UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

DNA uptake specificity of Haemophilus influenzae Poje, Grant Alexander 2000

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2000-0529.pdf [ 7.6MB ]
Metadata
JSON: 831-1.0089616.json
JSON-LD: 831-1.0089616-ld.json
RDF/XML (Pretty): 831-1.0089616-rdf.xml
RDF/JSON: 831-1.0089616-rdf.json
Turtle: 831-1.0089616-turtle.txt
N-Triples: 831-1.0089616-rdf-ntriples.txt
Original Record: 831-1.0089616-source.json
Full Text
831-1.0089616-fulltext.txt
Citation
831-1.0089616.ris

Full Text

D N A U P T A K E SPECIFICITY O F HAEMOPHILUS INFLUENZAE by G R A N T A L E X A N D E R POJE B . S c , Simon Fraser University, 1996 A THESIS S U B M I T T E D I N P A R T I A L F U L F I L L M E N T O F T H E R E Q U I R E M E N T S F O R T H E D E G R E E O F M A S T E R O F S C I E N C E in T H E F A C U L T Y OF G R A D U A T E STUDIES (Department of Zoology) We accept this thesis as conforming to the required standard T H E U N I V E R S I T Y OF B R I T I S H C O L U M B I A June, 2000 © Grant Alexander Poje, 2000 In p resen t i ng this thesis in partial fu l f i lment of the requ i rements for an a d v a n c e d d e g r e e at the Un ivers i ty of Brit ish C o l u m b i a , I agree that the Library shall make it f reely avai lable fo r re fe rence and s tudy. I fur ther agree that pe rm iss ion for ex tens ive c o p y i n g o f this thesis fo r scho lar ly p u r p o s e s may be gran ted by the head of m y d e p a r t m e n t o r by his o r her representat ives. It is u n d e r s t o o d that c o p y i n g o r pub l i ca t i on of this thesis for f inancial gain shal l no t be a l l o w e d w i t hou t m y wr i t ten p e r m i s s i o n . Department The Un ivers i ty of Brit ish C o l u m b i a V a n c o u v e r , C a n a d a DE-6 (2/88) Abstract D N A b i n d i n g and uptake by the natural ly transformable Gram-negat ive bac ter ium Haemophilus influenzae R d has been studied for over twenty years. It is w e l l characterized that H. influenzae cells preferentially b i n d and take up D N A from their o w n species. This preferential uptake is dependent on the abi l i ty of cells to recognize a 9-base pair uptake signal sequence (USS), 5 ' - A A G T G C G G T , i n the D N A molecule . G e n o m i c analysis has s h o w n that there are 1465 copies of the 9-base pair uptake sites. Further analysis revealed an extended consensus reg ion of 29 base pairs w h i c h includes the core region and two d o w n stream 6-base pair A / T - r i c h regions, each spaced about one hel ix turn apart. To determine properties of the D N A molecule that, i n add i t ion to the presence of the U S S , are necessary for uptake by H. influenzae I designed ol igonucleot ides w i t h variat ions i n the regions f lanking the core USS . Ol igonucleot ides were va r i ed i n both the length and base composi t ion of 3' and 5' f lanking sequences. I s h o w e d that nucleotides 5' to the U S S are required for h igh levels of b i n d i n g and uptake of D N A . A l s o , I showed that both length and base composi t ion of the 3' f l ank ing region greatly affect b i n d i n g and uptake. If sequence 3' to the U S S is G / C r ich , uptake proceeds at a ve ry l o w level . H o w e v e r , i f D N A lacks a 3' sequence, bo th b i n d i n g and uptake are abolished. Based on these findings I propose a speculat ive m o d e l of h o w cells b i n d and take u p D N A i n a sequence specific manner. I attempt w i t h this m o d e l to supplement other proposed models w h i c h do not address the in i t i a l steps of b i n d i n g a n d uptake by H. influenzae. ii A second goal of m y research was to isolate the receptor that a l lows competent cell to preferentially b i n d and take up sequence specific D N A . The method I used was U V laser cross l inking. Condi t ions used i n cross l inking experiments were var ied i n c l u d i n g the time of incubat ion of D N A and cells, the presence and absence of compe t ing D N A s and attachment of b u l k y groups to the D N A to prevent uptake. F o l l o w i n g m a n y attempts to isolate the receptor I conc luded that under the condit ions used, it was impossible to isolate the receptor us ing laser c ross l inking . iii T A B L E O F C O N T E N T S A B S T R A C T ii T A B L E O F C O N T E N T S iv LIST O F TABLES. . viii LIST O F FIGURES ix LIST O F A B B R E V I A T I O N S x i A C K N O W L E D G M E N T S x i i C H A P T E R O N E 1 Introduction I Competence , Transformation and D N A uptake 2 1.1 N a t u r a l competence 2 1.2 D N A uptake and natural transformation 2 1.3 Up take and transformation by gram-posit ive bacteria 3 1.4 Uptake and transformation by gram-negative bacteria 3 1.5 U p t a k e a n d transformation by H. influenzae 4 1.6 Processing and translocation of D N A 5 1.7 Up take requirements 7 . 1.8 Proteins i n v o l v e d i n translocation and recombinat ion 8 I I U V Laser C r o s s l i n k i n g 13 2.1 Backg round 15 2.2 M e c h a n i s m of cross l inking 16 2.3 Stabil i ty 16 2.4 Efficiency 16 2.5 Specificity 17 C H A P T E R TWO.... 18 Materials and Methods 2.1 Strains, P lasmids and Oligonucleotides 18 2.2 Cu l tu re condit ions 18 2.3 M e d i a 21 iv 2.4 Transformat ion of H. influenzae 23 2.4.1 Competence induct ion 23 2.4.2 Transformation us ing linear D N A 23 2.4.3 Transformation using circular p l a smid D N A 23 2.5 E. coli p l a s m i d transformation 24 2.6 N u c l e i c A c i d Techniques 24 2.6.1 Isolation of p l a s m i d D N A 24 2.6.2 Isolation of H. influenzae chromosomal D N A 24 2.6.3 D N A label ing 25 2.6.4 D N A sequencing 26 2.6.5 Oligonucleot ides 26 2.6.6 Biot inyla ted oligonucleotides 26 2.6.7 C l o n i n g of Oligonucleot ides 27 2.6.7.1 C l o n i n g USS-1 and USS-R 27 2.6.7.2 C l o n i n g USS-50 29 2.7 Electrophoresis 29 2.7.1 Agarose 30 2.7.2 Polyacry lamide G e l Electrophoresis ( P A G E ) 30 . 2.7.2.1 D N A 30 \ 2.7.2.2 Cross l inked D N A - p r o t e i n complexes 30 2.8 Up take experiments 31 2.9 B i n d i n g experiments 31 2.10 U V laser cross l inking 32 C H A P T E R T H R E E 35 Characterization of uptake requirements of H. influenzae 3.1 Is the 29 b p U S S sufficient for uptake? 35 3.1.1 Uptake of a 'perfect' USS 35 3.2 Effect of U S S posi t ion on b ind ing and uptake 38 3.2.1 Oligonucleot ides 38 3.2.1.1 B i n d i n g and uptake of 30 bp D N A fragments 38 3.2.1.2 B ind ing and uptake of 50 bp fragments 39 3.2.2 P l a s m i d D N A 42 v 3.3 Leng th dependence of uptake. Is USS-1 too short to be taken up? 44 3.4 Effect of 3' consensus f lanking sequence on D N A b i n d i n g and uptake 46 3.4.1 B i n d i n g and uptake of D N A containing the lowest frequency base composi t ion i n 3' f lanking consensus region 46 3.4.2 B i n d i n g and uptake of D N A lacking sequence 3' to the 9 b p core 48 3.5 C o m p e t i t i o n of var ious D N A s for uptake of ch romosomal D N A 50 3.5.1 Compe t i t i on by chromosomal D N A s and 29 bp fragments 52 3.5.2 Compe t i t i on by chromosomal D N A s and 50 bp fragments 52 3.6 Discuss ion of uptake results 55 3.7 Future experiments 56 CHAPTER FOUR 57 UV Laser Crosslinking C r o s s l i n k i n g labeled D N A to the receptor 57 4.1 T ime interval for uptake of USS-50 59 4.2 Does cross l inking increase the amount of D N A associated w i t h the outside of cells? 59 4.3 C r o s s l i n k i n g us ing labeled USS-50 61 4.4 C r o s s l i n k i n g fo l lowing var ied time of incubat ion 64 4.5 C r o s s l i n k i n g i n a rec-2 mutant background 66 4.5.1 Cross l i nk ing i n wi ld- type and rec-2 backgrounds 66 4.6 Biot inyla ted oligonucleotides 68 4.6.1 Up take experiments 68 4.6.2 Cros s l i nk ing experiments 72 4.7 Calcula t ions 74 4.7.1 Scenario 1; estimate 100 receptors /cel l and a 200 k D a receptor 74 4.7.2 Scenario 2; estimate 10 receptors /cel l and a 50kDa receptor 75 4.8 Discuss ion of cross l inking results 75 4.9 Future experiments 76 vi C H A P T E R FIVE... . . 78 Hypothetical model for uptake by H. influenzae 5.1 Discuss ion of uptake characterization results 78 5.1.1 M o d e l for uptake of H. influenzae 78 5.1.2 Interaction of oligonucleotides w i t h the receptor complex 82 B I B L I O G R A P H Y . . ; 87 vii LIST OF T A B L E S Table 2.1 Bacterial strains used in this study 19 Table 2.2 P lasmids used i n this s tudy 19 Table 2.3 Ol igonucleot ides used i n this s tudy 20 Table 2.4 Componen t s of non-commercia l med ia 21 viii LIST OF FIGURES Figure 1.1 Up take and incorporat ion of homologous D N A b y H. influenzae 6 Figure 1.2 A l i g n m e n t of the core 9-bp U S S and f lanking regions 10 Figure 1.3. Proteins thought to be responsible for uptake of D N A by H. influenzae 12 Figure 1.4 Genera l strategy for identification of the D N A b i n d i n g receptor of H. influenzae u s ing U V laser cross l inking 14 Figure 2.1 C l o n i n g of USS-1 , USS-R and USS-50 28 Figure 2.2 Schematic d r a w i n g of apparatus used for U V laser c ross l ink ing 33 Figure 3.1 Up take of 'perfect' USS containing D N A is not greater than a D N A that does not contain a USS 37 Figure 3.2 B i n d i n g and uptake of D N A s by competent cells 40 Figure 3.3 B i n d i n g and uptake by competent cells 41 Figure 3.4 Up take of cloned USS-1 43 Figure 3.5 Up take of different length oligos 45 Figure 3.6 B i n d i n g of 50 bp D N A fragments by competent cells 47 Figure 3.7 B i n d i n g of 50 bp D N A fragments by competent cells 49 Figure 3.8 Schematic representation of a competi t ion assay 51 Figure 3.9 C h r o m o s o m a l D N A and 29 bp fragments 53 Figure 3.10 C h r o m o s o m a l D N A and 50 bp fragments 54 Figure 4.1 Up take of labeled USS-50 as a function of time 58 Figure 4.2 C r o s s l i n k i n g increases the amount of D N A associated w i t h the outside of cells 60 Lx Figure 4.3 C r o s s l i n k i n g us ing short and long D N A fragments 62 Figure 4.4 C r o s s l i n k i n g USS-50 to wi ld- type H. influenzae cells 63 Figure 4.5 C r o s s l i n k i n g experiments using USS-50, USS-1 and M A P 7 D N A s as bait 65 Figure 4.6 C r o s s l i n k i n g us ing M A P 7 chromosomal D N A 67 Figure 4.7 C r o s s l i n k i n g in rec-2 and wi ld - type backgrounds 69 Figure 4.8 Biot inyla ted oligonucleotide 71 Figure 4.9 I l lustrat ion of interaction of competent H. influenzae cells w i t h b io t inyla ted D N A attached to agarose beads 73 Figure 5.1 Hypo the t i ca l m o d e l for b i n d i n g and uptake by H. influenzae 79 Figure 5.2 M o d e l for uptake of oligos lack ing 5' sequence 81 Figure 5.3 Model for binding of an oligo having a G/C rich 3' flanking region 83 Figure 5.4 B i n d i n g of USS-50-Ri 84 x L I S T O F A B B R E V I A T I O N S aa amino acid BHI bra in heart infusion (rich culture med ium) b p base pair cfu colony fo rming uni t D N A deoxyribonucleic acid D N a s e l deoxyribonuclease I E D T A ethylenediaminetetraacetic acid k b kilobase p.g m i c r o g r a m M I V " M - f o u r " ; a nutr ient- l imited H. influenzae competence induc t ion m e d i u m m l mill i l i ter N A D nicot inamide adenine dinucleotide n g n a n o g r a m nov H. influenzae novobioc in resistance allele n o v r novob ioc in resistant nt nucleotide o l igo ol igonucleotide r I U B code for pur ine s B H I bra in heart infusion supplemented w i t h haemin and N A D w I U B code for adenosine or thymidine y I U B code for cyt idine or thymidine xi ACKNOWLEDGMENTS I w o u l d l ike to tharik Dr . R. Redfield for p rov id ing excellent guidance and instruct ion on the w o r k per formed i n this thesis. I w o u l d also l ike to thank the members of m y superv i sory committee for their insightful comments: Dr . Beatty, D r . Brock and Dr . Roberge. A l s o , I w o u l d l ike to acknowledge al l the members of the Redf ie ld lab w h o made c o m i n g to lab everyday an enjoyable experience. I w o u l d l ike to acknowledge Lisette U n g e t h u m for her assistance on experiment 3.2.2. F ina l l y , I w o u l d l ike to thank m y suppor t ing cast. They remain i n the background , but suppor t me i n everything I do and deserve m u c h of the credit for w h o I have become. Thank y o u Sonia, M o m and Tracy. x i i Introduction CHAPTER ONE Introduction Competence is the abi l i ty of cells to b i n d and take u p D N A f rom their env i ronment [1,2]. The abi l i ty of cells to develop competence has received m u c h attention i n the past and continues to attract investigation. In this thesis I have tr ied to clarify some of the requirements for D N A uptake i n Haemophilus influenzae. In add i t ion to this I have at tempted to isolate the D N A b ind ing receptor that a l lows H. influenzae to recognize and preferentially take up homologous D N A from its envi ronment . The technique I chose to use to isolate the receptor is U V laser c ross l inking . This project is impor tant for a number of reasons. H. influenzae is a na tura l ly transformable gram-negative facultative anaerobe of the fami ly Pasteurellaceae. It is commensa l i n the upper respiratory tract of humans and is responsible for caus ing such diseases as meningi t is and otitis media [3]. Cur ren t ly there are vaccines for some strains of H. influenzae. H o w e v e r , isolat ing the receptor m a y p r o v i d e a n e w target for drugs i n an attempt to eliminate strains of H. influenzae for w h i c h there are current ly no vaccines available. A l s o , isolat ing the receptor m a y assist others t ry ing to ident i fy proteins responsible for sequence-specific uptake i n other gram-negative bacteria. W h e r e possible I have cited or ig ina l work . H o w e v e r , there are also m a n y useful r e v i e w articles that I have used. T w o comprehensive, though s l ight ly dated, r ev iew articles o n transformation are "Genetic Transformat ion" by Smi th and Danner [2], and "Transformat ion i n Haemophilus: a p rob lem i n membrane b i o l o g y " by K a h n and Smi th [4]. T w o useful rev iew articles on D N A uptake by bacteria are " D N A uptake 1 Introduction i n Haemophilus t ransformation" by G o o d g a l [1] and a very recent article b y D u b n a u cal led " D N A uptake i n bacteria" [5]. I Competence, Transformation and DNA uptake 1.1 Natural competence. Competence development requires proper expression of proteins w i t h i n the cy top lasm and de l ivery of specific proteins to the cell surface. Funct ions per formed b y these competence proteins include D N A b i n d i n g and transport across cell wa l l s and membranes. N a t u r a l competence differs f rom artificial competence i n that art if icial measures such as treatment w i t h lysozyme [6] or ca l c ium ions [7] are not requi red . 1.2 DNA uptake and natural transformation Transformat ion arises w h e n natural ly competent bacteria take up D N A and integrate n e w alleles into their genome. N a t u r a l transformation can be d i v i d e d into three steps: 1) competence development, 2) D N A uptake 3) D N A integrat ion. N a t u r a l transformation is widespread , occurr ing i n both gram-posi t ive and gram-negative bacteria. Bacillus subtilis and Streptococcus pneumoniae are examples of na tura l ly competent gram-posi t ive bacteria; H. influenzae and Neisseria gonorrhoeae are gram-negat ive examples. D N A uptake is an integral part of transformation. Interestingly, gram-posi t ive and gram-negative bacteria have evolved significantly different systems of b i n d i n g and uptake, poss ib ly due to differences i n their cell w a l l composi t ion and the presence of a thick pep t idog lycan layer su r round ing gram-posit ive bacteria. There are two m a i n differences i n D N A uptake between the two types of bacteria. The first is the abi l i ty of some gram-negative cells to take up specific D N A molecules, w h i c h is 2 Introduction dependent o n the presence of short repeated sequences i n the D N A . Gram-pos i t ive bacteria take u p D N A wi thout sequence preference. The second difference is the abi l i ty of gram-negative bacteria to take up both strands of D N A into a nuclease resistant form. Gram-pos i t ive bacteria degrade one strand on their cel l surface p r io r to uptake [2]. These points w i l l be covered i n more detail be low. 1.3 Uptake and transformation by gram-positive bacteria. Transformat ion i n both B. subtilis and S. pneumoniae has been s tudied extensively. U p o n development of competence in these bacteria, double s tranded D N A is b o u n d to the outside of the cell [8]. In S. pneumoniae, fo l lowing b i n d i n g the D N A is fragmented on the cell surface, p roduc ing single strand nicks w h i c h are converted to double s t rand breaks [9-11]. Cleavage at the cell surface may serve to generate n e w ends near proteins i n v o l v e d i n uptake, a l l o w i n g entry of the D N A into the cell by Us n e w l y fo rmed end. If uptake were to proceeded only f rom pre-exist ing ends, then as the length of the D N A fragment increased, search time for an end w o u l d also increase, w h i c h c o u l d place l imitations on the abil i ty of cells to h o l d onto D N A long enough for uptake to occur. A s D N A moves across the cytoplasmic membrane one strand is degraded and the remain ing strand is coated by Ssb, a single s t randed b i n d i n g protein. F o l l o w i n g this, D N A is incorporated into the host chromosome by R e c A , a pro te in requi red for homologous recombinat ion [12]. 1.4 Uptake and transformation by gram-negative bacteria. Gram-negat ive bacteria have a three-layered cell envelope composed of an inner cy toplasmic membrane, a pept idoglycan layer, and an outer membrane. The mechan i sm of D N A movement across these layers is unclear. 3 Introduction Uptake systems of gram-negative bacteria can be d i v i d e d into two general categories: homologous and heterologous. Acinetobacter calcoaceticus is a na tura l ly transformable gram-negative bacter ium w i t h heterologous uptake. It takes u p D N A wi thou t regard to the source [13,14]. Converse ly , i n both Haemophilus and Neisseria, D N A uptake is homospecific; that is, competent cells recognize and preferential ly take u p D N A from their o w n genus [15]. These gram-negative bacteria take u p both strands, convert ing it into a nuclease resistant form. It is not k n o w n if D N A taken up by A. calcoaceticus is taken up as a double s tranded molecule . Bo th H. influenzae and N. gonorrhoeae have been used as models to s tudy the t ransformation of gram-negative bacteria. The sequence specific b i n d i n g i n both bacteria results from recognit ion of short uptake sequences w h i c h are abundant i n their genomes. D N A that lacks these uptake sequences transforms poo r ly and competes inefficiently against uptake sequence-containing D N A [15-17]. 1.5 Uptake and transformation of H. influenzae. H. influenzae strains are classified into six serotypes (a-f) based on the antigenic properties of their capsule. The capsule is composed of a negat ively charged porous mat r ix consis t ing of a phosphodiester l i nked ribose-ribitol copo lymer [18]. Isolates that lack this polysaccharide capsule are classified as 'nontypable ' . These are also termed r o u g h because absence of the capsule causes colonies to lose the sheen of smooth capsulated colonies. The capsule does not prevent t ranslocation of D N A into the cell , as it has been s h o w n that encapsulated cells transform as efficiently as non-encapsulated strains [4,19]. The lab strain we use (Rd) is a non-encapsulated, non-pathogenic der ivat ive of a serotype d strain. 4 Introduction The proteins that a l l ow sequence specific b i n d i n g i n H. influenzae have not yet been characterized, but many features of uptake and transformation have been s tudied (transformation of H. influenzae is out l ined i n Figure 1.1). D N A conta in ing uptake sequences interacts w i t h a postulated receptor protein complex and crosses the outer membrane as intact double stranded D N A (Figure 1.1, Steps 1 a n d 2). W o r k b y D e i c h and Smi th (1980) has clarified many aspects of the uptake process. They found that cells were on ly able to take up 3 to 8 D N A molecules a n d suggested that cel l surface receptors acted only once. F r o m this, they estimated an uptake rate of 500-1000 nucleotides per second. After D N A is taken u p by cells it becomes resistant to external nucleases and cannot be eluted from cells by h igh salt washes. 1.6 Processing and translocation of D N A Trans loca t ion across the inner membrane of H. influenzae requires a free end (Figure 1.1 step 3) [20, 21]. C i r cu la r D N A or ha i rp in structures are able to m o v e across the outer membrane , but are not transported into the cy top lasm [22, 23]. Transpor t across the inner membrane results i n complete degradat ion of the 5' i n c o m i n g s trand a n d par t ia l degradation of the 3' strand [4,22, 24]. After crossing the inner membrane , the r emain ing 3' l eading strand is available for homologous recombinat ion. Transport of D N A into N. gonorrhoeae occurs i n the same w a y as it does i n H. influenzae [22]. Single s t randed D N A has not been isolated from the cytoplasm of cells. This m a y be because on ly a short length of single-stranded D N A is present at any g iven time as the D N A crosses the inner membrane [5]. H o m o l o g o u s recombinat ion occurs w h e n i n c o m i n g D N A replaces regions of the recipient chromosome conta in ing sequence 5 Introduction Figure 1.1. Uptake and incorporation of homologous DNA by H. influenzae. Step 1; Receptor binds D N A containing a USS . Step 2; M o v e m e n t of D N A across outer membrane into per ip lasmic space/ t ransformasome. D N A becomes resistant to external and internal nucleases. Step 3; Translocat ion of D N A across inner membrane into the cytoplasm. The 5' l ead ing strand is completely degraded whereas the 3' leading strand is degraded s lowly . Step 4; Integration of the 3' donor strand (A) into the homologous region of the recipient chromosome (a). 6 Introduction s imi la r i ty (Figure 1.1, Step 4) [21, 25]. A n average of 1.5 kb of the 3' s t rand of the donor D N A is degraded du r ing the search for homology [22]. Once recombina t ion is ini t iated, it is r ap id ly completed and proceeds to the 5' end of the i n c o m i n g D N A [22]. 1.7 Uptake requirements A s ment ioned above, D N A uptake by H. influenzae is sequence specific. Ce l l s have the abi l i ty to recognize and preferentially take up homologous D N A . The uptake specificity of H. influenzae depends on the abi l i ty of the short 9-base-pair (bp) sequence ( 5 ' A A G T G C G G T 3 ' ) , called an uptake signal sequence (USS), to interact w i t h the cel l surface receptor [16, 26-29]. The U S S f lanking sequence has also been s h o w n to be important for efficient uptake i n H. influenzae. The more A / T r ich the sequence f l ank ing the U S S , the greater the amount of D N A taken up by cells [30]. N. gonorrhoeae also binds homospecific D N A by recogniz ing an unrelated 10 bp U S S [16, 28]. H. influenzae was the first " l i v i n g " organism to have its complete genome sequenced [31] f o l l o w i n g the sequencing of several v i r a l and organellar genomes [32-34]. After sequencing, the frequency and dis t r ibut ion of USSs w i t h i n the genome was ana lyzed . Prev ious uptake and competi t ion experiments had estimated the number of USSs to be close to 600 [26], a l though the 62% A / T base compos i t ion of H. influenzae predic ted that about 8 USSs were expected to occur by chance. In fact, u p o n examin ing the sequence, it was found that 1465 USSs were present i n the genome, occur r ing i n both orientations w i t h equal frequency [35]. The over-representation of USSs is also reflected i n the frequency of 9 bp sequences differing f rom the consensus at a single posi t ion. There are 764 copies of these s ingly-mismatched 9 bp consensus sequences, where 254 w o u l d be expected b y chance [2]. 7 Introduction O n e hypothesis to expla in the over-representation of USSs i n the genome is that their occurrence results f rom selection for uptake of homologous D N A , w h i c h w o u l d require selection for both a biased receptor and over-representation of USSs w i t h i n the H. influenzae genome. Others have postulated that USSs migh t funct ion in t racel lu lar ly as transcription termination sequences or ch i sites [35]. G e n o m i c analysis has s h o w n that these specific roles of USSs are un l ike ly , however a structural role for the USS has not been ruled out [2]. A third hypothesis is that a biased receptor direct ly causes USSs to accumulate i n the genome [2,36]. The receptor preferentially binds D N A containing the USS , a l l o w i n g cells take up that D N A and integrate it into their chromosome. W i t h i n the H. influenzae genome, f lanking the USSs, there are also regions of consensus (Figure 1.2). W h e n a l l 1465 copies of the U S S were a l igned i n the plus di rect ion a 29 bp consensus U S S was identified, that had the sequence 5' a A A G T G C G G T . r w w w w w r w w w w w 3', where uppercase letters represent the bases that define the U S S , lowercase letters are bases that occur i n >50% of the USSs , a dot is any base, r is purine, and w is A or T [35]. A c c o r d i n g to Smi th et al. , if the lengths of a l l the 29-bp USSs and the s ingly mutated sites are added , there are a total of 2229 sites occupy ing approximately 3.5% of the genome [35]. In actuality, the USSs do not fu l ly constrain 3.5% of the genome. This is because, as i l lustrated i n Figure 1.2, each posi t ion, outside the 9 bp core, has some f lexibi l i ty i n the nucleot ide that can occupy it. 1.8 Proteins involved in translocation and recombination. The D N A - b i n d i n g receptor has not been isolated f rom either H. influenzae or N. gonorrhoeae. H o w e v e r , a number of other proteins required for processing and translocation of D N A i n these and other bacteria have been ident if ied. A l t h o u g h the D N A uptake mechanisms of gram-posit ive and gram-negative bacteria are thought 8 Introduction to be different, m a n y of the proteins k n o w n to be i n v o l v e d i n uptake and transformation are s imi lar i n both bacteria. I w i l l briefly cover the funct ion of proteins i n v o l v e d i n competence i n gram-posit ive bacteria and il lustrate h o w they m a y also funct ion i n gram-negative bacteria. The B. subtilis comE operon contains genes i n v o l v e d i n different aspects of competence and transformation. comEA is the first open reading frame of the comE operon [37, 38]. In B. subtilis C o m E A is required for both D N A b i n d i n g and transport into the cell [38]. C o m E A has homologs i n both N. gonorrhoeae and H. influenzae, however a function of these proteins has not yet been assigned i n these organisms. In these bacteria C o m E A could potential ly act as part of the receptor pro te in complex as it does i n gram-posit ive bacteria. H o w e v e r , it is p robab ly not the U S S recogni t ion protein, since gram-posit ive bacteria do not preferential ly recognize or take u p homologous D N A . In B. subtilis C o m E C , encoded by the th i rd open reading frame of the comE operon, has been s h o w n to be required for transport of D N A , but dispensable for b i n d i n g . C o m E C m a y fo rm part of an aqueous channel since it contains 6 potent ia l membrane spann ing segments [5]. The C o m E C homologs , Rec-2 i n H. influenzae and C o m A i n N. gonorrhoeae, have been s h o w n to p lay essential roles i n t ransformation [39-41]. Muta t ions in these proteins do not affect b i n d i n g or uptake of D N A but greatly reduce transformation frequencies by prevent ing transport of D N A across the inner membrane. L i k e Rec-2 mutants, H. influenzae cells w i t h mutat ions i n D p r A take up D N A into a DNase resistant form but are unable to transform [42, 43]. Thus, i n conjunction w i t h Rec-2, D p r A may funct ion to transport D N A across the inner membrane of H. influenzae. 9 Introduction o -<t a> LO CO CO T - T -w tn Ol i -O CM CM T " N « T -O Tt O CO LD LO t -Q) ^ T - CO OD O J CJ CM CO T -tO O N CM CM CM CM CM (D t- r O CM CM CM CO CO T - O) LO CO CM T - CM CO CO O N-CM CO CM i— o *i r C O) co r-. CM tD CO 00 to CO LO T— CM co t rt CM T-O CM CO CO CM T - -t LO CO (D N O J t CO O CD O) CM CO T— CM o o O y- O O o o — o <u O O T - o o o O O T - o CO o >- o o o o O O i - o o o T - o o o o o r>. co r-. co LO CM ID LO "t CM t- t-co co i n N CO OJ r r < r - C J O 10 Introduction Anothe r prote in w i t h an essential role i n transformation i n H. influenzae is P o r A , a disulf ide oxidoreductase that localizes to the per ip lasm and is required for competence-associated changes i n the protein compos i t ion of the membrane [44], In its absence, D N A b i n d i n g is abolished. It is possible that P o r A is needed for the correct f o ld ing of one or more membrane proteins du r ing competence deve lopment . Ano the r gene, c o m F C [45] has been characterized i n B. subtilis. The produc t of this gene resembles the C o m F prote in of H. influenzae [46, 47]. Muta t ions of c o m F C decrease transformation 5-10 fo ld i n B. subtilis, decreasing transport s l ight ly but not b i n d i n g . Dele t ion of comF i n H. influenzae does not impa i r the abi l i ty of cells to b i n d D N A [46]. A specific role for the gene product has not yet been e lucidated i n either o rgan i sm. Rec-1, a h o m o l o g of E. coli R e c A , is the only k n o w n recombinat ion prote in w i t h an ident i f ied role i n H . influenzae transformation. Muta t ions i n Rec-1 lead to a t ransformation deficient phenotype, not because cells are defective i n b i n d i n g , uptake or transport, but because they are defective i n integrat ion of donor D N A into the chromosome [41, 48, 49]. A m o d e l of D N A uptake i n H. influenzae has been proposed (Figure 1.3) [5]. In this m o d e l a large prote in complex is assembled be low the receptor i n the per ip lasmic space. This complex may contain as yet unident if ied proteins as w e l l as those l is ted above ( P o r A and C o m F ) . The receptor then binds D N A on the outside of the cell and passes the D N A across the outer membrane. D p r A and Rec-2 are located on the inner membrane and act to feed D N A through it. These proteins m a y associate w i t h a yet unident i f ied nuclease that cleaves the 5' strand of the i n c o m i n g D N A . U p o n entry, Rec-1 aids i n the incorporat ion of D N A into the chromosome. 11 Introduction D N A Figure 1.3 Proteins thought to be responsible for uptake of D N A by H. influenzae. 12 Introduction I I UV Laser Crosslinking of DNA to Proteins Researchers have t r ied to isolate the receptor that a l lows H. influenzae to take u p homologous D N A b y emp loy ing different approaches w i t h no success. Mutagenes is screens us ing transposons have been performed, i so la t ing genes that w h e n muta ted lead to defects i n transformation [50,51]. This technique has been useful i n f ind ing proteins i n v o l v e d i n the regulation of competence, nut r i t ional state sensing, D N A b ind ing , uptake and translocation [44, 51-54] Biochemica l approaches have inc luded a comparison of the polypept ides i n the membrane fraction of competent and non-competent cells [55, 56] and the isola t ion of D N A b i n d i n g proteins f rom membranes of competent cells [57]. Sutr ina and Scocca [58] reported the isolat ion of a per iplasmic protein fraction possessing D N A -b i n d i n g act ivi ty f rom non-competent cells. They suggested that these proteins may become associated w i t h the cell membrane d u r i n g competence development . K a h n et al . [59] reported the presence of D N A - b i n d i n g activity i n the cell culture supernatants of certain competence, mutants after they were subjected to competence- inducing procedures. Subsequent to this, C o n c i n o and G o o d g a l deve loped a procedure to label specific cell surface proteins impl ica ted i n D N A uptake [60] . These attempts to isolate the receptor were p r o m i s i n g i n that they isolated proteins w i t h the abil i ty to b i n d D N A , however a lack of r eproduc ib i l i ty has raised doubt to the va l id i ty of these results. The general strategy I employed to isolate the receptor was U V laser c ross l ink ing (Figure 1.4). The basis for cross l inking is that if D N A and proteins are i n contact, a laser pulse of U V - l i g h t can cause covalent crosslinks to form between them. Further to this, if the D N A is radioact ively labeled then the protein w i l l also become labeled w h e n cross l inked to the D N A . Such labeled proteins cou ld be detected w h e n samples are separated b y po lyacry lamide gel electrophoresis and exposed to f i l m . 13 Introduction labeled DNA UV light from laser P u r i f y l a b e l e d p r o t e i n s Figure 1.4 General strategy for identification of the D N A b ind ing receptor of H.influenzae using U V laser cross-l inking. 14 Introduction U s i n g c ross l ink ing to isolate the receptor has three m a i n benefits over the p rev ious ly used techniques. The first and p r imary benefit is its s impl ic i ty . It does not require pur i f ica t ion of membrane extracts or other compl ica ted procedures. Second, i t uses in vivo conditions. This is important because it eliminates the loss of protein-protein contacts w h i c h can occur i n membrane preparations. T h i r d l y , it is a re la t ively r a p i d procedure that can produce results i n a matter of days. 2.1 Background Ul t rav io le t l ight is a 'zero-length' cross l inking agent w h i c h creates bonds between proteins and D N A at contact sites. U n l i k e chemical cross l inking there is no need for exogenous cross l inking agents that may disrupt the protein-nucleic ac id complex [61, 62]. Firs t used i n the 1960s, U V ir radia t ion was s h o w n to cause the format ion of p r o t e i n - D N A crosslinks i n bacteria [63, 64]. The o r ig ina l c ross l inking experiments used broad band germic ida l lamps to irradiate samples. This was a weak source of U V light, and so these experiments requi red i r rad ia t ion times ranging from minutes to several hours [65]. Such p ro longed times of i r rad ia t ion created condit ions for the redis tr ibut ion of proteins. This p r o b l e m has been addressed by us ing lasers as the source of U V light. U V lasers confer a number of benefits. The laser a l lows the number of photons needed for c ross l inking to be del ivered i n nano- or picoseconds. Since this reaction is several orders of magni tude faster than macromolecular rearrangements between prote in and nucleic acid molecules (100 us or greater), U V - i n d u c e d c ross l ink ing essentially "freezes" interactions between two molecules, a l l o w i n g researchers to examine instantaneous D N A - p r o t e i n interactions [66]. Ano the r benefit to u s ing a laser is that samples are i r radiated w i t h a beam of monochromat ic l ight . T h r o u g h the use of frequency modulators a wavelength can be used that max imizes the 15 Introduction number of crosslinks per pulse and min imizes the amount of prote in degradat ion (see section 2.4). 2.2 Mechanism of crosslinking C r o s s l i n k i n g occurs i n two steps. The first step is the absorpt ion of photons by a nucle ic ac id base, causing the base to change f rom its g round state to an excited, h i g h l y reactive state. The second step involves the convers ion of the energy of the excited base into the protein-nucleic acid crosslink. Ini t ia l ly , photons p roduced by the laser excite nucleotide bases into singlet (Si) and triplet (Ti) states. This increases the possibi l i ty of absorpt ion of a second photon , and transi t ion to even higher excited states (Tn and Sn) [62]. These T n and Sn states have energies of 8-9 eV w h i c h exceeds the ioniza t ion potential of the bases i n so lu t ion and leads to the generation of purine and p y r i m i d i n e cation radicals [67]. Details of the crossl ink formation step are unclear but are thought to i n v o l v e the p y r i m i d i n e and pur ine cationic radicals w h i c h have the potential to crosslink to amino acids [62, 67]. 2.3 Stability U V i n d u c e d crosslinks between proteins and nucleic acids are covalent [68]. Cross l inks generated by l o w intensity U V lamps are k n o w n to be resistant to both heat and a lka l i [69], but are completely broken d o w n by treatment w i t h either I M acetic ac id or 6 M H C 1 for 15 m i n . at 25°C [70]. U V laser generated crossl inks are expected to have s imilar properties. 2.4 Efficiency The efficiency of crosslink formation has been s tudied in vitro by m a n y groups. Efficiency is highest between 245 and 280 n m , wavelengths where the U V l ight is 16 Introduction p r i m a r i l y absorbed by the nucleic acids (specifically the thymid ine residues) [71]. C r o s s l i n k i n g can also be obtained us ing other wavelengths (200-240 nm) , but i n this range a h i g h amount of prote in degradation also occurs [61]. D e p e n d i n g on the condi t ions ou t l ined be low, i r radia t ion by a UV- lase r can cause 1 to 20% of a prote in sample to become crossl inked to D N A [62, 71]. This range illustrates that many factors must be considered w h e n us ing c ross l ink ing to s tudy p r o t e i n - D N A interactions. For example, c ross l inking efficiency is a function of the number of favorable contacts that occur between protein and nucle ic ac id [71]. Specifically, w h e n the b i n d i n g site of the protein is completely f i l led w i t h nucleic acids, b i n d i n g (and crosslinking) should be maximal . In add i t ion to the strength of the D N A - p r o t e i n interaction, the efficiency of c ross l inking also depends on the wave leng th of the excit ing radiat ion, the nucleotide compos i t ion of the D N A , and the total number of photons app l ied to the sample [61]. 2.5 Specificity C r o s s l i n k i n g between D N A and proteins occurs through single nucleot ide residues [61]. C r o s s l i n k i n g shows nucleotide preference, w i t h thymidine be ing the most reactive. The nucleotide residues can be ranked i n order of decreasing photoreact ivi ty: dT>>dC>rU>rC, d A , d G [61]. It has been demonstrated that urac i l can be cross l inked to 12 different amino acids and thymidine to five [72-74]. Cy tos ine is also able to be crossl inked to amino acids, however , single pur ine bases appear to be un-reactive [75]. Therefore, if cross l inking is to be successful i n i sola t ing the receptor, D N A that is r ich i n thymidine shou ld be used as the 'bait ' . 17 Materials and. Methods CHAPTER TWO Materials and Methods 2.1 Strains, Plasmids and Oligonucleotides Strains, p lasmids and oligonucleotides (oligos) used i n this s tudy are l is ted i n Tables 2.1,2.2 and 2.3, respectively. A l l H. influenzae strains are descendants of A lexande r and L e i d y ' s o r ig ina l R d strain [76]. P l a smid p G E M 7 - was obtained f rom Promega . A l l ol igonucleotides used i n this study were purchased f rom A l p h a D N A . 2.2 Culture conditions H. influenzae strains were cul tured at 37°C i n bra in heart infusion (BHI; Difco) supplemented w i t h hemin (10 u g / m l ) and nicot inamide adenine dinucleot ide ( N A D ; 2 u g / m l ) . Cul tu res were innoculated f rom either a single colony or a frozen 1 m l al iquot of an early exponential phase culture. E. colt strains were cul tured i n L u r i a -Bertaini (LB) broth (Difco) or Terrific broth (Table 2.4) at 37°C [77]. W h e n h i g h levels of aeration were required for either bacterial species, cultures were g r o w n i n Er lenmeyer flasks (of at least 5X the culture vo lume) shaken at 200 r p m i n a shak ing water bath (Innova 3000, N e w B r u n s w i c k Scientific). If on ly gentle aeration was needed, cultures were g r o w n i n loosely-capped test tubes (18mm X 150 m m ) and ro l l ed (60 rpm) us ing a tissue culture roller (Lab-line) p laced i n a 37°C incubator . 18 Materials and Methods Table 2.1 Bacterial strains used in this study Strain Genotype Source or Reference H. influenzae K W 2 0 M A P 7 RR622 Wi ld - type kanr nalr novr strr spcr rif vior rec-2 : :Min iTnI0 kan Alexander and L e i d y [78] J. Set low [79] M i n i TnlOkan p l a smid from D . M c C a r t h y [80] integrated into K W 2 0 chromosome by P. Wi l l i ams . E. coli D H 5 a supE44 recAl D. H a n a h a n [81] Table 2.2 Plasmids used in this study Plasmid Genotype Source or Reference p G E M 7 - Z f -p G P l p G P R pGP50 pBR322 derivative (ampr) p G E M 7 - Z f - : : U S S - l pGEM7-Zf - : :USS-R pGEM7-Zf- : :USS-50 P r o m e g a This study This study This study 19 Materials and Methods Table 2.3 Oligonucleotides used in this study Oligonucleotide Sequence U S S - l - W 5'AAAGTGCGGTTAATTTTTAAAGTATTTTT 3 ' U S S - l - C 3'TTTCACGCCAATTAAAAATTTCATAAAAA 5 ' U S S - R - W 5'TCTTGTTAGAATCTGAGTGTTATTTAAAT 3 ' U S S - R - C 3'AGAACAATCTTAGACTCACAATAAATTTA 5 ' U S S - 3 0 - W Kpnl 5'GGTACCATATAAAGTGCGGTTAATTTTTAC 3 ' USS-30 -C 3'CCATGGTATATTTCACGCCAATTAAAAATG 5 ' U S S - 4 0 - W Kpn l 5'TGGTACCATATAAAGTGCGGTTAATTTTTACAGTATTTTT 3 ' USS-40 -C 3'ACCATGGTATATTTCACGCCAATTAAAAATGTCATAAAAA 5 ' Kpn l EcoRI U S S - 5 0 - W •5'TAATGGTACCATATAAAGTGCGGTTAATTTTTAAAGTATTTTTGAATTCC 3 ' USS-50 -C 3'ATTACCATGGTATATTTCACGCCAATTAAAAATTTCATAAAAACTTAAGG ECORI Kpn l 5 ' USS-50 L E - W 5'AAAOTOCGGTTAATTTTTAAAGTATTTTTGAATTCCTAATGGTACCATAT 3 ' USS-50 L E - C 3'TTTCACGCCAATTAAAAATTTCATAAAAACTTAAGGATTACCATGGTATA EcoRI Kpn l 5 ' USS-50 RI -W 5'TAATTTTTAAAGTATTTTTGAATTCCTAATGGTACCATATAAAGTGCGGT 3 ' USS-50 RI-C 3'ATTAAAAATTTCATAAAAACTTAAGGATTACCATGGTATATTTCACGCCA Kpnl EcoRI 5 ' USS-50 R C - W 5'TAATGGTACCTATAAAAGTGCGGTGCCCGGGCGTTCGCGCGGGGGAATTC 3 ' USS-50 R C - C 3'ATTACCATGGATATTTTCACGCCACGGGCCCGCAAGCGCGCCCCCTTAAG 5 ' USS-50 R-W 5'ATTCTATAGTTATAGTTGTGTATAACGTAGTATCAAGATACATCATTTGT 3 / USS-50 R-C 3'TAAGATATCAATATCAACACATATTGCATCATAGTTCTATGTAGTAAACA 5 / D - U S S - 5 0 - W - B i o t i n ! 5'TAATGGTAAAGTGCGGTATATAAAGTGCGGTTAATTTTTAAAGTATTTTT-B 3 ' • D-USS-50 -C 3'ATTACCATTTCACGCCATATATTTCACGCCAATTAAAAATTTCATAAAAA 5 ' A l l ol igonucleotides l isted were synthesized as single stranded molecules. Ol igos were des igned to a l l ow annealing w i t h complementary strands to fo rm double stranded D N A molecules. The 9 bp core USS is indicated i n bo ld . Restr ict ion enzyme sites are s h o w n above their recognit ion sequence. 20 Materials and. Methods A g a r plates were prepared by the addi t ion of 12 g / L Bacto-Agar (Difco) to l i q u i d med ia p r io r to autoclaving. A d d i t i o n a l hemin was appl ied to B H I plates older than 24 hours. For p la t ing of H. influenzae, cells were serially d i lu ted i n ' d i l u t ion solut ion ' conta in ing I X phosphate-buffered saline and 10% B H I , then plated on s B H I plates ( B H I plates supplemented w i t h hemin and N A D ) . W h e n screening for transformants, cells were plated on s B H I containing the f o l l o w i n g concentrations of antibiotics: novob ioc in , 2.5 u g / m l and chloramphenicol , 1 u g / m l . For L B plates the concentrations were: ampic i l l in , 100 p g / n i l and chloramphenicol , 25 u g / m l . 2.3 Media A l l med ia were s ter i l ized by autoclaving. The ingredients of non-commerc ia l media are descr ibed i n Table 2.4. Table 2.4 Components of non-commercial media a) Terrific broth [77] Bacto-tryptone Bacto-yeast extract Amount / l i ter 24 a 12 I Glycerol K H 2 P 0 4 K 2 H P 0 4 4 ml 2.31 g 12.54 g 21 Materials and Methods Table 2.4 continued b) MIV medium for competence induction [82]. Solution Amount Solution 21 Distilled water 850 ml L-Aspartic acid 4.0 s L-Glutamic acid 0.2 i Furmaric Acid 1.0 g N a C l 4.7 g Tween 80 0.2 ml K 2 H P 0 4 0.87 g K H 2 P O 4 0.67 g Solution 22 L-Cystine 0.04 g L-Tyrosine 0.1 g L-Citruline 0.06 g L-Phenylalanine 0.2 2 L-Serine 0.3 e L-Alanine 0.2 g Solution 23 C a C l 2 0.1 M solution Solution 24 M g S 0 4 0.1 M solution Solution 40 5% (w/v) solution of vitamin-free casamino acids (Difco) in distilled water. M I V is made by add ing 1 m l of each of solutions 22, 23, 24 and 40 to 100 m l of so lu t ion 21. 22 Materials and Methods 2.4 Transformation of H. influenzae 2.4.1 Competence induction Competence was i nduced i n H. influenzae by transfer of cells to M I V starvation m e d i u m [82] as ou t l ined i n Barcak et al. [79]. Cel ls were g r o w n overnight i n s B H I to stationary phase. The fo l lowing day cultures were d i lu ted 1000 fo ld into s B H I and incubated at 37°C to permi t several generations of g rowth d u r i n g exponent ia l phase. Ce l l s were g r o w n to a density of approximate ly 10 9 c f u / m l (OD600 of 0.2-0.25) and collected by fil tration us ing a 100 m l Nalgene A n a l y t i c a l Test Fi l ter F u n n e l (0.2 p m pore size). Cel ls were r insed once w i t h M I V [83] and transferred to a flask conta in ing one vo lume of M I V (equal to the amount of culture that was or ig ina l ly filtered). Ce l l s were shaken at 100 r p m for 100 minutes, by w h i c h time they achieved a m a x i m a l level of competence. 2.4.2 Transformation using linear DNA D N A (200 ng) containing antibiotic resistance markers was incubated w i t h 200 p i of M I V competent cells. Cel l s were ro l led i n a tissue culture roller at 37°C for 15 minutes to a l l o w sufficient time for uptake of the D N A [29]. D N a s e I was a d d e d and the mix tu re was ro l l ed for an addi t ional 10 minutes. The transformation mix ture was serially d i lu ted i n d i lu t ion solut ion and each d i lu t ion plated on m e d i u m conta in ing the appropriate antibiotic. 2.4.3 Transformation using circular plasmid DNA. Ci rcu l a r p l a s m i d D N A transforms H. influenzae poor ly . P l a s m i d transformations were carr ied out us ing a previous ly described method of enhancing p l a s m i d transformation by treating M l V - c o m p e t e n t cells w i t h 32% glycero l [84]. 23 Materials and Methods 2.5 E. coli p l a s m i d t ransformat ion E. coli cells were made competent by treatment w i t h co ld 100 m M C a C l 2 , a n d otherwise transformed by standard procedures [85]. A l l c lonings were carr ied out i n E . coli strain D H 5 a . 2.6 N u c l e i c A c i d Techn iques 2.6.1 Isolation of plasmid D N A H. influenzae cells were g r o w n i n sBHI and E. coli cells were g r o w n in Terrif ic Broth overnight to stationary phase. P l a smid D N A was extracted us ing the alkal ine lysis procedure [77]. If p lasmids were to be sequenced, D N A was further pu r i f i ed by precipi ta t ion w i t h L i C l and polyethylene g lycol ( P E G 8000; Sigma) [85]. 2.6.2 Isolation of H. influenzae chromosomal D N A C h r o m o s o m a l D N A was isolated as previous ly described [79]. Bacterial cultures (35 ml) were g r o w n overnight i n sBHI , pelleted and resuspended i n 0 .15M N a C l , 0 . 1 M ethlyenediamine-tetraacetic acid ( E D T A ) , p H 8.0. Cel ls were lysed by a d d i n g 1% s o d i u m dodecy l sulfate (SDS) for 10 minutes at 52°C. L y s e d cells were treated w i t h proteinase K (50 u g / m l ) for 1 hour at 37°C, fo l lowed by extraction w i t h one v o l u m e of phenol -ch loroform (1:1). D N A was precipitated by add ing 2 vo lumes of 95% ethanol a n d collected by spool ing on a glass rod. D N A was dr ied for 1 hour at r o o m temperature and dissolved i n 500 u l T E p H 8.0 [10 m M T r i s - H C l , p H 8 ; 1 m M E D T A ] . D i s s o l v e d D N A was treated w i t h RNase A (0.2 m g / m l , Sigma) at 37°C for 30 minutes . D N A was addi t ional ly pur i f ied by extraction w i t h equal vo lumes of phenol and phenol-chloroform. Extracted D N A was precipitated w i t h 2 vo lumes of 95% ethanol and 0 .15M N a C l , d r ied , then resuspended i n 10 m l of T E p H 8.0. 24 Materials and Methods 2.6.3 D N A labeling Oligos a n d l inear ized plasmids were end labeled us ing y - 3 3 P - A T P . D N A (4-40 ug) was incubated i n polynucleot ide kinase buffer (70 m M T r i s - H C l , 10 m M M g C b , 5 m M D T T ; p H 7.6) w i t h 5-25 u l y - 3 3 P - A T P (10 m C i / m l ) and 1 unit of T4 po lynuc leo t ide kinase i n a 50 u l vo lume. The reaction proceeded for 30 minutes and was hal ted b y transfer to a 65°C heat block for 20 minutes. N i c k translat ion was used to label chromosomal D N A [85]. C h r o m o s o m a l D N A (10-20 pg) was incubated i n E. coli D N A polymerase buffer (10 m M T r i s - H C l ; p H 7.5, 5 m M M g C b . , 7.5 m M dithiothreitol) w i t h 5-20 u l a - 3 3 P - d A T P (10 m C i / m l ) , 1 uni t of E. coli D N A polymerase, 1-5 p i of DNase I (0.01 u g / m l ) and 20 m M each of d T T P , d G T P and d C T P , i n a vo lume of 200-250 p i . The reaction was incubated at 12-15°C for 30 minutes. The reaction was stopped w i t h the add i t ion of E D T A to 0.5 M and 100 p i T E p H 8.0. After incubation, al l label ing reactions were extracted once w i t h an equal v o l u m e of phenol-chloroform. Labeled D N A s were pur i f i ed f rom un-incorpora ted nucleotides by us ing either 10 m l chromatography co lumns (Bio-Rad) packed w i t h Sephadex (G-15; Pharmacia) or ' M i c r o S p i n ' G-50 co lumns (Amersham) . The incorpora t ion of label into the D N A was determined by p lac ing labeled sample (0.5-10 ul) into a scintil lation v ia l , add ing 1 m l of scintil lation f lu id ( A C S Scint i l la t ion cocktail ; A m e r s h a m ) and count ing i n a Beckman scinti l lat ion counter. The specific act ivi ty was calculated by d i v i d i n g the number of counts per minute by the vo lume of the sample analyzed, then d i v i d i n g by the concentration of D N A . The concentration of D N A was estimated by d i v i d i n g the amount in i t ia l ly used i n the label ing reaction by the vo lume of the label ing reaction. The specific act iv i ty of the D N A is expressed as the number of counts per minute per m ic rog ram of D N A . 25 Materials and Methods 2.6.4 DNA sequencing A u t o m a t e d D N A sequencing of plasmids was carried out by the N u c l e i c A c i d -Pro te in Service ( N A P S ) unit at U B C us ing A m p l i T a q Dye Terminator C y c l e Sequencing chemistry. 2.6.5 Oligonucleotides A l l ol igonucleotides were purchased as single strand D N A molecules. Concentrat ions of ol igonucleotides were determined by their absorbance at 260 n m i n a Beckman Du-65 spectrophotometer, and appl icat ion of the fo rmula [ D N A concentration= A26O x d i lu t ion x 37 u g / m l ] . Ol igos were made double s t randed by a d d i n g equal amounts of each complementary ol igo (40-100 u g , 4 u g / u l i n d H ^ O ) i n a microfuge tube and p lac ing i n a beaker containing bo i l i ng water for 10 minutes . Immedia te ly after this incubat ion per iod tubes were spun for 5 seconds i n a microfuge, to remove condensation from wal ls and caps of tubes, then replaced i n the water bath. To facilitate anneal ing of the single strands the water bath was r emoved f rom the hot plate and a l l o w e d to cool at room temperature to 50°C, at w h i c h time the ol igos were expected to be double stranded. To conf i rm this a 1 u g al iquot of the bo i led sample, as w e l l as equal amounts of the single strand precursors, were r u n on a po lyac ry lamide gel and stained w i t h e th id ium bromide. E t h i d i u m b romide intercalates between the stacked bases of nucleic acids [86]. Single s tranded oligos were v is ib le i n lanes where they were added i n d i v i d u a l l y , but not i n the b o i l ed sample lanes. F r o m this, the D N A was considered to be p r i m a r i l y double stranded. 2.6.6 Biotinylated oligonucleotides D-USS-50-W-Biot in ' i s a single stranded oligonucleotide w i t h a b io t in molecule attached to the 3' terminus by a 15 atom spacer a rm (CH2-CH2-NH-CO-CH2-CH2-CH2-CH2-CH2-NH-CO-CH2-CH2-CH2-). It is complementary to D-USS-50 -C (see 26 Materials and Methods Table 2.3). These oligos were made double stranded by the same procedure as i n section 2.6.5 and were end labeled at the 5' ends as i n section 2.6.3. To jo in the b io t inyla ted oligo to streptavidin agarose beads (Gibco B R L ) a mix ture of the two components was incubated i n I X phosphate-buffered saline and ro l l ed i n a tissue culture roller for 30 minutes. Beads were pelleted by centrifugation and resuspended i n M I V (1 ml) after the supernatant l i q u i d was removed . This was repeated four times i n total to remove a l l u n b o u n d ol igo f rom the beads. The number of molecules of D N A b o u n d to the streptavidin-agarose beads was determined by scinti l lat ion counting, us ing the specific activity of rad io labe l l ing and molecular we igh t of the oligo. 2.6.7 C l o n i n g of O l i g o n u c l e o t i d e s (See F igure 2.1) D N A ligations were carried out according to Sambrook et al . [77] us ing T4 D N A ligase (Boehringer M a n n h e i m ) . P E G 8000 (15 % w / v ) was added to b lunt end ligations. 2.6.7.1 Cloning USS-1 and USS-R P l a s m i d p G E M 7 - (1-3 ug) was digested w i t h Smal, a blunt cutter w h i c h cuts once w i t h i n the mul t ip le c loning site i n the lacZ gene. To m i n i m i z e re-annealing, p lasmids were dephosphory la ted for 30 minutes at 37°C w i t h 0.1 units of alkal ine phosphatase i n 50 u l of one -Phor -Al l P L U S buffer (10 m M Tris-acetate, 10 m M m a g n e s i u m acetate'and 50 m M potass ium acetate). This reaction was s topped by heat inac t iva t ion of the enzyme at 85°C for 15 minutes. Water (150 ul) was added to the reaction and D N A was extracted w i t h 200 p i of phenol-chloroform (1:1). 27 Materials and Methods Figure 2.1 C l o n i n g of USS-1, USS-R and USS-50. A) To clone USS-1 and USS-R p G E M 7 - was digested with Smal then dephosphorylated. The oligos were phosphorylated then ligated into the Smal site of p G E M 7 - and scored for white phenotype. B) To clone USS-50, both p G E M 7 - and USS-50 were digested with EcoRI and Kpnl then ligated together. Plasmids that contained inserts were identified by scoring for a white phenotype in the presence of X - G A L . 28 Materials and Methods Ol igos (0.5-1 ug) were phosphoryla ted i n a 50 u l reaction v o l u m e of T4 polynucleot ide kinase buffer us ing T4 polynucleot ide kinase (10 units) i n the presence of 1 m M A T P . Phosphory la ted oligos were combined w i t h digested p lasmids i n T4 ligase buffer (66 m M T r i s - H C l , p H 7.6, 6.6 m M M g C b , 10 m M D T T , 66 u M A T P ) conta ining 1 unit of T4 D N A ligase (Boehringer Mannhe im) . Reactions were performed at r o o m temperature for 16-18 hours. Ligat ions were transformed into E. coli and cells were p la ted on L B containing ampic i l l i n . Colonies were scored for a whi te phenotype w h e n g r o w n i n the presence of X - G A L . P l a s m i d D N A was isolated f rom whi t e colonies, digested and r u n on 0.8 - 2 % agarose gels. After restriction m a p p i n g , inserts were sequenced us ing the T7 and SP6 primers [87]. 2.6.7.2 Cloning of USS-50 P l a s m i d p G E M 7 - (1-3 pg) and USS-50 (5-15 pg) were each digested w i t h EcoRI and KpnI. These enzymes cut once i n each D N A molecule. After digest ion, p l a s m i d D N A and oligos were combined i n T4 ligase buffer w i t h 1 unit of T4 D N A ligase. L iga t ions were performed at 14°C for 16-24 hours. A s above, l igat ions were t ransformed into E . coli and g r o w n i n the presence of X - G A L . A s above, p l a s m i d D N A was isolated f rom whi te colonies and extensive restriction digestions were per formed to conf i rm the presence of an insert. After restriction m a p p i n g , inserts were sequenced us ing the same primers as above. 2.7 Electrophoresis D N A fragments were separated on either agarose or po lyac ry lamide gels. Gels were stained w i t h e th id ium bromide (0.25 u g / m l ) and separated D N A fragments were v i sua l i zed under U V light. Either 100 bp or 1 kb ladders ( N e w E n g l a n d Biolabs) were used as size standards. 29 Materials and Methods 2.7.1 Agarose gel electrophoresis D N A fragments were separated on either 0.8 or 2 % agarose (Gibco B R L ) Tr is -Acetate E D T A ( T A E , p H 8) gels [77]. D N A fragments were pur i f i ed f rom agarose gels u s i n g a 'Gene-Clean ' k i t (Bio 101 Inc.). 2.7.2 Polyacrylamide Gel Electrophoresis (PAGE) 2.7.2.1 DNA Smal l fragments of D N A were separated by P A G E us ing either 15 or 20 % po lyac ry lamide gels i n I X Tris Borate E D T A (TBE) and r u n at 100-150 V [77]. 2.7.2.2 Crosslinked DNA-protein complexes Samples were ana lyzed by S D S - P A G E using either 8 or 12% po lyac ry lamide w i t h 5% stacking gels i n a vert ical min ige l electrophoresis system ( O w l Scientific) [77]. F o l l o w i n g i r rad ia t ion of D N A - p r o t e i n mixtures, samples were m i x e d w i t h 1/2 v o l u m e of 3 X sample buffer (187.5 m M T r i s - H C l ( p H 6.8), 6% ( w / v ) SDS, 30% glycero l a n d 0.03% brompheno l blue). Samples were bo i l ed for 10 minutes p r io r to load ing . For u n k n o w n reasons, m a n y crossl inked p r o t e i n - D N A complexes do not enter po lyac ry lamide gels w h e n so lub i l i zed i n sample buffer that does not contain at least I M urea [88]; therefore after bo i l ing 1/5 vo lume of 5 M urea was added to samples p r io r to load ing . Gels were electrophoresed (200-210 V ) then d r i e d us ing a gel dryer (BioRad) on W h a t m a n D E 81 filter paper. Dr i ed gels were exposed to a phosphoimager screen (Molecular Dynamics) for 24-96 hours. 30 Materials and Methods 2.8 Uptake experiments Radioac t ive ly labeled D N A (1 ug) was incubated w i t h 1 m l of freshly made M I V -competent cells. Ce l l s and D N A were ro l led at 37°C for 10 minutes. D N a s e I (50 ug) was added and the mixture was placed on ice. After 5 minutes 100 u l of N a C l (5M) was added a n d cells were pelleted by centrifugation at 13,000 r p m for 1 minu te at 4°C (Canlab Biofuge A ) . The supernatant f lu id was removed and cells were resuspended i n co ld M I V containing 1 M N a C l . Cel ls were again pel leted and the supernatant l i q u i d removed. The pellet was resuspended i n 200 u l of M I V at r o o m temperature and transferred to a scintil lation v ia l . Scint i l lat ion f l u i d (1 ml) was added and the radioact ivi ty of the sample was counted us ing the scint i l la t ion counter. 2.9 Binding experiments For some experiments it was necessary to determine the amount of D N A b o u n d by cells. This was achieved us ing a b ind ing assay. This procedure differs f rom uptake experiments i n that a b i n d i n g assay determines the amount of D N A that is able to be r emoved f rom the outside of cells, after non-specifically b o u n d D N A is r emoved . Brief ly, for b i n d i n g experiments, cells were incubated w i t h labeled D N A for 10 minutes , then washed w i t h M I V to remove any D N A that was non-specif ical ly associated w i t h the outside of the cell. After the non-specific D N A was thought to be r emoved , cells were treated w i t h DNase I to remove specifically b o u n d D N A . F o l l o w i n g D N a s e I treatment, cells were washed w i t h a h igh salt so lu t ion to facilitate r e m o v a l of D N A that remained b o u n d to cells. F o l l o w i n g these treatments the amount of label released into the supernatant f lu id was counted. 31 Materials and Methods 2.10 UV laser crosslinking C r o s s l i n k i n g experiments used a Quanta-Ray M o d e l G C R 1 4 S pu l sed N d : Y A G (neodymiumyt t r ium-a luminum-garne t ) laser (Spectra Physics) (i l lustrated i n F igure 2.2). Access to this laser was generously p r o v i d e d b y Dr . M . Roberge (Dept. of Biochemis t ry and Molecu la r Biology, U B C ) . This laser emits photons w i t h a wave leng th of 1064 n m . It is equipped w i t h an H G - 2 harmonic generator (Spectra Physics) containing K D * P (potassium d ideute r ium phosphate) crystals, w h i c h reduces the wave leng th of the emitted l ight f rom 1064 to 266 n m . Dich ro i c mi r rors (DHS-2 Quanta-Ray dichroic harmonic separator) are used to el iminate res idual 532 and 1064 n m l igh t to a beam d u m p and to reflect monochromat ic 266 n m light. This conf igurat ion a l lows the laser to emit 5-6 ns pulses w i t h an energy of up to 60 mj and a beam diameter of 6.4 m m . The energy was measured w i t h an A s t r a l A A 3 0 power and energy meter equ ipped w i t h an A C 2 5 U V sensor (Scientech) [88]. Freshly made M I V competent H. influenzae cells were incubated w i t h labeled D N A for 10 seconds, 1 minu te or 30 minutes pr ior to cross l inking. The rationale for v a r y i n g the time of incubat ion was to max imize the probabi l i ty that the receptor was i n contact w i t h the labeled D N A w h e n the pulses from the laser were app l ied . W h e n c ross l ink ing experiments were performed us ing b io t inyla ted ol igos, the labeled ol igos were incubated w i t h cells for 10 minutes pr ior to c ross l inking . Cel ls (50 p l , O D 0.2) were added to D N A (0.1 u g -1 ug) i n a microfuge tube and m i x e d w i t h a pipette tip. O p e n 1.5 m l microfuge tubes were placed hor izon ta l ly i n the path of the laser. Tubes were stabil ized by p lac ing them i n a 10-mm hole d r i l l ed 32 Materials and Methods N d : Y A G laser Harmonic 1064 nm generator 266 nm Dichroic mirrors 266 nm pulse Sample Beam dump (1064 nm, 532 nm) Plexiglass holder Micromanipulator Figure 2.2 Schematic drawing of apparatus used for U V laser cross- l inking. (Modif ied from H o et al., (1994). This is a top view, not to scale. The laser delivers pulses of 1064 nm. The harmonic generator reduces the wavelength of input light to 266 nm. The dichroic mirrors a l low passage of only 266 n m monochromatic light to the sample. Other wavelengths (1064 n m and 532 nm) are directed to the beam dump. The sample is held horizontally by a plexiglass sheet attached to a micromanipulator. 33 Materials and Methods i n a sma l l plexiglas sheet he ld i n place by a B r i n k m a n n micromanipula tor . C r o s s l i n k i n g experiments were performed w i t h three to six 50-mJ pulses. For c ross l ink ing experiments us ing streptavidin-agarose beads, samples were i r radia ted w i t h 6 pulses of U V l ight from the laser. F o l l o w i n g cross l ink ing , 1 % SDS was added to samples then incubated at 37°C for 10 minutes. The supernatant l i q u i d was r e m o v e d and streptavidin-agarose beads were washed once w i t h M I V . Samples were then treated w i t h D N a s e (see section 2.8) for 5 minutes on ice. Sample buffer was added and the entire sample was loaded into the w e l l . Af ter electrophoresis gels were stained us ing a silver s taining ki t (BioRad si lver stain plus). 34 Uptake Results and Discussion C H A P T E R T H R E E Charac te r i za t ion of D N A sequences requ i red for up take b y H. influenzae Competen t H. influenzae cells preferentially take up D N A w h i c h contains a specific uptake s ignal sequence (USS). In addi t ion to the 9 bp core, other factors m a y also affect uptake. In this chapter I describe experiments that address h o w f lank ing sequences affect D N A uptake by competent H. influenzae cells. 3.1 Is the 29 b p U S S suf f ic ient for uptake? USSs i n the genome are f lanked by regions of conserved sequence (see Figure 1.2). The 9 bp core and regions f lanking the USS total 29 base pairs. P rev ious research treated D N A uptake i n a qualitative manner [30]. H o w e v e r , this d i d not address the w i d e range (2 n g -150 ng) of uptake w h i c h occurs depend ing on D N A length, the sequence of the 9 bp core and variations i n the A / T richness f l ank ing the U S S . Since uptake occurs over such a range, it is more accurate to present it as a quanti tat ive value rather than a qualitative one. 3.1.1 Uptake of a 'per fect 'USS Uptake can be quantif ied i n two ways: u g of D N A / m l of competent cells or number of D N A molecu le s / ce l l . It is unclear whether the total amount of D N A taken u p by cells, or the number of molecules taken up per cell , is the most b io log ica l ly relevant w a y to present the data. Therefore, i n this chapter data w i l l be presented i n both ways . For clarity, i n the fo l l owing sections I w i l l include smal l diagrams of the oligos used. Black boxes represent the 9 bp core, hatched regions represent the consensus base and whi te regions represent non-conserved sequences. 35 Uptake Results and Discussion Is the 29 bp 'perfect' U S S sufficient for uptake? A n oligo (USS-1) was des igned based on the informat ion i n Figure 1.2. It contains a 9 bp core USS and i n the 3' f l ank ing reg ion it contains the consensus base (the base that occurs most frequently at that pos i t ion f o l l o w i n g a U S S i n the genome) QJss-1 MMZ/Z^} ( g e e Table 2.3). For consistency, I w i l l refer to the orientation of the U S S as presented i n F igure 1.2. Sequences to the left of the 9 bp core w i l l be termed 5' and sequences to the r ight w i l l be referred to as 3'. In add i t ion to USS-1 a negative control ol igo (USS-R) was also designed. U S S - R is the same length and base composi t ion as USS-1 but does not contain a 9 bp core [u s s " R I HI (See Table 2.3). Since USS-1 contains the consensus base at each posi t ion i n the core and f lanking regions, I p red ic ted that cells w o u l d b i n d and take it up preferentially over USS-R. Up take of USS-1 and USS-R was tested us ing nick translated H. influenzae and B. subtilis ch romosomal D N A as positive and negative controls, respectively. The results of this experiment are s h o w n i n Figure 3.1. F igure 3.1 (a) shows that USS-1 is not taken up better than negative control D N A s . A p p r o x i m a t e l y 100 fo ld more labeled H. influenzae ch romosomal D N A was taken up than a l l other D N A s . This correlates w e l l w i t h publ i shed results [15]. F igure 3.1 (b) represents uptake expressed as numbers of molecules per cell . It is clear t h a t H . influenzae chromosomal D N A is taken up better than B. subtilis ch romosoma l D N A . F r o m these data it appears that six fo ld more molecules of USS-1 and U S S - R were taken up per cell than M A P 7 D N A . This is because of the length of the chromosomal D N A , w h i c h was approximate ly 20 kb (estimated by electrophoresis). Since these chromosomal D N A fragments were m u c h longer than the ol igo, fewer molecules per cell were taken up. L i k e figure 3.1 (a) this figure shows that USS-1 is not taken up better than its negative control U S S - R . 36 Uptake Results and. Discussion 100-90-80-Uptake 70-(ng/ml) 60-50-40-30-20-10-o-MAP7 Bacillus © 90 - | 80 70 Uptake 60 (molecules/cell) 50-1 40-| 30 20 1<H 0 USS-1 USS-R MAP7 Bacillus ^ r USS-1 USS-R Figure 3.1. Uptake of 'perfect' USS oligo is not greater than an oligo that does not contain a USS. 1 m l of freshly made M I V competent cells were incubated w i t h 1 u g of D N A i n each case. Uptake procedures out l ined i n section 2.8 were fo l lowed . The mean va lue of duplicate trials are s h o w n and error bars represent the s tandard devia t ion between the samples. Where error bars are not s h o w n the error was too sma l l to graph. 37 • Uptake Results and Discussion These results i m p l y that uptake by H. influenzae requires more than the presence of a U S S oh the D N A molecule. Thus, the previous assumpt ion that the 9 bp core U S S is necessary and sufficient for uptake [30] appears to be incorrect. T w o possible explanations exist for the lack of recognit ion of USS-1 . First , sequence 5' to the core U S S m a y be necessary for h igh levels of uptake and second, the 29 b p molecu le m a y be too short to be taken up by competent cells. If the first explanat ion is correct, p lac ing a USS i n the midd l e of a 30 bp D N A fragment s h o u l d increase uptake of the fragment over negative control levels. H o w e v e r , i f the second explana t ion is correct, uptake shou ld be equal for al l 30 bp fragments regardless of the pos i t ion of the USS. Experiments testing these two possibi l i t ies are presented i n the fo l l owing sections. 3.2 Effect of USS position on binding and uptake Does the pos i t ion of the USS affect recognit ion and uptake of D N A ? In this section I w i l l address this question and test the hypothesis that h igh levels of uptake require sequences 5' to the 9 bp core USS . In most of the f o l l o w i n g experiments i n this chapter, both b i n d i n g and uptake results w i l l be presented, because i n determining h o w cells interact w i t h a D N A molecule , bo th the amount of D N A b o u n d and the por t ion of the b o u n d D N A that is taken u p are important . 3.2.1 O l i g o n u c l e o t i d e s 3.2.1.1 Binding and uptake of 30 bp DNA fragments In order to address the possibi l i ty that sequences 5' to the core U S S are necessary for uptake, a 30 bp ol igo was designed. USS-30 is 30 bp i n length, contains a 9 bp core and i n part of the 3' f lanking region it contains the USS consensus base 38 Uptake Results and Discussion [uss-301 wmz/Q (See Table 2.3). U n l i k e USS-1 , USS-30 has 11 bp 5' to the 9 b p core and contains on ly 10 bp of the 3' f lanking consensus (See Table 2.3). F igure 3.2 shows the results of b i n d i n g and uptake experiments per formed us ing USS-30, USS-1 and USS-R. These data show that, compared to USS-1 or USS-R , b i n d i n g a n d uptake are approximately three fold and two fo ld greater for USS-30. This impl ies that nucleotides 5' to the USS are necessary for uptake. 3.2.1.2 Binding and uptake of 50 bp fragments The result obtained w i t h USS-30 was further examined us ing longer ol igonucleot ides. USS-50 is a 50 bp fragment w i t h 15 bp 5' to the 9 bp core and 26 bp 3 , [uSS-50 [ Z I ^ H i I j] ( S e e T a b i e 2 .3 ) . L i k e USS-1 , USS-50 contains the consensus base i n the 3' f lanking region. For ease of c lon ing it also contains Kpnl and EcoRI restriction sites at its ends. I also des igned a 50 bp ol igo that consists of the 9 bp core starting one bp f rom the 5' end L__ =J and the consensus base at each pos i t ion m the 3' f l ank ing region (See Table 2.3). A negative control was also designed, USS-50-(See Table 2.3). L i k e USS-R , this ol igo does R [uSS-50-R not contain a U S S or f lanking consensus but has the same base compos i t ion as U S S -50. A s i n the p reced ing section, both b i n d i n g and uptake were tested. F igure 3.3 illustrates the results of these experiments. Figure 3.3 (a) shows that b i n d i n g decreases 1.5 fo ld w h e n the USS is located at the 5' terminus and 12 fo ld w h e n the 9 b p core is absent. U n l i k e the 30 bp D N A fragments, pos i t ion ing of the U S S at the 5' terminus d i d not decrease b i n d i n g to negative control levels. Ce l l s b o u n d 8.3 fo ld 39 Uptake Results and Discussion 0.8" 0.7" 0.6" 0.5 Binding 0 4 1 (ng/ml) 0.3 0.21 0.1 0 -25 -20 -15 USS-30 USS-1 USS-R 10 B i n d i n g ( m o l e c u l e s / c e l l ) © Uptake (ng/ml) 2.2' 2" 1.81 1.6-1.4-1.21 1-0.8-0.6" 0.4" 0.2-o-i USS-30 USS- USS-R 70 60 1-50 \- 40 Uptake (molecules/cell) r30 20 10 0 Figure 3.2. Binding and uptake of 29 and 30 bp oligonucleotides b y competent cells. The mean value of duplicate trials are s h o w n and error bars represent the standard devia t ion between the samples. Where error bars are not s h o w n the error was too smal l to graph. 40 Uptake Results and Discussion © Binding (ng/ml) © 0.7 0.6-0.5-0.4-0.3-0.2-o.i-0 r ~ i USS-50-Le USS-50 USS-50-R (left) (middle) (no USS) 14 -12 -10 - 8 6 - 4 - 2 0 Binding (molecules/cell) Uptake (ng/ml) 4 -3" 2' r 0" USS-50-Le USS-50 USS-50-R (left) (middle) (no USS) r l40 120 "100 " 80 60 40 20 0 Uptake (molecules/cell) Figure 3.3. Binding and uptake of 50 bp oligonucleotides by competent H. influenzae cells. The mean value of duplicate trials are s h o w n and error bars represent the standard deviat ion between the samples. Where error bars are not shown the error was too smal l to graph. 41 Uptake Results and Discussion more of USS-50-Le than of the negative control USS-50-R. Up take experiments i n part (b) show that uptake of USS-50 and USS-50-Le were 3.2 and 2.2 fo ld greater than the negative control levels, respectively. These results, l ike the results us ing the 30 bp D N A fragments, show that the pos i t ion of the U S S w i t h i n a fragment affects uptake. In order for m a x i m a l uptake to be achieved, D N A must have sequence 5' to the U S S (the m i n i m u m length of 5' sequence needed for op t ima l uptake was not tested). H o w e v e r , u n l i k e the 30 b p ol igos, i f the 5' sequence is absent i n 50 bp molecules, uptake and b i n d i n g are decreased but not abolished. 3.2.2 U p t a k e of p l a s m i d D N A m o d i f i e d b y inser t ion of U S S sequences The results presented above are based on changes of the pos i t ion the U S S w i t h i n short D N A fragments. To determine if these results are applicable to longer fragments, alteration of USS placement w i t h i n a 3 kb fragment was tested. USS-1 was c loned into the mul t ip le c loning site of p G E M 7 and the p l a s m i d was l inear ized separately w i t h three restriction enzymes Seal, Kpnl and Clal, such that the U S S and f lank ing consensus were local ized to the midd le , 5' and 3' ends respectively. Cleavage of the p l a s m i d w i t h Kpnl and Seal p laced the U S S w i t h i n four bases of the 5' end and 30 bp of :the 3' end, respectively, whereas a l l l inear ized p lasmids contained the entire 3' f lanking consensus region (Figure 3.4 a). The results of these uptake experiments are s h o w n i n Figure 3.4 (b). Placement of the U S S near the 3' end or the midd le of the linear p l a s m i d after cleavage w i t h Clal or Seal d i d not significantly affect uptake. Uptake of the linear p l a s m i d conta ining the U S S on the 5' end was less than other fragments. This is most l i ke ly due to the p rox imi ty of the USS to the 5' end. Demonstra ted w i t h 30 and 42 © 1 40-35-: 30-25-Uptake (ng/ral) 2 0 ~ 15-10-5-: o-^  Left (Kpnl) Middle (Seal) Rieht (ClaJ) r i 8 16 M 4 h i 2 10 Uptake (molecules/cell) 8 - 6 - 4 - 2 0 F igure 3.4. Up take of c loned U S S - 1 . a) Schematic d iagram of cloned USS-1. 9 bp core U S S is s h o w n i n bo ld . Ex tended consensus sequence is under l ined. C u t sites are s h o w n w i t h an arrow. Seal cut site is approximated. b) USS-1 was cloned into p G E M 7 - digested w i t h the indicated enzymes and end-labeled. One u g of 3 kb linear D N A was incubated w i t h cells as ou t l ined i n section 2.8. The mean value of duplicate trials are s h o w n and error bars represent the s tandard devia t ion between the samples. Where error bars are not s h o w n the error was too smal l to graph. 43 Uptake Results and Discussion 50 bp fragments, nucleotides 5' to the USS are necessary for efficient uptake. F r o m these results I conc luded that the necessity of 5' sequence for m a x i m a l uptake of U S S conta in ing D N A s applies to long D N A fragments as w e l l as short oligos. 3.3 L e n g t h d e p e n d e n c e of u p t a k e : Is U S S - 1 too s h o r t to b e t a k e n u p ? I tested the poss ib i l i ty that the l o w uptake of USS-1 was because a 29 bp fragment was too short to be recognized and taken u p by cells. If this explanat ion were correct a 29-30 b p fragment shou ld not be taken up b y cells regardless of the pos i t ion of the U S S . A s demonstrated i n section 3.2.1.1 this is not the case. Thus , i f 29-30 bp is l o n g enough to be taken up by cells, then uptake s h o u l d be s imi la r for 30, 40 and 50 bp fragments containing USSs i n the midd le . This p red ic t ion was tested by use of a 40 bp ol igo, designed to contain 11 bases 5' to the U S S core and the [uss-4oi mw/zzx^ consensus bases i n the 3' f lanking region F igure 3.5 shows the results of uptake experiments. Figure 3.5 (a) shows that the amount of D N A taken up per m l of cells increases as the length of the D N A fragments increase. This resembles the f ind ing that more ch romosomal D N A is taken u p than short oligos on a mass basis. H o w e v e r , w h e n these data are presented as numbers of molecules per cell it appears that uptake is equal for each ol igo. This indicates that USS-30 is long enough to be taken u p by cells. Thus the l i k e l y reason for l o w uptake of USS-1 is due to the absence of sequences 5' to the USS. F r o m Figure 3.5 (b);it appears that 30 molecules of U S S - R are taken u p per cell . This is l i ke ly a case of non-specific interaction of USS-R w i t h the cells. A l ipopolysacchar ide layer covers gram-negative bacteria [89,90], and so I speculate that this apparent uptake m a y be a consequence of D N A that has become 44 Uptake. Remits and Discussion © Uptake (ng/ml) 71 6 5 " 4 " 3 -2 1 1 0 © Uptake (molecules/cell) T USS-50 USS-40 USS-30 USS-R 160-140' 1201 100' 80' 601 40 201 0 USS-50 USS-40 USS-30 USS-R Figure 3.5. Uptake of different length oligos. The mean value of duplicate trials are s h o w n and error bars represent the standard devia t ion between the samples. Where error bars are not s h o w n the error was too smal l to graph. 45 Uptake Results and Discussion in te r twined w i t h the l ipopolysaccharide layer m a k i n g it inaccessible to D N a s e I. If this is the case, then D N A w o u l d appear to be taken up by cells w h e n i n fact it is s i m p l y b o u n d to the l ipopolysacchar ide region of the outer membrane. The explanat ion for this apparent uptake was not direct ly tested a l though, section 3.5.1 addresses this indirectly. 3.4 Ef fect of 3 ' consensus f l a n k i n g sequence on DNA b i n d i n g a n d uptake This section outlines experiments that tested h o w changing both the length and base compos i t ion of the 3' f lanking region affects uptake. 3.4.1 B ind ing and uptake of 50 bp oligos containing the non-consensus bases in the 3' f lank ing region. Uptake of a D N A fragment increases w h e n the U S S is f lanked by an A / T r i ch sequence [30, 91]. These experiments, performed before the H. influenzae genome was sequenced, tested natural ly occurr ing and artificially designed sequences. To test the effect of base composi t ion on uptake, a 50 bp ol igo was synthesized (USS-50-R C ) . This ol igo contains a 9 bp core USS. H o w e v e r , this oligo instead of conta ining the consensus bases i n the f lanking region has the least c o m m o n base at each pos i t ion (shaded region) ESS 5 0~R CI HZE^K^MIMMM, ZZ\ T | ^ g e e y / a r j i e 2.3). For direct compar i son of the effect of the 3' sequence, the sequence 5' to the USS is ident ica l to USS-50. The results of uptake and b i n d i n g experiments are i l lustrated i n F igure 3.6. F igure 3.6 (a) shows that b i n d i n g of USS-50 was 2 fo ld greater than for U S S - 5 0 - R C and 2.8 fo ld greater than USS-50-R. B i n d i n g of USS-50-RC was. 1.4 fo ld greater than USS-50-R. Up take of USS-50 was 2.3 fo ld greater than uptake of U S S - 5 0 - R C , whereas USS-50-RC was taken up 2.3 fo ld better than USS-50-R. F r o m these results 46 Uptake Results and Discussion 0.6" 0.5" 0.4" Binding (ng/ml) 0.3-0.2" o . i -0 J Binding USS-50 USS-50-RC USS-50-R h o 8 6 (molecules/cell) h 4 2 0 ® 8" 7" 6" Uptake 5" (ng/ml) 4 . 3" 2" 1-o-b "140 "120 -100 _ 8 n Uptake (molecules/cell) 60 "40 - 20 0 USS-50 USS-50-RC USS-50-R F igure 3.6. B i n d i n g and uptake of 50 bp o l igos . USS-50 contains the USS i n the midd l e of the D N A fragment. U S S - 5 0 - R C contains the U S S i n the m i d d l e of the fragment but contains the least c o m m o n nucleotide at each pos i t ion i n the 3' f l ank ing consensus region. USS-50-R does not contain a U S S . The mean value of duplicate trials are s h o w n a n d error bars represent the standard devia t ion between the samples. W h e r e error bars are not s h o w n the error was too smal l to graph. 47 Uptake Results and.Discussion I conclude that cells are able to take up D N A s containing the least c o m m o n base i n the 3' f l ank ing consensus region, a l though at a m u c h lower level than D N A conta in ing an A / T r ich f lanking region. These data agree w e l l w i t h previous results of analysis of the effect of G / C f lanking richness on uptake [30,91]. One reason pu t fo rward to explain the greater uptake of D N A conta in ing A / T r i ch f l ank ing sequences was that the receptor makes contact w i t h the m i n o r groove of the i n c o m i n g D N A [30]. In the minor groove, A / T base pairs differ f rom G / C pairs b y the absence of the centrally located 2-amino group of guanine [92]. It is thought that after the receptor contacts the D N A it may induce part ial me l t ing i n the region of the 9 bp core, a process facilitated by the lower mel t ing point of A + T - r i c h D N A [30]. 3.4.2 B i n d i n g and uptake of D N A l a c k i n g sequences 3' to the 9 bp core The prev ious section i l lustrated that base composi t ion of the 3' f l ank ing region affects uptake. To further explore this, I examined h o w the absence of 3' sequence affects uptake. A 50 bp oligo (USS-50-Ri) was designed that contained a 9 bp core at the 3' terminus. To main ta in fragment length and the same base compos i t ion as USS-50, sequences 3' of the core i n USS-50 were placed 5' to the core of USS-50-Ri [uSS-50-Ri I ~ ^Mj] It was predicted that r emova l of the 3' f l ank ing consensus sequence w o u l d decrease the cell's abil i ty to b i n d and take u p the ol igo. The results of b i n d i n g and uptake experiments are presented i n F igure 3.7. These results show that D N A lack ing 3' sequence is not b o u n d or taken up better than a negative control . B i n d i n g of USS-50-Ri was only s l ight ly better (1.4 fold) than USS-50-R. Uptake of USS-50 was 6.8 fold greater than USS-50-Ri . USS-50-R was 48 © Uptake Results and Discussion 0.6 i 0.5 1 0.4 Binding (ng/ml) Q 3 J 0.2 H 0.1 1 f 12 ho 9 8 7 6 5 4 3 2 1 0 Binding (molecules/cell) USS-50 USS-50 R i USS-50-R (USS 3') (no USS) © Uptake (ng/ml) 6 a 3 21 -160 -140 -120 " 1 0 ° Uptake - go (molecules/cell) h 60 40 h 20 0 USS-50 USS-50-Ri USS-50-R (USS 3') (no USS) F igure 3.7. B i n d i n g and uptake of 50 b p o l igos . USS-50 contains the USS i n the midd l e of the D N A fragment. USS-50-Ri contains the U S S at the 3' terminus. USS-50-R does not contain a USS. The mean value of duplicate trials are s h o w n and error bars represent the standard devia t ion between the samples. Where error bars are not shown the error was too sma l l to graph. 49 Uptake Results and Discussion taken u p 1.3 fo ld better than USS-50-Ri . These results indicate that the absence of 3' f l ank ing sequence decreases b i n d i n g to nearly the negative control levels and comple te ly abolishes uptake. I conclude that sequences 3' to the core U S S are absolutely requi red for uptake. 3.5 C o m p e t i t i o n of v a r i o u s D N A s f o r u p t a k e of c h r o m o s o m a l D N A A s a different k i n d of test of the abil i ty of various D N A s to be b o u n d and taken u p b y competent H. influenzae cells, competi t ion tests were performed. This assay was used to test whether or not the b i n d i n g and uptake results descr ibed i n the preceding sections were representative of actual b i n d i n g and uptake by cells. The general basis of a competi t ion assay is that a labeled D N A fragment, specif ical ly taken u p by cells, is incubated w i t h cells i n the presence or absence of un labe led compet ing D N A s (See Figure 3.8). W e can consider two cases. First, i f un labe led D N A s are taken up by cells and there are a l imi t ed number of receptors per cell , the unlabeled D N A w i l l compete w i t h the labeled D N A for access to receptors and decrease the amount of labeled D N A taken up (Figure 3.8 b). In the second case, i f the unlabe led D N A is not taken up by cells, competi t ion for access to the receptor w i l l not occur and labeled D N A w i l l be taken up at a h igh level (Figure 3.8 a and c). U s i n g this m o d e l , I expect that D N A s taken u p by cells in the previous sections s h o u l d compete for uptake of labeled M A P 7 and those that were not taken u p s h o u l d not. 50 Uptake Results and Discussion (1^ No competing D N A .yy^yy' (2) Specific competitor -yy^yy (^^Non-specific competitor 4 labeled molecules taken up 2 labeled molecules and 2 unlabeled molecules taken up 4 labeled molecules taken up ^ ^ ^ ^ Labeled DNA containing a USS Unlabeled competing DMA containing a USS Unlabeled competng DNA without a USS Figure 3.8 Schematic representation of a competition assay. a) Cel ls are incubated wi th labeled D N A containing a USS. Cel ls take-up 4 molecules of labeled D N A . b) Cel ls are incubated w i th labeled D N A containing a USS and unlabeled D N A that also contains a USS. A s a result of competitionfor access to the receptor, cells only take up 2 molecules of labeled D N A . c) Ce l l s are incubated w i t h labeled D N A containing a USS and unlabeled D N A that does not contain a USS. Since the competing D N A does not contain a USS cells are able to take-up 4 molecules of labeled D N A . 51 Uptake Results and Discussion 3.5.1 C o m p e t i t i o n b e t w e e n c h r o m o s o m a l D N A and 2 9 b p fragments Labe led M A P 7 chromosomal D N A ( l p g , approximately 20 kb) and unlabe led compet ing D N A s ( M A P 7 , E. coli D H 5 a , USS-1 and USS-R) were m i x e d i n tubes pr ior to the add i t i on of competent cells. Cel ls were incubated w i t h the D N A s for 10 minutes and the general uptake procedure was fo l lowed. F igure 3.9 shows the results of this experiment. Un labe led M A P 7 D N A competes for uptake of labeled M A P 7 D N A . This is expected because M A P 7 D N A is specifically b o u n d and taken up by competent H. influenzae cells. DH5oc ch romosomal D N A and USS-R do not interfere w i t h uptake of M A P 7 D N A . This is also expected since these D N A s are not taken up by cells. USS-1 competes w e a k l y w i t h uptake of M A P 7 chromosomal D N A better than U S S -R. This is surpr i s ing since figure 3.2 shows that USS-1 is not b o u n d or taken u p better than U S S - R . This compet i t ion might arise if USS-1 is b o u n d w e a k l y by the receptor. It was theorized by De ich and Smi th (1980) that D N A uptake occurs i n three stages [29]. The first is weak/ revers ib le b i n d i n g of D N A by receptors. The second step is s t rong/ i r revers ible b i n d i n g i n w h i c h the D N A is commi t t ed to uptake. The th i rd step is the conversion of D N A into a D N a s e resistant, non -elutable fo rm. Thus , i f USS-1 is able to be b o u n d weak ly by the receptor it w o u l d interfere w i t h uptake of labeled M A P 7 D N A . 3 .5 .2 C o m p e t i t i o n b e t w e e n c h r o m o s o m a l D N A fragments and 50 b p fragments U s i n g the same assay as above, the abil i ty of 50 bp fragments to compete for uptake of 20 kb chromosomal D N A was studied. Figure 3.10 shows that USS-50 and U S S -50-Le compete for uptake of labeled chromosomal D N A , however , U S S - 5 0 - R C , U S S -50-Ri and USS-50-R do not. 52 Uptake Results and Disrussinn 100 n Uptake of chromosomal D N A (ng/ml) lo-in 10 Uptake of chromosomal D N A (molecules/cell) M A P 7 D H 5 a USS-1 Compe t ing D N A s • 0 LJg competing D N A ED 1 jag competing D N A H 4 |ig competing D N A H 20 iag competing DNA U S S - R Figure 3.9. Competit ion for uptake of labeled chromosomal D N A . C o m p e t i n g D N A s were mixed w i t h 1 p g of labeled M A P 7 D N A pr ior to the addi t ion of cells. Uptake of the labeled D N A was measured by the standard assay. The mean value of duplicate trials are s h o w n and error bars represent the standard deviat ion between the samples. W h e r e error bars are not shown the error was too smal l to graph. 53 Uvtake Remits and Discussion lOOi Uptake of chromosomal DNA (ng/ml) icH EC Q C/3 7 3 r i i Compe t ing D N A s Q 0 ng competing DNA ™ 1 ^g competing DNA ^ 4 ng competing DNA El 20 (ig competing DNA 0* in 7 3 r lO Uptake of chromosomal D N A (molecules/cell) hi :S. 'J~. Figure 3.10. C o m p e t i t i o n for uptake of l a b e l e d c h r o m o s o m a l D N A . C o m p e t i n g D N A s were mixed wi th 1 u g of labeled M A P 7 D N A pr ior to the add i t ion of cells. Uptake of the labeled D N A was measured by the standard assay. The mean value of duplicate trials are s h o w n and error bars represent the standard deviat ion between the samples. Where error bars are not s h o w n the error was too smal l to graph. 54 : Uptake Results and Discussion This in format ion correlates w e l l w i t h the informat ion i n Figure 3.9 w h i c h shows that sequence 5' to the U S S is not needed for compet ing D N A s to interfere w i t h the uptake of ch romosomal D N A . H o w e v e r , sequence 3' to the 9 bp core is needed, and must be A / T r i ch if a D N A molecule is to compete. Var ia t ions i n the counts due to incomplete r emova l of labeled M A P 7 D N A from cells cou ld account for the apparent increase i n uptake of labeled M A P 7 chromosomal D N A i n the presence of USS-50-R and USS-50-RC. 3.6 Discussion of uptake results. Exper imenta l investigations of D N A b i n d i n g and uptake, p r ior to comple t ion of the H. influenzae genome sequence, indicated that b i n d i n g is saturable, reversible and specific. This suggested that a receptor protein, or complex of proteins, are responsible for the observed sequence specific uptake [41]. In this thesis I have at tempted to expand on previous results, gu ided by informat ion ga ined f rom the sequencing of the H. influenzae genome. Throughou t this thesis I have addressed a number of questions i n an attempt to assemble a m o d e l of preferential uptake of D N A i n H. influenzae. The general focus of these research questions address the importance of f lanking sequence on uptake, i n an attempt to determine h o w proteins that make u p the receptor interact w i t h the D N A molecule . USSs w i t h i n the genome are f lanked by regions of conserved sequence. W i t h this informat ion I designed oligos w i t h variat ions i n these f lanking regions. O l igos were var ied i n both length and composi t ion of 3' a n d 5' f l ank ing sequence. I have been able to show that nucleotides 5' to the U S S are requ i red for h i g h levels of b i n d i n g and uptake of D N A however , the length and base compos i t ion of the 5' region was not tested. A l s o , I have s h o w n that both length and base compos i t ion of the 3' f lanking region greatly affect b i n d i n g and uptake. If 55 . _/ Uptake Results and Discussion sequence 3' to the U S S is G / C r ich , uptake proceeds at a very l o w level . H o w e v e r , if D N A lacks a 3' sequence, both b ind ing and uptake are abolished. 3.7 Further research M a n y questions concerning the effect of f lanking D N A on b i n d i n g and uptake r ema in unanswered . I w i l l briefly cover two points that m a y be addressed i n the future. First , o l igos containing a single bp 5' to the U S S , and p lasmids that contain 4 b p 5' to the U S S , are not taken u p at w i ld type levels by cells. One quest ion to address c o u l d be: W h a t is the m i n i m u m length of the 5' sequence needed for h i g h levels of uptake to occur? Second, one can ask: H o w does a G / C r ich 5' f l ank ing sequence affect uptake, if the 3' f lanking consensus is A / T rich? If the D N A is denatured 5' to the U S S then increasing the G / C richness w i l l decrease uptake, as it does i n the 3' f lanking region. H o w e v e r , if denaturation does not occur i n the 5' r eg ion uptake shou ld not be affected. 56 Crosslinking Results and Discusion CHAPTER FOUR UV Laser Crosslinking Crosslinking labeled DNA to the receptor. U V laser c ross l inking is a powerfu l technique to s tudy D N A - p r o t e i n interactions. The des ign of m y cross l inking experiments was s imple. Labe led D N A was incubated w i t h competent cells. Samples were i r radiated w i t h three to six pulses f rom the laser, then bo i led i n sample buffer. Proteins were separated by po lyac ry lamide gel electrophoresis, stained w i t h either coomassie blue or s i lver and exposed to a phosphoimager screen. Variables adjusted were the t ime of incubat ion w i t h D N A a n d also the presence or absence of unlabeled compet ing D N A s . This chapter outlines the results attained i n attempting to crossl ink D N A to the H. influenzae receptor protein. 4.1 Time interval for uptake of USS-50 For U V l ight to crossl ink the receptor to D N A , the pulses must be de l ive red w h e n the two molecules are i n contact. To approximate w h e n the D N A contacted the receptor, I tested w h e n uptake begins and for h o w long uptake proceeds. Prev ious experiments have demonstrated that uptake of chromosomal D N A is complete w i t h i n 5 minutes [15, 29]. H o w e v e r , this had not been tested w i t h very short D N A molecules. F igure 4.1 shows that uptake of USS-50 begins soon after incubat ion w i t h cells. The D N a s e pre-treatment point corresponds to D N A being treated w i t h D N a s e for 10 minutes pr ior to incubat ion w i t h cells. Lit t le D N A is taken u p i n the first minute and 57 Crosslinking Remits and Discussion Uptake (ng/ml) r 100 Uptake (molecules/cell) h 10 DNase pre-treatment Time of incubation (minutes) F igure 4.1. Up take of l abe led USS-50 as a func t ion of t ime. Ce l l s were incubated w i t h l u g of labeled USS-50 for var ious time intervals, preceeded or fo l lowed by treatment w i t h D N a s e I as out l ined i n section 2.8. 58 . Crosslinking Results and Discusion uptake is complete after 10 minutes. F r o m this data I conc luded that i r rad ia t ion of samples s h o u l d take place before 10 minutes, pr ior to comple t ion of uptake. 4.2 Does crosslinking increase the amount of D N A associated with cells? To isolate the receptor, laser cross l inking must create crosslinks between labeled D N A and outer membrane proteins. To test if this was possible, D N A was incubated w i t h cells w i t h and wi thout i r radia t ion from the laser, and the amount of D N A b o u n d to the outside of cells was studied. Cel ls were first incubated w i t h D N A . A t specified times (10 sec, 1 m i n and 30 min) laser pulses were de l ivered to i n d i v i d u a l samples. After incubation, cells were washed and the amount of D N A able to be r e m o v e d b y D N a s e treatment was tested. I predic ted that if U V l ight caused the format ion of crosslinks, then the amount of D N A b o u n d to the outside of cells shou ld be increased by irradiat ion. The results are s h o w n i n F igure 4.2. The amount of D N A b o u n d to the surface of cells (i.e. accessible to D N a s e I) was increased by i r rad ia t ion after 10 seconds and 1 minute of incubat ion. H o w e v e r , i r rad ia t ion after 30 minutes of incubat ion d i d not increase the amount of D N A b o u n d , compared to the non-irradiated control. These results indicate that U V i r rad ia t ion increases the amount of D N A b o u n d to the outside of cells at short but not l ong incubat ion times. The increase i n the amount of D N A b o u n d to cells at short incubat ion times is most l i ke ly a result of D N A being i n contact w i t h the receptor at those time points. A s is s h o w n i n F igure 4.1, after 30 minutes cells have completed uptake of D N A , and so w h e n these cells were i r radiated there was little i f any D N A b o u n d to the outside of cells. 59 Crnsslinkiw Results and Discussion 0.25-1 0.2-Binding of USS-50 Q.15H (ng/50 ul cells) 0.H 0.05H h 7 5 i 1 1 r No X- l ink 10 sec. 1 min. 30 min. LOO r- 50 h 25 Binding of USS-50 (molecules/cell) Timing of mediation Figure 4.2. Crosslinking increases the amount of D N A associated with the outside of cells. Cel l s (50 ul) were incubated w i t h 0.05 u g of labeled USS-50, then irradiated w i t h a laser pulse at the indica ted times. D N A was removed from the outside of cells b y treatment w i t h D N a s e I and h igh salt washes. 60 Crosslinking Results and Discusion 4.3 Crosslinking using labeled USS-50 Ini t ial c ross l ink ing experiments used end labeled USS-50 as the 'bait'. A short ol igo was used, rather than labeled chromosomal D N A , i n an attempt to m i n i m i z e the amount of non-specific cross l inking (see Figure 4.3). C o m p e t i n g D N A was used i n the fo l lowing experiments to differentiate between sequence-specific and nonspecific crossl inking. If cells are incubated w i t h equal amounts of labeled and unlabeled D N A that are specifically recognized, the unlabeled D N A shou ld compete w i t h the labeled D N A for access to the receptor. This compet i t ion w o u l d lead to a decrease i n the amount of label associated w i t h proteins that b i n d D N A i n a sequence specific manner. H o w e v e r , if unlabeled compet ing D N A is not recognized there w i l l be no change i n the amount of label associated w i t h the receptor. Further to this, w h e n a compet ing D N A is used that is not recognized by cells, less label shou ld become associated w i t h proteins that b i n d D N A independent of its sequence. Figure 4.4 shows the results of c ross l ink ing experiments performed us ing USS-50. T w o compet ing D N A s were used i n these experiments, one that w o u l d compete w i t h labeled USS-50 for access to the receptor (unlabeled USS-50) and another that w o u l d not (unlabeled USS-R) . To m i n i m i z e the amount of background, a serial d i lu t ion of labeled USS-50 was used i n c ross l ink ing experiments . The mig ra t ion of D N A i n a polyacry lamide gel changes w h e n it is b o u n d to a p ro te in [93, 94], so I expected that these short D N A fragments s h o u l d migrate more s l o w l y w h e n crossl inked to a protein. H o w e v e r , the non-cross l inked D N A i n lane 9 migrates no faster than the crossl inked bands i n lanes 1-8. F r o m this I conc luded that cross l inking had not occurred and the bands seen i n lanes 1-8 were most l i ke ly un-reacted labeled D N A . N o other bands were vis ib le i n the image p r o d u c e d b y the phosphoimager screen 61 Crosslinkinv Results and Discussion Figure 4.3. Representationof hypothetical crosslinking using short and long D N A fragments. 1. L o n g nick translated chromosomal D N A used i n c ross l ink ing experiments has a h igh probabil i ty of coming into contact w i t h and becoming crossl inked to non-receptor membrane proteins. 2. Short oligonucleotides i n cross l inking experiments are less l i ke ly to come into contact w i t h non-receptor membrane proteins. 62 Crosslink™? Results and Discussion Figure 4.4. C r o s s l i n k i n g USS-50 to w i l d - t y p e H . influenzae ce l ls . Phosphor imager detection of 3 3 P radioact ivi ty associated w i t h bands i n an SDS-P A G E gel. N u m b e r s represent the amount of D N A incubated w i t h cells pr ior to cross l inking . Dashes indicate no D N A added. Labe led USS-50 (lanes 1-4) was crosslinked to competent K W 2 0 cells (50 pl) i n the presence of compet ing unlabeled D N A (USS-50, l aned 5 and 7; USS-50-R, lanes 6 and 8. Cros s l i nk ing was performed after 1 minute of incubat ion of cells w i t h D N A . Lane 9 contains labeled USS-50 loaded direct ly onto the gel. 63 , Crosslinking Results and Discusion 4.4 Crosslinking following varied times of incubation Ini t ia l attempts d i d not produce enough crossl inking to a l low v i sua l i za t ion of labeled proteins, perhaps because the receptor and D N A were not i n contact at the time of i r radia t ion . This cou ld be because the D N A had not yet contacted the receptor or because it had already been internal ized when the laser pulses were del ivered. To control for this, the time of incubat ion was varied. D N A s were incubated w i t h cells for either 10 seconds, 1 minute or 30 minutes pr ior to cross l inking. Different D N A s were also used i n case some migh t p rov ide a better substrate for c ross l ink ing than others. USS-50, USS-1 and M A P 7 chromosomal D N A were used i n the f o l l o w i n g c ross l ink ing experiments. The results are s h o w n i n Figure 4.5. C r o s s l i n k i n g us ing H. influenzae chromosomal D N A (MAP7) s h o w e d a h igh molecular weigh t streak i n the 10 second, 1 minute and 30 minute lanes (lanes 2, 5 and 8). Since this band was also visible i n the non-crossl inked lane I conc luded it was l i ke ly due to either incorporat ion into the chromosome or s i m p l y re-isolat ion of inpu t D N A . It has been demonstrated that integration of D N A into the chromosome can take place w i t h i n 10 minutes of incubat ion w i t h cells [41]. T h o u g h i r radia ted samples were placed on ice after c ross l inking , cells were stored for u p to 30 minutes pr ior to bo i l ing i n SDS. This may have a l l o w e d time for the D N A to integrate into the chromosome. Var i a t ion i n the intensi ty of bands c o u l d have arisen due to differences i n uptake by cells. C r o s s l i n k i n g us ing USS-1 (lanes 3, 6, and 9) d i d not produce any bands. This is most l i ke ly due to l o w uptake of the USS-1 oligo, out l ined i n section 3.1.1. Use of USS-50 as the 'bait' i n cross l inking experiments gave a h igh molecular weight band present i n lanes 1 and 4 that is not present i n the non-cross l inked lane (lane 10). 64 Crosslinking Results and Discussion 10 seconds 1 minute 30 minutes non-crosslinked 1 1 1 i Figure 4.5. C r o s s l i n k i n g experiments u s ing U S S - 5 0 , USS-1 a n d M A P 7 D N A s as b a i t Phosphor imager detection of 3 3 P radioactivi ty associated w i t h bands i n an S D S - P A G E gel . The upper and lower panels represent h igh and l o w molecular weight D N A from the same polyacry lamide gel , respectively. 0.1 pg of labeled D N A s were incubated wi th 50 p i of competent cells then cross l inked after the times l isted above. Lanes 1 - 3 represent cross l inking experiments performed after 10 seconds of incubat ion us ing. Lanes 4 - 6 are crossl inking experiments per formed after 1 minute us ing the same D N A s as lanes 1-3. Lanes 7 - 9 are c ross l ink ing experiments per formed after 30 minutes of incubat ion us ing the same D N A s as lanes 1-3. Lanes 10 -12 are control lanes, w h i c h are D N A s incubated w i t h cells but not crossl inked. 65 Crosslinking Results and Discusion The b a n d is most prominent at 10 seconds, decreasing i n intensity at 1 minute and is not v is ib le after 30 minutes (lane 7). Possible explanations for these bands inc lude , c ross l ink ing to proteins, incorporat ion into the chromosome or re- isolat ion of i npu t D N A . To test w h i c h explanation was correct, c ross l inking experiments were per formed i n a rec-2 background . 4.5 Cross l ink ing i n a rec-2 mutant background A s ou t l ined i n the Introduction, the Rec-2 protein is required for movemen t of D N A across the inner membrane of H. influenzae. Muta t ions i n Rec-2 lead to D N A being loca l i zed i n the per ip lasmic space, unable to move into the cy top lasm [39, 41]. C r o s s l i n k i n g experiments were performed i n a rec-2 mutant strain to prevent incorpora t ion of labeled D N A into the chromosome. It was expected that h igh molecular weigh t bands seen i n Figure 4.5 should disappear if they were due to incorpora t ion into the chromosome, but remain vis ible i f they were a result of cross l inking. 4.5.1 Crosslinking in wild-type and rec-2 backgrounds. M A P 7 chromosomal D N A , USS-50 and USS-1 were incubated w i t h freshly made M I V competent w i ld - type or rec-2 cells, and irradiated w i t h 3 pulses f rom the laser. Results are s h o w n i n Figure 4.6 and 4.7 for chromosomal D N A and oligos respectively. In F igure 4.6, lanes 1 - 4 (wildtype) and 5 - 8 (rec-2) show s imilar band ing patterns. There are bands i n non-crossl inked lanes (4 and 8), w h i c h indicates that these bands are not due to crossl inking. Since the bands are vis ible i n the rec-2 s train it is l ike ly that these bands are not due to incorporat ion into the chromosome but arise as a result of i so la t ion of input D N A . The pattern i n lanes 1 - 8 resemble that i n lane 10, 66 Crosslinking Results and Discussion c o Wild type cells rec-2 mutant cells L CD CO Q a Figure 4.6. C r o s s l i n k i n g u s i n g M A P 7 c h r o m o s o m a l DNA. Phosphor imager detection of 3 3 P radioactivi ty associated w i t h bands i n an S D S - P A G E gel . 0.1 u g of labeled 20 kb chromosomal D N A was incubated w i t h 50 u l of competent cells then crossl inked after the times l is ted be low. Lanes 1-4 are the result of crossl inking in a wi ld - type background . Incubat ion times were: lane 1,10 seconds; lane 2,1 minute; lane 3, 30 minutes; lane 4 non-crossl inked. Lanes 5-8 are the result of c ross l ink ing i n a rec-2 background . Incubation times were as above. The D N A i n lane 9 was treated w i t h DNase I pr ior to crossl inking. Lane 10 has M A P 7 D N A loaded direct ly. 67 . ; Crosslinking Results and Discusion w h i c h contained M A P 7 D N A loaded directly onto the gel. The decreased intensity l i ke ly reflects the smal l fraction of D N A taken up by cells under saturating condit ions. The D N A i n Lane 9 was digested w i t h D N a s e for 10 minutes pr ior to c ross l inking . This served as a control since digested D N A shou ld not be taken up by cells. I conc luded that the h igh molecular weight bands seen i n figures 4.5 and 4.6 are the result of re-isolation of the D N A taken up by cells f rom the pe r ip l a sm, rather than c ross l ink ing or chromosomal incorporat ion. This experiment was repeated us ing oligos instead of ch romosomal D N A (Figure 4.7). C r o s s l i n k i n g experiments i n a rec-2 mutant background are s h o w n i n lanes 1 -3. Lane 4 shows the non-crossl inked control. H i g h molecular we igh t bands were not v is ib le , p robably because USS-50 cannot cross the inner membrane a n d integrate into the chromosome. L o w intensity bands, w h i c h have the same mob i l i t y as that i n lane 6, indicate the presence of USS-50 i n these lanes. These l o w molecular weigh t bands are l i ke ly a result of re-isolation of USS-50. U s i n g USS-1 fai led to y ie ld any useful information. The faintness of the USS-1 band w h e n incubated w i t h cells (lane 8) l i k e l y reflects l o w uptake and subsequent re-isolation f rom the per ip lasm. 4.6 Biotinylated oligonucleotides 4.6.1 Uptake experiments L a c k of c ross l ink ing indicated that the previous approach w o u l d not label enough prote in to identify the receptor. I hypothesized that the failure to crossl ink sufficient receptor was because once bound , D N A is r ap id ly taken up and no longer available for c ross l inking . Cel ls start and complete uptake at s l ight ly different times. Thus , on ly a sma l l percentage of receptors w i l l be in contact w i t h D N A at any one time. In the p rev ious ly described experiments some cells might not yet have contacted a D N A molecule and others w o u l d have completed uptake at the time of i r radiat ion. 68 Crosslinking Results and Discussion J / / / / / / / / U S S - 5 0 c ross l inked <£ NT O ^ v O t o r e c - 2 . c e l l s # #' £ / $ i 8 9 1 0 Figure 4.7. C r o s s l i n k i n g i n rec-2 and w i l d - t y p e b a c k g r o u n d s . Phosphor imager detection of 3 3 P radioact ivi ty associated w i t h bands i n an S D S - P A G E gel. Incubat ion times for lanes 1-4 are 10 sec, 1 minute , 30 minutes a n d non-cross l inked respectively. Lanes 6 and 10 contain 0.1 p g of U S S -50 and USS-1 respectively, loaded directly onto the gel. 69 . , ; Crosslinking Results and Discusion If this were true, on ly a smal l percentage of receptors w o u l d have been available for c ross l ink ing w h e n the laser del ivered its pulses. It is not possible to s i m p l y irradiate samples for extended periods w i t h m a n y pulses from the laser due to the significant amount of prote in degradat ion that occurs w h e n greater than six pulses are de l ivered to a sample ( M . Roberge personal communicat ion) . Therefore, I des igned an experiment that shou ld a l l ow cells to part ial ly take up D N A then stop m i d w a y through uptake. This w o u l d essentially 'freeze' uptake at a point where D N A was in contact w i t h the receptor, increasing the amount of D N A cross l inked by the laser pulse. A n ol igo w i t h a b io t in molecule attached to its 3' terminus was designed to prevent complete uptake of the D N A molecule (Figure 4.8 and Table 2.3). The D N A is spaced f rom the b io t in by a 15 atom spacer a rm ( C H 2 - C H 2 - N H - C O -CH2-CH2-CH2-CH2-CH2-NH-CO-CH2-CH2-CH2-CH2-) . This spacer was attached between the D N A and the biot in to decrease interference by the D N A i n b io t in -s t reptavidin interactions. Up take experiments were performed us ing biot inylated D N A . It was found that b io t iny la t ion d i d not prevent uptake of the D N A molecule. H o w e v e r , uptake experiments s i m p l y determine the amount of label associated w i t h cells. Therefore if the b io t inyla ted D N A is taken up unt i l the spacer a rm is reached it m igh t appear as if the molecule is completely taken up by cells. Thus I tested whether b io t in was accessible to streptavidin-agarose beads after cells were incubated w i t h D N A for 10 minutes . Streptavidin-agarose consists of agarose beads covered w i t h s t rep tavid in molecules , w h i c h b i n d t ightly to biot in. The results from this experiment s h o w e d that b io t in was not accessible to streptavidin after incubat ion w i t h cells (21 c p m associated w i t h streptavidin-agarose after addit ion). F r o m this, I conc luded that the 70 Crosslinking Results and Discussion Figure 4.8. Biotinylated oligonucleotide. A . M a g n i f i e d v i e w showing biot in attached to a nucleot ide B. Size relat ionship of 50 bp D N A molecule to biot in . 71 __ ; Crosslinking Results and Discusion bio t iny la ted D N A had been completely taken up by cells. H o w e v e r , it is possible 4 that the l ipopolysacchar ide layer may have interfered w i t h s t reptavidin-biot in b i n d i n g , m a k i n g it appear as if the b iot in molecule was taken u p by cells, though it s t i l l r emained on the outside of cells. Re-isolation of the b io t inyla ted D N A was not pe r fo rmed . 4.6.2 Crosslinking experiments Because b io t iny la t ion of the double stranded oligo d i d not prevent complete uptake of the D N A , the bu lk ie r streptavidin-agarose molecule was attached pr ior to incubat ion w i t h cells. This association essentially attaches an agarose bead to the end of the D N A molecule. Comple te uptake of the complex is imposs ib le since the agarose beads are approximate ly 100 times larger than an H. influenzae cel l (100 p m vs 1 pm) . The m a x i m u m v o l u m e of a cross l inking experiment is 50 p l . Therefore, I at tempted to determine the number of cells that are able to b i n d to 50 p l of s t reptavidin-agarose beads. First, b iot inylated D N A was incubated w i t h s t reptavidin agarose beads for 30 minutes. U n b o u n d D N A was removed by extensive w a s h i n g (Figure 4.9 a). The complex was then incubated w i t h freshly made M l V - c o m p e t e n t cells for 10 minutes (Figure 4.9 b). After this incubation, the streptavidin-agarose beads were washed extensively to remove unbound cells. F o l l o w i n g the r emova l of u n b o u n d cells, p la t ing showed that there were 1.72 X 10 6 cfu remain ing associated w i t h 50 p l of streptavidin-agarose beads (approximately 1 X 10 3 cfu were associated w i t h beads i n the absence of D N A ) . This is the m a x i m u m number of cells available for c ross l ink ing i n a 50 p l vo lume. 72 Crosslinking Results and Discussion Figure 4.9. Illustration of the presumed interaction of competent H. influenzae cells with biotinylated DNA attached to agarose beads. Relat ionship not to scale. 73 . , Crosslinking Results and Discusion C r o s s l i n k i n g experiments were performed us ing the cell-bead complex and S D S -P A G E gels were stained using'a silver stain kit. Bands were not vis ible i n crossl inked or non-cross l inked lanes (gels not shown). 4.7 Calculations Calcula t ions were performed to evaluate w h y proteins were not v is ib le after c ross l inking . I predicted the reason for this was that the total mass of a l l the receptors i n 1.72 X 10 6 cells was not enough to v isual ize the band on si lver stained po lyac ry lamide gel. Sensitivity tests of the silver staining indicated a detection l imi t of approx imate ly 5 ng of protein per band. To per form these calculations, some estimates were made of the size and number of receptors. Calcula t ions were performed using two different estimates for these variables. Prev ious results estimated between three and eight receptors per c e l l . In the calculations be low I used an estimate of 10 and 100 receptors per cell . A l s o , I used two est imatesfor the size of the receptor protein, 50 and 200 k D a . 4.7.1 Scenario 1; estimate 100 receptors/cell and a 200kDa receptor. 1.72xl0 6 cells X 100 receptors/cell= 1.72xl0 8 receptors 1 .72xl0 8 receptors X 1 m o l / 6 . 0 2 x l 0 2 3 receptors= 2.86 x 10" 1 6 moles 2.86 x 10" 1 6 moles X 200000 g / m o l = 5.71X10"11 g 5.71X10"11 g= 5 7 x l 0 " 1 2 g= 57 pg The m i n i m u m amount of protein per band needed to be detected by si lver staining: 5000 p g / b a n d 5000 p g = 88* 57 p g 74 Crosslinking Results and Discusion 4.7.2 Scenario 2; estimate 10 receptors/cell and a 50kDa receptor. Same calculations as above 5000 p g = 3500* 1.43 p g This is the number of 50 p i aliquots needed, to have 5 ng (5000 pg) of receptor i n a single band on a po lyacry lamide gel. This assumes 100% of receptors become crossl inked to a D N A fragment. F r o m these calculations I concluded that i n order to v isua l ize the receptor, between 100 and 3000 samples must be loaded into a single w e l l of a po lyac ry l amide gel. A s ou t l ined i n the Introduct ion the efficiency of cross l inking is 1-20%. Therefore, the number of samples needed to isolate 5 n g of receptor f rom 1.72 X 10 6 cells is l i ke ly between 1000 - 30000. W i t h this information I concluded that it w o u l d be imposs ib le to isolate the receptor by U V laser cross l inking w i t h this strategy. Further attempts to isolate the receptor were not performed. 4.8 D i s c u s s i o n of c ross l i nk ing results. The use of laser cross l inking to isolate the receptor d i d not y i e l d enough pro te in for further s tudy. A potential explanation for this is that the interaction of the D N A w i t h the receptor is transient. Transient b i n d i n g cou ld arise if the interact ion of the D N A and receptor is reversible or i f the b o u n d D N A molecule is translocated r a p i d l y across the outer membrane. In either case the D N A w o u l d be i n contact w i t h the receptor for on ly a short time, decreasing the fraction of USSs i n contact w i t h the receptor at the time of U V irradiat ion. 75 Crosslinking Results and Discusion Comple t e uptake of the D N A molecule was prevented by us ing s t reptavidin-agarose beads. A s i n the previous experiments this d i d not isolate enough prote in to a l l o w further s tudy because only 1.7% of the cells or ig ina l ly incubated w i t h the streptavidin-agarose beads remained associated after r emova l of non-specif ical ly b o u n d cells. Calcula t ions performed i n chapter four illustrate that w i t h this number of cells it w o u l d be nearly impossible to isolate enough prote in to v i sua l ize a band on a po lyac ry lamide gel stained w i t h silver. In addi t ion to this, it is un l ike ly that each receptor of every cell was associated w i t h a D N A molecule. This arises because if w e imagine a cell b o u n d to a streptavidin-agarose bead by receptors on one side, it is l i ke ly that receptors on the other side of the cell w i l l not be i n contact w i t h the bead, thus l i m i t i n g the number of receptors i n contact w i t h D N A w h e n the sample was i r radiated. Cel l s are un l ike ly to be i n contact w i t h more than one bead, due to the beads' large size. 4.9 Future experiments If c ross l ink ing is to.be used again to try to isolate the receptor, a procedure w i l l need to be dev i sed that prevents complete uptake of the D N A molecule , yet a l lows a h igh p ropo r t i on of the receptors to contact D N A . It may be possible to achieve this by l i n k i n g g o l d particles to D N A molecule. Previous experimentat ion has s h o w n that go ld labeled D N A remains on the outside of cells after incubat ion (R. Redf ie ld personal communica t ion) . This procedure might prevent complete uptake of the D N A molecule , yet a l l ow a h igh propor t ion of receptors to contact D N A , increasing the probabi l i ty of isolat ing the receptor. A l s o , genomic analysis cou ld be used to identify the receptor. If a computer p r o g r a m were des igned that cou ld search the H. influenzae genome for proteins that contain transmembrane domains as w e l l as D N A b i n d i n g domains it c o u l d p rov ide a subset of genes, one of w h i c h migh t be the receptor. Deletions c o u l d be made of 76 : Crosslinking Results and Discusion each open reading frame fo l lowed by b i n d i n g and uptake assays to determine the phenotype of the mutant. The N. gonorrhoeae genome sequence m a y also serve to n a r r o w the number of potential genes that encode the receptor. Since both bacteria are able to b i n d and take u p sequence specific D N A , searching for genes i n N. gonorrhoeae that have homology to the D N A - b i n d i n g - m e m b r a n e proteins found i n the o r ig ina l search of the H. influenzae genome might assist i n isola t ing the receptor. H o w e v e r , since t h e U S S of N. gonorrhoeae is unrelated to the U S S of H. influenzae, this m a y not a i d i n decreasing the number of proteins w h i c h cou ld potent ia l ly be the receptor. 77 . Model of Uptake CHAPTER FIVE Hypothetical model for uptake by H. influenzae U s i n g the informat ion gained from m y research and previous f indings , I have formula ted a speculative m o d e l for h o w H. influenzae might recognize, b i n d and take u p D N A i n a sequence specific manner. This m o d e l differs f rom the m o d e l p roposed b y D u b n a u (1999) (Figure 1.3 p.12) i n a number of ways . D u b n a u ' s m o d e l does an excellent job of addressing the prote in compos i t ion of the receptor complex ins ide the outer membrane, therefore I w i l l not discuss the proteins i n v o l v e d i n transport of D N A after it crosses the outer membrane. A shor tcoming of Dubnau ' s m o d e l however , is that it does not address h o w the U S S is recognized at the outside of cells. H i s m o d e l hypothesizes that D N A enters the per ip lasm through an outer membrane pore consist ing of the secretin protein P i l Q [5]. A more complete m o d e l for uptake by H. influenzae should address h o w cells are able to preferential ly b i n d and take u p sequence specific D N A and also address h o w f lanking sequence affects uptake. Therefore, m y m o d e l w i l l focus on the in i t ia l steps of b i n d i n g and uptake i n an attempt to supplement the m o d e l proposed by D u b n a u . 5.1.1 Model for uptake by H. influenzae Figure 5.1 illustrates the proposed mode l . D N A is b o u n d b y four hypothet ica l proteins on the cell surface (Figure 5.1 (a)). For s impl ic i ty I w i l l refer to each protein separately ( A - D ) , a l though fewer proteins cou ld be i n v o l v e d , each h a v i n g more than one D N A b i n d i n g motif. Previous research has s h o w n that, as competence develops , the outer membrane of H. influenzae changes i n prote in compos i t ion [55, 56]. Therefore, it is 1 l i ke ly that as competence develops, genes are transcribed and the m R N A s encoding these b i n d i n g proteins are translated then inserted into the 78 Model of Uptake D N A binding proteins Figure 5.1. H y p o t h e t i c a l m o d e l for b i n d i n g and uptake b y H. influenzae. A ) D N A is b o u n d b y proteins A - D B) Proteins C and D cause mel t ing of the D N A i n the A / T r i ch 3' f l ank ing region eventual ly l ead ing to the formation of the single s tranded core region . C ) Pro te in B takes the D N A i n to the per iplasmic space by f o r m i n g a bend i n the D N A . 79 Model of Uptake membrane . U n p u b l i s h e d experiments have found that w h e n membrane proteins of H. influenzae are so lubi l ized , sequence specific D N A b i n d i n g is lost (R. Redf ie ld personal communica t ion) . Thus, I propose that each prote in must contact others of the complex before uptake can commence and if interaction between these proteins is prevented, b i n d i n g and uptake w i l l not occur. Up take begins w h e n the U S S recognit ion protein B b inds to the core U S S on the D N A . This is fo l lowed by proteins A , C and D b i n d i n g to the D N A (Figure 5.1 a). I hypothes ize that proteins C and D contact the mino r groove of the D N A since, as i l lustrated i n F igure 1.2 (p.9), the distance f rom the center of one A / T r i ch ( r w w w w w ) region' to the next is 12 bp, rough ly corresponding to one turn of the D N A hel ix (10.3 bp). Proteins C and D may recognize the A / T r i ch reg ion by the absence of 2-amino groups i n the minor groove of A / T base pairs [91]. I predict that another prote in A binds to the 5' region of the D N A , suppor ted by the observat ion that D N A lack ing 5' sequence is not taken up w e l l by competent cells. In the A / T r i ch ( r w w w w w ) region, proteins C and D begin to u n w i n d the D N A eventual ly m a k i n g the 9 bp core single stranded (Figure 5.1 b). B i n d i n g proteins A , C and D h o l d the single stranded core i n close p rox imi ty to the U S S recogni t ion pro te in B . This prote in then begins to translocate the D N A through the outer membrane (Figure 5.1 c). The mechanism of this movement is u n k n o w n but c o u l d i n v o l v e b e n d i n g of the single stranded D N A to a l l ow passage th rough the membrane . A s D N A is m o v e d into the per iplasmic space it re-anneals the single s t randed regions. F o l l o w i n g movement into the per ip lasm D N A is translocated across the inner membrane. 80 Model of Uptake 5.1.2 Interact ion of o l igos w i t h the receptor complex If the p roposed m o d e l is correct, it shou ld be possible to expla in the uptake and b i n d i n g characteristics of the different oligos used throughout this s tudy. If a D N A molecule lacks sequence 5' to the USS , b i n d i n g by protein A s h o u l d not occur. This w o u l d prevent the U S S from being he ld i n close p rox imi ty to pro te in B (See F igure 5.2 a). Proteins C and D w o u l d denature the double stranded D N A . H o w e v e r , prote in B , since it is not i n contact w i t h the core USS , w o u l d not internal ize the D N A molecule . This m o d e l correlates w e l l w i t h the behavior of USS-1 and USS-50-Le w h i c h lack sequence 5'to the USS. USS-1 ^^3Mk/////?±\ is not taken up better than its negative control D N A USS-R IE 3 . USS-50-Le ^f^ZZ////\ T[ j s | _ , o u n ( ; ) ; a n c } taken up at a level m u c h lower than USS-50 [E ^EKZZ///\ J_[ w h i c h has sequence 5' to the USS . It is also possible that i f the D N A is denatured i n the A / T r ich regions (Figure 5.2 b) the 9 bp core m a y also become denatured. This w o u l d lead to the denaturat ion of the entire ol igo w h i c h migh t cause cells to release the single stranded ol igo (Figure 5.2 c), p reven t ing uptake. To exp la in the l o w uptake of USS-50-RC Lb i^^mmmxmxm J J ^ w n j c n h a c j a n A / T r ich region replaced w i t h a G / C r ich 3' flanking consensus, it is possible that b i n d i n g occurs at proteins A - D (see Figure 5.3). The energy required to denature the G / C r ich region is higher than an A / T r ich 3' f lanking consensus. If proteins C and D are unable to denature the D N A , the single stranded U S S w i l l not be accessible to prote in B and uptake w i l l not occur. If uptake does not begin, cells m a y release the D N A molecule , leading to the l o w levels of b ind ing , uptake and interference observed. 81 Model of Uptake D N A binding proteins D N A binding proteins D N A binding proteins Figure 5.2. M o d e l for uptake of o l igos l a c k i n g 5' sequence a) D N A is b o u n d by proteins C and D . Protein A is unable to b i n d to the D N A because the o l igo lacks sequence 5' to the USS. Since the D N A is not b o u n d b y pro te in a the 9bp core is not i n close contact w i t h protein b therefore uptake does not occur. b) D N A is b o u n d by proteins B - D . Denaturation of A / T r ich regions begins. c) Denatura t ion continues to the 9 bp core USS. D N A becomes single s t randed a n d is released b y b i n d i n g proteins. 82 Model of Uptake Figure 5.3. M o d e l for binding of an oligo having a G / C r ich 3' f lanking region. D N A is b o u n d by proteins A - D . Since this D N A has a G / C r i ch 3' f l ank ing region, mel t ing i n that region does not occur. Th i s prevents the 9bp core from becoming single s tranded, p reven t ing uptake of the D N A . 83 . Model of Uptake Figure 5.4 shows b i n d i n g of D N A that lacks 3' f lanking sequence [E —"j^ tl. Since the 3' f lanking sequence is miss ing , i f prote in B b inds the U S S the D N A w i l l not be b o u n d by proteins C and D . A s above, i f this happens then denaturat ion and uptake w i l l not occur. If m y m o d e l is a true descr ipt ion of uptake i n H. influenzae one migh t expect that cells s h o u l d be able to take up single-stranded D N A . H o w e v e r , under 'natural ' condi t ions this does not occur. Previous research has s h o w n that s ingle-stranded D N A can be taken up , al though i n a non-sequence specific fashion, if cells are first incubated w i t h D N A at l o w p H , fo l lowed by a second pe r iod of incubat ion at neutral p H [95] . A n explanat ion for the lack of uptake under 'natural ' condi t ions c o u l d be that proteins C and D b i n d only double stranded D N A . If so, the core U S S w o u l d not be loca l ized near protein B and uptake w o u l d not occur. 84 Model of Uptake. Figure 5.4. B i n d i n g of U S S - 5 0 - R L D N A is b o u n d at 9bp core by protein B . The 3' f l ank ing reg ion is not i n contact w i t h proteins C and D therefore denaturat ion and uptake do not occur. 85 Bibliography Bibliography 1. G o o d g a l , S .H. , DNA uptake in Haemophilus transformation. [Review]. A n n u a l R e v i e w of Genetics, 1982.16(169): p. 169-92. 2. Smi th , H . O . , D .B . Danner, and R . A . Deich, Genetic transformation. A n n u Rev Biochem, 1981. 50: p . 41-68. 3. Fraser, D . W . , C . C . G e i l , and R . A . Fe ldman , Bacterial meningitis in Bernalillo County, New Mexico: a comparison with three other American populations. A m J E p i d e m i o l , 1974.100(1): p . 29-34. 4. K a h n , M . E . and H . O . Smith, Transformation in Haemophilus: a problem in membrane biology. [Review]. Journal of Membrane Bio logy , 1984. 81(2): p . 89-103. 5. D u b n a u , D . , DNA uptake in bacteria. A n n u Rev M i c r o b i o l , 1999. 53: p. 217-44. 6. C h a n g , S. and S . N . Cohen , High frequency transformation of Bacillus subtilis protoplasts by plasmid DNA. M o l G e n Genet, 1979.168(1): p. 111-5. 7. M a n d e l , M . and A . H i g a , Calcium-dependent bacteriophage DNA infection. J M o l B i o l , 1970. 53(1): p . 159-62. 8. D u b n a u , D . and C . Ci r ig l i ano , Fate of transforming DNA following uptake by competent Bacillus subtilis. Formation and properties of products isolated from transformed cells which are derived entirely from donor DNA. Journal of M o l e c u l a r B io logy , 1972. 64(1): p . 9-29. 9. Lacks , S., Uptake of circular deoxyribonucleic acid and mechanism of deoxyribonucleic acid transport in genetic transformation of Streptococcus pneumoniae. Journal of Bacter iology, 1979.138(2): p. 404-9. 86 _ ' Bibliography 10. Lacks , S. and B. Greenberg, Single-strand breakage on binding of DNA to cells in the genetic transformation of Diplococcus pneumoniae. Journal of M o l e c u l a r B io logy , 1976 .101 (2 ) : p . 255-75. 11. M o r r i s o n , D . A . and W . R . G u i l d , Breakage prior to entry of donor DNA in Pneumococcus transformation. Biochimica Et Biophysica Ac ta , 1973. 299 ( 4 ) : p. 545-56. 12. D u b n a u , D . , Genetic competence in Bacillus subtilis. M i c r o b i o l . Rev. , 1991. 55(3): p. 395-424. 13. Lo renz , M . G . , K . Reipschlager, and W . Wackernagel , Plasmid transformation of naturally competent Acinetobacter calcoaceticus in non-sterile soil extract and groundwater. A r c h M i c r o b i o l , 1992.157 (4) : p. 355-60. 14. Pa lmen , R., et al, Physiological characterization of natural transformation in Acinetobacter calcoaceticus. J G e n M i c r o b i o l , 1 9 9 3 .139 ( P t 2): p . 295-305. 15. Scocca, J.J., R . L . Po land , and K . C . Z o o n , Specificity in deoxyribonucleic acid uptake by transformable Haemophilus influenzae. J Bacteriol, 1 9 7 4 . 1 1 8 ( 2 ) : p . 369-73. 16. G o o d m a n , S.D. and J.J. Scocca, Identification and arrangement of the DNA sequence recognized in specific transformation of Neisseria gonorrhoeae. Proc N a t l A c a d Sci U S A , 1988. 85(18): p. 6982-6. 17. Graves , J.F., G . D . Biswas, and P.F. Spar l ing, Sequence-specific DNA uptake in transformation of Neisseria gonorrhoeae. Journal of Bacteriology, 1982 .152 (3 ) : p . 1071-7. 18. C r i s e l , R . M . , R.S. Baker, and D.E . Dorman , Capsular polymer of Haemophilus influenzae, type b. I. Structural characterization of the capsular polymer of strain Eagan. J B i o l C h e m , 1975. 250 (13) : p . 4926-30. 87 ; . ; Bibliography 19. R o w j i , P. , R. G r o m k o v a , and H . Koornhof , Genetic transformation in encapsulated clinical isolates of Haemophilus influenzae type b. Journal of Genera l M i c r o b i o l o g y , 1989. 20. G r o m k o v a , R. and S. Goodga l , Uptake of plasmid deoxyribonucleic acid by Haemophilus. J Bacteriol, 1981.146(1): p. 79-84. 21. P i f er, M . L . and H . O . Smith , Processing of donor DNA during Haemophilus influenzae transformation: analysis using a model plasmid system. Proc N a t l A c a d Sci U S A , 1985. 82(11): p . 3731-5. 22. Barany, F. , M . E . K a h n , and H . O . Smith, Directional transport and integration of donor DNA in Haemophilus influenzae transformation. Proceedings of the N a t i o n a l A c a d e m y of Sciences of the U n i t e d States of A m e r i c a , 1983. 80(23): p. 7274-8. 23. K a h n , M . E . , F. Barany, and H . O . Smith, Transformasomes: specialized membranous structures that protect DNA during Haemophilus transformation. Proceedings of the Na t iona l A c a d e m y of Sciences of the U n i t e d States of A m e r i c a , 1983. 80(22): p . 6927-31. 24. Stuy, J . H . , Fate of transforming DNA in the Haemophilus influenzae transformation system. Journal of Molecu l a r Bio logy , 1965.13(2): p . 554-70. 25. N o t a n i , N . and S . H . Goodga l , On the nature of recombinants formed during transformation in Hemophilus influenzae. J G e n Phys io l , 1966. 49(6): p. 197-209. 26. Sisco, K . L . and H . O . Smith, Sequence-specific DNA uptake in Haemophilus transformation. Proceedings of the Na t iona l A c a d e m y of Sciences of the U n i t e d States of A m e r i c a , 1979. 76(2): p. 972-6. 88 : Bibliography 27. Danner , D .B . , et al, An eleven-base-pair sequence determines the specificity of DNA uptake in Haemophilus transformation. Gene, 1980.11(3-4): p . 311-8. 28. E lk in s , C , et al, Species-specific uptake of DNA by gonococci is mediated by a 10-base- pair sequence. J; Bacteriol , 1991.173(12): p . 3911-3. 29. De ich , R . A . and H . O . Smith, Mechanism of homospecific DNA uptake in Haemophilus influenzae transformation. M o l G e n Genet, 1980.177(3): p. 369-74. 30. Danner , D . , H . O . Smi th , and S. Na rang , Construction of DNA recognition sites active in Haemophilus transformation. P N A S , 1982. 79: p. 2393-2397. 31. F le i schmann, R . D . , et al, Whole-Genome Random Sequencing and Assembly of Haemophilus influenzae Rd. Science, 1995. 269(5223): p. 496-512. 32. Goebe l , S.J., et al, The complete DNA sequence of vaccinia virus. V i r o l o g y , 1990. 179(1): p . 247-66,517-63. 33. Sanger, F. , et al, Nucliotide sequence of bacteriophage phi X174 DNA. Na tu re , 1977. 265(5596): p . 687-95. 34. Bankier , A . T . , et al, The DNA sequence of the human cytomegalovirus genome. D N A Seq, 1991. 2(1): p. 1-12. 35. Smi th , H.O,, et al, Frequency and distribution of DNA uptake signal sequences in the Haemophilus influenzae Rd genome. Science, 1995. 269: p . 538-540. 36. Redf ie ld , R.J. , Genes for breakfast: the have your cake and eat it too of transformation. J. Hered . , 1993. 84(5): p . 400-404. 89 ; : Bibliography 37. H a h n , ]., et al., Characterisation of comE, a late competence operon of Bacillus subtilis required for the binding and uptake of transforming DNA. M o l e c . M i c r o . , 1993.10: p. 99-111. 38. Inamine, G.S. and D . Dubnau , ComEA, a Bacillus subtilis integral membrane protein required for genetic transformation, is needed for both DNA. binding and transport. J Bacteriol , 1995.177(11): p. 3045-51. 39. C l i f t on , S.W., D . M c C a r t h y , and B . A . Roe, Sequence of the rec-2 locus of Haemophilus influenzae: homologies to comE-ORF3 of Bacillus subtilis and msbA of Escherichia coli. Gene, 1994.146(1): p . 95-100. 40. Facius, D . and T.F. Meyer , A novel determinant (comA) essential for natural transformation competence in Neisseria gonorrhoeae and the effect of a com A defect on pilin variation. M o l e c u l a r Mic rob io logy , 1993.10(4): p. 699-712. 41. Ba rouk i , R. and H . O . Smi th , Reexamination of phenotypic defects in rec-1 and rec-2 mutants of Haemophilus influenzae Rd. Journal of Bacteriology, 1985.163(2): p. 629-34. 42. K a r u d a p u r a m , S. and G.J. Barcak, The Haemophilus influenzae dprABC genes constitute a competence- inducible operon that requires the product of the tfoX (sxy) gene for transcriptional activation. J Bacteriol, 1997.179(15): p . 4815-20. 43. K a r u d a p u r a m , S., X . Zhao , and G.J. Barcak, DNA sequence and characterization of Haemophilus influenzae dprA+, a gene required for chromosomal but not plasmid DNA transformation. J. Bacteriol. , 1995.177(11): p. 3235-3240. 44. T o m b , J.F., A periplasmic protein disulfide oxidoreductase is required for transformation of Haemophilus influenzae Rd. Proceedings of the N a t i o n a l A c a d e m y of Sciences of the U n i t e d States of Amer i ca , 1992. 89(21): p . 10252-6. 90 Bibliography 45. Londono-Val le jo , J .A. and D . Dubnau , comF, a Bacillus subtilis late competence locus, encodes a protein similar to ATP-dependent. RNA/DNA helicases. M o l e c . M i c r o . , 1993. 9: p . 119-131. 46. La r son , T . G . and S .H . Goodga l , Donor DNA processing is blocked by a mutation in the comlOlA locus of Haemophilus influenzae. J Bacteriol, 1992.174(10): p . 3392-4. 47. La r son , T .G. .and S .H . Goodga l , Sequence and transcriptional regulation of comlOlA, a locus required for genetic transformation in Haemophilus influenzae. J Bacteriol , 1991.173(15): p. 4683-91. 48. Set low, J .K., et al., Repair of DNA in Haemophilus influenzae. 1.1. Excision, repair of single-strand breaks, defects in transformation, and host, cell modification in. UV-sensitive mutants. C o l d Sp r ing Harbor Sympos ia O n Quanti tat ive B io logy , 1968. 33(209): p . 209-18. 49. Set low, J .K., et al, A complex of recombination and repair genes in Haemophilus influenzae. Journal of Molecu la r Bio logy , 1972. 68(2): p. 361-78. 50. G w i n n , M . L . , et al, A new transformation-deficient mutant of Haemophilus influenzae Rd with normal DNA uptake. J Bacteriol, 1998.180(3): p . 746-8. 51. T o m b , J.F., et al, Transposon mutagenesis, characterization, and cloning of transformation genes of Haemophilus influenzae Rd. Journal of Bacter iology, 1989. 171(7): p . 3796-802. 52. Kra iss , A . , S .Schlor , and J. Re id l , In vivo transposon mutagenesis in Haemophilus influenzae. A p p l E n v i r o n M i c r o b i o l , 1998. 64(12): p. 4697-702. 53. Redf ie ld , R.J., sxy-1, a Haemophilus influenzae mutation causing greatly enhanced competence. J. B a c t e r i o l , 1991.173: p . 5612-5618. 91 . ] ; Bibliography 54. Chand le r , M . S . , The gene encoding cAMP receptor protein is required for competence development in Haemophilus influenzae Rd. Proc N a d A c a d Sci U S A , 1992. 89(5): p . 1626-30. 55. Z o o n , K . C . and J.J. Scocca, Constitution of the cell envelope of Haemophilus influenzae in relation to competence for genetic transformation. Journal of Bacter iology, 1975.123(2): p . 666-77. 56. Z o o n , K . C , M . Habersat, and J.J. Scocca, Synthesis of envelope polypeptides by Haemophilus influenzae during development of competence for genetic transformation. Journal of Bacteriology, 1976.127(1): p. 545-54. 57. De ich , R . A . , et al, Cloning of genes encoding a 15,000-dalton peptidoglycan-associated outer membrane lipoprotein and an antigenically related 15,000-dalton protein from Haemophilus influenzae. Journal of Bacteriology, 1988.170(2): p. 489-98. 58. Sutr ina, S.L. and J.J. Scocca, Haemophilus influenzae periplasmic protein which binds deoxyribonucleic acid: properties and possible participation in genetic transformation. Journal of Bacteriology, 1979.139(3): p. 1021-7. 59. K a h n , M . , et al, DNA binding activity of vesicles produced by competence deficient mutants of Haemophilus. B B R C , 1979. 87(3): p . 764-772. 60. C o n c i n o , M . and S. Goodga l , Haemophilus influenzae polypeptides involved in deoxyribonucleic acid uptake detected by cellular surface protein iodination. J. Bacteriol . , 1981.148(1): p . 220-231. 61. H o c k e n s m i t h , J.W., et ai, Laser cross-linking of nucleic acids to proteins. Methodology and first applications to the phage T4 DNA replication system. J B io l C h e m , 1986. 261(8): p . 3512-8. 92 • Bibliography 62. Pashev, I .G. , S.I. D i m i t r o v , and D . A n g e l o v , Crosslinking proteins to nucleic acids by ultraviolet laser irradiation. Trends Biochem Sci , 1991.16(9): p . 323-6. 63. Alexander , P. and H . M o r o s o n , Crosslinking of deoxyribonucleic acid to protein following ultra-violetirradiation of different cells. Nature , 1962.194: p. 882-883. 64. Smi th , K . C . , Dose dependent decrease in extractability of DNA from bacteria following irradiation with ultraviolet light or with visible light. Biochem. Biophys . Res. C o m m u n , 1962. 8(3): p. 157-163. 65. Shetlar, M . D . , Cross-linking of proteins to nucleic acids by ultrra.ci.olet light. Photochem. Photobio l . Rev. , 1980. 5: p. 105-197. 66. H o c k e n s m i t h , J .W., et al, Laser cross-linking of proteins to nucleic acids. I. Examining physical parameters of protein-nucleic acid complexes. J B i o l C h e m , 1993. 268(21): p . 15712-20. 67. N i k o g o s y a n , D . N . , Two-quantum UV photochemistry of nucleic acids: comparison with conventional low-intensity UV photochemistry and radiation chemistry. Int J Radiat B i o l , 1990. 57(2): p . 233-99. 68. Smi th , K . C . , A mixed, photoproduct of thymine and cysteine: 5-S-cysteine, 6-hydrothymine. B iochem Biophys Res C o m m u n , 1970. 39(6): p. 1011-6. 69. M a r k o v i t z , A . , Ultraviolet light-induced stable complexes of DNA and DNA polymerase. B i o c h i m Biophys Acta , 1972. 281(4): p. 522-34. 70. Paradiso , P.R. , Y . N a k a s h i m a , and W . Konigsberg , Photochemical cross-linking of protein . nucleic acid complexes. The attachment ofthefd gene 5 protein tofd DNA. J B i o l C h e m , 1979. 254 (11) : p . 4739-44. 93 Bibliography 71. H o c k e n s m i t h , J .W., et al, Laser cross-linking of proteins to nucleic acids. II. Interactions of the bacteriophage T4 DNA replication polymerase accessory proteins complex with DNA. J B i o l C h e m , 1993. 268(21): p. 15721-30. 72. Smi th , K . C , Photochemical addition of amino acids to 14C-uracil. B iochem Biophys Res C o m m u n , 1969. 34(3): p. 354-7. 73. Schott, H . N . and M . D . Shetlar, Photochemical addition of amino acids to thymine. B i o c h e m B iophys Res C o m m u n , 1974. 59(3): p. 1112-6. 74. D i z d a r o g l u , M . and M . G . Simic , Radiation-induced crosslinks between thymine and phenylalanine. Int J Radiat B i o l Relat S tud Phys C h e m M e d , 1985. 47(1): p . 63-9. 75. Reeve, A . E . and T.R. H o p k i n s , Photochem Photobio l , 1980. 31: p . 297-304. 76. Alexander , H . and G . L e i d y , Determination of inherited traits of H. influenzae by desoxyribonucleic acid fractions isolated from type-specific cells. J. E x p . M e d . , 1951. 93: p . 345-359. 77. Sambrook, J., E.F. Fritsch, and T. Mania t i s , Molecular Cloning: A Laboratory Manual. Second E d i t i o n ed, ed. e. C . N o l a n . 1989, N e w York , U S A : C o l d Spr ing H a r b o u r Labora to ry Press. 78. A lexander , H . , G . L e i d y , and E. H a h n , Studies on the nature of Hemophilus influenzae cells susceptible to heritable changes by desoxyribonucleic acids.']. E x p . M e d . , 1954. 99: p . 505-533. 79. Barcak, G.J . , et ai, Genetic systems in Haemophilus influenzae. M e t h o d s i n E n z y m o l . , 1991. 204: p. 321-342. 94 . . Bibliography 80. M c C a r t h y , D . , Cloning of the rec-2 locus of Haemophilus influenzae. Gene, 1989. 75(1): p . 135-43. .81. Hanahan , D . , Studies on transformation of Escherichia coli with plasmids. J. M o l . B i o l . , 1983.166: p. 557-580. 82. Herr io t t , R . M . , E . M , Meyer , and M . Vogt , Defined nongroioth media for stage II development of competence in Haemophilus influenzae. J Bacteriol , 1970.101(2): p . 517-24. 83. W i l l i a m s , P . , :W.L . H u n g , and R.J. Redfield, Cell transfer by filtration: evaluation of protocols for transformational competence. F E M S M i c r o . Letts., 1996. 137(2-3): p. 183-187. 84. Stuy, J., Effect of glycerol on Haemophilus influenzae tmnsfection. J. Bacteriol. , 1986.166(1): p . 285-289. 85. A u s u b e l , F. , et al, eds. Current Protocols in Molecular Biology.. 1993, G r e e n e / W i l e y . 86. Sharp, P . A . , B. Sugden, and J. Sambrook, Detection of two restriction endonuclease activities in Haemophilus parainfluenzae using analytical agarose-ethidium bromide electrophoresis. Biochemistry, 1973.12(16): p. 3055-63. 87. P romega , Technical Manual. pGEM-T and pGEM-T easy vector systems. 1999. 88. H o , D.T . , D . M . Sauve, and M . Roberge, Detection and isolation of DNA-binding proteins using single-pulse ultraviolet laser crosslinking. A n a l Biochem, 1994. 218(2): p. 248-54. 89. M a k e l a , P . H . , Unencapsulated Haemophilus influenzae-what kind of pathogen ? Eu r J C l i n M i c r o b i o l Infect Dis , 1988. 7(5): p. 606-9. 95 : : Bibliography 90. Wiese , A . , et al, The dual role of lipopolysaccharide as effector and target molecule. B i o l C h e m , 1999. 380(7-8): p . 767-84. 91. Danner , D . and H . O . Smith , Sequence-specific and non-sequence-specific components of DNA recognition in Haemophilus transformation., i n Gene Transfer and Cancer., M . Pearson and N . Sternberg, Editors . 1984, Raven Press: N e w Y o r k . p. 1-7. 92. Seeman, N . C , J . M . Rosenberg, and A . R ich , Sequence-specific recognition of double helical nucleic acids by proteins. Proc N a t l A c a d Sci U S A , 1976. 73(3): p. 804-8. 93. C a n n , J.R., Theoretical studies on the mobility-shift, assay of protein-DNA complexes. Electrophoresis , 1998.19(2): p . 127-41. 94. Sherman, P . A . , P . V . Basta, and J.P. T ing , Upstream DNA sequences required for tissue-specific expression of the HLA-DR alpha gene. Proc N a t l A c a d Sci U S A , 1987. 84(12): p . 4254-8. 95. Postel , E . H . and S .H. Goodga l , Uptake of "single-stranded" DNA in Hemophilus influenzae and its ability to transform. Journal of Molecu la r Bio logy , 1966. 16(2): p. 317-27. 96 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0089616/manifest

Comment

Related Items