KF and d9KR were used to generate d9Lysl 11 and Lys l 1 lGln variant mitogillins respectively. 31 2.12 Isolation of mutants with amino acid substitutions in the L4 region of mitogillin Ninety-three single random colonies of recombinants were selected, grown in tryptone broth containing 10 u.g/ml tetracycline, and the L-arabinose-induced culture supernatants were assayed for activity. Briefly, 3.0 ul rabbit reticulocyte lysate and 3.0 ul induced culture supernatant were mixed, incubated at 37 °C for 15 minutes, and the reaction stopped by the addition of 0.5 ul 10% SDS, extracted with 7.0 ul phenol/chloroform and 20.0 ul TE (pH 8.0); 15.0 ul of the aqueous layer were removed for electrophoresis. Extracted R N A was separated by electrophoresis (1.5 % agarose) and R N A species detected by staining with ethidium bromide. The specific ribonucleolytic activity of the toxin derivatives was followed by the appearance of the a-fragment, a 393 nt RNA species (Chan et al., 1983). Recombinants which retained the ability to cleave rabbit ribosomal RNA and produce the a-fragment were classified as functionally active mutants (a-fragment-active mutants) while others were considered functionally defective (a-fragment-inactive mutants); the a-fragment-inactive mutants were analyzed by D N A sequencing. 2.13 Production and purification of mutant mitogillins Proteins were produced in E. coli cells harboring pING3522-derived plasmids containing the mutant mitogillin genes. Protein production was detected by SDS-PAGE (0.1 % SDS/15 % polyacrylamide gel, according to Sambrook et al., 1989) of the induced culture supernatants followed by Western blotting using rabbit anti-sera raised against mitogillin (data not shown). Selected clones were grown at 37 °C to A600 = 0.4 in tryptone broth (containing 10 u.g tetracycline/ml) and induced by the addition of 0.1 % L-arabinose (Sigma) 32 and grown for 18 hours. The culture supernatant was diluted 2 fold with 20 m M Tris-HCl (pH 7.0). Activated SP-Sephadex C-25 (Pharmacia Biotech) was added (3 g/liter of culture supernatant) to the diluted supernatant and the mixture was agitated at 4 °C for 16 hours. The SP-Sephadex C-25 was collected by centrifugation. Bound protein was eluted with 100 ml of 4 M NaCl, the eluate concentrated and desalted using a CentriPrep-10 column (Amicon). The resulting solution was diluted into 25 ml of 20 mM Tris-HCl (pH 7.4) and loaded onto a Mono-S HR 5/5 column (Pharmacia Biotech) pre-equilibrated with 20 m M Tris-HCl, pH 7.4 and eluted with a 0-500 m M NaCl linear gradient. Alternatively, after the induced cultures had grown for 18 hours, the culture supernatant was diluted with an equal volume of deionized distilled water (final pH was adjusted to 7.0 with 10 M NaOH). SP-Sepharose® Fast Flow (Pharmacia Biotech) was added (15 ml/liter of culture supernatant) to the diluted supernatant and the mixture was agitated at 4 °C for 90 minutes. Bound protein was eluted with 100 ml of 2 M NaCl and the eluate was concentrated and desalted using a CentriPrep-10 column (Amicon). The resulting solution was diluted into 5 ml of 50 m M sodium phosphate buffer (pH 7.2) and loaded onto a Mono-S HR 5/5 column (Pharmacia Biotech) pre-equilibrated with 50 m M sodium phosphate buffer (pH 7.2) and eluted with a 0-500 m M NaCl linear gradient. The eluted proteins were concentrated and exchanged into 50 m M sodium phosphate buffer (150 mM NaCl, pH 7.4) using a CentriCon-10 column (Amicon). The concentrated protein solution was loaded directly onto a Superose 12 HR 10/30 gel filtration column (Pharmacia Biotech) and fractions corresponding to mitogillin or its variants were collected. Concentrations of the purified proteins were determined spectrophotometrically using a mitogillin sample provided by Xoma as standards. 33 2.14 Non-specific ribonucleolytic activity against synthetic homopoh nucleotides Ribonucleolytic activity against synthetic homopolynucleotides was assayed by using MicroCon-30 concentrators (Amicon). 200 uM of the homopolymers, poly(A), poly(C), poly(G), poly(I),or poly(U)(Sigma), were digested with various concentrations of mitogillins in 30 ul 10 m M Tris-HCl (pH 7.4) at 37 °C for 30 minutes. The reaction was stopped by the addition of 30 ul of 20 m M Tris-HCl (pH 11.5) and placed on ice. Samples were subsequently loaded onto pre-washed MicroCon-30 concentrators (molecular cut-off = 60 nt for single stranded RNA) and centrifuged at 13800xg for 15 minutes. The concentrators were spun to dryness before applying samples to obtain consistent results. Filtrates (containing degradation products smaller than 60 nucleotides) were collected and absorbances at 260 nm, 271 nm, 253 nm, 248.5 nm, and 262 nm for poly(A), poly(C), poly(G), poly(I), and poly(U) respectively were determined. The percentages of digestion were calculated from the molar absorption coefficients (Sambrook et al., 1989). Alternatively, activities were followed by the degradation of 200 u M poly(I) at 37 °C with 3.0 uM proteins at different time intervals in 30 10 m M Tris-HCl (pH 7.4). In initial rate experiments, 50 nM of each protein was used and the extent of poly(I) homopolymer hydrolysis was less than 10% of the total; MicroCon-100 concentrators (molecular cut-off = 300 nt for single stranded RNA; purchased from Amicon) were used to separate cleavage products from poly(I) homopolymers. 2.15 Non-specific ribonucleolytic activity on MS-2 phage R N A MS-2 phage RNA digestion was carried out by incubating R N A (400 ng ) with 300 n M ribotoxin preparation in 10 ul of reaction buffer (15 m M Tris-HCl ,pH 7.6; 15 m M NaCl, 34 50 m M KC1, 2.5 mM EDTA). The reaction was incubated at 37 °C for 30 minutes, stopped by the addition of 1.0 ul 5 % SDS and the products were separated by electrophoresis (1.2 % agarose, in T A E buffer); the gel was stained with ethidium bromide to monitor the degradation of the R N A substrate. 2.16 Zymogram electrophoresis The presence of contaminating ribonucleases was monitored by using an activity staining assay described by Blank et al. (1982). Briefly, degradation of poly(I) was examined by zymogram electrophoresis as follows: SDS-PAGE of various amounts of each of the purified mitogillin proteins was performed under non-reducing condition on a 0.1 % SDS/15 % polyacrylamide gel containing 0.3 mg/ml poly(I) substrate (Sigma). The gel was treated as described by Blank et al (1982) and incubated in 100 mM Tris-HCl, pH7.4, at 37 °C for 1 hour, stained with 0.2 % toluidine blue for 10 minutes at room temperature and washed extensively with water for 1 hour. RNase activity was detected by the appearance of a clear zone on a dark blue background. 2.17 Specific cleavage of rabbit ribosomal R N A (in vitro a-fragment release) a. Using purified proteins 30 ul reaction mixtures [20.0 ul of untreated rabbit reticulocyte lysate (Promega), 600 nM toxin protein, 15 m M Tris-HCl (pH 7.6), 15 m M NaCl, 50 m M KC1, 2.5 m M EDTA] were incubated at 37 °C for 15 minutes. The reaction was stopped by adding 3.0 ul 10 % SDS. After the addition of 20.0 ul phenol/chloroform the mixture was vortexed briefly to 35 emulsify the solution and diluted with 20.0 u.1 TE (pH 8.0) to enhance the extraction of RNA. The reaction mixtures were centrifuged at 14,000 rpm in a desk-top centrifuge (5415C Eppendorf) for 15 minutes at room temperature, 20.0 u.1 of aqueous layer removed and mixed with 1.0 pi electrophoresis loading buffer (0.025 % bromophenol blue, 0.025 % xylene cyanol FF, 3 % glycerol in water). Samples were heated at 95 °C for 5 minutes before loading onto a 2.0 % agarose gel and electrophoresis was carried out at 200 V in T A E buffer (40 m M Tris-acetate, 1 mM EDTA, pH 8.0) for 20 minutes. The gel was stained with 0.5 (j-g/ml ethidium bromide for 20 minutes. RNA species were visualized on a U V transluminator (312 nM Variable Intensity Transluminator, Fisher Biotech) and photographed using a Photo-documentation Camera (Fisher Biotech). The ribonucleolytic activity of the proteins was followed by the appearance of the cc-fragment, a 393 nt. R N A species on the gel. b. Using induced culture supernatants For the direct screening of mitogillin mutants from induced culture supernatants, a similar protocol was adopted using 3.0 u.1 rabbit reticulocyte lysate and 3.0 u.1 induced culture supernatant; the reaction was stopped by the addition of 0.5 u.1 10% SDS and extracted with 7.0 ul phenol/chloroform and 20.0ul TE (pH 8.0); 15.0LI1 of the aqueous layer was removed for electrophoresis. 36 2.18 Purification of synthetic D N A templates a-sarcin D N A templates were synthesized by Terragen Diversity Inc. according to D N A sequences published by Endo et al. (1988). The synthesized D N A templates were purified by preparative 15% polyacrylamide gel electrophoresis (PAGE); according to Sambrook et al. (1989) as follows: A 10 cm x 6 cm x 1.5 mm denaturing polyacrylamide gel was prepared. After the acrylamide solution was completely polymerized (~ 2 hours), D N A samples were heated with formamide at 90 °C for 2 minutes and loaded (2.0 u,g per lane) on to the gel. Electrophoresis was carried out using a Mini-PROTEAN II Electrophoresis cell (Bio-Rad) at 200 V for 50 minutes using l x T B E as the buffer. The D N A bands were detected by illuminating the gel with short wave U V (254 nm) on a fluorescent background (silica gel 60 F 2 5 4 T L C plates) and subsequently excised and eluted by soaking the gel slices (homogenized with a glass rod) in ddFIjO for a few hours at 4 °C. D N A was concentrated using CentriCon-3 concentrators. 2.19 S R L (35-mer RNA) synthesis using T7 R N A polymerase and synthetic D N A templates The protocol described by Milligan et al. (1987) was adopted, with some modifications, to carry out in vitro transcription of the SRL using T7 R N A polymerase and synthetic D N A templates (Endo et al., 1988) as follows: D N A templates (Figure 2.4) for transcription were prepared by heating the bottom strand (a 52-mer) which contains the T7 promoter region and the a-sarcin loop D N A sequences, with the top strand (an 18-mer) which contains only the promoter region, at 90° C for 2 minutes and then cooling the D N A on ice to allow annealing to occur. Transcriptions were carried out in 40 m M Tris-HCl (pH 37 8.0), 8.0 m M M g C l 2 , 2 mM spermidine-(HCl)3, 25 mM NaCl, 5 m M dithiothreitol (DTT), 0.01% (v/v) Triton X-100 and 80 mg/ml polyethylene glycol (8000 MW). Following the addition of 2.5 mM NTPs (a mixture of GTP, ATP, UTP, and CTP), 100 nM D N A templates, and 5U/LI1 T7 R N A polymerase (BRL), reaction mixtures (100 u.1 per tube) were incubated at 37° C for 3 hours. The reactions were stopped by the addition of 100 ul deionized formamide and 0.1% sodium dodecyl sulfate (SDS). Purification of the RNA products was achieved by employing the same protocol used to purify the D N A templates except that the percentage of the gel was increased to 19% and 10 mM Tris-HCl (pH 7.4) was used to elute the oligoribonucleotides. 38 T7-Promoter (18-mer DNA): Template (DNA 52-mer): 5 ' T A A T A C G A C T C A C T A T A G 3 ' 3 'ATTATGCTGAGTGATATCCCTTAGGACGAGTCATGCTCTCCTTGGCGTCCAA5' T7 R N A polymerase RNA transcript (RNA 35-mer): 5 ' p p p G G G A A U C C U G C U C A G U A C G A G A G G A A C A G A A G G U U 0 H 3 ' SRL Folded U G A C RTA ^ G A G ^ m i t o g i l l i n ^ G G 35-mer A SRL A C u c u — o o — u P —< u — o P u — o < — p < — p o 1 o -o Figure 2.4. Synthesis of the S R L using T7 R N A polymerase and synthetic D N A templates. Shown are the ricin A chain (RTA) depurination site and the mitogillin cleavage site. 39 2.20 Specific cleavage of the synthetic S R L R N A A R N A oligonucleotide (a 35-mer, Figure 2.4) that mimics (with the same nucleotide sequence as the naturally occuring SRL) the SRL of the eukaryotic large subunit rRNA was prepared with synthetic D N A templates, T7 R N A polymerase, and the four nucleotide triphosphates and purified using denaturing polyacrylamide gel electrophoresis. 1.0 p M of the synthetic R N A 35-mer was combined with 600 nM of mitogillin or mutant mitogillins for a total volume of 6.0 u.1 in 10 m M Tris-HCl (pH 7.4), and incubated at 37 °C for 15 minutes. The reaction was stopped by the addition of 4.0 ul deionized formamide and heated at 95 °C for 3 minutes. Cleavage products were separated by denaturing polyacrylamide gel electrophoresis and the gel stained with SYBR-GOLD nucleic acid stain (Molecular Probes). R N A species were detected on a U V transilluminator (312 nM, Variable Intensity Transilluminator, Fisher Biotech) and photographed with a photo-documentation camera (Fisher Biotech). 40 C H A P T E R 3 - P R O B I N G T H E A C T I V E SITE OF M I T O G I L L I N 3.1 Introduction Mitogillin and related ribotoxins are known to have amino acid sequence similarity with Tl-like ribonucleases (Wool, 1984; Lamy et al., 1992) but the specificity of their interaction with the ribosome causing a single ribonucleolytic cleavage in the large subunit rRNA is unique. Previous studies (Lamy et al., 1992) indicated that the amino acid sequence similarities and differences between fungal ribotoxins and a large family of microbial ribonucleases may represent domains or residues essential to ribonucleolytic activity and specificity. The presence of such "extra" protein domains (some of which are similar to sequences in ribosome-associated proteins) in fungal ribotoxins led to the hypothesis that the fungal ribotoxins are a family of naturally engineered toxins with ribosomal targeting elements acquired from different ribosome-associated proteins (Kao and Davies, 1995). The prediction that the mitogillin and related ribotoxins are Tl-like ribonucleases with additional protein domains extended from the catalytic core of the RNase is further supported by analyses of the crystal structure study of restrictocin determined by X-ray analysis (Yang and Moffat, 1996) and the three-dimensional structure study of a-sarcin in solution determined by N M R (Campos-Olivas et al., 1996). These structural analyses, together with other studies (Mancheno et al., 1995; Kao and Davies, 1995) support the proposal that the fungal ribotoxins mimic the action of Tl-like ribonucleases and that residues His49, Glu95, Argl20, and Hisl36 of mitogillin (corresponding to His40, Glu58, Argil, and His92 in ribonuclease T l ) are likely to be involved in the ribonucleolytic activity of the toxin. Mutational studies (Yang and Kenealy, 1992a; Kao and Davies, 1995; Lacadena et al., 1995) have shown that 41 the Hisl36 residue of restrictocin/mitogillin (Hisl37 of a-sarcin) is crucial for the catalytic activity of fungal ribotoxins but the involvement of the other proposed active site residues is less clear. An extensive mutational study of mitogillin was carried out and four variant forms of mitogillin (His49Tyr, Glu95Lys, Argl20Lys, and Hisl36Tyr) were isolated and analyzed in vivo and in vitro. Results presented in sections 3.1 and 3.2 were provided by J. Shea and D. Holden; they were responsible for carrying out hydroxylamine-mediated mutagenesis of the mitogillin gene and the work involving yeast in this project. The results in this chapter have been published in Kao et al. (1998). 3.2 Construction of mitogillin expression vectors The mitogillin gene was cloned from Aspergillus fumigatus cDNA after PCR amplification. Nucleotide sequencing of the mitogillin gene showed variations from the published restrictocin sequence (EMBO ace. no. X56176) at the following nucleotides: First, nucleotide 85 is an A instead of a G and results in an amino acid change from Ser25 to Asn25 (this residue is Ser in restrictocin, Asn in mitogillin). Second, nucleotide 104 is an A instead of a G; however this still remains a proline codon (Pro97). Third, nucleotide 315 is an A instead of a G; again there is no amino acid change (Vail 34). The mitogillin gene was cloned into the yeast expression vector pMW20 in both orientations to give pMIT+ve and pMIT-ve. Yeast transformants containing pMIT-ve and pMW20 were able to grow on both glucose and galactose supplemented media (see materials and methods); however, transformants containing pMIT+ve were unable to grow on galactose supplemented media presumably due to the production of mitogillin which is cytotoxic to the host. 42 3.3 Hydroxylamine mutagenesis of pMIT+ve plasmid and isolation of mitogillin mutants The 30-minute time point in hydroxylamine mutagenesis gave a knockout frequency of 3.15 % for the URA3 gene. As the mitogillin and URA3 genes are approximately the same size and a similar mutagenesis rate has previously been shown to be a suitable level for introducing mutations into a single gene (Guthrie and Fink, 1991), the 30-minute time point was selected to generate mutagenised plasmid D N A which was used to transform DH5ce cells. Approximately 2.5 x 104 transformants were then pooled, plasmid D N A prepared and transformed into S. cerevisiae BJ2168. Approximately 4 x 103 yeast transformants carrying the mutagenised pMIT+ve plasmid D N A were replica plated onto Y N B G A L solid media. 250 colonies appeared (those clones containing a functional mitogillin gene would be unable to grow on galactose) but only 80 were able to form single colonies when re-streaked out onto Y N B G A L solid media. Plasmid D N A was isolated and analysed by restriction digestion; approximately 50 % of the plasmids showed rearrangements and were discarded. Of the 30 mitogillin clones sequenced, one had a mutation of the A T G codon to an A T A codon, 18 had mutations resulting in the introduction of a premature stop codon, 2 had multiple mutations and 9 had single mutations altering amino acid codons (Table 3.1). The ability of yeast strains harboring mutant mitogillin clones to grow on galactose supplemented media (and hence loss of mitogillin function) is summarized in Table 3.2. 43 Clone Nucleotide Change Mutation p Y l G to A Trp3 to T A G pY2 G to A Trp50 to T A G pY9 G to A Cys5 to Tyr G to A Cys75 to Tyr G to A Asp76 to Asn pYlO G to A A T G to A T A p Y l l G to A Trpl7 to TGA pY13 C t o T His49 to Tyr pY15 C t o T His 136 to Tyr pY19 G to A Argl20to Lys pY23 G to A Trp50 to T G A pY24 G to A Trp3 to T A G pY25 C t o T Ala35 to Ala C t o T His 136 to Tyr pY26 G to A Trp 50 to T G A pY27 C t o T Gln8 to T A A C t o T Gln9 to T A G pY28 C t o T Hisl36toTyr pY37 C t o T His 136 to Tyr pY40 G to A Glu95 to Lys pY41 G to A Trp3 to TGA pY42 C t o T Gln9 to T A G pY44 G to A Argl20 to Lys pY45 G to A Trp3 to TGA pY46 G to A Gln83 to T A G pY49 C t o T Gln26 to T A A pY50 C t o T His49 to Tyr pY52 C t o T Gln26 to T A A pY53 G to A Trp50 to T G A pY55 G to A Trp 17 to T G A pY56 G to A Trp50 to T A G pY57 C t o T Gln8 to T A A C t o T Gln9 to T A G pY58 C t o T Gln26 to T A A pY60 C t o T Pro97 to Leu Table 3.1. Mitogillin mutants obtained after hydroxylamine mutagenesis. 44 Plasmid Mutation Growth on galactose Production of protein in E. coli pMIT+ve Wild-type N o Yes p M I T - v e Negative orientation of the gene Yes N o p Y R 9 Cys5Tyr /Cys75Tyr /Asp76Asn Yes N o p Y R 1 3 His49Tyr Yes Yes p Y R 1 5 H i s l 3 6 T y r Yes Yes p Y R 1 9 A r g l 2 0 L y s Yes Yes p Y R 4 0 Glu95Lys Yes Yes p Y R 4 6 G l n 8 3 T A G Yes N o p Y R 6 0 Pro97Leu Yes No * Phe96Leu No Not determined * A r g l 3 8 T G A Yes No * constructed by site-directed mutagenesis Table 3.2. Yeast cytotoxicity assay and production of mutant mitogillins in E. coli. 45 3.4 Cloning of mitogillin mutants into pING3522 The mutagenised mitogillin genes presumed to encode nonfunctional forms of mitogillin derived by hydroxylamine mutagenesis were cloned by PCR and fused to the Erwinia carotovora pelB leader sequence under the control of the tightly regulated Salmonella typhimurium araB promoter, and introduced into Escherichia coli expression vector pING3522 (Better et al., 1992). Double stranded nucleotide sequencing of the cloned regions confirmed that no error had been introduced during these manipulations. The plasmids were transformed into E. coli W3110 for protein expression. 3.5 Production and purification of mutant mitogillins Production of the mutagenised forms of mitogillin by E. coli transformants on growth in liquid culture was detected from clones by Western blotting with rabbit antiserum. Mitogillin and its variant forms were purified by ion-exchange chromatography and size-exclusion chromatography as described previously. SDS-PAGE followed by silver staining of the purified proteins has detected single bands corresponding to the position of mitogillin on the gel (Figure 3.1). The yields were approximately 1 mg per liter of original cell culture. 46 1 2 47 kDa 32 kDa 25 kDa 16.5 kDa 6.5 kDa Figure 3.1. SDS-PAGE of variant mitogillins produced in E. coli. SDS-PAGE of 1.0 |og of mitogillin (lane 1) and its variants (lane 2, His49Tyr; lane 3, Glu95Lys; lane 4, Argl20Lys; and lane 5, Hisl36Tyr) was performed under non-reducing conditions on a 0.1 % SDS/15 % polyacrylamide gel followed by silver staining. 47 3.6 Non-specific ribonucleolytic activity Non-specific substrates (other than ribosomes and SRL) were employed in order to examine the roles of His49, Glu95, Argl20, and Hisl36 mutations on the general RNase activity of mitogillin. Mitogillin digests synthetic homopolymers of ribonucleic acids in the order poly(I) > poly(A) > poly(U) > poly(C) > poly(G) in the assay system employed (Figure 3.2). The comparison between the ribonuclease activities of wild-type mitogillin and the mutants against the poly(I) homopolymer is shown in Figure 3.3. Mutations of His49, Glu95, Argl20, and Hisl36 to Tyr49, Lys95, Lysl20, and Tyrl36 respectively reduced the ribonucleolytic activity to background levels. This conclusion was further supported by results from zymogram electrophoresis in which no ribonuclease activity was detected from the His49Tyr, Glu95Lys, Argl20Lys, and Hisl36Tyr variant mitogillins in the activity staining assay (Figure 3.4). 48 Figure 3.2. Non-specific ribonucleolytic activity of mitogillin against various synthetic RNA homopolymers. 200 uM of the homopolymers, poly(A), poly(C), poly(G), poly(I),or poly(U), were digested with 3.0 uM mitogillin in 30 ul 10 m M Tris-HCl (pH 7.4) at 37 °C for 30 minutes. Results were plotted as percent of RNA degraded. 49 A B Figure 3.3. Non-specific ribonucleolytic activity of mitogillin and its variants against poly(l). Details of the assay conditions are described under "Materials and Methods (section 2.14)". A , results were plotted as percent of poly(I) degradation versus protein concentration. B, results were plotted as percent of poly(I) degradation versus time when 3 L I M of mitogillin or a variant was used. 50 Figure 3.4. Zymogram electrophoretic analyses of variant mitogillins produced in E. coli. SDS-PAGE of 1.0 u.g of mitogillin (lane 1) and its variants (lane 2, His49Tyr; lane3, Glu95Lys; lane 4, Argl20Lys; & lane 5, Hisl36Tyr) was performed under non-reducing conditions on a 0.1 % SDS/15 % polyacrylamide gel containing 0.3 mg poly(I) substrate.The appearance of a clearing zone indicates RNase activity. 5 1 3.7 Specific ribonucleolytic activity Upon treatment of rabbit reticulocyte lysates with 600 nM of purified mitogillin or its variants for 15 minutes (section 2.17), a distinctive cc-fragment band could be detected in the mitogillin incubated sample, but very faint bands corresponding to the cc-fragment position were detected in the His49Tyr, Glu95Lys, Argl20Lys mutants, and even more faintly in Hisl36Tyr mutant (Figure 3.5). This indicated that residual activity was retained in those four single-amino acid substituted mutants. This finding was not surprising as, in mutational studies of RNase T l and other ribonucleases, alterations of single active site residues did not eliminate the catalytic activity of the enzyme, presumably because of compensation by nearby residues in the active site. 52 Figure 3.5. Specific ribonucleolytic activity (in vitro a-fragment release) of mitogillin and its variants. Details of the assay conditions are described under "Materials and Methods (section 2.17)". The arrow marks the position of the a-fragment. Lane 1 contains mitogilin, other samples are: His49Tyr (lane 3), Glu95Lys (lane 4), Argl20Lys (lane 5), and Hisl36Tyr (lane 6). Lane 2 is a negative control (no toxin). Positions of 28S rRNA and 18S rRNA are also indicated. 53 3.8 Discussion By employing mutagenesis with hydroxylamine followed by an in vivo yeast cytotoxic screening assay, five single-amino acid substitution mutants (His49Tyr, Glu95Lys, Pro97Leu, Argl20Lys, and Hisl36Tyr), one triple-amino acid substitution mutant (Cys5Tyr/Cys75Tyr/Asp76Asn), and one truncated mutant (Gln83TAG, Gln83 mutated to a stop codon) of mitogillin were isolated which showed no cytotoxicity when expressed in S. cerevisiae. Mutagenesis with hydroxylamine followed by selection for survival in vivo enabled the identification of individual residues that contribute to the cytotoxic activities of mitogillin without pre-meditated bias. Since hydroxylamine reacts with double stranded D N A to create N4-hydroxy-cytosine which can base pair with adenosine and so results in C to T and G to A transition mutations, this mutagenesis will affect codons which contain C or G; codons for Asn, Lys, Tyr, Phe and He, as well as some Leu codons will not be mutated. PCR mediated cloning of the mutagenized genes of mitogillin into the E. coli expression vector pING3522 was efficient since, by synthesizing two new PCR primers (RM-1 and R M -2; Figure 2.1) and coupling the use of two "universal" PCR primers (RK-01 and RK-02), permitted the fusion of all the variants of mitogillin with the E. carotovora pelB leader sequence and to introduce suitable restriction enzyme sites into the cloning gene fragments. Subsequent expression of the isolated mutant mitogillin genes in E. coli yielded proteins from the His49Tyr, Glu95Lys, Argl20Lys, and Hisl36Tyr clones only (Table 3.2). It is possible that the Cys5Tyr/Cys75Tyr/Asp76Asn, Gln83TAG, and Pro97Leu mutations alter the protein structure leading to degradation by E. coli proteases, and may not represent changes in active site residues. Alterations of Pro and Cys (amino acid residues usually involved in maintaining the structural integrity of proteins) and the truncation of 45 % of 54 mitogillin from the carboxyl-terminus (Gln83TAG mutant) would likely result in conformationally unstable proteins. The importance of the carboxyl-terminus of mitogillin in maintaining its structural stability was confirmed by a site-specific mutation in which Argl38 was changed to a stop codon (Argl38TGA). This truncated mitogillin was not toxic to yeast cells but production could not be detected when over-expressed in E. coli (Table 3.2). These results suggest that inactivation of mitogillin by mutations in residues Cys5/Cys75/Asp76, Gln83, and Pro97 were probably due to disruption of the protein structure. It has previously been suggested that the His49, Glu95-Phe96-Pro97, Argl20, and Hisl36 (corresponding to His40, Glu58-Phe60-Pro61, Arg77, and His92 respectively in ribonuclease T l ) amino acid residues form the active site of mitogillin (Martinez del Pozo et al., 1988). As the Phe96 codon could not be targeted by hydroxylamine mutagenesis, the involvement of this residue in catalysis was examined by constructing a Phe96Leu mutant by site-specific mutagenesis. The resulting Phe96Leu variant was toxic to yeast in in vivo assays (Table 3.2). It is concluded that Phe96 does not play an essential role in the catalytic reaction. When the purified mutant mitogillins were studied in in vitro ribonucleolytic assay systems, it was evident that the His49Tyr, Glu95Lys, Argl20Lys, and Hisl36Tyr mutations severely impair the R N A cleavage capability of mitogillin. These four variants were unable to hydrolyze poly(I) efficiently and their ability to cleave ribosomal R N A was also adversely affected. The detection of residual activity in the His49Tyr, Glu95Lys, Argl20Lys variants and little activity in the Hisl36Tyr variant raises the possibility that neighboring amino acid residues may partially replace the roles of certain mutated active site residues. Since all these mutants were obtained by an in vivo yeast cytotoxicity screening method, it is likely that the minute residual activities of the variants were insufficient to affect the translational 55 machinery of the host. A previous study by Yang and Kenealy (1992a) has shown that a Glu95Gly mutation in restrictocin (which shares 99 % amino acid identity with mitogillin) did not abolish cytotoxicity towards yeast cells. It is reasonable to assume that the Glu95Lys mutation in this study has a more severe impact on the catalytic mechanism of fungal ribotoxins because substitution of glutamic acid with a highly basic lysine residue may destroy the pH environment of the active site and the newly introduced positive-charged lysine residue will definitely have the potentials to repulse other positively-charged residues (such as Argl20) at the active site; this lack of neutralization of the positive charges by a negatively-charged amino acid residue (Glu95 in wild-type mitogillin) may cause rearrangements of other residues at the active site resulting in the inactivation of the enzyme. Mutational studies of RNase T l during the last decade were recently reviewed by Steyaert (1997). Most of the available data support the conclusion that Glu58 (corresponding to Glu95 in mitogillin) and His92 (corresponding to Hisl36 in mitogillin) of RNase T l act as the catalytic base and acid in the transphosphorylation reaction and that His40 (corresponding to His49 in mitogillin) plays the role of base when Glu58 (Glu95 in mitogillin) is substituted by other residues. It has been suggested that Arg77 (Argl20 in mitogillin) may stabilize the transition state of the catalyzed reaction by neutralizing the negative charge developed; however the exact role of Arg77 is less clear since a conformationally stable Argil variant RNase T l has not been available for detailed biochemical study (Steyaert, 1997). The strong structural conservation in the core and the putative catalytic residues between fungal ribotoxins and RNase T l indicates that they share a common catalytic mechanism of R N A cleavage (Yang and Moffat, 1996; Campos-Olivas et al, 1996). Interestingly, Nayak and Batra (1997) described a His49Ala restrictocin variant 56 with elevated ribonucleolytic activity suggesting that this residue may be involved in specific recognition of the ribosomal RNA. However, studies by others (Martinez del Pozo et al., personal communication) did not support this conclusion. Nevertheless, based on the available structural and biochemical data, it is reasonable to conclude that the His49, Glu95, Argl20, and His 136 residues are essential active site residues for the catalytic activity of mitogillin. 57 C H A P T E R 4 - D E L E T I O N M U T A N T S OF M I T O G I L L I N 4.1 Introduction The recognition elements of the structure of the a-sarcin loop in 28S rRNA have been studied extensively (Gluck et al. 1992; 1994) and G4319 was proposed to be the identity element for a-sarcin (Gluck and Wool, 1996). However, very little is known about the ribosome-targeting elements of the protein toxins. As mentioned before (Chapter 1) mitogillin and related ribotoxins are known to share amino acid sequence similarity with T l -like ribonucleases (Table 1.2) and a-sarcin has been shown to behave as a cyclizing ribonuclease as with many other ribonucleases (Lacadena et al. 1998; Perez-Canadillas et al., 1998), but their property to interact specifically with the ribosome and cause a single ribonucleolytic cleavage in the large subunit rRNA is unique. I have suggested earlier that the similarities and differences detected in amino acid sequence comparison of ribotoxins and a large family of other guanyl/purine ribonucleases may represent domains or residues key to ribonucleolytic activity and specificity (Chapter 1). Findings in collaboration with D. Holden's group have confirmed that mitogillin shares the same catalytic residues with many Tl-like ribonucleases. The presence of "extra" protein domains (some of which are similar to sequences in ribosome-associated proteins) in fungal ribotoxins was first described in my preliminary study on the proposal that fungal ribotoxins are a family of naturally engineered toxins with ribosomal targeting elements acquired from different ribosome-associated proteins (Kao and Davies, 1995). The structural analyses of restrictocin by Yang and Moffat (1996) and a-sarcin by Campos-Olivas et al. (1996) have supported my proposal that the ribosomal protein-like region Lysl06-Lysl 13 is the major ribosomal recognition element in 58 mitogillin (Kao and Davies 1995). In order to study the ribosome targeting elements of fungal ribotoxins, fifteen deletion mutants (4 to 8 amino acid deletions) in motifs of mitogillin having little amino acid sequence similarity with guanyl/purine ribonucleases were prepared and their properties examined. The results in this chapter have been published in Kao and Davies (1999); my findings have led to conclusions concerning structural elements of mitogillin (and related ribotoxins) as contributing to the specific cleavage of ribosomes. 4.2 Mitogillin deletion mutant construction and protein purification Fifteen deletion mutants of mitogillin in regions of the protein that were predicted to be functional elements inserted into a Tl-like ribonuclease core structure were constructed. The mutant genes were completely sequenced to confirm the nature of the deletions; no other alterations were detected. Production of mutant proteins on growth in liquid culture was detected from ten clones (Table 4.1) by Western blotting with a rabbit antiserum. SDS-PAGE followed by silver staining of the purified proteins has detected single bands corresponding to the position of mitogillin on the gel (Figure 4.1). 59 Mutant Mitogillin Site of Deletion Production of Protein AQg-Ni i Gln8-Asnl 1 -A K 1 3 - K 1 6 Lysl3-Lysl6 + A K 1 6 - D 1 9 Lysl6-Aspl9 + AK20-L23 Lys20-Leu23 + A Y 2 4 to A 2 7 Tyr24-Ala27 -A K 2 8 to S31 Lys28-Ser31 + A N 3 2 to H35 Asn32-His35 -A A 3 6 to T 4 3 Ala36-Thr43 -A D 5 6 to K 6 0 Asp56-Lys60 + A G 5 9 to I62 Gly59-Ile62 + A K 6 3 to I68 Lys63-Ile68 + A K 6 9 to A 7 3 Lys69-Ala73 -A R 7 7 to Q 8 3 Arg77-Gln83 + A N 8 4 to K 8 8 Asn84-Lys88 + A K 1 0 6 tO K 1 1 3 Lysl06-Lysl l3 + Table 4.1. Production of mutant mitogillin proteins. Production was detected by SDS-P A G E of induced culture supernatants followed by Western blotting using rabbit anti-mitogillin antisera. +, production of protein detected; -,production not detected. 60 1 2 3 4 5 6 7 8 9 1 0 1 1 Figure 4.1. SDS-PAGE of deletion mutant mitogillins. 1 u,g of each mutant protein was subjected to electrophoresis on a 0.1%SDS/15% polyacryamide gel under non-reducing conditions. Presence of protein was detected by silver staining procedures. Lane 1, mitogillin; lane 2, A K 1 3 - K 1 6 mutant; lane 3, AK16-D19 mutant; lane 4, AK20-L23 mutant; lane 5, AK28-S31 mutant; lane 6, AD56-K.60 mutant; lane 7, AG59-I62 mutant; lane 8, AK.63-I68 mutant; lane 9, AR77-Q83 mutant; lane 10, AN84-K88 mutant; and lane 11, AK106-K113 mutant. Shown also are the positions of molecular markers in kilodaltons. 61 4.3 Non-specific ribonucleolytic activity of mitogillin deletion mutants RNase activity of mitogillin and all ten mutant proteins was detected when poly(I) s (Figure 4.2) or MS-2 phage R N A (Figure 4.3) were used as substrates. The comparison between the ribonuclease activities of mutant and wild-type mitogillin using poly(I) homopolymer is shown in Figure 4.2; initial rates of reaction are tabulated in Table 4.2. The data indicate that deleting Lys 13-Lys 16, Lysl6-Aspl9, or Lys20-Leu23 increased the RNase activity; Lys28-Ser31, Arg77-Gln83, or Lysl06-Lysl 13 decreased the RNase activity, while deletion of Asp56-Lys60, Gly59-Ile62, Lys63-Ile68, or Asn84-Lys88 had little effect as judged by the initial rates of ribonucleolytic reaction. Results obtained from the zymogram electrophoresis assay (Figure 4.4) eliminate the possibility of the presence of contaminating ribonucleases in the preparations as this activity staining technique has been demonstrated to detect the presence of less than 10 pg of RNase A (Blank et ai, 1982). 62 10 80 60 40 20 0 «AKi 3-K 1 6 AK20-L23 A K 1 6 - D 1 9 AK63-I6S Mitogillin AG59-I62 ADjs-Keo A N 8 4 - K 8 8 AK 2 8-S 3 1 AK106-Kji3 AR 77-Q 8 3 No toxin 0 20 40 60 80 100 120 140 160 180 200 Time (S) Figure 4.2. Non-specific ribonucleolytic activity of mitogillin and its deletion mutants on poly(I) substrate. Results were plotted as percent of poly(I) degradation versus time when 3 u M of mitogillin or a mutant protein was used. Details of the assay conditions are described under "Materials and Methods (section 2.14)". 63 Protein Activity (uMmin"') a Relative Activity Mitogillin 0.19 + 0.02 1.0 A K , 3 - K , 6 5.33 ± 0.28 27.9 A K 1 6 - D 1 9 4.23 ± 0.23 22.1 AK20-L23 5.00 ± 0.24 26.2 AK28-S31 0.033 ± 0.002 0.2 AD 5 6 -K 6 o 0.24 ± 0.02 1.3 A G 5 9 - l 6 2 0.30 ± 0.02 1.5 AK 6 3 - I 6 8 0.33 + 0.01 1.7 AR77-Q83 0.027 ± 0.001 0.1 A N 8 4 - K 8 8 0.26 ± 0.01 1.4 A K I 0 6 - K , | 3 0.039 ± 0.004 0.2 RNase T l 16.3 ± 0.84 85.1 Table 4.2. Comparison of the ribonucleolytic activity (initial rate of cleavage) of mitogillin, deletion mutant mitogillins, and ribonuclease T l on poly(I) homopolymer. a The activity is defined as p M of poly(I) homopolymer degraded/min (mean + standard deviation for 4 independent experiments). 64 1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 Figure 4.3. MS-2 Phage R N A degradation. The ribonucleolytic activity of the mutant mitogillin proteins was assayed by examining the extent of degradation of MS-2 phage RNA. Lane 1, mitogillin; lane 2, no toxin; lane 3, A K 1 3 -Ki6 mutant; lane 4, AK16-D19 mutant; lane 5, AK20-L23 mutant; lane 6, AK28-S31 mutant; lane 7, AD56-K60 mutant; lane 8, AG 5 9-I 62 mutant; lane 9, AK63-l68 mutant; lane 10, AR 77-Qg 3 mutant; lane 11, ANg^Kgg mutant; and lane 12, AK106-K113 mutant. Details of the assay conditions are described under "Materials and Methods (section 2.15)". 65 1 2 3 4 5 6 7 8 9 10 11 Figure 4.4. Zymogram electrophoresis of deletion mutants. SDS-PAGE of 150 ng of each of the mutant mitogillin proteins was performed under non-reducing condition on a 0.1 % SDS/15% polyacrylamide gel containing 0.3 mg poly(I) substrate (Sigma). RNase activity was indicated by the appearance of a clearing band on the poly(I) containing polyacrylamide gel stained with toluidine blue. Lane 1, mitogillin; lane 2, AK)3-Ki6mutant; lane 3, AK16-D19 mutant; lane 4, AK20-L23 mutant; lane 5, AK28-S31 mutant; lane 6, AD56-K60 mutant; lane 7, AG59-I62 mutant; lane 8, AK63-I68 mutant; lane 9, AR77-Q83 mutant; lane 10, ANg4-Kgg mutant; and lane 11, AK106-K113 mutant. Shown on the left are the positions of molecular markers in kilodaltons. 66 4.4 Specific ribonucleolytic activity On treatment of rabbit reticulocyte lysates with purified mitogillin or the deletion variants, a distinctive a-fragment band was detected in all samples except the ALysl06-Lys l 13 deletion (Figure 4.5). Extensive degradation of 28 S R N A in ribosomes by Lys l3-Leu23 deletion mutants suggests that this region in the fungal ribotoxin is involved in modulating the activity and specific recognition of the cleavage site in the ribosome. Results obtained from assays using synthetic SRL (a 35-mer) as substrate showed that deletions in regions Lysl3-Lysl6, Lysl6-Aspl9, or Lys20-Leu23 gave rise to mitogillin variants with elevated ribonucleolytic activity while deletion of Lysl06-Lysl 13 created a mutant which apparently fails to recognize and cleave the SRL (Figure 4.6). 67 1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 2 8 S r R N A -1 8 S r R N A a - f r a g m e n t — Figure 4.5. Specific ribonucleolytic activity (in vitro a-fragment release) of mitogillin and its deletion variants. Positions of 28 S rRNA, 18 S rRNA, and a-fragment are indicated. Lane 1, mitogillin; lane 2, no toxin; lane 3, AK13-K16 mutant; lane 4, AK16-D19 mutant; lane 5, AK20-L23 mutant; lane 6, AK28-S31 mutant; lane 7, A D 5 6 - K 6 o mutant; lane 8, AG59-I62 mutant; lane 9, AK 63-l68 mutant; lane 10, AR77-Q83 mutant; lane 11, ANg4-Kgg mutant; and lane 12, AK106-K113 mutant. Details of the assay conditions are described under "Materials and Methods (section 2.17)". 68 1 2 3 4 5 6 7 8 9 10 11 12 35-mer 21 -mer 14-mer Figure 4.6. Cleavage of S R L by mitogillin and its deletion variants. Positions of 35-mer, 21-mer, and 14-mer are also indicated. Lane 1, mitogillin; lane 2, no toxin; lane 3, AK13-K16 mutant; lane 4, AK16-D19 mutant; lane 5, AK20-L23 mutant; lane 6, AK28-S31 mutant; lane 7, AD56-K60 mutant; lane 8, AG59-I62 mutant; lane 9, AK63-I68 mutant; lane 10, AR77-Q83 mutant; lane 11, ANg4-Kg8 mutant; and lane 12, AK106-K113 mutant. Details of the assay conditions are described under "Materials and Methods (section 2.20)". 69 4.5 Discussion Structural comparison between the three-dimensional structures of restrictocin (99 % primary amino acid sequence identity with mitogillin) and T l ribonuclease reveals strong structural similarities with certain domains in the fungal ribotoxins absent from the T l ribonucleases; the most obvious differences are the P sheet 1-loop 1-P sheet 2 (B1-L1B2) region, the loop 3 (L3) region, and the loop 4 (L4) region of restrictocin (Figure 4.7). It has been postulated that these domains are "inserted" elements contributing to the specific, targeted, cytotoxicity of this class of proteins; preliminary studies on the L4 region confirmed that this region indeed is the major ribosome-targeting element of mitogillin (Kao and Davies, 1995). I have generated deletions (4-8 amino acid residues) in the regions of mitogillin proposed to be inserted elements. Deletions were preferred over amino acid substitutions for this analysis in order to remove domains that might be responsible for targeting mitogillin to the ribosome, and examine the effects of the absence of these "inserted" regions on the general properties of the fungal ribotoxin. Using the E.coli expression system, ten of the fifteen deletion constructs produced biologically active proteins. It is interesting to note that the five mutant mitogillin proteins which were not produced have deletions located near or extending into elements such as disulfide bridge-forming cysteine residues, proline residues, or helices, which are likely to be susceptible to host protease activity. My results show that the majority of the deletions obtained retain the general RNase catalytic activity of the ribotoxin which supports the proposal that these domains have roles in ribotoxin function distinct from RNase activity. Deletions in L4 and in B1-L1-B2 regions generate mutants with interesting properties in terms of their ribonucleolytic activities. The octapeptide Lysl06-Lysl 13 in the L4 region 70 has sequence similarity to various ribosome-associated proteins (Table 4.3) and the heptapeptide Thrl4-Lys20 in the B1-L1-B2 region is very similar to motifs in various elongation factors (Table 4.4). Although the significance of these similarity has yet to be examined it is noteworthy that the ALysl06-Lysl 13 mutant has lost the ability to recognize and cleave the SRL (Kao and Davies, 1995; Figures 4.5 and 4.6, this chapter), and that the ribonucleolytic activity of the deletion mutants in the B1-L1-B2 region is greatly elevated (20-30 fold higher than that of wild-type mitogillin, Table 4.2). The SRL/restrictocin docking model of Yang and Moffat (1996) suggests that the L4 region of mitogillin is in close proximity to the 28S rRNA identity element (G4319) of the fungal ribotoxin; my results support the conclusion that elements in the L4 domain interact with the "bulged" G4319 in the SRL to promote specific recognition and cleavage of the substrate. Since the B1-L1-B2 region of mitogillin is relatively distant from the catalytic center of the nuclease, the role of this domain in attenuating the catalytic activity of the toxin is intriguing. I propose that this is the result of hydrogen bond formation between amino acid residues in (3 sheet 1 (BI) and (3 sheet 2 (B2), and residues in p sheet 6 (B6) in which the catalytic residue Hisl36 is situated (Figure 4.8). It is possible that the B1-L1-B2 domain attenuates the catalytic activity of the toxin by keeping the catalytic residue Hisl36 in a configuration sub-optimal for nucleolytic activity through hydrogen bonding with B6. Upon binding to the ribosome, the interactions between L4 and the SRL trigger a conformational change in the protein which disrupts the interactions between the B1-L1-B2 domain and B6, so positioning the catalytic residue His 136 in a optimal environment for cleavage of phosphodiester bond of the RNA substrate. A recent report by Shapiro (1998) shows that the enzymatic potency and specificity of human angiogenin are modulated by hydrogen bonds. 71 This raises the intriguing possibility that other substrate specific ribonucleases may also modulate their specific activity by similar mechanisms. Deletions in loop 3 (L 3) region of mitogillin do not appear to interfere with the ribonucleolytic activity or the specificity of mitogillin. The dramatic decrease in RNase activity in AArg77-Gln83 may be due to the deletion of a catalytically important residue(s) or a change in the structure of the toxin affecting its catalytic activity. The latter interpretation is more likely since the proposed active site of mitogillin does not indicate the involvement of any residues in region Arg77-Gln83 for catalysis (Chapter 3). It should be noted that in mitogillin residues Arg77 to Gln83 are very close to Cys75 which forms a disulfide bond with Cys5; deletion of these seven residues presumably induces a change in the micro-environment of the active site of mitogillin and, as a result, reduces R N A cleavage activity. Based on the available information it is not possible to define further the functions of L3 region of mitogillin. Yang and Moffat (1996) suggest that this region may influence mitogillin/cell surface receptor recognition or translocation of the toxin through the lipid bilayer of the cell; mutants constructed in this region would be good candidates to elucidate the functions of this "extra" loop of the fungal ribotoxins. 72 Figure 4.7. Structural comparison of restrictocin and ribonuclease T l . Secondary structures of the proteins are labeled: p i , beta sheet 1; L I , loop 1; P2, beta sheet 2; HI , alpha helix 1; L2, loop 2; P3, beta sheet 3; L3, loop 3; H2, alpha helix 2; p4, beta sheet 4; L4, loop 4; P5, beta sheet 5; L5, loop 5; P6, beta sheet 6; L6, loop 6; p7, beta sheet 7. Positions of the catalytically important residues H 4 9 , E 9 5 , R120, and H i 3 6 of restrictocin and the corresponding residues H 4 0 , E 5 8 , R77, and H 9 2 of ribonuclease T l are also indicated. Noted is the absence of pl-loop 1-P2, loop 3, and loop 4 domains of mitogillin in ribonuclease T l . The coordinates of restrictocin and ribonuclease T l are taken from PDB files 1AQZ (Yang and Moffat, 1996) and 1RNT (Ami et al, 1988) repectively. 73 Protein Source Residues Sequence Mitogillin Restrictocin a-sarcin Ribosomal S12 Ribosomal S12 Ribosomal S12 Ribosomal S12 Ribosomal S12 Mitochondrial S12 Aspergillus restrictus Aspergillus restrictus 106-113 106-113 Aspergillus giganteus 107-114 Thermus aquaticus 119-126 Bacillus stearothermophilus 128-135 Cryptomonas phi 115-122 Zea mays 116-123 Streptococcus pneumoniae 129-136 Marchantia polymorpha 116-123 KFDSKKPK K F D S K K P K KFDSKKPK KYGTKKPK KYGAKKPK KYGAKKPK KYGAKKPK KYGTKKPK KYGTKKPK Table 4.3. Homologous motifs found in ribotoxins and in ribosomal protein S12 from a variety of sources. 74 Protein Source Mitogillin Restrictocin a-sarcin E F - l a EF-2 EF-3 A. restrictus A. restrictus A. giganteus E. gracilis Yeast Yeast Residues Sequence 14-20 14- 20 15- 21 152-158 254 - 260 140- 146 TNKWEDK TNKWEDK TNKYETK TNKFDDK TKKWTNK TNKWQEK Table 4.4. Homologous motifs found in mitogillin and in translation elongation factors. 75 t RI20 S ^ L o o p 6 Loop N 0 Figure 4.8. Hydrogen-bonding between (31-loop 1-02 and [36-loop 6-(37 domains of restrictocin. Loop 1 residues 11-16 are fully exposed to solvent and are consequently missing in the atomic model. Hydrogen bonds are denoted by dashed lines. Amino acid residues not relevant in forming hydrogen bonds are omitted for clarity. 76 C H A P T E R 5 - POINT M U T A T I O N S A F F E C T I N G T H E S P E C I F I C I T Y O F M I T O G I L L I N 5.1 Introduction Extensive studies on the recognition elements of the structure of the SRL of 28S rRNA by Wool and co-workers have shown that G4319 is a crucial identity element for ct-sarcin action (Gluck et al. 1992; 1994; Gluck and Wool, 1996); it was suggested that upon binding to the SRL the toxin uses G4319 for orientation and cleaves the R N A at a fixed position from the binding site; however, the functional aspects of the targeting of the ribotoxins to ribosomes is not clear. Previous mutational studies have identified certain mitogillin residues that are required for the ribonucleolytic activity (Chapter 3) and specificity of this fungal ribotoxin (Chapter 4). It was proposed that the ribosomal protein-like, lysine-rich L4 region of mitogillin (and presumably the corresponding regions in all other fungal ribotoxins) is the major ribosome targeting element and that the B1-L1-B2 domain of mitogillin is involved in substrate selection (Chapter 4). The three dimensional structures of restrictocin (by X-ray chrystallography, Yang and Moffat, 1996) and a-sarcin (by N M R spectroscopy, Campos-Olivas et al. 1996) and subsequent toxin/substrate docking models are consistent with these hypotheses. In order to identify the amino acid residue(s) essential for the ribosome-targeting property of mitogillin, partially degenerate PCR primers were used to mutate residues in the L4 region (Lysl06- Lys l 13). Alteration of Lys l 11 markedly reduced the specific cleavage of SRL but increased non-specific RNase activity, showing the key role of this residue in substrate recognition. 77 In order to investigate the machanistic involvement of the previously identified B l -L1-B2 domain in specific substrate selection, the asparagine residue in the B1-L1-B2 domain at position 7 was substituted by alanine which eliminates the hydrogen bonding between Asn7 and the (3 sheet 6-loop 6-(3 sheet 7 (B6-L6-B7) domain (residues Glyl32-Cysl47, in which the catalytically essential residue Hisl36 is situated; see Figure 4.8). The Asn7Ala mutant mitogillin has elevated ribonucleolytic activity but has reduced selectivity with regard to the specific cleavage site. A hypothesis is presented here to explain the involvement of the L 4 region and the B1-L1-B2 domain of fungal ribotoxins in R N A substrate recognition/selection. 5.2 PCR-mediated mutagenesis and the isolation of mutants in the L4 region A random mixture of recombinants was generated by PCR-mediated mutagenesis (Chapter 2). Of the ninety-three colonies picked and tested, fourteen were a-fragment-inactive (unable to cleave the SRL in ribosomes), and production of a mutant mitogillin was detected by SDS-PAGE followed by Western blotting with a rabbit antiserum in nine of these. The D N A sequences of the mutated genes were determined in order to deduce the resulting amino acid changes and to confirm that no additional amino acid change had been introduced, as shown in Table 5.1. The non-specific RNase activity of a-fragment-inactive mutants was detected by zymogram electrophoresis/activity staining from supernatants of the induced cultures (Figure 5.1). The results indicate that the failure of these mutants to cleave the SRL is not due to the loss of RNase activity. Analysis of the deduced amino acid sequences of these variant mitogillins indicates that the loss of SRL cleavage activity is correlated with alterations at amino acid residue Lys l 11 (Table 5.1); the reversion of Glnl 11 78 substitution to Lys l 11 in mutant d9 (termed d9Lysl 11, with deduced amino acid sequence Glnl06-Phel07-Asnl08-Serl09-Glnl 1 0 - K l l l - L e u l 12-Glnl 13; wild-type residues denoted by bold letters) restored the ability of the variant mitogillin to cleave the rabbit ribosomes and release the a-fragment in vitro (Figure 5.2) suggesting that Lys l 11 is a significant determinant for the specific targeting properties of mitogillin. This result has prompted further analysis of the functional roles of the Lys l 11 residue in substrate recognition by constructing another mitogillin variant with a single amino acid substitution of Lys l 11 by a glutamine residue; the Lys l 1 lGln mutant mitogillin was subsequently expressed and purified to homogeneity (Figure 5.3A). 5.3 Single amino acid substitution in the B1-L1-B2 domain The Asn7Ala mitogillin was constructed on the basis of a mutational study of the B l -L1-B2 domain of mitogillin (Chapter 4) and the analysis of the crystal structure of restrictocin (Yang and Moffat, 1996). The mutant gene was constructed by site-directed mutagenesis, the protein overproduced in E. coli and purified to homogeneity (Figure 5.3A). 79 Clone Mutation(s) Mitogillin AAA TTC GAT TCT AAG AAA CCT AAG Lys Phe Asp Ser Lys L y s Pro Lys a5 AAA TTC GAT TCT CAG CAA CTT CAG Lys Phe Asp Ser Gin Gin Leu Gin a7 CAA CTC GAT GCT AAG CAA CCT CAG Gin Leu Asp Ala Lys Gin Pro Gin b3 CAA CTC GAT TCT AAG CAA CTT CAG Gin Leu Asp Ser Lys Gin Leu Gin c4 CAA CTC AAT GCT AAG CAA CCT CAG Gin Leu Asn Ala Lys Gin Pro Gin e l l CAA CTC GAT GCT CAG CAA CCT CAG Gin Leu Asp Ala Gin Gin Pro Gin d9 CAA TTC AAT TCT CAG CAA CTT CAG Gin Phe Asn Ser Gin Gin Leu Gin e7 CAA CTC GAT TCT AAG CAA CTT CAG Gin Leu Asp Ser Lys Gin Leu Gin e8 CAA TTC GAT GCT CAG CAA CCT CAG Gin Phe Asp Ala Gin Gin Pro Gin flO CAA CTC GAT GCT CAG CAA CCT AAG Gin Leu Asp Ala Gin Gin Pro Lys Table 5.1. DNA and amino acid sequences of 9 a-fragment-inactive mutants isolated from mutagenesis of L4 region (amino acid residues 106 to 113) of mitogillin. Residue 111 is denoted bold. 80 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 E. coli endogenous ribonuclease—• Mitogillin proteins-*-Figure 5.1. RNase activity staining of a-fragment inactive mutants in L4 region of mitogillin by zymogram electrophoresis. SDS-PAGE of 20 ul of supernatant from induced E. coli cultures was performed under non-reduced condition on a 0.1 % SDS/15% polyacrylamide gel containing 0.3 mg poly(I) substrate (Sigma). RNase activity was indicated by clearing on the poly(I) containing polyacrylamide gel stained with toluidine blue. Lane 1, wild-type mitogillin gene; lane 2, truncated mitogillin gene; lane 3, a5 mutant; lane 4, a7 mutant; lane 5, b3 mutant; lane 6, blO; lane 7, c4 mutant; lane 8, c9 mutant; lane 9, c l 1 mutant; lane 10, d9 mutant; lane 11, e7 mutant; lane 12, el2 mutant; lane 13, f7 mutant; lane 14, flO mutant; lane 15, g6 mutant; lane 16, gl2 mutant; lane 17, h8 mutant; lane 18, 150 ng purified mitogillin. 81 12 3 4 2 8 S rRNA-1 8 S rRNA a~ fragment Figure 5.2. Specific ribonucleolytic activity (in vitro a-fragment release) of mitogillin and its variants. Positions of 28 S rRNA, 18 S rRNA, and a-fragment are indicated. Lane 1, mitogillin; lane 2, no toxin; lane 3, d9 mutant; lane 4, d911 IK mutant. Details of the assay conditions are described under "Materials and Methods (section 2.17)". 82 Figure 5.3. SDS-PAGE of mutant mitogillins and their RNase activity on zymogram electrophoresis. A , SDS-PAGE of mutant mitogillins. 1 ug of each mutant protein was separated on a 0.1%SDS/15%polyacryamide gel under non-reducing conditions. Presence of protein was detected by silver staining procedures. B, zymogram electrophoresis. SDS-PAGE of 150 ng of each of the mutant mitogillin proteins was performed under non-reducing condition on a 0.1 % SDS/15% polyacrylamide gel containing 0.3 mg poly(I) substrate (Sigma). RNase activity was indicated by the appearance of a clearing band on the poly(I) containing polyacrylamide gel stained with toluidine blue. Lane 1, mitogillin; lane 2 , Lys l 1 lGln mutant; lane 3, Asn7Ala mutant. Shown also are the positions of molecular markers in kilodaltons. 83 5.4 Enzyme activity assays As previously described, zymogram electrophoresis/activity staining was used to verify that no contaminating ribonuclease co-purified with the mutant mitogillins. It was estimated from the zymogram (Figure 5.3B) that the Lys l 1 lGln mutant has slightly higher activity than native mitogillin and the Asn7Ala mutant has significantly higher activity against poly (I) (judging from the size and the intensity of the zone of clearing ). A quantitative RNase activity determination by measuring the degradation products of poly(I) smaller than 60 nucleotides in length spectrophotometrically confirmed the elevated RNase activity of the mutants (Table 5.2). The specific cleavage of the SRL by mitogillin and its mutant derivatives was compared by their ability to cleave rabbit ribosomes or 35-mer R N A SRL. The results from rabbit ribosome cleavage indicate that the Lys l 1 lGln mutant has decreased activity (judging from the relative amounts of the a-fragment band released after 30 seconds incubation time, Figure 5.4) compared with that of native mitogillin. Increasing the incubation time shows that the Asn7Ala variant cleaves rRNA at many locations in contrast to the native mitogillin which cleaves only the SRL leaving other RNA species intact (Figure 5.4). Results from synthetic SRL cleavage assays show that while mitogillin cleaves the substrate specifically and gives clearly detectable cleavage products (21-mer and 14-mer) at 60 nM concentration, the Asn7Ala mutant cleaves non-specifically and the Lys l 1 lGln mutant fails to cleave (Figure 5.5A). At a higher concentration (600 nM), mitogillin maintains its cleavage specificity, the Asn7Ala mutant digests the substrate completely, and the Lys l 1 l G l n mutant gives multiple cleavage products (Figures 5.5B and 5.5C). 84 Protein Poly(I) degradation (%) Mitogillin 1.5 ±0.26 Lys l 11 Gin 3.1 ±0.22 Asn7Ala 38.8 ± 0.59 Table 5.2. Comparison of the ribonucleolytic activity of mitogillin and variants (LyslllGln and Asn7Ala) against poly(I). 200 u M of poly(I) was treated with 200 nM of mitogillin or variants in 30 pi 10 mM Tris-HCl (pH 7.4) at 37 °C for 10 min. Results are expressed as percentage of poly(I) degraded (mean + standard deviation for 4 independent experiments). 85 Figure 5.4. Specific ribonucleolytic activity (in vitro a-fragment release from rabbit ribosomes) of mitogillin and its variants. 600 n M mitogillin or its variants was used for the assay. Positions of 28 S rRNA (28 S), 18 S rRNA (18 S), and a-fragment (a) are indicated. Samples in lanes 1-4 were incubated at 37 °C for 0.5 min. Samples in lanes 5-8 were incubated at 37 °C for 15 min. Lanes 1 and 5, mitogillin; lanes 2 and 6, no protein; lanes 3 and 7, Lys l 1 lG ln mutant; lanes 4 and 8, Asn7Ala mutant. Details of the assay conditions are described under "Materials and Methods (section 2.17)". 86 Figure 5.5. Synthetic S R L cleavage assay. A, synthetic SRL R N A (1.0 uM) was incubated with 60 nM of mitogillin or its variants at 37 °C for 15 min. B, SRL (1.0 uM) was incubated with 600 nM of mitogillin or its variants at 37 °C for 0.5 min. C, SRL (1.0 uM) was incubated with 600 nM of mitogillin or its variants at 37 °C for 15 min. Lane 1, mitogillin; lane 2, Asn7Ala mutant; lane 3, Lys l 1 lG ln mutant. Lane 4, no protein. Positions of 35-mer, 21-mer, and 14-mer are indicated. Details of the assay conditions are described under "Materials and Methods (section 2.20)". 87 5.5 Discussion Previous studies (Chapter 4) indicated that deletion of residues Lys l 06 to Lys l 13, a lysine-rich loop of mitogillin (termed the L4 region, Yang and Moffat, 1996) that resembles a region of ribosomal protein S12 abolishes the ability of mitogillin to recognize and specifically cleave the SRL, although the non-specific ribonuclease activity in vitro is retained, suggesting that the L4 region is the major SRL recognition element of mitogillin. Amino acid substitutions in this region confirm my previous work and show that Lys l 11 is a significant determinant for the substrate specificity of mitogillin; the purified Lys l 1 lG ln mutant protein exhibits slightly increased non-specific RNase activity (about 2 fold increase compared with the native mitogillin) with reduced ability to cleave the ribosome specifically at the SRL. It is likely that, in mitogillin, the lysine residue at position 111 while increasing recognition of the SRL, suppresses the toxin's interaction with other R N A substrates thus reducing non-specific RNase activity. The crystal structure of restrictocin (Yang and Moffat, 1996) has aided the interpretation of mutational studies of mitogillin. It was shown earlier (Chapter 4) that disruption of a region near the N-terminus of mitogillin (the B1-L1-B2 domain) by site-specific deletions resulted in variants with markedly increased ribonucleolytic activity against various substrates including the rabbit ribosome. Examination of the structure of restrictocin reveals that although the B1-L1-B2 domain is relatively distant from the catalytic core, hydrogen bond formation should occur between amino acid residues in regions Bland B6 (in which the catalytic residue Hisl36 is situated). Notably, Asn7 N5 in the B1-L1-B2 domain is hydrogen-bonded to Hisl36 O and to Glyl39 O in the B6-L6-B6 domain (Figure 5.6). Based on deletion mutant studies (Chapter 4), it was proposed that the L1-B2-L2 88 domain of fungal ribotoxins modulates the catalytic activity of the protein by formation/disruption of hydrogen bonds with the B6-L6-B7 domain. An Asn7Ala replacement (the replacement of Asn by Ala should eliminate potential hydrogen bonding between this residue with Hisl36 and Glyl39) was prepared and examined. The results obtained from analyzing the properties of the mutant indicated that by eliminating a pair of hydrogen bonds formed between the B1-L1-B2 domain and the B6-L6-B7 domain, the ribonuclease activity of the mitogillin markedly increased and the selection of the SRL cleavage site by the toxin became less stringent. It is likely that the B1-L1-B2 domain (which is absent in the T l ribonuclease family) in fungal ribotoxins may enhance the specificity of the enzyme by maintaining the toxin in an "attenuated" form and the ribotoxin thus becomes less active on non-specific substrates. Upon binding to a suitable substrate (in this case, the SRL), a conformational change in the enzyme-substrate complex could be induced that involves the breaking/forming of hydrogen bonds and possibly the rearrangement of the structure of the active site. This conformational change poises the His 136 residue (in the B6-L6-B7 domain) in a catalytically favorable orientation and cleavage of the substrate proceeds in this speculative model; the enzyme flips back to its attenuated form once the enzyme-product complex is disassociated. It is possible that there is an equilibrium between the two populations (attenuated and active forms) of the toxin; the Asn7Ala mutation shifts the equilibrium in favor of the active form of the enzyme at the expense of reducing its substrate specificity. It is interesting to note that the crystal structure of restrictocin indicates two variant forms (chain A and chain B, PDB files 1AQZ). The two conformations are similar but significant differences are observed in the orientation of the Hisl36 residue and the 89 rearrangement of hydrogen bonds formed between the B1-L1-B2 domain and the B6-L6-B7 domain of restrictocin (Figure 5.6). One of the most noticeable differences is that the Hisl36 Ns in chain A is hydrogen-bonded to PO4 03 (not shown) while the Hisl36 ring in chain B is flipped to a different orientation and the formation of hydrogen bond of His 136 Ns with the phosphate ion becomes unfavorable; this suggests that the Asn7 residue is involved in the rearrangement of the hydrogen bonding network affecting the orientation of Hisl36 and the conformation of the active site. Could these two alternative restrictocin conformations represent naturally occurring inter-changeable forms of the fungal ribotoxins? This question remains to be answered. 90 C h a i n A C h a i n B Figure 5.6. Comparison of hydrogen-bonding between B1-L1-B2 and B6-L6-B7 domains of chain A and chain B of restrictocin. Left panel, chain A ; noted is the hydrogen bond formed between Glyl42 O and Hisl36 N5. Right panel, chain B; noted is the flipping of Hisl36 N8 to a position unfavorable for hydrogen bonding with Glyl42 O, and the formation of new hydrogen bonds between Argl45 Nr|2 and Ile6 O, and between Asn7 08 and Gln9 Ne. Loop 1 residues 11-16 are fully exposed to solvent and are consequently missing in the atomic model. Hydrogen bonds are denoted by dotted lines and bond distances indicated in A. Shown also is the disulfide bridge (in yellow) formed by residues Cys5 and Cysl47. Amino acid residues not relevant in bond formation are omitted for clarity. The coordinates of restrictocin are taken from PDB files 1AQZ (Yang and Moffat, 1996). 91 C H A P T E R 6 - C O N C L U S I O N S A N D F U T U R E D I R E C T I O N S In summary, the active site of mitogillin has been probed (in collaboration with J. Shea and D. Holden) by hydroxylamine mediated mutagenesis followed by in vivo yeast cytotoxicity screening and in vitro ribonucleolytic assays. The results are consistent with predictions of the active site of fungal ribotoxins based on the crystal structure of restrictocin (Yang and Moffat, 1996) and the N M R structure of a-sarcin (Campos-Olivas et al., 1996). With the availability of these well-characterized mutants, it should be possible to examine the precise catalytic function of individual active site residues in mitogillin and related fungal ribotoxins. I have also described the production and properties of ten deletion mutants of mitogillin, predicated on the hypothesis that motifs showing little amino acid sequence similarity with guanyl/purine ribonucleases are functional domains inserted into Tl-like ribonucleases through natural genetic engineering. Characterization of the enzymatic properties of the mutant proteins suggests that elements in L4 region of mitogillin are involved in the specific recognition of the ribosomal target (SRL) and elements in B1-L1B2 domain are involved in modulating the catalytic activity of the toxin. These studies also suggest that L3 region of mitogillin may be involved in functions other than targeting of mitogillin to the ribosome. Furthermore, information obtained from my analyses of the Lys l 1 lG ln and Asn7Ala mutants suggests that both the L4 region and the B1-L1-B2 domain of mitogillin (and presumably other members of the fungal ribotoxin family) contribute to the exquisite specificity of the toxin for the SRL in ribosomes. The Lys l 11 residue in L4 may play a 92 important role in recognizing/binding to the SRL, with the Asn7 residue in the B1-L1-B2 domain modulates the catalytic activity of the toxin. This proposed dual control mechanism for specificity (which may be concerted or sequential) may explain why the fungal ribotoxins are poor general ribonucleases but are extremely specific and potent inhibitors of protein synthesis. It is evident that these additional elements (some are ribosome-related), which appear to have been engineered naturally into Tl-like ribonucleases, are not required for RNase activity but have functions specific to cytotoxic activity. The availability of the mutants reported in this thesis will aid in further investigation of the biochemical and physiological roles of fungal ribotoxin function. An interesting question is whether it will be possible to insert such targeting motifs into other enzyme sequences to generate other types of ribosome-specific toxins. During the course of my quest to obtain an understanding of the properties/functions of fungal ribotoxins, the biochemical data generated from my mutational studies have elicited interest from others in the field of ribotoxin research. Besides the collaboration between our laboratory and Holden's laboratory in England to probe the active site of mitogillin (Chapter 3), close collaborations have also been initiated with other major laboratories in this field. In particular, collaboration with Gavilanes' group in Madrid, Spain, has led to a study of the occurrence of fungal ribotoxins in nature (Martinez-Ruiz et al., 1999) and the membrane translocation properties of various mitogillin mutants. Studies are also ongoing with Crameri's group in Davos, Switzerland, to examine the IgE binding properties of various fungal ribotoxins and mutants of mitogillin generated in the work I have described. 93 R E F E R E N C E S Arn i , R., Heinemann, U . , Tokuoka, R., and Saenger, W. 1988. Three-dimensional structure of the ribonuclease T l 2'-GMP complex at 1.9-A resolution. J. Biol. Chem. 263, 15358-15368. Arruda, L . K . , Platts-Mills, T.A., Fox, J.W., and Chapman, M . D . 1990. Aspergillus fumigatus allergen I, a major IgE-binding protein, is a member of the mitogillin family of cytotoxins. J. Experi. Med. 172: 1529-1532. Arruda, L . K . , Mann, B.J . , and Chapman, M.D. 1992. Selective expression of a major allergen and cytotoxin, Asp f I, in Aspergillus fumigatus. Implications for the immunopathogenesis of Aspergillus-related diseases. J. Immunology. 149: 3354-3359. Barciszewska, M . Z . , Lorenz, S., Joachimiak, A. , Ulbrich, N . , Erdmann, V . A . , and Barciszcwski, J . 1990. New model of tertiary structure of plant 5S rRNA is confirmed by digestion with alpha-sarcin. FEBS Lett. 269: 83-85. Better, M . , Bernhard, S.L., Lei , S.P., Fishwild, D . M . , and Carroll , S.F. 1992. Activity of recombinant mitogillin and mitogillin immunoconjugates. J. Biol. Chem. 267: 16712-16718. Blank, A. , Sugiyama, R . H . , and Dekker, C A . 1982. Activity staining of nucleolytic enzymes after sodium dodecyl sulfate-polyacrylamide gel electrophoresis: use of aqueous isopropanol to remove detergent from gels. Anal. Biochem. 120: 267-275. Bodey, G.P., and Vartivarian, S. 1989. Aspergillosis. European J. Clin. Microbiol, and Infect. Dis. 8:413-437. 94 Boon, T. 1972. Inactivation of ribosomes in vitro by colicin E3 and its mechanism of action. Proc. Natl. Acad. Sci. USA 69: 549-552. Bowman, C M . , Sidikaro, J . , and Nomura, M . 1971. Specific inactivation of ribosomes by colicin E3 in vitro and mechanism of immunity in colicingenic cells. Nature New Biol . 234: 133-137. Brandhorst, T.T., and Kenealy, W.R. 1992. Production and localization of restrictocin in Aspergillus restrictus. J. Gen. Microbiol. 138: 1429-1435. Brandhorst, T., Dowd, P.F., and Kenealy, W.R. 1996. The ribosome-inactivating protein restrictocin deters insect feeding on Aspergillus restrictus. Microbiology 142: 1551-1556. Brigotti, M . , Rambelli, F., Zamboni, M . , Montanaro, L . , and Sperti, S. 1989. Effect of alpha-sarcin and ribosome-inactivating proteins on the interaction of elongation factors with ribosomes. Biochem. J. 257: 723-727. Campos-Olivas, R., Bruix, M . , Santoro, J . , Martinez del Pozo, A. , Lacadena, J . , Gavilanes, J .G. , and Rico, M . 1996. Structural basis for the catalytic mechanism and substrate specificity of the ribonuclease alpha-sarcin. FEBS Lett. 399: 163-165. Chan, Y . L . , Endo. Y . , and Wool, I.G. 1983. The sequence of the nucleotides at the a-sarcin cleavage site in rat 28S ribosomal ribonucleic acid. J. Biol. Chem. 258: 12768-12770. Conde, F.P., Orlandi, R., Canvevari, S., Mezzanzanica, D., Ripamonti, M . , Munoz, S.M., Jorge, P., and Colnaghi, M. I . 1989. The Aspergillus toxin restrictocin is a suitable cytotoxic agent for generation of immunoconjugates with monoclonal antibodies directed against human carcinoma cells. Eur. J. Biochem. 178: 795-802. 95 Correll, C C , Munishkin, A. , Chan, Y . L . , Ren, Z. , Wool, I.G., and Steitz, T.A. 1998. Crystal structure of the ribosomal RNA domain essential for binding elongation factors. Proc. Natl. Acad. Sci. USA. 95: 13436-13441. Crameri, R., Faith, A. , Hemmann, S., Jaussi, R., Ismail, C , Menz, G. , and Blaser, K . 1996a. Humoral and cell-mediated autoimmunity in allergy to Aspergillus fumigatus. J. Exp. Med. 184: 265-270. Crameri, R., Lidholm, J. , Gronlund, H . , Stuber, D., Blaser, K . , and Menz, G . 1996b. Automated specific IgE assay with recombinant allergens: evaluation of the recombinant Aspergillus fumigatus allergen I in the Pharmacia Cap System. Clin. Exp. Allergy. 26: 1411-1419. D'Alatr i , L . , D i Massimo, A . M . , Anastasi, A . M . , Pacilli, A . , Novelli,S., Saccinto, M.P . , De Santis, R., Mele, A . , and Parente, D. 1998. Production and characterisation of a recombinant single-chain antiErbB2-clavin immunotoxin. Anticancer Res.18: 3369-3373. Dosio, F., Arpicco, S., Adobati, E. , Canevari, S., Brusa, P., De Santis, R., Parente, D., Pignanelli, P., Negri, D.R., Colnaghi, M . L , and Cattel, L . 1998. Role of cross-linking agents in determining the biochemical and pharmacokinetic properties of Mgr6-clavin immunotoxins. Bioconjug. Chem. 9: 372-381. Endo, Y . , and Wool, I.G. 1982. The site of action of alpha-sarcin on eukaryotic ribosomes. The sequence at the alpha-sarcin cleavage site in 28S ribosomal ribonucleic acid. J. Biol . Chem. 257: 9054-9060. Endo, Y . , Mitsui, K . , MotiZuki M . , and Tsurugi K . 1987. The mechanism of action of ricin and related toxic letins on eukaryotic ribosomes. The site and the characteristics of the modification in 28S ribosomal RNA caused by the toxins. J. Biol. Chem. 262: 5908-5912. 96 Endo, Y . , Chan, Y . L . , L i n , A . , Tsurugi, K . , and Wool, I.G. 1988. The cytotoxins alpha-sarcin and ricin retain their specificity when tested on a synthetic oligoribonucleotide (35-mer) that mimics a region of 28S ribosomal ribonucleic acids. J. Biol. Chem. 263: 7917-7920. Endo, Y . , Gluck, A. , Chan, Y . L . , Tsurugi, K . , and Wool, I.G. 1990. RNA-protein interaction. A n analysis with RNA oligonucleotides of the recognition by alpha-sarcin of a ribosomal domain critical for function. J. Biol. Chem. 265: 2216-2222. Endo, Y . , Oka, T., and Aoyama, Y . 1992. An efficient expression system for alpha-sarcin in Escherichia coli. Targeted Diagnosis & Therapy. 7: 259-269. Endo, Y . , Oka, T., Tsurugi, K . , and Natori, Y . 1993a. The biosynthesis of a cytotoxic protein, alpha-sarcin, in a mold Aspergillus giganteus. I. Synthesis of prepro- and pro-alpha-sarcin in vitro. Tokushima J. Exper. Med. 40: 1-6. Endo, Y . , Oka, T., Tsurugi, K . , and Natori, Y . 1993b. The biosynthesis of a cytotoxic protein, alpha-sarcin, in a mold Aspergillus giganteus. II. Maturation of precursor form of alpha-sarcin in vivo. Tokushima J. Exper. Med. 40: 7-12. Fando, J .L. , Alaba, I., Escarmis, C. Fernandez-Luna, J .L. , Mendez E. , and Salinas, M . 1985. The mode of action of restrictocin and mitogillin on eukaryotic ribosomes. Inhibition of brain protein synthesis, cleavage and sequence of the ribosomal R N A fragment. Eur. J. Biochem. 149: 29-34. Fernandez-Luna, J .L. , Lopez-Otin, C , Soriano, F., and Mendez, E . 1985. Complete amino acid sequence of the Aspergillus cytotoxin mitogillin. Biochem. 24: 861-867. Fernandez-Puentes, C , and Carrasco, L . 1980. Viral infection permeabilizes mammalian cells to protein toxins. Cell 20: 769-775. 97 Fernandez-Puentes, C. 1983. Permeability to alpha-sarcin in virus-infected cells. Moi . & Cell. Biochem. 50: 185-191. Fernandez-Puentes, C. 1984. Permeability to inhibitors of protein synthesis in virus infected cells. Molec. Biol. Reports. 10: 65-68. Fong, W.P., Wong, R.N.S., Go, T .T .M. , and Yeung, H.W. 1991. Enzymatic properties of ribosome-inactivating proteins (RIPs) and related toxins. Life Sciences 49: 1859-1869. Gao, W., Ling, J . , Zhong, X . , L i u , W., Zhang, R., Yang, EL, Cao, FL, and Zhang Z . 1994. Luffin-S: a small novel ribosome-inactivating protein from Luffa cylindrica. Characterization and mechanism studies. FEBS Lett. 374: 257-260. Gasset, M . , Martinez del Pozo, A. , Onaderra, M . , and Gavilanes, J .G. 1989. Study of the interaction between the antitumour protein alpha-sarcin and phospholipid vesicles. Biochem. J. 258: 569-575. Gasset, M . , Onaderra, M . , Goormaghtigh, E. , and Gavilanes, J .G. 1991. Acid phospholipid vesicles produce conformational changes on the antitumour protein alpha-sarcin. Biochim. Biophys. Acta. 1080: 51-58. Gasset, M . , Mancheno, J . M . , Laynez, J . , Lacadena, J . , Fernandez-Ballester, G. , Martinez del Pozo, A. , Onaderra, M . , and Gavilanes, J .G. 1995. Thermal unfolding of the cytotoxin alpha-sarcin: phospholipid binding induces destabilization of the protein structure. Biochim. Biophys. Acta. 1252: 126-134. Gluck, A . , Endo, Y . , and Wool, I.G. 1992. Ribosomal R N A identity elements for ricin A -chain recognition and catalysis. Analysis with tetraloop mutants. J. Moi. Biol. 226: 411-424. 98 Gluck, A . , Endo, Y . , and Wool, I.G. 1994. The ribosomal RNA identity elements for ricin and for alpha-sarcin: mutations in the putative C G pair that closes a G A G A tetraloop. Nucle. Acids Res. 22: 321-324. Gluck, A . , and Wool, I.G. 1996. Determination of the 28S ribosomal R N A identity element (G4319) for alpha-sarcin and the relationship of recognition to the selection of the catalytic site. J. Moi . Biol. 256: 838-848. Guthrie, C , and Fink, G.R. 1991. Guide to yeast genetic and molecular biology. Methods Enzymol. 194. Hausner T.P., and Nierhaus, K . H . 1988. Resistance of both the 5'- and 3'-domain of isolated Escherichia coli 23S rRNA against digestion with alpha-sarcin. Biochem. Intern. 17: 617-627. Hemmann, S., Nikolaizik, W.H. , Schoni, M . H . , Blaser, K . , and Crameri, R. 1998. Differential IgE recognition of recombinant Aspergillus fumigatus allergens by cystic fibrosis patients with allergic bronchopulmonary aspergillosis or Aspergillus allergy. Eur. J. Immunol. 28: 1155-1160. Hemmann, S., Menz, G. , Ismail, C , Blaser, K . , and Crameri, R. 1999. Skin test reactivity to 2 recombinant Aspergillus fumigatus allergens in A. fumigatus-sensitized asthmatic subjects allows diagnostic separation of allergic bronchopulmonary aspergillosis from fungal sensitisation. J. Allergy Clin. Immunol, (in press). Henze, P.P., Hahn, U . , Erdmann, V . A . , and Ulbrich, N . 1990. Expression of the chemically synthesized coding region for the cytotoxin alpha-sarcin in Escherichia coli using a secretion cloning vector. Euro. J. Biochem. 192: 127-131. 99 Hertler, A . A . , and Frankel, A . E . 1989. Immunotoxins: a clinical review of their use in the treatment of malignancies. J. Clin. Onoc. 7: 1932-1942. Hibberd, P .L. , and Rubin, R . H . 1994. Clinical aspects of fungal infection in organ transplant recipients. Clin. Infect. Dis. 19: S33-40. Higuchi, R., Krummel, B. , and Saiki, R . K . 1988. A general method of in vitro preparation and specific mutagenesis of D N A fragments: study of protein and D N A interactions. Nucleic Acids Res. 16: 7351-7367. Hobden, A . N . 1978. Ph. D. Dissertation, University of Leicester, Leicester, U .K . Hoffman, C.S., and Winston, F. 1987. A ten-minute D N A preparation from yeast efficiently releases autonomous plasmid for transformation of Escherichia coli. Gene. 57: 267-272. Holmberg, L . , and Nygard, O. 1994. Interaction sites of ribosome-bound eukaryotic elongation factor 2 in 18S and 28S rRNA. Biochem. 33: 15159-15167. Huber, P.W., and Wool, I .G. 1984. Nuclease protetion analysis of ribonucleoprotein complexes: use of the cytotoxic ribonuclease alpha-sarcin to determine the binding sites for Escherichia coli ribosomal proteins L5, L I 8, and L25 on 5S rRNA. Proc. Nat. Acad. Sci. U S A 81: 322-326. Huber, P.W., and Wool, I .G. 1986a. Use of the cytotoxic nuclease alpha-sarcin to identify the binding site on eukaryotic 5S ribosomal ribonucleic acid for the ribosomal protein L5. 1986. J. Biol. Chem. 261: 3002-3005. Huber, P.W., and Wool, I .G. 1986b. Identification of the binding site on 5S rRNA for the transcription factor III A: proposed structure of a common binding site on 5S rRNA and on the gene. Proc. Nat. Acad. Sci. USA 83: 1593-1597. 100 Huber, P.W., and Wool, I.G. 1988. Use of alpha-sarcin to analyze ribosomal RNA-protein interactions. Methods in Enzymology. 164: 468-475. Huang, K . - C . , Hwang, Y . - Y . , Hwu, L . , and L in , A . 1997. Characterization of a new ribotoxin gene (c-sar) from Aspergillus clavatus. Toxicon. 35, 383-392. Ikegami, Y . , Amitani, R., Murayama, T., Nawada, R., Lee, W.J . , Kawanami, R., and Kuze, F. 1998. Effects of alkaline protease or restrictocin deficient mutants of Aspergillus fumigatus on human polymorphonuclear leukocytes. Eur. Respir. J. 12: 607-611. Ito, H . , Fukada, Y . , Murata, K . , and Kimura, A . (1983) Transformation of intact yeast cells treated with alkali cations. J. Bacteriol. 153: 163-168. Kao, R., and Davies, J . 1995. Fungal ribotoxins: a family of naturally engineered targeted toxins? Biochem. Cell Biol. 73: 1151-1159. Kao, R., Shea, J.E., Davies, J . , and Holden, D.W. 1998. Probing the active site of mitogillin, a fungal ribotoxin. Molec. Microbiol. 29: 1019-1027. Kao, R., and Davies, J . 1999. Molecular dissection of mitogillin reveals that the fungal ribotoxins are a family of natural genetically-engineered ribonucleases. J. Biol. Chem. 274: 12576-12582. Kurup, V.P . , Kumar, A. , Kenealy, W.R., and Greenberger, P.A. 1994. Aspergillus ribotoxins react with IgE and IgG antibodies of patients with allergic bronchopulmonary aspergillosis. J. Lab. & Clin. Med. 123: 749-756. Lacadena, J . , Martinez del Pozo, A. , Barbero, J .L. , Mancheno, J . M . , Gasset, M . , Onaderra, M . , Lopez-Otin, C , Ortega, S., Garcia, J . , and Gavilanes, J .G. 1994. Overproduction and purification of biologically active native fungal alpha-sarcin in Escherichia coli. Gene. 142: 147-151. 101 Lacadena, J . , Mancheno, J . M . , Martinez-Ruiz, A. , Martinez del Pozo, Gasset, M . , Onaderra, M . , and Gavilanes, J .G. 1995. Substitution of histidine-137 by glutamine % abolishes the catalytic activity of the ribosome-inactivating protein a-sarcin. Biochem. J. 309: 581-586. Lacadena, J . , Martinez del Pozo, A. , Lacadena, V. , Martinez-Ruiz, A. , Mancheno, J . M . , Onaderra, M . , and Gavilanes, J .G. 1998. The cytotoxin a-sarcin behaves as a cyclizing ribonuclease. FEBS Lett. 424: 46-48. Lamy, B. , and Davies, J . 1991. Isolation and nucleotide sequence of the Aspergillus restrictus gene coding for the ribonucleolytic toxin restrictocin and its expression in Aspergillus nidulans: the leader sequence protects producing strains from suicide. Nucleic Acids Res. 19: 1001-1006. Lamy, B., Moutaouakil, M . , Latge, J.P., and Davies, J . 1991. Secretion of a potential virulence factor, a fungal ribonucleotoxin, during human aspergillosis infections. Molecular Microbiol. 5: 1811-1815. Lamy, B. , Davies, J . , and Schindler, D. 1992. The Aspergillus Ribonucleolytic Toxins (Ribotoxins). In Genetically Engineered Toxins. Ed. A.E . Frankel. Marcel Dekker. New-York. pp.237-257. L i n , A . , Chen, C .K . , and Chen, Y . J . 1991. Molecular action of tricholin, a ribosome-inactivating protein isolated from Trichoderma viride. Moi. Microbiol. 5: 3007-3013. L i n , A . , Hung, K . C . , Hwu, L . , and Tzean, S.S. 1995. Production of type II ribotoxins by aspergillus species and related fungi in Taiwan. Toxico. 33: 105-110. L i n , A . , Ciou-Jau, C , and Tzean, S.S. 1997. EMBL/GenBank/DDBJ databases, accession numbers AF012812-AF012817. 102 Lopez-Otin, C , Barber, D., Fernandez-Luna, J .L. , Soriano, F., and Mendez, E . 1984. The primary structure of the cytotoxin restrictocin. Eur. J. Biochem. 143: 621-634. Mancheno, J . M . , Gasset, M . , Lacadena, J . , Martinez Del Pozo, A. , Onaderra, M . , and Gavilanes, J .G. 1995. Predictive study of the conformation of the cytotoxic protein a-sarcin: a structural model to explain a-sarcin-membrane interaction. J. Theor. Biol . 172: 259-267. Mancheno, J . M . , Martinez del Pozo, A. , Albar, J,P., Onaderra, M . , and Gavilanes, J ,G . 1998. A peptide of nine amino acid residues from alpha-sarcin cytotoxin is a membrane-perturbing structure. J. Pept. Res. 51: 142-148. Martinez, S.E., and Smith, J .L . 1991. Crystallization and preliminary characterization of mitogillin, a ribosomal ribonuclease from Aspergillus restrictus. J. Moi . Biol . 218: 489-492. Martinez-Ruiz, A . , Kao, R., Davies, J . , and Martinez del Pozo A . 1999. Ribotoxins are a more widespread group of proteins within the filamentous fungi than previous believed. Toxicon. 37: 1549-1563. Martinez-Ruiz, A . , del Pozo, A . M . , Lacadena, J . , Mancheno, J . M . , Onaderra, M . , Lopez-otin, C , and Gavilanes, J ,G. 1998. Secretion of recombinant pro- and mature fungal alpha-sarcin ribotoxin by the methylotrophic yeast Pichia pastoris: the Lys-Arg motif is required for maturation. Protein Expr. Purif. 12: 315-322. Mil ler , S.P., and Bodley, J .W. 1988a. Alpha-sarcin cleaves ribosomal R N A at the alpha-sarcin site in the absence of ribosomal proteins. Biochem. Biophys. Res. Commun. 154: 404-410. Mil ler , S.P., and Bodley, J .W. 1988b. The ribosomes of Aspergillus giganteus are sensitive to the cytotoxic action of alpha-sarcin. FEBS Lett. 229: 388-390. 103 Milligan, J.F., Groebe, D.R., Witherell, G.W., and Uhlenbeck, O.C. 1987. Oligoribonucleotide synthesis using T7 RNA polymerase and synthetic D N A templates. Nucl. Acids Res. 15: 8783-8798. Moazed, D., Robertson, J . M . , and Noller, H.F. 1988. Interaction of elongation factors EF-G and EF-Tu with a conserved loop in 23 S RNA. Nature. 334: 362-364. Moser, M . , Crameri, R., Menz, G. , Schneider, T., Dudler, T., Virchow, C , Gmachl, M . , Blaser, K . , and Suter, M . 1992. Cloning and expression of recombinant Aspergillus fumigatus allergen I/a (rAsp f I/a) with IgE binding and type I skin test activity. J. Immunology. 149: 454-460. Nayak, S.K. & Batra, J .K . 1997. A single amino acid substitution in ribonucleolytic toxin restrictocin abolishes its specific substrate recognition activity. Biochemistry. 36: 13693-13699. Obrig, T .G. , Moran, T.P., and Brown, J .E. 1987. The mode of action of Shiga toxin on peptide elongation of eukaryotic protein synthesis. Biochemical J. 244: 287-294. Oka, T., Natori, Y . , Tanaka, S., Tsurugi, K . , and Endo, Y . 1990. Complete nucleotide sequence of cDNA for the cytotoxin alpha-sarcin. Nucle. Acids Res. 18: 1897. Oka, T., Aoyama, Y . , Natori, Y . , Katano, T., and Endo, Y . 1992. An efficient expression system for a variant form of the cytotoxic protein alpha-sarcin in Escherichia coli. Biochim. Biophys. Acta. 1130: 182-188. Olson, B . H . and Goerner, G .L . 1965. Alpha sarcin, a new antitumor agent. I. Isolation, purification, chemical composition, and the identity of a new amino acid. Applied Microbiol. 13: 314-321. 104 Olson, B .H. , Jennings, J.C., Roga, V. , Junek, A . J . and Schuurmans, D . M . 1965. Alpha sarcin, a new antitumor agent. II. Fermentation and antitumor spectrum. Applied Microbiol. 13: 322-326. Onaderra, M . , Mancheno, J . M . , Lacadena, J . , de los Rios, V . , Martinez del Pozo, A. , and Gavilanes, J .G. 1998. Oligomerization of the cytotoxin alpha-sarcin associated with phospholipid membranes. Moi . Membr. Biol. 15: 141-144 Orlandi, R., Canevari, S., Conde, F.P., Leoni, F., Mezzanznaica, D., Ripamonti, M . , and Colnaghi, M. I . 1988. Immunoconjugate generation between the ribosome-inactivating protein restrictocin and an anti-human breast carcinoma M A B . Cancer Immunology/ Immunotherapy. 26: 114-120. Parente, D., Raucci, G., Celano, B. , Pacilli, A . , Zanoni, L . , Canevari, S., Adobati, E . , Colnaghi, M . L , Dosio, F., Arpicco, S., Cattel, L . , Mele, A . , and De Santis, R. 1996. Clavin, a type-1 ribosome-inactivating protein from Aspergillus clavatus IFO 8605. cDNA isolation, heterologous expression, biochemical and biological characterization of the recombinant protein. Eur. J. Biochem. 239: 272-280. Parente, D., Raucci, G. , D'Alatr i , L . , d'Estais, G., Novelli, S., Pacilli, A . , Saccinto, M.P . , Mele, A . , and De Santis, R. 1998. Overproduction of soluble, extracellular cytotoxin alpha-sarcin in Escherichia coli. Moi. Biotechnol. 9: 99-106. Paris, S., Monod, M . , Diaquin, M . , Lamy, B., Arruda, L . K . , Punt, P.J., and Latge, J.P. 1993. A transformant of Aspergillus fumigatus deficient in the antigenic cytotoxin ASPFI. FEMS Microbiol. Lett. I l l : 31-36. Perez-Canadillas, J . M . , Campos-Olivas, R., Lacadena, J . , Martinez del Pozo, A . , Gavilanes, J .G. , Santoro, J . , Rico, M . , and Bruix, M . 1998. Characterization of pKa 105 values and titration shifts in the cytotoxic ribonuclease alpha-sarcin by N M R . Relationship between electrostatic interactions, structure, and catalytic function. Biochemistry 37:15865-15876. Rathore, D. and Batra, J .K . 1996. Generation of active immunotoxins containing recombinant restrictocin. Biochem. Biophys. Res. Commun. 1996. 222: 58-63. Rathore, D., Nayak, S.K., and Batra, J .K . 1997. Overproduction of fungal ribotoxin alpha-sarcin in Escherichia coli: generation of an active immunotoxin. Gene. 190: 31-35. Rodriguez, R., Lopez-Otin, C , Barber, D., Fernandez-Luna, J .L. , Gonzalez, G. , and Mendez, E . 1982. Aminoacid sequence homologies in alpha-sarcin, restrictocin and mitogillin. Biochem. & Biophys. Res. Comm. 108: 315-321. Rose, M . D . , and Fink, G.R. 1987. K A R 1 , a gene required for function of both intranuclear and extranuclear microtubules in yeast. Cell 48: 1047-1060. Roga, V . , Hedeman, L.P . , and Olson, B . H . 1971. Evaluation of mitogillin (NSC-69529) in the treatment of naturally occurring canine neoplasms. Cancer Chemo. Rep. 55: 101-113. Sacco, G. , Drickamer, K . , and Wool I .G. 1983. The primary structure of the cytotoxin alpha-sarcin. J. Biol. Chem. 258: 5811-5818. Sambrook, J. , Fitsch, E.F., and Maniatis, T. 1989. Molecular cloning: A Laboratory Manual. Cold Spring Harbor Press, Cold Spring Harbor, New York. Sanz, J .L. , and Amils, R. 1984. Sensitivity of thermoacidophilic archaebacteria to a-sarcin. FEBSLett. 171: 63-66. Schindler, D.G. , and Davies, J .E. 1977. Specific cleavage of ribosomal R N A caused by alpha-sarcin. Nucl. Acids Res. 4: 1097-1110. 106 Seggerson, K . and Moore, P.B. 1998. Structure and stability of variants of the sarcin-ricin loop of 28S rRNA: N M R studies of the prokaryotic SRL and a functional mutant. RNA. 4: 1203-1215. Shapiro, R. 1998. Structural features that determine the enzymatic potency and specificity of human angiogenin: Threonine-80 and residues 58-70 and 116-123. Biochem. 37: 6847-6856. Siegel, V . , and Walter, P. 1988. Binding sites of the 19-kDa and 68/72-kDa signal recognition particle (SRP) proteins on SRP R N A as determined in protein-RNA footprinting. Proc. Nat. Acad. Sci. USA 85: 1801-1805. Smith, J . M . , Davies, J.E., and Holden, D.W. 1993. Construction and pathogenicity of Aspergillus fumigatus mutants that do not produce the ribotoxin restrictocin. Molecular Microbiol. 9: 1071-1077. Smith, J . M . , Tang, C M . , Van Noorden, S., and Holden, D.W. 1994. Virulence of Aspergillus fumigatus double mutants lacking restrictocin and an alkaline protease in a low-dose model of invasive pulmonary aspergillosis. Infect. & Immunity. 62: 5247-5254. Steyaert, J . 1997. A decade of protein engineering on ribonuclease T l : Atomic dissection of the enzyme-substrate interactions. Eur. J. Biochem. 247: 1-11. Szewczak, A . A . , Moore, P.B., Chang, Y . L . , and Wool, I.G. 1993. The conformation of the sarcin/ricin loop from 28S ribosomal RNA. Proc. Nat. Acad. Sci. U S A 90: 9581-9585. Turnay, J . , Olmo, N . , Jimenez, A. , Lizarbe, M . A . , and Gavilanes, J .G. 1993. Kinetic study of the cytotoxic effect of alpha-sarcin, a ribosome inactivating protein from Aspergillus giganteus, on tumour cell lines: protein biosynthesis inhibition and cell binding. Moi . Cell Biochem. 122: 39-47. 107 Walsh, T.J. , and P.A. Pizzo. 1988. Nosocomial fungal infections: a classification for hospital-acquired fungal infections and mycoses from endogenous flora or reactivation. Ann. Rev. Microbiol. 42: 517-545. Wawrzynczak, E.J . , Henry, R.V. , Cumber, A . J . , Parnell, G.D., Derbyshire, E .J . , and Ulbrich, N . 1991. Biochemical, cytotoxicity and pharmacokinetic properties of an immunotoxin composed of a mouse monoclonal antibody Fib75 and the ribosome-inactivating protein alpha-sarcin from Aspergillus giganteus. Eur. J. Biochem. 196:203-209. Wimberly, B., Varani, G. , and Tinoco, I. Jr. 1993. The conformation of loop E of eukaryotic 5S ribosomal RNA. Biochem. 32: 1078-1087. Wirth, J . , Martinez del Pozo, A . , Mancheno, J . M . , Martinez-Ruiz, A . , Lacadena, J . , Onaderra, M . , and Gavilanes, J . G . 1997. Sequence determination and molecular characterization of gigantin, a cytotoxic protein produced by the mould Aspergillus giganteus IFO 5818. Arch. Biochem. Biophys. 343, 188-193. Wnendt, S., Felske-Zech, H . , Henze, P.P., Ulbrich, N . , and Stahl, U . 1993. Characterization of the gene encoding alpha-sarcin, a ribosome-inactivating protein secreted by Aspergillus giganteus. Gene. 124: 239-244. Wool, I .G. 1984. The mechanism of action of the cytotoxic nuclease a-sarcin and its use to analyze ribosome structure. Trends Biochem. Sci. 9: 14-17. Wool, I .G. 1997. Structure and mechanism of action of cytotoxic ribonuclease a-sarcin. In Ribinucleases: Structures and Functions. Ed. G. D'Alessio and J.F. Riordan. Academic Press. New York. pp. 131-162. Yang, R., and Kenealy, W.R. 1992a. Effects of amino-terminal extensions and specific mutations on the activity of restrictocin. J. Biol. Chem. 267: 16801-16805. 108 Yang, R., and Kenealy, W .R. 1992b. Regulation of restrictocin production in Aspergillus restrictus. J. General Microbiol. 138: 1421-1427. Yang, X . , and Moffat, K . 1996. Insights into specificity of cleavage and mechanism of cell entry from the crystal structure of the highly specific Aspergillus ribotoxin, restrictocin. Structure 4: 837-852. 109 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0089625/manifest

Comment

Related Items