Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Cleavage site specificity of the tomato ringspot nepovirus protease Carrier, Karma James 1999

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1999-388638.pdf [ 15.23MB ]
Metadata
JSON: 831-1.0089214.json
JSON-LD: 831-1.0089214-ld.json
RDF/XML (Pretty): 831-1.0089214-rdf.xml
RDF/JSON: 831-1.0089214-rdf.json
Turtle: 831-1.0089214-turtle.txt
N-Triples: 831-1.0089214-rdf-ntriples.txt
Original Record: 831-1.0089214-source.json
Full Text
831-1.0089214-fulltext.txt
Citation
831-1.0089214.ris

Full Text

C L E A V A G E SITE S P E C I F I C I T Y O F T H E T O M A T O RINGSPOT N E P O V I R U S P R O T E A S E By KARMA JAMES CARRIER B.Sc, University of British Columbia, 1994 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Department of Botany) We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA February, 1999 © Karma James Carrier, 1999 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department The University of British Columbia Vancouver, Canada DE-6 (2/88) 11 ABSTRACT Tomato ringspot nepovirus (TomRSV) encodes two polyproteins, which are processed by a 3C-like protease at specific cleavage sites. In this study two new cleavage sites have been identified: the cleavage site between the protease and putative RNA-dependent RNA polymerase (Pro-Pol), which is processed in cis and the cleavage site at the N-terminus of the movement protein (X-MP), which is cleaved in trans. A new trans-cleavage site was also localized in the N -terminal region of the polyprotein encoded by RNA-2 (P2) using partial cDNA clones and in vitro translations systems. These results suggest that at least two proteins are released from the region of P2 upstream of the movement proteia In contrast, only one protein is released from this region of P2 in characterized nepoviruses of subgroup A/B. Comparison of the sequence of the X-MP and Pro-Pol cleavage sites to that of other TomRSV cleavage sites allowed us to propose the following cleavage site consensus sequence for the TomRSV protease: (Cys,Val)-Gln/(Ser,Gly). This consensus is similar to cleavage sites recognized by proteases from picornaviruses, potyviruses and comoviruses but not to those from nepoviruses of subgroups A or B. Amino acid substitutions were introduced in the -6 to +1 positions of the Pro-Pol and X-MP cleavage sites. Substitution of conserved amino acids at the -2, -1 and +1 positions resulted in a significant reduction of proteolytic processing in vitro in both cleavage sites suggesting that these amino acids play a key role in the recognition of the cleavage sites by the protease. The effects of individual substitutions were stronger on the cleavage site processed in trans than on the one processed in cis. It has been predicted that the specificity of the TomRSV protease for cleavage sites similar to those of picornaviruses, potyviruses and comoviruses is due to the presence of a conserved His residue in the substrate-binding pocket. However, substituting this His residue in the TomRSV protease with a Leu found at a similar position in the proteases of iii nepovirus subgroups A and B did not allow recognition of cleavage sites in which amino acids typical of cleavage sites from those nepoviruses were introduced. iv TABLE OF CONTENTS ABSTRACT ii TABLE OF CONTENTS iv LIST OF TABLES ..vii LIST OF FIGURES viii LIST OF ABBREVIATIONS x ACKNOWLEDGMENTS xiv CHAPTER 1 LITERATURE REVIEW: VIRAL PROTEASES 1 1.1 Introduction 1 1.2 Classes of viral and cellular proteases 2 1.3 General mechanisms for the regulation of proteolytic processing in viruses 9 1.4 Proteolytic processing in representative well-characterized eukaryotic viruses 11 1.4.1 Aspartic protease of retroviruses 11 1.4.2 Alphavirus nsp2 cysteine protease and capsid serine protease 14 1.4.3 Flavivirus serine protease 17 1.5 Proteolytic processing in picorna-like viruses 20 1.5.1 Genomic organization and common features of picorna-like viruses 20 1.5.2 Picornaviruses 21 1.5.2.1. L protease 23 1.5.2.2 2A protease 23 1.5.2.3 3C protease 26 1.5.2.3.1 Processing events mediated by the 3C protease or its precursors and regulation of protease activity 27 1.5.2.3.2 Cleavage site specificity 29 1.5.3 Potyviruses 31 1.5.3.1 PI protease 33 1.5.3.2 HC-Pro protease 34 1.5.3.3 NIa protease 35 1.5.3.3.1 Processing events mediated by the NIa protease and regulation of protease activity 35 1.5.3.3.2 Cleavage site specificity 37 1.5.4 Comoviruses 38 1.5.4.1 3C-like protease 39 1.5.4.1.1 Processing events mediated by the 3C-like protease and regulation of protease activity 39 1.5.4.1.2 Cleavage site specificity 43 1.5.5 Nepoviruses 44 V 1.5.5.1 Nepoviruses subgroup A/B 45 1.5.5.1.1 3C-like protease 46 1.5.5.1.2 Processing events mediated by the 3C-like protease .. 47 1.5.5.1.3 Cleavage site specificity 49 1.5.5.2 Nepoviruses of subgroup C 51 1.5.5.2.1 3C-like protease 52 1.5.5.2.2 Processing events mediated by the 3C-like protease .. 52 1.5.5.2.3 Cleavage site specificity 53 1.5.5.3 Cleavage site specificity of the proteases of tentative nepoviruses 53 1.6 Summary 54 C H A P T E R 2 M A T E R I A L S A N D M E T H O D S 55 2.1 Plasmid constructions 55 2.2 Site-directed mutagenesis 56 2.3 In vitro translation and proteolytic processing 61 2.4 Quantification of the processing reaction 62 2.5 N-terminal microsequencing of radiolabelled peptides 63 2.6 Immunoprecipitation 63 C H A P T E R 3 IDENTIFICATION AND C H A R A C T E R I Z A T I O N O F T O M A T O RINGSPOT NEPOVIRUS C L E A V A G E SITES IN VITRO 65 3.1 Introduction 65 3.2 Results 65 3.2.1 Identification and characterization of the cleavage site between the protease and polymerase 65 3.2.2 Identification and characterization of the cleavage site at the N-terminus of the movement protein 75 3.2.3 Localization of a cleavage site in the N-terminal region of the RNA-2 encoded polyprotein 81 3.3 Discussion ..83 3.3.1 Consensus sequence for TomRSV cleavage sites .83 3.3.2 Intramolecular processing at the Pro-Pol cleavage site 84 3.3.3 Genomic organization of TomRSV RNA-2: Detection of a novel cleavage site in the N-terminal region of the RNA-2 encoded polyprotein in vitro 85 C H A P T E R 4 SITE-DIRECTED MUTAGENESIS O F T W O T O M A T O RINGSPOT NEPO VIRUS C L E A V A G E SITES 88 4.1. Introduction 88 4.2. Results 88 4.2.1. Site-directed mutagenesis of the Pro-Pol cleavage site 88 4.2.2 Site-directed mutagenesis of the X-MP cleavage site 94 4.3. Discussion 96 vi CHAPTER 5 CHARACTERIZATION OF AN ALTERED TOMATO RINGSPOT NEPO VIRUS PROTEASE WITH A MUTATION IN THE CONSERVED HIS IN THE PUTATIVE SUBSTRATE-BINDING POCKET 101 5.1. Introduction 101 5.2. Results 102 5.2.1. Selection of mutant cleavage sites 102 5.2.2. Cis-proteolytic activity of proteases mutated in the substrate-binding pocket (His1451 to Leu) on the proteolytic processing of mutated Pro-Pol cleavage sites 102 5.2.3. The effect of the protease substrate-binding pocket mutation (His1451 to Leu) on proteolytic processing of mutant cleavage sites in trans 103 5.3. Discussion 105 CHAPTER 6 GENERAL DISCUSSION 108 REFERENCES 114 vii LIST OF TABLES Table 2.1. Oligonucleotides used for the deletion of putative X-MP cleavage sites.... 57 Table 2.2. Oligonucleotides used to amplify the CAT coding sequence from plasmid pCaMVCN (Pharmacia) 57 Table 2.3. Oligonucleotides used for sequencing 57 Table 2.4. Oligonucleotides used in the site-directed mutagenesis of potential pT7X-N-Term cleavage sites 57 Table 2.5. Oligonucleotides used in the site-directed mutagenesis of the X-MP cleavage site 58 Table 2.6 Oligonucleotides used in the site-directed mutagenesis of the Pro-Pol cleavage site 59 Table 3.1 Comparison of the amino acid sequence surrounding TomRSV polyprotein cleavage sites 84 viii LIST OF FIGURES Fig. 1.1 Comparison of the genomic organization of members of the picorna-like supergroup 22 Fig. 1.2 Processing strategy of the poliovirus polyprotein 24 Fig. 1.3 Comparison of the cleavage sites from picornaviruses, comoviruses and potyviruses 31 Fig. 1.4 Processing strategy of the tobacco etch virus (TEV) polyprotein 32 Fig. 1.5 Processing strategy of the cowpea mosaic virus (CPMV) polyprotein 40 Fig. 1.6 Schematic representation of the grapevine fanleaf virus (GFLV) and tomato ringspot nepovirus (TomRSV) RNA-1 and RNA-2 45 Fig. 1.7 Comparison of the cleavage sites from nepoviruses (subgroups A,B andC) 50 Fig. 3.1 Identification of the Pro-Pol cleavage site 67 Fig. 3.2 N-terminal microsequencing of the N-pol protein isolated from the maturation products of the VPg-Pro-N-Pol-II precursor 68 Fig. 3.3 Construction of the VPg-Pro-N-Pol-CAT precursor and proteolytic processing at the Pro-Pol cleavage site in vitro 70 Fig. 3.4 Immunoprecipitation of the pT7VPg-Pro-N-Pol-CAT translation products 71 Fig. 3.5 Time course of processing of the VPg-Pro-N-Pol-CAT precursor into the 30 kDa or the 28 kDa cleaved products 71 Fig. 3.6 Time course of processing of the VPg-Pro- N-Pol-CAT precursor at early time points 73 Fig. 3.7 Intramolecular processing at the Pro-Pol cleavage site in vitro 74 Fig. 3.8 Schematic diagram of partial cDNA clones derived from TomRSV RNA-2 75 Fig. 3.9 Construction of the X-MP precursor and proteolytic processing at the X-MP cleavage site in vitro 76 Fig. 3.10 Immunoprecipitation of pT3X-MP translation products 77 Fig. 3.11 Identification of the X-MP cleavage site 79 ix Fig. 3.12 Time course of processing of the 63 and 43 kDa X-MP precursors by recombinant protease purified from E. coli 80 Fig. 3.13 Time course of processing of the X-MP precursors by recombinant protease purified from E. coli at early time points 80 Fig. 3.14 Processing at a third cleavage site on the P2 polyprotein 82 Fig. 4.1 Time course of proteolytic processing at mutated TomRSV cleavage sites 90 Fig. 4.2 Comparison of the relative rate of proteolytic processing at mutated TomRSV cleavage sites 92 Fig. 4.3 Processing of the X-MP precursors in vitro with VPg-Pro-Pol precursors containing mutations at the Pro-Pol cleavage site 95 Fig. 5.1 Cw-proteolytic activity of proteases mutated in the substrate-binding pocket (His 1451 to Leu) on mutated Pro-Pol cleavage sites 104 Fig. 5.2 7Va/M-proteolytic activity of proteases mutated in the substrate-binding pocket (His 1451 to Leu) on mutated X-MP cleavage sites 105 Fig. 6.1 Genomic organization of tomato ringspot nepovirus RNA-1 and RNA-2 109 LIST OF ABBREVIATIONS 3' three prime 5' five prime A adenosine in the context of nucleotide sequence A alanine in the context of amino acid sequence ArMV arabis mosaic virus Asn asparagine Asp aspartic acid ATP adenosine-5-triphosphate AUG triplet codon as a start codon and/or for amino acid methionine IA poliovirus 1A coat protein 2A poliovirus 2A protease 3 A poliovirus 3 A protein which contains a putative membrane binding domain 3 AB poliovirus 3 AB protein, precursor of 3A and 3B B bottom component in the context of virus particle sediment BLMV blueberry leaf mottle virus bp base pairs BSA bovine serum albumin BRAV mite-transmitted blackcurrant reversion associated virus BRL Bethesda Research Laboratories IB poliovirus IB coat protein 2B poliovirus 2B protein 2BC poliovirus 2BC protein, precursor of 2B and 2C C cytidine in the context of nucleotide sequence C cysteine in the amino acid sequence C1YVV clover yellow vein virus CAT chloramphenical acetyltransferase cDNA complementary DNA CiMV citrus mosaic virus CLRV cherry leaf roll virus Como- comovirus Co-pro comovirus proteas co-factor CP coat protein CP 1 coat protein one of comoviruses CP2 coat protein two of comoviruses CPMV cowpea mosaic virus CPSMV cowpea severe mosaic virus C-terminal carboxy-terminal C-termini carboxy-termini C-terminus carboxy-terminus Cys cysteine °C degrees Celsius IC poliovirus IC coat protein 2C poliovirus 2C protein (helicase or NTB-like protein) 3C poliovirus 3C protease 3CD poliovirus 3C protease and 3D polymerase precursor xi D aspartic acid dATP deoxyadenosine triphosphate dCTP deoxycytidine triphosphate dGTP deoxyguanosine triphosphate DNA deoxyribonucleic acid DTT dithiothreitol ID poliovirus ID coat protein 3D poliovirus 3D RNA-dependent RNA polymerase E glutamic acid E. coli Escherichia coli EDTA ethylenediaminetetraacetic acid eIF-3 eukaryotic initiation factor complex-3 eIF-4F eukaryotic initiation factor complex-4F ELISA enzyme-linked immunosorbent assay F phenylalanine FMDV foot-and-mouth disease virus Fig. figure G guanosine in the context of nucleotide sequence G glycine in the context of amino acid sequence GCMV grapevine chrome mosaic virus GFLV grapevine fanleaf virus Glu glutamic acid H histidine HAV hepatitis A virus HBV hepatitis B virus HC-pro potyvirus HC protease HCV hepatitis C virus His histidine HIV human immunodeficiency virus hr hour I isoleucine K lysine in the context of amino acid sequence K thousand in the context of size Kb kilobase kDa kilodalton 6kl potyvirus 6kl protein located between P3 and CI 6k2 potyvirus 6k2 protein located between CI and NIa-VPg L leucine in the context of amino acids L L protease in the context of proteins encoded by cardio- and aphthoviruses u, micro m milli M methionine in the context of amino acid sequence M molar in the context of concentration MAV myoblastosis associated virus min minute MuLV murine leukemia virus MP movement protein mRNA messenger RNA N asparagine nepo- nepovirus NIa potyvirus nuclear inclusion body "a" NIa-Pro potyvirus nuclear inclusion body "a" 3C-like protease domain NIa-VPg potyvirus nuclear inclusion body "a" VPg domain Nib potyvirus nuclear inclusion body "b" NIMV navel orange infectious mottling virus NPV nucleopolyhedrovirus NS 1 ffavivirus polynucleotide binding protein NS2A ffavivirus NS2A nonstructural protein (part of the replication complex) NS2B flavivirus NS2B serine protease co-factor NS3 flavivirus NS3 serine protease NS4A flavivirus NS4A serine protease co-factor NS4B flavivirus NS4B nonstructural protein (membrane-associated protein) NS5A flavivirus nonstructural protein (transcriptional activator) NS5B flavivirus RNA-dependent-RNA-polymerase nsP123 alphavirus nonstructural protein intermediate polyprotein nsP1234 alphavirus nonstructural protein precursor polyprotein nsPl alphavirus membrane associated protein nsP2 alphavirus cysteine protease nsP3 alphavirus nucleotide binding protein nsP4 alphavirus RNA-dependent RNA polymerase nt nucleotide N-terminal amino-terminal N-terminus amino-terminus NTB nucleoside triphosphate-binding motif NTB-VPg precursor protein of NTB and VPg NTP nucleoside triphosphate oligo oligonucleotide ORF open reading frame P proline PI polyprotein encoded by como- and nepovirus RNA-1 PI PI protease in the context of proteins encoded by potyviruses PI PI region encoding 1ABCD protein in the context of picornaviruses P2 polyprotein encoded by como- and nepovirus RNA-2 P2 P2 region encoding 2ABC protein in the context of picornaviruses P220 protein in the eukaryotic initiation factor complex P3 potyvirus P3 protein P3 P3 region encoding 3 ABCD in the context of picornaviruses PC7 protein convertase 7 PAGE polyacrylamide gel electrophoresis PCR polymerase chain reaction picorna- picornaviruses picorna-like picorna-like viruses supergroup pol polymerase poly(A) polyadenylate or polyadenylic acid poty- potyvirus PPV plum pox virus Pro protease Pro-Pol precursor of protease and polymerase Q glutamine R arginine RNA ribonucleic acid RNP ribonucleoprotein RRSV raspberry ringspot virus RdRp RNA-dependent RNA polymerase RNA ribonucleic acid RSV rous sarcoma virus RT-PCR reverse-transcription polymerase chain reaction 26S an alphavirus subgenomic RNA 49S an alphavirus subgenomic RNA S serine SDV satsuma dwarf virus SDS sodium dodecyl sulfate SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis Ser serine SFV Semliki Forest virus SLRV strawberry latent ringspot virus T threonine in the context of amino acid T thymidine in the context of nucleotide TBRV tomato blackring virus TEV tobacco etch virus TFIIC RNA polymerase III transcription factor Thr threonine TomRSV tomato ringspot virus Tris hydroxymethyl amino methane TRSV tobacco ringspot virus TuMV turnip mosaic virus TVMV tobacco vein mottling virus x unspecific amino acid X N-terminal protein of P2 encoded by TomRSV RNA-2 U uridine UBC University of British Columbia V valine VPg viral protein genome-linked VPg-Pro-Pol precursor protein of VPg, protease and polymerase W tryptophan IX 1 time 2X 2 times 10X 10 times 100X 100 times Y tyrosine xiv ACKNOWLEDGMENTS I would like to express deep appreciation to my principal supervisor Dr. Helene Sanfacon for her incredible guidance, informative advice, unconditional encouragement and financial support during all parts of this study. I would like to give his sincere appreciation to Dr. George Haughn of the University of British Columbia (Vancouver, B.C., Canada) for being his co-supervisor and the very generous use of laboratory space and equipment during part of this study. I would also like to thank his other supervisory committee members, Dr. D'Ann Rochon and Dr. Carl Douglas for important direction during the course of this study and for critical reading of this thesis. Appreciation is also to be given to a former supervisory committee member Dr. John Carlson for direction in the early stages of this project. I want to give special thanks to Dr. Fabienne Hans for important guidance and direction at early stages of the project and for construction of the plasmid pT7VPg-Pro-N-Pol-II. He wishes to thank Mr. Stephan Dube for aid in constructing the plasmid pT7X-N-Term. I am grateful to Mr. Andrew Wieczorek for the initial purification of recombinant active protease, to Dr. Claire Huguenot and Mrs. Jenny Vermeulen for the production of polyclonal antibodies against the movement protein, to Dr. Aiming Wang for the production of antibodies against the VPg and the protease, to Mrs. Joan Chisholm for expert technical assistance and to Dr. Sandy Kielland of the University of Victoria (Victoria, B.C., Canada) for N-terminal microsequencing. I would also like to thank Mr. Carl Chase and Dr. Sharon Chase for critical reading of this thesis. The author would like to extend my appreciation to the Pacific Agri-Food Research Centre for use of the facilities and expertise in making this project possible. This study was supported in part by a grant from Natural Sciences and Engineering Research Council of Canada to Dr. Helene Sanfacon. CHAPTER 1 l LITERATURE REVIEW: VIRAL PROTEASES 1.1 Introduction Tomato ringspot virus (TomRSV) is a member of the nepovirus genus and is found mainly around the Great Lakes and the Pacific Coast of North America but there has been sporadic appearance of the virus around the world through infected seeds. TomRSV is a major pathogen of small fruits, such as raspberry and grapevine and of tree fruits, especially apples and Primus species, such, peach and cherry. It is transmitted in nature by the nematode Xiphinema americanum and other closely related Xiphinema species. It can also be transmitted by seed and mechanically (Stace-Smith, 1984). The current method of controlling TomRSV is through the use of nematicides, such as methyl bromide, which kill its vector. Alternative strategies to control the virus-induced diseases that would alleviate the need for toxic and expensive chemicals are desirable. One strategy to control the virus could be the expression of viral proteins in transgenic plants. Indeed, transgenic tobacco plants expressing the TomRSV coat protein have been shown to provide resistance to TomRSV upon mechanical inoculation (Yepes et al, 1996). Other strategies could be developed based on inhibition of replication or viral protein production. The TomRSV genome consists of two RNAs (RNA-1 and RNA-2) each coding for a polyprotein (PI and P2) (Rott et al., 1991b and 1995). Mature proteins are released by proteolytic processing of these polyproteins by a viral encoded protease (Hans and Sanfacon, 1995; Wang et al., 1999). TomRSV is evolutionarily related to the picornaviruses and to other members of the picornavirus-like supergroup (Goldbach, 1987). Many viruses, including those in 2 the picorna-like supergroup, use proteases to regulate viral gene expression by processing precursor polyproteins. Protease inhibitor strategies have been used to control diseases induced by a number of animal and human viruses including human immunodeficiency virus (HIV) (Ashorn et al, 1990). These inhibitors act by preventing the production of mature viral proteins. Naturally occurring protease inhibitors have been found in plant cultivars that were resistant to infection by a comovirus (Ponz et al, 1988). Therefore the protease is a logical target for the control of TomRSV by the expression of protease inhibitors in transgenic plants. Towards these long-term objectives, the purpose of this thesis was to provide a better understanding of the cleavage site specificity of the TomRSV protease. In this review I will examine the regulation, proteolytic processing and cleavage site specificity of viral proteases. I will describe the general characteristics of proteases and briefly discuss the main classes of proteases. The proteolytic processing events that occur in a number of well-characterized viral polyproteins will then be discussed. These will include those induced by the aspartic acid proteases of retroviruses, the cysteine proteases of alphaviruses and the serine proteases of alphaviruses and flaviviruses. Then the proteolytic processing of polyproteins from members of the picorna-like supergroup including the picornaviruses, potyviruses, comoviruses and nepoviruses will be examined. Particular attention will be given to the activities of the serine and serine-like proteases encoded by these viruses, which are related to the TomRSV protease. These include the picornavirus 3C proteases, the potyvirus NIa proteases and the 3C-like proteases of comoviruses and nepoviruses. 1.2 Classes of viral and cellular proteases Proteolytic processing of viral polyproteins was first described for poliovirus and the bacteriophage T4 using protease inhibitor studies (Summer and Maizel, 1968; Jacobson and 3 Baltimore, 1968). Later, the activity of the encephalomyocarditis virus (a picornavirus) encoded protease was shown using a cell free translation system (Pelham, 1978). Since then, it has been demonstrated that all members of the picornavirus-like supergroup and many other positive-sense single-stranded RNA viruses use a polyprotein strategy either as a main method of genome expression or in combination with other strategies, such as the production of subgenomic RNAs or frameshifting (Dougherty and Semler, 1993; Spall et ah, 1997). Viruses using a polyprotein strategy encode one or more large precursor polypeptides, which contain several domains. These polyproteins are processed by viral encoded proteases or cellular proteases at specific cleavage sites to produce functional mature proteins. Proteases catalyze the hydrolysis of peptide bonds (Barrett, 1986). There are two types of proteases. Some proteases are exoproteases, which remove amino acids from the amino- or carboxy- termini of the proteins. Others are endoproteases, which cleave between specific peptide bonds. Endoproteases have a catalytic site and substrate-binding pocket, which are in close proximity to each other. The substrate-binding pocket is used to recognize the amino acids at the cleavage site and place the cleavage site in the proper alignment for hydrolysis of the peptide bond by the active site of the protease. The three-dimensional structure of the group of amino acids that make up the active site is conserved in nature and provides the basis for protease classification. There are four different classes of proteases, each with a specific three-dimensional structure. These include the serine proteases, the cysteine proteases, the aspartic acid proteases and the metallo proteases (Dougherty and Semler, 1993; Ryan and Flint, 1997). In addition, another type of protease is found in picorna-like viruses, which is related to the serine proteases. These are the serine-like proteases, which have a three-dimensional structure similar to the serine proteases but have a cysteine in the catalytic triad instead of a serine as will be discussed below. 4 Serine, cysteine and aspartic acid proteases are characterized by a distinctive globular structure. The proteases contain two globular domains, an N-terminal domain and a C-terminal domain. These domains come together to make each half of the protein. The two domains are usually similar especially in their secondary and tertiary structure (Burley et ah, 1991; Higaki et ah, 1987; Sielecki et ah, 1991). In the case of aspartic acid proteases the N-terminal and C-terminal globular domains are almost identical (Tang et ah, 1978; Tang and Wong, 1987). Amino acid residues that make up the active site are located between each half of the protease across a crevice that is formed between the two globular domains. All the proteases have this characteristic but each class of protease achieves this structural feature in a unique manner. This has been shown using X-ray crystallography to examine the location of catalytic amino acids of the active site in relation to the three dimensional structure of the protease (Thayer et ah, 1991; Musil et ah, 1991; Mathews et ah, 1994). The overall primary amino acid sequence of the proteases may show little similarity even within the same class of proteases but the amino acids that make up the catalytic triad have a highly conserved three dimensional structure. In contrast, there is relatively little conservation in the amino acids that make up the substrate-binding pocket of the protease and in the three-dimensional structure of the pocket. This is true even among members of the same class of protease (Beaumont et ah, 1991; Burley et ah, 1991; Dhanaraj et ah, 1992; Musil et ah, 1991; Thayer et ah, 1991). One interesting exception to this is the conserved His residue found in the substrate-binding pocket of 3C-like proteases from a number of picorna-like viruses as will be discussed below. The cleavage site specificity of each protease is determined by its unique substrate-binding pocket. The substrate-binding pocket may have a preference for only a single amino acid or may recognize cleavage sites that are up to seven amino acids long. The SI binding pocket is the portion of the substrate-binding pocket that accommodates an amino acid of a particular size or charge at the -1 amino acid position of the cleavage site (N-terminal amino acid of the dipeptide cleaved). Serine proteases have an active site which contains a catalytic triad. The catalytic triad in the serine protease is the three amino acids responsible for hydrolysis of the peptide bond at the cleavage site. It consists of the amino acids His, Asp and Ser, which are brought into proximity with each other by the tertiary structure of the protein. For chymotrypsin, which is a cellular serine protease, the catalytic residues His57, Asp102 and Ser195 make up the active site residues (Higaki et al, 1987). The reactive Ser residue of the catalytic triad acts as a nucleophile during the cleavage of the scissile bond. It donates an electron to the carbonyl group of the amino acid in the -1 position of the cleavage site resulting in the formation of an acyl Ser. A proton is donated to the departing amino group (the amino acid in the +1 position of the cleavage site) by the His residue of the catalytic triad. The carbonyl group at the amino acid residue in the -1 position is then hydrolyzed, which causes the carboxylic acid product to be released and regenerates the active site residues. The Asp residue is involved in holding the His residue into a specific orientation to allow its interaction with the amino group of the amino acid in the +1 position of the cleavage site. Substrate specificity of the cellular serine protease trypsin is for cleavage sites with a Lys or Arg at the -1 position (Craik et al, 1985; Graf et al., 1987) while chymotrypsin prefers a large hydrophobic residue at this position (Hill, 1965). Subtilisin prefers aromatic side chains in the -1 position but will cleave non-aromatic or charged amino acids in the -1 position as long as hydrophobic amino acids are present in the -3 or -4 position (Warshel etal, 1989). It is possible to substitute the substrate specificity of one serine protease for that of another by substituting important amino acids on those proteases. Indeed, modification of amino acids in the substrate-binding pocket of trypsin resulted in a change in its substrate specificity 6 (Craik et al., 1985; Graf et al., 1987). Serine proteases such as chymotrypsin and trypsin can not only hydrolyze peptide bonds but also amides and esters of amino acids found in the -1 position of the natural cleavage sites (Cole et al, 1965; Inagami and Sturtevant, 1964; Johannin and Yon, 1966; Stewart and Dobson, 1965). Changing one residue in the SI binding site of trypsin with the analogous one found in chymotrypsin (Asp189 to Ser) was sufficient to transfer chymotrypsin specificity for ester hydrolysis to trypsin (Hedstrom et al., 1992). However, specificity for amide hydrolysis was not transferred to trypsin by changing the residues in the substrate-binding pocket alone (Hedstrom et al., 1992). In addition to the SI binding pockets there are surface loops on the trypsin protease that do not directly interact with the substrate but contribute to the recognition of the substrate (Craik et al., 1985; Hedstrom et al., 1992). Replacing these surface loops on trypsin with those of chymotrypsin in addition to the substitutions of amino acids in the substrate-binding pocket did give trypsin a chymotrypsin-like amide specificity (Hedstrom et al., 1992; Hedstrom et al., 1994). The enzyme substrate interactions between viral serine proteases and their substrates are highly specific. Sub-optimal cleavage sites are processed at a slower rate allowing regulation of the relative accumulation of precursors and mature products at specific times during the virus replication cycle. The alphavirus capsid protease, the flavivirus NS3 protease and the potyvirus PI protease will be discussed in greater detail below. The serine-like viral proteases are structurally and functionally similar to the serine proteases. However, the serine in the catalytic triad has been replaced by a Cys (Dougherty et al, 1989a; Lawson and Semler, 1991). The picornavirus 2A and 3C proteases and the poty-, como- and nepovirus 3C-like proteases will be discussed in greater detail in the sections below. Viral cysteine proteases are similar to cellular cysteine proteases (such as papain) in structure and activity (Oh and Carrington, 1989; Strauss et al., 1992). Cysteine proteases have a 7 catalytic dyad consisting of Cys and His residues (Lowe, 1976). The mechanism of proteolytic processing is similar to that described above for serine proteases. In this case, the sulfhydryl group of the cysteine residue acts as the nucleophile to donate a proton to the carbonyl carbon of the peptide bond to be hydrolyzed resulting in the formation of an acyl-Cys. During this process the imidizole ring of the catalytic His residue probably withdraws a proton from the sulffiydryl group on the cysteine making it even more nucleophilic. Similar to the serine proteases, the His residue of the catalytic dyad donates a proton to the amide group on the amino acid at the +1 position of the cleavage site resulting in cleavage. The carbonyl group at the amino acid residue in the -1 position is then hydrolyzed resulting in the release of the carboxylic acid product and the regeneration of the active site residues. The cellular cysteine protease, papain, was found to process cleavage sites that had a large bulky amino acid such as Phe or Tyr in the -2 position (Berger and Schechter, 1970). The cellular cysteine a-lytic protease was found to process at cleavage sites that had an Ala in the -1 position (Bone et al., 1989). Amino acids, which define the substrate-binding pockets of papain and a-lytic protease, have been identified. Mutation of these amino acids altered the substrate specificity of the protease (Bone et al., 1989; Khouri et al., 1991; Silen and Agard, 1989). Cysteine proteases are found in a number of RNA viruses including alphaviruses, picornaviruses and potyviruses. The alphavirus nsP2 protease, picornavirus L protease and potyvirus HC-Pro protease will be discussed in greater detail in the sections below. Viral aspartic proteases are structurally and functionally related to the cellular aspartic acid proteases. Aspartic acid proteases are composed of a catalytic dyad made of two Asp residues. Acid base catalysis is used to process the scissile bond at the cleavage sites (Pearl and Blundell, 1984). In aspartic acid proteases a covalent enzyme substrate intermediate does not appear to be formed as they are in cysteine or serine proteases. They are active at acidic pH. 8 There are some differences between the cellular aspartic acid proteases and those found in viruses, such as retroviruses. The cellular aspartic acid proteases are larger, usually about 325 amino acids in size while the viral proteases are smaller and range from 99 to 125 amino acids in length. The cellular proteases contain two roughly identical domains that come together to form each half of the globular protease. Each domain contains one aspartic acid residue of the catalytic dyad. The retroviral aspartic proteases are composed of two identical subunits. These subunits come together to form a dimer which makes up the active protease. Each subunit contains one of the Asp residues required for making up the catalytic dyad and dimer formation is required for an active protease to form (Rao et al, 1991). Aspartic acid proteases have been extensively characterized in retroviruses, especially in HIV. The aspartic acid proteases of retroviruses will be described in greater detail below. Metalloproteases contain a divalent cation, such as Zn2+ at the catalytic site. A His and a Glu residue have been identified as essential amino acid residues in the active site by X-ray crystallography (Liu et al, 1998). The Glu residue is predicted to donate the proton to the carbonyl group of the peptide bond during catalysis. Metalloproteases are active at high pH, usually around 7.5. Mutagenesis experiments indicate that the vaccinia virus (a DNA virus) GIL protease is a putative viral-encoded metalloprotease but this has yet to be confirmed (Whitehead and Hruby, 1994). No other virus-encoded metalloproteases have been identified so far. However, there are some examples of the involvement of cellular metalloproteases in the processing of viral polyproteins. The cellular metalloprotease, enhancin, was shown to facilitate nucleopolyhedrosisvirus (NPV) infections in lepidopterans (Lepore et al, 1996). Binding and entry of the hepatitis B virus (HBV) into the T-lymphocyte was found to require the hepatitis B virus binding factor (HBV-BF), which is a membrane bound cellular metalloprotease (Budkowska et al., 1997). 9 1.3 General mechanisms for the regulation of proteolytic processing in viruses There is more to the regulation of viral protease activity than the simple processing of viral polyproteins into the mature proteins by the protease. Most of the proteolytic processing of viral polyproteins into mature products is regulated to express specific proteins in a time-dependent manner during viral replication. Some precursors are short-lived and processed rapidly into products that are required early in the virus replication cycle. Others accumulate and are only processed into mature products late in the replication cycle. Proteolytic processing as a method of regulating expression of specific products is especially important for those positive-sense RNA viruses that are unable to regulate gene expression at the transcriptional level, such as picornaviruses, potyviruses, comoviruses and nepoviruses. In these cases subgenomic RNAs are not produced and all the gene products are synthesized at the same time in the form of large precursors. Viruses can use several strategies to regulate the efficiency of processing at different cleavage sites. The mechanism of processing at specific sites i.e. in cis or in trans allows regulation of the timing of the processing events (Blair and Semler, 1993). When a protease processes at cleavage sites in cis (intramolecular cleavage), the cleavage sites are located on the same precursor polyprotein as the protease which cleaves them. This reaction is dilution independent and follows zero order kinetics. The cleavage sites can be far away from the protease on the polyprotein and release the protease as an intermediate polyprotein. The cleavage sites can also flank the protease and may be used to release the mature protease from the precursor. Often cleavage reactions in cis (also called autocatalytic reactions) are quite rapid and occur co-translationally. A cleavage reaction is called in trans when the protease present on one molecule cleaves a second molecule containing the cleavage site. This is a bimolecular reaction 10 that proceeds with second order kinetics and is sensitive to dilution. Cleavage in trans is often a slow process and may take place later in the virus replication cycle. In the case of toms-cleavage, regulation of the efficiency of cleavage can be achieved by controlling the protease concentration by sub-cellular localization of the protease away from its substrate. This has been found in the case of potyviruses where a protease precursor is localized into the nucleus as a possible method of regulating the concentration of active protease in the cytoplasm (Carrington et al., 1991). Other cellular processes can also be involved in regulating protease concentration. An example of this is the degradation of Sindbis virus protease precursors by the ubiquitin-dependent pathway (De Groot et al., 1991). Finally, regulation of trans-processing efficiency at specific cleavage sites occurs through interactions of the protease with amino acids at the cleavage sites (Dougherty et al., 1988). In this case, cleavage sites with a sub-optimal amino acid sequence or hidden by a sub-optimal secondary structure will be cleaved less efficiently by the protease. Sometimes proteolytic processing reactions require the presence of a third protein. For example, in the T4 bacteriophage an additional scaffolding or chaperone-like protein is required in order for the proteolytic processing to occur (Showe and Black, 1973; Showe et al., 1976; Showe and Onorato, 1978). A similar requirement has also been found for a comovirus protease. A viral encoded helper protein predicted to be involved in scaffolding or chaperoning is required for proteolytic processing at some cleavage sites but slows down the rate of proteolytic processing at other cleavage sites (Peters et al., 1992a; Peters et al., 1992b; Vos et al., 1988). Similarly, a requirement for additional proteins was also found for flavivirus proteases. An upstream region ofthe polyprotein was required in order for the protease to process a number of cleavage sites in Dengue and yellow fever virus (Chambers et al., 1991; Falgout et al., 1991). The adenovirus (a DNA virus) cysteine protease was found to require DNA and a specific peptide in order for proteolytic processing to occur at some cleavage sites of the capsid protein precursor (Mangel et al, 1993; Sicar et al, 1998). Finally, differential activities of the protease either in its mature form or as a precursor have been described in a number of viruses including poliovirus and nepoviruses (see below). The regulation of the activity of viral proteases is therefore a fairly complicated process, which differs from one virus group to another. 1.4 Proteolytic processing in representative well-characterized eukaryotic viruses 1.4.1 Aspartic protease of retroviruses Retroviruses are a group of positive-strand RNA viruses that have small, enveloped particles and enter a cell by binding to receptors on the cell surface. The virus creates a double-stranded DNA copy of the single-stranded RNA genome, which integrates into the genome of the host and remains latent until gene expression is required (Rabson, 1989). Well-studied members of the retrovirus family include human immunodeficiency virus (HIV), rous sarcoma virus (RSV) and myoblastosis associated virus (MAV). During replication of retroviruses the genomic and subgenomic mRNAs are translated to produce viral polyprotein precursors. These polyprotein precursors are processed into mature proteins by a virus encoded aspartic acid protease (Dittmar and Moelling, 1978; Von der Helm, 1977, Witte and Baltimore, 1978). The viral proteases are encoded as part of the polyprotein precursors, which are cleaved either in trans or in cis. The expression of retroviral proteases occurs by suppression of an in frame stop codon or by ribosomal frame shifting that connects two noncontiguous reading frames to produce a larger polyprotein (Jacks, 1990). It has been suggested that these mechanisms are designed to produce low protease activity to control the cleavage of the capsid precursor. Some HIV cleavage sites are processed by furin and protein convertase 7 (PC7), which are two cellular serine proteases that are similar to subtilisin (Decroly et al, 1998; Hallenberger et al, 1997). 12 Cauliflower mosaic virus, a plant pararetrovirus, was also shown to encode an aspartic acid protease (Torruella et al, 1989). As mentioned above, the retrovirus aspartic acid proteases consist of dimers. Aspartic acid proteases of retroviruses contain a conserved Asp-Thr (Ser)-Gly motif, which is characteristic of aspartic acid proteases (Tang and Wong, 1987). Cellular aspartic acid proteases have tertiary structure containing a single polypeptide chain consisting of two domains each with a conserved Asp residue that together make up the catalytic center of the enzyme (James and Sielecki, 1983; Sielecki et al, 1991). The small size of the protein and the presence of a single Asp-Thr-Gly motif suggested that the retrovirus proteases have a single domain rather than the double domain found in cellular aspartic acid proteases (Pearl and Taylor, 1987). The retrovirus aspartic proteases require the interaction of two separate identical molecules to form the complete globular protease (Navia et al, 1989; Ohlendorf et al, 1992; Wlodawyer et al, 1989). Dimer formation is required for HIV and RSV proteases to be active (Bizub et al, 1991; Cheng et al, 1990; Krausslich, 1991). When the two polypeptide chains dimerize to form the active molecule, two flap regions form that constitute flexible projections over the substrate-binding pocket and the active center of the enzyme. Three regions of the HIV protease were shown to be sensitive to mutagenesis. These included the flap regions, the active center and stretches of conserved amino acids that have important structural roles (Loeb et al, 1989). The flap regions were later shown to be important in interacting with amino acid residues at the cleavage site (Wu et al, 1998). A single-chain tethered dimer was produced from the HIV protease and was found to be more active in vitro than the natural HIV dimer because of high the dissociation rate associated with the natural dimer (Cheng et al, 1990). The use of heterodimers, consisting of one normal subunit and one defective subunit, resulted in inhibition of protease activity in HIV (Babe et al, 1991). The interface between the two dimer subunits has been characterized. Short 13 peptides derived from these binding regions could be used as competitive inhibitors to interfere with dimer formation (Schramm et al, 1996). Premature cleavage of the capsid protein precursors has been found to prevent particle assembly demonstrating the need for a regulation of the proteolytic activity (Bursrein et al, 1991, Krausslich, 1991). Therefore, dimer formation may be used in the regulation of the activity of the retrovirus aspartic acid protease. Cleavage site sequences have been identified for a number of retroviruses but no specific consensus was found (Oroszlan and Luftig, 1990). However, there is a prevalence of hydrophobic residues (Tyr, Phe or Leu) in the -1 position and Pro in the +1 position of the HIV cleavage sites. Mutagenesis of the cleavage site was used to demonstrate that the S1 substrate-binding pocket of the HIV protease can indeed accommodate a large hydrophobic residue in the -1 position (Skalka, 1989). Cleavage site specificity of the HIV protease has been studied using synthetic peptides with altered cleavage sites in in vitro assay systems (Ashorn et al., 1990; Richards et al., 1990; Tomasselli et al., 1990). These studies were useful in determining the role of individual amino acids in processing of the peptides by the HIV protease (Jupp et al., 1991b; Kay and Dunn, 1990). Large amino acids in the -1 position were tolerated but smaller aliphatic ones were not. Cleavage sites containing a small aliphatic amino acid in the -2 position were also cleaved more efficiently. Some uncleaved peptides were found to be effective inhibitors of the HIV proteases (McQuade et al, 1990; Roberts et al., 1990). Non-protein based inhibitors were also effective in inhibiting the HIV protease (DesJarlais et al., 1990; Karlstrom and Levine, 1991; Swain et al., 1990). Site-directed mutagenesis of cDNAs encoding polyprotein precursors have also been used to study substrate specificity of retroviral proteases (Jupp et al, 1991a; Loeb et al, 1989; Tritch et al, 1991). A number of mutations of the -1 or +1 positions of HIV protease cleavage sites drastically affected the ability of the protease to process the cleavage sites in most cases. However, the protease had a different tolerance for amino acids at different 14 cleavage sites (Loeb et al, 1989). Substitutions at the -2 position also affected proteolytic processing of some cleavage sites (Jupp et al, 1991a). Therefore, the -2, -1 and +1 positions of the cleavage site are important for defining a functional cleavage site in retroviruses. Substituting amino acid residues in the MAV protease substrate-binding pocket to corresponding ones from the substrate-binding pocket of the HIV protease gave the substrate specificity and pH profile of the HIV protease to the MAV protease (Konvalinka et al, 1992; Sedlacek et al, 1993 ). It was also possible to make the substrate specificity of the murine leukemia virus (MuLV) and RSV proteases more closely resemble that of HIV by substituting five amino acids in the substrate-binding pockets of these proteases with the amino acids found in the equivalent positions in the HIV protease (Cameron et al, 1994; Menendez-Arias et al, 1995). 1.4.2 Alphavirus nsp2 cysteine protease and capsid serine protease Alphaviruses are members of the Togaviridae family of positive-strand RNA viruses (Schlesinger and Schlesinger, 1990; Strauss and Strauss, 1986). These viruses are most commonly transmitted in nature by arthropod vectors, such as mosquitoes. The virions are enveloped and contain a single strand of positive-sense RNA that is 11 to 12 kb in length. The RNA has a 5' 7mG cap structure and a 3' poly(A) tail and is packaged into a spherical capsid structure composed of multiple copies of a single capsid protein. Two well-characterized members of the genus Alphavirus include Sindbis virus and Semliki Forest virus (SFV). After entry into the cell and uncoating, the virus encoded polyproteins are synthesized. The nonstructural proteins are encoded in the 5' half of the genomic RNA and are expressed as two polyproteins (nsP123 and nsP1234). The structural proteins are encoded in the 3' half of the RNA and are expressed from the 26S subgenomic RNA as a polyprotein (Schlesinger and Schlesinger, 1990; Strauss and Strauss, 1986). Processing of the alphavirus polyproteins involves two virus-encoded proteases and a host protease (Schlesinger and Schlesinger, 1990; Strauss and 15 Strauss, 1986). The nsP123 and nsP1234 polyproteins are processed by the nsP2 cysteine protease present in these precursors. The capsid protein, which is present in the structural polyprotein, contains a serine protease (Choi et al, 1991; De Groot et ah, 1990). The capsid serine protease cleaves itself from the structural polyprotein. The remaining cleavage site on the structural polyprotein is processed by either furin or a furin-like protease of cellular origin located within the membranes of the endoplasmic reticulum (Heidner and Johnston, 1994; Heidner et al, 1994). The alphavirus nsP2 cysteine protease is responsible for processing the nonstructural proteins on the nsP123 and nsP1234 polyproteins (De Groot et al, 1990). Indeed, antibodies raised against nsP2 inhibit proteolytic processing in vitro (Hardy and Strauss, 1988; Kujala, 1997). The 90 kDa nsP2 protein is a multifunctional protein with four activities including a putative helicase activity, an NTPase activity, a proteolytic activity and a regulatory activity on the synthesis of the 26S mRNA (Falgout et al, 1991; Kujala et al, 1997). The central portion of the protein contains a cysteine protease (Strauss and Strauss, 1990). Mutations in this portion of nsP2 resulted in a loss of proteolytic processing (Hardy et al, 1990). The alphavirus cysteine protease is similar in structure and activity to the cellular cysteine proteases (Gorbalenya et al, 1991). Mutagenesis of nsP2 indicated that Cys481 and His558 are crucial for proteolytic activity and make up the catalytic dyad of this protease (Strauss et al, 1992). Altering amino acids other than these amino acids had no effect on proteolytic activity. The Sindbis virus nsP2/3 and nsP3/4 cleavage sites are processed by nsP2 in cis and the nsPl/2 cleavage site is processed by nsP2 in trans (De Groot et al, 1990). However, proteases containing the nsPl domain were unable to cleave the nsP2/3 cleavage site and only nsP2 protease precursors containing the nsP3 protein can process the nsP3/4 cleavage site (De Groot et al, 1990). Therefore, processing at the nsPl/2 cleavage site is required before processing at the nsP2/3 can take place (Shirako and Strauss, 16 1990). This indicates that the nonstructural proteins are processed in a cascade of events resulting in production of precursors and products in a temporal fashion (De Groot et al., 1990; Strauss and Strauss, 1990). The temporal cascade is used to regulate the replication of viral RNA because the synthesis of either plus or minus-strand RNA occurs only in the presence of certain protein precursors (Lemm and Rice, 1993; Shirako and Strauss, 1994). The alphavirus cysteine protease recognizes conserved cleavage sites (Shirako and Strauss, 1990). The amino acid residues at the cleavage site are usually (Ala,Val,Ile)-Gly-(Ala,Gly)/(Ala,Gly,Tyr). These cleavage sites resemble those present in the polyproteins processed by the adenovirus (a DNA virus) cysteine protease (Freimuth and Anderson 1993; VanSlyke et al., 1991). The importance of these amino acids in defining a functional cleavage site has not been tested directly. The 26S subgenomic mRNA is synthesized by viral replication from the full-length 49S minus-strand RNA. The 26S subgenomic mRNA is then translated into a polyprotein which contains the structural proteins of the virus. Cleavage of the capsid protein from the N-terminal portion of the structural polypeptide is done by autocatalytic cleavage by a serine protease present in the capsid protein (McQuade et al, 1990). Sindbis virus and SFV capsid proteins have sequence homologies to serine proteases especially in areas around the putative catalytic triad of His, Asp and Ser (Hahn et al, 1985). Mutagenesis of the putative catalytic triad of the Sindbis virus capsid protease indicated that His141 and Ser215 are important residues in proteolytic processing and are probably members of the catalytic triad (Rice et al., 1987; Hahn and Strauss 1990). Mutating the putative active site nucleophilic residue, Ser215 to Cys resulted in some retention of its autoproteolytic activity. Other mutations in the Ser215 residue eliminated processing activity of the protease. The Ser219 of SFV, which corresponds to Ser215 of Sindbis virus capsid protein, is also part of the active site (Melancon and Garoff, 1987). X-ray crystallography confirmed that the Sindbis virus capsid serine protease has a structure similar to 17 that of chymotrypsin (Choi et al, 1991; Tong et al, 1993). The capsid protein has a bilobular structure with each domain forming a characteristic beta barrel. His141 and Ser215 are located at the interface region between the two lobes, forming a substrate-binding pocket within the folded protease. This confirmed that His141and Ser215 are members of the active site. However, a traditional catalytic triad was not observed since Asp163, the predicted third member of the catalytic triad, was positioned near the outer surface of the enzyme rather than at the interface region between the two lobes of the protease. It is suggested that Asp 1 6 3 is brought into the center of the enzyme by comformational changes resulting from the binding of the protease to the substrate. 1.4.3 Flavivirus serine protease Flaviviruses are enveloped, positive-sense single-stranded RNA viruses that have a 5' cap structure and are polyadenylated at their 3' end. Flaviviruses are often transmitted by arthropods, such as mosquitoes and are known to infect both human and animal hosts. Well-studied members of this group include yellow fever virus, dengue, tick born encephalitis and hepatitis C virus (Choo et al, 1991; Pletnev et al, 1990; Rice et al, 1985). Flaviviruses express their genes as a single long polyprotein. The structural and non-structural proteins are encoded by the 5' and 3' half of the flavivirus RNA, respectively (Chambers et al, 1990a; Rice et al., 1985). Several of the cleavage sites on the hepatitis C virus and yellow fever virus polyproteins are processed by a cellular signal peptidase that is membrane associated (Stocks and Lobigs, 1995; Stocks and Lobigs, 1998; Yamshchikov and Compans, 1993). The nature of the signal peptidase involved in processing of these cleavage sites is unknown (Chambers et al., 1990a; Tomei et al., 1993). However, many of cellular signal peptidases characterized so far are serine proteases (Paetzel et al, 1998; Suciu et al, 1997; Zhong and Benkovic, 1998). 18 The NS3 protease processes several cleavage sites on the flavivirus polyprotein (Rice et al, 1985; Butkiewicz et al., 1996). It has similarities to cellular serine proteases such as chymotrypsin (Bazan and Fletterick, 1989, Gorbalenya et al., 1989b, Chambers et al., 1990c; Kim et al, 1996). In Dengue, deletion of the N-terminal 184 amino acid residues of NS3 resulted in loss of proteolytic activity at the NS2A-NS2B junction and the NS2B-NS3 junction. In hepatitis C virus the N-terminal region of NS3 contains the catalytic triad residues of His57, Asp81 and Ser139 (Gorbalenya et al, 1989a, Love et al, 1996, Yan et al, 1998). The C-terminal region contains a nucleotide triphosphatase and an RNA helicase activity that may be involved in RNA replication (Chambers et al, 1990a; Falgout et al, 1991; Morgenstern et al, 1997). The NS3 protease of hepatitis C virus also contains a well-defined substrate-binding pocket (Love et al, 1996). There is a preferred order of cleavage for polyproteins encoded by yellow fever or Dengue virus RNA, which appears to be a product of direct protease substrate interactions (Chambers et al, 1990a; Preugschat et al, 1990; Preugschat et al, 1991). NS3 containing precursor polypeptides are capable of undergoing self-cleavage as a first step in the proteolytic processing pathway (Preugschat et al, 1991). Primary structure as well as secondary structure is important for determining the efficiency at which hepatitis C virus cleavage sites could be processed. For example, proteolytic processing at one cleavage site releases a peptide from the polyprotein resulting in a conformational change that makes proteolytic processing more efficient at another cleavage site (Lin et al, 1993a). It was also found that a number of alternative cleavage sites in yellow fever virus and hepatitis C virus can be processed by the NS3 protease when the normal cleavage sites are mutated (Nestorowicz et al, 1994). It is possible that the preference for specific cleavage sites prevents secondary cleavage sites from being processed as part of the polyprotein. Conformational changes after processing of the primary 19 cleavage site may render processing of alternative cleavage sites even more difficult for the protease. Intact NS2B sequence is required in addition to NS3 for cleavage at the NS2A/NS2B and NS2B/NS3 cleavage sites in Dengue (Falgout et al, 1991). This requirement can be supplied in trans by intact NS2B. The requirement for a viral-encoded protease co-factor and the ordering of autocatalytic cleavage events provides a number of steps at which the NS3 protease activity can be regulated (Falgout et al, 1991). Similarly, processing of the hepatitis C polyprotein at the NS3-NS4A and NS4B-NS5A cleavage sites requires the presence of NS4A in addition to the NS3 protease. In addition, cleavage at NS4A-NS4B and NS5A-NS5B sites is enhanced by the presence of NS4A. NS4A can be supplied in cis as part of a protease precursor or in trans (Failla et al, 1994; Butkiewicz et al, 1996: Tanji et al, 1995). The central portion of NS4A was found to be sufficient to act as a cofactor for the NS3 protease through its interaction with a region at the N-terminus of NS3 (Butkiewicz et al, 1996; Failla et al, 1995; Tomei et al, 1996). Binding of a peptide, resembling the central portion of NS4A, to the N-terminus of the NS3 protease resulted in increased protease activity (Yan et al, 1998). The flavivirus NS3 serine protease recognizes very specific cleavage sites (Chambers et al, 1990a). The yellow fever virus NS3 protease has a preference for cleavage sites that have two basic residues at the -1 and -2 position and an amino acid with a small side chain at the +1 position (Chambers et al, 1990b). NS3 has a more highly defined substrate specificity than trypsin, which has a specificity for Lys or Arg in the -1 position but has no requirements for amino acids in the -2 or +1 positions (Urbani et al, 1997; Zhang et al, 1997). Mutagenesis of the yellow fever virus NS4B/NS5 cleavage site demonstrated that the NS3 protease tolerated a Gly, Ala or Ser in the +1 position, an Arg, Lys, Gin or His in the -1 position and polar or hydrophobic residues in the -2 position (Lin et al, 1993b). Cleavage site analysis and site-20 directed mutagenesis studies have indicated that hepatitis C virus NS3 protease prefers to have a Cys or Thr in the -1 position and a Ser or Ala at the +1 position. There is also a conserved Glu or Asp at the -6 position but this was not found to be critical for proteolytic processing (Bartenschlager et al, 1995; Kolykahalov et al, 1994). In hepatitis C virus there is a more stringent requirement for amino acids at cleavage sites processed in trans than those processed in cis. Proteolytic processing of cleavage sites processed in cis is by folding of the protease to bring the catalytic triad in contact with the amino acid residues at the cleavage sites. However, proteolytic processing in trans has more stringent amino acid requirements probably resulting from specific interactions between the substrate-binding pocket of the protease and amino acid residues at the cleavage site (Bartenschlager et al, 1995). Amino acids in the substrate-binding pocket of the hepatitis C virus protease are important in defining substrate specificity. Substituting amino acids in the substrate-binding pocket of the hepatitis C NS3 protease with the corresponding ones of the Streptomyces griseus protease Bl resulted in a change of substrate specificity of NS3 (Failla et al, 1996). Indeed, the modified NS3 obtained a substrate specificity similar to that of the cellular serine proteases and was able to process cleavage sites that contained a Phe residue in the -1 position. Substituting the Phe154 residue in the NS3 protease with another amino acid was sufficient to change the protease specificity for amino acids in the -1 position (Koch and Bartenschlager, 1997). 1.5 Proteolytic processing in picorna-like viruses 1.5.1 Genomic organization and common features of picorna-like viruses Members ofthe Picornaviridae family, the Potyviridae family and the Comoviridae family, which includes comoviruses and nepoviruses have been classified together in the picornavirus-like supergroup (Golbach, 1987). Viruses of the picornavirus-like supergroup have 21 several features in common. They consist of icosahedral particles (rod-shaped for potyviruses) and have single-stranded positive-sense RNA genomes which are either monopartite or bipartite. Their genomic RNAs are covalently linked to a viral encoded protein (VPg) at their 5' terminus and a poly(A) tract is present at their 3' termini. The genomic RNA(s) code(s) for single long open reading frame(s) (ORFs) resulting in the production of polyproteins, which are processed by viral-encoded proteases to release mature gene products. Viruses in the picornavirus-like supergroup encode several non-structural proteins that have similar functions and significant amino acid sequence similarity. A protein with a nucleotide binding motif (NTB) may act as a helicase that unwinds duplex RNA during replication, transcription, recombination and repair (Bienz et al, 1992; Wimmer et al., 1993). The VPg is used as a primer in RNA replication (Cao et al., 1993; Paul et al, 1998; Reuer et al, 1990). The protease is responsible for processing of cleavage sites on the polyprotein and for binding to the viral RNA in the replication complex (Andino et al, 1990; Clark et al, 1991; Andino et al, 1993). The RNA-dependent RNA polymerase (Pol) is involved in polymerizing viral RNA strands during RNA replication. The genomic organization of the non-structural proteins of all members of the picornavirus-like supergroup is similar, consisting of the NTB-VPg-Pro-Pol motif (see Fig. 1.1). They all use a serine-like protease for proteolytic processing of most of the polyprotein cleavage sites although some have additional proteases. 1.5.2 Picornaviruses The Picornaviridae family includes enteroviruses (such as poliovirus), hepatoviruses (such as hepatitis A virus (HAV)), cardioviruses (such as encephalomyocarditis virus), rhinoviruses and aphthoviruses (such as foot and mouth disease virus (FMDV)) (Porter, 1993; Wimmer et al, 1993; Xiang et al, 1997). They are all animal viruses and each consist of icosahedral particles. They have a monopartite RNA genome, which contains a single long open 22 6k1 6k2 P1 HC-Pro P3 b v v v v i- v ^ i- i- II > > > > > f * | > > > j < < < < < V41 < < < { > > > > > > } > > > ! * f , !t4lb: CP Potyviruses MP 3B 1 Al 1B | 1C I 1D | 2A | 2B LhA 1B 1C 1D 2A 2B < < < < • { A s * < < < < < < < < T V < < < > > > > > > > > > > • rrt****** CP1 CP 2 32kDa MP CP MP CP it > \ \ \ \ i i i i < < < < < < < < 3A 3C 3B 3A 3C nTTTTTTT ]>>>>>>>>>>>>> VPg Pro VPg n:~rTTTTTTTTTTT < * < < <* < < { < « > > > > > > > > > > > > > K Pro VPg F J 5 > F F F F F F F f > >>>>>• N T R >>>>»• < < < < «*^' < < < < P r o ;:3P:; : ; : 3 © ; :p6i; Enteroviruses Rhinoviruses Apthoviruses Comoviruses Nepoviruses A/B Nepoviruses C Fig. 1.1 Comparison of the genomic organization of members ofthe picornavirus-like supergroup. The genomic organization of the potyviruses, enteroviruses/rhinoviruses, apthoviruses, comoviruses, nepoviruses subgroup A / B and nepoviruses subgroup C is shown. The viral polyproteins are shown with boxes. The vertical lines through the polyproteins indicate cleavage sites. The name of the domains for the different mature proteins are indicated within each polyprotein. For clarity, coding regions are not drawn to scale. The conserved NTB-VPg-Pro-Pol domain in each virus group are indicated by the dotted lines. Regions of similar function are indicated by boxes with similar shading. N T B : protein containing a N T P binding motif, VPg: viral genome linked protein, Pro: protease, Pol: RNA-dependent R N A polymerase, MP: movement protein, CP: coat protein. reading frame (see Fig. 1.2). The polyprotein is processed into mature gene products by viral encoded proteases (Lawson and Semler, 1990). The NTB-VPg-Pro-Pol motif is located near the C-terminus of the polyprotein. The polyprotein is processed into three intermediate precursors (primary products) PI, P2 and P3, by extremely rapid co-translational, intramolecular proteolytic processing (Ryan and Flint, 1997). These three primary products are further processed either in cis or in trans to release different sub-sets of functional mature and intermediate precursor proteins following an ordered proteolytic cascade. There are three main proteases, L, 2A and 3C, which are responsible for processing of picornavirus-encoded polyproteins. The 2A protease encoded by the polio- and rhinoviruses and the 3C protease encoded by all picornaviruses are 23 serine-like proteases, the L protease encoded by aphthoviruses is a cysteine protease (Ryan and Flint, 1997). 1.5.2.1. L protease The L protease is located at the N-terminus of the aphthovirus polyprotein and cleaves co-translationally at the L-l A junction either in cis or in trans (Medina et al., 1993; Cao et al 1995). The L protease has a number of similarities in structure and activity to the cellular cysteine proteases (Gorbalenya et al, 1991; Piccone et al, 1995; Roberts and Belsham, 1995). The amino acids that make up the catalytic dyad have been identified as Cys and His (Roberts and Belsham, 1995). The L protease also cleaves the host cell protein eIF-4F, which is the eukaryotic initiation factor complex that normally interacts with capped cellular mRNAs as a prerequisite to ribosome binding and initiation complex formation (Devany et al, 1988; Kirchweger et al, 1994; Roberts and Belsham, 1995; Thatch, 1992). The cleavage of eIF-4F by the L protease contributes to the shut-off of gene expression in infected cells (Devaney et al, 1988; Thatch, 1992). Proteolytic processing of eIF-4F by the entero- and rhinoviruses 2A protease has also been shown and will be discussed below. 1.5.2.2 2A protease The 2A protease is a serine-like protease located in the central portion of the entero- and rhinoviruses polyprotein (see Fig. 1.2). The 2A protease was shown to process the poliovirus polyprotein at the P1-P2 junction in vitro and in bacterial expression assays (Toyoda et al, 1986). This is a very rapid processing that occurs co-translationally resulting in the release of the structural precursor PI from the rest of the non-structural polyprotein sequences. The poliovirus 2A protease also processes a second cleavage site in trans within the 3D polymerase but processing at this cleavage site is not essential for virus proliferation (Lee and Wimmer, 1988; Toyoda et al, 1986). Purification of poliovirus 2A protein from infected cells revealed the 24 Poliovirus 3B 1A 1B 1C 1D 2A | 2B | 2C 3A 3C 3D • precursor P1 • P2 1AB ^ P3 1A 1C 1D~ 2A 1B 2B | 2Bc l 3AB 2C 3A 3B 1 3C 3CD 3D Fig 1.2 Processing strategy of the poliovirus polyprotein. The organization of the poliovirus genome is shown at the top of the figure. The open reading frame is indicated by a box. Horizontal lines at the sides of the open reading frame represent non coding regions. Vertical lines through the open reading frame indicate cleavage sites. The domains for the different mature proteins (1 A, IB, IC, ID, 2A, 2B, 2C, 3A, 3B, 3C and 3D) are indicated in the open reading frame. The processing strategy of the polyprotein is shown at the bottom of the figure and includes a drawing of the precursor polyprotein, the intermediate gene products (PI, P2, P3, 1AB, 2BC, 3AB, 3CD) and the mature proteins. The cleavage site processed by the 2A protease is indicated by an arrowhead above the open reading frame. All other cleavage sites are processed by the 3C protease. presence of a 17 kDa protein that was inhibited by compounds specific for cysteine proteases (Konig and Rosenwirth, 1988). The poliovirus and rhinovirus 2A proteins have a catalytic triad consisting of the amino acids His , Asp and Cys . The substrate-binding pocket of the 2A protease has been characterized (Hellen et al, 1991; Sommergruber et al, 1989, Yu and Loyd, 1991, Yu and Loyd, 1992). The 2A protease recognizes cleavage sites with a Tyr residue at the -1 position and a Gly residue at the +1 position. Substitution of the Gly in the +1 position with large amino acids results in inefficient cleavage in cis (Hellen et al, 1992; Skern et al, 1991). It was found that the 25 -2 and +1 positions were critical for defining a functional cleavage site. However, the +2, -1 and -3 positions were not as important. (Hellen et al, 1992; Lee and Wimmer, 1988). The amino acid requirements for as-processing at the P1-P2 cleavage site were not as stringent as those for fr-ans-processing at the second Tyr-Gly dipeptide in the 3D polymerase (Hellen et al, 1992). This is similar to the situation described above for the flavivirus NS3 protease. In addition to processing of cleavage site at the junction of the ID and 2 A proteins, the 2A protease is involved in the proteolytic processing of a cellular substrate, the p220 polypeptide. The p220 polypeptide is an integral component of eIF-4F (Thatch, 1992). Infection of Hela cells with either poliovirus or rhinovirus resulted in proteolytic processing of p220. This resulted in a loss of cap-dependent translation in infected cells (Etchison and Fout, 1985; Etchison et al, 1982). The 2A protease is capable of processing the p220 polypeptide directly but the processing efficiency is quite low (Bovee et ah, 1998). It is suggested that efficient processing of p220 in the cell requires cellular factors in addition to the 2A protease (Loyd et ah, 1988; Sun and Baltimore, 1989). Indeed, cleavage of p220 only occurred when the 2A protease interacted with the cellular factor eIF-3 (Wyckoff et al., 1992). This interaction requires catalytic residues within the 2A sequence that are involved in cleavage at the P1-P2 bond in the poliovirus polyprotein (Hellen et al, 1991; Yu and Loyd, 1991; Bovee et al, 1998). The proteolysis of p220 may be one factor contributing to the shutoff of host translation in the virus infected cell (Loyd et al, 1987; Perez and Carrasco, 1992, Ventoso et al, 1998). The 2A protease also blocks transcription and is involved in the inhibition of RNA polymerase II-mediated transcription. This indicates that the 2 A protease interferes with a number of host proteins at the transcriptional and translational level during virus replication (Ventoso et al., 1998). 1.5.2.3 3C protease Picornavirus 3C proteases are serine-like proteases that are also found in other members of the picornavirus-like supergroup. It is present near the C-terminal portion of the picornavirus polyprotein (see Fig. 1.2). Early inhibitor studies indicated that the 3C proteases were cysteine proteases but amino acid homology indicated similarities to the serine proteases (Lawson and Semler, 1991; Gorbalenya et al, 1986). The homology included the overall two domain beta barrel structure of the trypsin-like enzymes and the residues thought to form the catalytic triad of the enzyme (Gorbalenya et al, 1986; Bazan and Fletterick, 1988; Gorbalenya et al, 1989a; Bazan and Fletterick, 1990; Allaire et al, 1994; Mathews et al., 1994). X-ray crystallography, inhibitor studies, amino acid sequence comparisons and site-directed mutagenesis have been used to identify the amino acid residues that make up the catalytic triad. The active site nucleophile of the poliovirus 3C protease was demonstrated to be the highly conserved Cys147. His40 and Asp85 (or Glu71) have been suggested to be the other members of the catalytic triad (Hammerle etal, 1991; Ivanoff etal, 1986; Kean etal, 1991; Lawson and Semler, 1991). For the rhinovirus 3C protease Cys172 and His44 were found to be members of the catalytic triad (Allaire et al, 1994). In Hepatitis A virus the catalytic triad of the 3C protease was found to be Cys146, His40 and Glu71. A predicted Asp102 residue was not part of the catalytic triad (Mathews et al, 1994, Gosert et al, 1997). Mutations of the Cys147 residue of the poliovirus 3C protease to Ser resulted in the retention of some proteolytic activity, while other mutations eliminated proteolytic processing altogether (Lawson and Semler, 1991). This is consistent with results obtained during the mutagenesis of the TEV (a potyvirus) NIa protease (see below) and during the reciprocal experiment on the Sindbis virus (a flavivirus) serine protease (Hahn and Strauss, 1990; Dougherty et al, 1989b). This indicates that serine-like proteases are closely related to serine proteases because proteolytic activity is retained when amino acid residues from the 27 catalytic triad of one class of protease is substituted with amino acids from the other class of protease. 1.5.2.3.1 Processing events mediated by the 3C protease or its precursors and regulation of protease activity All picornaviruses use the 3C protease as their major source of proteolytic activity. The entero- and rhinovirus polyprotein precursors are processed into three intermediate precursors PI, P2 and P3, by rapid co-translational proteolytic processing in cis (see Fig. 1.2) (Ryan and Flint, 1997). As mentioned above the 2A protease processes the cleavage site at the PI-2A junction to release the PI (1 ABCD) intermediate precursor from the rest of the polyprotein. The 3C protease processes the polyprotein at the 2C-3A cleavage site in cis to produce the P2 (2ABC) and P3 (3ABCD) intermediate precursors. Alternative primary cleavage by the 3C-protease occurs at the 2A-2B site for poliovirus (Lawson and Semler, 1991) and the 2B-2C site for FMDV (Ryan and Flint, 1997). 3C is present in the infected cell in the form of the mature 3C protein and as the larger 3 CD polyprotein, which is an intermediate precursor produced by cleavage in cis of the P3 (3ABCD) intermediate precursor at the 3B-3C site. In poliovirus, the 3CD form of the protease is required for complete processing of the PI intermediate precursor, which contains the capsid proteins (Ypma-Wong etal., 1988a). Processing of the PI precursor occurs in trans to release the 1 AB, IC and ID proteins. Both the 3C and 3CD forms of the enzyme are capable of secondary processing of the P2 and P3 polyproteins, which occurs in cis and in trans (Ypma-Wong et al., 1988a; Ypma-Wong et al., 1988b). Proteolytic processing of P2 produces three mature products 2A, 2B and 2C and one long-lived precursor 2BC (Harris et al, 1990; Cuconati et al, 1998). Proteolytic processing of P3 produces four mature products 3 A, 3B, 3C and 3D, which are released by slow processing of 3AB in trans and of 3CD in cis (Xiang et al, 1998). 28 Regulation of proteolytic processing of picornavirus polyproteins by the 3C protease involves different intermediates of the 3C protease. As mentioned above, secondary processing of the poliovirus PI intermediate precursor into the capsid proteins is only by the 3CD form of the protease. The 3D portion of the 3CD enzyme may be required to recognize and interact with structural motifs in the PI precursor, which increases the rate and amount of processing by the 3C portion of the enzyme (Ypma-Wong et al, 1988a). Not all picornaviruses require the 3CD polypeptide for proteolytic processing of capsid precursors. For example, FMDV and HAV produce mature 3C enzymes capable of processing the PI precursor (Harmon et al., 1992; Jia et al., 1991; Vakharia et al., 1987). In addition to the differential activities of 3C and 3CD on PI cleavage sites, other intermediate proteins regulate the activity of 3C in poliovirus. The presence of the 3 AB protein increases the efficiency of auto-processing of 3CD to 3C and 3D. The 3 AB protein also enhances proteolytic processing of protein 2BC in trans by 3C or 3CD (Molla et al., 1994). The 3CD protease is more efficient than the 3C protease in cleaving 3AB in trans (Lama et al., 1994). Proteolytic processing of the intermediate capsid protein 1 AB into 1A and IB by the 3C protease is regulated by the presence of viral RNA. As a result cleavage at this site occurs late in the virus replication cycle after viral RNA has already been synthesized (Hellen and Wimmer, 1992). In addition to proteolytic processing of the viral polyproteins, the 3C protease is also responsible for proteolytic processing of a number of cellular substrates (Korant et al, 1980; Clark and Dasgupta, 1990). Poliovirus appears to directly inactivate polymerase III by proteolytic processing. It is also involved in the alteration of polymerase I and II activities in infected cells (Rubinstein et al, 1992). An RNA polymerase III transcription factor (TFIIC) is modified by dephosphorylation and proteolysis is mediated by the 3C protease (Clark et al, 1991). The poliovirus 3C protease is also known to cleave the TATA binding protein (Clark et 29 al, 1993) and the microtubule associated protein 4 (Joachims et al., 1995). The FMDV 3C protease appears to cleave the host histone protein H3 (Falk et al., 1990; Tesar and Marquardt, 1990). These activities of the 3C protease in combination with the processing of host cell factors by the 2A and L proteases cause significant damage to the host gene expression machinery, which may contribute to host gene shut-off during viral infection (Yalamachili et al., 1996; Aranda and Maule, 1998). 1.5.2.3.2 Cleavage site specificity The picornavirus 3C proteases are very specific for the cleavage sites they recognize and process. Poliovirus 3C protease processes almost exclusively at (Gln,Glu)/(Gly,Ser,Ala) cleavage sites in normal viral substrates with Gln/Gly being the most common cleavage site (see Fig. 1.3). Site-directed mutagenesis has resulted in alternate cleavage sites that can be cleaved by the 3C protease, such as Gln/Ile, Gln/Asn and Gln/Thr (Jia et al, 1991; Lawson and Semler, 1990). The rhinovirus protease also cleaves almost exclusively at Gln/(Gly,Ser) cleavage sites. However, Glu has been found in the -1 position and Ala has been found in the +1 position at a few cleavage sites (Long et al., 1989). HAV protease cleavage sites are almost identical to those of rhinovirus and poliovirus with Gin or Glu in the -1 position and Gly or Ser in the +1 position (Jewell et al., 1992). Substrate determinants other than the two amino acids at the cleavage site are involved in substrate recognition and proteolytic processing by the 3C protease since not all amino acid pairs containing the proper amino acid sequence are processed by the protease. Additional substrate determinants may include accessibility to the potential cleavage site by the protease resulting from folding of the polyprotein, recognition of secondary or tertiary structures and recognition of amino acids other than the two amino acids at the scissile bond by the protease (Nicklin et al., 1986). A conserved Ala in the -4 position was observed in poliovirus (Nicklin et al., 1986). Experimental evidence for the role of the -4 amino acid in substrate 30 cleavage was generated using synthetic peptide substrates and purified recombinant poliovirus 3C proteases (Pallai et al, 1989). There also appears to be a consensus for a small aliphatic amino acid (such as Val, Leu and Ile) in the -4 position of HAV and rhinovirus cleavage sites (see Fig. 1.3). Studies with synthetic peptides have also been used to characterize the relative cleavage efficiencies of 3C substrates present in the rhinovirus and HAV polyproteins (Long et ah, 1989, Petithory et al., 1991). Substitution of residues in the -4, -1 and +1 positions of cleavage sites recognized by the hepatitis A 3C protease resulted in reduction or loss of cleavage. Taken together, these results indicate that these amino acid positions are important in defining functional cleavage sites in at least three picornaviruses ( Blair and Semler 1991; Long et al., 1989; Jewell et al., 1992). The encephalomyocarditis virus protease also recognizes cleavage sites that are Gln/(Gly,Ser). However, these cleavage sites have no conserved amino acids in the -4 position. Instead, they have a Pro residue in either the -2 or +2 position (Palmenberg et al., 1984). The potential role of these conserved residues in cleavage site recognition has not been directly tested. A His located within the C-terminal region of the 3C protease has been suggested to be an essential component of the substrate-binding pocket of the protease (Gorbalenya et al., 1986; Bazan and Fletterick, 1988; Gorbalenya et al, 1989a; Bazan and Fletterick, 1990; Nienaber et al, 1993; Allaire et al, 1994; Mathews et al, 1994). Mutation of this His results in inactivation of the poliovirus protease (Ivanoff et al, 1986). The atomic structures of the recombinant 3C protease from rhinovirus and hepatitis A virus show shallow elongated substrate pockets that could easily accommodate up to 8 amino acids from the cleavage sites (Allaire et al, 1994; Mathews et al, 1994). The specificity of the 3C protease for a Gin residue in the -1 position of the cleavage site is predicted to be the result of direct interaction with the His residue of the substrate-binding pocket (Allaire et al, 1994). 3 1 PICORNAVIRUS CONSENSUS Polio XXAXXQ / G N i c k l i n et a l . (198 6) Rhinovirus HAV XXVXXQ / G Long et a l . (1989) E / S A XXVXXQ / G Jewell et a l . (1992) L E / S POTYVIRUS CONSENSUS TEV TuMV C 1 Y W COMOVIRUS CONSENSUS CPMV CPSMV EXIYXQ / S Dougherty et a l . (1988) L G V XXVXHQ / S Kim et a l . (1996) A T XXVXFQ / S Takahashi et a l . (1997) E G A XXAXAQ / S Wellink et a l . (1986) P G M XXAXAQ / S Chen and Bruening (1992a,b) V L M A Fig 1.3 Comparison of the cleavage sites from picornaviruses, potyviruses and Comoviruses. Consensus sequences in amino acids from the +1 to -6 positions of cleavage sites from two comoviruses, cowpea mosaic virus (CPMV) and cowpea severe mosaic virus (CPSMV); three picornaviruses poliovirus, rhinovirus, hepatitis A virus (HAV); and three potyviruses tobacco etch virus (TEV), turnip mosaic virus (TuMV) and clover yellow vein virus (Cl YVV) are shown. Amino acids consistent with the picorna-like dipeptide cleavage site consensus in the +1 and -1 positions are underlined. 1.5.3 Potyviruses Potyviruses are flexuous rod-shaped viruses that infect a number of plant species and are commonly transmitted by aphids. They have a monopartite genome of about 9500 nt in length (Dougherty and Carrington, 1988; Reichman et al, 1992). In potyviruses the structural proteins 32 are C-terminal of the NTB-VPg-Pro-Pol motif. The potyvirus genome contains a single open reading frame that is translated into a single long polyprotein (see Fig. 1.4). Well characterized members of this group include tobacco etch virus (TEV) and tobacco vein mottling virus (TVMV). In TEV three viral proteases are responsible for processing the precursor polyprotein into intermediate and final products. These are the PI protease, the HC-Pro protease and the NIa protease (Carrington et al., 1989b; Carrington and Dougherty, 1987; Carrington et al., 1990; Verchot et al., 1991). The PI protease is a serine protease, similar to the smaller bacterial serine TEV J PI HC-Pro 6k1 P3 P1-HC-Pro ,1 6k2 Cl N l a V P g g • P3-6k1 i r HC-Pro 6k2-Nla 6k2 or P3 NIa 6k1 Cl 6k2 NlaVPg NIaPro Nib • CP L_AAA precursor NIb-CP Nib CP Fig 1.4 Processing strategy of the tobacco etch virus (TEV) polyprotein. The organization of the TEV genome is shown at the top of the figure. The single long open reading frame is indicated by a box. Horizontal lines at the side of the open reading frame represent non coding regions. Vertical lines through the open reading frame indicate cleavage sites. The domains for the different mature proteins (PI, HC-Pro, P3, 6k l , CI, 6k2, VPg, NIa, Nib, CP) are indicated in the open reading frame. The processing strategy of the polyprotein is shown at the bottom of the figure and include a drawing of the 263kDa precursor polyprotein, the intermediate gene products and the mature proteins. Cleavage sites that are not processed by the NIA protease are indicated by arrows above the open reading frame. 33 proteases. It cleaves autocatalytically once at its own C-terminus (Carrington et al, 1989b; Verchot et al., 1991). The helper component protease (HC-Pro) is a cysteine protease that shares structural similarity to cellular cysteine proteases. It cleaves autocatalytically once at its own C-terminus (Oh and Carrington, 1989). The remaining cleavage events are directed by the 27 kDa NIa protease, which is a serine-like protease similar to the 3C protease of picornaviruses (Carrington and Dougherty, 1987, Dougherty and Parks, 1991). 1.5.3.1 PI protease The PI protease is a 35 kDa protein located at the N-terminal portion of the TEV polyprotein (see Fig. 1.4). It contains two domains. Although its N-terminus shows similarity to the movement protein of other viruses (Domier et al., 1987), PI does not have any of the properties normally associated with movement proteins (Rojas et al., 1997; Verchot and Carrington, 1995b). The PI protease plays a role in the amplification of genomic RNA (Verchot and Carrington, 1995a). The C-terminal domain of the PI protein has a proteolytic activity that allows its autocleavage from the rest of the polyprotein in cis (Verchot et al., 1991). This proteolytic processing event is not essential for replication of the virus (Verchot et al., 1995a). A conserved region, which is required for proteolytic processing, contains motifs associated with serine proteases. Conserved His and Asp residues are present upstream ofthe putative active site Ser although the spacing is different to that of cellular serine proteases. Substitution of His215 or Ser eliminated proteolytic activity indicating that these residues are part of the catalytic triad (Verchot et al, 1991, Verchot and Carrington, 1995b). In TVMV the PI protease cleaves a Phe-Ser cleavage site (Mavankal and Rhoads, 1991). In TEV the processing is at a Tyr-Ser cleavage site (Verchot etal, 1991). 34 1.5.3.2 HC-Pro protease HC-Pro (helper component protease) is expressed as part of the genome derived N-terminal 87 kDa polyprotein (see Fig. 1.4) (Carrington et al., 1989b). The TEV HC-Pro protein is 52 kDa and has two functional domains. The N-terminal domain is essential for aphid transmission of the virus by mediating association of the virus with the insect stylet during transmission (Dougherty and Carrington, 1988). The C-terminal domain has two apparent functions. It is essential for the movement of itself and viral RNA from cell to cell within an infected plant (Rojas et al., 1997). The C-terminal domain also contains a cysteine protease responsible for releasing itself and sequences upstream from the rest of the polyprotein by proteolytic processing at a single cleavage site at the C-terminal end of the protease (Carrington et al, 1989a). Processing at this cleavage site is rapid and occurs co-translationally (Carrington et al., 1990). Deletion experiments demonstrated that only the C-terminal 20 kDa of HC-Pro was required for functional protease activity (Carrington et al., 1989b; Carrington et al., 1990). Further deletions eliminated activity. Site-directed mutagenesis of Cys649 and His772 resulted in a loss of activity suggesting that they constitute the catalytic dyad (Kasschau and Carrington, 1995; Oh and Carrington, 1989). Proteolytic activity of HC-Pro in cis was found to be essential for amplification of the TEV genome (Kasschau and Carrington, 1995). Cleavage site comparisons indicate that HC-Pro has a preference for specific amino acids at its cleavage site (Carrington et al., 1989a; Carrington and Herndon., 1992). It recognizes and processes a single Gly-Gly cleavage site in cis. Amino acid substitutions were used to determine the importance of specific amino acids in defining a functional cleavage site. It was found that HC-Pro has a requirement for Tyr at the -4 position, Leu in the -2 position and Gly in the -1 and +1 positions (Carrington and Herndon, 1992; Kasschau and Carrington, 1995). Substitutions in 35 the -5 and -3 positions allowed proteolytic processing to occur but in a few cases proteolytic processing was reduced. 1.5.3.3 NIa protease The potyvirus NIa protease is located in the central portion of the potyvirus polyprotein (see Fig. 1.4). It shares many structural characteristics with cellular serine proteases (Bazan and Fletterick, 1990; Bazan and Fletterick, 1988; Gorbalenya et al, 1989a). The NIa protease is a serine-like protease similar to the picornaviral 3C protease. Mutagenesis has been used to demonstrate that His 4 6, Asp 8 1 and Cys 1 5 1 make up the catalytic triad of the TEV NIa protease (Carrington and Dougherty, 1988; Dougherty et al., 1989b; Garcia et al, 1990). Substitution of the nucleophilic Cys 1 5 1 with Ser resulted in the retaining of some proteolytic activity but all other mutations resulted in a complete loss of proteolytic activity. This is similar to results found in the mutagenesis of the active site Cys residue of poliovirus 3C protease (discussed above). The NIa protease processes most TEV cleavage sites with the same efficiency whether the protease is part of a larger precursor or not (Parks et al, 1992). However, processing at the 6kl/CI cleavage site was slower when the protease was part of a precursor containing the polymerase (Parks et al, 1992). Regulation of proteolytic processing of the NIa protease occurs at two levels. One level of regulation is at the primary amino acid sequence of the cleavage site (Dougherty and Parks, 1989). Another level of regulation involves subcellular localization dictated by precursor forms of the NIa protease (see below). 1.5.3.3.1 Processing events mediated by the NIa protease and regulation of protease activity The NIa serine-like protease is the major protease involved in the proteolytic processing of potyvirus polyproteins (Allison et al, 1986; Nicolas and Laliberte, 1992; Robaglia et al, 1989; Lain et al, 1989). The proteolytic processing pathway of the TEV polyprotein precursor 36 has been well characterized (see Fig. 1.4). Six primary products are produced by co-translational proteolytic processing of the TEV polyprotein: the Pl-HC-Pro intermediate precursor, the P3-6kl-CI intermediate precursor, the 6k2-NIa precursor or the mature 6k2 plus the NIa intermediate precursor and the Nib-CP precursor (see Fig. 1.4). The Pl-HC-Pro protein is obtained by self-cleavage of HC-Pro at its C-terminus at the junction between HC-Pro and P3. This protein is further processed into PI and HC-Pro by self-cleavage by the PI protease at its C-terminus. The TEV NIa protease cleaves in cis or in trans at all other known cleavage sites. The P3-6kl-CI intermediate precursor is generated by cleavage by NIa at the cleavage site at the Cl-6k2 junction. This protein is further processed by NIa in trans to generate P3, 6kl and CI. NIa cleaves at the NIa-NIb cleavage site and optionally at the 6k2-NIa cleavage site to obtain either the NIb-CP and 6k2-NIa proteins or the NIb-CP, 6k2 and NIa proteins. The Nib-CP precursor protein is further processed by NIa in trans to release the Nib and CP proteins. Self-cleavage of the 6k2-NIa protein produces the 6k2 and NIa proteins. The NIa protein is cleaved in cis to produce the NIaVPg and NIaPro mature proteins. NIaPro also autocatalytically cleaves at one (in TEV) or two (in TuMV) additional cleavage sites at its C-terminus (Himmler et al., 1990; Verchot et al., 1991; Dougherty and Semler, 1993). Processing at the VPg-Pro cleavage site and at the C-terminal cleavage site(s) within NIa is slow and inefficient (Kim et al., 1995; Parks et al., 1995, Kim et al., 1996). Deletion of the C-terminus of NIa does not affect its proteolytic activity (Kim et al., 1998). As stated prviously NIa protease activity is regulated by transport of protease precursors to the nucleus (Carrington et al., 1991). The NIa protease precursor is targeted to the nucleus where it aggregates into an ordered crystal shape referred to as the nuclear inclusion body. However transport of this protein to the nucleus is suppressed during RNA synthesis by interaction of the N-terminal VPg domain of the NIa precursor with viral RNA or other 37 replication proteins (Carrington et al, 1991). In addition, the presence of the 6k2 domain on the 6k2-NIa precursor prevents nuclear localization (Restrepo-Hartwig and Carrington, 1992). The NIa protease is released initially as either the NIa or the 6k2 -NIa precursors. These precursors are formed rapidly during translation. The smaller mature NIa-Pro protein is targeted to the cytosol (Restrepo-Harwig and Carrington, 1992). As mentioned above, the mature NIa protease represents the C-terminal portion of the NIa precursor. Slow processing of the larger precursors into the mature protease, which allows much of the larger precursors to be transported to the nucleus, is required for normal viral replication and is therefore, an important part of regulating protease activity (Shaad et al, 1996). 1.5.3.3.2 Cleavage site specificity Regulation of proteolytic processing by the NIa protease also occurs at the level of the primary sequence of the cleavage sites. A heptapeptide sequence has been implicated in defining a functional TEV NIa protease cleavage site. This was demonstrated by linker insertion experiments (Carrington and Dougherty, 1988) and by site-directed mutagenesis of two TEV cleavage sites (Dougherty et al, 1988, Dougherty et al, 1989a; Dougherty and Parks, 1989). The NIa protease has a strong preference for amino acids at the -6, -4, -3, -1 and +1 positions in TEV protease cleavage sites with a consensus of Glu-x-(Ile,Val,Leu)-Tyr-x-Gln/(Ser,Gly) (see Fig 1.3). Replacement of these conserved amino acids greatly reduced or eliminated cleavage. The Gin in the -1 position was the most sensitive to amino acid substitutions. Any changes at this position either eliminated or drastically reduced the ability of the NIa protease to process the cleavage site. The variable -5 and -2 positions can increase or decrease the rate of proteolytic processing depending on the amino acid present. Other potyviruses have similar but distinct cleavage site requirements. For example the NIa protease of TuMV recognizes cleavage sites with a consensus of x-x-Val-x-His-Gln/(Ser,Ala,Thr) (see Fig. 1.3)(Kim et al, 1996). The NIa 38 protease of clover yellow vein virus (Cl YVV) recognizes cleavage sites with a consensus of x-x- Val-x-Phe- (Gln,Glu)/(Ser, Ala, Giy) (see Fig. 1.3) (Takahashi etal, 1997). Some features of potyvirus cleavage sites are found in the cleavage sites of picornaviruses (as discussed above) and comoviruses (see below). Cleavage is frequently between a Gln/(Gly, Ser) and there is usually an amino acid with a small neutral side chain (Ala, Leu or Val) in the -4 position. Exceptions to this consensus are cleavage sites at the C-terminus of NIa, which are processed at low efficiency (Kim et al, 1996). These cleavage sites are Ser-Gly and Thr-Ser in TuMV and Met-Ser in TEV (Kim et al, 1995; Kim et al, 1996; Parks et al, 1995). A series of hybrid proteases have been constructed to identify residues involved in the substrate specificity of the NIa protease (Parks and Dougherty, 1991). Hybrid proteases were constructed using sequences from TEV and TVMV, which recognized similar but distinct cleavage sites. Three domains (domain I, amino acids 83 to 149, domain II, amino acids 153 to 183 and domain III, amino acids 184 to 210) were found to contain residues important in determining substrate specificity. Amino acids of the catalytic triad were not part of these domains and could be contributed by either virus. By analogy to related 3C-like proteases, a His residue located at position 167 has been suggested as a base component of the putative substrate-binding pocket and probably binds to the Gin residue in the -1 position (Bazan and Fletterick, 1990; Bazan and Fletterick, 1988). This His residue is present on domain II. Several mutations were required in order to change the substrate specificity between the TEV and TVMV proteases. 1.5.4 Comoviruses Comoviruses are positive-sense single-stranded RNA viruses with bipartite genomes (Golbach, 1987; Golbach and Wellink, 1996). They consist of small icosahedral particles. Cowpea mosaic virus (CPMV) is the most characterized member of this class of viruses. Each 39 viral RNA contains a single long open reading frame that allows the production of a polyprotein which is processed into mature products by a single viral encoded protease (see Fig. 1.5). The larger RNA species, B-RNA encodes gene products involved in replication including a 3C-like protease. The smaller RNA, M-RNA codes for a precursor polyprotein containing structural proteins (capsid proteins, CP) and a protein responsible for cell to cell movement (movement protein, MP). Proteases of comoviruses have many similarities to proteases from other viruses of the picorna-like family but are distinct in the regulation of their cleavage efficiency. Proteolytic activity is regulated by another viral protein, the 32 kDa protease co-factor (see below). 1.5.4.1 3C-like protease The comovirus proteases share sequence similarity and have similar activity to the 3C proteases of picornaviruses and NIa proteases of potyviruses (Bazan and Fletterick, 1990; Bazan and Fletterick, 1988; Franssen et al., 1984b; Argos et al., 1984). Sequence analysis and site-directed mutagenesis studies on the 24 kDa protease of CPMV suggested that the catalytic triad of the protease consisted of the residues His40, Glu75 and Cys166 (Bazan and Fletterick, 1988; Dessens and Lomonossoff., 1991; Gorbalenya et al 1989a; Gorbalenya et al., 1989b). The nucleophilic Cys can be replaced with a Ser while retaining some activity but all other substitutions eliminate activity. This is similar to results found with serine-like proteases of other members of the picorna-like supergroup of viruses, as described previously. 1.5.4.1.1 Processing events mediated by the 3C-like protease and regulation of protease activity The B- and M-RNAs are translated into large polyproteins that are processed at specific sites into several intermediate and final cleavage products by the B-RNA encoded 3C-like protease (see Fig. 1.5). This process has been studied extensively for CPMV and sequence 40 C P M V Co-pro B-RNA 32kDa NTB 58kDa VPg Pro Pol 87kDa 24kDa 200 kDa 32 kDa 170 kDa NTB-VPg-Pro Pol NTB-VPg Pro-Pol NTB VPg-Pro-Pol VPg Pro Pol 58 kDa 48 kDa" CP1 95 kDa 60 kDa 60 kDa CP2 .AAA MP CP CP M-RNA-1 1 48/58kDa 37kDa 23kDa 1 105 kDa .AAA Fig 1.5 Processing strategy ofthe cowpea mosaic virus (CPMV) polyprotein. The organization of the CPMV genome is shown at the top of the figure. B-RNA and M-RNA are indicated. The open reading frames are indicated by boxes. Horizontal lines at the sides of the open reading frames represent non coding regions. Vertical lines through the open reading frames represent cleavage sites. The domains for B-RNA and M-RNA are indicated in the open reading frames. The processing strategy of the polyprotein is shown at the bottom of the figure and include a drawing of the B-RNA (200 kDa) and M-RNA (105 and 95 kDa) precursor polyproteins, the B-RNA and M-RNA intermediate gene products and the mature proteins. NTB: protein containing a NTP binding motif, VPg: viral genome linked protein, Pro: protease, Pol: RNA-dependent RNA polymerase, MP: movement protein, CP1: coat protein2, CP2: coat protein2. 4 1 comparisons with other comoviruses suggest similar processing pathways (Beier et al, 1981; Gabriel et al., 1982). The 24 kDa 3C-like protease is the only protease found in comoviruses and is responsible for all proteolytic processing of the viral polyproteins (Garcia et al., 1987; Vos et al, 1988; Verver et al, 1987). The comovirus B-RNA is translated into a 200 kDa polyprotein (see Fig. 1.5). This polyprotein is cleaved co-translationally in cis to produce the 32 kDa (co-Pro) and 170 kDa (NTB-VPg-Pro-Pol) proteins (Pelham, 1979; Peng and Shih, 1984). The 32 kDa protein associates with the 170 kDa precursor by hydrophobic interactions with the NTB domain. This association induces a conformational change of the 170 kDa precursor which limits its rate of proteolytic processing and results in its accumulation (Peters et al, 1992a; Peters et al, 1992b; Franssen et al, 1984a). The 32 and 170 kDa proteins can be derived from different 200 kDa polyproteins but the translations must be simultaneous in order to form a functional complex (Peters etal, 1992a). The 170 kDa protein is further processed by the protease in cis to produce different sets of intermediate polyproteins (see Fig. 1.5). This processing is very efficient when the 32 kDa protein is not present. The 170 kDa precursor can be processed into either the NTB and VPg-Pro-Pol proteins, the NTB-VPg and Pro-Pol proteins or the NTB-VPg-Pro and Pol proteins. The VPg-Pro-Pol protein can be further processed into either the VPg and Pro-Pol proteins or into the VPg-Pro and Pol proteins (Golbach and Wellink, 1996). The Pro-Pol protein is processed inefficiently by the protease at the Pro-Pol cleavage site (Dessens and Lomonossoff, 1992). Cleavage at this site is greatly enhanced by the presence of sequences upstream of the protease domain on the precursor, suggesting that the mature polymerase arises only through direct processing of the 170 kDa protein. The NTB-VPg-Pro protein can be cleaved into either the NTB-VPg and Pro proteins or NTB and Vpg-Pro proteins. The VPg-Pro protein does not 42 accumulate and is rapidly cleaved into VPg and Pro. Studies with cleavage site mutants have shown that all cleavage sites in the B-RNA encoded polyprotein occur predominantly in cis (Peters et al, 1992b). The CPMV 24 kDa protease cannot cleave the NTB-VPg protein in trans (Peters et al., 1992b). This contrasts with the equivalent 3AB poliovirus precursor which is cleaved in trans by the protease. Cleavage between the 32 kDa and the 170 kDa proteins and between the NTB-VPg-Pro and Pol proteins can occur in trans but this is not an efficient process (Vos et al, 1988; Peters et al, 1992b). The M-RNA is translated into the 105 and 95 kDa polyproteins through translation initiation at two alternate AUG codons (see Fig. 1.4) (Rezelman et al, 1989). The 105 and 95 kDa polyproteins are cleaved into the N-terminal 58 or 48 kDa proteins and the C-terminal 60 kDa protein (a precursor to the capsid proteins) at the MP-CP cleavage site (Pelham, 1979; Franssen et al, 1982). Association of the B-RNA encoded 32 kDa protein with the 170 kDa B-RNA encoded precursor is essential to induce efficient cleavage of the M-RNA polyprotein at the MP-CP cleavage site by the protease contained in the 170 kDa precursor (Vos et al, 1988; Peters et al, 1992a). Cleavage of the 60 kDa structural protein precursor into the mature capsid proteins does not require the presence of the 32 kDa protein. This differential regulation of processing at specific cleavage sites is similar to the strategies used in the regulation of processing of poliovirus and flavivirus polyproteins described in sections 1.4.3 and 1.5.2.3.1 in which additional viral proteins were also shown to regulate the activity of the protease (Chambers et al, 1991, Preugschat et al, 1990, Wengler et al, 1991, Ypma-Wong et al, 1988a, see above). This is also similar to the two component processing that was first suggested for capsid maturation in bacteriophage T4 (Showe and Onorato, 1978). 43 1.5.4.1.2 Cleavage site specificity A number of cleavage sites have been identified in the CPMV polyproteins (Franssen et al, 1986; Wellink et al, 1986). Proteolytic processing occurs at specific Gln/Gly, Gln/Ser and Gin/Met cleavage sites. These are very similar to the protease serine-like cleavage sites present in the polyproteins of other members of the picorna-like supergroup of viruses (see Fig. 1.3). When sequences surrounding these cleavage sites were compared, it was found that Ala or Pro are present at the -2 position and that Ala is present in the -4 position at five of the six cleavage sites (Wellink et al, 1986). Comparison of the cleavage sites in the polyproteins from other comoviruses demonstrated similarities to the CPMV sites. A Gin residue was present at the -1 position, Ala and Val residues were found at the -4 position and Ala or Pro residues were found at the -2 position (Golbach and Wellink, 1996). For cowpea severe mosaic virus (CPSMV) and red clover mottle virus (RCMV), Gin/Ala and Gln/Thr cleavage sites have been reported (Shanks and Lomonossoff, 1992; Shanks et al, 1986; MacFarlane et al, 1991; Chen and Bruening, 1992a; Chen and Bruening, 1992b). The role of individual amino acids in defining functional cleavage sites in vitro in the CPMV polyproteins was examined using site-directed mutagenesis. Mutations were introduced at the Gln/Ser site between the B-RNA encoded 32 and 170 kDa proteins. Proteolytic processing at this cleavage site was not prevented when it was changed to a His/Met dipeptide. Proteolytic processing even occurred after insertion of four amino acid residues between the His and the Met, (Peters et al, 1992b). These results indicate that the cleavage site requirements for this efficient in cis cleavage are not stringently determined by the Gln/Ser dipeptide sequence alone. It is believed that the B-RNA polyprotein folds during translation. This folding of the polypeptide chain drives the active site of the 24 kDa protease and the cleavage site together and favors rapid intramolecular cleavage. In contrast, when Giy at the +1 position in the Gln/Gly 44 cleavage site between the capsid proteins was changed to Ala, Ser or Met (amino acids that are present at this position in other sites), cleavage was almost completely abolished (Vos et ah, 1988). It appears that the amino acids in the dipeptide of this M-RNA polyprotein cleavage site are critical in the definition of the cleavage site. This result suggested that requirements for specific amino acids were more stringent for the trans-cleavage site than for the 32/170 kDa cis-cleavage site. This is similar to the regulation for cis- and trans-cleavage previously discussed for the flavivirus NS3 protease and the poliovirus 2A protease (Bartenschlager, et ah, 1995; Hellen et ah, 1992). Similar to proteases of related viruses discussed above, a His in the substrate-binding pocket probably confers the substrate specificity to the protease in trans-cleavage reactions. 1.5.5 Nepoviruses Nepoviruses are small icosahedral viruses that are closely related to the comoviruses (Golbach, 1987; Mayo and Robinson, 1996; Sanfacon, 1995). They infect plants and are primarily transmitted by soil nematodes. Molecularly characterized nepoviruses include grapevine fanleaf virus (GFLV), tomato black ring virus (TBRV) and tomato ringspot virus (TomRSV) (Mayo and Robinson, 1996). Nepoviruses have a bipartite genome consisting of two molecules of positive-sense single-stranded RNA. Each RNA molecule has a single open reading frame that is expressed as a polyprotein, which is processed into the mature products by a viral encoded protease (see Fig. 1.6). RNA-2, which is the smaller RNA, codes for a precursor polyprotein containing structural proteins and a protein responsible for cell to cell movement. RNA-1, which is the larger RNA, encodes gene products involved in replication. 45 GFLV RNA-1. ? 35 kDa NTB CS GE RG j t f M ^ m — p | | Pol L . AAA VPg RNA-2- X MP CP .AAA 28 kDa TomRSV RNA-1 J ? NTB Pol 67 kDa VPg QG RNA-2H x MP CP JKAA 100 kDa Fig. 1.6 Schematic representation of the grapevine fanleaf virus (GFLV) and tomato ringspot nepovirus (TomRSV) RNA-1 and RNA-2. The open reading frames are indicated by the boxes. Horizontal lines beside the open reading frame indicate non coding regions. Vertical lines through the polyprotein indicate known cleavage sites. The sequence of the cleaved dipeptide at the MP-CP, 28K-MP, NTB-VPg, VPg-Pro and Pro-Pol cleavage sites are shown for GFLV. The sequence of the cleaved dipeptide at the MP-CP cleavage site is shown for TomRSV. NTB: protein containing a NTP binding motif, VPg: viral genome linked protein, Pro: protease, Pol: RNA-depedent RNA polymerase, MP: movement protein, CP: coat protein, X:protein X, AAA: poly (A) tail. 1.5.5.1 Nepoviruses subgroup A/B Nepoviruses have been further classified into 3 subgroups (A, B and C) based on the size of their RNA-2 and on their immunological properties (Mayo and Robinson, 1996). 46 Nepoviruses of subgroup A (such as GFLV) and B (such as TBRV) have a smaller RNA-2 than nepoviruses of subgroup C. In nepoviruses of subgroup A/B, a protein of approximately 50 kDa is present upstream of the NTB-VPg-Pro-Pol domains on the RNA-1 encoded polyprotein. Amino acid sequence similarities have been identified between the N-terminal 50 kDa protein of the nepovirus RNA-1 polyprotein and the N-terminal 32 kDa protein of CPMV B-RNA polyprotein, which acts as a protease cofactor (Rott et al., 1995; Vos et al., 1988; Ritzenthaler et al., 1991). However, no experimental evidence is available to suggest a similar role in proteolytic processing of the nepovirus polyproteins. The smaller size of RNA-2 in subgroup A/B nepoviruses is the result of a smaller non-coding region at the 3' end of the RNA and of a smaller coding region. A single mature protein of 30 to 50 kDa is released from N-terminal part of polyprotein, upstream of the movement protein domain (Demangeat et al., 1991; Margis et al, 1993). Proteases of nepoviruses have many similarities to proteases from other picornaviruses but are distinct in their substrate recognition. Cleavage sites recognized by the proteases of subgroups A/B are different from those recognized by the serine-like proteases of other picornaviruses. 1.5.5.1.1 3C-like protease The subgroup A/B nepovirus 3C-like proteases are serine-like proteases similar to the picornavirus 3C protease. Similar to the comovirus proteases described above, the nepovirus proteases are located in the central portion of the RNA-1 encoded polyproteins (see Fig. 1.6). Changing the active site Cys residue of the catalytic triad to Leu in the GFLV protease resulted in a loss of proteolytic activity. However, changing of the active site Cys residue to Ser had no effect (Margis and Pinck, 1992). This is consistent with results found with similar mutations in the serine-like proteases of other picorna and picorna-like viruses except that replacing the Cys with Ser in nepoviruses allowed for even greater retention of proteolytic activity (Margis et ah, 47 1991; Margis and Pinck, 1992). His and Asp (or Glu) residues are thought to be the other members of the catalytic triad of the enzyme (Gorbalenya et al, 1989a). The conserved His residue found in the substrate-binding pocket of the proteases of picornaviruses, potyviruses and comoviruses is not found in the substrate-binding pocket of the proteases of nepoviruses of subgroups A/B. The His residue is replaced by a Leu in these proteases. Changing this Leu residue to a His resulted in a loss of the activity of the GFLV protease (Margis and Pinck, 1992). This indicates that this residue is important for proteolytic processing and possibly for substrate specificity. Indeed, the cleavage sites present on the polyproteins of nepovirus subgroup A/B differ considerably from those of other members of the picornavirus super-group (see below). Proteolytic activity in nepoviruses of subgroup A/B is regulated by differential activities of a variety of protease precursors as will be discussed below. 1.5.5.1.2 Processing events mediated by the 3C-like protease In contrast to the rapid co-translational processing observed in the polyproteins of CPMV and TEV, nepovirus polyproteins are relatively inefficiently cleaved by the protease in vitro (Mayo and Robinson, 1996; Demangeat et al., 1990; Dougherty and Hiebert, 1980; Hemmer, et al., 1995). RNA-1 was shown to encode the protease because RNA-2 polyproteins were cleaved only when RNA-1 translation products were present (Morris-Krsinich et al., 1983; Forster and Morris-Krsinich, 1985). In GFLV, a 253 kDa polyprotein is produced from RNA-1 which is processed by the protease into the intermediate and mature proteins (Margis et al., 1991). Analysis of cDNA clones containing various portions of the RNA-1 encoded polyprotein revealed that VPg-Pro-Pol can catalyze its auto-cleavage to produce the mature polymerase and the VPg-Pro precursor (Margis et al., 1994). Cleavage between VPg and Pro is very inefficient in vitro (Margis et al., 1994). The mature protease or the VPg-protease precursor can cleave the amino terminus of the 48 RNA-1 encoded polyprotein in trans at a cleavage site upstream of the putative NTB-binding protein to release a 45 kDa protein, for which no function has yet been assigned. Both forms of the protease can also cleave the RNA-2 encoded 122 kDa polyprotein. This polyprotein is processed by the protease into the coat protein and a 66 kDa intermediate precursor. The 66 kDa precursor is subsequently processed into the movement protein and a 28 kDa protein of unknown function (Margis and Pinck, 1992). Processing of the RNA-2 polyprotein in trans is efficient in the presence of the protease alone and does not apparently require a protease co-factor (Margis et al., 1991). Efficiency of processing is regulated by the maturation of the protease itself. The mature protease was more effective than the VPg-Pro precursor at processing the RNA-2 polyprotein of GFLV. However, the VPg-Pro precursor was more effective than the mature protease at processing the cleavage site at the N-terminus of the RNA-1 polyprotein (Margis et al., 1994). In TBRV, a 250 kDa polyprotein was found when RNA-1 was translated in vitro (Hemmer, et al., 1995). This polyprotein is cleaved in cis by the 23 kDa protease into several intermediate precursor and mature proteins including a 50 kDa protein (with homology to the 32 kDa Co-Pro of CPMV), the NTB protein and the VPg-Pro-Pol and NTB-VPg-Pro-Pol precursors. The VPg-Pro-Pol precursor is very stable and is not cleaved further in vitro. This precursor was also found to accumulate in TBRV-infected plants (Demangeat et al., 1992). In contrast to GFLV, trans cleavage was not detected in the RNA-1 encoded polyprotein (Hemmer et al., 1995). The VPg-Pro-Pol precursor can cleave the RNA-2 encoded 150 kDa polyprotein in trans. This produces the coat protein and a 96 kDa precursor which is further processed into the movement protein and a 50 kDa protein of unknown function (Demangeat et al., 1991; Demangeat et al., 1992; Hemmer et al., 1995). Protease precursors were found to have different proteolytic activities. Similar to GFLV, the VPg-Pro-Pol and Pro-Pol precursors were able to 49 cleave RNA-2 derived precursors in trans with differential activities. However, unlike GFLV, the RNA-2 precursors were cleaved more effectively by the VPg-Pro-Pol than by the Pro-Pol protein (Hemmer et al., 1995). The presence of other proteins domains on the protease precursors may determine which proteolytic activity is favored at a particular time in virus replication (Mayo and Robinson, 1996). This type of regulation was also found for the poliovirus 3C protease and NS3 protease as described previously (Chambers et al., 1991, Preugschat et al., 1990, Wengler etal, 1991, Ypma-Wong, 1988a). 1.5.5.1.3 Cleavage site specificity Nepovirus subgroup A/B proteases recognize a wide range of dipeptide sequences on their polyproteins (see Fig. 1.7). The characterized dipeptide sequences of nepovirus subgroup A/B cleavage sites include Arg/Gly, Cys/Ala, Cys/Ser, Gly/Glu in the GFLV polyproteins, Arg/Ala in the GCMV polyproteins , Arg/Gly, Cys/Ala in the arabis mosaic virus (ArMV) polyproteins, Cys/Ala in the raspberry ringspot virus (RRSV) polyproteins, Cys/Ala in the tobacco ringspot virus (TRSV) polyproteins and Lys/Ala and Lys/Ser in the TBRV polyprotein. These cleavage sites are different from (Gln,Glu)/(Ser, Gly,Ala) recognized by the serine proteases in picornavirus, potyvirus and comovirus polyproteins (see Fig. 1.3) (Wellink et al, 1986; Margis etal, 1993; Serghini etal, 1990; Pinck etal, 1991; Demangeat etal, 1992; Margis et al, 1993; Hemmer et al, 1995). As mentioned above, the difference in substrate recognition may be the result of replacement of the conserved His with Leu in the proteases of subgroup A/B nepoviruses. However, the presence of this His or Leu residue in the substrate-binding pocket is not the sole factor in determining the cleavage site recognized by the protease. Indeed, the GFLV polyproteins were not cleaved by the RNA-1 translation products of either TRSV or TBRV even though these proteases recognize similar cleavage sites (Morris-Krsinich et al, 1983; NEPOVIRUS SUBGROUP C SEQUENCE REFERENCE TomRSV X-MP TRSNCQ / S t h i s study PRO-POL SFAPCQ / s Wang et al.(1999), t h i s study MP-CP RNSSVQ / G Hans and Sanfacon (1995) VPg-PRO RPQSVQ / G Wang et al. (1999) NTB-VPg GKMTVQ / S Wang et al. (1999) BLMV MP-CP RFTTCN / S Bacher et al. (1994) CLRV MP-CP INLPiQ / s Scott et al. (1993) BRAV MP-CP RFSTCD / s Latvala et al. (1998) NEPOVIRUS SUBGROUP A/B A r M V MP-CP MRTTTR / G B e r t i o l i et al. (1991) -MP STSVCC / A Loudes et al. (1995) TBRV MP-CP SLENiK / A Demangeat et al. (1992) NTB-VPg SAVDIK / A Hemmer et al. (1995) VPg-Pro RYAYAK / S Hemmer et al. (1995) GCMV MP-CP SETNiR / A Brault et al. (1989) RRSV MP-CP ENVPGC / A Blok et al. (1992) GFLV MP-CP LSSTVR / G Serghini et al. (1990) 28K-MP STSVCC / A Margis et al. (1993) NTB-VPg NASIPC / S Pinck et al. (1991) VPg-PRO ISKIRG / E Pinck et al. (1991) PRO-POL SSSFIR / G Pinck et al. (1991) TRSV MP-CP MC / A Buckley et al. (1993) TENTATIVE NEPOVIRUSES SLRSV MP-CP1 GEAEAS / G Kreiah et al. (1994) CP1-CP2 TTLVAS / G Kreiah et al. (1994) SDV CP1-CP2 TSSAQT / S Iwamami et al.(1998) C i M V CP1-CP2 SSSVQT / N Iwanami et al.(1998) N I M V CP1-CP2 TSSVQA / A Iwanami et al.(1998) Fig. 1.7 Comparison ofthe cleavage sites from nepoviruses (subgroups A,B and C). Amino acid sequences from the +1 to the -6 position are compared for cleavage sites of nepoviruses from subgroup C, tomato ringspot virus (TomRSV), blueberry leaf mottle virus (BLMV), cherry leafroll virus (CLRV), mite transmitted blackcurrant reversion associated virus (BRAV); from subgroups A/B, arabis mosaic virus (ArMV), tomato blackring virus (TBRV), grapevine chrome mosaic virus (GCMV), raspberry ringspot virus (RRSV), grapevine fanleaf virus(GFLV) and tobacco ringspot virus (TRSV); and from tentative nepoviruses, strawberry latent ringspot virus (SLRSV), satsuma dwarf virus (SDV), citrus mosaic virus (CiMV) and navel orange infectious mottling virus (NIMV). Amino acids consistent with the picorna-like dipeptide cleavage site consensus in the +1 and -1 positions are underlined. Cys, Val and Leu residues in the -2 position of nepovirus cleavage sites are in italics and bold. 51 Demangeat et al, 1991). Therefore there are probably other factors that play a role in substrate recognition. As discussed above, consensus sequences for 3C-like proteases from related viruses also include amino acids N-terminal of the cleavage sites. However, there does not appear to be any clear consensus sequence for nepovirus subgroup A/B cleavage sites. 1.5.5.2 Nepoviruses of subgroup C TomRSV is the only member of nepovirus subgroup C whose genome has been fully sequenced (Rott et al, 1991b, 1995). The extreme N-terminus of the polyproteins encoded by RNA-1 and RNA-2 are identical for approximately 270 amino acids (Rott et al, 1991a). RNA-1 is 8214 nt in length, excluding a 3' poly(A) tail and contains a single long open reading frame (ORF) of 6591 nt beginning at the first AUG at nucleotide position 78. This is predicted to produce a polyprotein with a molecular mass of 244 kDa. RNA-2 is 7273 nt in length excluding the 3' poly(A) tail and contains a single long ORF of 5646 nt beginning at the AUG at position 78 and terminating at position 5723. This is predicted to produce a polyprotein of 207 kDa. The deduced amino acid sequences of polyproteins from the TomRSV RNA-1 and RNA-2 cDNA sequence have been compared with those of other nepoviruses and comoviruses. Based on sequence homology, the genomic organization of TomRSV RNA-1 and RNA-2 has been predicted (see Fig. 1.6) (Rott et al, 1991b and 1995). The TomRSV coat protein, putative movement protein, protease and VPg have been recently characterized (Hans and Sanfacon, 1995; Sanfacon et al, 1995; Wang et al, 1999; Wieczorek and Sanfacon, 1993). The movement protein co-localizes with tubular structures containing virus-like particles found in or near the cell wall. These tubular structures are probably involved in virus movement from cell to cell (Wieczorek and Sanfacon, 1993). The region of the RNA-2 encoded polyprotein N-terminal of the movement protein is larger for TomRSV than for nepoviruses of subgroups A/B. There is approximately 100 kDa in this region that may include more than one protein. 52 1.5.5.2.1 3C-like protease The TomRSV protease is related to the 3C protease of picorna-like viruses based on sequence homologies (Bazan and Fletterick, 1988; Gorbalenya et al, 1989a). The catalytic triad probably consists of His1283, Asp1354 (or Glu1331) and Cys1433 (numbering of the RNA-1 encoded polyprotein, Rott et al, 1995). Indirect evidence that His may be a member the catalytic triad of the TomRSV protease was provided by amino acid substitution (Hans and Sanfacon, 1995). Substitution of His1283 with Asp resulted in a loss of proteolytic processing. The identity of the other members of the catalytic triad has not been confirmed. The TomRSV protease shows greater overall homology at the amino acid sequence level to proteases from nepoviruses of subgroup A/B than to proteases of comoviruses, picornaviruses or potyviruses. However, the TomRSV protease contains a His residue in its substrate-binding pocket, which is similar to the proteases of picornaviruses, comoviruses and potyviruses rather than the Leu that is present in the substrate-binding pocket of nepoviruses of subgroups A/B. Changing the His to a Leu caused a loss of proteolytic activity (Hans and Sanfacon, 1995). This indicated that this residue is important for proteolytic processing and possibly for substrate specificity (see below). 1.5.5.2.2 Processing events mediated by the 3C-like protease TomRSV RNA-1 and RNA-2 encoded polyproteins are processed into functional intermediate and end products by the RNA-1 encoded protease (Hans and Sanfacon, 1995; Wang et al, 1999). Similar to other nepoviruses and unlike comoviruses, the TomRSV protease can efficiently process a precursor protein, which contains the cleavage site between the movement and the coat protein, without the presence of a co-factor (Hans and Sanfacon, 1995). Processing of precursors at the cleavage sites between the NTB protein and VPg, between the VPg and the protease and between the protease and polymerase was shown in vitro and in E. coli (Wang et 53 al., 1999). However, cleavage between the VPg and protease was very inefficient in E. coli and in vitro resulting in accumulation of the VPg-Pro precursor (Wang et al., 1999). 1.5.5.2.3 Cleavage site specificity There have not been many cleavage sites characterized for subgroup C nepoviruses. When this study was initiated only one TomRSVcleavage site had been identified (Hans and Sanfacon, 1995). Recently a few new TomRSV cleavage sites have been identified (Wang et al., 1999). These cleavage sites were Gln/Gly or Gln/Ser. Protease cleavage sites found recently on the polyproteins of other members of nepovirus subgroup C include, Asn/Ser in the polyprotein encoded by blueberry leaf mottle virus (BLMV) (Bacher et al., 1994), Asp/Ser in the polyprotein encoded by mite-transmitted blackcurrant reversion associated virus (BRAV) (Latvala et al., 1998) and Gln/Ser in the polyprotein encoded by cherry leaf roll virus (Scott et al., 1993). These cleavage sites resemble the picornavirus, comovirus and potyvirus polyprotein cleavage sites (see Fig. 1.7). The Asp and Asn residues in these cleavage sites may play a role similar to Gin and Glu found in the cleavage sites of related viruses. It has been suggested that the presence of the His residue in the substrate-binding pocket is responsible for the TomRSV cleavage sites being more similar to the Gln/(Ser,Gly) consensus of picornaviruses, potyviruses and comoviruses than to those of nepoviruses of subgroups A/B (Hans and Sanfacon, 1995). 1.5.5.3 Cleavage site specificity ofthe proteases of tentative nepoviruses Several tentative nepoviruses have been identified, which include strawberry latent ringspot virus (SLRV), satsuma dwarf virus (SDV), citrus mosaic virus (CiMV) and navel orange infectious mottling virus (NIMV) (Iwanami et al., 1998; Kreiah et al., 1994). These viruses show many similarities to nepoviruses such as similar genomic organization and sequence homology but have two coat proteins (Iwanami et al., 1998; Kreiah et ah, 1994). They have polyproteins containing Ser/Gly, Thr/Ser, Thr/Asn or Ala/Ala cleavage sites, which are 54 different from the picornavirus, potyvirus and comovirus cleavage site consensus and other known nepovirus cleavage sites (see Fig. 1.7). No information is available on the presence of putative amino acids in the substrate-binding pocket of the proteases. 1.6 Summary The purpose of this review was to examine the proteolytic processing that occurs in a number of viral polyproteins. In particular, the proteolytic processing of members of the picorna-like family of viruses is described in detail. These include the picornaviruses, the potyviruses, the comoviruses and the nepoviruses. Particular attention was given to proteolytic processing by the serine-like proteases encoded by these viruses. These include the picornavirus 3C protease, the potyvirus NIa protease, the comovirus 3C-like protease and the nepovirus 3C-like protease. Proteolytic processing of these viruses was discussed from the point view of the various factors that regulate proteolytic processing and of the specificity of the protease substrate interactions. The overall goal of this thesis is to characterize the cleavage site specificity of the TomRSV protease. To realize this goal, this thesis has been designed to achieve the following objectives: (i) To identify cleavage sites on the TomRSV PI and P2 polyproteins in order to expand upon the genomic organization of RNA-1 and RNA-2 and determine if there is a consensus sequence for TomRSV cleavage sites. (ii) To determine the importance of individual amino acids in defining a functional TomRSV cleavage site using site-directed mutagenesis. (iii) To examine whether a TomRSV protease with a substitution of His to Leu in its putative substrate-binding pocket can recognize cleavage sites with similarities to those of nepovirus subgroup A/B. 55 CHAPTER 2 MATERIALS AND METHODS 2.1 Plasmid constructions To construct plasmid pT3X-MP, a 1674 bp EcoRV-Mlul fragment (TomRSV RNA2 nts. 2258-3932) of pMR14 (Rott et al, 1991b) was ligated into the Smal-Mlul site ofthe polylmker of plasmid pMTL 23 (Chambers et al, 1988). A Mlul-Xhol fragment was obtained by digestion of this intermediate plasmid with Mlul and Xhol and was ligated into the corresponding sites of pKS(+) (Stratagene). Restriction enzyme digests and DNA ligation were performed as described by Sambrook et al, 1989 . Plasmids pT7VPg-Pro-N-Pol-II, pT7VPg-Pro H1283D-N-Pol-II and pT7VPg-ProH1451L-N-Pol-II were constructed by ligating a 417 nt BamHl-EcoRI fragment from clone pMRlO (TomRSV RNA-1 nt 4436-4852) with the large BamKl-EcoW fragment of plasmid pTTPro, pT7ProH1283D and pT7ProH1451L (Hans & Sanfacon, 1995). To construct plasmids pT7VPg-Pro-QS"AS-N-Pol-II and pT7VPg-Pro- QM"AM-N-Pol-II, site-directed mutagenesis was performed using mutant oligonucleotides to prime synthesis on single stranded templates of pT7VPg-Pro-N-Pol-II generated by the Ml 3 bacteriophage and enriched with uridine to allow selection of the mutant strand (Kunkel, 1985). Mutations were made simultaneously in single in vitro reactions by adding equimolar amounts of oligonucleotides KC25 and KC26 (see Table 2.6) to pT7VPg-Pro-N-Pol-II single stranded DNA. To construct plasmids pT7VPg-Pro-N-Pol-CAT, pT7VPg-ProH1283D-N-Pol-CAT and pT7VPg-ProH1451L-N-Pol-CAT, a fragment containing the chloramphenicol acetyl transferase (CAT) coding region was amplified from plasmid pCaMVCN (Pharmacia) using oligonucleotides KC53 and KC54 (see Table 2.2.) and the Pfu polymerase (Stratagene). This 56 fragment was digested with Hindlll and Xhol and ligated into the corresponding sites of plasmids pT7VPg-Pro-N-Pol-II, pT7VPg-ProH1283D-N-Pol-II and pT7VPg-ProH145IL-N-Pol-II. To construct the plasmid pT7X-N-Term a 871 nt Smal-Hindlll fragment (TomRSV RNA-1 nts 363-1234) of pMR14 (Rott et al. 1991b) was ligated into the EcoRl-Hindlll site of the poly linker of the plasmid pET21B. The cleaved EcoRI site of plasmid pET21B had been filled in using the Klenow fragment of Poll to create blunt end allowing ligation with the blunt Smal end of the insert. 2.2 Site-directed mutagenesis Mutations were made on the Pro-Pol cleavage site and the X-MP cleavage site at amino acid positions +1,-1, -2, -3, -4, -5 and -6. Mutations of potential pT7X-N-Term cleavage sites were done at the -1 position. Mutations of the corresponding codon on the cDNA clones, pT7X-N-Term, pT3X-MP, pT7VPg-Pro-N-Pol-II and pT7VPg-Pro-N-Pol-CAT were introduced using the Quickchange site-directed mutagenesis kit (PDI Bioscience). Mutagenic primers, corresponding to the region of the TomRSV cleavage site, were 27 to 32 nt in length and contained one or two point mutations in the middle of the sequence (see Tables 2.1., 2.4., 2.5. and 2.6.). Alternatively, in some cases site-directed mutagenesis was performed using mutant oligonucleotides to prime synthesis on single stranded templates of pT7VPg-Pro-N-Pol-CAT or pT3X-MP generated by the Ml 3 bacteriophage and enriched with uridine to allow selection of the mutant strand (Kunkel, 1985) (see Tables 2.1., 2.5. and 2.6.). The presence of the mutations was verified by DNA Sequencing using the T7 Sequencing Kit (Pharmacia). Oligonucleotides KC52 and KC89 were used as sequencing primers for the pT7VPg-Pro-N-Pol-CAT cleavage site mutants, KC59 and KC60 were used as sequencing primers for the pT7X-N-Term cleavage site mutants and KC9 was used as the sequencing primer for the pT3X-MP cleavage site mutants 57 (see Table 2.3). The sequencing primers bound to a region approximately 150 nt upstream of the cleavage site. Oligonucleotides were sythesized using an Oligo 1000M DNA Synthesizer (Beckman). Table 2.1. Oligonucleotides used for the deletion of putative X-MP cleavage sites3 Name Polarity Sequence (5'to 3') Corresponding sequence of RNA-2 KC1 - GTTCCTAGAGAagactgGCAGTTAGAGCG 2865-2893 KC8 - CGAAAAAAGAGAggactgTACTGGGGCAG 2785-2813 a the sequence for nucleotides from the TomRSV sequence that were deleted are indicated in lower case. Table 2.2. Oligonucleotides used to amplify the CAT coding sequence from plasmid pCaMVCN (Pharmacia) Name Sequence (5' to 3') KC53 TTGAAAAGCTTGAGAAAAAAATCACTGGATAT KC54 TATATCTCGAGAAATTACGCCCCGCCC Table 2.3. Oligonucleotides used for sequencing. Name Polarity Sequence (5'to 3') Corresponding TomRSV sequence KC9 + CGTCTGCCCCAGTACAGT RNA-2 2782-2799 KC52 + GCCAGTCTAGTGTTATCAAAT RNA-1 4531-4544 KC59 + GGTACGCCCTGCTTTAA A RNA-2 869-883 KC60 + GGCCGAGTCTCTCCGGAGGCTCAA A RNA-2 821-845 KC89 + GAAGGTGGTTACAAAATCATA RNA-1 4401-4421 Mutation A Q 9 3 4 / S 9 3 5 A Q 9 0 7 / S 9 0 8 Table 2.4. Oligonucleotides used in the site-directed mutagenesis of potential pT7X-N-Term cleavage sites8 Name Polarity Sequence (5' to 3') Corresponding sequence Mutation of RNA-2 KC61 + GAACAGGTCTGAGCCTGTTcaagggGGCTTCTCCCTCCC 959-997 AQM,/GM1 KC62 - GGGAGGGAGAAGCCcccttgAACAGGCTGAGACCTGTTC 959-997 AQ301/G302 KC63 + GTTTATGTCGCTCCCACCGTTcagggtGTGGTGCGCGCTGG 1011-1051 AQ319/G320 KC64 - CCAGCGCGCACCACaccctcAACGGTGGGAGCGACATAAAC 1011-1051 AQ319/G320 a the sequence for nucleotides from the TomRSV sequence that were deleted are indicated in lower case. These nucleotides were not included in the oligonucleotide. 58 Table 2.5. Oligonucleotides used in the site-directed mutagenesis of the X-MP cleavage site" Name Polarity Sequence (5'to 3') Corresponding sequence Mutation of RNA-2 KC15 - G T T C C T A G A G A A G A C G C G C A G T T A G A G C G 2864-2893 Q 9 3 4 t o A KC16 - G T T C C T A G A G A A G A G T T G C A G T T A G A G C G 2864-2893 Q 9 3 4 t o N KC17 - G T T C C T A G A G A A G A C T C G C A G T T A G A G C G 2864-2893 Q 9 3 4 t oE KC18 - G T T C C T A G A G A A G A C C G G C A G T T A G A G C G 2864-2893 Q 9 3 4 toR KC19 - G A G T T C C T A G A G A A G C C T G G C A G T T A G A G 2868-2896 S 9 3 5 t o A KC20 - G A G T T C C T A G A G A A C C C T G G C A G T T A G A G 2868-2896 S 9 3 5 t o G KC21 - G A G T T C C T A G A G A C A T C T G G C A G T T A G A G 2868-2896 S 9 3 5 t o M KC22 - G A G T T C C T A G A G A T T C C T G G C A G T T A G A G 2868-2896 S 9 3 5 t oE KC23 - G A G T T C C T A G A G A A A A C T G G C A G T T A G A G 2868-2896 S 9 3 5 toF KC24 - G A G T T C C T A G A G A A G T C T G G C A G T T A G A G 2868-2896 S 9 3 5 toT KC27 - T A G A G A A G A C T G G G C G T T A G A G C G A G T 2862-2888 C 9 3 3 t o A KC28 - T A G A G A A G A C T G G A C G T T A G A G C G A G T 2862-2888 C 9 3 3 t o V KC29 - T A G A G A A G A C T G G A T G T T A G A G C G A G T 2862-2888 C 9 3 3 toI KC30 - T A G A G A A G A C T G G A G G T T A G A G C G A G T 2862-2888 C 9 3 3 t o L KC31 - T A G A G A A G A C T G G A A G T T A G A G C G A G T 2862-2888 C 9 3 3 toF KC32 - T A G A G A A G A C T G G G G G T T A G A G C G A G T 2862-2888 C 9 3 3 toP KC33 - T A G A G A A G A C T G G C T G T T A G A G C G A G T 2862-2888 C 9 3 3 toR KC34 - T A G A G A A G A C T G G C C G T T A G A G C G A G T 2862-2888 C 9 3 3 t o G KC112 + G T T A C T C G C T C T A A C A T C C A G T C T T C T C T A G G A A C 2859-2893 C 9 3 3 toI KC113 - G T T C C T A G A G A A G A C T G G A T G T T A G A G C G A G T A A C 2859-2893 C 9 3 3 toI KC114 + G T T A C T C G C T C T A A C T T C C A G T C T T C T C T A G G A A C 2859-2893 C 9 3 3 toF KC115 - G T T C C T A G A G A A G A C T G G A A G T T A G A G C G A G T A A C 2859-2893 C 9 3 3 toF KC116 + G T T A C T C G C T C T A A C C T C C A G T C T T C T C T A G G A A C 2859-2893 C 9 3 3 t o L KC117 - G T T C C T A G A G A A G A C T G G A G G T T A G A G C G A G T A A C 2859-2893 C 9 3 3 t o L KC118 + G T T A C T G C G T C T A A C C C C C A G T C T T C T C T A G G A A C 2859-2893 C 9 3 3 toP KC119 - G T T C C T A G A G A A G A C T G G G G G T T A G A G C G A G T A A C 2859-2893 C 9 3 3 toP KC120 + G T T A C T C G C T C T A A C C G C C A G T C T T C T C T A G G A A C 2859-2893 C 9 3 3 toR KC121 - G T T C C T A G A G A A G A C T G G C G G T T A G A G C G A G A A C 2859-2893 C 9 3 3 toR KC122 + G T T A C T C G C T C T A A C G G C C A G T C T T C T C T A G G A A C 2859-2893 C 9 3 3 t o G KC123 - G T T C C T A G A G A A G A C T G G C C G T T A G A G C G A G T A A C 2859-2893 C 9 3 3 t o G KC150 + G T T A C T C G C T C T T C C T G C C A G T C T T C T C 2859-2886 N 9 3 2 toS KC151 - G A G A A G A C T G G C A G G A A G A G C G A G T A A C 2859-2886 N 9 3 2 toS KC152 + G T T A C T C G C T C T G C C T G C C A G T C T T C T C 2859-2886 N 9 3 2 t o A KC153 - G A G A A G A C T G G C A G G C A G A G C G A G T A A C 2859-2886 N 9 3 2 t o A KC154 + G T T A C T C G C T C T C C C T G C C A G T C T T C T C 2859-2886 N 9 3 2 toP KC155 - G A G A A G A C T G G C A G G G A G A G C G A G T A A C 2859-2886 N 9 3 2 toP KC156 + C T T T G T T A C T C G C G C T A A C T G C C A G T C T T C 2855-2884 S 9 3 , t o A KC157 - G A A G A C T G G C A G T T A G C G C G A G T A A C A A A G 2855-2884 S 9 3 l t o A KC158 + C T T T G T T A C T C G C A C T A A C T G C C A G T C T T C 2855-2884 S 9 3 1 to T KC159 - G A A G A C T G G C A G T T A G T G C G A G T A A C A A A G 2855-2884 S 9 3 ' to T KC160 + C T T T G T T A C T C G C T T C A A C T G C C A G T C T T C 2855-2884 S 9 3 1 t o F KC161 - G A A G A C T G G C A G T T G A A G C A A G T A A C A A A G 2855-2884 S 9 3 1 t o F KC162 + C C C T T T G T T A C T G C C T C T A A C T G C C A G 2853-2879 R 9 3 0 t o A KC163 - C T G G C A G T T A G A G G C A G T A A C A A A G G G 2853-2879 R 9 3 0 t o A KC164 + C C C T T T G T T A C T A G C T C T A A C T G C C A G 2853-2879 R 9 3 0 toS KC165 - C T G G C A G T T A G A G C T A G T A A C A A A G G G 2853-2879 R 9 3 0 toS KC166 + C C C T T T G T T A C T T T C T C T A A C T G C C A G 2853-2879 R 9 3 0 t o F KC167 - C T G G C A G T T A G A G A A A G T A A C A A A G G G 2853-2879 R 9 3 0 t o F 59 Table 2.5 Continued Name Polarity Sequence (5'to 3') Corresponding sequence Mutation of RNA-2 KC168 + GTATCCCCTTTGTTTCTCGCTCTAACTGC 2848 •2876 T 9 2 9 toS KC169 - GCAGTTAGAGCGAGAAACAAAGGGGATAC 2848 -2876 T929toS KC170 + GTATCCCCTTTGTTCGTCGCTCTAACTGC 2848 •2876 T929toR KC171 - GCAGTTAGAGCGACGAACAAAGGGGATAC 2848 •2876 T929toR KC172 + GTATCCCCTTTGTTGCTCGCTCTAACTGC 2848 •2876 T929toA KC173 - GCAGTTAGAGCGAGCAACAAAGGGGATAC 2848 •2876 T 9 2 9 toA KC180 + CGCTCTAACTGCTGCTCTTCTCTAGGAAC 2865 -2893 Q 9 3 4 toC KC181 - GTTCCTAGAGAAGAGCAGCAGTTAGAGCG 2865 -2893 Q 9 3 4 toC KC182 + CGCTCTAACTGCAAGTCTTCTCTAGGAAC 2865 -2893 Q 9 3 4 toK KC183 - GTTCCTAGAGAAGACTTGCAGTTAGAGCG 2865 •2893 Q 9 3 4 toK KC184 + CGCTCTAACTGCGGCTCTTCTCTAGGAAC 2865 -2893 Q 9 3 4 toG KC185 - GTTCCTAGAGAAGAGCCGCAGTTAGAGCG 2865 •2893 Q 9 3 4 toG KC186 + CTCTAACTGCCAGGGCTCTCTAGGAACTC 2867 -2895 S935 toG KC187 - GAGTTCCTAGAGAGCCCTGGCAGTTAGAG 2867 •2895 S935 toG KC188 + CTCTAACTGCCAGGCTTCTCTAGGAACTC 2867 -2895 S935 toA KC189 - GAGTTCCTAGAGAAGCCTGGCAGTTAGAG 2867 -2895 S935 toA KC190 + CTCTAACTGCCAGTTCTCTCTAGGAACTC 2867 -2895 S935 toF KC191 - GAGTTCCTAGAGAGAACTGGCAGTTAGAG 2867 -2895 S935 toF KC192 + CTCTAACTGCCAGGAGTCTCTAGGAACTC 2867 -2895 S935 toE KC193 - GAGTTCCTAGAGACTCCTGGCAGTTAGAG 2867 -2895 S935 toE a The three nucleotides coding for the mutated amino acid are underlined. Table 2.6 Oligonucleotides used in the site-directed mutagenesis of the Pro-Pol cleavage site" Name Polarity Sequence (5'to 3') Corresponding Mutation sequence of RNA-1 KC25 + TTTGCTCCTTGCGCGTCTAGTGTTATC 4521-4547 Q , m toA KC26 + GTTGATGGAGTGGCGATGCCAAGATAC 4458-4484 Q 1 4 6 5 toA KC35 + TTTGCTCCTTGCAACTCTAGTGTTAT 4521-4546 Q , 486toN KC36 + TTTGCTCCTTGCAGGTCTAGTGTTAT 4521-4546 Q1486toR KC37 + TTTGCTCCTTGCGAGTCTAGTGTTAT 4521-4546 Q1486toE KC38 + GCTCCTTGCCAGGCTAGTGTTATCAAA 4524 -4550 S ,487 toA KC39 + GCTCCTTGCCAGGGTAGTGTTATCAAA 4524 -4550 S l487toG KC40 + GCTCCTTGCCAGATGAGTGTTATCAAA 4524-4550 S , 487toM KC41 + GCTCCTTGCCAGGAAAGTGTTATCAAA 4524 -4550 S , 487 toE KC42 + GCTCCTTGCCAGTTTAGTGTTATCAAA 4524 -4550 S , 487 toF KC43 + GCTCCTTGCCAGACTAGTGTTATCAAA 4524 -4550 S , 487 toT KC44 + TCTTTTGCTCCTGCCCAGTCTAGTGTT 4518-4543 C 1 4 8 5 toA KC45 + TCTTTTGCTCCTGTCCAGTCTAGTGTT 4518-4543 C 1 4 8 5 toV KC46 + TCTTTTGCTCCTATCCAGTCTAGTGTT 4518-4543 C 1 4 8 5 toI KC47 + TCTTTTGCTCCTCTCCAGTCTAGTGTT 4518-4543 C 1 4 8 5 toL KC48 + TCTTTTGCTCCTTTCCAGTCTAGTGTT 4518-4543 C , 4 8 5 toF KC49 + TCTTTTGCTCCTCCCCAGTCTAGTGTT 4518-4543 C , 4 8 5 toP KC50 + TCTTTTGCTCCTCGCCAGTCTAGTGTT 4518-4543 C , 4 8 5 toR 60 Table 2.6 Continued Name Polarity Sequence (5' to 3') Corresponding sequence of RNA-1 Mutation Q1486 n 1 4 8 6 KC51 + TCTTTTGCTCCTGGCCAGTCTAGTGTT 4518-4543 KC78 + CTTTTGCTCCTTGCAGGTCTAGTGTTATC 4519-4547 KC79 - GATAACACTAGACCTGCAAGGAGCAAAAG 4519-4547 KC80 + GCTCCTTGCCAGGCTAGTGTTATCAAATC 4524-4552 KC81 - GATTTGATAACACTAGCCTGGCAAGGAGC 4524-4552 KC82 + GCTCCTTGCCAGGGTAGTGTTATCAAATC 4524-4552 KC83 - GATTTGATAACACTACCCTGGCAAGGAGC 4524-4552 KC85 + GCTCCTTGCCAGTTTAGTGTTATCAAATC 4524-4552 KC86 - GATTTGATAACACTAAACTGGCAAGGAGC 4524-4552 KC87 + GCTCCTTGCCAGATGAGTGTTATCAAATC 4524-4552 KC88 - GATTTGATAACACTCATCTGGCAAGGAGC 4524-4552 KC96 + GCTCCTTGCCAGACTAGTGTTATCAAATC 4524-4552 KC97 - GATTTGATAACACTAGTCTGGCAAGGAGC 4524-4552 KC98 + CTTCTTTTGCTCCTGCCCAGTCTAGTGTTATC 4516-4547 KC99 - GATAACACTAGACTGGGCAGGAGCAAAAGAAG 4516-4547 KC100 + CTTCTTTTGCTCCTGTCCAGTCTAGTGTTATC 4516-4547 KC101 - GATAACACTAGACTGGACAGGAGCAAAAGAAG 4516-4547 KC102 + CTTCTTTTGCTCCTATCCAGTCTAGTGTTATC 4516-4547 KC103 - GATAACACTAGACTGGATAGGAGCAAAAGAAG 4516-4547 KC104 + CTTCTTTTGCTCCTCTCCAGTCTAGTGTTATC 4516-4547 KC105 - GATAACACTAGACTGGAGAGGAGCAAAAGAAG 4516-4547 KC106 + CTTCTTTTGCTCCTTTCCAGTCTAGTGTTATC 4516-4547 KC107 - GATAACACTAGACTGGAAAGGAGCAAAAGAAG 4516-4547 KC108 + CTTCTTTTGCTCCTCCCCAGTCTAGTGTTATC 4516-4547 KC109 - GATAACACTAGACTGGGGAGGAGCAAAAGAAG 4516-4547 KC110 + CTTCTTTTGCTCCTAGGCAGTCTAGTGTTATC 4516-4547 KC111 - GATAACACTAGACTGCCTAGGAGCAAAAGA AG 4516-4547 KC124 + CTTCTTTTGCTCCTGGCCAGTCTAGTGTTATC 4516-4547 KC125 - GATAACACTAGACTGGCCAGGAGCAAAAGAAG 4516-4547 KC126 + CTTCTTTTGCTTCTTGCCAGTCTAGTGTTATC 4516-4547 KC127 - GATAACACTAGACTGGCAAGAAGCAAAAGAAG 4516-4547 KC128 + CTTCTTTTGCTGCTTGCCAGTCTAGTGTTATC 4516-4547 KC129 - GATAACACTAGACTGGCAAGCAGCAAAAGAAG 4516-4547 KC130 + CTTCTTTTGCTAATTGCCAGTCTAGTGTTATC 4516-4547 KC131 - GATAACACTAGACTGGCAATTAGCAAAAGAAG 4516-4547 KC132 + GATTATTCTTCTTTTTCTCCTTGCCAGTCTAG 4509-4540 KC133 - CTAGACTGGCAAGGAGAAAAAGAAGAATAATC 4509-4540 KC134 + GATTATTCTTCTTTTACTCCTTGCCAGTCTAG 4509-4540 KC135 - CTAGACTGGCAAGGAGTAAAAGAAGAATAATC 4509-4540 KC137 - CTAGACTGGCAAGGGAAAAAAGAAGAATAATC 4509-4540 KC138 + GATTATTCTTCTTCCGCTCCTTGCCAGTCTAG 4509-4540 KC139 - CTAGACTGGCAAGGAGCGGAAGAAGAATAATC 4509-4540 KC140 + GATTATTCTTCTGCTGCTCCTTGCCAGTCTAG 4509-4540 KC141 - CTAGACTGGCAAGGAGCAGCAGAAGAATAATC 4509-4540 KC142 + GATTATTCTTCTAGGGCTCCTTGCCAGTCTAG 4509-4540 KC143 - CTAGACTGGCAAGGAGCCCTAGAAGAATAATC 4509-4540 s . 4 8 7 g.487 gl487 g.487 s , 4 8 7 gl487 s , 4 8 7 s , 4 8 7 c'4 8 5 C 1485 c1 4 8 5 ^,1485 c , 4 8 5 toG to R toR to A to A toG to G toF toF to M to M toT toT to A to A to V to V to I C , 4 8 5 toI C , 4 8 5 toL C 1 4 8 5 toL C , 4 8 5 toF C 1 4 8 5 toF C , 4 8 5 toP C 1 4 8 5 toP C 1 4 8 5 toR C 1 4 8 5 toR C 1 4 8 5 toG C 1 4 8 5 toG P l 4 8 4 toS P 1 4 8 4 toS P , 4 8 4 toA P 1 4 8 4 toA P 1 4 8 4 toN P 1 4 8 4 toN A 1 4 8 3 toS A 1 4 8 3 toS A , 4 8 3 toT A 1 4 8 3 toT A , 4 8 3 toF A 1 4 8 3 toF F , 4 8 2 toS F 1 4 8 2 toS F , 4 8 2 toA F 1 4 8 2 toA F 1 4 8 2 toR F 1 4 8 2 toR 61 Table 2.6 Continued Name Polarity Sequence (5'to 3') Corresponding Mutation sequence of RNA-1 KC144 + C C C G A T T A T T C T A C T T T T G C T C C T T G C C A G 4506-•4535 S 1 4 8 ' t o T KC145 - C T G G C A A G G A G C A A A A G T A G A A T A A T C G G G 4506--4535 S , 4 8 1 t o T KC146 + C C C G A T T A T T C T C G T T T T G C T C C T T G C C A G 4506-•4535 S 1 4 8 1 t o R KC147 - C T G G C A A G G A G C A A A A C G A G A A T A A T C G G G 4506--4535 S 1 4 8 1 t o R KC148 + C C C G A T T A T T C T G C T T T T G C T C C T T G C C A G 4506--4535 S , 4 8 , t o A KC149 - C T G G C A A G G A G C A A A A G C A G A A T A A T C G G G 4506 -4535 S I 4 8 , t o A KC174 + C T T T T G C T C C T T G C T G C T C T A G T G T T A T C 4519--4547 Q 1 4 8 6 t o C KC175 - G A T A A C A C T A G A G C A G C A A G G A G C A A A A G 4519--4547 Q 1 4 8 6 t o C KC176 + C T T T T G C T C C T T G C A A C T C T A G T G T T A T C 4519--4547 Q 1 4 8 6 t o K KC177 - G A T A A C A C T A G A C T T G C A A G G A G C A A A A G 4519-•4547 Q 1 4 8 6 t o K KC178 + C T T T T G C T C C T T G C G G C T C T A G T G T T A T C 4519--4547 Q , 4 8 6 t o G KC179 - G A T A A C A C T A G A G C C G C A A G G A G C A A A A G 4519--4547 Q , 4 8 6 t o G The three nucleotides coding for the mutated amino acid are underlined . 2.3 In vitro translation and proteolytic processing Expression of the wild-type and mutated pT7VPg-Pro-N-Pol-CAT cDNA clones in vitro was performed using the TNT coupled transcription/translation system (Promega). Translation products were generated from 0.5 u.g of plasmid DNA and were labelled with [35S]-methionine for 30 min at 30°C. Translation was arrested by adding 5 units of RNase A (Promega). The translation products were further incubated at 20°C in the presence of 0.1 M Tris-HCl pH 8.0 to allow proteolytic processing. Reactions were arrested by the addition of an equal volume of 2X protein sample buffer (Laemmli, 1970) For protease dilution experiments, the translation products were diluted using 0.1 M Tris-HCl pH 8.0. Run-off transcripts were synthesized from 10 ug of pT7X-N-Term (linearized with HindUl) or pT3X-MP (linearized with Mlul) plasmids using bacteriophage T7 or T3 RNA polymerase (Gibco BRL) respectively, as described previously (Hans and Sanfacon, 1995). The transcripts were resuspended in 10 ul of distilled H2O. In vitro translation of 1 ul of transcripts was performed using the rabbit reticulocyte lysate system (Promega) as described (Hans and 62 Sanfacon, 1995). The translation reactions were arrested by the addition of 5 units of RNase A (Promega). To allow processing of the translation products, exogenous protease was added to the translation mixture. The source of added protease was either cold translation products of clones pT7VPg-Pro-N-Pol-II, pT7VPg-Pro-N-Pol-CAT or pT7VPg-ProH1451L-N-Pol-CAT (translations were performed as described above but in the presence of unlabelled methionine) or recombinant protease purified from E. coli (see below). Proteolytic processing was allowed to proceed by incubation at 20°C and was arrested by the addition of an equal volume of 2X protein sample buffer (Laemmli, 1970). Recombinant active protease was purified from the expression products of plasmid pET15bVPgPro-N-Pol essentially as described previously (Wang et al., 1999). Upon expression, the protease was insoluble. Solubilization of the protease from the purified inclusion bodies with urea and renaturation of the protease by gradual dialysis was as described (Wang et al, 1999). Purified protease was stored in TRIS 50 mM pH8, 1 mM DTT, 10% glycerol at -70°C. 2.4 Quantification of the processing reaction. To measure the amount of proteolytic processing at the wild type and mutant cleavage sites, time-course experiments were conducted. The precursors and cleaved products were separated using 12% SDS-PAGE and the gels were scanned using a Storm 860 phosphor imager (Molecular Dynamics). The amount of radioactivity in individual bands was measured using ImageQuant (Molecular Dynamics). The cpm values were adjusted for the number of methionines present in each protein and the percentage of precursor that was converted to the cleaved product was calculated at each time point. This percentage was calculated taking into account the 58 kDa precursor and the 28 kDa cleaved product for pT7VPg-Pro-N-Pol-CAT and the 63 and 43 kDa precursors and the 38 kDa cleaved product for pT3X-MP. 63 2.5 N-terminal microsequencing of radiolabeled peptides For microsequencing of the 38 kDa cleaved product resulting from the processing of the 63 and 43 kDa precursor products, pT3X-MP transcripts were translated in vitro in the presence of [ H] leucine (NEN) and processed with purified recombinant protease as described above. The translation products were separated using SDS-PAGE. The region of the gel corresponding to the position of the 38 kDa protein was excised. The protein was electro-eluted from the gel slices, transferred to a PVDF membrane using a Pro-Spin column (Applied Biosystems) and subjected to microsequencing (Protein Microsequencing Laboratory, Department of Biochemistry and Microbiology, University of Victoria, Victoria, Canada). For microsequencing of the polymerase, in vitro translation of clone pT7VPg-Pro-N-Pol-II was performed in the presence of 3H-Leu (NEN) and the products were separated by SDS-PAGE. The region of the gel corresponding to the position of the mature polymerase was excised. Elution of the protein from the gel was as above. 2.6 Immunoprecipitation Immunoprecipitation of 35S-methionine labelled translation products was performed as previously described (Hans and Sanfacon, 1995). Ascites fluid (lul) containing a monoclonal antibody against the movement protein (MP antibody) (Wiezcorek and Sanfacon, 1993), protease (pro antibody) (Wang et al., 1999) or lul of purified polyclonal antibodies against the VPg (VPg antibody) (Wang et al., 1999) was added to the [35S]-methionine labelled translation products. 64 Polyclonal antibodies were raised against a fusion protein (MP-His) consisting of the C-terminal 31 kDa of MP followed by six histidines. The MP-His fusion protein was purified from the expression products of plasmid pET-MP essentially as described previously (Wang et al., 1999). One additional step of purification on a nickel column was performed prior to protein renaturation as described by the supplier (Novagen). One mg of this purified protein was used to inject rabbits intramuscularly as described (Sanfacon et al., 1995). Immunoprecipitations of [35S]-methionine labelled translation products with G-Sepharose CL 4B (Sigma) beads were performed essentially as described (Hans and Sanfacon, 1995). 65 CHAPTER 3 IDENTIFICATION AND CHARACTERIZATION OF TOMATO RINGSPOT NEPOVIRUS CLEAVAGE SITES IN VITRO. 1 3.1 Introduction As a first step towards the study of the cleavage site specificity of the TomRSV protease, three new TomRSV cleavage sites were localized. One of these cleavage site was encoded by RNA-1 and was located between the protease and polymerase (Pro-Pol cleavage site). The other two cleavage sites were encoded by RNA-2. One of,these cleavage sites was at the N-terminus of the TomRSV movement protein (X-MP cleavage site) while the other was in the uncharacterized region N-terminal of the movement protein. The Pro-Pol and X-MP cleavage sites were identified and characterized in vitro. Comparison of these cleavage sites with other TomRSV cleavage sites previously characterized revealed the presence of conserved amino acids at the -2, -1 and +1 positions. 3.2 Results 3.2.1 Identification and characterization ofthe cleavage site between the protease and polymerase. To study cleavage at the Pro-Pol site in vitro plasmid pT7VPg-Pro-N-Pol-II was created to contain the coding region for VPg, Pro and the amino terminal 12 kDa of Pol fused at its C-terminus to some fortuitous amino acids from the vector (Fig. 3.1). Translation products were 1 Part of this chapter is contained in the following publication and part has been accepted for publication: (a) Wang, A., Carrier, K., Chisholm, J., Wieczorek, A., Huguenot, C. and Sanfacon, H. 1999. Proteolytic processing of tomato ringspot nepovirus 3C-like protease precursors: Definition of the domains for the VPg, protease and putative RNA-dependant RNA polymerase. Journal of General Virology 80:799-809. (b) Carrier, K., Hans, F. and Sanfacon, H. 66 generated using a coupled transcription/translation rabbit reticulocyte system in the presence of [35S]-methionine (see Materials and Methods). Separation of the translation products on SDS-polyacrylamide gels allowed the visualization of a protein with an apparent molecular mass of 50 kDa which corresponded to the predicted size for the precursor polyprotein (3 kDa VPg, 27 kDa Pro, 12 kDa Pol, 6 kDa vector sequences). The translation was arrested by the addition of RNase A (see Materials and Methods) and the labelled precursor was incubated at 20 °C to allow proteolytic processing in cis. Upon incubation of the wild-type precursor two new proteins were produced with apparent molecular masses of 30 kDa (which corresponds to the predicted size for VPg-Pro) and 22 kDa (Fig. 3.1b, lane 2). N-terminal microsequencing of the 22 kDa protein indicated that it was the polymerase moiety (predicted molecular mass: 18 kDa) (see below). This protein was not always detected probably because of its instability. As a control, a mutant derivative was also constructed, which contained a mutation in the putative catalytic triad of the protease (pT7VPg-ProH1283D). This mutation was previously shown to inactivate the protease (Hans and Sanfacon, 1995). Appearance of the two smaller proteins was not observed with this mutant, demonstrating that these proteins were produced by the TomRSV protease. The VPg-Pro intermediate did not undergo further cleavage under the conditions used. Indeed, a protein of 27 kDa (the expected size for the mature protease) was not detected. Upon examination of the sequence at the C-terminus of the protease domain (i.e. at the Pro-Pol junction), two potential cleavage sites were identified at the residues Q 1 4 6 5 /M (predicted by Rott et al., 1995) and Q1486/S. To identify the cleavage site, mutagenesis of the two potential cleavage sites was performed on plasmid pT7VPg-Pro-N-Pol-II resulting in plasmids pT7VPg-Pro-QS"AS-N-Pol-II (Q in position 1486 mutated to A) and pT7VPg-Pro-QM"AM-N-Pol-II (Q in position 1465 mutated 1999. Mutagenesis of amino acids at two tomato ringspot nepovirus cleavage sites: Effect on proteolytic processing in cis and in trans by the 3C-like protease, (accepted to Virology pending minor modifications). 67 P1 AUG 3kDa VPg NTB Pro I Pol 12kDa 6kDa op ,48kDa 30kDa 18kDa Wt H-D Q S - A S Q M - A M kDa 0 20 0 20 0 20 0 20 hr 66 — 45 — 31 — kWkm" WH* -4— VPg-Pro-N-Pol ism <- VPg-Pro 2 1 1 2 3 4 5 6 7 8 Fig 3.1 Identification ofthe Pro-Pol cleavage site (a) Schematic representation of the cDNA clone encoding the VPg-Pro-N-Pol-II precursor, which contains the Pro- Pol cleavage site. The entire PI polyprotein encoded by TomRSV RNA-1 is represented on the top of the figure. The regions encoding the putative NTP-binding protein (NTB), the VPg protein (VPg), the protease (Pro) and the putative RNA-dependant RNA polymerase (Pol) are shown. The region of the PI polyprotein contained in plasmid pT7VPg-Pro-N-Pol-II is indicated by the dotted lines. Plasmid pT7VPg-Pro-N-Pol-II is shown below the PI polyprotein. The open reading frames are indicated by boxes, and the bacteriophage T7 promoter is represented by the circle. The coding regions for the different TomRSV protein domains (as above) are shown along with the predicted molecular mass of each domain and the 6 kDa region encoded by the PKS(+) vector. The Pro-Pol cleavage site is indicated by the arrow-head. The predicted translation products are shown at the bottom of the figure before (48 kDa precursor) and after (30 and 18 kDa cleaved products) processing by the endogenous protease, (b) Effect of mutations of predicted cleavage sites on proteolytic processing. [S35]methionine-labelled in vitro translation products of clones pT7VPg-Pro-N-Pol-II (wt: containing the wild type protease), pT7VPg-Pro H 1 2 8 3 D -N-Pol-II (H-D: containing the inactive protease), pT7VPg-Pro-QS"AS-N-Pol-II (QS-AS: containing a mutation at the Q 1 4 8 6 - S 1 4 8 7 predicted cleavage site) and pT7VPg-Pro-Q M"A M-N-Pol-Il (QM-AM: containing a mutation at the Q 1 4 6 5 - M 1 4 6 6 predicted cleavage site) were separated on 12% polyacrylamide-SDS gels and visualized as described in Materials and Methods. The incubation times are indicated above each lane as hours after incubation. The positions of the 48 kDa precursor and of the VPg-Pro and N-Pol cleavage products are indicated on the right side of the gel. Positions of the molecular mass markers are indicated on the left side of the gel. 68 to A). Only the 50 kDa precursor was observed in the radio-labelled polypeptides generated from pT7VPg-Pro-QS"AS-N-Pol-II (Fig. 3.1b, lanes 5 and 6) indicating that processing did not occur in this mutant. In contrast, the 50 kDa precursor and the 30 and 22 kDa cleavage products could be visualized from clone pT7VPg-Pro-QM'AM-N-Pol-II (Fig. 3.1b, lanes 7-8). These results suggest that Q1486/S corresponds to the Pro-Pol cleavage site. To directly sequence the N-terminal portion of Pol, in vitro translation of clone pT7VPg-Pro-N-Pol-II was performed in the presence of H- leucine and the 22 kDa protein was subjected to microsequencing. The presence of a single peak of radioactivity at residue 7 was consistent with the first amino acid of Pol beingS1487 (Fig. 3.2). 3 00 S S V I K S L I Q E A G V E E R Amino Acid Residue Fig 3.2 N-terminal microsequencing ofthe N-pol protein isolated from the maturation products of the VPg-Pro-N-Pol-II precursor. The 22 kDa product corresponding to the N-Pol was labelled with tritiated leucine, isolated from the gel and subjected to microsequencing as described in Materials and Methods. The amount of radioactivity measured in the fractions collected at each cycle of the Edman degradation products is show in C P M . The amino acid sequence shown below corresponds to the amino acid sequence of the TomRSV RNA -2 polyprotein starting at S 1 4 8 7 located immediately downstream of the putative Q 1 4 8 6 /S cleavage site. Cleavage of the VPg-Pro-N-Pol-II precursor released two products: the VPg-Pro intermediate precursor and the N-Pol fragment, which was very unstable and often not detectable. To stabilize the N-Pol fragment and improve the quantification of processing at the Pro-Pol cleavage site, a new plasmid was constructed which contained the chloramphenicol 69 acetyl transferase (CAT) coding region fused in frame at the C-terminal end of the polymerase fragment (plasmid pT7VPg-Pro-N-Pol-CAT, see Fig. 3.3a). The presence of the VPg protein on the precursor has been shown to enhance cleavage at the Pro-Pol site (Wang et al., 1999). The VPg protein was therefore included on the VPg-Pro-N-Pol-CAT precursor to ensure optimal processing at the Pro-Pol site. Upon coupled transcription/translation in vitro of this new plasmid a protein with an apparent molecular mass of 58 kDa corresponding to the expected size for the VPg-Pro-N-Pol-CAT precursor was produced (Fig. 3.3b). Incubation of the wild-type precursor resulted in the production of two new proteins with apparent molecular masses of 30 and 28 kDa corresponding to the expected sizes for the VPg-Pro and the Pol-CAT cleaved products (Fig. 3.3b, lanes 1-7). Polyclonal antibodies raised against the VPg and monoclonal antibodies raised against the protease (Wang et al., 1999) could immunoprecipitate the 58 kDa precursor and the 30 kDa protein but not the 28 kDa protein, confirming that the 30 kDa protein is the VPg-Pro cleaved product (see Fig. 3.4). Proteins smaller than the 30 kDa VPg-Pro precursor were not immunoprecipitated by the monoclonal antibodies against the protease suggesting that cleavage at the VPg-Pro site was not detectable in the pT7VPg-Pro-N-Pol-CAT precursor. This was similar to results shown above with the VPg-Pro-N-Pol II precursor. The 30 and 28 kDa proteins were not observed upon incubation of a precursor containing an inactive protease (Fig. 3.3b, lanes 8 to 14), indicating that they were produced by proteolytic cleavage through the action of the endogenous protease present in the precursor. Labeling of the 28 kDa protein was more intense than that of the 30 kDa protein due to the presence of a much larger number of methionine residues in the 28 kDa protein. Proteolytic processing of the wild-type precursor at the Pro-Pol site was quantified by measuring the percentage of the 58 kDa precursor converted to either the 28 kDa cleaved product or the 30 kDa protein (Fig. 3.5). The two curves were similar at the early time points and differed slightly at later time points probably due to the relative 70 P1 VPg NTB AUG T7 stop 3kDa CAT 25kDa 3RTJa~ 58kDa b 30kDa WT 28kUa HD Mutant 0 .25 .5 1 2 4 16 0 .25 .5 1 2 4 16 hr 58 kDa— 66 kDa 30 kDa 28 kDa— mm i l l 45 kDa i — 31 kDa 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Fig 3.3 Construction of the VPg-Pro-N- Pol-CAT precursor and proteolytic processing at the Pro-Pol cleavage site in vitro, (a) Schematic representation of the cDNA clone encoding the VPg-Pro-N- Pol-CAT precursor, which contains the Pro- Pol cleavage site. The entire PI polyprotein encoded by TomRSV RNA-1 is represented on the top of the figure. The regions encoding the putative NTP-binding protein (NTB), the VPg protein (VPg), the protease (Pro) and the putative RNA-dependent RNA polymerase (Pol) are shown. The region of the PI polyprotein contained in plasmid pT7VPg-Pro-N-Pol-CAT is indicated by the dotted lines. Plasmid pT7VPg-Pro-N-Pol-CAT is shown below the PI polyprotein. The open reading frames are indicated by boxes, and the bacteriophage T7 promoter is represented by the circle. The coding regions for the different TomRSV protein domains (as above ) and for the choramphenicol acetyl transferase protein (CAT) are shown along with the predicted molecular mass of each domain. The Pro- Pol cleavage site is indicated by the arrow-head. The predicted translation products are shown at the bottom of the figure before (58 kDa precursor) and after (30 and 28 kDa cleaved products) processing by the endogenous protease, (b) Time course processing of pT7VPg-Pro-N-Pol-CAT precursor in vitro. Processing was tested in precursors containing a wild-type protease (WT) or a protease mutated in the catalytic triad (HD mutant) as described in Materials and Methods. The translation products were separated on a 12% SDS- polyacrylamide gel. The time of incubation of the different samples is indicated above each lane (hr: hours). The expected position of the precursor and cleaved products are indicated on the left side of the gel. Positions of the molecular mass markers are indicated on the right side of the gel. 71 Fig 3.4 Immunoprecipitation of the pT7VPg-Pro-N-Pol-CAT translation products. The translation mixtures were loaded on a 12% polyacrylamide gel either before (lane 1) or after immunoprecipitation with antibodies raised against the VPg (lane 2) or the protease (lane 3). The locations of the predicted 58 kDa precursor and the 30 kDa and 28 kDa cleaved products are indicated on the left side of the gel. Fig 3.5 Time course of processing of the V P g - P r o - N - P o l - C A T precursor into the 30 kDa or the 28 kDa cleaved products. Percentage of conversion of the pT7VPg-Pro-N-Pol-CAT precursor to the 30 kDa or 28 kDa product was calculated as described in Materials and Methods. Both curves originated from a single processing experiment. 72 stability of the two products. The 28 kDa product, which seemed more stable and was labelled more intensly, was used in further calculations of processing efficiency. The reaction rate remained linear for approximately 30 min and reached a plateau after 2 to 4 hours. After 4 hours of incubation, 70 to 80% of the precursor was converted to the 28 kDa cleaved product (Fig. 3.5, Fig. 3.6 and Fig. 3.7a). Fifty percent of this maximum conversion occurred after approximately 15 min (Fig. 3.6). To determine whether processing at the Pro-Pol cleavage site by the endogenous protease was predominantly in cis or in trans, a dilution experiment was conducted. The pT7VPg-Pro-N-Pol-CAT translation products were diluted in 0.1 M Tris-HCl, pH 8.0. The endogenous protease was able to process the Pro-Pol cleavage site at an equivalent rate at all the dilutions tested (lx, lOx, lOOx, Fig. 3.7a) suggesting that proteolytic cleavage at the Pro-Pol site was predominantly an intramolecular (in cis) event under the conditions tested. To confirm that the Pro-Pol cleavage site could not be processed by the protease in trans, mutated pT7VPg-Pro-N-Pol-CAT precursors containing inactive proteases were incubated in the presence of exogenous TomRSV protease. The source of exogenous protease was recombinant purified protease, which was shown to be active on RNA-2 encoded cleavage sites (see below). Two different precursors were tested that contained a mutation in the catalytic triad (described above) and in the substrate-binding pocket (His1451 mutated to Leu)(Hans and Sanfacon, 1995). The two mutated precursors containing inactive proteases did not undergo proteolytic processing (Fig. 3.7b, lanes 2 and 4). This was consistent with previous observations (Hans and Sanfacon, 1995; Wang et al, 1999). Addition of the exogenous protease to these precursors did not result in any processing of the precursors (Fig. 3.7b, lanes 3 and 5). 73 Fig 3.6 Time course of processing of the VPg-Pro-N-Pol-CAT precursor at early time points. Percentage of conversion of the pT7VPg-Pro-N-Pol-CAT precursor to the 2 kDa product was calculated as described in Materials and Methods. The arrow indicates the percent of conversion at the 15 min (0.25 hr) time point. U30kDa L28kDa 1 2 3 4 5 Fig. 3.7 Intramolecular processing at the Pro-Pol cleavage site in vitro, (a) Time course of processing of the VPg-Pro-N-Pol-CAT precursor at different dilutions. After translation, the samples were diluted as indicated in 0.1 M Tris-HCl pH 8.0. Percentage of conversion of the VPg-Pro-N-Pol-CAT precursor to the 28 kDa cleaved product was calculated as described in Materials and Methods, (b) Analysis of the processing of precursors containing a defective protease in the presence or absence of exogenous protease. VPg-Pro-N-Pol-CAT precursors containing a wild-type (WT) or mutated protease (HD and HL) were incubated for 4 hrs after translation in the presence (+Pro) or absence of recombinant protease purified from E. coli. (HL: protease mutated in the substrate-binding pocket; HD: protease mutated in the catalytic triad). 75 3.2.2 Identification and characterization of the cleavage site at the N-terminus of the movement protein. To identify the cleavage site at the N-terminus of the movement protein, cDNA clone pT3X-MP was constructed. This plasmid includes the coding region for the N-terminal portion of MP and the C-terminal portion of the protein immediately upstream of MP (protein X) under the control of the T3 RNA promoter (Fig. 3.8 and 3.9a). In vitro translation of run-off transcripts derived from this plasmid, resulted in the production of small amounts of a protein with an estimated molecular mass of 63 kDa, which corresponded to the expected size for the X-MP precursor (Fig. 3.9b, lane 1). A predominant protein of approximately 43 kDa was also observed (Fig. 3.9b, lane 1). Examination of the sequence in the coding region of protein X revealed the presence of one alternate AUG codon in an optimal context for translation initiation according to the criteria established by Kozak (1987). Initiation at this codon would result in the production P2 X MP CP T7 38 kDa VS T3 25kDa MP 38kDa pT7X-N-Term pT3X-MP Fig 3.8 Schematic diagram of the partial cDNA clones derived from TomRSV RNA-2. The entire P2 polyprotein encoded by TomRSV RNA-2 is represented on the top of the figure. The regions encoding a protein of unknown function (X), the movement protein (MP) and the coat protein (CP) are shown by boxes. The regions of the P2 polyprotein contained in plasmid pT3X-MP and pT7X-N-Term are indicated by the dotted line. The open reading frames are indicated by boxes, and the bacteriophage T7 and T3 promoters are represented by the circles. Vector sequences (VS) consisting of 2 kDa fortuitous amino acids from the vector fused to the TomRSV protein sequence are shown by the grey box. The coding regions for the different TomRSV protein domains (as above) are shown along with the predicted molecular mass of each domain. 76 MP Abs I P2 MP CP AUG AUG T3 MP Abs X 25 kDa MP 38 kDa _ I 5/25 kDa : 43/63 kDa •38 kDa b Purified E. coli Protease Protease produced in vitro 0 .25 .5 1 2 4 16 0 .25 .5 1 2 4 16hr 63k Da _ f l , _ ^ /# * % —45 kDa 43k Da * art. -»» s«1 flip Jjjlp." flflflflt i WmWm ' PJP ' 38k D a - * H i H A ^ — 31 kDa 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Fig 3.9 Construction of the X-MP precursor and proteolytic processing at the X-MP cleavage site in vitro, (a) Schematic representation of the cDNA clone encoding the X-MP precursor, which contains the X-MP cleavage site. The entire P2 polyprotein encoded by TomRSV RNA-2 is represented on the top of the figure. The regions encoding a protein of unknown function (X), the movement protein (MP) and the coat protein (CP) are shown. The region of the P2 polyprotein contained in plasmid pT3X-MP is indicated by the dotted line. Plasmid pT3X-MP is shown below the P2 polyprotein. The open reading frames are indicated by boxes, and the bacteriophage T3 promoter is represented by the circle. The coding regions for the different TomRSV protein domains (as above) are shown along with the predicted molecular mass of each domain. The X-MP cleavage site is indicated by the arrow-head. Two AUG codons are shown, the second of which may be responsible for the production of the 43 kDa precursor through internal initiation. The rectangles shown above the MP domains in the P2 and X-MP precursor represent the region of the MP against which polyclonal antibodies were raised (MP Abs, see Materials and Methods). The predicted translation products are shown at the bottom of the figure before (63 and 43 kDa precursor) and after (38, 25 and 5 kDa cleaved products) processing by the exogenously supplied TomRSV protease (b) Time course of processing of the pT3X-MP precursor in vitro. Processing was tested on precursors using TomRSV protease purified from E. coli (lanes 1 to 7) or produced in vitro (lanes 8 to 14) as described in Materials and Methods. The translation products were separated on 12% SDS-polyacrylamide gel. The time of incubation of the different samples is indicated above each lane (hr: hours). The position of the precursors and cleaved products is indicated on the left side of the gel. The positions of the molecular mass markers are indicated on the right side of the gel. 77 of a precursor containing a region of protein X with an estimated size of 5 kDa followed by the entire MP region (estimated size: 38 kDa) (see Fig. 3.9a). Immunoprecipitation experiments with polyclonal antibodies raised against the C-terminal 31 kDa of MP (Fig. 3.9a) confirmed that both the 43 and 63 kDa proteins contained this region of MP (Fig. 3.10 ). 63 kDa 43 kDa 38 kDa translation TO 2hF MP Abs 0 hr 2 hr 1 2 3 4 Fig 3.10 Immunoprecipitation of pT3X-MP translation products. Radio labelled pT3X-MP precursors were matured with protease and samples were taken at 0 and 2 hr time points. The translation mixtures were loaded on a 12% polyacrylamide gel either before (lanes 1 and 2) or after immunoprecipitation with antibodies raised against the movement protein (lanes 3 and 4). The locations of the 63 and 43 kDa precursor and the 38 kDa cleaved products are indicated on the left side of the gel. To test for the presence of the X-MP cleavage site in the 63 and 43 kDa precursors, exogenous TomRSV protease was added to the translation products of plasmid pT3X-MP. The source of protease was either purified recombinant TomRSV protease or from cold translation products obtained from plasmids pT7VPg-Pro-N-Pol-II or pT7VPg-Pro-N-Pol-CAT. Upon addition of either protease, the amount of the predominant 43 kDa precursor decreased over time while a new protein with an estimated molecular mass of 38 kDa which corresponded to the expected size for the MP cleaved product, was produced (Fig. 3.9b). The nature of the 38 kDa 78 protein was confirmed by immunoprecipitation with polyclonal antibodies raised against the C-terminal half of MP (Fig. 3.10) and by microsequencing of its N-terminus (see below). The large amount of 38 kDa protein produced indicated that it was released mainly from the 43 kDa precursor. An additional protein with an estimated molecular mass of 25 kDa was also occasionally detected in very low amounts (Fig. 3.11a, lane 2). The estimated size of this protein corresponded to the expected size for the cleaved product of the X protein (Fig. 3.9a). This protein was predicted to be produced from the 63 kDa precursor but not from the 43 kDa precursor. Therefore, cleavage of the 63 kDa precursor was likely to contribute to a small extent to the production of the 38 kDa product. For quantification ofthe processing efficiency, the percentage of conversion of the 63 and 43 kDa precursors to the 38 kDa product was calculated as described in Material and Methods. Very similar results were obtained when only the 43 kDa precursor was included in the calculation (Fig. 3.12). As expected from a cleavage site recognized in trans, the efficiency of proteolytic processing was dependent upon the dilution of the exogenously supplied protease (data not shown). To allow meaningful comparison of cleavage at the Pro-Pol and X-MP sites, the concentration of protease added to the X-MP precursor was adjusted to obtain kinetics similar to those observed for the cis cleavage in the pT7VPg-Pro-N-Pol-CAT precursor (Fig. 3.13). Under those conditions, the reaction rate remained linear for approximately 30 min with a maximum of conversion of the precursors to the product of approximately 85%. Similar to the pT7VPg-Pro-N-Pol-CAT cleavage kinetics, half of this maximum conversion occurred after approximately 15 min (Fig. 3.13). Upon examination of the amino acid sequence in the region N-terminal of the movement protein, two potential cleavage sites were predicted: Q907/S and Q934/S. Mutants of pT3X-MP were obtained in which the Gin and the Ser were deleted from each of these potential cleavage sites (pT3X-MPAQ907/S908 and pT3X-MPAQ934/S935) resulting in a Ser residue occupying the -1 WT AQ 9 0 7 /S 9 0 8 AQ 9 3 4 /S 9 3 5 Protease * - 63kDa ••Iii h43kDa h 38kDa -25kDa b 1400 1200 § 1 0 0 0 •g "co £ 800 CD ° - 600 H Q_ O 400 200 H 1 2 3 4 5 6 o j ; , , , , , , , 1 S S L G T P G L N V H T I H Q E Amino Acid Residue Fig. 3.11 Identification ofthe X-MP cleavage site, (a) Effect of mutations of predicted cleavage sites on proteolytic processing in vitro. Translation products from the wild-type pT3X-MP precursor (WT) or from two mutant derivatives including a deletion of the Glu and Ser at the -1 and +1 positions in the predicted Q 9 0 7/S 9 0 8 (AQ9°7/S908) and Q 9 3 4/S 9 3 5 (AQ934/S935) cleavage sites were incubated in the presence (+) or absence (-) of purified recombinant protease. The [35S]-methionine labelled translation products were separated using 12% SDS-PAGE. (b) N-terminal microsequencing of the 38 kDa cleaved product released from the maturation of the wild-type X-MP precursor with TomRSV protease. The protein was labelled with [3H]-leucine, extracted from the acrylamide gel and subjected to Edman degradation as described in Materials and Methods. The amount of radioactivity measured in the fractions collected at each cycle of the Edman degradation procedure is shown in CPM. The amino acid sequence shown below corresponds to the amino acid sequence of the TomRSV RNA-2 polyprotein starting at S935 located immediately downstream of the putative Q934/S cleavage site. 80 T i m e ( m i n ) F i g 3.12 T i m e c o u r s e of p r o c e s s i n g o f t h e 63 a n d 43 k D a X - M P p r e c u r s o r s by r e c o m b i n a n t protease p u r i f i e d f r o m E. coli. Percentage of conversion of the p T 3 X - M P precursors to the 38 kDa product was calculated as described in Materials and Methods. The amount of proteolytic processing is shown with and without the 63 kDa precursor band included in the calculations. Both curves originated from a single processing experim ent. 90 o 4 , , , , , 1 0 5 0 1 0 0 1 5 0 2 0 0 2 5 0 3 0 0 Time (min) Fig 3.13 Time course of processing ofthe X-MP precursors by recombinant protease purified from E. coli at early time points. Percentage of conversion of the pT3X-MP precursors to the 38 kDa product was calculated as described in Materials and Methods. The arrow indicates the percentage of conversion at the 15 min time point. 81 position for both cleavage sites. When protease purified from E. coli was added to the pT3X-MPAQ907/S908 mutant translation products, processing of the 63 and 43 kDa precursors into the 38 and 25 kDa cleaved products was observed (Fig. 3.11a, lanes 3 and 4). However, when the purified protease was added to the pT3X-MPAQ934/S935 mutant translation products, processing of the 63 or 43 kDa precursors was not detected (Fig. 3.11a, lanes 5 and 6). This suggested that Q934/S was the X-MP cleavage site. To further confirm the nature of the cleavage site, translation of the wild-type clone pT3X-MP was performed in the presence of [3H]-leucine, then recombinant protease was added and the 38 kDa cleaved product was eluted from the SDS polyacrylamide gel and subjected to Edman degradation. The presence of two peaks of radioactivity at amino acid positions 3 and 8 is consistent with S935 being the first amino acid of the 38 kDa cleaved product (Fig. 3.11b). 3.2.3 Localization of a cleavage site in the N-terminal region of the RNA-2 encoded polyprotein The N-terminal region of the RNA-2 encoded polyprotein, i.e. the region upstream of the movement protein, has not been characterized so far. To determine if there was a cleavage site in this region of the polyprotein, cDNA clone pT7X-N-Term was constructed. This plasmid includes the N-terminal portion of the coding region of the protein upstream of MP (protein X) with approximately 2 kDa of fortuitous amino acids from the vector fused to its N-terminus under the control of the T7 RNA promoter (Fig. 3.8 and 3.14a). In vitro translation of run-off transcripts derived from this plasmid, resulted in the production of a protein with an estimated molecular mass of 34 kDa, which corresponded to the expected size for the precursor (Fig. 3.14b, lane 1). To test for the presence of a cleavage site in the 34 kDa precursor, purified recombinant TomRSV protease was added to the translation products of plasmid pT7X-N-Term. After maturation with the protease a new protein with an estimated molecular mass of 24 kDa 82 a P2 X MP CP A U G / T7 38 kDa 38 kDa b 24kDa or 16kDa 14 kDa 24 kDa Protease A Q 3 2 8 /G 3 2 9 + WT A Q 3 2 8 /G 3 2 9 AQ 3 4 6 /G 3 4 7 A 0 3 4 6 /G 3 4 7 + " - + - + - + kDa —66 kDa 38kDa —45 kDa —31 kDa 24kDa— —21 kDa 1 2 3 4 5 6 7 8 Fig 3.14 Processing at a third cleavage site on the P2 polyprotein. (a) Schematic representation of the cDNA clone encoding the pT7X-N-Term precursor, which contains the cleavage site. The entire P2 polyprotein encoded by TomRSV RNA-2 is represented on the top of the figure. The regions encoding a protein of unknown function (X), the movement protein (MP) and the coat protein (CP) are shown. The region of the P2 polyprotein contained in plasmid pT7X-N-Term is indicated by the dotted line. Plasmid pT7X-N-Term is shown below the P2 polyprotein. The box indicates the open reading frame, and the circle shows the bacteriophage T7 RNA promoter. The region encoding 38 kDa of the X protein is shown. The arrows show two potential Q / G cleavage sites. The predicted translation products are shown before (38 kDa precursor) and after (14 and 24 kDa cleaved products) processing by the protease, (b) Effect of mutations of predicted cleavage sites on proteolytic processing in vitro. Translation products from the wild-type precursor or three mutant derivatives including a deletion in the Glu and Giy of the -1 and +1 positions in the predicted Q 3 2 8 /G 3 2 9 ( A Q 3 2 8 / G 3 2 9 ) and Q 3 4 6 / G 3 4 7 (AQ / G 3 4 7 ) cleavage sites and a double mutant of both cleavage sites (AQ 3 2 8/G 3 2 9 + A Q 3 4 6 /G 3 4 7 ) were incubated in the presence (+) or absence (-) of purified recombinant protease. The [35S]-methionine labelled translation products were separated using 12%SDS-PAGE. was produced (Fig. 3.14b, lane 2). This suggested that there was a cleavage site in this region. However, processing at this cleavage site was inefficient and only small amounts of the 24 kDa protein were produced. Upon examination of the amino acid sequence in the region of protein X, two potential cleavage sites were predicted: Q3 0 1/G and Q3I9/G. Mutants of pT7X-N-Term were obtained in which Gin and Gly was deleted from either one of these potential cleavage sites (pT7X-N-TermAQ301/G302, pT7X-N-TermAQ319/G320) resulting in Gly and Val occupying the -1 positions of both these cleavage sites respectively. When protease purified from E. coli was added to these mutant translation products, processing of the two mutated 34 kDa precursor into the 24 kDa cleaved product was observed (Fig. 3.14, lanes 3 to 6). Therefore, deletion of the Gin and Gly at either potential cleavage site did not prevent processing of the 34 kDa precursor. To eliminate the possibility that one of these cleavage sites was an alternate cleavage site for the other, a new mutant precursor was created in which both predicted cleavage sites were mutated (plasmid pT7X-N-TermAQ301/G302+AQ319/G320 ). This new precursor was also processed into the 24 kDa product (Fig. 3.14 lanes 7 to 8). The small amounts of the 24 kDa protein produced did not allow direct N-terminal microsequencing of this protein that would have allowed the identification of the cleavage site. 3.3 Discussion 3.3.1 Consensus sequence for TomRSV cleavage sites. In this study two TomRSV protease cleavage sites have been characterized in vitro: the Pro-Pol cleavage site (determined to be Q/S) and the X-MP cleavage site (determined to be Q/S). The identity of these two cleavage sites was compared to that of other previously identified cleavage sites (Hans and Sanfacon, 1995, Wang et al, 1999). Conserved amino acids in 84 TomRSV cleavage sites are Gin at the -1 position and Ser or Giy at the +1 position. This is similar to amino acids found in the cleavage sites of como-, poty- and picornaviruses and of one other nepovirus of subgroup C (blueberry leaf mottle virus, BLMV; see Fig. 1.7) but not to those found in cleavage sites of nepoviruses of subgroup A/B. A Cys or Val residue can be found in the -2 position of all identified TomRSV cleavage sites and of all other nepoviruses of subgroup C cleavage sites characterized so far (see Fig. 1.7). These amino acids are also found in the -2 position of some of the cleavage sites of nepoviruses of subgroup A/B. Based on these results a TomRSV cleavage site consensus is proposed, which consists of (Cys,Val)-Gln/(Ser,Gly) (see Table 3.1). The importance of these amino acids must be confirmed by site-directed mutagenesis (see Chapter 4). The quantitative proteolytic assays described in this chapter can be used to address this question. Table 3.1 Comparison of the amino acid sequence surrounding TomRSV polyprotein cleavage sites. Conserved amino acids are shown in bold. Cleavage Site Amino acid -6 -5 -4 -3 -2 -1 / +1 +2 +3 +4 MP-CP (RNA-2)a Arg Asn Ser Ser Val Gin Giy Giy Ser Trp X-MP (RNA-2) Thr Arg Ser Asn Cys Gin Ser Ser Leu Giy NTB-VPg (RNA-l)b Giy Lys Met Thr Val Gin Ser Thr Ile Pro VPg-Pro (RNA-1 )c Pro Arg Gin Ser Val Gin Giy Ser Ser Leu Pro-Pol (RNA-1) Ser Phe Ala Pro Cys Gin Ser Ser Val Ile a Cleavage site between the movement and the coat protein (Hans and Sanfacon, 1995). — b Cleavage site between the nucleotide binding protein and VPg (Wang et al, 1999). 0 Cleavage site between the VPg and protease (Wang et al., 1999). 3.3.2 Intramolecular processing at the Pro-Pol cleavage site. Under the experimental conditions used, processing at the Pro-Pol cleavage site was predominantly an intramolecular event in vitro. Two lines of evidence were presented to indicate that trans-cleavage did not occur at this site. First, the rate of processing was independent of the concentration of protease. Second, precursors containing defective protease 85 were not cleaved upon the addition of exogenous protease. Similarly, Pro-Pol sites of other picorna-like viruses are also cleaved in cis. These include poliovirus (Palmenberg and Rueckert, 1982; Hanecak et al., 1984), TBRV (Hemmer et al., 1995), grapevine fanleaf virus (Margis et al, 1994), CPMV (Peters et al, 1992) and TEV (Carrington and Dougherty, 1987). In poliovirus, it was found that although the cleavage is predominantly a cis event early in infection when the concentration of the protease is low, it can become a trans event late in infection (Palmenberg and Rueckert, 1982; Hanecak et al, 1984). Although we could not detect trans-cleavage in vitro under the conditions tested, we cannot exclude the possibility that it could occur late in infection. 3.3.3 Genomic organization of TomRSV RNA-2: Detection of a novel cleavage site in the N-terminal region of the RNA-2 encoded polyprotein in vitro. The results presented here provide new information on the genomic organization of TomRSV RNA-2. Identification of the cleavage site at the N-terminus of the movement protein presented here and previous identification of the cleavage site between the movement protein and the coat protein (Hans and Sanfacon, 1995) allows the precise localization of the movement protein. Based on these results the movement protein has a predicted molecular mass of 44 kDa and is located between amino acid S935 and Q 1 3 2 0 (RNA-2 numbering, Rott et al, 1991b). In addition, our results indicate the presence of a third unidentified cleavage site in the N-terminal portion of the RNA-2 encoded polyprotein suggesting that at least two mature proteins are released from this region of the polyprotein. This is the first report of a cleavage site in the N-terminal region of the RNA-2 encoded polyprotein for any nepovirus. Indeed, in the characterized GFLV and TBRV subgroup A/B nepoviruses, only one protein was released from this region of the polyprotein (Margis et al, 1993; Demangeat etal, 1991). Nepoviruses of subgroup C contain a larger coding region in RNA-2 than nepoviruses of subgroup A/B. This 86 extended coding capacity is at the N-terminus of the polyprotein (100 kDa upstream of the MP for nepoviruses of subgroup C compared to 30 to 50 kDa in the same region for nepoviruses of subgroup A/B). Our results raise the possibility that other nepovirus of subgroup C may also produce more than one protein from this region of the polyprotein. The putative function of proteins released from the N-terminal half of the P2 polyprotein remains unknown. It is possible that these proteins are involved in nematode transmission as suggested by Rott et al. (1991b). Interestingly, the first of these proteins at the extreme N-terminus of the polyprotein contains the region of homology to RNA-1. An additional cleavage site was also found in the N-terminal region of the RNA-1 encoded polyprotein and was also located downstream of this region of homology (Wang, 1999). The RNA-1 and RNA-2 encoded N-terminal proteins may play a common accessory role in replication perhaps in directing the replication complex to the appropriate RNA, as suggested for the RNA-2 encoded 58 kDa protein of comoviruses (Peters et al., 1992a). The two precursors studied here (pT3X-MP and pT7X-N-Term) represent a large portion of the N-terminal region of the RNA-2 encoded polyprotein, however, there is a region of approximately 35 kDa which has not been examined (see Fig. 3.8). Therefore we cannot exclude the possibility that other cleavage sites are present in this area in addition to the one we have described here. We were unable to construct other plasmids containing this part of the RNA-2 polyprotein coding sequence for in vitro studies despite numerous attempts. It is possible that this particular region of the P2 polyprotein is toxic to the E. coli strains used. Attempts made to study this region by expressing truncated regions of the full length RNA2 cDNA clone were also ineffective because of the presence of a large amount of background bands probably caused by internal initiation in the in vitro translation system. 87 To confirm that the cleavage site detected in vitro is also used in vivo, immunodetection of the corresponding viral proteins in infected plants is necessary. Attempts were made to express fusion proteins containing this region of the RNA-2 encoded polyprotein to generate antibodies but failed because of toxicity problems. Polyclonal antibodies were raised against a synthetic peptide that corresponded to a predicted antigenic domain in the region immediately upstream of the movement protein. However, this antibody did not immunoprecipitate the X-MP precursor containing the corresponding TomRSV protein (data not shown). Site-directed mutagenesis of two predicted cleavage sites in the X-N-term precursor failed to eliminate proteolytic processing. One possibility is that cleavage did occur at one of the two potential cleavage sites, but that deletion of the conserved Gin and Gly at the -1 and +1 positions did not prevent proteolytic processing. This seems unlikely however, as these cleavage sites are processed in a trans fashion. Our results presented in the following chapter suggest that the requirement for a Gin at the -1 position of another TomRSV /rara-cleavage site is very stringent. Another possibility is that the cleavage site present in the 34 kDa precursor is between a different dipeptide than the Q/S or Q/G cleavage sites identified. Examination of the sequence did not reveal the presence of other potential cleavage sites corresponding to the consensus identified in this study. Cleavage of the X-N-term precursor is inefficient and it is therefore possible that the dipeptide cleaved differs from the consensus. In potyviruses, inefficient cis-cleavage sites present at the C-terminus of the NIa protease were shown to differ considerably from the consensus for cleavage sites recognized by this protease (Kim et al., 1995; Kim et al., 1996; Parks etal, 1995). 88 CHAPTER 4 SITE-DIRECTED MUTAGENESIS OF TWO TOMATO RINGSPOT NEPOVIRUS CLEAVAGE SITES2 4.1. Introduction Five TomRSV cleavage sites have been identified so far (Hans and Sanfa§on, 1995; Wang et al, 1999, Chapter 3). Cleavage occurred at Q/G and Q/S dipeptides. In addition, a Cys or Val residue was found at the -2 position of these cleavage sites (Wang et al, 1999; see Fig. 1.6). Other amino acids did not appear to be conserved. The importance of conserved amino acids on proteolytic processing of cleavage sites from nepoviruses and comoviruses has not been systematically studied. In this chapter, a site-directed mutagenesis study was conducted on two cleavage sites (the Pro-Pol cleavage site recognized in cis and the X-MP cleavage site recognized in trans) to test the importance of amino acids from the -6 to the +1 position in determining a functional TomRSV cleavage site. 4.2. Results 4.2.1. Site-directed mutagenesis of the Pro-Pol cleavage site. Amino acid substitutions in the -6 to +1 positions of the Pro-Pol and X-MP cleavage sites were introduced into the VPg-Pro-N-Pol-CAT and X-MP precursors, respectively. Time-course experiments were performed on each mutant as described in Chapter 3. Kinetic analysis of each mutant was performed in parallel with the corresponding wild-type precursor at least three times 2 Part of this chapter has been accepted for publication: Carrier, K., Hans, F and Sanfacon, H. 1999. Mutagenesis of amino acids at two tomato ringspot nepovirus cleavage sites: effect on proteolytic processing in cis and in trans by the 3C-like protease, (accepted to Virology pending minor modifications). 89 and a representative experiment is shown. Processing efficiency of the mutated cleavage sites was compared to that of the wild-type at the 15 min time point. As mentioned in Chapter 3, at this time, the rates of processing of the wild-type X-MP and VPg-Pro-N-Pol-CAT precursors at the X-MP and Pro-Pol cleavage sites were linear. Kinetics of processing of the Pro-Pol cleavage site for each individual mutant are shown in Fig. 4.1a. Relative efficiency of processing of the mutant cleavage sites compared to that of the wild-type cleavage site at the 15 min time point is shown in Fig. 4.2a. Substituting Ser at the +1 position of the Pro-Pol cleavage site had a variable effect on processing efficiency. Substitutions with Gly, Ala or Thr did not appear to influence the kinetics of proteolytic processing. In contrast, substitution with Met, Phe or Glu resulted in a significant reduction in proteolytic processing. After a 15 min incubation, processing of precursors with an introduced Met and Phe at the +1 position was approximately 30 and 20% that of wild type precursor, respectively. Very little processing (if any) was detected for the Glu mutant. Mutation of Gin at the -1 position by substituting any of the amino acids tested (Asp, Glu, Lys, Ala and Arg) resulted in a significant reduction in proteolytic processing. After a 15 min incubation, processing efficiency was approximately 30, 10 and 10% that of wild-type for the Lys, Glu and Asn mutants, respectively. Very little processing (if any) was detected for the Ala and Arg mutants. Substitution of Cys at the -2 position had a range of effects on proteolytic processing depending on the nature of the amino acid introduced. Substitutions with the aliphatic amino acids Val, Leu or He resulted in kinetics that showed little or no reduction in cleavage efficiency compared to the wild type. Substitution with Ala and Phe resulted in kinetics that showed a lower level of proteolytic processing than with the other aliphatic amino acids. After a 15 min incubation, processing efficiency of precursors containing a substitution with Ala and Phe was approximately 50 and 20% that of the wild-type precursor, respectively. Processing was very o ON 8 S 8 8 8 § 8 8 o O o > _i _ u. a < * + * * • + P . 8 8 0 8 ° . £ 0 CO < 5 u - LU • + * • + 8 8 8 1 5 8 8 9 8 8 3 ° 03 8 8 8 S 8 8 S 8 8 2 ° sjanpojd oi U O I S J S A U O D % P CD OH <+H CJO O CL, CJ (JJ CX CO o o C T 3 O <U ^ ,3 * H T3 C O CO c CO C l H (U 73 * ' C O T3 CO -*—» CJ 3 to o ^ tO ^H rt r< Z a j£ H ^ § 'S rt to CO T3 to to fa O / ^ tO a x> w 3 cw T3 * '3 DC 2 SB .5 > P 4» < CJ ^3 CO <0 -B s-g ^ -2 " O c j S tO CO rt I s ' t o " O ° 2 _<u <; T3 S O rt 00 o © CO ^ tO ns co 1 ^ o « o E 6 % CH <u co o ~ a o u too '•° .S S*> to | 8 P 2 to ' u i s + b! CO o £ <v rt Z CO p cx CJ C/5 O La CO B X ! CO OX) rt rt c~ co H "o cx "n <*-< CX ° i to O C cx.2 co X I rt u WD B rt 3 3 2 2 $ CXCK H c < .2 U 3 PH E 8 8 8 f 2 8 8 ? 8 8 S ° LL O < _ > _l Of 4 + + * * 4 I. , 8 8 8 R 8 8 S 8 S 5 0 8 8 8 1 5 8 8 9 8 8 2 nT cc o zf <r 4 X 8 8 8 R 8 8 3 8 8 £ ° 8 8 8 f 3 8 8 S 8 8 e ° sjonpcud oj U O I S J S A U O O % I CN 92 a 200 C180 'vi Vi g 1 6 0 O f ^ 4 0 u ^ 1 2 0 o O 1 0 0 V H D H <~ 80 ea 60 V H 40 J3 2 20 Pro-Pol 1 1 1 • I ll ..1 1 1 II W T H D G A T M F E N E K A R V L I F G A A N S S T F A S R R T A MutatioTT + 1(S) -1(Q) -2(C) -3(P) -4(A) -5(F) -6(F) b 200 60 .2 180 Vi Vi 8160 S • ^ 1 2 0 o ca O 1 0 0 & 80 60 •B 40 & 20 X-MP -1 1 1 1 I II 1 W T G A T M F E N E K A R V L I F G A R A P S A T F A S F R S A Mutation +KS) •KQ) -2(C) -3(N) -4(S) -5(R) -6(T) Fig 4.2 Comparison of the relative rate of proteolytic processing (a)Comparative analysis of processing of pT7VPg-Pro-N-Pol-CAT Pro-Pol cleavage site mutations by the TomRSV protease. Relative processing efficiency at the 15 min. time point is shown for each mutant as a percentage of the processing efficiency of the wild-type precursor, (b) Comparative analysis of processing of pT3X-MP X-MP cleavage site mutations by the TomRSV protease. As in (a) 93 inefficient (or absent) in the mutated cleavage site in which Gly was introduced at the -2 position. Amino acid substitution of Ala at the -4 position did show some effect on processing efficiency depending upon the specific mutant tested. Replacing the Ala with Ser resulted in kinetics that were very similar to that of wild type. However, when Thr or Phe were introduced at that position, cleavage at the Pro-Pol site was less efficient. After 15 min, relative processing efficiency of the Thr and Phe mutants was 30 to 40% that of the wild-type (Fig. 4.2a). Changes introduced in the -3 and -5 position did not seem to have much effect on the ability of the protease to process the Pro-Pol cleavage site in vitro. Substitution of Pro at the -3 position with Ala, Asp and Ser resulted in processing kinetics that were similar to those of the wild type cleavage site. Similarly, replacement of the Phe at the -5 position by Ala, Ser or Arg did not seem to affect the efficiency of processing. Mutation of the Ser at the -6 position did not have a negative effect on the ability of the protease to process the Pro-Pol cleavage site in vitro. Introduction of Arg or Ala in this position resulted in kinetics that were similar to that of the wild type (Fig. 4.1a). Substitution with Thr resulted in a kinetic that showed a level of proteolytic processing that was higher than the wild type. Indeed, processing efficiency was approximately 160 % that of the wild-type precursor after 15 min. The pT7VPg-Pro-N-Pol-CAT precursor used in the above experiments included an in-frame fusion to the CAT protein. To verify that the presence of this protein on the precursor did not alter recognition of the cleavage sites, several of the amino acid substitutions discussed above were introduced in the cDNA clone pT7VPg-Pro-N-Pol-II. Results from time-course experiments of these mutated precursors were similar to those obtained for the corresponding mutated pT7VPg-Pro-N-Pol-CAT precursor (data not shown). Finally, to verify that substitution of amino acids at the Pro-Pol cleavage site did not affect the catalytic activity of the protease itself, several mutants were tested for their ability to cleave the X-MP cleavage site in trans. 94 Cold translations of amino acid substitutions at the -1 position, which resulted in loss of cleavage at the Pro-Pol site, were incubated in the presence of the X-MP precursor. Processing at the X-MP cleavage site was comparable to that obtained from incubation of the X-MP precursor with the cold translation products from the wild-type pT7VPg-Pro-N-Pol-CAT plasmid (Fig. 4.3 a and b). Taken together, these results suggested that amino acids at position -2, -1 and +1 and possibly -4 and -6 played an important role in the efficiency of processing of the Pro-Pol cleavage site by the TomRSV protease. 4.2.2 Site-directed mutagenesis of the X-MP cleavage site. The effects of point mutations on the X-MP cleavage site are shown in Fig. 4.1b and 4.2b, as described above. The results shown were obtained from incubation of the pT3X-MP precursor containing mutated cleavage sites with purified recombinant TomRSV protease. Similar results were observed from incubation of several representative mutants with TomRSV protease produced in the rabbit reticulocyte system (cold in vitro translation products of wild-type pT7VPg-Pro-N-Pol-CAT, see Fig. 4.3). Introduced changes at the +1 position had various effects on the ability of the protease to process the X-MP cleavage site in vitro. Only Ser (the wild-type amino acid), Gly or Ala were tolerated at this position. After a 15 min incubation, processing efficiency was approximately 130 and 80 % that of the wild-type for the Gly and Ala mutants, respectively. Processing was not detected in mutants that included a Met, Phe, Thr or Glu at the +1 position. Replacement of Gin at the -1 position by any of the amino acids tested (Asp, Glu, Lys, Ala or Arg) resulted in undetectable processing at the cleavage site. Several amino acid substitutions at the -2 position showed a dramatic effect on processing efficiency. Of the amino acids tested only Cys (wild-type), Ala or Val resulted in efficient processing at the X-MP site. After a 15 min incubation, processing efficiency was approximately 130 and 160% that of the wild-type for the Ala and 95 WT Pro 3'Q to N Pro 0 .25 .5 1 2 4 16 0 .25 .5 1 2 4 16hr 63 k D a — ~~ 43 k D a — 38 k D a — 1 2 3 4 5 6 7 8 9 10 11 12 13 14 3'Q to A Pro 3'Q to R Pro 0 .25 .5 1 2 4 16 0 .25 .5 1 2 4 16hr 63 k D a — 43 k D a — 38 k D a — J$0! 1' d&Bte m->f j!<mm,. " " ^ f t ^ttttf 15 16 17 18 19 20 21 22 23 24 25 26 27 28 Fig 4.3 Processing of the X-MP precursors in vitro with VPg-Pro-Pol precursors containing mutations at the Pro-Pol cleavage site. Processing was tested using unlabelled pT7VPg-Pro-N-Pol-CAT translation products that were wild-type (lanes 1 to 7) or had an amino acid substitution at the Gin in the -1 position of the pro-pol cleavage site (lanes 8 to 28). These substitutions included introduction of the following amino acids at the -1 position: an Asn (lanes 8 to 14), an Ala (lanes 15 to 21), or an Arg (lanes 22 to 28). Proteolytic processing reactions and separation of the translation products on 12% SDS-PAGE was as described in Materials and Methods. The time of incubation of the different samples is given above each lane (hr: hours). The expected position for the precursors and the cleaved products is given on the left side of the gel. 96 Val mutants, respectively. Introduction of He or Leu resulted in decreased cleavage at the X-MP site. After 15 min, relative processing efficiency compared to the wild-type was approximately 50% for the He and Leu mutants. Replacement of Cys by other amino acids (Arg, Phe, Gly) prevented processing at the cleavage sites. The effect of mutations at the -4 position varied with the specific amino acid introduced. Replacement of Ser at the -4 position with Thr or Ala resulted in reduced processing efficiency. After 15 min, processing efficiency was approximately 80 and 50% of the wild-type for the Thr and Ala mutant, respectively. Introduction of Phe at this position resulted in a drastic reduction of proteolytic processing (processing was not detectable). Amino acid substitutions in the -3, -5 and -6 positions did not have a dramatic effect on the ability of the protease to process the X-MP cleavage site in vitro. Substituting Asp at the -3 position with Pro, Ser or Ala resulted in kinetics that showed similar levels of proteolytic processing to that of the wild type cleavage site. Substitution of Arg at the -5 position with Phe or Ala only slightly influenced processing efficiency. Introduction of Ser at this position resulted in a small reduction of proteolytic processing (processing efficiency was approximately 70% that of the wild-type after 15 min). Replacement of Thr at the -6 position with Ala, Ser or Arg did not influence the efficiency of processing at the cleavage site. Taken together, these results suggest that amino acids at positions -2, -1, +1 and possibly -4 play a critical role in the ability of the protease to cleave the X-MP cleavage site. 4.3. Discussion All the TomRSV cleavage sites identified so far have a conserved amino acid sequence of (Cys,Val)-Gln/(Ser/Gly) (Hans and Sanfacon, 1995; Wang et al, 1999; Chapter 3). The results of the site-directed mutagenesis presented here provide direct evidence for the importance of these conserved amino acids. Indeed, in both of the cleavage sites analyzed, mutations in the +1, 97 -1 and -2 positions were found to have the most pronounced effect on cleavage efficiency. Several features of the TomRSV cleavage sites defined here were also found in those of the related picornaviruses and potyviruses. Previous published studies on the mutagenesis of potyvirus (TEV) and picornavirus (hepatitis A virus, HAV) cleavage sites have shown that, similar to the TomRSV cleavage sites, the -1 position was the most sensitive to amino acid substitutions (Dougherty et al, 1988; Jewell et al, 1992). In TomRSV, substitutions of the Gin at the -1 position with Arg or Ala prevented processing at the Pro-Pol or X-MP cleavage site. However, substitutions with Lys, Glu or Asn allowed some processing of the Pro-Pol cleavage site. Interestingly Lys, Glu or Asn are present in the -1 position of several other picorna-like cleavage sites: Glu is found in several picornavirus cleavage sites (rhinovirus and HAV) and Asn is found in one subgroup C nepovirus cleavage site (BLMV) (Fig. 1.6). Requirements for specific amino acids at the +1 position were less stringent in the TEV and TomRSV cleavage sites (Dougherty et al, 1988; this study). Amino acid substitutions with Met, Phe, Thr or Glu at the +1 position of the TomRSV X-MP cleavage site resulted in a loss of proteolytic processing. In the +1 position of the Pro-Pol cleavage site only substitution with Glu prevented processing at the cleavage site. However, substitution with Met or Phe did show a dramatic decrease in proteolytic processing. It is interesting that substitution with Met had such a drastic effect on proteolytic processing for both cleavage sites because it is present in the cleavage sites of CPMV, a closely related virus (Wellink et al, 1986). These results suggest that the TomRSV protease prefers an amino acid with a small side chain, such as Giy, Ser or Ala at the +1 position while the CPMV protease can accommodate a larger residue at this position. In TomRSV, the -2 position was defined as an important determinant of the cleavage sites in addition to the cleaved dipeptide. In the X-MP site, substitutions of the Cys with Arg, Giy or Phe resulted in a loss of proteolytic processing, while substitutions with Leu or Ile 98 resulted in a decrease in proteolytic processing. Amino acid substitutions in the -2 position of the Pro-Pol cleavage site resulted in a loss of function only when Giy was used and in a dramatic decrease in proteolytic processing when substituted with Phe. It appears that the protease has a preference for cysteine or an aliphatic amino acid, such as Val or Ala, at this position. Interestingly, a Cys or Val is found at the -2 position in cleavage sites of other subgroup C nepoviruses and of some subgroup A/B nepoviruses, while a conserved Ala or Pro is found at the -2 position of the CPMV cleavage sites. Conserved amino acids at the -2 position were also found in turnip mosaic virus (a potyvirus) (see Fig. 1). Therefore, requirement for specific amino acids at the -2 position may not be unique to the TomRSV cleavage sites. In contrast, in TEV, hepatitis A virus and poliovirus, specific amino acids were not conserved at the -2 position (Dougherty et al., 1988; Blair and Semler, 1991; Jewell et al, 1992). Amino acid substitutions in the -3, -5 and -6 positions of the TomRSV cleavage sites did not dramatically influence processing efficiency. In contrast, in TEV, amino acids in the -3 and -6 positions were important for proteolytic processing by the protease (Dougherty et al, 1988). The cleavage sites of picornaviruses, potyviruses and comoviruses contain a small aliphatic amino acid, such as Ala, Leu or Ile at the -4 position (Fig. 1.2). In poliovirus and human rhinovirus, the -4 position was critical in defining a functional protease cleavage site (Pallai et al, 1989; Cordingley et al., 1990; Blair and Semler, 1991). In contrast, there were no conserved amino acids in the -4 position for the nepovirus cleavage sites. Of all the known nepovirus cleavage sites only the TomRSV Pro-Pol and the TBRV VPg-Pro cleavage sites contained an Ala at the -4 position. Mutagenesis of the -4 position of the Pro-Pol and X-MP resulted in modest changes in the processing efficiency, with the exception of substituting the Ser at the -4 position of the X-MP cleavage site with Phe, which resulted in loss of proteolytic processing. This loss of processing might have been the result of a severe conformation change. Although, only a limited number of 99 mutations have been tested at the -4 position, the results of the mutagenesis study and the lack of conserved residues at this position in the TomRSV cleavage sites suggest that the presence of specific amino acids at the -4 position may modulate processing efficiency at the cleavage site but may not be a primary determinant in the definition of the TomRSV cleavage sites. The cleavage site specificity of different 3C-like proteases depends to a large extent on the nature of the amino acids immediately upstream of the cleavage site (Dougherty et al, 1988; Blair and Semler, 1991; Jewell et al, 1992; this study). Specific requirements for conserved amino acids upstream of the cleavage site vary with different proteases used. In this study, the effect of amino acid substitutions on processing efficiency was tested at two TomRSV cleavage sites. The rate of processing at the X-MP cleavage site was adjusted to be similar to that of the Pro-Pol site to allow a meaningful comparison of the proteolytic processing at the two cleavage sites. The results presented here show that amino acid substitutions were tolerated more at the Pro-Pol cleavage site (recognized in cis) than at the X-MP cleavage site (recognized in trans). This was most evident in the -1 position. In the X-MP cleavage site all substitutions eliminated proteolytic processing. In the Pro-Pol cleavage site although several substitutions resulted in some cleavage at the Pro-Pol site most amino acid substitutions resulted in severe reduction of proteolytic processing efficiency. These results raise the possibility that the requirements for specific amino acids are more stringent at cleavage sites recognized in trans than in cis. Analysis of other cleavage sites recognized in cis and in trans would be necessary to confirm this suggestion. Similar to our results, the flavivirus NS3 protease (Bartenschlager et al, 1995) and the poliovirus 2A protease (Hellen et al, 1992) were reported to have more stringent requirements for specific amino acids at frans-cleavage sites rather than at c/s-cleavage sites. To our knowledge, substrate determinants for cis- and trans-cleavage by other 3C like proteases have not been systematically compared. A mutation of the 100 Gln/Ser dipeptide to His/Met at the czs-cleavage site between the CPMV RNA-1 encoded 32K and 170K protein resulted in efficient cleavage at this site (Peters et al, 1992b). In contrast, mutation of the +1 position in the rrans-cleavage site between the CPMV coat proteins resulted in drastic reduction of processing at this site (Vos et al, 1988). Although, the effects of equivalent mutations in both cleavage sites were not compared, the results suggest the requirement for specific amino acids are less stringent at a cw-cleavage site than at a trans-cleavage site in CPMV (Goldbach and Wellink, 1996). The results presented in this study are useful for establishing the cleavage site specificity of the TomRSV protease. However, there are limitations in the system used. First, cleavage sites were characterized in partial polyproteins rather than in the entire RNA-1 or RNA-2 encoded polyproteins. Second, we have only looked at the rates of proteolytic processing in vitro. Despite these limitations, it is noteworthy that the requirements for specific amino acids at the -2, -1 and +1 position were similar in the two TomRSV cleavage sites studied. Definition of the effect of cleavage site mutations on virus amplification in vivo will await the construction of infectious transcripts. 101 CHAPTER 5 CHARACTERIZATION OF AN ALTERED TOMATO RINGSPOT NEPOVIRUS PROTEASE WITH A MUTATION IN THE CONSERVED HIS IN THE PUTATIVE SUBSTRATE-BINDING POCKET. 5.1. Introduction Results shown in Chapter 3 and previously (Hans and Sanfacon, 1995) indicate that a His residue in the substrate-binding pocket of the TomRSV protease was essential for its activity on wild-type TomRSV cleavage sites. The equivalent His residue in the substrate-binding pocket of related proteases has been shown to directly interact with a conserved Gin at the -1 position of the cleavage sites and is probably an important determinant of the cleavage site specificity of these proteases (see Chapter 1). A Gin is conserved in the -1 position of all TomRSV cleavage sites characterized so far (see Chapter 3). Presence of this Gin in the cleavage site was found to be an absolute requirement for efficient recognition of the cleavage site by the protease (see Chapter 4). Interaction between the His in the substrate-binding pocket of the TomRSV protease and the Gin in the cleavage site may therefore be critical in establishing the substrate specificity of the protease. In contrast, a Leu residue is found at the equivalent position in the substrate-binding pocket of nepovirus subgroup A/B proteases (Margis and Pinck, 1992). As mentioned in Chapter 1, cleavage sites recognized by these proteases differ from the cleavage sites recognized by 3C-like proteases of other members of the picornavirus-like supergroup (see Fig. 1.2 and Fig. 1.7) and do not include a Gin at the -1 position. It has been hypothesized that the replacement of the His residue by a Leu residue in the substrate-binding pocket of the nepovirus subgroup A/B proteases is responsible for the change in cleavage site specificity (Ritzenthaler et al, 1991). In this chapter, we therefore decided to test if replacement of the His in the putative 102 substrate-binding pocket of the TomRSV protease by a Leu would result in a change of substrate specificity and allow the TomRSV protease to recognize mutated cleavage sites that resemble those of nepoviruses of subgroup A/B. 5.2. Results 5.2.1. Selection of mutant cleavage sites Nepoviruses of subgroup A/B recognize a number of different cleavage sites (see Fig. 1.7). Cleavage sites that were similar to cleavage sites recognized by proteases from nepoviruses of subgroup A/B were selected from the mutagenesis study in Chapter 4. In particular, mutations in the -1 position were chosen that included substitution of the conserved Gin with Lys and Arg. These amino acids are found in the -1 position of cleavage sites recognized by the ArMV, TBRV, GCMV and GFLV proteases (Fig. 1.7). In addition other TomRSV cleavage site mutants in the +1 and -2 position were available as controls, which also had some similarities to cleavage sites of nepoviruses of subgroup A/B. Mutations were chosen which included substitution of the Ser with Ala, Giy and Glu in the +1 position and of the Cys with Giy, Val, Leu and Ile in the -2 position (Fig. 1.7). These mutations were used to examine the ability of the mutant protease to process altered cleavage sites in cis or in trans. 5.2.2. Cis-proteolytic activity of proteases mutated in the substrate-binding pocket (His1451 to Leu) on the proteolytic processing of mutated Pro-Pol cleavage sites The ability of a protease mutated in its substrate-binding pocket (H1 4 5 1 substituted with L) to cleave mutated Pro-Pof cleavage sites in cis was tested. For this purpose, the selected mutations were introduced in the Pro-Pol cleavage site of the VPg-ProHI451L-N-Pol-CAT precursor using site-directed mutagenesis as described in Materials and Methods. As expected, in vitro translations of the wild-type and mutant constructs resulted in the production of the 58 kDa 103 precursor (Fig. 5.1a, b and c). Processing of the precursor into the 30 and 28 kDa products was observed after incubation of the wild-type pT7VPg-Pro-N-pol-CAT translation products as previously shown in Chapter 3. However, incubation of the pT7VPg-ProH1451L-N-Pol-CAT translation products including wild-type or mutated Pro-Pol cleavage sites did not result in the detection of the 30 and 28 kDa products (Fig. 5.1a, b and c). This suggests that the protease H 1 4 5 1 L was unable to process the wild-type or mutated cleavage sites in cis. 5.2.3. The effect of the protease substrate-binding pocket mutation (His1451 to Leu) on proteolytic processing of mutant cleavage sites in trans The ability of the mutated protease"1451L to process modified X-MP cleavage sites in trans was also tested. In vitro translation of transcripts generated from the pT3X-MP constructs containing either the wild-type or the selected mutant cleavage sites revealed the production of the 63 and 43 kDa precursor bands as described previously in Chapter 3 and 4 (Fig.5.2). To supply exogenous wild-type or mutated protease to these substrates, plasmids pT7VPg-ProH1451L-N-pol-CAT and pT7VPg-Pro-N-Pol-CAT were translated in the coupled transcription-translation system in the presence of cold methionine instead of labelled methionine as described in Material and Methods. As shown in the previous section, equivalent amounts of the wild-type and mutated protease precursors were produced in the coupled transcription/translation system (Fig. 5,1a). The protease precursors present in the cold translation products were added to the labelled X-MP wild-type and mutated precursors. As shown before, wild-type precursors were processed into the 38 kDa product upon addition of the wild-type pT7VPg-Pro-N-Pol-CAT translation products (Fig. 5.2a). However, there was no accumulation of the 38 kDa product for either the wild-type or the mutant substrates when the pT7VPg-ProHI451L-N-Pol-CAT translation products were added. This indicated that the mutant protease"145IL was unable to process these mutated X-MP cleavage sites in trans. 104 cleavage site CQS CQS CKS CRS protease WT HL HL HL 0 4 16 0 4 16 0 4 16 0 4 16hr 58kDa— mm mm m m * § t f f 1 "****• 30kDa_ ••- mm «•) 28kDa_< 1 2 3 4 5 6 7 8 9 10 11 12 cleavage site CQA CQG CQE GQS protease HL HL HL HL 0 4 16 0 4 16 0 4 16 0 4 16 hr 58k Da —+M 30k Da — 28k Da — 13 14 15 16 17 18 19 20 21 22 23 24 cleavage site VQS LQS IQS protease HL HL HL 0 4 16 0 4 16 0 4 16hr 58k Da — 30k Da — 28k Da — 25 26 27 28 29 30 31 32 33 Fig. 5.1 Cis-proteolytic activity of proteases mutated in substrate binding pocket (His1451 to Leu) on proteolytic processing of mutated Pro-Pol cleavage sites. Proteolytic processing of wild-type and mutant pro-pol cleavage sites by wild-type protease (WT) or protease with a His to Leu amino substitution in the substrate binding pocket (HL). Amino acid substitutions introduced into the cleavage sites on the pT7VPg-Pro -N-Pol-CAT precursor at the +1,-1, and -2 positions are shown above each lane. Samples were taken after 0, 4 and 16 hr and separated using 12% SDS-PAGE. Proteolytic processing was visualized by the appearance of the 28 and 30 kDa cleaved products. Positions of the precursors and the cleaved products are shown on the left of each gel. 105 cleavage site protease. 63kDa-0 CQS WT 0 CQS _HL_ CKS HL 0 CRS _HL_ CQA HL 0 A CQG bU CQE HJ 0 4 hr 43kDa- 1 38kDa-8 10 11 12 13 14 cleavage site GQS protease HL 63kDa-4 3 k D a - f \ 38kDa-VQS HL 0 4 0 LQS HL IQS _HL_ 4 0 4 hr 15 16 17 18 19 20 21 22 Fig . 5.2 The effect of protease substrate binding pocket mutation (His to Leu) on proteolytic processing of mutant cleavage sites in trans. Effect of H L mutant protease on X - M P cleavage site mutations. Amino acid substitutions were introduced to the p T 3 X - M P precursors at the +1,-1, and -2 positions. These precursors were matured with unlabelled translation products of plasmids pT7VPg-Pro-N-Pol-CAT (WT) or pT7VPg-P r o H 1 4 5 I L - N - P o l - C A T (HL). Samples were taken after 0 and 4 hr and separated using 12% S D S - P A G E . Proteolytic processing at these sites was visualized by the appearance of the 38 kDa product after 4 hr. Positions of the precursors and cleaved products are shown on the left of each gel. 5.3. Discussion In this chapter we have examined the proteolytic activity of a TomRSV protease mutant in which the His in the substrate-binding pocket was replaced with the Leu found in the substrate-binding pocket of nepovirus subgroup A/B proteases. The protease H 1 4 5 1 L did not process any of the cleavage sites tested in cis or in trans, including those that had similarities to the cleavage sites of nepoviruses subgroup A/B or those that were processed at a reduced efficiency by the wild-type protease (Fig. 4.2a and b). We have shown that in vitro production of 106 wild-type protease present in precursors containing the CAT gene resulted in efficient processing both in cis at the Pro-Pol cleavage site present in the precursor and in trans at the X-MP cleavage site (Fig. 5.1a, lanes 1-3 and Fig. 5.2a, lanes 1-2). We have shown in Chapter 4 that the activity of the wild-type protease was not dependant upon effective removal of the Pol-CAT domain from the precursor. Indeed, VPg-Pro-N-Pol-CAT precursors that included mutations of the Pro-Pol cleavage site were still an efficient source of active exogenous protease on the wild-type X-MP precursor (see Fig. 4.3). Therefore, it was not the method of generating the mutated protease within larger precursors that resulted in its inability to process the cleavage sites in cis or in trans. The specificity of the 3C protease for a Gin residue in the -1 position of the cleavage site is believed to be the result of direct interaction with the His residue of the substrate-binding pocket (Bazan and Fletterick, 1988; Allaire et al., 1994; Matthews et al., 1994). One possible interpretation of our results is that substitution of the His for the Leu residue resulted in a drastic conformation change that destroyed the substrate-binding pocket of the protease. Alternatively, it is possible that changing the substrate specificity of the protease required alteration of other features of the substrate-binding pocket in addition to the His to Leu mutation. In this model, the absence of the His prevented recognition of the wild-type cleavage site, while introduction of a Leu at this position without other required changes to the protease did not allow recognition of the mutated cleavage sites. Evidence for the requirement of other factors in addition to a His or Leu in the substrate-binding pocket of nepoviruses is provided by the observation that GFLV cleavage sites were not cleaved by the RNA-1 translation products of either TRSV or TBRV even though these proteases recognize similar cleavage sites (Morris-Krsinich et al., 1983; Demangeat et al., 1991). As mentioned in Chapter 1, introduction of single point mutations to alter substrate specificity has been successful in some proteases but not in others. Altering the 107 amino acids, which define the substrate-binding pockets of papain and a-lytic protease resulted in a change of the substrate specificity of the proteases (Bone et al, 1989; Khouri et al, 1991; Silen and Agard, 1989). Substitution of a single amino acid in the SI binding pocket of hepatitis C virus NS3 protease also resulted in a change in the specificity of the protease for the substrate (Failla et al, 1996; Koch and Bartenschlager et al, 1997). However, in trypsin it was found that changing surface loops in addition to the substrate-binding pocket was required to change the substrate specificity of the protease (Hedstrom et al, 1992; Hedstrom et al, 1994). Finally, it is also possible that other cleavage sites not tested here may be recognized by the TomRSV protease"1451L. The cleavage sites tested here, although containing amino acids typical of cleavage sites from nepoviruses of subgroup A/B were not authentic nepovirus subgroup A/B cleavage sites. Therefore double mutants that reconstruct natural cleavage sites from nepoviruses subgroup A/B should be tested. It was demonstrated in Chapter 4 that other amino acids in addition to the -1 position were important in determining the substrate specificity of the TomRSV protease. How these amino acids interact with the substrate-binding pocket of the protease from either TomRSV or nepoviruses of subgroup A/B, is not known. Finally other features of the cleavage sites, such as their secondary structure are likely to play an important role in their interaction with the protease. Obtaining the tertiary structure of the TomRSV protease through crystallography studies would allow us to better predict how the protease and substrate interact and to design other mutations that may allow alteration of the substrate specificity of the protease. 108 CHAPTER 6 GENERAL DISCUSSION In this thesis, three new cleavage sites we characterized: the cw-cleavage site between the protease and the polymerase, the tows-cleavage site at the N-terminus of the movement protein and an additional rrans-cleavage site in the N-terminal half of the RNA-2 encoded polyprotein (see Chapter 3). These results combined with results obtained by others in the laboratory (Wang et al, 1999; Wang, 1999) better define the genomic organization of RNA-1 and RNA-2 (see Fig. 6.1). Our results suggest that the organization of TomRSV RNA-2 is different from that of any other nepovirus characterised so far. Indeed, characterization of an additional cleavage site in the N-terminal half of the RNA-2 encoded polyprotein suggest that at least two mature proteins are released from this region of the polyprotein. As discussed in Chapter 3, these results must be confirmed in vivo and the remainder of the RNA-2 encoded polyprotein must be examined for the presence of additional cleavage sites. It is striking to note that the two N-terminal proteins released by the RNA-1 and RNA -2 encoded polyproteins share an extensive region of sequence similarity (see Fig. 6.1). Future work should be directed at understanding the function of these proteins perhaps in viral RNA replication. It will also be interesting to see if the RNA of other members of nepovirus subgroup C have a similar genomic organization. In Chapter 3 and 4, two TomRSV cleavage sites have been characterized in detail and the cleavage site specificity of the TomRSV protease has been studied by site-directed mutagenesis of these cleavage sites. The TomRSV protease is most related to the protease of GFLV, a nepovirus of subgroup A (Rott et al, 1995). However, the TomRSV protease contains a His residue in its substrate-binding pocket (instead of a Leu at the equivalent position in the substrate-binding pocket of the proteases of GFLV and other nepoviruses of subgroup A/B) which is important for catalytic activity (Hans and Sanfacon, 1995; and this thesis, Chapter 3 109 TomRSV ( O p ) (QP) Q * ? G ?s RNA-1 J x i X2 NTB Pol AAA VPg (??) QS Q G RNA-2H ? x MP CP AAA Fig 6.1 Genomic organization of tomato ringspot nepovirus RNA-1 and RNA-2. The open reading frames are indicated by the boxes. Horizontal lines beside the open reading frame indicate noncoding regions. Vertical lines through the polyprotein indicate known and putative cleavage sites. Putative cleavage sites are shown by brackets. The sequence of the determined and putative (between parenthesis) cleaved dipeptides at the Pro-Pol, VPg-Pro, NTB-VPg, NTB-X2, and XI-X2 are shown for RNA-1. The sequence of the cleaved dipeptides at the MP-CP and X-MP cleavage site are shown for RNA-2. The cleavage site in the region N-terminal of the movement protein is indicated by (??). The regions of homology at the 5' ends of RNA-1 and RNA-2 are lightly shaded. Abbreviations are: nucleotide binding protein (NTB), VPg protein (VPg), 3C-like protease (Pro), RNA-dependent RNA polymerase (Pol), coat protein (CP), movement protein (MP), protein X (X), Protein XI (XI), Protein X2 (X2), and poly(A) tail (AAA). and 5). This His residue is present in the substrate-binding pocket of the 3C and 3C-like proteases from picorna-, poty- and comoviruses and plays a key role in the specificity of the 3C protease for a Gin residue in the -1 position of the cleavage site (Bazan and Fletterick, 1988; Allaire et al, 1994; Mathews et al., 1994). The different TomRSV cleavage sites identified so far are consistent with this potential role of the His in the substrate-binding pocket of the protease and include a conserved Gin at the -1 position (Fig. 1.7 ) (Hans and Sanfacon, 1995; Wang et al., 1999; Wang, 1999; this thesis). Our results allow us to suggest a TomRSV cleavage site consensus of (Cys,Val)-Gln/ (Ser,Giy) with the Gin in the -1 position being the most critical amino acid in defining a TomRSV cleavage site as shown by the site-directed mutagenesis study. These general features were also conserved in cleavage sites from other nepoviruses of subgroup 110 C, although some included an Asn or an Asp in the -1 position (see Fig. 1.7) which may have a function equivalent to that of the Gin and Glu found at this position in the picornavirus cleavage sites. Interestingly, although cleavage occurs at very different dipeptides in the polyproteins of nepoviruses of subgroup A/B, a Cys or Val (or Leu or He) was also found at the -2 position of some of these cleavage sites, especially those on the RNA-2 encoded GFLV polyprotein (see Fig. 1.7). The cleavage site specificity of the TomRSV protease was not solely determined by the presence of a His residue in the putative substrate-binding pocket. Indeed, replacement of this His by the Leu found in the putative substrate-binding pocket of the GFLV protease did not allow it to recognize cleavage sites in which amino acids characteristic of GFLV cleavage sites were introduced at the -1 position (see Chapter 5). In chymotrypsin it was found that changing structural loops outside the substrate-binding pocket in addition to amino acids in the substrate-binding pocket was required to change the substrate specificity to that of trypsin (Hedstrom et al, 1992; Hedstrom et al., 1994). As discussed in Chapter 5, it is possible that changing similar structural features in the TomRSV protease in addition to mutations in the substrate-binding pocket is also required to alter the substrate specificity. It is difficult to predict specific amino acids involved in substrate recognition based solely on sequence homology. X-ray crystallography has been effective in predicting amino acids involved in substrate recognition for other picorna-like viruses proteases (Allaire et al., 1994; Mathews et al, 1994). Obtaining the 3D structure of the TomRSV protease through X-ray crystallography is therefore an essential step in the prediction of amino acids from the protease that are involved in the interaction with the substrate. The importance of amino acids in the cleavage site specificity of the protease could then be confirmed using experiments similar to the ones described in Chapter 5. Finally, X-ray crystallography could be used to demonstrate the identity of amino acids of the catalytic I l l triad. His has been suggested as a member of the catalytic triad by site-directed mutagenesis (Hans and Sanfacon, 1995). However, the identity of this and other members of the catalytic triad predicted from sequence homology needs to be confirmed. Other factors in addition to the primary amino acid sequence around the cleavage sites are likely to play a critical role in the recognition of the cleavage sites by the protease. In our in vitro assay, tripeptide VQ907/S present on the X-MP precursor was not recognized by the TomRSV protease either in a wild-type precursor or in a precursor in which the Q934/S cleavage site was deleted even though it met the TomRSV cleavage site consensus (see Chapter 3). In contrast, alternative cleavage sites have previously been found to be processed in flaviviruses when the normal cleavage site was mutated (Nestorowicz et al, 1994; Bartenschlager et al, 1995). These results suggest that other factors such as secondary structures are likely to be important for the definition of TomRSV cleavage sites as suggested by Ypma-Wong et al, (1988) for the poliovirus cleavage sites. Although processing at the Q907/S dipeptide in vitro was detected, it is possible that it may be processed in vivo in larger precursors including the entire P2 polyprotein which may present a different secondary structure around this site. This may provide an explanation for a previous observation made in this laboratory that two closely migrating species of the movement protein were observed upon SDS-PAGE analysis of extracts of TomRSV infected protoplasts (Sanfacon et al., 1995). As mentioned above, an additional cleavage site was detected in the N-terminal region of the RNA-2 encoded polyprotein using in vitro translation systems and partial RNA-2 cDNA clones (see Chapter 3). Surprisingly, mutagenesis of two potential tripeptides (VQ301/G and VQ /G), which met the TomRSV cleavage site consensus, did not eliminate proteolytic processing at this cleavage site. This suggested that either these cleavage sites have a different sensitivity for point mutation than that observed for the Pro-Pol and X-MP cleavage sites or that 112 cleavage occurred at different cleavage sites that did not fit our consensus. As discussed in Chapter 3, cleavage at this site is very inefficient in the precursor studied in contrast to the very efficient cleavage at the X-MP or Pro-Pol cleavage sites. It is interesting to note that in potyviruses, inefficient ds-processing at the C-terminus of the NIa protease was shown to occur at cleavage sites that differed considerably from the consensus established for these viruses (Kim et al., 1995; Parks et al., 1995, Kim et al., 1996). A more extensive site- directed mutagenesis study could be used to indicate the possible location of the cleavage site. However, the identity of this cleavage site can not be confirmed unless N-terminal sequencing is used to verify the amino acid sequence of products resulting from processing at the cleavage site. This would prove to be very difficult because cleavage at this site is very inefficient. It may be possible to improve the efficiency of cleavage at this site either by modifying the precursor used (i.e. including a larger part of RNA-2), by using a different protease precursor (as shown for the poliovirus 3C and 3CD proteases, Ypma-Wong et al., 1988) or by addition of a protease co-factor (as shown for comoviruses and flaviviruses, Failla et al., 1994; Failla et al., 1995; Peters et al., 1992a; Peters etal, 1992b; Franssen etal, 1984a). In our site-directed mutagenesis experiments, we have created several mutated cleavage sites that were inefficiently cleaved by the protease (Fig. 4.1a and b). These results may be used for the development of substrate based protease inhibitors against the TomRSV protease. The exact mechanism of proteolytic processing is not known but is probably similar to that of serine and cysteine proteases (Dougherty and Semler, 1993). In this model, the substrate-binding pocket of the protease must first recognize and bind to the precursor substrate. Cleavage then occurs and an acyl-Cys is produced between the protease active site and the N-terminal cleaved product. The final step of the reaction involves the release of the carboxylic acid product and the regeneration of the active site of the protease. A wild-type substrate would undergo all these 113 processes and may therefore act as a competitive inhibitor of protease. Several mutant cleavage sites characterized in Chapter 4 were either not cleaved or cleaved inefficiently by the protease. It is not known at this point whether this reduced cleavage is due to inefficient binding of the protease to the substrate or to inefficient cleavage or release of the cleaved product from the protease. Further experiments (such as far-westerns and competition of proteolytic activity) would be necessary to determine the ability of these mutated cleavage sites to bind to the protease. Mutated cleavage sites that can bind tightly to the protease but are not cleaved or released are potential irreversible inhibitors that would interfere with the protease active site. The characterization of such inhibitors could be of importance in the development of new strategies to engineer resistance to plant viruses and would also be useful tools towards a better understanding of the protease-substrate interactions. 114 REFERENCES Allaire, M., Chernia, M., Malcolm, B. A. and James, M. N. G. 1994. Picornaviral 3C cysteine proteinases have a fold similar to chymotrypsin-like serine proteinases. Nature 369:72-76. Allison, R., Johnston, R.E. and Dougherty, W.G. 1986. The nucleotide sequence of the coding region of tobacco etch virus genomic RNA: evidence for the synthesis of a single polyprotein. Virology 154: 9-20. Andino, R., Rieckholf, G.E., Achacoso, P.L. and Baltimore, D. 1993. Poliovirus RNA synthesis utilizes an RNP complex formed around the 5'-end of viral RNA. EMBO J. 12:3587-3598. Andino, R., Reickholf, G.E. and Baltimore, D. 1990. A functional ribonucleoprotein complex forms around the 5' end of poliovirus RNA. Cell 63:369-380. Aranda, M. and Maule, A. 1998. Virus-induced host gene shutoff in animals and plants. Virology 243:261-267. Argos, P., Kamer, G., Nicklin, M.J.H. and Wimmer, E. 1984. Similarity in gene organization and homology between proteins of animal picornaviruses and a plant comovirus suggest common ancestry of these viral families. Nucleic acids research 12:7251-7267. Ashorn, P., McQuade, T.J. Thaisrivongs, S., Tomasselli, A.G., Tarpley, W.G. and Moss, B. 1990. An inhibitor of the protease blocks maturation of human and simian immunodefficiency viruses and spread of infection. Proc. Natl. Acad. Sci. USA 87:7472-7476. Babe, L.M., Pichountes, S. and Craik, C.S., 1991. Inhibition of HIV protease activity by heterodimer formation. Biochemistry 30:106-111. Bacher, J.W., Warkentin, D., Ramsdell, D. and Hancock, J. F. 1994. Sequence analysis of the 3' termini of RNA-1 and RNA-2 of blueberry leaf mottle virus. Virus Res. 33:145-151. Barrett, A.J. 1986. Proteinase inhibitors. Elsevier Biomedical Press, Amsterdam. Bartenschlager, R., Ahlborn-Laake, L., Yasarggil, K., Mous, J. and Jacobsen, H. 1995. Substrate determinants for cleavage in cis and in trans by hepatitis C virus NS3 proteinase. J. Virol. 69, 198-205. Bazan, J.F. and Fletterick, R.J. 1990. Structural and catalytic models of trypsin-like viral proteases. Semin. Virol 1:311-322. Bazan, J.F. and Fletterick R.J. 1989. Detection of a trypsin-like serine protease domain in flaviviruses and pestiviruses. Virology 171:637-639. Bazan, J.F. and Fletterick, R.J. 1988. Viral cysteine proteases are homologous to the trypsin-like family of serine proteases: structural and functional implications. Proc. Natl. Acad. Sci. USA 85:7872-7876. 115 Beaumont, A., Le Moual, H., Boileau, G., Crine, P. and Roques, B.P. 1991. Evidence that both arginine-102 and arginine-747 are involved in substrate-binding to neutral endopeptidase (EC 3.4.24.11). J. Biol. Chem. 266:214-220. Beier, H., Issinger, D.G., Deuschle, M. and Mundry, K.W. 1981, Translation ofthe RNA of cowpea severe mosaic virus in vitro and in cowpea protoplasts. J. Gen. Virol. 54:379-385. Berger, A. and Schecter, I. 1970. Mapping the active site of papain with the aid of peptide substrates and inhibitors. Philos. Trans. R. Soc. London, Ser. B 257:249-264. Bienz, K., Egger, D., Pfister, T. and Troxler, M. 1992. Structural organization of poliovirus RNA replication complex. J. Virol. 66:2740-2747. Bizub, D., Weber, I.T., Cameron, C.E., Leis, J.P. and Skalaka, A.M. 1991. A range of catalytic efficiencies with avian retroviral protease subunits genetically linked to form single polypeptide chains. J. Biol. Chem. 266:4951-4958. Black, L.W. and Showe, M.K. 1983. Morphogenesis ofthe T4 head, p. 219-245. In C. K. Mathews, E. M. Kutter, G. Mosig. and P. B. Berget (ed.), Bacteriophage T4. American Society for Microbiology, Washington, D.C. Blair, W.S. and Semler, B.L. 1991. Role for the P4 amino acid residue in substrate utilization by the poliovirus 3CD proteinase. J. Virol. 65:6111-6123. Block, V.C., Wardell, J., Jolly, C.A., Manoukian, A., Robinson, D.J., Edwards, M.L. and Mayo, M.A. 1992. The nucleotide sequence of RNA-2 of raspberry ringspot nepovirus. J. Gen. Virol. 73:2189-2194. Bone, R., Silen, J.L. and Agard, D.A. 1989. Structural plasticity broadens the specificity of an engineered protease. Nature (London) 339:191-195. Bovee, M.L., Amphear, B.J., Rhoads, R.E. and Loyd, R.E. 1998. Direct cleavage of elF4G by poliovirus 2A protease is inefficient in vitro. Virology 245:241-249. Budkowska, A., Maillard, P., Theret, N., Groh, F., Possehl, C, Topilko, A. and Crainic, R. 1997. Activation of the envelope proteins by a metalloproteinase enables attachment and entry of the hepatitis B virus into T-Lymphocyte. Virology 237:10-22. Burley, S.K., David, P.R. and Lipscomb. 1991. Leucine aminopeptidase: bestatin inhibition and a model for enzyme catalyzed peptide hydrolysis. Proc. Natl. Acad. Sci. USA 88:6916-6920. Burstein, H., Bizub, D. and Skalka, A.M. 1991. Assembly and processing of avian retroviral gag polyproteins containing linked protease dimers. J. Virol. 65:6165-6172. Butkiewicz, N.J., Wendel, M., Zhang, R., Jubin, R., Pichardo, J., Smith, E.B., Hart, A.M., Ingram, R., Durkin, J., Mui, P.W., Murray, M.G, Ramanathan, L. and Dasmahapatra, B. 1996. Enhancement of hepatitis C virus NS3 proteinase activity by association with NS4A-specific 116 synthetic peptides: identification of sequence and critical residues of NS4A for the cofactor activity. Virology 225:328-38. Cameron, C.E., Ridky, T.W., Shulenin, S., Leis, J., Weber, I.T., Copeland, T., Wlodawer, A., Burstein, H., Bizub-Bender, D. and Skalka, A.M. 1994. Mutational analysis of the substrate-binding pockets of the rous sarcoma virus and human immunodeficiency virus-1 protease. J. Biol. Chem. 269:11170-11177. Cao, X., Bergman, I.E. and Fulkieg, R. and Beck, E. 1995. Functional analysis of the two alternative initiation sites of foot and mouth disease virus. J. Virol. 69:560-563. Cao, X., Kuhn, R.J. and Wimmer, E. 1993. Replication of poliovirus RNA containing two VPg coding sequences leads to a specific deletion event. J. Virol. 67:560-563. Carrington, J.C, Cary, S.M., Parks, T.D. and Dougherty, W.G. 1989a. A second proteinase encoded by a plant potyvirus genome. EMBO J. 8:365-370. Carrington, J.C. and Dougherty, W.G. 1988. A viral cleavage site cassette: identification of amino acid sequences required for tobacco etch virus polyprotein processing. Proc. Natl. Acad. Sci. USA 85:3391-3395. Carrington, J.C. and Dougherty, W.G. 1987. Small nuclear inclusion protein encoded by a plant potyvirus genome is a protease. J. Virol. 61:2540-2548. Carrington, J.C, Freed, D.D. and Leinicke, A.J. 1991. Bipartite signal sequence mediates nuclear translocation of the plan potyviral NIa protein. Plant Cell 3:953-962. Carrington, J.C, Freed, D.D. and Oh, CS. 1990. Expression of potyviral polyproteins in transgenic plants reveals three proteolytic activities required for complete processing. EMBO J. 9:1347-1353. Carrington, J.C, Freed, D.D. and Sanders, T.C. 1989b. Autocatalytic processing of the potyvirus helper component proteinase in Escherichia coli and in vitro. J. Virol. 63:4459-4463. Carrington, J.C. and Herndon, K.L. 1992. Characterization of the potyviral HC-pro autoproteolytic cleavage site. Virology 187:308-315. Chambers, T.J., Grakoui, A. and Rice, CM. 1991. Processing of the yellow fever virus nonstructural polyprotein: a catalyticaly active NS3 proteinase domain and NS2B are required for cleavages at dibasic sites. J. Virol. 65:6042-6050. Chambers, T.J., Hahn, C.S., Galler, R. and Rice, CM. 1990a. Flavivirus genome organization, expression and replication. Annu. Rev. Microbiol. 44:649-688. Chambers, T.J., McCourt, D.W. and Rice, CM. 1990b. Production of yellow fever virus in infected cells: identification of discrete polyprotein species and analysis of cleavage kinetics using region-specific polyclonal antisera. Virology 177:159-174. 117 Chambers, S.P., Prior, S. E., Barstow, D.A. and Minto, N.P. 1988. The pMTL nic- cloning vectors. I. Improved pUC polylinker regions to facilitate the use of sonicated DNA for nucleotide sequencing. Gene 68:139-149. Chambers, T.J., Weir, R.C., Grakoui, A., McCourt, D.W., Bazan, F., Fletterick, R.J. and Rice, CM. 1990c. Evidence that the N-terminal domain of nonstructural protein NS3 from yellow fever virus is a serine protease responsible for site-specific cleavages in the viral polyprotein. Proc. Natl. Acad. Sci. USA 87:8898-8902. Chen, X. and Bruening, G. 1992a. Nucleotide sequence and genetic map of cowpea severe mosaic RNA-2 and comparisons with the RNA2 of other comoviruses. Virology 187: 682-692. Chen, X. and Bruening, G. 1992b. Cloned DNA copies of cowpea severe mosaic virus genomic RNAs: Infectious transcripts and complete nucleotide sequence of RNA 1. Virology 191:607-618. Cheng, Y.S., Yin, F.H., Foundling, S., Blomstrom, D. and Kettner, CA. 1990. Stability and activity of human immunodeficiency virus protease: comparison of the natural dimer with a homologous, single-chain tethered dimer. Proc. Natl. Acad. Sci. USA 87:9660-9664. Choi, H., Tong, L., Minor, W., Dumas, P., Boege, U., Rossmann, M.G. and Wengler, G. 1991. Structure of Sindbis virus core protein reveals a chymotrypsin-like serine proteinase and the organization of the virion. Nature (London) 354:37-43. Choo, Q., Richman, K.H., Han, J.H., Berger, K., Lee, C, Dong, C, Gallegos, C, Coit, D., Medina-Selby, A., Barr, P.J., Weiner, A.J.. Bradley, D.W., Kuo, G. and Houghton, M. 1991. Genetic organization and diversity of the hepatitis C Virus. Proc. Natl. Acad. Sci. USA 88:2451-2455. Clark, M.E. and Dasgupta, A. 1990. A transcriptionaly active form of TFIIIC is modified in poliovirus-infected HeLa cells. Mol. Cell. Biol. 10:5106-5113. Clark, M.E., Hammerle, T., Wimmer, E. and Dasgupta, A. 1991. Poliovirus proteinase 3C converts an active form of transcription factor IIIC to an inactive form: a mechanism for inhibition of host cell polymerase III transcription by poliovirus. EMBO J. 10: 2941-2947. Clark, M.E., Lieberman, P.M., Berk, A.J. and Dasgupta, A. 1993. Direct cleavage of human TATA-binding protein by poliovirus 3C in vivo and in vitro. Molecular and Cellular Biology 13:1232-1237. Cole, E.R., Koppel, J.L. and Olwin JH. 1966. The hydrolysis of phenylalanine methyl ester by bovine thrombin. Can. J. Biochem. 44:1051-1059. Craik, C.S., Largman, C, Fletcher, T., Roczniak, S., Barr, R.J., Fletterick, R. and Rutter. W.J. 1985. Redesigning trypsin: alteration of substrate specificity. Crit. Rev. Biochem. 15:291-297. Cuconati, A., Xiang, W., Lahser, F., Pfister, T. and Wimmer, E. 1998. A protein linkage map of the P2 nonstructural proteins of poliovirus. J. Virol. 72:1297-1307. 118 Decroly, E., Benjannet, S., Savaria, D. and Seidah, N.G. 1997. Comparative functional role of PC 7 and furin in th eprocessing of the HIV envelope protein gpl60. FEBS Lett. 405:68-72 De Groot, R.J., Hardy, W.R., Shirako, Y. and Strauss, J.H. 1990. Cleavage-site preferences of Sindbis virus polyproteins containing the non-structural proteinase. Evidence for temporal regulation of polyprotein processing in vivo. EMBO J. 9:2631-2638. De Groot, R.J., Rumenapf, T., Kuhn, R.J., Strauss, E.G. and Strauss, J.H. 1991. Sindbis virus RNA polymerase is degraded by the N-end rule pathway. Proc. Natl. Acad, Sci. USA 88:8967-8971. DesJarlais, R.L., Seibel, G.I., Kuntz, I.D., Furth, P.S., Alvarez, J.C, Oritz de Monellano, P.R., deCamp, D.L., Babe, L.M. and Craik, CS. 1990. Structure-based design of nonpeptide inhibitors specific for the human immunodeficiency virus 1 protease. Proc. Natl. Acad. Sci. USA 87:6644-6648. Demangeat, G., Grief, C, Hemer, O. and Fritsch, C. 1990. Analysis of the in vitro cleavage products of the tomato black ring virus RNA-1-encoded 205K polyprotein. J. Gen. Virol. 71:1649-1654. Demangeat, G., Hemmer, O., Le Gall, O. and Candresse, T. 1991. In vitro processing of the RNA-2 encoded polyprotein of two nepoviruses: tomato black ring virus and grapevine chrome mosaic virus. J. Gen. Virol. 72:247-252. Demangeat, G., Hemmer, O., Reinbolt, J., Mayo, M. A. and Fritsch, C. 1992. Virus-specific proteins in cells infected with tomato black ring nepovirus: evidence for proteolytic processing in vivo. J. Gen. Virol. 73:1609-1614. Dessens, J.T. and Lomonossoff, G.P. 1992. Sequence upstream of the 24K protease enhances cleavage of the cowpea mosaic virus B-RNA-encoded polyprotein at the junction between the 24K and 87k protiens. Virology 189:225-231. Dessens, J.T. and Lomonossof, G.P. 1991. Mutational analysis of the cowpea mosaic virus 24K protease. Virology 184:738-746. Devaney, M.A., Vakharia, V.N., Loyd, R.E., Ehrenfeld, E. and Grubman, M. J. 1988. Leader protein of foot and mouth disease virus is required for cleavage of the p220 component of the cap-binding protein complex. J. Virol. 62:4407-4409. Dhanaraj, V., Dealwis, C.G., Frazao, C, Badasso, M., Sibanda, B.L., Tickle, I.J., Cooper, J.B., Driessen, H.P.C, Newman, M., C. Aguilar, C, Wood, S.P., Blundell, T.L., Hobart, P.M., Geoghegan, K.F., Ammirati, M.J., Danley, D.E., O'Connor, B.A. and Hoover, D.J. 1992. X-ray analyses of peptide-inhibitor complexes define the structural basis of a specificity for human and mouse renins. Nature (London) 357:466-471. Dittmar, K.J. and Moelling, K. 1978. Biochemical properties of pl5-associated protease in an avian RNA tumor virus. J. Virol. 28:106-118. 119 Domier, L.L., Shaw, J.G. and Rhoads, R.E. 1987. Potyviral proteins share amino acid sequence homology with picorna-, como- and caulimoviruses. Virology 158:20-27. Dougherty, W.G. and Carrington, J.C. 1988. Expression and function of potyviral gene products. Annu. Rev. Phytothol. 26:123-143. Dougherty, W.G., Carrington, J.C, Cary, S.M. and Parks, T.D. 1988. Biochemical and mutational analysis of a plant virus polyprotein cleavage site. EMBO J. 7:1281-1287. Dougherty, W.G., Cary, S.M. and Parks, T.D. 1989a. Molecular genetic analysis of a plant virus polyprotein cleavage site: a model. Virology 171:356-364. Dougherty, W.G. and Hiebert, E. 1980. Translation of potyvirus RNA in a rabbit reticulocyte lysate: reaction conditions and capsid protein as one of the products of in vitro translation of tobacco etch and pepper mottle viral RNAs. Virology 144:516. Dougherty, W.G. and Parks, T.D. 1991. Post-translational processing of the tobacco etch virus 49-kDa small nuclear inclusion polyprotein: identification of an internal cleavage site and delimitation of VPg and proteinase domains. Virology 183:449-456. Dougherty, W.G. and Parks, T.D. 1989. Molecular genetic and biochemical evidence for the involvement of the heptapeptide cleavage sequence in determining the reaction profile at the two tobacco etch virus cleavage sites in cell free assays. Virology 172:145-155. Dougherty, W.G, Parks, T.D., Cary, S.M., Bazan, J.F. and Fletterick, R.J. 1989b. Characterization of the catalytic residues of the tobacco etch virus 49-kDa proteinase. Virology 172:302-310. Dougherty, W.G. and Semler, B.L. 1993. Expression of virus encoded proteinases: functional and structural similarities with cellular enzymes. Microbiological reviews 57:781-822. Etchison, D. and Fout, S. 1985. Human rhinovirus 14 infection of He La cells results in the proteolytic cleavage of the p220 cap-binding complex subunit and inactivates globin mRNA translation in vitro. J. Virol. 54:634-638. Etchison, D., Milburn, S.C, Edery, I., Sonenberg, N. and Hershey, J.W. 1982. Inhibition of HeLa cell protein synthesis following poliovirus infection correlates with the proteolysis of a 220,000-dalton polypeptide associated with eukaryotic initiation factor 3 and a cap binding protein complex. J. Biol. Chem. 257:14806-14810. Failla, CM., Pizzi, E., Fransesco, R.D. and Tramontano, A. 1996. Redesigning the substrate specificity of the hepatitis C virus NS3 protease. Fold. Des. 1:35-42. Failla, C, Tomei, L. and De Francesco, R. 1995. An amino-terminal domain of the hepatitis C virus NS3 protease is essential for interaction with NS4A. J Virol 69:1769-77. 120 Failla, C , Tomei, L. and De Francesco, R. 1994. Both NS3 and NS4A are required for proteolytic processing of hepatitis C virus nonstructural proteins. J Virol 68:3753-60. Falgout, B., Pethel, M., Zhanga, Y.M. and Lai, CJ. 1991. Both nonstructural proteins NS2B and NS3 are required for the proteolytic processing of dengue virus nonstructural proteins. J. Virol. 65:2467-2475. Falk, M.M., Grigera, P.R. Bergmann, I.E., Zibert, A., Multhaup, G. and Beck, E. 1990. Foot-and-mouth disease virus protease 3C induces specific proteolytic cleavage of host histone H3. J. Virol. 64:748-756. Forster, R.L.S. and Morris-Krsinich, B.A.M. 1985. Synthesis and processing of the translation products of tobacco ringspot virus in rabbit reticulocyte lysates. Virology 144:516-522. Franssen, H., Goldbach, R., Broekhuysen, M., Moerman, M. and Van Kammen, A. 1982. Expression of middle-component RNA of cowpea mosaic virus: In vitro generation of precursor to both capsid proteins by a bottom-component RNA-encoded protease from infected cells. J. Virol. 41:8-14. Franssen, H., Golbach, R. and Van Kammen, A. 1984a. Translation of bottom component RNA of cowpea mosaic virus in reticulocyte lysate: faithful proteolytic processing of the primary translation product. Virus research 1: 39-49. Franssen, H., Leunissen, J., Golbach, R., Lomonossoff, G. and Zimmern, D. 1984b, Homologous sequences in non-structural proteins from cowpea mosaic virus and picornaviruses. EMBO J. 3: 855-863. Franssen, H., Roelofsen, W. and Goldbach, R. 1986. Mapping of the coding regions for the capsid proteins of cowpea mosaic virus on the nucleotide sequence of middle component RNA, Chinese J. Virol. 2:46-53. Freimuth, P. and Anderson, CW. 1993. Human adenovirus serotype 12 virion precursors pMu and pVI are cleaved at amino-terminal and carboxy-terminal sites that conform to the adenovirus 2 endoproteinase cleavage consensus sequence. Virology 193: 348-355. Gabriel, C.J., Derrick, K.S. and Shih, D.S. 1982. The synthesis and processing of the proteins of bean pod mottle virus in rabbit reticulocyte lysates. Virology 122:476. Garcia, J.A., Lain, S., Cervera, M.T., Riechman, J.L. and Martin, M.T. 1990. Mutational analysis of plum pox potvirus polyprotein processing by the NIa protease in Escherichia coli. J. Gen. Virol 71: 2773-2779. Garcia, J.A., Schrijvers, L., Tan, A., Vos, P., Wllink, J. and Goldbach, R. 1987. Proteolytic activity of the cowpea mosaic virus encoded 24K protein synthesized in Escherichia coli. Virology 159: 67-73. Golbach, R. 1987. Genomic similarities between plant and animal RNA viruses. Microbiologiical Sciences 4: 197-205. 121 Golbach, R. and Wellink, J. 1996. Comovirus: molecular biology and replication. In: The plant viruses (B.D. Harrison and A.F. Murant, eds.), pp. 35-76. Plenum press, New York and London. Gorbalenya, A.E., Blinov, V.M. and Dochenko, A.P. 1986. Poliovirus-encoded proteinase 3C: a possible evolutionary link between cellular serine and cysteine proteinases families. FEBS Lett. 194: 253-259. Gorbalenya, A.E., Donchenko, A.P., Blinov, V.M. and Koonin, E.V. 1989a. Cysteine proteases of positive-strand RNA viruses and Chymotrypsin-like serine proteases. A distinct superfamily with a common structural fold. FEBS Lett. 243:103-114. Gorbalenya, A.E., Donchenko, A.P., Koonin, E.V. and Blinov, V.M. 1989b. N-terminal domains of putative helicases of flavi- and pestiviruses may be serine proteases. Nucleic Acids Res. 18:3889-3897. Gorbaleyna, A.E., Koonin, E.V. and Lai, M.M.C. 1991. Putative papain-related thiol protease of positive-strand RNA viruses: identification of rubi-and aphthovirus protease and delineation of a novel conserved domain associated with proteases of rubi-, alpha- and coronaviruses. FEBS Letters 288: 201-205. Gosert, R., Dollenmaier, G. and Weitz, M . 1997. Identification of the active site residues in protease 3C of hepatitis A virus by site-directed mutagenesis. J. Virol. 71: 3062-3068. Graf, L., Craik, C.S, Patthy, A., Roczniak, S., Fletterick, R.J. and Rutter, W.J. 1987. Selective alteration of substrate specificity by replacement of aspartic acid-189 with lysine in the binding pocket of trypsin. Biochemistry 26: 2616-2623. Hahn, C.S. and Strauss, J.H. 1990. Site-directed mutagenesis of the proposed catalytic amino acids of the Sindbis virus capsid protein autoprotease. J. Virol. 64:3069-3073. Hahn, C.S., Strauss, E.G. and Strauss, J.H. 1985. Sequence analysis of three Sindbis virus mutants temperature-sensitive in the capsid protein autoprotease. Proc. Natl. Acad. Sci. USA 82:4648-4652. Hallenberger, S., Moulard, M. , Sordel, M. , Klenk, H.D. and Garten, W. 1997. The role of eukaryotic subtilisin-like endoproteases for the activation of human immunodeficiency virus glycoproteins in natural host cells. J. Virol. 71:1036-1045. Hammerle, T., Hellen, C.U. and Wimmer, E. 1991. Site-directed mutagenesis of the putative catalytic triad of poliovirus 3C proteinase. J. Biol. Chem. 266:5412-5416. Hanecak, R., Semler, B.L., Ariga, H., Anderson, CW. and Wimmer, E. 1984. Expression of cloned gene segments of poliovirus in E. coli: evidence for autocatalytic production of the viral protease. Cell 37, 1063-1073. Hans, F. and Sanfacon, H. 1995. Tomato ringspot nepovirus protease: characterization and cleavage site specificity. J.Gen. Virol. 76:917-927. 122 Hardy, W.R., Hahnm, Y.S., de Groot, R.J., Strauss, E.G. and Strauss, J.H. 1990. Synthesis and processing of the nonstructural polyproteins of several temperature-sensitive mutants o f Sindbis virus. Virology 177:199-208. Hardy, W.R. and Strauss, J.H.. 1988. Processing the non-structural polyproteins of several temperature-sensitive mutants of Sindbis virus. Virology 177:199-208. Harmon, S.A., Updike, W., Jia, X., Summers, D.F. and Ehrenfeld, E.. 1992. Polyprotein processing in cis and in trans by hepatitis A virus 3C protease cloned and expressed in Escherichia coli. J. Virol. 66:5242-5247. Harris, K.S., Hellen, C.U. and Wimmer, E. 1990. Proteolytic processing in the replication of picornaviruses. Semin. Virol. 1:323-333. Hedstrom, L., Perona, J.J. and Rutter, W.J. 1994. Converting trypsin to chymotrypsin: residue 172 is a substrate specificity determinant. Biochemistry 33:8757-8763. Hedstrom, L., Szilagyi, L. and Rutter, W.J. 1992. Converting trypsin to chymotrypsin: the role of surface loops. Science 255:1249-1253. Heidner, H.W. and Johnston, R.E. The amino-terminal residue of Sindbis virus glycoprotein E2 influences virus maturation, specific infectivity for BHK cells and virulence in mice. J. Virol. 68:8064-8070. Heidner, H.W., McKnight, K.L., Davis, N.L. and Johnston, R.E. 1994. Lethality of PE2 incorporation into Sindbis virus can be suppressed by second-site mutations in E3 and E2. J. Virol. 68:2683-2692. Hellen, C.U.T., Facke, M., Krausslich, H., Lee, C. and Wimmer, E. 1991. Characterization of poliovirus 2A proteinase by mutational analysis: residues required for autocatalytic activity are essential for induction of cleavage of eukaryotic initiation factor 4F polypeptide p220. J. Virol. 65:4226-4231. Hellen, C.U.T., Lee, C. K. and Wimmer, E. 1992. Determinants of substrate recognition of poliovirus 2A proteinase. J. Virol. 66:3330-3338. Hellen, C.U.T. and Wimmer, E. 1992. Maturation of poliovirus capsid proteins. Virology 187:391-397. Hellmann, G.M., Shaw, J.G. and Rhoads, R.E. 1988. In vitro analysis of tobacco vein mottling virus NIa cistron: evidence for a virus-encoded protease. Virology 163:554-562. Hemmer, O., Grief, C, Dufourcq, P., Reinbolt, J. and Fritsch, C. 1995. Functional characterization of the proteolytic activity of the tomato blackring nepovirus RNA-1 encoded polyprotein. Virology 206:362-371. 123 Higaki, J.N., Gibson, B.W. and Craik, C.S. 1987. Evolution of catalysis in the serine proteases. Cold Spring Harbor Symp. Quant. Biol. 52:615-621. Himmler, G., Frank, S., Steinkellner, H., Ruker, F., Mattanovich, D. and Katinger, H.W.D. 1990. Detection of the trans activity of the plum pox virus NIa-like protease in infected plants. J. Gen. Virol. 71:1623-1625. Hill, R.L. 1965. Hydrolysis of proteins. Adv. Protein. Chem. 20:37-107. Inagami, T. and Sturtevant, J.M. 1964. The alpha-chymotrypsin-catalyzed hydrolysis and hydroxylaminolysis of acetyltyrosine p-nitroanilide. Biochem. Biophys. Res. Commun. 14:69-74. Ivanoff, L.A., Towatari, T., Ray, J., Korant, B.D. and Petteway, S.R. 1986. Expression and site-specific mutagenesis of the poliovirus 3C protease in Escherichia coli. Proc. Natl. Acad. Sci. USA 83: 5392-5396. Iwanami, T., Kondo, Y., Makit, C, Azeyanagi, C. and Leki, H. 1998. The nucleotide sequence of the coat protein genes of satsuma dwarf virus and navel orange infectious mottling virus. Arch. Virol. 143:405-412. Jacks, T. 1990. Translational suppression in gene expression in retroviruses and retrotransposons. Curr. Top, Micorbiol. Immunol. 157:93-124. Jacobson, M.F. and Baltimore, D. 1968. Polypeptide cleavages in the formation of poliovirus proteins. Proc. Natl. Acad. Sci. USA 61:77-84. James, M.N.G. and Sielecki, A.R. 1983. Structure and refinement of penicillopepsin at 1.8 A resolution. J. Mol. Biol. 163:591-602. Jewell, D.A., Swietnicki, W., Dunn, B.M. and Malcolm, B.A. 1992. Hepatitis A virus 3C proteinase substrate specificity. Biochemistry 31: 7862-7869. Jia, X., Ehrefeld, E. and Summers, D.F. 1991. Proteolytic activity of hepatitis A virus 3C protein. J. Virol. 65:2595-2600. Joachims, M., Harris, K.S.,and Etchison, D. 1995. Poliovirus proteinase 3C mediates cleavage of microtubule-associated protein 4. Virology 211:451-461. Johannin, G. and Yon, J. 1966. Some evidence for the existence of two non-covalent complexes before the acylation step during the tryptic hydrolysis of benzoyl-arginine para-nitroanilide. Biochem. Biophys. Res. Commun. 25:320-325. Jupp, R.A., Phylip, L.H., Mils, J.S., Le Grice, S.F.J, and Kay, J. 1991a. Mutating P2 and PI rescues at cleavage junctions in the HIV-1 pol polyprotein: effects on hydrolysis by HIV-1 proteinase. FEBS Lett. 283:180-184. 124 Jupp, R.A., Richards, A.D., Phylip, L.H., Kay, J., Konvalinka, J., Strop, P., Kostaka, V., Scarborough, P.E., Farmerie, W.G. and Dunn, B.M. 1991b. Substrate cleavage by HIV-1 proteinase, p. 461-467. In B. M. Dunn (ed.), Structure and function of the aspartic proteinases. Plenum Press, New York. Karlstrom, A.R. and Levine, R.L. 1991. Copper inhibits the protease from human immunodeficiency vrius type 1 Gag proteins are preocessed in two cellular compartments. Proc. Natl. Acad. Sci. USA 88:4528-4532. Kasschau, K.D. and Carrington, J.C. 1995. Requirement for HC-Pro processing during genome amplification of tobacco etch potyvirus. Virology 209:268-273. Kay, J. and Dunn, B.M. 1990. Viral proteinases; weakness in strength. Biochem. Biophys. Acta 1048:1-18. Kean, K.M., Tetrina, N.L., Marc, D. and Girard. M. 1991. Analysis of putative active site residues of the poliovirus 3C protease. Virology 181:609-619. Khouri, H.E., Vernet, T., Menard, R., Parlati, F., Laflamme, P., Tessier, D.C, Gour-Salin, B., Thomas, D.Y. and Storer, A.C. 1991. Engineering of papain: selective alteration of substrate specificity by site-directed mutagenesis. Biochemistry 30:8929-8936. Kim, D.H., Han, J.S., Lew, J., Kim, S.S. Kang, B.H., Hwang, D.C, Jang, D.S., Kim, W., Song, B.D. and Choi, K.Y. 1998. Effects of mutations in the C-terminal region of NIa protease on cis-cleavage between NIa and Nib. Virology 241:94-100. Kim, D., Hwang, D.C, Kang, B.H., Lew, J., Han, J., Song, B.D. and Kwan, C. 1996. Effects of internal cleavages and mutations in the C-terminal region of NIa protease of turnip mosaic potyvirus on catalytic activity. Virology 226:183-190. Kim, J.L., Morgenstern, K.A., Lin, C, Fox, T., Dweyer, M.D., Landro, J.A., Chambers, S.P., Markland, W., Lepre, C.A., O'Malley, E.T., Harbeson, S.L., Rice, CM., Murcko, M.A., Caron, P.R. and Thomson, J.A. 1996. Crystal structure of the hepatitis C virus NS3 protease domain complexed with a synthetic NS4A cofactor peptide. Cell 87:343-355. Kim, D, Park, Y.S., Kim, S.S., Lew, J., Nam, H.G. and Choi, K.Y. 1995. Expression, purification and identification of a novel self-cleavage site of the NIa C-terminal 27-kDa protease of turnip mosaic potyvirus C5. Virology 213:517-525. Kirchweger, R., Ziegler, E., Lamphear, B. J., Waters, D., Liebig, H., Sommergruber, W., Sobrinto, F., Hohenadl, C, Blaas, D., Rhoads, R. E. and Skern, T. 1994. Foot and mouth disease virus leader proteinase: purification of the Lb form and determination of its cleavage site on elF-4y. J. Virol. 68:547-553. Koch, J.A. and Bartenschlager, R. 1997. Determinants of substrate specificity in the NS3 serine protease of the hepatitis C virus. Virology 237:78-88. 125 Kolykhalov, A.A., Agapov, E.V. and Rice, CM. 1994. Specificity of the heapatitis C virus NS3 serine protease: effects of substitutions at the 3/4A, 4A/4B, 4B/5A and 5A/5B cleavage sites on polyprotein processing. J.Virol. 68:7525-7523. Konig, H. and Rosenwirth, B. 1988. Purification and partial characterization of poliovirus protease 2A by means of a functional assay. J. Virol. 62:1243-1250. Konvalinka, J., Hroejsi, M. Andreansky, M., Novek, P., Pichova, I., Blaha, I., Fabry, M., Sedlacek, J., Foundling, S. and Strop, P. 1992. An engineered retroviral proteinase from myeloblastosis associated virus acquire pH dependence and substrate specificity of the HIV-1 proteinase. EMBO J. 11:1141-1144. Korant, B.D., Chow, N.L., Lively, M.O. and Powers, J.C. 1980. Proteolytic events in the replication of animal viruses. Ann. N.Y. Acad. Sci. 343:304-318. Kozak, M. 1987. An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Research 15:8125-8148. Krausslich, H. 1991. Human immunodeficiency virus proteinase dimer as component of the viral polyprotein prevents particle assembly and viral infectivity. Proc. Natl. Acad. Sci. USA 88:3213-3217. Kreiah, S., Strunk, G. and Cooper, J. I. 1994. Sequence analysis and location of capsid proteins within RNA-2 of strawberry latent ringspot virus. J. Gen. Virol. 75:2527-2532. Kujala P., Rikkonen M., Ahola, T, Kelve, M. and Kaariainen, L. 1997. Monoclonal antibodies specific for Semliki forest virus replicase protein nsP2. J. Gen. Virol. 78:343-351. Kunkel, T.A. 1985. Rapid and efficient site specific mutagenesis without phenotypic selection. Proc. Natl. Acad. Sci. USA 82:488-492. Laemmli, U.K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685. Lain, S., Riechmann, J.L. and Garcia, J.A. 1989. The complete nucleotide sequence of plum pox potyvirus. Virus Research 13:157-163. Lama, J., Paul, A.V., Harris, K.S. and Wimmer, E. 1994. Properties of purified poliovirus protein 3AB as substrate for viral proteinases and as co-factor for RNA polymerase 3Dpo1. J. Biol. Chem. 269:66-70. Latvala, S., Susi, P., Kalkkinen, N. and Lehto, K. 1998. Characterization of the coat protein gene of mite transmitted blackcurrant reversion associated nepovirus. Virus Research 53:1-11. Lawson, M. A. and Semler, B. L. 1991. Poliovirus thiol proteinase 3C can utilize a serine nucleophile within the putative catalytic triad. Proc. Natl. Acad. Sci. USA 88:9919-9923. 126 Lawson, M.A. and Semler, B.L. 1990. Picornavirus protein processing-enzymes, substrates and genetic regulation. Curr. Top, Microbiol. Immunol. 161:49-80. Lee, C. and Wimmer, E. 1988. Proteolytic processing of poliovirus polyprotein: ellimination of 2Apro-mediated alternative cleavage of polypeptide 3CD by in vitro mutagenesis. Virology 166:405-414. Lemm, J.A. and Rice, CM. 1993. Roles of nonstructural polyproteins and cleavage products in regulating Sindbis virus RNA replication and transcription. J. Virol. 67:1916-1926. Lepore, L.S., Roelvink, P.R. and Granados, R.R. 1996. Enhancin, the granulosis virus protein that facilitates nucleopolyhedrovirus (NPV) infections, is a metalloprotease. J. Invertebr. Pathol. 68:131-140. Lin, C , Amberg, S.M., Chambers, T.J. and Rice, CM. 1993a. Cleavage at a novel site in the NS4A region by the yellow fever virus NS2B-3 proteinase is a prerequisite for processing at the downstream 4A/4B signalase site. J. Virol. 67:2327-2335. Lin, C , Chambers, T.J. and Rice, CM. 1993b. Mutagenesis of conserved residues at the 3/4A and 4B/5 dibasic cleavage sites: effects on cleavage efficiency and polyprotein processing. Virology 192:596-604. Liu, S., Widom, J., Kemp, C.W., Crews, CM. and Clardy, J. 1998. Structure of Human methionine aminopeptidase-2 complexed with fumagillin. Nature 282:1324-1327 Lloyd, R.E., Grubman, M.J. and Ehrnefeld, E. 1988. Relationship of p220 cleavage during picornavirus infection to 2A proteinase sequences. J. Virol. 62:421-4223. Lloyd, R.E., Jense, H.G. and Ehrenfeld, E. 1987. Restriction of translation of capped mRNA in vitro as a model for poliovirus-induced inhibition of host cell protein synthesis: relationship to p220 cleavage. J. Virol. 1:2480-2488. Loeb, D.D., Swanstrom, R., Everitt, L., Manchester, M., Stamper, S.E. and Hutchison III, CA. 1989. Complete mutagenesis of the HIV-1 protease. Nature (London) 340: 397-400. Long, A.C, Orr, D.C, Cameron, J.M., Dunn, B.M. and Kay, J. 1989. A consensus sequence for substrate hydrolysis by rhinovirus 3C proteinase. FEBS Let. 258: 75-78. Love, R.A., Parge, H.E., Wickersham, J.A., Hostomsky, Z., Habuka, N., Moomaw, E.W., Adachi, T. and Hostomska, Z. 1996. The crystal structure of hepatitis C virus NS3 proteinase reveals a trypsin-like fold and a structural zinc binding site. Cell 87:331-342. Lowe, G. 1976. The cysteine proteinases. Tetrahedron 32:291-302. MacFarlane, S.A., Shanks, M., Davies, J.W., Zlotnick, A. and Lomonossoff, G.P. 1991. Analysis of the nucleotide sequence of bean pod mottle virus middle component RNA, Virology 183:405-413. 127 Mangel, W.F., McGrath, W.J., Toledo, D.L. and Anderson, CW. 1993. Viral DNA and a viral peptide are confactors of adenovirus virion proteinase activity. Nature (London) 361:274-275. Margis, R. and Pinck, L. 1992. Effect of site-directed mutagenesis on the presumed catalytic triad and substrate-binding pocket of grapevine fanleaf nepovirus 24-kDa proteinase. Virology 190:884-888. Margis, R., Ritzenthaler, C, Reinboly, J., Pinck, M. and Pinck, L. 1993. Genome organization of grapevine fanleaf nepovirus RNA-2 deduced from the 122 kDa polyprotein P2 in vitro cleavage products. J. Gen. Virol. 74:1919-1926. Margis, R., Viry, M., Pinck, M. and Pinck, L. 1991. Cloning and in vitro characterization of the grapevine fanleaf virus proteinase cistron. Virology 185: 779-787. Margis, R., Viry, M., Pinck, M., Bardonnet, N. and Pinck, L. 1994. Differential proteolytic activities of precursor and mature forms of the 24 K proteinase of grapevine fanleaf nepovirus. Virology 200:79-86. Mathews, D., Smith, W.W., Ferre, R.A., Codon, B., Budahazi, G., Sisson, W., Villafranca, J.E., Janson, C.A., McElroy, H.E., Gribskov, CL. and Worland, S. 1994. Structure of human rhinovirus 3C protease reveals a trypsin-like polypeptide fold, RNA-binding site and means for cleaving precursor polyprotein. Cell 77:761-771. Mavankal, G. and Rhoads, R.E. 1991. In vitro cleavage at or near the N-terminus of the helper component protein in the tobacco vein mottling virus polyprotein. Virology 185:721-731. Mayo, M.A. and Robinson, D.J. 1996. Nepoviruses: molecular biology and replication, in: The plant viruses (B. D. Harrison and A. F. Murant, eds.), pp. 139-185, Plenum. McQuade, T.J., Tomasselli, A.G., Liu, L., Karacostas, V., Moss, B., Sawyer, T.K., Heinrikson, R.L. and Tarpley, W.G. 1990. A synthetic HIV-1 protease inhibitor with antiviral activity arrest HIV-like particle maturation. Science 247:454-456. Medina, M., Domingo, E., Brangwyn, J. K. and Belsham, G. J. 1993. The two species of the foot and mouth disease virus leader protein expressed individually, exhibit the same activities. Virology 194:355-359. Menendez-Arias, L., Weber, IT. and Oroszlan, S. 1995. Mutational analysis of the substrate-binding pocket of murine leukemia virus protease and comparison with human immunodeficiency virus proteases. J. Biol. Chem. 270:29162-29168. Melancon, P. and Garoff, H. 1987. Processing of the Semliki forest virus structural polyprotein: role of the capsid protease. J. Virol. 61:1301-1309. Molla, A., Harris, K.S., Paul, A.V., Shin, S.H., Mugavero, J. and Wimmer, E. 1994. Stimulation of poliovirus proteinase 3Cpro-related proteolysis by the genome-linked protein VPg and its precursor 3AB. J. Biol. Chem. 269:27015-27020. 128 Morganstern, K.A., Landro, J.A., Hsiao, K., Lin, C, Gu, Y., Su, M.S. and Thomson, J.A. 1997. Polynucleotide modulation of the protease, nucleoside triphoshatase and helicase activities of a hepatitis C virus NS3-NS4A complex isolated from transfected COS cells. J. Virology 71:3767-3775. Morris-Krsinich, B.A.M., Forster, R.L.S. and Mossop, D.W. 1983. The synthesis and processing of the nepovirus grapevine fanleaf virus proteins in rabbit reticulocyte lysate. Virology 130: 523-529. Musil, D., Zucic, D., Turk, D., Engh, R.A., Mayr, I., Huber, R., Popovic, T., Turk, V., Towatari, T., Katanuma, N. and Bode, W. 1991. The fined 2.15A X-ray crystal structure of human liver cathepsin B: the structural basis for its specificity. EMBO J. 10:2321-2330. Navia, M.A., Fitzgerald, P.M.D., McKeever, B.M., Leu, C, Hemibach, J.C, Herber, W.K., Sigal, I.S., Darke, P.L. and Springer, J.P.. 1989. Three-dimensional structure of aspartyl protease from human immunodeficiency virus HJV-1. Nature (London) 337:615-620. Nestorowicz, A., Chambers, T. J. and Rice, C. M. 1994. Mutagenesis of yellow fever virus NS2A/2B cleavage site: effects on proteolytic processing, viral replication and evidence for alternative processing of the NS2A protein. Virology 199:114-123. Nicklin, M.J., Toyoda, H., Murray, M.G. and Wimmer, E. 1986. Proteolytic processing in the replication of polio and related viruses. Biotechnology 4:33-34. Nicolas, O. and Laliberte, J.F. 1992. The complete nucleotide sequence of turnip mosaic potyvirus RNA. J. Gen. Virol. 73:2785-2793. Nienaber, V.L., Breddam, K. and Birktoft, J.J. 1993. A glutamic acid specific serine protease utilizes a novel histidine triad in substrate-binding. Biocheistry 32:11470-11475. Oh, C. and Carrington, J.C. 1989. Identification of essential residues in potyvirus proteinase HC-Pro by site-directed mutagenesis. Virology 73: 692-699. Ohlendorf, D.H., Foundling, S.L, Wendoloski, J.J. Sedlacek, J., Strop, P. and Salemme, F.R. 1992. Structural studies of the retroviral proteinase from avian myelpblastosis asocitaed virus. Proteins Struct. Funct. Gent. 14:382-391. Oroszlan, S. and Luftig, R.B. 1990. Retroviral proteinases. Curr. Top. Microbiol. Immunol. 157:153-185. Paetzel, M., Dalbey, R.E. and Strynadka, N.C. 1998. Crystal structure of a bacterial signal peptidase in complex with a beta-lactam inhibitor. Nature 6707:186-190. Pallai, P.V., Burkhardt, F., Skoog, M., Schreiner, K., Baxt, P., Cohen, K.A., Hansen, G., Palladino, D.E.H., Harris, K.S., Nicklin, M.J. and Wimmer, E. 1989. Cleavage of synthetic peptides by purified poliovirus 3C proteinase. J. Biol. Chem. 264:9738-9741. 129 Palmenberg, A.C. and Rueckert, R.R. 1982. Evidence for intramolecular self-cleavage of picornaviral replicase processing enzyme. J. Virol. 41:244-249. Palmenberg, A.C, Kirby, E.M., Janda, M.R., Drake, N.L., Duke, G.D., Portratz, K.F. and Collet, M.S. 1984. The nucleotide and deduced amino acid sequence of the encephalomyocarditis viral polyprotein coding region. Nucleic acids. Research 12:2969-2985. Parks, T.D. and Dougherty, W.G. 1991. Substrate recognition by the NIa proteinase of two potyviruses involves multiple domains: characterization using genetically engineered hybrid proteinase molecules. Virology 182:17-27. Parks, T.D., Smith, H.A. and Dougherty, W.G. 1992. Cleavage profiles of tobacco etch virus (TEV)-derived substrates mediated by precursor and processed forms of the TEV NIa proteinase. J. Gen. Virol. 73:149-155. Parks, T.D., Howard, E.D., Wolpert, T.J., Arp, D.J. and Dougherty, W.G. 1995. Expression and purification of a recombinant tobacco etch virus NIa protease: biological analysis of the full-length and a naturally occurring truncated protease form. Virology 210:194-201. Paul, A.V., Boom, J.V., Filipov, D. and Wimmer, E. 1998. Protein-primed RNA synthesis by purified poliovirus RNA polymerase. Nature 393:280-284. Pearl, L.H. and Blundell, T. 1984. The active site of aspartic proteinases. FEBS lett. 174:96-101. Pearl, L.H. and Taylor, W.R. 1987. A Structural model for the retroviral proteases. Nature (London) 329:351-354. Pelham, H.R.B. 1979. Synthesis and proteolytic processing of cowpea mosaic virus proteins in reticulocyte lysates. Virology 96: 463-477. Pelham, H.R.B. 1978. Translation of encephalomyocarditis virus RNA in vitro yields an active proteolytic processing enzyme. Eur. J. biochem. 85:457-462. Peng, X.X. and Shih, D.S. 1984. Proteolytic processing of the proteins translated from the bottom component RNA of cowpea mosaic virus. J. Biol. Chem. 259:3197-3201 Perez. L. and Carrasco, L. 1992. Lack of direct correlation between p220 cleavage and shut-off of host translation after poliovirus infection. Virology 180:178-186. Peters, S.A., Voorhorst, W.G.B., Wery, J., Wellink, J. and Van Kammen, A. 1992a. A regulatory role for the 32K protein in proteolytic processing of cowpea mosaic virus polyproteins. Virology 191:81-89. Peters, S.A., Voorhorst, W.G.B., Wellink, J. and van Kammen, A. 1992b. Processing of the VPg containing polyproteins encoded by the B-RNA from cowpea mosaic virus. Virology 191: 90-97. 130 Petithory, J.R., Masiarz, F.R., Kirsch, J.F., Santi, D.V. and Malcolm, B.A. 1991. A rapid method for determination of endoproteinase substrate specificty: specificity of the 3C proteinase from hepatits A virus. Proc. Natl. Acad. Sci. USA 88:11510-11514. Piccone, M.E., Zellner, M., Kumosinski, T.F., Mason P.W. and Grubman, M.J. 1995. Identification of the active site residues of the L proteinase of foot and mouth disease virus. J. Virol 69: 4950-4956. Pinck, M., Reinbolt, J., Loudes, A.M., Le Ret, M. and Pinck, P. 1991. Primary structure and location of genome linked protein (VPg) of grapevine fanleaf virus. FEBS Letters 284:117-119. Pletnev, A.G., Yamshchikov, V.F. and Blinov, V.M. 1990. Nucleotide sequence of the genome and complete amino acid sequence of the polyprotein of tick-borne encephalitis virus. Virology 174:250-263. Ponz, F., Glascock, C.B. and Bruening, G. 1988. An inhibitor of polyprotein processing with the characteristics of a natural virus resistance factor. Mol. Plant-Microbe Interact. 1:25-31. Porter, A,G. 1993. Picornavirus nonstructural proteins: emerging roles in virus replication and inhibition of host cell functions. J. Virol. 67:6917-6921. Preugschat, F., Lenches, E.M. and Strauss, J.H. 1991. Flavivirus enzyme-substrate studies with chimeric proteinases: identification of an intragenic locus important for substrate recognition. J. Virol. 65:4749-4758. Preugschat, F., Yao, C. and Strauss, J.H. 1990. In vitro processing of dengue virus type 2 nonstructural proteins NS2A, NS2B and NS3. J. Virol. 64:4364-4374. Rabson, A.B. 1989. In "Aids Pathogeneisis and treatment" (J.A. Levy, ed.), p. 231-256. Dekker, New York. Rao, J.K.M., Erickson, J.W. and Wlodawer, A. 1991. Structural and evolutionary relationships between retroviral and eukaryotic aspartic proteinases. Biochemistry 30:4663-4671. Reichmann, J.L., Lain, S. and Garcia, J.A. 1992. Highlights and prospects of potyvirus molecular biology. J. Gen. Virol. 73:1-16. Restrepo-Hartwig, M.A. and Carrington, J.C. 1992. Regulation of nuclear transport of a plant viral protein by autoproteolysis. J. Virol. 66:5662-5666. Reuer, Q., Kuhn, R.J. and Wimmer, E. 1990. Characterization of poliovirus clones containing lethal and nonlethal mutations in the genome-linked protein VPg. J. Virol. 64:2967-2975. Rezelman, G., Van Kammen, A. and Wellink, J. 1989. Expression of cowpea mosaic virus M RNA in cowpea prototplasts. J. Gen. Virol. 70:3043. 131 Rice, CM., Lenches, E.M., Eddy, S.R., Shin, S.J., Sheets, R.L. and Strauss, J.H. 1985. Nucleotide sequence of yellow fever virus: implications for flavivirus gene expression and evolution. Science 229:726-733. Rice, CM., Levis, R., Strauss, J.H. and Huang, H.V. 1987. Production of infectious RNA transcripts from Sindbis virus cDNA clones: mapping of lethal mutations, rescue of a temperature-sensitive marker and in vitro mutagenesis to generate defined mutants. J. Virol. 61:3809-3819. Richards, A.D., Phylip, L.H., Farmerie, W.G., Scarborough, P.E., Alvarez, A., Dunn, B.M, Hirel, P., Konvalinka, J., Strop, P., Pavlickova, L., Kostka, V. and Kay, J. 1990. Sensitive, soluble chromogenic substrates for HIV-1 proteinase. J. Biol. Chem. 265:7733-7736. Ritzenthaler, C, Viry, M., Pinck, M., Margis, R., Fuchs, M. and Pinck, L. 1991. Complete nucleotide sequence and genetic organization of grapevine fanleaf nepovirus RNA1. J. Gen. Virol. 72:2357-2365. Robaglia, C, Durand-Tardif, M., Touchet, M., Boudazin, G., Astier-Manifacier, S. and Casse-Delbart, F. 1989. Nucleotide sequence of potato virus Y (N strains) genomic RNA. J. Gen. Virol. 70:935-947. Roberts, P.J. and Belsham, G. J. 1995. Identification of critical amino acids within the foot and mouth disease virus leader protein, a cysteine protease. Virology 213:140-146. Roberts, N.A., Martin, J.A., Kinchington, D., Broadhurst, A.V., Craig, J.C, Duncan, I.B., Glapin, S.A., Handa, B.K., Kay, J., Krohn, A., Lamber, R.W., Merrett, J.H., Mills, J.S., Parkes, K.E.B., Redshaw, S., Ritchie, A.J., Taylor, D.L., Thomas, G.J. and Machin, P.J. 1990. Rational design of peptide-based HIV proteinase inhibitors. Science 248:358-361. Rojas, M.R., Zerbini, F.M. Allison, R.F. Gilbertson, R.L. and Lucas, W.J. 1997. Capsid protein and helper component-proteinase function as potyvirus cell-to-cell movement proteins. Virology 237:283-295. Rott, M.E., Gilchrist, A., Lee, L. and Rochon, D.M. 1995. Nucleotide sequence of the Tomato ringspot virus RNA1. J. Gen. Virol. 76:465-473. Rott, M.E., Tremaine, J.H. and Rochon, D.M. 1991a. Comparison of the 5' and 3' termini of TomRSV RNA1 and RNA2: evidence for RNA recombination. Virology 185:468-472. Rott, M,E., Tremaine, J.H. and Rochon, D.M. 1991b. Nucleotide sequence of the tomato ringspot virus RNA2. J. Gen. Virol. 72:1505-1515. Rubinstein, S.L., Hammerie, T., Wimmer, E. and Dasgupta, A. 1992. Infection of HeLa cells with poliovirus results in modification of a complex that binds to the rRNA promoter. J. Virol. 66:3062-3068. Ryan, M.D. and Flint, M. 1997. Virus encoded proteinases of the picornavirus supergroup. J. Gen. Virol. 72:2727-2732. 132 Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecular Cloning: A Laboratory Manual, 2nd edn. New York: Cold Spring Harbour Laboratory. Sanfacon, H. 1995. Nepoviruses, in: Pathogenesis and host specificity in plant disease: histopathological, biochemical and molecular bases, Vol.III. Viruses and viroids (R.P. Singh, U.S. Singh and K. Kohmoto, eds) pp. 129-141, Pergamon Press, Oxford. Sanfacon, H., Wieczorek, A. and Hans, F. 1995. Expression of Tomato ringspot nepovirus movement and coat protein in protoplasts. J. Gen. Virol. 76:2299-2303. Schlesinger, S. and Schlesinger, M.J. 1990. Replication of togaviridae and flaviviridae, p. 697-710. In V. n. fields et al. (ed.) Virology, vol. 1, 2nd ed. Raven Press, New York. Schramm, H.J., Boetzel, J., Buttner, J., Fritsche, E., Gohring, W., Jaeger, E., Konig, S.. Thumfart, O., Wenger, T., Nagel, N.E. and Schramm, W. 1996. The inhibition of human immunodeficiency virus proteases by 'interface peptides". Antiviral Research 30:155-170. Scott, N.W., Cooper, J.I. and Edwards, M.L. 1993. The identification, cloning and seqquence analysis of the coat protein coding region of a birch isolate (12) of cherry leafroll nepovirus. Arch.Virol. 131:209-215 Sedlacek, J., Fabry, M., Coward, J.E., Horejsi, M., Strop, P. and Luftig, R.B. 1993. Myeloblastosis associated virus (MAV) proteinase site-mutated to be HIV-like has a higher activity and allows production of infectious but morphologically altered virus. Virology 192:667-672. Serghini, M.A., Fuchs, M., Pink, M., Reinbolt, J., Walter, B. and Oinck, L. 1990. RNA-2 of grapevine fanleaf virus: sequence analysis and coat protein cistron location. J. Gen. Virol. 71: 1433-1441. Shaad, M.C., Haldeman-Cahill, R., Cronin, S. and Carrington, J.C. 1996. Analysis ofthe VPg-proteinase (NIa) encoded by tobacco etch potyvirus: effects of mutations on subcellular transport, proteolytic processing and genome amplification. J. Virol. 70: 7039-7048. Shanks, M. and Lomonossoff, G.P. 1992. The nucleotide sequence of red clover mottle virus bottom component RNA. J. Gen. Virol. 73:2473-2479. Shanks, M., Stanley, J. and Lomonossoff, G.P. 1986. The primary structure of red clover mottle virus middle component RNA, Virology 155:697-703. Shirako, Y. and Strauss, J.H. 1994. Regulation of Sindbis virus RNA replication: uncleaved PI23 and nsP4 function in minus-strand RNA synthesis, whereas cleaved products from PI23 are required for efficient plus-strand RNA synthesis. J. Virol. 68:1874-1875. Shirako, Y. and Strauss, J.H. 1990. Cleavage between nsPl and nsP2 intiates the processing pathway of Sindbis virus nonstructural polyprotein P123. Virology 177:54-64. 133 Showe, M. and Black, L.W. 1973. Assembly core of bacteriophage T4: an intermediate in head formation. Nature (London) New Biol. 242:70-75. Showe, M.K., Isobe, E. and Onorato, L. 1976. Bacteriophage T4 prohead proteinase. II. Its cleavage from the product of gene 21 and regulation in phage-infected cells. J. Mol. Biol. 107:55-69. Showe, M.K. and Onorato, L. 1978. Kinetic factors and form determination of the head of bacteriophage T4. Proc. Natl. Acad. Sci. USA 75:4165-4169. Sielecki, A.R., Fujinaga, M., Read, R.J. and James, N.M.G. 1991. Refined structure of porcine pepsinogen at 1.8 A resolution. J. Mol. Biol. 219:671-692. Silen, J.L. and Agard, D.A. 1989. The a-lytic protease pre-region does not require a physical linkage to activate the protease domain in vivo. Nature (London) 341:462-464. Sircar, S., Ruzindana-Umunyana, A., Neugebauer, W. and Weber, J.M. 1998. Adenovirus endopeptidase and papain are inhibited by the same agents. Antiviral Res. 40:45-51. Skalka, A.M. 1989. Retroviral proteases: first glimpses at the anatomy of a processing machine. Cell 56:911-913. Skern, T., Sommergruber, W., Auer, H., Volkmann, P., Zorn, M., Liebig, H., Fessl, F., Blaas, D. and Kuechler, E. 1991. Substrate requirements of a human rhinoviral 2A proteinase. Virology 181:46-54. Sommergruber, W., Zorn, M., Blaas, D., Fessl, F., Volkmann, P., Maurer-Fogy, I., Pallai, P., Merluzzi, V., Matteo, M., Skern, T. and Kuechler, E. 1989. Polypeptide 2A of human rhinovirus type 2: identification as a protease and characterization by mutational analysis. Virology 169:68-77. Spall, V.E., Shanks, M. and Lomonossoff, G.P. 1997. Polyprotein processing as a strategy for gene expression in RNA Viruses. Semin. Virol. 8:15-23. Stace-Smith, R. 1984. Tomato ringspot virus. In: CMI7AAB Description of plant viruses, no. 290, Commonwealth Mycological Institute/Association of Appplied Biologists, Kew Surrey, England. Stewart, J.A. and Dobson, J.E., 1965. Trypsin-catalyzed hydrolysis of N-benzoly-L-arginine ethyl ester at low pH. Biochemistry 4:1086-1091. Stocks, CE. and Lobigs, M. 1998. Signal peptidasecleavage at the flavirus C-prM junction: dependence on the viral NS2B-3 protease for efficient processing requires determinants in C, the signal peptide and prM. J. Virol. 72:2141-2149. Stocks, CE. and Lobigs, M. 1995. Postranslational signal peptidase cleavage at the flavivirus C-prM junction in vitro. J. Virol. 69:8123-8126. 134 Strauss, E.G., De Groot, R.J., Levinson, R. and Strauss, J.H. 1992. Identification of the active site residues in the nsP2 proteinase of Sindbis virus. Virology 191:932-940. Strauss, J.H. and Strauss, E.G. 1990. Alphavirus proteinases. Semin. Virol. 1:347-356. Strauss, E.G. and Strauss, J.H. 1986. Structure and replication of the alphavirus genome, p. 35-90. In E. G. Strauss and J.H. Strauss (ed.) The Togaviridae and Flaviviridae. Plenum press, New York. Suciu, D., Chatterjee, S. and Inouye, M. 1997. Catalytic efficiency of signal peptidase I of Escherichia coli is comparable to that of members of the serine protease family. Protein Engineering 10:1057-1060. Summer, D.F. and Maizel, J. V. 1968. Evidence for large precursor proteins in poliovirus synthesis. Proc. Natl. Acad. Sci. USA 59:966-971. Sun, X., and d. Baltimore. 1989. Human immunodeficiency virus tat-activated expression of poliovirus protein 2A inhibits mRNA translation. Proc. Natl, Acad. Sci. USA 86:2143-2146. Swain, A.L., Miller, M.M., Green, J., Rich, D.H., Schneider, J., Kent, S.B.H. and Wlodawer. A., 1990. X-ray crystallographic structure of a complex between a synthetic protease of human immunodeficiency virus 1 and a substrate-based hyroxyethylamine inhibitor. Proc. Natl. Acad. Sci. USA 87:8805-8809. Takahashi, Y., Takahashi, T. and Uyeda, I. 1997. A cDNA clone to clover yellow vein potyvirus genome is highly infectious. Virus genes 14: 235-243. Tang, J., James, M.N.G., Hsu, I.N., Jenkins, J.A. and Blundell, T.L. 1978. Structural evidence for gene duplication in the evolution of the acid proteases. Nature (London) 271:618-622. Tang, J. and Wong, R.N.S. 1987. Evolution in the structure and function of aspartic proteases. J. Cell. Biochem. 33:53-63. Tanji, Y., Hijikata, M., Satoh, S., Kaneko, T. and Shimotohno, K. 1995. Hepatitis C virus-encoded nonstructural protein NS4A has versatile functions in viral protein processing. J Virol 69:1575-81. Tesar, M. and Marquardt, O. 1990. Foot-and-mouth disease virus protease 3C inhibits cellular transcription and mediates cleavage of histone H3. Virology 174:364-374. Thatch, R.E. 1992. Cap-recap: the involvement of the eUMFyin regulating gene expression. Cell 68:177-180. Thayer, M.M., Flaherty, K.M. and McKay, D.B. 1991. Three-dimensional structure of the elastase of Pseudomonas aeruginosa at 1.5-A resolution. J. Biol. Chem. 266:2864-2871. 135 Tomasselli, A.G., Hui, J.O., Sawyer, T.K., Staples, D.J., Bannow, C, Reardon, I.M., Howe, W.J., DeCamp, D.L., Craik, C.S. and Heinrikson, R.L. 1990. Specificity and inhibition of proteases from human immunodeficiency viruses 1 and 2. J. Biol. Chem. 265:14675-14683. Tomei, L., Failla, C, Santolini, E., De Francesco, R. and La Monica, N. 1993. NS3 is a serine protease required for processing of hepatitis C virus polyprotein. J. Virol 67:4017-4026. Tomei, L., Failla, C, Vitale, R.L., Bianchi, E. and De Francesco, R. 1996. A central hydrophobic domain of the hepatitis C virus NS4A protein is necessary and sufficient for the activation of the NS3 protease. J Gen Virol 77:1065-70. Tong, L., Wengler, G. and Rossman, M.G. 1993. Refined structure of the Sindbis virus core protein and comparison with other chymotrypsin-like serine protease structures. J. Mol. Biol. 230:228-247. Torruella, M., Gordon, K. and Hohn, T. 1989. Cauliflower mosaic virus produces an aspartic proteinase to cleave its polyproteins. EMBO J. 8:2819-2825 Toyoda, H., Nicklin, M.J.H., Murray, M.G. Anderson, C.W., Dunn, J.J., Studier, F.W. and Wimmer, E. 1986. A second virus-encoded proteinase involved in proteolytic processing of poliovirus polyprotein. Cell 45:761-770. Tritch, R.J., Cheng, Y.E., Yin, F.H. and S. Vitanen, S. 1991. Mutagenesis of protease cleavage sites in the human immunodeficiency virus type 1 gag polyprotein. J. Virol. 65:922-930. Urbani, A., Bianchi, B., Narjes, F., Tramontane A., De Francesco, R., Steinkuhler, C. and Pessi, A. 1997. Substrate specificity of the hepatitis C virus serine protease NS3. J. Biol. Chem. 272:9204-9209. Vakharia, V.N., DeVaney, M.A., Moore, D.M., Dunn, J.J. and Grubman, M.J. 1987. Proteolytic processing go foot-and-mouth disease virus polyproteins expressed in a cell-free system from clone-derived transcripts. J. Virol. 61:3199-3207. VanSlyke, J.K., Franke, CA. and Hruby, D.E. 1991. Proteolytic maturation of vaccinia virus core proteins; identification of a conserved motif at the N termini of the 4b and 25K virion proteins. J. Gen. Virol. 72:411-416. Ventoso, I., Barco, A. and Carrasco, L. 1998. Mutational analysis of poliovirus 2Apro. Distinct inhibitory functions of 2Apro on translation and transcription. J. Biol. Chem. 273:27960-27967. Verchot, J. and Carrington, J.C. 1995a. Debilitation of plant potyvirus infectivity by PI protease-inactivating mutations and restoration by second site modifications. J. Virol. 69:1582-1590. Verchot, J. and Carrington, J.C. 1995b. Evidence that the potyvirus PI proteinase functions in trans as an accessory factor for genome amplification. J. Virol. 69:3668-3674. Verchot, J., Koonin, E.V. and Carington, J.C. 1991. The 35-kDa protein from the N-terminus of the potyviral polyprotein functions as a third virus-encoded proteinase. Virology 185:527-535. 136 Verver, J., Goldbach, R., Garcia, J. A. and Vos, P., 1987, In vitro expression of a full-length DNA copy of cowpea mosaic virus B RNA: Identification of the B RNA encoded 24-kd protein as a viral protease. EMBO J. 6:549-554. Von der Helm, K. 1977. Cleavage of Rous sarcoma viral polypeptide precursor into internal structural proteins in vitro involves viral protein pl5. Proc. Natl. Acad. Sci. USA 74:911-915. Vos, P., Verver, J., Jaegle, M., Wellink, P. and Golbach, R. 1988. Two viral proteins involved in the proteolytic processing of the cowpea mosaic virus polyprotein. Nucleic Acids Research 16:1967-1985. Wang, A. 1999. Proteolytic processing and membrane association of tomato ringspot nepovirus RNA-1 encoded proteins. Ph.D. thesis. University of British Columbia. Wang, A., Carrier, K., Chisholm, J., Wieczorek, A., Huguenot, C. and Sanfacon, H. 1999. Proteolytic processing of tomato ringspot nepovirus 3C-like protease precursors: definition of the domains for the VPg, protease and putative RNA-dependent RNA-polymerase. J. Gen. Virol. 80:799-809. Warshel, A., Naray-Szabo, A., Sussman, F. and Hwang, J. 1989. How do serine proteases really work? Biochemistry 28:3629-3637. Wellink, J., Rezelman, G., Golbach, R. and Beyreuther, K. 1986. Determinants of the proteolytic processing sites in polyprotein encoded by the bottom-component RNA of cowpea mosaic virus. J. Virol. 59:50-58. Wengler, G., Czaya, G., Farber, P.M. and Hegemann, J.H. 1991. In vitro synthesis of West Nile virus proteins indicates that the amino-terminal segment of the NS3 protein contains the active centre of the protease, which cleaves the viral polyprotein after multiple basic amino acids. J. Gen. Virol. 72:851-858. Whithead, S.S. and Hruby, D.E. 1994. A transcriptionally controlled trans-processing assay: putative identification of a vaccinia virus proteinase which cleaves precursor protein P25K. J. Virol. 68:7603-7608 Wieczorek, A. and Sanfacon, H. 1993. Characterization and subcellular localization of tomato ringspot nepovirus putative movement protein. Virology 194:734-742. Wimmer, E., Hellen, C.U.T. and Cao, X.M. 1993. Genetics of poliovirus. Annual review in Genetics 27:353-346. Witte, O.N. and Baltimore, D. 1978. Relationship of retrovirus polyprotein cleavages in virion maturatin studied with temperature-sensitive murine leukemia virus mutants. J. Virol. 26:750-761. 137 Wlodawyer, A., Miller, M., Jaskolski, M., Sathyanarayana, B.K., Baldwin, E., Weber, I.T., Selk, L.M., Clawson, L., Schneider, J. and Kent, S.B.H. 1989. Conserved folding in retroviral proteases: crystal structure of a synthetic HIV-1 protease. Science 245:616-621. Wu, J., Adomat, J.M., Ridky, T.W., Louis, J.M., Leis, J., Harrison, R.W., Weber, I.T. 1998. Structural basis for specificity of retroviral proteases. Biochemistry 37:4518-4526. Wyckoff, E.E., Loyd, R.E. and Ehrenfeld, E. 1992. Relationship of eukaryotic initiation factor 3 to poliovirus-induced p220 cleavage activity. J. Virol. 66:2943-2951. Xiang, W., Cuconati, A., Hope, D., Kirkegaard, K. and Wimmer, E. 1998. Complete protein linkage map of poliovirus P3 proteins: interaction of 3Dpt>1 with VPg and with genetic variants of 3AB. J. Virol. 726732-6741. Xiang, W., Paul, A.V. and Wimmer, E. 1997. RNA signals in entero- and rhinovirus genome replication. Seminars in Virology 8:256-273. Yalamanchili, P., Harris, K., Wimmer, E. and Dasgupta, A. 1996. Inhibition of basal transcription by poliovirus: A virus-encoded protease (3Cpro) inhibits the formation of TBP-TATA box complex in vitro. J. Virol. 70:2922-2927. Yamshchikov, V.F. and Compans, R.W. 1993. Regulation of the late events in flavivirus protein processing and maturation. Virology 192:38-51. Yan, Y., Li, Y., Munshi, S., Sardana, V., Cole, J.L., Sardana, M., Steinkueler, C, Tomei, L., De Francesco, R., Kuo, L.C. and Chen, Z. 1998. Complex of NS3 protease and NS4A peptide of BK strain hepatitis C virus: a 2.2 A resolution structure in a hexagonal crystal form. Protein Science 7:837-847. Yepes, L.M., Fuchs, M., Slightom, J.L. and Gonsalves. 1996. Sense and antisense coat protein gene constructs confer high levels of resistance to tomato ringspot nepovirus in transgenic Nicotiana species. Phytopathology 86:417-424. Ypma-Wong, M.F., Dewalt, P.G., Johnson, V.H., Lamb, J.G. and Semler, B.L. 1988a. Protein 3CD is the major poliovirus proteinase responsible for cleavage of the PI capsid precursor. Virology 166:165-270. Ypma-Wong, M.F., Filman, D.J., Hogle, J.M. and Semler, B.L. 1988b. Structural domains of the poliovirus polyprotein are major determinants for proteolytic processing at Gln-Gly pairs. J. Biol. Chem. 263, 17846-17856. Yu, S.F. and Lloyd, R.E. 1992. Characterization of the roles of conserved cysteine and histidine residues in poliovirus 2A protease. Virology 186:725-735. Yu, S.F. and Lloyd, R.E. 1991. Identification of essential amino acid residues in the functional activity of poliovirus 2A protease. Virology 182:615-625. Zhang, R., Durkin, J., Windsor, W.T., McNemar, C, Ramanathan, L. and Le HV. 1997. Probing the substrate specificity of hepatitis C virus NS3 serine protease by using synthetic peptides. J. Virol. 71:6208-6213. Zhong, W. and Benkovic, S.J. 1998. Development of an internally quenched fluorescent substrate for Eschericia coli leader peptidase. Anal. Biochem. 255:66-73. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0089214/manifest

Comment

Related Items