Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Pore-forming ability and topological structure of the C-terminal domain of the Bordetella Pertussis Autotransporter… Shannon, Jennifer Louise 1999

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1999-0623.pdf [ 6.13MB ]
Metadata
JSON: 831-1.0089199.json
JSON-LD: 831-1.0089199-ld.json
RDF/XML (Pretty): 831-1.0089199-rdf.xml
RDF/JSON: 831-1.0089199-rdf.json
Turtle: 831-1.0089199-turtle.txt
N-Triples: 831-1.0089199-rdf-ntriples.txt
Original Record: 831-1.0089199-source.json
Full Text
831-1.0089199-fulltext.txt
Citation
831-1.0089199.ris

Full Text

Pore-forming Ability and Topological Structure of the C-terminal Domain of the Bordetella pertussis Autotransporter BrkA by JENNIFER L O U I S E S H A N N O N B . S c , The University of British Columbia, 1996 A THESIS S U B M I T T E D IN P A R T I A L F U L F I L M E N T O F T H E R E Q U I R E M E N T S FOR T H E D E G R E E OF M A S T E R O F S C I E N C E in T H E F A C U L T Y OF G R A D U A T E STUDIES Department of Microbiology & Immunology We accept this thesis as conforming to the required standard T H E UNIVERSITY O F BRITISH C O L U M B I A October 1999 © Jennifer Louise Shannon, 1999 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, 1 agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. (Signature) ^simm ILLA „ ^Xi^x/riryum Department of [\\rrO^olofl^ 4-Xvwmi>jq 0)1 The University of British Columbia Vancouver, Canada Date Pel, I F , mq DE-6 (2/88) Abstract One of the many virulence factors of Bordetella pertussis, the causative agent of whooping cough, is BrkA, which is involved in adherence and mediates resistance to antibody-dependent killing by complement. BrkA is a 103 kDa outer membrane protein that is proteolytically processed into a 73 kDa N-terminal domain and a 30 kDa C-terminal domain. It is also a member of the autotransporter family of proteins. With autotransporters, translocation of their N-terminal domains across the outer membrane is hypothesized to occur through a pore formed by their C -terminal domains, which adopt an amphipathic 6-barrel structure. However, neither pore-forming ability nor this topology has ever been shown for any of the autotransporters. To test pore formation by the BrkA C-terminal domain, black lipid bilayer experiments were performed, where insertion of pore-forming proteins into an artificial membrane causes measurable jumps in conductance. A His-tagged fusion form of the protein formed channels with an average size of 3.0 nS. Similar results were obtained with the fusion protein that was eluted from an S D S - P A G E gel. The addition of the 73 kDa BrkA N-terminal protein that had been purified in a similar way to the fusion protein, showed no increases in conductance; channels were again observed after addition of the BrkA C-terminal protein to the system. Similar results were obtained with protein from a clone containing a vector without the brkA insert. These results show that the C-terminal autotransporter domain of BrkA is capable of forming a pore. BrkA C-terminal protein that was purified from the outer membrane also formed channels. However, the protein could not be completely separated from other proteins that when extracted from a vector-only clone showed some pore-forming activity, although to a lesser extent. This data suggests that the BrkA C -terminal domain does form a pore in the outer membrane. To determine the topology of the BrkA C-terminal domain, a transposon-based method of generating 31 a.a. tags was employed because it produces random in-frame insertions. Four different insertions were obtained, but only two were in-frame. The anti-31 a.a. tag antibody worked in Western blots, but did not work in immunofluorescence, so the tag could not be localized. The results obtained from expression experiments confirmed the position of a transmebrane strand and a loop region, which agreed with my proposed model. ii Table of Contents Abstract ii Table of Contents iii List of Tables v List of Figures vi List of Abbreviations viii Acknowledgements x 1. Introduction 1.1. Bordetella pertussis pathogenesis 1 1.2. Autotransporters 4 1.3. Goals of the project 12 2. Materials & Methods 2.1. Bacterial strains and growth conditions 13 2.2. Reagents 13 2.3. DNA techniques 13 2.4. Construction of clones 15 2.5. Protein purification 17 2.6. Outer membrane separation 17 2.7. Extraction of outer membrane proteins with Octyl-POE 18 2.8. SDS-PAGE and Western blotting 18 2.9. N-terminal sequencing 19 2.10. Dot blot analysis 19 2.11. Black lipid bilayer analysis 19 2.12. A.DE3 lysogenization 20 2.13. Generation of 31 a.a. insertions with XTnphoA/in 21 2.14. Immunofluorescence 24 iii 3. Results 3.1. Black lipid bilayer analysis of the BrkA C-terminal domain 26 3.1.1. Purification of the BrkA C-terminal domain from RF1065 26 3.1.2. Black lipid bilayer analysis of the BrkA C-terminal protein from RF1065 26 3.1.3. Black lipid bilayer analysis of the BrkA N-terminal protein and protein from a vector-only clone 29 3.1.4. Isolation of the BrkA C-terminal domain from JS1025 35 3.1.5. Black lipid bilayer analysis of the BrkA C-terminal protein from JS1025 37 3.2. Mapping the topology of the BrkA C-terminal domain 37 3.2.1. Generation of 31 a.a. insertions in the BrkA C-terminal domain 41 3.2.2. Characterization of 31 a.a. inserts in the BrkA C-terminal domain 41 4. Discussion 4.1. Pore-forming ability of the BrkA C-terminal domain 52 4.2. Topology of the BrkA C-terminal domain 55 4.3. Conclusions and future directions 59 References 61 iv List of Tables Table 1. Autotransporters of Gram-negative bacteria 5 Table 2. Bacterial strains and plasmids used in this study 14 Table 3. Pore sizes of various proteins 53 List of Figures Fig . 1. Model of autotransporter export 7 Fig. 2. Preliminary topological model of the B r k A C-terminal domain 9 Fig. 3. Alignment of the C-terminal domains of selected autotransporters 10 F ig . 4. Construction of pJS1025 16 Fig. 5. Generation of 31 a.a. insertions using XTnphoA/'m 22 F ig . 6. Structure of transposon TnphoA/in 23 Fig. 7. Diagram of BrkA E. coli clones used in this study i 27 Fig. 8. S D S - P A G E and Western blot analysis of protein purified from RF1065 28 Fig. 9. Black lipid bilayer analysis of BrkA C-terminal protein from RF1065 30 Fig. 10. Distribution of single channel conductance measurements for BrkA C-terminal protein from RF1065 31 Fig. 11. Black lipid bilayer analysis of gel purified BrkA C-terminal protein from RF1065 32 Fig. 12. Black lipid bilayer analysis of BrkA N-terminal protein 33 Fig. 13. Black lipid bilayer analysis of a vector-only clone : 34 Fig. 14. S D S - P A G E and Western blot analysis of outer membrane preparations 36 Fig. 15. Black lipid bilayer analysis of heated BrkA C-terminal protein from JS1025 38 Fig. 16. Black lipid bilayer analysis of unheated BrkA C-terminal protein from JS1025 39 Fig. 17. Black lipid bilayer analysis of protein from JS 11 40 Fig. 18. Topological model of the BrkA C-terminal domain showing the position of the 31 a.a. inserts 42 Fig. 19. Western blot analysis of inserts E l and H5 43 Fig. 20. Western blot and S D S - P A G E analysis of inserts E l , H5, H20 and K25 45 vi Fig. 20. Western blot and S D S - P A G E analysis of inserts E l , H5, H20 and K25 45 Fig. 21. Western blot analysis of inserts E l , H5, H20 and K25 46 Fig. 22. Translation of D N A sequence from insert H20 47 Fig. 23. Translation of D N A sequence from insert K25 48 Fig. 24. Western blot and S D S - P A G E analysis of newly retransformed inserts E l and H5 50 Fig. 25. Alternative topological model of the B r k A C-terminal domain 51 vii List of Abbreviations a.a. amino acid Ab antibody A M P adenosine monophosphate A m p R ampicillin resistant B S A bovine serum albumin C m R chloramphenicol resistant D N A deoxyribonucleic acid D N T dermonecrotic toxin E D T A ethylenediaminetetraacetic acid F H A filamentous hemagglutinin FITC fluorescein isothiocyanate GentR gentamicin resistant G T P guanosine triphosphate His histidine H P L C high performance liquid chromatography IgA immunoglobulin A IgG immunoglobulin G E L - l interleukin-1 IPTG isopropyl B-D-thiogalactopyranoside K a n R kanamycin resistant kDa kilodalton mAb monoclonal antibody Na l R nalidixic acid resistant nS nanoSiemen N T A nitrilotriacetic acid viii Octyl-POE n-Octylpolyoxyethylene O D 6 0 0 optical density at 600 nm P A G E polyacrylamide gel electrophoresis PBS phosphate-buffered saline PCR polymerase chain reaction PMSF phenylmethylsulfonyl fluoride R G D arginine-glycine-aspartate RNA ribonucleic acid SDS sodium dodecyl sulphate TCF tracheal colonization factor TCT tracheal cytotoxin VLA-5 very late antigen-5 XP 5-bromo-4-chloro-3-indolyl phosphate toluidine salt Acknowledgements I would like to thank the following people for all of their help and support: my supervisor, Dr. Rachel Fernandez; lab members, David Oliver, George Huang, Colin Crist, Carrie Mathewson, Ken Lee and Linda Voda; my advisory committee members, Dr. Bob Hancock and Dr. John Smit; Hancock lab members, Manjeet Bains and Fiona Brinkman; and my family, who were always there when I needed them. Financial support for this project was provided by the Natural Sciences and Engineering Research Council. x 1. Introduction 1.1. Bordetella pertussis pathogenesis Bordetella pertussis is a Gram-negative bacterium that is the causative agent of whooping cough or pertussis. Although thought of by many in developed countries to no longer be a problem, world-wide there are 20-40 million cases and 200,000-300,000 deaths per year (World Health Organization, 1999). Even though pertussis is most commonly seen in children, it is estimated that about 30% of adults with a persistent cough actually have pertussis (Deville et al., 1995). This infection of adults, which often goes unrecognized due to the atypical presentation of symptoms (Yaari et al., 1999), has serious implications for the maintenance and spread of B. pertussis in the population, as it only infects humans (Robbins, 1999). Even though there is a high degree of immunization in some developed countries, such as Canada, the U.S. and the Netherlands, there has been an increase in the number of cases of pertussis in these places (Mooi et al, 1998). It has been postulated that this is due to antigenic drift of various virulence factors, so that they are no longer the same as those found in the vaccines. While the vaccines that have been in use prevent some of the more serious symptoms of the disease (Cherry, 1996), immunity to infection appears to last only a few years. Natural infection by B. pertussis was thought to confer life-long protection, but waning immunity is seen in this case as well (Cherry, 1996). Besides possible antigenic changes, lack of protection against infection may also be related to the number and redundancy of virulence factors found in B. pertussis. In order to establish infection in the upper respiratory tract, B. pertussis must be able to both attach itself strongly to the epithelial cells and to elude various components of the immune system. B. pertussis contains several toxins which subvert the host defenses in various ways (Weiss, 1997). Pertussis toxin affects many signal transduction pathways by modifying G T P -binding proteins and is necessary for the development of lethal infection in infant mice (Weiss and 1 Goodwin, 1989). Among its many effects are prevention of the chemotactic migration of neutrophils, monocytes, lymphocytes and natural killer cells to the site of infection (Weiss, 1997). Adenylate cyclase toxin also interferes with cell signalling by increasing the level of cyclic A M P in various eukaryotic cells (Confer and Eaton, 1982). This inhibits chemotaxis and killing by polymorphonuclear leukocytes and induces apoptosis, or programmed cell death, in macrophages (Khelef and Guiso, 1995). In infant mice, adenylate cyclase toxin was found to be necessary for colonization (Goodwin and Weiss, 1990) and lethal infection (Weiss and Goodwin, 1989). Dermonecrotic toxin (DNT), so-called because of the skin lesions it causes in infant mice, has not been extensively studied in B. pertussis, but it is not required for lethal infection as shown by the infant mouse model (Weiss and Goodwin, 1989). In B. bronchiseptica, D N T has been shown to modify the small GTP-binding protein Rho, which induces actin stress fibre formation (Horiguchi et al., 1997) and membrane organelle proliferation (Senda et al., 1997) in various host cells. Tracheal cytotoxin (TCT), which consists of shed fragments of peptidoglycan, immobilizes the ciliated cells that line the respiratory tract and eventually leads to their death. It induces IL-1 in these cells (Heiss etal, 1993) and in conjunction with LPS , induces nitric oxide (NO) production by other epithelial cells (Strauss, 1999). Production of both EL-l and N O has been implicated in the destruction of the ciliated cells. As well, T C T severely affects the functioning of neutrophils, although not through the stimulation of IL-1 production (Cundell et al., 1994). The destruction of epithelial cells by T C T helps B. pertussis colonization by facilitating attachment through the other main group of virulence factors, the adhesins. The major adhesin appears to be filamentous hemagglutinin (FHA), a 220 kDa.protein that contains at least four different binding sites, one of which has an affinity for ciliated cells (Liu et al., 1997). F H A was found to adhere to both laryngeal and bronchial epithelial cells (van den Berg et al., 1999), which further supports that it has a significant role in colonization of the entire respiratory tract. 2 In comparison to F H A , fimbriae were found to only interact with laryngeal epithelial cells (van den Berg et al, 1999). The fimbrial adhesins are different from F H A in that they are produced in two antigenically distinct types and undergo phase variation. Also, fimbriae are composed of major and minor subunits. Both have been found to bind sulfated sugars (Geuijen et al., 1996, 1997), but the minor subunit also binds V L A - 5 (Hazenbos et al., 1995), a receptor found on epithelial and macrophage cells. B. pertussis contains a third group of adhesins, which includes pertactin, tracheal colonization factor (TCF) and BrkA. They all contain arginine-glycine-aspartate (RGD) sequences that could be involved in adhesion. R G D motifs of other proteins have been shown to mediate adherence through interaction with host cell receptors called integrins (Ruoslahti et al., 1996). However, the mechanism of adhesion for these three proteins has not yet been fully determined. In the case of pertactin, there are conflicting results about the involvement of the R G D sequence in adherence. It was shown to be involved in adherence of mammalian cells to the purified protein (Leininger et al., 1991), but mutation of its R G D motif to R G E did not affect the adhesiveness of E. coli HB101 cells, which were engineered to express the protein (Everest etal., 1996). . Besides their involvement in adhesion, these three proteins also share structural similarities. They are all proteolytically processed from larger precursors at both the N- and C-terminal ends and contain proline-rich N-terminal regions. In the case of pertactin, processing produces a 60 kDa N-terminal domain and a 30 kDa C-terminal domain, although the N-terminal domain migrates at an apparent molecular weight of 69 kDa in an S D S - P A G E gel (Charles et al., 1994). This is most likely due to the B-helix structure that this proline-rich region adopts (Emsley et al., 1996). The N-terminal region remains loosely associated with the outside of the bacteria through an unknown mechanism and the C-terminal domain remains embedded in the outer membrane. Proteolytic processing of T C F results in a 34 kDa N-terminal domain, which migrates at an apparent molecular weight of 60 kDa in S D S - P A G E gels, and a 30 kDa C-terminal domain (Finn 3 and Stevens, 1995). The N-terminal domain most likely has a conformation similar to that of pertactin given this altered mobility. As its name implies, TCF is involved in the initial stages of infection. When a 5. pertussis strain lacking TCF was used to infect mice, 10 times fewer bacteria were found in the trachea as compared to a wild-type strain (Finn, and Stevens, 1995). In the case of BrkA, proteolytic processing results in a 68 kDa N-terminal domain (Shannon et al., 1998) and a 30 kDa C-terminal domain. As with the others, the N-terminal domain has altered mobility and migrates as an apparent 73 kDa protein (Fernandez and Weiss, 1994). The ability of BrkA to function as an adhesin is shown by the 50% reduction in adherence to lung fibroblast cells of a brkA mutant in comparison to a wild-type strain (Fernandez and Weiss, 1994). Besides the RGD sequence, BrkA also contains two putative glycosaminoglycan attachment sites, which could possibly be involved in adherence. Besides being an adhesin, BrkA is also responsible for resistance to killing by the classical complement pathway (Fernandez and Weiss, 1994). When exposed to normal human serum, brkA mutants were found to be 10-1,000 times more sensitive to killing by serum than wild-type (Fernandez and Weiss, 1994). As well, a strain lacking both BrkA and pertactin had the same survival rate as the brkA mutant, which shows that despite their similarities, pertactin has no role in serum resistance (Fernandez and Weiss, 1994). The importance of BrkA during infection is indicated by the result that a 10-fold greater amount of a brkA mutant was required to cause a lethal infection in infant mice in comparison to the wild-type (Weiss and Goodwin, 1989). Pertussis toxin and adenylate cyclase toxin were the only other virulence factors that affected the ability of B. pertussis to cause lethal infection in infant mice (Weiss and Goodwin, 1989). 1.2. Autotransporters BrkA, pertactin and TCF are part of a larger group of proteins called autotransporters. This family of extracellular proteins, most of which appear to be virulence factors, are found in a wide range of Gram-negative bacteria and have many different functions (Loveless, and Saier, 1997; Henderson et al, 1998). The autotransporters that have been identified to date are listed in Table 1. 4 Table 1. Autotransporters of Gram-negative bacteria Microorganism Protein Function References Bordetella bronchiseptica Bordetella parapertussis Bordetella pertussis Escherichia coli Haemophilus influenzae Helicobacter mustelae Helicobacter pylori Moraxella catarrhalis Neisseria gonorrheae Neisseria meningitidis Rickettsia spp. Salmonella enterica Pertactin P.68 Pertactin P.70 BrkA Pertactin P.69 T C F Vag8 AIDA-I Antigen 43 EspC EspP (PssA) Pet TibA Tsh Hap Hia Hsf IgA protease Hsr VacA UspAl UspA2 IgA protease IgA protease rOmpA rOmpB SlpT MisL adherence adherence serum resistance, adherence adherence adherence adherence? adherence adherence? unknown protease cytotoxin, mucinase adherence, invasion hemagglutination adherence, invasin unknown adherence cleavage of IgA ring-forming surface protein vacuolating cytotoxin adherence serum resistance cleavage of IgA cleavage of IgA adherence unknown surface layer protein unknown L i etal, 1992 L i etal., 1991 Fernandez et al., 1994 Charles etal., 1994 Finn etal., 1995 Finn et al, 1998 Suhr etal, 1996 Henderson etal, 1999 Stein etal, 1996 Brunder et al, 1997; Djafari etal, 1997 Eslava etal, 1998 Lindenthal et al, 1999 Provence etal, 1994 Hendrixson et al, 1997 St. Geme etal, 1996 St. Geme etal, 1996 Poulsen etal, 1989 O'Toole etal, 1994 Cover etal, 1994 Aebi etal, 1997 Aebi etal, 1998 Klauserefa/., 1993a Klausere/a/., 1993a L i et al, 1998 Hackstadt etal, 1992 Hahn etal, 1993 Blanc-Potard etal, 1999 Serratia marcescens Shigella flexneri Ssp Ssp-hl Ssp-h2 IcsA (VirG) SepA ShMu protease protease? protease? intracellular spread. tissue invasion? Miyazaki etal, 1989 Ohnishi et al, 1997 Ohnishi etal, 1997 Suzuki etal, 1995 Benjelloun-Touimi et al, 1995 hemagglutination? mucinase? Rajakumar et al, 1997 Besides BrkA, members of this diverse family include IgA proteases from Neisseria gonorrheae and Haemophilus influenzae; VacA, a vacuolating cytotoxin from Helicobacter pylori; the ATDA-I adhesin from Escherichia coli; IcsA from Shigella flexneri, which is involved in intracellular spread; the ring-forming protein from Helicobacter mustelae; Tsh, a temperature sensitive hemagglutinin from an avian E. coli strain; and EspP, an extracellular serine protease from enterohaemorrhagic E. coli. Despite their differences, the autotransporters are grouped together by the following three characteristics: (i) Most of the mature proteins are proteolytically processed into an approximately 30 kDa C-terminal domain and a much larger N-terminal domain; (ii) The C-terminal domains are predicted to form amphipathic 6-barrels in the outer membrane; and (iii) Export through the outer membrane does not require accessory proteins, hence the name autotransporters. In the proposed model of autotransporter secretion (Fig. 1; Klauser et al., 1993b), an N-terminal signal sequence enables translocation across the cytoplasmic membrane using the Sec or Type II secretion machinery. Once the protein is in the periplasm, the signal sequence is cleaved and the C-terminal domain then inserts itself into the outer membrane. It presumably forms a pore through which the N-terminal domain is exported by the formation of a hairpin loop. Cleavage of the N-terminal domain occurs after translocation through the outer membrane, either autoproteolytically or by another protease (Egile et al., 1997). Passage through the inner membrane using the Sec system is indicated by the presence in most of the proteins of an N-terminal signal sequence that shares at least some of the features of a typical sec-dependent signal peptide (Henderson et al., 1998). A few do not possess an obvious leader peptide and therefore it is possible that these proteins may cross the inner membrane by another mechanism. 6 ] O M ] IM Fig. 1. Model of autotransporter export. The N-terminal signal sequence allows passage of the entire protein through the inner membrane (IM). This is followed by cleavage of the signal peptide and insertion of the C-terminal domain (black) in the outer membrane (OM). The N-terminal domain (grey) is then exported through the pore formed by the C-terminal domain and is almost always cleaved once on the outside. This model was adapted from Klauser et al., 1993. 7 No matter how the proteins arrive in the periplasm, once there the C-terminal domain inserts itself into the outer membrane through the localization signal that is present at the extreme C-terminus. This signal is similar to those seen in other outer membrane proteins, such as the E. coli porin OmpF. Deletion of this sequence from the H. influenzae Hap autotransporter abolished outer membrane localization of the protein (Hendrixson et al., 1997). Computer programs, such as A M P H I , predict that the C-terminal domains form amphipathic 8-barrels in the outer membrane (Jose et al, 1995). This means that each B-strand has alternating hydrophobic and hydrophilic residues, with the hydrophobic ones pointing towards the membrane and the hydrophilic ones lining the inside of the barrel. My preliminary model of the BrkA C-terminal domain, which is mostly based on its amphipathicity profile, is shown in Fig. 2. Sequence alignment is also used to determine the position of the B-strands. Even though areas of conserved sequence among the C-terminal domains of the autotransporters tend to coincide with the positions of computer-predicted transmembrane strands (Henderson et al., 1998), they do not always agree. The alignment of several autotransporter sequences in relation to the computer predicted positions of the 6-strands for BrkA is shown in Fig. 3. Some of-the strands coincide perfectly, whereas others do not. The exact number and position of the B-strands has not yet been experimentally determined for any of the autotransporters. The B-barrel structure that the C-terminal domain most likely adopts is hypothesized to form a pore in the outer membrane through which the N-terminal domain is extruded (Klauser et al, 1993b). However, not all B-barrel proteins form pores (Pautsch and Schulz, 1998) and pore-forming ability has never been demonstrated for any of the autotransporter domains. One thing that is known about the export of the N-terminal domain is that there is a requirement for the passenger protein to be unfolded. This is evidenced by the results of an experiment in which cholera toxin was attached to the autotransporter domain of IgA protease (Klauser et al., 1990). Formation of disulfide bonds within the toxin molecule prevented its export, but translocation was seen when the 8 G K V K w S P H R COOH IN. R D E Y S A Y L N A G A G H ¥1 G H C R N V R D V G V N G I V Q p R' L| IG W | T , E Q I D A A L G K S F K G A L A I |R RI R R G L K G T A R S Y T R R A W GS S L A T N M A R Y G V W i L E s D R A L A V Q E T K P G V V E G R r D A R A F R G N W F D L G H G V G G D G G Y P A Y A T Y R V D G A l D Y N S I R H A R A Y D Q T V D N E L T G A I N G T G G !Y ! L Y > G! E Y 'L i I L ! L; G D •G - L T ! G; D V ;A • R L • Y! G R J W : W L R S G G A Y Q R Y D P GS Q Q R E S F T R A W P G ~GA: D . A ' R ! L! R ' L! E ; G""' L R K D Out Peri -A- NH, H G F i g . 2. Preliminary topological model of the BrkA C-terminal domain. This model was determined through the use of the AMPHI and G C G computer programs, which predict areas of amphipathicity, and areas of high surface probability and turns, respectively. The boxed areas represent 6-strands. Dashed boxes indicate less highly predicted strands, out: outside, peri: periplasm 9 c Fig. 3. Alignment of the C-terminal domains of selected autotransporters. The amino acid sequences were aligned using the GCG computer program and shaded to indicate similarity by Boxshade. Bars above the sequence indicate the position of the 6-strands in my proposed model of the BrkA C-terminal domain. The dashed bars represent less highly predicted strands. The arrow indicates the C-terminal proteolytic processing site. brka720: BrkA, prn620: pertactin, tcf380: TCF, tiba690: TibA, pet990: Pet 10 rt! J > < H fa fa * s s s < < P W W 2 J J J 4 4 4 2 2 2 w w w w w « « w j co < ra > > H O | > 4 I K E E J 2 << p; H e o ijyjjgrn ra o > < O M M O 5 B > g g | O ra P J E > H laaaaa f H fa fa >4 4 o o o O O O 0 1 O Q W t t t ] 2 W C5 r< W Q fa > H H fa g grans «c «:E aB3 w <! H B J !« J H < P I P I Pi P I > > > > H 0 > H > g A Pi Ui o o o o 5 O O Q • o < H R P K H H fa P fa o o o o o « W « M P l> 2 B a 2 H J C H ^ Pi K Pt O K Q Pi M Ui U < ra < a m < fa w w ffiOQJ ! H i* fa g: O C E E > -2 ra to O d! H E O < > O O K 2 2 K r t K Pi P E E E C H < »< a o H E E C O P E P < < 2 2 o O O O (J F T H «:n 2 M K f > 7 g t-l t-l H H H ro ro in CM VO in in ro ro m CM i n O O O H H H r l r l r l H ro ro m CM ro LO LO vo r- r-H i - l H H H O O CM oo ro CM CM CM CM rO CM CM CM CM CM oo oo o r> ro t*» f- oo 00 Cn CM CM CM CM CM o o o o o o O o O o o O CM o O CT| O CM o o c n O CM o O O l O CM o o c n O CM o o c n o CM o o c n O r> CM CO vo c n r» CM 00 vo c n r * CM 03 LO c n r> CM 00 LO c n r ~ CM 00 vo e n CM 00 vo OH id 10 r o id (Ti id LO r o id c n id VO r o id <T\ id vo r o id O l id vo r o i d c n id LO r o id c n a <H A A; a <H A3 4-> M-l XI •P a <u X l 4-> a VH Xt 4-> a XI 4-> U u O - r l M U 0 -H ID L| 0 •H <D u u u •H 0) u u O -H (D N u U •H CD XI ft 4 J 4 J a X i ft 4-> - U ft XI ft V • U ft XI 0 l 4 J •P ft X) a 4 J 4-1 ft X l a 4 J 4 J ft fusion protein was expressed in an E. coli strain that lacked the periplasmic enzyme that forms disulfide bonds. Cleavage of the N-terminal domain after translocation occurs with all but two of the autotransporters: Vag8, a protein from B. pertussis of unknown function (Finn and Stevens, 1998), and Hsr, the ring-forming surface protein from H. mustelae (O'Toole et al., 1994). As well, proteolytic processing of some of the proteins results in larger C-terminal domains, such as E. coli AEDA-I and H. pylori VacA, which are 47.5 (Suhr et ai, 1996) and 48 kDa (Cover et ai, 1994), respectively. Once cleaved, the functional N-terminal domains are either secreted into the surrounding media (Brunder etal., 1997) or remain associated with the bacteria . The mechanism of this adherence is unknown, but could be mediated through interaction with the C-terminal domain or some other outer membrane component. 1.3. Goals of the project Research of the various autotransporters has mainly focussed on the structure and function of the N-terminal domains of these proteins. Many details of the mechanism of export by the C -terminal domain, as well as its structure, have yet to be elucidated for any of the autotransporters., It is proposed that the C-terminal domain forms a multistranded 6-barrel in the outer membrane through which the N-terminal domain is exported. In this study, this hypothesis was tested for the B. pertussis autotransporter BrkA. The goals of this project were 1) to determine the pore-forming ability of the BrkA C-terminal domain through black lipid bilayer analysis and 2) to map the topology of this domain in the outer membrane through a transposon-based method of inserting 31 a.a. tags. 12 2. Materials & Methods 2.1. Bacterial strains and growth conditions The bacterial strains used in this study are listed in Table 2. E. coli cultures were grown at 37°C in Luria broth or on Luria agar supplemented with the following antibiotics at the indicated concentrations: ampicillin, 100 ug/ml; chloramphenicol, 34 ug/ml; and kanamycin, 50 ug/ml. B. pertussis cultures were grown at 37°C on Bordet-Gengou (BG) medium ( B B L , Cockseyville, Md.) containing 15% sheep blood (Western Biologicals, Calgary, Alta.) supplemented with the following antibiotics at the indicated concentrations: nalidixic acid, 30 ug/ml; and gentamicin, 10 ug/ml. After 3-4 days of growth (until hemolysis was detected) the bacteria were resuspended in Stainer-Scholte (SS) broth ( O D 6 0 0 of about 0.2) and pelleted for use as positive controls in Western blots. 2.2. Reagents Restriction enzymes and T4 D N A ligase were obtained from New England Biolabs (Mississauga, Ont.). Reagents for SDS-polyacrylamide gel electrophoresis and the Kaleidoscope Prestained Standards, which were used for molecular weight determination in Western blots, were obtained from Biorad (Hercules, Calif.). The Low Molecular Weight Electrophoresis Calibration Kit used as S D S - P A G E molecular weight markers were obtained from Amersham Pharmacia Biotech (Baie d'Urfe, Que.). All other reagents were obtained from Fisher Scientific Canada (Nepean, Ont.) or Sigma-Aldrich Canada (Oakville, Ont.), unless otherwise specified. 2.3. DNA techniques Purification of plasmid D N A was done using the Qiagen Spin Miniprep or the Qiagen Plasmid Midi kits (Qiagen, Mississauga, Ont.), according to the manufacturer's instructions. To screen large numbers of transformants, alkaline lysis (Sambrook et al., 1989) was used to isolate plasmids. Restriction enzyme digests were performed at 37°C for 1-2 hours or overnight. 13 Table 2. Bacterial strains and plasmids used in this study Strain or Plasmid Relevant Characteristics Reference or Source Strains B. pertussis D0676 E. coli BL21 DE3 pLysS CC118 CC118DE3 CC160 CC245 DH5cc D0218 JS1025 JS1033 JS1034 JS1035 JS11 JS13 RF1065 RF1066 Plasmids pET20b pET30b pRSETb pD0218 pJS1025 pRF1065 2 chromosomal copies of brkA in a pertactin mutant (BBC9); Nal R , GentR expression strain; ompTlon; DE3 lysogen expresses T7 R N A polymerase; pLysS (CmR) ReC, araDI39 A(ara-leu)7697 AlacX74 phoA20 galE galK thi rpsE rpoB argEam recAl CC118 w/ ADE3 lysogen Rec + , Dam", araDI39 A(ara-leu)7697 AlacX74 galE galK thi rpsL dam Kan R , supF supE hsdR galK trpR metB lacYtonA damr.kan cloning strain pD0218 in BL21 DE3 pLysS pJS1025 in BL21 DE3 pLysS pJS1025inCC118 pJS1025inCC160 pJS1025inCC118DE3 pET20b in BL21 DE3 pLysS pRSETb in BL21 DE3 pLysS pRF 1065 in BL21 DE3 pLy sS entire brk locus in D H 5 a cloning vector; T7 promoter; N-terminal PelB signal sequence for export past inner membrane; Amp R cloning vector; lilac promoter; N- and C-terminal His tags; Kan R cloning vector; T7 promoter; N-terminal His tag; Amp R Aft III - BamU I of brkA in pET30b; encodes first 694 a.a.; Kan R BamR I - Hind III of brkA in pET20b; encodes a.a. 694-1010; A m p R BamH. I - Hind III of brkA in pRSETb; encodes a.a. 694-1010; A m p R Shannon etal., 1998 Novagen Manoil etal., 1997 This study Manoil etal., 1997 Manoil etal, 1997 N E B Shannon etal., 1999 This study This study This study This study This study This study Shannon etal., 1999 Fernandez etal., 1998 Novagen Novagen Invitrogen Shannon etal., 1999 This study Shannon etal., 1999 14 Electrophoresis of D N A was carried out using 0.8% (w/v) agarose (SeaKem L E or SeaPlaque G T G , Mandel Scientific, Guelph, Ont.) gels in tris acetate buffer. The QIAquick Gel Extraction kit (Qiagen) was used for removal of agarose. Ligation was done at room temperature overnight using T4 D N A Ligase. Transformation was carried out as follows: competent cells and D N A were incubated on ice for 30 min., then shocked at 42°C for 40 sec. and placed back on ice for 2 min. 50-100 pi of L-broth was added and then the cells were incubated with shaking at 37°C for 1 hr. Al l of the suspension was then plated onto media containing the appropriate antibiotics and grown overnight at 37°C. Cells used in transformation were made competent by first growing them to an O D 6 0 0 of about 0.4-0.5. After centrifuging at 2,000 x g, the pellet was resuspended in ice cold 50 m M C a C l 2 and incubated on ice for 10 min. The cells were centrifuged again and resuspended in 50 m M C a C l 2 and 15% glycerol. Sequencing was performed by the Nucleic Acid/Protein Service Unit (NAPS, University of British Columbia). 2.4. Construction of clones RF1065 and D0218 are laboratory strains made by Rachel Fernandez and David Oliver, respectively. pRF1065, pD0218 and pJS1025 were subcloned from pRF1066 (Fernandez and Weiss, 1998). To construct pRF1065, brkA from the BamH I to the Hind III site, which represents amino acids 694-1010 of BrkA, was ligated to pRSETb (Invitrogen, Carlsbad, Calif.). This clone contains the C-terminal domain plus 37 a.a. that are upstream of the C-terminal processing site, as well as an N-terminal His tag. For pD0218, brkA from the Afl III to the BamH I site was ligated to pET30b (Novagen, Madison, Wis.). This clone contains the first 694 a.a. of BrkA with N- and C-terminal His tags. As with pRF1065, pJS1025 (Fig. 4) contains the terminal 316 a.a. of BrkA, but in pET20b (Novagen), a vector which encodes an N-terminal PelB signal sequence to allow export past the inner membrane. To enable cloning into the EcoR V and Hind III sites of pET20b, the overhang left by BamH I digestion was filled-in using the large (Klenow) fragment of D N A polymerase I (GibcoBRL, Burlington, Ont.) before digestion with Hind III. All constructs were transformed into E. coli BL21 DE3 pLysS cells (Novagen). 15 BamH I L Hind III EcoRW Hind III brkA pRF1066 I C-terminal processing site PelB pET20b Digest w/ BamH I Fill-in w/ Klenow Digest w/ Hind III Digest w/ ZscoR V Digest w/ Hind III Ligate PJS1025 C-terminal processing | site PelB signal sequence Fig. 4. Construction of pJS1025. The terminal 316 a.a. of BrkA was put into a vector encoding an N-terminal signal sequence to allow export of the protein past the inner membrane. 16 2.5. Protein purification Protein expression was induced with isopropyl 6-D-thiogalactopyranoside (IPTG) when the cultures reached an O D 6 0 0 of 0.6-0.8. Protein from RF1065 and D0218 was purified by denaturing N i + 2 - N T A purification using the Xpress System Protein Purification protocol (Invitrogen). In order to renature the protein, elution fractions containing the protein of interest were pooled and then slowly dialyzed against decreasing concentrations of urea in phosphate-buffered saline (PBS; 7.5 g/1 NaCl , 0.2 g/1 KC1, 0.2 g/1 K H 2 P 0 4 , 1.15 g/1 N a 2 H P 0 4 , pH 7.4). Essentially, 8 M urea was diluted at a rate of 1 ml/min by PBS during the dialysis. For RF1065, the final dialysis was done overnight against 0.1% Triton X-100, 10 m M Tris, pH 8.0. For D0218, the final dialysis was against PBS. A l l dialysis was performed at 4°C. For some experiments, the above protein from RF1065 and protein from outer membrane preparations of JS1025 and JS 11 (Sec. 2.6) were gel purified. In this case, protein was electrophoresed on an 11% polyacrylamide gel (Laemmli, 1970) and then a portion of the gel was stained with Coomassie brilliant blue so that it could be used as a guide for cutting the protein out of the unstained segment of the gel. The protein was eluted from the gel overnight at room temperature with 0.2-1 ml of 0.1% Triton X-100, 10 m M Tris, pH 8.0. 2.6. Outer membrane separation To separate the outer membranes of JS1025 and JS11, extraction with sarcosyl was performed. 20-40 ml cultures induced with IPTG were pelleted and resuspended in 5 ml of 10 mM Hepes, 20 ug/ml phenylmethylsulfonyl fluoride (PMSF). The cell suspension was then sonicated on ice for 20 x 5 sec. (power level 3, Sonicator Ultrasonic Processor X L , Misonix) and centrifuged for 2 min. to pellet debris. The supernatant was spun for 30 min. and the pellet resuspended in 500 pi of 10 m M Hepes. 500 pi of 2% (w/v) n-lauroyl-sarcosine was added to the resuspended pellet. After incubation at room temperature for 30 min., the mixture was centrifuged for 30 min. and the supernatant was removed. The pellet was washed with 500 pi of 10 mM Hepes and centrifuged for 30 min. Final resuspension of the pellet was in 75-120 pi of 10 mM Hepes. A l l centrifugation was carried out at >15,500 x g. 17 2.7. Extraction of outer membrane proteins with Octyl-POE In order to separate the BrkA C-terminal protein from E. coli outer membrane proteins, pellets obtained from sarcosyl extraction were subjected to treatment with n-Octylpolyoxyethylene (Octyl-POE; Bachem Bioscience, King of Prussia, Penn.) . Pellets of JS1025 and JS 11 were resuspended in 1.5 ml of 10 m M Tris, pH 8.0, 0.5% Octyl-POE, sonicated 3 x 10 sec. and centrifuged for 1 hr. The supernatant was removed and saved. The pellet was resuspended in 1.5 ml of 10 m M Tris, pH 8.0, 3% Octyl-POE, then sonicated 3 x 10 sec. and centrifuged for 1 hr. After removal and retention of the supernatant, the pellet was resuspended in 1.5 ml of 10 mM Tris, pH 8.0, 0.5% Octyl-POE, 50 m M E D T A . The suspension was sonicated 3 x 10 sec. and centrifuged for 1 hr., after which the supernatant was removed and retained. The pellet was finally resuspended in 50 ul 0.1% Triton X-100, 10 m M Tris, pH 8.0. All centrifugation was carried out at 125,000 x g (45,000 rpm) using rotor T L A 45 in a TL-100 Ultracentrifuge (Beckman). 2.8. SDS-PAGE and Western blotting Protein samples were analyzed by being resuspended in disruption buffer and run on an 11% SDS-polyacrylamide gel (Laemmli, 1970). Some of the samples were boiled for 10 min. before being run, while others were not boiled. The proteins were visualized following staining with Coomassie brilliant blue. In the case of Western blots, after electrophoresis was performed, the proteins were transferred to an Immobilon-P membrane (Millipore, Bedford, Mass.) at 100 V for 75 min. or 70 V for 3 hrs. by a wet transfer apparatus (Trans-Blot Electrophoretic Transfer Cell, Biorad) according to the manufacturer's instructions. After transfer, the membrane was blocked with a 5% (w/v) skim milk solution in blocking PBS (5.8 g/1 NaCl , 3.0 g/1 N a H 2 P 0 4 , 11.5 g/1 Na 2 HP0 4 ) for at least an hour at room temperature. Washing and antibody incubation were carried out in blot wash buffer, which is a solution of blocking PBS containing, 0.25% skim milk and 0.5% Tween 20. Mouse anti-BrkA C-terminal monoclonal antibody (a gift from Roger Parton, University of Glasgow), which was raised against the BrkA C-terminal domain isolated from the outer 18 membrane of B. pertussis, was used at a 1/15 or 1/30 dilution for 2 hrs. at 37°C. A polyclonal rabbit antibody that recognizes the 31 a.a. tag generated by XYnphpA/in mapping (Sec. 2.13) was used at a 1/1,000 or 1/2,000 dilution for 1-2 hrs. at room temperature or 37°C. Primary antibody incubation was followed by 30 min. of washing. Secondary antibody incubation with a 1/10,000 dilution of goat anti-mouse or anti-rabbit IgG conjugated to horse radish peroxidase (Cappel, ICN Biomedicals, Costa Mesa, Calif.) was carried out for 1 hr. at room temperature followed by 30 min. of washing. Renaissance Western blot chemiluminescence reagent ( N E N ™ Life Science Products, Boston, Mass.) was used for detection. Signal was recorded with X-ray film (Kodak, Rochester, N.Y.). 2.9. N-terminal sequencing S D S - P A G E was performed with unheated protein samples followed by transfer in the same way as for the Western blots. After transfer, the membrane was washed with distilled water (8 washes over 20 min.) and then stained for 1 min. with 0.025% Coomassie in 40% methanol. The membrane was destained for 5 min. with 50% methanol, air-dried and then the bands were excised and sent for N-terminal sequencing by NAPS. 2.10. Dot blot analysis Dot blots were performed by applying 5 pi of cells to prewet (with blocking PBS) Immobilon-P membrane. After air drying, the membranes were rewetted with blot wash buffer and then washed and incubated with antibody in the same manner as the Western blots. The anti-31 a.a. tag antibody was used at a 1/1,000 dilution and incubated at 37°C for 1 hr. 30 min. Detection was performed as stated above. 2.11. Black lipid bilayer analysis Black lipid bilayer experiments to measure the single channel conductance were performed as previously described (Benz and Hancock, 1981). Lipid bilayers of 1.5% (w/v) oxidized cholesterol in n-decane were formed across a 0.2 mm 2 hole between two chambers of a Teflon cell, 19 both of which contained 1 M KC1. Protein was added to one chamber and 50 mV was applied across the lipid bilayer. Conductance increases were then recorded. The average pore size of the BrkA C-terminal protein from RF1065 was calculated from 127 conductance increases obtained from two separate experiments. The D0218 N-terminal protein, which was previously dialyzed against PBS, was diluted in 0.1% Triton X-100, 10 m M Tris, pH 8.0 before black lipid bilayer analysis. 2.12. XDE3 lysogenization A.DE3 lysogenization of CC118 was performed in order to ensure efficient expression of the BrkA C-terminal domain construct (pJS1025), which contains a T7 promoter. X.DE3 was introduced into the chromosome of CC118 cells using the A.DE3 lysogenization kit (Novagen). The cells were grown in L-broth supplemented with 0.2% maltose and 10 m M M g S 0 4 to an O D 6 0 0 of 0.330. Next, 2 (il of cells were mixed with 108 pfu each of A.DE3, Helper phage and Selection phage. Helper phage provide the integrase function for XDE3 and Selection phage kill host cells lacking ADE3, but they cannot form lysogens themselves. The mixture was incubated at 37°C for 20 min. so that the phage could adsorb to the host. Several dilutions were plated and grown overnight at 37°C. Some of the surviving colonies were then tested for lysogenization through the use of Tester phage, which cannot infect cells unless they contain active T7 R N A polymerase. Candidates were grown in L-broth with 0.2% maltose, 10 m M M g S 0 4 to an O D 6 0 0 of 0.35-0.5. 100 ul of cells were then mixed with 100 ul of a 10"7 dilution of Tester phage and incubated at 37°C for 20 min. Molten top agarose (1% tryptone, 0.5% NaCl , 0.6% agarose) was added to each tube and poured on L-agar plates with or without IPTG to check for induction of T7 R N A polymerase through the production of plaques. The lysogen that produced small plaques in the absence of 20 IPTG (<2 mm in diameter) and larger plaques in the presence of IPTG (>4 mm in diameter) was chosen and named CC118 DE3. 2.13. Generation of 31 a.a. insertions with XTnphoA/in Insertions in the BrkA C-terminal domain were generated following the method of Manoil and Bailey (1997), which is illustrated in Fig. 5. This method uses A, phage to deliver a modified version of transposon Tn5, which encodes promoterless alkaline phosphatase, into cells carrying the target gene on a plasmid. This allows for blue/white screening of colonies with transposon insertions. The requirement for alkaline phosphatase activity ensures that in-frame insertions will be obtained. Excision of the majority of the transposon sequence leaves behind a 31 a.a. tag, which can be recognized by an antibody. XTnphoA/'m (Fig. 6) phage were grown on CC245 cells and stocks were created according to Protocol I for preparing plate lysate stocks (Sambrook et al., 1989). JS1033, JS1034 and JS1035 cells were grown overnight to stationary phase in L-broth with 0.2% maltose. Phage were mixed with the host cells at a multiplicity of infection of 0.1-0.3 phage/cell and then the mixture was incubated at 37°C for 10 min. 400-800 pi of L-broth was added and the suspension was grown overnight at 30°C on a roller. The mixture was plated onto L-agar plates containing ampicillin and elevated levels of chloramphenicol (100 pg/ml) to select for cells with transposon insertions, especially those with insertion of ISphoAI'm. After 2 days of growth at 30°C, the colonies were scraped off the plate and plasmid DNA was purified. CC118 and CC118 DE3 cells were transformed and plated on L-agar plates minus NaCl and plus sucrose (5%, w/v), ampicillin (100 pg/ml), chloramphenicol (34 pg/ml) and 5-bromo-4-chloro-3-indolyl phosphate toluidine salt (XP, 40 pg/ml). Sucrose selects for left-end insertions over full transposon insertions and XP is a substrate that when cleaved by alkaline phosphatase produces a blue colour. These plates were incubated overnight at 37°C. Full-length transposons cannot be fully removed by BamH I digestion to create the 31 a.a. tag. Colonies that turned blue, either overnight or after several days 21 BamU I BamU I 'phoA cat neo sacB + PJS1025 Infect cells carrying pJS 1025 I with XYnphoA/'m y Select for left-end insertions BamU I BamR I PJS1025 Isolate D N A from blue, Kans transformants Digest with BamR I & ligate I 93 bp insertion I PJS1025 I Fig.. 5. Generation of 31 a.a. insertions using XlnphoAI'm. In-frame insertion of the left-end insertion sequence (ISphoA/'m) into the target gene is selected for and then insertions of interest are converted to the 31 codon form. 22 BamH I BamH I 'phoA cat^ neo sacB ^np ISphoA/in Fig. 6. Structure of transposon TnphoA/'m. 'phoA: promoterless alkaline phosphatase, cat: chloramphenicol resistance, neo: kanamycin resistance, sacB: sucrose sensitivity, tnp: transposase 23 at room temperature, were picked and tested for kanamycin sensitivity. Clones with insertion of only ISphoA/in are sensitive to kanamycin. Plasmid preps were done with blue, kanamycin sensitive clones and restriction mapping was carried out. Inserts in BrkA were converted to 31 a.a. inserts through BamH I digestion followed by ligation. Sequencing of the insertion site was done using the primer 5' - C G G G A T C C C C C T G G A T G G - 3 ' , which is complementary to part of the insertion. The XTnphoA/'m construct, as well as the E. coli strains CC118, CC160 and CC245, were generous gifts from Dr. Colin Manoil (University of Washington). 2.14. Immunofluorescence Indirect immunofluorescence was performed to localize the 31 a.a. tag. For surface staining, 25-100 pi of cells were pelleted and washed with PBS (Sec. 2.5). The cells were incubated at 37°C with a 1/100 dilution of primary antibody for 30-60 min and then washed 3 times with PBS. Secondary antibody incubation with a 1/100 dilution of goat anti-rabbit IgG conjugated to fluorescein isothiocyanate (FITC; Cappel) was carried out at 37°C for 30 min. followed by washing 3 times with PBS. The pellet was resuspended in 25 ul of PBS and 2-5 pi was added to poly-L-lysine coated slides. A coverslip was then added and sealed with nail polish. For periplasmic/cytoplasmic staining, cells were added to poly-L-lysine coated slides and allowed to sit 10-20 min. or until dry. The cells were then fixed with either 3.7% paraformaldehyde for 30-60 sec. followed by 20 sec. of ice-cold acetone or with the acetone alone. The slides were rinsed briefly with PBS and then water between the paraformaldehyde and the acetone treatments. After the acetone, the slides were rinsed in water then PBS and allowed to air dry. The cells were then blocked with 0.5% B S A in PBS for 10 min. or 3% B S A in PBS for 30 min. Primary and secondary antibody incubations were carried out for 30 min. Al l blocking and antibody incubations were done in a humidified chamber at 37°C. The slides were rinsed with water and PBS after antibody exposure. 5 pi of mounting media (50% glycerol in PBS) was then added to each well before adding the coverslip. All antibodies used in the above procedures were. 24 diluted with 0.6% BSA in PBS. As a positive control for the procedure, RF1066 cells were stained using a rabbit anti-BrkA N-terminal antibody. 25 3. Results 3.1. Black lipid bilayer analysis of the BrkA C-terminal domain The C-terminal domains of the autotransporters are thought to act like channels in the outer membrane, through which the N-terminal domains of the proteins are exported. However, this has never been shown for any of the autotransporters. In order to determine the pore-forming ability of the C-terminal domain of the B. pertussis autotransporter BrkA, black lipid bilayer experiments were performed. With this technique, putative channel-forming proteins are tested for the ability to insert into artificial lipid bilayers. If the protein can form a pore, this allows the flow of ions across the membrane, which causes a measurable increase in conductance. Black lipid bilayer analysis of the BrkA C-terminal domain from RF1065, which is expresssed as a His-tagged fusion protein, and from JS1025, which is exported to the outer membrane, was performed. 3.1.1. Purification of the BrkA C-terminal domain from RF1065 To purify the recombinant His-tagged protein from RF1065 (Fig. 7), denaturing nickel chromatography was performed, followed by overnight dialysis against slowly decreasing concentrations of urea and finally against 0.1% Triton X-100, 10 m M Tris, pH 8.0. The results of this purification are seen in Fig. 8. The S D S - P A G E gel of pooled elution fractions after dialysis (Fig. 8b) shows a 37 kDa band, which corresponds to the size of the BrkA C-terminal domain (30 kDa) along with the 37 a.a. upstream from the processing site (Fig. 7) and the His tag. The Western blot (Fig. 8b) with anti-BrkA C-terminal monoclonal antibody confirms that the BrkA C -terminal protein was isolated. 3.1.2. Black lipid bilayer analysis of the BrkA C-terminal protein from RF1065 The pore-forming ability of the BrkA C-terminal protein from RF1065 was assessed through black lipid bilayer analysis. Addition of the protein to a 1 M KC1 solution bathing a membrane of 1.5% oxidized cholesterol in n-decane with an applied voltage of 50 mV, caused 26 D0218 RF1065 JS1025 N-I I 694 731 1-c 1010 § C-terminal proteolytic processing site ^ Outer membrane localization signal BrkA Fig. 7. Diagram of BrkA E. coli clones used in this study. Numbers below the boxes refer to amino acids. 27 (a) sO o 94-M £ (b) «n O .. „ „„, , 1 67- ~" 1 43-78-30- — 39.5-20.1- — 30.7-14.4-Fig. 8. SDS-PAGE and Western blot analysis of protein purified from RFl065. (a) SDS-P A G E gel stained with Coomassie Blue showing pooled fractions of BrkA C-terminal protein obtained from denaturing Ni+2 chromatography after dialysis. Dialysis was performed slowly at 4°C, against decreasing concentrations of urea and finally against 0.1% Triton X-100, 10 mM Tris, pH 8.0. M : Low Molecular Weight markers with weights shown in kDa (Pharmacia) (b) Western blot of BrkA C-terminal protein (same as in (a)). Detection was performed with an anti-BrkA C-terminal monoclonal antibody. Kaleidoscope Prestained Standards (Biorad) were used for molecular weight determination with weights shown in kDa. 28 stepwise increases in conductance (Fig. 9). This indicates that channels were being formed in the membrane. The distribution of these conductance measurements is shown in Fig. 10. The average single channel conductance of the BrkA C-terminal protein in 1 M KC1 was found to be 3.0 nanoSiemens (nS). This average was calculated from 127 conductance increases obtained from two separate experiments. Similar sized channels were also observed when BrkA C-terminal protein from a second purification was used. To help rule out the possibility of contaminants in our protein preparation, I performed black lipid bilayer experiments with BrkA C-terminal protein that had been further purified by being cut and eluted out of an S D S - P A G E gel. Addition of this protein caused similar sized increases in conductance (Fig. 11) to those seen previously. This indicates that the channels seen are being formed by the BrkA C-terminal protein and not by possible contaminants. 3.1.3. Black lipid bilayer analysis of the BrkA N-terminal protein and protein from a vector-only clone RF1065 overexpresses the BrkA C-terminal protein in the form of inclusion bodies, which necessitated purification under denaturing conditions. Porin proteins may contaminate preparations when proteins are produced in inclusion bodies (Hancock, 1999). In order to ensure that these results were not due to possible contaminants, the BrkA N-terminal protein from D0218 (Fig. 7) was purified in a similar way to that of the C-terminal protein. The BrkA N-terminal protein is also expressed in inclusion bodies and is not a pore-forming protein. Addition of the N-terminal protein diluted in 0.1% Triton X-100, 10 m M Tris, pH 8.0 caused no increases in conductance (Fig. 12), even when large amounts of the protein were added. Upon addition of the BrkA C-terminal protein from RF1065 to the system (Fig. 12), channels were again observed. As another control for the protein purification method, a black lipid bilayer experiment was performed with protein that had been purified from a vector-only clone (JS13; does not contain brkA insert) in the same manner as the BrkA C-terminal protein. Increases in conductance were not observed upon addition of protein from JS13 (Fig. 13). Addition of BrkA C-terminal protein again 29 2nS Fig. 9. Black lipid bilayer analysis of BrkA C-terminal protein from RF1065. Single channel conductance measurements after addition of protein to a 1 M KC1 solution bathing a membrane of 1.5% oxidized cholesterol in n-decane. There was an applied voltage of 50 mV. 35 -, 1.0- 1.6- 2.2- 2.8- 3.4- 4.0- 4.6-1.4 2.0 2.6 3.2 3.8 4.4 5.0 Pore Size (nS) Fig. 10. Distribution of single channel conductance measurements for BrkA C-terminal protein from RF1065. nS: nanoSiemens 31 I Fig. 11. Black lipid bilayer analysis of gel purified BrkA C-terminal protein from RF1065. Single channel conductance measurements were recorded after addition of protein that had been further purified by elution from an SDS-PAGE gel. Protein was added to a 1 M KC1 solution bathing a membrane of 1.5% oxidized cholesterol in n-decane. There was an applied voltage of 50 mV. The arrows indicate stepwise increases in conductance. nS: nanoSiemens 32 2nS I D0218 T RF1065 • Fig. 12. Black lipid bilayer analysis of BrkA N-terminal protein . Single channel conductance measurements were recorded after addition of first BrkA N-terminal protein (D0218) and then BrkA C-terminal protein (RF1065). Protein was added to a 1 M KC1 solution bathing a membrane of 1.5% oxidized cholesterol in n-decane. There was an applied voltage of 50 mV. Protein from D0218 was purified in a similar way to protein from RF1065. N-terminal protein was diluted in 0.1% Triton X-100, 10 mM Tris, pH 8.0 before addition. nS: nanoSiemens 33 Fig. 13. Black lipid bilayer analysis of a vector-only clone. Single channel conductance measurements were recorded after addition of first protein from a clone containing the vector alone (JS13) and then BrkA C-terminal protein (RF1065). Protein was added to a 1 M KC1 solution bathing a membrane of 1.5% oxidized cholesterol in n-decane. There was an applied voltage of 50 mV. Protein from JS13 was purified in the same way as protein from RF1065. nS: nanoSiemens 34 caused the appearance of channels (Fig. 13). Both of these results help to rule out contaminants as the source of the channels seen with the BrkA C-terminal protein from RF1065. 3.1.4. Isolation of the BrkA C-terminal domain from JS1025 The BrkA C-terminal protein from JS1025 (Fig. 4 and 7) is properly processed and exported to the outer membrane. This is demonstrated in Fig. 14, which shows the results of outer membrane extractions of JS1025 and JS 11 (vector alone) with sarcosyl. S D S - P A G E of the insoluble fractions shows a 30 kDa band in the heated sample from JS1025, which is not present in the heated sample from JS11 (Fig. 14a). The 30 kDa size of the band corresponds to that of the processed form of the BrkA C-terminal domain. The identity of this band as the BrkA C-terminal protein is confirmed by Western blot with the anti-BrkA C-terminal monoclonal antibody (Fig. 14b). The BrkA C-terminal protein from JS1025 does not have any tags that would assist in purification of the protein, and therefore purification was performed by cutting and eluting out of an S D S - P A G E gel. This method worked well in isolation of the protein from heated samples, but heating of proteins before S D S - P A G E results in denaturation of the proteins, which are then usually inactive in black lipid bilayer experiments. As can be seen in Fig. 14a, the BrkA C-terminal domain co-migrates with at least one other protein if the sample is not heated before being run on an S D S - P A G E gel. In order to try and separate these proteins, Octyl-POE extraction of outer membrane preparations was performed. This did not remove the co-migrating proteins and therefore these proteins were N-terminally sequenced to try to identify them. Sequencing identified OmpA, which occasionally forms channels, but they are usually smaller (Table 3) and so they might not interfere in black lipid bilayer experiments. Therefore, the 30 kDa region from unheated samples of both JS1025 and JS11 were also purified by cutting out of an S D S - P A G E gel for use in black lipid bilayer analysis. 35 (a) JS11 JS1025 U H U H JS1025 19.7 -Fig. 14. SDS-PAGE and Western blot analysis of outer membrane preparations, (a) SDS-PAGE gel of pellets obtained from JS1025 and JS11 after sarcosyl extraction. The samples were either heated (H) or not heated (U) before loading. The proteins were visualized with Coomassie blue and molecular weights (in kDa) were determined by Low Molecular Weight markers (Pharmacia), (b) Western blot of samples obtained from sarcosyl extraction of JS1025 and JS11. Soluble (SN) and insoluble (P) fractions extracted from IPTG-induced (+) and uninduced (-) cultures were heated before loading. Detection was performed with an anti-BrkA C-terminal monoclonal antibody. Kaleidoscope Prestained Standards (Biorad) were used for molecular weight determination (in kDa). The arrow indicates the 30 kDa band in the heated JS1025 sample. 36 3.1.5. Black lipid bilayer analysis of the BrkA C-terminal protein from JS1025 Four separate black lipid bilayer experiments were performed with the BrkA C-terminal protein that had been heated before being eluted out of an SDS-PAGE gel. There were a few jumps in conductance that could possibly indicate pores (Fig. 15), but the large amount of noise seen made it difficult to determine the presence of channels. Non-native forms of pore-forming proteins can disturb the membrane and cause large fluctuations in conductance, which suggests that the majority of the protein was denatured. With the unheated protein from JS1025 and JS 11, seven and five black lipid bilayer experiments were performed, respectively. As can be seen in Fig. 16, the addition of BrkA C-terminal protein from JS1025 caused the formation of channels of a similar size to those seen with the protein from RFl065. However, larger channels were also sometimes seen with the control (JS11, Fig. 17). These figures represent the trials that gave the best results, but they were not typical. In the other trials, there was more noise and the channels would appear more sporadically. Overall, 85 pores in 142 min. (average rate of 0.6/min.) were seen with the BrkA C-terminal protein, as compared to 31 pores in 198 min. with the control (0.16/min.). This indicates, although not conclusively, that the BrkA C-terminal domain obtained from the outer membrane has pore-forming ability. 3.2. Mapping the topology of the BrkA C-terminal domain The C-terminal domains of the autotransporters are predicted to. form multistranded 6-barrels in the outer membrane. This same basic structure appears to be common to all outer membrane proteins, as it has been found in all that have been studied to date (Pautsch and Schulz, 1998). The computer-predicted models of these proteins give a general idea of their structure, but as evidenced by the recently published structures of OmpA (Pautsch and Schulz, 1998) and FepA (Buchanan et al., 1999), they can be wrong. In the case of the autotransporters, none of the proposed structures have been tested yet. In order to do this for the BrkA C-terminal domain, a transposon-based method of generating 31 a.a. insertions was chosen to map the topology. 37 I 2nS i Fig. 15. Black lipid bilayer analysis of heated BrkA C-terminal protein from JS1025. The protein from sarcosyl insoluble fractions was heated prior to elution from an SDS-PAGE gel. Single channel conductance measurements were recorded after addition of protein to a 1 M KC1 solution bathing a membrane of 1.5% oxidized cholesterol in n-decane. There was an applied voltage of 50 mV. nS: nanoSiemens 38 J2nS Fig. 16. Black lipid bilayer analysis of unheated BrkA C-terminal protein from JS 1025. Protein migrating at 30 kDa in unheated sarcosyl insoluble fractions was eluted from an SDS-PAGE gel. Single channel conductance measurements were recorded after addition of this protein to a 1 M KC1 solution bathing a membrane of 1.5% oxidized cholesterol in n-decane. There was an applied voltage of 50 mV. This recording represents the best of seven trials. nS: nanoSiemens 39 Fig. 17. Black lipid bilayer analysis of protein from JS11. Protein migrating at 30 kDa in unheated sarcosyl insoluble fractions from a vector-only clone was eluted from an SDS-P A G E gel. Single channel conductance measurements were recorded after addition of this protein to a 1 M KC1 solution bathing a membrane of 1.5% oxidized cholesterol in n-decane. There was an applied voltage of 50 mV. This recording represents the best of five trials. nS: nanoSiemens 3.2.1. Generation of 31 a.a. insertions in the BrkA C-terminal domain The general method used to generate insertions in the BrkA C-terminal domain is summarized in Fig. 5. Four separate rounds of infection of cells carrying pJS1025 with XTnphoA/in (Fig. 6) were carried out. After transformation and selection on X P plates, the number of colonies per plate ranged from 100-1000 and 0-33 of the colonies were blue. However, some colonies that were originally white turned blue a few days later. Overall, insertions in four different places were obtained, all of which are clustered near the N-terminal of the protein. The positions of these insertions in relation to my proposed model are shown in Fig. 18. Sequencing of other candidate insertions showed that four others were in the same position as E l , one other was in the same place as H5, four others shared the same position as H20 and three others were located in the same place as K25. These additional insertions in each position were obtained from transformation of D N A from the same round of infection. Therefore, they most likely represent siblings and not independent insertions into the same site. Insertions that produced blue colonies were also found in one other place on the plasmid and this was in the ampicillin resistance gene. However, the 72 insertions in this site did not abolish resistance to ampicillin. 3.2.2. Characterization of 31 a.a. inserts in the BrkA C-terminal domain The first two insertions that I obtained were E l and H5 (Fig. 18). E l is located in a putative transmembrane strand and H5 is located in a loop predicted to be on the outside of the cell. To determine protein expression in E l and H5, Western blots were performed using an anti-BrkA C-terminal mAb. As can be seen in Fig. 19, there is very little expression in E l , but there is good expression in H5. Inserts in a transmembrane strand should disrupt the structure and lead to degradation of the protein, whereas inserts in a loop region should not affect expression of the protein. Therefore, these Western blots support the proposed respective positions of E l and H5 in a transmembrane strand and a loop region. Western blots done with samples from induction of the inserts a few months after the initial characterization showed that they were no longer expressing the protein. Therefore, new 41 G K V K w S P F I H N A I G R Y D R G Y A S A F Y C O O H E Y S A Y L N K G N G A G A G H R H C R V A V I V Q p G A L A I ( N 1 R D V T R L G W T Q E D A A L G K S F K R R R R S Y T R R A W G rS S L A T N M A R Y G V W L E S D R A L A V Q E T K P G V V E G R r D A R KJ A F R G N W F D L H V G G Y A A Y V G D G D V R G T L A T D E N L P T G A I N Y Q L G R Y D Q H G G G N S I R G H D A G R P A Y Y T D R Q D T A V Y S T _ G ' i E E f > G I D Y G : L L G • G ; A ' Y! W ; "R" S G A G S L I R W Q Q R E S F T \ W P G _ C JA D A R L R L E G \ L R K D N H , (K25) Fig. 18. Topological model of the B r k A C-terminal domain showing the position of the 31 a.a. inserts. This model was determined through the use of computer-predicted areas of amphipathicity, high surface probability and turns. The boxed areas represent 6-strands. Dashed boxes indicate less highly predicted strands. Inserts are indicated by the circles. 42 Fig. 19. Western blot analysis of inserts E l and H5. Expression of BrkA C-terminal protein containing 31 a.a. tags was determined through Western blots with the anti-BrkA C-terminal mAb. The numbers underneath the bar represent the time (in hours) after IPTG induction. Kaleidoscope Prestained Standards (Biorad) were used for molecular weight determination (in kDa). D0676: B. pertussis brkA^ strain 43 transformants were made from the D N A used to originally sequence the inserts. A Western blot was then performed using the anti-31 a.a. tag Ab (Fig. 20a). Despite the presence of nonspecific bands, after induction E l and H5 have bands of the right size that do not show up in the others. Expression in H5 does not appear to be as good as that seen in Fig. 19 with the anti-BrkA C -terminal mAb and there is no expression seen with H20 and K25. As well, a 50-60 kDa protein appears in the S D S - P A G E gel after induction of H5 (Fig. 20b) that does not correspond to the band seen in the Western blot. To further characterize these inserts, immunofluorescence with the anti-31 a.a. tag Ab was performed. A standard procedure that had previously worked with a variety of proteins and cell types was used. As a control for the procedure, immunofluorescence of cells producing full-length BrkA (RFl066) using an anti-BrkA N-terminal Ab was performed. In this case, both surface and interior staining were seen. Surface staining of the inserts was performed twice on different samples, but there was no signal seen with any of them. Interior staining was performed three times and fluorescence of debris only was seen in all of the samples, even the negative controls. The fixing procedure seemed to disrupt most of the cells, so whether or not the cells fluoresced could not be determined. To ascertain if the lack of fluorescence with the inserts was due to the antibody or a problem with expression, a Western blot with anti-BrkA C-terminal mAb was done again (Fig. 21). This showed that none of the inserts were expressing the protein. Since H20 and K25 showed no expression in Western blots using the BrkA or 31 a.a. tag Abs, the D N A sequences of all of the inserts were analyzed to see if they were out of frame. This was not done previously because the requirement for active alkaline phosphatase should result in in-frame insertions. Translation of the sequences from H20 and K25 (Figs. 22 and 23) showed that the inserts were out of frame beginning at the junction of the brkA and insertion sequences. Since E l and H5 appeared to have stopped expressing the protein, they were retransformed from D N A used originally for sequencing. Western blots were performed with two E l and two H5 44 H20 K25 F i g . 20. Western blot and SDS-PAGE analysis of inserts E l , H5, H20 and K25. Expression of the 31 a.a. tag was determined through Western blot with the anti-31 a.a. tag Ab. (a) Western blot, (b) SDS-PAGE gel stained with Coomassie blue after transfer. Kaleidoscope Prestained Standards (Biorad) were used for molecular weight determination (in kDa). The arrow indicates the 50-60 kDa band in the IPTG-induced H5 sample. -: no IPTG; +: IPTG added 45 Fig. 21. Western blot analysis of inserts E l , H5, H20 and K25. Expression of the BrkA C-terminal containing 31 a.a. inserts was determined through Western blot with the anti-BrkA C-terminal mAb. Kaleidoscope Prestained Standards (Biorad) were used for molecular weight determination (in kDa). -: no IPTG; +: IPTG added 46 TTAACTTTAAGAAGGAGATATACATATGAAATACCTGCTGCCGACCGCTGCTGCTGGTTT + + + + + + AATTGAAATTCTTCCTCTATATGTATACTTTATGGACGACGGCTGGCGACGACGACCAAA L T L R R R Y T Y E I P A A D R C C W F * L * E G D I H M K Y L L P T A A A G L N F K K E I Y I * N T C C R P L L L V C GCTGNTCCTCGCTGCCCAGCCGGCGATGGCCATGGATGATCCGAAGACGCATGTCTGGAG + + + + + + CGACNAGGAGCGACGGGTCGGCCGCTACCGGTACCTACTAGGCTTCTGCGTACAGACCTC A ? P R C P A G D G H G * S E D A C L E L ? L A A Q P A M A M D D P K T H V W S 7 S S L P S R R W P W M I R R R M S G A CTTGCAGCGCGCGGGCCAGGCCCTGTCGGGGGCGGCCAATGCCGCCGTGAACGCGGCGGA + + + + + + GAACGTCGCGCGCCCGGTCCGGGACAGCCCCCGCCGGTTACGGCGGCACTTGCGCCGCCT L A A R G P G P V G G G Q C R R E R G G L Q R A G Q A L S G A A N A A V N A A D C S A R A R P C R G R P M P P * T R R I TCTTTCCAGCATCGCCCTGGCCGAGTCCAACGCGCTGGACAAGCGCCTGGGCCTGACTCT + + + + + + AGAAAGGTCGTAGCGGGACCGGCTCAGGTTGCGCGACCTGTTCGCGGACCCGGACTGAGA S F Q H R P G R V Q R A G Q A P G P D S L S S I A L A E S N A L D K R L G L T L F P A S P W P S P T R W T S A W A * L L TATACACAAGTAGCGTCCTGGACGGACNTTT + + +_ ATATGTGTTCATCGCAGGACCTGCCTGNAAA Y T Q V A S W T D ? I H K * R P G R T F Y T S S V L D G ? Fig. 22. Translation of D N A sequence from insert H20. A primer complimentary to part of the 31 a.a. tag was used to obtain D N A sequence upstream of the tag. The reading frame of the BrkA C-terminal domain is indicated in blue. The reading frame of the tag is indicated in red. 47 AGGAGATATACATATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGC + + + + + + TCCTCTATATGTATACTTTATGGACGACGGCTGGCGACGACGACCAGACGACGAGGAGCG R R Y T Y E I P A A D R C C W S A A P R G D I H M K Y L L P T A A A G L L L L A E I Y I * N T C C R P L L L V C C S S L TGCCCAGCCGGCGATGGCCATGGATGATCCGAAGACGCATGTCTGGAGCTTGCAGCGCGC + + + + + + ACGGGTCGGCCGCTACCGGTACCTACTAGGCTTCTGCGTACAGACCTCGAACGTCGCGCG C P A G D G H G * S E D A C L E L A A R A Q P A M A M D D P K T H V W S L Q R A P S R R W P W M I R R R M S G A C S A R GGGCCAGGCCCTGTCGGGGGCGGCCAATGCCGCCGTGAACGCGGCGGATCTTTCCAGCAT + + + + + + CCCGGTCCGGGACAGCCCCCGCCGGTTACGGCGGCACTTGCGCCGCCTAGAAAGGTCGTA G P G P V G G G Q C R R E R G G S F Q H G Q A L S G A A N A A V N A A D L S S I A R P C R G R P M P P * T R R I F P A S CGCCCTGGCCGAGTCCAACGCCTGACTCTTATACACAAGTAGCGTCCTGGACGGAACCTN + + + + + + GCGGGACCGGCTCAGGTTGCGGACTGAGAATATGTGTTCATCGCAGGACCTGCCTTGGAN R P G R V Q R L T L I H K * R P G R N L A L A E S N A * L L Y T S S V L D G T ? P W P S P T P D S Y T Q V A S W T E P ? TCCCGT AGGGCA S R P P Fig. 23. Translation of D N A sequence from insert K25. A primer complimentary to part of the 31 a.a. tag was used to obtain D N A sequence upstream of the tag. The reading frame of the BrkA C-terminal domain is indicated in blue. The reading frame of the tag is indicated in red. 48 transformants using anti-BrkA C-terminal mAb and anti-31 a.a. tag Ab . In Fig. 24a, the Western blot with the 31 a.a. tag Ab shows that there is good expression in H5-2. This is confirmed by the mAb Western (Fig. 24b) and the S D S - P A G E gel (Fig. 24c), both of which have corresponding bands. These transformants were then used in immunofluorescence and dot blots to see if the 31 a.a. tag could be localized. There was no fluorescence of the cells seen with either surface or periplasmic/cytoplasmic staining using the anti-31 a.a. tag Ab. The only signal was from clumps of debris. As an alternative way of determining if the tag could be detected on the surface, dot blots of whole cells were done using the anti-31 a.a. tag Ab. Signal was detected with the JS 1025 negative control, but no signal was detected with the inserts. These results indicated that the anti-31 a.a. tag Ab could not be used to localize the insertions in the BrkA C-terminal domain. Without the data from immunofluorescence or dot blots, insert H5 could not be localized to the outer or periplasmic side of the membrane. However, it is highly probable that it is in a loop region. This is supported by the Western blots with two different antibodies showing good expression of the protein (Figs. 19 and 24). It is also indicated by the observation that after transformation the size of E l colonies were very small, transformants of H5 were bigger and colonies of H20 and K25 were even larger. This pattern was observed with every transformation that was performed. Inserts in transmembrane domains can adversely affect growth because the insertion of unstable structures into the membrane can cause disruption. This seems to be the case with E l . The larger size of the colonies of H5 indicates that this insertion is tolerated better and is therefore likely to be in a loop. Overall, I was able to confirm the presence of one transmembrane strand and one loop region of the BrkA C-terminal domain, but could not determine the orientation of the loop. The results are consistent with my original model (Figs. 2 and 18), but do not allow me to rule out the alternative model shown in Fig. 25. 49 (a) © El-2 El-3 H5-2 H5-3 (b) © 5 El-2 El-3 tZ3 H5-2 H5-3 84 41 -31.7-Fig. 24. Western blot and S D S - P A G E analysis of newly retransformed inserts E l and H5. (a) Expression of the 31 a.a. tag was determined through Western blot with the anti-31 a.a. tag A b . (b) Expression of the B r k A C-terminal protein was determined through Western blot with the anti-BrkA C-terminal mAb. (c) S D S - P A G E gel stained with Coomassie blue after transfer. Kaleidoscope Prestained Standards (Biorad) were used for molecular weight determination (in kDa). The arrow indicates the dark band in the induced H5-2 sample. -: no IPTG; +: IPTG added 50 A G A W G H s P R G F I H I H N G G A I R N G R V T Y D E R R G L V Y A G D S A A G F 1 Y E G V T S COOH N G I G V A Q L P A K G R S Y T R R A W R A L G W T Q E Y S A Y L N H G D A A L G K K R R R G T L A T G S s L A T N M A R Y G V W i L E S D R A L A V Q E T K P G V V E G D A R A F R G N W F D D E N L P T G A I N G Y D V R G D G V R S G A G S Out Y Q L L G G R K Y V D K Q G Y G V H , T W G R D L G I L G Y S A v D T R Q T D G Y X G D G P R HA Peri N H 2 - A L D K R L G E L R L R A D A G G P W A R T F S E R Q Q I S (K25) (H2T) N R Fig. 25. Alternative topological model of the BrkA C-terminal domain. This model was determined through the use of computer-predicted areas of amphipathicity and turns, as well as sequence alignment with other autotransporters. The boxed areas represent 6-strands. Dashed boxes indicate less highly predicted strands. Inserts are indicated by the circles, out: outside, peri: periplasm 51 4. Discussion 4.1. Pore-forming ability of the BrkA C-terminal domain One of the objectives of this study was to determine the pore-forming ability of the BrkA C-terminal domain through the use of black lipid bilayer analysis. This was done using two forms of the BrkA C-terminal protein: a His-tagged fusion from RFl065 and one that is processed and exported to the outer membrane from JS1025. It was demonstrated that the BrkA C-terminal domain from RFl065 is capable of forming a pore. Black lipid bilayer analysis showed the formation of channels upon the addition of BrkA C-terminal protein from RF1065, but not upon the addition of BrkA N-terminal protein or protein from a vector-only clone (JS13), all of which had been purified in a similar way. As well, the BrkA C-terminal protein that had been further purified by being cut out of an S D S - P A G E gel still formed channels. As evidenced by these results for the BrkA C-terminal domain, black lipid bilayer analysis can be used to determine not only the channel-forming capabilities of typical trimeric porins, but also of a wide variety of proteins, including those involved in protein export (Benz et al., 1993) and those from Mycobacterial (Trias and Benz, 1994, Trias et al., 1992) and Gram-positive (RieB et al, 1998) cell walls. Some examples of these proteins and their pore sizes are listed in Table 3. Besides the pore sizes as determined by black lipid bilayer analysis, Table 3 also shows the pore sizes as determined by liposome swelling assays (Nikaido and Rosenberg, 1983). With this technique, liposomes incorporating the protein of interest are used to measure the influx of water that accompanies the permeation of sugars of various sizes through the pores. The swelling of the liposomes decreases their refractive index and this in turn decreases the optical density, which can then be measured. This technique can give a better estimation of channel size due to the wider range of solutes that can be used. The two methods are widely used and give results that generally agree. 52 Table 3. Pore sizes of various proteins Organism and protein Method Black Lipid Liposome" Crystal. b (nS) (nm) (nm) References Aeromonas salmonicida 28kDaporin 1.96 Bordetella pertussis BrkA C-terminal domain 3 MOMP 0.56 Campylobacter coli MOMP 0.53 « 1 Escherichia coli OmpF 2.1 1.2 OmpC 1.5 1.1 PhoE 1.8 K 1.5 NmpC 1.3 LamB 2.7/0.2 OmpA 1.2/0.18c OmpG Tsx 0.01 FepA (ARV)d TolC 0.08 PapC Haemophilus influenzae type b 40 kDa porin 1.1 Legionella pneumophila MOMP 0.1c Mycobacterium chelonae 59 kDa cell wall protein 2.7 2.2 Mycobacterium smegmatis cell wall extract 4.1 40 kDa porin 2 Pseudomonas aeruginosa OprF 5.6/0.36 2 OprP 0.28 Salmonella typhimurium OmpC (40K) 2.4 OmpF (39K) 2.2 OmpD (38K) 2.5 Treponema denticola 53 kDa outer sheath protein 10.9 1 2 2 2 1.8 Lutwyche etal., 1995 This Study Armstrong etal., 1986 Page etal., 1989 Benz et ai; 1985; Nikaido, 1992 Benz etal., 1985; Nikaido, 1992 Benz etal., 1984 Benz etal., 1985 Benz etal., 1985 Benz etal., 1985 Saint et al., 1993; Sugawara et ai, 1992 Fajardo etal., 1998 Benz et al., Maier et al., 1988 Liu etal., 1993 Benz etal., 1993 2-3 Thanassi et al., 1998 Vachon etal., 1986, 1988 Gabay etal., 1985 Trias etal., 1992 Trias etal., 1994 Mukhopadhyay etal., 1997 Benz et ai, 1981; Nikaido et al., 1991; Woodruff etal, 1986 Benz etal, 1981 Benz etal, 1980 Benz etal, 1980 Benz et al, 1980 Egli etal, 1993 a Liposome swelling b X-ray crystallography c Measurements were made in 0.25 M KC1 d A portion of the N-terminal was deleted c Measurements were made in 0.1 M NaCl 53 A pore size of 3.0 nS in 1 M KC1 was found for the BrkA C-terminal protein from RF1065. As can be seen in Table 3, this is larger than the sizes reported for the typical trimeric E. coli porins OmpF and OmpC, as well as many other proteins, but is not without precedent. The monomer OprF from P. aeruginosa sometimes forms pores of 5.6 nS (Benz and Hancock, 1981) and the 53 kDa outer sheath protein of T. denticola was found to have a single channel conductance of 10.9 nS (Eglie et al, 1993). As well, a 59 kDa cell wall protein from M. chelonae was found to have a channel size of 2.7 nS (Trias et al., 1992). A larger pore size for the BrkA C-terminal domain would be expected based on its protein exporting function. PapC, an outer membrane usher, through which the subunits of P pili are exported in uropathogenic E. coli, has a pore diameter of at least 2 nm (Thanassi et al., 1998). This is large enough to allow the passage of unravelled pilus subunits. It appears that a similar requirement for unfolded passenger proteins also applies to autotransporters (Klauser et al., 1990). In order for the BrkA C-terminal to have consistently formed channels, one would expect that it was properly folded, but the denaturing purification procedure that was used to obtain the protein from RFl065 brings up the question of whether or not the protein should be capable of assuming its native conformation. In order to renature the protein, the urea was slowly removed and a detergent was used. Examples of the renaturation of outer membrane proteins into a native conformation using related procedures have been shown previously. Outer membrane proteins extracted and renatured from inclusion bodies were found to have the same pore-forming characteristics as those obtained from the outer membrane (Saxena et al., 1999; Schmid et al., 1998). As well, crystals of OmpA were obtained from inclusion bodies (Pautsch et al., 1999) and then used for structure determination by X-ray diffraction analysis (Pautsch and Schulz, 1998). Even though the BrkA C-terminal domain is capable of forming a pore, it may not do so in the outer membrane or it may be blocked after transport occurs. To answer this question unheated BrkA C-terminal protein was extracted from the outer membrane of JS 1025 by being cut out of an 54 S D S - P A G E gel. Black lipid bilayer analysis of this form of the protein showed channels of a similar size to those seen with the protein from RF1065. However, co-migrating proteins were present in the preparations and addition of these proteins alone from a vector-only control (JS 11) caused the appearance of some larger channels, although not as many and at a slower rate. N-terminal sequencing of the co-migrating proteins identified OmpA. This monomeric protein does not normally form a pore in the outer membrane (Pautsch and Schulz, 1998), but does occasionally form pores in lipid bilayers. Usually they are quite small, but can be larger in size (Table 3). Even though no other proteins were identified, it is also possible that there was a small amount of another protein that was partly responsible for the channels seen with the control. Only a small amount of an active protein is needed, as this technique measures the insertion of individual proteins. In comparison to the protein from RFl065, channels did not appear as often with the protein from JS1025. As well, there was more noise with the protein from JS1025, which indicates that more of the protein was in a denatured form. This at least partially accounts for the lesser activity with JS1025, but it could also be due to some of the protein from the outer membrane being blocked. Large open pores in the outer membrane would most likely not be tolerated, and therefore, the pore is likely to be blocked through the folding of loops or the end of the C-terminal protein plugging the barrel after transport of the passenger domain. Overall, the results of this study show that the BrkA C-terminal domain is capable of forming a pore, which is the first time this has ever been shown for any autotransporter. As well, the results suggest that the BrkA C-terminal domain does form a pore in the outer membrane, but this still needs to be determined conclusively. 4.2. Topology of the BrkA C-terminal domain The second objective of this study was to map the topology of the BrkA C-terminal domain through the use of XTnphoA/'m to generate 31 a.a. insertions. The technique was chosen because it 55 appeared to be a way to quickly generate random insertions, while still ensuring that the insertions would be in-frame. With this method, I obtained insertions in four different places within the BrkA C-terminal domain, all of which were located near the N-terminal part of the protein. There are three possible reasons for this clustering effect. One is that these represent hotspots for transposon insertion. However, Tn5, from which this transposon is derived, is known to insert fairly randomly (Manoil and Bailey, 1997). Another is the relatively low number of insertions that were obtained. It is possible that these insertions are not representative of the actual distribution. A third reason may be the alkaline phosphatase fusion that is used to generate and screen the insertions. One study using phoA fusions to the outer membrane protein FhuA found clustering of insertions near the N-terminal of the protein (Coulton et al., 1988), but another study did not show this effect (Giinter and Braun, 1988). A possible hotspot for transposon insertion was found, but not within the BrkA C-terminal domain. 72 insertions were found in the ampicillin resistance gene as compared to 28 in brkA. Restriction mapping places all of them in approximately the same position, in the first half of the gene. There is either enough of the enzyme remaining to still be active or a mutation has occurred giving resistance to ampicillin in some other way. The latter is unlikely because it would have had to occur on at least four separate occasions, as this insertion in the 8-lactamase gene was seen with every infection that was performed. To improve efficiency, the infection step should be performed numerous times and many transformations of the D N A from each infection should be done. I often found that there were no blue colonies or only a few on plates with hundreds of transformants. As well, many of the insertions can be siblings due the high copy number of many common plasmids, which lowers the chance of finding insertions in different positions. 56 Of the four insertions in the BrkA C-terminal domain that were found, two were determined to be out of frame. This was unexpected due to the fact that they were obtained from blue colonies, which means that they were producing active alkaline phosphatase. A possible explanation for this is that the insertions were originally in-frame, but became out of frame later on because they were not tolerated well by the cells. This could occur through insertion or deletion of a base or a base pair change which introduces a stop codon . Alternatively, they could have been out of frame from the beginning. This latter explanation is supported by analysis of the D N A sequences from the inserts. There are no base pair changes, insertions or deletions in either the brkA or insert coding sequences. Both insertions are out of frame starting from the junction between the sequences. As well, the other insertions obtained at these two positions are out of frame starting from the where the two sequences join. All of the insertions at a particular position were obtained from the same experiment and most likely do not represent independent insertions. If the insertions were originally out of frame, the only other possible source of alkaline phosphatase is the endogenous one encoded by the cell. This form of the protein has no signal sequence, and therefore cannot be exported into the oxidizing environment of the periplasm where the enzyme usually becomes active due to the formation of intramolecular disulfide bonds. However, cytoplasmically located alkaline phosphatase has been shown to slowly gain activity after suspension of growth (Derman and Beckwith, 1995). This explanation is supported by the fact that the two colonies in question did not turn blue until several days after the initial plating on the selective media. Although this result indicates that only colonies which become blue right away should be picked, one of the other insertions I obtained that is in-frame (El) also turned blue several days later. To characterize the remaining two insertions that were in-frame, expression experiments, immunofluorescence and dot blots were performed. Only the expression experiments yielded any data about where the inserts were located within the structure of the protein. This appears to be due to the anti-31 a.a. tag A b , which worked in Western blots, but did not work in immunofluorescence or dot blots. As a control for the immunofluorescence procedure, cells 57 expressing full-length BrkA were stained with an anti-BrkA N-terminal Ab . This resulted in the expected surface and periplasmic/cytoplasmic staining. After these experiments were performed, I contacted Colin Manoil's lab for advice and learned that the anti-31 a.a. tag Ab had never been used in immunofluorescence (Bailey, 1999). Without the data from immunofluorescence or dot blots, the tag could not be localized to the outer membrane or the periplasm. However, the expression experiments did support the predicted positions of insert E l in a transmembrane strand and insert H5 in a loop region. Expression experiments with insert H5 also sometimes showed the induction of a 50-60 kDa protein that did not show up in the Western blot (Fig. 20). This protein may be a protease induced by production of the protein because it possibly aggregated in some way, Even though the positions of inserts E l and H5 are consistent with my original model (Fig. 18), this does not allow me to rule out the alternative model in Fig. 25. This other model places two areas of high surface probability and the larger loops in the periplasm, which is not as favorable. Larger extracellular loops and shorter periplasmic turns are predicted for a wide variety of outer membrane proteins and this arrangement has been shown experimentally in some cases (Buchanan etal., 1999; Ferguson et ai, 1998; Rehm and Hancock, 1996; Sukhan and Hancock, 1995), which supports my original model. Overall, the topology mapping supported my proposed model of the BrkA C-terminal domain, but did not allow me to refine it further. In spite of these results, this method could still be useful in mapping the topology of this or other outer membrane proteins. More rounds of infection and transformation are needed to determine if a wider distribution of insertions can be obtained. As well, the anti-31 a.a. tag antibody might still be made to work in immunofluorescence or another antibody could be developed. 58 4.3. Conclusions and future directions As part of the mechanism of autotransporter export, the C-terminal domains of these proteins are predicted to form pores in the outer membrane through which the N-terminal domains are exported. Black lipid bilayer analysis of the BrkA C-terminal domain demonstrated that it is capable of forming a pore. This is the first time that pore-forming ability has ever been shown for any of the autotransporter C-terminal domains. The data also suggested that the BrkA C-terminal domain may form a pore in the outer membrane. To definitively determine if the BrkA C-terminal domain does indeed form a channel in the outer membrane, a pure form of the protein is necessary. The major co-migrating protein in outer membrane preparations containingthe BrkA C-terminal domain was found to be OmpA. Expression in an OmpA" strain would remove this main contaminant. However, small amounts of other pore-forming proteins could still be present. The unheated protein could also be run on an S D S - P A G E gel at a lower temperature, which may alter the mobility of the proteins enough so that they no longer co-migrate. Alternatively, other protein purification methods could be tried, such as salt precipitation, ion exchange chromatography or H P L C . However, complete separation of outer membrane proteins by chromatography alone can be difficult (Hancock, 1999), so a combination of methods would probably be necessary. As well, these alternate techniques may alter the activity of the BrkA C-terminal domain in black lipid bilayer experiments. The C-terminal domains of the autotransporters are also predicted to form multistranded amphipathic 6-barrels in the outer membrane, but the details of their topological structure have never been experimentally determined. To map the topology of the BrkA C-terminal domain, I chose a transposon-based method of inserting 31 a.a. tags because it had the potential to generate random in-frame insertions in a short period of time. With this method, I was able to confirm the position of one transmembrane strand and one loop region. However, two other insertions were out of frame and all of the insertions were clustered near the N-terminal of the protein. This clustering effect indicates that this technique cannot be used to map a large part of the protein, but it could still be useful in determining the orientation of the extreme N-terminal 8-strand. This is one 59 of the most important aspects of the topology of the autotransporter C-terminal domains because whether or not the end of this strand faces the outside or the periplasm affects the proposed mechanisms of secretion and cleavage of the N-terminal domains. In order to complete the mapping of the BrkA C-terminal domain, FLAG or malarial epitopes could be introduced into specific sites through inverse PCR (Gama and Breitwieser, 1999). With this technique, a pair of adjacent primers, each encoding half of the desired tag, are used to insert the epitope and amplify the target sequence. The PCR product can then be ligated and the methylated non-mutagenized plasmid DNA can be removed through digestion with Dpn I. This is then followed by transformation. The only potential problems with this technique are being able to design appropriate primers for the proposed insertion sites and the possible introduction of secondary mutations during PCR. Otherwise, the method is quick and allows you to map the majority of the protein, as well as focus on a particular part, such as the extreme N-terminal B-strand. 60 References Aebi, C , E. R. Lafontaine, L. D. Cope, J. L. Latimer, S. L. Lumbley, G. H. McCracken, Jr., and E. J. Hansen. 1998. Phenotypic effect of isogenic uspAl and uspA2 mutations on Moraxella catarrhalis 035E. Infect. Immun. 66:3113-3119. Aebi, C , I. Maciver, J. L. Latimer, L. D. Cope, M. K. Stevens, S. E. Thomas, G. H. McCracken, Jr., and E. J. Hansen. 1997. A protective epitope of Moraxella catarrhalis is encoded by two different genes. Infect. Immun. 65:4367-4377. Armstrong, S. K., T. R. Parr, Jr., C. D. Parker, and R. E. W. Hancock. 1986 Bordetella pertussis major outer membrane porin protein forms small, anion-selective channels in lipid bilayer membranes. J. Bacteriol. 166:212-216. Bailey, J. 1999. Personal communication. Benjelloun-Touimi, Z., P. J. Sansonetti, and C. Parsot. 1995. SepA, the major extracellular protein of Shigella flexneri: autonomous secretion and involvement in tissue invasion. Mol . Microbiol. 17:123-135. Benz, R., R. P. Darveau, and R. E. W. Hancock. 1984. Outer-membrane protein PhoE from Escherichia coli forms anion-selective pores in lipid-bilayer membranes. Eur. J. Biochem. 140:319-324. Benz, R., and R. E. W. Hancock. 1981. Properties of the large ion-permeable pores formed from protein F of Pseudomonas aeruginosa in lipid bilayer membranes. Biochim. Biophys. Acta. 646:298-308. Benz, R., J. Ishii, and T. Nakae. 1980. Determination of ion permeability through the channels made of porins from the outer membrane of Salmonella typhimurium in lipid bilayer membranes. J. Membr. Biol . 56:19-29. Benz, R., E. Maier, and I. Gentschev. 1993. To lC of Escherichia coli functions as an outer membrane channel. Zbl. Bakt. 278:187-196. Benz, R., A. Schmid, and R. E. W. Hancock. 1985. Ion selectivity of Gram-negative bacterial porins. J. Bacteriol. 162:722-727. 61 Benz, R., A. Schmid, C. Maier, and E. Bremer. 1988. Characterization of the nucleoside-binding site inside the Tsx channel of Escherichia coli outer membrane: Reconstitution experiments with lipid bilayer membranes. Eur. J. Biochem. 176:699-705. Blanc-Potard, A., F. Solomon, J. Kayser, and E. A. Groisman. 1999. The SPI-3 pathogenicity island of Salmonella enterica. J. Bacteriol. 181:998-1004. Brunder, W., H. Schmidt, and H. Karch. 1997. EspP, a novel extracellular serine protease of enterohaemorrhagic Escherichia coli 0157:H7 cleaves human coagulation factor V . Mol . Microbiol. 24:767-778. Buchanan, S. K., B. S. Smith, L. Venkatramani, D. Xia, L. Esser, M. Palnitkar, R. Chakraborty, D. van der Helm, and J. Deisenhofer. 1999. Crystal structure of the outer membrane active transporter FepA from Escherichia coli. Nat. Struct. Biol. 6:56-63. Charles, I., N . Fairweather, D. Pickard, J. Beesley, R. Anderson, G. Dougan, and M. Roberts. 1994. Expression of the Bordetella pertussis P.69 pertactin adhesin in Escherichia coli: fate of the carboxy-terminal domain. Microbiol. 140:3301-3308. Cherry, J. D. 1996. Historical review of pertussis and the classical vaccine. J. Infect. Dis. 174:S259-S263. Confer, D. L., and J. W. Eaton. 1982. Phagocyte impotence caused by an invasive bacterial adenylate cyclase. Science. 217:948-950. Coulton, J. W., G. K. Reid, and A. Campana. 1988. Export of hybrid proteins F h u A ' -'LacZ and FhuA' - 'PhoA to the cell envelope of Escherichia coli K-12. J. Bacteriol. 170:2267-2275. Cover, T. L., M. K. R. Tummuru, P. Cao, S. A. Thompson, and M. J. Blaser. 1994. Divergence of genetic sequences for the vacuolating cytotoxin among Helicobacter pylori strains. J. Biol . Chem. 269:10566-10573. Cundell, D. R., K. Kanthakumar, G. W. Taylor, W. E. Goldman, T. Flak, P. J. Cole, and R. Wilson. 1994. Effect of tracheal cytotoxin from Bordetella pertussis on human neutrophil function in vitro. Infect. Immun. 62:639-643. 62 Derman, A. I., and J. Beckwith. 1995. Escherichia coli alkaline phosphatase localized to the cytoplasm slowly acquires enzymatic activity in cells whose growth has been suspended: a caution for gene fusion studies. J. Bacteriol. 177:3764-3770! Deville, J. G., J. D. Cherry, P. D. Christenson, E. Pineda, C. T. Leach, T. L. Kuhls, and S. Viker. 1995. Frequency of unrecognized Bordetella pertussis infections in adults. Clin. Infect. Dis. 21:639-642. Djafari, S., F. Ebel, C. Deibel, S. Kramer, M. Hudel, and T. Chakraborty. 1997. Characterization of an exported protease from Shiga toxin-producing Escherichia coli. Mol . Microbiol. 25:771-784. Egile, C , H. d'Hauteville, C. Parsot, and P. J. Sansonetti. 1997. SopA, the outer membrane protease responsible for polar localization of IcsA in Shigella flexneri. Mol . Microbiol. 23:1063-1073. Egli, C , W. K. Leung, K-H. Miiller, R. E. W. Hancock, and B. C. McBride. 1993. Pore-forming properties of the major 53-kilodalton surface antigen from the outer sheath of Treponema denticola. Infect. Immun. 61:1694-1699. Emsley, P., I. G. Charles, N. F. Fairweather, and N. W. Isaacs. 1996. Structure of Bordetella pertussis virulence factor P.69 pertactin. Nature. 381:90-92. Eslava, C , F. Navarro-Garcia, J. R. Czeczulin, I. R. Henderson, A. Cravioto, and J. P. Nataro. 1998. Pet, an autotransporter enterotoxin from enteroaggregative Escherichia coli. Infect. Immun. 66:3155-3163. Everest, P., J. Li, G. Douce, I. Charles, J. de Azavedo, S. Chatfield, G. Dougan, and M. Roberts. 1996. Role of the Bordetella pertussis P.69/pertactin protein and the P.69/pertactin R G D motif in the adherence to and invasion of mammalian cells. Micobiol. 142:3261-3268. Fajardo, D. A., J. Cheung, C. Ito, E. Sugawara, H. Nikaido, and R. Misra. 1998. Biochemistry and regulation of a novel Escherichia coli K-12 porin protein, OmpG, which produces unusually large channels. J. Bacteriol. 180:4452-4459. Fernandez, R. C , and A. A. Weiss. 1994. Cloning and sequencing of a Bordetella pertussis serum resistance locus. Infect. Immun. 62:4727-4738. 63 Fernandez, R. C , and A. A. Weiss. 1998. Serum resistance in /?vg-regulated mutants of Bordetella pertussis. F E M S Microbiol. Lett. 163:57-63. Finn, T. M., and D. F. Amsbaugh. Vag8, a Bordetella pertussis &vg-regulated protein. Infect. Immun. 66:3985-3989. Finn, T. M., and L. A. Stevens. 1995. Tracheal colonization factor: a Bordetella pertussis secreted virulence determinant. Mol . Microbiol. 16:625-634. Gabay, J. E., M. Blake, W. D. Niles, and M. A. Horwitz. 1985. Purification of Legionella pneumophila major outer membrane protein and demonstration that it is a porin. J. Bacteriol. 162:85-91. Gama, L., and G. E. Breitwieser. 1999. Generation of epitope-tagged proteins by inverse PCR mutagenesis. BioTechniques. 26:814-816. Geuijen, C. A. W., R. J. L. Willems, M. Bongaerts, J. Top, H. Gielen, and F. R. Mooi. 1997. Role of the Bordetella pertussis minor fimbrial subunit, F imD, in colonization of the mouse respiratory tract. Infect. Immun. 65:4222-4228. Geuijen, C. A. W., R. J. L. Willems, and F. R. Mooi. 1996. The major fimbrial subunit of Bordetella pertussis binds to sulfated sugars. Infect. Immun. 64:2657-2665. Goodwin, M. St. M., and A. A. Weiss. 1990. Adenylate cyclase toxin is critical for colonization and pertussis toxin is critical for lethal infection by Bordetella pertussis in infant mice. Infect. Immun. 58:3445-3447. Gtinter, K., and V. Braun. 1988. Probing F h u A ' - ' P h o A fusion proteins for the study of FhuA export into the cell envelope of Escherichia coli K12. Mol . Gen. Genet. 215:69-75. Hackstadt, T., R. Messer, W. Cieplak, and M. G. Peacock. 1992. Evidence for proteolytic cleavage of the 120-kilodalton outer membrane protein of Rickettsiae: identification of an avirulent mutant deficient in processing. Infect. Immun. 60:159-165. Hahn, M., K. Kim, I. Kim, and W. Chang. 1993. Cloning and sequence analysis of the gene encoding the crystalline surface layer protein of Rickettsia typhi. Gene. 133:129-133. Hancock, R. E. W. 1999. Personal communication. Hazenbos, W. L. W., B. M. van den Berg, C. W. Geuijen, F. R. Mooi, and R. van Furth. 1995. Binding of F imD on Bordetella pertussis to very late antigen-5 on 64 monocytes activates complement receptor type 3 via protein tyrosine kinases. J. Immunol. 155:3972-3978. Heiss, L. N., S. A . Moser, E. R. Unanue, and W. E. Goldman. 1993. Interleukin-1 is linked to the respiratory epithelial cytopathology of pertussis. Infect. Immun. 61:3123-3128. Henderson, I. R., and P. Owen. 1999. The major phase-variable outer membrane protein of Escherichia coli structurally resembles the immunoglobulin A l protease class of exported protein and is regulated by a novel mechanism involving Dam and OxyR. J. Bacteriol. 181:2132-2141. Henderson, I. R., F. Navarro-Garcia, and J. P. Nataro. 1998. The great escape: structure and function of the autotransporter proteins. Trends Microbiol. 6:370-378. Hendrixson, D. R., M. L. de la Morena, C. Stathopoulos, and J. W. St. Geme III. 1997. Structural determinants of processing and secretion of the Haemophilus influenzae Hap protein. Mol . Microbiol. 26:505-518. Horiguchi, Y., N. Inoue, M. Masuda, T. Kashimoto, J. Katahira, N. Sugimoto, and M. Matsuda. 1997. Bordetella bronchiseptica dermonecrotizing toxin induces reorganization of actin stress fibers through deamidation of Gln-63 of the GTP-binding protein Rho. Proc. Natl. Acad. Sci. U S A . 94:11623-11626. Jose, J., F. Jahnig, and T. F. Meyer. 1995. Common structural features of IgAl protease-like outer membrane protein autotransporters. Mol . Microbiol. 18:377-382. Khelef, N., and N. Guiso. 1995. Induction of macrophage apoptosis by Bordetella pertussis adenylate cyclase-hemolysin. F E M S Microbiol. Lett. 134:27-32. Klauser, T., J. Kramer, K. Otzelberger, J. Pohlner, and T. F. Meyer. 1993a. Characterization of the Neisseria IgaB-core the essential unit for outer membrane targeting and extracellular protein secretion. J. Mol . Biol. 234:579-593. Klauser, T., J. Pohlner, and T. F. Meyer. 1990. Extracellular transport of cholera toxin B subunit using Neisseria IgA protease beta-domain: conformation-dependent outer membrane translocation. E M B O J. 9:1991-1999. Klauser, T., J. Pohlner, and T. F. Meyer. 1993b. The secretion pathway of IgA protease-type proteins in Gram-negative bacteria. Bioessays. 15:799-805. 65 Laemmli, TJ. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227:680-685. Leininger, E., M . Roberts, J. G. Kenimer, I. G. Charles, N. Fairweather, P. Novotny, and M . J. Brennan. 1991. Pertactin, an Arg-Gly-Asp-containing Bordetella pertussis surface protein that promotes adherence of mammalian cells. Proc. Natl. Acad. Sci. U S A . 88:345-349. Li, H., and D. H. Walker. 1998. rOmpA is a critical protein for the adhesion of Rickettsia rickettsii to host cells. Microbial Path. 24:289-298. Li, J., N. F. Fairweather, P. Novotny, G. Dougan and I. G. Charles. 1992. Cloning, nucleotide sequence and heterologous expression of the protective outer-membrane protein P.68 pertactin from Bordetella bronchiseptica: J. Gen. Micobiol. 138:1697-1705. Li, L. J., G. Dougan, P. Novotny, and I. G. Charles. 1991. P.70 pertactin, an outer-membrane protein from Bordetella parapertussis: cloning, nucleotide sequence and surface expression in Escherichia coli. Molec. Microbiol. 5:409-417. Lindenthal, C , and E. A . Elsinghorst. 1999. Identification of a glycoprotein produced by enterotoxigenic Escherichia coli. Infect. Immun. 67:4084-4091. Liu, D., E. Phillips, T. M . Wizemann, M . M . Siegel, K. Tabei, J. L. Cowell, and E. Tuomanen. 1997. Characterization of a recombinant fragment that contains a carbohydrate recognition domain of the filamentous hemagglutinin. Infect. Immun. 65:3465-3468. Liu, J., J. M . Rutz, J. B. Feix, and P. E. Klebba. 1993. Permeability properties of a large gated channel within the ferric enterobactin receptor, FepA. Proc. Natl. Acad. Sci. U S A . 90:10653-10657. Loveless, B. J., and M . H. Saier, Jr. 1997. A novel family of channel-forming, autotransporting, bacterial virulence factors. Mol . Mem. Biol. 14:113-123. Lutwyche, P., M . M . Exner, R. E. W. Hancock, and T. J. Trust. 1995. A conserved Aeromonas salmonicida porin provides protective immunity to rainbow trout. Infect. Immun. 63:3137-3142. 66 Maier, C , and E. Bremer. 1988. Pore-forming activity of the Tsx protein from the outer membrane of Escherichia coli: Demonstration of a nucleoside-specific binding site. J. Biol. Chem. 263:2493-2499. Manoil, C , and J. Bailey. 1997. A simple screen for permissive sites in proteins: analysis of Escherichia coli lac permease. J. Mol . Biol. 267:250-263. Miyazaki, H., N. Yanagida, S. Horinouchi, and T. Beppu. 1989. Characterization of the precursor of Serratia marcescens serine protease and COOH-terminal processing of the precursor during its excretion through the outer membrane of Escherichia coli. J. Bacteriol. 171:6566-6572. Mooi, F. R., H. van Oirschot, K. Heuvelman, H. G. J. van der Heide, W. Gaastra, and R. J. L. Willems. 1998. Polymorphism in the Bordetella pertussis virulence factors P.69/pertactin and pertussis toxin in the Netherlands: temporal trends and evidence for vaccine-driven evolution. Infect. Immun. 66:670-675. Mukhopadhyay, S., D. Basu, and P. Chakrabarti. 1997. Characterization of a porin from Mycobacterium smegmatis. J. Bacteriol. 179:6205-6207. Nikaido, H. 1992. Porins and specific channels of bacterial outer membranes. Mol . Microbiol. 6:435-442. Nikaido, H., K. Nikaido, and S. Harayama. 1991. Identification and characterization of porins in Pseudomonas aeruginosa. J. Biol . Chem. 266:770-779. Nikaido, H., and E. Y. Rosenberg. 1983. Porin channels in Escherichia coli: studies with liposomes reconstituted from purified proteins. J. Bacteriol. 153:241-252. Ohnishi, Y., T. Beppu, and S. Horinouchi. 1997. Two genes encoding serine protease homologues in Serratia marcescens and characterization of their products in Escherichia coli. J. Biochem. 121:902-913. O'Toole, P. W., J. W. Austin, and T. J. Trust. 1994. Identification and molecular characterization of a major ring-forming surface protein from the gastric pathogen Helicobacter mustelae. Mol . Microbiol. 11:349-361. 67 Page, W. J., G . Huyer, M. Huyer, and E.A. Worobec. 1989. Characterization of the porins of Campylobacter jejuni and Campylobacter coli and implications for antibiotic susceptibility. Antimicrob. Agents Chemother. 33:297-303. Pautsch, A., and G . E. Schulz. 1998. Structure of the outer membrane protein A transmembrane domain. Nat. Struct. Biol. 5:1013-1017. Pautsch, A., J. Vogt, K. Model, C. Siebold, and G . E. Schulz. 1999. Strategy for membrane protein crystallization exemplified with OmpA and OmpX. Proteins. 34:167-172. Poulsen, K., J. Brandt, J. P. Hjorth, H. C. Th0gersen, and M. Kilian. 1989. Cloning and sequencing of the immunoglobulin A l protease gene (iga) of Haemophilus influenzae serotype b. Infect. Immun. 57:3097-3105. Provence, D. L., and R. Curtiss III. 1994. Isolation and characterization of a gene involved in hemagglutination by an avian pathogenic Escherichia coli strain. Infect. Immun. 62:1369-1380. Rajakumar, K., C. Sasakawa, and B. Adler. 1997. Use of a novel approach, termed island probing, identifies the Shigella flexneri she pathogenicity island which encodes a homolog of the immunoglobulin A protease-like family of proteins. Infect. Immun. 65:4606-4614. Rehm, B. H. A., and R. E. W. Hancock. 1996. Membrane topology of the outer membrane protein OprH from Pseudomonas aeruginosa: PCR-mediated site-directed insertion and deletion mutagenesis. J. Bacteriol. 178:3346-3349. RieB, F . G . , T . Lichtinger, R. Cseh, A. F . Yassin, K. P. Schaal, and R. Benz. 1998. The cell wall porin of Nocardiafarcinica: biochemical identification of the channel-, forming protein and biophysical characterization of the channel properties. Mol . Microbiol. 29:139-150. Robbins, J. B. 1999. Pertussis in adults: introduction. Cl in. Infect. Dis. 28:S91-S93. Ruoslahti, E. 1996. R G D and other recognition sequences for integrins. Annu. Rev. Cell Dev. Biol. 12:697-715. Saint, N., E. De, S. Julien, N . Orange, and G . Molle. 1993. Ionophore properties of OmpA of Escherichia coli. Biochim. Biophys. Acta. 1145:119-123. 68 St. Geme, J. W., D. Cutter, and S. J. Barenkamp. 1996. Characterization of the genetic locus encoding Haemophilus influenzae type b surface fibrils. J. Bacteriol. 178:6281-6287. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, Second Edition, p. 1.38-1.39, 2.60-2.65. Cold Spring Harbor Laboratory Press, Plainview, New York. Saxena, K., V. Drosou, E. Maier, R. Benz, and B. Ludwig. 1999. Ion selectivity reversal and induction of voltage-gating by site-directed mutations in the Paracoccus denitrificans porin. Biochemistry. 38:2206-2212. Schmid, B., L. Maveyraud, M. Kromer, and G. E. Schulz. 1998. Porin mutants with new channel properties. Protein Sci. 7:1603-1611. Senda, T., Y. Horiguchi, M . Umemoto, N. Sugimoto, and M. Matsuda. 1997. Bordetella bronchiseptica dermonecrotizing toxin, which activates a small GTP-binding protein Rho, induces membrane organelle proliferation and caveolae formation. Exp. Cell Res. 230:163-168. Shannon, J. L., and R. C. Fernandez. 1999. The C-terminal domain of the Bordetella pertussis autotransporter BrkA forms a pore in lipid bilayer membranes. J. Bacteriol. 181:5838-5842. Shannon, J. L., D. C. Oliver, and R. C. Fernandez. 1998. Expression and processing of the Bordetella pertussis BrkA protein in B. pertussis and in E. coli. Abstract. 98th General Meeting of the American Society for Microbiology. Stein, M., B. Kenny, M. A. Stein, and B. B. Finlay. 1996. Characterization of E s p C , a 110-kilodalton protein secreted by enteropathogenic Escherichia coli which is homologous, to members of the immunoglobulin A protease-like family of secreted proteins. J. Bacteriol. 178:6546-6554. Strauss, E. 1999. New clues to whooping cough pathology. Science. 285:811-813. Sugawara, E., and H. Nikaido. 1992. Pore-forming activity of OmpA protein of Escherichia coli. J. Biol . Chem. 267:2507-2511. 69 Suhr, M., I. Benz, and M. A . Schmidt. 1996. Processing of the AIDA- I precursor: removal of ATDA 0 and evidence for the outer membrane anchoring as a 6-barrel structure. Mol . Microbiol. 22:31-42. Sukhan, A . , and R. E. W. Hancock. 1995. Insertion mutagenesis of the Pseudomonas aeruginosa phosphate-specific porin OprP. J. Bacteriol. 177:4914-4920. Suzuki, T., M. Lett, and C. Sasakawa. 1995. Extracellular transport of V i r G protein in Shigella. J. Biol. Chem. 270:30874-30880. Thanassi, D. G., E. T. Saulino, M. Lombardo, R. Roth, J. Heuser, and S. J. Hultgren. 1998. The PapC usher forms an oligomeric channel: implications for pilus biogenesis across the outer membrane. Proc. Natl. Acad. Sci. U S A . 95:3146-3151. Trias, J., and R. Benz. 1994. Permeability of the cell wall of Mycobacterium smegmatis. Mol . Microbiol. 14:283-290. Trias, J., V. Jarlier, and R. Benz. 1992. Porins in the cell wall of mycobacteria. Science. 258:1479-1481. Vachon, V., D. N. Kristjanson, and J. W. Coulton. 1988. Outer membrane porin protein of Haemophilus influenzae type b: pore size and subunit structure. Can. J. Microbiol. 34:134-140. Vachon, V., R. Laprade, and J. W. Coulton. 1986. Properties of the porin of Haemophilus influenzae type b in planar lipid bilayer membranes. Biochim. Biophys. Acta. 861:74-82. van den Berg, B. M., H. Beekhuizen, R. J. L. Willems, F. R. Mooi, and R. van Furth. 1999. Role of Bordetella pertussis virulence factors in adherence to epithelial cell lines derived from the human respiratory tract. Infect. Immun. 67:1056-1062. Weiss, A . 1997. Mucosal immune defense and the response of Bordetella pertussis. A S M News. 63:22-28. Weiss, A . A . , and M. St. M. Goodwin. 1989. Lethal infection by Bordetella pertussis mutants in the infant mouse model. Infect. Immun. 57:3757-3764. 70 Woodruff, W. A., T. R. Parr, Jr., R. E. W. Hancock, L. F. Hanne, T. I. Nicas, and B. H. Iglewski. 1986. Expression in Escherichia coli and function of Pseudomonas aeruginosa outer membrane porin protein F. J. Bacteriol. 167:473-479. World Health Organization. 1999. http://www.who.int/gpv-dvacc/diseases/ pertussisvaccine.htm Yaari, E., Y. Yafe-Zimerman, S. B. Schwartz, P. E. Slater, P. Shvartzman, N. Andoren, D. Branski, and E. Kerem. 1999. Clinical manifestations of Bordetella pertussis infection in immunized children and young adults. Chest. 115:1254-1258. 71 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0089199/manifest

Comment

Related Items