UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

DNA uptake specificity of Haemophilus influenzae Poje, Grant Alexander 2000

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2000-0529.pdf [ 7.6MB ]
Metadata
JSON: 831-1.0089616.json
JSON-LD: 831-1.0089616-ld.json
RDF/XML (Pretty): 831-1.0089616-rdf.xml
RDF/JSON: 831-1.0089616-rdf.json
Turtle: 831-1.0089616-turtle.txt
N-Triples: 831-1.0089616-rdf-ntriples.txt
Original Record: 831-1.0089616-source.json
Full Text
831-1.0089616-fulltext.txt
Citation
831-1.0089616.ris

Full Text

D N A U P T A K E S P E C I F I C I T Y O F HAEMOPHILUS INFLUENZAE  by G R A N T A L E X A N D E R POJE B . S c , Simon Fraser University, 1996  A THESIS SUBMITTED IN P A R T I A L F U L F I L L M E N T OF THE REQUIREMENTS FOR THE DEGREE OF M A S T E R OF SCIENCE in T H E F A C U L T Y OF G R A D U A T E STUDIES (Department of Zoology) We accept this thesis as conforming to the required standard  THE UNIVERSITY OF BRITISH C O L U M B I A  June, 2000  © Grant Alexander Poje, 2000  In  presenting  degree freely  at  this  the  available  copying  of  department publication  of  in  partial  fulfilment  of  the  University  of  British  Columbia,  I  agree  for  this or  thesis  reference  thesis by  this  for  his thesis  and  scholarly  or for  her  Department  DE-6 (2/88)  Columbia  I further  purposes  gain  that  agree  may  be  It  is  representatives.  financial  permission.  T h e U n i v e r s i t y o f British Vancouver, Canada  study.  requirements  shall  not  that  the  Library  permission  granted  by  understood be  for  allowed  an  advanced  shall for  the that  without  head  make  it  extensive of  my  copying  or  my  written  Abstract  D N A b i n d i n g a n d u p t a k e b y the n a t u r a l l y transformable G r a m - n e g a t i v e b a c t e r i u m Haemophilus influenzae R d has been s t u d i e d for over twenty years. It is w e l l characterized that H. influenzae cells preferentially b i n d a n d take u p D N A from their o w n species. T h i s preferential uptake is dependent o n the ability of cells to recognize a 9-base p a i r uptake signal sequence (USS), 5 ' - A A G T G C G G T , i n the D N A m o l e c u l e . G e n o m i c analysis has s h o w n that there are 1465 copies of the 9-base p a i r u p t a k e sites. F u r t h e r analysis revealed a n extended consensus r e g i o n of 29 base pairs w h i c h i n c l u d e s the core r e g i o n a n d t w o d o w n stream 6-base p a i r A / T - r i c h regions, each s p a c e d about one helix t u r n apart.  T o d e t e r m i n e properties of the D N A m o l e c u l e that, i n a d d i t i o n to the presence of the U S S , are necessary for uptake b y H. influenzae I d e s i g n e d o l i g o n u c l e o t i d e s w i t h v a r i a t i o n s i n the regions f l a n k i n g the core U S S . O l i g o n u c l e o t i d e s w e r e v a r i e d i n b o t h the l e n g t h a n d base c o m p o s i t i o n of 3' a n d 5' f l a n k i n g sequences.  I s h o w e d that  n u c l e o t i d e s 5' to the U S S are r e q u i r e d for h i g h levels of b i n d i n g a n d u p t a k e of D N A . A l s o , I s h o w e d that b o t h length a n d base c o m p o s i t i o n of the 3' f l a n k i n g r e g i o n greatly affect b i n d i n g a n d uptake. If sequence 3' to the U S S is G / C r i c h , u p t a k e proceeds at a v e r y l o w level. H o w e v e r , i f D N A lacks a 3' sequence, b o t h b i n d i n g a n d u p t a k e are a b o l i s h e d . B a s e d o n these findings I p r o p o s e a s p e c u l a t i v e m o d e l of h o w cells b i n d a n d take u p D N A i n a sequence specific manner. I attempt w i t h this m o d e l to s u p p l e m e n t other p r o p o s e d m o d e l s w h i c h d o not address the i n i t i a l steps of b i n d i n g a n d u p t a k e b y H. influenzae.  ii  A s e c o n d g o a l of m y research w a s to isolate the receptor that a l l o w s c o m p e t e n t cell to preferentially b i n d a n d take u p sequence specific D N A . T h e m e t h o d I u s e d was U V laser c r o s s l i n k i n g . C o n d i t i o n s used i n c r o s s l i n k i n g experiments w e r e v a r i e d i n c l u d i n g the time of i n c u b a t i o n of D N A a n d cells, the presence a n d absence of c o m p e t i n g D N A s a n d attachment of b u l k y groups to the D N A to p r e v e n t u p t a k e . F o l l o w i n g m a n y attempts to isolate the receptor I c o n c l u d e d that u n d e r the c o n d i t i o n s used, it w a s i m p o s s i b l e to isolate the receptor u s i n g laser c r o s s l i n k i n g .  iii  TABLE OF  CONTENTS  ABSTRACT  ii  TABLE OF CONTENTS  iv  LIST O F T A B L E S . .  viii  LIST O F FIGURES  ix  LIST O F A B B R E V I A T I O N S  x i  ACKNOWLEDGMENTS  x i i  CHAPTER ONE  1  Introduction I C o m p e t e n c e , T r a n s f o r m a t i o n a n d D N A uptake  2  1.1 N a t u r a l competence  2  1.2 D N A u p t a k e a n d natural transformation  2  1.3 U p t a k e a n d transformation b y gram-positive bacteria  3  1.4 U p t a k e a n d transformation b y gram-negative bacteria  3  1.5 U p t a k e a n d transformation b y H. influenzae  4  1.6 P r o c e s s i n g a n d translocation of D N A  5  1.7 U p t a k e requirements  7.  1.8 Proteins i n v o l v e d i n translocation a n d r e c o m b i n a t i o n  8  I I U V Laser C r o s s l i n k i n g  13  2.1 B a c k g r o u n d  15  2.2 M e c h a n i s m of c r o s s l i n k i n g  16  2.3 S t a b i l i t y  16  2.4 Efficiency  16  2.5 Specificity  17  C H A P T E R TWO....  18  Materials and Methods 2.1 Strains, P l a s m i d s a n d O l i g o n u c l e o t i d e s  18  2.2 C u l t u r e conditions  18  2.3 M e d i a  21  iv  2.4 T r a n s f o r m a t i o n of H. influenzae  23  2.4.1 C o m p e t e n c e i n d u c t i o n  23  2.4.2 T r a n s f o r m a t i o n u s i n g linear D N A  23  2.4.3 T r a n s f o r m a t i o n u s i n g circular p l a s m i d D N A  23  2.5 E. coli p l a s m i d transformation  24  2.6 N u c l e i c A c i d Techniques  24  2.6.1 Isolation of p l a s m i d D N A  24  2.6.2 Isolation of H. influenzae c h r o m o s o m a l D N A  24  2.6.3 D N A l a b e l i n g  25  2.6.4 D N A sequencing  26  2.6.5 O l i g o n u c l e o t i d e s  26  2.6.6 B i o t i n y l a t e d oligonucleotides  26  2.6.7 C l o n i n g of O l i g o n u c l e o t i d e s  27  2.6.7.1 C l o n i n g USS-1 a n d U S S - R  27  2.6.7.2 C l o n i n g USS-50  29  2.7 Electrophoresis  29  2.7.1 A g a r o s e  30  2.7.2 P o l y a c r y l a m i d e G e l Electrophoresis ( P A G E )  30  . 2.7.2.1 D N A  30  \ 2.7.2.2 C r o s s l i n k e d D N A - p r o t e i n complexes  30  2.8 U p t a k e experiments  31  2.9 B i n d i n g experiments  31  2.10 U V laser c r o s s l i n k i n g  32  CHAPTER THREE  35  Characterization of uptake requirements of H. influenzae 3.1 Is the 29 b p U S S sufficient for uptake? 3.1.1 U p t a k e of a 'perfect' U S S 3.2 Effect of U S S p o s i t i o n o n b i n d i n g a n d u p t a k e 3.2.1 O l i g o n u c l e o t i d e s  35 35 38 38  3.2.1.1 B i n d i n g a n d u p t a k e of 30 b p D N A fragments  38  3.2.1.2 B i n d i n g a n d u p t a k e of 50 b p fragments  39  3.2.2 P l a s m i d D N A  42  v  3.3 L e n g t h dependence of uptake. Is USS-1 too short to be taken u p ?  44  3.4 Effect of 3' consensus f l a n k i n g sequence o n D N A b i n d i n g a n d uptake  46 3.4.1 B i n d i n g a n d uptake of D N A c o n t a i n i n g the l o w e s t frequency base c o m p o s i t i o n i n 3' f l a n k i n g consensus r e g i o n  46  3.4.2 B i n d i n g a n d u p t a k e of D N A l a c k i n g sequence 3' to the 9 b p core  48  3.5 C o m p e t i t i o n of v a r i o u s D N A s for uptake of c h r o m o s o m a l DNA  50 3.5.1 C o m p e t i t i o n b y c h r o m o s o m a l D N A s a n d 29 b p fragments  52  3.5.2 C o m p e t i t i o n b y c h r o m o s o m a l D N A s a n d 50 bp fragments 3.6 D i s c u s s i o n of uptake results 3.7 F u t u r e experiments  52 55 56  CHAPTER FOUR UV Laser Crosslinking  57  C r o s s l i n k i n g l a b e l e d D N A to the receptor  57  4.1 T i m e i n t e r v a l for uptake of USS-50  59  4.2 D o e s c r o s s l i n k i n g increase the a m o u n t of D N A associated w i t h the outside of cells?  59  4.3 C r o s s l i n k i n g u s i n g labeled USS-50  61  4.4 C r o s s l i n k i n g f o l l o w i n g v a r i e d time of i n c u b a t i o n  64  4.5 C r o s s l i n k i n g i n a rec-2 m u t a n t b a c k g r o u n d  66  4.5.1 C r o s s l i n k i n g i n w i l d - t y p e a n d rec-2 b a c k g r o u n d s 4.6 B i o t i n y l a t e d oligonucleotides  66 68  4.6.1 U p t a k e experiments  68  4.6.2 C r o s s l i n k i n g experiments  72  4.7 C a l c u l a t i o n s  74  4.7.1 Scenario 1; estimate 100 r e c e p t o r s / c e l l a n d a 200 k D a receptor  74  4.7.2 Scenario 2; estimate 10 r e c e p t o r s / c e l l a n d a 5 0 k D a receptor  75  4.8 D i s c u s s i o n of c r o s s l i n k i n g results  75  4.9 F u t u r e experiments  76  vi  78  C H A P T E R FIVE..... Hypothetical model for uptake by H. influenzae 5.1 D i s c u s s i o n of uptake characterization results  78  5.1.1 M o d e l for uptake of H. influenzae  78  5.1.2 Interaction of oligonucleotides w i t h the receptor c o m p l e x  82  87  BIBLIOGRAPHY..;  vii  LIST OF T A B L E S Table 2.1 Bacterial strains u s e d i n this s t u d y  19  Table 2.2 P l a s m i d s u s e d i n this s t u d y  19  Table 2.3 O l i g o n u c l e o t i d e s u s e d i n this s t u d y  20  Table 2.4 C o m p o n e n t s of n o n - c o m m e r c i a l m e d i a  21  viii  LIST OF FIGURES Figure 1.1 U p t a k e a n d i n c o r p o r a t i o n of h o m o l o g o u s D N A b y H. influenzae  6  Figure 1.2 A l i g n m e n t of the core 9-bp U S S a n d f l a n k i n g regions  10  Figure 1.3. Proteins thought to be responsible for u p t a k e of D N A b y H. influenzae  12  Figure 1.4 G e n e r a l strategy for identification of the D N A b i n d i n g receptor of H. influenzae u s i n g U V laser c r o s s l i n k i n g  14  Figure 2.1 C l o n i n g of U S S - 1 , U S S - R a n d USS-50  28  Figure 2.2 Schematic d r a w i n g of apparatus u s e d for U V laser crosslinking  33  Figure 3.1 U p t a k e of 'perfect' U S S c o n t a i n i n g D N A is not greater than a D N A that does n o t contain a U S S  37  Figure 3.2 B i n d i n g a n d u p t a k e of D N A s b y competent cells  40  Figure 3.3 B i n d i n g a n d u p t a k e b y competent cells  41  Figure 3.4 U p t a k e of c l o n e d USS-1  43  Figure 3.5 U p t a k e of different length oligos  45  Figure 3.6 B i n d i n g of 50 b p D N A fragments b y competent cells  47  Figure 3.7 B i n d i n g of 50 b p D N A fragments by competent cells  49  Figure 3.8 Schematic representation of a c o m p e t i t i o n assay  51  Figure 3.9 C h r o m o s o m a l D N A a n d 29 b p fragments  53  Figure 3.10 C h r o m o s o m a l D N A a n d 50 b p fragments  54  Figure 4.1 U p t a k e of labeled USS-50 as a function of time  58  Figure 4.2 C r o s s l i n k i n g increases the a m o u n t of D N A associated w i t h the outside of cells  60  Lx  Figure 4.3 C r o s s l i n k i n g u s i n g short a n d l o n g D N A fragments  62  Figure 4.4 C r o s s l i n k i n g USS-50 to w i l d - t y p e H. influenzae cells  63  Figure 4.5 C r o s s l i n k i n g experiments u s i n g USS-50, USS-1 a n d M A P 7 D N A s as bait  65  Figure 4.6 C r o s s l i n k i n g u s i n g M A P 7 c h r o m o s o m a l D N A  67  Figure 4.7 C r o s s l i n k i n g in rec-2 a n d w i l d - t y p e b a c k g r o u n d s  69  Figure 4.8 B i o t i n y l a t e d oligonucleotide  71  Figure 4.9 Illustration of interaction of competent H. influenzae cells w i t h b i o t i n y l a t e d D N A attached to agarose beads  73  Figure 5.1 H y p o t h e t i c a l m o d e l for b i n d i n g a n d u p t a k e b y  H. influenzae  79  Figure 5.2 M o d e l for uptake of oligos l a c k i n g 5' sequence  81  Figure 5.3 M o d e l for binding of an oligo having a G / C rich 3' flanking region  83  Figure 5.4 B i n d i n g of U S S - 5 0 - R i  84  x  LIST O F A B B R E V I A T I O N S  aa  a m i n o acid  BHI  b r a i n heart infusion (rich culture m e d i u m )  bp  base pair  cfu  colony forming unit  DNA  deoxyribonucleic acid  DNasel  deoxyribonuclease I  EDTA  ethylenediaminetetraacetic  kb  kilobase  p.g  microgram  MIV  " M - f o u r " ; a nutrient-limited H. influenzae competence i n d u c t i o n  acid  medium ml  milliliter  NAD  n i c o t i n a m i d e adenine dinucleotide  ng  nanogram  nov nov  H. influenzae n o v o b i o c i n resistance allele r  n o v o b i o c i n resistant  nt  nucleotide  oligo  oligonucleotide  r  I U B code for p u r i n e  sBHI  b r a i n heart infusion s u p p l e m e n t e d w i t h h a e m i n a n d N A D  w  I U B code for adenosine or t h y m i d i n e  y  I U B code for cytidine or t h y m i d i n e  xi  ACKNOWLEDGMENTS  I w o u l d l i k e to tharik D r . R. R e d f i e l d for p r o v i d i n g excellent g u i d a n c e a n d i n s t r u c t i o n o n the w o r k p e r f o r m e d i n this thesis. I w o u l d also like to thank the m e m b e r s of m y s u p e r v i s o r y committee for their i n s i g h t f u l comments: D r . Beatty, D r . B r o c k a n d D r . R o b e r g e . A l s o , I w o u l d l i k e to a c k n o w l e d g e a l l the m e m b e r s of the R e d f i e l d l a b w h o m a d e c o m i n g to lab e v e r y d a y a n enjoyable experience. I w o u l d l i k e to a c k n o w l e d g e Lisette U n g e t h u m for her assistance o n e x p e r i m e n t 3.2.2.  F i n a l l y , I w o u l d l i k e to thank m y s u p p o r t i n g cast. T h e y r e m a i n i n the b a c k g r o u n d , b u t s u p p o r t m e i n e v e r y t h i n g I do a n d deserve m u c h of the credit for w h o I h a v e b e c o m e . T h a n k y o u S o n i a , M o m a n d Tracy.  xii  Introduction  CHAPTER ONE Introduction C o m p e t e n c e is the a b i l i t y of cells to b i n d a n d take u p D N A f r o m their e n v i r o n m e n t [1,2]. T h e a b i l i t y of cells to d e v e l o p competence has r e c e i v e d m u c h attention i n the past a n d continues to attract investigation. In this thesis I h a v e t r i e d to clarify some of the requirements for D N A uptake i n Haemophilus influenzae. In a d d i t i o n to this I h a v e a t t e m p t e d to isolate the D N A b i n d i n g receptor that a l l o w s H. influenzae to r e c o g n i z e a n d preferentially take u p h o m o l o g o u s D N A f r o m its e n v i r o n m e n t . T h e technique I chose to use to isolate the receptor is U V laser c r o s s l i n k i n g .  T h i s project is i m p o r t a n t for a n u m b e r of reasons. H. influenzae is a n a t u r a l l y transformable gram-negative facultative anaerobe of the f a m i l y Pasteurellaceae.  It  is c o m m e n s a l i n the u p p e r respiratory tract of h u m a n s a n d is responsible for c a u s i n g s u c h diseases as m e n i n g i t i s a n d otitis m e d i a [3]. C u r r e n t l y there are vaccines for some strains of H. influenzae. H o w e v e r , i s o l a t i n g the receptor m a y p r o v i d e a n e w target for d r u g s i n a n attempt to eliminate strains of H. influenzae for w h i c h there are c u r r e n t l y n o vaccines available. A l s o , i s o l a t i n g the receptor m a y assist others t r y i n g to i d e n t i f y proteins responsible for sequence-specific uptake i n other g r a m - n e g a t i v e bacteria.  W h e r e possible I have cited o r i g i n a l w o r k . H o w e v e r , there are also m a n y useful r e v i e w articles that I have used. T w o c o m p r e h e n s i v e , t h o u g h s l i g h t l y d a t e d , r e v i e w articles o n t r a n s f o r m a t i o n are "Genetic T r a n s f o r m a t i o n " b y S m i t h a n d D a n n e r [2], a n d " T r a n s f o r m a t i o n i n Haemophilus: a p r o b l e m i n m e m b r a n e b i o l o g y " b y K a h n a n d S m i t h [4]. T w o useful r e v i e w articles o n D N A uptake b y bacteria are " D N A u p t a k e  1  Introduction  i n Haemophilus t r a n s f o r m a t i o n " b y G o o d g a l [1] a n d a v e r y recent article b y D u b n a u c a l l e d " D N A u p t a k e i n bacteria" [5].  I Competence, Transformation and D N A uptake 1.1 Natural competence. C o m p e t e n c e d e v e l o p m e n t requires p r o p e r expression of proteins w i t h i n the c y t o p l a s m a n d d e l i v e r y of specific proteins to the cell surface. F u n c t i o n s p e r f o r m e d b y these competence proteins i n c l u d e D N A b i n d i n g a n d transport across cell w a l l s a n d m e m b r a n e s . N a t u r a l competence differs f r o m artificial competence i n that artificial measures s u c h as treatment w i t h l y s o z y m e [6] or c a l c i u m ions [7] are not required.  1.2 DNA uptake and natural transformation T r a n s f o r m a t i o n arises w h e n n a t u r a l l y competent bacteria take u p D N A a n d integrate n e w alleles into their genome. N a t u r a l transformation c a n be d i v i d e d into three steps: 1) competence d e v e l o p m e n t , 2) D N A u p t a k e 3) D N A i n t e g r a t i o n . N a t u r a l transformation is w i d e s p r e a d , o c c u r r i n g i n b o t h g r a m - p o s i t i v e a n d g r a m negative bacteria. Bacillus subtilis a n d Streptococcus pneumoniae are e x a m p l e s of n a t u r a l l y competent g r a m - p o s i t i v e bacteria; H. influenzae a n d Neisseria gonorrhoeae are g r a m - n e g a t i v e examples.  D N A u p t a k e is a n i n t e g r a l part of transformation. Interestingly, g r a m - p o s i t i v e a n d g r a m - n e g a t i v e bacteria have e v o l v e d significantly different systems of b i n d i n g a n d u p t a k e , p o s s i b l y d u e to differences i n their cell w a l l c o m p o s i t i o n a n d the presence of a thick p e p t i d o g l y c a n layer s u r r o u n d i n g g r a m - p o s i t i v e bacteria. There are t w o m a i n differences i n D N A uptake between the t w o types of bacteria. T h e first is the a b i l i t y of some gram-negative cells to take u p specific D N A m o l e c u l e s , w h i c h is  2  Introduction d e p e n d e n t o n the presence of short repeated sequences i n the D N A . G r a m - p o s i t i v e bacteria take u p D N A w i t h o u t sequence preference. T h e s e c o n d difference is the a b i l i t y of gram-negative bacteria to take u p b o t h strands of D N A into a nuclease resistant f o r m . G r a m - p o s i t i v e bacteria degrade one strand o n their cell surface p r i o r to u p t a k e [2].  These points w i l l be c o v e r e d i n m o r e detail b e l o w .  1.3 Uptake and transformation by gram-positive bacteria. T r a n s f o r m a t i o n i n b o t h B. subtilis a n d S. pneumoniae has been s t u d i e d e x t e n s i v e l y . U p o n d e v e l o p m e n t of competence i n these bacteria, d o u b l e s t r a n d e d D N A is b o u n d to the outside of the cell [8]. In S. pneumoniae, f o l l o w i n g b i n d i n g the D N A is f r a g m e n t e d o n the cell surface, p r o d u c i n g single s t r a n d n i c k s w h i c h are c o n v e r t e d to d o u b l e s t r a n d breaks [9-11]. C l e a v a g e at the cell surface m a y serve to generate n e w e n d s near proteins i n v o l v e d i n uptake, a l l o w i n g entry of the D N A into the cell b y Us n e w l y f o r m e d e n d . If u p t a k e w e r e to p r o c e e d e d o n l y f r o m p r e - e x i s t i n g ends, then as the l e n g t h of the D N A fragment increased, search time for a n e n d w o u l d also increase, w h i c h c o u l d place l i m i t a t i o n s o n the ability of cells to h o l d onto D N A l o n g e n o u g h for u p t a k e to occur. A s D N A m o v e s across the c y t o p l a s m i c m e m b r a n e one s t r a n d is d e g r a d e d a n d the r e m a i n i n g strand is coated b y Ssb, a single s t r a n d e d b i n d i n g p r o t e i n . F o l l o w i n g this, D N A is i n c o r p o r a t e d into the host c h r o m o s o m e by R e c A , a p r o t e i n r e q u i r e d for h o m o l o g o u s r e c o m b i n a t i o n [12].  1.4 Uptake and transformation by gram-negative bacteria. G r a m - n e g a t i v e bacteria have a three-layered cell envelope c o m p o s e d of a n i n n e r c y t o p l a s m i c m e m b r a n e , a p e p t i d o g l y c a n layer, a n d an outer m e m b r a n e . m e c h a n i s m of D N A m o v e m e n t across these layers is unclear.  3  The  Introduction  U p t a k e systems of gram-negative bacteria can be d i v i d e d into t w o g e n e r a l categories: h o m o l o g o u s a n d heterologous. Acinetobacter calcoaceticus is a n a t u r a l l y transformable gram-negative b a c t e r i u m w i t h heterologous u p t a k e . It takes u p D N A w i t h o u t r e g a r d to the source [13,14]. C o n v e r s e l y , i n b o t h Haemophilus a n d Neisseria, D N A u p t a k e is homospecific; that is, competent cells r e c o g n i z e a n d preferentially take u p D N A from their o w n genus [15]. These g r a m - n e g a t i v e bacteria take u p b o t h strands, c o n v e r t i n g it into a nuclease resistant f o r m . It is not k n o w n i f D N A taken u p b y A. calcoaceticus is taken u p as a d o u b l e s t r a n d e d molecule.  B o t h H. influenzae a n d N. gonorrhoeae have been u s e d as m o d e l s to s t u d y the t r a n s f o r m a t i o n of gram-negative bacteria. T h e sequence specific b i n d i n g i n b o t h bacteria results from r e c o g n i t i o n of short uptake sequences w h i c h are a b u n d a n t i n their g e n o m e s . D N A that lacks these uptake sequences transforms p o o r l y a n d competes inefficiently against uptake sequence-containing D N A [15-17].  1.5 Uptake and transformation of H. influenzae. H. influenzae strains are classified into six serotypes (a-f) based o n the antigenic p r o p e r t i e s of their capsule. T h e capsule is c o m p o s e d of a n e g a t i v e l y c h a r g e d p o r o u s m a t r i x c o n s i s t i n g of a p h o s p h o d i e s t e r l i n k e d ribose-ribitol c o p o l y m e r [18]. Isolates that lack this p o l y s a c c h a r i d e capsule are classified as ' n o n t y p a b l e ' . These are also t e r m e d r o u g h because absence of the capsule causes colonies to lose the sheen of s m o o t h c a p s u l a t e d colonies. The capsule does not p r e v e n t t r a n s l o c a t i o n of D N A i n t o the cell, as it has been s h o w n that encapsulated cells transform as efficiently as n o n - e n c a p s u l a t e d strains [4,19]. The lab strain w e use (Rd) is a n o n - e n c a p s u l a t e d , n o n - p a t h o g e n i c d e r i v a t i v e of a serotype d strain.  4  Introduction T h e p r o t e i n s that a l l o w sequence specific b i n d i n g i n H. influenzae h a v e not yet been c h a r a c t e r i z e d , b u t m a n y features of uptake a n d transformation h a v e been s t u d i e d (transformation of H. influenzae is o u t l i n e d i n F i g u r e 1.1). D N A c o n t a i n i n g u p t a k e sequences interacts w i t h a p o s t u l a t e d receptor p r o t e i n c o m p l e x a n d crosses the outer m e m b r a n e as intact d o u b l e s t r a n d e d D N A (Figure 1.1, Steps 1 a n d 2). W o r k b y D e i c h a n d S m i t h (1980) has clarified m a n y aspects of the u p t a k e process. T h e y f o u n d that cells w e r e o n l y able to take u p 3 to 8 D N A m o l e c u l e s a n d suggested that cell surface receptors acted o n l y once. F r o m this, they estimated a n u p t a k e rate of 500-1000 nucleotides per second. After D N A is taken u p b y cells it becomes resistant to external nucleases a n d cannot be eluted from cells b y h i g h salt washes.  1.6 Processing and translocation of D N A T r a n s l o c a t i o n across the inner m e m b r a n e of H. influenzae requires a free e n d (Figure 1.1 step 3) [20, 21]. C i r c u l a r D N A or h a i r p i n structures are able to m o v e across the outer m e m b r a n e , b u t are not transported into the c y t o p l a s m [22, 23]. T r a n s p o r t across the i n n e r m e m b r a n e results i n complete d e g r a d a t i o n of the 5' i n c o m i n g s t r a n d a n d p a r t i a l d e g r a d a t i o n of the 3' strand [4,22, 24]. After c r o s s i n g the i n n e r m e m b r a n e , the r e m a i n i n g 3' l e a d i n g s t r a n d is available for h o m o l o g o u s r e c o m b i n a t i o n . T r a n s p o r t of D N A into N. gonorrhoeae occurs i n the same w a y as it does i n H. influenzae [22]. Single s t r a n d e d D N A has not been isolated from the c y t o p l a s m of cells. T h i s m a y be because o n l y a short l e n g t h of single-stranded D N A is present at any g i v e n time as the D N A crosses the i n n e r m e m b r a n e [5]. H o m o l o g o u s r e c o m b i n a t i o n occurs w h e n i n c o m i n g D N A replaces regions of the recipient c h r o m o s o m e c o n t a i n i n g sequence  5  Introduction  Figure 1.1. Uptake and incorporation of homologous D N A by H. influenzae. Step 1; Receptor b i n d s D N A c o n t a i n i n g a U S S . Step 2; M o v e m e n t of D N A across outer m e m b r a n e into p e r i p l a s m i c space/transformasome.  D N A becomes resistant to external a n d i n t e r n a l  nucleases. Step 3; T r a n s l o c a t i o n of D N A across inner m e m b r a n e into the c y t o p l a s m . T h e 5' l e a d i n g s t r a n d is c o m p l e t e l y d e g r a d e d whereas the 3' l e a d i n g s t r a n d is d e g r a d e d slowly. Step 4; Integration of the 3' d o n o r strand ( A ) into the h o m o l o g o u s r e g i o n of the r e c i p i e n t c h r o m o s o m e (a).  6  Introduction s i m i l a r i t y ( F i g u r e 1.1, Step 4) [21, 25]. A n average of 1.5 k b of the 3' s t r a n d of the d o n o r D N A is d e g r a d e d d u r i n g the search for h o m o l o g y [22]. O n c e r e c o m b i n a t i o n is i n i t i a t e d , it is r a p i d l y c o m p l e t e d a n d proceeds to the 5' e n d of the i n c o m i n g D N A [22].  1.7 Uptake requirements A s m e n t i o n e d above, D N A uptake b y H. influenzae is sequence specific. C e l l s h a v e the ability to r e c o g n i z e a n d preferentially take u p h o m o l o g o u s D N A . T h e u p t a k e specificity of H. influenzae depends o n the ability of the short 9-base-pair (bp) sequence ( 5 ' A A G T G C G G T 3 ' ) , called a n uptake signal sequence (USS), to interact w i t h the cell surface receptor [16, 26-29]. The U S S f l a n k i n g sequence has also been s h o w n to be i m p o r t a n t for efficient uptake i n H. influenzae. T h e m o r e A / T r i c h the sequence f l a n k i n g the U S S , the greater the a m o u n t of D N A taken u p b y cells [30]. N. gonorrhoeae also b i n d s homospecific D N A b y r e c o g n i z i n g a n u n r e l a t e d 10 b p U S S [16, 28]. H. influenzae w a s the first " l i v i n g " o r g a n i s m to h a v e its c o m p l e t e g e n o m e s e q u e n c e d [31] f o l l o w i n g the s e q u e n c i n g of several v i r a l a n d organellar genomes [32-34]. A f t e r s e q u e n c i n g , the frequency a n d d i s t r i b u t i o n of USSs w i t h i n the g e n o m e w a s a n a l y z e d . P r e v i o u s uptake a n d c o m p e t i t i o n experiments h a d e s t i m a t e d the n u m b e r of U S S s to be close to 600 [26], a l t h o u g h the 62% A / T base c o m p o s i t i o n of H. influenzae p r e d i c t e d that about 8 USSs were expected to occur b y chance. In fact, u p o n e x a m i n i n g the sequence, it w a s f o u n d that 1465 USSs w e r e present i n the g e n o m e , o c c u r r i n g i n b o t h orientations w i t h equal frequency [35]. T h e o v e r representation of U S S s is also reflected i n the frequency of 9 b p sequences differing f r o m the consensus at a single p o s i t i o n . There are 764 copies of these s i n g l y m i s m a t c h e d 9 b p consensus sequences, w h e r e 254 w o u l d be expected b y chance [2].  7  Introduction O n e h y p o t h e s i s to e x p l a i n the over-representation of U S S s i n the g e n o m e is that their occurrence results f r o m selection for uptake of h o m o l o g o u s D N A , w h i c h w o u l d r e q u i r e selection for b o t h a biased receptor a n d over-representation of U S S s w i t h i n the H. influenzae genome. Others have p o s t u l a t e d that U S S s m i g h t f u n c t i o n i n t r a c e l l u l a r l y as transcription termination sequences or c h i sites [35]. G e n o m i c analysis has s h o w n that these specific roles of U S S s are u n l i k e l y , h o w e v e r a s t r u c t u r a l role for the U S S has not been r u l e d out [2]. A third h y p o t h e s i s is that a b i a s e d receptor d i r e c t l y causes U S S s to accumulate i n the g e n o m e [2,36]. T h e receptor preferentially b i n d s D N A c o n t a i n i n g the U S S , a l l o w i n g cells take u p that D N A a n d integrate it i n t o their c h r o m o s o m e .  W i t h i n the H. influenzae g e n o m e , f l a n k i n g the U S S s , there are also r e g i o n s of consensus (Figure 1.2). W h e n a l l 1465 copies of the U S S w e r e a l i g n e d i n the p l u s d i r e c t i o n a 29 b p consensus U S S w a s identified, that h a d the sequence 5' aAAGTGCGGT .rwwwww  r w w w w w 3', w h e r e uppercase letters represent  the bases that define the U S S , lowercase letters are bases that occur i n >50% of the U S S s , a d o t is a n y base, r is p u r i n e , a n d w is A or T [35]. A c c o r d i n g to S m i t h et al., if the lengths of a l l the 29-bp USSs a n d the s i n g l y m u t a t e d sites are a d d e d , there are a total o f 2229 sites o c c u p y i n g a p p r o x i m a t e l y 3.5% of the genome [35]. In actuality, the U S S s d o n o t f u l l y constrain 3.5% of the genome. T h i s is because, as i l l u s t r a t e d i n F i g u r e 1.2, each p o s i t i o n , outside the 9 b p core, has some flexibility i n the n u c l e o t i d e that c a n o c c u p y it.  1.8 Proteins involved in translocation and recombination. T h e D N A - b i n d i n g receptor has not been isolated f r o m either H. influenzae or N. gonorrhoeae. H o w e v e r , a n u m b e r of other proteins r e q u i r e d for p r o c e s s i n g a n d t r a n s l o c a t i o n of D N A i n these a n d other bacteria have been i d e n t i f i e d . A l t h o u g h the D N A u p t a k e m e c h a n i s m s of g r a m - p o s i t i v e a n d gram-negative bacteria are t h o u g h t  8  Introduction to be different, m a n y of the proteins k n o w n to be i n v o l v e d i n u p t a k e a n d t r a n s f o r m a t i o n are s i m i l a r i n b o t h bacteria. I w i l l briefly cover the f u n c t i o n of proteins i n v o l v e d i n competence i n g r a m - p o s i t i v e bacteria a n d illustrate h o w they m a y also f u n c t i o n i n gram-negative bacteria.  T h e B. subtilis comE o p e r o n contains genes i n v o l v e d i n different aspects of competence a n d transformation. comEA is the first o p e n r e a d i n g frame of the comE o p e r o n [37, 38]. In B. subtilis C o m E A is r e q u i r e d for b o t h D N A b i n d i n g a n d transport into the cell [38]. C o m E A has h o m o l o g s i n b o t h N. gonorrhoeae a n d H. influenzae, h o w e v e r a f u n c t i o n of these proteins has not yet been a s s i g n e d i n these o r g a n i s m s . In these bacteria C o m E A c o u l d p o t e n t i a l l y act as part of the receptor p r o t e i n c o m p l e x as it does i n gram-positive bacteria. H o w e v e r , it is p r o b a b l y not the U S S r e c o g n i t i o n p r o t e i n , since gram-positive bacteria do not preferentially r e c o g n i z e or take u p h o m o l o g o u s D N A .  In B. subtilis C o m E C , e n c o d e d b y the t h i r d o p e n r e a d i n g frame of the comE o p e r o n , has been s h o w n to be r e q u i r e d for transport of D N A , but d i s p e n s a b l e for b i n d i n g . C o m E C m a y f o r m part of a n aqueous channel since it contains 6 p o t e n t i a l m e m b r a n e s p a n n i n g segments [5]. T h e C o m E C h o m o l o g s , Rec-2 i n H. influenzae a n d C o m A i n N. gonorrhoeae, have been s h o w n to p l a y essential roles i n t r a n s f o r m a t i o n [39-41]. M u t a t i o n s i n these proteins do not affect b i n d i n g or u p t a k e of D N A b u t greatly reduce transformation frequencies b y p r e v e n t i n g transport of D N A across the i n n e r m e m b r a n e . L i k e Rec-2 mutants, H. influenzae cells w i t h m u t a t i o n s i n D p r A take u p D N A into a D N a s e resistant f o r m b u t are u n a b l e to t r a n s f o r m [42, 43]. T h u s , i n conjunction w i t h Rec-2, D p r A m a y f u n c t i o n to transport D N A across the i n n e r m e m b r a n e of H. influenzae.  9  Introduction  o -<t a> T-  LO  CO  CO  w  t n Ol i -  O T"  CM CM N « T-  O  Tt  CO LD LO  T-  O t-  o *i  Q) ^  T-  OD  CO  OJ  CJ CM CO  T-  tO O N CM CM CM CM CM (D t- r O CM CM CM CO CO T - O) LO CO CM T - CM CO CO O NCM CO CM i—  r  C  O)  co r-. CM tD  CO  00 t o  CO LO  T—  CM  rt CM  T-  O CM CO CO CM T -  -t  t  co  LO (D N  CO OJ  t  CO O CD O) CM CO T— CM  O  o o  y-  O  O  o  o  —  o  O  O  T-  o  <u  o o  O  O  T-  CO  o  o >- o o O  o o  T-  o o  i-  o  o o  o  O  o o  r>. co r-. co  LO CM ID LO "t CM t- tco co i n CO OJ r  N  r  <r-CJO  10  Introduction A n o t h e r p r o t e i n w i t h a n essential role i n transformation i n H. influenzae is P o r A , a d i s u l f i d e oxidoreductase that localizes to the p e r i p l a s m a n d is r e q u i r e d for competence-associated changes i n the p r o t e i n c o m p o s i t i o n of the m e m b r a n e [44], I n its absence, D N A b i n d i n g is abolished. It is possible that P o r A is n e e d e d for the correct f o l d i n g of one or m o r e m e m b r a n e proteins d u r i n g competence development. A n o t h e r gene, c o m F C [45] has been characterized i n B. subtilis. T h e p r o d u c t of this gene resembles the C o m F p r o t e i n of H. influenzae [46, 47]. M u t a t i o n s of c o m F C decrease t r a n s f o r m a t i o n 5-10 f o l d i n B. subtilis, decreasing transport s l i g h t l y b u t not b i n d i n g . D e l e t i o n of c o m F i n H. influenzae does not i m p a i r the a b i l i t y of cells to b i n d D N A [46]. A specific role for the gene p r o d u c t has not yet b e e n e l u c i d a t e d i n either organism. Rec-1, a h o m o l o g of E. coli R e c A , is the o n l y k n o w n r e c o m b i n a t i o n p r o t e i n w i t h a n i d e n t i f i e d role i n H . influenzae transformation. M u t a t i o n s i n Rec-1 l e a d to a t r a n s f o r m a t i o n deficient p h e n o t y p e , not because cells are defective i n b i n d i n g , u p t a k e or transport, but because they are defective i n i n t e g r a t i o n of d o n o r D N A into the c h r o m o s o m e [41, 48, 49].  A m o d e l of D N A uptake i n H. influenzae has been p r o p o s e d (Figure 1.3) [5]. In this m o d e l a large p r o t e i n c o m p l e x is assembled b e l o w the receptor i n the p e r i p l a s m i c space. T h i s c o m p l e x m a y contain as yet u n i d e n t i f i e d proteins as w e l l as those l i s t e d above ( P o r A a n d C o m F ) . T h e receptor then b i n d s D N A o n the o u t s i d e of the cell a n d passes the D N A across the outer m e m b r a n e . D p r A a n d Rec-2 are located o n the i n n e r m e m b r a n e a n d act to feed D N A t h r o u g h it. These proteins m a y associate w i t h a yet u n i d e n t i f i e d nuclease that cleaves the 5' strand of the i n c o m i n g D N A . entry, Rec-1 aids i n the i n c o r p o r a t i o n of D N A into the c h r o m o s o m e .  11  Upon  Introduction  DNA  F i g u r e 1.3 Proteins thought to be responsible for u p t a k e of D N A by H. influenzae.  12  Introduction  I I U V Laser Crosslinking of D N A to Proteins Researchers h a v e t r i e d to isolate the receptor that a l l o w s H. influenzae to take u p h o m o l o g o u s D N A b y e m p l o y i n g different approaches w i t h no success. M u t a g e n e s i s screens u s i n g transposons have been p e r f o r m e d , i s o l a t i n g genes that w h e n m u t a t e d l e a d to defects i n transformation [50,51]. T h i s technique has been useful i n f i n d i n g proteins i n v o l v e d i n the r e g u l a t i o n of competence, n u t r i t i o n a l state sensing, D N A b i n d i n g , uptake a n d translocation [44, 51-54] B i o c h e m i c a l approaches have i n c l u d e d a c o m p a r i s o n of the p o l y p e p t i d e s i n the m e m b r a n e fraction of competent a n d non-competent cells [55, 56] a n d the i s o l a t i o n of D N A b i n d i n g proteins f r o m membranes of competent cells [57]. S u t r i n a a n d Scocca [58] r e p o r t e d the isolation of a p e r i p l a s m i c p r o t e i n fraction p o s s e s s i n g D N A b i n d i n g a c t i v i t y f r o m non-competent cells. T h e y suggested that these p r o t e i n s m a y b e c o m e associated w i t h the cell m e m b r a n e d u r i n g competence d e v e l o p m e n t . K a h n et a l . [59] r e p o r t e d the presence of D N A - b i n d i n g activity i n the cell c u l t u r e supernatants of certain competence, mutants after they w e r e subjected to c o m p e t e n c e - i n d u c i n g procedures. Subsequent to this, C o n c i n o a n d G o o d g a l d e v e l o p e d a p r o c e d u r e to label specific cell surface proteins i m p l i c a t e d i n D N A u p t a k e [60] . These attempts to isolate the receptor w e r e p r o m i s i n g i n that they isolated proteins w i t h the ability to b i n d D N A , h o w e v e r a lack of r e p r o d u c i b i l i t y has r a i s e d d o u b t to the v a l i d i t y of these results.  T h e g e n e r a l strategy I e m p l o y e d to isolate the receptor w a s U V laser c r o s s l i n k i n g (Figure 1.4). T h e basis for c r o s s l i n k i n g is that if D N A a n d proteins are i n contact, a laser p u l s e of U V - l i g h t can cause covalent crosslinks to f o r m b e t w e e n them. F u r t h e r to this, if the D N A is r a d i o a c t i v e l y labeled then the p r o t e i n w i l l also b e c o m e l a b e l e d w h e n c r o s s l i n k e d to the D N A . S u c h labeled proteins c o u l d be detected w h e n s a m p l e s are separated b y p o l y a c r y l a m i d e gel electrophoresis a n d e x p o s e d to f i l m .  13  Introduction  UV light from laser  labeled DNA  P u r i f y labeled proteins  Figure 1.4 General strategy for identification of the D N A b i n d i n g receptor of H.influenzae using U V laser cross-linking.  14  Introduction U s i n g c r o s s l i n k i n g to isolate the receptor has three m a i n benefits over the p r e v i o u s l y u s e d techniques. The first a n d p r i m a r y benefit is its s i m p l i c i t y . It does n o t r e q u i r e p u r i f i c a t i o n of m e m b r a n e extracts or other c o m p l i c a t e d p r o c e d u r e s . S e c o n d , it uses in vivo conditions. This is i m p o r t a n t because it eliminates the loss of p r o t e i n - p r o t e i n contacts w h i c h can occur i n m e m b r a n e preparations. T h i r d l y , it is a r e l a t i v e l y r a p i d p r o c e d u r e that can p r o d u c e results i n a matter of days.  2.1 Background U l t r a v i o l e t l i g h t is a 'zero-length' c r o s s l i n k i n g agent w h i c h creates b o n d s b e t w e e n p r o t e i n s a n d D N A at contact sites. U n l i k e c h e m i c a l c r o s s l i n k i n g there is n o n e e d for exogenous c r o s s l i n k i n g agents that m a y d i s r u p t the p r o t e i n - n u c l e i c a c i d c o m p l e x [61, 62]. F i r s t u s e d i n the 1960s, U V i r r a d i a t i o n w a s s h o w n to cause the f o r m a t i o n of p r o t e i n - D N A c r o s s l i n k s i n bacteria [63, 64]. T h e o r i g i n a l c r o s s l i n k i n g experiments u s e d b r o a d b a n d g e r m i c i d a l l a m p s to irradiate samples. T h i s w a s a w e a k source of U V light, a n d so these experiments r e q u i r e d i r r a d i a t i o n times r a n g i n g f r o m m i n u t e s to several hours [65]. S u c h p r o l o n g e d times of i r r a d i a t i o n created c o n d i t i o n s for the r e d i s t r i b u t i o n of proteins. T h i s p r o b l e m has been a d d r e s s e d b y u s i n g lasers as the source of U V light.  U V lasers confer a n u m b e r of benefits. The laser a l l o w s the n u m b e r of p h o t o n s n e e d e d for c r o s s l i n k i n g to be d e l i v e r e d i n nano- or picoseconds. Since this reaction is s e v e r a l orders of m a g n i t u d e faster than m a c r o m o l e c u l a r r e a r r a n g e m e n t s b e t w e e n p r o t e i n a n d n u c l e i c a c i d molecules (100 us or greater), U V - i n d u c e d c r o s s l i n k i n g essentially "freezes" interactions between t w o m o l e c u l e s , a l l o w i n g researchers to e x a m i n e instantaneous D N A - p r o t e i n interactions [66]. A n o t h e r benefit to u s i n g a laser is that samples are i r r a d i a t e d w i t h a b e a m of m o n o c h r o m a t i c l i g h t . T h r o u g h the use of frequency m o d u l a t o r s a w a v e l e n g t h can be u s e d that m a x i m i z e s the  15  Introduction n u m b e r of crosslinks per pulse a n d m i n i m i z e s the a m o u n t of p r o t e i n d e g r a d a t i o n (see section 2.4).  2.2 Mechanism of crosslinking C r o s s l i n k i n g occurs i n t w o steps. T h e first step is the a b s o r p t i o n of p h o t o n s b y a n u c l e i c a c i d base, c a u s i n g the base to change f r o m its g r o u n d state to a n e x c i t e d , h i g h l y reactive state. T h e second step i n v o l v e s the c o n v e r s i o n of the e n e r g y of the excited base i n t o the protein-nucleic acid crosslink. Initially, p h o t o n s p r o d u c e d b y the laser excite nucleotide bases into singlet (Si) a n d triplet ( T i ) states. T h i s increases the p o s s i b i l i t y of a b s o r p t i o n of a s e c o n d p h o t o n , a n d t r a n s i t i o n to e v e n higher excited states (Tn a n d Sn) [62]. These T n a n d S n states h a v e energies of 8-9 e V w h i c h exceeds the i o n i z a t i o n p o t e n t i a l of the bases i n s o l u t i o n a n d leads to the generation of p u r i n e a n d p y r i m i d i n e cation radicals [67]. Details of the c r o s s l i n k f o r m a t i o n step are unclear b u t are thought to i n v o l v e the p y r i m i d i n e a n d p u r i n e cationic radicals w h i c h have the potential to crosslink to a m i n o acids [62, 67].  2.3 Stability U V i n d u c e d crosslinks between proteins a n d nucleic acids are covalent [68]. C r o s s l i n k s generated b y l o w intensity U V l a m p s are k n o w n to be resistant to b o t h heat a n d a l k a l i [ 6 9 ] , b u t are c o m p l e t e l y b r o k e n d o w n b y treatment w i t h either I M acetic a c i d or 6 M H C 1 for 15 m i n . at 25°C [70]. U V laser generated c r o s s l i n k s are expected to h a v e s i m i l a r properties.  2.4 Efficiency T h e efficiency of crosslink f o r m a t i o n has been s t u d i e d in vitro b y m a n y g r o u p s . Efficiency is highest between 245 a n d 280 n m , w a v e l e n g t h s w h e r e the U V l i g h t is  16  Introduction p r i m a r i l y absorbed b y the n u c l e i c acids (specifically the t h y m i d i n e residues) [71]. C r o s s l i n k i n g can also be obtained u s i n g other w a v e l e n g t h s (200-240 n m ) , b u t i n this range a h i g h a m o u n t of p r o t e i n d e g r a d a t i o n also occurs [61]. D e p e n d i n g o n the c o n d i t i o n s o u t l i n e d b e l o w , i r r a d i a t i o n b y a U V - l a s e r can cause 1 to 20% of a p r o t e i n s a m p l e to become c r o s s l i n k e d to D N A [62, 71]. T h i s range illustrates that m a n y factors m u s t be c o n s i d e r e d w h e n u s i n g c r o s s l i n k i n g to s t u d y p r o t e i n - D N A interactions. For example, c r o s s l i n k i n g efficiency is a f u n c t i o n of the n u m b e r of favorable contacts that occur between p r o t e i n a n d n u c l e i c a c i d [71]. Specifically, w h e n the b i n d i n g site of the protein is completely filled w i t h n u c l e i c acids, b i n d i n g (and crosslinking) s h o u l d be m a x i m a l . In a d d i t i o n to the strength of the D N A - p r o t e i n interaction, the efficiency of c r o s s l i n k i n g also d e p e n d s o n the w a v e l e n g t h of the e x c i t i n g r a d i a t i o n , the nucleotide c o m p o s i t i o n of the D N A , a n d the total n u m b e r o f p h o t o n s a p p l i e d to the sample [61].  2.5 Specificity C r o s s l i n k i n g b e t w e e n D N A a n d proteins occurs t h r o u g h single n u c l e o t i d e residues [61]. C r o s s l i n k i n g s h o w s nucleotide preference, w i t h t h y m i d i n e b e i n g the m o s t reactive. T h e n u c l e o t i d e residues can be r a n k e d i n order of decreasing p h o t o r e a c t i v i t y : d T > > d C > r U > r C , d A , d G [61]. It has been d e m o n s t r a t e d that u r a c i l can be c r o s s l i n k e d to 12 different a m i n o acids a n d t h y m i d i n e to five [72-74]. C y t o s i n e is also able to be c r o s s l i n k e d to a m i n o acids, h o w e v e r , single p u r i n e bases appear to be un-reactive [75]. Therefore, if c r o s s l i n k i n g is to be successful i n i s o l a t i n g the receptor, D N A that is r i c h i n t h y m i d i n e s h o u l d be u s e d as the 'bait'.  17  Materials and. Methods  CHAPTER TWO Materials and Methods 2.1 Strains, Plasmids and Oligonucleotides Strains, p l a s m i d s a n d oligonucleotides (oligos) used i n this s t u d y are listed i n Tables 2.1,2.2 a n d 2.3, respectively. A l l H. influenzae strains are descendants of A l e x a n d e r a n d L e i d y ' s o r i g i n a l R d strain [76]. P l a s m i d p G E M 7 - w a s o b t a i n e d f r o m P r o m e g a . A l l oligonucleotides u s e d i n this s t u d y were p u r c h a s e d f r o m A l p h a D N A .  2.2 Culture conditions H. influenzae strains w e r e c u l t u r e d at 37°C i n b r a i n heart i n f u s i o n ( B H I ; Difco) s u p p l e m e n t e d w i t h h e m i n (10 u g / m l ) and n i c o t i n a m i d e adenine d i n u c l e o t i d e ( N A D ; 2 u g / m l ) . C u l t u r e s w e r e i n n o c u l a t e d f r o m either a single c o l o n y or a f r o z e n 1 m l a l i q u o t of a n early exponential phase culture. E. colt strains w e r e c u l t u r e d i n L u r i a B e r t a i n i (LB) b r o t h (Difco) or Terrific broth (Table 2.4) at 3 7 ° C [77]. W h e n h i g h levels of aeration were r e q u i r e d for either bacterial species, cultures w e r e g r o w n i n E r l e n m e y e r flasks (of at least 5 X the culture v o l u m e ) s h a k e n at 200 r p m i n a s h a k i n g water b a t h (Innova 3000, N e w B r u n s w i c k Scientific). If o n l y gentle aeration w a s n e e d e d , cultures were g r o w n i n l o o s e l y - c a p p e d test tubes ( 1 8 m m X 150 m m ) a n d r o l l e d (60 r p m ) u s i n g a tissue culture roller (Lab-line) p l a c e d i n a 3 7 ° C incubator.  18  Materials and Methods  Table 2.1 Bacterial strains used i n this study  Strain H. influenzae  Genotype  KW20 MAP7 RR622  Wild-type  Source or Reference  A l e x a n d e r a n d L e i d y [78] J. S e t l o w [79] M i n i TnlOkan p l a s m i d f r o m D . M c C a r t h y [80] integrated i n t o K W 2 0 chromosome by P. Williams.  kan nal nov str spc rif vio rec-2 : : M i n i T n I 0 kan r  r  r  r  r  r  E. coli DH5a  supE44 recAl  D . H a n a h a n [81]  Table 2.2 Plasmids used i n this study  Plasmid  Genotype  pGEM7-ZfpGPl pGPR pGP50  pBR322 derivative (amp ) pGEM7-Zf-::USS-l pGEM7-Zf-::USS-R pGEM7-Zf-::USS-50  Source or Reference r  19  Promega This s t u d y This s t u d y This s t u d y  Materials and Methods  Table 2.3 Oligonucleotides used in this study  Oligonucleotide  Sequence  USS-l-W USS-l-C  5'AAAGTGCGGTTAATTTTTAAAGTATTTTT 3 ' 3'TTTCACGCCAATTAAAAATTTCATAAAAA 5 '  USS-R-W USS-R-C  5'TCTTGTTAGAATCTGAGTGTTATTTAAAT 3 ' 3'AGAACAATCTTAGACTCACAATAAATTTA 5 ' Kpnl 5'GGTACCATATAAAGTGCGGTTAATTTTTAC 3 '  USS-30-W USS-30-C  3'CCATGGTATATTTCACGCCAATTAAAAATG 5 ' Kpnl 5'TGGTACCATATAAAGTGCGGTTAATTTTTACAGTATTTTT 3 '  USS-40-W USS-40-C  3'ACCATGGTATATTTCACGCCAATTAAAAATGTCATAAAAA 5 ' Kpnl EcoRI •5'TAATGGTACCATATAAAGTGCGGTTAATTTTTAAAGTATTTTTGAATTCC 3 '  USS-50-W USS-50-C  3'ATTACCATGGTATATTTCACGCCAATTAAAAATTTCATAAAAACTTAAGG  5'  ECORI Kpnl 5'AAAOTOCGGTTAATTTTTAAAGTATTTTTGAATTCCTAATGGTACCATAT 3 '  USS-50 L E - W USS-50 L E - C  3'TTTCACGCCAATTAAAAATTTCATAAAAACTTAAGGATTACCATGGTATA  5'  EcoRI Kpnl 5'TAATTTTTAAAGTATTTTTGAATTCCTAATGGTACCATATAAAGTGCGGT 3 '  USS-50 R I - W USS-50 R I - C  3'ATTAAAAATTTCATAAAAACTTAAGGATTACCATGGTATATTTCACGCCA  5'  Kpnl EcoRI 5'TAATGGTACCTATAAAAGTGCGGTGCCCGGGCGTTCGCGCGGGGGAATTC 3 '  USS-50 R C - W USS-50 R C - C  3'ATTACCATGGATATTTTCACGCCACGGGCCCGCAAGCGCGCCCCCTTAAG 5 '  USS-50 R - W USS-50 R - C  5'ATTCTATAGTTATAGTTGTGTATAACGTAGTATCAAGATACATCATTTGT 3 / 3'TAAGATATCAATATCAACACATATTGCATCATAGTTCTATGTAGTAAACA 5 /  D-USS-50-W-Biotin D-USS-50-C  !  5'TAATGGTAAAGTGCGGTATATAAAGTGCGGTTAATTTTTAAAGTATTTTT-B 3 ' • 3'ATTACCATTTCACGCCATATATTTCACGCCAATTAAAAATTTCATAAAAA 5 '  A l l o l i g o n u c l e o t i d e s listed were synthesized as single stranded m o l e c u l e s . O l i g o s w e r e d e s i g n e d to a l l o w a n n e a l i n g w i t h c o m p l e m e n t a r y strands to f o r m d o u b l e s t r a n d e d D N A molecules. The 9 b p core U S S is i n d i c a t e d i n b o l d . R e s t r i c t i o n e n z y m e sites are s h o w n above their r e c o g n i t i o n sequence.  20  Materials and. Methods  A g a r plates w e r e p r e p a r e d b y the a d d i t i o n of 12 g / L B a c t o - A g a r (Difco) to l i q u i d m e d i a p r i o r to a u t o c l a v i n g . A d d i t i o n a l h e m i n w a s a p p l i e d to B H I plates older than 24 hours. F o r p l a t i n g of H. influenzae, cells were serially d i l u t e d i n ' d i l u t i o n s o l u t i o n ' c o n t a i n i n g I X phosphate-buffered saline a n d 10% B H I , then p l a t e d o n s B H I plates ( B H I plates s u p p l e m e n t e d w i t h h e m i n a n d N A D ) . W h e n screening for transformants, cells w e r e p l a t e d o n s B H I c o n t a i n i n g the f o l l o w i n g concentrations of antibiotics: n o v o b i o c i n , 2.5 u g / m l a n d c h l o r a m p h e n i c o l , 1 u g / m l . F o r L B plates the concentrations were: a m p i c i l l i n , 100 p g / n i l a n d c h l o r a m p h e n i c o l , 25 u g / m l .  2.3 Media A l l m e d i a w e r e s t e r i l i z e d b y autoclaving. The ingredients of n o n - c o m m e r c i a l m e d i a are d e s c r i b e d i n Table 2.4.  Table 2.4 Components of non-commercial media  a) Terrific broth [77] Bacto-tryptone Bacto-yeast extract Glycerol KH P0 K HP0 2  2  4  4  Amount/liter 24 a 12 I 4 ml 2.31 g 12.54 g  21  Materials and Methods  Table 2.4 continued  b) MIV medium for competence induction [82]. Solution Solution 21 Distilled water L-Aspartic acid L-Glutamic acid Furmaric A c i d NaCl Tween 80 K HP0  Amount  KH2PO4  850 ml 4.0 s 0.2 i 1.0 g 4.7 g 0.2 ml 0.87 g 0.67 g  Solution 22 L-Cystine L-Tyrosine L-Citruline L-Phenylalanine L-Serine L-Alanine  0.04 g 0.1 g 0.06 g 0.2 2 0.3 e 0.2 g  Solution 23 CaCl  0.1 M solution  Solution 24 MgS04  0.1 M solution  2  4  2  Solution 40  5% (w/v) solution of vitamin-free casamino acids (Difco) in distilled water.  M I V is m a d e b y a d d i n g 1 m l of each of solutions 22, 23, 24 a n d 40 to 100 m l of s o l u t i o n 21.  22  Materials and Methods 2.4 Transformation of H.  influenzae  2.4.1 Competence induction C o m p e t e n c e w a s i n d u c e d i n H. influenzae b y transfer of cells to M I V starvation m e d i u m [82] as o u t l i n e d i n Barcak et al. [79]. C e l l s were g r o w n o v e r n i g h t i n s B H I to stationary phase. T h e f o l l o w i n g d a y cultures w e r e d i l u t e d 1000 f o l d i n t o s B H I a n d i n c u b a t e d at 3 7 ° C to p e r m i t several generations of g r o w t h d u r i n g e x p o n e n t i a l phase. C e l l s w e r e g r o w n to a density of a p p r o x i m a t e l y 1 0 c f u / m l (OD600 o f 0.29  0.25) a n d collected b y filtration u s i n g a 100 m l N a l g e n e A n a l y t i c a l Test Filter F u n n e l (0.2 p m p o r e size). C e l l s w e r e r i n s e d once w i t h M I V [83] a n d transferred to a flask c o n t a i n i n g one v o l u m e of M I V (equal to the a m o u n t of culture that w a s o r i g i n a l l y filtered). C e l l s w e r e shaken at 100 r p m for 100 m i n u t e s , b y w h i c h time they a c h i e v e d a m a x i m a l l e v e l of competence.  2.4.2 Transformation using linear D N A D N A (200 ng) c o n t a i n i n g antibiotic resistance markers w a s i n c u b a t e d w i t h 200 p i of M I V competent cells. C e l l s were r o l l e d i n a tissue culture roller at 3 7 ° C for 15 m i n u t e s to a l l o w sufficient time for uptake of the D N A [29]. D N a s e I w a s a d d e d a n d the m i x t u r e w a s r o l l e d for a n a d d i t i o n a l 10 minutes. T h e t r a n s f o r m a t i o n m i x t u r e w a s serially d i l u t e d i n d i l u t i o n s o l u t i o n a n d each d i l u t i o n p l a t e d o n m e d i u m c o n t a i n i n g the a p p r o p r i a t e antibiotic.  2.4.3 Transformation using circular plasmid DNA. C i r c u l a r p l a s m i d D N A transforms H. influenzae p o o r l y . P l a s m i d transformations w e r e c a r r i e d out u s i n g a p r e v i o u s l y described m e t h o d of e n h a n c i n g p l a s m i d t r a n s f o r m a t i o n b y treating M l V - c o m p e t e n t cells w i t h 32% g l y c e r o l [84].  23  Materials and Methods 2.5 E. coli p l a s m i d t r a n s f o r m a t i o n E. coli cells w e r e m a d e competent b y treatment w i t h c o l d 100 m M C a C l 2 , a n d o t h e r w i s e transformed b y s t a n d a r d procedures [85]. A l l c l o n i n g s w e r e c a r r i e d o u t i n E . coli strain D H 5 a .  2.6 N u c l e i c A c i d T e c h n i q u e s 2.6.1 Isolation of plasmid D N A H. influenzae cells w e r e g r o w n i n s B H I a n d E. coli cells were g r o w n i n Terrific B r o t h o v e r n i g h t to stationary phase. P l a s m i d D N A was extracted u s i n g the a l k a l i n e lysis p r o c e d u r e [77]. If p l a s m i d s were to be sequenced, D N A w a s further p u r i f i e d b y p r e c i p i t a t i o n w i t h L i C l a n d polyethylene g l y c o l ( P E G 8000; Sigma) [85].  2.6.2 Isolation of H . influenzae chromosomal D N A C h r o m o s o m a l D N A w a s isolated as p r e v i o u s l y described [79]. Bacterial cultures (35 m l ) w e r e g r o w n o v e r n i g h t i n s B H I , pelleted a n d r e s u s p e n d e d i n 0 . 1 5 M N a C l , 0 . 1 M ethlyenediamine-tetraacetic acid ( E D T A ) , p H 8.0. C e l l s w e r e l y s e d b y a d d i n g 1% s o d i u m d o d e c y l sulfate (SDS) for 10 minutes at 5 2 ° C . L y s e d cells w e r e treated w i t h proteinase K (50 u g / m l ) for 1 h o u r at 3 7 ° C , f o l l o w e d b y extraction w i t h one v o l u m e of p h e n o l - c h l o r o f o r m (1:1). D N A w a s precipitated b y a d d i n g 2 v o l u m e s o f 95% ethanol a n d collected b y s p o o l i n g o n a glass rod. D N A was d r i e d for 1 h o u r at r o o m temperature a n d d i s s o l v e d i n 500 u l T E p H 8.0 [10 m M T r i s - H C l , p H 8 ; 1 m M E D T A ] . D i s s o l v e d D N A w a s treated w i t h R N a s e A (0.2 m g / m l , Sigma) at 3 7 ° C for 30 m i n u t e s . D N A w a s a d d i t i o n a l l y p u r i f i e d b y extraction w i t h equal v o l u m e s of p h e n o l a n d p h e n o l - c h l o r o f o r m . Extracted D N A w a s precipitated w i t h 2 v o l u m e s of 95% ethanol a n d 0 . 1 5 M N a C l , d r i e d , then r e s u s p e n d e d i n 10 m l of T E p H 8.0.  24  Materials and Methods 2.6.3 D N A labeling O l i g o s a n d l i n e a r i z e d p l a s m i d s were end labeled u s i n g y - P - A T P . D N A (4-40 ug) 3 3  w a s i n c u b a t e d i n p o l y n u c l e o t i d e kinase buffer (70 m M T r i s - H C l , 10 m M M g C b , 5 m M D T T ; p H 7.6) w i t h 5-25 u l y - P - A T P (10 m C i / m l ) a n d 1 u n i t of T4 3 3  p o l y n u c l e o t i d e kinase i n a 50 u l v o l u m e . The reaction p r o c e e d e d for 30 m i n u t e s a n d w a s h a l t e d b y transfer to a 65°C heat b l o c k for 20 m i n u t e s .  N i c k t r a n s l a t i o n w a s u s e d to label c h r o m o s o m a l D N A [85]. C h r o m o s o m a l D N A (10-20 pg) w a s i n c u b a t e d i n E . coli D N A polymerase buffer (10 m M T r i s - H C l ; p H 7.5, 5 m M M g C b . , 7.5 m M dithiothreitol) w i t h 5-20 u l a - P - d A T P (10 m C i / m l ) , 1 u n i t of 3 3  E. coli D N A p o l y m e r a s e , 1-5 p i of D N a s e I (0.01 u g / m l ) a n d 20 m M each of d T T P , d G T P a n d d C T P , i n a v o l u m e of 200-250 p i . T h e reaction w a s i n c u b a t e d at 12-15°C for 30 m i n u t e s . T h e reaction w a s s t o p p e d w i t h the a d d i t i o n of E D T A to 0.5 M a n d 100 p i T E p H 8.0. After i n c u b a t i o n , all l a b e l i n g reactions w e r e extracted once w i t h an e q u a l v o l u m e of p h e n o l - c h l o r o f o r m . L a b e l e d D N A s were p u r i f i e d f r o m u n i n c o r p o r a t e d nucleotides b y u s i n g either 10 m l c h r o m a t o g r a p h y c o l u m n s ( B i o - R a d ) p a c k e d w i t h Sephadex (G-15; Pharmacia) or ' M i c r o S p i n ' G-50 c o l u m n s ( A m e r s h a m ) .  T h e i n c o r p o r a t i o n of label into the D N A w a s d e t e r m i n e d b y p l a c i n g l a b e l e d s a m p l e (0.5-10 ul) into a scintillation v i a l , a d d i n g 1 m l of scintillation f l u i d ( A C S Scintillation cocktail; A m e r s h a m ) a n d c o u n t i n g i n a B e c k m a n s c i n t i l l a t i o n counter. T h e specific a c t i v i t y w a s calculated b y d i v i d i n g the n u m b e r of counts per m i n u t e b y the v o l u m e of the s a m p l e a n a l y z e d , then d i v i d i n g b y the concentration of D N A .  The  concentration of D N A was estimated b y d i v i d i n g the a m o u n t i n i t i a l l y u s e d i n the l a b e l i n g reaction b y the v o l u m e of the l a b e l i n g reaction. T h e specific a c t i v i t y of the D N A is expressed as the n u m b e r of counts per m i n u t e per m i c r o g r a m of D N A .  25  Materials and Methods 2.6.4 D N A sequencing A u t o m a t e d D N A sequencing of p l a s m i d s was c a r r i e d out b y the N u c l e i c A c i d P r o t e i n Service ( N A P S ) u n i t at U B C u s i n g A m p l i T a q D y e T e r m i n a t o r C y c l e Sequencing chemistry.  2.6.5 Oligonucleotides A l l o l i g o n u c l e o t i d e s were p u r c h a s e d as single strand D N A molecules. C o n c e n t r a t i o n s of o l i g o n u c l e o t i d e s were d e t e r m i n e d b y their absorbance at 260 n m i n a B e c k m a n D u - 6 5 spectrophotometer, a n d a p p l i c a t i o n of the f o r m u l a [ D N A concentration=  A26O  x  d i l u t i o n x 37 u g / m l ] . O l i g o s w e r e m a d e d o u b l e s t r a n d e d b y  a d d i n g e q u a l a m o u n t s of each c o m p l e m e n t a r y oligo (40-100 u g , 4 u g / u l i n d H ^ O ) i n a m i c r o f u g e tube a n d p l a c i n g i n a beaker c o n t a i n i n g b o i l i n g w a t e r for 10 m i n u t e s . I m m e d i a t e l y after this i n c u b a t i o n p e r i o d tubes w e r e s p u n for 5 seconds i n a m i c r o f u g e , to r e m o v e condensation from w a l l s a n d caps of tubes, then r e p l a c e d i n the w a t e r bath. T o facilitate a n n e a l i n g of the single strands the water bath w a s r e m o v e d f r o m the hot plate a n d a l l o w e d to cool at r o o m temperature to 5 0 ° C , at w h i c h time the o l i g o s w e r e expected to be d o u b l e stranded. T o c o n f i r m this a 1 u g a l i q u o t of the b o i l e d s a m p l e , as w e l l as e q u a l amounts of the single strand precursors, w e r e r u n o n a p o l y a c r y l a m i d e gel a n d stained w i t h e t h i d i u m b r o m i d e . E t h i d i u m b r o m i d e intercalates b e t w e e n the stacked bases of nucleic acids [86]. S i n g l e s t r a n d e d oligos w e r e v i s i b l e i n lanes w h e r e they were a d d e d i n d i v i d u a l l y , b u t not i n the b o i l e d s a m p l e lanes. F r o m this, the D N A w a s c o n s i d e r e d to be p r i m a r i l y d o u b l e s t r a n d e d .  2.6.6 Biotinylated oligonucleotides D - U S S - 5 0 - W - B i o t i n ' i s a single stranded oligonucleotide w i t h a b i o t i n m o l e c u l e attached to the 3' t e r m i n u s b y a 15 a t o m spacer a r m  CH2-CH2-CH2-NH-CO-CH2-CH2-CH2-).  (CH2-CH2-NH-CO-CH2-CH2-  It is c o m p l e m e n t a r y to D - U S S - 5 0 - C (see  26  Materials and Methods Table 2.3). These oligos w e r e m a d e d o u b l e stranded b y the same p r o c e d u r e as i n section 2.6.5 a n d were e n d l a b e l e d at the 5' ends as i n section 2.6.3. T o j o i n the b i o t i n y l a t e d oligo to s t r e p t a v i d i n agarose beads ( G i b c o B R L ) a m i x t u r e of the t w o c o m p o n e n t s w a s i n c u b a t e d i n I X phosphate-buffered saline a n d r o l l e d i n a tissue culture roller for 30 minutes. Beads w e r e pelleted b y centrifugation a n d r e s u s p e n d e d i n M I V (1 m l ) after the supernatant l i q u i d w a s r e m o v e d . T h i s w a s repeated four times i n total to r e m o v e a l l u n b o u n d oligo f r o m the beads. T h e n u m b e r of m o l e c u l e s of D N A b o u n d to the streptavidin-agarose beads w a s d e t e r m i n e d b y scintillation c o u n t i n g , u s i n g the specific activity of r a d i o l a b e l l i n g a n d m o l e c u l a r w e i g h t of the oligo.  2.6.7 C l o n i n g o f O l i g o n u c l e o t i d e s (See F i g u r e 2.1) D N A ligations w e r e carried out a c c o r d i n g to S a m b r o o k et a l . [77] u s i n g T4 D N A ligase (Boehringer M a n n h e i m ) . P E G 8000 (15 % w / v ) w a s a d d e d to b l u n t e n d ligations. 2.6.7.1 Cloning USS-1 and USS-R P l a s m i d p G E M 7 - (1-3 ug) w a s digested w i t h Smal, a b l u n t cutter w h i c h cuts once w i t h i n the m u l t i p l e c l o n i n g site i n the lacZ gene. To m i n i m i z e re-annealing, p l a s m i d s w e r e d e p h o s p h o r y l a t e d for 30 minutes at 37°C w i t h 0.1 units of a l k a l i n e p h o s p h a t a s e i n 50 u l of o n e - P h o r - A l l P L U S buffer (10 m M Tris-acetate, 10 m M m a g n e s i u m acetate'and 50 m M p o t a s s i u m acetate). T h i s reaction w a s s t o p p e d b y heat i n a c t i v a t i o n of the e n z y m e at 85°C for 15 minutes. W a t e r (150 ul) w a s a d d e d to the reaction a n d D N A w a s extracted w i t h 200 p i of p h e n o l - c h l o r o f o r m (1:1).  27  Materials and Methods  Figure 2.1 C l o n i n g of USS-1, U S S - R and USS-50. A ) To clone USS-1 and USS-R p G E M 7 - was digested with Smal then dephosphorylated. The oligos were phosphorylated then ligated into the Smal site of p G E M 7 - and scored for white phenotype. B) To clone USS-50, both p G E M 7 - and USS-50 were digested with EcoRI and Kpnl then ligated together. Plasmids that contained inserts were identified by scoring for a white phenotype in the presence of X - G A L .  28  Materials and Methods O l i g o s (0.5-1 ug) w e r e p h o s p h o r y l a t e d i n a 50 u l reaction v o l u m e o f T 4 p o l y n u c l e o t i d e kinase buffer u s i n g T4 p o l y n u c l e o t i d e kinase (10 units) i n the presence of 1 m M A T P . P h o s p h o r y l a t e d oligos were c o m b i n e d w i t h digested p l a s m i d s i n T4 ligase buffer (66 m M T r i s - H C l , p H 7.6, 6.6 m M M g C b , 10 m M D T T , 66 u M A T P ) c o n t a i n i n g 1 u n i t of T4 D N A ligase (Boehringer M a n n h e i m ) . Reactions were p e r f o r m e d at r o o m t e m p e r a t u r e for 16-18 hours. L i g a t i o n s were transformed into E . coli a n d cells w e r e p l a t e d o n L B c o n t a i n i n g a m p i c i l l i n . C o l o n i e s were scored for a w h i t e p h e n o t y p e w h e n g r o w n i n the presence of X - G A L . P l a s m i d D N A w a s i s o l a t e d f r o m w h i t e colonies, d i g e s t e d a n d r u n o n 0.8 - 2 % agarose gels. After restriction m a p p i n g , inserts w e r e sequenced u s i n g the T 7 a n d SP6 p r i m e r s [87]. 2.6.7.2 Cloning of USS-50 P l a s m i d p G E M 7 - (1-3 pg) a n d USS-50 (5-15 pg) were each digested w i t h EcoRI a n d KpnI. These e n z y m e s cut once i n each D N A m o l e c u l e . After d i g e s t i o n , p l a s m i d D N A a n d oligos w e r e c o m b i n e d i n T4 ligase buffer w i t h 1 unit of T4 D N A ligase. L i g a t i o n s w e r e p e r f o r m e d at 14°C for 16-24 hours. A s above, l i g a t i o n s w e r e t r a n s f o r m e d into E . coli a n d g r o w n i n the presence of X - G A L . A s above, p l a s m i d D N A w a s i s o l a t e d f r o m w h i t e colonies a n d extensive restriction digestions w e r e p e r f o r m e d to c o n f i r m the presence of a n insert. After restriction m a p p i n g , inserts w e r e s e q u e n c e d u s i n g the same p r i m e r s as above.  2.7 E l e c t r o p h o r e s i s D N A fragments w e r e separated o n either agarose or p o l y a c r y l a m i d e gels. G e l s w e r e stained w i t h e t h i d i u m b r o m i d e (0.25 u g / m l ) a n d separated D N A fragments w e r e v i s u a l i z e d u n d e r U V light. Either 100 b p or 1 k b ladders ( N e w E n g l a n d Biolabs) w e r e u s e d as size standards.  29  Materials and Methods 2.7.1 Agarose gel electrophoresis D N A fragments w e r e separated o n either 0.8 or 2 % agarose (Gibco B R L ) T r i s Acetate E D T A ( T A E , p H 8) gels [77]. D N A fragments w e r e p u r i f i e d f r o m agarose gels u s i n g a ' G e n e - C l e a n ' k i t (Bio 101 Inc.).  2.7.2 Polyacrylamide Gel Electrophoresis (PAGE) 2.7.2.1 DNA S m a l l fragments of D N A w e r e separated b y P A G E u s i n g either 15 or 20 % p o l y a c r y l a m i d e gels i n I X Tris Borate E D T A (TBE) a n d r u n at 100-150 V [77].  2.7.2.2 Crosslinked DNA-protein  complexes  S a m p l e s w e r e a n a l y z e d b y S D S - P A G E u s i n g either 8 or 12% p o l y a c r y l a m i d e w i t h 5% s t a c k i n g gels i n a vertical m i n i g e l electrophoresis system ( O w l Scientific) [77]. F o l l o w i n g i r r a d i a t i o n of D N A - p r o t e i n m i x t u r e s , samples w e r e m i x e d w i t h 1/2 v o l u m e of 3 X s a m p l e buffer (187.5 m M T r i s - H C l ( p H 6.8), 6% ( w / v ) S D S , 30% g l y c e r o l a n d 0.03% b r o m p h e n o l blue). Samples w e r e b o i l e d for 10 m i n u t e s p r i o r to l o a d i n g . F o r u n k n o w n reasons, m a n y c r o s s l i n k e d p r o t e i n - D N A c o m p l e x e s d o n o t enter p o l y a c r y l a m i d e gels w h e n s o l u b i l i z e d i n s a m p l e buffer that does n o t c o n t a i n at least I M urea [88]; therefore after b o i l i n g 1/5 v o l u m e of 5 M urea w a s a d d e d to s a m p l e s p r i o r to l o a d i n g . Gels were electrophoresed (200-210 V ) then d r i e d u s i n g a gel d r y e r (BioRad) o n W h a t m a n D E 81 filter paper. D r i e d gels w e r e e x p o s e d to a p h o s p h o i m a g e r screen ( M o l e c u l a r D y n a m i c s ) for 24-96 hours.  30  Materials and Methods  2.8 Uptake experiments R a d i o a c t i v e l y l a b e l e d D N A (1 ug) was i n c u b a t e d w i t h 1 m l of freshly m a d e M I V c o m p e t e n t cells. C e l l s a n d D N A were r o l l e d at 3 7 ° C for 10 m i n u t e s . D N a s e I (50 ug) w a s a d d e d a n d the m i x t u r e was p l a c e d o n ice. After 5 m i n u t e s 100 u l of N a C l (5M) w a s a d d e d a n d cells were pelleted b y centrifugation at 13,000 r p m for 1 m i n u t e at 4 ° C ( C a n l a b Biofuge A ) . T h e supernatant f l u i d w a s r e m o v e d a n d cells w e r e r e s u s p e n d e d i n c o l d M I V c o n t a i n i n g 1 M N a C l . C e l l s w e r e a g a i n p e l l e t e d a n d the supernatant l i q u i d r e m o v e d . T h e pellet was r e s u s p e n d e d i n 200 u l of M I V at r o o m temperature a n d transferred to a scintillation v i a l . Scintillation f l u i d (1 m l ) w a s a d d e d a n d the r a d i o a c t i v i t y of the sample w a s c o u n t e d u s i n g the s c i n t i l l a t i o n counter.  2.9 Binding experiments F o r s o m e e x p e r i m e n t s it w a s necessary to determine the a m o u n t of D N A b o u n d b y cells. T h i s w a s a c h i e v e d u s i n g a b i n d i n g assay. This p r o c e d u r e differs f r o m uptake e x p e r i m e n t s i n that a b i n d i n g assay determines the a m o u n t of D N A that is able to be r e m o v e d f r o m the outside of cells, after non-specifically b o u n d D N A is r e m o v e d . Briefly, for b i n d i n g experiments, cells were i n c u b a t e d w i t h l a b e l e d D N A for 10 m i n u t e s , then w a s h e d w i t h M I V to r e m o v e any D N A that w a s n o n - s p e c i f i c a l l y associated w i t h the outside of the cell. After the non-specific D N A w a s t h o u g h t to be r e m o v e d , cells w e r e treated w i t h D N a s e I to r e m o v e specifically b o u n d D N A . F o l l o w i n g D N a s e I treatment, cells were w a s h e d w i t h a h i g h salt s o l u t i o n to facilitate r e m o v a l of D N A that r e m a i n e d b o u n d to cells. F o l l o w i n g these treatments the a m o u n t of label released into the supernatant f l u i d w a s c o u n t e d .  31  Materials and Methods  2.10 UV laser crosslinking C r o s s l i n k i n g experiments u s e d a Q u a n t a - R a y M o d e l G C R 1 4 S p u l s e d N d : Y A G ( n e o d y m i u m y t t r i u m - a l u m i n u m - g a r n e t ) laser (Spectra P h y s i c s ) (illustrated i n F i g u r e 2.2). A c c e s s to this laser w a s generously p r o v i d e d b y D r . M . R o b e r g e (Dept. of B i o c h e m i s t r y a n d M o l e c u l a r B i o l o g y , U B C ) . T h i s laser emits p h o t o n s w i t h a w a v e l e n g t h of 1064 n m . It is e q u i p p e d w i t h an H G - 2 h a r m o n i c generator (Spectra P h y s i c s ) c o n t a i n i n g K D * P (potassium d i d e u t e r i u m phosphate) crystals, w h i c h reduces the w a v e l e n g t h of the emitted light f r o m 1064 to 266 n m . D i c h r o i c m i r r o r s ( D H S - 2 Q u a n t a - R a y d i c h r o i c h a r m o n i c separator) are u s e d to e l i m i n a t e r e s i d u a l 532 a n d 1064 n m l i g h t to a b e a m d u m p a n d to reflect m o n o c h r o m a t i c 266 n m light. T h i s c o n f i g u r a t i o n a l l o w s the laser to emit 5-6 ns pulses w i t h an energy of u p to 60 m j a n d a b e a m diameter of 6.4 m m . The energy w a s m e a s u r e d w i t h a n A s t r a l A A 3 0 p o w e r a n d energy meter e q u i p p e d w i t h an A C 2 5 U V sensor (Scientech) [88].  F r e s h l y m a d e M I V competent H. influenzae cells were i n c u b a t e d w i t h l a b e l e d D N A for 10 seconds, 1 m i n u t e or 30 m i n u t e s p r i o r to c r o s s l i n k i n g . T h e r a t i o n a l e for v a r y i n g the time of i n c u b a t i o n w a s to m a x i m i z e the p r o b a b i l i t y that the receptor w a s i n contact w i t h the labeled D N A w h e n the pulses from the laser w e r e a p p l i e d . W h e n c r o s s l i n k i n g experiments w e r e p e r f o r m e d u s i n g b i o t i n y l a t e d o l i g o s , the l a b e l e d o l i g o s w e r e i n c u b a t e d w i t h cells for 10 m i n u t e s p r i o r to c r o s s l i n k i n g .  C e l l s (50 p l , O D 0.2) w e r e a d d e d to D N A (0.1 u g - 1 ug) i n a m i c r o f u g e tube a n d m i x e d w i t h a pipette tip. O p e n 1.5 m l microfuge tubes were p l a c e d h o r i z o n t a l l y i n the p a t h of the laser. Tubes were stabilized b y p l a c i n g them i n a 1 0 - m m hole d r i l l e d  32  Materials and Methods  266 nm pulse  Sample  Dichroic mirrors Plexiglass holder  N d : Y A G laser 1064 nm  Harmonic generator 266 nm  Micromanipulator B e a m dump (1064 nm, 532 nm)  F i g u r e 2.2 Schematic d r a w i n g of apparatus used for U V laser c r o s s - l i n k i n g . ( M o d i f i e d from H o et al., (1994). This is a top v i e w , not to scale. The laser delivers pulses of 1064 n m . The harmonic generator reduces the wavelength of input light to 266 n m . The dichroic mirrors a l l o w passage of only 266 n m monochromatic light to the sample. Other wavelengths (1064 n m and 532 nm) are directed to the beam d u m p . The sample is held horizontally b y a plexiglass sheet attached to a micromanipulator.  33  Materials and Methods i n a s m a l l p l e x i g l a s sheet h e l d i n place b y a B r i n k m a n n m i c r o m a n i p u l a t o r . C r o s s l i n k i n g experiments w e r e p e r f o r m e d w i t h three to six 50-mJ pulses. F o r c r o s s l i n k i n g experiments u s i n g streptavidin-agarose beads, s a m p l e s w e r e i r r a d i a t e d w i t h 6 pulses of U V light from the laser. F o l l o w i n g c r o s s l i n k i n g , 1 % S D S w a s a d d e d to samples then i n c u b a t e d at 37°C for 10 minutes. The supernatant l i q u i d w a s r e m o v e d a n d streptavidin-agarose beads were w a s h e d once w i t h M I V . S a m p l e s w e r e then treated w i t h D N a s e (see section 2.8) for 5 m i n u t e s o n ice. S a m p l e buffer w a s a d d e d a n d the entire s a m p l e w a s l o a d e d into the w e l l . A f t e r electrophoresis gels w e r e stained u s i n g a silver s t a i n i n g k i t ( B i o R a d silver s t a i n plus).  34  Uptake Results and Discussion  CHAPTER  THREE  C h a r a c t e r i z a t i o n o f D N A sequences r e q u i r e d f o r u p t a k e b y H.  influenzae  C o m p e t e n t H. influenzae cells preferentially take u p D N A w h i c h contains a specific u p t a k e s i g n a l sequence (USS). I n a d d i t i o n to the 9 b p core, other factors m a y also affect u p t a k e . I n this chapter I describe experiments that address h o w f l a n k i n g sequences affect D N A uptake b y competent H. influenzae cells.  3.1 Is the 29 b p U S S s u f f i c i e n t f o r u p t a k e ? U S S s i n the g e n o m e are f l a n k e d b y regions of c o n s e r v e d sequence (see F i g u r e 1.2). T h e 9 b p core a n d regions f l a n k i n g the U S S total 29 base pairs. P r e v i o u s research treated D N A u p t a k e i n a qualitative m a n n e r [30]. H o w e v e r , this d i d not address the w i d e range (2 n g - 1 5 0 ng) of uptake w h i c h occurs d e p e n d i n g o n D N A l e n g t h , the sequence o f the 9 b p core a n d variations i n the A / T richness f l a n k i n g the U S S . Since u p t a k e occurs over s u c h a range, it is m o r e accurate to present it as a q u a n t i t a t i v e v a l u e rather than a qualitative one.  3.1.1 Uptake of a ' p e r f e c t ' U S S U p t a k e c a n be q u a n t i f i e d i n t w o w a y s : u g of D N A / m l of c o m p e t e n t cells or n u m b e r of D N A m o l e c u l e s / c e l l . It is unclear whether the total a m o u n t of D N A taken u p b y cells, or the n u m b e r of molecules taken u p per cell, is the m o s t b i o l o g i c a l l y relevant w a y to present the data. Therefore, i n this chapter data w i l l be p r e s e n t e d i n b o t h ways.  F o r clarity, i n the f o l l o w i n g sections I w i l l i n c l u d e s m a l l d i a g r a m s of the o l i g o s used. B l a c k boxes represent the 9 b p core, hatched regions represent the consensus base a n d w h i t e regions represent n o n - c o n s e r v e d sequences.  35  Uptake Results and Discussion Is the 29 b p 'perfect' U S S sufficient for uptake? A n oligo (USS-1) w a s d e s i g n e d based o n the i n f o r m a t i o n i n F i g u r e 1.2. It contains a 9 b p core U S S a n d i n the 3' f l a n k i n g r e g i o n it contains the consensus base (the base that occurs m o s t frequently at that p o s i t i o n f o l l o w i n g a U S S i n the genome)  QJss-1 MMZ/Z^}  (g  e e  Table 2.3).  For consistency, I w i l l refer to the orientation of the U S S as presented i n F i g u r e 1.2. Sequences to the left of the 9 b p core w i l l be termed 5' a n d sequences to the r i g h t w i l l be referred to as 3'. In a d d i t i o n to USS-1 a negative c o n t r o l o l i g o (USS-R) w a s also d e s i g n e d . U S S - R is the same l e n g t h a n d base c o m p o s i t i o n as USS-1 b u t does not c o n t a i n a 9 b p core  [u " I ss  R  HI  (See Table 2.3). Since USS-1 contains the  consensus base at each p o s i t i o n i n the core a n d f l a n k i n g regions, I p r e d i c t e d that cells w o u l d b i n d a n d take it u p preferentially over U S S - R . U p t a k e of USS-1 a n d U S S - R was tested u s i n g nick translated H. influenzae a n d B. subtilis c h r o m o s o m a l D N A as positive a n d negative controls, r e s p e c t i v e l y . T h e results of this e x p e r i m e n t are s h o w n i n F i g u r e 3.1. F i g u r e 3.1 (a) s h o w s that USS-1 is not taken u p better than negative c o n t r o l D N A s . A p p r o x i m a t e l y 100 f o l d m o r e labeled H. influenzae c h r o m o s o m a l D N A w a s taken u p than a l l other D N A s . T h i s correlates w e l l w i t h p u b l i s h e d results [15].  F i g u r e 3.1 (b) represents u p t a k e expressed as n u m b e r s of m o l e c u l e s per cell. It is clear t h a t H . influenzae c h r o m o s o m a l D N A is taken u p better than B . subtilis c h r o m o s o m a l D N A . F r o m these data it appears that six f o l d m o r e m o l e c u l e s of USS-1 a n d U S S - R w e r e taken u p per cell than M A P 7 D N A . T h i s is because of the l e n g t h of the c h r o m o s o m a l D N A , w h i c h was a p p r o x i m a t e l y 20 k b (estimated b y electrophoresis). Since these c h r o m o s o m a l D N A fragments w e r e m u c h l o n g e r than the o l i g o , fewer m o l e c u l e s per cell were taken up. L i k e figure 3.1 (a) this figure s h o w s that USS-1 is not taken u p better than its negative c o n t r o l U S S - R .  36  Uptake Results and. Discussion  ©  100-  90 -|  90-  80  80-  70  Uptake 70(ng/ml) 60-  Uptake 60 (molecules/cell)  50-  50-1  40-  40-|  30-  30  20-  20  10-  1<H  oM A P 7 Bacillus  0  USS-1 USS-R  MAP7 Bacillus  ^ r USS-1 USS-R  Figure 3.1. Uptake of 'perfect' U S S oligo is not greater than an oligo that does not contain a U S S . 1 m l of freshly m a d e M I V competent cells were i n c u b a t e d w i t h 1 u g of D N A i n each case. U p t a k e procedures o u t l i n e d i n section 2.8 w e r e f o l l o w e d . T h e m e a n v a l u e of d u p l i c a t e trials are s h o w n a n d error bars represent the s t a n d a r d d e v i a t i o n b e t w e e n the samples. W h e r e error bars are not s h o w n the error w a s too s m a l l to g r a p h .  37  •  Uptake Results and Discussion  These results i m p l y that uptake b y H. influenzae requires m o r e than the presence of a U S S o h the D N A m o l e c u l e . T h u s , the p r e v i o u s a s s u m p t i o n that the 9 b p core U S S is necessary a n d sufficient for uptake [30] appears to be incorrect.  T w o p o s s i b l e explanations exist for the lack of r e c o g n i t i o n of U S S - 1 . First, sequence 5' to the core U S S m a y be necessary for h i g h levels of u p t a k e a n d s e c o n d , the 29 b p m o l e c u l e m a y be too short to be taken u p b y competent cells. If the first e x p l a n a t i o n is correct, p l a c i n g a U S S i n the m i d d l e of a 30 b p D N A fragment s h o u l d increase u p t a k e of the fragment over negative c o n t r o l levels. H o w e v e r , i f the s e c o n d e x p l a n a t i o n is correct, uptake s h o u l d be equal for a l l 30 b p fragments regardless of the p o s i t i o n of the U S S . E x p e r i m e n t s testing these t w o p o s s i b i l i t i e s are presented i n the f o l l o w i n g sections.  3.2 Effect of U S S position on b i n d i n g and uptake D o e s the p o s i t i o n of the U S S affect r e c o g n i t i o n a n d u p t a k e of D N A ? In this section I w i l l address this question a n d test the hypothesis that h i g h levels of u p t a k e require sequences 5' to the 9 b p core U S S . In m o s t of the f o l l o w i n g experiments i n this chapter, b o t h b i n d i n g a n d u p t a k e results w i l l be presented, because i n d e t e r m i n i n g h o w cells interact w i t h a D N A m o l e c u l e , b o t h the a m o u n t of D N A b o u n d a n d the p o r t i o n of the b o u n d D N A that is taken u p are i m p o r t a n t .  3.2.1 O l i g o n u c l e o t i d e s  3.2.1.1 Binding and uptake of 30 bp DNA fragments In o r d e r to address the p o s s i b i l i t y that sequences 5' to the core U S S are necessary for u p t a k e , a 30 b p oligo w a s designed. USS-30 is 30 b p i n length, contains a 9 b p core a n d i n part of the 3' f l a n k i n g r e g i o n it contains the U S S consensus base  38  Uptake Results and Discussion  [uss-301  wmz/Q  (See Table 2.3). U n l i k e U S S - 1 , USS-30 has 11 b p 5' to the 9  b p core a n d contains o n l y 10 b p of the 3' f l a n k i n g consensus (See T a b l e 2.3).  F i g u r e 3.2 s h o w s the results of b i n d i n g a n d u p t a k e e x p e r i m e n t s p e r f o r m e d u s i n g U S S - 3 0 , USS-1 a n d U S S - R . These data s h o w that, c o m p a r e d to USS-1 or U S S - R , b i n d i n g a n d u p t a k e are a p p r o x i m a t e l y three f o l d a n d t w o f o l d greater for U S S - 3 0 . T h i s i m p l i e s that nucleotides 5' to the U S S are necessary for u p t a k e .  3.2.1.2 Binding and uptake of 50 bp fragments T h e result o b t a i n e d w i t h USS-30 w a s further e x a m i n e d u s i n g l o n g e r o l i g o n u c l e o t i d e s . USS-50 is a 50 b p fragment w i t h 15 b p 5' to the 9 b p core a n d 26 b p 3  , [uSS-50  [ZI^Hi  I j]  (  S e e  T  a  b  i  e  2  . 3 ) . L i k e U S S - 1 , U S S - 5 0 contains the  consensus base i n the 3' f l a n k i n g r e g i o n . F o r ease of c l o n i n g it also c o n t a i n s Kpnl a n d EcoRI restriction sites at its ends.  I also d e s i g n e d a 50 b p o l i g o that consists of the 9 bp core s t a r t i n g one b p f r o m the 5' end  L__  =J a n d the consensus base at each p o s i t i o n m  the 3' f l a n k i n g r e g i o n (See Table 2.3). A negative c o n t r o l w a s also d e s i g n e d , U S S - 5 0 -  R  [uSS-50-R  (See Table 2.3). L i k e U S S - R , this o l i g o does  not c o n t a i n a U S S or f l a n k i n g consensus but has the same base c o m p o s i t i o n as U S S 50.  A s i n the p r e c e d i n g section, b o t h b i n d i n g a n d uptake were tested. F i g u r e 3.3 illustrates the results of these experiments. F i g u r e 3.3 (a) s h o w s that b i n d i n g decreases 1.5 f o l d w h e n the U S S is located at the 5' terminus a n d 12 f o l d w h e n the 9 b p core is absent. U n l i k e the 30 b p D N A fragments, p o s i t i o n i n g of the U S S at the 5' t e r m i n u s d i d not decrease b i n d i n g to negative c o n t r o l levels. C e l l s b o u n d 8.3 f o l d  39  Uptake Results and Discussion  -25  0.8" 0.7"  -20  0.6" 0.5 Binding (ng/ml)  0  -15  4  Binding  1  10  0.3  (molecules/cell)  0.21 0.1 0  ©  2.2' 2" 1.8 1.61.4Uptake 1.21 (ng/ml) 10.80.6" 0.4" 0.2-  USS-30  USS-1  USS-R  70 i  60  1  o-  1-50 \- 40 Uptake (molecules/cell)  r30  20 10 USS-30  USS-  USS-R  0  Figure 3.2. B i n d i n g and uptake o f 29 and 30 b p oligonucleotides b y competent cells. The m e a n value of duplicate trials are s h o w n a n d error bars represent the s t a n d a r d d e v i a t i o n b e t w e e n the samples. W h e r e error bars are n o t s h o w n the error w a s too s m a l l to g r a p h .  40  Uptake Results and Discussion  © Binding (ng/ml)  0.7  14  0.6-  -12  0.5-  -10  0.4-  - 8  0.3-  6  0.2-  - 4  o.i-  - 2  0  r~i  Binding (molecules/cell)  0  USS-50-Le USS-50 USS-50-R (left) (middle) (no U S S )  rl40  ©  120 "100 Uptake (ng/ml)  4  Uptake " 80 (molecules/cell)  -  3"  60  2'  40  r  20  0" USS-50-Le USS-50 (left) (middle)  USS-50-R (no U S S )  0  Figure 3.3. B i n d i n g and uptake of 50 bp oligonucleotides by competent H. influenzae cells. T h e m e a n value of duplicate trials are s h o w n a n d error bars represent the standard d e v i a t i o n between the samples. W h e r e error bars are not s h o w n the error w a s too s m a l l to graph.  41  Uptake Results and Discussion m o r e of U S S - 5 0 - L e than of the negative control USS-50-R. U p t a k e e x p e r i m e n t s i n p a r t (b) s h o w that u p t a k e of USS-50 a n d USS-50-Le were 3.2 a n d 2.2 f o l d greater t h a n the negative c o n t r o l levels, respectively.  These results, l i k e the results u s i n g the 30 b p D N A fragments, s h o w that the p o s i t i o n of the U S S w i t h i n a fragment affects uptake. In order for m a x i m a l u p t a k e to be a c h i e v e d , D N A m u s t have sequence 5' to the U S S (the m i n i m u m l e n g t h of 5' sequence n e e d e d for o p t i m a l uptake was not tested). H o w e v e r , u n l i k e the 30 b p o l i g o s , i f the 5' sequence is absent i n 50 b p m o l e c u l e s , u p t a k e a n d b i n d i n g are decreased b u t n o t a b o l i s h e d .  3.2.2 U p t a k e o f p l a s m i d D N A m o d i f i e d b y i n s e r t i o n of U S S s e q u e n c e s T h e results p r e s e n t e d above are based on changes of the p o s i t i o n the U S S w i t h i n short D N A fragments. T o determine if these results are a p p l i c a b l e to l o n g e r fragments, alteration of U S S placement w i t h i n a 3 k b fragment w a s tested. U S S - 1 w a s c l o n e d into the m u l t i p l e c l o n i n g site of p G E M 7 a n d the p l a s m i d w a s l i n e a r i z e d separately w i t h three restriction e n z y m e s Seal, Kpnl a n d Clal, s u c h that the U S S a n d f l a n k i n g consensus w e r e l o c a l i z e d to the m i d d l e , 5' a n d 3' ends r e s p e c t i v e l y . C l e a v a g e of the p l a s m i d w i t h Kpnl a n d Seal p l a c e d the U S S w i t h i n four bases of the 5' e n d a n d 30 b p of the 3' e n d , respectively, whereas a l l l i n e a r i z e d p l a s m i d s :  c o n t a i n e d the entire 3' f l a n k i n g consensus r e g i o n (Figure 3.4 a). T h e results of these u p t a k e e x p e r i m e n t s are s h o w n i n F i g u r e 3.4 (b).  P l a c e m e n t of the U S S near the 3' e n d or the m i d d l e of the linear p l a s m i d after cleavage w i t h Clal or Seal d i d not significantly affect uptake. U p t a k e of the linear p l a s m i d c o n t a i n i n g the U S S o n the 5' e n d was less than other fragments. T h i s is m o s t l i k e l y d u e to the p r o x i m i t y of the U S S to the 5' e n d . D e m o n s t r a t e d w i t h 30 a n d  42  ©  40-  ri8  35-  16  : 30-  M4  1  hi2  25-  10 Uptake (molecules/cell) 8  Uptake (ng/ral)  2 0  :  ~  15-  - 6  10-  - 4  5-  - 2  o-^  0 Left  Middle  Rieht  (Kpnl)  (Seal)  (ClaJ)  F i g u r e 3.4. U p t a k e of c l o n e d U S S - 1 . a) Schematic d i a g r a m of c l o n e d U S S - 1 . 9 b p core U S S is s h o w n i n b o l d . E x t e n d e d consensus sequence is u n d e r l i n e d . C u t sites are s h o w n w i t h a n a r r o w . Seal cut site is a p p r o x i m a t e d . b) U S S - 1 w a s c l o n e d into p G E M 7 - digested w i t h the i n d i c a t e d e n z y m e s a n d end-labeled. O n e u g of 3 kb linear D N A was i n c u b a t e d w i t h cells as o u t l i n e d i n section 2.8. T h e m e a n v a l u e of duplicate trials are s h o w n a n d error bars represent the s t a n d a r d d e v i a t i o n between the samples. W h e r e error bars are n o t s h o w n the error w a s too s m a l l to graph.  43  Uptake Results and Discussion 50 b p fragments, nucleotides 5' to the U S S are necessary for efficient u p t a k e . F r o m these results I c o n c l u d e d that the necessity of 5' sequence for m a x i m a l u p t a k e of U S S c o n t a i n i n g D N A s applies to l o n g D N A fragments as w e l l as short oligos.  3.3 L e n g t h d e p e n d e n c e of u p t a k e : Is U S S - 1 too short to b e t a k e n u p ? I tested the p o s s i b i l i t y that the l o w uptake of USS-1 w a s because a 29 b p fragment w a s too short to be r e c o g n i z e d a n d taken u p b y cells. If this e x p l a n a t i o n w e r e correct a 29-30 b p fragment s h o u l d not be taken u p b y cells regardless of the p o s i t i o n of the U S S . A s demonstrated i n section 3.2.1.1 this is not the case. T h u s , i f 29-30 b p is l o n g e n o u g h to be taken u p b y cells, then uptake s h o u l d be s i m i l a r for 30, 40 a n d 50 b p fragments c o n t a i n i n g USSs i n the m i d d l e . T h i s p r e d i c t i o n w a s tested b y use of a 40 b p o l i g o , d e s i g n e d to c o n t a i n 11 bases 5' to the U S S core a n d the consensus bases i n the 3' f l a n k i n g r e g i o n  [uss-4oi  mw/zzx^  F i g u r e 3.5 s h o w s the results of uptake experiments. F i g u r e 3.5 (a) s h o w s that the a m o u n t of D N A taken u p per m l of cells increases as the l e n g t h of the D N A fragments increase. T h i s resembles the f i n d i n g that m o r e c h r o m o s o m a l D N A is t a k e n u p than short oligos o n a mass basis. H o w e v e r , w h e n these data are p r e s e n t e d as n u m b e r s of m o l e c u l e s per cell it appears that u p t a k e is e q u a l for each o l i g o . T h i s indicates that USS-30 is l o n g e n o u g h to be taken u p b y cells. T h u s the l i k e l y r e a s o n for l o w u p t a k e of USS-1 is due to the absence of sequences 5' to the USS. F r o m F i g u r e 3.5 (b);it appears that 30 molecules of U S S - R are taken u p per cell. T h i s is l i k e l y a case of non-specific interaction of U S S - R w i t h the cells. A l i p o p o l y s a c c h a r i d e layer covers gram-negative bacteria [89,90], a n d so I speculate that this a p p a r e n t u p t a k e m a y be a consequence of D N A that has b e c o m e  44  Uptake. Remits and Discussion  ©  © 160  -  71  140'  Uptake 6 (ng/ml) 5"  Uptake 1201 (molecules/cell) 100'  4"  80'  3 -  601  2  40  1 0  1  201 0  T  USS-50 USS-40 USS-30  USS-R  USS-50 USS-40 USS-30  USS-R  Figure 3.5. Uptake of different length oligos. T h e m e a n v a l u e of duplicate trials are s h o w n a n d error bars represent the standard d e v i a t i o n between the samples. W h e r e error bars are not s h o w n the error was too s m a l l to g r a p h .  45  Uptake Results and Discussion i n t e r t w i n e d w i t h the l i p o p o l y s a c c h a r i d e layer m a k i n g it inaccessible to D N a s e I. If this is the case, then D N A w o u l d appear to be taken u p b y cells w h e n i n fact it is s i m p l y b o u n d to the l i p o p o l y s a c c h a r i d e r e g i o n of the outer m e m b r a n e . T h e e x p l a n a t i o n for this apparent uptake was not d i r e c t l y tested a l t h o u g h , section 3.5.1 addresses this indirectly.  3.4 E f f e c t o f 3 ' c o n s e n s u s f l a n k i n g sequence o n DNA b i n d i n g a n d u p t a k e T h i s section outlines experiments that tested h o w c h a n g i n g b o t h the l e n g t h a n d base c o m p o s i t i o n of the 3' f l a n k i n g r e g i o n affects uptake.  3.4.1 B i n d i n g and uptake of 50 b p oligos containing the non-consensus bases i n the 3' f l a n k i n g region. U p t a k e of a D N A fragment increases w h e n the U S S is f l a n k e d b y a n A / T r i c h sequence [30, 91]. These experiments, p e r f o r m e d before the H. influenzae g e n o m e w a s sequenced, tested n a t u r a l l y o c c u r r i n g a n d artificially d e s i g n e d sequences. T o test the effect of base c o m p o s i t i o n o n uptake, a 50 b p oligo w a s s y n t h e s i z e d (USS-50R C ) . T h i s o l i g o contains a 9 b p core USS. H o w e v e r , this oligo instead of c o n t a i n i n g  E  the consensus bases i n the f l a n k i n g r e g i o n has the least c o m m o n base at each  SS  p o s i t i o n (shaded region)  50  ~ I RC  HZE^K^MIMMM, ZZ\  T| ^ g  e e  y/  a r j  i  e  2.3).  For  direct c o m p a r i s o n of the effect of the 3' sequence, the sequence 5' to the U S S is i d e n t i c a l to USS-50. T h e results of uptake a n d b i n d i n g experiments are i l l u s t r a t e d i n F i g u r e 3.6.  F i g u r e 3.6 (a) s h o w s that b i n d i n g of USS-50 w a s 2 f o l d greater than for U S S - 5 0 - R C a n d 2.8 f o l d greater than USS-50-R. B i n d i n g of U S S - 5 0 - R C was. 1.4 f o l d greater than USS-50-R. U p t a k e of USS-50 w a s 2.3 f o l d greater than u p t a k e of U S S - 5 0 - R C , w h e r e a s U S S - 5 0 - R C w a s taken u p 2.3 f o l d better than USS-50-R. F r o m these results  46  Uptake Results and Discussion  0.6"  ho  0.5"  8  0.4" Binding (ng/ml) 0.3-  Binding 6 (molecules/cell)  h  0.2"  4 2  o.i0  ®  0  J  USS-50 U S S - 5 0 - R C USS-50-R  8"  "140  7"  "120  6"  -100 _ Uptake (molecules/cell)  Uptake 5" (ng/ml) .  8  4  3"  "40  1-  o-  60  b  2"  n  - 20 USS-50 U S S - 5 0 - R C USS-50-R  0  F i g u r e 3.6. B i n d i n g a n d u p t a k e of 50 b p o l i g o s . USS-50 contains the U S S i n the m i d d l e of the D N A fragment. U S S - 5 0 - R C contains the U S S i n the m i d d l e of the fragment b u t contains the least c o m m o n nucleotide at each p o s i t i o n i n the 3' f l a n k i n g consensus region. USS-50-R does not c o n t a i n a U S S . T h e m e a n v a l u e of duplicate trials are s h o w n a n d error bars represent the standard d e v i a t i o n between the samples. W h e r e error bars are not s h o w n the error was too s m a l l to g r a p h . 47  Uptake Results and.Discussion I c o n c l u d e that cells are able to take u p D N A s c o n t a i n i n g the least c o m m o n base i n the 3' f l a n k i n g consensus r e g i o n , a l t h o u g h at a m u c h l o w e r level than D N A c o n t a i n i n g a n A / T r i c h f l a n k i n g region. These data agree w e l l w i t h p r e v i o u s results of a n a l y s i s of the effect of G / C f l a n k i n g richness o n uptake [30,91].  O n e reason p u t f o r w a r d to e x p l a i n the greater uptake of D N A c o n t a i n i n g A / T r i c h f l a n k i n g sequences w a s that the receptor m a k e s contact w i t h the m i n o r g r o o v e of the i n c o m i n g D N A [30]. In the m i n o r groove, A / T base pairs differ f r o m G / C pairs b y the absence of the centrally located 2-amino g r o u p of g u a n i n e [92]. It is t h o u g h t that after the receptor contacts the D N A it m a y i n d u c e p a r t i a l m e l t i n g i n the r e g i o n of the 9 b p core, a process facilitated b y the l o w e r m e l t i n g p o i n t of A + T - r i c h D N A [30].  3.4.2 B i n d i n g a n d u p t a k e o f D N A l a c k i n g sequences 3' to the 9 b p core T h e p r e v i o u s section i l l u s t r a t e d that base c o m p o s i t i o n of the 3' f l a n k i n g r e g i o n affects u p t a k e . T o further explore this, I e x a m i n e d h o w the absence of 3' sequence affects u p t a k e . A 50 b p oligo (USS-50-Ri) was d e s i g n e d that c o n t a i n e d a 9 b p core at the 3' t e r m i n u s . T o m a i n t a i n fragment l e n g t h a n d the same base c o m p o s i t i o n as U S S - 5 0 , sequences 3' of the core i n USS-50 w e r e p l a c e d 5' to the core of U S S - 5 0 - R i [uSS-50-Ri I  ~  ^Mj]  It w a s p r e d i c t e d that r e m o v a l of the 3' f l a n k i n g  consensus sequence w o u l d decrease the cell's ability to b i n d a n d take u p the o l i g o . T h e results of b i n d i n g a n d uptake experiments are presented i n F i g u r e 3.7.  These results s h o w that D N A l a c k i n g 3' sequence is not b o u n d or taken u p better t h a n a negative control. B i n d i n g of U S S - 5 0 - R i was o n l y s l i g h t l y better (1.4 fold) than USS-50-R. U p t a k e of USS-50 w a s 6.8 fold greater than U S S - 5 0 - R i . U S S - 5 0 - R w a s  48  Uptake Results and Discussion  © 0.6 0.5 Binding (ng/ml)  12  i  ho  1  9  0.4 Q  8 Binding 7 (molecules/cell) 6  J  3  f  0.2 H 0.1  5 4 3  1 USS-50  2 1 0  USS-50 R i U S S - 5 0 - R (USS 3') (no U S S )  ©  -160 -140 -120  6 Uptake (ng/ml)  a  " ° Uptake - go (molecules/cell) 1 0  h 60  3  21  40  h 20 0 USS-50  U S S - 5 0 - R i USS-50-R (USS 3') (no U S S )  F i g u r e 3.7. B i n d i n g a n d u p t a k e o f 50 b p o l i g o s . USS-50 contains the U S S i n the m i d d l e of the D N A fragment. U S S - 5 0 - R i contains the U S S at the 3' terminus. U S S - 5 0 - R does not contain a U S S . T h e m e a n value of duplicate trials are s h o w n a n d error bars represent the standard d e v i a t i o n between the samples. W h e r e error bars are not s h o w n the error was too s m a l l to g r a p h .  49  Uptake Results and Discussion t a k e n u p 1.3 f o l d better than U S S - 5 0 - R i . These results i n d i c a t e that the absence of 3' f l a n k i n g sequence decreases b i n d i n g to n e a r l y the negative c o n t r o l levels a n d c o m p l e t e l y abolishes uptake. I c o n c l u d e that sequences 3' to the core U S S are a b s o l u t e l y r e q u i r e d for uptake.  3.5 C o m p e t i t i o n of v a r i o u s D N A s f o r u p t a k e of c h r o m o s o m a l  DNA  A s a different k i n d of test of the ability of v a r i o u s D N A s to be b o u n d a n d t a k e n u p b y c o m p e t e n t H. influenzae cells, c o m p e t i t i o n tests were p e r f o r m e d . T h i s assay w a s u s e d to test w h e t h e r or not the b i n d i n g a n d uptake results d e s c r i b e d i n the p r e c e d i n g sections w e r e representative of actual b i n d i n g a n d u p t a k e b y cells. The general basis of a c o m p e t i t i o n assay is that a labeled D N A fragment, specifically t a k e n u p b y cells, is i n c u b a t e d w i t h cells i n the presence or absence of u n l a b e l e d c o m p e t i n g D N A s (See F i g u r e 3.8). W e can consider t w o cases. First, i f u n l a b e l e d D N A s are taken u p b y cells a n d there are a l i m i t e d n u m b e r of receptors per cell, the u n l a b e l e d D N A w i l l compete w i t h the labeled D N A for access to receptors a n d decrease the a m o u n t of labeled D N A taken u p (Figure 3.8 b). I n the s e c o n d case, i f the u n l a b e l e d D N A is not taken u p b y cells, c o m p e t i t i o n for access to the receptor w i l l not occur a n d labeled D N A w i l l be taken u p at a h i g h level (Figure 3.8 a a n d c). U s i n g this m o d e l , I expect that D N A s taken u p b y cells i n the p r e v i o u s sections s h o u l d compete for uptake of labeled M A P 7 a n d those that w e r e not taken u p s h o u l d not.  50  Uptake Results and Discussion (1^ No competing D N A  .yy^yy'  4 labeled molecules taken up  (2) Specific competitor  -yy^yy  2 labeled molecules and 2 unlabeled molecules taken up  (^^Non-specific competitor  4 labeled molecules taken up  ^ ^ ^ ^  Labeled DNA containing a USS Unlabeled competing DMA containing a USS Unlabeled competng DNA without a USS  Figure 3.8 Schematic representation of a competition assay. a) C e l l s are incubated w i t h labeled D N A containing a U S S . C e l l s take-up 4 molecules of labeled D N A . b) C e l l s are incubated w i t h labeled D N A containing a U S S and unlabeled D N A that also contains a USS. A s a result of competitionfor access to the receptor, cells o n l y take u p 2 molecules of labeled D N A . c) C e l l s are incubated w i t h labeled D N A containing a U S S a n d u n l a b e l e d D N A that does not contain a USS. Since the competing D N A does not contain a U S S cells are able to take-up 4 molecules of labeled D N A .  51  Uptake Results and Discussion 3.5.1  C o m p e t i t i o n b e t w e e n c h r o m o s o m a l D N A and 2 9 b p fragments  L a b e l e d M A P 7 c h r o m o s o m a l D N A ( l p g , a p p r o x i m a t e l y 20 kb) a n d u n l a b e l e d c o m p e t i n g D N A s ( M A P 7 , E. coli D H 5 a , USS-1 a n d U S S - R ) w e r e m i x e d i n tubes p r i o r to the a d d i t i o n of competent cells. C e l l s were i n c u b a t e d w i t h the D N A s for 10 m i n u t e s a n d the general uptake p r o c e d u r e w a s f o l l o w e d . F i g u r e 3.9 s h o w s the results of this experiment. U n l a b e l e d M A P 7 D N A competes for u p t a k e of labeled M A P 7 D N A . This is expected because M A P 7 D N A is specifically b o u n d a n d taken u p b y competent H. influenzae cells. DH5oc c h r o m o s o m a l D N A a n d U S S - R d o not interfere w i t h uptake of M A P 7 D N A . T h i s is also e x p e c t e d since these D N A s are not taken u p b y cells. USS-1 competes w e a k l y w i t h uptake of M A P 7 c h r o m o s o m a l D N A better than U S S R. T h i s is s u r p r i s i n g since figure 3.2 shows that USS-1 is not b o u n d or taken u p better t h a n U S S - R . T h i s c o m p e t i t i o n m i g h t arise if USS-1 is b o u n d w e a k l y b y the receptor. It w a s t h e o r i z e d b y D e i c h a n d S m i t h (1980) that D N A u p t a k e occurs i n three stages [29]. T h e first is w e a k / r e v e r s i b l e b i n d i n g of D N A b y receptors. T h e s e c o n d step is s t r o n g / i r r e v e r s i b l e b i n d i n g i n w h i c h the D N A is c o m m i t t e d to u p t a k e . T h e t h i r d step is the c o n v e r s i o n of D N A into a D N a s e resistant, n o n elutable f o r m . T h u s , i f USS-1 is able to be b o u n d w e a k l y b y the receptor it w o u l d interfere w i t h uptake of labeled M A P 7 D N A .  3 . 5 . 2 C o m p e t i t i o n b e t w e e n c h r o m o s o m a l D N A fragments a n d 50 b p  fragments  U s i n g the same assay as above, the ability of 50 b p fragments to compete for u p t a k e of 20 k b c h r o m o s o m a l D N A was s t u d i e d . F i g u r e 3.10 s h o w s that USS-50 a n d U S S 50-Le compete for uptake of labeled c h r o m o s o m a l D N A , h o w e v e r , U S S - 5 0 - R C , U S S 5 0 - R i a n d U S S - 5 0 - R d o not.  52  Uptake Results and  100 n  Disrussinn  10  in  Uptake of chromosomal DNA (ng/ml)  Uptake of chromosomal DNA  (molecules/cell)  lo-  MAP7  DH5a  USS-1  USS-R  Competing D N A s • 0 LJg competing D N A ED 1 jag competing D N A H  4 |ig competing D N A  H  20 iag competing D N A  Figure 3.9. DNA.  Competition for uptake of labeled chromosomal  C o m p e t i n g D N A s were m i x e d w i t h 1 p g of l a b e l e d M A P 7 D N A p r i o r to the a d d i t i o n of cells. U p t a k e of the l a b e l e d D N A w a s m e a s u r e d b y the s t a n d a r d assay. T h e m e a n value of duplicate trials are s h o w n a n d error bars represent the s t a n d a r d d e v i a t i o n b e t w e e n the samples. W h e r e error bars are not s h o w n the error w a s too s m a l l to g r a p h .  53  Uvtake Remits and Discussion  lOOi  rlO  rii Uptake of  Uptake of chromosomal DNA (molecules/cell)  chromosomal DNA (ng/ml)  icH  hi  0*  EC Q  C/3  in 73  73  :S. 'J~.  Competing D N A s Q  0 ng competing DNA  ™  1 ^g competing DNA  ^  4 ng competing DNA  El  20 (ig competing DNA  F i g u r e 3.10. C o m p e t i t i o n for u p t a k e o f l a b e l e d c h r o m o s o m a l DNA. C o m p e t i n g D N A s w e r e m i x e d w i t h 1 u g of l a b e l e d M A P 7 D N A p r i o r to the a d d i t i o n of cells. U p t a k e of the labeled D N A w a s m e a s u r e d b y the standard assay. T h e m e a n v a l u e of duplicate trials are s h o w n a n d error bars represent the standard d e v i a t i o n between the samples. W h e r e error bars are not s h o w n the error was too s m a l l to g r a p h .  54  Uptake Results and Discussion  :  T h i s i n f o r m a t i o n correlates w e l l w i t h the i n f o r m a t i o n i n F i g u r e 3.9 w h i c h s h o w s that sequence 5' to the U S S is not n e e d e d for c o m p e t i n g D N A s to interfere w i t h the u p t a k e of c h r o m o s o m a l D N A . H o w e v e r , sequence 3' to the 9 b p core is n e e d e d , a n d m u s t be A / T r i c h if a D N A molecule is to compete. V a r i a t i o n s i n the counts due to i n c o m p l e t e r e m o v a l of labeled M A P 7 D N A f r o m cells c o u l d account for the a p p a r e n t increase i n uptake of labeled M A P 7 c h r o m o s o m a l D N A i n the presence of USS-50-R a n d U S S - 5 0 - R C .  3.6 Discussion of uptake results. E x p e r i m e n t a l investigations of D N A b i n d i n g a n d uptake, p r i o r to c o m p l e t i o n of the H. influenzae g e n o m e sequence, i n d i c a t e d that b i n d i n g is saturable, r e v e r s i b l e a n d specific. T h i s suggested that a receptor p r o t e i n , or c o m p l e x of p r o t e i n s , are r e s p o n s i b l e for the o b s e r v e d sequence specific uptake [41]. In this thesis I h a v e a t t e m p t e d to e x p a n d o n p r e v i o u s results, g u i d e d b y i n f o r m a t i o n g a i n e d f r o m the s e q u e n c i n g of the H. influenzae genome. T h r o u g h o u t this thesis I have addressed a n u m b e r of questions i n a n attempt to assemble a m o d e l of preferential uptake of D N A i n H. influenzae. T h e general focus of these research questions address the i m p o r t a n c e of f l a n k i n g sequence o n uptake, i n a n attempt to determine h o w proteins that m a k e u p the receptor interact w i t h the D N A m o l e c u l e . U S S s w i t h i n the genome are f l a n k e d b y regions of c o n s e r v e d sequence. W i t h this i n f o r m a t i o n I d e s i g n e d oligos w i t h v a r i a t i o n s i n these f l a n k i n g regions. O l i g o s w e r e v a r i e d i n b o t h length a n d c o m p o s i t i o n of 3' a n d 5' f l a n k i n g sequence. I have been able to s h o w that nucleotides 5' to the U S S are r e q u i r e d for h i g h levels of b i n d i n g a n d uptake of D N A h o w e v e r , the l e n g t h a n d base c o m p o s i t i o n of the 5' r e g i o n w a s not tested. A l s o , I have s h o w n that b o t h l e n g t h a n d base c o m p o s i t i o n of the 3' f l a n k i n g r e g i o n greatly affect b i n d i n g a n d uptake. If  55  .  _/  Uptake Results and Discussion  sequence 3' to the U S S is G / C r i c h , uptake proceeds at a v e r y l o w level. H o w e v e r , if D N A l a c k s a 3' sequence, b o t h b i n d i n g a n d uptake are abolished.  3.7 Further research M a n y questions c o n c e r n i n g the effect of f l a n k i n g D N A o n b i n d i n g a n d u p t a k e remain unanswered.  I w i l l briefly cover two points that m a y be a d d r e s s e d i n the  future. First, o l i g o s c o n t a i n i n g a single b p 5' to the U S S , a n d p l a s m i d s that c o n t a i n 4 b p 5' to the U S S , are not taken u p at w i l d t y p e levels b y cells. O n e q u e s t i o n to address c o u l d be: W h a t is the m i n i m u m length of the 5' sequence n e e d e d for h i g h levels of u p t a k e to occur? Second, one can ask: H o w does a G / C r i c h 5' f l a n k i n g sequence affect uptake, if the 3' f l a n k i n g consensus is A / T rich? If the D N A is d e n a t u r e d 5' to the U S S then increasing the G / C richness w i l l decrease uptake, as it does i n the 3' f l a n k i n g r e g i o n . H o w e v e r , if denaturation does not occur i n the 5' r e g i o n u p t a k e s h o u l d not be affected.  56  Crosslinking Results and Discusion  CHAPTER FOUR U V Laser Crosslinking Crosslinking labeled DNA to the receptor. U V laser c r o s s l i n k i n g is a p o w e r f u l technique to s t u d y D N A - p r o t e i n interactions. T h e d e s i g n of m y c r o s s l i n k i n g experiments was s i m p l e . L a b e l e d D N A w a s i n c u b a t e d w i t h competent cells. Samples were i r r a d i a t e d w i t h three to six pulses f r o m the laser, then b o i l e d i n s a m p l e buffer. Proteins were separated b y p o l y a c r y l a m i d e gel electrophoresis, stained w i t h either coomassie b l u e or silver a n d e x p o s e d to a p h o s p h o i m a g e r screen. V a r i a b l e s adjusted w e r e the t i m e of i n c u b a t i o n w i t h D N A a n d also the presence or absence of u n l a b e l e d c o m p e t i n g D N A s . T h i s chapter outlines the results attained i n attempting to c r o s s l i n k D N A to the H. influenzae receptor p r o t e i n .  4.1 Time interval for uptake of USS-50 F o r U V l i g h t to c r o s s l i n k the receptor to D N A , the pulses m u s t be d e l i v e r e d w h e n the t w o m o l e c u l e s are i n contact. To a p p r o x i m a t e w h e n the D N A contacted the receptor, I tested w h e n uptake begins a n d for h o w l o n g uptake proceeds. P r e v i o u s e x p e r i m e n t s h a v e d e m o n s t r a t e d that uptake of c h r o m o s o m a l D N A is c o m p l e t e w i t h i n 5 m i n u t e s [15, 29]. H o w e v e r , this h a d not been tested w i t h v e r y short D N A molecules.  F i g u r e 4.1 s h o w s that uptake of USS-50 begins s o o n after i n c u b a t i o n w i t h cells. The D N a s e pre-treatment p o i n t corresponds to D N A b e i n g treated w i t h D N a s e for 10 m i n u t e s p r i o r to i n c u b a t i o n w i t h cells. Little D N A is taken u p i n the first m i n u t e a n d  57  Crosslinking Remits and Discussion  r 100  Uptake (ng/ml)  Uptake (molecules/cell)  h 10  DNase pre-treatment  Time of incubation (minutes)  F i g u r e 4.1. U p t a k e of l a b e l e d U S S - 5 0 as a f u n c t i o n of t i m e . C e l l s w e r e i n c u b a t e d w i t h l u g of labeled USS-50 for v a r i o u s time intervals, preceeded or f o l l o w e d b y treatment w i t h D N a s e I as o u t l i n e d i n section 2.8.  58  .  Crosslinking Results and Discusion  u p t a k e is c o m p l e t e after 10 minutes. F r o m this data I c o n c l u d e d that i r r a d i a t i o n of s a m p l e s s h o u l d take place before 10 m i n u t e s , p r i o r to c o m p l e t i o n of u p t a k e .  4.2 Does crosslinking increase the amount of D N A associated w i t h cells? T o isolate the receptor, laser c r o s s l i n k i n g m u s t create c r o s s l i n k s b e t w e e n l a b e l e d D N A a n d outer m e m b r a n e proteins. T o test if this was possible, D N A w a s i n c u b a t e d w i t h cells w i t h a n d w i t h o u t i r r a d i a t i o n from the laser, a n d the a m o u n t of D N A b o u n d to the outside of cells w a s studied. C e l l s were first i n c u b a t e d w i t h D N A . A t specified times (10 sec, 1 m i n a n d 30 m i n ) laser pulses w e r e d e l i v e r e d to i n d i v i d u a l samples. After i n c u b a t i o n , cells were w a s h e d a n d the a m o u n t of D N A able to be r e m o v e d b y D N a s e treatment w a s tested. I p r e d i c t e d that if U V l i g h t c a u s e d the f o r m a t i o n of crosslinks, then the a m o u n t of D N A b o u n d to the o u t s i d e of cells s h o u l d be increased b y i r r a d i a t i o n . The results are s h o w n i n F i g u r e 4.2. T h e a m o u n t of D N A b o u n d to the surface of cells (i.e. accessible to D N a s e I) was i n c r e a s e d b y i r r a d i a t i o n after 10 seconds a n d 1 m i n u t e of i n c u b a t i o n . H o w e v e r , i r r a d i a t i o n after 30 m i n u t e s of i n c u b a t i o n d i d not increase the a m o u n t of D N A b o u n d , c o m p a r e d to the n o n - i r r a d i a t e d control. These results i n d i c a t e that U V i r r a d i a t i o n increases the a m o u n t of D N A b o u n d to the o u t s i d e of cells at short but not l o n g i n c u b a t i o n times.  T h e increase i n the a m o u n t of D N A b o u n d to cells at short i n c u b a t i o n times is m o s t l i k e l y a result of D N A b e i n g i n contact w i t h the receptor at those time p o i n t s . A s is s h o w n i n F i g u r e 4.1, after 30 m i n u t e s cells have c o m p l e t e d u p t a k e of D N A , a n d so w h e n these cells w e r e i r r a d i a t e d there was little i f any D N A b o u n d to the o u t s i d e of cells.  59  Crnsslinkiw Results and Discussion  0.25-1  LOO  0.2-  h75  Binding of USS-50  Q.15H  (ng/50 ul cells)  r- 50  Binding of USS-50 (molecules/cell)  0.H  h 25  0.05H  i No X-link  1  10 sec.  1  1 min.  r  30 min.  Timing of mediation  Figure 4.2. Crosslinking increases the amount of D N A associated with the outside of cells. C e l l s (50 u l ) w e r e i n c u b a t e d w i t h 0.05 u g of l a b e l e d U S S - 5 0 , then i r r a d i a t e d w i t h a laser p u l s e at the i n d i c a t e d times. D N A w a s r e m o v e d f r o m the outside of cells b y treatment w i t h D N a s e I a n d h i g h salt washes.  60  Crosslinking Results and Discusion  4.3 Crosslinking using labeled USS-50 Initial c r o s s l i n k i n g experiments u s e d e n d labeled USS-50 as the 'bait'. A short oligo w a s u s e d , rather than l a b e l e d c h r o m o s o m a l D N A , i n a n attempt to m i n i m i z e the a m o u n t of non-specific c r o s s l i n k i n g (see F i g u r e 4.3). C o m p e t i n g D N A w a s u s e d i n the f o l l o w i n g experiments to differentiate b e t w e e n sequence-specific a n d nonspecific crosslinking. If cells are i n c u b a t e d w i t h e q u a l a m o u n t s of l a b e l e d a n d u n l a b e l e d D N A that are specifically r e c o g n i z e d , the u n l a b e l e d D N A s h o u l d compete w i t h the labeled D N A for access to the receptor. T h i s c o m p e t i t i o n w o u l d l e a d to a decrease i n the a m o u n t of label associated w i t h p r o t e i n s that b i n d D N A i n a sequence specific manner. H o w e v e r , if u n l a b e l e d c o m p e t i n g D N A is not r e c o g n i z e d there w i l l be no change i n the a m o u n t of label associated w i t h the receptor. Further to this, w h e n a c o m p e t i n g D N A is u s e d that is n o t r e c o g n i z e d b y cells, less label s h o u l d become associated w i t h proteins that b i n d D N A i n d e p e n d e n t of its sequence. F i g u r e 4.4 s h o w s the results of c r o s s l i n k i n g e x p e r i m e n t s p e r f o r m e d u s i n g USS-50. T w o c o m p e t i n g D N A s w e r e u s e d i n these e x p e r i m e n t s , one that w o u l d compete w i t h labeled USS-50 for access to the receptor ( u n l a b e l e d USS-50) a n d another that w o u l d not (unlabeled U S S - R ) . T o m i n i m i z e the a m o u n t of b a c k g r o u n d , a serial d i l u t i o n of labeled USS-50 w a s u s e d i n c r o s s l i n k i n g experiments.  T h e m i g r a t i o n of D N A i n a p o l y a c r y l a m i d e gel changes w h e n it is b o u n d to a p r o t e i n [93, 94], so I expected that these short D N A fragments s h o u l d m i g r a t e m o r e s l o w l y w h e n c r o s s l i n k e d to a protein. H o w e v e r , the n o n - c r o s s l i n k e d D N A i n lane 9 m i g r a t e s no faster than the c r o s s l i n k e d bands i n lanes 1-8. F r o m this I c o n c l u d e d that c r o s s l i n k i n g h a d not o c c u r r e d a n d the b a n d s seen i n lanes 1-8 w e r e m o s t l i k e l y un-reacted l a b e l e d D N A . N o other bands w e r e v i s i b l e i n the i m a g e p r o d u c e d b y the p h o s p h o i m a g e r screen  61  Crosslinkinv Results and Discussion  Figure 4.3. Representationof hypothetical crosslinking u s i n g short and long D N A fragments. 1. L o n g n i c k translated c h r o m o s o m a l D N A u s e d i n c r o s s l i n k i n g experiments has a h i g h p r o b a b i l i t y of c o m i n g into contact w i t h a n d b e c o m i n g c r o s s l i n k e d to non-receptor m e m b r a n e proteins. 2. Short oligonucleotides i n c r o s s l i n k i n g experiments are less l i k e l y to come into contact w i t h non-receptor m e m b r a n e proteins.  62  Crosslink™? Results and Discussion  Figure 4.4. C r o s s l i n k i n g U S S - 5 0 to w i l d - t y p e H . influenzae c e l l s . P h o s p h o r i m a g e r detection of P r a d i o a c t i v i t y associated w i t h b a n d s i n a n S D S P A G E gel. N u m b e r s represent the a m o u n t of D N A i n c u b a t e d w i t h cells p r i o r to c r o s s l i n k i n g . Dashes indicate no D N A a d d e d . L a b e l e d U S S - 5 0 (lanes 1-4) w a s crosslinked to competent K W 2 0 cells (50 pl) i n the presence of c o m p e t i n g u n l a b e l e d D N A (USS-50, l a n e d 5 a n d 7; U S S - 5 0 - R , lanes 6 a n d 8. C r o s s l i n k i n g was p e r f o r m e d after 1 m i n u t e of i n c u b a t i o n of cells w i t h D N A . L a n e 9 contains labeled USS-50 l o a d e d d i r e c t l y onto the gel. 3 3  63  ,  Crosslinking Results and Discusion  4.4 Crosslinking following varied times of incubation I n i t i a l attempts d i d not p r o d u c e e n o u g h c r o s s l i n k i n g to a l l o w v i s u a l i z a t i o n of labeled p r o t e i n s , p e r h a p s because the receptor a n d D N A were not i n contact at the time of i r r a d i a t i o n . T h i s c o u l d be because the D N A h a d not yet contacted the receptor or because it h a d a l r e a d y been i n t e r n a l i z e d w h e n the laser pulses w e r e d e l i v e r e d . T o c o n t r o l for this, the time of i n c u b a t i o n w a s v a r i e d . D N A s w e r e i n c u b a t e d w i t h cells for either 10 seconds, 1 m i n u t e or 30 minutes p r i o r to c r o s s l i n k i n g . Different D N A s w e r e also u s e d i n case some m i g h t p r o v i d e a better substrate for c r o s s l i n k i n g than others. USS-50, USS-1 a n d M A P 7 c h r o m o s o m a l D N A w e r e u s e d i n the f o l l o w i n g c r o s s l i n k i n g experiments. The results are s h o w n i n F i g u r e 4.5. C r o s s l i n k i n g u s i n g H. influenzae c h r o m o s o m a l D N A (MAP7) s h o w e d a h i g h m o l e c u l a r w e i g h t streak i n the 10 second, 1 m i n u t e a n d 30 m i n u t e lanes (lanes 2, 5 a n d 8). Since this b a n d was also visible i n the n o n - c r o s s l i n k e d lane I c o n c l u d e d it w a s l i k e l y d u e to either i n c o r p o r a t i o n into the c h r o m o s o m e or s i m p l y r e - i s o l a t i o n of i n p u t D N A . It has been d e m o n s t r a t e d that integration of D N A into the c h r o m o s o m e can take place w i t h i n 10 m i n u t e s of i n c u b a t i o n w i t h cells [41]. T h o u g h i r r a d i a t e d samples w e r e p l a c e d o n ice after c r o s s l i n k i n g , cells w e r e stored for u p to 30 m i n u t e s p r i o r to b o i l i n g i n S D S . T h i s m a y have a l l o w e d time for the D N A to integrate into the c h r o m o s o m e . V a r i a t i o n i n the i n t e n s i t y of b a n d s c o u l d h a v e arisen d u e to differences i n uptake b y cells.  C r o s s l i n k i n g u s i n g USS-1 (lanes 3, 6, a n d 9) d i d not p r o d u c e a n y bands. T h i s is m o s t l i k e l y d u e to l o w uptake of the USS-1 oligo, o u t l i n e d i n section 3.1.1.  U s e of USS-50 as the 'bait' i n c r o s s l i n k i n g experiments gave a h i g h m o l e c u l a r w e i g h t b a n d present i n lanes 1 a n d 4 that is not present i n the n o n - c r o s s l i n k e d lane (lane 10).  64  Crosslinking Results and Discussion  10 seconds 1  1 minute 1  30 minutes 1  non-crosslinked i  F i g u r e 4.5. C r o s s l i n k i n g e x p e r i m e n t s u s i n g U S S - 5 0 , USS-1 a n d M A P 7 D N A s as b a i t P h o s p h o r i m a g e r detection of P radioactivity associated w i t h b a n d s i n a n S D S - P A G E gel. T h e u p p e r a n d l o w e r panels represent h i g h a n d l o w m o l e c u l a r w e i g h t D N A f r o m the same p o l y a c r y l a m i d e gel, respectively. 0.1 pg of l a b e l e d D N A s were incubated w i t h 50 p i of c o m p e t e n t cells then c r o s s l i n k e d after the times listed above. L a n e s 1 - 3 represent c r o s s l i n k i n g experiments p e r f o r m e d after 10 seconds of i n c u b a t i o n u s i n g . Lanes 4 - 6 are c r o s s l i n k i n g experiments p e r f o r m e d after 1 m i n u t e u s i n g the same D N A s as lanes 1-3. Lanes 7 - 9 are c r o s s l i n k i n g e x p e r i m e n t s p e r f o r m e d after 30 m i n u t e s of i n c u b a t i o n u s i n g the same D N A s as lanes 1-3. Lanes 10 - 1 2 are control lanes, w h i c h are D N A s i n c u b a t e d w i t h cells b u t not c r o s s l i n k e d . 3 3  65  Crosslinking Results and Discusion T h e b a n d is m o s t p r o m i n e n t at 10 seconds, decreasing i n intensity at 1 m i n u t e a n d is not v i s i b l e after 30 m i n u t e s (lane 7). Possible explanations for these b a n d s i n c l u d e , c r o s s l i n k i n g to proteins, i n c o r p o r a t i o n into the c h r o m o s o m e or r e - i s o l a t i o n of i n p u t D N A . T o test w h i c h e x p l a n a t i o n was correct, c r o s s l i n k i n g experiments w e r e p e r f o r m e d i n a rec-2 b a c k g r o u n d .  4.5 C r o s s l i n k i n g i n a rec-2 mutant b a c k g r o u n d A s o u t l i n e d i n the I n t r o d u c t i o n , the Rec-2 p r o t e i n is r e q u i r e d for m o v e m e n t of D N A across the i n n e r m e m b r a n e of H. influenzae. M u t a t i o n s i n Rec-2 l e a d to D N A b e i n g l o c a l i z e d i n the p e r i p l a s m i c space, unable to m o v e into the c y t o p l a s m [39, 41]. C r o s s l i n k i n g experiments w e r e p e r f o r m e d i n a rec-2 m u t a n t s t r a i n to p r e v e n t i n c o r p o r a t i o n of l a b e l e d D N A into the c h r o m o s o m e . It w a s expected that h i g h m o l e c u l a r w e i g h t b a n d s seen i n F i g u r e 4.5 s h o u l d disappear if they w e r e d u e to i n c o r p o r a t i o n into the c h r o m o s o m e , but r e m a i n v i s i b l e i f they w e r e a result of crosslinking.  4.5.1 Crosslinking in wild-type and rec-2 backgrounds. M A P 7 c h r o m o s o m a l D N A , USS-50 a n d USS-1 were i n c u b a t e d w i t h freshly m a d e M I V competent w i l d - t y p e or rec-2 cells, and i r r a d i a t e d w i t h 3 pulses f r o m the laser. Results are s h o w n i n F i g u r e 4.6 a n d 4.7 for c h r o m o s o m a l D N A a n d o l i g o s respectively.  I n F i g u r e 4.6, lanes 1 - 4 ( w i l d t y p e ) a n d 5 - 8 (rec-2) s h o w s i m i l a r b a n d i n g patterns. There are b a n d s i n n o n - c r o s s l i n k e d lanes (4 a n d 8), w h i c h indicates that these b a n d s are not d u e to c r o s s l i n k i n g . Since the bands are v i s i b l e i n the rec-2 strain it is l i k e l y that these b a n d s are not due to i n c o r p o r a t i o n into the c h r o m o s o m e b u t arise as a result of i s o l a t i o n of i n p u t D N A . The pattern i n lanes 1 - 8 resemble that i n lane 10,  66  Crosslinking Results and Discussion  c o CD  CO  Wild type cells  rec-2  mutant cells L  Q a  F i g u r e 4.6. C r o s s l i n k i n g u s i n g M A P 7 c h r o m o s o m a l DNA. P h o s p h o r i m a g e r detection of P radioactivity associated w i t h b a n d s i n an S D S - P A G E gel. 0.1 u g of l a b e l e d 20 k b c h r o m o s o m a l D N A w a s i n c u b a t e d w i t h 5 0 u l of competent cells then c r o s s l i n k e d after the times listed b e l o w . L a n e s 1-4 are the result of c r o s s l i n k i n g i n a w i l d - t y p e b a c k g r o u n d . I n c u b a t i o n times were: lane 1,10 seconds; lane 2,1 m i n u t e ; lane 3, 30 m i n u t e s ; lane 4 n o n - c r o s s l i n k e d . Lanes 5-8 are the result of c r o s s l i n k i n g i n a rec-2 b a c k g r o u n d . Incubation times were as above. The D N A i n lane 9 w a s treated w i t h D N a s e I p r i o r to c r o s s l i n k i n g . L a n e 10 has M A P 7 D N A loaded directly. 3 3  67  .  ;  Crosslinking Results and Discusion  w h i c h c o n t a i n e d M A P 7 D N A l o a d e d directly onto the gel. T h e decreased intensity l i k e l y reflects the s m a l l fraction of D N A taken u p b y cells u n d e r saturating c o n d i t i o n s . The D N A i n L a n e 9 w a s digested w i t h D N a s e for 10 m i n u t e s p r i o r to c r o s s l i n k i n g . T h i s s e r v e d as a control since digested D N A s h o u l d not be taken u p by cells. I c o n c l u d e d that the h i g h molecular w e i g h t bands seen i n figures 4.5 a n d 4.6 are the result of re-isolation of the D N A taken u p b y cells f r o m the p e r i p l a s m , rather than c r o s s l i n k i n g or c h r o m o s o m a l i n c o r p o r a t i o n .  T h i s e x p e r i m e n t w a s repeated u s i n g oligos instead of c h r o m o s o m a l D N A (Figure 4.7). C r o s s l i n k i n g experiments i n a rec-2 m u t a n t b a c k g r o u n d are s h o w n i n lanes 1 3. L a n e 4 s h o w s the n o n - c r o s s l i n k e d control. H i g h m o l e c u l a r w e i g h t b a n d s w e r e n o t v i s i b l e , p r o b a b l y because USS-50 cannot cross the inner m e m b r a n e a n d integrate i n t o the c h r o m o s o m e . L o w intensity bands, w h i c h have the s a m e m o b i l i t y as that i n lane 6, indicate the presence of USS-50 i n these lanes. These l o w m o l e c u l a r w e i g h t b a n d s are l i k e l y a result of re-isolation of USS-50. U s i n g USS-1 failed to y i e l d a n y useful i n f o r m a t i o n . T h e faintness of the USS-1 b a n d w h e n i n c u b a t e d w i t h cells (lane 8) l i k e l y reflects l o w uptake a n d subsequent re-isolation f r o m the p e r i p l a s m .  4.6 B i o t i n y l a t e d oligonucleotides 4.6.1 Uptake experiments L a c k of c r o s s l i n k i n g i n d i c a t e d that the p r e v i o u s a p p r o a c h w o u l d not label e n o u g h p r o t e i n to i d e n t i f y the receptor. I h y p o t h e s i z e d that the failure to c r o s s l i n k sufficient receptor w a s because once b o u n d , D N A is r a p i d l y taken u p a n d no l o n g e r available for c r o s s l i n k i n g . C e l l s start a n d complete uptake at s l i g h t l y different times. T h u s , o n l y a s m a l l percentage of receptors w i l l be i n contact w i t h D N A at a n y one time. In the p r e v i o u s l y d e s c r i b e d experiments some cells m i g h t not yet h a v e contacted a D N A m o l e c u l e a n d others w o u l d have c o m p l e t e d uptake at the time of i r r a d i a t i o n .  68  Crosslinking Results and Discussion  J  /  /  / / / / / / U S S - 5 0 crosslinked t o r e c  - . 2  <£  #  c e l l s  NT  #'  £  O  /  8  ^  $  9  O  v  10  i  F i g u r e 4.7. C r o s s l i n k i n g i n rec-2 a n d w i l d - t y p e b a c k g r o u n d s . P h o s p h o r i m a g e r detection of P r a d i o a c t i v i t y associated w i t h b a n d s i n a n S D S - P A G E gel. I n c u b a t i o n times for lanes 1-4 are 10 sec, 1 m i n u t e , 30 m i n u t e s a n d n o n - c r o s s l i n k e d respectively. Lanes 6 a n d 10 c o n t a i n 0.1 p g of U S S 50 a n d U S S - 1 respectively, l o a d e d directly onto the gel. 3 3  69  .  ,  Crosslinking Results and Discusion  ;  If this w e r e true, o n l y a s m a l l percentage of receptors w o u l d h a v e been a v a i l a b l e for c r o s s l i n k i n g w h e n the laser d e l i v e r e d its pulses. It is not possible to s i m p l y irradiate s a m p l e s for e x t e n d e d p e r i o d s w i t h m a n y pulses from the laser d u e to the significant a m o u n t of p r o t e i n d e g r a d a t i o n that occurs w h e n greater than six pulses are d e l i v e r e d to a s a m p l e ( M . Roberge p e r s o n a l c o m m u n i c a t i o n ) . Therefore, I d e s i g n e d a n e x p e r i m e n t that s h o u l d a l l o w cells to p a r t i a l l y take u p D N A then stop m i d w a y t h r o u g h u p t a k e . T h i s w o u l d essentially 'freeze' uptake at a p o i n t w h e r e D N A was i n contact w i t h the receptor, i n c r e a s i n g the a m o u n t of D N A c r o s s l i n k e d b y the laser pulse. A n o l i g o w i t h a b i o t i n m o l e c u l e attached to its 3' terminus w a s d e s i g n e d to p r e v e n t c o m p l e t e u p t a k e of the D N A m o l e c u l e (Figure 4.8 a n d T a b l e 2.3). T h e D N A is s p a c e d f r o m the b i o t i n b y a 15 a t o m spacer a r m ( C H 2 - C H 2 - N H - C O C H 2 - C H 2 - C H 2 - C H 2 - C H 2 - N H - C O - C H 2 - C H 2 - C H 2 - C H 2 - ) . T h i s spacer w a s attached b e t w e e n the D N A a n d the b i o t i n to decrease interference b y the D N A i n b i o t i n s t r e p t a v i d i n interactions.  U p t a k e experiments w e r e p e r f o r m e d u s i n g b i o t i n y l a t e d D N A . It w a s f o u n d that b i o t i n y l a t i o n d i d not p r e v e n t uptake of the D N A m o l e c u l e . H o w e v e r , u p t a k e e x p e r i m e n t s s i m p l y determine the a m o u n t of label associated w i t h cells. Therefore if the b i o t i n y l a t e d D N A is taken u p u n t i l the spacer a r m is reached it m i g h t appear as if the m o l e c u l e is c o m p l e t e l y taken u p by cells. T h u s I tested w h e t h e r b i o t i n was accessible to streptavidin-agarose beads after cells were i n c u b a t e d w i t h D N A for 10 m i n u t e s . Streptavidin-agarose consists of agarose beads c o v e r e d w i t h s t r e p t a v i d i n m o l e c u l e s , w h i c h b i n d t i g h t l y to biotin. The results from this e x p e r i m e n t s h o w e d that b i o t i n w a s not accessible to s t r e p t a v i d i n after i n c u b a t i o n w i t h cells (21 c p m associated w i t h streptavidin-agarose after a d d i t i o n ) . F r o m this, I c o n c l u d e d that the  70  Crosslinking Results and Discussion  Figure 4.8. Biotinylated oligonucleotide. A . M a g n i f i e d v i e w s h o w i n g b i o t i n attached to a n u c l e o t i d e B. Size r e l a t i o n s h i p of 50 bp D N A m o l e c u l e to b i o t i n .  71  __  ;  Crosslinking Results and Discusion  b i o t i n y l a t e d D N A h a d been c o m p l e t e l y taken u p b y cells. H o w e v e r , it is possible 4  that the l i p o p o l y s a c c h a r i d e layer m a y have interfered w i t h s t r e p t a v i d i n - b i o t i n b i n d i n g , m a k i n g it appear as if the b i o t i n m o l e c u l e w a s taken u p b y cells, t h o u g h it still r e m a i n e d o n the outside of cells. Re-isolation of the b i o t i n y l a t e d D N A w a s n o t performed.  4.6.2 Crosslinking experiments Because b i o t i n y l a t i o n of the d o u b l e stranded oligo d i d not p r e v e n t complete u p t a k e of the D N A , the b u l k i e r streptavidin-agarose m o l e c u l e w a s attached p r i o r to i n c u b a t i o n w i t h cells. T h i s association essentially attaches an agarose b e a d to the e n d of the D N A m o l e c u l e . C o m p l e t e u p t a k e of the c o m p l e x is i m p o s s i b l e since the agarose beads are a p p r o x i m a t e l y 100 times larger than an H. influenzae cell (100 p m vs 1 p m ) .  T h e m a x i m u m v o l u m e of a c r o s s l i n k i n g experiment is 50 p l . Therefore, I a t t e m p t e d to d e t e r m i n e the n u m b e r of cells that are able to b i n d to 50 p l of s t r e p t a v i d i n agarose beads. First, b i o t i n y l a t e d D N A was incubated w i t h s t r e p t a v i d i n agarose beads for 30 m i n u t e s . U n b o u n d D N A was r e m o v e d b y extensive w a s h i n g (Figure 4.9 a). T h e c o m p l e x w a s then incubated w i t h freshly m a d e M l V - c o m p e t e n t cells for 10 m i n u t e s (Figure 4.9 b). After this i n c u b a t i o n , the streptavidin-agarose beads were w a s h e d e x t e n s i v e l y to r e m o v e u n b o u n d cells. F o l l o w i n g the r e m o v a l of u n b o u n d cells, p l a t i n g s h o w e d that there were 1.72 X 1 0 cfu r e m a i n i n g associated w i t h 50 p l 6  of streptavidin-agarose beads (approximately 1 X 1 0 cfu were associated w i t h beads 3  i n the absence of D N A ) . T h i s is the m a x i m u m n u m b e r of cells a v a i l a b l e for c r o s s l i n k i n g i n a 50 p l v o l u m e .  72  Crosslinking Results and Discussion  Figure 4.9. Illustration of the presumed interaction of competent H. influenzae cells with biotinylated DNA attached to agarose beads. R e l a t i o n s h i p not to scale.  73  .  ,  Crosslinking Results and Discusion  C r o s s l i n k i n g experiments were p e r f o r m e d u s i n g the cell-bead c o m p l e x a n d S D S P A G E gels w e r e stained using'a silver stain kit. Bands w e r e not v i s i b l e i n c r o s s l i n k e d or n o n - c r o s s l i n k e d lanes (gels not s h o w n ) .  4.7 Calculations C a l c u l a t i o n s w e r e p e r f o r m e d to evaluate w h y proteins w e r e n o t v i s i b l e after c r o s s l i n k i n g . I p r e d i c t e d the reason for this w a s that the total mass of a l l the receptors i n 1.72 X 1 0 cells w a s not e n o u g h to v i s u a l i z e the b a n d o n silver s t a i n e d 6  p o l y a c r y l a m i d e gel. Sensitivity tests of the silver staining i n d i c a t e d a detection l i m i t of a p p r o x i m a t e l y 5 n g of p r o t e i n per b a n d . T o p e r f o r m these calculations, some estimates were m a d e of the size a n d n u m b e r of receptors. C a l c u l a t i o n s were p e r f o r m e d u s i n g two different estimates for these variables. P r e v i o u s results estimated between three a n d eight receptors per c e l l . In the calculations b e l o w I u s e d an estimate of 10 a n d 100 receptors per cell. A l s o , I u s e d t w o e s t i m a t e s f o r the size of the receptor p r o t e i n , 50 a n d 200 k D a .  4.7.1 Scenario 1; estimate 100 receptors/cell and a 200kDa receptor. 1 . 7 2 x l 0 cells X 100 receptors/cell= 1 . 7 2 x l 0 receptors 6  8  1 . 7 2 x l 0 receptors X 1 m o l / 6 . 0 2 x l 0 receptors= 2.86 x 1 0 " 8  2 3  16  moles  2.86 x 1 0 " m o l e s X 200000 g / m o l = 5.71X10" g 16  5.71X10" g= 5 7 x l 0 " 11  11  1 2  g= 57 p g  T h e m i n i m u m a m o u n t of p r o t e i n per b a n d n e e d e d to be detected b y silver staining: 5000 p g / b a n d 5000 p g = 88* 57 p g  74  Crosslinking Results and Discusion  4.7.2 Scenario 2; estimate 10 receptors/cell and a 50kDa receptor. Same calculations as above 5000 p g = 3500* 1.43 p g  T h i s is the n u m b e r of 50 p i aliquots needed, to have 5 n g (5000 pg) of receptor i n a single b a n d o n a p o l y a c r y l a m i d e gel. T h i s assumes 100% of receptors become c r o s s l i n k e d to a D N A fragment.  F r o m these calculations I c o n c l u d e d that i n order to v i s u a l i z e the receptor, b e t w e e n 100 a n d 3000 samples m u s t be l o a d e d into a single w e l l of a p o l y a c r y l a m i d e gel. A s o u t l i n e d i n the I n t r o d u c t i o n the efficiency of c r o s s l i n k i n g is 1-20%. Therefore, the n u m b e r of samples n e e d e d to isolate 5 n g of receptor f r o m 1.72 X 1 0 cells is l i k e l y 6  b e t w e e n 1000 - 30000. W i t h this i n f o r m a t i o n I c o n c l u d e d that it w o u l d be i m p o s s i b l e to isolate the receptor b y U V laser c r o s s l i n k i n g w i t h this strategy. F u r t h e r attempts to isolate the receptor w e r e not p e r f o r m e d .  4.8 D i s c u s s i o n of c r o s s l i n k i n g results. T h e use of laser c r o s s l i n k i n g to isolate the receptor d i d not y i e l d e n o u g h p r o t e i n for further s t u d y . A potential e x p l a n a t i o n for this is that the i n t e r a c t i o n of the D N A w i t h the receptor is transient. Transient b i n d i n g c o u l d arise if the i n t e r a c t i o n of the D N A a n d receptor is reversible or i f the b o u n d D N A m o l e c u l e is translocated r a p i d l y across the outer m e m b r a n e . In either case the D N A w o u l d be i n contact w i t h the receptor for o n l y a short time, decreasing the fraction of U S S s i n contact w i t h the receptor at the time of U V i r r a d i a t i o n .  75  Crosslinking Results and Discusion C o m p l e t e u p t a k e of the D N A m o l e c u l e was p r e v e n t e d b y u s i n g s t r e p t a v i d i n agarose beads. A s i n the p r e v i o u s experiments this d i d not isolate e n o u g h p r o t e i n to a l l o w further s t u d y because o n l y 1.7% of the cells o r i g i n a l l y i n c u b a t e d w i t h the streptavidin-agarose beads r e m a i n e d associated after r e m o v a l of n o n - s p e c i f i c a l l y b o u n d cells. C a l c u l a t i o n s p e r f o r m e d i n chapter four illustrate that w i t h this n u m b e r of cells it w o u l d be n e a r l y i m p o s s i b l e to isolate e n o u g h p r o t e i n to v i s u a l i z e a b a n d o n a p o l y a c r y l a m i d e gel stained w i t h silver. In a d d i t i o n to this, it is u n l i k e l y that each receptor of every cell was associated w i t h a D N A m o l e c u l e . T h i s arises because if w e i m a g i n e a cell b o u n d to a streptavidin-agarose b e a d b y receptors o n one side, it is l i k e l y that receptors o n the other side of the cell w i l l not be i n contact w i t h the b e a d , thus l i m i t i n g the n u m b e r of receptors i n contact w i t h D N A w h e n the s a m p l e w a s i r r a d i a t e d . C e l l s are u n l i k e l y to be i n contact w i t h m o r e than one bead, d u e to the beads' large size.  4.9 Future experiments If c r o s s l i n k i n g is to.be u s e d again to try to isolate the receptor, a p r o c e d u r e w i l l n e e d to be d e v i s e d that prevents complete uptake of the D N A m o l e c u l e , yet a l l o w s a h i g h p r o p o r t i o n of the receptors to contact D N A . It m a y be possible to achieve this b y l i n k i n g g o l d particles to D N A m o l e c u l e . P r e v i o u s e x p e r i m e n t a t i o n has s h o w n that g o l d l a b e l e d D N A remains o n the outside of cells after i n c u b a t i o n (R. R e d f i e l d p e r s o n a l c o m m u n i c a t i o n ) . This p r o c e d u r e m i g h t p r e v e n t c o m p l e t e u p t a k e of the D N A m o l e c u l e , yet a l l o w a h i g h p r o p o r t i o n of receptors to contact D N A , i n c r e a s i n g the p r o b a b i l i t y of i s o l a t i n g the receptor.  A l s o , g e n o m i c analysis c o u l d be used to identify the receptor. If a c o m p u t e r p r o g r a m w e r e d e s i g n e d that c o u l d search the H. influenzae g e n o m e for proteins that c o n t a i n t r a n s m e m b r a n e d o m a i n s as w e l l as D N A b i n d i n g d o m a i n s it c o u l d p r o v i d e a subset of genes, one of w h i c h m i g h t be the receptor. D e l e t i o n s c o u l d be m a d e of  76  :  Crosslinking Results and Discusion  each o p e n r e a d i n g frame f o l l o w e d b y b i n d i n g a n d u p t a k e assays to d e t e r m i n e the p h e n o t y p e of the mutant. T h e N. gonorrhoeae g e n o m e sequence m a y also serve to n a r r o w the n u m b e r of p o t e n t i a l genes that encode the receptor. Since b o t h bacteria are able to b i n d a n d take u p sequence specific D N A , s e a r c h i n g for genes i n N. gonorrhoeae that have h o m o l o g y to the D N A - b i n d i n g - m e m b r a n e p r o t e i n s f o u n d i n the o r i g i n a l search of the H. influenzae genome m i g h t assist i n i s o l a t i n g the receptor. H o w e v e r , since t h e U S S of N. gonorrhoeae is unrelated to the U S S of H. influenzae, this m a y n o t a i d i n decreasing the n u m b e r of proteins w h i c h c o u l d p o t e n t i a l l y be the receptor.  77  . Model of Uptake  CHAPTER FIVE Hypothetical model for uptake by H.  influenzae  U s i n g the i n f o r m a t i o n g a i n e d f r o m m y research a n d p r e v i o u s f i n d i n g s , I h a v e f o r m u l a t e d a speculative m o d e l for h o w H. influenzae m i g h t r e c o g n i z e , b i n d a n d take u p D N A i n a sequence specific manner. T h i s m o d e l differs f r o m the m o d e l p r o p o s e d b y D u b n a u (1999) (Figure 1.3 p.12) i n a n u m b e r of w a y s . D u b n a u ' s m o d e l does a n excellent job of a d d r e s s i n g the p r o t e i n c o m p o s i t i o n of the receptor c o m p l e x i n s i d e the outer m e m b r a n e , therefore I w i l l not discuss the proteins i n v o l v e d i n transport of D N A after it crosses the outer m e m b r a n e .  A s h o r t c o m i n g of D u b n a u ' s  m o d e l h o w e v e r , is that it does not address h o w the U S S is r e c o g n i z e d at the outside of cells. H i s m o d e l hypothesizes that D N A enters the p e r i p l a s m t h r o u g h an outer m e m b r a n e p o r e c o n s i s t i n g of the secretin p r o t e i n P i l Q [5]. A m o r e c o m p l e t e m o d e l for u p t a k e b y H. influenzae s h o u l d address h o w cells are able to preferentially b i n d a n d take u p sequence specific D N A a n d also address h o w f l a n k i n g sequence affects uptake. Therefore, m y m o d e l w i l l focus on the i n i t i a l steps of b i n d i n g a n d u p t a k e i n a n attempt to s u p p l e m e n t the m o d e l p r o p o s e d b y D u b n a u .  5.1.1 Model for uptake by H. influenzae F i g u r e 5.1 illustrates the p r o p o s e d m o d e l . D N A is b o u n d b y four h y p o t h e t i c a l proteins o n the cell surface (Figure 5.1 (a)). F o r s i m p l i c i t y I w i l l refer to each p r o t e i n separately ( A - D ) , a l t h o u g h fewer proteins c o u l d be i n v o l v e d , each h a v i n g m o r e t h a n one D N A b i n d i n g motif. P r e v i o u s research has s h o w n that, as competence d e v e l o p s , the outer m e m b r a n e of H. influenzae changes i n p r o t e i n c o m p o s i t i o n [55, 56].  Therefore, it is l i k e l y that as competence develops, genes are t r a n s c r i b e d a n d 1  the m R N A s e n c o d i n g these b i n d i n g proteins are translated then inserted into the  78  Model of Uptake  D N A binding proteins  F i g u r e 5.1. H y p o t h e t i c a l m o d e l for b i n d i n g a n d u p t a k e b y H. influenzae. A ) D N A is b o u n d b y proteins A - D B) Proteins C a n d D cause m e l t i n g of the D N A i n the A / T r i c h 3' f l a n k i n g r e g i o n e v e n t u a l l y l e a d i n g to the formation of the single s t r a n d e d core r e g i o n . C ) P r o t e i n B takes the D N A i n to the p e r i p l a s m i c space b y f o r m i n g a b e n d i n the D N A .  79  Model of Uptake membrane.  U n p u b l i s h e d experiments have f o u n d that w h e n m e m b r a n e proteins of  H. influenzae are s o l u b i l i z e d , sequence specific D N A b i n d i n g is lost (R. R e d f i e l d p e r s o n a l c o m m u n i c a t i o n ) . T h u s , I propose that each p r o t e i n m u s t contact others of the c o m p l e x before u p t a k e can commence a n d if interaction b e t w e e n these proteins is p r e v e n t e d , b i n d i n g a n d uptake w i l l not occur. U p t a k e begins w h e n the U S S r e c o g n i t i o n p r o t e i n B b i n d s to the core U S S o n the D N A . T h i s is f o l l o w e d b y proteins A , C a n d D b i n d i n g to the D N A (Figure 5.1 a). I h y p o t h e s i z e that proteins C a n d D contact the m i n o r g r o o v e of the D N A since, as i l l u s t r a t e d i n F i g u r e 1.2 (p.9), the distance f r o m the center of one A / T r i c h ( r w w w w w ) r e g i o n ' t o the next is 12 b p , r o u g h l y c o r r e s p o n d i n g to one t u r n of the D N A h e l i x (10.3 bp). Proteins C a n d D m a y recognize the A / T r i c h r e g i o n b y the absence of 2 - a m i n o g r o u p s i n the m i n o r groove of A / T base p a i r s [91]. I p r e d i c t that another p r o t e i n A b i n d s to the 5' r e g i o n of the D N A , s u p p o r t e d b y the o b s e r v a t i o n that D N A l a c k i n g 5' sequence is not taken u p w e l l b y competent cells. In the A / T r i c h ( r w w w w w ) region, proteins C a n d D b e g i n to u n w i n d the D N A e v e n t u a l l y m a k i n g the 9 b p core single stranded (Figure 5.1 b). B i n d i n g proteins A , C a n d D h o l d the single stranded core i n close p r o x i m i t y to the U S S r e c o g n i t i o n p r o t e i n B . T h i s p r o t e i n then begins to translocate the D N A t h r o u g h the outer m e m b r a n e (Figure 5.1 c). T h e m e c h a n i s m of this m o v e m e n t is u n k n o w n b u t c o u l d i n v o l v e b e n d i n g of the single stranded D N A to a l l o w passage t h r o u g h the m e m b r a n e . A s D N A is m o v e d into the p e r i p l a s m i c space it re-anneals the single s t r a n d e d regions. F o l l o w i n g m o v e m e n t into the p e r i p l a s m D N A is translocated across the i n n e r m e m b r a n e .  80  Model of Uptake  5.1.2 I n t e r a c t i o n o f o l i g o s w i t h the receptor c o m p l e x If the p r o p o s e d m o d e l is correct, it s h o u l d be possible to e x p l a i n the u p t a k e a n d b i n d i n g characteristics of the different oligos u s e d t h r o u g h o u t this s t u d y . If a D N A m o l e c u l e lacks sequence 5' to the U S S , b i n d i n g b y p r o t e i n A s h o u l d not occur. T h i s w o u l d p r e v e n t the U S S f r o m b e i n g h e l d i n close p r o x i m i t y to p r o t e i n B (See F i g u r e 5.2 a). P r o t e i n s C a n d D w o u l d denature the d o u b l e s t r a n d e d D N A . H o w e v e r , p r o t e i n B , since it is not i n contact w i t h the core U S S , w o u l d not i n t e r n a l i z e the D N A m o l e c u l e . T h i s m o d e l correlates w e l l w i t h the behavior of USS-1 a n d U S S - 5 0 - L e w h i c h lack sequence 5'to the U S S . USS-1  ^^3Mk/////?±\  than its negative c o n t r o l D N A U S S - R  IE  ^f^ZZ////\  } taken u p at a l e v e l m u c h l o w e r than USS-50  [E  T[ j | _ , s  oun(;  ^EKZZ///\ J_[  ); w  a n c  3.  is not taken u p better  USS-50-Le  h i c h has sequence 5' to the U S S . It is also p o s s i b l e that if  the D N A is d e n a t u r e d i n the A / T r i c h regions (Figure 5.2 b) the 9 b p core m a y also b e c o m e d e n a t u r e d . This w o u l d l e a d to the d e n a t u r a t i o n of the entire o l i g o w h i c h m i g h t cause cells to release the single stranded oligo (Figure 5.2 c), p r e v e n t i n g uptake.  T o e x p l a i n the l o w uptake of U S S - 5 0 - R C  Lb  i^^mmmxmxm J J ^  w  n  j  c  n  h j a c  a  n  A / T r i c h r e g i o n replaced w i t h a G / C r i c h 3' flanking consensus, it is possible that b i n d i n g occurs at proteins A - D (see F i g u r e 5.3). The energy r e q u i r e d to d e n a t u r e the G / C r i c h r e g i o n is higher than an A / T r i c h 3' f l a n k i n g consensus. If p r o t e i n s C a n d D are u n a b l e to denature the D N A , the single s t r a n d e d U S S w i l l not be accessible to p r o t e i n B a n d uptake w i l l not occur. If uptake does not b e g i n , cells m a y release the D N A m o l e c u l e , l e a d i n g to the l o w levels of b i n d i n g , u p t a k e a n d interference o b s e r v e d .  81  Model of Uptake  D N A binding proteins  D N A binding proteins  D N A binding proteins  F i g u r e 5.2. M o d e l for u p t a k e of o l i g o s l a c k i n g 5' s e q u e n c e a) D N A is b o u n d b y proteins C a n d D . P r o t e i n A is unable to b i n d to the D N A because the o l i g o lacks sequence 5' to the U S S . Since the D N A is not b o u n d b y p r o t e i n a the 9bp core is not i n close contact w i t h p r o t e i n b therefore u p t a k e does not o c c u r . b) D N A is b o u n d b y proteins B - D . D e n a t u r a t i o n of A / T r i c h r e g i o n s begins. c) D e n a t u r a t i o n continues to the 9 bp core U S S . D N A becomes s i n g l e s t r a n d e d a n d is released b y b i n d i n g proteins.  82  Model of Uptake  Figure 5.3. M o d e l for b i n d i n g of an oligo h a v i n g a G / C rich 3' f l a n k i n g region. D N A is b o u n d b y proteins A - D . Since this D N A has a G / C r i c h 3' f l a n k i n g r e g i o n , m e l t i n g i n that region does not occur. T h i s prevents the 9 b p core f r o m b e c o m i n g single s t r a n d e d , p r e v e n t i n g u p t a k e of the D N A .  83  .  Model of Uptake  F i g u r e 5.4 s h o w s b i n d i n g of D N A that lacks 3' f l a n k i n g sequence  [E  —"j^tl.  Since the 3' f l a n k i n g sequence is m i s s i n g , i f p r o t e i n B  b i n d s the U S S the D N A w i l l not be b o u n d b y proteins C a n d D . A s above, i f this h a p p e n s then d e n a t u r a t i o n a n d uptake w i l l not occur.  If m y m o d e l is a true d e s c r i p t i o n of uptake i n H. influenzae one m i g h t expect that cells s h o u l d be able to take u p single-stranded D N A . H o w e v e r , u n d e r 'natural' c o n d i t i o n s this does not occur. P r e v i o u s research has s h o w n that s i n g l e - s t r a n d e d D N A can be taken u p , a l t h o u g h i n a non-sequence specific fashion, if cells are first i n c u b a t e d w i t h D N A at l o w p H , f o l l o w e d b y a second p e r i o d of i n c u b a t i o n at n e u t r a l p H [ 9 5 ] . A n e x p l a n a t i o n for the lack of uptake u n d e r ' n a t u r a l ' c o n d i t i o n s c o u l d be that proteins C a n d D b i n d o n l y d o u b l e stranded D N A . If so, the core U S S w o u l d not be l o c a l i z e d near p r o t e i n B a n d uptake w o u l d not occur.  84  Model of Uptake.  F i g u r e 5.4. B i n d i n g of U S S - 5 0 - R L D N A is b o u n d at 9bp core b y p r o t e i n B . T h e 3' f l a n k i n g r e g i o n is not i n contact w i t h proteins C a n d D therefore d e n a t u r a t i o n a n d u p t a k e d o not occur.  85  Bibliography  Bibliography 1.  G o o d g a l , S . H . , DNA uptake in Haemophilus transformation. [Review]. A n n u a l  R e v i e w of Genetics, 1982.16(169): p . 169-92. 2.  S m i t h , H . O . , D . B . Danner, a n d R . A . D e i c h , Genetic transformation. A n n u R e v  B i o c h e m , 1981. 50: p . 41-68.  3.  Fraser, D . W . , C . C . G e i l , a n d R . A . F e l d m a n , Bacterial meningitis in Bernalillo  County, New Mexico: a comparison with three other American populations. A m J E p i d e m i o l , 1974.100(1): p . 29-34.  4.  K a h n , M . E . a n d H . O . Smith, Transformation in Haemophilus: a problem in  membrane biology. [Review]. Journal of M e m b r a n e B i o l o g y , 1984. 81(2): p . 89-103. 5.  D u b n a u , D . , DNA uptake in bacteria. A n n u R e v M i c r o b i o l , 1999. 53: p . 217-44.  6.  C h a n g , S. a n d S . N . C o h e n , High frequency transformation of Bacillus subtilis  protoplasts by plasmid DNA. M o l G e n Genet, 1979.168(1): p . 111-5.  7.  M a n d e l , M . a n d A . H i g a , Calcium-dependent bacteriophage DNA infection. J M o l  B i o l , 1970. 53(1): p . 159-62.  8.  D u b n a u , D . a n d C . C i r i g l i a n o , Fate of transforming DNA following uptake by  competent Bacillus subtilis. Formation and properties of products isolated from transformed cells which are derived entirely from donor DNA. Journal of M o l e c u l a r B i o l o g y , 1972. 64(1): p . 9-29.  9.  L a c k s , S., Uptake of circular deoxyribonucleic acid and mechanism of  deoxyribonucleic acid transport in genetic transformation of Streptococcus pneumoniae. J o u r n a l of B a c t e r i o l o g y , 1979.138(2): p . 404-9.  86  _ 10.  '  Bibliography  L a c k s , S. a n d B. Greenberg, Single-strand breakage on binding of DNA to cells in  the genetic transformation of Diplococcus pneumoniae. Journal of M o l e c u l a r B i o l o g y , 1 9 7 6 . 1 0 1 ( 2 ) : p . 255-75.  11.  M o r r i s o n , D . A . a n d W . R . G u i l d , Breakage prior to entry of donor DNA in  Pneumococcus transformation. B i o c h i m i c a E t B i o p h y s i c a A c t a , 1973. 2 9 9 ( 4 ) : p . 545-56. 12.  D u b n a u , D . , Genetic competence in Bacillus subtilis. M i c r o b i o l . R e v . , 1991. 55(3):  p. 395-424.  13.  L o r e n z , M . G . , K . Reipschlager, a n d W . W a c k e r n a g e l , Plasmid transformation of  naturally competent Acinetobacter calcoaceticus in non-sterile soil extract and groundwater. A r c h M i c r o b i o l , 1 9 9 2 . 1 5 7 ( 4 ) : p . 355-60.  14.  P a l m e n , R., et al, Physiological characterization of natural transformation in  Acinetobacter calcoaceticus. J G e n M i c r o b i o l , 1 9 9 3 . 1 3 9 ( P t 2): p . 295-305.  15.  Scocca, J.J., R . L . P o l a n d , a n d K . C . Z o o n , Specificity in deoxyribonucleic acid  uptake by transformable Haemophilus influenzae. J Bacteriol, 1 9 7 4 . 1 1 8 ( 2 ) : p . 369-73. 16.  G o o d m a n , S.D. a n d J.J. Scocca, Identification and arrangement of the DNA  sequence recognized in specific transformation of Neisseria gonorrhoeae. Proc N a t l A c a d Sci U S A , 1988. 85(18): p . 6982-6.  17.  G r a v e s , J.F., G . D . B i s w a s , a n d P . F . S p a r l i n g , Sequence-specific DNA uptake in  transformation of Neisseria gonorrhoeae. J o u r n a l of B a c t e r i o l o g y , 1 9 8 2 . 1 5 2 ( 3 ) : p . 1071-7.  18.  C r i s e l , R . M . , R.S. Baker, a n d D . E . D o r m a n , Capsular polymer of Haemophilus  influenzae, type b. I. Structural characterization of the capsular polymer of strain Eagan. J B i o l C h e m , 1975. 2 5 0 ( 1 3 ) : p . 4926-30.  87  ; 19.  .  ;  Bibliography  R o w j i , P . , R . G r o m k o v a , a n d H . K o o r n h o f , Genetic transformation in  encapsulated clinical isolates of Haemophilus influenzae type b. J o u r n a l of G e n e r a l M i c r o b i o l o g y , 1989.  20.  G r o m k o v a , R. a n d S. G o o d g a l , Uptake of plasmid deoxyribonucleic acid by  Haemophilus. J Bacteriol, 1981.146(1): p. 79-84.  21.  P i f er, M . L . a n d H . O . Smith, Processing of donor DNA during Haemophilus  influenzae transformation: analysis using a model plasmid system. P r o c N a t l A c a d Sci U S A , 1985. 82(11): p . 3731-5.  22.  B a r a n y , F., M . E . K a h n , a n d H . O . Smith, Directional transport and integration of  donor DNA in Haemophilus influenzae transformation. Proceedings of the N a t i o n a l A c a d e m y of Sciences of the U n i t e d States of A m e r i c a , 1983. 80(23): p. 7274-8. 23.  K a h n , M . E . , F. Barany, a n d H . O . S m i t h , Transformasomes: specialized  membranous structures that protect DNA during Haemophilus transformation. P r o c e e d i n g s of the N a t i o n a l A c a d e m y of Sciences of the U n i t e d States of A m e r i c a , 1983. 80(22): p . 6927-31.  24.  Stuy, J . H . , Fate of transforming DNA in the Haemophilus influenzae transformation  system. J o u r n a l of M o l e c u l a r B i o l o g y , 1965.13(2): p . 554-70.  25.  N o t a n i , N . a n d S . H . G o o d g a l , On the nature of recombinants formed during  transformation in Hemophilus influenzae. J G e n P h y s i o l , 1966. 49(6): p. 197-209. 26.  Sisco, K . L . a n d H . O . Smith, Sequence-specific DNA uptake in Haemophilus  transformation. P r o c e e d i n g s of the N a t i o n a l A c a d e m y of Sciences of the U n i t e d States of A m e r i c a , 1979. 76(2): p. 972-6.  88  Bibliography  :  27.  D a n n e r , D . B . , et al, An eleven-base-pair sequence determines the specificity of  DNA uptake in Haemophilus transformation. Gene, 1980.11(3-4): p . 311-8. 28.  E l k i n s , C , et al, Species-specific uptake of DNA by gonococci is mediated by a 10-  base- pair sequence. J; Bacteriol, 1991.173(12): p . 3911-3. 29.  D e i c h , R . A . a n d H . O . Smith, Mechanism of homospecific DNA uptake in  Haemophilus influenzae transformation. M o l G e n Genet, 1980.177(3): p . 369-74. 30.  D a n n e r , D . , H . O . S m i t h , a n d S. N a r a n g , Construction of DNA recognition sites  active in Haemophilus transformation. P N A S , 1982. 79: p . 2393-2397. 31.  F l e i s c h m a n n , R . D . , et al, Whole-Genome Random Sequencing and Assembly of  Haemophilus influenzae Rd. Science, 1995. 269(5223): p . 496-512.  32.  G o e b e l , S.J., et al, The complete DNA sequence of vaccinia virus. V i r o l o g y , 1990.  179(1): p . 247-66,517-63.  33.  Sanger, F., et al, Nucliotide sequence of bacteriophage phi X174 DNA. N a t u r e ,  1977. 265(5596): p . 687-95.  34.  B a n k i e r , A . T . , et al, The DNA sequence of the human cytomegalovirus genome.  D N A Seq, 1991. 2(1): p. 1-12.  35.  S m i t h , H.O,, et al, Frequency and distribution of DNA uptake signal sequences in  the Haemophilus influenzae Rd genome. Science, 1995. 269: p . 538-540. 36.  R e d f i e l d , R.J., Genes for breakfast: the have your cake and eat it too of  transformation. J. H e r e d . , 1993. 84(5): p . 400-404.  89  ;  37.  Bibliography  :  H a h n , ]., et al., Characterisation of comE, a late competence operon of Bacillus  subtilis required for the binding and uptake of transforming DNA. M o l e c . M i c r o . , 1993.10: p . 99-111.  38.  Inamine, G.S. a n d D . D u b n a u , ComEA, a Bacillus subtilis integral membrane  protein required for genetic transformation, is needed for both DNA. binding and transport. J B a c t e r i o l , 1995.177(11): p . 3045-51.  39.  C l i f t o n , S.W., D . M c C a r t h y , a n d B . A . Roe, Sequence of the rec-2 locus of  Haemophilus influenzae: homologies to comE-ORF3 of Bacillus subtilis and msbA of Escherichia coli. G e n e , 1994.146(1): p . 95-100.  40.  Facius, D . a n d T.F. M e y e r , A novel determinant (comA) essential for natural  transformation competence in Neisseria gonorrhoeae and the effect of a com A defect on pilin variation. M o l e c u l a r M i c r o b i o l o g y , 1993.10(4): p . 699-712.  41.  B a r o u k i , R. a n d H . O . S m i t h , Reexamination of phenotypic defects in rec-1 and rec-  2 mutants of Haemophilus influenzae Rd. Journal of Bacteriology, 1985.163(2): p . 629-34.  42.  K a r u d a p u r a m , S. a n d G.J. Barcak, The Haemophilus influenzae dprABC genes  constitute a competence- inducible operon that requires the product of the tfoX (sxy) gene for transcriptional activation. J Bacteriol, 1997.179(15): p . 4815-20.  43.  K a r u d a p u r a m , S., X . Z h a o , a n d G.J. Barcak, DNA sequence and characterization  of Haemophilus influenzae dprA+, a gene required for chromosomal but not plasmid DNA transformation. J. Bacteriol., 1995.177(11): p . 3235-3240.  44.  T o m b , J.F., A periplasmic protein disulfide oxidoreductase is required for  transformation of Haemophilus influenzae Rd. Proceedings of the N a t i o n a l A c a d e m y of Sciences of the U n i t e d States of A m e r i c a , 1992. 89(21): p . 10252-6.  90  Bibliography 45.  L o n d o n o - V a l l e j o , J.A. a n d D . D u b n a u , comF, a Bacillus subtilis late competence  locus, encodes a protein similar to ATP-dependent. RNA/DNA  helicases. M o l e c . M i c r o . ,  1993. 9: p . 119-131. 46.  L a r s o n , T . G . a n d S . H . G o o d g a l , Donor DNA processing is blocked by a mutation  in the comlOlA locus of Haemophilus influenzae. J Bacteriol, 1992.174(10): p . 3392-4. 47.  L a r s o n , T . G . . a n d S . H . G o o d g a l , Sequence and transcriptional regulation of  comlOlA, a locus required for genetic transformation in Haemophilus influenzae. J Bacteriol, 1991.173(15): p. 4683-91. Setlow, J.K., et al., Repair of DNA in Haemophilus influenzae. 1.1. Excision, repair of  48.  single-strand breaks, defects in transformation, and host, cell modification in. UV-sensitive mutants. C o l d S p r i n g H a r b o r S y m p o s i a O n Quantitative B i o l o g y , 1968. 33(209): p . 209-18. 49.  S e t l o w , J.K., et al, A complex of recombination and repair genes in Haemophilus  influenzae. J o u r n a l of M o l e c u l a r B i o l o g y , 1972. 68(2): p. 361-78. 50.  G w i n n , M . L . , et al, A new transformation-deficient mutant of Haemophilus  influenzae Rd with normal DNA uptake. J Bacteriol, 1998.180(3): p . 746-8. 51.  T o m b , J.F., et al, Transposon mutagenesis, characterization, and cloning of  transformation genes of Haemophilus influenzae Rd. Journal of Bacteriology, 1989. 171(7): p . 3796-802. 52.  K r a i s s , A . , S . S c h l o r , a n d J. R e i d l , In vivo transposon mutagenesis in Haemophilus  influenzae. A p p l E n v i r o n M i c r o b i o l , 1998. 64(12): p. 4697-702. 53.  R e d f i e l d , R.J., sxy-1, a Haemophilus influenzae mutation causing greatly enhanced  competence. J. B a c t e r i o l , 1991.173: p . 5612-5618.  91  . 54.  ]  ;  Bibliography  C h a n d l e r , M . S . , The gene encoding cAMP receptor protein is required for  competence development in Haemophilus influenzae Rd. Proc N a d A c a d Sci U S A , 1992. 89(5): p . 1626-30. 55.  Z o o n , K . C . a n d J.J. Scocca, Constitution of the cell envelope of Haemophilus  influenzae in relation to competence for genetic transformation. Journal of Bacteriology, 1975.123(2): p . 666-77. 56.  Z o o n , K . C , M . Habersat, a n d J.J. Scocca, Synthesis of envelope polypeptides by  Haemophilus influenzae during development of competence for genetic transformation. J o u r n a l of Bacteriology, 1976.127(1): p . 545-54. 57.  D e i c h , R . A . , et al, Cloning of genes encoding a 15,000-dalton peptidoglycan-  associated outer membrane lipoprotein and an antigenically related 15,000-dalton protein from Haemophilus influenzae. Journal of Bacteriology, 1988.170(2): p . 489-98. 58.  Sutrina, S.L. a n d J.J. Scocca, Haemophilus influenzae periplasmic protein which  binds deoxyribonucleic acid: properties and possible participation in genetic transformation. J o u r n a l of Bacteriology, 1979.139(3): p. 1021-7. 59.  K a h n , M . , et al, DNA binding activity of vesicles produced by competence deficient  mutants of Haemophilus. B B R C , 1979. 87(3): p . 764-772. 60.  C o n c i n o , M . a n d S. G o o d g a l , Haemophilus influenzae polypeptides involved in  deoxyribonucleic acid uptake detected by cellular surface protein iodination. J. Bacteriol., 1981.148(1): p . 220-231. 61.  H o c k e n s m i t h , J.W., et ai, Laser cross-linking of nucleic acids to proteins.  Methodology and first applications to the phage T4 DNA replication system. J B i o l C h e m , 1986. 261(8): p . 3512-8.  92  • 62.  Bibliography  Pashev, I.G., S.I. D i m i t r o v , a n d D . A n g e l o v , Crosslinking proteins to nucleic  acids by ultraviolet laser irradiation. Trends B i o c h e m Sci, 1991.16(9): p . 323-6. 63.  A l e x a n d e r , P . a n d H . M o r o s o n , Crosslinking of deoxyribonucleic acid to protein  following ultra-violetirradiation of different cells. N a t u r e , 1962.194: p. 882-883. 64.  S m i t h , K . C . , Dose dependent decrease in extractability of DNA from bacteria  following irradiation with ultraviolet light or with visible light. B i o c h e m . B i o p h y s . Res. C o m m u n , 1962. 8(3): p . 157-163.  65.  Shetlar, M . D . , Cross-linking of proteins to nucleic acids by ultrra.ci.olet light.  P h o t o c h e m . P h o t o b i o l . R e v . , 1980. 5: p. 105-197.  66.  H o c k e n s m i t h , J.W., et al, Laser cross-linking of proteins to nucleic acids. I.  Examining physical parameters of protein-nucleic acid complexes. J B i o l C h e m , 1993. 268(21): p . 15712-20.  67.  N i k o g o s y a n , D . N . , Two-quantum UV photochemistry of nucleic acids: comparison  with conventional low-intensity UV photochemistry and radiation chemistry. Int J Radiat B i o l , 1990. 57(2): p . 233-99.  68.  S m i t h , K . C . , A mixed, photoproduct of thymine and cysteine: 5-S-cysteine, 6-  hydrothymine. B i o c h e m B i o p h y s Res C o m m u n , 1970. 39(6): p . 1011-6.  69.  M a r k o v i t z , A . , Ultraviolet light-induced stable complexes of DNA and DNA  polymerase. B i o c h i m B i o p h y s A c t a , 1972. 281(4): p. 522-34.  70.  P a r a d i s o , P . R . , Y . N a k a s h i m a , a n d W . K o n i g s b e r g , Photochemical cross-linking  of protein . nucleic acid complexes. The attachment ofthefd gene 5 protein tofd DNA. J B i o l C h e m , 1979. 254(11): p . 4739-44.  93  Bibliography 71.  H o c k e n s m i t h , J.W., et al, Laser cross-linking of proteins to nucleic acids. II.  Interactions of the bacteriophage T4 DNA replication polymerase accessory proteins complex with DNA. J B i o l C h e m , 1993. 268(21): p. 15721-30.  72.  S m i t h , K . C , Photochemical addition of amino acids to 14C-uracil. B i o c h e m B i o p h y s  Res C o m m u n , 1969. 34(3): p. 354-7.  73.  Schott, H . N . a n d M . D . Shetlar, Photochemical addition of amino acids to thymine.  B i o c h e m B i o p h y s Res C o m m u n , 1974. 59(3): p. 1112-6.  74.  D i z d a r o g l u , M . a n d M . G . Simic, Radiation-induced crosslinks between thymine  and phenylalanine. Int J R a d i a t B i o l Relat S t u d P h y s C h e m M e d , 1985. 47(1): p . 63-9.  75.  R e e v e , A . E . a n d T . R . H o p k i n s , P h o t o c h e m P h o t o b i o l , 1980. 31: p . 297-304.  76.  A l e x a n d e r , H . a n d G . L e i d y , Determination of inherited traits of H. influenzae by  desoxyribonucleic acid fractions isolated from type-specific cells. J. E x p . M e d . , 1951. 93: p . 345-359.  77.  S a m b r o o k , J., E.F. Fritsch, a n d T. M a n i a t i s , Molecular Cloning: A Laboratory  Manual. S e c o n d E d i t i o n ed, ed. e. C . N o l a n . 1989, N e w Y o r k , U S A : C o l d S p r i n g H a r b o u r L a b o r a t o r y Press.  78.  A l e x a n d e r , H . , G . L e i d y , a n d E. H a h n , Studies on the nature of Hemophilus  influenzae cells susceptible to heritable changes by desoxyribonucleic acids.']. E x p . M e d . , 1954. 99: p . 505-533.  79.  Barcak, G.J., et ai, Genetic systems in Haemophilus influenzae. M e t h o d s i n  E n z y m o l . , 1991. 204: p. 321-342.  94  . 80.  .  Bibliography  M c C a r t h y , D . , Cloning of the rec-2 locus of Haemophilus influenzae. G e n e , 1989.  75(1): p . 135-43.  .81.  H a n a h a n , D . , Studies on transformation of Escherichia coli with plasmids. J. M o l .  B i o l . , 1983.166: p . 557-580.  82.  H e r r i o t t , R . M . , E . M , M e y e r , a n d M . V o g t , Defined nongroioth media for stage II  development of competence in Haemophilus influenzae. J Bacteriol, 1970.101(2): p . 517-24. 83.  W i l l i a m s , P . , : W . L . H u n g , a n d R.J. Redfield, Cell transfer by filtration: evaluation  of protocols for transformational competence. F E M S M i c r o . Letts., 1996. 137(2-3): p. 183187.  84.  Stuy, J., Effect of glycerol on Haemophilus influenzae tmnsfection. J. Bacteriol.,  1986.166(1): p . 285-289.  85.  A u s u b e l , F., et al, eds. Current Protocols in Molecular Biology.. 1993,  Greene/Wiley. 86.  S h a r p , P . A . , B. S u g d e n , a n d J. Sambrook, Detection of two restriction  endonuclease activities in Haemophilus parainfluenzae using analytical agarose-ethidium bromide electrophoresis. B i o c h e m i s t r y , 1973.12(16): p. 3055-63.  87.  P r o m e g a , Technical Manual. pGEM-T and pGEM-T easy vector systems. 1999.  88.  H o , D . T . , D . M . Sauve, a n d M . Roberge, Detection and isolation of  DNA-binding  proteins using single-pulse ultraviolet laser crosslinking. A n a l B i o c h e m , 1994. 218(2): p. 248-54.  89.  M a k e l a , P . H . , Unencapsulated Haemophilus influenzae-what kind of pathogen ? E u r  J C l i n M i c r o b i o l Infect D i s , 1988. 7(5): p. 606-9.  95  :  90.  :  Bibliography  W i e s e , A . , et al, The dual role of lipopolysaccharide as effector and target molecule.  B i o l C h e m , 1999. 380(7-8): p . 767-84.  91.  D a n n e r , D . a n d H . O . S m i t h , Sequence-specific and non-sequence-specific  components of DNA recognition in Haemophilus transformation., i n Gene Transfer and Cancer., M . P e a r s o n a n d N . Sternberg, E d i t o r s . 1984, R a v e n Press: N e w Y o r k . p . 1-7.  92.  S e e m a n , N . C , J . M . R o s e n b e r g , a n d A . R i c h , Sequence-specific recognition of  double helical nucleic acids by proteins. Proc N a t l A c a d Sci U S A , 1976. 73(3): p. 804-8. 93.  C a n n , J.R., Theoretical studies on the mobility-shift, assay of protein-DNA complexes.  E l e c t r o p h o r e s i s , 1998.19(2): p . 127-41.  94.  S h e r m a n , P . A . , P . V . Basta, a n d J.P. T i n g , Upstream DNA sequences required for  tissue-specific expression of the HLA-DR alpha gene. Proc N a t l A c a d Sci U S A , 1987. 84(12): p . 4254-8.  95.  Postel, E . H . a n d S . H . G o o d g a l , Uptake of "single-stranded" DNA in Hemophilus  influenzae and its ability to transform. Journal of M o l e c u l a r B i o l o g y , 1966. 16(2): p . 31727.  96  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0089616/manifest

Comment

Related Items