Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Identification of PhoP-PhoQ homologues in Pseudomonas aeruginosa responsible for regulation of the outer… Kwasnicka, Agnieszka 1999

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1999-0541.pdf [ 5.25MB ]
Metadata
JSON: 831-1.0089162.json
JSON-LD: 831-1.0089162-ld.json
RDF/XML (Pretty): 831-1.0089162-rdf.xml
RDF/JSON: 831-1.0089162-rdf.json
Turtle: 831-1.0089162-turtle.txt
N-Triples: 831-1.0089162-rdf-ntriples.txt
Original Record: 831-1.0089162-source.json
Full Text
831-1.0089162-fulltext.txt
Citation
831-1.0089162.ris

Full Text

Identification of PhoP-PhoQ homologues in Pseudomonas aeruginosa responsible for regulation of the outer membrane protein O p r H  by Agnieszka Kwasnicka  B.Sc.(Honours) in Genetics, 1997. University of Manitoba, Winnipeg, Manitoba  A THESIS SUBMITTED IN P A R T I A L F U L F I L L M E N T OF T H E REQUIREMENTS FOR THE D E G R E E OF  M A S T E R OF SCIENCE In THE F A C U L T Y OF G R A D U A T E STUDIES (MICROBIOLOGY P R O G R A M )  We accept this thesis as conforming to the required standard  THE UNIVERSITY OF BRITISH C O L U M B I A September 1999 © Agnieszka Kwasnicka, 1999  In  presenting  degree freely  at  this  the  thesis  in  partial  fulfilment  University  of  British  Columbia,  available for  copying  of  department publication  this or of  reference and study.  thesis by  this  his  for  scholarly  or  thesis for  her  The University of British Columbia Vancouver, Canada  Date  DE-6  (2/88)  I further  purposes  the  requirements  I agree  that the  agree  may  representatives.  financial  permission.  of  It  gain shall not  be is  that  permission  granted  an  advanced  Library shall make  by  understood be  for  for  the that  allowed without  it  extensive  head  of  my  copying  or  my  written  Abstract  Expression of the Pseudomonas aeruginosa outer membrane protein OprH is induced in low magnesium growth conditions (Nicas and Hancock, 1980; 1983). This protein has been proposed to play a role in stabilizing the outer membrane in the absence of M g  2 +  by interacting with LPS at sites where these cations would bind. Adaptation to  magnesium limitation in Salmonella typhimurium has been shown to occur through activation of the two-component regulatory system, PhoP-PhoQ (Soncini et al., 1996). Putative PhoP and PhoQ proteins were identified in the P. aeruginosa genome through homology searches using the corresponding S. typhimurium protein sequences. The genes encoding these proteins were located directly downstream of the gene encoding OprH. Transcriptional linkage of oprH, phoP and phoQ was demonstrated and the hypothesis that this system regulates expression of OprH in P. aeruginosa was tested in the following study.  Through construction of aphoP null mutants and transformation of this mutant with PhoP encoding plasmids, it was shown that PhoP is required for expression of OprH. Furthermore, PhoP was demonstrated to be an activator of oprH, phoP and phoQ transcription from a promoter upstream of oprH. In contrast, a phoQ null mutant showed high-level, unregulated activation of oprH and phoP transcription and OprH expression. Complementation of this mutant demonstrated a requirement for PhoQ in down regulation of transcription and response to magnesium. Analysis of the oprH promoter enabled identification of the start of transcription and delineation of the sequences required for regulated OprH expression to within 90 basepairs of the A T G .  ii  c  Table of Contents  Abstract  M  Table of Contents  Hi  List of Tables  v  List of Figures  vi  List of Abbreviations  viii  Acknowledgements  1  Introduction .1.1  2  x  Pseudomonas aeruginosa  1  1.2  P. aeruginosa Outer Membranes  2  1.3  OprH  4  1.4  PhoP-PhoQ: A Two-component Regulatory System  5  1.5  Aims of This Study  9  Materials and Methods 2.1  Sequence Analysis  11  2.2  Strains, Plasmids and Growth Conditions  11  2.3  Reagents  14  2.4  D N A Techniques  14  2.5  D N A Sequencing  15  2.6  OprH Expression Analysis  17  2.7  Construction of the phoP Mutant H851  18  2.8  Southern Blot Analysis  18  2.9  Determination of Catechol-2,3-dioxygenase Activity  19  2.10  R N A Isolation and RT-PCR  20  2.11  Generation of Probes for R N A Dot Blots and Northern Blots.  21  2.12  Northern Blot and R N A Dot Blot Analysis  22  2.13  Primer Extension  !  23  iii  3  Results 3.1  Identification of phoP andphoQ Genes in P. aeruginosa  24  3.2  Construction of the phoP Mutant H851  30  3.3  Magnesium Regulated Expression of OprH in the phoP and phoQ mutants  3.4  34  The Role of PhoP-PhoQ in Transcription of the oprH-phoP-phoQ Operon  36  3.4.1  Transcriptional Linkage of oprH andphoP-phoQ  36  3.4.2  Magnesium Regulated Transcription of oprH, phoP and phoQ  3.4.3  38  Reporter Gene Transcription in the oprH, phoP and phoQ mutants  3.5  45  Analysis of the oprH-phoP-phoQ Promoter  48  3.5.1  Sequences Necessary for Regulated Expression of OprH  48  3.5.2  Determination of the Transcription Start Site for the oprH-phoP-phoQ Operon  51  4  Discussion  53  5  References  63  iv  List of Tables  Table 1. Bacterial Strains used in this study  12  Table 2. Plasmids used in this study  13  Table 3. Primers used in this study  16  Table 4. Relative levels of oprH, phoP and phoQ transcription in wildtype P. aeruginosa and the oprH, phoP and phoQ mutants as determined by quantitative R N A dot blots  44  Table 5. Catechol-2,3-dioxygenase activity in strain H851 (phoP:: xylE-Gm ) R  harbouring PhoP and PhoQ encoding plasmids  46  Table 6. Catechol-2,3-dioxygenase activity in strain H854 (phoQ::xylE-Gm ) R  harbouring PhoP and PhoQ encoding plasmids  V  47  List of Figures  Figure 1. Signal transduction and transcriptional regulation by the PhoP-PhoQ two-component regulatory system in Salmonella typhimurium  7  Figure 2. Amino acid sequence alignment of the PhoP proteins  25  Figure 3. Amino acid sequence alignment of the PhoQ proteins  26  Figure 4. Genetic organization of the oprH,phoP and phoQ genes  27  Figure 5. Chromosomal context of the oprH, phoP and phoQ genes  31  Figure 6. Confirmation of the genotype of the phoP mutant, H851, by Southern blot hybridization  ..33  Figure 7. Effect of magnesium and PhoP and PhoQ expressing plasmids on OprH expression in the phoP mutant  35  Figure 8. Effect of magnesium and PhoP and PhoQ expressing plasmids on OprH expression in the phoQ mutant  Figure 9. Cotranscription of the oprH and phoP genes as shown by RT-PCR  37  39  Figure 10. Northern blot analysis of oprH,phoP and phoQ transcription in wildtype P. aeruginosa in response to magnesium  40  Figure 11. Northern blot analysis of oprH, phoP and phoQ transcription in phoQ mutant in response to magnesium  vi  42  Figure 12. Expression of OprH from promoter deletions in E. coli in response to magnesium levels  50  Figure 13. Determination of the start of oprH transcription by primer extension  vii  52  List of Abbreviations  aa  amino acids  Asp  aspartate  ATP  adenosine triphosphate  bp  base pair  BSA  bovine serum albumin  CF  Cystic Fibrosis  dATP  deoxyadenosine triphosphate  dCTP  deoxycytosine triphosphate  DMSO  dimythelsulfoxide  dNTPs  deoxynucleoside triphosphates  EDTA  ethylenediaminotetraacetate  ExoIII  exonuclease III  AG  free energy change  Gm  R  gentamicin resistance  IgG  immunoglobulin G  He  isoleucine  kb  kilobase pairs  kDa  kiloDaltons  LB  Luria Bertani  LPS  lipopolysaccharide  Lys  lysine  MCS  multiple cloning site  min  minute  OD  optical density  Pag(s)  PhoP-activated gene(s)  PBS  phosphate-buffered saline  PCR  polymerase chain reaction  PEG  polyethylene glycol  Prg(s)  PhoP-repressed gene(s)  S.E.M.  standard error of the mean  SSC  sodium acetate and sodium chloride  TAE  Tris-HCl, acetic acid and E D T A  TBE  Tris-HCl, boric acid and E D T A  TE  Tris-HCl and E D T A  Thr  threonine  UV  ultra-violet  Acknowledgement  I would like to extend my sincere thanks to my supervisor, Dr. Robert E. W. Hancock, for his guidance, insight and support during the course of this project. I would also like to thank Dr. Emma Macfarlane, without whom this project and thesis would not have been possible. I would also like to acknowledge Dr. Martina Ochs, for her invaluable technical and intellectual advice and for proofreading of this thesis. Special thanks goes out to my committee members, Drs. Fernandez and Spiegelman for their help and encouragement, the rest of the Hancock lab for keeping me sane, and Dr. Meg Pope for her guidance. Last, but not least, I would like to thank my dearest Greg Wasney for all the emotional support he has provided me over the past two years.  1  Introduction  1.1  Pseudomonas aeruginosa  Pseudomonas aeruginosa is ubiquitous in the environment, residing in water and soil, and associating with both plants and animals (Clarke and Slater, 1986). This Gram negative, motile rod is harmless to a healthy host, though infection is problematic for the immunocompromised individual. In recent years, P. aeruginosa has become one of the most common nosocomial pathogens, second only to the enterococci (Botzenhurt and Riiden, 1987). It most commonly causes respiratory infections that are particularly severe for Cystic Fibrosis (CF) patients. Infection caused by mucoid stains of P. aeruginosa is the most common cause of death in CF patients (Hoiby et al, 1987). P. aeruginosa has also been implicated in burn, eye and post-surgical infections. Colonization by this organism is aided by its many virulence factors. Exotoxin A , proteases and the exopolysaccharide alginate are just a few of the factors contributing to virulence (Doring etal, 1987; Liu, 1974). A unique feature of P. aeruginosa is its intrinsic resistance to many antimicrobial agents, specifically those used in the treatment of infection. Aminoglycosides, some (3lactams, quinolones (Hancock and Speert, 1996) and polymyxins are becoming the few effective antibiotics able to treat P. aeruginosa infection. Antibiotic inactivating enzymes like aminoglycoside acetyltransferase and P-lactamases contribute to this resistance (Bryan, 1979), but the intrinsic low outer membrane permeability of P. aeruginosa likely contributes to resistance to many unrelated antimicrobials.  1  1.2  The Outer Membrane of P. aeruginosa  Like all Gram negative bacteria, P. aeruginosa has both an inner, cytoplasmic membrane and an outer membrane. Located between these are the periplasmic space and the peptidoglycan (Nikaido and Vaara, 1985). The outer membrane consists of a lipid bilayer interspersed with proteins. The lipid content of the outer membrane differs from the cytoplasmic membrane in that its outer leaflet is predominantly made up of lipopolysaccharide (LPS). LPS is an amphipathic molecule with a hydrophobic lipid A anchor and hydrophilic core oligosaccharide and O-side chain oligosaccharide. Although the study of P. aeruginosa LPS has lagged behind that of other Gram negative organisms, it has been shown that there are an exceptionally high number of phosphate groups in the core oligosaccharide (Kropinski et al., 1979). Nine major proteins occupy the outer membrane (for review see Hancock et al., 1990). The most abundant outer membrane protein, OprF, acts as a non-specific, water filled channel. Nutrient inducible proteins include; OprP, induced by phosphate limitation, OprB, induced by glucose, OprD, induced by certain carbon sources, OprG, induced in high magnesium and iron, and OprH, induced in low magnesium but repressed in high magnesium, calcium, strontium and manganese. In addition to that observed in OprF, channel forming ability has also been observed for OprP (specific for small anions), OprB (glucose channel), OprD2 (selective for the P-lactam, imipenem) and possibly OprC and E. The lipoproteins OprL and OprI are peptidoglycan associated and play structural rules. OprF is also associated with peptidoglycan and has a role in structure and cell shape. OprH, the focus of this study, is described in detail below.  2  In order to exert their bacteriocidal or bacteriostatic effects, antibiotics must first penetrate the outer membrane. In P. aeruginosa three methods of antibiotic uptake have been proposed (Moore et al, 1987). Entry of hydrophilic compounds occurs mainly through the water filled channel of OprF. Hydrophobic molecules may cross the lipid bilayer but the close association of LPS molecules described below, largely restricts this type of entry. A third method has been proposed through the study of OprH and polymyxin B. Hancock (1997) described a method for entry by cationic antimicrobial like polymyxin B termed self-promoted uptake. Binding of these molecules to the negatively charged outer membrane is thought to displace LPS stabilizing divalent cations. These molecules, larger than the ions they displace, disrupt and permeabilize the membrane and facilitate their own uptake. This mechanism was proposed through the study of OprH overexpressing mutants and under inducing conditions. Under conditions that induce overexpression of this slightly basic outer membrane protein, P. aeruginosa also becomes resistant to polymyxin B, gentamicin and E D T A (Brown and Melling, 1969; Nicas and Hancock, 1980, 1983). OprH is thought to inhibit self-promoted uptake by replacing divalent cations in the outer membrane and interacting with LPS. The role of OprH in resistance is described further in the following section. -  The low permeability of the P. aeruginosa outer membrane is conferred by  restriction of entry of hydrophilic molecules due to the small channel size of porins like OprF and the blockage of entry of hydrophobic molecules by the tight packing of the LPS. The negative charge imparted by phosphate ions on LPS requires it to associate with cations such as magnesium and calcium for stability (Schindler and Osborn, 1979). This interaction imparts stability to the outer membrane as is evident in the  3  permeabilizing effect of the chelator E D T A and the ability of magnesium ions to antagonize permeabilization (Nikaido and Hancock, 1986).  1.3  The Outer Membrane Protein O p r H  The outer membrane protein, OprH, is a 21 kDa, slightly basic (theoretical pi 8.6) protein. Its structure has been proposed to be an eight-stranded (3-barrel (Rehm and Hancock, 1996). Although B-barrel structures are characteristic of porins, no channel forming ability has been detected in OprH (Bell et al., 1991). Expression of this outer membrane protein is induced when P. aeruginosa is grown in limiting concentrations of the divalent cation magnesium (Nicas and Hancock, 1980; 1983). OprH has been shown to associate with LPS and may stabilize the outer membrane in the absence of these stabilizing cations (Bell and Hancock, 1989; Hancock and Carey, 1997). OprH has been proposed to interact with LPS at magnesium binding sites and it has been shown that the amount of OprH is inversely proportional to the level of magnesium ions in the outer membrane (Nicas and Hancock, 1980; 1983). This interaction may contribute to polymyxin B , gentamicin and E D T A resistance. Resistance to these antimicrobials was observed to be associated with overexpression of OprH, whether due to mutation causing overexpression of OprH or adaptation to low magnesium (Hancock et al, 1981; Bell et al, 1991; Young et al, 1992). In contrast, no resistance to P-lactams or tetracycline was observed. Nicas and Hancock (1983) proposed that OprH interferes with self-promoted uptake of cationic antimicrobials such as polymyxin B. Interaction of this integral membrane protein with LPS at sites where magnesium ions are usually found would prevent displacement by  4  polymyxin B and thus prevent the initial interaction with the outer membrane. In support of this hypothesis, rough mutations of P. aeruginosa LPS were shown to abolish resistance to polymyxin B in low magnesium (Bell et al., 1991). Overexpression of plasmid encoded OprH in an OprH deficient mutant demonstrated that this protein is largely responsible for E D T A resistance but may only contribute in a minor way to gentamicin and polymyxin B resistance (Bell et al., 1991). Preliminary data suggested that LPS alteration may be the primary resistance mechanism. In E. coli, expression of OprH encoded on a multicopy plasmid did not confer resistance to gentamicin or polymyxin B on this organism. Thus the OprH overexpressing mutant (P. aeruginosa strain HI81) which is also polymyxin B resistant is likely a regulatory mutant with effects elsewhere in the cell.  1.4  PhoP-PhoQ: A Two-Component Regulatory System  Adaptation by Salmonella typhimurium to depletion of extracellular magnesium and calcium ions occurs via the two-component regulatory system PhoP-PhoQ (Soncini et al., 1996). PhoP-PhoQ was first identified, and named, for its regulation of expression of a nonspecific acid phosphatase, PhoN (Kiers et al, 1979). Although best characterized in S. typhimurium, PhoP-PhoQ systems have been identified in Salmonella typhi (Baker et al., 1997), E. coli (Groisman et al., 1992; Kasahara et al., 1992) and Shigella flexneri (Groisman et al., 1989). These two proteins show sequence similarity to the classical two-component systems OmpR-EnvZ and PhoB-PhoR (Groisman et al., 1989). PhoP is the response regulator and PhoQ the sensor-kinase.  5  Response via two-component signal transduction occurs first through sensing of the environmental condition by the cytoplasmic membrane bound sensor-kinase (Figure 1). This protein usually autophosphorylates at a conserved histidine residue. This is hypothesized to occur by cross phosphorylation of two interacting sensor-kinases molecules. Transfer of the phosphate to an aspartate residue in the response-regulator propagates the signal. Phosphorylation of these D N A binding proteins may alleviate constraints between the C- and N-termini or may promote dimerization, resulting in enhancement of its D N A binding ability. This regulator can then activate or repress a subset of genes whose transcription is controlled by the signal (see Stock et al., 1989 for review). When magnesium or calcium ion concentrations in the extracellular environment are low, S. typhimurium PhoQ autophosphorylates and in turn phosphorylates PhoP (Figure 1), a regulator of transcription of over 40 genes. PhoP activated genes (Pags) include genes for virulence (Miller et al., 1989), intramacrophage survival (Fields et al., 1989), resistance to cationic antimicrobials (Miller et ah, 1990; Guo et al., 1998) and defensins (Fields et al, 1989), magnesium uptake systems (Garcia Vescovi et al., 1996) and LPS modifications (Groisman et al., 1997; Gou et al, 1997; Gunn et al., 1998). A number of PhoP repressed genes (Prgs) have been identified including a possible type III secretion system (Pegues et al, 1995). PhoP regulated genes fall into two distinct categories; those regulated by PhoPPhoQ directly and those regulated by PmrA-PmrB, a PhoP-PhoQ activated twocomponent regulatory system (Soncini and Groisman, 1996). Genes for polymyxin B resistance and LPS modifications are activated in low magnesium by PmrA-PmrB  6  through its activation by PhoP (Roland et al, 1994; Groisman et al, 1997; Gunn et al, 1998). The PmrA-PmrB system also responds to pH as an environmental signal independent of PhoP-PhoQ (Soncini and Groisman, 1996). LPS modification is postulated to occur, in part, through expression of the products of the following PhoPactivated genes; pmrE (also calledpagA or ugd, Gunn et al, 1998) encoding a UDPglucose dehydrogenase, pmrF (Gunn et al, 1998), part of an operon responsible for complex carbohydrate biosynthesis, pmrD (Roland et al, 1994), encoding a peptide responsible for polymyxin B resistance, andpagP (Gou et al, 1998), which increases lipid A modification. These changes may enable the organism to respond to depletion of the LPS stabilizing divalent cation and indirectly enable resistance to cationic antimicrobials by preventing their interaction and binding to the outer membrane. Though many of the PhoP-regulated genes identified thus far have been shown to be involved in virulence, possible phoP and phoQ genes have been identified in a number of non-pathogenic species. This system is also necessary for response to the environmental stress of divalent cation depletion. Magnesium ions are essential not only for membrane stabilization but also cellular reactions that require ATP. In S. typhimurium, PhoP-PhoQ activates transcription of genes encoding two magnesium uptake systems, mgtA and mgtBC (Garcia Vescovi et al, 1996). PhoP mutants have been shown to be deficient for growth in low magnesium liquid media, though some growth is observed, presumably due to the cor A magnesium uptake system (Soncini et al, 1996). The genes encoding PhoP and PhoQ are themselves PhoP-activated genes and thus autoregulated in response to magnesium (Soncini et al, 1996). Transcription of this operon in S. typhimurium occurs from two promoters upstream of phoP; one  8  constitutively expressing PhoP and PhoQ at low levels and a second promoter for magnesium regulated expression (Gunn and Miller, 1996). Though no consensus PhoP binding sequence has been identified in the promoter regions of genes activated by this regulator, hexanucleotide repeats are observed upstream of phoP in both S. typhimurium and E. coli (Groisman et al, 1989 and 1992; Kasahara et al, 1992). Two sets of GTTTAT sequences, spaced five nucleotides apart, are observed 11 bases upstream of the -10 region in S. typhimurium. These sequences overlap the -35 region and have been proposed to be involved in PhoP mediated regulation. PhoQ has been shown to bind both magnesium and calcium, but at different sites in the periplasmic region of this protein (Garcia Vescovi et al, 1997). A mutation, pho24, which results in constitutive activation of Pags and repression of Prgs, has been isolated in S. typhimurium (Gunn et al, 1996). The mutation occured in phoQ and resulted in a substitution of isoleucine for threonine at position 48 in the periplasmic domain of the protein. This mutation resulted in increased phosphorylation of PhoP without an increase in the overall amount of PhoQ protein in the membrane. Explanations for the increase in phospho-PhoP proposed included enhanced phosphotransfer by the mutant PhoQ, the inability of this mutant PhoQ to act as a phosphatase towards PhoP, or an increase in interaction and cross phosphorylation between these proteins. Although the first explanation is favoured, no definitive evidence to discount the latter two hypotheses has been presented.  9  1.5  Aims of This Study  P. aeruginosa from the sputum of CF patients was shown to possess elevated levels of OprH (Brown et al., 1984). Thus, study of the regulation of expression of this protein may be relevant to the determination of a) other genes induced during infection and b) which antimicrobials will be effective in treatment. As OprH in P. aeruginosa is induced in low magnesium and PhoP-PhoQ in S. typhimurium responds to this signal, it was hypothesized that homologues of this two-component system regulate expression of OprH in P. aeruginosa. In this study, a PhoP-PhoQ two-component regulatory system in P. aeruginosa responsible for adaptation to growth in low magnesium was identified. Furthermore, I have shown that PhoP-PhoQ regulates expression of OprH and itself in response to extracellular magnesium ion concentration. The study of the transcriptional behavior of the oprH, phoP and phoQ genes and determination of sequences necessary for their transcription and regulation was also achieved.  10  2  Materials and Methods  2.1  Sequence Analysis  Homology searches against the database of contig sequences at the Pseudomonas Genome Project (http://wvAv.pseudomonas.com, released Sept 17, 1997) for identification of putative phoP and phoQ genes were performed using the T B L A S T N algorithm (Altschul et al., 1990). B L A S T X analysis against the National Center for Biotechnology Investigation (NCBI) non-redundant set of databases (http://www.ncbi.nlm.nih.gov/BLAST/) was performed to determine the genomic context of oprH. Amino acid sequence alignment of S. typhimurium, E. coli and P. aeruginosa PhoP and PhoQ was performed using the C L U S T A L W (Thompson et al, 1994) application and shaded using the GeneDoc program version 1.1.004 (Nicholas and Hughes, 1996). Protein structure predictions were performed using the T M B A S E application (Hofmann and Stoffel, 1993). Sequence alignment of promoter deletion construct sequences and identification of direct and inverted repeats was accomplished using the PCGene program (Korn and Queen, 1984).  2.2  Strains, Plasmids and Growth Conditions.  Bacterial strains and plasmids used in this study are listed in Tables 1 and 2, respectively. For rich media, strains were grown in Luria Bertani (LB) broth (1.0% Tryptone, 0.5% yeast extract, 0.5% NaCl) and maintained on L B solid media (agar added to 1.5% (w/v)) at 37°C. Media components were purchased from Difco Laboratories (Detroit, MI). Antibiotic concentrations used for E. coli were 100p,g/mL ampicillin and  11  Table 1. Bacterial strains used in this study  Strain Pseudomonas aeruginosa'. H103 H851 H854 H855 Escherichia coli: DH5oc  S17-1  Source or reference  Relevant genotype  Wild type P A O l HI 03 phoP::xylE-Gm H103 phoQ::xylE-Gm HI03 oprH::xylE-Gm  Nicas and Hancock (1980) This work Macfarlane et al. (1999) Macfarlane (unpublished data)  [supE44, lacll\69(§ 80/acZM15), hsdRXl, recAl, endAl, gyrA96, thil,relAl] [pro endA::RP4(Tc::Mu-Km::7n7)]  Gibco B R L  R R  R  12  Simon et al. (1983)  Table 2. Plasmids used in this study Plasmid pUCP19 p X 1918GT p E X l 00T  pEXP pGB22  pEMR2  pEMR3 pEMQla  pEMQ3c pEMPQ lb  pEMPQ2a  Relevant characteristic Escherichia-Pseudomonas shuttle vector pUC-based plasmid containing xylE-Gm cassette flanked by restriction sites from pUC19 Gene replacement vector with sacB marker, lacZ allele, oriT for conjugation-mediated transfer and unique Smal and l-Scel cloning sites phoP::xylE-Gm cloned into the Smal site of plasmid pEXlOOT 2.8kB .EcoRI chromosomal fragment from H103 containing oprH, phoP and part of phoQ cloned intopUC18 0.9kB Pstl fragment from pGB22 containing phoP cloned into pUCP 19 in reverse orientation to the lac promoter As pEMR2 but insert cloned behind the lac promoter 1.55kB fragment containing phoQ and 156 bases of phoP cloned behind the lac promoter in pUCP20 As p E M Q 1 a but insert cloned in reverse orientation to the lac promoter 2.16kB fragment containing phoP and phoQ and 93 bases of upstream sequence cloned behind the lac promoter in pUCP20 As p E M P Q l b but insert in reverse orientation to the lac promoter Sspl- Hindi fragment of an exonuclease III treated pGB22 cloned into the Smal site of pUCP19(see Figure 12 A) Sspl- Hindi fragment of an exonuclease III treated pGB22 cloned into the Smal site of pUCP19(see Figure 12 A) Smal- Hindi fragment of pAK9 cloned into the Smal site of pUCP19 (see Figure 11, A) Sspl- Hindi fragment of an exonuclease III treated pGB22 cloned into the Smal site of pUCP19(see Figure 12A) a exonuclease III treated pGB22 which resulted in deletion of the oprH region (see Figure 4) P C R amplified oprH gene cloned into pUCP 19 R  R  Source or reference Schweizer(1991) Schweizer and Hoang (1995) Schweizer and Hoang (1995)  This work Bell and Hancock (1989)  Macfarlane et al. (1999)  Macfarlane et al. (1999) Macfarlane et al. (1999)  Macfarlane et al. (1999) Macfarlane et al. (1999)  Macfarlane et al. (1999)  a  pAKP8  pAKP9  pAKP9.5 pAKP12  pAK17 pBHR20  This work  This work  This work This work  This work Rehm and Hancock (1996)  the phoP gene on this plasmid has a G->A base change resulting in a Val88-»Ile change in the protein  13  for P. aeruginosa 300-350 u,g/mL carbenicillin and 15 pg/mL gentamicin. To study the effects of external magnesium concentration, P. aeruginosa strains were grown in B M 2 minimal media (Gilleland et al., 191 A) with glucose as the sole carbon source and supplemented with 0.02mM (low magnesium) or 2mM (high magnesium) MgSCu (Macfarlane et al., 1999). To study expression of OprH in E. coli, cells were grown in M9 minimal media (Sambrook et al., 1989) supplemented with magnesium at the high and low concentrations stated above. Plasmids were transformed into P. aeruginosa and E. coli by electroporation using a Gene Pulser™ (BioRad Laboratories, Hercules, CA) and 0.1cm gap cuvettes (BioRad Laboratories) according to published protocols (Sambrook et al, 1989; Dennis and Sokol, 1995).  2.3  Reagents  Commonly used buffers including PBS, SSC, T A E , TBE, TE (pH 8.0), and 50mM potassium phosphate buffer were made as described in Sambrook et al. (1989). A l l D N A restriction and modification enzymes were purchased from Gibco B R L (Burlington, ON) or New England Biolabs (Mississauga, ON) and used according to the manufacturer's instructions.  2.4  D N A Techniques  General molecular biology methods were performed according to Sambrook et al. (1989) or Ausubel et al. (1987 and updates). Small-scale plasmid preparations were performed using the QIAprep Spin Miniprep System (Qiagen Inc., Chatworth, CA). D N A  14  fragments were purified from agarose gels using the GeneClean kit (Bio 101 Inc., Vista, CA). Large-scale isolation of plasmid pGB22 was performed as previously described (Sambrook et al, 1989) and the plasmid D N A was purified by P E G precipitation (Sambrook et al, 1989). Deletions of plasmid pGB22 (Table 2) were introduced by controlled exonuclease III (ExoIII) digestion (Henihoff, 1984) with the aid of the Erasea-Base® System according to the manufacturer's directions (Promega, Madison, WI). Briefly, to ensure targeted deletion, nicked and linear D N A was removed by acid-phenol extraction. Digestion of plasmid pGB22 with appropriate restriction enzymes followed by controlled ExoIII digestion and re-ligation resulted in nested deletions of the oprH promoter region. Digestion with the selected enzymes (Xbal and Aatll) resulted in the loss of 0.5kb of the plasmid containing part of the M C S and the reverse primer binding site. After initiation of ExoIII mediated deletion, samples were taken every 30 seconds for the first 3 minutes and every 1 minute for the following 6 minutes.  2.5  D N A Sequencing  Sequencing primer 1 (Table 3) was chosen using the Primer Designer 2.01 program and synthesized on a 392 D N A / R N A Synthesizer (PE-Applied Biosystems, Foster City, CA). Oligonucleotides were purified after deprotection at 55°C by precipitation with butanol and quantitated using a Perkin-Elmer (Lambda3) dual-beam spectrophotometer. Plasmid D N A for sequencing was quantitated using a Hoefer spectroflourometer (model TKO100, Hoefer Scientific Instruments, San Francisco, CA). D N A was sequenced using the A B I Model 373 automated D N A sequencer and the ABI Prism Dye Terminator Cycle Sequencing Kit with AmpliTaq D N A polymerase, FS (PE-  15  Table 3. Primers used in this study Primer Name Sequencing primer 1 Rt-forward Rt-reverse HpF HpR Qi  Primer Sequence  Poutl PpF PpR2 QpF Qseq3 Qseql Qinl OprH-rev2  5' - T A G A G C T G T T C C A T C A G G - 3 ' 5' - C T G C T G G T A G T G G A A G A C G A - 3 ' 5' -TCGACCTTGTCCTGCC AGTT-3' 5' - G G A G A A C A C C A T C G A G C A G C - 3 ' 5' - C G A T A G A C C T T G T C C A G C - 3 ' 5' - A G G A G T T C T T C G T G T T C G A C - 3 ' 5' - C A A C A G G C G G T T A A G C A G T G - 3 ' 5' -TGGATGTTGTTGCTGGTCTC-3'  5' -GGCGAC A C G G A A A T G T T - 3 ' 5' - G A A G G C G G C T A T C G T T A C C T - 3 ' 5' -GGTCGTGGTGGTATTCGCTG-3' 5' - C A A C T T C G T C G G C C T G A C C T - 3 ' 5' - G C C G T C C T G T T C C A G C T T G A - 3 ' 5' - A A C T A C A A G T T C T A A A T G A C C - 3 '  (R) indicates primer complementary to the non-coding strand  16  Complementary to Nucleotides 895-911 ofpUC18/19 475-494 of oprH 120-139 ofphoP(Rf 72-91 of oprH 367-386 of oprH (R) 589-603 of oprH and 1-6 of the oprH and phoP intergenic region 519-536 ofphoP(R) 7-26 of phoP 247-266 of phoP (R) 108-127 of phoQ 955-982 of phoQ (R) 388-407 ofphoQ 666-685 of phoQ (R) 96-115 of oprH (R)  Applied Biosystems). The method of D N A sequencing used for primer extension experiments is described below.  2.6  O p r H Expression Analysis  Whole cell lysates of logarithmic phase cells (OD6oo=0.6) were prepared by harvesting l m L of E. coli or P. aeruginosa cells and resuspending in lOmM Tris-HCl, pH 7.4 buffer. Protein quantitation was carried out according to published protocols (Sandermann and Strominger, 1972). Samples were prepared for sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) by addition of loading buffer containing 2% (w/v) SDS and 2% (v/v) 2-mercaptoethanol and heating to 100°C for 5 minutes. Proteins were resolved on a 15% SDS-polyacrylamide gel, with 70mM NaCl included in the gel for resolution of OprH and OprL (Hancock and Carey, 1979). Western immunoblotting onto Imobilon-P membranes (Millipore, Bedford, Ma) was performed using BioRad Trans-Blot electrophoretic transfer cell with cooling pack at constant voltage, 100V for 1 hour according to standard methodology (Sambrook et ah, 1989). Blots were probed with polyclonal anti-OprH serum (Bell and Hancock, 1989) at 1:10,000 dilution in PBS containing 1% (w/v) B S A for 1 hour followed by goat antirabbit alkaline phosphatase conjugated IgG (BioRad Laboratories, Hercules, CA) at 1:3,000 dilution. Immunoblots were developed using 50(ag/mL 5-bromo-4-chloro-3indolyl-phosphate, lOpg/mL nitroblue tetrazolium and lOpg/mL M g C h in 0.1M TrisH C l , pH 9.6 (Sambrook et al, 1989).  17  2.7  Construction of the phoP Mutant H851  The xylE-Gm cassette from pX1918GT was cloned into the unique Kpnl site of R  pAK9 (Table 2 and Figure 4). A plasmid containing aphoP::xylE-Gm fusion (pEXP, R  Table 2) was constructed by subsequent digestion with Smal and PshAI and subcloning into the unique Smal site of pEXlOOT. This construct was transferred into the mobilizing E. coli strain SI7-1 for conjugative transfer into P. aeruginosa P A O l . For biparental mating experiments P. aeruginosa was grown at 42°C and E. coli at 30°C, both in rich media. Mating was performed by a modified method of the triparental mating experiments previously described by Goldberg and Ohman (1984). Single crossover events were selected for on B M 2 minimal media containing carbenicillin and gentamicin. To select for the double crossover events, colonies were subsequently streaked on L B containing 5% sucrose. Sucrose resistant strains were checked for carbenicillin sensitivity and four sensitive clones were verified by Southern blot analysis. One of these (H851) was chosen for further study.  2.8  Southern Blot Analysis  Genomic D N A from wild-type P. aeruginosa and the phoP mutant H851 was prepared according to standard protocols (Ausubel et al., 1987 and updates). Approximately 20ug of each D N A was digested with Pstl or Bbsl overnight and the fragments were resolved on a 1% agarose gel. The digested D N A was transferred in alkaline buffer onto a positively charged nylon membrane (Boeringer Mannheim, Laval,  18  Quebec). The membrane was prehybridized for 30 minutes at 55°C prior to addition of probe. A xylE probe was generated by digesting plasmid pX1918GT with Aatll and a second probe complementary to bases 92-629 of the phoP gene, was generated by digestion of plasmid pAK17 with Kpnl and Pvul. Probe labeling with alkaline phosphatase, prehybridization, hybridization and blot development was performed as described in the AlkPhos Direct Manual (Amersham Life Science, Oakville, Ontario). Signal detection was carried out using CDP-Star™ detection reagent (Amersham Life Science). Blots were exposed to Kodak Biomax M R Film (Eastman Kodak Company, Rochester, N Y ) .  2.9  Determination of Catechol-2,3-dioxygenase Activity  Assays were performed on mid-logarithmic phase cells (OD6oo=0.7) according to published methods (Dereic and Konyecsni, 1988). Cells from 50mL of culture were harvested and resuspended in 750uL 50mM potassium phosphate buffer, pH 7.5 containing 10% acetone. Cells were broken by sonication on ice for 30 seconds. Unbroken cells and debris were removed by centrifugation for 20 minutes at 5000rpm at 4°C. Protein concentration of the supernatant was determined as described above. Two samples of the supernatant, each diluted in a total volume of l m L containing 50mM potassium phosphate buffer, pH7.5 and 0.3mM catechol, were assayed for catechol-2,3dioxygenase activity. The conversion of catechol to 2-hydroxymuconic semialdehyde was recorded on a Perkin-Elmer (Lambda3) dual-beam spectrophotometer coupled to a Perkin-Elmer 561 chart recorder by following the change in absorbance at 375nm. The  19  molar extinction coefficient of the product, 2-hydroxymuconic semialdehyde, at this wavelength is 4.4 x 10 M " cm" . A l l experiments were performed in triplicate. 4  2.10  1  1  R N A Isolation and R T - P C R  Total cellular R N A was isolated from logarithmic phase cultures of P. aeruginosa grown in B M 2 containing 0.02mM MgSC»4 using the RNeasy™ Mini Kit (Qiagen Inc.) according to the manufacturer's instructions. Samples were treated for 30 minutes with 50U DNase (RNase-ffee; Gibco BRL) in the presence of 15U R N A Guard (Amersham Pharmacia Biotech, Buckingamshire, England) in a total volume of lOOpL, followed by ethanol precipitation of the R N A . The quality was assessed by running approximately 5ug on a 0.7% agarose-formaldehyde gel using standard procedures (Sambrook et al., 1989). Reverse transcription was performed using lOpg R N A template, 15pmoles of the 5' primer (RT-rev, Table 4), 13.5U A M V reverse transcriptase in l x RT Buffer (Gibco BRL), 50mM M g C l and 2.5mM each of dATP, dTTP, dGTP and dCTP. Reactions were 2  performed in a Minicycler (Fisher Scientific, Nepean, ON) at 42°C for 15 minutes followed by a denaturation step (99°C for 5 minutes) to inactivate the reverse transcriptase. After reverse transcription, PCR was performed in a lOOuL final volume after addition of the following components: 2U of Taq D N A polymerase, l x PCR Buffer (Gibco BRL), an additional 50pmoles each of 5' primer and of 3' primer, MgCb_ to a final concentration of 50mM. Amplification was achieved by 31 cycles of 95°C for 1 minute, 50°C for 1 minute and 72°C for 2 minutes. As a positive control, PCR was also performed using lOuL of D N A isolated from whole cells by chloroform extraction as a  20  template. PCR products were resolved on a 1% agarose gel according to standard protocols (Sambrook et al, 1989).  2.11  Generation of Probes for R N A Dot Blots and Northern Blots  A probe complementary to oprH was generated by PCR amplification of the appropriate genetic regions using the HpF and HpR primers (Table 3) and pBHR20 (Table 2) as a template. A probe complementary to phoP was obtained by amplification of 630 bp region of pEMR3 using the primers Q l and Poutl (Table 3). To minimize the presence of nonp/zoP-coding regions, the product of this PCR was subsequently used as a template in a second round of PCR using the primers PpF and PpR (Table 3) to amplify a 260 bp fragment internal to phoP. Similarly, a probe complementary to phoQ was generated by two round of PCR; the first using primers QpF and Qseq3 (Table 3) and p E M Q l a as a template (Table 2) to amplify a 866 bp fragment, the second using primers Qseql and Qinl amplify an internal a 287 bp fragment suitable for use as a probe. A probe complementary to rpoB (generated as described in Och et al., 1999) for use in R N A dot blots was a kind gift from Dr. Och. PCR was performed in a 50pL volume with I X Vent® polymerase buffer, 1U Vent polymerase (New England Biolabs), 4mM dNTPs and 50pmoles of each primer. For amplification of the oprH probe, 5%(v/v) D M S O was included in the P C R and for the phoP large fragment and both phoQ fragments 10%(v/v) D M S O was included. The PCR program used for amplification of all fragments was: 94°C for 5 minutes, 65°C or 67°C for the phoP probe for 1 minute; 72°C for 1 minute, 25-31 cycles of 94°C for 1 minute, 65°C or 67°C for 1 minute and 72°C for 1 minute; then one cycle of 94°C for 1 minute, 65°C or 67°C for 1 minute and 72°C for 10 minutes.  21  Approximately 25ng of each D N A probe was labeled with [aP ]-dCTP (Amersham Pharmacia Biotech) using the rediprime™ II random primer labeling system (Amersham Pharmacia Biotech) according to the manufacturer's instructions.  2.12  Northern Blot and R N A Dot Blot Analysis  R N A was isolated from P. aeruginosa cells grown in B M 2 media containing 2mM or 0.02mM MgSC»4 as described above. Approximately 5pg of each sample were denatured at 65°C for 5 minutes in the presence of 2.2M formaldehyde and 50% formamide and resolved on a 1.2% agarose gel containing 0.6M formaldehyde in MOPS buffer. R N A was transferred onto a positively charged nylon membrane (Boehringer Mannheim) by downward alkaline blotting in 50mM NaOH (Ingelbrecht et al., 1998). Blots were hybridized overnight at 60°C (oprH probe) or 45°C (phoP and phoQ probes) in formamide prehybridization/hybridization buffer as described by Ausubel et al. (1987 and updates). Blots were washed twice for 5 minutes at room temperature in 2XSSC, 0.1% SDS, twice for 5 minutes at room temperature in 0.2XSSC, 0.1% SDS then twice for 15 minutes at hybridization temperature in 0.1XSSC, 0.1% SDS. Autoradiography was performed as described by Ausubel et al. (1987 and updates) and blots were exposed to Kodak Biomax A R Film (Eastman Kodak Company). For R N A dot blots, 3ug of R N A isolated from wildtype P. aeruginosa and the phoP,phoQ and oprH mutants were denatured at 65 °C for 5 minutes and spotted onto positively charged nylon membranes (Boehringer Mannheim). Crosslinking was carried out by exposure to a U V source. Hybridization and washing was performed as described above for the Northern blots. Dot blots were quantitated by exposure to the  22  Phospholmager SI system using the ImageQuant v. 1.1 software (Molecular Dynamics Inc., Sunnyvale, CA). The amount of rpoB transcript was used as a standard to quantitatively compare the amount of oprH, phoP and phoQ transcripts. A l l dot blots were performed in triplicate.  2.13  Primer Extension  Total cellular R N A was isolated as described above. The OprH-rev2 primer (Table 3), which hybridized within the oprH gene was end-labeled with [y -P]dATP 32  (Amersham Canada Ltd.) then added to 5pg of R N A in 50mM Tris-HCl, pH 8.3 containing 20mM KC1 in a final volume of lOuL for hybridization at 60°C. The primer was extended by addition of 100U Superscript™ reverse transcriptase (Gibco B R L ) in the presence of 50mM Tris-HCl, pH 8, 40mM KC1, 6mM M g C l , 20mM dNTPs and 10U 2  Ribonuclease Inhibitor (Gibco B R L ) in a final volume of 30uL. Reaction mixtures were incubated at 45°C for 60 minutes then stopped by addition of l p L 0.5M E D T A , pH 8. Following treatment of the samples with DNase-free RNase (Boehringer Mannheim) for 15 minutes at 37°C the, c D N A was isolated by ethanol precipitation . The c D N A pellets were resuspended in 3-4uL fmol loading buffer (Promega), denatured and loaded on a 6% acrylamide sequencing gel. Dideoxy-sequencing of the appropriate region of plasmid pGB22 was carried out using the fmol D N A cycle sequencing system (Promega) with the OprH-rev2 and the reactions were loaded alongside the primer extension reactions. As controls, reactions were performed with tRNA only or R N A treated with RNase prior to cDNA synthesis.  23  3  Results  3.1  Identification oiphoP and phoQ Genes in P. aeruginosa  Identification of PhoP and PhoQ homologues in P. aeruginosa was facilitated by the September 17, 1997 release of a database of contig sequences by the Pseudomonas Genome Project. Using the T B L A S T N algorithm (Altschul et al., 1997), two openreading frames (ORFs) were identified in the same direction as the oprH gene encoding proteins with high sequence similarities to both S. typhimurium (Miller et ai, 1989) and E. coli (Kasahara et al., 1992) PhoP and PhoQ proteins. The putative P. aeruginosa PhoP and PhoQ proteins showed 53-54 % and 33% sequence identity, respectively, to the corresponding proteins from S. typhimurium and E. coli (Figures 2 and 3). The phoP and phoQ genes have G C contents typical of P. aeruginosa genes (>65%). The start of the putative phoP gene is located 79 bp downstream of oprH, but no obvious a  7 0  type  consensus sequence was evident in the intergenic region. The phoQ ORF was proposed to begin with the less common G T G start codon and overlap phoP by four nucleotides (Figure 4), suggesting the genes are transcribed as a single unit. Despite extensive analysis, no -10 or -35 consensus sequences could be identified in the region upstream of oprH. However, four direct hexanucleotide repeats (GTTCAG) were identified 60 bp upstream of oprH, each separated by five nucleotides (Figure 4). Four similar repeats were identified on the opposite strand within the oprH gene; three in the reverse direction to and one in the same direction as oprH transcription (Figure 12A). One of these repeats contains an adenine to guanine change and the spacing between the repeats was not conserved. It should be noted that direct hexanucleotide repeats  24  GKHVD LVVED||ALLRHHLYTRjL'GEQiHav LVVEDIALLRHHLKVQLQDSGH&/D  P. ae S .ty E . co  P. ae S .ty E . co  GHfiBVD  GADDYV GADDYV GADDYV  99 100 99  KQAL^EjEJQPVA R E LSVNEEVIK RELSF^DEY'-I-W  149 150 149  I DLGLPGMS 3L LIP.EL P.SQGK 3Ls LIP. b: RS pDLGLP DEO DLGLP 3L LIP. RS  ••  • •• •  P. ae S .ty E . co  LASQVHNI LAJ_OVaSL@  P. ae S.ty E . co  P. ae S .ty E . co  49 50 49  HHgQ iia:.:.  LMjSQLYPD  iSnngkhhs  LMlQLYPD  I  TVRGQGYLF TVRGQGYLF jrcJoYPQElIf TVRGQGYLF  L E 3 C G G F K PHD  |DANVpE eshtT ESHT  225 224 223  Figure 2. Amino acid sequence alignment of the PhoP proteins. PhoP of P. aeruginosa (P.ae) was aligned with the protein sequence from E. coli (E.co) and S. typhimurium (S.ty) using the C L U S T A L W application and shaded with GeneDoc P. aeruginosa PhoP shows 53 and 54% sequence identity to the PhoP proteins of S. typhimurium and E. coli respectively. Residues marked by dots below the sequence are conserved among response regulators while those marked by asterisks above are highly conserved. One of the aspartate residues may constitute the site of phosphorylation.  25  199 200 199  P.ae S.ty . E. co  \DVATLVS7 RGESNLFYTLi  BIS  P. ae S .ty E . co  LPVE@]FNLPEAKVLGY| |LRr- . : |lD .  P. ae 5 .ty E .co  REDDDQREMHSVAVNj  RSTSAADESINYTHRYDGRG—NHFHJJTR11KGEEFFVFDVEIDL| TP!Nli*ffilKs|F^^KjTiP^ A g ^ D v r '.MKr-'i'.gHiJ i \r t ,L_t 1a#u#Ir^pSG«i|QcJ  RKDDDDAEMTHSVAV|  HKQRER LLISE RERYjNK LLHSE RSRYjDK  P. ae S .ty E . co  s  ^SF  39S11  -STL  lEEHYRLmGRWRVG^LG PGY S E LWV E D D G P G CKYBlErfflEI  : : :  LAVA LAVA LAVA  140 146 146  267 296 296  LAVLQ LAVL':; LAVL>;  |K—SGl  -PGNREOVRWLQG  P. ae S .ty E .co  67 71 71  192 221 221  P . ae S .ty E . co  p ae s ty E co  IKGRLVMPEH  |DEELSLDiSE Q|l|spL K1V|GE  VEDDGPG S^QTriEHlJYgV V E D D G P G  3FRIR  •••-.•v| RMB.VSI  448 487 486  Figure 3. Amino acid sequence alignment of the PhoQ proteins Translation of the phoQ gene from of P. aeruginosa (P.ae) was aligned with the protein sequence from E. coli (E.co) and S. typhimurium (S.ty). P. aeruginosa PhoQ shows 33% sequence identity to PhoQ proteins of both S. typhimurium and E. coli. Predicted transmembrane domains are indicated by underlines for the S. typhimurium protein and by dashed overhead lines for the P aeruginosa PhoQ. Residues conserved among sensor kinases are indicated by dots below the sequence and the histidine resicue believed to be the site of autophosphorylation is marked by an asterisk. The start of the putative ATP binding domain is indicated by a directional arrow below the sequence. The amino acid substitution Thr48->Ile in a S. typhimurium mutant, that constitutively expresses PhoP, activated genes in indicated by an arrowhead below.  26  339 371 370  414 446 445  CCGGCAAACGCGAGTCGTTCAGCCCGGGTTCAGCAAGCGTTCAGGGGCGGTTCAGTACCC  .OprH  61 1  TGTCCGTACTCTGCAAGCCGTGAACGACACGACTCTCGCAGAAdGGAGKAACACC :C!ATGA *ATGAA M K  121 3  AGCACTCAAGACTCTCTTCATCGCCACCGCCCTGCTGGGTTCCGCCGCCGGCGTCCAGGC A L K T L F I A T A L L G S A A G V Q A  181 23  CGCCGACAACTTCGTCGGCCTGACCTGGGGCGAGACCAGCAACAACATCCAGAAATCCAA A D N F V G L T W G E T S N N I Q K S K  2 41 43  GTCGCTGAACCGCAACCTGAACAGCCCGAACCTCGACAAGGTGATCGACAACACCGGCAC S L N R N L N S P N L D K V I D N T G T  301 63  CTGGGGCATCCGCGCCGGCCAGCAGTTCGAGCAGGGCCGCTACTACGCGACCTACGAGAA W G I R A G Q Q F E Q G R Y Y A T Y E N  361 83  CATCTCCGACACCAGCAGCGGCAACAAGCTGCGCCAGCAGAACCTGCTCGGCAGCTACGA I S D T S S G N K L R Q Q N L L G S Y D  4 21 103  CGCCTTCCTGCCGATCGGCGACAACAACACCAAGCTGTTCGGCGGTGCCACCCTCGGCCT A F L P I G D N N T K L F G G A T L G L  481 123  GGTCAAGCTGGAACAGGACGGCAAGGGCTTCAAGCGCGACAGCGATGTCGGCTACGCTGC V K L E Q D G K G F K R D S D V G Y A A  541 143  CGGGpTGCAGpCCGGTATdCTGCAGpAGCTGAGCAAGAATGCCTCGATCGAAGGCGGCTA G L Q A G I FT Q E L S K N A S I E G G Y  601 163  TCGTTACCTGCGCACCAACGCCAGCACCGAGATGACCCCGCATGGCGGCAACAAGCTGGG R Y L R T N A S T E M T P H G G N K L G  661 183  CTCCCTGGACCTGCACAGCAGCTCGCAATTCTACCTGGGCGCCAACTACAAGTTCTAAAT S L D L H S S S Q F Y L G A |N_ Y K F * 200  721  GACCGCGCAGCGCCCGCGAGGGCATGCTTCGATGGCCGGGCCGGAAGGTCCGGCCGCATC  781 1  T C A T C C ; G A G G ; A A C CrTCCAATTGGAA A A C T G C T G G T A G T G G A A G A C G A G G C G C T G T T G C G C C A C C M K L L V V E D E A L L R H H  841 16  ACCTCTATACCCGCCTGqGTGAACp,GGGGCACGTGGTGGACGCGGTACCGGATGCCGAGG L Y T R L G E Q G H V V D A V P D A E E  ,  Pxt.T  m  pEMR2/3  pEMPQlb/2a PhoP  • 'pAK17 ,  KpnJ  901 36  AAGCCCTCTACCGGGTCAGCGAATACCACCACGACCTGGCGGTGATCGACCTCGGCCTGC A L Y R V S E Y H H D L A V I D L G L P  961 56  CGGGCATGAGCGGCCTGGACCTGATCCGCGAGCTGCGTTCGCAGGGCAAGTCCTTCCCGA G M S G L D L I R E L R S Q G K S F P I  1021 76  TCCTGATCCTCACCGCCCGCGGCAACTGGCAGGACAAGGTCGAAGGCCTGGCCGCCGGGG L I L T A R G N W Q D K V E G L A A G A  1081 96  CCGACGACTACGTGGTCAAGCCGTTCCAGTTCGAGGAACTGGAAGCGCGCCTGAACGCGT D D Y V V K P F Q F E E L E A R L N A L  27  1141 116  TGCTGCGACGCTCCTCGGGGTTCGTCCAGTCGACCATCGAGGCCGGCCCCCTGGTCCTCG L R R S S G F V Q S T I E A G P L V L D  1201 136  ACCTGAACCGCAAGCAGGCGCTGGTCGAGGAGCAACCGGTGGCGCTGACCGCCTACGAAT L N R K Q A L V E E Q P V A L T A Y E Y  12 61 156  ACCGCATCCTCGAATACCTCATGCGGCATCACCAGCAGGTGGTGGCCAAGGAACGCCTGA R I L E Y L M R H H Q Q V V A K E r|_L M  1321 176  TGGAACAGCTCTATCCCGACGACGAGGAGCGCGACGCCAACGTCATCGAGGTGCTGGTCG E Q L Y P D D E E R D A N V I E V L V G  1381 196  GCCGCCTGCGGCGCAAGCTGGAGGCCTGCGGCGGCTTCAAGCCGATCGATACGGTGCGCG R L R R K L E A C G G F K P I D T V R G  pEMQla/3c  j—•  PhoQ  14 41 216 1  G C C A G G G C T A C C T G T T C A C C GAG' ^ G C T G C C G G T G A T C C G T T C C C T G C G C A T C C G T C T G A T Q G Y L F T E R C R * 225 V I R S L R I R L M  1501 II  GCTCGGCGCCGCCGCCCTGGCGGTGCTGTTCATGCTGGCGCTGCTGCCGGCCCTGCAGCG L G A A A L A V L F M L A L L P A L _qJ R  1561 31  GGCCTTCGGCATCGCCCTGGAGAACACCATCGAGCAGCGCCTGGCCGCCGACGTGGCGAC A F G I A L E N T I E Q R L A A D V A T  1621 51  CCTGGTCTCGGCGGCGCGGGTGGAGAAGGGCCGCCTGGTGATGCCCGAGCACCTGCCGGT L V S A A R V E K G R L V M P E H L P V  1681 71  GGAGGAGTTCAACCTGCCGGAGGCCAAGGTCCTCGGCTATATCTACGACCAGAATGGCGA E E F N L P E A K V L G Y I Y D Q N G D  17 41 91  TCTGCTCTGGCGCTCCACCTCGGCGGCCGACGAGTCGATCAACTACACGCCGCGCTACGA L L W R S T S A A D E S I N Y T P R Y D  18 01 III  CGGCCGCGGCAACjGAATTCpACACCACCCGCGATGCGAAGGGCGAGGAGTTCTTCGTGTT G R G N E F H T T R D A K G E E F F V F  18 61 131  CGACGTCGAGATCGACCTGCTGCGCGGCAAGCAGGCGGCCTACAGCATCGTCACCATGCA D V E I D L L R G K Q A A Y S I V T M Q  1921 151  ATCGGTCAGCGAGTTCGAGAGCCTGCTCAAGGGGTTCCGCGAGCAGCTCTACCTGTGGCT S V S E F E S L L K G F R E Q L Y L W L  1981 171  CGGCGGCGCCCTGCTGGTCTTGCTCGGGCTGCTCTGGCTGGGTCTGACCTGGGGCTTCCG G G A L L V L L G L L W L G L T W G F R  2 041 191  GGCGATGCGCGGGTTGAGTTCCGAGCTGGACCAGATCGAATCCGGCGAGCGCGAGAGCCT A M R G L S S E L D Q I E S G E R E S L  2101 211  GAGCGAGGAGCATCCGCGCGAGCTGCTGCGCCTGACCCACTCGCTTAACCGCCTGTTGCG S E E H P R E L L R L T H S L N R L L R  2161 231  CAGCGAGCACAAACAGCGCGAGCGCTACCGCCACTCCCTCGGCGACCTGGCGCACAGTCT S E H K Q R E R Y R H S L G D L A H S L  2221 251  GAAGACGCCGCTGGCGGTCTTGCAGGGGGTCGGCGACCAGCTCGCCGAGGAGCCCGGCAA K T P L A V L Q G V G D Q L A E E P G N  pEMR2/3  EcoRT  28  2281 271  CCGCGAGCAGGTGCGGGTGCTACAGGGCCAGATCGAGCGCATGAGCCAGCAGATAGGCTA R E Q V R V L Q G Q I E R M S Q Q I G Y  2341 291  TCAGTTGCAGCGCGCCAGCCTGCGCAAGAGCGGCCTGGTACGCCATCGCGAGCAACTGGC Q L Q R A S L R K S G L V R - H R E Q L A  2 4 01 311  GCCGCTGGTGGAGACCCTGTGCGACGCGCTGGACAAGGTCTATCGCGACAAGCGGGTAAG P L V E T L C D A L D K V Y R D K R V S  2 4 61 331  CCTGCAGCGGGACTTCTCGCCGTCCTTCAGCGTGCCGGTGGAGCGCGGCGCGCTGCTGGA L Q R D F S P S F S V P V E R G A L L E  2 521 351  ACTGCTCGGCAACCTGCTGGAGAACGCCTATCGCCTGTGCCTGGGCCGGGTCCGCGTGGG L L G N L L E N A Y R L C L G R V R V G  2581 371  CGCCCGGCTGGGGCCGGGTTACTCGGAGCTGTGGGTCGAGGACGACGGTCCCGGAGTGCC A R L G P G Y S E L W V E D D G P G V P  2 641 391 .  TGCCGAACAGCGCGCACGAATCATCCGCCGCGGCGAGCGCGCCGATACCCAGCACCCGGG A E Q R A R I I R R G E R A D T Q H P G  2 7 01 411  GCAGGGCATCGGCCTGGCCGTGGCGCTGGACATCATCGAGAGCTACGACGGCGAACTGAG Q G I G L A V A L D I I E S Y D G E L S  27 6 1 431  CCTGGACGATTCCGAGCTGGGCGGCGCCTGCTTCCGCATACGTTTCGCTACAGTCTGAGA L D D S E L G G A C F R I R F A T V * 448  2821  CTTGGCGGCCGTTCCCTACGTCTGAGGTGTTIICCGCGCTACGCTGAAGTCTGTTCGGCTG  38 8 1  GCGCAGTTCCTTTGACGCAGGTACCGGGGATTCGAGCGGATGTTCAGTGGCAAAACCGAC  \pEMQla/3c,pEMPQlb/2a  Figure 4. Genetic organization of the oprH,phoP and phoQ genes The nucleotide sequence and the translation of the oprH, phoP and phoQ genes are shown. A n arrow indicates the start of the coding region of each gene and putative ShineDalgarno sequences are boxed. The start of transcription from the oprH promoter is in bold and underlined. A putative -10 sequence is also indicated in bold and the hexanucleotide repeats are underlined. The restriction enzyme sites for insertion of xylEG m cassettes are boxed and named above (PstI for oprH, Kpnl for phoP and EcoRl for phoQ). The regions cloned into plasmids carrying the phoP and phoQ genes (Table 2) are bound by brackets with the name of the plasmids in italics below. A n arrowhead indicates the extent of deletion in plasmid pAK17. R  29  (GTTTAT) have also been identified upstream of the phoP genes in S. typhimurium (Groisman et al., 1989) and E. coli (Groisman et al, 1992). To aid the future study of the transcriptional behavior of these genes, their chromosomal context was determined. Starting 224 bp upstream of the oprH gene and oriented in the opposite direction, six ORFs were identified. Their putative gene products showed amino acid sequence similarity to the Nap family of proteins (NapEFDABC) found in various Gram negative organisms (Figure 5). In Rhodobacter sphaeroides these proteins are involved in denitrification (Liu et al, 1999). One hundred bases downstream of phoQ is a large ORF (1120 aa) coding for a putative protein that shows similarity only to a hypothetical protein from E. coli.  3.2  Construction of the phoP Mutant H851  To investigate the role of PhoP and PhoQ in regulation of oprH, phoP and phoQ transcription, a P. aeruginosa mutant was constructed in which the phoP gene was interrupted by a xylE-Gm cassette. To construct this mutant, the plasmid pEXP was R  created by cloning thephoP::xylE-Gm fusion into plasmid pEXlOOT. Plasmid pEXP R  was then conjugally transferred into wildtype P. aeruginosa P A O l to allow integration of the gene fusion into the chromosome by homology mediated crossover. Many cointegrates were obtained by selection on B M 2 media containing gentamicin and carbenicillin. The sacB positive selection was used to select for double crossover events by streaking cointegrates on L B media containing gentamicin and sucrose. Approximately 20 clones identified by this method were checked for excision of plasmid  30  IS  IS"  OQ ^ B 3  a. to  o  O 09  TO  xt 2  «> 55  g a O O > t/a O  £8  sequences by testing for growth on carbenicillin. Four carbenicillin sensitive clones were randomly selected for Southern blot analysis. Genomic D N A from the above clones was digested with both Pstl and Bbsl, which allowed verification of the insertion of the cassette in the correct location and the excision of plasmid sequences (Figure 6A). Digests were resolved on an agarose gel, blotted and probed with D N A complementary to both the xylE and phoP genes. A fragment of the correct size was identified in all four mutants when the blot was probed with the xylE fragment, compared to the absence of any signal in the wild type (Figure 6B). Similarly, when compared to wild type, all four mutants showed a 3.4 kb increase in the Pstl fragment hybridizing to the phoP probe which corresponded to the insertion of the xylE-Gm cassette into the phoP gene (Figure 6B). When genomic D N A from the R  mutants was digested with Bbsl, a change from 1.4 kb to 985 bp for the fragment hybridizing to the phoP probe was observed due to the additional Bbsl site within the cassette (Figure 6B). . Based on these results, one of these positive mutants (H851) was selected for further study. In addition to being phoP null, this mutant contains a phoPwxylE chromosomal gene fusion. In this construct omega fragments flank the gentamicin resistance gene, aacCl, preventing read-through from the aacCl promoter into downstream genes (Schweizer and Hoang, 1995). The phoP mutant H851 was, therefore, assumed to be both phoP and phoQ negative. This phoP mutant was not defective for growth on both rich media (LB) and minimal media with low magnesium (BM2, 0.02mM MgSC^) in contrast to a S. typhimurium phoPv.TnlO insertional mutant which was deficient for growth in low magnesium liquid media (Soncini et al., 1996)  32  A.  993b  oprH \ phoPi  wildtype  phoP mutant  P  3,438b  °P ){\  xylE/Gm  rH  phoQ  [  K  985b  t  2,863b  B  u  B  B.  M  W  M  W  M  W  M  W  bp  3,438 •2,863  -1,405 :985, 993 Digest:  Probe:  Pst\  Bbs\  phoP  Pst\  Bbs\  xylE  Figure 6. Confirmation of the genotype of the phoP mutant, H851, by Southern blot hybridization. A . Pstl (P) and Bbsl (B) sites are indicated above and below the genes in wild type and the phoP mutant. The expected size of digest fragments in base pairs are shown between the sites. The xy/^-gentamicin resistance cassette is represented by the hatched box. Approximate sites of phoP and xylE probe binding are indicated by small arrows within the genes. B. Enzymes used to digest genomic D N A from wild type (W) and the phoP mutant (M) and the probes used for hybridization are indicated below each blot. The fragment sizes are indicated to the right of the blots.  33  3.3  Magnesium Regulated Expression of O p r H in the phoP and phoQ mutants To determine the role of PhoP and PhoQ in expression of the outer membrane  protein OprH, a phoQ mutant (H854), constructed in a similar manner to that described above for the phoP mutant (Macfarlane et al, 1999), was studied. In H854, the xylE-Gm* cassette had been inserted into the unique EcoEl site in phoQ and the mutant was confirmed by Southern blot analysis. Multicopy plasmids encoding PhoP and PhoQ, cloned individually or together (Table 2), were transformed into both the phoP and phoQ mutants and OprH expression was assessed by Western immunoblotting. As previously reported (Nicas and Hancock, 1980), OprH expression was induced in wildtype P. aeruginosa under low magnesium conditions (0.02mM MgS04) but was almost completely absent under high magnesium conditions (2mM MgS04) (Figure 7, lanes 1 and 2). In contrast, OprH was not expressed in the phoP mutant under either high or low magnesium conditions (Figure 7, lanes 3 and 4). Transformation of this mutant with a plasmid encoding PhoP under control of the lac promoter (pEMR3, Table 2) restored OprH expression irrespective of magnesium concentration and to a higher level than that seen in wildtype P. aeruginosa grown in low magnesium (Figure 7, lanes 7 and 8 versus lane 2). The phoP mutant could be complemented with a plasmid carrying both genes in reverse orientation to the lac promoter (pEMPQ2a, Table 2). This plasmid both restored OprH expression and the regulation of this expression by magnesium (Figure 7, lanes 15 and 16). Surprisingly, a plasmid encoding both PhoP and PhoQ expressed from the lac promoter (pEMPQlb, Table 2) did not restore OprH expression in the phoP mutant (Figure 7, lanes 13 and 14). Plasmids carrying phoP in the reverse orientation to the lac promoter (pEMR2),phoQ in either orientation (pEMQla and pEMQ3c) or the control  34  Figure 7. Effect of magnesium and PhoP and PhoQ expressing plasmids on O p r H expression in the phoP mutant A . 15% SDS-polyacrylamide gel and B. Western immunoblot of whole cell lysates from P. aeruginosa cells with PhoP and PhoQ expressing plasmids grown in high and low magnesium. Lane M . molecular weight marker; lane 1. H103 (wild type P. aeruginosa) in low M g ; lane 2. H103 in high M g ; lane 3. W>5\(phoP mutant) in high M g ; lane 4. H851 in low M g ; lane 5. H851/pEMR2 in high M g ; lane 6. H851/pEMR2 in low M g ; lane 7. H851/pEMR3 in high M g ; lane 8. H851/pEMR3 in low M g ; lane 9. H851/pEMQla in high M g ; lane 10. H851/pEMQla in low M g ; lane 11. H851/pEMQ3c in high M g ; lane 12. H851/pEMQ3c in low M g ; lane 13. H851/pEMPQlb in high M g ; lane 14. H851/pEMPQlb in low M g ; lane 15. H851/pEMPQ2a in high M g ; lane 16. H851/pEMPQ2a in low M g . 2 +  2 +  2 +  2 +  2 +  2 +  2 +  2 +  2 +  2 +  2 +  2 +  2 +  2 +  2 +  2 +  35  plasmid (pUCP19) did not affect OprH expression in the phoP mutant (Figure 7, lanes 5 and 6, 9 and 10, and 11 and 12; data not shown for pUCP19). In contrast to the phoP mutant, OprH expression in the phoQ mutant H854 was both constitutive and high (Figure 8, lanes 2 and 3). A plasmid carrying phoQ behind the lac promoter (pEMQla) decreased expression of OprH in both high and low magnesium, but to a greater extent in high magnesium (Figure 8, lanes 9 and 10). Regulated expression of OprH was also restored in the phoQ mutant when the plasmid encoding PhoP and PhoQ (pEMPQ2a) was used to complement (Figure 8, lanes 13 to 16). Similar to the phoP mutant, expression of PhoP and PhoQ from the lac promoter on the multicopy plasmid p E M P Q l b suppressed expression of OprH (Figure 8, lanes 13 and 14). Plasmids carrying phoP or phoQ in the reverse orientation to the lac promoter (pEMR2 and pEMQ2a) and the control plasmid (pUC19) did not affect OprH expression in the phoQ mutant (Figure 8, lanes 5 and 6 and 11 and 12; data not shown for pUCP19).  3.4  The Role of PhoP-PhoQ in Transcription of the oprH-phoP-phoQ Operon  3.4.1  Transcriptional Linkage of oprH and phoP-phoQ  The proximity of the oprH and phoP genes (79 bp apart) prompted us to investigate whether cotranscription of these two genes occurs. Reverse transcription followed by PCR (RT-PCR) was performed using total R N A from wildtype P. aeruginosa and primers complementary to basepairs 475-494 of oprH and basepairs 120139 of phoP. The presence of both these genes on a single transcript would give a 346 bp product after RT-PCR. When R N A from P. aeruginosa grown in low magnesium (to  36  M  1  2  3  4 5  6  7 8  9  1  2  3  4  6  7 8  9 10 11 12 13 14 15 16  5  10 11 12 13 14 15 16  —OprH  Figure 8. Effect of magnesium and PhoP and PhoQ expressing plasmids on O p r H expression in the phoQ mutant A . 15% SDS-polyacrylamide gel and B. Western immunoblot of whole cell lysates from P. aeruginosa cells with PhoP and PhoQ expressing plasmids grown in high and low magnesium. Lane M . molecular weight marker; lane 1. HI03 (wild type P. aeruginosa) in low M g ; lane 2. H103 in high M g ; lane 3. H854 (phoQ mutant) in high M g ; lane 4. H854 in low M g ; lane 5. H854/pEMR2 in high M g ; lane 6. H854/pEMR2 in low M g ; lane 7. H854/pEMR3 in high M g ; lane 8. H854/pEMR3 in low M g ; lane 9. H854/pEMQla in high M g ; lane 10. H854/pEMQla in low M g ; lane 11. H854/pEMQ3c in high M g ; lane 12. H854/pEMQ3c in low M g ; lane 13. H854/pEMPQlb in high M g ; lane 14. H854/pEMPQlb in low M g ; lane 15. H854/pEMPQ2a in high M g ; lane 16. H854/pEMPQ2a in low M g . 2 +  2 +  2 +  2 +  2 +  2 +  2 +  2 +  2 +  2 +  2 +  2 +  2 +  2 +  2 +  2 +  37  increase the abundance of oprH transcript) was used as the template for RT-PCR, a product of this size was observed (Figure 9, lane 1). In the absence of an R N A template or of reverse transcriptase enzyme, no product was observed, but a fragment of the same size was obtained in the control PCR reaction using genomic D N A as the template (Figure 9, lanes 2, 3 and 4). As the phoP and phoQ genes overlap by four nucleotides and a promoter for phoQ would have to lie within the phoP gene, it was assumed that phoP and phoQ were also transcriptionally linked. Thus the three genes, oprH, phoP and phoQ form a small operon. This gene arrangement was confirmed by Northern blot experiments described below.  3.4.2  Magnesium Regulated Transcription of oprH, phoP and phoQ  Transcription of the oprH, phoP and phoQ genes was compared in wild type P. aeruginosa and the phoP and phoQ mutants by Northern blot analysis. R N A isolated from wild type P. aeruginosa grown in high (2mM M g S 0 ) and low (0.02mM M g S 0 ) 4  4  magnesium media was probed with D N A complementary to each of these genes. These experiments revealed not only magnesium regulated transcription of oprH, but also magnesium regulated phoP and phoQ transcription (Figure 10). After growth in low magnesium, a major rnRNA 0.7 kb in size was observed that represented oprH alone (Figure 10A). Additional transcripts were observed, 1.3 and 2.7 kb in size (FigurelOA), that were an appropriate length to represent oprH-phoP and oprH-phoP-phoQ respectively. The hybridization pattern of these transcripts to probes complementary to phoP and phoQ (Figure 10B and C) confirmed the presence of these genes on oprH transcripts. Both these larger transcripts were present at lower concentrations than the  38  Figure 9. Col ra n script ion of the oprH and phoP genes as shown by R T - P C R . Lane M . molecular weight marker; lane 1. whole cell R N A from HI03 (wild type P. aeruginosa) grown in low M g after RT-PCR with primers RT-forward and RT-reverse (Table 3); lane 2. R N A submitted to PCR without prior reverse transcription; lane 3. as lane 1 without R N A template; lane 4. control PCR with HI03 genomic D N A and RTforward and RT-reverse primers. The results shown are one of three independent experiments. 2 +  39  A.  C.  B.  12  12  12  oprH-phoP-phoQ oprH-phoP oprH  Figure 10. Northern blot analysis of oprH, phoP and phoQ transcription in wild type P. aeruginosa in response to magnesium. R N A isolated from HI03 (wild type P. aeruginosa) grown in high 1. and low 2. M g and probed with D N A complementary to A . oprH, B . phoP and C. phoQ. Transcript sizes corresponding to oprH (0.7 kb), oprH-phoP (1.3kb) and oprH-phoP-phoQ (2.7 kb) are shown on the left. 2 +  40  oprH transcript. After growth in high magnesium, transcripts containing either phoP or phoQ were completely absent (Figure 10B, and C, lane 1), but a low level of oprH transcription was observed in overexposed Northern blots (data not shown). Under either growth conditions no transcripts carrying phoP alone (0.7 kb), phoQ alone (1.3 kb) or phoP-phoQ (2.0 kb) were observed (Figure 10B and C). No transcription of oprH, phoP or phoQ was seen in Northern blot analysis of the phoP mutant (data not shown). The absence of an oprH transcript was consistent with the previously observed absence of OprH protein. In addition, the absence of phoQ containing transcripts was consistent with the hypothesis that phoP and phoQ were transcriptionally linked. In contrast to the phoP mutant, the levels of phoP and oprH transcripts in the phoQ mutant were approximately the same in both high and low magnesium (Figure 11, lane 1 is slightly under-loaded). Transcripts corresponding to oprH alone, oprH-phoP and oprH-phoP-phoQ::xylE fusion were observed (Figure 11, A and B). The levels of oprH and phoP transcription in both high and low magnesium appeared to be greater in H854 than those seen in wildtype P. aeruginosa under low magnesium growth conditions (Figure 10A, lane 2 compared with Figure 11 A , lanes 1 and 2). To quantitatively compare the amount of oprH, phoP and phoQ transcription in the mutants and the wildtype, R N A dot blots were performed. A n oprH mutant, with the xylE-Gm  K  cassette inserted into the Pstl site (Figure 3) of the oprH gene (Macfarlane and  Hancock, unpublished data) was also assessed for phoP and phoQ transcription. The probes used in the R N A dot blot experiments were identical to those used in the Northern blots. A l l signals were standardized by comparison to blots probed with rpoB, the gene  41  A.  B.  1  2  1  2  oprH-phoP-phoQ::xylE oprH-phoP oprH  Figure 11. Northern blot analysis of oprH,phoP and phoQ transcription in phoQ mutant in response to magnesium. R N A isolated from H854 (phoQ mutant) grown in high 1. and low 2. M g and probed with D N A complementary to A . oprH and B. phoP. Lane 1 in both panels is slightly underloaded.Transcript sizes corresponding to oprH (0.7 kb), oprH-phoP (1.3kb) and oprH-phoP-phoQ::xylE (2.7 kb) are shown on the left. 2 +  42  encoding the beta subunit of R N A polymerase, which was assumed to be constitutively expressed. The level of each gene transcript relative to that in wildtype P. aeruginosa in high magnesium is given in Table 4. Quantitative analysis of oprH, phoP and phoQ transcription confirmed many of the observations made by Northern blot analysis. Transcription of these genes was not observed in the phoP mutant and the phoQ mutant showed constitutive and high levels of phoP and oprH transcripts. The levels of phoP transcripts were about 1.7-fold higher and transcription of oprH was 1.5-fold higher in the phoQ mutant compared to the wildtype grown in low magnesium (Table 4). The levels of induction of phoQ transcription in wildtype under conditions of low magnesium were higher than that seen for the phoP gene (13.6 ± 0.4 compared with 9.4 ± 1.0), whereas the levels ofphoP and phoQ transcripts appeared equal in Northern blots (Figure 10A). This might have been due to experimental error or differing concentrations or affinities of labeled phoP and phoQ probes. The latter was evident in the comparison of Northern blots probed with phoP and phoQ (Figure 10B and C). The oprH mutant appeared to be negative for phoP and phoQ transcription in both high and low magnesium (Table 4). The probe used to assess oprH transcription hybridized to the region upstream of the xylE-Gm cassette insertion in the oprH mutant, hence a transcript could be observed R  in R N A dot blots (Table 4). Transcription of oprH in this mutant was still regulated by magnesium to approximately the same extent as in wildtype P. aeruginosa, despite our inability to detect any phoP or phoQ transcripts by R N A dot blot (Table 4) and Northern blot analysis (data not shown).  43  Table 4. Relative levels of oprH, phoP and phoQ transcription in wildtype P. aeruginosa and the oprH, phoP and phoQ mutants as determined by quantitative R N A dot blots  Gene  Strain  High M g '  oprH  wildtype (HI03) oprH mutant (H855) phoP mutant (H851) phoQ mutant (H854) wildtype (H103) oprH mutant (H855) phoP mutant (H851) phoQ mutant (H854) wildtype (HI03) oprH mutant (H855) /?AoP mutant (H851) /?/zo£> mutant (H854)  1.00 1.59±0.32 0.66 ± 0.25 80.1 ± 19.4 1.00 0.45 + 0.02 0.70 ± 0.03 16.2 + 3.7 1.00 0.37 ±0.17 0.15 ±0.01 0.38 ±0.01  phoP  phoQ  +  a  Low M g  z+  52.1 ± 6 . 0 46.0 ± 12.2 1.16 ±0.44 76.3 ± 10.4 9.4 ± 1.0 0.63 ± 0.04 1.00 ±0.11 15.6 ± 4 . 8 13.6 ± 0 . 4 0.46 ±0.05 0.23 ± 0.02 0.47 ± 0.07  a  oprH transcription in the oprH mutant represents transcription of the region upstream of the xylE-Qm cassette.  a  44  3.4.3  Reporter Gene Transcription in the oprH, phoP and phoQ Mutants  In order to further determine the effect of PhoP and PhoQ on oprH,phoP and phoQ transcription, assays were performed to quantitate the amount of catechol-2,3dioxygenase expressed from the xylE chromosomal fusions in each mutant in the presence of plasmid encoded PhoP and PhoQ. Catechol-2,3-dioxygenase activity was determined in log-phase cells grown in high and low magnesium media. No activity was observed in wildtype P. aeruginosa (data not shown). Low level enzyme activity was observed in strain H851 (phoPy.xylE-Gm^) without a vector control (Table 5). This activity was only slightly higher (1.39-fold) in low magnesium. Whereas a plasmid carrying PhoQ alone (pEMQla) had no effect on catechol-2,3-dioxygenase activity, the PhoP plasmid (pEMR3) caused a strong increase in activity in both high and low magnesium (a 350-fold increase over mutant alone). Similar to the effect of plasmid pEMPQ2a (phoP and phoQ in reverse orientation to the lac promoter) on the production of OprH, this plasmid imposed regulation of catechol2,3-dioxygenase expression by magnesium. The level of catechol-2,3-dioxygenase activity with plasmid pEMPQ2a, after growth in low magnesium, was much lower than seen with plasmid pEMR2. The control plasmid pUCP19, and plasmids carrying phoP in the reverse orientation, phoQ on either orientation or phoP and phoQ in the same orientation relative to the lac promoter had no effect on catechol-2,3-dioxygenase activity (Table 5 or data not shown). In contrast to the phoP mutant, strain H854 (phoQ\:xylE-GrrP) showed a greater level of catechol-2,3-dioxygenase activity without PhoP and PhoQ encoding plasmids (Table 6). The observed difference in activity between high and low magnesium was less  45  Table 5. Catechol-2,3-dioxygenase activity in strain H851 (phoP:: xylE-Gm ) harbouring PhoP and PhoQ encoding plasmids R  Catechol-2,3-dioxygenase Activity / pmol min" pg" protein Low M g ^ High M g Fold Difference 1  1  i T  Plasmid  3  none pEMR3 (phoP ) p E M Q l a (photf) p E M P Q l b (phoPtf) pEMPQ2a (phoPQ ) ¥  K  Mean activity" ± S.E.M (relative amount) 60.3 15.0(1.00) 17,42714,554 (289) 61.914.9(1.03) 66.1 19.2(1.10) 3,428 1 194 (56.8) c  Mean activity 1 S.E.M (relative amount) 43.5 13.6(1.00) 15,545 14,675 (357) 43.813.7 (1.00) 43.619.2(1.00) 5517 (1.26) 0  c  Low/High 1.4 1.1 1.4 1.5 62.3  Genes cloned behind (F) or in reverse orientation (R) to the lac promoter Values are the mean of three independent experiments The values for H851/pEMPQ2a, with an independent evaluation of H851 without plasmid as a positive control, were performed at a later date than all other values. Catechol dioxygenase activities for H851 in these trials were lower than those shown in the above table, therefore, the values shown for H851/pEMPQ2a were scaled up by an appropriate factor to allow direct comparison Low/High gives the increase in expression in low magnesium compared to high a  b  c  d  46  d  Table 6. Catechol-2,3-dioxygenase activity in strain H854 (phoQ::xylE-Gm ) harbouring PhoP and PhoQ encoding plasmids R  Catechol-2,3-dioxygenase Activity / pmol min" pg" protein Low M g High M g Fold Difference 1  i T  Plasmid  3  none pEMR3 (phoP ) p E M Q l a ipho(f) p E M P Q l b (phoPQ ) pEMPQ2a (phoPQ ) F  F  K  a  b  c  1  i T  Mean activity" ± S.E.M (relative amount) 2,039 ± 2 0 6 (1.00) 1,771 ± 166 (0.87) 327 ± 5 1 (0.16) 10.1 ± 1.4 (0.005) 207 ± 3 3 (0.10)  Mean activity" ± S.E.M (relative amount) 1,165 + 10 (1.00) 1,178 ± 1 2 8 (1.01) 24.0 ± 2.8 (0.02) 5.2 ± 0 . 5 (0.004) 4.9 ± 0.2 (0.004)  Genes cloned behind (F) or in reverse orientation (R) to the lac promoter Values are the mean of three independent experiments Low/High gives the increase in expression in low magnesium compared to high  47  Low/High 1.8 1.5 13.6 1.9 42.3  0  than two-fold. Plasmids carrying phoQ in the same orientation, or phoP and phoQ in reverse orientation to the lac promoter decreased the level of catechol-2,3-dioxygenase expression from the fusion by as much as 250-fold. Complementation of the mutant with the PhoQ encoding plasmid OpEMQla) imposed regulation by magnesium to give a 13.6fold difference in catechol-2,3-dioxygenase activity between high and low magnesium growth conditions, whereas the plasmid encoding both PhoP and PhoQ (pEMPQ2a) resulted in an even greater difference (42.3-fold). Although the plasmid p E M P Q l b (phoP and phoQ in the forward orientation) decreased expression from the xylE gene, the difference in catechol-2,3-dioxygenase activity between high and low magnesium was less than two-fold. To confirm results obtained in R N A dot blots, which suggested that transcription of oprH was still regulated in strain H855 (oprH::xylE-Gm ), catechol-2,3-dioxygenase R  activity from this chromosomal fusion was assessed. Enzyme activities were 155.6 ± 33.2/pmol min" pg" protein in high magnesium and 3,001.5 ± 64.8/pmol min" pg" 1  1  1  1  protein in low magnesium. This 19.3-fold difference was consistent with the difference in oprH transcription observed in R N A dot blots, though it was not as high (compare with a 52.1 ± 6.0-fold increase in low magnesium).  3.5  Analysis of the oprH-phoP-phoQ Promoter  3.5.1  Sequences Necessary for Regulated Expression of O p r H  Since magnesium regulated expression of OprH was assumed to be PhoP-PhoQ dependent, the ideal background for expression of oprH promoter deletion constructs  48  would be PhoP-PhoQ positive but negative for OprH expression. M y transcriptional studies indicated that the P. aeruginosa oprH mutant was PhoP-PhoQ negative and was unsuitable for this purpose. Therefore expression of deletion constructs was attempted in E. coli as this organism is known to contains PhoP and PhoQ and hexanucleotide repeats have been found upstream of the autoregulated phoP-phoQ genes in this organism (Groisman et al., 1992). Location of the oprH promoter was achieved through transforming E. coli with a set of ExoIII digested and re-circularized portions of plasmid pGB22 and assessing OprH expression. The smallest plasmid still allowing OprH expression contained 211 bp of sequence upstream of the A T G codon (data not shown). To further investigate the sequences necessary for OprH expression and regulation by magnesium, an additional deletion was made in this 211 bp region that eliminated one of the hexanucleotide repeats and left only 90 bp of upstream sequence (pAKP9.5, Table 2, Figure 12A). After ExoIII digestion, the region containing the oprH gene and upstream sequences from each deletion was subcloned into pUCP19 to remove the phoP gene that was present in the original plasmid pGB22 (Table 2). Analysis of OprH expression from E. coli containing the deletion constructs indicated that even with only 90 bp of sequence upstream of the A T G codon, magnesium regulated expression of OprH was observed (Figure 12B).  49  A. 1  GCAGATCACGAGAAACAGGAAGAGCCTGGCTTCCATGCCCTTGACGCGTCCCTGGTCGGG CGTCTAGTGCTCTTTGTCCTTCTCGGACCGAAGGTACGGGAACTGCGCAGGGACCAGCCC  pAKP8  A  61  TTGTTCGTTCATTGGCCCAGCCTCTATGCAGGCGACTGTAGAAAGCCTAGACCCTACTTG AACAAGCAAGTAACCGGGTCGGAGATACGTCCGCTGACATCTTTCGGATCTGGGATGAAC A  121  181  pAKP9  TAGTACGGGCAAAAACCTCGCCGAGCCGGCGCGCGGCAGCCTGGAAACAGAGCGTTCGCC ATCATGCCCGTTTTTGGAGCGGCTCGGCCGCGCGCCGTCGGACCTTTGTCTCGCAAGCGG  GGCAAACGCGAGTCGTTCAGCCCGGGTTCAGCAAGCGTTCAGGGGCGGTTCAGTACCCTG CCGTTTGCGCTCAGCAAGTCGGGCCCAAGTCGTTCGCAAGTCCCCGCCAAGTCATGGGAC  pAKP9.5  A  241  T C C G T A C T C T G C A A G C CGT GA A C GA C A C G A C T C T C G C A GAAClGG A G K A A C A C C A T G A A A G AGGCATGAGACGTTCGGCACTTGCTGTGCTGAGAGCGTCTTGJcCTcbTTGTGGTACTTTC SD |_M K  301  CACTCAAGACTCTCTTCATCGCCACCGCCCTGCTGGGTTCCGCCGCCGGCGTCCAGGCCG GTGAGTTCTGAGAGAAGTAGCGGTGGCGGGACGACCCAAGGCGGCGGCCGCAGGTCCGGC A L K T L F I A T A L L G S A A G V Q A  361  CCGACAACTTCGTCGGCCTGACCTGGGGCGAGACCAGCAACAACATCCAGAAATCCAAGT GGCTGTTGAAGCAGCCGGACTGGACCCCGCTCTGGTCGTTGTTGTAGGTCTTTAGGTTCA A D N F V G L T W G E T S N N I Q K S K  4 21  CGCTGAACCGCAACCTGAACAGCCCGAACCTCGACAAGGTGATCGACAACACCGGCACCT GCGACTTGGCGTTGGACTTGTCGGGCTTGGAGCTGTTCCACTAGCTGTTGTGGCCGTGGA S L N R N L N S P N L D K V I D N T G T  ^pAKP12  B  -  M  1  2  3  4  5  6  7  8  9  10  81.0 47.7  t '  34.6 2 8  3  •  •  '—  —  «—-OprH  19.2 m  Figure 12. Expression of OprH from promoter deletions constructs in E. coli in response to magnesium levels. A. The start of each deletion construct is indicated by an arrowhead below the sequence. The Shine-Dalgarno sequence is boxed. Hexanucleotide repeats are in bold. The start of the oprH transcript (as determined by primer extension, Figure 12) and the putative -10 sequence are in boldface and underlined. B. Western immunoblot of OprH expression in E. coli DH5a harbouring oprH promoter deletion constructs and grown in high or low M g . Lane M . molecular weight marker; lane 1. E. colli pAKP8 in high M g ; lane 2. E. colilpAKPS in low M g ; lane 3. E coft/pAKP9 in high M g ; lane 4. E. colli pAKP9 in low M g ; lane 5. E. colil pAKP9.5 in high M g ; lane 6. E. colil pAKP9.5 in low M g ; lane 7. E. colil pAKP12 in high M g ; lane 8. E. colil pAKFT2 in low M g ; lane 9. HI03 (wild type P. aeruginosa) control in high M g ; lane 10. HI03 in low M g . 2 +  2+  2 +  2 +  2 +  2 +  2 +  2 +  2 +  2 +  50  2 +  3.5.2  Determination of the Transcription Start Site for the oprH-phoP-phoQ  Operon  Given the fact that there was no discemable o~ promoter sequence upstream of 70  oprH, an attempt was made to determine the transcription start site for this gene by primer extension analysis. A primer complementary to basepairs 96-115 of opri/(OprHrev2, Table 3) was used to generate cDNA from R N A transcripts containing oprH. One primer extension product, which appeared strongly in low magnesium and to a lesser extent in high magnesium, was assumed to be the magnesium inducible oprH transcript (Figure 13). Analysis of this product on a denaturing acrylamide gel placed the start site at a guanine residue 36 bp upstream of the A T G codon. A weak -10 consensus sequence (TActcT) was identified 7 bp upstream of this transcriptional start, but no sequence similar to a -35 sequence was observed. Although previous experiments suggested the oprH-phoP-phoQ operon was transcribed from a single promoter located upstream of oprH, an attempt was made to identify any phoP-phoQ transcripts by primer extension. Two primers that bound within phoP gave a variety of extension products, but no consistent start site. A number of large extension products were observed from R N A isolated under both high and low magnesium growth conditions (data not shown).  51  1 2 G A T C  T A  C G GC GC  ca— AT C G TA TA  14.  GGCA7AACGCGAGTCGTTCAGCCCGGGTTCAGC7AAGCGTTC tataat AGGGGCGGTTCAGTACCCTGTCCGTACTCTGCAAGCCGTG  oprH :ATGAAAG  M  K  Figure 13. Determination of the start of oprH transcription by primer extension. A. Primer extension products using primer OprH-rev2 (Table 3)and R N A isolated from wild type P.aeruginosa grown in either lane 1. high M g or lane 2. low M g and. Lanes G A T C represent sequencing reactions performed with OprH-rev2 and plasmid pGB22 (Table 2). The start of the transcript is indicated by an arrow to the right of the figure. B. Sequence upstream of oprH is shown with the transcription start site in bold and underlined. A putative -10 sequence is also shown in bold with the consensus sequence above. Hexanuceotide repeats upstream of the -10 region are highlighted. 2 +  52  2 +  4  Discussion In S. typhimurium, the PhoP-PhoQ two-component regulatory system regulates  expression of over forty genes in response to extracellular magnesium ion levels (Garcia Vescovi et a l , 1996). The P. aeruginosa outer membrane protein, OprH, is preferentially expressed in low magnesium conditions (Nicas and Hancock, 1980). This prompted investigation of whether PhoP and PhoQ homologues exist in P. aeruginosa that regulate expression of OprH. Not only were candidate phoP and phoQ open reading frames (ORFs) identified, but these putative genes were located 79 nucleotides downstream of the oprH gene. Furthermore, the phoQ gene overlaps the upstream phoP gene by four nucleotides suggesting the genes encoding these proteins are transcriptionally linked. It was postulated that these three genes in P. aeruginosa are cotranscribed from a magnesium regulated promoter upstream of oprH. In support of this hypothesis, RT-PCR revealed that oprH and phoP were found in the same transcriptional unit (Figure 9). Northern blot analysis confirmed that indeed both these genes and phoQ were cotranscribed from a promoter upstream of oprH (Figure 10). Thus, oprH,phoP and phoQ form a small operon. Although cotranscription ofphoP and phoQ is seen in S. typhimurium and E. coli, in these organisms no transcriptionally linked upstream genes have been found (Soncini et al., 1995; Kasahara et al., 1992). In contrast genes encoding a PhoP-regulated two-component regulatory system in S. typhimurium, PmrA-PmrB, are cotranscribed with an upstream gene (pmrC) which encodes a putative membrane protein (Gunn and Miller, 1996). Both the pmrC-pmrApmrB and phoP-phoQ operons in this organism have two promoters; one regulated promoter that drives transcription of the entire operon and a second constitutive promoter  53  for transcription of pmrA-pmrB alone or phoP-phoQ at low levels (Gunn and Miller, 1996; Soncini and Groisman, 1996; Soncini et al., 1995). A magnesium regulated promoter was identified upstream of oprH in P. aeruginosa by primer extension analysis, but no second promoter in this region or in the oprH-phoP intergenic region could be found (Figure 13). Although no phoP-phoQ transcripts were observed by Northern blot analysis (Figure 10), there was some suggestion that low level phoP-phoQ transcription occured independently of oprH transcription. A n oprH insertional mutant, in which no phoPphoQ transcripts were detected in Northern or R N A dot blots, still exhibited magnesium regulated oprH transcription (Table 4). While this could occur as a result of a second magnesium responsive regulatory mechanism acting on the oprH promoter, it seems unlikely as no regulated OprH expression was observed in either the phoP or phoQ mutant. In addition, a plasmid carrying phoP and phoQ in the opposite orientation to the lac promoter was able to complement phoP and phoQ mutants for oprH and phoP transcription and regulation (Figure 7 and 8, Table 5 and 6). Ninety-three bases of sequence upstream of phoP are carried on this plasmid (Figure 4) and may include a promoter driving low level expression of phoP-phoQ. The phoP and phoQ genes are probably expressed at very low level from a second promoter to ensure sufficient protein is present to allow the system to respond to the inducing signal. No other genes except oprH, phoP and phoQ were found to be transcribed from the oprH promoter. Upstream ORFs are in the opposite orientation to oprH (Figure 5), and thus are probably divergently transcribed. Downstream of phoQ there is only a large ORF (Figure 5), and no transcripts of the appropriate size to include this gene were  54  observed in Northern blots (Figure 10). No strong stem loop structures were identified downstream of the phoQ gene, but rho-dependant termination may occur. Possible stem loops structures were located in the oprH-phoP intergenic region (6 base stem, 9 base loop, A G -8.0 kcal/mol) as well as 66 nucleotides into the phoQ gene (6 base stem, 10 base loop, A G -6.0 kcal/mol) and could function as rho-independent terminators for the oprH and oprH-phoP transcripts observed in Northern blots. Northern blot analysis revealed that phoP and phoQ transcription was induced in low magnesium (Figure 10). Although a low level of the 0.7 kb oprH transcript was observed in high magnesium on over-exposed Northern blots (data not shown), no detectable phoP or phoQ transcription occurred under these conditions. The second most abundant transcript in low magnesium conditions was one that contained oprH and phoP, followed by the oprH-phoP-phoQ transcript. This differential expression of transcriptionally linked genes could occur through weak termination, read-through from oprH and phoP or R N A processing of the large 2.7 kb (oprH-phoP-phoQ) transcript. Activation of transcription in response to low magnesium ion levels most likely occurs through transduction of the signal from PhoQ to PhoP, followed by PhoP binding and enhancing transcription from promoters of PhoP-activated genes. In S. typhimurium and E. coli no consensus PhoP-binding sequence has been identified, though a set of direct hexanucleotide repeats (GTTTAT) spaced four nucleotides apart are present in the phoP promoter region 11 bases upstream of the proposed -10 sequence (Groisman et al., 1989 and 1992). Similar repeats (GTTCAG) located the same distance from the Pribnow box in the oprH promoter may serve as PhoP binding sites (Figure 4). Despite the sequence difference between the repeats, PhoP from E. coli may be able to bind to the  55  oprH promoter. This is supported by the magnesium regulated expression of OprH in E. coli harbouring the promoter deletion constructs (Figure 12). It is noteworthy that only three of the four repeats were sufficient for this regulatory effect. This may be due to the fact that only two repeats are found in the E. coli promoter (Groisman et al, 1992) and thus its PhoP protein may bind through a slightly different mechanism. Although similar repeats found on the non-coding strand within oprH are imperfect, they may play a role in regulation of OprH, PhoP and PhoQ expression. For example, in high magnesium they could serve as PhoP binding sites to repress OprH expression, as is seen in the repression of the Bacillus subtilis spoOA, abrB and kinA promoters by SpoOA binding within these genes (Hoch, 1995). They may also function in feedback inhibition when phosphorylated PhoP levels get too high. Equally possible is a positive regulatory role for these sequences, as is seen in the requirement for internal regulator binding sites for PhoP of B. subtilis in transcription of phoA andpstS (Liu et ai, 1998). A search was performed to determine i f similar repeats were located upstream of P. aeruginosa genes homologous to those regulated by PhoP in S. typhimurium. No such sequences were found upstream of putative pmrA/pmrB or mgtB genes (mgtB encodes a putative magnesium ion transporter protein). Five equally spaced, identical repeats and one imperfect repeat were identified in the genome, but they occurred upstream of an ORE that showed no sequence similarity to proteins in the non-redundant N C B I database. Downstream of this ORF is a second ORF with homology to a B. subtilis protein similar to 3-oxoacyl-acyl-carrier protein reductase (Morbidoni et al., 1996). The P. aeruginosa PhoP protein sequence shows 53 and 54% identity at the amino acid level to S. typhimurium and E. coli PhoP proteins respectively (Figure 2).  56  Most importantly, the residues postulated to constitute the acidic pocket for phosphotransfer from PhoQ (Asp-8, Asp-51 and Lys-101; Stock et al, 1989) are conserved. Presumably, as the response regulator, PhoP is a D N A binding protein. No helix-tum-helix D N A binding motif was identified in PhoP, but this is not uncommon. OmpR of E. coli has no recognizable D N A binding motif but it has clearly been shown to bind the promoter regions of ompF and ompC (Pratt and Silhavy, 1995). P. aeruginosa PhoP is an activator of oprH, phoP and thus phoQ transcription. Disruption of the phoP gene completely abolished OprH expression and transcription (Figure 7 and Table 4) indicating that PhoP is necessary for any transcription from the oprH promoter. Deletion of the phoP gene also disrupts its own and phoQ transcription as seen in the analysis of the phoPr.xylE fusion (Table 5) and mRNA analysis (Table 4). Thus, the PhoP-PhoQ system autoregulates its expression from the oprH promoter. Autoregulation has been seen in other two-component regulatory systems (Gunn and Miller, 1996; Seki et al, 1987 and 1988). A low level of phoPr.xylE transcription was observed in the absence of PhoP (Table 5). This may reflect phoP transcription independent of PhoP or it could simply be a result of xylE incorporation anywhere into the P. aeruginosa genome. The sensor-kinase of this two-component regulatory system also shows sequence conservation at the amino acid level with the corresponding proteins from S. typhimurium and E. coli (Figure 3, 33% identity). Although the N-terminal sequence does not show high identity, the region after the second transmembrane segment shows greater similarity. More importantly, both the histidine at position 249 and the region possibly involved in A T P binding (amino acids 381 to 448) are conserved. The protein contains  57  two putative transmembrane domains and its location is assumed to be in the cytoplasmic membrane. It is notable that the sequence between the two membrane spanning regions, the periplasmic sensing domain, shows little similarity to the PhoQ proteins of S. typhimurium and E. coli. In addition, an amino acid difference at position 40 in the P. aeruginosa protein (isoleucine instead of threonine) is the same as that seen in a S. typhimurium mutant (pho-24, Thr48—» He) that constitutively expresses PhoP-activated genes (Gunn et al., 1996). As the periplasmic region, and specifically Thr48, has been shown to be involved in sensing (Garcia Vescovi et al., 1997), it will be interesting to determine what differences in PhoQ function occur in P. aeruginosa. The role of PhoQ is to modulate expression of PhoP-regulated genes in response to magnesium. This was evident from the constitutive, unregulated oprH and phoP transcription in the phoQ mutant (Figure 7 and 10, Table 4 and 6). Moreover, PhoQ downregulates PhoP mediated transcription, such that its deletion resulted in higher expression of OprH and phoP transcription than was observed in wildtype P. aeruginosa. In early studies of PhoP-PhoQ in S. typhimurium, higher level transcription of phoP was observed in a phoQ mutant though no negative regulatory effect for this protein has been proposed (Groisman et al., 1989; Soncini et al., 1995). In P. aeruginosa, expression of plasmid encoded PhoQ decreased xylE reporter gene transcription and OprH expression (Table 6 and Figure 8). It is accepted that most sensor kinases in two-component regulatory systems often possess phosphatase activity towards their cognate response regulators, especially when the phosphorylated response regulator is long lived (Stock et al., 1995). PhoQ may act as a phosphatase towards phosphorylated PhoP and its absence, therefore, would allow a high level of activated PhoP to accumulate. Given that it is the  58  phosphorylated form of the regulator that is commonly believed to be the D N A binding species, this increase in phospho-PhoP would result in a high level of activation of the oprH promoter. The question of how PhoP could be phosphorylated in the absence of PhoQ remains. The large number of possible two-component regulatory systems identified through homology searches of the P. aeruginosa genome allow for the possibility that a second kinase could phosphorylate PhoP through crosstalk between systems. Crosstalk has been demonstrated in vitro in E. coli between the OmpR-EnvZ, CheY-CheA and NRI-NRII systems (Igo et al, 1989) and has been proposed to occur between PmrB of the PmrA-PmrB system and PhoP in S. typhimurium (Soncini and Groisman, 1996). Homologues of PmrA and PmrB have been identified in the P. aeruginosa genome by sequence homology searches and could be involved in crosstalk with PhoP-PhoQ. In addition, PhoP could be phosphorylated by a small molecule phosphodonor such as acetyl phosphate, as is the case for CheY in E. coli (Stock et al., 1995). Finally, it may be possible that the unphosphorylated form of the response regulator activates transcription if it is present in high enough concentration. Given that PhoP is overexpressed in the phoQ mutant, high enough levels of this protein could be achieved to see activation by the unphosphorylated response regulator. Any one of these possibilities could explain the activation of reporter gene transcription in strain H851 (phoP::xylE-Gm ) when PhoP R  was added back on a multicopy plasmid (pEMR3) without concomitant PhoQ expression (Table 5). Of particular significance in the complementation of the phoP and phoQ mutants with plasmid borne genes, was the ability of a multicopy plasmid carrying phoP and  59  phoQ in reverse orientation to the lac promoter (pEMPQ2a) to restore back to wildtype oprH and phoP transcription. A similar plasmid carrying these genes behind the lac promoter (pEMPQlb) could not complement. It is possible that the levels of PhoP and PhoQ produced from the latter plasmid were so high that they could not function like they do in wildtype P. aeruginosa. In this case it is also possible that PhoQ did not insert into the cytoplasmic membrane. On plasmid pEMPQ2a there are 93 bp of sequence upstream of phoP that encompass the entire intergenic region and 14 nucleotides of oprH. It is possible that in this region a promoter exists that drives expression of PhoP and PhoQ at low levels which, in multicopy, may be similar to the levels observed in wildtype P. aeruginosa. In addition, antisense regulation could occur through transcription of the opposite strand driven from the lac promoter. Whether antisense regulation plays a role in normal PhoP-PhoQ regulation, however, remains to be determined. PhoP-PhoQ in S. typhimurium is indirectly involved in resistance to polymyxin B and other cationic antimicrobials through interaction with PmrA-PmrB (Roland et al., 1993; Gunn and Miller, 1996). This second two-component system regulates expression of at least four genes involved in LPS modifications that may disrupt the ability of these positively charged antimicrobials to interact with the negatively charged membrane (Roland et al., 1994; Gunn et al., 1998; Guo et al., 1998). Through regulation of, and interaction with PmrA-PmrB, PhoP-PhoQ activates expression of resistance genes in conditions of low magnesium and calcium. In P. aeruginosa PhoP-PhoQ also seems to play a role in regulation of polymyxin B resistance, though its role is not as straightforward as it is in OprH regulation (Macfarlane et al., 1999). Wildtype P.  60  aeruginosa becomes resistant to polymyxin B under magnesium limiting conditions (Brown and Melling, 1969). Both the phoP and phoQ mutants remain resistant in low magnesium but the phoQ mutant also exhibits resistance in high magnesium (Macfarlane et al, 1999). It was demonstrated that whenever a PhoP PhoQ" phenotype occurred, +  resistance was seen in high magnesium as well as low, establishing the role of PhoP in the resistance phenotype. Moreover, when the phenotype was PhoP' PhoQ , susceptibility +  to polymyxin B occured in low magnesium, establishing a role for PhoQ in modulation of polymyxin B resistance. In this way PhoP may indirectly activate expression of genes necessary for resistance and PhoQ, in the absence of PhoP, may crosstalk to another system, such as PmrA-PmrB, to turn off expression of resistance genes. A role for OprH in resistance to polymyxin B and E D T A has previously been proposed (Nicas and Hancock, 1980; 1983; Bell et al, 1991). In low magnesium the positively charged protein takes the place of magnesium ions in stabilizing interactions with LPS molecules. Unlike these ions, this integral membrane protein could not be chelated by E D T A or displaced by cationic antimicrobials, and would contribute to resistance. Although complementation of an oprHv.tet mutant with plasmid encoded OprH established the role of this protein in E D T A resistance, resistance to polymyxin B could not be restored by this plasmid alone (Bell et al, 1991; Young et al, 1992). Through work presented in this thesis it is now clear that the oprH::xylE-Gm mutant is R  deficient in PhoP and PhoQ expression as well. It is logical, therefore, to envision OprH as playing only a secondary role in polymyxin B resistance, while other PhoP-PhoQ regulated genes contribute to the bulk of this phenotype. Nevertheless, the fact that oprH  61  is transcriptionally linked to and regulated by a system responsible at least in part for polymyxin B resistance, suggests it may be important for this phenotype. In conclusion, the work presented in this thesis has enabled identification and preliminary characterization of a PhoP-PhoQ two-component regulatory system in P. aeruginosa. Moreover, I have demonstrated that the genes encoding PhoP, PhoQ and the upstream OprH form an operon that is transcribed from a promoter upstream of oprH. The PhoP-PhoQ system regulates expression of both OprH and of itself in response to extracellular magnesium ion concentration. PhoP is necessary for transcription from the oprH promoter and PhoQ modulates the response to magnesium and down-regulates expression. Further study will enable us to better understand the role of PhoQ and the repeats in the oprH promoter region. This, in turn, may enable the identification of other genes regulated by PhoP-PhoQ in P. aeruginosa.  62  5  References  Altschul, S. F., T. L . Madden, A . A. Scaffer, J. Zhang, J. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped B L A S T and PSI-BLAST: a new generation of protein database search programs. Nuc. Acids. Res. 25: 3389-3402. Ausubel, F. M . , R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A . Smith, and K. Struhl. 1987 and updates. Current protocols in molecular biology. John Wiley andSons, Inc. Baker, S. J., C. Daniels, and R. Morona. 1997. PhoP/Q regulated genes in Salmonella typhi: identification of melittin sensitive mutants. Microb. Pathogenesis 22: 165-179. Bell, A., M . Bains, and R. E. W. Hancock. 1991. Pseudomonas aeruginosa outer membrane protein OprH: expression from the cloned gene and function in E D T A and gentamicim resistance. J. Bacteriol. 173: 6657-6664. Bell, A., and R. E. W. Hancock. 1989. Outer membrane protein H I of Pseudomonas aeruginosa: purification of the protein and cloning and nucleotide sequence of the gene. J. Bacteriol. 171: 3211-3217. Botzenhart, K., and H . Ruden. 1987. Hospital infections caused by Pseudomonas aeruginosa. In "Basic Research and Clinical Aspects of Pseudomonas aeruginosa", G. Doring, I. A . Holder, and K . Botzenhart (Eds.), Karger, Basal, Switzerland. 1-15. Brown, M . R. W., and J. Melling. 1969. Role of divalent cations in the action of polymyxin B and E D T A on Pseudomonas aeruginosa. J. Gen. Microbiol. 54: 263-274. Brown, M . R. W., H. Anwar, and P. A . Lambert. 1984. Evidence that mucoid Pseudomonas aeruginosa in the cystic fibrosis lung grows under iron-restricted conditions. F E M S Microbiol. Lett. 21: 113-117. Bryan, L. E. 1979. Resistance to antimicrobial agents: the general nature of the problem and the basis of resistance. In "Pseudomonas aeruginosa: Clinical Manifestations of Infection and Current Therapy", R. D. Doggett (Ed.), Academic Press, New York, N Y . 219-270. Clarke, P. H., and J. H . Slater. 1986. Evolution of enzyme structure and function in Pseudomonas. In "The Bacteria, Volume X . The Biology of Pseudomonas''', J. R. Sokatch (Ed.), Academic Press, Orlando, FL. 71-75. Dennis, J. J., and P. A . Sokol. 1995. Electrotransformantion of Pseudomonas. Methods Mol. Biol. 47: 125-133.  63  Deretic, V., and W. M . Konyecsni.1988. Broad-host-range plasmid and M13 bacteriophage-derived vectors for promoter analysis in Escherichia coli and Pseudomonas aeruginosa. Gene. 74: 375-386. Ddring, G., M . Maier, E. Miiller, Z. Bibi, B. Tummler, and A . Kharazmi.1987. Virulence factors of Pseudomonas aeruginosa. In "Basic Research and Clinical Aspects of Pseudomonas aeruginosa", G. Ddring, I. A. Holder, and K . Botzenhart (Eds.), Karger, Basal, Switzerland. 136-148. Fields, P. I., E. A . Groisman, and F. Heffron. 1989. A Salmonella locus that controls resistance to microbicidal proteins from phagocytic cells. Science 243: 1059-1062 Garcia Vescovi, E., Y . M . Ayala, E. D i Cera, and E. A . Groisman. 1997. Characterization of the bacterial sensor protein PhoQ. J. Biol. Chem. 272: 1440-1443. Garcia Vescovi, E., Y . M . , F. C. Soncini, and E. A. Groisman. 1996. M g as an extracellular signal: environmental regulation oi Salmonella virulence. Cell 84: 165-174. 2 +  Gilleland, H . E., J. D. Stinnett Jr., and R. G. Eagon. 1974. Ultrastructural and chemical alteration of the cell envelope of Pseudomonas aeruginosa associated with resistance to ethylenediaminetetraacetic acid resulting from growth in Mg -deficient medium. J. Bacteriol. 117: 302-311. 2+  Goldberg, J. B., and D. E. Ohman. 1984. Cloning and expression in Pseudomonas aeruginosa of a gene involved in the production of alginate. J. Bacteriol. 158:1115-1121. Groisman, E. A., J. Kayser, and F. C. Soncini. 1997. Regulation of polymyxin resistance and adaptation to low-Mg environments. J. Bacteriol. 179: 7040-7045. 2+  Groisman, E. A., F. Heffron, and F. Solomon. 1992. Molecular analysis of the Escherichia coliphoP locus. J. Bacteriol. 174: 486-491. Groisman, E. A., E. Chiao, C. J. Lipps, and F. Heffron. 1989. Salmonella typhimurium phoP virulence gene is a transcriptional regulator. Proc. Natl. Acad. Sci. U S A 86: 70777081. Gunn, J. S., K . B . Lim, J. Krueger, K . Kim, L. Guo, M . Hackett, and S. I. Miller. 1998. PmrA-PmrB-regulated genes necessary for 4-aminoarabinose lipid A modification and polymyxin resistance. Moi. Microbiol. 27: 1171-1182. Gunn, J. S., and S. L . Miller. 1996. PhoP-PhoQ activates transcription of pmrAB, encoding a two-component regulatory system involved in Salmonella typhimurium antimicrobial peptide resistance. J. Bacteriol. 178: 6857-6864.  64  Gunn, J. S., E. L . Hohmann, and S. L . Miller. 1996. Transcriptional regulation of Salmonella virulence: a PhoQ periplasmic domain mutation results in increased net phosphotransfer to PhoP. J. Bacteriol. 178: 6369-6373. Guo, L., K . B . Lim, C. M . Podule, M . Daniel, J. S. Gunn, M . Hackett, and S. I. Miller. 1998. Lipid A acylation and bacterial resistance against vertebrate antimicrobial peptides. Cell 95: 189-198. Guo, L., K . B . Lim, J. S. Gunn, B. Bainbridge, R. P. Darveau, M . Hackett, and S. I. Miller. 1997. Regulation of lipid A modification by Salmonella typhimurium virulence genes phoP-phoQ. Science 276: 250-253. Hancock,, R. E. W. 1997. The bacterial outer membrane as a drug barrier. Trends in Microbiol. 5: 37-42. Hancock, R. E. W., and D. P. Speert. 1996. Antibiotics for Pseudomonas and related infections. In "Cystic Fibrosis-Current Topics, Volume 3", J. A. Dodge, J. H. Brock, and J. H. Widdecombe (Eds.), John Wiley & Sons Ltd., New York, N Y . 245-266. Hancock, R. E. W., R. Siehnel, and N . Martin. 1990. Outer membrane proteins of Pseudomonas. Moi. Microbiol. 4: 1069-1075. Hancock, R. E. W., V . J. Raffle, and T. I. Nicas. 1981. Involvement of the outer membrane in gentamicin and streptomycin uptake and killing in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 19: 777-785. Hancock, R. E. W., and A. M . Carey. 1979. Outer membrane oi Pseudomonas aeruginosa: heat- and 2-mercaptoethanol-modifiable proteins. J. Bacteriol. 140: 902-910. Henihoff, S. 1984. Unidirectional digestion with exonuclease III creates targetd breakpoints for D N A sequencing. Gene. 28: 351-359. Hoch, J. A . 1995. Control of cellular development in sporulating bacteria by phosphorelay. In "Two-Component Signal Transduction", J. A. Hoch, and J. S. Thomas (Eds.), A S M Press, Washington, DC. 129-144. Hofmann, K., and W. Stoffel. 1993. T M B A S E - a database of membrane spanning protein segments. Biol. Chem. Hoppe-Seyler. 374: 166 Hoiby, N . , G. Doling, P. O. Schiotz. 1987. Pathogenic mechanisms of chronic Pseudomonas aeruginosa infection in Cystic Fibrosis patients. In "Basic Research and Clinical Aspects oi Pseudomonas aeruginosa", G. Ddring, I. A. Holder, and K . Botzenhart (Eds.), Karger, Basal, Switzerland. 60-76.  65  Igo, M . M . , A. J. Ninfa, J. B . Stock, and T. J. Silhavy. 1989. Phosphorylation and dephosphorylation of a bacterial transcriptional activator by a transmembrane receptor. Gen. Develop. 3: 1725-1734. Ingelbreht, I. L., C. I. Mandelbaum, and T. E. Mirkov. 1998. Highly sensitive Northern hybridization using a rapid protocol for downward alkaline blotting of R N A . BioTechniques 25: 420-498. Kasahara, A., A . Nakata, and H . Shinagawa. 1992. Molecular analysis of the Escherichia coli phoP-phoQ operon. J. Bacteriol. 174: 492-498. Kiers, L. D., R. M . Weppelman, and B. N . Ames. Regulation of nonspecific acid phosphatase in Salmonella: phoN and phoP genes. J. Bacteriol. 138: 155-161. Kom, L. J., and C. Queen. 1984. Analysis of biological sequences on small computers. D N A . 3: 421-436. Kropinski, A . M . , L. C. Chan, and F. H . Milazzo. 1979. The extraction and analysis of lipopolysaccharide from Pseudomonas aeruginosa strain PAO, and three rough mutants. Can. J. Microbiol. 25: 390-398. Liu, H . P., S. Takio, T. Satoh, and I. Yamamaoto. 1999. Involvement in denitrification of the napKEFDABC genes encoding the periplasmic nitrate reductase system in the denitrifying phototrophic bacterium Rhodobacter sphaeroides f. sp. denitrificans. Biosci. Biotechnol. Biochem. 63: 530-536. Liu, P. V . 1974. Extracellular toxins of Pseudomonas aeruginosa. J. Infect. Dis. 130 (suppl); S94-S99. Liu, W., Y . Qi, and F. M . Hulett. 1998. Sites internal to the coding regions oiphoA and pstS bind PhoP and are required for full promoter activity. Moi. Microbiol. 28: 119-130. Macfarlane, E. L. A., A . Kwasnicka, M . M . Ochs, and R. E. W. Hancock. 1999. PhoPPhoQ homologues in Pseudomonas aeruginosa regulate expression of the outermembrane protein OprH and polymyxin B resistance. Moi. Microbiol, in press. Miller, S. I., W. S. Pulkkinen, M . E. Selsted, and J. J. Mekalanos. 1990. Characterization of defensin resistance phenotypes associated with mutations in the phoP virulence regulon of Salmonella typhimurium. Infect. Immun. 58: 3706-3710. Miller, S. I., A . M . Kukral, and J. J. Mekalanos. 1989. A two-component regulatory system (phoPphoQ) controls Salmonella typhimurium virulence. Proc. Natl. Acad. Sci. U S A 86: 5054-5058.  66  Moore, R. A., W. A . Woodruff, and R. E. W. Hancock. 1987. Antibiotic uptake pathways across the outer membrane of Pseudomonas aeruginosa. In "Basic Research and Clinical Aspects of Pseudomonas aeruginosa", G. Ddring, I. A. Holder, and K . Botzenhart (Eds.), Karger, Basal, Switzerland. 172-181. Morbidoni, H . R., D. Demendoza, and J. E. Cronan. 1996. Bacillus subtilis acyl carrier protein is encoded in a cluster of lipid biosynthesis genes. J. Bacteriol. 178: 4794-4800. Nicas., T. L, and R. E. W. Hancock. 1983. Alteration of susceptability to EDTA, polymyxin B and gentamicin in Pseudomonas aeruginosa by divalent cation regulation of outer membrane protein H I . J. Gen. Microbiol. 129: 509-517. Nicas., T. I., and R. E. W. Hancock. 1980. Outer membrane protein H I of Pseudomonas aeruginosa: involvement in adaptive and mutational resistance to ethylenediaminetetraacetate, polymyxin B, and gentamicin. J. Bacteriol. 143: 872-878. Nicholas, T. I., and H . B . Hughes Jr. 1996. GeneDoc: a tool for editing and annotating multiple sequence alignments. Distributed by author. Nikaido, H., and R. E. W. Hancock. 1986. Outer membrane permiability of Pseudomonas aeruginosa. In "The Bacteria, Volume X . The Biology of Pseudomonas", J. R. Sokatch (Ed.), Academic Press, Orlando, FL. 154-193. Nikaido, H., and M . Vaara. 1985. Molecular basis of bacterial outer membrane permiability. Microbiol. Rev. 49: 1-32. Ochs, M . M . , M . P. McCusker, M . Bains, and R. E. W. Hancock. 1999. Negative regulation of the Pseudomonas aeruginosa outer membrane porin OprD selective for imipenem and basic amino acids. Antimicrob. Agents Chemother. 43: 1085-1090. Patt, L . A., and Silhavy, T. J. 1995. Porin regulon of Escherichia coli. In "TwoComponent Signal Transduction", J. A. Hoch, and J. S. Thomas (Eds.), A S M Press, Washington, DC. 105-127. Pegues, D. A., M . J. Hantman, I. Behlau, and S. I. Miller. 1995. PhoP/PhoQ transcriptional repression of Salmonella typhimurium invasion genes: evidence for a role in protein secretion. Mol. Microbiol. 17: 169-181. Rehm, B . H., and R. E. W. Hancock. 1996. Membrane topology of the outer membrane protein OprH from Pseudomonas aeruginosa: PCR-nediated site-directed insertion and deletion mutagenesis. J. Bacteriol. 178: 3346-3349. Roland, K . L., C. R. Esther, and J. K . Spintznagel. 1994. Isolation and charcterization of a gene, pmrD, from Salmonella typhimurium that confers resistance to polymyxin when expressed in multiple copies. J. Bacteiol. 176: 3589-3597.  67  Roland, K . L., L. E. Martin, C. R. Esther, and J. K . Spintznagel. 1993. pmrA mutants of. Salmonella typhimurium LT2 define a two-component regulatory system with a possible role in virulence. J. Bacteriol. 175: 4154-4164. Sambrook, J., E. F. Frisch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2 ed. Cold Spring Harbor Laboratory, Cold Spring Harbour, N Y . nd  Sandermann, H., Jr., and J. L. Strominger. 1972. Purification and properties of C55isoprenoid alcohol phosphokinase from Staphylococcus aureus. J. Biol. Chem. 247: 5123-5131. Schindler, M . , and M . J. Osborn. 1979. Interaction of divalent cations and polymixin B with lipopolysaccharide. Biochem. 18: 4425-4430. Schweizer, H. P. 1991. Escherichia-Pseudomonas shuttle vectors derived from pUC18/19. Gene 97: 109-112. Schweizer, H . P., and T. T. Hoang. 1995. A n improved system for gene replacement and xylE fusion analysis in Pseudomonas aeruginosa. Gene. 158: 15-21. Simon, R., U . Priefer, and A . Puhler. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram negative bacteria. Bio/Technology 1: 784-790. Seki. T., H . Yoshikawa, H . Tukahashi, H . Saito. 1988. Nucleotide sequence of the Bacillus subtilisphoR gene. J. Bacteriol. 170: 5935-5938. Seki. T., H. Yoshikawa, H . Tukahashi, H. Saito. 1987. Cloning and nucleotide sequence of phoP, the regulatory gene for alkaline phosphatase and phosphdiesterase in Bacillus subtilis. J. Bacteriol. 169: 2913-2916. Soncini, F. C , and E. A . Groisman. 1996. Two-component regulatory systems can interact to process multiple environmental signals. J. Bacteriol. 178: 6796-6801. Soncini, F. C , E. Garcia Vescovi, F. Solomon, and E. A. Groisman. 1996. Molecular basis of the magnesium deprivation response in Salmonella typhimurium: identification of PhoP-regulated genes. J. Bacteriol. 178: 5092-5099. Soncini, F. C , E. Garcia Vescovi, and E. A. Groisman. 1995. Transcriptional autoregulation of the Salmonella typhimurium phoPQ operon. J. Bacteriol. 177: 43644371. Stock, J. B., A. J. Ninfa, and A . M . Stock. 1989. Protein phosphorylation and regulation of adaptive responses in bacteria. Microbiol. Rev. 53: 450-490.  68  Stock, J. B., M . G. Surette, M . Levit, and P. Park. 1985. Two-component signal transduction systems: structure-function relationships and mechanisms of catalysis. In "Two-Component Signal Transduction", J. A . Hoch, and J. S. Thomas (Eds.), A S M Press, Washington, DC. 25-51. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. C L U S T A L W: improving the sensitivity of progressive multiple sequence alignments through sequence weighting, position-specific gap penalties and weight matrix choice. Nucl. Acids. Res. 22: 46734680. Young, M . L., M . Bains, A . Bell, and R. E. W. Hancock. 1992. Role of Pseudomonas aeruginosa outer membrane protein OprH in polymyxin and gentamicin resistance: isolation of an OprH-deficient mutant by gene replacement techniques. 1992. Antimicrob. Agents Chemother. 36: 2566-2568.  69  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0089162/manifest

Comment

Related Items