Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Identification and the relationship between mutations in the lipoprotein lipase gene, dyslipidemia and… Gagné, S. Eric 1999

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1999-388891.pdf [ 8.59MB ]
Metadata
JSON: 831-1.0089229.json
JSON-LD: 831-1.0089229-ld.json
RDF/XML (Pretty): 831-1.0089229-rdf.xml
RDF/JSON: 831-1.0089229-rdf.json
Turtle: 831-1.0089229-turtle.txt
N-Triples: 831-1.0089229-rdf-ntriples.txt
Original Record: 831-1.0089229-source.json
Full Text
831-1.0089229-fulltext.txt
Citation
831-1.0089229.ris

Full Text

IDENTIFICATION A N D THE RELATIONSHIP BETWEEN MUTATIONS IN THE LIPOPROTEIN LIPASE GENE, DYSLIPIDEMIA AND C O R O N A R Y HEART DISEASE By S. E R I C G A G N E B.Sc Universite Laval, 1986; M.Sc. Universite Laval, 1990 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY In THE F A C U L T Y OF G R A D U A T E STUDIES (Medical Genetics ..Graduate Program; Department of Medical Genetics) We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA October 1998 © S. Eric Gagne , \<\% In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of \ V Alli!V C X The University of British Columbia Vancouver, Canada DE-6 (2/88) ABSTRACT Lipoprotein lipase (LPL) is a critical enzyme which primary function is to hydrolyze triglycerides from triglyceride-rich particles in the circulation. LPL deficiency is a rare disease with a frequency of approximately 1 per million individuals. Affected individuals present with chylomicronemia and often develop pancreatitis, xanthomatas and hepatosplenomegaly. Heterozygote carriers of a LPL null allele are present in the population at approximately 1 per 500 individuals worldwide and manifest with reduced HDL-C, reduced apoA-I and increased V L D L and VLDL-triglycerides. The central role that LPL plays in plasma lipid homeostasis suggests that LPL may represent an important susceptibility gene for coronary heart disease through modulation of HDL-C and triglyceride levels. This hypothesis has remained largely untested given the difficulty of collecting large number of affected individuals. We postulated that the LPL gene might underlie common mutations in the population which may modulate plasma lipids and the risk for coronary heart disease. For this, we screened a group of 31 French Canadian patients with familial combined hyperlipidemia (FCHL) and a group of 120 coronary artery disease (CAD) male patients with low LPL activity for mutations in the LPL gene. Our results indicate that while no mutation in the LPL gene could account for a significant proportion of FCHL patients, three (3) mutations (D9N, N291S and S447*) were found at relatively high frequency (4.6%, 5.4% and 18.5% respectively) in the entire cohort of C A D patients (820 patients; REGRESS Study). In vitro characterization of these three ii mutations using in vitro mutagenesis and transient expression in COS-1 cells indicates that all three mutations lead to impaired secretion and/or impaired function of the protein, providing evidence of the functionality of these variants. In the REGRESS cohort, the D9N and N291S mutations were associated with decreased HDL-C. In contrast, the S447* mutation was associated with an increased HDL-C level and decreased triglyceride level. In addition, in a two-year follow-up of the REGRESS Study, carriers of the D9N allele showed increased progression of atherosclerosis compared to non-carriers. To further assess the impact of these variants at the population level, 2258 DNA specimens (1114 men and 1144 women) of the Framingham Offspring Study were analyzed for the three LPL mutations (D9N, N291S and S447*). Our result show that these LPL variants are associated with differences in HDL-C and triglyceride levels in men in the general population with the D9N and N291S mutation being associated with lower HDL-C and higher triglycerides. In contrast, the S447* allele is associated with higher HDL-C, lower triglycerides and confers significant protection against coronary heart disease in men. Together, our results present strong evidence that common variants in the LPL gene are significant modulators of plasma lipid concentration and risk for coronary heart disease in men in the general population. iii Table of Contents Abstract ii Table of content iv List of Tables vii List of Figures ix List if abbreviations x Acknowledgements xii CHAPTER I 1 1. INTRODUCTION 1 1.1 CIRCULATION 1 1.1.1 Evolution 1 1.2 CARDIOVASCULAR DISEASE 1 1.2.1 General 1 1.2.2 Economic impact of C V D , CHD and atherosclerosis 4 1.2.3 Atherosclerosis 5 1.3 LIPID A N D LIPOPROTEIN M E T A B O L I S M 8 1.3.1 Lipids 8 1.3.2 Lipoproteins 10 1.4 DYSLIPIDEMIA A N D ATHEROSCLEROSIS 15 1.5 LIPOPROTEIN LIPASE 18 1.5.1 Overview 18 1.5.2 Gene and protein structure 23 1.5.3 Genetics 27 1.6 THESIS RATIONALE '. 37 CHAPTER II. 40 2. F A M I L A L COMBINED H Y P E R L I P E M I A 40 2.1 INTRODUCTION: 42 2.2 METHODOLOGY 44 2.2.1 Subjects: 44 2.2.2 Analysis of the LPL gene: 44 2.2.3 In vitro mutagenesis and expression studies: 46 2.2.4 DNA analysis in controls: 47 2.2.5 Measurements of LPL activity and mass: : 48 2.3 RESULTS: 50 2.3.1 DNA changes in the LPL gene: Exonic polymorphisms 50 2.3.2 Amino acid substitutions: 54 2.3.3 Effect of the newly identified amino acid substitutions in the LPL gene on catalytic function of LPL: 59 2.3.4 Population and segregation studies 60 2.4 DISCUSSION: 63 CHAPTER III 67 3. RELATIONSHIP BETWEEN LPL ACTIVITY, LPL MUTATIONS AND CORONARY A R T E R Y DISEASE 67 3.1 INTRODUCTION 70 3.2 METHODOLOGY 72 3.2.1 Patients 72 3.2.2 Quantitative Coronary Arteriography (QCA) 72 iv 3.2.3 Lipid and lipoprotein analysis 73 3.2.4 Denaturing Gradient Gel Electrophoresis (DGGE) 74 3.2.5 SSCP analysis 75 3.2.6 Sequencing 75 3.2.7 Variant analysis 75 3.2.8 Post heparin LPL activity and mass 76 3.2.9 Statistical analysis 77 3.3 RESULTS 80 3.3.1 Mutation analysis 80 3.3.2 N291S mutation 83 3.3.3 D9N mutation 89 3.3.4 S447* mutation 93 3.3.5 Effect of LPL activity on lipids and severity of coronary artery disease 97 3.4 DISCUSSION 101 CHAPTER IV 108 4. INVITRO CHARACTERIZATION OF C O M M O N LPL MUTATIONS 108 4.1 INTRODUCTION 110 4.2 METHODOLOGY 113 4.2.1 In vitro Site-Directed Mutagenesis and LPL cDN A Expression Vectors 113 4.2.2 Isolation and purification of expression constructs 113 4.2.3 Transient Expression of LPL Constructs 114 4.2.4 Measurements of LPL Mass and Catalytic Activity 115 4.3 RESULTS 117 4.3.1 Comparison of transfection methodologies 117 4.3.2 Comparison of different DNA preparations 118 4.3.3 Peak secretion rates of LPL 118 4.3.4 The effect of DNA dose on the expression of LPL 118 4.3.5 The effect of heparin concentration on the secretion of LPL 122 4.3.6 Measurement of LPL mass and catalytic activities of the variants in COS media 124 4.3.7 Stability of LPL sequence variants 125 4.3.8 Determination of homodimer specific activity 126 4.3.9 Relative binding affinity of LPL variants to cell membrane proteoglycans 126 4.4 DISCUSSION 131 CHAPTER V. 136 5. EFFECT OF C O M M O N LPL MUTATION ON P L A S M A LIPID AND RISK FOR CORONARY HEART DISEASE: THE F R A M I N G H A M OFFSPRING STUDY 136 5.1 INTRODUCTION '. 138 5.2 METHODOLOGY 141 5.2.1 Population 141 5.2.2 Lipid Analysis 142 5.2.3 DNA analysis 142 5.2.4 Statistics 143 5.3 RESULTS 146 5.3.1 Demographic 146 5.3.2 Frequency of LPL variants 146 5.3.3 Effect of the LPL genotype on plasma lipids 147 5.3.4 LPL genotype and risk of CHD 151 5.4 DISCUSSION 155 CHAPTER VI 160 v GENERAL DISCUSSION BIBLIOGRAPHY List of Tables Table 1-1 Reported mutations in the LPL gene 29 Table 2-1 Summary of Clinical Data on 31 FCHL Patients 51 Table 2-2 Number and Nature of DNA changes in 31 Patients with FCHL 52 Table 2-3 Exonic polymorphisms in the LPL gene in FCHL patients 52 Table 2-4 Exonic changes resulting in amino acid substitutions in patients with FCHL 56 Table 2-5 LPL Activity, Mass and Specific activity in COS1 Cell Medium 60 Table 3-1 List of primers for DDGE analysis 79 Table 3-2 Amino acid substitution in the LPL gene 82 Table 3.-3 Other changes in the LPL gene of 120 C A D patients with low LPL activity (<77 mU/ml) 82 Table 3-4 Baseline characteristics of patients with and without the N291S mutation 86 Table 3-5 Baseline lipid values in individuals with and without the N291S mutation not treated with p-blockers 87 Table 3-6 Baseline lipase activity in C A D patients not on P-blockers 89 Table 3-7 Baseline characteristics of patients with and without the D9N mutation 92 Table 3-8 Changes in lipid levels in patient with and without the D9N mutation 93 Table 3-9 Changes of angiographic parameters and clinical events in patients with and without the D9N mutation 93 Table 3-10 Baseline characteristics of patients with and without the S447* mutation 95 Table 3-11 Mean LPL and HDL-C levels among non-p-blocker users 96 Table 3-12 Lipoprotein lipase activity and plasma lipid levels 99 Table 3-13 Effect of lipoprotein lipase activity on the extent of C A D and angina pectoris 100 Table 4-1 Summary of published transfection results for the three common LPL variants 112 Table 4-2 Comparison of COS cell transfection efficiencies using DNA prepared by double CsCl and alkaline lysis methods 119 Table 4-3 The effect of heparin concentration on the expression of LPL in COS-1 cell media 123 Table 4-4 LPL mass production and activity from wild type and LPL variants in transfected COS-1 cell media 127 Table 4-5 Homodimer specific activity of LPL released from the transfected cells at 4°C by 5 U/ml heparin 130 Table 4-6 Relative binding affinity of LPL variant to COS cell proteoglycans 130 vii Table 5-1 Demographic and biochemical characteristics 147 Table 5-2 Carrier frequency of LPL polymorphisms in Framingham Offspring Study 148 Table 5-3 Effect of LPL genotype on plasma lipids by gender 149 Table 5-4 LPL genotype, lipid values and menopause 150 Table 5-5 Odds ratio (OR),attributable risk (AR) and preventive fraction (PF) for specific lipid abnormalities 153 Table 5-6 Odds ratio(OR) and preventive fraction (PF) for Coronary Heart Disease 154 viii List of figures Number Page Figure 1-1 Leading causes of death in Canada 2 Figure 1-2 Death rate from cardiovascular diseases in selected countries 3 Figure 2-1 Single-strand conformation polymorphism analysis of PCR-amplified exon 2 53 Figure 2-2 Nucleotide sequence of a substitution at codon 21 and cross species comparison 57 Figure 2-3 Nucleotide sequence of a substitution at codon 44 and cross species comparison 58 Figure 2-4 Pedigree of families with FCHL 62 Figure 3-1 Diagram showing the mean segment diameter (MSD) and minimum obstruction diameter (MOD).73 Figure 3-2 Frequency of LPL N29 IS mutation in relation to HDL levels 88 Figure 3-3 Frequency of LPL D9N mutation in relation to HDL levels 92 Figure 3-4 Frequency of LPL S447* mutation in relation to HDL levels 96 Figure 4-1 Optimization of the collection period for maximal LPL secretion . 120 Figure 4-2. Optimization of the expression phagemid concentration 121 Figure 4-3 Stability study of LPL variant 129 ix List of abbreviations apo(a): apolipoprotein little a apoA-I; apolipoprotein A-I apoA-II; apolipoprotein A-II apoA-IV; apolipoprotein A-IV apoB; apolipoprotein B apoB-100; apolipoprotein B-100 apoB-48: apolipoprotein B-48 apoC-I; apolipoprotein C-I apoC-II; apolipoprotein C-II apoC-III; apolipoprotein C-III apoE; apolipoprotein E AR; attributable risk C A D ; coronary artery disease CETP; cholesterol ester transfer protein CHD; coronary heart disease CVD; cardiovascular disease DGGE: density gradient gel electrophoresis DNA; deoxyribonucleic acid EGF; epidermal growth factor FCHL; familial combined hyperlipidemia FGF; fibroblast growth factor HDL; high density lipoprotein HDL-C; high density lipoprotein cholesterol HL; hepatic lipase IDL; intermediate density lipoprotein LCAT; lecithinxholesterol acyltransferase LDL; low density lipoprotein LDL-C; low density lipoprotein cholesterol LDLr; low density lipoprotein receptor Lp(a); lipoprotein particle (a) LPL; lipoprotein lipase LRP; low-density lipoprotein receptor related protein/a2-macroglobulin receptor mRNA; messenger ribonucleic acid N Y H A : New York Heart Association OR; Odds ratio PCR; polymerase chain reaction PDGF; platelet derived growth factor PF; preventive fraction PL; pancreatic lipase PVD; peripheral vascular disease x REGRESS study; Regression Growth Evaluation Statin Study SSCP: single strand conformation polymorphism TC; total cholesterol TG; triglycerides TGF; tumor growth factor UTR; untranslated region V L D L ; very low density lipoprotein V L D L - C ; very low density lipoprotein cholesterol VLDLr; very low density lipoprotein receptor xi ACKNOWLEDGMENTS I would like to acknowledge the support of many individuals who have contributed in a variety of ways to the work described in this thesis. In particular, I would like to thank my supervisor, Dr. Michael Hayden, for taking the risk of letting me join his group, for his inspiration and his continuous support throughout my degree. I would also like to thank the members of my thesis committee, Dr. Lome Clarke, Dr. Frederick Dill , Dr. Jan Friedman, Dr. Jiri Frolich and Dr. Sylvie Langlois for their constructive criticism and input during the entire program. Along the way, I also established some very special friendships which have made those years an unforgettable experience. In particular, I would like to thank David Ginzinger, Graeme Hodgson, Susan Andrew, Dave Spear, Ryan Brinkman, Christopher Duva, Tom Kornecook, Simon Pimstone, Hanfang Zhang, Robin Ma, Bernhard Weber, Paul Guerette, Michael Kalchman and Kerry Nichol. I would also like to thank L i Miao, Nagat Bissadat, Suzie Clee, Kate Ashbourne, Suzan Lewis, Elizabeth Almquist, Rona Graham, Jane Theilman and Kathy Kalvinou for providing insightful suggestions and help when necessary; the personnel of the Framingham Heart Study, Dr. Peter Wilson, Dr. Jose Ordovas, Dr. Marty Larson, Dr. Jacques Genest Jr. and Dr. John Kastelein and his group for their valued contribution to many of the studies described in this thesis. Finally I would like to thank my parents and family, Serge, Gaetane, Natalie, Marlene, Nicolas, Jean-Philippe for believing in me and last but not least, Margaret Mckinnon for her love, her support and her patience. The funding for this work was provided in part as a scholarship from the Heart and Stroke Foundation of BC and Yukon. xii Chapter I Chapter I 1. INTRODUCTION 1.1 Circulation 1.1.1 Evolution The cardiovascular system has evolved as an adaptation of higher forms of animal life in response to the increasing complexity of their bodies. While unicellular organisms can readily exchange gas, nutrients and waste with their surrounding medium for their proper function, multicellular organisms in which the various functions of the organism are performed by groups of specialized cells, are confronted with the unique problem of supplying each cell with these vital elements. In humans as in all vertebrates, a closed circulatory system bounded by an endothelium has emerged as an efficient way to fulfill this dual role of supplying nutrients and removing harmful waste products from one part of the body to another. The primary role of the cardiovascular system is therefore to ensure at every moment the survival of all cells of the body. 1.2 Cardiovascular disease 1.2.1 General Diseases of the cardiovascular system are the leading cause of death worldwide accounting for approximately 38% of all deaths (Figure 1-1). In Canada, cancer ranks second with 28% of all deaths. On this basis, it has been estimated that if all major forms of cardiovascular 1 Chapter I diseases were eliminated, life expectancy would rise by almost 10 years. If all forms of cancer were eliminated, the gain in life expectancy would be only 3 years (American Heart Association, 1996). The rate of cardiovascular disease (CVD) varies considerably between countries with Canada's rate being in the middle range (Figure 1-2). Factors such as genetic predisposition, diet and lack of physical exercise may account for this international difference in cardiovascular disease. Socioeconomic factors have also been reported to play an important role in this difference (Marmot, 1992). Cardiovascular disease can be divided into many categories. Without doubt, the largest contributor to cardiovascular diseases is coronary heart disease (CHD) which accounts for 58% of all cardiovascular diseases and 22% of all deaths (Figure 1-1). Figure 1-1 Leading causes of death, Canada 1992 (Heart and Stroke Foundation of Canada, 1995) Other C V D Cancer 2 Chapter I Coronary heart disease is almost always the consequence of atherosclerosis, a disease of the medium and large arteries which results from the response to various forms of insult to the endothelium and smooth muscles of the artery wall (Ross, 1993). Atherosclerosis is also the principal cause of stroke and peripheral vascular disease. 1 6 0 0 1 4 0 0 1 2 0 0 1 0 0 0 8 0 0 6 0 0 4 0 0 2 0 0 0 2 0 0 4 0 0 6 0 0 8 0 0 Russian Federation Romania (92) Poland Argentina (91) Scotland Finland EnglandAVales United States (93) Germany Denmark (93) China-Urban Israel (93) Netherlands Greece Australia (93) Canada (93) Italy (92) Spain (92) Mexico (93) France(93) Japan Rate per 100,000 population Fi gure 1-2 Death rate from cardiovascular diseases in selected countries, 1994 (or most recent year available) (American Heart Association, 1996) Although the exact pathogenesis of atherosclerosis still remains to be elucidated, it is now known that this process is influenced by a complex interplay of both genetic and environmental factors. The identification of these factors, called "risk factors", has been a g M E N • W O M E N Chapter I major focus of medical research over the past 50 years. Large epidemiological studies have demonstrated that a high fat diet, smoking, hyperlipidemia, diabetes and lack of exercise represent major risk factors in the population. The benefits of such research have already been felt. Since the mid-60s, CHD death rates have been declining steadily in Canada. The 1992 death rates are almost half of those that prevailed in 1969. It has been estimated that 54 % of the decline in CHD mortality is attributed to changes in life style, including a reduction in the prevalence of smoking, consumption of dietary fat and increased levels of exercise in the population. Similar trends have been observed in the United States. Between 1960 and 1991, the average plasma cholesterol decreased from 5.7mmol/L (220mg/dL) to 5.3mmol/L (205mg/dL) in Americans aged 20 to 74 (Johnson et al., 1993) and smoking decreased by 37% (American Heart Association, 1996). These changes have coincided with national risk reduction efforts beginning in the 1960s against the known major risk factors of CHD. 1.2.2 Economic impact of C V D , CHD and atherosclerosis The high morbidity and mortality invariably associated with C V D comes at a high cost for developed countries. In Canada, C V D was the most expensive disease category in 1993, accounting for nearly $8.3 billion or 16% of the total direct cost of illnesses ($52 billion). C V D research accounted for 0.8% ($65 million) of the total direct cost of illnesses. Other costs include the loss of productivity due to illness or disability, and the loss of future 4 Chapter I earnings due to premature death. While the numbers for these costs are not currently available for Canada, the United States estimate of such indirect costs if applicable at a similar level in Canada, could raise the total cost by approximately 40%. The cost for CHD itself is estimated at approximately 35% of the total cost for CVD. Stroke represents an additional 16% of that cost. While strokes may be caused by many factors, atherosclerosis is by far the most common cause, accounting for 70% of all strokes. As such, atherosclerosis represents the largest single contributor, accounting for nearly 50% of the cost of CVD. 1.2.3 Atherosclerosis Atherosclerosis is the process by which blood vessels, mainly large or medium sized arteries, become gradually occluded as the result of growth of atherosclerotic plaques. Lesions tend to form at the branch point of arterial blood vessels. They form by an asymmetrical thickening of the intima, which gradually reduces lumen size and blood flow. The mature plaque consists of two main components: a soft, lipid-rich core and a hard, collagen-rich sclerotic tissue. On average, the plaque consist of over 70% sclerotic tissue. The sclerotic tissue, although participating in reducing blood flow, is generally perceived as a stabilizing component, protecting the plaque against disruption. In contrast, the inner lipid rich core destabilizes the plaques, making them vulnerable to rupture, thereby exposing 5 Chapter I thrombogenic material to flowing blood and increasing the risk of thrombosis that ultimately leads to infarction. In the 19 th Century, two theories were put forward to explain the process of atherosclerosis. The first hypothesis by Von Rokitansky (Von Rokitansky, 1852) and entitled the "incrustation hypothesis" suggested that the arterial wall was the site of lipid accumulation subsequent to fibrin deposition and fibroblast infiltration. The second hypothesis by Virchow (Virchow, 1861) and entitled " the lipid hypothesis" described the atherosclerotic lesion as an inflammatory process resulting in the degeneration of the connective tissue of the arterial wall thereby creating a favorable environment for lipid infiltration. In 1973, these two hypotheses were integrated into the "response to injury hypothesis" developed by Russell Ross of the University of Washington (Ross and Glomset, 1973). The revised "response to injury hypothesis" (Ross, 1993), the prevalent view of the atherosclerotic process today, suggests that the atherosclerotic plaque is the result of an excessive fibroproliferative response to numerous forms of injury to the endothelium and smooth muscle of the arterial wall. The process of vascular injury may not require endothelial denudation but more likely invokes subtle changes of the endothelium such as alteration in endothelial permeability, capacity to bind leukocytes and release of vasoactive substances. Various factors have been identified as potential sources of vascular injury. In spontaneous atherosclerosis models, for example (Ip et al., 1990), mechanical forces such as disturbances 6 Chapter I in blood flow in certain parts of the vascular tree can lead to chronic minimal injury, which can be potentiated by hyperlipidemia, oxidative stress, immune reaction, infections and chemical irritants such as tobacco smoke. In addition, variability in endothelial susceptibility to these factors can contribute in determining the severity of the damage sustained by the endothelium (Fuster et al., 1992). Macrophages are present at every step of the atherosclerotic process. Circulating monocytes are attracted to the site of injury and migrate into the intima as a result of chemoattractant release by the surrounding damaged endothelium and underlying smooth muscle cells. Once established in the intima, monocytes differentiate into macrophages capable of accumulating lipids. Lipids appear to play a critical role in this process. Lipid loaded macrophages become foam cells. Accumulation of these cells in the intima of the vessel wall leads to the formation of fatty streaks, the earliest macroscopic lesion. The presence of macrophages and foam cells in the intima has serious consequences on the progression of the lesion. Macrophages can oxidize LDL and release peroxides thereby contributing to further vascular injury. In addition, activated macrophages can synthesize and secrete potent mitogens for smooth muscle cells such as PDGF, FGF, EGF-like factors and TGF-(3 . Stimulated smooth muscle cells are actively involved in synthesis and secretion of extracellular matrix components such as collagen, elastic fibers and several types of 7 Chapter I proteoglycans. Smooth muscle cells can also participate in the enlargement of the lesion by autocrine stimulation. Injury to the vascular endothelium is an ubiquitous process. This is best illustrated by the presence of isolated foam cells in the intima of infants up to eight months of age and the presence of fatty streaks in the coronary artery of half of the autopsy specimens of children age 10 to 14 (Stary, 1989). It is therefore postulated that atherosclerosis may not be a disease in itself but rather a protective response to damage to the endothelium and smooth muscle cells of the artery wall. However when it is found to be excessive and chronic, this response leads to arterial occlusion and coronary heart disease. The concept that lipids may play a important role in this inflammatory response was first proposed by Virchow in the XIX century based on his observation of lipid deposition in arterial lesions. Since this initial observation, a large body of evidence has accumulated to confirm this hypothesis in such a way that today a causal relationship between atherosclerosis and lipid metabolism is universally accepted. 1.3 LIPID AND LIPOPROTEIN METABOLISM 1.3.1 Lipids Lipids are a diverse group of molecules that share the common feature of being insoluble in water. Cellular lipids can be categorized in 2 large classes; 1) fatty acid derivatives 8 Chapter I (including triglycerides, phospholipids and fatty acids) and 2) isoprenoids (which includes cholesterol and cholesterol esters). While most lipids such as triglycerides are non-polar molecules, others, such as phospholipids, are amphipathic molecules carrying both hydrophobic and hydrophilic regions. Phospholipids have the unique property of forming micelles and liposomes spontaneously in aqueous solution, a conformation which minimizes interaction with water molecules. This property has been suggested to have been critical for the development of living organisms, allowing primitive molecules to evolve in compartments isolated from the surrounding media. Lipids participate in a wide variety of functions in living organisms. Phospholipids are the principal architectural component of the plasma membrane, accounting for almost 50% of its total mass. Cholesterol is also essential for the integrity of the plasma membrane. Present in a ratio of 1:1 with phospholipids, cholesterol decreases the permeability as well as increases the stability and flexibility of the plasma membrane. In addition, cholesterol is a precursor in the synthesis of many bioactive molecules including steroids, vitamin D and bile acids. Approximately 70% of plasma cholesterol is found as cholesterol esters. Triglycerides on the other hand represent the major source of energy storage in the body. At equal mass, oxidation of fatty acids contained in triglycerides releases twice the amount of energy as glucose making fatty acids the principal source of energy of muscle cells. In 9 Chapter I addition, triglycerides can be conveniently stored in adipocytes as droplets, providing an easily accessible source of fatty acids. Although cells can synthesize most lipids essential for their survival, the energetic cost is high and unfavorable. As such, multicellular organisms have developed elaborate systems allowing the absorption of fat from ingested food and their distribution to the various tissues. In organisms equipped with a circulatory system, the role of distributing lipids to the tissues in a soluble form is accomplished via specialized particles called lipoproteins. 1.3.2 Lipoproteins Lipoproteins are complex structures containing a core of hydrophobic lipids surrounded by a layer of phospholipids, free cholesterol and amphipathic proteins called apolipoproteins. Lipoproteins are usually classified according to their density but recent methods also allow their classification according to their apolipoprotein content or size (Alaupovic, 1981). The apolipoprotein composition of the lipoproteins determines their affinity for lipids. Lipoproteins can exchange apolipoproteins between themselves and deliver lipids to the tissues. Specific plasma enzymes also participate in modulating these exchanges. This dynamic and complex process explains why the various lipoprotein pools appear and disappear rapidly from the circulation. 10 Chapter I A number of other factors also influence the metabolism of lipoproteins in the plasma. Diet rich in saturated fat, for example, will preferentially stimulate V L D L synthesis while decreasing plasma HDL levels. High carbohydrate diets, on the other hand, will preferentially affect plasma V L D L levels. In addition, sex hormones, insulin and thyroid hormone can also modulate lipoprotein synthesis and degradation through transcriptional or post-transcriptional mechanisms. 1.3.2.1 Exogenous Pathway The metabolism of lipoproteins is generally divided into three major pathways: the exogenous, the endogenous and the reverse pathways. The exogenous pathway begins with the synthesis of chylomicrons by intestinal cells following the absorption of fat from a meal. Chylomicrons are the largest lipoproteins produced measuring approximately 1000 angstroms in diameter. Their content is almost exclusively triglycerides, which represent approximately 90% of the total mass of this particle. In contrast proteins account for only 2% of the total mass of chylomicrons. Apolipoproteins, which are synthesized by the intestine, include apoA-I, apoA-IV and apoB-48, which are assembled into chylomicrons. Chylomicrons are released in the lymph where they transit before reaching the blood stream. In the process, they acquire the apolipoproteins apoC-I, apoC-II and apoC-III from HDL particles (Havel et al., 1973; Schaefer et al., 1978). Exposure of apoC-II at the surface of the chylomicron activates lipoprotein lipase, an enzyme bound to the endothelium of 11 Chapter I capillaries and responsible for the hydrolysis of triglycerides (Havel et al., 1979). During lipolysis, chylomicrons lose most of their triglycerides. The released fatty acids bind to albumin and are then taken up by the nearby tissues. Triglyceride depleted chylomicrons release phospholipids, apoA-I, apoA-IV and apoCs to the HDL particles in exchange for apoE and cholesterol esters from other lipoproteins. This change in apolipoproteins and lipid composition leads to the formation of the chylomicron remnant which is then rapidly taken up by the liver via the apoE receptor. This exogenous pathway insures that alimentary lipids are delivered to the appropriate organs (Havel and Kane, 1995). 1.3.2.2 Endogenous Pathway The endogenous pathway starts with the synthesis of very low density lipoproteins (VLDL) by the liver. These particles are both triglyceride- and cholesterol-rich, with triglycerides accounting for nearly 60% of the total mass and cholesterol ester approximately 20%. Proteins constitute approximately 10% of the total mass with apoB-100 being the central apolipoprotein of the particle. Upon secretion in the plasma, VLDLs take up apoC-II and undergo lipolysis by LPL. Upon hydrolysis, VLDLs take up apoE from HDL, a process which leads to the formation of V L D L remnants or "intermediate density lipoproteins". The fate of these remnant particles however may follow one of two paths. The V L D L remnant may either be taken up by the liver via the apoE receptor pathway or further catabolized by hepatic lipase to form LDL particles (Havel and Kane, 1995). 12 Chapter I LDL particles originate from the catabolism of V L D L particles and as such are highly enriched in cholesterol esters, which constitute about 40% of the total mass of the particles. The protein content of the particle is represented by a single apoB-100 molecule, which constitutes about 20% of the total mass. This apolipoprotein targets the lipoprotein to the L D L receptor, an ubiquitous receptor which is found in virtually every cell type, but which is found at higher levels in tissues requiring high levels of cholesterol such as the adrenals and the liver (Schaefer, 1990). Binding of the LDL particle to the LDL-receptor insures the uptake of the lipoprotein by the cells and delivery of cholesterol. Approximately 10% of LDL particles are found associated with the apolipoprotein apo(a) to form the lipoprotein Lp(a). The exact role of this particle is still unknown, but high levels of this lipoprotein have been associated with increased risk of atherosclerosis. 1.3.2.3 Reverse Pathway The reverse pathway enables the peripheral tissues to return cholesterol to the liver where it can be metabolized and excreted as bile salts. This function is performed by HDL particles which are secreted by the liver and the intestine as flattened disk-like particles that undergo maturation in the plasma (Schaefer, 1990). It has been suggested that chylomicrons undergoing lipolysis may also participate in the production of nascent HDL by releasing small vesicles with HDL properties. The maturation process results mainly in the gradual filling of the core of the nascent HDL with cholesterol from peripheral tissues. The conversion of cellular cholesterol into cholesterol ester is catalyzed by the enzyme 13 Chapter I lecithinxholesterol acyltransferase (LCAT) which is activated by apoA-I at the surface of the HDL particles. ApoA-I appears to be critical for the formation of the HDL particles since in its absence the production of HDL is markedly reduced (Schaefer et al., 1982). ApoA-I is secreted by both the intestine and the liver and can be found on the surface of HDL particles alone or in combination with apoA-II. ApoA-II is secreted by the liver but its role in lipid metabolism remains unclear. HDLs are commonly categorized according to two methods: 1) according to their density into HDL2 (density of 1.063-1.125g/ml) and HDL3 (density 1.1255-1.21 g/ml) or 2) according to their apoA content into LpAI or LpAI-AII particles (Alaupovic, 1981). Since the liver can synthesize both apoA-I and apoA-II, it is believed that LpAI-AII particles originate mostly from the liver and that most LpAI particles originate from the intestine. While LpAI particles can efficiently remove excess cholesterol from peripheral tissues, LpAI-AII particles are unable to perform this function. As such, excess LpAI-AII has been associated with increased atherosclerosis in experimental models while excess LpAI in similar models offers significant protection against the disease (Havel and Kane, 1995). HDLs are generally regarded as a reservoir for apoE and apoC lipoproteins which can be then shuffled back and forth between triglyceride rich particles and HDL. In addition, cholesterol esters from HDL particles can be readily exchanged with triglycerides from LDL 14 Chapter I and V L D L particles via cholesterol ester transfer protein (CETP) which facilitates this process. Through the action of CETP, HDL particles become triglyceride enriched. Conversely, V L D L and LDL particles become cholesterol enriched which facilitates the catabolism of these lipoproteins by their respective receptors and return of cholesterol to the liver. This reciprocal transfer of lipids between HDL and lower density lipoproteins is responsible for over 70% of the tissue efflux of cholesterol by the reverse pathway (Havel and Kane, 1995). 1.4 DYSLIPIDEMIA AND ATHEROSCLEROSIS Large prospective cohort (Castelli et al., 1986; Martin et al., 1986) and case control studies (Papadopoulos and Bedynek, 1973; Frick et al., 1978) have convincingly shown that plasma lipids and lipoproteins play a major role in the development of CHD. In particular, high levels of total cholesterol, high LDL-C and low HDL-C represent major risk factors for the development of atherosclerosis. As a result, controlling these lipid parameters form the basis of the current clinical guidelines aimed at reducing the incidence of the disease. While many studies have failed to show an association between triglycerides and coronary artery disease after correction for other risk factors (Austin, 1991), the demonstration that high triglyceride levels in combination with low HDL-C levels account for about twice as many cases of CHD as low HDL-C alone clearly point out a role for triglycerides in this relationship (Castelli, 1992). Recent studies by Alaupovic et al. (Alaupovic et al., 1997) 15 Chapter I showing that triglyceride-rich particles of the apoB family represent significant predictors of coronary artery disease progression support this hypothesis. Because approximately 80% of subjects with coronary heart disease present with abnormalities of plasma lipids (Kwiterovich et al., 1993), understanding the causes and consequences of dyslipidemia has become a major issue. At the population level, twin and adoption studies have shown the importance of genetic factors in explaining the interindividual variation in plasma lipid levels (Sing and Moll, 1989; Heller et al., 1993; Marenberg et al., 1994). Studies also suggest that monogenic disorders of lipids and lipoproteins are present in less then 10% of survivors of myocardial infarction (Goldstein et al., 1973; Hopkins and Williams, 1989; Vogel and Motulsky, 1989) thus accounting for only a small percentage of cases of CHD. Complex segregation analysis conducted in large pedigrees supports the model of a major locus modulated by other genes or environmental factors in most patient with CHD. Examples of both mechanisms already exist. The best known example of monogenic disorder is familial hypercholesterolemia. In this disorder, high levels of plasma LDL-C result from a defect in the LDL-receptor gene. Familial hypercholesterolemia is an autosomal dominant disorder with a carrier frequency of 1/500 individuals. The heterozygous form is characterized by elevation of plasma cholesterol levels at about twice the normal level and usually results in the development of 16 Chapter I CHD after 40 years of age. In the homozygous form, subjects commonly present with extreme cholesterol levels about 4 times greater than the normal level with ensuing CHD before age 20. The polygenic form of dyslipidemia is best exemplified by type III hyperlipoproteinemia, a disorder characterized by the accumulation of IDL particles which result in an increase risk for CHD and PVD. Although 1 to 2% of individuals in the general population are homozygous for a defective form of apoE (E2/E2), only 2 to 5% of E2/E2 homozygotes develop type III hyperlipoproteinemia. Further support for additional genetic factors predisposing to this form of dyslipidemia comes from the recent study by Zhang et al. reporting that, in patients carrying a defective apoE allele, mutations in the LPL gene represent one of the significant predisposing factors for the development of type III hyperlipoproteinemia (Zhang et al., 1995). A number of candidate genes involved in lipid and lipoprotein metabolism have been the subject of intense scrutiny in an effort to determine their role in the development of dyslipidemias and CHD. These efforts have culminated in the identification of a number of mutations in genes involved in lipid metabolism, such as the LDL-receptor, the apoA-I, apoB and the L C A T genes. The LPL gene represents another candidate gene which may be 17 Chapter I involved in modulating the risk for dyslipidemia and atherosclerosis. Genetic defects in the LPL gene result in altered lipid profiles which may be proatherogenic. 1.5 LIPOPROTEIN LIPASE 1.5.1 Overview Little attention was given to Dr. Paul Hahn's observation in 1943 on the elimination of alimentary lipemia in the plasma of dogs given intravenous injection of heparin (Hahn, 1943). The importance of this finding, however became apparent when, in 1950, Anderson and Fawcett suggested that this phenomenon could result from the release of a "clearing factor" in plasma (Anderson and Fawcett, 1950). The original proposal suggested that heparin released an unknown surface-active agent promoting the physical dispersion of lipids. However it was clearly demonstrated two years later that the phenomenon had all the properties of an enzymatic reaction (Anfinsen et al., 1952). The name lipoprotein lipase was coined by Korn (Korn, 1952b) to reflect the enzymatic action of this enzyme on lipids of lipoproteins. We now know that lipoprotein lipase plays a critical role in plasma lipid homeostasis and that its primary role is the hydrolysis of triglycerides from the core of triglyceride-rich lipoproteins in plasma (Brunzell, 1995). The free fatty acids released by the hydrolysis of circulating triglycerides form water soluble complexes with albumin, thereby allowing their local delivery to the tissues either as a source of energy or for fat storage (Robinson and 18 Chapter I French, 1953; Shore et al., 1953). LPL is synthesized primarily by the adipose tissue, skeletal muscle and the heart although it has been detected in a wide variety of tissues and cell types including the brain, lungs, ovaries, lactating mammary glands, stomach, placenta, arterial wall and macrophages. LPL is also expressed in the fetal liver, although the expression is extinguished in adult liver (Vilaro et al., 1988). From its primary source of synthesis, LPL is secreted and transported in an unknown fashion to the luminal side of the capillary of the endothelium (Scow and Egelrud, 1976) to which it is attached by non-covalent binding to the heparan sulfate glycosaminoglycan (Saxena et al., 1991; Braun and Severson, 1992). Recent observations also suggest that LPL may be bound to the endothelium through an additional 116 Kda protein which shares 100% identity with the amino terminal end of apoB (Sivaram et al., 1994). The affinity of LPL for membrane bound heparan sulfate glycosaminoglycans has been widely used to study LPL. Heparin actively competes with the natural binding site of LPL thereby allowing LPL to be released into the circulation Early studies by Korn (Korn, 1952a; Korn, 1952b) suggested that LPL had limited ability to hydrolyze triglycerides from artificial emulsions except when mixed with plasma HDL. These observations served as a basis for the identification of a co-factor named apoC-II, a small protein of 79 amino acids, which was found to be required for optimal LPL activity (Scanu, 1966; Havel et al., 1973). ApoC-II is found at the surface of HDL particles from 19 Chapter I which apoC-II is transferred to nascent VLDL and chylomicron. Upon hydrolysis of triglycerides from the core of VLDL and chylomicron, excess material is shed from the surface of these lipoproteins and transferred back to HDL particles allowing apoC-II to be recycled (Havel et al., 1973). The majority of LPL bound to the endothelium is found as a homodimer, the active form of the protein (Osborne, Jr. et al., 1985). While the orientation adopted by each subunit in the dimer has been the subject of active debate for many years, elegant studies by Wong et al. (Wong et al., 1997) suggest that a head to tail orientation leads to active LPL. Osborne et al. have presented evidence that the active dimer is in reverse equilibrium with the monomer (Osborne, Jr. et al., 1985). However the monomer is prone to reversible changes which result in loss of activity and ultimately degradation by the liver (Wallinder et al., 1984). Each subunit of the dimer has an apoC-II binding site. Two apoC-II molecules are required to occupy these sites which are believed to act independently (Clarke and Holbrook, 1985). LPL can hydrolyze a wide variety of substrates including long and short chain triglycerides, diglycerides, monoglycerides and long and short chain phosphatidylcholine (Nilsson-Ehle et al., 1973; Egelrud and Olivecrona, 1973; Shinomiya and Jackson, 1984). The rate of hydrolysis varies widely for different substrates. Phospholipids, for example, are 20 Chapter I hydrolyzed at only a small fraction of triglyceride's rate. LPL hydrolyses preferentially the first and third ester bond of triglycerides leading to the formation of 2-monoglyceride. Monoglycerides are hydrolyzed by LPL at a faster rate when the remaining fatty acid is located at position 1 or 3 of the glycerol backbone. Consequently, complete hydrolysis of the triglyceride occurs mostly after the enzymatic isomerization of the remaining fatty acid at position 1 or 3 (Nilsson-Ehle et al., 1973). Studies performed in the early 90s have clearly demonstrated that LPL can act as a ligand and influences lipoprotein binding and uptake by cell-specific receptors through mechanisms independent of lipolysis (Olivecrona and Olivecrona, 1995). Early studies by Beisiegel et al. using chemical cross-linking (Beisiegel et al., 1991) demonstrated that in cell culture, LPL-chylomicron complexes could bind to the low-density lipoprotein receptor related protein/a.2-macroglobulin receptor (LRP). Other studies demonstrated that both the LDL receptor and the V L D L receptor are capable of promoting LPL-mediated uptake of lipoproteins (Takahashi et al., 1995; Medh et al., 1996). On the other hand, Eisenberg et al. (Eisenberg et al., 1992) demonstrated in vitro that cellular proteoglycans also participate in this process. Ji et al. provided compelling evidence for this pathway by demonstrating that intravenous injection of heparinase, an enzyme which specifically cleaves heparan sulfate side chain, inhibits lipoprotein clearance from the plasma and uptake by the liver (Ji et al., 1995). 21 Chapter I The significance of LPL-mediated binding and uptake of lipoprotein in vivo has been actively debated. Recently however, Skottova et al. (Skottova et al., 1995) successfully demonstrated that, in a model of perfused rat liver, addition of LPL enhances chylomicron remnant uptake. Although lipolysis itself was shown to increase chylomicron remnants uptake, it was also demonstrated by using a lipolysis inhibitor that LPL had an additional effect on the removal which was independent of catalysis. (Skottova et al., 1995). The evidence to date supports the concept that LPL mediated binding and uptake of lipoproteins occurs through the initial binding of LPL-lipoprotein complexes to proteoglycans with subsequent transfer of the complex to specific lipoprotein receptors (LRP, VLDLr and LDLr) for endocytosis and degradation. Binding of LPL to heparan sulfate proteoglycans could also promote lipoprotein uptake by direct internalization. Nykjaer et al. showed that the enzyme needs to be in the dimeric form for this function (Nykjaer et al., 1993). While both the enzyme monomer and dimer show binding affinity for lipoproteins, cell surface receptor and proteoglycans, it is suggested that some of these binding sites may partly overlap making the dimer the only form capable of mediating the uptake of lipoproteins (Krapp etal., 1995). 22 Chapter I 1.5.2 Gene and protein structure The gene for lipoprotein lipase is located on the short arm of chromosome 8 (8p22) (Sparkes et al., 1987). The genomic organization of the LPL gene consists of 10 exons separated by 9 introns encompassing a total of 30 kb (Deeb and Peng, 1989). Exon 10 is untranslated but encodes a long 3' untranslated region (UTR) which contains 2 polyadenylation signals. These sites are used alternatively to produce 2 species of mRNA of approximately 3350 and 3750 nucleotides respectively (Wion et al., 1987). The message encodes a protein of 475 amino acids from which a signal peptide of 27 amino acids is cleaved to form a 50kD protein of 448 amino acids. Examination of the nucleotide sequence of the LPL gene suggests that LPL belongs to the lipase family together with hepatic lipase (HL) and pancreatic lipase (PL). It is believed that all three genes have evolved from a single ancestral gene (Kirchgessner et al., 1989). LPL shows a 53% homology with HL and 35% homology with PL. The homology between HL and PL is 36%. This suggests that PL branched off at an earlier time from the other 2 lipases (Kirchgessner et al., 1989). In addition, the demonstration of LPL and apoC-II like activity in the absence of HL-like activity in lower species also suggest that phylogeneticly, the LPL-apoC-II system may have evolved prior to the HL system. 23 Chapter I A l l three lipases belong to the family of serine esterases but differ from the classic esterases in that they show specificity for substrates insoluble in water and are active mostly when exposed to an oil-water interface. They also possess a catalytic triad consisting of serine, aspartate and histidine, characteristic of this type of enzyme (Wion et al., 1987). PL is the only one of the three lipases to have been successfully crystallized (Winkler et al., 1990; VanTilbeurgh H. et al., 1992). The three-dimensional structure of PL now serves as a model for both HL and LPL. Both LPL and HL are bound to membrane proteoglycans and are released into the plasma after heparin injection. PL, on the other hand, is synthesized by the pancreas and is secreted in the duodenum where it is responsible for the hydrolysis of dietary triglycerides (Lowe, 1994). The molecule is active as a monomer and circulates freely. HL is also active as a monomer but, in contrast to LPL, is synthesized exclusively in the liver where it is secreted and localized at the surface of liver sinusoids (Jackson, 1983). The primary structure of the three lipases indicates a similar molecular organization with a large amino(N)-terminal domain associated with a smaller carboxy(C)-terminal domain. Fusion studies between LPL and HL reveal that the binding site of apoC-II on LPL may be localized in the N-terminal domain of the protein (Davis et al., 1992). In contrast, the binding of colipase, a cofactor of PL which allows activation in the presence of bile salts, 24 Chapter I was visualized by crystallography and found to occur in the C-terminal domain of the molecule (Chaillan et al., 1992). These observations are in line with the absence of sequence similarity suggesting that colipase and apoC-II are evolutionary unrelated. There is no known cofactor of HL. The region of the catalytic triad of lipases is maintained in a hydrophobic pocket which shows high degree of conservation. In contrast, the mobile lid, which covers the catalytic site and controls access to the substrate, is poorly conserved (Lawson et al., 1992). Heparan sulfate proteoglycans are negatively charged molecules which interact with positively charged regions of proteins through electrostatic binding. At least 5 different clusters of charged amino acid have been postulated to play a role in heparan binding of LPL. Evidence from several laboratories now suggests that the majority of these sites may be involved in the binding of LPL to heparan sulfate but the exact extent to which each site participates in these interactions may depend on the distribution of charges and the nature of the ligand (Davis et al., 1992; Berryman and Bensadoun, 1993; Dichek et al., 1993; Hata et al., 1993; Ma et al., 1994; VanTilbeurgh H. et al., 1994). Other important structural motifs of the LPL enzyme include a) an apoC-II binding site; b) a lid; c) the catalytic triad; d) the lipid binding sites and d) a dimerization site. The apoC-II binding site is localized in the N-terminal domain of the protein (Dichek et al., 1993) while 25 Chapter I the exact residues involved in the binding of apoC-II remain to be determined. Substitution of the charged amino acids Lys l 4 7 -Lys 1 4 8 produced evidence of the involvement of these two amino acids in the binding of apoC-II to LPL (Bruin et al., 1992). The catalytic triad of LPL is not readily accessible to lipid substrate. Access involves repositioning of the lid which controls entry of lipid substrates. The sequence of the lid is 9 1 ft ") TQ determined by 22 amino acids contained within cys and cys ,which form a disulfide bond with the possible effect of stabilizing the lid structure. The secondary structure of the lid suggests two highly amphipathic helices. The opening of the lid is presumably triggered by an initial interaction of LPL with the lipoprotein through the C-terminal domain of the protein (Henderson et al., 1993). Upon activation, the hydrophobic surface of the lid becomes exposed, offering an increased surface for interaction with the non-polar lipid. This also has the effect of creating an hydrophobic seal against water access to the catalytic site during lipolysis (Santamarina-Fojo and Dugi, 1994). The heart of the catalytic site is formed by three residues Ser l j 2 , Asp 1 5 6 , and His 2 4 1 , which together form what is called the catalytic triad. This triad is essential for lipolytic activity and is conserved in all lipases known to date. 26 Chapter I 1.5.3 Genetics Lipoprotein lipase was initially classified as an autosomal recessive disease. Recent observations on the manifestation of lipid abnormalities in LPL heterozygotes now suggest that LPL deficiency could be viewed as an autosomal co-dominant disease. Complete LPL deficiency occurs in the general population at a frequency of about 1 in a million except in the northern part of Quebec, where the frequency can reach 1 in 4000 individuals due to a founder effect (Brunzell, 1995). The syndrome of chylomicronemia was first described in 1932 by Burger and Grutz (Burger and Grutz, 1932). Holt et al. then reported a familial pattern of inheritance of the disease (Holt et al., 1939). Havel and Gordon were the first to demonstrate that a lipolytic defect was at the origin of the syndrome by showing that LPL activity was absent in affected individuals (Havel and Gordon, 1960). Breckenridge et al. demonstrated that in some cases in which LPL deficiency could not be invoked, deficiency in the activator protein apoC-II could lead to a similar phenotype (Breckenridge et al., 1978). Individuals affected with LPL deficiency have massive elevation of plasma triglycerides (22.6mmol/L or 2000mg/dl, normal<3.4 mmol/L or 300mg/dl) and commonly present early in life with abdominal pain and failure to thrive, or later in life with hepatosplenomegaly and recurrent pancreatitis which can be life threatening if untreated. Physical signs such as 27 Chapter I eruptive xantomatas and lipaemia retinalis are also commonly observed in such individuals. There is currently no cure for the disease, although patients can usually remain symptom free by adhering to an extremely low fat diet. In patients with recurrent symptoms, a dietary indiscretion could usually be identified (Gagne and Gaudet, 1995). Approximately 80 different mutations have been described to date in the coding region of the LPL gene. Another 20 mutations have been described in the non-coding region of the gene (Table 1-1). The regions harboring the functional sites of the molecule also contain the highest mutation density. Approximately 30% of the mutations are found in exon 5 and approximately 22% are found in exon 6, the rest being distributed in the other exons. As with the other medium sized genes, point mutations represent the vast majority (86%) of the mutations found in the LPL gene, with insertions and deletions accounting for a small percentage (14%) of the gene defects. 28 eu X= U c <a bD >—1 O H h J CD e/i C O s T3 tU O CD 1 c o '5b cu ri cu o C CU S-H .u ri CU OA X 3 U CD ft H c o o o H - l 00 oo 60 60 00 00 00 00 00 00 00 00 00 c c c c c c .5 .5 .5 .5 c e c - a •a T3 -a - o - a - a -a • a - a '•5 T3 '-3 o o O o o o o o o o o O o o o o cj cj CJ CJ CJ o CJ CJ CJ o c c c S3 c c c c c c c c c o o o o o o o o o o o o o a c c c c c c c c c c c c a GO > H a . x> o £ o o E o o E o o D. -^^  ,—S 994) CM CN 994) (N OS Os 994) os OS © CN OS 994) OS OS r s Os r—< r~ os © OS „ ON oo OS OS "5 OS "cd +-» 1u eu ca u eo : • IJU3I a5 ess "O et aL ca T3 usch mura usch etal r et a £ o ca +^  o +-» eb ka eb N he IE o ca o ca O CJ a a X, tz / s , ^  ,—s , s ,—s ,—s </-) SO >/-l IO <n OS OS OS OS Os Os OS Os OS OS OS OS ca ca ca ca ca ca -4-* +^ CJ <u CJ <u CD CJ 00 00 on 00 00 00 c e c c c c ca ca ca CO ca ca >• >- > > >• >• is a u C J o < o S ca oo a O U CJ u < < a < t -o co ca o < f— O o CJ oo ca oo cj ca 00 oo ca ca oo a GO a 00 ca a 00 ca cj fc 0\ CN cj 00 ca fc c ca ca o o +^ +z 00 o Q GO at (— Q. C o c o X UQ < GO t-D. X> O X o cfc o. x> © CN > t-O. < GO a . < GO E o efc! Q. X) a: H a . X) D GO GO Di > Q. Q. X) XI 00 ca CJ < GO E eg X) D. X) 00 o CO0 I CJ 60 ca ca cu S Q cu GO §• E cu O < O 0 O a ^ ca ^ cu Q. D. X) •1- 00 00 CJ CJ o o o o o o CJ 00 00 > > > > > oi t— E— t— t— E— r— o. a . a. o. n . a. XI X) X) X) X) XI CO SO SO SO 00 OS OS c c c c c c c c n c o o o o o o o o o o 1— — I— fc u fc t -c c c c c c t r C c c ro so ro Os OS Os ro <n so r» oo os s -<L) X3 a c o '5b I a: c-OX) 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 c c c c c c c c c e c c c c c c c c c n c -a -a -a TD TD -a -a T3 -a T3 -o T3 •a -a T3 T3 -a -a T3 T3 T3 o o o O O o o O o O o O o o O O o o O O O o o o O o o o O o O o o o o O cj o o o o O ii (J c H os os Os Os CO 4_, CJ 00 c CO >• <D CJ I a so OS OS CO cd C 3 OS OS CJ CO _c '53 a) cj c 00 CO a OS OS — CO „ CO >. CO x> o OS OS CJ CJ c oo CO a CJ C CJ x> 3 O OS OS 03 tt ~ CJ CO -o o o a OS OS _ : CO Os OS CO OS OS <D o Q. on c o OS Os CO tt tt c o CN OS Os CJ CO O A3 ^ ^ S o OS OS X> os ,—s ,.—v Os CO OS OS Os CO OS To o OS OS o OS OS Os OS OJ OS OS 73 *— CO ; „ c CO CO o CJ cS llye ers cs a3 CJ CJ CJ CD CJ CO "S3 «3 llye -a c _Q C X) ' 5 c a> mi 00 CO 'Foul 00 CS mi CJ <D 2 LU o 'Foul a LU Q ISO u < u f -o o U < a < o < u < < a t-o o 3 t— a a o < u 2 2 H a a u < a < a H < a o E— S— U H < f— a < < t-t- a o o o a < f— u a < < a o a < a a u o < CJ Q Q . Q . X) 2 35 T o. — < cj f-e-CJ oo u H CO > CN D . cj C/3 a. x> < < Lt -l - 3 CJ CJ f— J •<t os so SO & To C— > cj C/3 in 00 a. X) so oo & f— a SO 00 & t-Q / s bp H GO , , S3 To t— > C a CN 00 oo O o o — >, c 73 x> —] a > O CJ a a. X) o (N < so ro 2 I C O o o c o X LU 2 O X LU O X LU O X LU rs) c o X LU o X L U rsi CN ri ro ro ro ro ro ro ro ro ro c c c c c c c c c c c C c c c c o o o o o o o o o o o o o o o o X X X X X X X X X X X X X X X X LU LU LU LU LU W LU LU LU LU LU LU LU LU LU LU o o CN — CN CN CN ro CN CN >iO CN SO CN O O CN OS CN O — ro ro CN ro ro ro ro ro so ro ro oo ro o — -3-0) X 3 u c o '5b ri o c cu cu ri 00 00 00 00 00 00 00 oo 00 oo Oi) 00 00 00 00 00 00 00 00 00 oo 00 c c c c c c c c c .5 e c c c c c c .5 c c c c T3 -o -a -o -a -a •a T3 -o -a T 3 •a T 3 T3 -o T J T J -a T J T J -a T J O o o o o o o O o o O o O O o O O o O o o O CJ CJ CJ o CJ CJ CJ o CJ CJ CJ o CJ o o CJ CJ o CJ o CJ o os ON CJ o > QQ os ON OS OS m OS OS 4- 1 : 3 E CO +-* tu c "5J _ £ S UU CO a) CN OS OS <L> CO OS Os CJ CO CO CO OS Os c CJ X) 3 o Uu CN OS Os OS OS Os OS SO OS OS T3 tt X ! CJ « « _ tt u o c X> -S2 3 -g a 3 X> <D CQ X) CN os os T J e CO C CJ -o c ^ O OS OS CJ 00 CJ CQ Os Os CD "5 & c CD XI 3 CO CC Os OS CO c CD o OS OS XJ OS OS <D t_ <D X) 3 O Uu os / - ^ t-~ —' Os r 2 15 Os _ ^ ^ OS CN ~ OS Os r — 2 « _f <u c o -a c CJ CO CD x: CJ a CD CO •a o o a 60 c U CU ft c o o o H - l < < a o U < a a a a u u H t— i- a < o < a < < a u o o o o o a U t— a < < < a a a a < a u o < u u u < a o O < a H O f— o t— U < < o •4—' < u a < o o U < a o o a o u < ^ < o o o < < O 0 o < u a u a a o a o 3 o o H < r- U H O < < < a u u 2 . 2 2 s a CN CO > Os CD GO i n < SO a SO X SO E— oo < SO a a > >• §• & S- s « 3 a < < < cu < a o so ^ 3 a u CN <D 00 h-SO r--a o oo a < < x _3 O 0 0 oo ~>< a < oo a < Os u CD GO t-OS a </-> OS a SO •* 0 0 OS o CN ro I T ) IT) i n SO 00 OS IT) o — SO SO CN SD a o CN D . ac < m i n I T ) i n >n i n i n i n i n i n m i n i n i n i n i n c c c c c c c c c c c c c c C c c c c c c o o o o o o o o o o o o o o o o o o o o o o X X X X X X X X X X X X X X X X X X X X X x UU UQ PJ tu uu uu uu uu uu uu uu uu uu uu uu uu uu uu uu uu uu so U c o '5b <u U cu o o o hJ 00 60 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 c C c _c _c c c .e _c .S c c c c c c c c c c c T3 T3 T3 •5 •5 T5 T3 T3 T3 T5 T3 - a T3 T3 T3 - a -a -a •a T3 T3 •a O O O o o o O O O O O o O O O o o o o O O o o O O o o o o cj O o o o O CJ CJ o CJ CJ o CJ o CJ CN OS OS CJ C 3 _c '33 CJ oo io © CN CJ OS OS CN OS OS o 3 X> 5 £ x> CN OS OS T3 C CO C CJ T3 X OS Os ro OS OS c o OS oo OS CJ XI CJ CJ a CJ -a c CJ X oo c CO OS OS CO E-OS OS OS OS CJ CJ JZ CN OS OS OS OS CJ CO Q 2 Q. a. < — / s O CO OS CN OS OS a OS — OS a> OS j= „ CO • o ; CO COCJ a3 iebu CJ CO CO iebu ca X, 2 t— Os OS X) OS Os CO OS OS O OS CN Os os co *  _>> CJ U CJ CO tt ° O 1> t/1 CJ o c 3 U. 5 g a < u o 2 S 2 t- a < E- U O < u a E- f— o f— C J < u < o o o f— E— £-O u t- o < < u cj u a < a E-i— cj C J o o o o U u U U a o a u t— C J u u o o o o o ° o o U U H 2 3 O < < E-o a o o o U< a E— U a u < O S— U a u u < o o i— C J a u < a CJ Q Q. X) OS O CN a C J CJ Q Q. X) P 2 E-IO CN CN CN •9 _CJ CJ Q x> SO CJ E-OS ro CN >• C J n CN oo U CO CN 00 - J CN 00 < < < t-CJ CO < o >/-> CN a. U 00 < CN g. CJ R s CJ t-CN >n CN 3 CJ < OS CJ 00 Xi SO X CN SO CN E— CJ E-CN SO CN L->> H CL SO SO •2 CJ oo IT) l/~) IO c c c c c c o o o o o o X X X X X X UJ PJ LU LU LU LU ^J- SO f- 00 OS SO SO SO SO SO SO c o X LU X) e^t-as OS os _• — X) 3 O O < U a < < U u u t- U u o o o o 6 U a < < u E— E- E- t- U s a. so 00 CN 3 CJ SO so SO SO SO SO so SO so so SO SO SO so SO c c c c c c c c c c c c c c n O o o o o o o o o o o o o o o X X X X X X X X X X X X X X X LU LU LU LU LU LU LU LU LU LU LU LU LU LU LU CN ro IO SO r-^  00 Os o CN ro 'Cf IO r- r- r- 00 00 oo 00 00 00 C N s-CD a. c3 - C U a c o C CD a o '5b ri o e CD s-l ri 1) c X3 u CD ft o o o 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 .5 c c c c c c c c e c c c c c T J T J T ) -a T J T J •a T J T J T J T J T J T J T J T J T J O O O o o o o O O O O O O O O O o O O CJ CJ  o CJ CJ CJ CJ CJ O o CJ o os OS OS OS o OS OS r o OS OS <D c < a X> o Os OS CJ 3 X> CN OS Os 3 OS OS CJ c 00 CO u CN OS OS 113 os « 2 3 - ™ X) CJ •a co Os OS CO T J O 4-* o O SO OS OS Os OS S5 « CJ O to "> <D S-0-SO OS OS r /—s o OS OS CO OS OS CD '—' "co C o 15 «3 I— c <D <D .2 nd CO "E CJ to CD X CQ E-o < o E— < < E— t-< O u < o o U E— U U O < a o < < o a u E— U U < < a < f— < o a E- E— o o o < a a E- a a U E- E-a o < E— < a o o < < a a E-< E-o o rO 0. r o o r o 3 CJ _ 1 X) CN SO C c E-r o r o ca CN m r o x: E— T J Q . X) CN CO 3 CJ SO r o CO ,!> > E-fN SO OO eg c o cj B" -1 E— < D E— CN 0 0 r o P -_) o 3 a a E-oo U SO SO SO SO r - r - 0 0 0 0 c c 3 c c c c C c o o o o o o o O o X X X X X X X X X LU LU LU LU LU LU LU LU LU 0 0 SO r-~ OS o CN r o t^-0 0 0 0 0 0 0 0 Os Os Os Os Os oo c o X LU oo c o X oo c o X LU LU o X LU OS c o X LU < a t-o f- < o u CD t-cj GO X) r o o X LU o o Os c o X LU GO E-a . a . —i _u U. Lu Oi Oi T J T J CD <D So £ 3 3 >. >• * 00 CD E- 2 T J C X CO CO J I E— T J Chapter I Homozygotes carrying two defective alleles of the LPL gene develop a phenotype of familial chylomicronemia also called type 1 hyperlipidemia. In the absence of LPL activity, chylomicrons and V L D L cannot be catabolized properly and accumulate in the plasma, leading to massive elevation of plasma triglycerides. Although high triglyceride-rich lipoprotein levels may predispose individuals to atherosclerosis, patients with LPL deficiency also have very low levels of LDL-C due to their inability to process V L D L particles. Accordingly, early studies suggested that LPL deficiency does not predispose to atherosclerosis (Havel and Gordon, 1960; Lees et al., 1973), and preliminary studies revealed no serious atherosclerotic lesions (Nikkila, 1983). Recent studies by Benlian et al. (Benlian et al., 1996), however, suggest otherwise. Benlian reported that 4 patients with LPL deficiency followed prospectively had premature peripheral or coronary atherosclerosis before the age of 55. It is suggested that these patients have severely impaired triglyceride clearance which may increase the exposure of lipoproteins to oxidation. In addition, the missense mutations in these patients, which result in impaired catalytic activity, may result in mutant proteins still capable of promoting lipoprotein retention at the vessel wall, thereby increasing the uptake of lipoproteins, formation of foam cells and atherosclerotic plaques. Complete LPL deficiency is rare, with a frequency of approximately 1 in a million. Heterozygosity for complete LPL deficiency is found in approximately 1 per 500 individuals worldwide, except for certain regions of Quebec where the carrier frequency 34 Chapter I reaches 1 in 40 individuals due to a founder effect (Hayden, 1992a). In contrast to homozygotes, heterozygotes carrying a defective allele do not present any gross clinical manifestations of the disease. As such, heterozygotes are usually identified as relatives of an affected proband using molecular screening tools. Heterozygotes for LPL deficiency show a decrease in post-heparin LPL activity ranging from 20 to 60%. Post-prandial studies in these individuals reveal impaired lipolysis leading to prolonged residence of circulating chylomicrons and V L D L (Miesenbock et al., 1993). Lipid analysis in the fasting state reveals decreased HDL-C levels, particularly HDL2-C, reduced apoA-I and increased V L D L and VLDL-triglyceride (Wilson et al., 1990; Bijvoet et al., 1996). Age, obesity and hyperinsulinemia also contribute to the expression of hypertriglyceridemia in heterozygotes (Wilson et al., 1990; Wilson et al., 1993). This potentially atherogenic lipid profile has led to the hypothesis that heterozygotes for LPL deficiency may be at higher risk for coronary heart disease. This hypothesis has remained largely untested, given the difficulty of collecting large number of affected individuals. A recent study by Norgestgaard et al., however, offers the first evidence that this hypothesis may be correct. The authors found that heterozygotes for LPL deficiency due to a G188E substitution were more common among patients with ischemic heart disease than individuals from the general population, adding weight to the concept that 35 Chapter I heterozygosity for LPL deficiency increases the risk for atherosclerosis (Nordestgaard et al., 1997). 36 Chapter I 1.6 THESIS RATIONALE A number of arguments support the notion that LPL plays an important role in modulating the risk for developing atherosclerosis. A positive correlation exists between LPL activity and HDL-C, a major risk factor for CHD. Impaired lipolysis results in delayed triglyceride-rich particle clearance which has been shown to contribute to the growth of coronary artery plaque (Phillips et al., 1993). Animal studies conducted in an atherosclerotic rat model showed that rats treated with a specific LPL activator had significantly less atherosclerotic plaques than control animals (Tsutsumi et al., 1993). Finally, heterozygotes for LPL deficiency tend to have a more atherogenic lipid profile than control individuals (Bijvoet et al., 1996). One of the major limitations in determining the exact role of LPL deficiency on the risk for coronary atherosclerosis has been the small number of affected individuals. Because homozygosity for LPL deficiency is a rare condition and because heterozygotes have no clinical manifestation of the disease, the number of subjects available for such study has always represented a major obstacle. A turning point in this area of research was the observation by Ma et al. (Ma et al., 1993) that certain mutations in the LPL gene lead to partial catalytic defect and that under specific environmental stimuli, these "dormant" mutations produced an observable phenotype. 37 Chapter I This finding has led us to speculate that mutations in the LPL gene may be more frequent than initially estimated based on the frequency of complete LPL deficiency. This concept is also supported by the observation that mutations that abolish LPL activity are compatible with life and therefore may be underdiagnosed. We therefore hypothesized that, based on the critical role of LPL in lipid metabolism; LPL mutations may represent common genetic risk factors contributing to the etiology of various forms of dyslipidemia and CHD. Together, these two concepts have been the driving force behind the work described in this thesis and led to the following hypothesis. HYPOTHESIS: y Heterozygosity for complete or partial LPL deficiency is a common primary cause of familial combined hyperlipidemia (FCHL). (Chapter II) ^ Heterozygosity for complete or partial LPL deficiency underlies different forms of dyslipidemia and confers an increased risk for atherosclerosis and coronary artery disease. (Chapter III) 38 Chapter I > Common variants in the coding region of the LPL gene represent functional mutations and alter LPL kinetic properties in vitro. (Chapter IV) > Common variants in the coding region of the LPL gene are associated with altered lipid levels and modulate the risk of coronary heart disease in the general population. (Chapter V) 39 Chapter II Chapter II 2. FAMILAL COMBINED HYPERLIPIDEMIA The majority of the data presented in this chapter contributed to the following manuscript: E. Gagne, J. Genest, Jr, H. Zhang, L.A. Clarke, M.R. Hayden; Analysis of DNA changes in the LPL gene in patients with familial combined hyperlipidemia, Arteriosclerosis and Thrombosis (1994) 14: 1250-1257 40 Chapter II Foreword This study was conducted in collaboration with Dr. Jacques Genest Jr. who provided the DNAs and lipid profile of 31 familial combined hyperlipidemic patients. Dr. Lome Clarke initiated this collaboration and I assumed responsibility for the ensuing work. I performed the screening and sequencing of all exons and developed PCR methods for rapid screening of control patients. I performed in-vitro mutagenesis, transfection experiments and LPL protein assays for all amino acid substitutions described in this chapter. These experiments were conducted with the help of Dr. Zhang who provided valuable expertise in the transfection and protein assays. The LPL activity assays were performed by our technician Ian Forsyth. Finally, the family studies were conducted with the help of Vincent Lajoie, a trained nurse from the Montreal area, whom I recruited to contact and collect blood samples from the families of interest in the Montreal area. 41 Chapter II 2.1 INTRODUCTION: Familial combined hyperlipidemia (FCHL) is a common genetic disorder in humans with a population prevalence of 0.5-2% (Grundy et al., 1987) and is seen in approximately 10% of males with premature coronary artery disease (Genest, Jr. et al., 1992). The diagnosis of FCHL is based on ascertainment of multiple individuals in the same family with different types of primary hyperlipidemia including an increase in cholesterol and/or triglyceride levels (Brunzell et al., 1983). The genetic basis for FCHL has not been determined. Genetic studies indicate that it is due either to a single autosomal dominant gene with variable expression or the combined effect of multiple genes (Iselius, 1981; Austin et al., 1990; Austin et al., 1992). A characteristic feature of the metabolic disturbance in FCHL is over-production of hepatic apoB of V L D L (Chait et al., 1980; Venkatesan et al., 1993). In addition, decreased LPL activity has been shown in one-third of the cases of FCHL (Babirak et al., 1992). This finding suggested that mutations in the LPL gene leading to partial defects in LPL catalytic activity, may underlie the lipid phenotype in some patients with FCHL. A number of studies have suggested that LPL is a multi-functional protein with other roles in addition to hydrolysis of triglyceride-rich lipoproteins (Williams et al., 1991; Beisiegel et 42 Chapter II al., 1991; Eisenberg et al., 1992). Of particular interest is the proposal from Williams et al. that LPL is involved in the remodelling and reuptake of nascent lipoproteins in and near the space of Disse in the liver (Williams et al., 1991). Mutations in the LPL gene causing impaired remodeling and uptake of triglyceride-rich lipoproteins could lead to reduced uptake of apoB and the apparent over-production of apoB characteristic of FCHL. In an effort to explore the role of the LPL gene in FCHL, the entire coding region of the LPL gene was assessed in 31 unrelated French Canadians with the lipid phenotype consistent with the diagnosis of FCHL. Our study shows that in this population of patients, defects in the LPL gene do not account for a significant proportion of patients who present with the phenotype of FCHL. 43 Chapter II 2.2 METHODOLOGY 2.2.1 Subjects: A total of 31 probands with FCHL were ascertained in the Lipid Clinic of the Clinical Research Institute of Montreal. A l l patients were ascertained as being French Canadian based on a three-generation analysis. The hyperlipidemic status for each subject was assigned on the basis of the first lipid level obtained at the Lipid Clinic. Cholesterol and triglyceride levels were measured as described previously (Henderson et al., 1991). Plasma apoB concentration was measured with the Berling nephelometer. In all instances the diagnosis of FCHL was made on the basis of an increase in LDL-C alone and/or triglyceride levels above the 90th percentile for age and sex as well as the presence of a first degree relative with one of these lipid phenotypes but different from that of the proband (Table 2-1). The FCHL subjects were not taking any medication known to affect lipid levels before their assessment. To determine the allele frequency of D N A changes, 49 unrelated consecutively ascertained French Canadian patients attending a genetic clinic for reasons other than lipid disorders were used as control subjects. 2.2.2 Analysis of the LPL gene: Human DNA was isolated using standard methods (Langlois et al., 1989). Polymerase chain reaction (PCRs) for exon 1 to 9 of LPL were carried out as previously described 44 Chapter II (Monsalve et al., 1990; Ma et al., 1991) with the exception of exon 3 which was amplified using the following primers: LPL-80= 5 'GGTGGGTATTTTAAGAAAGCT 3 ' ; LPL-81= 5 'AAAACACTGTTTGGACACATA 3 ' ; (Annealing temperature 52°C). The PCRs for SSCP were performed in 50 pi volumes containing lOOng of template DNA, 75pmol/L dNTPs, 0.25pCi [oc- 3 2P]dCTP (Amersham) 20pmol/L of each primer, 1.5mmol/L MgCl2, lOmmol/L Tris pH 8.3, 50mmol/L KC1, 0.01% gelatin and 1.25 units of Taq DNA polymerase (BRL). PCR product was diluted 1:50 to 1:100 in lOmmol/L EDTA and 0.1% SDS and 5pl of the solution was added to 5pl of loading buffer (95% formamide, lOmmol/L NaOH, 0.006% xylene cyanol and bromophenol blue). Samples were denatured at 95°C for 4 minutes and loaded on a non-denaturing polyacrylamide gel using two different gel conditions: 1) 6% polyacrylamide (19:1 acryhbis) and 5% glycerol in 0.5 X Tris-borate-EDTA buffer (TBE) at room temperature with constant power of 40 watts for 3-6 hours; 2) 10% polyacrylamide (19:1 acryhbis) and 10% glycerol in 1 X TBE at 4°C with constant power of 20 watts for 18 to 24 hours. Gels were dried on blotting paper and exposed to X-ray film for 1-10 days. Exons showing changes in the band pattern by SSCP as compared to a normal control were amplified by PCR and run on a low melting point agarose gel (nuSieve GTG), excised from 45 Chapter II the gel and purified using the DNA purification system "Magic PCR Prep" (Promega). The amplified exons were then sequenced either directly using "CircumVent" thermal cycle sequencing kit (NEB) or after cloning into a TA cloning vector (Invitrogen Inc., San Diego, CA). 2.2.3 In vitro mutagenesis and expression studies: A 1.6 kb cDNA fragment containing the entire coding sequence of human LPL was cloned into a dual function vector (CDM8) for both mutagenesis and expression (Ma et a l , 1992). In vitro site directed mutagenesis was performed using three different primers: (Asn9)5 G A A G A G ATTTT ATC A A C A T C G A A A G T A A A 3 ' ; (Val21 ) 5 ' C T A A G G A C C C C T G A A G T C A C A G C T 3 ' ; (Tyr44) 5 'TCATTTCAATTACAGCAGCAAAAC 3 ' . Mutant clones were identified by oligonucleotide hybridisation and verified by DNA sequencing. Expression phagemids were introduced in COS-1 cells by electroporation (Henderson et al., 1991) with the following modifications. The Gene Pulser apparatus (BioRad Laboratories) was set at 240V/960 uFD. After electroporation, the cells were transferred immediately to a 10cm culture dish containing D M E M (high glucose), 10% fetal calf serum. After 24 hours the medium was removed and replaced with fresh medium containing 7mU heparin/ml. The medium from each dish was collected every 24 hours for 4 days, snap frozen and maintained at -70° until assayed for mass and activity. 46 Chapter II 2.2.4 D N A analysis in controls: PCR-based methods of detection were established to ascertain in the control group the allele frequency of the various changes detected in our FCHL patients. Detection of the D9N substitution was carried out by digesting the PCR amplified exon with Taq 1 (BRL) for 3 hours at 65°C. The digest was loaded on an 8% polyacrylamide gel and run at 30 mAmp for 3 hours. An abnormal 58 base pair fragment was detectable in the presence of the mutation. Screening of the D21V substitution was carried out by digesting the PCR amplified exon 2 with the restriction enzyme Mae III (Boehringer Manheim). The mutation generates a unique Mae III site that produces a 78 base pair and 135 base pair fragment that can be seen when run on a 3% agarose gel. The exon 3 polymorphism ((405)G to A) was detected by digesting the PCR-amplified exon 3 with Hae III (BRL). This mutation abolishes a Hae III site that can be detected by the presence of an abnormal 183bp fragment when run on a 3% agarose gel. The S447* mutation was detected by digesting the PCR-amplified exon 9 with M n l 1 (NEB) and seen by running the digest on a 3% agarose gel. The exon 2 mutation H44Y and exon 8 polymorphism ((1164) C to A) were detected using mismatch PCR. The primer LPL-S44:ACCATGAAGGTTTTGCTGCTTT was designed to generate a new Mse 1 site in the presence of a thymine (T) at nucleotide 211, whereas LPL-S361:^ C T G A A G T T T C C A C A A A T A A G G C was designed to abolish an Hae III site in the 47 Chapter II presence of an adenine (A) nucleotide at 1164. In both cases, PCR was performed with a complementing primer under the following conditions: 94°C (1 min), 52°C (1 min), 72°C (1 min) for 30 cycles. Digestion was performed according to the manufacturer's specifications and the digest was run on a 3% agarose gel. Screening for the (435) G to A was carried out by oligonucleotide hybridisation of amplified DNA. Exon 4 was amplified by PCR and approximately 50ng of the DNA was denatured and transferred in duplicate onto nylon membrane (Hybond N-Plus, Amersham). Oligonucleotides homologous to the normal and mutant sequences were synthesized and 32 end-labelled with [Y~ PJATP. Hybridisation was performed as previously described (Ma et al., 1991) with the following modifications. Labeled oligonucleotides were incubated overnight at 65°C and washed several times under the following conditions: in buffer 1 (2 X SSPE, 0.5 % sodium deodecyl sulfate) for 10 minutes at room temperature, in buffer 2 (lx SSPE, 0.1 per cent sodium deodecyl sulfate) for 10 minutes at room temperature and in buffer 3 (O.lx SSPE, 1% sodium deodecyl sulfate) for 12 minutes at 49°C. 2.2.5 Measurements of LPL activity and mass: LPL lipolytic activity in COS-1 cell medium was determined using radio-labelled tri-(l-14C)oleate-lecithin emulsion as substrate. The released fatty acids were extracted and counted in a liquid scintillation counter. The activity in COS-1 cell medium is expressed as 48 Chapter II mU (1 mU = 1 nmol FFA /min /ml), in the COS-1 cell medium. LPL dimer and monomer masses were determined by ELISA using monoclonal antibodies 5D2 and 5F9 (see section 4.2.4 for additional details) (Babirak et al., 1989; Peterson et al., 1992a). Specific activities of the LPL were derived by division of lipase activity in the medium by the dimer mass as determined by the antibodies. 49 Chapter II 2.3 PvESULTS: 2.3.1 D N A changes in the LPL gene: Exonic polymorphisms A total of 25 band shifts in 16 patients (approximately 50% of cohort) were seen (Table 2-2, Figure 2-1). To define the DNA changes underlying these mobility shifts the exons demonstrating band shifts were further assessed by direct sequencing. A total of 13 band shifts were due to silent substitutions in exons. These changes have no effect on the amino acid composition of LPL (Table 2-3). Among these changes, 3 represent new exonic polymorphisms in exons 3, 4 and 8. To compare the frequency of these polymorphisms on control chromosomes, a total of 49 unrelated, consecutively selected French Canadian control subjects were further assessed. Five patients were heterozygous for the exon 3 polymorphism (allelic frequency: 5%), while the polymorphisms in exon 4 and 8 were present on 10% and 14% of control chromosomes respectively (Table 2-3). Since these polymorphisms do not affect the amino acid composition of the protein and show similar frequency in both FCHL and the control group, we assume these changes to be non-functional. 50 Table 2-1 Summary of Clinical Data on 31 FCHL Patients Mean SD Range A G E 51 11 31-74 WEIGHT 73 11 56-100 BMI 27.1 3.1 22-35 TC 7.63 1.32 6.09-11.9 TG 3.67 1.58 0.73-7.3 HDL-C 0.97 0.26 0.51-1.7 V L D L - C 1.69 0.93 0.29-4.6 LDL-C 4.92 0.89 3.57-7.2 ApoB 195 45 122-341 Weight is given in Kg. Cholesterol(TC), triglyceride(TG) and lipoprotein values are in mmol/L. Apo-B values are expressed in mg/dL. 51 Chapter II Table 2-2 Number and Nature of DNA changes in 31 Patients with FCHL No. of No. of Patients Total No. DNA Changes of Changes 1 8 8 2 7 14 3 1 3 Total 16(50%) 25 FCHL indicates familial combined hyperlipidemia. Of the DNA changes, 13 were exonic silent substitution, and 12 were amino acid substitutions. Table 2-3 Exonic polymorphisms in the LPL gene in FCHL patients Allele Frequency Exon Nucleotide change F C H L , n (%) Control, n (%) Exon 3 (405)G -> A 3(5) 5(5) Exon 4 (435)G -> A 4(6) 10(10) Exon 8 (1164)C —» A 6(10) 14(14) There were 62 FCHL alleles and 98 control alleles. 52 Chapter II 1 2 3 4 5 6 Figure 2-1 Single-strand conformation polymorphism (SSCP) analysis of PCR-amplified exon 2 of 4 familial combined hyperlipidemia patients (lane 1 to 4). Band shifts are present in lane 1 and 4 compared with a normal subject (lane 5). Direct sequencing (Figure 2) of exon 2 in these patients revealed that the band shift in lane 1 is caused by an A to T transversion at nucleotide 144 (codon 21) while the band shift observed in lane 3 is caused by a C to T transition at nucleotide 211 (codon 44). Nucleotide and codon position are taken from the published cDNA sequence under GenBank accession No. M l 15856 53 Chapter II 2.3.2 Amino acid substitutions: Twelve SSCP band shifts were shown to be due to nucleotide changes that did result in amino acid substitutions in the LPL gene (Table 2-4). Six patients had a TCA to TGA nucleotide change resulting in a S447* mutation. This was seen on 10% of the FCHL alleles and also seen on 10% of the control alleles. A nucleotide change in exon 5 resulted in a G to A transition resulting in the substitution of a glutamine for glycine at position 188. This mutation, however, appears frequently in the French Canadian population and is not unexpected (Monsalve et al., 1990; Bergeron et al., 1992). Three independent SSPC band shifts were seen in exon 2. The first represented a G to A substitution resulting in a D9N codon change. This was seen in 5% of the FCHL alleles and 8%) of controls including one homozygote. The high frequency of this substitution in both controls and FCHL families suggested to us that this change is unlikely to be causative of FCHL in these families. Two previously undescribed substitutions were found in exon 2. The first represented an A to T change that resulted in a substitution of a valine for aspartic acid at residue 21 (nucleotide 144) (Figure 2-2, top). This was observed in one of the patients with FCHL and was not seen on any of the control chromosomes. Comparison of this residue 21 in LPL 54 Chapter II from many different species including humans (Wion et af, 1987), chickens (Cooper et af, 1992), rats (Etienne and Brault, 1992), mice (Kirchgessner et al., 1987), guinea pigs (Enerback et al., 1987), pigs (Harbitz et al., 1992), cattle (Edwards et al., 1993) and cats (Ginzinger et al., 1996) revealed that aspartic acid at residue 21 of the LPL gene is highly conserved in all species except chickens. In this species the aspartic acid is replaced by glutamic acid which represents a conservative substitution. The aspartic acid to valine substitution results in a change in charge and represents a substitution not normally seen in LPL of any of these species (Figure 2-2, bottom). A C to T change at nucleotide 211 which results in a substitution of tyrosine for histidine at residue 44 in one patient with FCHL was not seen on any of the control chromosomes (Figure 2-3, top). Histidine is also a highly conserved residue at this position in LPL from nine species, and the histidine to tyrosine substitution represents a non-conservative change (Figure 2-3, bottom). 55 4 Chapter II Table 2-4 Exonic changes resulting in amino acid substitutions in patients with FCHL Allele frequency Exon Nucleotide change Codon change F C H L , n(%) Control, n(%) Exon 2 (106)GAC->AAC D9N 3(5) 8(8) Exon 2 (144)GAC^GTC D21V 1(1.6) 0(0) Exon 2 (211)CAC->TAC H44Y 1(1.6) 0(0) Exon 5 (644)GGG-»GAG G188E 1(1.6) (0.6)a Exon 9 (1421)TCA->TGA S447* 6(10) 10(10) There were 62 FCHL alleles and 98 control alleles, a: (Bergeron et al., 1992) 56 Chapter II 3' 3' 5' 5' 15 16 17 IS iy 20 21 22 2.S 24 25 26 HUMAN Ala Leu Arg Thr Pro Glu .Asp Thr Ala Glu Asp Thr CHICKEN Scr © © © © © Glii Pro Asp © © Val RAT e © © © © © © © B ffi MOUSE e © © © © © •©•'. © ffi © © GUINEA PIG © Arg © © © © .©.; © Val © © ffi PIG © © e © • © • . © Val © •i Val BOVINE © © © © © © • © © © ffi ffi CAT © © © © © © lie © ffi © HUMAN-FCH © © © © © © .Va! © ffi © © © Figure 2-2 Top, Nucleotide sequence of the non-coding strand for the normal and mutant exon 2 showing an A to T transversion at nucleotide 144 that results in the substitution of valine for aspartic acid at codon 21. Bottom, cross species comparison of the amino acid composition of lipoprotein lipase between residues 15 to 26 showing the conservation of aspartic acid at position 21 in all the listed species with the exception of the chicken which shows a conservative change. 57 Chapter II 5' 5' 39 4(1 41 42 43 44 45 46 47 48 49 50 HUMAN Thr Cys His Phe Asn His Ser Ser Lys Thr Phe Met CHICKEN Gin 0 Asn 0 ffi ffi Thr 0 © ffi ffi Val RAT Asn 0 © ffi ffi ffi ffi ffi ffi ffi ffi Val MOUSE Asn © © ffi © ffi ffi ffi ffi ffi ffi Val GUINEA PIG Asn ffi ffi ffi © ffi ffi ffi ffi ffi ffi PIG Asn © ffi ffi ffi © © ffi ffi ffi ffi Val BOVINE Asn ffi ffi ffi ffi ffi ffi ffi ffi ffi ffi Val CAT Asn 0 ffi © ffi ffi Thr ffi ffi ffi ffi Val HUMAN-FCH e ffi © ffi © Tyr ffi ffi ffi ffi © : Figure 2-3 Top, Nucleotide sequence o f the non-coding strand for the normal and mutant exon 2 showing the C to T transition at nucleotide 211 that results in the substitution of tyrosine for histidine at codon 44. Bottom, Cross species comparison of the amino acid composition of lipoprotein lipase between residues 39-50 showing the conservation of histidine at position 44 in all the listed species. 58 Chapter II 2.3.3 Effect of the newly identified amino acid substitutions in the LPL gene on catalytic function of LPL: Prior reports have documented the functional effects on catalysis of triglyceride-rich particles of the G188E mutation and the S447*. The G188E mutation abolishes LPL catalytic activity when present in the homozygous state (Emi et al., 1990b; Paulweber et al., 1991; Henderson et al., 1992), whereas the S447* mutation is seen in the general population and does not impair significantly the capacity of LPL to hydrolyse long chain fatty acids (Faustinella et al., 1991). However, because the effect of the 3 mutations in exon 2 had not previously been assessed for their effect on catalytic function, in vitro mutagenesis studies were undertaken. The 3 LPL mutants in exon 2 yielded detectable mass in the medium from transfected COS-1 cells which was found within the normal range of the wild type LPL (Table 2-5). In addition, specific activity was also similar to wild type for the D9N, (0.32 nmols/min/ng), the D21V (0.35 nmols/min/ng) and the H44Y (0.31 nmols/min/ng) substitutions. 59 Chapter II Table 2-5 LPL Activity, Mass and Specific activity in COS-1 Cell Medium cDNA Mass ng/mL (% of wildtype) Activity mU(% of Wild Type) Specific Activity nmol FFA/min/ng Wild Type LPL D9N D21V H44Y 369(100) 304 (82) 357 (97) 459(125) 104(100) 96 (92) 124(119) 144(138) 0.28 0.32 0.35 0.31 FFA: free fatty acid 2.3.4 Population and segregation studies To further define whether any of the D N A changes found were related to the phenotype of FCHL, the frequency of these D N A changes in patients with FCHL were compared with their frequency on normal control chromosomes of French Canadian descent. The S447* and D9N substitutions were seen on control chromosomes at equal or greater frequency than that seen in patients with FCHL (Table 2-4). The H44Y and D21V changes were not seen on any of the control chromosomes. The frequency of the G188E has already been documented and shown to be at relatively high frequency (1 in 169 individuals) in persons living around Montreal (Bergeron et al., 1992). Further segregation analysis in this family demonstrated that this particular mutation was not segregating with the lipid phenotype of FCHL in this family. This suggested that the G188E as seen in our patient with FCHL was not causative, but rather represented a coincidental DNA change in a patient from a population with a relatively high frequency of this mutation (Table 2-4). 60 Chapter II D21V and H44Y represent two previously unreported mutations in the LPL gene that were not found on any of the control chromosomes. DNA and lipid analysis was undertaken in family members of both probands. In one family (H44Y) the lipid phenotype of FCHL were found together with the mutation in two siblings. However, the mother who also had high lipid value did not the carry the mutation and the father, an obligate carrier, could not be ascertained for this study (Figure 2-4). In the family of the proband with the D21V mutation, four family members could be ascertained and, in two individuals with the mutation, a normal lipid profile was detected (Figure 2-4). However these relatives were at least 10 years younger and weighted 16 kilogram less than the proband with the DNA change and the lipid phenotype of FCHL. 61 Chapter II D21V mutation H44Y mutation II I 0 r t l L l O L F T i code 1-1 I-2 I-3 11-1 n-2 1-1 I-2 11-1 H-2 II-3 age 48 37 26 25 75 40 42 39 weight 88 72 54 54 54 90 81 79 TC 7.65 5.10 3.99 3.74 8.08 8.13 7.31 6.59 TG 2.68 0.99 0.74 0.67 2.03 3.25 1.43 3.19 HDL-C 1.06 1.45 1.42 1.48 1.34 1.31 0.87 0.84 LDL-C 4.95 3.07 2.04 1.85 5.47 5.03 5.37 4.13 VLDL-C - 1.64 0.58 0.53 0.41 1.27 1.79 1.07 1.62 Apo-B 185 111 77 71 195 198 187 173 Figure 2-4 Chart showing the plasma total cholesterol (TC), triglycerides, T G , H D L - C , L D L - C , V L D L - C , and apoB concentration in the proband (arrow) and the family members of the famililal combined hyperlipidemia patient carrying a mutation in the lipoprotein lipase gene at residue 21 (right) and residue 44 (left). Age is given in years; weight is in kilogram; cholesterol, triglycerides and lipoprotein values are in mmol/L; and apoB values are given in mg/dl. Half filled symbols indicate heterozygotes who carry one mutant and one normal L P L allele. Ll Indicate males; O females. ? indicates that the subject was not avalaible for the analysis. 62 Chapter II 2.4 DISCUSSION: Prior studies of patients with FCHL have identified a subset of patient (36%) who presented with deficiency in LPL catalytic activity. We have searched for changes in the LPL gene that might result in a catalytically defective LPL protein and be responsible for the phenotype of FCHL in 31 patients with FCHL. A total of 25 DNA changes in 16 patients of this cohort were detected. Three previously undescribed polymorphisms in the LPL gene were found in exons 3, 4 and 8 that resulted in nucleotide changes. However these changes, which accounted for 13 of the DNA changes, had no effect on the amino acid composition of the protein. Amino acid substitutions represented the remaining 12 DNA changes detected. In 6 patients a nucleotide substitution (TCA to TGA) results in a previously described stop mutation and a truncated protein (Faustinella et al., 1991) with an allele frequency similar to that of persons in the general population of the same ancestry. In 3 patients, a previously reported D9N substitution (Loshe et al., 1991) was detected that was seen with slightly higher frequency in the control population. A G188E mutation was found in 1 patient with FCHL, but this did not occur at a greater frequency than what would be expected on normal French Canadian chromosomes and did not segregate with the phenotype of FCHL in this particular family. 63 Chapter II Two other mutations in exon 2 (D21V, H44Y) were seen only on FCHL chromosomes. In vitro mutagenesis studies indicated that these mutations have minimal or no effect on the catalytic function of the LPL protein. We therefore conclude that in this particular cohort, none of the DNA changes detected result in decreased LPL activity and consequently account for the FCHL lipid phenotype in this population of patients. Mutations in the LPL gene that result in a catalytically defective protein are likely to be uncommon causes of FCHL in this particular population. In addition, this study clearly shows that exonic changes in the LPL gene are frequent (13/62 alleles or 20%) and further supports the need for functional studies to allow assessment of any DNA changes in the LPL gene. The lipid phenotype of FCHL, however, may be related to LPL not through mutations affecting catalytic activity, but rather through DNA changes affecting other domains of the protein that may play a role in the remodelling of nascent lipoproteins in the liver. In this regard two mutations in exon 2 of this gene are of interest. These mutations occur in residues which are conserved across LPL of nine different species. Further studies are clearly indicated to assess the affect of these mutations on the capacity for LPL to remodel nascent lipoproteins. The family studies thus far are insufficient to either clearly support or refute the hypothesis that these DNA changes are associated in some way with the phenotype of FCHL. The presence of a normal lipid profile in the sibling and daughter of the proband who have the D21V mutation similar to the proband may suggest that this 64 Chapter II DNA change is not related to the phenotype of FCHL in this family. However, this sibling is 10 years younger and the daughter 20 years younger than the proband. In contrast to the proband, they have a normal body mass index and therefore it could be argued that the environmental factors interacting with this DNA change are not yet operative. Extended family studies will be needed to resolve this issue. It has previously been suggested that the phenotypic heterogeneity of FCHL may be due to mutations in different genes which might be interacting (Iselius, 1981). We have previously shown that patients with mutations in the LPL gene which result in partial deficiency of LPL activity may manifest in significant lipid disturbance, primarily chylomicronemia when exposed to environmental stresses such as pregnancy, diabetes or alcohol (Ma et al., 1993; Ma et al., 1994b). In addition, we have shown that some patients may be particularly susceptible to these triggers if they also have other genetic factors such as an apoE-2 allele which might affect the uptake of remnant particles. The patient with the H44Y mutation had an E3-E3 genotype, whilst the proband with the D21V substitution had an E3-E4 genotype. Thus it would appear that in these patients with FCHL there was no association with the apolipoprotein E-2 isoform similar to that previously described in patients with environmentally induced chylomicronemia. 65 Chapter II While the biochemical phenotype associated with FCHL has been shown to be associated with hyper apoB, the genetic defect underlying the increase in apoB levels have not yet been defined. The results of this study indicates that defects in the LPL gene which result in impairment of catalytic activity, do not represent a primary cause of FCHL in this particular population. However, this study has not excluded a role for LPL gene mutations as possible contributors to the phenotype of FCHL. 66 Chapter III Chapter III 3. RELATIONSHIP BETWEEN LPL ACTIVITY, LPL MUTATIONS AND CORONARY ARTERY DISEASE The majority of the data presented in this chapter contributed to the following manuscripts: P.W.A. Reymer, E. Gagne, B.E. Groenemeyer, H. Zhang, I. Forsyth, H. Jansen, J. C. Seidell, D. Kromhout, K.E. Lie, J.J.P. Kastelein, M.R. Hayden. A lipoprotein lipase mutation (Asn291Ser) is associated with reduced HDL cholesterol levels in premature atherosclerosis. Nature Genetics; (1995), 10:28-34 J.W. Jukema, A.J.V. Boven, B.Groenemeiyer, A . H . Zwinderman, J.H.C. Reiber, A.V.J . Bruschke, T.Bruin. M.R. Hayden, E. Gagne, J.P.P. Kastelein. The Asp9Asn mutation in the lipoprotein lipase gene is associated with increased progression of coronary atherosclerosis. Circulation (1996), 94:1913-1918 B.E. Groenemeijer, M . Hallman, P.W.A. Reymer, E. Gagne, J. A. Kuivenhoven, T. Bruin, H. Jansen, K.I. Lie, A .V .G . Bruschke, E. Boerwinkle, M.R. Hayden, J.J.P. Kastelein. A genetic variant with a positive influence on lipoprotein lipase activity and HDL-cholesterol level in C A D patients: The Ser447Stop substitution in the lipoprotein lipase gene. Circulation (1997); 95, 2628-2635 67 Chapter III Foreword The REGRESS study was established as a double blind placebo controlled study in which 820 patients with documented coronary artery disease were randomized to a placebo or lipid lowering drug (pravastatin) and followed for 2 years for progression or regression of coronary artery disease. A series of substudies including DNA and LPL activity studies were designed to take advantage of this unique cohort with the goal of identifying factors which could contribute to the progression or regression of the disease or which could determine the patients response to the study drug. Our laboratory had the privilege to take part in these substudies through the involvement of Dr. Michael Hayden as a member of the policy advisory board and Dr. John Kastelein as a member of the clinical chemical committee. Because of my interest in the involvement of LPL gene mutations in the determination of the risk for developing coronary artery disease, I became the project leader in our laboratory and became involved in all studies involving LPL in the REGRESS study. I conducted all SSCP and sequencing analysis on 60 patients with low LPL activity which revealed that only 3 amino acid substitutions could be identified in these individuals. The DGGE analysis was conducted by Paul Reymer in Amsterdam and confirmed our original findings on the 60 patients initially tested and an additional 60 patients also with low LPL activity. The genotyping of the 820 patients for these three mutations was conducted in Amsterdam under the supervision of Paul Reymer and Bjorn Groenemeyer. The LPL activity assays were conducted in the laboratory of Dr. Hans Jansen, Rotterdam, with a 68 Chapter III subset of patients being assayed for LPL activity by Ian Forsyth and LPL mass by myself in our laboratory. I conducted all the statistical analysis involving the 291 mutation while Aiko Zwinderman and Michael Hallman, two expert biostatisticians, conducted the final statistical analysis on the D9N and S447* respectively. I conducted the statistical analysis on the relationship of LPL activity with clinical parameters during my visit to Dr. John Kastelein's laboratory in Amsterdam. The lipid and coronary disease assessment were conducted as part of the original design of the RERGRESS study and the data was made available to us for further analysis. 69 Chapter III 3.1 INTRODUCTION It has been well established that heterozygosity for complete LPL deficiency is associated with partial LPL activity, increased triglycerides and decreased HDL-C levels. In addition, these individuals demonstrate a reduced LpAI level and depletion of apoC-III in HDL which represent good markers of reduced lipolysis and a good predictor of the progression of C A D (Bijvoet et al., 1996). These changes are consistent with a relatively increased risk of premature atherosclerosis although this outcome has yet to be demonstrated. To determine the role that mutations in the LPL gene may play in the predisposition to develop C A D we investigated the nature and frequency of mutations in the LPL gene in individuals with documented C A D . These individuals were participants in a multicenter angiographic trial, The Regression Growth Evaluation Statin Study (REGRESS) earned out in the Netherlands, which evaluated the effect of 3-hydroxy-3 methylglutaryl coenzyme A (HMG-CoA) reductase inhibitor (pravastatin) on the evolution of coronary artery disease in patients with normal and mildly disturbed lipoprotein levels. We hypothesized that mutations in LPL would operate, at least partially, through impaired catalytic function of the enzyme. Individuals from this cohort were tested for post-heparin LPL activity and a subgroup of 120 participants with low LPL activity was assessed for mutations in the coding region of the LPL gene using single strand conformation 70 Chapter III polymorphism (SSCP) and density gradient gel electrophoresis (DGGE). Only 3 amino acid substitutions were detected in the 120 C A D patients examined. Each amino acid substitution was subsequently characterized in the entire cohort. 71 Chapter III 3.2 METHODOLOGY. 3.2.1 Patients A total of 820 men already taking part a study called REGPvESS were eligible for this study. The REGRESS study, described in detail elsewhere by Jukema et al.(Jukema et al., 1995), was designed as a double blind, placebo-controlled, multicenter study in the Netherlands to assess the effect of treatment on the progression and regression of coronary atherosclerosis. A l l patients were males of Dutch descent, below 70 years of age, who had angiographicaly documented coronary artery disease (>50% of a major vessel). Patients were specifically excluded if they had unstable angina or had had a myocardial infarction within the preceding six months of the study. A l l patients had total cholesterol between 4 and 8 mmol/L and triglyceride levels below 4mmol/L. A family history of C A D was recorded for patients who had at least one first-degree relative with coronary disease before the age of 60 (defined as myocardial infarction, sudden cardiac death, coronary artery bypass surgery or percutaneous transluminal coronary angioplasty). 3.2.2 Quantitative Coronary Arteriography (OCA) The quantitative coronary arteriographic (QCA) procedures are described in detail in Jukema et al. (Jukema et al., 1995). Briefly, baseline coronary cinearteriography was performed 5 to 10 min. after oral administration of 5 to 10 mg isorbide dinitrate sublingually and analyzed by QCA using the Cardiovascular Measurement System (CMS-72 Chapter III MEDIS Medical imaging systems). The coronary tree was divided in 13 segments according to the American Heart Association classification, excluding the posterolateral branches. Minimum obstruction diameter (MOD), mean segment diameter (MSD) (Figure 3-1) and percent diameter stenosis (% D-stenosis) were calculated for each qualifying segment. To calculate an average per patient, the MOD, MSD and % D-stenosis of all qualifying segments were added and divided by the number of contributing segments. MSD MOD Figure 3-1 Diagram showing the mean segment diameter (MSD) and minimum obstruction diameter (MOD). 3.2.3 Lipid and lipoprotein analysis Blood samples were collected from C A D patients after an overnight fast. Al l lipid laboratory tests were carried out at the Lipid Reference Laboratory, as previously described (Jukema et al., 1995). Total cholesterol was measured with an enzymatic kit ( Boehringer Mannheim) and calibrated with a human serum calibrator. HDL-C was measured after precipitation of apolipoprotein B- containing lipoprotein with a 4% tungstate solution and 73 Chapter 111 centrifugation (Allain et al., 1974), and the triglycerides were analyzed enzymatically (Bayer/Technicon) by a technique that included free triglycerol (Buccolo and David, 1973). LDL-C was calculated from total cholesterol HDL-C and triglycerides according to the Friedewald formula (Friedewald et al., 1972). 3.2.4 Denaturing Gradient Gel Electrophoresis (DGGE) PCR-primers were designed based on the melting maps of the different exons of the LPL-gene and the complementary DNA sequence (cDNA) published by Wion et al. (Wion et al., 1987). One primer, either 5'- or 3', of each set was designed to contain a 40 nucleotide GC-clafnp according to (Myers et al., 1985). Sequence and position of the primers are listed in Table 3-1. Melting maps of all segments to be analyzed were generated with the Melt87 computer algorithm (Lerman and Silverstein, 1987). Melt87 calculates the melting temperature of each exon as a function of its nucleotide sequence and composition. Translation of the calculated melting temperature into a range of denaturing agents gives a rough indication for the DGGE-gel conditions. GC-clamped PCR-products were run through 6% polyacrylamide gels containing a gradient (0 to 80%) of denaturing agents (100% = 7M urea and 40% deionized formamide [v/v]). Electrophoresis was performed in a temperature controlled bath at 100V for 17 hours at 60oC in TAE-buffer (40mM Tris-Acetate, ImM EDTA, pH=7.4). The denaturing range of each exon was then optimized, aiming at the appearance of heteroduplex D N A fragments of a positive control in the 74 Chapter III middle portion of the gel. Gels were stained with ethidium bromide and photographed on a UV transilluminator. 3.2.5 SSCP analysis SSCP analysis of the LPL gene was performed as described in section 2.2.2 3.2.6 Sequencing Exons showing changes in either DGGE or SSCP as compared to a normal control were amplified by PCR and sequenced either directly after a purification/denaturation step using streptavidin coated Dynal-beads (Dynal A.S Oslo) or after cloning into a TA cloning vector (Invitrogen Inc., San Diego, CA). Single-stranded DNA sequencing was performed on both strands by the dideoxy chain termination reaction method using Sequenase version 2.0 (US Biochemical., Cleveland OH) or by Taq DydeoxyTM Terminator Cycle Sequencing Kit method (ABI, Foster City, CA). 3.2.7 Variant analysis Rapid PCR-based methods of detection were utilized to confirm the genotype of carriers and for screening the entire cohort. Mismatch PCR and restriction enzyme digest were performed as described in section 2.2.4. The promoter mutation -93 was detected as 75 Chapter III described earlier by Deeb (Yang et al., 1995). Screening of the entire cohort was performed for the three amino acid substitutions D9N, N291S and S447* only. 3.2.8 Post heparin LPL activity and mass Post-heparin LPL activity was measured in C A D patients only. Blood was collected in heparin tubes 20 minutes after injection of heparin (50IU/kg body weight) intravenously in the opposite arm. Post-heparin lipoprotein lipase was determined as described by (Huttunen et al., 1976). Specific inhibition of hepatic lipase was achieved using a goat antibody directed against human post-heparin hepatic lipase. Lipoprotein lipase activity was determined by using a gum acacia-stabilized [3H]trioleoylglycerol as substrate. The released free-fatty acids from the substrate were extracted and counted in a liquid scintillation counter. Pooled plasma with low and high LPL activity was included as a reference in each series of determinations. LPL mass was determined in a selected number of C A D patients without P-blockers (see results section: N291S mutation) according to the methods described in section 2.2.5. In these patients LPL activity, as reported in Table 3-6, was also determined as described in chapter II. 76 Chapter III 3.2.9 Statistical analysis. Allele frequencies were determined for all 3 polymorphic loci (N291S, D9N and S447*) and tested for Hardy-Weinberg equilibrium using % analysis. A l l loci were found to be in Hardy-Weinberg equilibrium. The change of the lipid values and the angiographic parameters were analyzed with two-way A N C O V A with randomized therapy (placebo or pravastatin) and the presence of the mutation as fixed factors and baseline values as covariates. Time to first clinical event was analyzed with the Cox model. The effect of pravastatin on carriers compared to non-carriers was assessed with the test for interaction between presence and absence of mutation. A value of P<0.5 was considered significant. Differences among categorical variables were tested using the Pearson %2 test. 3.2.9.1 Statistics for the N291S mutation Patients and controls were compared with regards to baseline characteristics. With regards to lipids and LPL activity values, data were analyzed excluding those subjects on P-blockers which might alter lipid and LPL levels. Demographics, lipid and LPL activity were tested for equal variance using the F-test. Homoscedastic values were analyzed using the student's t test, while heteroscedastic values were analyzed with the Welch's approximate test. A total of 296 unrelated males who were part of a population based risk-factor study (Verschuren et al., 1993) and who did not have any history of angina or myocardial 77 Chapter III infarction, were not diabetic, and were not treated for hypertension or dyslipidemia were ascertained to assess the frequency of the N291S mutations in the general population. These controls were less than 60 years of age. 3.2.9.2 Statistics for the D9N mutation Patients with and without the D9N mutation were compared with respect to baseline characteristics and changes in lipid values. Differences with respect to baseline parameters were analyzed with the student's t test. 3.2.9.3 Statistics for the S447* mutation Non parametric analyses were conducted to test mean differences among the groups. A l l the values reported are from the non-parametric analyses Kruskal-Wallis. Analyses were carried out both on unadjusted variables and variables adjusted for age2, body mass index (BMI), alcohol and smoking without affecting the conclusions. The results presented are from the unadjusted analyses. 78 Chapter III Table 3-1 List of primers for D D G E analysis. Region DGGE Fragment size (nucleotide) Promoter-1 5 ' - (CG)20ATGTGTGTCCCTCTATCCCTAC ATT-3' 341 (-450 to -200) 5 ' -G A A A G G G C A G A C G G A A A A A T T T G C T - 3 ' Promoter-2 5 ' - (CG)20AGCAAATTTTTCCGTCTGCCCTTTC-3 ' 228(-176to-36) 5 ' -CTTATGTGACTGG A A A T A T G C A A A - 3 ' Exon 1 5 ' - (CG)20ATATTTCCAGTCACATAAGCAGCCT-3 ' 382 5 ' -AGGGG A G T T T G C G C G C A A A - 3 ' Exon 2 5 '-(CG)20CTCATATCCAATTTTTCC-3' 251 5 ' -CTCTTCCCCAAAGAGCCT-3 ' Exon 3 5 '-(CG)20 A AGCTTGTGTC ATCAT-3 ' 299 5 ' - C T G G C T C C A G T C A A A A A C A C T G T - 3 ' Exon 4 5 ' -CCTATATTTGG A A A A C A A T A T T T A T A T T C A-3' 347 5 '-(CG)20CC A C A C ATGTGGGTATTTA A C A A A ATT-3 ' Exon 5 5 ' - (CG)20TGCCAGTGCATTCAAATGATGAGCAGTGAC-3 ' 415 5'-A A G G G T T A A G G AT A A G A G T G A C A T T T A ATT-3' Exon 6 5 '-(CG)20CAAATG A A C A C T C T T T G T G A ATTTCT-3 ' 391 5 ' -AGGACTCCTTGGTTTCCTTATTATTTA-3 ' Exon 7 5 ' -G ATACTTCTGTGGTTCTG AATTGCCTG-3 ' 303 5 ' - (CG)20CAAGGGTTATGGCAGGAG AGGGACT-3 ' Exon 8 5 ' - T A T T T G G A G A G G A G A A A A A A A A G T G G G - 3 ' 391 5 ' - (CG)2()GAATTGTGAAGGCCCCTGAAATACAG-3 ' Exon 9 5 '-(CG)20CCTGACAG A A C T G T A C C T T T G T G A A C A - 3 ' 293 5 ' -GAATGCATGAAGCTGCCTCCCTTAG-3 ' 79 Chapter 111 3.3 RESULTS 3.3.1 Mutation analysis We initially screened for functional mutations in the LPL gene of C A D patients with low LPL activity. A total of 163 patients had an PH-LPL activity in the lowest quartile (<77mU/ml). Of these, 120 patients were randomly chosen for screening of the coding region of the LPL gene. It has been well established that although screening methods for mutation detection are highly efficient (over 80%), specific mutations can sometimes escape detection. The mutation screening was therefore carried out by submitting the entire group with low LPL activity (120 patients) to denaturing gel gradient electrophoresis (DGGE) and half of the patients to single strand conformation polymorphism (SSCP) to ensure that no mutation was missed in the sample. SSCP and DGGE showed equal sensitivity in our system. A l l mutations detected with one method were also detected using the other method. Table 3-2 and Table 3-3 provide a summary of the findings. Each exon showing a change was sequenced to determine the source of the aberrant migration. Three previously described silent changes (see chapter II) were detected in exon 3 (nucl. 405), exon 4 (nucl. 435) and exon 8 (nucl. 1164) with a carrier frequency of 7.5%, 3.3% and 15% respectively. Specific restriction digests of the PCR products of all 120 patients confirmed this finding. 80 Chapter III A total of 8, 13 and 17 patients were found to carry the described amino acid substitution D9N (exon 2), N291S (exon 6) and S447* (exon 9) respectively. These were the only mutations present in the coding region of the LPL gene in the 120 low LPL activity patients screened in this study. The recent description of promoter mutations in the LPL gene which result in reduction of transcription in vitro prompted us to screen the first 450 nucleotides of the LPL promoter in these patients. The results indicate that all 8 patients who were previously found to carry an D9N mutation were simultaneously carrying a -93 promoter mutation, confirming previous reports that N9 and -93 mutations are in strong linkage disequilibrium (Yang et al., 1995; Yang et al., 1996; Ehrenborg et al., 1997). A mutation at position -95 was also identified. This mutation has been reported by Yang et al. to be non-functional (Yang et al., 1996). The entire cohort of C A D patients was then genotyped by PCR for the amino acid substitutions (D9N, N291S and S447*) and the promoter mutation (-93). It should be noted that all carriers of D9N were shown also to carry the -93 promoter variant. Because the effect of these mutations cannot be distinguished, in this chapter, D9N will refer to the effect of both mutations. 81 Table 3-2 Amino acid substitution in the LPL gene Chapter III Region DNA changes C A D patients with low C A D cohort Controls LPL activity (N=l20) (A) (B) (C) % % % Exon 2 D9N 677% 4.6%b 1.4% Exon 6 N291S 10.8%a 5.2% 4.6% Exon 9 S447* 14.2% 18.5% 18.6% a: A versus B; P value=0.03 b: B versus C; P value = 0.008 Table 3-3 Other changes in the LPL gene of 120 C A D patients with low LPL activity (<77 mU/ml) Region D N A change Number (%) promoter -93 8 (6.7%) -95 3 (2.5%) Exon 3 (405)G to A 9 (7.5%) Exon 4 (435)G to A 4(3.3%) Exon 8 (1164)Cto A 18(15%) 82 Chapter III 3.3.2 N291S mutation 3.3.2.1 General findings The N291S mutation occurred in 42 /807 (5.2%) ofthe patient group with C A D (Table 3-4) and was seen in increased frequency in patients with low levels of HDL-C (hypoalphalipoproteinemia). As baseline HDL-C levels decreased in the C A D group, the relative proportion of patients with this mutation increased, both in the total unselected group, and in the group not treated with P-blockers (Figure 3-2 A and B). Many of the patients in this cohort (581/807) were on P-blockers, a treatment which can decrease HDL-C levels. After exclusion of patients on P-blockers, the frequency of patients with the N291S mutation increased from 1.1% (1/89) for HDL-C >1.0mmol/L to 9.4% (11/117) for HDL-C <lmmol/L (P=0.01). This frequency increased to 12.8% (6/47) for those with a HDL-C level <0.8mmol/L (Figure 3-2B). The N291S mutation was seen in 4.6% (10/215) of controls (Table 3-2). Similar to what was seen in the C A D group, this mutation was significantly enriched in individuals with lower HDL-C levels in the control population (Figure 3-2 C). 3.3.2.2 Lipids and LPL activity We sought further evidence of the functional nature of this mutation by looking at the effect of this mutation on lipids and LPL catalytic activity. In the C A D patients, there were no 83 Chapter III significant differences in age, BMI, proportion of smokers or persons using p-blockers between individuals with or without the N291S mutation. Compared to the control group, C A D patients had a significant increase in total cholesterol (P<10~5), LDL-C (P<1'0"5) and triglycerides levels (P<10"5) and also had decreased HDL-C levels (P<10"5) (Table 3-4 and Table 3-5). Within the C A D group, carriers of the N291S mutation showed decreased HDL-C levels (P=0.04) compared to non-carriers (Table 3-4). When C A D patients on P-blocker were excluded from the analysis, individuals with the N291S mutation also had significantly reduced HDL-C levels compared to non-carriers (P=0.001). Similarly, the controls with the N291S mutation also had lower HDL-C levels than those without the mutation (P=0.04) (Table 3-5). C A D patients with the N291S mutation had slightly reduced post-heparin LPL activity compared to non-carriers although this did not reach statistical significance (97mU versus 108mU respectively; P=0.18). We also analyzed post-heparin LPL activity and mass in C A D patients not taking P-blockers. Ten C A D patients with the N291S mutation and 17 without this D N A change were randomly chosen for assessment of LPL in our laboratory. A similar proportion of smokers was present in both groups. The results show that carriers of the N291S mutation have significantly reduced LPL activity (63% of controls) and LPL immunoreactive mass (73% of controls) compared to individuals without the mutation 84 Chapter III (Table 3-6). The specific activity of the enzyme was also significantly reduced in carriers of N291S(P<0.009). 3.3.2.3 Angiographic measurements and lipid profile after pravastatin therapy. Analysis of the impact of the N291S mutation on the angiographic parameters after a 2 year follow-up revealed no significant differences between carriers and non-carriers as measured by MOD, MSD, % D-stenosis, number of vessels affected and clinical events during this trial. Similarly, there were no significant differences in lipid levels between N291S carriers and non-carriers under pravastatin therapy, indicating that this mutation did not influence the response to pravastatin therapy. 85 Chapter Table 3-4 Baseline characteristics of patients with and without the N291S mutation Non-Carriers (n=778) Mean ± SD N291S (n=42) Mean 1 SD P value Age 56+8 55+3 0.25 BMI 26±3 2613 0.49 Familial Heart Disease 48% 58% 0.26 P-Blocker user 72% 69% 0.42 Total Cholesterol mmol/L 6.04±0.87 6.0110.71 1.0 LDL-C mmol/L 4.31±0.79 4.2510.73 0.84 HDL-C mmol/L 0.9310.22 0.8510.17 0.04 Triglycerides mmol/L 1.7810.76 2.0210.69 0.60 86 3 <U M O • ca. TJ cu ts cu o c c o s as CN o CS TJ TJ c/a t U > T3 "cu C/a CQ cu ca H cu c/a cd cu oo |TJ c? CU C o i-o o 1-8 CU c/a c3 cu c/a |T5 £ ? • cu t: CS c o t-o O > +1 c co ^ 2 u o CN — io CO ,—, C/3 +1 C CO cu cu 3 CQ c/a > < Os SO O CN S O ro © © oo 3 3 io CN CN OS 0O CN +1 +1 oo s o <o CN oo ro +1 +1 m s o i o CN SO 00 — SO CN o o o © © CN CN IO OS OS ro SO o o O +1 +1 +1 +1 o oo IO >/o IO Os r-~ <ri ro o CN ro OS SO 00 CN O O © O ' +1 +1 +1 +1 i o ro CN IO s o oo SO v i ro Os SO IO oo CN '—' © © © , '. +1 +1 +1 +1 i o CN — o s o 00 IO ro r —' a oo r- -—< SO oo Os O o o o © o © SO ro 00 00 — ©>' © c a o +1 +1 +1 +1 SO IO o o ro 00 OS SO •t' o o SO CN OS oo CN r-o o O © ' +1 +1 +1 +1 — o ro <—' ro p SO SO o IO oo CN o o O o +1 +1 +1 +1 — r-- OS — ro OS SO s o o cu 0B < CQ o o cu c/) _aa o u ~B o H U I Q oo O _j Q CC cu 12 cu o O i ) tea cu cu e o CM C^ Chapter III <0.80 0.81-0.90 0.91-1.00 1.01-1.10 1.11-1.20 >1.20 HDL-C mmol/L (6 / 47) (0 / 23) (0 / 34) < 0.80 0.81-0.90 0.91-1.00 1.01-1.10 1.11-1.20 >1.20 HDL-C mmol/L (5 / 27) <0.80 0.81-0.90 0.91-1.00 1.01-1.10 1.11-1.20 >1.20 HDL-C mmol/L Figure 3-2 Frequency of LPL N291S mutation in relation to HDL levels, a, The complete group with CAD. b, C A D patient not treated with (3-blocker therapy, c .Control group. The mutation frequency increases in patients with lower HDL-C values in all groups. 88 Chapter III Table 3-6 Baseline lipase activity in C A D patients not on P-blockers N29IS mutation Non-carriers Carriers P value N=17 N=10 Age 56+7 59±8 0.31 BMI 25±3 26±2 0.28 LPL activity (mU) 230±68 146+47 <0.001 Total mass (ng/ml) 897±280 6511204 O.003 Specific activity 0.34±0.08 0.2610.03 <o.oor (nmol FFA/min/ng) Hepatic lipase activity (mU) 139±47 131134 0.42 a: Welch's approximate test 3.3.3 D9N mutation 3.3.3.1 General findings A total of 4.6% (38/810) of the C A D patients carried the D9N mutation. There were no significant differences in age, BMI and P-blocker usage between carriers and non-carriers. C A D patients with the D9N mutation had more frequently a positive history for cardiovascular disease (P=0.03) and had lower HDL levels at baseline (P=0.01) than C A D patients without the mutation (Table 3-7). Total cholesterol, LDL-C and triglycerides showed a trend toward elevation in D9N carriers that did not reach statistical significance (Table 3-7). Similar to patients with the N291S mutation, carriers of the D9N mutation were seen at increased frequency in patients with low levels of HDL-C (Figure 3-3). For 89 Chapter III example, patients carriers of the D9N mutation were 2.2 times more likely (P=0.03) to have HDL-C levels below 0.9mmol/L compared to non-carriers. 3.3.3.2 LPL activity C A D patients with the D9Nmutation also had slightly reduced post-heparin LPL activity compared to non-carriers although this did not reach statistical significance (97 mU versus 108 mU respectively; P=0.2). Unfortunately, the very low number of D9N carriers not on P-blocker therapy prevented us from performing the analysis of LPL activity on individuals not taking P-blockers. 3.3.3.3 Angiographic measurements and lipid profile after pravastatin therapy Mean changes of lipid parameters are reported in Table 3-8. Within the group of patients who received pravastatin, the reduction of total cholesterol and LDL-C was less pronounced in patients with the D9N mutation compared with patients without the mutation (P=0.02 and P-0.008 respectively). There were no significant differences within the placebo group between carriers and non-carriers. Results of the angiographic procedures are presented in Table 3-9. In the placebo group, patients with the D9N mutation showed a significant reduction of MOD (baseline minus 2 year follow-up) compared to non-carriers indicating a marked progression of focal 90 Chapter III atherosclerosis in carriers of the mutation (P=0.03). There were no significant differences between mutation carriers and non-carriers in response to pravastatin therapy. Carriers in the placebo group showed a significant increase of % D-stenosis compared to patients without the D9N mutation (P=0.004). Again there were no significant difference in the pravastatin group between carriers and non-carriers. The interaction test between randomized therapy and D9N mutation had a probability value of 0.038 indicating that the deleterious effect of the D9N mutation could be overcome by pravastatin therapy. There were no significant changes of MSD (change of diffuse atherosclerosis) or number of vessels affected between carriers and non-carriers in either the placebo or the pravastatin group. After 2 years of follow-up, 90% of the patients in the pravastatin group without the D9N mutation and 79% of the patient carrying the mutation were event-free, while in the placebo group these numbers were 81% and 73% respectively. The relative risk of the presence of the D9N mutation for any clinical event was therefore estimated at 2.16 (95%CI 1.09-4.29; P=0.027) after adjusting for pravastatin therapy and calcium channel-blocking therapy which were the only statistically independent prognostic factors for clinical event-free survival. 91 Chapter III Table 3-7 Baseline characteristics of patients with and without the D9N mutation Non-Carriers D9N P value (n= 772) (n=38) Mean + SD Mean 1 SD Age 56±8 54+8 0.15 BMI 26±3 2613 0.90 Familial Heart Disease 47% 66% 0.03 (3-Blocker user 73% 82% 0.24 Total Cholesterol mmol/L 6.0210.85 6.2610.77 0.11 LDL-C mmol/L 4.3010.76 4.5010.77 0.14 HDL-C mmol/L 0.9410.22 0.8310.17 0.01 Triglycerides mmol/L 1.7810.73 1.9910.84 0.13 <0.80 0.81-0.90 0.91-1.00 1.01-1.10 1.11-1.2 >1.2 HDL-C mmol/L Figure 3-3 Frequency of LPL D9N mutation in relation to HDL levels 92 Chapter III Table 3-8 Changes in lipid levels in patient with and without the D9N mutation Placebo (meanisd) Pravastatin (mean±sd) Non-carrier Carrier P value Non-carrier Carrier P value D9N mutation (n=374) (n=23) (n=398) (n=l5) Total Cholesterol mmol/L 0.1410.74 0.11 ±0.90 0.83 -1.34+0.84 -0.7910.94 0.02 LDL-C mmol/L 0.01+0.65 -0.01+0.86 0.92 -1.39+0.74 -0.8210.95 0.01 HDL-C mmol/L 0.03±0.16 0.03±0.11 0.90 0.1010.17 0.0710.20 0.49 Triglycerides mmol/L 0.22±0.81 0.19±0.74 0.89 -0.1310.72 -0.0810.43 0.8! indicates a reduction of the lipid level at follow-up) Table 3-9 Changes of angiographic parameters and clinical events in patients with and without the D9N mutation Placebo Pravastatin D9N mutation Non-carrier Carrier P value Non-carrier Carrier P value MOD,mm a MSD, mma % Diameter Stenosis3 -0.1210.21 -0.2510.58 0.029 -0.1110.21 -0.1210.26 0.98 1.415.6 6.4116.4 0.004 Event-free after 2 years, 81% (77-85) 73% (54-92) 0.38 % (95%CI) -0.0910.34 -0.0710.19 1.319.1 0.0110.17 0.40 -0.0110.12 0.41 -0.714.2 0.51 90%> (87-93) 79%. (57-99) 0.15 a:. Follow-up minus baseline measurements. Values presented as measn ± sd 3.3.4 S447* mutation 3.3.4.1 General findings A total of 149 C A D patients (18.5%) carried at least one copy ofthe S447* allele and 6 (0.74%) were homozygous for this mutation. There were no significant differences in age, BMI and (3-blocker usage between S447* carriers and non-carriers in the C A D group (Table 3-10). There were no significant differences in total cholesterol and LDL-C between 93 Chapter III carriers and non-carriers. However, C A D carriers of the S447* mutation had significantly higher levels of HDL-C (P=0.007) and lower levels of triglycerides (P=0.04) compared to non-carriers. In contrast to N291S and D9N carriers, carriers of the S447* mutation were seen at increased frequency in patients with high levels of HDL-C (Figure 3-4) with carriers \ being 1.6 times more likely to have HDL-C above 1 mmol/L than non-carriers (P-0.037). 3.3.4.2 LPL activity With regards to LPL activity, C A D subjects carrying the S447* mutation showed significantly higher levels of LPL activity compared to non-carriers (119 mU and 107 mU; P=0.034). This analysis was repeated after stratifying the group between P-blocker users and non-user. The frequency of the S447* mutation did not differ significantly between users and non-users. As shown in Table 3-11, for those patients on P-blockers, LPL activity in carriers was significantly increased. In addition, in the P-blocker group, carriers of the S447* mutation had increased HDL-C levels compared to non-carriers. A test for interaction between p-blocker therapy and the S447* mutation had a probability value of 0.026, suggesting that the negative effect of P-blocker therapy on lipids profile is reduced in carriers of the S447* mutation. 94 Chapter III 3.3.4.3 Angiographic measurements and lipid profile after pravastatin therapy. Analysis of the impact of the S447* mutation on the angiographic parameters after a 2 year follow-up revealed no significant differences between carriers and non-carriers as measured by MOD, MSD, % D-stenosis, number of vessels affected and clinical events during this trial. Similarly, there were no significant differences in lipid levels between carriers and non-carriers under pravastatin therapy. Similar results were obtained when looking at patients with or without (3-blocker therapy. Table 3-10 Baseline characteristics of patients with and without the S447* mutation Non-Carriers (n= 662) Mean 1 SD S447* (n=149) Mean 1 SD P value Age 56±8 57+8 0.07 BMI 26±3 26+3 0.35 Familial Heart Disease 50% 44% 0.19 (3-Blocker user 72% 71% 0.88 Total Cholesterol mmol/L 6.05±0.88 5.9810.88 0.43 LDL-C mmol/L 4.3110.78 4.2710.78 0.52 HDL-C mmol/L 0.9210.23 0.9610.20 0.01 Triglycerides mmol/L 1.8110.77 1.6710.73 0.04 95 Chapter III Figure 3-4 Frequency of LPL S447* mutation in relation to HDL levels Table 3-11 Mean LPL and HDL-C levels among non-(3-blocker users S447* N LPL activity (mU) mean±sd P value N HDL-C (mmol/L) meanisd P value No P-blockers Carrier 32 112.7±58.9 43 0.9910.22 Non-carrier 141 113.5146.8 0.59 187 0.9810.25 0.75 P-blockers Carrier 88 121.3148.2 104 0.9410.19 Non-carrier 378 104.6139.5 0.005 470 0.8910.21 0.002 96 Chapter III 3.3.5 Effect of LPL activity on lipids and severity of coronary artery disease The design of the REGRESS study provided us with the unique opportunity to examine the effect of LPL activity on lipids and CAD. While the influence of post-heparin LPL activity on plasma lipids has been documented on numerous occasions, prior studies suffered from many pitfalls such as low number of patients, mixed gender and variable LPL activity assays. The Regress study offered the advantage of a large single gender cohort with documented LPL activity from single assay procedure, lipid levels and angiographically defined CAD. Patients with LPL activity values were stratified by LPL activity tertiles to analyze the effects of LPL activity on lipid and anthropometric parameters (Table 3-12). Statistical analyses were performed by comparing each tertile to the first tertile (lowest). Only one patient was excluded as an outlier. In this cohort there were no differences in age, E5MI and glucose levels between LPL activity tertiles. Similarly there were no differences in the frequency of smokers or in the frequency of (3-blocker users. A clear association between LPL activity and lipid profile was present in this cohort. Major changes in lipid levels were noted for triglycerides, V L D L - C and HDL-C levels in the high LPL activity tertile. High LPL activity (3rd tertile) was associated with a 19% decrease in triglycerides levels (PO.01). In contrast, HDL-C levels were increased by 17% (PO.01) 97 Chapter III and total cholesterol and LDL-C were slightly increased by 4.4% and 6.5% respectively (P<0.01). The total cholesterol/HDL ratio was found to be significantly lower in the third fertile (12%; P<0.01). Changes in the second fertile represented approximately half of the changes observed in the third fertile. 1.3.2 LPL tertiles and coronary scores The effect of LPL activity on the extent and severity of coronary disease was also analyzed by LPL tertiles. The familial history of myocardial infarct was similar in each tertile of LPL activity (data not shown). The severity of coronary disease as expressed by the MOD and MSD showed no association with LPL tertiles. Similarly we found no association between LPL tertiles and the number of diseased vessels (P=0.179) (Table 3-13). However, baseline New York Heart Association (NYHA) classification for severity of angina pectoris was significantly different between LPL tertiles. Patients in the higher tertiles of LPL activity reported significantly less severe anginal pain (NYHA class >2) than patients in the lower tertiles (OR: 2.49 (95%CI: 1.7-3.7). This became more evident in the "NYHA class 4" group where the odds ratio reached 7.0 (95% CI: 2.4-20.3). A strong inverse correlation was established between LPL activity and anginal pain (R= - 0.20; PO.OOl). This inverse relationship was maintained after exclusion of patients on P-blockers. 98 6 > _CU 'S, Cd s c/a J3 T3 C cd £ _> "+-» o cd cd . & _fi '53 +J o u. o OH H J CN cn cu tc H -q C/j i <D JD ' £ T ? CU H n CU H c/a T3 c/3 CU e io cn cn ON © © cn o o o o © V © © © V © © © V © © © V 3 S cn ON CN i CN CN O N VO cn VO rt r-- CN ^ ^ oo r-» CN vo rt W W O O © © in O N W W W W W vd i n ^ ^ O r -^ N ^ . t S ^ ^ vo rt • vo rt — i rt CN CN rt CN (N i CN CN CN CN CN CN CN CN CN CN CN CN oo c n oo H § H < OH h-l H-l © © CN © OO m vo OO O N VO in © © rt 00 00 © CN vo CN © © © © © © © © ' © © ' © 3 § CN oo VO in © in rt 00 d 00 r- CN r- VD © , © , o, rt cn "—' v i oo vd vd CN 6.04 4.31 0.92 1.80 6.82 ,—i rt rt O N O N rt O N CN CN ^ H CN CN CN CN CN CN CN OO CN in O N in U-i in CN rt CN CN O N © VO" 00 © O N CN ©" 00 O N © , © ^ © , © , O N VO 00 r--O N CN iri rt o r< rt CN CN CN CN CN CN CN CN rt CN CN CN CN CN .2 T J c/3 ¥ CU s c cu 00 T J CO ¥ <D B c/a rt a u TJ c/a s e - i Q i—1 Q T J c/a CU 1_J e Q n ^ 3 CN v i CN OO T J U c/a O § PQ H H0 O H 3 CN i oo 0O oo I l O N O N .—i 00 © © O N O N CN 1—1 © o © © © © © © ' V © © V CN VD in oo i/~> OO CN m cn od CN © © © © ' —< CON 00 CN vo © in in un cn IT ) rt O N >ra CN vd •St ^ in rt VO rt rt rt rt vo ira vo VO vo vo vo vo © © O N VO CN vo © O N in O N in CN CN © CN ON in in © OO oo © © © © © O © © © O N in O N CN O IT) oo CN VO in od CN © © o © rt ^—s ^—s OO O N oo ON rt in vd iri O N CN ON vq cn >ra CN iri rt © vd © © © © o © vo IT) VO VO VO VO vo CN" © " CN" vo" in* '—* O N oo CN cc cn © © © © —^^  s^ © 00 cn ON 00 CN iri © cn 00 oo m CN vd rt © oo rt oo rt rt rt rt icn vo iri VD VO VO vo 1. T 3 N^ <D s CD bfi T3 c/a T3 c/a I cu CU s ^ ^ ^ < CQ H c/a* I cu H-l Q H J T3 c/a I CU H J Q X T3 C cd cu a c H J Q r—1 H 3 cr 00 fi rt O o T3 » C/3 CD » CD 3 Q oo _C 'c/a C O c/a 'C cd fin a o o CD C/3 cd rt Chapter III Table 3-13 Effect of lipoprotein lipase activity on the extent of CAD and angina pectoris 1 st Tertile 2nd Tertile 3rd Tertile P value ALL PATIENTS LPL activity range 13-85 mU/mf 86-121 mU/ml 122-293 mU/ml Extent of CAD: Number (%) 1 Vessel 85 (38%) 91 (41%) 102 (46%) 2 Vessels 74 (33%) 84 (38%) 70 (31%) 3 Vessels 64 (29%) 45(21%) 52 (23%) 0.1730 Total 223(100%) 220(100%) 224(100%) N Y H A angina class: Number (%) I 22(10%) 16(7%) 34(15%) II 85 (39%) 120 (55%) 125 (56%) III 89 (40%) 70 (32%) 61 (27%) IV 25(11%) 14(6%) 4 (2%) Total 221 (100%) 220(100%) 224(100%) 0.001" WITHOUT B-BLOCKERS LPL activity 24-87mU/ml 88-125 mU/ml 126-273 mU/ml Extent of CAD: Number (%) 1 Vessel 30 (49%) 27 (45%) 39 (64%) 2 Vessels 20 (33%) 20 (33%) 12(20%) 3 Vessels 11 (18%) 13 (22%) 10(16%) Total 61 (100%) 60(100%) 61 (100%) 0.26 NYHA angina class: Number (%) I 10(16%) 6(10%) 13 (21%) 11 25(41%) 37 (63%) 37(61%) III 21 (35%) 13 (22%) 11 (18%) IV 5 (8%) 3 (5%) 0 (0%) Total 61 (100%) 59(100%) 61 (100%) 0.03 b P value comparing each group to each other using Pearson x2test. Correlation by Pearson coefficient a: Pearson R=-0.202 p=0.0000 b: Pearson R=-0.208 p=0.005 100 Chapter III 3.4 DISCUSSION A family history of coronary artery disease is an important risk factor for developing heart disease (Roncaglioni et al., 1992; Silberberg et al., 1998). Moreover in approximately 40% of patients with premature CAD, a familial lipoprotein disorder with low HDL-C is present (Genest, Jr. et al., 1992). Despite the recognition that genetic factors modulate the risk for C A D through alteration of plasma lipids and lipoproteins levels, the molecular basis underlying many of these lipid disorders has not been elucidated. LPL represents one of the most appealing candidate genes that might explain at least part of the lipid and lipoprotein abnormalities seen in C A D patients. We sought to investigate the role that LPL variants might play in the predisposition to C A D in the population by studying a group of 820 male C A D patients of Dutch ancestry participating in the regression trial "REGRESS Study". Anthropomorphic measurements, lipid values and quantitative coronary arteriography (QCA) were performed at the initial visit and repeated after a two-year period to monitor the evolution of CAD. Post-heparin LPL activity measurements were performed in 676 C A D patients included in the study. Using this information, we randomly selected 120 C A D patients with low LPL activity (lowest quartile) to be screened for variation in the LPL gene. To our knowledge, this is the largest group of C A D patients ever screened for mutations in the LPL gene. 101 Chapter III Our results indicate that only 3 common amino acid substitutions can be found in the coding region of the LPL gene in C A D patients. Approximately 5.2% of the C A D patients were carriers of a N291S mutation, 4.6% carried a D9N and 18.5% carried a S447* mutation. A l l three mutations were associated with significant differences in HDL-C levels in carriers of the mutations versus non-carriers. However, while the N291S and D9N were associated with decreased HDL-C, the S447* was associated with an increase in HDL-C. Our data indicate that the association between HDL-C and the S447* mutation remains valid only when considering individuals under p-blocker therapy. Similarly, LPL activity was higher in carriers of the S447* mutation compared to non-carriers only in those individuals using P-blockers. Day et al. reported that individuals under P-blocking therapy showed slower triglyceride removal associated with higher total cholesterol, LDL-C and lower HDL-C (Day et al., 1984), suggesting a possible inhibition of LPL by P-blockers. While this initial observation has been confirmed, the exact mechanism by which P -blockers inhibit LPL activity has not been clarified. Kubo et al. presented evidence that lipophilic P-blockers may interfere with LPL action by binding to phospholipids on lipoproteins at the cell surface membrane, possibly preventing LPL from gaining access to the substrate (Kubo and Hostetler, 1987). Nevertheless, our results strongly suggest that individuals carrying a S447* mutation respond differently to P-blocking agents, allowing the carriers to resist the negative impact of P-blockers on plasma HDL-C. These results 102 Chapter III suggest that the loss of 2 amino acids at the C-terminal portion of the molecule interferes with the natural interaction between LPL and P-blockers, possibly through altered binding of the mutant LPL to either lipoproteins or cell surface proteoglycans. Individuals carrying this mutation may therefore have an advantage and resist better to factors which could otherwise increase their risk of developing C A D . Carriers of both the D9N and N291S mutations were found at an increased frequency in C A D patients with low HDL-C. For the D9N carriers, it was demonstrated that these carriers who present with relatively subtle disturbances in lipoprotein metabolism showed accelerated progression of coronary atherosclerosis and a reduced clinical event-free survival. To determine if these differences in progression of coronary atherosclerosis could be attributed to the changes in lipid levels, a subset of C A D patients matched for lipid levels (carrier HDL ± 0.05mmol/L; carrier triglycerides ± O.lOmmol/L; carrier LDL ± 0.5mmol/L) were selected and compared to the carriers for progression of atherosclerosis. These patients (97 C A D patients) did not differ significantly from carriers with regards to baseline characteristics. Again, progression in the placebo group was significantly larger in carriers than in matched non-carriers (P= 0.016 and P=0.035 for MOD and % D- stenosis respectively) suggesting that the negative effect of the D9N mutation on progression of atherosclerosis may not be solely explained by the changes in fasting plasma lipid. This 103 Chapter III strongly suggests that other functions of the LPL protein may be involved in modulating the risk for atherosclerosis. Despite their effect on HDL-C, the N291S and S447* mutations showed no significant association with the progression or regression of coronary atherosclerosis. While our study may have lacked the power to detect such an association, these mutations may also be involved in modulating the progression of the disease by altering the composition of the atherosclerotic plaque, making it more or less susceptible to rupture. While these changes would not be readily observable by angiography, such an effect might result in increased or decreased incidence of clinical events during the follow-up period. A longer follow-up may therefore be needed to shed light on this question. The N291S mutation was found at similar frequency in both in the C A D population and the control population of the same ancestry. In the control population, three out of the ten individuals carrying this mutation had a normal lipid level while the remaining seven had low levels of HDL-C. Interestingly, the three individuals with a normal lipid level had a lower BMI than control carriers with low HDL-C. This observation suggested to us that environmental factors may modulate the phenotypic expression of this mutation. 104 Chapter III Since this initial report, Fisher et al.(Fisher et al., 1995) and Reymer et al. (Reymer et al., 1995b) have provided evidence that individuals with higher BMI carrying the N291S mutation may be predisposed to increased plasma triglyceride levels. In our study however, the increase in triglycerides in carriers only approached significance when comparing groups not taking P-blockers. The similar frequency of the N291S mutation in the control group and the CAE> cohort suggests that this mutation may represent a new marker for individuals with low HDL-C levels who are not at increased risk of coronary atherosclerosis. While our study cannot clearly rule out this possibility, it can be argued that the subtle effect of N291S mutation on plasma lipids may require a larger cohort of both C A D and control patients to detect such a difference. Interactions with other genes or environmental factors such as BMI would also reduce our ability to detect a difference. It should also be noted that the control group was 9 years younger that the C A D group and that the absence of a well matched control group may have limited our statistical power. There was a tendency for both D9N and N291S carriers to have low triglyceride levels, although this did not reach statistical significance. It should be noted that the REGRESS population was drawn entirely from C A D patients with triglyceride levels below 4mmol/L. 105 Chapter III Our study therefore is likely to underestimate the effect of these mutations on triglyceride levels. The determination of LPL activity in subjects with C A D provided a unique opportunity to study the relationship between LPL activity and circulating plasma lipids and the severity of coronary artery disease. To our knowledge, our study is the first to demonstrate unequivocally that LPL activity in male C A D patients correlates inversely with fasting plasma triglycerides and directly with HDL-C levels. This is in contrast to previous smaller studies that showed no correlation between LPL activity and plasma lipids in C A D patients (Tornvall et al., 1995) while showing a significant association in healthy adults (Jackson et al., 1990; Glaser et al., 1992; Tornvall et al., 1995; Tan et al., 1995). However, in our study, the coefficient of correlation between LPL activity and HDL-C was decreased by approximately 40% in C A D patient compared to controls from other studies. This suggests that other factors may partially override LPL activity as a determinant of plasma lipids in C A D patients. We also present the first evidence that LPL activity is associated with myocardial ischemia as determined by the N Y H A classification for severity of angina pectoris. Although angina pectoris represents a subjective measure of myocardial ischemia, the strong and directional association detected between LPL activity and angina pectoris is unlikely to be caused by 106 Chapter III chance alone. Moreover, there is increasing evidence that major cardiovascular risk factors such as LDL-C, diabetes and smoking play a significant role in hemodynamically mediated coronary ischemia. The mechanism for the association between LPL activity and ischemia could be mediated either indirectly through lipoproteins or plasma lipids or possibly by direct influence of LPL on the vessel wall. Triglyceride-rich lipoproteins promote the growth of unstable plaques and decrease endothelium-dependent vasodilation (Lundman et al., 1997; Vogel et al., 1997; Stroes et al., 1997; Yokoyama et al., 1998). Since LPL activity is an important determinant of both fasting and post-prandial triglyceride-rich lipoproteins and triglyceride levels (Miesenbock et al., 1993), LPL may indirectly modulate vascular tone through its effect on plasma lipids and lipoproteins. Alternatively, LPL could have a direct effect on vascular reactivity through mechanisms controlling availability of endothelium-derived relaxing factors such as nitric oxide. In this respect, it is of interest that LPL has been shown to increase nitric oxide synthetase m-RNA expression and the production of nitric oxide in macrophages in vitro (Renier and Lambert, 1995). 107 Chapter IV Chapter IV 4. INVITRO CHARACTERIZATION OF COMMON LPL MUTATIONS The majority of the data presented in this chapter contributed to the following manuscript: H. Zhang, H.E. Henderson, S.E. Gagne, L. Miao, G. Liu, M.R. Hayden. Common sequence variants of lipoprotein lipase: Standardized studies of In Vitro expression and catalytic function. Biochim. Biophys. Acta, 1996, 1302: 159-166 108 Chapter IV Foreword Dr. Zhang and myself initiated this study to answer some important questions regarding the functionality of the three variants identified in the REGRESS study on which multiples studies from other group yielded conflicting data. My role in this study was to construct two of the variants, D9N and S447*, while Dr. Zhang constructed the third variant N291S. Dr. Zhang and myself collaborated in every aspect of this study, sharing the load of isolating and testing the c-DNAs from these variants using various methods. The LPL activity assays were performed by Li Miao under the supervision of Dr. Liu and the LPL mass assays were conducted by Dr. Zhang and myself. The transfection experiments were also conducted by D. Zhang and myself. Dr. Henderson participated in the interpretation of the results and the preparation of the manuscript. 109 Chapter IV 4.1 INTRODUCTION Three common LPL variants detected in the assessment of C A D and dyslipidemic patients are associated with partial changes in catalytic function. One of these, N291S, is generated by an A to G transition of the second base at codon 291 in exon 6 of the LPL gene and results in a substitution of serine for asparagine (Zhang et al., 1995; Reymer et al., 1995a). The carrier frequency of this variant has been reported to vary between 1.3-4.7% in the general population (Zhang et al., 1995; Reymer et al., 1995a) and to be higher in individuals who have very low HDL-C levels (Reymer et al., 1995a), or factors predisposing to hyperlipidemia such as the E2 isoform of apoE (Zhang et al., 1995). Several studies, in different population groups, have reported an association of this variant with hyperlipidemia (Minnich et al., 1995; Fisher et al., 1995; Reymer et al., 1995b). However, homozygotes for this mutation do not obviously appear to have a more severe phenotype, and questions have been raised about the functional nature of this mutation (Funke and Assmann, 1995). A second variant, D9N, arises from a point mutation in exon 2 at codon 9 resulting in a substitution of asparagine for aspartic acid. We have reported that this variant is present at a frequency of 16% in French Canadians from Montreal (see chapter II), while others have reported a mean frequency of 3% in healthy individuals from 4 European countries (Mailly et al., 1995). D9N has further been shown to have a 2-3 fold increase in frequency in patients from the same region with familial combined hyperlipidemia (Mailly et al., 1995). 110 Chapter IV Reports of normal and reduced catalytic activity for this variant have appeared in the literature (Gagne et al., 1994; Elbein et al., 1994; Mailly et al., 1995). The third common variant of LPL, S447*, results in a two amino acid truncation of LPL and has been reported at carrier frequencies of 16-33% (Hata et al., 1990; Faustinella et al., 1991; Gagne et al., 1994). This mutation was first reported as the molecular basis for a patient with type I hyperlipidemia (Kobayashi et al., 1992). However, other studies have found that this variant occurs at a lower frequency in hyperlipidemic patients than in normolipidemic subjects (Hata et al., 1990; Stocks et al., 1992) and may be associated with a lipoprotein profile protective against atherosclerosis (Mattu et al., 1994; Jemaa et al., 1995). In vitro studies have yielded conflicting data on whether these variants are truly functional (Table 4-1). Potentially confounding variables in the in vitro assessment of variant function include poorly standardized cell transfection procedures. We have therefore re-examined these variants using optimized experimental conditions for the in vitro expression of their cDNA constructs and have determined their catalytic activities, stabilities, and cell surface binding affinities in rigorously controlled and comparable experiments. These properties have been compared to those of normal LPL expressed under identical conditions. I l l u > H-l h-l c o s E o o CU I <L» . f i 3 C/3 CU lH fi * r t o HW c/a T3 CU - f i c/3 HO fi CH <+H o & fi C/3 rt 03 H * rt rt GO ON Q 00. ON CN CU a s-fi o C/3 H-l OH HJ 9 S cd ^ a j 13 ofl| •K C o vii fi 03 _ 4g s c/3 C/3 cd — o fi o x JO ON ON O oo CN .5±3. rt +1 CN ^ 0s-4±13 91+9 rt ON O l-H o <N rt r~- r- cn —H y—1 i—i *—H rt NO + 1 cn rt oo rt +1 ON CN 0s O NO +1 in O oo oo CN cn +1 o in rt +1 00 cn VO in o +1 NO od in cn +1 P 8 vo rt O VO ON CN ON cn +1 CN CN o o ^ * S ON rt £ O CN 00 VO O CN ON vo vo cn cn oo vq oo CN rt .© +1 +1 CON OO h M rt 00 K rt VO m vo cn CN V 0 +1 +1 <>-—1 oo r-^  in oo o in iri rt cu T3 1 +1 00 in 00 o rt +1 cn vo in cu oo rt +1 o rt O in vo +1 ON VO ON O in ^ & - I H I 1 T3 .2 .2 ^ > > O rt vd cn oo CN in cn in 0 s in CN I I I cu I -a CD H tg 1 T3 .2 .3 c3 cd ^ > > cu cu 1—1 O CO g "w O O N 6 3 a> cs o S3 rr O N O N o 1) CN O N O N CU ca >. CO X ) CU > , O I = rt « l rt . „ O N n- — O N -_ 73 "55 _ -— an <u 23 C c -3 S SP a CO " O CU rt Chapter IV 4.2 METHODOLOGY 4.2.1 In vitro Site-Directed Mutagenesis and LPL cDNA Expression Vectors A 1.6 kb cDNA fragment containing the entire coding sequence of human LPL gene was prepared from the LPL cDNA clone pLPL 35 (Wion et al., 1987). This fragment was cloned into vector CDM8 for mutagenesis as previously described (Ma et al., 1992). The mutated cDNAs were excised by digestion with Hind III/Xba I and subcloned into a PcDNA-3 vector (Stratagene, Inc) using competent Top 10 bacteria. The entire 1.6 kb LPL cDNA of each construct was sequenced to ensure that no other sequence changes were introduced during the DNA manipulation. 4.2.2 Isolation and purification of expression constructs Large-scale preparations of DNA from the normal and mutant LPL constructs were obtained by lysozyme-Triton X-100 lysis, followed by double CsCl gradient centrifugations as described by Kingston, Chen, and Okayama (Kinston et al., 1991) and by alkaline lysis as described (Sambrook et al., 1989). In the former procedure, plasmid bands were recovered from the CsCl gradients and extracted with phenol/chloroform. DNA was precipitated by ethanol, dissolved in TE (0.5% SDS), extracted again with phenol/chloroform, and finally precipitated by ethanol. In the alkaline lysis method, deviations from the published methods included treatment of the bacterial pellets with equal volumes of solutions I, II, and III and an omission of the PEG precipitation step. The purity of plasmid DNA preparations from 113 Chapter IV both methods was assessed by electrophoresis in 1% agarose and by the 260nm to 280nm ratio. The concentration of the DNA preparation was calculated from the optical density at 260nm. 4.2.3 Transient Expression of LPL Constructs In order to establish the highest reproducibility and efficiency of expression, the methods of electroporation, DEAE-dextran uptake, and liposome fusion were considered for the transfection of COS-1 cells with the LPL constructs. Electroporation was performed with a gene pulser apparatus from Bio Rad. Briefly, 10-20 ug of DNA was mixed with 0.6 ml of cells at a density of 1.5xl07/ml in RPMI containing 0.1 mM dithiothreitol and incubated at room temperature (RT) for 10 min. The mixture of cells and DNA (0.5 ml) was transferred to a 0.4 cm cuvette and electroporated at 250 volts/ 960 uF capacitance. The protocol for the DEAE-dextran method was that described by Aruffo (Aruffo, 1991). Transfections using Lipofectamine were performed according to the manufacturer's instructions (Gibco). Briefly, plasmid D N A was mixed with OPTI-MEM I reduced serum medium (Gibco) to a final volume of 400 ul. This was gently added to an equal volume of diluted Lipofectamine in OPTI M E M (20ul Lipofectamine + 380ul OPTI-MEM), and incubated at RT for 15 min whereupon a further 3.2 ml of OPTI-MEM was added. This mix was added in 1.2ml aliquots to triplicate wells of COS-1 cells (80% confluent) in 6 114 Chapter IV well-plates, these cells being previously washed with PBS and OPTI-MEM. After incubation at 37 °C for 5 hr, 0.5 ml of OPTI-MEM with 17% FBS was added to the cells to give a final concentration of 5% FBS, and the incubation continued for another 8-10 hr. Antibiotics were not present in the OPTI-MEM medium during the initial 5hr incubation and transfection period. Medium was changed the following day and on the subsequent two days. These media collections were cleared of dead cells by centrifugation, aliquoted, snap frozen and kept at -70 °C until assayed. 4.2.4 Measurements of LPL Mass and Catalytic Activity LPL mass levels in the media were measured by an ELISA using the 5F9 and 5D2 LPL monoclonal antibodies as capture and detection antibodies respectively (Babirak et al., 1989; Peterson et al., 1992b). The epitope of the 5F9 monoclonal antibody is undetermined but known to be exposed only on denatured or monomeric LPL while the 5D2 epitope is exposed in both the dimer and monomer forms of LPL and is located between residues 396-405 (Liu et a l , 1992). LPL total mass was determined after dissociation of dimeric enzyme into monomers by denaturation with 1M GuHCl (guanidinium hydrochloride) (Peterson et al., 1992b). LPL dimeric mass was indirectly determined by subtracting the monomer mass determined in the absence of denaturation with GuHCL from the total monomer mass after denaturation (Peterson et al., 1992b). Microtitre plates were coated with the 5F9 monoclonal antibody in PBS by incubation for 4 hours at 37 °C. COS-1 cell media samples 115 Chapter IV or purified bovine LPL (used as standard controls) were added to each well and incubated for 18 hours at 4 °C. Wells were then washed to remove the unbound LPL and incubated with the 5D2 monoclonal antibody, conjugated to horseradish peroxidase, for 4-hours at room temperature. Wells were washed 5 times in PBS/Triton X-100 and substrate was added for color development. LPL lipolytic activities were measured using a radiolabeled tri[l- H]-oleate, phospholipid emulsion and are expressed in milliunits (1 mU = 1 nmol FFA /min /ml). The intra and interassay coefficients of variation were 5.1 and 6.2% respectively. 116 Chapter IV 4.3 PvESULTS 4.3.1 Comparison of transfection methodologies We initially compared different methods for the transfection of COS-1 cells to establish which gave the highest reproducibility and efficiency. Although we found that electroporation consistently gave high transfection efficiencies (30-60% positive cells) with either the LPL cDNA construct or the P-gal reporter gene alone, reproducibility was poor, even with duplicate transfections within the same experiment (data not shown). Another detracting factor was the large number of cells required for each electroporation, effectively limiting the opportunity for multiple transfections for comparitive purpose. We found DEAE-dextran to be highly toxic with very low and poorly reproducible levels of LPL activity being measured. Similar observations have been reported by others (Kinston et al., 1991). In contrast good, reproducible transfection efficiencies were achieved with Lipofectamine. The method consistently gave 5% variation in activity between two separate transfection mixtures with wild type LPL cDNA (195.5±14.5 vs 210.8±5.5 mU/ml), and gave 40-50% positive cells on X-gal staining when the P-gal reporter gene construct was used. Another advantage of this method was the significant number of transfections which could be performed at any one time to afford proper comparisons between the variants and control LPL. Transfection with Lipofectamine proved to be the method of choice in our hands and was utilized in all the transfection experiments reported in this manuscript. 117 Chapter IV 4.3.2 Comparison of different DNA preparations Plasmid DNA purified by lysozyme-Triton lysis followed by ultracentrifugation on CsCl gradients provided high purity of D N A with the least contamination by toxic bacterial lipopolysaccharide (Kinston et al., 1991; Wicks et al., 1995). However, yields of DNA were poor and routinely averaged 100 ug /100ml of Luria-Bertani (LB) broth. The alkaline lysis method gave 6 fold higher yields, averaging 660 ug of DNA /100ml LB. The purity of these preparations was good with 260 to 280 nm ratios >1.8. Parallel transfection experiments were done with both D N A preparations and there was no significant difference in the expression levels of LPL and P-gal activity with either DNA isolate (Table 4-2). We therefore elected to use the alkaline lysis method for all transfection experiments. 4.3.3 Peak secretion rates of LPL To determine the time of peak LPL secretion by the transfected cells, medium was collected daily for 5 days. The LPL activity levels over time after transfection are shown in Figure 4-1. Peak secretion occurred between 48 and 72 hr post-transfection. 4.3.4 The effect of D N A dose on the expression of LPL LPL expression varies with the amount of DNA used in the transfection experiments and was found to be highest at 0.5 ug/ml of Lipofectamine mix for PcDNA-3 LPL constructs (Figure 4-2). Higher concentrations of DNA resulted in a significant reduction in LPL 118 Chapter IV synthesis. An accurate determination of the amount of D N A in the preparations is therefore essential. OD 260nm calculations were checked by gel electrophoresis with the vector DNA also being compared to a known amount of vector DNA purified by centrifugation through CsCl gradients Table 4-2 Comparison of COS-1 cell transfection efficiencies using DNA prepared by double CsCl and alkaline lysis methods. DNA Preparation (3-Gal Activity LPL Activity (mU/well) (mU/ml/min.) COS-1 (no DNA) 0.0 0.83 + 0.03(3) CsCl DNA 4234.1 ±645.8(4) 88.45 ± 14.44(3) Alkaline Lysis D N A 3979.0 ± 454.9(4) 83.70 + 6.60(3) P value 0.54 0.63 119 Chapter IV 0 24 48 72 96 120 Post-Transfection Time (hr) Figure 4-1 Optimization of the collection period for maximal LPL secretion. Medium was collected daily for 5 days, and assayed for LPL activity. The peak LPL secretion rates occurred between 48 and 72 hours post- transfection. A l l collection were therefore carried out at 48 hours post-transfection. 120 Chapter IV 0 0.5 1 1.5 2 DNA C o n c e n t r a t i o n (ug /mL) Figure 4-2. Optimization of the expression phagemid concentration in the lipofectamine mix. LPL expression varied with the amount of DNA used in the transfection experiments and was found to be highest at 0.5 pg/ml of transfection mixture. 121 Chapter IV 4.3.5 The effect of heparin concentration on the secretion of LPL Heparin acts as a secretagogue for LPL and has therefore been used in almost all of the reported in vitro expression studies of LPL and variant forms. The reported concentrations of heparin used in culture media for transfection experiments have ranged from 2000 to 20,000 mU/ml (14 - 140 ug/ml) (Faustinella et al., 1991; Previato et al., 1994; Mailly et al., 1995). To determine the optimum functional concentration of heparin for transfected COS cells, we varied the medium heparin concentrations from 0 to 5000 mU/ml. Media levels of LPL activity and mass recorded are shown in Table 4-3. Transfected COS-1 cells showed a significant secretion rate of LPL. This phenomenon was also found in other cell lines, such as CHO-K1, 293 and HepG2 cells (data not shown). Heparin increased the secretion of LPL protein. LPL mass showed the greatest change, with total mass increasing 3.5 fold at the maximal heparin concentration employed. However, LPL activity did not show the same proportional increase with increasing amounts of heparin, only giving a 1.3-fold excess at peak secretion, with lOOOmU/ml heparin. One of the models of regulation of intracellular LPL levels shows a post golgi division between secretory and degradative pathways (Doolittle et al., 1990). Extracellular heparin is presumed to interact with the cell membrane and divert the flow of LPL into the secretory pathway and thereby increase the rate of secretion. The exact mechanism of this interaction is unknown but it may involve an alteration of the concentration gradient of LPL between 122 Chapter IV the intracellular pool and membrane bound forms. Displacing LPL from the cell surface, heparin may alter this gradient and promote the transportation and secretion of LPL. Our data clearly shows a marked alteration in the ratio of secreted dimer to monomer forms of LPL with increasing heparin concentrations (Table 4-3). The ratio dropped from 1.09 to 0.19 and this may have been caused by either rapid homodimer dissociation or increased production of non-functional monomeric LPL. We chose to include none or low concentrations of heparin (7mU/ml ) in the medium as this provided the highest ratio of dimer to monomer (Table 4-3). Table 4-3 The effect of heparin concentration on the expression of LPL in COS-1 cell media Heparin Dose LPL Mass (ng/ml) Activity (mU/ml) Total Dimer Monomer Dimer/Monomer (mU/ml per min) 0 706 368 338 1.09 69.76 7 695 336 359 0.94 73.49 500 1516 649 867 0.75 86.91 1000 2140 665 1475 0.45 92.68 5000 2425 388 2037 0.19 85.21 Average value from duplicate wells in the transfection experiment. Dimer/Mon. = the ratio of dimer to monomer of hLPL. Media were withdrawn after 24 hours incubation. 123 Chapter IV 4.3.6 Measurement of LPL mass and catalytic activities of the variants in COS media The mean LPL activity and mass data from multiple transfections carried out in 3 to 5 different experiments are listed in Table 4-4. Two of the variants showed decreased catalytic activities when compared to normal LPL, with the N291S species manifesting the lowest activity at 57% of normal (p< 0.0005). The activity of the D9N variant was 85%) of control (p<0.0005). The S447* truncated variant gave 94% of normal activity, and this was not significantly different from control. We measured mass for both the monomeric and dimeric forms of LPL and could therefore, express specific activities using either mass level as the denominator. Specific activities derived from the dimeric mass (homodimer specific activity) are determined largely by the kinetic properties of the enzyme, while specific activities derived from the total mass (total mass specific activity) are additionally determined by the comparative rates of dissociation of active dimer into inactive monomer. A decrease in total mass specific activities can therefore indicate changes in either of these parameters although the latter is likely to predominate. The N291S enzyme also gave the lowest mass level, but this decrease was less than the reduction in lipolytic activity (Table 4-4). This variant additionally had the lowest dimer to monomer ratio and therefore yielded a low total mass specific activity when calculated using the total mass. The low ratio of dimer to monomer could have arisen from either inactivation of the dimeric form, giving an increased rate of dissociation into inactive 124 Chapter IV monomers, or excess secretion of monomeric LPL. Although the D9N variant gave a significant reduction in activity, there was no evidence for increased instability, as this decrease was paralleled by a reduction in mass, giving a normal dimer to monomer ratio and therefore a normal total mass specific activity. While the catalytic activity of S447* did not differ from normal, it showed substantially increased monomeric mass, thereby significantly lowering the dimer to monomer ratio and the total mass specific activity. Again, this raised the possibility of increased dimer dissociation or excess secretion of the monomeric form of the lipase. 4.3.7 Stability of LPL sequence variants LPL variants that are less stable in the medium than normal LPL are likely to present with higher relative concentrations of the inactive monomer form. To determine whether the relative excess of monomer over dimer of the N291S and S447* variants was due to greater dimer dissociation rates or increased monomer secretion rates, post-transfection media were incubated at 37 °C for an indicated time, and LPL activities were analyzed. Control LPL activity decreased with time, giving a Tl/2 of 145±39 min. and 59% residual activity at 2hrs (Figure 4-3). Similar results were apparent for the S447* and D9N variants. In contrast, variant N291S gave an accelerated loss of LPL activity with a Tl/2 of 78±14 min. and residual activity of 32% after 2 hrs at 37 °C. The Tl/2 of N291S is significantly different from the wild type (p<0.05). The observation of normal stability for the S447* variants 125 Chapter IV suggests that the excess monomer recorded in the transfection medium was due to an increased secretion of LPL monomer. 4.3.8 Determination of homodimer specific activity The decreased total mass specific activities of the LPL variants could also be explained by altered enzyme kinetics for each mutation. To explore this, we assayed lipolytic activity immediately after release of membrane bound LPL at 4 °C when the majority of LPL was in the active dimeric form. Transfected cells pre-incubated without heparin were washed twice with cold PBS, and the bound LPL was released by incubation at 4 °C for 15 min. with chilled medium containing heparin (5 U/ml). It was striking that mass determinations revealed more than 90% dimer in released LPL. Since it is the dimeric form of LPL that is functional [40, 41], kinetic activities were determined using dimeric mass values (homodimer specific activities) and are listed in Table 4-5. A l l three variants gave homodimer specific activities similar to that of normal LPL and therefore manifest similar kinetic properties. 4.3.9 Relative binding affinity of LPL variants to cell membrane proteoglycans Assay of LPL released from the cell membrane also facilitated an assessment of the relative polyanion binding affinities of the variant enzymes. The LPL released by heparin at 4 °C arises from the cell surface since none was released when the cells were pre-incubated with 126 > 03 U o3 CD CD O O -a a 4-' a PH T3 CD eg M-H a aJ C o o TJ O S-i PH C/5 03 OH h-l •st •4 _CD H o 03 P < Vn o crj h-l PH h-l 03 s PH h-l CD a o cn h-l PH C/3 C/2 03 s O H ^ > o 03 CD O c o a CD 03 O m m o © +1 ON •st O +1 o o © o ON o +1 ON o CD ON o o o +1 t^ o o +1 SO II N$L ON CN © +1 t^ m o +1 o o II ON p VO CN o © +1 o o ca m l/~> in o IO 1 +1 +1 +1 o 00 VO oo ON © +1 © cd ON O co m m vo m CN CN +1 t< i - H +1 m +1 + 1 o ON CN r—1 © ON VO o VO 00 1—1 o OO ,—i * t^ vo * I O CD Q g i s <J E c c/i O C ON § CN I i * £ CD ~ C .o tj c£ T3 E o 00 ca C h 2 c<-O g. « ^ o T -.E ° It CD uj O . CS £• E 2 15 ° CD CD J3 § jd p c a. E cn cd <D TH OH CN it 2 • = CD a. a . CD 4 = T3 CD > -e CD •ti -S ^  T3 CJ 5 ~ <S ca 5 <D cd a. E o I O o o V a. cd X> o Chapter IV 5U/ml heparin at 37 °C (data not shown). Binding affinity is described by the equation B=nKS (Berryman and Bensadoun, 1993), where B is the amount of LPL bound to the cells per dish, n is the maximal number of binding sites of the cells per dish, K is the affinity constant, and S is the concentration of LPL dimer in the pre-release harvesting media. The factor "n" can be ignored in calculating relative affinity constants for the variants since COS cells were plated at the same density. The relative affinity constants are therefore equal to B/S. A l l three variants gave normal binding affinities (Table 4-6), discounting any defect in interaction with cell membrane proteoglycans. Our data clearly demonstrate that it is the dimer form that binds to cell membrane proteoglycans and that this binding is not influenced by monomeric LPL, as the N291S and S447* variants gave normal affinities in spite of their high levels of monomeric LPL in the medium. 128 Chapter IV Figure 4-3 Stability study of LPL variant proteins. Post-transfection media were incubated at 37 °C for the indicated time, and analyzed for LPL activity. Wild type LPL showed decreased activity with incubation time, with a Tl/2 of 145±39 min. Similar results were recorded for the S447* and D9N variants. However, the N291S variant produced an accelerated loss of activity with a Tl/2 of 78±14 min. ^ 129 Chapter IV Table 4-5 Homodimer specific activity of LPL released from the transfected cells at 4°C by 5 U/ml heparin LPL source LPL dimer LPL activity Specific activity mass (ng/ml) (mU/ml/min) (activity/dimer) Wild Type (n=3) 241124 101.9+1.9 0.42710.052 Asp291Ser (n=3) 157±9 a 67.2±4.0 a 0.470+0.011115 D9N (n=3) 248+28 101.7+10.4 0.411l0.006ns S447* (n=3) 226±27 100.1+1.8 0.448i0.061ns Each value represent mean S.E. triplicate wells in the transfection experiment, a: PO.005 compared with the wild type NS: Not significant Table 4-6 Relative binding affinity of LPL variant to COS cell proteoglycans LPL source Bound dimer Concentration dimer Bound dimer (ng/well) (in medium, ng/ml) (B)/Conc. Dimer (S) Wild Type (n=3) 144+14 224+21 0.64610.075 Asp291Ser (w=j; 94±5 a 153116a 0.62010.037ns D9N (n=3) 149+17 240+42 0.62810.110115 S447* (n=3) 136+16 212144 0.65210.100ns Each value represent mean ± S.E. from triplicate wells. Concentration of dimer = the dimer concentration in the pre-release harvesting medium. a: PO.01 ns: Not significant 130 Chapter IV AA DISCUSSION In an effort to resolve the potentially conflicting reports on the functional integrity of the three common LPL variants (Table 4-1), we have re-assessed their functional activity after optimizing conditions for the COS cell transfection. We show that heparin concentration and length of period of transfection may significantly alter the results of these studies. Assessment of the functional effects of these mutations in parallel experiments under the same conditions at the same time has allowed comparisons between these different mutations in an effort to determine which has greater functional effects. We show that none of these mutations affect binding of LPL to cell surface proteoglycans. Our data clearly indicate that the N291S sequence variant of LPL manifests with a partial reduction of catalytic activity (57% of normal) and a reduction of mass (76% of normal) in the COS-1 cell expression system. This is in keeping with the previous studies from this laboratory, reporting a 40% reduction in catalytic activity (Zhang et al., 1995; Reymer et al., 1995a). In addition, we have demonstrated that the N291S homodimer is less stable than the normal counterpart and that this likely accounts, in part, for its decreased lipolytic activity. Incubation at 37 °C induced a more rapid drop in catalytic activity (32% residual vs 59% for control LPL) after 2 hrs with a 50% reduction in the half life (Tl/2) of the enzyme. Loss of activity due to an accelerated rate of dimer dissociation is supported by the higher LPL monomer concentrations measured in the harvesting medium. An inherently 131 Chapter IV unstable N291S homodimer and reduced secretion of the protein may therefore explain the lower in vivo LPL activities seen in N291S carriers (Reymer et al., 1995a). The D9N sequence variant showed a mild but significant reduction in overall catalytic activity despite a normal homodimer specific activity and dimer stability. This in vitro demonstration of some impairment of lipolytic function is in accord with the reported tendency of D9N carriers towards lowered post heparin LPL levels (Mailly et al., 1995). It is possible that the tendency toward hyperlipidemia is only apparent when this variant is combined with secondary hyperlipidemic factors such as diabetes and obesity. Catalytic activity and dimeric mass levels for the S447* truncation variant were similar to those of control LPL. However, total mass levels (after GuHCL denaturation) were significantly elevated at 131% of control, giving a 28% reduction in the total mass specific activity of the variant (Table 4-4). We have shown that this monomer excess is not derived from enhanced denaturation of the dimer form and most likely arises from a higher constitutive secretion rate. This truncation variant was originally reported as the molecular basis for the LPL deficiency of a type I patient, since in vitro expression data recorded a 43% drop in catalytic activity and a 55% reduction in the specific activity (Kobayashi et al., 1992). Another study also 132 Chapter IV reported a decrease in mass and activity to 76% of normal for this variant (Faustinella et al., 1991). In contrast, Previato et al. (Previato et al., 1994) reported an increase in lipolytic activity to 120% of control, but with a 30% reduction in specific activity (Table 4-1). While the reasons for these discrepancies are not clear, it may be significant that our study and that of two others (Kobayashi et al., 1992; Previato et al., 1994) have found a significantly excessive secretion of LPL carrying this truncation. Since LPL is active as a dimer, it is important to study the kinetic properties of the enzyme by homodimer specific activity. We found the S447* variant to manifest normal homodimer specific activity (Table 4-5 ). This result is different from the previous reports showing decreased specific activity. Since those investigators did not measure the dimer mass, their specific activity reflected total mass specific activity and did not specifically take into account the active dimeric mass. Our results are consistent, however (Table 4-4) with the previous results when total mass specific activities are compared. The functional importance of the terminal residues of LPL is unclear, but it is possible that they are involved in the post-translational modification processes that determine the dimerization of LPL monomers prior to secretion. This hypothesis is supported by the recent demonstration that the S447* truncation abolishes the 10% residual activity of the Glu410Val homodimer (Previato et al., 1994), possibly through inhibition of dimerization. 133 Chapter IV It has been shown that S447* mutation occurs at a lower frequency in hyperlipidemia patients than in the general population (Hata et al., 1990; Stocks et a l , 1992), and is associated with a lipoprotein profile protective against atherosclerosis (Mattu et al., 1994; Jemaa et al., 1995). Our in vitro expression data, however, showing normal catalytic activity and normal dimer stability suggest that the lipolytic function of the variant is not a critical determinant of the lipoprotein phenotype in these subjects. An enhanced secretion rate of the monomeric form of this variant could be involved, as LPL monomers have been detected on circulating lipoproteins (Vilella et al., 1993). The effect of an increased LPL monomer production rate on lipoprotein metabolism remains to be elucidated. In summary, we have optimized procedures for in vitro transfection of COS cells with phagemid vectors and have examined the catalytic activity and stability of three common LPL sequence variants which have been shown in vivo to be associated with reduced LPL levels or altered plasma lipid and lipoprotein concentrations. The N291S variant manifests with a significant reduction in catalytic activity through a decreased production rate and an unstable homodimer assembly. The D9N species gave a mild but significant reduction in activity which was paralleled by a decreased secretion of enzyme protein. The overall catalytic activity of the S447* truncated variant was shown to be normal, but there was an increase in the secretion of inactive monomer. 134 Chapter IV In terms of the effects of these sequence changes on the function of LPL, our data indicate that these specific variants manifest with an abnormality of function or secretion, at least in vitro. These findings are in keeping with the case-control comparisons which are suggestive of functional alteration in vivo. 135 Chapter V Chapter V 5. EFFECT OF COMMON LPL MUTATION ON PLASMA LIPID AND RISK FOR CORONARY HEART DISEASE: THE FRAMINGHAM OFFSPRING STUDY The majority of the data presented in this chapter contributed to the manuscripts: S.E. Gagne, S.N. Pimstone, M.G. Larson. E.J. Schaefer, P.W.F. Wilson, J.M. Ordovas, J.J.P. Kastelein, M.R. Hayden. Effect o f lipoprotein lipase gene mutations on plasma lipids. The Framingham Offspring Study (submitted for publication) 136 Chapter V Foreword My contribution to this study was multifold. I was involved in the original design of the study and generation of the hypothesis to be tested. Dr. Ordovas provided the DNAs of 2500 individuals from the Framingham Offspring Study which I tested for all three mutations using PCR methods developed in previous studies conducted in our laboratory. This tedious part of the study amounted to a total of nearly 10 000 PCR digest, which I performed almost single handedly. Dr. Pimstone was responsible for capturing the results into a computer database to be used in conjunction with the Framingham Offspring Study database for data analysis. The data analysis was conducted under my supervision during my visit to the Framingham Heart study site by the Framingham biostatistician Dr. Marty Larson. At my request and over a period approximately 6 months, subsequent analyses were required to refine these primary analyses. The clinical parameters reported in this study were collected as part of the Framingham Offspring Study which studies prospectively a group of 5000 individuals with follow-up at 4 year interval. 137 Chapter V 5.1 INTRODUCTION Evidence from twin studies clearly indicates that genetic factors play a major role in the susceptibility to atherosclerosis (Marenberg et al., 1994). These influences are thought to result from changes in multiple genes which act in concert to increase susceptibility. The influence of genetic variation on lipoprotein levels primarily manifests as elevated low-density lipoprotein cholesterol (LDL-C) and decreased high-density lipoprotein cholesterol (HDL-C), both associated with an increased risk for atherosclerosis (Kannel et al., 1979; Wilson et al., 1980; Kannel et al., 1986; Assmann and Schulte, 1992). Until recently there has been no documented single mutation in a gene which alters lipid levels and predisposes carriers to atherogenesis in a significant proportion of the general population. One possible exception is a polymorphism in the apolipoprotein E gene where carriers of the apoE polymorphism (apoE4) may have an increase in LDL levels and increased susceptibility to CHD (Wilson et al., 1994; Wilson et al., 1996). We and others have recently reported three common variants in the coding region of the gene for lipoprotein lipase (Hata et al., 1990; Stocks et al., 1992; Mattu et al., 1994; Gagne et al., 1994; Mailly et al., 1995; Zhang et al., 1995; Pimstone et al., 1995; Zhang et al., 1995; Fisher et al., 1995; Reymer et al., 1995a; Reymer et al., 1995b; Mailly et al., 1996; Jukema et al., 1996; Kuivenhoven et al., 1997; Wittrup et al., 1997; Groenemeijer et al., 138 Chapter V 1997). LPL hydrolyses triglycerides in the core of chylomicrons and V L D L ; this enzyme provides the rate limiting step for clearance of plasma triglycerides from the circulation. This process generates free fatty acids that promote the exchange of lipids and apolipoproteins between HDL and triglyceride-rich particles, a critical step in the maturation of nascent HDL particles (Brunzell, 1995). A strong correlation exists between LPL activity and HDL-C levels (Taskinen and Nikkila, 1981). We have previously shown that one common LPL variant (N291S) is present in approximately 5% of the population and is associated with a significant decrease in HDL-C levels in both patients with CHD and controls (Reymer et al., 1995a). In addition, another LPL variant (D9N in exon 2), which occurs in approximately 3% of the Caucasian population, is associated with higher triglyceride levels and has recently been reported in a group of patients with CHD to be associated with more rapid progression of coronary atherosclerosis and with an increased frequency of clinical morbidity (Jukema et al., 1996). In contrast to the N291S and D9N variants, another polymorphism at residue 447 of the LPL gene (S447*) causing a truncation of LPL by two residues, has been found to be associated with decreased triglyceride levels in patients with CHD (Zhang et al., 1995; Groenemeijer et al., 1997) and with elevated HDL-C levels in normolipidemic males and CHD patients (Kuivenhoven et al., 1997; Groenemeijer et al., 1997) This variant occurs in 139 Chapter V 15-17% of individuals in different populations of Caucasian descent (Hata et al., 1990; Stocks et al., 1992; Mattu et al., 1994; Jemaa et al., 1995). Whereas patients with hyperlipidemia and CHD have been studied, evidence that these three DNA variants can influence plasma lipid levels and the prevalence of CHD in the general population is limited. Since the LPL gene may represent an important susceptibility gene for coronary atherosclerosis through modulation of HDL and triglyceride levels, we sought to assess the relation of these mutations to lipid values and to CHD in persons in the general population who have been ascertained as part of the Framingham Offspring Study (FOS). This study shows that the N291S and D9N mutations have significant phenotypic effects with alterations in lipoprotein values in men in the general population. In contrast, the S447* variant is associated with an elevation in HDL-C, reduced triglyceride level and a significantly reduced risk for CHD. This study provides direct evidence for a genetic variant which significantly reduces the risk for CHD in the general population. 140 Chapter V 5.2 METHODOLOGY 5.2.1 Population Individuals in this study were participants in The Framingham Offspring Study (FOS), a long-term prospective evaluation of risk factors of cardiovascular disease initiated in 1971 in which participants are the offspring of the subjects in the Framingham Heart Study and their spouses. Details of the sampling scheme and study design of the FOS have been reviewed elsewhere (Feinleib et al., 1975). Of the 4019 Caucasian individuals who attended the 4th examination visit of the FOS conducted between 1987 and 1991, a total of 2417 D N A specimens were available and were analyzed for three LPL gene variants (D9N, N291S and S447*). Subsequently, 159 subjects were excluded. Of these, LPL genotyping was incomplete for 21 subjects; another 93 subjects were receiving lipid-lowering medication; and 45 subjects had incomplete lipid or covariate data. A total of 1114 men and 1144 women were available for the analysis. At the visit, a complete medical history, physical examination, cardiac examination and fasting blood lipid profile were performed. Smoking status was based on the reported habit in the year prior to the examination. Coronary heart disease (CHD) was defined as current or previously diagnosed angina pectoris, myocardial infarction or coronary insufficiency (Cupples and D'Agostino, 1987). Women were defined as menopausal if they had not had menses in the last 12 months. 141 Chapter V 5.2.2 Lipid Analysis Blood was drawn after a 12 hour fast for the determination of plasma glucose and lipids according to a modified Lipid Research Clinic Protocol (Lipids Research Clinics Program., 1974). Total cholesterol and triglycerides were measured by automated enzymatic method (McNamara and Schaefer, 1987), and HDL-C (Warnick et al., 1982) was determined after precipitation of plasma low-density lipoproteins (LDL) and very low-density lipoprotein (VLDL) with dextran sulfate-Mg2+. Low-density lipoprotein cholesterol (LDL-C) was estimated using the Friedewald formula for persons with plasma triglyceride levels lower than 400 mg/dl [4.52mmol/L] (Friedewald et al., 1972). For persons whose triglyceride levels were above 400 mg/dl [4.52mmol/L], the L D L was estimated after ultracentrifugation measurement of bottom fraction cholesterol (d< 1.006) and subtraction of the HDL estimate according to the Lipid Research Clinic Protocol (Lipids Research Clinics Program., 1974). 5.2.3 D N A analysis Human D N A was extracted from leukocytes by standard procedures (Technical tips: 1989). LPL genotyping was performed as previously described (Gagne et al., 1994; Zhang et al., 1995) with the following modifications: D N A was amplified using the polymerase chain reactions (PCR) in 15pi volume using elongated mismatch primers (40 to 52 bases). The entirety of the PCR product was digested using 3U of the appropriate restriction enzyme 142 Chapter V and the DNA fragment separated on 2% agarose gel. Quality control was insured by the addition of a positive control and water-blank to each PCR. Failure in either one of these two controls precluded the entry of the data. Participants identified with a DNA variant were independently confirmed in a separate assessment. Only subjects in whom all 3 polymorphisms were successfully screened were included in the analysis. 5.2.4 Statistics Previous studies have clearly shown that both D9N and N291S result in partial defect in catalysis and reduced protein secretion of similar amplitude in vitro and in vivo (Fisher et al., 1995; Zhang et al., 1996; Hoffer et al., 1996). Similarly, case-control studies have reported a similar reduction in HDL-C levels (Reymer et al., 1995a; Reymer et al., 1995b; Jukema et a l , 1996; de Bruin et al., 1996; Hoffer et al., 1996; Wittrup et al., 1997) and elevation in triglyceride levels for both variants (Elbein et al., 1994; Mailly et al., 1995; Fisher et al., 1995; Reymer et a l , 1995b; Mailly et al., 1996; de Bruin et al., 1996; Hoffer et al., 1996; Wittrup et al., 1997). The absence of detectable interaction and the similar effect of the D9N and N291S mutation on lipid levels suggested to us that these 2 mutations could be combined for analysis. Linear regression models (Kleinbaum et al., 1988) that included age, BMI, alcohol and smoking (and menopausal status and estrogen therapy for women) were used. Age splines 143 Chapter V with 2 knots at 45 and 60 years were included in the regression models to accommodate age patterns in lipids. Logistic regression (Hosmer and Lemeshow, 1989) using these covariates was employed to test for associations between the LPL variants and the prevalence of dyslipidemia and CHD. Dyslipidemia categories were defined according to cut-off levels in common use by the National Cholesterol Education Program and Triglyceride Consensus Conference (Expert Panel on Detection, 1993; NIH Consensus Development Peine 1 on Triglyceride, 1993). A l l participants genotyped in this study were included in the analyses. As a result, all linear and logistic regression models included LPL genotype thereby accounting for the effect of compound heterozygotes. For the presence of dyslipidemia or coronary disease, we computed attributable risk percent as 100*P*(1-OR)/[1+P*(OR-1)] or preventive fraction percent as 100*P*(1-OR), as appropriate, where P is the prevalence of a specific LPL gene mutation and OR is odds ratio for the corresponding clinical condition (Kleinbaum et al., 1988). To test for interactions of LPL genotype with age and with body mass index, secondary analyses were conducted using linear or logistic regression models, as appropriate, augmented by interaction variables. Furthermore, because approximately 15% of the samples consisted of same-sex siblings, we carried out additional analyses on the measured 144 Chapter V lipids in which mixed-model linear regressions were used to accommodate correlations within sibships. Statistical analyses were performed with the SAS statistical package (SAS Institute Inc, 1989; SAS Institute Inc, 1996). A two-sided P-value of P<0.05 was used for declaring statistical significance. 145 Chapter V 5.3 RESULTS 5.3.1 Demographic To investigate the frequency and phenotypic effect of the 3 common LPL variants at the population level, we analyzed a total of 2258 participants (1114 males and 1144 females) who participated in the Framingham Offspring Study and who had lipid values available off lipid altering medication. Table 5-1 provides the summary of the demographics and biochemical characteristics of the participants. The mean age of the participants at examination was 51.4 years. A similar proportion of men and women were smokers (24%) and over half of the female participants (55%) were post-menopausal. 5.3.2 Frequency of LPL variants The prevalence of the 3 common LPL polymorphisms is shown in Table 5-2 with no difference between men and women.. A l l loci were found to be in Hardy-Weinberg equilibrium. The determined carrier frequencies were in keeping with previous estimates obtained in other Caucasian populations (Technical tips: 1989; Hata et al., 1990; Galton et al., 1994; Mailly et al., 1995; Jemaa et al., 1995; Fisher et al., 1995; Reymer et al., 1995a; Mailly et al., 1996; Jukema et al., 1996). In addition, compound heterozygotes carrying 2 LPL polymorphisms were detected in the expected frequencies (N=2, 0.1% N9/S291; N=7, 0.3% N9/*447; N=6, 0.3% S291/*447). 146 Chapter V Table 5-1 Demographic and biochemical characteristics M E N W O M E N N Mean SD N Mean SD Age 1114 51.8(10.1) 1144 51.2 (9.9) Body mass index (kg/m2) 1114 27.7(3.9) 1144 26.1 (5.5) Total-C (mg/dL) 1114 203.5 (36.3) 1144 203.1 (38.9) LDL-C (mg/dL) 1089 133.4 (32.2) 1129 125.3 (34.7) HDL-C (mg/dL) 1114 43.8(11.6) 1144 56.3 (15.3) Triglycerides (mg/dL) 1114 136.7 (102.4) 1144 107.9 (85.1) Total-C/HDL-C 1114 4.9(1.5) 1144 3.9(1.4) Triglycerides/ HDL-C 1114 3.6 (3.8) 1144 2.3 (3.0) glucose (mg/dL) 1114 98.7 (27.6) 1144 93.0 (24.4) alcohol (ounce/week) 1114 4.2 (5.71) 1144 1.8 (2.6) cigarette smokers (N (%)) 1114 267 (24) 1144 283 (25) Post-menopausal (N (%)) - - - 1144 629 (55) On estrogen Rx (N (%)) - - - 629 83 (13) 5.3.3 Effect of the LPL genotype on plasma lipids We investigated the effect of the LPL variants on plasma lipids using linear models allowing adjustment for age, BMI, smoking, alcohol intake and LPL genotype (Table 5-3) Data for women were adjusted for menopausal status and estrogen therapy (Table 5-3) or analyzed separately (Table 5-4). A total of 65 men were carrying either a D9N or N291S (D9N/N291S) allele. Overall, the D9N/N291S alleles were associated with a significant reduction in HDL-C levels (-3mg/dL [-0.08mmol/L]; p=0.03) and a trend to an increase in triglycerides levels (+23mg/dL [0.25mmol/L]; p=0.07). Conversely, male carriers of a Chapter V S447* allele (179 men) showed, on average, a significant increase in total cholesterol levels (7mg/dL [0.18mmol/L]; p=0.02), LDL-C (7mg/dL [0.18mmol/L]; p=0.01) and HDL-C (2mg/dL [0.06mmol/L]; p=0.01) and a decrease in triglyceride levels (-18mg/dL [0.21 mmol/L]; p=0.02). As a result of these changes, the triglyceride/HDL-C ratio was significantly increased in D9N and N291S carriers (p=0.03) and decreased in S447* carriers (p=0.03) compared with non-carriers. Table 5-2 Carrier frequency of LPL polymorphisms in Framingham Offspring Study D9N N291S S447* Total N (%) N (%) N (%) Men 1114 33 (3.0) 33 (3.0) 179(16.1) Women 1144 25 (2.2) 29 (2.5) 200(17.5) Total 2258 58 (2.6) 62 (2.7) 379(16.8) Interestingly, corresponding analysis in women showed no significant effect of these LPL variants on plasma lipid profiles in the group as a whole (Table 5-3) or when stratified based on their menopausal status (Table 5-4). Secondary analyses found no statistically significant interactions between LPL mutations and either age or body mass index among men or among women. Analyses with mixed-model regressions to incorporate lipid correlations within families produced results similar to those already tabulated. 148 > <u rt X u cu T3 C CD Si) C/3 - d ccj s (3 O CD &, O c CD oO i—1 O H o rt o w i CD t/3 S-CU s-i . C3 o I c l l r-5/3 ON Z ON Q CD c/3 +1 <D CD "3 > CD C/3 +1 CD <D 13 > C/3 +1 CD m CN rt rt ro o -—1 — — © ro © © +1 +i +1 +1 +1 +1 vq vq ro O N r-~; oi CN ro od rt ro o ro rt ro CN CN CN in CO O © O O IO o o o © o o o r~- rt oo rt ro CN CN o r~ o O +1 +1 +1 +1 +1 +1 r~ O N O N o O N p O N oi iri © rt ro O ro rt CN CN O ro ro rt r--CN od © © i i • r-^  ro ro r-- 0 0 ro CN O o '—' O o O O o o O CN rt rt- ro CN CN in rt rt *-H © o +1 +1 +1 +1 +1 +1 V D rt 0 0 0 0 CN r~ V D C3 © in rt O N CN rt V O CN 0 0 m CN O iri vd CN CN © rt i i CN CJ _ CJ Q to _J X <u T 3 Q "«5 'C X 72 CJ U 'C o 1 CJ CJ 1 o cc & —1 _- 73 o Q o "C o .SP t - -J f- t -V3 s-ii °S u OS c o Z tr-Tt Tt C/3 C/3 ON CN z ON Q CD c/3 +1 CD "c3 CD c/3 +1 CD 13 CD C/3 +1 3 CD r t r t c cu s o rt CN —; i n p — — O oi O cd +1 +1 +1 +1 +1 +1 O co r— O N Oj ro i n vd N D CO oi O CN m 0 CN O O V D 0 ro co rt 0- ro O N •—1 0 O 0 O cd cd 10 ro p CN CN CN — iri 0 cd +1 +1 +1 +1 +1 +1 O rt vo vo O N N O CN ro vd oi ro oi O CN i n — CN ro ro rt O co 1 CN 1 O vd O cd 0 O V O co 0 0 CN ro vo vo 01 rt i n O 0 O 0 O cd 0 O N IO O N , \ CN rt rt rt — cd cd +1 +1 +1 +1 +1 +1 rt r - rt i n 0 i n r~" i n 0 0 rt oi 0 CN m CN co O N rt co rt CN O oi cd cd ^ o CJ 0 Q H —1 Q X CJ Cfl _J 1 i 1 2 ' £ O CJ I -1 Q X CD 72 *c CD o _ > N 60 8.-8 2 C J g >' bl} 01) -1 'B —1 cu - 1 C8 O C3 Um ' ^ o r -J = N O -° " -a ^> 3 -o 4—» C3 f 15 g 3 I CO fc &2 c CL) O o o c ^ C3 CQ T 3 O i n o -a U < -a a> E on _ r~ co . 5 i n vi 00 u 00 >^  58 J3 rt ' a . •> rt '-5 O N rt O CD cn CX o c CD s TJ cn CD > T3 CL) PH o c CL) 00 h-l Tt I IT) "3 H c*> u 'E u « I e i l * Tt Tt ON fN ON CL) cn +1 CL) CL) 13 > cu +1 i W CD CD cn +1 C 03 CD CN rn m 00 Tt Tt O N m rn o O N CN © rn CN © vd vd CN +1 +1 +1 +1 +1 +i +1 +i +1 m vq VO CN VO vq CN m H-H CN in © in vd rn CN © o in O IO O in CN CN CN CN m m CN m o CN Tt O N IT) © CN in 00 O N i—i VO o © © © © © © © © © O N Tt o in o IT) © CN Tt VO Tt r-1 in CN +1 +1 +1 +1 +1 +1 +1 +1 +1 00 rn 00 OO oo ^ H m O N IO Tt in O N 00 in CN Tt Tt vd o in o O N IT) CN CN vo 00 CN —H ^ H ^ H CN in CN m r--i 13 2 i tH OPH H m © oo m © o Tt rn CN CN m © in C CD 00 o 1--t—» cn W O C 03 cn PH O S o u h-l Q ffi oo © O N © Tt vd oo CN © © Tt oo oo © r- Tt © ©' CN Tt 2 & rn 00 oo © m cn CD T J 'C CD O "5b "C H P CD 00 o cn w o .a 13 cn cd PH O e CD cn O PH 03 4-> O H h-l Q ffi cn CD TJ ' C CD o >'. "5b "C H m oo C CD 00 o 13 PH O a CD CN 03 VO CN m © CN © O H CJ I h-l Q ffi rn m Tt Tt in in oo © in ON vo © ON © © 00 vd CN CN CN CN Tt +1 +1 +i +i +1 +1 +1 +1 +1 ON rn Tt in r- © rn Tt ^ H ON* rn ON m rn in Tt CN CN ON in © Tt 1—1 in CN CN VO oo ^ H ^ H in CN CN 00 m CD TJ ' C CD U >> "5b f—1 C L i> o c CD 61) _J 0-_1 -a c ca oo c 12 o oo oo X ) CJ -g > 5^ o E CJ o > c o r--vo X2 -g > -J" "5 o <u _0) o JZ o t CJ > c o o o H °° 8 "oo Cj" C E SP Si = 2 B > cn cj = ^ r2 < < J © in Chapter V Logistic models using the same covariates as above were employed to test for associations between the LPL gene variants and various forms of dyslipidemia. The results of these tests, presented in Table 5-5, supported the results of the linear models. In men, the N9/S291 alleles were associated with an increased likelihood for low HDL-C [<35 mg/dL or 0.91mmol/L](p=0.006) and elevated triglycerides [>200mg/dL or 2.26mmol/L](p=0.004). There was a relative risk of 3.7 for combined dyslipidemia (HDL<35mg/dL or 0.91mmol/L and triglycerides>200 or 2.26mmol/L) in the presence of D9N or N291S (p=0.0001). In contrast to the D9N or N291S alleles, the likelihood ofthe S447 allele was significantly decreased in persons having elevated triglycerides (p=0.01) (Table 5-5). In contrast to men, no significant association between HDL-C and/or triglycerides were seen in female carriers of the S447* allele (Table 5-5). 5.3.4 LPL genotype and risk of CHD CHD was present in 84 men (8%) and 36 women (3%) respectively. Logistic regression models were used to estimate the association between the LPL gene alleles and the prevalence of CHD. The results of the first model adjusting for age, BMI, smoking and alcohol (as well as menopausal status and estrogen therapy in women) are presented in Table 5-6 and showed that the S447* allele was associated with a significantly decreased likelihood for CHD in men (PvR=0.42; p=0.04). Adjustment for plasma cholesterol, HDL-C and triglycerides along with other risk factors slightly decreased this relationship (RR=0.5, p=0.09), suggesting that the impact of the S447* allele on CHD was, at least in part, 151 Chapter V independent of the effect of the S447* alleles on plasma lipids. In contrast, corresponding analysis for the N9/S291 alleles showed no significant association between these variants and the prevalence of CHD in either gender. 1 5 2 > - f i O 00 cu cd O fi -§ "2 !& o 'o CL) PH 00 SH <£ G CJ CO cu _> C cu > cu In P H TJ < cn "C cu JD cd +-> 3 o cd SH cn TJ TJ O in i in cu 1 a. o cu J3 O. C CJ IT) ON Pi o N« tn PH u o CZ5 H ON CN z O cu u s Jj "3 > cu &. PH cu "5 > c C U IT) ON o z Tt ON O NO p NO in ,—1 0 0 NO in i • in • rn i in • 0 0 © Os Tl-CO m o ON O o CN CN Tt CN NO CN o Os m m © © © © © © © © © © o Tt Tt NO © oo oo CN rn — CN CN CN Os CN O CN CN © —•' —' rn — Tt m p Os ON Tt Tt m m CN m CN Tt m r- NO in NO — © © © © © © © © © in NO Tt ON NO CN m m NO m oo OO NO rn in Tt p r--in © © © © O °i NO cn in NO ON © in m i CN NO cn Tt CN o o" cn NO o m O Tt o © Tt © OO ON ON Tt 0 0 © in o © o © © © © V © © © © o m p m CN in Os NO CN CN Tt © oo cn Tt Tt ON CN r-0 0 —' m Tt r-" Tt cn Tt rn t-" © in (N NO CN cn Os oo m © ON CN CN 0 0 m r^ -m © © — —• —• —• o O © © CN m m m Tt CN NO cn ON NO Tt © Tt NO ON ON CN © o o CN CN cn CN © TP O ^ CN" CN O ^ G" NO" Tt~ 0 0 S rn" m 0 0 o CN Tt CN oo ON © 0 0 m in oo m s cu T3 -J I | Tt © CN VO A A I £ E— - J X J "5b s H-l -a © w A A - J T3 "5b E in m V U I —) Q X x) c C3 © © in m V U I _J Q X CD 12 4) O 1) 12 D O .SP o 1) s © Tt CN A C J • o H -a "5b & © NO A C J I —I Q -J - J ^b in m V O I T J ^ b © © CN A C/J CD !2 'C <u CJ >, .SP 'C E— -o "ob E in m V O I -1 a x •a c cd © © CN A 1/5 4) r2 'C CD CJ .SP *c E— o c o o D. o a. I  CL oo oo >> CJ -a > -5 J "o CJ CJ o CJ > c o CJ o r-~ SO OO m cj T3 '> '-5 O £ E 11 3 CJ C ^ CJ CJ > o cd cj Ofi " CJ tl c cj Cd > Cd cj cn XJ C fc « c C^  o J — cd rn in 5H 5 CD C/3 CD 1/3 5 CD X c? S3 o 1-o U •--& P-T P H , c .2 rt o cd CD > CD > (D •— CL T3 rt o •— C/3 T3 o VO <D i i f—1 * rr rf r/2 P H CD =S 13 o O N C/3 o C/3 O N C N O N P P H P H CD 13 > CH| o X ? in O N rt O 0S-cn rr O O N ' 1 06 cn rf N O O N CN o O O O 0-o O O O 10s cn cn ^ O N cn CN O CN >-H CN O N N O CN CN ^ H m CN cn O 0 O 0 N—^ CN CN O rf rf O N I O O O O O O O C N O O N O rf cn CN CN O 00 00 O N rf 1 1 cn I T ) N O n- N O O 0 0 oo" C-- O N O N rf ^ rf O O CN O O O CN O O O O O r- CN N O N O N O O O O 00 cn 00 cn N—s rt- NO rf NO 00 cn * 00 cn l H o -4—» CJ C/3 c2 CD rt C/3 =5 rr rt! —< r f c/3 O rt rf - H —1 rf rt CD a CD O c CD C/3 'S, T 3 CD rt C/3 00 c/l CD T3 3 ca 0. o c CJ c o ' € o 0. 8 CD rt T3 O rt>2 fc cn rt co 7 3 rt co u u — rt 3 Q 13 co _•> rt *- CO o rP > T 3 - O C CD CD CD to to J?* 3 3 Ji G-co co • • . . . . UH * +— CL r f IT) Chapter V 5.4 DISCUSSION Coronary heart disease (CHD) is a leading cause of death in most industrialized countries and both environmental and genetic factors have been shown to play an important role in its etiology. Recently, three functional D N A polymorphisms have been described in the LPL gene, a critical enzyme in triglyceride metabolism. However, the frequency and phenotypic effect of these polymorphisms in the general population has not been reported. We report here that approximately 23% of North Americans of Caucasian descent may be carriers of functional changes in the LPL gene, with 6% carrying either a D9N (3%) or N291S (3%) and 17% carrying a S447* polymorphism. In addition, we also show in men that the D9N and N291S polymorphisms are significant predictors of raised triglycerides levels while the S447* polymorphism is associated with decreased triglycerides and a lower prevalence of coronary heart disease in middle aged Caucasian men. The carrier frequencies for LPL polymorphisms in the Framingham Offspring Study are similar to frequencies reported earlier in European countries. These results are consistent with the ethnic background of the Framingham Offspring Study as the vast majority of participants are descended from Irish, British and Italian immigrants to the United States over the last 300 years. 155 Chapter V Plasma lipid values and risk for CHD were assessed for each LPL genotype. In men, the S447* allele significantly reduces the relative odds for prevalent CHD. Men carrying this allele show a 5% increase in HDL-C and a 13% decrease in triglycerides while the estimated relative risk for CHD in these individuals is reduced by 60% compared with non-carriers (PO.04). The S447* variant was first reported as the molecular basis for LPL deficiency in a patient with type I hyperlipidemia (Kobayashi et al., 1992). However, in vitro analysis of this variant has yielded conflicting results concerning its functional effects on catalytic function (Faustinella et al., 1991; Kozaki et al., 1993; Previato et al., 1994; Zhang et al., 1996). It has been suggested that the S447* variant may result in increased production of LPL protein and lipolytic activity (Kozaki et al., 1993; Zhang et al., 1996; Groenemeijer et al., 1997). Increased levels of remnants of triglyceride-rich particles have been shown to correlate with progression of atherosclerosis (Phillips et al., 1993). Because increased lipolysis results in enhanced turn-over and clearance of remnants particles, it is suggested that increased catalysis could provide a possible mechanism for the effect of this variant on lipids and CHD. Our results also suggest that the protective effect of the S447* polymorphism is, in part, independent of its effect on catalysis and its association with plasma lipids. LPL enhances 156 Chapter V the binding of apoB-lipoproteins to the cellular surface and the extracellular matrix in vitro, a property shown to be independent of LPL catalytic activity (Eisenberg et al., 1992; Skottova et al, 1995). Retention of apoB-lipoprotein at the vessel wall has been suggested as a key factor for the initiation and development of atherosclerotic lesions (Zilversmit, 1979; Rapp et al., 1994). Because LPL is found both at the vessel wall and in atherosclerotic lesions (Williams et al., 1992; O'Brien et al., 1992), it is possible that truncation of the carboxy-terminal portion of the LPL enzyme results in decreased retention of apoB-lipoproteins at the vessel wall.. These effects could be mediated by reduced interaction with extracellular matrix components that interact with LPL, such as sphingomyelinase and proteoglycans (Rumsey et al., 1992; Eisenberg et al., 1992; Tabas et al., 1993; Edwards et al., 1995; Williams and Tabas, 1995). The net effect could be decreased apoB-lipoproteins in early and developing atherosclerotic lesions. Men carrying a D9N or N291S allele show a 6% decrease in HDL-C levels compared to non-carriers and a trend to increased triglycerides levels by approximately 16% (p=0.07). Logistic regression models were used to test for associations between these LPL genotypes and plasma lipids, and the results clearly showed that the D9N and N291S alleles were associated with an increased likelihood for both low HDL-C levels (RR: 2.2) and high triglyceride levels (RR: 2.4). The association of the D9N and N291S allele with low HDL-C was stronger than that for smoking (RR: 2.1) in this group. 157 Chapter V Low HDL-C level is a major risk factor for CHD. In this study, male carriers of the D9N and N291S show an increased likelihood (RR: 3.7) for the low HDL-C/ high triglyceride phenotype, a result highly predictive of individuals at an increased risk for CHD. However, no influence of the D9N/N291S mutations on the frequency of CHD was detected. Participants in the Framingham Offspring Study are still relatively young, with a mean age of 51 years old, and CHD is a relatively infrequent event before the age of 60 in this group. As the D9N and N291S variants occur in only 6% of the population sample, the statistical power to detect an association between the D9N and N291S and CHD is limited. The Framingham Offspring Study, however, is an ongoing prospective study, and as such will allow reassessment of these issues at a later time as the population ages and more CHD becomes evident. No significant associations between LPL genotype and plasma lipids or CHD were demonstrated in women. The lack of association with CHD can most likely be explained by the small number of women with CHD (11 women) in this relatively young cohort. However, the absence of association with lipid levels is less clear. It is well established that lipid levels are influenced by hormonal levels in women. However, consideration of menopausal status and estrogen replacement therapy did not alter the results. Gender-specific variations in lipid levels and LPL activity have previously been shown in persons 158 Chapter V heterozygous for LPL deficiency. Indeed, while plasma LPL activity was significantly associated with plasma triglycerides and HDL-C in men, similar effects were not seen in pre-menopausal women (St-Amand et al., 1995). A recent report has suggested that the N291S mutation may influence nonfasting lipid levels in a large cohort of Danish women (Wittrup et al., 1997). However, our earlier studies demonstrated that while fasting lipids may be normal, postprandial measurements may unmask lipid abnormalities in patients with mutations in the LPL gene (Pimstone et al., 1996). It is therefore possible that, under certain circumstances, these mutations may be associated with lipid abnormalities in women. To date, no DNA changes in any gene have been found in relatively high frequency which appear to alter HDL-C and/or triglycerides levels in the general population. Here we describe three common polymorphisms in the LPL gene which modulate plasma lipid levels, in particular HDL-C and triglycerides. In addition, we report for the first time a common DNA change seen in 1 in 6 persons in this population associated with protection against premature atherosclerosis in men. Such results encourage further examination of the role of LPL in CHD and the potential benefits of assessment for these mutations in the general population. 159 Chapter VI Chapter VI 6. GENERAL DISCUSSION The studies described in this thesis were designed to determine the role that LPL may play in the complex process leading to dyslipidemia and coronary heart disease. Based on the prior observation that LPL plays an important role in plasma lipid homeostasis but that complete LPL deficiency is rarely lethal i f appropriately diagnosed and treated, we speculated that common mutations with partial defects may exist within the population which may modulate plasma lipids and the risk for developing coronary artery disease. Our first approach involved screening for mutations in the coding region of the LPL gene in patients with FCHL (Chapter II). Such patients are present in approximately 1 % of the population and account for approximately 11% of patients with premature CAD. That LPL may be involved in the etiology o f at least a subset of FCHL was originally proposed by Babirak et al. (Babirak et al., 1989) following the observation of similarity between the phenotype expressed by heterozygotes for LPL deficiency and FCHL. This proposal was further strengthened by the observation that approximately 36% of FCHL individuals had reduced LPL (Babirak et al., 1989). Our examination o f the coding region o f the LPL gene in a cohort of FCHL patients was initiated through a collaboration with Dr. Jacques Genest Jr. in Montreal, who provided us 160 Chapter VI with the DNA of 31 unrelated French Canadians diagnosed with FCHL. Using SSCP as a screening method, I was able to identify DNA changes which were characterized at the molecular level. A total of 3 silent mutations and 5 amino acid substitutions were identified. Silent mutations rarely represent functional changes unless present in a consensus splicing site. Since these mutations did not affect a splicing site, and given the similar allele frequency observed in the affected group and our control group, these changes were unlikely to represent potential disease causing mutations. Of the remaining 5 mutations, 3 had previously been described (D9N, G188E, S447*) and 2 were novel mutations (D21V, H44Y). Careful examination of the 2 novel mutations using transient expression in vitro revealed no defects in LPL as measured by the mass and activity of the gene product. Segregation analysis in family members of the probands did not clearly support the association of these 2 mutations with the phenotype studied. This is also suggested by the absence of these mutations in the original cohort of FCHL reported by Babirak (personal communication). Of the remaining 3 mutations, 2 showed similar frequency in both FCHL and control alleles (D9N and S447*), and one (G188E) was considered a coincidental change in a population with a relatively high frequency of this mutation. Our results therefore suggest that 161 Chapter VI mutations in the LPL gene do not represent a frequent cause of FCHL in the French Canadian population. Nevin et al. (Nevin et al., 1994) simultaneously reported similar findings in the original cohort of 20 FCHL with reduced LPL activity from the Seattle area. More recently however, Reymer et al. (Reymer et al., 1995b) and Mailly et al. (Mailly et al., 1995) reported that in European cohorts, the D9N and N291S mutations are found with an increased frequency in FCHL patients compared to controls. Extensive family studies conducted for 3 probands carrying the N291S mutation showed that the carrier status explained approximately 12% of the total variance in plasma triglycerides, supporting a possible role for this mutation in the etiology of the disease. While the N291 mutation has been observed in the French Canadian population, particularly in hypertriglyceridemic patients (Minnich et al., 1995),this mutation was not present in our cohort of FCHL. On the other hand, the D9N was found at similar or slightly increased frequency in our control group, the highest prevalence reported to date for this variant. The discrepancy between our findings and those of Reymer et al. (Reymer et al., 1995a) and Mailly et al. (Mailly et al., 1995) most likely are due to the much smaller sample size examined in our study. 162 Chapter VI Taken together, these results suggest that LPL mutations are not a primary cause of FCHL. However, LPL mutations D9N and N291S may represent predisposing genetic factors for FCHL. Clearly, additional genetic and environmental factors are required for the complete expression of the FCHL phenotype. Our second approach consisted in screening for mutations in the LPL gene in individuals with coronary disease. Our results indicate that 3 common amino acid substitutions are present in the LPL gene of C A D individuals with low LPL activity. Two mutations, D9N and N291S, are associated with decreased HDL-C and a trend to increased triglycerides in C A D patients, while a third mutation (S447*) is associated with increased HDL-C and a trend to decreased triglyceride levels. Our comprehensive in vitro study confirms the functionality of these 3 variants. Finally, we showed that these 3 common variants modulate lipid levels in the general population and that the S447* mutation is associated with significant protection against premature atherosclerosis in Caucasian males. Our strategy to screen for mutations in the LPL gene of patients with C A D clearly provided us with an ability to rapidly identify the 3 amino acid substitutions which are frequent in this gene. This finding was unexpected, given the significant variability of LPL mutations which afflict patients with classical chylomicronemia. In addition, at least 2 of these mutations, D9N and S447*, had been previously described and generally believed to 163 Chapter VI represent common mutations with no significant effect as in vitro expression studies revealed little difference as compared to the wild type LPL. The N291S mutation on the other hand has been shown by Dr. Robin Ma in our laboratory to be associated with severe chylomicronemia during pregnancy, although its general relevance with regards to other forms of dyslipidemia was unknown. Our report on the N291S mutation which appeared in Nature Genetics in 1995 (Reymer et al., 1995a) was the first report to conclusively show that a common LPL mutation with a partial defect was associated with reduced HDL-C. Our findings of decreased HDL-C in carriers of the N291S mutation have been substantiated by some (Pimstone et al., 1995; Reymer et al., 1995b; Hoffer et al., 1996; Wittrup et al., 1997; Wittekoek et al., 1998; Reymer et al., 1995b) but not others (Jemaa et al., 1995; Fisher et al., 1995; de Bruin et al., 1996). Similarly, triglyceride levels in carriers were found to be increased in certain studies (Fisher et al., 1995; Reymer et al., 1995b; Wittrup et al., 1997; Gerdes et al., 1997; Wittekoek et al., 1998) but not in others (Pimstone et al., 1995; Jemaa et al., 1995; de Bruin et al., 1996). Only two studies so far report no association between the N291S variant and either HDL-C or triglyceride levels. Of these two studies, one (de Bruin et al., 1996) was conducted in a very small sample size (N=6). Overall, the overwhelming majority of the studies to date confirm that the N291S mutation is associated with lipid abnormalities, specifically raised triglycerides and low HDL-C levels. These conclusions are also 164 Chapter VI supported by post-prandial studies which indicate that carriers present with delayed post-prandial triglyceride clearance (Pimstone et al., 1996; Gerdes et al., 1997). Despite the association of the N291S mutation with lipid abnormalities, only one study has shown an increase prevalence of CAD in individuals carrying this mutation compared to non-carriers (Wittrup et al., 1997). In this study, which sampled 9214 individuals from the population and 948 patients with ischemic heart disease, women carriers of the N291S mutation were found more frequently among patients with ischemic heart disease than among individuals from the general population. This association was not seen in men. The study also reported that this variant is associated with a decrease in HDL-C levels in both genders and a statistically significant decrease in triglyceride levels in women only. This is in contrast to our own population study where an association was detected between carriers and lipid levels only in men. Although Wittrup et al. studied a large population sample, individuals in that study, in contrast to the FOS, were assessed in the non-fasting state. The authors speculate that the lack of association between N291S and triglycerides in men may explain the absence of associated risk of ischemic heart disease in men. Alternatively, it could be argued that because non-fasting triglyceride levels are generally higher than fasting levels, the plasma triglyceride levels reported in this study might not accurately reflect the full impact of the N291S mutation on this parameter. 165 Chapter VI A recent meta-analysis by Hokanson (Hokanson, 1997) which combined all published data on the 3 common LPL variants (D9N, N291S and S447*) reporting C A D disease status for both carriers and non-carriers ( total 5998 individuals), revealed no association between N291S and C A D in men. (OR: 0.93 CI 0.73-1.19). Adding data collected by Witttrup et al. on women did not change these results appreciably. In contrast, Hokanson reports that the D9N and S447* mutations are associated with coronary disease, with the D9N showing an increased risk, and the S447* showing a decreased risk for coronary disease. While no differences in frequencies could be demonstrated in case-control studies of C A D patients, Wittekoek et al. (Wittekoek et al., 1998) recently reported an increased frequency of cardiovascular diseases in FH heterozygotes carrying the N291S mutation compared to FH heterozygotes lacking this mutation (OR: 3.9; p=0.006). In addition at least 3 other reports suggest an increased frequency of this mutation in dyslipidemic patients, particularly FCHL, type III, type IV and type V hyperlipoproteinemia (Minnich et al., 1995; Zhang et al., 1995; Reymer et al., 1995b). Thus it can be concluded that, based on all data reported to date, the N291S mutation modulates plasma lipid levels, particularly through increased triglyceride levels and decreased HDL-C levels. The combined data also suggest that despite its influences on lipid levels, the presence of the N291S mutation alone may not be sufficient to lead to coronary disease but that in combination with other genes or environmental factors such as obesity (Fisher et al., 1995; Gerdes et al., 1997), pregnancy (Ma et al.., 1993), 166 Chapter VI gender (Wittrup et al., 1997) and FH (Wittekoek et al., 1998), the N291S mutation represents a predisposing genetic factor for coronary disease. The D9N mutation is now known to be in almost complete linkage disequilbrium with a promoter mutation resulting in a T to G transition at nucleotide -93 of the LPL gene in Caucasian populations. The results pertaining to the transcriptional activity of this variant in vitro have been conflicting. This allele has been shown to have a reduced transcriptional activity (40-50% of wild type) in the human monocytic cell line THP-1 and the myoblast cell line C2C12 (Yang et al., 1995; Yang et al., 1996), while the promoter activity was increased with this variant by 24% and 18% in smooth muscle cell lines and human adrenal cell lines respectively (Hall et al., 1997). Studies from our own laboratory reveal that the frequency of this mutation varies widely between ethnic groups. While this mutation is present without the D9N in only 1.7% of the Dutch Caucasian population, the carrier frequency is 76% in the South African Black population (Ehrenborg et al., 1997). These results suggest that the -93g allele might be in fact the ancestral allele. This is consistent with the observation that the -93g allele is conserved among other species including mice (Hua et al., 1991; Zechner et al., 1991), chicken (Cooper et al., 1992) and cats (K.A Excoffon, unpublished data). The population differences, along with the association of the D9N mutation with a specific C A allele repeat size within the LPL gene in Caucasians, clearly suggest that the D9N mutation originated on a specific -93 g allele. 167 Chapter VI Two studies have reported decreased triglyceride levels in individuals carrying the -93g promoter mutation alone (Ehrenborg et al., 1997; Hall et al., 1997). These results are consistent with an increased transcriptional activity in the presence of this mutation. The question therefore arises as to which mutation, D9N or -93g, is responsible for the phenotypic effect observed in our study of Caucasian individuals carrying both mutations. Since the -93g leads to decreased triglyceride levels in vivo and the D9N has been shown to have decreased activity in vitro (D9N alone) and in vivo (-93 g and D9N combined), the observed decrease in triglyceride levels associated with the D9N (-93 g and D9N combined) suggests that the effect of the D9N predominates over the effect of the -93 g mutation in vivo. A recent meta-analysis by Kastelein et al. (Kastelein et al., 1998) combining lipid data from published and unpublished studies and looking at gender specificity in LPL mutations confirms our findings that the D9N mutation does not lead to decreased HDL-C in women. Although triglyceride levels were significantly increased in female carriers, this increase was 40% smaller than the increase observed in males, suggesting that women respond only modestly to the effect of the D9N mutation on lipid levels. It is therefore possible that women compensate for the reduced LPL activity associated with this variant by enhancing expression and secretion of the enzyme. We have shown that the D9N variant results in 168 Chapter VI decreased LPL activity in vitro, most likely as a result of decreased secretion of the enzyme. Overexpression of the variant may be sufficient to compensate for the reduced activity and its effect on plasma lipids. The -93g promoter mutation may represent a key player in this gender specificity in Caucasian individuals. The -93 g leads to decrease triglyceride levels in vivo, a finding consistent with increased transcriptional activity. Hall et al. (Hall et al., 1997) recently demonstrated through band shift assay that a protein binds to the -93g but not to the -931 allele, adding weight to the argument of the functionality of this variant. It is therefore tempting to speculate that the enhancing effect of the -93 g variant may be increased to a higher level in women through hormonal stimulation. Studies in Black African women based on their menopausal status may help clarify this issue. Our studies suggest that C A D patients carrying the D9N mutation present with reduced HDL-C and increased progression of atherosclerosis as compared to non-carriers. We also present evidence that the negative effect of this mutation may not be entirely attributed to changes in lipid levels induced by this variant and suggest that other functions of the LPL enzyme may contribute to this effect. It remains to be determined whether women who seem to be able to resist the unfavorable effect of this variant on lipid levels will present with an increased risk for coronary disease. 169 Chapter VI Of the 6 other studies reported so far (Elbein et al., 1994; Mailly et al., 1995; Mailly et al., 1996; de Bruin et al., 1996; Gerdes et al., 1997), 5 show a statistically significant relationship between triglycerides and carriership of the D9N mutation. The triglyceride levels in our C A D study showed a trend for increased triglycerides in carriers, although this difference did not reach statistical significance. One likely reason for the lack of significant association in our study probably is that the entry criteria for the REGRESS study required triglyceride levels below 4mmol/L, thus excluding hypertriglyceridemic individuals from the study. Nevertheless, our data from the FOS demonstrates that the the D9N is indeed associated with elevated triglycerides in men; a result consistent with the decreased LPL activity associated with this variant in vitro (chapter II and IV) and in vivo (Mailly et al., 1995). Our data (chapter III and V) also support an association between D9N and decreased HDL-C levels. At least two other studies support our findings regarding HDL-C (de Bruin et al., 1996; Gerdes et al., 1997). The decrease in HDL-C associated with this variant is in agreement with the inverse relationship which exists between triglycerides and HDL-C. We report in chapter III that heterozygotes for the D9N mutation are also at increased risk for progression of atherosclerosis (OR : 2.16; P=0.027). This finding is in keeping with the increased frequency of a family history of C A D in carriers compared to non-carriers. Hokanson calculated that the summary odds ratio for an association between D9N and 170 Chapter VI coronary disease is 1.59 (CI : 1.03-2.55) (2881 individuals), representing a 59% increase in coronary disease risk in carriers. Our data from the REGRESS study suggest that the progression of atherosclerosis attributed to the D9N mutation can be prevented by pravastatin therapy. Therefore, lowering L D L cholesterol may be of particular benefit in such patients. Identification of C A D patients carrying the D9N may therefore prove valuable in targeting patients most likely to benefit from early treatment with lipid lowering therapy. The S447* mutation is the third mutation commonly found in the coding region of the LPL gene. With a frequency varying from 10% to 23% (mean 20%), this mutation is by far the most frequent of all 3 variants. Evidence from several laboratories including ours (chapter IV) suggest that this variant is responsible for an increased secretion of monomeric LPL (Kobayashi et al., 1992; Previato et al., 1994). In the FOS study, the S447* mutation was associated with increased HDL-C levels and decreased triglyceride levels in men only. Consistent with this finding, the S447* was found at increased frequency in C A D patients with high HDL-C levels. Kuivenhoven et al. (Kuivenhoven et al., 1997) have reported similar findings in men from the general population selected on the basis of low, medium or high HDL-C levels. 171 Chapter VI We also demonstrate for the first time that the S447* mutation is associated with significant protection against coronary disease in men (RR 0.4; P=0.04). The estimated preventive fraction indicates that approximately 9% of coronary disease in this population was prevented as a result of the S447* mutation. This effect is comparable in amplitude, although in opposite direction, to the effect of the apo E4 allele on the prevalence of coronary disease in men of the FOS (Wilson et al., 1994). Hokanson (Hokanson, 1997) calculated that the summary odds ratio of 4 other studies which independently failed to demonstrate a significant association, yielded a significant odds ratio of 0.81 (CI : 0.(51-1.0) between S447* and coronary disease when these studies were combined (2075 individuals), confirming our findings in the FOS. The recent description of an increased frequency of the S447* in centenarians compared to young healthy controls also supports our findings and suggest that this variant is associated with increased longevity. The exact mechanism by which these three mutations exert their effect on plasma lipid and coronary disease is still unclear. Our in vitro studies indicate that the N291S mutation leads to the most impaired LPL enzyme of all 3 variants. Despite this finding, the N291S appears to require other genetic or environmental factor to achieve its full potential in vivo, while the D9N and S447* appear to be independent risk factor for coronary disease. This observation raises the possiblity that other functions of the protein beside catalysis may be involved in modulating the risk for coronary disease. This hypopthesis is also supported by 172 Chapter VI the observation that changes in plasma lipids induced by the D9N and S447* mutation do not fully explain the increased risk for coronary disease in these individuals. LPL is now considered a molecule with both an atherogenic and anti-atherogenic potential. The fine balance between these two functions appears to be dependent on a number of factors, primarily the amount, nature, and expression pattern of the enzyme. While high plasma LPL appears to be anti-atherogenic in nature through clearance of triglyceride-rich particles from the circulation, indirect evidence suggests that LPL within the vessel wall may have an atherogenic effect through increased retention of triglycerides-rich particles thereby contributing to plaque formation (Williams and Tabas, 1995). In this respect, LPL behaves in a similar fashion to cholesterol, showing both beneficial and detrimental characteristics. Any changes brought about either genetically or through environmental stimuli, may therefore shift the balance in favor of the protective effect against atherosclerosis. Factors which will increase LPL activity in the plasma without affecting LPL at the vessel wall will likely be anti-atherogenic in nature while changes in LPL properties at the vessel wall without compensatory effect on plasma LPL will likely predispose to atherosclerosis. The complexity of the effects associated with the 3 variants described in this thesis clearly illustrate this principle and challenge us to find innovative approaches to resolve the underlying mechanisms involved in this process. 173 7. BIBLIOGRAPHY Alaupovic, P. (1981). David Rubinstein Memorial Lecture: the biochemical and clinical significance of the interrelationship between very low density and high density lipoproteins. Canadian Journal of Biochemistry 59, 565-579. Alaupovic, P., Mack, W.J., Knight-Gibson, C , and Hodis, H.N. (1997). The role of triglyceride-rich lipoprotein families in the progression of atherosclerotic lesions as determined by sequential coronary angiography from a controlled clinical trial. Arterioscler.Thromb.Vasc.Biol. 17,715-722. Allain, C C , Poon, L.S., Chan, C.S.G., Richmond, W., and Fu, P .C (1974). Enzymatic determination of total cholesterol. Clin.Chem. 20, 470-475. Ameis, D., Kobayashi, J., Davis, R . C , Ben-Zeev, O., Malloy, M.J., Kane, J.P., LeeG., Wong, H., Havel, R.J., and Schotz, M.C. (1991). Familial chylomicronemia (type I hyperlipoproteinemia) due to a single missense mutation in the lipoprotein lipase gene. J.ClinJnvest. 87, 1165-1170. American Heart Association. 1997 Heart and Stroke Statistical update. 1-29. 1996. Texas, USA, American Heart Association. Anderson, N.G. and Fawcett, B. (1950). An antichylomicronemic substance produced by heparin injection. Proc.Soc.Exp.Biol.Med 74,768-771. Anfinsen, C.B., Boyle, E., and Brown, R.K. (1952). The role of heparin in lipoprotein metabolism. Science 115, 583-586. Anwar, R., Puntis, J.W., and Markham, A.F. (1997). A new mutation in the human lipoprotein lipase gene causing familial hyperchylomicronaemia. Mol.Pathol. 50, 221-223. Appelman, E.E.G., Bijvoet, S.M., Wiebusch, H., Ma, Y. , Reymer, P.W., Bruin, T., Hayden, M.R., and Kastelein, J.J. (1994). A de novo mutation in the lipoprotein lipase (LPL) gene causing LPL deficiency. Atherosclerosis 109, 63(Abstract) Aruffo, A. (1991). Current Protocol in Molecular Biology (New York: Green/Wiley-Interscience). Assmann, G. and Schulte, H. (1992). Relation of high-density lipoprotein cholesterol and triglycerides to incidence of atherosclerotic coronary artery disease (the P R O C A M experience). Prospective Cardiovascular Munster study. Am.J.Cardiol. 70, 733-737. 174 Austin, M.A. (1991). Plasma triglyceride and coronary heart disease. Arterioscler.Thromb 77,2-14. Austin, M.A. , Brunzell, J.D., Fitch, W.L., and Krauss, R .M. (1990). Inheritance of low density subclass patterns in familial combined hyperlipidemia. Arteriosclerosis 10, 520-530. Austin, M.A. , Horowitz, H., Wijsman, E., Krauss, R .M. , and Brunzell, J.D. (1992). Bimodality of plasma apolipoprotein B levels in familial combined hyperlipidemia. Arterioscler.Thromb 92, 67-77. Babirak, S.P., Brown, B.G., and Brunzell, J.D. (1992). Familial combined hyperlipidemia and abnormal lipoprotein lipase. Arterioscler.Thromb 12, 1176-1183. Babirak, S.P., Iverius, P.H., Fujimoto, W.Y., and Brunzell, J.D. (1989). Detection and characterization of the heterozygote state for lipoprotein lipase deficiency. Arteriosclerosis 9, 326-334. Beg, O.U., Meng, M.S., Skarlatos, S.L, Previato, L., Brunzell, J.D., and Brewer, H.B., Jr. (1990). Lipoprotein lipaseBethesda: a single amino acid substitution (Ala-176—Thr) leads to abnormal heparin binding and loss of enzymic activity. Proc.Natl.Acad.Sci. 87, 3474-3478. Beisiegel, U. , Weber, W., and Bengtsson-Olivecrona, G. (1991). Lipoprotein lipase enhances the binding of chylomicrons to low density lipoprotein receptor-related protein. Proc.Natl.Acad.Sci. 88, 8342-8346. Benlian, P., De Gennes.J.L., Foubert, L., Zhang, H., Gagne, S.E., and Hayden, M . (1996). Premature atherosclerosis in patients with familial chylomicronemia caused by mutations in the lipoprotein lipase gene. N.Engl.J.Med. 335, 848-854. Benlian, P., Etienne, J., de Gennes, J.L., Noe, L., Brault, D., Raisonnier, A., Hamelin, J., Foubert, L., Chuat, J.C., (1995). Homozygous deletion of exon 9 causes lipoprotein lipase deficiency: possible intron-Alu recombination. J.Lipid Res. 36, 356-366. Bergeron, J., Normand, T., Bharucha, A. , Ven Murthy, M.R., Julien, P., Gagne, C., De Braekeleer, M . , Brun, D., Hayden, M.R., (1992). Prevalence, geographical distribution and genealogical investigations of mutation 188 of lipoprotein lipase gene in the French Canadian population of Quebec. Clin.Genet 41, 206-210. Berryman, D.E. and Bensadoun, A . (1993). Site-directed mutagenesis of a putative heparin binding domain of avian lipoprotein lipase. J Biol.Chem. 268, 3272-3276. 175 Bijvoet, S., Gagne, S.E., Moorjani, S., Gagne, C., Henderson, H.E., Fruchart, J.C., Dallongeville, J., Alaupovic, P., Prins, M . , Kastelein, J.J.P., and Hayden, M.R. (1996). Alterations in plasma lipoproteins and apolipoproteins before the age of 40 in heterozygotes for lipoprotein lipase deficiency. J.Lipid Res. 37, 640-650. Bijvoet, S.M., Bruin, T., Tuzgol, S., Bakker, H.D., Hayden, M.R., and Kastelein, J.J. (1994). Homozygosity for a mutation in the lipoprotein lipase gene (Glyl39—>Ser) causes chylomicronaemia in a boy of Spanish descent. Hum.Genet 93, 339-343. Braun, J.E. and Severson, D.L. (1992). Lipoprotein lipase release from cardiac myocytes is increased by decavanadate but not insulin. Am.J Physiol. 262, E663-E670 Breckenridge, W.C., Little, J.A., Steiner, G., Chow, A., and Poapst, M . (1978). Hypertriglyceridemia associated with deficiency of apolipoprotein C-II. N.Engl.J.Med. 298, 1265-1273. Bruin, T., Kastelein, J.J., Van Diermen, D.E., Ma, Y. , Henderson, H.E., Stuyt, P.M.. Sturk, A. , Brunzell, J.D., and Hayden, M.R. (1992). A missense mutation Prol57 Arg in lipoprotein lipase (LPLNijmegen) resulting in loss of catalytic activity. Eur.J Biochem. 208, 267-272. Bruin, T., Tuzgol, S., Mulder, W.J., van den Ende, A.E. , Jansen, H., and Hayden, M.R. (1994). A compound heterozygote for lipoprotein lipase deficiency, Val69~>Leu and Glyl88~>Glu: correlation between in vitro LPL activity and clinical expression. J.Lipid Res. 35, 438-445. Bruin, T., Tuzgol, S., Van Diermen, D.E., Hoogerbrugge-van der Linden, N . , Hayden, M.R., and Kastelein, J.J. (1993). Recurrent pancreatitis and chylomicronemia in an extended Dutch kindred is caused by a Glyl54—>Ser substitution in lipoprotein lipase. J.Lipid Res. 34,2109-2119. Bruin, T., Vander Sluis, B.E.M., and Kastelein, J.J.P. (1992). Identification ofthe ApoCII binding site on human LPL. Circulation 86,1-608 Brunzell, J.D. (1995). Familial lipoprotein lipase deficiency and other causes of the chylomicronemia syndrome. In The Metabolic and Molecular Bases of Inherited Disease Vol. II. C R . Scriver, A.L . Beaudet, W.S. Sly, and D. Valle, eds. (New York: McGraw Hill, Inc.), pp. 1913-1932. Brunzell, J.D., Albers, J.J., Chait, A. , Grundy, S.M., Grosek, E., and McDonald, G.B. (1983). Plasma lipoproteins in familial combined hyperlipidemia and monogenic familial hypertriglyceridemia. J.Lipid Res. 24,147-155. 176 Buccolo, G. and David, H. (1973). Quantitative determination of serum triglycerides by the use of enzymes. Clin.Chem. 19, 476-482. Burger, M . and Grutz, O. (1932). Uber hepatosplenomegale lipoidose mit xantomatosen veranderungen in haut und schleimhaut. Arch.Dermatol.Syphilol. 166, 542 Castelli, W.P. (1992). Epidemiology of triglycerides: a view from Framingham. Am.J.Cardiol. 70, 3H-9H. Castelli, W.P., Garrison, R.J., Wilson, P.W., Abbott, R.D., Kalousdian, S., and KannelWB. (1986). Incidence of coronary heart disease and lipoprotein cholesterol levels. The Framingham Study. J A M A 256, 2835-2838. Chaillan, C , Kerfelec, B., Foglizzo, E., and Chapus, C. (1992). Direct involvement of the C-terminal extremity of pancreatic lipase (403-449) in colipase binding. Biochem.Biophys.Res.Commun. 184, 206-211. Chait, A., Albers, J.J., and Brunzell, J.D. (1980). Very low density lipoprotein overproduction in genetic forms of hypertriglyceridemia. Eur.J Clin.Invest. 110, 12-22. Chimienti, G., Capurso, A., Resta, F., and Pepe, G. (1992). A G — C change at the donor splice site of intron 1 causes lipoprotein lipase deficiency in a southern-Italian family. Biochem.Biophys.Res.Commun. 187, 620-627. Clarke, A.R. and Holbrook, J.J. (1985). The mechanism of activation of lipoprotein lipase by apolipoprotein C-II. The formation of a protein-protein complex in free solution and at a triacylglycerol/water interface. Biochim.Biophys.Acta 827, 358-368. Cooper, D.A., Lu, S.C., Viswanath, R., Freiman, R.N., and Bensadoun, A. (1992). The structure and complete nucleotide sequence of the avian lipoprotein lipase gene. Biochim.Biophys.Acta 1129, 166-171. Cupples, L.A. and D'Agostino, R.B. (1987). Some risk factors related to the annual incidence of cardiovascular disease and death using pooled biennial measurements: Framingham Heart study, 30 years follow-up. In The Framingham study: Epidemiological investigation of cardiovascular disease. Spingfield,VA: U.S. Department of Commerce Davis, R.C., Wong, H., Nikazy, J., Wang, K., Han, Q., and Schotz, M.C. (1992). Chimeras of hepatic lipase and lipoprotein lipase. Domain localization of enzyme-specific properties. J Biol.Chem. 267, 21499-21504. 177 Day, J.L., Metcalfe, J., Simpson, N . , and Lowenthal, L. (1984). Adrenergic mechanisms in the control of plasma lipids in man. Am.J.Med. 76, 94-96. de Bruin, T.W., Mailly, F., van Barlingen, H.H., Fisher, R., Castro Cabezas, M . , Talmud, P., Dallinga-Thie, G.M., and Humphries, S.E. (1996). Lipoprotein lipase gene mutations D9N and N291S in four pedigrees with familial combined hyperlipidaemia. Eur.J Clin.Invest. 2(5,631-639. Deeb, S.S. and Peng, R.L. (1989). Structure of the human lipoprotein lipase. Biochemistry 25,4131-4135. Deeb, S.S., Reina, M . , Peterson, J., Takata, K., Kajiama, G., and Brunzell, J.D. (1991). Gene mutations in patients with lipoprotein lipase deficiency. Arterioscler.Thromb. 11, 1418(Abstract) Devlin, R.H., Deeb, S., Brunzell, J., and Hayden, M.R. (1990). Partial gene duplication involving exon-Alu interchange results in lipoprotein lipase deficiency. Am.J Hum.Genet 46, 112-119. Dichek, H.L., Fojo, S.S., Beg, O.U., Skarlatos, S.I., Brunzell, J.D., and Cutler, G.B., Jr. (1991). Identification of two separate allelic mutations in the lipoprotein lipase gene of a patient with the familial hyperchylomicronemia syndrome. J Biol.Chem. 266, A13>A11. Dichek, H.L., Parrott, C , Ronan, R., Brunzell, J.D., and Brewer, H.B., Jr. (1993). Functional characterization of a chimeric lipase genetically engineered from human lipoprotein lipase and human hepatic lipase. J.Lipid Res. 34, 1393-1340. Doolittle, M.H. , Ben-Zeev, O., Elovson, J., Martin, D., and Kirchgessner, T.G. (1990). The response of lipoprotein lipase to feeding and fasting. Evidence for posttranslational regulation. J Biol.Chem. 265, 4570-4577. Edwards, I.J., Xu, H., Obunike, J .C, Goldberg, I.J., and Wagner, W.D. (1995). Differentiated macrophages synthesize a heparan sulfate proteoglycan and an oversulfated chondroitin sulfate proteoglycan that bind lipoprotein lipase. Arterioscler.Thromb.Vasc.Biol. 75,400-409. Edwards, W.D., Daniels, S.E., Page, R.A., Volpe, CP . , Kille, P., and Sweeney, G.E. (1993). Cloning and sequencing of a full length cDNA encoding ovine lipoprotein lipase. Biochim.Biophys.Acta 1172, 167-170. 178 Egelrud, T. and Olivecrona, T. (1973). Purified bovine milk (lipoprotein) lipase: activity against lipid substrates in the absence of exogenous serum factors. Biochim.Biophys.Acta 305,115-127. Ehrenborg, E., Clee, S.M., Pimstone, S.N., Reymer, P.W., Benlian, P., Hoogendijk, CF, Davis, H.J., Bissada, N . , Miao, L., Gagne, S.E., Greenberg, L.J., Henry, R., Henderson, H., Ordovas, J.M., Schaefer, E.J., Kastelein, J.J., Kotze, M.J., Hayden, M.R (1997). Ethnic variation and in vivo effects of the -93t—>g promoter variant in the lipoprotein lipase gene. Arterioscler.Thromb Biol. 17, 2672-2678. Eisenberg, S., Sehayek, E., Olivecrona, T., and Vlodavsky, I. (1992). Lipoprotein lipase enhances binding of lipoproteins to heparan sulfate on cell surfaces and extracellular matrix. J.Clin.Invest. 90, 2013-2021. Elbein, S.C, Yeager, C , Kwong, L.K. , Lingam, A. , Inoue, I., Lalouel, J.M., and WilsonDE. (1994). Molecular screening of the lipoprotein lipase gene in hypertriglyceridemic members of familial noninsulin-dependent diabetes mellitus families. J.Clin.Endocrinol.Metab 79, 1450-1456. Emi, M . , Hata, A., Robertson, M . , Iverius, P.H., Hegele, R., and Lalouel, J.M. (1990a). Lipoprotein lipase deficiency resulting from a nonsense mutation in exon 3 of the lipoprotein lipase gene. Am.J Hum.Genet 47, 107-111. Emi, M . , Wilson, D.E., Iverius, P.H., Wu, L., Hata, A., Hegele, R., and Williams, R.R. (1990b). Missense mutation (Giy—Glul88) of human lipoprotein lipase imparting functional deficiency. J Biol.Chem. 265, 5910-5916. Enerback, S., Semb, H., Bengtsson-Olivecrona, G., Carlsson, P., Hermansson, M.L., and Bjursell, G. (1987). Molecular cloning and sequence analysis of cDNA encoding lipoprotein lipase of guinea pig. Gene 58,1-12. Etienne, J. and Brault, D. (1992). Lipoprotein lipase deficiencies. Annales de Biologie Clinique 50, 299-309. Expert Panel on Detection, E.a.T.o.H.B.C.i.A. (1993). Summary of the second report of the National Cholesterol Education Program (NCEP) Expert Panel on Detection, Evaluation and Treatment of High Blood Cholesterol in Adults (Adult Treatment Panel II). J A M A 269, 3015-3023. Faustinella, F., Chang, A. , Van Biervliet, J.P., Rosseneu, M . , Vinaimont, N . , Smith, L . C , Chen, S.H., and Chan, L. (1991). Catalytic triad residue mutation (Aspl56—Giy) causing 179 familial lipoprotein lipase deficiency. Co-inheritance with a nonsense mutation (Ser447— Ter) in a Turkish. J Biol.Chem. 266,14418-14424. Feinleib, M . , Kannel, W.B., Garrison, R.J., McNamara, P.M., and Castelli, W.P. (1975). The Framingham Offspring Study. Design and preliminary data. Prevent.Med. 4, 518-525. Fisher, K.L. , FitzGerald, G.A., and Lawn, R .M. (1987). Two polymorphisms in the human lipoprotein lipase (LPL) gene. Nucl.Acids Res. 75, 7657-7657. Fisher, R.M. , Mailly, F., Peacock, R.E., Hamsten, A., Seed, M . , Yudkin, J.S., Beisiegel, U. , Feussner, G., Miller, G., Humphries, S.E., and Talmud, P.J. (1995). Interaction of the lipoprotein lipase asparagine 291-serine mutation with body mass index determines elevated plasma triacylglycerol concentrations - a study in hyperlipidemic subjects, myocardial infarction survivors, and healthy adults. J.Lipid Res. 36, 2104-2112. Foubert, L., Benlian, P., and de Gennes, J.L. (1994a). Molecular genetics and lipoprotein lipase deficiency. Bulletin de 1 Academie Nationale de Medecine / 78, 405-413. Foubert, L., Gagne, E., de Gennes, J.L., Ma, Y., Forsythe, I., Liu, M.S., Zhang, H., Dairou, F., Lagarde, J.P., Benlian, P., and Hayden, M.R. (1994b). An analysis of mutations underlying lipoprotein lipase (LPL) deficiency in France. Atherosclerosis 109, 67(Abstract) Frick, M.H. , Dahlen, G., Berg, K., Valle, M . , and Hekali, P. (1978). Serum lipids in angiographically assessed coronary atherosclerosis. Chest 73, 62-65. Friedewald, W.T., Levy, R.L, and Fredrickson, D.S. (1972). Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clin.Chem. 18,499-502. Funke, H. and Assmann, G. (1995). The low down on lipoprotein lipase. Nat.Genet 10, 6-7. Funke, H., Reckwerth, A., Stapenhorst, D., Schulze Beiering, M . , and Jansen, M . (1988). Bst NI (Eco RII) RFLP in the lipoprotein lipase gene (LPL). Nucl.Acids Res. 16, 2741-2741. Funke, H., Wiebusch, H., Paulweber, B., and Assman, G. (1990). Identification of the molecular defect in a patient with Type 1 hyperlipidemia. Arteriosclerosis 10, 830(Abstract) Fuster, V., Badimon, L., Badimon, J.J., and Chesebro, J.H. (1992). The pathogenesis of coronary artery disease and the acute coronary syndromes (1).. N.Engl.J.Med. 326, 242-250. 180 Gagne, C. and Gaudet, D. (1995). Dyslipoproteinemias in Quebec: primary deficit in lipoprotein lipase and familial hypercholesterolemia. Union.Med Can. 124, 61-67. Gagne, E., Genest, J., Jr., Zhang, H., Clarke, L.A. , and Hayden, M.R. (1994). Analysis of DNA changes in the LPL gene in patients with familial combined hyperlipidemia. Arterioscler.Thromb 14, 1250-1257. Galton, D.J., Mattu, R.K., and Cavanna, J. (1994). Polymorphisms ofthe lipoprotein lipase gene and premature atherosclerosis. J Intern.Med Supplement. 736, 63-68. Gehrisch, S., Steinke, M . , Kosta, H., Hoche, I., Julius, U. , and Jaross, W. (1994). Point mutations in the lipoprotein lipase(LPL) gene in normal (N) and combined hyperlipidemic (CH) subject. Atherosclerosis 7OP, 61 Genest, J., Jr., Martin, S., McNamara, J.R., Ordovas, J.M., Jenner, J.L., Meyers, R., Wilson, P.W.F., Salem, D.N., and Schaefer, E.J. (1992). Familial lipoprotein disorders in patients with premature coronary artery disease. Circulation 85, 2025-2033. Gerdes, C , Fisher, R.M. , Nicaud, V. , Boer, J., Humphries, S.E., Talmud, P.J., and Faergeman, O. (1997). Lipoprotein lipase variants D9N and N291S are associated with increased plasma triglyceride and lower high-density lipoprotein cholesterol concentrations: studies in the fasting and postprandial states: the European Atherosclerosis Research Studies. Circulation 96, 733-740. Ginzinger, D.G., Lewis, M.E.S., Ma, Y. , Jones, B.R., Liu, G., Jones, S.D., and Hayden, M.R. (1996). A mutation in the lipoprotein lipase gene is the molecular basis of chylomicronemia in a colony of domestic cats. J.Clin.Invest. 97(5), 1257-1266. Glaser, D.S., Yost, T.J., and Eckel, R.H. (1992). Preheparin lipoprotein lipolytic activities: relationship to plasma lipoproteins and postheparin lipolytic activities. J Lipid Res. 33, 209-214. Goldstein, J.L., Schrott, H.G., Hazzard, W.R., Bierman, E.L., and Motulsky, A.G. (1973). Hyperlipidemia in coronary heart disease. II. Genetic analysis of lipid levels in 176 families and delineation of a new inherited disorder, combined hyperlipidemia. J Clin.Invest. 52, 1544-1568. Gotoda, T., Murase, T., Ishibashi, S., Shimario, H., Harada, K., and Yamada, N . (1990). Splicing,nonsense and missense mutations in familial lipoprotein lipase deficiency. Arteriosclerosis 10, 833(Abstract) Gotoda, T., Yamada, N . , Kawamura, M . , Kozaki, K. , Mori, N . , Ishibashi, S., Takaku, F., Yazaki, Y. , Furuichi, Y. , and et al. (1991). Heterogeneous mutations in the human 181 lipoprotein lipase gene in patients with familial lipoprotein lipase deficiency. J.Clin.Invest. 88, 1856-1864. Gotoda, T., Yamada, N . , Murase, T., Shimano, H., Shimada, M . , Harada, K., Kozaki, K. , and Yazaki, Y. (1992). Detection of three separate DNA polymorphisms in the human lipoprotein lipase gene by gene amplification and restriction endonuclease digestion. J.Lipid Res. 33, 1067-1072. Groenemeijer, B.E., Hallman, M.D., Reymer, P.W., Gagne, E., Kuivenhoven, J.A., Bruin, T., Jansen, FL, Lie, K.L, Bruschke, A.V. , Boerwinkle, E., Hayden, M.R., and Kastelein, J.J. (1997). Genetic variant showing a positive interaction with beta-blocking agents with a beneficial influence on lipoprotein lipase activity, HDL cholesterol, and triglyceride levels in coronary artery disease patients. The Ser447-stop substitution in the lipoprotein lipase gene. REGRESS Study Group. Circulation 95, 2628-2635. Grundy, S.M., Chait, A. , and Brunzell, J.D. (1987). Familial combined hyperlipidemia workshop. Arteriosclerosis 7, 203-207. Hahn, P.F. (1943). Abolishment of alimentary lipemia following injection of heparin. Sciences, 19-20. Hall, S., Chu, G., Miller, G., Cruickshank, K., Cooper, J.A., Humphries, S.E., and Talmud, P.J. (1997). A common mutation in the lipoprotein lipase gene promoter, -93T/G, is associated with lower plasma triglyceride levels and increased promoter activity in vitro. Arterioscler.Thromb Biol. 17, 1969-1976. Harbitz, I., Kristensen, T., Kran, S., and Davies, W. (1992). Isolation and sequencing of porcine lipoprotein lipase cDNA and its use in multiallelic restriction fragment length polymorphism detection. Animal Genetics 23, 517-522. Hata, A. , Emi, M . , Luc, G., Basdevant, A., Gambert, P., Iverius, P.H., and LalouelJM. (1990). Compound heterozygote for lipoprotein lipase deficiency: Ser-—Thr244 and transition in 3' splice site of intron 2 ( A G — A A ) in the lipoprotein lipase gene. Am.J Hum.Genet 47, 721-726. Hata, A., Ridinger, D.N., Sutherland, S., Emi, M . , Shuhua, Z., Myers, R.L., Ren, K., Cheng, T., Inoue, I., and Wilson, D.E. (1993). Binding of lipoprotein lipase to heparin. Identification of five critical residues in two distinct segments of the amino-terminal domain. J Biol.Chem. 268, 8447-8457. Hata, A., Ridinger, D.N., Sutherland, S.D., Emi, M . , Kwong, L.K. , Shuhua, J., Guy-Grand, B., Basdevant, A., Iverius, P.H., (1992). Missense mutations in exon 5 of the human 182 lipoprotein lipase gene. Inactivation correlates with loss of dimerization. J Biol.Chem. 267, 20132-20139. Hata, A., Robertson, M . , Emi, M . , and Lalouel, J .M. (1990). Direct detection and automated sequencing of individual alleles after electrophoretic strand separation: identification of a common nonsense mutation in exon 9 of the human lipoprotein lipase gene. Nucl.Acids Res. 75,5407-5411. Haubenwallner, S., Hori, G., Shachter, N.S., Presta, E., Fried, S.K., Hofler, G., Breslow, J.L., and Zechner, R. (1993). A novel missense mutation in the gene for lipoprotein lipase resulting in a highly conservative amino acid substitution (Aspl80~>Glu) causes familial chylomicronemia (type I hyperlipoproteinemia). Genomics 18, 392-396. Havel, R.J. and Gordon, R.S. (1960). Idiopathic hyperlipidemia: metabolic studies in an affected family. J.Clin.Invest. 39, 1777-1790. Havel, R.J. and Kane, J.P. (1995). Structure and metabolism of plasma lipoproteins. In The Metabolic and Molecular Bases of Inherited Disease Vol. II. C R . Scriver, A.L . Beaudet, W.S. Sly, and D. Valle, eds. (New York: McGraw Hill , Inc. Havel, R.J., Kane, J.P., and Kashyap, M.L. (1973). Interchange of apolipoproteins between chylomicrons and high density lipoproteins during alimentary lipemia in man. J.Clin.Invest. 52, 32-38. Havel, R.J., Kotite, L., and Kane, J.P. (1979). Isoelectric heterogeneity of the cofactor protein for lipoprotein lipase in human blood plasma. Biochemical Medicine 27, 121-138. Hayden, M.R. (1992a). Molecular genetics of human lipoprotein lipase deficiency. In Genetics of Coronary Heart Disease. i.h.o.Dr.K.B. Festchrift, ed. (University of Oslo, Norway: The Institute for Medical Genetics), pp. 115-122. Hayden, M.R. and Ma, Y . (1992b). Molecular genetics of human lipoprotein lipase deficiency. Mol.Cell Biochem. 113, 171-176. Heart and Stroke Foundation of Canada. Heart disease and stroke in Canada. 1-63. 95. Canada, Heart and Stroke Foundation of Canada. Heinzmann, C , Ladias, J., Antonarakis, S., Kirchgessner, T., Schotz, M . , and LusisAJ. (1987). RFLP for the human lipoprotein lipase (LPL) gene: Hindlll. Nucl.Acids Res. 75, 6763-6763. 183 Heizmann, C , Kirchgessner, T., Kwiterovich, P.O., Ladias, J.A., Derby, C , and Lusis, A.J. (1991). DNA polymorphism haplotypes of the human lipoprotein lipase gene: possible association with high density lipoprotein levels. Hum.Genet 86, 578-584. Heller, D.A., de, F.U., Pedersen, N.L., Dahlen, G., McClearn, and GE (1993). Genetic and environmental influences on serum lipid levels in twins. N.Engl.J.Med. 328, 1150-1156. Henderson, H.E., Devlin, R., Peterson, J., Brunzell, J.D., and Hayden, M.R. (1990). Frameshift mutation in exon 3 of the lipoprotein lipase gene causes a premature stop codon and lipoprotein lipase deficiency. Molecular Biology & Medicine 7, 511 -517. Henderson, H.E., Hassan, F., Berger, G.M., and Hayden, M.R. (1992). The lipoprotein lipase Giy 188—Glu mutation in South Africans of Indian descent: evidence suggesting common origins and an increased frequency. J Med Genet 29, 119-122. Henderson, H.E., Hassan, F., Marais, D., and Hayden, M.R. (1996). A new mutation destroying disulphide bridging in the C-terminal domain of lipoprotein lipase. Biochem.Biophys.Res.Commun. 227, 189-194. Henderson, H.E., Ma, Y. , Hassan, M.F., Monsalve, M.V. , Marais, A.D., Winkler, F., Peterson, J., Brunzell, J.D., and Hayden, M.R. (1991). Amino acid substitution (Ile 194— Thr) in exon 5 of the lipoprotein lipase gene causes lipoprotein lipase deficiency in three unrelated probands. Support for a multicentric origin. J.Clin.Invest. 87, 2005-2011. Henderson, H.E., Ma, Y. , Liu, M.S., Clark-Lewis, I., Maeder, D.L., Kastelein, J.J., and Hayden, M.R. (1993). Structure-function relationships of lipoprotein lipase: mutation analysis and mutagenesis of the loop region. J.Lipid Res. 34, 1593-1602. Hoffer, M.J.V., Bredie, S.J.H., Boomsma, D.L, Reymer, P.W.A., Kastelein, J.J.P., Deknijff, P., Demacker, P.N.M., Stalenhoef, A.F.H., Havekes, L . M . , and Frants, R.R. (1996). The lipoprotein lipase (Asn291-]Ser mutation is associated with elevated lipid levels in families with familial combined hyperlipidemia. Atherosclerosis 119,159-167. Hokanson, J.E. (1997). Lipoprotein lipase gene variants and risk of coronary disease: a quantitative analysis of population-based studies. Int.J Clin.Lab.Res. 27, 24-34. Holt, L.E., Aylward, F.X., and Timbres, H.G. (1939). Idiopathic familial lipemia. Bull.John Hopkins Hosp. 64, 279 Holzl, B., Huber, R., Paulweber, B., Patsch, J.R., and Sandhofer, F. (1994). Lipoprotein lipase deficiency due to a 3' splice site mutation in intron 6 of the lipoprotein lipase gene. J.Lipid Res. 55,2161-2169. 184 Hopkins, P.N. and Williams, R.R. (1989). Human genetics and coronary heart disease: a public health perspective. Annu.Rev.Nutr 9, 303-345. Hosmer, D.W. and Lemeshow, S. (1989). Applied logistic regression (New York: John Wiley and Sons). Hua, X . X . , Enerback, S., Hudson, J., Youkhana, K., and Gimble, J.M. (1991). Cloning and characterization of the promoter of the murine lipoprotein lipase-encoding gene: structural and functional analysis. Gene 107, 247-258. Huttunen, J.K., Ehnholm, C , Kekki, M . , and Nikkila, E.A. (1976). Post-heparin plasma lipoprotein lipase and hepatic lipase in normal subjects and in patients with hypertriglyceridaemia: correlations to sex, age and various parameters of triglyceride metabolism. Clinical Science & Molecular Medicine 50, 249-260. Ip, J.H., Fuster, V., Badimon, L., Badimon, J., Taubman, M.B., and Chesebro, J.H. (1990). Syndromes of accelerated atherosclerosis: role of vascular injury and smooth muscle cell proliferation. J Am.Coll.Cardiol 15, 1667-1687. Iselius, L. (1981). Complex segregation analysis of hypertriglyceridemia. Human Heredity 31, 222-226. Ishimura-Oka, K., Faustinella, F., Kihara, S., Smith, L.C., Oka, K., and Chan, L. (1992). A missense mutation (Trp86—Arg) in exon 3 of the lipoprotein lipase gene: a cause of familial chylomicronemia. Am.J Hum.Genet 50, 1275-1280. Jackson, R.L. (1983). Lipoprotein lipase and hepatic lipase. In The enzymes,volume XVI . P. Boyer, ed. (Newe York: Academic Press), pp. 141-148. Jackson, R.L., Yates, M.T., McNerney, C.A., and Kashyap, M.L. (1990). Relationship between post-heparin plasma lipases, triglycerides and high density lipoproteins in normal subjects. Horm.Metab Res. 22, 289-294. Jemaa, R., Fumeron, F., Poirier, O., Lecerf, L., Evans, A. , Arveiler, D., Luc, G., Cambou, J.P., Bard, J.M., Fruchart, J .C, Apfelbaum, M . , Cambien, F., and Tiret, L. (1995). Lipoprotein lipase gene polymorphisms: Associations with myocardial infarction and lipoprotein levels, the ECTIM study. J.Lipid Res. 36, 2141-2146. Ji, Z.S., Sanan, D.A., and Mahley, R.W. (1995). Intravenous heparinase inhibits remnant lipoprotein clearance from the plasma and uptake by the liver: in vivo role of heparan sulfate proteoglycans. J.Lipid Res. 36, 583-592. 185 Johnson, C.L., Rifkind, B .M. , Sempos, C.T., Carroll, M.D., Bachorik, P.S., Briefel, RR, Gordon, D.J., Burt, V.L. , Brown, C D . , and Lippel, K. (1993). Declining serum total cholesterol levels among US adults. The National Health and Nutrition Examination Surveys. J A M A 269, 3002-3008. Jukema, J.W., Bruschke, A.V. , van Boven, A.J., Reiber, J.H., Bai, E.T., ZwindermanAH., Jansen, H., Boerma, G.J., van Rappard, F.M. , Lie, K.I., and on behalf of the REGRESS Study Group (1995). Effects of lipid lowering by pravastatin on progression and regression of coronary artery disease in symptomatic men with normal to moderately elevated serum cholesterol levels. The Regression Growth Evaluation Statin Study (REGRESS). Circulation 91, 2528-2540. Jukema, J.W., Vanboven, A.J., Groenemeijer, B., Zwinderman, A.H. , Reiber, J.H.C, Bruschke, A.V.G. , Henneman, J.A., Molhoek, G.P., Bruin, T., Jansen, H., Gagne, E., Hayden, M.R., and Kastelein, J.J.P. (1996). The Asp(9)Asn mutation in the lipoprotein lipase gene is associated with increased progression of coronary atherosclerosis. Circulation 94, 1913-1918. Kannel, W.B., Castelli, W.P., and Gordon, T. (1979). Cholesterol in the prediction of atherosclerotic disease. New perspectives based on the Framingham study. Ann.Intem.Med. 90, 85-91. Kannel, W.B., Neaton, J.D., Wentworth, D., Thomas, H.E., Stamler, J., and Hulley, S.B. (1986). Overall and coronary heart disease mortality rates in relation to major risk factors in 325,348 men screened for the MRFIT. Multiple Risk Factor Intervention Trial. Am.Heart J. 112, 825-836. Kastelein, J.J.P., Gagne, S.E., Ordovas, J.M., Pimstone, S.N., Wilson, P.W.F., Wittekoek, M.E., Boer, J.M., Gerdes, C , Schaefer, E.J., Larson, M.G., and Hayden, M.R. (1998). Two common mutations (D9N, N291S) in lipoprotein lipase: a cumulative analysis of their influence on plasma lipids and liporptoeins in men and women, (submitted) Kinston, R.E., Chen, C.A., and Okayama, H. (1991). Current Protocol in Molecular Biology (New York: Green/Wiley-InterScience). Kirchgessner, T.G., Chuat, J .C, Heinzmann, C , Etienne, J., Guilhot, S., Svenson, Ameis, D., Pilon, C , d'Auriol, L., and Andalibi, A . (1989). Organization of the human lipoprotein lipase gene and evolution of the lipase gene family. Proc.Natl.Acad.Sci. 86, 9647-9651. Kirchgessner, T.G., Svenson, K.L. , Lusis, A.J., and Schotz, M.C. (1987). The sequence of cDNA encoding lipoprotein lipase. A member of a lipase gene family. J Biol.Chem. 262, 8463-8466. 186 Kleinbaum, D.G., Kupper, L.L. , and Muller, K.E . (1988). Applied regression analysis and other multivariable methods (Boston,MA: PWS-Kent Publishing Company). Kobayashi, J., Inadera, H., Fujita, Y. , Talley, G., Morisaki, N . , Yoshida, S., Fojo, S.S., and Brewer, H.B., Jr. (1994). A naturally occurring mutation at the second base of codon asparagine 43 in the proposed N-linked glycosylation site of human lipoprotein lipase: in vivo evidence that asparagine 43 is essential for catalysis and secretion. Biochem.Biophys.Res.Commun. 205, 506-515. Kobayashi, J., Nishida, T., Ameis, D., Stahnke, G., Schotz, M . C , Hashimoto, H., Shirai, K., Saito, Y. , and Yoshida, S. (1992). A heterozygous mutation (the codon for Ser447—-a stop codon) in lipoprotein lipase contributes to a defect in lipid interface recognition in a case with type I hyperlipidemia. Biochem.Biophys.Res.Commun. 182,10-11. Kobayashi, J., Sasaki, N . , Tashiro, J., Inadera, H., Saito, Y. , and Yoshida, S. (1993). A missense mutation (Ala334—>Thr) in exon 7 of the lipoprotein lipase gene in a case with type I hyperlipidemia. Biochem.Biophys.Res.Commun. 191, 1046-1054. Korn, E.D. (1952a). Clearing factor, a heparin-activated lipoprotein lipase II: Substrate specificity and activiation of coconut oil. J Biol.Chem. 215, 15-26. Korn, E.D. (1952b). Clearing factor, a heparin-activated lipoprotein lipase I: Isolation and characterization of the enzyme from normal rat heart. J Biol.Chem. 215, 1-14. Kozaki, K., Gotoda, T., Kawamura, M . , Shimano, H., Yazaki, Y. , Ouchi, Y. , OrimoH., and Yamada, N . (1993). Mutational analysis of human lipoprotein lipase by carboxy-terminal truncation. J.Lipid Res. 34,1765-1772. Krapp, A. , Zhang, H., Ginzinger, D., Liu, M.-S., Lindberg, A., Olivecrona, G., Hayden, M.R., and Beisiegel, U . (1995). Structural features in lipoprotein lipase necessary for the mediation of lipoprotein uptake into cells. J.Lipid Res. 36, 2362-2373. Kubo, M . and Hostetler, K . Y . (1987). Inhibition of purified bovine milk lipoprotein lipase by propranolol and other beta-adrenergic blockers in vitro. Biochim.Biophys.Acta 918, 168-174. Kuivenhoven, J.A., Groenemeyer, B.E., Boer, J.M., Reymer, P.W., Berghuis, R., Bruin, T, Jansen, H., Seidell, J .C, and Kastelein, J.J. (1997). Ser447stop mutation in lipoprotein lipase is associated with elevated HDL cholesterol levels in normolipidemic males. Arterioscler.Thromb.Vase.Biol. 17, 595-599. 187 Kwiterovich, P.O.J., Coresh, J., and Bachorik, P.S. (1993). Prevalence of hyperapobetalipoproteinemia and other lipoprotein phenotypes in men (aged < or = 50 years) and women (< or = 60 years) with coronary artery disease. Am.J.Cardiol. 77, 631-639. Langlois, S., Deeb, S., Brunzell, J.D., Kastelein, J.J., and Hayden, M.R. (1989). A major insertion accounts for a significant proportion of mutations underlying human lipoprotein lipase deficiency. Proc.Natl.Acad.Sci. 86, 948-952. Lawson, D.M. , Brzozowski, A . M . , and Dodson, G.G. (1992). Protein structure: lifting the lid of lipases. Current Biology 2, 473-475. Lees, R.S., Wilson, D.E., Schonfeld, G., and Fleet, S. (1973). The familial dyslipoproteinemias. In Progress in medical genetics. A .G. Steinberg and A.G. Beam, eds. (New York: Grune and Stratton), pp. 237-290. Lerman, L.S. and Silverstein, K. (1987). Computational simulation of DNA melting and its application to denaturing gradient gel electrophoresis. Methods Enzymol. 755, 482-501. Lipids Research Clinics Program. (1974). Manual of Laboratory Operations. Bethesda, Md: National Institute of Health;NIH publication 75-686. Liu, M.-S., Ma, Y. , Hayden, M.R., and Brunzell, J.D. (1992). Mapping of the epitope on lipoprotein lipase recognized by a monoclonal antibody (5D2) which inhibits lipase activity (rapid report). Biochimica et Biophysica Acta. 7725, 113-115. Loshe, P., Beg, O.U., Brunzell, J.D., Santamarina-Fojo, S., and Brewer, H.B. (1991). Familial chylomicronemia: identification of a unique patient homozygous for two separate mutations in the LPL gene. Circulation 84, 1497. Abstract Lowe, M.E. (1994). Pancreatic triglyceride lipase and colipase: insights into dietary fat digestion. Gastroenterology 707, 1524-1536. Lundman, P., Eriksson, M . , Schenck-Gustafsson, K., Karpe, F., and Tornvall, P. (1997). Transient triglyceridemia decreases vascular reactivity in young, healthy men without risk factors for coronary heart disease. Circulation 96, 3266-3268. Ma, Y. , Henderson, H.E., Liu, M.S., Zhang, H., Forsythe, I.J., Clarke-Lewis, I., Brunzell, J.D., and Hayden, M.R. (1994). Mutagenesis in four candidate heparin binding regions (residues 279-282, 291-304, 390-393, and 439-448) and identification of residues affecting heparin binding of human lipoprotein lipase. J.Lipid Res. 35, 2049-2059. 188 Ma, Y. , Henderson, H.E., Murthy, V., Roederer, G., Monsalve, M.V. , Clarke, L.A. , Mien , P., Gagne, C , Lambert, M . , and Hayden, M.R. (1991). A mutation in the human lipoprotein lipase gene as the most common cause of familial chylomicronemia in French Canadians. N.Engl.J.Med. 324, 1761-1766. Ma, Y. , Liu, M.S., Chitayat, D., Bruin, T., Beisiegel, U. , Benlian, P., FoubertL., de Gennes, J.L., Funke, H., Forsythe, I., and Hayden, M.R.. (1994). Recurrent missense mutations at the first and second base of codon Arg243 in human lipoprotein lipase in patients of different ancestries. Hum.Mutat. 3, 52-58. Ma, Y. , Liu, M.S., Ginzinger, D., Frohlich, J., Brunzell, J.D., and Hayden, M.R. (1993). Gene-environment interaction in the conversion of a mild-to-severe phenotype in a patient homozygous for a Serl72~>Cys mutation in the lipoprotein lipase gene. J.Clin.Invest. 91, 1953-1958. Ma, Y. , Ooi, T.C., Liu, M.S., Zhang, H. , McPherson, R., Edwards, A.L. , Forsythe, I.J., Brunzell, J.D., and Hayden, M.R. (1994a). High frequency of mutations in the human lipoprotein lipase gene in pregnancy-induced chylomicronemia: possible association with apolipoprotein E2 isoform. J.Lipid Res. 35, 1066-1075. Ma, Y. , Ooi, T.C., Liu, M.S., Zhang, H., McPherson, R., Edwards, A.L. , Forsythe, I.J., Frolich, J., Brunzell, J.D., and Hayden, M.R. (1994b). Pathogenesis of hypertriglyceridemia: the interrelationship between partial lipoprotein lipase deficiency, apolipoprotein E, isoforms and pregnancy. J.Lipid Res. 35, 1066-1075. Ma, Y. , Wilson, B.L, Bijvoet, S., Henderson, H.E., Cramb, E., Roederer, G., VenMurthy, M.R., Julien, P., Bakker, H.D., Kastelein, J.J., and Hayden, M.R. (1992). A missense mutation (Asp250—Asn) in exon 6 of the human lipoprotein lipase gene causes chylomicronemia in patients of different ancestries. Genomics 13, 649-653. Ma, Y .H . , Bruin, T., Tuzgol, S., Wilson, B.L, Roederer, G., Liu, M.S., Davignon, J., Brunzell, J.D., and Hayden, M.R. (1992). Two naturally occurring mutations at the first and second bases of codon aspartic acid 156 in the proposed catalytic triad of human lipoprotein lipase. In vivo evidence that aspartic acid 156 is essential for catalysis. J Biol.Chem. 267 , 1918-1923. Mailly, F., Fisher, R.M. , Nicaud, V. , Luong, L.A. , Evans, A.E. , Marquesvidal, P., Luc, G., Arveiler, D., Bard, J.M., Poirier, O., Talmud, P.J., and Humphries, S.E. (1996). Association between the LPL-D9N mutation in the lipoprotein lipase gene and plasma lipid traits in myocardial infarction survivors from the ECTIM study. Atherosclerosis 122, 21-28. 189 Mailly, F., Palmen, J., Muller, D.P., Gibbs, T., Lloyd, J., Brunzell, J., Durrington, P., Mitropoulos, K., Betteridge, J., Watts, G., Lithell, H., Angelico, F., Humphries, S.E., and Talmud, P.J. (1997). Familial lipoprotein lipase (LPL) deficiency: a catalogue of LPL gene mutations identified in 20 patients from the U K , Sweden, and Italy. Hum.Mutat. 10, 465-473. Mailly, F., Tugrul, Y. , Reymer, P.W., Bruin, T., Seed, M . , Groenemeyer, B.F., Vallance, D., Winder, A.F., Miller, G.J., Miller, G.J, Kastelein, J.J.P., Hamsten, A. Olivecrona, G., Humphries, S., Talmud, P.J. (1995). A common variant in the gene for lipoprotein lipase (Asp9~>Asn). Functional implications and prevalence in normal and hyperlipidemic subjects. Arterioscler.Thromb.Vasc.Biol. 15, 468-478. Marenberg, M.E., Risch, N . , Berkman, L.F., Floderus, B., and de Faire, U. (1994). Genetic susceptibility to death from coronary heart disease in a study of twins. N.Engl.J.Med. 330, 1041-1046. Marmot, M . (1992). Coronary heart disease: rise and fall of modern epidemic. In Coronary heart disease epidemiology: From aetiology to public health. M . Marmot and P. Elliott, eds. (Oxford, UK: Oxford University Press), pp. 1-19. Martin, M.J., Hulley, S.B., Browner, W.S., Kuller, L.H. , and Wentworth (1986). Serum cholesterol, blood pressure, and mortality: implications from a cohort of 361,662 men. Lancet 2, 933-936. Mattu, R.K., Needham, E.W., Morgan, R., Rees, A., Hackshaw, A.K. , Stocks, J., and Galton, D.J. (1994). DNA variants at the LPL gene locus associate with angiographically defined severity of atherosclerosis and serum lipoprotein levels in a Welsh population. Arterioscler.Thromb 14, 1090-1097. McNamara, J.R. and Schaefer, E.J. (1987). Automated enzymatic standardized lipid analyses for plasma and lipoprotein fractions. Clin.Chim.Acta 166, 1-8. Medh, J.D., Bowen, S.L., Fry, G.L., Ruben, S., Andracki, M . , Inoue, I., Lalouel, J.M., Strickland, D.K., and Chappell, D.A. (1996). Lipoprotein lipase binds to low density lipoprotein receptors and induces receptor-mediated catabolism of very low density lipoproteins in vitro. J Biol.Chem. 271, 17073-17080. Miesenbock, G., Holzl, B., Foger, B., Brandstatter, E., Paulweber, B., and Patsch, J.R. (1993). Heterozygous lipoprotein lipase deficiency due to a missense mutation as the cause of impaired triglyceride tolerance with multiple lipoprotein abnormalities. J.Clin.Invest. 91, 448-455. 190 Minnich, A., Kessling, A. , Roy, M . , Giry, C , DeLangavant, G., Lavigne, J., and Davignon, J. (1995). Prevalence of alleles encoding defective lipoprotein lipase in hypertriglyceridemic patients of French Canadian descent. J.Lipid Res. 36, 117-124. Monsalve, M.V. , Henderson, H., Roederer, G., Julien, P., Deeb, S., Kastelein, J.J., Devlin, R., Bruin, T., Murthy, M.R., Hayden, M.R.. (1990). A missense mutation at codon 188 of the human lipoprotein lipase gene is a frequent cause of lipoprotein lipase deficiency in persons of different ancestries. J.Clin.Invest. 86, 728-734. Myers, R.M. , Fischer, S.G., Lerman, L.S., and Maniatis, T. (1985). Nearly all single base substitutions in DNA fragments joined to a GC-clamp can be detected by denaturing gradient gel electrophoresis. Nucl.Acids Res. 13, 3131-3145. Nakamura, T., Suehiro, T., Yasuoka, N . , Yamamoto, M . , Ito, H., Yamano, T., and Hashimoto, K. (1996). A novel nonsense mutation in exon 1 and a transition in intron 3 of the lipoprotein lipase gene. J Atheroscler.Thromb 3, 17-24. Nakamura, T., Yasuoka, N . , Suehiro, T., Nakauchi, Y. , Yamamoto, M . , Kumon, Y. , and Hashimoto, K. (1994). Association of lipoprotein lipase gene polymorphism in intron 3 with hypertriglyceridemia. Atherosclerosis 109, 62(Abstract) Nevin, D.N., Brunzell, J.D., and Deeb, S.S. (1994). The LPL gene in individuals with familial combined hyperlipidemia and decreased LPL activity. Arterioscler.Thromb 14, 869-873. NIH Consensus Development Panel on Triglyceride, H.-D.L.a.C.H.D. (1993). Triglyceride, high-density lipoprotein and coronary heart disease. J A M A 269, 5050-510. Nikkila, E.A. (1983). Familial lipoprotein lipase deficiency and related disorders of chylomicron metabolism. In The metabolic basis of inherited disease. J.B. Standbury, J.B. Wyngaarden, and D.S. Fredrickson, eds. (New York: McGraw Hill), pp. 622-642. Nilsson-Ehle, P., Egelrud, T., Belfrage, P., Olivecrona, T., and Borgstrom, B. (1973). Positional specificity of purified milk lipoprotein lipase. J Biol.Chem. 248, 6734-6737. Nordestgaard, B.G., Abildgaard, S., Wittrup, H.H., Steffensen, R., Jensen, G., and Tybjaerg-Hansen, A. (1997). Heterozygous lipoprotein lipase deficiency: frequency in the general population, effect on plasma lipid levels, and risk of ischemic heart disease. Circulation 96, 1737-1744. Nykjaer, A. , Bengtsson-Olivecrona, G., Lookene, A. , Moestrup, S.K., PetersenCM., Weber, W., Beisiegel, U. , and Gliemann, J. (1993). The alpha 2-macroglobulin receptor/low density 191 lipoprotein receptor-related protein binds lipoprotein lipase and beta-migrating very low density lipoprotein associated with the lipase. J Biol.Chem. 268, 15048-15055. O'Brien, K.D., Gordon, D., Deeb, S., Ferguson, M . , and Chait, A. (1992). Lipoprotein lipase is synthesized by macrophage-derived foam cells in human coronary atherosclerotic plaques. J.Clin.Invest. 89, 1544-1550. Olivecrona, G. and Olivecrona, T. (1995). Triglyceride lipases and atherosclerosis. Curr.Opin.Lipidol. 6, 291-305. Osborne, J .C, Jr., Bengtsson-Olivecrona, G., Lee, N.S., and Olivecrona, T. (1985). Studies on inactivation of lipoprotein lipase: role of the dimer to monomer dissociation. Biochemistry 24, 5606-5611. Papadopoulos, N . M . and Bedynek, J.L. (1973). Serum lipoprotein patterns in patients with coronary atherosclerosis. Clin.Chim.Acta 44, 153-157. Paulweber, B., Wiebusch, H., Miesenboeck, G., Funke, FL, Assmann, G., Hoelzl, B., Friedl, W., Patsch, J.R., and Sandhofer, F. (1991). Molecular basis of lipoprotein lipase deficiency in two Austrian families with type I hyperlipoproteinemia. Atherosclerosis 86, 239-250. Peterson, J., Fujimoto, W.Y., and Brunzell, J.D. (1992a). Human lipoprotein lipase: relationship of activity, heparin affinity, and conformation as studied with monoclonal antibodies. J.Lipid Res. 33, 1165-1170. Peterson, J., Fujimoto, Y. , and Brunzell, J.D. (1992b). Relationship of activity , heparin affinity and conformation as studied with monoclonal antibodies. J.Lipid Res. 33, 1165-1170. Phillips, N.R., Waters, D., and Havel, R.J. (1993). Plasma lipoproteins and progression of coronary artery disease evaluated by angiography and clinical events. Circulation 88, 2762-2770. Pimstone, S.N., Clee, S.M., Gagne, S.E., Miao, L., Zhang, H., Stein, E.A., Hayden, and M R (1996). A frequently occurring mutation in the lipoprotein lipase gene (Asn291Ser) results in altered postprandial chylomicron triglyceride and retinyl palmitate response in normolipidemic carriers. J.Lipid Res. 37, 1675-1684. Pimstone, S.N., Gagne, S.E., Gagne, C , Lupien, P.J., Gaudet, D., Williams, R.R., Kotze, M . , Reymer, P.W.A., Defesche, J .C, Kastelein, J.J.P., Moorjani, S., and Hayden, M.R. (1995). Mutations in the gene for lipoprotein lipase - A cause for low HDL cholesterol 192 levels in individuals heterozygous for familial hypercholesterolemia. Arterioscler.Thromb.Vasc.Biol. 75, 1704-1712. Previato, L., Guardamagna, O., Dugi, K.A. , Ronan, R., Talley, G.D., and Brewer, H.B., Jr. (1994). A novel missense mutation in the C-terminal domain of lipoprotein lipase (Glu410~ >Val) leads to enzyme inactivation and familial chylomicronemia. J.Lipid Res. 55, 1552-1560. Rapp, J.H., Lespine, A., Hamilton, R.L., Colyvas, N . , Chaumeton, A.H. , Tweedie-Hardman, J., Kotite, L., Kunitake, ST., Havel, R.J., and Kane, J.P. (1994). Triglyceride-rich lipoproteins isolated by selected-affinity anti-apolipoprotein B immunosorption from human atherosclerotic plaque. Arterioscler.Thromb 14, 1767'-177'4. Reina, M . , Brunzell, J.D., and Deeb, S.S. (1992). Molecular basis of familial chylomicronemia: mutations in the lipoprotein lipase and apolipoprotein C-II genes. J.Lipid Res. 33,1823-1832. Renier, G. and Lambert, A . (1995). Lipoprotein lipase synergizes with interferon gamma to induce macrophage nitric oxide synthetase mRNA expression and nitric oxide production. Arterioscler.Thromb.Vasc.Biol. 75, 392-399. Reymer, P.W.A., Gagne, E., Groenemeyer, B.E., Zhang, H., Forsyth, I., Jansen, H., Kromhout, D., Lie, K.E. , Kastelein, J., and Hayden, M.R. (1995a). A lipoprotein lipase mutation (Asn291Ser) is associated with reduced HDL cholesterol levels in premature atherosclerosis. Nat.Genet 10, 28-34. Reymer, P.W.A., Groenemeyer, B.E., Gagne, E., Miao, L., Appelman, E.E.G., Seidel, J .C, Kromhout, D., Bijvoet, S.M., Van de Oever, K., Bruin, T., Hayden, M.R., and Kastelein, J.J.P. (1995b). A frequently occurring mutation in the lipoprotein lipase gene (Asn291Ser) contributes to the expression of familial combined hyperlipidemia. Hum.Mol.Genet. 4, 1543-1549. Robinson, D.S. and French, J.E. (1953). The role of albumin in the interaction of chyle and plasma in the rat. Q.J.Exp.Physiol. 38, 233-239. Roncaglioni, M . C , Santoro, L., D'Avanzo, B., Negri, E., Nobili, A., Ledda, A., Pietropaolo, F., Franzosi, M.G., La, V . C , and Feruglio, G.A. (1992). Role of family history in patients with myocardial infarction. An Italian case-control study. GISSI-EFRIM Investigators. Circulation 85, 2065-2072. Ross, R. (1993). The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature 5(52,801-809. 193 Ross, R. and Glomset, J.A. (1973). Atherosclerosis and the arterial smooth muscle cell: Proliferation of smooth muscle is a key event in the genesis of the lesions of atherosclerosis. Science 180, 1332-1339. Rouis, M . , Lohse, P., Dugi, K.A. , Beg, O.U., Ronan, R., Talley, G.D., Brunzell, J.D., and Santamarinafojo, S. (1996). Homozygosity for two point mutations in the lipoprotein lipase (LPL) gene in a patient with familial LPL deficiency-LPL(Asn9Asn, Tyr262His). J.Lipid Res. 37, 651-661. Rumsey, S.C., Obunike, J.C., Arad, Y. , Deckelbaum, R.J., and Goldberg, l.J. (1992). Lipoprotein lipase-mediated uptake and degradation of low density lipoproteins by fibroblasts and macrophages. J.Clin.Invest. 90, 1504-1512. Sambrook, J., Fritsch, E.F., and Maniatis, T. (1989). Molecular Cloning; A Laboratory Manual (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press). Santamarina-Fojo, S. and Dugi, K . A . (1994). Structure, function and role of lipoprotein lipase in lipoprotein metabolism. Curr.Opin.Lipidol. 5, 117-125. SAS Institute Inc (1989). SAS/STAT User's Guide, Version 6 (Cary, NC: SAS Institute Inc.). SAS Institute Inc (1996). SAS/STAT Software: Changes and Enhancements through Release 6.11 (Cary, NC: SAS Institute, Inc.). Saxena, U. , Klein, M.G., and Goldberg, I.J. (1991). Identification and characterization of the endothelial cell surface lipoprotein lipase receptor. J Biol.Chem. 266,17516-17521. Scanu, A . (1966). Serum high-density lipoprotein: effect of change in structure on activity of chicken adipose tissue lipase. Science 153, 640-641. Schaefer, E.J. (1990). High-density lipoproteins and coronary heart disease (New York: Gower Medical Publishing). Schaefer, E.J., Heaton, W.H., Wetzel, M.G. , and Brewer, H.B.J. (1982). Plasma apolipoprotein A - l absence associated with a marked reduction of high density lipoproteins and premature coronary artery disease. Arteriosclerosis 2, 16-26. Schaefer, E.J., Jenkins, L.L., and Brewer, H.B.J. (1978). Human chylomicron apolipoprotein metabolism. Biochem.Biophys.Res.Commun. 80,405-412. 194 Scow, R.O. and Egelrud, T. (1976). Hydrolysis of chylomicron phosphatidylcholine in vitro by lipoprotein lipase, phospholipase A2 and phospholipase C. Biochim.Biophys.Acta 431, 538-549. Shinomiya, M . and Jackson, R.L. (1984). Lipoprotein lipase-catalyzed hydrolysis of dimyristoylphosphatidylcholine. Effect of lipid organization and apolipoprotein C-II on enzyme activity. Biochim.Biophys.Acta 794, 177-182. Shore, B., Nichols, A.V. , and freeman, N.K. (1953). Evidence for lipolytic action by human plasma obtained after intravenous administration of heparin. Proc.Soc.Exp.Biol.Med 83, 216-220. Silberberg, J.S., Wlodarczyk, J., Fryer, J., Robertson, R., and Hensley, M.J. (1998). Risk associated with various definitions of family history of coronary heart disease. The Newcastle Family History Study II. Am.J Epidemiol. 147, 1133-1139. Sing, C F . and Moll, P.P. (1989). Genetics of variability of CHD risk. International Journal of Epidemiology 18, S183-S195 Sivaram, P., Choi, S.Y., Curtiss, L.K. , and Goldberg, I.J. (1994). An amino-terminal fragment of apolipoprotein B binds to lipoprotein lipase and may facilitate its binding to endothelial cells. J Biol.Chem. 269, 9409-9412. Skottova, N . , Savonen, R., Lookene, A. , Hultin, M . , and Olivecrona, G. (1995). Lipoprotein lipase enhances removal of chylomicrons and chylomicron remnants by the perfused rat liver. J.Lipid Res. 5t5, 1334-1344. Sparkes, R.S., Zollman, S., Klisak, I., Kirchgessner, T.G., Komaromy, M . C , Schotz, M . C , and Lusis, A.J. (1987). Human genes involved in lipolysis of plasma lipoproteins: mapping of loci for lipoprotein lipase to 8p22 and hepatic lipase to 15q21. Genomics /, 138-144. Sprecher, D.L., Kobayashi, J., Rymaszewski, M . , Goldberg, I.J., Harris, B.V., Ameis, D., Yunker, R.L., Black, D.M. , Stein, E.A. (1992). Trp64—nonsense mutation in the lipoprotein lipase gene. J.Lipid Res. 33, 859-866. St-Amand, J., Despres, J.P., Lemieux, S., Lamarche, B., Moorjani, S., Prud'hommeD., Bouchard, C , and Lupien, P.J. (1995). Does lipoprotein or hepatic lipase activity explain the protective lipoprotein profile of premenopausal women? Metabolism 44, Clinical &-Clinical &8 Stary, H.C. (1989). Evolution and progression of atherosclerotic lesions in coronary arteries of children and young adults. Arteriosclerosis 9,119-132 195 Stocks, J., Thorn, J.A., and Galton, D.J. (1992). Lipoprotein lipase genotypes for a common premature termination codon mutation detected by PCR-mediated site-directed mutagenesis and restriction digestion. J.Lipid Res. 33, 853-857. Stroes, E., de, B.T., de, V.H. , Erkelens, W., Banga, J.D., van, R.H., Koomans, H., and Rabelink, T. (1997). NO activity in familial combined hyperlipidemia: potential role of cholesterol remnants. Cardiovasc.Res. 36, 445-452. Tabas, I., L i , Y. , Brocia, R.W., Xu, S.W., Swenson, T.L., and Williams, K.J. (1993). Lipoprotein lipase and sphingomyelinase synergistically enhance the association of atherogenic lipoproteins with smooth muscle cells and extracellular matrix. A possible mechanism for low density lipoprotein and lipoprotein(a) retention and macrophage foam cell formation. J Biol.Chem. 268, 20419-20432. Takagi, A., Ikeda, Y. , Mori, A., Tsutsumi, Z., Oida, K., Nakai, T., and Yamamoto, A. (1994). A newly identified heterozygous lipoprotein lipase gene mutation (Cys239~ >stop/TGC972~>TGA; LPLobama) in a patient with primary type IV hyperlipoproteinemia. J.Lipid Res. 35, 2008-2018. Takahashi, S., Suzuki, J., Kohno, M . , Oida, K., Tamai, T., Miyabo, S., YamamotoT., and Nakai, T. (1995). Enhancement of the binding of triglyceride-rich lipoproteins to the very low density lipoprotein receptor by apolipoprotein E and lipoprotein lipase. J Biol.Chem. 270, 15747-15754. Tan, C.E., Foster, L., Caslake, M.J., Bedford, D., Watson, T.D., McConnell, M . , Packard, C.J., and Shepherd, J. (1995). Relations between plasma lipids and postheparin plasma lipases and V L D L and L D L subfraction patterns in normolipemic men and women. Arterioscler.Thromb Vasc.Biol. 75, 1839-1848. Taskinen, M.R. and Nikkila, E.A. (1981). High density lipoprotein subfractions in relation to lipoprotein lipase activity of tissues in man-evidence for reciprocal regulation of HDL2 and HDL3 levels by lipoprotein lipase. Clin.Chim.Acta 772, 325-332. Technical tips: (1989). an efficient salt-chloroform extraction of DNA from blood and tissues. Trends.Genet 5, 391-391. Tenkanen, H., Taskinen, M.R., Antikainen, M . , Ulmanen, I., Kontula, K., and EhnholmC. (1994). A novel amino acid substitution (Hisl83->Gln) in exon 5 of the lipoprotein lipase gene results in loss of catalytic activity: phenotypic expression of the mutant gene in a heterozygous state. J.Lipid Res. 35, 220-228. Tornvall, P., Olivecrona, G., Karpe, F., Hamsten, A., and Olivecrona, T. (1995). Lipoprotein lipase mass and activity in plasma and their increase after heparin are separate 196 parameters with different relations to plasma lipoproteins. Arterioscler.Thromb.Vasc.Biol. 75,1086-1093. Tsutsumi, K., Inoue, Y. , Shima, A., Iwasaki, K., Kawamura, M . , and Murase, T. (1993). The novel compound NO-1886 increases lipoprotein lipase activity with resulting elevation of high density lipoprotein cholesterol, and long-term administration inhibits atherogenesis in the coronary arteries of rats with experimental atherosclerosis. J.Clin.Invest. 92, 411-417. VanTilbeurgh H., Roussel, A., Lalouel, J.M., and Cambillau, C. (1994). Lipoprotein lipase. Molecular model based on the pancreatic lipase x-ray structure: consequences for heparin binding and catalysis. J Biol.Chem. 269, 4626-4633. VanTilbeurgh FL, Sarda, L., Verger, R., and Cambillau, C. (1992). Structure of the pancreatic lipase-procolipase complex. Nature 359, 159-162. Venkatesan, S., Cullen, P., Pacy, P., Halliday, D., and Scott, J. (1993). Stable isotopes show a direct relation between V L D L apoB overproduction and serum triglyceride levels and indicate a metabolically and biochemically coherent basis for familial combined hyperlipidemia. Arterioscler.Thromb 13, 1110-1118. Verschuren, W.M., van Leer, E .M. , Blokstra, A. , Seidell, J .C, Smith, H.A., Bueno de Mesquita, H.B., Obermann-de Boer, G.L., and Kromhout, D. (1993). Cardiovascular disease risk factors in the Netherlands. Neth.J.Cardiol 4, 205-210. Vilaro, S., Llobera, M . , Bengtsson-Olivecrona, G., and Olivecrona, T. (1988). Lipoprotein lipase uptake by the liver: localization, turnover, and metabolic role. Am..! Physiol. 254, G711-G722 Vilella, E., Joven, J., Fernandez, M . , Vilaro, S., Brunzell, J.D., and Olivecrona, T. (1993). Lipoprotein lipase in human plasma is mainly inactive and associated with cholesterol-rich lipoproteins. J.Lipid Res. 34, 1555-1564. Virchow, R. (1861). La pathologie cellulaire basee sur l'etude physiologique et pathologique des tissus. (Translation from German) (Paris: Bailliere). Vogel, F. and Motulsky, A.G. (1989). Human genetics: problems and approaches (Berlin, Germany: Springer-Verlag). Vogel, R.A., Corretti, M . C , and Plotnick, G.D. (1997). Effect of a single high-fat meal on endothelial function in healthy subjects. Am.J Cardiol 79, 350-354. 197 Von Rokitansky (1852). A manual of phatological anatomy (London: Sydenhaus Society). Wallinder, L., Peterson, J., Olivecrona, T., and Bengtsson-Olivecrona, G. (1984). Hepatic and extrahepatic uptake of intravenously injected lipoprotein lipase. Biochim.Biophys.Acta 795,513-524. Warnick, G.R., Benderson, J., and Albers, J J . (1982). Dextran sulfate-Mg2+ precipitation procedure for quantitation of high-density-lipoprotein cholesterol. Clin.Chem. 28, 1379-1388. Wicks, LP., Howell, M.L. , Hancock, T., Kohsaka, H. , Olee, T., and Carson, D.A. (1995). Bacterial lipopolysaccharide copurifies with plasmid DNA: implications for animal models and human gene therapy. Hum.Gene Ther. 6, 317-323. Wiebusch, H., Funke, H., Bruin, T., Bucher, H. , von, E.A., Kastelein, JJ, and Assmann, G. (1996). Compound heterozygosity for a known (D250N) and a novel (E410K) missense mutation in the C-terminal domain of lipoprotein lipase causes familial chylomicronemia. Hum.Mutat. 5,381-383. Wiebusch, H. , Funke, H., Kastelein, J.J.P., Bruin, T., Pometta, D., Armstrong V, and Assman, G. (1992). Mutation in the lipoprotein lipase gene are not restricted to patients with type I hyperlipidemia. Circulation 86,1-609(Abstract) Wiebusch, H., Funke, H., Santer, R., Richter, W., and Assmann, G. (1996). A novel missense (E163G) mutation in the catalytic subunit of lipoprotein lipase causes familial chylomicronemia. Hum.Mutat. 8, 392 Williams, K.J., Fless, G.M., Petrie, K.A. , Snyder, M.L. , Brocia, R.W., and Swenson, T.L. (1992). Mechanisms by which lipoprotein lipase alters cellular metabolism of lipoprotein(a), low density lipoprotein, and nascent lipoproteins. Roles for low density lipoprotein receptors and heparan sulfate proteoglycans. J Biol.Chem. 267, 13284-13292. Williams, K.J., Petrie, K.A. , Brocia, R.W., and Swenson, T.L. (1991). Lipoprotein lipase modulates net secretory output of apolipoprotein B in vitro. A possible pathophysiologic explanation for familial combined hyperlipidemia. J.Clin.Invest. 88, 1300-1306. Williams, K.J. and Tabas, I. (1995). The response-to-retention hypothesis of early atherogenesis. Arterioscler.Thromb.Vasc.Biol. 75, 551-561. Wilson, D.E., Emi, M . , Iverius, P.H., Hata, A. , Wu, L.L. , Hillas, E., and Williams, R.R. (1990). Phenotypic expression of heterozygous lipoprotein lipase deficiency in the extended pedigree of a proband homozygous for a missense mutation. J.Clin.Invest. 86, 735-750. 198 Wilson, D.E., Hata, A., Kwong, L.K. , Lingam, A., Shuhua, J., Ridinger, D.N., YeagerC, Kaltenborn, K . C , Iverius, P.H., and Lalouel, J.M. (1993). Mutations in exon 3 of the lipoprotein lipase gene segregating in a family with hypertriglyceridemia, pancreatitis, and non-insulin-dependent diabetes. J.Clin.Invest. 92, 203-211. Wilson, P.W., Garrison, R.J., Castelli, W.P., Feinleib, M . , McNamara, P.M., Kannel, and WB. (1980). Prevalence of coronary heart disease in the Framingham Offspring Study: role of lipoprotein cholesterols. Am. J.Cardiol. 46, 649-654. Wilson, P.W., Myers, R.H., Larson, M.G., Ordovas, J.M., Wolf, P.A., and Schaefer, E.J. (1994). Apolipoprotein E alleles, dyslipidemia, and coronary heart disease. The Framingham Offspring Study. J A M A 272 , 1666-1671. Wilson, P.W., Schaefer, E.J., Larson, M.G., and Ordovas, J.M. (1996). Apolipoprotein E alleles and risk of coronary disease. A meta- analysis. Arterioscler.Thromb.Vase.Biol. 16, 1250-1255. Winkler, F.K., D'Arcy, A., and Hunziker, W. (1990). Structure of human pancreatic lipase. Nature 343, 771-774. Wion, K.L. , Kirchgessner, T.G., Lusis, A.J., Schotz, M . C , and Lawn, R.M. (1987). Human lipoprotein lipase complementary D N A sequence. Science 235, 1638-1641. Wittekoek, M.E., Pimstone, S.N., Reymer, P.W., Feuth, L., Botma, G.J., Defesche, J .C, Prins, M . , Hayden, M.R., and Kastelein, J.J. (1998). A common mutation in the lipoprotein lipase gene (N291S) alters the lipoprotein phenotype and risk for cardiovascular disease in patients with familial hypercholesterolemia. Circulation 97, 729-735. Wittrup, H.H., Tybjaerg-Hansen, A. , Abildgaard, S., Steffensen, R., Schnohr, P., and Nordestgaard, B.G. (1997). A common substitution (Asn291Ser) in lipoprotein lipase is associated with increased risk of ischemic heart disease. J.Clin.Invest. 99, 1606-1613. Wong, H., Yang, D., Hil l , J.S., Davis, R . C , Nikazy, J., and Schotz, M.C. (1997). A molecular biology-based approach to resolve the subunit orientation of lipoprotein lipase. Proc.Natl.Acad.Sci. 94, 5594-5598. Yang, W.S., Nevin, D.N., Iwasaki, L., Peng, R., Brown, B.G., Brunzell, J.D., Deeb, and SS (1996). Regulatory mutations in the human lipoprotein lipase gene in patients with familial combined hyperlipidemia and coronary artery disease. J.Lipid Res. 37, 2627-2637. 199 Yang, W.S., Nevin, D.N., Peng, R., Brunzell, J.D., and Deeb, S.S. (1995). A mutation in the promoter of the lipoprotein lipase (LPL) gene in a patient with familial combined hyperlipidemia and low LPL activity. Proc.Natl.Acad.Sci. 92, 4462-4466. Yokoyama, I., Ohtake, T., Momomura, S., Yonekura, K., Kobayakawa, N . , Aoyagi, T., Sugiura, S., Sasaki, Y. , and Omata, M . (1998). Altered myocardial vasodilatation in patients with hypertriglyceridemia in anatomically normal coronary arteries. Arterioscler.Thromb Vasc.Biol. 18, 294-299. Zechner, R., Newman, T.C., Steiner, E., and Breslow, J.L. (1991). The structure of the mouse lipoprotein lipase gene: a B l repetitive element is inserted into the 3' untranslated region of the mRNA. Genomics 11, 62-76. Zhang, FL, Henderson, H. , Gagne, S.E., Clee, S.M., Miao, L., Liu, G., and Hayden, M.R. (1996). Common sequence variants of lipoprotein lipase: standardized studies of in vitro expression and catalytic function. Biochim.Biophys.Acta 1302, 159-166. Zhang, H. , Reymer, P.W.A., Liu, M.S., Forsythe, I.J., Groenemeyer, B.E., Frohlich, J., Brunzell, J.D., Kastelein, J.J.P., Hayden, M.R., and Ma, Y . (1995). Patients with ApoE3 deficiency (E2/2, E3/2, and E4/2) who manifest with hyperlipidemia have increased frequency of an Asn 291->Ser mutation in the human LPL gene. Arterioscler.Thromb.Vasc.Biol. 15, 1695-1703. Zhang, Q., Cavanna, B.R., Winkelman, B., Shine, B., Gross, W., Marz, W., and Galton, D.J. (1995). Atherosclerosis, coronary artery disease, lipoprotein lipase, gene, and polymorphisms. Clin.Genet 48, 293-298. Zilversmit, D.B. (1979). Atherogenesis: a postprandial phenomenon. Circulation 60, 473-485. Zuliani, G. and Hobbs, H.H. (1990). Tetranucleotide repeat polymorphism in the LPL gene. Nucl.Acids Res. 18,4958-4958. 200 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0089229/manifest

Comment

Related Items