Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Characterization and developmental expression patterns of the ubiquitin-conjugating enzyme UBC-2 in the… Stevens, Tracy Alison 1999

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_2000-487210.pdf [ 8.66MB ]
Metadata
JSON: 831-1.0089521.json
JSON-LD: 831-1.0089521-ld.json
RDF/XML (Pretty): 831-1.0089521-rdf.xml
RDF/JSON: 831-1.0089521-rdf.json
Turtle: 831-1.0089521-turtle.txt
N-Triples: 831-1.0089521-rdf-ntriples.txt
Original Record: 831-1.0089521-source.json
Full Text
831-1.0089521-fulltext.txt
Citation
831-1.0089521.ris

Full Text

Characterization and developmental expression patterns of the ubiquitin-conjugating enzyme UBC-2 in the nematode Caenorhabditis elegans by Tracy Alison Stevens B . S c , University o f British Columbia, 1985 M . S c , Portland State University, 1989 A THESIS S U B M I T T E D I N P A R T I A L F U L F I L M E N T OF T H E R E Q U I R E M E N T S F O R T H E D E G R E E OF D O C T O R OF P H I L O S O P H Y in T H E F A C U L T Y OF G R A D U A T E STUDIES Genetics Program We accept this thesis as conforming to the required standard T H E U N I V E R S I T Y OF B R I T I S H C O L U M B I A December, 1999 © Tracy Alison Stevens, 1999 I n p r e s e n t i n g t h i s t h e s i s i n p a r t i a l f u l f i l m e n t o f t h e r e q u i r e m e n t s f o r a n a d v a n c e d d e g r e e at T h e U n i v e r s i t y o f B r i t i s h C o l u m b i a , I a g r e e t h a t t h e L i b r a r y s h a l l m a k e it f r e e l y a v a i l a b l e f o r r e f e r e n c e a n d s t u d y . I f u r t h e r a g r e e t h a t p e r m i s s i o n f o r e x t e n s i v e c o p y i n g o f t h i s t h e s i s f o r s c h o l a r l y p u r p o s e s m a y b e g r a n t e d b y t h e H e a d o f m y D e p a r t m e n t o r b y h i s o r h e r r e p r e s e n t a t i v e s . It i s u n d e r s t o o d t h a t c o p y i n g o r p u b l i c a t i o n o f t h i s t h e s i s f o r f i n a n c i a l g a i n s h a l l n o t b e a l l o w e d w i t h o u t m y w r i t t e n p e r m i s s i o n . G e n e t i c s P r o g r a m T h e U n i v e r s i t y o f B r i t i s h C o l u m b i a 6 3 5 6 A g r i c u l t u r a l R d . V a n c o u v e r , B.C., C a n a d a V 6 T 1 Z 2 D a t e : D e c e m b e r 21, 1 9 9 9 ABSTRACT T h e r o l e o f t h e e s s e n t i a l u b i q u i t i n - c o n j u g a t i n g e n z y m e , U B C - 2 , d u r i n g d e v e l o p m e n t i n t h e n e m a t o d e Caenorhabditis elegans w a s e x a m i n e d . T h e m u t a n t s t r a i n , let-70, w h i c h c o r r e s p o n d e d t o ubc-2, w a s L 3 l a r v a l l e t h a l , a n d i n d i c a t e d t h a t U B C - 2 w a s r e q u i r e d p o s t -e m b r y o n i c a l l y . A d d i t i o n a l l y , a m a t e r n a l c o n t r i b u t i o n o f U B C - 2 w a s n e c e s s a r y f o r e m b r y o n i c d e v e l o p m e n t . D e t a i l e d a n a l y s i s o f let-70(sl 132) a n d let-70(s689) m u t a n t p h e n o t y p e s r e v e a l e d d e f e c t s i n m u s c l e c e l l p o s i t i o n i n g , a t t a c h m e n t a n d s a r c o m e r e a s s e m b l y . I n t e s t i n a l c e l l a t t a c h m e n t a n d m a t u r a t i o n w e r e a l s o a f f e c t e d . A s m a l l n u m b e r o f let-70(s689) m u t a n t s d e v e l o p e d i n t o s t e r i l e a d u l t s w i t h g o n a d a l d e f e c t s . I n t h e s e m u t a n t s , t h e s o m a t i c g o n a d a n d v u l v a d i d n o t d e v e l o p p r o p e r l y , o n l y a s m a l l n u m b e r o f g e r m c e l l s w e r e p r o d u c e d , a n d o o c y t e s a n d s p e r m a t o c y t e s f a i l e d t o m a t u r e . U B C - 2 p r o t e i n w a s u n d e t e c t a b l e i n let-70(sl 132) a n d let-70(s689) m u t a n t s . T h e let-70(s689) m u t a t i o n a l t e r e d t h e s p l i c e d o n o r sit e o f t h e f o u r t h i n t r o n . I n a f f e c t e d a n i m a l s , t h e f o u r t h i n t r o n w a s n o t r e m o v e d f r o m t h e ubc-2 p r e - m R N A , a n d t h e t r a n s c r i p t w a s s u b j e c t t o s/ w g - m e d i a t e d m R N A s u r v e i l l a n c e . T h e m u t a n t U B C - 2 p r o t e i n p r o d u c e d i n let-70(sl 132) a p p e a r e d t o b e h i g h l y u n s t a b l e . T h e let-x(s2293) s t r a i n w a s i d e n t i f i e d i n a n o n - c o m p l e m e n t a t i o n s c r e e n f o r a d d i t i o n a l a l l e l e s o f let-70 a n d w a s a l a r g e d e l e t i o n t h a t s p a n n e d s e v e r a l e s s e n t i a l g e n e s , i n c l u d i n g ubc-2. T h e U B C - 2 e x p r e s s i o n p a t t e r n d u r i n g d e v e l o p m e n t w a s d e t e r m i n e d b y i m m u n o f l u o r e s c e n c e s t a i n i n g a n d e x a m i n a t i o n o f t r a n s g e n i c a n i m a l s c a r r y i n g a U B C - 2 : : G F P f u s i o n c o n s t r u c t . U B C - 2 e x p r e s s i o n w a s l a r g e l y t i s s u e g e n e r a l i n e m b r y o n i c s t a g e s . P o s t -e m b r y o n i c a l l y , U B C - 2 r e m a i n e d t i s s u e g e n e r a l , a l t h o u g h a l a r g e a m o u n t o f p r o t e i n b e c a m e c o n c e n t r a t e d i n t h e n u c l e o l i o f a n u m b e r o f c e l l s , i n c l u d i n g i n t e s t i n a l , b o d y w a l l m u s c l e , h y p o d e r m a l , s o m a t i c g o n a d , g e r m l i n e , p h a r y n g e a l m u s c l e , p h a r y n g e a l - i n t e s t i n a l v a l v e a n d s e v e r a l n e u r o n s . I n a d d i t i o n , U B C - 2 l o c a l i z e d t o t h e d e n s e b o d i e s o r M - l i n e s o f b o d y w a l l m u s c l e , a n d a f e w n e u r o n a l c e l l p r o c e s s e s . I n let-70 m u t a n t s , t h i s e x p r e s s i o n p a t t e r n w a s l o s t . S o m a t i c a n d g e r m l i n e e x p r e s s i o n o f a n e x t r a c h r o m o s o m a l a r r a y t h a t c o n t a i n e d ubc-2 c o u l d r e s c u e let-70(s689), b u t n o t let-70(sl 132) m u t a n t s . A c o l d - s e n s i t i v e a l l e l e o f ubc-2 w a s c o n s t r u c t e d w h i c h w a s a l s o c a p a b l e o f r e s c u i n g let-70(s689) m u t a n t s i n a t e m p e r a t u r e -d e p e n d e n t m a n n e r . ubc-2 f o r m s p a r t o f a p o l y c i s t r o n i c u n i t w i t h t w o o t h e r g e n e s , apg-7 a n d Y 5 F 2 A . 4 . B o t h ubc-2 a n d Y 5 F 2 A . 4 a r e e x c l u s i v e l y S L l - s p l i c e d w h i l e apg-7 i s S L 1 - a n d S L 2 - s p l i c e d . ii Comparison of the ubc-2 polypeptide sequence between C. elegans and C. briggsae revealed 100% identity; however, C. briggsae UBC-2 was unable to rescue let-70 mutants. A high degree of synteny exists between the genomic sequences surrounding the C. elegans and C. briggsae ubc-2 genes, with the exception of sequences immediately surrounding the ubc-2 operon. iii TABLE OF CONTENTS A B S T R A C T i i T A B L E O F C O N T E N T S i v L I S T O F T A B L E S i x L I S T O F F I G U R E S x L I S T O F A B B R E V I A T I O N S x i A C K N O W L E D G E M E N T S x i v I. I N T R O D U C T I O N 1 1. U b i q u i t i n - m e d i a t e d p r o t e i n d e g r a d a t i o n - a n o v e r v i e w 1 2. T h e u b i q u i t i n s y s t e m 1 2.1 U b i q u i t i n 1 2.2 U b i q u i t i n c o n j u g a t i o n 2 2.3 D e g r a d a t i o n o f u b i q u i t i n a t e d p r o t e i n s 5 2.4 R e c y c l i n g o f u b i q u i t i n 6 3. E n z y m e s o f t h e u b i q u i t i n s y s t e m 6 3.1 U b i q u i t i n - a c t i v a t i n g e n z y m e s 6 3.2 U b i q u i t i n - c o n j u g a t i n g e n z y m e s 7 3.3 U b i q u i t i n - p r o t e i n l i g a s e s 8 4. T h e U B C 4 b r a n c h o f u b i q u i t i n - c o n j u g a t i n g e n z y m e s 9 5. R o l e s o f t h e U B C 4 b r a n c h o f u b i q u i t i n - c o n j u g a t i n g e n z y m e s 10 5.1 S t r e s s r e s p o n s e 11 5.2 C e l l c y c l e p r o g r e s s i o n 11 5.2.1 R o l e o f u b i q u i t i n - d e p e n d e n t d e g r a d a t i o n i n t h e G l / S t r a n s i t i o n 12 5.2.2 U b i q u i t i n - d e p e n d e n t p r o t e o l y s i s a n d t h e a n a p h a s e p r o m o t i n g c o m p l e x 13 5.3 D e g r a d a t i o n o f t h e t r a n s c r i p t i o n f a c t o r s c - F o s a n d c - J u n 14 5.4 P r o c e s s i n g o f N F - K B 15 5.5 U b i q u i t i n - d e p e n d e n t d e g r a d a t i o n o f I K B a n d t h e Drosophila h o m o l o g , C a c t u s . . . . 15 5.6 T h e W n t / W g p a t h w a y 16 5.7 U b i q u i t i n a t i o n o f p 5 3 17 6. C. elegans as a m o d e l o r g a n i s m 18 6.1 E m b r y o n i c a n d l a r v a l d e v e l o p m e n t 19 6.2 G o n a d a l d e v e l o p m e n t a n d a n a t o m y 2 0 iv 6.3 I n t e s t i n a l s t r u c t u r e 2 3 6.4 M u s c l e s t r u c t u r e a n d d e v e l o p m e n t . 23 6.4.1 M u s c l e c o m p o s i t i o n 2 6 6.4.2 M u s c l e d e v e l o p m e n t 2 8 6.5 cis- a n d fr-cws-splicing o f C. elegans g e n e t r a n s c r i p t s 31 6.6 O p e r o n s i n C. elegans 31 7. U B C - 2 c h a r a c t e r i z a t i o n 3 2 8. T h e p r e s e n t s t u d y 3 2 II. M A T E R I A L S A N D M E T H O D S 3 5 1. N e m a t o d e s t r a i n s a n d c u l t u r e c o n d i t i o n s 3 5 1.1 C u l t u r e a n d m a i n t e n a n c e o f s t r a i n s 3 5 1.2 S t r a i n s u t i l i z e d i n t h i s s t u d y 3 5 2. N e m a t o d e a n a l y s i s a n d g e n e t i c s 3 6 2.1 N e m a t o d e m a t i n g s 3 6 2.2 S t r a i n o u t c r o s s e s 3 6 2.3 C o n s t r u c t i o n o f t r a n s g e n i c let-70 s t r a i n s 3 7 2.4 C o n s t r u c t i o n o f let-70 smg-1 d o u b l e m u t a n t s 3 7 2.5 C o m p l e m e n t a t i o n c r o s s e s 3 7 2.6 D A P I s t a i n i n g 3 9 2.7 M i c r o s c o p y 3 9 3. G e n e r a l D N A a n d R N A t e c h n i q u e s 4 0 3.1 R e s t r i c t i o n e n d o n u c l e a s e d i g e s t i o n o f D N A 4 0 3.2 E n z y m a t i c m a n i p u l a t i o n s o f D N A 4 0 3.3 P u r i f i c a t i o n o f p l a s m i d D N A f r o m E. coli 4 0 3.4 B a c t e r i a l t r a n s f o r m a t i o n 41 3.5 P o l y m e r a s e c h a i n r e a c t i o n 41 3.6 N e m a t o d e P C R 41 3.6.1 S i n g l e e m b r y o P C R 41 3.6.2 L o n g d i s t a n c e P C R 41 3.7 D N A s e q u e n c i n g 4 2 3.8 G e n o m i c D N A i s o l a t i o n 4 2 3.9 R a n d o m p r i m e r e x t e n s i o n 4 2 v 3.10 G e n o m i c S o u t h e r n b l o t 4 3 3.11 T o t a l R N A e x t r a c t i o n 4 3 3.12 F i r s t s t r a n d c D N A s y n t h e s i s 4 4 3.13 S y n t h e s i s o f d o u b l e - s t r a n d e d R N A 4 4 3.14 C o m p u t e r a n a l y s i s 4 5 4. P r o t e i n a n d i m m u n o l o g i c a l t e c h n i q u e s 4 5 4.1 O v e r e x p r e s s i o n a n d p u r i f i c a t i o n o f U B C - 2 f u s i o n p r o t e i n 4 5 4.2 P r e p a r a t i o n o f C. elegans p r o t e i n e x t r a c t 4 6 4.3 S D S - p o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s 4 6 4.4 W e s t e r n b l o t a n a l y s i s 4 6 4.5 I m m u n o s t a i n i n g o f W e s t e r n b l o t s 4 6 5. I m m u n o f l u o r e s c e n c e s t a i n i n g 4 7 5.1 I m m u n o s t a i n i n g o f e m b r y o s 4 7 5.2 I m m u n o s t a i n i n g o f l a r v a e a n d a d u l t s 4 8 5.2.1 F o r m a l d e h y d e f i x a t i o n m e t h o d 4 8 5.2.'2 F r e e z e - f r a c t u r e m e t h o d 4 8 5.3 A n t i b o d i e s u s e d i n t h i s s t u d y 4 9 6. M e t h o d s r e l a t e d t o t r a n s g e n i c s t u d i e s 5 0 6.1 C o n s t r u c t i o n o f ubc-2: : G F P f u s i o n s 5 0 6.2 C o n s t r u c t i o n o f a t e m p e r a t u r e - s e n s i t i v e let-70 a l l e l e 51 6.3 P r e p a r a t i o n o f D N A f o r i n j e c t i o n i n t o n e m a t o d e s 51 6.3.1 C o - i n j e c t i o n s o l u t i o n s 51 6.3.2 I n j e c t i o n m i x t u r e s c o n t a i n i n g c a r r i e r D N A 51 6.4 E s t a b l i s h m e n t o f t r a n s g e n i c C. elegans s t r a i n s 5 2 6.5 S e l e c t i o n o f t r a n s f o r m e d p r o g e n y 5 2 III. R E S U L T S ...53 1. P h e n o t y p e o f let- 70 m u t a n t s 53 1.1 P h e n o t y p e o f let-70(sl 132) h e r m a p h r o d i t e s 53 1.2 P h e n o t y p e o f let-70(s689) h e r m a p h r o d i t e s 53 1.3 P h e n o t y p e o f let-70 m a l e s 5 9 2. T h e let-70(s689) m u t a t i o n i s a s p l i c i n g e r r o r 5 9 2.1 s/wg-mediated s u r v e i l l a n c e i n let-70(s689) m u t a n t s 6 0 vi 3. W e s t e r n a n a l y s i s o f U B C - 2 i n w i l d t y p e a n d let-70 m u t a n t s 6 2 4. R N A i n t e r f e r e n c e 6 2 4.1 R N A i n t e r f e r e n c e u s i n g G F P 6 5 4.2 R N A i n t e r f e r e n c e u s i n g ubc-2 6 5 5. N o n - c o m p l e m e n t a t i o n s c r e e n f o r n e w let-70 a l l e l e s 6 6 5.1 G e n e t i c c h a r a c t e r i z a t i o n o f let-x(s2293) 6 9 5.2 T h e let-x(s2293) m u t a t i o n i s a l a r g e d e l e t i o n 7 2 6. I m m u n o f l u o r e s c e n t s t a i n i n g o f w i l d t y p e a n d let-70 e m b r y o s , l a r v a e a n d a d u l t s 7 6 6.1 U B C - 2 s t a i n i n g i n e m b r y o s 7 6 6.2 U B C - 2 s t a i n i n g i n l a r v a e a n d a d u l t s 8 2 7. C o n s t r u c t i o n o f t r a n s g e n i c ubc-2::GFP a n i m a l s 8 9 7.1 E x p r e s s i o n o f ubc-2: : G F P i n t r a n s g e n i c l i n e s c a r r y i n g p T S 2 . 2 8 9 7.2 E x p r e s s i o n o f ubc-2: : G F P i n t r a n s g e n i c l i n e s c a r r y i n g p T S l . l 9 5 8. D N A - m e d i a t e d t r a n s f o r m a t i o n r e s c u e o f let-70 9 5 8.1 N 2 g e n o m i c D N A f r a g m e n t s d o n o t r e s c u e let-70 9 9 8.2 G e r m l i n e a n d s o m a t i c e x p r e s s i o n o f p Z M 1 3 c a n r e s c u e let-70(s689) 9 9 8.3 G e r m l i n e a n d s o m a t i c e x p r e s s i o n o f p Z M 1 3 d o e s n o t r e s c u e let-70(sl 132) 1 0 0 9. D N A - m e d i a t e d t r a n s f o r m a t i o n r e s c u e w i t h a t e m p e r a t u r e - s e n s i t i v e ubc-2 a l l e l e 1 0 0 10. C. briggsae f o s m i d i d e n t i f i c a t i o n , s e q u e n c i n g a n d c o m p a r i s o n t o C. elegans 104 10.1 I d e n t i f i c a t i o n a n d s e q u e n c i n g o f C. briggsae f o s m i d G 4 7 J 1 1 1 0 4 10.2 S e q u e n c i n g a n d c o m p a r i s o n o f Cb-ubc-2 w i t h Ce-ubc-2 105 10.3 Cb-ubc-2 d o e s n o t r e s c u e let-70 m u t a n t s 105 10.4 O r g a n i z a t i o n a n d s e q u e n c i n g o f r e g i o n s f l a n k i n g ubc-2 108 10.5 ubc-2 is p a r t o f a p o l y c i s t r o n i c u n i t 1 0 8 10.6 r r a « 5-splicing o f g e n e s i n t h e p o l y c i s t r o n i c u n i t I l l 10.7 S y n t e n i c c o n s e r v a t i o n i n t h e ubc-2 r e g i o n b e t w e e n C. elegans a n d C. briggsaeWi I V . D i s c u s s i o n 1 1 7 1. S u m m a r y 1 1 7 2. C o m p a r a t i v e g e n o m i c a n a l y s i s oi ubc-2 1 1 7 3. Iet-70(s689) i s s u b j e c t t o s/wg-mediated m R N A s u r v e i l l a n c e 1 2 0 4. let-70(sl 132) a n i m a l s p r o d u c e a n u n s t a b l e f o r m o f U B C - 2 1 2 2 5. U B C - 2 s t r u c t u r e : i n s i g h t s f r o m a t e m p e r a t u r e - s e n s i t i v e a l l e l e 1 22 vii 6. B o t h m a t e r n a l a n d p o s t - e m b r y o n i c c o n t r i b u t i o n s o f U B C - 2 a r e r e q u i r e d 123 7. U B C - 2 i s r e q u i r e d i n b o t h s o m a t i c a n d g e r m l i n e t i s s u e 1 24 8. T h e p o s s i b l e r o l e o f U B C - 2 i n C. elegans s i g n a l l i n g p a t h w a y s 125 8.1 I n t e g r i n - m e d i a t e d a n d M A P K s i g n a l l i n g p a t h w a y s 125 8.2 T h e W n t / W g p a t h w a y 1 3 0 8.3 N F - K B - m e d i a t e d s i g n a l l i n g 135 8.4 T r a n s c r i p t i o n a l r e g u l a t i o n d u r i n g m y o g e n e s i s 1 3 6 8.5 C e l l c y c l e r e g u l a t i o n 1 3 6 9. U B C - 2 i n t h e n u c l e o l u s 1 3 8 10. C o n c l u s i o n s a n d p r o s p e c t s 141 V . R E F E R E N C E S 143 V I . A P P E N D I C E S 1 6 7 A. C. elegans s t r a i n s u t i l i z e d i n s t u d y 1 6 7 B . T r a n s g e n i c s t r a i n s u t i l i z e d i n t h e p r e s e n t s t u d y 1 6 7 C. T r a n s g e n i c s t r a i n s p r o d u c e d i n t h e p r e s e n t s t u d y 1 6 7 D . L i s t o f o l i g o n u c l e o t i d e s e q u e n c e s 1 6 8 E . L i n k e r s e q u e n c e u t i l i z e d i n s t u d y 1 6 9 viii LIST OF TABLES T a b l e 1. A n t i b o d y d i l u t i o n s u s e d f o r i m m u n o s t a i n i n g a n d t h e i r s p e c i f i c i t y 5 0 T a b l e 2. E f f e c t o f ubc-2 d s R N A i n t e r f e r e n c e o n C. elegans d e v e l o p m e n t 6 6 T a b l e 3. P r i m e r p a i r c o m b i n a t i o n s u s e d t o a m p l i f y ubc-2 i n w i l d t y p e a n d let-x(s2293) e m b r y o s 7 5 T a b l e 4. S u m m a r y o f D N A - m e d i a t e d t r a n s f o r m a t i o n r e s c u e e x p e r i m e n t s 9 8 ix LIST OF FIGURES F i g u r e 1. M a j o r e n z y m a t i c s t e p s i n t h e u b i q u i t i n p r o t e o l y t i c p a t h w a y 4 F i g u r e 2. O r g a n i z a t i o n o f t h e h e r m a p h r o d i t e a n d m a l e g o n a d 2 2 F i g u r e 3. C. elegans a n a t o m y a n d m u s c l e o r g a n i z a t i o n 2 5 F i g u r e 4. E m b r y o n i c m u s c l e a s s e m b l y i n C. elegans 3 0 F i g u r e 5. S e q u e n c e o f let-70(ubc-2) w i l d t y p e a n d m u t a n t a l l e l e s 3 4 F i g u r e 6. N o n - c o m p l e m e n t a t i o n s c r e e n f o r let-70 a l l e l e s 3 8 F i g u r e 7. I n t e s t i n a l d e f e c t s i n let-70(sl 132) a n d let-70(s689) m u t a n t a n i m a l s 55 F i g u r e 8. G o n a d a l d e f e c t s i n let-70(s689) m u t a n t a n i m a l s 5 8 F i g u r e 9. T h e f o u r t h i n t r o n o f ubc-2 i s n o t s p l i c e d f r o m let-70(s689) p r e - r n R N A 61 F i g u r e 10. U B C - 2 i s e x t r e m e l y l o w o r a b s e n t i n let-70(sl 132) o r let-70(s689) a n i m a l s 6 4 F i g u r e 11. T h e R N A i n t e r f e r e n c e p h e n o t y p e i s l a r v a l a r r e s t 6 8 F i g u r e 12. Iet-x(s2293) a r r e s t e d e m b r y o s d o n o t e x p r e s s U B C - 2 a n d d i s p l a y s e v e r e m u s c l e d e v e l o p m e n t a l d e f e c t s 71 F i g u r e 13. Iet-x(s2293) i s a l a r g e d e l e t i o n t h a t r e m o v e s ubc-2 a n d s e v e r a l o t h e r g e n e s 7 4 F i g u r e 14. T h e i m m u n o l o c a l i z a t i o n o f a n t i - U B C - 2 i s U B C - 2 - s p e c i f i c 7 8 F i g u r e 15. I m m u n o l o c a l i z a t i o n o f U B C - 2 i n w i l d t y p e a n d let-70 m u t a n t e m b r y o s 81 F i g u r e 16. I m m u n o l o c a l i z a t i o n o f U B C - 2 i n w i l d t y p e l a r v a e 8 4 F i g u r e 17. I m m u n o l o c a l i z a t i o n o f U B C - 2 i n t h e h e a d r e g i o n o f w i l d t y p e a n i m a l s 8 6 F i g u r e 18. I m m u n o l o c a l i z a t i o n o f U B C - 2 i n let-70 m u t a n t a n i m a l s 8 8 F i g u r e 19. U B C - 2 : : G F P f u s i o n p r o t e i n is e x p r e s s e d i n a n u m b e r o f t i s s u e s i n C. elegans 9 2 F i g u r e 20. U B C - 2 : : G F P i s e x p r e s s e d i n s e v e r a l n e u r o n s 9 4 F i g u r e 2 1 . U B C - 2 : : G F P i s e x p r e s s e d i n t h e m u s c l e n u c l e u s a n d i n t h e s a r c o m e r e 9 7 F i g u r e 22. Iet-70(s689) i s p a r t i a l l y r e s c u e d b y s o m a t i c e x p r e s s i o n o f ubc-2 t r a n s g e n i c a r r a y s a n d i s f u l l y r e s c u e d b y s o m a t i c a n d g e r m l i n e e x p r e s s i o n o f ubc-2 102 F i g u r e 23. C. elegans a n d C. briggsae ubc-2 p o l y p e p t i d e s e q u e n c e s a r e a b s o l u t e l y c o n s e r v e d 1 0 7 F i g u r e 24. G e n o m i c o r g a n i z a t i o n o f t h e C. elegans a n d C. briggsae ubc-2 r e g i o n 1 1 0 F i g u r e 25. ubc-2 i s p a r t o f a p o l y c i s t r o n i c u n i t t h a t i n c l u d e s apg-7 a n d a z i n c - f i n g e r g e n e , a n d i s e x c l u s i v e l y S L 1 - s p l i c e d 113 F i g u r e 26. M o d e l o f p r o p o s e d C. elegans a d h e s i o n c o m p l e x c o m p o n e n t s 1 28 F i g u r e 27. M o d e l f o r t h e a c t i o n o f W n t A V g s i g n a l l i n g p a t h w a y c o m p o n e n t s 1 3 2 LIST OF ABBREVIATIONS A a n g s t r o m A P C a d e n o m a t o u s p o l y p o s i s c o l i A P C / C a n a p h a s e p r o m o t i n g c o m p l e x / c y c l o s o m e apr A P C - r e l a t e d A r m a r m a d i l l o A T P a d e n o s i n e t r i p h o s p h a t e P-cat P-catenin p - T r C P f M r a n s d u c i n r e p e a t - c o n t a i n i n g p r o t e i n B L A S T b a s i c l o c a l a l i g n m e n t s e a r c h t o o l b p b a s e p a i r s C d c c e l l d i v i s i o n c y c l e C D K c y c l i n - d e p e n d e n t k i n a s e c D N A c o m p l e m e n t a r y d e o x y r i b o n u c l e i c a c i d deb d e n s e b o d y c o m p o n e n t D N A d e o x y r i b o n u c l e i c a c i d dpy d u m p y D s h d i s h e v e l e d D T T d i t h i o t h r e i t o l E l u b i q u i t i n - a c t i v a t i n g e n z y m e E 2 u b i q u i t i n - c o n j u g a t i n g e n z y m e E 3 u b i q u i t i n l i g a s e E C L e n h a n c e d c h e m i l u m i n e s c e n c e E C M e x t r a c e l l u l a r m a t r i x E G F e p i d e r m a l g r o w t h f a c t o r E R e n d o p l a s m i c r e t i c u l u m F l f i r s t f i l i a l g e n e r a t i o n F 2 s e c o n d f i l i a l g e n e r a t i o n F A C f o c a l a d h e s i o n c o m p l e x F A K f o c a l a d h e s i o n k i n a s e F G F f i b r o b l a s t g r o w t h f a c t o r F z f r i z z l e d xi ges gut esterase GFP green fluorescent protein gon gonad development abnormal GSK-3P glycogen synthase kinase-3f3 hlh helix-ioop-helix HM silent mating type loci I K B inhibitor of N F - K B ILK integrin-linked kinase kb kilobase kDa kiloDalton let lethal lev levamisole resistant Un abnormal cell lineage MAPK mitogen activated protein kinase ml milliliter mm millimeter mM millimolar mom more of MS mRNA messenger ribonucleic acid mu map unit mua muscle-attachment defective mup muscle-positioning defective Net nucleolar silencing establishing factor and telophase regulator N F K B nuclear factor K B NLS nuclear localization signal NMD nonsense-mediated mRNA decay OD optical density PAGE polyacrylamide gel electrophoresis pat paralyzed, arrested elongation at two-fold PBS phosphate buffered saline PCR polymerase chain reaction PKC protein kinase C xii pop p o s t e r i o r p h a r y n x - d e f e c t i v e R a d r a d i a t i o n s e n s i t i v i t y a b n o r m a l R E N T r e g u l a t o r o f n u c l e o l a r s i l e n c i n g a n d t e l o p h a s e rol r o l l e r r p m r e v o l u t i o n s p e r m i n u t e S C F S k p l - C d c 5 3 / C U L l - F - b o x p r o t e i n S D S s o d i u m d o d e c y l s u l f a t e S L s p l i c e d l e a d e r S l i m b s u p e r n u m e r a r y l i m b s smg s u p p r e s s o r a f f e c t i n g m e s s a g e s t a b i l i t y T r i s t r i s ( h y d r o x y m e t h y l ) a m i n o m e t h a n e U B C u b i q u i t i n - c o n j u g a t i n g e n z y m e U b p u b i q u i t i n p r o t e a s e U C H u b i q u i t i n C - t e r m i n a l h y d r o l a s e u g m i c r o g r a m u l m i c r o l i t e r unc u n c o o r d i a n t e d m o v e m e n t U V u l t r a v i o l e t W g w i n g l e s s wrm w o r m a r m m o t i f Y A C y e a s t a r t i f i c i a l c h r o m o s o m e xiii ACKNOWLEDGEMENTS T h i s t h e s i s i s d e d i c a t e d t o t h e m e m o r y o f m y f a t h e r , R a y m o n d D o u g l a s S t e v e n s , w h o p a s s e d a w a y w h i l e t h i s w o r k w a s i n p r o g r e s s . A l l t h e l o v e a n d c a r i n g y o u g a v e t o m e w i l l r e m a i n i n m y h e a r t f o r e v e r . I w o u l d l i k e t o t h a n k m y s u p e r v i s o r , P e t e r C a n d i d o f o r h i s s u p p o r t a n d v a l u a b l e a d v i c e d u r i n g t h i s p r o j e c t . I a m g r a t e f u l t o m y c o m m i t t e e m e m b e r s D o n M o e r m a n , R o s s M a c G i l l i v r a y a n d I v a n S a d o w s k i f o r t h e i r g u i d a n c e , s u p p o r t a n d c r i t i c a l r e a d i n g o f m y t h e s i s i n s u c h a s h o r t t i m e . T o D a v e B a i l l i e a n d J a c q u e l i n e S c h e i n , t h a n k s f o r i n t r o d u c i n g m e t o w o r m g e n e t i c s , a n d f o r b e i n g p a t i e n t w h i l e I m u t i l a t e d m a n y w o r m s . I w o u l d l i k e t o t h a n k f e l l o w w o r m b r e e d e r s C o l i n T h a c k e r , G r e g M u l l e n a n d K e n N o r m a n f o r i n t e r e s t i n g d i s c u s s i o n s o n w o r m s , s c i e n c e , a n d h o w t o j u m p m y b i k e o v e r a l o g w i t h o u t b r e a k i n g m y n e c k . A s p e c i a l t h a n k s t o C o l i n f o r c r i t i c a l r e a d i n g o f m y t h e s i s . T o t h e p a s t a n d p r e s e n t m e m b e r s o f t h e C a n d i d o l a b , D o n , M e i , E m i l y , L i l y , S a n d r a , D a v e a n d M i c h e l , t h a n k s f o r b e i n g m y s c i e n t i f i c a d v i s o r s as w e l l as m y f r i e n d s . F o r m y m o t h e r , w i t h m u c h l o v e , I t h a n k y o u f o r b e l i e v i n g i n m e a n d f o r s u p p o r t i n g m y c h o i c e s i n l i f e . T o m y f r i e n d s M e g a n C a r s o n , A n d r e a S u s s m a n , A l w y n S p i e s , M a r k S n o w a n d S u e E t t i n g e r , I t h a n k y o u f o r b e i n g a n i m p o r t a n t p a r t o f m y l i f e . Y o u p r o v i d e d m e w i t h u n f a i l i n g m o r a l s u p p o r t , a n d y o u a r e g r e a t p e o p l e t o g o d r i n k i n g , k a y a k i n g , h i k i n g a n d c y c l i n g w i t h . I w i l l a l w a y s b e g r a t e f u l f o r y o u r f r i e n d s h i p . A s p e c i a l t h a n k s t o a l l t h e p a s t a n d p r e s e n t m e m b e r s o f t h e v a r i o u s v o l l e y b a l l t e a m s I p l a y e d on. A b e t t e r g r o u p o f f r i e n d s d o e s n o t e x i s t ! However far you go, you will never find the boundaries of the soul. Heraclitus xiv I. INTRODUCTION 1. UBIQUITIN-MEDIATED PROTEINDEGRADATION-AN OVERVIEW U b i q u i t i n - m e d i a t e d p r o t e i n d e g r a d a t i o n i s b e l i e v e d t o b e t h e m a j o r n o n - l y s o s o m a l p r o t e o l y t i c s y s t e m i n e u k a r y o t i c c e l l s . C i e c h a n o v e r et al. ( 1 9 7 8 ) s h o w e d t h a t i n t r a c e l l u l a r p r o t e i n d e g r a d a t i o n w a s a n A T P - d e p e n d e n t p r o c e s s t h a t r e q u i r e d a c o - f a c t o r , w h i c h w a s l a t e r d e t e r m i n e d t o b e u b i q u i t i n ( W i l k i n s o n et al., 1980). T h i s p r o c e s s i n v o l v e s t h e a t t a c h m e n t o f u b i q u i t i n t o a s p e c i f i c p r o t e i n , w i t h t h e a t t a c h e d u b i q u i t i n t h e n s e r v i n g a s a s i g n a l f o r d e g r a d a t i o n . T a r g e t p r o t e i n r e c o g n i t i o n a n d t h e a t t a c h m e n t o f u b i q u i t i n i s c o n t r o l l e d b y a m u l t i - s t e p e n z y m a t i c p a t h w a y t h a t i n c l u d e s a u b i q u i t i n - a c t i v a t i n g e n z y m e , a m e m b e r o f t h e u b i q u i t i n - c o n j u g a t i n g e n z y m e f a m i l y a n d o n e o r m o r e u b i q u i t i n p r o t e i n l i g a s e s . A m u l t i u b i q u i t i n c h a i n i s f o r m e d o n t h e p r o t e i n a n d i s r e c o g n i z e d b y a l a r g e m u l t i s u b u n i t p r o t e a s e c a l l e d t h e 2 6 S p r o t e a s o m e w h i c h d e g r a d e s t h e t a r g e t p r o t e i n a n d r e l e a s e s p e p t i d e s a n d f r e e u b i q u i t i n . 2. THE UBIQUITIN SYSTEM 2.1 Ubiquitin U b i q u i t i n i s a s m a l l 7 6 a m i n o a c i d p r o t e i n t h a t is p r e s e n t i n a l l e u k a r y o t i c c e l l s . It is c o n s i d e r e d t o b e o n e o f t h e m o s t c o n s e r v e d p r o t e i n s k n o w n i n e u k a r y o t e s , w i t h y e a s t a n d h u m a n u b i q u i t i n d i f f e r i n g b y o n l y t h r e e c o n s e r v a t i v e a m i n o a c i d s u b s t i t u t i o n s ( O z k a y n a k et al, 1 9 8 4 ) . S u c h a h i g h d e g r e e o f e v o l u t i o n a r y c o n s e r v a t i o n i n d i c a t e s t h a t t h e e n t i r e u b i q u i t i n m o l e c u l e h a s b e e n u n d e r i n t e n s e s e l e c t i v e p r e s s u r e . T h e c r y s t a l s t r u c t u r e o f u b i q u i t i n h a s b e e n d e t e r m i n e d t o 1.8-A r e s o l u t i o n ( V i j a y - K u m a r et ai, 1 9 8 7 ) . It i s a c o m p a c t , g l o b u l a r p r o t e i n w i t h a p r o t r u d i n g C - t e r m i n a l g l y c i n e - g l y c i n e t h a t i s i n v o l v e d i n c o v a l e n t i n t e r a c t i o n s w i t h l y s i n e s - a m i n o g r o u p s o n o t h e r p r o t e i n s . U b i q u i t i n g e n e s a r e e n c o d e d i n t w o f o r m s : A s p o l y u b i q u i t i n , i n w h i c h t h e u b i q u i t i n c o d i n g r e g i o n s a r e l i n e d u p h e a d t o t a i l , o r as f u s i o n s t o r i b o s o m a l p r o t e i n s ( F i n l e y et al., 1 9 8 9 ; O z k a y n a k et al., 1984). T h e u b i q u i t i n f u s i o n s a r e t r a n s l a t e d as s i n g l e u n i t s a n d a r e r a p i d l y p r o c e s s e d b y h y d r o l a s e s c a l l e d u b i q u i t i n C - t e r m i n a l h y d r o l a s e s ( U C H ) o r u b i q u i t i n s p e c i f i c p r o t e a s e s ( U b p ) , w h i c h c l e a v e u b i q u i t i n at t h e C - t e r m i n u s ( J o n n a l a g a d d a et al., 1 9 8 9 ; L i u et al., 1 9 8 9 ) . T h e p o l y u b i q u i t i n p r e c u r s o r s t h a t a r e p r o d u c e d c o n t a i n a d d i t i o n a l a m i n o a c i d r e s i d u e s 1 o n t h e C - t e r m i n u s t h a t p r e v e n t c o n j u g a t i o n t o p r o t e i n s ( F i n l e y a n d C h a u , 1 9 9 1 ) . T h e s e r e s i d u e s a r e r e m o v e d b y u b i q u i t i n h y d r o l a s e s p r i o r t o a c t i v a t i o n o f t h e u b i q u i t i n m o i e t y . 2.2 Ubiquitin conjugation U b i q u i t i n i s c o v a l e n t l y a t t a c h e d t o p r o t e i n s i n a m u l t i - s t e p e n z y m a t i c p r o c e s s ( F i g u r e 1). T h e u b i q u i t i n a t i o n o f a p r o t e i n t a r g e t s t h a t p r o t e i n f o r d e g r a d a t i o n b y t h e 2 6 S p r o t e a s o m e . U b i q u i t i n i t s e l f i s f i r s t a c t i v a t e d b y a u b i q u i t i n - a c t i v a t i n g e n z y m e ( E l ) . I n a r e a c t i o n t h a t r e q u i r e s A T P h y d r o l y s i s a n d p r o c e e d s v i a a n a d e n y l a t e i n t e r m e d i a t e , a h i g h - e n e r g y t h i o e s t e r b o n d i s f o r m e d b e t w e e n t h e C - t e r m i n a l g l y c y l r e s i d u e o f u b i q u i t i n a n d a s p e c i f i c c y s t e i n y l r e s i d u e i n t h e E l ( H a a s et al., 1982). U b i q u i t i n i s t h e n t r a n s f e r r e d t o a s p e c i f i c c y s t e i n y l r e s i d u e o f a u b i q u i t i n - c o n j u g a t i n g e n z y m e ( E 2 ; H e r s h k o et al, 1983; P i c k a r t a n d R o s e , 1 9 8 5 ) . E 2 e n z y m e s c a n t r a n s f e r u b i q u i t i n d i r e c t l y t o p r o t e i n s u b s t r a t e s in vitro ( P i c k a r t a n d R o s e , 1 9 8 5 ) ; h o w e v e r , i t i s b e l i e v e d t h a t u b i q u i t i n c o n j u g a t i o n in vivo r e q u i r e s a c c e s s o r y f a c t o r s f o r s u b s t r a t e r e c o g n i t i o n . T h e s e f a c t o r s , c a l l e d u b i q u i t i n l i g a s e s ( E 3 ) c a n f u n c t i o n i n d i f f e r e n t w a y s . O n e c l a s s f u n c t i o n s as a s i n g l e p r o t e i n o r as a m u l t i - p r o t e i n E 3 c o m p l e x a n d s e r v e s t o b r i n g E 2 e n z y m e s a n d s u b s t r a t e s i n c l o s e p r o x i m i t y t o f a c i l i t a t e t h e u b i q u i t i n a t i o n o f t h e s u b s t r a t e d i r e c t l y b y t h e E 2 e n z y m e ( B a i l l y et al., 1994; H e r s h k o , 1 9 9 7 ) . A n o t h e r g r o u p o f E 3 s h a s t h e a b i l i t y t o a c c e p t u b i q u i t i n as a t h i o e s t e r a n d t h u s a c t s as a c a t a l y t i c i n t e r m e d i a t e i n t h e t r a n s f e r o f u b i q u i t i n t o t h e t a r g e t p r o t e i n ( S c h e f f n e r et al, 1 9 9 5 ) . U b i q u i t i n a t t a c h e s t o t h e t a r g e t p r o t e i n b y a n i s o p e p t i d e b o n d t h a t f o r m s b e t w e e n t h e c a r b o x y l - t e r m i n a l g l y c i n e o f u b i q u i t i n a n d t h e e - a m i n o g r o u p o f a l y s y l r e s i d u e i n t h e t a r g e t p r o t e i n ( H e r s h k o , 1991; H e r s h k o et al, 1983; P i c k a r t a n d V e l l a , 1 9 8 8 ) . O n c e t h e f i r s t u b i q u i t i n i s a t t a c h e d t o t h e s u b s t r a t e p r o t e i n , u b i q u i t i n i t s e l f c a n b e c o m e a t a r g e t f o r f u r t h e r u b i q u i t i n a t i o n , r e s u l t i n g i n t h e f o r m a t i o n o f a m u l t i u b i q u i t i n c h a i n ( C h a u et al, 1 9 8 9 ) . P o l y u b i q u i t i n c h a i n s l i n k e d t h r o u g h K 4 8 - G 7 6 i s o p e p t i d e b o n d s r e p r e s e n t t h e p r e d o m i n a n t in vivo t a r g e t i n g s i g n a l i n t h e u b i q u i t i n p a t h w a y ( B a c h m a i r et al, 1 9 8 6 ; F i n l e y et al, 1994; J o h n s o n et al, 1992). T h e r e i s e v i d e n c e , h o w e v e r , t h a t at l e a s t f o u r o t h e r l y s y l r e s i d u e s a r e s i t e s f o r m u l t i u b i q u i t i n c h a i n i n i t i a t i o n . T h e f u n c t i o n a l s i g n i f i c a n c e o f m o s t o f t h e s e c h a i n i n i t i a t i o n s i t e s r e m a i n s t o b e d e t e r m i n e d . I n y e a s t , K 2 9 - l i n k e d d i u b i q u i t i n a n d K 6 3 - l i n k e d c h a i n s y n t h e s i s t h a t i s m e d i a t e d b y t h e E 2 s U b c 4 a n d U b c 5 h a v e b e e n o b s e r v e d ( A r n a s o n a n d E l l i s o n , 1 994; S p e n c e et al, 1 9 9 5 ) . T h e K 6 3 l i n k a g e s a r e i n v o l v e d i n t h e s t r e s s r e s p o n s e as w e l l as D N A r e p a i r . U b c 2 / R a d 6 - m e d i a t e d p o l y u b i q u i t i n c h a i n s that, i n i t i a t e at K 6 a r e f o r m e d 2 Figure 1. Major enzymatic steps in the ubiquitin proteolytic pathway. U b i q u i t i n i s a c t i v a t e d t h r o u g h t h e A T P - d e p e n d e n t f o r m a t i o n o f a h i g h - e n e r g y t h i o e s t e r b o n d w i t h E l a n d t r a n s f e r r e d t o a n E 2 . A p r o t e i n s u b s t r a t e is b o u n d t o a s p e c i f i c u b i q u i t i n l i g a s e , E 3 , a n d a n i n t e r m e d i a r y c o m p l e x i s f o r m e d b e t w e e n E 3 , t h e p r o t e i n s u b s t r a t e a n d E 2 - u b i q u i t i n . U b i q u i t i n i s t r a n s f e r r e d t o a l y s y l r e s i d u e o f t h e p r o t e i n s u b s t r a t e , f o l l o w e d b y f o r m a t i o n o f a m u l t i u b i q u i t i n c h a i n . T h e 2 6 S p r o t e a s o m e u t i l i z e s A T P t o d e g r a d e t h e p r o t e i n s u b s t r a t e i n t o p e p t i d e s , a n d u b i q u i t i n i s r e c y c l e d b y t h e a c t i o n o f i s o p e p t i d a s e s . 3 ATP AMP Ubiquitin — ~ < peptides ADP ATP 26S proteasome o n h i s t o n e s in vitro ( B a b o s h i n a a n d H a a s , 1996), a l t h o u g h t h i s t y p e o f l i n k a g e h a s n o t b e e n d e m o n s t r a t e d in vivo. I n m a m m a l i a n s y s t e m s , t h e k e r a t i n o c y t e - s p e c i f i c e n z y m e E2EPF h a s b e e n s h o w n t o i n i t i a t e p o l y u b i q u i t i n c h a i n f o r m a t i o n o f N - e n d r u l e s u b s t r a t e s a t K l 1 ( B a b o s h i n a a n d H a a s , 1996; L i u et al, 1996). T h e e x i s t e n c e o f t h e s e d i s t i n c t l i n k a g e s , a n d t h e r e c o g n i t i o n t h a t at l e a s t o n e m a y b e i n v o l v e d i n a s p e c i f i c c e l l u l a r p r o c e s s , r a i s e s t h e p o s s i b i l i t y t h a t a l t e r n a t i v e p o l y u b i q u i t i n c h a i n l i n k a g e s m a y r e p r e s e n t a n o v e l m e c h a n i s m f o r s p e c i f y i n g t h e f a t e o f u b i q u i t i n a t e d p r o t e i n s . 2.3 Degradation of ubiquitinated proteins M o s t m u l t i u b i q u i t i n a t e d p r o t e i n s i n t h e e u k a r y o t i c c e l l a r e d e g r a d e d b y t h e 2 6 S p r o t e a s o m e w h i c h c o n t a i n s a 2 0 S c a t a l y t i c c o r e a n d t w o 1 9 S c a p s t h a t a c t as r e g u l a t o r y c o m p l e x e s ( O r i n o et al., 1991; P e t e r s et al-., 1991; P e t e r s et al., 1 9 9 8 ) . T h e c r y s t a l s t r u c t u r e o f t h e 2 0 S p r o t e a s o m e f r o m t h e a r c h a e o n Thermoplasma acidophilum r e v e a l e d a h o l l o w , c y l i n d r i c a l s h a p e d s t r u c t u r e c o m p o s e d o f f o u r s t a c k e d r i n g s ( L o w e et al., 1 9 9 5 ) . T h e t w o i n n e r r i n g s a r e c o m p o s e d o f P t y p e s u b u n i t s w h i l e t h e o u t e r r i n g s a r e a s u b u n i t s . T h e P s u b u n i t s c o n t a i n c a t a l y t i c s i t e s p o s i t i o n e d w i t h i n t h e c e n t r a l c h a n n e l o f t h e p r o t e a s o m e t h a t h a v e c h y m o t r y p s i n - l i k e , t r y p s i n - l i k e a n d p e p t i d y l - g l u t a m y l - p e p t i d e h y d r o l y s i n g a c t i v i t i e s ( L o w e et al, 1995; S e e m t i l l e r et al., 1996). T h e a r i n g s o n e i t h e r e n d o f t h e p r o t e a s o m e f o r m s m a l l p o r e s o f 13 A i n d i a m e t e r w h i c h p r e s u m a b l y a l l o w o n l y u n f o l d e d p r o t e i n s t o t r a v e l t h r o u g h i n t o t h e i n n e r c h a n n e l o f t h e P s u b u n i t s , t h u s p r e v e n t i n g r a n d o m e n t r y a n d d e g r a d a t i o n o f p r o t e i n s b y t h e 2 0 S p r o t e a s o m e . T h e 1 9 S r e g u l a t o r y c o m p l e x is b e l i e v e d t o c o n f e r s u b s t r a t e r e c o g n i t i o n , s u b s t r a t e u n f o l d i n g a n d t h e a b i l i t y t o t r a n s f e r p o l y p e p t i d e c h a i n s t o t h e a c t i v e s i t e s w i t h i n t h e i n n e r c h a n n e l o f t h e p r o t e a s o m e ( P e t e r s et al, 1998). O f t h e 15-17 s u b u n i t s t h a t m a k e u p t h e 1 9 S r e g u l a t o r y c o m p l e x ( D u b i e l et al, 1995), t h e f u n c t i o n o f o n l y a f e w h a v e b e e n e l u c i d a t e d . S i x s u b u n i t s a r e A A A A T P a s e s ( C o n f a l o n i e r i a n d D u g u e t , 1995; G l i c k m a n et al, 1 9 9 8 ) , o n e s u b u n i t ( S 5 a ) b i n d s p o l y u b i q u i t i n c h a i n s a n d p r e s u m a b l y f u n c t i o n s i n s u b s t r a t e s e l e c t i o n ( D e v e r a u x et al, 1 9 9 4 ) a n d o n e s u b u n i t i s a d e u b i q u i t i n a t i n g e n z y m e c a p a b l e o f c l e a v i n g t h e p o l y u b i q u i t i n c h a i n f r o m t h e s u b s t r a t e p r o t e i n , t h u s p r e v e n t i n g t h e d e g r a d a t i o n o f u b i q u i t i n ( G l i c k m a n etal, 1998). T h e p r o t e a s o m e i s a d y n a m i c s t r u c t u r e t h a t a l t e r s i t s f u n c t i o n d e p e n d i n g o n t h e n e e d s o f t h e c e l l . O n e o f it s f u n c t i o n s i s i n a n t i g e n p r e s e n t a t i o n . I n m a m m a l s t w o P s u b u n i t s , L M P 2 5 a n d L M P 7 a r e i n d u c e d b y y - i n t e r f e r o n a n d s p e c i f i c a l l y r e p l a c e t h e (3 s u b u n i t s , 5 a n d M B 1 , r e s p e c t i v e l y ( F r u h et al., 1994). T h i s m o d i f i c a t i o n c a u s e s a c h a n g e i n t h e c l e a v a g e a c t i v i t i e s o f t h e p r o t e a s o m e b y e n h a n c i n g t h e c h y m o t r y p s i n - l i k e a n d t r y p s i n - l i k e a c t i v i t i e s . I n a d d i t i o n , a r i n g s h a p e d p a r t i c l e c a l l e d P A 2 8 , w h i c h i s a l s o i n d u c e d b y y - i n t e r f e r o n , c a n a s s e m b l e o n t o t h e e n d s o f t h e 2 0 S p r o t e a s o m e ( G r a y et al., 1994; G r o e t t r u p et al., 1 9 9 6 ) . T h i s a c t i v a t o r c o m p l e x a c t s t o i n c r e a s e t h e r a t e o f a n t i g e n i c p e p t i d e p r o d u c t i o n b y t h e p r o t e a s o m e . I n a d d i t i o n t o i t s r o l e i n p r o t e i n d e g r a d a t i o n a n d a n t i g e n p r e s e n t a t i o n , t h e p r o t e a s o m e i s a l s o i m p l i c a t e d i n p r o t e i n p r o c e s s i n g . I n a c t i v e p r o t e i n p r e c u r s o r s s u c h as N F - K B a n d t h e Drosophila t r a n s c r i p t i o n a l r e g u l a t o r y p r o t e i n C u b i t u s i n t e r r u p t u s ( C i ) a r e s p l i c e d b y t h e 2 6 S p r o t e a s o m e i n t o a c t i v e p r o t e i n p r o d u c t s ( P a l o m b e l l a et al, 1994; I n g h a m , 1 9 9 8 ) . 2.4 Recycling of ubiquitin T h e final s t e p i n t h e u b i q u i t i n p a t h w a y i s t h e r e g e n e r a t i o n o f f r e e a n d r e u s a b l e u b i q u i t i n . T h i s i s c a r r i e d o u t b y U C H s o r i s o p e p t i d a s e s . T h e l i n k a g e b e t w e e n t h e p r o t e i n s u b s t r a t e a n d u b i q u i t i n m o l e c u l e i s c l e a v e d b y U C H s ( E y t a n et al., 1 9 9 3 ) . T h i s p r o c e s s o c c u r s at t h e 2 6 S p r o t e a s o m e a n d u t i l i z e s A T P . I s o p e p t i d a s e T p r e f e r e n t i a l l y c l e a v e s t h e G 7 6 - K 4 8 l i n k a g e b e t w e e n u b i q u i t i n m o i e t i e s i n m u l t i u b i q u i t i n c h a i n s ( H a d a r i et al., 1 9 9 2 ) . I t s f u n c t i o n a p p e a r s t o b e t h e d i s a s s e m b l y o f m u l t i u b i q u i t i n c h a i n r e m n a n t s f o l l o w i n g p r o t e o l y s i s o f t h e s u b s t r a t e p r o t e i n v i a t h e 2 6 S p r o t e a s o m e . A s u r p r i s i n g l y l a r g e n u m b e r o f U C H s h a v e b e e n i d e n t i f i e d , a l t h o u g h c o m p a r a t i v e l y l i t t l e i s k n o w n a b o u t t h e m . A l l d e u b i q u i t i n a t i n g e n z y m e s a r e t h i o l p r o t e a s e s ( M a y e r a n d W i l k i n s o n , 1 9 8 9 ) w h i c h a r e c a p a b l e o f b i n d i n g u b i q u i t i n ( W i l k i n s o n et al, 1 9 9 5 ) . It i s l i k e l y t h a t t h e y s e r v e d i s t i n c t f u n c t i o n s at d i s c r e t e t i m e s a n d p l a c e s i n t h e c e l l . S o m e d e u b i q u i t i n a t i n g e n z y m e s a r e i n v o l v e d i n s p e c i f i c d e v e l o p m e n t a l p r o c e s s e s . T h e fat facets (faf) g e n e p r o d u c t i s a d e u b i q u i t i n a t i n g e n z y m e t h a t i s r e q u i r e d i n Drosophila f o r e a r l y d e v e l o p m e n t a n d n o r m a l e y e f o r m a t i o n ( H u a n g et al., 1995). I n yeast, a d e u b i q u i t i n a t i n g e n z y m e , U b p 3 i s i n v o l v e d i n g e n e s i l e n c i n g at t e l o m e r e s a n d t h e s i l e n t m a t i n g t y p e l o c i ( M o a z e d a n d J o h n s o n , 1 9 9 6 ) . 3. ENZYMES OF THE UBIQUITIN SYSTEM 3.1 Ubiquitin-activating enzymes E l s c a r r y o u t t h e A T P - d e p e n d e n t a c t i v a t i o n o f t h e C - t e r m i n a l g l y c y l r e s i d u e o f u b i q u i t i n i n a t w o step p r o c e s s . A n u b i q u i t i n a d e n y l a t e i s f o r m e d b y d i s p l a c e m e n t o f P P i f r o m 6 A T P a n d t h e u b i q u i t i n i s t h e n t r a n s f e r r e d t o a t h i o l e s t e r s i t e o n E l , a n d A M P i s r e l e a s e d ( C i e c h a n o v e r et al., 1981). G e n e s e n c o d i n g E l e n z y m e s h a v e b e e n c l o n e d f r o m v a r i o u s o r g a n i s m s i n c l u d i n g y e a s t ( M c G r a t h et al, 1991), w h e a t ( H a t f i e l d et al, 1 9 9 0 ) a n d h u m a n ( H a n d l e y et al, 1 9 9 1 ) . W i t h t h e e x c e p t i o n o f t h r e e r e l a t e d E l g e n e s p r e s e n t i n w h e a t ( H a t f i e l d a n d V i e r s t r a , 1 9 9 2 ) , t h e e n z y m e e x i s t s as a s i n g l e - c o p y g e n e i n o t h e r o r g a n i s m s . T h e E l e n z y m e i s r o u g h l y 1 0 0 k D a a n d c o n t a i n s t h e n u c l e o t i d e - b i n d i n g m o t i f , G X G X X G , w h e r e X is a n y r e s i d u e ( M c G r a t h et al, 1991). T h e p u t a t i v e a c t i v e s i t e c y s t e i n y l r e s i d u e t h a t i s r e q u i r e d f o r t h i o e s t e r f o r m a t i o n w i t h u b i q u i t i n i s l o c a t e d i n t h e c e n t e r o f t h e a m i n o a c i d s e q u e n c e ( H a t f i e l d a n d V i e r s t r a , 1992). E l f u n c t i o n s as a h o m o d i m e r ( C i e c h a n o v e r et al, 1 9 8 2 ) , a n d l i k e l y f o r m s a c o m p l e x w i t h E 2 a n d E 3 p r o t e i n s i n t h e u b i q u i t i n a t i o n o f s u b s t r a t e p r o t e i n s . 3.2 Ubiquitin-conjugating enzymes E 2 e n z y m e s a c c e p t a c t i v a t e d u b i q u i t i n f r o m E l t h r o u g h h i g h e n e r g y t h i o e s t e r b o n d f o r m a t i o n a n d t r a n s f e r t h e u b i q u i t i n m o i e t y t o t h e s u b s t r a t e p r o t e i n , e i t h e r d i r e c t l y o r v i a a t h i r d p r o t e i n , t h e u b i q u i t i n l i g a s e . E 2 s f o r m a l a r g e e n z y m e f a m i l y . I n y e a s t , 13 g e n e s c o d i n g f o r u b i q u i t i n c o n j u g a t i n g e n z y m e s ( U B C g e n e s ) h a v e b e e n i d e n t i f i e d ( H e r s h k o et al, 1983; P i c k a r t a n d R o s e , 1 9 8 5 ) , a n d i n C. elegans, 2 0 U B C g e n e s a r e k n o w n ( D . J o n e s , p e r s . comm.). R e s e a r c h s u g g e s t s t h a t at l e a s t 2 0 U B C g e n e s a r e p r e s e n t i n o t h e r s p e c i e s as w e l l ( H a a s a n d S i e p m a n n , 1 9 9 7 ) . S e q u e n c e c o m p a r i s o n o f E 2 s r e v e a l e d t h a t a l l s h a r e a h i g h l y c o n s e r v e d c a t a l y t i c d o m a i n t e r m e d t h e U B C d o m a i n . W i t h i n t h e U B C d o m a i n , a s p e c i f i c c y s t e i n y l r e s i d u e i s r e q u i r e d f o r u b i q u i t i n - E 2 t h i o e s t e r f o r m a t i o n ( S o m m e r a n d J e n t s c h , 1993; S u n g et al, 1 9 9 0 ) . T h e a c t i v e s i t e r e g i o n h a s a c o n s e n s u s s e q u e n c e o f F H P N I X X X G X I C L D L t h a t i s n e a r l y i d e n t i c a l i n a l l E 2 s . I n a d d i t i o n t o t h e a c t i v e s i t e c y s t e i n e , t h e c o n s e n s u s s e q u e n c e c o n t a i n s a c o n s e r v e d H P N t r i p e p t i d e w h i c h i s r e q u i r e d f o r p r o p e r f o l d i n g o f t h e c o r e r e g i o n o f t h e E 2 ( H a a s a n d S i e p m a n n , 1997). T h e c o n s e r v e d h i s t i d i n e o f t h e t r i p e p t i d e f o r m s a t r i a d w i t h t w o c o n s e r v e d t y r o s i n y l r e s i d u e s t h a t a r e s p a c e d s e v e n a m i n o a c i d s a p a r t i n t h e c a r b o x y l t e r m i n a l r e g i o n . T h e l o s s o f i n t e r a c t i o n o f t h i s t r i a d t h r o u g h m u t a t i o n at a n y o f t h e t h r e e s i t e s r e s u l t s i n a d r a m a t i c d e c r e a s e i n t h e s t a b i l i t y o f t h e p r o t e i n , s u g g e s t i n g t h a t t h e t r i a d i s c r i t i c a l i n m a i n t a i n i n g t h e t e r t i a r y s t r u c t u r e o f t h e E 2 ( R H . B o h n s a c k , p e r s . comm.). T h e N - t e r m i n a l r e g i o n o f t h e U B C d o m a i n i s a c o n s e r v e d b a s i c m o t i f that, w h e n d e l e t e d , r e s u l t s i n d e c r e a s e d t h i o e s t e r f o r m a t i o n , s u g g e s t i n g t h a t t h i s d o m a i n i s i n v o l v e d i n E l b i n d i n g ( S u l l i v a n a n d V i e r s t r a , 1991). T h e C - t e r m i n a l r e g i o n m a y b e i n v o l v e d i n b i n d i n g o f E 3 7 u b i q u i t i n l i g a s e s s i n c e d e l e t i o n o f t h e c a r b o x y l t e r m i n u s o f h u m a n U b c H 2 B r e s u l t s i n l o s s o f E 3 a b i n d i n g ( R . H . B o h n s a c k , p e r s . comm.). E 2 s c a n b e d i v i d e d i n t o f o u r c l a s s e s b a s e d o n t h e i r s t r u c t u r e . C l a s s I E 2 s a r e s m a l l p r o t e i n s o f a p p r o x i m a t e l y 16 k D a t h a t c o n s i s t o f o n l y t h e U B C d o m a i n . T h i s c l a s s i n c l u d e s y e a s t U b c 4 , U b c 5 , U b c 7 a n d U b c 9 , Drosophila UbcDl a n d C. elegans U B C - 2 . C l a s s II E 2 s c o n t a i n C - t e r m i n a l e x t e n s i o n s i n a d d i t i o n t o t h e U B C d o m a i n . Y e a s t c l a s s I I E 2 s i n c l u d e U b c l , U b c 2 ( R a d 6 ) , U b c 3 ( C d c 3 4 ) , U b c 6 a n d U b c 8 . C. elegans U B C - 1 i s a l s o a c l a s s I I e n z y m e ( L e g g e t t et al., 1995). T h e e x t e n s i o n s m a y m e d i a t e s u b s t r a t e s p e c i f i c i t y o r i n t r a c e l l u l a r l o c a l i z a t i o n . T h e s h o r t a c i d i c C - t e r m i n a l t a i l o f R a d 6 i s r e q u i r e d in vitro f o r t h e r e c o g n i t i o n o f b a s i c s u b s t r a t e s s u c h as h i s t o n e s ( S u n g et al., 1988), a n d in vivo f o r s p o r u l a t i o n ( M o r r i s o n et al., 1988). T h e t a i l s o f C d c 3 4 a n d C. elegans U B C - 1 a r e i n v o l v e d i n s e l f -a s s o c i a t i o n t o f o r m h i g h e r o r d e r q u a t e r n a r y s t r u c t u r e s ( L e g g e t t a n d C a n d i d o , 1 9 9 7 ; P t a k et al., 1 9 9 4 ) . T h e C - t e r m i n a l e x t e n s i o n o f U b c 6 a n c h o r s t h e e n z y m e t o t h e e n d o p l a s m i c r e t i c u l u m ( E R ) m e m b r a n e w i t h t h e c a t a l y t i c d o m a i n f a c i n g t h e c y t o s o l ( S o m m e r a n d J e n t s c h , 1 9 9 3 ) . U b c 6 i s b e l i e v e d t o f o r m p a r t o f a n E R d e g r a d a t i o n p a t h w a y f o r i n t e g r a l m e m b r a n e p r o t e i n s . C l a s s I I I e n z y m e s have, i n a d d i t i o n t o t h e U B C d o m a i n , N - t e r m i n a l e x t e n s i o n s . W h i l e n o c l a s s I I I E 2 s h a v e b e e n i d e n t i f i e d i n y e a s t , t h e y h a v e b e e n f o u n d i n h i g h e r e u k a r y o t i c o r g a n i s m s . T h e s e i n c l u d e Drosophila UbcD2 a n d h u m a n U b c H 6 , U b c H 7 , U b c H 8 a n d U b c H 9 ( M a t u s c h e w s k i et al., 1 9 9 6 ; N u b e r et al., 1996). I n h u m a n s , t h e s e e x t e n s i o n s a r e e n r i c h e d i n s e r i n e a n d t h r e o n i n e r e s i d u e s w h i c h m a y f u n c t i o n as p h o s p h o r y l a t i o n s i t e s t o p r o v i d e s u b s t r a t e s p e c i f i c i t y . M e m b e r s o f t h i s f a m i l y c a n p a r t i a l l y s u b s t i t u t e f o r U b c 4 i n y e a s t , s u g g e s t i n g t h a t t h e y h a v e U b c 4 - r e l a t e d f u n c t i o n s . T h e C l a s s I V e n z y m e s c o n t a i n b o t h C - a n d N - t e r m i n a l e x t e n s i o n s a n d i n c l u d e r a b b i t E2230K a n d m u r i n e U b c M l (S. J e n t s c h , pers. comm.; B e r l e t h a n d P i c k a r t , 1 9 9 6 ) . U b c M l h a s a s h o r t C - t e r m i n a l e x t e n s i o n a n d a l o n g N - t e r m i n a l e x t e n s i o n . T h e o v e r a l l o r g a n i z a t i o n o f t h e e n z y m e r e s e m b l e s E 3 e n z y m e s w i t h H E C T d o m a i n s ( s e e S e c t i o n 1.5.7), s u g g e s t i n g t h a t U b c M l m a y c o m b i n e E 2 w i t h E 3 - l i k e p r o p e r t i e s w i t h i n t h e s a m e m o l e c u l e . 3.3 Ubiquitin-protein ligases E 3 s a r e l o o s e l y d e f i n e d as p r o t e i n s t h a t p a r t i c i p a t e w i t h E l a n d E 2 s i n t h e u b i q u i t i n a t i o n o f p r o t e i n s t h a t a r e o t h e r w i s e n o t r e c o g n i z e d b y E 2 s ( C i e c h a n o v e r , 1994; H e r s h k o a n d C i e c h a n o v e r , 1 9 9 2 ) . It h a s b e c o m e i n c r e a s i n g l y c l e a r t h a t E 3 s p l a y a m a j o r r o l e i n s u b s t r a t e 8 r e c o g n i t i o n i n t h e u b i q u i t i n p a t h w a y . R e c e n t l y , a n u m b e r o f E 3 l i g a s e s h a v e b e e n i d e n t i f i e d t h a t f a l l i n t o t w o g r o u p s . O n e t y p e o f E 3 f u n c t i o n s a s p a r t o f a n E 1 - E 2 - E 3 t h i o l r e l a y ( S c h e f F n e r et al, 1 9 9 5 ) . T h e E 3 a c c e p t s u b i q u i t i n f r o m a n E 2 , f o r m i n g a t h i o e s t e r b o n d w i t h u b i q u i t i n at a s p e c i f i c c y s t e i n y l r e s i d u e . T h e u b i q u i t i n i s t h e n t r a n s f e r r e d t o a s u b s t r a t e p r o t e i n t h a t i s a l s o b o u n d t o t h e E 3 . O t h e r E 3 l i g a s e s d o n o t b i n d u b i q u i t i n . T h e y t e n d t o f u n c t i o n a s a s c a f f o l d p r o t e i n f o r b o t h t h e E 2 a n d t h e s u b s t r a t e , b r i n g i n g t h e m i n c l o s e p r o x i m i t y t o f a c i l i t a t e t r a n s f e r o f u b i q u i t i n ( D o h m e n et al., 1991; P a t t o n et al., 1998). It m u s t b e p o i n t e d o u t t h a t a s p e c i f i c E 3 m a y i n t e r a c t w i t h s e v e r a l E 2 s , j u s t as a s p e c i f i c E 2 c a n i n t e r a c t w i t h m a n y E 3 s . T h i s i n t e r c h a n g e a b i l i t y o f c o m p o n e n t s a i d s i n t a r g e t s p e c i f i c i t y . M a n y l a b o r a t o r i e s a r e c u r r e n t l y s t u d y i n g E 3 l i g a s e s , a n d i t i s l i k e l y t h a t m a n y m o r e t y p e s o f E 3 s a w a i t d i s c o v e r y . 4. THE UBC4 BRANCH OF UBIQUITIN-CONJUGATING ENZYMES I n y e a s t , t h r e e E 2 s e n c o d e d b y U B C 1 , -4, a n d -5 c o m p r i s e a f u n c t i o n a l l y o v e r l a p p i n g E 2 s u b f a m i l y t h a t h a s b e e n d e s i g n a t e d t h e " U B C 4 b r a n c h " o f E 2 s . T h e s e e n z y m e s a r e r e s p o n s i b l e f o r t h e d e g r a d a t i o n o f m o s t s h o r t - l i v e d a n d a b n o r m a l p r o t e i n s ( S e u f e r t a n d J e n t s c h , 1 9 9 0 ) . I n a d d i t i o n , U B C 4 a n d U B C 5 e x p r e s s i o n i n c r e a s e s o n e x p o s u r e t o h e a t s h o c k , ubc4ubc5 d o u b l e m u t a n t s t r a i n s a r e s e n s i t i v e t o a v a r i e t y o f s t r e s s e s a n d d e l e t i o n o f a l l t h r e e E 2 s i s l e t h a l ( S e u f e r t a n d J e n t s c h , 1990; T r e i e r et al, 1 9 9 2 ) . I n g e n e r a l , t h e s e E 2 s , t o g e t h e r w i t h s p e c i f i c E 3 s , a r e t h o u g h t t o r e c o g n i z e a b n o r m a l p r o t e i n s a n d p r e v e n t t h e i r a c c u m u l a t i o n b y t a r g e t i n g t h e m f o r d e g r a d a t i o n . H o w e v e r , it is u n c l e a r w h a t s t r u c t u r a l f e a t u r e s o f a n a b n o r m a l p r o t e i n a r e r e c o g n i z e d b y t h e E 2 s . I n C. elegans, U B C - 2 is t h e f u n c t i o n a l h o m o l o g o f y e a s t U b c 4 a n d i s a b l e t o r e s c u e t h e g r o w t h d e f e c t o f y e a s t ubc4ubc5 d o u b l e m u t a n t s ( Z h e n et al, 1 9 9 3 ) . T h i s s u g g e s t s t h a t U B C - 2 i n C. elegans m a y a l s o f u n c t i o n t o d e g r a d e s h o r t - l i v e d a n d a b n o r m a l p r o t e i n s . I n t e r e s t i n g l y , ubc-2 i s a n e s s e n t i a l g e n e tha t is r e q u i r e d d u r i n g l a r v a l d e v e l o p m e n t ( Z h e n et al, 1996). C o m p a r i s o n o f t h e 2 0 k n o w n C. elegans E 2 s t o t h e ubc-2 s e q u e n c e d o e s n o t r e v e a l a n y c l o s e l y r e l a t e d g e n e s t h a t m a y f o r m p a r t o f a s u b f a m i l y w i t h ubc-2 ( D . J o n e s , p e r s . comm.). O n e g e n e w i t h h i g h s i m i l a r i t y t o ubc-2 w a s p r e v i o u s l y i d e n t i f i e d , b u t w a s s u b s e q u e n t l y d e t e r m i n e d t o b e a p s e u d o g e n e ( Z h e n , 1 9 9 5 ) . T h e Drosophila U B C 4 h o m o l o g , UbcDl, i s a l s o a n e s s e n t i a l g e n e ( T r e i e r et al, 1 9 9 2 ) . D e l e t i o n m u t a n t s a r e e m b r y o n i c l e t h a l , w h i l e w e a k a l l e l e s c a u s e l e t h a l i t y d u r i n g t h e p u p a l s t a g e 9 a n d d i s r u p t t e l o m e r e b e h a v i o r i n b o t h m i t o t i c a n d m e i o t i c c e l l s . S o m e m u t a n t a l l e l e s p r o d u c e s t e r i l e m a l e s w i t h a b n o r m a l t e l o m e r e b e h a v i o r i n m e i o t i c c e l l s ( C e n c i et ai, 1 9 9 7 ) . T h u s , UbcDl, l i k e C. elegans ubc-2, h a s s p e c i f i c f u n c t i o n s d u r i n g d e v e l o p m e n t . I n a d d i t i o n , b o t h E 2 s a r e u n i q u e i n t h e U B C 4 b r a n c h i n t h a t t h e y a r e e s s e n t i a l g e n e s . T h e U B C 4 b r a n c h o f E 2 e n z y m e s ha s e x p a n d e d d u r i n g t h e e v o l u t i o n o f h i g h e r o r g a n i s m s . I n Arabidopsis, m u l t i p l e i s o f o r m s o f U B C 8 e x i s t a n d it i s b e l i e v e d t h a t t h e e x p a n s i o n o f t h e f a m i l y h a s l e d t o t h e s p e c i a l i z a t i o n o f i s o f o r m s i n t e r m s o f s p a t i a l a n d t e m p o r a l e x p r e s s i o n a n d i n t h e s p e c i f i c i t y o f b i n d i n g p a r t n e r s . T h r e e h o m o l o g s o f U B C 4 h a v e b e e n f o u n d i n t h e rat, t w o o f w h i c h a r e g e r m l i n e s p e c i f i c , w i t h o n e b e i n g e x p r e s s e d o n l y i n s p e r m a t i d s ( W i n g et al., 1996). I n h u m a n s at l e a s t t h r e e i s o f o r m s o f U b c H 5 h a v e b e e n i d e n t i f i e d ( U b c H 5 A , U b c H 5 B a n d U b c H 5 C ; J e n s e n et al, 1 9 9 5 ) , a l l o f w h i c h a r e c a p a b l e o f t r a n s f e r r i n g u b i q u i t i n t o t h e E 3 l i g a s e E 6 - A P in vitro, a l t h o u g h o n l y U b c H 5 C a p p e a r s t o p e r f o r m t h i s f u n c t i o n in vivo. T h e U b c H 5 B i s o f o r m i s s p e c i f i c f o r t h e d e g r a d a t i o n o f I K B a n d t h e p r o c e s s i n g o f N F - K B ( s e e S e c t i o n s 1.5.4 a n d 1.5.5). T h u s , a n i n t e r e s t i n g f e a t u r e o f h u m a n U B C 4 f a m i l y m e m b e r s is t h a t e a c h a p p e a r s t o b i n d t o s p e c i f i c t a r g e t s t h r o u g h i n t e r a c t i o n w i t h s p e c i f i c E 3 s . S u b t l e d i f f e r e n c e s i n a m i n o a c i d s e q u e n c e w i t h i n t h e U b c H 5 f a m i l y m a y d i c t a t e E 3 s p e c i f i c i t y . 5. ROLES OF THE UBC4 BRANCH OF UBIQUITIN-CONJUGATING ENZYMES A l t h o u g h t h e e n z y m a t i c p a t h w a y f o r u b i q u i t i n c o n j u g a t i o n is w e l l c h a r a c t e r i z e d , t h e w a y s i n w h i c h p r o t e i n s a r e s e l e c t e d f o r d e g r a d a t i o n a r e o n l y b e g i n n i n g t o b e e l u c i d a t e d . T h e d e g r a d a t i o n o f s u b s t r a t e s a p p e a r s t o b e m e d i a t e d b y s p e c i f i c d e g r a d a t i o n s i g n a l s w h i c h a r e s e q u e n c e o r s t r u c t u r a l f e a t u r e s o f t h e s u b s t r a t e . T h e s e s i g n a l s i n c l u d e l y s y l r e s i d u e ( s ) t h a t c a n b e u b i q u i t i n a t e d as w e l l as e l e m e n t s t h a t a r e r e c o g n i z e d b y a s p e c i f i c E 2 / E 3 c o m p l e x . T h e p r o t e o l y s i s o f a n u m b e r o f p r o t e i n s i s p h o s p h o r y l a t i o n - d e p e n d e n t , s u c h t h a t t h e u b i q u i t i n a t i o n a p p a r a t u s o n l y r e c o g n i z e s a n d m o d i f i e s t h e s u b s t r a t e i n s p e c i f i c p h o s p h o r y l a t i o n states. S o m e s u b s t r a t e s m u s t b e d e p h o s p h o r y l a t e d , w h i l e o t h e r s r e q u i r e p h o s p h o r y l a t i o n at s p e c i f i c r e s i d u e s t o b e r e c o g n i z e d b y t h e d e g r a d a t i o n s y s t e m . O n e f a m i l y o f E 3 u b i q u i t i n l i g a s e s t h a t r e c o g n i z e p h o s p h o r y l a t e d s u b s t r a t e s a r e F b o x -c o n t a i n i n g p r o t e i n s t h a t f o r m p a r t o f t h e S C F ( S k p l - C d c 5 3 / C U L l - F - b o x p r o t e i n ) c o m p l e x ( F e l d m a n et al., 1997; S k o w r y a et al., 1997). T h e p h o s p h o r y l a t i o n - d e p e n d e n t d e s t r u c t i o n o f s u b s t r a t e p r o t e i n s v i a S C F c o m p l e x e s h a s b e e n d e s c r i b e d f o r y e a s t p r o t e i n s t h a t r e g u l a t e t h e G l 10 p h a s e a n d G l / S t r a n s i t i o n o f t h e c e l l c y c l e , t h e i n h i b i t o r p r o t e i n IKB, a n d f 3 - c a t e n i n ( F e l d m a n et al, 1997; S k o w r y a et al, 1997; S p e n c e r s al, 1999; W i n s t o n et al, 1999; M a n i a t i s , 1 9 9 9 ) . I n m a n y o f t h e s e s y s t e m s , t h e E 2 r e s p o n s i b l e f o r u b i q u i t i n a t i o n o f t h e s u b s t r a t e s i s a m e m b e r o f t h e U B C 4 b r a n c h o f c o n j u g a t i n g e n z y m e s . A l a r g e n u m b e r o f p r o t e i n s t h a t a r e t a r g e t e d f o r d e g r a d a t i o n b y t h e u b i q u i t i n - d e p e n d e n t p r o t e o l y s i s s y s t e m h a v e b e e n i d e n t i f i e d i n r e c e n t y e a r s . T h i s i n c l u d e s m a n y t r a n s c r i p t i o n a l r e g u l a t o r s , c y c l i n s , i n t e g r a l m e m b r a n e p r o t e i n s a n d c e l l c y c l e i n h i b i t o r s ( r e v i e w e d i n P e t e r s et al, 1 9 9 8 ) . I n f a c t , t h e l i s t o f k n o w n s u b s t r a t e p r o t e i n s i s f a r t o o l a r g e f o r a l l o f t h e m t o b e d e s c r i b e d . T h e r e f o r e , o n l y t h o s e u b i q u i t i n p a t h w a y s a n d s u b s t r a t e s w h i c h a r e k n o w n t o b e m e d i a t e d b y E 2 s o f t h e U B C 4 b r a n c h , o r h a v e s o m e r e l a t i o n t o U B C 4 - d e p e n d e n t s y s t e m s , w i l l b e d i s c u s s e d . 5.1 Stress response U b i q u i t i n d e g r a d a t i o n p l a y s a n e s s e n t i a l r o l e i n t h e e u k a r y o t i c s t r e s s r e s p o n s e . I n y e a s t , U B C 4 a n d U B C 5 a r e s t r e s s i n d u c i b l e ( S e u f e r t a n d J e n t s c h , 1 9 9 0 ) . U B C 7 i s a l s o i n d u c e d b y c a d m i u m , w h i c h i s k n o w n t o e l i c i t a s t r e s s r e s p o n s e ( J u n g m a n n et al, 1 9 9 3 ) . A t e l e v a t e d t e m p e r a t u r e s , ubc4ubc5 n u l l m u t a n t s a r e i n v i a b l e , a n d e x p r e s s h e a t s h o c k p r o t e i n s u n d e r n o n -s t r e s s c o n d i t i o n s . ubc7 n u l l m u t a n t s a r e o n l y a f f e c t e d w h e n t r e a t e d w i t h c a d m i u m . T h i s s u g g e s t s t h a t U b c 4 / U b c 5 a n d U b c 7 - m e d i a t e d p r o t e o l y s i s a r e i n v o l v e d i n t h e s t r e s s r e s p o n s e i n d u c e d b y h e a t s h o c k a n d c a d m i u m , r e s p e c t i v e l y . T h e C. elegans gene, ubc-2, w h i c h i s a f u n c t i o n a l h o m o l o g o f U B C 4 , i s n o t h e a t s h o c k i n d u c i b l e ( Z h e n et al, 1993). H o w e v e r , U B C - 2 i s e x p r e s s e d at a l l l i f e s t a g e s a n d , at l e a s t d u r i n g e m b r y o n i c a n d l a r v a l stages, i s e x p r e s s e d i n a l l t i s s u e s ( Z h e n et al, 1 9 9 6 ) . T h u s , a r o l e f o r U B C - 2 i n t h e s t r e s s r e s p o n s e c a n n o t b e r u l e d out. R a t h e r t h a n i n c r e a s e d e x p r e s s i o n o f U B C - 2 , p e r h a p s e x i s t i n g p o o l s o f U B C - 2 a r e r e - l o c a l i z e d u n d e r s t r e s s c o n d i t i o n s . A r n a s o n a n d E l l i s o n ( 1 9 9 4 ) h a v e s h o w n t h a t K 6 3 o f u b i q u i t i n i s e s s e n t i a l t o t h e s t r e s s r e s p o n s e a n d t h a t t h e f o r m a t i o n o f t h e K 6 3 - l i n k e d p o l y u b i q u i t i n c h a i n s i s m e d i a t e d b y U B C 4 a n d U B C 5 . T h e f u n c t i o n a l r o l e f o r t h e s e a l t e r n a t i v e l y l i n k e d c h a i n s i n t h e s t r e s s r e s p o n s e h a s n o t b e e n d e t e r m i n e d . 5.2 Cell cycle progression F o r c e l l s t o d i v i d e , t w o c r i t i c a l p r o c e s s e s m u s t o c c u r : D N A m u s t b e a c c u r a t e l y r e p l i c a t e d a n d it m u s t b e a c c u r a t e l y s e g r e g a t e d t o d a u g h t e r c e l l s . T h e c e l l c y c l e c o n t r o l l l m e c h a n i s m r e g u l a t e s t h e p r o g r e s s i o n o f t h e c e l l f r o m o n e p h a s e t o a n o t h e r b y e n s u r i n g t h a t e a c h p r o c e s s h a s o c c u r r e d c o r r e c t l y b e f o r e c o n t i n u i n g o n t o t h e next. E u k a r y o t i c c e l l s c y c l e t h r o u g h a D N A r e p l i c a t i o n p h a s e ( S ) a n d a m i t o t i c p h a s e ( M ) w h i c h a r e i n t e r s p e r s e d w i t h g a p p h a s e s t h a t o c c u r b e f o r e ( G l ) a n d a f t e r ( G 2 ) r e p l i c a t i o n . T h e t r a n s i t i o n f r o m o n e p h a s e t o t h e n e x t i s c o n t r o l l e d b y t h e a c t i v a t i o n o r i n a c t i v a t i o n o f c y c l i n - d e p e n d e n t p r o t e i n k i n a s e s ( C D K s ; r e v i e w e d i n M o r g a n , 1995). I n yeast, t h e r e i s o n l y o n e C D K ( C d c 2 8 ) , w h i l e i n h i g h e r e u k a r y o t e s t h e r e a r e s e v e r a l . T h e k e y r e g u l a t o r o f C D K s , a n d t h u s o f c e l l c y c l e t r a n s i t i o n s , a r e c y c l i n s . C y c l i n l e v e l s f l u c t u a t e d u r i n g t h e c e l l c y c l e a n d a r e c o n t r o l l e d b y u b i q u i t i n - m e d i a t e d p r o t e o l y s i s ( C h u n et al, 1996; H e r s h k o , 1997). T w o m a j o r p a t h w a y s o f u b i q u i t i n - d e p e n d e n t d e g r a d a t i o n a r e i n v o l v e d i n c e l l c y c l e p r o g r e s s i o n . O n e p a t h w a y u t i l i z e s t h e S C F c o m p l e x ( S k p l - C d c 5 3 / C U L l - F - b o x p r o t e i n ) a n d r e g u l a t e s t h e t r a n s i t i o n f r o m G l t o S phase, w h i l e t h e s e c o n d u t i l i z e s t h e a n a p h a s e p r o m o t i n g c o m p l e x / c y c l o s o m e ( A P C / C ) c o m p l e x a n d t r i g g e r s a n a p h a s e a n d e x i t f r o m m i t o s i s . 5.2.1 Role of ubiquitin-dependent degradation in the Gl/S transition T h e t r a n s i t i o n f r o m G l t o S is c o n t r o l l e d b y a C d c 3 4 - d e p e n d e n t p r o t e o l y t i c p a t h w a y . C d c 3 4 i s a u b i q u i t i n c o n j u g a t i n g e n z y m e a l s o k n o w n as U b c 3 ( G o e b l et al, 1 9 8 8 ) . I n t h i s p a t h w a y , C d c 3 4 i s r e s p o n s i b l e f o r t h e d e g r a d a t i o n o f a n i n h i b i t o r p r o t e i n S i c l ( S c h w o b et al, 1 9 9 4 ) . I n G l c e l l s , S i c l b i n d s t o a n d i n h i b i t s t h e C d c 2 8 - C l b k i n a s e c o m p l e x , t h u s p r e v e n t i n g i n i t i a t i o n o f D N A r e p l i c a t i o n . S i c l i s p h o s p h o r y l a t e d b y C d c 2 8 - C l n 2 p k i n a s e , w h i c h a l l o w s t h e u b i q u i t i n a t i o n a n d s u b s e q u e n t d e s t r u c t i o n o f S i c l b y t h e C d c 3 4 p a t h w a y ( V e r m a et al, 1 9 9 7 ) . C d c 3 4 i s a s s o c i a t e d w i t h a l a r g e m u l t i p r o t e i n S C F c o m p l e x w h i c h i n c l u d e s C d c 4 , C d c 5 3 a n d S k p l ( F e l d m a n et al, 1997). T h e S C F c d c 4 c o m p l e x c o n s t i t u t e s a n E 3 l i g a s e a n d f u n c t i o n s t o f a c i l i t a t e t h e u b i q u i t i n a t i o n o f S i c l b y C d c 3 4 ( L i s z t w a n et al, 1998; L y a p i n a et al, 1998; M a t h i a s et al, 1998; P a t t o n et al, 1998). C d c 4 c o n t a i n s a n a m i n o a c i d m o t i f t e r m e d t h e F - b o x a n d a s e r i e s o f W D r e p e a t s w h i c h a r e i n v o l v e d i n p r o t e i n - p r o t e i n i n t e r a c t i o n s ( B a i et al, 1 9 9 6 ) . C d c 4 b i n d s t h e s u b s t r a t e p r o t e i n S i c l a n d a l s o a s s o c i a t e s w i t h S k p l . S k p l i s i n t u r n b o u n d t o t h e c u l l i n p r o t e i n C d c 5 3 w h i c h r e c r u i t s C d c 3 4 t o t h e c o m p l e x . T h u s , t h e w h o l e c o m p l e x s e r v e s t o b r i n g t h e E 2 a n d t h e s u b s t r a t e p r o t e i n t o g e t h e r t o f a c i l i t a t e t r a n s f e r o f u b i q u i t i n t o t h e s u b s t r a t e . 12 S C F h a s b e c o m e t h e g e n e r a l n a m e f o r a c o l l e c t i o n o f E 3 s t h a t h a v e b e e n i d e n t i f i e d i n m a n y s y s t e m s , a n d w h i c h b e a r s t r i k i n g s i m i l a r i t y t o t h e y e a s t S C F c o m p l e x ( S p e n c e r et al, 1 9 9 9 ; W i n s t o n et al., 1999). T h e S C F c o m p l e x i s c o m p o s e d o f t w o e v o l u t i o n a r i l y c o n s e r v e d f a c t o r s , S k p l a n d a m e m b e r o f t h e C u l l i n f a m i l y o f p r o t e i n s . I n a d d i t i o n , t h e c o m p l e x c o n t a i n s a n F - b o x p r o t e i n a n d a u b i q u i t i n - c o n j u g a t i n g e n z y m e . T h e F - b o x p r o t e i n s a r e a d i v e r s e f a m i l y o f p r o t e i n s t h a t a r e c a p a b l e o f r e c o g n i z i n g d i f f e r e n t s u b s t r a t e s t h r o u g h s p e c i f i c p r o t e i n - p r o t e i n i n t e r a c t i o n d o m a i n s s u c h as W D o r l e u c i n e - r i c h r e p e a t s ( B a i et al., 1 9 9 6 ) . A n e x a m i n a t i o n o f g e n o m e d a t a b a s e s h a s r e v e a l e d o v e r 4 0 0 F - b o x p r o t e i n s , w i t h 2 0 i n y e a s t a n d o v e r 1 0 0 i n C. elegans ( K o e p p et al., 1999). M e m b e r s o f t h e C u l l i n f a m i l y o f p r o t e i n s a r e t h o u g h t t o r e c r u i t t h e E 2 w h i l e t h e a d a p t e r p r o t e i n , S k p l , t e t h e r s t h e p r o t e i n s t o t h e c o m p l e x . 5.2.2 Ubiquitin-dependent proteolysis and the anaphase promoting complex D u r i n g m i t o s i s , t w o e v e n t s a r e c o n t r o l l e d b y u b i q u i t i n - m e d i a t e d p r o t e o l y s i s : s i s t e r c h r o m a t i d s e p a r a t i o n a n d e x i t f r o m t e l o p h a s e i n t o G I ( r e v i e w e d i n P e t e r s et al., 1 9 9 8 ) . B o t h e v e n t s u t i l i z e a l a r g e m u l t i s u b u n i t E 3 l i g a s e c o m p l e x , t h e A P C / C , w h i c h i n y e a s t i s c o m p o s e d o f 12 s u b u n i t s ( Z a c h a r i a e et ai, 1 9 9 8 b ) . T h e f o r m a t i o n o f t h i o e s t e r i n t e r m e d i a t e s w a s n o t d e t e c t e d w i t h t h e A P C / C , s u g g e s t i n g t h a t t h e A P C / C s e r v e s a s c a f f o l d i n g f u n c t i o n r a t h e r t h a n a c t i n g a s a f i n a l u b i q u i t i n d o n o r i n t h e r e a c t i o n ( K i n g et al., 1 9 9 5 ) . T h e t a r g e t s o f t h e A P C / C i n c l u d e b o t h A a n d B - t y p e c y c l i n s a n d a n u m b e r o f i n h i b i t o r p r o t e i n s t h a t r e g u l a t e c e l l c y c l e p r o g r e s s i o n ( K o e p p et al., 1999; W o l f a n d J a c k s o n , 1 9 9 8 ) . M a n y o f t h e A P C / C t a r g e t s c o n t a i n a c o n s e r v e d 9 - r e s i d u e m o t i f c a l l e d t h e " d e s t r u c t i o n b o x " w h i c h i s b e l i e v e d t o s i g n a l u b i q u i t i n - m e d i a t e d d e g r a d a t i o n b y t h e A P C / C ( G l o t z e r et al., 1 9 9 1 ) . It i s n o t c l e a r , h o w e v e r , w h e t h e r t h e d e s t r u c t i o n b o x o n i t s o w n r e p r e s e n t s a r e c o g n i t i o n s i t e o r w h e t h e r i t m u s t b e p r e s e n t e d w i t h i n a l a r g e r s t r u c t u r e f o r r e c o g n i t i o n . T h e t r a n s i t i o n f r o m m e t a p h a s e t o a n a p h a s e i s c o n t r o l l e d b y t h e s e q u e n t i a l d e g r a d a t i o n o f i n h i b i t o r s b y t h e A P C / C ( C o h e n - F i x et al., 1996). C d c 2 0 i s e x p r e s s e d d u r i n g G 2 a n d b i n d s t o t h e A P C / C d u r i n g m e t a p h a s e . T h e a s s o c i a t i o n o f C d c 2 0 w i t h A P C / C a l l o w s u b i q u i t i n a t i o n o f t h e a n a p h a s e i n h i b i t o r P d s l ( L i m et al, 1998). D e s t r u c t i o n o f P d s l r e m o v e s t h e b l o c k t o a n a p h a s e a l l o w i n g s i s t e r c h r o m a t i d s e p a r a t i o n t o p r o c e e d . E x i t f r o m m i t o s i s r e q u i r e s t h e d e g r a d a t i o n o f B - t y p e c y c l i n s b y t h e A P C / C . T h i s a c t i v i t y d e p e n d s o n t h e a c t i v a t o r p r o t e i n C d h l ( F a n g et al, 1 9 9 8 ; Z a c h a r i a e et al, 1 9 9 8 a ) . C d h l i s c o n s t i t u t i v e l y p r e s e n t b u t b i n d s t h e A P C / C o n l y d u r i n g m i t o t i c e x i t a n d G I , p o i n t s i n 13 t h e c e l l c y c l e w h e r e m i t o t i c c y c l i n s a r e d e g r a d e d . D u r i n g m o s t o f t h e c e l l c y c l e , C d h l i s i n h i b i t e d b y C d k p h o s p h o r y l a t i o n . C d h l i s a c t i v a t e d b y t h e p h o s p h a t a s e C d c l 4 w h i c h f u n c t i o n s i n t h r e e p a r a l l e l p r o c e s s e s t o e n s u r e t h e d e s t r u c t i o n o f B - t y p e c y c l i n s a n d m i t o t i c e x i t ( V i s i n t i n et al, 1998). C d c l 4 a c t s d u r i n g t e l o p h a s e t o d e p h o s p h o r y l a t e a n d a c t i v a t e b o t h C d h l a n d a t r a n s c r i p t i o n f a c t o r S w i 5 . A c t i v e S w i 5 s t i m u l a t e s t h e t r a n s c r i p t i o n o f t h e i n h i b i t o r S i c l . C d c l 4 a l s o d e p h o s p h o r y l a t e s S i c l w h i c h p r o t e c t s S i c l f r o m d e g r a d a t i o n b y t h e S C F ( s e e S e c t i o n 1.5.2.1). T h e i n c r e a s e d l e v e l s o f S i c l b l o c k C d c 2 8 / C l b a c t i v i t y , w h i l e at t h e s a m e t i m e , B - t y p e c y c l i n s a r e d e g r a d e d b y t h e A P C / C . T h e s e p r o c e s s e s , a c t i n g i n c o n c e r t , l e a d t o e x i t o f c e l l s from m i t o s i s . T h e t i m i n g o f m i t o t i c e x i t i s r e g u l a t e d b y t h e a b i l i t y o f C d c l 4 t o a c c e s s i t s s u b s t r a t e s ( S h o u etal, 1999; V i s i n t i n et al, 1999). T h r o u g h G l a n d e a r l y m i t o s i s , C d c l 4 i s l o c a l i z e d i n t h e n u c l e o l u s t h r o u g h i t s a s s o c i a t i o n w i t h t h e n u c l e o l a r p r o t e i n C f i l / N e t l . D u r i n g t e l o p h a s e , C d c l 4 i s r e l e a s e d f r o m t h e n u c l e o l u s a n d s p r e a d s t h r o u g h t h e n u c l e u s a n d i n t o t h e c y t o p l a s m w h e r e it f u n c t i o n s t o d e p h o s p h o r y l a t e i t s s u b s t r a t e . T h u s , t h e a c t i v i t y o f C d c l 4 i s r e g u l a t e d t h r o u g h i t s p h y s i c a l l o c a t i o n w i t h i n t h e c e l l . W h i l e t h e i d e n t i t y o f t h e E 2 t h a t w o r k s i n c o n c e r t w i t h A P C / C i s u n k n o w n , b i o c h e m i c a l e x p e r i m e n t s i n d i c a t e t h a t U b c 4 i s a p o s s i b l e c a n d i d a t e ( K i n g et al, 1 9 9 5 ) , a n d Drosophila U b c D l i s r e q u i r e d f o r p r o p e r t e l o m e r e b e h a v i o r ( C e n c i et al, 1997). H o w e v e r , i n Xenopus a n o v e l E 2 c a l l e d U b c x w a s s h o w n t o b e i n v o l v e d i n A P C / C - d e p e n d e n t d e g r a d a t i o n ( Y u et al, 1 9 9 6 ) . I n t h e p r e s e n c e o f E l a n d p u r i f i e d A P C / C , U b c 4 o r U b c x c a n m e d i a t e t h e u b i q u i t i n a t i o n o f c y c l i n . I n s u p p o r t o f a r o l e f o r U b c x i n t h e A P C / C , m u t a t i o n s i n t h e h o m o l o g o f U b c x i n fission y e a s t ( U b c P 4 ; O s a k a et al, 1 9 9 7 ) a n d h u m a n ( U b c H I O ; T o w n s l e y et al, 1 9 9 7 ) c a u s e m e t a p h a s e a r r e s t . 5.3 Degradation of the transcription factors c-Fos and c-Jun T h e t r a n s c r i p t i o n a l a c t i v a t o r A P - 1 i s i n v o l v e d i n c e l l p r o l i f e r a t i o n f o l l o w i n g s t i m u l a t i o n b y m i t o g e n i c f a c t o r s ( r e v i e w e d i n A n g e l a n d K a r i n , 1 9 9 1 ) . T h e a c t i v e f o r m o f A P - 1 i s c o m p o s e d o f t w o s u b u n i t s , J u n a n d F o s . B o t h c - J u n a n d c - F o s a r e u b i q u i t i n a t e d in vivo ( S t a n c o v s k i et al, 1995; T r e i e r et al, 1 9 9 4 ) a n d t h e u b i q u i t i n a t i o n o f c - F o s i s g r e a t l y e n h a n c e d b y i n t e r a c t i o n w i t h c - J u n ( T s u r u m i et al, 1995). F o r c - J u n t o b e d e g r a d e d , i t m u s t b e d e p h o s p h o r y l a t e d ( M u s t i et al, 1 9 9 7 ) a n d t h e r e i s e v i d e n c e w h i c h s u g g e s t s t h a t c - F o s m u s t a l s o b e d e p h o s p h o r y l a t e d f o r u b i q u i t i n a t i o n t o o c c u r ( O k a z a k i a n d S a g a t a , 1 9 9 5 ) . W h e n c - J u n i s 14 p h o s p h o r y l a t e d b y t h e M A P K s i g n a l l i n g p a t h w a y , u b i q u i t i n a t i o n a n d d e g r a d a t i o n o f c - J u n i s s u p p r e s s e d , a n d g e n e s r e g u l a t e d b y c - J u n a n d c - F o s a r e t r a n s c r i b e d . T h e u b i q u i t i n a t i o n o f b o t h c - F o s a n d c - J u n r e q u i r e s U b c H 5 ( M u s t i et al, 1997; S t a n c o v s k i et al, 1 9 9 5 ) . A n E 3 e n z y m e s p e c i f i c f o r c - F o s , c a l l e d E 3 - F o s , h a s a l s o b e e n i d e n t i f i e d ( S t a n c o v s k i et al, 1 9 9 5 ) . 5.4 Processing of N F - K B N F - K B i s a m e m b e r o f t h e R e l f a m i l y o f d i m e r i c t r a n s c r i p t i o n f a c t o r s a n d r e g u l a t e s t h e e x p r e s s i o n o f m u l t i p l e g e n e s i n v o l v e d i n i m m u n e a n d i n f l a m m a t o r y r e s p o n s e s ( r e v i e w e d i n T h a n o s a n d M a n i a t i s , 1995; V e r m a et al, 1995). It i s a h e t e r o d i m e r f o r m e d f r o m t h e p 5 0 (NF-KB 1) a n d p 6 5 ( R e l A ) s u b u n i t s . T h e p 5 0 s u b u n i t i s g e n e r a t e d f r o m a 105 k D a p r e c u r s o r c a l l e d p i 0 5 . T h e r e l a t i v e l y s t a b l e p i 0 5 i s u b i q u i t i n a t e d a n d p a r t i a l l y d e g r a d e d t o p r o d u c e a c t i v e p 5 0. U n l i k e o t h e r s u b s t r a t e s o f t h e p r o t e a s o m e w h i c h a r e d e g r a d e d t o s m a l l p e p t i d e s , o n l y t h e C -t e r m i n u s o f p l 0 5 i s d e g r a d e d , l e a v i n g t h e f u n c t i o n a l p 5 0 s u b u n i t ( P a l o m b e l l a et al, 1 9 9 4 ) . T h e C - t e r m i n u s i s c h a r a c t e r i z e d b y a s e r i e s o f a n k y r i n r e p e a t s a n d a P E S T d o m a i n ( G h o s h et al, 1 9 9 0 ) . A n k y r i n r e p e a t s a r e i n v o l v e d i n p r o t e i n - p r o t e i n i n t e r a c t i o n s ( G i l l i g a n a n d B e n n e t t , 1 9 9 3 ) , a n d t h e P E S T d o m a i n i s b e l i e v e d t o b e a d e g r a d a t i o n s i g n a l ( R e c h s t e i n e r a n d R o g e r s , 1 9 9 6 ) . U b i q u i t i n a t i o n o f p i 0 5 r e q u i r e s a m e m b e r o f t h e U b c H 5 s u b f a m i l y ( C o u x a n d G o l d b e r g , 1 9 9 8 ) . R a b b i t E225K, a n o t h e r U B C 4 b r a n c h m e m b e r , c a n s u b s t i t u t e f o r U b c H 5 i n t h e r e a c t i o n . A n o v e l 3 2 0 k D a E 3 is a l s o n e c e s s a r y f o r p i 0 5 p r o c e s s i n g ( O r i a n et al, 1 9 9 5 ) . A s m a l l E 3 (E3-KB) w a s i d e n t i f i e d b y C o u x a n d G o l d b e r g ( 1 9 9 8 ) a n d i s i n v o l v e d i n p i 0 5 p r o c e s s i n g . It i s l i k e l y t h a t E3-KB i s a c o m p o n e n t o f t h e 3 2 0 k D a a c t i v i t y . 5.5 Ubiquitin-dependent degradation of I K B and the Drosophila homolog, Cactus T h e t r a n s c r i p t i o n f a c t o r NF-KB, i t s e l f , i s a l s o a c t i v a t e d b y t h e u b i q u i t i n - p r o t e a s o m e p a t h w a y ( B a e u e r l e a n d H e n k e l , 1994; L i et al, 1995; P a l o m b e l l a et al, 1 9 9 4 ; R o f f et al, 1 9 9 6 ) . I n q u i e s c e n t c e l l s , N F - K B i s h e l d i n a l a t e n t state i n t h e c y t o p l a s m t h r o u g h a t t a c h m e n t t o a m e m b e r o f t h e IKB f a m i l y o f i n h i b i t o r s , I x B a . I n r e s p o n s e t o e x t e r n a l s t i m u l i s u c h as v i r u s e s , c y t o k i n e s a n d a n t i g e n s , I x B a i s d e g r a d e d i n a u b i q u i t i n - d e p e n d e n t m a n n e r , a l l o w i n g t h e n u c l e a r t r a n s l o c a t i o n o f N F - K B w h i c h l e a d s t o a v a r i e t y o f t r a n s c r i p t i o n a l r e s p o n s e s ( B a e u e r l e a n d H e n k e l , 1994). 15 IKBO. c o n t a i n s a n k y r i n r e p e a t s a n d a P E S T d o m a i n , a n d b e a r s s t r i k i n g s i m i l a r i t y t o t h e C - t e r m i n u s o f p l 0 5 ( s e e S e c t i o n 1.5.4). It i s i n t e r e s t i n g t h a t b o t h t h e C - t e r m i n u s o f p l 0 5 a n d IKBO. f u n c t i o n t o i n h i b i t t h e n u c l e a r t r a n s l o c a t i o n o f N F - K B . F o l l o w i n g s t i m u l a t i o n o f c e l l s u r f a c e r e c e p t o r s , a s i g n a l t r a n s d u c t i o n c a s c a d e i s i n i t i a t e d t h a t l e a d s t o t h e a c t i v a t i o n o f a n IKB k i n a s e c o m p l e x . T h i s c o m p l e x p h o s p h o r y l a t e s N F - K B -b o u n d IKBO. at t w o s p e c i f i c s e r i n e r e s i d u e s i n its N - t e r m i n a l r e g u l a t o r y d o m a i n , s e r i n e 3 2 a n d 3 6 ( B r o w n et al, 1995; C h e n et al., 1996). T h e a d d i t i o n o f t h e s e p h o s p h a t e s t r i g g e r s t h e r e c o g n i t i o n o f IKBO. b y t h e E 3 u b i q u i t i n l i g a s e , p - T r C P ( S p e n c e r et al., 1 9 9 9 ; W i n s t o n et al., 1 9 9 9 ) . T h e t a r g e t i n g c o m p o n e n t f o r E 3 b i n d i n g i s a shor t , p h o s p h o r y l a t i o n - d e p e n d e n t r e c o g n i t i o n e l e m e n t i n IKBCC, D S * G L D S * ( w h e r e S * r e p r e s e n t s a p h o s p h o s e r i n e ) a n d d o e s n o t i n c l u d e t h e u b i q u i t i n c o n j u g a t i o n sit e . T h e E 3 u b i q u i t i n l i g a s e t h a t b i n d s t o t h e IKBOC d e g r a d a t i o n d e t e r m i n a n t i s t h e F b o x a n d W D d o m a i n p r o t e i n P-TrCP ( S p e n c e r et al, 1999; W i n s t o n et al, 1 9 9 9 ) . W h e n p - T r C P r e c o g n i z e s t h e p h o s p h o r y l a t e d d e g r a d a t i o n s i g n a l o n N F - K B - b o u n d IKBO., it i s a s s o c i a t e d w i t h S k p l , C u l l a n d U b c H 5 C i n a l a r g e c o m p l e x ( S p e n c e r et al, 1999; W i n s t o n et al, 1 9 9 9 ) . T h e S C F p " T r C P c o m p l e x p r o m o t e s t h e U b c H 5 C - d e p e n d e n t c o n j u g a t i o n o f u b i q u i t i n t o IKBCC. T h e m u l t i u b i q u i t i n a t e d IKBOC i s t h e n t a r g e t e d t o t h e 2 6 S p r o t e a s o m e f o r d e g r a d a t i o n . T h e Drosophila IKB h o m o l o g , C a c t u s , a l s o u n d e r g o e s s i g n a l - i n d u c e d d e g r a d a t i o n ( B e l v i n et al, 1 9 9 5 ) . A n u m b e r o f p a r a l l e l s e x i s t b e t w e e n IKB a n d C a c t u s . T h e Drosophila N F - K B h o m o l o g D o r s a l i s s e q u e s t e r e d i n t h e c y t o p l a s m i n e a r l y e m b r y o s t h r o u g h i n t e r a c t i o n w i t h C a c t u s . D u r i n g d o r s a l - v e n t r a l p a t t e r n i n g o f t h e e a r l y Drosophila e m b r y o , D o r s a l i s a c t i v a t e d s p e c i f i c a l l y o n t h e v e n t r a l s i d e o f t h e e m b r y o b y t h e T o l l r e c e p t o r - s i g n a l l i n g p a t h w a y ( r e v i e w e d i n M o r i s a t o a n d A n d e r s o n , 1995). T h e p a t h w a y c u l m i n a t e s i n t h e d e s t r u c t i o n o f C a c t u s , a l l o w i n g n u c l e a r t r a n s l o c a t i o n o f D o r s a l a n d a c t i v a t i o n o f d o w n s t r e a m g e n e s s u c h as twist a n d snail ( G e i s l e r et al, 1992). T h e E 3 i n v o l v e d i n t h i s p r o c e s s i s S l i m b , a h o m o l o g o f P-T r C P , w h i c h i s a c o m p o n e n t o f a n S C F c o m p l e x i n Drosophila ( S p e n c e r etal, 1 9 9 9 ) . 5.6 The Wnt/Wg pathway T h e E 3 u b i q u i t i n l i g a s e P - T r C P / S l i m b d e g r a d e s P - c a t e n i n / A r m a d i l l o v i a t h e W n t / W g s i g n a l l i n g p a t h w a y . T h i s p a t h w a y i s c o n s e r v e d b e t w e e n C. elegans, Drosophila a n d v e r t e b r a t e s ( R o c h e l e a u et al, 1997; T h o r p e et al, 1997), a n d i s i n v o l v e d i n a n u m b e r o f 16 d e v e l o p m e n t a l l y r e g u l a t e d p r o c e s s e s s u c h as c e l l f a t e d e c i s i o n s , s e g m e n t p o l a r i t y a n d a x i s f o r m a t i o n , r e s p e c t i v e l y . I n a p p r o p r i a t e a c t i v a t i o n o f t h e W n t p a t h w a y h a s a l s o b e e n i m p l i c a t e d i n h u m a n c a n c e r s ( H e et al, 1998). I n t h e a b s e n c e o f W n t s i g n a l l i n g , t h e s e r i n e / t h r e o n i n e k i n a s e g l y c o g e n s y n t h a s e k i n a s e -3P (GSK-3P) i s a c t i v a t e d . GSK-3P, i n a c o m p l e x w i t h a d e n o m a t o u s p o l y p o s i s c o l i ( A P C ) a n d a x i n , b i n d s t o p - c a t e n i n a n d p h o s p h o r y l a t e s t w o s e r i n e r e s i d u e s o n it s N - t e r m i n u s ( O r f o r d et al, 1 9 9 7 ) . T h e p h o s p h o r y l a t i o n s i t e s a r e p a r t o f a s e q u e n c e t h a t b e a r s a s t r i k i n g r e s e m b l a n c e t o t h e IKBO. d e g r a d a t i o n s i g n a l . I n a p r o c e s s r e m i n i s c e n t o f I x B a d e g r a d a t i o n , p h o s p h o r y l a t e d P-c a t e n i n i s u b i q u i t i n a t e d a n d s u b s e q u e n t l y d e g r a d e d ( A b e r l e et al, 1 9 9 7 ; I k e d a et al, 1998). T h e S C F p " T r C P c o m p l e x i s b e l i e v e d t o m e d i a t e t h i s p r o c e s s ( M a n i a t i s , 1 9 9 9 ) . W h e n t h e W n t p a t h w a y i s a c t i v a t e d , GSK-3P i s i n h i b i t e d ( C o o k et al, 1 9 9 6 ) , r e s u l t i n g i n t h e a c c u m u l a t i o n o f P-catenin w h i c h t r a n s l o c a t e s t o t h e n u c l e u s a n d i n t e r a c t s w i t h a n H M G -b o x t r a n s c r i p t i o n f a c t o r , T c f / L E F - 1 . T h i s p r o m o t e s t h e a c t i v a t i o n o r r e p r e s s i o n o f a n u m b e r o f d e v e l o p m e n t a l g e n e s ( r e v i e w e d i n W i l l e r t a n d N u s s e 1998; P a y r e et al, 1 9 9 9 ) . 5.7 Ubiquitination of p53 T h e t u m o r s u p p r e s s o r p r o t e i n p 5 3 i s a t r a n s c r i p t i o n f a c t o r t h a t r e g u l a t e s t h e e x p r e s s i o n o f g e n e s i n v o l v e d i n c e l l c y c l e a r r e s t a n d a p o p t o s i s ( r e v i e w e d i n K o a n d P r i v e s , 1996; V o g e l s t e i n , 1 9 9 0 ) . T h e c u r r e n t m o d e l o f p 5 3 f u n c t i o n s u g g e s t s t h a t i t p r e v e n t s t h e a c c u m u l a t i o n o f s o m a t i c m u t a t i o n s b y e i t h e r s i g n a l l i n g c e l l c y c l e a r r e s t t o a l l o w t i m e f o r d a m a g e r e p a i r , o r b y e l i m i n a t i n g t h e d a m a g e d c e l l b y a p o p t o s i s . M u t a t i o n s w i t h i n t h e p 5 3 g e n e a r e f r e q u e n t l y a s s o c i a t e d w i t h h u m a n c a n c e r . D e g r a d a t i o n o f p 5 3 i s i n c r e a s e d i n c e l l s i n f e c t e d w i t h h u m a n p a p i l l o m a v i r u s ( S c h e f f n e r et al, 1 9 9 0 ) . A p r o t e i n e n c o d e d b y t h e v i r u s , E 6 , i s r e s p o n s i b l e f o r t h e i n c r e a s e d d e g r a d a t i o n o f p 5 3 . E 6 a c t s b y b i n d i n g t o a c e l l u l a r p r o t e i n c a l l e d E 6 - a s s o c i a t e d p r o t e i n ( E 6 - A P ) . T h e E 6 / E 6 - A P c o m p l e x f u n c t i o n s as a n E 3 p r o t e i n l i g a s e b y a c c e p t i n g u b i q u i t i n f r o m a n E 2 a n d t r a n s f e r r i n g it t o p 5 3 , t h e r e b y p r o m o t i n g t h e u b i q u i t i n a t i o n a n d s u b s e q u e n t d e g r a d a t i o n o f p 5 3 ( S c h e f f n e r et al, 1 9 9 5 ) . T h e E 2 e n z y m e s t h a t t r a n s f e r u b i q u i t i n t o E 6 - A P a r e U b c H 5 A , 5 B , 5 C , 6 a n d 7 ( J e n s e n et al, 1995; N u b e r et al, 1996; S c h e f f n e r et al, 1 9 9 4 ) . T h e first f o u r a r e m e m b e r s o f t h e U B C 4 b r a n c h , w h i l e U b c H 7 i s not, i n d i c a t i n g t h a t d i s t i n c t E 2 f a m i l i e s c a n d i r e c t u b i q u i t i n t r a n s f e r t o a s p e c i f i c E 3 p r o t e i n . 17 E 6 - A P i s m e m b e r o f a l a r g e f a m i l y o f r e l a t e d p r o t e i n s c a l l e d H E C T p r o t e i n s ( h o m o l o g o u s t o E 6 - A P c a r b o x y l t e r m i n u s ) ( H u i b r e g t s e et al, 1 9 9 5 ) . T h e r e a r e at l e a s t 2 0 H E C T p r o t e i n s i n h u m a n s ( S c h w a r z et al., 1 9 9 8 ) a n d s i x i n C. elegans ( P e t e r s et al., 1 9 9 8 ) . H E C T p r o t e i n s a r e d e f i n e d b y a n e s s e n t i a l c o n s e r v e d C - t e r m i n a l d o m a i n o f a p p r o x i m a t e l y 3 5 0 a m i n o a c i d s ( H u i b r e g t s e et al., 1995). T h i s d o m a i n c o n t a i n s t h e a c t i v e s i t e c y s t e i n e n e c e s s a r y f o r u b i q u i t i n t h i o e s t e r b o n d f o r m a t i o n a n d p l a y s s o m e r o l e i n s u b s t r a t e s p e c i f i c i t y . H E C T d o m a i n p r o t e i n s d e f i n e a c l a s s o f E 3 u b i q u i t i n l i g a s e s t h a t f u n c t i o n as p a r t o f a t h i o e s t e r c a s c a d e l e a d i n g t o u b i q u i t i n a t i o n o f t h e t a r g e t p r o t e i n . I n t h e a b s e n c e o f E 6 , E 6 - A P d o e s n o t d i r e c t t h e u b i q u i t i n a t i o n o r d e g r a d a t i o n o f p 5 3 ( H u i b r e g t s e et al, 1 9 9 3 ) . H o w e v e r , u n d e r n o r m a l c i r c u m s t a n c e s , p 5 3 i s a t a r g e t o f t h e u b i q u i t i n s y s t e m . T h e u b i q u i t i n l i g a s e M d m 2 h a s b e e n s h o w n t o f u n c t i o n in vivo a n d in vitro w i t h U b c H 5 t o u b i q u i t i n a t e p 5 3 , l e a d i n g t o its d e s t r u c t i o n v i a t h e 2 6 S p r o t e a s o m e ( H o n d a et al, 1 9 9 7 ) . M d m 2 is, as e x p e c t e d , a m e m b e r o f t h e H E C T f a m i l y o f E 3 p r o t e i n s . 6. C. elegans AS A MODEL ORGANISM M o s t s t u d i e s o f u b i q u i t i n - m e d i a t e d p r o t e i n d e g r a d a t i o n h a v e b e e n c a r r i e d o u t i n y e a s t o r i n m a m m a l i a n t i s s u e c u l t u r e . T o e x a m i n e t h e r o l e o f t h e u b i q u i t i n s y s t e m d u r i n g d e v e l o p m e n t i n a m u l t i c e l l u l a r o r g a n i s m , t h e f r e e - l i v i n g s o i l n e m a t o d e , C. elegans, w a s u t i l i z e d , s i n c e it h a s m a n y c h a r a c t e r i s t i c s t h a t m a k e it a n a t t r a c t i v e m o d e l o r g a n i s m f o r d e v e l o p m e n t a l , g e n e t i c a n d m o l e c u l a r s t u d i e s . It h a s a s h o r t l i f e c y c l e o f a b o u t 3-4 d a y s at 2 0 ° C w h e r e i t d e v e l o p s f r o m a n e m b r y o t h r o u g h f o u r l a r v a l s t a g e s ( L 1 - L 4 ) t o a n a d u l t ( W h i t e , 1 9 8 8 ) . It c a n b e e a s i l y g r o w n i n t h e l a b o r a t o r y o n n u t r i e n t g r o w t h m e d i a s p r e a d w i t h b a c t e r i a as a f o o d s o u r c e . T h e p o p u l a t i o n c o n s i s t s p r i m a r i l y o f s e l f - f e r t i l i z i n g h e r m a p h r o d i t e s a l t h o u g h m a l e s a r i s e s p o n t a n e o u s l y t h r o u g h n o n - d i s j u n c t i o n . M a l e s c a n b e m a i n t a i n e d b y m a t i n g t o h e r m a p h r o d i t e s , t h u s a l l o w i n g f o r g e n e t i c c r o s s e s . A s i n g l e m a t e d h e r m a p h r o d i t e w i l l p r o d u c e a r o u n d 3 0 0 p r o g e n y . T h e a n i m a l i s t r a n s p a r e n t w i t h a r e l a t i v e l y s i m p l e a n a t o m y c o n s i s t i n g o f l e s s t h a n 1 0 0 0 c e l l s . T h e d e v e l o p m e n t a l p a t t e r n i s i n v a r i a n t a n d t h e c o m p l e t e c e l l l i n e a g e , i n c l u d i n g c e l l m i g r a t i o n , p r o g r a m m e d c e l l d e a t h a n d n e u r o c i r c u i t r y i s k n o w n ( S u l s t o n , 1 9 8 3 ; S u l s t o n a n d H o r v i t z , 1977; S u l s t o n et al, 1983). A d d i t i o n a l l y , m u t a n t s c a n b e r e a d i l y o b t a i n e d u s i n g v a r i o u s m u t a g e n s . T h e m u t a n t s c a n b e e a s i l y m a p p e d a n d t h e g e n e s i s o l a t e d . M e t h o d s o f t a r g e t - s e l e c t e d g e n e i n a c t i v a t i o n u s i n g t r a n s p o s o n i n s e r t i o n a n d e x c i s i o n o r c h e m i c a l m u t a g e n s h a v e b e e n d e v e l o p e d ( R u s h f o r t h et al, 1993; P l a s t e r k et al, 1 9 9 8 ) . D N A t r a n s f o r m a t i o n i n C. 18 elegans, b o t h i n t e g r a t i v e a n d e x t r a c h r o m o s o m a l , p r o v i d e a n e f f i c i e n t m e a n s t o e m p l o y r e v e r s e g e n e t i c s a n d t o s t u d y g e n e e x p r e s s i o n a n d c e l l b i o l o g y ( M e l l o a n d F i r e , 1 9 9 5 ) . T h e g e n o m e i s r e l a t i v e l y s m a l l , b e i n g o n l y five t i m e s t h a t o f y e a s t ( H e r m a n , 1 9 8 8 ) . M o s t o f t h e g e n o m e h a s b e e n c l o n e d a n d o r d e r e d as a se r i e s o f c o s m i d a n d Y A C ( y e a s t a r t i f i c i a l c h r o m o s o m e ) c l o n e s ( C o u l s o n et al., 1 9 8 8 ) . T h e C. elegans g e n o m e s e q u e n c i n g p r o j e c t i s e s s e n t i a l l y c o m p l e t e , s o a n y s e q u e n c e o r g e n e c a n b e e a s i l y o b t a i n e d a n d m a n i p u l a t e d ( T h e C. elegans S e q u e n c i n g C o n s o r t i u m , 1998). A c e D B ( a C. elegans d a t a b a s e ) , a n p r o g r a m t h a t c o m p i l e s a n d d i s p l a y s d a t a o n C. elegans, i n c l u d i n g s e q u e n c e a n d g e n e i n f o r m a t i o n , i s c u r r e n t l y a v a i l a b l e o n l i n e at h t t p : / / g e n o m e . w u s t l . e d u / g s c / a c e / a c e d o c s / a c e . h t m l . M a n y o f t h e p h e n o t y p e s o b s e r v e d i n t h i s s t u d y m a k e i t n e c e s s a r y t o p r o v i d e a d d i t i o n a l i n f o r m a t i o n a b o u t C. elegans e m b r y o g e n e s i s a n d d e v e l o p m e n t o f t h e g o n a d , i n t e s t i n e a n d b o d y w a l l m u s c l e . 6.1 Embryonic and larval development E m b r y o g e n e s i s l a s t s a p p r o x i m a t e l y 8 0 0 m i n u t e s p o s t - f e r t i l i z a t i o n at 2 2 ° C ( W o o d , 1 9 8 8 ) . D u r i n g t h e first 100 m i n u t e s , s i x f o u n d e r c e l l s , A B , M S , E , C, D a n d P 4 a r e p r o d u c e d b y a s e r i e s o f a s y n c h r o n o u s d i v i s i o n s ( S u l s t o n et ai, 1983). T h r e e o f t h e s e , A B , M S a n d C g i v e r i s e t o a m i x t u r e o f h y p o d e r m a l , n e u r o n a l a n d m u s c l e c e l l s . D g i v e s r i s e t o b o d y w a l l m u s c l e c e l l s , E p r o d u c e s i n t e s t i n e e x c l u s i v e l y , a n d t h e g e r m l i n e d e v e l o p s f r o m d e s c e n d a n t s o f P 4 . A n u m b e r o f c e l l m i g r a t i o n s a n d p r o g r a m m e d c e l l d e a t h s t a k e p l a c e i n t h e d e s c e n d a n t s o f t h e s e f o u n d e r c e l l s d u r i n g d e v e l o p m e n t . G a s t r u l a t i o n o c c u r s at a r o u n d 100 m i n u t e s a n d i s f o l l o w e d b y a p e r i o d o f c e l l d i v i s i o n a n d o r g a n o g e n e s i s w h i c h c o n t i n u e s u n t i l a b o u t 3 5 0 m i n u t e s . F r o m 3 5 0 - 6 5 0 m i n u t e s , m o r p h o g e n e s i s t a k e s p l a c e . D u r i n g t h i s t i m e , t h e e m b r y o u n d e r g o e s t r a n s f o r m a t i o n f r o m a b a l l o f a b o u t 5 5 0 c e l l s i n t o a c y l i n d r i c a l w o r m . T h e v o l u m e a n d c e l l n u m b e r o f t h e a n i m a l d o e s n o t c h a n g e m u c h d u r i n g t h i s t i m e , b u t t h e r e i s a f o u r - f o l d i n c r e a s e i n l e n g t h . A s t h e e m b r y o e l o n g a t e s w i t h i n t h e c o n f i n e s o f t h e e g g s h e l l , it i s f o r c e d t o f o l d u p o n i t s e l f . A s e r i e s o f m o r p h o l o g i c a l s t a g e s c a n b e i d e n t i f i e d b a s e d o n t h e e x t e n t o f e l o n g a t i o n . T h e s e s t a g e s i n c l u d e c o m m a ( a r o u n d 3 9 0 m i n u t e s ) , 1.5-fold ( a r o u n d 4 2 0 m i n u t e s ) , 2 - f o l d ( a r o u n d 4 5 0 m i n u t e s ) a n d 3 - f o l d ( a r o u n d 5 2 0 m i n u t e s ) . T h e first t w i t c h i n g m o v e m e n t s , i n d i c a t i v e o f m u s c l e f u n c t i o n , a r e o b s e r v e d at a r o u n d 4 0 0 m i n u t e s a n d p h a r y n g e a l p u m p i n g b e g i n s at a b o u t 7 6 0 m i n u t e s . 19 E m b r y o s h a t c h as L I l a r v a e c o n s i s t i n g o f 5 5 8 c e l l s i n t h e h e r m a p h r o d i t e a n d 5 6 0 c e l l s i n t h e m a l e . O v e r t h e n e x t 5 0 h o u r s , l a r v a l d e v e l o p m e n t p r o c e e d s t h r o u g h t h r e e a d d i t i o n a l l a r v a l s t a g e s , L 2 , L 3 a n d L 4 , d u r i n g w h i c h t h e y u n d e r g o f u r t h e r c e l l d i v i s i o n s . T h e l a r v a l s t a g e s a r e p u n c t u a t e d b y m o l t s . D u r i n g e a c h m o l t , a n e w c u t i c l e i s s y n t h e s i z e d u n d e r t h e o l d o n e w h i c h i s s h e d . T h e c u t i c l e i s d i f f e r e n t b o t h s t r u c t u r a l l y a n d m o l e c u l a r l y at e a c h s t a g e . 6.2 Gonadal development and anatomy T h e C. elegans L I l a r v a h a t c h e s w i t h a g o n a d p r i m o r d i u m c o n s i s t i n g o f f o u r c e l l s : Z 2 a n d Z 3 a r e p r e c u r s o r s o f t h e g e r m l i n e , a n d Z l a n d Z 4 a r e s o m a t i c g o n a d p r e c u r s o r s ( r e v i e w e d i n K i m b l e a n d W a r d , 19 8 8 ) . D u r i n g g o n a d o g e n e s i s , d i s t a l t i p c e l l s p r o d u c e d f r o m Z l a n d Z 4 c o n t r o l t h e e l o n g a t i o n o f t h e g r o w i n g g o n a d a l a r ms. T h e h e r m a p h r o d i t e r e p r o d u c t i v e s y s t e m c o n s i s t s o f t w o t u b u l a r g o n a d s , o n e e x t e n d i n g a n t e r i o r l y a n d t h e o t h e r p o s t e r i o r l y f r o m t h e m i d d l e o f t h e a n i m a l . E a c h l o b e i s U - s h a p e d , c o n s i s t i n g o f a d i s t a l ( t o t h e u t e r u s ) o v a r y , a m o r e p r o x i m a l o v i d u c t a n d a s p e r m a t h e c a c o n n e c t e d t o a c o m m o n u t e r u s c e n t e r e d a r o u n d t h e v u l v a ( F i g u r e 2; K i m b l e a n d W a r d , 1988). S o m a t i c c e l l s o f t h e g o n a d c o n s i s t o f o n e d i s t a l t i p c e l l l o c a t e d at t h e a p e x o f t h e g o n a d arm, t w o s o m a t i c e p i t h e l i a l c e l l s i n t h e d i s t a l a r m a n d a c o n t r a c t i l e e p i t h e l i a l s h e a t h , o r o v i d u c t , s u r r o u n d i n g t h e p r o x i m a l a r m . T h e g e r m l i n e n u c l e i l o c a t e d m o s t d i s t a l l y a r e m i t o t i c and, as t h e y t r a v e l p r o x i m a l l y , p r o g r e s s t h r o u g h m e i o s i s a n d r e a c h d i a k i n e s i s i n t h e o v i d u c t p r i o r t o f e r t i l i z a t i o n . T h e d i s t a l a r m c o n s i s t s o f a c e n t r a l a n u c l e a t e c o r e s u r r o u n d e d b y a l a y e r o f g e r m l i n e n u c l e i . A n i n c o m p l e t e p l a s m a m e m b r a n e s e p a r a t e s e a c h n u c l e u s , w h i l e t h e c y t o p l a s m i s c o n t i n u o u s . T h u s , t h e o v a r y i s s y n c y t i a l i n t h e d i s t a l arm. D i f f e r e n t i a t i o n o f t h e g e r m l i n e c e l l s i n t o s p e r m a n d o o c y t e s b e g i n s i n t h e l o o p r e g i o n . T h e p r o x i m a l a r m o f t h e g o n a d i s t h e s i t e o f g a m e t o g e n e s i s . H e r m a p h r o d i t e s t r a n s i e n t l y p r o d u c e a b o u t 1 5 0 s p e r m b e f o r e s w i t c h i n g t o o o c y t e p r o d u c t i o n . D e v e l o p i n g o o c y t e s t r a v e l s i n g l e f i l e a l o n g t h e p r o x i m a l a r m a n d a r r e s t i n d i a k i n e s i s o f m e i o s i s I. T h e o o c y t e i s f e r t i l i z e d as it p a s s e s t h r o u g h t h e s p e r m a t h e c a t o t h e u t e r u s . T h e o o c y t e n u c l e u s c o m p l e t e s m e i o s i s a f t e r f e r t i l i z a t i o n , t w o p o l a r b o d i e s a r e e x t r u d e d a n d t h e t w o p r o n u c l e i m o v e t o w a r d s o n e a n o t h e r . T h e p r o n u c l e a r m e m b r a n e s b r e a k d o w n a n d e m b r y o n i c c e l l d i v i s i o n s b e g i n . T h e m a l e r e p r o d u c t i v e s y s t e m c o n s i s t s o f a s i n g l e U - s h a p e d t u b u l a r t e s t i s t h a t is c o n n e c t e d t o t h e c l o a c a b y t h e s e m i n a l v e s i c l e a n d v a s d e f e r e n s ( F i g u r e 2 ) . T w o d i s t a l t i p c e l l s a r e l o c a t e d at t h e a p e x o f t h e testis. A s i n h e r m a p h r o d i t e s , g e r m l i n e c e l l s a r e m i t o t i c d i s t a l l y 20 Figure 2. Organization of the hermaphrodite and male gonad. A ) H e r m a p h r o d i t e g o n a d s t r u c t u r e . T h e d i s t a l t i p c e l l , o v a r y , o v i d u c t , o o c y t e s , s p e r m a t h e c a , u t e r u s , v u l v a a n d d e v e l o p i n g e g g s a r e i n d i c a t e d . B ) M a l e g o n a d s t r u c t u r e . T h e d i s t a l t i p c e l l s , t e s t i s , s p e r m a t o c y t e s , s p e r m , s e m i n a l v e s i c l e , v a s d e f e r e n s , p r o c t o d e u m , f a n a n d s e n s o r y r a y s a r e i n d i c a t e d . F r o m W h i t e , 1988. 21 22 a n d p r o g r e s s t h r o u g h m e i o s i s as t h e y m o v e p r o x i m a l l y . S p e r m m a t u r e at t h e p r o x i m a l e d g e o f t h e p r o x i m a l a r m a n d s p e r m a t i d s t r a v e l t h r o u g h t h e v a s d e f e r e n s t o t h e s e m i n a l v e s i c l e . S p e r m a t i d s t r a n s f e r r e d t o h e r m a p h r o d i t e s d u r i n g c o p u l a t i o n c o m p l e t e m a t u r a t i o n i n t h e u t e r u s w h e r e t h e y f o r m p s e u d o p o d s a n d c r a w l t o t h e s p e r m a t h e c a . T h e m a l e t a i l c o n t a i n s s e v e r a l s t r u c t u r e s s p e c i a l i z e d f o r c o p u l a t i o n . T h e t a i l f o r m s i n t o a f a n w i t h n i n e p a i r s o f s e n s o r y r a y s a n d t w o c o p u l a t o r y s p i c u l e s . T h e s e s t r u c t u r e s a r e u s e d t o l o c a t e t h e h e r m a p h r o d i t e v u l v a a n d f o r s p e r m t r a n s f e r . 6.3 Intestinal structure I n C. elegans, t h e i n t e s t i n e c o n s i s t s o f a t u b e o f 2 0 c e l l s s u r r o u n d i n g a n i n t e r i o r l u m e n ( W h i t e , 1 9 8 8 ) . A d e n s e l a y e r o f m i c r o v i l l i i s l o c a t e d o n t h e a p i c a l s u r f a c e o f t h e s e c e l l s . A l l b u t t h e s i x a n t e r i o r - m o s t a n d a n y o f t h e f o u r p o s t e r i o r - m o s t c e l l s u n d e r g o n u c l e a r d i v i s i o n d u r i n g L I l e t h a r g u s a n d b e c o m e b i n u c l e a t e , r e s u l t i n g i n 3 0 - 3 4 n u c l e i i n a d u l t s . T h e n u c l e i a r e l a r g e a n d c i r c u l a r , w i t h a p r o m i n e n t n u c l e o l u s . T h e i n t e s t i n a l c e l l s a l s o u n d e r g o e n d o r e d u p l i c a t i o n o f t h e i r D N A d u r i n g l a r v a l g r o w t h t o r e a c h a D N A c o n t e n t o f 3 2 n i n a d u l t s ( H e d g e c o c k a n d W h i t e , 1 9 8 5 ) . T h e i n t e s t i n e c o n n e c t s t o t h e p h a r y n x v i a t h e p h a r y n g e a l - i n t e s t i n a l v a l v e . T h i s s t r u c t u r e i s m a d e u p o f s i x c e l l s ( W h i t e , 1988). O n e c e l l c o n n e c t s t o t h e m u s c l e c e l l at t h e p o s t e r i o r e n d o f t h e p h a r y n x , t w o a r e a t t a c h e d t o t h e a n t e r i o r i n t e s t i n a l c e l l s a n d a l a y e r o f t h r e e c e l l s l i e s i n b e t w e e n . A l l o f t h e c e l l s a r e c o u p l e d t o e a c h o t h e r b y d e s m o s o m e s . I n t e s t i n a l c e l l s a r e m u l t i - f u n c t i o n a l . T h e y s e c r e t e d i g e s t i v e e n z y m e s i n t o t h e l u m e n a n d a b s o r b n u t r i e n t s . Y o l k p r o t e i n s y n t h e s i s o c c u r s e x c l u s i v e l y i n t h e i n t e s t i n a l c e l l s . T h e y o l k p r o t e i n s a r e s e c r e t e d i n t o t h e p s e u d o c o e l o m a n d t r a n s p o r t e d t o t h e g o n a d t o b e i n c o r p o r a t e d i n t o d e v e l o p i n g o o c y t e s ( K i m b l e a n d S h a r r o c k , 1 9 8 3 ) . I n t e s t i n a l c e l l s a r e o n e o f t h e m a j o r s t o r a g e o r g a n s o f t h e n e m a t o d e b o d y a n d c o n t a i n a l a r g e n u m b e r o f g r a n u l e s w i t h d i v e r s e f u n c t i o n s . S o m e o f t h e s e g r a n u l e s c o n t a i n y o l k p r o t e i n s . A s u b s e t o f g u t g r a n u l e s a r e s t r o n g l y a u t o f l u o r e s c e n t u n d e r 3 0 0 - 4 0 0 n m l i g h t a n d a p p e a r t o b e l y s o s o m e s ( C l o k e y a n d J a c o b s o n , 1 9 8 6 ) . S o m e g r a n u l e s c o n t a i n l i p i d , p r o t e i n , a n d / o r c a r b o h y d r a t e d e p o s i t s . 6.4 Muscle structure and development C. elegans b o d y w a l l m u s c l e e x t e n d s f r o m n o s e t o t a i l a n d i s a r r a n g e d i n f o u r q u a d r a n t s l o c a t e d l e f t a n d r i g h t s u b d o r s a l l y a n d l e f t a n d r i g h t s u b v e n t r a l l y ( F i g u r e 3 ) . E a c h q u a d r a n t c o n s i s t s o f a d o u b l e r o w o f e l o n g a t e d s p i n d l e - s h a p e d m u s c l e c e l l s t h a t r u n t h e l e n g t h o f t h e 23 Figure 3. C elegans anatomy and muscle organization. A ) S c h e m a t i c o f t h e p o s i t i o n o f b o d y w a l l m u s c l e s i n C. elegans. B ) D i a g r a m m a t i c v i e w o f t h e m y o f i l a m e n t l a t t i c e , s h o w i n g t h i n a n d t h i c k f i l a m e n t s a n d t h e i r r e s p e c t i v e a t t a c h m e n t s t r u c t u r e s , t h e d e n s e b o d i e s a n d M -l i n e s . C ) S c h e m a t i c o f a d e n s e b o d y w i t h t h e c o m p o n e n t s , i n c l u d i n g c u t i c l e , h y p o d e r m i s , b a s e m e n t m e m b r a n e , c e l l m e m b r a n e , i n t e g r i n , t a l i n , v i n c u l i n , a - a c t i n i n a n d a c t i n i n d i c a t e d . A d a p t e d f r o m M u l l e n , 1998. 24 vulva anus 25 a n i m a l . M u s c l e c e l l s a r e a t t a c h e d t o t h e h y p o d e r m i s t h r o u g h a n e x t r a c e l l u l a r m a t r i x t e r m e d t h e b a s e m e n t m e m b r a n e . T h i s p h y s i c a l l i n k b e t w e e n b o d y w a l l m u s c l e a n d t h e h y p o d e r m i s t h r o u g h t h e b a s e m e n t m e m b r a n e i s c r i t i c a l i n t r a n s d u c i n g t h e f o r c e o f c o n t r a c t i o n t o t h e c u t i c l e o f t h e n e m a t o d e f o r l o c o m o t i o n . 6.4.1 Muscle composition T h e b a s i c s t r u c t u r a l u n i t o f C. elegans m u s c l e i s a n a l o g o u s t o t h e s a r c o m e r e o f v e r t e b r a t e m u s c l e ( r e v i e w e d i n W a t e r s t o n 1988). T h i c k f i l a m e n t s c o n t a i n i n g m y o s i n a r e c e n t r a l l y p l a c e d a n d o v e r l a p w i t h t w o sets o f a c t i n - c o n t a i n i n g t h i n f i l a m e n t s . T h e t h i c k filaments a r e a l i g n e d b y a s t r u c t u r e c a l l e d t h e M - l i n e , a n d t h i n f i l a m e n t s a r e a t t a c h e d t o d e n s e b o d i e s ( F i g u r e 3). B o t h d e n s e b o d i e s a n d M - l i n e s a r e a n c h o r e d t o t h e b a s e m e n t m e m b r a n e a n d s e r v e a s s i t e s f o r t h e a t t a c h m e n t o f m u s c l e c e l l s t o t h e h y p o d e r m i s ( F r a n c i s a n d W a t e r s t o n , 1 9 8 5 ) . D e n s e b o d i e s a n d M - l i n e s a r e a t t a c h e d t o t h e b a s e m e n t m e m b r a n e t h r o u g h t r a n s m e m b r a n e c o m p l e x e s . M - l i n e c o m p l e x e s c o n t a i n t r a n s m e m b r a n e r e c e p t o r s c a l l e d i n t e g r i n s ( F r a n c i s a n d W a t e r s t o n , 1 9 8 5 ) a n d t h e unc-89 p r o d u c t ( B e n i a n et ai, 1 9 9 6 ) . D e n s e b o d i e s a r e s i m i l a r i n s t r u c t u r e t o v e r t e b r a t e f o c a l a d h e s i o n c o m p l e x e s ( B u r r i d g e et al., 1 9 9 7 ) . T h e y a r e a n c h o r e d t o t h e b a s e m e n t m e m b r a n e t h r o u g h i n t e g r i n s ( F i g u r e 3; G e t t n e r et al, 1 9 9 5 ) . I n t e g r i n s a r e h e t e r o d i m e r i c m o l e c u l e s m a d e u p o f o n e a - a n d o n e P-subunit. I n C. elegans, a-i n t e g r i n (pat-2) a n d P-l i n t e g r i n (pat-3) f o r m t h e t r a n s m e m b r a n e i n t e g r i n r e c e p t o r ( W i l l i a m s a n d W a t e r s t o n , 1 9 8 9 ) . I n t e g r i n s a r e e s s e n t i a l f o r m e d i a t i n g c e l l - e x t r a c e l l u l a r m e m b r a n e a n d c e l l - c e l l i n t e r a c t i o n s . T h e y a l s o f u n c t i o n t o a c t i v a t e s i g n a l l i n g p a t h w a y s t h a t r e g u l a t e g e n e e x p r e s s i o n a n d c a n i n f l u e n c e c e l l f a t e d e c i s i o n s ( B u r r i d g e et al., 1 9 9 7 ) . I n t r a c e l l u l a r l y , i n t e g r i n s a r e a s s o c i a t e d w i t h v i n c u l i n {deb-1; B a r s t e a d a n d W a t e r s t o n , 1 9 8 9 ) , t a l i n ( M o u l d e r et al., 1 9 9 6 ) a n d a - a c t i n i n (atn-1; B a r s t e a d a n d W a t e r s t o n , 1 9 9 1 ; F r a n c i s a n d W a t e r s t o n , 1 9 8 5 ) t o m a k e u p t h e d e n s e b o d y . T h e s e m o l e c u l e s i n t u r n a s s o c i a t e w i t h t h e a c t i n - c o n t a i n i n g t h i n f i l a m e n t s o f t h e s a r c o m e r e . I n v e r t e b r a t e s , a n u m b e r o f o t h e r c e l l a d h e s i o n a n d s i g n a l l i n g m o l e c u l e s h a v e b e e n i d e n t i f i e d t h a t a r e a l s o a s s o c i a t e d w i t h i n t e g r i n ( B u r r i d g e et al., 1997). E x t r a c e l l u l a r l y , i n t e g r i n s a n c h o r d e n s e b o d i e s t o t h e b a s e m e n t m e m b r a n e . B a s e m e n t m e m b r a n e s a r e t h i n s h e e t s o f s p e c i a l i z e d e x t r a c e l l u l a r m a t r i x ( E C M ) m a t e r i a l t h a t a r e c l o s e l y a s s o c i a t e d w i t h c e l l m e m b r a n e s . T h e y a r e i m p o r t a n t i n c e l l a d h e s i o n , m i g r a t i o n a n d d i f f e r e n t i a t i o n . D u r i n g m o r p h o g e n e s i s , t h e y a r e r e q u i r e d t o p r o v i d e a s u r f a c e f o r c e l l 26 a t t a c h m e n t w h i l e t i s s u e s a r e o r g a n i z e d , a n d t o i n i t i a t e c e l l p o l a r i t y t h r o u g h i n t e r a c t i o n w i t h c e l l u l a r p r o t e i n s a n d t h e c y t o s k e l e t o n . I n C. elegans, b a s e m e n t m e m b r a n e s c o v e r t h e p s e u d o c o e l o m i c f a c e s o f t h e h y p o d e r m i s , p h a r y n x , i n t e s t i n e , g o n a d , a n d b o d y w a l l m u s c l e s ( W h i t e e/ al, 1 9 7 6 ) . B a s e m e n t m e m b r a n e s a r e c o m p o s e d o f t y p e I V c o l l a g e n , l a m i n i n , a n d p r o t e o g l y c a n s ( P a u l s s o n , 1992; Y u r c h e n c o a n d S c h i t t n y , 1990). C. elegans g e n e s f o r m o s t o f t h e b a s e m e n t m e m b r a n e c o m p o n e n t s h a v e b e e n i d e n t i f i e d . T y p e I V c o l l a g e n i s a h e t e r o t r i m e r o f t w o a l (emb-9) a n d o n e a 2 ( I V ) (let-2) c h a i n s ( S i b l e y et al, 1993). L a m i n i n i s a t r i m e r i c m o l e c u l e , c o m p o s e d o f t h r e e d i s u l f i d e - b o n d e d s u b u n i t s , aPy, t h a t b i n d s t o i n t e g r i n ( T i m p l a n d B r o w n , 1 9 9 4 ) . I n C. elegans, t h e a c h a i n (epi-1) a n d P c h a i n (lam-1) h a v e b e e n i d e n t i f i e d ( K . J o h , p e r s . comm.). P r o t e o g l y c a n s a r e a l a r g e f a m i l y o f p r o t e i n s i n v e r t e b r a t e s . T h e C. elegans unc-52 g e n e e n c o d e s t h e h o m o l o g o f t h e m a m m a l i a n b a s e m e n t m e m b r a n e h e p a r a n s u l f a t e p r o t e o g l y c a n , p e r l e c a n ( R o g a l s k i et al, 1993). P e r l e c a n b i n d s t o m a n y b a s e m e n t m e m b r a n e c o m p o n e n t s a n d t o i n t e g r i n s . T h e a s s o c i a t i o n o f i n t e g r i n w i t h p e r l e c a n (unc-52) i s r e q u i r e d f o r a n c h o r i n g d e n s e b o d i e s a n d M - l i n e s ( M u l l e n , 1998). A n o t h e r c o m p o n e n t o f b a s e m e n t m e m b r a n e s i s S P A R C , a g l y c o p r o t e i n t h a t c a n m o d u l a t e t h e i n t e r a c t i o n o f c e l l s w i t h t h e E C M ( L a n e a n d S a g e , 1994; S c h w a r z b a u e r a n d S p e n c e r , 1 9 9 3 ) . L o c o m o t i o n i s a c c o m p l i s h e d b y t r a n s m i s s i o n o f t h e f o r c e o f c o n t r a c t i o n t o t h e c u t i c l e o f t h e a n i m a l . F o r t h i s t o o c c u r , t h e m y o f i l a m e n t l a t t i c e i s a t t a c h e d t o t h e c u t i c l e v i a a s e r i e s o f l i n k s b e t w e e n t h e b a s e m e n t m e m b r a n e , t h e h y p o d e r m i s a n d t h e c u t i c l e . I n v e r t e b r a t e s , a d h e s i o n o f t h e h y p o d e r m i s t o t h e b a s e m e n t m e m b r a n e a n d t h e c u t i c l e i s m e d i a t e d b y h e m i d e s m o s o m e s ( R e v i e w e d b y G a r r o d , 1993). H e m i d e s m o s o m e s a r e b e l i e v e d t o p l a y a k e y r o l e i n s i g n a l t r a n s d u c t i o n p a t h w a y s tha t l e a d t o b a s a l c e l l p r o l i f e r a t i o n a n d e p i d e r m a l d i f f e r e n t i a t i o n . T h e t r a n s m e m b r a n e c o m p l e x o f h e m i d e s m o s o m e s i s c o m p o s e d o f i n t e g r i n a n d B P A G 2 ( H o p k i n s o n et al, 1992; S t e p p et al, 1990). T h e p r o t e i n H D 1 i s i n v o l v e d i n a t t a c h m e n t o f t h e t r a n s m e m b r a n e c o m p l e x t o t h e i n t e r m e d i a t e f i l a m e n t s o f t h e e p i d e r m a l c e l l ( H i e d a et al, 1 9 9 2 ) . W i t h i n t h e b a s e m e n t m e m b r a n e , i n t e g r i n s a r e b e l i e v e d t o b e a s s o c i a t e d w i t h k a l i n i n ( a l s o c a l l e d n i c e i n ) w h i c h b i n d s l a m i n i n ( R o u s e l l e et al, 1 9 9 1 ) . I n C. elegans, h e m i d e s m o s o m e s are a s s o c i a t e d w i t h d e n s e b o d i e s i n b o d y w a l l m u s c l e a n d t h e p h a r y n g e a l - i n t e s t i n a l v a l v e ( W a t e r s t o n , 1988). T h e y a n c h o r t h e h y p o d e r m i s t o t h e b a s e m e n t m e m b r a n e a n d t h e c u t i c l e . T o n o f i l a m e n t s l o c a t e d i n h y p o d e r m a l c e l l s a d j a c e n t t o m u s c l e c e l l s c o n n e c t t o h e m i d e s m o s o m e s . M a n y o f t h e c o m p o n e n t s o f h e m i d e s m o s o m e s h a v e 27 n o t b e e n i d e n t i f i e d , a l t h o u g h t h e m o n o c l o n a l a n t i b o d y M H 5 a p p e a r s t o r e a c t s p e c i f i c a l l y w i t h a h e m i d e s m o s o m a l p r o t e i n ( F r a n c i s a n d W a t e r s t o n , 1991). S e v e r a l o t h e r m o n o c l o n a l a n t i b o d i e s , M H 4 a n d M H 4 6 a p p e a r t o b e h y p o d e r m a l p r o t e i n s t h a t a r e i n v o l v e d i n a d h e s i o n o f t h e h y p o d e r m i s t o t h e b a s e m e n t m e m b r a n e . M y o t a c t i n (let-805) i s i n v o l v e d i n m a i n t a i n i n g t h e c o n n e c t i o n b e t w e e n m u s c l e c e l l s a n d h e m i d e s m o s o m e s a n d m a y b e a c o m p o n e n t o f h e m i d e s m o s o m e s ( H r e s k o et al, 1999). T h e t r a n s m e m b r a n e p r o t e i n mup-4 i s b e l i e v e d t o i n t e r a c t d i r e c t l y w i t h t h e b a s e m e n t m e m b r a n e a n d / o r t h e c u t i c l e t o a n c h o r t h e h y p o d e r m i s t o t h e E C M ( L . H o n g , pers. comm.). T h i s f u n c t i o n s u g g e s t s t h a t mup-4 i s a l s o a c o m p o n e n t o f h e m i d e s m o s o m e s . D u r i n g p o s t - e m b r y o n i c d e v e l o p m e n t i n C. elegans, t h e b a s e m e n t m e m b r a n e a n d t h e c u t i c l e u n d e r g o s t r u c t u r a l c h a n g e s . T h e unc-52 g e n e e x p r e s s e s t i s s u e a n d t e m p o r a l - s p e c i f i c p e r l e c a n i s o f o r m s ( M u l l e n et al, 1 9 9 9 ) t h a t m u s t b e i n c o r p o r a t e d i n t o t h e b a s e m e n t m e m b r a n e at d i f f e r e n t t i m e s d u r i n g d e v e l o p m e n t . A t t h e e n d o f e a c h l a r v a l stage, n e m a t o d e s u n d e r g o a m o l t i n w h i c h n e w c u t i c l e i s f o r m e d a n d o l d c u t i c l e i s s h e d . T h u s , a t t a c h m e n t o f t h e c u t i c l e t o t h e h y p o d e r m i s m u s t b e d e s t r o y e d a n d r e f o r m e d at e a c h m o l t . T h e m e c h a n i s m s i n v o l v e d i n t h e s e p r o c e s s e s a r e u n k n o w n . 6.4.2 Muscle development M u s c l e d e v e l o p m e n t i n C. elegans c a n b e d i v i d e d i n t o f o u r p h a s e s : c e l l f a t e d e c i s i o n , c e l l m i g r a t i o n , m y o f i l a m e n t l a t t i c e a s s e m b l y , a n d m u s c l e g r o w t h . D u r i n g e m b r y o n i c d e v e l o p m e n t , 81 o f t h e 9 5 b o d y w a l l m u s c l e c e l l s a r e b o r n a n d e s t a b l i s h a t t a c h m e n t s t o e a c h o t h e r a n d t o t h e h y p o d e r m i s . T h e s e a t t a c h m e n t s a r e m a i n t a i n e d d u r i n g l a r v a l m o l t s . M u s c l e s t r u c t u r a l p r o t e i n s a r e first d e t e c t e d at a r o u n d 2 9 0 m i n u t e s ( E p s t e i n a n d B e r n s t e i n , 1 9 9 2 ) . T w o r o w s o f m y o b l a s t s a r e i n i t i a l l y l o c a t e d l a t e r a l l y a l o n g t h e s e a m c e l l s ( F i g u r e 4; S u l s t o n et al, 1 9 8 3 ) . T h e m y o b l a s t s m i g r a t e o n t o d o r s a l a n d v e n t r a l s u r f a c e s , a n d o r g a n i z e i n t o t w o d o r s a l a n d t w o v e n t r a l m u s c l e q u a d r a n t s b y 3 5 0 m i n u t e s . M u s c l e c o m p o n e n t s l o c a l i z e t o t h e m e m b r a n e s w h e r e a d j a c e n t m u s c l e c e l l s c o n t a c t o n e a n o t h e r a n d t h e u n d e r l y i n g h y p o d e r m a l c e l l s ( H r e s k o et al, 1994). H y p o d e r m a l c o m p o n e n t s a c c u m u l a t e i n t h e r e g i o n s a d j a c e n t t o t h e m u s c l e , a n d m u s c l e c e l l s f l a t t e n a g a i n s t h y p o d e r m i s . A t t h i s p o i n t , m u s c l e , b a s e m e n t m e m b r a n e a n d h e m i d e s m o s o m e c o m p o n e n t s b e c o m e c o e x t e n s i v e . T h e o r g a n i z a t i o n o f s a r c o m e r e s b e g i n s at t h e b a s e m e n t m e m b r a n e w h e r e t w o m e m b r a n e - a s s o c i a t e d p r o t e i n s , i n t e g r i n a n d p e r l e c a n , c o l o c a l i z e a n d f o r m p a r t o f t h e n u c l e a t i o n s i t e f o r d e n s e b o d y a n d M - l i n e 28 Figure 4. Embryonic muscle assembly in C. elegans. S u m m a r y o f m y o f i l a m e n t a s s e m b l y i n C. elegans, d e p i c t e d i n c r o s s s e c t i o n s o f e m b r y o s at v a r i o u s s t a g e s o f d e v e l o p m e n t . 1) A n e m b r y o 2 9 0 m i n u t e s a f t e r first d i v i s i o n . M y o f i l a m e n t c o m p o n e n t s ( d o t s ) a c c u m u l a t e d i n m u s c l e c e l l s ( c i r c l e s ) t h a t a r e a d j a c e n t t o s e a m c e l l s . M u s c l e c e l l s b e g i n d o r s a l a n d v e n t r a l m i g r a t i o n s . 2 ) 3 5 0 m i n u t e e m b r y o . M y o f i l a m e n t c o m p o n e n t s p o l a r i z e t o t h e p l a s m a m e m b r a n e at s i t e s a d j a c e n t t o o t h e r m u s c l e c e l l s a n d t h e h y p o d e r m i s . B a s e m e n t m e m b r a n e a n d h e m i d e s m o s o m a l c o m p o n e n t s a r e c o n c e n t r a t e d at t h e s e f o c a l r e g i o n s ( b l a c k a n d h a t c h i n g , r e s p e c t i v e l y ) . 3 ) C l o s e - u p o f m u s c l e q u a d r a n t o f 4 2 0 m i n u t e e m b r y o . M u s c l e c e l l s f l a t t e n a n d m y o f i l a m e n t , b a s e m e n t m e m b r a n e a n d h e m i d e s m o s o m e c o m p o n e n t s a r e c o e x t e n s i v e . 4 ) C l o s e - u p o f m u s c l e q u a d r a n t o f 4 5 0 m i n u t e e m b r y o s h o w i n g o r g a n i z a t i o n o f m y o f i l a m e n t l a t t i c e a n d t h e e x t r a c e l l u l a r a n c h o r a g e . F r o m H r e s k o et ai, 1994; M u l l e n , 1998; r e v i e w e d i n M o e r m a n a n d F i r e , 1997. 29 (1) 290 min Dorsal (3) 420 min Dorsal Ventral (2) 350 min (4) 450 min 30 a s s e m b l y . T h e a s s e m b l y o f d e n s e b o d i e s a n d M - l i n e s i s b e l i e v e d t o o c c u r b y t h e s t e p w i s e a d d i t i o n o f i n t e r n a l c o m p o n e n t s f r o m t h i s n u c l e a t i o n site. T h e o r g a n i z a t i o n o f t h e h y p o d e r m a l c o m p o n e n t s i n t o h e m i d e s m o s o m e s o c c u r s c o o r d i n a t e l y w i t h m u s c l e a s s e m b l y . T h e p o s i t i o n o f h e m i d e s m o s o m e s i n t h e h y p o d e r m i s i s n o t d i c t a t e d b y t h e p o s i t i o n o f m u s c l e s t r u c t u r a l c o m p o n e n t s ( F r a n c i s a n d W a t e r s t o n , 1 9 8 5 ) . T h e m y o f i l a m e n t l a t t i c e i s f u l l y f o r m e d b y 4 5 0 m i n u t e s ( H r e s k o etal, 1 9 9 4 ) a n d l a r v a e h a t c h w i t h t w o s a r c o m e r e s i n e a c h m u s c l e c e l l . D u r i n g l a r v a l d e v e l o p m e n t , m u s c l e c e l l s i n c r e a s e i n s i z e , t h e n u m b e r o f s a r c o m e r e s p e r c e l l i n c r e a s e s t o a r o u n d t e n i n a d u l t m u s c l e , a n d a f e w n e w b o d y w a l l m u s c l e c e l l s a r e g e n e r a t e d . 6.5 cis- and fra/ts-splicing of C. elegans gene transcripts C. elegans g e n e t r a n s c r i p t s c a n u n d e r g o b o t h cis- a n d fr-cms-splicing ( K r a u s e a n d H i r s h , 1987; B l u m e n t h a l a n d S t e w a r d , 1997). T h e r e m o v a l o f i n t r o n s b y c / s - s p l i c i n g f o l l o w s a p r o c e s s s i m i l a r t o t h a t i n o t h e r e u k a r y o t e s . A l m o s t a l l i n t r o n s b e g i n w i t h t h e d i n u c l e o t i d e G U ( w i t h t h e v e r y r a r e u s e o f G C ) a n d e n d w i t h t h e d i n u c l e o t i d e A G . T h i s i s r e f e r r e d t o as t h e G U -A G r u l e . T h e 5' s p l i c e s i t e c o n s e n s u s s e q u e n c e G / G U R A G ( R = A o r G ) i s w e l l c o n s e r v e d i n C. elegans. H o w e v e r , t h e 3' s p l i c e s i t e c o n s e n s u s v a r i e s s l i g h t l y f r o m t h a t i n o t h e r e u k a r y o t e s , c o n s i s t i n g o f a n e x t e n d e d , v e r y h i g h l y c o n s e r v e d c o n s e n s u s s e q u e n c e , U U U U C A G . C. elegans a l s o d i s p l a y s ^ r a w s - s p l i c i n g , i n w h i c h a 2 2 - n u c l e o t i d e s p l i c e d l e a d e r ( S L ) s e q u e n c e f r o m a s m a l l n u c l e a r R N A is a t t a c h e d t o t h e 5' e n d o f a m R N A p r e c u r s o r ( K r a u s e a n d H i r s h , 1 9 8 7 ) . T h e s p l i c e s i t e f o r / r a w s - s p l i c i n g i s t h e s a m e as t h a t f o r c / s - s p l i c i n g e x c e p t t h a t i t l a c k s t h e 5' d o n o r c o n s e n s u s site. A n u m b e r o f S L s e q u e n c e s h a v e b e e n i d e n t i f i e d . S L 1 i s t h e m o s t c o m m o n s p l i c e d l e a d e r u s e d , a n d i s a t t a c h e d n e a r t h e 5' e n d s o f m o s t p r e - m R N A s . S L 2 is u s e d at i n t e r n a l 7 r a«s-splicing s i t e s o f p o l y c i s t r o n i c p r e - m R N A s ( H u a n g a n d H i r s c h , 1 9 8 9 ) . R e c e n t l y , S L 3 , -4 a n d -5 s e q u e n c e s h a v e b e e n i d e n t i f i e d , a l t h o u g h t h e e x a c t r o l e o f t h e s e a d d i t i o n a l S L s h a v e n o t b e e n e l u c i d a t e d ( R o s s et al, 1 9 9 5 ) . 6.6 Operons in C. elegans C. elegans c o n t a i n s n u m e r o u s g e n e s t h a t a r e o r g a n i z e d as o p e r o n s ( B l u m e n t h a l a n d S t e w a r d , 1997). I n a n o p e r o n , t w o o r m o r e s t r u c t u r a l g e n e s a r e t r a n s c r i b e d a s a p o l y c i s t r o n i c m e s s a g e d r i v e n b y a u n i q u e 5' p r o m o t e r / e n h a n c e r r e g i o n ( S p i e t h et al, 1 9 9 3 ) . T h e p o l y c i s t r o n i c m e s s a g e i s c o n v e r t e d t o m o n o c i s t r o n i c m R N A s b y c o n v e n t i o n a l c l e a v a g e a n d p o l y a d e n y l a t i o n o f t h e 3' ends. A d d i t i o n a l l y , t h e p r e - m R N A s a r e fr-cms-spliced t o a s p l i c e d 31 l e a d e r . T h e f i r s t g e n e o f t h e p o l y c i s t r o n i c m e s s a g e i s u s u a l l y trans-spMced t o S L 1 w h i l e g e n e s i n d o w n s t r e a m p o s i t i o n s a r e g e n e r a l l y S L 2 s p l i c e d ; h o w e v e r , t h e y t o o , c a n b e S L 1 s p l i c e d ( S p i e t h et al, 1993; Z o r i o et al., 1994). 7. UBC-2 CHARACTERIZATION T h e C. elegans g e n e e n c o d i n g t h e u b i q u i t i n - c o n j u g a t i n g e n z y m e , ubc-2 h a s b e e n c l o n e d a n d p a r t i a l l y c h a r a c t e r i z e d ( Z h e n , 1995). U B C - 2 i s a 16.7 k D a p r o t e i n t h a t b e l o n g s t o a h i g h l y c o n s e r v e d g e n e f a m i l y o f c l a s s I E 2 s w h i c h i n c l u d e s y e a s t U B C 4 a n d U B C 5 ( S e u f e r t a n d J e n t s c h , 1 9 9 0 ) , Drosophila UbcDl ( T r e i e r et al., 1992), Arabidopsis U B C 8 ( G i r o d et al, 1 9 9 3 ) a n d h u m a n U b c H 5 ( J e n s e n et al, 1995; S c h e f f n e r et al, 1994). ubc-2 b e a r s s t r i k i n g s e q u e n c e s i m i l a r i t y t o y e a s t U B C 4 / 5 a n d Drosophila UbcDl, at 9 0 % a n d 9 8 % , r e s p e c t i v e l y . C. elegans ubc-2 w a s s h o w n t o b e t h e f u n c t i o n a l h o m o l o g o f y e a s t U B C 4 , as it c a n r e s c u e t h e g r o w t h d e f e c t o f y e a s t ubc4ubc5 d o u b l e m u t a n t s ( Z h e n et al, 1993). N o r t h e r n a n a l y s i s i n d i c a t e s t h a t ubc-2 i s c o n s t i t u t i v e l y e x p r e s s e d at a l l l i f e s t a g e s . T h e p r o t e i n i s p r e s e n t at e a c h l i f e stage, a l t h o u g h t h e r e i s s o m e v a r i a t i o n i n t h e p a t t e r n o f U B C - 2 e x p r e s s i o n d u r i n g d e v e l o p m e n t ( Z h e n et al, 1996). I n t r a n s g e n i c a n i m a l s t h a t e x p r e s s e d ubc-2/lac Z f u s i o n s , t h e f u s i o n p r o t e i n w a s e x p r e s s e d i n a t i s s u e g e n e r a l p a t t e r n i n e m b r y o n i c a n d l a r v a l s t a g e s t h a t b e c a m e r e s t r i c t e d t o t h e n e r v o u s s y s t e m i n a d u l t s . T h i s w a s c o n f i r m e d i m m u n o f l u o r e s c e n t s t a i n i n g o f a d u l t s u s i n g t h e a n t i - U B C - 2 a n t i b o d y . H o w e v e r , a d e t a i l e d a n a l y s i s o f t h e U B C - 2 s t a i n i n g p a t t e r n i n w i l d t y p e a n i m a l s w a s n o t u n d e r t a k e n . A c o m p l e m e n t a t i o n s c r e e n o f p r e v i o u s l y i d e n t i f i e d e s s e n t i a l g e n e s i n t h e v i c i n i t y o f ubc-2 r e v e a l e d t h a t ubc-2 c o r r e s p o n d s t o let-70, a g e n e e s s e n t i a l f o r l a r v a l d e v e l o p m e n t ( Z h e n et al, 1 9 9 6 ) . T w o r e c e s s i v e a l l e l e s o f let-70 w e r e i d e n t i f i e d ; b o t h a r e L 2 / L 3 l a r v a l l e t h a l . T h e m o l e c u l a r n a t u r e o f t h e m u t a t i o n s w a s d e t e r m i n e d ( F i g u r e 5). let-70(sl 132) i s a C t o T t r a n s i t i o n t h a t r e s u l t s i n t h e s u b s t i t u t i o n o f h i s t i d i n e 75 f o r t y r o s i n e . T h e let-70(s689) m u t a t i o n i s a G t o A t r a n s i t i o n at t h e s p l i c e d o n o r si t e o f t h e f o u r t h i n t r o n . 8. THE PRESENT STUDY I n t h i s s t u d y , a d e t a i l e d a n a l y s i s o f t h e let-70(sl 132) a n d let-70(s689) m u t a n t p h e n o t y p e s w a s u n d e r t a k e n . A s d e s c r i b e d i n S e c t i o n 1.7, let-70 h a d b e e n p r e v i o u s l y s h o w n t o b e L 2 / L 3 l e t h a l ( Z h e n et al, 1 9 9 6 ) ; h o w e v e r , t h e s p e c i f i c d e v e l o p m e n t a l d e f e c t s t h a t r e s u l t i n l e t h a l i t y w e r e n o t e x a m i n e d . T h u s , s p e c i f i c t i s s u e a n d s t r u c t u r a l d e f e c t s w e r e e x a m i n e d u s i n g N o m a r s k i o p t i c s , D A P I s t a i n i n g a n d i m m u n o f l u o r e s c e n t s t a i n i n g . T o i d e n t i f y t h e p u t a t i v e n u l l 32 p h e n o t y p e o f let-70, d o u b l e - s t r a n d e d R N A i n t e r f e r e n c e w a s e m p l o y e d . A c o m p l e m e n t a t i o n s c r e e n o f u n k n o w n l e t h a l m u t a n t s w a s u n d e r t a k e n t o i d e n t i f y a d d i t i o n a l a l l e l e s o f let-70, a n d o n e p u t a t i v e a l l e l e w a s p a r t i a l l y c h a r a c t e r i z e d . T h e m o l e c u l a r n a t u r e o f t h e let-70(s689) m u t a t i o n w a s i d e n t i f i e d b y m u t a n t c D N A a n a l y s i s , let-70 smg-1 d o u b l e m u t a n t s w e r e c o n s t r u c t e d t o d e t e r m i n e i f s w g - m e d i a t e d m R N A s u r v e i l l a n c e w a s a f a c t o r i n t h e p h e n o t y p e o f let-70(s689) m u t a n t s . T h r o u g h t h e u s e o f i m m u n o f l u o r e s c e n t s t a i n i n g w i t h U B C - 2 a n t i b o d i e s a n d t h e c o n s t r u c t i o n o f a t r a n s g e n i c l i n e c a r r y i n g a ubc-2::GFP f u s i o n p r o t e i n a s a n e x t r a c h r o m o s o m a l a r r a y , t h e w i l d t y p e U B C - 2 e x p r e s s i o n p a t t e r n w a s d e t e r m i n e d . O n c e i d e n t i f i e d , t h e d e v e l o p m e n t a l e x p r e s s i o n p a t t e r n o f U B C - 2 w a s t h e n c o m p a r e d w i t h m u t a n t U B C - 2 e x p r e s s i o n p a t t e r n s a n d t h e m u t a n t p h e n o t y p e s . T o d e t e r m i n e t h e m i n i m a l r e s c u i n g f r a g m e n t , a t t e m p t s w e r e m a d e t o r e s c u e t h e let-70 l e t h a l i t y b y s t a n d a r d D N A - m e d i a t e d t r a n s f o r m a t i o n o f w o r m s u s i n g a n u m b e r o f ubc-2 c o n s t r u c t s t h a t c o n t a i n e d d i f f e r e n t a m o u n t s o f u p s t r e a m a n d d o w n s t r e a m s e q u e n c e . T o p r o v i d e r o b u s t e x p r e s s i o n i n t h e g e r m l i n e a n d s o m a , a n e x c e s s o f r a n d o m g e n o m i c D N A w a s i n c l u d e d i n t h e i n j e c t i o n s o l u t i o n s . U s i n g s i m i l a r t e c h n i q u e s , a p u t a t i v e t e m p e r a t u r e - s e n s i t i v e a l l e l e o f let-70 w a s i n t r o d u c e d i n t o m u t a n t let-70 s t r a i n s . T h e r e s u l t a n t t r a n s g e n i c l i n e s w e r e e x a m i n e d f o r t h e a b i l i t y o f t o r e s c u e let-70 m u t a n t s i n a t e m p e r a t u r e - s e n s i t i v e m a n n e r . T o i d e n t i f y e v o l u t i o n a r i l y c o n s e r v e d s e q u e n c e s , t h e C. briggsae h o m o l o g o f let-70 w a s i s o l a t e d a n d c h a r a c t e r i z e d . A p p r o x i m a t e l y 3 0 k b o f s e q u e n c e s u r r o u n d i n g ubc-2 w a s c o m p a r e d b e t w e e n C. elegans a n d C. briggsae. T h e s t r u c t u r e o f t h e o p e r o n c o n t a i n i n g ubc-2 w a s d e t e r m i n e d , a n d / r a w s - s p l i c i n g o f t h e g e n e s w i t h i n t h e o p e r o n w a s e x a m i n e d . 33 1 ATG GCT CTC AAA AGA ATC CAG AAG gtaaggtttcaacacttaacaacaataa 52 1 M A L K R I Q K 8 53 aattattatgtacgtttcag GAA CTC CAA GAT CTC GGC CGT GAT CCA CCC 102 9 E L Q D L G R D P P 18 103 19 GCA A CAA Q TGC C TCC S GCT A GGA G CCA GTT P V GGT GAT G D GAT D TTG L TTC F CAT H TGG W 147 33 148 34 CAA Q GCT A ACG T ATT I ATG M GGC G CCA CCA P P GAG TCT E S CCC P TAT Y CAG Q GGA G GGT G 192 48 193 49 GTC V TTC F TTC F CTC L ACT T ATC I CAC TTC H F CCA ACA P T GAC D TAT Y CCA P TTC F AAA K 237 63 238 64 CCA P CCA P AAG K gtattgatcgaaattggaaaaaaataaatttaatttgttttcttcag 293 66 81132 T (Y) X CAT CCG H P 294 67 GTT V GCC A TTC F ACC T ACT T CGA R ATT TAT I Y AAC N ATC I AAT N TCA S AAC N 338 81 339 82 GGA G AGC S ATC I TGC C CTT L GAC D ATT CTC I L CGT TCG R S CAG Q TGG W TCG S CCG P GCT A 383 96 384 CTG ACC ATT TCG AAA G g t t g a t a t t a t c a t t a t t g t t c g c g t t c t a a c t t t t a a 437 97 Li T I S K V 102 438 t t t t c a g TT CTG CTT TCG ATC TGC TCG CTG CTC TGT GAT CCA AAT 482 103 L L S I C S L L C D P N 114 483 CCG GAT GAT CCA CTT GTG CCA GAG ATT GCA CGC ATC TAC AAG ACG 527 115 P D D P L V P E I A R I Y K T 129 8689 a X 528 GAT CGT GAA AG at a a a t t t a a a t t t t c t t t t a a c t a c t a a a a a t a a t c a a t t t t c a 583 130 D R E R 133 584 g G TAC AAT CAA TTG GCT AGA GAA TGG,ACG CAA AAG TAC GCT ATG 627 134 Y N Q L A R E W T Q K Y A M 147 628 TGA ggaggctaacaccattcatataagaacgcagccaaaccaatcaataaaccatgtgt 686 148 * 148 Figure 5. Sequence of let-70(ubc-2) wild type and mutant alleles. E x o n s e q u e n c e s are s h o w n i n u p p e r c a s e , i n t r o n a n d 3' n o n - c o d i n g s e q u e n c e s i n l o w e r case. P r o t e i n s e q u e n c e i s i n d i c a t e d i n u p p e r c a s e b e l o w t h e n u c l e o t i d e s e q u e n c e , i n s i n g l e l e t t e r c o d e . T h e n u c l e o t i d e a n d a m i n o a c i d c h a n g e s f o r let-70(s689) a n d let-70(sll32) a r e i n d i c a t e d . P o s s i b l e s t o p c o d o n f o r let-70(s689) i s u n d e r l i n e d . 3 4 II. MATERIALS AND METHODS 1. NEMA TODE STRAINS AND CULTURE CONDITIONS 1.1 Culture and maintenance of strains A l l n e m a t o d e s t r a i n s w e r e c u l t u r e d o n N G p l a t e s ( 0 . 3 % N a C l , 0 . 2 5 % t r y p t o n e , 5 m g / m l c h o l e s t e r o l , 1 m M M g S 0 4 , 1 m M C a C l 2 , 2 5 m M K H 2 P 0 4 p H 6.0, 1 . 7 % a g a r o s e ) s e e d e d w i t h Escherichia coli O P 5 0 as d e s c r i b e d b y B r e n n e r ( 1 9 7 4 ) . A n i m a l s w e r e m a i n t a i n e d at 2 0 ° C u n l e s s o t h e r w i s e i n d i c a t e d . N e m a t o d e s w e r e m a i n t a i n e d o n N G p l a t e s b y t r a n s f e r r i n g L 4 l a r v a e t o n e w p l a t e s e a c h g e n e r a t i o n . L a r g e s c a l e g r o w t h o f C. elegans w a s p e r f o r m e d i n l i q u i d c u l t u r e ( S u l s t o n a n d B r e n n e r , 1 9 7 4 ) u s i n g f r o z e n E. coli M R E - 6 0 0 ( p u r c h a s e d f r o m t h e F e r m e n t a t i o n F a c i l i t y , U n i v e r s i t y o f A l a b a m a at B i r m i n g h a m ) a s a f o o d s o u r c e . F o r s h o r t t e r m s t o r a g e , p l a t e s o f w o r m s w e r e p l a c e d at 1 5 ° C a n d l e f t t o s t a r v e a n d d e v e l o p i n t o d a u e r l a r v a e . D a u e r l a r v a e c a n s u r v i v e w i t h o u t f o o d f o r u p t o t h r e e m o n t h s a n d c a n b e r e v i v e d b y t r a n s f e r r i n g t o s e e d e d p l a t e s ( R i d d l e , 1988). S t r a i n s w e r e f r o z e n i n l i q u i d n i t r o g e n f o r l o n g t e r m s t o r a g e . A p o p u l a t i o n o f a n i m a l s w a s g r o w n t o c o n t a i n a h i g h p r o p o r t i o n o f L 2 l a r v a e , w a s h e d off* p l a t e s w i t h M 9 b u f f e r ( 3 % K H 2 P 0 4 , 6 % N a 2 H P 0 4 , 5 % N a C l , 1 m M M g S 0 4 ) , m i x e d w i t h a n e q u a l v o l u m e o f f r e e z i n g b u f f e r ( 3 0 % g l y c e r o l i n M 9 b u f f e r ) , a l i q u o t e d a n d f r o z e n at - 8 0 ° C f o r s e v e r a l d a y s b e f o r e t r a n s f e r t o l i q u i d n i t r o g e n . I n g e n e r a l , o n l y L 2 l a r v a e s u r v i v e f r e e z i n g ( R i d d l e , 1988). 1.2 Strains utilized in this study T h e g e n e t i c n o m e n c l a t u r e u s e d f o l l o w s g u i d e l i n e s set b y t h e C. elegans r e s e a r c h c o m m u n i t y ( H o d g k i n , 1 9 9 5 ) . A p p e n d i x A l i s t s t h e n e m a t o d e s t r a i n s u s e d i n t h i s w o r k . A l l let-70 m u t a n t s w e r e b a l a n c e d o v e r nTl (IV;V), a t r a n s l o c a t i o n t h a t r e c o m b i n a t i o n a l l y b a l a n c e s t h e r i g h t p o r t i o n o f L G I V a n d t h e l e f t p o r t i o n o f L G V ( F e r g u s o n a n d H o r v i t z , 1 9 8 5 ) . T h e unc-22(s7) a l l e l e w a s u s e d a s a m a r k e r t o i d e n t i f y i n d i v i d u a l s c a r r y i n g a let-70 a l l e l e ( M o e r m a n a n d B a i l l i e , 1 979). unc-22(s7) i s a c o n d i t i o n a l s e m i d o m i n a n t m u t a t i o n w h e r e unc-22(s7)/+ i n d i v i d u a l s h a v e a " t w i t c h e r " p h e n o t y p e w h e n p l a c e d i n 1 % n i c o t i n e s o l u t i o n b u t a r e o t h e r w i s e p h e n o t y p i c a l l y w i l d t y p e . H o m o z y g o u s unc-22(s7) i n d i v i d u a l s a r e u n c o n d i t i o n a l t w i t c h e r s , a n d w i l d t y p e h o m o z y g o t e s a r e c o n t r a c t e d a n d p a r a l y z e d i n n i c o t i n e . I n t h i s s t u d y , h e t e r o z y g o u s let-70/nTl i n d i v i d u a l s w e r e i d e n t i f i e d a n d 35 s e l e c t e d b y p l a c i n g w o r m s i n a d r o p o f 1 % n i c o t i n e . A f t e r o n e m i n u t e , w o r m s t h a t w e r e t w i t c h i n g w e r e t r a n s f e r r e d t o n e w p l a t e s . F o r s i m p l i c i t y , n e m a t o d e s t r a i n s w i l l b e r e f e r r e d t o b y t h e i r f i r s t m u t a t i o n a n d a l l e l e d e s i g n a t i o n o n l y , i.e. let-70(sl 132), h e n c e f o r t h . L i n k e d m u t a t i o n s a r e p r e s u m e d t o b e p r e s e n t u n l e s s o t h e r w i s e n o t e d . T r a n s g e n i c w o r m s w i l l b e r e f e r r e d t o b y t h e i r s t r a i n d e s i g n a t i o n . 2. NEMA TODE ANAL YSIS AND GENETICS 2.1 Nematode matings N e m a t o d e c r o s s e s w e r e set u p o n m a t i n g p l a t e s , c o n s i s t i n g o f a s m a l l s p o t o f O P 5 0 b a c t e r i a i n t h e c e n t e r o f a n N G p l a t e . F o u r L 4 h e r m a p h r o d i t e s w e r e p l a c e d o n t h e p l a t e a l o n g w i t h e i g h t m a l e s . M a t i n g s w e r e a l l o w e d t o p r o c e e d o v e r n i g h t at 2 0 ° C a n d t h e n h e r m a p h r o d i t e s w e r e t r a n s f e r r e d t o s e p a r a t e p l a t e s . P l a t e s w e r e e x a m i n e d s e v e r a l d a y s l a t e r f o r t h e p r e s e n c e o f m a l e p r o g e n y , i n d i c a t i n g t h a t m a t i n g h a d b e e n s u c c e s s f u l . 2.2 Strain outcrosses T h e t h r e e s t r a i n s w e r e o u t c r o s s e d p r i o r t o a n a l y s i s : 1) let-70(sll32) unc-22(s7) unc-31(el69)/nTl(IV);+/nTl(V), 2 ) let-70(s689) unc-22(s7)MTl(IV);+/nTl(V), a n d 3 ) let-x(s2293) unc-22(s7) lev-l(x22)/nTl(IV);+/nTl(V). H e r m a p h r o d i t e s w e r e m a t e d t o N 2 m a l e s a n d o u t c r o s s e d h e r m a p h r o d i t e p r o g e n y w e r e s e l e c t e d i n 1 % n i c o t i n e . T h e m a t i n g o f n i c o t i n e -s e l e c t e d h e r m a p h r o d i t e s t o N 2 m a l e s c o n t i n u e d f o r 7-10 g e n e r a t i o n s . A t e a c h g e n e r a t i o n , t h e p l a t e s w e r e e x a m i n e d f o r h o m o z y g o u s a r r e s t e d let-70 w o r m s t o e n s u r e t h a t t h e let-70 a l l e l e h a d n o t b e e n r e m o v e d f r o m t h e s t r a i n . T o r e b a l a n c e t h e o u t c r o s s e d let-70 s t r a i n s o v e r nTl, n i c o t i n e - s e l e c t e d m a l e s w e r e m a t e d t o dpy-13(el84sd)/nTl(IV);unc-42(e270)/nTl(V) h e r m a p h r o d i t e s , dpy-13 ("dumpy") m u t a n t s a r e s h o r t e r t h a n w i l d t y p e a n d unc-42 w o r m s e x h i b i t a " k i n k e r " p h e n o t y p e . A n u m b e r o f n i c o t i n e - s e l e c t e d c r o s s p r o g e n y w e r e set t o i n d i v i d u a l p l a t e s . F o u r d a y s later, t h e p l a t e s w e r e e x a m i n e d f o r dpy-13 o r unc-42 p r o g e n y . P l a t e s w e r e r e t a i n e d i f n o d p y o r u n c p r o g e n y w e r e seen. T h e p o p u l a t i o n w a s m a i n t a i n e d s e v e r a l g e n e r a t i o n s t o e n s u r e t h a t t h e dpy-13 a n d unc-42 m u t a t i o n s w e r e n o t p r e s e n t . T h e o u t c r o s s e d a n d r e b a l a n c e d s t r a i n s w e r e u t i l i z e d i n a l l s u b s e q u e n t a n a l y s e s . 36 2.3 Construction of transgenic let-70 strains Extrachromosomal arrays were placed in mutant backgrounds by mating to both let-70(sll32) and let-70(s689) strains. The transgenic strains that were used are listed in Appendices B and C. Stably transformed hermaphrodites with a 'roller' phenotype were mated to let-70/+ males. Fl roller progeny that twitched in 1% nicotine were set to separate plates. These worms carried the extrachromosomal array and the genotype was let-70/+. The progeny of these worms were examined for animals that twitched (let-70/let-70) and rolled (carried the extrachromosomal array). Twitcher/roller F2 animals were set individually and their development was followed to determine if the let-70 mutation was rescued by the transgene. For the putative temperature-sensitive let-70 transgenes, half of the selected Fl worms were placed at 15°C and selected F2's were also maintained at 15°C. The other half of the selected Fl's were placed at 25°C for the duration of the experiments. 2.4 Construction of let-70 smg-1 double mutants To generate let-70 smg-1 double mutants, let-70(s689) hermaphrodites were crossed to N2 males. Homozygous smg-1 hermaphrodites were mated to let-70(s689)/+ males and nicotine-selected cross progeny were set to separate plates and placed at 25°C. A large number of twitcher F2 progeny were set separately, and development at 25°C was followed. Of the twitcher F2 progeny, Vi should be let-70(s689) unc-22(s7)/ let-70(s689) unc-22(s7);smg-1/smg-1 homozygotes, while the rest should be let-70(s689) unc-22(s7)/ let-70(s689) unc-22(s7);smg-1/+. 2.5 Complementation crosses Complementation tests were performed on lethal mutations that were tightly linked to unc-22. The procedure used to screen the mutants is shown in Figure 6. Hermaphrodites of the genotype let-70(s689) unc-22(s7)/nTl(IV);+/nTl(V) were mated to wild type N2 males. Heterozygous male progeny were picked and crossed to either let-x unc-22(s7) lev-l(x22)/ nTl(IV);+/nTl(V) (Marra, 1994) or let-x unc-22(s7) unc-31(el69)/nTl(IV);+/nTl(V) (M.E. Green and D.V. Clark, unpubl.) hermaphrodites. If no fertile twitcher progeny were found, then the lethal mutation was considered to be a putative allele of let-70. Putative alleles of let-70 were further tested for complementation by mating to let-70(sll32) animals following the protocol described above. The progeny were examined for fertile twitcher hermaphrodites. 37 Iet-70(s689) unc-22/nTl 4 x N2 rf Select rf that twitch in 1% nicotine -let-x unc-22 lev-1/nTl 4 x let-70(s689) unc-22/++ rf Screen for surviving Unc-22 progeny T fef-x MWC-22 lev-l/let-70(s689) unc-22 + If Unc-22 progeny present, mutation is not an allele of let-70 If no Unc-22 progeny, mutation may be an allele of let-70 Figure 6. Non-complementation screen for let-70 alleles. Heterozygous let-70(s689) unc-22 males were mated to let-x unc-22 hermaphrodites. The progeny were screened for surviving Unc-22 animals, indicating that the mutation is not an allele of let-70. If no Unc-22 progeny were present, the mutation was considered a putative allele of let-70, and was further examined. 38 2.6 DAPI staining T o D A P I s t a i n a p o p u l a t i o n o f n e m a t o d e s , a n i m a l s w e r e w a s h e d o f f a p l a t e w i t h M 9 b u f f e r a n d r e s u s p e n d e d i n a c e t o n e . A f t e r p e r m e a b i l i z a t i o n f o r 4 m i n u t e s , a n i m a l s w e r e w a s h e d s e v e r a l t i m e s w i t h M 9 a n d r e s u s p e n d e d i n D A P I s o l u t i o n ( 3 3 n g / m l ) . A n e q u a l v o l u m e o f m o u n t i n g m e d i u m ( 2 . 5 % D A B C O , 9 0 % g l y c e r o l , 0 . 5 % s o d i u m a z i d e , 7 % 1 0 X T B E p H 8.0) w a s a d d e d a n d t h e s t a i n e d a n i m a l s w e r e e x a m i n e d u n d e r U V f l u o r e s c e n c e . T o D A P I s t a i n i n d i v i d u a l s , a n i m a l s w e r e p i c k e d i n t o a d r o p o f d H 2 0 o n a p o l y l y s i n e c o a t e d s l i d e . M o s t o f t h e d E ^ O w a s e v a p o r a t e d , a n d d r o p s o f a c e t o n e w e r e a d d e d s u c h t h a t t h e s a m p l e w a s i n c u b a t e d i n a c e t o n e c o n t i n u a l l y f o r 4 m i n u t e s . D A P I ( 3 3 n g / m l ) f o l l o w e d b y a n e q u a l v o l u m e o f m o u n t i n g m e d i u m w a s a d d e d . A n i m a l s w e r e e x a m i n e d b y U V f l u o r e s c e n c e m i c r o s c o p y . 2.7 Microscopy F o r p h e n o t y p i c a n a l y s i s , n e m a t o d e s w e r e e x a m i n e d o n a Z e i s s I M 3 5 m i c r o s c o p e e q u i p p e d w i t h f l u o r e s c e n c e a n d N o m a r s k i o p t i c s . M a g n i f i c a t i o n r a n g e d f r o m 2 0 0 - 1 0 0 0 X . P h o t o g r a p h s w e r e t a k e n u s i n g a n a t t a c h e d 3 5 m m c a m e r a . T o m a k e f i g u r e s , p h o t o g r a p h s w e r e s c a n n e d i n t o a M a c i n t o s h 8 6 0 0 / 2 0 0 c o m p u t e r u s i n g a n U m a x A s t r a 1 2 2 0 S f l a t b e d s c a n n e r w i t h V i s t a s c a n ( v e r s i o n 2.4.3) s o f t w a r e . I m m u n o f l u o r e s c e n c e w a s v i e w e d o n e i t h e r a Z e i s s A x i o s k o p - 2 o r a N i k o n O p t i p h o t - 2 m i c r o s c o p e . T h e A x i o s k o p - 2 f l u o r e s c e n c e w a s e q u i p p e d w i t h A t t o a r c , a n d m a g n i f i c a t i o n r a n g e d f r o m 2 0 0 - 1 0 0 0 X . I m a g e s w e r e c a p t u r e d w i t h a S o n y 9 5 0 C C D c a m e r a u s i n g t h e N o r t h e r n E c l i p s e ( v e r s i o n 5.0) a p p l i c a t i o n . T h e O p t i p h o t - 2 w a s e q u i p p e d f o r b o t h e p i f l u o r e s c e n c e a n d c o n f o c a l l a s e r s c a n n i n g m i c r o s c o p y ( C L S M ) . C o n f o c a l i m a g e s w e r e c a p t u r e d o n a B i o R a d M R C 6 0 0 s y s t e m u s i n g t h e C o M O S 7.0a a p p l i c a t i o n . K l a n d K 2 filters w e r e u s e d f o r d u a l c h a n n e l c o l l e c t i o n a n d e a c h c h a n n e l w a s c a p t u r e d s e p a r a t e l y . F o r m o s t s a m p l e s , t h e c o n f o c a l a p e r t u r e w a s set b e t w e e n 2 a n d 3 t o p r o v i d e t h e b e s t c o m p r o m i s e b e t w e e n b r i g h t n e s s a n d c o n f o c a l i t y . T h e n e u t r a l d e n s i t y filter w a s u s u a l l y set t o 1, w h i c h a t t e n u a t e s l i g h t f r o m t h e l a s e r t o 3 0 % o f i t s m a x i m a l i n t e n s i t y . A s e t t i n g o f 2 ( 3 % ) w a s u s e d f o r s o m e s a m p l e s , d e p e n d i n g o n t h e b r i g h t n e s s o f t h e f l u o r e s c e n c e . S c a n s p e e d w a s set t o n o r m a l a n d a k a l m a n filter (4 s c a n s ) w a s u s e d t o r e d u c e b a c k g r o u n d n o i s e d u r i n g c o l l e c t i o n . 39 F o r i m a g e c a p t u r e , a Z - s e r i e s w a s c o l l e c t e d at 0.2 m i c r o n i n t e r v a l s f o r t h e f u l l d e p t h o f t h e s p e c i m e n . F o r e m b r y o s , c o l l e c t i o n s w e r e 4 0 0 x 4 0 0 p i x e l i m a g e s . F o r l a r v a e a n d a d u l t s , c o l l e c t i o n s r a n g e d f r o m 4 0 0 x 5 0 0 t o 7 0 0 x 5 0 0 p i x e l i m a g e s . Z - s e r i e s w e r e t r a n s f e r r e d t o a P o w e r M a c i n t o s h 8 6 0 0 / 2 0 0 f o r d a t a a n a l y s i s a n d t o g e n e r a t e p r o j e c t i o n s . Z - s e r i e s w e r e i m p o r t e d i n t o N I H I m a g e 1.62 f o r v i e w i n g a n d m a n i p u l a t i o n s s u c h as m a k i n g p r o j e c t i o n s , r o t a t i n g i m a g e s a n d g e n e r a t i n g v e r t i c a l s e c t i o n s . P r o j e c t i o n s p r o d u c e d i n N I H I m a g e a n d a l l s c a n n e d o r c a p t u r e d i m a g e s w e r e i m p o r t e d i n t o A d o b e P h o t o s h o p ( v e r s i o n 4.0) f o r a s s e m b l y i n t o f i g u r e s f o r p u b l i c a t i o n . I m a g e s w e r e c r o p p e d t o t h e d e s i r e d s i z e a n d r e s o l u t i o n , c o l o r i z e d , a r r a n g e d a n d l a b e l l e d . F i g u r e s w e r e p r i n t e d o n a C o d o n i c s N P - 1 6 0 0 p r i n t e r . 3. GENERAL DNA AND RNA TECHNIQUES 3.1 Restriction endonuclease digestion of DNA D N A s a m p l e s ( 1 - 1 0 u g ) w e r e d i g e s t e d w i t h a v a r i e t y o f r e s t r i c t i o n e n d o n u c l e a s e s u s i n g c o n d i t i o n s r e c o m m e n d e d b y t h e m a n u f a c t u r e r s . R e s t r i c t i o n e n z y m e s w e r e o b t a i n e d f r o m P r o m e g a , G I B C O / B R L a n d P h a r m a c i a . R e s t r i c t e d s a m p l e s w e r e l o a d e d d i r e c t l y o n t o h o r i z o n t a l a g a r o s e g e l s f o r a n a l y s i s . T o p u r i f y s a m p l e s , t h e D N A b a n d o f i n t e r e s t w a s c u t o u t o f t h e g e l a n d p u r i f i e d u s i n g t h e Q i a e x II k i t ( Q i a g e n , Inc.). A t t i m e s , t h e s a m p l e w a s p u r i f i e d d i r e c t l y a f t e r d i g e s t i o n b y p r e c i p i t a t i n g t h e D N A w i t h t h r e e v o l u m e s o f e t h a n o l . T h e D N A w a s c o l l e c t e d b y c e n t r i f u g a t i o n at 12,000 r p m f o r 15 m i n u t e s , w a s h e d i n 7 5 % e t h a n o l , d r i e d a n d r e s u s p e n d e d i n d H 2 0 o r T E ( 1 0 m M T r i s - H C l ; 1 m M E D T A , p H 8.0). 3.2 Enzymatic manipulations of DNA L i g a t i o n s w e r e p e r f o r m e d u s i n g T 4 l i g a s e ( G i b c o / B R L ) f o l l o w i n g t h e m a n u f a c t u r e r ' s i n s t r u c t i o n s . N u c l e o t i d e o v e r h a n g s r e s u l t i n g f r o m r e s t r i c t i o n d i g e s t s w e r e filled i n u s i n g K l e n o w D N A p o l y m e r a s e ( P h a r m a c i a ) f o l l o w i n g t h e m a n u f a c t u r e r ' s d i r e c t i o n s . 3.3 Purification of plasmid DNA from E. coli F i v e m l c u l t u r e s o f E. coli c o n t a i n i n g t h e p l a s m i d o f i n t e r e s t w e r e g r o w n o v e r n i g h t at 3 7 ° C i n L B b r o t h s u p p l e m e n t e d w i t h 1 0 0 u g / m l a m p i c i l l i n . P l a s m i d D N A w a s p u r i f i e d f o l l o w i n g t h e m e t h o d o f M o r e l l e ( 1 9 8 9 ) , o r u s i n g t h e Q i a p r e p s p i n m i n i p r e p k i t ( Q i a g e n Inc.) f o l l o w i n g t h e m a n u f a c t u r e r ' s i n s t r u c t i o n s . 40 3.4 Bacterial transformation Purified plasmid DNA and ligation products were transformed into competent E. coli DH5a cells (GIBCO/BRL) following the manufacturer's instructions. Competent BL21(DE3) cells (Novagen) were prepared by CaCl2 treatment and transformed by standard protocols (Sambrook etal., 1989). 3.5 Polymerase chain reaction Polymerase chain reactions (PCR) were performed in a 25 ul volume using PCR beads (Pharmacia) containing 10 mM Tris-HCl pH 9.0, 50 mM KC1, 1.5 mM MgCl 2, 200 uM of each dNTP and 1.5 units of Taq DNA polymerase. Primers were added to a final concentration of 2 pM. Oligonucleotides utilized in this study are listed in Appendix D. Reactions were overlaid with mineral oil. In general, the PCR conditions were 95°C for 3 minutes; 30 cycles of 95°C for 30 seconds, 60°C for 30 seconds, 72°C for 1 minute; 72°C for 10 minutes. The annealing temperature varied between 58°C and 62°C, depending on the length and GC content of the oligonucleotides being used for amplification. DNA samples (1-5 pi) were added to the reaction mixture during the initial period at 95°C. Reactions were carried out in the TwinBlock™ system thermal cycler (ERICOMP Inc.). 3.6 Nematode PCR 3.6.1 Single embryo PCR For single embryo PCR, one egg was picked using a piece of sterile fishing line (10 lb. test) and placed in 5 pi PCR-lysis solution (50 mM KC1, 10 mM Tris-HCl pH 8.5, 2.5 mM MgCl2, 0.45% Tween 20, 0.01% gelatin) supplemented with 1.0 pi Proteinase K (20 mg/ml). The mixture was incubated at 60°C for 1.5 hours followed by 95 °C for 15 minutes. The entire solution was used in PCR reactions. 3.6.2 Long Distance PCR Long distance PCR was performed on genomic DNA and on pools of 2-3 homozygous let-x(s2293) arrested embryos that had been treated with Proteinase K. Reactions were run in 50 ul volumes containing IX Boehringer Mannheim Buffer 3, 0.7 mM of each dNTP, 25 pmol of each primer and 2.6 units Expand Taq polymerase (Boehringer Mannheim). Reaction conditions were 94°C for 3 minutes; 30 cycles of 94°C for 15 seconds, 57°C for 45 seconds and 41 6 8 ° C f o r 3 m i n u t e s w i t h a 3 0 s e c o n d e x t e n s i o n f o l l o w i n g e a c h c y c l e ; 7 2 ° C f o r 10 m i n u t e s . T h e P C R r e a c t i o n s w e r e r u n o n a P e r k i n E l m e r D N A t h e r m a l c y c l e r . 3.7 D N A sequencing S e q u e n c i n g o f d o u b l e s t r a n d e d D N A b y t h e d i d e o x y c h a i n t e r m i n a t i o n m e t h o d ( S a n g e r et al., 1 9 7 7 ) w a s p e r f o r m e d u s i n g t h e T 7 S e q u e n a s e v e r s i o n 2.0 D N A s e q u e n c i n g k i t ( U . S . B i o c h e m i c a l s ) f o l l o w i n g t h e m a n u f a c t u r e r ' s p r o c e d u r e . S a m p l e s w e r e a n a l y z e d o n A p p l i e d B i o s y s t e m s ( A B I ) m o d e l 3 7 3 s t r e t c h o r A B I P r i s m 3 7 7 D N A s e q u e n c e r s . T h i s s e r v i c e w a s p r o v i d e d b y t h e N A P S U n i t B i o t e c h n o l o g y L a b o r a t o r y , U n i v e r s i t y o f B r i t i s h C o l u m b i a . 3.8 Genomic D N A isolation C. elegans g e n o m i c D N A w a s p r e p a r e d f r o m f r e s h l a r v a e a n d a d u l t s o r f r o z e n e m b r y o s . A p p r o x i m a t e l y 1 g r a m o f f r o z e n e m b r y o s o r 0.5 g r a m o f f r e s h w o r m s w e r e r e s u s p e n d e d i n P r o t e i n a s e K b u f f e r ( 1 0 0 m M T r i s - H C l p H 8.0, 5 0 m M E D T A , 2 0 0 m M N a C l , 1 % S D S , 0.15 m g / m l P r o t e i n a s e K ) . T h e s a m p l e s w e r e i n c u b a t e d f o r t h r e e h o u r s at 6 5 ° C , e x t r a c t e d t w i c e w i t h a n e q u a l v o l u m e o f p h e n o l : c h l o r o f o r m : i s o a m y l a l c o h o l (25:24:1) t h e n e x t r a c t e d o n c e w i t h a n e q u a l v o l u m e o f c h l o r o f o r m . T h r e e v o l u m e s o f 9 5 % e t h a n o l w e r e a d d e d t o p r e c i p i t a t e t h e D N A . D N A w a s c o l l e c t e d b y c e n t r i f u g a t i o n at 10,000 x g f o r 3 0 m i n u t e s , w a s h e d w i t h 7 0 % e t h a n o l , d r i e d a n d r e s u s p e n d e d i n d H 2 0 . F o r t h e g e n o m i c S o u t h e r n b l o t , n e m a t o d e s w e r e g r o w n i n 2 5 0 m l l i q u i d c u l t u r e a n d g e n o m i c D N A w a s p r e p a r e d u s i n g a s a l t e x t r a c t i o n p r o t o c o l . W o r m s i n l i q u i d c u l t u r e w e r e t r a n s f e r r e d t o 2 5 0 m l c e n t r i f u g e b o t t l e s , s e t t l e d , a n d m o s t o f t h e s o l u t i o n w a s a s p i r a t e d . A n i m a l s w e r e r e s u s p e n d e d i n P K b u f f e r ( 1 0 m M T r i s - H C l p H 8.0, 10 m M E D T A , 1 % S D S , 2 0 0 u g / m l P r o t e i n a s e K ) , i n c u b a t e d at 3 7 ° C o v e r n i g h t w i t h s h a k i n g , a n d N a C l w a s a d d e d t o a f i n a l c o n c e n t r a t i o n o f 1.44 M . S a m p l e s w e r e m i x e d f o r 3 0 s e c o n d s , c e n t r i f u g e d at 3 0 0 0 x g f o r 3 5 m i n u t e s a n d t h e s u p e r n a t a n t w a s t r a n s f e r r e d t o a n e w tube. T h r e e v o l u m e s o f 9 5 % e t h a n o l w e r e a d d e d , a n d t h e s o l u t i o n w a s g e n t l y r o c k e d t o p r e c i p i t a t e t h e D N A . D N A w a s s p u n o n t o a g l a s s r o d , t r a n s f e r r e d t o 7 0 % e t h a n o l a n d c o l l e c t e d b y c e n t r i f u g a t i o n at 10,000 x g f o r 3 0 m i n u t e s . T h e D N A w a s d r i e d a n d r e s u s p e n d e d i n d H 2 0 . 3.9 Random primer extension D N A p r o b e s ( 2 0 0 n g ) w e r e l a b e l l e d w i t h 3 2 P b y r a n d o m h e x a m e r e x t e n s i o n u s i n g t h e T 7 Q u i c k P r i m e k i t ( P h a r m a c i a ) f o l l o w i n g t h e m a n u f a c t u r e r ' s d i r e c t i o n s . T h e l a b e l l e d p r o b e 42 w a s s e p a r a t e d f r o m u n i n c o r p o r a t e d P o n a 1 m l S e p h a d e x G - 5 0 s p i n c o l u m n , p r e p a r e d i n a 1 c c s y r i n g e . A s m a l l a m o u n t o f s t e r i l e g l a s s w o o l w a s p l a c e d i n t h e b o t t o m o f t h e s y r i n g e a n d T E - e q u i l i b r a t e d S e p h a d e x G - 5 0 w a s a d d e d t o t h e s y r i n g e t o a v o l u m e o f 1 c c . T h e c o l u m n w a s w a s h e d s e v e r a l t i m e s w i t h T E b y c e n t r i f u g i n g at 2 0 0 0 x g f o r 1 m i n u t e . T h e l a b e l l e d p r o b e w a s a p p l i e d t o t h e b e d o f t h e c o l u m n , s p u n f o r 1 m i n u t e at 3 0 0 0 x g a n d c o l l e c t e d i n a 1.5 m l t u b e . O n e p i w a s s p o t t e d o n a g l a s s f i b r e f i l t e r a n d i n c o r p o r a t i o n o f 3 2 P w a s m e a s u r e d b y s c i n t i l l a t i o n c o u n t i n g . I n g e n e r a l , D N A p r o b e s l a b e l l e d i n t h i s m a n n e r h a d a s p e c i f i c a c t i v i t y o f 2.5-4 x 1 0 5 c p m / n g . 3.10 Genomic Southern blot S o u t h e r n b l o t s w e r e p e r f o r m e d o n g e n o m i c D N A a n d R T - P C R p r o d u c t s . G e n o m i c D N A (4 u g ) w a s d i g e s t e d w i t h v a r i o u s r e s t r i c t i o n e n d o n u c l e a s e s p r i o r t o s e p a r a t i o n b y e l e c t r o p h o r e s i s o n 0 . 8 % - 1 . 5 % a g a r o s e g e l s . R T - P C R p r o d u c t s w e r e l o a d e d d i r e c t l y o n t o a g a r o s e g e l s . T h e D N A w a s t r a n s f e r r e d t o H y b o n d N n y l o n m e m b r a n e s ( A m e r s h a m ) f o l l o w i n g t h e a l k a l i n e t r a n s f e r m e t h o d o f W e s t n e a t ( 1 9 8 8 ) . 3 2 P - l a b e l l e d D N A p r o b e s w e r e g e n e r a t e d b y r a n d o m p r i m e r e x t e n s i o n ( s e e S e c t i o n II.3.9). H y b r i d i z a t i o n s w e r e c a r r i e d o u t o v e r n i g h t at 6 5 ° C i n 7 % S D S , 1 m M E D T A p H 8.0, 1 % B S A , 0.263 M N a 2 H P 0 4 . T h e m e m b r a n e s w e r e w a s h e d t w i c e i n 2 X S S C / 0 . 1 % S D S ( 3 0 0 m M N a C l , 3 0 m M f o r 15 m i n u t e s at r o o m t e m p e r a t u r e t h e n o n c e i n 2 X S S C . T h e m e m b r a n e w a s e x p o s e d o n a P h o s p h o r l m a g e s c r e e n f o r s e v e r a l h o u r s t o s e v e r a l d a y s . T h e i m a g e w a s s c a n n e d u s i n g a M o l e c u l a r D y n a m i c s P h o s p h o r l m a g e r S I a n d d i g i t i z e d o n t o a M a c i n t o s h 7 6 0 0 u s i n g t h e I P L a b g e l s c i e n t i f i c i m a g e p r o c e s s i n g a p p l i c a t i o n , v e r s i o n 1.5e. 3.11 Total RNA extraction T o t a l R N A w a s e x t r a c t e d f r o m w i l d t y p e C. elegans, w i l d t y p e C. briggsae, h o m o z y g o u s let-70(sl 132) a n d h o m o z y g o u s let-70(s689) a n i m a l s . A p p r o x i m a t e l y 3 0 0 w o r m s w e r e i n d i v i d u a l l y p i c k e d i n t o 180 u l D E P C - t r e a t e d H 2 0 . A c i d - w a s h e d g l a s s b e a d s w e r e a d d e d t o f i l l a 1 0 0 p i v o l u m e a n d t w o v o l u m e s o f l y s i s b u f f e r ( 4 M g u a n i d i n e i s o t h i o c y a n a t e , 0 . 1 3 % s a r k o s y l , 3 3 m M T r i s - H C l , 0 . 5 % P-mercaptoethanol, 6.7 m M E D T A , p H 8.0) w e r e a d d e d . O n e v o l u m e o f p h e n o l : c h l o r o f o r m (1:1) w a s a d d e d a n d s a m p l e s w e r e m i x e d v i g o r o u s l y ( V o r t e x ) f o r f o u r m i n u t e s a n d c e n t r i f u g e d at 10,000 x g f o r 10 m i n u t e s . T h e u p p e r a q u e o u s l a y e r w a s t r a n s f e r r e d t o a n e w t u b e a n d r e - e x t r a c t e d w i t h c h l o r o f o r m . R N A w a s p r e c i p i t a t e d b y t h e 43 a d d i t i o n o f 1/10 v o l u m e o f D E P C - t r e a t e d 3 M N a O A c a n d t h r e e v o l u m e s o f 9 5 % e t h a n o l , c o l l e c t e d b y c e n t r i f u g a t i o n , w a s h e d w i t h 7 0 % D E P C - t r e a t e d e t h a n o l , d r i e d a n d r e s u s p e n d e d i n D E P C - t r e a t e d H 2 0 . 3.12 First strand cDNA synthesis F i r s t s t r a n d c D N A w a s s y n t h e s i z e d f r o m t o t a l R N A e x t r a c t e d f r o m w h o l e w o r m s f o l l o w i n g t h e p r o t o c o l p r o v i d e d w i t h t h e r e v e r s e t r a n s c r i p t a s e e n z y m e ( B R L S u p e r s c r i p t n, B e t h e s d a , M D ) . B r i e f l y , 1 u g o f R A C E 3 6 p r i m e r w a s a d d e d t o 10 u g t o t a l R N A . T h e m i x t u r e w a s h e a t e d t o 7 0 ° C a n d i m m e d i a t e l y p l a c e d o n i c e . F i r s t s t r a n d b u f f e r w a s a d d e d t o a I X c o n c e n t r a t i o n , a l o n g w i t h 10 m M D T T a n d 0.5 m M o f e a c h d N T P . T h e r e a c t i o n m i x w a s h e a t e d t o 4 2 ° C , S u p e r s c r i p t II r e v e r s e t r a n s c r i p t a s e w a s a d d e d a n d t h e r e a c t i o n i n c u b a t e d at 4 2 ° C f o r 5 0 m i n u t e s . T h e e n z y m e w a s d e n a t u r e d b y h e a t i n g t o 7 0 ° C f o r 15 m i n u t e s . F i r s t s t r a n d c D N A p r e p a r e d i n t h i s m a n n e r w a s u s e d i n P C R r e a c t i o n s . 3.13 Synthesis of double-stranded RNA D o u b l e - s t r a n d e d R N A w a s s y n t h e s i z e d f o l l o w i n g t h e m e t h o d o f F i r e et a l . ( 1 9 9 8 ) . T h e c o d i n g r e g i o n o f ubc-2 t h a t h a d b e e n s u b c l o n e d i n t o t h e p h a g e m i d p B S I I K S ( + ) ( P r o m e g a ) w a s u s e d as a t e m p l a t e f o r R N A s y n t h e s i s . T e m p l a t e D N A w a s l i n e a r i z e d w i t h Hind I I I o r Pst I a n d p u r i f i e d as d e s c r i b e d i n S e c t i o n II.3.1. A l l s u b s e q u e n t m a n i p u l a t i o n s w e r e c a r r i e d o u t i n a n R N a s e - f r e e e n v i r o n m e n t . F o r s e n s e - s t r a n d R N A s y n t h e s i s , 1 u g o f Hind I l l - r e s t r i c t e d t e m p l a t e D N A w a s i n c u b a t e d at 3 7 ° C f o r 2 h o u r s i n I X T S C b u f f e r ( P r o m e g a ) c o n t a i n i n g 0.125 m M e a c h o f r A T P , r G T P , r C T P a n d r U T P , 5 m M D T T , 1.0 u n i t R N a s i n ( P r o m e g a ) a n d 10 u n i t s T 7 p o l y m e r a s e . T o m a k e a n t i - s e n s e s t r a n d R N A , 1 u g o f Pst I - r e s t r i c t e d t e m p l a t e D N A w a s i n c u b a t e d at 2 5 ° C f o r t w o h o u r s i n t h e s a m e s o l u t i o n as d e s c r i b e d a b o v e e x c e p t t h a t T 7 p o l y m e r a s e w a s r e p l a c e d w i t h 10 u n i t s o f T 3 p o l y m e r a s e . T h e t w o r e a c t i o n s w e r e c o m b i n e d a n d s t o p p e d b y t h e a d d i t i o n o f S t o p b u f f e r (1 M N P L A c , 10 m M E D T A , 0.2 % S D S ) a n d 6 u g g l y c o g e n as a c a r r i e r . T h e s o l u t i o n w a s e x t r a c t e d o n c e w i t h a n e q u a l v o l u m e o f p h e n o l x h o r o f o r m (1:1) a n d o n c e w i t h a n e q u a l v o l u m e o f c h l o r o f o r m . T h e s o l u t i o n w a s i n c u b a t e d at 6 8 ° C f o r 10 m i n u t e s , t h e n t r a n s f e r r e d t o 3 7 ° C f o r 3 0 m i n u t e s t o a l l o w t h e R N A s t r a n d s t o a n n e a l . T h e d o u b l e - s t r a n d e d R N A w a s p r e c i p i t a t e d b y a d d i n g t h r e e v o l u m e s o f e t h a n o l , c o l l e c t e d b y c e n t r i f u g a t i o n at 10,000 x g f o r 10 m i n u t e s , w a s h e d w i t h 7 0 % e t h a n o l , d r i e d a n d r e s u s p e n d e d i n R N a s e - f r e e T E . F o r m a t i o n o f p r e d o m i n a n t l y d o u b l e - s t r a n d e d R N A 44 w a s c o n f i r m e d b y a g a r o s e g e l e l e c t r o p h o r e s i s o f a s m a l l a m o u n t o f sense-, a n t i - s e n s e - a n d d o u b l e - s t r a n d e d m a t e r i a l . D o u b l e - s t r a n d e d R N A p r e p a r e d i n t h i s m a n n e r w a s l o a d e d d i r e c t l y i n t o n e e d l e s a n d i n j e c t e d i n t o y o u n g a d u l t s . 3.14 Computer analysis C o m p a r i s o n o f C. elegans a n d C. briggsae g e n o m i c D N A s e q u e n c e s w a s p e r f o r m e d u s i n g t h e D o t t e r a p p l i c a t i o n ( S o n n h a m m e r a n d D u r b i n , 1 9 9 6 ) a n d G e n e f i n d e r ( P . G r e e n a n d L . H i l l i e r , u n p u b l . ) . T h e C. elegans M 7 + Y 5 F 2 s e q u e n c e u s e d f o r a n a l y s i s w a s m a d e b y c o m b i n i n g t h e s e q u e n c e o f c o s m i d M 7 ( Z 6 8 3 3 7 ) a n d Y A C Y 5 F 2 A ( Z 9 8 8 7 1 ) . T h e s e q u e n c e f o r a n a l y s i s w a s r e v e r s e c o m p l e m e n t e d f o r t h e a l i g n m e n t s , as ubc-2 w a s e n c o d e d i n t h e o p p o s i t e o r i e n t a t i o n t o t h a t p r e s e n t e d i n t h e ftp site. T h e C. briggsae G 4 7 J 1 1 s e q u e n c e w a s o b t a i n e d f r o m t h e W a s h i n g t o n U n i v e r s i t y G e n o m e S e q u e n c i n g C e n t e r w e b sit e : h t t p ://genome. w u s t l . e d u / g s c / i n d e x . h t m l . 4. PROTEIN AND IMMUNOLOGICAL TECHNIQUES 4.1 Overexpression and purification of UBC-2 fusion protein A ubc-2 e x p r e s s i o n c o n s t r u c t i n p R S E T C ( I n v i t r o g e n ) w a s u s e d t o e x p r e s s t h e 6 X H I S -U B C - 2 f u s i o n p r o t e i n . P r e v i o u s e x p e r i m e n t s h a d s h o w n t h a t a s m a l l a m o u n t o f e x p r e s s e d 6 X H I S - U B C - 2 w a s s o l u b l e ( Z h e n , 1995). T h e p R S E T C - U B C - 2 c o n s t r u c t w a s t r a n s f o r m e d i n t o B L 2 1 ( D E 3 ) c e l l s a n d f r e s h t r a n s f o r m a n t s w e r e i n o c u l a t e d i n t o 10 m l o f L B / a m p i c i l l i n / k a n a m y c i n m e d i u m a n d g r o w n o v e r n i g h t at 3 7 ° C . O n e l i t r e o f t h e s a m e m e d i u m w a s i n o c u l a t e d 1:100 w i t h t h e o v e r n i g h t c u l t u r e a n d i n c u b a t e d at 3 7 ° C w i t h s h a k i n g u n t i l a n OD 6 o o r e a d i n g o f 0.7 w a s r e a c h e d . C e l l s w e r e i n d u c e d w i t h 2 m M I P T G , g r o w n a n a d d i t i o n a l t w o h o u r s a n d h a r v e s t e d b y c e n t r i f u g a t i o n at 4,000 x g f o r 10 m i n u t e s . S o l u b l e 6 X H I S - U B C - 2 f u s i o n p r o t e i n w a s i s o l a t e d u n d e r n o n - d e n a t u r i n g c o n d i t i o n s at 4 ° C . 3 - m e r c a p t o e t h a n o l w a s a d d e d t o a l l s o l u t i o n s u s e d i n t h e p u r i f i c a t i o n p r o c e s s t o a f i n a l c o n c e n t r a t i o n o f 10 m M , t o p r e v e n t o x i d a t i o n o f t h e a c t i v e s i t e c y s t e i n y l r e s i d u e . T h e c e l l p e l l e t w a s d i s s o l v e d i n s o n i c a t i o n b u f f e r ( 5 0 m M N a H 2 P 0 4 , 3 0 0 m M N a C l , p H 8.0), f r o z e n i n a d r y i c e / e t h a n o l b a t h , t h a w e d i n c o l d w a t e r a n d s o n i c a t e d o n i c e ( 3 0 s e c o n d b u r s t s / 1 m i n u t e c o o l i n g f o r a t o t a l o f 6 m i n u t e s ) . T h e s a m p l e w a s p a s s e d t h r o u g h a 21 g a u g e s y r i n g e n e e d l e s e v e r a l t i m e s t o s h e a r t h e D N A a n d c e n t r i f u g e d at 10,000 x g f o r 2 0 m i n u t e s t o p e l l e t t h e c e l l d e b r i s . T h e s u p e r n a t a n t w a s g e n t l y m i x e d w i t h N i - N T A r e s i n f o r o n e h o u r t o a l l o w t h e 6 X 45 H I S - U B C - 2 f u s i o n p r o t e i n t o b i n d t o t h e r e s i n . T h e r e s i n w a s w a s h e d s e v e r a l t i m e s w i t h s o n i c a t i o n b u f f e r a n d W a s h b u f f e r ( 5 0 m M N a H 2 P 0 4 , 3 0 0 m M N a C l , 1 0 % g l y c e r o l , p H 5.0). T h e p r o t e i n - r e s i n m i x t u r e w a s l o a d e d o n t o a c o l u m n a n d w a s h e d w i t h W a s h b u f f e r u n t i l t h e A 2 8 o o f t h e f l o w - t h r o u g h w a s l e s s t h a n 0.1. B o u n d p r o t e i n s w e r e e l u t e d w i t h a p H 5.0-pH 4.0 g r a d i e n t i n W a s h b u f f e r . S a m p l e s w e r e d i a l y z e d i n W a s h b u f f e r t o b r i n g t h e p H o f t h e s o l u t i o n u p t o p H 8.0. T h i s p r o c e d u r e r e s u l t e d i n t h e p u r i f i c a t i o n o f 4-5 m g o f 6 X H I S - U B C - 2 f u s i o n p r o t e i n . 4.2 Preparation of C. elegans protein extract T o e x t r a c t p r o t e i n s f r o m n e m a t o d e s f o r S D S - P A G E a n a l y s i s , 5 0 m u t a n t o r w i l d t y p e i n d i v i d u a l s w e r e p i c k e d i n t o a d r o p o f M 9 b u f f e r i n t h e l i d o f a 1.5 m l m i c r o c e n t r i f u g e tube. T h e d r o p c o n t a i n i n g t h e w o r m s w a s q u i c k l y s p u n i n t o t h e t u b e a n d I X L a e m m l i s a m p l e b u f f e r ( 5 0 m M T r i s - H C l p H 6.8, 1 0 0 m M D T T , 2 % S D S , 1 0 % g l y c e r o l , 0 . 1 % b r o m o p h e n o l b l u e ) w a s a d d e d . S a m p l e s w e r e b o i l e d f o r 2 0 m i n u t e s p r i o r t o l o a d i n g o n t o a 1 2 . 5 % S D S - P A G E g e l . 4.3 SDS-polyacrylamide gel electrophoresis D i s c o n t i n u o u s S D S - p o l y a c r y l a m i d e g e l e l e c t r o p h o r e s i s ( S D S - P A G E ) w a s u s e d t o s e p a r a t e p r o t e i n s a m p l e s ( L a e m m l i , 1970). S a m p l e s w e r e d i s s o l v e d i n I X L a e m m l i s a m p l e b u f f e r , b o i l e d f o r 5-20 m i n u t e s a n d l o a d e d o n t o S D S - P A G E g e l s . G e l s w e r e p o u r e d a n d r u n u s i n g t h e M i n i - P R O T E A N II a p p a r a t u s ( B i o - R a d ) a c c o r d i n g t o t h e p r o t o c o l s d e s c r i b e d b y t h e m a n u f a c t u r e r . 4.4 Western blot analysis P r o t e i n s w e r e s e p a r a t e d o n S D S - P A G E g e l s a n d e l e c t r o b l o t t e d o n t o I m m o b i l o n - P m e m b r a n e s ( M i l l i p o r e ) . P r i o r t o t r a n s f e r , t h e g e l a n d m e m b r a n e w e r e s o a k e d i n t r a n s f e r b u f f e r ( 2 5 m M T r i s - H C l p H 8.5, 192 m M g l y c i n e , 2 0 % m e t h a n o l ) f o r 10 m i n u t e s . T h e g e l a n d m e m b r a n e w e r e s a n d w i c h e d b e t w e e n s h e e t s o f p r e - s o a k e d f i l t e r p a p e r a n d p l a c e d i n t h e t r a n s f e r a p p a r a t u s . T h e t r a n s f e r w a s c a r r i e d o u t at 2 5 0 m A f o r o n e h o u r o r 5 0 m A o v e r n i g h t . A f t e r t r a n s f e r , t h e m e m b r a n e w a s r i n s e d w i t h d H 2 0 . 4.5 Immunostaining of Western blots W e s t e r n b l o t s w e r e b l o c k e d w i t h 1 0 % m i l k p o w d e r i n T B S - T w e e n ( 1 4 0 m M N a C l , 2 0 m M T r i s - H C l , 0 . 0 5 % T w e e n - 2 0 , p H 7.5) f o r o n e h o u r . P r i m a r y a n t i b o d y w a s a d d e d ( 1 : 5 0 0 0 46 d i l u t i o n i n T B S - T w e e n f o r a n t i - U B C - 2 a n t i b o d y ) a n d t h e b l o t w a s i n c u b a t e d f o r o n e h o u r . T h e b l o t w a s w a s h e d t h r e e t i m e s i n T B S - T w e e n , i n c u b a t e d i n s e c o n d a r y a n t i b o d y ( 1:10,000 d i l u t i o n i n T B S - T w e e n o f p e r o x i d a s e - l a b e l l e d a n t i - r a b b i t a n t i b o d y ; A m e r s h a m ) f o r 3 0 m i n u t e s a n d w a s h e d t h r e e t i m e s i n T B S - T w e e n . T h e p r o t e i n - a n t i b o d y c o m p l e x e s w e r e v i s u a l i z e d u s i n g t h e e n h a n c e d c h e m i l u m i n e s c e n c e k i t ( E C L - A m e r s h a m ) . 5. IMMUNOFLUORESCENCE STAINING 5.1 Immunostaining of embryos E m b r y o s w e r e p r e p a r e d a n d s t a i n e d as d e s c r i b e d b y G o h a n d B o g a e r t ( 1 9 9 1 ) w i t h s o m e m o d i f i c a t i o n s . T o o b t a i n m u t a n t e m b r y o s , let-70(sl 132) unc-22(s7) unc-31(el69)/nTl(IV); +/nTl(V) o r let-70(s689) unc-22(s7)MTl(IV);+/nTl(V) h e r m a p h r o d i t e s w e r e c r o s s e d t o N 2 m a l e s . O u t c r o s s h e r m a p h r o d i t e p r o g e n y w e r e set t o 1 0 0 m m N G p l a t e s a n d m a i n t a i n e d u n t i l l a r g e n u m b e r s o f e m b r y o s h a d a c c u m u l a t e d . O u t c r o s s i n g r e m o v e d t h e nTl b a l a n c e r f r o m t h e m u t a n t p o p u l a t i o n a n d p r e v e n t e d t h e m i s - i d e n t i f i c a t i o n o f nTl a n e u p l o i d s a s let-70 m u t a n t e m b r y o s . W o r m s a n d e m b r y o s w e r e w a s h e d o f f p l a t e s a n d t r e a t e d w i t h a n a l k a l i n e s o d i u m h y p o c h l o r i t e s o l u t i o n ( 2 5 % b l e a c h , 15 m M N a O H ) t o d i s s o l v e w o r m s a n d r e l e a s e a n y u n l a i d e g g s . E m b r y o s w e r e w a s h e d s e v e r a l t i m e s i n M 9 b u f f e r , fixed i n 3 % f o r m a l d e h y d e / P B S , w a s h e d i n d H 2 0 a n d r e s u s p e n d e d i n - 2 0 ° C m e t h a n o l . T h e e m b r y o s w e r e r e h y d r a t e d t h r o u g h a m e t h a n o l / T B S s e r i e s ( 7 5, 5 0 a n d 2 5 % ) , w a s h e d s e v e r a l t i m e s i n T B S a n d i n c u b a t e d i n b l o c k b u f f e r ( 2 % m i l k p o w d e r i n T B S - T w e e n ) . P r i m a r y a n t i b o d i e s w e r e a d d e d a n d e m b r y o s w e r e i n c u b a t e d at 4 ° C o v e r n i g h t . S a m p l e s w e r e e x t e n s i v e l y w a s h e d i n T B S - T w e e n , r e s u s p e n d e d i n b l o c k b u f f e r a n d f l u o r e s c e n t l y - l a b e l l e d s e c o n d a r y a n t i b o d i e s w e r e a d d e d . S a m p l e s w e r e i n c u b a t e d at r o o m t e m p e r a t u r e f o r t w o h o u r s t o o v e r n i g h t . I n s o m e e x p e r i m e n t s , D A P I ( l u g / m l ) w a s a l s o a d d e d . E m b r y o s w e r e e x t e n s i v e l y w a s h e d i n T B S - T w e e n a n d T B S , t h e n r e s u s p e n d e d i n m o u n t i n g m e d i u m . T h e s t a i n e d e m b r y o s w e r e a m i x e d p o p u l a t i o n o f p h e n o t y p i c a l l y w i l d t y p e a n d m u t a n t e m b r y o s at a 3:1 r a t i o . T h u s , it w a s n e c e s s a r y t o e x a m i n e a l a r g e n u m b e r o f e m b r y o s t o i d e n t i f y t h e m u t a n t p h e n o t y p e s . I n g e n e r a l , 5 0 e m b r y o s at e a c h d e v e l o p m e n t a l s t a g e w e r e e x a m i n e d w i t h t h e a s s u m p t i o n t h a t V i o f t h e s e w o u l d b e m u t a n t . I f a v a r i a n t s t a i n i n g p a t t e r n w a s s e e n i n at l e a s t 8/50 e m b r y o s , t h e n t h e d i f f e r e n c e w a s i d e n t i f i e d a n d d e s c r i b e d as a m u t a n t p h e n o t y p e . I f f e w e r t h a n 8/50 e m b r y o s e x h i b i t e d a v a r i a n t s t a i n i n g p a t t e r n , t h e p h e n o t y p e w a s 47 not identified as different from wild type. In some cases the mutant phenotype was obvious and it was not necessary to score as many as 50 embryos. In those instances, 15-20 mutant embryos were scored and wild type embryos were disregarded. 5.2 Immunostaining of larvae and adults 5.2.1 Formaldehyde fixation method Wild type and mutant larvae and adults were stained using a modification of the procedure of Finney and Ruvkun (1990). Outcrossed let-70 hermaphrodites were produced as described in Section II.2.2. Briefly, animals were collected from 10-12 large NG plates with M9 buffer and incubated in 4% sucrose/1 mM EDTA, pH 8.0 for one hour. Worms were resuspended in -20°C Ruvkun fixation buffer (160 mM KC1, 40 mM NaCl, 20 mM EGTA, 10 mM spermidine HC1, 30 mM PIPES pH 7.4, 50% methanol). Formaldehyde (JB. E M Services) was added to a final concentration of 2% and worms were frozen at -80°C until required. Worms were taken through several freeze/thaw cycles, incubated on ice for 30 minutes, washed in TTB (100 mM Tris-HCl pH 7.4, 1% Triton X-100, 1 mM EDTA) and incubated for 30 minutes at room temperature in 1% Triton X-100 in M9 buffer. Worms were then incubated in 1% (3-mercaptoethanol for several hours at 37°C. This treatment reduces disulfide bonds in the nematode cuticle. Worms were washed and incubated in 50 mM H3BO3 / 25 mMNaOH/10 mM DTT/0.01% Triton X-100 for 15 minutes at room temperature to complete the reduction reaction. The thiol groups were oxidized by treatment in 50 mM H3BO3 / 25 mM NaOH/0.3% H2O2/0.01% Triton X-100 for 15 minutes at room temperature. Samples were washed, resuspended in AbA buffer (1% BSA, 0.5% Triton X-100 in PBS) and primary antibodies were added. Samples were incubated overnight at 4°C, extensively washed in AbB buffer (0.1% BSA, 0.5% Triton X-100 in PBS) and resuspended in AbA buffer. Fluorescently-labelled secondary antibodies and DAPI (1 ug/ml) were added. Samples were incubated two hours to overnight at room temperature, washed extensively in AbB buffer and resuspended in mounting medium. Immunostained animals (10-15 pi) were mounted on 2% agarose pads on slides and examined. 5.2.2 Freeze-fracture method In some experiments, larvae and adults were immunostained using the freeze-fracture method of Albertson (1984). Outcrossed let-70 hermaphrodites were produced as described in Section II.2.2. Staged worms were washed off 5-8 small NG plates with M9 buffer, collected 48 b y g e n t l e c e n t r i f u g a t i o n ( 2 0 0 0 r p m f o r 1 m i n u t e ) , r e s u s p e n d e d i n 4 % s u c r o s e / 1 m M E D T A , p H 8.0 a n d c o l l e c t e d o n c e a g a i n . T h e s u c r o s e s o l u t i o n w a s a s p i r a t e d , l e a v i n g t h e w o r m s i n a p p r o x i m a t e l y 2 5 0 p i s o l u t i o n . 20-25 u l o f w o r m s u s p e n s i o n w a s p i p e t t e d o n t o a p o l y l y s i n e -c o a t e d s l i d e a n d c o v e r e d w i t h a l a r g e ( 2 4 x 5 0 mm, t h i c k n e s s 2 ) c o v e r s l i p . S l i d e s w e r e p l a c e d o n a m e t a l b l o c k t h a t h a d b e e n p r e - c o o l e d t o - 8 0 ° C a n d s t o r e d at - 8 0 ° C u n t i l n e e d e d . C o v e r s l i p s w e r e q u i c k l y f l i p p e d o f f t h e s l i d e w i t h a r a z o r b l a d e a n d t h e s l i d e s w e r e f i x e d i n 1 0 0 % m e t h a n o l at - 2 0 ° C f o r 4 mi n u t e s . S l i d e s w e r e t r a n s f e r r e d t o - 2 0 ° C a c e t o n e f o r 4 mi n u t e s , r e h y d r a t e d t h r o u g h a g r a d e d a c e t o n e / T B S s e r i e s ( 7 5 , 50, a n d 2 5 % ) a n d w a s h e d i n T B S . T h e a r e a a r o u n d t h e w o r m s w a s c a r e f u l l y d r i e d , a n d p r i m a r y a n t i b o d y i n 1 % B S A i n T B S - T w e e n w a s p i p e t t e d o n t o t h e w o r m s . S a m p l e s w e r e i n c u b a t e d i n a h u m i d i f i e d c h a m b e r o v e r n i g h t at 1 5 ° C t h e n w a s h e d e x t e n s i v e l y i n T B S - T w e e n . T h e a r e a a r o u n d t h e w o r m s w a s d r i e d , f l u o r e s c e n t l y - l a b e l l e d s e c o n d a r y a n t i b o d i e s w e r e p i p e t t e d o n t o t h e s l i d e s a n d t h e s a m p l e s w e r e i n c u b a t e d i n a h u m i d i f i e d c h a m b e r f o r t w o h o u r s at r o o m t e m p e r a t u r e . S l i d e s w e r e e x t e n s i v e l y w a s h e d i n T B S - T w e e n , 10-15 u l o f m o u n t i n g m e d i u m w a s p i p e t t e d o n t o t h e w o r m s , a n d a l a r g e c o v e r s l i p w a s p l a c e d o n top. 5.3 Antibodies used in this study F o r i m m u n o l o c a l i z a t i o n o f U B C - 2 , t h e r a b b i t p o l y c l o n a l a n t i b o d y , a n t i - U B C - 2 , w a s u s e d . A n t i - U B C - 2 h a d b e e n p r o d u c e d b y i m m u n i z i n g r a b b i t s w i t h r e c o m b i n a n t U B C - 2 f o l l o w e d b y a f f i n i t y a n d a c e t o n e p o w d e r p u r i f i c a t i o n ( Z h e n , 1 9 9 5 ) . O n e o r m o r e m o u s e m o n o c l o n a l a n t i b o d i e s w e r e i n c l u d e d i n t h e p r e p a r a t i o n s as a c o u n t e r s t a i n t o a i d i n t h e i d e n t i f i c a t i o n o f c e l l s a n d t i s s u e s . T h e s e i n c l u d e d D M 5 . 6 ( a k i n d g i f t f r o m D . M i l l e r ) , I C B 4 ( a k i n d g i f t f r o m G. M u l l e n ) , C 4 ( I C N B i o m e d i c a l s , Inc.), a d o u b l e s t r a n d e d D N A a n t i b o d y ( C h e m i c o n I n t e r n a t i o n a l Inc.) a n d K 7 6 ( d e v e l o p e d b y S. S t r o m e a n d W.B. W o o d a n d o b t a i n e d f r o m t h e D e v e l o p m e n t a l S t u d i e s H y b r i d o m a B a n k , T h e U n i v e r s i t y o f I o w a , D e p a r t m e n t o f B i o l o g i c a l S c i e n c e s , I o w a C i t y , I A 5 2 2 4 2 , u n d e r c o n t r a c t N O l - H D - 7 - 3 2 6 3 f r o m t h e N I C H D ) . T h e s p e c i f i c i t y a n d d i l u t i o n s o f t h e a n t i b o d i e s u s e d a r e s h o w n i n T a b l e 1. T h e s e c o n d a r y a n t i b o d i e s u s e d w e r e F I T C - c o n j u g a t e d A f F i n i P u r e F(ab ' ) 2 f r a g m e n t o f D o n k e y A n t i - r a b b i t I g G a n d T e x a s R e d - c o n j u g a t e d A f F i n i P u r e F(ab ' ) 2 f r a g m e n t o f D o n k e y A n t i - m o u s e I g G ( J a c k s o n I m m u n o R e s e a r c h L a b o r a t o r i e s Inc.). S e c o n d a r y a n t i b o d i e s w e r e d i l u t e d 1:200 f o r m o s t e x p e r i m e n t s . 49 F o r t h e c o m p e t i t o r assay, a n t i - U B C - 2 a n t i b o d y w a s p r e - i n c u b a t e d i n a n e x c e s s o f r e c o m b i n a n t U B C - 2 ( s e e S e c t i o n II.4.1). T w o u g o f U B C - 2 w a s a d d e d t o t h e p r i m a r y a n t i b o d y a n d t h e m i x t u r e w a s i n c u b a t e d at 4 ° C f o r o n e h o u r w i t h s h a k i n g . T h e e n t i r e s o l u t i o n w a s a d d e d t o t h e n e m a t o d e s a m p l e s f o r p r i m a r y a n t i b o d y s t a i n i n g . Table 1. Antibody dilutions used for immunostaining and their specificity Antibody name Specificity Dilution a n t i - U B C - 2 U B C - 2 1:400 D M 5 . 6 m y o s i n h e a v y c h a i n A 1:50 1 C B 4 i n t e s t i n e , s p e r m , s e n s o r y n e u r o n s 1:50 K 7 6 P g r a n u l e s 1:20 C 4 a c t i n 1:50 a n t i - d s D N A d o u b l e - s t r a n d e d D N A 1:50 6. METHODS RELATED TO TRANSGENIC STUDIES 6.1 Construction of ubc-2: :GFP fusions T o m a k e c o n s t r u c t s p T S l . l a n d p T S 2 . 2 , t h e c o d i n g r e g i o n o f G F P w a s i n s e r t e d i n -f r a m e i n t o t h e s e c o n d e x o n o f a ubc-2 g e n o m i c c l o n e . T h e p T S l . l a n d p T S 2 . 2 c o n s t r u c t s a r e i d e n t i c a l e x c e p t t h a t p T S l . l c o n t a i n s t h e n u c l e a r l o c a l i z i n g s i g n a l ( N L S ) f r o m S V 4 0 u p s t r e a m o f t h e G F P c o d i n g s e q u e n c e , a n d t h e p T S 2 . 2 c o n s t r u c t d o e s not. B o t h f u s i o n s w e r e p r o d u c e d i n t h e p Z M 1 3 c o n s t r u c t b a c k g r o u n d , a n d c o n t a i n t h e c o m p l e t e ubc-2 c o d i n g s e q u e n c e , i n c l u d i n g f i v e e x o n s a n d f o u r i n t r o n s , w i t h 7 k b o f s e q u e n c e u p s t r e a m o f t h e ubc-2 i n i t i a t i o n c o d o n a n d 6 k b o f s e q u e n c e d o w n s t r e a m o f t h e ubc-2 p o l y - a d e n y l a t i o n s i g n a l . A n Apa I - c o n t a i n i n g l i n k e r w a s g e n e r a t e d a n d i n s e r t e d b e t w e e n t h e Pst I a n d BamH I s i t e s o f t h e u p s t r e a m m u l t i p l e c l o n i n g s i t e ( M C S ) o f t h e G F P v e c t o r s p P D 9 5 . 7 0 a n d p P D 9 5 . 7 9 ( a k i n d g i f t f r o m A . F i r e ) . T h i s i n t r o d u c e d a n Apa I site i n t o t h e u p s t r e a m M C S o f t h e G F P v e c t o r s . T h e l i n k e r s e q u e n c e i s s h o w n i n A p p e n d i x E . T h e G F P v e c t o r s w e r e d i g e s t e d w i t h Apa I a n d t h e a p p r o x i m a t e l y 1.8 k b f r a g m e n t s c o n t a i n i n g t h e G F P s e q u e n c e w e r e p u r i f i e d . T h e p Z M 1 3 c o n s t r u c t w a s o r i g i n a l l y a 13 k b BarnW 1-Bgl II f r a g m e n t i n p B S I I S K ( + ) . A Not l-Sal I f r a g m e n t c o n t a i n i n g t h e 13 k b ubc-2 f r a g m e n t w a s r e m o v e d f r o m p Z M 1 3 a n d l i g a t e d t o p G E M - 9 Z ( - ) ( P r o m e g a ) . T h e s u b - c l o n i n g s t e p w a s n e c e s s a r y t o r e m o v e a l l v e c t o r - c o n t a i n i n g Apa I s i t e s . T h e Apa I G F P f r a g m e n t s w e r e i n s e r t e d i n t o t h e Apa I s i t e o f ubc-2 t o p r o d u c e a n 50 i n - f r a m e f u s i o n o f G F P t o t h e s e c o n d e x o n o f ubc-2. R e s t r i c t i o n d i g e s t i o n w i t h Xho I i d e n t i f i e d c l o n e s c o n t a i n i n g t h e G F P c o d i n g s e q u e n c e i n t h e p r o p e r o r i e n t a t i o n w i t h i n t h e ubc-2 g e n e . 6.2 Construction of a temperature-sensitive let-70 allele I n y e a s t , a n a l l e l e o f t h e c e l l c y c l e - r e l a t e d E 2 , cdc34-l, i s t e m p e r a t u r e - s e n s i t i v e w i t h r e s p e c t t o i t s E 2 a c t i v i t y ( G o e b l et al., 1988). cdc34-l c o n t a i n s a m i s s e n s e m u t a t i o n r e s u l t i n g i n a p r o l i n e t o s e r i n e s u b s t i t u t i o n at a r e s i d u e t h a t i s c o n s e r v e d i n a l l E 2 s e x a m i n e d t o d a t e ( E l l i s o n et al., 1991). F u r t h e r m o r e , c r e a t i o n o f t h e c o r r e s p o n d i n g m u t a t i o n i n t h e y e a s t E 2 s , R A D 6 a n d U b c 9 , c r e a t e d t e m p e r a t u r e - s e n s i t i v e a l l e l e s i n t h e s e g e n e s as w e l l ( B e t t i n g a n d S e u f e r t , 1996; E l l i s o n et al., 1991). A p u t a t i v e t e m p e r a t u r e - s e n s i t i v e a l l e l e s o f ubc-2, p Z M 1 3 . 3 4 , w a s c o n s t r u c t e d b y M e i Z h e n i n p Z M 1 3 f o l l o w i n g c o n v e n t i o n a l s i t e - d i r e c t e d m u t a g e n e s i s p r o t o c o l s ( S a m b r o o k et al, 1989). F o r p Z M 1 3 . 3 4 , t h e c y t o s i n e at n u c l e o t i d e p o s i t i o n 2 2 9 w a s c h a n g e d t o a t h y m i n e , w h i c h c o n v e r t e d t h e p r o l i n e at p o s i t i o n 61 i n t o s e r i n e ( P 6 1 S ) . T h e n u c l e o t i d e s u b s t i t u t i o n m a d e w a s b a s e d o n t h e p u b l i s h e d s e q u e n c e o f cdc34-l ( E l l i s o n et al, 1991). 6.3 Preparation of DNA for injection into nematodes 6.3.1 Co-injection solutions F o r D N A c o - i n j e c t i o n s , p l a s m i d a n d f o s m i d D N A w a s p r e p a r e d u s i n g t h e Q i a p r e p S p i n M i n i p r e p k i t ( Q i a g e n , Inc.). I n j e c t i o n s o l u t i o n s c o n t a i n e d a m i x t u r e o f t h e D N A c o n s t r u c t o f i n t e r e s t a n d t h e p l a s m i d p R F 4 at a m a s s r a t i o o f 1:50 o r 1:200. T h e t o t a l D N A c o n c e n t r a t i o n w a s 1 0 0 u g / m l i n d H 2 0 . 6.3.2 Injection mixtures containing carrier DNA I n j e c t i o n m i x t u r e s c o n t a i n i n g c a r r i e r D N A w e r e p r e p a r e d f o l l o w i n g t h e p r o t o c o l o f K e l l y et al. ( 1 9 9 7 ) . S a m p l e s w e r e l i n e a r i z e d b y d i g e s t i o n w i t h t h e a p p r o p r i a t e r e s t r i c t i o n e n z y m e an d , i f r e q u i r e d , o v e r h a n g i n g e n d s w e r e f i l l e d i n u s i n g K l e n o w e n z y m e ( s e e S e c t i o n s II.3.1 a n d II.3.2). S a m p l e s w e r e p u r i f i e d u s i n g t h e Q i a e x II D N A p u r i f i c a t i o n k i t o r t h e Q i a s p i n P C R p u r i f i c a t i o n k i t . E a c h i n j e c t i o n m i x t u r e c o n t a i n e d Pvu I I - d i g e s t e d N 2 g e n o m i c D N A ( 1 0 0 u g / m l ) , Sma I - d i g e s t e d p l a s m i d p R F 4 (2 u g / m l ) a n d t h e l i n e a r i z e d D N A c o n s t r u c t o f i n t e r e s t (2 u g / m l ) i n d H 2 0 . T h i s g e n e r a l l y g a v e a 1:3:100 m a s s r a t i o o f r e p o r t e r D N A : p R F 4 : g e n o m i c D N A . 51 6.4 Establishment of transgenic C. elegans strains I n j e c t i o n n e e d l e s w e r e p u l l e d f r o m g l a s s c a p i l l a r i e s ( C a t . N o . 1 B 1 0 0 F - 6 , W o r l d P r e c i s i o n I n s t r u m e n t s Inc.) u s i n g a F r e d e r i c H a e r & C o . m i c r o p i p e t t e p u l l e r a n d filled w i t h t h e a p p r o p r i a t e D N A m i x t u r e t o b e i n j e c t e d . W i l d t y p e o r let-70(s689) unc-22(s7)/ nTl(IV);+/nTl(V) w o r m s w e r e i n j e c t e d i n t o t h e s y n c y t i a l g o n a d at a m a g n i f i c a t i o n o f 4 0 0 X u s i n g a Z e i s s I M 3 5 m i c r o s c o p e e q u i p p e d w i t h N o m a r s k i o p t i c s , a n d a L e i t z m i c r o m a n i p u l a t o r a c c o r d i n g t o t h e m e t h o d o f F i r e ( 1 9 8 6 ) . 6.5 Selection of transformed progeny S e l e c t i o n o f p r o g e n y t r a n s f o r m e d w i t h p R F 4 , a p l a s m i d c o n t a i n i n g t h e rol-6(su!006) a l l e l e w a s b y v i s u a l i n s p e c t i o n f o r a n i m a l s t h a t r o l l . T h e a n t i m o r p h i c a l l e l e sul006 e n c o d e s a m u t a n t c o l l a g e n a n d t h e s e m u t a n t s p o s s e s s a n a l t e r e d b o d y c u t i c l e w h i c h f o r c e s t h e a n i m a l t o r o l l o n i t s r i g h t s i d e ( K r a m e r et al., 1990). E a c h s e l e c t e d F l t r a n s g e n i c a n i m a l w a s p l a c e d o n a s e p a r a t e p l a t e f o r p r o p a g a t i o n a n d t h e F 2 w e r e e x a m i n e d f o r r o l l e r p r o g e n y t o c h e c k f o r h e r i t a b l e t r a n s m i s s i o n o f t h e a r r a y . C l o n e s t h a t s e g r e g a t e d t h e t r a n s g e n i c a r r a y s w e r e c o n s i d e r e d t o b e i n d e p e n d e n t l i n e s . 52 m . RESULTS 1. PHENOTYPE OF let- 70 MUTANTS Earlier studies indicated that let-70 mutants arrested at the L2/L3 stage of development (Zhen et al., 1996). In this study, a comprehensive examination of the mutant phenotype of let-70(sll32) and let-70(s689) homozygotes was undertaken. Specific cellular defects in mutant hermaphrodites and males were identified and compared to N2 and unc-22 animals. The unc-22 phenotype was utilized as a control since all let-70 mutants were in an unc-22 background. To generate let-70 males, let-70/nTl hermaphrodites were crossed to let-70/+ males and the resulting twitcher (let-70/let-70) male progeny were examined. Tissues and cellular structures were examined in live animals using Nomarski optics and in DAPI stained animals using UV fluorescence microscopy. 1.1 Phenotype of let-70(sll32) hermaphrodites The let-70(sll32) hermaphrodite had a consistent phenotype (Figure 7). Most mutants arrested at L3 and were very thin and clear. Young larvae moved fairly well, becoming progressively more sluggish as they aged, and were usually paralyzed by L3 arrest. The pharynx of let-70(sl132) mutant larvae pumped and the animals were capable of feeding. The development of the intestine was most strongly affected in let-70(sl 132) mutants. Although the correct number of intestinal cells were present in these mutants, they were abnormal in appearance (Figure 7B). The intestinal cells were much smaller than normal and had an enlarged nucleus with a conspicuous nuclear membrane. The nucleolus, while prominent, was often abnormally shaped. Many intestinal cells were detached from the basement membrane, and as a consequence, the pseudocoelomic space between the intestinal cells and the basement membrane was enlarged. The intestinal cells contained very few gut granules. In general, more gut granules were located in the anterior intestine cells than in the posterior cells. The lack of gut granules in the intestinal cells may account for the clear appearance of the let-70(sl 132) mutants. By Nomarski optics, the development of other cells and tissues did not appear to be strongly affected in let-70(sll32) mutants. 1.2 Phenotype of let-70(s689) hermaphrodites The let-70(s689) mutant phenotype was more variable than the let-70(sll32) mutant phenotype. The arrest stage ranged from L3 to sterile adult, although animals which developed 53 Figure 7. Intestinal defects in let-70(sll32) and let-70(s689) mutant animals. A) Wild type adult viewed with Nomarski optics. The pharyngeal-intestinal valve (pi), intestine cell nucleus (int) and the numerous gut granules (gg) are indicated. B) let-70(sl 132) terminal phenotype. Note the enlarged pseudocoelomic cavity (pc) and the absence of gut granules. C) and D) let-70(s689) mutant phenotypes. In panel C, note the separation of the intestine cells from the pharyngeal-intestinal valve and the enlarged pseudocoelomic cavity. In panel D, the intestinal lumen (lu) is enlarged and contains undigested bacteria. In each panel, anterior is to the left. Scale bar indicates 50 microns. 54 55 beyond L3 were relatively rare. Most of the animals that arrested in L3 had phenotypes similar to let-70(sl 132) mutants, although the defects were usually exacerbated. The intestinal cells were very small and were detached from the basement membrane, such that pseudocoelomic spaces encompassed most of the internal space of the animal. The apical border of microvilli was often not visible and there were very few gut granules. In many individuals, the intestine was partially detached from the pharyngeal-intestinal valve, with only a thin, ragged connection between the pharynx and the intestine (Figure IC). In some animals, the intestine cells remained attached to the basement membrane, which resulted in the expansion of the intestinal lumen to form a large cavity within the animal that was often filled with bacteria (Figure 7D). A small number of let-70(s689) individuals developed into sterile adults (Figure 8). In contrast to most let-70(s689) animals, the let-70(s689) adults had well developed intestinal cells and produced a large number of gut granules. However, these animals developed gonad defects that varied in phenotype and severity among individuals. The defects seen in let-70(s689) mutants affected almost all gonadal structures. The distal tip was enlarged and bulbous and the distal tip cell was often indistinguishable from the surrounding germline nuclei. In many individuals, the gonadal arms did not reflex and the arm continued to grow straight outward toward the anterior or posterior end of the animal. In some mutants, the distal arm reflexed or bent several times during outgrowth. In addition, the ovary contained fewer germ cells than normal, and these did not mature properly. Maturation of the germ cells was initiated at a position more distal than in wild type animals such that oocytes often formed within the loop region rather than within the oviduct (Figure 8B). The oocytes were often elongated ovals rather than the normal cuboidal shape. The oocytes were not fertilized and did not migrate into the uterus; however, an accumulation of oocytes within the oviduct and gonadal arm was not detected. Germ cell maturation appeared to arrest after only a few oocytes were produced. Only a small number of sperm were produced as well. The spermatheca and uterus of let-70(s689) mutants were a mass of undifferentiated cells rather than the well defined structure that is generally seen in wild type nematodes (Figure 8D). In many individuals, the development of the vulva was affected such that a proper vulval opening was not produced. In summary, let-70(s689) mutant hermaphrodites that developed into sterile adults exhibited defects in the formation of the somatic gonad and in the maturation of the germline. Attempts were made to mate early adult let-70(s689) homozygotes with N2 males to 56 Figure 8. Gonadal defects in let-70(s689) mutant animals. A ) a n d C ) T h e a n t e r i o r g o n a d a l a r m o f a w i l d t y p e h e r m a p h r o d i t e v i e w e d w i t h N o m a r s k i o p t i c s . T h e d i s t a l o v a r y ( o v a ) c o n t a i n s m i t o t i c g e r m l i n e n u c l e i t h a t p r o g r e s s t h r o u g h m e i o s i s at t h e l o o p i n t h e g o n a d a l a r m a n d d e v e l o p i n t o o o c y t e s ( o o ) . T h e o o c y t e s a r e f e r t i l i z e d a s t h e y t r a v e l t h r o u g h t h e s p e r m a t h e c a i n t o t h e u t e r u s (ut), a n d e m b r y o s a r e r e l e a s e d t h r o u g h t h e v u l v a ( v u l ) . B) T h e a n t e r i o r g o n a d a l a r m o f a let-70(s689) h e r m a p h r o d i t e . D) U t e r u s a n d v u l v a o f a let-70(s689) h e r m a p h r o d i t e . E ) W i l d t y p e m a l e w i t h p r i m a r y s p e r m a t o c y t e s ( p s ) a n d s p e r m a t i d s ( s p ) i n d i c a t e d . F) let-70(s689) m u t a n t male. I n e a c h p a n e l , a n t e r i o r i s t o t h e l e f t . S c a l e b a r i n d i c a t e s 5 0 m i c r o n s . 57 58 d e t e r m i n e w h e t h e r w i l d t y p e s p e r m c o u l d r e s c u e t h e a r r e s t s t a g e o f t h e s e m u t a n t s . M a t e d let-70(s689) m u t a n t h e r m a p h r o d i t e s d i d n o t p r o d u c e f e r t i l i z e d e g g s , n o r d i d t h e y l a y a n y e g g s . T h e p h e n o t y p e o f m a t e d let-70(s689) a n i m a l s w a s s i m i l a r t o t h a t o f u n m a t e d i n d i v i d u a l s , a l t h o u g h s e v e r a l m a t e d i n d i v i d u a l s d e v e l o p e d v u l v a l p r o t r u s i o n s , p r e s u m a b l y a s a r e s u l t o f t h e m a t i n g p r o c e s s . 1.3 Phenotype of let-70 males . M u t a n t let-70(sl 132) m a l e s a r r e s t at L 3 o r e a r l y L 4 . T h e i n t e s t i n e w a s a f f e c t e d i n a m a n n e r s i m i l a r t o m u t a n t h e r m a p h r o d i t e s : t h e c e l l s w e r e s m a l l , l a c k e d a m i c r o v i l l u s b o r d e r a n d c o n t a i n e d v e r y f e w g u t g r a n u l e s . T h e d i s t a l t i p o f t h e g o n a d a r m w a s b u l b o u s i n s h a p e a n d t h e g o n a d a r m i t s e l f w a s s l i g h t l y m i s s h a p e n ( d a t a n o t s h o w n ) . T h e m u t a n t let-70(s689) m a l e s a r r e s t e d b e t w e e n L 3 a n d y o u n g a d u l t . T h e L 3 a r r e s t w a s s i m i l a r i n p h e n o t y p e t o let-70(sl 132) males. T h e m o s t c o m m o n a r r e s t s t a g e s e e n w a s m i d - L 4 . T h e v a s d e f e r e n s h a d e x t e n d e d to, b u t h a d n o t c o n n e c t e d w i t h , t h e c l o a c a . T h e s p e c i a l i z e d m a l e t a i l s t r u c t u r e s h a d d i f f e r e n t i a t e d a n d t h e n u m b e r a n d l o c a t i o n o f s e n s o r y r a y s a n d s p i c u l e s a p p e a r e d n o r m a l ( d a t a n o t s h o w n ) . T h e d i s t a l t i p o f t h e t e s t i s w a s b u l b o u s a n d s l i g h t l y m i s s h a p e n , a l t h o u g h i n g e n e r a l , t h e t e s t i s s t r u c t u r e w a s p r o p e r l y f o r m e d . B o t h m a t u r a t i o n o f t h e g e r m c e l l s a n d p r i m a r y s p e r m a t o c y t e f o r m a t i o n w e r e i n i t i a t e d c l o s e r t o t h e d i s t a l e n d o f t h e g o n a d t h a n i n w i l d t y p e m a l e s ( F i g u r e 8 F ) . 2. THE let- 70(s689) MUTA TION IS A SPLICING ERROR P r e v i o u s c h a r a c t e r i z a t i o n o f t h e let-70(s689) a l l e l e i n d i c a t e d t h a t t h e s p l i c e d o n o r s i t e o f t h e f o u r t h i n t r o n w a s a l t e r e d ( s e e S e c t i o n 1.7; Z h e n et al., 1 9 9 6 ) . T h i s s u g g e s t e d t h a t t h e s p l i c e s i t e o f t h e f o u r t h i n t r o n o f ubc-2 m i g h t n o t b e r e c o g n i z e d b y t h e s p l i c e o s o m e a n d t h a t s u b s e q u e n t l y , t h e f o u r t h i n t r o n m i g h t n o t b e r e m o v e d f r o m t h e p r e - m R N A . T o d e t e r m i n e i f t h e f o u r t h i n t r o n w a s s p l i c e d f r o m t h e m e s s a g e , t o t a l R N A w a s i s o l a t e d f r o m w i l d t y p e a n d h o m o z y g o u s let-70(s689) m u t a n t a n i m a l s a n d c D N A w a s s y n t h e s i z e d . T h e c o d i n g r e g i o n o f ubc-2 w a s a m p l i f i e d f r o m first s t r a n d c D N A u s i n g R A C E 3 6 a n d O Z M 3 . f o l i g o n u c l e o t i d e s . A p o r t i o n o f t h i s r e a c t i o n w a s r e - a m p l i f i e d u s i n g O Z M 3 . f a n d O Z M 2 . r . T w o a m p l i f i c a t i o n p r o d u c t s w e r e p r o d u c e d , o n e a p p r o x i m a t e l y 4 4 0 b p i n l e n g t h ( s 6 8 9 - l ) a n d t h e o t h e r a p p r o x i m a t e l y 4 9 0 b p ( s 6 8 9 - 2 ) . T h e i n t e n s i t y o f t h e s 6 8 9 - 2 b a n d w a s f a r g r e a t e r t h a n t h a t o f s 6 8 9 - l ( d a t a n o t s h o w n ) . B o t h f r a g m e n t s w e r e p u r i f i e d , s u b c l o n e d i n t o t h e p B S I I K S ( + ) v e c t o r , a n d t h e n u c l e o t i d e s e q u e n c e w a s d e t e r m i n e d . 59 S e q u e n c i n g r e v e a l e d t h a t b o t h f r a g m e n t s c o d e d f o r ubc-2. T h e s 6 8 9 - l f r a g m e n t s e q u e n c e m a t c h e d t h e w i l d t y p e ubc-2 c o d i n g r e g i o n e x a c t l y ( F i g u r e 9). F i v e e x o n s e q u e n c e s o f ubc-2 w e r e p r e s e n t , a n d a l l f o u r i n t r o n s h a d b e e n c o r r e c t l y s p l i c e d f r o m t h e p r e - m R N A . T h e r e f o r e , s o m e m u t a n t let-70(s689) m e s s a g e is c o r r e c t l y s p l i c e d . T h e s e q u e n c e o f s6 8 9 - 2 c o n t a i n e d t h e w h o l e s e q u e n c e o f t h e f o u r t h i n t r o n i n a d d i t i o n t o t h e five e x o n s . T h e o t h e r i n t r o n s e q u e n c e s w e r e a b s e n t . T h u s , t h e let-70(s689) m u t a t i o n i s c a u s e d b y m i s - s p l i c i n g o f t h e f o u r t h i n t r o n o f ubc-2, s u c h t h a t t h e i n t r o n s e q u e n c e r e m a i n s p a r t o f t h e m a t u r e m R N A . C o n c e p t u a l t r a n s l a t i o n o f t h e s 6 8 9 - 2 s e q u e n c e r e v e a l e d a n i n - f r a m e s t o p c o d o n l o c a t e d i m m e d i a t e l y a d j a c e n t t o t h e m u t a n t s p l i c e d o n o r s i t e ( F i g u r e 9). T h i s p r e d i c t s t h a t a t r u n c a t e d p r o t e i n p r o d u c t l a c k i n g t h e c a r b o x y l t e r m i n a l 14 a m i n o a c i d s o f U B C - 2 m a y b e t r a n s l a t e d i n let-70(s689) m u t a n t a n i m a l s . 2.1 smg-mediated surveillance in let-70(s689) mutants S i n c e t h e let-70(s689) m u t a t i o n i s l i k e l y d u e t o t h e p r e s e n c e o f a p r e m a t u r e s t o p c o d o n i n t h e m a t u r e m R N A c a u s e d b y m i s - s p l i c i n g o f t h e f o u r t h i n t r o n , i t i s p o s s i b l e t h a t smg-m e d i a t e d m R N A s u r v e i l l a n c e m a y b e i n v o l v e d i n t h e m a n i f e s t a t i o n o f t h e m u t a t i o n . N o n s e n s e -m e d i a t e d m R N A d e c a y ( N M D ) o r m R N A s u r v e i l l a n c e i s a s y s t e m p r e s e n t i n m a n y e u k a r y o t e s t h a t i s i n v o l v e d i n t h e r a p i d d e g r a d a t i o n o f m R N A s c o n t a i n i n g n o n s e n s e o r f r a m e s h i f t m u t a t i o n s ( P e l t z et al, 1994; R u i z - E c h e v a r r i a et al, 1996). N o n s e n s e - m u t a n t m R N A s a r e d e g r a d e d m o r e r a p i d l y t h a n t h e i r w i l d t y p e c o u n t e r p a r t s . B o t h c/'s-acting e l e m e n t s a n d / r a m -a c t i n g f a c t o r s a r e i n v o l v e d i n N M D . A c o m p l e x o f p r o t e i n s i s t h o u g h t t o a s s e m b l e at s t o p c o d o n s d u r i n g t r a n s l a t i o n t e r m i n a t i o n a n d s c a n d o w n s t r e a m f o r t h e p r e s e n c e o f c/'s-acting e l e m e n t s ( C z a p l i n s k i et al, 1998). I f s u c h e l e m e n t s a r e f o u n d , t h e m R N A i s d e g r a d e d . T h e m u t a n t m R N A i s d e c a p p e d b y d e c a p p i n g e n z y m e s a n d d e g r a d e d f r o m t h e 5' e n d b y e x o r i b o n u c l e a s e X r n l p ( M u h l r a d a n d P a r k e r , 1994). I n C. elegans, it i s b e l i e v e d t h a t t h e smg g e n e s (smg-l-smg-7) c o n s t i t u t e a m R N A s u r v e i l l a n c e s y s t e m t h a t p r o t e c t s c e l l s from e r r o r s i n m R N A s y n t h e s i s o r p r o c e s s i n g . T h e m R N A p r o d u c e d b y n o n s e n s e a l l e l e s o f m a n y g e n e s a r e u n s t a b l e i n a smg(+) b a c k g r o u n d b u t h a v e n o r m a l o r n e a r n o r m a l s t a b i l i t y i n smg(-) b a c k g r o u n d s ( C a l i a n d A n d e r s o n , 1998; P u l a k a n d A n d e r s o n , 1993). I n a d d i t i o n , t h e r e is a n i n c r e a s e i n t h e e x p r e s s i o n o f m u t a n t p o l y p e p t i d e s w h e n n o n s e n s e a l l e l e s a r e p l a c e d i n a smg(-) b a c k g r o u n d . T o d e t e r m i n e w h e t h e r let-70(s689) w a s a f f e c t e d b y t h e N M D s y s t e m , let-70(s689) smg-60 o a u c j o o o o o c j c j c j EH EH EH o u u EH EH EH < < < o o c j 3 3 3 o u u C J C J C J EH EH EH C J C J C J 3 3 3 c j e> o C J < O EH EH EH O O < EH C J EH < EH EH < EH EH C J u EH EH C J cj cj EH EH EH C J O < < EH O c j o c j 3 3 3 C J C J e> < < <c cj cj o o u u EH EH EH <: < < 0 0 0 u cj u EH EH EH C J C J C J EH EH EH o o u O O V CJ CJ O EH EH EH < «: < u «; < -•H 2 2 g a a o o o c CD (N CTi Dl 2 co cn c j u C J C J C J C J u C J C J EH EH EH U C J C J EH EH EH C J C J C J < < < C J C J < «c < c j C J U u C J u < < < C J C J C J C J C J c j C J C J C J o C J C J o C J C J C J C J C J EH EH EH < < < EH EH EH EH EH EH < <c <C o o o o o C J < < < EH EH EH u u C J o C J erf C J a u 3 C J 3 C J C J C J C J C J C J C J &H EH EH EH EH EH < < < C J c j C J C J C J C J EH EH EH EH EH o C J O EH EH EH EH EH EH EH EH &H < <: o C J C J EH EH EH < <: < C J C J C J EH EH EH C J C J C J C J o C J EH EH EH EH EH EH C J C J C J < <: < o u C J U o o < <c o C J o C J o o EH EH EH C J C J C J C J C J o O C J C J c j C J C J EH EH EH C J C J C J C J C J C J EH EH EH < c j < C J < C J < <; < u o c j C J C J o U C J o U C J u a C J C J <c <c < u C J c j C J C J C J EH EH EH < <C < o C J o EH EH EH O C J C J C J C J U u < < •H 2 2 g Q Q o o u c a> C N CXi Di 2 C O ra EH EH EH C J C J C J C J EH C J C J C J C J EH EH EH C J C J C J C J r£ EH EH EH r£ EH EH EH u C J C J •5 EH EH EH 3, <i EH EH EH C J C J C J < <C <C C J U C J C J C J C J C J C J C J C J C J C J EH EH EH EH EH EH < < < < <: < C J o C J EH EH EH EH EH EH C J C J C J < < < «< < < EH EH EH 0 C J C J EH EH EH <C <c < EH EH EH C J C J C J 3 3 3 C J C J o C J C J C J C J C J C J C J u C J EH EH EH C J u C J C J C J C J EH EH EH < < <: EH EH EH u C J u C J C J C J C J C J o < <Cj < < < < C J C J cj u u u C J C J C J EH EH EH EH EH EH EH EH EH < < <; U C J C J EH EH EH U C J C J C J C J C J C J C J C J < << << EH EH EH C J u u EH 1 EH EH EH C J 1 1 o o C J C J 1 1 u C J C J < 1 I EH EH EH u 1 1 EH EH EH EH 1 1 C J C J C J EH 1 1 EH EH EH C J 1 1 EH EH EH EH 1 1 C J C J C J EH •1 I EH EH EH EH 1 1 C J C J C J EH 1 i EH EH EH C J 1 1 C J C J C J EH I 1 C J C J C J EH | 1 <C < < EH I 1 C J C J C J 1 1 C J C J C J < 1 1 C J C J C J EH I 1 < < <: EH 1 1 C J C J C J EH t 1 EH EH EH <! I 1 < <C < | I EH EH EH < 1 C J < U < < •H 2 2 •rH 2 2 g Q Q g Q Q o u U O O O C c C D C N a\ Q ) C M CT\ Dl 2 C O Dl 2 C O »Xi cn W C J < C J EH EH EH EH < < EH EH EH EH CJ % EH C J EH EH C J C J C J C J EH EH C J EH EH < EH EH <C C J EH < EH EH ^ ^ ^ C J U C J 1 u C J C J I EH EH EH 1 < < < 1 C J C J o C J I EH EH EH < I m C J C J C J EH I •m EH EH EH C J I m C J C J C J 1 EH EH EH < 1 C J C J C J EH 1 C J C J C J EH W; EH EH EH EH I C J C J C J H I m C J C J C J U I m C J C J C J EH i m EH EH EH EH I m C J C J C J EH I m C J C J C J EH I m EH EH EH < I m C J C J C J C J I m EH EH EH < I m < < < EH I w C J C J C J EH I m C J C J u EH I m EH EH EH I m EH EH EH < I C J < < O < < 2 2 •rH 2 2 g Q Q g Q Q o C J C J O o U c c 0) C M cr, C M D) 2 C O Dl 2 C O <Xi cn cn «4H o cn (U U C <u a* a> < O C E i o <£ •o o e 1 S o c o u CU u s Ml C -§ o o 2 C/3 a VO a o i O -Ci a ON" ? ° VO J e CD O c <u 3 CT <U CO < g o i CD a, T3 VO Z I T3 4) a •a -»-» H-» a) o C eo 3 cr C D CO C O 43 G O ^ 3 -a «> o ••6 CD 61 I(cc545) a n d let-70(s689) smg-l(cc546) d o u b l e m u t a n t s w e r e g e n e r a t e d . O u t c r o s s e d let-70(s689)/+ m a l e s w e r e m a t e d t o smg-1 m u t a n t h e r m a p h r o d i t e s . N i c o t i n e - s e l e c t e d c r o s s p r o g e n y w e r e set t o i n d i v i d u a l p l a t e s a n d t h e d e v e l o p m e n t o f a l l t w i t c h e r p r o g e n y w a s e x a m i n e d . T w i t c h e r p r o g e n y (let-70/let-70) w e r e e x p e c t e d t o b e smg-l(+), smg-l(+)lsmg-l, o r smg-11 smg-1. A p p r o x i m a t e l y lA o f t h e t w i t c h e r s e x a m i n e d d e v e l o p e d i n t o e g g - l a y i n g a d u l t s , w h i l e t h e r e m a i n i n g a r r e s t e d at L 3 . It w a s p r e s u m e d t h a t t h e t w i t c h e r s w h i c h d e v e l o p e d i n t o e g g - l a y i n g a d u l t s w e r e let-70 smg-1 d o u b l e m u t a n t s . I n t h e p u t a t i v e d o u b l e m u t a n t s , t h e i n t e s t i n a l a n d g o n a d a l d e f e c t s c h a r a c t e r i s t i c o f let-70 m u t a n t s w e r e r e s c u e d ( d a t a n o t s h o w n ) . A s m a l l n u m b e r o f e g g s w e r e l a i d , a n d a p o r t i o n o f t h e s e w e r e f e r t i l i z e d . E m b r y o s a r r e s t e d j u s t a f t e r g a s t r u l a t i o n , at t h e p r e - c o m m a stage. T h i s i n d i c a t e s t h a t let-70(s689) i s a f f e c t e d b y smg-m e d i a t e d m R N A s u r v e i l l a n c e , a n d t h a t t h e m u t a n t U B C - 2 p r o t e i n m a d e i n t h e smg(-) b a c k g r o u n d c a n p a r t i a l l y r e s c u e t h e let-70(s689) m u t a t i o n . T h i s f u r t h e r i m p l i e s t h a t t h e m u t a n t p r o t e i n i s p a r t i a l l y f u n c t i o n a l w h e n p r o d u c e d i n let-70 smg-1 d o u b l e m u t a n t s . 3. WESTERN ANAL YSIS OF UBC-2 IN WILD TYPE AND let- 70 MUTANTS W e s t e r n a n a l y s i s o f p r o t e i n e x t r a c t s w a s p e r f o r m e d t o d e t e r m i n e w h e t h e r U B C - 2 w a s p r o d u c e d i n let-70(sl 132) a n d let-70(s689) a n i m a l s . I n d i v i d u a l let-70 h o m o z y g o t e s w e r e p i c k e d i n t o L a e m m l i b u f f e r a n d b o i l e d t o r e l e a s e p r o t e i n s . A n t i - U B C - 2 p o l y c l o n a l a n t i b o d i e s w e r e u s e d t o d e t e c t U B C - 2 i n w i l d t y p e a n d let-70 m u t a n t p r o t e i n e x t r a c t s . U B C - 2 w a s s e e n i n w i l d t y p e s a m p l e s at t h e e x p e c t e d s i z e o f 16.7 k D a ( F i g u r e 10). W i t h a s t a n d a r d e x p o s u r e , U B C - 2 c o u l d n o t b e d e t e c t e d i n let-70(sll32) o r let-70(s689) m u t a n t s ; h o w e v e r , w h e n t h e b l o t w a s o v e r e x p o s e d , a f a i n t b a n d o f U B C - 2 w a s o b s e r v e d at 16.7 k D a i n b o t h t h e let-70(sl 132) a n d let-70(s689) l a n e s , s u g g e s t i n g U B C - 2 i s p r e s e n t i n t h e let-70 m u t a n t s at a l o w c o n c e n t r a t i o n . T h u s , b o t h let-70 m u t a n t s t r a i n s p r o d u c e a s m a l l a m o u n t o f U B C - 2 p r o t e i n t h a t i s t h e s a m e s i z e as w i l d t y p e U B C - 2 . It s h o u l d b e n o t e d t h a t a t r u n c a t e d p r o t e i n p r o d u c t w a s n o t o b s e r v e d i n e x t r a c t s p r e p a r e d f r o m let-70(s689) a n i m a l s , e v e n a f t e r l o n g e x p o s u r e . 4. RNA INTERFERENCE D o u b l e - s t r a n d e d R N A ( d s R N A ) c a n a c t as a s i g n a l f o r g e n e - s p e c i f i c s i l e n c i n g o f e x p r e s s i o n i n C . elegans (Fire et al., 1998). I n j e c t i o n o f d s R N A c o r r e s p o n d i n g t o t h e c o d i n g r e g i o n o f a s p e c i f i c g e n e r e s u l t s i n p o t e n t a n d s p e c i f i c g e n e t i c i n t e r f e r e n c e o f t h e c o r r e s p o n d i n g g e n e p r o d u c t s . T h e s i l e n c i n g e f f e c t i s g e n e r a l l y e v i d e n t i n t h e i n j e c t e d a n i m a l a n d i t s F l p r o g e n y . I n m o s t case s , t h e p h e n o t y p e p r o d u c e d b y i n t e r f e r e n c e i s e x t r e m e l y s p e c i f i c a n d 62 Figure 10. UBC-2 is extremely low or absent in let-70(sll32) or let-70(s689) animals. P r o t e i n e x t r a c t s f r o m w i l d t y p e , let-70(sl 132) a n d let-70(s689) w o r m s w e r e s e p a r a t e d b y S D S -P A G E e l e c t r o p h o r e s i s , b l o t t e d as d e s c r i b e d i n M a t e r i a l s a n d M e t h o d s , a n d p r o b e d w i t h A ) a n t i -U B C - 2 p o l y c l o n a l a n t i b o d y o r B ) t h e m o n o c l o n a l a n t i b o d y C4, w h i c h r e c o g n i z e s a c t i n . 63 & ^ & / ^ # UBC-2 ACTIN 64 m i m i c s l o s s - o f - f u n c t i o n m u t a t i o n s . T h i s h a s p r o v e n u s e f u l f o r a n a l y z i n g t h e p u t a t i v e n u l l p h e n o t y p e o f g e n e s w h e r e t r u e n u l l m u t a t i o n s d o n o t e x i s t ( F a y et al., 1 9 9 9 ; A s h c r o f t et al., 1 9 9 9 ) . T h e m o l e c u l a r n a t u r e o f t h e t w o let-70 m u t a n t s s u g g e s t s t h a t n e i t h e r i s a t r u e n u l l a l l e l e . T o i d e n t i f y t h e p u t a t i v e n u l l p h e n o t y p e o f let-70, d s R N A i n t e r f e r e n c e w a s p e r f o r m e d o n C . elegans. S e n s e - a n d a n t i s e n s e - R N A d i r e c t e d t o t h e c o d i n g r e g i o n o f ubc-2 w a s p r e p a r e d u s i n g b a c t e r i o p h a g e R N A p o l y m e r a s e . T h e t w o s t r a n d s w e r e a n n e a l e d a n d i n j e c t e d i n t o y o u n g N 2 ad u l t s . I n j e c t e d a n i m a l s w e r e a l l o w e d t o l a y e g g s f o r 15-20 h o u r s ( B r o o d A ) , t r a n s f e r r e d t o a n e w p l a t e f o r 10-12 h o u r s ( B r o o d B ) t h e n t r a n s f e r r e d o n c e a g a i n ( B r o o d C ) . T h e d e v e l o p m e n t o f t h e F l p r o g e n y f r o m e a c h b r o o d w a s c l o s e l y f o l l o w e d . A r r e s t s t a g e s w e r e i d e n t i f i e d a n d t h e p h e n o t y p e o f a r r e s t e d a n i m a l s w a s d e t e r m i n e d . 4.1 RNA interference using GFP T h e e f f i c i e n c y o f d s R N A i n t e r f e r e n c e i n C. elegans w a s f i r s t d e t e r m i n e d i n a c o n t r o l e x p e r i m e n t . T r a n s g e n i c a n i m a l s c o n t a i n i n g a n unc-54::GFP c o n s t r u c t w e r e i n j e c t e d w i t h d s R N A d i r e c t e d t o t h e c o d i n g r e g i o n o f G F P , a n d t h e e x p r e s s i o n o f G F P w a s e x a m i n e d i n t h e p r o g e n y o f i n j e c t e d a n i m a l s , unc-54 c o d e s f o r m y o s i n h e a v y c h a i n A a n d i s e x p r e s s e d i n b o d y w a l l a n d v u l v a l m u s c l e s . T r a n s g e n i c unc-54: : G F P a n i m a l s e x p r e s s G F P s t r o n g l y i n t h e f o u r b a n d s o f b o d y w a l l m u s c l e t h a t r u n f r o m t h e n o s e t o t h e t a i l , a n d i n t h e v u l v a l m u s c l e s . G F P e x p r e s s i o n c a n b e v i s u a l i z e d w h e n a n i m a l s a r e e x a m i n e d u n d e r 4 8 8 n m l i g h t . A n u m b e r o f i n d i v i d u a l s w e r e i n j e c t e d a n d t h e F l p r o g e n y w e r e e x a m i n e d f o r G F P e x p r e s s i o n . F r o m a t o t a l o f 2 7 0 F l r o l l e r p r o g e n y , 9 7 % i n h i b i t i o n o f G F P e x p r e s s i o n w a s o b s e r v e d i n b o d y w a l l a n d v u l v a l m u s c l e s . E i g h t i n d i v i d u a l s d i d e x p r e s s unc-54::GFP. T h e s e a n i m a l s w e r e f r o m B r o o d A a n d w e r e a m o n g t h e o l d e s t p r o g e n y , s u g g e s t i n g t h a t e g g s h e l l f o r m a t i o n h a d o c c u r r e d p r i o r t o g e r m l i n e u p t a k e o f d s R N A . T h u s , t h e b l o c k i n unc-54::GF¥ p r o t e i n e x p r e s s i o n u s i n g d s R N A w a s n e a r 1 0 0 % f o r p r o g e n y p r o d u c e d a r o u n d 6 h o u r s p o s t - i n j e c t i o n . 4.2 RNA interference using ubc-2 T o i d e n t i f y t h e p u t a t i v e n u l l p h e n o t y p e o f ubc-2, d s R N A i n t e r f e r e n c e o f ubc-2 w a s p e r f o r m e d . D o u b l e - s t r a n d e d R N A w a s s y n t h e s i z e d t o t h e c o m p l e t e c o d i n g s e q u e n c e o f ubc-2, i n j e c t e d i n t o t h e g o n a d o f y o u n g a d u l t N 2 a n i m a l s a n d t h e d e v e l o p m e n t o f t h e F l p r o g e n y w a s m o n i t o r e d . T a b l e 2 s u m m a r i z e s t h e r e s u l t s o f t h e ubc-2 R N A i n t e r f e r e n c e e x p e r i m e n t s . O f 2 8 5 F l p r o g e n y , 1 4 6 ( 5 1 % ) a r r e s t e d s o o n a f t e r g a s t r u l a t i o n i n t h e p r e - c o m m a sta g e , as 65 d e t e r m i n e d b y D A P I s t a i n i n g . O f t h e a n i m a l s t h a t h a t c h e d , 9 0 ( 3 2 % o f t h e t o t a l ) a r r e s t e d as L 3 l a r v a e . T h e L 3 a r r e s t e d l a r v a e h a d a p h e n o t y p e s i m i l a r t o a r r e s t e d let-70 m u t a n t s : t h e y w e r e t h i n , w i t h s m a l l i r r e g u l a r l y s h a p e d i n t e s t i n a l c e l l s t h a t l a c k e d a m i c r o v i l l u s a n d h a d v e r y f e w g u t g r a n u l e s ( F i g u r e 11). T h e i n t e s t i n a l c e l l s g e n e r a l l y r e m a i n e d a t t a c h e d t o t h e b a s e m e n t m e m b r a n e , r e s u l t i n g i n a n e n l a r g e d i n t e s t i n a l l u m e n . S o m e i n d i v i d u a l s w e r e o b s e r v e d w i t h i n t e s t i n a l c e l l s t h a t h a d d e t a c h e d f r o m t h e b a s e m e n t m e m b r a n e . A b o u t 1 7 % o f t h e a n i m a l s d e v e l o p e d i n t o a d u l t s w i t h n o o b v i o u s m u t a n t p h e n o t y p e . A l l a n i m a l s t h a t d e v e l o p e d i n t o n o r m a l a d u l t s w e r e f r o m B r o o d A . It i s l i k e l y t h a t t h e s e i n d i v i d u a l s d i d n o t r e c e i v e d s R N A f r o m t h e i n j e c t e d p a r e n t b e f o r e e g g s h e l l f o r m a t i o n a n d t h u s , w e r e n o t s u b j e c t t o R N A i n t e r f e r e n c e . T h e s e r e s u l t s s u g g e s t t h a t let-70 n u l l m u t a n t s a r e l i k e l y t o r e q u i r e m a t e r n a l U B C - 2 , a n d w i t h o u t it t h e y a r e e m b r y o n i c l e t h a l . T h e L 3 a r r e s t p h e n o t y p e a p p e a r s t o b e c a u s e d b y a r e d u c t i o n i n U B C - 2 l e v e l s . A l t e r n a t i v e l y , it m a y b e t h e n u l l p h e n o t y p e o f a n i m a l s t h a t r e v i e v e a m a t e r n a l c o n t r i b u t i o n o f U B C - 2 . B o t h o f t h e let-70 m u t a t i o n s t h a t h a v e b e e n i s o l a t e d t o d a t e h a v e L 3 a r r e s t p h e n o t y p e s , i n d i c a t i n g t h a t let-70(sl 132) a n d let-70(s689) a r e p r o b a b l y r e d u c t i o n - o f - f u n c t i o n m u t a n t s o r g e n e t i c n u l l s . T o d e t e r m i n e w h e t h e r t h e let-70 m u t a t i o n s f u n c t i o n as n u l l a l l e l e s , h e m i z y g o u s a n i m a l s w e r e p r o d u c e d b y p l a c i n g let-70(sl 132) a n d let-70(s689) o v e r t w o d e f i c i e n c i e s w h i c h u n c o v e r let-70, mDf7 a n d sDf80. T h e s e c r o s s e s w e r e p e r f o r m e d b y J. S c h e i n i n t h e l a b o r a t o r y o f D . L . B a i l l i e . T h e t e r m i n a l p h e n o t y p e o f b o t h h e m i z y g o u s s t r a i n s w a s L 3 l e t h a l , w h i c h s u p p o r t e d t h e h y p o t h e s i s t h a t b o t h c o u l d b e a n u l l a l l e l e o f let-70. Table 2. Effect of ubc-2 dsRNA interference on C. elegans development Total Embryonic Lethal L 3 Lethal Adult1 2 8 5 1 4 6 9 0 4 9 a l l a n i m a l s f r o m B r o o d A 5. NON-COMPLEMENTA TION SCREEN FOR NEW let- 70 ALLELES I n f o r m a t i o n r e g a r d i n g t h e s t r u c t u r e a n d f u n c t i o n o f a p a r t i c u l a r g e n e c a n b e o b t a i n e d f r o m t h e m o l e c u l a r c h a r a c t e r i z a t i o n o f m u t a n t a l l e l e s o f t h e g e n e o f i n t e r e s t . A n u l l a l l e l e c a n b e p a r t i c u l a r l y u s e f u l i n D N A - m e d i a t e d t r a n s f o r m a t i o n e x p e r i m e n t s , a n d i n s u p p r e s s o r s c r e e n s t o i s o l a t e g e n e s w i t h i n a p a r t i c u l a r p a t h w a y . I n a n e f f o r t t o i s o l a t e a n u l l a l l e l e o f let-70, a n o n -c o m p l e m e n t a t i o n s c r e e n w a s u n d e r t a k e n . A n u m b e r o f u n i d e n t i f i e d l e t h a l m u t a n t s t h a t m a p p e d 66 Figure 11. The RNA interference phenotype is larval arrest. A) let-70(s689) L2 animal with an enlarged intestinal lumen (lu). B) L1-L2 progeny of a wild type worm injected with double stranded RNA directed to the coding region of ubc-2. Note the enlarged intestinal lumen anteriorly. Scale bar indicates 10 microns. 67 68 t o w i t h i n 1 m a p u n i t ( m u ) o f unc-22 w e r e s c r e e n e d f o r c o m p l e m e n t a t i o n t o let-70(s689). M u t a t i o n s t h a t d i d n o t c o m p l e m e n t let-70(s689) w e r e t h e n t e s t e d f o r c o m p l e m e n t a t i o n t o let-70(sll32). T h e t e r m i n a l p h e n o t y p e o f t h e m u t a t i o n w a s d e t e r m i n e d b y m i c r o s c o p i c a n a l y s i s a n d i m m u n o f l u o r e s c e n t s t a i n i n g w i t h a n t i - U B C - 2 a n t i b o d i e s a n d t h e m o n o c l o n a l a n t i b o d y D M 5.6, w h i c h s t a i n s m y o s i n h e a v y c h a i n A . T h e m o l e c u l a r n a t u r e o f t h e n o n -c o m p l e m e n t i n g m u t a t i o n w a s t h e n d e t e r m i n e d b y P C R a m p l i f i c a t i o n o f ubc-2 a n d s u r r o u n d i n g s e q u e n c e s . '/" A t o t a l o f 183 l e t h a l m u t a n t s w e r e s c r e e n e d f o r c o m p l e m e n t a t i o n t o let-70(s689) as d e s c r i b e d i n S e c t i o n II.2.5. O n l y o n e s t r a i n , let-x(s2293) unc-22 lev-l/nTl(IV);+MTl(V), f a i l e d t o c o m p l e m e n t t h e let-70(s689) m u t a t i o n . I n a d d i t i o n , let-x(s2293) a l s o f a i l e d t o c o m p l e m e n t let-70(sll32). I n b o t h i n s t a n c e s , let-x(s2293)llet-70 a n i m a l s w e r e L 3 l e t h a l . T h e m u t a n t let-x(s2293) s t r a i n w a s o u t c r o s s e d s e v e n t i m e s a n d r e b a l a n c e d o v e r nTl p r i o r t o f u r t h e r a n a l y s i s . 5.1 Genetic characterization of let-x(s2293) T h e t e r m i n a l p h e n o t y p e o f let-x(s2293) h o m o z y g o t e s w a s e m b r y o n i c l e t h a l i t y . E m b r y o s p e r s i s t e d i n t h e a r r e s t e d state f o r 4-5 d a y s b e f o r e d y i n g . T o i d e n t i f y t h e e m b r y o n i c a r r e s t s t a g e m o r e s p e c i f i c a l l y , let-x(s2293) e m b r y o s w e r e e x a m i n e d b y N o m a r s k i o p t i c s , D A P I s t a i n i n g a n d i m m u n o f l u o r e s c e n t s t a i n i n g w i t h a n t i - U B C - 2 a n d m A b D M 5 . 6 . B y D A P I s t a i n i n g , m o r e t h a n 5 0 0 n u c l e i w e r e p r e s e n t i n a r r e s t e d e m b r y o s , a l t h o u g h t h e r e w a s n o i n d i c a t i o n o f e m b r y o e l o n g a t i o n . T h i s s u g g e s t e d t h a t let-x(s2293) e m b r y o s a r r e s t e d b e t w e e n 3 0 0 a n d 4 2 0 m i n u t e s a f t e r f e r t i l i z a t i o n . I m m u n o s t a i n i n g i n d i c a t e d t h a t v e r y l i t t l e o r n o U B C - 2 w a s p r e s e n t i n let-x(s2293) m u t a n t e m b r y o s ( F i g u r e 12). D M 5 . 6 i m m u n o s t a i n i n g s h o w e d t h a t m y o s i n h a d f o r m e d i n t o d i s t i n c t filamentous b a n d s a n d h a d t h e a p p e a r a n c e o f m y o s i n b a n d s t h a t a r e g e n e r a l l y s e e n i n e m b r y o s b e t w e e n 4 2 0 a n d 4 5 0 m i n u t e s a f t e r first c l e a v a g e . H o w e v e r , as s h o w n i n F i g u r e 12, t h e b o d y w a l l m u s c l e b a n d s w e r e e x t r e m e l y d i s o r g a n i z e d . T h e y d i d n o t f o r m a c o n t i n u o u s b a n d f r o m a n t e r i o r t o p o s t e r i o r . T h e r e w e r e g a p s i n s e v e r a l p l a c e s a l o n g t h e m u s c l e b a n d a n d t h e filaments h a d a t h i c k , c l u m p e d a p p e a r a n c e . T h e f o u r s e t s o f b o d y w a l l m u s c l e b a n d s h a d f o r m e d b u t w e r e d i s o r g a n i z e d a n d a p p e a r e d t o b e c o n c e n t r a t e d a l o n g o n e s u r f a c e o f t h e a n i m a l r a t h e r t h a n b e i n g e q u a l l y s p a c e d i n f o u r q u a d r a n t s . T h u s , t h e let-x(s2293) m u t a t i o n a f f e c t s t h e f o r m a t i o n a n d t h e p o s i t i o n i n g o r a t t a c h m e n t o f b o d y w a l l m u s c l e d u r i n g e m b r y o n i c d e v e l o p m e n t . B a s e d o n t h e a p p e a r a n c e o f t h e m y o s i n filaments, let-x(s2293) e m b r y o s a p p e a r 69 Figure 12. Iet-x(s2293) arrested embryos do not express UBC-2 and display severe muscle developmental defects. E m b r y o s w e r e v i s u a l i z e d b y l a s e r s c a n n i n g c o n f o c a l m i c r o s c o p y . W i l d t y p e ( p a n e l s A a n d a) a n d let-x(s2293) ( p a n e l s B a n d b ) e m b r y o s w e r e d o u b l e - l a b e l l e d w i t h a n t i - U B C - 2 ( g r e e n , F I T C ) a n d D M 5 . 6 ( r e d , T R S C ) w h i c h r e c o g n i z e s m y o s i n h e a v y c h a i n A . P a n e l s A a n d B s h o w t h e l a t e r a l v i e w o f a o n e a n d a h a l f - f o l d e m b r y o (-420 min.). I n p a n e l B , n o t e t h e a b s e n c e o f U B C - 2 s t a i n i n g a n d t h e h i g h l y d i s o r g a n i z e d m u s c l e . T h e l i n e s i n p a n e l s A a n d B i n d i c a t e t h e l o c a t i o n w h e r e c r o s s - s e c t i o n s o f t h e T R S C c h a n n e l w e r e t a k e n ( p a n e l s a a n d b). I n p a n e l a, t h e f o u r q u a d r a n t s o f m y o s i n s t a i n i n g a r e a s s o c i a t e d w i t h t h e b a n d s o f b o d y w a l l m u s c l e . I n p a n e l b, n o t e t h e d i s p l a c e m e n t o f t h e m u s c l e b a n d s . S c a l e b a r i n d i c a t e s 10 m i c r o n s . 70 7] t o a r r e s t b e t w e e n 4 2 0 a n d 4 5 0 m i n u t e s ( c o m m a t o 1 Vz f o l d s t a g e s ) , b u t d o n o t u n d e r g o e m b r y o n i c e l o n g a t i o n . T h e e f f e c t i v e l e t h a l s t a g e o f let-x(s2293) a n i m a l s w a s e m b r y o n i c , a n d t h a t o f t h e let-70 a l l e l e s w a s L 3 . S i n c e let-x(s2293)llet-70 a n i m a l s w e r e L 3 l e t h a l , it w a s p o s s i b l e t h a t let-x(s2293) m i g h t b e a n u l l a l l e l e o f let-70, w h i l e let-70(sl 132) a n d let-70(s689) w e r e r e d u c t i o n o f f u n c t i o n a l l e l e s . T o e x a m i n e t h e p o s s i b i l i t y t h a t let-x(s2293) w a s a n u l l a l l e l e o f let-70, h e m i z y g o u s a n i m a l s w e r e p r o d u c e d b y p l a c i n g let-x(s2293) o v e r t w o d e f i c i e n c i e s w h i c h u n c o v e r let-70, mD/7 a n d sD/80. T h e s e c r o s s e s w e r e p e r f o r m e d b y J. S c h e i n i n t h e l a b o r a t o r y o f D . L . B a i l l i e . T h e t e r m i n a l p h e n o t y p e o f b o t h h e m i z y g o u s s t r a i n s w a s e m b r y o n i c l e t h a l , w h i c h s u p p o r t e d t h e h y p o t h e s i s t h a t let-x(s2293) c o u l d b e a n u l l a l l e l e o f let-70. A s a c o n t r o l , let-x(s2293) w a s p l a c e d o v e r t h e d e f i c i e n c y nD/27, w h i c h d o e s n o t u n c o v e r let-70. I f let-x(s2293) w e r e a n a l l e l e o f let-70, t h e n t h e m u t a t i o n w o u l d n o t b e u n c o v e r e d b y nD/27 a n d h e m i z y g o u s a n i m a l s w o u l d b e w i l d t y p e . I n t e r e s t i n g l y , t h e t e r m i n a l p h e n o t y p e o f t h i s s t r a i n w a s a l s o e m b r y o n i c l e t h a l , r a i s i n g t h e p o s s i b i l i t y t h a t let-x(s2293) w a s a l a r g e d e l e t i o n e n c o m p a s s i n g t h e r e g i o n f r o m let-70 t o t h a t u n c o v e r e d b y nD/27. A l t e r n a t i v e l y , a s e c o n d m u t a t i o n m i g h t e x i s t i n t h e let-x(s2293) s t r a i n t h a t i s l o c a t e d w i t h i n t h e r e g i o n u n c o v e r e d b y nD/27. It w a s p o s s i b l e t h a t a s e c o n d m u t a t i o n w a s p r e s e n t a n d h a d n o t b e e n r e m o v e d b y o u t c r o s s i n g t h e let-x(s2293) s t r a i n . T h e e m b r y o n i c l e t h a l i t y o f let-x(s2293) m i g h t t h e n b e d u e t o t h e s e c o n d s i t e m u t a t i o n , o r a c o m b i n a t i o n o f b o t h m u t a t i o n s . 5.2 The let-x(s2293) mutation is a large deletion T o d e t e r m i n e t h e m o l e c u l a r n a t u r e o f t h e let-x(s2293) m u t a t i o n , P C R a m p l i f i c a t i o n o f ubc-2 w a s p e r f o r m e d o n s i n g l e let-x(s2293) e m b r y o s . F o r t h i s e x p e r i m e n t , o l i g o n u c l e o t i d e p r i m e r s O Z M 3 . f a n d M e i 20-5.r w e r e u s e d t o a m p l i f y ubc-2. T h e l o c a t i o n o f t h e s e p r i m e r s o n t h e ubc-2 g e n o m i c s e q u e n c e a r e s h o w n i n F i g u r e 1 3 A . A s a n i n t e r n a l p o s i t i v e c o n t r o l , t h e p r i m e r s M I C 1 2 . f a n d M I C 1 4 . r , w h i c h a m p l i f y a p o r t i o n o f t h e cct-1 g e n e , w e r e i n c l u d e d i n t h e r e a c t i o n . A t t e m p t s t o a m p l i f y ubc-2 f r o m m u t a n t e m b r y o s f a i l e d t o p r o d u c e a P C R p r o d u c t ; h o w e v e r , t h e i n t e r n a l cct-1 c o n t r o l p r o d u c t w a s c o n s i s t e n t l y a m p l i f i e d ( F i g u r e 1 3 B ) . T h e let-x(s2293) m u t a t i o n a f f e c t e d t h e a b i l i t y o f at l e a s t o n e o f t h e p r i m e r p a i r s t o a n n e a l t o t h e c o r r e s p o n d i n g g e n o m i c s e q u e n c e . P C R r e a c t i o n s w e r e t h e n r u n u s i n g o t h e r p r i m e r s i n c o m b i n a t i o n w i t h O Z M 3 . f a n d M e i 20-5.r. T a b l e 3 l i s t s a l l p r i m e r p a i r c o m b i n a t i o n s t e s t e d f o r a m p l i f i c a t i o n o f ubc-2, a n d t h e r e s u l t s o b t a i n e d f o r w i l d t y p e a n d let-x(s2293) a r r e s t e d 72 Figure 13. Iet-x(s2293) is a large deletion that removes ubc-2 and several other genes. P C R a m p l i f i c a t i o n o f D N A f r o m w i l d t y p e a n d d u p l i c a t e s a m p l e s o f let-x(s2293) e m b r y o s as d e s c r i b e d i n M a t e r i a l s a n d M e t h o d s . F o r t h e (-) c o n t r o l , n o D N A w a s a d d e d t o t h e r e a c t i o n . A ) S c h e m a t i c o f g e n o m i c r e g i o n s u r r o u n d i n g u b c - 2 gen e . C o d i n g r e g i o n s a r e s h o w n as b o x e s a n d n o n - c o d i n g r e g i o n s as l i n e s . P r i m e r s u s e d f o r P C R r e a c t i o n s o f ubc-2 a r e i n d i c a t e d , w i t h t h o s e t h a t b i n d t o t h e c o m p l e m e n t a r y s t r a n d l o c a t e d a b o v e t h e l i n e a n d t h o s e t h a t b i n d t o t h e s e n s e s t r a n d l o c a t e d b e l o w t h e l i n e . B ) ubc-2 a n d cct-1 w e r e a m p l i f i e d f r o m s i n g l e e m b r y o s . P r i m e r s O Z M 3 . f a n d M e i 20-5.r w e r e u s e d t o a m p l i f y a 6 7 2 b p ubc-2 f r a g m e n t . A s a n i n t e r n a l c o n t r o l , a 1 0 2 5 b p f r a g m e n t o f t h e cct-1 g e n e w a s a l s o a m p l i f i e d u s i n g p r i m e r s M I C 1 2 . f a n d M I C 1 4 . r . C ) A 3.6 k b f r a g m e n t t h a t i n c l u d e s ubc-2 w a s a m p l i f i e d f r o m a p o o l o f 2-3 e m b r y o s u s i n g p r i m e r s T S l . f a n d T S 2 . r . T h e unc-52 c o n t r o l r e a c t i o n w a s r u n o n s e p a r a t e p o o l s o f e m b r y o s . P r i m e r s p 2 3 a n d p i 50-3 w e r e u s e d t o a m p l i f y a 4.7 k b f r a g m e n t o f unc-52. D ) P C R a m p l i f i c a t i o n o f a 7 4 3 b p f r a g m e n t o f M 7 . 7 f r o m s i n g l e e m b r y o s u s i n g M 7 . 7 . f a n d M 7 . 7.r p r i m e r s . S e e A p p e n d i x C f o r p r i m e r s e q u e n c e s . 73 A MEI20-1 0ZM3 MEI20-2 MEI20-4 0ZM2 MEI20-5 B cct-1 -> ubc-2 -» N W ,vO k f r k / r ubc-2 unc-52 -» 74 e m b r y o s . T h e l o c a t i o n o f e a c h p r i m e r o n t h e ubc-2 g e n o m i c s e q u e n c e i s i l l u s t r a t e d i n F i g u r e 1 3 A . P C R p r o d u c t s w e r e o b t a i n e d f r o m w i l d t y p e e m b r y o s u s i n g a l l p r i m e r p a i r c o m b i n a t i o n s , w h i l e n o wZ>c-2-directed P C R p r o d u c t s w e r e a m p l i f i e d f r o m let-x(s2293) a r r e s t e d e m b r y o s . S i n c e ubc-2 c o u l d n o t b e a m p l i f i e d i n let-x(s2293) e m b r y o s , r e g a r d l e s s o f t h e o l i g o n u c l e o t i d e s u s e d , it w a s t e m p t i n g t o s p e c u l a t e t h a t ubc-2 w a s d e l e t e d i n t h e let-x(s2293) s t r a i n . T o t e s t t h i s p o s s i b i l i t y , l o n g d i s t a n c e P C R w a s p e r f o r m e d u s i n g o l i g o n u c l e o t i d e s T S l . f a n d T S 2 . r , w h i c h w e r e d i r e c t e d t o s e q u e n c e s a p p r o x i m a t e l y 1 5 0 0 b p u p s t r e a m a n d d o w n s t r e a m o f ubc-2, r e s p e c t i v e l y . W h i l e t h e 3.6 k b f r a g m e n t w a s a m p l i f i e d i n w i l d t y p e e m b r y o s , n o P C R p r o d u c t w a s o b t a i n e d f r o m let-x(s2293) a r r e s t e d e m b r y o s ( F i g u r e 1 3 C ) . H o w e v e r , a 4.7 k b f r a g m e n t o f t h e unc-52 g e n e w a s p r o d u c e d f r o m b o t h w i l d t y p e a n d m u t a n t e m b r y o s . T h i s i n f o r m a t i o n f u r t h e r s u p p o r t e d t h e i d e a t h a t ubc-2 w a s d e l e t e d i n let-x(s2293) m u t a n t a n i m a l s . It a l s o s u g g e s t e d t h a t t h e d e l e t i o n e x t e n d e d i n t o a r e g i o n o f f l a n k i n g s e q u e n c e , p r e v e n t i n g at l e a s t o n e o f t h e T S p r i m e r s f r o m a n n e a l i n g t o i t s c o r r e s p o n d i n g g e n o m i c s e q u e n c e . Table 3. Primer pair combinations used to amplify ubc-2 in wild type and let-x(s2293) embryos Primer combinations PCR product obtained forward reverse wild type let-x(s2293) O Z M 3 . f M E I 2 0 - 5 . r Y e s N o O Z M 3 . f O Z M 2 . r Y e s N o O Z M 3 . f M E I 2 0 - 4 . r Y e s •No M E I 2 0 - l . f M E I 2 0 - 5 . r Y e s N o M E I 2 0 - l . f O Z M 2 . r Y e s N o M E I 2 0 - l . f M E I 2 0 - 4 . r Y e s N o M E I 2 0 - 2 . f M E I 2 0 - 5 . r Y e s N o M E I 2 0 - 2 . f O Z M 2 . r Y e s N o S i n c e t h e T S l . f a n d T S 2 . r o l i g o n u c l e o t i d e s w e r e e a c h l o c a t e d a p p r o x i m a t e l y 1.5 k b f r o m t h e ubc-2 g e n o m i c s e q u e n c e , t h e d e l e t i o n i n let-x(s2293) a p p e a r e d t o b e q u i t e e x t e n s i v e , p o s s i b l y e n c o m p a s s i n g s e v e r a l e s s e n t i a l g e n e s . P C R a m p l i f i c a t i o n o f a s e r i n e - t h r e o n i n e k i n a s e g e n e , M7.7, l o c a t e d a p p r o x i m a t e l y 10 k b u p s t r e a m o f ubc-2 t o w a r d s t h e r e g i o n o f nD/27 w a s p e r f o r m e d . A s s h o w n i n F i g u r e 1 3 D , M 7 . 7 w a s n o t a m p l i f i e d i n let-x(s2293) a r r e s t e d e m b r y o s . T h e r e f o r e , t h e d e l e t i o n i n let-70(s2293) e x t e n d s at l e a s t 10 k b u p s t r e a m a n d i n c l u d e s ubc-2 a n d 75 M7.7. S i n c e let-x(s2293) i s a l a r g e d e l e t i o n s p a n n i n g m a n y g e n e s , it c a n n o t b e c o n s i d e r e d a n a l l e l e o f let-70; t h u s let-x(s2293) w a s n o t i n c l u d e d i n a n y f u r t h e r a n a l y s i s o f let-70 i n t h i s s t u d y . 6. IMMUNOFL U ORESCENT STAINING OF WILD TYPE AND let-70 EMBRYOS, LARVAE AND ADULTS T h e e x p r e s s i o n p a t t e r n o f U B C - 2 d u r i n g d e v e l o p m e n t i n w i l d t y p e , unc-22 a n d let-70 m u t a n t a n i m a l s w a s d e t e r m i n e d . T h e let-70 m u t a n t s t a i n i n g p a t t e r n s w e r e c o m p a r e d w i t h t h o s e o f unc-22 m u t a n t s , s i n c e a l l let-70 m u t a n t s w e r e i n a n unc-22 b a c k g r o u n d . E m b r y o s w e r e p r e p a r e d a n d i m m u n o s t a i n e d as d e s c r i b e d i n S e c t i o n II.5.1. L a r v a e a n d a d u l t s w e r e p r e p a r e d b y f r e e z e f r a c t u r e o r b y t h e m e t h o d o f F i n n e y a n d R u v k u n ( 1 9 9 0 ) as d e s c r i b e d i n S e c t i o n II.5.2. A l l a n i m a l s w e r e i m m u n o s t a i n e d w i t h a p o l y c l o n a l a n t i b o d y d i r e c t e d a g a i n s t U B C - 2 . T o a i d i n t h e i d e n t i f i c a t i o n o f c e l l s a n d t i s s u e s , a n i m a l s w e r e c o u n t e r s t a i n e d w i t h a v a r i e t y o f m o n o c l o n a l a n t i b o d i e s ( m A b s ) d i r e c t e d a g a i n s t a n u m b e r o f s p e c i f i c t i s s u e s o r c e l l t y p e s ( s e e S e c t i o n II. 5.2 a n d T a b l e 1). T h e s p e c i f i c i t y o f t h e U B C - 2 p o l y c l o n a l a n t i b o d y w a s d e t e r m i n e d i n w i l d t y p e e m b r y o s . A s s h o w n i n F i g u r e 14, w h e n a n t i - U B C - 2 w a s p r e - i n c u b a t e d w i t h a n e x c e s s o f r e c o m b i n a n t U B C - 2 p r o t e i n p r i o r t o i m m u n o s t a i n i n g , v i r t u a l l y n o s t a i n i n g o f t h e e m b r y o s c o u l d b e d e t e c t e d . I n a d d i t i o n , w h e n C. elegans p r o t e i n e x t r a c t w a s p r o b e d w i t h a n t i - U B C - 2 o n a W e s t e r n b l o t , o n l y o n e b a n d at 16.7 k D a w a s o b s e r v e d ( d a t a n o t s h o w n ) . T h i s d e m o n s t r a t e d t h a t a n t i - U B C - 2 w a s s p e c i f i c f o r U B C - 2 i n C. elegans. 6.1 UBC-2 staining in embryos E m b r y o s w e r e i s o l a t e d a n d i m m u n o s t a i n e d as d e s c r i b e d i n S e c t i o n II. 5. T o e x a m i n e t h e U B C - 2 s t a i n i n g p a t t e r n d u r i n g e a r l y d e v e l o p m e n t , e m b r y o s w e r e i m m u n o s t a i n e d w i t h a n t i -U B C - 2 a n d c o u n t e r s t a i n e d w i t h m A b s K 7 6 , C 4 a n d a n t i - d o u b l e s t r a n d e d D N A , w h i c h s t a i n P gr a n u l e s , a c t i n a n d D N A , r e s p e c t i v e l y . P g r a n u l e s a r e l o c a t e d i n t h e P c e l l l i n e a g e d u r i n g e a r l y c l e a v a g e ; t h u s , K 7 6 o r i e n t e d t h e e m b r y o s b y i d e n t i f i c a t i o n o f t h e p o s t e r i o r e nd. T h e C 4 a n t i b o d y s t a i n e d t h e a c t i n c y t o s k e l e t o n o f c e l l s a n d w a s u s e f u l f o r d e l i n e a t i n g t h e b o r d e r s o f i n d i v i d u a l c e l l s , a n d a n t i - D N A l o c a l i z e d t h e n u c l e u s o f e a c h c e l l . T h e s e a n t i b o d i e s w e r e u t i l i z e d f o r e x a m i n a t i o n o f t h e U B C - 2 s t a i n i n g p a t t e r n i n e a r l y e m b r y o s u p t o t h e c o m m a stage. U B C - 2 s t a i n i n g w a s o b s e r v e d i n w i l d t y p e a n d unc-22 e m b r y o s f r o m f e r t i l i z a t i o n a n d s h o w e d a t i s s u e g e n e r a l U B C - 2 s t a i n i n g p a t t e r n . U B C - 2 s t a i n i n g d i d n o t l o c a l i z e t o a n y s p e c i f i c c e l l u l a r r e g i o n ; r a t h e r , i t w a s f a i r l y u n i f o r m i n a l l c e l l s t h r o u g h o u t t h e e m b r y o . T h e d i s t r i b u t i o n a n d 76 Figure 14. The immunolocalization of anti-UBC-2 is UBC-2-specific. L a s e r s c a n n i n g c o n f o c a l m i c r o s c o p y o f w i l d t y p e e m b r y o s d o u b l e - l a b e l l e d w i t h a n t i - U B C - 2 ( g r e e n , F I T C ) a n d D M 5 . 6 ( m y o s i n h e a v y c h a i n A ; r e d , T R S C ) . P a n e l s A a n d B s h o w t h e l a t e r a l v i e w o f a o n e a n d a h a l f - f o l d e m b r y o (-420 m i n ) . I n p a n e l B , a n t i - U B C - 2 w a s p r e - i n c u b a t e d w i t h r e c o m b i n a n t U B C - 2 p r i o r t o i m m u n o s t a i n i n g . S c a l e b a r i n d i c a t e s 10 m i c r o n s . 77 78 i n t e n s i t y o f s t a i n i n g i n b o t h let-70(sll32) a n d let-70(s689) e a r l y e m b r y o s w a s s i m i l a r t o t h a t o b s e r v e d i n w i l d t y p e a n d unc-22 e m b r y o s ( d a t a n o t s h o w n ) . E m b r y o s b e t w e e n 1.5 a n d 3 - f o l d s t a g e o f d e v e l o p m e n t w e r e s t a i n e d w i t h a n t i - U B C - 2 a n d c o u n t e r s t a i n e d w i t h m A b s D M 5.6, 1 C B 4 o r C 4 . D M 5.6 r e c o g n i z e s m y o s i n h e a v y c h a i n A i n b o d y w a l l m u s c l e a n d 1 C B 4 r e c o g n i z e s i n t e s t i n a l c e l l s , s p e r m a n d s e v e r a l s e n s o r y n e u r o n s . I n w i l d t y p e a n d unc-22 e m b r y o s , U B C - 2 s t a i n e d a l m o s t a l l c e l l s u n i f o r m l y ( F i g u r e 1 5 A ) . M o r e i n t e n s e U B C - 2 s t a i n i n g w a s s o m e t i m e s o b s e r v e d i n t h e t w o g o n a d p r i m o r d i a c e l l s , Z 2 a n d Z 3 , s u g g e s t i n g t h a t U B C - 2 e x p r e s s i o n i s e n h a n c e d i n t h e g o n a d p r e c u r s o r c e l l s o f d e v e l o p i n g e m b r y o s ( d a t a n o t s h o w n ) . I n m u t a n t let-70(sl 132) e m b r y o s , U B C - 2 s t a i n i n g w a s u b i q u i t o u s , a l t h o u g h t h e r e w a s a n o t i c e a b l e d e c r e a s e i n o v e r a l l s t a i n i n g i n t e n s i t y ( F i g u r e 1 5 B ) . A n i n c r e a s e i n t h e i n t e n s i t y o f U B C - 2 s t a i n i n g i n t h e g o n a d p r i m o r d i a c e l l s i n a m a n n e r s i m i l a r t o t h a t o b s e r v e d i n w i l d t y p e a n d unc-22 e m b r y o s w a s o f t e n seen. E x a m i n a t i o n o f b o d y w a l l m u s c l e a n d i n t e s t i n a l d e v e l o p m e n t u s i n g D M 5.6 a n d 1 C B 4 r e v e a l e d n o o b v i o u s d e v e l o p m e n t a l d e f e c t s i n let-70(sll32) m u t a n t e m b r y o s . T h u s , t h e e m b r y o n i c d e v e l o p m e n t o f let-70(sl 132) e m b r y o s a p p e a r e d t o b e s i m i l a r t o t h a t o f w i l d t y p e a n d unc-22 e m b r y o s . I n let-70(s689) m u t a n t e m b r y o s , t h e i n t e n s i t y o f U B C - 2 s t a i n i n g v a r i e d f r o m n e a r w i l d t y p e l e v e l s t o v i r t u a l l y n o U B C - 2 s t a i n i n g . I n g e n e r a l , h o w e v e r , t h e o v e r a l l U B C - 2 s t a i n i n g i n t e n s i t y w a s l o w ( F i g u r e 1 5 C ) . I n c r e a s e d s t a i n i n g i n t e n s i t y o f t h e g o n a d p r i m o r d i a c e l l s w a s o b s e r v e d i n m a n y o f t h e m u t a n t e m b r y o s e x a m i n e d . D M 5.6 s t a i n i n g i n d i c a t e d t h a t let-70(s689) m u t a n t e m b r y o s d e v e l o p e d b o d y w a l l m u s c l e d e f e c t s . M y o s i n w a s n o t o r g a n i z e d i n o r d e r e d A - b a n d s w i t h i n t h e m u s c l e c e l l s a n d f o r m e d l a r g e a g g r e g a t e s , s u g g e s t i n g t h a t m u s c l e s a r c o m e r e a s s e m b l y w a s d e f e c t i v e . T h e f o u r m u s c l e q u a d r a n t s w e r e n o t c o n t i n u o u s f r o m a n t e r i o r t o p o s t e r i o r a n d t h e r e w e r e r e g i o n s w h e r e m y o s i n A - b a n d s w e r e a b s e n t , w h i c h i n d i c a t e d t h a t s o m e m u s c l e c e l l s w e r e p o s i t i o n e d i n c o r r e c t l y o r d i d n o t p r o p e r l y a s s e m b l e t h e m y o s i n A - b a n d s ( F i g u r e 15c, d). I n s t r o n g l y a f f e c t e d e m b r y o s , t h e m u s c l e b a n d s w e r e n o t p r o p e r l y l o c a t e d i n t h e f o u r q u a d r a n t s , a n d o n e o r m o r e o f t h e b a n d s w a s d i s p l a c e d i n t o a n o t h e r q u a d r a n t , o r m i s s i n g a l t o g e t h e r . T h i s d i s p l a c e m e n t o f t e n a f f e c t e d o n l y t h e d o r s a l b a n d s o f m u s c l e . T h u s , m u s c l e c e l l a t t a c h m e n t w a s a f f e c t e d i n t h e s e m u t a n t s . T h e d i s o r g a n i z e d m u s c l e p h e n o t y p e w a s first o b s e r v e d i n 1.5 f o l d e m b r y o s a n d c o n t i n u e d t h r o u g h o u t d e v e l o p m e n t . T h e m u s c l e d e f e c t s s u g g e s t e d t h a t s a r c o m e r e a s s e m b l y , m u s c l e c e l l p o s i t i o n i n g a n d m u s c l e c e l l a t t a c h m e n t w e r e a l l a f f e c t e d i n let-70(s689) m u t a n t e m b r y o s . 79 Figure 15. Immunolocalization of UBC-2 in wild type and let-70 mutant embryos. L a s e r s c a n n i n g c o n f o c a l m i c r o s c o p y o f e m b r y o s w e r e d o u b l e - l a b e l l e d w i t h a n t i - U B C - 2 ( g r e e n , F I T C ) a n d D M 5 . 6 ( m y o s i n h e a v y c h a i n A ; r e d , T R S C ) . P a n e l s A , B a n d C s h o w t h e l a t e r a l v i e w o f a o n e a n d a h a l f - f o l d e m b r y o (-420 min.). A ) W i l d t y p e e m b r y o , a) T R S C c h a n n e l i m a g e o f a c r o s s - s e c t i o n o f w i l d t y p e e m b r y o t a k e n at l i n e a i n p a n e l A t o s h o w t h e f o u r q u a d r a n t s o f m y o s i n s t a i n i n g t h a t a r e a s s o c i a t e d w i t h t h e b a n d s o f b o d y w a l l m u s c l e . D o r s a l i s t o w a r d s t o t o p o f t h e p a n e l . B ) let-70(sl 132) e m b r y o . N o t e t h e r e d u c t i o n i n U B C - 2 s t a i n i n g i n t e n s i t y , b ) T R S C c h a n n e l i m a g e o f a c r o s s - s e c t i o n o f let-70(sl 132) e m b r y o t a k e n at l i n e b i n p a n e l B . C ) let-70(s689) e m b r y o . N o t e t h e r e d u c t i o n i n U B C - 2 s t a i n i n g i n t e n s i t y a n d t h e h i g h l y d i s o r g a n i z e d m u s c l e , c ) T R S C c h a n n e l i m a g e o f a c r o s s s e c t i o n o f let-70(s689) e m b r y o t a k e n at l i n e c i n d i c a t e d i n p a n e l C. N o t e t h a t t h e m u s c l e c e l l i n t h e r i g h t v e n t r a l q u a d r a n t i s m i s s i n g , d ) C r o s s s e c t i o n o f let-70(s689) e m b r y o t a k e n at l i n e d i n d i c a t e d i n p a n e l C. N o t e t h a t b o t h t h e r i g h t d o r s a l a n d v e n t r a l m u s c l e c e l l s a r e m i s s i n g . S c a l e b a r i n d i c a t e s 10 m i c r o n s . 80 S I 6.2 UBC-2 staining in larvae and adults W i l d t y p e a n d unc-22 L I l a r v a e e x h i b i t e d l o w l e v e l s o f U B C - 2 s t a i n i n g i n a l m o s t a l l c e l l s a n d t i s s u e s . T h e i n t e n s i t y o f s t a i n i n g w a s s l i g h t l y h i g h e r i n t h e d e v e l o p i n g g o n a d . T h i s p a t t e r n r e s e m b l e d t h a t d e s c r i b e d f o r e m b r y o s . T h e l o w l e v e l o f U B C - 2 s t a i n i n g i n a l l c e l l s a n d t i s s u e s w a s o b s e r v e d t h r o u g h o u t d e v e l o p m e n t . T h e s p e c i f i c s t a i n i n g p a t t e r n s d e s c r i b e d b e l o w w e r e o b s e r v e d a s a n i n c r e a s e i n s t a i n i n g i n t e n s i t y a b o v e t h i s o v e r a l l b a c k g r o u n d l e v e l . I n L 2 l a r v a e , a c h a n g e i n t h e c e l l u l a r d i s t r i b u t i o n o f U B C - 2 w a s o b s e r v e d . A d r a m a t i c i n c r e a s e i n s t a i n i n g i n t e n s i t y w a s s e e n i n t h e n u c l e o l i o f a n u m b e r o f c e l l t y p e s , i n c l u d i n g h y p o d e r m a l , i n t e s t i n a l a n d b o d y w a l l m u s c l e c e l l s ( F i g u r e 1 6 B , C ) . T h e s t r o n g n u c l e o l a r e x p r e s s i o n o f U B C - 2 i n t h e s e c e l l t y p e s c o n t i n u e d t h r o u g h o u t d e v e l o p m e n t . A t L 3 , t h e n u c l e o l i o f s e v e r a l a d d i t i o n a l c e l l t y p e s e x h i b i t e d i n c r e a s e d U B C - 2 e x p r e s s i o n , i n c l u d i n g t h o s e o f t h e g e r m c e l l s ( F i g u r e 1 6 E , F ) . I n t h e h e a d o f t h e a n i m a l , U B C - 2 e x p r e s s i o n i n c r e a s e d i n t h e n u c l e o l i o f a l l p h a r y n g e a l m u s c l e c e l l s , p h a r y n g e a l n e u r o n s , t h e p h a r y n g e a l - i n t e s t i n a l v a l v e c e l l s , a n d s e v e r a l n e u r o n s l o c a t e d n e a r t h e t e r m i n a l b u l b o f t h e p h a r y n x ( F i g u r e 17). T h e s e n e u r o n s m a y f o r m p a r t o f t h e d o r s a l a n d / o r v e n t r a l n e r v e c o r d s . I n t e r e s t i n g l y , n u c l e o l a r s t a i n i n g o f U B C - 2 w a s c o n s p i c u o u s l y a b s e n t i n m a n y o f t h e n e u r o n s t h a t f o r m p a r t o f t h e n e r v e r i n g ( F i g u r e 1 7 B - D ) . I n s u m m a r y , U B C - 2 w a s e x p r e s s e d at a l o w b a c k g r o u n d l e v e l i n m o s t c e l l s a n d t i s s u e s i n t h e a n i m a l t h r o u g h o u t d e v e l o p m e n t . D u r i n g l a r v a l d e v e l o p m e n t , U B C - 2 l e v e l s i n c r e a s e d i n t h e n u c l e o l i o f a n u m b e r o f s p e c i f i c c e l l t y p e s . T h e s e c e l l t y p e s i n c l u d e d h y p o d e r m a l , i n t e s t i n a l , b o d y w a l l m u s c l e a n d g e r m l i n e . I n t h e l a t e r s t a g e s o f l a r v a l d e v e l o p m e n t , U B C - 2 a l s o b e c a m e c o n c e n t r a t e d i n t h e n u c l e o l i o f p h a r y n g e a l m u s c l e c e l l s , n e u r o n s a s s o c i a t e d w i t h t h e p h a r y n x , t h e p h a r y n g e a l - i n t e s t i n a l v a l v e c e l l s a n d s e v e r a l n e u r o n s n e a r t h e t e r m i n a l b u l b o f t h e p h a r y n x . M u t a n t let-70 l a r v a e w e r e s t a i n e d w i t h a n t i - U B C - 2 t o d e t e r m i n e t h e e x p r e s s i o n p a t t e r n o f t h e m u t a n t f o r m s o f U B C - 2 . T h e m u t a n t l a r v a e w e r e c o u n t e r s t a i n e d w i t h t h e m A b s D M 5.6 a n d 1 C B 4 t o e x a m i n e t i s s u e d e v e l o p m e n t . I n let-70(sl 132) m u t a n t l a r v a e , U B C - 2 l e v e l s w e r e v e r y l o w . T h e e x p r e s s i o n p a t t e r n , h o w e v e r , w a s s i m i l a r t o t h a t o f w i l d t y p e ( F i g u r e 18 A , B ) . T h e o v e r a l l l o w l e v e l o f b a c k g r o u n d s t a i n i n g o f U B C - 2 w a s i n c r e a s e d i n g o n a d p r i m o r d i a c e l l s a n d i n t h e n u c l e o l i o f m u s c l e , h y p o d e r m a l , i n t e s t i n a l a n d g e r m l i n e c e l l s . T h i s p a t t e r n p e r s i s t e d d e s p i t e t h e i n t e s t i n a l d e f e c t s t h a t d e v e l o p e d i n let-70(sl 132) m u t a n t l a r v a e . 82 Figure 16. Immunolocalization of UBC-2 in wild type larvae. L a s e r s c a n n i n g c o n f o c a l m i c r o s c o p y o f l a r v a e d o u b l e - l a b e l l e d w i t h a n t i - U B C - 2 ( g r e e n , F I T C ) a n d a n t i - d o u b l e s t r a n d e d D N A ( r e d , T R S C ) . P a n e l s A - C s h o w a m i d - b o d y s e c t i o n o f a n L 2 l a r v a . A n t e r i o r i s t o w a r d s t h e t o p a n d v e n t r a l i s l e f t . A ) T R S C c h a n n e l i m a g e o f L 2 l a r v a w i t h r e p r e s e n t a t i v e i n t e s t i n e ( i n t ) , h y p o d e r m i s ( h y p ) a n d m u s c l e ( m ) n u c l e i i n d i c a t e d . N o t e t h e a n t i - d o u b l e - s t r a n d e d D N A s t a i n s n u c l e i a n d o f t e n e x c l u d e s n u c l e o l i . B ) F I T C c h a n n e l i m a g e o f a n L 2 l a r v a s h o w i n g U B C - 2 i m m u n o f l u o r e s c e n c e . C ) B o t h c h a n n e l s s h o w n s i m u l t a n e o u s l y . N o t e t h a t t h e U B C - 2 s t a i n i n g p a t t e r n a l i g n s w i t h t h e n u c l e o l i . P a n e l s D - F s h o w a m i d - b o d y s e c t i o n o f t h e d e v e l o p i n g g o n a d o f a n L 4 l a r v a . T h e r e g i o n o f t h e a n i m a l s h o w n i s a 4.4 m i c r o n t h i c k s l i c e t h r o u g h t h e g o n a d . T h e s e c t i o n s o f t h e a n i m a l l o c a t e d a b o v e a n d b e l o w t h i s s l i c e h a v e b e e n r e m o v e d . D ) T R S C c h a n n e l i m a g e o f L 4 l a r v a s h o w i n g t h e d o u b l e - s t r a n d e d D N A s t a i n i n g p a t t e r n . A n t e r i o r i s l e f t a n d v e n t r a l is t o w a r d s t h e b o t t o m . R e p r e s e n t a t i v e m i t o t i c g e r m l i n e ( g l ) a n d m u s c l e ( m ) n u c l e i a r e i n d i c a t e d . E ) F I T C c h a n n e l i m a g e o f L 4 l a r v a s h o w i n g U B C - 2 s t a i n i n g p a t t e r n . F ) B o t h c h a n n e l s s h o w n s i m u l t a n e o u s l y . S c a l e b a r i n d i c a t e s 1 0 m i c r o n s . 83 84 Figure 17. Immunolocalization of UBC-2 in the head region of wild type animals. L a s e r s c a n n i n g c o n f o c a l m i c r o s c o p y o f a n i m a l s d o u b l e - l a b e l l e d w i t h a n t i - U B C - 2 ( g r e e n , F I T C ) a n d a n t i - d o u b l e s t r a n d e d D N A ( r e d , T R S C ) . A a n d E ) T h e h e a d r e g i o n o f w i l d t y p e a d u l t s w i t h b o t h c h a n n e l s s h o w n s i m u l t a n e o u s l y . A n t e r i o r t o le f t . B - D ) C l o s e - u p o f r e g i o n w i t h i n t h e b o x i n p a n e l A , s h o w i n g p a r t o f t h e n e r v e r i n g ( n r ) a n d t h e t e r m i n a l b u l b o f t h e p h a r y n x . T h e r e g i o n o f t h e a n i m a l s h o w n i s a 2.6 m i c r o n t h i c k s l i c e t h r o u g h t h e he a d . T h e s e c t i o n s o f t h e a n i m a l l o c a t e d a b o v e a n d b e l o w t h i s s l i c e h a v e b e e n r e m o v e d . R e p r e s e n t a t i v e p h a r y n x ( p h ) a n d h y p o d e r m a l ( h y p ) n u c l e i a r e i n d i c a t e d . P a n e l B s h o w s t h e T R S C c h a n n e l w i t h t h e d o u b l e -s t r a n d e d D N A s t a i n i n g p a t t e r n . N o t e t h e n u c l e a r s t a i n i n g w h i c h o f t e n e x c l u d e s t h e n u c l e o l u s . P a n e l C s h o w s t h e F I T C c h a n n e l w i t h t h e U B C - 2 s t a i n i n g p a t t e r n . P a n e l D s h o w s b o t h c h a n n e l s s i m u l t a n e o u s l y . N o t e t h a t t h e U B C - 2 s t a i n i n g p a t t e r n a l i g n s w i t h t h e n u c l e o l i o f m a n y c e l l s , b u t d o e s n o t s t a i n n u c l e i o r n u c l e o l i o f n e u r o n s i n t h e n e r v e r i n g . F - G ) C l o s e - u p o f r e g i o n w i t h i n t h e b o x i n p a n e l E , s h o w i n g i s t h m u s a n d t e r m i n a l b u l b o f t h e p h a r y n x , p h a r y n g e a l - i n t e s t i n a l v a l v e a n d p a r t o f t h e i n t e s t i n e . T h e r e g i o n o f t h e a n i m a l s h o w n i s a 2.6 m i c r o n t h i c k s l i c e t h r o u g h t h e head. T h e s e c t i o n s o f t h e a n i m a l l o c a t e d a b o v e a n d b e l o w t h i s s l i c e h a v e b e e n r e m o v e d . R e p r e s e n t a t i v e p h a r y n x ( p h ) , p h a r y n g e a l - i n t e s t i n a l v a l v e ( p i ) , n e u r o n ( n ) a n d i n t e s t i n e ( i n t ) n u c l e i a r e i n d i c a t e d . P a n e l F s h o w s t h e T R S V c h a n n e l w i t h d o u b l e -s t r a n d e d D N A s t a i n i n g p a t t e r n . P a n e l G s h o w s t h e U B C - 2 s t a i n i n g p a t t e r n i n t h e F I T C c h a n n e l . P a n e l H s h o w s b o t h c h a n n e l s s i m u l t a n e o u s l y . S c a l e b a r i n d i c a t e s 10 m i c r o n s . 85 Figure 18. Immunolocalization of U B C - 2 in let-70 mutant animals. L a s e r s c a n n i n g c o n f o c a l m i c r o s c o p y o f w i l d t y p e ( p a n e l A ) a n d let-70(sll32) ( p a n e l B ) w o r m s d o u b l e - l a b e l l e d w i t h a n t i - U B C - 2 ( g r e e n , F I T C ) a n d 1 C B 4 ( r e d , T R S C ) w h i c h s t a i n s i n t e s t i n e c e l l s , s p e r m a n d s e v e r a l s e n s o r y n e u r o n s . A n t e r i o r is l e f t a n d d o r s a l i s t o w a r d s t h e t o p . I n t e s t i n e ( i n t ) a n d g o n a d ( g o n ) a r e i n d i c a t e d A ) A w i l d t y p e L 3 l a r v a . N o t e t h e s t r o n g U B C - 2 s t a i n i n g i n t h e g o n a d . B ) let-70(sl 132) L l l a r v a . N o t e t h e d e c r e a s e d U B C - 2 s t a i n i n g i n t e n s i t y a n d t h e i n t e s t i n a l c e l l a b n o r m a l i t i e s . P a n e l s C a n d D s h o w w i l d t y p e a n d let-70(s689) L2 l a r v a e , r e s p e c t i v e l y , d o u b l e - l a b e l l e d w i t h a n t i - U B C - 2 ( g r e e n , F I T C ) a n d D M 5 . 6 ( r e d , T R S C ) w h i c h s t a i n s m y o s i n h e a v y c h a i n A . A r e p r e s e n t a t i v e b o d y w a l l m u s c l e q u a d r a n t ( b w m ) i s i n d i c a t e d . I n C, a n t e r i o r i s t o w a r d s t h e t o p a n d v e n t r a l i s l e f t . I n D, a n t e r i o r i s l e f t . N o t e t h e m u s c l e d i s p l a c e m e n t a n d d i s o r g a n i z a t i o n . S c a l e b a r i n d i c a t e s 10 m i c r o n s . 87 8 8 I n let-70(s689) m u t a n t l a r v a e , U B C - 2 l e v e l s w e r e v i r t u a l l y u n d e t e c t a b l e ( F i g u r e 1 8 D ) . I n a d d i t i o n , b o d y w a l l m u s c l e w a s e x t r e m e l y d i s o r g a n i z e d , i n a m a n n e r s i m i l a r t o t h a t o b s e r v e d i n let-70(s689) m u t a n t e m b r y o s . M y o s i n w a s n o t o r g a n i z e d i n t o o r d e r e d A - b a n d s a n d f o r m e d l a r g e a g g r e g a t e s . I n m a n y l a r v a e , o n e o r m o r e o f t h e m u s c l e q u a d r a n t s w e r e d e t a c h e d f r o m t h e h y p o d e r m i s . T h e d e t a c h m e n t t e n d e d t o o c c u r m o s t l y at m i d - b o d y , w h e r e t h e a n i m a l s f l e x d u r i n g l o c o m o t i o n . T h i s s t r o n g m u s c l e d e f e c t w a s s e e n o n l y i n L 1 - L 3 m u t a n t l a r v a e , let-70(s689) m u t a n t s t h a t d e v e l o p e d b e y o n d L 3 d i d n o t e x h i b i t s u c h s t r o n g m u s c l e a s s e m b l y a n d a t t a c h m e n t d e f e c t s . T h e a d u l t s t a i n i n g p a t t e r n w a s e x a m i n e d s o l e l y i n w i l d t y p e a d u l t s . T h e U B C - 2 s t a i n i n g p a t t e r n w a s s i m i l a r t o t h a t s e e n i n L 3 l a r v a e , w i t h a l o w l e v e l o f U B C - 2 e x p r e s s i o n i n m o s t t i s s u e s a n d c e l l s ( d a t a n o t s h o w n ) . I n c r e a s e d e x p r e s s i o n w a s s e e n i n t h e n u c l e o l i o f b o d y w a l l m u s c l e , p h a r y n g e a l m u s c l e , i n t e s t i n e , h y p o d e r m i s , g e r m l i n e , p h a r y n g e a l n e u r o n s a n d s e v e r a l n e u r o n s i n t h e v e n t r a l n e r v e c o r d . 7. CONSTRUCTION OF TRANSGENIC ubc-2::GFP ANIMALS T h e e x p r e s s i o n o f ubc-2 d u r i n g d e v e l o p m e n t i n l i v e a n i m a l s w a s e x a m i n e d u s i n g t r a n s g e n i c l i n e s c a r r y i n g ubc-2::GFP f u s i o n c o n s t r u c t s . T h e ubc-2::GFP f u s i o n s w e r e c o n s t r u c t e d b y i n s e r t i n g t h e G F P c o d i n g r e g i o n i n t o t h e s e c o n d e x o n o f ubc-2 i n t h e p l a s m i d p Z M 1 3 . T h e l a t t e r c o n t a i n e d 7 k b o f s e q u e n c e u p s t r e a m a n d 6 k b d o w n s t r e a m o f ubc-2. W h e n e x p r e s s e d as a t r a n s g e n i c a r r a y , p Z M 1 3 w a s c a p a b l e o f f u l l y r e s c u i n g h o m o z y g o u s m u t a n t let-70(s689) a n i m a l s ( s e e S e c t i o n III.8.2). T w o f u s i o n c o n s t r u c t s w e r e m ade. I n p T S l . l , t h e N L S o f S V 4 0 w a s i n s e r t e d u p s t r e a m o f t h e G F P c o d i n g s e q u e n c e . T h e N L S s h o u l d l o c a l i z e t h e f u s i o n p r o t e i n t o t h e n u c l e i o f c e l l s t h a t e x p r e s s i t . T h e p T S 2 . 2 c o n s t r u c t l a c k e d a n N L S . I n j e c t i o n m i x t u r e s c o n t a i n e d r a n d o m g e n o m i c D N A , t h e m a r k e r p l a s m i d p R F 4 a n d t h e ubc-2 : : G F P f u s i o n c o n s t r u c t o f i n t e r e s t . R a n d o m g e n o m i c D N A w a s i n c l u d e d i n t h e i n j e c t i o n m i x t u r e s t o a l l o w b o t h s o m a t i c a n d g e r m l i n e e x p r e s s i o n o f t h e t r a n s g e n i c a r r a y . N 2 a n i m a l s w e r e i n j e c t e d a n d s t a b l e t r a n s g e n i c l i n e s w e r e e s t a b l i s h e d ( A p p e n d i x C ) . T r a n s g e n i c i n d i v i d u a l s f r o m e a c h l i n e w e r e e x a m i n e d f o r G F P e x p r e s s i o n , a n d t h e c e l l s a n d t i s s u e s i n w h i c h ubc-2::GFP w a s e x p r e s s e d w e r e i d e n t i f i e d . 7.1 Expression of ubc-2::GF¥ in transgenic lines carrying pTS2.2 T r a n s g e n i c a n i m a l s c a r r y i n g p T S 2 . 2 e x p r e s s e d ubc-2::GFP i n m a n y c e l l s a n d t i s s u e s . A n u m b e r o f a n i m a l s e x p r e s s e d t h e t r a n s g e n e i n a u b i q u i t o u s p a t t e r n s i m i l a r t o t h a t o b s e r v e d i n 89 e m b r y o s a n d l a r v a e i m m u n o s t a i n e d w i t h a n t i - U B C - 2 . T h i s p a t t e r n h a s b e e n p r e v i o u s l y d e s c r i b e d i n S e c t i o n III.6. M a n y a n i m a l s e x p r e s s e d t h e t r a n s g e n e o n l y i n s p e c i f i c c e l l s a n d t i s s u e s i n a m o s a i c p a t t e r n . M o s a i c i s m i n t r a n s g e n i c s r e s u l t s f r o m t h e l o s s o f t h e e x t r a c h r o m o s o m a l a r r a y i n c e l l s d u r i n g d e v e l o p m e n t , s u c h t h a t t h e a r r a y i s e x p r e s s e d o n l y i n a s u b s e t o f c e l l s . F o r t h e a n a l y s i s o f U B C - 2 e x p r e s s i o n , m o s a i c a n i m a l s p r o v e d t o b e v e r y u s e f u l . I n m a n y m o s a i c s , b a c k g r o u n d e x p r e s s i o n o f ubc-2::GFP w a s absent, a n d a l l o w e d v i s u a l i z a t i o n o f ubc-2::GFP e x p r e s s i o n i n c e l l s t h a t h a d p r e v i o u s l y b e e n o b s c u r e d b y b a c k g r o u n d e x p r e s s i o n l e v e l s . M o s a i c ubc-2::GFP e x p r e s s i o n w a s s e e n i n a n u m b e r o f c e l l t y p e s t h a t h a d b e e n p r e v i o u s l y i d e n t i f i e d b y i m m u n o s t a i n i n g , s u c h as b o d y w a l l m u s c l e , p h a r y n g e a l m u s c l e , i n t e s t i n e a n d h y p o d e r m i s ( F i g u r e 19 A , B , a n d C ) . E x p r e s s i o n w a s o b s e r v e d i n t h e c y t o p l a s m o f t h e s e c e l l s a n d t h e r e w a s u s u a l l y a n i n c r e a s e i n t h e i n t e n s i t y o f e x p r e s s i o n i n t h e n u c l e u s . I n t e r e s t i n g l y , t h e w h o l e n u c l e u s , r a t h e r t h a n j u s t t h e n u c l e o l u s , e x h i b i t e d i n c r e a s e d ubc-2: : G F P e x p r e s s i o n . S e v e r a l c e l l s a n d t i s s u e s t h a t h a d n o t p r e v i o u s l y b e e n s h o w n t o e x p r e s s U B C - 2 w e r e f o u n d t o e x p r e s s ubc-2::GFP. E x p r e s s i o n w a s s e e n i n t h e d e v e l o p i n g v u l v a o f L 3 a n d L 4 l a r v a e , t h e v u l v a l m u s c l e s , t h e u t e r u s a n d t h e s o m a t i c g o n a d ( F i g u r e 1 9 C , D , E a n d F ) . E x p r e s s i o n w a s a l s o o b s e r v e d i n t h e s p e r m a t h e c a a n d a n a l s p h i n c t e r m u s c l e ( n o t s h o w n ) . T h e ubc-2::GFP e x p r e s s i o n p a t t e r n s i n t h e s e t i s s u e s w e r e o b s e r v e d i n a n u m b e r o f t r a n s g e n i c i n d i v i d u a l s . S e v e r a l n e u r o n s a l s o e x p r e s s e d ubc-2::GFP. T h e c e l l b o d i e s a n d p r o c e s s e s o f s e v e r a l I - c l a s s p h a r y n g e a l n e u r o n s e x p r e s s e d ubc-2::GFP ( F i g u r e 1 9 B ) . S e v e r a l o t h e r n e u r o n s i n t h e h e a d r e g i o n e x p r e s s e d ubc-2: : G F P i n b o t h t h e n u c l e i a n d p r o c e s s e s ( F i g u r e 2 0 ) . T h e n u c l e i o f t h e s e n e u r o n s w e r e l o c a t e d n e a r t h e t e r m i n a l b u l b o f t h e p h a r y n x . O n e p r o c e s s e x t e n d e d a n t e r i o r l y , w h i l e t w o p r o c e s s e s e x t e n d e d p o s t e r i o r l y , w i t h o n e t r a v e l l i n g a l o n g t h e v e n t r a l n e r v e c o r d . B a s e d o n t h e i r l o c a t i o n , t h e s e n e u r o n s a p p e a r e d t o b e A V M a n d S D Q L . B o t h o f t h e s e n e u r o n s a r e d e s c e n d e n t s o f t h e Q n e u r o b l a s t l i n e a g e , w i t h A V M b e i n g i n v o l v e d i n m e c h a n o s e n s a t i o n . I n a d d i t i o n , o n e n e u r o n w i t h a c e l l b o d y l o c a t e d i n t h e t a i l r e g i o n a n d a p r o c e s s t h a t r a n a n t e r i o r l y a l o n g t h e b o d y e x p r e s s e d ubc-2::GFP ( n o t s h o w n ) . It i s p o s s i b l e t h a t t h i s i s t h e s e n s o r y n e u r o n P Q R , a n o t h e r Q n e u r o b l a s t d e s c e n d a n t ; h o w e v e r , t h e t w i s t i n t h e b o d y o f t h e a n i m a l s c a u s e d b y t h e rol-6 m u t a t i o n p r e v e n t e d u n e q u i v o c a l i d e n t i f i c a t i o n o f m a n y n e u r o n s . I n s u m m a r y , t h e v e n t r a l n e r v e c o r d , at l e a s t t w o n e u r o n s t h a t e x t e n d a l o n g t h e b o d y o f t h e a n i m a l a n d at l e a s t o n e t a i l n e u r o n e x p r e s s e d U B C - 2 i n t h e i r n u c l e i a n d i n t h e n e u r a l p r o c e s s e s . M a n y 90 Figure 19. UBC-2::GFP fusion protein is expressed in a number of tissues in C. elegans. Transgenic worms carrying pTS2.2 extrachromosomal arrays were visualized for expression of the UBC-2: :GFP fusion protein. A) Adult worm showing the terminal bulb of the pharynx and the anterior portion of the intestine. Anterior is left in all panels. Note the strong UBC-2: :GFP expression in cytoplasm and nucleus of the intestine cell (int). The yellow spots are a subset of gut granules that autofluoresce under 488 nm light. B) Head of an adult worm. Note the strong UBC-2::GFP expression in the processes of the pharyngeal neurons (pn) and in the nucleus of the pharyngeal muscle cells (ph). C) Mid-body of L3 larva showing strong UBC-2::GFP expression in hypodermal cell (hyp) and in the developing vulva (vul). D) Ventral surface of adult mid-body. Note UBC-2: :GFP expression in the vulva muscles (vm). E) Mid-body of adult with UBC-2: :GFP expression in uterus (ut) and vulva of gonad. F) Adult animal showing oviduct (ov) with oocytes inside. Note UBC-2: :GFP expression in the somatic oviduct tissue. Scale bar indicates 10 microns. 91 92 Figure 20. UBC-2::GFP is expressed in several neurons. T r a n s g e n i c w o r m s c a r r y i n g p T S 2 . 2 e x t r a c h r o m o s o m a l a r r a y s w e r e v i s u a l i z e d u n d e r 4 8 8 n m l i g h t f o r e x p r e s s i o n o f t h e U B C - 2 : : G F P f u s i o n p r o t e i n . A ) L 4 l a r v a e x p r e s s i n g U B C - 2 : : G F P i n n e u r o n c e l l b o d i e s ( n e b ) a n d p r o c e s s e s ( n p ) . A n t e r i o r i s r i g h t i n a l l p a n e l s . B ) C l o s e - u p o f u p p e r b o d y at a d i f f e r e n t f o c a l p l a n e t o s h o w t h e c o n n e c t i o n o f t h e n e u r a l p r o c e s s e s t o t h e c e l l b o d i e s n e a r t h e p h a r y n x . C ) C l o s e - u p o f n e u r o n c e l l b o d y s h o w i n g p r o c e s s e s e x t e n d i n g a n t e r i o r l y a n d p o s t e r i o r l y . S c a l e b a r i n d i c a t e s 10 m i c r o n s . C3 93 94 o f t h e s e n e u r o n s a p p e a r t o b e d e s c e n d a n t s o f t h e Q n e u r o b l a s t l i n e a g e . A n i n t e r e s t i n g p a t t e r n o f ubc-2::GFV e x p r e s s i o n w a s o b s e r v e d i n t h e b o d y w a l l m u s c l e . W h e n t r a n s g e n i c a n i m a l s w e r e o b s e r v e d u n d e r l o w m a g n i f i c a t i o n , ubc-2::GFP e x p r e s s i o n w a s s e e n i n a l l b o d y w a l l m u s c l e c e l l s ( F i g u r e 21 A ) . E x p r e s s i o n w a s l o c a l i z e d t o t h e n u c l e u s a n d w a s a l s o o b s e r v e d i n a p u n c t a t e p a t t e r n t h a t m a t c h e d t h e s t r i a t i o n s o f t h e m u s c l e s a r c o m e r e ( F i g u r e 2 I B , C ) . T h e p u n c t a t e ubc-2::GFP e x p r e s s i o n p a t t e r n w i t h i n t h e s a r c o m e r e a p p e a r e d t o l o c a l i z e t o d e n s e b o d i e s o r M - l i n e s . 7.2 Expression of ubc-2::GFY in transgenic lines carrying pTSl.l T h e e x p r e s s i o n o f ubc-2:: G F P i n t r a n s g e n i c s c a r r y i n g p T S l . l w a s e x t r e m e l y p o o r . D u e t o t h e m o s a i c n a t u r e o f t h e e x t r a c h r o m o s o m a l a r r a y , o n l y a s m a l l n u m b e r o f n u c l e i w e r e o b s e r v e d t o e x p r e s s t h e t r a n s g e n e i n i n d i v i d u a l a n i m a l s . C e l l s t h a t e x p r e s s e d ubc-2::GFV i n t h e n u c l e u s i n c l u d e d h y p o d e r m i s , i n t e s t i n e a n d m u s c l e ( d a t a n o t s h o w n ) . H o w e v e r , it w a s o f t e n d i f f i c u l t t o i d e n t i f y t h e n u c l e i t h a t e x p r e s s e d ubc-2::GFP b e c a u s e t h e r e w a s n o c o u n t e r s t a i n a v a i l a b l e t o a i d i n c e l l i d e n t i f i c a t i o n . 8. DNA-MEDIATED TRANSFORMATION RESCUE OF let-70 A n u m b e r o f t r a n s g e n i c l i n e s w e r e c o n s t r u c t e d a n d t e s t e d f o r t h e i r a b i l i t y t o r e s c u e t h e let-70 m u t a t i o n . T h e r e s u l t s a r e s u m m a r i z e d i n T a b l e 4. O n e c o n s t r u c t , p Z M I . l , i n c l u d e d 1.4 k b o f s e q u e n c e u p s t r e a m o f ubc-2 a n d 2.5 k b o f d o w n s t r e a m s e q u e n c e . A t t e m p t s t o r e s c u e let-70 m u t a n t s w i t h p Z M I . l w e r e u n s u c c e s s f u l . T h i s c o n s t r u c t w a s u t i l i z e d i n m o s t o f t h e e a r l i e r t r a n s g e n i c ubc-2::lacZ e x p r e s s i o n s t u d i e s ( Z h e n , 1995; Z h e n et al., 1 9 9 6 ) . A l a r g e r c o n s t r u c t , p Z M 1 3 , w h i c h i n c l u d e d a p p r o x i m a t e l y 7 k b o f u p s t r e a m a n d 6 k b o f d o w n s t r e a m s e q u e n c e w a s a l s o m a d e ( M . Z h e n , u n p u b l . ) , a n d t h e t r a n s g e n i c l i n e P C 1 2 5 u b E x l l O w a s e s t a b l i s h e d w i t h t h i s c o n s t r u c t . W h e n P C 1 2 5 u b E x l l O t r a n s g e n i c s w e r e c r o s s e d t o let-70 m u t a n t s , t h e r e s u l t i n g t w i t c h e r / r o l l e r p r o g e n y w e r e p a r t i a l l y r e s c u e d ( F i g u r e 1 7 B , E ) . T r a n s g e n i c s d e v e l o p e d p a s t t h e L 3 l e t h a l s t a g e a n d b e c a m e a d u l t s . I n t e r e s t i n g l y , t h e p h e n o t y p e o f t h e s e p a r t i a l l y r e s c u e d a n i m a l s w a s s i m i l a r t o t h a t o f let-70(s689) h o m o z y g o t e s t h a t d e v e l o p e d i n t o e a r l y a d u l t s . T h e i n t e s t i n a l d e f e c t s w e r e r e s c u e d a n d a l l t r a n s g e n i c a n i m a l s h a d l a r g e , h e a l t h y - l o o k i n g i n t e s t i n a l c e l l s w i t h m a n y g u t g r a n u l e s . H o w e v e r , g o n a d a l d e v e l o p m e n t w a s a b n o r m a l a n d t h e a n i m a l s w e r e s t e r i l e . T h e t y p e a n d e x t e n t o f g e r m l i n e a b n o r m a l i t i e s v a r i e d . I n s o m e a n i m a l s , t h e g o n a d i t s e l f f a i l e d t o d e v e l o p p r o p e r l y . T h e d i s t a l t i p s o f t h e g o n a d a r m s w e r e b u l b o u s . O n e a r m o f t e n d i d n o t r e f l e x d u r i n g o u t g r o w t h , o r w o u l d 95 Figure 21. UBC-2::GFP is expressed in the muscle nucleus and in the sarcomere. T r a n s g e n i c w o r m s c a r r y i n g p T S 2 . 2 e x t r a c h r o m o s o m a l a r r a y s w e r e v i s u a l i z e d u n d e r 4 8 8 n m l i g h t f o r e x p r e s s i o n o f t h e U B C - 2 : : G F P f u s i o n p r o t e i n . A ) A n L 4 l a r v a e x p r e s s i n g U B C -2 : : G F P i n t h e b o d y w a l l m u s c l e b a n d s (m). T h e y e l l o w s p o t s a r e a s u b s e t o f g u t g r a n u l e s t h a t a u t o f l u o r e s c e u n d e r 4 8 8 n m l i g h t . A n t e r i o r i s l e f t . B ) T h r e e i n d i v i d u a l m u s c l e c e l l s e x p r e s s i n g U B C - 2 : : G F P i n t h e c e l l n u c l e u s ( m c b ) a n d i n a s t r i a t e d p a t t e r n a l o n g t h e l e n g t h o f t h e m u s c l e c e l l s . C ) C l o s e - u p o f m u s c l e c e l l s s h o w i n g t h e p u n c t a t e s t a i n i n g p a t t e r n ( p s ) i n t h e m u s c l e s t r i a t i o n s . S c a l e b a r i n d i c a t e s 10 m i c r o n s . 96 97 b e n d s e v e r a l t i m e s d u r i n g d e v e l o p m e n t . O o c y t e s f o r m e d i n s o m e a n i m a l s , b u t f a i l e d t o r e a c h t h e u t e r u s a n d w e r e n o t f e r t i l i z e d . T h u s , a n o o c y t e , w h e t h e r f e r t i l i z e d o r not, w a s n e v e r o b s e r v e d i n s i d e t h e u t e r u s o f t h e s e a n i m a l s . T h e u t e r u s i t s e l f w a s a m a s s o f u n d i f f e r e n t i a t e d c e l l s w i t h a n a l m o s t t u m o r o u s a p p e a r a n c e . Table 4. Summary of DNA-mediated transformation rescue experiments Plasmid Construct Mutant Background Genomic DMA Rescue Upstream Sequence Downstream Sequence p Z M I . l sll32 s689 N o N o 1.4 k b 2.5 k b p Z M 1 3 sll32 s689 N o P a r t i a l 1 7 k b 6 k b M 7 sll32 s689 N o P a r t i a l 1 2 1 k b 1.5 k b p Z M 1 3 sll32 Y e s M E L 2 7 k b 6 k b s689 Y e s F U L L G 4 7 J 1 1 sll32 s689 Y e s N o 8 k b 15 k b R e s c u e t o s t e r i l e a d u l t ; n o e g g s l a i d 2 M a t e r n a l e f f e c t l e t h a l ; e m b r y o s a r r e s t at g a s t r u l a t i o n A t t e m p t s w e r e m a d e t o r e s c u e let-70 m u t a n t s u s i n g c o s m i d M 7 , w h i c h c o n t a i n e d 21 k b u p - a n d 1.5 k b d o w n s t r e a m o f ubc-2 (J. S c h e i n , u n p u b l . ) . It w a s t h o u g h t t h a t t h e i n c l u s i o n o f a d d i t i o n a l u p s t r e a m s e q u e n c e m i g h t p e r m i t t h e f u l l e x p r e s s i o n o f U B C - 2 . T r a n s g e n i c l i n e s c o n t a i n i n g M 7 as a n e x t r a c h r o m o s o m a l a r r a y w e r e e s t a b l i s h e d a n d p l a c e d i n a let-70 b a c k g r o u n d . T w i t c h e r a n i m a l s w e r e o n l y p a r t i a l l y r e s c u e d b y t h e i n t r o d u c t i o n o f t h e M 7 t r a n s g e n i c a r r a y a n d e x h i b i t e d a s t e r i l e a d u l t p h e n o t y p e s i m i l a r t o t h a t o f m u t a n t a n i m a l s c a r r y i n g t h e p Z M 1 3 a r r a y . A l l p r e v i o u s l y m e n t i o n e d t r a n s g e n i c a n i m a l s c a r r y i n g ubc-2 c o n s t r u c t s h a d b e e n g e n e r a t e d u s i n g c o n v e n t i o n a l t r a n s f o r m a t i o n t e c h n i q u e s i n w h i c h t h e p l a s m i d o f i n t e r e s t w a s c o - i n j e c t e d w i t h a m a r k e r p l a s m i d ( F i r e , 1986). S u c h t r a n s g e n e s a r e h e r i t a b l y t r a n s m i t t e d as e x t r a c h r o m o s o m a l a r r a y s w i t h e f f i c i e n t e x p r e s s i o n i n m o s t s o m a t i c t i s s u e s ( C h a l f i e et al., 1994; F i r e et al, 1990). I n t e r e s t i n g l y , m a n y l a b o r a t o r i e s h a v e r e p o r t e d t h e i n a b i l i t y t o o b s e r v e a n y r e p o r t e r t r a n s g e n e e x p r e s s i o n i n t h e g e r m l i n e . T h i s l e d t o t h e g e n e r a l t h e o r y t h a t t r a n s g e n e s a r e r e c o g n i z e d d i f f e r e n t l y b y t h e g e r m l i n e a n d t h e s o m a , a n d a r e s o m e h o w r e p r e s s e d i n t h e 98 p o s t e m b r y o n i c g e r m l i n e . I m m u n o f l u o r e s c e n t s t a i n i n g o f C. elegans w i t h a n t i - U B C - 2 s h o w e d t h a t U B C - 2 w a s s t r o n g l y e x p r e s s e d i n t h e g e r m l i n e ( s e e S e c t i o n III.6). A s d i s c u s s e d a b o v e , let-70 m u t a n t s c a r r y i n g U B C - 2 - c o n t a i n i n g e x t r a c h r o m o s o m a l a r r a y s w e r e p a r t i a l l y r e s c u e d i n a m a n n e r t h a t s u g g e s t e d t h a t s o m a t i c d e f e c t s w e r e r e s c u e d w h i l e g e r m l i n e d e f e c t s w e r e not. T o g e t h e r , t h i s i n f o r m a t i o n i n d i c a t e d t h a t g e r m l i n e e x p r e s s i o n o f U B C - 2 m i g h t b e r e q u i r e d f o r d e v e l o p m e n t . R e c e n t w o r k b y K e l l y et al. ( 1 9 9 7 ) h a s s h o w n t h a t t h e i n c l u s i o n o f r a n d o m g e n o m i c f r a g m e n t s o f n e m a t o d e D N A i n t h e i n j e c t i o n m i x t u r e r e s u l t s i n r o b u s t e x p r e s s i o n o f t r a n s g e n e s i n b o t h g e r m l i n e a n d s o m a t i c t i s s u e . It i s b e l i e v e d t h a t a d d i t i o n o f g e n o m i c D N A i n c r e a s e s t h e g e n e t i c c o m p l e x i t y o f t h e e x t r a c h r o m o s o m a l a r r a y , t h u s p r e v e n t i n g s i l e n c i n g o f t h e a r r a y i n t h e g e r m l i n e . T o d e t e r m i n e i f g e r m l i n e e x p r e s s i o n o f let-70 w a s r e q u i r e d f o r d e v e l o p m e n t , w i l d t y p e a n i m a l s w e r e i n j e c t e d w i t h p Z M 1 3 a n d N 2 g e n o m i c D N A f r a g m e n t s ( s e e S e c t i o n II.6.3) t o g e n e r a t e t r a n s g e n i c l i n e s . E a c h t r a n s g e n i c l i n e w a s t h e n c r o s s e d w i t h b o t h a l l e l e s o f let-70, a n d t h e p r o g e n y w e r e e x a m i n e d f o r t h e p r e s e n c e o f t w i t c h e r / r o l l e r a n i m a l s . T h e s e a n i m a l s w e r e p r e s u m a b l y h o m o z y g o u s let-70 a n i m a l s c a r r y i n g t h e p Z M 1 3 t r a n s g e n i c a r r a y . T h e d e v e l o p m e n t o f t h e s e a n i m a l s w a s t h e n m o n i t o r e d . 8.1 N2 genomic DNA fragments do not rescue let-70 C o n t r o l i n j e c t i o n s w e r e p e r f o r m e d i n w h i c h w i l d t y p e i n d i v i d u a l s w e r e i n j e c t e d w i t h a m i x t u r e o f p R F 4 a n d N 2 g e n o m i c D N A f r a g m e n t s a l o n e ( c x - c o n t r o l ) . S e v e r a l i n d e p e n d e n t s t a b l e l i n e s w e r e e s t a b l i s h e d . E a c h l i n e w a s p l a c e d i n let-70(s689) a n d let-70(sl 132) m u t a n t b a c k g r o u n d s , a n d t h e d e v e l o p m e n t o f t w i t c h e r / r o l l e r p r o g e n y w a s f o l l o w e d . H o m o z y g o u s let-70 m u t a n t s t h a t c o n t a i n e d t h e c x - c o n t r o l a r r a y a r r e s t e d at L 3 . T h e a r r e s t p h e n o t y p e o f t h e s e a n i m a l s w a s s i m i l a r t o t h a t o b s e r v e d i n let-70 m u t a n t s t r a i n s . T h e y w e r e t h i n w i t h s m a l l i n t e s t i n e c e l l s t h a t l a c k e d m i c r o v i l l i a n d g u t g r a n u l e s . T h u s , e x t r a c h r o m o s o m a l a r r a y s c o n t a i n i n g N 2 g e n o m i c D N A f r a g m e n t s a l o n e w e r e n o t s u f f i c i e n t t o r e s c u e let-70 m u t a n t s t r a i n s . 8.2 Germline and somatic expression of pZM13 can rescue let-70(s689) N 2 g e n o m i c D N A f r a g m e n t s w e r e m i x e d w i t h p Z M 1 3 a n d p R F 4 t o m a k e a c o m p l e x p Z M 1 3 m i x t u r e ( c x - p Z M 1 3 ) , i n j e c t e d i n t o N 2 a n i m a l s , a n d s i x i n d e p e n d e n t l i n e s w e r e g e n e r a t e d ( A p p e n d i x C ) . W h e n p l a c e d i n a let-70(s689) b a c k g r o u n d , h o m o z y g o u s m u t a n t s c a r r y i n g c x - p Z M 1 3 w e r e f u l l y r e s c u e d . F u l l r e s c u e w a s o b t a i n e d w i t h a l l s i x t r a n s g e n i c l i n e s 99 (Figure 22C, F). Intestinal cells were nearly wild type in appearance and a fully functional gonad was produced. However, the rescued let-70(s689) animals exhibited a slow growth phenotype and were slightly egg-laying defective such that embryos were retained in the uterus longer than normal before being released. Brood size was fairly small, ranging from 15 to 150 eggs, with a mixture of fertilized and unfertilized embryos. Approximately 30% of the eggs that were laid hatched into viable progeny. These phenotypes may be caused by mosaic expression of the transgene, since it was not integrated into the genome. The complete rescue of the let-70(s689) mutation with cx-pZM13 indicated that germline expression of let-70 was required for C. elegans development. Since the genomic DNA alone was unable to rescue let-70 mutants, it appears that combined somatic and germline expression of pZM13 is necessary for rescue of the let-70(s689) mutation. Thus, cx-pZM13 contains all of the information required for the proper spatial and temporal expression of ubc-2. 8.3 Germl ine and somatic expression of p Z M 1 3 does not rescue let-70(sll32) Homozygous let-70(sl 132) mutants were not completely rescued by the complex pZM13 array. Transgenic mutants developed beyond the L3 lethal stage and became egg-laying adults. The gonad developed normally, and hermaphrodites laid around 100 fertilized eggs. However, all embryos arrested at gastrulation or soon thereafter. No viable progeny were produced by let-70(sll32) animals that carried the cx-pZM13 array. Therefore, the same extrachromosomal array that was capable of fully rescuing let-70(s689) mutants was incapable of rescuing let-70(sll32) mutants. This suggested that a feature unique to let-70(sll32) affected the ability of cx-pZM13 to rescue the strain. 9. DNA-MEDIATED TRANSFORMATION RESCUE WITH A TEMPERATURE-SENSITIVE ubc-2 ALLELE The ability to control the developmental expression of a gene has greatly contributed to our understanding of gene function. In genetics, temperature-sensitive mutations have proven to be one of the most useful methods for controlling gene expression. In yeast, a number of temperature-sensitive E2 mutations have been isolated (Ellison et al, 1991; Goebl et al., 1988). It was therefore of interest to construct a temperature-sensitive ubc-2 mutant that would permit one to examine the temporal requirements for ubc-2 expression in C. elegans. The full rescue of the let-70(s689) mutation indicated that, when expressed in somatic and germline tissue, pZM13 contained all of the let-70 control elements required for proper 100 Figure 22. Iet-70(s689) is partially rescued by somatic expression of ubc-2 transgenic arrays and is fully rescued by somatic and germline expression of ubc-2. Worms were visualized under Nomarski optics. A and D) Wild type animal. Panel A shows the terminal bulb of the pharynx and the upper intestine. Anterior is left. The pharyngeal-intestinal valve (pi), a representative intestine cell (int) and gut granules (gg) are indicated. Panel D shows the gonad with uterus (ut) and vulva (vul) indicated. B and E) Somatic expression of the pZM13 transgenic array in a let-70(s689) mutant background. The strain is PC125ubExllO. Partial rescue is evident. Panel B shows rescue of the intestinal defects. Panel E shows that gonad development is defective. Note the granular appearance of the uterus. C and F) Germline and somatic expression of pZM13 transgenic array in a let-70(s689) mutant background. The strain is PC167ubExl37. Full rescue was obtained. In panel C, the intestinal defects have been rescued. Note the wild type appearance of the intestinal cells with numerous gut granules. Panel F shows the ventral surface of a rescued animal. The uterus contains two developing embryos (emb). Note that one embryo is in comma stage. Scale bar indicates 50 microns. 101 expression of UBC-2 during development. Mei Zhen had previously constructed a putative temperature-sensitive allele of ubc-2, pZM13.34, which contained a P61S alteration (see Section 11.6.2). In yeast, the permissive temperature for this allele was 30°C while the non-permissive temperature was 39°C (Ellison et ai, 1991). Earlier attempts to rescue let-70 mutants with this putative temperature-sensitive allele at 15°C and 25°C had been unsuccessful. However, the transgenic lines had been generated by conventional techniques, which indicated that pZM13.34 would probably not have been expressed in the germline. Rescue experiments with the putative temperature-sensitive let-70 allele, pZM13.34, were therefore repeated using transformation techniques that allowed both germline and somatic expression of the transgene. N2 genomic DNA fragments were mixed with pRF4 and pZM13.34 to make the complex mixtures cx-pZM13.34, injected into N2 animals and stable transgenic lines were established. Transgenic lines containing complex pZM13.34 extrachromosomal arrays were crossed to let-70 animals and roller progeny that twitched in 1% nicotine were set to individual plates. The development of twitcher/roller animals at the putative permissive (15°C) and non-permissive (25°C) temperatures was monitored. When transgenic lines carrying the cx-pZM13.34 extrachromosomal arrays were placed in a let-70(sl 132) background, twitcher/roller animals developed into sterile adults at both 15°C and 25°C. The phenotype was similar to that previously described for partially rescued animals (see Section III.8.1). The intestinal defect was rescued but oocytes did not move into the uterus, and the uterus consisted of a mass of undifferentiated cells. The partially rescued phenotype suggested that cx-pZM13.34 was able to rescue the somatic defects of let-70(sl 132), but could not rescue the germline defects, despite the expectation that cx-pZM13.34 would be expressed in the germline. In addition, it did not appear that cx-pZM13.34 functioned in a temperature-dependent manner, since similar phenotypes were observed at both temperatures. The cx-pZM13.34 array was also placed in a let-70(s689) background. At 15°C, transgenic twitcher/rollers developed into egg-laying adults. A large number of fertilized and unfertilized eggs were laid; however, embryos arrested at gastrulation and no progeny hatched. This suggested that cx-pZM13.34 in a let-70(s689) background at 15°C was a maternal effect lethal. Interestingly, twitcher/roller animals maintained at 25°C were fully rescued. The animals had a slow growth phenotype, laid few eggs and only a small portion of those hatched and developed into adults. The phenotype was very similar to that of let-70(s689) mutants that were rescued by somatic and germline expression of cx-pZM13 (see Section III.8.2), although 103 the mutants rescued with cx-pZM13.34 appeared less healthy. It is possible that integration of the extrachromosomal array into the genome of let-70(s689) animals might further increase the survival of this strain. In summary, it appears that cx-pZM13.34 is a cold-sensitive allele of let-70 in C. elegans, and that the permissive temperature is 25°C while the non-permissive temperature is 15°C. 10. C. briggsae FOSMID IDENTIFICATION, SEQUENCING AND COMPARISON TO C. elegans The evolutionary conservation of genes and proteins between closely related species has been useful for the identification of functionally important domains and structures within a gene or protein family (Pilgrim et al., 1995; Snutch and Baillie, 1983). In addition, the comparison of flanking sequences has identified important regions that control the temporal and spatial expression of specific proteins. For C. elegans, DNA and polypeptide sequences are often compared with sequences from a closely related nematode species, C. briggsae. While both nematode species are almost identical in development and morphology (Nigon and Dougherty, 1949), it has been estimated that the two species diverged 23-40 million years ago (Emmons et al., 1979; Heschl and Baillie, 1990; Kennedy et al., 1993). Comparison of sequences between the two species has demonstrated that synteny is conserved, often over large sequence tracts (Thacker et al., 1999), and for polycistronic transcription units (Page, 1999). However, DNA sequence conservation between the two species is confined to protein-coding sequences and short flanking sequences. Conserved protein-coding sequences have identified domains and structures that are important in protein function and conserved 5' flanking sequences have identified cis-acting elements that are involved in the regulation of gene expression (Heschl and Baillie, 1990; Krause et al., 1994; Kuwabara, 1996; Lee et al., 1992). 10.1 Identification and sequencing of C. briggsae fosmid G47J11 In this study, the evolutionary conservation of ubc-2 and flanking sequences was examined between C. elegans and C. briggsae. To identify the C. briggsae genomic clone containing the ubc-2 homolog, a C. briggsae gridded fosmid filter was hybridized with a 3 2P-labelled ubc-2 genomic DNA fragment. The ubc-2 fragment hybridized to several fosmids on the filter, all of which mapped to a single contig, indicating that the ubc-2 genomic fragment had hybridized to a single copy gene in C. briggsae. Contig mapping of the fosmids was 104 carried out at the Genome Sequencing Center, St. Louis, MO. Fosmids located within the contig were obtained from the Genome Sequencing Center. PCR amplification of the fosmids using oligonucleotide primers 0ZM2.r and OZM3.f identified those containing the C. briggsae homolog of ubc-2 (Cb-ubc-2), and the fosmid G47J11 was submitted to the Genome Sequencing Center for sequencing. 10.2 Sequencing and comparison of Cb-ubc-2 with Ce-ubc-2 While the fosmid sequencing was in progress, the Cb-ubc-2 homolog was subcloned and sequenced. Cb-ubc-2 was amplified by PCR using primers OZM2.r and OZM3.f. High fidelity Taq polymerase (Boehringer Mannheim) was used in the reaction to reduce amplification errors. The amplification product was sub-cloned into pBSITKS(+) and sequenced. The sequence of Cb-ubc-2 was determined and compared with C. elegans ubc-2 (Ce-ubc-2; Figure 23). Comparison of the two gene sequences indicated that they were 79.7% identical and the coding sequences were 91.4% identical. When the coding sequence was conceptually translated, all of the nucleotide changes between Ce-ubc-2 and Cb-ubc-2 occurred in the third position of codons, and indicated that the coding sequences were 100% conserved. Thus, the polypeptide sequences of Ce-ubc-2 and Cb-ubc-2 were 100% identical. The high degree of sequence conservation in ubc-2 between the two species suggests that selective pressure on ubc-2 has been strong. 10.3 Cb-ubc-2 does not rescue let-70 mutants Many C. briggsae genes have exhibited functional conservation, as demonstrated by rescue of C. elegans mutant phenotypes by DNA-mediated transformation (Krause et al., 1994; Kuwabara, 1996; Maduro and Pilgrim, 1996; Thacker et al, 1999). To determine the functional conservation of Cb-ubc-2, the C. briggsae fosmid G47J11 was transformed into let-70 mutants. G47J11 was co-injected with random genomic DNA fragments and the marker plasmid pRF4 into N2 animals, and stable transgenic lines were established. The cx-G47Jl 1 transgenic arrays were placed in a let-70(sl 132) and a let-70(s689) background, and the survival of twitcher/roller progeny was examined. Mutant animals from both let-70 strains that contained cx-G47Jll extrachromosomal arrays arrested at L3; the arrest phenotype was similar to that seen in let-70 homozygous mutants (Table 4). Therefore, the 23 kb C. briggsae fragment containing the ubc-2 homolog was unable to rescue the let-70 lethality in C. elegans. 105 Figure 23. C elegans and C. briggsae ubc-2 polypeptide sequences are absolutely conserved. Nucleotide coding sequence of C. elegans and C. briggsae ubc-2. Sequence differences between species are shaded. The protein sequence is indicated below the nucleotide sequence in single letter code. Stop codons are indicated with an asterisk. 106 o u o o < o u o u EH E H W oo o o EH E H O o O O < < oo o o < o o o o U U C H o o O O D H EH EH << O O Q EH EH O O O O t f mm o o o p o i l i l i EH EH O O J EH EH << O O Q <;<: <<: oua o o E H E < oo J <:< <<; o o w o o <j <!« o o o oo oo EH EH O O << <^ O O EH EH O O J EH EH O O o o < o o EH EH bo bo 0 0 0 : S * 0 EH EH>H I I O O U U ( H EH EH O O EH E H W O O <C r< O O W < < < 0 0 O O P H o o mM 0 0 0 0 0 0 0 EH EH < K S EH'EH o < 0 0 < < E H EH EH O O oo<c S S 0 0 0 0 0 0 0 EH E H ^ EH EH 0 0 EH EH EH EH W O O EH EH EH EH J EH EH O O Q EH EH < <C O O Q EH EH O O O O O § 1 1 1 EH EH o o > O O O O P H «£J::jp O O O O O EH EH O O EH EH EH EH W O O O O P H EH EH << 0 0 O O Q O O o o O O P H O O EH EH 0 0 o o EH EH <; <3 H EH EH O O < < E H O O EH EH O O J O O EH EH EH E - H Q O O EH EH EH Enfc O O EH EH oo> mm 0 0 o 0 0 <c <c 0 0 O O O 0 0 0 0 EH E H W EH EH O O oocd O O EH EH O O Q EH EH EH EH <C < H 0 0 O O Q mm EH EH O O Q O O EH E H O W B EH EH <C < H O O O O O O O O O 0 0 < < : O O E-H E H W « o mm EH EH r< I< H O O 0 0 O O O , EH EH mm •<;••<;• EH EH>H P i otB O O P H EH EH O O < < ; E H H i 0 0 <C < E H 0 0 EH EH EH Enfc << O O O O O , EH EH O O Q O O EH E H O O O EH EH O O Q 0 0 EH EH O O Q mm 0 0 EH E H W O O O O 0 0 EH EH < < H O O O O m^ui EH EH EH EH O O Q O O EH EH O O Q EH EH EH EH oo> S S 0 0 0 0 EH E H W gf f< r< H o o 0 0 << < E H 0 0 EH EH O O Q EH EH O O oo<s mm 0 0 O O Q 0 0 O O O O EH E H S 0 0 O O O » 3 bo 60 bo to I bo So bo V5 i bo So bo s? bo bo U fj «5 O O O mm '<"< < < z , 0 0 O O O O oow EH EH O O U O f f J mm O O Q o o <C <CEH 0 0 0 0 << E*m>i o o EH EH < <CH « : p O O 0 0 & <c .< o o oo< EH EH EH EH <! < H 0 0 O O W << O O O O Q O O EH EH oo> iliiiil: EH EH O O Q i l l ! 0 0 ' O O Q EH EH O O Q EH EH O O Q O O O O O O Q EH EH so S £° So bo ^ 'C u u 107 10.4 Organization and sequencing of regions f lanking ubc-2 To generate a contiguous C. elegans sequence for comparison, the reverse complement of cosmid sequence M7 was joined to the sequence of the yeast artificial chromosome (YAC), Y5F2. A portion of this DNA sequence (called M7+Y5F2), consisting of 10 kb upstream and 20 kb downstream of ubc-2, was utilized for comparison to the complete C. briggsae fosmid sequence, G47J11. The M7+Y5F2 sequence was analyzed using Genefinder (P. Green and L. Hillier, unpubl.) which predicts the locations of putative genes on DNA sequences. Within this 31.5 kb region, twelve genes were predicted. The locations and direction of transcription of these genes is illustrated in Figure 24A. A cluster of five genes is located upstream of ubc-2 (M7.3, M7.7, M7.6, M7.4 and M7.2). The predicted gene M7.3 has similarity to the KH domain family of RNA binding proteins. M7.6 and M7.4 have no known homologs in other species. These three genes are transcribed in the same direction, and are located quite close to one another. The ATG start codon of M7.6 is located 22 nucleotides (nt) downstream ofthe predicted polyadenylation signal for M7.3, and the ATG start codon for M7.4 is 257 nt downstream of the predicted polyadenylation signal for M7.6. These features suggest that these three predicted genes form a polycistronic unit. M7.7, a predicted serine/threonine kinase, is transcribed from the complementary strand. The coding sequence of M7.7 is located within several introns of M7.3. M7.2, a predicted kinesin light chain gene is located nearest to ubc-2 and is transcribed off the complementary strand. Downstream of the gene cluster that includes ubc-2 lies a 3.6 kb repetitive sequence, RI. The repeat unit is 40 nucleotides long, and is fairly well conserved throughout its length. Immediately downstream of RI lies a second repetitive sequence of 1.4 kb, R2, which is composed of a repeat unit 9 bp long that is also fairly well conserved. Four genes are predicted downstream of these repetitive sequences. Y5F2A.3 is transcribed from the complementary strand and has no known homology in other species. Y5F2A. 1 and Y5F2A.2 are predicted transthyretin-like genes. Downstream of these genes lies lin-3, which is transcribed from the complementary strand. 10.5 ubc-2 is part of a polycistronic unit Two genes, M7.5 and Y5F2A.4, form a gene cluster with ubc-2. BLAST (basic local alignment search tool) searches predict that M7.5 has homology to a yeast hypothetical protein, YHX1 and a yeast gene called APG7. Comparison of YHX1 and APG7 sequences indicated 108 Figure 24. Genomic organization of the C. elegans and C. briggsae ubc-2 region. A) Schematic representation of the ubc-2 region from C. elegans M7+Y5F2 (top) and C. briggsae G47J11 (bottom). Genes predicted by Genefinder are indicated as boxes and are labelled, non-coding regions as lines and repeat sequences as ovals. Genes located above the line are transcribed left to right, and genes located below the line are transcribed in the opposite direction. Homologous genes are pattern coded. Note that the genomic region in C. briggsae is lacking the genes M7.2 and Y5F2A.3 and the repeats RI and R2. In addition, the Y5F2A.1 homolog has been duplicated. Scale bar indicates 2 kb. B) Dot matrix comparison of C. elegans M7+Y5F2 and C. briggsae G47J11 sequences showing syntenic conservation. M7+Y5F2 sequences (vertical axis) are plotted against G47J11 (horizontal axis). Regions of similarity between the two sequences show as diagonal lines. The relative positions of genes are indicated by solid lines with the accompanying gene name. The arrow indicates a possible control region. 109 A C. elegans M7.3 M7.6 M7.4 ubc-2 apg-7 Y5F2A.4 I | I E 1 1 2 kb Y5F2A.2 Y5F2A.1 I M7.7 v. \ C. briggsae B If) + jg 1 4 3 3 0 -S2 1 6 3 3 0 -c Q) 1 8 3 0 3 -. U 0 0 3 C. briggsae G47J11 5000 I I I , ) , 10300 M 7 . 6 \ \ M 7 . 4 ubc-2 M 7 . 5 5 F 2 A 4 R1 Y 5 F 2 A 2 Y 5 F 2 A . 1 lin-3 20000 : , i 110 t h a t t h e y a r e t h e s a m e g e n e . T h u s , M 7 . 5 i s a C. elegans h o m o l o g o f A P G 7 , a n d w i l l h e n c e f o r t h b e c a l l e d apg-7. Y 5 F 2 A . 4 is a p r e d i c t e d z i n c f i n g e r p r o t e i n . A n a l y s i s o f t h e o r g a n i z a t i o n o f t h e t h r e e g e n e s , ubc-2, apg-7 a n d Y 5 F 2 A . 4 s u g g e s t e d t h a t t h e y m a y b e c o - t r a n s c r i b e d as a p o l y c i s t r o n i c u n i t . A l l t h r e e g e n e s a r e c l o s e l y s p a c e d a n d t r a n s c r i b e d i n t h e s a m e o r i e n t a t i o n . T h e p r e d i c t e d A T G sta r t c o d o n o f apg-7 i s l o c a t e d 4 0 nt d o w n s t r e a m o f t h e ubc-2 p o l y a d e n y l a t i o n s i g n a l ( F i g u r e 2 5 A ) . I m m e d i a t e l y u p s t r e a m o f t h e apg-7 p r e d i c t e d A T G start c o d o n i s a p e r f e c t trans-spWce d o n o r site. T h e p r e d i c t e d A T G sta r t c o d o n o f Y 5 F 2 A . 4 i s l o c a t e d 1 2 0 nt d o w n s t r e a m o f t h e p r e d i c t e d apg-7 p o l y a d e n y l a t i o n s i g n a l . A g a i n , a / r a « 5 - s p l i c e d o n o r s i t e i s l o c a t e d u p s t r e a m o f t h e Y 5 F 2 A . 4 A T G start. T h e g e n o m i c o r g a n i z a t i o n o f t h e s e g e n e s s u g g e s t s t h a t t h e y f o r m a n o p e r o n s u c h t h a t t r a n s c r i p t i o n o f a l l t h r e e g e n e s i s d r i v e n b y a s i n g l e p r o m o t e r / e n h a n c e r r e g i o n l o c a t e d 5' o f t h e ubc-2 gene. 10.6 Trans-splicing of genes in the polycistronic unit T h e g e n o m i c o r g a n i z a t i o n o f t h e t h r e e g e n e s ubc-2, apg-7 a n d Y 5 F 2 A . 4 s t r o n g l y s u g g e s t e d t h a t t h e y f o r m e d a p o l y c i s t r o n i c t r a n s c r i p t i o n a l u n i t . A s d e s c r i b e d i n S e c t i o n 1.6.6, g e n e s w i t h i n o p e r o n s c a n o f t e n b e i d e n t i f i e d b y t h e l e a d e r s e q u e n c e t h a t i s toms-spliced t o t h e m R N A d u r i n g p r o c e s s i n g . I n g e n e r a l , m o n o c i s t r o n i c g e n e s a n d g e n e s t h a t l i e n e a r t h e p r o m o t e r s o f p o l y c i s t r o n i c g r o u p s a c c e p t t h e S L 1 l e a d e r , w h i l e d o w n s t r e a m g e n e s m a y e i t h e r b e e x c l u s i v e l y S L 2 - s p l i c e d , o r m a y u t i l i z e a c o m b i n a t i o n o f S L 1 - a n d S L 2 - s p l i c i n g . P r e v i o u s a n a l y s i s o f ubc-2 c D N A i n d i c a t e d t h a t ubc-2 w a s S L l - s p l i c e d ( Z h e n et al., 1 9 9 6 ) . T o de t e r m i n e i f ubc-2, apg-7 a n d Y 5 F 2 A . 4 w e r e S L 1 - a n d / o r S L 2 - s p l i c e d , S o u t h e r n a n a l y s i s o f c D N A P C R p r o d u c t s w a s p e r f o r m e d . T o t a l R N A w a s i s o l a t e d f r o m a m i x e d s t a g e p o p u l a t i o n o f C. elegans a n d f i r s t s t r a n d c D N A w a s s y n t h e s i z e d . P C R a m p l i f i c a t i o n w a s p e r f o r m e d u s i n g p r i m e r s s p e c i f i c f o r S L 1 o r S L 2 a n d a p r i m e r s p e c i f i c f o r t h e g e n e o f i n t e r e s t . F o r ubc-2, O Z M 2 . r w a s u s e d i n c o m b i n a t i o n w i t h e a c h o f t h e S L p r i m e r s . F o r apg-7 a n d Y 5 F 2 A . 4 , t h e Y H X l - B l . r a n d Z i n c l . r p r i m e r s w e r e u s e d , r e s p e c t i v e l y . T h e a m p l i f i e d s a m p l e s w e r e l o a d e d o n t o a g a r o s e g e l s , s e p a r a t e d b y e l e c t r o p h o r e s i s a n d t r a n s f e r r e d t o a n y l o n m e m b r a n e . T h e m e m b r a n e w a s h y b r i d i z e d w i t h 3 2 P - l a b e l l e d p Z M 1 3 , w h i c h c o n t a i n s a s i n g l e c o p y o f e a c h g e n e . T h e r e s u l t s o f t h e S o u t h e r n b l o t a r e s h o w n i n F i g u r e 2 5 B . A s c a n b e s e e n , ubc-2 w a s e x c l u s i v e l y S L l - s p l i c e d . T h e apg-7 g e n e w a s b o t h S L 1 - a n d S L 2 - s p l i c e d , a l t h o u g h it a p p e a r e d t h a t i t w a s p r e f e r e n t i a l l y S L 2 - s p l i c e d . Y 5 F 2 A . 4 a p p e a r e d t o b e m o s t l y S L l - s p l i c e d . I l l Figure 25. ubc-2 is part of a polycistronic unit that includes apg-7 and a zinc finger gene, and is exclusively SLl-spliced. A ) S c h e m a t i c r e p r e s e n t a t i o n o f t h e w i c - 2 - c o n t a i n i n g p o l y c i s t r o n i c u n i t . G e n e s a r e i n d i c a t e d as b o x e s a n d n o n - c o d i n g r e g i o n s as l i n e s . P r e d i c t e d s p l i c e l e a d e r s e q u e n c e s ( S L ) a n d p o l y a d e n y l a t i o n s i t e s ( p A ) a r e i n d i c a t e d . S c a l e b a r i n d i c a t e s 1 kb. B ) ubc-2 a n d Y 5 F 2 A . 4 are e x c l u s i v e l y S L l - s p l i c e d w h i l e apg-7 i s S L 1 - a n d S L 2 - s p l i c e d . F i r s t s t r a n d c D N A w a s P C R a m p l i f i e d , b l o t t e d a n d p r o b e d w i t h r a d i o l a b e l e d p Z M 1 3 . T h e P C R p r i m e r s u s e d w e r e S L 1 ( s p l i c e d l e a d e r 1) o r S L 2 ( s p l i c e d l e a d e r 2 ) i n c o m b i n a t i o n w i t h O Z M 2 ( f o r ubc-2), Y H X 1 - B ( f o r apg-7) a n d z i n c l ( f o r Y 5 F 2 A . 4 ) . S e e A p p e n d i x C f o r P C R p r i m e r s e q u e n c e s . 112 1 kb ubc-2 PA apg-7 PA Y5F2A.4 SL SL SL B ubc-2 S L 1 S L 2 apg-7 S L 1 S L 2 Y 5 F 2 A . 4 S L 1 S L 2 113 10.7 Syntenic conservation in the ubc-2 region between C. elegans and C. briggsae The extent of genomic conservation between C. elegans and C. briggsae throughout the ubc-2 region was determined. DNA sequence comparisons between the 31.5 kb M7+Y5F2 sequence of C. elegans and the 23 kb G47J11 fosmid sequence of C. briggsae were performed using the Dotter program (Sonnhammer and Durbin, 1996), which compares every nucleotide from one sequence to every nucleotide on the other sequence to create a dot-matrix plot of similarity and a sequence alignment display. This program provides a powerful means for identifying homologies between two sets of sequences. Figure 24B shows that syntenic conservation was fairly strong over this large stretch of DNA with some interesting exceptions. Many of the genes were conserved in location and orientation, and exhibited a high degree of sequence similarity. Intergenic sequences were reduced in length in C. briggsae throughout the region. This has also been observed with other genes such as unc-119 and bli-4 (Maduro and Pilgrim, 1996; Thacker etal, 1999). The structure of the gene cluster containing the C. briggsae homologs of M7.3, M7.7, M7.6 and M7.4 was conserved. In C. briggsae, however, the intergenic regions were much shorter, which brought the predicted genes much closer to one another. Within this cluster, the stop codon of a gene was generally located within 100 bp of the start codon of another gene. In many cases, however, it was difficult to recognize the polyadenylation signal within the short sequence span between the genes. The placement and orientation of the M7.7 homolog (the putative serine-threonine kinase) within the introns of the M7.3 gene was conserved. An interesting exception to the synteny of this region was the apparent deletion of sequences within the region of the M7.2 gene in C. briggsae. M7.2 codes for a kinesin light chain in C. elegans and is missing in the corresponding region in C. briggsae. As a consequence of this deletion, Cb-MIA is in close proximity to the Cb-ubc-2 gene. The ATG start codon of Cb-ubc-2 is 1458 nt downstream of the putative polyadenylation site of Cb-M7.4, while in C. elegans, that same intergenic region is around 3.6 kb and includes the M7.2 gene. Comparison of the ubc-2 region in C. briggsae indicated that the genomic arrangement of Cb-ubc-2, Cb-apg-7 and CA-Y5F2A.4 genes followed the same organization as in C. elegans. The predicted ATG start of Cb-apg-7 is located 65 nt downstream of the Cb-ubc-2 polyadenylation signal, and a /ra«s-splice consensus sequence is located immediately upstream of the ATG start. Interestingly, the sequence of the intergenic region between Cb-ubc-2 and 114 Cb-apg-7 is highly conserved. The predicted ATG start of CZ>-Y5F2A.4 is 265 nt downstream of the putative Cb-apg-7 polyadenylation site. In a reversal of the trend, the intergenic sequence lengths within this polycistronic unit are longer in C. briggsae than they are in C. elegans. Alignment of the Ce-apg-7 and Cb-apg-7 sequences indicates 65.3% identity in genomic sequence. The putative coding sequences were 65.4% identical. The introns of apg-7 were fairly short, and thus did not strongly affect the identities between the genomic and the coding sequences. The polypeptide sequence was 62.5% identical. Polypeptide sequence conservation of apg-7 between the two nematode species was much lower than that observed for ubc-2, which was 100%. Sequence similarity was even less with the Y5F2A.4 homologs. Genomic sequences were 46.2 % identical, coding sequences were 63.6 % , while polypeptide sequence identity was 55.4 %. Upstream of the ubc-2 polycistronic unit there is a short region of similarity between the two species which may include promoter/enhancer control elements of the operon (Figure 24B). A TATA box was predicted in C. elegans within this region 170 bp upstream of the ATG start codon. However, this element was not conserved in C. briggsae. In fact, no TATA elements were found within the 2 kb region upstream of Cb-ubc-2. A 9 kb sequence segment downstream of the ubc-2 polycistronic unit was deleted in C. briggsae. This segment included the large repetitive sequence and the Y5F2A.3 gene. The location of the repetitive element is indicated in Figure 24B as several long vertical lines (marked Rl), indicating that some sequences within the repetitive element are present in the C. briggsae genomic sequence. An examination of the genomic sequence revealed that the sequences present in C. briggsae with similarity to the repeat element were mostly poly-T tracts, which are part of the C. elegans repeat element, Rl. Portions of the Y5F2A.2 transthyretin-like gene sequence, including its location and orientation, were conserved in C. briggsae. Interestingly, the Y5F2A.1 gene homolog has been partially duplicated in C. briggsae and the duplication is located immediately downstream of the first gene copy, with the same orientation. Downstream of the C&-Y5F2A. 1 gene, the Cb-lin-3 gene is also conserved in sequence, location and orientation. In summary, synteny has been conserved in some regions of the genomic sequence flanking ubc-2 in C. elegans and C. briggsae. The ubc-2 polycistronic unit exhibits conservation in gene structure, orientation and in parts of the sequence. Some interesting exceptions to the syntenic conservation have been identified. Genomic sequences immediately 115 surrounding the ubc-2 polycistronic unit have been deleted in C. briggsae. The deletion removes approximately 2.5 kb upstream of ubc-2 and includes the kinesin light chain gene, Ml.2. Another deletion removes approximately 9 kb downstream of the ubc-2 polycistronic unit. The sequences absent in C. briggsae include the 3.5 kb repeat sequence and the putative transthyretin-like gene, Y5F2A.3. In addition, there has been a partial duplication of the Y5F2A. 1 transthyretin-like gene in C. briggsae. Thus, the regions immediately surrounding the ubc-2 polycistronic unit have not been conserved between the two nematode species, although the unit itself has been conserved, as have the sequences flanking the deleted regions. 116 IV. DISCUSSION 1. SUMMARY In this study, a detailed analysis of the let-70 mutant phenotype was undertaken. The principle phenotype was L3 lethal, although some let-70(s689) animals developed into sterile adults. Defects were observed in muscle positioning, attachment and sarcomere assembly. Intestinal cell attachment and maturation were also affected. Within the reproductive system, the somatic gonad and vulva failed to develop properly, and oocytes did not mature. Through dsRNA interference and analysis of a cold-sensitive allele of let-70, pZM13.34, a maternal requirement for UBC-2 was identified. The let-70(s689) allele is a mutation in the splice donor site of the fourth intron that is subject to smg-mediated mRNA surveillance. The s2293 allele is. a large deletion that spans many essential genes, including ubc-2. ubc-2 forms part of a polycistronic unit with two other genes, apg-7 and Y5F2A.4. The amino acid composition of C . elegans UBC-2 is 100% identical to C. briggsae UBC-2. When genomic sequences surrounding the ubc-2 gene were compared between the two species, a high degree of synteny was observed; however, some interesting differences were seen in the sequences surrounding the ubc-2 operon. 2. COMPARA TIVE GENOMIC ANAL YSIS OF ubc-2 Comparative genomic analysis was used to delineate the structural organization of ubc-2 and the sequences surrounding this gene. The polypeptide sequence of UBC-2 is absolutely conserved between C. elegans and C. briggsae. While 100% polypeptide sequence conservation has been noted for specific protein domains between the two species (Kuwabara and Shah, 1994), such high conservation has, to our knowledge, not been previously documented for complete polypeptide sequences. In general, the highest degree of polypeptide sequence conservation between homologous genes in C. elegans and C. briggsae ranges from 90-96% for genes such as UbL, unc-119 and bli-4 (Jones and Candido, 1993; Maduro and Pilgrim, 1996; Thacker et al., 1999). This indicates that selective pressure on ubc-2 is extremely high. The absolute conservation of UBC-2, coupled with its lethality when mutated, also indicates that UBC-2 performs an important function that is sensitive to amino acid alterations. Since UBC-2 is a small protein, its function may depend upon the entire structure of the protein such that polypeptide sequence alterations are not tolerated. The other genes that 117 a r e b e l i e v e d t o f o r m a p o l y c i s t r o n i c u n i t w i t h ubc-2 a r e n o t as w e l l c o n s e r v e d , i n d i c a t i n g t h a t ubc-2 i s t h e o n l y g e n e w i t h i n t h e o p e r o n t h a t i s s u b j e c t t o s u c h s t r o n g s e l e c t i v e p r e s s u r e . T h e g e n o m i c s e q u e n c e s s u r r o u n d i n g ubc-2 i n d i c a t e t h a t ubc-2 m a y b e t h e f i r s t g e n e o f a n o p e r o n t h a t c o n t a i n s t w o o t h e r g e n e s , apg-7 a n d t h e p u t a t i v e z i n c f i n g e r p r o t e i n , Y 5 F 2 A . 4 . T h e g e n e s a r e i n c l o s e p r o x i m i t y t o o n e a n o t h e r , a n d a trans-sp\ice d o n o r s i t e i s l o c a t e d i m m e d i a t e l y u p s t r e a m o f t h e A T G start c o d o n o f a l l t h r e e g e n e s . B o t h ubc-2 a n d Y 5 F 2 A . 4 a p p e a r t o b e o n l y S L l - s p l i c e d w h i l e apg-7 i s b o t h S L 1 - a n d S L 2 - s p l i c e d . I n C. elegans o p e r o n s , t h e first g e n e i s u s u a l l y S L l - s p l i c e d w h i l e a l l o t h e r d o w n s t r e a m g e n e s a r e e i t h e r e x c l u s i v e l y S L 2 - s p l i c e d o r a r e s p l i c e d b y a m i x t u r e o f S L 1 a n d S L 2 ( S p i e t h et al., 1 9 9 3 ; Z o r i o et al, 1 9 9 4 ) . B a s e d o n t h i s i n f o r m a t i o n , ubc-2 a n d apg-7 a r e l i k e l y t o f o r m a n o p e r o n , a l t h o u g h it i s n o t c l e a r w h e t h e r Y 5 F 2 A . 4 i s a l s o p a r t o f t h i s o p e r o n . A n e w f o r m o f o p e r o n h a s b e e n i d e n t i f i e d i n w h i c h t h e m R N A o f t h e d o w n s t r e a m g e n e i s *ra«s-spliced t o S L 1 r a t h e r t h a n S L 2 ( H e n g a r t n e r a n d H o r v i t z , 1 9 9 4 ) . I n t h i s t y p e o f o p e r o n , t h e i n t e r c i s t r o n i c s e q u e n c e i s l a c k i n g , s u c h t h a t t h e p o l y a d e n y l a t i o n s i t e o f t h e u p s t r e a m g e n e i s a d j a c e n t t o t h e / r a w s - s p l i c e s i t e o f t h e d o w n s t r e a m gene. A l t h o u g h t h i s p a r t i c u l a r s i t u a t i o n d o e s n o t e x i s t b e t w e e n apg-7 a n d Y 5 F 2 A . 4 , it s e r v e s t o i n d i c a t e t h a t S L 2 - s p l i c i n g o f d o w n s t r e a m g e n e s i s n o t a n a b s o l u t e r e q u i r e m e n t f o r o p e r o n s . T h u s , Y 5 F 2 A . 4 m i g h t b e p a r t o f t h e ubc-2lapg-7 o p e r o n , a n d m a y u t i l i z e a n o v e l s p l i c i n g m e c h a n i s m . M a n y C. elegans o p e r o n s a r e m a d e u p o f g e n e s w i t h r e l a t e d f u n c t i o n s ( C l a r k et al, 1994; H u a n g et al, 1994; P a g e , 1999; T r e i n i n et al, 1998). T h u s , i t i s i n t e r e s t i n g t o n o t e t h a t t h e apg-7 g e n e i s p a r t o f a s y s t e m s i m i l a r t o u b i q u i t i n - m e d i a t e d d e g r a d a t i o n . I n y e a s t , A p g 7 i s a u b i q u i t i n - a c t i v a t i n g e n z y m e - l i k e p r o t e i n t h a t is i n v o l v e d i n a u t o p h a g y ( M i z u s h i m a et al, 1 9 9 8 ) , t h e b u l k d e l i v e r y o f c y t o p l a s m i c m a t e r i a l t o t h e l y s o s o m e f o r d e g r a d a t i o n ( D u n n , 1 9 9 4 ) . I n a p r o c e s s s i m i l a r t o u b i q u i t i n a t i o n , A p g l 2 ( a u b i q u i t i n - l i k e m o l e c u l e ) i s a c t i v a t e d b y b i n d i n g t o A p g 7 v i a a h i g h - e n e r g y t h i o e s t e r b o n d . A p g l 2 i s t r a n s f e r r e d t h r o u g h A p g l O ( a n E 2 - l i k e m o l e c u l e ) a n d i s c o n j u g a t e d t o A p g 5 v i a a n i s o p e p t i d e b o n d . H o m o l o g s o f t h i s s y s t e m h a v e b e e n f o u n d i n Drosophila, h u m a n s , a n d n o w i n C. elegans, i n d i c a t i n g t h a t t h i s c o n j u g a t i o n s y s t e m i s c o n s e r v e d ( M i z u s h i m a et al, 1998). U B C - 2 a n d A P G - 7 p r o b a b l y d o n o t f u n c t i o n w i t h i n t h e s a m e p a t h w a y , a l t h o u g h t h e a c t i v i t i e s o f t h e i r r e s p e c t i v e p a t h w a y s a r e s i m i l a r . It i s m o r e l i k e l y t h a t t h e s e g e n e s a r e r e q u i r e d at a p p r o x i m a t e l y t h e s a m e t i m e d u r i n g d e v e l o p m e n t a n d t h u s u t i l i z e a c o m m o n p r o m o t e r . 118 Synteny is conserved over a large sequence tract surrounding the ubc-2 gene in C. elegans and C. briggsae. There are, however, several regions where synteny is not maintained. In particular, sequences immediately upstream and downstream of the ubc-2 operon are different between the two species. The upstream kinesin light chain gene, and a downstream 9 kb segment including a repetitive sequence and the Y5F2A.3 gene, are absent in C. briggsae. Whether these sequences have been translocated or deleted is unknown. However, the Cb-Y5F2A.1 gene has been partially duplicated, which suggests that a translocation event has taken place in C. briggsae. It is tempting to speculate that the absence of the 9 kb segment might be associated with this event. It is of interest to note that while the sequences immediately surrounding the ubc-2 operon have been altered, the operon itself and more distant sequences have not changed dramatically between the two species. These alterations indicate that relatively large scale changes have occurred that affect the synteny of C. elegans and C. briggsae sequences. The effect of these sequence alterations on gene expression in this region is unknown. The inability of the C. briggsae fosmid G47J11 to rescue C. elegans let-70 mutants was surprising. Considering the absolute conservation of UBC-2 between the two species, Cb-ubc-2 should be able to rescue C. elegans let-70 mutants if expressed in the proper spatial and temporal pattern. Thus, it appears that Cb-ubc-2 was not properly expressed in C. elegans mutants. Several attempts were made to generate transgenic animals with functional Cb-ubc-2 by injecting a number of different constructs at varying DNA concentrations. While roller progeny were produced in most cases, indicating that pRF4 was present and functional, G47J11 may not have been incorporated at a concentration that was conducive to proper ubc-2 expression. It is possible that the fosmid sequence has undergone a rearrangement leading to the apparent deletions observed in the regions surrounding the ubc-2 operon. A comparison of this region between the fosmid and C. briggsae genomic DNA using Southern analysis would help to determine if such a rearrangement had occurred. G47J11 contains 8 kb up- and 15 kb downstream of Cb-ubc-2, while the C. elegans plasmid pZM13, which can fully rescue let-70(s689) mutants, contains 7 kb up- and 6 kb downstream of ubc-2. If G47J11 is missing a key regulatory element for ubc-2 expression, it is probably located upstream, since the fosmid contains a much longer downstream sequence than pZM13. Interestingly, a TATA element was located approximately 170 bp upstream of the Ce-119 ubc-2 ATG start codon, while one could not be found upstream of Cb-ubc-2. As noted above, the sequences upstream of the ubc-2 operon in these two species have diverged. In C. elegans, a kinesin light chain gene is located upstream of Ce-ubc-2 while in C. briggsae, this gene is missing. The M7.4 homolog is closer to Cb-ubc-2, with the ATG start codon of Cb-ubc-2 only 1458 nt downstream of the putative polyadenylation site of M7.4 (see Figure 24). This raises the possibility that the Cb-ubc-2 operon is linked to the putative upstream operon such that all of the genes are transcribed under a common promoter. If this has occurred, it raises the question of how such a change in the organization of ubc-2 regulation could occur between C. elegans and C. briggsae without affecting the essential UBC-2 function during the intermediate stages. The 5' non-coding region of the putative upstream operon containing the genes M7.3, M7.6 and M7.4 is not present in G47J11. If Cb-ubc-2 is a downstream gene within this operon, then G47J11 would not contain the Cb-ubc-2 promoter and therefore could not express Cb-ubc-2. A C. briggsae fosmid with a longer sequence upstream of Cb-ubc-2 has been placed in the sequencing queue at the Genome Sequencing Center in St. Louis. If this fosmid contains the promoter region for the putative operon, it will be interesting to determine whether it can rescue let-70 mutants. 3. let- 70(s689) IS SUBJECT TO smg-MEDIA TED mRNA SUR VEILLANCE Sequencing of the ubc-2 cDNA generated from let-70(s689) mutant animals shows that the fourth intron of ubc-2 is generally not removed when the pre-rnRNA is processed. Conceptual translation of the mutant cDNA reveals an in-frame termination codon within the fourth intron, suggesting that a truncated protein product could be produced in let-70(s689) mutants. However, a truncated UBC-2 product is not detected in extracts from let-70(s689) mutants, indicating that if made, it is highly unstable. Alternatively, the s689 mRNA might be subject to nonsense-mediated mRNA decay (NMD) such that the s689 transcript is degraded prior to translation, resulting in very little protein product. The partial rescue of let-70(s689) smg-1 double mutants indicates that the mutant mRNA transcript is subject to NMD. Removal of the mRNA surveillance system is sufficient to rescue let-70 smg-1 double mutants, but cannot rescue the progeny of these mutants, causing maternal effect lethality. Two possible explanations can be envisioned for the partial rescue. Both hypotheses assume that the smg-1 mutation prevents proper NMD function, and that 120 m u t a n t ubc-2 t r a n s c r i p t s f a i l t o b e e f f i c i e n t l y d e g r a d e d . T h e f i r s t p o s s i b i l i t y i s t h a t a t r u n c a t e d U B C - 2 p r o t e i n i s p r o d u c e d t h a t i s p a r t i a l l y a c t i v e a n d c a p a b l e o f r e s c u i n g s o m e o f t h e let-70 d e f e c t s . T h e t r u n c a t e d p r o t e i n w o u l d l a c k 14 a m i n o a c i d s f r o m t h e c a r b o x y l t e r m i n u s , i m p l y i n g t h a t t h e s e r e s i d u e s a r e n o t r e q u i r e d t o r e s c u e s o m a t i c a n d g e r m l i n e d e f e c t s , b u t a r e n e c e s s a r y f o r e a r l y e m b r y o n i c f u n c t i o n . T h e s e c o n d p o s s i b i l i t y i s b a s e d o n t h e o b s e r v a t i o n t h a t a s m a l l a m o u n t o f c o r r e c t l y s p l i c e d ubc-2 m R N A i s p r o d u c e d i n let-70(s689) m u t a n t s , i n d i c a t i n g t h a t t h e C. elegans s p l i c e o s o m e c a n o c c a s i o n a l l y u t i l i z e t h e m u t a t e d s p l i c e d o n o r site, r e m o v e t h e f o u r t h i n t r o n , a n d p r o d u c e c o r r e c t l y s p l i c e d ubc-2 m R N A . I n let-70(s689) a n i m a l s , a l l s i g n a l s n e c e s s a r y f o r p r o p e r s p l i c i n g o f t h e f o u r t h i n t r o n a r e p r e s e n t w i t h t h e e x c e p t i o n o f t h e 5' s p l i c e d o n o r site. P e r h a p s t h e s p l i c e o s o m e r e c o g n i z e s t h e s p l i c i n g s i g n a l s t h a t a r e p r e s e n t and, w h i l e s e a r c h i n g f o r a 5' s p l i c e d o n o r site, o c c a s i o n a l l y u t i l i z e s t h e m u t a t e d site. I f t h i s o c c u r s i n let-70(s689) m u t a n t s , t h e a m o u n t o f p r o p e r l y s p l i c e d ubc-2 t r a n s c r i p t w o u l d d e p e n d o n t h e f r e q u e n c y w i t h w h i c h t h e s p l i c e o s o m e u s e s t h e m u t a n t 5' s p l i c e d o n o r site. T h e p r o b a b i l i t y o f m u t a n t s i t e u s a g e w o u l d v a r y b e t w e e n i n d i v i d u a l s , a n d m i g h t e x p l a i n w h y t h e let-70(s689) m u t a n t p h e n o t y p e i s s o h i g h l y v a r i a b l e . I f a c o r r e c t l y s p l i c e d t r a n s c r i p t w e r e p r o d u c e d f a i r l y o f t e n , t h e n t h e i n d i v i d u a l m i g h t p r o d u c e e n o u g h w i l d t y p e U B C - 2 t o s u r v i v e t o t h e a d u l t stage. A n o b v i o u s e x t e n s i o n o f t h i s s c e n a r i o i s t h a t s o m e let-70(s689) m u t a n t a n i m a l s m i g h t p r o d u c e e n o u g h U B C - 2 t o g e n e r a t e v i a b l e o f f s p r i n g . I n f a c t , v i a b l e o f f s p r i n g w e r e s o m e t i m e s o b s e r v e d , a l t h o u g h i t w a s n o t d e t e r m i n e d w h e t h e r t h e s e i n d i v i d u a l s w e r e s u r v i v i n g m u t a n t s o r r e v e r t a n t s r e s u l t i n g f r o m r e c o m b i n a t i o n e v e n t s o c c u r r i n g b e t w e e n let-70 a n d unc-22. I n let-70 smg-1 d o u b l e m u t a n t s , i m p r o p e r u t i l i z a t i o n o f t h e m u t a n t 5' s p l i c e d o n o r s i t e b y t h e s p l i c e o s o m e m i g h t a l s o o c c u r . S i n c e t h e m u t a n t m R N A i s l i k e l y t o b e m o r e s t a b l e i n t h e smg-1 b a c k g r o u n d , a g r e a t e r n u m b e r o f c o r r e c t l y s p l i c e d ubc-2 t r a n s c r i p t s m i g h t b e g e n e r a t e d t h a n i n let-70(s689) s i n g l e m u t a n t s . T h u s , m o r e w i l d t y p e U B C - 2 m a y b e p r o d u c e d i n let-70 smg-1 d o u b l e m u t a n t s , p e r h a p s i n s u f f i c i e n t q u a n t i t i e s t o r e s c u e t h e s o m a t i c a n d g e r m l i n e d e f e c t s . H o w e v e r , t h i s l e v e l g e n e r a l l y a p p e a r s t o b e i n s u f f i c i e n t f o r e m b r y o g e n e s i s . T h i s s c e n a r i o w o u l d a l s o p r e d i c t t h a t s o m e i n d i v i d u a l s s h o u l d p r o d u c e e n o u g h U B C - 2 f o r m a t e r n a l r e s c u e as w e l l . W h i l e t h i s w a s n o t o b s e r v e d , a n e x a m i n a t i o n o f a l a r g e r n u m b e r o f p r o g e n y from let-70 smg-1 d o u b l e m u t a n t s m i g h t r e v e a l r a r e f u l l r e s c u e o f let-70 smg-1 d o u b l e m u t a n t s . 121 4. let- 70(sll32) ANIMALS PRODUCE AN UNSTABLE FORM OF UBC-2 Western analysis indicates that the mutant form of UBC-2 produced in let-70(sl 132) animals is unstable. The histidine to tyrosine mutation affects the conserved HPN tripeptide that is necessary for maintaining tertiary structure of UBCs in vertebrates (see Section 1.3.2; R. W. Bohnsack, pers. comm.). Thus, it appears that the instability of UBC-2 in let-70(sll32) animals is caused by misfolding of the mutant protein. If this protein is inactive and quickly degraded, si 132 may represent a genetic null allele of let-70, indicating that the let-70(sl 132) mutant phenotype is due to loss of UBC-2. 5. UBC-2 STRUCTURE: INSIGHTS FROM A TEMPERA TU RE-SENSITIVE ALLELE The P61S allele of let-70, pZM13.34, is cold-sensitive when expressed in a let-70(s689) background. At 25°C, let-70(s689) transgenics are fully rescued, indicating that the pZM13.34 protein is functional in both germline and somatic tissue. However, at 15°C, transgenic animals expressing pZM13.34 exhibited maternal effect lethality, indicating that the temperature-dependent structural change in pZM13.34 protein abolishes maternal UBC-2 function, but not somatic function. Thus, UBC-2 activity within the early embryo is distinct from its other functions during development, and may involve different regions of the protein. A number of C. elegans proteins perform discrete functions during development. For example, GLP-1 is involved in early cell fate decisions during embryogenesis and is also important in signalling from the distal tip cell to promote germline proliferation (Schedl, 1997; Schnabel and Priess, 1997). Many protein-protein associations occur through hydrophobic interactions, the strength of which are based mainly on entropy changes, and thus decrease with temperature. The cold sensitivity of the pZM13.34 allele suggests that a protein-protein interaction is lost at 15°C that may be driven by hydrophobic effects. The P61S mutation may destabilize UBC-2-protein interactions such that they are lost at lower temperature. The association may involve a specific E3-binding or substrate-binding site on UBC-2. In addition, it is known that E2s will self-associate to form dimers and multimers (Ptak et al., 1994; Leggett and Candido, 1997). Thus, the ability of the pZM13.34 protein to bind to itself or other protein partners may be impaired at lower temperature. While pZM13.34 is capable of rescuing let-70(s689) mutants at 25°C, it is unable to rescue let-70(sl 132) mutants at any temperature. Interestingly, however, the intestinal defects 122 w e r e r e s c u e d , w h i l e t h e s o m a t i c g o n a d d e f e c t s a n d s t e r i l i t y w e r e not. B o d y w a l l m u s c l e d e f e c t s w e r e n o t a s s e s s e d i n t h e s e a n i m a l s . D e s p i t e t h e p r o b a b l e p r e s e n c e o f a s e c o n d s i t e m u t a t i o n i n let-70(sl 132) a n i m a l s , t h e r e s c u e o f i n t e s t i n a l , b u t n o t g o n a d a l , d e f e c t s b y t h e p Z M 1 3 . 3 4 p r o t e i n r a i s e s t h e p o s s i b i l i t y t h a t U B C - 2 a c t i v i t y d u r i n g i n t e s t i n a l d e v e l o p m e n t m i g h t b e d i s t i n c t f r o m i t s f u n c t i o n d u r i n g g o n a d f o r m a t i o n . T h e p r o t e i n b i n d i n g p a r t n e r s m a y c h a n g e d u r i n g d e v e l o p m e n t a n d i n d i f f e r e n t t i s s u e s . I f U B C - 2 s e l f - a s s o c i a t e s t o b e c o m e a c t i v e , p Z M 1 3 . 3 4 a n d si 132 p r o t e i n s m i g h t i n t e r a c t w i t h e a c h o t h e r i n t r a n s g e n i c a n i m a l s , p r o d u c i n g a c o m p l e x t h a t f u n c t i o n s i m p r o p e r l y a n d i n t e r f e r e s w i t h g o n a d a l d e v e l o p m e n t . T h e c o l d - s e n s i t i v e a l l e l e o f let-70 s h o w s t h a t U B C - 2 has d i s t i n c t f u n c t i o n s d u r i n g C . elegans d e v e l o p m e n t t h a t c a n b e s e p a r a t e d i n t o e m b r y o n i c , s o m a t i c a n d g e r m l i n e a c t i v i t i e s . S i n c e t h e p Z M 1 3 . 3 4 a l l e l e i n t e r f e r e s w i t h s o m e o f t h e s e f u n c t i o n s , it m a y p r o v e u s e f u l i n i d e n t i f y i n g U B C - 2 a c t i v i t y at s p e c i f i c t i m e s d u r i n g d e v e l o p m e n t . B y u t i l i z i n g t h e m a t e r n a l e f f e c t l e t h a l p h e n o t y p e o f let-70(s689) m u t a n t s c a r r y i n g t h e p Z M 1 3 . 3 4 t r a n s g e n e , g e n e t i c s c r e e n s c o u l d b e d e s i g n e d t o i d e n t i f y s u p p r e s s o r s o f let-70 e m b r y o n i c l e t h a l i t y . S i m i l a r l y , g e n e t i c s c r e e n s c o u l d b e d e s i g n e d t o i d e n t i f y s u p p r e s s o r s o f let-70 s o m a t i c a n d g e r m l i n e d e f e c t s . U B C - 2 p r o b a b l y i n t e r a c t s w i t h a n u m b e r o f E 3 s a n d / o r s u b s t r a t e s at v a r i o u s t i m e s d u r i n g d e v e l o p m e n t , a n d s u c h s c r e e n s m a y h e l p t o i d e n t i f y a n d i s o l a t e t h e s e p r o t e i n s . 6. BOTH MA TERNAL AND POST-EMBR YONIC CONTRIBUTIONS OF UBC-2 ARE REQUIRED A s d e s c r i b e d b y F i r e et al ( 1 9 9 8 ) , R N A i n t e r f e r e n c e i n C . elegans i s b e l i e v e d t o s i l e n c e e x p r e s s i o n i n a g e n e - s p e c i f i c m a n n e r . P h e n o t y p e s p r o d u c e d b y i n t e r f e r e n c e m i m i c l o s s - o f -f u n c t i o n m u t a t i o n s a n d h a v e b e e n u s e d t o d e t e r m i n e t h e p u t a t i v e n u l l s t a t e o f m a n y g e n e s ( F i t z g e r a l d a n d S c h w a r z b a u e r , 1998; F a y et al, 1999; A s h c r o f t et al, 1 9 9 9 ) . R N A i n t e r f e r e n c e o f ubc-2 p r o d u c e d t w o p h e n o t y p e s : e m b r y o n i c l e t h a l a n d L 3 l e t h a l . T h e e m b r y o n i c l e t h a l i t y s u p p o r t s t h e p r e v i o u s l y d e s c r i b e d let-70(s689) smg-1 d o u b l e m u t a n t a n d t e m p e r a t u r e - s e n s i t i v e a l l e l e d a t a w h i c h i n d i c a t e s a m a t e r n a l r e q u i r e m e n t f o r U B C - 2 . P o s t - e m b r y o n i c a l l y , t h e let-70 n u l l p h e n o t y p e a p p e a r s t o b e L 3 l e t h a l i t y . T h i s s u g g e s t s t h a t let-70(sl 132) i s a n u l l a l l e l e , a p o s s i b i l i t y t h a t i s s u p p o r t e d b y t h e i n s t a b i l i t y o f U B C - 2 i n m u t a n t a n i m a l s a n d t h e o b s e r v a t i o n t h a t h e m i z y g o u s let-70(sll32) a n i m a l s a r e a l s o L 3 l e t h a l . T h e L 3 a r r e s t m a y r e s u l t f r o m t h e i n a b i l i t y o f let-70 m u t a n t s t o d e g r a d e a s p e c i f i c s u b s t r a t e p r o t e i n at a c r i t i c a l t i m e . 123 A l t e r n a t i v e l y , d e f e c t s c a u s e d b y U B C - 2 d y s f u n c t i o n m a y a c c u m u l a t e s u c h t h a t b y L 3 , t h e a n i m a l s a r e u n a b l e t o d e v e l o p a n y f u r t h e r . T h e s i m i l a r i t y o f t h e U B C d o m a i n w i t h i n t h e E 2 f a m i l y o f e n z y m e s r a i s e s t h e p o s s i b i l i t y t h a t t h e p h e n o t y p e s o b s e r v e d b y R N A i n t e r f e r e n c e m a y b e c a u s e d b y t h e s i l e n c i n g o f m a n y E 2 s . T w o l i n e s o f e v i d e n c e s u g g e s t t h a t t h i s i s n o t t h e cas e . F i r s t , w h e n ubc-2 i s h y b r i d i z e d t o C. elegans g e n o m i c D N A , o n l y o n e g e n e p r o d u c t i s d e t e c t e d ( Z h e n , 1 9 9 6 ) . S e c o n d , b o t h t h e e m b r y o n i c a n d L 3 a r r e s t p h e n o t y p e s w e r e o b s e r v e d i n let-70 m u t a n t s a n d i n t r a n s g e n i c a n i m a l s c o n t a i n i n g d i f f e r e n t a l l e l e s o f let-70, s u g g e s t i n g t h a t t h e s e p h e n o t y p e s a r e t h e r e s u l t o f s p e c i f i c l o s s o r r e d u c t i o n i n U B C - 2 f u n c t i o n . 7. UBC-2 IS REQUIRED IN BOTH SOMA TIC AND GERMLINE TISSUE T h e p l a s m i d p Z M 1 3 i s c a p a b l e o f f u l l y r e s c u i n g let-70(s689) w h e n e x p r e s s e d i n b o t h s o m a t i c a n d g e r m l i n e t i s s u e . A c c o r d i n g t o K e l l y et al. ( 1 9 9 7 ) , s o m a t i c a n d g e r m l i n e e x p r e s s i o n o f e x t r a c h r o m o s o m a l a r r a y s c a n b e o b t a i n e d i n C . elegans w h e n r a n d o m g e n o m i c D N A f r a g m e n t s a r e i n c l u d e d i n t h e i n j e c t i o n m i x t u r e . It is b e l i e v e d t h a t t h e a d d i t i o n a l D N A i n c r e a s e s t h e g e n e t i c c o m p l e x i t y o f t h e a r r a y , t h u s p r e v e n t i n g i t s s i l e n c i n g i n t h e g e r m l i n e . T h i s a p p e a r s t o b e t r u e f o r U B C - 2 , s i n c e i n j e c t i o n o f p Z M 1 3 a l o n e g i v e s p a r t i a l r e s c u e o f let-70(s689) m u t a n t s , w h i l e a d d i t i o n o f r a n d o m g e n o m i c D N A i n t h e i n j e c t i o n m i x t u r e r e s u l t s i n f u l l r e s c u e . T h u s , p Z M 1 3 a p p e a r s t o c o n t a i n a l l o f t h e s e q u e n c e s n e c e s s a r y f o r t h e p r o p e r s p a t i a l a n d t e m p o r a l e x p r e s s i o n o f U B C - 2 . A l t h o u g h s o m a t i c a n d g e r m l i n e e x p r e s s i o n o f p Z M 1 3 c a n r e s c u e let-70(s689), p Z M 1 3 i s i n c a p a b l e o f r e s c u i n g let-70(sl 132), i n d i c a t i n g t h a t a f u n d a m e n t a l d i f f e r e n c e e x i s t s b e t w e e n t h e t w o m u t a n t s t r a i n s . T h e s i m p l e s t e x p l a n a t i o n i s t h a t let-70(sl 132) h a s a s e c o n d s i t e m u t a t i o n t h a t a f f e c t s t h e r e s c u i n g a b i l i t y o f p Z M 1 3 . A l t h o u g h t h i s s t r a i n w a s o u t c r o s s e d t o N 2 a n i m a l s at l e a s t t e n t i m e s , a s e c o n d m u t a t i o n m a y y e t e x i s t t h a t i s c l o s e t o let-70 o r l i e s b e t w e e n let-70 a n d unc-22. T h e s e c o n d m u t a t i o n , i f p r e s e n t , a p p e a r s t o b e r e q u i r e d e m b r y o n i c a l l y s i n c e e x p r e s s i o n o f p Z M 1 3 w a s a b l e t o r e s c u e t h e F l b u t n o t t h e F 2 p r o g e n y o f t r a n s g e n i c let-70(sll32) a n i m a l s . A l t e r n a t i v e l y , t h e m u t a n t U B C - 2 p r o t e i n p r o d u c e d i n let-70(sl 132) a n i m a l s m a y i n t e r f e r e w i t h t h e f u n c t i o n o f t h e w i l d t y p e p r o t e i n t h r o u g h E 2 s e l f - a s s o c i a t i o n . T h i s i s a l e s s l i k e l y s c e n a r i o s i n c e si 132 d o e s n o t a c t as a d o m i n a n t n e g a t i v e a l l e l e ; r a t h e r , it i s r e c e s s i v e , a n d h e t e r o z y g o t e s a r e p h e n o t y p i c a l l y w i l d t y p e . 124 8. THE POSSIBLE ROLE OF UBC-2 IN C. elegans SIGNALLING PATHWA YS T h e p l e i o t r o p i c p h e n o t y p e o f let-70 p r o v i d e s i n s i g h t i n t o t h e r o l e o f U B C - 2 d u r i n g C. elegans d e v e l o p m e n t . T h e p h e n o t y p e i n c l u d e s d e f e c t s i n i n t e s t i n a l c e l l m a t u r a t i o n a n d a t t a c h m e n t t o t h e h y p o d e r m i s , t h e p o s i t i o n i n g , a s s e m b l y a n d a t t a c h m e n t o f b o d y w a l l m u s c l e c e l l s , g o n a d a n d v u l v a d e v e l o p m e n t , a n d t h e f o r m a t i o n , m a t u r a t i o n a n d m i g r a t i o n o f o o c y t e s . B o t h s o m a t i c a n d g e r m l i n e e x p r e s s i o n o f U B C - 2 a r e r e q u i r e d t o r e s c u e let-70 m u t a n t s . A m a t e r n a l e f f e c t l e t h a l ( M E L ) p h e n o t y p e w a s o b s e r v e d i n t h e p r o g e n y o f a n i m a l s i n j e c t e d w i t h d s R N A d i r e c t e d t o ubc-2; i n t h e p r o g e n y o f r e s c u e d let-70(s689) smg-1 d o u b l e m u t a n t s ; a n d i n t r a n s g e n i c let-70(s689) m u t a n t s c a r r y i n g p Z M 1 3 . 3 4 w h e n r a i s e d at t h e n o n - p e r m i s s i v e t e m p e r a t u r e . E m b r y o n i c e x p r e s s i o n o f U B C - 2 w a s u b i q u i t o u s , a n d d u r i n g l a r v a l d e v e l o p m e n t , e x p r e s s i o n b e c a m e c o n c e n t r a t e d i n t h e n u c l e o l i o f m a n y c e l l s , i n t h e d e n s e b o d i e s o r M - l i n e s o f b o d y w a l l m u s c l e a n d i n c e r t a i n n e u r o n s . I n g e n e r a l , U B C - 2 p l a y s a r o l e i n t h r e e f a c e t s o f C. elegans d e v e l o p m e n t : e m b r y o n i c , s o m a t i c a n d g e r m l i n e . T h e e m b r y o n i c a c t i v i t y o f U B C - 2 m a y b e r e l a t e d t o e a r l y c e l l f a t e d e c i s i o n s . T h e m i g r a t i o n , a t t a c h m e n t a n d m a t u r a t i o n o f m o s t c e l l s a r e s o m a t i c f u n c t i o n s , w h i l e o o c y t e m a t u r a t i o n i s l i k e l y d u e t o U B C - 2 a c t i v i t y i n t h e g e r m l i n e . U B C - 2 m a y f u n c t i o n i n d e v e l o p m e n t i n a n u m b e r o f w a y s . U B C - 2 m a y b e r e q u i r e d i n d e p e n d e n t l y d u r i n g t h e p r o c e s s e s o f c e l l a t t a c h m e n t , m u s c l e c e l l p o s i t i o n i n g , s a r c o m e r e a s s e m b l y , g o n a d a n d v u l v a l d e v e l o p m e n t a n d o o c y t e m a t u r a t i o n . A r e d u c t i o n o r l o s s o f U B C - 2 a c t i v i t y c o u l d a f f e c t e a c h p a t h w a y s e p a r a t e l y , r e s u l t i n g i n t h e p l e i o t r o p i c p h e n o t y p e t h a t i s o b s e r v e d i n let-70 m u t a n t a n i m a l s . H o w e v e r , m a n y o f t h e s e d e v e l o p m e n t a l p r o g r a m s u t i l i z e t h e s a m e o r s i m i l a r s i g n a l l i n g p a t h w a y s , s o m e o f w h i c h a r e k n o w n t o b e r e g u l a t e d b y u b i q u i t i n -m e d i a t e d p r o t e i n d e g r a d a t i o n . T h u s , it i s p o s s i b l e t h a t t h e let-70 p h e n o t y p e i s c a u s e d b y a d e c r e a s e i n U B C - 2 a c t i v i t y w i t h i n a s m a l l n u m b e r o f s i g n a l l i n g p a t h w a y s t h a t u l t i m a t e l y a f f e c t m a n y d e v e l o p m e n t a l p r o c e s s e s . T h e p h e n o t y p e s o b s e r v e d i n let-70 m u t a n t s s u g g e s t s t h a t t h e s e p a t h w a y s m i g h t i n c l u d e C. elegans W n t / W g , NF-KB, i n t e g r i n - m e d i a t e d a n d M A P K s i g n a l l i n g c a s c a d e s . I n a d d i t i o n , U B C - 2 m a y p l a y a r o l e i n c e l l c y c l e p r o g r e s s i o n w i t h i n t h e g e r m l i n e . 8.1 Integrin-mediated and MAPK signalling pathways I n let-70 m u t a n t s , t h e d e t a c h m e n t p h e n o t y p e o b s e r v e d i n b o d y w a l l m u s c l e a n d i n t e s t i n a l c e l l s i n d i c a t e s t h a t U B C - 2 i s i n v o l v e d i n c e l l a t t a c h m e n t . D u r i n g d e v e l o p m e n t , b o d y w a l l m u s c l e c e l l s , i n t e s t i n a l c e l l s a n d t h e s o m a t i c g o n a d f o r m a t t a c h m e n t s t o t h e h y p o d e r m i s 125 through the basement membrane (also called extracellular membrane; ECM). In C. elegans, the process of body wall muscle attachment to the ECM has been intensively studied (see Section 1.6.4), and it is believed that other cell-ECM attachments are formed by a similar process. In muscle, cell-ECM attachments utilize integrins (Gettner et al., 1995), suggesting that UBC-2 may play a role in anchoring cells to the ECM via integrin receptors. During muscle development, cell positioning, cell attachment and sarcomere assembly are integrated processes. Many signalling pathways and structural components in muscle, basement membrane and hypodermis function co-operatively to mediate the formation of body wall muscle (see Section 1.6.4). Briefly, myoblast cells migrate from a lateral position to the dorsal and ventral quadrants. Muscle, hypodermal and basement membrane components localize at sites called dense bodies, where integrin-based attachment structures are formed and the muscle sarcomere is assembled. Mutations in many C. elegans genes involved in cell attachment result in mutant muscle phenotypes that resemble that of let-70. Examples include deb-1 (vinculin; Barstead and Waterston, 1989), pat-3 (p-integrin; Williams and Waterston, 1994; Gettner et al., 1995), pat-2 (a-integrin; Williams and Waterston, 1994), unc-52 (perlecan; Rogalski et al, 1993), mua-3 (a novel transmembrane protein; E.A. Bucher, pers. comm.), mua-1 (a transcription factor, J. Plenefish, pers. comm.), mup-2 (troponin T; Myers et al, 1996) and mup-4 (a novel transmembrane protein; E.A. Bucher, pers. comm.). The null allele of these genes is usually Pat (paralyzed arrest at embryonic two-fold stage; Williams and Waterston, 1994) or 3-fold arrest. Since the presumed null phenotype of let-70 is arrest at pre-comma stage, UBC-2 probably functions upstream of the genes listed above. Thus, UBC-2 likely plays a role in events that lead to the localization of muscle and hypodermal structures, and the formation of cell adhesions. C. elegans dense bodies are similar to vertebrate focal adhesion complexes (FACs; Burridge et al, 1997). As shown in Figure 26, both consist of transmembrane integrin receptors associated with multimeric protein complexes that function to anchor cytoskeletal structural proteins to the ECM and serve as recipients and generators of signalling information (Boudreau and Jones, 1999; Schoenwaelder and Burridge, 1999). The formation and activity of FACs are regulated by many extracellular and intracellular inputs. At least 20 proteins can be recruited to the integrin/ECM binding site, including Rho GTPases, growth factor receptors, Raf, Ras, focal adhesion kinase (FAK), integrin-linked kinase (ILK), protein kinase C (PKC) 126 Figure 26. Model of proposed C. elegans adhesion complex components. S c h e m a t i c r e p r e s e n t a t i o n o f t h e a d h e s i o n c o m p l e x i n C. elegans w i t h p r o p o s e d c o m p o n e n t s i n d i c a t e d . K n o w n C. elegans m u t a t i o n s a r e s h o w n i n b r a c k e t s C o m p o n e n t s k n o w n t o l o c a l i z e t o C . elegans d e n s e b o d i e s a r e m a r k e d w i t h a n a s t e r i s k . C o m p o n e n t s m a r k e d w i t h a q u e s t i o n m a r k h a v e n o t b e e n u n e q u i v o c a l l y l o c a l i z e d . S e e t e x t f o r e x p l a n a t i o n o f a b b r e v i a t i o n s . 127 o c (0 CM "r ^ I <D CD O CJ) O) § — — s o o o o o > > CD ;-v z~\ o CO £ is c & 111 O O Q . B E S c •integri o a * * X a> a E o a c O) CO I CD CD co o 0 O 0 CD 8 J § I— .C o ^ o CD CD CD o: o: K d < Q . =3 DL O O < 01 5 Q. W S CD • » CM CD CL Is? c X o 128 and MAP kinases (MAPK; Miyamoto et al, 1995). In C. elegans, FAK and ILK homologs have recently been identified and are found to be associated with dense bodies (R.J. Barstead, pers. comm. and D.G. Moerman, per. comm., respectively), indicating that the dense body is a site for signal transduction as well as cellular adhesion and muscle formation. Many integrin-dependent and growth factor signalling pathways lead to the modulation of Ras-mediated MAPK signal transduction cascades, which affect cell migration, adhesion, growth and differentiation (Mainiero et al, 1995; Marshall, 1995; Wang et al, 1998). In multicellular organisms, many MAPK signalling pathways are regulated by ubiquitin-mediated degradation of proteins such as the growth factor receptor PDGFRa (Miyake et al, 1998) and PKC (Lu et al, 1998). The transcription factors c-Fos and c-Jun activate genes in response to a number of inducers that act through the MAPK signal transduction pathway. As described in Section 1.5.3, the expression of c-Fos and c-Jun are regulated by UbcH5B-dependent degradation. In Drosophila, D-Jun activation affects cell fate decisions and cellular differentiation during Drosophila eye development (Isaksson et al, 1997). These studies implicate members of the UBC4 branch of E2s in regulating MAPK signalling pathways that are associated with FACs and affect cellular differentiation. Homologous MAPK pathways in C. elegans may therefore be associated with dense bodies, and affect cell growth and differentiation. If the E2 involved in this pathway is also conserved, then UBC-2 may mediate the ubiquitination of substrates in MAPK signalling pathways. In C. elegans, the migration and differentiation of Q neuroblasts, sex myoblasts, distal tip cells and vulval cells are, in part, regulated by integrin-mediated signalling pathways that involve interactions between the migrating cell and the basement membrane (Hedgecock et al, 1987; Baum et al, 1999; Gettner et al, 1995). Many of these cell types express UBC-2, and their development is defective in let-70 mutants, which suggests that UBC-2 may play a role in integrin-dependent and MAPK signalling pathways. In transgenic animals carrying the ubc-2::GFP transgenic array, several neurons that express the fusion protein appear to be descendants of the Q neuroblasts. Thus, UBC-2 may be involved in Q neuroblast migration and differentiation. Sex myoblasts are descendants of the M lineage and develop into vulval muscle cells. Once sex myoblasts form, they migrate to a position above the gonad, differentiate and attach to the body wall, uterus and vulva. The migration of sex myoblasts is integrin-dependent, and is regulated by Ras-mediated MAPK signalling via the fibroblast growth factor (FGF) homolog 129 (Chen and Stern, 1998; Gettner et al, 1995; Clark et al, 1992; Stern et al, 1993; Sundaram and Han, 1995). Transgenic nematodes express UBC-2::GFP in the vulval muscle cells, which provides supporting evidence of a role for UBC-2 activity in integrin-dependent and MAPK signalling pathways that regulate sex myoblast migration and differentiation. Ras-mediated MAPK signalling is also involved in vulval cell fate decisions and morphogenesis. In C. elegans larvae, specific cells become competent to respond to LIN-3, an epidermal growth factor (EGF) homolog that activates the Ras-mediated MAPK pathway and signals vulval morphogenesis. Since vulval development is defective in let-70 mutants, ubiquitin-mediated degradation may play a role in regulating the signalling pathways that specify vulval cell fate and differentiation. During gonadogenesis, distal tip cells undergo a complex stereotyped migration in which they follow the basement membrane to form U-shaped structures that differentiate into the somatic gonad. Migration of the distal tip cells is controlled by the metalloprotease, GON-1, which restructures the basement membrane as migration proceeds (Blelloch and Kimble, 1999). Integrin-mediated signalling at the basement membrane is likely to be involved in controlling distal tip cell migrations as well (Hedgecock et al, 1987; Antebi et al, 1997). During gonad formation in let-70 mutants, distal tip cell migration is not strongly affected; however, their ability to change direction is affected. Thus, it appears that UBC-2-mediated ubiquitination and degradation of proteins may be important to cue directional changes to the distal tip cells, a process that may also involve integrin-mediated pathways. UBC-2 is also required during somatic gonad differentiation. The spermatheca and uterus are unable to differentiate in let-70 mutants, resulting in the formation of a large mass of undetermined cells. Myoepithelial cell formation may also be affected, since oocytes are not transported through the oviduct in let-70 mutants. Thus, UBC-2 is required to cue the leader cells to change direction during migration, and for differentiation of the somatic gonad once migration is complete. These two processes might be controlled by a single activity of UBC-2, or they may be regulated by independent processes that each require UBC-2. 8.2 The W n t A V g pathway The WntAVg pathway, which is conserved between C. elegans, Drosophila and vertebrates (Rocheleau etal, 1997; Thorpe etal, 1997), is regulated by ubiquitin-mediated 130 Figure 27. Mode l for the action of W n t / W g signalling pathway components. Vertebrate, Drosophila (underlined) and C. elegans (italicized) homologs are indicated. For C. elegans, components that function during E and MS cell fate determination1, Q neuroblast migration and differentiation2, and vulval cell fate determination3 are indicated. A) Signalling from Wnt inactivates GSK-3P, which allows the translocation of P-catenin, its binding to TCF, and the transcription of genes involved in mesoderm differentiation. In C. elegans, Wnt homolog signalling results in the developmental programs indicated. B) In the absence of Wnt signalling, GSK-3P forms a complex with P-catenin and APC, resulting in the phosphorylation, ubiquitination and subsequent degradation of P-catenin. In C. elegans, lack of Wnt signalling results in the developmental programs indicated. 131 132 degradation (see Section 1.5.6; Figure 27). In C. elegans, Wnt/Wg is involved in early cell fate decisions, gonad and vulval development, and Q neuroblast migration (Lin et al., 1995; Sawa et al, 1996; Sternberg and Horvitz, 1988; Guo, 1995; Harris et al, 1996). In Drosophila it plays a role in segment polarity and in vertebrates it is involved in axis formation. Since Wnt/Wg in C. elegans controls a number of developmental processes that are defective in let-70 mutants, and the pathway is regulated by ubiquitin-mediated proteolysis, it is possible that UBC-2 might be involved in Wnt/Wg regulation in C. elegans. As described in Section 1.5.6, signals from Wnt/Wg activate a signal transduction pathway that culminates in the accumulation of P-catenin/Armadillo (p-cat/Arm), which translocates to the nucleus and promotes the transcription of genes involved in mesoderm formation (Figure 27). 3-cat/Arm levels are regulated by ubiquitin-mediated proteolysis, such that in the absence of Wnt/Wg signalling, P-cat/Arm is ubiquitinated and degraded (reviewed in Willert and Nusse, 1998). In C. elegans, a number of genes involved in Wnt/Wg signalling have been identified, and several homologs exist for many of the components of the pathway. For example, two P-cat/Arm homologs are found in C . elegans, WRM-1 and BAR-1, and each homolog is utilized in a separate developmental pathway (Lin et al, 1995; Guo, 1995; Sawa et al, 1996). In the four cell embryo of C. elegans, Wnt/Wg signalling is required for the specification of E and MS cell fates (Figure 27). The C. elegans homolog of Wnt/Wg, MOM-2, signals the P2 blastomere to activate MOM-5 (Fz receptor homolog) in the EMS cell, leading to the accumulation of WRM-1. High levels of WRM-1 downregulate POP-1 (a Tcf/LEF-1 family member) post-transcriptionally. When the EMS cell divides, the posterior daughter contains low levels of POP-1 and takes on the E cell fate, while the anterior cell has higher POP-1 levels and becomes the MS blastomere (Lin et al, 1995). Thus, WRM-1 and POP-1 regulation via the Wnt/Wg signalling pathway affects cell fate decisions and is important in endoderm (E) and mesoderm (MS) formation in C. elegans. The conservation of the Wnt/Wg pathway between species suggests that WRM-1 levels are regulated by the ubiquitin system, possibly mediated by UBC-2. In UBC-2 mutants, one would expect that WRM-1 levels would accumulate throughout the EMS blastomere regardless of Wnt/Wg signalling. This would result in high POP-1 levels in the daughter cells, causing both cells to take on an MS fate. This could be confirmed by examining early four cell stage 133 let-70 e m b r y o s f o r P O P - 1 l e v e l s and, i n l a t e r s t a g e e m b r y o s , e x a m i n i n g f o r t h e p r e s e n c e o f i n t e s t i n a l m a r k e r s s u c h as ges-1 ( E d g a r a n d M c G h e e , 1986; K e n n e d y et al., 1 9 9 3 ) . W R M - 1 i s a s t r o n g c a n d i d a t e s u b s t r a t e f o r U B C - 2 u b i q u i t i n a t i o n , a n d t h e E 3 i n v o l v e d i n W R M - 1 d e g r a d a t i o n i s l i k e l y t o b e a n sCF p- T r C P / s , i m b h o m o l o g . I f C . elegans U B C - 2 , W R M -1 a n d h o m o l o g s o f t h e sCF p- T r C P / s l i m b c o m p l e x w e r e b i o c h e m i c a l l y p u r i f i e d o r r e c o m b i n a n t l y e x p r e s s e d , a n in vitro a s s a y c o u l d d e t e r m i n e i f U B C - 2 c a n u t i l i z e t h e S C F p ' T r C P / s l i m b c o m p l e x t o u b i q u i t i n a t e W R M - 1 . T h e W n t A V g s i g n a l l i n g p a t h w a y a l s o f u n c t i o n s e a r l y i n v u l v a l d e v e l o p m e n t t o r e g u l a t e t h e c o m p e t e n c e o f h y p o d e r m a l c e l l s t o t a k e o n a v u l v a l c e l l f a t e ( E i s e n m a n n et al., 1 9 9 8 ) . T h e g e n e s i n v o l v e d i n W n t A V g s i g n a l l i n g d u r i n g v u l v a l d e v e l o p m e n t d i f f e r f r o m t h o s e u t i l i z e d d u r i n g e m b r y o g e n e s i s , a l t h o u g h t h e p a t h w a y i t s e l f i s u n c h a n g e d ( F i g u r e 2 7 ) . T h e g e n e s i n c l u d e lin-44 ( t h e Wnt/Wg h o m o l o g ; H e r m a n et al, 1 9 9 5 ) , lin-17 (Fz), bar-1 (B-cat; E i s e n m a n n et al, 1998), mom-1 a n d mom-3. A s a r e s u l t o f L I N - 4 4 s i g n a l l i n g , c e r t a i n c e l l s r e s p o n d t o t h e L I N - 3 i n d u c t i v e s i g n a l a n d a d o p t a v u l v a l c e l l f a t e . L I N - 3 , a n E G F h o m o l o g , a c t i v a t e s t h e R a s - m e d i a t e d M A P K p a t h w a y a n d s i g n a l s v u l v a l m o r p h o g e n e s i s . T h u s , b o t h M A P K a n d W n t A V g p a t h w a y s a r e i n v o l v e d i n r e g u l a t i n g v u l v a l m o r p h o g e n e s i s . S i n c e U B C - 2 a c t i v i t y i s n e c e s s a r y f o r p r o p e r v u l v a l d e v e l o p m e n t , it i s l i k e l y t o b e i n v o l v e d i n r e g u l a t i o n o f t h e W n t A V g a n d / o r M A P K p a t h w a y s t h a t s i g n a l v u l v a l c e l l f a t e d e c i s i o n s . I n t h e W n t A V g p a t h w a y , U B C - 2 p r o b a b l y f u n c t i o n s t o a f f e c t B A R - 1 l e v e l s , i n a m a n n e r s i m i l a r t o t h a t d e s c r i b e d f o r W R M - 1 . I f it d o e s , o n e w o u l d e x p e c t B A R - 1 t o a c c u m u l a t e i n let-70 m u t a n t s , w h i c h m i g h t p r e v e n t s o m e v u l v a l p r e c u r s o r c e l l s f r o m a d o p t i n g a v u l v a l c e l l f a t e . S i n c e v u l v a l m o r p h o g e n e s i s f o l l o w s a s t e r e o t y p e d p a t t e r n , t h e c e l l f a t e s o f v u l v a l p r e c u r s o r c e l l s c o u l d b e d e t e r m i n e d i n let-70 m u t a n t s , a n d m i g h t h e l p t o i d e n t i f y w h e t h e r v u l v a l c e l l f a t e d e c i s i o n s a r e a f f e c t e d b y a d e c r e a s e i n U B C - 2 e x p r e s s i o n . T h e W n t A V g p a t h w a y h a s b e e n i m p l i c a t e d i n g o n a d d e v e l o p m e n t ( S a w a et al, 1996; S t e r n b e r g a n d H o r v i t z , 1 9 8 8 ) , a n d m a y b e i n v o l v e d i n t h e m i g r a t i o n o f l e a d e r c e l l s a n d / o r t h e d e v e l o p m e n t o f t h e s o m a t i c g o n a d . It i s a l s o k n o w n t o b e i n v o l v e d i n Q n e u r o b l a s t m i g r a t i o n ( F i g u r e 2 7 ; G u o , 1995; H a r r i s et al, 1996; M a l o o f et al, 1 9 9 9 ) . A r o l e f o r U B C - 2 i n t h e r e g u l a t i o n o f W n t A V g p a t h w a y s i s s u p p o r t e d b y t h e o b s e r v a t i o n s t h a t g o n a d d e v e l o p m e n t i s d e f e c t i v e i n let-70 m u t a n t s , a n d s e v e r a l n e u r o n s th a t e x p r e s s U B C - 2 : : G F P f u s i o n s i n t r a n s g e n i c a n i m a l s a p p e a r t o b e d e s c e n d a n t s o f t h e Q n e u r o b l a s t s . I n v o l v e m e n t o f U B C - 2 i n t h e 134 u b i q u i t i n a t i o n a n d d e g r a d a t i o n o f a l l p - c a t h o m o l o g s i n C. elegans, i n c l u d i n g B A R - 1 a n d W R M - 1 , w o u l d p r o v i d e a n e x p l a n a t i o n f o r m a n y o f t h e let-70 p h e n o t y p e s t h a t a r e o b s e r v e d . 8.3 NF-KB-mediated signalling In Drosophila, D o r s a l (NF-KB) s i g n a l l i n g i s i n v o l v e d i n m e s o d e r m a l p a t t e r n i n g t h r o u g h r e g u l a t i o n o f t h e t r a n s c r i p t i o n f a c t o r , T w i s t ( C r i p p s et al., 1 9 9 8 ) . I n m a m m a l i a n s y s t e m s , N F -KB i s a c t i v a t e d t h r o u g h t w o m e c h a n i s m s : u b i q u i t i n - m e d i a t e d p r o c e s s i n g o f t h e i n a c t i v e N F - K B p i 0 5 p r e c u r s o r i n t o a n a c t i v e p 5 0 s u b u n i t , a n d t h e u b i q u i t i n - m e d i a t e d d e g r a d a t i o n o f i t s i n h i b i t o r , IKBOC. B o t h o f t h e s e p r o c e s s e s a r e m e d i a t e d b y a m e m b e r o f t h e U B C 4 b r a n c h o f E 2 s ( s e e S e c t i o n s 1.5.4 a n d 1.5.5; A l k a l a y et al., 1995; B a l d i et al., 1 9 9 6 ) . T h u s , m y o g e n e s i s i n Drosophila i s r e g u l a t e d b y u b i q u i t i n - d e p e n d e n t m e c h a n i s m s t h a t a r e l i k e l y m e d i a t e d b y a n E 2 o f t h e U B C 4 b r a n c h . H L H - 8 , a C. elegans T w i s t h o m o l o g , is d i r e c t l y i n v o l v e d i n a c t i v a t i n g g e n e e x p r e s s i o n i n p o s t - e m b r y o n i c m e s o d e r m ( H a r f e et al., 1998). T h e hlh-8 g e n e i s i n a c t i v e i n e a r l y e m b r y o s , a n d t u r n e d o n o n l y i n m e s o d e r m a l c e l l s o f t h e M l i n e a g e t o a f f e c t n o n - s t r i a t e d m u s c l e c e l l f a t e d e c i s i o n s . M d i v i s i o n s i n e a r l y l a r v a l d e v e l o p m e n t y i e l d b o d y w a l l m u s c l e , c o e l o m o c y t e s a n d s e x m y o b l a s t s , w h i c h l a t e r d e v e l o p i n t o v u l v a l m u s c l e c e l l s ( S u l s t o n a n d H o r v i t z , 1 9 7 7 ; H a r f e etal, 1 9 9 8 ) . I f t h e N F - K B / D o r s a l s i g n a l l i n g p a t h w a y i s c o n s e r v e d b e t w e e n C. elegans, Drosophila a n d m a m m a l s , t h e n U B C - 2 m i g h t b e i n v o l v e d i n t h e a c t i v a t i o n o f H L H - 8 a n d t h e s p e c i f i c a t i o n o f m e s o d e r m a l c e l l f a tes. I n d e e d , t r a n s g e n i c a n i m a l s e x p r e s s U B C - 2 : : G F P i n t h e v u l v a l m u s c l e s , i n d i c a t i n g t h a t U B C - 2 i s e x p r e s s e d i n s o m e d e s c e n d a n t s o f t h e M l i n e a g e . I n let-70 a n i m a l s , w h e r e U B C - 2 e x p r e s s i o n i s l o w , hlh-8 a c t i v a t i o n m a y b e d e f e c t i v e , t h u s a l t e r i n g M l i n e a g e c e l l f a t e d e c i s i o n s . H L H - 8 l e v e l s c o u l d b e a s s e s s e d i n let-70 m u t a n t s u s i n g i m m u n o f l u o r e s c e n t s t a i n i n g w i t h a n t i - H L H - 8 a n t i b o d i e s . I n a d d i t i o n , a n e x a m i n a t i o n o f M l i n e a g e c e l l f a t e s i n let-70 m u t a n t s m a y h e l p t o d e t e r m i n e w h e t h e r U B C - 2 i s i n v o l v e d i n t h i s p r o c e s s . C a n d i d a t e s u b s t r a t e s f o r U B C - 2 u b i q u i t i n a t i o n a r e t h e C. elegans h o m o l o g s o f t h e N F -KB p l 0 5 p r e c u r s o r o r IKB, a n d t h e E 3 i n v o l v e d i n IKB d e g r a d a t i o n is l i k e l y t o b e a n S C F p " T r C P h o m o l o g . I n t e r e s t i n g l y , i n m a m m a l s , t h e E 2 / E 3 c o m p l e x i n v o l v e d i n IKB d e g r a d a t i o n i s t h e s a m e as t h a t u t i l i z e d i n P-cat d e g r a d a t i o n , n a m e l y U b c H 5 a n d S C F p " T r C P . P e r h a p s t h i s p a t h w a y i s c o n s e r v e d i n C. elegans. A n in vitro assay, s i m i l a r t o t h a t d e s c r i b e d i n S e c t i o n IV.7.2, m i g h t 135 determine if UBC-2 can utilize the SCF | 3" I r C P complex to ubiquitinate I K B . Alternatively, a genetic approach could be used. Genes for components of the N F - K B / I K B pathways could be knocked out in C. elegans to generate mutant strains. Epistasis analysis might help determine the role of UBC-2 in these pathways. 8.4 Transcriptional regulation during myogenesis The hlh-1 gene, the homolog of vertebrate MyoD, is important in C. elegans myogenesis (Krause et al., 1990), and is a likely candidate gene for ubiquitin-dependent proteolysis during early development. MyoD in vertebrates is a tissue-specific transcription factor that is involved in the regulation of skeletal muscle development (Davis et al., 1987; Weintraub, 1993). It is a short-lived protein that is degraded by the ubiquitin-dependent proteolysis system both in vivo and in vitro (Abu Hatoum et al.,- 1998). The ubiquitin-conjugating enzyme E 2HK mediates the ubiquitination of MyoD. There has been debate regarding the homology of many mammalian E2s, due in part to the high degree of sequence similarity which exists among them. Until recently, E 2HK was believed to be the ortholog of yeast UBC4/5. Currently, however, it is considered to be the ortholog of yeast RAD6 (Wing et al, 1992), which in C. elegans is ubc-1 (Leggett et al, 1995). Thus, it is difficult to predict which C. elegans E2 may be responsible for hlh-1 ubiquitination. There is little doubt, however, that hlh-1 is a strong candidate substrate for ubiquitin-dependent proteolysis. It remains to be determined which E2 mediates this process in C. elegans. 8.5 Cell cycle regulation In addition to somatic gonad defects, aberrant germline development is observed in adult let-70(s689) mutants. The number of germ cells produced is lower than normal, suggesting that UBC-2 may be involved in mitotic and/or meiotic progression, such that reduced levels of UBC-2 lead to a reduction in germ cell proliferation. Church et al (1995) showed that the MAPK signalling cascade is required for meiotic cell cycle progression in C. elegans. UBC-2 may be involved in regulating meiosis through modulation of MAPK signalling. A role for UBC-2 in cell cycle progression is also supported by the finding that in Drosophila the UBC-2 homolog, UbcDl, is required for proper telomere behavior during mitosis and meiosis (Cenci et al, 1997). In addition, a rat homolog called Ubc4-testis, is expressed solely in rat testis and is involved in the formation and maturation of spermatocytes (Wing et al, 1996; S. Wing, pers. comm.). In yeast, ubiquitin-mediated degradation is 136 necessary for cell cycle progression at the Gl/S transition and to promote anaphase (see Section 1.5.2). While it is known that Cdc34 is involved in Gl/S phase progression, the E2 that interacts with the APC/C is unknown; however, it is believed to be Ubc4 (Feldman et al, 1997; King et al, 1995). Thus, in C . elegans, UBC-2 may interact with the APC/C to ubiquitinate substrates such as A and B-type cyclins and inhibitor proteins, thus promoting sister chromatid separation and exit from telophase in mitotic and meiotic germ cells. A detailed examination of the let-70 mutant gonad using DAPI and immunostaining with anti-dsDNA antibodies might reveal defects in cell division due to a reduction in UBC-2 levels. Biochemical analysis of the C . elegans APC/C might reveal that UBC-2 interacts with the complex to promote the ubiquitination of substrate proteins. In let-70(s689) mutants, oocyte development in hermaphrodites and spermatocyte formation in males occurs prematurely within the gonad. There are several possible explanations for this. The mutation might affect the formation of the myoepithelial sheath surrounding the oviduct in hermaphrodites and the vas deferens in males such that they fail to contract properly to transport germ cells. In hermaphrodites, the spermatheca and uterus are improperly formed and may be unable to receive germ cells. Thus, oocytes would remain in the oviduct and may even back up into the ovary. Germline defects similar to those described for let-70(s689) mutants are seen in the progeny of animals injected with dsRNA directed to the basement membrane protein SPARC (osteonectin; Fitzgerald and Schwarzbauer, 1998). In addition to the germline defects, RNAi(ost) mutants fail to produce gut granules, a defect that is also seen in let-70 mutants. Thus, it appears that the basement membrane is involved in processes that direct gut granule formation and oocyte maturation. Perhaps UBC-2 activity at or near the basement membrane is also associated with gut granule formation in the intestine. A subset of gut granules are known to be yolk proteins that are transported to developing oocytes. Yolk proteins are required for the maturation of oocytes. Thus, the inability of let-70(s689) oocytes to mature may simply be due to a lack of yolk proteins. However, males, which do not normally produce yolk proteins, are also affected. Thus, the premature development of the spermatocytes, and possibly the oocytes, may be due to an additional function of UBC-2 that is independent of yolk protein production. 137 9. UBC-2 IN THE NUCLEOLUS Immunofluorescent staining of wild type C. elegans with anti-UBC-2 shows that U B C -2 is concentrated in the nucleolus of a number of cell types, including intestine, muscle, hypodermis, some neurons and the germline. In let-70 mutants, conspicuous nucleolar expression of UBC-2 was not observed, and this may be relevant to the defects observed in these tissues. An examination of some of the functions of the nucleolus may provide insights into the site of action of UBC-2 in this organelle. The major function of nucleolus is rRNA transcription, rRNA processing and ribosome assembly. It is also involved in the processing of some mRNAs, small nuclear RNAs, tRNAs, and telomerase R N A (reviewed in Pederson, 1998; Scheer and Hock, 1999). Ribosome assembly requires the constant influx of approximately 80 ribosomal proteins from the cytoplasm to the nucleolus, and the export of completed ribosomal subunits in the opposite direction. Signalling pathways that utilize fibroblast growth factor, nerve growth factor and protein kinase C are involved in ribosome assembly and R N A processing (Bonnet et al., 1996; Zhou et al., 1997). While there is no evidence that ubiquitin degradation plays a role in ribosome assembly or R N A processing, it may be involved in signalling pathways that lead to the activation or maintenance of these processes. The nucleolus also functions in the silencing of tandemly repeated rDNA (Bryk et al., 1997; Smith and Boeke, 1997). In yeast, gene silencing occurs at telomeres, the silent mating type loci (HM) and rDNA repeats in nucleolar genes (Gottschling et al., 1990; Rine and Herskowitz, 1987). Silencing at the telomeres and H M loci involves the silent information regulators Sir2, Sir3, and Sir4. With the exception of Sir2, rDNA silencing is regulated by a different set of proteins. In the nucleolus, Sir2 associates with Netl (also called C f i l ; Visintin et al., 1999) and Cdcl4 to form the RENT complex (regulator of nucleolar silencing and telophase; Straight et al., 1999), which interacts with other proteins to facilitate gene silencing, suppress recombination, maintain nucleolar integrity, and regulate exit from mitosis and entry into meiosis. There is some evidence that the ubiquitin-conjugating enzyme, Rad6 is required for silencing at telomere and H M loci (Huang et al., 1997) and also plays a role in rDNA repeat silencing (Bryk et al., 1997). Rad6, known to be involved in D N A repair, is also believed to play a role in the organization of chromatin structure (Bailly et al., 1997; Siede, 1988; Sung et al., 1988). Hence, Rad6 may facilitate the formation of nucleosomal structures which are 138 r e s i s t a n t t o t r a n s c r i p t i o n a n d r e c o m b i n a t i o n at s i l e n c e d l o c i s u c h as t e l o m e r e s , t h e H M l o c i a n d r D N A r e p e a t . M o a z e d a n d J o h n s o n ( 1 9 9 6 ) f o u n d t h a t d e l e t i o n o f t h e d e u b i q u i t i n a t i n g e n z y m e , U b p 3 , r e s u l t s i n i n c r e a s e d s i l e n c i n g at t e l o m e r e s a n d t h e H M l o c i . It h a s b e e n s u g g e s t e d t h a t t h e a c t i v a t i o n o f t h e g e n e s i l e n c i n g c o m p l e x i s r e g u l a t e d b y t h e u b i q u i t i n - d e p e n d e n t d e g r a d a t i o n o f a n i n h i b i t o r p r o t e i n , a n d r e m o v a l o f u b i q u i t i n f r o m s u c h a n i n h i b i t o r b y U b p 3 w o u l d p r e v e n t i t s d e g r a d a t i o n , t h u s l e a d i n g t o i n a c t i v a t i o n o f t h e s i l e n c i n g c o m p l e x . I f t h i s s y s t e m i s c o n s e r v e d i n C. elegans, t h e n t h e R a d 6 h o m o l o g , U B C - 1 w o u l d l i k e l y m e d i a t e r e g u l a t i o n o f t h e s i l e n c i n g c o m p l e x . It i s p o s s i b l e t h a t b o t h U B C - 2 a n d U B C - 1 f u n c t i o n t o m e d i a t e g e n e s i l e n c i n g i n C. elegans. A l t e r n a t i v e l y , U B C - 2 m a y h a v e t a k e n o v e r t h e r o l e o f r e g u l a t i n g g e n e s i l e n c i n g i n t h e n u c l e o l u s o f C. elegans. U B C - 2 c o u l d a l s o b e i n v o l v e d i n a p r o c e s s w i t h i n t h e n u c l e o l u s t h a t i s u n r e l a t e d t o g e n e s i l e n c i n g . T h e n u c l e o l u s a l s o h a s a r e g u l a t o r y f u n c t i o n . A s d e s c r i b e d e a r l i e r , N e t l , S i r 2 a n d C d c l 4 a r e a s s o c i a t e d w i t h t h e r D N A g e n e s d u r i n g i n t e r p h a s e a n d f u n c t i o n i n g e n e s i l e n c i n g . D u r i n g a n a p h a s e , t h e R E N T c o m p l e x d i s p e r s e s , a n d S i r 2 a n d C d c l 4 d i f f u s e t h r o u g h o u t n u c l e u s a n d c y t o p l a s m , w h i l e N e t l r e m a i n s i n n u c l e o l u s ( S t r a i g h t et al., 1999; V i s i n t i n et al., 1 9 9 9 ) . T h e r e l e a s e o f C d c l 4 f r o m n u c l e o l a r s e q u e s t r a t i o n i s n e c e s s a r y f o r e x i t f r o m m i t o s i s . M i t o t i c e x i t i s r e g u l a t e d b y u b i q u i t i n - d e p e n d e n t d e g r a d a t i o n o f B - t y p e c y c l i n s a n d t h e i n h i b i t o r S i c l ( s e e S e c t i o n 1.5.2.2), t h u s p r o v i d i n g a c o n n e c t i o n b e t w e e n u b i q u i t i n - m e d i a t e d p r o t e o l y s i s a n d t h e n u c l e o l u s . It i s b e l i e v e d t h a t t h e R E N T c o m p l e x s e q u e s t e r s C d c l 4 i n t h e n u c l e o l u s t o p r e v e n t C d c l 4 a c t i v i t y i n t h e n u c l e u s at i n a p p r o p r i a t e t i m e s d u r i n g t h e c e l l c y c l e . T h e p h y s i c a l s e g r e g a t i o n o f i n t e r a c t i n g p r o t e i n s w o u l d b e a n e f f e c t i v e m e t h o d f o r t h e r e g u l a t i o n o f m a n y p a t h w a y s . T h e r e a r e s e v e r a l e x a m p l e s o f t r a n s i e n t n u c l e o l a r l o c a l i z a t i o n a s a r e g u l a t o r y m e c h a n i s m . T h e Drosophila R N A h e l i c a s e g e n e pitchoune, w h i c h i s e s s e n t i a l f o r l a r v a l d e v e l o p m e n t a n d i s a p o t e n t i a l t a r g e t o f t h e t r a n s c r i p t i o n f a c t o r M y c , i s n u c l e o l a r l o c a l i z e d ( Z a f f r a n et al., 1 9 9 8 ) . S t i m u l a t i o n o f m a m m a l i a n c e l l s w i t h E G F r e s u l t s i n t h e t r a n s l o c a t i o n o f t h e z i n c f i n g e r p r o t e i n Z P R 1 f r o m c y t o p l a s m t o n u c l e u s , a n d i t s a c c u m u l a t i o n i n t h e n u c l e o l u s ( G a l c h e v a - G a r g o v a et al, 1998). T h e t u m o r s u p p r e s s o r p r o t e i n p l 9 A r f i s l o c a t e d i n t h e n u c l e o l u s . It a c t i v a t e s t h e t u m o r s u p p r e s s o r p 5 3 b y s e q u e s t e r i n g t h e p 5 3 i n h i b i t o r , M d m 2 i n t h e n u c l e o l u s ( W e b e r et al, 1999). M d m 2 is a u b i q u i t i n l i g a s e t h a t h a s b e e n s h o w n t o f u n c t i o n in vivo a n d in vitro w i t h U b c H 5 t o u b i q u i t i n a t e p 5 3 , l e a d i n g t o i t s d e s t r u c t i o n v i a t h e 2 6 S 139 p r o t e a s o m e ( s e e S e c t i o n 1.5.7; H o n d a et al., 1997). T h u s , a p o s s i b l e r o l e f o r t h e n u c l e o l u s l i e s i n s e q u e s t e r i n g p r o t e i n s , t h e r e b y p r e v e n t i n g t h e i r a c t i v i t y w i t h i n t h e n u c l e u s o r c y t o p l a s m . U b i q u i t i n - d e p e n d e n t p r o t e o l y s i s a p p e a r s t o p l a y a n i m p o r t a n t r o l e i n t h e p r o c e s s o f n u c l e o l a r s e q u e s t r a t i o n . It m a y b e i n v o l v e d i n m a i n t a i n i n g t h e a c t i v i t y o f p r o t e i n c o m p l e x e s w i t h i n t h e n u c l e o l u s at s p e c i f i c t i m e s d u r i n g t h e c e l l c y c l e t h r o u g h d e s t r u c t i o n o f a n i n h i b i t o r p r o t e i n , i n a m a n n e r s i m i l a r t o t h a t p r e s e n t e d f o r r e g u l a t i o n o f t h e g e n e s i l e n c i n g c o m p l e x . I n d e e d , U b c H 5 - m e d i a t e d d e g r a d a t i o n o f t h e i n h i b i t o r IKB a l l o w s N F - K B t o t r a n s l o c a t e i n t o t h e n u c l e u s w h e r e it a c t i v a t e s g e n e e x p r e s s i o n ( A l k a l a y et ai, 1 9 9 5 ) . D e g r a d a t i o n o f i n h i b i t o r s m a y b e a g e n e r a l m e c h a n i s m f o r U B C 4 b r a n c h - m e d i a t e d d e g r a d a t i o n p r o c e s s e s . It i s p o s s i b l e t h a t c e r t a i n E 2 s ( f o r e x a m p l e , C. elegans U B C - 2 ) a r e t h e m s e l v e s s e q u e s t e r e d i n t h e n u c l e o l u s i n a m a n n e r s i m i l a r t o t h a t o f t h e E 3 , M d m 2 . T h i s w o u l d p h y s i c a l l y s e p a r a t e t h e E 2 f r o m i ts t a r g e t s u b s t r a t e , t h u s p r e v e n t i n g i n a p p r o p r i a t e u b i q u i t i n a t i o n . E 2 s c o u l d b e s p e c i f i c a l l y t a r g e t e d t o t h e n u c l e o l u s , o r t h e y m i g h t b e t r a n s p o r t e d i n t o t h e n u c l e o l u s p a s s i v e l y w h i l e a s s o c i a t e d w i t h a n E 3 . T h e E 2 s m i g h t r e m a i n w i t h i n t h e n u c l e o l u s u n t i l r e q u i r e d i n t h e n u c l e u s o r c y t o p l a s m f o r a c t i v i t y . I n g e n e r a l , t h e e x p r e s s i o n p a t t e r n o f t h e UBC-2:.G F P f u s i o n p r o t e i n f a i t h f u l l y m i m i c s t h a t o f w i l d t y p e U B C - 2 . T h e r e i s , h o w e v e r , a n i n t e r e s t i n g e x c e p t i o n . U n l i k e t h e w i l d t y p e U B C - 2 e x p r e s s i o n p a t t e r n , U B C - 2 : : G F P e x p r e s s i o n w a s n o t c o n f i n e d t o t h e n u c l e o l u s , b u t w a s s p r e a d t h r o u g h o u t t h e n u c l e u s . T o c o n s t r u c t t h e ubc-2::GFP f u s i o n , t h e g e n e c o d i n g f o r G F P w a s i n s e r t e d i n t o t h e s e c o n d e x o n o f ubc-2. T h e r e s u l t a n t U B C - 2 : :GFP f u s i o n p r o t e i n c o n t a i n s o n l y t h e a m i n o - t e r m i n u s o f U B C - 2 f u s e d t o GFP. T h e e x p r e s s i o n o f t h e U B C - 2 : :GFP f u s i o n p r o t e i n t h r o u g h o u t t h e n u c l e u s s u g g e s t s t h a t t h e n u c l e o l a r l o c a l i z a t i o n o f U B C - 2 o c c u r s p o s t -t r a n s l a t i o n a l l y . T h e c a r b o x y l r e g i o n o f ubc-2 m a y c o n t a i n a n u c l e o l a r l o c a l i z a t i o n s i g n a l , o r U B C - 2 m a y b e t a r g e t e d t o t h e n u c l e o l u s t h r o u g h i n t e r a c t i o n w i t h o t h e r p r o t e i n s . T h e s e i n t e r a c t i o n s a p p e a r t o r e q u i r e t h e c a r b o x y l - t e r m i n u s o f U B C - 2 . It i s i n t e r e s t i n g t o n o t e t h a t t h e l o c a l i z a t i o n o f U B C - 2 : : G F P t o t h e n u c l e u s a n d t o t h e s a r c o m e r e o f b o d y w a l l m u s c l e s t i l l o c c u r s i n t h e f u s i o n p r o t e i n . T h e c o n c e n t r a t i o n o f U B C - 2 t o t h e s e r e g i o n s m u s t u t i l i z e a d i f f e r e n t s i g n a l f r o m t h a t w h i c h l o c a l i z e s U B C - 2 t o t h e n u c l e o l u s . T h i s l o c a l i z a t i o n m a y o c c u r p r i o r t o t r a n s l a t i o n , o r m a y b e d u e t o i n t e r n a l s i g n a l s o r p r o t e i n i n t e r a c t i o n s w i t h i n t h e a m i n o -t e r m i n u s o f U B C - 2 . T h e c o n s t r u c t i o n o f a f u l l y f u n c t i o n a l U B C - 2 : : G F P c o n s t r u c t w o u l d b e u s e f u l f o r d e t e r m i n i n g t h e s i g n a l s r e s p o n s i b l e f o r U B C - 2 l o c a l i z a t i o n . 140 10. CONCL USIONS AND PROSPECTS I n s u m m a r y , U B C - 2 is i n v o l v e d i n m a n y a s p e c t s o f C. elegans d e v e l o p m e n t . U s i n g a c o m b i n a t i o n o f g e n e t i c a n d m o l e c u l a r t e c h n i q u e s t o e x a m i n e t h e e x p r e s s i o n o f U B C - 2 i n w i l d t y p e a n d m u t a n t a n i m a l s , it h a s b e e n p o s s i b l e t o i d e n t i f y s o m e o f t h e r e q u i r e m e n t s f o r U B C - 2 d u r i n g e u k a r y o t i c d e v e l o p m e n t . A m a t e r n a l c o n t r i b u t i o n o f U B C - 2 i s n e c e s s a r y d u r i n g e m b r y o g e n e s i s . I n a d d i t i o n , it is e s s e n t i a l p o s t - e m b r y o n i c a l l y f o r t h e p r o p e r d e v e l o p m e n t o f m o s t t i s s u e s w i t h i n t h e n e m a t o d e , i n c l u d i n g t h e g e r m l i n e . U B C - 2 a p p e a r s t o f u n c t i o n i n t h e r e g u l a t i o n o f s i g n a l l i n g p a t h w a y s t h a t i n c l u d e o n e o r m o r e o f t h e W n t / W g , N F - K B , i n t e g r i n -m e d i a t e d a n d M A P K c a s c a d e s . T h e c o l d - s e n s i t i v e a l l e l e o f let-70, p Z M 1 3 . 3 4 , m a y p r o v e u s e f u l f o r f u r t h e r a n a l y s i s o f t h e r o l e o f U B C - 2 i n C. elegans d e v e l o p m e n t . W h e n i n t e g r a t e d i n t o t h e let-70(s689) b a c k g r o u n d , i t w i l l b e p o s s i b l e t o d e t e r m i n e t h e t e m p e r a t u r e - s e n s i t i v e p e r i o d o f let-70. I n a d d i t i o n , p Z M 1 3 . 3 4 c o u l d b e u t i l i z e d i n g e n e t i c s c r e e n s t o i d e n t i f y s u p p r e s s o r s o f let-70. S i n c e U B C - 2 a p p e a r s t o h a v e d i s t i n c t f u n c t i o n s d u r i n g e m b r y o n i c , s o m a t i c a n d g e r m l i n e d e v e l o p m e n t , t h e s c r e e n s c o u l d b e d e s i g n e d t o i s o l a t e s u p p r e s s o r s t h a t a r e u n i q u e f o r e a c h d e v e l o p m e n t a l p r o c e s s . A n a l t e r n a t i v e m e t h o d f o r i s o l a t i n g p r o t e i n s t h a t i n t e r a c t w i t h U B C - 2 , t h e y e a s t t w o h y b r i d s c r e e n , h a s b e e n i n i t i a t e d i n t h e l a b o r a t o r y . T h e p r e s e n t s t u d y h a s p r o v i d e d i n s i g h t i n t o t h e i d e n t i t y o f c o m p o n e n t s o f U B C - 2 -m e d i a t e d p r o t e i n d e g r a d a t i o n , i n c l u d i n g s e v e r a l E 3 s a n d t a r g e t p r o t e i n s . P o s s i b l e E 3 s a r e h o m o l o g s o f t h e A P C / C i n v o l v e d i n c e l l c y c l e p r o g r e s s i o n a n d t h e S C F p " T r C P i n v o l v e d i n W n t / W g a n d I K B s i g n a l l i n g . S o m e l i k e l y t a r g e t p r o t e i n s i n c l u d e W R M - 1 a n d B A R - 1 , M y o D , t h e N F - k B p i 0 5 p r e c u r s o r a n d I k B h o m o l o g . E x p e r i m e n t s c o u l d b e d e s i g n e d t o d e t e r m i n e i f a n y o f t h e s e E 3 s o r p u t a t i v e s u b s t r a t e s a r e d o w n s t r e a m e f f e c t o r s o f U B C - 2 . W i t h c o m p l e t i o n o f t h e g e n o m e s e q u e n c i n g p r o j e c t , c o m p o n e n t s o f t h e E 3 c o m p l e x e s c o u l d b e i d e n t i f i e d , i s o l a t e d a n d in vitro u b i q u i t i n a t i o n a s s a y s u t i l i z e d t o d e t e r m i n e w h e t h e r U B C - 2 i n t e r a c t s w i t h t h e E 3 s t o u b i q u i t i n a t e s p e c i f i c t a r g e t p r o t e i n s . I n a d d i t i o n , y e a s t t w o h y b r i d a n a l y s i s c o u l d b e p e r f o r m e d u s i n g s p e c i f i c p r o t e i n s t h a t a r e b e l i e v e d t o i n t e r a c t d i r e c t l y w i t h U B C - 2 . M u t a t i o n s i n m a n y o f t h e g e n e s i n t h e s e p a t h w a y s a l r e a d y e x i s t . R e c e n t l y , t h e r e l a t i v e e a s e w i t h w h i c h C. elegans g e n e k n o c k o u t s c a n b e o b t a i n e d m a k e s it p o s s i b l e t o m u t a t e e v e r y g e n e w i t h i n a p a t h w a y . T h u s , a c o m p l e t e g e n e t i c a n a l y s i s o f t h e s i g n a l l i n g p a t h w a y s c o u l d u l t i m a t e l y b e p e r f o r m e d t o d e t e r m i n e t h e g e n e t i c i n t e r a c t i o n s o f U B C - 2 w i t h o t h e r c o m p o n e n t s 141 of the pathways. Genetic analysis would also provide valuable information regarding spatial and temporal requirements for the pathways. Through a combination of biochemical and genetic analysis, the role of UBC-2 and ubiquitin-mediated protein degradation in the development of multicellular organisms can be further elucidated. 142 V. REFERENCES A b e r l e , H., S c h w a r t z , H., a n d K e m l e r , R. ( 1 9 9 6 ) . C a d h e r i n - c a t e n i n c o m p l e x : p r o t e i n i n t e r a c t i o n s a n d t h e i r i m p l i c a t i o n s f o r . c a d h e r i n f u n c t i o n . J. Cell. Biochem. 61, 5 1 4 - 5 2 3 . A b e r l e , H., B a u e r , A., S t a p p e r t , J., K i s p e r t , A., a n d K e m l e r , R. ( 1 9 9 7 ) . P-catenin i s a t a r g e t f o r t h e u b i q u i t i n - p r o t e a s o m e p a t h w a y . EMBOJ. 16, 3 7 9 7 - 3 8 0 4 . A b u H a t o u m , O., G r o s s - M e s i l a t y , S., B r e i t s c h o p f , K., H o f f m a n , A., G o n e n , H., C i e c h a n o v e r , A., a n d B e n g a l , E . ( 1 9 9 8 ) . D e g r a d a t i o n o f m y o g e n i c t r a n s c r i p t i o n f a c t o r M y o D b y t h e u b i q u i t i n p a t h w a y in vivo a n d in vitro: r e g u l a t i o n b y s p e c i f i c D N A b i n d i n g . Mol. Cell. Biol. 18, 5 6 7 0 - 5 6 7 7 . A l b e r t s o n , D . G. ( 1 9 8 4 ) . L o c a l i z a t i o n o f t h e r i b o s o m a l g e n e s i n Caenorhabditis elegans c h r o m o s o m e s b y in situ h y b r i d i z a t i o n u s i n g b i o t i n - l a b e l e d p r o b e s . EMBO J. 3, 1 2 2 7 -1234. A l k a l a y , I., Y a r o n , A., H a t z u b a i , A., O r i a n , A , C i e c h a n o v e r , A., a n d B e n - N e r i a h , Y . ( 1 9 9 5 ) . S t i m u l a t i o n - d e p e n d e n t IKBO. p h o s p h o r y l a t i o n m a r k s t h e N F - K B i n h i b i t o r f o r d e g r a d a t i o n v i a t h e u b i q u i t i n - p r o t e a s o m e p a t h w a y . Proc. Natl. Acad. Sci. USA 92, 1 0 5 9 9 - 1 0 6 0 3 . A n g e l , P., a n d K a r i n , M . ( 1 9 9 1 ) . T h e r o l e o f J u n , F o s a n d t h e A P - 1 c o m p l e x i n c e l l p r o l i f e r a t i o n a n d t r a n s f o r m a t i o n . Biochem. Biophys. Acta 1072, 1 2 9 - 1 5 7 . A n t e b i , A., N o r r i s , C . R., H e d g e c o c k , E . M., a n d G a r r i g a , G. ( 1 9 9 7 ) . C e l l a n d g r o w t h c o n e m i g r a t i o n s . In: C. elegans II. (ed. R i d d l e , D . L., B l u m e n t h a l , T., M e y e r , B . J., a n d P r i e s s , J. R.) pp. 583-610. C o l d S p r i n g H a r b o r L a b o r a t o r y P r e s s , P l a i n v i e w , N e w Y o r k . A r n a s o n , T., a n d E l l i s o n , M . J. ( 1 9 9 4 ) . S t r e s s r e s i s t a n c e i n Saccharomyces cerevisiae i s s t r o n g l y c o r r e l a t e d w i t h a s s e m b l y o f a n o v e l t y p e o f m u l t i u b i q u i t i n c h a i n . Mol. Cell. Biol. 14, 7 8 7 6 - 7 8 8 3 . A s h c r o f t , N . R., S r a y k o , M., K o s i n s k i , M . E., M a i n s , P. E., a n d G o l d e n , A . ( 1 9 9 9 ) . R N A -m e d i a t e d i n t e r f e r e n c e o f a c d c 2 5 h o m o l o g i n Caenorhabditis elegans r e s u l t s i n d e f e c t s i n t h e e m b r y o n i c c o r t i c a l m e m b r a n e , m e i o s i s , a n d m i t o s i s . Dev. Biol. 206, 15-32. B a b o s h i n a , O. V., a n d H a a s , A . L . ( 1 9 9 6 ) . N o v e l m u l t i u b i q u i t i n c h a i n l i n k a g e s c a t a l y z e d b y t h e c o n j u g a t i n g e n z y m e s E2EPF a n d R A D 6 a r e r e c o g n i z e d b y 2 6 S p r o t e a s o m e s u b u n i t 5. J. Biol. Chem. 271, 2 8 2 3 - 2 8 3 1 . B a c h m a i r , A., F i n l e y , D., a n d V a r s h a v s k y , A . ( 1 9 8 6 ) . in vivo h a l f - l i f e o f a p r o t e i n i s a f u n c t i o n o f i t s a m i n o - t e r m i n a l r e s i d u e . Science 234, 179-186. B a e u e r l e , P. A., a n d H e n k e l , T. ( 1 9 9 4 ) . F u n c t i o n a n d a c t i v a t i o n o f N F - K B i n t h e i m m u n e s y s t e m . Ann. Rev. Immunol. 12 ,141-179. 143 B a i , C , S e n , P., H o f m a n n , K , M a , L., G o e b l , M., H a r p e r , J. W., a n d E l l e d g e , S. J. ( 1 9 9 6 ) . S K P 1 c o n n e c t s c e l l c y c l e r e g u l a t o r s t o t h e u b i q u i t i n p r o t e o l y s i s m a c h i n e r y t h r o u g h a n o v e l m o t i f , t h e F - b o x . Cell 86, 263-274. B a i l l y , V., L a m b , J., S u n g , P., P r a k a s h , S., a n d P r a k a s h , L . ( 1 9 9 4 ) . S p e c i f i c c o m p l e x f o r m a t i o n b e t w e e n y e a s t R A D 6 a n d R A D 18 p r o t e i n s : A p o t e n t i a l m e c h a n i s m f o r t a r g e t i n g R A D 6 u b i q u i t i n - c o n j u g a t i n g a c t i v i t y t o D N A d a m a g e sites. Genes Dev. 8, 8 1 1 - 8 2 0 . B a i l l y , V., L a u d e r , S., P r a k a s h , S., a n d P r a k a s h , L . ( 1 9 9 7 ) . Y e a s t D N A r e p a i r p r o t e i n s R a d 6 a n d R a d 18 f o r m a h e t e r o d i m e r t h a t h a s u b i q u i t i n c o n j u g a t i n g , D N A b i n d i n g , a n d A T P h y d r o l y t i c a c t i v i t i e s . J.Biol. Chem. 272, 2 3 3 6 0 - 2 3 3 6 5 . B a l d i , L., B r o w n , K., F r a n z o s o , G., a n d S i e b e n l i s t , U . ( 1 9 9 6 ) . C r i t i c a l r o l e f o r l y s i n e s 21 a n d 2 2 i n s i g n a l - i n d u c e d , u b i q u i t i n - m e d i a t e d p r o t e o l y s i s o f I i c B a . J. Biol. Chem. 271, 3 7 6 - 3 7 9 . B a r s t e a d , R. J., a n d W a t e r s t o n , R. H. ( 1 9 8 9 ) . T h e b a s a l c o m p o n e n t o f t h e n e m a t o d e d e n s e - b o d y i s v i n c u l i n . J. Biol. Chem. 264, 1 0 1 7 7 - 1 0 1 8 5 . B a r s t e a d , R. J., a n d W a t e r s t o n , R. H. ( 1 9 9 1 ) . C l o n i n g , s e q u e n c i n g a n d m a p p i n g o f a n a - a c t i n i n g e n e f r o m t h e n e m a t o d e Caenorhabditis elegans. CellMotil. Cytoskel. 20, 69-78. B a u m , P. D., G u e n t h e r , C , F r a n k , C. A , P h a m , B . V., a n d G a r r i g a , G. ( 1 9 9 9 ) . T h e Caenorhabditis elegans g e n e ham-2 l i n k s H o x p a t t e r n i n g t o m i g r a t i o n o f t h e H S N m o t o r n e u r o n . Genes Dev. 13, 4 7 2 - 4 8 3 . B e l v i n , M . P., J i n , Y., a n d A n d e r s o n , K. V . ( 1 9 9 5 ) . C a c t u s p r o t e i n d e g r a d a t i o n m e d i a t e s Drosophila d o r s a l - v e n t r a l s i g n a l i n g . Genes Dev. 9, 7 8 3 - 7 9 3 . B e n i a n , G. M., T i n l e y , T. L., T a n g , X., a n d B o r o d o v s k y , M . ( 1 9 9 6 ) . T h e Caenorhabditis elegans g e n e unc-89, r e q u i r e d f o r m u s c l e M - l i n e a s s e m b l y , e n c o d e s a g i a n t m o d u l a r p r o t e i n c o m p o s e d o f I g a n d s i g n a l t r a n s d u c t i o n d o m a i n s . J. Cell Biol. 132, 8 3 5 - 8 4 8 . B e r l e t h , E . S., a n d P i c k a r t , C. M . ( 1 9 9 6 ) . M e c h a n i s m o f u b i q u i t i n c o n j u g a t i n g e n z y m e E 2 -2 3 0 K : c a t a l y s i s i n v o l v i n g a t h i o l r e l a y ? Biochemistry 35, 1 6 6 4 - 1 6 7 1 . B e t t i n g , J., a n d S e u f e r t , W. ( 1 9 9 6 ) . A y e a s t U b c 9 m u t a n t p r o t e i n w i t h t e m p e r a t u r e - s e n s i t i v e in vivo f u n c t i o n i s s u b j e c t t o c o n d i t i o n a l p r o t e o l y s i s b y a u b i q u i t i n - a n d p r o t e a s o m e -d e p e n d e n t p a t h w a y . J. Biol. Chem. 271, 2 5 7 9 0 - 2 5 7 9 6 . B l e l l o c h , R., a n d K i m b l e , J. ( 1 9 9 9 ) . C o n t r o l o f o r g a n s h a p e b y a s e c r e t e d m e t a l l o p r o t e a s e i n t h e n e m a t o d e Caenorhabditis elegans. Nature 399, 5 8 6 - 5 9 0 . B l u m e n t h a l , T. a n d S t e w a r d , K. ( 1 9 9 7 ) . R N A p r o c e s s i n g a n d g e n e s t r u c t u r e . In: C. elegans II. ( e d . R i d d l e , D. L., B l u m e n t h a l , T., M e y e r , B . J., a n d P r i e s s , J. R.) pp. 117-146. C o l d S p r i n g H a r b o r L a b o r a t o r y P r e s s , P l a i n v i e w , N e w Y o r k . 144 B o n n e t , H., F i l h o l , O., T r u c h e t , I., B r e t h e n o u , P., C o c h e t , C , A l m a r i c , F., a n d B o u c h e , G. ( 1 9 9 6 ) . F i b r o b l a s t g r o w t h f a c t o r - 2 b i n d s t o t h e r e g u l a t o r y P s u b u n i t o f C K 2 a n d d i r e c t l y s t i m u l a t e s C K 2 a c t i v i t y t o w a r d n u c l e o l i n . J. Biol. Chem. 271, 2 4 7 8 1 - 2 4 7 8 7 . B o u d r e a u , N . J., a n d J o n e s , P. L . ( 1 9 9 9 ) . E x t r a c e l l u l a r m a t r i x a n d i n t e g r i n s i g n a l l i n g : T h e s h a p e o f t h i n g s t o c o m e . Biochem. J. 339, 4 8 1 - 4 8 8 . B r e n n e r , S. ( 1 9 7 4 ) . T h e g e n e t i c s o f Caenorhabditis elegans. Genetics 11, 71-94. B r o w n , K., G e r s t b e r g e r , S., C a r l s o n , L., F r a n z o s o , G., a n d S i e b e n l i s t , U . ( 1 9 9 5 ) . C o n t r o l o f IKBCC p r o t e o l y s i s b y s i t e - s p e c i f i c , s i g n a l - i n d u c e d p h o s p h o r y l a t i o n . Science 267, 1 4 8 5 -1488. B r y k , M., B a n n e r j e e , M., M u r p h y , M., K n u d s e n , K. E., G a r f i n k e l , D . J., a n d C u r c i o , M . J. ( 1 9 9 7 ) . T r a n s c r i p t i o n a l s i l e n c i n g o f T y l e l e m e n t s i n t h e R D N 1 l o c u s o f y e a s t . Genes Dev. 11, 2 5 5 - 2 6 9 . B u r r i d g e , K., C h r z a n o w s k a - W o d n i c k a , M., a n d Z h o n g , C. ( 1 9 9 7 ) . F o c a l a d h e s i o n a s s e m b l y . Trends Cell Biol. 1, 3 4 2 - 3 4 7 . C a l i , B . M., a n d A n d e r s o n , P. ( 1 9 9 8 ) . m R N A s u r v e i l l a n c e m i t i g a t e s g e n e t i c d o m i n a n c e i n Caenorhabditis elegans. Mol. Gen. Genet. 260, 176-184. C e n c i , G., R a w s o n , R. B., B e l l o n i , G., C a s t r i l l o n , D. H., T u d o r , M., P e t r u c c i , R., G o l d b e r g , M . L., W a s s e r m a n , S. A., a n d G a t t i , M . ( 1 9 9 7 ) . UbcDl, & Drosophila u b i q u i t i n - c o n j u g a t i n g e n z y m e r e q u i r e d f o r p r o p e r t e l o m e r e b e h a v i o r . Genes Dev. 11, 8 6 3 - 8 7 5 . C h a l f i e , M., T u , Y., E u s k i r c h e n , G., W a r d , W. W., a n d P r a s h e r , D . C. ( 1 9 9 4 ) . G r e e n fluorescent p r o t e i n as a m a r k e r f o r g e n e e x p r e s s i o n . Science 263, 8 0 2 - 8 0 5 . C h a u , V., T o b i a s , J. W., B a c h m a i r , A., M a r r i o t t , D., E c k e r , D. J., G o n d a , D . K., a n d V a r s h a v s k y , A . ( 1 9 8 9 ) . A m u l t i u b i q u i t i n c h a i n i s c o n f i n e d t o s p e c i f i c l y s i n e i n a ta r g e t e d s h o r t - l i v e d p r o t e i n . Science 243, 1 5 7 6 - 1 5 8 3 . C h e n , E . B., a n d S t e r n , M . J. ( 1 9 9 8 ) . U n d e r s t a n d i n g c e l l m i g r a t i o n g u i d a n c e : l e s s o n s f r o m s e x m y o b l a s t m i g r a t i o n i n C. elegans. Trends Gen. 14, 3 2 2 - 3 2 7 . C h e n , Z. J., P a r e n t , L., a n d M a n i a t i s , T. ( 1 9 9 6 ) . S i t e - s p e c i f i c p h o s p h o r y l a t i o n o f IKBCI b y a n o v e l u b i q u i t i n a t i o n - d e p e n d e n t p r o t e i n k i n a s e a c t i v i t y . Cell 84, 8 5 3 - 8 6 2 . C h u n , K. T., M a t h i a s , N., a n d G o e b l , M . G. ( 1 9 9 6 ) . U b i q u i t i n - d e p e n d e n t p r o t e o l y s i s a n d c e l l c y c l e c o n t r o l i n y e a s t . Prog. Cell Cycle Res. 2, 115-127. C h u r c h , D . L., G u a n , K. L., a n d L a m b i e , E . J. ( 1 9 9 5 ) . T h r e e g e n e s o f t h e M A P k i n a s e c a s c a d e , mek-2, mpk-l/sur-1 a n d let-60 ras, a r e r e q u i r e d f o r m e i o t i c c e l l c y c l e p r o g r e s s i o n i n Caenorhabditis elegans. Development 121, 2 5 2 5 - 2 5 3 5 . C i e c h a n o v e r , A . ( 1 9 9 4 ) . T h e u b i q u i t i n - p r o t e a s o m e p r o t e o l y t i c p a t h w a y . Cell 79, 13-21. 145 C i e c h a n o v e r , A., E l i a s , S., H e l l e r , H , a n d H e r s h k o , A . ( 1 9 8 2 ) . " C o v a l e n t a f f i n i t y " p u r i f i c a t i o n o f u b i q u i t i n - a c t i v a t i n g e n z y m e . J. Biol. Chem. 257, 2 5 3 7 - 2 5 4 2 . C i e c h a n o v e r , A , H e l l e r , H , K a t z - E t z i o n , R., a n d H e r s h k o , A . ( 1 9 8 1 ) . A c t i v a t i o n o f t h e heat-s t a b l e p o l y p e p t i d e o f t h e A T P - d e p e n d e n t p r o t e o l y t i c s y s t e m . Proc. Natl. Acad. Sci. USA 78, 7 6 1 - 7 6 5 . C i e c h a n o v e r , A , H o d , Y., a n d H e r s h k o , A . ( 1 9 7 8 ) . A h e a t - s t a b l e p o l y p e p t i d e c o m p o n e n t o f a n A T P - d e p e n d e n t p r o t e o l y t i c s y s t e m f r o m r e t i c u l o c y t e s . Biochem. Biophys. Res. Commun. 81, 1 1 0 0 - 1 1 0 5 . C l a r k , D . V , R o g a l s k i , T. M., D o n a t i , L . M., a n d B a i l l i e , D . L . ( 1 9 8 8 ) . T h e unc-22(W) r e g i o n o f Caenorhabditis elegans: g e n e t i c a n a l y s i s o f l e t h a l m u t a t i o n s . Genetics 119, 3 4 5 - 3 5 3 . C l a r k , S. G., L u , X., a n d H o r v i t z , H. R. ( 1 9 9 4 ) . T h e Caenorhabditis elegans l o c u s lin-15, a n e g a t i v e r e g u l a t o r o f a t y r o s i n e k i n a s e s i g n a l i n g p a t h w a y , e n c o d e s t w o d i f f e r e n t p r o t e i n s . Genetics 137, 9 8 7 - 9 9 7 . C l a r k , S. G , S t e r n , M . J., a n d H o r v i t z , H. R. ( 1 9 9 2 ) . G e n e s i n v o l v e d i n t w o Caenorhabditis elegans c e l l - s i g n a l i n g p a t h w a y s . Cold Spring Harbor Symposia on Quantitative Biology 57, 3 6 3 - 3 7 3 . C l o k e y , G. V., a n d J a c o b s o n , L . A . ( 1 9 8 6 ) . T h e a u t o f l u o r e s c e n t " l i p o f u s c i n g r a n u l e s " i n t h e i n t e s t i n a l c e l l s o f Caenorhabditis elegans a r e s e c o n d a r y l y s o s o m e s . Mech. Ageing Dev. 35, 79-94. C o h e n - F i x , O., P e t e r s , J. M., K i r s c h n e r , M . W., a n d K o s h l a n d , D. ( 1 9 9 6 ) . A n a p h a s e i n i t i a t i o n i n Saccharomyces cerevisiae i s c o n t r o l l e d b y t h e A P C - d e p e n d e n t d e g r a d a t i o n o f t h e a n a p h a s e i n h i b i t o r P d s l p . Genes Dev. 10, 3 0 8 1 - 3 0 9 3 . C o n f a l o n i e r i , F., a n d D u g u e t , M . ( 1 9 9 5 ) . A 2 0 0 - a m i n o a c i d A T P a s e m o d u l e i n s e a r c h o f a b a s i c f u n c t i o n . Bioessays 17, 639-650. C o o k , D., F r y , M . J., H u g h e s , K., S u m a t h i p a l a , R., W o o d g e t t , J. R., a n d D a l e , T. C. ( 1 9 9 6 ) . W i n g l e s s i n a c t i v a t e s g l y c o g e n s y n t h a s e k i n a s e - 3 v i a a n i n t r a c e l l u l a r s i g n a l l i n g p a t h w a y w h i c h i n v o l v e s a p r o t e i n k i n a s e C. EMBO J. 15, 4 5 2 6 - 4 5 3 6 . C o u l s o n , A., W a t e r s t o n , R., K i f f , J., S u l s t o n , J., a n d K o h a r a , Y . ( 1 9 8 8 ) . G e n o m e l i n k i n g w i t h y e a s t a r t i f i c i a l c h r o m o s o m e s . Nature 335, 184-186. C o u x , O., a n d G o l d b e r g , A . L . ( 1 9 9 8 ) . E n z y m e s c a t a l y z i n g u b i q u i t i n a t i o n a n d p r o t e o l y t i c p r o c e s s i n g o f t h e p l 0 5 p r e c u r s o r o f n u c l e a r f a c t o r K B I . J. Biol. Chem. 273, 8 8 2 0 - 8 8 2 8 . C o x , R. T., K i r k p a t r i c k , C , a n d P e i f e r , M . ( 1 9 9 6 ) . A r m a d i l l o i s r e q u i r e d f o r a d h e r e n s j u n c t i o n a s s e m b l y , c e l l p o l a r i t y , a n d m o r p h o g e n e s i s d u r i n g Drosophila e m b r y o g e n e s i s . J. Cell. Biol. 134, 133-148. 146 C r i p p s , R. M., B l a c k , B . L., Z h a o , B., L i e n , C.-L., S c h u l z , R. A., a n d O l s o n , E . N . ( 1 9 9 8 ) . T h e m y o g e n i c r e g u l a t o r y g e n e Me/2 is a d i r e c t t a r g e t f o r t r a n s c r i p t i o n a l a c t i v a t i o n b y T w i s t d u r i n g Drosophila m y o g e n e s i s . Genes Dev. 12, 4 2 2 - 4 3 4 . C z a p l i n s k i , K., R u i z - E c h e v a r r i a , M . J., P a u s h k i n , S. V., H a n , X., W e n g , Y., P e r l i c k , H . A., D i e t z , H . C , T e r - A v a n e s y a n , M . D., a n d P e l t z , S. W. ( 1 9 9 8 ) . T h e s u r v e i l l a n c e c o m p l e x i n t e r a c t s w i t h t h e t r a n s l a t i o n r e l e a s e f a c t o r s t o e n h a n c e t e r m i n a t i o n a n d d e g r a d e a b e r r a n t m R N A s . Genes Dev. 12, 1665-16 7 7 . D a v i s , R. L., W e i n t r a u b , H , a n d L a s s e r , A . B . ( 1 9 8 7 ) . E x p r e s s i o n o f a s i n g l e t r a n s f e c t e d c D N A c o n v e r t s f i b r o b l a s t s t o m y o b l a s t s . Cell 51, 9 8 7 - 1 0 0 0 . D e v e r a u x , Q., U s t r e l l , V., P i c k a r t , C , a n d R e c h s t e i n e r , M . ( 1 9 9 4 ) . A 2 6 S p r o t e a s e s u b u n i t t h a t b i n d s u b i q u i t i n c o n j u g a t e s . J. Biol. Chem. 269, 7 0 5 9 - 7 0 6 1 . D o h m e n , R. J., M a d u r a , K., B a r t e l , B., a n d V a r s h a v s k y , A . ( 1 9 9 1 ) . T h e N - e n d r u l e i s m e d i a t e d b y t h e U B C 2 ( R A D 6 ) u b i q u i t i n - c o n j u g a t i n g e n z y m e . Proc. Natl. Acad. Sci. USA 88, 73 5 1 - 7 3 5 5 . D u b i e l , W., F e r r e l l , K., a n d R e c h s t e i n e r , M . ( 1 9 9 5 ) . S u b u n i t s o f t h e r e g u l a t o r y c o m p l e x o f t h e 2 6 S p r o t e a s e . Mol. Biol. Rep. 21, 27-34. D u n n , W. A . J. ( 1 9 9 4 ) . A u t o p h a g y a n d r e l a t e d m e c h a n i s m s o f l y s o s o m e - m e d i a t e d p r o t e i n d e g r a d a t i o n . Trends Cell Biol. 4, 139-143. E d g a r , L . G., a n d M c G h e e , J. D. ( 1 9 8 6 ) . E m b r y o n i c e x p r e s s i o n o f a g u t - s p e c i f i c e s t e r a s e i n Caenorhabditis elegans. Dev. Biol. 114, 109-118. E l l i s o n , K . S., G w o z d , T., P r e n d e r g a s t , J. A., P a t e r s o n , M . C , a n d E l l i s o n , M . J. ( 1 9 9 1 ) . A s i t e -d i r e c t e d a p p r o a c h f o r c o n s t r u c t i n g t e m p e r a t u r e - s e n s i t i v e u b i q u i t i n - c o n j u g a t i n g e n z y m e s r e v e a l s a c e l l c y c l e f u n c t i o n a n d g r o w t h f u n c t i o n f o r R A D 6 . J. Biol. Chem. 266, 2 4 1 1 6 -2 4 1 2 0 . E m m o n s , S. W., K l a s s , M . R., a n d H i r s h , D. ( 1 9 7 9 ) . A n a l y s i s o f t h e c o n s t a n c y o f D N A s e q u e n c e s d u r i n g d e v e l o p m e n t a n d e v o l u t i o n o f t h e n e m a t o d e Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 76, 1333-13 3 7 . E p s t e i n , H . F., a n d B e r n s t e i n , S. I. ( 1 9 9 2 ) . G e n e t i c a p p r o a c h e s t o u n d e r s t a n d i n g m u s c l e d e v e l o p m e n t . Dev. Biol. 154, 231-244. E y t a n , E., A r m o n , T., H e l l e r , H , B e c k , S., a n d H e r s h k o , A . ( 1 9 9 3 ) . U b i q u i t i n C - t e r m i n a l h y d r o l a s e a c t i v i t y a s s o c i a t e d w i t h t h e 2 6 S p r o t e a s e c o m p l e x . J. Biol. Chem. 268, 4 6 6 8 -4 6 7 4 . F a n g , G., Y u , H , a n d K i r s c h n e r , M . W. (1 9 9 8 ) . D i r e c t b i n d i n g o f C D C 2 0 p r o t e i n f a m i l y m e m b e r s a c t i v a t e s t h e a n a p h a s e - p r o m o t i n g c o m p l e x i n m i t o s i s a n d G I . Mol. Cell 2, 163-171. 147 F a y , D . S., S t a n l e y , H . M , H a n , M , a n d W o o d , W. B . ( 1 9 9 9 ) . A Caenorhabditis elegans h o m o l o g u e o f h u n c h b a c k i s r e q u i r e d f o r l a t e s t a g e s o f d e v e l o p m e n t b u t n o t e a r l y e m b r y o n i c p a t t e r n i n g . Dev. Biol. 205, 2 4 0 - 2 5 3 . F e l d m a n , R. M , C o r r e l l , C. C , K a p l a n , K. B., a n d D e s h a i e s , R. J. ( 1 9 9 7 ) . A c o m p l e x o f C d c 4 p , S k p l p , a n d C d c 5 3 p / c u l l i n c a t a l y z e s u b i q u i t i n a t i o n o f t h e p h o s p h o r y l a t e d C D K i n h i b i t o r S i c l p . Cell 91, 2 2 1 - 2 3 0 . F e r g u s o n , E . L., a n d H o r v i t z , H. R. ( 1 9 8 5 ) . I d e n t i f i c a t i o n a n d c h a r a c t e r i z a t i o n o f 2 2 g e n e s t h a t a f f e c t t h e v u l v a l c e l l l i n e a g e s o f t h e n e m a t o d e Caenorhabditis elegans. Genetics 110, 17-72. F i n l e y , D., B a r t e l , B., a n d V a r s h a v s k y , A . ( 1 9 8 9 ) . T h e t a i l s o f u b i q u i t i n p r e c u r s o r s a r e r i b o s o m a l p r o t e i n s w h o s e f u s i o n t o u b i q u i t i n f a c i l i t a t e s r i b o s o m e b i o g e n e s i s . Nature 338, 3 9 4 - 4 0 1 . F i n l e y , D., a n d C h a u , V . ( 1 9 9 1 ) . U b i q u i t i n a t i o n . Ann. Rev. Cell Biol. 7, 25-69. F i n l e y , D., S a d i s , S., M o n i a , B . P., B o u c h e r , P., E c k e r , D. J., C r o o k e , S. T., a n d C h a u , V . ( 1 9 9 4 ) . I n h i b i t i o n o f p r o t e o l y s i s a n d c e l l c y c l e p r o g r e s s i o n i n a m u l t i u b i q u i t i n a t i o n -d e f i c i e n t y e a s t m u t a n t . Mol. Cell. Biol. 14, 5 5 0 1 - 5 5 0 9 . F i n n e y , M., a n d R u v k u n , G. B . ( 1 9 9 0 ) . T h e unc-86 g e n e p r o d u c t c o u p l e s c e l l l i n e a g e a n d c e l l i d e n t i t y i n C. elegans. Cell 63, 895-900. F i r e , A . ( 1 9 8 6 ) . I n t e g r a t i v e t r a n s f o r m a t i o n o f Caenorhabditis elegans. EMBO J. 5, 2 6 7 3 - 2 6 8 0 . F i r e , A., H a r r i s o n , S. W., a n d D i x o n , D. ( 1 9 9 0 ) . A m o d u l a r set o f l a c Z f u s i o n v e c t o r s f o r s t u d y i n g g e n e e x p r e s s i o n i n Caenorhabditis elegans. Gene 93, 189-198. F i r e , A , X u , S , M o n t g o m e r y , M . K , K o s t a s , S. A , D r i v e r , S. E., a n d M e l l o , C. C. ( 1 9 9 8 ) . P o t e n t a n d s p e c i f i c g e n e t i c i n t e r f e r e n c e b y d o u b l e - s t r a n d e d R N A i n Caenorhabditis elegans. Nature 391, 806-811. F i t z g e r a l d , M . C , a n d S c h w a r z b a u e r , J. E . ( 1 9 9 8 ) . I m p o r t a n c e o f t h e b a s e m e n t m e m b r a n e p r o t e i n S P A R C f o r v i a b i l i t y a n d f e r t i l i t y i n Caenorhabditis elegans. Curr. Biol. 8, 1 2 8 5 - 1 2 8 8 . F r a n c i s , G. R., a n d W a t e r s t o n , R. H. ( 1 9 8 5 ) . M u s c l e o r g a n i z a t i o n i n Caenorhabditis elegans. l o c a l i z a t i o n o f p r o t e i n s i m p l i c a t e d i n t h i n f i l a m e n t a t t a c h m e n t a n d I - b a n d o r g a n i z a t i o n . J. Cell Biol. 101, 1 5 3 2 - 1 5 4 9 . F r a n c i s , R., a n d W a t e r s t o n , R. H . ( 1 9 9 1 ) . M u s c l e c e l l a t t a c h m e n t i n Caenorhabditis elegans. J. Cell. Biol. 114, 4 6 5 - 4 7 9 . F r u h , K., G o s s e n , M., W a n g , K , B u j a r d , H , P e t e r s o n , P. A., a n d Y a n g , Y . ( 1 9 9 4 ) . D i s p l a c e m e n t o f h o u s e k e e p i n g p r o t e a s o m e s u b u n i t s b y M H C - e n c o d e d L M P s : A n e w l y 148 d i s c o v e r e d m e c h a n i s m f o r m o d u l a t i n g t h e m u l t i c a t a l y t i c p r o t e i n a s e c o m p l e x . EMBO J. 13, 3 2 3 6 - 3 2 4 4 . G a l c h e v a - G a r g o v a , Z., G a n g w a n i , L., K o n s t a n t i n o v , K. N., M i k r u t , M., T h e r o u x , S. J., E n o c h , T., a n d D a v i s , R. J. ( 1 9 9 8 ) . T h e c y t o p l a s m i c z i n c f i n g e r p r o t e i n Z P R 1 a c c u m u l a t e s i n t h e n u c l e o l u s o f p r o l i f e r a t i n g c e l l s . Mol. Biol. Cell 9, 2 9 6 3 - 2 9 7 1 . G a r r o d , D. R. ( 1 9 9 3 ) . D e s m o s o m e s a n d h e m i d e s m o s o m e s . Curr. Opin. Cell Biol. 5, 30-40. G e i s l e r , R., B e r g m a n n , A., H i r o m i , Y., a n d N u s s l e i n - V o l h a r d , C. ( 1 9 9 2 ) . Cactus, a g e n e i n v o l v e d i n d o r s o v e n t r a l p a t t e r n f o r m a t i o n o f Drosophila, i s r e l a t e d t o t h e I K B g e n e f a m i l y o f v e r t e b r a t e s . Cell 7 1 , 6 1 3 - 6 2 1 . G e t t n e r , S. N., K e n y o n , C , a n d R e i c h a r d t , L . F. ( 1 9 9 5 ) . C h a r a c t e r i z a t i o n o f P pat-3 h e t e r o d i m e r s , a f a m i l y o f e s s e n t i a l i n t e g r i n r e c e p t o r s i n C. elegans. J. Cell Biol. 129, 1 1 2 7 - 1 1 4 1 . G h o s h , S., G i f f o r d , A . M , R i v i e r e , L . R., T e m p s t , P., N o l a n , G. P., a n d B a l t i m o r e , D . ( 1 9 9 0 ) . C l o n i n g o f t h e p 5 0 s u b u n i t o f N F - K B: H o m o l o g y t o r e l a n d d o r s a l . Cell 62, 1 0 1 9 - 1 0 2 9 . G i l l i g a n , D., a n d B e n n e t t , V . ( 1 9 9 3 ) . T h e s p e c t r i n - b a s e d m e m b r a n e s k e l e t o n a n d m i c r o n - s c a l e o r g a n i z a t i o n o f t h e p l a s m i d m e m b r a n e . Ann. Rev. Cell Biol. 9, 27-66. G i r o d , P. A., C a r p e n t e r , T. B., v a n N o c k e r , S., S u l l i v a n , M . L., a n d V i e r s t r a , R. D. ( 1 9 9 3 ) . H o m o l o g s o f t h e e s s e n t i a l u b i q u i t i n c o n j u g a t i n g e n z y m e s U B C 1 , 4, a n d 5 i n y e a s t a r e e n c o d e d b y a m u l t i g e n e f a m i l y i n Arabidopsis thaliana. Plant J. 3, 5 4 5 - 5 5 2 . G l i c k m a n , M . H , R u b i n , D . M., F r i e d , V . A., a n d F i n l e y , D. ( 1 9 9 8 ) . T h e r e g u l a t o r y p a r t i c l e o f t h e Saccharomyces cerevisiae p r o t e a s o m e . Mol. Cell. Biol. 18, 3 1 4 9 - 3 1 6 2 . G l o t z e r , M., M u r r a y , A . W., a n d K i r s c h n e r , M . W. ( 1 9 9 1 ) . C y c l i n i s d e g r a d e d b y t h e u b i q u i t i n p a t h w a y . Nature 349, 132-138. G o e b l , M . G., Y o c h e m , I , J e n t s c h , S., M c G r a t h , J. P., V a r s h a v s k y , A., a n d B y e r s , B . ( 1 9 8 8 ) . T h e y e a s t c e l l c y c l e g e n e C D C 3 4 e n c o d e s a u b i q u i t i n - c o n j u g a t i n g e n z y m e . Science 241, 1 3 3 1 - 1 3 3 5 . G o h , P., a n d B o g a e r t , T. ( 1 9 9 1 ) . P o s i t i o n i n g a n d m a i n t e n a n c e o f e m b r y o n i c b o d y w a l l m u s c l e a t t a c h m e n t s i n C. elegans r e q u i r e s t h e mup-1 gene. Development 111, 6 6 7 - 6 8 1 . G o t t s c h l i n g , D . E., A p a r i c i o , O. M., B i l l i n g t o n , B . L., a n d Z a k i a n , V . A . ( 1 9 9 0 ) . P o s i t i o n e f f e c t at S. cerevisiae t e l o m e r e s : r e v e r s i b l e r e p r e s s i o n o f P o l II t r a n s c r i p t i o n . Cell 63, 7 5 1 - 7 6 2 . G r a y , C. W., S l a u g h t e r , C. A., a n d D e M a r t i n o , G. N . ( 1 9 9 4 ) . P A 2 8 a c t i v a t o r p r o t e i n f o r m s r e g u l a t o r y c a p s o n p r o t e a s o m e s t a c k e d r i n g s . J. Mol. Biol. 236, 7-15. 149 G r o e t t r u p , M., S o z a , A., E g g e r s , M., K u e h n , L., D i c k , T. P., S c h i l d , H., R a m m e n s e e , H . G., K o s z i n o w s k i , U . H , a n d K l o e t z e l , P. M . ( 1 9 9 6 ) . A r o l e f o r t h e p r o t e a s o m e r e g u l a t o r P A 2 8 a i n a n t i g e n p r e s e n t a t i o n . Nature 381, 166-168. G u o , C. B . ( 1 9 9 5 ) . mig-5: a g e n e t h a t c o n t r o l s c e l l f a t e d e t e r m i n a t i o n a n d c e l l m i g r a t i o n i n C . elegans, i s a m e m b e r o f t h e dsh f a m i l y . J o h n s H o p k i n s U n i v e r s i t y , B a l t i m o r e , M a r y l a n d . H a a s , A . L., a n d S i e p m a n n , T. J. ( 1 9 9 7 ) . P a t h w a y s o f u b i q u i t i n c o n j u g a t i o n . FASEB J. 11, 1 2 5 7 - 1 2 6 8 . H a a s , A . L., W a r m s , J. V., H e r s h k o , A., a n d R o s e , I. A . ( 1 9 8 2 ) . U b i q u i t i n - a c t i v a t i n g e n z y m e . M e c h a n i s m a n d r o l e i n p r o t e i n - u b i q u i t i n c o n j u g a t i o n . J. Biol. Chem. 257, 2 5 4 3 - 2 5 4 8 . H a d a r i , T., W a r m s , J. V., R o s e , I. A., a n d H e r s h k o , A . ( 1 9 9 2 ) . A u b i q u i t i n C - t e r m i n a l i s o p e p t i d a s e t h a t a c t s o n p o l y u b i q u i t i n c h a i n s . R o l e i n p r o t e i n d e g r a d a t i o n . J. Biol. Chem. 267, 7 1 9 - 7 2 7 . H a n d l e y , P. M., M u e c k l e r , M., S i e g e l , N . R., C i e c h a n o v e r , A., a n d S c h w a r z , A . L . ( 1 9 9 1 ) . M o l e c u l a r c l o n i n g , s e q u e n c e , a n d t i s s u e d i s t r i b u t i o n o f t h e h u m a n u b i q u i t i n - a c t i v a t i n g e n z y m e E l . Proc. Natl. Acad. Sci. USA 88, 2 5 8 - 2 6 2 . H a r f e , B . D., G o m e s , A . V., K e n y o n , C , L i u , J., K r a u s e , M., a n d F i r e , A . ( 1 9 9 8 ) . A n a l y s i s o f a Caenorhabditis elegans T w i s t h o m o l o g i d e n t i f i e s c o n s e r v e d a n d d i v e r g e n t a s p e c t s o f m e s o d e r m a l p a t t e r n i n g . Genes Dev. 12, 2 6 2 3 - 2 6 3 5 . H a r r i s , J., H o n i g b e r g , L., R o b i n s o n , N., a n d K e n y o n , C. ( 1 9 9 6 ) . N e u r o n a l c e l l m i g r a t i o n i n C. elegans: r e g u l a t i o n o f H o x g e n e e x p r e s s i o n a n d c e l l p o s i t i o n . Development 122, 3 1 1 7 -3 1 3 1 . H a t f i e l d , P. M., C a l l i s , J., a n d V i e r s t r a , R. D. ( 1 9 9 0 ) . C l o n i n g o f u b i q u i t i n a c t i v a t i n g e n z y m e f r o m w h e a t a n d e x p r e s s i o n o f a f u n c t i o n a l p r o t e i n i n Escherichia coli. J. Biol. Chem. 267,15813-15817. H a t f i e l d , P. M., a n d V i e r s t r a , R. D. ( 1 9 9 2 ) . M u l t i p l e f o r m s o f u b i q u i t i n - a c t i v a t i n g e n z y m e E l f r o m w h e a t . I d e n t i f i c a t i o n o f a n e s s e n t i a l c y s t e i n e b y in vitro m u t a g e n e s i s . J. Biol. Chem. 267, 1 4 7 9 9 - 1 4 8 0 3 . H e , T. C , S p a r k s , A . B., R a g o , C , H e r m e k i n g , H , Z a w e l , L., d a C o s t a , L . T., M o r i n , P. J., V o g e l s t e i n , B., a n d K i n z l e r , K. W. ( 1 9 9 8 ) . I d e n t i f i c a t i o n o f c - M Y C as a t a r g e t o f t h e A P C p a t h w a y . Science 281, 1509-1512. H e d g e c o c k , E . M., a n d W h i t e , J. G. ( 1 9 8 5 ) . P o l y p l o i d t i s s u e s i n t h e n e m a t o d e Caenorhabditis elegans. Dev. Biology 107, 128-133. H e d g e c o c k , E . M., C u l o t t i , J G., H a l l , D. H , a n d S t e r n , B . D. ( 1 9 8 7 ) . G e n e t i c s o f c e l l a n d a x o n m i g r a t i o n s i n Caenorhabditis elegans. Development 100, 3 6 5 - 3 8 2 . 150 H e n g a r t n e r , M . O., a n d H o r v i t z , H . R. ( 1 9 9 4 ) . C. elegans c e l l s u r v i v a l g e n e ced-9 e n c o d e s a f u n c t i o n a l h o m o l o g o f t h e m a m m a l i a n p r o t o - o n c o g e n e bcl-2. Cell 76, 6 6 5 - 6 7 6 . H e r m a n , M . A., V a s s i l i e v a , L . L., H o r v i t z , H. R., Shaw, J. E., a n d H e r m a n , R. K . ( 1 9 9 5 ) . T h e C. elegans g e n e lin-44, w h i c h c o n t r o l s t h e p o l a r i t y o f c e r t a i n a s y m m e t r i c c e l l d i v i s i o n s , e n c o d e s a W n t p r o t e i n a n d a c t s c e l l n o n a u t o n o m o u s l y . Cell 83, 101-110. H e r m a n , R. K. ( 1 9 8 8 ) . G e n e t i c s . In: T h e N e m a t o d e Caenorhabditis elegans. ( e d . W. B . W o o d a n d t h e C o m m u n i t y o f C. elegans R e s e a r c h e r s ) , pp. 17-46. C o l d S p r i n g H a r b o r L a b o r a t o r y , C o l d S p r i n g H a r b o r , N e w Y o r k . H e r s h k o , A . ( 1 9 9 1 ) . T h e u b i q u i t i n p a t h w a y o f p r o t e i n d e g r a d a t i o n a n d p r o t e o l y s i s o f u b i q u i t i n -p r o t e i n c o n j u g a t e s . Biochem. Soc. Trans. 19, 7 2 6 - 7 2 9 . H e r s h k o , A . ( 1 9 9 7 ) . R o l e s o f u b i q u i t i n - m e d i a t e d p r o t e o l y s i s i n c e l l c y c l e c o n t r o l . Curr. Opin. Cell Biol. 9, 7 8 8 - 7 9 9 . H e r s h k o , A., a n d C i e c h a n o v e r , A . ( 1 9 9 2 ) . T h e u b i q u i t i n s y s t e m f o r p r o t e i n d e g r a d a t i o n . Ann. Rev. Biochem. 61, 7 6 1 - 8 0 7 . H e r s h k o , A., H e l l e r , H , E l i a s , S., a n d C i e c h a n o v e r , A . ( 1 9 8 3 ) . C o m p o n e n t s o f u b i q u i t i n -p r o t e i n l i g a s e s y s t e m . R e s o l u t i o n , a f f i n i t y p u r i f i c a t i o n , a n d r o l e i n p r o t e i n b r e a k d o w n . J. Biol. Chem. 258, 8 2 0 6 - 8 2 1 4 . H e s c h l , M . F . P., a n d B a i l l i e , D . L . ( 1 9 9 0 ) . F u n c t i o n a l e l e m e n t s a n d d o m a i n s i n f e r r e d f r o m s e q u e n c e c o m p a r i s o n s o f a h e a t s h o c k g e n e i n t w o n e m a t o d e s . J. Mol. Evol. 31, 3-9. H i e d a , Y., N i s h i z a w a , Y., U e m a t s u , J., a n d O w a r i b e , K. ( 1 9 9 2 ) . I d e n t i f i c a t i o n o f a n e w m a j o r h e m i d e s m o s o m a l p r o t e i n , H D 1 : a m a j o r , h i g h m o l e c u l a r m a s s c o m p o n e n t o f i s o l a t e d h e m i d e s m o s o m e s . J. Cell. Biol. 116, 1497-1506. H o d g k i n , J. ( 1 9 9 5 ) . G e n e t i c n o m e n c l a t u r e g u i d e . Caenorhabditis elegans. Trends Gen. 11, 2 4 -25. H o d g k i n , J., P a p p , A., P u l a k , R., A m b r o s , V., A n d e r s o n , P. ( 1 9 8 9 ) . A n e w k i n d o f i n f o r m a t i o n a l s u p p r e s s i o n i n t h e n e m a t o d e Caenorhabditis elegans. Genetics 123, 3 0 1 -3 1 3 . H o n d a , R., T a n a k a , H , a n d Y a s u d a , H. ( 1 9 9 7 ) . O n c o p r o t e i n M D M 2 i s a u b i q u i t i n l i g a s e E 3 f o r t u m o r s u p p r e s s o r p 5 3 . FEBS Lett. 420, 25-27. H o p k i n s o n , S. B., R i d e l l e , K. S , a n d J o n e s , J. C. R. ( 1 9 9 2 ) . C y t o p l a s m i c d o m a i n o f t h e 1 8 0 - k D b u l l o u s p e m p h i g o i d a n t i g e n , a h e m i d e s m o s o m a l c o m p o n e n t : M o l e c u l a r a n d c e l l b i o l o g i c c h a r a c t e r i z a t i o n . J. Inv. Derm. 99, 2 6 4 - 2 7 0 . H r e s k o , M . C , W i l l i a m s , B . D., a n d W a t e r s t o n , R. H . ( 1 9 9 4 ) . A s s e m b l y o f b o d y w a l l m u s c l e a n d m u s c l e c e l l a t t a c h m e n t s t r u c t u r e s i n Caenorhabditis elegans. J. Cell Biol. 124, 4 9 1 -506. 151 H r e s k o , M . C , S c h r i e f e r , L . A., S h r i m a n k a r , P., a n d W a t e r s t o n , R. H . ( 1 9 9 9 ) . M y o t a c t i n , a n o v e l h y p o d e r m a l p r o t e i n i n v o l v e d i n m u s c l e - c e l l a d h e s i o n i n Caenorhabditis elegans. J. Cell. Biol. 146, 659-672. H u a n g , H , K a h a n a , A., G o t t s c h l i n g , D. E., P r a k a s h , L., a n d L i e b m a n , S. W. ( 1 9 9 7 ) . T h e u b i q u i t i n - c o n j u g a t i n g e n z y m e R a d 6 ( U b c 2 ) is r e q u i r e d f o r s i l e n c i n g i n Saccharomyces cerevisiae. Mol. Cell. Biol. 17, 6 6 9 3 - 6 6 9 9 . H u a n g , L . S., T z o u , P., a n d S t e r n b e r g , P. W. ( 1 9 9 4 ) . T h e lin-15 l o c u s e n c o d e s t w o n e g a t i v e r e g u l a t o r s o f Caenorhabditis elegans v u l v a l d e v e l o p m e n t . Mol. Biol. Cell 5, 3 9 5 - 4 1 1 . H u a n g , X.-Y., a n d H i r s c h , D . ( 1 9 8 9 ) . A s e c o n d / r a w - s p l i c e d R N A l e a d e r s e q u e n c e i n t h e n e m a t o d e Caenorhabditis elegans. Proc. Natl. Acad. Sci. USA 86, 8 6 4 0 - 8 6 4 4 . H u a n g , Y., B a k e r , R. T., a n d F i s c h e r - V i z e , J. A . ( 1 9 9 5 ) . C o n t r o l o f c e l l f a t e b y a d e u b i q u i t i n a t i n g e n z y m e e n c o d e d b y t h e fat facets gene. Science 270, 1 8 2 8 - 1 8 3 1 . H u i b r e g t s e , J. M., S c h e f f n e r , M., B e a u d e n o n , S., a n d H o w l e y , P. M . ( 1 9 9 5 ) . A f a m i l y o f p r o t e i n s s t r u c t u r a l l y a n d f u n c t i o n a l l y r e l a t e d t o t h e E 6 - A P u b i q u i t i n - p r o t e i n l i g a s e . Proc. Natl. Acad. Sci. USA 92, 775-784. H u i b r e g t s e , J. M., S c h e f f n e r , M , a n d H o w l e y , P. M . ( 1 9 9 3 ) . L o c a l i z a t i o n o f t h e E 6 - A P r e g i o n s t h a t d i r e c t h u m a n p a p i l l o m a v i r u s E 6 b i n d i n g , a s s o c i a t i o n w i t h p 5 3 , a n d u b i q u i t i n a t i o n o f a s s o c i a t e d p r o t e i n s . Mol. Cell. Biol. 13, 4 9 1 8 - 4 9 2 7 . I k e d a , S., K i s h i d a , K., Y a m a m o t o , H , M u r a i , H , K o y o m a , S., a n d K i k u c h i , A . ( 1 9 9 8 ) . A x i n , a n e g a t i v e r e g u l a t o r o f t h e W n t s i g n a l i n g p a t h w a y , f o r m s a c o m p l e x w i t h GSK - 3 P a n d p -c a t e n i n a n d p r o m o t e s GSK-3P-dependent p h o s p h o r y l a t i o n o f P-catenin. EMBO J. 17, 1 3 7 1 - 1 3 8 4 . I n g h a m , P. W. ( 1 9 9 8 ) . T r a n s d u c i n g H e d g e h o g : T h e s t o r y s o far. EMBO J. 17, 3 5 0 5 - 3 5 1 1 . I s a k s s o n , A., P e v e r a l i , F. A., K o c k e l , L., M l o d z i k , M., a n d B o h m a n n , D . ( 1 9 9 7 ) . T h e d e u b i q u i t i n a t i o n e n z y m e f a t f a c e t s n e g a t i v e l y r e g u l a t e s R T K / R a s / M A P K s i g n a l l i n g d u r i n g Drosophila e y e d e v e l o p m e n t . Mech. Dev. 68, 59-67. J e n s e n , J. P., B a t e s , P. W., Y a n g , M., V i e r s t r a , R. D., a n d W e i s s m a n , A . M . ( 1 9 9 5 ) . I d e n t i f i c a t i o n o f a f a m i l y o f c l o s e l y r e l a t e d h u m a n u b i q u i t i n c o n j u g a t i n g e n z y m e s . J. Biol. Chem. 270, 3 0 4 0 8 - 3 0 4 1 4 . J o h n s o n , E . S., B a r t e l , B., S e u f e r t , W., a n d V a r s h a v s k y , A . ( 1 9 9 2 ) . U b i q u i t i n a s a d e g r a d a t i o n s i g n a l . EMBOJ. 11, 4 9 7 - 5 0 5 . J o n e s , D., a n d C a n d i d o , E . P. ( 1 9 9 3 ) . N o v e l u b i q u i t i n - l i k e r i b o s o m a l p r o t e i n f u s i o n g e n e s f r o m t h e n e m a t o d e s Caenorhabditis elegans a n d Caenorhabditis briggsae. J. Biol. Chem. 268, 1 9 5 4 5 - 1 9 5 5 1 . 152 J o n n a l a g a d d a , S., B u t t , T. R., M o n i a , B . P., M i r a b e l l i , C. K , G o t l i b , L., E c k e r , D . J., a n d C r o o k e , S. T. ( 1 9 8 9 ) . M u l t i p l e ( a - N H - u b i q u i t i n ) p r o t e i n e n d o p r o t e a s e s i n c e l l s . J. Biol. Chem. 264, 1 0 6 3 7 - 1 0 6 4 2 . J u n g m a n n , J., R e i n s , H . A., S c h o b e r t , C , a n d J e n t s c h , S. ( 1 9 9 3 ) . R e s i s t a n c e t o c a d m i u m m e d i a t e d b y u b i q u i t i n - d e p e n d e n t p r o t e o l y s i s . Nature 361, 3 6 9 - 3 7 1 . K e l l y , W. G., X u , S., M o n t g o m e r y , M . K , a n d F i r e , A . ( 1 9 9 7 ) . D i s t i n c t r e q u i r e m e n t s f o r s o m a t i c a n d g e r m l i n e e x p r e s s i o n o f a g e n e r a l l y e x p r e s s e d Caenorhabditis elegans g e n e . Genetics 146, 2 2 7 - 2 3 8 . K e n n e d y , B . P., A a m o d t , E . J., A l l e n , F. L., C h u n g , M . A., H e s c h l , M . F., a n d M c G h e e , J. D. ( 1 9 9 3 ) . T h e g u t e s t e r a s e g e n e (ges-J) f r o m t h e n e m a t o d e s Caenorhabditis elegans a n d Caenorhabditis briggsae. J. Mol. Biol. 229, 890-908. K i m b l e , J. a n d W a r d , S. ( 1 9 8 8 ) . G e r m - l i n e d e v e l o p m e n t a n d f e r t i l i z a t i o n . In: T h e N e m a t o d e Caenorhabditis elegans. (ed. W. B . W o o d a n d t h e C o m m u n i t y o f C. elegans R e s e a r c h e r s ) , pp. 191-214. C o l d S p r i n g H a r b o r L a b o r a t o r y , C o l d S p r i n g H a r b o r , N e w Y o r k . K i m b l e , J., a n d S h a r r o c k , W. J. ( 1 9 8 3 ) . T i s s u e - s p e c i f i c s y n t h e s i s o f y o l k p r o t e i n s i n Caenorhabditis elegans. Dev. Biol. 96, 189-196. K i n g , R. W., P e t e r s , J. M., T u g e n d r e i c h , S., R o l f e , M., H i e t e r , P., a n d K i r s c h n e r , M . W. ( 1 9 9 5 ) . A 2 0 S c o m p l e x c o n t a i n i n g C D C 2 7 a n d C D C 16 c a t a l y z e s t h e m i t o s i s - s p e c i f i c c o n j u g a t i o n o f u b i q u i t i n t o c y c l i n B . Cell 81, 2 7 9 - 2 8 8 . K o , L . J., a n d P r i v e s , C. ( 1 9 9 6 ) . p 5 3 : P u z z l e a n d p a r a d i g m . Genes Dev. 10, 1 0 5 4 - 1 0 7 2 . K o e p p , D . M., H a r p e r , J. W., a n d E l l e d g e , S. J. ( 1 9 9 9 ) . H o w t h e c y c l i n b e c a m e a c y c l i n : R e g u l a t e d p r o t e o l y s i s i n t h e c e l l c y c l e . Cell 97, 4 3 1 - 4 3 4 . K r a m e r , J. M., F r e n c h , R. P., P a r k , E . - C , a n d J o h n s o n , J. J. ( 1 9 9 0 ) . T h e Caenorhabditis elegans rol-6 gene, w h i c h i n t e r a c t s w i t h t h e sqt-1 c o l l a g e n g e n e t o d e t e r m i n e o r g a n i s m a l m o r p h o l o g y e n c o d e s a c o l l a g e n . Mol. Cell. Biol. 10, 2 0 8 1 - 2 0 8 9 . K r a u s e , M., F i r e , A., W h i t e - H a r r i s o n , S., P r i e s s , J., a n d W e i n t r a u b , H . ( 1 9 9 0 ) . C e M y o D a c c u m u l a t i o n d e f i n e s t h e b o d y w a l l m u s c l e c e l l f a t e d u r i n g C. elegans e m b r y o g e n e s i s . Ce//63, 9 0 7 - 9 1 9 . K r a u s e , M., H a r r i s o n , S. W., X u , S. Q . , C h e n , L., a n d F i r e , A . ( 1 9 9 4 ) . E l e m e n t s r e g u l a t i n g c e l l -a n d s t a g e - s p e c i f i c e x p r e s s i o n o f t h e C. elegans M y o D f a m i l y h o m o l o g hlh-1. Dev. Biol. 166, 133-148. K r a u s e , M., a n d H i r s h , D. ( 1 9 8 7 ) . A trans-spliced l e a d e r s e q u e n c e o n a c t i n m R N A i n C. elegans. Cell 49, 7 5 3 - 7 6 1 . 153 K u w a b a r a , P. E . ( 1 9 9 6 ) . I n t e r s p e c i e s c o m p a r i s o n r e v e a l s e v o l u t i o n o f c o n t r o l r e g i o n s i n t h e n e m a t o d e s e x - d e t e r m i n i n g g e n e tra-2. Genetics 1 4 4 , 5 9 7 - 6 0 7 . K u w a b a r a , P. E., a n d S h a h , S. ( 1 9 9 4 ) . C l o n i n g b y s y n t e n y : i d e n t i f y i n g C. briggsae h o m o l o g u e s o f C. elegans g e n e s . Nucleic Acids Res. 2 2 , 4 4 1 4 - 4 4 1 8 . L a e m m l i , U . K. ( 1 9 7 0 ) . C l e a v a g e o f s t r u c t u r a l p r o t e i n s d u r i n g t h e a s s e m b l y o f t h e h e a d o f b a c t e r i o p h a g e T 4 . Nature 2 2 7 , 680-685. L a n e , T. F., a n d S a g e , E . H . ( 1 9 9 4 ) . T h e b i o l o g y o f S P A R C , a p r o t e i n t h a t m o d u l a t e s c e l l -m a t r i x i n t e r a c t i o n s . FASEB J. 8 , 163-173. L e e , Y . H , H u a n g , X. Y., H i r s h , D., F o x , G. E., a n d H e c h t , R. M . ( 1 9 9 2 ) . C o n s e r v a t i o n o f g e n e o r g a n i z a t i o n a n d / r a w s - s p l i c i n g i n t h e g l y c e r a l d e h y d e - 3 - p h o s p h a t e d e h y d r o g e n a s e -e n c o d i n g g e n e s o f Caenorhabditis briggsae. Gene 1 2 1 , 2 2 7 - 2 3 5 . L e g g e t t , D. S., a n d C a n d i d o , P. M . ( 1 9 9 7 ) . B i o c h e m i c a l c h a r a c t e r i z a t i o n o f Caenorhabditis elegans U B C - 1 : s e l f - a s s o c i a t i o n a n d a u t o - u b i q u i t i n a t i o n o f a R A D 6 - l i k e u b i q u i t i n -c o n j u g a t i n g e n z y m e in vitro. Biochem. J. 3 2 7 , 3 5 7 - 3 6 1 . L e g g e t t , D . S., J o n e s , D., a n d C a n d i d o , E . P. ( 1 9 9 5 ) . Caenorhabditis elegans U B C - 1 , a u b i q u i t i n - c o n j u g a t i n g e n z y m e h o m o l o g o u s t o y e a s t R A D 6 / U B C 2 , c o n t a i n s a n o v e l c a r b o x y - t e r m i n a l e x t e n s i o n t h a t i s c o n s e r v e d i n n e m a t o d e s . DNA Cell Biol. 1 4 , 8 8 3 -8 9 1 . L i , C. C , D a i , R. M., a n d L o n g o , D. L . ( 1 9 9 5 ) . I n a c t i v a t i o n o f N F - K B i n h i b i t o r IKBCX: u b i q u i t i n - d e p e n d e n t p r o t e o l y s i s a n d its d e g r a d a t i o n p r o d u c t . Biochem. Biophys. Res. Comm. 2 1 5 , 2 9 2 - 3 0 1 . L i m , H . H , G o h , P. Y., a n d S u r a n a , U . ( 1 9 9 8 ) . C d c 2 0 i s e s s e n t i a l f o r t h e c y c l o s o m e - m e d i a t e d p r o t e o l y s i s o f b o t h P d s l a n d C l b 2 d u r i n g M p h a s e i n b u d d i n g y e a s t . Curr. Biol. 8 , 2 3 1 -234. L i n , R., T h o m p s o n , S., a n d P r i e s s , J. R. ( 1 9 9 5 ) . pop-1 e n c o d e s a n H M G b o x p r o t e i n r e q u i r e d f o r t h e s p e c i f i c a t i o n o f a m e s o d e r m p r e c u r s o r i n e a r l y C. elegans e m b r y o s . Cell 8 3 , 5 9 9 - 6 0 9 . L i s z t w a n , J., M a r t i , A., S u t t e r l u t y , H , G s t a i g e r , M., W i r b e l a u e r , C , a n d K r e k , W. ( 1 9 9 8 ) . A s s o c i a t i o n o f h u m a n C U L - 1 a n d u b i q u i t i n - c o n j u g a t i n g e n z y m e C D C 3 4 w i t h t h e F - b o x p r o t e i n p 4 5 - S K P 2 : E v i d e n c e f o r e v o l u t i o n a r y c o n s e r v a t i o n i n t h e s u b u n i t c o m p o s i t i o n o f t h e C D C 3 4 - S C F p a t h w a y . EMBO J. 1 7 , 3 6 8 - 3 8 3 . L i u , C. C , M i l l e r , H . I., K o h r , W. J., a n d S i l b e r , J. I. ( 1 9 8 9 ) . P u r i f i c a t i o n o f a u b i q u i t i n p r o t e i n p e p t i d a s e f r o m y e a s t w i t h e f f i c i e n t in vitro a s s a y s . J. Biol. Chem. 2 6 4 , 2 0 3 3 1 - 2 0 3 3 8 . L i u , Z., H a a s , A . L., D i a z , L . A., C o n r a d , C. A., a n d G i u d i c e , G. J. ( 1 9 9 6 ) . C h a r a c t e r i z a t i o n o f a n o v e l k e r a t i n o c y t e u b i q u i t i n c a r r i e r p r o t e i n . J. Biol. Chem. 2 7 1 , 2 8 1 7 - 2 8 2 2 . 154 L o w e , J., S t o c k , D., Jap, B., Z w i c k l , P., B a u m e i s t e r , W., a n d H u b e r , R. ( 1 9 9 5 ) . C r y s t a l s t r u c t u r e o f t h e 2 0 S p r o t e a s o m e f r o m t h e a r c h a e o n T. acidophilum at 3.4 A r e s o l u t i o n . Science 268, 5 3 3 - 5 3 9 . L u , Z., L i u , D., H o r n i a , A., D e v o n i s h , W., P a g a n o , M., a n d F o s t e r , D . A . ( 1 9 9 8 ) . A c t i v a t i o n o f p r o t e i n k i n a s e C t r i g g e r s its u b i q u i t i n a t i o n a n d d e g r a d a t i o n . Mol. Cell. Biol. 18, 8 3 9 -845. L y a p i n a , S. A , C o r r e l l , C. C , K i p r e o s , E . T., a n d D e s h a i e s , R. J. ( 1 9 9 8 ) . H u m a n C U L 1 f o r m s a n e v o l u t i o n a r i l y c o n s e r v e d u b i q u i t i n l i g a s e c o m p l e x ( S C F ) w i t h S K P 1 a n d a n F - b o x p r o t e i n . Proc. Natl. Acad. Sci. U.S.A. 95, 7 4 5 1 - 7 4 5 6 . M a d u r o , M., a n d P i l g r i m , D . ( 1 9 9 6 ) . C o n s e r v a t i o n o f f u n c t i o n a n d e x p r e s s i o n o f unc-119 f r o m t w o Caenorhabditis s p e c i e s d e s p i t e d i v e r g e n c e o f n o n - c o d i n g D N A . Gene 183, 77-85. M a i n i e r o , F., P e p e , A., W a r y , K. K., S p i n a r d i , L., M o h a m m a d i , M., S c h l e s s i n g e r , J., a n d G i a n c o t t i , F. G. ( 1 9 9 5 ) . S i g n a l t r a n s d u c t i o n b y t h e a 6 p 4 i n t e g r i n : d i s t i n c t P4 s u b u n i t s i t e s m e d i a t e r e c r u i t m e n t o f S h c / G r b 2 a n d a s s o c i a t i o n w i t h t h e c y t o s k e l e t o n o f h e m i d e s m o s o m e s . EMBOJ. 14, 4 4 7 0 - 4 4 8 1 . M a n i a t i s , T . ( 1 9 9 9 ) . A u b i q u i t i n l i g a s e c o m p l e x e s s e n t i a l f o r t h e N F - K B , W n t / W i n g l e s s a n d H e d g e h o g s i g n a l i n g p a t h w a y s . Genes Dev. 13, 505-510. M a r r a , M . A . ( 1 9 9 4 ) . G e n o m e a n a l y s i s i n C. elegans: G e n e t i c a n d m o l e c u l a r i d e n t i f i c a t i o n o f g e n e s t i g h t l y l i n k e d t o unc-22(YV). Ph.D. t h e s i s . S i m o n F r a s e r U n i v e r s i t y , V a n c o u v e r . M a r s h a l l , C. J. ( 1 9 9 5 ) . S p e c i f i c i t y o f r e c e p t o r t y r o s i n e k i n a s e s i g n a l i n g : T r a n s i e n t v e r s u s s u s t a i n e d e x t r a c e l l u l a r s i g n a l - r e g u l a t e d k i n a s e a c t i v a t i o n . Cell 80, 1 7 9 - 1 8 5 . M a t h i a s , N., S t e u s s y , C. N., a n d G o e b l , M . G. ( 1 9 9 8 ) . A n e s s e n t i a l d o m a i n w i t h i n C d c 3 4 p is r e q u i r e d f o r b i n d i n g t o a c o m p l e x c o n t a i n i n g C d c 4 p a n d C d c 5 3 p i n Saccharomyces cerevisiae. J. Biol. Chem. 273, 4 0 4 0 - 4 0 4 5 . M a t u s c h e w s k i , K., H a u s e r , H . P., T r e i e r , M., a n d J e n t s c h , S. ( 1 9 9 6 ) . I d e n t i f i c a t i o n o f a n o v e l f a m i l y o f u b i q u i t i n - c o n j u g a t i n g e n z y m e s w i t h d i s t i n c t a m i n o - t e r m i n a l e x t e n s i o n s . J. Biol. Chem. Ill, 2 7 8 9 - 2 7 9 4 . M a y e r , A . N., a n d W i l k i n s o n , K. D. ( 1 9 8 9 ) . D e t e c t i o n , r e s o l u t i o n , a n d n o m e n c l a t u r e o f m u l t i p l e u b i q u i t i n c a r b o x y l - t e r m i n a l e s t e r a s e s f r o m b o v i n e c a l f t h y m u s . Biochemistry 28, 166-172. M c G r a t h , J. P., J e n t s c h , S., a n d V a r s h a v s k y , A . ( 1 9 9 1 ) . UBA1: A n e s s e n t i a l y e a s t g e n e e n c o d i n g u b i q u i t i n - a c t i v a t i n g e n z y m e . EMBOJ. 10, 2 2 7 - 2 3 6 . M e l l o , C , a n d F i r e , A . ( 1 9 9 5 ) . D N A t r a n s f o r m a t i o n . Methods Cell Biol. 48, 4 5 1 - 4 8 2 . M i l l e r , J. R., a n d M o o n , R. T. ( 1 9 9 6 ) . S i g n a l t r a n s d u c t i o n t h r o u g h P-catenin a n d s p e c i f i c a t i o n o f c e l l f a t e d u r i n g e m b r y o g e n e s i s . Genes Dev. 10, 2 5 2 7 - 2 5 3 9 . 155 M i y a k e , S., L u p h e r , M . L., Jr., D r u k e r , B., a n d B a n d , H. ( 1 9 9 8 ) . T h e t y r o s i n e k i n a s e r e g u l a t o r C b l e n h a n c e s t h e u b i q u i t i n a t i o n a n d d e g r a d a t i o n o f t h e p l a t e l e t - d e r i v e d g r o w t h f a c t o r r e c e p t o r a l p h a . Proc. Natl. Acad. Sci. USA 95, 7 9 2 7 - 7 9 3 2 . M i y a m o t o , S., T e r a m o t o , H., C o s o , A., G u t k i n d , J. S., B u r b e l o , P. D., A k i y a m a , S. K., a n d K M . , Y . ( 1 9 9 5 ) . I n t e g r i n f u n c t i o n : m o l e c u l a r h i e r a r c h i e s o f c y t o s k e l e t a l a n d s i g n a l l i n g m o l e c u l e s . J. Cell Biol. 131, 7 9 1 - 8 0 5 . M i z u s h i m a , N., N o d a , T., Y o s h i m o r i , T., T a n a k a , Y., I s h i i , T., G e o r g e , M . D., K l i o n s k y , D . J., O h s u m i , M., a n d O h s u m i , Y. ( 1 9 9 8 ) . A p r o t e i n c o n j u g a t i o n s y s t e m e s s e n t i a l f o r a u t o p h a g y . Nature 395, 395-398. M o a z e d , D., a n d J o h n s o n , D. ( 1 9 9 6 ) . A d e u b i q u i t i n a t i n g e n z y m e i n t e r a c t s w i t h S I R 4 a n d r e g u l a t e s s i l e n c i n g i n S. cerevisiae. Cell 86, 6 6 7 - 6 7 7 . M o e r m a n , D . G. a n d F i r e , A . ( 1 9 9 7 ) . M u s c l e : s t r u c t u r e , f u n c t i o n , a n d d e v e l o p m e n t . In: C elegans II. (ed. R i d d l e , D. L., B l u m e n t h a l , T., M e y e r , B . J., a n d P r i e s s , J. R.) pp. 4 1 7 -4 7 0 . C o l d S p r i n g H a r b o r L a b o r a t o r y P r e s s , P l a i n v i e w , N e w Y o r k . M o e r m a n , D. G., a n d B a i l l i e , D. L . ( 1 9 7 9 ) . G e n e t i c o r g a n i z a t i o n o f Caenorhabditis elegans. F i n e - s t r u c t u r e a n a l y s i s o f t h e unc-22 gene. Genetics 91, 95-103. M o r e l l e , G. ( 1 9 8 9 ) . A p l a s m i d e x t r a c t i o n p r o c e d u r e o n a m i n i p r e p s c a l e . Focus 11, 7-8. M o r g a n , D. O. ( 1 9 9 5 ) . T h e p r i n c i p l e s o f C D K r e g u l a t i o n . Nature 374, 131-134. M o r i s a t o , D., a n d A n d e r s o n , K. V . ( 1 9 9 5 ) . S i g n a l i n g p a t h w a y s t h a t e s t a b l i s h t h e d o r s a l - v e n t r a l p a t t e r n o f t h e Drosophila e m b r y o . Ann. Rev. Genet. 19, 3 7 1 - 3 7 9 . M o r r i s o n , A., M i l l e r , E . J., a n d P r a k a s h , L . ( 1 9 8 8 ) . D o m a i n s t r u c t u r e a n d f u n c t i o n a l a n a l y s i s o f t h e c a r b o x y l - t e r m i n a l p o l y a c i d i c s e q u e n c e o f t h e R A D 6 p r o t e i n o f Saccharomyces cerevisiae. Mol. Cell Biol. 8, 1 1 7 9 - 1 1 8 5 . M o u l d e r , G. L., H u a n g , M . M., W a t e r s t o n , R. H , a n d B a r s t e a d , R. J. ( 1 9 9 6 ) . T a l i n r e q u i r e s p -i n t e g r i n , b u t n o t v i n c u l i n , f o r its a s s e m b l y i n t o f o c a l a d h e s i o n - l i k e s t r u c t u r e s i n t h e n e m a t o d e Caenorhabditis elegans. Mol. Biol. Cell 7, 1 1 8 1 - 1 1 9 3 . M u h l r a d , D., a n d P a r k e r , R. ( 1 9 9 4 ) . P r e m a t u r e t r a n s l a t i o n a l t e r m i n a t i o n t r i g g e r s m R N A d e c a p p i n g . Nature 370, 5 7 8 - 5 8 1 . M u l l e n , G. P. ( 1 9 9 8 ) . L o c a l i z a t i o n a n d f u n c t i o n o f p e r l e c a n / U N C - 5 2 i s o f o r m s i n t h e n e m a t o d e Caenorhabditis elegans. Ph.D. t h e s i s . U n i v e r s i t y o f B r i t i s h C o l u m b i a , V a n c o u v e r . M u l l e n , G. P., R o g a l s k i , T. M., B u s h , J. A., G o r j i , P. R., a n d M o e r m a n , D . G. ( 1 9 9 9 ) . C o m p l e x p a t t e r n s o f a l t e r n a t i v e s p l i c i n g m e d i a t e t h e s p a t i a l a n d t e m p o r a l d i s t r i b u t i o n o f P e r l e c a n / U N C - 5 2 i n Caenorhabditis elegans. Mol. Biol. Cell 10, 3 2 0 5 - 3 2 2 1 . 156 M u s t i , A . M , T r e i e r , M., a n d B o h m a n n , D . ( 1 9 9 7 ) . R e d u c e d u b i q u i t i n - d e p e n d e n t d e g r a d a t i o n o f c - J u n a f t e r p h o s p h o r y l a t i o n b y M A P k i n a s e s . Science 2 7 5 , 4 0 0 - 4 0 2 . M y e r s , C . D., G o h , P. - Y , A l l e n , T. S., B u c h e r , E . A , B o g a e r t , T. ( 1 9 9 6 ) . D e v e l o p m e n t a l g e n e t i c a n a l y s i s o f t r o p o n i n T m u t a t i o n s i n s t r i a t e d a n d n o n s t r i a t e d m u s c l e c e l l s o f Caenorhabditis elegans. J. Cell Biol. 132. 1 0 6 1 - 1 0 7 7 . N i g o n , V., a n d D o u g h e r t y , E . C. ( 1 9 4 9 ) . R e p r o d u c t i v e p a t t e r n s a n d a t t e m p t s at r e c i p r o c a l c r o s s i n g o f Rhabditis elegans M a u p a s 1900, a n d Rhabditis briggsae. J. Exp. Zool. 112, 4 8 5 - 5 0 3 . N u b e r , U., S c h w a r z , S., K a i s e r , P., S c h n e i d e r , R., a n d S c h e f f n e r , M . ( 1 9 9 6 ) . C l o n i n g o f h u m a n u b i q u i t i n - c o n j u g a t i n g e n z y m e s U b c H 6 a n d U b c H 7 ( E 2 - F 1 ) a n d c h a r a c t e r i z a t i o n o f t h e i r i n t e r a c t i o n w i t h E 6 - A P a n d R S P 5 . J.Biol. Chem. Ill, 2 7 9 5 - 2 8 0 0 . O k a z a k i , K , a n d S a g a t a , N . ( 1 9 9 5 ) . T h e M o s / M A P k i n a s e p a t h w a y s t a b i l i z e s c - F o s b y p h o s p h o r y l a t i o n a n d a u g m e n t s its t r a n s f o r m i n g a c t i v i t y i n N T H 3 T 3 c e l l s . EMBO J. 14, 5 0 4 8 - 5 0 5 9 . O r f o r d , K., C r o c k e t t , C , J e n s e n , J. P., W e i s s m a n , A . M., a n d B y e r s , S. W. ( 1 9 9 7 ) . S e r i n e p h o s p h o r y l a t i o n - r e g u l a t e d u b i q u i t i n a t i o n a n d d e g r a d a t i o n o f P-catenin. J. Biol. Chem. 272, 2 4 7 3 5 - 2 4 7 3 8 . O r i a n , A., W h i t e s i d e , S., I s r a e l , A., S t a n c o v s k i , I., S c h w a r t z , A . L., a n d C i e c h a n o v e r , A . ( 1 9 9 5 ) . U b i q u i t i n - m e d i a t e d p r o c e s s i n g o f N F - K B t r a n s c r i p t i o n a l a c t i v a t o r p r e c u r s o r p i 0 5 . R e c o n s t i t u t i o n o f a c e l l - f r e e s y s t e m a n d i d e n t i f i c a t i o n o f t h e u b i q u i t i n - c a r r i e r p r o t e i n , E 2 , a n d a n o v e l u b i q u i t i n - p r o t e i n l i g a s e , E 3 , i n v o l v e d i n c o n j u g a t i o n . J. Biol. Chem. 270,21707-21714. O r i n o , E., T a n a k a , K., T a m u r a , T., Sone, S., O g u r a , T., a n d I c h i h a r a , A . ( 1 9 9 1 ) . A T P -d e p e n d e n t r e v e r s i b l e a s s o c i a t i o n o f p r o t e a s o m e s w i t h m u l t i p l e p r o t e i n c o m p o n e n t s t o f o r m 2 6 S c o m p l e x e s t h a t d e g r a d e u b i q u i t i n a t e d p r o t e i n s i n h u m a n H L - 6 0 c e l l s . FEBS Lett. 284, 2 0 6 - 2 1 0 . O s a k a , F., S e i n o , H., S e n o , T., a n d Y a m a o , F. ( 1 9 9 7 ) . A u b i q u i t i n - c o n j u g a t i n g e n z y m e i n f i s s i o n y e a s t t h a t i s e s s e n t i a l f o r t h e o n s e t o f a n a p h a s e i n m i t o s i s . Mol. Cell. Biol. 17, 3 3 8 8 - 3 3 9 7 . O z k a y n a k , E., F i n l e y , D., a n d V a r s h a v s k y , A . ( 1 9 8 4 ) . T h e y e a s t u b i q u i t i n g e n e : h e a d - t o - t a i l r e p e a t s e n c o d i n g a p o l y u b i q u i t i n p r e c u r s o r p r o t e i n . Nature 312, 6 6 3 - 6 6 6 . P a g e , A . P. ( 1 9 9 9 ) . A h i g h l y c o n s e r v e d n e m a t o d e p r o t e i n f o l d i n g o p e r o n i n Caenorhabditis elegans a n d Caenorhabditis briggsae. Gene 230, 2 6 7 - 2 7 5 . P a l o m b e l l a , V . J., R a n d o , O. J., G o l d b e r g , A . L., a n d M a n i a t i s , T. ( 1 9 9 4 ) . T h e u b i q u i t i n -p r o t e a s o m e p a t h w a y i s r e q u i r e d f o r p r o c e s s i n g t h e N F - K B 1 p r e c u r s o r p r o t e i n a n d t h e a c t i v a t i o n o f N F - K B . Cell IS, 773-785. 157 P a t t o n , E . E., W i l l e m s , A . R., Sa, D., K u r a s , L., T h o m a s , D., C r a i g , K . L., a n d T y e r s , M . ( 1 9 9 8 ) . C d c 5 3 i s a s c a f f o l d p r o t e i n f o r m u l t i p l e C d c 3 4 / S k p l / F - b o x p r o t e i n c o m p l e x e s t h a t r e g u l a t e c e l l d i v i s i o n a n d m e t h i o n i n e b i o s y n t h e s i s i n y e a s t . Genes Dev. 12, 6 9 2 -705.' P a u l s s o n , M . ( 1 9 9 2 ) . B a s e m e n t m e m b r a n e p r o t e i n s . S t r u c t u r e , a s s e m b l y a n d c e l l u l a r i n t e r a c t i o n s . Crit. Rev. Biochem. Mol. Biol. 27, 93-127. P a y r e , F., V i n c e n t , A., a n d C a r r e n o , S. ( 1 9 9 9 ) . o v o / s v b i n t e g r a t e s W i n g l e s s a n d D E R p a t h w a y s t o c o n t r o l e p i d e r m i s d i f f e r e n t i a t i o n . Nature 400, 2 7 1 - 2 7 5 . P e d e r s o n , T. ( 1 9 9 8 ) . T h e p l u r i f u n c t i o n a l n u c l e o l u s . Nucleic Acids Res. 26, 3 8 7 1 - 3 8 7 6 . P e l t z , S. W., H e , F., W e l c h , E., a n d J a c o b s o n , A . ( 1 9 9 4 ) . N o n s e n s e - m e d i a t e d m R N A d e c a y i n y e a s t . Prog. Nucleic Acid Res. Mol. Biol. 47, 2 7 1 - 2 9 8 . P e t e r s , J.-M., H a r r i s , J. R., a n d K l e i n s c h m i d t , J. A . ( 1 9 9 1 ) . U l t r a s t r u c t u r e o f t h e a p p r o x i m a t e l y 2 6 S c o m p l e x c o n t a i n i n g t h e a p p r o x i m a t e l y 2 0 S c y l i n d e r p a r t i c l e ( m u l t i c a t a l y t i c p r o t e i n a s e / p r o t e a s o m e ) . Eur. J. Cell Biol. 56, 4 2 2 - 4 3 2 . P e t e r s , J.-M., H a r r i s , J. R., a n d F i n l e y , D., E d s . ( 1 9 9 8 ) . U b i q u i t i n a n d t h e b i o l o g y o f t h e c e l l . P l e n u m P r e s s , N e w Y o r k . P i c k a r t , C. M., a n d R o s e , I. A . ( 1 9 8 5 ) . F u n c t i o n a l h e t e r o g e n e i t y o f u b i q u i t i n c a r r i e r p r o t e i n s . J. Biol. Chem. 260, 1 5 7 3 - 1 5 8 1 . P i c k a r t , C. M., a n d V e l l a , A . T. ( 1 9 8 8 ) . U b i q u i t i n c a r r i e r p r o t e i n - c a t a l y z e d u b i q u i t i n t r a n s f e r t o h i s t o n e s . M e c h a n i s m a n d s p e c i f i c i t y . J. Biol. Chem. 263, 1 5 0 7 6 - 1 5 0 8 2 . P i l g r i m , D., M c G r e g o r , A., J a c k i e , P., J o h n s o n , T., a n d H a n s e n , D . ( 1 9 9 5 ) . T h e C. elegans sex-d e t e r m i n i n g g e n e fem-2 e n c o d e s a p u t a t i v e p r o t e i n p h o s p h a t a s e . Mol. Biol. Cell 6, 1 1 5 9 -1171. P l a s t e r k , R. H , V a n L u e n e n , H , V o s , C , I v i e s , Z., I s z v a k , Z., F i s h e r , S. ( 1 9 9 8 ) . T r a n s p o s a b l e e l e m e n t s as t o o l s f r o m m u t a g e n e s i s a n d t r a n s g e n e s i s o f v e r t e b r a t e s . Path. Biol. 46, 6 7 4 -67 5 . P t a k , C , P r e n d e r g a s t , J. A., H o d g i n s , R., K a y , C. M., C h a u , V., a n d E l l i s o n , M . J. ( 1 9 9 4 ) . F u n c t i o n a l a n d p h y s i c a l c h a r a c t e r i z a t i o n o f t h e c e l l c y c l e u b i q u i t i n - c o n j u g a t i n g e n z y m e C D C 3 4 ( U B C 3 ) . I d e n t i f i c a t i o n o f a f u n c t i o n a l d e t e r m i n a n t w i t h i n t h e t a i l t h a t f a c i l i t a t e s C D C 3 4 s e l f - a s s o c i a t i o n . J. Biol. Chem. 269, 2 6 5 3 9 - 2 6 5 4 5 . P u l a k , R., a n d A n d e r s o n , P. ( 1 9 9 3 ) . m R N A s u r v e i l l a n c e b y t h e Caenorhabditis elegans smg g e n e s . Genes Dev. 7, 1885-1897. R e c h s t e i n e r , M., a n d R o g e r s , S. W. ( 1 9 9 6 ) . P E S T s e q u e n c e s a n d r e g u l a t i o n b y p r o t e o l y s i s . Trends Biochem. Sci. 247, 2 6 7 - 2 7 1 . 158 R i n e , J., a n d H e r s k o w i t z , I. ( 1 9 8 7 ) . F o u r g e n e s r e s p o n s i b l e f o r a p o s i t i o n e f f e c t o n e x p r e s s i o n f r o m H M L a n d F f M R i n Saccharomyces cerevisiae. Genetics 116, 9-22. R o c h e l e a u , C. E., D o w n s , W. D., L i n , R., W i t t m a n n , C , B e i , Y., C h a , Y . H , A l i , M., P r i e s s , J. R., a n d M e l l o , C. C. ( 1 9 9 7 ) . W n t s i g n a l i n g a n d a n A P C - r e l a t e d g e n e s p e c i f y e n d o d e r m i n e a r l y C. elegans e m b r y o s . Cell 90, 707-716. R o f f , M., T h o m p s o n , J., R o d r i g u e z , M . S., J a c q u e , J. M., B a l e u x , F., A r e n z a n a - S e i s d e d o s , F., a n d H a y , R. T. ( 1 9 9 6 ) . R o l e o f IKBCC u b i q u i t i n a t i o n i n s i g n a l - i n d u c e d a c t i v a t i o n o f N F -K B in vivo. J. Biol. Chem. 271, 7 8 4 4 - 7 8 5 0 . R o g a l s k i , T. M., a n d B a i l l i e , D . L . ( 1 9 8 5 ) . G e n e t i c o r g a n i z a t i o n o f t h e unc-22 I V g e n e a n d t h e a d j a c e n t r e g i o n i n Caenorhabditis elegans. Mol. Gen. Genet. 201, 4 0 9 - 4 1 4 . R o g a l s k i , T. M., W i l l i a m s , B . D., M u l l e n , G. P., a n d M o e r m a n , D . G. ( 1 9 9 3 ) . P r o d u c t s o f t h e unc-52 g e n e i n Caenorhabditis elegans a r e h o m o l o g o u s t o t h e c o r e p r o t e i n o f t h e m a m m a l i a n b a s e m e n t m e m b r a n e h e p a r a n s u l f a t e p r o t e o g l y c a n . Genes Dev. 7, 1 4 7 1 -1484. R o s s , L . H., F r e e d m a n , J. H , a n d R u b i n , C. S. ( 1 9 9 5 ) . S t r u c t u r e a n d e x p r e s s i o n o f n o v e l s p l i c e d l e a d e r R N A g e n e s i n Caenorhabditis elegans. J. Biol. Chem. 21 ti, 2 2 0 6 6 - 2 2 0 7 5 . R o u s e l l e , P., L u n d s t r u m , G. P., K e e n e , D. R., a n d B u r g e s o n , R. E . ( 1 9 9 1 ) . K a l i n i n : A n e p i t h e l i u m - s p e c i f i c b a s e m e n t m e m b r a n e a d h e s i o n m o l e c u l e t h a t i s a c o m p o n e n t o f a n c h o r i n g f i l a m e n t s . J. Cell Biol. 114, 567-576. R u i z - E c h e v a r r i a , M . J., C z a p l i n s k i , K , a n d P e l t z , S. W. ( 1 9 9 6 ) . M a k i n g s e n s e o f n o n s e n s e i n y e a s t . Trends Biochem. Sci. 21, 433-438. R u s h f o r t h , A . M., S a a r i , B., a n d A n d e r s o n , P. ( 1 9 9 3 ) . S i t e - s e l e c t e d i n s e r t i o n o f t h e t r a n s p o s o n T e l i n t o a Caenorhabditis elegans m y o s i n l i g h t c h a i n g e n e . Mol. Cell. Biol. 13, 9 0 2 -9 1 0 . S a m b r o o k , J., F r i t s c h , E . F., a n d M a n i a t i s , T. ( 1 9 8 9 ) . M o l e c u l a r C l o n i n g : A l a b o r a t o r y m a n u a l . C o l d S p r i n g H a r b o r L a b o r a t o r y , C o l d S p r i n g H a r b o r , N e w Y o r k . S a n g e r , F., N i c k l e n , S., a n d C o u l s o n , A . R. ( 1 9 7 7 ) . D N A s e q u e n c i n g w i t h c h a i n - t e r m i n a t i n g i n h i b i t o r s . Proc. Natl. Acad. Sci. USA 14, 5 4 6 3 - 5 4 6 7 . S a w a , H , L o b e l , L., a n d H o r v i t z , H. R. ( 1 9 9 6 ) . T h e Caenorhabditis elegans g e n e lin-17, w h i c h i s r e q u i r e d f o r c e r t a i n a s y m m e t r i c c e l l d i v i s i o n s , e n c o d e s a p u t a t i v e s e v e n -t r a n s m e m b r a n e p r o t e i n s i m i l a r t o t h e Drosophila f r i z z l e d p r o t e i n . Genes Dev. 10, 2 1 8 9 -2 1 9 7 . S c h e e r , U., a n d H o c k , R. ( 1 9 9 9 ) . S t r u c t u r e a n d f u n c t i o n o f t h e n u c l e o l u s . Curr. Opin. Cell Biol. 11, 3 8 5 - 3 9 0 . 159 S c h e f f n e r , M , H u i b r e g t s e , J. M , a n d H o w l e y , P. M . ( 1 9 9 4 ) . I d e n t i f i c a t i o n o f a h u m a n u b i q u i t i n - c o n j u g a t i n g e n z y m e t h a t m e d i a t e s t h e E 6 - A P - d e p e n d e n t u b i q u i t i n a t i o n o f p 5 3 . Proc. Natl. Acad Sci. USA 9 1 , 8 7 9 7 - 8 8 0 1 . S c h e f f n e r , M., N u b e r , U., a n d H u i b r e g t s e , J. M . ( 1 9 9 5 ) . P r o t e i n u b i q u i t i n a t i o n i n v o l v i n g a n E l -E 2 - E 3 e n z y m e u b i q u i t i n t h i o e s t e r c a s c a d e . Nature 3 7 3 , 81-83. S c h e f f n e r , M., W e r n e s s , B . A., H u i b r e g t s e , J. M., L e v i n e , A . J., a n d H o w l e y , P. M . ( 1 9 9 0 ) . T h e E 6 o n c o p r o t e i n e n c o d e d b y h u m a n p a p i l l o m a v i r u s t y p e s 16 a n d 18 p r o m o t e s t h e d e g r a d a t i o n o f p 5 3 . Cell 63, 1 1 2 9 - 1 1 3 6 . S c h e d l , T. ( 1 9 9 7 ) . D e v e l o p m e n t a l g e n e t i c s o f t h e g e r m l i n e . In: C. elegans II. ( e d . R i d d l e , D . L., B l u m e n t h a l , T., M e y e r , B . I , a n d P r i e s s , J. R.) pp. 2 4 1 - 2 7 0 . C o l d S p r i n g H a r b o r L a b o r a t o r y P r e s s , P l a i n v i e w , N e w Y o r k . S c h n a b e l , R. a n d P r e i s s , J. R. ( 1 9 9 7 ) . S p e c i f i c a t i o n o f c e l l f a t e s i n t h e e a r l y e m b r y o . In: C. elegans II. ( e d . R i d d l e , D. L., B l u m e n t h a l , T., M e y e r , B . J., a n d P r i e s s , J. R.) pp. 3 6 1 -3 8 2 . C o l d S p r i n g H a r b o r L a b o r a t o r y P r e s s , P l a i n v i e w , N e w Y o r k . S c h o e n w a e l d e r , S. M., a n d B u r r i d g e , K. ( 1 9 9 9 ) . B i d i r e c t i o n a l s i g n a l i n g b e t w e e n t h e c y t o s k e l e t o n a n d i n t e g r i n s . Curr. Opin. Cell Biol. 11, 2 7 4 - 2 8 6 . S c h w a r z , S. E., R o s a , J. L., a n d S c h e f f n e r , M . ( 1 9 9 8 ) . C h a r a c t e r i z a t i o n o f h u m a n h e c t d o m a i n f a m i l y m e m b e r s a n d t h e i r i n t e r a c t i o n w i t h U b c H 5 a n d U b c H 7 . J. Biol. Chem. 2 7 3 , 1 2 1 4 8 - 1 2 1 5 4 . S c h w a r z b a u e r , J. E., a n d S p e n c e r , C. S. ( 1 9 9 3 ) . T h e Caenorhabditis elegans h o m o l o g u e o f t h e e x t r a c e l l u l a r c a l c i u m b i n d i n g p r o t e i n S P A R C / o s t e o n e c t i n a f f e c t s n e m a t o d e b o d y m o r p h o l o g y a n d m o b i l i t y . Mol. Biol. Cell 4, 9 4 1 - 9 5 2 . S c h w o b , E., B o h m , T., M e n d e n h a l l , M., a n d N a s m y t h , K. ( 1 9 9 4 ) . T h e B - t y p e c y c l i n k i n a s e i n h i b i t o r p 4 0 s i c l c o n t r o l s t h e G I t o S t r a n s i t i o n i n S. cerevisiae. Cell 7 9 , 2 3 3 - 2 4 4 . S e e m i i l l e r , E., L u p a s , A., a n d B a u m e i s t e r , W. (1 9 9 6 ) . P r o t e a s o m e f r o m Thermoplasma acidbphilum: A t h r e o n i n e p r o t e a s e . Science 2 6 8 , 5 3 3 - 5 3 9 . S e u f e r t , W., a n d J e n t s c h , S. ( 1 9 9 0 ) . U b i q u i t i n - c o n j u g a t i n g e n z y m e s U B C 4 a n d U B C 5 m e d i a t e s e l e c t i v e d e g r a d a t i o n o f s h o r t - l i v e d a n d a b n o r m a l p r o t e i n s . EMBO J. 9, 5 4 3 - 5 5 0 . S h o u , W., S e o l , J. H , S h e v c h e n k o , A., B a s k e r v i l l e , C , M o a z e d , D., C h e n , Z. W. S., J a n g , J., S h e v c h e n k o , A., C h a r b o n n e a u , H , a n d D e s h a i e s , R. J. ( 1 9 9 9 ) . E x i t f r o m m i t o s i s i s t r i g g e r e d b y T e r n 1 - d e p e n d e n t r e l e a s e o f t h e p r o t e i n p h o s p h a t a s e C d c l 4 f r o m n u c l e o l a r R E N T c o m p l e x . Cell 97, 233-244. S i b l e y , M . H , J o h n s o n , J. J., M e l l o , C. C , a n d K r a m e r , J. M . ( 1 9 9 3 ) . G e n e t i c i d e n t i f i c a t i o n , s e q u e n c e , a n d a l t e r n a t i v e s p l i c i n g o f t h e Caenorhabditis elegans a l p h a 2 ( I V ) c o l l a g e n g e n e . J. Cell Biol. 123, 2 5 5 - 2 6 4 . 160 S i e d e , W. ( 1 9 8 8 ) . T h e R A D 6 g e n e o f y e a s t : a l i n k b e t w e e n D N A r e p a i r , c h r o m o s o m e s t r u c t u r e a n d p r o t e i n d e g r a d a t i o n ? Rad. Env. Biophys. 27, 2 7 7 - 2 8 6 . S k o w y r a , D., C r a i g , K. L., T y e r s , M., E l l e d g e , S. J., a n d H a r p e r , J. W. ( 1 9 9 7 ) . F - b o x p r o t e i n s a r e r e c e p t o r s t h a t r e c r u i t p h o s p h o r y l a t e d s u b s t r a t e s t o t h e S C F u b i q u i t i n - l i g a s e . Cell 91, 2 0 9 - 2 1 9 . S m i t h , J. S., a n d B o e k e , J. D . ( 1 9 9 7 ) . A n u n u s u a l f o r m o f t r a n s c r i p t i o n a l s i l e n c i n g i n y e a s t r i b o s o m a l D N A . Genes Dev. 11, 241-254. S n u t c h , T. P., a n d B a i l l i e , D . L . ( 1 9 8 3 ) . A l t e r a t i o n s i n t h e p a t t e r n o f g e n e e x p r e s s i o n f o l l o w i n g h e a t s h o c k i n t h e n e m a t o d e Caenorhabditis elegans. Can. J. Biochem. Cell Biol. 61, 4 8 0 - 4 8 7 . S o m m e r , T., a n d J e n t s c h , S. ( 1 9 9 3 ) . A p r o t e i n t r a n s l o c a t i o n d e f e c t l i n k e d t o u b i q u i t i n c o n j u g a t i o n at t h e e n d o p l a s m i c r e t i c u l u m . Nature 365, 176-179. S o n n h a m m e r , E . L . L., a n d D u r b i n , R. ( 1 9 9 6 ) . A d o t - m a t r i x p r o g r a m w i t h d y n a m i c t h r e s h o l d c o n t r o l s u i t e d f o r g e n o m i c D N A a n d p r o t e i n s e q u e n c e a n a l y s i s . Gene 1 6 7 , 1-10. S p e n c e , J., S a d i s , S., H a a s , A . L., a n d F i n l e y , D. ( 1 9 9 5 ) . A u b i q u i t i n m u t a n t w i t h s p e c i f i c d e f e c t s i n D N A r e p a i r a n d m u l t i u b i q u i t i n a t i o n . Mol. Cell. Biol. 15, 1 2 6 5 - 1 2 7 3 . S p e n c e r , E., J i a n g , J., a n d C h e n , Z. J. ( 1 9 9 9 ) . S i g n a l - i n d u c e d u b i q u i t i n a t i o n o f IKBO. b y t h e F -b o x p r o t e i n S l i m b / p - T r C P . Genes Dev. 13, 2 8 4 - 2 9 4 . S p i e t h , J., B r o o k e , G., K u e r s t e n , S., L e a , K., a n d B l u m e n t h a l , T. ( 1 9 9 3 ) . O p e r o n s i n C. elegans. p o l y c i s t r o n i c m R N A p r e c u r s o r s a r e p r o c e s s e d b y t r a n s - s p l i c i n g o f S L 2 t o d o w n s t r e a m c o d i n g r e g i o n s . Cell 73, 521-532. S t e r n , M . J., M a r e n g e r e , L . E., D a l y , R. J., L o w e n s t e i n , E . J., K o k e l , M., B a t z e r , A., O l i v i e r , P., P a w s o n , T., a n d S c h l e s s i n g e r , J. ( 1 9 9 3 ) . T h e h u m a n G R B 2 a n d Drosophila D r k g e n e s c a n f u n c t i o n a l l y r e p l a c e t h e Caenorhabditis elegans c e l l s i g n a l i n g g e n e sem-5. Mol. Biol. Cell 4, 1 1 7 5 - 1 1 8 8 . S t e r n b e r g , P. W., a n d H o r v i t z , H . R. ( 1 9 8 8 ) . lin-17 m u t a t i o n s o f Caenorhabditis elegans d i s r u p t c e r t a i n a s y m m e t r i c c e l l d i v i s i o n s . Dev. Biol. 130, 67-73. S t a n c o v s k i , I., G o n e n , H , O r i a n , A., S c h w a r t z , A . L., a n d C i e c h a n o v e r , A . ( 1 9 9 5 ) . D e g r a d a t i o n o f t h e p r o t o - o n c o g e n e p r o d u c t c - F o s b y t h e u b i q u i t i n p r o t e o l y t i c s y s t e m i n v i v o a n d i n v i t r o : I d e n t i f i c a t i o n a n d c h a r a c t e r i z a t i o n o f t h e c o n j u g a t i n g e n z y m e s . Mol. Cell. Biol. 15, 7 1 0 6 - 7 1 1 6 . S t e p p , M . A , S p u r r - M i c h a u d , S., T i s d a l e , A , E l w e l l , J., a n d G i p s o n , I. K. ( 1 9 9 0 ) . a 6 p 4 i n t e g r i n h e t e r o d i m e r i s a c o m p o n e n t o f h e m i d e s m o s o m e s . Proc. Natl. Acad. Sci. U.S.A. 87, 8 9 7 0 - 8 9 7 4 . 161 S t r a i g h t , A . F., S h o u , W., D o w d , G. J., T u r c k , C. W., D e s h a i e s , R. J., J o h n s o n , A . D., a n d M o a z e d , D . ( 1 9 9 9 ) . N e t l , a S i r 2 - a s s o c i a t e d n u c l e o l a r p r o t e i n r e q u i r e d f o r r D N A s i l e n c i n g a n d n u c l e o l a r i n t e g r i t y . Cell 91, 245-256. S u l l i v a n , M . L., a n d V i e r s t r a , R. D. ( 1 9 9 1 ) . C l o n i n g o f a 1 6 - k D a u b i q u i t i n c a r r i e r p r o t e i n f r o m w h e a t a n d Arabidopsis thaliana. I d e n t i f i c a t i o n o f f u n c t i o n a l d o m a i n s b y in vitro m u t a g e n e s i s . J. Biol. Chem. 266, 2 3 8 7 8 - 2 3 8 8 5 . S u l s t o n , J. E . ( 1 9 8 3 ) . N e u r o n a l c e l l l i n e a g e s i n t h e n e m a t o d e Caenorhabditis elegans. Cold Spring Harbor Symposia on Quantitative Biology 48 ,443-452. S u l s t o n , J. E., a n d B r e n n e r , S! ( 1 9 7 4 ) . T h e D N A o f Caenorhabditis elegans. Genetics 11, 9 5 -104. S u l s t o n , J. E., a n d H o r v i t z , H. R. ( 1 9 7 7 ) . P o s t - e m b r y o n i c l i n e a g e s o f t h e n e m a t o d e , Caenorhabditis elegans. Dev. Biol. 5 6 , 1 1 0 - 1 5 6 . S u l s t o n , J. E., S c h i e r e n b e r g , E., W h i t e , J. G., a n d T h o m s o n , J. N . ( 1 9 8 3 ) . T h e e m b r y o n i c c e l l l i n e a g e o f t h e n e m a t o d e Caenorhabditis elegans. Dev. Biol. 100, 6 4 - 1 1 9 . S u n d a r a m , M., a n d H a n , M . ( 1 9 9 5 ) . T h e C. elegans ksr-1 g e n e e n c o d e s a n o v e l R a f - r e l a t e d k i n a s e i n v o l v e d i n R a s - m e d i a t e d s i g n a l t r a n s d u c t i o n . Cell 83, 8 8 9 - 9 0 1 . S u n g , P., P r a k a s h , S., a n d P r a k a s h , L . ( 1 9 8 8 ) . T h e R A D 6 p r o t e i n o f Saccharomyces cerevisiae p o l y u b i q u i t i n a t e s h i s t o n e s , a n d its a c i d i c d o m a i n m e d i a t e s t h i s a c t i v i t y . Genes Dev. 2, 1 4 7 6 - 1 4 8 5 . S u n g , P., P r a k a s h , S., a n d P r a k a s h , L . ( 1 9 9 0 ) . M u t a t i o n o f c y s t e i n e - 8 8 i n t h e Saccharomyces cerevisiae R A D 6 p r o t e i n a b o l i s h e s i t s u b i q u i t i n - c o n j u g a t i n g a c t i v i t y a n d i t s v a r i o u s b i o l o g i c a l f u n c t i o n s . Proc. Natl. Acad. Sci. USA 87, 2 6 9 5 - 2 6 9 9 . T a o , Y . S., E d w a r d s , R. A., T u b b , B., W a n g , S., B r y a n , J., a n d M c C r e a , P. D . ( 1 9 9 6 ) . p - c a t e n i n a s s o c i a t e s w i t h t h e a c t i n - b u n d l i n g p r o t e i n f a s c i n i n a n o n c a d h e r i n c o m p l e x . J. Cell. Biol. 134, 1 2 7 1 - 1 2 8 1 . T h a c k e r , C , M a r r a , M . A., J o n e s , A., B a i l l i e , D . L., a n d R o s e , A . M . ( 1 9 9 9 ) . F u n c t i o n a l g e n o m i c s i n Caenorhabditis elegans: A n a p p r o a c h i n v o l v i n g c o m p a r i s o n s o f s e q u e n c e s f r o m r e l a t e d n e m a t o d e s . Genome Res. 9, 3 4 8 - 3 5 9 . T h a n o s , D., a n d M a n i a t i s , T. ( 1 9 9 5 ) . N F - K B : A l e s s o n i n f a m i l y v a l u e s . Cell 80, 5 2 9 - 5 3 2 . T h o r p e , C. J., S c h l e s i n g e r , A., C a r t e r , J. C , a n d B o w e r m a n , B . ( 1 9 9 7 ) . W n t s i g n a l i n g p o l a r i z e s a n e a r l y C. elegans b l a s t o m e r e t o d i s t i n g u i s h e n d o d e r m f r o m m e s o d e r m . Cell 90, 6 9 5 -70 5 . T i m p l , R., a n d B r o w n , J. C. ( 1 9 9 4 ) . T h e l a m i n i n s . Matrix Biol. 14, 2 7 5 - 2 8 1 . 162 T o w n s l e y , F. ML, A r i s t a r k h o v , A., B e c k , S., A., H., a n d R u d e r m a n , J. V . ( 1 9 9 7 ) . D o m i n a n t -n e g a t i v e c y c l i n - s e l e c t i v e u b i q u i t i n c a r r i e r p r o t e i n E 2 - C / U b c H 1 0 b l o c k s c e l l s i n m e t a p h a s e . Proc. Natl. Acad. Sci. USA 94, 2 3 6 2 - 2 3 6 7 . T r e i e r , M., S e u f e r t , W., a n d J e n t s c h , S. ( 1 9 9 2 ) . Drosophila UbcDl e n c o d e s a h i g h l y c o n s e r v e d u b i q u i t i n - c o n j u g a t i n g e n z y m e i n v o l v e d i n s e l e c t i v e p r o t e i n d e g r a d a t i o n . EMBO J. 11, 3 6 7 - 3 7 2 . T r e i e r , M., S t a s z e w s k i , L . M., a n d B o h m a n n , D. ( 1 9 9 4 ) . U b i q u i t i n - d e p e n d e n t c - J u n d e g r a d a t i o n in vivo is m e d i a t e d b y t h e d e l t a d o m a i n . Cell 78, 7 8 7 - 7 9 8 . T r e i n i n , M., G i l l o , B., L i e b m a n , L., a n d C h a l f i e , M . ( 1 9 9 8 ) . T w o f u n c t i o n a l l y d e p e n d e n t a c e t y l c h o l i n e s u b u n i t s a r e e n c o d e d i n a s i n g l e Caenorhabditis elegans o p e r o n . Proc. Natl. Acad. Sci. USA 95, 1 5 4 9 2 - 1 5 4 9 5 . T s u r u m i , C , I s h i d a , N., T a m u r a , T., K a k i z u k a , A., N i s h i d a , E., O k u m u r a , E., K i s h i m o t o , T., I n a g a k i , M., O k a z a k i , K., S a g a t a , N., a n d et al. ( 1 9 9 5 ) . D e g r a d a t i o n o f c - F o s b y t h e 2 6 S p r o t e a s o m e i s a c c e l e r a t e d b y c - J u n a n d m u l t i p l e p r o t e i n k i n a s e s . Mol. Cell. Biol. 15, 5 6 8 2 - 5 6 8 7 . V e r m a , I. M., S t e v e n s o n , J. K., S c h w a r z , E . M., V a n A n t w e r p , D., a n d M i y a m o t o , S. ( 1 9 9 5 ) . R e l / N F - K B / I - K B f a m i l y : I n t i m a t e t a l e s o f a s s o c i a t i o n a n d d i s s o c i a t i o n . Genes Dev. 9, 2 7 2 3 - 2 7 3 5 . V e r m a , R , A n n a n , R. S., H u d d l e s t o n , M . J., C a r r , S. A., R e y n a r d , G., a n d D e s h a i e s , R. J. ( 1 9 9 7 ) . P h o s p h o r y l a t i o n o f S i c l p b y G I C d k r e q u i r e d f o r i t s d e g r a d a t i o n a n d e n t r y i n t o S p h a s e . Science 278, 4 5 5 - 4 6 0 . V i j a y - K u m a r , S., B u g g , C. E., a n d C o o k , W. J. ( 1 9 8 7 ) . S t r u c t u r e o f u b i q u i t i n r e f i n e d at 1.8 A r e s o l u t i o n . J. Mol. Biol. 194, 531-544. V i s i n t i n , R., C r a i g , K , H w a n g , E . S., P r i n z , S., T y e r s , M., a n d A m o n , A . ( 1 9 9 8 ) . T h e p h o s p h a t a s e C d c l 4 t r i g g e r s m i t o t i c e x i t b y r e v e r s a l o f C d k - d e p e n d e n t p h o s p h o r y l a t i o n . Mol. Cell 2, 7 0 9 - 7 1 8 . V i s i n t i n , R., H w a n g , E . S., a n d A m o n , A . ( 1 9 9 9 ) . C f i l p r e v e n t s p r e m a t u r e e x i t f r o m m i t o s i s b y a n c h o r i n g C d c l 4 p h o s p h a t a s e i n t h e n u c l e o l u s . Nature 398, 8 1 8 - 8 2 3 . V o g e l s t e i n , B . ( 1 9 9 0 ) . A d e a d l y i n h e r i t a n c e . Nature 348, 6 8 1 - 6 8 2 . W a n g , F., W e a v e r , V., P e t e r s o n , O., L a r a b e l l , C , D e d h a r , S., B r i a n d , P., L u p u , R., a n d B i s s e l l , M . J. ( 1 9 9 8 ) . R e c i p r o c a l i n t e r a c t i o n s b e t w e e n B l - i n t e g r i n a n d e p i d e r m a l g r o w t h f a c t o r r e c e p t o r i n t h r e e - d i m e n s i o n a l b a s e m e n t m e m b r a n e b r e a s t c u l t u r e s : A d i f f e r e n t p e r s p e c t i v e i n e p i t h e l i a l b i o l o g y . Proc. Natl. Acad. Sci. USA 95, 1 4 8 2 1 - 1 4 8 2 6 . W a t e r s t o n , R. H. ( 1 9 8 8 ) . M u s c l e . In: T h e N e m a t o d e Caenorhabditis elegans. ( e d . W. B . W o o d a n d t h e C o m m u n i t y o f C. elegans R e s e a r c h e r s ) , pp. 2 8 1 - 3 3 6 . C o l d S p r i n g H a r b o r L a b o r a t o r y , C o l d S p r i n g H a r b o r , N e w Y o r k . 163 W e b e r , J. D., T a y l o r , L . J., R o u s s e l , M . F., S h e r r , C. J., a n d B a r - S a g i , D . ( 1 9 9 9 ) . N u c l e o l a r A r f s e q u e s t e r s M d m 2 a n d a c t i v a t e s p53. Nature Cell Biol. 1, 20-26. W e i n t r a u b , H . ( 1 9 9 3 ) . T h e M y o D f a m i l y a n d m y o g e n e s i s : r e d u n d a n c y , n e t w o r k s , a n d t h r e s h o l d s . CW /75, 1241-1244. W e s t n e a t , D . F., N o o n , W. A., R e e v e , H . K., a n d A q u a d r o , C. F. ( 1 9 8 8 ) . I m p r o v e d h y b r i d i z a t i o n c o n d i t i o n s f o r D N A " f i n g e r p r i n t s " p r o b e d w i t h M l 3. Nucleic Acids Res. 16,4161. W h i t e , J. ( 1 9 8 8 ) . T h e a n a t o m y . In: T h e N e m a t o d e Caenorhabditis elegans. ( e d . W. B . W o o d a n d t h e C o m m u n i t y o f C. elegans R e s e a r c h e r s ) , pp. 81-122. C o l d S p r i n g H a r b o r L a b o r a t o r y , C o l d S p r i n g H a r b o r , N e w Y o r k . W h i t e , J. G., S o u t h g a t e , E., T h o m s o n , J. N , a n d B r e n n e r , S. ( 1 9 7 6 ) . T h e s t r u c t u r e o f t h e v e n t r a l n e r v e c o r d o f Caenorhabditis elegans. Philos. Trans. R. Soc. Lond. B Biol. Sci. 275, 3 2 7 - 3 4 8 . W i l k i n s o n , K. D., T a s h a y e v , V . L., O ' C o n n o r , L . B., L a r s e n , C . N , K a s p e r e k , E., a n d P i c k a r t , C . M . ( 1 9 9 5 ) . M e t a b o l i s m o f t h e p o l y u b i q u i t i n d e g r a d a t i o n s i g n a l : s t r u c t u r e , m e c h a n i s m , a n d r o l e o f i s o p e p t i d a s e T. Biochemistry 34, 1 4 5 3 5 - 1 4 5 4 6 . W i l k i n s o n , K . D., U r b a n , M . K., a n d H a a s , A . L . ( 1 9 8 0 ) . U b i q u i t i n i s t h e A T P - d e p e n d e n t p r o t e o l y s i s f a c t o r I o f r a b b i t r e t i c u l o c y t e s . J. Biol. Chem. 255, 7 5 2 9 - 3 2 . W i l l e r t , K . a n d N u s s e , R. ( 1 9 9 8 ) . P-catenin: a k e y m e d i a t o r o f W n t - s i g n a l l i n g . Curr. Opin. Gen. Dev. 8, 95-102. W i l l i a m s , B . D., a n d W a t e r s t o n , R. H. ( 1 9 9 4 ) . G e n e s c r i t i c a l f o r m u s c l e d e v e l o p m e n t a n d f u n c t i o n i n Caenorhabditis elegans i d e n t i f i e d t h r o u g h l e t h a l m u t a t i o n s . J. Cell Biol. 124, 4 7 5 - 4 9 0 . W i n g , S. S., D u m a s , F., a n d B a n v i l l e , D. ( 1 9 9 2 ) . A r a b b i t r e t i c u l o c y t e u b i q u i t i n c a r r i e r p r o t e i n t h a t s u p p o r t s u b i q u i t i n - d e p e n d e n t p r o t e o l y s i s ( E 2 n k ) i s h o m o l o g o u s t o t h e y e a s t D N A r e p a i r g e n e R A D 6 . J. Biol. Chem. 267, 6 4 9 5 - 6 5 0 1 . W i n g , S. S., B e d a r d , N , M o r a l e s , C , H i n g a m p , P., a n d T r a s l e r , J. ( 1 9 9 6 ) . A n o v e l r a t h o m o l o g o f t h e Saccharomyces cerevisiae u b i q u i t i n - c o n j u g a t i n g e n z y m e s U B C 4 a n d U B C 5 w i t h d i s t i n c t b i o c h e m i c a l f e a t u r e s i s i n d u c e d d u r i n g s p e r m a t o g e n e s i s . Mol. Cell. Biol. 16, 4 0 6 4 - 4 0 7 2 . W i n s t o n , J. T., S t r a c k , P., B e e r - R o m e r o , P., C h u , C. Y., E l l e d g e , S. J., a n d H a r p e r , J. W. ( 1 9 9 9 ) . T h e S C F p - T r C P - u b i q u i t i n 1 i g a s e c o m p l e x a s s o c i a t e s s p e c i f i c a l l y w i t h p h o s p h o r y l a t e d d e s t r u c t i o n m o t i f s i n IKBCC a n d P-catenin a n d s t i m u l a t e s I i c B a u b i q u i t i n a t i o n in vitro. Genes Dev. 13, 2 7 0 - 2 8 3 . 164 W o l f , D . A., a n d J a c k s o n , P. K. ( 1 9 9 8 ) . C e l l c y c l e : o i l i n g t h e g e a r s o f a n a p h a s e . Curr. Biol. 8, R 6 3 6 - 6 3 9 . W o o d , W. B . ( 1 9 8 8 ) . E m b r y o l o g y . In: T h e N e m a t o d e Caenorhabditis elegans. ( e d . W o o d , W. B., a n d t h e C o m m u n i t y o f C. elegans R e s e a r c h e r s ) , pp. 2 1 5 - 2 4 2 . C o l d S p r i n g H a r b o r L a b o r a t o r y , C o l d S p r i n g H a r b o r , N e w Y o r k . Y u , H., K i n g , R. W., P e t e r s , J. M., a n d K i r s c h n e r , M . W. ( 1 9 9 6 ) . I d e n t i f i c a t i o n o f a n o v e l u b i q u i t i n - c o n j u g a t i n g e n z y m e i n v o l v e d i n m i t o t i c c y c l i n d e g r a d a t i o n . Curr. Biol. 6, 4 5 5 - 4 6 6 . Y u r c h e n c o , P. D., a n d S c h i t t n y , J. C. ( 1 9 9 0 ) . M o l e c u l a r a r c h i t e c t u r e o f b a s e m e n t m e m b r a n e s . FASEBJ. 4, 1 5 7 7 - 1 5 9 0 . Z a c h a r i a e , W., S c h w a b , M., N a s m y t h , K , a n d S e u f e r t , W. ( 1 9 9 8 a ) . C o n t r o l o f c y c l i n u b i q u i t i n a t i o n b y C D K - r e g u l a t e d b i n d i n g o f H c t l t o t h e a n a p h a s e p r o m o t i n g c o m p l e x . Science 282, 1 7 2 1 - 1 7 2 4 . Z a c h a r i a e , W., S h e v c h e n k o , A., A n d r e w s , P. D., C i o s k , R., G a l o v a , M., S t a r k , M . J. R., M a n n , M., a n d N a s m y t h , K. ( 1 9 9 8 b ) . M a s s s p e c t r o m e t r i c a n a l y s i s o f a n a p h a s e - p r o m o t i n g c o m p l e x f r o m y e a s t : I d e n t i f i c a t i o n o f a s u b u n i t r e l a t e d t o c u l l i n s . Science 2 7 9 , 1 2 1 6 -1219. Z a f f r a n , S., C h a r t i e r , A., G a l l a n t , P., A s t i e r , M., A r q u i e r , N., D o h e r t y , D., G r a t e c o s , D., a n d S e m e r i v a , M . ( 1 9 9 8 ) . A Drosophila R N A h e l i c a s e g e n e pitchoune, i s r e q u i r e d f o r c e l l g r o w t h a n d p r o l i f e r a t i o n a n d i s a p o t e n t i a l t a r g e t o f d - M y c . Development 1 2 5 , 3 5 7 1 -3 5 8 4 . Z h e n , M . ( 1 9 9 5 ) . C l o n i n g , c h a r a c t e r i z a t i o n a n d f u n c t i o n a l a n a l y s i s o f ubc-2, a g e n e e n c o d i n g a u b i q u i t i n - c o n j u g a t i n g e n z y m e i n t h e n e m a t o d e Caenorhabditis elegans. P h . D t h e s i s . U n i v e r s i t y o f B r i t i s h C o l u m b i a , V a n c o u v e r . Z h e n , M., H e i n l e i n , R., J o n e s , D., J e n t s c h , S., a n d C a n d i d o , E . P. ( 1 9 9 3 ) . T h e ubc-2 g e n e o f Caenorhabditis elegans e n c o d e s a u b i q u i t i n - c o n j u g a t i n g e n z y m e i n v o l v e d i n s e l e c t i v e p r o t e i n d e g r a d a t i o n . Mol. Cell. Biol. 13, 1 3 7 1 - 1 3 7 7 . Z h e n , M., S c h e i n , J. E., B a i l l i e , D . L., a n d C a n d i d o , E . P. ( 1 9 9 6 ) . A n e s s e n t i a l u b i q u i t i n -c o n j u g a t i n g e n z y m e w i t h t i s s u e a n d d e v e l o p m e n t a l s p e c i f i c i t y i n t h e n e m a t o d e Caenorhabditis elegans. EMBOJ. 15, 3 2 2 9 - 3 2 3 7 . Z h o u , G., S e i b e n h e n e r , M . L., a n d W o o t e n , M . W. ( 1 9 9 7 ) . N u c l e o l i n i s a p r o t e i n k i n a s e C-C, s u b s t r a t e . C o n n e c t i o n b e t w e e n c e l l s u r f a c e s i g n a l i n g a n d n u c l e u s i n P C 12 c e l l s . J. Biol. Chem. 2 7 2 , 3 1 1 3 0 - 3 1 1 3 7 . Z o r i o , D . A., C h e n g , N . N., B l u m e n t h a l , T., a n d S p i e t h , J. ( 1 9 9 4 ) . O p e r o n s as a c o m m o n f o r m o f c h r o m o s o m a l o r g a n i z a t i o n i n C. elegans. Nature 3 7 2 , 2 7 0 - 2 7 2 . 165 Z o r i o , D . A. R., a n d B l u m e n t h a l , T. ( 1 9 9 9 ) . U2AF(35) i s e n c o d e d b y a n e s s e n t i a l g e n e c l u s t e r e d i n a n o p e r o n w i t h R R M / c y c l o p h i l i n i n Caenorhabditis elegans. RNA 5, 4 8 7 -4 9 4 . 166 VI. APPENDICES APPENDIX A. C. elegans STRAINS UTILIZED IN STUDY Strain Reference N 2 A F 1 6 B C 2 0 2 0 let-70(s!132) unc-22(s7) unc-31(e!69)/nTl(IV);+/nTl(V)1 ( C l a r k et al, 1 9 8 8 ) B C 5 6 4 3 let-70(s!132) unc-22(s7) unc-31(e!69)/nTl(IV);+/nTl(V) T h i s s t u d y B C 1 0 9 3 let-70(s689) unc-22(s7)/nTl(IV);+/nTl(V)1 ( R o g a l s k i a n d B a i l l i e , 1 9 8 5 ) P C 1 5 6 let-70(s689) unc-22(s7)/nTl(IV);+/nTl(V) T h i s s t u d y D R 0 0 7 8 9 dpy-13(el84sd)/nTl(IV);unc-42(e270)/nTl(V)x B C 3 8 3 5 let-x(s2293) unc-22(s7) lev-l(x22)/nTl(IV);+/nTl(V)x ( M a r r a , T 9 9 4 ) P C 1 5 7 let-x(s2293) unc-22(s7) lev-l(x22)/nTl(IV);+/nTl(V) T h i s s t u d y P D 8 1 1 9 smg-1 (cc545) 2 ( H o d g k i n et al., 1 9 8 9 ) P D 8 1 2 0 smg-1 (cc546) 2 ( H o d g k i n et al., 1 9 8 9 ) ! K i n d l y p r o v i d e d b y D r . D. B a i l l i e , S i m o n F r a s e r U n i v e r s i t y , V a n c o u v e r 2 O b t a i n e d f r o m Caenorhabditis G e n e t i c s C e n t e r ( C G C ) APPENDIX B. TRANSGENIC STRAINS UTILIZED IN THE PRESENT STUDY S t r a i n G e n o t y p e S e l e c t i o n C o n s t r u c t R a n d o m D N A P C I 15 U b E x l O O p R F 4 p Z M I . l N O P C 125 U b E x l l O p R F 4 p Z M 1 3 N O APPENDIX C. TRANSGENIC STRAINS PRODUCED IN THE PRESENT STUDY S t r a i n G e n o t y p e S e l e c t i o n C o n s t r u c t R a n d o m D N A P C 1 6 7 U b E x l 3 7 p R F 4 p Z M 1 3 Y E S P C 1 6 8 U b E x l 3 8 p R F 4 p Z M 1 3 Y E S 167 P C 169 U b E x l 3 9 pRF4 pZM13 Y E S P C 170 U b E x l 4 0 pRF4 pZM13 Y E S PC175 U b E x l 4 3 pRF4 N O N E Y E S P C 176 U b E x l 4 4 pRF4 N O N E Y E S PC178 U b E x l 4 6 pRF4 pZM13.34 Y E S P C 179 U b E x l 4 7 pRF4 pZM13.34 Y E S P C 180 U b E x l 4 8 pRF4 pTS2.2 Y E S PC181 U b E x l 4 9 pRF4 p T S l . l Y E S P C 182 U b E x l 5 0 pRF4 p T S l . l Y E S PC183 U b E x l 5 1 pRF4 pTS2.2 Y E S P C 184 U b E x l 5 2 pRF4 CA-G47J11 Y E S APPENDIX D. LIST OF OLIGONUCLEOTIDE SEQUENCES primer name1 Sequence 5' to 3 ,2 O Z M 3 . f G A G G A T C G 4 7 U G C T C T C A A A A G A A T C C A G A A G BamHl Ncol O Z M 2 . r G C C A A G C T T T T A G C C T C C T C A C A T A G C G T A Hin&m MEI20-1 f G G G T G T A G C C G G G T C A A T A C G M E I 2 0 - 2 T G G T T G C C T T C A C C A C T C G A A T MEI20-4.I- G G T C A G A G C C G G C G A C C A C T G MEI20-5.r T G A T T G G T T T G G C T G C G T T C T T T S l . f G A G C A T T C A G C A C T C G G C A A G G T TS2.r C A A C G T A A T A T G G G A T A G A C A A G C A G M I C 1 2 . f T A T T A C C A A A C G C C G C A T T G M I C H . r A T A T A A A C G G G G T A A A C G G G M7 .7 . f T A T G T G C C A C G A G C C T A C G A C Ml'.l.x G A C A G A A A C G T C G T C A G G C C S L l . f G G T T T A A T T A C C C A A G T T T G A G SL2 . f G T T T T A A C C C A G T T A C T C A A Y H X 1 - B 1 r G C A C C A A G A A T G A G A A C C T G 168 Z I N C 1 .r G A T G A G A A A G A C G T G G A A T A C Y H X l . f G A G G A T C C A T G G C C A C G T T T G T T C C C T T T G BamHl Y H X l . r G A G T C G A C T C A G A A A T C T T C A T C A T C C T C Sail Primers suffixed with an f are sense stranded, while those suffixed with an r are the complementary strand. Restriction sites are underlined or italicized. APPENDIX E. LINKER SEQUENCE UTILIZED IN STUD Y 5 1 - GCGGGCCCAAG - 3 1 3 1 - ACGTCGCCCGGGTTCCTAG - 5 • Pst I Apal BamHl 169 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0089521/manifest

Comment

Related Items