Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Characterization of a unique gene of opMNPV and analysis of regulatory motifs involved in basal activity… Shippam, Cynthia Elizabeth 1999

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1999-389774.pdf [ 7.11MB ]
Metadata
JSON: 831-1.0089290.json
JSON-LD: 831-1.0089290-ld.json
RDF/XML (Pretty): 831-1.0089290-rdf.xml
RDF/JSON: 831-1.0089290-rdf.json
Turtle: 831-1.0089290-turtle.txt
N-Triples: 831-1.0089290-rdf-ntriples.txt
Original Record: 831-1.0089290-source.json
Full Text
831-1.0089290-fulltext.txt
Citation
831-1.0089290.ris

Full Text

C H A R A C T E R I Z A T I O N O F A U N I Q U E G E N E O F O p M N P V A N D A N A L Y S I S O F R E G U L A T O R Y M O T I F S I N V O L V E D IN B A S A L A C T I V I T Y A N D IE2 T R A N S - A C T I V A T I O N by C Y N T H I A E L I Z A B E T H S H I P P A M B . S c , The University o f V ic tor ia , 1993 A T H E S I S S U B M I T T E D IN P A R T I A L F U L F I L L M E N T O F T H E R E Q U I R E M E N T S F O R T H E D E G R E E O F D O C T O R O F P H I L O S O P H Y in The Faculty o f Graduate Studies Department o f Plant Science W e accept this thesis-as. conforming T o the required standard T H b T U N I V E R S I T Y O F B R I T I S H C O L U M B I A January 1999 © Cynthia Elizabeth Shippam, 1999 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of The University of British Columbia Vancouver, Canada Date DE-6 (2/88) A B S T R A C T Baculovirus early genes are transcribed by host cell transcription factors and serve to regulate the infectious cycle via a cascade effect, and may also play a significant role in viral host range. Opep-2 is one of two unique early genes in the IE1 gene region of Orgyia pseudotsugata multicapsid nucleopolyhedrovirus (OpMNPV). Opep-2 is transcribed from 1-36 hours post infection as three transcripts, with a single consensus baculovirus early gene initiation motif and three termination sites, corresponding to transcripts of 1,1, 0.98 and 0.88 kb. Opep-2 is regulated by a promoter region that has several recognizable motifs, including a pair of previously unidentified 13 base direct repeats that serve as regulatory motifs, as well as GATA and CACGTG motifs. Transient expression assays in two insect cell lines - Ld652Y and Sf9 - have indicated different minimal promoter requirements for activation by host cell nuclear factors and for trans-activation by the viral transcription factor IE2. This is the first study to investigate the sequence requirements for IE2 //vms-activation. No specific sequences are absolutely required for /rara-activation by either cell line. Deletion viruses lacking the opep-2 ORF have indicated that opep-2 is not required for infection in tissue culture, and its absence has no effect on virus production or infectivity in either tissue culture or in insects susceptible to the wild type virus. The deletion of opep-2 from the genome has resulted in a change in plaque morphology, and transmission electron microscopy studies have indicated that cells infected with the deletion virus do not lyse as quickly as WT infected cells. ii TABLE OF CONTENTS Abstract ii Table of Contents iii List of Tables vi List of Figures vii List of Abbreviations ix Acknowledgements x INTRODUCTION Baculovirus infection cycle Genome organization Homologous regions (hrs) Gene regulation Early gene transcription Late gene transcription Transcriptional Enhancers DNA replication Virally-encoded transcription factors OpMNPVIE-l/IE-0 OpMNPV IE-2 OpMNPVP34 Host Range Study Objectives METHODS AND MATERIALS Cells and Virus 32 Plaque Assays 32 DNA Sequencing and Analysis 32 Plasmid Constructs 33 Opep-2 Fusion Constructs 33 CAT Reporter Constructs 34 Site-directed Mutagenesis of the opep-2 promoter GATA and CACGTG elements 36 Construction of synthetic promoters 38 Viral trans-activator clones . 39 Opep-2 expression vectors for generation of recombinant AcMNPV 39 RNA isolation and Northern Blots 40 Transcript Mapping 41 cDNA synthesis and 3' RACE 41 S1 Nuclease protection and Primer Extension 42 Analysis of Viral DNA Replication 43 1 6 8 9 9 12 14 16 19 20 22 25 27 30 iii Electrophoretic Mobility Shift Assays Nuclear extracts for use in EMSA Probes for EMSA EMSA Transfections and CAT Assays Antibody Production Protein Analysis SDS-PAGE and Western Blot 35S labelling of total proteins In vitro translation Cell fractionation Purification of membranes from infected cells N-glycosylation analysis of OPEP-2 Phosphorylation analysis of OPEP-2 Isolation and purification of ODV and BV Construction of Recombinant viruses Opep-2 deletion virus AcMNPV recombinant virus Insect bioassay Occlusion body preparation O. leucostigma maintenance T. ni maintenance Oral inoculation protocol Transmission Electron Microscopy RESULTS Characterization of opep-2 Identification of opep-2 Transcriptional mapping and temporal expression of opep-2 Temporal expression of OPEP-2 Cellular localization of OPEP-2 Deletion of opep-2 Protein expression DNA replication Virus production Plaque morphology Transmission electron microscopy Insect bioassay Opep-2 promoter analysis 5'-3' promoter deletions 3'-5' promoter deletions Mutagenesis of selected motifs Synthetic promoter constructs CACGTG motifs 13R motifs iv Electrophoretic Mobility Shift Assays 148 DISCUSSION 151 Characterization of opep-2 151 OPEP-2 expression 152 Deletion virus studies 154 Bioassay of WT and deletion viruses 157 Opep-2 promoter studies 159 Promoter requirements for transient expression 161 Promoter motifs involved in /rans-activation 166 CONCLUSIONS 171 REFERENCES 173 v LIST OF TABLES Table 1 Primers used for 3'-5' deletions of opep2CAT promoter 35 Table 2 Primers used for mutagenesis of GATA motifs 37 Table 3 Final titres of WT and vAopep-2 OpMNPV stocks 94 Table 4 LD50 of 0. leucostigma orally inoculated with WT or vAopep-2 OpMNPV at 3 r d instar 107 Table 5 LD50 of T. ni orally inoculated with WT or recombinant AcMNPV at 5th instar 114 Table 6 LD50 of T. ni orally inoculated with WT or recombinant AcMNPV at 3rd instar 115 VI L I S T O F F I G U R E S Figure 1 Baculovirus life cycle 4 Figure 2 Comparison of OpMNPV and AcMNPV iel-ie2 gene region 61 Sequence of opep-2 61 Figure 3 Northern blot of opep-2 transcripts 64 Figure 4 Transcriptional mapping of opep-2 67 Figure 5 Western blot analysis of OPEP-2 expression 70 Figure 6 Analysis of phosphorylation of OPEP-2 72 Figure 7 Cellular localization of OPEP-2 75 Figure 8 Western blot analysis of BV and ODV 77 Figure 9 Analysis of N-glycosylation and membrane association of OPEP-2 80 Figure 10 Evidence of deletion of opep-2 from OpMNPV 83 Figure 11 Western blot analysis of steady state levels of selected early and late proteins 86 Figure 12 Time course analysis of 35S labelled total proteins from infected Ld652Y cells , 89 Figure 13 Time course analysis of DNA replication in OpMNPV infected Ld652Y cells 93 Figure 14 Time course of budded virus titres from OpMNPV infected Ld652Y cells 96 Figure 15 Plaque morphology of WT and vAopep-2 OpMNPV 99 Figure 16 Electron micrograph time course analysis of WT and vAopep-2 OpMNPV infected Ld652Y cells 101 Figure 17 Modal time to death of 0. leucostigma orally inoculated with WT or vAopep-2 OpMNPV at 3rd instar 109 Figure 18 Schematic diagram of constructs for AcMNPV recombinant virus 112 Figure 19 Modal time to death of T. ni orally inoculated with WT or recombinant AcMNPV at 3rd or 5th instar 117 Figure 20 Nucleotide sequence of opep-2 promoter 120 Figure 21 Trans-activator analysis of -270 opep2CAT in Ld652Y and Sf9 cell lines 124 Figure 22 Tram-activator analysis of -174 opep2CAT in Ld652Y and Sf9 cell lines 126 Figure 23 5'-3' deletion analysis of opep2CAT promoter in Ld652Y and Sf9 cell lines 131 Figure 24 3'-5' deletion analysis of opep2CAT promoter in Ld652Y and Sf9 cell lines 133 Figure 25 Mutagenesis of GATA and CACGTG of-124 opep2CAT -effects on CAT activity and IE2 frara-activation 136 vii Figure 26 Mutagenesis of GATA motifs of -76 opep2CAT - effect on activity and IE2 ^raw-activation 141 Figure 27 CACGTG synthetic promoters - activity and ^ raw-activation by IE2 145 Figure 28 13R synthetic promoters - activity and ^ raw-activation bylE2 147 Figure 29 EMSA analysis of the opep-2 promoter 150 Figure 30 Incidence of 13R in OpMNPV and AcMNPV genome 163 viii L I S T O F A B B R E V I A T I O N S AcMNPV Autographa californica multicapsid nucleopolyhedrovirus (5-gal (3-galactosidase BmNPV Bombyx mori nucleopolyhedrovirus bp base pair BV budded virus CAT chloramphenicol acetyl transferase CIP calf intestinal phosphatase DAS dilute alkaline saline dNTP deoxynucleotide triphosphates DTT dithiothreitol EMSA electrophoretic mobility shift assay hr homologous region hr p.i. hour post infection IE immediate early kb kilobase kDa kilodaldon L D 5 0 lethal dose to kill 50% LEF late expression factor LMP agarose low melting point agarose LdMNPV Lymantria dispar multicapsid nucleopolyhedrovirus M.o.i. multiplicity of infection OB occlusion body ODV occlusion derived virus OpMNPV Orgyia pseudotsugata multicapsid nucleopolyhedrovirus ORF open reading frame PAGE polyacrylamide gel electrophoresis PBS phosphate buffered saline PCR polymerase chain reaction PIB phosphatase inhibitor buffer pmol picomole PSB protein sample buffer RACE rapid amplification of cDNA ends SDS sodium dodecyl sulfate TBS Tris buffered saline TCID50 Tissue culture infectious dose to kill 50% pg microgram WT wild type ix ACKNOWLEDGMENTS I would first like to express my gratitude to my supervisor, Dr. David Theilmann, who invested the time, effort and patience to teach not only myself, but everyone who came through the lab. Thanks are also due to my supervisory committee - Dr. Caroline Astell, Dr. Murray Isman and Dr. James Kronstad - for their many good ideas and support for the last 5 years. Sandy Stewart was an invaluable help to me from the beginning, with the patience to answer my questions about everything - from the unanswerable to the inane. Les Willis continued answering questions after the move to Summerland, and provided a great music collection to make late nights at the lab more interesting. Since the first day I arrived in Summerland to a lab half unpacked, everyone at the Summerland Research Station has been a wonderful help, providing directions, an extra hand, and an excuse to have a cup of coffee from time to time. Thanks are due to Dr. Basil Arif of the Great Lakes Forestry Centre for providing the White-marked Tussock Moth larvae, Dr. Xiaoning Wu for the Northern blot analysis of opep-2 expression and to Dr. Maynard Milks for the many bioassays on cabbage loopers and invaluable instruction in statistics. I would also like to say thank you to the staff of the Department of Plant Science at UBC for their help in many aspects of administration. Finally, I cannot express gratitude enough for the patience and support given to me by my parents, Grace and Glen Shippam, and my husband, Jason Brett. INTRODUCTION Baculoviruses are large double-stranded DNA viruses pathogenic for a variety of insect species. As such, they have the potential to be used for biological pest control in forestry and agriculture in both naturally occurring and engineered forms (Wood and Granados, 1991). Orgyiapseudotsugata multicapsid nucleopolyhedrovirus (OpMNPV) is a pathogen of the Douglas fir tussock moth, a major pest of Western Canadian forests. OpMNPV has a narrow host range and infects only a few species, making it a useful biological control agent in Pacific Northwest forests (Cunningham, 1988; Shepherd et al., 1984). Baculovirus infection cycle Baculoviruses in general are unique among viruses, having two phenotypes in the infection cycle. These two forms, budded virus (BV) and occlusion-derived virus (ODV), are genetically identical, but have distinct roles in transmission of infection and arise at different points in the infection cycle (Figure 1). ODV is produced late in infection and is the orally infectious form of the virus that persists in the environment and spreads the infection through a population of insects. In the environment, the ODV are protected within occlusion bodies composed of the crystallized viral protein polyhedrin (Rohrmann, 1986, and references therein). The infection initiates with the ingestion of the occlusion bodies by the insect larvae. In the alkaline midgut, the occlusion bodies solubilize, releasing the enveloped ODV. In order to reach the epithelial cells of the gut and establish infection, the released virus particles must cross the peritrophic membrane (PM). The PM is a noncellular membrane lining the midgut lumen of the larva and is composed of chitin, glycosaminoglycans, glycoproteins and other proteins, including various digestive enzymes (Adang and Spence, 1981; Derksen and Granados, 1988) and would appear to present a formidable barrier to protect the insect from viral infection. The virus does manage to cross this barrier, and a viral factor associated with the granulosis virus of Trichoplusia ni (TnGV) was observed to enhance the movement of virus through the PM (Derksen and Granados, 1988). This infection enhancing protein was later identified in the granulosis viruses of other lepidopteran species and named 'enhancin' (Corsaro et al., 1993). Enhancin has been determined to be a zinc-binding metalloproteinase that augments the infectivity of the nucleopolyhedrovirus via proteolytic degradation of specific PM proteins (Lepore et al., 1996). Nucleopolyhedroviruses however, do not possess enhancins, but chitinase activity is known to be associated with polyhedra (Hawtin et al., 1997) and this may facilitate the penetration of the PM by the virus. Once past the PM, the envelopes of the ODV fuse with the columnar epithelial cells and the virion enters the cell via absorptive endocytosis. The low pH within the endosome induces fusion of the viral envelope with the endosomal membrane, which releases the viral nucleocapsid into the cytoplasm (Granados and Lawler, 1981; Volkman and Goldsmith, 1985; Wang et al, 1997). Release of the nucleocapsid into the cytoplasm induces actin polymerization, with the nucleocapsids localized to one end (Charlton and Volkman, 1993; Lanier and Volkman, 1998) and possibly involving a nucleocapsid-associated actin-binding protein (Lanier et al, 1996). It is thought that the capsids are 2 Figure 1. Infection cycle of a nuclear polyhedrosis virus. Polyhedra are ingested by a susceptible insect and solubilized in the high pH environment of the midgut. Occlusion derived virus (ODV) is released and enters the midgut cells. Nucleocapsids are transported to the nucleus, where the viral DNA is uncoated, followed by early gene expression and DNA replication. Progeny nucleocapsids assemble within and around the virogenic stroma. Some progeny nucleocapsids bud through the nuclear membrane and lose the nuclear membrane in the cytoplasm. Nucleocapsids bud through the cytoplasmic membrane into the hemocoel acquiring the BV specific envelope. These virions are specialized for secondary infection of other host tissues. A second group of progeny nucleocapsids (ODV) become enveloped within the nucleus and are occluded within polyhedrin protein. Maturation of the polyhedra includes addition of a polyhedral envelope surrounding the formed crystal. Upon death of the insect and liquifaction induced by virally-encoded chitinases, the polyhedra are released into the environment. (Adapted from Blissard and Rohrmann, 1990). 4 transported through the cytosol by actin polymerization behind the nucleocapsid, which allows them to reach the nucleus (Whittaker and Helenius, 1998), where they have been observed to 'dock' at the nuclear pore complexes (Raghow and Grace, 1974; Summers, 1971). Some of these capsids contain DNA, while others are empty, suggesting that only the DNA is transported into the nucleus (for review of virus entry, see Whittaker and Helenius, 1998) Once the viral DNA is within the nucleus, transcription of viral immediate early genes commences (Friesen and Miller, 1986). Host genes are transcribed and translated at early times in infection (host factors are required for transcription of early genes), but the virus shuts down host gene transcription and translation of cellular mRNA by 24h (Ooi and Miller, 1988; Vlak et al, 1981). Host nuclear DNA remains intact during viral infection (Wilson and Miller, 1986) and the cell cycle is halted at the G2 /M phase, blocking host cell DNA replication (Braunagel et al, 1998). Replication of viral DNA does occur however, and virions are formed within the virogenic stroma in the nucleus of the infected cell. BV is the first viral phenotype produced and is singly enveloped by budding from the plasma membrane to spread the infection to surrounding cells. Budded virus also enters the cell via adsorptive endocytosis, and initiates the second round of viral replication (Blissard and Rohrmann, 1990). At later times in the infection cycle, nucleocapsids within the nucleus are preferentially enveloped either singly (SNPV) or multiply (MNPV) in membranes synthesized de novo, and occluded within crystallizing polyhedrin, forming large occlusion bodies or polyhedra (Hess and Falcon, 1977; Summers and Volkman, 1976). The occlusion bodies are released into the environment 5 when the cell lyses and the insect is liquified by virally-encoded chitinase, cathepsin and possibly other viral gene products (Ayres et al, 1994; Hawtin et al, 1997; Slack et al, 1995). Genome Organization OpMNPV has a circular DNA genome of 131,900 bp, containing 152 putative open reading frames (ORF) of 150 nucleotides or larger (Ahrens et al., 1997). In addition, four other viruses have been completely sequenced - the archetype baculovirus Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV) - 133,894 bp (Ahrens et al., 1997), Lymantria dispar multicapsid nucleopolyhedrovirus (LdMNPV) -161,044 bp (Kuzio et al., 1999) and Bombyx mori nucleopolyhedrovirus (BmNPV) -128,417 bp (Gomi et al, 1997). Of these four, OpMNPV and AcMNPV have been studied in the greatest depth. Genome organization of OpMNPV and archetype baculovirus AcMNPV is similar over much of the genomes. Genes are not clustered according to temporal expression or function but are scattered throughout the genome, with a few major differences in the gene order of these two well-studied viruses. Two large inversions have occurred during the evolutionary divergence between OpMNPV and AcMNPV -ORFs 1-10 and ORFs 24-38 of OpMNPV (Ahrens et al, 1997). Sequence within these regions shows similarity to the corresponding ORFs in AcMNPV, but in the opposite orientation. Three regions where insertions or deletions have occurred have also been identified. AcMNPV has a 4.2 kb insert in between the p26 and alkaline-exonuclease ORFs containing p94, p35 and hr5 - this insert is not found in OpMNPV and the p26 and 6 alkaline-exonuclease ORFs are adjacent to one another. One insertion in the OpMNPV genome occurs between the sod gene and ORF 38 (ORF 30 and sod of AcMNPV). This insert contains 8 ORPs, including three ORFs that have no sequence similarity to other ORFs in Genbank. The other five include a conotoxin-like gene (ctl), an inhibitor of apoptosis gene (iap-3), three involved in nucleotide metabolism - an ORF with a similarity to dUTPase (dutpase) and two ribonucleotide reductase-like ORFs (rrl and rr2) - and one homologous region (hr2) (Ahrens et al., 1997). The G+C content of OpMNPV (55%) differs significantly from the host insect Orgyia pseudostugata (36%) (Rohrmann et al., 1978). OpMNPV having its own dNTP synthetic enzymes may enable the virus to alter the host's dNTP pool composition to better suit the requirements of the virus (Ahrens et al., 1997). The second insertion in the OpMNPV genome that does not occur in AcMNPV is found between odvp-6e and ie-2 (odv-e56 and ie-2 of AcMNPV) and contains two unique genes - opep-2 which is the subject of this thesis, and opep-3 (Ahrens et al, 1997; Theilmann et al, 1996; Wu et al, 1993b) Host cell DNA sequences have been identified in the genomes of several AcMNPV isolates, initially in FP (few polyhedra) mutants because of the differences in plaques produced by these mutant viruses in tissue culture (Carstens, 1987; Fraser et al, 1983; Friesen and Miller, 1987; Friesen et al, 1986; Miller and Miller, 1982). Some of these host sequences arise from transposable elements, which appear to be derived from repeated DNA in the host insect cell (Beames and Summers, 1988; Gombart et al, 1989). These insertions can disrupt viral genes by interfering with gene expression or by causing aberrant expression of the gene product. Conversely, the inserted DNA may encode an ORF which can be expressed, or spliced with existing viral genes to generate a novel 7 gene product (Friesen et al, 1986; Gombart et al, 1989). W o r k o f G o m i and colleagues ( G o m i et al., 1997) has suggested that baculoviruses carry many genes not necessary for infection - greater than 5 0 % o f the B m N P V genes appear to be non-essential for growth in tissue culture when deleted individually. W h y these genes are maintained i f they are not necessary is unclear. It is thought that the large differences in genome sizes for baculoviruses (90-180 kb) may reflect incorporation o f insect or other viral genes that may confer selective advantage, while not being essential for replication in tissue culture where the majority o f these studies are carried out (Blissard and Rohrmann, 1990; Gombart etal, 1989). Homologous regions (hrs) A distinctive feature o f all baculovirus genomes are homologous repeat regions spread throughout the genome. Baculovirus hr sequences are composed o f highly conserved repeated sequences, encompassing both direct repeats and imperfect pal indromic sequences ( K o o l et al, 1995). F ive hrs are found throughout the genome o f O p M N P V , these contain 30 bp imperfect palindromes within a 66 bp repeat, with each hr ranging in size f rom two to ten repeats (Ahrens et al, 1997; The i lmann and Stewart, 1992b). A c M N P V has nine hrs also scattered throughout the genome, ranging in size f rom one to nine repeats. E a c h A c M N P V repeat is about 70 bp, containing a 30 bp palindrome flanked by about 20 bp o f direct repeat sequence (Ayres et al, 1994; Guarino etal, 1986). 8 Gene regulation Baculovirus genes are regulated primarily at the level of transcription in an orderly cascade, where each successive stage is dependent on the previous one for expression (Friesen and Miller, 1986). Gene expression can be divided in two general categories - early genes, which are dependent on the host cell RNA polymerase II (Fuchs et al., 1983; Huh and Weaver, 1990; Kogan et al, 1995), and late genes which are transcribed concomitant with the onset of D N A replication, by an RNA polymerase of unique composition that is partially or entirely of viral origin (Beniya et al., 1996; Grula et al., 1981; Yang et al., 1991). A subset of late genes are the very late genes which are hyperexpressed by the viral RNA polymerase at very late times when many of the late and early genes are shut down, (reviewed in Rohrmann, 1986; Blissard and Rohrmann, 1990). Baculovirus mRNAs appear to be polyadenylated by the cellular enzymes responsible for the processing of cellular mRNA (Birnstiel et al., 1985; Rohrmann, 1986). Early gene transcription Naked baculovirus DNA is infectious when transfected into permissive cells (Carstens et al., 1980), indicating that very early transcription of viral genes is independent of viral factors. These immediate early genes (IE genes) have promoters that resemble 'typical' RNA polymerase II promoters found in both insect cells and other organisms (Bucher, 1990) and are readily transcribed in uninfected cells (Friesen and Miller, 1986; Guarino and Summers, 1986a; Hoopes and Rohrmann, 1991; Theilmann and Stewart, 1991). In contrast to IE genes, delayed early genes are those genes that are 9 transcribed before DNA replication, but require other viral factors for non-basal levels of expression (Glocker et al, 1992; Guarino and Summers, 1986a; Theilmann and Stewart, 1991). A number of promoter elements have been identified that regulate early gene expression. Consensus sequence of many early gene basal promoters includes a TATA box 21-27 nt upstream of the transcription initiation site, CAGT or CACAGT (Blissard and Rohrmann, 1989; Carson et al., 1991b; Chisholm and Henner, 1988; Guarino and Summers, 1986a; Guarino and Summers, 1987; Krappa and Knebel-Morsdorf, 1991; Theilmann and Stewart, 1991; Theilmann and Stewart, 1992a). This arrangement has been observed in a number of insect genes also and is highly conserved (Cherbas and Cherbas, 1993) reviewed in (Harshman and James, 1998)). Studies using minimal promoters of OpMNPV gp64 and AcMNPV iel and p35 genes have indicated that the TATA box is the primary element controlling initiation site selection (Blissard et al., 1992; Dickson and Friesen, 1991). Mutations of the sequences downstream of the TATA box in both p35 and ie-J of AcMNPV did not affect correct initiation of transcripts 30 bases downstream. Although the transcripts initiated correctly in the ie-1 gene when the CAGT was mutagenized, it was at a significantly lower level, presumably due to a pyrimidine (C) at the start site, rather than the preferred purine (A). The p35 model had a purine (A) present for all promoters tested. Cg30 is an early gene that lacks a CAGT consensus sequence, as well as a consensus TATA box, however an AT rich sequence is located 30 nucleotides upstream of the transcription initiation site and this appears to be able to serve in its place (Thiem and Miller, 1989a). Only a few regulatory elements of early gene promoters have been identified to date. GATA elements were first identified in a baculovirus gene in the promoter of the 10 OpMNPV early gene ie-2 and the AcMNPV early gene pe38 (Krappa and Knebel-Morsdorf, 1991; Theilmann and Stewart, 1992a). GATA motifs are found alone or in multiple copies in either orientation in many baculoviral early gene promoters, and interaction with host cell nuclear factors has been demonstrated (Kogan and Blissard, 1994; Kogan et al, 1995; Krappa et al, 1992; Skeiky and Iatrou, 1991). Studies on the motifs of the promoter of gp64 of OpMNPV have demonstrated that mutation of another element, CACGTG, or GATA resulted in a significant decrease of transcriptional activity from the promoter (Kogan and Blissard, 1994). CCAAT sequences, GC rich motifs and other specific sequence motifs have also been identified in the upstream activating region (UAR) and have been shown to influence transcriptional activity of the iel promoter of OpMNPV (Dickson and Friesen, 1991; Leisy et al, 1997; Theilmann and Stewart, 1991), but their ability to interact with insect cell factors has not been demonstrated. The CAGT of iel functions as a transcriptional initiator element, as it is required to determine the position of the RNA start site and to regulate the rate of transcription. Iel transcription is also controlled by a downstream activating region (DAR), extending from +11 to +24 nucleotides in the 5' untranslated region of the RNA transcript. Deletions which remove both the CAGT and DAR eliminated detectable transcription of the iel gene (Pullen and Friesen, 1995a; Pullen and Friesen, 1995b). The hrl sequence found in the promoter of the ie2 gene was also found to influence transcription. This hr element increased transcription of ie2 only when in cis (not in trans), was both orientation and position independent, and did not required IE-1 for its enhancing activity (Carson et al., 1991b). Additional motifs that regulate baculovirus early genes have yet to be positively identified. 11 In addition to the cellular factors that interact with these motifs, many of these early promoters are trans-regulated by transcription factors of viral origin as well (discussed below). Maximal expression of some of these early genes requires these viral /rara-activators, and it is also possible that these /rara-activators play a role in the effective host range or virulence of the virus (Theilmann and Stewart, 1991). Enhancer sequences are found throughout the genome and also significantly increase transcription of early genes in transient assays, both in the presence and absence of viral factors (discussed below). Late gene transcription The unique RNA polymerase responsible for transcription of late genes is composed of subunits that confer resistance to a-amanitin (Grula et al., 1981), enabling it to be distinguished from the three host RNA polymerases present in the cell. Information from baculovirus genomes that have been fully sequenced have not indicated any ORFs that encode a prominent domain suggestive of an RNA polymerase (Ahrens et al., 1997; Ayres et al, 1994), although Passarelli et al. (1994) (Passarelli et al, 1994) have identified a late gene expression factor (lef-8) with a 13 amino acid region at the C terminal end that shows homology with eukaryotic and prokaryotic RNA polymerase subunits. Baculovirus RNA polymerase complexes from AcMNPV infected Sf9 cells that preferentially support either late or very late gene transcription have been separated by phosphocellulose chromatography (Xu et al, 1995), indicating the presence of factors that discriminate between the two categories of late genes. The recently isolated viral encoded RNA polymerase is composed of four equimolar subunits - LEF-8, LEF-9, LEF-12 4 and P47 - and has been determined to be specific for late and very late viral transcripts (Guarino etal, 1998). Transcription of late genes by this unique RNA polymerase initiates concurrently with or following DNA replication (Gordon and Carstens, 1984; Miller et al, 1981; Rice and Miller, 1986; Wang and Kelly, 1983) and requires 19 virally encoded late expression factors (lefs) for transcription in vitro. These include lefs 1-12, p47, ie-1, ie-n, 39K, dnapol,p35,pl43 and the very late factor, vlf-1 (Guarino et al, 1998; Lu and Miller, 1995a; Lu and Miller, 1995b; Rapp et al, 1998; Todd et al, 1996). Vlf-1 has been found to be essential for very late gene expression in vivo (Gomi et al, 1997). Despite the identification of many viral factors essential for late gene expression, none have been demonstrated to interact directly with the late gene promoters. A 30 kDa host factor, PPBP (polyhedrin promoter binding protein), has been identified as a DNA binding protein that specifically interacts with motifs in the polyhedrin promoter (Burma et al, 1994; Ghosh et al, 1998). While not essential for transcription in vitro, the presence of PPBP significantly enhances expression from the polyhedrin promoter (for review, see also (Hasnain et al, 1997)). Hr sequences have also been shown to upregulate transcription of late genes in transient assays when linked in cis (discussed below). Transcription of late genes has long been known to initiate almost exclusively from a (G/T/A)TAAG motif, which seems to function both as a promoter and an mRNA start site (Rankin et al, 1988; Rohrmann, 1986). In some late genes, multiple copies of this late promoter motif are found, and transcription may initiate from one or all of them (Blissard and Rohrmann, 1989; Thiem and Miller, 1989). Linker-scanning mutagenesis studies of both late (vp39) and very late (polyhedrin) gene promoter sequences in 13 AcMNPV have identified both essential and stimulatory regions surrounding the T A A G motif in each. Initiation of transcription of polyhedrin was found to have an absolute requirement for an 8 base pair sequence (TAAGTATT), and sequences in the 5' untranslated region were found to stimulate transcription of polyhedrin, but were not essential (Ooi et al, 1989; Rankin et al., 1988). Transcription of vp39 requires an intact T A A G sequence as found in the polyhedrin transcriptional start site, and is enhanced by the immediate surrounding bases (Morris and Miller, 1994). The sequences surrounding the transcriptional start sites for both genes is AT rich, but are greatly divergent - the only identity is the T A A G sequence which may be the recognition sequence for the unique RNA polymerase activity for both late and very late genes (Ooi et al., 1989; Thiem and Miller, 1989). At very late times post infection, expression of the late genes declines and the very late genes {polyhedrin and plO) are expressed to very high levels. Very late factor 1 (VLF-1) of AcMNPV selectively enhances transcription of very late genes during infection and in transient assays, while demonstrating no effect on late genes in transient assays (McLachlin and Milier, 1994; Todd et al, 1996). The T A A G sequence is essential for VLF-1 activity, but as the context of this motif differs in the two classes of late genes, it is possible that this, in conjunction with the stimulatory downstream promoter sequences of polyhedrin, modulate its effects to allow for hyperexpression of the very late gene exclusively (Ooi et al., 1989; Todd et al., 1996). Transcriptional enhancers Enhancers are cw-acting DNA sequence elements that increase the rate of utilization of promoters by RNA polymerase II and function relatively independent of 14 their orientation or distance from the promoter, although optimal positions have been determined for the OpMNPV hr\ motif in transient assays (Theilmann and Stewart, 1992b). Hrs have been shown to serve as c/s-acting enhancers of early genes such as 39K (Guarino and Summers, 1986a), ie2 (Carson et al., \99\a),p35 (Nissen and Friesen, 1989) andpl43 (Lu and Carstens, 1993). IE1 has been demonstrated to bind the hr sequences (Choi and Guarino, 1995b; Guarino and Dong, 1991; Guarino and Dong, 1994; Leisy et al., 1995; Rodems and Friesen, 1995) and expression of 39K, ie2 andp35 is further increased by the viral transcription factor IE1 in the presence of the hr sequence (Guarino et al., 1986; Nissen and Friesen, 1989; Theilmann and Stewart, 1991). Late gene transcription is also positively regulated by hr sequences when they are linked in cis and r^aw-activated by IE-1 (Guarino and Summers, 1988). The minimal enhancer structure that is required for frYWs-activation of an early gene promoter in vitro is small -42 bp encompassing a synthetic AcMNPV hr central palindrome has been found to be sufficient for minimal enhancer function (Rasmussen et al., 1996). Small insertions or deletions at the centre of the palindrome has been shown to eliminate replication ability and independent /rans-activation, but IE-1 binding remained unaffected (Rodems and Friesen, 1995). In addition to their role as enhancer sequences, hrs of both OpMNPV and AcMNPV have also been demonstrated to function as putative origins of DNA replication in transient replication assays (Guarino et al., 1986; Leisy and Rohrmann, 1993; Pearson et al., 1993; Theilmann and Stewart, 1992b). In addition, it has been determined in vitro that identical sequences are essential for both DNA replication and enhancer function (Leisy et al., 1995). IE1 is an essential viral factor for DNA 15 replication (Lu and Mi l ler, 1995b) and as discussed above, is able to bind the hr sequences. It is thought that the hr palindromes may confer essential structural features that are important for replication and ^raw-activation, possibly regulated by the binding o f l E l (Rasmussen et al., 1996). The palindromic structures would imply that two hairpins form, interrupted by the two 13 bp stems (direct repeat flanking regions), forming a cruciform structure. This transition could facilitate local base pair melting to assist replication or interaction of transcription factors. Experimental data indicates that this cruiciform structure does not occur in vitro, and IE-1 does not bind the hairpin structures when their formation is induced in vitro. In vivo formation of this cruciform structure however, is still undetermined (Rasmussen et al., 1996). DNA replication Late gene expression initiates concurrently with D N A replication (Friesen and Mi l ler, 1986). Several genes are involved in D N A replication - dnapol,pl43, iel, lef-1, lef-2 lef-3,p35, ie2,p34 (pe38 of A c M N P V ) and lef-7, as determined by transient replication assays (Ahrens and Rohrmann, 1995a; Koo l et al., 1995; L u and Mi l ler , 1995b). The D N A polymerase of both A c M N P V and O p M N P V ( D N A P O L ) were found to be interchangeable in transient replication assays while PI43 (putative helicase) was not (Ahrens and Rohrmann, 1996). L E F - 3 , a single stranded D N A binding protein (Hang et al., 1995; Laufs et al., 1997) is required for accurate trafficking of P143 to the nucleus (Wu and Carstens, 1998). The functions of LEF-1 and L E F - 2 have not been determined, but it is known that they interact with each other (Evans et al., 1997). IE-1, IE-2 and P34 16 (PE38) are early genes that are known to be viral transcription factors (Guarino and Summers, 1988; Krappa and Knebel-Morsdorf, 1991; Theilmann and Stewart, 1991; Theilmann and Stewart, 1992a; Wu et al., 1993a). IE-1 has also been shown to bind hr (homologous region) sequences (Guarino and Dong, 1991; Guarino and Dong, 1994; Leisy et al., 1995; Nissen and Friesen, 1989), which act as origins of replication in the baculovirus genome (Ahrens et al., 1995; Leisy and Rohrmann, 1993; Pearson et al., 1993; Pearson and Rohrmann, 1995; Theilmann and Stewart, 1992a; Xie et al., 1995). P34 (PE38 of AcMNPV), IE2 and LEF-7 are stimulatory only, as is the anti-apoptotic protein P35 - their absence from the transient assay did not completely inhibit replication (Ahrens and Rohrmann, 1995b; Kool et al, 1994; Lu and Miller, 1995a). LEF-7 of AcMNPV is a transcription factor specific for late and very late genes - no trans-activation effect on early genes was observed (Morris et al., 1994). Nothing is currently known about the function of LEF-7 of OpMNPV. P35 is not present in OpMNPV, but is found in AcMNPV where the bulk of the investigations into DNA replication have been done. P35 is believed to exert its effect by preventing cell lysis due to apoptosis and is not involved directly with the replication process. IAP (inhibitor of apoptosis) of both OpMNPV and a granulosis virus of Cydia pomonella (CpGV) can substitute for P35 in the transient replication assay (Lu and Miller, 1995b) although they do not share sequence homology with P35. Almost all of the work investigating viral factors involved in DNA replication has been performed in vitro, using transient assays. Recent work has demonstrated that LEF-2 is not essential for replication in vivo (Merrington et al., 1996), suggesting that further studies using mutant viruses rather than transient replication 17 assays are required to more completely resolve the events involved in baculovirus DNA replication. Formation of the replication complex is usually the rate limiting step in DNA replication (Kornberg and Baker, 1992), and having a mechanism that allows for multiple replication complexes to form, or one that allows a single replication complex to assemble once and generate multiple copies would be the most efficient. Transient replication assays have indicated that the multiple hrs of both AcMNPV and OpMNPV behave as origins of DNA replication (Ahrens and Rohrmann, 1995a; Kool et al., 1995; Kool et al, 1993; Leisy and Rohrmann, 1993; Pearson et al, 1992). Having multiple origins would greatly increase the efficiency with which the millions of genome copies are made. Recent work has provided evidence that baculovirus DNA replication proceeds via a rolling circle mechanism (Leisy and Rohrmann, 1993; Oppenheimer and Volkman, 1997), resulting in multiple genome length concatemers. Long, concatemeric multiple genome length units with up to nine different initiation sites could, however, provide a serious complication for cleaving the concatemers accurately into the appropriate size fragments. Again, almost all investigations into the function of hrs as origins of replication have used transient assays - it remains possible that during virus replication only a single hr could be a functional origin. Multiple copies of hrs have been maintained by the virus and are known to serve as transcriptional enhancers from selected genes (discussed above). They may also serve as auxiliary origins of replication, if the 'real' one were to be damaged or lost. Deletion of hr5 from the genome of AcMNPV did not have a detectable effect on viral DNA replication (Rodems and Friesen, 1993), 18 suggesting that multiple hrs are redundant for replication, or that hr5 is not involved in replication in vivo. Deletion studies have indicated that the efficiency of an individual hr was dependent on the number of palindromes present (Pearson et al., 1992), but that the relative level of replication of different hrs was independent of the number of palindromes (Leisy and Rohrmann, 1993). A single palindrome derived from an hr of AcMNPV with flanking regions has been found to be sufficient for replication (Leisy et al., 1995). It is thought that the hr palindromes may also confer essential structural features that are important for replication and /raw-activation, possibly regulated by the binding of an IE-1 dimer when the two half-sites are. properly positioned within the palindrome, allowing activation of both replication and enhancer functions (Rasmussen et al., 1996). It has been determined in vitro that identical sequences are essential for DNA replication and enhancer function (Leisy et al., 1995). Separating these two intimately linked events in the viral infection cycle may present a significant experimental barrier to their study in vivo. Viral transcription factors All of the categories of activation domains described above are represented among the known baculoviral ^raw-activators. Within a few of these proteins, multiple DNA binding domains and activation domains are found - IE1 (acidic domain, unique oligomerization domain) (Forsythe et al, 1998; Rodems and Friesen, 1995; Slack and Blissard, 1997; Theilmann and Stewart, 1991), IE2 (small acidic region, basic region, arginine/proline rich, RING finger, leucine zipper) (Carson et al., 1991a; Theilmann and 19 Stewart, 1992a; Yoo and Guarino, 1994b) P34/PE38 (zinc finger, leucine zipper) (Krappa and Knebel-Morsdorf, 1991; Wu et al, 1993a), CG30 (zinc finger, leucine zipper, basic and acidic domains) (Thiem and Miller, 1989), and ME53 (zinc finger, proline rich domain) (Knebel-Morsdorf et al, 1993), suggesting that they affect the regulation of more than one event in the viral replication cycle. The multiple roles of a few of these genes in the baculovirus infection cycle have been studied in detail. O p M N P V IE-1/IE-0 The IE1 gene of OpMNPV codes for a predicted protein of 560 amino acids with a molecular weight of 64.7 kDa. IE1 transcripts are first detected at 0.5 hr p.i. and are present throughout the baculovirus infection. IE1 is associated with the virion particles of OpMNPV, but is not detected in virion particles of AcMNPV (Choi and Guarino, 1995b; Guarino and Summers, 1987; Theilmann and Stewart, 1991; Theilmann and Stewart, 1993). IE1 is primarily a nuclear protein, as indicated by Western blots of fractionated OpMNPV Ld652Y cells. The AcMNPV homologue of IE1 shares only 21 % amino acid identity in the N terminal region with OpMNPV IE1 but maintains the acidic profile, while the C terminal have 55% amino acid identity (Theilmann and Stewart, 1991). IE1 also has the distinction of being the only known spliced baculovirus gene. The spliced OpMNPV IE 1 has a 135 bp exon, while AcMNPV IE1 has a 189 bp exon spliced to the N-terminus. The spliced form of IE1 is called IE0 and transcripts are also detectable.at very early times in the infection. IE0 expression peaks at 4-6 hr p.i. and declines by 12 hr, but is detectable up to 48 hr p.i. in OpMNPV infections. In AcMNPV infections, IE0 expression peaks at 1-2 hr p.i. and declines to undetectable levels by 6 hr 20 p.L, reflecting the slower progress of the OpMNPV infection (Chisholm and Henner, 1988; Kovacs et al, 1991; Theilmann and Stewart, 1991). AcMNPV IEO /row-activates the IE1 promoter in transient assays, but unlike IE1, is not autoregulatory. IEO also /raw-activates the delayed early gene 39K, but in an enhancer-dependent manner only (Kovacs et al, 1991). The role of IEO in the baculovirus infection cycle is presently unknown. Both in vitro and in vivo studies have assigned multiple potential roles to IE1. It is a potent ^ ram-activator of both early and late gene promoters (Carson et al, 1988; Guarino et al, 1986; Guarino and Summers, 1986a; Guarino and Summers, 1986b; Guarino and Summers, 1988; Kovacs etal, 1991; Lu and Carstens, 1993; Nissen and Friesen, 1989; Passarelli and Miller, 1993; Ribeiro et al, 1994; Theilmann and Stewart, 1991). Reporter gene activity is increased up to 1000-fold when the promoter is linked in cis to baculovirus enhancer elements and co-transfected with IE1 (Carson et al, 1988; Guarino et al, 1986; Guarino and Summers, 1986a; Guarino and Summers, 1986b; Kovacs et al, 1991; Lu and Carstens, 1993; Nissen and Friesen, 1989; Passarelli and Miller, 1993; Ribeiro etal, 1994; Theilmann and Stewart, 1991; Theilmann and Stewart, 1992b). IE1 binds the palindrome of the enhancer as a dimer and may confer enhanced interaction or stabilization with the host transcription factors (Rodems and Friesen, 1995). IE1 is also able to down-regulate expression from at least two early gene promoters - ie2 and ieO (Carson et al, 1991b; Kovacs et al, 1992; Kovacs et al, 1991; Leisy etal, 1997). IE1 is also an essential factor for DNA replication in vitro (Ahrens and Rohrmann, 1995b; Kool et al, 1994). Electrophoretic mobility shifts have shown that 21 IE1 will bind the AcMNPV enhancer sequences (Choi and Guarino, 1995a; Leisy et al., 1995; Rodems and Friesen, 1995) and mutations at the centre of the palindrome that eliminate both replication and /raw-activation activities do not eliminate binding (Rodems and Friesen, 1995), suggesting that IE1 may recruit other factors that are required for replication and ^ram-activation, but require the correct sequence to interact (Rasmussen et al., 1996). IE1 has also been shown to induce apoptosis when transfected into Sf21 cells but not TN-368 cells (Prikhod'ko and Miller, 1996). Co-transfection of ie-1 withp35 or Cp-iap blocked the induction of apoptosis, although these inhibitors have different mechanisms of action. IE1 is not the only viral signal involved in induction of apoptosis, as viruses with temperature sensitive mutations in iel are still able to induce apoptosis at the restrictive temperature (Ribeiro et al., 1994). OpMNPV IE2 IE2 of OpMNPV is expressed as a non-spliced transcript immediately upon infection. Expression peaks at 6 hr p.i. and declines steadily, but is detectable up to 48 hr p.i. The predicted 45.6 kDa protein has several domains that may be involved in DNA binding and protein-protein interactions independently (Theilmann and Stewart, 1992a). The IE2 proteins of OpMNPV and AcMNPV share only 38% amino acid identity, but maintain a similar organization of their regulatory domains (discussed below), suggesting homologous functions within their respective virus life cycles (Carson et al., 1991a; Theilmann and Stewart, 1992a). IE2 has also been demonstrated to play multiple roles in the baculovirus infection, many of which are intimately linked with that of IEL Like 22 IE1, and another trans-regulatory protein of AcMNPV - PE38, IE2 is localized to the nucleus (Krappa et al, 1995; Yoo and Guarino, 1994b). IE2 can rrara-activate its own promoter and the promoter of IE1 and another OpMNPV /raw-activator P34, in addition to several other early genes (Carson et al, 1988; Carson et al., 1991a; Theilmann and Stewart, 1992a; Wu et al, 1993a; Wu et al, 1993b; Yoo and Guarino, 1994a). IE2 expression can also be ^ rara-activated by IE1 via an enhancer linked in cis - without the enhancer, IE1 has a negative regulatory effect on IE2 expression (Carson et al, 1991b; Theilmann and Stewart, 1992a; Theilmann and Stewart, 1992b). IE2 is also required, along with 17 other viral gene products, for late and very late gene expression (Lu and Miller, 1995b; Passarelli and Miller, 1993; Todd et al, 1996). However, since the IE2 protein is not detected after 36 hr p.i. in OpMNPV infections and 26 hr p.i. in AcMNPV infections, it remains to be demonstrated whether IE2 is involved in the regulation of very late promoters in vivo (Krappa and Knebel-Morsdorf, 1991; Krappa et al, 1995; Theilmann and Stewart, 1993). The requirement for ie2 of AcMNPV for transient expression of late genes is host specific, as it is required for late gene expression in Sf-21 cells, but not TN-368 and BmN cells (Gomi et al, 1997; Lu and Miller, 1995a). IE2 also plays a role in DNA replication, and again a host range effect is observed. Transient replication assays in SF-21 cells have indicated that ie2 is essential, while in TN368 cells, ie2 is only stimulatory. • Ie2 has also been shown to be stimulatory for in vivo assays as well, as BmNPV z'e2-deletion viruses replicated successfully in B. mori larvae, but at a reduced level (Gomi et al, 1997). These differences in host requirements in vitro suggest that IE2 may play a role in host range determination in vivo, but this remains to be investigated further. 23 IE2's multiple domains have also been shown to affect specific events in the baculovirus infection cycle. The proline rich region of A c M N P V IE2 does not appear to be required for ^ raw-activation of iel, as deletion of this domain resulted in only a slight reduction in iel ^raw-activation. Traw-activation of ie2 and 39K promoters was eliminated however, suggesting that a different mode of activation is required for these genes. Deletion of the small acidic activation region or the R I N G finger motif eliminates the ^raw-activating effect of IE2 from A c M N P V on several genes (Yoo and Guarino, 1994b). Experiments by Prikhod'ko and Mi l le r (1998) contradict this result, as mutation of a single cysteine in the R I N G finger motif did not significantly affect iel trans-activation. The deletions in these studies differed slightly, and it remains possible that only a portion of the R I N G finger motif is required for /raw-activation (Prikhod'ko and Mil ler , 1998). Leucine zippers have been proposed to be involved in protein-protein interactions (O'Shea et al., 1992) however, deletion of the leucine zipper does not affect the ^raw-activation ability of A c M N P V IE2 (Yoo and Guarino, 1994b), suggesting that multimer formation may not be required for this activity. The arrangement of these motifs in the IE2 proteins of O p M N P V is similar to that of A c M N P V , however the acidic region in the O p M N P V protein is N-terminal to the proline rich region, and on the C-terminal side of the proline rich region in A c M N P V (Theilmann and Stewart, 1992a; Yoo and Guarino, 1994b). More experiments are necessary, but it is expected that IE2 of O p M N P V wi l l play a similar role. A unique effect of A c M N P V IE2 expression is its ability to block cell cycle progression in Sf21 cells, stalling the cells in the S phase. Cellular D N A replication is not arrested, resulting in enlarged cells with greater than 4 N D N A content (Prikhod'ko 24 and Miller, 1998). Deletion mutants of IE2 transfected into SF-21 cells have indicated that a complete RING finger motif is required for this arrest, while retaining the ability to r^aw-activate iel (Prikhod'ko and Miller, 1998) - this is in contradiction to results obtained by Yoo and Guarino (1994) in Sf9 cells as described above. This suggests that one role of IE2 in the infection cycle is to provide an optimal environment for viral DNA replication, but this may not be required, as ie2 has been demonstrated to be nonessential for replication in BmNPV (Gomi et al., 1997). Despite these data on both OpMNPV and AcMNPV ie2, it is still unknown if IE2 requires specific promoter elements for /raw-activation or if it is even a DNA binding protein. An objective of this thesis, as described below, is to determine promoter elements required for IE2 activation. O p M N P V P34 P34 transcripts are detectable immediately upon infection and decline to 48 hr p.i., after which they are not detectable. A second, smaller p34-specific transcript is detected starting at 18 hr p.i., continuing throughout the infection (Wu et al., 1993a). The predicted amino acid sequence of P34 of OpMNPV and its AcMNPV homologue, PE38, share 37% amino acid identify and have multiple roles in the baculovirus infection cycle. P34 contains several motifs found in other eukaryotic transcription factors, including IE2 (Krappa and Knebel-Morsdorf, 1991; Theilmann and Stewart, 1992b; Wue/o/., 1993a). These motifs include a basic amino acid region at the N-terminus of the protein, adjacent to a RING finger motif, a small acidic region, a glutamine rich region, and a leucine zipper. P34 is a ^ raw-activating protein - P34 upregulates expression of both ie2 and 25 another early gene of OpMNPV, p8.9 (Wu et al, 1993a; Wu et al, 1993b). The presence of a leucine zipper in the primary structure of P34 suggests that it may be able to form homo- or heterodimers (Wu et al, 1993a), (D.Theilmann, unpublished). P34 is also unique in that it is expressed as both a full length 34 kDa protein and a 20 kDa N-terminally truncated protein at later times in infection. This smaller protein results from an alternate transcription initiation site (Wu et al, 1993a). The full length protein is expressed throughout the OpMNPV infection, with the smaller protein appearing at 24h and continuing through to late times post infection. It is not known if P34 also localizes to the nucleus, but the similarity of structure and function to PE38 would suggest that it does. The 20 kDa p34 late protein retains the glutamine-rich domain and leucine zipper, but is lacking the RING finger domain and basic region, and unable to r^aw-activate ie2. Its role in the infection cycle of OpMNPV is unknown, but may serve as an inhibitor of transcription by binding the P34 protein to form heterodimers, forming nonfunctional complexes (Wu et al, 1993a). The PE38 protein of AcMNPV is also expressed as both a full length 38 kDa protein and a smaller 20 kDa protein (Krappa and Knebel-Morsdorf, 1991). The 38 kDa protein is detectable only until 24 hr p.i. After that, the smaller protein alone is detected but its occurrence is unaffected by inhibition of late transcription. In contrast to P34, only a single full length pe38 transcript is detected; no alternate transcription initiation site appears to be present. Production of the 20 kDa protein from the 38 kDa protein may occur via a cleavage event, and may require additional viral early factors (Krappa et al, 1995). Like the other rraw-activators IE1 and IE2 (Yoo and Guarino, 1994b) (D. Theilmann, unpublished), transiently expressed PE38 co-localizes in the nucleus with IE2 26 in Sf9 cells, while the 20 kDa protein is detectable in the cytoplasm only (Krappa et al., 1995). Unlike IE2, PE38 is not required for late gene expression in transient assays, but does have a stimulatory effect, perhaps by ^ ram-activation of IE2 (Lu and Miller, 1995a; Passarelli and Miller, 1993). Both P34 and PE38 are also stimulatory for transient DNA replication assays (Ahrens and Rohrmann, 1995b; Kool et al., 1994), Host Range The host range of any given virus is usually limited to one or a few species, making viruses a valuable tool in pest management (Cunningham, 1988); beneficial insects such as honeybees are unaffected by Lepidopteran-specific viruses (Groner, 1986). Limitations in the host range infectivity of baculoviruses have been deemed both an advantage and a liability. Limited host range for a biological pesticide is an advantage from a safety perspective - only the pest insect is killed, but is economically disadvantageous, as several different viruses may be required to control the range of pests infecting a crop. In order to modify the host range and ensure that nontarget species will not be affected, understanding of the genetic and molecular basis of host specificity is required. Most nucleopolyhedroviruses are restricted to members of the genus or family of the original host. AcMNPV, the archetype virus for the family Baculoviridae, is an exception, with a host range of over 30 species (Groner, 1986). Infectivity in an insect host has previously been determined by the appearance of polyhedra in the tissues of the test host, but this does not allow for observation of sublethal infections or virus replication events that do not result in the production of polyhedra (Groner, 1986). 27 Cultured insect cells are used as a model system for the study of NPV infection, as they are more convenient than insect colonies and permit easier study of molecular events in infection. In addition, cultured cells often allow growth of viruses outside of the range that are infectious in vivo, making them valuable for host range studies also. Host cell lines can be categorized as permissive, semipermissive or nonpermissive for viral replication. Permissive cell lines support complete DNA and protein synthesis, leading to the production of infectious virus and lysis of the host cell. Nonpermissive cell lines survive viral challenge, some genes may be expressed if the virus enters the cell, but viral replication does not occur. Semipermissive cell lines support limited gene expression and possibly some replication (McClintock et al., 1986). Several- baculovirus genes have been found to play a role in host range determination in tissue culture, and sequence alterations in a single gene may be sufficient to affect host range. AcMNPV and BmNPV have greater than 90% homology at the DNA sequence level (Ayres et al., 1994; Gomi et al., 1997), yet their host ranges are non-overlapping (Maeda et al., 1993; Maeda et al, 1990). BmNPV replicates well in BmN cells but does not replicate in Sf9 cells, while AcMNPV grows well in Sf9 cells but not in BmN cells, although DNA replication does occur (Maeda et al., 1990) (Croizier et al., 1994). A 572 bp region of the pi 43 gene of BmNPV when recombined with the corresponding region of the AcMNPV pi 43, a putative DNA helicase (Lu and Carstens, 1991), gene enabled the resulting recombinant AcMNPV virus to replicate to high titres in BmN and Bm5 cells. Fourteen amino acids distributed throughout this region differ between the two viruses (Maeda et al, 1993). Data from Crozier et al. (1994) further narrowed the different amino acids necessary for the expansion of host range to include 28 Bm5 cells to four - at positions 551, 556, 564 and 577. No specific role for these amino acids has been identified. The pi 43 gene is known to be essential for viral replication, and is believed to have multiple functions in the infection cycle (Lu and Carstens, 1991). Kamita and Maeda (1996) also suggest that the level of recombinant PI43 (specifically, a reduction of the AcMNPV WT PI 43-induced cytotoxicity) in the infected culture may influence host specificity. Additional viral genes that have been found to alter host range in baculoviruses are hrf-1 and hcf-1. Hrf-1 is a unique gene found in the baculovirus of Lymantria dispar which replicates efficiently in Ld652Y cells in culture (Thiem et al., 1996). In contrast, when AcMNPV infects Ld652Y cells, synthesis of both viral and host proteins is shut down (Guzo et al., 1991; McClintock et al., 1986), resulting in an abortive, non-productive LdMNPV infection. If LdMNPV hrf-1 is expressed in the cultured cells, either transiently or from a recombinant AcMNPV, viral protein synthesis is not shut off and AcMNPV progeny virus are produced. OpMNPV, similar to LdMNPV, can replicate in Ld652Y and contains an hrf-1 like ORF (Ahrens et al, 1997; Thiem et al, 1996), however, the OpMNPV hrf-1 like ORF does not complement AcMNPV and allow replication (Du and Thiem, 1997). Another host range factor that exerts its effect in a different manner is hcf-1. Hcf-1 is required for transient late gene expression in TN368 cells but not SF21 cells (Lu and Miller, 1995a). Replication of AcMNPV lacking hcf-1 was also impaired in TN368 cells, but normal in SF21 cells. Infectivity of this deletion virus in T.ni depended on the route of infection - oral inoculation with ODV was identical to that of wild type AcMNPV, while injected BV was less infectious. Orally infected larvae died more slowly, 29 indicating a tissue-specific effect of HCF-1, and demonstrating the importance of HCF-1 as a virulence factor for AcMNPV in T. ni larvae (Lu and Miller, 1996; Thiem, 1997). Study Objectives Throughout evolution, baculoviruses have obtained unique genes that allow them to survive in specific environments. Many of the genes in OpMNPV have homologues in AcMNPV as described above. One of the genes of OpMNPV without a homologue in AcMNPV is opep-2, (ORF 148 of OpMNPV) - part of an OpMNPV-specific insertion found within the iel-ie2 gene region (Ahrens et al.h 1997). Prior to its discovery, most of the immediate early genes of OpMNPV (ie-1, ie-2,p34 and gp64 (Blissard and Rohrmann, 1989; Theilmann and Stewart, 1991; Theilmann and Stewart, 1992a; Wu et al, 1993a)) played essential roles in the viral replication cycle. Opep-2 has been maintained by the virus, and this strongly suggested that it also played an important role in the infection of insect cells in tissue culture or insects. In addition, initial Northern blots showed that opep-2 was expressed as multiple transcripts at early times post infection. The only other early gene known to do this was the spliced gene, ie-1. Finally, opep-2 is located in one of only two regions that share no homology with the archetype virus AcMNPV, suggesting that opep-2 may play a role in determining some of the unique biological characteristics of OpMNPV, relative to AcMNPV. For these reasons, it was of significant interest to characterize the role of opep-2 in the OpMNPV life cycle. The first two objectives of this thesis were 1) to characterize the expression and gene structure of opep-2, and 2) determine the function of opep-2 in the viral infection cycle. 30 The viral transcription factor IE2 has been shown to be a strong r^aw-activator and also augments viral DNA replication in transient assays. However, very limited research has been performed on the mechanism of IE2 r^aw-activation. Initial studies with the opep-2 promoter showed that it was strongly activated by IE2. Due to its small size, the opep-2 promoter provided an ideal model system for determining promoter requirements for IE2 /raw-activation. The third objective of this thesis was, therefore, to investigate the regulatory motifs of baculovirus early genes and the requirements of host specific factors in IE2 /raw-activation using the opep-2 promoter as a model. 31 M E T H O D S AND MATERIALS Cells and virus Lymantria dispar (Ld652Y) cells and Spodoptera frugiperda (Sf9) cells were maintained in TCI00 medium as previously described (Summers and Smith, 1987). OpMNPV and the deletion virus, vAopep-2, were propagated in Ld652Y cells as previously described (Quant-Russell et al., 1987). Virus stocks were titred using the TCID50 method, as described in Summers and Smith (1987). Plaque Assays To visualize the plaque morphology of OpMNPV deletion viruses, 1.2-1.5x106 cells were seeded in 6 cm petri dishes and infected and overlaid with 1.7% SeaPlaque agarose (FMC Bioproducts) in TCI00 as described (Summers and Smith, 1987), with 0.02% X-gal (5-bromo-4-chloro-3-indolyl-(3-D-galactoside, Life Technologies) included in the agarose overlay. When plaques were clearly visible (9-11 days post infection), dishes with agarose were overlaid with 2-3 ml formaldehyde (37% w/w) and allowed to fix for 30 minutes. The formaldehyde and agarose overlay was then removed, and 2-3 ml of crystal violet stain (5% crystal violet [w/v], 25% formaldehyde [37% w/w]) added and stained for 5 minutes. The stain was decanted off and the dishes rinsed well with distilled water and allowed to air dry. DNA Sequencing and Analysis All reagents for molecular biology were supplied by Life Technologies, unless otherwise indicated. 32 Manual DNA sequencing was carried out using Sequenase version 2.0 (Amersham) as described (Toneguzzo et al., 1988). DNA for use in automated sequencing was purified using the QIAGEN Miniprep kit. Automated sequencing of DNA was carried out using the ABI Prism Dye Terminator Cycle Sequencing Kit and ABI Prism 310 Genetic Analyzer (Perkin Elmer), following manufacturer's instructions. DNA and predicted protein sequences were analyzed and compared to the Genbank, EMBL, PIR and SWISSPROT databases using the UWGCG and DNA Strider sequence analysis packages (Devereux et al., 1984; Marck, 1988). Plasmid constructs Plasmid clones containing opep-2 were derived from a 1.9 kb Pstl restriction fragment from the cosmid Op47 (Leisy et al., 1984). A plasmid to generate run-off transcripts of opep-2 for use in in vitro translation was constructed by inserting a 1.8 kb ^4raII fragment (Figure 2b) containing the opep-2 ORF downstream of the T7 RNA polymerase promoter in pBS+ (pOp6-7Aval.8A). Opep-2 Fusion Constructs A glutathione S-transferase (GST)-opep-2 fusion protein was constructed using the expression vector pGEX-3X (Smith and Johnson, 1988). The resulting fusion protein consisted of GST fused to amino acids 11-236 of OPEP-2. The opep-2 p-galactosidase fusion construct for deletion of opep-2 from the OpMNPV genome were made by inserting the lacZ gene from the pMC1871 plasmid (Shapira et al., 1983) in frame with the opep-2 gene at the EcoRI and Seal sites. 33 CAT Reporter Constructs The chloramphenicol acetyltransferase (CAT) reporter constructs were made by inserting the CAT gene in frame into the EcoRl and Seal sites of the opep-2, yielding opep2CAT. -174 opep2CAT was made by digestion of opep2CAT with Sphl and Psp5Il, blunt ending the DNA with Mung Bean Nuclease and religating with T4 DNA ligase. To generate the set of 5' to 3' promoter deletions, opep2CAT was linearized using Xmalll or Psp5ll. BaBl was used to generate a nested series of deletions in the opep2CAT promoter region. After stopping the BaBl reaction, the unwanted 5' promoter regions were removed by digestion with Sphl. 3' and 5' overhangs were polished by T4 DNA polymerase, and the plasmid religated. Clones were screened by PCR using primers opep2A (5' CAGAAACAGCTATGACC 3') and opep2B (5' AAGG GTGAACACTATCCC 3'), and a range of promoter deletions selected. To facilitate generation of 3' to 5' deletions of the opep2CAT promoter, an Ncol site was constructed immediately 5' to the TATA box of opep2CAT by in vitro site directed mutagenesis using the QuikChange™ site-directed mutagenesis kit (Stratagene). Primers opep2Nco (5'GGCCGATAAACCAT GGTAT AAATACAACCG 3') and Nco-(5'CAGGTTGTATTTATACCATGGTT TATCGG 3') were phosphorylated with T4 polynucleotide-kinase (Pharmacia) and used to introduce the 3 base change to create the Ncol site of the plasmid Nco-TATA. The base changes introduced by mutagenesis are underlined. The 3' to 5' deletion set was generated by PCR amplification of the selected promoter regions, placing an Ncol site at the 3' end and a Hindlll site at the 5' end of the 34 Table 1. Oligonucleotide sequences of primers used for 3'-5' deletions of the opep-2CAT promoter. The -270 primer was used for the 5' end of all amplifications. The numerical names refer to the inventory number of the primer. -270 5' TGTGCAAGCTTATGCGGACTATTAGCTGC #74 5' TATACCATGGTTTATCGG #75 5' CATGCCATGGCGGCCTGCTGATAGTGGG #76 5' GGGGCCATGGCGCTGATGGCCTACGTGA #77 5' CCTACCATGGTAGCCTCACGTTTTGG #78 5* CCTACCATGGCAATCACACGTGCAAG #79 5' ATCACCATGGCAAGTGTTTATCTATAA #80 5' AAGTCCATGGCTATAACAAGCACGATAAC #81 5' AGCACCATGGCAGCGGGTATAAAAGCGG #82 5' GGGTCCATGGGCGGGACCTGTTCAAATAC #83 5' TACACCATGGGTCTTCACGGCGTCAGGC 35 amplified fragment, which was ligated into opep2CAT-Nco that had the Hindlll-Ncol promoter region removed. Primers used for amplification are listed in Table 1. Site-directed mutagenesis of the opep-2 promoter GATA and CACGTG elements Mutation of the pair of GATA (GATA-A and -B) motifs in the 3' end of the opep-2CAT promoter was by site directed mutagenesis as described above. The first, second or both GATAs (Figures 2b, 20) were mutated in the -124 opep2CAT, -76 opep2CAT and -44 opep2CAT constructs. Primer sequences are listed in Table 2. Primers #88 and #89 were used to mutagenize the single GATA of -44 opep2CAT, giving the construct -44b opep2CAT. Primers #84 and #85 were used to mutagenize the GATA-B motif of -76 and -124 opep2CAT, and primers #86 and #87 used to mutagenize the GATA-A motif of these constructs, yielding constructs -76a opep2CAT and -124a opep2CAT, and -76b opep2CAT and -124b opep2CAT, respectively. Constructs mutated in both the GATA-A and -B were made from the -76a opep2CAT and -124a opep2CAT using primers #86 and #87 - 76c opep2CAT and -124c opep2CAT, respectively. 36 Table 2. Oligonucleotide sequences of primers used for mutagenesis of GATA motifs the opep-2CAT promoter. The base changes introduced by mutagenesis are underlined. #84 5' CCATCAGCGTTCGAGCCCCACTATC #85 5' GATAGTGGGGCTCGAACGCTGATGG #86 5' CAGCAGGCCTCGAAAACTTGG #87 5' CCAAGTTTTCGAGGCCTGCTG #88 5' CAAAAGCTTGCTCGAAAACTTGG #89 5' CCAAGTTTTCGAGCAAGCTTTTG #114 5' AC AAA AGCTTGGC ATGATTGATTGGTC ACG opep2dXho 5' CTCGAGTTAACACACGGTTTTGACAAC 37 The CACGTG of the -124 opep-2CAT series of constructs was also mutagenized. Primer #114 and opep2dXho (Table 2) were used to introduce the mutated CACGTG into the opep2CAT promoter using PCR (10 pmol each primer, 20 ng parent plasmid template DNA (-124 opep2CAT, -124a opep2CAT, -124b opep-2CAT or-124c opep-2CAT), 20 mM Tris-HCl (pH 8.4), 50 mM KCI, 0.4 mM dNTPs, 1 mM MgCl 2 , 2.5 units recombinant Pfu polymerase (Stratagene)). Samples were denatured at 95°C for 2 minutes and amplified for 30 cycles (95°C for 30 seconds, 58°C for 30 seconds, 72°C for 1 minute), with a final extension at 72°C for 2 minutes using a Stratagene Robocycler. The PCR products were extracted once with CHCI3, precipitated with ethanol and digested with EcoRl and Hindlll. The 438 bp EcoRl-Hindlll fragment was gel purified and ligated into the parent plasmid that had also been cut with EcoRl and Hindlll. Positive clones were verified by sequencing. Construction of synthetic promoters Promoters containing multiple copies of the CACGTG motif were constructed from primers #98 (5' AGCTGCACGTG) and #99 (5' AGCTCACGTGC). The 13 base repeat was constructed from primers #100 (5' AGCTAGTCACGTAGGCCAT) and #101 (5' AGCTATGGCCTACGTGACT). Primer pairs were phosphorylated as described above. Equimolar quantities of primer pairs were combined and heated at 95°C for 5 minutes to denature then allowed to anneal by removing from the heating block and allowing to cool to room temperature (30 minutes) and placed on ice or frozen until 38 needed. Annealed primer pairs were inserted into Hindlll digested -44 opep2CAT and -44b opep2CAT (Figures 21, 22). The quantity and orientation of inserts was verified by automated sequencing, as described above. The CAT-1 primer (5' GTTCTTTACG ATGCCATTGGG 3') was used for sequencing of all reporter constructs containing chloramphenicol acetyl transferase. Viral trans-activator clones The source of IE1 in transient assays was the plasmid Op47Sal-IE-l (Theilmann and Stewart, 1993), designated iel for this study. The plasmid construct Nsi-p34 was used as the source of p34 in this study and has also been previously described (Wu et al., 1993a). A 2.3 kb EcoRl fragment containing the iel gene region was cloned into pBS+ (IE2-E2.3) and used as the source of ie2 in the transient assays (Theilmann and Stewart, 1992a). Opep-2 expression vectors for generation of recombinant AcMNPV Two recombinant AcMNPV viruses expressing OPEP-2 were constructed. The first, (opep-2)OPEP-2, has the opep-2 ORF expressed under control of its own promoter. The transfer vector pEVocc+ (Dickson and Friesen, 1991) was cut with Xhol, blunted with Klenow fragment and cut again with Spel. The opep-2 ORF with 270 bp of promoter was amplified by PCR using the primers opep2 Spe3' (5' TAATACTAG TTTAACACACGGTTTTCAG ) and 270Xho (10 pmol each primer, 10 ng -270 opep2CAT DNA, 10 mM KC1, 10 mM (NH 4) 2S0 4, 3.5 mM MgCl 2, 20 mM Tris-HCl pH 8.75, 0.1% Triton X-100, 100 pg/ml BSA, 2.5 units recombinant Pfu) with 30 cycles of 39 95°C for one minute, 60°C for one minute and 72°C for one minute, preceded by a 2 minute denaturing step at 95°C and followed by a 2 minute final annealing step at 72°C. This PCR fragment was gel purified, digested with Spel and ligated into the cut pEVocc+, resulting in the transfer vector p(opep-2)opep-2. pOpIEX BS- was generated by inserting a Sail fragment from pOpIElSal-BamHI which contains the iel promoter and polyadenylation signals and a BamHl cloning site into the multiple cloning site of pEVocc+ at the Spel and Sail sites in the opposite orientation to the polyhedrin gene. A multiple cloning site was inserted at the BamHl site, with Bglll at the 5' end and Smal at the 3' end. To insert the opep-2 ORF under control of the IE1 promoter, pOpIEX BS- was cut with Spel and Bglll, which removed all of the multiple cloning site and the 3' end of the IE 1 Sal insert. The opep-2 ORF was amplified by PCR using opep2 Spe3' and opep2 Bgl5' (5' GTAAAGATCTATGAAC ACCAACAAACCAC) under the conditions above, digested with Bglll and Spel and ligated into the cut pOpIEX BS-, resulting in the overexpression transfer vector p(IEl)opep-2. Clones were verified by sequencing. RNA isolation and Northern blots Total RNA from OpMNPV-infected Ld652Y cells for Northern blots and 5' transcript mapping was prepared as described (Chirgwin et al., 1979; Turpen and Griffith, 1986). Total cellular RNA for cDNA synthesis was extracted from infected cells (mock, 8 and 48 hr p.i.) with Trizol (BRL) according to manufacturer's instructions. For Northern blotting, total RNAs (5 pg per lane) were separated by electrophoresis in 1.25% agarose gels containing 6% formaldehyde, lx MOPS buffer (20 mM MOPS (3-40 [N-morpholino]-propanesulfonic acid, pH 8.0), 5 mM sodium acetate, 1 mM EDTA) (Thomas, 1983). Separated RNAs were transferred to Nytran nylon membrane (Schleicher & Schuell) by capillary blotting. Hybridization was carried out at 60°C in 50% formamide containing 6x SSC (lx is 0.15 M NaCI, 0.015 M sodium citrate, pH 7.0), lflX Denhardfs solution (lx is 0.02% polyvinylpyrolidone, 0.02% BSA, 0.02% Ficoll 400), 0.1 % SDS, 100 pg/ml denatured DNA from salmon sperm, 100 pg/ml yeast RNA. Single stranded RNA probes complementary to opep-2 mRNA were synthesized using T7 RNA polymerase. After hybridization, blots were washed twice for 15 minutes in 2x SSC, 0.1% SDS at 60°C, twice for 15 minutes in 0.1 x SSC, 0.1% SDS at 75°C and exposed to Kodak XAR film with an intensifying screen. Transcript mapping cDNA synthesis and 3' RACE First strand cDNA was synthesized from total RNA using primer XBEdT (5' CTCGAGGGATCCGAATTC(T, 7) 3') which incorporates Xbal, BamHl and £coRI sites immediately 5' to the polyT tail. Five pg total RNA and 10 pmol XBEdT in 20 pi H20 were heated to 65°C for 3 minutes to denature, then quenched on ice. To the denatured RNA-primer mix 4 pi of 5X Reverse Transcription buffer (lx is 50 mM Tris-Cl pH 8.3, 75 mM KCI, 3 mM MgCl2), 33 units RNAguard (Pharmacia), 10 mM dithiothreitol, 0.5 mM each dATP, dTTP, dCTP, dGTP), and 200 units of Superscript RNase H- reverse transcriptase (BRL) prewarmed to 37°C, and incubated at 42°C for 60 minutes. Reverse transcriptase was inactivated at 65°C for 10 minutes and 30 pi of O.lx TE (lx is 10 mM 41 Tris-HCl pH 7.4, 1 mM EDTA, pH 8.0) added - this cDNA stock was used in the amplification reaction. Second strand cDNA ends were synthesized by combining 2 pi of cDNA stock with 50 pmol of each primer XBE (5' CTCGAGGGATCCGAATTC 3') and p25-l (5'GTCATAACCACAACGGATGC 3'), in 20 mM Tris-HCl pH 8.4, 50 mM KCI, 2 mM MgCb, in a final reaction volume of 50pl. The reaction mix was heated at 94°C for 5 minutes followed by addition 2.5 units Taq DNA polymerase (BRL), annealing at 42°C for 5 minutes and extended at 72°C for 40 minutes. cDNA ends were then amplified for 40 cycles using the following conditions, 94°C for 40 seconds; 45°C for 30 seconds; 72°C for 1 minute. The final extension was at 72°C, 15 minutes. The resulting amplified products were digested with EcoRl and Hindi, gel purified and cloned into pBS+ (Stratagene). Sl Nuclease protection and Primer Extension 5' Sl nuclease protection analysis was performed as described (Theilmann and Stewart, 1991) using 10 pg of total RNA. DNAs were labeled with 3 2P-dATP and T4 polynucleotide kinase (Sambrook et al., 1989). Sl nuclease protected fragments were analyzed on denaturing sequencing gels (8% polyacrylamide, 4.6 M urea, lx TBE (100 mM Tris-borate (pH 8.3), 20 mM EDTA) using Ml3 sequencing ladders as size markers. Primer extension reactions using 10 pg total RNA were performed as previously described (Chisholm and Henner, 1988). A 17-mer oligonucleotide (5' GTCTCCACC ATTAACTG 3') complementary to the sequence of the opep-2 transcript, 149 bp 42 downstream from the start of the predicted ORF was used as a primer for the extension, and to obtain a sequencing ladder from pOpPstl.9B. Primer extension was also performed on the opep-2CAT parent clone using 40 ug total RNA. A 16-mer oligonucleotide (5'TACGATGCCATTGGGA 3') complementary to the sequence of the opep2CAT transcript, 111 bases downstream from the initiation codon of the opep2CAT ORF, was used both for the extension reaction and to obtain a sequencing ladder from the opep2CAT plasmid. Primer extension products and sequencing ladders were analyzed on 6% denaturing polyacrylamide gels as described above. Analysis of Viral DNA Replication Relative quantities of viral DNA in infected cells were measured following the protocol of Bradford et al. (1990). Cells were seeded at 4xl0 5 per well in a 24 well plate in triplicate for each time point, and allowed to adhere for 1 hour. Supernatant was removed and the virus stock added in a volume of 500 pi at the appropriate moi. After 1 hour incubation, virus stock was removed, the cells were rinsed once and overlaid with 1 ml fresh media. At appropriate times post infection, the supernatant was removed. Cells were disrupted and the RNA degraded by adding 400 pi of 0.5 M NaOH to each well and the contents transferred to an Eppendorf tube. Ten ng of pBS+ plasmid DNA was then added to each sample as an internal standard. Samples were boiled for 3 minutes, and brought to a final concentration of 1 M ammonium acetate. Each sample was brought to a volume of 500 pi with H 2 O and extracted with equal volumes of buffer-saturated phenol (Life Technologies), phenol/chloroform (1:1) and chloroform/isoamyl alcohol 43 (24:1), precipitated with ethanol and the pellet resuspended in 100 pi H 2 O . The DNA was denatured by adding 100 pi of 0.6 M NaOH to each sample and incubating at 60°C for 5 minutes. Samples were brought to 1 M ammonium acetate in a final volume of 1 ml. DNA from 2xl0 5 cell equivalents was added to each slot of a Schleicher & Schuell slot blot apparatus and bound onto nitrocellulose (Schleicher & Schuell) following manufacturer's instructions. OpMNPV genomic DNA was labelled using the RadPrime Kit to a specific activity of 4xl0 8 cpm/pg and added to the hybridization solution at a concentration of 1.3xl07 cpm/ml. Blots were hybridized overnight at 42°C in 50% formamide (containing 6x SSC (lx is 0.15 M NaCl, 0.015 M sodium citrate, pH 7.0), 10X Denhardt's solution (lx is 0.02% polyvinylpyrolidone, 0.02% BSA, 0.02% Ficoll 400), 0.1 % SDS, 100 pg/ml denatured DNA from salmon sperm) and then washed twice for 15 minutes in 2x SSC, 0.1% SDS at 60°C, and twice for 15 minutes in 0.2x SSC, 0.1% SDS at 60°C. Radiolabeled DNA hybridizing to the slots was visualized and quantified using a Storm Phosphorimager (Molecular Dynamics). As a correction for variability in the extraction procedure, the blots were allowed to decay and reprobed with 3 2 P labelled pBS+, and analyzed as described above. The lowest value from the pBS+ hybridation was assigned an arbitrary value of one, and data from the OpMNPV hybridization were adjusted relative to the internal standards. Electrophoretic mobility shift assays (EMSA) Nuclear extracts for use in EMSA Nuclear extracts from Sf9 and Ld652Y cells were prepared according to Hoopes and Rohrman (1991), with modifications according to Kogan and Blissard (1994). Sf9 and Ld652Y 44 cells grown in suspension culture as previously described were harvested at a density of 3-4 x 106/ml (Sf9) or 2xl06/ml (Ld652Y) by low speed centrifugation (1500 rpm, Beckman GS6R) at room temperature. All subsequent steps are performed on ice, using ice cold buffers. The cell pellet was gently resuspended in 4 packed cell volumes buffer A (10 mM Tris-HCl pH 7.9, 1.5mM MgCl 2 , 10 mM KCI, 0.5 mM DTT, 0.2 mM PMSF) and incubated on ice for 10 minutes. Cells were collected by centrifugation for 10 minutes at 1500 rpm at 4°C, and the resulting pellet resuspended in 2 packed-cell volumes of buffer A. Cells were lysed with 10 strokes of a Dounce homogenizer (pestle B), and the nuclei pelleted at 2500 rpm for 10 minutes at 4°C. Pelleted nuclei were resuspended in one nuclear volume of buffer C (20 mM Tris-HCl pH 7.9, 25% glycerol, 420 mM NaCI, 1.5 mM MgCl 2 , 0.2 mM EDTA, 0.5 mM DTT, 0.2 mM PMSF) and lysed with 15 strokes of the homogenizer (pestle B). Broken nuclei were stirred slowly on ice for 30 minutes and centrifuged at 25000g in an Eppendorf centrifuge at 4°C for 30 minutes. The supernatant was removed and dialyzed (Spectra/Por 10,000-14,000 MW cutoff) against buffer D (20 mM Tris-HCl pH 7.9, 25% glycerol, 1.5 mM MgCl 2 , 0.2 mM EDTA, 0.5 mM DTT, 0.2 mM PMSF) for 3 hours. The resulting dialysate was centrifuged at 25000g for 5 minutes to remove debris, and the cleared supernatant was aliquoted and quick frozen in liquid nitrogen for storage at -80°C. Protein concentration was determined using the Bradford assay (Bradford, 1976). Probes for EMSA Probe 13R was made by combining primer # 150 (5' TGATTGGTCACGTAGG CCAAAACGTGAGGCTAGTCACGTAGGCCATCAGCG) and primer # 151 (5' CG CTGATGGCCTACGTGACTAGCCTCACGTTTTGGCCTACGTGACCAATCA) in equimolar quantities and heating to 95°C for 5 minutes. The primer mixture was allowed to cool slowly to 45 room temperature for 30 minutes to allow annealing. Probe GATA was made by combining primer # 148 (5' CAGCGTTATCGCCCCACTATCAGCAGG CCGATAAAACTTG) and primer # 149 (5' CAAGTTTTATCGGCCTGCTG ATAGTGGGGCGATAACGCTG) in equimolar quantities and annealed as for probe 13R. Probe 137 was generated by PCR using primers #136 (5' ACACTTGC ACGTGTGATT) and #137 (5' CCAAGTTTTATCGGCCTG) under the following conditions: 10 pmol each primer, 10 ng -152 opep2CAT DNA, 10 mM KCI, 10 mM (NH 4) 2S0 4, 3.5 mM MgCl 2 , 20 mM Tris-HCl pH 8.75, 0.1% Triton X-100, 100 pg/ml BSA, 2.5 units recombinant Pfu, with 30 cycles of 95°C for 30 seconds, 60°C for 30 seconds and 72°C for one minute, preceded by a 1 minute denaturing step at 95°C and followed by a 2 minute final annealing step at 72°C. The PCR probe was desalted and concentrated using a centricon-10 microconcentrator (Amicon) and used in this state as an unlabelled competitor for EMSA. DNA to be 5' labelled for EMSA was further purified using the MERmaid™ kit (BiolOl) and end-labelled using 3 2P-CTP and T4 polynucleotide kinase (Life Technologies). Electrophoretic mobility shift assays EMSA was performed following the methods of Kogan and Blissard (1994). For each binding reaction, 30-60 fmol of end labelled DNA (10,000-20,000 cpm), 5 pi of 4x reaction buffer (lx is 20 mM HEPES pH 7.9, 20 mM KCI, 6 mM MgCl 2, 1 mM DTT, 12.5% glycerol), 2 ug of poly(dl-dC) (Pharmacia) and 5 pg of Sf9 or Ld652Y nuclear protein extract were combined in a final volume of 20 ul. The binding reactions were incubated for 30 minutes on ice. When included, unlabelled competitor DNAs were added at a 370-1100 fold molar excess. After, incubation, the DNA-protein complexes were loaded onto a high ionic strength 5% polyacrylamide gel (Chodosh, 1988), which 46 had been pre-run at 100V for 60 minutes. Samples were electrophoresed in high ionic strength buffer for 4-6h at 30 mA, with water cooling. Following electrophoresis, the gels were dried under vacuum and exposed to a Kodak phosphor screen. Exposed screens were analyzed using a Storm Phosphorimager (Molecular Dynamics). Transfections and CAT assays Liposomes for transfection were made according to (Campbell, 1995). Liposomes were titred for optimal liposome/DNA ratio - 2 pg DNA in total was transfected for each sample. One pg of reporter plasmid and 1 pg of trans-activator plasmid (if appropriate) were transfected for each sample, pBS+ was included in the transfection mixture as required to ensure equivalent quantities of DNA was delivered to each well. To assay for CAT activity, cells were scraped off the dishes 48 hours post transfection, pelleted, all media removed, and the cell pellet resuspended in 200 pi 250 mM Tris-HCl (pH 7.8). Cells were lysed by freezing and thawing (three cycles) and any cellular deacetylases inactivated by incubation at 65°C for 15 minutes, with a final short centrifugation to pellet cell debris. Cell extracts were titred to determine the appropriate quantity of extract to use to ensure a linear response in the assay. To assay, an appropriate volume of cell extract (1-50 ul) was combined with 6.25 mM chloramphenicol, 160 mM Tris-HCl (pH 7.8), 3.2 pM acetyl Coenzyme A (Sigma) and 0.025 pCi (125 pmol) [3H] acetyl-Coenzyme A (New England Nuclear, CAT Assay Grade) (total volume 125 pi) as described (Neumann et al., 1987). Assay rates were normalized to the parent reporter construct for each set of experiments, which was 47 assigned a value of one to allow comparison of several experiments. All transfections were repeated a minimum of 3 times, each in duplicate. Antibody Production Rabbit polyclonal antisera was raised against the GST OPEP-2 fusion protein using standard techniques (Harlow and Lane, 1988) and used for immunoprecipitation and to probe Western blots. Polyclonal antisera to ODVP-6E and monoclonal antisera to IE1 and P34 have been described previously (Theilmann et al., 1996; Theilmann and Stewart, 1993; Wu et al., 1993a). GP64-EFP monoclonal antisera AcVs, have also been described previously (Blissard and Rohrmann, 1989). Monoclonal antisera against capsid and polyhedrin proteins (Pearson et al, 1988; Quant et al, 1984) were a gift from Dr. G.F. Rohrmann. Monoclonal antisera against OPEP-3 was also used (D.A. Theilmann, manuscript in preparation). Protein Analysis SDS-PAGE and Western blot Cell samples to be assayed were harvested by scraping or centrifugation, washed once with PBS (10.1 mM Na 2HP0 4, 1.8 mM KH 2 P0 4 , 2.7 mM KC1, 136 mM NaCl, pH 7.2), resuspended in an appropriate volume of PBS and lysed with an equal volume of 2x protein sample buffer (PSB; 125 mM Tris pH 6.8, 2% SDS, 10% glycerol, 5% 2-mercaptoethanol, 0.1 % bromphenol blue (Laemmli, 1970)) and boiled for 2 minutes to completely denature the protein. Proteins were separated using denaturing gel electrophoresis (SDS-PAGE; Laemmli, 1970) and transferred to Immobilon membranes 48 (Millipore) using the Novablot apparatus (Pharmacia), following manufacturer's instructions. Western blots were incubated with appropriate dilutions of polyclonal or monoclonal antisera. Immunoreactive proteins were detected using rabbit anti-mouse or goat anti-rabbit horseradish peroxidase (HRP) linked secondary antibody (Jackson Laboratories) followed by a chemiluminescent substrate (ECL; Amersham), following manufacturer's instructions. Time course analyses of OpMNPV infected Ld652Y cells were performed as previously described, using an MOI of 10-20 (Blissard and Rohrmann, 1989). 35S labelling of total proteins Ld652Y cells were infected in suspension culture (7xl05/ml) and infected with WT OpMNPV or vAopep-2 #10 at an moi of 10 as described. One hour before the desired timepoint, 0.5 ml of cells (350,000) were removed, washed once in 500 pi methionine-free Grace's medium (Sigma), resuspended in 95 pi methionine-free Grace's and incubated at 27°C. At the desired timepoint, 4 pCi of S-L-methionine (ICN Translation grade) was added and the cells incubated at 27°C for an additional 2 hours. After 2 hours, the cells were collected by centrifugation and the pellet resuspended in 60 pi of lx PSB. SDS-PAGE analysis was performed as described above. Gels were dried and exposed to Kodak Phosphor screens and the images analyzed using the Storm Phosphorimager. 49 In vitro translation pOp6-7Aval.8A was linearized with Hindlll and run-off transcripts were synthesized with T7 RNA polymerase. Transcripts were phenol extracted, ethanol precipitated and resuspended in 10 pi H 2 0. Transcribed RNA (0.9 pi) was translated in 3.5 pi nuclease-treated Rabbit Reticulocyte Lysate (Promega), 0.1 pi methionine-free amino acid mix (1 mM total), 3.3 units RNAguard (Pharmacia), 4 pCi S-methionine (New England Nuclear - Translation Grade) (final volume 5 pi) for 2 hours at 30°C. One microlitre was removed for loading as the total translation reaction. Immunoprecipitations were performed by combining 4 pi of in vitro translated proteins with 300 pi IP buffer (250 mM NaCI, 50 mM HEPES pH 7.0, 5 mM EDTA, 1 mM PMSF, 0.5 mM dithiothreitol, and 0.1% NP-40), 5 pi Protein-G Sepharose (Pharmacia) and 0.5 pi undiluted polyclonal antisera. Samples were rocked for 1 h at 4°C, pelleted one minute, washed twice with IP buffer and resuspended in 10 pi lx protein sample buffer and separated on a 12% SDS-PAGE gel as described above. Cell fractionation Nuclear and cytoplasmic fractions of OpMNPV-infected Ld652Y were prepared as previously described (Jarvis et ai, 1991). Briefly, 2xl0 6 cells were harvested with sterile rubber policemen and pelleted in 15 ml conical tubes at 3000 rpm for 5 minutes. Cell pellets were washed once with 1 ml phosphate buffered saline (PBS; 10.1 mM Na 2HP0 4, 1.8 mM KH 2 P0 4 , 2.7 mM KCI, 136 mM NaCI, pH 7.2). Washed pellets were resuspended in 100 pi NP-40 lysis buffer (10 mM Tris-HCl pH 7.9, 10 mM NaCI, 5 mM MgCl 2, 1 mM dithiothreitol, 0.5% NP-40). Samples were chilled 5 minutes on ice and 50 nuclei pelleted at lOOOg for 5 minutes. The supernatant was removed and 100 pi 2x PSB added. The nuclear pellet was resuspended in 100 pi NP-40 lysis buffer and 100 pi 2x PSB added. DNA in each sample was sheared with a 25 gauge needle. For the total cell protein sample, 100 pi 2x PSB was added to whole cells resuspended in 100 pi NP-40 buffer, and DNA sheared with a 25 gauge needle. Purification of membranes from infected Ld652Y cells 6 8 Ld652Y cells were infected in suspension culture at 1x10 cells/ml (total 1x10 cells in 100 ml TCI00) and infected with WT OpMNPV at an moi of 10 as described. All steps were performed on ice. At 10 hr p.i., cells were collected by centrifugation, pooled and resuspended in 10 volumes of TE-sucrose (0.25 M sucrose, 50 mM Tris-HCl pH 7.4, 1 mM EDTA) and sheared with 10 strokes of a Dounce homogenizer (B pestle). The homogenate was centrifuged at lOOOxg for 10 minutes and the pellet washed again with 10 volumes of TE-sucrose and centrifuged. Supernatants from both steps were pooled and centrifuged at 105,000xg for one hour in a SW60 rotor (Beckman). The resulting pellet was resuspended in 20-30 volumes of Tris/EDTA (50 mM Tris-HCl pH 7.4, 1 mM EDTA) and centrifuged at 30,000 xg for 20 minutes. The final pellet was resuspended in 2 volumes of Tris/EDTA and protein concentration determined using the Bradford assay (Bradford, 1976). N-glycosylation Analysis of OPEP-2 2xl0 6 Ld652Y cells were seeded in 6 cm petri dishes as described above and were infected with wild type OpMNPV at an moi of 10 in the presence or absence of 10 pg/ml 51 tunicamycin (Sigma) in the media. Virus was removed after one hour and the cells washed and overlaid with 4 ml media in the presence or absence of tunicamycin, as appropriate. At various times post infection, cells were harvested by scraping the dish, washing once with PBS and resuspending the cell pellet in lx PSB at 20,000 cells/pl. Total cellular protein was analyzed by Western blot as described above. Phosphorylation Analysis of OPEP-2 Ld652Y cells were seeded at lxlO 6 cells/well in 6 well plates as described above and infected with wild type OpMNPV at an moi of 10 in TCI00. Cells were harvested by scraping the dishes at 8 hr p.i., and dephosphorylated following the protocol of Slack and Blissard (1997). Briefly, cells were washed twice with TBS (137mM NaCI, 2 mM KCI, 25 mM Tris base, pH 7.4) and the washed cells divided into two tubes. One aliquot was resuspended in phosphatase buffer (PB, 50 mM Tris base pH 8.5, 2mM Z n S 0 4 , 1 mM MgCh, ImM leupeptin, 4 mM Pefabloc SC, 1 mM pepstatin (protease inhibitors from Boehringer Mannheim), the other in phosphatase inhibitor buffer (PIB, 1 mM EDTA, 50 mM NaF, 30 mM sodium pyrophosphate, 2 mM N a V 0 3 , ImM leupeptin, 4 mM Pefabloc SC, 1 mM pepstatin) and the suspended cells lysed by 3 cycles of freeze-thaw. Fifty pi of the PB sample were transferred to a fresh tube and 5pl of 1% SDS/25 mM DTT added. The sample was heated to 95 °C for 5 minutes and cooled on ice. 5 U of calf intestinal alkaline phosphatase (CIP) was then added and the tube was incubated at 37°C for 1.5 hours. Total cell proteins were analyzed by Western blot as described above. Immediately before boiling the samples in IX PSB, 5 U of CIP was added to the sample 52 in PIB and to the control PB sample to ensure that an equal quantity of protein was loaded for each lane. Isolation and Purification of ODV and BV Budded virus (BV) was purified using the methods of Summers and Smith (1987). Occlusion-derived virus (ODV) were isolated from OpMNPV occlusion bodies (OBs) obtained from infected Orgyiapseudotsugata larvae (2 mg). OBs were resuspended in 200 pi H 2 O , and heated at 70°C for 20 minutes, and pelleted at 12000g for 5 minutes at 4°C. The pellet was resuspended in 180 pi H 2 O , 20 pi dilute alkaline saline (DAS; IM Na2C03, 50 mM NaCl), solubilized at 65°C for 5 minutes and quenched on ice for 2 minutes. DAS-insoluble material was pelleted at 12,000g for 10 minutes at 4°C and the soluble fraction removed to a fresh tube. The pellet was resuspended in 60 pi 10 mM Tris-HCl pH 7.5. An equal volume of 2x PSB was added to both the pellet and supernatant fractions. Construction of Recombinant viruses Opep-2 deletion virus The OpMNPV opep-2 deletion viruses were constructed by co-transfection of opep2(3-gal (opep-2 fusion construct) and purified OpMNPV viral DNA into Ld652Y cells by CaP04 precipitation (Summers and Smith, 1987). Cells were incubated at 27°C, and the culture supernatant harvested after visible pathological effects were evident. (3-galactosidase expressing viruses were isolated by plaque assay. Positives were confirmed through three rounds of plaque purification. Restriction digest, PCR and Western blot 53 analyses were used to confirm the deletion of the opep-2 ORF from the viral genome. Two isolates of the deletion virus, vAopep-2 #10 and #11 were used to generate BV stocks for use in subsequent studies. The PCR reactions were performed using 10 ng of viral DNA, 10 pmol each of primers opep2d (5' GAATTCTAACACACGGTT TTGACCAA) and opep2e (5' TATTGTGTTTGACACTGC) in 25 ul PCR buffer (10 mM Tris-HCl pH 8.4, 0.05% Tween-20, 0.05% NP-40, 1.5 mM MgCl2, 0.25 mM dNTPs, 3.75 units Taq DNA polymerase). The reaction was hot started at 95°C for 2 minutes, followed by 30 cycles at 95°C for 1 minute; 50°C for 1 minute; 72°C for 1 minute. The final extension was 72°C for 2 minutes. AcMNPV recombinant virus Two AcMNPV recombinant viruses expressing OPEP-2 were generated using Baculogold (strain C6) (Pharmingen). 1.5xl06 Sf9 cells were seeded in a 6 cm petri dish and allowed to adhere overnight. One hundred ng of Baculogold genomic DNA was transfected into the cells, either by itself (as a negative control) or with either of the two transfer vectors - p(opep-2)opep-2 and p(IEl)opep-2 (opep-2 expression vectors), using the liposomes as described above. Supernatants were aseptically harvested 4-5 days post infection and plaque assayed to obtain plaques positive for recombinants. Isolated plaques were picked and subjected to a second round of plaque purification to ensure a pure clone. Stocks of positives were grown, titred and assayed for OPEP-2 production by Western blot analysis of total protein from the infected cells as described above. One clone from each line was selected for generation of occlusion bodies for insect bioassays. 54 Insect bioassay Occlusion body preparation Occluded OpMNPV wild type and recombinant viruses were initially crudely purified from infected cells in tissue culture. Infected cells were pelleted and resuspended in 8 ml of 2% Triton-XlOO and incubated at 37°C for 60 minutes, after which the cell suspension was brought to 1.6% sodium deoxycholate and incubated at 37°C for another 60 minutes. The occluded virions were pelleted, washed twice with water and resuspended in water. These occlusion bodies (OBs) were fed to larvae in order to generate a stock of occluded virus from insect cadavers. Dead larvae were collected daily and stored at -20°C until required. To purify occluded virus from larvae, the frozen cadavers were thawed and crushed in 0.1% SDS to make a loose paste. This paste was strained through 2 layers of cheesecloth and washed with extra 0.1 % SDS to ensure most of the OBs were washed through. The strained suspension was centrifuged 30 minutes at 3000 rpm in a Beckman GS6R centrifuge. The supernatant was poured off and the pellet washed 3 times in lx TE (10 mM Tris-HCl pH 8.0, 1 mM EDTA) to remove most of the insect debris. The OBs were further purified on a 50-60% step sucrose gradient at 90000xg for 1 hour in an SW28 rotor (Beckman). The OB band was removed and washed with lx TE to remove sucrose, and counted twice using a Fuchs-Rosenthal hemocytometer. Orgyia leucostigma maintenance Late 2nd/early 3 r d instar larvae and diet were generously provided by Dr. Basil Arif of the Great Lakes Forestry Centre, Sault Ste. Marie, Ontario, Canada. Upon 55 receipt, insects were starved overnight and placed on virus-inoculated diet plugs the following morning. Insects were maintained at 22°C with a photoperiod of 16:8 (L:D) at ambient humidity. Trichoplusia ni maintenance Colony-raised larvae were maintained on a high wheat germ diet (Jaques, 1967; Milks, 1997) in styrofoam cups as described. Neonates were placed individually in plastic cups and allowed to feed ad lib until the desired age for inoculation had been reached - 120 hours (3rd instar) or 168 hours post hatch (5th instar). Insects were maintained at 26°C with a photoperiod of 16:8 (L:D) at ambient humidity. Oral inoculation protocol Fifth instar T. ni larvae or 3 r d instar O. leucostigma larvae were orally inoculated with the desired dose of virus by plug feeding. The larvae were individually transferred to 25 ml plastic cups containing a single 2-3mm thick, 5 mm diameter plug of diet treated with distilled water (control) or the desired dose of occlusion bodies (5 - 2000 OBs for O. leucostigma, 470 - 10000 OBs for T. ni) in a volume of 10 pi. Larvae were allowed 48 hours to finish the plug, those that failed to consume the entire plug within this time period were removed from the study. After ingesting the dose, larvae were returned to their original cup and diet. Larvae were checked daily, and time to death recorded. Diagnosis of mortality was based on observation of gross symptoms typical of nucleopolyhedrosis, namely discoloration and liquefaction (Evans and Entwistle, 1987). 56 Third instar T.ni larvae were unable to consume their plug of diet before it dried out and became inedible, so the inoculation procedure had to be modified. A 4 mm hole was cut in the bottom of a new empty 25 ml cup and the larvae placed in this cup, which was in turn placed in the original cup of diet. The OB inoculum was placed on the small circle of diet that protruded through the hole, so that the insect had to consume the circle and its entire dose of virus before proceeding to eat the uninoculated diet. Once larvae had eaten through the dose, the cup with the hole was removed and the larvae replaced in the original cup and diet. Diagnosis of mortality was as above. For all T.ni experiments, each dose was replicated 3 times within an experiment, with seven larvae per replicate. Cohorts of 15-25 larvae were used as controls, depending on availability. For experiment 1 with O. leucostigma, cohorts of 24 insects were used for each of 3 viruses (single dose of 2000 OBs) and control. For experiment 2, cohorts of 14 insects were used for each dose (6 doses) for each of 3 viruses. 30 larvae were used for controls. The equation of dosage-mortality curves and LD50 with associated 95% CIs were computed for each experiment (PROC LOGIT, (SAS, 1990)). Mortality of controls did not exceed 10% in O. leucostigma and 7% in T. ni, thus the data used in the logit analyses were not corrected for control mortality. One-way ANOVA (Kruskal-Wallis) of dose of virus x time to death was used to analyze the data. Transmission Electron Microscopy Ld652Y cells were grown in suspension culture at a density of lxlO 6 and infected at an moi of 10 as previously described. At various times post infection, 3 ml of cells and 57 media were removed (approximately 3xl06 cells). Cells were washed once with lx PC+CaCl2 buffer (0.1M Na2HP04, 9.7 mM Na citrate (pH 7.2), 1.5mM CaCl2) and resuspended in 50 pi LMP agarose in lx PC+CaCl2, stirring the pellet well to ensure even distribution of cells in the agarose drop. Once the agarose had solidified, the cells were fixed in 2.5% glutaraldehyde in lx PC+CaCl2 and stored in their fixative until required for further processing. Once all timepoints were collected and the cells fixed, the cell/agarose pellets were washed in lx PC+CaCl2, sliced into 2 mm cubes and fixed in 1% Os04 for one hour, rinsed well with water and stained with 2% uranyl acetate for one hour. The fixed samples were dehydrated in a series of ethanol washes, followed by propylene oxide, and stored overnight in a final soak of Epompropylene oxide (1:1). Samples were embedded in Epon 812 (Electron Microscopy Sciences) and allowed to polymerize at 60°C for 48 hours. Sections were stained with Reynold's Lead Citrate and examined with a Hitachi H-7000 Transmission Electron Microscope. 58 R E S U L T S Characterization of opep-2 Identification of opep-2 The opep-2 ORF was identified in the genomic region between the iel and ie2 genes (Theilmann and Stewart, 1991; Theilmann and Stewart, 1992a). Within this region, some rearrangements in gene order and orientation were found, when compared to AcMNPV (Figure 2a). The ie2 gene of OpMNPV and its homologue in AcMNPV are in opposite orientations (Carson et al., 1991b; Theilmann and Stewart, 1992a). Another early gene, p34 (pe38 in AcMNPV) (Krappa and Knebel-Morsdorf, 1991; Wu et al., 1993a), is transcribed in the same orientation in both viruses, but is downstream of the enhancer region of OpMNPV whereas pe38 is upstream of an hr enhancer region (Ayres et al., 1994; Theilmann and Stewart, 1992b). The iel gene and the downstream late gene odvp-6e and its AcMNPV homologue odv-e56, have similar arrangements in both OpMNPV and AcMNPV (Braunagel et al, 1996; Theilmann et al, 1996). P8.9 is a small early gene whose function is unknown (Wu et al, 1993b). In the centre of this region in OpMNPV are two ORFs not present in AcMNPV or BmNPV. Opep-2 is immediately upstream of p8.9 and transcribed off the opposite strand. It is unique to OpMNPV, as AcMNPV and BmNPV do not have homologous sequences in their genomes (Ayres et al, 1994; Gomi et al, 1997). The second gene, opep-3, is also unique to OpMNPV (D. A. Theilmann, manuscript in preparation). The opep-2 ORF was found to be 708 nt in length and codes for a predicted protein of 236 amino acids with a predicted molecular weight of 25.4 kDa(Figure 2b). Analysis of the predicted amino acid sequence did not identify any recognizable motifs. 59 Figure 2 (a) Comparison of the OpMNPV and AcMNPV iel-ie2 gene region. Arrows indicate the orientation and location of the ORFs. The name of the ORF is given above the arrow. IE-1, IE-2 and P34 (IE-1, IE-2 and PE38 are the corresponding homologues in AcMNPV) are transcriptional trans-activators. OPEP-2 and OPEP-3 do not have corresponding homologues in AcMNPV. HR are homologous enhancer elements of OpMNPV and AcMNPV (Cochran and Faulkner, 1983; Theilmann and Stewart, 1992b). The OpMNPV and AcMNPV maps are drawn to the same scale, (b) Nucleotide and amino acid sequence of opep-2. The consensus early transcription initiation motif, CACAGT, is overlined in bold, the transcription initiation site is indicated by a bent arrow. GATA motifs in both orientations are underlined as well as the CACGTG motif. The TATA box 5' of opep-2 ORF is boxed, polyadenylation signals (AATAAA) 3' to the ORF are also boxed, letter designations correspond to Figure 4c. The 3' transcription termination sites are indicted by asterisks above the nucleotide. Direct repeats in the promoter region are double underlined and relevant restriction sites (•) are indicated above the sequence. 6 0 OPEP-2 IE-1 ODVP-6E OPEP-3 p8.9 IE-2 HR P34 AcMNPV IE-1 ODV-E56 IE-2 PE38 A v a i l CA3GTCCCGC T T T T A T A C C C G C T G T T A T C G T G C T T G T T A T A G A T A A A C A C T T G C A C G T G T G A T T G C T C A C G T A G G C C A A A A C G T G A G G C T A G T C A C G T A G 100 3TCCAGGGCG A E 2 5 3 3 3 G G C G A C A A T A G C A C G A A C A A T A T C T A T T T G T G A A C G T G C A C A CTAAcSfflRTTSWcGGlTT T G C A C T C C G A TCKGTGCHTC ^£CATCAGCG TTATCGCCCC ACTATCAGCA GGCCGATAAA ACTrGGffSX^SSTACAACCG CAATGnTCA GAAAGCACAG TTCGACTGGT AACTCAACAT 200 CflflTAGTCGC AATAGCGGGG TGATAGTCGT CCGGCTATTT TGAACCATAT TTATGTTGGC GTTACAAAGT CTTTCGTGTC AAGCTGACCA TTGAGTTGTA EcoRI M 3AACACCAAC AAACACGTGA AGACCTACAT G^ATTCTATT GTGTTTGACA CTGCGGCTGT GCAAGCTGCG GCGGCTTTGC AGCCAATAAT GGAGACCGAG 300 CTTGTGGTTG ITrGTGCACT TCTGGATGTA CTTAAGATAA CACAAACTGT GACGCCGACA CGTTCGACGC CGCCGAAACG TCGGTTATTA CCTCTGGCTC N T N K H V K T Y M N S I V F D T A A V Q A A A A L Q P I M E T E 3CGGCGCAAA GTGCACAAGT GCCGCACAGC AGCGAGGCGG CTTTGCAGTT AATGGTGGAG ACCGAGGCGG CGCAAAGTGT TAGTGCTGCC CCGCAAGAAG 400 ; G C C G C G T T T CACGTGTTCA C G G C G T G T C G T C G C T C C G C C GAAACGTCAA T T A C C A C C T C T G G C T C C G C C GCGTTTCACA ATCACGACGG G G C G T T C T T C * A Q S A Q V P H S S E A A L Q L M V E T E A A Q S V S A A P Q E V Nael ITGCCAATGA AATATTGCAG GATGCC^GCG ACACGAGCGC ACGTGTCATA ACCACAACGG ATGCCCTGCA AGTTTTTTCC GAAGCCGTGC AAGCTATCGG 500 AACGGTTACT TTATAACGTC CTACGGCCGC TGTGCTCGCG TGCACAGTAT TGGTGTTGCC TACGGGACGT TCAAAAAAGG CTTCGGCACG TTCGATAGCC A N E I L Q D A G D T S A R V I T T T D A L Q V F S E A V Q A I G SacI I rGAAGTTATT CAAGAAACCG C^GACGGCCC ACACGCAATT ATTGAAGTAA AACGAGCCGT TTTTGATGCA ACAAAAATGC TGGCCCAACT GGGCACAGCT 600 ACTTCAATAA GTTCTTTGGC GCCTGCCGGG TGTGCGTTAA TAACTTCATT TTGCTCGGCA AAAACTACGT TGTTTTTACG ACCGGGTTGA CCCGTGTCGA E V I Q E T A D G P H A I I E V K R A V F D A T K M L A Q L G T A N a r l 3TGGTGAAAT TTTACAGCCC TCTTTTTACG SSEGCCCGAGC GCATTGTGGA ATTAGTTTAT TCAATTTCTT TGCTGGTGAG GATTATGAAA CGAATCATAA 700 ^ACCACTTTA AAATGTCGGG AGAAAAATGC CGCGGGCTCG CGTAACACCT TAATCAAATA AGTTAAAGAA ACGACCACTC CTAATACTTT GCTTAGTATT if V K F Y S P L F T A P E R I V E L V Y S I S L L V R I M K R I I K AAAACGACAG CCTGGATAAG TTGACCGTGG ATGGACTTGA CAGCGCGGCA ACATTGCTTG CCGACGTGCG CTCTATAATT GGCGACATGT TTGAAGTGTT 800 ITTTGCTGTC GGACCTATTC AACTGGCACC TACCTGAACT GTCGCGCCGT TGTAACGAAC GGCTGCACGC GAGATATTAA CCGCTGTACA AACTTCACAA N D S L D K L T V D G L D S A A T L L A D V R ' S I I G D M F E V F N a r l S a i l rGTCGTCAAC TTCAGGTATG CG3EGCCCGC CGAGTACTTT G A G G C T X C G ACGAAATGGT GCACACCGTC ACCGATTTGG CCTTGCATGT TGTCAAAACC 900 ACAGCAGTTG AAGTCCATAC GCCGCGGGCG GCTCATGAAA CTCCGACAGC TGCTTTACCA CGTGTGGCAG TGGCTAAACC GGAACGTACA ACAGTTTTGG V V N F R Y A A P A E Y F E A V D E M V H T V T D L A L H V V K T GTGTGTTAAA TAATCATTAT GTATTAATTA T A T G O T I Y H A TAAJtATTTAT ATTTTATAAA TTTATTTTGT TAATTGATAG TGCAAACGTT AATTTTATAT 1000 CACACAATTT ATTAGTAATA CATAATTAAT ATACCAAGTT ATTPTAAATA TAAAATATTT AAATAAAACA ATTAACTATC ACGTTTGCAA TTAAAATATA V C A A.TAAATTATA ATATTATATA RATAAAfGTA ATATATGTTT ATTAAATTAA TTAATAACTT GTAATTGTTG ATATGTAATG TTTATTAAAT TAATTAATAA 1100 rATTTAATAT TATAATATAT TTATTTACAT TATATACAAA TAATTTAATT AATTATTGAA CATTAACAAC TATACATTAC AAATAATTTA ATTAATTATT B C , . . . rrTGTAATTG TTGATATGTA ACATES32S3 ACAATTAAAA C A T K A T A TO V CAATTAATTT TTCTAAAAGT TTATTATATG ATCAATTGTA AATTTTAGCA 1200 3AACATTAAC AACTATACAT TGTATTATTT TGTTAATTTT GTATTATTTT GTTAATTAAA AAGATTTTCA AATAATATAC TAGTTAACAT TTAAAATCGT » D , , , TACATGTAGC TTGTATCAAT ATAATGTTGT TTATACAAAA AATATTACTT ACAACTAAfrA TAAAtTAAAA TAATAACAAT TTATATTAAT. TTAATGTATA 1300 A.TGTACATCG AACATAGTTA TATTACAACA AATATGTTTT. TTATAATGAA TGTTGA'm'l1 A'l'l'l'AATTTT ATTATTGTTA AATATAATTA AATTACATAT Ps t I kT GAAAAGTGCG GGTAAACAAA TTCTTCTTCA AACGCTTTGG CAAGCGCGGC GTCGTTGTTG A C A C G C T G C A T C 1382 TA CTTTTCACGC CCATTTGTTT A A G A A G A A G T TTGCGAAACC GTTCGCGCCG CAGCAACAAC TGTGCGACGT CG 61 In addition, no significant homologies to known proteins have been identified by comparison with protein and nucleic acid databases (Genbank; EMBL; SWISSPROT; PIR). One noticeable feature of the predicted protein sequence was the high valine and alanine content, comprising 27.4% of the total amino acids. An early gene transcription initiation motif (TATAA-N27-CAGT) was found 17 bases upstream of the initiating methionine of the opep-2 ORF (Figure 2b). This early gene motif is conserved in several baculovirus early gene promoters. Upstream of the TATA box a number of possible regulatory motifs were found, which included four GATA motifs, one CACGTG, and two 13 bp direct repeats. Six polyadenylation signal sequences (AATAAA) were found downstream of the TAA stop codon of the opep-2 ORF (Figure 2b). Transcriptional mapping and temporal expression of opep-2 Temporal expression of opep-2 was analysed by Northern blot of total RNAs extracted from OpMNPV infected Ld652Y cells at various times post infection and hybridized to a strand-specific RNA probe homologous to the entire opep-2 ORF (Figure 3a). Three opep-2 transcripts of 1.1, 0.98 and 0.88 kb were detected from 1 to 36 hr p.i. (Figure 3b) At late times (18-120 hr p.i.), two larger transcripts of 6.8 kb and 1.6 kb were detected. A smaller 616 base strand specific RNA probe (Figure 3a) was also used to probe a similar Northern blot and identical results were obtained (data not shown). The detection of three major early transcripts homologous to opep-2 at 1 hr p.i. was unusual, as the only OpMNPV early gene that is expressed as multiple transcripts immediately 62 Figure 3 (a) Schematic diagram of opep-2 gene region. The 5' SI nuclease probe and protected fragment and primer extension product are indicated below the ORF. Location of opep-2 mRNAs as determined by 5' and 3' mapping are illustrated by arrows. Complimentary RNA probes used for Northern blots are indicated by thick black lines, (b) Northern blot analysis of expression of opep-2 in OpMNPV infected Ld652Y cells. Total RNA (5 pg) from 1 to 120 hr p.i. was probed with a strand specific RNA probe homologous to the opep-2 ORF, (EcoRl 1.6 kb). Approximate sizes of three major early transcripts (1.1, 0.98 and 0.88 kb) as well as the 1.6 and 6.8 kb transcripts are indicated on the left side, size markers are given on the right side of the autoradiograph. M, mock infected cells, lane numbers correspond to hours post-infection. 63 (a) T A T A A A T A C A A C C G C A A T G T T T C A G A A A G C A C A G T P°ly* PolyA p 0 , y A _ I \ 6PEP-5 248 nt 5 S1 protected fragment 185 nt primer extension product EcoRI 1 6 Kb probe 636 nt EcoRI-Sall probe { 100 bp (b) 6.80-1.60-1.10. 0.98, 0.88 M 1 2 4 6 8 12 18 24 36 48 72 96 120 inn I - 1 35 0.24 64 upon infection is iel, which is spliced. It was therefore possible that opep-2 was spliced or there were multiple transcript initiation or termination sites. To determine which of these was correct, opep-2 transcripts were mapped by 5' and 3' SI nuclease protection analysis, primer extension and 3' RACE. 5' SI nuclease protection analysis indicated a single 248 nt protected fragment at 2, 12 and 48 hr p.i. (Figure 4a), corresponding to transcription initiation at the CACAGT motif 17 bases from the 5' end of the opep-2 ORF (Figure 2b). An additional 254 nt protected fragment was consistently detected at 48 hr p.i. Precise mapping of the 5' end of the opep-2 transcript was also determined by primer extension, using a 17 nt oligonucleotide, complementary to the sequence of the opep-2 transcript 146 bases downstream of the start methionine of the opep-2 ORF. A single extension product of 185 nt was also observed at 8 hr p.i. (Figure 4b), mapping the transcription initiation site of opep-2 to the first A of the CACAGT of the early gene motif (Figure 2b). An 185 nt extension product was detected at 48 hr, as well as several additional extension products of varying sizes. (Figure 4b). 3' SI nuclease analysis was attempted using several different probes, none of which were successful in obtaining a protected fragment (data not shown). A possible reason for this was the greater than 80% A+T content of the region downstream of the OPEP-2 ORF. Therefore, to accurately map the 3' end, 3' RACE was performed on total RNA isolated from infected cells at 8 and 48 hr p.i. Nine opep-2 specific cDNAs were isolated and sequenced. The results shown in Figure 4c indicated there were three clusters of termination sites, downstream from polyadenylation signals at 885 nt, 987 nt and 1096 nt (Figures 2c and 4c), corresponding to the sizes of the three transcripts of 887, 65 Figure 4 Transcriptional mapping of opep-2 and transfection analysis of the opep-2 promoter, (a) 5' SI nuclease protection analysis of opep-2. Total RNAs from mock (M), 2, 12 and 48 hr p.i. were hybridized with 5' labelled DNA, indicated in Fig. 3a. A single protected fragment of 248 nt is indicated on the left. Sequencing ladder for sizes is Ml3 DNA, primed with universal forward primer, (b) Primer extension product of opep-2. Total RNAs from mock (M), 8, and 48 hr p.i. were incubated with primer XW2. A single 185 nt product is indicated on the right. Size and sequence location was determined from a sequencing ladder made with the same primer. Sequence and initiation sites are schematically shown on the left, (c) Sequence of 3' RACE cDNAs. The polyadenylation signals are indicated by the letter designations A-D' which correspond to Figure 2b. 66 c ) A I) TATATAAATAAATGTAATATATGTTTATTAAATTAATTAATAACTTGTAA(An) B C II) TAACATAAIAAAACAATTAAAACATMIMAACAATTAATTTTTCTAAAAG (An) TAACATAATAAAACAATTAAAACATAATAAAACAATTAATTTTTCTAAAA(An) TAACATAATAAAACAATTAAAACATAATAAAACAATTAATTTTTC(An) TAACATAATAAAACAATTAAAACATAATAAAA(An) D III) ACAACTAAAATAAATTAAAATAATAACAA(An) ACAACTAAAATAAATTAAAATAATAA(An) ACAACTAAAATAAATTAAAATAA(An) ACAACTAAAA(An) 67 998 and 1103 nt. These transcripts correspond in size to the 3 early transcripts detected by Northern blot. Based on this transcriptional mapping data, it therefore appears that the three opep-2 transcripts arose due to the use of multiple termination signals. Temporal expression of OPEP-2 To further analyse the expression of OPEP-2, a polyclonal antiserum was generated against an OPEP-2 fusion protein. The steady state levels of OPEP-2 were then analysed from 2-120 hr p.i. by Western blot. A single 32 kDa band was detected by 2 hr p.i. and declined to barely detectable by 48 hr p.i. (Figure 5a). The steady state levels of OPEP-2 peaked at 12 hr p.i., prior to DNA replication, which starts at approximately 18 hr p.i. (Bradford et al., 1990). The 32 kDa size observed in the Western blot was unexpected since the predicted size of OPEP-2 based on the putative amino acid sequence was 25.4 kDa. This large difference between the predicted and observed size suggested that the protein may be post-translationally modified or that the aberrant migration was an inherent property of the protein. In addition, it was possible that OPEP-2 antiserum was not detecting the correct viral protein. To investigate this further, transcripts of the opep-2 ORF were translated in vitro using a rabbit reticulocyte lysate system. Three proteins -25, 29 and 32 kDa in size - were specifically immunoprecipitated by the OPEP-2 polyclonal antiserum (Figure 5b). Western blot analysis of an infected cell extract on the same gel indicated an OPEP-2 specific band migrating at the same position as the 32 kDa in vitro translated product. The smallest in vitro translation product migrated at 25 kDa, 68 Figure 5 (a) Western blot analysis of OPEP-2 in OpMNPV infected Ld652Y cells from 2 to 120 hr p.i. OPEP-2 specific proteins were identified using polyclonal antisera and detected with HRP-labelled secondary antibody and a chemiluminescent substrate; M, mock infected cells, lane numbers correspond to hours p.i. Size standards are indicated on the right, the single 32 kDa immunoreactive protein is indicated on left, (b) In vitro translation of cloned opep-2 ORF using rabbit reticulocyte lysate. Lane 1, RNA-free negative control; lane 2, unprecipitated opep-2 translation products; lane 3, opep-2 translation products immunoprecipitated with OPEP-2 specific polyclonal antisera; lane 4, immunoprecipitated by non-specific polyclonal antisera. Lane 5, translation products of luciferase RNA positive control; lane 6, as in lane 5 but immunoprecipitated with OPEP-2 polyclonal antiserum. Lanes 7 and 8, Western blot analysis of mock (lane 7) and OpMNPV infected Ld652Y cells at 8 hr p.i. (lane 8). 32 kDa migrating OPEP-2 is indicated by an arrow on the right. Size markers are indicated on the left. 69 (a) M 2 4 6 8 12 18 24 36 48 72 96 120 32 kDa _ 97 kDa — 66 _ 42 — 31 — 21 _ 14 (b) 1 2 3 4 5 6 7 8 66 kDa -43-29 I OPEP-2 21 70 Figure 6. Phosphorylation analysis of OPEP-2 in OpMNPV infected Ld652Y cells, (a) Western blot analysis of phosphorylated and dephosphorylated OPEP-2. WT PIB, infected cells in phosphatase inhibitor buffer; PB, infected cells in phosphatase buffer; PIB+CIP, infected cells dephosphorylated by CIP in phosphatase buffer; M, mock; untreated, infected cell extract. OPEP-2 specific proteins were identified using OPEP-2 polyclonal antisera. (b) The same protein samples as in (a) were run on a duplicate gel and probed with an IE1 specific monoclonal antibody. 71 (a) PIB PB +CIP M untreated 32 kDa - OPEP-2 (b) 64 kDa IE-1 72 the predicted size of OPEP-2. Rabbit reticulocyte lysate systems have been shown to have kinase activity (Joshi et al., 1995), and if OPEP-2 was a phosphoprotein, the in vitro translation product would also be phosphorylated. To investigate this, total protein from WT OpMNPV infected Ld652Y cells was dephosphorylated with calf intestinal alkaline phosphatase (Figure 6). The migration of OPEP-2 was unaffected by dephosphorylation (Figure 6a, lanes PB, PB+CIP). As a positive control, duplicate gels were probed with IE-1 specific monoclonal antisera. IE-1 is known to be phosphorylated (Choi and Guarino, 1995b; Slack and Blissard, 1997) and when dephosphorylated, the IE1 specific band shows a distinct decrease in molecular weight (Figure 6b, lanes PB, PB+CIP). Cellular localization of OPEP-2 To determine cellular localization of OPEP-2, OpMNPV infected Ld652Y cells at various times post infection were fractionated into nuclear and cytoplasmic fractions using a detergent-based protocol and analyzed by Western blotting. OPEP-2 was detected in the total cell and cytoplasmic fractions up to 48 hr p.i. (Figure 7). To determine if OPEP-2 was a structural protein, both viral phenotypes were purified and analyzed by Western blotting, using the OPEP-2 specific antisera. Figure 8a shows the results of these Western blots, no OPEP-2 specific proteins were detected. OPEP-2 was detected only in infected cell extracts (24 hr p.i. total protein). Analysis of ODV yielded similar results, as OPEP-2 was not detected in either ODV-P or ODV-S fractions (Figure 8b). To confirm the presence of virus in the ODV samples, an identical blot was probed using p39 specific polyclonal antisera, and both the soluble and insoluble fractions were 73 Figure 7 Cellular localization of OPEP-2 by Western blot analysis of total, nuclear and cytoplasmic proteins from OpMNPV.infected Ld652Y cells at 4, 8, 24, 48 and 72 hr p.i. M , mock infected cells; T, total; N , nuclear; C, cytoplasmic fractions. 74 mock 4 8 24 48 72 T N C T N C T N C T N C T N C T N 32 k D a ^ 75 Figure 8 Western blot analysis of purified BV and ODV. (a) Purified budded virus (BV) analyzed by Western blotting and probed with OPEP-2 polyclonal antiserum. M , mock infected cells; T, total protein 8 hr p.i. (b)Alkaline soluble (S) and insoluble (P) fractions of ODV were analyzed by Western blot and probed with OPEP-2 or (c) p39-capsid polyclonal antisera. 76 M T BV 42 kDa — (a) 31 — WB ^OPEP-2 77 positive for the 39 kDa capsid protein (Figure 8c). These results indicate that OPEP-2 does not appear to be associated with either BV or ODV. Analysis by the PhD protein analysis software (Rost et al., 1995) suggested that OPEP-2 may be a membrane associated protein due to the presence of potential transmembrane domains at amino acids 129-146, 149-163 and 193-208 (Figure 9a). In addition, there is a single potential N-glycosylation site (AsnrX-Ser) at Asn 1 6 9 , which could also account for the aberrant size of OPEP-2 on SDS-PAGE. To investigate the possibility of N-glycosylation, Ld652Y cells were infected with WT OpMNPV in the presence and absence of tunicamycin, a known inhibitor of N-glycosylation. No effect on the migration of OPEP-2 was observed (Figure 9b). Duplicate blots were probed with GP64 specific monoclonal antisera as a positive control. GP64 is a known baculovirus glycoprotein (Oomens et al., 1995) that is membrane associated (Monsma and Blissard, 1995). To analyze potential membrane associations, total cell protein and proteins from a membrane-enriched fraction of WT OpMNPV infected Ld652Y cells were analysed by Western blotting. Results shown in Figure 9c indicated that OPEP-2 co-purifies predominantly with the cytoplasmic fraction. This contrasts with GP64, a known baculovirus membrane protein that co-purifies with the membrane fraction. These results indicate that OPEP-2 is cytoplasmic in origin. It is not membrane associated, nor is it a structural component of either form of the virus. The aberrant migration of OPEP-2 cannot be accounted for by either phosphorylation or N-glycosylation. At this point it can be concluded that the migration of OPEP-2 as a 32 kDa protein is likely due to the amino acid composition of the protein and/or post-translational modifications other than phosphorylation or N-glycosylation. 78 Figure 9. Analysis of N-glycosylation and membrane association of OPEP-2. (a) Schematic diagram of potential transmembrane domains I, II and III (aa 129-146, 149-163 and 193-208) and N-glycosylation site (aa 169) of OPEP-2 protein as predicted by PhD protein analysis software (www.public.iastate.edu/~pedro/rt_l .html), (b) Western blot analysis of OPEP-2 and GP-64 in OpMNPV infected Ld652Y cells in the presence (+tun) and absence (-tun) of tunicamycin from 12-48 hr p.i. M, mock infected cells. OPEP-2 specific proteins were detected by an OPEP-2 specific polyclonal antisera, GP-64 specific proteins were detected by a GP-64 specific monoclonal antisera. (c) Western blot analysis of membrane and cytoplasmic fractions of OpMNPV infected Ld652Y cells. M , mock infected cells; Cell, 5 pg total cellular protein; Mem, 5 pg protein from membrane-enriched fraction. 79 (a) 129-146 169 193-208 149-163 (b) (c) tun +tun M 12 24 48 12 24 48 M m e m c e l l 32 kDa 64 kDa 58 kDa I OPEP-2 GP64 80 Deletion of opep-2 To aid in determining the function of OPEP-2 in the viral infection cycle, we constructed deletion viruses to see if absence of OPEP-2 affected viral growth. Homologous recombination in vivo replaced the majority of the opep-2 ORE with 13-galactosidase in the OpMNPV genome, resulting in the isolation of two deletion viruses, vAopep-2#10 and #11. Restriction digestion, PCR and Western blot analyses were performed to confirm deletion of the gene. Results of PCR analysis of purified viral DNAs using ORF-specific primers are shown in Figure 10a. A single, 728 bp fragment was amplified from the WT DNA, and no amplified products were detectable in either isolate of the deletion viruses, indicating that the ORF was no longer present. To further confirm that opep-2 expression had been eliminated, Western blot analysis of steady state levels of OPEP-2 and B-galactosidase in WT and vAopep-2 infected Ld652Y cells was performed (Figure 10b). OPEP-2 expression in WT OpMNPV infected cells was detected from 6 hr p.i., and was undetectable by 48 hr p.i.,. as expected. In both vAopep-2 #10 and #11, OPEP-2 was not detected. Conversely, B-galactosidase was not detected in the WT infection, but was expressed in both of the deletion viruses from 6 hr p.i., and continued to the end of the time course at 72 hr p.i. The expression pattern of B-galactosidase under control of the OPEP-2 promoter differed from that of OPEP-2 in WT infections which declines to barely detectable levels by 48 hr p.i. It is believed that B-galactosidase persisted in the infected cell due to its stability, rather than the continued production of protein. These results confirmed that the opep-2 ORF was deleted from the virus. 81 Figure 10. Analysis of OPEP-2 deletion virus, vAopep-2. (a) PCR analysis of WT and vAopep-2 viral DNA. A single, 728 bp fragment amplified from the WT DNA is indicated. M , mock; WT, WT OpMNPV; 10 and 11, vAopep-2 isolates #10 and #11. (b) Western blot analysis of total cell proteins from WT and vAopep-2 #10 and #11 infected Ld652Y cells from 6 to 72 hr p.i., probed with OPEP-2 polyclonal antisera or an anti-P galactosidase monoclonal antibody. 82 CN oo < 5 . • CN CO CN oo CN CNI QL LU D. O n 3 2 Q. CO CM 83 Protein expression The successful isolation of vAopep-2 #10 and #11 indicated that OPEP-2 was not essential for growth of OpMNPV in cell culture. To determine if its absence affected aspects of OpMNPV infection, time course analyses of WT and vAopep-2 #10 and #11 were performed and steady state levels of selected proteins were analysed by Western blotting. Figure 11a shows expression of four early genes, GP64-EFP, IE1, P34 and OPEP-3 in WT and vAopep-2 infected Ld652Y cells. GP64-EFP, a structural protein of BV was first detected faintly at 6 hr p.i. and continued to be expressed through to 72 hr p.i. in both WT and deletion viruses. A GP64-EFP 25 kDa specific band is also detected at 48 hr p.i. in both WT and vAopep-2 infected cells. Similarly no consistent changes in the expression of the viral trans-activators IE1 and P34, were detected in WT and vAopep-2 #10 and #11 infected cells. Opep-3 is another unique OpMNPV gene, adjacent to opep-2 in the iel-ie2 region of the OpMNPV genome (D. A. Theilmann, manuscript in preparation). OPEP-3 expression started at 6 hr p.i. and continued through to the end of the time course (72 hr). Expression of this gene was also unaffected by deletion of the opep-2 ORF. Figure 1 lb shows steady state levels of three late genes, capsid, ODVP-6E and polyhedrin in WT and vAopep-2 infected Ld652Y cells. Capsid protein was first detected at 48 hr p.i. in all three infections. ODVP-6E was detected weakly by 48 hr p.i. (indicated by arrowhead), and was more prominent at 72 hr p.i. Polyhedrin was detected weakly at 24 hr p.i. and continued to increase up to 72 hr p.i. No differences were observed in the expression of these proteins in either the WT or vAopep-2 isolates #10 and #11. 84 Figure 11 Western blot analyses of steady state levels of selected early (a) and late (b) proteins in wt and vAopep-2#10 and #11 infected Ld652Y cells from 6 to 72 hr p.i. The early proteins analyzed were GP64-EFP, IE1, P34 and OPEP-3. Late proteins were capsid, ODVP-6E and polyhedrin. The ODVP-6E specific bands are indicated by the arrowhead. The numbers above each line indicates hr p.i., M is mock infected total cell protein. The protein analyzed is indicated on top and the virus on the left. 85 (a) GP64 (EFP) M 6 12 18 24 48 72 IE1 P34 M 6 12 18 24 48 72 M 6 12 18 24 48 72 OPEP-3 M 6 12 18 24 48 72 WT Aopep-2 #10 Aopep-2 #11 (b) CAPSID M 6 12 18 24 48 72 ODVP-6E M 6 12 18 24 48 72 POLYHEDRIN M 6 12 18 24 48 72 WT Aopep-2 #10 .a Aopep-2 #11 86 The above mentioned seven proteins are a small fraction of the putative 150 genes of OpMNPV (Ahrens et al, 1997). It is possible that the deletion of opep-2, while not appearing to have a significant effect on the genes analyzed, does affect expression of other proteins produced by OpMNPV or the infected cell. Figure 12 shows an S-methionine pulse-labelled time course of total proteins expressed in WT OpMNPV and vAopep-2 infected Ld652Y cells from 2-72 hr p.i. The overall pattern of expression is very similar for both viruses at the early times in the infection, with the number of proteins being produced decreasing after 24 hours, with a further drop in proteins present after 48 hours. This decrease in total protein synthesis suggests a shut down of host protein synthesis at late times in OpMNPV infected Ld652Y cells. Shut off of host cell protein synthesis has been previously observed in AcMNPV infected Ld652Y cells as early as 20 hr p.i. (McClintock et al., 1986). This faster shut off may be reflective of OpMNPV producing a slower infection than AcMNPV in its normal host cell line (Bradford et al., 1990), or due to an extremely attenuated AcMNPV infection in Ld652Y cells, which are only semipermissive for AcMNPV infection (Guzo et al., 1991; McClintock et al, 1986). Differences in WT and deletion virus expression levels of some proteins are observed starting at 48 hr p.i. Proteins of 12, 28, 30 and 53 kDa (Figure 12a) all show increased levels in the vAopep-2 infected cells relative to WT. The 20 and 34 kDa, and other proteins produced at late times do not show any significant differences in their relative levels, suggesting their expression is unaffected by deletion of opep-2, and that differences in moi or number of cells harvested is not the cause for the different intensities of specific bands. 87 Figure 12. Time course analysis of total cell protein from OpMNPV and vAopep-2 infected Ld652Y cells, pulse labelled with 35S-methionine. Molecular weight standards are shown on the right, estimated sizes of proteins that have elevated levels in deletion virus infected cells are indicated on the left. M, mock; WT, OpMNPV infected cells; A, vAopep-2 infected cells. Hours post infection indicated in top row. (a) Total labelled proteins from 2x105 cells, harvested from 2-72 hr p.i., separated by 10% SDS-PAGE. (b) Total labelled proteins from 2xl0 5 cells harvested from 12-144 hr p.i., separated by 12% SDS-PAGE. 88 89 Figure 12b is a second labelled time course from 12-144 hr p.i. An OPEP-2 specific band is not detected in the background of cellular proteins. As in Figure 12a, specific proteins are overexpressed by the vAopep-2 infected cells, relative to WT and in addition, significant protein synthesis continues up to 120 hr p.i. compared to WT, which is almost undetectable at 120 hr p.i. This suggests that WT cells are dying more rapidly. The 12 kDa protein is also detected out to 72 hours, but no difference in relative levels is apparent. After 96 hours, only the 30 kDa protein is detectable. Significant cell death is occurring at this time and very little viral protein is being made. Western blot data (Figure 5a) indicates that the level of OPEP-2 is greatly decreased by 48 hours and undetectable by 72 hours, yet this is the time when the effects of opep-2 deletion are observed. DNA replication The timing of DNA replication was also investigated to observe the possible effects of opep-2 deletion. Total DNA from Ld652Y cells infected with WT OpMNPV 32 and vAopep-2 at three different moi were bound to nitrocellulose and probed with P-labelled WT OpMNPV DNA. An increase in the quantity of viral DNA is observed between 18 and 24 hours for all viruses and moi's (Figure 13), except WT virus at an moi of 100, where the increase in viral DNA levels is observed earlier, between 12 and 18 hours. This increase in the quantity of viral specific DNA has been correlated with the onset of viral DNA replication in the literature (Bradford et al., 1990). Differences between replicates up to 30 hours are small, while at later times the variation between samples is large for all moi, suggesting that retention of viral DNA within the cell is 90 highly variable at later times, likely due to cell lysis and budding of virus. No consistent, significant differences overall are observed between the WT and vAopep-2 viruses, except at very high moi, where the WT may initiate replication of DNA slightly earlier and replicate to higher levels, although there is considerable variability at very late times. This variability at high moi has been observed previously in temporal production of OpMNPV budded virus (Bradford et al, 1990). Virus production Temporal expression of selected proteins known to be associated with either form of the virus were unaffected by deletion of opep-2 (Figure 11). To investigate the effect of opep-2 deletion on temporal production of budded virus, culture supernatant at various times post infection was removed and the level of BV present was measured by determining the TCID50 of the sample (Figure 14). The onset of BV production is slow between 24 and 30 hours, and increases sharply from 30-36 hours. Peak levels in the supernatant occur after 48 hours post infection. No differences in BV production were observed, indicating that deletion of opep-2 does not affect BV production in tissue cultures. Several stocks of both WT and deletion viruses were generated for use in experiments. Table 3 shows the final titres obtained from two separate stocks of WT and vAopep-2 #10 and #11 made for use in experiments. Ld652Y cells were infected at an moi of 0.2 and harvested 96-120 hr post infection. No significant differences between the titres of the stocks were observed. 91 Figure 13. Time course of accumulation of viral DNA in OpMNPV (white box) and vAopep-2 (black box) infected Ld652Y cells, infected at moi 5, 10 or 100. Relative 32 quantities of DNA at various times post infection was determined by hybridization of P-labelled viral genome specific DNA probes to slot blots of DNA samples from equivalent numbers of infected cells infected at various moi. Signal levels were determined using the Storm Phosphorimaging system (Molecular Dynamics) and corrected for variability in the extraction protocol using an internal standard. One standard error is indicated. 92 WT OpMNPV v opep-2 OpMNPV £ Q. O > ro CC MOI = 100 Hours post infection 93 Table 3. Final litres of WT and both vAopep-2 virus stocks produced independently Ld652Y cells in tissue culture. Cells were infected initially at an moi of 0.2. Virus Stock I Stock II-WT OpMNPV 2.51xl08 4.88x 101 vAopep-2#10 2.51xl08 2.64x 10s vAopep-2#ll 1.26xl08 3.53x 101 94 Figure 14. Time course of budded virus titres produced from OpMNPV and vAopep-2 infected Ld652Y cells. Cells were infected at an moi of 20, and culture supernatant sampled at various times post infection. WT, white square; vAopep-2 #10, black diamond; vAopep-2 #11, white circle. One standard error is indicated. 95 96 Plaque morphology To investigate the effects that deletion of opep-2 had on virus growth and its spread in tissue culture, plaque assays of both WT and vAopep-2 OpMNPV were performed. Differences in plaque morphology between WT and vAopep-2 OpMNPV were visualized by fixing with formaldehyde and staining the fixed cells with crystal violet, which stains only unlysed cells. The results of two independent experiments are shown in Figure 15. Both experiments demonstrated a consistent difference in plaque morphology. Plaques from the WT infected monolayer have a small clear centre with a halo comprising most of the plaque (Figure 15a,c). Plaques from the deletion virus (Figure 15b,d) are smaller overall, with a more defined centre, and lack the halo area. A control with an alternate P-galactosidase expressing virus did produce similar plaques to the WT (data not shown), indicating that P-galactosidase was not responsible for the alteration in plaque morphology. Transmission Electron Microscopy Deletion of opep-2 resulted in an observable plaque phenotype (Figure 15). Monitoring the progress of the virus infection by transmission electron microscopy was done to investigate the possibility of differences in cell pathology that could account for the change in plaque morphology. Ld652Y cells infected with WT, vAopep-2 #10 and #11 OpMNPV were fixed at various times post infection and examined by transmission electron microscopy. Selected photographs are shown (Figure 16). Mock infected cells harvested at 168 hours post infection were comparable to those harvested at 6 hours post infection. Seven days in suspension culture did not seem to affect the appearance of the 9 7 Figure 15 Comparison of OpMNPV and vAopep-2 plaques in an Ld652Y cell monolayer. Monolayers are fixed in formaldehyde at 11 days post infection and stained with crystal violet. Plaques from two independent experiments are shown. Experiment 1 (a) WT OpMNPV and (b) vAopep-2 OpMNPV plaques, bar is 1 cm. Experiment 2 (c) WT OpMNPV and (d) vAopep-2 OpMNPV plaques, bar is 2 mm. 98 99 Figure 16 Electron micrograph time course analysis of OpMNPV and vAopep-2 #10 and #11 infected Ld652Y cells. Cells were harvested at 6, 12,18, 24, 48, 72 and 168 hours post infection. Bar is 5 pm. i 6 h.p. i . 1 68 h.o. i . Mock 100 to I 1 8 h.p.i 24 h.p. i . 48 h.p . i . 72 h.p . i . / 0 3 1 68 h . p . i cells. Virogenic stroma and enlarged nuclei are first visible in all three infections at 18 hours. No significant differences between infections are observed until 168 hours post infection. At this time, in the WT sections, any cells that could be found were fractured, while mainly intact cells were found in the deletion virus sections (Figure 16). A minimum of 10 sections per time point per infection were examined. This suggests that the opep-2 deletion virus infected cells are lysing at a significantly later time in the infection cycle. Insect bioassay It has been shown that opep-2 was not essential for viral infection and growth in tissue culture. Tissue culture, however, is a somewhat artificial situation, when compared to the natural infection of the WT virus in lepidopteran hosts. OpMNPV grows well in Lymantria dispar cells in tissue culture, which is not its natural host in the wild. To investigate the infectivity of the deletion virus compared to the WT virus, colony-raised Orgyia leucostigma larvae, a natural host of OpMNPV, were orally inoculated with varying doses of both WT and vAopep-2 OpMNPV. Larvae were received from the Great Lakes Forestry Centre at the late second/early third instar, and starved overnight to ensure they would ingest the entire dose. Experiment 1 investigated time to death only, with a fixed dose of 2000 OBs for all three viruses. The modal time to death for the WT virus was 168-192 hours, while for the two deletion viruses #10 and #11 modal time to death was 192-216 and 216-240 hours, respectively, suggesting possibly a slight difference in time to death at a high dose of virus (Figure 17a). Experiment 2 covered a range of doses, from 5 to 2000 OBs, enabling both time to death and LD50 to be investigated. The percentage of survival per dose generally decreased with an increase in 105 dose for all three viruses, however there was no difference in the LD50 (Table 4). The confidence interval of the LD50 of the WT virus was quite large, but overlapped almost completely with both of the deletion viruses. The 5 OB dose had 40% fewer survivors than the 20 OB dose for this virus, which is contrary to what would be expected, and may account for the unusually large 95% confidence interval. One way ANOVA was used to investigate the effect of does of virus on time to death. The x values of the three viruses were less than 10.4 with 5 degrees of freedom, and all probabilities were greater than 0.06, indicating that the dose received had no significant effect on time to death. Therefore, the different doses were combined and the pooled data were used to determine the modal time to death. When this was done, the modal time to death was the same for all three viruses, 120-14 hours post infection (Figure 17b). The difference in modal time to death between the two experiments may be due to the general health of the insects (two separate shipments two months apart) or to a slight difference in the age of the larvae. The data obtained from these experiments indicates that opep-2 is not essential for successful infection and suggests that deletion of opep-2 does not influence time to death or LD50 of the WT and vAopep-2 OpMNPV for O. leucostigma. Since deletion of opep-2 from the OpMNPV genome did not affect viral pathogenicity, I proceeded to examine the effect of aberrant expression of opep-2. Opep-2 is expressed at early times in infection and is not found in AcMNPV. To observe the effects of a gain-of-function mutant of AcMNPV, two recombinant AcMNPV viruses were constructed. V(opep-2)opep-2 expressed OPEP-2 under regulation of its own promoter, but outside the context of the OpMNPV genome, and v(IEl)opep-2 (Figure 18) which expresses OPEP-2 under control of the OpMNPV IE1 promoter, a strong early 106 Table 4. Number of larvae and percentage of survival of O. leucostigma in relation to virus dose, L D 5 0 and 95% CI, and slope of dosage-mortality curves for Logit model. Oral inoculation at 3 r d instar. Percentage of survival per OpMNPV dose (OBs) 95% 0 Confidence Virus n a (control) 5 20 50 100 1000 2000 LDsn interval Slope (SE) Intercept(SE) Experiment 2 WT 112 90 50 85 71 57 35 25 195 30-12817 0.649 (0.57) -1.48 (0.65) vAopep-2 # 10 111 90 78 57 71 57 16 0 73 30-189 1.45 (0.35) -2.71 (1.45) vAopep-2 # 11 110 90 85 69 64 64 35 16 172 58-761 1.06 (0.39) -2.38 (1.06) Total number of larvae, including controls, that consumed the plug within 36h 107 Figure 17. Effect of wild type and vAopep-2 #10 and #11 OpMNPV on modal time to death in 3 r d instar Orgyia leucostigma. Within a given virus, the doses were pooled because time to mortality was independent of dosage (see text). 108 Experiment 1 OD CM CC O CO CM CO o CO r H •sr CO CX) r H CO UO CM i H r H r H CM CM CM CM co CO CM C l I r H 1 1 © 1 GO 1 CM 1 CD 1 O 1 i 00 1 CM r» CM >X) «r C£> CT, r H CD 00 r H V r~ <H i—) H r H CM CM CM CM co • WT OpMNPV 0 #10 OpMNPV • #11 OpMNPV Experiment 2 t>> 4 0 1 • WT OpMNPV 0 #10 OpMNPV • #11 OpMNPV Hours p.i. 109 promoter that is expressed immediately upon infection and continuing throughout (Theilmann and Stewart, 1991), unlike opep-2 which is turned off at late times post infection. The OpMNPV IE1 promoter has previously been demonstrated to be active in Sf9 cells (Theilmann and Stewart, 1991). WT AcMNPV (C6 strain) was used as a positive control for these experiments. In experiment 1, there was no difference in the L D 5 0 of WT C6, v(opep-2)opep-2, and (IEl)opep-2 AcMNPV (Table 5). In experiment 2, there was no difference in the LD5o for the two OPEP-2 expressing viruses, but there did appear to be a significant difference compared to the WT AcMNPV (Table 5). However, PROC PROBIT was unable to calculate an LD5o and associated 95% CI for the WT virus, presumably because only two of the doses had survivors, and few at that (9% for the 940 OB dose and 5% for the 3750 OB dose; Table 5). Resistance to virus infection has been demonstrated to increase with the age of the larvae (Engelhard and Volkman, 1995; Teakle et al, 1986). To investigate the possible effect of larval age, the feeding experiments were repeated with 3 r d instar T.ni (Table 6). In experiment 1, there was no significant difference in LD50 for either of the OPEP-2 expressing viruses, but there did appear to be a significant difference from the WT AcMNPV. The LD50 of the WT virus is 4-7 fold less than that of the OPEP-2 expressing viruses. In experiment 2 (Table 6), the LD50S suggest that there may be a difference between the three viruses, but the confidence intervals of both OPEP-2 expressing viruses overlapped with that of the WT virus. Data from these four experiments in T. ni larvae indicate that there is not likely to be a difference in LD50 for theWT and OPEP-2 expressing AcMNPV in both 3 r d and 5 t h instars. There is a slight difference in the 3 r d instar LD50S, but it was not signfiicant. 110 Figure 18 Schematic diagram of constructs used to make AcMNPV recombinant virus expressing OPEP-2. (a) p(IEl)opep-2 insert placing opep-2 ORF under control of OpMNPV IE1 in the polyhedrin locus of AcMNPV. (b) p(opep-2)opep-2 insert placing opep-2 ORF under control of its own promoter in the polyhedrin locus of AcMNPV. i l l p(IE1)opep-2 polyhedrin 7.1 mu polyA 3.2 m u p(opep-2)opep-2 polyhedrin polyA 7.1 mu 3.2 m u 112 The effect of opep-2 on the time it takes AcMNPV to kill T. ni was also investigated. In all, 12 Kruskal-Wallis ANOVAs were conducted. (5th and 3 r d instars, 3 virus doses/ instar and 2 experiments/instars = 12 analyses). In 8 of these ANOVAs, the X values were less than 5.4 with 4 degrees of freedom and all probabilities were greater than 0.15, indicating that there was not a relationship between dose and time to death. The 4 ANOVAs that were significant were: 3 r d instar, experiment I WT x2=26.07, P=0.0 df=4 (Figure 19a); 3 r d instar experiment II WT x2=25.54, P=0.0 df=4 (Figure 19a); 5 t h instar experiment II (opep-2)opep-2 x2=18.62, P=0.00 df=4 (Figure 19f); 5 t h instar experiment II WT x =14.19, P=0.00 df=4 (Figure 19d). The effect of doses, however, was not consistent and there was no trend of increasing or decreasing time to death with increasing or decreasing dose. Hence, the doses were combined and the pooled data were used to calculate the modal time to mortality of each virus. Based on this analysis, there was no difference in the modal time to death between the three viruses when T. ni were infected at either 3 r d or 5 t h instar. Modal time to death for 3 r d instar was 108-120 hours post infection for all viruses except v(opep-2)opep-2, experiment 2 which had a mode of 132-144 hours post infection. Modal time to death for 5 t h instar was 132-156 hours post infection for all viruses except v(IEl)opep-2, experiment 2 which had a mode of 108-120 hours post infection, and v(opep-2)opep-2, experiment 2 which had a mode of 156-168 hours post infection. 113 Table 5 Number of larvae and percentage of survival of T. ni in relation to dose, LD50 and 95% CI, and slope of dosage-mortality curves for Logit model. Oral inoculation at 5th instar Percentage of survival per AcMNPV dose (OBs") 95% 0 • Confidence Virus n a (control) 470 940 1880 3750 7000 10000 LD, n interval Slope (SE) Intercept (SE) Experiment 1 WT 119 95 83 66 46 8 - c 1315 946-1824 3.6(0.8) -11.2 (2.5) (opep-2)opep-2 119 95 50 66 21 8 1638 1018-22873.3 (0.8) -10.6 (2.6) (IEl)opep-2 119 95 50 42 12 - 0 1242 681-1784 3.4(0.9) -10.7(2.9) Experiment 2 WT 120 93 9 0 5 0 0 153 ~ b 3.05 (2.06) -6.67 (6.59) (opep-2)opep-2 119 93 57 38 49 5 9 1378 621-2075 2.67(0.675) -8.38 (2.30) (IEl)opep-2 119 93 71 9 19 0 19 1110 520-1624 3.25 (0.80) -9.91 (2.66) a Total number of larvae, including controls, that consumed the plug within 36h b 95% CI could not be estimated by SAS Institute (1990). c Dose not administered for this experimental group. 114 Table 6 Number of larvae and percentage of survival of T. ni in relation to dose, LD50 and 95% CI, and slope of dosage-mortality curves for Logit model. Oral inoculation at 3rd instar. Percentage of survival per AcMNPV dose (OBs) 95% 0 Confidence Virus n a (control) 940 1880 3750 7000 10000 interval Slope (SE) Intercept (SE) Experiment 1 WT 116 95 33 28 14 9 0 552 15-1125 1.27 (0.45) 76.10(2.73) (opep-2)opep-2 116 95 81 57 28 28 25 2589 1548-3952 2.56 (0.66) -8.75 (2.31) (IEl)opep-2 116 95 95 43 38 43 25 3983 2759-6175 2.99 (0.71) -10.79 (0.71) Experiment 2 WT 120 100 19 14 0 0 0 500 13-860 4.42(1.76) -11.95 (5.52) (opep-2)opep-2 119 100 71 47 14 52. 10 1910 698-3141 1.93 (0.58) -6.34 (2.05) (IEl)opep-2 120 100 43 24 4 0 0 886 440-1221 4.76(1.27) -14.05 (4.04) Total number of larvae, including controls, that consumed the plug within 36h 115 Figure 19. Effect of wild type and recombinant AcMNPV on modal time to death in 3r and 5 t h instar Trichoplusia ni. Percentage of total mortality was determined at 12 hour intervals. Experiment 1 data is the solid bars, experiment 2 is the hatched bars. % values from 8 of 12 experiments were less than 5.35 and had probabilities (in brackets) greater than 0.148, with 4 degrees of freedom, values for the remaining 4 experiments were greater than 14.194 with probabilities less than 0.007 and 4 degrees of freedom. Upon examination of the individual experiments, the data were inconsistent, therefore, all doses were pooled for total mortality over time, as no significant dosage effect overall was observed (see text for details). 116 3rd Instar 5th instar wild type A c M N P V (IE1)opep-2 A c M N P V (opep-2)opep-2 A c M N P V O C M M " C Q 0 3 O C \ ! ^ r • ° 0?, r H 1 ' I 1 I ' ' ' r - ' s r v o ' o c N r o ^ i n c o o o c r i V CO CTi O C \ J ^ r U 3 0 D O c \ l ' = 3 1 C 0 ( M ( Y ) ^ l i " ) ^ ) C D 0 ) O T O O O l M ' S P l X J O O O O J Hours p.i. Hours p.i. 117 Opep-2 promoter analysis The very early expression of opep-2 transcripts and initiation from an early gene motif (Figure 4b) suggested that the promoter would be functional in uninfected cells and not require viral factors for expression. Information concerning baculovirus early gene regulation is very limited, although some motifs known to play a role in promoter activity have been identified in other early promoters - ie-1, ie-2 and gp64 of OpMNPV, and ie-1, ie-2,p35, 39K of AcMNPV are a few of these (Dickson and Friesen, 1991; Friesen and Miller, 1987; Guarino and Smith, 1990; Guarino and Summers, 1987; Kogan and Blissard, 1994; Kogan et al., 1995; Theilmann and Stewart, 1991; Theilmann and Stewart, 1992a). Figure 20 shows the sequence of the opep-2 promoter, which contains four GATA elements (GATA-A to -D) and a single CACGTG element. Both of these motifs have been previously shown to bind cellular factors and regulate early expression (Kogan et al, 1995; Krappa et al., 1992). In addition, there is a 13 bp sequence that is repeated (13R-A and 13R-B). This sequence has not previously been shown to regulate baculovirus gene expression. We performed deletion and mutation analysis to determine which of these elements are involved in opep-2 expression, and in addition to identify which elements are required for activation by the viral ^raw-activator IE2. For the initial investigations into the activity of the opep-2 promoter, two reporter constructs (-174 opep2CAT and -270 opep2CAT) were made that contained 174 or 270 bp of sequence upstream of the opep-2 transcriptional start site (Figure 20). Initial experiments were performed to determine which, if any, known early gene /raw-activators activated opep-2 expression. OpMNPV contains three regulatory proteins that are known 118 Figure 20. Nucleotide sequence of opep-2 promoter. The consensus early transcription initiation motif, CACAGT, is overlined in bold, the transcription initiation sites of opep-2 (-1) and opep-3 (-189) are indicated by a bent arrow. GATA motifs in both orientations are underlined and labelled A-D (-42, -69, -135, -153). The CACGTG is also underlined (-123). The 13 base direct repeats in the promoter region are double underlined and labelled 13R-A (-86) and 13R-B (-111). The TATA boxes 5' to opep-2 and opep-3 ORFs are boxed (-30, -161). The 5' most base of the 5'-3' promoter deletions are indicated (•). 119 -270 •w AATGC GACTATTAGC TGCGTGCCAA TGCTTGTTGC AGGACTCTG CGTGCTGATG CTTGTTGCCT GACGCCGTGA AGACTGTGCA TGTATTTGAA TTACG CTGATAATCG ACGCACGGTT ACGAACAACG TCCTGAGAC GCACGACTAC GAACAACGGA CTGCGGCACT TCTGACACGT ACATAAACTT -174 -152 -124 -103 CAGGTCCCGC TTTTATACCC GCTGTTATCG TGCTTGTTAT A£AI£AACAC TTGCACGTGT G A T T r - n T r a r - r . T t m r a t a ACGTGAGC-CT AC-TCACGTAG GTccAGGGCG ^HAIKSGGG CGACAATAGC ACGAACAATA TCTATTTGTG AACGTGCACA CTAACCAGTG CATCCGGTTT TGCACTCCGA TCAGTGCATC GATA-D G A T A - C C A C G T G 13R-B 13R-A -76 -44 ^ _ _ _ T C A G C G T T A T C G C C C C A C T A T C A G C A G G C C G A T A A A A C T T G G 5 A I I J 3 T A C A A C C G C A A T G T T T C A G A A A G C A C A G T T C G A C T G G T A A C T C A A C A T C G G T A G T C G C A A T A G C G G G G T G A T A G T C G T C C G G C T A T T T T G A A C C A T A T T T A T G T T G G C G T T A C A A A G T C T T T C G T G T C . A A G C T G A C C A T T G A G T T G T A G A T A - B G A T A - A M 120 to /raw-activate early gene promoters - IE-1, IE-2 and P34. -270 opep2CAT and -174 opep-2CAT were transfected alone or in the presence of the three /'raw-activators individually or in combination. In Ld652Y cells, all trans-activators activated the -270 opep2CAT construct (Figure 21). IE2 was the most effective ^raw-activator, and its effect was slightly reduced by co-transfection with IEL P34 gave a 5-fold increase in -270 opep2CAT activity, and no significant additive effect was observed upon co-transfection with IE1 or IE2. All three /'raw-activators together gave slightly reduced activity compared to IE2 or P34 alone. In Sf9 cells, only IE2 and P34 by themselves had a significant effect on CAT activity from the -270 opep2CAT construct (Figure 21), however, there is no additive effect when both IE2 and P34 are co-transfected. Co-transfection of IE1 with IE2 increases CAT activity, but it is reduced from that of IE2 alone, suggesting a negative effect of IE1. IE1+P34 do not significantly rraw-activate -270 opep2CAT. When all three /"raw-activators are present, the promoter is ^ raw-activated, but expression is reduced from that of IE2 alone or with P34. The -174 opep2CAT construct was significantly ^raw-activated by IE2 in both cell lines (Figure 22). In Ld652Y cells, IE1 and P34 do /'raw-activate, increasing the CAT activity 2.5-fold, but do not have an additive effect when co-transfected. Trans-activation by IE2 alone or with IE1 or P34 results in a 9-fold increase in CAT activity. All three /raw-activators together only increase CAT activity an additional 10 percent. In Sf9 cells, IE2 was the only rraw-activator to have an effect, and when co-transfected with IE1, the activity was reduced to the level of the construct alone. IE1 again has a negative effect when all three ^ rara-activators are present, but activity is still 1.5 times that of-174 opep2CAT alone. These data indicated that while IE1, IE2 and P34 all can affect expression of opep2CAT depending on the size of the promoter, only IE2 has a significant, consistent effect on both promoters in both cell lines. Based on these results, IE2 alone was selected for further investigation to determine what promoter elements were required for IE2 trans-activation. 5'-3' promoter deletions As previously indicated, the promoter of opep-2 contains several previously identified regulatory motifs, as well as a 13 base motif that is repeated twice (Figure 20). The opep-2 promoter was therefore used to identify the elements required for early gene expression in the absence of viral factors in Ld652Y and Sf9 cell lines. In addition, the opep-2 promoter was used to determine which promoter elements were required for ^ram-activation by IE2. Currently, nothing is known about promoter elements involved in IE2 /ram-activation of baculovirus early genes. Figure 20 shows the identifiable motifs found in the -270 opep2CAT promoter -the CACAGT transcriptional start site of opep-2, a TATA box, two GATA motifs (GATA-A and GATA-B - one in each orientation), two 13 base direct repeats (13R-A and 13R-B), a single CACGTG palindrome, a second pair of GATA motifs (GATA-C and GATA-D), the opep-3 TATA box and the CACAGT transcriptional start site for opep-3. To facilitate this functional dissection of the opep-2 promoter, a series of nested 5'-3' promoter deletions were made, yielding opep2CAT reporter constructs containing 122 Figure 21. Tram-activator analysis of -270 opep2CAT in Ld652Y and Sf9 cell lines using the OpMNPV regulatory proteins IE1, IE2 and P34. Relative CAT activity is shown. Rates have been normalized to the reporter construct in the absence of ^ ram-activators, which has been assigned an arbitrary value of one. Bars represent the standard error. 123 124 Figure 22. Tram-activator analysis of-174 6pep2CAT in Ld652Y and Sf9 cell lines using the OpMNPV regulatory proteins IE1, IE2 and P34. Relative CAT activity is shown. Rates have been normalized to the reporter construct in the absence of trans-activators, which has been assigned an arbitrary value of one. Bars represent the standard error. 125 126 270 to 44 bp of 5' promoter sequence (Figure 23). These constructs were transfected into Ld652Y and Sf9 cells in the presence and absence of a plasmid capable of expressing IE2. In Ld652Y cells, deletion of sequences upstream of-124 increases CAT activity 2-3.5 fold (-124 opep2CAT). Deletion from -124 to -103, which removes the CACGTG and 13R-B reduces CAT activity by 90%. Deletion of the 13R-A motif (-103 to -76) restores CAT activity to a level similar to that of the parent construct. Further deletion of the promoter, removing all but the GATA-A motif (-44 opep2CAT) reduces CAT activity, but it is still present at low levels. Al l constructs containing at least one complete 13R motif (-103 opep2CAT and up) are trans-activated by IE2 in Ld652Y cells. Constructs containing 76 bp or less of promoter sequence were not /raw-activated. In Sf9 cells, deletions of-270 to -174 bp, which includes the opep-3 CACAGT transcriptional start site results in a doubling of CAT activity. Subsequent deletion of the opep-3 TATA box (-174 to -152) reduces CAT activity to the -270 level. Deletion of sequences -152 to -124 had no significant effect on expression, however, deletion of -124 to -103 which removes the CACGTG and half of the 13-B motif, reduced CAT activity by 50%. Deletion of-103 to -76, which deletes the 13R-A motif eliminates significant CAT activity in Sf9 cells. This contrasts to that observed in Ld652Y cells, where deletion of the 13R motifs does not eliminate CAT activity in the absence of IE2 Tram'-activation by IE2 in Sf9 cells is largely unaffected by deletion of sequences upstream of -103. Deletion of the 13R-A motif (-76 opep2CAT) results in an 80% reduction in IE2 /rara-activation, and ^ra«s-activation is reduced further upon deletion of the sequences upstream of -44, but is not eliminated. 127 The minimal sequence requirement for detectable CAT activity from the opep-2 promoter is different for Ld652Y and Sf9 cells lines. Only 44 bp of promoter which contains a single GATA is required for activity in Ld652Y cells, while in Sf9 cells, 103 bp of the promoter containing GATA-A, GATA-B and 13R-A is required in the absence of IE2. In Ld652Y cells, IE2 does not ^ram-activate the opep-2 promoter once the 13 base repeats have been deleted. In contrast, all promoters are ^ram-activated by IE2 in Sf9 cells, even when a single GATA is present (-44 opep2CAT). 3'-5' promoter deletions To complement the 5'-3' deletions, a set of nested 3'-5' deletions of the opep2CAT promoter were also generated to allow investigation of the roles of the various motifs in the opep-2 promoter region. Promoter inserts were generated by PCR, with an Ncol site at the 3' end and a Hindlll site at the 5' end to facilitate their insertion into the plasmid. The resulting set of reporter constructs was transfected into both Sf9 and Ld652Y cells and assayed for CAT activity. Rates are normalized to the parent construct, Nco-TATA, which was assigned a value of one. There was no difference in basal activity or ^ram-activation levels of CAT activity in both -270 opep2CAT and Nco-TATA in either cell line, indicating that insertion of the Ncol site by mutagenesis did not affect expression (Figure 24). In Ld652Y cells, increased activity is observed upon deletion of-35-42A (approximately 75%). Deletion of-35-84A (13R-A) reduces activity by 25%, and deletion of -35-110A (13R-B) further reduces promoter activity to 25% of Nco-TATA. Promoter activity remains at this level until the -35-165A deletion, which lacks all 128 upstream motifs except the CACAGT of opep-3. 7>ans-activation by IE2 is 2-3 fold in Ld652Y cells up to the -35-65A, which contains 13R-A and 13R-B. Trans-activation of subsequent constructs does not occur, although the promoter is active at detectable levels in the absence of IE2. The -35-42 deletion increased CAT activity 3-fold in Sf9 cells, a more marked effect than observed in Ld652Y cells for the same construct. Further deletion of bases -35-65 reduced CAT activity back to the level of the parent construct, and deletion of bases -35-84 (13R-A) reduced CAT activity to background levels. Subsequent deletions did not restore significant promoter activity, suggesting a significant role for the pair of direct repeats, or at least the 13R-A motif, in promoter activity in Sf9 cells. In Sf9 cells, high levels of trans-activation by IE2 (11-18 fold) is observed for all constructs up to the -35-65 deletion. Deletion of bases -35-84 (13R-A) reduced CAT activity by more than 90%, and further deletions reduced trans-activatable promoter activity to levels only slightly above background. The -35-122A is the exception to this, as it demonstrated IE2 frYWS-activatable CAT activity similar to -35-85A, even though all sequences downstream of GATA-C has been removed, including the 13 base repeats and the CACGTG. The GATA-A and GATA-B motifs appear to be involved in promoter regulation and IE2 /rara-activation in both Ld652Y and Sf9 cells lines. More important than the GATA motifs however, are the 13 base repeats A and B. Removal of these motifs from the promoter significantly reduces basal activity in Ld652Y cells, and eliminates basal activity in Sf9 cells. Thms'-activation of the promoter is lost upon removal of the 13R 129 Figure 23. 5'-3' deletion analysis of opep-2CAT reporter constructs in Ld652Y and Sf9 cell lines containing 270 to 44 bp of 5' promoter sequence, alone or in the presence of the OpMNPV trans-activator, IE2. Rates have been normalized to -270 opep-2CAT in the absence of IE2, which has been assigned an arbitrary value of one. Relative CAT activity of the construct alone is indicated by the black bar, hatched bars indicate the CAT activity when trans-activated by IE2. Standard error is indicated. The opep-2CAT open reading frame is indicated by a two part arrow- the black square represents the intact 5' end of the opep-2 ORF, the arrow indicates the CAT gene fused in frame. The transcriptional start site is indicated by a white box with an arrow and the TATA box is indicated by a hatched box. The GATA motif (in either orientation) is indicated by a grey circle, and the 13 base repeat is indicated by a black box with a white arrow inside, designating orientation of the motif. The CACGTG palindrome is indicated by a black circle. 130 131 Figure 24. 3'-5' deletion analysis of opep2CAT promoter in Ld652Y and Sf9 cell lines. Opep-2CAT reporter constructs with 7 to 235 bp internal deletions in the 5' promoter sequence, upstream of the TATA box were assayed for CAT activity alone and in the presence of IE2. Relative CAT activity of the construct alone is indicated by the black bar, hatched bars indicate the CAT activity when /ram-activated by IE2. Standard error is indicated. Rates have been normalized to the Nco-TATA construct in the absence of IE2, which has been assigned an arbitrary value of one. 132 O) LL tf) CM CM UJ UJ I I T I . r*n, i n n . >• CM in 10 Q CM CM UJ UJ I-< o If! K) i n tn co co co in m in in m CO CO CO co < o 133 motifs from the promoter in Ld652Y cells, and is significantly reduced in Sf9 cells, although not eliminated completely. Mutagenesis of selected motifs The 5'-3' and 3'-5' deletion analysis showed a definite role of the 13 base repeat and possibly the GATA motifs. To further analyze the role of the GATAs and CACGTG in the presence of the 13 base repeat without altering the spatial relationship between factors, site directed mutagenesis was performed to inactivate these motifs. The GATA and CACGTG motifs have been previously demonstrated to bind host cell nuclear factors and play a role in the activation of the gp64 promoter. Mutations were designed to eliminate the ability of the motif to bind cellular factors, as demonstrated by Kogan and Blissard (1994). The smallest promoter that is ^ ram-activated by IE2 in both cell lines and possess all. the motifs in question was the -124 opep2CAT promoter (Figure 23), thus it was selected for mutagenesis studies on the CACGTG (changed to CATGAT) and GATA-A (changed to TCGAA) and GATA-B (changed to TTCGA) motifs in the context of the opep-2 promoter. Figure 25 shows the effects of mutating the CACGTG and GATA, singly and in combination on the expression of-124 opep2CAT in the presence and absence of IE2. In Ld652Y cells, all mutations of the promoter motifs increased the expression levels of the opep-2 promoter at least two fold. However, ?ram-activation by IE2 is reduced 20% when GATA-B is mutagenized, and increases 20% when GATA-A is mutagenized. Mutation of both GATA motifs (-124c opep2CAT), or the CACGTG (Bbr-124 opep2CAT), reduces /ram-activation again by 20%. Activity was further reduced with 134 Figure 25. Mutagenesis of GATA and CACGTG motifs of-124 opep2CAT - effects on CAT activity and IE2 rrara-activation in Ld652Y and Sf9 cell lines. Motifs have been mutagenized to eliminate host cell nuclear protein binding capacity (indicated by black ' X ' through motif), as determined by previously published results (Kogan and Blissard, 1994). Relative CAT activity of the construct alone is indicated by the black bar, hatched bars indicate the CAT activity when fr-ara-activated by IE2. Standard error is indicated. Rates have been normalized to the -124 opep-2CAT construct in the absence of IE2, which has been assigned an arbitrary value of one. 135 < o CL CU CL o < O «? a ai a o ra t CM < O C N i a a 4> a> a. a o o X I o C N C N < o C N a 0) a. o «t CM < o CM i a cu CL O co t CM n m < o CM • CL O CL o X I «t CM m < o CM i a u CL o o CM x> m X I m cc H < O CM i CL CU CL o 136 mutation of the CACGTG and either one of the GATAs. When all three motifs are mutagenized (Bbr-124C opep2CAT) no IE2 /raw-activation was observed in Ld652Y cells. In Sf9 cells, mutagenesis of GATA-B(-124a opep2CAT) increased promoter activity by 25%, while mutation of the reverse orientation GATA-A (-124b opep2CAT) reduced promoter activity by 40%. Eliminating the binding ability of both GATAs (-124c opep2CAT) did not further reduce activity. Mutagenesis of the CACGTG by itself reduced activity approximately 25% (Bbr-124 opep2CAT). The lowest level of CAT activity was observed when both GATAs and the CACGTG were mutagenized (Bbr-124c opep2CAT). Trims-activation by IE2 of all constructs was significant, with a 2.5 fold increase in activity for the parent construct and all of the GATA mutations in the presence of CACGTG. Mutation of the GATA motifs or the CACGTG motif by themselves did not affect IE2 activation. Mutation of the CACGTG or both of the GATA motifs does not reduce IE2 /'rarcs-activation of the promoter. IE2 /'rara-activation is reduced, however, when one or both of the GATAs are mutated along with CACGTG (Bbr-124a,b opep2CAT). Mutation of all three motifs decreases IE2 activation by -40% but does not eliminate it. These results indicate that in Sf9 cells, the motifs probably do not act individually, but in a co-operative manner to influence promoter activity both in the presence and absence of IE2. Two GATAs or one GATA and the CACGTG are required for fr-a/M-activation in the presence of the 13R motifs in Ld652Y cells. As Bbr-124c opep2CAT is active in both cell lines, this also supports the significance of the 13 base 137 repeat in promoter activity and for /rara-activation by IE2 in Sf9 cells, but not Ld652Y cells. To analyze the effects of the GATA mutations in the absence of the 13 base repeats and CACGTG, the -76 opep2CAT construct was mutagenized at either or both of the GATA motifs as described above (Figure 26). Mutation of either or both of the GATAs did not have a significant effect on promoter activity in Ld652Y cells in the absence of IE2, however, mutation of both GATAs resulted in 50% less activity when trans-activated by IE2. This suggests that in the absence of GATA, IE2 may have a negative regulatory effect. In Sf9 cells, detectable CAT activity occurs only when the promoter is rrara-activated by IE2. Mutation of a single GATA did not significantly affect trans-activation, while mutation of both GATAs (-76c opep2CAT) reduced CAT activity by 65%, suggesting an important role for the GATA motifs in Sf9 cells when the CACGTG and 13 base repeats are not present. Synthetic promoter constructs CACGTG motifs. The promoter deletion and mutagenesis studies have indicated an important role for both the 13 base repeats and the CACGTG motifs in the activation of the opep-2 promoter. In order to study the effects of these motifs individually and in the presence or absence of a GATA motif, a series of synthetic promoter constructs was generated, taking care to preserve the spacing between motifs found in the native promoter. Figure 27 illustrates the CACGTG-containing promoters. The single GATA motif found in -44opep2CAT was mutagenized for loss of function to generate -44b 138 opep2CAT. One to seven CACGTG motifs were inserted into both of these constructs, resulting in a series of 10 promoters (CS44 Pml 1-10). In Ld652Y cells, a significant increase (20-fold) in CAT activity is observed upon deletion of the GATA motif in the parent construct (-44b opep2CAT). One CACGTG with the GATA motif (CS44 Pml-8) gives a 15-fold increase in activity, and is not affected by mutation of the GATA. Two CACGTG motifs and the GATA motif result in a 20-fold increase in activity (CS44 Pml-2), and increases to 30-fold upon mutation of the GATA (CS44b Pml-4). Additional CACGTG motifs further increases promoter activity, up to 60-fold (CS44 Pml-10). Trans-activation by IE2 does not occur with the single CACGTG and GATA (CS44 Pml-8), and a negative effect of IE2 is observed when the GATA is mutated (CS44b Pml-7). This trend is also observed with two CACGTG motifs in the presence and absence of a functional GATA; IE2 does not frans-activate the promoter in the presence of the GATA (CS44 Pml-2), but exerts a negative effect when the GATA is mutagenized (CS44b Pml-4). When three or more CACGTG motifs are present in the promoter, they compensate for the negative effect of the mutated GATA in the presence of IE2. None of the constructs in the CACGTG series have detectable CAT activity in the absence of IE2 in Sf9 cells. Up to 7 CACGTG motifs can be added to the parent construct with no increase in expression of the constructs in Sf9 cells. Trans-activation by IE2 occurs for all constructs in Sf9 cells, to varying degrees (0.25-3 fold that of-44 opep2CAT+IE2). Mutation of the GATA (-44b opep2CAT) doubles the promoter activity, and addition of one CACGTG with a functional GATA triples the activity (CS44 Pml-8). When the GATA is mutated in the presence of the single CACGTG, activity 139 Figure 26. Mutagenesis of GATA motifs of -76 opep2CAT - effect on CAT activity and ^ram-activation by IE2 in Ld652Y and Sf9 cell lines. GATA motifs have been mutagenized to eliminate host cell nuclear protein binding as described in Figure 20. Relative CAT activity of the construct alone is indicated by the black bar, hatched bars indicate the CAT activity when trans-activated by IE2. Standard error is indicated. Rates in Ld652Y cells have been normalized to the -76 opep-2CAT construct, which has been assigned an arbitrary value of one. In Sf9 cells, -76 opep-2CAT does not produce detectable levels of activity, therefore -76 opep-2CAT j'ra/w-activated by IE2 was given an arbitrary value of one and rates were normalized to this. 140 141 decreases by over 75% (CS44b Pml-7). Addition of two CACGTG to the GATA increases activity 50% (CS44 Pml-2), and again a significant decrease occurs upon mutation of the GATA (CS44b Pml-4). Again, as observed with Ld652Y cells, when three or more CACGTG motifs are present in. the promoter, they compensate for the mutated GATA, and this decrease does not occur. Interestingly, constructs that contain 5 (CS44 Pml-9) or 7 CACGTG (CS44 Pml-10) motifs results in lower CAT levels in Sf9 cells. 13R motifs. The 5'-3' and 3'-5' deletion series has shown that the 13 base repeat has the greatest impact on opep-2 expression in the presence and absence of IE2. The 13R containing synthetic promoter constructs are illustrated in Figure 28. Promoters containing from one to three copies of the 13 base repeat in either orientation were generated in the same manner as the synthetic CACGTG promoter series. In Ld652Y cells, the presence of a 13R motif with or without a GATA motif increases basal activity by 3-6 fold (Figure 28). There is no obvious correlation between orientation, quantity of motifs, and activity level. The only consistent ^rara-activation by IE2 was CS44b 13-3, which contains three motifs, one in reverse orientation, in the absence of GATA. When ^ raws-activated by IE2, the level of expression is only as high as CS44b 13-4, with or without IE2. CS44b 13-4 contains a single reverse 13 base motif in the presence of a GATA, and this reversed motif alone does not appear likely to be responsible for this effect, as it does not affect ?ram,-activation when by itself, in the presence or absence of GATA (CS44 13-4, 13-6). 142 In Sf9 cells, all 13R constructs are ^raws-activated by IE2, and detectable CAT activity in the absence of IE2 is observed with some of the 13R containing promoters. CS44 13-4 has one repeat in the reverse orientation and has basal activity twice that of the trans-activated -44 opep2CAT construct, but this activity is lost upon mutation of the GATA (CS44b 13-7). Two 13R motifs in the presence or absence of a functional GATA (CS44 13-6, CS44b, 13-1) give low levels of CAT activity (CS44 13-6, 13-1). When a third motif in the reverse orientation is added, CAT activity increases 4-5 fold over the two motifs in the absence of GATA (CS44b 13-3). The presence of this reversed 13R also significantly increases IE2 /raw-activation from 6-8 fold over that of the -44 opep2CAT construct. These data on the 13R synthetic promoter constructs suggests a significant role for the 13R motif in promoter activity in Ld652Y cells and IE2 Trans-activation in Sf9 cells. Orientation of the motif seems to be significant in both basal activity and ^ raws-activation in Sf9 cells, with the reverse orientation playing a significant role. GATA can also have an effect, depending on the arrangement of the 13 base motifs. 143 Figure 27. Synthetic promoters containing 1-7 copies of the CACGTG palindrome in the presence and absence of a functional GATA motif - effect on CAT activity and trans-activation by IE2. Relative CAT activity of the construct alone is indicated by the black bar, hatched bars indicate the CAT activity when r^aws-activated by IE2. Standard error is indicated. Rates in Ld652Y cells have been normalized to the -44 opep-2CAT construct, which has been assigned an arbitrary value of one. In Sf9 cells, -44 opep-2CAT does not produce detectable levels of activity, therefore -44 opep-2CAT /raws-activated by IE2 was given an arbitrary value of one and rates were normalized to this. 144 145 Figure 28. Synthetic promoters containing 1-3 copies of the 13 base repeat in either orientation in the presence and absence of a functional GATA motif - effect on CAT activity and Traws-activation by IE2 in Ld652Y and Sf9 cell lines. Relative CAT activity of the construct alone is indicated by the black bar, hatched bars indicate the CAT activity when /raw-activated by IE2. Standard error is indicated. Rates in Ld652Y cells have been normalized to the -44 opep-2CAT construct, which has been assigned an arbitrary value of one. In Sf9 cells, -44 opep-2CAT does not produce detectable levels of activity, therefore -44 opep-2CAT ^raws-activated by IE2 was given an arbitrary value of one and rates were normalized to this. 146 Electrophoretic Mobility Shift Assays (EMSA) The ability of GATA and CACGTG sequences to bind host cell nuclear proteins had previously been demonstrated in Ld652Y and Sf9 cell lines (Kogan and Blissard, 1994; Krappa et al., 1992), but the 13R motif sequence has not been previously reported in the literature as a promoter regulatory motif. The transient assay results indicated that the 13R motif is the most significant element in opep-2 expression in the absence of viral factors, which suggests that host cell nuclear factors may interact with this motif. To investigate this possibility, EMSA was performed using a 102 bp fragment of the opep-2 promoter (Figure 29a, probe 137). Multiple protein-DNA complexes are observed with the 102 bp #137 probe; 6 in Ld652Y cells (A-F) and 5 in Sf9 cells (G-K) (Figure 29b). Competition with the 13R decreases or eliminates complexes D, E and F in Ld652Y cells and complex K in Sf9 cells (Figure 29b, lane 3), indicating the ability of the 13R motif to interact with host cell nuclear factors in both cell lines. The GATA motif competes for the slower migrating complex G and decreases complex K in Sf9 cells, and competes for complexes E and F in Ld652Y cells (Figure 29b, lane 4). 148 Figure 29 EMSA analysis of the opep-2 promoter. The opep-2 promoter was tested with extracts from Ld652Y and Sf9 cells (5 pg) for binding to specific elements. Competitors were present at a 370-1100 fold molar excess, (a) Probe and unlabelled competitors used for EMSA. Black circle, CACGTG motif; grey circle, GATA motif; black box with white arrow, 13R. (b) EMSA of Ld652Y and Sf9 cell extracts on probe #137 and competition with specific elements. Lane 1, free probe; lane 2, no competitor; lane 3, 13R specific competitor; lane 4, GATA specific competitor. Significant bands are indicated by line and letter designation on the left (A-F) and right (G-K). 149 (a) -124 opep2CAT probe #137 13R GATA - # — ® -150 D I S C U S S I O N In this study the immediate early gene opep-2 of the baculovirus OpMNPV has been identified, mapped and characterized. Opep-2 function has been analyzed by generation of deletion viruses and insertion of opep-2 into viruses that would not normally express opep-2. Through studies on the virulence of the wild type and deletion viruses lacking opep-2 expression in tissue culture and in vivo, I have attempted to assign a role for opep-2 in the OpMNPV infection cycle. The opep-2 promoter was also analyzed by deletion, nucleotide substitution and insertion studies to determine the sequences important for promoter activity in the absence of viral factors. In addition, the opep-2 promoter has been used to identify the motifs required for IE2 /raws-activation of opep-2 in both Ld652Y and Sf9 cells. Characterization o/opep-2 No gene homologous to opep-2 has been identified in any other baculovirus. Opep-2 is one of two early genes found in the. IE1-IE2 intergenic region, and therefore is unique to OpMNPV. This region is one of two large insertions in the OpMNPV genome relative to the genome of the archetype baculovirus, AcMNPV (Ahrens et al., 1997). Opep-2 is a unique early gene as it is transcribed as three transcripts immediately upon infection. The only early gene previously known to be expressed as multiple transcripts at similar times post infection is iel, which is spliced (Chisholm and Henner, 1988; Theilmann and Stewart, 1991). Contrary to iel however, transcriptional mapping of opep-2 indicated that the three mRNAs initiate at a single conserved baculovirus early gene transcriptional start site, CACAGT, but terminate using multiple polyadenylation 151 signals at the 3' end of the gene (Figure 2b). The possible reason for this is that the region 3' to the opep-2 ORF is greater than 80% A+T and in such an environment the fidelity of the RNA polymerase may be affected. The p8.9 early gene, which is transcribed off the opposite strand, also terminates in this A+T rich region but utilizes only a single polyadenylation signal at early times p.i. (Wu et al., 1993b). The opep-2 early gene initiation site, CACAGT, is similar to other baculovirus early genes including the OpMNPV genes iel, ie2,p34, and gp64-EFP, all of which play important roles in OpMNPV replication and are transcribed in the absence of viral factors (Blissard and Rohrmann, 1989; Theilmann and Stewart, 1991; Theilmann and Stewart, 1992a; Wu etal., 1993a). OPEP-2 Expression Western blots of total infected cell proteins probed with an OPEP-2 specific polyclonal antibody detected a single protein migrating at 32 kDa (Figure 5a) which is significantly larger than the predicted size of 25 kDa. Post-translational modifications specific to insect cells were initially thought to be a likely cause for the difference between predicted and observed sizes, however, in vitro translation of the cloned opep-2 ORF in rabbit reticulocyte lysate and immunoprecipitation with the OPEP-2 specific polyclonal antisera indicated that the modification was not specific to insect cells. Three major bands of 25, 29, and 32 kDa (Figure 5b) were detected. The 25 kDa band corresponds to the predicted size of OPEP-2, based on its amino acid sequence, and the largest band, 32 kDa, co-migrates with the OPEP-2 protein from infected cells. Rabbit reticulocyte lysate systems have kinase activities (Joshi et al., 1995), but 152 dephosphorylation of OPEP-2 did not affect the migration in SDS-PAGE gels (Figure 6a), indicating that phosphorylation was not a reason for the aberrant migration. Analysis of nuclear and cytoplasmic protein fractions and total protein of infected cells indicated that OPEP-2 is predominantly a cytoplasmic protein (Figure 7). Structure analysis software identified three potential transmembrane domains in OPEP-2 (Figure 9a). OPEP-2 did not co-purify with cell membranes, suggesting that OPEP-2 was not tightly associated with the cellular membrane, but is a cytoplasmic protein (Figure 9c). Glycosylation of OPEP-2 was also considered a possible reason for the difference in predicted and observed size on SDS-PAGE. A single potential N-glycosylation site is found at Asn 1 6 9 (Asn-X-Ser) (Figure 9a). No difference in the migration of OPEP-2 from cells infected in the presence or absence of tunicamycin was observed, indicating that OPEP-2 is not glycosylated (Figure 9b). Other post-translational modifications are still possible, such as ADP-ribosylation, O-glycosylation or the attachment of glycosyl-phosphatidylinositol membrane anchors. ADP-ribosylation could be investigated by digestion of total protein from infected cells by glycohydrolase and analysis by Western blot. Attachment of phosphatidylinositol membrane anchors is unlikely, as OPEP-2 is not membrane associated, but could be investigated by digestion of total protein with phospholipase C and analysis by Western blot (Creighton, 1993). The possibility of O-glycosylation could be investigated by growth of the infected cells in the presence of benzyl-alpha N-galactosaminide, which inhibits the transfer of the UDP-(N-acetyl galactosamine) to the appropriate amino acid. Contradiction between predicted and observed values of molecular weight can result if there are abnormalities in SDS binding or protein confirmation, large differences in 153 charge, or covalently attached nonprotein moieties which would cause the denatured protein to migrate in an aberrant manner in the gel (Creighton, 1993). OPEP-2 may also have had a structural role, or be associated with either form of the virus. This is not believed to be the case, as OPEP-2 was not detected in association with either the purified extracellular virus or the purified and fractionated occlusion derived virus (Figure 7). Deletion virus studies To aid in the elucidation of the possible role for OPEP-2 in the viral infection cycle, opep-2 was deleted from the genome by homologous recombination in vitro. Viable deletion mutants were obtained which indicated that opep-2 does not play an essential role in OpMNPV infection of Ld652Y cells in culture. Possible effects of the absence of OPEP-2 on expression of other selected early and late proteins was investigated by Western blot analysis of total proteins from both WT and vAopep-2 infected Ld652Y cells. No consistent differences in expression of GP64-EFP, IE1, P34, OPEP-3, capsid, ODVP-6E and polyhedrin from WT or vAopep-2 infected Ld652Y cells were observed (Figure 1 la,b). While all of these seven proteins are essential for various important events in the baculovirus infection cycle, they are only a small fraction of the total proteins produced in OpMNPV infected cells. When an 35S-methionine pulse labelled time course was analyzed by SDS-PAGE, an increase in the relative levels of at least four proteins in the vAopep-2 OpMNPV infected cells was observed (53, 30, 28 and 12 kDa) at late times post infection (Figure 12). Al l of these proteins are present at later times in both WT and 154 vAopep-2 infected cells, but appear to be expressed at a higher level in the vAopep-2 infected cells. The identity of these proteins is not known. Observing differences between infections at this late time in infection was unexpected, as OPEP-2 peak expression is at 8-12 hours post infection, and is not detected in infected cells after 48 hours (Figure 5 a). Unlike AcMNPV-infected Sf9 cells where polyhedrin is visible as a prominent band in Coomassie blue stained SDS-PAGE gels of total proteins (Smith et al, 1983; Van Oers et al., 1992), an intense polyhedrin band on the gel was not observed in this time course of OpMNPV infected cells. OpMNPV polyhedrin has 5 methionine residues (Leisy et al., 1986) so insufficient label incorporation is not likely the cause. Production of polyhedra in OpMNPV infected Ld652Y cells occurs approximately 24 hours later than in AcMNPV infected Sf9 cells (Bradford et al, 1990; Smith et al, 1983), and fewer polyhedra are observed, suggesting that the polyhedrin protein is not produced at as high a level as in AcMNPV, although there is no direct way to compare based on the data presented here. Western blot data (Figure 11) indicates that polyhedrin is made at the appropriate time in the infection and is unaffected by deletion of OPEP-2. The timing of DNA replication (Figure 13) and budded virus production (Figure 14) was unaffected by deletion of opep-2. These criteria, along with the data that production of selected proteins essential for various stages of the viral replication cycle are also temporally unaffected by deletion of opep-2 (Figure 11), confirm that deletion of opep-2 does not affect the growth of the virus. While opep-2 is expressed immediately upon infection and is tightly regulated, it is not surprising that it is not essential for viral infection, as many baculovirus genes, both early and late, are not essential for tissue culture infection (Ahrens et al, 1997; Ayres et al., 1994; Gomi et al, 1997). Deletion of opep-2 did result in a difference in plaque morphology, compared to the WT OpMNPV. The mutant plaques appeared smaller, and lacked the halo found in the WT plaques (Figure 15). The halo region of the plaque is a mixture of whole cells (stained) and lysed cells (unstained), leading to the hypothesis that the virus may be impeded in lysis and/or cell to cell spread through a monolayer. BV is released from intact cells by budding through the plasma membrane, rather than lysis of the cell and release of BV in a burst, therefore if B V release were affected by deletion of opep-2, the BV time course and final titres would reflect this. There is no significant difference in BV production from the WT and vAopep-2 OpMNPV - both viruses are equally virulent in tissue culture (Figure 14; Table 3). Cell to cell spread therefore, is not likely affected. Transmission electron microscopy was used to investigate the physical state of the cells infected with either WT or vAopep-2 OpMNPV at various times post infection, ranging from 6 to 168 hours. At early and late times the infection progresses normally for both the WT and mutant infected cells; enlargement of the nuclei and formation of the virogenic stroma are visible at 18 hours and virions are easily observed at 48 hours. Not until very late times, 168 hours post infection, is a difference between the infections noted. For all grids analyzed, cells infected with the WT virus had lost membrane integrity. In contrast, the majority of mutant infected cells maintained their membrane integrity at least until this point in the infection. No further time points were taken, although it would be interesting to determine if this was just a delay in the lysis of the cells, or a defect in the lysis mechanism. Cell viability experiments using Trypan blue as 156 a vital stain to indicate the proportion of cells that were alive yielded inconclusive results (data not shown). Cell lysis could also be investigated by assaying for lactate dehydrogenase (LDH). LDH activity is an assay for cytoplasmic disintegration and would provide further evidence as to whether the mutant infected cells had maintained their membrane integrity (Wu et al., 1992). . The 3 5S labelled time course of total proteins indicated that proteins from the vAopep-2 OpMNPV infected cells were detected at later times post infection that those from the WT OpMNPV infected cells. Only intact cells would be continuing to synthesize proteins at the very late times post infection, and the electron microscopy results indicate that only the vAopep-2 OpMNPV infected cells are intact at the very late times post infection - WT OpMNPV infected cells are lysed at very late times post infection. These data together suggest that the deletion virus infected cells are delayed in the lysis process, or prevented from lysing altogether. This would also fit with the altered plaque morphology. WT infected cells lyse as normal when infected and produce the halo region surrounding the centre of the plaque - a mixture of lysed and unlysed cells. Deletion virus infected cells maintain their membrane integrity and retain the crystal violet stain, therefore no visible mixture of lysed and unlysed cells occurs. Bioassay of WT and deletion viruses If OPEP-2 were only required for infection in vivo, the effect of its deletion would only be evident in a bioassay. White-marked tussock moth larvae (O. leucostigma) were used as an alternate host for bioassay. No difference in time to death or LD50 was observed upon deletion of opep-2 from the genome of OpMNPV, compared to the WT 157 virus in this host (Table 4, Figure 17). Due to the conditions of this set of bioassays, it is possible that there was a slight effect in time to death, but if it were less than 24 hours, it would not be detected. Sublethal effects of OpMNPV or vAopep-2 infection are also possible, however no studies on the fecundity or health of surviving adult moths have been done at this time. If deletion of the opep-2 gene affected the spread of the virus within a population of larvae, this would also not be observed with the bioassay. The delay in cell lysis in tissue culture is likely occurring in the bioassay - in order to study this in insects, tissue samples would have to be dissected out and sectioned for examination by electron microscopy. Chitinase and cathepsin enzymes are actively degrading the tissues of the insect at late times in infection and would make handling of the dying larvae difficult without destroying what remains of the tissues O. pseudotsugata is the 'natural' host of OpMNPV, and it remains possible that OPEP-2 is only required for infection of this species. Initial attempts at bioassays in this species failed as only insects taken from the wild were available and results were too inconsistent to yield useful data (data not shown). To investigate the effects of opep-2 outside of the context of its normal genome complement, recombinant AcMNPV expressing opep-2 under control of its own promoter or that of the OpMNPV immediate early gene ie-1, were generated. Ie-1 is a strong early promoter expressed immediately upon infection and continuing throughout infection, while the opep-2 promoter is shut down at late times. Opep-2 does not have a homologue in AcMNPV (Ayres et al., 1994), and its expression out of context may have provided clues as to its function. Expression of opep-2 under the control of either promoter did not have a significant effect on either time to death or LD50 when compared 158 to the WT strain of AcMNPV (C6). In addition, no age related effects on time to death or LD50 were observed (Tables 5, 6, Figure 19). These data indicate that while the role of OPEP-2 in the infection cycle in tissue culture is not essential, it does affect the expression of other proteins late in the infection cycle. The identity and significance of these affected proteins is unknown. In addition, deletion of opep-2 appears to cause a delay or failure of the cell lysis that occur at late times. The mechanism of this inhibition is unknown. Opep-2 promoter studies Initial characterization of the opep-2 gene region indicated it had a number of recognizable motifs in its promoter. In addition to investigating the function of opep-2,1 wanted to determine which of these motifs were involved in regulating opep-2 expression and whether the opep-2 promoter was significantly /"rans-activated by the viral trans-activator IE2, and if so, which promoter elements are required for IE2 mediated trans-activation. The promoter of opep-2 is transcriptionally active in the absence of viral factors in transient assays, this is consistent with opep-2 being a classical early gene; its promoter is recognized by the host cell factors, and no viral factors are required for promoter activity. Other studies have inserted the (3-galactosidase gene into the opep-2 ORF, 212 bp upstream of the opep-3 transcriptional start site. Opep-3 is expressed normally in vAopep-2 infected Ld652Y cells, indicating that the opep-3 promoter requirement is 212 bp or less, although there may be distal promoter elements that also have an effect (ie. enhancers). While there is no data on the minimal promoter 159 requirements of opep-2 in infected cells, only 174 bp of promoter sequence is required for expression of opep-2 in transient assays in uninfected Ld652Y and Sf9 cells (Figure 22), suggesting that opep-2 may also have a small promoter. This 174 bp region 5' to the CACAGT of opep-2 contains several motifs - a TATA box, four GATA motifs (two in either orientation), a single CACGTG motif, and two 13 base direct repeats (Figure 20) -making it a potentially valuable model for dissecting the role of these elements in baculovirus early gene expression. The TATA box is common to most eukaryotic genes transcribed by the host cell RNA polymerase II, but is not essential for transcription of all baculovirus early genes, as has been demonstrated by Kogan et al. (1995), and is not present at all in the promoter of CG30 of AcMNPV, although a similar sequence may function in its place (Thiem and Miller, 1989). The GATA motif is also present in many baculovirus early genes, and it has been demonstrated to be important in regulating promoter activity (Carson et al., 1991a; Kogan et al., 1995; Krappa and Knebel-Morsdorf, 1991; Theilmann and Stewart, 1992a). The GATA and the CACGTG motifs have been previously shown to bind host nuclear factors from lepidopteran cells (Kogan and Blissard, 1994; Krappa et al., 1992) and may have roles in transcriptional regulation of opep-2 or adjacent genes. The 13 base repeat has not been previously identified as a regulatory motif of a baculovirus early gene, but this motif is not exclusive to opep-2. Copies of this sequence with two or less base mismatches are found in the promoter regions of several other genes in OpMNPV -helicase, ieO, me53, ie2, lef-1, dnapol, gp64 and p8.9 - and AcMNPV - me53 and gp64, and other ORFs identified only from the sequence of the viral genome (Figure 30) (Ahrens and Rohrmann, 1996; Ahrens et al, 1997; Ayres et al, 1994; Blissard and 160 Rohrmann, 1989; Knebel-Morsdorf et al, 1993; Theilmann and Stewart, 1992a; Whitford et al, 1989; Wu et al, 1993b). Only a few of these genes have had their promoters studied in great detail, and as yet no role for the 13R motif has been demonstrated. Promoter requirements for transient expression The minimal promoter requirements for the Ld652Y and Sf9 cell lines used in this study differ significantly. The —44b opep2CAT reporter (Figure 27) has demonstrated that the TATA box is sufficient for minimal promoter activity in Ld652Y cells. In Sf9 cells, at least 103 bp of the promoter sequence is required, containing two GATAs and one complete copy of the 13 base repeat. These differences suggest that there are cell specific differences in trans-acting factors that interact specifically with selected motifs. Cell-specific effects on transient expression have also been observed previously for other baculovirus early genes - ie-1, gp64 and ie-2 of OpMNPV, and 39K of AcMNPV (Blissard and Rohrmann, 1991; Forsythe etal., 1998; Theilmann and Stewart, 1991; Theilmann and Stewart, 1992a). Of the three motifs in the opep-2 promoter, the CACGTG appeared to have the least influence overall, and the 13 base repeat sequence the most. Influence of GATA motifs was variable, depending on context and cell line. Mutation of the CACGTG motif (Figure 25) resulted in an increase in promoter activity in the absence of viral factors in Ld652Y cells, as did the mutation of either of the GATA motifs A and B. Experiments with the synthetic promoter constructs (Figure 27) indicated that a single CACGTG (CS44 Pml-8) increased promoter activity significantly over that of the parent (-44 opep2CAT). Increasing the number of motifs resulted in a further increase in promoter 161 Figure 30. Incidence of 13 base repeat in (a) OpMNPV and (b) AcMNPV genome allowing 2 or less mismatches. 13 base repeat sequence in the opep-2 promoter is shown in upper case text on the top line. Position of the identified motif is in the left column (base pair of first nucleotide), identified motif is shown in upper case text, with flanking viral sequence in lower case text. Corresponding ORF is indicated in the right hand column. Base mismatches are underlined, in bold. 'Findpatterns' program of UWGCG analysis software was used to identify corresponding sequences (Devereux et ah, 1984). 162 (a) OpMNPV (forward) GTCACGTAGGCCA 676 GOCAC GGCACGTAGTCCA TCACA 1629 capsid 79,009 CCTGC GTCAGGTACGCCA CGGGG helicase 117,725 AACAA GTCACGTAGGCGC TTTGC ie0/ME53 117,773 CACAA GTCACGTAGGCGC TTTGC ie0/ME53 126,722 GATTG GTCACGTAGGCCA AAACG opep-2/opep-3 126,748 GGCTA GTCACGTAGGCCA TCAGC opep-2/opep-3 128,446 CGGCA GTCACGTAGGCCG GCCTT ie2/p8.9 OpMNPV (reverse) TGGCCTACGTGAC 5,291 CGCGA TGGCCGACGTGCC CGCGC orf8 10,176 CGTGG TGGCCGACGAGAC CACCG lef-1 15,202 GTACA TGGCCCACGTGAT GGTGG orf20 37,019 GCGCC TGGCGTACGTGGC CGATA orf46/gta 58,543 CTGTG TGGCCAACGAGAC CGCGC dnapol/orf71 (b) AcMNPV (forward) GTCACGTAGGCCA 78,817 TCATA CTGACGTAGGCCA TTAAA orf91 122,675 GCCTG GTCACGTAGGCAC TTTGC ME53(orfl21) AcMNPV (reverse) TGGCCTACGTGAC 600 GTTGT TTGCGTACGTGAC TAGCG orfl 68,266 CGACA AGGCCGACGTGAC CATGA orf82 94,255 GCTTT TGGCCAACGTGAT GAACG orf 107 109,801 TTATC TGGCCTACGTGAC ACAAG gp64 163 activity. Mutation of CACGTG did not have a significant effect in Sf9 cells (Figure 25), nor did addition of up to 7 CACGTG motifs in the synthetic promoter constructs have any effect. No construct exhibited significant CAT activity in the absence of viral transcription factors (Figure 27). These results suggest that the Sf9 nuclear factors that have previously been shown to interact with CACGTG (Kogan and Blissard, 1994) are not sufficient to activate the opep-2 promoter. Interaction of Ld652Y cell nuclear factors with the CACGTG motif has not yet been demonstrated. Transient assay analysis of the opep2CAT 5'-3' and 3'-5' promoter deletion constructs indicated a prominent role for the 13 base repeat (Figures 23 and 24). For example, the Bbr-124c opep2CAT construct (Figure 25) has the two complete copies of this 13 base repeat but has both GATAs and the CACGTG mutagenized, yet gene expression levels are increased four fold over the parent construct in Ld652Y cells. In Ld652Y cells therefore, the GATAs and CACGTG may actively inhibit expression. In Sf9 cells, Bbr -124c opep2CAT has only 25% the activity of the parent construct. This strongly indicates that the GATA and CACGTG have a greater role in Sf9 cells. This construct is transiently expressed in Sf9 cells, indicating that the 13 base repeats are sufficient to interact with host cell factors to allow transcription from this promoter. A single 13 base repeat with the TATA box however, is insufficient to allow expression of the reporter construct, but whether this is due to a single repeat being insufficient, or the altered context of the motif is unclear. When the orientation of the single 13 base sequence is reversed, the synthetic promoter is again active in Sf9 cells (Figure 28, construct CS44 13-4), indicating a strict orientation effect for a single motif, and raising the question as to which gene's promoter the 13 base repeats are intended to 164 influence - opep-2 as examined in these studies, or opep-3 where they would function in the opposite orientation. Context effects for both the 13 base repeat and the GATA are also demonstrated in the 3'-5' deletion series for both Ld652Y and Sf9 cell lines (Figure 24). In Sf9 cells, when GATA motif A is deleted, reporter activity more than doubles. Upon deletion of both GATAs A and B, moving the pair of 13 base repeats adjacent to the TATA box (-35-65A opep2CAT), activity drops to significantly less than the parent construct. This, along with the synthetic promoter data, suggests that the ability of the 13 base repeat to influence transcription in Sf9 cells is dependent on both orientation and spacing in relation to the TATA box. This context and orientation effect does not appear to be as significant in Ld652Y cells, as the presence of the 13R motif is sufficient to increase transcription. For the 3'-5' deletion series assayed in Ld652Y cells, deletion of the first GATA (-3 5-42A opep2CAT) again shows an increase, suggesting a possible negative regulatory role for this GATA that may be context specific. Further internal deletions reduce the promoter activity gradually as the total number of motifs in the promoter region decrease. Of the genes listed in Figure 30 that have a 13R motif in their putative promoter region, only a very few have had any promoter analysis performed. Promoter deletion studies performed on ie2 of OpMNPV in Sf9 and Ld652Y cell lines (Theilmann and Stewart, 1992a) show a significant decrease in promoter activity in Sf9 cells, and activity is reduced to background levels in Ld652Y cells when the region of the promoter containing a single complete and one partial 13R motif is deleted. Within this 150 bp deletion are several other motifs that also have a demonstrated role in transcription; the 165 contribution of the 13 base repeats in this situation remains uncertain, but a cell type difference was observed, likely due to cell specific trans-acting factors. Promoter deletions on me53 of AcMNPV (Knebel-Morsdorf et al., 1993) also failed to provide a definitive answer to the contribution of the 13 base repeat. The promoter deletions studied were large (130 bp) and several motifs were also found in this region, making the contribution of the 13 base repeat uncertain. These experiments were performed in Sf9 cells only. Blissard and Rohrmann (1991) performed a more detailed analysis of the promoter of gp64 of OpMNPV in three cell lines - Sf9, Ld652Y, and Dml (Drosophila). When the 43 bp section containing the single copy of the 13 base repeat was deleted, no significant effects on transcription were observed in either of the lepidopteran cell lines, but the Dml cells did show a 50% decrease in promoter activity. Traws-activation of the reporter construct by iel was largely unaffected (Blissard and Rohrmann, 1991). This 43 bp region also contains a single GATA motif and again the contribution of the 13 base repeat is not clearly indicated. None of the previous studies on baculovirus early gene promoters has identified this 13 base motif. The results presented in this study are the first conclusive evidence of a significant role for the 13R motif in the transcriptional regulation of a baculovirus early gene in both Ld652Y and Sf9 cell lines. Promoter motifs involved in fra/ts-activation This is the first study that has demonstrated that there is no specific motif required for IE2 ^raws-activation of the opep-2 promoter. Of the three OpMNPV r^aws-regulatory 166 genes investigated, only IE2 consistently /rans-activated both of the promoters tested in both Ld652Y and Sf9 cell lines (Figures 21 and 22). The 13 base repeat identified in this study appears to be the most significant motif involved, although the GATA and CACGTG motifs also influence trans-activation. In addition, opep-2 promoter requirements for IE2 /^ ram-activation differ in Ld652Y and Sf9 cell lines. In Sf9 cells, /rans-activation by IE2 is observed for all constructs, including those that have no detectable expression in the absence of IE2. In the 5'-3' deletion series and -124 opep2CAT mutagenesis series (Figures 23 and 25) significant IE2 /ram'-activation is observed as long as the 13 base repeat is present. Once the 13 base repeats are deleted (as in the 5'-3'deletion series), weak /raw-activation is still observed, but actual levels are very low. When copies of the 13 base repeat are added back to the single GATA containing promoter (Figure 23, construct -44 opep2CAT), trans-activation by IE2 increases promoter activity up to 8 fold with the highest levels of activation occurring in the constructs that were active in the absence of viral factors (Figure 28, constructs CS44 13-4 and CS44b 13-3). GATA does have an influence in some situations, mutation of the GATA in construct CS44 13-4 (CS44b 13-7) reduces IE2 <*ra«,s-activation by half, and activity in the absence of IE2 is also lost. However, this effect of GATA is not observed in all constructs. Addition of multiple CACGTG motifs to the -44 opep2CAT construct (Figure 27) also results in an increase in promoter activity in the presence of IE2 in Sf9 cells, although not as consistent as with the 13 base repeat synthetic promoters. The varying degree of frans-activation by IE2 on the CACGTG synthetic promoter constructs in Sf9 cells is consistent over several experiments, but the reason for this wide variation is unclear (Figure 27). The presence or absence of a functional GATA motif does not have a significant influence. The effect of the GATA motifs on IE2 trans-activation in Sf9 cells is best observed with the mutated -76 opep2CAT promoter constructs (Figure 26). Mutation of both GATAs (-76 opep2CAT) does not eliminate /raws-activation, but it is significantly reduced - more than 60% less than the parent construct with two intact motifs. GATA does therefore have a role in trans-activation in Sf9 cells, but its effects are weak, and are significant only when observed in isolation, relative to the 13R and CACGTG motifs. The requirements for fraws-activation of the opep-2 promoter by IE2 in Ld652Y cells are less obvious. The 5'-3'deletion series (Figure 23,-103 opep2CAT) suggests that /ra«s-activation requires at least one complete copy of the 13 base repeat. When this motif is deleted (-76 opep2CAT), /raws-activation by IE2 is lost. Adding back the 13 base repeat to -44 opep2CAT (Figure 28) does not restore frvms-activation however, nor does addition of the CACGTG (Figure 27). Overall transcription from these synthetic promoters is increased with the addition of motifs, but ^raws-activation does not occur. The -124 series of site directed mutations (Figure 25) does not contradict that of the 5'-3' promoter deletions, but suggests that the 13 base repeats by themselves are not sufficient for trans-activation by IE2. Traws-activation is observed as long as at least one of the CACGTG or GATA motifs are left unaltered along with the 13R motifs in the WT promoter. There does not appear to be any specificity between the GATAs A and B, nor is quantity of motifs sufficient, as demonstrated by the synthetic promoter assays. Important motifs for /raws-activation in Ld652Y cells are less clear than for Sf9. All that 168 can be stated at this point is that no specific motif is absolutely required, but all influence IE2 /rans-activation. The promoters of ie2 and opep-2 are very similar, containing many of the same motifs. As discussed above, there is one complete and one partial copy of the 13R motif in the promoter of ie2, as well as several GATAs, and a different, 18 base repeat sequence not found in the promoter of opep-2 (Theilmann and Stewart, 1992a). IE2 is also known to be autoregulatory (Carson et al, 1991b; Theilmann and Stewart, 1992a), therefore, based on these promoter similarities it is not surprising that IE2 /rans-activates opep-2. Preliminary data indicates when the ie2 promoter is co-transfected with opep-2CAT reporter constructs that are ordinarily fraws-activated by IE2, there is a slight increase in reporter activity over that of the reporter construct alone. This suggests that IE2 is the r^ans-activating factor, but that there may be a negative regulatory cellular factor that the IE2 promoter can bind and thus influence the increase in opep-2 promoter activity. It would be interesting to express ie2 under the control of an unrelated baculovirus promoter to negate the influence of the ie2 promoter on opep-2 promoter activity. Currently this is not possible, as the other baculovirus promoters studied in detail regulate both themselves and ie2. AcMNPV ie2 has also been demonstrated to cause cell cycle arrest in Sf9 cells. Cell growth is arrested in the S phase and, by 48 hours the majority of cells had a greater than 4N DNA complement - DNA replication was able to occur, but the cell did not divide. The mechanism of this ie2 induced cell cycle arrest is unknown, but an intact RING finger motif of ie2 is required (Prikhod'ko and Miller, 1998). OpMNPV ie2 also 169 has a RING finger motif in its predicted protein structure, but no data is available on the effects of OpMNPV ie2 on Ld652Y cells, or if OpMNPV ie2 can arrest the cell cycle in Sf? cells. Although IE2 has been conclusively demonstrated to be a transcriptional activator, both in the study reported here and several others (Carson et al., 1988; Theilmann and Stewart, 1992a; Yoo and Guarino, 1994a), its mechanism of action is unknown. IE2 possesses predicted activation (proline/serine rich) and dimerization (RING finger, leucine zipper) domains, and has been demonstrated to form homodimers via the predicted leucine zipper using the yeast two-hybrid system (D.A. Theilmann, unpublished). However, it has not been shown to interact directly with the promoter DNA or other cellular transcription factors. Electrophoretic mobility shift assays to investigate the presence of IE2 in opep-2 promoter binding protein complexes were unsuccessful. The results of this study strongly indicate that no specific promoter element was required for IE2 Trans-activation. The cell-specific differences in the trans-activation properties of some of the promoters used in this study would suggest that IE2 may therefore interact with the cellular transcription factors, or IE2 may /raws-activate a yet-unknown cellular factor gene directly by interaction with its promoter or by interaction with other accessory factors. 170 CONCLUSIONS This thesis describes the identification, expression and characterization of a unique OpMNPV gene, opep-2 - the first non-essential immediate early gene of OpMNPV to be characterized. It is expressed as three transcripts from 2 to 48 hr p.i., with peak levels occurring before DNA replication, and is not associated with either the budded or occluded form of the virus. Deletion of opep-2 does however, result in an alteration of plaque morphology, possibly due to different timing of the lysis events in the infection cycle, and this was confirmed by transmission electron microscopy. WT infected cells are lysed at very late times in infection, while the cells infected with the deletion virus appear to maintain their membrane integrity. Interestingly, although OPEP-2 is not present in infected cells at late times in infection, its absence affects the expression of late proteins in infected cells. It remains to be investigated if this has any correlation with the differences in the timing of cell lysis. Opep-2 is transcribed from a single, consensus baculovirus early gene initiation site, and, characteristic of an immediate early gene, the opep-2 promoter is active in transient assays in the absence of viral factors. A novel 13 base direct repeat motif (13R) was identified in the promoter studies presented here, and has been demonstrated to be significant for both promoter activity and IE2 ?ra«s-activation in both Sf9 and Ld652Y cells, although its role differs in the two host cell lines. An orientation effect of the 13R motif has also been identified - it is possible then, that the 13 base direct repeats in the intergenic region between opep-2 and opep-3 also regulate the opep-3 gene. Opep-3, unlike opep-2, is not turned off at late times post infection. 171 This is also the first detailed study of the promoter elements involved in IE2 frans-activation of a baculovirus early gene. The data in this study suggest that IE2 does not bind the opep-2 promoter directly but more likely interacts with host cell factors that are known to bind the GATA, CACGTG or 13R motifs. This interaction may serve to enhance interactions with the cellular RNA Polymerase II complex, which results in increased transcription of the gene. 172 R E F E R E N C E S Adang, M.J. and Spence, K.D. (1981). Surface morphology of peritrophic membrane formation in the cabbage looper, Trichoplusia ni. Cell Tissue Res. 218, 141-147. Ahrens, C.H., Pearson, M.N. and Rohrmann, G.F. (1995). Identification and characterization of a second putative origin of DNA replication in a baculovirus of Orgyia pseudotsugata. Virology 207, 572-6. Ahrens, C.H. and Rohrmann, G.F. (1995a). Identification of essential trans-acting regions required for DNA replication of the Orgyia pseudotsugata multinucleocapsid nuclear polyhedrosis virus: lef-1 is an essential replication gene. Virology 207, 417-28. Ahrens, C.H. and Rohrmann, G.F. (1995b). Replication of Orgyia pseudotsugata baculovirus DNA: lef-2 and ie-1 are essential and ie-2, p34, and Op-iap are stimulatory genes. Virology 212, 650-62. Ahrens, C.H. and Rohrmann, G.F. (1996). The DNA polymerase and helicase genes of a baculovirus of Orgyia pseudosugata. J. Gen. Virol. 77, 825-37. Ahrens, C.H., Russell, R.L.Q., Funk, C.J., Evans, J.T., Harwood, S.H. and Rohrmann, G.F. (1997). The sequence of the Orgyia pseudotsugata multinuclocapsid nuclear polyhedrosis virus genome. Virology 229, 381-399. Ayres, M.D., Howard, S.C, Kuzio, J., Lopez Ferber, M. and Possee, R.D. (1994). The complete DNA sequence of Autographa californica nuclear polyhedrosis virus. Virology 202, 586-605. Beames, B. and Summers, M.D. (1988). Comparisons of host cell DNA insertions and altered transcription at the site of insertions in few polyhedra baculovirus mutants. Virology 162, 206-220. Beniya, H., Funk, C.J., Rohrmann, G.F. and Weaver, R.F. (1996). Purification of a virus-induced RNA polymerase from Autographa californica nuclear polyhedrosis virus-infected Spodoptera frugiperda cells that accurately initiates late and very late transcription in vitro. Virology 216, 12-9. Birnstiel, M.L., Busslinger, M. and Strub, K. (1985). Transcription termination and 3' processing: the end is in site! Cell 41, 349-359. Blissard, G.W., Kogan, P.H., Wei, R. and Rohrmann, G.F. (1992). A synthetic early promoter from a baculovirus: Roles of the TATA box and conserved start site CAGT sequence in basal levels of transcription. Virology 190, 783-793. 173 Blissard, G.W. and Rohrmann, G.F. (1989). Location, sequence, transcriptional mapping, and temporal expression of the gp64 envelope glycoprotein gene of the Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus. Virology 170, 537-55. Blissard, G.W. and Rohrmann, G.F. (1990). Baculovirus diversity and molecular biology. Ann. Rev. Entomol. 35, 127-55. Blissard, G.W.and Rohrmann, G.F. (1991). Baculovirus gp64 gene expression: Analysis of sequences modulating early transcription and transactivation by IEL J. Virol. 65, 5820-5827. Bradford, M.B., Blissard, G.W. and Rohrmann, G.F. (1990). Characterization of the infection cycle of the Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus in Lymantria dispar cells. J. Gen. Virol. 71,2841-2846. Bradford, M.M. (1976). A rapid and sensitive method for the quantitationof microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248. Braunagel, S.C, Elton, D.M., Ma, H. and Summers, M.D. (1996). Identification and analysis of an Autographa californica nuclear polyhedrosis virus structural protein of the occlusion-derived virus envelope: ODV-E56. Virology 217, 97-110. Braunagel, S.C, Parr, R., Belyavskyi, M. and Summers, M.D. (1998). Autographa californica nucleopolyhedrovirus infection results in Sf9 cell cycle arrest at G2/M phase. Virology 244, 195-211. Burma, S., Mukherjee, B., Jain, A., Habib, S. and Hasnain, S.E. (1994). An unusual 30-kDa protein binding to the polyhedrin gene promoter of Autographa californica nuclear polyhedrosis virus. J. Biol. Chem. 269, 2750-2757. Campbell, M.J. (1995). Lipofection reagents prepared by a simple ethanol injection technique. Biotechniques 18, 1027-1032. Carson, D.D., Guarino, L A . and Summers, M.D. (1988). Functional mapping of an AcNPV immediate early gene which augments expression of the IE-1 trans-activated 39K gene. Virology 162, 444-451. Carson, D.D., Summers, M.D. and Guarino, L A . (1991a). Molecular analysis of a baculovirus regulatory gene. Virology 182, 279-86. Carson, D.D., Summers, M.D. and Guarino, L A . (1991b). Transient expression of the Autographa californica nuclear polyhedrosis virus immediate-early gene, IE-N, is regulated by three viral elements. J. Virol. 65, 945-51. Carstens, E.B. (1987). Identification and nucleotide sequence of the regions of Autographa californica nuclear polyhedrosis virus genome carrying insertion elements derived from Spodoptera frugiperda. Virology 161, 8-17. 174 Carstens, E.B., Tjia, S.T. and Doerfler, W. (1980). Infectious DNA from Autographa californica nuclear polyhedrosis virus. Virology 101, 311-314. Charlton, C A . and Volkman, L.E. (1993). Penetration of Autographa californica nuclear polyhedrosis virus nucleocapsids into IPLB Sf 21 cells induces actin cable formation. Virology 197, 245-54. Chirgwin, V.L., Przybyla, A.E., MacDonald, R.J. and Rutter, W.J. (1979). Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18, 5294-5299. Chisholm, G.E. and Henner, D.J. (1988). Multiple early transcripts and splicing of the Autographa californica nuclear polyhedrosis virus IE-1 gene. J. Virol. 62, 3193-3200. Chodosh, L.A. (1988). Mobility shift DNA binding assay using gel electrophoresis. In "Current Protocols in Molecular Biology" (F. M. A. e. al., Ed.), pp. 12.2.1-12.2.10. Wiley, New York. Choi, J. and Guarino, L.A. (1995a). The baculovirus transactivator IE1 binds to viral enhancer elements in the absence of insect cell factors. J. Virol. 69, 4548-51. Choi, J. and Guarino, L.A. (1995b). Expression of the IE1 transactivator of Autographa californica nuclear polyhedrosis virus during viral infection. Virology 209, 99-107. Corsaro, B.G., Gijzen, M.R., Wang, P. and Granados, R.R. (1993). Baculovirus enhancing proteins as determinants of viral pathogenesis. In "Parasites and Pathogens of Insects" (N. Beckage, S. N. Thompson, and B.A.Federici, Eds.), Vol. 2, pp. 127-145. Academic Press, New York. Creighton, T.E. (1993). "Proteins: structures and molecular properties." 2nd ed. Freeman and Co., New York. Croizier, G., Croizier, L., Argaud, O. and Poudevigne, D. (1994). Extension of Autographa californica nuclear polyhedrosis virus host range by interspecific replacement of a short DNA sequence in the pi 43 helicase gene. Proc. Natl. Acad Sci. USA 91,48-52. Cunningham, J.C. (1988). Baculoviruses: their status compared to Bacillus thuringiensis as microbial insecticides. Outlook on Agri. 17, 10-17. Derksen, C.G. and Granados, R.R. (1988). Alteration of a lepidopteran peritrophic membrane by baculoviruses and enhancement of viral infectivity. Virology 167, 242-250. Devereux, J., Haeberli, P. and Smithies, O. (1984). A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12, 387-395. 175 Dickson, J.A. and Friesen, P.D. (1991). Identification of upstream promoter elements mediating early transcription from the 35,000-molecular-weight protein gene of Autographa californica nuclear polyhedrosis virus. J. Virol. 65, 4006-4016. Du, X. and Thiem, S.M. (1997). Characterization of host range factor 1 (hrf-1) expression in Lymantria dispar M nucleopolyhedrovirus- and recombinant Autographa californica M nucleopolyhedrovirus-infected IPLB-Ld652Y cells. Virology 227, 420-30. Engelhard, E.K. and Volkman, L.E. (1995). Developmental resistance in fourth instar Trichoplusia ni orally inoculated with Autographa californica M nuclear polyhedrosis virus. Virology 209, 384-9. Evans, H.F. and Entwistle, P.F. (1987). Viral diseases. In "Epizootiology of Insect Diseases" (J. R. Fuxa, and Y. Tanada, Eds.), pp. 257-322. Wiley, New York. Evans, J.T., Leisy, D.J. and Rohrmann, G.F. (1997). Characterization of the interaction between the baculovirus replication factors LEF-1 and LEF-2. J. Virol. 71, 3114-9. Forsythe, I.J., Shippam, C.E., Willis, L., Stewart, S. and Theilmann, D A . (1998). Functional analysis of the acidic activation domain of the OpMNPV IE1 transactivator. Virology 252, 65-81. Fraser, M.J., Smith, G.E. and Summers, M.D. (1983). Acquisition of host cell DNA sequences by baculoviruses: Relationship between host cell DNA insertions and FP mutants of Autographa californica and Galleria mellonella nuclear polyhedrosis viruses. J. Virol. 47, 287L300. Friesen, P.D. and Miller, L.K. (1986). The regulation of baculovirus gene expression. Curr. Top. Microbiol. Immunol. 131, 31-49. Friesen, P.D. and Miller, L.K. (1987). Divergent transcription of early 35- and 94-kilodalton protein genes encoded by the Hindlll K genome fragment of the baculovirus Autographa californica nuclear polyhedrosis virus. J. Virol. 61, 2264-2272. Friesen, P.D., Rice, W.C., Miller, D.W. and Miller, L.K. (1986). Bidirectional transcription from a solo long terminal repeat of the retrotransposon TED: symmetrical RNA start sites. Mol. Cell Biol. 6, 1599-607. Fuchs, L.Y., Woods, M.S. and Weaver, R.F. (1983). Viral transcription during Autographa californica nuclear polyhedrosis virus infection: A novel RNA polymerase induced in infected Spodoptera frugiperda cells. J. Virol. 48, 641-646. Ghosh, S., Jain, A., Mukherjee, B., Habib, S. and Hasnain, S.E. (1998). The host factor polyhedrin promoter binding protein (PPBP) is involved in transcription from the baculovirus polyhedrin promoter. J. Virol. 72,7484-7493. 176 Glocker, B., Hoopes, R.R. and Rohrmann, G.R. (1992). In vitro transactivation of baculovirus early genes by nuclear extracts from Autographa californica nuclear polyhedrosis virus-infected Spodoptera frugiperda cells. J. Virol. 66, 3476-3484. Gombart, A.F., Blissard, G.W. and Rohrmann, G.F. (1989). Characterization of the genetic organization of the Hindlll M region of the multicapsid nuclear polyhedrosis virus of Orgyia pseudotsugata reveals major differences among baculoviruses./. Gen. Virol. 70, 1815-28. Gomi, S., Zhou, C.E., Yih, W., Majima, K. and Maeda, S. (1997). Deletion analysis of four of eighteen late gene expression factor gene homologues of the baculovirus, BmNPV. Virology 230, 35-47. Gordon, J.D. and Carstens, E.B. (1984). Phenotypic characterization and physical mapping of a temperature-sensitive mutant of Autographa californica nuclear polyhedrosis virus defective in DNA synthesis. Virology 138, 69-81. Granados, R.R. and Lawler, K.A. (1981). In vivo pathway of Autographa californica baculovirus invasion and infection. Virology 108, 297-308. Groner, A. (1986). Specficity and safety of baculoviruses. In "The Biology of Baculoviruses" (R. R. Granados, and B. A. Federici, Eds.). CRC Press, Boca Raton, Fla. Grula, M.A., Buller, P.L. and Weaver, R.F. (1981). Alpha amanitin-resistant viral RNA synthesis in nuclei isolated from nuclear polyhedrosis virus-infected Heliothis zea larvae and Spodotera frugiperda cells. J. Virol. 38, 916-921. Guarino, L.A. and Dong, W. (1991). Expression of an enhancer-binding protein in insect cells transfected with the Autographa californica nuclear polyhedrosis virus IE1 gene. J. Virol. 65, 3676-3680. Guarino, L.A. and Dong, W. (1994). Functional dissection of the Autographa californica nuclear polyhedrosis virus enhancer element hr5. Virology 200, 328-335. Guarino, L.A., Gonzalez, M.A. and Summers, M.D. (1986). Complete sequence and enhancer function of the homologous DNA regions of Autographa californica nuclear polyhedrosis virus. J. Virol. 60, 224-229. Guarino, L.A. and Smith, M.W. (1990). Nucleotide sequence and characterization of the 39K gene region of Autographa californica nuclear polyhedrosis virus. Virology 179,1-8. Guarino, L.A. and Summers, M.D. (1986a). Functional mapping of a trans-activating gene required for expression of a baculovirus delayed-early gene. J. Virol. 57, 563-71. 177 Guarino, L.A. and Summers, M.D. (1986b). Interspersed homologous DNA of Autographa californica nuclear polyhedrosis virus enhances delayed-early gene expression. J. Virol. 60,215-223. Guarino, L.A. and Summers, M.D. (1987). Nucleotide sequence and temporal expression of a baculovirus regulatory gene. J. Virol. 61, 2091-2099. Guarino, L.A. and Summers, M.D. (1988). Functional mapping of Autographa California nuclear polyhedrosis virus genes required for late gene expression. J. Virol. 62, 463-71. Guarino, L A . , Xu, B., Jin, J. and Dong, W. (1998). A virus-encoded RNA polymerase purified from baculovirus-infected cells. J. Virol. 72,7985-7991. Guzo, D., Dougherty, E.M., Lynn, D.E., Braun, S.K. and Weiner, R.M. (1991). Changes in macromolecular synthesis of gypsy moth cell line IPLB-Ld652Y induced by Autographa californica nuclear polyhedrosis virus infection. J. Gen. Virol. 72, 1021-1029. Hang, X., Dong, W. and Guarino, L.A. (1995). The lef-3 gene of Autographa californica nuclear polyhedrosis virus encodes a single-stranded DNA-binding protein. J. Virol. 69, 3924-8. Harlow, E. and Lane, D. (1988). "Antibodies: A laboratory manual." 1st ed. Cold Spring Harbor Laboratory, Cold Spring Harbor. Hawtin, R.E., Zarkowska, T., Arnold, K., Thomas, C.J., Gooday, G.W., King, L A . , Kuzio, J.A. and Possee, R.D. (1997). Liquifaction of Autographa californica nucleopolyhedrovirus-infected insects is dependent on the integrity of virus-encoded chitinase and cathepsin genes. Virology 238, 243-253. Hess, R.T. and Falcon, L.A. (1977). Observations on the interaction of baculoviruses with the plasma membrane. J. Gen. Virol. 36, 525-530. Hoopes, R.R., Jr. and Rohrmann, G.F. (1991). In vitro transcription of baculovirus immediate early genes: accurate mRNA initiation by nuclear extracts from both insect and human cells. Proc. Natl. Acad. Sci. USA 88, 4513-7. Huh, N.E. and Weaver, R.F. (1990). Identifying the RNA polymerases that synthesize specific transcripts of the Autographa californica nuclear polyhedrosis virus. J. Gen. Virol. 71, 195-201. Jaques, R.P. (1967). The persistence of a nuclear polyhedrosis virus in the habitat of the host insect, Trichoplusia ni. Can. Entomol. 99, 785-794. Jarvis, D.L., Bohlmeyer, D.A. and Garcia, A.J. (1991). Requirements for nuclear localization and supramolecular assembly of a baculovirus polyhedrin protein. Virology 185, 795-810. 178 Joshi, B., Cai, A.L., Keiper, B.D., Minich, W.B., Mendez, R., Beach, C M . , Stepinski, J., Stolarski, R., Darzynkiewicz, E. and Rhoads, R.E. (1995). Phosphorylation of eukaryotic protein synthesis initiation factor 4E at Ser-209. J. Biol. Chem. 270, 14597-14603. Knebel-Morsdorf, D., Kremer, A. and Jahnel, F. (1993). Baculovirus gene ME53, which contains a putative zinc finger motif, is one of the major early transcribed genes. J. Virol. 67, 753-758. Kogan, P.H. and Blissard, G.W. (1994). A baculovirus gp64 early promoter is activated by host transcription factor binding to CACGTG and GATA elements. J. Virol. 68,813-22. Kogan, P.H., Chen, X.Y. and Blissard, G.W. (1995). Overlapping TATA-dependent and TATA-independent early promoter activities in the baculovirus gp64 envelope fusion protein gene. J. Virol. 69, 1452-1461. Kool, M. , Ahrens, C.H., Goldbach, R.W., Rohrmann, G.F. and Vlak, J.M. (1994). Identification of genes involved in DNA replication of the Autographa californica baculovirus. Proc. Natl. Acad. Sci. USA 91, 11212-11216. Kool, M. , Ahrens, C.H., Vlak, J.M. and Rohrmann, G.F. (1995). Replication of baculovirus DNA. J. Gen. Virol. 76,2103-18. Kool, M. , Voeten, J.T.M., Goldbach, R.W., Tramper, J. and Vlak, J.M. (1993). Identification of seven putative origins of Autographa californica multiple nucleocapsid nuclear polyhedrosis virus DNA replication. J. Gen. Virol. 74,2661-2668. Kovacs, G.R., Choi, J., Guarino, L.A. and Summers, M.D. (1992). Functional dissection of the Autographa californica nuclear polyhedrosis virus immediate-early 1 transcriptional regulatory protein. J. Virol. 66, 7429-37. Kovacs, G.R., Guarino, L.A. and Summers, M.D. (1991). Novel regulatory properties of the IE1 and IEO transactivators encoded by the baculovirus Autographa californica multicapsid nuclear polyhedrosis virus. J. Virol. 65, 5281-8. Krappa, R., Behn, K.A., Jahnel, F., Doerfler, W. and Knebel, M.D. (1992). Differential factor binding at the promoter of early baculovirus gene PE38 during viral infection: GATA motif is recognized by an insect protein. J. Virol. 66, 3493-3503. Krappa, R. and Knebel-Morsdorf, D. (1991). Identification of the very early transcribed baculovirus gene PE-38. /. Virol. 65, 805-812. Krappa, R., Roncarati, R. and Knebel-Morsdorf, D. (1995). Expression of PE38 and IE2, viral members of the C3HC4 finger family, during baculovirus infection: PE38 and IE2 localize to distinct nuclear regions. J. Virol. 69, 5287-93. 179 Kuzio, J., Pearson, M.N., Harwood, S.H., Funk, C.J., Evans, J.T., Slavicek, J. and Rohrmann, G.F. (1999). Sequence and analysis of the genome of a baculovirus pathogenic for Lymantria dispar. Virology 253, 17-34. Laemmli, U.K. (1970). Cleavage of structural proteins during the assembly of the head of the bacteriophage T4. Nature 227, 680-685. Lanier, L.M., Slack, J.M. and Volkman, L.E. (1996). Actin binding and proteolysis by the baculovirus AcMNPV: the role of virion-associated V-CATH. Virology 216, 380-8. Lanier, L.M. and Volkman, L.E. (1998). Actin binding and nucleation by Autographa California M nucleopolyhedrovirus. Virology 243, 167-77. Laufs, S., Lu, A., Arrell, L.K. and Carstens, E.B. (1997). Autographa californica nuclear polyhedrosis virus pi43 gene product is a DNA binding protien. Virology 228, 98-106. Leisy, D., Nesson, M., Rohrmann, G. and Beaudreau, G. (1986). Location and nucleotide sequence of the Orgyia pseudotsugata single nucleocapsid nuclear polyhedrosis virus polyhedrin gene. J . Gen. Virol. 67, 1073-1079. Leisy, D.J., Rasmussen, C , Kim, H.T. and Rohrmann, G.F. (1995). The Autographa californica nuclear polyhedrosis virus homologous region la: identical sequences are essential for DNA replication activity and transcriptional enhancer function. Virology 208, 742-52. Leisy, D.J., Rasmussen, C , Owusu, E.O. and Rohrmann, G.F. (1997). A mechanism for negative gene regulation in Autographa californica multinucleocapsid nuclear polyhedrosis virus. J. Virol. 71, 5088-94. Leisy, D.J. and Rohrmann, G.F. (1993). Characterization of the replication of plasmids containing hr sequences in baculovirus-infected Spodoptera frugiperda cells. Virology 196, 722-30. Leisy, D.J., Rohrmann, G.F. and Beaudreau, G.S. (1984). Conservation of genome organization in two multicapsid nuclear polyhedrosis viruses. J. Virol. 52, 699-702. Lepore, L.S., Roelvink, P.R. and Granados, R.R. (1996). Enhancin, the granulosis virus protein that facilitates nucleopolyhedrovirus (NPV) infections is a metalloproteinase. J. Invert. Path 68, 131-140. Lu, A. and Carstens, E.B. (1991). Nucleotide sequence of a gene essential for viral DNA replication in the baculovirus Autographa californica nuclear polyhedrosis virus. Virology 181, 336-347. 180 Lu, A. and Carstens, E.B. (1993). Immediate-early baculovirus genes transactivate the pi 43 gene promoter of Autographa californica nuclear polyhedrosis virus. Virology 195, 710-718. Lu, A. and Miller, L.K. (1995a). Differential requirements for baculovirus late expression factor genes in two cell lines. J. Virol. 69, 6265-72. Lu, A. and Miller, L.K. (1995b). The roles of eighteen baculovirus late expression factor genes in transcription and DNA replication. J. Virol. 69, 975-82. Lu, A. and Miller, L.K. (1996). Species-specific effects of the hcf-1 gene on baculovirus virulence. J. Virol. 70, 5123-30. Maeda, S., Kamita, S.G. and Kondo, A. (1993). Host range expansion of Autographa californica nuclear polyhedrosis virus. (NPV) following recombination of a 0.6 kilobase-pair DNA fragment originating from Bombyx mori NPV. J. Virol. 67, 6234-6238. Maeda, S., Mukohara, Y. and Kondo, A. (1990). Characteristically distinct isolates of the nuclear polyhedrosis virus from Spodoptera littura. J. Gen. Virol. 71,2631-2639. Marck, C. (1988). 'DNA Strider': a 'C program for the fast analysis of DNA and protein sequences on the Apple Macintosh family of computers. Nucleic Acids Res. 15, 1829-1836. McClintock, J.T., Dougherty, E.M. and Weiner, R.M. (1986). Semipermissive replication of a nuclear polyhedrosis virus of Autographa californica in a gypsy moth cell line. J. Virol. 57, 197-204. McLachlin, J.R. and Miller, L.K. (1994). Identification and characterization of vlf-1, a baculovirus gene involved in very late gene expression. J. Virol. 68, 7746-7756. Merrington, C.L., Kitts, P.A., King, L.A. and Possee, R.D. (1996). An Autographa californica nucleopolyhedrovirus lef-2 mutant: consequences for DNA replication and very late gene expression. Virology 217, 338-348. Milks, M.L. (1997). Comparative biology and susceptibility of Cabbage Looper (Lepidoptera: Noctuidae) lines to a nuclear polyhedrosis virus. Environ. Entomol. 26, 839-848. Miller, D.W. and Miller, L.K. (1982). A virus mutant with an insertion of a copia-like transposable element. Nature 299, 562-4. Miller, L.K., Jewell, J.E. and Browne, D. (1981). Baculovirus induction of a DNA polymerase. J. Virol. 40, 305-8. 181 Monsma, S.A. and Blissard, G.W. (1995). Identification of a membrane fusion domain and an oligomerization domain in the baculovirus GP64 envelope fusion protein. J. Virol. 69, 2583-2595. Neumann, J.R., Morency, C A . and Russian, K.O. (1987). A novel rapid assay for chloramphenicol acetyltransferase gene expression. BioTechniques 5, 444-448. Nissen, M.S. and Friesen, P.D. (1989). Molecular analysis of the transcriptional regulatory region of an early baculovirus gene. J. Virol. 63, 493-503. Ooi, B.G. and Miller, L.K. (1988). Regulation of host RNA levels during baculovirus infection. Virology 166, 515-23. Ooi, B.G., Rankin, C. and Miller, L.K. (1989). Downstream sequences augment transcription from the essential initiation site of a baculovirus polyhedrin gene. J. Mol. Biol. 210, 721-36. Oomens, A.G., Monsma, S.A. and Blissard, G.W. (1995). The baculovirus GP64 envelope fusion protein: synthesis, oligomerization, and processing. Virology 209, 592-603. Oppenheimer, D.I. and Volkman, L.E. (1997). Evidence for rolling circle replication of Autographa californica M nucleopolyhedrovirus genomic DNA. Arch. Virol. 142, 2107-13. O'Shea, E.K., Rutkowski, R. and Kim, P.S. (1992). Mechanism of specificity in the Fos-Jun oncoprotein heterdimer. Cell 68, 699-708. Passarelli, A.L. and Miller, L.K. (1993). Three baculovirus genes involved in late and very late gene expression: ie-1, ie-n, and lef-2. Virol. 67, 2149-58. Passarelli, A.L., Todd, J.W. and Miller, L.K. (1994). A baculovirus gene involved in late gene expression predicts a large polypeptide with a conserved motif of RNA polymerases. J. Virol. 68,4673-8. Pearson, M., Bjornson, R., Pearson, G. and Rohrmann, G. (1992). The Autographa californica baculovirus genome: Evidence for multiple replication origins. Sconce 257, 1382-1384. Pearson, M.N., Bjornson, R.M., Ahrens, C. and Rohrmann, G.F. (1993). Identification and characterization of a putative origin of DNA replication in the genome of a baculovirus pathogenic for Orgyia pseudotsugata. Virology 197, 715-725. Pearson, M.N. and Rohrmann, G.F. (1995). Lymantria dispar nuclear polyhedrosis virus homologous regions: characterization of their ability to function as replication origins. J. Virol. 69,213-21. 182 Pearson, M.N., Russell, R.L.Q., Rohrmann, G.F. and Beaudreau, G.S. (1988). p39, a major baculovirus structural protein: Immunocytochemical characterization and genetic location. Virology 167, 407-413. Prikhod'ko, E.A. and Miller, L.K. (1996). Induction of apoptosis by baculovirus transactivator IEl.J . Virol. 70,7116-24. Prikhod'ko, E.A. and Miller, L.K. (1998). Role of baculovirus IE2 and its RING finger in cell cycle arrest. J. Virol. 72, 684-92. Pullen, S.S. and Friesen, P.D. (1995a). The CAGT motif functions as an initiator element during early transcription of the baculovirus transregulator ie-1. J. Virol. 69, 3575-83. Pullen, S.S. and Friesen, P.D. (1995b). Early transcription of the ie-1 transregulator gene of Autographa californica nuclear polyhedrosis virus is regulated by DNA sequences within its 5' noncoding leader region. J. Virol. 69, 156-165. Quant, R.L., Pearson, M.N., Rohrmann, G.F. and Beaudreau, G.S. (1984). Production of polyhedrin monoclonal antibodies for distinguishing two Orgyia pseudotsugata baculoviruses. Appl. Environ. Microbiol. 48, 732-736. Quant-Russell, R.L., Pearson, M.N., Rohrmann, G.F. and Beaudreau, G.S. (1987). Characterization of baculovirus plO synthesis using monoclonal antibodies. Virology 160, 9-19. Raghow, R. and Grace, T.D.C. (1974). Studies on a nuclear polyhedrosis virus in Bombyx mori cells in vitro. J. Ultrastruct. Res. 47, 384-399. Rankin, C , Ooi, B.G. and Miller, L.K. (1988). Eight base pairs encompassing the transcriptional start point are the major determinant for baculovirus polyhedrin gene expression. Gene 70, 39-49. Rapp, J.C, Wilson, J.A. and Miller, L.K. (1998). Nineteen baculovirus open reading frames, including LEF-12, support late gene expression. J. Virol. 72, 10197-10206. Rasmussen, C , Leisy, D.J., Ho, P.S. and Rohrmann, G.F. (1996). Structure-function analysis of the Autographa californica multinucleocapsid nuclear polyhedrosis virus homologous region palindromes. Virology 224,235-45. Ribeiro, B.M., Hutchinson, K. and Miller, L.K. (1994). A mutant baculovirus with a temperature-sensitive IE-1 transregulatory protein. J. Virol. 68, 1075-84. Rice, W.C and Miller, L.K. (1986). Baculovirus transcription in the presence of inhibitors and in nonpermissive Drosophila cells. Virus Res. 6, 155-172. 183 Rodems, S.M. and Friesen, P.D. (1995). Transcriptional enhancer activity of hr5 requires dual-palindrome half sites that mediate binding of a dimeric form of the baculovirus transregulator IE1. J. Virol. 69, 5368-75. Rohrmann, G.F. (1986). Polyhedrin structure.' J. Gen. Virol. 67, 1499-513. Rohrmann, G.F., Martignoni, M.E. and Beaudreau, G.S. (1978). Quantification of two viruses in technical preparations of Orgyia pseudotsugata baculovirus by means of buoyant density centrifugation of viral deoxyribonucleic acid. Appl. Environ. Microbiol. 35, 690-3. Rost, B., Casadio, R., Fariselli, P. and Sander, C. (1995). Prediction of helical transmembrane segments at 95% accuracy. Protein Science 4, 521-533. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989). "Molecular Cloning: A laboratory manual." 2nd ed. 3 vols. Cold Spring Harbor Press, Cold Spring Harbor. SAS. (1990). " SAS User's guide: statistics." SAS Institute, Cary, N.C. Shapira, S.K., Chou, J., Richaud, F.V. and Casadaban, M.J. (1983). New versatile plasmid vectors for expression of hybrid proteins coded by a cloned gene fused to lacZ gene sequences encoding an enzymatically active carboxy-terminal portion of B-galactosidase. Gene 25, 71-82. Shepherd, R.F., Otvos, I.S., Chorney, R.J. and Cunningham, J.C. (1984). Pest management of Douglas-fir tussock moth (Lepidoptera, Lymantriidae): Prevention of an outbreak through early treatment with a nuclear polyhedrosis virus by ground and aerial applications. Can. Entomol. 116,1533-1542. Skeiky, Y.A.W. and Iatrou, K. (1991). Synergistic interactions of silkmoth chorion promoter-binding factors. Mol. Cell Biol. 11, 1954-1964. Slack, J.M. and Blissard, G.W. (1997). Identification of two independent transcriptional activation domains in the Autographa californica multicapsid nuclear polyhedrosis virus IE1 protein. J. Virol. 71, 9579-87. Slack, J.M., Kuzio, J. and Faulkner, P. (1995). Characterization of v-cath, a cathepsin L-like proteinase expressed by the baculovirus Autographa californica multiple nuclear polyhedrosis virus. J. Gen. Virol. 76, 1091-8. Smith, D.B. and Johnson, K.S. (1988). Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene 67, 31-40. Smith, G.E., Fraser, M.J. and Summers, M.D. (1983). Molecular engineering of the Autographa californica nuclear polyhedrosis virus genome: Deletion mutations within the polyhedrin gene. J. Virol. 46, 584-593. 184 Summers, M.D. (1971). Electron microscopic observations on granulosis virus entry, uncoating and replication processes during infection of the midgut cells of Trichoplusia ni. J. Ultrastruc. Res. 28, 462-480. Summers, M.D. and Smith, G.E. (1987). "A manual of methods for baculovirus vectors and insect cell culture procedures." Department of Entomology, Texas Agricultural Experiment Station, Bulletin no. 1555. Texas A & M University, College Station. Summers, M.D. and Volkman, L.E. (1976). Comparison of biophysical and morphological properties of occluded and extracellular nonoccluded baculovirus from in vivo and in vitro host systems. J. Virol. 17, 962-72. Teakle, R.E., Jensen, J.M. and Giles, J.E. (1986). Age-related susceptibility of Heliothis punctiger to a commercial formulation of nuclear polyhedrosis virus. J. Invertebr. Pathol. 47, 82-92. Theilmann, D.A., Chantler, J.K., Stweart, S., Flipsen, H.T., Vlak, J.M. and Crook, N.E. (1996). Characterization of a highly conserved baculovirus structural protein that is specific for occlusion-derived virions. Virology 218, 148-58. Theilmann, D.A. and Stewart, S. (1991). Identification and characterization of the IE-1 gene of Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus. Virology 180, 492-508. Theilmann, D.A. and Stewart, S. (1992a). Molecular analysis of the trans-activating IE-2 gene of Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus. Virology 187, 84-96. Theilmann, D.A. and Stewart, S. (1992b). Tandemly repeated sequence at the 3' end of the IE-2 gene of the baculovirus Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus is an enhancer element. Virology 187, 97-106. Theilmann, D.A. and Stewart, S. (1993). Analysis of the Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus trans-activators IE-1 and IE-2 using monoclonal antibodies. J . Gen. Virol. 74, 1819-26. Thiem, S.M. (1997). Prospects for altering host range for baculovirus bioinsecticides. Curr. Op. Biotech. 8, 317-22. Thiem, S.M., Du, X., Quentin, M.E. and Berner, M.M. (1996). Identification of baculovirus gene that promotes Autographa californica nuclear polyhedrosis virus replication in a nonpermissive insect cell line. J. Virol. 70, 2221-9. Thiem, S.M. and Miller, L.K. (1989). A baculovirus gene with a novel transcription pattern encodes a polypeptide with a zinc finger and a leucine zipper. J. Virol. 63, 4489-97. 185 Todd, J.W., Passarelli, A.L., Lu, A. and Miller, L.K. (1996). Factors regulating baculovirus late and very late gene expression in transient-expression assays. J. Virol. 70, 2307-17. Toneguzzo, F., Glynn, S., Leci, E., Mijolsness, S. and Hayday, A. (1988). Use of a chemically modified T7 polymerase for manual and automated sequencing of supercoiled DNA. BioTechniques 6, 460-469. Turpen, H.P. and Griffith, O.M. (1986). Rapid isolation of RNA by a guanidinium isocyanate cesium chloride gradient method. BioTechniques 4, 11-15. Van Oers, M.M., Malarme, D., Jore, J.M.P. and Vlak, J.M. (1992). Expression of the Autographa californica nuclear polyhedrosis virus plO gene: Effect of polyhedrin gene expression. Arch. Virol. 123, 1-11. Vlak, J.M., Smith, G.E. and Summers, M.D. (1981). Hybridization selection and in vitro translation of Autographa californica nuclear polyhedrosis virus mRNA. J. Virol. 40, 762-771. Volkman, L.E. and Goldsmith, P A . (1985). Mechanism of neutralization of budded Autographa californica nuclear polyhedrosis virus by a monoclonal antibody: Inhibition of entry by adsorptive endocytosis. Virology 143, 185-195. Wang, P., Hammer, D A . and Granados, R.R. (1997). Binding and fusion of Autographa californica nucleopolyhedrovirus to cultured insect cells. J. Gen. Virol. 70, 187-202. Wang, X. and Kelly, D.C. (1983). Baculovirus replication: Purification and identification of the Trichoplusia ni nuclear polyhedrosis virus-induced DNA polymerase. J. Gen. Virol. 64, 2229-2236. Whitford, M. , Stewart, S., Kuzio, J. and Faulkner, P. (1989). Identification and sequence analysis of a gene encoding gp67, an abundant envelope glycoprotein of the baculovirus Autographa californica nuclear polyhedrosis virus. J. Virol. 63, 1393-1399. Whittaker, G.R. and Helenius, A. (1998). Nuclear import and export of viruses and virus genomes. Virology 246, 1-23. Wilson, M.E. and Miller, L.K. (1986). Changes in the nucleoprotein complexes of a baculovirus DNA during infection. Virology 151, 315-28. Wood, H A . and Granados, R.R. (1991). Genetically engineered baculoviruses as agents for pest control. Ann. Rev. Microbiol. 45, 69-87. Wu, J., Daugulis, A.J., Faulkner, P. and Goosen, M.F.A. (1992). Correlation of LDH activity with loss of insect cell viability: an assessment of LDH assay. Biotechnology Techniques 6, 335-3340. 186 Wu, X., Stewart, S. and Theilmann, D.A. (1993a). Alternative transcriptional initiation as a novel mechanism for regulating expression of a baculovirus trans activator. J. Virol. 67, 5833-5842. Wu, X., Stewart, S. and Theilmann, D.A. (1993b). Characterization of an early gene coding for a highly basic 8.9K protein from the Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus. Gen. Virol. 74, 1591-8. Xie, W.D., Arif, B., Dobos, P. and Krell, P.J. (1995). Identification and analysis of a putative origin of DNA replication in the Choristoneura fumiferana multinucleocapsid nuclear polyhedrosis virus genome. Virology 209, 409-19. Xu, B., Yoo, S. and Guarino, L.A. (1995). Differential transcription of baculovirus late and very late promoters: Fractionation of nuclear extracts by phosphocellulose chromatography. J. Virol. 69, 2912-2917. Yang, C.L., Stetler, D.A. and Weaver, R.F. (1991). Structural comparison of the Autographa californica nuclear polyhedrosis virus-induced RNA polymerase and the three nuclear RNA polymerases from the host, Spodoptera frugiperda. Virus Res. 20, 251-264. Yoo, S. and Guarino, L.A. (1994a). The Autographa californica nuclear polyhedrosis virus ie2 gene encodes a transcriptional regulator. Virology 202, 746-753. Yoo, S. and Guarino, L.A. (1994b). Functional dissection of the IE2 gene product of the baculovirus Autographa californica nuclear polyhedrosis virus. Virology 202, 164-172. 187 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0089290/manifest

Comment

Related Items