Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Regulation of intracellular cAMP levels and competence development in haemophilus influenzae by a phosphoenolpyruvate… Macfadyen, Leah Pauline 1999

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1999-463818.pdf [ 10.25MB ]
Metadata
JSON: 831-1.0089301.json
JSON-LD: 831-1.0089301-ld.json
RDF/XML (Pretty): 831-1.0089301-rdf.xml
RDF/JSON: 831-1.0089301-rdf.json
Turtle: 831-1.0089301-turtle.txt
N-Triples: 831-1.0089301-rdf-ntriples.txt
Original Record: 831-1.0089301-source.json
Full Text
831-1.0089301-fulltext.txt
Citation
831-1.0089301.ris

Full Text

REGULATION OF INTRACELLULAR cAMP LEVELS AND COMPETENCE DEVELOPMENT IN HAEMOPHILUS INFLUENZAE BY A PHOSPHOENOLPYRUVATE:FRUCTOSE PHOSPHOTRANSFERASE SYSTEM by L E A H PAULINE MACFADYEN B.Sc, The University of Edinburgh, 1993 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES Department of Zoology We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA May 1999 © Leah Pauline Macfadyen, 1999 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of 7-OOOOGtJ The University of British Columbia Vancouver, Canada DE-6 (2/88) ABSTRACT Diverse and distantly-related bacteria can develop competence for natural transformation. Competent cells can bind free extracellular DNA, transport it into the cytoplasm, and sometimes recombine it into the chromosome. Competence has a long evolutionary history and is therefore expected to significantly benefit the cell. In an attempt to elucidate the function (benefit) of natural competence, I have carried out genetic studies of the regulation of competence development in Haemophilus influenzae. Competence in this organism is dependent on an increase in intracellular concentrations of cAMP complexed with its receptor, CRP. In related bacteria, cAMP synthesis by adenylate cyclase is regulated in response to carbon source availability by the phosphoenolpyruvate:glycose phosphotransferase system (PTS). This enzyme complex detects availability of preferred sugars, and transports them into the cell. In the absence of preferred sugars, the PTS activates adenylate cyclase. I demonstrated the existence of a simple fructose-specific PTS in H. influenzae by cloning the pts and fru operons. I disrupted genes encoding PTS components, constructed mutant strains, and assessed the effect of these mutations on competence and other cAMP-dependent phenotypes. Strains lacking or unable to activate the putative adenylate cyclase-regulating component of this PTS (EIIA G l c) showed a 150-fold reduction in competence under standard competence-inducing conditions, unless exogenous cAMP was added. Moreover, these PTS-deficient strains could not catabolize cAMP-dependent sugars, and showed reduced (3-galactosidase expression from a cAMP-dependent /acZ-based reporter construct, implying that the H. influenzae regulates adenylate cyclase activity and competence. Competence was also found to be optimized by a cAMP-phosphodiesterase and reduced by the presence of physiological concentrations of free nucleotides. Putative regulatory sites in the promoters of competence genes were shown to be indistinguishable from cAMP-CRP binding sites, suggesting that the cAMP-CRP complex regulates transcription of these genes. In conclusion, adenylate cyclase activity and competence in H. influenzae are regulated by nutritional signals. It is proposed that cells may therefore transport DNA for the nucleotides it contains, and that competence may be part of the hunger response of H. influenzae and other bacteria to nutritional stress. iii TABLE OF CONTENTS ABSTRACT ; i i TABLE OF CONTENTS i v LIST OF TABLES xi LIST OF FIGURES xiii LIST OF ABBREVIATIONS xvii ACKNOWLEDGMENTS xx CHAPTER ONE General Introduction 1 1.1 Natural competence in bacteria 1 1.2 Competence development by Haemophilus influenzae 5 1.3 Evolution of competence and the function of natural transformation 10 1.3.1 The potential risks of competence development 10 1.3.2 Why become competent for natural transformation? 11 1.4 Studying competence regulation to understand function 13 1.4.1 Competence development in H. influenzae is dependent on cAMP 14 1.4.2 Regulation of intracellular cAMP levels in bacteria 15 1.4.3 Regulation of adenylate cyclase activity by a putative H. influenzae PTS? 19 1.5 Objectives and approach 19 CHAPTER TWO Materials and Methods 20 2.1 Strains, plasmids and culture conditions 20 2.1.1 Strains and plasmids 20 2.1.2 Culture conditions 24 iv 2.1.3 Media 24 2.2 Nucleic acid techniques 25 2.2.1 DNA cloning methods 25 2.2.2 Polymerase chain reaction (PCR) 26 2.2.3 Southern blotting 27 2.2.4 DNA sequencing : 27 2.3 Biochemical techniques 27 2.3.1 Preparation of cell extracts and membrane fractions 27 2.3.2 Protein purification 28 2.4 Cloning and mutagenesis of specific genes 28 2.4.1 ptsl 28 2.4.2 ptsH 30 2.4.3 err 31 2.4.4 fruB 32 2.4.5 fruA ,...32 2.4.6 ice 34 2.4.7 relA ; 35 2.5 Construction of a /acZ-based cAMP reporter cassette 36 2.6 Construction of mutant and reporter strains 39 2.7 Assays of competence development by H. influenzae strains 39 2.7.1 Spontaneous competence development in rich medium 39 2.7.2 Competence development in nutrient-limited medium 40 2.7.3 Induction of competence by anaerobic shift ..40 2.8 Assays of sugar uptake and utilization 40 2.8.1 Sugar fermentation studies 40 2.8.2 Fructose transport studies 41 2.8.3 Sugar phosphorylation assays 42 2.9 Assays of (3-galactosidase activity 42 v 2.10 Software used in data analysis and presentation 43 CHAPTER THREE Haemophilus influenzae has a Phosphotransferase System 44 3.1 Introduction 44 3.2 Cloning, mapping and mutagenesis of ptsl of the Haemophilus influenzae pts operon 46 3.3 Genome analysis 47 3.3.1 pts operon 48 3.3.2 fru operon 52 3.4 Analysis of gene disruptions in mutant strains: PTS mutations are reflected in phenotypic changes 56 3.4.1 Strain RR745 (ptsl) 57 3.4.2 Strain RR817 (ptsH) 57 3.4.3 Strain RR801 (err) 58 3.4.4 Strain RR798 (fruB) 58 3.4.5 Strain RR813 (fruA) 59 3.5 Sugar fermentation assays 59 3.6 In vitro analyses of sugar phosphorylation 60 3.6.1 Demonstration of functionality of PTS proteins 61 3.6.2 Confirmation of PTS-independent glucose and galactose phosphorylation 64 3.7 Discussion 65 3.7.1 H. influenzae expresses a functional fructose-specific PTS 65 3.7.2 Regulation of expression of the H. influenzae PTS 65 3.7.3 Evolution from a primordial fructose-specific PTS 67 3.7.4 Regulatory potential of the H. influenzae PTS 69 vi 3.7.5 A working model of the H. influenzae PTS 70 C H A P T E R F O U R The Haemophilus influenzae PTS regulates Intracellular c A M P Levels and Competence development •. 72 4.1 Introduction 72 4.1.1 Intracellular cAMP levels regulate transcription of many genes 72 4.1.2 The PTS regulates intracellular cAMP levels 73 4.2 The H. influenzae PTS regulates carbon source utilization 74 4.2.1 Sugar fermentation by wild type H. influenzae 77 4.2.2 Sugar fermentation by strains lacking components of the PTS 81 4.2.3 PTS-mediated repression of non-PTS sugar utilization by xylitol 85 4.3 The H. influenzae PTS regulates competence development 88 4.3.1 Development of competence under nutrient-limitation or anaerobiosis by PTS-deficient strains 88 4.3.2 Spontaneous competence development in rich medium by PTS-deficient strains 89 4.3.3 cAMP-dependence of competence under different conditions 92 4.3.4 Regulation of adenylate cyclase in PTS-disrupted strains 92 4.3.5 PTS-mediated repression of competence by fructose 94 4.4 cAMP-dependent (3-galactosidase expression by strains carrying a cAMP reporter construct 95 4.4.1 Expression of lacZ in reporter strains is dependent on cAMP 98 vu 4.4.2 (3-Galactosidase expression is reduced in ptsl or err strains 101 4.5 Assessment of candidate competence-specific CRP binding sites in the H. influenzae chromosome 101 4.5.1 Construction of a CRP binding matrix using a log likelihood test for goodness of fit 103 4.5.2 Matrix-derived scores reflect CRP affinity for CRP binding sites 105 4.5.3 Assessment of differences between scores of CRP sites and putative CRE regulatory sites 108 4.6 Discussion 116 4.6.1 The H. influenzae PTS functions as an environmental sensor 116 4.6.2 A revised model of the H. influenzae PTS 118 4.6.3 The PTS may integrate a variety of environmental/ nutritional signals 120 4.6.4 cAMP-dependence of competence 126 4.6.5 A model for competence development 127 4.6.6 Competence development as a response to nutritional stress 132 CHAPTER FIVE A Putative cAMP Phosphodiesterase Modulates cAMP Levels and Optimizes Competence in Haemophilus influenzae 134 5.1 Introduction 134 5.2 ice may encode a putative cAMP phosphodiesterase 135 5.2.1 Analysis of the ice gene 135 5.2.2 The ice gene product is a functional phosphodiesterase. 139 vi i i 5.3 Ice regulates intracellular cAMP levels in Haemophilus influenzae 142 5.3.1 The ice mutation increases intracellular cAMP levels 142 5.3.2 Sensitivity of H. influenzae ice strains to exogenous cAMP '. 145 5.4 Regulation of competence development by a cAMP phosphodiesterase 146 5.4.1 Ice regulates competence throughout growth in rich medium.. 146 5.4.2 Ice regulates timing of starvation-induced increases in intracellular cAMP 146 5.5 Discussion 149 5.5.1 cAMP phosphodiesterase is not the only modulator of intracellular cAMP levels 149 5.5.2 cAMP phosphodiesterase may protect cells from the effects of excess intracellular cAMP 149 5.5.3 Uncontrolled cAMP increases may repress transcription of competence genes 150 5.5.4 A role for Ice in regulation of competence development 150 C H A P T E R S I X C o m p e t e n c e D e v e l o p m e n t b y Haemophilus influenzae is R e g u l a t e d b y A v a i l a b i l i t y o f N u c l e i c A c i d P r e c u r s o r s 152 6.1 Introduction 152 6.1.1 DNA as a source of carbon? 152 6.1.2 DNA as a source of nitrogen? 156 6.1.3 DNA as a source of nucleic acid precursors? 159 ix 6.2 Inhibition of competence by purine ribonucleosides 160 6.3 Mechanism of regulation exerted by purine ribonucleoside monophosphates 166 6.3.1 Purine ribonucleoside monophosphates do not alter activity of Sxy, a positive regulator of competence 166 6.3.2 The purine nucleoside monophosphate response is not mediated by the stringent response system 166 6.3.3 Purine nucleoside monophosphates influence intracellular cAMP levels ....169 6.3.4 Purine nucleoside regulation of intracellular cAMP levels is not mediated by components of the PTS 170 6.4 Discussion 174 6.4.1 Competence development by H. influenzae is regulated by availability of nucleic acid precursors 174 6.4.2 Purine ribonucleosides as an indicator of nucleic acid precursor availability 175 6.4.3 Mechanism of regulation of competence by purine nucleotides 176 6.4.4 DNA uptake as a feeding process 178 C H A P T E R S E V E N General Conclusions 180 7.1 Nutritional regulation of competence in H. influenzae 180 7.2 Competence development and the nutritional niche 180 7.3 Scavenging of DNA by other bacteria 182 7.4 Sexual isolation and the evolution of competence 183 B I B L I O G R A P H Y 185 x LIST OF TABLES Table 1.1 Uncharacterized putative competence genes of H. influenzae 7 Table 1.2 Characterized competence genes of Haemophilus influenzae 8 Table 2.1 Bacterial strains used in this study 21 Table 2.2 Plasmid clones used in this study 22 Table 3.1 Putative regulatory sites for the H. influenzae pts and fru operons 49 Table 3.2 Sugar fermentation by H. influenzae strains 60 Table 3.3 Demonstration of functional H. influenzae Enzyme I and HPr....61 Table 3.4 Demonstration of functional H. influenzae EIIA G l c. 62 Table 3.5 Demonstration of functional H. influenzae EIIB'BC F r u permease 63 Table 3.6 Presence of galactokinase and glucokinase in H. influenzae extracts 64 Table 4.1 H. influenzae genes for uptake and catabolism of sugars 75 Table 4.2 Putative CRP-binding sites for H. influenzae sugar catabolic operons 80 Table 4.3 PTS-mediated repression of sugar fermentation in H. influenzae by xylitol -...87 Table 4.4 Matrix representation of the E. coli CRP binding site 106 Table 4.5 E. coli CRP binding sites with known affinities for CRP 107 Table 4.6 Putative CRP binding sites identified in the promoter regions of selected H. influenzae genes 109 Table 4.7 Putative CRP binding sites identified in the promoter regions of genes required for competence or recombination of DNA 110 xi Table 4.8 A Shapiro-Wilk test for normality of distribution of lsea scores within samples 113 Table 4.8 B Kruskal-Wallis non-parametric comparison of I s e i ? samples 114 Table 4.8 C Dunn's non-parametric pairwise comparisons of lsecj samples. 115 Table 4.9 Two-component (sensor-regulator) systems of H. influenzae 117 Table 4.10 Model of multifactorial regulation of competence in H. influenzae 131 Table 5.1 Bacterial sequences showing similarity to Ice 137 Table 5.2 Bacterial species having no predicted protein products with significant sequence identity to Ice 138 Table 5.3 Effect of overexpression of ice and cpdA on E. coli sugar fermentation 140 Table 6.1 Predicted H. influenzae homologues of E. coli nucleoside catabolism genes '. 154 Table 6.2 Predicted nitrogen catabolite repression genes of H. influenzae.. 157 Table 6.3 Predicted nucleoside salvage pathway genes of H. influenzae 159 Table 6.4 Predicted genes of the H. influenzae stringent response system.. 169 xii LIST OF FIGURES Figure 1.1 Distribution of natural competence in bacteria 2 Figure 1.2 DNA uptake by naturally competent H. influenzae 6 Figure 1.3 Organization of Enzyme II complexes of bacterial phosphotransferase systems 16 Figure 1.4 Mechanism of activation of adenylate cyclase, and inducer exclusion, by the phosphotransferase system of enteric bacteria 17 Figure 2.1 Structures of pts operon clones 29 Figure 2.2 Structures of fru operon clones 33 Figure 2.3 Structure of ice operon clones 34 Figure 2.4 Structure of relA clones 35 Figure 2.5 A Plasmids used in construction of reporter strain RR802 37 Figure 2.5 B Plasmids used in construction of reporter strain RR828 38 Figure 3.1 E. coli adenylate cyclase can complement the adenylate cyclase deficiency of a H. influenzae cya strain 45 Figure 3.2 pts operon of H. influenzae 48 Figure 3.3 Schematic of predicted protein components of the H. influenzae PTS 51 Figure 3.4 fru operon of H. influenzae 53 Figure 3.5 Schematic depiction of fructose-specific 'pseudo-HPr' PTS components from various organisms, showing the different known permutations of the constituent domains 55 Figure 3.6 Uptake of 1 4C-fructose by H. influenzae after growth on fructose, glucose or galactose 66 x i i i Figure 3.7 Distribution of fructose-specific phosphotransferase systems in eubacteria 68 Figure 3.8 Divergence of the eubacterial lineages giving rise to the families Enterobacteriaceae and Pasteurellaceae of the y proteobacteria 69 Figure 3.9 A working model of H. influenzae PTS function 71 Figure 4.1 Pathways of sugar catabolism in H. influenzae 78 Figure 4.2 Fermentation of sugars by H. influenzae pts and fru strains 83 Figure 4.3 Sugar fermentation by RR668 (cya) in the presence of increasing concentrations of exogenous cAMP 85 Figure 4.4 Competence of pts and fru strains after transfer to nutrient-limitation 90 Figure 4.5 Spontaneous competence development in rich medium by H. influenzae pts strains 91 Figure 4.6 Differential response of cya strain RR668 to cAMP under different conditions 93 Figure 4.7 Inhibition of MlV-induced competence by fructose 95 Figure 4.8 Promoter sequence and structure of the /acZ-based cAMP reporter construct 97 Figure 4.9 (3-Galactosidase expression from reporter strains in rich medium 99 Figure 4.10 (3-Galactosidase expression from the /acZ-based reporter cassette in different genetic backgrounds 100 Figure 4.11 Correlation between theoretical scores of CRP binding site affinity (lseCj) and experimentally determined CRP affinity (ln(K s/K ns)) for known E. coli CRP binding sites 108 xiv Figure 4.12 Scatter plot showing distribution of I s e ( ? scores for E. coli and H. influenzae sequences I l l Figure 4.13 Revised model of the H. influenzae PTS 119 Figure 4.14 Model for the interaction of the PTS with pools of intermediate metabolites ; 123 Figure 5.1 Schematic of the H. influenzae ice operon 139 Figure 5.2 Reduction of f3-galactosidase expression in a cpdA::kan E. coli strain by overexpression of the E. coli cAMP phosphodiesterase gene, cpdA or of its H. influenzae homologue, ice 141 Figure 5.3 Effect of ice disruption on ribose fermentation in wild-type, cya or r PTS-disrupted backgrounds 143 Figure 5.4 Competence of ice mutant strains after transfer to nutrient-limitation 144 Figure 5.5 cAMP sensitivity of ice cya and icc+ cya H. influenzae strains.... 145 Figure 5.6 Spontaneous late exponential phase competence of wild-type and zee H. influenzae strains in rich medium 147 Figure 5.7 MlV-induced competence of wild-type and ice strains, compared with RR668 (cya) pre-cultured with or without ImmM cAMP 148 Figure 6.1 Pathways of nucleotide synthesis and salvage in H. influenzae. 155 Figure 6.2 Possible mechanisms of nitrogen catabolite repression of catabolic and competence genes in H. influenzae 158 Figure 6.3 Competence development by H. influenzae in MIV medium supplemented with nucleotides or nucleotide precursors 161 Figure 6.4 Competence development by H. influenzae in MIV medium supplemented with ribonucleoside monophosphates, ribonucleosides or purine bases 163 xv Figure 6.5 Dosage-dependence of competence development on purine ribonucleoside monophosphates 164 Figure 6.6 Competence development by H. influenzae in rich medium supplemented with AMP or GMP 165 Figure 6.7 Predicted routes of (p)ppGpp metabolism by the H. influenzae stringent response 168 Figure 6.8 Exogenous cAMP partially restores competence to H. influenzae in MIV medium supplemented with AMP/GMP 169 Figure 6.9 (3-Galactosidase expression by cAMP-reporter strain RR828 in MIV medium plus AMP or GMP 172 Figure 6.10 Competence of various mutant strains after transfer to MIV nutrient-limited medium plus AMP/GMP 173 Figure 6.11 Model of H. influenzae's regulatory hierarchy for systems catalyzing synthesis or scavenging of nucleic acid precursors 175 xvi LIST OF ABBREVIATIONS aa amino acids Ac- acetate ADP adenosine 5'-diphosphate AK acetate kinase AMP adenosine 5'-monophosphate ATase uridylyl transferase ATP adenosine 5'-triphosphate BHI brain heart infusion (rich culture medium) bp base pairs cAMP 3',5' cyclic adenosine monophosphate cat chloramphenicol resistance gene cassette CDP cytidine 5'-monophosphate cfu colony forming units CMP cytidine 5'-monophosphate Cm r chloramphenicol resistant CRE competence regulatory element CRP cAMP receptor protein CTP cytidine 5-triphosphate DNA deoxyribonucleic acid DNasel deoxyribonuclease I dNMP deoxyribonucleoside 5'-monophosphate dNDP deoxyribonucleoside 5'-diphosphate dNTP deoxyribonucleoside 5'-triphosphate ApH pH change DSE dyad symmetry element DTT dithiothreitol E value Expect value e" electron EDTA ethylenediaminetetraacetic acid EFTu elongation factor Tu GDP guanosine 5'-diphosphate GMP guanosine 5'-monophosphate GS glutamine synthase GTP guanosine 5'-triphosphate HI# Haemophilus influenzae gene # IMP inosine 5'-monophosphate xvii IPTG isopropyl-(3-D-thiogalactopyranoside kan kanamycin resistance gene cassette kan H. influenzae kanamycin resistance allele kb kilobase(s) MocG methyl-oc-glucoside (a glucose analogue) uC micro-Curies MIV "M-four"; a nutrient-limited H. influenzae competence induction medium (for composition see) m R N A messenger RNA n number N A D nicotinamide adenine dinucleotide nal H. influenzae nalidixic acid resistance allele NDP ribonucleoside 5'-diphosphate N M P ribonucleoside 5'-monophosphate nov H. influenzae novobiocin resistance allele nov r novobiocin resistant N TP ribonucleoside 5'-triphosphate OD optical density ONPG onitrophenyl P-D-galactopyranoside ori origin of replication P phosphate Pase phosphatase PCR polymerase chain reaction PEP phosphoenolpyruvate Pi free phosphate PMSF phenylmethylsulphonyl fluoride ppGpp guanosine 3',5'-bis(diphosphate) pppGpp guanosine 3'-diphosphate 5'-triphosphate PRB phenol red broth PTS phosphoenolpyruvate:glycose phosphotransferase system R N A ribonucleic acid r R N A ribosomal RNA o standard deviation sBHI brain heart infusion supplemented with haemin and N A D SEM standard error of the mean spc spectinomycin resistance gene cassette spc H. influenzae spectinomycin resistance allele spp. species xviii str H. influenzae streptomycin resistance allele stv H. influenzae streptovaricin resistance allele TDP cell-free extract buffer (Tris-DTT-PMSF) TDP thymidine 5'-triphosphate TF transformation frequency TMP thymidine 5'-monophosphate TR transcriptional regulator Tris Tris(hydroxymethyl)aminomethane tRNA transfer RNA TTP thymidine 5-triphosphate UDP uridine 5'-diphosphate UMP uridine 5'-monophosphate USS uptake signal sequence UTase uridylyl transferase UTP uridine 5'-triphosphate v variance vio H. influenzae viomycin resistance allele W T wild type Xgal 5-bromo-4-chloro-3-indolyl-(3-D-galactoside XMP xanthosine 5'-monophosphate xix ACKNOWLEDGMENTS Although the cover of this thesis carries a single name, many people have contributed to its completion. To my supervisor, Dr. Rosie Redfield go my thanks for providing the guiding ideas central to these studies, the facilities to pursue them and extensive training in scientific writing. My graduate committee members (Dr. Julian Davies, Dr. Linda Matsuuchi, Dr. Gerry Weeks and Dr. Rachel Fernandez) have kept me on track, and listened patiently to some dense presentations! I also owe my thanks to our collaborators, Dr. Milton Saier and Dr. Jonathan Reizer who were generous with their advice and expertise - my many communications with them have been invaluable in clarifying for me the complexities of phosphotransferase systems. Dr. Michelle Gwinn very helpfully shared with me the results of her complementary research. Numerous other researchers also gave helpful advice, information and suggestions; where possible they have been cited in the text, and I must also thank Dr James Botsford, Dr Alan Peterkofsky, Dr Richard Ebright'and Dr Sally Otto. The members of the Redfield lab have been my staunch compatriots, and have offered constructive criticism, good music, and, when all else failed, beer and nachos. It has been a pleasure to work with Shaun, Grant, Trevor, Aliza, Lisa and Grant, but especial thanks are due to Laura who single-handedly introduced me to the field of Haemophilus genetics, and to Dr. Rik Myers who was a true ally and taught me a hundred tricks of the trade. I must also credit Dr. Stan Maloy and the Cold Spring Harbor Laboratory summer programme in Advanced Bacterial Genetics for turning me from a biochemist into a bacterial geneticist, and for forever altering my understanding of how a scientists must be. He was truly an inspiration. For financial support I must thank the Canadian Cystic Fibrosis Foundation whose four-year graduate Studentship allowed me to focus full-time on research, and whose Travel Grants (1996, 1997, 1998) allowed me to attend significant Conferences in the field. Thanks also to the UBC Faculty of Graduate Studies and Department of Zoology whose Travel Award (1996), University Graduate Fellowship (1995) and Sandercock Memorial Scholarship (1995) kept me off the bread-line; a number of Teaching Assistantships also allowed me to gain some teaching skills. Grateful thanks must also go to the Scottish Office Education Department for continuing financial support. However, it has been the people in my life (all my lives) who have kept me sane (or almost) through my graduate years. My love and thanks go to all of them, too many to mention by name. Allan has been my rock, my mentor and my agony aunt, as well as merely my room-mate, these past five years, and Ella has of course provided support of the canine variety. Together with Sheila, these two created a home and a family here for me. A more recent family member is the awesome Claire, who reminds me never to take anyone or anything for granted. In Victoria, Olivia Barr has again and again offered me a safe haven and calming words. Jenni was my first true kindred spirit in Vancouver and never fails to make me laugh, and Sundhya has continued that great Aussie tradition. Rachel taught me a lot about love as well as about trees and Yorkshire, and Deb and Jen saved me in the great winter of despair. Tove continues to be my biggest supporter, and I love her dearly. Rachel Rose has cheered my efforts electronically, and my Edinburgh friends (Helen, xx Debbie, Katie, Sara, Amanda, Pixie) are unflagging (if bemused) fans. Steven, my gem, my partner in crime, has been my best conference find to date. For inspiration and motivation of a different kind I must acknowledge the faculty and community of Lester B. Pearson United World College of the Pacific (Victoria, BC). They pushed me to challenge myself academically many years ago, and gave me freedom to explore my limits. Today, my Pearson friends world-wide are a community that I am privileged and thankful to be a member of. Lastly, and most importantly, my great love and thanks go to my family. Their , encouragement by letter and by phone (even when they really don't understand what it is I am doing) has been tireless. My special love and gratitude go to my mum, who from the beginning taught me that I could achieve whatever I set my sights on, and to my gentle dad - I wish he could see me now. xxi C H A P T E R O N E General Introduction 1.1 Natural competence in bacteria Bacteria are the only organisms capable of developing competence for natural transformation (132), a process in which cells express specialized proteins that allow binding of free (extracellular) DNA, transport of bound DNA into the cytoplasm, and integration of some of this DNA into the chromosome by homologous recombination (234). Natural competence should not be confused with artificially induced competence, which results from the chemical or electrical treatment of cells. Rather, natural competence is part of the normal physiology of the cell and is the only form of bacterial DNA exchange whose functions are encoded on the chromosome - other gene transfer processes are determined by genes located on plasmids and transposons (conjugation) and on bacteriophages (transduction) (234). First observed in Pneumococcus (Streptococcus pneumoniae) by Griffith in 1928 (77), natural competence has now been observed in photolithotrophic, chemolithotrophic, heterotrophic and methylotrophic Gram-negative and Gram-positive eubacteria from a variety of environmental niches, as well as a number of clinical isolates of pathogenic eubacteria, and two species of archaebacteria (16, 132, 246 and Y. Abu Kwaik, personal communication). As demonstrated in Figure 1.1, these bacterial species are widely distributed across the bacterial phylogenetic tree (163), implying a long evolutionary history of natural competence. While some bacterial taxa may have lost the ability to develop natural competence, it is likely that our current knowledge of the true range of naturally competent bacteria is limited by our ability to detect it under laboratory conditions. 1 U CU u rs 43 u C cu cu a, o u C O c cu I-l S < si 6 - 3 QJ CM S 1 - 1 CO N — Z "a; •a -a 1 1 e 2 1.1.1 Models of natural transformation Natural transformation can be analyzed in four steps: development of competence, DNA binding at the cell surface, uptake of DNA by the recipient cell, and integration of some of this DNA into the genome (234). The presence of an additional outer membrane in Gram-negative bacteria, and differences in cell-wall composition and structure between Gram-positive and Gram-negative bacteria imply that different DNA uptake systems may have evolved in these groups to allow transport of DNA into the cytoplasm. In fact, early studies did demonstrate a shared mechanism of transformation in the Gram-positive bacteria Streptococcus pneumoniae, S. sanguis and Bacillus subtilis, while a different mechanism was observed in Haemophilus spp. and Neisseria gonorrheae. It was therefore proposed that natural transformation systems fall into two groups, one typical of Gram-positive and one typical of Gram-negative bacteria (226). i) The Gram-positive (Streptococcus-Bacillus) model Competence in the well-studied naturally competent Gram-positive bacteria is induced by small extracellular proteins called competence factors that are excreted by the bacterial cells, and accumulate during growth. At a critical concentration, these factors induce a network of complex regulatory pathways for a number of post-exponential phase functions including competence development, production of antibiotics and enzymes, and motility (132). After development of competence/cells bind double-stranded DNA non-covalently, and without base sequence specificity, at a finite number of sites (although a receptor has not yet been identified) (229). Binding of the DNA is accompanied by single-stranded nicking by a competence-specific endonuclease; after binding, the DNA is rapidly processed further by introduction of double-stranded breaks. During passage across the cytoplasmic membrane one strand of the donor DNA is degraded, and single-stranded DNA entering the cytoplasm is coated by a competence-specific single-stranded binding 3 protein (Ssb). Up to 70% of transported single-stranded DNA may then be recombined into the chromosome by RecA-mediated homologous recombination (132). ii) The Gram-negative (Haemophilus-Neisseria) model As in the naturally competent Gram-positive bacteria, competence in most naturally transformable Gram-negative bacteria is transient. However, development of competence by Gram-negative organisms is not regulated by a secreted competence factor, but instead is induced in different species by changes in growth phase, changes in nutrient availability and/or other poorly characterized signals (132). DNA-binding by unidentified receptors in the Gram-negative species H. influenzae and N. gonorrheae is sequence specific, due to the recognition of short uptake signal sequences (USS) in the DNA (44, 52, 76). Bound DNA is not cut, but is transported across the outer membrane via poorly characterized pores. Subsequently, the DNA is translocated from a periplasmic compartment into the cytoplasm; a single strand of DNA enters the cytoplasm while the other is degraded. As in Gram-positive bacteria, some of this transported DNA may be recombined into the chromosome by RecA-mediated homologous recombination. Recent studies have demonstrated that some bacteria share features of one model with typical features of another. Consistent with the prediction that competence for natural transformation evolved in an ancient common ancestor of the eubacteria, genomic studies are revealing significant gene similiarities: for example, predicted products of the H. influenzae competence genes comF (comlOlA) and rec-2 show 22%-24% similarity with the competence-related genes comF ORF3 and comE ORF3, respectively, of B. subtilis (56). The separation between Gram-positive and Gram-negative models of competence may therefore be somewhat artificial. 4 1.2 Competence development by Haemophilus influenzae H. influenzae is a naturally competent Gram-negative facultative anaerobe of the family Pasteurellaceae (Figure 3.8). The mechanisms of competence development and DNA uptake by H. influenzae remain poorly characterized; our current understanding is summarized below and in Figure 1.2. Competence genes with assigned functions are listed in Table 1.2. Competence development is positively regulated by the product of the sxy (tfoX) gene (186/260, 272), and expression of several competence-related genes is known to be dependent on Sxy (105). (For further details of this positive regulator, see Section 4.6.5). Induction of competence involves extensive membrane rearrangements and targeting of a new set of polypeptides to both outer and cytoplasmic membranes (36, 102, 270, 271) - a process which may require the activity of Por, a homologue of an Escherichia coli periplasmic oxidoreductase (244). An as yet unidentified receptor or receptor complex recognizes and binds the USS of Haemophilus DNA - a frequently-occurring 29bp sequence containing a highly conserved core 9bp and flanking consensus sequences (44, 52). DNA binding may also require Type IV pili, specified by the pilA gene (55). Bound DNA is rapidly sequestered in an inter-membrane compartment whose identity is still under debate: this compartment may simply be the periplasmic space, or may comprise specialized vesicles called 'transformasomes' (20nm vesicles apparently located at adhesion sites between outer and inner membranes (37, 103)). So far, no proteins involved in the DNA uptake machinery have been characterized. However, transposon insertions in four genes of a competence operon (comC, comA, comE and coml (ponA)) reduce or prevent uptake of DNA into transformasomes (or the periplasmic space) (245). 5 outer membrane putative receptors and/or pores [ComC, ComA, ComE, Coml?] inner membrane degradation of 5' strand and displaced homologous DNA 'transformasome' putative translocation/ nuclease complex [Rec-2, ComF, DprA?] free DNA chrom1 osome periplasm Figure 1.2 DNA uptake by naturally competent Haemophilus influenzae Free extracellular DNA is recognized by a proposed receptor complex, bound, transported into transformasomes or the periplasmic space, translocated into the cytoplasm and either degraded or homologously recombined into the chromosome, as described in Section 1.2. The role of a number of proteins (indicated in brackets) in DNA uptake or recombination has been inferred from genetic studies of competence-deficient strains, and the relevant genes are listed in Table 1.2. Putative competence genes whose roles are as-yet undefined are listed in Table 1.1. 6 cu CJ ci cu J-H cu CU o 00 o o CN LD CN fs. CU DH o Ci DH| 4-1 C co s to cO u O -i-> cj < z a >-H o DH co a CO l-H H-» Ci CO U CU U T i C CO o T S CU t/3 C J T5 cj cu d l -H cu to Ci cu .2 S-H U H *4-» to Ci o H-» ca ri C o H S-H cj o cu M-H l -H CO J-t Ci CO i s T S TS T S T S T J T S cu cu cu cu cu CU 4 - » H-» H-» CO 1/3 (/) CO to CO cu cu CU CU a» cu -4-» H-* H-» CU CU cu cu cu cu Ci Ci C Ci Ci d o O O o o o 2 Z 2 • z Z Z 2 T S O DH _o H-» CO g s o C J CU S-H S-H o bO C 'co to cu cu o S-H DH < Q c^ . Ci • - H CU DH CU B ca w P " Ci • i-H cu o l -H DH c o 'H-» C3 cj to Ci cO D CN Ci o • i-H 4-1 C J cu CD cu cu co V SX CO CO Ci O )-H CU DH O CU B CO w C ~ Ci •i-H cu o S-H DH c O *-i-i CO C J O CO c CO < z Q CN Ci o • H^ u CU cn cu cu to ^ sx ts co CO G O l -H cu DH O o H - i s co CU bO o o bo g T S Ci IS < Q S-H o UH T S cu l -H • ^ H cr cu S-H cj Ci o CO N • i-H 'cO Ci s-. cu T S Ci CO C o S-H cu DH O £ o u l - H cu B cu ci o l -H cu DH o o CU B cu 'bb ci CO DH cu l - H < Q ci o • l—i x> B o u cu cu o I-H , DH bO Ci • i -H T S C < z Q TS cu T S Ci CO l - H cu ci cu 5 o c_> sx u sx *cs 1X1 s o CQ Q o o CO to 00 O N o CO 00 ON o 00 o o 00 CO o V O CO o o m CN o 7 QJ rt1' OI Si QJ QJ | o NO CN NO 00 LO o O . CN LO CN 00 LO CN LO CN LO CN O CN CN CN CN CN O 00 LO CN LO O 00 CO ON CD CN. CX o rt oi Xi CX| C ro "5 u TJ Pi o; a; 4—* - M u • I—I TJ CX QJ g cx o 0 0 S i _g CX 4-» >, cx Xi QJ I/} co TJ C3 rt QJ O i i '41 ro - n rue rt c 4-4 g < '3 Z fx ri QJ > QJ Si CX >> 41 OJ 'EH o o rt 4-4 CX Si CO QJ ri QJ QJ U rt' QJ 4-» QJ CX g o u < Z D cx QJ ro O rt rt ro QJ U < z a CX cu ro o rt ro u QJ u Q cx QJ ro o rt rt ro u QJ U QJ M ro 41 CX < Q TJ QJ TJ QJ Si O -rt to QJ u rt ro to ro 'a. o -t_* >> QJ Xi O rt rt ro d xi < D CX QJ 5 QJ ro u o TJ C ro < Z a ro u to rt ro Si O rt rt ro cj to tq to QJ ro cu U £ U QJ 4-» rt QJ > QJ Si cx 4 - t * - H o 4 - t rt z Q rt o • i i -»-» ro g o <_> QJ Si ^ , bJ0| ro X CX TJ O Si fx Si o 4-1 ro 3 0 0 QJ QJ > to O fX QJ U C QJ 4-» QJ CX o u QJ ro 4-4 CX Si o TJ rt ro oo g TJ g < Z a c QJ -t-> O Si CX QJ ro CX Si o TJ rt ro oo rt • i - H TJ rt < z Q rt • i -H QJ 41 o Si CX QJ ro 4-» CX 3 TJ rt ro bo g TJ rt • i -H x> z rt QJ 4-i o Si CX QJ ro 41 CX Si O TJ rt ro OJD rt •F-1 TJ g Q c • i QJ 4-» o Si CX rt o • .—I 4-» ro o to rt ro Si C * 4 QJ 4 1 o Si CX < Z Q Si O TJ rt ro rt o 4-1 ro o o rt ro Si 4-* < z Q 60 rt to to QJ U O Si CX QJ rt QJ X to o U o o O S i . O o o CN tj o O ON CO o CO O LO CO O O o CO o NO o o 8 O o CM m in oo T - l CN tC T - H CM < z to c j o To d S-H O d d co C J CD U S-H O TS d d o *H-> t0 C J c> tO d S-H < Q to© d 'co to CU C J o S H P H cu C J d cu cu DH a o cj d o • I 4— < ' S H H - H CO TS CU 5- H o 2 to cu TS QJ S-H o X o u co cn QJ ^ < CO D H d Ti CU cu d TS a> S-H o co u co _d '53 H - » o S i DH S-H • O TS d CO s cu to co CO S-H O >H-H TS S-H DH -d PH cr cu S-H z Q TS cu H - » CO - ^ H CU O CO to CO t a; d to cu d TJ O D bb d T5 d < Z Q TS QJ C J d TS QJ S H O -d CO QJ U cj d co QJ d d eq o bO S H CO S H M H o » — H DH o QJ d S H o • f—i 4—1 d O < 03 i z B d Q S H o U H to ve nd d ' H H - » CO CO cj d S H QJ H - H U H nd de CO (-H CO QJ S H cu S H CO IS M co H - » 6 .•o up Ce C J QJ S H CO S-H •S > OJ M o S H D H Q J < J d Q J 4 - * Q J DH B o cj QJ DH d d X J d CD < u QJ QJ d bO O O v. sx m oo ON o o Sa-V O 00 o ON OA CN o CJ cu o o VO O 9 Translocation of DNA from transformasomes or the periplasmic space into the cytoplasm requires a free end and is probably mediated in part by the products of the genes rec-2 (10,144, 217), comF (comlOlA) (121, 245) and possibly dprA (105, 106). Concomitant with translocation into the cytoplasm, the strand whose 5'-end enters the cytoplasm is degraded (although no membrane-bound nuclease has been identified). A portion of the strand whose 3' end enters the cytoplasm may be homologously recombined into the chromosome in a process which requires the, product of the rec-1 gene, a homologue of the E. coli RecA protein (217, 218). Additionally, the products of a number of other uncharacterized or poorly characterized genes have been implicated as components of the DNA uptake machinery (Table 1.1). 1.3 Evolution of competence and the function of natural transformation 1.3.1 The potential risks of competence development Development of competence, and the uptake and recombination of extracellular DNA, are potentially risky operations for a bacterial cell. The development of competence requires changes in cell physiology which can decrease cell viability -for example, competence-associated autolysis by B. subtilis may be due to a decrease in integrity of the cell wall (39) and enhanced autolytic activity (267) during competence. Synthesis of novel competence-specific proteins and the transportation of large charged hydrophilic DNA molecules across hydrophobic lipid bilayers (cell membranes) are predicted to be energy-expensive processes. By recombining DNA from dead cells into their chromosome, competent cells risk increasing their load of deleterious mutations (188). Moreover, a high incidence of mutations at loci which were wild-type in both donor and recipient cells was observed in chromosomal transformants of Anacystis nidulans (89) and S. pneumoniae (78), suggesting that transformational recombination itself can introduce new chromosomal mutations. Cells also risk transforming themselves into a competence-deficient state by uptake 10 and homologous recombination of DNA carrying mutant alleles of com genes (188). Uptake of homologous or heterologous DNA can cause induction of endogenous prophages and has been observed to result in killing of up to 55% of a H. influenzae culture (216). Moreover, unrestricted gene uptake could neutralize specific genetic adaptations of a species to its particular habitat (132). Nonetheless, competence is a heritable trait that appears to have persisted for a long period of evolutionary time, implying that competence provides cells with a significant selective advantage which outweighs any potential risks of scavenging foreign DNA. 1.3.2 Why become competent for natural transformation? i) The recombinant progeny model It has been widely assumed that bacterial transformation, like eukaryotic sex, has evolved because of the evolutionary benefits of producing recombinant progeny. Recombination may allow the elimination of deleterious mutations (115), and indeed, in models of pure populations of transforming bacterial cells, transformation was found to reduce mutation load. However, this benefit was reduced or eliminated if it was assumed that transforming DNA came from cells killed by selection against deleterious mutations (185). Redfield et al. (1997) subsequently developed an analytical model to investigate whether the benefit of eliminating deleterious mutations is strong enough to allow evolution of competence. This model showed that under biologically realistic conditions (where transforming DNA carried deleterious mutations and came from non-competent cells) this benefit was unable to account for the evolutionary success of natural transformation systems (184). It has been suggested that transformational recombination may confer new alleles or allelic combinations on progeny and render them better suited to a new or changing environment. Recombinant bacteria may acquire traits such as new degradative . 11 capacity or antibiotic resistance from genetically distinct organisms, or may acquire new alleles from related organisms. Transformation has also been shown to facilitate evasion of lysis by bacteriophage (120) and evasion of host defenses by pathogens. For example, transformation and homologous recombination of exogenous DNA by N. gonorrheae contributes to frequent allele switching at the pilE locus, resulting in regular switching of the immunogenic determinants of pili, a major target of immune attack (215). However, frequency of gene exchange between species is low (for review see 131), suggesting that sexual isolation mechanisms have evolved to minimize the risks of recombination of DNA from dead cells. The potential for novel beneficial recombinant progeny may therefore be severely restricted (132), suggesting that this benefit is unlikely to have been strong enough to have driven evolution of competence. ii) The DNA repair model Competence might allow repair of damaged DNA. A cell that has sustained DNA damage might be rescued by recombination with exogenous homologous DNA, and indeed, competent cultures of B. subtilis were found to survive UV irradiation better when provided with transforming DNA (147). However, in similar experiments with H. influenzae, cells given H. influenzae DNA survived UV-irradiation no better than cells given control (non-transforming B. subtilis) DNA (188). Moreover, DNA damage does not induce competence in B. subtilis or H. influenzae, and it has therefore been argued that repair alone has not been a strong enough selective advantage for the evolution of natural competence (187). iii) The nutritional model DNA uptake may have evolved as a means of acquiring nutrients, and nutrient acquisition may be a stronger selective force than either recombination or DNA 12 repair (188, 234). Consistent with this idea is the observation that competence is induced in many organisms by entry into the stationary phase of growth, by starvation and/or by other nutritional signals (Section 4.6.6). Moreover, the processing of transforming DNA has the potential to release free nucleotides, sugars, phosphates and nitrogenous bases for metabolism (Section 6.1). Some researchers have rejected this model on the grounds that no data exists to show that bacterial cells can generate enough energy from transformed DNA to allow macromolecular synthesis or growth (229). However, the recent demonstration that E. coli cells can utilize exogenous DNA as a sole nutrient and energy source (S. Finkel, personal communication) is consistent with the contention that cells may develop competence in order to scavenge DNA as a source of carbon and/or nitrogen and/or nucleotides (see Chapter Six). 1.4 Studying competence regulation to understand function Regulatory mechanisms have evolved by selection for appropriate expression of the traits they control. Competence development by all known naturally competent bacterial species (except N. gonorrheae) is regulated in response to environmental and/or intracellular signals, suggesting that competence regulatory mechanisms have evolved to allow cells to maximize the benefits of DNA uptake. I have therefore carried out studies to investigate regulation of competence in the naturally competent bacterial species H. influenzae, because an understanding of the nature of signals and mechanisms regulating competence should illuminate the function of DNA uptake in this organism. It is hoped that elucidation of the function of natural transformation will shed light on the selective pressures which have driven the evolution of competence and its maintenance across the bacterial phylogenetic spectrum. 13 1.4.1 Competence development in Haemophilus influenzae is dependent on cAMP The cyclic nucleotide and signal molecule 3',5' cyclic adenosine monophosphate (cAMP) is a central regulator of the response of enteric bacteria to changing environmental conditions; when complexed with its receptor protein, CRP, cAMP mediates positive and negative transcriptional regulation of several hundred genes in E. coli or S. typhimurium (22). Competence development by H. influenzae is tightly regulated and is absolutely dependent on cAMP. Mutant strains lacking adenylate cyclase (54) or CRP (28) are completely deficient in competence. In wild-type cells, competence is undetectable during exponential growth, a phase in which intracellular cAMP levels are known to be low in well-characterized bacteria (167). It develops spontaneously at a stage of growth in which intracellular cAMP levels in better-studied bacteria are known to be high, for example at the onset of stationary phase in rich medium (167), or when exogenous cAMP is added (263). The highest levels of competence are seen when exponential phase cells are transferred to a nutrient-limited non-growth medium, (MIV (90)), when intracellular cAMP levels are expected to reach a starvation-induced peak, as seen for E. coli (51, 158). Competence can also be induced in H. influenzae by a period of anaerobic growth (75) and induction of competence by transient anaerobiosis is also cAMP-dependent (data not shown), consistent with reports that intracellular cAMP levels of E. coli are increased during growth under anaerobic conditions (252). 1.4.2 Regulation of intracellular cAMP levels in bacteria The synthesis of cAMP by adenylate cyclase is the major site of regulation of intracellular cAMP levels in bacteria. Adenylate cyclase activity is, in part, regulated at the level of expression, but this regulation is not sufficient to explain the large changes observed in cAMP synthesis under various conditions (22). Instead, sugar 14 transport by the bacterial phosphotransferase system (PTS) is thought to be the primary signal regulating adenylate cyclase activity. i) Bacterial phosphotransferase systems The PTS of E. coli was first identified in 1964 (117) and characterized as a novel three-component sugar phosphorylating system that uses phosphoenolpyruvate (PEP) as the phosphoryl donor. Now, more than thirty years later, several dozen E. coli PTS proteins are known, as well as hundreds of PTS proteins in both Gram-positive and Gram-negative eubacteria (207). Phosphotransferase systems consist of two general energy-coupling proteins, Enzyme I and HPr, as well as one or more sugar-specific permeases, known as Enzyme II complexes. These consist of two peripheral membrane proteins or domains (IIA and HB) as well as one (or sometimes two) integral membrane proteins or domains (IIC with or without IID) (210). These protein domains can be detached or fused together, so that the Enzyme II complexes may consist of one, two, three or four polypeptide chains encoded by the same number of genes (Fig. 1.3) (207). Alignments of full-length sequences indicate that the EII permeases can be grouped into at least four classes (174). However, comparison of local domain sequences indicates that these may all have evolved from a common ancestor and that during their evolution, the various domains have been fused to each other in. different orders and combinations, or spliced from each other to become distinct polypeptide chains (210). In the well-studied enteric bacteria, glucose is the central and preferred substrate of the PTS. Phosphate is transferred from phosphoenolpyruvate to glucose via Enzyme I, HPr, EIIA G l c and the EIICB G l c permease (Fig. 1.4). Preference among PTS-transported carbohydrates is mediated via competition of the various sugar-specific EIIA domains for phosphorylated HPr (194, 197a). 15 Figure 1.3 Organization of Enzyme II complexes of bacterial phosphotransferase systems Enzyme I (EI) and HPr are the general energy-coupling proteins for all phosphotransferase systems. Three sugar-specific Ells of E. coli are shown. Each contains two hydrophilic domains, IIA (shaded oval) containing the first phosphorylation site (His), and IIB (striped oval) containing the second phosphorylation site (His or Cys). The hydrophobic IIC domain may be split into two domains (IIC and IID; white ovals). Phosphate group is represented as '-P' and arrows show routes of phosphotransfer and sugar transport. This schematic is adapted from that of Postma et al. (174). 16 PEP pyruvate non-PTS permease/ catabolic enzyme (INACTIVATED) Glucose Adenylate Cyclase j (ACTIVATED) Figure 1.4 Mechanism of activation of adenylate cyclase, and inducer exclusion, by the phosphotransferase system of enteric bacteria Plain arrows indicate route of transfer of phosphate (-P) from phosphoenolpyruvate (PEP) to EIIA G l c via Enzyme I (EI) and HPr of the PTS. Dotted arrows represent regulatory interactions of EIIA G l c with adenylate cyclase or non-PTS permeases and catabolic enzymes, respectively, as described in Section 1.4.2. In the presence of glucose, phosphotransfer to glucose increases the proportion of non-phosphorylated EIIA G l c, which can then inactivate a number of non-PTS permeases and enzymes. In the absence of glucose, phosphotransfer to glucose stops and EIIA G l c is stalled in its phosphorylated state and can activate adenylate cyclase. This schematic is adapted from that of Saier (204). 17 ii) PTS-mediated repression: EIIA G l c mediates inducer exclusion and regulates adenylate cyclase activity Phosphotransferase systems have been shown to monitor the nutritional environment and fine-tune expression and/or activity of various non-PTS sugar permeases and catabolic enzymes in order to maximize uptake of readily metabolizable preferred sugars and minimize expression of unnecessary genes. In the presence of glucose, phosphotransfer proceeds from PEP to glucose, and the EIIA G l c component exists in a largely non-phosphorylated state (Fig. 1.4). In a process known as inducer exclusion, non-phosphorylated EIIA G l c can bind and inhibit activity of a number of target permeases and enzymes, including the lactose permease, melibiose permease, MalK and glycerol kinase (174). This inhibition blocks either uptake or formation of the inducers of sugar-specific catabolic operons, preventing wasteful expression of catabolic enzymes for less-preferred sugars, when favoured sugars are available. . In the absence of glucose, EIIA G l c and phosphotransfer proteins exist in a predominantly phosphorylated state. Phosphorylated EIIA G l c does not catalyze inducer exclusion, so concentrations of available inducer molecules accumulate inside the cell. Phosphorylated EIIA G l c does, however, activate adenylate cyclase (174,181). Newly-formed cAMP-CRP complexes, together with specific inducers, can then participate in transcriptional activation of cAMP-dependent operons for catabolism of non-PTS (and less-preferred) carbon sources (Fig. 1.4). Thus, the EIIA G l c component is the key regulatory component of PTS-mediated repression. 18 1.4.3 Regulation of adenylate cyclase activity by a putative Haemophilus influenzae PTS? In enteric bacteria, intracellular cAMP levels and adenylate cyclase activity are known to be regulated in large part by phosphotransferase systems. Since H. influenzae is a member of the family Pasteurellaceae, a sister family of the Enterobacteriaceae, in the y-proteobacteria group of eubacteria (163) (Fig. 3.8), it seemed reasonable to investigate whether a PTS regulates intracellular cAMP levels and thus competence in this organism. 1.5 Objectives and approach I have used genetic studies to investigate the regulation of competence and intracellular cAMP levels in the Gram-negative bacterium Haemophilus influenzae, in an attempt to gain insight into the function of bacterial transformation, and thus the nature of the selective advantages which may have driven the evolution of natural competence. Materials and methods used in these studies are detailed in Chapter Two. In Chapters Three and Four I present data which confirm that this organism possesses a simple phosphotransferase system, and that this PTS regulates intracellular cAMP levels, and thus competence. The molecular basis of the cAMP-dependence of competence is discussed, and a model for regulation of competence development is proposed. The possible role of a cAMP-specific phosphodiesterase in modulation of intracellular cAMP levels and competence is described in Chapter Five. In Chapter Six I report the discovery that intracellular cAMP levels and competence are regulated by the availability of free purine nucleotides by an unknown PTS-independent mechanism. Finally, in Chapter Seven I discuss the implications of these data for H. influenzae - a commensal living in a DNA-rich environment. 19 CHAPTER TWO Materials and Methods 2.1 Strains, plasmids and culture conditions 2.1.1 Strains and plasmids Strains and plasmids used in this study are listed in Tables 2.1 and 2.2, respectively. A l l Haemophilus influenzae strains are descendants of Alexander and Leidy's original Rd strain (1). All gene number assignments (HI#) and identifications listed in this report are as assigned for this strain by Fleischmann et al. (66) and The Institute for Genome Research (Rockville, USA) (241) unless otherwise indicated. A1316 (vector for miniTnlO/can) (111) was obtained from N. Kleckner (Harvard University, USA). H. influenzae shuttle vectors pSU2719 (140), pSU18, pSU20 and pSU40 (12) were obtained from B. Bartolome (Universidad de Cantabria, Spain). H. influenzae vector pHK (9) was obtained from G. Barcak (University of Maryland, USA). PCR-product cloning vector pGEM-T was purchased from Promega. Plasmid pKRP12 (189), carrying a spectinomycin-resistance gene cassette, was obtained from G. J. Phillips (Iowa State University, USA). Plasmid pWJC3 (32), carrying a kanamycin-resistance gene cassette, was obtained from W. T. McAllister (SUNY Health Science Center at Brooklyn, USA). Plasmid pCAT19 (68), carrying a chloramphenicol-resistance gene cassette, was obtained from W. C. Fuqua (University of Maryland, USA). 20 Table 2.1 Bacterial strains used in this study Bacterium & Strain Relevant Genotype Source or Referen H. influenzae Rd KW20 Wild type (1) ' MAP7 str kan nov nal spc vio stv J. Setlow, (8) RR563 sxy-1 (186). RR668 cy a:\mmxlrvl0kan , (54) JG287a crp::miniTnl Okan (28) RR745 ptsIr.miniTnlOkan . (134), Section 2.4.1 RR817 ptsHv.miniTnlOkan Section 2.4.2 RR794 ptsLdacZ/kan c rn.xat (82) RR801 crr::cat Section 2.4.3 RR798 fruBv.kan Section 2.4.4 RR813 AfruAv.spc Section 2.4.5 RR823 ptsH::mimTnlOkan fruB::kan Section 4.4.1 RR810 crrv.cat fruBv.kan Section 4.4.3 RR812 ice:: spc (136), Section 2.4.6 RR819 ptsI::miniTnlOkan icc::spc (136) RR820 err: :spc ice: :spc (136) RR821 cyfl::miniTn20A:fln z'cc::spc (136) . RR822 relA::spc Section 2.4.7 . RR802 xylFv.lacZ/cat Section 2.5 RR828 xylFdacZ/spc Section 2.5 RR829 xylF::lacZ/spc crpv.miniTnlOkan Section 2.5 RR830 xylF::lacZ/spc cya::mimTnlOkan Section 2.5 RR831 xylFv.lacZ/spc ptsI::mimTnlOkan Section 2.5 RR832 xylF::lacZ/spc or::cat Section 2.5 21 Table 2.1 Continued R R 8 3 3 xylF::lacZ/cat iccr.spc S e c t i o n 2.5 E. coli D H 5 a supE44 recAl D . H a n a h a n L J 1 7 6 cpdptsI313ts M . H . S a i e r Jr . , (97) N M 5 5 4 . sup° recA13 AlacX74 N . M u r r a y W 3 1 1 0 mcrA mcrB IN(rrnD-rrnE) H . N i k i , (95) S H 8 1 5 0 mcrA mcrB IN(rrnD-rrnE) cpdA::kan H . N i k i , (95) G M 2 1 6 3 dam N e w E n g l a n d B i o L a b s C A 8 3 0 6 Acya (108) T P 2 8 1 1 (A(ptsHIcrr)) (126) T P 2 8 1 9 (A(ptslcrr) (126). S. typhimurium S B 1 4 7 5 ptsH15 M . H . S a i e r , Jr., (63) a S t r a i n J G 2 8 7 = s t r a i n R R 5 4 0 i n the c o l l e c t i o n o f D r . R . J. R e d f i e l d . Table 2.2 Plasmid clones used in this study P l a s m i d s R e l e v a n t I n s e r t / V e c t o r 3 S o u r c e o r R e f e r e n c e p E C l cya+ (E. coli)/ p B R 3 2 2 A . H . K o o p , (116) p I D l l cya+ (E. coli)/ p S U 1 8 . . (134) p R J R 1 2 4 cya+ (H. influenzae)/ p G E M - 7 (54) p I D I O cya+ (H. influenzae)/ p S U 1 8 (134) • 22 Table 2.2 Continued pLPMl ptsH+ ptsl+ crr+/pSU20 (134), Section 2.4.1 pLPMl::E2 ptsH+ ptsIr.mimTnlOkan crr+/ pSU20 (134), Section 2.4.1 pBlall 'miniTnlOJfcfln 'ptsl / pSU40 Section 2.4.1 pLPM7 ptsH:-.mimTnlOkan ptsl+ crr+/ pSU20 Section 2.4.2 pLPM8 'miniTnlOfcan 'ptsH+/ pSU20 Section 2.4.2 pHKcrr crr+/ pHK Section 2.4.3 pGEM/rwB fruB+/ pGEM-T Section 2.4.4 pGEM/ruB::kan fruB::kan/ pGEM-T Section 2.4.4 pSU20/ruB fruB+/ pSU20 Section 2.4.4 pSU2719fru A fruA+/ pSU2719 Section 2.4.5 pSU2719A/raA::spc AfruAv.spc/ pSU2719 Section 2.4.5 pGEMsry sxy+/ pGEM-T L. Bannister pAX923 cpdA+/ pACYC184 H. Niki. (95) pCMP icc+/ pGEM-T (136), Section 2.3.6 pCMP::spc icc::spc/ pGEM-T (136), Section 2.3.6 pGEMre/A relA+/ pGEM-T Section 2.4.7 pGEMreL4::spc relA::spc/ pGEM-T Section 2.4.7 pXN15 crp+(E. coli)/ pSU2718 (28) pWB300 lacZ+ tetR+/ pACYC184 (123) p WBLM /flcZ+-cat/ pACYC184 Section 2.5 pGEMxy/ xylG+F+A+K+/ pGEM-T Section 2.5 p213C xylG+F::lacZ -cat-on xylA+K+/ pGEM-T Section 2.5 p260-l xylG+F::lacZ -spc-ori xylA+K+/ pGEM-T Section 2.5 pLZspc xylG+F::lacZ -spc-Aori xylA+K+/ pGEM-T Section 2.5 a Apostrophe indicates truncated gene or transposon. 23 2.1.2 Culture conditions H. influenzae strains were cultured aerobically at 37°C in brain heart infusion (Difco) supplemented with haemin (lOug/mL) (Sigma), NAD (2ug/mL) (Boehringer Mannheim) and the recommended concentrations of antibiotics (8). Cultures were inoculated from either a single colony or a frozen 0.5ml aliquot of an early exponential phase ('pre-competent') culture. Escherichia coli strains were routinely grown aerobically in Luria-Bertani (LB) broth (Difco) or Terrific broth (see Section 2.1.3) at 37°C, with the recommended concentrations of antibiotics (6). Where good culture aeration was required, cultures were grown in Erlenmeyer flasks (of at least 5X the culture volume) that were shaken at 200rpm in a shaking water bath (Innova 3000, New Brunswick Scientific). Where only gentle mixing or aeration of small cultures was required, cultures were grown in 18mm x 150mm test tubes and 'rolled' (~60rpm) using a tissue culture rotor (Lab-Line) that had been placed in an incubator. Agar plates were prepared by addition of 12g/L Bacto-Agar (Difco) to liquid media before autoclaving. Additional haemin was applied to supplemented BHI plates greater than 24 hours old. 2.1.3 Media All media were sterilized by either autoclaving or filtration. Non-commercial media were prepared as follows: i) Terrific broth (6) This rich medium contains, per litre: Bacto-tryptone 12g Bacto-yeast extract 24g Glycerol 4ml K H 2 P 0 4 K2HPO4 2.31g 12.54g 24 ii) MIV medium for H. influenzae competence induction (90) This defined non-growth medium contains, per litre: Fumarate lg Citrulline 12mg Tween-80 200mg Sodium chloride 4.7g MgS0 4 124mg CaCl 2 147mg KH 2P04 1.74g Arginine 21mg Aspartate 4g Cystine 6mg Glutamate 314mg Leucine 61mg Lysine 35mg Methionine 18mg Serine 65mg Tyrosine 42mg Isoleucine 33mg Glycine 2.5mg Histidine 13mg Valine 35mg Phenylalanine 46mg Threonine 20mg Alanine 48mg Proline 50mg (Final pH 7.0 at 25°C) 2.2 Nucleic acid techniques 2.2.1 DNA cloning methods Al l manipulations of DNA (preparation of chromosomal and plasmid DNA, restriction enzyme digestion of DNA, dephosphorylation of vectors, ligations, 25 polyethylene glycol precipitation of DNA for sequencing) were carried out using standard procedures (6). Electrophoresis of DNA was carried out in 0.8% UltraPure Agarose (Gibco BRL) in TAE buffer (0.04M Tris-acetate, 0.01M. EDTA (6)). Restriction fragments, gene cassettes and PCR products for cloning were purified from agarose gels using the GeneClean II Kit (Bio 101). All cloning was carried out in E. coli strain DH5a, unless otherwise stated. E. coli cells were made competent by transfer to cold lOOmM CaCi2, and transformed by standard procedures (6). Salmonella typhimurium strain SB1475 was made competent by treatment with dimethyl sulphoxide (DMSO) (6). Plasmids were transformed into H. influenzae strains by a glycerol-aided MIV transformation method (238). pGEM-T-, pSU20- and pSU40-based clones were identified by blue-white screening on 5-bromo-4-chloro-3-indolyl-B-D-galactoside (Xgal) (150). All plasmid structures were confirmed by restriction enzyme mapping. 2.2.2 Polymerase chain reaction (PCR) Forward and reverse primers were designed using the programme 'Primers' Version 1.1 (201), and primer sequences were checked for potential interferences and mispriming using the programme 'Amplify' Version 1.2(3 (W. Engels, University of Wisconsin, Genetics). Primers were synthesized on Applied BioSystems Oligonucleotide Synthesizers by the UBC Nucleic Acid-Protein Service Unit. PCR reaction conditions were optimized using the method of Cobb and Clarkson (35). Reaction mixtures contained 0.1-lng/uL DNA template, 2-3 mM Mg 2 +, 0.05-0.4 mM dNTP, 10-35 pmoles each primer, IX Extender Buffer (Stratagene), 5U Taq Polymerase (Boehringer Mannheim) and 5U Taq Extender (Stratagene). Reaction cycles were carried out on a Perkin Elmer Cetus DNA Thermal Cycler 480 as follows: 1 x [30secs at 94°C, 30secs at 54°C, 3mins at 72°C], 30 x [15secs at 92°C, 30secs at 54°C, 3mins at 72°C]. 26 2.2.3 Southern blotting Downward alkaline blotting (112) of DNA from 0.8% agarose gel to positively charged nylon membrane (Hybond-N+, Amersham) was followed by non-radioactive probe labelling and signal visualization using components of the 'DIG DNA Labelling and Detection Kit - Non-radioactive' (Boehringer Mannheim) and the method of Engler-Blum et al. (61) with the following modifications: 1% blocking reagent was used to minimize background signal; blocking buffer was adjusted to pH 7.5 to maximize dissolving of the blocking reagent. 2.2.4 DNA sequencing Sequencing was carried out by the UBC Nucleic Acid-Protein Service Unit, using ABI AmpliTaq DyeDeoxy Terminator Cycle Sequencing Chemistry. 2.3 Biochemical techniques (These methods were used by our collaborators Dr. Milton H. Saier and Dr. J. Reizer in experiments described in Section 3.6). 2.3.1 Preparation of cell extracts and membrane fractions Cells from a 500ml of culture were harvested by centrifugation, washed twice and suspended in 10ml of 50mM Tris-HCl buffer (pH 7.5) containing ImM dithiothreitol (DTT) and O.lmM phenylmethylsulphonyl fluoride (TDP buffer). Cells were ruptured by two passages through a French pressure cell at 10,000 pounds/in , and cell extracts were centrifuged for 15 min at 10,000xg to remove whole cells and cell debris. Membranes were then collected by centrifugation at 100,000xg for 180 min at 4°C, washed twice with TDP buffer and resuspended in the same buffer at a protein concentration of 5-10mg/ml. 27 2.3.2 Protein purification Enzyme I, HPr and Enzyme II A G l c of E. coli were overproduced and purified as described by Reizer et al. (194). Overproduction and purification of the diphosphoryl transfer protein (DTP) of S. typhimurium have also been described (30). Protein concentration was determined by the bicinchoninic acid (BCA) method (Pierce Chemical Co.) using bovine serum albumin as standard. 2.4 Cloning and mutagenesis of specific genes 2.4.1 ptsl AH. influenzae genomic library was constructed by partial Saw3A I digestion of H. influenzae MAP7 genomic DNA and ligation of the resultant fragments into the E. coli IH. influenzae shuttle vector pSU20, pre-cut with BaraHI. The library was amplified by transformation into E. coli DH5oc, and chloramphenicol-resistant colonies were pooled for preparation of plasmid DNA. The library was transformed into the E. coli ptsl temperature sensitive strain LJ176, and complementing clones were identified by growth at 42°C on minimal salts agar supplemented with 1% mannitol (an E. coli PTS sugar). A complementing clone, pLPMl, with a ~12.5kb DNA insert was chosen for further analysis (Fig. 2.1). 28 hyp.'. pepA betT basS basR ? ? err ptsl ptsH hyp. hyp. de' [B] 3 Sad Xho\ 3 [C] BglW Xho\ [D] EcoRl EcoRV Figure 2.1 Structures of pts operon clones [A] Schematic of the ~12.5kb Sau3Al fragment cloned in pLPMl, encompassing genes HI#1704-1716. Genes and transcriptional direction are indicated by arrows. Bold arrows indicate genes of the H. influenzae pts operon. Dark triangles Tnl and Tn2 indicate approximate positions of mmilvdOkan insertion in pLMPl::E2 and pLPM7 respectively. Apostrophes indicate truncated open reading frames. pepA, aminopeptidase A; betT, choline transport protein; basR/basS, two-component system of unknown function; err, PTS enzyme IIA G l c; ptsl, PTS enzyme I; ptsH, PTS phosphotransfer protein HPr; ?, putative open reading frame; hyp., genes homologous to E. coli genes of unknown function. [B] Sacl-Xhol fragment cloned in pBlall. [C] Bglll-Xhol fragment cloned in pLPM8. [D] EcoRV-EcoRI fragment cloned in pHKcrr. To locate the ptsl gene (HI#1712) within this insert, and to disrupt it for later construction of chromosomal mutants, pLPMl was transformed into strain NM554 and mutagenized by miniTnlOkan insertion, with delivery of the transposon from the phage vector MNTK1316. The method of Kleckner was used, with the following modifications (111): A.NK1316 lysate was prepared using the 'lysate rescue' method described by Miller (150); mutagenized clones were selected on 25 ug/ml chloramphenicol plus 300ug/ml kanamycin (six-fold higher than the concentration 29 used routinely to select for chromosomal kanamycin insertions) to enrich for insertions in the intermediate copy-number plasmid pLPMl. Pooled mutagenized plasmid was transformed into fresh competent E. coli strain LJ176. Loss of complementation of the ptsl phenotype identified plasmids carrying insertions in the ptsl gene. One of these, pLPMl::E2 (Fig. 2.1), was used in construction of the ptsl strain RR745. In preparation for sequencing, pLPMl was cut with Sacl and Xhol to yield two fragments each carrying half of the mimTnlOkan transposon. A ~6.7kb fragment that was expected to contain an upstream portion of the ptsl gene was gel-purified and sub-cloned into pSU40 to give plasmid pBlall (Fig. 2.1). Sequencing from the TnlO end of the subcloned fragment was carried out using a primer complementary to the ends of mimTnlOkan ('5-CCACCTTAACTTAATGATTTTTACC-3') (28), and confirmed transposon insertion at or near bp 1297 of ptsl. 2.4.2 ptsH The ptsH gene (HI#1713) encodes the small HPr protein which catalyzes transfer of phosphate from Enzyme I to sugar-specific Enzyme IIA domains (174). The coding region of the H. influenzae ptsH homologue comprises only 255bp (66), and contains no useful restriction sites for directed disruption of the gene. Instead, pLPMl clones with a miniTnl Okan insertion in ptsH were selected from the pool of mutagenized pLPMl created in Section 2.4.1 above. Pooled mutagenized pLPMl was transformed into the S. typhimurium ptsH strain SB1475. Transformants were selected on MacConkey 1% mannitol agar (Section 2.1.3) containing 50ug/ml kanamycin and 25ug/ml chloramphenicol. Because most clones carried an intact ptsH gene they complemented the inability of strain SB1475 to catalyze PTS-mediated uptake of mannitol; complemented colonies were able to 30 ferment mannitol and appeared pink on the MacConkey agar. Plasmid was prepared from ten white non-complemented colonies, and the location of each transposon insertion determined by restriction analysis. All ten appeared to have a transposon insertion within ptsH. One of these was designated pLPM7 (Fig. 2.1) and used for construction of the ptsH strain RR817. In preparation for sequencing, a ~2.3kb Xhol/Bglll fragment of pLPM7, carrying half of the miniTnl 0/can transposon and the ptsH region downstream of the insertion site, was subcloned into pSU20 to give pLPM8 (Fig. 2.1). Sequencing from the miniTnlO end of the subcloned fragment was carried out using the primer complementary to the ends of miniTnlOfcan described above, and confirmed insertion of the transposon at or near bp 76 of the ptsH coding region. 2.4.3 err The gene err (HI#1711) (66) encodes the H. influenzae homologue of the E . coli EIIA G l c PTS component which catalyzes phosphotransfer from HPr to the glucose permease EIICB G l c (Fig. 1.4) (174). The ptslv.lacZ/kan crrr.cat strain (RR794) obtained from M. Gwinn (82) carries a chloramphenicol-resistance cassette (cat) insertion in an Mboll site at bp 94 of the coding region. Chromosomal DNA was prepared from this strain, digested with EcoRV to disrupt linkage between the neighbouring err and ptsl mutations, and transformed to competent H. influenzae strain KW20. Chloramphenicol-resistant, kanamycin-sensitive transformants were selected, and one of these, designated RR801, was used for further study. A ~2.7kb EcoRl/EcoKV fragment of pLPMl carrying err was also purified from an agarose gel and subcloned into the tetracycline-resistant H. influenzae shuttle vector pHK to give pHKcrr (Fig. 2.1). 31 2.4.4 fruB T h e l a r g e (1497bp) fruB gene (HI#0448) (66) e n c o d e s the u n i q u e f r u c t o s e - s p e c i f i c d i p h o s p h o r y l t r ans fe r p r o t e i n ( D T P ) (193). A ~ 4 . 4 k b r e g i o n o f the K W 2 0 c h r o m o s o m e c a r r y i n g fruB a n d f l a n k i n g s e q u e n c e s w a s a m p l i f i e d b y P C R w i t h the f o l l o w i n g f o r w a r d a n d r e v e r s e p r i m e r s : 5 ' - G C C A G C C C C A A C T T G A C C A C G G G - 3 ' a n d 5 - C G T G G C T G A T T G A T G G C G C A A C G C - 3 ' a n d c l o n e d i n t o the p l a s m i d v e c t o r p G E M - T ( F i g . 2.2 A ) . P l a s m i d p G E M / r a B ca r r i e s t w o Hz'ncII r e s t r i c t i o n s i tes , o n e o f w h i c h i s at b p 332 o f fruB. T h e p l a s m i d w a s p a r t i a l l y d i g e s t e d w i t h Hz'ncII u s i n g the s e r i a l d i l u t i o n m e t h o d (6), a n d the r e a c t i o n m i x w a s l i g a t e d w i t h a T n 9 - d e r i v e d k a n a m y c i n - r e s i s t a n c e casset te (kan) w h i c h h a d b e e n p r e v i o u s l y e x c i s e d f r o m p l a s m i d p W J C 3 b y Smal d i g e s t i o n . A p G E M / r w B : : k a n c l o n e ( F i g . 2.2 A ) w a s s e l e c t e d a n d c h a r a c t e r i z e d b y r e s t r i c t i o n a n a l y s i s , a n d u s e d for c o n s t r u c t i o n o f the fruB s t r a i n R R 7 9 8 . F o r c o m p l e m e n t a t i o n s t u d i e s , the ~4.4 k b fruB P C R p r o d u c t w a s r e l e a s e d f r o m p G E M - T b y Sall/Sphl r e s t r i c t i o n e n z y m e d i g e s t i o n a n d s u b c l o n e d i n t o the H. influenzae s h u t t l e v e c t o r p S U 2 0 to g i v e pSU20:\fruB ( p G E M - b a s e d p l a s m i d s w i l l n o t r e p l i c a t e i n H. influenzae). 2.4.5 fruA T h e m e m b r a n e - b o u n d f r u c t o s e - s p e c i f i c E I I B ' B C F r u p e r m e a s e o f the H. influenzae P T S i s e n c o d e d b y fruA (HI#0446) (66). A ~ 4 . 3 k b f r a g m e n t c a r r y i n g fruA a n d f l a n k i n g s e q u e n c e s w a s a m p l i f i e d f r o m the K W 2 0 c h r o m o s o m e u s i n g the f o l l o w i n g f o r w a r d a n d r e v e r s e p r i m e r s : 5 ' - G G G T A C A G A G G C T A C T C G C G C T G G - 3 ' a n d 5 ' - C G G C A G T G C C A C C G T C T G A A C C C G - 3 ' . T h e p r o d u c t w a s cu t w i t h Pstl/Scal a n d l i g a t e d i n t o Pstl/Smal-cut H. influenzae s h u t t l e v e c t o r p S U 2 7 1 9 to g i v e pSU2719fruA ( F i g . 2.2 B ) . 32 Bglll digestion removed a 669 bp fragment internal to fru A (bp 123-792). This fragment was replaced by a spectinomycin-resistance cassette (spc) which was excised from pKRP12 using BamHI. The resultant plasmid was named pSU2719A/nM::spc (Fig. 2.2 B) and was used in construction of the fruA strain RR813. [A] 4 4 'fruA fruK [B] 'secG fruA fruB Six: Spc T 1.0 kb hyp. vapD hyp. hyp. L J 4 Abp 123-792 fruK1 Figure 2.2 Structures of fru operon clones. [A] Schematic of the ~4.4kb PCR product cloned in pGEM/rwB encompassing genes HI#0446-0452. [B] Schematic of the ~3.1kb PstT-Scal subcloned PCR product contained in pSU2719/nM, encompassing genes HI#0445-0447. Bracket indicates deleted fru A region in pSU2719A/riM::spc. Genes and transcriptional direction are indicated by arrows. Bold arrows indicate genes of the H. influenzae fru operon. Apostrophes indicate truncated open reading frames. Dark triangles indicate approximate location of spectinomycin-resistance gene cassette insertions in pGEM/ruB::kan and pSU2719A/nM::spc. fru A, PTS enzyme IIB'BCFru; fruB, PTS diphosphoryl transfer protein (DTP); fruK, 1-phosphofructokinase; secG, protein export membrane protein; vapD, homologue of Dichelobacter nodosus virulence associated protein; hyp., genes homologous to E. coli genes of unknown function. 33 2.4.6 ice C l o n i n g o f the H. influenzae g e n e ice (HI#0399) a n d c o n s t r u c t i o n o f the m u t a n t s t r a i n R R 8 1 2 w a s c a r r i e d o u t b y C a i x i a M a . T h e ice gene e n c o d e s a c A M P . p h o s p h o d i e s t e r a s e (136) h o m o l o g o u s to tha t e n c o d e d b y the E. coli g e n e cpdA (95). A ~ 3 k b r e g i o n o f K W 2 0 c h r o m o s o m a l D N A c o n t a i n i n g the ice o p e r o n (HI#0398 a n d HI#0399) w a s a m p l i f i e d b y P C R u s i n g the f o l l o w i n g f o r w a r d a n d r e v e r s e p r i m e r s : 5 - G C G T A A A T C G C C A A G T G A C G G - 3 ' a n d 5 ' - G C A T T C C G T T C A A C T T G G G C - 3 ' . T h e r e s u l t i n g f r a g m e n t w a s c l o n e d i n t o p G E M - T to gene ra t e p C M P ( F i g . 2.3). A s p e c t i n o m y c i n -r e s i s t a n c e g e n e casset te (spc) w a s p r e p a r e d b y BatnHl r e s t r i c t i o n o f p l a s m i d p K R P 1 2 a n d l i g a t e d i n t o p C M P p r e p a r e d f r o m E . coli s t r a i n G M 2 1 6 3 at a Bell s i te i n t e r n a l to the ice g e n e (bp 522) , g i v i n g p C M P : : s p c ( F i g . 2.3) (136). T h i s p l a s m i d w a s u s e d i n c o n s t r u c t i o n o f the ice s t r a i n R R 8 1 2 . Figure 2.3 Structure of ice operon clones. S c h e m a t i c o f the ~ 3 . 3 k b P C R p r o d u c t c l o n e d i n p C M P , e n c o m p a s s i n g genes HI#0397-0401 . G e n e s a n d t r a n s c r i p t i o n a l d i r e c t i o n are i n d i c a t e d b y a r r o w s . B o l d a r r o w s i n d i c a t e genes o f the p u t a t i v e H. influenzae ice o p e r o n . A p o s t r o p h e s i n d i c a t e t r u n c a t e d o p e n r e a d i n g f r a m e s . F i l l e d t r i a n g l e i n d i c a t e s a p p r o x i m a t e l o c a t i o n o f s p e c t i n o m y c i n - r e s i s t a n c e g e n e casset te i n s e r t i o n at b p 1573 (a Bell si te) i n p C M P : : s p c . O p e n c i r c l e i n d i c a t e s l o c a t i o n o f p u t a t i v e C R P - b i n d i n g s i te . xseA, e x o n u c l e a s e V I I , l a r g e s u b u n i t ; ompPl, o u t e r m e m b r a n e p r o t e i n ; h y p . , g e n e s h o m o l o g o u s to E . coli genes o f u n k n o w n f u n c t i o n . 34 2.4.7 relA H. influenzae possesses homologues of the E. coli genes relA and spoT (66) which encode the central enzymes of the stringent response system (26). A ~4.8kb region containing relA and flanking sequences was amplified by PCR using the following forward and reverse primers: 5'-GGGTCATCGCCTTAATTATCGGCG-3' and 5'-GGCGATGCTTGGGCGTATCGTCG-3' and cloned into pGEM-T to give pGEMrelA (Fig. 2.4). The cloned relA gene was disrupted by ligation of a spectinomycin-resistance cassette (spc) (excised from pKRP12 by EcoRl digestion) into an internal EcoRl restriction site (at bp 1824). The resultant plasmid pGEMre/A::spc (Fig. 2.4) was used to construct the relA strain RR822. Figure 2.4 Structure of relA clones Schematic of the ~4.8kb PCR product cloned in pGEMrelA, encompassing genes HI#0333-0338. Genes and transcriptional direction are indicated by arrows. Apostrophes indicate truncated open reading frames. Filled triangle indicates approximate location of spectinomycin-resistance gene cassette insertion in pGEMrg/A::spc. ycgA, putative RNA methyltransferase; relA, GTP pyrophosphokinase; dgkA, diacylglycerol kinase; mog, molybdopterin biosynthesis protein; glnB, nitrogen regulatory protein P-II; hyp., gene homologous to an E. coli gene of unknown function. 35 2.5 Construction of a /acZ-based cAMP reporter cassette A r e g i o n o f the K W 2 0 c h r o m o s o m e e n c o m p a s s i n g the n o n - e s s e n t i a l x y l o s e u t i l i z a t i o n o p e r o n genes xylG, xylF, xylA and xylK (HI#1110-HI#1113) (66) w a s a m p l i f i e d b y P C R u s i n g the f o l l o w i n g f o r w a r d a n d r e v e r s e p r i m e r s : 5 ' - G C G A T A A G C C A C C C A C C A A C C A T T C C - 3 ' a n d 5 ' - C A C A T C A G C A A T C A T T T G C C G C C - 3 ' . T h e ~ 5 . 8 k b P C R p r o d u c t w a s c l o n e d i n t o the v e c t o r p G E M - T , g i v i n g p G E M x y / ( F i g . 2.5 A)'. T h e t e t r a c y c l i n e - r e s i s t a n c e gene (tetR) c a r r i e d b y the lacZ+ p l a s m i d p W B 3 0 0 i s n o t e x p r e s s e d b y H. influenzae. T o a l l o w s e l e c t i o n for d e r i v a t i v e s o f t h i s p l a s m i d i n H. influenzae, a T n 9 0 3 - d e r i v e d cat gene ( e x c i s e d f r o m p C A T 1 9 b y Sphl d i g e s t i o n ) w a s l i g a t e d i n t o a n Sphl s i te i n t e r n a l to tetR, g i v i n g the n e w p l a s m i d p W B L M ( F i g . 2.5 A ) . p W B L M a n d pGEMxyl w e r e c u t w i t h Bglll a n d l i g a t e d t oge the r . T h e n e w f u s i o n p l a s m i d p 2 1 3 C ( F i g . 2.5 A ) thus ca r r i e s the p W B L M - d e r i v e d lac p r o m o t e r - / a c Z - c a t c o n s t r u c t i n s e r t e d i n t o a Bglll s i te at b p 72 o f xylF (HI#1111). P l a s m i d p 2 1 3 C w a s l i n e a r i z e d b y r e s t r i c t i o n w i t h Apal to g i v e a / a c Z / c a t c o n s t r u c t f l a n k e d b y r e g i o n s o f the x y l o s e o p e r o n , a n d th i s D N A w a s u s e d i n c o n s t r u c t i o n o f the lacZ+ C m r r e p o r t e r s t r a i n R R 8 0 2 . P l a s m i d p 2 6 0 - l w a s c o n s t r u c t e d b y r e m o v a l o f a ~ 3 . 0 k b Nhel f r a g m e n t c o n t a i n i n g cat a n d flanking tetR s e q u e n c e s f r o m p 2 1 3 C , a n d l i g a t i o n o f a p K R P 1 2 - d e r i v e d s p e c t i n o m y c i n - r e s i s t a n c e casset te i n i ts p l a c e ( F i g . 2 .5 .B) . F i n a l l y , a ~ 2 . 4 k b f r a g m e n t c a r r y i n g the p W B 3 0 0 ori w a s r e m o v e d f r o m p 2 6 0 - l b y Snaftl a n d p a r t i a l Bstl\07\ r e s t r i c t i o n e n z y m e d i g e s t i o n ; the r e m a i n i n g ~ 1 4 k b f r a g m e n t w a s r e c i r c u l a r i z e d b y l i g a t i o n . T h e n e w p l a s m i d , p L Z s p c ( F i g . 2.5 B ) , w a s l i n e a r i z e d b y Apal/Spel d i g e s t i o n a n d u s e d i n c o n s t r u c t i o n o f the lacZ+ S p c r r e p o r t e r s t r a i n R R 8 2 8 . 36 03 Figure 2.5 A Plasmids used in construction of reporter strain RR802 Plasmid pWB300 was converted to plasmid pWBLM by insertion of a chloramphenicol-resistance cassette, and fused with plasmid pGEMxy/ to give plasmid p213C, as described in section 2.5. Hyphens indicates truncated genes. 37 Figure 2.5 B Plasmids used in construction of reporter strain RR828 Plasmid p213C (Figure A) was converted to plasmid p260-l by insertion of a spectinomycin-resistance cassette, and plasmid p260-l was converted to plasmid pLZspc by deletion of the pACYC184 ori as described in section 2.5. Hyphens indicate truncated genes. 38 2.6 Construction of mutant and reporter strains In all cases, mutations or reporter constructs were created in cloned genes of interest, and the mutation/construct transferred to the H. influenzae chromosome by homologous recombination (the recipient strain was transformed with linearized plasmid DNA, and transformants selected on the appropriate antibiotic(s)). Strain RR823 (which carries two kanamycin resistance genes, in ptsH and fruB) was selected at the increased kanamycin concentration of 40ug/ml. Strains RR829-RR833 were constructed by transformation of competent reporter strains RR802 or RR828 with chromosomal DNA carrying the relevant mutations, and selection for appropriate antibiotic resistance. Insertion of transposon, antibiotic-resistance cassette or lacZ construct was confirmed for each strain by Southern blotting (Section 2.2.3) using probes specific to both the inserted DNA, and to the chromosomal region under study (data not shown). 2.7 Assays of competence development by Haemophilus influenzae strains 2.7.1 Spontaneous competence development in rich medium Spontaneous competence development was followed during growth in BHI medium supplemented with haemin and NAD (sBHI, Sections 2.1.2 and 2.1.3). A single colony, or a frozen 0.5ml aliquot of precompetent cells, was inoculated into 50ml sBHI and incubated with shaking at 37°C. Once OD^oo (read on a Pharmacia NovaSpec® II Spectrophotometer) reached -0.1, aliquots were removed at intervals and incubated, rolling, with lug/ml (saturating) MAP7 DNA at 37°C for 20 minutes. DNase I (Boehringer Mannheim) was added to a concentration of lug/ml and the mixture rolled at 37°C for a further 10 mins. Transformation frequency, a measure of competence, was assessed by plating dilutions on appropriate media and scoring the frequency of Nov 1 transformants. 39 2.7.2 Competence development in nutrient-limited medium Maximal competence was induced in wild-type H. influenzae by transfer to MIV starvation (non-growth) medium (90) (for composition, see Section 2.1.3), as described by Barcak et al. (8). Briefly, early-exponential phase cells (OD600 of 0.2-0.3) were collected by filtration in 100ml Analytical Test Filter Funnels (0.2p pore size; Nalgene) (259), resuspended in MIV and incubated with gentle shaking (lOOrpm) at 37°C. Aliquots of 200ul were removed at intervals, or at 100 minutes, and incubated, rolling, with lug/ml (saturating) MAP7 DNA at 37°C for 30 minutes. 800uL of sBHI was then added and the cultures incubated with rolling at 37°C for a further 30 mins in the absence of novobiocin to allow time for expression of the MAP7-derived novobiocin resistance allele. Transformation frequency was assessed as described above. 2.7.3 Induction of competence by anaerobic shift Competence was induced using the anaerobic growth method of Goodgal and Herriot (75) as follows: Cultures were grown to an O D 6 0 0 of -0.5 with shaking at 37°C in a flask. 10ml aliquots were then removed to 15ml test tubes and incubated at 37°C without shaking for 60 mins, followed by 30 mins aerobic growth at 37°C in a flask. Competence development was assessed as described above. 2.8 Assays of sugar uptake and utilization 2.8.1 Sugar fermentation studies Sugar fermentation by E. coli and S. typhimurium strains was scored on Difco MacConkey agar (Section 2.1.3) containing 1% of test sugar. H. influenzae will not grow on MacConkey agar or other standard indicator media used for detection of sugar fermentation. Instead, sugar fermentation by H. influenzae was assayed by 40 o v e r n i g h t a e r o b i c g r o w t h at 3 7 ° C i n D i f c o p h e n o l r e d b r o t h i n d i c a t o r m e d i u m ( S e c t i o n 2.1.3) s u p p l e m e n t e d w i t h N A D , h a e m i n , 1 0 % B H I a n d 1% o f the s u g a r to be t e s t ed . I n c r e a s i n g a c i d i t y r e s u l t i n g f r o m s u g a r f e r m e n t a t i o n c a u s e s th i s i n d i c a t o r m e d i u m to c h a n g e c o l o u r f r o m r e d to y e l l o w . I n q u a l i t a t i v e s t u d i e s , f e r m e n t a t i o n o f s u g a r w a s a s s e s s e d b y s i m p l e c o l o u r c h a n g e ( r e d / o r a n g e / y e l l o w ) . I n q u a n t i t a t i v e s t u d i e s , p H o f e a c h c u l t u r e w a s m e a s u r e d u s i n g a h a n d - h e l d p H m e t r e ( B e c k m a n ) a n d the p H c h a n g e ( A p H ) r e l a t i v e to p H o f a p a r a l l e l c u l t u r e l a c k i n g the test s u g a r w a s c a l c u l a t e d . D e g r e e o f s u g a r f e r m e n t a t i o n b y m u t a n t s s t r a i n s w a s e x p r e s s e d as a p e r c e n t a g e o f w i l d - t y p e A p H for e a c h test s u g a r . T h i s a s s a y d o e s n o t g i v e a d i r e c t m e a s u r e o f s u g a r f e r m e n t a t i o n b y H. influenzae, b u t i n s t e a d p r o v i d e s c o n s i s t e n t r e l a t i v e m e a s u r e s o f s u g a r u t i l i z a t i o n b y d i f f e r e n t m u t a n t s t r a i n s . I n p a r t i c u l a r , th is m e t h o d a v o i d s s u b j e c t i v e c o l o u r j u d g m e n t s a n d a l l o w s d i f f e r e n t i a t i o n o f f e r m e n t a t i o n s co re s w h i c h m a y a l l a p p e a r ' o r a n g e ' b y the q u a l i t a t i v e m e t h o d . 2.8.2 F r u c t o s e t r a n s p o r t s t u d i e s T h e s e a s says w e r e c a r r i e d o u t b y D r . M . H . Sa i e r a n d D r . J. R e i z e r ( U n i v e r s i t y o f C a l i f o r n i a , S a n D i e g o ) . C e l l s w e r e c u l t u r e d i n 100 to 2 0 0 m l o f h e a r t i n f u s i o n ( D i f c o ) s u p p l e m e n t e d w i t h h a e m i n a n d N A D a n d w i t h s u g a r s as s p e c i f i e d i n F i g u r e 3.6, a n d h a r v e s t e d i n the m i d - e x p o n e n t i a l p h a s e o f g r o w t h b y c e n t r i f u g a t i o n ( 1 2 0 0 0 x g fo r 5 m i n ) at 4 ° C . C e l l s w e r e t h e n w a s h e d t w i c e w i t h 5 0 m M p o t a s s i u m p h o s p h a t e b u f f e r ( p H 7.4) c o n t a i n i n g 0.2% ( N H 4 ) 2 S 0 4 a n d 0.02% M g S C V 7 H 2 0 , a n d r e s u s p e n d e d i n the s a m e b u f f e r to a n OD600 o f 0.5-0.6. C e l l s u s p e n s i o n s c o n t a i n i n g 0 . 5 u g / m l N A D a n d 0 .2% c a s a m i n o a c i d s w e r e p r e w a r m e d to 3 7 ° C fo r 5 m i n b e f o r e a d d i t i o n o f ( 1 4 C ) -f r u c t o s e ( 2 0 u M ; s p e c i f i c a c t i v i t y , 5 u C i / u m o l ) . T h e t r a n s p o r t r e a c t i o n w a s t e r m i n a t e d b y w i t h d r a w i n g s a m p l e s at a p p r o p r i a t e i n t e r v a l s a n d c o l l e c t i n g the ce l l s b y f i l t r a t i o n o n 25 m m m e m b r a n e f i l t e r s ( 0 . 4 5 u m p o r e s i z e ; M i l l i p o r e C o r p . , B e d f o r d , M A ) . T h e c e l l s w e r e w a s h e d w i t h t w o 3 m l v o l u m e s o f t r a n s p o r t bu f f e r , a n d f i l t e r s w i t h ce l l s 41 were dried under an infrared lamp and placed in vials containing 10ml of scintillation fluid for determination of radioactivity. An intracellular volume of 2.15ul per 1.2 absorbance units at 600nm was used to determined the concentration of substrate accumulated (J. Reizer, unpublished data). 2.8.3 Sugar phosphorylation assays These assays were carried out by Dr. M. H. Saier and Dr. J. Reizer (University of California, San Diego). ATP- or PEP-dependent sugar phosphorylation assays were performed as described by Reizer (191). Assay mixtures contained 50mM potassium phosphate buffer (pH 7.4), 25mM KF, 12.5mM MgCl 2, 2.5mM DTT, 5mM PEP or ATP, 20uM of the (14C)-sugar substrate (specific activity, 5uCi/umol), and either crude extracts or purified protein constituents of the PTS and washed membranes at concentrations indicated in Table legends. Reaction mixtures were incubated at 37°C for 20-60 min and assayed for (14C)-sugar-P using ion exchange columns to separate phosphorylated from free sugar (118). 2.9 Assays of (j-galactosidase activity E. coli strains were grown in M9 minimal glucose medium (6) supplemented with 0.5% casamino acids (Difco) and ImM IPTG. H. influenzae strains were sampled during growth in sBHI or after incubation in MIV non-growth medium (for composition see Section 2.1.3). |3-Galactosidase activity was assayed using a modification of the method described by Miller (149). Duplicate samples (various volumes) were pelleted briefly in a microcentrifuge (Heraeus-Sepatech Biofuge A), media was aspirated and cell pellets were frozen at -80°C. For assay, pellets were thawed on ice and the assay was initiated by vortexing cell pellets in 1ml of Z-buffer (60mM N a 2 H . P O 4 - . 7 H 2 O , 40mM 42 N a H 2 P 0 4 - H 2 0 , l O m M K C I , I m M M g S O 4 - 7 H 2 0 , 5 0 m M p - m e r c a p t o e t h a n o l ) c o n t a i n i n g o - n i t r o p h e n y l - P - D - g a l a c t o p y r a n o s i d e ( O N P G , 4 m g / m l ) , s o d i u m d e o x y c h o l a t e ( O . l m g / m l ) a n d h e x a d e c y l t r i m e t h y l a m m o n i u m b r o m i d e ( 0 . 2 m g / m l ) . R e a c t i o n m i x t u r e s w e r e i n c u b a t e d at 2 8 ° C u n t i l the a s s a y w a s t e r m i n a t e d b y a d d i t i o n o f 0 . 5 m l o f 1 M N a 2 C C > 3 . W h e r e d i l u t i o n w a s r e q u i r e d , c e l l p e l l e t s w e r e f i r s t r e s u s p e n d e d i n Z - b u f f e r w i t h o u t O N P G a n d t h e n d i l u t e d 1 / 1 0 o r 1 / 1 0 0 i n t o Z bu f fe r c o n t a i n i n g O N P G . F o l l o w i n g a s s a y t e r m i n a t i o n , c e l l d e b r i s w a s p e l l e t e d b r i e f l y i n a m i c r o c e n t r i f u g e a n d the y e l l o w c o l o u r q u a n t i t a t e d at 4 2 0 n m . U n i t s o f P-g a l a c t o s i d a s e a c t i v i t y w e r e c a l c u l a t e d as: 1 0 0 0 x O D 4 2 o t x v x O D 6 o o w h e r e O D 4 2 o i s r e a d f r o m the r e a c t i o n m i x t u r e , ODgoo ref lec ts the c e l l d e n s i t y j u s t b e f o r e a s s a y , r= r e a c t i o n t i m e i n m i n u t e s a n d v= r e a c t i o n v o l u m e ( i n m l ) (149). 2.10 S o f t w a r e u s e d in data a n a l y s i s and p r e s e n t a t i o n D N A s e q u e n c e s w e r e a n a l y z e d for r e s t r i c t i o n e n z y m e s i tes a n d o p e n r e a d i n g f r a m e s u s i n g D N A S t r i d e r ™ V e r s i o n 1.1 ( © C h . M a r c k a n d C E A , F r a n c e ) . D N A a n d a m i n o a c i d s e q u e n c e s i m i l a r i t y s e a r c h i n g w a s c a r r i e d o u t u s i n g B L A S T a l g o r i t h m s (3) p r o v i d e d o n the G e n B a n k D a t a b a s e in t e r f ace (72). S h o r t s e q u e n c e s s h o w i n g s i m i l a r i t y to c h o s e n p r o t e i n b i n d i n g si te c o n s e n s u s s e q u e n c e s w e r e i d e n t i f i e d u s i n g G C G (53). M i c r o s o f t ® E x c e l V e r s i o n 3.0 w a s u s e d for a l l m a t h e m a t i c a l c a l c u l a t i o n s , a n d s t a t i s t i c a l a n a l y s e s w e r e c a r r i e d o u t u s i n g J M P I N ® V e r s i o n 3.2.1 ( S A S In s t i t u t e Inc . ) . D a t a w e r e g r a p h e d u s i n g C r i c k e t G r a p h I I I ™ V e r s i o n 1.01 ( © 1992, C o m p u t e r A s s o c i a t e s I n t e r n a t i o n a l , Inc. ) . O t h e r f i g u r e s w e r e d e s i g n e d u s i n g M a c D r a w P r o ® V e r s i o n 1.5.1 ( C l a r i s C o r p o r a t i o n , 1992), a n d w o r d - p r o c e s s i n g w a s c a r r i e d o u t u s i n g M i c r o s o f t ® W o r d V e r s i o n 5.1a. 43 C H A P T E R T H R E E Haemophilus influenzae h a s a P h o s p h o t r a n s f e r a s e S y s t e m 3.1 I n t r o d u c t i o n N u m e r o u s g e n e t i c s t u d i e s i n e n t e r i c b a c t e r i a a n d r e l a t e d p r o t e o b a c t e r i a h a v e d e m o n s t r a t e d the r o l e o f the p h o s p h o e n o l p y r u v a t e : s u g a r p h o s p h o t r a n s f e r a s e s y s t e m ( P T S ) i n r e g u l a t i o n o f i n t r a c e l l u l a r c A M P l e v e l s . I n p a r t i c u l a r , the p h o s p h o r y l a t e d f o r m o f E I I A G l c o f the e n t e r i c b a c t e r i a l P T S i s i m p l i c a t e d i n a c t i v a t i o n o f a d e n y l a t e c y c l a s e (174). T w o l i n e s o f e v i d e n c e s u g g e s t e d tha t a P T S m i g h t s i m i l a r l y r e g u l a t e a d e n y l a t e c y c l a s e a c t i v i t y i n Haemophilus influenzae. F i r s t , p h o s p h o t r a n s f e r a s e s y s t e m s are w i d e l y d i s t r i b u t e d a m o n g b o t h G r a m - p o s i t i v e a n d G r a m - n e g a t i v e e u b a c t e r i a , a n d h a v e b e e n c h a r a c t e r i z e d i n s e v e r a l o t h e r m e m b e r s o f the g a m m a s u b d i v i s i o n o f P r o t e o b a c t e r i a (to w h i c h H. influenzae b e l o n g s ; F i g . 3.8) , i n c l u d i n g Escherichia coli, Salmonella typhimurium, Klebsiella pneumoniae, Vibrio alginolyticus, Erwinia chrysanthemi and Xanthomonas campestris (174). S e c o n d l y , the h i g h d e g r e e o f s e q u e n c e s i m i l a r i t y b e t w e e n E . coli a n d H. influenzae a d e n y l a t e c y c l a s e s t h r o u g h o u t b o t h t h e i r r e g u l a t o r y a n d c a t a l y t i c d o m a i n s (54), i m p l i e s tha t t h e y p a r t i c i p a t e i n s i m i l a r r e g u l a t o r y i n t e r a c t i o n s . S i n c e r e g u l a t i o n o f a d e n y l a t e c y c l a s e i s P T S - m e d i a t e d i n E . coli, i t w a s p r o p o s e d tha t a P T S m a y a l s o r e g u l a t e the H. influenzae a d e n y l a t e c y c l a s e . T o assess w h e t h e r E . coli a n d H. influenzae a d e n y l a t e c y c l a s e s a re i n fac t s i m i l a r l y r e g u l a t e d , c o m p l e m e n t a t i o n o f a n H. influenzae cya s t r a i n b y the E . coli cya g e n e w a s e x a m i n e d (134). T h e H. influenzae cya m u t a n t R R 6 6 8 i s u n a b l e to d e v e l o p c o m p e t e n c e u n l e s s c A M P i s p r o v i d e d (54). F i g u r e 3.1 s h o w s that n o r m a l c o m p e t e n c e d e v e l o p m e n t w a s r e s t o r e d b y b o t h the H. influenzae a n d E . coli cya g e n e s e n c o d e d b y the m o d e r a t e c o p y - n u m b e r p l a s m i d s p I D I O a n d p I D l l , r e s p e c t i v e l y ; t i m i n g a n d ra te w e r e b o t h i n d i s t i n g u i s h a b l e f r o m the s t a n d a r d cya+ • s t r a i n K W 2 0 . I m p o r t a n t l y , n e i t h e r s t r a i n s h o w e d c o m p e t e n c e d u r i n g e x p o n e n t i a l g r o w t h , a n d b o t h d e v e l o p e d c o m p e t e n c e at the onse t o f s t a t i o n a r y p h a s e . 44 T 1 1 1 1 r 0 50 100 150 200 250 300 Time (min) Figure 3.1 Escherichia coli adenylate cyclase can complement the adenylate cyclase deficiency of a Haemophilus influenzae cya strain Competence of strains with wild-type or cya backgrounds was assayed throughout growth in rich medium (sBHI) as described in Section 2.7.1. Plasmid pIDIO carries the H. influenzae cya gene. Plasmid pIDll carries the E. coli cya. gene (134). H. influenzae cultures will only develop high levels of competence during exponential growth in rich medium if exogenous cAMP is added (263), and I have demonstrated that the degree of competence development by a cya strain correlates 45 with the concentration of exogenous cAMP added to the culture medium (see, for example, Figure 4.6). The simplest interpretation of these complementation data is therefore that, as in wild-type cells, cAMP levels are low during exponential growth in rich medium, and increase as cells approach stationary phase. In turn, this implies that the H. influenzae adenylate cyclase is regulated by a PTS in a fashion similar to that in E. coli (134) (and see Fig. 1.4). The sequence analyses and genetic and biochemical experiments described in this chapter were designed to identify and characterize components of the putative H. influenzae PTS. 3.2 Cloning, mapping and mutagenesis o f the Haemophilus influenzae ptsl gene To confirm the existence of an H. influenzae PTS, I cloned and sequenced the H. influenzae ptsl gene (134). Before publication of the H. influenzae KW20 genome sequence (66), the existence of an H. influenzae phosphoenolpyruvate:sugar phosphotransferase system (PTS) had not been demonstrated. By 1992, however, it had been shown that the ptsl gene sequence (encoding PTS Enzyme I) was highly conserved in several eubacteria (both Gram-positive and Gram-negative), and Kohlbrechter et al. (1992) had shown complementation of an E. coli ptsl mutant strain with cloned ptsl from the Gram-positive strain Staphylococcus carnosus (113). Enzyme I catalyzes the first reaction step in the PTS (Fig. 1.4) - it is always the initial phosphate acceptor in PTS-mediated phosphotransfer (174)), and is the best-conserved component of phosphotransferase systems which can otherwise vary widely in structure and complexity (174). This information suggested that it should be possible to clone the H. influenzae ptsl gene by complementation of an E. coli ptsl mutant strain (especially since these are closely-related proteobacterial species (163)). 46 An H. influenzae genomic library was transformed into the E. coli ptsl temperature sensitive strain LJ176, and complementing clones were identified by growth at 42°C on minimal salts agar supplemented with 1% mannitol (an E. coli PTS sugar). A complementing clone with a ~12.5kb DNA insert was chosen for further analysis (pLPMl). To locate the ptsl gene within this insert, and to disrupt it for later construction of chromosomal mutants, I mutagenized pLPMl with miniTnlOkan and transformed the pool of mutated clones into fresh competent LJ176. Loss of complementation of the ptsl phenotype identified plasmids carrying insertions in the ptsl gene. Restriction analysis of five independent isolates showed that all carried insertions in the same 0.6kb Psfl-EcoRI fragment of the pLPMl insert. Preliminary sequencing of one of these, pLPMl::E2, gave ~500bp of ptsl sequence, sufficient to identify homologies with E. coli and S. typhimurium ptsl genes from Genbank (72). Later, analysis of the newly-released H. influenzae genome sequence (66) and comparison with the pLPMl restriction map and partial DNA sequence confirmed that this clone contains the entire H. influenzae ptsHIcrr operon (HI#1711-1713), as well as several other genes (Fig. 2.1). 3 .3 Genome analysis The H. influenzae genome sequence was analyzed by BLAST sequence similarity searching for homologues of bacterial PTS proteins. This confirmed the presence of a pts operon encoding Enzyme I, HPr and EIIA G l c homologues, and also located a fru operon encoding homologues of the E. coli fructose-specific diphosphoryl transfer protein (DTP), the enzyme 1-phosphofructokinase and the fructose-specific permease, EIIB'BC F r u. Together, these proteins comprise a complete fructose-specific PTS. Reizer et al. (193) also used the BLAST programme to screen the translated H. influenzae genome for genes encoding homologues of all other currently known PTS proteins and confirmed that no additional genes encoding recognizable PTS 47 proteins are present in this genome. Of particular interest is the complete absence of aptsG homologue, encoding an Enzyme IICB G l c glucose permease (Fig. 1.4), despite the presence of a gene (err) encoding a glucose-specific Enzyme IIA (Fig. 3.2). To investigate the likelihood that each of the genes predicted to encode PTS components is transcribed and translated by H. influenzae, and that each predicted component has the potential to function similarly to its enteric bacterial homologue, I examined the DNA sequences of H. influenzae pts and fru operon genes, and the amino acid sequences of their predicted products. Figure 3.2 pts operon of Haemophilus influenzae Genes and transcriptional direction are indicated by arrows. P, putative promoter site; open oval, putative CRP binding site. 3.3.1 pts operon H. influenzae possesses a pts operon structurally similar to those of enteric bacteria, with the ptsl gene (HI#1712) lying downstream from ptsH (HI#1713) and upstream from err (HI#1711) (Fig. 3.2). Unlike those of the closely related proteobacteria E. coli, S. typhimurium and K. pneumoniae (163) (Fig. 3.8) the H. influenzae pts operon is not flanked by cysK (HI#1103) and other cys genes (174) and so appears to have a different location on the gene map. Sequence comparison with promoter consensus sequences identified two potential ptsH promoters upstream of the ATG initiation, codon (Table 3.1 A). One of these, promoter ptsH P2, is preceded by a candidate CRP binding site whose 5' end is located at bp 1785472 of the KW20 48 genome. This candidate site matches 14 of the 22 base pairs of the E. coli consensus CRP binding site (22)), and the scoring method of Stormo and Hartzell (236) gives an l$eq score of 9.05, suggesting that CRP should have' good affinity for this sequence (see Section 4.5). As in E. coli, a potential independent err promoter is found within the 3' end of ptsl (202). A GCG 'findpatterns' search using the E. coli promoter -35 box consensus sequence (5 '-TTGACA-3') also identified two novel potential ptsl promoters, beginning 90 bp and 111 bp upstream of the ptsl ATG initiation codon, within the 3' end of ptsH (Table 3.1 A). Putative ribosome binding sites (222) were identified just upstream of the ATG initiation codon of each gene (Table 3.1 B). Table 3.1 Putative regulatory sites for the H. influenzae pts and fru operons. A Putative Promoters Promoter -35 bOxa Spacing -10 box a Distance from Start Codon (bp) E. coli consensus TTGACA N15-21 TATAAT ptsH P2 AGGGCA Nl8 111AAT 23-54 ptsH PI _MI AAT N17 TATTCT 81-110 ptsl PI H I A G A Nl8 TAAAAT 60-90 ptsl P2 H I AGT N17 TAGAAT 82-111 err TTGAAG N21 TAAATT 62-95 fruB H I 1 CA N20 1MCAI 36-67 fruK TTGAGT Nl6 TAGAAA 31-58 a Underlining highlights identities with the E. coli consensus. 49 B Putative Ribosome Binding Sites Gene Transcript Ribosome Binding Site a Matches to 3' end of 16s r RNA b ptsH 5'-UUGAUUAGUCGAGGUAGCAUUAUG-3' 9 ptsl UAAUUGUUUCGGAAGGUAUCUAUG 7 err UUGAAUGGAUAGGAGAUUAAAAUG 5 fruB UUAAAUUAUUAAGGAGCAAGAAUG 7 fruK AAUCGGGUUUAGGGGAAUAGUAUG 5 fru A UAACGAUGAUUGAAGGAUAGUAUG 7 a Putative binding site is underlined. Translational initiation codon is shown in bold. b 5--AUUCCUCCACUAG-3' (222). i) ptsl Enzyme I of the PTS, encoded by ptsl, catalyzes the first reaction of the PTS (Fig. 1.4), transferring phosphate from phosphoenolpyruvate (PEP) to a histidine residue in HPr. The full-length 1725 bp H. influenzae ptsl coding region is predicted to encode a 575 amino acid polypeptide with 84% similarity (70% identity) to S. typhimurium Enzyme I and 82% similarity (70% identity) to E. coli Enzyme I. The active site histidine, His-189, which accepts a phosphate residue from phosphoenolpyruvate, and surrounding active site amino acids are identical to those of all homologous Enzymes I (192) (Fig. 3.3). 50 100 aa El El-N tt 189 :.EI-C - 3 1 HPr E | | A G i c 15 88 - i i u V D T P MA ( H ) l i l i i M l l l i ^ i i i C H ) ~ H P r L ( H ) - H P r 61 300 424 EIIB'BC F r u IIB 112 42 264 Figure 3.3 Schematic of predicted protein components of the Haemophilus influenzae PTS Conserved catalytically active residues are shown in bold, circled, and their position indicated. Triangles indicate approximate site of transposon or cassette insertion in the respective mutant strain, with approximate amino acid position indicated above. Diagonal lines flank the deleted region of EIIB'BC F r u in strain RR813. El-N, N-terminal region of Enzyme I involved in phosphorylation of HPr; EI-C, carboxy-terminal region of Enzyme I required for PEP interaction and dimerization; IIA, domain homologous to E. coli EIIA M t l domain family; M, putative two-component system receiver module; -HPr, HPr-like domains of the fructose-specific diphosphoryl transfer protein (DTP); L, nonconserved linker region; IIB', duplicated IIB domain which facilitates phosphotransfer from DTP to IIB; IIB, domain catalyzing phosphotransfer to fructose; IIC, membrane-inserted fructose permease domain. 51 ii) ptsH Phospho(His)-HPr, the product of the Enzyme I-catalyzed reaction described above, has been shown to phosphorylate all Enzyme IIA domains which have been studied (174). The 255 bp H. influenzae ptsH coding region encodes a predicted 85 amino acid protein with 87% similarity (76-77 % identity) to HPrs of E. coli, S. typhimurium and K. pneumoniae. In particular, the active site His-15 residue, is conserved (174) (Fig. 3.3). iii) err Enzyme IIA G l c, encoded by err, is the central regulatory component of the PTS, and has been shown to mediate both inducer exclusion and activation of adenylate cyclase depending on its phosphorylation state (see Section 1.4.2) (174). The 498 bp H. influenzae err coding region is predicted to encode a 166 amino acid protein with 83% similarity (74% identity) to E. coli EIIA G l c and 82% similarity (72% identity) to S. typhimurium EIIA G l c. The active site histidine which accepts a phosphate group from HPr is conserved at position 88 (Fig. 3.3). 3.3.2 fru operon The fru operon of H. influenzae encodes the substrate-specific components of the H. influenzae PTS, and is located at a position in the genome distant from the pts operon. This operon is structurally similar to fru operons of enteric bacteria and those of Rhodobacter capsulatus (265, 266) and Xanthomonas campestris (47) with the fruK gene (HI#0447) lying downstream from fruB (HI#0448) and upstream from fruA (HI#0449) (Fig. 3.4). Putative ribosome binding sites (222) were identified just upstream of the ATG initiation codon of each gene (Table 3.1 B); coding regions of this operon are separated by only one base pair, suggesting translational coupling. 52 Sequence comparison with promoter consensus sequences identified a potential fruB promoter upstream of the ATG initiation codon. No candidate promoter sequences could be identified for fruK, but a potential independent fru A promoter was found within the 3' end of fruK (Table 3.1 A). These observations are consistent with the findings of de Crecy-Lagard et al. (47), who demonstrated that insertions in the fruB gene of X. campestris were polar on fruK, but not on fru A, and suggested that fruA may be transcribed from its own promoter. In S. typhimurium, basal (uninduced) expression of the fru operon is dependent on cAMP (63). However, H. influenzae cya and crp strains (lacking cAMP or its receptor protein CRP, respectively) can ferment fructose at wild-type levels (Table 3.2) (137) and no candidate CRP sites could be identified in the promoter regions of fruB or fru A, so expression of the fru operon is probably not cAMP-dependent in this organism. P P 4 fruA fruK fruB 1.0 kb Figure 3.4 fru operon of Haemophilus influenzae Genes and transcriptional direction are indicated by arrows. P, putative promoter site. 53 i) fruB The fructose system is the only PTS of enteric bacteria with its own HPr-like activity (63). Early studies demonstrated that E. coli and S. typhimurium ptsH strains were able to transport fructose, but no other PTS sugar, and it was suggested that a second soluble fructose-specific protein, named FPr or 'pseudo-HPr' could substitute for HPr (209). FPr proteins of enteric bacteria (renamed diphosphoryl transfer proteins, or DTPs (210)) were cloned and sequenced and found to contain three domains (70, 191): an amino-terminal IIA F r u domain, a central 'M' domain with weak identity to receiver domains of the cytoplasmic regulator component of two-component systems (266), and a carboxy-terminal HPr-like domain (Fig. 3.5). Meanwhile, the 'pseudo-HPr' proteins of Rhodobacter capsulatus (266) and Xanthomonas campestris (47), were found to be multiphosphoryl transfer proteins (MTPs) which lack the M domain of DTP but possess an amino-terminal IIA F r u domain, an HPr-like domain and a carboxy-terminal El-like domain, coupled through non-conserved linkers (Fig. 3.5). Reizer et al. (1996) have now demonstrated the relatedness of the HPr-like domains of these and other bacterial PTS components (193), and propose that this supports a modular evolution model for phosphotransferase systems in which genetic rearrangements have given rise to domain shuffling as well as inter-domain gene splicing and fusion events (207, 210). The H. influenzae PTS also includes a protein with HPr-like activity, in addition to HPr: the 1497 bp H. influenzae fruB gene encodes a unique 499 amino acid diphosphoryl transfer protein that possesses two C-terminal HPr-like domains fused via a central domain (M) to an N-terminal I I A F r u domain (193) (Fig. 3.5). The duplicated HPr-like domains of this DTP are 64% identical to each other in a 90-residue overlap, and HPri shows 75% similarity (57-58% identity) to HPr-like domains of DTP of E. coli and S. typhimurium. All catalytic and structural residues known to be important for HPr function are conserved (193). 54 a. i -Q c '•2 P i n O "0 •S c CL ct) to — o o 9-° b ui a. x Q_ I c. 3 o o. OT c co O N -C 5? Q. Q> OT _? ° ~ -C -S Q. 5 1 £•8 0) CO « 8 o .e Q. CO o .H- CO 2 QC to O • pH I-l rt > B o s .S SJ rt s g PH 1ft - 3 PH U PH <U O +3 T 3 MH 3 O-X «> o u -SI y3 « u 3 br »H V PH O 9 s. 3 ° O 3 .2 8 tv tu rt 3 CO « • B « g tu *3 »H 3 3 rt 60 60 PH " 3 HH o s CL, T3 JS a» £ £ -2 •X3 bO rt QJ OH QJ s i CN QJ > Hi QJ CO "2 ON 3 T-H O — u ^ § 3 3 rt ,_j « 43 3 rt s o T3 " 'rt to 3 •i-H g O T3 QJ - i S T 9 a; & 3 ^ ° S o 3 O O. M QJ > • i—t QJ U QJ 3 « S | to £ to T 3 55 The I I A F r u domain of the H. influenzae DTP is 72% similar (64% identical ) to the homologous domain in fructose DTPs of E. coli and S. typhimurium, and 56-57% similar (42-43% identical) to the homologous domains in fructose multiphosphoryl transfer proteins of R. capsulatus and X . campestris. Within it, the catalytically active histidine (174) is conserved at position 61. ii) fruK The 940 bp fruK gene encodes a 314 amino acid homologue of 1-phosphofructokinase, an enzyme which converts, the fructose-l-phosphate product of PTS-mediated transport into fructose-l,6-bisphosphate which may then enter pathways of intermediary metabolism (Fig. 4.1). The absence of a candidate promoter, together with data from studies in homologous systems (47) suggest that fruB and fruK are in the same transcriptional unit. iii) fru A The 1668 bp fru A gene of H. influenzae is predicted to encode a 557 amino acid Enzyme IIB'BC F r u permease. This permease is 63% similar (50% identical) to Enzyme IIB'BC F r u of E. coli, and also contains the N-terminal duplication of the IIB domain observed in the E. coli homologue. The catalytically active cysteine residue (174) of the IIB domain is conserved at position 112. 3.4 Analysis of gene disruptions in mutant strains I constructed strains carrying insertional or deletion mutations in the genes encoding PTS components, as described in Section 2.4. To confirm that the insertion in each gene prevented expression of the functional PTS component, I examined the location of each mutation relative to codons encoding functionally significant residues. 56 Phosphotransferase systems of enteric bacteria regulate adenylate cyclase activity and thus intracellular levels of cAMP (174). Ideally, adenylate cyclase activity is followed by direct measurement of intracellular cAMP concentrations. However, earlier attempts to measure intracellular cAMP levels in H. influenzae were unsuccessful (54). Instead, I assessed cAMP-dependent phenotypes (development of competence, and fermentation of cAMP-dependent sugars) of PTS-defective strains to confirm that this PTS regulates adenylate cyclase and that expression of the PTS components in question had been inactivated. 3.4.1 Strain RR745 (ptsl) Sequencing showed that the ptsl strain RR745 carries a mimTnlOkan insertion at or near bp 1297 of ptsl, downstream of His codon 189 (Fig. 3.3). RR745 may therefore express a truncated Enzyme I which possesses the active site His-189 but lacks the carboxy-terminal domain necessary for interaction with PEP and for dimerization (128). The selection of this mutation by lack of function (Section 2.4.1), and the cAMP-deficient phenotypes of this strain (Sections 4.2.2 and 4.3.1) suggest, however that this mutation effectively disrupts El-mediated phosphotransfer to HPr. Consistent with this, the competence deficiency of this strain was complemented by introduction of the wild-type ptsl gene on the intermediate copy-number plasmid pLPMl; data not shown). 3.4.2 Strain RR817 (ptsH) Sequencing showed that the ptsH strain.RR817 carries a mimTnlOkan insertion at or near bp 72, downstream from the catalytic His-15 codon (encoded by bp 43-45) (Fig. 3.3). However, the selection of this mutation by lack of function (Section 2.4.2), argues against the expression of a functional truncated HPr. As shown in Figure 3.2, ptsH lies upstream of ptsl in the H. influenzae pts operon. However, the 57 observation that, unlike the ptsl strain, this strain develops approximately wild-type competence levels (Fig. 4.4) and ferments cAMP-dependent sugars (Fig. 4.2) normally implies that this ptsH insertion mutation is not polar on ptsl, and supports the identification of candidate ptsl-speciiic promoters (Section 3.3.1). 3.4.3 Strain RR801 (err) The err strain RR801 carries a cat insertion at bp 94 (M. Gwinn, personal communication) of the err gene, and so any truncated EIIA G l c product will lack the catalytically significant His-88 residue encoded by bp 262-264 (Fig. 3.3) and will be inactive (181). This is confirmed by the cAMP-deficient phenotypes (82) (Sections 4.2.2 and 4.3.1) of this strain (which were complemented by re-introduction of the wild-type err gene on plasmid pHKcrr; data not shown). 3.4.4 Strain RR798 (fruB) The fruB strain RR798 carries a kan insertion at bp 332 of the coding region (Fig. 3.3), downstream from bp 184-186 which encode the catalytically active His-61 residue (174). Thus, any truncated DTP protein expressed by this strain may possess a partial I I A F r u domain but will lack both HPr-like phosphotransfer domains. Since fruB lies immediately upstream of fruK in the H. influenzae fru operon, the fructose^ negative phenotype of strain RR798 (Fig. 4.2) could be ascribed to a polar effect of this insertion on fruK. The demonstration that this strain is, however, relatively resistant to xylitol-induced PTS-mediated repression of cAMP-dependent sugar fermentation (discussed below) implies that it does not express an active EIIA F r u (1-phosphofructokinase is required for fermentation of fructose, but not for PTS-mediated phosphotransfer to the fructose analogue, xylitol). 58 3.4.5 Strain RR813 (fruA) The fruA strain RR813 has an internal deletion in fruA from amino acids 42-264 (bp 123-792) which is predicted to delete part of IIB' (the IIB' domain facilitates phosphotransfer between DTP and the permease (30)), all of IIB (including the catalytically active Cys-112 residue) and part of the membrane-spanning permease (IIC) domain (30) (Fig. 3.3). That this gene has been inactivated is demonstrated by the fructose-negative phenotype of this strain (Fig. 4.2). 3 . 5 Sugar fermentation assays The enteric PTS favours glucose over all other PTS sugars (174), and in the absence of genomic information this suggested that a PTS of H. influenzae (a close relative of the enteric bacteria) might also favour glucose uptake over uptake of other sugars. Fermentation of glucose was, however, completely unaffected by Enzyme I disruption (134), implying that the H. influenzae PTS is not the main transporter of glucose (although formally, the presence of an active non-PTS glucose transporter may mask the effect of EI disruption on any undetected PTS-mediated glucose uptake). Instead, disruption of Enzyme I completely prevented fermentation of fructose, and exogenously-supplied cAMP did not correct the defect (Table 3.2), suggesting that fructose is directly transported by the PTS. This effect was not seen for any other tested sugar (Table 3.2 and Section 4.2.1), confirming the conclusion drawn from genomic analysis (above) that the PTS of this organism is fructose-specific. (Fermentation of ribose and galactose, whose catabolism by H.influenzae is known to be cAMP-dependent (54), was also disrupted by mutation of ptsl, but was restored by exogenous cAMP (Table 3.2), demonstrating that these sugars are not transported by the PTS). 59 3.6 In vitro analyses of sugar phosphorylation Parallel biochemical experiments were carried out by our collaborators Dr. Milton. H. Saier and Dr. Jonathan Reizer at the University of California, San Diego. The studies described in Section 3.6.1 were undertaken to determine whether the PTS genes identified in the H. influenzae genome express PTS proteins with functions similar to their E. coli homologues. The study described in Section 3.6.2 was undertaken to investigate the apparent absence of components necessary for PTS-mediated phosphorylation of glucose in H. influenzae. Table 3.2 Sugar fermentation by Haemophilus influenzae strains strain: KW20 RR668 (cya) RR540 (crp) RR745 (ptsl) cAMP: - - + - + - + S U G A R Fructose + + + + + - -Fucose + - + - - + Xylose + - + - + + Ribose + - + - - + Galactose + + /- + + /- +/- + Glycerol + + + + + • + Sialic acid + + + + + + + Glucose + + + + + + + Fermentation of each test sugar was qualitatively assessed in supplemented phenol red broth medium, as described in Section 2.8.1. +, red culture (no fermentation); +/-, orange culture (some fermentation); -, yellow culture (good fermentation). For a list of tested sugars not fermented by H. influenzae see Section 4.2.1. 60 3.6.1 Demonstration of functionality of PTS proteins The E. coli PTS phosphorylates the sugar mannitol by catalyzing transfer of phosphate from PEP via Enzyme I, HPr, and the mannitol-specific permease EIIBCA M t l to mannitol. An in vitro phosphorylation assay determined that a total protein extract of the ptsHIcrr E. coli strain TP2811 was deficient in phosphorylation of the substrate (14C)-mannitol unless excess purified E. coli Enzyme I and HPr were added. Alternatively, addition of H. influenzae cell-free extract also restored phosphorylation of ( 1 4C)-mannitol (Table 3.3), demonstrating that H. influenzae expresses functional HPr and Enzyme I homologues. Table 3.3 Demonstration of functional Haemophilus influenzae Enzyme I and HPr Components in Reaction Sugar E.coli TP2811 E. coli E. coli H. Sugar-P A(ptsHIcrr) Enzyme I HPr influenzae formed extract extract (nmole/hr) + - - - 0.03 + + - - 0.06 ( 1 4 C ) - M a n n i t o l + - + - 0.04 + + +, - 3.2 + + + 1.2 + - + + 3.0 Assay mixtures (50ul) contained an extract of E. coli TP2811 (10ug) as the source of Enzyme IIBCA M t l, purified E. coli Enzyme I (2.8ug), purified £. coli HPr (2.5ug), and H. influenzae extract (37.5ug) as described in Section 2.8.3. 61 Phosphorylation of the glucose analogue methyl-a-glucoside by E. coli is dependent on the PTS components Enzyme I, HPr and EIIA G l c. An in vitro phosphorylation assay determined that a total protein extract of the ptsl err E. coli strain TP2819 was incapable of phosphorylating (14C)-methyl-a-glucoside unless excess purified E. coli Enzyme I and EIIA G l c were added. Alternatively, addition of H. influenzae cell-free extract also restored phosphorylation of (14C)-methyl-a-glucoside (Table 3.4), demonstrating that H. influenzae expresses a functional EIIA G l c homologue. Table 3.4 Demonstration of functional Haemophilus influenzae E I I A G l c Components in Reaction Sugar E. coli TP2819 E. coli E. coli Sugar-P A(ptslcrr) Enzyme I EIIA G l c H. influenzae formed extract • extract (nmole/hr) + - - - 0.03 (14C)- • + + - - 0.3 Methyl- + - + - 0.03 oc-glucoside - + + + 0.02 + + + - 0.85 + + - + 0.8 Assay mixtures (50ul) contained an extract of E. coli TP2819 (8ug) as the source of Enzyme IICBGlc, purified E. coli Enzyme I (2.8ug), purified E. coli Enzyme IIA G l c (3.2ug), and H. influenzae extract (37.5ug) as described in Section 2.8.3. 62 PTS-mediated phosphorylation of fructose requires transfer of phosphate from PEP via Enzyme I, the fructose-specific diphosphoryl transfer protein (DTP) and the membrane-bound fructose-specific permease IIB'BC F r u to fructose (as described in Section 3.3.2). Phosphorylation of the substrate (14C)-fructose by a reconstituted PTS comprising purified Enzyme I and diphosphoryl transfer protein (DTP), of E. coli and S. typhimurium respectively, and a H. influenzae washed membrane preparation was observed in vitro (Table 3.5). This demonstrated that membranes from fructose-grown H. influenzae cells exhibited Enzyme IIB'BC F r u (permease) activity. These complementation data confirm the functionality of all of the H. influenzae PTS proteins except DTP, which was not tested (134). Table 3.5 Demonstration of functional Haemophilus influenzae E I I B ' B C F r u permease Components in Reaction S. Sugar-P Sugar E. coli E. coli typhimurium H. influenzae formed Enzyme I HPr DTP membranes (nmole/hr) + + - - 0.03 ( 1 4C)-Fructose + - + - 0.03 + + - + 0.05 ' +__ - + + 0.35 Assay mixtures (50ul) contained purified Enzyme I (2.8ug) and HPr (2.5ug), both of E. coli, purified DTP (6ug) of S. typhimurium and washed membranes of H. influenzae (5ug protein) as described in Section 2.8.3. 63 3.6.2 Confirmation of PTS-independent glucose and galactose phosphorylation Sugars taken up by the PTS are concomitantly phosphorylated with phosphate derived from phosphoenolpyruvate (PEP). In contrast, non-PTS sugars are phosphorylated only after uptake, and by ATP-dependent sugar-specific kinases. The sugar phosphorylation assay data summarised in Table 3.6 established the presence of ATP-dependent galactokinase activity in cell-free extracts of galactose grown cells, and the presence of ATP-dependent glucokinase activity in cell-free extracts of glucose grown cells. This is in agreement with the identification of genes specifying galactokinase (galK, HI#0819) and glucokinase (glk, HI#0144) (Table 4.1). Moreover, significant PEP-dependent phosphorylation of glucose was not observed, consistent with the absence of the PTS glucose permease EIICB G l c. The non-PTS sugar galactose served as a control. ATP-dependent phosphorylation of glucose was also demonstrated in the H. influenzae ptsl mutant strain RR745 (data not shown). This confirmed the conclusion that phosphate from ATP was not being transferred to PEP and thence to glucose via the PTS. Table 3.6 Presence of galactokinase and glucokinase in Haemophilus influenzae extracts Sugar Phosphoryl donor Sugar-P formed (nmole/mg/hr) 04C)-Glucose none 0.004 PEP 0.15 ATP 2.2 (14C)-Galactose none 0.08 PEP 0.1 ATP 1.9 Sugar phosphorylation was measured as described in Section 2.8.3. 64 3.7 Discussion 3.7.1 H. influenzae expresses a functional fructose-specific PTS Sequence analysis indicates that the pts and fru operons of H. influenzae possess the necessary regulatory sequences for expression of the genes they contain. Moreover, these genes encode homologues, with conserved catalytically active residues, of PTS proteins that together mediate the uptake and phosphorylation of fructose. In vitro sugar phosphorylation assays confirmed that H. influenzae expresses functional homologues of Enzyme I, HPr, EIIA G l c and EIIB'BCFru, and also demonstrated that phosphorylation of glucose (the favoured PTS sugar of enteric bacteria) is independent of PEP and thus of the PTS in this organism. Assessment of the sugar-fermenting capacity of the PTS-deficient strain RR745 confirmed that the H. influenzae PTS is fructose-specific. 3.7.2 Regulation of expression of the H. influenzae PTS Expression of the pts operon in enteric bacteria is positively controlled by both extracellular glucose and the intracellular cAMP concentration (48, 195). These regulatory mechanisms keep pts expression at a similar level under conditions of both high and low catabolite repression (174). It has been suggested that glucose-mediated transcriptional activation of the pts operon is controlled by the enteric EIICB G l c permease, based on the demonstration that transcription is enhanced by overexpression of EIICB G l c (but not by accumulation of intracellular glucose or glucose-6-phosphate) (49). Since H. influenzae lacks this PTS component, this regulatory mechanism is unlikely to be relevant to pts operon expression in this organism. The presence of two candidate CRP sites upstream of the pts operon suggests that expression of the H. influenzae pts operon may, however, be positively regulated by cAMP-CRP, although Gwinn et al. (82) showed constitutive expression 65 of both ptsl and err during growth under conditions in which intracellular cAMP levels are expected to rise. The fru operons of enteric bacteria are regulated by a repressor, FruR (also known as Cra, (178)), which binds fructose-l-phosphate and fructose as inducers. Analysis of the H. influenzae genome sequence revealed no FruR homologue, and the fruB promoter region does not contain sequences similar to palindromic FruR binding sites (179). Nonetheless, uptake of fructose by H. influenzae was shown to be fructose-inducible (Fig. 3.6) (134), suggesting that an as-yet uncharacterized repressor may substitute for FruR in this organism. Figure 3.6 Uptake of 1 4C-fructose by Haemophilus influenzae after growth on fructose, glucose or galactose Growth conditions and transport assays with 20uM substrate were conducted as described in Section 2.8.2. Transport experiments were conducted three times with independent cultures, and each experiment gave essentially similar results (+/-15%). Representative results are shown. 66 3.7.3 Evolution from a primordial fructose-specific PTS The fructose PTS is widespread among bacterial species (63) and fructose is the only sugar that feeds directly into glycolysis without conversion to another sugar (see Fig. 4.1). Many primitive photosynthetic, N2-fixing and heterotrophic bacteria possess a fructose-specific PTS, and the fructose regulon of enteric bacteria is the only one that encodes its own HPr-like protein. Sequence analysis and biochemical studies have demonstrated the relatedness of EII permeases, implying evolution from a common ancestral EII. H. influenzae joins species of Rhodospirilium, Rhodobacter (205), Pseudomonas (203), Streptomyces (242), Listeria (151), Thiocapsa, Thiocystis, Alcaligenes, Azospirillum and Fusobacterium (41) in being predicted to possess a PTS that only transports fructose, based on evidence from growth, sugar uptake and PEP-dependent phosphorylation studies (Fig. 3.7). Together, these observations support the contention of Saier et al. (197, 203, 206) that the primordial PTS was specific for fructose. Saier has proposed that exposure of the evolving bacterium to an increasingly complex nutritional environment may have favoured intragenic duplications, gene duplications and operon duplications which could allow evolution of a more complex PTS (203). Intragenic rearrangements and dissociation of domains by mutations creating nonsense codons could explain the domain-shuffling seen in otherwise homologous EII components (266). The discovery that the H. influenzae PTS contains a unique DTP component is consistent with this model: the duplicated HPr-like domain of DTP probably arose by a tandem intragenic duplication event at a time in evolutionary history after the enteric bacteria lineage branched off from that which gave rise to H. influenzae (Fig. 3.8) (193). 67 o CO CO CD > CD D I S S X CD w .<5 CD O CO p Ba CD'S CD o £ > CO £ ' w d O O Q ° o W § Low G Gram-Listeria Low G Gram-Listeria CO 0) o co o c CO >. O 3 Q. C o c CD CD cu 44 u ti X> 3 cu cfl Cfl CU C/3 ti CU Cfl q «S IH 44 o X OH cfl O DH u cu DH Cfi cu Cfl O 4 * 4 u 3 O 3 •rH Cfl CO 01 IH 3 60 • I H .B CU co « cj co cu 68 H. influenzae retains homologues of HPr and EIIA G l c (the latter required by E. coli for both glucose phosphorylation and adenylate cyclase activation), but lacks a homologue of ptsG, the E. coli gene that encodes the glucose-specific permease EIICB G l c. However, ptsG homologues have been .identified in Gram-positive bacteria such as Bacillus subtilis, as well as in other members of the (Gram-negative) Enterobacteriaceae (174). More recently, a ptsG homologue has been located in the unfinished genome sequence of Actinobacillus actinomycetemcomitans (72), member of the family Pasteurellaceae and close relative of H. influenzae. These observations imply that an early common bacterial ancestor possessed a PTS glucose permease, and that this permease has been lost latterly, after the divergence of the Enterobacteriaceae and Pasteurellaceae, as suggested (137). The glucose-specific E I I A G l c component has presumably been retained for its regulatory functions Figure 3.8 Divergence of the eubacterial lineages giv ing rise to the famil ies Enterobacteriaceae and Pasteurellaceae of the y proteobacteria This schematic phylogeny indicates divergence of lineages within the y subdivision of the proteobacteria (see Figure 3.7). It is based on a prokaryotic phylogenetic tree abstracted from the Ribosomal Database Project by Olsen et al. (163), derived by maximum likelihood analysis of small-subunit rRNA sequences from 253 representative species. Representative members of the families are listed. Branch lengths in this figure are not representative of the actual degrees of sequence divergence between groups. (Section 1.4.2). Ente robac te r i acaea Escherichia spp Salmonella spp. Klebsiella spp. Erwinia spp. Proteus spp. ...and others Aeromonas Pasteure l laceae Haemophilus spp. Pasteurella spp. Actinobacillus spp. P s e u d o m o n a d s 69 W h i l e t h i s d o e s n o t r e s o l v e the q u e s t i o n o f s p e c i f i c i t y o f the p r i m o r d i a l P T S , I s u g g e s t t ha t the e x i s t e n c e o f a s i m p l e f r u c t o s e - s p e c i f i c P T S i n th i s H. influenzae is the r e s u l t o f a d a p t a t i o n o f t h i s o r g a n i s m to a n u t r i t i o n a l l y - l i m i t e d n i c h e - h u m a n m u c o s a l s u r f a c e s ( S e c t i o n 7.2). 3.7.4 R e g u l a t o r y p o t e n t i a l o f the Haemophilus influenzae P T S T h e s c a r c i t y o f genes e n c o d i n g P T S p r o t e i n s i n the H. influenzae c h r o m o s o m e (0 .03% o f the 1743 p r e d i c t e d c i s t rons ) con t r a s t s w i t h the a b u n d a n c e ( 1 % o f c h r o m o s o m a l genes ) i n E. coli (193). F u r t h e r m o r e , H. influenzae l a c k s a h o m o l o g u e o f F r u R ( C r a ) , w h i c h p l a y s a c e n t r a l r o l e i n r e g u l a t i o n o f g l u c o n e o g e n e s i s i n e n t e r i c b a c t e r i a (178). T h e s e o b s e r v a t i o n s s u g g e s t tha t the P T S o f H. influenzae m a y p l a y a m u c h m o r e l i m i t e d r e g u l a t o r y r o l e t h a n the P T S o f e n t e r i c b a c t e r i a . S e v e r a l c o m p o n e n t s o f th is s i m p l e P T S m a y n e v e r t h e l e s s h a v e r e g u l a t o r y r o l e s . T h e p r e s e n c e o f a n E I I A G l c h o m o l o g u e d e s p i t e the a p p a r e n t l o s s o f a n E I I C B G l c p e r m e a s e s u g g e s t s tha t i t m a y h a v e b e e n r e t a i n e d as a r e g u l a t o r o f a d e n y l a t e c y c l a s e a n d / o r o t h e r e n z y m e s . It has b e e n s u g g e s t e d that the d u p l i c a t e d H P r - l i k e d o m a i n o f D T P m a y h a v e r e g u l a t o r y s i g n i f i c a n c e (193). F i n a l l y , the c e n t r a l M d o m a i n o f D T P s h o w s s o m e s e q u e n c e s i m i l a r i t y to r e c e i v e r d o m a i n s o f r e g u l a t o r c o m p o n e n t s of t w o - c o m p o n e n t s y s t e m s (266). T h i s d o m a i n is a b s e n t f r o m the e q u i v a l e n t f r u c t o s e M T P o f R. capsulatus, s u g g e s t i n g that i t is n o t e s s e n t i a l fo r f r u c t o s e t r a n s p o r t o r p h o s p h o r y l a t i o n , a n d the re fo re tha t i t w a s p r o b a b l y n o t p r e s e n t i n the p r i m o r d i a l P T S (266). T h i s d o m a i n i s a n o t h e r s i te o f p o t e n t i a l r e g u l a t o r y i n t e r a c t i o n s . 3.7.5 A w o r k i n g m o d e l o f the Haemophilus influenzae P T S B a s e d o n m o d e l s o f P T S - m e d i a t e d f ruc tose u p t a k e i n e n t e r i c b a c t e r i a (30, 174), I d e v e l o p e d a w o r k i n g m o d e l o f the H. influenzae P T S (134). I n i t , h i g h e n e r g y p h o s p h a t e i s t r a n s f e r r e d f r o m p h o s p h o e n o l p y r u v a t e to E n z y m e I, a n d t h e n v i a the 70 two domains of DTP to the E I I B ' B C F r u permease and finally to incoming fructose ('path V, Fig. 3.9). Since a glucose-specific PTS permease is absent, HPr and the glucose-specific regulatory component E I I A G l c appear to have no role in sugar uptake. Instead, these proteins were suggested to play a regulatory role: in the absence of fructose, phosphotransfer from PEP to fructose is blocked, and this blockage allows phosphotransfer via HPr to E I I A G l c ('path 2', Fig. 3.9). (See Section 4.6.3 for a discussion of mechanisms whereby E I I A Q c may be dephosphorylated even in the absence of fructose). As in enteric bacteria, the phosphorylated form of EIIA G l c is proposed to activate adenylate cyclase, causing cAMP levels to rise and CRP-dependent promoters to be induced. Fruc tose F i g u r e 3.9 A w o r k i n g m o d e l of Haemophilus influenzae P T S f u n c t i o n . 'Path 1' consists of EI, DTP and EII F r u, and catalyzes phosphorylation of fructose [by phosphotransfer from phosphoenolpyruvate (PEP)] and concomitant release of fructose-l-phosphate into the cytoplasm. In the absence of fructose, phosphotransfer to fructose halts, and 'Path 2' consisting of EI, HPr and EIIA G l c, causes phosphate to accumulate on EIIA G l c, whose phosphorylated form activates adenylate cyclase. 71 CHAPTER FOUR The Haemophilus influenzae PTS Regulates Intracellular cAMP Levels and Competence Development 4.1 Introduction 4.1.1 Intracellular cAMP levels regulate transcription of many genes The cyclic nucleotide cAMP is a central regulator of the response of enteric bacteria to different nutritional states; when complexed with its receptor protein, CRP, it mediates positive and negative transcriptional regulation of several hundred genes (22). In particular, this cyclic nucleotide is an important mediator of the phenomenon known as catabolite repression - the repression of numerous catabolic enzymes by glucose and other rapidly metabolizable substrates (249, 250). Early evidence for the role of cAMP in catabolite repression in bacteria was provided by Makman and Sutherland (139), who found that addition of glucose to the growth medium brought about a rapid loss of intracellular cAMP. Subsequently, it was shown that addition of exogenous cAMP could overcome glucose-induced catabolite repression (251). Numerous studies (91, 98, 100) have since demonstrated a correlation between intracellular cAMP concentrations and carbon source availability and/or growth phase: cAMP levels are low when easily metabolizable carbon sources are abundant, and higher when only less-preferred carbon sources are available. The rate of cAMP synthesis can vary over 100-fold, and cAMP levels increase in late exponential phase of culture growth (99, 167). Intracellular cAMP levels also peak sharply and transiently when cells are transferred to a nutrient-limited medium with low (<0.3mM) glucose (160). Such regulation of intracellular levels by nutritional signals means that a large number of cAMP-CRP-dependent genes are elevated in expression upon transition into starvation or stationary phase (142, 213, 258). Although most of the cited studies have been carried out in Salmonella 72 typhimurium or Escherichia coli, cAMP-mediated regulation has been reported in a number of enteric and nonenteric bacteria, including Haemophilus influenzae and its close proteobacterial relations Erwinia chrysanthemi, Klebsiella aerogenes, Klebsiella pneumoniae, Pseudomonas fluorescens, Vibrio cholerae, Vibrio fischerii and Vibrio parahaemolyticus (22). 4.1.2 The PTS regulates intracellular cAMP levels As discussed in Section 1.4.2, sugar transport by the bacterial phosphotransferase system is the primary signal regulating adenylate cyclase activity: E. coli ptsl and err strains make only 3% as much cAMP as wild-type strains (126) and adenylate cyclase activity in permeabilized E. coli cells is strongly inhibited by PTS carbohydrates (86, 168). Later experiments showed that EIIA G l c~P, the phosphorylated form of the PTS protein EIIA G l c, activates adenylate cyclase (65, 155, 181). The current consensus model of PTS-mediated regulation, deduced from results of these and other studies, proposes that in the presence of glucose, phosphotransfer proceeds from PEP to glucose via EI, HPr, EIIA G l c and EIICB G l c. In the absence of glucose, phosphate accumulates on EIIA G l c, and EIIA G l c~P activates adenylate cyclase (174) (Fig. 1.4, Section 1.4.2). Although glucose is the preferred substrate of enteric phosphotransferase systems, many PTS sugars are utilized in preference to non-PTS carbon sources because they cause a net dephosphorylation of EIIA G l c - either directly by competition for phosphotransfer from EIIA G l c, or indirectly because transport and phosphorylation of all other substrates via their respective EII permeases will result in dephosphorylation of HPr (174). In a similar way, if the PTS regulates adenylate cyclase activity in H. influenzae, fructose - the substrate of this PTS - might be expected to cause dephosphorylation of the H. influenzae EIIA G l c homologue, and prevent activation of adenylate cyclase in this organism. Experiments described in 73 this chapter were designed to examine whether the H. influenzae. PTS regulates adenylate cyclase activity and intracellular cAMP levels in response to fructose availability, thereby regulating utilization of less-preferred carbon sources (Section 4.2) and competence development (Section 4.3). I also describe an analysis of candidate regulatory sequences in the promoter regions of competence-associated genes which may render these genes sensitive to cAMP-CRP-mediated transcriptional activation. 4.2 T h e Haemophilus influenzae P T S r e g u l a t e s c a r b o n s o u r c e u t i l i z a t i o n Phosphotransferase systems of enteric bacteria effectively mediate a hierarchy of preferred carbon sources. Firstly, preference among PTS carbohydrates is mediated via competition of the various Ells for phosphorylated HPr (194, 197a). Secondly, the PTS only activates adenylate cyclase in the absence of glucose or other PTS-transported sugars, and thus cAMP-CRP dependent operons are not expressed when PTS-transported sugars are available. This, in combination with EIIAGlc-mediated exclusion of certain catabolic operon inducers, comprises the phenomenon known as 'PTS-mediated repression' (174). If the simple H. influenzae PTS is capable of regulating adenylate cyclase activity, it might also play a role in mediating carbon source utilization in this organism, depending on the presence or absence of its PTS substrate, fructose. Based on the working model of this PTS (Fig. 3.9), I predicted that mutations preventing formation of EIIA G l c~P should render mutant strains incapable of utilizing cAMP-dependent carbon sources. Moreover, according to this model, DTP and EIIB'BC F r u are not involved in phosphotransfer to EIIA G l c. Mutations in genes specifying these components (fruB or fru A, respectively) should not affect fermentation of cAMP-dependent sugars, but should make these strains insensitive to fructose-induced PTS-mediated repression. 74 Table 4.1 Haemophilus influenzae genes for uptake and catabolism of sugars HI# Gene Product Fructose 0446 fruA EIIB'BC F r u permease 0447 fruK 1-phosphofructokinase 0448 fruB diphosphoryl transfer protein (DTP) Galactose 0819 galK galactokinase 0820 galT galactose-l-phosphate uridylyl transferase 0821 galS gal operon repressor 0822 mglB D-galactose binding protein 0823 mglA methyl-galactoside permease ATP-binding protein 0824 mglC MglC protein Ribose 0501 rbsD high affinity ribose transport protein 0502 rbsA high affinity ribose transport protein 0503 rbsC high affinity ribose transport protein 0504 rbsB periplasmic ribose binding protein 0505 rbsK ribokinase 0506 rbsR rbs repressor 0464 rpiA ribose phosphate isomerase (25) 0566 dod D-ribulose-5-phosphate 3-epimerase Xylose 1106 xylR xylose operon regulatory protein 1109 xylH xylose transport permease protein 1110 xylG D-xylose transport ATP-binding protein 1111 xylF D-xylose binding periplasmic protein 1112 xylA xylose isomerase 1113 xylB xylulose kinase 1023 tktA transketolase 75 T a b l e 4.1 C o n t i n u e d H I # G e n e P r o d u c t F u c o s e 0610 fucP L-fucose permease 0611 fucA fuculose-l-phosphate aldolase 0612 fucll fucose operon protein 0613 fucK fucokinase 0614 fuel L-fucose isomerase 0615 fucR L-fucose operon activator 0499 aldH aldehyde dehydrogenase G l u c o s e 0144 glk glucose kinase (Streptomyces coelicor) 0488 putative phosphoglucomutase S i a l i c A c i d 0140 nagA N-acetylglucosamine-6-phosphate deacetylase 0141 nagB glucosamine-6-phosphate deaminase 0142 nan A N-acetylneuraminate lyase 1104 nanT sialic acid permease (25) G l y c e r o l 0683 glpC glycerol-3-phosphate dehydrogenase, subunit C 0684 glpB glycerol-3-phosphate dehydrogenase, subunit B 0685 glpA glycerol-3-phosphate dehydrogenase, subunit A 0686 glpT glycerol-3-phosphate transporter 0690 glpF glycerol uptake facilitator 0691 glpK glycerol kinase 1009 glpR glycerol-3-phosphate regulon repressor All identifications are to E. coli homologues, and were made by Fleischmann et al. (66), unless otherwise noted. 76 4.2.1 Sugar fermentation by wild type Haemophilus influenzae Before investigating the role of the H. influenzae PTS in regulating utilization of different carbon sources, I tested wild type cells for the ability to ferment a broad range of sugars, using a qualitative phenol red broth (PRB) assay (Section 2.8.1). Fructose, fucose, sialic acid (N-acetyl neuraminic acid) and glycerol gave positive results, as did the previously-tested glucose, ribose, galactose, and xylose (54,110). Comparison with the sugar-fermenting capabilities of cya and crp strains showed that fermentation of the sugars ribose, galactose, fucose and xylose is dependent on cAMP-CRP (54) (Table 3.2). A large number of other sugars were not fermented by wild-type cells: lactose, deoxyribose, maltose, mannose, arabinose, sucrose, glucose-6-phosphate, sorbitol, mannitol, inositol, erythritol, galactosamine, glucosamine, mannosamine, N-acetylgalactosamine, N-acetylglucosamine, glucoronic acid, glucoronic acid, methyl-a-glucoside and methyl-f3-glucoside. Analysis of the H. influenzae genome sequence (137) confirmed that the necessary genetic information is present for use of the fermented sugars, and absent (or unrecognizable) for the others (Table 4.1). i) Fructose The role of the H. influenzae PTS in transportation of fructose has been discussed (Section 3.3.2). The product of PTS-mediated fructose transport (fructose-1-phosphate) is phosphorylated to fructose-l,6-bisphosphate and fed directly into the glycolytic pathway (Fig. 4.1). ii) cAMP-dependent sugars: galactose, ribose, xylose, fucose H. influenzae has homologues of genes for the high affinity mgl galactose uptake system (85, 200), but not for the galP low affinity system (138). These lie adjacent to the galTK genes whose products carry out galactose catabolism (219). Galactose may 77 GALACTOSE .mglABC RIBOSE rbsABCD Figure 4.1 Pathways of sugar catabolism in Haemophilus influenzae Sugar-specific genes are described in Table 4.1. Genes of the glycolytic pathway are as follows: IctD, L-lactate dehydrogenase (HIM739); gapdH, glyceraldehyde-3-phosphate dehydrogenase (HI#0001); pgk, phosphoglyrate kinase (HI#0525); eno, enolase (HI#0932); pykA, pyruvate kinase (HIM573); tpiA, triose phosphate isomerase, (HI#0678); fba, fructose bisphosphate aldolase (HI#0524); pfkA, 6-phosphofructokinase (HI#0982); pgi, glucose-6-phosohate isomerase (HIM576) (66,72). 78 also enter the bacterial cell via one or more cAMP-independent glucose permeases (88), which could explain the intermediate levels of fermentation of this sugar by cya mutants (Table 3.2). H. influenzae has homologues of the inducible high affinity E. coli ribose (5) and xylose (199) uptake systems, as well as a full complement of catabolic genes. Lastly, H. influenzae contains a complete set of fucose uptake and catabolism genes (27). Associated with the genes for uptake and metabolism of each sugar is a gene for a sugar-specific repressor or activator, which links gene expression to presence of the appropriate substrate. Potential CRP sites with at least 11 and as many as 17 matches to the 22bp E. coli CRP consensus binding site were identified near promoters for genes of these cAMP-dependent sugar utilization operons (upstream from xylA (HI#1112), rbsD (HI#0501), mglB (HI#0822) and fucR (HI#0615)) (Table 4.2). CRP is predicted to have high affinity for all of these sites, using the method of Stormo and Hartzell (236) which calculates a relative binding protein affinity score for a given DNA sequence (for detailed explanation, see Section 4.5). iii) cAMP-independent sugars and carbohydrates: glycerol, glucose, sialic acid Although H. influenzae lacks the PTS glucose permease, it has been shown to take up glucose, phosphorylate it via an ATP-dependent kinase (Section 3.6.2) (134) and feed it into central metabolism (Fig. 4.1). As in E. coli, the Mgl system for galactose uptake may also transport glucose (50), and indeed, some inhibition of galactose uptake by glucose has been observed in H. influenzae (134). However, the cAMP-independence of glucose fermentation argues for additional as yet unidentified uptake mechanisms, as has been postulated for E. coli (50). 79 Table 4.2 Putative CRP-binding sites for Haemophilus influenzae sugar catabolic operons CRP site Associated 5' end Base Sugar in Genome Sequence 3 Score dseqP E. coli consensus (22) xylA (HI#1112) mglB (HI#0822) rbsD (HI#0501) fucR (HI#0615) AAATGTGATNTANATCACATTT xylose 1177197 AACTGTGGCGTGGATCACAGTT 15.54 galactose 872810 AmGTGACATGGATCACAAAT 21.09 ribose 517340 TTTTGTGATCAATATCCCAAAT 15.60 fucose 647650 TTTTGJGAGTTTCTTTTCAAGA 6.00 a Underlining highlights identities with the E. coli consensus. D See Section 4.5. Score for each putative site was calculated using the matrix shown b=22 in Table 4.4, and represents relative CRP affinity for the site. Iseq = I > , where Ifr 6=1 represents the information content score for each base in the sequence (236). H. influenzae has the glpF gene whose product in E. coli facilitates diffusion of glycerol across the cell membrane. glpT, encoding a transporter for glycerol-3-phosphate is also present. Moreover, a complete glycerol operon (129) allows glycerol to be fed directly into the glycolytic pathway (Fig. 4.1). H. influenzae ferments free sialic acid (N-acetylneuraminic acid, NANA). A sialic acid permease was overlooked in the original gene assignments, but the hypothetical HI#1104 protein has been found to have significant sequence similarity to the E. coli sialic acid permease encoded by nanT (25, 141). N-acetylneuraminate lyase (encoded by nanA) is present and would yield pyruvate and N-acetylmannosamine; the latter is probably phosphorylated and converted to N-acetylglucosamine-phosphate by an as yet unidentified epimerase (epimerases with 80 this activity have been purified from Aerobacter cloacae, E. coli and Clostridium perfringens (255), but not yet sequenced). N-acetylglucosamine phosphate can then be further metabolized to fructose-6-phosphate by sequential action of a deacetylase (nagA encoded) and a deaminase (nagB encoded). 4.2.2 Sugar fermentation by strains lacking components of the PTS I used quantitative phenol red broth assays (Section 2.8.1) to investigate the role of the H. influenzae PTS in regulation of sugar uptake and utilization. During anaerobic fermentation by bacteria, sugars are oxidized at the expense of NAD +. To maintain glycolytic flux, the N A D + is regenerated by depositing the reducing equivalents on partially oxidized metabolic intermediates which are then excreted from the cell, increasing the acidity of the culture medium. Fermentation of different sugars generates different amounts of N A D H + H +, such that pH change of the medium is sugar-specific. I did not compare relative pH change for different sugars, but instead used this assay to follow fermentation-induced pH change for each sugar for each strain tested. I found that overnight pH change for each sugar and strain was consistent and reproducible. The pH of a wild-type (KW20) overnight culture in phenol red broth with no sugar added was 7.6 ± 0.2. Overnight pH for KW20 phenol red broth cultures supplemented with 1% sugars were as follows: Fructose, 5.9 ± 0.1; Glucose, 5.3 ± 0.1; Fucose, 6.0 ± 0.1; Xylose, 5.4 ± 0.1; Ribose, 5.4 ± 0.1; Galactose, 5.6 ± 0.2. i) Fructose As predicted, strains lacking the central phosphotransfer protein Enzyme I, the fructose permease EIIB'BC F r u or the fructose-specific phosphotransfer protein DTP were essentially unable to ferment fructose (Fig. 4.2). In each case, ability to ferment fructose was complemented by introduction of the wild-type gene on an 81 intermediate copy-number plasmid, but not by addition of cAMP (data not shown) confirming that fructose is directly transported by the PTS. Strain RR801, lacking EIIA G l c, ferments fructose as well as wild-type cells (Fig. 4.2), supporting the proposition that this component has no role in fructose uptake. Because I predicted that the HPr-like domains of the PTS component DTP should complement a HPr-deficiency, I was surprised to discover that the H. influenzae ptsH strain RR817 was essentially unable to ferment fructose (Fig. 4.2). The implied dependence on HPr for fructose uptake even in the presence of DTP is consistent, however, with early observations that HPr-deficient strains of E. coli and S. typhimurium grow more slowly than wild-type strains on fructose (208). Although studies in enteric bacteria (70, 71, 208, 209) have found that HPr and HPr-like domains of fructose-specific phosphotransfer proteins are functionally redundant, the fructose-negative phenotype of strain RR817 suggest that HPr plays the central role in phosphotransfer from EI to the EIIA F r u domain, and that DTP-catalyzed phosphotransfer from EI to EIIA F r u is insufficient for fructose uptake. (Uptake studies with labelled sugar might, however, reveal a low level of fructose uptake by this strain (M.H. Saier, Jr., personal communication)). ii) cAMP-dependent sugars As predicted, strains lacking fructose-specific components of the PTS can ferment cAMP-dependent sugars at wild-type levels, since these strains are still capable of phosphorylating EIIA G l c. Strains lacking Enzyme I or EIIA G l c, however, were unable to ferment the cAMP-dependent sugars ribose and galactose (Fig. 4.2). Fermentation was restored by addition of ImM cAMP or by introduction of the relevant wild-type gene on an intermediate copy-number plasmid (data not shown) confirming that the H. influenzae PTS regulates intracellular cAMP levels. 82 X C L < CD CL c o c CD E CD L L ca D) 3 100-5 0 -0 WT ptsl ptsH err fruB fruA 100-5 0 -0 WT ptsl ptsH err fruB fruA 100-50-o-ll I r n WT ptsl ptsH err fruB fruA 100-50 0 4 WT pte/ pteAV err frt/B frtv>A 100-5 0 -0 -WT ptsl ptsH err fruB fruA missing enzyme CL X < Lu CL Q 3 L L O CQ m Fructose Ribose Galactose Xylose Fucose F i g u r e 4.2 F e r m e n t a t i o n o f sugars b y Haemophilus influenzae pts a n d fru s t r a i n s Strains were cultured overnight in supplemented phenol red broth plus 1% of test sugar as described in Section 2.8.1. pH of each culture was measured and the pH change (ApH) calculated. Degree of sugar fermentation by mutant strains was expressed as a percentage of wild-type ApH (which is set at 100%). Mean values from three replicates are shown. Error bars represent standard error mean (SEM). 83 T h e l e s s s e v e r e p h e n o t y p e o f err d i s r u p t i o n , c o m p a r e d to tha t o f ptsl d i s r u p t i o n ( a n d see a s i m i l a r effect o n c o m p e t e n c e , F i g . 4.4) m i g h t re f lec t a r o l e fo r n o n -p h o s p h o r y l a t e d E I I A G l c as a n i n h i b i t o r o f a d e n y l a t e c y c l a s e (127, 155, 175) ( c o m p l e t e l a c k o f E I I A G l c i n s t r a i n R R 8 0 1 w o u l d the re fo re r e l i e v e th i s i n h i b i t i o n , b u t i n a ptsl s t r a i n , E I I A G l c c o u l d s t i l l i n h i b i t a d e n y l a t e cyc l a se ) . A l t e r n a t i v e l y , o r i n a d d i t i o n , err d i s r u p t i o n m i g h t r e l i e v e E I I A G l c - m e d i a t e d e x c l u s i o n o f i n d u c e r s o f the gal a n d rib o p e r o n s , a n d p e r m i t u p t a k e o f these s u g a r s . W i l d - t y p e f e r m e n t a t i o n o f r i b o s e a n d g a l a c t o s e b y the ptsH s t r a i n R R 8 1 7 i m p l i e s that the H P r - l i k e d o m a i n s o f D T P c a n m e d i a t e p h o s p h o t r a n s f e r f r o m E I to E I I A G l c e f f i c i e n t l y e n o u g h to a l l o w f o r m a t i o n o f a c t i v e p h o s p h o r y l a t e d E I I A G l c ( w h i c h c a n a c t i v a t e a d e n y l a t e c y c l a s e ) , e v e n t h o u g h these H P r - l i k e d o m a i n s m a y n o t be a b l e to c a t a l y z e the i n t e r n a l p h o s p h o t r a n s f e r to the E I I A F r u d o m a i n o f D T P r e q u i r e d fo r f r u c t o s e u p t a k e a n d p h o s p h o r y l a t i o n (see a b o v e ) . P e r h a p s the o b s e r v e d d u p l i c a t i o n o f the H P r d o m a i n o f H. influenzae's D T P c o m p o n e n t (193) h a s f o r c e d D T P i n t o a n e w c o n f o r m a t i o n i n w h i c h i n t e r n a l p h o s p h o t r a n s f e r c a n n o t t a k e p l a c e . W i l d - t y p e f e r m e n t a t i o n o f the c A M P - d e p e n d e n t s u g a r s x y l o s e a n d f u c o s e b y a l l H. influenzae pts s t r a i n s t e s ted ( F i g . 4.2), b u t n o t b y cya o r crp s t r a i n s ( T a b l e 3.2), s u g g e s t s tha t e x p r e s s i o n o f c a t a b o l i c o p e r o n s fo r x y l o s e a n d f u c o s e r e q u i r e s l o w e r i n t r a c e l l u l a r c A M P c o n c e n t r a t i o n s t h a n are n e e d e d fo r e x p r e s s i o n o f r i b o s e o r g a l a c t o s e c a t a b o l i c o p e r o n s . T h i s r e l a t i v e r e q u i r e m e n t fo r c A M P ( r i b o s e > f u c o s e > x y l o s e ) w a s c o n f i r m e d b y t i t r a t i n g the cya s t r a i n R R 6 6 8 w i t h c A M P a n d a s s a y i n g s u g a r f e r m e n t a t i o n ( F i g . 4.3). D i f f e r e n t i a l c A M P r e q u i r e m e n t s for e x p r e s s i o n o f v a r i o u s g e n e s a n d o p e r o n s i s w e l l - e s t a b l i s h e d (114, 131, 239) a n d is m e d i a t e d i n p a r t b y D N A s e q u e n c e o f r e g u l a t o r y s e q u e n c e s i n t h e i r p r o m o t e r s : a f f i n i t y o f the C R P - c A M P c o m p l e x for C R P -b i n d i n g s i tes d e p e n d s o n the i r d e g r e e o f s e q u e n c e s i m i l a r i t y to the b i n d i n g s i te c o n s e n s u s s e q u e n c e (see 22 a n d re fe rences the re in ) . T h e t h e o r e t i c a l C R P a f f i n i t y 84 scores calculated for candidate CRP-binding sites of H. influenzae sugar catabolic operons (Table 4.2) do not, however, correlate simply with observed cAMP sensitivity. Since such theoretical CRP affinity scores appear to reflect real affinities (Section 4.5.2), this suggests that factors such as inducer exclusion and derepression by inducers may also contribute to the regulation of transcription of these operons. Nonetheless, these data imply that, as in enteric bacteria, adenylate cyclase is not completely inactive in the absence of PTS-mediated activation (22). Galactose Xylose Fucose Ribose CAMP (mM) Figure 4.3 Sugar fermentation by RR668 (cya) in the presence of increasing concentrations of exogenous cAMP Strains were cultured overnight in supplemented phenol red broth plus 1% of test sugar and cAMP, as described in Section 2.8.1. pH of each culture was measured and the pH change (ApH) calculated. Degree of sugar fermentation by mutant strains was expressed as a percentage of wild-type ApH (which is set at 100%). Mean values from three replicates are shown. Error bars represent standard error mean (SEM). 85 4.2.3 PTS-mediated repression of non-PTS sugar utilization by xylitol As described in Sections i.4.2 and 4.1.2, phosphotransferase systems of enteric bacteria prevent utilization of non-PTS carbon sources when PTS-transported sugars are available, via a combination of EIIA G l c-mediated inhibition of adenylate cyclase and exclusion of certain catabolic operon inducers. The effect of PTS sugar availability on fermentation of non-PTS sugars by enteric bacteria has been studied through the use of PTS sugar analogues that are recognized, transported and phosphorylated by specific PTS permeases but which are not metabolized. Any fermentation detected is thus the result of fermentation of the non-PTS sugar under test. The analogue methyl-a-glucoside can substitute for glucose (209), while the analogue xylitol can substitute for fructose (247). Neither analogue is fermented by enteric bacteria, but both have affinity for their respective PTS permeases. I confirmed that these analogues are also not fermented by H. influenzae (data not shown). To determine whether fructose or glucose cause PTS-mediated repression in H. influenzae, I carried out phenol red broth fermentation assays of wild type cells, using 1-10% of the analogues xylitol or methyl-a-glucoside in combination with the sugars glucose, fucose, ribose or galactose. (The cAMP-dependent sugar xylose was not tested, since xylitol is a competitive inhibitor of xylose uptake (225)). 1-10% lactose, a sugar which is not transported or metabolized by H. influenzae, replaced the analogues in negative control assays. (Although these analogue concentrations are high, culture growth was not significantly affected - OD600 measurements of overnight cultures indicated that all had reached a stationary phase density.) Sugar utilization by KW20 was unaffected by the presence of up to 10% methyl-a-glucoside or lactose. In contrast, 5% and 10% xylitol prevented utilization of all the above sugars except glucose, and this effect was overcome by addition of ImM or 5mM cAMP (Table 4.3). 86 CD rt H 60 CD 60 Cfi CU »H PH P4 O X o X o X ID CU cn O .*-» u rt o cu C o c < O CD 1$, m l + 15, cu o Z Q + + + + i + Q Z Q z I + + z I + + Q Z + + to O -t-» u 3 cu o *"H "1 UH PH + cu O 4-t O "rt u + + cu o o PH QJ o O I—( u o 3 to rt Hi rt /-) bC 2 W QJ QJ -< rt d Q QJ -a £ £ ~ »H C rt H-» QJ IO <+H O O u QJ 1/3 QJ TJ > O J_< > o aj b QJ C/l H Hi rt 3 5 *H - 3 QJ QJ 4! £ ^ QJ TJ • i-H C/3 O 3 00 CN o box! * u o cu JH CD -a TJ I I r-H Ifl O QJ X « ^ CD bOP-H " TJ QJ c o rt H-» c QJ VH QJ QJ O I/) QJ Hi •4—> u QJ bo rt VH O bO ^ .a QJ v £ -2 + DH P H ^ QJ OH J- • ^ d o tJ QJ in .-H QJ O rt E1 O TJ ^ TJ O TJ r-H rt QJ VH QJ 4-» QJ TJ 87 Moreover, the fruB strain RR798 (lacking the E I I A F m domain essential for phosphotransfer to fructose/xylitol) was resistant to repression of ribose or galactose fermentation by 10% xylitol (not shown). These findings suggest that the H. influenzae PTS, like its E. coli counterpart, has two functions: in addition to directly transporting sugar, it controls expression of cAMP-dependent operons by regulating intracellular cAMP levels according to the availability of its substrate, fructose. 4.3 The Haemophilus influenzae PTS regulates competence development Competence development is absolutely dependent on cAMP. If the PTS is the primary regulator of adenylate cyclase activity under all conditions, then mutations preventing formation of EIIA G l c~P should prevent or reduce competence development. Mutations disrupting PTS components whose only role is phosphotransfer to fructose (DTP and EIIB'B.CFru) should have little or no effect on competence. Since the fructose analogue xylitol caused PTS-mediated repression of cAMP-dependent sugar utilization, I predicted that fructose should repress competence development by wild-type cells. Strains lacking the fructose specific PTS components DTP or EIIB'BC F r u should, however, be resistant to repression of competence by fructose. 4.3.1 Development of competence under nutrient-limitation or anaerobiosis by PTS-deficient strains To investigate the role of the PTS in regulation of competence under nutrient-limited conditions, strains carrying mutations in genes encoding PTS components were transferred to the nutrient-limited medium MIV, which lacks the amino acids, cofactors and carbon source required for growth. Transformation frequency was 88 assessed as described (Section 2.7.2). Competence of these strains was also assessed after a period of anaerobic growth (Section 2.7.3). Strains lacking Enzyme I or EIIA G l c showed a ~100-fold reduction in competence under nutrient-limited conditions (MIV medium) (Fig. 4.4), reaching levels of competence similar to those reached by wild-type cells in late exponential phase growth in rich medium (sBHI). After transient anaerobiosis, these strains developed only -10% of the competence levels of wild-type cells (data not shown), as reported by Gwinn et al. (82). The ptsH fruB strain RR823, lacking all HPr and HPr-like domains, developed 10-fold lower MlV-induced competence than either of its parental strains (Fig. 4.4), confirming the partial redundancy of HPr and the HPr-like domains of DTP. Under both conditions, wild-type levels of competence were restored to all of these strains by addition of ImM cAMP. As expected, strains lacking the fructose-specific components DTP or EIIB'BC F r u showed only a very modest (4-fold) reduction in starvation-induced competence (Fig. 4.4), and this reduction was not overcome by addition of cAMP. In fact, addition of ImM cAMP to these strains decreased competence even further (Fig. 4.4). These and other findings (Section 5.4.2) suggest that these strains have elevated intracellular levels of cAMP and that excess cAMP can inhibit expression of cAMP-CRP-dependent genes. This idea is explored further in Chapter 5. These data suggest that PTS-mediated regulation of adenylate cyclase activity in turn regulates competence under conditions of nutrient limitation, and in anaerobiosis. 4.3.2 Spontaneous competence development in rich medium by PTS-deficient strains Strains lacking adenylate cyclase or CRP are completely deficient in competence throughout growth in rich medium. Competence of strains lacking Enzyme I or EIIA G l c was assessed under these conditions, with the expectation that they should 89 also develop reduced levels of competence under these conditions. Surprisingly, these mutant strains developed essentially wild-type levels of competence (Fig. 4.5), suggesting either that regulation of adenylate cyclase by phosphorylated EIIA G l c of the PTS is not significant during growth in rich medium, or that reduced but non-zero levels of cAMP produced by these strains are sufficient for competence development under these conditions. • MIV H M I V + I m M c A M P 10-2 WT ptsl ptsH err fruB fruA fruB fruB ptsH ar missing E l HPr EIIAG l c DTP EIIB'BC EIIB'BC DTP enzyme HPr EIIAG l c Figure 4.4 Competence of pts and fru strains after transfer to nutr ient-l im i ta t ion Early exponential-phase cells were transferred to MIV nutrient-limited medium, and maximal transformation frequency measured at 100 minutes post-transfer, as described in Section 2.7. Mean values from three replicates are shown. Error bars represent standard error mean (SEM). 90 1CT3 1 — i i r 100 200 300 Time (Mins.) Figure 4.5 Spontaneous competence development in r ich medium by Haemophilus influenzae pts strains Cultures were sampled at time intervals during growth in supplemented brain heart infusion medium, and transformation frequency assessed as described in Section 2.7. Competence experiments were repeated three times, and each experiment gave essentially similar results. Representative data are shown. 91 4.3.3 cAMP-dependence of competence under different conditions To determine whether competence levels are dependent on similar intracellular cAMP levels in both rich medium and nutrient-limited medium, I assessed competence of the cya strain RR668 in MIV and in sBHI supplemented with increasing amounts of cAMP (Fig. 4.6). In both media, competence increased as cAMP concentrations increased, within the 0 - 500 uM range. Within this range, cells in MIV are 5 - 50-fold, more competent than cells in sBHI with the same concentration of cAMP. This suggests that cells in MIV have a more extreme competence development response to cAMP than late exponential phase cells in rich medium. 4.3.4 Regulation of adenylate cyclase in PTS-disrupted strains Strains lacking Enzyme I or EIIA G l c have a competence deficiency under starvation conditions, but nevertheless reach levels of competence 10,000-fold higher than cya and crp strains (Fig. 4.4). This implied that adenylate cyclase is partially active in these strains under nutrient-limited conditions. This may represent a basal uninduced level of adenylate cyclase activity, or adenylate cyclase may be activated in these strains by other regulatory factors. To test whether the IIA F r u domain of DTP might function analogously to EIIA G l c and participate in activation of adenylate cyclase, strain RR810, lacking both these domains, was constructed. This strain developed similar levels of competence to err and ptsl strains (Fig. 4.4), implying that the IIA F r u domain is not regulatory. This suggests that in ptsl and err strains, residual regulation of adenylate cyclase activity in nutrient-limitation or anaerobiosis is not mediated by a phosphorylated PTS EIIA F r u domain. 9 2 < cu O 4-> OH CU CH £ 12 P H »H H-» in jS cj CU W u-1 it CU p/j AOU) Aouenbejj UOJIBUJJOJSUBJI 93 4.3.5 PTS-mediated repression of competence by fructose The experiments described in Section 4.2.2 demonstrated that the H. influenzae PTS can regulate cAMP-dependent processes (in that case, catabolic gene expression) according to the availability of its substrate, fructose, as predicted by the working model of this PTS. I therefore predicted that addition of fructose to competence-inducing medium (MIV) should inhibit development of competence by wild-type H. influenzae, and that mutant strains incapable of transporting or phosphorylating fructose or (de)phosphorylating EIIA G l c should be resistant to this inhibition. I found that supplementation of MIV medium with 8% fructose caused a ~10-fold inhibition in the development of normal competence.by early-exponential phase wild-type H. influenzae cells. The same concentration of fructose, however, caused lesser but reproducible (between 2- and 6- fold) inhibition of competence development by various PTS-disrupted strains (Fig. 4.7). On the other hand, the presence of 0.5% fructose in rich medium had no effect on development of spontaneous competence in late exponential phase by wild-type cells (not shown). These data are difficult to interpret, and may be obscured by osmotic effects of such non-physiological fructose concentrations (human serum fructose levels have been measured at <0.002% (256)). While suggestive of a PTS-mediated response to fructose, these observations also imply that fructose may not be the significant environmental signal recognized by the PTS. It is also possible that the partially-disrupted PTS of different mutant strains is still capable of regulating adenylate cyclase activity (see Section 4.6.3 for discussion). 94 I MIV medium WT ptsl err fruB fruA fruB ptsH F i g u r e 4.7 I n h i b i t i o n of M l V - i n d u c e d c o m p e t e n c e b y f r u c t o s e E a r l y e x p o n e n t i a l p h a s e ce l l s g r o w i n g i n r i c h m e d i u m w e r e t r a n s f e r r e d to M I V m e d i u m s u p p l e m e n t e d w i t h 8% f r u c t o s e , a n d t r a n s f o r m a t i o n f r e q u e n c y w a s a s ses sed at 100 m i n u t e s p o s t t rans fe r as d e s c r i b e d i n S e c t i o n 2.7. M e a n d a t a f r o m three r e p l i c a t e s are s h o w n . E r r o r b a r s r e p r e s e n t s t a n d a r d e r r o r o f the m e a n ( S E M ) . 4.4 c A M P - d e p e n d e n t p-galactosidase e x p r e s s i o n b y s t r a i n s c a r r y i n g a c A M P re p o r t e r c o n s t r u c t W i l d - t y p e c o m p e t e n c e l e v e l s i n d u c e d b y t r ans fe r to n u t r i e n t - l i m i t e d m e d i u m ( M I V ) or b y a n a e r o b i o s i s are 1 0 0 - f o l d h i g h e r ( T F m a x o f ~ 1 0 - 2 ) t h a n m a x i m a l c o m p e t e n c e l e v e l s t ha t d e v e l o p s p o n t a n e o u s l y i n la te e x p o n e n t i a l p h a s e g r o w t h i n r i c h m e d i u m ( T F m a x o f ~ 1 0 ' 4 ) . R e s u l t s f r o m S e c t i o n 4.3 s u g g e s t tha t P T S - m e d i a t e d a c t i v a t i o n o f a d e n y l a t e c y c l a s e i s r e q u i r e d fo r m a x i m a l M l V - i n d u c e d c o m p e t e n c e , b u t n o t f o r the 95 lower levels of competence reached in rich medium. The simplest model derived from these observations is that intracellular cAMP levels are higher in anaerobiosis or starvation than in late exponential phase growth. However, experiments described in Section 4.3.3 (Fig. 4.6) suggest that cultures can develop different levels of competence in the presence of similar cAMP concentrations, depending on their nutritional environment (nutrient-limited or rich medium). In order to clarify the relationship between intracellular cAMP concentration and maximal competence under different conditions, I required a means of quantifying intracellular cAMP concentrations, independent of competence. As discussed (Section 3.4), attempts to measure intracellular H. influenzae cAMP levels directly have been unsuccessful (R.J. Redfield, unpublished data). Instead, I developed a /acZ-based cAMP reporter system in which changes in intracellular cAMP levels are reflected in changes in (3-galactosidase expression. Transcription of the E. coli lac operon is positively regulated by the cAMP-CRP complex, and several studies (62, 91, 98) have shown a correlation between intracellular cAMP concentration and (3-galactosidase expression. The pWB300-derived reporter construct carries the E . coli lacZ gene, preceded by a pseudo-wild-type promoter containing a CRP-binding sites, but deleted for the major Lad repressor binding site (operator site lacOl, which begins 8bp downstream of the -10 box of the lacZ promoter) (123) (17) (Fig. 4.8 and Section 2.5). The H. influenzae CRP shows 87% similarity (77% identity) to its E . coli homologue, and the single amino acid change in the DNA-binding helix-turn-helix domain is at a position predicted to be unimportant for DNA-binding (262). Moreover, Chandler (28) has demonstrated that the E . coli crp gene can complement an H. influenzae crp strain. The H. influenzae CRP-cAMP complex is therefore predicted to bind and activate transcription from this E . coli lac promoter, and (3-galactosidase expression should provide a relative measure of intracellular cAMP-CRP complex concentrations under different conditions or in the presence of different mutations. 96 JS < C_J C_J C_J < U < < 2 t 'to ^ CO l«J . £ I— ~u Q. cr o C_J < < I -CA 3 o o 01 M o a, <u «3 u cu CA « u <s QJ '55 <3 .S3 rN u 8 ,3 OJ u 3 •a CA -a 3 OS OJ o 3 ai 3 CT1 OJ CA M 0) H-> o s o PH 00 OJ 3 60 •i-i UH \n 3 to *H „, V 1 o 22 c» 97 4.4.1 Expression of lacZ in reporter strains is dependent on cAMP The reporter cassette was inserted as a single copy into the nonessential xylF gene in the naturally lacZ~ \acl~ H. influenzae KW20 chromosome (Section 2.5). Both lacZ+ . reporter strains (RR802 and RR828) grow with wild-type doubling times and develop wild-type levels of competence (data not shown). In an otherwise wild-type background, B-galactosidase activity was found to be low in early exponential growth in rich medium, and to increase in late exponential phase and stationary phase (Fig. 4.9). This pattern of increase in B-galactosidase expression parallels wild-type patterns of competence development by H. influenzae, and patterns of intracellular cAMP increase during exponential growth of E. coli (167). After transfer to the nutrient-limited medium MIV, B-galactosidase activity in the reporter strain RR828 peaks sharply at 100 minutes, coincident with maximal competence levels (Fig. 4.10). Expression of B-galactosidase under both sets of conditions was greatly decreased by mutations in cya or crp. B-galactosidase activity was increased roughly ten-fold under both conditions by overexpression of the E. coli crp gene from plasmid pXN15 (28) (not shown). These data confirm that expression of lacZ from the reporter construct is regulated by the CRP-cAMP complex, and suggest that, as in enteric bacteria, cAMP levels rise at entry into stationary phase of growth in rich medium, or on transition to starvation. 98 10 _, — 1 J 0.1 100 200 Time (Mins.) 300 F i g u r e 4.9 B-Galactosidase e x p r e s s i o n f r o m r e p o r t e r s t r a i n s i n r i c h m e d i u m Cultures were sampled at time intervals during growth in supplemented brain heart infusion medium, and p-galactosidase activity assessed as described in Section 2.9. Assays were repeated three times with independent cultures, and each gave essentially similar results. Representative data are shown. 99 14 1 Time After Transfer to MIV (Mins.) Figure 4.10 B-Galactosidase expression from the facZ-based reporter cassette in different genetic backgrounds Early exponential phase cells were transferred to MIV nutrient-limited medium, and samples taken at time intervals post-transfer. (3-Galactosidase activity was assessed as described in Section 2.9. Assays were repeated three times with independent cultures, and each gave essentially similar results. Representative data are shown. 100 4.4.2 B-Galactosidase expression is reduced in ptsl or err strains Disruption of the genes encoding Enzyme I or EIIA G l c of the PTS was found to essentially abolish B-galactosidase expression both in rich medium and in MIV (Figs. 4.9 and 4.10). Although these results support the conclusion that the PTS is required for activation of adenylate cyclase in this organism under both types of conditions, they unfortunately are not informative with regards to relative intracellular cAMP-CRP concentrations of these strains. (These strains have been found to differ in other cAMP-dependent phenotypes, for example in their abilities to ferment the cAMP-dependent sugars ribose and galactose (Fig. 4.2). Such differences imply that intracellular cAMP-CRP complex levels are reduced but not identical in each strain.) It must be assumed that the reduced but non-zero cAMP levels of pts strains are insufficient to catalyze (3-galactosidase expression from the E. coli lacZ promoter. Expression of B-galactosidase from H. influenzae gene and operon fusions has been reported at levels 100-fold higher than that observed in the reporter strains. The generally low level of B-galactosidase expression from this reporter construct in H. influenzae may be due to poor recognition of the E. coli promoter by the H. influenzae RNA polymerase, or may be due to differences in levels of intracellular CRP. A more sensitive reporter construct might be constructed by fusing lacZ to a known cAMP-sensitive H. influenzae promoter. 4.5 Assessment of candidate competence-specific CRP b ind ing sites in the Haemophilus influenzae chromosome Competence in H. influenzae is absolutely dependent on cAMP: a mutant strain lacking adenylate cyclase is completely competence-deficient, but competence is restored to this cya strain by exogenous cAMP (54). Addition of cAMP to non-competent wild-type cells in early exponential phase growth in rich medium induces premature competence (263), and I have now shown that disruption of PTS-101 m e d i a t e d a c t i v a t i o n o f a d e n y l a t e c y c l a s e d r a m a t i c a l l y r e d u c e s c o m p e t e n c e . C e l l s l a c k i n g the c A M P r e c e p t o r p r o t e i n ( C R P ) h o m o l o g u e are a l s o c o m p e t e n c e d e f i c i e n t (28), i m p l y i n g tha t as i n e n t e r i c b a c t e r i a , a c A M P - C R P c o m p l e x a c t i v a t e s t r a n s c r i p t i o n at C R P b i n d i n g si tes i n the p r o m o t e r r e g i o n o f a g e n e o r genes r e q u i r e d f o r c o m p e t e n c e d e v e l o p m e n t . A l t h o u g h the m e c h a n i s t i c b a s i s o f H. influenzae c o m p e t e n c e a n d i t s r e g u l a t i o n a re p o o r l y c h a r a c t e r i z e d , a n u m b e r o f c o m p e t e n c e genes h a v e b e e n i d e n t i f i e d ( S e c t i o n 1.2). T h e c o m p e t e n c e gene sxy (a lso c a l l e d tfoX) i s p r o p o s e d to e n c o d e a r e g u l a t o r o f c o m p e t e n c e , a n d d i s r u p t i o n o f sxy c o m p l e t e l y p r e v e n t s c o m p e t e n c e (260). E x p r e s s i o n o f the dprABC o p e r o n ( e n c o d i n g p r o p o s e d D N A p r o c e s s i n g c o m p e t e n c e genes ) (105) , the l a te c o m p e t e n c e gene comlOlA (comF) (272) a n d p o s s i b l y the e n t i r e com o p e r o n is a b s o l u t e l y d e p e n d e n t o n S x y . T h e sxy p r o m o t e r p o s s e s s e s a c a n d i d a t e C R P b i n d i n g s i te ( T a b l e 4.7), a n d Z u l t y a n d B a r c a k (272) d e m o n s t r a t e d a t h r e e - f o l d i n d u c t i o n o f S x y e x p r e s s i o n after a d d i t i o n o f I m M c A M P to the c u l t u r e m e d i u m . M o r e o v e r , e x p r e s s i o n o f S x y has r e c e n t l y b e e n s h o w n to p a r a l l e l i n c r e a s e s i n c A M P (as r e p r e s e n t e d b y (3-galactosidase e x p r e s s i o n p a t t e r n s o f r e p o r t e r s t r a i n s ) i n r i c h m e d i u m a n d i n n u t r i e n t - l i m i t e d m e d i u m ( L . B a n n i s t e r , u n p u b l i s h e d ) . A s i m p l e m o d e l o f c o m p e t e n c e i n d u c t i o n h a s b e e n p r o p o s e d i n w h i c h i n c r e a s e d l e v e l s o f c A M P t r i g g e r e x p r e s s i o n o f S x y , a n d S x y t h e n ac t i va t e s t r a n s c r i p t i o n o f c o m p e t e n c e genes (105, 243) . A l t h o u g h S x y s h o w s n o a m i n o a c i d s e q u e n c e s i m i l a r i t y to p r o t e i n s o f k n o w n f u n c t i o n , i t i s p r e d i c t e d to be a s m a l l b a s i c p r o t e i n , m a k i n g i t a c a n d i d a t e D N A -b i n d i n g p r o t e i n . R e c e n t l y , s e v e r a l i n v e s t i g a t o r s h a v e i d e n t i f i e d a c o n s e r v e d 2 6 b p p a l i n d r o m i c ' c o m p e t e n c e r e g u l a t o r y e l emen t ' . ( C R E ; a l s o k n o w n as a ' d y a d s y m m e t r y e l e m e n t , D S E ) i n the p r o m o t e r r e g i o n s o f comA (105, 243) , rec-2 (34), comM (80), dprA (105) a n d pilA (55) ( T a b l e 4.7), a l l o f w h i c h are r e q u i r e d for a n d i n d u c e d d u r i n g c o m p e t e n c e d e v e l o p m e n t ( S e c t i o n 1.4.1). T h e C R E w a s s h o w n to be r e s p o n s i b l e f o r i n d u c t i o n o f the com o p e r o n , a n d i t has b e e n p r o p o s e d that th i s 102 sequence represents a Sxy binding site (105, 243). A similar sequence was also identified in the promoter region of the H. influenzae gene specifying single-stranded D N A binding protein (Ssb) whose E. coli homologue functions in D N A recombination (146) and which may therefore play a role in recombination of transported D N A (56). The putative CRE sequences are very similar to the CRP consensus binding site: CRP consensus binding site (22) AAATGTGATNTANATCACATTT CRE consensus sequence (105) ATTTTTGCGATCYGCATCGCAAAATT Candidate CRE sequences were also identified near genes not expected to have any involvement in competence or recombination (105). Moreover, CRE sites, like CRP binding sites, are positioned upstream from suboptimal promoters (defined as promoter regions with few matches to the consensus E. coli promoter sequence), and at a distance roughly equal to an integral number of turns of the D N A helix from the proposed transcriptional start site (105). I have now used statistical methods to determine the likelihood that these sites are, in fact, CRP binding sites. 4.5.1 Construction of a CRP binding matrix using a log likelihood test for goodness of fit The affinity of CRP for its binding site has been shown to depend on the degree to which this sequence resembles the CRP binding site consensus sequence (see 22 and references therein). However, some positions in the CRP binding site are more conserved than others, and so any attempt to simply 'score' candidate CRP sites by the absolute number of matches to the consensus sequence will be inaccurate. 103 Instead, I used a 'goodness of fit' scoring method (236) - which incorporates a weighting for more conserved sites in the sequence - to assign a relative CRP-binding score to each CRE site. This method calculates a 'goodness of fit' score for each possible base at each possible position of the CRP binding site, using a sample of known CRP binding site sequences, and gives a matrix representation of the CRP binding site, as described below. In classical statistical analysis, the discrepancy between the observed frequency and the expected frequency of any result (or 'likelihood') is expressed as the ratio of their frequencies: where /, represents observed frequency and / represents expected frequency. The ratio of these two frequencies can be used as a statistic to measure the degree of agreement between sampled and expected frequencies. Goodness of fit, G, is calculated as G - 21n and the greater the departure from expectation, the greater is the value of G (228). Stormo and Hartzell recognized that the degree to which choice of base is constrained at a given position in the DNA sequence of a protein binding site can be expressed as a measure of goodness of fit or 'information content', Ifr: lb =log 2 where fb is the observed frequency of occurrence of a base at a given position in a set of aligned binding site sequences, and pb represents the predicted frequency of occurrence of this base/which is dependent on the base composition of organism. The more frequently a given base occurs at a given position in the protein binding site, the greater is the value of Ifr for that base. 104 M o r e o v e r , u s i n g a m a t r i x c o n s t r u c t e d f r o m a l i g n e d s e q u e n c e s o f k n o w n b i n d i n g s i t es , a n i n f o r m a t i o n sco re c a n be c a l c u l a t e d for a n y c a n d i d a t e b i n d i n g s i te s e q u e n c e as: n heq = w h e r e Ifr r e p r e s e n t s the i n f o r m a t i o n c o n t e n t s co re fo r e a c h b a s e i n the s e q u e n c e , a n d n i s the n u m b e r o f bases i n the s e q u e n c e . A n Iseq s co re i s t he r e fo r e a w e i g h t e d m e a s u r e o f h o w c l o s e l y a s p e c i f i c s e q u e n c e fi ts the c o n s t r a i n t s t h o u g h t to be i m p o s e d b y i t s f u n c t i o n , a n d these scores c a n be u s e d to r a n k the C R P a f f i n i t i e s o f d i f f e r e n t s i tes . S u c h sco res h a v e b e e n s h o w n to d o w e l l as p r e d i c t o r s o f q u a n t i t a t i v e a c t i v i t y , w h e n c o m p a r e d to e x p e r i m e n t a l d a t a (14, 15, 152, 235). I u s e d th i s m e t h o d to c o n s t r u c t a m a t r i x (Tab l e 4.4) fo r C R P b i n d i n g s i tes u s i n g the 49 c h a r a c t e r i z e d E . coli C R P - b i n d i n g sites l i s t e d i n the D P I n t e r a c t d a t a b a s e (196). 4.5.2 M a t r i x - d e r i v e d scores ref lec t C R P a f f i n i t y for C R P b i n d i n g s i tes I u s e d the m a t r i x d e s c r i b e d a b o v e to c a l c u l a t e Iseq s co res f o r a set o f k n o w n E . coli C R P b i n d i n g s i tes w h o s e C R P - b i n d i n g a f f i n i t y has b e e n d e t e r m i n e d e x p e r i m e n t a l l y ( T a b l e 4.5) . F i g u r e 4.11 s h o w s tha t e x p e r i m e n t a l l y d e t e r m i n e d C R P a f f i n i t y i s r o u g h l y p r o p o r t i o n a l to the c a l c u l a t e d score fo r e a c h s i te , c o n f i r m i n g t ha t the m a t r i x - d e r i v e d Iseq s co re ref lec ts the u t i l i t y o f e a c h s i te as a C R P b i n d i n g s i te . 105 • oo <s 3 H ro S i o iv m r o I s - too ro ro *X> L A T H T-H »—1 »—i r o © r o ^ * t <S> S H ^ CO £0 3 rr, r H IN] INI e? < I— 0 0 < 9 (NI 9 s I N S > I S <s ( S r H I S I N rr, r H >£> (NJ ( S r H <s < 3 ( S ( S •* r H ** (NJ rr, -t 0 0 r H Ol I S I S (S> ( S (NI r H I N co (NI r H O O s> •* ( S s> ( S ( S (NJ rr, 0.01 INJ I S 0.14 0.65 (NI r H I N co I S (NI ( S r H <s <S> s> ( S m 0.01 0.14 $ O 0 0 ( S r H (NI r H | N CD * m <s <s ( S I S r H r H 0.14 0.33 0.31 0.22 rr, •G (NI INI CO r H 0 0 ( S ( S ( S I S l/> m r H rr. (NI s I N <s <s I S I S r H r H <S> 0.18 0.41 0.31 I N r H (NJ ( S 0.18 0.29 0.35 is r H 0.18 0.12 0.49 (NI ( S CO ® 0 0 0 0 r H <s> CO <s> rr, s i <s> ( S <s m t O O 0 0 ( S O O ( S r H I S  <s <s> ( S I S r H I S INJ I S (NI 0 0 CO r H 0 0 I S I S ( S ( S INJ oo 3 (NI r H (NI I S r H s> (5> <s> s r H <s 0 0 CO r H 0 0 <s <s G> G> 0 0 r H | N rr, | N rr, 0 0 < S ( S ( S ( S I S (NJ r H I N I N rr. <s INI (S> ( S ( S <s O O <s IN. rr, TI-INJ I S r H (S> CS cs l_J < r - l_> r H ® ® <S> cs> H m oo ® >N- -3-<s> <s> <s> <s> T J - C3 t S H <S? (VI r H <S> ® ® <S> CS) ® <S> O i i I N 0 1 H rg (\j oo <s> cs © cs> I I (Tt T J - r H CTt (NI r - (NI r H (S> <S> <S> <S> (S> <S> O i i Tt- r o i v <y> •q- <S> 0 1 PsJ <S> r H ® ® (NJ r H (NJ Tj- rO r H <S> N CD O CD r H (NI* r H r O fNI ^ r H CS) <S> G> ® r H H ® (S> N T H cs» cs ro <JJ < \— u (V ±1 w " ' « S3 ^ . ,3 U c O £ cn cn CO CU rO .tn rC " r t u bO (J to c d) -rH C <-> .3 ' rQ T3 c • r—t rD PH PH O cu X N ' ' 0» I H cu H H u cO rH CO X, CU ON .tJ C ^ ° y cn C CO M H (J O cu cn .O rX cu • i-H r-Ci T3 O CO CU > o cn O DH s o cO CQ iJ o -o c .3 cn vfl •rH C U cn £ Q J ° _ n o u w cu"" S ^ cu ^ ^ g £ CO u CO o 8 c 1 - 1 <u OJ bo B u 2 w • H _ ^ O) cu cn ^ CU CO CO g CU rH o o . rH r v g « C ^ -CU 3H * «» „H rH T3 O CU MH > rH CU cn o CM O g $ g -xi «« cu C H 8 U O rQ o U H rH CU CU rH 3 -M CU 3 o u 3 •t: u ' H S O 3 3 cu O 7 IH 'H ^ cu .ti cn rQO 11 CU -c. X, OH cn .2i •rH M • CN V M H CU CU cn co rQ * bo rO S CO C N H-< WjrO • O o X II Q. ^ .tl cu S ^ 5O > N cn CO T3 CU r^ H 4-» -rH CO rQ "3 co r-^  O CO *H CU OH 106 QJ VH o C/j '2 OJ a» cr a» cn a» 4-» cn b© 3 cS PH p< u o •i-H 4-* PH CO rt 3 « 31 I - H IN O CO ON tN I - H IN 00 p CO CN 00 I - H 00 CO r - H NO I - H I - H o o LO CN CM ON lO NO 00 tN < C_J < C_J I— < h-< < < CM CM eft P CO c a» CO o u a> < c_j I-c_j < C-J h-<u < < CJ3 < < QJ in rs T3 •i-H o 4 - i u rS 3 bO Pi .2 4-» rs N QJ cn O u rs N u <3 1 1 IV ATTA ATAA < C_J < < < h-TA AA TG < CJ <j h-CJ < C_J C_J < < < cj CJ7 h- h- 1— 11 GT 1 1 AA AA AA QJ in rs T3 •i-H cn O 4-> u rS i — i CS bO oa ca o 4-» rs N QJ cn rs VH QJ a , QJ QJ cn O 4-4 u rs Is bC i PH D O • i—t 4-1 rs N X 3 3 •rH «rH QJ cn O 4-> u rs CN N u QJ w O 4-> u rs 3 bO C_J C_J C_J < cj I— CJ3 cj 3 o b0 QJ VH r-~* CS VH o 4-4 rS 3 bO QJ VH VH O • i-H 4-* rS N QJ cn O H—i 3 B tt ~ bo S QJ cn _CS 3 VH ir1 QJ 4-t CS P O P c cS QJ cn O X QJ , 3 Cr-ew cn LO 3 rH rs cn .2 g •0 o QJ X PH 1 / 3 <P X P TJ o c rs T3 rs QJ CJ c QJ P" QJ 2i « 3 •2 3 " CU 2 •-rG cn 4-4 VH o % < 4 H b 0 ^ p rS s QJ £ bO •rH cn p T 3 P 3 QJ _> '-<-» P PH QJ U P ai VH 4-4 <U • V4-H VH 3^ P rS QJ T3 QJ 4-* QJ cn QJ 3 O u o PH 5 QJ g cn o •rH ^ . 4 ^ 3 B 3 C^ J - 1 « o < H rs -P NO CO CM QJ U QJ cr QJ cn QJ X, QJ cn rS -P X rs QJ VH o <4-H QJ < VH O U cn 4-4 c QJ 4-4 c o O 'X4 CS S VH ' O M-4 n • r H QJ d QJ cn QJ VH PH QJ VH 5^ r - H QJ VH QJ rCi 107 10-, 0 5 10 15 20 Matrix Score (I seq) Figure 4.11 Correlation between theoretical scores of CRP binding site affinity (Iseq) a n d experimentally determined CRP affinity (ln(K s/K ns)) for known E. coli CRP binding sites Scores for five E. coli CRP binding sites listed in Table 4.5 were calculated using the matrix shown in Table 4.4. Experimentally determined values for CRP binding affinity were taken from Berg and von Hippel (15). Line was fitted by least-squares analysis using CricketGraph III™ Version 1.01. 4.5.3 Assessment of differences between scores of CRP sites and putative CRE regulatory sites I used the E. co/z-derived matrix to score five sets of sequences: a set of randomly selected 22bp sequences from the H. influenzae genome (n=100), a set of randomly selected 22bp sequences from the E. coli genome (n=100), a set of known E. coli CRP sites (n=49) (196), a set of candidate H. influenzae CRP sites from promoter regions 108 of catabolic and biosynthetic genes (n=13) (Tables 4.2 and 4.6) and the set of putative H. influenzae CRE regulatory sites found in the promoter regions of competence genes (n=9) (Table 4.7).. Distribution of Iseq scores for each set of sequences is shown in Figure 4.12. T a b l e 4.6 P u t a t i v e C R P b i n d i n g sites i d e n t i f i e d i n the p r o m o t e r r e g i o n s o f s e l e c t e d Haemophilus influenzae g e n e s HI# Gene a Function Putative CRP Site Sequence^ Score (heq)c 0604 cya adenylate cyclase AATTGTGA11IAIGICACAI11 22.44 0398 hyp. promoter proximal gene 11IIGTGACTCACTTCAAACTC 16.38 of ice operon 0957 crp cAMP receptor protein AAGCGTGA111IACGCGAAGGA 5.23 0185 adhC alcohol dehydrogenase 1111GTGATATGGCTCACAAAA 20.90 1739.1 IctD lactate utilization (L- AATTGTGATCTAGTTCTCAAAA 19.03 lactate dehydrogenase) 364 pbp7 cell wall synthesis 1111GCGATCTAGATCGCAAAT 18.83 0851 mobB dinucleotide TACTGCGA111AGATCGCAAAC 14.95 biosynthesis protein B 0937 suhB role in protein synthesis 111MGCGATCTGTATCGCAAAG 13.07 a cya was cloned and sequenced by Dorocicz et al. (54), and crp was cloned and sequenced by Chandler (28). b Putative CRP sites for cya (54) and crp (28) were identified by sequence gazing, inspired by the existence of CRP binding sites in the promoter regions of their E. coli homologues (as reviewed in .22). Putative CRP site for HI#0398 was identified by sequence gazing by Macfadyen et al. (136). All other listed candidate CRP binding sites were identified by Dr. R.J. Redfield, by GRASTA searching of the H. influenzae genome for sequences similar to the E. coli CRP binding site consensus sequence (22). c Total information content for the candidate binding site, calculated using the b=22 matrix shown in Table 4.4. lsen = ]>>, where Ifr represents the information content b=l score for each base in the sequence (236). 109 QJ VH o <j c/j QJ U d QJ VH QJ MH QJ PH" QJ U d QJ cr QJ U QJ > •r-H 4—» PH rs n _o 4-1 cj d d PH QJ QJ O r—I cs-CM CO NO ON o CO LO LO CO NO CN ON CO CN 00 o o 00 CN LO CN NO NO NO 00 NO I -H I -H I -H I -H r - H I -H I -H I -H I -H r ^ H r ^ H VH O X H f N -QJ CJ d QJ 4-» QJ DH B O cj O 4-» rS to© QJ Vi VH o X H LO o 3 3 C_7 C_J h-< < cj c_j u CJ? < < CJ3 cj? CJ? d o • r H 4-» 03 Cl •r-H X B o u QJ QJ d 00 3 B o v-CJ? < CJC_J CJ? c^ -d .2 *4-» r3 U O d rS VH 4-» < Q QJ U d QJ H-» QJ OH o u CN i cu LO o LO LO CJ? < C_J CJ? C_J h-< cj? cj? < u < cj? C_J CJ? LO to LO o o o I -H I -H I -H VH O 3 S 3 3 h- CJ CJ? CJ? CJ CJ h- h-< < CJ CJ CJ? h-CJ X H 3 3 CJ CJ CJ? CJ CJ cj? C_J CJ < < CJ? CJ? CJ CJ? CJ CJ? < CJ? < CJ? CJ < CJ? CJ QJ CJ QJ 4-> QJ DH s o o vX QJ CJ d QJ 4-4 QJ DH O o c^ -d *4-» cci U O r - H 1/3 cs VH 4-» < Q —^ QJ U d QJ 4—* QJ DH O u V. vX QJ C QJ to© QJ CJ d QJ 4-1 QJ DH O CJ rE> v, 03 QJ d bO 3 S o X o < cj? CJ < CJ? CJ cj? cj? QJ U d QJ 4-> QJ DH o C J O VH O X H < c j CJ? CJ < CJ h-< CJ? CJ cj? -2 3 D d • r H cn cS DH QJ VH < Q o • r H 4-t rt • r H X J a o CJ QJ VH rO CD cn I -H o I -H O N O N L O 00 t N O O o N O O N C O oo o r - H L O N O N O o C N O N o I -H C N O o o o O o r-H r-H O '53 o VH DH too Pi • r H TJ Pi • r H X < Z n Xi QJ TJ Pi rs > PS ' u — QJ 3 > DHX! rS 4-> DH TJ QJ X ^ rd ^ EH • 2 QJ - rPi rS cn QJ 4~* O Pi QJ TJ CN *H-> CJ QJ cn QJ QJ cn PH u QJ > o cn VH CS CS DH 6 o pi DH QJ cn cn QJ Pi QJ X, bO t3 rs QJ QJ cn QJ o ,P -2 cn d o •P CJ d rs <J d QJ TJ TJ rs ^ d cn -d O too 2 ° DH QJ 3 -d S O ^ 3 c OH QJ > cn QJ d QJ too TJ QJ 4 - t CS • r H CJ O cn cn cs i QJ <J d QJ 4-> QJ DH B O CJ cn VH QJ 4-> o B o . VH '—-DH LO d . r ^ VH CJ cn QJ TJ too QJ VH CS TJ r2 S 'd. u 5 d QJ QJ C J n i d QJ TJ QJ CJ d QJ P cr QJ cn VH ^ £ PH CS rQ cn d cn d QJ u 8 cn QJ cn CS-CV> cn QJ CS E-H d o Xi cn rs s QJ X 4—* bO _d cn d TJ QJ *H d CS do 3 u b0 d • r H TJ d • r H X> QJ > • r H 4-* rt 4-» d DH QJ 4-> VH O dQJ 4-> d o CJ d 4-» rs B VH o o H NO co CN QJ CJ d QJ d cr QJ cn QJ rd QJ cn rs X X CJ cs QJ VH O *4-H QJ VH O CJ cn 4-* d QJ 4-4 d o CJ d *4-t rs VH O QJ X d QJ cn QJ VH DH QJ VH rO iS QJ VH QJ X 110 30 -40 —I E. coli H. influenzae £ c o / / H influenzae H. influenzae CRP CRE Sites CRP sites Random Sequences sites (putative) Figure 4.12 Scatter plot showing distribution of lSeq scores for Escherichia coli and Haemophilus influenzae sequences lSeq scores, representing relative affinity of CRP for each sequence, were calculated as described in Section 4.5, using the matrix shown in Table 4.4. I used statistical methods to determine whether there is significant difference between mean predicted CRP binding affinity {Iseq) f° r each set of sequences. Shapiro-Wilk tests (269) determined that Iseq scores in all five sets are normally distributed (Table 4.8 A). Tests of variance (269) showed, however, that the variances of these samples are significantly different (not shown), and these five samples also differ in size, precluding the use of a simple ANOVA comparison of mean scores. Instead, I used the non-parametric Kruskal-Wallis test (269) to test the null hypothesis that all of these samples are the same. Because this test rejected the 111 n u l l h y p o t h e s i s ( T a b l e 4.8 B ) , I s u b s e q u e n t l y c o m p a r e d p a i r s o f s a m p l e s o f i n t e r e s t u s i n g a n o n - p a r a m e t r i c tests d e v e l o p e d b y D u n n (269) ( T a b l e 4.8 C ) . W h i l e the base c o m p o s i t i o n o f E. coli i s 50:50 A T : G C , the base c o m p o s i t i o n o f the H . influenzae g e n o m e i s 62:38 A T : G C (66). T h i s d i f f e r e n c e w i l l n e c e s s a r i l y affect the d e g r e e s o f c o n s t r a i n t o n i n d i v i d u a l bases o c c u r r i n g at g i v e n p o s i t i o n s i n D N A b i n d i n g s i te s e q u e n c e s . I n the absence o f a set o f k n o w n H. influenzae C R P b i n d i n g s i te s e q u e n c e s , i t i s , h o w e v e r , i m p o s s i b l e to c o n s t r u c t a s p e c i e s - s p e c i f i c m a t r i x . T o d e t e r m i n e w h e t h e r th i s E. c o / z - d e r i v e d m a t r i x w i l l , o n a v e r a g e , g i v e r e l e v a n t C R P a f f i n i t y s co re s fo r H. influenzae s e q u e n c e s I c o m p a r e d scores s a m p l e s o f 2 2 b p s e q u e n c e s r a n d o m l y c o l l e c t e d f r o m the H. influenzae a n d E. coli g e n o m e s . B o t h the m e a n Iseq s co re s ( T a b l e 4.8 A ) a n d the score d i s t r i b u t i o n s ( F i g . 4.12) d i f f e r s l i g h t l y b e t w e e n these t w o g r o u p s , p r e s u m a b l y as a r e s u l t o f d i f f e r e n c e s i n g e n o m i c base c o m p o s i t i o n . P a i r w i s e c o m p a r i s o n o f these t w o s a m p l e s u s i n g D u n n ' s m e t h o d ( T a b l e 4.8 C ) s h o w e d , h o w e v e r , that scores fo r r a n d o m l y s e l e c t e d s a m p l e s o f E . coli a n d H. influenzae s e q u e n c e s d o n o t d i f fe r to a d e g r e e tha t i s s t a t i s t i c a l l y s i g n i f i c a n t (p > 0.05). T h i s s u g g e s t s that d e s p i t e d i f f e rences i n base c o m p o s i t i o n , the E . coli m a t r i x w i l l g e n e r a t e s u f f i c i e n t l y a c c u r a t e C R P - a f f i n i t y s co res fo r H. influenzae s e q u e n c e s . N o n - p a r a m e t r i c p a i r w i s e c o m p a r i s o n s a l s o d e m o n s t r a t e d tha t s c o r e s f o r the E. coli a n d H. influenzae C R P si te s a m p l e s a n d for the H. influenzae C R E s i te s a m p l e a l l d i f f e r s i g n i f i c a n t l y f r o m the scores o f the s a m p l e s o f r a n d o m s e q u e n c e s ( T a b l e 4.8 C ) . T h i s i m p l i e s tha t the s e q u e n c e s i n a l l th ree s a m p l e s a re c o n s t r a i n e d r e l a t i v e to r a n d o m l y s e l e c t e d s e q u e n c e s , a n d are u n l i k e l y to h a v e o c c u r r e d r a n d o m l y i n e i t h e r o r g a n i s m . 112 CA CU "EH e rt CA 3 CA CU VH o o CA o s o • rH 4-< 3 jQ "iH 44 CA • rH T3 o a >H o s VH o M H 4 - » CA CU • w ri< i o . a rt A CD < CO cu « 3 O •r-1 CO j 3 " u 3 O u V o VH P H CU VH o u CD 3 rt cu QJ "EH g rt C D rt 3 rt 3 rt 3 rt 3 rt 3 on on on ort or] 3 3 3 3 3 CO t N ON C N o CO ON C N ON CO t N t N LO C N CN ON C N CN LO o o o O O CN T-H CO T-H O CO r-H r-H CN O C N ON 0 0 CN ON ON ON ON ON o O O O O o NO O CN t N NO U> 1 f*\ ON CN LO Li J oq NO t N CO LO I-H 0 0 o C N LO LO LO NO CN 0 0 CM CN r - l LO r-H CO NO r-H LO NO O O co QJ U ' 3 QJ 3 cr QJ CA a o -cs 3 rt VH o u ON r-H CN O o ON cn QJ U 3 QJ 3 CT1 QJ CA g o T3 3 rt CA VH QJ 4-» cu CS • rH CA N P H K S cu P H u S •5 u CO QJ > • r H • P 3 P H PH U cu CS N e CU S ON CO CO LO ON NO NO CO NO 0 0 CN ^ CM LO LO I -H I -H I -H O N CA £ QJ Si w PH u cu CS N K cu S X) QJ 4-t r3 X3 3 O "rt QJ U S • 4-> " 3 QJ rt x! 4-t 4_, CA 3 bp O 3 " '55 3H D ^ cu D H ^ rt to -3 _ C D rt _ U >rH ^ CA 4-4 . v rt c o * CH r - H • r H QJ H Xi ^ ^ - 3 4-1 QJ CA c/> co QJ co CA rt CA rt QJ U 3 VH _ rt QJ > U » g rt • v !/) ^ r3 D H U g s? S Qj rt , CA VH ° cu >, . - - 3 CJN « rt NO 2 3 .CM. o u co O rs £ N QJ X 3^ QJ a; w a; a; g g £ S 3 T H 3 3 « VH CA 0 VH W v o QJ K C H T3 113 03 cn I QJ X 03 QJ QJ > H o u CD c C3 P< cn QJ o u CD 03 CJ s 03 CD IBS! I N LQ 1—1 ON LO ON O O cn QJ U QJ c r QJ cn B o X i G 03 i-l O W CO CM IN ON o C~> 0 0 ON CM CM o co T-H CM CM CM CO ON O O O cn QJ CJ G QJ cr QJ cn B o c 03 >H « N K <x> 3 ON NO CO ON cn QJ PH PH" u o u NO LO r H CO CO QJ > • i H 03 -l-> OH 1/J OJ PH PH U cu « N K <u 3 CO CM CM ON PH u « N K cu a n; w n; £ QJ B CS cn QJ X 4 H QJ ) H CtJ cn QJ "OH S C3 cn QJ > t3 cn cu X 4 H o OH X 3 Z c _o '•Jj1 c3 s o > H OH OH 03 cn QJ H >% C3 i O) C O CN A PH O c QJ ( H cn cn cu • - H , OH S CO cn cu > X S QJ O H CJ QJ 'oT ( H cn QJ H-» , OH 3 C H ) H o o o o V PH Q LO NO ON LO 114 c o 'cn j3 o U LO o o o a t — i r - H NO O C N ON C N C N CN CO LO 00 00 00 CM ON ON ON NO 00 C N CO r - H LO r - H I - H 00 O r - H 10* LO 0 0 O w 00 o t N NO C N NO t N CM C N CM O r - H LO CM ON ON cn I-H I-H CO I - H CO I - H C N CM C N CM CO CM CM 00 CM CO CO OJ C J QJ VH QJ O cn • r H V H rS a, £ o U QJ "EH CO CO N* QJ n c QJ QJ QJ QJ QJ QJ QJ QJ c VH VH VH VH VH QJ QJ QJ QJ QJ VH VH VH rs M H >H-I S H H H >H-H ro rs ro 1/3 H H M H • r H H H H H H H •f-t cn CO CO T3 T3 C N C N C N C N C N t N C N t N C N O O O O O 0 O O O 00 00 00 00 00 00 00 00 00 CM CM CM CM CN CM CM CM CM NO 00 C N £ o xi ro cu a N R cu S cn > £ o Xi ro ON LO O NO ON ON L O CM CO NO "HH CM CM O I - H CO 00 O0 C N r - H CM L O CO CO L O O L O I - H I - H r - H I - H r - H I - H r - H Vi QJ PH PH u o W vi > O Xi c rs VH CU « N R cu 3 Vi QJ PH u o W vi > £ o xi c rS VH O C_> Vi QJ W PH U H i « N R cu s Vi > £ o Xi c rS VH O CJ cn QJ u <u cs N R cu QJ > 4-> rt 4-* DH cn QJ PH r * u a N R cu s QJ > • i-H 4-t 4-* 3 DH QJ QJ •5 R * a; J P H P< U cu <s N R cu 3 cn > £ o xi 3 rs VH cu « N R cu 3 cn > £ o Xi 3 cs VH cu ' « N JK cu S cn > cn QJ PH OH u w cn > cn QJ W PH u cu « N R cu 3 O -5 QJ _> *4-t rt 4-t 3 DHI PH PH U cu « N R cu S PH PH u _ R a; cn > cn QJ £ ^ 3 W PH U cu CS N R cu 3 115 More significantly, this pairwise comparison method showed that scores for sites identified as CRE in H. influenzae competence gene promoters do not score significantly differently from the set of known E. coli or candidate H. influenzae CRP sites (Table 4.8 C). This suggests strongly that the cAMP-CRP complex will recognize, bind and activate transcription from these candidate H. influenzae regulatory sequences, while the predicted Sxy protein lacks any recognizable helix-turn-helix DNA-binding domains (262) and has never been shown to bind CRE sequences. These observations have implications for the roles of Sxy and cAMP in regulation of competence (see Section 4.6.5). 4.6 Discussion 4.6.1 The Haemophilus influenzae PTS functions as an environmental sensor All bacteria have mechanisms for regulating the acquisition of metabolites and the conservation of intracellular energy resources. Central to these are sensors that detect the scarcity or depletion of preferred energy sources, and signal pathways that transduce the resulting information into appropriate alterations in gene expression. One well-characterized enteric bacterial sensor is the PTS, an enzyme complex that takes up preferred sugars, detects changes in their availability and regulates transcription of catabolic genes for less-preferred sugars accordingly. I have demonstrated that the H. influenzae PTS allows this organism to monitor its environment for one carbon source (fructose). In the absence of fructose, this PTS induces transcriptional activation of genes for a repertoire of other sugars by activating adenylate cyclase. Moreover, the PTS-mediated response also induces development of competence, so that cells in a suboptimal nutritional environment develop the ability to take up exogenous DNA. Do any other environment-sensing systems regulate competence development by H. influenzae? Bacteria respond to a range of other environmental stimuli 116 (presence of nitrogen, changes in pH, osmolarity and temperature, nutrient deprivation) via a group of closely-related 'two-component systems', each comprising a membrane-bound sensor that detects environmental signals and a cytoplasmic regulatory component that regulates gene expression (79). Analysis of the H. influenzae genome identified only five putative two-component systems (Table 4.9) (66). Disruption of each of these two-component systems, however, did not significantly affect competence development (82), implying that while these systems may regulate expression of specific operons, they do not participate in the global cAMP-mediated response of H. influenzae to nutritional stress. The PTS may therefore be the significant environmental sensor regulating competence development in H. influenzae. Table 4.9 Two-component (sensor-regulator) systems of Haemophilus influenzae Genes HI# Function in E. coli arcB 0220 Regulate response to anaerobic conditions arcA 0884 (231). basS 1707 Unknown (153). basR 1708 cpxR 0837 Regulates response to excess extracellular protein (40). narQ 0267 Regulate response to nitrate/nitrite in narP 0726 anaerobic conditions (177). phoR 1378 Regulate response to limiting phosphate phoB 1379 (177). 117 4.6.2 A revised model of the Haemophilus influenzae PTS Assays of the phenotypes of H. influenzae strains lacking one or more component of the PTS suggest that this PTS is considerably more complex than was implied by the preliminary working model (Fig. 3.9). As proposed for E. coli (127, 155, 175), non-phosphorylated EIIA G l c may inhibit adenylate cyclase. It may also participate in interactions with sugar permeases resulting in exclusion of ribose and/or galactose (inducer exclusion). The primary route of phosphotransfer to fructose appears to utilize HPr (rather than the HPr-like domains of DTP). DTP can however substitute for HPr and catalyze phosphotransfer to EIIA G l c sufficient for adenylate cyclase activation. I have incorporated these features into a modified model of the H. influenzae PTS (Fig. 4.13). Peterkofsky et al. (1989, 1993) have proposed that the physiologically responsive form of adenylate cyclase is a complex with the three prs-operon encoded PTS proteins, and that this complex can both activate and inhibit adenylate cyclase, depending on phosphorylation state (170, 172). This model is based on the findings that adenylate cyclase activity of permeabilized E. coli cells is considerably lower than that of cell extracts (172), and that in an in vitro system, the most potent inhibition of adenylate cyclase is achieved by addition of all three non-phosphorylated PTS proteins (182). The notion that the PTS may function as a phosphotransfer complex is further supported by the finding that some sugar-specific phosphotransferase systems exist as single multidomain polypeptides (174). It has also been proposed that this complex is membrane-associated, because EI and HPr have been purified from membrane vesicles which have been depleted of cytoplasmic proteins (101, 204), and because immunoelectron microscopy studies have located a considerable fraction of cellular EI at or near the cytoplasmic membrane (74). While a membrane-associated enzyme complex model, rather than a simple phosphotransfer model, might more accurately reflect physiological conditions, the experiments described in this chapter do not allow me to determine 118 whether Enzyme I functions as a simple phosphotransfer protein in H. influenzae, or whether it participates in more complex interactions with adenylate cyclase, HPr and EIIA G l c. Signal? Non-PTS J U S u 9 a r ^ Sensor? Permease Fructose membrane Figure 4.13 Revised model of the Haemophilus influenzae PTS Bold arrows represent the central route of phosphotransfer from phosphoenolpyruvate (P-EP) via EI, HPr and the EIIA F r u domain of DTP to fructose, and phosphotransfer from P-EP via EI and HPr to the regulatory component EIIA G l c. Small arrows represent minor routes of phosphotransfer between PTS components, and possible phosphorylation of PTS components by other regulatory systems, as discussed in Section 4.6.3. Dashed arrows represent potential regulatory interactions of phosphorylated and non-phosphorylated PTS components with adenylate cyclase and with non-PTS permeases (inducer exclusion). AK, acetate kinase; NTPs, ribonucleoside triphosphates; H, HPr-like domains of DTP; M, putative regulator module of DTP. 119 4.6.3 The PTS may integrate a variety of environmental/nutritional signals The observation that disruption of EI or EIIA G l c of the H. influenzae PTS has a much more severe effect on competence than does the presence of high levels of fructose (compare Figs. 4.4 and 4.7) implies that the H. influenzae PTS may also regulate adenylate cyclase in response to environmental and/or intracellular signals other than fructose availability. Studies in enteric bacteria have demonstrated that a number of factors can influence the phosphorylation state of the PTS (especially the phosphorylation state of EIIA G l c), and thus PTS-mediated activation of adenylate cyclase. i) Phosphate: a connection to cellular energy levels? In E. coli, PTS-mediated regulation of adenylate cyclase is influenced by intracellular concentrations of inorganic orthophosphate (Pi), which vary inversely with carbon source availability (166) (Pi is consumed in the synthesis of the ATP and PEP used to phosphorylate sugar during transport: as the intracellular sugar-phosphate pool increases, pools of phosphate, ATP and PEP are depleted). In vitro and in permeabilized cells, PEP-dependent phosphorylation of PTS proteins has no effect on adenylate cyclase activity in the absence of Pj (87, 182), and it has been proposed that the PTS complex must contain both covalently and non-covalently associated phosphate to be fully active (166). This requirement for free phosphate is proposed to fine-tune the cellular response to changes in cellular energy levels and the nutritional environment, permitting full activation of adenylate cyclase only when it is useful for cells to accumulate cAMP (when carbon source availability is low) (166). By analogy, intracellular levels of Pi inH. influenzae might be expected to rise when cells are transferred to a nutrient-limited environment (MIV medium), and contribute to maximal PTS-mediated activation of adenylate cyclase. Although addition of fructose to MIV medium may alter the EIIA G l c/EIIA G l c~P ratio, the lOmM Pj content of MIV medium (90) may maintain the PTS in a semi-active state. 120 i i ) T h e [ P E P ] : [ p y r u v a t e ] r a t i o : a c o n n e c t i o n to m e t a b o l i c ra te? A n u m b e r o f s t u d i e s h a v e d e m o n s t r a t e d that i n t r a c e l l u l a r c A M P c o n c e n t r a t i o n s . c a n n o t b e s i m p l y a n d d i r e c t l y c o r r e l a t e d w i t h a v a i l a b i l i t y o f g l u c o s e o r o t h e r P T S s u g a r s (160, 170). G l u c o n a t e , g l u c o s e - 6 - p h o s p h a t e (62, 92 , 99) , l a c t o s e (92) a n d o t h e r n o n - g l u c o s e s u g a r s (59) h a v e a l s o b e e n s h o w n to i n f l u e n c e c A M P l e v e l s . H o g e m a et al. (1998) h a v e s h o w n i n E. coli a n d S. typhimurium t ha t w h i l e g l u c o s e c a u s e s a l m o s t c o m p l e t e d e p h o s p h o r y l a t i o n o f E I I A G l c , a n u m b e r o f . l e s s - p r e f e r r e d P T S s u g a r s a n d n o n - P T S c a r b o n s o u r c e s c a n a l s o i n d u c e a 4 5 - 7 5 % d e p h o s p h o r y l a t i o n o f t h i s P T S c o m p o n e n t . ( S e v e r a l o t h e r n o n - P T S s u g a r s a n d ' p o o r ' c a r b o n s o u r c e s s u c h as g l y c e r o l a n d l ac ta te cause less t h a n 2 0 % d e p h o s p h o r y l a t i o n o f E I I A G l c ) . T h e d e p h o s p h o r y l a t i o n effect o f g l u c o s e - 6 - p h o s p h a t e i s n o t the r e s u l t o f g l u c o s e s -p h o s p h a t e t r a n s p o r t , the p r e s e n c e o f g l u c o s e - 6 - p h o s p h a t e i n the c e l l o r t he a c t i v i t y o f the e n z y m e p h o s p h o g l u c o s e i s o m e r a s e . I n s t e a d , c a r b o n f l u x t h r o u g h the g l y c o l y t i c p a t h w a y affects the p h o s p h o r y l a t i o n state o f the P T S b y r e d u c i n g the i n t r a c e l l u l a r [ P E P ] : [ p y r u v a t e ] r a t i o - the d r i v i n g fo rce fo r p h o s p h o r y l a t i o n o f the P T S p r o t e i n s . D e p h o s p h o r y l a t i o n of E I I A G l c ~ P o c c u r s as the [ P E P ] : [ p y r u v a t e ] r a t i o is l o w e r e d (93). M a n y d i f f e r en t m e t a b o l i c p a t h w a y s l e a d to o r f r o m P E P a n d p y r u v a t e , a n d so the [ P E P ] : [ p y r u v a t e ] r a t i o m a y be r e g u l a t e d i n a n u m b e r o f w a y s a n d i s p o o r l y u n d e r s t o o d . It i s c l ea r , h o w e v e r , that c e r t a i n n o n - P T S s u g a r s c a n a l s o i n f l u e n c e p h o s p h o r y l a t i o n state o f the P T S a n d i t s a b i l i t y to r e g u l a t e a d e n y l a t e c y c l a s e a c t i v i t y . S i m i l a r r e g u l a t i o n o f P T S p h o s p h o r y l a t i o n state i n H. influenzae m i g h t e x p l a i n the o b s e r v a t i o n tha t m e t a b o l i z a b l e s u g a r s o t h e r t h a n f r u c t o s e c a u s e m i n o r b u t r e p r o d u c i b l e r e d u c t i o n s i n c o m p e t e n c e d e v e l o p m e n t , a n d s u g g e s t tha t the P T S m a y m o d u l a t e a d e n y l a t e c y c l a s e a c t i v i t y e v e n i n the absence o f f r u c t o s e (82). 121 iii) Acetate kinase/ EI Kinase: a connection to the rate of carbon flux through fermentation pathways and the electron transport chain? The enzyme acetate kinase catalyses the conversion of acetate and ATP into acetyl phosphate and Pi. In vitro studies have demonstrated that the E. coli enzyme acetate kinase (AK) can also phosphorylate Enzyme I (and thus HPr and EIIA G l c) by the following reaction sequence (31, 67): ATP (or GTP or acetyl~P) + AK <-> A DP (or GDP or Ac") + P~AK P~AK + E I B A K + P~EI If phosphorylation of EI by phosphorylated acetate kinase can occur in vivo, then the ratio of phosphorylated to non-phosphorylated PTS proteins should be influenced by the ratio of phosphorylated to non-phosphorylated acetate kinase. This, in turn, would be determined by the intracellular ratios of ATP/ADP, GTP/GDP and acetyl phosphate/acetate (67). This acetate-kinase-mediated link between carbon flux through fermentation pathways and the PTS may be another means that the cell uses to assess cellular energy resources before deciding whether to activate adenylate cyclase (Fig. 4.14). H. influenzae gene HI#1204 encodes a protein with 84% similarity (69% identity) to E. coli acetate kinase, despite the apparent absence of the oxaloacetate -f AcetylCoA —> a-ketoglutarate branch of the tricarboxylic acid cycle of H. influenzae (240). I have speculated elsewhere (133) that acetate kinase may have been conserved in this organism for its regulatory properties (as has been proposed for EIIA G l c). A further (unique) ATP-dependent El-kinase has been purified from E. coli (42). Its activity is regulated by the NAD+/NADH ratio, leading to the suggestion that this kinase links PTS activity to activity of the electron transport chain. H. influenzae may possess a homologue of this kinase, and a connection between electron transport chain activity and the PTS could then explain the PTS-dependence of competence induced by transient anaerobiosis. 122 Pyruvate Acetate M e m b r a n e Acetyl-SCoA Acetyl-P ATP/GTP Sugar Sugar-P Figure 4.14 Model for the interaction of the PTS with pools of intermediate metabolites T h e i n t e r a c t i o n o f acetate k i n a s e ( A K ) w i t h the P T S s u g g e s t s a p a t h w a y f o r c o n n e c t i n g the P T S to o t h e r p a t h w a y s o f i n t e r m e d i a r y m e t a b o l i s m , s u c h as a n a e r o b i c f e r m e n t a t i o n p a t h w a y s . S c h e m a t i c b a s e d o n a n o r i g i n a l m o d e l p r o p o s e d b y F o x et al. (67). i v ) E n z y m e I I A N t r : a c o n n e c t i o n to n i t r o g e n s o u r c e a v a i l a b i l i t y ? A c o n n e c t i o n b e t w e e n n i t r o g e n a n d c a r b o n u t i l i z a t i o n w a s p r o p o s e d m a n y y e a r s a g o , b a s e d o n e x p e r i m e n t a l e v i d e n c e s h o w i n g that the d e g r e e o f c a t a b o l i t e r e p r e s s i o n w a s d e p e n d e n t o n the a v a i l a b i l i t y o f a n i t r o g e n s o u r c e : a r a p i d l y m e t a b o l i z a b l e c a r b o n s o u r c e p l u s s l o w l y u t i l i z a b l e s o u r c e o f n i t r o g e n i n d u c e d m a x i m a l r e p r e s s i o n o f a d e n y l a t e c y c l a s e a c t i v i t y (38). T h e r p o N - e n c o d e d p r o t e i n a 5 4 i s a n a l t e rna t e s i g m a fac tor o f the b a c t e r i a l R N A p o l y m e r a s e c o m p l e x a n d i s i n v o l v e d i n t r a n s c r i p t i o n a l a c t i v a t i o n o f a n u m b e r o f n i t r o g e n - r e g u l a t e d genes . T h e d i s c o v e r y o f s i g n i f i c a n t s i m i l a r i t i e s b e t w e e n I I A F r u / I I A M t l d o m a i n s a n d the p r e d i c t e d p r o t e i n p r o d u c t ( n a m e d E I I A N t r ) of a n o p e n r e a d i n g f r a m e e n c o d e d d o w n s t r e a m of ( a n d c o t r a n s c r i b e d w i t h ) rpoN i n v a r i o u s o r g a n i s m s s u g g e s t e d tha t the P T S m a y 123 provide a mechanistic link between carbon and nitrogen regulation (29). EIIA N t r negatively regulates nitrogen-regulated genes (57, 145) in enteric bacteria, and it has been proposed that this regulation may involve PTS-mediated phosphorylation of I I A N T R which may then in turn phosphorylate an as-yet unidentified regulatory protein. H. influenzae encodes a protein (HI#1147) showing 68% similarity (39% identity) to the pteN-encoded E. coli IIA N t r, suggesting that nitrogen source availability may similarly affect the phosphorylation state and activity of the H. influenzae PTS. It has also been suggested that the inactive form of the nitrogen-regulatory system protein PII may be directly or indirectly involved in the stimulation of a phosphatase which could affect the phosphorylation state of proteins of the PTS (see Section 6.1.2, and Fig. 6.2) (29). v) Nucleoside triphosphates: a connection to availability of nucleic acid precursors? GTP and other ribonucleoside triphosphates (but not diphosphates or monophosphates) stimulate adenylate cyclase activity in permeabilized E. coli cells (233). This stimulatory effect is not seen for purified adenylate cyclase or disrupted cells, which suggested that regulation of adenylate cyclase by GTP is mediated by other protein factors (169). Peterkofsky et al. (1995) have shown that in strains lacking components of the PTS, adenylate cyclase activity is unaffected by GTP. Labelling studies demonstrated that GTP and other nucleoside triphosphates (NTPs) complex with HPr, suggesting that HPr mediates GTP-dependent stimulation of adenylate cyclase complex in E. coli (171). In E. coli, intracellular pools of ribonucleotide triphosphates are reduced by up to 40% on amino acid starvation (69), and protein and RNA synthesis halts. GTP-mediated regulation of adenylate cyclase activity may therefore serve to couple protein, RNA and cAMP synthesis. A l l HPr residues shown to participate in GTP-binding by HPr (Lys-24, Lys-27, Ser-46, Thr-36, Asp-69) (171) are conserved in the H. 124 influenzae HPr homologue (but not in the HPr-like domains of DTP). The H. influenzae PTS may similarly mediate a response to NTPs. This model predicts, however, that adenylate cyclase activity is depressed in amino acid starvation, while my data suggest adenylate cyclase activity in H. influenzae is stimulated in an amino acid-limited environment (MIV medium; see for example, Sections 4.3 and 4.4, and associated Figures). Moreover, I have observed a different H. influenzae response to exogenous ribonucleotide triphosphates (see Chapter 6). vi) Signalling via DTP: a connection to other environmental signals? As described in Section 3.3.2, DTP of the H. influenzae PTS possesses a central domain with some weak sequence similarity to regulator modules of two-component systems. Disruption of the five regulatory components of known H. influenzae two-component systems (identified by sequence similarity) did not interfere with normal competence development (and, by inference, did not prevent PTS-mediated activation of adenylate cyclase). However, strains mutant in the sensor components ArcB and NarQ - both of which mediate cellular responses to anaerobiosis - were not tested (82). Considerable cross-talk has been demonstrated in vivo and in vitro between sensors and regulators of different two-components systems (reviewed in (79)) suggesting that ArcB and/or NarQ and/or as yet unidentified sensor components could be capable of phosphorylating DTP in response to anaerobiosis or other environmental signals, and that DTP could be another site at which this PTS integrates several environmental signals. Moreover, the possible involvement of a sensor of anaerobiosis in PTS phosphorylation may provide another explanation for the observed involvement of the PTS in anaerobically induced competence development. 125 In summary, although the simple prediction that the PTS mediates a response to fructose availability is borne out by the data presented, the phosphorylation state of the PTS and therefore its regulatory activity may be further modulated by intracellular levels of phosphate, ATP, GTP (and other ribonucleotide . triphosphates) and acetyl phosphate, activity of the electron transport chain, availability of easily assimilated nitrogen sources, and by flux through pathways of general metabolism (glycolysis and anaerobic fermentation). Possible sites of regulatory interaction are indicated on the revised PTS model (Fig. 4.13), and several of these forms of regulation may still occur when the PTS is partially disrupted. I suggest, therefore, that although the H. influenzae PTS transports and phosphorylates fructose, it has been conserved not because it allows cells to respond to fructose availability (indeed, this role may be insignificant because H. influenzae inhabits a consistently fructose-limited environment - see Section 7.2) but because it can integrate multiple signals of nutrient availability and cellular energy and coordinate an efficient cellular response to changing conditions. 4.6.4 cAMP-dependence of competence Since the helix-turn-helix DNA-binding domains of H. influenzae CRP and E. coli CRP are identical, and E . coli CRP can complement an H. influenzae crp strain (28) it is expected that both proteins will recognize sequences showing similarity to the E . coli CRP consensus binding site. Moreover, I predicted the presence of CRP binding sites in the promoter region of a gene or genes required for competence, because the absolute requirement for cAMP and CRP for competence development is well-established (28, 54). As described in Section 4.5,1 have demonstrated that CRP is likely to have high affinity for a set of sequences identified by others as candidate regulatory sites in the promoter region of several competence genes. I propose that under conditions which cause intracellular cAMP levels to rise, the cAMP-CRP 126 complex activates transcription of numerous competence-associated genes, in addition to sxy, contrary to the simple regulatory cascade model proposed by others (105, 243). A potential role for Sxy as a competence-specific regulator is discussed below. 4.6.5 A model for competence development i) Degree of competence does not correlate simply with intracellular cAMP concentration It is difficult to incorporate all existing data on the regulation of competence development under different conditions into a simple model. Clearly, at least basal levels of cAMP are required for competence development in both rich and nutrient-limited media. Disruption of mechanisms activating adenylate cyclase result in reduced but intermediate levels of competence in MIV nutrient-limited medium, and we have demonstrated a correlation between exogenous cAMP concentrations and competence development in both MIV and sBHI by a cya strain (136) (Fig. 4.6). Disruption of the cAMP phosphodiesterase enzyme, which degrades intracellular cAMP, renders otherwise wild-type strains prematurely competent in early exponential phase in rich medium, and can partially reverse the competence defect of pts strains (136) and Chapter Five). These findings all suggest that competence levels are linked to intracellular cAMP concentrations under both sets of conditions. On the other hand, while 25 - 100% of cells become competent under nutrient-limited conditions ( T F m a x = IO"2) (75), a maximum of approximately 1% of cells ( T F m a x = 10"4) become competent at the onset of stationary phase in rich medium (I. R. Dorocicz and R. J. Redfield, unpublished data). Addition of cAMP.to rich medium does not further boost competence, suggesting that the higher levels of competence induced by MIV are not the result of higher intracellular cAMP concentrations. This is supported by the observation that at any given concentration 127 of exogenous cAMP in the 0.05-0.5mM range a cya strain reaches a higher level of competence in MIV medium than in rich medium (Fig. 4.6). In summary, although competence increases with intracellular cAMP levels in both MIV and sBHI, cells in the nutrient-limited medium MIV have the ability to develop higher maximal competence at any given cAMP concentration within a given range of cAMP concentrations. ii) A role for (a) competence specific regulator(s)? As proposed by Dorocicz et al. (54), at least one other regulatory factor (which may be competence-specific) must also regulate expression of competence genes and induction of competence under some conditions and may maximize cAMP-dependent expression of competence genes. It is also possible that expression of the proposed regulator is dependent on cAMP, but that its activation requires a secondary signal. This scenario would allow fine-tuning of induction of competence according to the nature of the cellular environment. In principle, a secondary transcriptional activator can act synergistically with a primary activator by a) proving additional DNA-protein contacts to stabilize the transcription initiation complex, b) creating a DNA conformation that is better recognized by the partner protein, or c) by inducing a conformational change in the partner protein that promotes its interaction with its binding site. A competence-specific factor might act in one of these modes to promote transcription of cAMP-CRP-regulated competence genes. It may be significant that, unlike proposed CRP sites of catabolic and other genes, all of the candidate CRP sites identified in promoters of competence genes (except for that of sxy) contain a conserved C (rather than T) at base 6 and a conserved G (rather than A) at base 17 (Table 4.7). Both changes fall within the most highly conserved 128 motifs of the CRP binding site consensus, and are symmetric. Changing bases at these positions to the E. coli consensus bases T and A, respectively, increases the I$eq score for each sequence by 4.13 (or an average of 27%) (data not shown), implying that these conserved changes in CRE sequences relative to the consensus reduce affinity of the CRP protein for these sites (22). Sequence specificity of DNA recognition by CRP might, however, be altered by interaction with a second regulatory factor, as has recently been demonstrated for CytR/CRP interaction in E. coli (165). Such 'protein-induced fit' could increase the affinity of cAMP-CRP for CRE sites in competence-specific promoters and maximize the cAMP response under nutrient-limited conditions. Could Sxy be the second regulator of competence? Overexpression of the sxy gene from a plasmid has been found to induce 100% competence in cells growing in rich medium (260) suggesting that the Sxy protein mediates the competence-specific signal in nutrient-limitation, and that expression, stability or degree of activation of this proposed regulator may be the limiting factor in competence development in rich medium. However, recent data has suggested that absolute levels of Sxy expression are similar in late exponential phase growth in rich medium, and after transfer to MIV (L. Bannister, unpublished data). This implies that if it is acting as a second regulator, the degree of activation of Sxy (rather than levels of Sxy expression) under different conditions may be the limiting factor in competence development. Activated Sxy may interact with operator sites of com genes or with CRP directly, or may activate an unknown regulatory protein. iii) Multi-factorial regulation of competence More than one combination of regulatory factors may be able to induce similar levels of competence (Table 4.10). In situations where both cAMP levels and activity of a secondary factor are low, competence will be almost undetectable, for example 129 during early exponential phase growth in rich medium (assuming that second regulator activity is low during exponential growth in rich medium). When cAMP levels are high, and second regulator activity is high, competence levels will be high, for example when cells are transferred to MIV medium. Different combinations of intracellular cAMP and second regulator activity can result in apparently similar intermediate levels of competence. For example, pts strains have reduced cAMP levels, but transfer to MIV medium may maximizes the activity of the proposed secondary regulator. Random fluctuations in cAMP concentrations (83) and in the activity of the second regulator will allow some cells to develop competence, and the culture will reach an intermediate level of competence (54). In this model, addition of exogenous cAMP is predicted to restore maximal competence to these strains, and this is seen experimentally (Fig. 4.4). In wild-type cells, cAMP levels are high in late exponential phase growth in rich medium, but I suggest that activity of the proposed second regulator will be lower than the levels induced by transfer to MIV. In some cells, second regulator activity may randomly reach levels that allow expression of competence genes, and again, the culture will reach an intermediate level of competence (54). Since the limiting factor in this situation is activity of the second regulator, addition of exogenous cAMP is not predicted to increase competence. This lack of induction is seen experimentally (54). Table 4.10 describes a best-fit model to explain my experimental observations, but may not be complete. In particular, to explain the wild-type levels of competence reached by pts strains in rich medium (which are believed to have reduced levels of cAMP), it must be assumed that such reduced levels of cAMP are higher than wild-type early exponential phase cAMP levels, and are still sufficient for spontaneous development of competence in late exponential phase. It is possible, however, that further regulatory factors specific to these conditions are involved. 130 S i o r 3 3 WD QJ 04 X i c o o QJ 131 4.6.6 Competence development as a response to nutritional stress In addition to regulating carbohydrate catabolic operons in enteric bacteria, the cAMP-CRP complex is involved in positive regulation of a number of other functions which are not directly involved in carbohydrate catabolism but which make up the global 'hunger response' (158-160) of enteric bacteria to nutritional stress and allow cells to maximize resources and conserve energy in the face of nutritional stress. These include flagellum synthesis and chemotaxis, amino acid biosynthesis, fatty acid utilization, glycogen synthesis and thiosulphate reduction (22). Of 30 unique proteins induced when E. coli cells are starved for carbon, nitrogen or phosphate, 20 are dependent on cAMP for expression, although none of these is absolutely required for survival of the bacteria when starved (142, 213). It is also significant that the product's of many of these genes are also induced, in response to anaerobiosis. Competence development by H. influenzae is a cAMP-dependent (nonessential) function induced by nutrient limitation or the onset of stationary phase (and many of the changes involved in stationary phase in enteric bacteria are actually stimulated by carbon starvation). Moreover, adenylate cyclase activity in this strain - as represented by (3-galactosidase expression - increases under these conditions and is regulated by the PTS in response to availability of fructose and possibly other indicators of cellular energy levels. (Adenylate cyclase is likely to have basal uninduced activity, and may also be subject to non-PTS mediated activation.) The cAMP-dependence of competence, and the regulation of competence by nutritional signals and an enzyme complex (the PTS) which mediates the cellular response to changes in the nutritional environment, all suggest that competence development forms part of the hunger response (158-160) of H. influenzae. H. influenzae is not alone in its ability to develop competence in response to impending starvation. Of more than forty known naturally transformable strains of 132 bacteria (132) (including Gram negative and Gram positive eubacteria, and archaebacteria), only Neisseria gonorrheae is constitutively competent (230). In all other transformable bacteria, competence is inducible. Several organisms, including Azotobacter vinelandii, H. influenzae and Pseudomonas stutzeri (132) show induction of or increased levels of competence under nutrient-limited conditions (limitation for carbon and/or nitrogen and/or phosphate), while Bacillus subtilis will not develop competence in rich medium (58). Competence development in late exponential phase or during the transition to stationary phase has also been observed in Acinetobacter calcoaceticus, A. vinelandii, Staphylococcus aureus, Streptococcus pneumoniae, Anacystis nidulans R2, B. subtilis, Bacillus stearothermophilus, Chlorobium limicola, Methylobacterium organophilum, P. stutzeri, Synechocystis spp. and Vibrio spp. (reviewed in (132)). Clearly, it has proven beneficial to a number of widely divergent bacterial species to bring the ability to develop competence under nutritional control, even though these bacteria may utilize very different mechanisms both for DNA uptake and for monitoring and responding to their nutritional environments. In Chapter Six I describe experiments designed to investigate the nature of the possible nutritional advantage of D NA uptake to H. influenzae. 133 C H A P T E R FIVE A Putative c A M P Phosphodiesterase Modulates c A M P Levels and Optimizes Competence in Haemophilus influenzae 5.1 Introduction Bacterial cells must closely regulate cAMP levels throughout growth to optimize transcription of cAMP-dependent hunger response genes whose expression allow cells to maximize resources and conserve energy in the face of nutritional stress. Because cAMP is a very stable molecule, active mechanisms for elimination, are needed to quickly reduce cAMP concentrations whenever conditions improve. In enteric bacteria, absolute intracellular levels of cAMP are determined not only by the rate of its synthesis, but also by the rates of its excretion and degradation (4). Cyclic AMP is synthesized by adenylate cyclase, which has only basal activity during exponential growth, on preferred sugars. Adenylate cyclase activity is stimulated by the PTS when these sugars are depleted from the medium (reviewed in (174)). Cyclic AMP is excreted when preferred sugars are restored (21, 211), but the regulatory significance of excretion is unclear, and awaits isolation of excretion-defective mutants. Finally, cAMP-specific phosphodiesterases can also reduce cAMP levels by catalyzing cleavage of 3',5'-cAMP to 5'-AMP. Although the regulatory role of cAMP phosphodiesterases has been unclear (23), Imamura et al. (1996) recently demonstrated that the cAMP phosphodiesterase encoded by the Escherichia coli cpdA gene modulates intracellular cAMP levels, and proposed that such phosphodiesterases may regulate expression of cAMP-dependent genes (95). I have shown that a fructose-specific PTS regulates cAMP synthesis by adenylate cyclase, and thus competence development in Haemophilus influenzae (Chapter Four) (134). Efflux of cAMP by this organism has not been studied. H. influenzae does, however, possess a cpdA homologue, ice (66, 95). 134 Experiments described in this chapter were designed to determine whether the ice gene encodes a functional cAMP phosphodiesterase, and to explore whether this phosphodiesterase plays a role in regulation of intracellular cAMP levels and thus of competence development (and other cAMP-dependent processes) under different conditions. (As described in Section 2.4.6, cloning and mutagenesis of ice and construction of the mutant strain was carried out by Caixia Ma. She also carried out the sugar fermentation assays described in Section 5.2.2, the cAMP sensitivity assays described in Section 5.3.2 and the competence assays described in Section 5.4.) 5.2 Ice may encode a cAMP phosphodiesterase 5.2.1 Analysis of the ice gene The gene now known to encode the E. coli cAMP-specific phosphodiesterase was originally characterized as affecting only the expression of the lacZ gene (94), and the gene sequence was submitted to GenBank under the name ice. Imamura et al. (1996) subsequently demonstrated that the E. coli ice gene encodes a 3',5'-cAMP-specific phosphodiesterase (95) and renamed the gene cpdA. The existence of an H. influenzae ice homologue was noted (66, 95); it retains the name ice. The H. influenzae ice gene is predicted to encode a 274 amino acid polypeptide with 71% similarity (53% identity) to its E. coli homologue, CpdA. BLAST searching of the GenBank databases (72) and available bacterial genome sequences detected extensive amino acid sequence identities (E [expect value] < le~ 3 0) between Ice and candidate Ice homologues in only three other bacterial species, all members of the gamma subdivision of Proteobacteria (163) (Table 5.1). In addition, cyclic AMP-specific phosphodiesterases have also been purified from the Proteobacteria Serratia marcescens (162), Salmonella typhimurium(2) and Klebsiella aerogenes (24). As 135 expected, organisms possessing cAMP phosphodiesterase activity or containing sequences showing extensive identity to zee also contain adenylate cyclase (cya) homologues: H. influenzae, E. coli, Actinobacillus actinomycetemcomitans, Pseudomonas aeruginosa and Salmonella typhimurium. Sequences from three further bacterial species showed only limited sequence identity (le-10<E>le-20) to ice (Table 5.1), while searching of the genomes of eighteen other species detected no significant homology (Table 5.2). These findings suggest that cAMP phosphodiesterases may be limited to the Proteobacteria. Interestingly, zee appears to belong to a conserved nucleotide-processing operon: the upstream gene HI#0398 is separated from zee (HI#0399) by only 13bp (Fig. 5.1). Similarly, an HI#0398 homologue is found immediately upstream of the ice homologues of P. aeruginosa and A. actinomycetemcomitans and is separated by only one gene (yqiE) from the E. coli ice gene homologue cpdA. Both HI#0398 and its homologues contain a signature sequence common to members of the MutT family of proteins whose members hydrolyze nucleoside diphosphate linkages in various substrates (161). Although I found no candidate zee-specific promoters (by sequence comparison with the E. coli promoter consensus) I identified two potential promoters upstream of the HI#0398 initiation codon: PI at bp 419321-419351 and P2 at bp 419417-419445. I also identified a candidate binding site for the cAMP-receptor protein (CRP) immediately 5' to P2 (at bp 419394-419416) (Table 4.6), by comparison with the E. coli CRP-binding consensus (22) (Fig. 5.1). These findings suggest that expression of the zee operon is not constitutive, but is probably induced as cAMP levels rise. Since HI#0398 and zee may be coordinately expressed, it is possible that the HI#0398 product also plays a role in regulation of cellular cAMP levels. 136 d o ^ cu d CD « a> CU a> cu vK cu w ( 0 a; 3 d O O u u 03 > 03 03 O 03 03 CJ £ cu 6 c 03 WD o CM CO CM o CM IN O O o o cs N K cu 3 c/i s -S o £ co LO CM NO CM 0 0 I N CM NO 3 o s H H u CM LN L N LO LO NO r H D NO L N CO r H I N NO CO CO L O I N I N CM ss HH 5 o u 5 <u HH o 5 o •5 HH u o cx> u cs o _e 'So 3 <u cs e o s o 3 cu c/3 (X CM L N NO LO CO LO NO CM DH a X i • i - H a cn 03 CM 0 0 I - H NO L O ON N o L N L N CM cn *3 cx> 3 DH £ ft) a ^ HH c_> cs cs S -a cu o ' I & CJ ^ CM L N CM 0 0 I - H LO r H D LO • O L N L N L O r H r H L N CO r H r H r H CU CU CU CU CU Al r H r H r H CM CO L N r H T-H o 0 0 ON O L N L N CO NO r H r H CM CM CM CM CM CM CM CM L N CM <u CS r. ft. cu s •2 cu HH CS O C_> >N CU > 03 x, X i 3 o cu X cj H-» 03 a cu u d cu d cr cu cn x i cu d cu x i •r—I d 03 03 X X i o o X "cu cu •s cn cu X • H S H CJ cn cu X) . fi) <v w CJ 03 f3 >-6 o -a w C cu to O 137 rS •rH VH O J 4-1 cj CCS 4 O QJ > cn O DH rt l -H QJ cj c QJ VH QJ HH QJ O z c o •rH CA) cn QJ U cn 'S cS bC VH o 0 0 C N r-H O A ON N * s 3 CJ 3~> 3 -a O 4 s cu cn CJ 5^ <S H S 3 5 cn 3 cn v. ——* 4 - 4 • * S cn CJ O CS CO.- U C N * cn 58 CS V. 3 Ts .0 "5 CS f s cn 3 cj cj O U O •5 Q C N * .cn "« cj CX) cn 3 cj CJ O cj O V. CX) 4 - 4 55 W C N C N NO ON CO .3 "5 H4 • —-» St CX) bo cn o cj C O C M I - H C O L O l - H L O CM C M CM C M * cn 3 CX) 3 CS cn 3 cj CJ O cj _o ">> -St CS H s CO * V-o *o cj "cu o cj cn 3 cj cj O CJ O 4 - 4 v X cu V. 4 - 4 CO * cx> .« 55 O 3 cu 55 C x . cn 3 cj cj O cj O 4 - 4 a . CX) V. H 4 CO * cn cu 55 cu be o >> SX cn 3 U u o cj O H S sx cu v. 4 s CO r3 • r H VH QJ 4-4 CJ C3 -Q QJ > *4-i CO bO QJ I g ca VH o QJ CJ QJ VH QJ UH QJ o Z 0 'cn cn QJ cj CJ C CS bO VH o C N C N 0 0 C O L O C O o o CO NO cn 55 ,« "3 T S .cn 4-4 cn >> cj cS 3 C M v. cu o TS bo V-3 -0 cu V-v. O CM CM 55 3 v. cu 4s cj cS o CS ~sx C O CS u « o -St CJ CS .cS TS -St U C M r H NO O O O W < C N V--2 ">» sx v. cu H s CJ cS r d o cj "co a; C O r H C N r H r H L O O C M C N r H ^—^ C M C N * cu « cu -St V. o 55 O bo V. cu cn cn CX) r> .cn TS bo 55 55 cu •2 cu cn .cn cu CO O OO NO U U CL, .cn H s cn r ^ cj O -St cj cu 55 C O CS V. cS CS bo o v-co -St E—1 cu « V-CJ o - s ; CJ V-138 In E. coli, UUG is the least efficiently recognized of the three known initiation codons and Imamura et al. (95) have suggested that the cpdA gene may be subject to translational regulation since it initiates at a UUG codon. H. influenzae's ice is predicted to initiate from the efficiently recognized A UG codon, so expression of Ice is unlikely to be regulated in this way. Translation of HI#0398 (but not its E. coli homologue) is predicted to initiate from the less-efficient GUG codon, implying that expression of this gene may be under translational control. Hl#0397 Hl#0398 Hl#0399 Hl#0400 Hl#0401 'xseA hyp. ice hyp. ompPV Figure 5.1 Schematic of the Haemophilus influenzae ice operon Genes ice and HI#0398 are indicated by arrows. Genes homologous to putative E. coli genes of unknown function are indicated as 'hyp.' xseA, exonuclease VII, large subunit; ompPl, outer membrane protein; PI and P2, putative promoter sites; open circle, putative CRP-binding site; inverted triangle, approximate location of spectinomycin-resistance gene cassette insertion in strain RR812. 5.2.2 The ice gene product is a functional phosphodiesterase To determine whether the E. coli and H. influenzae cAMP phosphodiesterase homologues have similar activities, the effect of over-expression of each on cAMP-dependent processes in E. coli was compared. Expression of the E. coli lactose and maltose utilization operons is dependent on cAMP, and Imamura et al. (1996) have 139 shown that over-expression of cpdA in E. coli reduces transcription of lacZ and catabolism of lactose analogues (95). As judged by colony colour on MacConkey agar plates supplemented with 1% lactose or maltose, plasmids carrying the E. coli and H. influenzae homologues of cpdA reduced fermentation of both sugars by E . coli W3110 to similar degrees. Disruption of the ice gene by gene-cassette insertion in pCMP::spc abolished this effect, while vector controls pACYC184 and pGemsxy had no effect on sugar fermentation (Table 5.3). Table 5.3 Effect of ice and cpdA on Escherichia coli sugar fermentation Plasmid Lactose Maltose + + + + + + no plasmid + + pAX923 +/-pACYC184 a + + pCMP +/-pCMP::spc + + pGemsxyb + + E. coli W3110 (lac+) transformants carrying each of the plasmids listed were streaked onto MacConkey agar containing 1% sugar, and colony colour noted. ++: bright red (very good fermentation), +: pink (good fermentation), +/- : pink-white (intermediate fermentation), -: white (no fermentation). a pAX923 control; b pCMP control. 140 P-galactosidase activity gives a more sensitive relative measure of intracellular cAMP concentration in cells expressing different phosphodiesterase homologues. Plasmid pCMP, like pAX923, reduced (3-galactosidase activity by at least 75%. Vector controls did not significantly affect (3-galactosidase expression (Fig. 5.2). 8000 -. ;> < CD CO CO •g CO o o _CO CO o I ca 6000 -\ 4000 -\ 2000 -A W3110 (cpaW+) •D 'E w CO o CO T— O > < Q. CO CM cn X < Q. + E CD (3 CL O CL SH8150(cpdA:kan) Figure 5.2 Reduction of (3-galactosidase expression i n a cpdAnkan E. coli strain by overexpression of the £. coli c A M P phosphodiesterase gene, cpdA, or of its H. influenzae homologue ice (3-Galactosidase activity was assayed as described in Section 2.9, and expressed in Miller Units. Mean values from three replicates are shown. Error bars represent standard error of the mean (SEM). These data are consistent with the prediction that the H. influenzae gene ice encodes a product with activity similar to that of CpdA. The more extreme effect of pAX923 141 on (3-galactosidase activity may reflect sub-maximal expression of the H. influenzae gene in E. coli, and/or minor differences in activity of the two enzymes. 5.3 Ice regulates intracellular cAMP levels in Haemophilus influenzae 5.3.1 The ice mutation increases intracellular cAMP levels Because the presence of the plasmid-borne ice gene limits intracellular cAMP in the E. coli cpdA strain SH8150, its phosphodiesterase product was predicted to influence intracellular cAMP concentrations in H. influenzae. To test this assumption, an ice mutant strain was constructed and the effects of chromosomal ice disruption on known cAMP-dependent processes (sugar fermentation and competence development) was assessed. Utilization of certain sugars by H. influenzae is cAMP-dependent (Section 4.2.1). The cya strain RR668 cannot ferment ribose (54) and mutations in the PTS genes ptsl (134) or err (135) reduce fermentation of ribose (Fig. 5.3) by disrupting PTS-mediated activation of adenylate cyclase and so reducing intracellular cAMP concentrations (Section 4.2.2). Phenol red broth (PRB) assays demonstrated that ice disruption has little effect on ribose fermentation in a wild-type background (Fig. 5.3). I predicted, however, that if the ice mutation prevents degradation of cellular cAMP, it should restore ribose fermentation to strains with low cAMP (ptsl or err), but not to a strain totally lacking cAMP (cya). As expected, an ice cya strain remained unable to ferment ribose, but ice ptsl and ice err strains fermented ribose at almost wild-type levels (Fig. 5.3), presumably because they cannot degrade the small amounts of cAMP that these cells synthesize. 142 X Q. < CD Q. 120 - , 100 80 H o CO cz CD E CD CD CO O _Q Lr 60 J 40 J 20 -I WT cc cya cc ptsl ice cya ptsl err or Strain Genotype Figure 5.3 Effect of ice disruption on ribose fermentation in wild-type, cya or PTS-disrupted backgrounds A f t e r i n o c u l a t i o n i n t o 1% r i b o s e P R B m e d i u m a n d o v e r n i g h t i n c u b a t i o n , p H o f e a c h c u l t u r e w a s m e a s u r e d a n d the p H c h a n g e ( A p H ) c a l c u l a t e d . D e g r e e o f r i b o s e f e r m e n t a t i o n o f m u t a n t s s t r a i n s w a s e x p r e s s e d as a p e r c e n t a g e o f w i l d - t y p e A p H ( w h i c h i s set at 100%) . M e a n v a l u e f r o m th ree r e p l i c a t e s are s h o w n . E r r o r b a r s r e p r e s e n t s t a n d a r d e r r o r m e a n ( S E M ) . D e v e l o p m e n t o f c o m p e t e n c e for n a t u r a l t r a n s f o r m a t i o n i s a l s o c A M P - d e p e n d e n t , a n d i s a s e n s i t i v e m e a s u r e o f i n t r a c e l l u l a r c A M P l e v e l s i n H. influenzae. W i l d - t y p e H. influenzae s t r a i n K W 2 0 r eaches t r a n s f o r m a t i o n f r e q u e n c i e s ( T F ) as h i g h as 10~ 2. T h e cya m u t a t i o n c o m p l e t e l y a b o l i s h e s c o m p e t e n c e d e v e l o p m e n t ( T F < 10~ 7) (54) w h i l e ptsl s t r a i n s s h o w a ~ 1 0 0 - f o l d r e d u c t i o n i n c o m p e t e n c e ( T F = 7 x 10~ 5) (134). It w a s e x p e c t e d tha t ice d i s r u p t i o n s h o u l d n o t affect c o m p e t e n c e d e v e l o p m e n t i n a w i l d - t y p e b a c k g r o u n d , s i n c e s u c h a s t r a i n i s e x p e c t e d to h a v e w i l d - t y p e o r h i g h e r 143 levels of intracellular cAMP. Moreover, ice disruption should not correct the competence defect of a cya strain, but should increase competence in PTS-disrupted strains where cAMP is present in limiting concentrations. As expected, competence remained undetectable in a cya ice strain (TF < lt>7), but disruption of the phosphodiesterase gene in a ptsl background boosted competence 10-fold (TF = 7 x 10"4) (Fig. 5.4). These data confirm that H. influenzae cells lacking the z'ec-encoded putative cAMP phosphodiesterase have increased levels of intracellular cAMP. > o >. o c CD Z5 cr CD tz o cc E o c CC 10"2 n l O ' 3 10"4 10"5 * 10-6 -J 10 -7 -J WT ICC f cya ICC cya ptsl ICC ptsl Figure 5.4 Competence of ice strains after transfer to nutrient-limitation Early exponential-phase cells were transferred to MIV nutrient-limited medium, and maximal transformation frequency measured at 100 minutes post-transfer, as described in Section 2.7. Mean values from three replicates are shown. Error bars represent standard error mean (SEM). 144 5.3.2 Sensitivity of Haemophilus influenzae ice strains to exogenous cAMP Alper and Ames (2) found that the presence of a cpd mutation in S. typhimurium strains lacking endogenous cAMP (cya mutants) reduced 10-fold the exogenous cAMP required for expression of catabolic operons. The cAMP sensitivity of icc+ and ice H. influenzae strains was examined by assaying the sensitivity of competence development to exogenous cAMP. To prevent masking of the effect of exogenous cAMP by high levels of endogenous cAMP, a cya background was used. As expected, the ice strain was much more sensitive to exogenous cAMP: the lowest concentration tested (lOuM) increased competence 10,000-fold in this strain, but only three-fold in the icc+ strain (Fig. 5.5). These data imply that the H. influenzae ice strain is unable to degrade exogenously-supplied cAMP. 2 i c r 2 -, [cAMP] (mM) Figure 5.5 cAMP sensitivity of ice cya and icc+ cya Haemophilus influenzae strains cAMP was added to samples of each strain grown to mid-exponential phase (OD600 = ~0.3) in sBHI, and cells incubated in sBHI + cAMP until late exponential phase (OD600 = ~1.0). Transformation frequency was assessed as described in Section 2.7. Representative results are shown. 145 5.4 Regulation of competence development by a putative c A M P phosphodiesterase 5.4.1 Ice regulates competence throughout growth in rich medium Because Ice apparently influences intracellular cAMP levels in H. influenzae, it was expected that ice disruption should affect competence development. If Ice is expressed or active only when intracellular cAMP levels are already high (for example, during transitions into stationary phase or starvation), then an ice strain should nevertheless develop wild-type competence during growth in rich medium. If, however, Ice plays a routine role in modulating cAMP levels throughout growth, the intracellular cAMP concentration of an ice strain should be abnormally high during the exponential phase of growth in rich medium (when cAMP concentrations are thought to be low), causing premature competence development. The ice strain RR812 was found to develop spontaneous competence unusually early during exponential growth in rich medium (Fig. 5.6). This observation is consistent with a model in which Ice regulates intracellular cAMP concentrations throughout growth, and not merely when cAMP levels are high. 5.4.2 Ice regulates timing of starvation-induced increases in intracellular cAMP The simplest model predicted that inactivation of the putative cAMP phosphodiesterase encoded by ice should increase intracellular cAMP concentrations, and that an ice strain should achieve at least wild-type levels of competence. It was therefore surprising to discover that the ice strain failed to reach even wild-type levels of competence in both rich and nutrient-limited media (Figs. 5.6 and 5.4). I subsequently determined that this was not due to a simple toxic effect of high intracellular cAMP, since up to lOmM exogenous cAMP did not significantly affect H. influenzae viability (data not shown). Moreover, ice disruption itself does not reduce viability of this strain - it grows with a normal doubling time in batch culture. 146 O I ' 1 ' I 1 I 0 100 200 300 Time (Mins.) Figure 5.6 Spontaneous late exponential phase competence of wild-type and ice Haemophilus influenzae strains in rich medium Transformation frequencies were assayed throughout culture growth in rich medium (sBHI) as described in Section 2.7.1. Filled squares, KW20; open circles, RR812 (ice). Competence experiments were repeated three times with independent cultures, and each experiment gave essentially similar results. Representative results are shown. Instead, I reasoned that the timing of an increase in intracellular cAMP relative to growth rate or nutrient availability might be significant in the induction of maximal competence. To investigate this idea, I assessed competence of a cya strain provided 147 with ImM exogenous cAMP either continuously or only after transfer of cells to the competence-inducing medium MIV. I found that cya cells that encounter a dramatic increase in cAMP coincident with nutrient limitation develop wild-type competence levels. However, cells cultured in ImM cAMP prior to transfer to MIV show delayed and reduced competence, similar to the ice strain (Fig. 5.7). These data suggest that the timing of a cAMP increase is critical in competence induction and that Ice regulates this timing in H. influenzae. 10-2 I I I I 0 50 100 150 Time After Transfer to MIV (Mins.) Figure 5.7 MlV-induced competence of wild-type and ice strains, compared with RR668 (cya) pre-cultured with or without ImmM cAMP Transformation frequencies were assayed as described in Section 2.7. Filled squares, KW20 (WT); open circles, RR812 (ice); open triangles, RR668 (cya) transferred to MIV + ImM cAMP; filled triangles, RR668 (cya) cultured in sBHI + ImM before transfer to MIV + ImM cAMP. Competence experiments were repeated three times with independent cultures, and each experiment gave essentially similar results. Representative results are shown. 148 5.5 Discussion 5.5.1 cAMP phosphodiesterase is not the only modulator of intracellular cAMP levels Experiments described in this chapter demonstrated that disruption of the putative H. influenzae cAMP-phosphodiesterase gene, ice, increases cAMP-dependent sugar fermentation and competence development in low-cAMP H. influenzae strains. Although the simple model predicted that ice disruption should increase intracellular cAMP, the ice strain is not constitutively competent. Like wild-type cells, this strain shows almost undetectable competence in early exponential phase of growth in rich medium, at a time when intracellular cAMP is predicted to be low, and reaches maximal competence levels when cAMP levels are predicted to be high. Results of the experiments described in this chapter therefore suggest that although Ice modulates cellular cAMP levels, the absolute concentration of intracellular cAMP levels is at least partially regulated by other factors (possibly in response to growth phase and/or nutrient availability). This is consistent with the conclusion that cAMP phosphodiesterases are not the sole, or even primary, element of control of intracellular cAMP concentrations (23). 5.5.2 cAMP phosphodiesterase may protect cells from the effects of excess intracellular cAMP cAMP phosphodiesterases may protect cells from the transcriptional repression that can result from excessive cAMP (2). Such repression may be caused by the cAMP-CRP complex directly: although this complex is best-known as a transcriptional activator, it can also function as a transcriptional repressor. In addition, excessive cAMP may prevent efficient transcription of cAMP-dependent genes by overloading the CRP complex: the CRP protein has two identical subunits, each of which can 149 bind one molecule of cAMP, and the C R P - C A M P 2 complex has much lower affinity for CRP binding sites that the CRP-cAMPi complex. 5.5.3 Uncontrolled cAMP increases may repress transcription of competence genes It was puzzling that disruption of the putative H. influenzae phosphodiesterase gene apparently increased intracellular cAMP levels (as indicated by ribose fermentation capacities of ice strains, Fig. 5.3), but reduced maximal competence levels in both stationary phase and MIV (Figs. 5.6 and 5.4). I suggest that for maximal competence, maximal expression of cAMP-dependent competence genes must coincide with maximal activity of proposed secondary competence-inducing factors (see Section 4.6.5) that occur at the onset of stationary phase, or on entry into a nutrient-limited environment. In the ice strain, uncontrolled increase in intracellular cAMP may repress transcription of cAMP-dependent competence genes (as described above) before secondary competence-inducing signals occur. This would explain the reduced maximal competence levels and the delay in MIV-induced competence observed. One role of the cAMP-phosphodiesterase may therefore be regulation of the timing of increases in intracellular cAMP. 5.5.4 A role for Ice in regulation of competence development Phosphodiesterase activity, like PTS activity, may also be regulated by nutritional signals: increased levels of free phosphate have been shown to negatively regulate phosphodiesterase activity (198) as well as maximize PTS-mediated activation of adenylate cyclase (Section 4.6.3), allowing a coordinated response to changes in cellular energy levels. Changes in intracellular cAMP levels in response to changes in nutrient availability are therefore likely to be determined by phosphodiesterase activity as well as adenylate cyclase activity (and probably also by the rate of cAMP 150 efflux by this organism). I suggest that activity of a cAMP phosphodiesterase must therefore be incorporated into any complete model of regulation of competence induction in H. influenzae. 151 CHAPTER SIX C o m p e t e n c e D e v e l o p m e n t b y Haemophilus influenzae is R e g u l a t e d b y A v a i l a b i l i t y of N u c l e i c A c i d P r e c u r s o r s 6 .1 I n t r o d u c t i o n More than one regulatory event may be required for induction of maximal competence development in H. influenzae (Section 4.6.5) (54) and, as discussed, the PTS may recognize and respond to a number of indicators signalling changes in the nutritional environment (Section 4.6.3). In an attempt to elucidate the nature of further competence-regulating environmental signals, I considered the potential nutritional benefits to the cell of uptake of exogenous DNA. In H. influenzae, only about 15% of radioactively labelled transforming DNA is incorporated into the chromosome by homologous recombination and the remainder is degraded (173). Thus at least 85% of transported DNA is potentially available to the cell as carbon, nitrogen and energy sources and/or as nucleotide precursors (234). 6.1.1 DNA as a source of carbon? Might H. influenzae utilize the nucleotides of transported DNA as a source of carbon? Escherichia coli and Salmonella typhimurium have the genetic potential to utilize purine and pyrimidine nucleosides and deoxyribonucleosides as sole source of carbon and energy (84), and can grow on cytidine, uridine, adenosine, inosine, guanosine, xanthosine, deoxycytidine, deoxyuridine, thymidine, deoxyadenosine, deoxyinosine and deoxyguanosine (130). Moreover, recent studies have demonstrated that E. coli can utilize free DNA as a sole carbon source (S. Finkel, personal communication). The catabolism of the pentose or deoxy-pentose sugars of nucleosides by enteric bacteria is catalyzed by the combined action of eight enzymes, 152 (Table 6.1) and the glyceraldehyde-3-phosphate and acetaldehyde produced are fed into the glycolytic pathway (see Figure 4.1). H. influenzae possesses a reduced set of nucleoside catabolism genes (cdd, udp, deoD; Table 6.1) which nonetheless are predicted to be sufficient for extraction of (deoxy)ribose-l-phosphate from purine and pyrimidine (deoxy)ribonucleosides (Fig. 6.1). However, although this organism is also predicted to be able to catalyze conversion of deoxyribose-5-phosphate (via deoC) and ribose-5-phosphate (via tktA and talB, respectively; Table 6.1) into glycolytic intermediates, it apparently lacks a key enzyme of the nucleoside catabolic pathway: BLAST searching of the H. influenzae genome sequence revealed no homologue of DeoB, the mutase which in enteric bacteria, converts (deoxy)ribose-l-phosphate to (deoxy)ribose-5-phosphate (Fig. 6.1). E. coli and S. typhimurium deoB mutant strains are unable to use nucleotides as a carbon source (156). I have found that H. influenzae does not ferment purine or pyrimidine ribonucleosides (data not shown), and it is now known that an earlier report that this organism could use deoxyribose as a carbon source (109) was in error (54). These observations imply that H. influenzae probably cannot directly utilize nucleosides as a source of carbon and energy. 153 CO « N R co 3 QJ d tool o "o s o X o LO CO I -H I—I X o 00 CM o CO t— I LO o NO r H r-H I -H * r—I X CO CM o r H I 1 X LO CM r—I X 73 CU N ~CS 4-» rs U d O •i-H o rS CU ro X z + QJ d VH x o Q> 3 CU d u X o cu 73 ro X z + cu d '55 o o cu 73 cu d cn O d cu 73 rs ^ X o cu 73 cj rS VH 3 CU cn O X cu d I-H 2 OJ d n cS X + cu cn O A J CU d ' in O AH d rS X cj rS VH CU d X 4-t + PH CU cn O X VH X o cu 73 cu d 73 • i-H VH d >^  X o OJ 73 QJ d • r— I -a r ^ J d OJ c 'VH DH + PH OJ cn o X o cu 73 cn QJ 73 cn O cu TJ d ri o X X o cu 3 QJ d -VH d DH PH I LO I QJ cn O X> 'C X o QJ 73 d PH I QJ cn O A J X O QJ 73 PH I CN QJ cn O DH QJ X o 73 QJ cn + PH j2 co QJ 73 ^ X QJ 73 QJ 73 X QJ 73 4-» QJ CJ rS + PH CO I cu 73 X cu 73 CS VH QJ CJ "too LO I QJ cn O A J VH X o QJ 73 CS VH QJ U "CS X LO l QJ cn O •f O PH - r 1 X PH P LO QJ cn O X CO QJ 73 >, X QJ 3 VH QJ cj >^ "tob + NO i QJ cn O 4-H CJ .VH l i b 4-LO i QJ cn O X + i QJ cn O VH 4-t >^  VH QJ NO I QJ cn O H—• CJ d VH I QJ cn O DH QJ X O 73 QJ cn - 3 + PH I CO I QJ 73 >-, A ^ QJ 3 'cS VH QJ U "bb QJ cn O VH X * t cu QJ d QJ U O cj w QJ cn cS d CS QJ 73 QJ d CJ -a "a cj QJ cn rs d CS QJ 73 QJ d •i-H cn o d QJ 73 -CS TS TS e QJ cn rs VH O X DH cn O X DH QJ d 73 •i-H VH d sx TS R QJ a> AH "3 o DH' cn O X DH QJ d • r H cn O 4-t d cS X ^ v SX cs X o x DH cn O X DH QJ d o co TS CU cn CS O x DH cn O X DH CU 73 • rH cn O QJ T J d d V Q o CO TS QJ cn cs d S o x> • r H VH X o cu 73 CQ o co TS QJ cn r - H "o 3 "cS o r Q • r H VH >, X o QJ 73 QJ cn cs QJ r^ cn d CS • VH u o CO J J TS H S QJ cn cs 'o 3 cn d cs VH £9 154 cytoplasm dCTP glycolysis V periplasm ribose-5-PH*"*'ribose-1 -P' (no DeoB) Apt/G£t_ ATP i Cdd (deoxy)ribo-nucleosides NupC UshA A|JPl-^ dADP • dATP AMP i IMP T XMP T GMP T GDP' T GTP dNTPs (ready to use) (deoxy)ribo-nucleoside phosphates kinases external hydrolysis T DNA/RN4 dNMPs \ internal hydrolysis DNA dGDP 1 dGTP Figure 6.1 Pathways of nucleotide synthesis and salvage in Haemophilus influenzae Three potential routes for obtaining nucleic acid precursors are shown: competence, nucleoside salvage, and de novo nucleotide synthesis. Enzymes responsible for de novo pyrimidine nucleotide synthesis are encoded by: pyrBICDEFGH, udp, udk, cmkA, nrdAB, tmk, thyA, ndk. Enzymes involved in de novo purine nucleotide synthesis are encoded by: purFDGIECBHJAB, adk, nrdA, ndk, guaAB, gmk (240). A M , C N , U N , T N , G N represent pyrimidine and purine nucleosides. A, C , U, A, G represent free purine and pyrimidine bases. Nucleotide names are shown in full in the List of Abbreviations (pp. xvii -xix). Enzymes and proteins involved in nucleoside transport and salvage are indicated (Table 6.3). Shaded box/dashed arrow represents absence of DeoB (Table 6.1). 155 6.1.2 DNA as a source of nitrogen? Among transformable bacteria, members of Pseudomonas, Bacillus and Streptococcus genera have been shown to use the purine/pyrimidine salvage pathways to supply carbon and/or nitrogen. In particular, deamination of cytidine is common and supplies nitrogen in the readily usable form of ammonia (156). If transformation evolved to allow scavenging of DNA as a nitrogen source, one might expect competence to be regulated in the same way as pathways of genes for other secondary nitrogen sources, that is, by nitrogen source availability. The H. influenzae genome encodes homologues of the E. coli enzymes cytidine deaminase (51.2% identity/ 64.6% similarity to Cdd, Table 6.1) and deoxycytidine triphosphate deaminase (76.2% identity/ 87% similarity to Dcd, HI#0133), giving this organism the ability to catabolize nucleosides and release free ammonia (Table 6.1). Moreover, competence can be induced in H. influenzae by shifting an exponentially growing culture from a medium rich in ammonia to a medium containing none (90). Development of competence by ammonium-starved Azotobacter vinelandii cells is controlled by nitrogen catabolite repression (164). Although H. influenzae appears to lack homologues of NtrB and NtrC - components of the E. coli nitrogen regulatory response (190) - and the nitrogen-specific sigma factor (o 5 4), it nevertheless possesses genes predicted to encode the necessary components for nitrogen catabolite repression (Table 6.2). Together, these factors comprise a functional system which may regulate gene expression in response to nitrogen source availability (Fig. 6.2) and which could regulate competence by activation of unknown transcriptional activators of competence genes and/or by affecting the phosphorylation state of the PTS (29). These observations suggest that H. influenzae may develop competence in response to a reduction in nitrogen source availability in the environment in order to utilize the nucleotide components of transported DNA as a source of nitrogen. However, further investigation of this possibility is beyond the scope of this thesis. 156 Table 6.2 Predicted nitrogen catabolite repression genes of Haemophilus influenzae H I # G e n e P r o d u c t P r o d u c t 1719 glnD u r i d y l y l t r ans fe rase ( U T a s e ) S e n s o r o f the i n t r a c e l l u l a r g l u t a m i n e / a -k e t o g l u t a r a t e r a t i o (a m e a s u r e o f n i t r o g e n a v a i l a b i l i t y ) ; A c t i v a t e s P I I . 0337 glnB n i t r o g e n - s p e c i f i c r e g u l a t o r P I I C o n t r o l s t r a n s c r i p t i o n o f n i t r o g e n -r e g u l a t e d genes ; A c t i v a t e s a d e n y l y l t r ans fe rase ; S t i m u l a t e s p h o s p h o r y l a t i o n o f P T S ? 0069 glnE a d e n y l y l t r ans fe rase ( A T a s e ) A c t i v a t e s G S . 0865 glnA g l u t a m i n e s y n t h a s e ( G S ) A s s i m i l a t e s N H 3 1147 ptsN E n z y m e I I A N t r P h o s p h o r y l a t e d b y the P T S ; N e g a t i v e l y r e g u l a t e s n i t r o g e n - r e g u l a t e d g e n e s . T h e r o l e o f e a c h c o m p o n e n t i n n i t r o g e n c a t a b o l i t e r e p r e s s i o n i s s h o w n i n F i g u r e 6.2. 157 Transcriptional regulation? (competence genes?) INACTIVE ACTIVE Glutamate + NH 4 ^ Glutamine Figure 6.2 Possible mechanisms of nitrogen catabolite repression of catabolic and competence genes in Haemophilus influenzae This schematic was adapted from that of Charbit (29). H. influenzae genes encoding components of the nitrogen catabolitet response system are shown in Table 6.2. In response to nitrogen starvation, UTase uridylates PII. Modified PII stimulates de-adenylation (and thus activation) of glutamine synthase (GS), which in turn catalyzes assimilation of ammonium. It has also been suggested that unmodified PII may directly or indirectly stimulate activity of an unknown phosphatase (Pase) which may regulate transcription of other catabolic (and competence?) genes by influencing the phosphorylation state of the PTS and/or other uncharacterized transcriptional regulators (TR) (see Section 4.6.3). 158 6.1.3 DNA as a source of nucleic acid precursors? Perhaps more significantly, transport of exogenous DNA could provide H. influenzae with ready-made nucleotide precursors for synthesis of DNA and RNA. Synthesis of nucleic acids has been calculated to use -22% of the energy budget of glucose-grown cells (237) of which some 70% is expended in synthesis of nucleic acid monomers (nucleotides) (96). Salvage pathways allow cells to scavenge preformed bases and nucleosides, and to reutilize bases and nucleotides produced endogenously as a result of nucleotide turnover (268), providing cells with a significant energetic advantage. Indeed, enteric bacteria will preferentially scavenge exogenous nucleosides rather than synthesize them de novo: in the presence of free bases or nucleosides, de novo nucleoside synthesis enzymes are inhibited by feedback inhibition, and their expression is greatly suppressed (268). Moreover, exogenous RNA can be used as a total pyrimidine source by pyrimidine-requiring S. typhimurium mutant strains (257), implying that nucleotide salvage pathways can also process scavenged nucleic acids. Table 6.3 Predicted nucleoside salvage pathway genes of Haemophilus influenzae H I # Gene Product 0206 ushA 5'-(deoxy)ribonucleotidase 0583 cpdB 3'-ribonucleotidase 1116 nupC nucleoside uptake system C 1230 apt adenine phosphoribosyl transferase 0674 gpt xanthine/guanine phosphoribosyl transferase 0132 udk uridine kinase 1228 upp uracil phosphoribosyl transferase Gene names and functions are as described by Zalkin and Nygaard (268), Neuhard and Kelln (157) and the EcoCyc Worldwide Web database (60). 159 H. influenzae can transport DNA as described (Section 1.2), and also encodes enzymes and transporters which catalyze uptake of free nucleosides and processing of these into new nucleic acid precursors (Table 6.3). The expectation that these enzymes allow cells to recycle the nucleotide degradation products of transforming DNA is supported by the observation that the bulk of labelled unrecombined DNA is incorporated as individual nucleotides into the chromosome (104, 173). Moreover, in an early study, Miller and Huang found that addition of ~7.5 mM of the purine precursor inosine to a synthetic nutrient-limited medium inhibited competence development 4000-fold (148), suggesting that in the absence of the precursor H. influenzae may satisfy its purine requirements by transporting exogenous DNA. The ability to take up exogenous DNA may, therefore, have evolved as a means of scavenging nucleic acid precursors. If this is the case, one might expect competence to be regulated by availability of free nucleotides, since development of competence and transport of large charged hydrophilic DNA molecules across the cell membrane may be more costly and more risky (see Section 1.3.1) to the cell than salvage of free nucleosides. Experiments described in this chapter were designed to determine whether supplying H. influenzae cells with nucleic acid precursors prevented or reduced competence development, and to investigate whether any competence-regulating effects of free nucleosides or nucleotides are mediated by the PTS and/or by changes in intracellular cAMP levels. 6.2 Inhibition of competence by purine ribonucleosides To determine whether nucleotide availability influenced competence, I assessed the competence development of wild-type cells transferred to the nutrient-limited medium MIV supplemented with ribonucleoside or deoxyribonucleoside monophosphates or triphosphates. Competence in the presence of the pyrimidine 160 and purine precursors uracil and hypoxanthine, respectively, was also tested. Intracellular concentrations of purine nucleotides in enteric bacteria have been reported in the 1-5 mM range (169), and so a test concentration of 5mM of each precursor or nucleotide was chosen to approximate physiologically relevant nucleoside concentrations. Figure 6.3 shows that while nucleoside precursors, deoxyribonucleoside monophosphates and triphosphates, and ribonucleoside triphosphates had little effect on competence, the presence of 5mM ribonucleoside monophosphates reduced competence several hundred-fold. > o o c CD ~J cr CD rz o 05 E o CO c CO I— 1 0 - 1 10 -2 1 0 -3 -4 1 0 1 0 " 5 MIV uracil + |\jyp only hypoxanthine NMP dNTP dNMP Figure 6.3 Competence development by Haemophilus influenzae in M I V medium supplemented with nucleotides or nucleotide precursors Wild-type H. influenzae cells in early exponential phase of growth in rich medium were transferred to MIV medium supplemented with either nucleotide precursors (5mM of each) or nucleotides (5mM of each; 20mM total). Transformation frequency was assessed as described in Section 2.7. NTP, ribonucleoside triphosphates; NMP, ribonucleoside monophosphates; dNTP, deoxyribonucleoside triphosphates; dNMP, deoxyribonucleoside monophosphates. Mean data from three replicates are shown. Error bars represent standard error mean (SEM). 161 The effect of individual ribonucleoside monophosphates on competence development by wild-type strains was tested, revealing that only purine ribonucleoside monophosphates reduce competence development by this organism (Fig. 6.4). While it might be hypothesized that free nucleotides reduce competence by simply competing with exogenous DNA for an as yet uncharacterized uptake system, the lack of effect of pyrimidine nucleosides on competence suggests that this is not the case, and that purine nucleosides are recognized and transported by a separate system from DNA. Presence of the non-phosphorylated ribonucleosides adenosine and guanosine also reduced competence by at least one hundred-fold, although adenosine had a less severe effect than AMP. This is consistent with the early report (148) that the purine nucleoside inosine inhibits competence. However, the free purine bases adenine and guanine (Fig. 6.4) or free ribose (not shown) reduced competence less than three-fold, suggesting that the observed regulatory effect requires both the ribose and base nucleoside moieties. Dosage-dependence studies demonstrated that the competence-regulating effect of both AMP and GMP is concentration-dependent and can be detected at concentrations as low as 0.1 mM (Fig. 6.5), well within the physiological range of nucleotide concentrations measured in bacterial cells (169). In rich medium, presence of 5mM AMP or GMP did not affect growth rate, but reduced maximal competence by ~ 100-fold and ~ 10-fold, respectively (Fig. 6.6), suggesting that the regulatory mechanism mediating competence repression by AMP or GMP operates in both nutrient-limited and nutrient-rich environments. Intracellular pools of purine nucleotides may be influenced by uptake of free nucleotides or degradation of transported DNA or RNA. Together, these observations imply that competence development in H. influenzae is regulated in response to concentrations of free nucleotides that it may encounter in its natural environment or accumulate intracellularly (see Section 6.4.2). 162 o > o o c CD CT <D CO E to c co IO' 1 10-2 IO" 3 10"4 10"5 MIV NMP only (20mM) AMP GMP CMP UMP 5 m M r ibonuc leos ide m o n o p h o s p h a t e s CD c tn o c CD "D CO CD C CO o c co CD c 'c CD -o CO CD c 'c CO 5 m M r ibonuc leos ides 5 m M n u c l e o b a s e s Figure 6.4 Competence development by Haemophilus influenzae i n M I V medium supplemented with ribonucleoside monophosphates, ribonucleosides or purine bases Wild-type H. influenzae cells in early exponential phase of growth in rich medium were transferred to MIV medium supplemented with either ribonucleoside monophosphates (NMP), purine ribonucleosides or their respective bases. Transformation frequency was assessed as described in Section 2 . 7 . Mean data from three replicates are shown. Error bars represent standard error mean (SEM). 163 1 1 1 1 1 0.001 0.01 0.1 1 1 0 Nucleotide Concentration (mM) Figure 6.5 Dosage-dependence of competence development on purine ribonucleoside monophosphates Wild-type H. influenzae cells in early exponential phase of growth in rich medium were transferred to MIV medium supplemented with different concentrations of AMP or GMP. Transformation frequency was assessed as described in Section 2.7. Mean data from three replicates are shown. Error bars represent standard error of the mean (SEM). 164 Time (Mins.) Figure 6.6 Competence development by Haemophilus influenzae in r ich medium supplemented w i t h AMP or GMP Cultures were sampled at time intervals during growth in supplemented brain heart infusion medium + 5mM AMP or GMP, and transformation frequency assessed as described in Section 2.7. Competence assays were repeated three times with independent cultures, and each experiment gave essentially similar results. Representative data are shown. 165 6 . 3 Mechanism of regulation exerted by purine ribonucleoside monophosphates 6.3.1 Purine ribonucleoside monophosphates do not alter activity of Sxy, a positive regulator of competence H. influenzae strain RR563 carries a point mutation (sxy-1) in the gene encoding Sxy (HI#0601), a putative positive regulator of competence (Section 4.5). In rich medium this strain is 100 to 1,000 times more competent than wild-type (186)) and it is proposed that the sxy-1 mutation increases the abundance or activity of Sxy (260). I reasoned, therefore, that if purine ribonucleoside monophosphates reduce competence development in wild type strains by reducing Sxy expression or activity, the sxy-1 hyper-competence mutation should overcome this effect and the sxy-1 strain should develop wild-type levels of competence even in the presence of AMP or GMP. I found, however, that the presence of 5mM AMP or GMP in MIV medium reduced competence development by this strain approximately 50-fold (Fig. 6.10), implying that the purine ribonucleoside effect is not mediated via changes in Sxy expression or activity. The proposed increase in Sxy abundance/activity in the sxy-1 strain may, however, partially compensate for the competence-repressing effects of purine ribonucleosides, accounting for the less extreme effect of AMP/GMP on competence of this strain compared to wild-type. 6.3.2 The purine nucleoside monophosphate response is not mediated by the stringent response system To further investigate the mechanism by which AMP/GMP repress competence development in H. influenzae, I considered the possible roles of known bacterial regulatory pathways whose effects may be transmitted or mediated by changes in intracellular levels of purine nucleotides. One such regulatory system is the stringent response system of enteric bacteria. This system mediates a pleiotropic response to amino acid starvation, and results in inhibition of the synthesis of the 166 c e l l u l a r m a c h i n e r y ( D N A , r R N A , t R N A ) a n d a s t i m u l a t i o n o f t he s y n t h e s i s o f p r o t e i n s r e l e v a n t to n u t r i t i o n a l s t ress . T h i s i n h i b i t i o n o c c u r s at the l e v e l o f t r a n s c r i p t i o n , a n d i s m e d i a t e d b y the p o l y - p h o s p h o r y l a t e d n u c l e o t i d e ( p ) p p G p p w h i c h a c c u m u l a t e s i m m e d i a t e l y i n r e s p o n s e to a m i n o a c i d s t a r v a t i o n (264). S y n t h e s i s o f ( p ) p p G p p ( F i g . 6.7) is p r i m a r i l y c o n t r o l l e d b y ( p ) p p G p p s y n t h e t a s e I ( R e l A ) , the p r o d u c t o f the relA g ene , w h i c h t rans fe r s the p \ y - p h o s p h a t e s f r o m A T P to the r i b o s e 3 ' - h y d r o x y l o f G D P o r G T P (26). T h e m e c h a n i s m s o f b o t h n e g a t i v e a n d p o s i t i v e t r a n s c r i p t i o n a l r e g u l a t i o n i n d u c e d b y ( p ) p p G p p are c o m p l e x a n d p o o r l y c h a r a c t e r i z e d , b u t a re b e l i e v e d to i n v o l v e , i n p a r t , ( p ) p p G p p - m e d i a t e d a l t e r a t i o n i n c l o s e d c o m p l e x f o r m a t i o n b y R N A p o l y m e r a s e at c e r t a i n p r o m o t e r s (26). S y n t h e s i s o f ( p ) p p G p p a l s o r e s u l t s i n a dec rease i n i n t r a c e l l u l a r p o o l s o f G T P a n d A T P o f a b o u t 4 0 % a n d 3 0 % , r e s p e c t i v e l y (169), a n d a c e l l u l a r r e s p o n s e to the d e c r e a s e i n c e l l u l a r A T P / G T P m a y a l s o a c c o u n t fo r s o m e o f the m u l t i f a r i o u s effects o f a m i n o a c i d s t a r v a t i o n . H. influenzae p o s s e s s e s h o m o l o g u e s o f the genes i n v o l v e d i n ( p ) p p G p p m e t a b o l i s m ( T a b l e 6.4), a n d e x p r e s s i o n p a t t e r n s o f a n u m b e r o f s t r i n g e n t - r e s p o n s e r e g u l a t e d g e n e s (B . W r i g h t , p e r s o n a l c o m m u n i c a t i o n ) a re s i m i l a r to p a t t e r n s o f c o m p e t e n c e d e v e l o p m e n t b y H. influenzae. It s e e m e d p o s s i b l e , t he r e fo re , tha t e x p r e s s i o n o f c o m p e t e n c e genes m i g h t be r e g u l a t e d i n p a r t b y the s t r i n g e n t r e s p o n s e to a m i n o a c i d s t a r v a t i o n w h e n c e l l s are t r a n s f e r r e d to the a m i n o - a c i d l i m i t e d m e d i u m M I V . I h y p o t h e s i z e d tha t the c o m p e t e n c e - r e p r e s s i n g effect o f p u r i n e r i b o n u c l e o s i d e m o n o p h o s p h a t e s o n H. influenzae m i g h t be the r e s u l t o f f e e d b a c k i n h i b i t i o n o f ( p ) p p G p p s y n t h e s i s b y R e l A , w h i c h m i g h t in t e r fe re w i t h ( p ) p p G p p - m e d i a t e d p o s i t i v e r e g u l a t i o n o f c o m p e t e n c e genes . A l t e r n a t i v e l y , a d d i t i o n o f p u r i n e r i b o n u c l e o s i d e m o n o p h o s p h a t e s m i g h t r e s to r e A T P / G T P p o o l s to n o r m a l l e v e l s a n d p r e v e n t i n d u c t i o n o f c o m p e t e n c e b y a p u t a t i v e r e g u l a t o r o f a r e s p o n s e to r e d u c e d i n t r a c e l l u l a r c o n c e n t r a t i o n s o f A T P / G T P . 167 Pi AMP p p p G p p 9PP p p G p p spoT G T P T G D P ndk PPi ATP NDP NTP Figure 6.7 Predicted routes of (p)ppGpp metabolism by the Haemophilus influenzae stringent response The enzymes predicted to be involved in (p)ppGpp metabolism are represented by their respective structural genes, which are listed in Table 6.4. In amino acid starvation, RelA is activated by a complex comprising mRNA, ribosomes, and uncharged tRNAs. This schematic adapted from Cashel et al. (26). To determine whether competence is regulated by elements of a H. influenzae stringent response, I constructed an H. influenzae relA strain (Section 2.4.7), which is expected to be unable to accumulate (p)ppGpp (26). I found, however, that this strain develops essentially wild-type levels of competence in both MIV nutrient-limited medium (Fig. 6.10) and in late exponential phase of growth (data not shown). These data imply that if the H. influenzae stringent response system functions similarly to that of enteric bacteria, it does not regulate expression of competence genes. Moreover, MlV-induced competence development by this strain was reduced ~15 and ~150-fold by addition of AMP or GMP, respectively, to the medium, suggesting that purine nucleoside monophosphate-induced inhibition of competence is not dependent on a functional stringent response system. 168 Table 6.4 Haemophilus influenzae genes of the stringent response system Comparison with E. coli homologue HI# Gene Product % Identity % Similarity 0334 relA GTP pyrophosphokinase 63 81 1741 spoT guanosine-3',5'-bis(diphosphate) 3'- 58 77 pyrophosphohydrolase 0876 ndk nucleoside diphosphate kinase . 63 74 0695* gPP guanosine pentaphosphate 43 82 phosphohydrolase The role of each enzyme in metabolism of (p)ppGpp is indicated in Figure 6.7. * This gene was identified as a putative exopolyphosphatase by Fleischmann et al. (66,241). 6.3.3 Purine nucleoside monophosphates influence intracellular cAMP levels To investigate whether the purine ribonucleoside effect could be mediated by regulation of adenylate cyclase activity and intracellular cAMP levels, I assessed competence of wild-type cells in MIV nutrient-limited medium supplemented with purine ribonucleoside and cAMP. As is evident in Figure 6.8, ImM and 5mM cAMP significantly restored competence development to GMP-inhibited cells, and partially restored competence to AMP-inhibited cells, suggesting that availability of purine nucleosides may influence intracellular cAMP levels. Conceivably, exogenous cAMP might counter the effects of addition of exogenous purine nucleosides by competing with them for uptake via a transporter or channel. I found, however that both AMP and GMP reduce (cAMP-dependent) fj-galactosidase expression by the cAMP reporter strain PvR828 (Fig. 6.9), confirming that purine nucleoside-induced repression of competence is correlated with a reduction in intracellular cAMP 169 levels. The more extreme effect of AMP compared with GMP on competence development by wild-type H. influenzae is consistent with the observation that AMP-treated RR828 expresses lower levels of (3-galactosidase than RR828 treated with GMP. 6.3.4 Purine nucleoside regulation of intracellular cAMP levels is not mediated by components of the PTS Peterkofsky et al. (1993) demonstrated an apparent role for components of the phosphotransferase system in regulation of E. coli adenylate cyclase activity by nucleotides (171), and as discussed, the PTS may regulate adenylate cyclase activity in response to a number of as-yet uncharacterized environmental nutritional signals (Section 4.6.3). To investigate whether the H. influenzae PTS regulates adenylate cyclase activity in response to intracellular concentrations of purine ribonucleosides, I assessed the effect of AMP or GMP on competence development by PTS-deficient strains. Strains lacking Enzyme I, Enzyme IIA G l c or DTP + HPr of the H. influenzae PTS have a significant competence deficiency, but I found that addition of AMP or GMP further reduced competence of these strains between 50- and ~500-fold (Fig. 6.10). Purine ribonucleoside monophosphates also inhibited competence development by strains lacking HPr, DTP or EIIB'BC F r u of the PTS (Fig. 6.10). These findings suggest that the H. influenzae PTS is not involved in the apparent regulation of adenylate cyclase activity induced by AMP or GMP. 170 10-2 IO" 3 10 10 4 H •5 H 10 6 -4 MIV only 1mM 5mM 5mM AMP 1mM 5mM [ C A M P ] 5mM GMP Figure 6.8 Exogenous cAMP partially restores competence to Haemophilus influenzae in MIV medium supplemented with A M P / G M P Wild-type H. influenzae cells in early exponential phase of growth in rich medium were transferred to MIV medium supplemented with 5mM AMP or GMP plus 0,1 or 5 mM cAMP, as indicated. Transformation frequency was assessed as described in Section 2.7. Mean data from three replicates are shown. Error bars represent standard error mean (SEM). 171 E CD c o '(/) (/) 0) Q . X U J CD </) CO •g '</) o o _co co e> CO. 12 -10 -8 -6 _ 4 -2 -° - r -50 Hi MIV only -A 5 m M AMP - O 5 m M GMP ~r o i 50 100 150 200 250 Time After Transfer to MIV (Mins.) Figure 6.9 [3-Galactosidase expression by cAMP-reporter strain RR828 i n M I V medium + A M P or G M P Early exponential phase cells were transferred to MIV nutrient-limited medium, and samples taken at time intervals post-transfer, p-Galactosidase activity was assessed as described in Section 2.9. Representative data are shown. 172 c o > CL 0. < (D £ E LO LD • I b CO b CD i o (np/jAou) Aouanb9J-j UOJIELUJOISUBJI < CD C L i _ I - 0-Q X O C O eg QJ C L h-Q C L X o (5 < Qj LL) .£ E "E i crt j 3 "E, S .3 73 cu s 73 CU s cu 3 3 H CU cn 3 rt H CU H-> MH rt cn .s rt H-» cn H-» 3 rt *J 3 s cn 3 .2 rt cuu 3 H-> A H 3 a; cr 1 DH JH CU S . 3 £ © ^ 3 rt o g cu I-H rt « 3 rt cu U 5 cu u 3 bp 173 6.4 Discussion 6.4.1 Competence development by Haemophilus influenzae is regulated by availability of nucleic acid precursors In summary, the data described in this chapter provide evidence that H. influenzae can detect availability of certain nucleic acid precursors, and regulate competence accordingly. The regulatory mechanism underlying this regulation appears to be mediated via regulation of intracellular cAMP levels, but components of the phosphotransferase system are not involved in transduction of the nucleotide signal. Furthermore, repression of competence by nucleotides is not effected by inactivation or transcriptional repression of Sxy - a putative positive regulator of competence - or by interference with the stringent response system of H. influenzae. Significantly, the discovery that competence development is regulated by availability of nucleic acid precursors strengthens the proposition that H. influenzae takes up DNA primarily for the nucleotides it contains. The significant advantage provided to cells by the ability to catabolize DNA has recently been demonstrated by Finkel and Kolter (S. Finkel, personal communication): E. coli strains carrying null mutations in (unlinked) homologues of the H. influenzae competence genes com] or comE (245) are unable to catabolize exogenous DNA. These mutants exhibit no fitness loss compared to wild-type when cultured alone, but are out-competed by the wild-type after two days co-incubation at stationary phase, and are completely lost from co-culture after 10-12 days (S. Finkel, personal communication). However, repression of competence in the presence of nucleic acid precursors also supports the prediction that it is probably more energetically efficient (and less risky - see Section 1.3.1) for cells to transport free nucleosides than to develop competence and transport DNA. Although I have not demonstrated that H. influenzae takes up the free nucleosides provided, this organism is predicted to express the necessary periplasmic 5'- and 3'- nucleotidases (UshA and CpdB, respectively) and the 174 membrane-bound nucleoside uptake system (NupC) (Table 6.3, Fig. 6.1) to scavenge free nucleosides in the same way as other y-proteobacteria. We have consequently proposed a model in which cells preferentially obtain nucleic acid precursors by uptake. If externally available nucleotides are insufficient, availability of energy resources (as determined by the phosphotransferase system and other sensors of nutrient availability) will determine whether nucleotides are synthesized de novo, or whether cells become competent in order to take up any free DNA in the environment (Fig. 6.11) (134). environmental - de novo nucleosides resources nucleotide available? • high? • synthesis 1 YES 1 1 NO 1 t uptake of T nucleotide scavenging by nucleosides competence development and DNA uptake Figure 6.11 Model of Haemophilus influenzae^ 'decision-making' schema for regulation of systems catalyzing synthesis or scavenging of nucleic acid precursors 6.4.2 Purine ribonucleosides as an indicator of nucleic acid precursor availability It was initially surprising that the ability of H. influenzae to transport DNA is regulated not by availability of DNA precursors, but by availability of certain ribonucleosides (precursors of RNA). In assessing the significance of this observation, I considered the predicted abundance of DNA and RNA (and their precursors) in the natural environments of H. influenzae and other bacteria. DNA 175 has been detected in considerable quantities in all environmental locations examined so far (up to 44ug/l in aquatic environments; lug/gram in freshwater sediment), and appears to be largely of microbial origin (132). High levels of DNA (up to 28mg/g (224), of which <1.5% is microbial (125)) have also been detected in respiratory tract mucus - H. influenzae's natural environment (Section 7.2). Since it has been calculated that bacterial cells contain at least six times as much RNA as DNA (154), it is likely that any environment containing DNA from dead bacterial cells will contain even more RNA. Dead eukaryotic cells (such as polymorphonuclear leukocytes and epithelial cells (224) in the mucosal environment) will also release free RNA as well as DNA. While some free DNA is stabilized by association with clay minerals in soils and sediments, and by association with mucoproteins in lung mucus (124, 125), microbially secreted nucleases are ubiquitous: it has been estimated that greater than 90% of the heterotrophic bacterial populations of soil and aquatic environments secrete DNases (132). RNA released by lysing bacteria (and other cells) is intrinsically less stable than DNA, and is also likely to be degraded by environmental nucleases. I speculate, therefore, that mucosal and other environments which have been characterized as DNA-rich are even richer in ribonucleotides, and that hydrolysis of free nucleic acids exposes bacterial cells such as H. influenzae to a large pool of free ribonucleotides and a smaller pool of free deoxyribonucleotides. RNA degradation products may therefore be a more accurate indicator to the cell of the availability of nucleic acid precursors, explaining the observed H. influenzae response to ribonucleotides. 6.4.3 Mechanism of regulation of competence by purine nucleotides In the enteric bacteria, transcription of multiple operons required for both purine-and pyrimidine-nucleotide biosynthesis and metabolism is regulated by purine 176 a v a i l a b i l i t y (268). I n th i s l i g h t , i t is p e r h a p s n o t s u r p r i s i n g tha t c o m p e t e n c e -a r g u a b l y a n a l t e r n a t e m e a n s o f s u p p l y i n g the c e l l w i t h n u c l e o t i d e s - i s a l s o r e g u l a t e d b y a v a i l a b i l i t y o f p u r i n e r i b o n u c l e o s i d e s . E x p r e s s i o n o f the n u c l e o t i d e m e t a b o l i s m r e g u l o n o f e n t e r i c b a c t e r i a i s c o n t r o l l e d b y the g l o b a l r e g u l a t o r , P u r R , w h i c h is d e p e n d e n t o n h y p o x a n t h i n e o r g u a n i n e (bu t n o t a d e n i n e , p y r i m i d i n e s , o r p y r i m i d i n e o r p u r i n e n u c l e o s i d e s ) f o r D N A b i n d i n g (268). T h e H. influenzae g e n e HI#1635 e n c o d e s a P u r R p r o t e i n w i t h 7 3 % s i m i l a r i t y (56% i d e n t i t y ) to i t s E . coli h o m o l o g u e . A l t h o u g h I f o u n d tha t free p u r i n e b a s e s d i d n o t i n f l u e n c e c o m p e t e n c e d e v e l o p m e n t b y H. influenzae ( F i g . 6.4), i t i s p o s s i b l e t h a t H . influenzae c a n n o t t r a n s p o r t free bases , a n d tha t a d d i t i o n o f A M P / G M P m i g h t exe r t a r e g u l a t o r y effect b y i n c r e a s i n g the i n t r a c e l l u l a r p o o l o f a d e n i n e / g u a n i n e . I r e a s o n e d t ha t a d d i t i o n o f G M P to H. influenzae m i g h t t h e r e f o r e a l l o w P u r R - g u a n i n e -m e d i a t e d r e p r e s s i o n o f c o m p e t e n c e genes . H o w e v e r , a l t h o u g h B L A S T s e a r c h i n g o f the H. influenzae g e n o m e s e q u e n c e w i t h the E . coli c o n s e n s u s P u r R b i n d i n g s i te s e q u e n c e ( 5 ' - A C G C A A A C G T T T G C G T - 3 ' (268)) i d e n t i f i e d c a n d i d a t e b i n d i n g s i tes i n the p r o m o t e r r e g i o n s o f a n u m b e r o f genes r e q u i r e d for n u c l e o t i d e m e t a b o l i s m (da ta n o t s h o w n ) , n o P u r R b i n d i n g si tes w e r e f o u n d i n p r o m o t e r r e g i o n s o f k n o w n c o m p e t e n c e g e n e s . W h i l e i t i s p o s s i b l e tha t P u r R m a y r e g u l a t e c o m p e t e n c e b y r e p r e s s i o n o f a s -ye t u n c h a r a c t e r i z e d r e g u l a t o r s o f c o m p e t e n c e , t h i s m o d e l d o e s n o t e x p l a i n the o b s e r v e d r e g u l a t i o n o f c o m p e t e n c e b y n u c l e o s i d e s , n o r the effect o f these n u c l e o t i d e s o n i n t r a c e l l u l a r c A M P l e v e l s . A d d i t i o n a l w e l l - c h a r a c t e r i z e d r e g u l a t o r s o f n u c l e o t i d e c a t a b o l i c g e n e s , C y t R a n d D e o R , c a n be d i s c a r d e d as c a n d i d a t e r e g u l a t o r s o f the n u c l e o t i d e r e p r e s s i o n o f c o m p e t e n c e . T h e E . coli C y t R r e p r e s s o r i s i n d u c e d b y c y t i d i n e a n d i t h a s b e e n s u g g e s t e d tha t c y t i d i n e m a y s i g n a l the a v a i l a b i l i t y o f b o t h D N A a n d R N A to the c e l l (84). A s d i s c u s s e d , h o w e v e r , a v a i l a b i l i t y o f p y r i m i d i n e n u c l e o t i d e s d o e s n o t affect c o m p e t e n c e ( F i g . 6.3) a n d H. influenzae l a c k s a C y t R h o m o l o g u e . T h i s o r g a n i s m a l so l a c k s a h o m o l o g u e o f the r i b o s e - 5 - p h o s p h a t e - i n d u c e d D e o R r e p r e s s o r . 177 P e t e r k o f s k y et al. (1993) f o u n d that G T P a n d o t h e r n u c l e o t i d e s , b u t n o t G M P , stimulated a d e n y l a t e c y c l a s e a c t i v i t y (169), b y a m e c h a n i s m tha t r e q u i r e s H P r o f the P T S (171). S i n c e r e p r e s s i o n o f c o m p e t e n c e b y A M P a n d G M P a p p e a r s to i n v o l v e a reduction i n i n t r a c e l l u l a r c A M P l e v e l s , a n d w a s a l so o b s e r v e d e v e n i n a n H P r -d e f i c i e n t s t r a i n ( F i g . 6.10), i t i s u n l i k e l y tha t the o b s e r v e d A M P / G M P effect o n c o m p e t e n c e i s m e d i a t e d i n th is w a y . S o m e p r e l i m i n a r y s t u d i e s b y th i s g r o u p a l s o d e m o n s t r a t e d tha t E. coli a d e n y l a t e c y c l a s e s p e c i f i c a l l y i n t e r ac t s w i t h , a n d i s a c t i v a t e d b y , the G T P - b i n d i n g p r o t e i n / e l o n g a t i o n fac to r E F T u (183), a l t h o u g h f u r t h e r i n v e s t i g a t i o n o f t h i s i n t e r a c t i o n h a s n o t b e e n c a r r i e d ou t . It i s p o s s i b l e , t he re fo re , t ha t the H. influenzae E F T u h o m o l o g u e ( e n c o d e d b y tufA [HI#0578 , a n d tufB [HI#0632]) m a y f o r m p a r t o f a n a d e n y l a t e c y c l a s e r e g u l a t o r y c o m p l e x tha t r e g u l a t e s a d e n y l a t e c y c l a s e a c t i v i t y a c c o r d i n g to c h a n g e s i n i n t r a c e l l u l a r p o o l s o f g u a n i n e n u c l e o t i d e s . S o m e e v i d e n c e h a s s u g g e s t e d the ex i s t ence o f p r o t e i n s i n E . coli a n d S. typhimurium tha t s ense the a v a i l a b i l i t y o f p u r i n e bases , n u c l e o s i d e s o r n u c l e o t i d e s a n d r e g u l a t e n u c l e o t i d e m e t a b o l i s m a c c o r d i n g l y , a l t h o u g h these h a v e n o t b e e n c h a r a c t e r i z e d (268). P u t a t i v e H. influenzae h o m o l o g u e s o f s u c h r e g u l a t o r s , o r n o v e l r e g u l a t o r s , m a y m e d i a t e t r a n s c r i p t i o n a l r e p r e s s i o n o f c o m p e t e n c e g e n e s , o r d i r e c t l y o r i n d i r e c t l y c o n t r o l a d e n y l a t e c y c l a s e o r c A M P p h o s p h o d i e s t e r a s e a c t i v i t y , i n r e s p o n s e to p u r i n e n u c l e o t i d e a v a i l a b i l i t y . H o w e v e r , e l u c i d a t i o n o f the r e g u l a t o r y m e c h a n i s m u n d e r l y i n g p u r i n e n u c l e o s i d e m o n o p h o s p h a t e r e p r e s s i o n o f c o m p e t e n c e a w a i t s the i s o l a t i o n o f r e s i s t a n t m u t a n t s t r a i n s . 6.4.4 D N A u p t a k e as a f e e d i n g p r o c e s s H. influenzae d e g r a d e s s o m e 8 5 % o f the D N A i t t r a n s p o r t s , a n d the r e s u l t a n t n u c l e o t i d e s a re r e c y c l e d ( r a n d o m l y i n c o r p o r a t e d i n t o the c h r o m o s o m e ) (173). O t h e r 178 naturally competent bacteria also degrade and recycle a significant proportion of the DNA they transport: processing of bound double-stranded DNA by Bacillus subtilis, Streptococcus pneumoniae and Acinetobacter calcoaeticus immediately makes 50% of the nucleotide content of DNA available for metabolism, while any single-stranded DNA not incorporated into the chromosome is also subject to nucleolysis (132, 234). This total utilization of transformed DNA - either as new genetic information or for DNA precursors - has justly been described as a "DNA feeding process" (248). 179 C H A P T E R S E V E N General Conclusions 7.1 Nutritional regulation of competence in Haemophilus influenzae I have demonstrated that the development of competence for DNA uptake by H. influenzae is regulated by systems which allow this organism to respond to changes in the nutritional environment. The H. influenzae phosphotransferase system mediates regulation of non-PTS sugar utilization and competence development according to the availability of fructose (and/or possibly other nutrients) in the environment. The PTS-mediated signal is transmitted via changes in the intracellular concentration of cAMP, a well-characterized bacterial signal of nutritional lack (22) (Chapter Four). Competence development is absolutely dependent on cAMP (54), suggesting that competence for DNA uptake forms part of the H. influenzae 'hunger response' (158-160). Intracellular cAMP levels are fine-tuned by a putative cAMP-specific phosphodiesterase, whose activity has been shown to be modulated by further nutritional signals in other organisms (198) (Chapter Five). Finally, and perhaps even more significantly, development of competence, like de novo nucleotide synthesis (268), appears to be regulated by availability of free nucleic acid precursors (Chapter Six). Since regulatory mechanisms have evolved to optimize expression of the traits they control, this additional evidence for nutritional regulation of competence suggests that in H. influenzae competence has a nutritional function, namely, the scavenging of DNA for the nucleotides it contains. 7.2 Competence development and the nutritional niche Most bacteria can utilize a variety of carbon sources and can adapt themselves to their surroundings to be able to effectively compete with other organisms for limiting nutrients. If competence is in fact a nucleotide-scavenging system, is it one 180 which is likely to benefit H. influenzae in its natural environment? H. influenzae is an obligate commensal and opportunistic pathogen which colonizes mucosal surfaces in the human respiratory tract. While some studies have shown adherence of this organism to epithelial cells (180, 232), a number of studies have suggested that H. influenzae may preferentially inhabit respiratory mucus (11, 18, 45, 180, 261). Analyses of the H. influenzae genome sequence (137, 240) and sugar fermentation studies (137) have suggested that unlike the enteric bacteria, H. influenzae can utilize only a very limited range of sugars as sources of carbon and energy (Section 4.2.1). This limited nutritional repertoire is likely the result of adaptation of this organism to respiratory tract mucus, a niche predicted to be nutritionally-limited. As an extracellular commensal, H. influenzae has no direct contact with the bulk of sugars in the host diet or host cell metabolic intermediates, and only has access to monosaccharide sugars that can cross mucosal cell membranes. The major monosaccharide breakdown products of the human diet are glucose, fructose and galactose, and H. influenzae can catabolize all three sugars. However, although glucose is the predominant dietary sugar entering the circulation from the diet, lung epithelia rapidly re-absorb any free glucose in mucus, making the respiratory tract an environment almost devoid of glucose (254). This might explain why H, influenzae has only a simple and fructose-specific PTS. H. influenzae can also catabolize glycerol (a breakdown product of dietary and stored fats) and fucose and sialic acid (constituents of the oligosaccharide side chains of the mucus glycoproteins which make up 40-60% of the solid phase of respiratory tract mucus (20)). Clearly, H. influenzae has maintained genes which allow it to exploit the small number of sugars likely to be available in the mucosal niche. A significant alternate source of nutrients in the mucosal niche might be provided by DNA. Respiratory tract mucus of healthy individuals may contain DNA at concentrations of up to 300ug/ml (143), while mucus of individuals with respiratory disease, especially cystic fibrosis, may contain as much as 28 mg DNA/g (224). H. 181 influenzae has the potential to exploit this resource by using its natural competence system to take up this DNA and recycle its nucleotide components, and thus save the considerable energy resources required for de novo nucleotide synthesis (237). The ability to develop natural competence therefore provides H. influenzae with a novel nutritional niche, and may provide this organism with a competitive advantage in an environment where nutrients are limited. 7.3 Scavenging of DNA by other bacteria Might other bacteria similarly exploit exogenous DNA as a nutritional resource? As discussed, it is becoming evident that free DNA is ubiquitous in a wide range of bacterial environments. Significant concentrations of free DNA have been detected in sea-water, fresh-water, soils and sediments (Section 6.4.2) (132). DNA is found in nasal mucus (221) as well as respiratory tract mucus, and high concentrations of DNA have been measured in mucus of the small intestine (550ug/ml) (64). Other habitats suggested to have high levels of DNA (as the result of bacterial lysis or excretion of DNA) are root nodules, the intestines of insects, worms and other warm-blooded animals, the interior of protozoa and the surface and inter/intracellular spaces of plants (132). Natural competence might therefore provide a significant nutritional advantage to a wide range of bacteria occupying a great diversity of niches. Evidence is amassing that a range of bacteria are capable of transporting free DNA under environmental (rather than laboratory) conditions. Studies have demonstrated that naturally competent Vibrio spp. and Pseudomonas stutzeri can take up DNA from natural marine water or sediment, Acinetobacter calcoaeticus can take up DNA from aqueous extracts of various soils and groundwater, and Bacillus subtilis can take up DNA adsorbed to sand or clay particles, or from soil samples (132). No direct evidence currently exists for natural transformation in 182 vivo, other than the original experiment of Griffith which demonstrated transformation of Streptococcus pneumoniae in a mixed culture injected into mice (77). However, co-cultivation experiments with Neisseria spp. and studies of nucleotide sequences of naturally competent species have pointed to the frequent occurrence of DNA exchange within and between species (132). Moreover, it is likely that our identification of naturally competent bacteria is limited by our ability to recreate competence-inducing conditions for different species in the laboratory, and that many other bacteria might be able to exploit free DNA in their environment. For example, a recent study has shown that E. coli - long considered to be incapable of natural competence - can take up DNA under environmental (rather than artificial) conditions (13), and analysis of the newly-released E. coli K12 genome sequence (19) has identified E. coli homologues of at least eleven H. influenzae competence genes. The demonstration that E. coli strains carrying mutations in two of these homologues (com] or comE) have lost the ability to utilize free chromosomal DNA as a sole source of nutrients, and are out-competed by wild-type cells in co-culture (S. Finkel, personal communication) both provide evidence that free DNA provides bacteria with an accessible source of nutrients and support the proposition that the ability to take up free DNA provides bacteria with a competitive advantage. 7.4 Sexual isolation and the evolution of competence H. influenzae preferentially takes up DNA from Haemophilus species (214, 223) by recognizing a conserved 9bp sequence (USS) (43, 44) which occurs frequently in the H. influenzae genome (227), and it might be argued that this selectivity limits the usefulness of competence as a nutrient-scavenging system. I suggest, however, that the frequently occurring and conserved USS of H. influenzae (and Neisseria gonorrheae) might have evolved as one means of protecting cells from the 183 significant potential hazards of integrating foreign DNA: increased mutational load, loss of competence, induction of prophages and neutralization of niche-specific genetic adaptations (as discussed in Section 1.3.1). By preferentially transporting DNA from closely related bacteria, cells can maximize the nutritional benefits of the DNA and minimize the risk that their essentially constitutive homologous recombination system (which plays other important roles unrelated to transformation) will recombine 'dangerous DNA' into the chromosome. Mismatch correction systems and restriction-modification systems perform a similar role. Indeed, it appears that many known naturally competent bacteria have evolved 'sexual isolation' systems. Although some evidence exists to confirm that chromosomal genes can occasionally be transferred across taxonomic boundaries, the interspecies passage of chromosomal genes is mostly limited to members of the same genus (132). It has been suggested that a combination of recombinational adaptation, protection against phages and/or host immune responses, DNA repair and acquisition of nutrients might have led to the conservation of the DNA uptake capability in bacteria (132). However, it should be pointed out that the total nucleotide content of transported DNA is available to the cell, whether or not a portion of the transformed DNA is recombined into the chromosome, since the DNA strand displaced by any recombination event is also degraded (Fig. 1.2). As suggested by Redfield (188), the simplest model might be that while DNA uptake might result in the occasional benefits of recombination or repair, the consistent and reliable nutritional benefit of DNA uptake may have driven the evolution of competence. 184 BIBLIOGRAPHY 1. Alexander, H. and Leidy, G. 1951. Determination of inherited traits of H. influenzae by desoxyribonucleic acid fractions isolated from type-specific cells. /. Exp. Med. 93:345-359. 2. Alper, M. D. and Ames, B. N. 1975. Cyclic 3',5'-adenosine monophosphate phosphodiesterase mutants of Salmonella typhimurium. J. Bacteriol. 122: 1081-1090. 3. Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W. and Lipman, D. J. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucl, Acids Res. 25: 3389-3402. 4. Amin, N. and Peterkofsky, A. 1995. A dual mechanism for regulating cAMP levels in Escherichia coli. }. Biol. Chem. 270: 11803-11805. 5. Anderson, A. and Cooper, R. A. 1970. Biochemical and genetical studies on ribose catabolism in Escherichia coli K-12. /. Gen. Microbiol. 62: 335-339. 6. Ausubel, F., Brent, R., Kingston, R., Moore, D., Seidman, }., Smith, J. and Struhl, K. (Ed.). 1994. Current Protocols in Molecular Biology. Greene/Wiley, New York. 7. Bacillus subtilis Genome Project. http://www.pasteur.fr/Bio/SubtiList.html 8. Barcak, G. J., Chandler, M. S., Redfield, R. J. and Tomb, J.-F. 1991. Genetic systems in Haemophilus influenzae. Meths. Enzymol. 204: 321-342. 9. Barcak, G. J., Tomb, J. F., Laufer, C. S. and Smith, H. O. 1989. Two Haemophilus influenzae Rd genes that complement the recA-like mutation rec-1. ]. Bacteriol. 171: 2451-7. 10. Barouki, R. and Smith, H. O. 1985. Re-examination of phenotypic defects in rec-1 and rec-2 mutants of Haemophilus influenzae Rd. /. Bacteriol. 163: 629-34. 11. Barsum, W., Wilson, R., Read, R. C, Rutman, A., Todd, H. C, Houdret, N., Roussel, P. and Cole, P. J. 1995. Interaction of fimbriated and nonfimbriated strains of unencapsulated Haemophilus influenzae with human respiratory tract mucus. Eur. Respir. }. 8: 709-714. 185 12. Bartolome, B., Jubete, Y., Martinez, E. and de la Cruz, F. 1991. Construction and properties of a family of pACYC184-derived cloning vectors compatible with pBR322 and its derivatives. Gene 102: 75-78. 13. Baur, B., Hanselmann, K., Schlimme, W. and Jenni, B. 1996. Genetic transformation in freshwater: Escherichia coli is able to develop natural competence. Appl. Env. Micro. 62: 3673-3678. 14. Berg, O. G. and von Hippel, P. H. 1987. Selection of DNA binding sites by regulatory proteins. I. Statistical-mechanical theory and application to operators and promoters. /. Moi. Biol. 193: 723-750. 15. Berg, O. G. and von Hippel, P. H. 1988. Selection of DNA binding sites by regulatory proteins. II. The binding specificity of cyclic AMP receptor protein to recognition sites. /. Moi. Biol. 200: 709-723. 16. Bertolla, F., van Gijsegem, F., Nesme, X. and Simonet, P. 1997. Conditions for natural transformation of Ralstonia solanacearum. Appl. Env. Micro. 63: 4965-4968. 17. Besse, M., von Wilcken-Bergmann, B. and Muller-Hill, B. 1986. Synthetic lac operator mediates repression through lac repressor when introduced upstream and downstream from lac promoter. EMBO /. 5: 1377-1381. 18. Bilton, D., Pye, A., Johnson, M. M., Mitchell, J. L., Dodd, M., Webb, A. K., Stockley, R. A. and Hill, S. L. 1995. The isolation and characterization of non-typeable Haemophilus influenzae from the sputum of adult cystic fibrosis patients. Eur. Respir. J. 8: 948-953. 19. Blattner, F., Plunkett, G. r., Bloch, C, Perna, N., Burland, V., Riley, M., Collado-Vides, J., Glasner, J., Rode, C, Mayhew, G., Gregor, J., Davis, N., Kirkpatrick, H., Goeden, M., Rose, D., Mau, B. and Shao, Y. 1997. The complete genome sequence of Escherichia coli K-12. Science 277: 1453-1474. 20. Boat, T. F., Cheng, P. W., Iyer, R. N., Carlson, D. M. and Polony, I. 1976. Human respiratory tract secretions. Mucous glycoproteins of nonpurulent tracheobronchial secretions and sputum of patients with bronchitis and cystic fibrosis. Arch. Biochem. Biophys. 177: 95-104. 21. Botsford, J. L. 1981. cAMP and regulation of carbohydrate metabolism. Basic Life Sciences 18: 315-34. 186 22. Botsford, J. L. and Harman, J. G. 1992. Cyclic AMP in prokaryotes. Microbiol. Rev. 56: 100-122. 23. Buettner, M. J., Spitz, E. and Rickenberg, H. V. 1973. Cyclic adenosine 3',5'-monophosphate in Escherichia coli. J. Bacteriol. 14: 1068-1073. 24. Calcott, P. and Calvert, T. 1981. Characterization of 3',5'-cyclic AMP phosphodiesterase in Klebsiella aerogenes and its role in substrate-accelerated death. /. Gen. Microbiol 122: 313-321. 25. Casari, G., Andrade, M. A., Boyle, J., Daruvar, A., Ouzounis, C , Schneider, R., Tamames, J., Valencia, A. and Sander, C. 1995. Challenging times for bioinformatics. Nature 376: 647-648. 26. Cashel, M., Gentry, D. R., Hernandez, V. J. and Vinella, D. 1996. The Stringent Response. In: Escherichia coli and Salmonella: Cellular and molecular biology. Neidhardt, F. C. (Ed.). ASM Press, Washington, D.C. pp. 1458-1496. 27. Chakrabarti, T., Chen, Y.-M. and Lin, E. C. C. 1984. Clustering of genes for L-fucose dissimilation by Escherichia coli. }. Bacteriol. 157: 984-986. 28. Chandler, M . S. 1992. The gene encoding cyclic AMP receptor protein is required for competence development in Haemophilus influenzae Rd. Proc. Natl. Acad. Sci. USA 89: 1626-1630. 29. Charbit, A. 1996. Coordination of carbon and nitrogen metabolism. Res. Micro. U7: 513-518. 30. Charbit, A., Reizer, J. and Saier, M. H. Jr. 1996. Function of the Duplicated IIB domain and oligomeric structure of the fructose permease of Escherichia coli. J. Biol. Chem. 271: 9997-10003. 31. Chauvin, F., Brand, L. and Roseman, S. 1996. Enzyme I: The first protein and potential regulator of the bacterial phosphoenolpyruvate:glycose phosphotransferase system. Res. Microbiol. 147: 471-479. 32. Chen, W., Gross, L., Joho, K. and McAllister, W. T. 1992. A modified kanamycin-resistance cassette to facilitate two-codon insertion mutagenesis. Gene 111: 143-144. 33. Chlamydia Genome Project. http://chlamydia-www.berkely.edu:4231/ 187 34. Clifton, S. W., McCarthy, D. and Roe, B. A. 1994. Sequence of the rec-2 locus of Haemophilus influenzae: Homologies to com£-ORF3 of Bacillus subtilis and msbA of Escherichia coli. Gene 146: 95-100. 35. Cobb, B. D. and Clarkson, J. M. 1994. A simple procedure for optimizing the polymerase chain reaction (PCR) using modified Taguchi methods. Nucl. Acids Res. 22:3801-3805. 36. Concino, M. and Goodgal, S. 1981. Haemophilus influenzae polypeptides involved in deoxyribonucleic acid uptake detected by cellular surface protein iodination. J. Bacteriol. 148:220-231. 37. Concino, M. F. and Goodgal, S. H. 1982. DNA-binding vesicles released from the surface of a competence-deficient mutant of Haemophilus influenzae. J. Bacteriol. 152: 441-50. 38. Contesse, G., Crepin, M., Gros, F., Ullman, A. and Monod, J. 1969. In: The lactose Operon. Beckwith, J. and Zipser, D. (Ed.). Cold Spring Harbor Laboratories, New York. pp. 401-415. 39. Crabb, W. D., Streips, U. N. and Doyle, R. J. 1977. Selective enrichment for genetic markers in DNA released by competent cultures of Bacillus subtilis. Mol. Gen. Genet. 155: 179-183. 40. Danese, P. N., Snyder, W. B., Cosma, C. L., Davis, L. J. and Silhavy, T. J. 1995. The Cpx two-component signal transduction pathway of Escherichia coli regulates transcription of the gene specifying the stress-inducible periplasmic protease, DegP. Genes Dev. 9: 387-398. 41. Daniels, G. A., Drews, G. and Saier, M. H. 1988. Properties of a Tn5 insertion mutant defective in the structural gene (fruA) of the fructose-specific phosphotransferase system of Rhodobacter capsulatus and cloning of the fru regulon. /. Bacteriol. 170: 1698-1703. 42. Dannelly, H. K. and Roseman, S. 1992. NAD+ and N A D H regulate an ATP-dependent kinase that phosphorylates Enzyme I of the Escherichia coli phosphotransferase system. Proc. Natl. Acad. Sci. USA 89: 11274-11276. 43. Danner, D., Smith, H. O. and Narang, S. 1982. Construction of DNA recognition sites active in Haemophilus transformation. Proc. Natl. Acad. Sci. USA 79: 2393-2397. 188 44. Danner, D. B., Deich, R. A., Sisco, K. L. and Smith, H. O. 1980. An eleven-base-pair sequence determines the specificity of DNA uptake in Haemophilus transformation. Gene 11: 311-8. 45. Davies, J., Carlstedt, I., Nilsson, A.-K., Hakansson, A., Sabharwal, H., van Alphen, L., van Ham, M. and Svanborg, C. 1995. Binding of Haemophilus influenzae to purified mucins from the human respiratory tract. Infect. Immun. 63: 2485-2492. 46: de Combrugghe, B., Busby, S. and Buc, H. 1984. Cyclic AMP receptor protein: role in transcription activation. Science 224: 831-838. 47. de Crecy-Lagard, V., Binet, M. and Danchin, A. 1995. Fructose phosphotransferase system of Xanthomonas campestris pv. campestris: characterization of the fruB gene. Microbiology 141: 2253-2260. 48. De Reuse, H. and Danchin, A. 1988. The ptsH, ptsl, and err genes of the Escherichia coli phosphoenolpyruvate-dependent phosphotransferase system: a complex operon with several modes of transcription. /. Bacteriol. 170: 3827-3837. 49. De Reuse, H. and Danchin, A. 1991. Positive regulation of the pts operon of Escherichia coli: Genetic evidence for a signal transduction mechanism. /. Bacteriol. 173: 727-733. 50. Death, A. and Ferenci, T. 1993. The importance of the binding-protein-dependent Mgl system to the transport of glucose in Escherichia coli growing on low sugar concentrations. Res. Microbiol. 144: 529-537. 51. Death, A. and Ferenci, T. 1994. Between feast and famine: endogenous inducer synthesis in the adaptation of Escherichia coli to Growth with limiting carbohydrates. /. Bacteriol. 176: 5101-5107. 52. Deich, R. A. and Smith, H. O. 1980. Mechanism of homospecific DNA uptake in Haemophilus influenzae transformation. Molecular & General Genetics 177: 369-74. 53. Devereux, J., Haeberli, P. and Smithies, O. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucl. Acids Res. 12: 387-95. 54. Dorocicz, I., Williams, P. and Redfield, R. J. 1993. The Haemophilus influenzae adenylate cyclase gene: cloning, sequence and essential role in competence. J. Bacteriol. 175: 7142-7149. 189 55. Dougherty, B. A. and Smith, H. O. 1999. Identification of Haemophilus influenzae Rd transformation genes using cassette mutagenesis. Microbiology 145: 401-9. 56. Dreiseikelmann, B. 1994. Translocation of DNA across bacterial membranes. Micro. Rev. 58: 293-316. 57. Du, Y., Holtel, A., Reizer, J. and Saier, M. H. Jr. 1996. Regulation of c 5 4-dependent transcription of the Pseudomonas putida xyl operon by the I I A N t r protein of the phosphotransferase system in Escherichia coli. Res. Microbiol. 147:129-132. 58. Dubnau, D. 1991. Genetic competence in Bacillus subtilis. Microbiol. Rev. 55: 395-424. 59. Dumay, V., Danchin, A. and Crasnier, M. 1996. Regulation of Escherichi coli adenylate cyclase activity during hexose phosphate transport. Microbiology. 142: 575-583. 60. Encyclopaedia of Escherichia coli genes and metabolism. http://ecocyc.PangeaSystems.com/ecocyc/server.html. 61. Engler-Blum, G., Meier, M., Frank, J. and Muller, G. A. 1993. Reduction of background problems in non-radioactive northern and southern blot analyses enables higher sensitivity than 32"P-based hybridizations. Anal. Biochem. 210: 235-244. 62. Epstein, W., Rothman-Denes, L. B. and Hesse, J. 1975. Adenosine 3':5'-cyclic monophosphate as mediator of catabolite repression in Escherichia coli. Proc. Natl Acad. Sci. USA 72: 2300-2304. 63. Feldheim, D. A., Chin, A. M., Nierva, C. T., Feucht, B. U., Cao, Y. W., Xu, Y. F., Sutrina, S. L. and Saier, M. H. Jr. 1990. Physiological consequences of the complete loss of phosphoryl-transfer proteins HPr and FPr of the phosphoenolpyruvate:sugar phosphotransferase system and analysis of fructose (fru) operon expression in Salmonella typhimurium. J. Bacteriol. 172: 5459-5469. 64. Ferencz, A., Orskov, S., Orskov, F. and Klemm, P. 1980. Deoxyribonucleic acid is a significant component of the small-intestinal mucus. Acta Path. Microbiol. Scand Sect. B. 88: 347-348. 190 65. Feucht, B. U. and Saier, M. H. Jr. 1980. Fine control of adenylate cyclase by the phosphoenolpyruvate: sugar phosphotransferase systems in Escherichia coli and Salmonella typhimurium. J. Bacteriol. 141:603-610. 66. Fleischmann, R. D., Adams, M. D., White, O., Clayton, R. A., Kirkness, E. F., Kerlavage, A. R., Bult, C. J., Tomb, J.-F., Dougherty, B. A., Merrick, J. M., McKenney, K., Sutton, G., FitzHugh, W., Fields, C, Gocayne, J. D., Scott, J., Shirley, R., Liu, L.-L, Glodek, A., Kelley, J. M., Weidman, J. F . , Phillips, C. A., Spriggs, T., Hedblom, E., Cotton, M. D., Utterback, T. R., Hanna, M. C, Nguyen, D. T., Saudek, D. M., Brandon, R. C, Fine, L. D., Fritchman, J. L., Fuhrmann, J. L., Geoghagen, N. S. M., Gnehm, C, McDonald, L. A., Small; K. V., Fraser, C. M., Smith, H. O. and Venter, J. C. 1995. Whole-genome random sequencing and assembly of Haemophilus influenzae Rd. Science 269: 496-512. 67. Fox, D., Meadow, N. D. and Roseman, S. 1986. Phosphate transfer between acetate kinase and Enzyme I of the bacterial phosphotransferase system. /. Biol. Chem. 261: 13498-13503. 68. Fuqua, W. C. 1992. An improved chloramphenicol resistance gene cassette for site-directed marker replacement mutagenesis. BioTechniques 12: 223-225. 69. Gallant, J. and Harada, B. 1969. The control of ribonucleic acid synthesis in Escherichia coli. Ill The functional relationship between purine ribonucloside triphosphate pool sizes and the rate of ribonucleic acid accumulation. /. Biol. Chem. 244: 3125-3132. 70. Geerse, R. H., Izzo, F. and Postma, P. W. 1989. The PEP:fructose phosphotransferase system in Salmonella typhimurium: FPr combines Enzyme III F r u and pseudo-HPr activities. Moi. Gen. Genet. 216: 517. 71. Geerse, R. H., Ruig, C. R., Schuitema, A. R. J. and Postma, P. W. 1986. Relationship between pseudo-HPr and the PEP:fructose phosphotansferase system in Salmonella typhimurium and Escherichia coli. Moi. Gen. Genet. 203: 435-444. 72. GenBank. http://www.ncbi.nlm.nih.gov/ 73. Genome Therapeutics, http://www.genomecorp.com/ 74. Ghosh, B. K., Owens, K., Pietri, R. and Peterkofsky, A. 1989. Localization to the inner surface of the cytoplasmic membrane by immunoelectron microscopy of Enzyme I of the phosphoenolpyruvate:sugar phosphotransferase system of Escherichia coli. Proc. Natl. Acad. Sci. USA 86: 849-853. 191 75. Goodgal, S. H. and Herriott, R. M. 1961. Studies on transformations of Haemophilus influenzae: I. Competence. /. Gen. Physiol. AA: 1201-1227. 76. Goodman, S. D. and Scocca, J. J. 1988. Identification and arrangement of the DNA sequence recognized in specific transformation of Neisseria gonorrhoeae. Proc. Natl. Acad. Sci. USA 85: 6982-6986. 77. Griffith, F. 1928. The significance of pneumococcal types. /. Hygeine 27: 113-159. 78. Grist, R. W. and Butler, L. O. 1983. Effect of transforming DNA on growth and frequency of mutation in Streptococcus pneumoniae. J. Bacteriol. 153: 153-162. 79. Gross, R, Arico, B. and Rappuoli, R. 1989. Families of bacterial signal-transducing proteins. Mol. Micro. 3: 1661-1667. 80. Gwinn, M. L., Ramanathan, R., Smith, H. O. and Tomb, J. F. 1998. Anew transformation-deficient mutant of Haemophilus influenzae Rd with normal DNA uptake. / Bacteriol 180: 746-8. 81. Gwinn, M. L., Stellwagen, A. E., Craig, N. L., Tomb, J. F. and Smith, H. O. 1997. In vitro Tn7 mutagenesis of Haemophilus influenzae Rd and characterization of the role of atpA in transformation. / Bacteriol 179: 7315-20. 82. Gwinn, M. L., Yi, D., Smith, H. O. and Tomb, J.-F. 1996. Role of two-component signal transduction and the phosphoenolpyruvate:carbohydrate phosphotransferase systems in competence development of Haemophilus influenzae Rd. /. Bacteriol. 178: 6366-6368. 83. Hailing, P. J. 1989. Do the laws of chemistry apply to living cells? Trends. Biochem. Sci. 14: 317-318. 84. Hammer-Jespersen, K. 1983. Nucleoside catabolism. In: Metabolism of nucleotides, nucleosides and nucleobases. Munch-Petersen, A. (Ed.). Academic Press, Copenhagen, pp. 203-258. 85. Harayama, S. J., Bollinger, J., lino, T. and Hazelbauer, G. L. 1993. Characterization of the mgl operon of Escherichia coli by transposon mutagenesis and molecular cloning. /. Bacteriol. 153: 408-415. 86. Harwood, J. P., Gazdar, C, Prasad, C, Peterkofsky, A., Curtis, S. J. and Epstein, W. 1976. Involvement of the glucose Enzymes II of the sugar phosphotransferase system in the regulation of adenylate cyclase by glucose in Escherichia coli. J. Biol. Chem. 251: 2462-2468. 192 87. Harwood, J. P. and Peterkofsky, A. 1975. Glucose-sensitive adenylate cyclase in toluene-treated cells of Escherichia coli B. /. Biol. Chem. 250: 4656-4662. 88. Henderson, P. J. F. 1990. Proton-linked sugar transport systems in bacteria. /. Bioenerg. Biomemb. 22: 525-569. 89. Herdman, M. 1973. Mutations arising during transformation in the blue-green alga Anacystis nidulans. Mol. Gen. Genet. 120: 369-378. 90. Herriott, R. M., Meyer, E. M. and Vogt, M. 1970. Defined nongrowth media for stage II development of competence in Haemophilus influenzae. J. Bacteriol. 1 0 1 : 517-24. 91. Hertz, R. and Bar-Tana, J. 1982. Modulation of the 3':5'-Cyclic AMP content by the respiration rate in Eschericha coli K-12. Arch. Biochem. Biophys. 213: 193-199. 92. Hogema, B., Arents, J. C., Inada, T., Aiba, H., van Dam, K. and Postma, P. 1997. Catabolite repression by glucose-6-phosphate, gluconate and lactose in Escherichia coli. Mol. Microbiol. 24: 857-867. 93. Hogema, B. M., Arents, J. C., Bader, R., Eijkemans, K., Yoshida, H., Takahashi, H., Aiba, H. and Postma, P. W. 1998. Inducer exclusion in Escherichia coli by non-PTS substrates: the role of PEP to pyruvate ratio in determining the phosphorylation state of Enzyme IIA. Mol. Microbiol. 30: 487-498. 94. Imamura, R. 1993. Notes with Genbank submission, Accession #: P36650. 95. Imamura, R., Yamanaka, K., Ogura, T., Hiraga, S., Fujita, N., Ishihama, A. and Niki, H. 1996. Identification of the cpdA gene encoding cyclic 3',5'-adenosine monophosphate phosphodiesterase in Escherichia coli. J. Biol. Chem. 271: 25423-25429. 96. Ingraham, J.L., Maaloe, O., Neidhardt, F.C. 1983. Growth of the bacterial cell. Sinauer, Sunderland, Massachusetts. 97. Isaacs, H. J., Chao, D., Yanofsky, C. and Saier, M. H. Jr. 1994. Mechanism of catabolite repression of tryptophanase synthesis in Escherichia coli. Microbiology 140: 2125-2134. 98. Jiresova, M., Janecek, J. and Naprstek, J. 1981. Catabolite repression during . single and multiple induction in Escherichia coli. Folia Microbiol. 26: 1-7. 193 99. Joseph, E., Bernsley, C, Guiso, N. and Ullman, A. 1982. Multiple regulation of the activity of adenylate cyclase in Escherichia coli. Moi. Gen. Genet. 185: 262-268. 100. Joseph, E. and Guesdon, J.-L. 1982. (3-Galactosidase immunoassay for the measurement of cyclic AMP. Anal. Biochem. 119: 335-340. 101. Kaback, H. R. 1968. The role of the phosphoenolpyruvate-phosphotransferase system in the transport of sugars by isolated membrane preparations of Escherichia coli. J. Biol. Chem. 243: 3711-3724. 102. Kahn, M., Concino, M., Gromkova, R. and Goodgal, S. 1979. DNA binding activity of vesicles produced by competence deficient mutants of Haemophilus. Biochim. Biophys. Res. Commun. 87: 764-772. 103. Kahn, M., Maul, G. and Goodgal, S. 1982. Possible mechanism for donor DNA binding and transport in Haemophilus. Proc. Natl. Acad. Sci. USA 79: 6370-6374. 104. Kahn, M. E. and Smith, H. O. 1984. Transformation in Haemophilus: a problem in membrane biology. /. Memb. Biol. 81: 89-103. 105. Karudapuram, S. and Barcak, G. J. 1997. The Haemophilus influenzae dpi ABC genes constitute a competence- inducible operon that requires the product of the tfoX (sxy) gene for transcriptional activation. / Bacteriol 179: 4815-20. 106. Karudapuram, S., Zhao, X. and Barcak, G. J. 1995. DNA sequence and characterization of Haemophilus influenzae dprA+, a gene required for chromosomal but not plasmid DNA transformation. /. Bacteriol. 177: 3235-3240. 107. Kazusa DNA Research Institute. http://www.kazusa.or.jp/KDRI/kazusa_home-e.html 108. Kiely, B. and O'Gara, F. 1983. 3'-5' adenosine monophosphate synthesis in Rhizohium: identification of a cloned sequence from Rhizobium meliloti coding for adenyl cyclase. Moi. Gen. Genet. 192: 230-234. 109. Kilian, M. 1976. A taxonomic study of the genus Haemophilus, with the proposal of a new species. /. Gen. Microbiol. 93: 9-62. 110. Kilian, M. and Frederiksen, W. 1981. Identification tables for the Haemophilus-Pasteurella-Actinobacillus group. In: Haemophilus, Pasteurella, and Actinobacillus. Kilian, M., Frederiksen, W. and Biberstein, E. L. (Ed.). Academic Press, London, pp. 281-290. 194 111. Kleckner, N. 1991. Uses of Transposons, with emphasis on TnlO. Meths. Enzymol. 204: 139-200. 112. Koetsier, P. A., Schorr, J. and Doerfler, W. D. 1993. A rapid optimised protocol for downward alkaline Southern blotting of DNA. BioTechniques 15: 260-262. 113. Kohlbrechter, D., Eisermann, R. and Hengstenberg, W. 1992. Staphylococcal phosphoenolpyruvate-dependent phosphotransferase system: molecular cloning and nucleotide sequence of the Staphylococcus carnosus ptsl gene and expression and complementation studies of the gene product. /. Bacteriol. 174: 2208-2214. 114. Kolb, A., Spassky, A., Chapon, C, Blazy, B. and Buc, H. 1983. On the different binding affinities of CRP at the lac, gal and malT promoter regions. Nucl. Acids. Res. 11:7833-7852. 115. Kondrashov, A. 1994. Sex and deleterious mutation. Nature 369:99-100. 116. Koop, A. H., Schorr, J. and Doerfler, W. D. 1984. Analysis of the cya locus of Escherichia coli. Gene 28: 133-146. 117. Kundig, W., Ghosh, S. and Roseman, S. 1964. Phosphate bound to histidine in a protein as an intermediate in a novel phosphotransferase system. Proc. Natl. Acad. Sci. USA. 52: 1067-1074. 118. Kundig, W. and Roseman, S. 1971. Sugar Transport I. Isolation of a phosphotransferase system from Escherichia coli. J. Biol. Chem. 246: 1393-1406. 119. Kupfer, D. M. and McCarthy, D. 1992. ra>2-dependent phage recombination in Haemophilus influenzae. J Bacteriol 17 A: 4960-6. 120. Lacks, S. A., Mannarelli, B. M., Springhorn, S. S. and Greenberg, B. 1986. Genetic basis of the complementary Dpnl and Dpnll restriction systems of Streptococcus pneumoniae: an intracellular cassette mechanism. Cell 46: 993-1000. 121. Larson, T. G. and Goodgal, S. H. 1991. Sequence and transcriptional regulation of comlOlA, a locus required for genetic transformation in Haemophilus influenzae. } Bacteriol 173: 4683-91. 122. Larson, T. G. and Goodgal, S. H. 1992. Donor DNA processing is blocked by a mutation in the comlOlA locus of Haemophilus influenzae. } Bacteriol 17A: 3392-4. 195 123. Lehming, N., Sartorius, J., Niemoeller, M., Genenger, G., von Wilcken-Bergmann, B. and Mueller-Hill, B. 1987. The interaction of the recognition helix of lac repressor with lac operator. EMBO J. 6: 3145-3153. 124. Lethem, M. I., James, S. L. and Marriot, C. 1990. The role of mucous glycoproteins in the rheologic properties of cystic fibrosis sputum. Am. J. Respir. Dis. 142:1053-1058. 125. Lethem, M. I., James, S. L., Marriott, C. and Burke, J. F. 1990. The origin of DNA associated with mucous glycoproteins in cystic fibrosis sputum. Eur. Resp. J. 3:19-23. 126. Levy, S., Zeng, G. Q. and Danchin, A. 1990. Cyclic AMP synthesis in Escherichia coli strains bearing known deletions in the pts phosphotransferase operon. Gene 86: 27-33. 127. Liberman, E., Saffen, D., Roseman, S. and Peterkofsky, A. 1986. Inhibition of Escherichia coli adenylate cyclase activity by inorganic orthophosphate is dependent on III G l c of the phpsphoenolpyruvate: glycose phosphotransferase system. Biochem. Biophys. Res. Commun. 141: 1138-1144. 128. LiCalsi, C, Crocenzi, T. S., Freire, E. and Roseman, S. 1991. Sugar transport by the bacterial phosphotransferase system: Structural and thermodynamic domains of Enzyme I of Salmonella typhimurium. }. Biol. Chem. 266: 19519-19527. 129. Lin, E. C. C. 1987. Dissimilatory pathways for sugars, polyols and carboxylates. In: Escherichia coli and Salmonella typhimurium: Cellular and molecular biology. Neidhardt, F. C. (Ed.). ASM Press, Washington, D.C. pp. 244-284. 130. Lin, E. C. C. 1996. Sugars, polyols and carboxylates. In: Escherichia coli and Salmonella: Cellular and molecular biology. Neidhardt, F. C. (Ed.). ASM Press, Washington, D.C. pp. 307-342. 131. Lis, J. T. and Schleif, R. 1973. Different cyclic AMP requirements for induction of the arabinose and lactose operons of Escherichia coli. J. Moi. Biol. 79: 149-162. 132. Lorenz, M. G. and Wackernagel, W. 1994. Bacterial gene transfer by natural genetic transformation in the environment. Micro. Rev. 58: 563-602. 133. Macfadyen, L. P. 1996. Commentary: Haemophilus influenzae acetate kinase. Res. Microbiol. 147: 586-587. 196 134. Macfadyen, L. P., Dorocicz, I. R., Reizer, J., Saier, M. H., Jr. and Redfield, R. J. 1996. Regulation of competence development and sugar utilization in Haemophilus influenzae Rd by a phosphoenolpyruvate:fructose phosphotransferase system. Mol Microbiol 21: 941-52. 135. Macfadyen, L. P., Ma, C. and Redfield, R. J. 1997. Unpublished data. 136. Macfadyen, L. P., Ma, C. and Redfield, R. J. 1998. A 3,5' cyclic AMP (cAMP) phosphodiesterase modulates cAMP levels and optimizes competence in Haemophilus influenzae Rd. / Bacteriol 180: 4401-5. 137. Macfadyen, L. P. and Redfield, R. J. 1996. Life in mucus: sugar metabolism in Haemophilus influenzae. Res Microbiol 147: 541-51. 138. Macpherson, A. J. S., Jones-Mortimer, M. C. and Henderson, P. J. F. 1981. Identification of the GalP galactose transport protein of Escherichia coli. J. Biol. Chem. 258:4390-4396. 139.. Makman, R. S. and Sutherland, E. W. 1965. Adenosine 3':5'-phosphate in Escherichia coli. J. Biol. Chem. 240: 1309-1314. 140. Martinez, E., Bartolome, B. and de la Cruz, F. 1988. pACYC184-derived cloning vectors containing the multiple cloning site and lacZa reporter gene of pUC8/9 and pUC18/19 plasmids. Gene 68: 159-162. 141. Martinez, J., Steenbergen, S. and Vimr, E. 1995. Derived structure of the putative sialic acid transporter from Escherichia coli predicts a novel sugar permease domain. /. Bacteriol. 177: 6005-6010. 142. Matin, A., Auger, E. A., Blum, P. H. and Schultz, J. E. 1989. The genetic basis of starvation survival in non-differentiating bacteria. Ann. Rev. Micro. 43: 293-316. 143. Matthews, L., Spector, S., Lemm, J. and Potter, J. 1963. Studies on pulmonary secretions. I. The overall chemical composition of pulmonary secretions from patients with cystic fibrosis, bronchiectasis and laryngectomy. Am. Rev. Respir. Dis. 88: 199-204. 144. McCarthy, D. 1989. Cloning of the rec-2 locus of Haemophilus influenzae. Gene 75: 135-43. 197 145. Merrick, M.J., Taylor, M., Saier, M.H.Jr., Reizer, J. 1995. The roles of genes downstream of the a N structural gene rpoN in Klebsiella pneumoniae. In: Nitrogen fixation: Fundamentals and applications. Proceedings, 10th International Congress on Nitrogen Fixation. St. Petersburg, pp. 189-194. 146. Meyer, R. R. and Laine, P. S. 1990. The single stranded binding protein of Escherichia coli. Microbiol. Rev. 54: 342-380. 147. Michod, R. E., Wojciechowski, M. and Hoelzer, M. 1988. DNA repair and the evolution of transformation in the bacterium Bacillus subtilis. Genetics 118: 31-39. 148. Miller, D. H. and Huang, P. 1972. Identification of competence-repressing factors during log-phase growth of Haemophilus influenzae. J. Bacteriol. 109: 560-564. 149. Miller, J. H. 1972. Assay of (3-galactosidase. In: Experiments in Molecular Genetics. (Ed.). Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. pp. 352-355. 150. Miller, J. H. 1992. A short course in bacterial genetics: A laboratory manual for Escherichia coli and related bacteria. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 151. Mitchell, w. J., Reizer, J., Herring, C, Hoischen, C. and Saier, M. H. Jr. 1993. Identification of a phosphoenolpyruvate:fructose phosphotransferase system (fructose-l-P forming) in Listeria monocytogenes. J.Bacteriol. 175: 2758-2761. 152. Mulligan, M. E., Hawley, D. K., Entriken, R. and McClure, W. R. 1984. Escherichia coli promoter sequences predict in vitro RNA polymerase selectivity. Nucl. Acids. Res. 12: 789-800. 153. Nagasawa, S., Ishige, K. and Mizuno, T. 1993. Novel members of the two-component signal transduction genes in Escherichia coli. }. Biochem. .144: 350-357. 154. Neidhardt, F. C. 1987. Chemical composition of Escherichia coli. In: Escherichia coli and Salmonella typhimurium: Cellular and molecular Biology. Neidhardt, F. C. (Ed.). ASM Press, Washington, D.C. pp. 3-6. 155. Nelson, S. O., Scholte, B. J. and Postma, P. W. 1982. Phosphoenolpyruvate: sugar phosphotransferase system-mediated regulation of carbohydrate metabolism in Salmonella typhimurium. J. Bacteriol 150: 604-615. 198 156. Neuhard, J. 1983. Utilization of preformed pyrimidine bases and nucleosides. In: Metabolism of nucleotides, nucleosides and nucleobases. Munch-Petersen, A. (Ed.). Academic Press, Copenhagen, pp. 97-147. 157. Neuhard, J. and Kelln, R. A. 1996. Biosynthesis and conversions of pyrimidines. In: Escherichia coli and Salmonella: Cellular and molecular biology. Neidhardt, F. C. (Ed.). ASM Press, Washington, D.C. pp. 580-599. 158. Notley, L. and Ferenci, T. 1995. Differential expression of mal genes under cAMP and endogenous inducer control in nutrient-stressed Escherichia coli. Mol. Microbiol 16: 121-129. 159. Notley, L. and Ferenci, T. 1996. Induction of RpoS-dependent functions in glucose-limited continuous culture: What level of nutrient limitation induces the stationary phase of Escherichia coli? J. Bacteriol. 178: 1465-1468. 160. Notley-McRobb, L., Death, A. and Ferenci, T. 1997. The relationship between external glucose concentration and cAMP levels inside Escherichia coli: implications for models of phosphotransferase-mediated regulation of adenylate cyclase. Microbiology 143: 1909-1918. 161. O'Handley, S. F., Frick, D. N., Bullions, L. C, Mildvan, A. S. and Bessman, M . J. 1996. Escherichia coli orfl7 codes for a nucleoside triphosphate pyrophosphohydrolase member of the MutT family of proteins. Cloning, purification, and characterization of the enzyme. /. Biol. Chem. 271: 24649-24654. 162. Okabayashi, T. and Ide, M. 1970. Cyclic 3',5'-nucleotide phosphodiesterase of Serratia marcescens. Biochim. Biophys. Acta 220: 116-123. 163. Olsen, G. J., Woese, C. R. and Overbeek, R. 1994. The winds of (evolutionary) change: Breathing new life into microbiology. /. Bacteriol. 176: 1-6. 164. Page, W. J. and Sadoff, H. L. 1976. Control of transformational competence in Azotobacter Vinelandii by nitrogen catabolite derepression. /. Bacteriol. 125: 1088-1095. 165. Pedersen, H. and Valentin-Hansen, P. 1997. Protein-induced fit: the CRP activator protein changes sequence-specific DNA recognition by the CytR repressor, a highly flexible Lad member. EMBO J. 16: 2108-2118. 166. Peterkofsky, A. 1988. Redistribution of phosphate pools and the regulation of Escherichia coli adenylate cyclase activity. Arch. Biochem. Biophys. 265: 227-233. 199 167. Peterkofsky, A. and Gazdar, C. 1971. Glucose and the metabolism of adenosine 3':5'-cyclic monophosphate. Proc. Natl. Acad. Sci. USA. 63: 2794-2798. 168. Peterkofsky, A. and Gazdar, C. 1975. Interactions of Enzyme I of the phosphoenolpyruvate: sugar phosphotransferase system with adenylate cyclase of Escherichia coli. Proc. Natl. Acad. Sci. USA. 72: 2920-2924. 169. Peterkofsky, A. and Gollop, N. 1993. The Escherichia coli adenylyl cyclase complex: stimulation by GTP and other nucleotides. Protein Science 2: 498-505. 170. Peterkofsky, A., Reizer, A., Reizer, J., Gollop, N., Zhu, P. and Amin, N. 1993. Bacterial adenylyl cyclases. Prog. Nucl. Acids Res. Mol. Biol. 44: 31-65. 171. Peterkofsky, A., Seok, Y. J., Amin, N., Thapar, R, Lee, S. Y., Klevit, R. E., Waygood, E. B., Anderson, J. W., Grushus, J., Huq, H. and Gollop, G. 1995. The Escherichi coli adenylyl cyclase complex: requirement of PTS proteins for stimulation by nucleotides. Biochemistry 34: 8950-8959. 172. Peterkofsky, A., Svenson, I. and Amin, N. 1989. Regulation of Escherichia coli adenylate cyclase activity by the phosphoenolpyruvate:sugar phosphotransferase system. FEMS Micro. Rev. 63: 103-108. 173. Pifer, M. L. and Smith, H. O. 1985. Processing of donor DNA during Haemophilus influenzae transformation: analysis using a model plasmid system. Proc. Natl. Acad. Sci. USA. 82: 3731-5. 174. Postma, P. W., Lengeler, J. W. and Jacobson, G. R. 1993. Phosphoenolpyruvatexarbohydrate phosphotransferase systems of bacteria. Micro. Rev. 57: 543-594. 175. Postma, P. W. and Scholte, B. J. 1979. Regulation of sugar transport in Salmonella typhimurium. In: Functional and molecular aspects of biomembrane transport. Quagliariello, E., Papa, S. and Klingenberg, M. (Ed.). Elsevier/North-Holland Biomedical Press, Amsterdam, pp. 249-257. 176. Pseudomonas aeruginosa Genome Project, http://www.pseudo.com/ 177. Rabin, R. S. and Stewart, V. 1993. Dual response regulators (NarL and NarP) interact with dual sensors (NarX and NarQ) to control nitrate and nitrite-regulated gene expression in Escherichia coli K12. /. Bacteriol 175: 3259-3268. 178. Ramseier, T. 1996. Cra and the control of carbon flux via metabolic pathways. Res. Microbiol. 147: 489-493. 200 179. R a m s e i e r , T . M . , N e g r e , D . , C o r t a y , J . - C , S c a r a b e l , M . , C o z z o n e , A . J. a n d Sa i e r , M . H . Jr . 1993. In vitro b i n d i n g o f the p l e i o t r o p i c t r a n s c r i p t i o n a l r e g u l a t o r y p r o t e i n , F r u R , to the fru, pps, ace, pts a n d icd o p e r o n s o f Escherichia coli a n d Salmonella typhimurium. J. Moi. Biol. 234: 28-44. 180. R e a d , R . C , R u t m a n , A . A . , Jeffery , P . K . , L u n d , V . J . , B r a i n , A . P . R . , M o x o n , R . E . , C o l e , P . E . a n d W i l s o n , R . 1992. I n t e r a c t i o n o f c a p s u l a t e Haemophilus influenzae w i t h h u m a n a i r w a y m u c o s a i n v i t r o . Infect. Immun. 60 : 3244-3252 . 181. R e d d y , P . a n d K a m i r e d d i , M . 1998. M o d u l a t i o n o f a d e n y l a t e c y c l a s e a c t i v i t y b y c a t a l y t i c s i te m u t a n t s o f p r o t e i n E I I A ( G l c ) o f the p h o s p h o e n o l p y r u v a t e : s u g a r p h o s p h o t r a n s f e r a s e s y s t e m . / . Bacteriol. 180: 732-736. 182. R e d d y , P . , M e a d o w , N . , R o s e m a n , S. a n d P e t e r k o f s k y , A . 1985. R e c o n s t i t u t i o n o f r e g u l a t o r y p r o p e r t i e s o f a d e n y l a t e c y c l a s e i n Escherichia coli ex t r ac t s . Proc. Natl. Acad. Sci. USA 82: 8200-8204. 183. R e d d y , P . , M i l l e r , D . a n d P e t e r k o f s k y , A . 1986. S t i m u l a t i o n o f Escherichia coli a d e n y l a t e c y c l a s e a c t i v a i t y b y e l o n g a t i o n fac tor T u , a G T P - b i n d i n g p r o t e i n e s s e n t i a l f o r p r o t e i n s y n t h e s i s . / , Biol. Chem. 261 : 11448-11451 . 184. R e d f i e l d , R . , S c h r a g , M . a n d D e a n , A . 1997. T h e e v o l u t i o n o f b a c t e r i a l , t r a n s f o r m a t i o n : sex w i t h p o o r r e l a t i o n s . Genetics 146: 27-38. 185. R e d f i e l d , R . J. 1988. E v o l u t i o n o f b a c t e r i a l t r a n s f o r m a t i o n : is s ex w i t h d e a d c e l l s e v e r be t te r t h a n n o sex at a l l ? Genetics 119: 213-21 . 186. R e d f i e l d , R . J . 1991. sxy-1, a Haemophilus influenzae m u t a t i o n c a u s i n g g r e a t l y e n h a n c e d c o m p e t e n c e . / . Bacteriol. 173: 5612-5618. 187. R e d f i e l d , R . J. 1993. E v o l u t i o n of n a t u r a l t r a n s f o r m a t i o n : t e s t i n g the D N A r e p a i r h y p o t h e s i s i n Bacillus subtilis a n d Haemophilus influenzae. Genetics 133: 755-761. 188. R e d f i e l d , R . J . 1993. G e n e s for b reakfas t : the h a v e y o u r c a k e a n d eat i t t oo o f t r a n s f o r m a t i o n . / . Hered. 84: 400-404. 189. R e e c e , K . S. a n d P h i l l i p s , G . J. 1995. N e w p l a s m i d s c a r r y i n g a n t i b i o t i c - r e s i s t a n c e casset tes . Gene 105: 141-142. 190. R e i t z e r , L . J . 1996. S o u r c e s o f n i t r o g e n a n d the i r u t i l i z a t i o n . In: Escherichia coli a n d Salmonella: C e l l u l a r a n d m o l e c u l a r b i o l o g y . N e i d h a r d t , F . C . ( E d . ) . A S M P r e s s , W a s h i n g t o n , D . C . p p . 380-391 . 201 191. Reizer, J. 1989. Regulation of sugar uptake and efflux in Gram-positive bacteria. FEMS Microbiol. Rev. 63: 149-156. 192. Reizer, J., Hoischen, C., Reizer, A., Pham, T. and Saier, M. H. Jr. 1993. Sequence analyses and evolutionary relationships among the energy-coupling proteins Enzyme I and HPr of the bacterial phosphoenolpyruvate:sugar phosphotransferase system. Protein Science 2: 506-521. 193. Reizer, J., Reizer, A. and Saier, M. H. Jr., 1996. Novel PTS proteins revealed by bacterial genome sequencing: A unique fructose-specific phosphoryl transfer protein with two HPr-like domains in Haemophilus influenzae. Res. Micro. 147: 209-215. 194. Reizer, J., Sutrina, S. L., Wu, L. F., Deutscher, J., Reddy, P. and Saier, M. H. Jr. 1992. Functional interactions between proteins of the phosphoenolpyruvate:sugar phosphotransferase systems of Bacillus subtilis and Escherichia coli. J. Biol. Chem. 267: 9158-9169. 195. Rephaeli, A. W. and Saier, M. H. Jr. 1980. Regulation of genes coding for enzyme constituents of the bacterial phosphotransferase system. /. Bacteriol. 141: 658-663. 196. Robison, K. and Church, G. DPInteract: A database on DNA-protein interactions, http://arep.med.harvard.edu/dpinteract/ 197. Romano, A. H. and Saier, M. H. Jr. 1992. Evolution of the bacterial phosphoenolpyruvate:sugar phosphotransferase system. Section I. Physiologic and organismic considerations. In: The evolution of metabolic function. Morlock, R. P. (Ed.). CRC Press Inc., Boca Raton, Florida, pp. 43-170. 197a. Roossien, F.F. Blaauw, M. and Robillard, G.T. 1984. Kinetics and subunit interaction of the mannitol-specific Enzyme II of the Escherichia coli phosphoenolpyruvate-dependent phosphotransferase system. Biochemistry 23: 4934-4939. 198. Rosenberg, H., Russell, L. M, Jacomb, P. A. and Chegwidden, K. 1982. Phosphate exchange in the pit transport system in Escherichia coli. }. Bacteriol 149:123-140. 199. Rosenfeld, S. A., Stevis, P. E. and Ho, N. W. Y. 1984. Cloning and characterization of the xyl genes from Escherichia coli. Mol Gen. Genet. 194: 410-415. 202 200. Rotman, B., Ganesan, A. K. and Guzman, R. 1968. Transport systems for galactose and galactosides in Escherichia coli. II Substrate and inducer specificities. /. Moi. Biol. 36: 247-260. 201. Rychlik, W. and Rhoads, R. 1989. A computer programme for choosing optimal oligonucleotides for filter hybridisation techniques and in vitro amplification of DNA. Nucl. Acids. Res. 17: 8543-8551. 202. Saffen, D. W., Presper, K. A., Doering, T. L. and Roseman, S. 1987. Sugar transport by the bacterial phosphotransferase system. /. Biol. Chem. .262: 16241-16253. 203. Saier, M. H. Jr. 1977. Bacterial phosphoenolpyruvate:sugar phosphotransferase systems: Structural, functional and evolutionary interrelationships. Bacteriol. Rev. 41: 856-871. 204. Saier, M. H. Jr., Cox, D. F., Feucht, B. U. and Novotny, M. J. 1982. Evidence for the functional association of Enzyme I and HPr of the phosphoenolpyruvate-sugar phosphotransferase system with the membrane in sealed vesicles of Escherichia coli. J. Cell. Biochem: 18: 231. 205. Saier, M. H. Jr., Feucht, B. U. and Roseman, S. 1971. Phosphoenolpyruvate-dependent fructose phosphorylation in photosynthetic bacteria. /. Biol. Chem. 246: 7819-7821. 206. Saier, M. H. Jr., Grenier, F. C, Lee, C. A. and Waygood, E. B. 1985. Evidence for the evolutionary relatedness of the proteins of the bacterial phosphoenolpyruvate:sugar phosphotransferase system. /. Cell. Biochem. 27: 43-56. 207. Saier, M. H. Jr. and Reizer, J. 1994. The bacterial phosphotransferase system: New frontiers, 30 years later. Moi. Microbiol. 13: 755-764. 208. Saier, M. H. Jr., Simoni, R. and Roseman, S. . 1970. The physiological behaviour of Enzyme I and heat-stable protein mutants of a bacterial phosphotransferase system. /. Biol. Chem. 245: 5870-5873. 209. Saier, M. H. Jr., Simoni, R. D. and Roseman, S. 1976. Sugar transport. Properties of mutant bacteria defective in proteins of the phosphoenolpyruvate: sugar phosphotransferase system. /. Biol. Chem. 251: 6584-6597. 203 210. Saier, M. H. Jr. and Reizer, J. 1992. Proposed uniform nomenclature for the proteins and protein domains of the bacterial phosphoenolpyruvate:sugar phosphotransferase system. /. Bacteriol. 174: 1433-1438. 211. Saier, M. Jr., Feucht, B. and McCaman, M. 1975. Regulation of intracellular adenosine cyclic 3',5'-monophosphate levels in Escherichia coli and Salmonella typhimurium. J. Biol. Chem. 250: 7593-7601. 212. Sanger Centre/ John Innes Centre, http://www.sanger.ac.uk and http://www.uea.ac.uk/urp/jic/ 213. Schultz, J. E., Latter, G. I. and Matin, A. 1988. Differential regulation by cyclic AMP of starvation protein synthesis in Escherichia coli. }. Bacteriol. 170: 3903-3909. 214. Scocca, J. J., Poland, R. L. and Zoon, K. C. 1974. Specificity in deoxyribonucleic acid uptake by transformable Haemophilus influenzae. J. Bacteriol. 118: 369-73. 215. Seifert, H. S., Ajioka, R. S., Marchal, C, Sparling, P. F. and So, M. 1988. DNA transformation leads to pilin antigenic variation in Neisseria gonorrhoeae. Nature 336: 392-5. 216. Setlow, J. K., Boling, M. E., Allison, D. P. and Beattie, K. L. 1973. Relationship between prophage induction and transformation in Haemophilus influenzae. }. Bacteriol. 115: 153-61. 217. Setlow, J. K., Notani, N. K., McCarthy, D. and Clayton, N. L. 198.1. Transformation of Haemophilus influenzae by plasmid RSF0885 containing a cloned segment of chromosomal deoxyribonucleic acid. /. Bacteriol. 148: 804-11. 218. Setlow, J. K., Spikes, D. and Griffin, K. 1988. Characterization of the rec-1 gene of Haemophilus influenzae and behavior of the gene in Escherichia coli. J. Bacteriol. 170: 3876-81. 219. Shapiro, J. A. and Adhya, S. L. 1969. The galactose operon of Escherichia coli K-12. II A deletion analysis of operon structure and polarity. Genetics 62: 249-264. 220. Sharma, U . K., Dwarakanath, P., Banerjee, N., Town, C. and Balganesh, T. S. 1995. Expression and characterization of the ponA (ORF I) gene of Haemophilus influenzae: Functional complementation in a heterologous system. /. Bacteriol. 177:6745-50. 221. Shelhamer, J., Marom, Z. and Kaliner, M. 1984. The constituents of nasal secretion. Ear, Nose and Throat J. 63: 82-85. 204 222. Shine, J. and Dalgarno, L. 1974. The 3' terminal sequence of Escherichia coli 16S ribosomal RNA: Complementarity to nonsense triplets and ribosome binding sites. Proc. Natl Acad. Sci. USA 71: 1342-1346. 223. Sisco, K. L. and Smith, H. O. 1979. Sequence-specific DNA uptake in Haemophilus transformation. Proc. Natl. Acad. Sci. USA. 76: 972-6. 224. Smith, A. L., Redding, G., Doershuk, C, Goldman, D., Gore, E., Hilman, B., Marks, M., Moss, R., Ramsey, B., Rubio, T., Schwartz, R. H., Thomassen, M. J., Williams-Warren, J., Weber, A., Wilmott, R. W., Wilson, H. D., and Yogev, R. 1988. Sputum changes associated with therapy for endobronchial exacerbation in cystic fibrosis. /. Paediatrics 112: 547-554. 225. Smith, C. A., Rangarajan, M. and Hartley, B. S. 1991. D-Xylose (D-glucose) isomerase from Arthrobacter strain N.R.R.L. B3728. Purification and properties. Biochem. J. 277: 255-261. 226. Smith, H. O., Danner, D. B. and Deich, R. A. 1981. Genetic transformation. Ann. Rev. Biochem. 50: 41-68. 227. Smith, H. O., Tomb, J.-E, Dougherty, B. A., Fleischmann, R. D. and Venter, J. C. 1995. Frequency and distribution of DNA uptake signal sequences in the Haemophilus influenzae Rd genome. Science 269: 538-540. 228. Sokal, R. R. and Rohlf, F. J. 1969. Biometry (Second Edition). W.H. Freeman and Co., New York. 229. Solomon, J. M. and Grossman, A. D. 1996. Who's competent when: Regulation of natural genetic competence in bacteria. Trends Genet. 12: 150-155. 230. Sparling, P. F. 1966. Genetic transformation of Neisseria gonorrhoeae to streptomycin resistance. /. Bacteriol. 92: 1364-1371. 231. Spiro, S. and Guest, J. R. 1991. Adapative responses to oxygen limitation in Escherichia coli. Trends Biochem. Sci. 16: 310-314. 232. St Geme, J. W. 3rd. 1994. The HMW1 adhesin of nontypeable Haemophilus ingluenzae recognises sialylated glycoprotein receptors on cultured human epithelial cells. Infect. Immun. 62: 3881-3889. 233. Stein, J. M., Kornberg, H. L. and Martin, B. R. 1985. Effects of GTP, GDP [pS] and glucose on adenylate cyclase activity of Escherichia coli B. FEBS Letts 182: 429-434. 205 234. Stewart, G. J. and Carlson, C. A. 1986. The biology of natural transformation. Ann. Rev. Microbiol. 40: 211-235. 235. Stormo, G. D. 1988. Computer methods for analyzing sequence recognition of nucleic acids. Ann. Rev. Biophys. Chem. 17: 241-263. 236. Stormo, G. D. and Hartzell, G. W. I. 1989. Identifying protein-binding sites from unaligned DNA fragments. Proc. Natl. Acada. Sci. USA 86: 1183-1187. 237. Stouthamer, A. H. 1979. The search for correlation between theoretical and experimental growth yields. Int. Rev. Biochem. 21: 1-47. 238. Stuy, J. 1986. Effect of glycerol on Haemophilus influenzae transfection. /. Bacteriol. 166: 285-289. 239. Takahashi, M., Blazy, B., Baudras, A. and Hillen, W. 1989. Ligand-modulated binding of a gene regulatory protein to DNA. Quantitaive analysis of cyclic-AMP induced binding of CRP from Escherichia coli to non-specific and specific DNA targets. /. Mol. Biol. 207: 783-796. 240. Tatusov, R. L., Mushegian, A. R., Bork, P., Brown, N. P., Hayes, W. S., Borodovsky, M., Rudd, K. E. and Koonin, E. V. 1996. Metabolism and evolution oi Haemophilus influenzae deduced from a whole-genome comparison with Escherichia coli. Curr. Biol. 6: 279-91. 241. The Institute for Genome Research. 1999. http://www.tigr.org 242. Titgemeyer, F., Walkenhorst, J., Reizer, J., Stuiver, M. H., Cui, X. and Saier, M. H. Jr. 1995. Identification and characterization of phosphoenolpyruvateiructose phosphotransferase systems in three Streptomyces species. Microbiology 141: 51-58. 243. Tomb, J.-F., Amitai, H. and Abuchakra, S. 1993. A competence-specific regulatory sequence of Haemophilus influenzae. Abstract 19 in Proceedings, Molecular Genetics of Bacteria and Phages Conference, Cold Spring Harbor Laboratory. Cold Spring Harbor Laboratory Press, New York. 244. Tomb, J. F. 1992. A periplasmic protein disulfide oxidoreductase is required for transformation of Haemophilus influenzae Rd. Proc. Natl. Acad. Sci. USA. 89: 10252-10256. 245. Tomb, J. F., el Hajj, H. and Smith, H. O. 1991. Nucleotide sequence of a cluster of genes involved in the transformation of Haemophilus influenzae Rd. Gene 104:1-10. 206 246. Tenjum, T., Bukholm, G. and Bovre, K. 1990. Identification of Haemophilus aphrophilus and Actinobacillus actinomycetemcomitans by DNA-DNA hybridization and genetic transformation. /. Clin. Microbiol. 28: 1994-1998. 247. Trahan, L., Bareil, M., Gauthier, L. and Vadeboncoeur, C. 1985. Transport and phosphorylation of xylitol by a fructose phosphotransferase system in Streptococcus mutans. Caries Research 19: 53-63. 248. Trombe, M. C., Clave, C. and Manias, J.-M. 1992. Calcium regulation of growth and differentiation in Streptococcus pneumoniae. J. Gen. Microbiol. 138: 77-84. 249. Ullman, A. 1996. Catabolite repression: A story without end. Res. Microbiol. 147: 455-458. 250. Ullman, A. and Danchin, A. 1983. Role of cyclic AMP in bacteria. In: Advances in cyclic nucleotide research. Greengard, P. and Robison, G. A. (Ed.). Raven Press, New York. pp. 1-53. 251. Ullmann, A., Contesse, G., Crepin, M., Gros, F. and Monod, J. 1969. Cyclic AMP and catabolite repression in Escherichia coli. In: The Role of Adenyl Cyclase and Cyclic 3',5'-AMP in Biological Systems. (Ed.). National Institutes of Health, Bethesda, Maryland, pp. 215-231. 252. Unden, G. and Guest, J. R. 1984. Cyclic AMP and anaerobic gene expression in Escherichia coli. FEBS Lett. 170: 321-325. 253. University of Oklahoma Advanced Centre for Genome Technology, http:/ / www.genome.ou.edu 254. Valeyre, D., Soler, P., Basset, G., Loiseau, P., Pre, J., Turbie, P., Battesti, J. P. and Georges, R. 1991. Glucose, K + and albumin concentrations in the alveolar mileu of normal humans and pulmonary saccharoidosis patients. Am. Rev. Respir. Dis. 143:1096-1101. 255. Warren, L. 1972. The biosynthesis and metabolism of amino sugars and amino sugar-containing heterosaccharides. In: Glycoproteins: Their Composition, structure and Function. Gottschalk, A. (Ed.). Elsevier, Amsterdam-London-New York. pp. 1097-1126. 256. Watanabe, S., Kamiyama, J., Chigasaki, H. and Yoshioka, S. 1989. Polyol content of cerebrospinal fluid in brain-tumor patients. /. Neurosurg. 70: 183-189. 257. Wehr, C. T. 1973. Isolation and properties of a ribonuclease-deficient mutant of Salmonella typhimurium. }. Bacteriol. 114: 96-102. 207 258. Weichart, D., Lange, D v Henneberg, N. and Hengge-Aronis, R. 1993. Identification and characterization of stationary-phase inducible genes in Escherichia coli. Mol. Microbiol. 10: 407-420. 259. Williams, P., Huang, W, L . and Redfield, R. J. 1996. Cell transfer by filtration: evaluation of protocols for transformational competence. FEMS Micro. Letts. 137: 183-187. 260. Williams, P. M., Bannister, L . A. and Redfield, R. J. 1994. The Haemophilus influenzae sxy-1 mutation is in a newly identified gene essential for competence. /. Bacteriol. 176: 6789-6794. 261. Wilson, R. 1992. Interaction of Haemophilus influenzae with mucus, cilia, and respiratory epithelium. /. Inf. Dis. 165 (suppl.): S100-102. 262. Wintjens, R. and Rooman, M. 1996. Structural classification of H T H DNA-binding domains and protein-DNA interaction modes. /. Mol. Biol. 262: 294-313. 263. Wise, E. M., Alexander, S. and Powers, M. 1973. Adenosine 3':5'-cyclic monophosphate as a regulator of bacterial transformation. Proc. Natl. Acad. Sci. USA. 70:471-474. 264. Wright, B. 1996. The effect of the stringent response on mutation rates in Escherichia coli K12. Mol. Microbiol. 19: 213-219. 265. Wu, L . - F . and Saier, M. H. Jr. 1990. Nucleotide sequence of the fruA gene, encoding the fructose permease of the Rhodobacter capsulatus phosphotransferase system, and analyses of the deduced protein sequence. /. Bacteriol. 172: 7167-7178. 266. Wu, L . - F . , Tomich, J. M. and Saier, M. H. Jr. 1990. Structure and evolution of a multidomain multiphosphoryl transfer protein. Nucleotide sequence of the fruB(HI) gene in Rhodobacter capsulatus and comparisons with homologous genes from other organisms. /. Mol. Biol. 213: 687-703. 267. Young, F . E. and Spizizen, J. 1963. Biochemical aspects of competence in the Bacillus subtilis transformation system. II Autolytic enzyme activity of cell walls. /. Biol. Chem. 238: 3126-3130. 268. Zalkin, H. and Nygaard, P. 1996. Biosynthesis of purine nucleotides. In: Escherichia coli and Salmonella: Cellular and molecular biology. Neidhardt, F . C. (Ed.). ASM Press, Washington, D.C. pp. 307-342. 208 269. Zar, J. H. 1996. Biostatistical Analaysis (Third Edition). Prentice-Hall, Upper Saddle River, New Jersey. 270. Zoon, K. C, Habersat, M. and Scocca, J. J. 1976. Synthesis of envelope polypeptides by Haemophilus influenzae during development of competence for genetic transformation. /. Bacteriol. 127: 545-54. 271. Zoon, K. C. and Scocca, J. J. 1975. Constitution of the cell envelope of Haemophilus influenzae in relation to competence for genetic transformation. /. Bacteriol. 123: 666-77. 272. Zulty, J. J. and Barcak, G. J. 1995. Identification of a DNA transformation gene required for coml01A+ expression and supertransformer phenotype in Haemophilus influenzae. Proc. Natl. Acad. Sci. USA 92: 3616-20. 209 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0089301/manifest

Comment

Related Items