UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Analysis of the resistance-nodulation-division and HOP families of cell envelope proteins in helicobacter… Bina, James 1998

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Notice for Google Chrome users:
If you are having trouble viewing or searching the PDF with Google Chrome, please download it here instead.

Item Metadata


831-ubc_1998-345122.pdf [ 6.02MB ]
JSON: 831-1.0089116.json
JSON-LD: 831-1.0089116-ld.json
RDF/XML (Pretty): 831-1.0089116-rdf.xml
RDF/JSON: 831-1.0089116-rdf.json
Turtle: 831-1.0089116-turtle.txt
N-Triples: 831-1.0089116-rdf-ntriples.txt
Original Record: 831-1.0089116-source.json
Full Text

Full Text

Analysis of the Resistance-Nodulation-Division and Hop families of Cell Envelope Proteins in Helicobacter pylori B y J A M E S B I N A B . S c . U n i v e r s i t y o f W i s c o n s i n - M a d i s o n , 1 9 9 2 M . S c . U n i v e r s i t y o f W i s c o n s i n - M a d i s o n , 1 9 9 4 A T H E S I S S U B M I T T E D I N P A R T I A L F U L F I L L M E N T O F T H E R E Q U I R E M E N T S F O R T H E D E G R E E O F D O C T O R O F P H I L O S O P H Y i n T H E F A C U L T Y O F G R A D U A T E S T U D I E S ( D e p a r t m e n t o f M i c r o b i o l o g y a n d I m m u n o l o g y ) W e a c c e p t t h i s t h e s i s as c o n f o r m i n g T o t h e r e q u i r e d - . s t a n d a r d T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A A u g u s t 1 9 9 8 ©James B i n a , 1 9 9 8 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department The University of British Columbia Vancouver, Canada DE-6 (2/88) A B S T R A C T T h i s s t u d y w a s i n i t i a t e d to i d e n t i f y p o t e n t i a l g e n e s that p l a y a f u n c t i o n a l r o l e i n t h e in vivo a n t i b i o t i c r e s i s t a n c e o f Helicobacter pylori. T r a n s l a t i o n a l f u s i o n s o f H. pylori g e n e s to a l k a l i n e p h o s p h a t a s e w e r e m a d e to i d e n t i f y g e n e s w h o s e p r o d u c t s w e r e s e c r e t e d o r e x p o r t e d i n Escherichia coli. T h e i n i t i a l s c r e e n i d e n t i f i e d th ree p o t e n t i a l H. pylori e f f l u x g e n e s o f t h e b a c t e r i a l r e s i s t a n c e - n o d u l a t i o n - d i v i s i o n f a m i l y . O n e o f t h e e f f l u x s y s t e m s w a s f o u n d t o b e e x p r e s s e d o n l y in vivo a n d I w a s n o t a b l e to i d e n t i f y e f f l u x a c t i v i t y i n i n v i t r o - g r o w n H. pylori. T h e o v e r a l l r e s u l t s o f t h e s e e x p e r i m e n t s w e r e c o n s i s t e n t w i t h t h e s u g g e s t i o n that t h e s e e f f l u x s y s t e m s d o n o t f u n c t i o n i n t h e in vitro i n t r i n s i c r e s i s t a n c e o f H. pylori t o a n t i b i o t i c s . A s e c o n d l i n e o f i n v e s t i g a t i o n a n a l y z e d m e m b e r s o f t h e H. pylori H o p f a m i l y o f o u t e r m e m b r a n e / a d h e s i n p r o t e i n s . E x n e r et al. ( I n f e c t i o n & I m m u n i t y 6 3 : 1 5 6 7 - 1 5 7 2 , 1 9 9 5 ) p r e v i o u s l y d e s c r i b e d t h i s f a m i l y o f 5 p o r i n p r o t e i n s b a s e d o n e x t e n s i v e N - t e r m i n a l a m i n o a c i d s i m i l a r i t y . T h i s f a m i l y w a s f u r t h e r e x p a n d e d to i n c l u d e 3 2 p r o t e i n s c o n t a i n i n g e x t e n s i v e C -t e r m i n a l a m i n o a c i d s i m i l a r i t y b y T o m b et al. ( N a t u r e 3 8 8 : 5 3 9 - 5 4 7 , 1 9 9 7 ) . M y a n a l y s i s o f t h e H. pylori g e n o m e h a s f u r t h e r e x p a n d e d t h i s f a m i l y to 3 4 m e m b e r s . T h e D N A s e q u e n c e s e n c o d i n g t h e c o n s e r v e d s e q u e n c e m o t i f s that a re f o u n d w i t h i n the H o p f a m i l y h a d b e e n p r o p o s e d to f u n c t i o n i n h o m o l o g o u s r e c o m b i n a t i o n to g e n e r a t e a n t i g e n i c d i v e r s i t y o r i n r e s p o n s e to e n v i r o n m e n t a l c h a n g e s . H o w e v e r , m y c o m p a r i s o n o f the s e q u e n c e s o f t h e H o p f a m i l y g e n e s i n t w o H. pylori s t r a i n s s u g g e s t e d that the c o n s e r v e d s e q u e n c e s d i d n o t f u n c t i o n i n r e c o m b i n a t i o n . B a s e d o n m o l e c u l a r m o d e l i n g o f H o p E , I p r o p o s e d a n d t e s t e d , b y l i n k e r i n s e r t i o n m u t a g e n e s i s , the h y p o t h e s i s that the c o n s e r v e d s e q u e n c e m o t i f s a re p a r t o f a c o n s e r v e d s t r u c t u r a l m o t i f . T h e o v e r a l l r e s u l t s o f these e x p e r i m e n t s s u p p o r t e d the h y p o t h e s i s that t h e c o n s e r v e d s e q u e n c e s e n c o d e a c o n s e r v e d s t r u c t u r a l m o t i f f o r a f a m i l y o f P -barrel p r o t e i n s . i i TABLE OF CONTENTS ABSTRACT i i TABLE OF CONTENTS i i i LIST OF FIGURES . v LIST OF TABLES vj_ ACKNOWLEDGEMENTS v i i CHAPTER 1 - I n t r o d u c t i o n 1 Helicobacter pylori 1 F u n c t i o n a l a s p e c t s o f t h e Gram n e g a t i v e c e l l e n v e l o p e i n a n t i b i o t i c u p t a k e 6 B a c t e r i a l p o r i n p r o t e i n s 13 CHAPTER 2 - M a t e r i a l s and Methods 19 S t r a i n s , p l a s m i d s and growth c o n d i t i o n s 19 Reagents 22 G e n e t i c m a n i p u l a t i o n s 22 DNA s e q u e n c i n g 22 P r o t e i n a n a l y s i s 23 C o n s t r u c t i o n o f a Helicobacter p y l o r i - a l k a l i n e p h o s p h a t a s e f u s i o n l i b r a r y 23 I n h i b i t i o n o f endogenous a l k a l i n e p hosphatase a c t i v i t y i n Escherichia c o l i ER1793 24 The e f f e c t o f 50 mM NaP0 4 i n XP agar on t h e d e t e c t i o n s e n s i t i v i t y f o r a l k a l i n e p h o s p h a t a s e 24 DNA s e q u e n c i n g and a n a l y s i s o f H. p y l o r i - a l k a l i n e p h o s p h a t a s e f u s i o n c l o n e s 25 C l o n i n g o f t h e hefABC operon 25 DNA s e q u e n c i n g o f t h e hefABC operon 26 i i i Uptake o f 3 H - t e t r a c y c l i n e , ^ - c h l o r a m p h e n i c o l and 1-N-pheny I n a p t h y l amine 27 DNA and p r o t e i n sequence a n a l y s i s 28 C l o n i n g o f hefBC and hefC 28 Complementation o f E. c o l i acrAB mutants w i t h hefBC and hefC 29 C l o n i n g o f hopE 2 9 P r o t e i n e x p r e s s i o n 30 C o n s t r u c t i o n o f hopE i n s e r t i o n mutants 30 S t r u c t u r a l p r e d i c t i o n o f HopE 31 CHAPTER 3 - R e s u l t s 34 I . I d e n t i f i c a t i o n o f v i r u l e n c e f a c t o r s i n Helicobacter pylori--34 I I . C h a r a c t e r i z a t i o n o f t h e r e s i s t a n c e - n o d u l a t i o n - d i v i s i o n e f f l u x systems i n Helicobacter pylori 4 4 I I I . I d e n t i f i c a t i o n o f a c o n s e r v e d s t r u c t u r a l m o t i f i n t h e Hop o u t e r membrane p r o t e i n f a m i l y 67 CHAPTER 4 - D i s c u s s i o n 82 I d e n t i f i c a t i o n o f p o t e n t i a l v i r u l e n c e f a c t o r s i n Helicobacter pylori-81 R o l e o f e f f l u x i n t h e i n t r i n s i c a n t i b i o t i c r e s i s t a n c e o f Helicobacter pylori 84 I d e n t i f i c a t i o n o f a c o n s e r v e d s c a f f o l d i n g f o r a f a m i l y o f ( 3 - b a r r e l p r o t e i n s 90 CHAPTER 5 - Ap p e n d i x 97 BIBLIOGRAPHY 99 i v L I S T O F F I G U R E S Figure 1 Schematic representation of Gram negative cell envelope 8 Figure 2 Cross-section of the Escherichia coli PhoE porin 15 Figure 3 Schematic of plasmids PDJT1-3 25 Figure 4 Protocol for epitope insertion 33 Figure 5 D N A sequence of the Helicobacter pylori 11637 hefABC operon 46 Figure 6 Schematic representation of the Helicobacter pylori RND efflux operons 51 Figure 7 Phylogenetic tree of the Helicobacter pylori RND efflux pump proteins 54 Figure 8 Titration of Helicobacter pylori with polymyxin B 56 Figure 9 Mg 2 + inhibition of polymyxin B-stimulated 1-N-phenylnapthylamine 58 uptake in Helicobacter pylori Figure 10 M g 2 + inhibition of polymyxin B-stimulated 1-N-phenylnapthylamine 59 uptake in Helicobacter pylori Figure 11 Acid inhibition of polymyxin B-stimulated 1-N-phenylnapthylamine 60 uptake in Helicobacter pylori Figure 12 Uptake of 1-N-phenylnapthylamine by Escherichia coli and Helicobacter 61 pylori Figure 13 CCCP inhibition of polymyxin B-stimulated 1-N-phenylnapthylamine 63 uptake in Helicobacter pylori Figure 14 Uptake of ^-chloramphenicol by Helicobacter pylori 65 Figure 15 B L O C K S alignment of Helicobacter pylori family of outer membrane 68 proteins Figure 16 Amino acid sequence of identified B L O C K S in the Helicobacter pylori 69 Hop Figure 17 Structural prediction for Helicobacter pylori HopE 72 Figure 18 Map of PCR oligonucleotides used for the cloning and D N A sequencing of 76 Helicobacter pylori hopE Figure 19 Recombinant expression of Helicobacter pylori hopE in Escherichia coli 76 Figure 20 Map of epitope insertion sites in Helicobacter pylori hopE 79 Figure 21 Westem-immunoblot of Helicobacter pylori hopE insertion mutants 80 L I S T O F T A B L E S T a b l e I B a c t e r i a l s t r a i n s 2 0 T a b l e I I P l a s m i d s 2 1 T a b l e I I I O l i g o n u c l e o t i d e p r i m e r s 3 2 T a b l e I V Helicobacter pylori 1 1 6 3 7 'phoA f u s i o n c l o n e s w i t h 3 7 s i g n i f i c a n t s i m i l a r i t y to d a t a b a s e g e n e s T a b l e V M a p p i n g oi Helicobacter pylori 1 1 6 3 7 'phoA f u s i o n 4 0 c l o n e s to the g e n o m e o f Helicobacter pylori 2 6 6 9 5 T a b l e V I S e q u e n c e s i m i l a r i t y a n d i d e n t i t y a m o n g Helicobacter 5 3 pylori R N D o p e r o n p r o t e i n s v i A C K N O W L E D G E M E N T I t h a n k m y s u p e r v i s o r , B o b H a n c o c k , f o r h i s e n o r m o u s c o n t r i b u t i o n to m y d e v e l o p m e n t as a s c i e n t i s t a n d f o r h i s p a t i e n c e , g e n e r o s i t y a n d s u p p o r t t h r o u g h o u t the t i m e I s p e n t i n h i s l a b o r a t o r y . A s p e c i a l t h a n k s to S u s a n F a r m e r w h o s e a s s i s t a n c e h e l p e d to m a k e e v e r y t h i n g p o s s i b l e . I a l s o a c k n o w l e d g e the h e l p a n d s u p p o r t o f the o t h e r m e m b e r s o f t h e H a n c o c k l a b a n d m y s u p e r v i s i n g c o m m i t t e e , D r s . B e a t t y , S p i e g e l m a n a n d W a r r e n f o r t h e i r a d v i c e a n d h e l p i n a s s e m b l i n g t h i s t h e s i s . I w o u l d l i k e to t h a n k o u r c o l l a b o r a t o r s at A s t r a R e s e a r c h B o s t o n I n c . , D r s . A i m , D o i g a n d T r u s t , f o r t h e i r t e c h n i c a l a s s i s t a n c e a n d h e l p . L a s t l y , I t h a n k m y w i f e , R e n e e , f o r h e r s u p p o r t a n d h e l p d u r i n g the c o u r s e o f m y g r a d u a t e s t u d i e s . vii I N T R O D U C T I O N A. Helicobacter pylori 1. H i s t o r y T h e f i r s t r e p o r t o f s p i r a l s h a p e d b a c t e r i a a s s o c i a t e d w i t h the g a s t r i c e p i t h e l i u m w a s p u b l i s h e d i n the 1 8 9 0 s ( r e v i e w e d i n L e e & O ' R o u r k e , 1 9 9 3 ) . A l t h o u g h t h e r e w e r e s e v e r a l s u b s e q u e n t r e p o r t s o f s p i r a l o r g a n i s m s a s s o c i a t e d w i t h t h e h u m a n s t o m a c h , t h e s i g n i f i c a n c e o f t h e s e o b s e r v a t i o n s w e r e n o t r e a l i z e d u n t i l the 1 9 8 0 s . I n 1 9 8 2 B a r r y M a r s h a l l a n d R o b i n W a r r e n f i r s t p r o p o s e d that t h e r e w a s a c o r r e l a t i o n b e t w e e n t h e p r e s e n c e o f t h e s e c u r v e d b a c t e r i a a n d d u o d e n a l u l c e r s . S u b s e q u e n t l y , i n 1 9 8 3 , t h e y w e r e t h e f i r s t t o c u l t u r e t h e c u r v e d - s h a p e d b a c t e r i u m that e v e n t u a l l y c a m e to b e k n o w n as Helicobacter pylori ( M a r s h a l l & W a r r e n , 1 9 8 4 ) . T h e a s s e r t i o n b y W a r r e n a n d M a s h a l l that H. pylori w a s t h e c a u s a l a g e n t f o r g a s t r i c u l c e r s w a s n o t i n i t i a l l y a c c e p t e d ; d o g m a at that t i m e s ta ted that u l c e r s w e r e c a u s e d b y d i e t a n d s t ress . H o w e v e r , t h r o u g h a s e r i e s o f g r o u n d b r e a k i n g e x p e r i m e n t s w h i c h p r o v e d K o c h ' s p o s t u l a t e s f o r H. j ^ y / o r z ' - i n d u c e d g a s t r i t i s , i n c l u d i n g a d e m o n s t r a t i o n that c u r i n g o f H. pylori r e s u l t e d i n c u r i n g o f u l c e r s , H pylori h a s n o w b e c o m e w i d e l y a c c e p t e d as t h e c a u s a t i v e a g e n t f o r n u m e r o u s g a s t r i c p a t h o l o g i e s i n c l u d i n g g a s t r i t i s , g a s t r i c u l c e r s a n d g a s t r i c c a n c e r s . 2. M i c r o b i o l o g y H. pylori i s a s l o w - g r o w i n g , c u r v e d G r a m n e g a t i v e r o d , w h i c h i s m o t i l e b y v i r t u e o f a p o l a r tu f t o f s h e a t h e d f l a g e l l a ( G e i s et al, 1 9 8 9 ) . H. pylori i s f a s t i d i o u s i n i t s g r o w t h r e q u i r e m e n t s a n d i s u s u a l l y g r o w n o n a c o m p l e x m e d i u m c o n t a i n i n g 5 - 1 0 % b l o o d p r o d u c t ; i t d o e s n o t g r o w w e l l i n l i q u i d b r o t h a n d i s u s u a l l y m a i n t a i n e d o n s o l i d m e d i a . T h i s o r g a n i s m r e q u i r e s t h e p r e s e n c e o f e l e v a t e d c o n c e n t r a t i o n s o f CO2 f o r g r o w t h , a n d w i l l n o t g r o w i n a i r o r u n d e r a n a e r o b i c c o n d i t i o n s . 1 G r o w t h s t u d i e s o f H. pylori r e v e a l e d that m o s t s t r a i n s r e q u i r e 6 to 8 o f t h e 2 0 e s s e n t i a l a m i n o a c i d s a n d g r o w w i t h o u t a d d e d v i t a m i n s , p u r i n e s o r p y r i m i d i n e s ( H a z e l l & M e n d e z , 1 9 9 3 ; R e y n o l d s & P e n n , 1 9 9 4 ) . T h e s e o b s e r v a t i o n s h a v e b e e n c o n f i r m e d b y s e q u e n c e a n a l y s i s o f t h e H. pylori 2 6 6 9 5 g e n o m e i n w h i c h m o s t g e n e s r e q u i r e d f o r the p r e s u m e d b i o s y n t h e t i c p a t h w a y s h a v e b e e n f o u n d , w h e r e a s t h o s e g e n e s f r o m p a t h w a y s w h o s e e n d p r o d u c t s m u s t b e s u p p l i e d e x o g e n o u s l y , a re n o t f o u n d i n the g e n o m e s e q u e n c e ( T o m b et al, 1 9 9 7 ) . T h e r e i s a l s o s e q u e n c e a n d b i o c h e m i c a l e v i d e n c e f o r the p r e s e n c e i n H. pylori o f t h e E n t n e r - D o u d o r o f f p a t h w a y , t h e T C A c y c l e , t h e p e n t o s e p h o s p h a t e c y c l e a n d g l y c o l y s i s ( B e r g et al, 1 9 9 7 ; H a z e l l & M e n d e z , 1 9 9 3 ; T o m b e r a / . , 1 9 9 7 ) . H. pylori u n d e r g o e s a p h e n o t y p i c s h i f t d u r i n g i ts g r o w t h c y c l e ( S o r b e r g et al, 1 9 9 6 ) . A c t i v e l y d i v i d i n g c e l l s a re r o d - s h a p e d , b u t as the c u l t u r e ages t h e c e l l m o r p h o l o g y s h i f t s t o w a r d s a c o c c o i d f o r m (at a p p r o x i m a t e l y 4 - 6 d a y s o n s o l i d aga r ) w h i c h i s n o l o n g e r c u l t u r a b l e . S i m i l a r p h e n o t y p i c s h i f t s h a v e b e e n o b s e r v e d w i t h Vibrio s p . ( C o l w e l l & H u q , 1 9 9 4 ) , i n w h i c h t h e c o c c o i d c e l l s a re b e l i e v e d to b e a n e n v i r o n m e n t a l r e s t i n g state a n d h a v e b e e n t e r m e d " v i a b l e b u t n o n c u l t u r a b l e " . W h e t h e r the c o c c o i d - s h a p e d H. pylori r e p r e s e n t a " v i a b l e b u t n o n c u l t u r a b l e " state h a s b e e n a p o i n t o f c o n t e n t i o n i n t h e l i t e r a t u r e . C e l l i n i et al, r e p o r t e d o b t a i n i n g v i a b l e H. pylori f r o m c u l t u r e s o f the n o n v i a b l e c o c c o i d c e l l s b y p a s s a g e t h r o u g h t h e s t o m a c h o f m i c e ( C e l l i n i et al, 1 9 9 4 ) , w h i c h i s i n c o n t r a s t to t h e f i n d i n g s o f E a t o n et al. ( 1 9 9 5 ) w h o w e r e n o t a b l e to o b t a i n v i a b l e c u l t u r e s f o l l o w i n g p a s s a g e t h r o u g h p i g l e t s ( E a t o n et al, 1 9 9 5 ) . I n c o n t r a s t , K u s t e r s et al. ( 1 9 9 7 ) a n a l y z e d t h e p r o t e i n a n d n u c l e i c a c i d c o n t e n t o f t h e c o c c o i d c e l l s a n d f o u n d that the p r o t e i n s a n d n u c l e i c a c i d s w e r e d e g r a d e d , a n d c o n c l u d e d that t h e p h e n o t y p i c s h i f t i s a m a n i f e s t a t i o n o f c e l l d e a t h ( K u s t e r s et al, 1 9 9 7 ) . 3. Helicobacter pylori g e n o m e T h e g e n o m i c s e q u e n c e o f H. pylori s t r a i n 2 6 6 9 5 w a s p u b l i s h e d ( T o m b et al, 1 9 9 7 ) f o l l o w i n g t h e c o m p l e t i o n o f C h a p t e r s 1 a n d 2 o f t h i s t h e s i s . T h e H. pylori 2 6 6 9 5 g e n o m e s e q u e n c e c a n b e a c c e s s e d o n l i n e at T h e I n s t i t u t e f o r G e n o m i c R e s e a r c h ( T I G R ) w e b s i t e ( w w w . t i g r . o r g / t d b / m d b / h p d b / h p d b . h t m l ) . T h e g e n o m e o f H. pylori 2 6 6 9 5 i s 1.67 M b p i n l e n g t h a n d h a s a G C c o n t e n t o f 3 9 % ( T o m b et al, 1 9 9 7 ) . T h e g e n o m e c o n t a i n s 1 5 9 0 p r e d i c t e d o p e n i n g r e a d i n g f r a m e s ( O R F s ) , 4 9 9 o f w h i c h a re u n i q u e to H. pylori i n that t h e y d o n o t h a v e s i m i l a r i t y to o t h e r g e n e s i n t h e d a t a b a s e s . I n t e r e s t i n g l y , m a n y H. pylori g e n e s are m o s t c l o s e l y r e l a t e d to g e n e s f o u n d a m o n g t h e G r a m p o s i t i v e b a c t e r i a , the a r c h e a a n d e u k a r y o t e o r g a n i s m s . S i n c e H. pylori i s n a t u r a l l y c o m p e t e n t ( N e d e n s k o v - S o r e n s e n et a l . , 1 9 9 0 ) , t h i s o b s e r v a t i o n w a s i n t e r p r e t e d as p o t e n t i a l e v i d e n c e f o r h o r i z o n t a l g e n e t r a n s f e r i n H. pylori ( T o m b et al, 1 9 9 7 ) . A l a r g e p r o p o r t i o n o f the H. pylori g e n o m e i s p r e d i c t e d to b e i n v o l v e d i n t r a n s p o r t f u n c t i o n s ; s i n c e i t c o n t a i n s 17 A T P - b i n d i n g casse t te ( A B C ) t r a n s p o r t s y s t e m s , 3 r e s i s t a n c e -n o d u l a t i o n - d i v i s i o n f a m i l y t r a n s p o r t s y s t e m s ( i d e n t i f i e d b y m e p r i o r to t h e g e n o m e r e l e a s e ; B i n a et al, 1 9 9 6 ) ; a n d a 4 0 k b p a t h o g e n i c i t y i s l a n d ( P A T ) , the c a g p a t h o g e n i c i t y i s l a n d , that m a y e n c o d e c o m p o n e n t s o f t y p e I I I a n d t y p e I V s e c r e t i o n s y s t e m s ( T o m b et al, 1 9 9 7 ) . A l s o p r e s e n t are 9 5 p a r a l o g o u s g e n e f a m i l i e s w h i c h c o n s i s t e d o f a t o t a l o f 2 6 6 g e n e s ( 1 6 % o f t h e g e n o m e ) ( T o m b et al, 1 9 9 7 ) . T h e l a r g e s t g e n e f a m i l y , w h i c h c o n t a i n e d 3 2 m e m b e r s , w a s t h e H o p f a m i l y o f o u t e r m e m b r a n e / a d h e s i n p r o t e i n s a n d i s the s u b j e c t o f C h a p t e r 3 o f t h i s t h e s i s . 4. P a t h o g e n e s i s H. pylori i s a c o m m o n h u m a n p a t h o g e n that h a s b e e n e s t i m a t e d to c o l o n i z e 5 0 % o f t h e w o r l d ' s p o p u l a t i o n . H. pylori c o l o n i z a t i o n o f the h u m a n g a s t r i c m u c o s a h a s b e e n a s s o c i a t e d 3 w i t h a n u m b e r o f p a t h o l o g i e s , i n c l u d i n g g a s t r i t i s , u l c e r s , g a s t r i c c a n c e r s a n d e v e n h e a r t d i s e a s e ( v a n d e r H u l s t et al, 1 9 9 6 ) . E p i d e m i o l o g i c a l e v i d e n c e s u g g e s t s that H. pylori i s s p r e a d b y f e c a l - o r a l a n d o r a l - o r a l r o u t e s . T h e r e are n o k n o w n e n v i r o n m e n t a l r e s e r v o i r s f o r H. pylori, b u t H. pylori h a s b e e n c u l t u r e d f r o m t h e f e c e s ( T h o m a s et al, 1 9 9 2 ) o f i n f e c t e d i n d i v i d u a l s a n d h a s b e e n d e t e c t e d b y p o l y m e r a s e c h a i n r e a c t i o n ( P C R ) i n d e n t a l p l a q u e ( N g u y e n et al, 1 9 9 3 ) . W h e n H. pylori en te rs the s t o m a c h , t h e b a c t e r i a p e n e t r a t e t h e g a s t r i c m u c o s a a n d c o l o n i z e t h e g a s t r i c e p i t h e l i u m a n d m u c o s a . I n i t i a l i n f e c t i o n r e q u i r e s t h e e x p r e s s i o n o f m o t i l i t y a n d t h e u r e a s e e n z y m e ( E a t o n et al, 1 9 9 6 ; T s u d a et al, 1 9 9 4 ) . M o t i l i t y i s r e q u i r e d f o r H. pylori to p e n e t r a t e the g a s t r i c m u c u s a n d e s t a b l i s h i n f e c t i o n o n t h e g a s t r i c e p i t h e l i u m . U r e a s e c a t a l y z e s t h e c o n v e r s i o n o f u r e a i n t o a m m o n i a a n d c a r b o n d i o x i d e , a n d i t i s b e l i e v e d that t h e g e n e r a t i o n o f a m m o n i a b y t h e H. pylori u r e a s e e n z y m e f u n c t i o n s i n n e u t r a l i z i n g t h e a c i d i c e n v i r o n m e n t i n t h e g a s t r i c l u m e n . H. pylori s h o w s t r o p i s m f o r the h u m a n g a s t r i c e p i t h e l i u m ( r e v i e w e d i n B o r e n et al, 1 9 9 4 ) . It h a s b e e n s h o w n that the b l o o d g r o u p a n t i g e n s L e w i s b a n d H - 1 m e d i a t e a d h e r e n c e o f H. pylori to h u m a n g a s t r i c e p i t h e l i a l c e l l s in situ a n d that B a p A , a H. pylori p r o t e i n , b i n d s to t h e s e b l o o d g r o u p a n t i g e n s ( l i v e r et al, 1 9 9 8 ) . S i g n i f i c a n t l y , B a p A i s a m e m b e r o f t h e c o n s e r v e d H o p f a m i l y o f o u t e r m e m b r a n e / a d h e s i n p r o t e i n s ( l i v e r et al, 1 9 9 8 ) . It h a s a l s o b e e n s p e c u l a t e d that o t h e r m e m b e r s o f t h e H o p f a m i l y f u n c t i o n as a d h e s i n s . H. pylori i n f e c t i o n o f the s t o m a c h r e s u l t s i n c h r o n i c g a s t r i t i s i n the m a j o r i t y o f i n f e c t e d p e o p l e . T h e p r o g r e s s i o n f r o m g a s t r i t i s to m o r e s e v e r e p a t h o l o g i e s s u c h as u l c e r s a n d g a s t r i c c a n c e r s i s a s s o c i a t e d w i t h the p r e s e n c e i n the i n f e c t i n g s t r a i n o f t h e c a g p a t h o g e n i c i t y i s l a n d a n d t h e e x p r e s s i o n o f t h e v a c u o l a t i n g c y t o t o x i n (vacA) a n d the c y t o t o x i n a s s o c i a t e d (cagA) g e n e s ( B e r g et al, 1 9 9 7 ; C o v a c c i & R a p p o u l i , 1 9 9 8 ) . T h e H. pylori l i p o p o l y s a c c h a r i d e ( L P S ) c o n t a i n s s e v e r a l u n u s u a l f e a t u r e s . F i r s t , t h e L i p i d A ( m e m b r a n e i n s e r t e d ) p o r t i o n i s m i s s i n g the 4 ' p h o s p h a t e g r o u p that i s f o u n d o n m o s t b a c t e r i a l L i p i d A m o l e c u l e s ( M o r a n et al, 1 9 9 7 ; M u o t i a l a et al, 1 9 9 2 ) . A r e d u c t i o n i n t h e c h a r g e o f L P S , e i t h e r t h r o u g h r e d u c e d p h o s p h a t e c o n t e n t o r s u b s t i t u t i o n o f p h o s p h a t e g r o u p s w i t h a r a b a n o s a m i n e , i s a s s o c i a t e d w i t h r e d u c e d t o x i c i t y o f e n d o t o x i n a n d i n c r e a s e d r e s i s t a n c e to c a t i o n i c a n t i m i c r o b i a l p e p t i d e s . T h i s f i n d i n g i s c o n s i s t e n t w i t h the o b s e r v a t i o n that H. pylori e n d o t o x i n i s r e l a t i v e l y n o n t o x i c ( M u o t i a l a et al, 1 9 9 2 ) a n d that H. pylori i s r e a s o n a b l y r e s i s t a n t to c a t i o n i c a n t i m i c r o b i a l p e p t i d e s ( R . E . W . H a n c o c k , u n p u b l i s h e d o b s e r v a t i o n s ) . S e c o n d , t h e O a n t i g e n o f H. pylori c o n t a i n s L e w i s X a n d L e w i s Y b l o o d g r o u p a n t i g e n s ( S h e r b u r n e et al, 1 9 9 5 ; A p p e l m e l k et al, 1 9 9 6 ) . T h e p r e s e n c e o f t h e s e a n t i g e n s i s b e l i e v e d to f u n c t i o n i n e v a s i o n o f t h e i m m u n e s y s t e m ( t h r o u g h m o l e c u l a r m i m i c r y ) ( A p p e l m e l k et al, 1 9 9 7 ) . It h a s a l s o b e e n s p e c u l a t e d that t h e e x p r e s s i o n o f i n c o m p l e t e l y f o r m e d L e w i s a n t i g e n s b y H. pylori m a y b e i n v o l v e d i n the g e n e r a t i o n o f a u t o i m m u n e a n t i b o d i e s w h i c h c o n t r i b u t e to p a t h o g e n e s i s ( A p p e l m e l k et al, 1 9 9 7 ) . T h i r d , the l i p i d p o r t i o n o f H. pylori L P S c o n t a i n s u n u s u a l l y l o n g s a t u r a t e d f a t t y a c i d s a n d g l y c o s y l a t e d c h o l e s t e r o l esters ( A s p i n a l l et al, 1 9 9 6 ; G e i s et al, 1 9 9 0 ) . 5. T r e a t m e n t . W h e n H. pylori b e c o m e s e s t a b l i s h e d i n the g a s t r i c m u c o s a , i n f e c t e d i n d i v i d u a l s u s u a l l y c a r r y H. pylori f o r l i f e u n l e s s t r e a t e d w i t h a n t i b i o t i c s . A l t h o u g h H. pylori i s s u s c e p t i b l e to m o s t a n t i b i o t i c s in vitro ( R u b i n s t e i n et a l . , 1 9 9 4 ) , t r e a t m e n t o f H. / ?v7orz ' - i n fected i n d i v i d u a l s h a s p r o v e n d i f f i c u l t . S i n g l e a n t i b i o t i c t h e r a p y h a s p r o v e n v i r t u a l l y i n e f f e c t i v e ; s u c c e s s f u l t r e a t m e n t u s u a l l y r e q u i r e s a m u c h m o r e a g g r e s s i v e t h e r a p y u s i n g t w o o r t h r e e a n t i b i o t i c s g i v e n i n 5 c o m b i n a t i o n w i t h a p r o t o n p u m p i n h i b i t o r ( v a n d e r H u l s t et al, 1 9 9 6 ) . T h i s m o r e a g g r e s s i v e t r e a t m e n t s t r a t e g y r e s u l t s i n a s u c c e s s rate o f 8 0 - 9 5 % ( v a n d e r H u l s t et al, 1 9 9 6 ) . S e v e r a l f a c t o r s c o u l d e x p l a i n the d i f f i c u l t y o f t r e a t i n g H. pylori in vivo i n c l u d i n g : a c i d i n a c t i v a t i o n o f d r u g s ; i n a c c e s s i b i l i t y o f d r u g s to the g a s t r i c l u m e n ; t o o s h o r t a t r e a t m e n t t i m e ; v a r i a b l e p a t i e n t c o m p l i a n c e w i t h p h y s i c i a n ' s i n s t r u c t i o n s ; i n a p p r o p r i a t e f o r m u l a t i o n o f d r u g s ; in vivo a l t e r a t i o n s i n H. pylori p e r m e a b i l i t y ( th is t h e s i s ) a n d a c t i v e e f f l u x m e c h a n i s m s ( th i s t h e s i s ) . A l l o f t h e s e p o s s i b i l i t i e s h a v e m e r i t i n s o m e i n s t a n c e s b u t t h e y d o n o t g l o b a l l y e x p l a i n t h e a p p a r e n t l y e l e v a t e d in vivo i n t r i n s i c r e s i s t a n c e o f H. pylori t o a n t i b i o t i c s . I p r o p o s e a n o t h e r h y p o t h e s i s i n C h a p t e r 2 o f t h i s t h e s i s , that t h e c o n d i t i o n a l e x p r e s s i o n o f m u l t i p l e d r u g e f f l u x s y s t e m s , i n c o n j u n c t i o n w i t h d e c r e a s e d o u t e r m e m b r a n e p e r m e a b i l i t y , r e s u l t s i n t h e e l e v a t e d i n t r i n s i c in vivo r e s i s t a n c e o f H. pylori to a n t i b i o t i c s . B. F u n c t i o n a l a s p e c t s o f t h e G r a m n e g a t i v e c e l l e n v e l o p e i n a n t i b i o t i c u p t a k e T h e c e l l e n v e l o p e o f G r a m n e g a t i v e b a c t e r i a c o n s i s t s o f t w o m e m b r a n e s , t h e c y t o p l a s m i c a n d o u t e r m e m b r a n e , w h i c h are s e p a r a t e d b y the p e r i p l a s m i c s p a c e ( F i g u r e 1). It h a s l o n g b e e n a s s u m e d that the o u t e r m e m b r a n e o f G r a m n e g a t i v e b a c t e r i a i s t h e p r i m a r y d e t e r m i n a n t i n the i n t r i n s i c r e s i s t a n c e o f b a c t e r i a to a n t i m i c r o b i a l c o m p o u n d s s u c h as a n t i b i o t i c s a n d d e t e r g e n t s . H o w e v e r , r e c e n t l y i t h a s b e c o m e c l e a r that t h e r e are o t h e r m e m b r a n e - l o c a l i z e d f a c t o r s , s u c h as c o n s t i t u t i v e l y e x p r e s s e d a c t i v e e f f l u x s y s t e m s , that w o r k i n s y n e r g y w i t h r e s t r i c t e d o u t e r m e m b r a n e p e r m e a b i l i t y t o b r i n g a b o u t the i n t r i n s i c a n d i n s o m e c a s e s h i g h l e v e l r e s i s t a n c e o f b a c t e r i a to a n t i m i c r o b i a l s ( M a et a l . , 1 9 9 4 ; N i k a i d o , 1 9 9 6 ; H a n c o c k , 1 9 9 7 ) . 1. S t r u c t u r e o f t h e o u t e r m e m b r a n e T h e o u t e r m e m b r a n e o f G r a m n e g a t i v e b a c t e r i a p l a y s a r o l e i n e x c l u d i n g n o x i o u s c o m p o u n d s s u c h as a n t i b i o t i c s , e n z y m e s a n d d e t e r g e n t s f r o m t h e b a c t e r i a l c y t o p l a s m w h i l e 6 f u n c t i o n i n g as a s e l e c t i v e p e r m e a b i l i t y b a r r i e r f o r t h e u p t a k e o r e g r e s s o f o t h e r c o m p o u n d s ( N i k a i d o , 1 9 9 3 ; H a n c o c k , 1 9 9 7 ) . T h e o u t e r m e m b r a n e i s a n a s y m m e t r i c b i l a y e r that c o n t a i n s L P S i n t h e o u t e r l e a f l e t a n d p h o s p h o l i p i d s i n t h e i n n e r l e a f l e t . L P S c o n s i s t s o f t h ree r e g i o n s , a h y d r o p h o b i c c o r e c o n s i s t i n g o f L i p i d A w h i c h i s i n s e r t e d i n t o t h e m e m b r a n e , t h e c o n s e r v e d c o r e o l i g o s a c c h a r i d e a n d t h e i m m u n o d o m i n a n t a n d v a r i a b l e O - a n t i g e n . I n m o s t c o m m o n p a t h o g e n s , L i p i d A i s a d i m e r o f d i p h o s p h o r y l a t e d N -a c e t y l g l u c o s a m i n e that i s s u b s t i t u t e d w i t h 6 to 7 s a t u r a t e d f a t t y a c i d r e s i d u e s w h i c h a n c h o r t h e L P S m o l e c u l e i n the m e m b r a n e ( D a r v e a u , 1 9 9 8 ) . C o v a l e n t l y a t t a c h e d to t h e L i p i d A b a c k b o n e a n d e x t e n d i n g t o w a r d s the e x t r a c e l l u l a r e n v i r o n m e n t i s t h e c o r e r e g i o n . T h e c o r e r e g i o n c o n s i s t s o f a h e t e r o g e n e o u s o l i g o s a c c h a r i d e o f 8 to 12 s u g a r r e s i d u e s i n c l u d i n g t h e u n i q u e o c t a s a c c h a r i d e 2 - k e t o - 3 - d e o x y o c t u l o s o n a t e ( K D O ) , L - g l y c e r o l - D - m a n n o h e p t o s e , a n d t w o o r m o r e h e x o s e s o r h e x o s a m i n e s ; t h e i n d i v i d u a l s u g a r r e s i d u e s i n t h e c o r e o l i g o s a c c h a r i d e m a y b e f u r t h e r m o d i f i e d b y a d d i t i o n a l s u g a r r e s i d u e s , a m i n o a c i d s a n d / o r b y p h o s p h o r y l a t i o n ( H a n c o c k , 1 9 9 7 ; D a r v e a u , 1 9 9 8 ) . I m m e d i a t e l y f o l l o w i n g the c o r e m a y b e a t t a c h e d t h e h i g h l y v a r i a b l e O -a n t i g e n w h i c h c o n s i s t s o f 3 to 5 s u g a r u n i t s that are r e p e a t e d n u m e r o u s t i m e s . O t h e r p a t h o g e n s m a y h a v e l i p o o l i g o s a c c h a r i d e ( L O S ) w i t h a v a r i a b l e c o r e s u g a r r e g i o n a n d n o O - a n t i g e n ( H a n c o c k , 1 9 9 7 ; D a r v e a u , 1 9 9 8 ) . 7 F i g u r e 1. S c h e m a t i c d i a g r a m o f t h e c e l l e n v e l o p e o f G r a m n e g a t i v e b a c t e r i a . T h e c e l l e n v e l o p e o f G r a m n e g a t i v e b a c t e r i a c o n s i s t s o f t w o m e m b r a n e s , the c y t o p l a s m i c a n d o u t e r m e m b r a n e w h i c h are s e p a r a t e d b y the p e r i p l a s m . T h e o u t e r m e m b r a n e i s a n a s y m m e t r i c b i l a y e r w i t h l i p o p o l y s a c c h a r i d e ( L P S ) i n t h e o u t e r l e a f l e t a n d p h o s p h o l i p i d s i n t h e i n n e r l e a f l e t . T h e p e r i p l a s m separa tes the t w o m e m b r a n e s a n d c o n t a i n s t h e m e s h -l i k e p e p t i d o g l y c a n l a y e r . T h e i n n e r m e m b r a n e ( c y t o p l a s m i c m e m b r a n e ) i s a p h o s p h o l i p i d b i l a y e r . P r o t e i n s s h o w n are : a t h r e e - c o m p o n e n t r e s i s t a n c e - n o d u l a t i o n -d i v i s i o n e f f l u x s y s t e m c o n s i s t i n g o f the i n t e g r a l o u t e r m e m b r a n e p o r e p r o t e i n s , t h e p e r i p l a s m i c m e m b r a n e f u s i o n p r o t e i n s ( M F ) a n d t h e i n t e g r a l c y t o p l a s m i c r e s i s t a n c e -n o d u l a t i o n - d i v i s i o n p u m p p r o t e i n ; a n o u t e r m e m b r a n e p o r i n p r o t e i n f o r m i n g a d i f f u s i o n c h a n n e l a n d a p e r i p h e r a l p e r i p l a s m i c p e n i c i l l i n b i n d i n g p r o t e i n ( P B P ) w h i c h f u n c t i o n s i n t h e s y n t h e s i s o f the p e p t i d o g l y c a n l a y e r . 8 T h e p r e d o m i n a n t f e a t u r e s o f the o u t e r m e m b r a n e that i n f l u e n c e a n t i b i o t i c u p t a k e are the l a r g e net n e g a t i v e c h a r g e o n L P S a n d t h e p r e s e n c e o f p o r i n p r o t e i n s i n t h e o u t e r m e m b r a n e ( N i k a i d o 1 9 8 8 ; N i k a i d o , 1 9 9 3 ; H a n c o c k 1 9 8 7 ; H a n c o c k , 1 9 9 7 ) . T h e h i g h n e g a t i v e c h a r g e a s s o c i a t e d w i t h p h o s p h a t e a n d K D O r e s i d u e s o n L i p i d A a n d t h e c o r e o l i g o s a c c h a r i d e are n e u t r a l i z e d b y n o n c o v a l e n t c r o s s l i n k i n g w i t h d i v a l e n t c a t i o n s ( N i k a i d o , 1 9 9 3 ; H a n c o c k 1 9 8 7 ; H a n c o c k , 1 9 9 7 ) . T h e e f f e c t o f t h i s c r o s s l i n k i n g i s t o s t a b i l i z e t h e o u t e r m e m b r a n e . T h e p o r i n p r o t e i n s a re r e s p o n s i b l e f o r t h e s i e v i n g c h a r a c t e r i s t i c s o f t h e o u t e r m e m b r a n e . P o r i n s f u n c t i o n as w a t e r f i l l e d d i f f u s i o n c h a n n e l s that a l l o w t h e p a s s a g e o f s m a l l ( e .g . , < 6 0 0 D a l t o n i n E. coli) h y d r o p h i l i c m o l e c u l e s ( H a n c o c k 1 9 8 7 ; N i k a i d o 1 9 8 8 ; N i k a i d o , 1 9 9 3 ; H a n c o c k , 1 9 9 7 ) . T h e e x c l u s i o n l i m i t o f t h e o u t e r m e m b r a n e i s d e t e r m i n e d b y t h e s i z e o f t h e c h a n n e l s f o r m e d b y the m o s t p r e d o m i n a n t n o n - s p e c i f i c p o r i n s . 2. M e c h a n i s m s o f a n t i b i o t i c u p t a k e T h e r e e x i s t s t h ree g e n e r a l p a t h w a y s f o r a n t i b i o t i c u p t a k e i n G r a m n e g a t i v e b a c t e r i a : the p o r i n p a t h w a y , t h e h y d r o p h o b i c p a t h w a y a n d the s e l f p r o m o t e d u p t a k e p a t h w a y ( H a n c o c k , 1 9 9 7 ) . S m a l l h y d r o p h i l i c m o l e c u l e s en te r t h e p e r i p l a s m b y d i f f u s i o n t h r o u g h t h e p o r i n c h a n n e l s that a re p r e s e n t i n the o u t e r m e m b r a n e . P o r i n p r o t e i n s are c l a s s i f i e d i n t o th ree c l a s s e s : g e n e r a l p o r i n s w h i c h h a v e n o s u b s t r a t e s e l e c t i v i t y , s p e c i f i c p o r i n s w h i c h c o n t a i n a b i n d i n g s i te f o r a s p e c i f i c s u b s t r a t e a n d g a t e d , s p e c i f i c p o r i n s w h i c h are b e l i e v e d to h a v e o b s t r u c t e d c h a n n e l s that a re o p e n e d b y t h e b i n d i n g o f a s p e c i f i c subs t ra te ( V a n G e l d e r et al, 1 9 9 7 ) . U p t a k e o f s m a l l h y d r o p h i l i c a n t i b i o t i c s u s u a l l y o c c u r s t h r o u g h the g e n e r a l p o r i n s . A n t i b i o t i c u p t a k e t h r o u g h the s p e c i f i c p o r i n s i s n o t w e l l d o c u m e n t e d , b u t i t h a s b e e n s h o w n that t h e b a s i c a m i n o a c i d - s p e c i f i c 9 O p r D p o r i n o f Pseudomonas aeruginosa m e d i a t e s t h e u p t a k e o f t h e P - l a c t a m a n t i b i o t i c i m i p e n e m ( S u m i t a et al.., 1 9 9 3 ; Y o n e y a m a et al.., 1 9 9 3 ) . L i p o p h i l i c a n d a m p h i p a t h i c a n t i b i o t i c s en te r t h e c e l l t h r o u g h t h e h y d r o p h o b i c p a t h w a y b y p a s s i v e p e r m e a t i o n t h r o u g h t h e o u t e r m e m b r a n e b i l a y e r ( H a n c o c k & B e l l , 1 9 8 8 ) . T h e m e c h a n i s m o f u p t a k e o f h y d r o p h o b i c a n d a m p h i p a t h i c a n t i b i o t i c s i s n o t w e l l u n d e r s t o o d b u t p r o b a b l y i n v o l v e s t h e p a r t i t i o n i n g i n t o the h y d r o c a r b o n c o r e o f t h e o u t e r m e m b r a n e a n d s i m p l e d i f f u s i o n . It h a s b e c o m e c l e a r that t h e i n t r i n s i c a n d h i g h l e v e l r e s i s t a n c e o f b a c t e r i a to m a n y h y d r o p h o b i c a n t i m i c r o b i a l s i s m e d i a t e d b y a c t i v e e f f l u x m e c h a n i s m s r a t h e r t h a n c h a n g e s i n o u t e r m e m b r a n e p e r m e a b i l i t y . C a t i o n i c a n t i m i c r o b i a l s s u c h as the a m i n o g l y c o s i d e s a n d c a t i o n i c a n t i m i c r o b i a l p e p t i d e s enter t h e c e l l s b y c o m p e t i n g f o r d i v a l e n t c a t i o n b i n d i n g s i tes o n t h e s u r f a c e L P S i n a p r o c e s s that h a s b e e n t e r m e d s e l f p r o m o t e d u p t a k e ( H a n c o c k , 1 9 9 7 ) . It i s b e l i e v e d that t h e b i n d i n g o f these c o m p o u n d s to t h e o u t e r m e m b r a n e d i s p l a c e s the n a t i v e d i v a l e n t c a t i o n s a n d , d u e to t h e i r b u l k i n e s s , t h e y d e s t a b i l i z e ( p e r m e a b i l i z e ) the o u t e r m e m b r a n e a n d t h e r e b y f a c i l i t a t e f u r t h e r u p t a k e o f t h e m s e l v e s a n d o t h e r m o l e c u l e s ( H a n c o c k , 1 9 9 7 ) . 3. Factors that influence antibiotic accumulation T w o s y n e r g i s t i c m e c h a n i s m s are i n v o l v e d i n the i n t r i n s i c r e s i s t a n c e o f b a c t e r i a to m a n y c l a s s e s o f a n t i m i c r o b i a l c o m p o u n d s : r e s t r i c t e d u p t a k e t h r o u g h t h e c h a n n e l s o f p o r i n p r o t e i n s a n d a c t i v e e f f l u x s y s t e m s ( M a et al, 1 9 9 4 ; N i k a i d o , 1 9 9 6 ; H a n c o c k , 1 9 9 7 ) . T h u s , f a c t o r s i n f l u e n c i n g t h e e x p r e s s i o n l e v e l o f t h e s e s y s t e m s h a v e b e e n s h o w n to a l t e r a n t i b i o t i c r e s i s t a n c e . C h a n g e s i n t h e l e v e l s a n d / o r the c o m p l e m e n t o f p o r i n p r o t e i n s i n t h e o u t e r m e m b r a n e c a n h a v e l a r g e e f f e c t s o n t h e p e r m e a t i o n o f h y d r o p h i l i c c o m p o u n d s a c r o s s t h e o u t e r m e m b r a n e ( N i k a i d o , 1 9 9 3 ) . T h e b e s t c h a r a c t e r i z e d e x a m p l e i s p r o v i d e d b y t h e O m p C a n d O m p F p o r i n 10 p r o t e i n s o f Escherichia coli ( S l a u c h a n d S i l h a v y , 1 9 8 9 ; H a n c o c k , 1 9 8 7 ) . W h e n g r o w n u n d e r c o n d i t i o n s o f l o w o s m o l a r i t y , s u c h as i n a n e n v i r o n m e n t o u t s i d e o f t h e m a m m a l i a n g a s t r o i n t e s t i n a l t rac t , E. coli p r e d o m i n a n t l y e x p r e s s e s O m p F , w h i c h h a s a r e l a t i v e l y l a r g e p o r e s i z e ( N i k a i d o a n d R o s e n b e r g , 1 9 8 3 ; L a k e y et al, 1 9 8 5 ) , i n the o u t e r m e m b r a n e . I n c o n t r a s t , w h e n E. coli i s g r o w n u n d e r c o n d i t i o n s o f h i g h o s m o l a r i t y , s u c h as i n t h e m a m m a l i a n g a s t r o i n t e s t i n a l t rac t , t h e e x p r e s s i o n o f O m p F i s r e p r e s s e d a n d t h e e x p r e s s i o n o f O m p C i s i n d u c e d . T h e O m p C p o r i n c o n t a i n s a m u c h s m a l l e r d i a m e t e r p o r e r e l a t i v e ( N i k a i d o a n d R o s e n b e r g , 1 9 8 3 ; L a k e y et al, 1 9 8 5 ) to O m p F a n d r e s t r i c t s t h e p e r m e a t i o n o f n o x i o u s m o l e c u l e s that a re p r e s e n t in vivo. P o r i n l e v e l s c a n a l s o b e a f f e c t e d b y b o t h l a b o r a t o r y a n d c l i n i c a l l y d e r i v e d m u t a t i o n s , l e a d i n g to i n c r e a s e d l e v e l s o f r e s i s t a n c e t o m a n y o r a f e w a n t i b i o t i c s . T h e l o s s o f t h e P. aeruginosa i m i p e n e m - s p e c i f i c O p r D p o r i n o c c u r s i n a p p r o x i m a t e l y 5 0 % o f p a t i e n t s t r e a t e d w i t h i m i p e n e m ( S u m i t a et al, 1 9 9 3 ; Y o n e y a m a et al, 1 9 9 3 ) . R e c e n t e x p e r i m e n t s h a v e r e v e a l e d that the c o n s t i t u t i v e e x p r e s s i o n i n G r a m n e g a t i v e b a c t e r i a o f a c t i v e e f f l u x m e c h a n i s m s w i t h b r o a d subs t ra te s p e c i f i c i t y i s r e s p o n s i b l e f o r t h e i n t r i n s i c r e s i s t a n c e o f b a c t e r i a to a m p h i p a t h i c a n t i m i c r o b i a l s ( N i k a i d o , 1 9 9 6 ; P a u l s e n et al, 1 9 9 6 ) . T h e r e i s e v i d e n c e that t h e s e e f f l u x s y s t e m s a l s o c o n t r i b u t e t o t h e i n t r i n s i c r e s i s t a n c e to o t h e r h y d r o p h i l i c a n t i m i c r o b i a l s i n c l u d i n g P - lactams, d i v a l e n t c a t i o n s a n d c a t i o n i c a n t i m i c r o b i a l p e p t i d e s ( P a u l s e n et al, 1 9 9 6 ; S h a f e r et al, 1 9 9 8 ; S r i k u m a r et al, 1 9 9 8 ) . T h e r e are at l e a s t f o u r c o n s e r v e d f a m i l i e s o f b a c t e r i a l e f f l u x s y s t e m s that h a v e b e e n a s s o c i a t e d w i t h r e s i s t a n c e to a n t i b i o t i c s ( S a i e r et al, 1 9 9 8 ) . O n e o f t h e s e f a m i l i e s that i s o f p a r t i c u l a r i n t e r e s t i n the i n t r i n s i c r e s i s t a n c e o f G r a m n e g a t i v e b a c t e r i a to a n t i m i c r o b i a l s i s the R e s i s t a n c e - N o d u l a t i o n - D i v i s i o n ( R N D ) f a m i l y o f b a c t e r i a l e f f l u x s y s t e m s ( N i k a i d o , 1 9 9 6 ; 11 P a u l s e n et al, 1 9 9 7 ) . T h e R N D f a m i l y e f f l u x s y s t e m s are p r o t o n m o t i v e f o r c e - d e p e n d e n t e f f l u x s y s t e m s that a re w i d e s p r e a d a m o n g t h e G r a m n e g a t i v e b a c t e r i a . S u c h s y s t e m s , i n c l u d i n g t h e acrAB-tolC s y s t e m i n E. coli ( M a et a l . , 1 9 9 3 ) , the mexAB-oprM s y s t e m i n P. aeruginosa ( L i et al, 1 9 9 5 ) a n d t h e mtrCDE s y s t e m i n Neisseria gonnorhoeae ( H a g m a n et a l . , 1 9 9 5 ) , h a v e b e e n i m p l i c a t e d i n t h e i n t r i n s i c r e s i s t a n c e o f t h e s e r e s p e c t i v e b a c t e r i a to a w i d e v a r i e t y o f s t r u c t u r a l l y a n d c h e m i c a l l y u n r e l a t e d a n t i b i o t i c s a n d o t h e r a n t i m i c r o b i a l c o m p o u n d s , i n c l u d i n g m a n y a n t i b i o t i c s , d e t e r g e n t s a n d d y e s . R N D s y s t e m s are 3 c o m p o n e n t e f f l u x s y s t e m s c o n s i s t i n g o f a c o n s e r v e d i n t e g r a l c y t o p l a s m i c m e m b r a n e p u m p p r o t e i n , a c o n s e r v e d p e r i p l a s m i c m e m b r a n e f u s i o n o r l i n k e r p r o t e i n , a n d a l e s s w e l l c o n s e r v e d i n t e g r a l o u t e r m e m b r a n e p r o t e i n that h a s b e e n p r e s u m e d to b e a p o r e f o r m i n g p r o t e i n ( N i k a i d o , 1 9 9 6 ) ( F i g u r e 1). T h e m e m b r a n e f u s i o n p r o t e i n i s l i n k e d to the c y t o p l a s m i c m e m b r a n e b y a s i n g l e t r a n s m e m b r a n e d o m a i n , o r t h r o u g h c o v a l e n t a t t a c h m e n t o f a l i p i d , a n d h a s b e e n p r o p o s e d to f u n c t i o n to l i n k t h e c y t o p l a s m i c p u m p p r o t e i n to the o u t e r m e m b r a n e p o r e p r o t e i n . T h i s l i n k a g e i s b e l i e v e d to r e s u l t i n the f o r m a t i o n o f a c o n t i n u o u s c h a n n e l f o r t h e e x t r u s i o n o f s u b s t r a t e s to the e x t r a c e l l u l a r e n v i r o n m e n t . A n t i b i o t i c e f f l u x s y s t e m s f u n c t i o n s y n e r g i s t i c a l l y w i t h c h a n g e s that d e c r e a s e o u t e r m e m b r a n e p e r m e a b i l i t y ( N i k a i d o , 1 9 9 6 ; H a n c o c k , 1 9 9 7 ) . T h i s i s e v i d e n t w h e n c o m p a r i n g the c o n t r i b u t i o n o f t h e R N D s y s t e m s to t h e i n t r i n s i c a n t i b i o t i c r e s i s t a n c e i n E. coli ( M a et a l . , 1 9 9 3 ) a n d P. aeruginosa ( L i et a l . , 1 9 9 5 ) . O n l y i n the la t te r s p e c i e s d o t h e R N D s y s t e m s r e s u l t i n c l i n i c a l l y s i g n i f i c a n t l e v e l s o f a n t i b i o t i c r e s i s t a n c e . T h i s f i n d i n g i s t h o u g h t to r e s u l t from the r e l a t i v e l y l o w e r p o r o s i t y o f t h e o u t e r m e m b r a n e i n P. aeruginosa r e l a t i v e to t h e o u t e r m e m b r a n e o f E. coli ( N i k a i d o , 1 9 8 8 ; N i k a i d o , 1 9 9 3 ) . 12 I n g e n e r a l , t h e s t e a d y state c o n c e n t r a t i o n o f m a n y a n t i b i o t i c s i n t h e c y t o p l a s m ( o r ' p e r i p l a s m ) i s d e t e r m i n e d b y the rate o f i n f l u x a n d t h e ra te o f e f f l u x ( N i k a i d o , 1 9 9 6 ) . I n E. coli, s o m e a n t i m i c r o b i a l c o m p o u n d s p e n e t r a t e the o u t e r m e m b r a n e v e r y r a p i d l y a n d o v e r w h e l m the e f f l u x s y s t e m s a n d r a p i d l y r e a c h t o x i c c o n c e n t r a t i o n s i n the c y t o p l a s m ( M a et al, 1 9 9 4 ; N i k a i d o , 1 9 9 6 ) ; t h u s t h e r e l a t i v e l y h i g h m e m b r a n e p e r m e a b i l i t y o f E. coli r e s u l t s o n l y i n a m o d e r a t e i n t r i n s i c r e s i s t a n c e to a n t i m i c r o b i a l c o m p o u n d s . T h e o u t e r m e m b r a n e o f P. aeruginosa, h o w e v e r , i s m u c h l e s s p e r m e a b l e t h a n the o u t e r m e m b r a n e o f E. coli ( N i k a i d o , 1 9 9 3 ; N i k a i d o , 1 9 8 8 ) , a n d t h e p e n e t r a t i o n o f s m a l l a n t i m i c r o b i a l m o l e c u l e s a c r o s s t h e o u t e r m e m b r a n e i n P. aeruginosa c o m p e t e s p o o r l y w i t h t h e i r e f f l u x ; t h e net e f f e c t o f t h i s l o w m e m b r a n e p e r m e a b i l i t y i s that P. aeruginosa h a s a f a r h i g h e r i n t r i n s i c r e s i s t a n c e to a n t i m i c r o b i a l c o m p o u n d s ( M a et al, 1 9 9 4 ; N i k a i d o , 1 9 9 6 ) . C. Bacterial porin proteins 1. Structure of porins P o r i n s r e p r e s e n t a d i s t i n c t c l a s s o f m e m b r a n e p r o t e i n s c o m p a r e d to the p r e d o m i n a n t l y a -h e l i c a l c y t o p l a s m i c m e m b r a n e p r o t e i n s i n G r a m n e g a t i v e b a c t e r i a . I n c o n t r a s t to m o s t i n t e g r a l m e m b r a n e p r o t e i n s , p o r i n s d o n o t c o n t a i n s t r e t c h e s o f h y d r o p h o b i c a m i n o a c i d r e s i d u e s that are l o n g e n o u g h to s p a n t h e o u t e r m e m b r a n e ( J e a n t e u r et al, 1 9 9 1 ) . I n f a c t , h y d r o p a t h y a n a l y s e s i n d i c a t e that m o s t p o r i n s are r e l a t i v e l y h y d r o p h i l i c i n n a t u r e . H o w t h e s e s e e m i n g l y h y d r o p h i l i c p r o t e i n s are a c c o m m o d a t e d i n the b a c t e r i a l o u t e r m e m b r a n e w a s r e v e a l e d b y a n u m b e r o f p h y s i c a l a n d g e n e t i c m e a n s , w h i c h w e r e s u b s e q u e n t l y v a l i d a t e d b y s o l v i n g t h e c r y s t a l s t r u c t u r e s f o r f o u r g e n e r a l d i f f u s i o n p o r i n s : the P h o E a n d O m p F p o r i n s o f E. coli ( C o w a n et al, 1 9 9 2 ) , a n d the p o r i n s f r o m Rhodobacter capsulatus ( W e i s s et al, 1 9 9 1 ) a n d Rhodopseudomonas blastica ( P a u l & R o s e n b u s c h , 1 9 8 5 ) . 13 T h e P h o E a n d O m p F p o r i n s o f E. coli s h a r e h i g h l e v e l s o f s e q u e n c e s i m i l a r i t y to e a c h o t h e r b u t l i t t l e s i m i l a r i t y to the o t h e r t w o p o r i n s w h o s e s t r u c t u r e i s k n o w n ( J e a n t e u r et al, 1 9 9 1 ) . I n t e r e s t i n g l y , e v e n w i t h t h e p a u c i t y o f a m i n o a c i d s i m i l a r i t y , a l l the c r y s t a l l i z e d p o r i n s h a v e s i m i l a r t e r t i a r y a n d q u a t e r n a r y s t r u c t u r e s ( S c h u l z , 1 9 9 6 ) . E a c h o f t h e s e p r o t e i n s f o r m t r i m e r s i n t h e o u t e r m e m b r a n e ( J e a n t e u r et al, 1 9 9 1 ) . E a c h m o n o m e r c o n t a i n s a t r a n s m e m b r a n e c o r e that i s c o n s t r u c t e d o f a 1 6 - s t r a n d e d a n t i p a r a l l e l (3 -barre l ( F i g u r e 2 ) . T h e P -strands are a m p h i p a t h i c w i t h the h y d r o p h o b i c s i d e f a c i n g o u t a n d i n t e r a c t i n g w i t h the m e m b r a n e a n d t h e h y d r o p h i l i c f a c e o r i e n t e d t o w a r d s t h e i n t e r i o r o f the b a r r e l ( V a n G e l d e r et al, 1 9 9 7 ) . T h e a n t i p a r a l l e l P-s t r a n d s a re c o n n e c t e d b y s h o r t t u r n s o n t h e p e r i p l a s m i c s i d e a n d l o n g l o o p s o n t h e e x t r a c e l l u l a r s i d e ( V a n G e l d e r et al, 1 9 9 7 ) . 14 Antiparallel (3-strands Periplasmic loops Figure 2. C r o s s - s e c t i o n t h r o u g h t h e c r y s t a l s t r u c t u r e o f t h e Escherichia coli P h o E p o r i n ( C o w e n et al, 1 9 9 2 ) . B a c t e r i a l p o r i n s a re c o m p o s e d o f a t r a n s m e m b r a n e c o r e o f a n t i p a r a l l e l a m p h i p a t h i c p - s h e e t s that a re c o n n e c t e d b y s h o r t l o o p s o n t h e p e r i p l a s m i c s i d e a n d l o n g s u r f a c e e x p o s e d l o o p s ( V a n G e l d e r et al, 1 9 9 7 ) . L o o p 3 , i n p a r t i c u l a r , d i p s d o w n i n t o t h e c h a n n e l t o c r e a t e t h e m o s t c o n s t r i c t e d p a r t o f the c h a n n e l a n d d e t e r m i n e t h e c h a r a c t e r i s t i c s ( s i z e a n d i o n s e l e c t i v i t y ) o f t h i s c h a n n e l ( N i k a i d o , 1 9 9 3 ) . 15 2. Synthesis and outer membrane insertion of porins P o r i n s a re s y n t h e s i z e d i n t h e c y t o p l a s m as p r e c u r s o r s w i t h N - t e r m i n a l s i g n a l s e q u e n c e s ( V a n G e l d e r et al, 1 9 9 7 ) . T h e y are t r a n s l o c a t e d a c r o s s t h e c y t o p l a s m i c m e m b r a n e a n d i n t o the p e r i p l a s m v i a t h e g e n e r a l s e c r e t o r y p a t h w a y i n a p r o c e s s that i n v o l v e s c l e a v a g e o f the s i g n a l p e p t i d e ( V a n G e l d e r et al, 1 9 9 7 ) . T h e p r o c e s s e s that o c c u r f o l l o w i n g s e c r e t i o n i n t o t h e p e r i p l a s m are n o t w e l l u n d e r s t o o d . T h e c u r r e n t m o d e l s u g g e s t s that t h e o n c e t h e p r o t e i n enters t h e p e r i p l a s m , t h e p r o t e i n f o r m s a t e r t i a r y o r q u a t e r n a r y s t r u c t u r e p r i o r t o s p o n t a n e o u s i n s e r t i o n i n t o the o u t e r m e m b r a n e ( V a n G e l d e r et al, 1 9 9 7 ) . O n e fea tu re o f p o r i n b i o g e n e s i s i s that m u t a t i o n s , w h i c h a d v e r s e l y a f f e c t p o r i n f o l d i n g i n the p e r i p l a s m r e s u l t i n p r o t e o l y s i s o f the p o r i n p r o t e i n i n t h e p e r i p l a s m . I n g e n e r a l , m u t a t i o n s , i n c l u d i n g l a r g e i n s e r t i o n s a n d d e l e t i o n s , a re t o l e r a t e d i n t h e l o o p r e g i o n s o f p o r i n s a n d d o n o t a f f e c t p r o t e i n f o l d i n g o r p r o c e s s i n g , b u t t h e s e m u t a t i o n s a re n o t t o l e r a t e d i n the t r a n s m e m b r a n e c o r e a n d t h e r e s u l t i n g p r o t e i n s a re p r o t e o l y z e d ( V a n G e l d e r et al, 1 9 9 7 ) . C o r r e c t l y a s s e m b l e d p o r i n s h a v e s e v e r a l d e f i n i t i v e b i o c h e m i c a l a n d i m m u n o l o g i c a l p r o p e r t i e s . V i r t u a l l y a l l p o r i n s h a v e a h i g h t h e r m a l s t a b i l i t y e v e n i n t h e p r e s e n c e o f de te rgent . I n the p r e s e n c e o f 2 % S D S , t e m p e r a t u r e s e x c e e d i n g 6 0 to 70°C are r e q u i r e d f o r d e n a t u r a t i o n o f t h e p o r i n p r o t e i n s ( V a n G e l d e r et al, 1 9 9 7 ) . T h u s m a n y p o r i n p r o t e i n s that a re s o l u b i l i z e d at t e m p e r a t u r e s b e l o w 60°C p r i o r t o e l e c t r o p h o r e s i s m i g r a t e s l o w e r (as f o l d e d t r i m e r s ) o r f as te r (as f o l d e d m o n o m e r s ) t h a n p o r i n s that a re s o l u b i l i z e d at t e m p e r a t u r e s e x c e e d i n g 6 0 to 70°C ( V a n G e l d e r et al, 1 9 9 7 ) . T h i s p r o p e r t y , t e r m e d heat m o d i f i a b i l i t y , i s a d e f i n i t i v e c h a r a c t e r i s t i c o f c o r r e c t l y f o l d e d p o r i n p r o t e i n s . M a n y p o r i n s are v e r y r e s i s t a n t t o p r o t e o l y s i s ( V a n G e l d e r et al, 1 9 9 7 ) . I n a d d i t i o n , m o n o c l o n a l a n t i b o d i e s r a i s e d a g a i n s t n a t i v e p o r i n s o f t e n r e c o g n i z e c o n f o r m a t i o n a l e p i t o p e s that are n o t p r e s e n t i n the d e n a t u r e d p r o t e i n ( V a n G e l d e r et al, 1 9 9 7 ) . 16 3. Structural analysis of porins B e c a u s e o f t h e i r c h a r a c t e r i s t i c P -barre l s t r u c t u r e , i t i s p o s s i b l e t o p r e d i c t t h e t o p o l o g y o f p o r i n s b a s e d o n t h e i r p r i m a r y a m i n o a c i d s e q u e n c e w i t h g r e a t e r a c c u r a c y t h a n f o r m o s t p r o t e i n s ( G r o m i h a et al, 1 9 9 7 ; G r o m i h a & P o n n u s w a m y , 1 9 9 3 ; H a n c o c k , 1 9 8 7 ; H a n c o c k , 1 9 9 7 ; J e a n t e u r et al, 1 9 9 1 ; V o g e l & J a h n i g , 1 9 8 6 ) . T h e s e m o d e l s c a n t h e n b e v e r i f i e d b y a v a r i e t y o f g e n e t i c m e t h o d s a i m e d at i d e n t i f y i n g t h e m e m b r a n e s p a n n i n g a n d s u r f a c e e x p o s e d r e g i o n s o f t h e n a t i v e p r o t e i n b y e p i t o p e i n s e r t i o n , p r o t e o l y t i c d e g r a d a t i o n s t u d i e s a n d p r o b i n g w i t h m o n o c l o n a l a n t i b o d i e s . S e v e r a l m e t h o d s e x i s t f o r p r e d i c t i n g the s t r u c t u r a l t o p o l o g y o f p - b a r r e l o u t e r m e m b r a n e p r o t e i n s . T h e m e t h o d o f P a u l & R o s e n b u s h ( 1 9 9 0 ) i s b a s e d o n i d e n t i f y i n g t h e p e r i p l a s m - f a c i n g l o o p r e g i o n s b y s e a r c h i n g f o r P -turn p r o m o t i n g a n d P -turn i n h i b i t i n g r e s i d u e s . V o g e l et al. ( 1 9 8 6 ) d e s i g n e d a m e t h o d f o r i d e n t i f y i n g a m p h i p a t h i c t r a n s m e m b r a n e s e g m e n t s b a s e d o n p r i m a r y a m i n o a c i d c o m p o s i t i o n . L a s t l y , the m e t h o d o f G r o m i h a et al. ( 1 9 9 3 ) i s b a s e d o n n e i g h b o r i n g h y d r o p h o b i c i t i e s a n d o t h e r i n f e r e n c e s f r o m a n a l y s i s o f the s o l v e d s t r u c t u r e s o f the c r y s t a l l i z e d p o r i n p r o t e i n s . N o n e o f the c u r r e n t p r e d i c t i o n m e t h o d s i s p e r f e c t , b u t t h e y s e r v e as a g o o d s t a r t i n g p o i n t f o r the a p p l i c a t i o n o f g e n e t i c e x p e r i m e n t s d e s i g n e d to test t h e t h e o r e t i c a l m o d e l s . O n e p r i m a r y s t r a t e g y u s e d to p r o b e the m e m b r a n e t o p o l o g y o f p o r i n p r o t e i n s i s b a s e d o n e p i t o p e i n s e r t i o n s i n t o t h e p r o t e i n o f i n t e r e s t ( B o u g e s - B o c q u e t et al, 1 9 8 4 ; B o u l a i n et al, 1 9 8 6 , B o s c h a n d T o m m a s s e n , 1 9 8 7 ; W o n g et al, 1 9 9 3 ) . I n g e n e r a l , m o s t e p i t o p e s a re d e s i g n e d to b e p e r m i s s i v e f o r t h e l o o p r e g i o n s b u t n o n p e r m i s s i v e f o r i n s e r t i o n i n t o t h e t r a n s m e m b r a n e c o r e o f t h e p o r i n o f i n te res t . T h u s i n s e r t i o n o f t h e e p i t o p e a l l o w s the d i s c r i m i n a t i o n o f l o o p v e r s u s t r a n s m e m b r a n e s e g m e n t s b a s e d o n w h e t h e r t h e p o r i n p r o t e i n i s p r o d u c e d . A d d i t i o n a l l y , 17 s p e c i f i c a n t i b o d i e s ( i f a v a i l a b l e ) d i r e c t e d a g a i n s t t h e i n s e r t e d e p i t o p e c a n b e u s e d to p r o b e p e r m i s s i v e ( i . e . , i n s e r t i o n s that d o n o t a f f e c t p r o t e i n p r o d u c t i o n ) c l o n e s a n d t o i d e n t i f y s u r f a c e e x p o s e d l o o p r e g i o n s o f the p o r i n b y i n d i r e c t i m m u n o f l u o r e s c e n c e ( W o n g et al., 1 9 9 3 ) . D . Rationale for this work H. pylori i s d i f f i c u l t t o t reat w i t h a n t i b i o t i c s i n i n f e c t e d i n d i v i d u a l s w h i c h i s i n c o n t r a s t to w h a t i s o b s e r v e d i n the l a b o r a t o r y w h e r e H. pylori i s v e r y s u s c e p t i b l e to m o s t a n t i b i o t i c s . B a s e d o n t h i s o b s e r v a t i o n , I h y p o t h e s i z e d that c h a n g e s i n c e l l p e r m e a b i l i t y , as h a s b e e n o b s e r v e d i n m a n y o t h e r b a c t e r i a , m a y f u n c t i o n i n H. pylori r e s i s t a n c e to a n t i b i o t i c s . T h e r e f o r e I s o u g h t to i d e n t i f y , u s i n g a b r o a d - b a s e d s c r e e n , H. pylori g e n e s that c o u l d p o t e n t i a l l y b e i n v o l v e d i n t h i s p h e n o t y p e ( i .e . o u t e r m e m b r a n e p r o t e i n s a n d e f f l u x g e n e s ) . T o i d e n t i f y s u c h g e n e s , t r a n s l a t i o n a l f u s i o n s o f H. pylori g e n e s to a l k a l i n e p h o s p h a t a s e w e r e m a d e to i d e n t i f y g e n e s w h o s e p r o d u c t s w e r e s e c r e t e d o r e x p o r t e d i n E. coli. T h e i n i t i a l s c r e e n i d e n t i f i e d th ree p o t e n t i a l H. pylori e f f l u x g e n e s o f t h e b a c t e r i a l r e s i s t a n c e - n o d u l a t i o n - d i v i s i o n f a m i l y . T h e s u b s e q u e n t c h a r a c t e r i z a t i o n o f t h e s e th ree e f f l u x s y s t e m s b y m e a l o n e a n d i n c o l l a b o r a t i o n w i t h A s t r a R e s e a r c h B o s t o n I n c . ( C a m b r i d g e , M A ) s u g g e s t e d that t h e s e e f f l u x s y s t e m s d o n o t f u n c t i o n i n t h e in vitro i n t r i n s i c r e s i s t a n c e o f H. pylori to a n t i b i o t i c s . P o r i n p r o t e i n s are i n v o l v e d i n the e x c h a n g e o f s m a l l h y d r o p h i l l i c c o m p o u n d s a c r o s s the b a c t e r i a l o u t e r m e m b r a n e . A s a c o n s e q u e n c e o f t h i s p r o p e r t y , p o r i n p r o t e i n s c a n a f f e c t c e l l s u s c e p t i b i l i t y t o a n t i b i o t i c s . E x n e r et al. ( 1 9 9 5 ) p r e v i o u s l y d e s c r i b e d the H o p f a m i l y o f f i v e p o r i n p r o t e i n s i n H. pylori b a s e d o n e x t e n s i v e N - t e r m i n a l a m i n o a c i d s i m i l a r i t y . P o r i n s f o u n d a m o n g t h i s f a m i l y w e r e c l a s s i f i e d as g e n e r a l d i f f u s i o n p o r i n s a n d are t h e r e f o r e l i k e l y to b e i n v o l v e d i n t h e u p t a k e o f a n t i b i o t i s b y H. pylori. 18 T h e H o p f a m i l y was f u r t h e r e x p a n d e d to i n c l u d e 3 2 p r o t e i n s c o n t a i n i n g e x t e n s i v e C -t e r m i n a l a m i n o a c i d s i m i l a r i t y b y T o m b et al. ( 1 9 9 7 ) . T h e s e q u e n c e c o n s e r v a t i o n a m o n g the H o p f a m i l y w a s s u g g e s t e d to p o s s i b l y f u n c t i o n i n h o m o l o g o u s r e c o m b i n a t i o n to g e n e r a t e a n t i g e n i c d i v e r s i t y a n d / o r i n r e s p o n s e to e n v i r o n m e n t a l c h a n g e s ( T o m b et al, 1 9 9 7 ; B e r g et al, 1 9 9 7 ) . H o w e v e r , c o m p a r a t i v e s e q u e n c e a n a l y s i s o f the H o p f a m i l y g e n e s i n t w o H. pylori s t r a i n s s u g g e s t e d that t h e c o n s e r v e d s e q u e n c e s d o n o t f u n c t i o n i n r e c o m b i n a t i o n ( H a n c o c k , et al 1 9 9 8 ) . T h e r e f o r e I p r o p o s e d a n d t e s t e d the h y p o t h e s i s that the c o n s e r v e d m o t i f s a re p a r t o f a c o n s e r v e d s t r u c t u r a l m o t i f . T h e o v e r a l l r e s u l t s o f t h e s e e x p e r i m e n t s s u p p o r t t h e h y p o t h e s i s that t h e c o n s e r v e d s e q u e n c e m o t i f s i n t h e H o p f a m i l y a re p a r t o f a c o n s e r v e d s t r u c t u r a l m o t i f . M A T E R I A L S A N D M E T H O D S I. S t r a i n s , p l a s m i d s a n d g r o w t h c o n d i t i o n s S t r a i n s u s e d i n t h e s e s t u d i e s are l i s t e d i n T a b l e I a n d a l l p l a s m i d s u s e d a re l i s t e d i n T a b l e II. E. coli s t r a i n s w e r e r o u t i n e l y g r o w n i n L u r i a B e r t a n i ( L B ) b r o t h ( 1 . 0 % T r y p t o n e , 0 . 5 % y e a s t e x t r a c t , 0 . 5 % N a C l ) c o n t a i n i n g 0 .5 % g l u c o s e ; f o r s o l i d m e d i a a g a r w a s a d d e d to 1 . 4 % ( w t / v o l ) . X P a g a r w a s L B a g a r c o n t a i n i n g 9 0 p g / m l 5 - b r o m o - 4 - c h l o r o - 3 - i n d o l y l p h o s p h a t e ; X P - P O 4 a g a r w a s X P a g a r c o n t a i n i n g 5 0 m M N a P 0 4 . H. pylori s t r a i n s w e r e g r o w n o n c h o c o l a t e b l o o d a g a r p l a t e s p u r c h a s e d from P r e p a r e d M e d i a L a b s ( R i c h m o n d , B C ) . B r a i n hear t i n f u s i o n b r o t h c o n t a i n i n g 0 . 1 % c y c l o d e x t r a n w a s u s e d f o r the g r o w t h o f H. pylori i n b r o t h . A l l m e d i a c o m p o n e n t s w e r e p u r c h a s e d from D i f c o L a b o r a t o r i e s ( D e t r o i t , M I ) . A n t i b i o t i c s w e r e u s e d f o r E. coli w h e n r e q u i r e d at t h e f o l l o w i n g c o n c e n t r a t i o n s : a m p i c i l l i n , 1 0 0 p g / m l ; c h l o r a m p h e n i c o l , 2 5 p g / m l ; t e t r a c y c l i n e , 15 p g / m l . 19 Table I B a c t e r i a l s t r a i n s . Strain: Relevant characteristics: Source/reference: E. coli: DH5a supEAA, /act/169 (<|> 80/acZM15), hsdR17, recAl, endAl, gyrA96, thi-1, relAl BRL DH5a-MCR F" mcrA A(mrr-hsdRMS-mcrBC) <(>80d/acZdM15 A{lacZYA-argF)Ul69 endAl recAl deoR thil supEAA X-gyrA96 relAl BRL BL21(DE3) hsdSgal (A,clts857 indl Sam7 nin5 Iacuv5-T7 gene 1) Promega JM110 dam, dcm, supEAA, thi, leu, rpsL, lacY, galK, galT, ara, tonA, thr, tsx (lac-proAB), F'[traD36 proAB+ laclq lacZM15] BRL CC118 phoA (Manoilef a/., 1990) ER1793 F- mcrA A(mrr-hsdRMS-mcrBC) endAl recAl deoR thil supE44 X-gyrA96 relAl NEB JZMIOO WC1763, AacrBv. Tn903kanr (Okusu etal., 1996) JZM120 WC1763, AacrAB:: Tn903kanr (Okusu etal., 1996) JZM130 WC1763, acrA::Tn903kanr (Okusu et al, 1996) WC1763 wildtype (Okusu etal, 1996) HN818 DH5a AacrAB H. Nikado HN817 DH5aacr5::Km H. Nikado H. pylori: 11637 Type strain NCTC 22695 Genome sequenced by TIGR K. Eaton J99 Genome sequence licenced to Astra Astra 744 Metronidizole resistant clinical isolate (Moore etal, 1995a) 754 Gyrase independent ciprofloxicin resistant clinical isolate (Moore etal, 1995b) 20 T a b l e II. L i s t o f p l a s m i d s . Plasmid: Relevant charactistics: Source/reference: p G W 2 5 p R K 4 0 4 c o n t a i n i n g t h e Pseudomonas syringae p v . syringae oprF:\Tr\phoA H a n c o c k l a b s t r a i n p L A P R 3 B r o a d - h o s t - r a n g e c o s m i d , t e t k ( S t a s k a w i c z et al, 1 9 8 7 ) p B B R l M C S B r o a d - h o s t - r a n g e c l o n i n g v e c t o r , C m K ( K o v a c h et al., 1 9 9 4 ) p T 7 - 7 T 7 R N A p o l y m e r a s e - p r o m o t e r e x p r e s s i o n v e c t o r , A m p k ( S t u d i e r & M o f f a t t , 1 9 8 6 ) p D J T l - 3 U s e d f o r t r a n s l a t i o n a l f u s i o n s to a l k a l i n e p h o s p h a t a s e . T h r e e s e p a r a t e v e c t o r s e a c h c o n t a i n i n g a u n i q u e BamHI r e s t r i c t i o n s i te u p s t r e a m a n d i n a d i f f e r e n t r e a d i n g f r a m e r e l a t i v e to 'phoA. A m p R ( M d l u l i et al, 1 9 9 5 ) p H P A P l - 2 3 3 Helicobacter pylori phoA f u s i o n s ( tab le x ) T h i s s t u d y p B S l h e f B C c l o n e d i n t o t h e EcoRI-EcoRV s i t e o f p B l u e s c r i p t T h i s s t u d y p B S 2 h e f C c l o n e d i n t o t h e EcoRI-EcoRV s i te o f p B l u e s c r i p t T h i s s t u d y p M C S l h e f B C c l o n e d i n t o t h e EcoRI-EcoRV s i t e o f p B B R l M C S T h i s s t u d y p M C S 2 h e f C c l o n e d i n t o the EcoRI-EcoRY s i te o f p B B R l M C S T h i s s t u d y p 2 0 0 : 4 p L A F R 3 l i b r a r y c l o n e c o n t a i n i n g the hemE-hefABC o p e r o n T h i s s t u d y p J l p B l u e s c r i p t c o n t a i n i n g hopE c l o n e d i n t o the EcoRV s i t e a n d i n t h e s a m e o r i e n t a t i o n as the lac p r o m o t e r . T h i s s t u d y p J 3 S a m e as p J l e x c e p t hopE i s c l o n e d i n the r e v e r s e o r i e n t a t i o n r e l a t i v e to the lac p r o m o t e r . U s e d f o r a n e g a t i v e c o n t r o l . T h i s s t u d y p J 5 p J l w i t h R S K D V i n s e r t e d i n t o H o p E a f te r a m i n o a c i d 155 ( b e t w e e n N D i n l o o p 5) T h i s s t u d y p J 6 p J l w i t h R S K D V i n s e r t e d i n t o H o p E a f te r a m i n o a c i d 2 6 0 ( b e t w e e n K R i n l o o p 8) T h i s s t u d y p J l O p J l w i t h R S K D V i n s e r t e d i n t o H o p E a f te r a m i n o a c i d 8 9 ( b e t w e e n G L i n T M 5 ) T h i s s t u d y p J 1 2 p J l w i t h R S K D V i n s e r t e d i n t o H o p E a f te r a m i n o a c i d 2 1 7 ( b e t w e e n W L i n T M 12) T h i s s t u d y p J 1 4 p J l w i t h a f o u r a m i n o a c i d d e l e t i o n i n H o p E l o o p 8 a n d t h e c o n c o m i t a n t i n s e r t i o n o f R S K D V ( A 2 6 2 - 2 6 5 : : R S K D V ) T h i s s t u d y p J 1 8 p J l w i t h R S K D V i n s e r t e d i n t o H o p E a f te r a m i n o a c i d 2 9 ( b e t w e e n Y I i n T M 1) T h i s s t u d y p J 2 0 p J l w i t h R S K D V i n s e r t e d i n t o H o p E a f te r a m i n o a c i d 2 6 5 ( b e t w e e n Y L i n l o o p 8) T h i s s t u d y p J 2 1 p J l w i t h R S K D V i n s e r t e d i n t o H o p E a f te r a m i n o a c i d 2 0 2 ( b e t w e e n N A i n l o o p 6 T h i s s t u d y p J 6 3 p J l w i t h R S K D V i n s e r t e d i n t o H o p E a f te r a m i n o a c i d 9 7 ( b e t w e e n F F i n l o o p 3 T h i s s t u d y 21 II. Reagents C h e m i c a l r e a g e n t s u s e d i n t h i s s t u d y w e r e p u r c h a s e d from S i g m a C h e m i c a l C o m p a n y (St . L o u i s , M O ) . R e s t r i c t i o n e n z y m e s , p o l y m e r a s e s a n d o t h e r m o l e c u l a r b i o l o g y r e a g e n t s w e r e p u r c h a s e d from G i b c o B R L ( B u r l i n g t o n , O N ) . A l l e n z y m e s w e r e u s e d as d e s c r i b e d i n t h e m a n u f a c t u r e r ' s i n s t r u c t i o n s . ^ - C h l o r a m p h e n i c o l (1 m C i / m l , 3 0 - 6 0 C i / m m o l ) a n d 3 H -t e t r a c y c l i n e (1 m C i / m l , 0 . 7 7 C i / m m o l ) w e r e p u r c h a s e d f r o m D u P o n t N E N ( B o s t o n , M A ) ; 3 2 P -l a b e l l e d A T P ( l O m C i / m l , - 3 0 0 0 C i / m m o l ) w a s p u r c h a s e d f r o m A m e r s h a m ( O a k v i l l e , O N ) . R a b b i t a n t i - H o p E p o l y c l o n a l a n t i b o d y ( V a c 3 8 ) w a s p r o v i d e d b y D r . R . A i m ( A s t r a R e s e a r c h I n c . , C a m b r i d g e , M A ) . A l k a l i n e p h o s p h a t a s e c o n j u g a t e d d o n k e y a n t i - r a b b i t a n t i b o d y w a s p u r c h a s e d from P r o m e g a ( M a d i s o n , W I ) . III. Genetic manipulations G e n e r a l m o l e c u l a r b i o l o g y p r o t o c o l s w e r e p e r f o r m e d a c c o r d i n g to s t a n d a r d m e t h o d s d e s c r i b e d i n S a m b r o o k et al. ( 1 9 8 9 ) . D N A f r a g m e n t s w e r e i s o l a t e d u s i n g t h e G e n e C l e a n k i t ( B i o l O l I n c . , V i s t a , C A ) . S t i c k y e n d l i g a t i o n s w e r e p e r f o r m e d at R T f o r 3 0 - 6 0 m i n ; b l u n t e n d l i g a t i o n s w e r e d o n e o v e r n i g h t i n a t h e r m o c y c l e r p r o g r a m m e d to c o n t i n u o u s l y c y c l e b e t w e e n 10°C a n d 30°C f o r 3 0 s e c at e a c h t e m p e r a t u r e . IV. DNA sequencing D N A s e q u e n c i n g w a s d o n e o n a n A B I 3 7 3 a u t o m a t e d D N A s e q u e n c e r ( A p p l i e d B i o s y s t e m s , F o s t e r C i t y , C A ) u s i n g the A B I P r i s m d y e t e r m i n a t o r s e q u e n c i n g k i t a c c o r d i n g to t h e m a n u f a c t u r e r ' s d i r e c t i o n s . P l a s m i d D N A w a s p r e p a r e d f o r s e q u e n c i n g u s i n g Q i a g e n c o l u m n s ( Q i a g e n , I n c . , C h a t s w o r t h , C A ) a n d p l a s m i d D N A w a s q u a n t i f i e d u s i n g a H o e f e r T K O 1 0 0 m i n i s p e c t r o f l u o r i m e t e r . O l i g o n u c l e o t i d e s e q u e n c i n g p r i m e r s w e r e s y n t h e s i z e d as n e e d e d o n a n A B I 3 9 2 D N A / R N A o l i g o n u c l e o t i d e s y n t h e s i z e r a c c o r d i n g to t h e m a n u f a c t u r e r ' s 22 d i r e c t i o n s . O l i g o n u c l e o t i d e p r i m e r s w e r e p u r i f i e d as f o l l o w s : f o l l o w i n g d e p r o t e c t i o n f o r 8 h at 55°C, t h e o l i g o n u c l e o t i d e s w e r e l y o p h i l i z e d a n d r e s u s p e n d e d i n 5 0 0 u.1 d e i o n i z e d w a t e r . T h e r e s u s p e n d e d o l i g o n u c l e o t i d e w a s c e n t r i f u g e d f o r 5 m i n at m a x i m u m s p e e d ( - 1 0 , 0 0 0 x g ) i n a m i c r o c e n t r i f u g e to r e m o v e i n s o l u b l e m a t e r i a l a n d the s u p e r n a t a n t w a s r e t a i n e d . T h e c o n c e n t r a t i o n o f o l i g o n u c l e o t i d e w a s d e t e r m i n e d b y m e a s u r i n g the a b s o r b a n c e at 2 6 0 n m . V. Protein analysis A n a l y s i s o f p r o t e i n p r o f i l e s w a s d o n e b y e l e c t r o p h o r e s i s t h r o u g h S D S 1 2 % -p o l y a c r y l a m i d e g e l s ( P A G E ) ( M u t h a r i a & H a n c o c k , 1 9 8 3 ) . P r o t e i n s w e r e s o l u b i l i z e d i n s a m p l e b u f f e r (0 .5 M T r i s - H C l b u f f e r , p H 6 .8 , c o n t a i n i n g 2 % S D S , 1 0 % g l y c e r o l , 5 % P-m e r c a p t o e t h a n o l a n d 0 . 1 % b r o m o p h e n o l b l u e ) f o r e i t h e r 10 m i n at 98°C o r 2 0 m i n at 37°C b e f o r e b e i n g a p p l i e d t o the g e l . F o l l o w i n g e l e c t r o p h o r e s i s p r o t e i n s w e r e v i s u a l i z e d b y s t a i n i n g w i t h C o o m a s s i e B r i l l i a n t B l u e R 2 5 0 ( B i o - R a d , R i c h m o n d , C A ) . I m m u n o b l o t t i n g p r o c e d u r e s w e r e p e r f o r m e d as d e s c r i b e d p r e v i o u s l y ( M u t h a r i a & H a n c o c k , 1 9 8 3 ) . V a c 3 8 a n t i b o d y w a s u s e d at a 1 : 5 0 0 0 d i l u t i o n f o r W e s t e r n i m m u n o b l o t t i n g . P r o t e i n c o n c e n t r a t i o n s w e r e d e t e r m i n e d u s i n g the b i c i n c h o n i n i c a s s a y a c c o r d i n g to the m a n u f a c t u r e r ' s d i r e c t i o n s ( S i g m a , S t . L o u i s , M O ) . B S A w a s u s e d as a s t a n d a r d . VI. Construction of a Helicobacterpylorfr2^3^^ phosphatase fusion library H. pylori 1 1 6 3 7 c h r o m o s o m a l D N A w a s p a r t i a l l y r e s t r i c t e d w i t h r e s t r i c t i o n e n z y m e Sau3A1 a n d s i z e f r a c t i o n a t e d o n a c o n t i n u o u s 1 0 - 4 0 % s u c r o s e g r a d i e n t . D N A r e s t r i c t i o n f r a g m e n t s o f a p p r o x i m a t e l y 2 k b i n s i z e w e r e l i g a t e d i n t o BamHI d i g e s t e d a n d p h o s p h a t a s e d p J D T l , p J D T 2 , a n d p J D T 3 ( F i g u r e 3) . T h e l i g a t i o n r e a c t i o n s w e r e u s e d f o r t h e t r a n s f o r m a t i o n o f e i t h e r E. coli E R 1 7 9 3 o r E. coli C C 118 . A l k a l i n e p h o s p h a t a s e e x p r e s s i n g t r a n s f o r m a n t s w e r e i d e n t i f i e d o n X P - P O 4 agar . T h e a l k a l i n e p h o s p h a t a s e e x p r e s s i n g c l o n e s w e r e s c r e e n e d f o r 23 D N A i n s e r t s b y BamHI r e s t r i c t i o n e n z y m e d i g e s t i o n a n d c l o n e s c o n t a i n i n g i n s e r t s w e r e f u r t h e r s c r e e n e d b y D N A s e q u e n c i n g . VII. Inhibition of endogenous alkaline phosphatase activity in Escherichia coli ER1793 T h e c o n c e n t r a t i o n o f p h o s p h a t e i n t h e g r o w t h m e d i a that w a s r e q u i r e d to c o m p l e t e l y i n h i b i t t h e b a c k g r o u n d ( c h r o m o s o m a l l y e n c o d e d ) p h o s p h a t a s e a c t i v i t y i n E. coli E R 1 7 9 3 w a s d e t e r m i n e d b y p l a t i n g E. coli E R 1 7 9 3 a n d E R 1 7 9 3 / p G W 2 5 o n t o X P a g a r c o n t a i n i n g 0 , 2 5 , 5 0 o r 1 0 0 m M NaPC>4 ( p H 7 .2) . T h e r e s u l t i n g b a c t e r i a l c o l o n i e s w e r e e x a m i n e d f o l l o w i n g i n c u b a t i o n f o r 2 4 h at 37°C f o r the e x p r e s s i o n o f p h o s p h a t a s e a c t i v i t y . VIII. The effect of 50 m M NaP0 4 in XP agar on the detection sensitivity for alkaline phosphatase. T h e i n h i b i t o r y e f f e c t o f the e x c e s s p h o s p h a t e i n X P a g a r o n the d e t e c t i o n s e n s i t i v i t y f o r a l k a l i n e p h o s p h a t a s e i n m y s c r e e n i n g m e t h o d w a s d e t e r m i n e d i n t h e f o l l o w i n g w a y . A s e r i a l 2 -f o l d d i l u t i o n o f b a c t e r i a l a l k a l i n e p h o s p h a t a s e w a s m a d e i n 5 0 m M T r i s - H C l ( p H 8 .5 ) , 1 m M E D T A a n d 2 u.L a l i q u o t s f r o m e a c h d i l u t i o n w a s s p o t t e d o n t o t h e s u r f a c e o f b o t h X P - P O 4 a n d X P agar . F o l l o w i n g a n 18 h i n c u b a t i o n at 37°C the p l a t e s w e r e e x a m i n e d a n d t h e h i g h e s t d i l u t i o n o f a l k a l i n e p h o s p h a t a s e that p r o d u c e d a v i s i b l e b l u e c o l o r o n t h e s u r f a c e o f the a g a r w a s r e c o r d e d . 24 F i g u r e 3. S c h e m a t i c o f p l a s m i d s p D J T l , p D J T 2 a n d p D J T 3 . T h e s e p l a s m i d v e c t o r s a l l o w the t r a n s l a t i o n a l f u s i o n o f g e n e s to a s i g n a l s e q u e n c e - d e f i c i e n t E. coli a l k a l i n e p h o s p h a t a s e g e n e ('phoA). T h e a l k a l i n e p h o s p h a t a s e e n z y m e i s o n l y a c t i v e w h e n t r a n s p o r t e d a c r o s s t h e c y t o p l a s m i c m e m b r a n e a n d t h e r e f o r e f a c i l i t a t e s the i d e n t i f i c a t i o n o f s e c r e t e d a n d e x p o r t e d p r o t e i n s . T h e v e c t o r s c o n t a i n a u n i q u e BamHI r e s t r i c t i o n s i t e u p s t r e a m o f a 'phoA w h i c h i s i n a d i f f e r e n t r e a d i n g frame r e l a t i v e to phoA i n e a c h o f the t h r e e v e c t o r s . T h e c o n s t r u c t i o n o f these v e c t o r s i s d e s c r i b e d i n M d l u l i et al. ( 1 9 9 6 ) . 25 IX. DNA sequencing and analysis of //^/^/-alkaline phosphatase fusion clones T h e H. ^ v / o n ' - a l k a l i n e p h o s p h a t a s e f u s i o n c l o n e s w e r e s e q u e n c e d u s i n g t h e 'phoA o l i g o n u c l e o t i d e p r i m e r . T h i s p r i m e r w a s c o m p l e m e n t a r y to t h e phoA D N A s e q u e n c e l o c a t e d a p p r o x i m a t e l y 3 0 b p u p s t r e a m o f the u n i q u e BamHI s i t e i n p l a s m i d s p J D T l , p J D T 2 a n d p J D T 3 , a n d d i r e c t e d s e q u e n c i n g a c r o s s the BamHI f u s i o n j u n c t i o n a n d i n t o t h e i n s e r t e d H. pylori D N A . T h e r e s u l t i n g D N A s e q u e n c e s w e r e u s e d f o r h o m o l o g y s e a r c h e s o f t h e N a t i o n a l C e n t e r f o r B i o t e c h n o l o g y I n v e s t i g a t i o n ( N C B I ) n o n - r e d u n d a n t d a t a b a s e w i t h t h e B L A S T X p r o g r a m ( w w w . n c b i . n l m . n i h . g o v / c g i - b i n / B L A S T / ) . T h e d e f a u l t s e t t i n g s f o r t h e B L A S T X p r o g r a m w e r e u s e d f o r a l l t h e s e a r c h e s . X. Cloning of the hefABC operon T h e D N A i n s e r t f r o m H. pylori a l k a l i n e p h o s p h a t a s e f u s i o n c l o n e 2 0 0 ( T a b l e I) w a s u s e d as a h y b r i d i z a t i o n p r o b e to s u b c l o n e the c o r r e s p o n d i n g l o c u s from a H. pylori 1 1 6 3 7 g e n o m i c l i b r a r y that w a s c o n s t r u c t e d i n the c o s m i d p L A F R 3 . S e v e r a l l i b r a r y c l o n e s h y b r i d i z e d to t h e p r o b e . R e s t r i c t i o n m a p p i n g i n c o n j u n c t i o n w i t h h y b r i d i z a t i o n e x p e r i m e n t s u s i n g t h e p r o b e from H. pylori a l k a l i n e p h o s p h a t a s e f u s i o n c l o n e 2 0 0 i d e n t i f i e d c o s m i d c l o n e p 2 0 0 : 4 as c o n t a i n i n g the e n t i r e hefABC l o c u s . C o s m i d p 2 0 0 : 4 w a s s u b s e q u e n t l y u s e d f o r s u b c l o n i n g a n d D N A s e q u e n c i n g o f hefABC. XI. DNA sequencing of the nefABC ° P e r o n T h e D N A s e q u e n c e o f t h e hefABC o p e r o n o f H. pylori 1 1 6 3 7 w a s g e n e r a t e d b y s h o t g u n s e q u e n c i n g o f r a n d o m s u b c l o n e s o f c o s m i d c l o n e 2 0 0 : 4 w h i c h c o n t a i n e d t h e hefABC e f f l u x s y s t e m . C o s m i d p 2 0 0 : 4 w a s p a r t i a l l y r e s t r i c t e d w i t h Sau3A\ r e s t r i c t i o n e n z y m e a n d the r e s u l t i n g D N A w a s s i z e f r a c t i o n a t e d o n a n a g a r o s e g e l . R e s t r i c t i o n f r a g m e n t s o f a p p r o x i m a t e l y 2 - 3 k b i n l e n g t h w e r e p u r i f i e d a n d l i g a t e d i n t o BamHI - d i g e s t e d p B l u e s c r i p t . T h e r e s u l t a n t 26 r e c o m b i n a n t c l o n e s w e r e s c r e e n e d i n h y b r i d i z a t i o n e x p e r i m e n t s u s i n g the D N A i n s e r t f r o m H. pylori a l k a l i n e p h o s p h a t a s e f u s i o n c l o n e 2 0 0 as a p r o b e . T h e c l o n e s that r e a c t e d p o s i t i v e l y w i t h t h e p r o b e w e r e s e q u e n c e d w i t h t h e u n i v e r s a l r e v e r s e a n d f o r w a r d p r i m e r s . T h e r e m a i n i n g D N A s e q u e n c e g a p s w e r e f i l l e d i n b y p r i m e r w a l k i n g u s i n g p 2 0 0 : 4 as a t e m p l a t e . S e q u e n c e a s s e m b l y w a s f a c i l i t a t e d b y t h e u s e o f the C o n t i g A l i g n m e n t P r o g r a m ( H u a n g , 1 9 9 2 ) . T h e r e s u l t i n g D N A s e q u e n c e s c o v e r e d t h e hefABC o p e r o n at l e a s t t w i c e o n e a c h D N A s t r a n d . T h e D N A s e q u e n c e o f t h e hefABC o p e r o n w a s a s s i g n e d t h e G e n B a n k a c c e s s i o n n u m b e r A F 0 5 9 0 4 1 . XII. Uptake of 3H-tetracycline, 3H-chloramphenicol and 1-N-phenylnapthylamine. T w o d a y c u l t u r e s ofH. pylori 1 1 6 3 7 , g r o w n o n c h o c o l a t e b l o o d a g a r p l a t e s w e r e r e s u s p e n d e d i n P B S , w a s h e d o n c e i n 5 m M H E P E S b u f f e r p H 7 .2 c o n t a i n i n g 10 u M M g C l 2 a n d r e s u s p e n d e d at a n OD600 o f 0 .5 i n 5 m M g l u c o s e , 5 m M H E P E S b u f f e r at e i t h e r p H 4 , p H 7 .2 o r p H 9 ; t h e c e l l s u s p e n s i o n w a s a l i q u o t e d a n d u s e d i m m e d i a t e l y i n t h e u p t a k e a s s a y s . C a r b o n s o u r c e s w e r e a d d e d w h e n n e e d e d at a f i n a l c o n c e n t r a t i o n o f 0 . 4 % (acetate , c i t r a t e , e t h a n o l , f r u c t o s e , g l u c o n a t e , g l u c o s e , g l y c e r o l , l a c t o s e , m a l t o s e , m a n n i t o l , m a n n o s e , p r o p i o n a t e , s u c c i n a t e a n d s u c r o s e ) o r 0 . 2 % ( a l a n i n e , g l y c i n e , h i s t i d i n e a n d p r o l i n e ) a n d the r e s u l t i n g c e l l s u s p e n s i o n w a s i n c u b a t e d at 37°C f o r 2 0 m i n p r i o r t o a s s a y i n i t i a t i o n . W h e n r e q u i r e d c a r b o n y l c y a n i d e m - c h l o r o p h e n y l h y d r a z o n e ( C C C P ) w a s a d d e d to a f i n a l c o n c e n t r a t i o n o f 4 0 u . M , 15 m i n p r i o r t o a s s a y i n i t i a t i o n . T h e a n t i b i o t i c u p t a k e a s s a y s w e r e i n i t i a t e d b y the a d d i t i o n o f a p p r o x i m a t e l y 3 u .C i o f r a d i o l a b e l e d a n t i b i o t i c to a 5 0 0 p.1 s u s p e n s i o n o f the c e l l s . A t v a r i o u s t i m e p o i n t s , 1 0 0 u l a l i q u o t s w e r e r e m o v e d f r o m t h e r e a c t i o n a n d a d d e d to 2 m l o f 1 0 0 m M L i C l a n d t h e c e l l s w e r e v a c u u m - f i l t e r e d o n t o a 0 .2 u m f i l t e r . T h e f i l t e r w a s w a s h e d t w i c e w i t h 2 m l o f 1 0 0 m M L i C l , 27 d r i e d a n d t h e a m o u n t o f r a d i o a c t i v i t y o n t h e f i l t e r w a s d e t e r m i n e d b y s c i n t i l l a t i o n c o u n t i n g . A n t i b i o t i c u p t a k e a s s a y s w e r e p e r f o r m e d at 25°C. T h e 1 - N - p h e n y l n a p t h y l a m i n e ( N P N ) u p t a k e a s s a y s w e r e p e r f o r m e d as d e s c r i b e d p r e v i o u s l y ( L o h et al, 1 9 8 4 ) . B r i e f l y , 1 m l o f the H. pylori c e l l s u s p e n s i o n w a s p l a c e d i n a q u a r t z c u v e t t e a n d N P N w a s a d d e d to a f i n a l c o n c e n t r a t i o n o f 10 p M . T h e c e l l s u s p e n s i o n w a s b r i e f l y m i x e d b y i n v e r s i o n a n d p l a c e d i n t o a s p e c t r o f l u o r i m e t e r to d e t e r m i n e t h e b a c k g r o u n d l e v e l o f f l u o r e s c e n c e . S u b s e q u e n t l y p o l y m y x i n B w a s a d d e d to t h e c u v e t t e , t h e c o n t e n t s o f t h e c u v e t t e w e r e b r i e f l y m i x e d a n d p l a c e d b a c k i n t o the f l u o r i m e t e r a n d t h e c h a n g e i n f l u o r e s c e n c e o v e r t i m e w a s r e c o r d e d o n a c h a r t r e c o r d e r . T h e f l u o r e s c e n c e m e a s u r e m e n t s w e r e d o n e o n a P e r k i n - E l m e r 6 5 0 - 1 0 S s p e c t r o f l u o r i m e t e r at r o o m t e m p e r a t u r e w i t h a n e x c i t a t i o n w a v e l e n g t h o f 3 5 0 n m , a n e m i s s i o n w a v e l e n g t h o f 4 2 0 n m a n d a s l i t w i d t h o f 5. X I V . D N A a n d p r o t e i n s e q u e n c e a n a l y s i s P a i r w i s e s e q u e n c e a l i g n m e n t s w e r e p e r f o r m e d u s i n g t h e A L I G N p r o g r a m at t h e G e n e s t r e a m S e a r c h n e t w o r k s e r v e r ( g e n o m e . e e r i e . f r / b i n / a l i g n - g u e s s . c g i , M o n t p e l l i e r , F r a n c e ) . P h y l o g e n e t i c a n a l y s i s w a s d o n e w i t h t h e P H Y L I P p h y l o g e n y i n f e r e n c e p a c k a g e ( F e l s e n s t e i n , J . 1 9 9 3 . D i s t r i b u t e d b y t h e a u t h o r . D e p a r t m e n t o f G e n e t i c s , U n i v e r s i t y o f W a s h i n g t o n , Sea t t l e ) . P h y l o g e n e t i c t rees w e r e c o n s t r u c t e d u s i n g the n e a r e s t n e i g h b o r d i s t a n c e m a t r i x . B L O C K S a l i g n m e n t s w e r e d o n e u s i n g t h e M a c a w c o m p u t e r p r o g r a m ( d i s t r i b u t e d b y N C B I , W a s h i n g t o n D C , w w w . n c b i . n l m . n i h . g o v ) . M u l t i p l e s e q u e n c e a l i g n m e n t s w e r e m a d e w i t h t h e C l u s t a l W ( v l . 7 ) p r o g r a m ( T h o m p s o n et al, 1 9 9 4 ) . X V . C l o n i n g oi hefBC a n d hefC T h e hefBC a n d hefC g e n e s w e r e c l o n e d i n t o t h e h i g h - c o p y - n u m b e r p h a g e m i d p B l u e s c r i p t a n d t h e m e d i u m - c o p y - n u m b e r v e c t o r p B B R l M C S . P r i m e r s P I a n d P 2 w e r e 28 d e s i g n e d w i t h a u n i q u e 5'-BamHl r e s t r i c t i o n s i t e to f a c i l i t a t e c l o n i n g i n t o p B l u e s c r i p t a n d p B B R l M C S . T h e d o w n s t r e a m p r i m e r , P 3 , c o n t a i n e d a u n i q u e . E c o R V r e s t r i c t i o n s i te . F o r c l o n i n g i n t o p B l u e s c r i p t a n d p B B R l M C S t h e hefBC a n d hefC g e n e s w e r e a m p l i f i e d b y P C R f r o m c o s m i d p 2 0 0 : 4 u s i n g P C R p r i m e r sets P 1 / P 3 a n d P 2 / P 3 r e s p e c t i v e l y . F o l l o w i n g a m p l i f i c a t i o n t h e p u r i f i e d P C R a m p l i c o n w a s d i g e s t e d u s i n g r e s t r i c t i o n e n d o n u c l e a s e s BamHI a n d EcoKV a n d c l o n e d i n t o s i m i l a r l y d i g e s t e d p B l u e s c r i p t a n d p B B R l M C S r e s u l t i n g i n p B S l {hefBC), p B S 2 (hefC), p M C S l (hefBC) a n d p M C S 2 (hefC), r e s p e c t i v e l y . X V I . C o m p l e m e n t a t i o n o f K c o U a c r B a n d a c r A B m u t a n t s w i t h nefBQ a n d hefC C o s m i d 2 0 0 : 4 a n d p l a s m i d s B S 1 , B S 2 , M C S 1 a n d M C S 2 w e r e t r a n s f o r m e d i n t o the f o l l o w i n g E. coli s t r a i n s : D H 5 a W C 1 7 6 3 , J Z M 1 0 0 , J Z M 1 2 0 , J Z M 1 3 0 , F T N 8 1 8 a n d F T N 8 1 7 . T h e r e s u l t a n t s t r a i n s w e r e u s e d i n m i n i m u m i n h i b i t o r y c o n c e n t r a t i o n e x p e r i m e n t s t o d e t e r m i n e the e f f e c t o f t h e p r e s e n c e o f e a c h o f t h e s e p l a s m i d s o n t h e s u s c e p t i b i l i t y o f t h e r e s u l t i n g s t r a i n s to a n t i m i c r o b i a l c o m p o u n d s . T e s t e d c o m p o u n d s i n c l u d e d the f o l l o w i n g : a m p i c i l l i n , a z i t h r o m y c i n , C C C P , c h l o r o a m p h e n i c o l , c i p r o f l o x i c i n , c l a r i t h r o m y c i n , C0CI2 , c r y s t a l v i o l e t , e r y t h r o m y c i n , g e n t a m y c i n , k a n a m y c i n , m e t r o n i d i z o l e , n e o m y c i n , M O 2 , S D S , t e t r a c y c l i n e a n d T r i t o n X - 1 0 0 . T h e M I C s w e r e d o n e i n L B b r o t h p l u s a n d m i n u s 1 0 0 m M I P T G . C o n t r o l s t r a i n s c o n t a i n e d t h e p l a s m i d a n d c o s m i d v e c t o r s . X V I . C l o n i n g o f h o p E T h e hopE g e n e w a s a m p l i f i e d f r o m the c h r o m o s o m e o f H. pylori u s i n g p r i m e r s F 2 a n d F 0 a n d b l u n t e n d c l o n e d i n t o the . E c o R V s i te o f p B l u e s c r i p t . T h e e n d s o f t h e F 2 / F 0 D N A a m p l i c o n w e r e m a d e b l u n t b y i n c u b a t i o n w i t h K l e n o w D N A p o l y m e r a s e , a n d t h i s a m p l i c o n w a s t h e n l i g a t e d i n t o t h e . E c o R V s i t e o f p B l u e s c r i p t . T h e l i g a t i o n p r o d u c t s w e r e t r a n s f o r m e d i n t o E. coli J M 1 1 0 . T h e r e s u l t i n g t r a n s f o r m a n t s w e r e s c r e e n e d b y r e s t r i c t i o n a n a l y s i s . P l a s m i d s J l a n d 29 J 3 w e r e i d e n t i f i e d as c o n t a i n i n g the hopE g e n e i n the s a m e ( p J l ) a n d r e v e r s e o r i e n t a t i o n ( p J 3 ) r e l a t i v e to t h e lac p r o m o t e r . P l a s m i d J l w a s s e q u e n c e d o n b o t h s t r a n d s t o c o n f i r m that t he re w e r e n o e r r o r s i n t h e D N A s e q u e n c e . P r i m e r s F 3 a n d F O w e r e u s e d to c l o n e hopE i n t o p T 7 - 7 . T h e F 3 / F 0 a m p l i c o n w a s d i g e s t e d w i t h EcoRI a n d Ndel r e s t r i c t i o n e n z y m e s a n d l i g a t e d i n t o s i m i l a r l y d i g e s t e d p T 7 - 7 . T h e l i g a t i o n p r o d u c t s w e r e t r a n s f o r m e d i n t o E. coli J M 1 1 0 . T h e r e s u l t i n g t r a n s f o r m a n t s w e r e s c r e e n e d b y r e s t r i c t i o n a n a l y s i s . P l a s m i d J 2 6 w a s i d e n t i f i e d as c o n t a i n i n g t h e hopE g e n e a n d the s e q u e n c e i n t e g r i t y o f hopE i n t h i s p l a s m i d w a s c o n f i r m e d b y D N A s e q u e n c i n g . XVII. Protein expression E x p r e s s i o n o f hopE i n r e c o m b i n a n t c l o n e s w a s p e r f o r m e d as f o l l o w s . A n o v e r n i g h t c u l t u r e o f E. coli J M 1 1 0 (E. coli B L 2 1 ( D E 3 ) f o r p J 2 6 ) c o n t a i n i n g t h e s p e c i f i e d p l a s m i d s a n d g r o w n at 37°C i n L B b r o t h p l u s 0 . 5 % g l u c o s e w a s u s e d t o i n o c u l a t e a f r e s h c u l t u r e o f L B b r o t h w i t h o u t g l u c o s e . T h e c u l t u r e w a s i n c u b a t e d o n a r o t a r y s h a k e r at 37°C. E x p r e s s i o n o f hopE w a s i n d u c e d w h e n t h e c u l t u r e r e a c h e d a n OD600 o f a p p r o x i m a t e l y 0 .6 b y t h e a d d i t i o n o f I P T G to a f i n a l c o n c e n t r a t i o n o f 1 0 0 u M . T h e c e l l s w e r e u s u a l l y h a r v e s t e d 3 - 4 h a f t e r i n d u c t i o n . XVIII. Construction of nQp£ insertion mutants P C R p r i m e r s ( T a b l e I I I ) w e r e d e s i g n e d to i n s e r t i n f r a m e f i v e a m i n o a c i d s ( R S K D V ) a n d t w o u n i q u e r e s t r i c t i o n e n z y m e s i tes i n t o hopE ( F i g u r e 4 ) , u s i n g p J l as t h e t e m p l a t e D N A . T h e P C R a m p l i f i c a t i o n w a s p e r f o r m e d w i t h T a q D N A p o l y m e r a s e u s i n g a t o u c h d o w n a m p l i f i c a t i o n p r o c e d u r e as f o l l o w s . T h e P C R t h e r m o c y c l e r w a s p r o g r a m m e d f o r a n i n i t i a l d e n a t u r a t i o n s tep o f 96°C f o r 4 m i n f o l l o w e d b y 18 c y c l e s u s i n g a n i n i t i a l a n n e a l i n g t e m p e r a t u r e o f 65°C ( f o r 9 0 s e c ) w h i c h w a s d e c r e a s e d b y 0.5°C e a c h s u c c e s s i v e c y c l e , a n e x t e n s i o n at 72°C f o r 6 m i n a n d d e n a t u r a t i o n at 96°C f o r 1 m i n . S u b s e q u e n t t o c o m p l e t i o n o f 30 t h e f i r s t 18 c y c l e s , a n a d d i t i o n a l 14 a m p l i f i c a t i o n c y c l e s w e r e p e r f o r m e d u s i n g 72°C e x t e n s i o n a n d 96°C d e n a t u r a t i o n s teps w i t h a c o n s t a n t 55°C a n n e a l i n g t e m p e r a t u r e . T h e r e s u l t i n g a m p l i c o n w a s e x t r a c t e d w i t h p h e n o l a n d c h l o r o f o r m , p r e c i p i t a t e d w i t h e t h a n o l a n d m a d e b l u n t b y d i g e s t i o n w i t h t h e K l e n o w f r a g m e n t o f D N A p o l y m e r a s e . T h e P C R p r o d u c t s w e r e d i g e s t e d w i t h Dpnl r e s t r i c t i o n e n z y m e to r e m o v e t h e t e m p l a t e D N A , r e l i g a t e d a n d t r a n s f o r m e d i n t o E. coli J M 1 1 0 . R e c o m b i n a n t c l o n e s w e r e i d e n t i f i e d b y u s i n g o l i g o n u c l e o t i d e p r i m e r n u m b e r 10 p l u s t h e r e v e r s e p r i m e r i n P C R a m p l i f i c a t i o n r e a c t i o n s . I d e n t i f i e d c l o n e s w e r e s e q u e n c e d to v e r i f y that t h e i n s e r t e d a m i n o a c i d s w e r e i n frame a n d that n o e r r o r s w e r e i n t r o d u c e d i n t o the hopE g e n e . X I X . S t r u c t u r a l p r e d i c t i o n o f H o p E T h e p r o p o s e d s t r u c t u r a l m o d e l f o r H o p E w a s c o n s t r u c t e d u s i n g t h e c o n f o r m a t i o n a l p a r a m e t e r s a n d a l g o r i t h m o f G r o m i h a et al. ( 1 9 9 7 ) . 31 T a b l e III. O l i g o n u c l e o t i d e p r i m e r s u s e d . PRIMER: DNA Sequence: ' phoA ATCACCCGTTAAACGGCGAGCAC h e l l CTAGCCCTGAAGAAATGGAAAACAACATCG hel2 CCTTGCCATGTCATTAAAATCCG hel3 TCAAATCCAGCGTGATGTAGTAGCCG hel4 ATTTATCCCCCAAATCAATGAAGGGG E9 TTGGATCCACATTAGGCTTACCCACT FO CCGAATTCTAAAGGCATGAACGCTTGCA F2 AAGGATCCGATAGGAATGTAAAGGAATGG F3 TAAAGGAATGGAACATATGAAAAAG F4 GGACAAGCCCGTTTGAATAG F5 GGCATGCCACTTTAGGCAAG F6 GCACCAAAACTTCAACCGTC G2 GTTCTTTCGCTTATCAGGACCCTTAGCTTCAATGATTTG G3 GCGAATCCGAATGTTTGTACCCCTACTTATTGTAACCCT G4 AGGACGTCGATAACGCTTCTTTTGGTATTTTTGGT G5 T AGAT CT GT T AT C AAT AAT AT C AGCT AAC AAAT C G6 AGGACGTCCGGGATTATTCGCTTTATTTAGGTTAT G7 TAGATCTTTTCAATTGTTAATAAAGATTAGTAGC G8 AGGACGTACTAGGGACTAATTATCAGCTTGGACAA G9 TAGATCTATAAACACCATCACCTTCGGCTAACAA HO AGGACGTCTTGAATGTGGGTTATAAGAAGTTCTTC HI TAGATCTCCCAAGACCATTCAAAGCCCCATTAGC H2 AGGACGTCTTGAATTTTGGGGTGAGAGCCAATATT H3 TAGATCTCCATACCTGAAAAGCGACGGTTGAAGT H4 AGGACGTCTATTTAGGGTATAACTACACTTTTTAA H5 TAGATCTCCGTTTCAAATGGTAATAAAGATTAGT H6 AGGACGTCTTCTTCCAGTTCAAGTCTTTTGATATG • H7 TAGATCTCTTCTTATAACCCACATTCAACCCAAG H8 AGGACGTCGCTCCTTATAGCACCAAAACTTCAACC H9 TAGATCTGTTACAATAAGTAGGGGTACAGTTAGG 10 AGATCTAAGGACGTC 11 AGGACGTCAAGCATAATCCAGGAGGCACCAAT 12 TAGATCTATTAGCGGTAAGACCTGGGGGGCA PI GGAATTCCATATGTGCATTAAGGGAGTGGAAATGAT P2 GGAATTCCATATGTATAAAACAGCGATTAATCGTC P3 AAGATATCAAGCCCGCCCATAAAGCCAA SK CCGCTCTAGAACTAGTGGATC KS CCCTCGAGGTCGACGGTATC UNI TGTAAAACGACGGCCAGT REV CAGGAAACAGCTATGACC hopE l P 2 * I 1. Amplify with Taq DNA polymerase "pJT hopE I 2. Treat with Klenow DNA polymerase 3. Religate 4. Digest withOpnl restriction enzyme 5. Electroporate intof. co//JM110 6. Verify insertions by DNA sequencing hopE Bga R S K D V pJT F i g u r e 4. M e t h o d f o r t h e i n s e r t i o n a l m u t a g e n e s i s o f hopE g e n e i n p l a s m i d J l . B a c k - t o - b a c k P C R p r i m e r s ( l a b e l l e d P I a n d P 2 a b o v e ) c o n t a i n i n g a 5' t a i l c o d i n g f o r t h e a m i n o a c i d s R S K D V a n d t w o u n i q u e r e s t r i c t i o n s i tes (BgRl a n d Aatll) w e r e d e s i g n e d to s i t e s p e c i f i c a l l y i n s e r t these a m i n o a c i d s ( R S K D V ) i n t o v a r i o u s s i tes i n the hopE g e n e . T h e s e l e c t e d a m i n o a c i d s w e r e c h o s e n f o r m u t a g e n e s i s b e c a u s e o f t h e i r p r o p e n s i t y f o r d i s r u p t i o n o f t h e t r a n s m e m b r a n e s p a n n i n g d o m a i n s o f b a c t e r i a l o u t e r m e m b r a n e P -barre l p r o t e i n s . F o l l o w i n g P C R a m p l i f i c a t i o n a n d t r e a t m e n t o f t h e D N A e n d s w i t h the K l e n o w f r a g m e n t o f D N A p o l y m e r a s e , the p r o d u c t c o n t a i n i n g t h e i n s e r t e d s e q u e n c e w a s r e l i g a t e d to g i v e t h e r e c o m b i n a n t p l a s m i d . C o n t a m i n a t i n g p J l w a s r e m o v e d b y d i g e s t i o n w i t h the m e t h y l a t e d - D N A s p e c i f i c Dpnl r e s t r i c t i o n e n z y m e p r i o r to t r a n s f o r m a t i o n o f E. coli J M 1 1 0 w i t h the l i g a t i o n p r o d u c t s . T h e r e s u l t i n g r e c o m b i n a n t c l o n e s w e r e v e r i f i e d b y D N A s e q u e n c i n g to m a k e s u r e that t h e i n s e r t i o n d i d n o t d i s r u p t the r e a d i n g f r a m e o f hopE a n d that t he re w e r e n o o t h e r m u t a t i o n s i n t r o d u c e d i n t o t h e hopE g e n e . 33 RESULTS Chapter 1. Use of alkaline phosphatase fusions to identify secreted proteins, including potential efflux proteins and virulence factors from Helicobacter pylori 1.0 Introduction C u r r e n t l y s e v e r a l b a c t e r i a l c h r o m o s o m e s h a v e b e e n f u l l y o r s u b s t a n t i a l l y s e q u e n c e d (see w w w . t i g r . o r g / t d b / m d b / m d b . h t m l ) . O n e in te res t i n a n a l y z i n g the g e n o m e s o f t h e s e o r g a n i s m s i s to i d e n t i f y g e n e s o f t h e r a p e u t i c i n te res t s u c h as v i r u l e n c e f a c t o r s , v a c c i n e c a n d i d a t e s a n d n o v e l d r u g ta rgets . A c o m p l e m e n t a r y s t r a t e g y f o r t h e i d e n t i f i c a t i o n o f g e n e s o f p o t e n t i a l t h e r a p e u t i c i n te res t i s t o i d e n t i f y e x t r a c e l l u l a r , s u r f a c e a s s o c i a t e d o r p e r i p l a s m i c p r o t e i n s . S i n c e s u c h p r o t e i n s are m o r e a c c e s s i b l e to d r u g t h e r a p y t h a n are c y t o p l a s m i c p r o t e i n s . T r a n s l a t i o n a l f u s i o n s to a l k a l i n e p h o s p h a t a s e h a v e b e e n s u c c e s s f u l l y u s e d f o r t h e i d e n t i f i c a t i o n o f e x t r a c e l l u l a r , s u r f a c e a s s o c i a t e d o r p e r i p l a s m i c p r o t e i n s i n s e v e r a l b a c t e r i a l s y s t e m s ( D e r m a n & B e c k w i t h , 1 9 9 5 ) . H o w e v e r , t h e a p p l i c a t i o n o f g e n e f u s i o n t e c h n o l o g y to b a c t e r i a l s p e c i e s that c o n t a i n u n d e f i n e d r e s t r i c t i o n a n d m o d i f i c a t i o n s y s t e m s , s u c h as H. pylori, i s m o r e d i f f i c u l t . A t t e m p t s at t r a d i t i o n a l TnphoA m u t a g e n e s i s ( M a n o i l et al, 1 9 9 0 ) o f H. pylori h a v e n o t b e e n s u c c e s s f u l . T h e r e f o r e I s o u g h t to adapt a r a p i d a n d s i m p l e s y s t e m f o r t h e i d e n t i f i c a t i o n o f H. pylori s e c r e t e d p r o t e i n s i n a h e t e r o l o g o u s s y s t e m . I n t h i s c h a p t e r I d e s c r i b e a s t r a t e g y f o r t h e i d e n t i f i c a t i o n o f s e c r e t e d p r o t e i n s f r o m H. pylori b a s e d o n g e n e f u s i o n s to b a c t e r i a l a l k a l i n e p h o s p h a t a s e , a n e n z y m e that o n l y b e c o m e s a c t i v e a f te r p a s s a g e a c r o s s the c y t o p l a s m i c m e m b r a n e . T h e a p p r o a c h p r e s e n t e d h e r e w a s b a s e d o n a set o f p l a s m i d v e c t o r s that a l l o w t h e t r a n s l a t i o n a l f u s i o n o f g e n e s to a s i g n a l s e q u e n c e - d e f i c i e n t E. coli a l k a l i n e p h o s p h a t a s e g e n e (phoA) ( M d l u l i et al, 1 9 9 5 ) . E x p r e s s i o n o f a l k a l i n e p h o s p h a t a s e i n t h e s e v e c t o r s i s d e p e n d e n t 34 u p o n t h e c l o n i n g o f a n i n f r a m e s i g n a l s e q u e n c e u p s t r e a m o f 'phoA. I n t h e s e v e c t o r s the phoA g e n e i s c l o n e d d o w n s t r e a m a n d i n t h e s a m e o r i e n t a t i o n as the lac p r o m o t e r , a l l o w i n g f o r h i g h -l e v e l t r a n s c r i p t i o n o f g e n e s that c o n t a i n w e a k p r o m o t e r s o r f o r t h e e x p r e s s i o n o f i n t e r n a l g e n e s i n p o l y c i s t r o n i c o p e r o n s . E x p r e s s i o n o f a l k a l i n e p h o s p h a t a s e a c t i v i t y i s d e t e c t e d o n s o l i d m e d i u m c o n t a i n i n g a c o l o r i m e t r i c i n d i c a t o r . T h i s s t u d y w a s c o m p l e t e d a n d p u b l i s h e d ( B i n a et al, 1 9 9 7 ) p r i o r to the r e l e a s e o f t h e H. pylori g e n o m e s e q u e n c e . T h e a p p l i c a t i o n o f t h i s s t r a t e g y to H. pylori p r i o r t o t h e H. pylori g e n o m e r e l e a s e a l l o w e d t h e i d e n t i f i c a t i o n o f s e v e r a l n o v e l ta rgets f o r d r u g i n t e r v e n t i o n a n d p o t e n t i a l v i r u l e n c e f a c t o r s . S u b s e q u e n t to t h e r e l e a s e o f t h e H. pylori g e n o m e t h e r e s u l t s o f t h e s e e x p e r i m e n t s a l l o w e d the m a p p i n g a n d i d e n t i f i c a t i o n o f n u m e r o u s u n i q u e a n d p r e v i o u s l y u n d o c u m e n t e d s e c r e t e d p r o t e i n s i n H. pylori. 1.1 Construction of a Helicobacter /ry/on-alkaline phosphatase fusion library I n i t i a l a t t e m p t s to c o n s t r u c t t h e H. ; ? y / o n ' - a l k a l i n e p h o s p h a t a s e f u s i o n l i b r a r y i n phoA d e f i c i e n t E. coli C C 118 w e r e u n s u c c e s s f u l . E. coli C C 118 p r o v e d to b e a p o o r r e c i p i e n t f o r H. pylori DNA; r e c o m b i n a n t c l o n e s w e r e o b t a i n e d at l o w e f f i c i e n c y , p r o b a b l y a c o n s e q u e n c e o f E. coli C C 1 1 8 r e s t r i c t i o n o f / / , pylori D N A ( P h a d n i s et al, 1 9 9 4 ) . S u b s e q u e n t l y , E. coli E R 1 7 9 3 , aphoA+ s t r a i n that h a s b e e n s h o w n to b e p e r m i s s i v e f o r t h e c l o n i n g o f H. pylori DNA ( P h a d n i s et al, 1 9 9 4 ) , w a s u s e d as the h o s t f o r t h e c o n s t r u c t i o n o f t h e H. pylori-alkaline p h o s p h a t a s e f u s i o n l i b r a r y . R a t h e r t h a n c o n s t r u c t a phoA d e f i c i e n t s t r a i n , I f o u n d that t h e i n c l u s i o n o f 5 0 m M NaP04 i n the s e l e c t i o n m e d i u m c o m p l e t e l y i n h i b i t e d the e x p r e s s i o n o f t h e e n d o g e n o u s p h o s p h a t a s e a c t i v i t y i n E. coli E R 1 7 9 3 w h i l e s t i l l a l l o w i n g the d e t e c t i o n o f r e c o m b i n a n t a l k a l i n e p h o s p h a t a s e f u s i o n p r o t e i n s . 1.2 DNA sequencing and B L A S T X analysis of Helicobacter /jj'/or/'-alkaline phosphatase fusion clones 35 A t o t a l o f 1 2 0 H. / ^ / o n - a l k a l i n e p h o s p h a t a s e f u s i o n l i b r a r y c l o n e s w e r e r a n d o m l y s e l e c t e d f o r s c r e e n i n g b y D N A s e q u e n c i n g . E a c h c l o n e w a s s u b j e c t e d to a s i n g l e p a s s D N A s e q u e n c i n g r u n a n d I o b t a i n e d a n a v e r a g e o f a p p r o x i m a t e l y 3 5 0 b p o f D N A s e q u e n c e f r o m e a c h c l o n e . T h e s e D N A s e q u e n c e s w e r e u s e d s e p a r a t e l y f o r B L A S T X h o m o l o g y s e a r c h e s o f the N C B I n o n - r e d u n d a n t n u c l e o t i d e d a t a b a s e ( A l t s c h u l et al., 1 9 9 0 ) . T h e B L A S T X r e s u l t s w e r e s c r e e n e d f o r u n g a p p e d a n d c o n s i s t e n t l y g a p p e d h i g h - s c o r i n g s e g m e n t p a i r s that p r o d u c e d P ( N ) s c o r e s o f 10" 5 o r l o w e r , s i n c e s u c h p a i r i n g s a re g e n e r a l l y c o n s i d e r e d to b e s i g n i f i c a n t . T h r e e a d d i t i o n a l c l o n e s w i t h h i g h h i g h - s c o r i n g s e g m e n t p a i r s c o r e s w e r e a l s o i n c l u d e d . T h r e e c l o n e s w i t h h o m o l o g y o n l y t o c y t o p l a s m i c p r o t e i n s a n d th ree c l o n e s w i t h h o m o l o g y to p r o t e i n s e n c o d e d o n t h e n e g a t i v e s t r a n d r e l a t i v e to phoA w e r e n o t i n c l u d e d i n T a b l e I V . A m o n g t h e 1 2 0 H. pylori-alkaline p h o s p h a t a s e f u s i o n l i b r a r y c l o n e s that w e r e s e q u e n c e d , 21 c l o n e s p r o d u c e d h i g h - s c o r i n g s e g m e n t p a i r s o f 10" 5 o r l o w e r ( T a b l e I V ) . T h e i d e n t i f i e d h o m o l o g o u s g e n e s i n c l u d e d s e v e r a l p r i m e ta rgets f o r d r u g i n t e r v e n t i o n o r v a c c i n e c o n s t r u c t i o n i n c l u d i n g g e n e s i n v o l v e d i n m o t i l i t y ( c l o n e s 1 1 , 3 0 a n d 1 2 1 ) , e f f l u x ( c l o n e s 12 , 3 9 , 61 a n d 2 0 0 ) , i r o n u p t a k e ( c l o n e 10) , c e l l w a l l b i o s y n t h e s i s ( c l o n e s 4 4 a n d 1 6 2 ) , p e r m e a s e s ( c l o n e s 1 9 9 a n d 2 3 0 ) , c y t o c h r o m e ( c l o n e 1 0 5 ) , e n z y m e s ( c l o n e 3 ) a n d l i p i d b i o s y n t h e s i s ( c l o n e 182 ) . I n a d d i t i o n t o t h o s e c l o n e s l i s t e d i n T a b l e I V , a n o t h e r 8 9 c l o n e s h a d o n l y w e a k s i m i l a r i t y to s e q u e n c e s i n t h e n o n - r e d u n d a n t d a t a b a s e . T h e s e c l o n e s d i d n o t h a v e a s u f f i c i e n t a m o u n t o f s i m i l a r i t y t o s e q u e n c e s p r e s e n t i n t h e d a t a b a s e to a l l o w a c o n f i d e n t p r e d i c t i o n o f t h e i r p o s s i b l e f u n c t i o n ( d a t a n o t s h o w n ) . A d d i t i o n a l s e q u e n c i n g i n t h e s e c l o n e s w o u l d b e r e q u i r e d b e f o r e a p r e d i c t i o n o f t h e i r f u n c t i o n c o u l d b e m a d e . L a s t l y , 7 c l o n e s d i d n o t p r o d u c e a l i g n m e n t s w i t h a n y s e q u e n c e s i n t h e N C B I n o n - r e d u n d a n t d a t a b a s e . W h e t h e r t h e s e s e q u e n c e s r e p r e s e n t n o v e l 36 T a b l e I V . H. pylori-alkaline p h o s p h a t a s e f u s i o n l i b r a r y c l o n e s h a v i n g s i g n i f i c a n t s i m i l a r i t y t o d a t a b a s e s e q u e n c e s . Clone # (accession #):' HSP gene (accession Organism:J Function:4 AA residues (N):5 %Id.:0 %Sim.:' HSP:8 P(N):' 3(U61522) /o/D(D10588) Ec dehydrogenase 41(3) 50 70 68 6.5x10-° 10(U60606) exbD (U08209) Hi siderophore uptake 41(1) 51 80 125 5.5x10-' 11 (U60607) /q/B(L06176) Vp motility 101(2) 31 56 92 4.4x10"5 12(U60608) helA (U49498) Lp efflux 59(1) 38 59 102 2.0x10"' 20 (U61524) virB4(U28133) Hp ? 69(2) 48 56 75 4.2xl0"8 26(U61525) kpnBl (U33094) Kp DNA restriction system 64(2) 39 70 90 8.8X10-8 30 (U60610) motB (M77238) Bsu motility 43(1) 53 72 118 2.2xl0"7 32(U60611) yrbJ (U18997) Ec ? 40(1) 55 60 92 2.2xl0-s 39(U82393) let (Ml6217) Sa tet efflux 62(1) 26 47 66 .997 44 (U60613) vanA (M97297) Ef vancomycin resistance 52(1) 34 53 86 9.1xl0-5 52 (U60615) T3RE (X06287) PI DNA restriction 83(3) 40 62 74 8.0xl0"8 53 (U81608) HI0325 (U00072) Hi ? 46(1) 34 58 87 7.2xl0"5 57(U82394) yjcO (P32713) Ec ? 46(1) 32 54 65 .996 61 (U60617) mtrC (U14993) Ng efflux 94(2) 27 48 67 .94 70 (U60618) HI 1586(U32779) Hi '? 53(2) 43 74 91 3.6x10-'° 105 (U60620) c y « / ( X 6 5 1 8 9 ) Ws cytochrome 87(1) 54 75 261 1.9xl0"3° 117(U60622) ppsA (D64005) Ssp. kinase 58(1) 52 76 171 l.lxlO"2 0 121 (U60623) motB (M77238) Bs motility 43(1) 53 72 121 1.0x10"' 158(U60627) /eofl(U18997) Ec iron transport 68(2) 46 66 88 8.4x10"'° 162 (U60628) pbpA (X04516) Ec penicillin binding protein 113(2) 32 52 128 9.8xl0"'4 182 (U60630) cdh (Ml 1331) Ec lipid biosynthesis 89(2) 66 82 269 9.4xl0"35 199 (U60633) yejA (U00008) Ec permease 55(1) 31 53 97 1.9xl0"6 200 (U60634) yhiV(U00039) Ec efflux 91(2) 34 57 103 3.6xl0"7 211 (U81609) rfbA (L34166) Sm LPS biosynthesis 38(1) 37 55 68 .90 230 (U60638) HI0325 (U32826) Hi hypothetical permease 99(2) 33 55 114 8.0x10"'" T a b l e I V l e g e n d : H. pylori-a\kaline p h o s p h a t a s e f u s i o n l i b r a r y c l o n e s a n d t h e i r h o m o l o g g e n e s i d e n t i f i e d b y B L A S T X h o m o l o g y s e a r c h e s ( B i n a et al, 1 9 9 7 ) . (1 ) H. p y / o n - a l k a l i n e p h o s p h a t a s e f u s i o n l i b r a r y c l o n e a n d i t s G e n B a n k a c c e s s i o n n u m b e r . (2 ) G e n e n a m e a n d a c c e s s i o n n u m b e r o f t h e d a t a b a s e g e n e w h i c h w a s s i m i l a r to the H. j p y / o n ' - a l k a l i n e p h o s p h a t a s e f u s i o n l i b r a r y c l o n e l i s t e d i n c o l u m n 1. (3) O r i g i n o f g e n e l i s t e d i n c o l u m n 2 . A b b r e v i a t i o n s : Bsu, Bacillus subtilis; Cf, Citrobacter freundii; Ec, Escherichia coli; Ef Enterococcus facium; , Hi, Haemophilus influenzae; Hp, Helicobacter pylori; Kp, Klebsiella pneumoniae; Lp, Legionella pneumophila; Ng, Neisseria gonorrhoeae; PI, bacteriophage PI; Sa, Staphylococcus aureus; Sm, Serratia marcescens; Ssp, Synechocystis species; Vp, Vibrio parahaemolyticus; Ws, Wolinella succinogenes. (4 ) F u n c t i o n o f g e n e l i s t e d i n c o l u m n 2 . (5) T h e n u m b e r o f a m i n o a c i d s a n d H S P s ( i n p a r e n t h e s i s ) i n the B L A S T X a l i g n m e n t . (6) P e r c e n t a m i n o a c i d i d e n t i t y r e p o r t e d i n t h e B L A S T X s e a r c h r e s u l t s . (7) P e r c e n t a g e o f a m i n o a c i d s i m i l a r i t y r e p o r t e d i n t h e B L A S T X s e a r c h r e s u l t s . (8) H S P s c o r e r e p o r t e d i n B L A S T X r e s u l t s . (9) P ( N ) r e p o r t e d i n t h e B L A S T X s e a r c h r e s u l t s . 37 a n d u n i q u e H. pylori g e n e s w a s n o t p o s s i b l e to d e t e r m i n e w i t h o u t f u r t h e r s e q u e n c i n g ( p r i o r to c o m p l e t i o n o f t h e H. pylori g e n o m e s e q u e n c e ) . 1.3 Confirmation of gene identification for putative Helicobacter pylori efflux clones . T h e m a j o r o b j e c t i v e f o r u n d e r t a k i n g t h i s s t u d y w a s to i d e n t i f y p o t e n t i a l H. pylori m u l t i p l e d r u g a c t i v e e f f l u x s y s t e m s . I n m y i n i t i a l s c r e e n I i d e n t i f i e d t h r e e p o t e n t i a l g e n e s f r o m H pylori e f f l u x s y s t e m s i n c l o n e s 12 , 61 a n d 2 0 0 w h i c h w e r e s i m i l a r t o t h e r e s i s t a n c e -n o d u l a t i o n - d i v i s i o n ( R N D ) f a m i l y o f b a c t e r i a l e f f l u x s y s t e m s . I n g e n e r a l , t h e R N D e f f l u x o p e r o n s c o n t a i n a c o n s e r v e d m e m b r a n e f u s i o n p r o t e i n u p s t r e a m o f the p u m p p r o t e i n ( N i k a i d o , 1 9 9 6 ; P a u l s e n et al, 1 9 9 7 ) . T o c o n f i r m t h e i n i t i a l g e n e i d e n t i f i c a t i o n I o b t a i n e d u p s t r e a m D N A s e q u e n c e i n f o r m a t i o n f o r e a c h o f t h e s e c l o n e s . I n i t i a l s c r e e n i n g s u g g e s t e d that c l o n e 12 c o n t a i n e d s e q u e n c e s i m i l a r i t y to a n R N D p u m p p r o t e i n . T h e r e f o r e , c l o n e 12 w a s s e q u e n c e d w i t h t h e r e v e r s e s e q u e n c i n g p r i m e r to d e t e r m i n e i f the re w a s s e q u e n c e s i m i l a r i t y to a m e m b r a n e f u s i o n p r o t e i n i n t h e D N A r e g i o n u p s t r e a m from t h e p u t a t i v e e f f l u x p u m p p r o t e i n . B L A S T X s e a r c h e s u s i n g the r e s u l t i n g D N A s e q u e n c e s h o w e d that t h e r e w a s s e q u e n c e s i m i l a r i t y to R N D m e m b r a n e f u s i o n p r o t e i n s u p s t r e a m o f t h e p u t a t i v e e f f l u x p u m p p r o t e i n ( d a t a n o t s h o w n ) . I n a d d i t i o n , the D N A s e q u e n c e g a p b e t w e e n t h e p u t a t i v e B L A S T X i d e n t i f i e d m e m b r a n e f u s i o n a n d p u m p p r o t e i n s w a s c o n s i s t e n t w i t h t h e s i z e o f t h e D N A i n s e r t i n c l o n e 12 a n d w i t h o t h e r R N D e f f l u x o p e r o n s . T h e s e r e s u l t s s u p p o r t t h e i n i t i a l p r e d i c t i o n that c l o n e 12 c o n t a i n e d a p u t a t i v e H. pylori a c t i v e e f f l u x p u m p - p h o A f u s i o n p r o t e i n . C l o n e 61 w a s i n i t i a l l y i d e n t i f i e d as h a v i n g a w e a k s i m i l a r i t y to a b a c t e r i a l m e m b r a n e f u s i o n p r o t e i n (mtrC from N. gonorrhoeae). T o f u r t h e r i n v e s t i g a t e t h i s c l o n e a D N A s e q u e n c i n g p r i m e r w a s s y n t h e s i z e d to e x t e n d the o r i g i n a l D N A s e q u e n c e . B L A S T X a n a l y s i s o f t h e r e s u l t i n g D N A s e q u e n c e ( a p p r o x i m a t e l y 9 0 0 b p ) w a s c o n s i s t e n t w i t h t h e i n i t i a l p r e d i c t i o n 38 that t h i s c l o n e e n c o d e d a m e m b r a n e f u s i o n p r o t e i n . T h e e x t e n d e d D N A s e q u e n c e i d e n t i f i e d h i g h - s c o r i n g s e g m e n t p a i r s at a m u c h h i g h e r c o n f i d e n c e l e v e l ( P ( N ) o f 9 . 6 x 1 0 " 5 f o r Alcaligenes eutrophus cnrB). C l o n e 2 0 0 w a s s i m i l a r to s e v e r a l R N D e f f l u x p u m p s . M u l t i p l e s e q u e n c e a l i g n m e n t s o f the p u t a t i v e a m i n o a c i d s e q u e n c e o f c l o n e 2 0 0 a n d o t h e r R N D e f f l u x p u m p s s h o w e d that c l o n e 2 0 0 s h a r e d m o s t o f t h e c o n s e r v e d a m i n o a c i d s w i t h the o t h e r e f f l u x p u m p s . A d d i t i o n a l D N A s e q u e n c i n g o f the u p s t r e a m r e g i o n o f t h i s c l o n e r e v e a l e d t h e p r e s e n c e o f a p u t a t i v e H. pylori h o m o l o g u e o f t h e E. coli acrAB ( M a et al, 1 9 9 3 ) e f f l u x o p e r o n i n c l u d i n g t h e p u t a t i v e p u m p p r o t e i n a n d a n u p s t r e a m m e m b r a n e f u s i o n p r o t e i n . 1.4 Analysis of the clones after publication of the Helicobacter pylori 26695 genome sequence. T h e s e q u e n c e d a l k a l i n e p h o s p h a t a s e f u s i o n c l o n e s w e r e m a p p e d t o t h e g e n o m e s e q u e n c e o f H. pylori 2 6 6 9 5 . T h e r e s u l t s o f t h i s are s h o w n i n T a b l e V . A m o n g t h e s e q u e n c e d c l o n e s , 5 9 c l o n e s ( 4 9 % ) w e r e u n i q u e to H. pylori ( i . e. , u n i d e n t i f i e d O R F s ) , 6 5 c l o n e s ( 5 4 % ) c o n t a i n e d t y p i c a l s i g n a l s e q u e n c e s a n d 19 c l o n e s ( 1 6 % ) w e r e p r e d i c t e d to b e c e l l e n v e l o p e - a s s o c i a t e d . A d d i t i o n a l l y , 4 4 c l o n e s ( 3 7 % ) o f t h e s e q u e n c e d c l o n e s w e r e r e d u n d a n t a n d 12 c l o n e s ( 1 0 % ) w e r e p r e d i c t e d to e n c o d e c y t o p l a s m i c p r o t e i n s . 39 T a b l e V. M a p p i n g o f Helicobacter pylori 1 1 6 3 7 phoA g e n e f u s i o n s to the Helicobacter pylori 2 6 6 9 5 g e n o m e . C l o n e : T I G R O R F : F u n c t i o n : 3 0577 methylene-tetrahydrofolate dehydrogenase (folD) 5 0817 unidentified ORF 8 0817 unidentified ORF 9 0931 unidentified ORF 10 1446 biopolymer transport protein (exbD) 11 0752 flagellar hook-associated protein 2 (fliD) 12 1329 cation efflux system protein (czcA) 13 1517 type IIS restriction enzyme 15 0817 unidentified ORF 16 0248 conserved hypothetical protein 17 1098 conserved hypothetical secreted protein 19 0817 unidentified ORF 20 0544 cag pathogenicity island protein (cag23) 21 0298 dipeptide ABC transporter, periplasmic dipeptid 22 0898 hydrogenase expression/formation protein 23 0547 cag pathogenicity island protein (cag26) 24 0289 toxin-like outer membrane protein 25 1429 polysialic acid capsule expression protein 26 1402 type I restriction enzyme R protein (hsdR) 27 0187 unidentified ORF 29 1402 type I restriction enzyme R protein (hsdR) 31 0529 cag pathogenicity island protein (cag9) 32 1569 unidentified ORF 33 0366 spore coat polysaccharide biosynthesis 34 0764 unidentified ORF 36 1517 type IIS restriction enzyme 38 0931 unidentified ORF 39 0594 unidentified ORF 43 0488 unidentified ORF 43 1116 unidentified ORF 44 0738 D-alanine:D-alanine ligase A (ddlA) 47 0078 unidentified ORF 49 1457 unidentified ORF 50 1272 NADH-ubiquinone oxidoreductase, NQ013 subunit 51 0018 unidentified ORF 52 1521 type III restriction enzyme R protein 53 0758 conserved hypothetical integral membrane protein 55 0725 outer membrane protein (ompl7) 57 1098 conserved hypothetical secreted protein 60 0144 cytochrome c oxidase, heme b and copper-binding 61 0970 nickel-cobalt-cadmium resistance protein (nccB) 62 0922 toxin-like outer membrane protein 63 0403 phenylalanyl-tRNA synthetase, alpha subunit 40 C l o n e : T I G R O R F : F u n c t i o n : 65 0887 vacuolating cytotoxin 70 0946 conserved hypothetical integral membrane protein 71 0289 toxin-like outer membrane protein 72 0817 unidentified ORF 73 0817 unidentified ORF 77 0522 cag pathogenicity island protein (cag3) 78 0677 conserved hypothetical integral membrane protein 79 0638 unidentified ORF 80 0330 ketol-acid reductoisomerase (ilvC) 81 1433 hypothetical protein 82 0492 unidentified ORF 83 0289 toxin-like outer membrane protein 85 0817 unidentified ORF 89 0018 unidentified ORF 90 0817 unidentified ORF 91 1237 carbamoyl-phosphate synthetase 92 1072 copper-transporting ATPase, P-type (copA) 93 0817 unidentified ORF 95 0817 unidentified ORF 96 0078 unidentified ORF 97 0912 unidentified ORP 99 0855 alginate O-acetylation protein (algl) 100 1213 polynucleotide phosphorylase 102 0817 unidentified ORF 105 0633 quinone-reactive Ni/Fe hydrogenase 107 0721 unidentified ORF 111 1497 peptidyl-tRNA hydrolase 112 0817 unidentified ORF 114 0972 glycyl-tRNA synthetase 115 1561 iron(III) A B C transporter 116 0817 unidentified ORF 117 0121 phosphoenolpyruvate synthase 118 0167 unidentified ORF 121 0816 flagellar motor rotation protein 122 1144 unidentified ORF 123 0424 unidentified ORF 123 1411 unidentified ORF 124 0020 carboxynorspermidine decarboxylase 125 0817 unidentified ORF 127 0527 cag pathogenicity island protein (cag7) 128 1524 unidentified ORF 129 1394 conserved hypothetical protein 130 1523 D N A recombinase (recG) 131 1346 glyceraldehyde-3 -phosphate dehydrogenase 132 1350 protease 133 0946 conserved hypothetical integral membrane protein 134 0817 unidentified ORF C l o n e : T I G R O R F : F u n c t i o n : 136 0689 unidentified ORF 139 0257 conserved hypothetical secreted protein 144 1524 unidentified ORF 145 0036 unidentified ORF 146 0531 cag pathogenicity island protein (cagl 1) 147 0447 conserved hypothetical protein 149 1157 unidentified ORF 151 0817 unidentified ORF 152 1524 unidentified ORF 155 0254 outer membrane protein (omp8) 157 1527 unidentified ORF 158 0687 iron(II) transport protein (feoB) 159 0817 unidentified ORF 160 0758 conserved hypothetical integral membrane protein 161 0273 unidentified ORP 162 1565 penicillin-binding protein 2 (pbp2) 163 0868 unidentified ORF 164 0019 chemotaxis protein (cheV) 165 0020 carboxynorspermidine decarboxylase (nspC) 169 0019 chemotaxis protein (cheV) 170 0019 chemotaxis protein (cheV) 171 0376 ferrochelatase (hemH) 173 0522 cag pathogenicity island protein (cag3) 176 0273 unidentified ORF 178 0576 signal peptidase I 182 0871 CDP-diglyceride hydrolase 184 1092 flagellar basal-body rod protein 189 0207 ATP-binding protein 194 0668 unidentified ORF 195 1524 unidentified ORF 199 1252 oligopeptide A B C transporter 200 0607 acriflavine resistance protein 201 0719 unidentified ORF 209 0271 unidentified ORF 211 0378 cytochrome C biogenesis protein 212 1212 ATP synthase F0 214 0272 unidentified ORF 215 0595 unidentified ORF 216 0532 cag pathogenicity island protein (cag 12) 222 0149 unidentified ORF 223 0287 unidentified ORF 224 0273 unidentified ORF 225 1116 unidentified ORF 42 CHAPTER 2. Role of efflux in antibiotic resistance oi Helicobacter pylori 2.0 Introduction I p r e v i o u s l y i d e n t i f i e d t h e p r e s e n c e o f t h ree p o t e n t i a l R N D e f f l u x s y s t e m s i n H. pylori 1 1 6 3 7 (see C h a p t e r 1). I n t h i s c h a p t e r I t e s t e d the h y p o t h e s i s that a c t i v e e f f l u x m e d i a t e d b y these t h r e e e f f l u x s y s t e m s f u n c t i o n s i n the i n t r i n s i c r e s i s t a n c e o f H. pylori t o a n t i b i o t i c s . T h e c h a r a c t e r i z a t i o n o f the R N D s y s t e m s i n H. pylori w a s d o n e i n c o l l a b o r a t i o n w i t h D r . R . A i m at A s t r a R e s e a r c h B o s t o n I n c . (see A p p e n d i x I). F o r t h e s e q u e n c e a n a l y s i s c o n t a i n e d i n t h i s c h a p t e r , t h e s e q u e n c e o f the R N D e f f l u x s y s t e m s f o u n d i n H. pylori J 9 9 w a s m a d e a v a i l a b l e to m e b y A s t r a R e s e a r c h B o s t o n , I nc . . T h e r e s u l t s o f t h i s w o r k b y D r . A i m a n d I r e v e a l e d that the R N D e f f l u x s y s t e m s are c o n s e r v e d a m o n g H. pylori s t r a i n s , that a c t i v e e f f l u x d o e s n o t p l a y a r o l e i n t h e in vitro i n t r i n s i c a n t i b i o t i c r e s i s t a n c e o f H. pylori, that hefBC d o e s n o t c o m p l e m e n t E. coli acrAB m u t a n t s a n d that o n e o f t h e H. pylori R N D e f f l u x s y s t e m s i s d i f f e r e n t i a l l y r e g u l a t e d . 2.1 Cloning and DNA sequencing of the hefABC operon from Helicobacter pylori 11637 I h a d p r e v i o u s l y r e c o v e r e d p a r t i a l g e n e s that s h o w e d h o m o l o g y to t h e p r o t e i n s o f t h ree d i f f e r e n t R N D f a m i l y e f f l u x o p e r o n s i n H. pylori 1 1 6 3 7 b y t r a n s l a t i o n a l f u s i o n to a l k a l i n e p h o s p h a t a s e (see C h a p t e r 1). T h e D N A i n s e r t f r o m H. pylori a l k a l i n e p h o s p h a t a s e f u s i o n c l o n e 2 0 0 , w h i c h w a s m o s t s i m i l a r to t h e E. coli acrB e f f l u x p u m p , w a s u s e d as a h y b r i d i z a t i o n p r o b e to s u b c l o n e t h e c o r r e s p o n d i n g l o c u s from a H. pylori g e n o m i c l i b r a r y that w a s c o n s t r u c t e d i n t h e c o s m i d p L A F R 3 . C o s m i d c l o n e p 2 0 0 : 4 w a s i d e n t i f i e d as c o n t a i n i n g t h e e n t i r e l o c u s a n d w a s u s e d f o r s u b c l o n i n g a n d D N A s e q u e n c i n g o f hefABC. T h e r e s u l t i n g D N A s e q u e n c e c o n t a i n e d t h r e e o p e n r e a d i n g f r a m e s w h i c h I n a m e d hefABC ( H e l i c o b a c t e r e / F l u x ; a c c e s s i o n n u m b e r A F 0 5 9 0 4 1 ; F i g u r e s 5 & 6) . T h e hefA a n d hefB g e n e s e a c h c o n t a i n e d a t y p i c a l s i g n a l 43 s e q u e n c e . A h o m o l o g o f E. coli u r o p o r p h y r i n o g e n d e c a r b o x y l a s e (hemE) w a s p r e s e n t u p s t r e a m as par t o f the s a m e p u t a t i v e o p e r o n as w a s the hefABC g e n e s . T h e H. pylori hefABC g e n e s e n c o d e d p r o t e i n s that w e r e s i m i l a r t o t h o s e e n c o d e d b y the A c r A B - T o l C R N D e f f l u x s y s t e m w h i c h m e d i a t e s t h e r e s i s t a n c e o f E. coli ( M a et al, 1 9 9 3 ) to a v a r i e t y o f d i f f e r e n t a n t i b i o t i c s , d e t e r g e n t s a n d d y e s ( P a u l s e n et al, 1 9 9 6 ) . T h e hefA g e n e e n c o d e d a p u t a t i v e E. coli tolC h o m o l o g a n d t h e hefB a n d hefC g e n e s w e r e h o m o l o g s o f the E. coli acrA a n d acrB g e n e s , r e s p e c t i v e l y . T o l C i s b e l i e v e d to b e t h e o u t e r m e m b r a n e c o m p o n e n t o f the A c r A B e f f l u x s y s t e m w h e r e a s A c r A i s a m e m b e r o f the c o n s e r v e d f a m i l y o f m e m b r a n e f u s i o n p r o t e i n s , a n d A c r B i s the R N D f a m i l y m u l t i p l e d r u g e f f l u x p u m p p r o t e i n ( M a et al, 1 9 9 4 ) . W h e t h e r t h e u p s t r e a m u r o p o r p h y r i n o g e n d e c a r b o x y l a s e h o m o l o g h a s a f u n c t i o n a l r o l e i n t h e hefABC o p e r o n i s u n k n o w n . T h e a s s o c i a t i o n o f a u r o p o r p h y r i n o g e n d e c a r b o x y l a s e h o m o l o g a n d o f t h e o t h e r g e n e s as d e s c r i b e d b e l o w , i s u n i q u e to H. pylori. 2.2 S e q u e n c e a n a l y s i s o f t h e H. pylori R N D e f f l u x o p e r o n s " T h e H. pylori 2 6 6 9 5 g e n o m i c s e q u e n c e , w h i c h w a s p u b l i s h e d a f te r o u r p u b l i c a t i o n d e s c r i b i n g t h e e x i s t e n c e o f 3 e f f l u x o p e r o n s i n H. pylori, c o n t a i n e d o n l y 6 o p e n r e a d i n g f r a m e s ( O R F s ) that w e r e r e p o r t e d as h a v i n g h o m o l o g y to R N D e f f l u x c o m p o n e n t s ( O R F s 6 0 6 , 6 0 7 , 9 6 9 , 9 7 0 , 1 3 2 8 a n d 1 3 2 9 ) ( T o m b et al, 1 9 9 7 ) . T h e D N A i n s e r t s f r o m H. pylori a l k a l i n e p h o s p h a t a s e f u s i o n c l o n e s 12 , 61 a n d 2 0 0 w e r e u s e d s e p a r a t e l y f o r B l a s t s e a r c h e s ( A l t s c h u l et al, 1 9 9 0 ) o f t h e g e n o m i c D N A s e q u e n c e s o f H. pylori 2 6 6 9 5 ( T o m b et al, 1 9 9 7 ) a n d H. pylori J 9 9 to i d e n t i f y t h e i r c o r r e s p o n d i n g l o c i i n e a c h o f t h e s e t w o s t r a i n s . A l l t h r e e g e n e s m a p p e d to p u t a t i v e R N D e f f l u x o p e r o n s . T h e g e n e s t r u c t u r e s o f e a c h o f the t h r e e H. pylori R N D o p e r o n s are s h o w n i n F i g u r e 6 ; t h e r e w e r e n o o t h e r R N D e f f l u x s y s t e m s p r e d i c t e d i n e i t h e r s t r a i n o f H. pylori f o r w h i c h t h e g e n o m i c s e q u e n c e h a s b e e n e l u c i d a t e d (H. pylori 2 6 6 9 5 o r J 9 9 ) . 44 T h e hemE-hefABC o p e r o n w h i c h I s e q u e n c e d f r o m H. pylori 1 1 6 3 7 w a s h o m o l o g o u s to H. pylori 2 6 6 9 5 O R F s 6 0 4 , 6 0 5 , 6 0 6 a n d 6 0 7 . T h e hemE-hefABC o p e r o n w a s h i g h l y c o n s e r v e d a m o n g t h e t h r e e H. pylori s t r a i n s ( s t r a i n s 1 1 6 3 7 , 2 6 6 9 5 a n d J 9 9 ) ; e a c h i n d i v i d u a l p r o t e i n w a s g r e a t e r t h a n 9 7 % i d e n t i c a l t o e a c h o f i t s c o r r e s p o n d i n g p r o t e i n s i n t h e o t h e r t w o H. pylori s t r a i n s . T h e D N A i n s e r t f r o m H. pylori a l k a l i n e p h o s p h a t a s e f u s i o n c l o n e 61 w a s h o m o l o g o u s to H. pylori 2 6 6 9 5 O R F 9 7 0 , w h i c h i s a m e m b e r o f t h e s e c o n d H. pylori R N D e f f l u x s y s t e m . T h i s o p e r o n a l s o c o n t a i n e d f o u r O R F s , n a m e d h e r e hefDEF-or/V68, w h i c h c o r r e s p o n d to H. pylori 2 6 6 9 5 O R F s 9 7 1 , 9 7 0 , 9 6 9 a n d 9 6 8 . T h e hefD g e n e w a s i d e n t i f i e d b y m e as a p u t a t i v e o u t e r m e m b r a n e p o r e p r o t e i n b y s i m i l a r i t y to tolC, hefA a n d hefG (see b e l o w ) ; hefE w a s the m e m b r a n e f u s i o n p r o t e i n h o m o l o g a n d hefF e n c o d e d the R N D p u m p p r o t e i n h o m o l o g ( T a b l e V I a n d F i g u r e 6 ) . T h e orf968 e n c o d e d a p u t a t i v e 21 a m i n o a c i d p e p t i d e that s h o w e d l o w s i m i l a r i t y b e t w e e n t h e s t r a i n s a n d i ts s i g n i f i c a n c e a n d w h e t h e r i t i s e x p r e s s e d i s u n k n o w n . T h e hefD a n d hefE g e n e s e a c h c o n t a i n e d a t y p i c a l s i g n a l s e q u e n c e . T h e D N A i n s e r t from H. pylori a l k a l i n e p h o s p h a t a s e f u s i o n c l o n e 12 w a s h o m o l o g o u s to the H. pylori 2 6 6 9 5 O R F 1 3 2 9 , w h i c h i s a m e m b e r o f t h e t h i r d H. pylori R N D e f f l u x s y s t e m . T h i s o p e r o n , s i m i l a r t o the t w o o p e r o n s d e s c r i b e d a b o v e c o n t a i n e d f o u r O R F s , n a m e d h e r e orfl326-hefGHI, w h i c h c o r r e s p o n d s to H. pylori 2 6 6 9 5 O R F s 1 3 2 6 , 1 3 2 7 , 1 3 2 8 a n d 1 3 2 9 . T h e hefGHI g e n e s s e e m t o e n c o d e t h e o u t e r m e m b r a n e p o r e , m e m b r a n e f u s i o n a n d R N D p u m p p r o t e i n s r e s p e c t i v e l y . T h e hefG o u t e r m e m b r a n e p r o t e i n w a s i d e n t i f i e d b y s i m i l a r i t y to tolC, 45 Figure 5. D N A s e q u e n c e , a m i n o a c i d s e q u e n c e a n d o l i g o n u c l e o t i d e P C R p r i m e r m a p Helicobacter pylori 1 1 6 3 7 hefABC o p e r o n . 1 ATGAATACTATCATAAGATATGCGAGTTTATGGGGCTTGTGTGCGGCTTTAACTCTAGCG M N T I I R Y A S L W G L C A A L T L A 61 CAAACCCCCTCTAAAACCCCAGAAGAAATCAAGCAAATCGTTAACAATTATAGCCATAAG Q T P S K T P E E I K Q I V N N Y S H K 121 AATTTAATACTCATTGATCCGCCGACAAGTTCTTTAGAAGCAACACCGAGTTTTTTATCC N L I L I D P P T S S L E A T P S F L S 181 TCGCATAAAGAGACAGCGACCACGGTCAATCAAGAGATTGCTAAATACCATGAAAAAAGC S H K E T A T T V N Q E I A K Y H E K S 241 GATAAAGCCGCTTTGGGGCTTTATGAATTGCTAAAAGGGGCTACCACTAATCTCAGTTTG D K A A L G L Y E L L K G A T T N L S L 301 C AAG C G C AAG AAC T CAG TGT C AAG C AAG C G AT G AAAAAC CACACCATCGC C AAAGC G AT G Q A Q E L S V K Q A M K N H T I A K A M 361 TTTTTGCCCACTTTGAACGCGAGTTATAATTTTAAAAATGAAGCTAGGGATACTCCAGAA F L P T L N A S Y N F K N E A R D T P E 421 TATAAGCATTATGACACCCAACAACTCCAAGCTCAAGTCACATTGAATGTGTTTAATGGC Y K H Y D T Q Q L Q A Q V T L N . V F N G 4 81 TTTAGCGATGTGAATAATGTCAAAGAAAAGTCTGCGACTTACCGCTCCAATGTGGCTAAT F S D V N N V K E K S A T Y R S N V A N 541 TTAGAATATAGCCGCCAGAGCGTGTATTTGCAAGTGGTGCAACAATACTACGAGTATTTT L E Y S R Q S V Y L Q V V Q Q Y Y E Y F 601 AACAATCTCGCTCGCATGATCGCTTTGCAAAAGAAATTAGAGCAAATCAAAACAGACATT N N L A R M I A L Q K K L E Q I K T D I 661 AAAAGGGTTACCAAACTCTATGACAAAGGGCTGACCACGATTGATGATTTGCAAAGCTTA K R V T K L Y D K G L T T I D D L Q S L 721 AAAGCGCAAGGGAATTTGAGCGAATACGATATTTTGGACATGCAATTTGCTTTGGAGCAA K A Q G N L S E Y D I L D M Q F A L E Q 7 81 AAC CGCTTGACTT TAGAATAC C T CAC TAAC CTCAGTGT GAAAAAT T T GAAAAAGACCACG N R L T L E Y L T N L S V K N L K K T T 841 ATTGATGCGCCTAATTTGCAATTAAGAGAAAGGCAGGATTTGGTTTCTTTAAGGGAGCAG I D A P N L Q L R E R Q D L V S L R E Q 901 ATTTCTGCAATCAGATACCAAAACAAGCAACTCAATTATTACCCCAAGATAGATGTGTTT I S A I R Y Q N K Q L N Y Y P K I D V F 961 GACTCATGGCTTTTTTGGATCCAAAAACCCGCTTATGCCACAGGGCGTTTTGGGAATTTC D S W L F W I Q K P A Y A T G R F G N F 1021 TACCCAGGTCAGCAAAATACGGCTGGGGTTACTGCGACTTTGAATATTTTTGATGATATA Y P G Q Q N T A G V T A T L N I F D D I 1081 GGCTTGAGCTTGCAAAAACAATCCATCATGTTAGGCCAATTAGCGAATGAAAAGAATTTA G L S L Q K Q S I M L G Q L A N E K N L 1141 GCGTATAAAAAGCTAGAGCAAGAAAAAGACGAACAGCTTTACAGAAAGTCGCTTGATATT A Y K K L E Q E K D E Q L Y R K S L D I 1201 GCCAGAGCCAAGATTGAATCTTCAAAGGCTAGTTTGGATGCGGCTAATCTTTCTTTTGCC A R A K ' I E S S K A S L D A A N L S F A 12 61 AATATTAAAAGGAAATACGACGCTAATTTAGTGGATTTCACCACTTATTTAAGGGGCTTA N I K R K Y D A N L V D F T T Y L R G L 1321 ACCACGCGCTTTGATGCAGAAGTGGCTTACAATTTAGCGCTCAACAATTATGAAGTGCAA T T R F D A E V A Y N L A L N N Y E V Q ^ • 1381 AAAGCCAATTACATTTTCAACAGCGGGCATAAAATAGACGACTATGTGCATTAAGGGAGT K A N Y I F N S G H K I D D Y V H * M C I K G • V 14 41 GGAAATGATACGAAAAATTTTAATAGGACTTTTTTTGAGTTTTTTGAGCATGGAAGCTGG E M I R K I L I G L F L S F L S M E A G 1501 CGAAAAAGTGTATGCGATTTTTAATGTGAAAGCGATGCAAGATTCCAAACTCACCTTAGA E K V Y A I F N V K A M Q D S K L T L D 1561 CAGCACAGGGATTGTGGATAGCATTAAGGTTACTGAGGGGAGCGTGGTCAAAAAGGGCGA S T G I V D S I K V T E G S V V K K G D 1621 TGTTTTGTTGCTTTTGTATAATCAAGACAAACAGGCTCAAAGCGATTCCACTGAGCAACA V L L L L Y N Q D K Q A Q S D S T E Q Q 1681 ACTCATTTTCGCTAAAAAGCAATACCAACGATACAGCAAAATTGGGGGTGCTGTGGATAA L I F A K K Q Y Q R Y S K I G G A V D K 17 41 AAACACTCTAGAGGGTTATGAGTTCACTTACAGGCGTTTGGAGTCTGATTACGCTTATTC N T L E G Y E F T Y R R L E S D Y A Y S 1801 TATTGCGGTATTGAATAAAACCATTTTAAGAGCCCCTTTTGATGGCGTGATAGCGAGTAA I A V L N K T I L R A P F D G V I A S K 18 61 AAACATTCAAGTGGGCGAAGGGGTGAGCGCGAATAACACCGTGTTATTGAGACTAGTCAG N I Q V G E G V S A N N T V L L R L V S 1921 CCATGCTAGGAAATTGGTTATTGAATTTGATTCTAAATATATTAATGCAGTCAAAGTGGG H A R K L V I E F D S K Y I N A V K V G 1981 GGATACTTACACTTATTCTATAGATGGGGATTCTAATCAGCATGAAGCTAAAATCACTAA D T Y T Y S I D G D S N Q H E A K I T K 2041 GATTTACCCCACGGTTGATGAAAACACCAGAAAAGTGAGTGCTGAAGCCCTTTTGTCTAA I Y P T V D E N T R K V S A E A L L S K 2101 GCCTATGGCAGTGGGGCTTTTTGGCGATGGGTTTATCCAAACAAAATAATAGGATATTTT 47 P M A V G L F G D G F I Q T K * 2161 GATGTATAAAACAGCGATTAATCGTCCTATTACGACCTTGATGTTTGCTTTGGCGATTGT M Y K T A I N R P I T T L M F A - L A I V 2221 TTTTTTTGGGACTATGGGGTTTAAAAAATTGAGCGTGGCGCTTTTCCCTAAAATTGATTT F F G T M G F K K L S V A L F P K I D L 2281 GCCTACAGTGGTGGTTACTACGACTTATCCTGGGGCTAGCGCTGAAATCATAGAGAGTAA P T V V V T T T Y P G A S A E I I E S K 2341 GGTAACCGATAAGATTGAAGAAGCGGTGATGGGGATTGATGGGATCAAAAAGGTTACTTC V T D K I E E A V M G I D G I K K V T S 24 01 TACCAGTTCTAAAAATGTGAGTATCGTTGTCATTGAATTTGAGTTAGAAAAGCCTAATGA T S S K N V S I V V I E F E L E K P N E 24 61 AGAAGCCTTAAACGATGTGGTTAATAAAATTTCTTCGGTGCGTTTTGATGACTCTAACAT E A L N D V V N K I S S V R F D D S N I 2521 TAAAAAACCCTCTATCAATAAATTTGATACCGACAGCCAAGCCATTATTTCATTGTTTGT K K P S I N K F D T D S Q A I I S L F V 2581 GAGCAGTTCAAGCGTGCCGGCTACAACCCTTAATGACTACGCTAAAAACACCATTAAACC S S S S V P A T T L N D Y A K N T I K P 2 641 CATGCTCCAAAAAATCAATGGGGTAGGGGGCGTGCAGCTCAACGGCTTTAGGGAGCGCCA M L Q K I N G V G G V Q L N G F R E R Q 27 01 GAT TAGGAT T TAT GCAGATCCCACTTTGATGAATAAATACAACC TGAC TTATGCGGATCT I R I Y A D P T L M N K Y N L T Y A D L 27 61 TTTCAGCACGCTTAAAGCGGAGAATGTGGAAATTGATGGGGGGCGCATTGTCAATAGCCA F S T L K A E N V E I D G G R I V N S Q 2821 AAGGGAATTGTCCATTTTAATCAATGCGAATAGTTATAGCGTTGCGGATGTGGAAAAGAT R E L S I L I N A N S Y S V A D V E K I 2881 CCAAGTGGGTAATCATGTGCGTCTTGGCGATATTGCAAAAATTGAAATCGGTTTGGAAGA Q V G N H V R L G D I A K I E I G L E E 2 941 AGACAACACTTTTGCGAGCTTTAAAGACAAACCCGGTGTGATTTTAGAAATCCAAAAGAT D N T F A S F K D K P G V I L E I Q K I 3001 TGCCGGAGCGAATGAAATTGAAATCGTGGATAGGGTGTATGAAGCTTTAAAACACATTCA A G A N E I E I V D R V Y E A L K H I Q 3061 AGCCATTAGCCCCAGATATGAAATCAGACCCTTTTTAGACACCACGAGCTATATCCGCAC A I S P R Y E I R P F L D T T S Y I R T 3121 CTCTATTGAAGACGTGAAATTTGATCTAATCTTAGGAGCGATTTTAGCGGTTTTAGTGGT S I E D V K F D L I L G A I L A V L V V 3181 GTTTGCGTTCTTGCGTAACGGCACGATCACCCTTGTTTCAGCGATCTCTATCCCTATTTC 48 F A F L R N G T I T L V S A I S I P I S 3241 TATCATGGGGACTTTTGCGCTCATCCAATGGATGGGCTTTTCATTAAACATGCTCACCAT I M G T F A L I Q W M G F S L N M L T M 3301 GGTGGCTTTAACGCTAGCGATAGGGATTATCATTGATGATGCGATCGTGGTGATTGAAAA V A L T L A I G I I I D D A I V V I E N 3361 CATCCATAAAAAGCTAGAAATGGGCATGAACAAGCGCAAAGCGAGCTATGAAGGGGTGAG I H K K L E M G M N K R K A S Y E G V R 3421 GGAAATTGGCTTTGCTCTAGTGGCGATTTCAGCGATGCTGCTCTCTGTTTTTGTGCCTAT E I G F A L V A I S A M L L S V F V P I 34 81 AGGAAACATGAAAGGCATTATCGGGCGCTTTTTCCAAAGCTTTGGGATCACGGTGGCTTT G N M K G I I G R F F Q S F G I T V A L 3541 AGCGATCGCTCTATCGTATGTGGTGGTCGTTACGATTATCCCCATGGTAAGCTCAGTCGT A I A L S Y V V V V T I I P M V S S V V 3601 GGTCAATCCCAGGCATTCTCGTTTTTATGTGTGGAGTGAGCCTTTTTTTAAAGCTTTAGA V N P R H S R F Y V W S E P F F K A L E 3661 GTCTCGCTATACCAGATTACTCCAATGGGTATTAAACCACAAGCTCATTATCTCTATAGC S R Y T R L L Q W V L N H K L I I S I A 37 21 GGTGGTTTTGGTGTTTGTGGGTTCGCTTTTTGTGGCTTCTAAATTGGGTATGGAGTTCAT V V L V F V G S L F V A S K L G M E F M 37 81 GCTGAAAGAAGATAGGGGGAGGTTTTTGGTGTGGCTTAAGGCTAAACCGGGCGTGAGCAT L K E D R G R F L V W L K A K P G V S I 38 41 AGATTACATGACACAAAAGAGTAAGATCTTTCAAAAAGCGATTGAAAAACATGCTGAAGT D Y M T Q K S K I F Q K A I E K H A E V 3901 GGAATTCACCACCTTGCAAGTGGGTTATGGCACCACGCAAAACCCTTTTAAGGCTAAGAT E F T T L Q V G Y G T T Q N P F K A K I 3961 TTTTGTGCAGCTCAAGCCTTTAAAAGAGCGCAAAAAAGAGAGTGAATTAGGGCAATTTGA F V Q L K P L K E R K K E S E L G Q F E 4 021 GTTGATGAGCGCTTTAAGGAAGGAATTAAAAAGCATGCCTGAAGCTAAAGGTTTAGATAC L M S A L R K E L K S M P E A K G L D T 4 081 TATTAATCTTTCTGAAGTCTCGCTTTTAGGTGGCGGTGGGGATAGTTCGCCTTTCCAAAC I N L S E V S L L G G G G D S S P F Q T 4141 TTTTGTGTTTTCCCATTCTCAAGAAGCGGTGGATAAAAGCGTGGCGAATTTGAAAAAATT F V F S H S Q E A V D K S V A N L K K F 4201 CTTATTGGAAAGCCCTGAGTTAAAAGGCAAGATTGAAGGCTATCATACGAGCACGAGCGA L L E S P E L K G K I E G Y H T S T S E 4 261 ATCGCAACCGCAACTGCAACTGAAAATCTTAAGACAAAACGCCAACAAATACGGCGTGAG S Q P . Q L Q L K I L R Q N A N K Y G V S 4 321 CGCTCAAACCATTGGAGCAGTGGTGAGCTCTGCTTTCTCTGGGACTTCTCAAGCGAGCGT A Q T I G A V V S S A F S G T S Q A S V 4 381 GTTCAAAGAAGATGGTAAAGAATACGACATGATCATTAGAGTGCCTGATGACAAACGCGT F K E D G K E Y D M I I R V P D D K R V 4 4 41 TTCTGTAGAAGACATCAAACGCTTGCAAGTGCGTAACAAATACGATAAATTGATGTTTTT S V E D I K R L Q V R N K Y D K L M F L 4501 AGACGCTTTAGTGGAAATCACAGAAACTAAAAGCCCGTCCAGCATTTCTCGTTATAACCG D A L V E I T E T K S P S S I S R Y N R 4 5 61 CCAACGCAGCGTTACGGTGCTCGCTCAACCTAAAGCGGGTATCTCTTTAGGGGAAATTTT Q R S V T V L A Q P K A G I S L G E I L 4 621 AACGCAAGTGAGTAAAAACACTAAAGAATGGCTGGTTGAAGGGGCGAATTACAGATTTAC T Q V S K N T K E W L V E G A N Y R F T 4 681 CGGTGAAGCGGATAACGCTAAAGAGACTAATGGGGAGTTTTTAGTCGCTTTAGCGACAGC G E A D N A K E T N G E F L V A L A T A 4 741 GTTTGTGTTGATTTATATGATTTTAGCGGCGTTGTATGAATCCATTTTAGAGCCTTTTAT F V L I Y M I L A A L Y E S I L E P F I 4 801 CATCATGGTTACCATGCCTTTAAGCTTTTCAGGGGCGTTTTTTGCTCTAGGTTTAGTGCA I M V T M P L S F S G A F F A L G L V H 4 8 61 TCAGCCTTTGAGCATGTTCTCTATGATAGGCTTGATTTTGCTCATTGGTATGGTGGGTAA Q P L S M F S M I G L I L L I G M V G K 4 921 AAACGCCACGCTTTTAATTGATGTGGCGAATGAAGAGCGTAAAAAAGGTTTGAATATCCA N A T L L I D V A N E E R K K G L N I Q 4 981 AGAAGCCATTTTATTTGCCGGCAAAACCCGTCTAAGACCGATTTTAATGACGACCATTGC E A I L F A G K T R L R P I L M T T I A 5041 GATGGTTTGTGGCATGCTGCCTTTAGCGTTGGCGAGTGGGGATGGAGCGGCGATGAAATC M V C G M L P L A L A S G D G A A M K S 5101 CCCTATAGGGATTGCGATGAGTGGGGGCTTGATGATTTCTATGGTGTTAAGCTTACTCAT P I G I A M S G G L M I S M V L S L L I 5161 TGTGCCGGTGTTTTATCGCTTACTCGCTCCAATAGACGACAAAATCAAGCGGTTTTATCA V P V F Y R L L A P I D D K I K R F Y Q 5221 AAACCAAAAAGCTTTAGAATGAAAAAGATTGTTTTCATTTTGGCTTTATGGGCGGGCTTG N Q K A L E * 50 hemE-hefABC O M P hemE he/A he/B hefC ( o r f 604) (orf 605) (orf 606) (orf 607) hefDEF-orf968 O M P M F P U M P » » » » » » _ ^ hefD hefE hefF (orf 971) (orf970) (orf969) orf 96S orfl326-hefGHI O M P M F I I I orf 1326 he/G hefH (orf1327) (orf1328) hefl (orf1329) 600b 1-2 1 F i g u r e 6. S c h e m a t i c m a p a n d p r o p o s e d g e n e n a m e s f o r the th ree Helicobacter pylori R N D e f f l u x s y s t e m s . T h e p r o p o s e d n a m e i s l i s t e d b e l o w e a c h g e n e as i s the c o r r e s p o n d i n g H. pylori 6 6 3 9 5 O R F n u m b e r a s s i g n e d b y T h e I n s t i t u t e f o r G e n o m i c R e s e a r c h . hefA, hefD a n d hefG e n c o d e p u t a t i v e o u t e r m e m b r a n e p o r e p r o t e i n s ( O M P ) ; hefB, hefE a n d hefH e n c o d e t h e p u t a t i v e m e m b r a n e f u s i o n ( M F ) p r o t e i n s ; hefC, hefF a n d hefl e n c o d e t h e p u t a t i v e R N D e f f l u x p u m p p r o t e i n s . T h e hemE g e n e i s a n E. coli u r o p o r p h y r i n o g e n d e c a r b o x y l a s e h o m o l o g a n d t h e p u t a t i v e or/961 a n d orf!326 g e n e s are u n i q u e to H. pylori. 51 hefA a n d hefD. T h e orfl326 g e n e e n c o d e d a 125 a m i n o a c i d p r o t e i n o f u n k n o w n f u n c t i o n . T h e orfl326, hefG a n d hefH g e n e s a l l c o n t a i n e d t y p i c a l s i g n a l s e q u e n c e s . T h e hefDEF a n d hefGHI o p e r o n s w e r e h i g h l y c o n s e r v e d b e t w e e n H. pylori 2 6 6 9 5 a n d H. pylori J 9 9 i n r e s p e c t to t h e p r e d i c t e d p r o t e i n s e q u e n c e s as w e l l as t h e i r g e n e a r r a n g e m e n t . T h e hefDEF a n d t h e hefGHI g e n e s f r o m H. pylori 2 6 6 9 5 w e r e g r e a t e r t h a n 9 7 % a n d 9 1 % i d e n t i c a l at t h e a m i n o a c i d l e v e l c o m p a r e d to t h e i r c o r r e s p o n d i n g g e n e s i n H. pylori J 9 9 . T h e h i g h l e v e l o f s e q u e n c e c o n s e r v a t i o n a m o n g the R N D e f f l u x o p e r o n s f r o m t h e s e th ree H. pylori i s o l a t e s s u g g e s t s a p o s s i b l y c o n s e r v e d f u n c t i o n f o r t h e s e e f f l u x s y s t e m s i n t h e e c o l o g y o f H. pylori. C o m p a r i s o n o f t h e H. pylori 2 6 6 9 5 a n d H. pylori J 9 9 i n d i v i d u a l R N D e f f l u x o p e r o n s i n d i c a t e d a l o w d e g r e e o f s i m i l a r i t y ( T a b l e V I ) . T h e p u m p p r o t e i n s w e r e 2 3 . 8 t o 2 8 . 4 % i d e n t i c a l a n d 4 4 to 5 9 % s i m i l a r t o e a c h o ther . T h e m e m b r a n e f u s i o n p r o t e i n s w e r e 16 to 2 2 % i d e n t i c a l ( 4 2 t o 5 3 % s i m i l a r ) w h i l e the o u t e r m e m b r a n e p o r e p r o t e i n s w e r e 18 t o 2 2 % i d e n t i c a l ( 45 t o 4 9 % s i m i l a r ) t o e a c h o the r . P r e v i o u s l y i t h a s b e e n p r o p o s e d f r o m a n a l y s i s o f t h e R N D e f f l u x p u m p p r o t e i n s that the p u m p p r o t e i n s c l u s t e r t o g e t h e r a c c o r d i n g to subs t ra te s p e c i f i c i t y ( S a i e r et al, 1 9 9 8 ) . A n a l y s i s o f t h e H. pylori e f f l u x p u m p s w i t h o t h e r c h a r a c t e r i z e d R N D e f f l u x p u m p s r e v e a l e d that H e f F a n d H e f l w e r e m o s t s i m i l a r t o t h o s e R N D e f f l u x p u m p s i n v o l v e d i n t h e e f f l u x o f d i v a l e n t c a t i o n s w h i l e H e f C w a s m o s t s i m i l a r to R N D e f f l u x p u m p s c h a r a c t e r i z e d as m u l t i p l e d r u g e f f l u x p u m p s ( F i g u r e 7 ) . H o w e v e r , i t i s a p p a r e n t that t h e H. pylori R N D p u m p p r o t e i n s d i v e r g e d from t h e R N D p u m p p r o t e i n s from o t h e r b a c t e r i a l s p e c i e s . C o n s i s t e n t w i t h these f i n d i n g s , s e q u e n c e a n a l y s i s r e v e a l e d that the m e m b r a n e f u s i o n a n d o u t e r m e m b r a n e p o r e p r o t e i n s w e r e a l s o d i v e r g e n t from t h e i r o t h e r c h a r a c t e r i z e d h o m o l o g s . T h e s e r e s u l t s a re 52 Table VI. P e r c e n t a g e o f a m i n o a c i d s i m i l a r i t y a n d i d e n t i t y a m o n g Helicobacter pylori R N D e f f l u x o p e r o n p r o t e i n s Pump proteins \ ^ I d . %Sim>- HefC HefF Hefl AcrB CzcA HefC 25.8 23.8 27.4 23.7 HefF 43.7 28.4 23.1 35.5 Hefl 59.3 43.7 21.6 29.7 AcrB 63.9 59.0 57.3 24.2 CzcA 58.6 68.7 66.3 58.4 Membrane fusion proteins: \ ^ I d . %Sim>^ HefB HefE HefH AcrA CzcB HefB 20.3 16.3 16.1 14.0 HefE 44.2 21.8 17.5 16.2 HefH 41.2 53.4 18.7 18.4 AcrA 39.0 52.2 49.4 19.2 CzcB 32.8 41.7 40.6 43.7 Outer membrane pore proteins: \ ^ I d . %Sim>- HefA HefD HefG TolC CzcC HefA 19.5 17.6 18.8 18.9 HefD 49.1 22.0 17.8 20.3 HefG 51.6 53.5 20.7 16.8 TolC 47.0 49.6 45.8 19.7 CzcC 47.0 50.2 50.6 47.7 53 CnrA NccA HelA HefF CzcA Hefl HefC MexB AcrB MtrD MexD F i g u r e 7. P h y l o g e n e t i c t ree s h o w i n g the r e l a t i o n s h i p o f the H. pylori R N D p u m p p r o t e i n s to R N D p u m p p r o t e i n s from o t h e r b a c t e r i a l s p e c i e s . M u l t i p l e s e q u e n c e a n a l y s i s w a s d o n e u s i n g the C l u s t a l W m e t h o d a n d t h e p h y l o g e n e t i c t ree w a s c o n s t r u c t e d u s i n g t h e n e a r e s t n e i g h b o r d i s t a n c e m a t r i x . T h e t h r e e H. pylori R N D e f f l u x p u m p p r o t e i n s ( H e f D , H e f G a n d H e f L ) a re d i v e r g e n t from t h e c l u s t e r s o f R N D e f f l u x p u m p p r o t e i n s i n v o l v e d i n t h e e f f l u x o f d i v a l e n t c a t i o n s ( C n r A , Ralstonia eutropha; N c c A , Alcaligenes denitrificans; H e l A , Legionella pneumophila; C z c A , Ralstonia eutropha) a n d t h o s e p u m p s i n v o l v e d i n m u l t i p l e d r u g e f f l u x ( A c r A , E. coli; M e x B , P. aeruginosa; M e x D , P. aeruginosa; M t r D , Neisseria gonorrhoeae). 54 c o n s i s t e n t w i t h e a r l y a c q u i s i t i o n o f t h e s e g e n e s a n d s u b s e q u e n t d i v e r g e n c e . T h e d i v e r g e n c e o f t h e s e s y s t e m s m a y r e f l e c t t h e e v o l u t i o n o f f u n c t i o n a l d i f f e r e n c e s i n c l u d i n g d i f f e r e n c e s i n subs t ra te s p e c i f i c i t y a m o n g t h e s e th ree e f f l u x s y s t e m s . 2.3 1-N-phenylnapthylamine uptake and the interaction of polymyxin B with the outer membrane oi Helicobacter pylori N P N i s a s u b s t r a t e f o r a c t i v e e f f l u x s y s t e m s i n m a n y G r a m n e g a t i v e b a c t e r i a a n d I d e c i d e d to e x a m i n e w h e t h e r N P N w a s a subs t ra te f o r a c t i v e e f f l u x i n H. pylori. N P N i s a s m a l l , h y d r o p h o b i c f l u o r e s c e n t c o m p o u n d that f l u o r e s c e s w e a k l y i n a q u e o u s e n v i r o n m e n t s b u t s t r o n g l y i n h y d r o p h o b i c e n v i r o n m e n t s s u c h as the m e m b r a n e c o m p a r t m e n t o f b a c t e r i a l c e l l s ( L o h et al, 1 9 8 4 ; M o o r e et al, 1 9 8 6 ) . I n G r a m n e g a t i v e b a c t e r i a , N P N i s e x c l u d e d f r o m the m e m b r a n e c o m p a r t m e n t b y the h i g h l y c h a r g e d , d i v a l e n t c a t i o n - b r i d g e d l i p o p o l y s a c c h a r i d e o f t h e o u t e r m e m b r a n e a n d t h e r e f o r e r e q u i r e s t h e p r e s e n c e o f a m e m b r a n e d e s t a b i l i z i n g a g e n t s u c h as p o l y m y x i n B f o r e n t r y i n t o t h e m e m b r a n e s ( L o h et al, 1 9 8 4 ; M o o r e et al, 1 9 8 6 ) . S i n c e H. pylori i s i n t r i n s i c a l l y r e s i s t a n t to p o l y m y x i n B , I f i r s t i n i t i a t e d e x p e r i m e n t s to a n a l y z e the i n t e r a c t i o n o f p o l y m y x i n B w i t h the o u t e r m e m b r a n e o f H. pylori u s i n g N P N . T i t r a t i o n o f H. pylori w i t h p o l y m y x i n B r e v e a l e d that t h e m a x i m u m l e v e l o f N P N u p t a k e o c c u r r e d at a p p r o x i m a t e l y 6 .4 p g / m l p o l y m y x i n B ( F i g u r e 8) . T h u s H. pylori r e q u i r e d a p p r o x i m a t e l y a 1 0 - f o l d h i g h e r c o n c e n t r a t i o n o f p o l y m y x i n B to p e r m e a b i l i z e i t s o u t e r m e m b r a n e t h a n w a s r e q u i r e d f o r E. coli (not s h o w n ) . T h i s c o r r e l a t e d w e l l w i t h t h e M I C s o f H. pylori a n d E. coli to p o l y m y x i n B ( 5 - 8 p g / m l a n d 0 .5 p g / m l , r e s p e c t i v e l y ) . T h e p o l y m y x i n B -s t i m u l a t e d u p t a k e o f N P N b y H. pylori w a s i n h i b i t e d b y M g 2 + as i s o b s e r v e d b y u s e o f t h i s F i g u r e 8. T i t r a t i o n oi Helicobacter pylori w i t h p o l y m y x i n B . H. pylori w a s r e s u s p e n d e d i n H E P E S b u f f e r w i t h o u t M g C f i as d e s c r i b e d i n t h e M a t e r i a l s a n d M e t h o d s . T h e c e l l s u s p e n s i o n w a s i n c u b a t e d w i t h 10 p M N P N a n d i n c r e a s i n g a m o u n t s o f p o l y m y x i n B w e r e a d d e d a n d t h e m a x i m u m l e v e l o f f l u o r e s c e n c e w a s r e c o r d e d . T h i s e x p e r i m e n t w a s p e r f o r m e d o n c e a n d f l u o r e s c e n c e i s e x p r e s s e d i n a r b i t r a r y u n i t s (a . u.). R e s u l t s s u g g e s t e d that 6 . 4 - 1 0 u.g p o l y m y x i n B w a s r e q u i r e d f o r m a x i m a l u p t a k e o f N P N b y H. pylori. S u b s e q u e n t l y , 6 . 4 p . g / m l p o l y m y x i n B w a s u s e d i n N P N a s s a y s . 56 a s s a y w i t h o t h e r G r a m n e g a t i v e b a c t e r i a a n d w a s c o n s i s t e n t w i t h the p r e s e n c e o f t h e s e l f -p r o m o t e d u p t a k e p a t h w a y i n H. pylori ( F i g u r e s 9 & 10) . I n t e r e s t i n g l y , t h e l e v e l o f N P N u p t a k e w a s d r a s t i c a l l y r e d u c e d u n d e r a c i d i c c o n d i t i o n s ( F i g u r e 11) . T h e s i g n i f i c a n c e o f t h i s la t te r f i n d i n g i s u n c l e a r a n d i t i s n o t k n o w i f i t i s t h e r e s u l t o f m e m b r a n e s t a b i l i z a t i o n at a c i d p H , r e d u c e d p o l y m y x i n B b i n d i n g , o r o t h e r n o n s p e c i f i c p H - i n d u c e d a l t e r a t i o n s i n H. pylori p h y s i o l o g y . I n c u b a t i o n o f E. coli w i t h N P N p r o d u c e d a b a s a l l e v e l o f 2 0 f l u o r e s c e n c e u n i t s ( F i g u r e 1 2 A ) . T h e a d d i t i o n o f 0 . 6 4 u.g p o l y m y x i n B to the m i x t u r e r e s u l t e d i n t h e r a p i d u p t a k e o f N P N w h i c h r a p i d l y r e a c h e d a m a x i m u m l e v e l . U p o n r e a c h i n g the m a x i m u m l e v e l o f N P N a c c u m u l a t i o n b y t h e c e l l s , the f l u o r e s c e n c e l e v e l b e g a n to g r a d u a l l y d e c r e a s e i n t h e p r e s e n c e o f a p r o t o n m o t i v e f o r c e ( P M F ) c o n s i s t e n t w i t h the a c t i v e e x t r u s i o n o f N P N b y t h e c e l l ' s e f f l u x s y s t e m s . D i s s i p a t i o n o f t h e p r o t o n m o t i v e f o r c e b y p r e i n c u b a t i o n o f t h e c e l l s w i t h the u n c o u p l e r C C C P c o m p l e t e l y a b o l i s h e d the e x t r u s i o n o f N P N b y the c e l l s . T h e s e r e s u l t s f o r E. coli w e r e s i m i l a r t o t h o s e p r e v i o u s l y o b s e r v e d b y L o h et al. ( 1 9 8 4 ) f o r P. aeruginosa. I n c u b a t i o n o f H. pylori i n t h e p r e s e n c e o f N P N p r o d u c e d a s i g n i f i c a n t l y h i g h e r b a c k g r o u n d l e v e l o f f l u o r e s c e n c e c o m p a r e d to E. coli ( F i g u r e 1 2 B ) . T h i s h i g h b a c k g r o u n d l e v e l o f f l u o r e s c e n c e i n d i c a t e d that e i t h e r the o u t e r m e m b r a n e o f in vitro-grown H. pylori w a s p e r m e a b l e to h y d r o p h o b i c c o m p o u n d s o r that t he re w a s a l a c k o f a c t i v e e f f l u x i n in v z Y r o - g r o w n H. pylori. T h e a d d i t i o n o f p o l y m y x i n B r e s u l t e d i n the r a p i d u p t a k e o f N P N s i m i l a r t o that s e e n w i t h E. coli. I n c o n t r a s t , o n c e t h e f l u o r e s c e n c e l e v e l h a d r e a c h e d i ts m a x i m u m l e v e l i t d i d n o t d i m i n i s h o v e r t h e t i m e c o u r s e o f t h e s e e x p e r i m e n t s s u g g e s t i n g that H. pylori d i d n o t e f f l u x N P N . O n e p o t e n t i a l e x p l a n a t i o n f o r t h e l a c k o f a n y d e t e c t a b l e e f f l u x a c t i v i t y w a s t h e d e e n e r g i z a t i o n o f t h e c e l l m e m b r a n e o v e r t h e c o u r s e o f the e x p e r i m e n t s . H o w e v e r , e x a m i n a t i o n 57 F i g u r e 9. M g C L _ i n h i b i t i o n o f p o l y m y x i n B - s t i m u l a t e d N P N u p t a k e i n Helicobacter pylori. N P N u p t a k e a s s a y s w e r e p e r f o r m e d u s i n g 6 .4 p g / m l o f p o l y m y x i n B w i t h H. pylori i n the p r e s e n c e o f 0 , 1, 10 , 2 5 o r 5 0 m M M g C F . . T h e p r e s e n c e o f M g C l 2 i n the a s s a y b u f f e r r e d u c e d the l e v e l o f N P N u p t a k e b y t h e c e l l s . T h e e x p e r i m e n t s w e r e p e r f o r m e d 3 t i m e s a n d r e p r e s e n t a t i v e d a t a from o n e e x p e r i m e n t i s s h o w n . B a s a l l e v e l o f N P N u p t a k e i s d e f i n e d as 0 f l u o r e s c e n c e u n i t s a n d f l u o r e s c e n c e i s e x p r e s s e d i n a r b i t r a r y u n i t s (a. u.). R e s u l t s a re e x p r e s s e d as t h e c h a n g e s i n f l u o r e s c e n c e r e l a t i v e to t h e c o n t r o l (0 m M MgCl2). T h e s e d a t a s u g g e s t that M g 2 + i s c o m p e t i n g w i t h p o l y m y x i n B f o r b i n d i n g s i tes o n the L P S o f H. pylori. 58 8 -, -1 . . -2 -3 -1 10 100 [Polymyxin B] Ug F i g u r e 1 0 . M g 2 + i n h i b i t s p o l y m y x i n B p e r m e a b i l i z a t i o n o f the Helicobacter pylori o u t e r m e m b r a n e . H. pylori w a s r e s u s p e n d e d i n H E P E S b u f f e r ( p H 7 ) c o n t a i n i n g 0 , 10 o r 5 0 m M M g C ^ . N P N w a s a d d e d to 10 m M a n d t h e s p e c i f i e d a m o u n t s o f p o l y m y x i n B w e r e a d d e d to the c e l l s o l u t i o n a n d t h e m a x i m u m l e v e l o f f l u o r e s c e n c e w a s r e c o r d e d on a c h a r t r e c o r d e r . T h e e x p e r i m e n t s w e r e p e r f o r m e d 3 t i m e s a n d r e p r e s e n t a t i v e d a t a f r o m one e x p e r i m e n t i s s h o w n . B a s a l l e v e l o f N P N u p t a k e i s d e f i n e d as 0 f l u o r e s c e n c e u n i t s a n d f l u o r e s c e n c e i s e x p r e s s e d i n a r b i t r a r y u n i t s (a . u. ) . T h e r e s u l t s s h o w that the M g 2 + i n h i b i t s t h e u p t a k e o f N P N b y t h e c e l l s p r e s u m a b l y b y c o m p e t i n g w i t h p o l y m y x i n B f o r b i n d i n g s i tes o n the c e l l s L P S . 59 120 S3 u a I-o S 100 80 60 40 20 • P H 4 • P H 7 1 0 1 0 0 [Polymyxin B] ug 2 0 0 F i g u r e 11. E f f e c t o f p H o n p e r m e a b i l i z a t i o n o f the Helicobacter pylori o u t e r m e m b r a n e b y p o l y m y x i n B . H. pylori r e s u s p e n d e d i n H E P E S b u f f e r at p H 4 o r p H 7 w a s u s e d i n N P N u p t a k e e x p e r i m e n t s w i t h t h e l i s t e d c o n c e n t r a t i o n s o f p o l y m y x i n B . T h i s e x p e r i m e n t w a s p e r f o r m e d o n c e . B a s a l l e v e l o f N P N u p t a k e i s d e f i n e d as 0 f l u o r e s c e n c e u n i t s a n d f l u o r e s c e n c e u n i t s a re e x p r e s s e d i n a r b i t r a r y u n i t s (a . u.) . U p t a k e o f N P N w a s d r a m a t i c a l l y r e d u c e d at a c i d p H . 60 F i g u r e 12. U p t a k e o f 1 - N - p h e n y l n a p t h y l a m i n e b y Escherichia coli ( p a n e l A ) a n d Helicobacter pylori ( p a n e l B ) . I n c u b a t i o n o f the c e l l s i n the p r e s e n c e o f N P N a l o n e p r o d u c e d a s i g n i f i c a n t l y h i g h e r b a c k g r o u n d l e v e l o f f l u o r e s c e n c e i n H. pylori t h a n i n E. coli ( p a n e l A a n d B , d a s h e d l i n e ) . T h e a d d i t i o n o f N P N a n d p o l y m y x i n B to the c e l l s r e s u l t e d i n t h e r a p i d a c c u m u l a t i o n o f N P N b y b o t h E. coli a n d H. pylori ( p a n e l A a n d B , s o l i d l i n e ) , h o w e v e r , N P N w a s n o t a s u b s t r a t e f o r e x t r u s i o n i n H. pylori. I n c u b a t i o n o f E. coli w i t h C C C P p r i o r t o t h e a d d i t i o n o f N P N a n d p o l y m y x i n B h a l t s t h e e x t r u s i o n o f N P N b y E. coli ( p a n e l A , d o t t e d l i n e ) . P r e i n c u b a t i o n o f H. pylori w i t h C C C P c o m p l e t e l y a b o l i s h e d t h e u p t a k e to N P N b y t h e c e l l s ( p a n e l B , d o t t e d l i n e ) . T h i s e x p e r i m e n t w a s p e r f o r m e d s i x t i m e a n d r e p r e s e n t a t i v e d a t a f r o m o n e e x p e r i m e n t are p r e s e n t e d . 61 o f t h e c e l l s b y p h a s e c o n t r a s t m i c r o s c o p y s h o w e d that the c e l l s w e r e a c t i v e l y m o t i l e w h i c h s u g g e s t s that t h e c e l l s m a i n t a i n e d a p r o t o n m o t i v e f o r c e t h r o u g h o u t t h e s e e x p e r i m e n t s . R e g a r d l e s s , t h e H. pylori c e l l s w e r e p r e i n c u b a t e d w i t h 18 d i f f e r e n t p o t e n t i a l c a r b o n s o u r c e s (see M a t e r i a l s a n d M e t h o d s ) t o s e e i f t h e a d d i t i o n o f t h e s e c a r b o n s o u r c e s c o u l d e n e r g i z e a c t i v e e f f l u x o f N P N . T h e e x p e r i m e n t s w e r e a l s o r e p e a t e d at p H 4 a n d p H 9 i n t h e a b s e n c e o f a c a r b o n s o u r c e i n a n a t t e m p t t o i n d u c e a n a r t i f i c i a l P M F . H o w e v e r , n e i t h e r t h e a d d i t i o n o f t h e s e c a r b o n s o u r c e s n o r t h e a l t e r a t i o n o f t h e a s s a y m e d i u m p H w e r e r e s u l t e d i n t h e e x t r u s i o n o f N P N b y H. pylori s u g g e s t i n g that N P N w a s n o t a subs t ra te f o r a c t i v e e f f l u x b y in vitro-grown H. pylori. P r e t r e a t m e n t o f H. pylori w i t h as l i t t l e as 1 u M o f t h e u n c o u p l e r C C C P , f o r u n k n o w n r e a s o n s , c o m p l e t e l y a b o l i s h e d t h e p o l y m y x i n B - s t i m u l a t e d u p t a k e o f N P N i n t h e s e e x p e r i m e n t s w h e r e a s p r e t r e a t m e n t w i t h a z i d e o r a r s e n a t e h a d n o e f f e c t ( F i g u r e 13) . I n c o n t r a s t , n e i t h e r 1 u M C C C P n o r t h e c o n c e n t r a t i o n s g e n e r a l l y u s e d i n E. coli (5 p M ) a n d P. aeruginosa ( 2 5 0 u .M) to i n h i b i t e n e r g y d e p e n d e n t e f f l u x ( L o h et al, 1 9 8 4 ) , h a d a n y e f f e c t o n the b a c k g r o u n d l e v e l o f N P N u p t a k e b y t h e s e c e l l s . T o r u l e o u t t h e p o s s i b i l i t y that C C C P a f f e c t e d t h e i n t e r a c t i o n o f p o l y m y x i n B w i t h t h e o u t e r m e m b r a n e o f H. pylori, I a n a l y z e d t h e i n t e r a c t i o n o f d a n s y l - l a b e l l e d p o l y m y x i n B w i t h H. pylori. T h e r e s u l t s o f these e x p e r i m e n t s s h o w e d that C C C P - t r e a t e d H. pylori b o u n d a n i d e n t i c a l a m o u n t o f d a n s y l p o l y m y x i n B as d i d t h e u n t r e a t e d c o n t r o l . T h i s s u g g e s t s that C C C P t r e a t m e n t d i d n o t a f f e c t the i n t e r a c t i o n o f p o l y m y x i n B w i t h t h e o u t e r m e m b r a n e o f H. pylori, b u t i n s t e a d p r e v e n t e d u p t a k e o f N P N b y a m e c h a n i s m that w a s i n h i b i t e d b y C C C P . 62 [ C C C P ] u M F i g u r e 1 3 . I n h i b i t i o n o f p o l y m y x i n B - s t i m u l a t e d N P N u p t a k e b y C C C P i n Helicobacter pylori. H. pylori 1 1 6 3 7 w a s p r e i n c u b a t e d w i t h t h e s p e c i f i e d c o n c e n t r a t i o n o f C C C P f o r 5 m i n p r i o r t o the a d d i t i o n o f N P N a n d 6 .4 p g / m l o f p o l y m y x i n B . T h e e x p e r i m e n t s w e r e p e r f o r m e d 3 t i m e s a n d r e p r e s e n t a t i v e d a t a f r o m o n e e x p e r i m e n t i s s h o w n . B a s a l l e v e l o f N P N u p t a k e i s d e f i n e d as 0 f l u o r e s c e n c e u n i t s a n d f l u o r e s c e n c e i s e x p r e s s e d i n a r b i t r a r y u n i t s (a . u.). C h a n g e s i n the f l u o r e s c e n c e l e v e l w a s r e c o r d e d o n a c h a r t r e c o r d e r . S t e a d y state l e v e l s o f f l u o r e s c e n c e w e r e r e c o r d e d a n d d a t a p r e s e n t e d i s r e l a t i v e to t h e u n t r e a t e d c o n t r o l ( 0 p M C C C P ) . C e l l c u l t u r e s w e r e p r e i n c u b a t e d w i t h s o d i u m a rsenate ( A R S ) a n d p o t a s s i u m c y a n i d e ( K C N ) f o r 15 m i n p r i o r t o a s s a y i n i t i a t i o n . 63 2.4 Accumulation of 3H-tetracycline and 3H-chloramphenicol by Helicobacter pylori. S i n c e N P N w a s n o t a s u b s t r a t e f o r a c t i v e e f f l u x b y H. pylori, I e x a m i n e d t h e 3 3 3 3 a c c u m u l a t i o n o f H - t e t r a c y c l i n e a n d H - c h l o r a m p h e n i c o l b y H. pylori; H - t e t r a c y c l i n e a n d H -c h l o r a m p h e n i c o l a re t y p i c a l l y s u b s t r a t e s f o r a c t i v e e f f l u x b y R N D m u l t i p l e d r u g e f f l u x s y s t e m s . I n c u b a t i o n o f H. pylori 2 6 6 9 5 s e p a r a t e l y w i t h 3 H - t e t r a c y c l i n e a n d 3 H - c h l o r a m p h e n i c o l r e s u l t e d i n t h e a c c u m u l a t i o n o f r a d i o l a b e l b y t h e c e l l s . P r e t r e a t m e n t o f H. pylori w i t h C C C P r e s u l t e d i n a n a p p r o x i m a t e l y 5 0 % r e d u c t i o n i n t h e a c c u m u l a t i o n o f b o t h 3 H - c h l o r a m p h e n i c o l ( F i g u r e 14) a n d H - t e t r a c y c l i n e (no t s h o w n ) r e l a t i v e to the u n t r e a t e d c o n t r o l . T h e s e r e s u l t s w e r e c o n t r a r y to w h a t w a s e x p e c t e d f o r a s y s t e m i n w h i c h a c t i v e e f f l u x p l a y e d a r o l e . I f a c t i v e e f f l u x w e r e i n v o l v e d , t h e s t e a d y s ta te l e v e l a c c u m u l a t i o n o f a n t i b i o t i c s h o u l d i n c r e a s e f o l l o w i n g t r e a t m e n t w i t h C C C P , s i n c e t h e s t e a d y state l e v e l o f a n t i b i o t i c i s d e t e r m i n e d b y the b a l a n c e o f i n f l u x a n d e f f l u x ( M a et al, 1 9 9 6 ) . T r e a t m e n t o f m o s t b a c t e r i a l c e l l s w i t h C C C P n o r m a l l y n e g a t e s p r o t o n -d e p e n d e n t e f f l u x ( L e v y , 1 9 9 2 ) ( b y d i s s i p a t i o n o f the P M F w h i c h e n e r g i z e s e f f l u x ) a n d t h e r e f o r e w o u l d r e s u l t i n a n i n c r e a s e i n the s t e a d y state l e v e l o f the a n t i b i o t i c . T h e r e s u l t s f o r H. pylori w e r e t h e r e f o r e c o n s i s t e n t w i t h a n a c t i v e u p t a k e m e c h a n i s m ( L e v y , 1 9 9 2 ) f o r t h e s e a n t i b i o t i c s o r a l t e r n a t i v e l y t h e p a r t i t i o n i n g o f t h e a n t i b i o t i c s a c r o s s the c e l l m e m b r a n e a c c o r d i n g to a m e m b r a n e p o t e n t i a l ( N i k a i d o & T h a n a s i . 1 9 9 3 ) . It i s i n t e r e s t i n g to n o t e that t h e s e r e s u l t s a re s i m i l a r t o t h o s e o f M o o r e et al. f o r the u p t a k e o f r a d i o l a b e l e d m e t r o n i d a z o l e b y H. pylori ( M o o r e etal, 1 9 9 5 a ) 64 F i g u r e 1 4 . C C C P i n h i b i t i o n o f 3 H - c h l o r a m p h e n i c o l u p t a k e b y Helicobacter pylori. H. pylori ( s o l i d b a r s ) a n d H. pylori p r e t r e a t e d w i t h 4 0 u M C C C P ( o p e n b a r s ) , w e r e i n c u b a t e d s e p a r a t e l y i n t h e p r e s e n c e o f 3 H - c h l o r a m p h e n i c o l . A l i q u o t s w e r e r e m o v e d at 1, 1 5 , 3 0 a n d 4 5 m i n u t e s f o l l o w i n g t h e a d d i t i o n o f 3 H - c h l o r a m p h e n i c o l a n d p r o c e s s e d as s ta ted i n t h e M a t e r i a l s a n d M e t h o d s s e c t i o n . T h e a m o u n t o f r a d i o a c t i v i t y o n the f i l t e r w a s d e t e r m i n e d b y s c i n t i l l a t i o n c o u n t i n g . T h e r e l a t i v e u p t a k e i s d e f i n e d as the p e r c e n t a g e o f r a d i o a c t i v i t y ( c p m ) a c c u m u l a t e d b y the c e l l s . T h e e x p e r i m e n t s w e r e p e r f o r m e d 3 t i m e s w i t h 3 d i f f e r e n t H. pylori i s o l a t e s ( 1 1 6 3 7 , 7 4 4 a n d 7 5 4 ) . P r e s e n t e d d a t a i s f r o m 1 e x p e r i m e n t a n d i s r e p r e s e n t a t i v e o f t h e d a t a f r o m a l l the t e s t e d H. pylori s t r a i n s . T h e s e r e s u l t s s u g g e s t that p r e t r e a t m e n t o f H. pylori w i t h C C C P i n h i b i t s the u p t a k e o f 3 H - c h l o r a m p h e n i c o l . S i m i l a r r e s u l t s w e r e o b s e r v e d w i t h 3 H - t e t r a c y c l i n e . 65 Chapter 3. Sequence analysis of the Helicobacter pylori Hop protein family: Identification of a conserved structural motif. 3.0 Introduction E x n e r et al. ( 1 9 9 5 ) p r e v i o u s l y p u r i f i e d , c h a r a c t e r i z e d t h e p o r e f o r m i n g a b i l i t y o f a n d o b t a i n e d t h e N - t e r m i n a l a m i n o a c i d s e q u e n c e s f o r f i v e p o r i n p r o t e i n s f r o m in vitro-grown H. pylori. T h e N - t e r m i n a l a m i n o a c i d s e q u e n c e s o f f o u r o f the f i v e p r o t e i n s c o n t a i n e d s t r o n g s e q u e n c e i d e n t i t y a n d t h e s e p r o t e i n s w e r e s u b s e q u e n t l y n a m e d t h e H o p f a m i l y ( H e l i c o b a c t e r o u t e r m e m b r a n e p r o t e i n ) w i t h t h e i n d i v i d u a l p r o t e i n s b e i n g n a m e d H o p A - E . W i t h the r e l e a s e o f t h e H. pylori 2 2 6 9 5 g e n o m e s e q u e n c e b y T I G R t h i s f a m i l y w a s e x p a n d e d to 3 2 m e m b e r s ( T o m b et al., 1 9 9 7 ) , a m o n g w h i c h w e r e p r o t e i n s p r e v i o u s l y i d e n t i f i e d as a d h e s i n s ( l i v e r et al., 1 9 9 8 ) . M e m b e r s o f t h e H o p f a m i l y r a n g e d i n s i z e f r o m 85 to 1 2 3 0 a m i n o a c i d s a n d c o n t a i n e d e x t e n s i v e a m i n o a c i d s e q u e n c e c o n s e r v a t i o n ( T o m b et al., 1 9 9 7 ) . T h e r o l e o f t h e c o n s e r v e d r e g i o n s a m o n g t h e H o p p r o t e i n s i s u n k n o w n , b u t i t w a s s u g g e s t e d that t h e c o n s e r v e d n u c l e o t i d e s e q u e n c e s o f t h e g e n e s m a y f u n c t i o n i n h o m o l o g o u s r e c o m b i n a t i o n to g e n e r a t e c h r o m o s o m e r e a r r a n g e m e n t s a n d a n t i g e n i c d i v e r s i t y o r i n a d a p t i v e r e s p o n s e to c h a n g e s i n t h e e n v i r o n m e n t ( B e r g et al., 1 9 9 7 ; T o m b et al., 1 9 9 7 ) . S e v e r a l s t u d i e s h a v e s u g g e s t e d s i g n i f i c a n t g e n o m i c v a r i a t i o n a m o n g H. pylori i s o l a t e s ( A k o p y a n z et al, 1 9 9 2 ; G o et al, 1 9 9 6 ; J i a n g et al, 1 9 9 6 ) . I n t h i s c h a p t e r I d e s c r i b e m y s e q u e n c e a n a l y s i s o f the H o p f a m i l y w h i c h l e d to the d e v e l o p m e n t o f t h e h y p o t h e s i s that t h e c o n s e r v e d m o t i f s a m o n g t h e H o p f a m i l y p r o t e i n s are a c o n s e r v e d s t r u c t u r a l m o t i f f o r a f a m i l y o f (3 -barre l p r o t e i n s . I t e s t e d t h i s h y p o t h e s i s , u s i n g H o p E as a m o d e l p r o t e i n , b y i n s e r t i o n a l m u t a g e n e s i s . T h e r e s u l t s o f t h e s e s t u d i e s i n c o n j u n c t i o n w i t h t h e s e q u e n c e a n a l y s i s o f the H o p f a m i l y i n H. pylori J 9 9 , s u g g e s t e d that the 66 c o n s e r v e d s e q u e n c e s a m o n g t h e H o p f a m i l y d o n o t f u n c t i o n i n r e c o m b i n a t i o n b u t i n s t e a d s e r v e as a c o n s e r v e d s c a f f o l d i n g s t r u c t u r e f o r a f a m i l y o f P -barrel p r o t e i n s . 3 .1 S e q u e n c e a n a l y s i s o f t h e H o p f a m i l y u s i n g t h e B L O C K S m e t h o d M y a n a l y s i s o f t h e H. pylori 2 2 6 9 5 g e n o m e r e v e a l e d a n a d d i t i o n a l t w o m e m b e r s o f t h e H o p f a m i l y ( O R F s 0 1 0 1 a n d 1 0 6 6 ) t h u s i n c r e a s i n g t h e t o t a l n u m b e r o f m e m b e r s o f t h e H o p f a m i l y to 3 4 . T h e 3 4 m e m b e r s o f t h e H o p f a m i l y w e r e u s e d i n m u l t i p l e s e q u e n c e a l i g n m e n t a n a l y s i s u s i n g t h e G i b b s m o t i f s a m p l i n g a l g o r i t h m ( N e u w a l d et al, 1 9 9 5 ) i m p l e m e n t e d w i t h the M A C A W u s e r i n t e r f a c e ( N C B I , W a s h i n g t o n , D . C . ) w i t h a m a x i m u m a l i g n m e n t w i n d o w o f 18 a m i n o a c i d s a n d a m i n i m u m a l i g n m e n t w i n d o w o f 6 a m i n o a c i d s . T h e r e s u l t s o f t h i s a n a l y s i s a re s h o w n i n F i g u r e s 15 a n d 16 . F i g u r e 15 s h o w s a g r a p h i c a l v i e w o f the a l i g n m e n t w i t h i d e n t i f i e d B L O C K S o f c o n s e r v e d a m i n o a c i d s e q u e n c e i n b l a c k w h i l e F i g u r e 16 s h o w s the a m i n o a c i d s e q u e n c e o f t h e m a j o r B L O C K S that w e r e i d e n t i f i e d a n d s h o w n i n F i g u r e 15 . T h e B L O C K S a l i g n m e n t r e v e a l e d that t he re are at l e a s t m a j o r 8 c o n s e r v e d m o t i f s a m o n g the H o p f a m i l y a n d that t h e s e c o n s e r v e d m o t i f s w e r e s e p a r a t e d b y v a r y i n g l e n g t h s o f n o n - c o n s e r v e d a m i n o a c i d s e q u e n c e s . A d d i t i o n a l l y , t hese r e s u l t s s u g g e s t e d that the H o p f a m i l y c a n b e b r o k e n d o w n i n t o t w o s u b f a m i l i e s , t h o s e w i t h ( 2 4 p r o t e i n s ) a n d t h o s e w i t h o u t ( 1 0 p r o t e i n s ) s e q u e n c e c o n s e r v a t i o n at t h e i r N - t e r m i n i . T h e s i g n i f i c a n c e o f the N - t e r m i n a l B L O C K o r w h e t h e r t he re i s a s t r u c t u r a l o r f u n c t i o n a l b a s i s f o r s u b g r o u p i n g the H o p f a m i l y i s n o t k n o w n . 67 m m 0 50 100 1 1 l 150 200 250 300 350 400 450 500 I I I 550 600 650 700 750 800 850 900 95010001050110011501 . 1 1 1 I 1 I I 1 I I I I I 200125013001350140014501500 l l l l l l l HP0009 n m=mf m HP0025 CD mm WD m=D w=m m HP0078 •=> m HP0079 m m=> • m m HP0101 I HP0127 = m> m=D • m= m HP0227 MD » • HP0229 • n mm m HP0252 CD 0B=i r> •= WDUP m HP0254 » t- •=• u-mi m HP0317 CJ *D •=> w=m: m HP0324 LZZZZ2 •= ) WD M' i mm m HP0472 CD *D m Wt> mm m HP0477 CD 1 [—j • • m wt=> • V I HP0638 a m=D 1— w=mp wt HP0671 = •=> • • • i •> • HP0706 HP0722 HP0725 cn mmcD m » WD m m m KD • K B • B 1 • • E mDrnz • HP0796 •=1 wmv m HP0896 CD ••=1 1=1 •=> r * • HP0912 CD (•=> *- •=> • HP0913 C=D ••=) WD WfD •=>•? • HP0923 1=3 m=D m •=> HP1086 a • • • - V • = i - • HP1107 = V •=> • : •=> • HP1113 •= mmvD m •=> * •=• HP1156 [=i • • = i WD mzj l=*P • HP1177 CD ••=> •=> •=> m > m HP1243 CD •-] m=D WDW • HP1342 • ••=! l=i •=> F i g u r e 1 5 . S c h e m a t i c o f i d e n t i f i e d B L O C K S o f c o n s e r v e d a m i n o a c i d s e q u e n c e a m o n g the H. pylori H o p / a d h e s i n f a m i l y o f o u t e r m e m b r a n e p r o t e i n s . C o n s e r v e d B L O C K S w e r e i d e n t i f i e d u s i n g the M A C A W c o m p u t e r p r o g r a m ( N C B I , W a s h i n g t o n D . C . ) a n d a re a l i g n e d a n d s h a d e d b l a c k ; u n c o n s e r v e d a m i n o a c i d s e q u e n c e i s r e p r e s e n t e d b y t h e u n s h a d e d b a r s . B L O C K S are s e p a r a t e d b y v a r y i n g l e n g t h s o f u n c o n s e r v e d a m i n o a c i d s e q u e n c e . H P 1 1 7 5 w a s o m i t t e d f r o m the f i g u r e d u e t o s i z e c o n s t r a i n t s . 68 VO 0 0 U O H-1 PQ C D C D PI O O U v© 1—1 <U ha s ex fa o Q 1 C O 1 Cn a o 03 03 Q O HH z a Z a a a 1 z Z 1 1 I—1 z z Cd Q 3 Z a Cu a z Z D z z z 1 M M 1 >• 1 < M M X Cu H H Cu M HH E H 1—1 HH H 1—1 i—i 1 Cu Cu 1 Cu 1 CU Cu Cu > M Cu Cu HH Cu S > HH HH Cu HH 0 3 z z 1 z 1 z z z Z Z z z z z z z Q z z Z X, X > 1 X 1 Cu X HH X S X s > X HH X < > X > X H P 1 H P 1 H P H P H P HH HH HH > 1—1 HH HH HH HH HH HP Hi HH > HH 1 > 1 > < H P Cu Cu «: eC HH X H H H HH HH < HP Cu Q Q 1 Q 1 a Q Q a Q Q a a Q Q a Q a a a Q En C O 1 Cu 1 E H 2 C O E H E H < > o l—l H HH C O C O < C O < o O 1 o 1 o o o O O O o C3 z 13 O 1 3 C3 13 C3 > > 1 > 1 < > rt > fiC Cu > 13 •4 Cu > > u Cu o P S O O 1 o 1 o o o o 13 O o O C3 C3 o o C3 o C3 X X 1 >H 1 X X X X X X X X X X X s X X X X tn z o 1 a • 3 Cu > Cu S 1 iu1 H H > H^ s s s 03 > z Cd 1 0 3 > HH H l> z 1 C3 Cu 13 a HH > HH HH Q Q z a 1 2 Q z Z z Q z E H H H > 13 H H Q Q Q CO C O C O ec M 1 o C O C O ft C O 13 HH H H Z CO CO CO Q <: Q o O 1 < < o < O HH Q a Z CO rt C O C3 C O C O cu HH 1 a C O C O > > C O X Z Cu u C O CU CO C O C O z z E H a 1 z z z NS < z X O C O E H rt z z z > tu Cu 03 C O 1 >H Cu Cu H P C O Cu O NS Z e> HH X Cu Cu Cu u In Cu E H o 1 E H Cu Cu z CO Cu NS E H 13 Cu rt > Cu Cu Cu CO a E H > 1 >H Z z E H HH C O CU cc > > Z a CO CO C O z C O C O Z Cu 1 X C O CO Q CO C O X Cd tu C O CO CO C O NS NS a C O 1 NS NS NS O 13 Ui 03 E H C3 13 o C 3 « « ! *3 HP M z z HH 1 X 1—1 HH Cu HH HH 2 13 Cu > Cu H3 HH HH HH Cu X Cd z 1 X X X Z o Cu O CO Z 13 > H X Cu X Cu < E H H P ec 1 CO ec < <: H < X C - O < C 3 < o C 3 a z 1 CO X 33 X Cu X O Z X H J X cc X X X z z C O z 1 < Z Z o O z O Cu C3 a o 13 z Z z < X X X X 1 Cu X X X X X s S X X X X X X X X Q a a CO J a a a a Q a Q a Q 13 Q a a a a Q > Cu >H 1 Cu Cu Cu H H Cu Cu H H HH X Cu s Cu Cu Cu Cu J Cu Cu o >H 1 Cu Cu Cu Cu Cu Cu Cu Cu Cu Cu Cu H J Cu Cu Cu C O o o o o 1 o o < o < o «: o HH H 5 C3 C3 e> o o > >H >H o >H 1 X X X X X X Cu X X C O X X X X X X X >H H H C O 1 X X X X X X X > X EC X > X X X Cu a; 03 fa 03 1 05 03 03 C3 03 03 0 3 03 03 03 03 03 03 03 cC 03 H H rt < Cu 1 2 H P M HH HH < H H < HH Cu rt Cu •4 rt HH Cu o C l o 15 1 o o O o o 13 O o o C3 C3 ( 3 ID u C3 C3 s s C O Cu 1 Cu s Cu > H H H Cu 1—1 Cu Cu s s s X 03 03 1 03 1 a Cu z z NS H H ts z H H s S 03 y. 03 03 03 NS 1 Ui 1 cu 03 NS NS 03 ui NS 03 03 cc « Cd Ui z 1 E H 1 C O NS z NS ui NS a z ^3 C O CO « C O X, CJ NS 1 Ui z NS NS NS ES z a cu Cd E H Cd a Cd O o 1 O 03 NS O o E H o o X 1 E H 13 S u C3 C3 CU tu Cu 1 Cu H H Cu Cu Cu Cu Cu Cu Cu 1 Cu HH Cu a Cu Cu Cu Cu 03 03 CO CO Cu H H > Cu X > > a D E H E H 13 C3 > > X X X H H H P H H C3 Z > > z a z z a x E H E H CO cu 03 C3 Cu Z C3 CS > > CO ( 3 < < z z x x CO C O Cu Cu Cu Cu U 13 X X X X 03 03 H H > J C3 C3 l—l > § z « z « Cd U U Cu Cu rt Q X > S J S H X Cu 13 D D CO HH C3 Cu CJ) 13 Cd J > J O O O X X X ^3 E H O Cu HH S O Z a < Cu a O HU* Z E H O co > a O 03 Z E H Cu > z X Cu Cu Cu Cu z X H P < a o o o > Cu > o o o z X < a s o _ Cu Cu . _ H P E H > X z o o X X a a X HH HH J H 5 Q QS H X O E H ft O O SS S S > > > Q Q Q CO CO CO <;<;<; CO CO CO z z z Cu Cu Cu Cu Cu Cu Z CO Z CO CO CO (4 CO J I—I H I—I <; > £ CO > O H3 CO CO Cd CO S*3 Cd O < O O X Cu I—II—I HH CO < < X CO o H P Cu X Odd Cu X Cu X < X z a i Cu C u C u C u C u C u C u C u C u X X Cu Cu Cu Cu a a x o « feci z > X X X Cu o o o o > > E Hi a a > M H H H P Cu o o o z Cu H H I—I H P o o o o Z g Z X M S C O H P > a O Q o o s z X z z o Cu Cu o « !>3 M X X O O > > E H Z H P H H o o H P H P O O a z S H P > < rt o H P Z O Cu H P 2 Cd < < C O O C O ft E H O Q i=C z z cu u: H P H P a x 2 co a a < < H P C U H H < o l—i C O CO z H P CO CO Q CO Ui H P > s < 3, z Z H P a <: CO z a a rt < Cu a Cu Cu Cu O O O X X X o o o > > > a o o > H > O O O Hp I—I Hp O O O z z z H P 2 J < a ft o o o z z z Cu H P Cu H H H Q Cd Q O < O rt O ft X < X co O co n ft n > z > o w o W H P W O 2 O Z CO Z O O O ft ft ft Cu Cu Cu z O 1 l 1 E H o o o o o H ^ CU ft ui o H P 1 a 1 i o O 1 2 E H X O o o O z < 1 i | CO > > 03 a Z O X HH CO 03 1 1 i 2 > 1 Cu z o HH > > E H CO i l I H P < ft rt ft a HH X CO X < 1 < 1 i > > ] > HH HH rt < a ft o Cd 1 l t 2 Cd Cd H P o ca CO 06 M CO o o 1 1 i o o 1 E H < CO H P Cd Cd Cd CO O 1 l I O O O CO o o o O CO o o o 1 o [ i o o 1 O CO o CO O o O CO HH 1 i t H P HH HH E H H H H H E H O X Cd > H P 1 M 1 i H P H P 1 HH H P H H E H HH HH HH HH o 1 i I o o o o o o o O Cd H P o o 1 a 1 i o Cd 1 o a a O o a a H P X 1 i I X X X X X X X X Cu Cu X X 1 1 i X X t X X X X X X X O o 1 I I Q o o Q o o z o O Z CO z 1 O 1 i o O 1 CO o o CO o o o > < 1 l I HH > > M > > > < > H P H H E H 1 > 1 i > tu 1 CO > H P > > > > 03 CO 1 i I o CO CO > o CO o o CO o o O 1 CO 1 E H H 1 CO o o O CO CO CO 03 > 1 1 HH E H Cu 2 E H 2 ft H H H H 1—1 1 En ] i Cu 2 1 2 H P H P 2 H P E H E H Cu Cu 1 l I Cu X Cu Cu X X X Cu X X X X 1 >H 1 i tu Cu 1 X X X Cu Cu X X cu Cu 1 i I Cu > ft Cu Cu H P Cu < Cu s > 1 Pn 1 i O O 1 CO CM Cu Cu > Cu Cu z o 1 i I a o o o o o z O o o «; o 1 O 1 i O O 1 H P E H < O o O O X z 1 i I z Q Q Q a Q Z z z z Q 1 Q 1 i Q a 1 z Z CO a z a Q O Q 1 l i 03 Q Z Cd a Q E H > Cd 03 O 1 Q 1 i Q Cd 1 Cd P3 03 a a a Q H P Cd ' 1 1 Cd Cd Id Cd Cd Cd S Cd Cd Cd Cd Cd 1 1 1 Cd Cd 1 ft a a Cd Cd Cd Cd LT> C O CTi <-H r - r - c n CM ^ * r - CM r - C O .—1 \D CM i n CM cn CO CD r~ r o SD CO CM O CN] r - r - O CM C M C M L O L O H H CM r - r - CO r - O CM CM CTi OS r H r H CM CD o H H L O •ST O O o o r H C M C M C M C M CO CO VD VD r - r - r - r - CO as CS CTi O r H H H r H r H CM CO O O o o O O O O O o o o o o O o o o o o O o o O H H r—\ I-H H H H H . H CU Cu Cu O P CU CU CU CU CU cu 0J Oi cu cu CU cu cu P J cu eu Cu Cu cu C U CU cx, C U CU CU CU CU X X X X X X X X X X X X X X X X X X X X X X X X X X X X X 03 03 H P CO Cu O X o a ft > z ts X M Q Cd y; z > ^3 ft E H C U O Cu I H Z > > Cu Cd U< X O o o O H P H P > H > CO O eC Cu o o o z H P O H P E H Ui 2 Z Cu < H P co 2 z 2 Cu z > o X CO o o ft ft H P CU H P O X 3 X 03 03 Cu H P o o Cu Cu S 2 w 2 E H « Cd NS Cd O X Cu > Cu S O N3 N3 X X O O > 2 O Ui > > o o H P C U O O Z Z co 2 > Z X z CO CO O O O X X X X X X 03 03 03 H P ft H P o o o S 3 S CC Ui Z N3 03 03 Cd O W O O O Cu Cu Cu Cu Cu [u o a o N3 NS ts X X X o o o > > > o o o > H > o o o Hp I—II—I o o o z z z H P 2 2 < a < o o o z z z H P H P H P H H 2 l-H Cd NS Cd < cC <C o o o Z CO cC KC co O CO Cd Z < < fi! X Z Z Cd NS <C H P H P H P Cu 2 2 Z NS O „ os a o o < cc < «; Cu H P Cu Cu Z H P 2 Cd X X NS fe fe fe X X fe fe X fe fe fe fe fe fe X X X fe fe fe fe fe fe fe fe X X X rf S Z CO C O rf rf o < ca CO z z E H rf rf rf a CO <; U l X z H H C J rf rf rf fe fe 3 l—l > > fe H H > i—i fe X fe X X X X fe fe fe X X X X 3 X X H H fe fe fe > > C O 2 M 1—1 > > C O > z > > OS z > > > H C J cj > CO i—i Z > > > X X rf X X X X X X X X X X X X X X X X CO X X X X X X X X X X Z z C O z C O 05 z z u z z o a C O z o z z z E H CO > CO C O z z C J z z z H H CU fe H H 3 fe > 1—1 HH > > > H H > HH HH H i H H 3 3 > > fe fe > H i H i H i X X z XZ X fe XX X X X X z X X X X X X X X X z fe XXX X X fe > > > HH rf fe HH > fe fe > fe s fe > HH HH > > > > > > fe fe rf > fe > > H i C O C O N S C O z rf C O C O C O < C O < C O C O C O CO C O C O C O C O C O CO 2 HH > C O CO C O CO C O X X H fe fe X X X fe X X fe X p> > X X X X X 1—1 X X > fe Cu X fe X X X •J Q z os O J 2 H i H3 > X H-l > a a HH HH HH cu cu H H C O HH z rf H i H i OS- OS CU 2 Cu O J s OS os O S °5 O S OS OS OS os OS OS OS 2 OS OS OS OS OS OS 2 OS OS Ctj es O S N S N S NS X OS O S s O S oS 2 HH hi hi OS NS OS OS OS NS fe h NS u X OS OS OS OS OS X X I > 1 W X X X X X s I E H a X HH X X X fe X X H 1 E H z X X X X o o 1 C O 1 O J M < C O a a t Z HU- E H z a NS a ca NS NS Z 1 E H z N S fe NS fe H H 1 cj 1 > H H •H < > HH > 1 HH N S fe E H HH HH H H > > HH 1 C O C O rf H i H i H i o H 1 a 1 z NS NS C O fe I o a C O rf a fe a E H E H fe C J 1 HH H H E H NS fe NS IH 1 > 1 Q rf rf C O < < HH 1 NS o HH Z E H rf E H X E H rf NS 1 C J z > E H rf rf C J U 1 o 1 <: o u C J O o «: HH O X Z CU O C J C J HH C J C J C J 1 a z < J a C J C J H ! H H 1 oS 1 C O s s a z s Q ca a C D C J H H 2 H H CU rf C J cc 1 H H 2 fe H i 2 2 H ! H H 1 w 1 <: E fe E H *S fe E H > E H a ca rf fe fe fe E H C O rf E H 1 H H C O C O fe fe fe C O C O 1 N S 1 E H C O C O < oS C O E H Q U C O z C O CO CO CO NS NS NS fe 1 fe X a CO CO CO X X 1 X 1 X X X fe HH X X U S X X fe HH X X X fe X X X1 E H X X X X X X X 1 fe 1 X X X X X X X C O fe X X fe X X X X X X fe 1 OS X X X X X z z 1 a 1 z z z O S z Ui C O z X NS z z z a E H E H CO 1 NS z E H z z z H E H 1 z 1 z E H E H ca o E H z a Z > > Z E H E H E H z Z z z 1 Z fe X E H E H E H 2 Z 1 En 1 O J z z z z z z 2 hi z H H z H E H X X 2 1 O J XX z Z z M l—l 1 fe 1 M t H M H H M H > 5] fe M HH M H H 1—1 H ! 1—1 1—I rf 1 M X HH 1—1 1—1 H H H E H 1 HH 1 E H E H E H > < E H E H s HH rt E H E H E H H fe E H HH 1 > H > E H E H E H cu cu 1 1 a O J O J O J O J CU Cu Cu O J O J 0J CU CU CU CU CU CU O J cu 1 O J CU CU CU CU CU M i - t 1 H ! 1 1—1 1—1 M H M HH fe h H > H H > M M HH 1—1 > H H M fe fe HH H H 1—1 1—1 1—1 NS NS 1 NS 1 NS N S U S ^ hi « NS NS OS NS NS NS OS > a NS H H NS N S N S NS NS NS > > 1 fe 1 H ! fe > > > fe > HH > > > H H HH M rf > > HH CO H H 1—1 H i > H i fe C J (J 1 C J 1 cj cjO ( J O O O C J C J C J C J C J C J OS C J C J ( J C J C J C J 1 > 1 M HH fe fe HH H < s HH fe fe HH HH HH HH fe 1—1 s OS fe fe fe J HH H ! w w 1 fe 1 w Id fe f t W u w w fe w Q Bl fe fe U fe fe fe u fe C J fe w fe H > 2 1 H H 1 fe t - t > 1—1 S M fe fe fe > fe > H H H H H H 1—1 > 1—1 fe O J 1—1 fe HH 2 HH HH cj cj 1 C J 1 cj C J o o w «: u C O W 0 C J C J rf E H CO C J E H fe a C J C J C J C J X 1 C O 1 a ca ca o ca ca ca C O z C O a Z ca ca ca s X cc z H H z z a X X X o o 1 x 1 X a ca Q a a w OS ca e> ca ca a a a z a a I fe X X CO a a a z z 1 z 1 cj z o Z ca z HH OS z z X z z z z OS z z z 0 S C J C J s z z z 2 E H 1 C O 1 H ! E H «! > s E H <. E H 2 E H X 2 > fe fe H i H B a; 1 os 1 os 2 OS OS 2 2 2 2 OS OS OS 2 OS 2 Ctf OS 2 cd a os OS CC OS 2 2 J j 1 fe 1 i—i J •H > > H i o > > 1—1 > H H > H H X 2 H H > > fe > HH H i > H i o cj 1 o 1 cj cj o O o O u u o u O C J C J C J C J C J C J C J C J C J C J C J C J C J H i I fe 1 cj H H E H i j HH s fe HH fe fe HH fe H H 2 H H > fe > fe fe > H i H i - 1 2 H i z z 1 u 1 z Q Z a Z z z z z NS Z z Z Z z z Q a z NS NS z a z Z Q fe fe ( > 1 > fe fe fe fe fe fe s HH O fe HH fe fe fe HH fe fe H H C J > > fe fe fe fe HH H H 1 Cu f H ! (-} HH H 3 HH HH CU a HH S HH HH 2 HH HH O J HH HH HH H i H i H i H i fe h 1 s 1 > fe fe fe fe fe fe fe M HH fe > fe fe fe > fe fe H H rf HH fe fe fe fe fe a a 1 a 1 a a a a a a ooa a a a a a a a a a a 2 o a a a a a fe h 1 fe 1 h fe h fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe z Z 1 X 1 z z Z C O z z C O OS fe M i—i rf z z z 2 ca NS fe X H i C J CO z z z s s 1 fe 1 s s s s 3 3 s s & s & s B s S fe X 3 3 X a 3 3 3 3 C O C O 1 C O 1 C O C O E H E H H C O C O H C O E H C O E H E H C O E H E H E H C O E H E H X C O C O CO H E H 1 a 1 E H E H E H a Z H z Z CO C O z z E H E H E H fe w a C O z rf > a E H E H E H C J C J 1 C J 1 C J C J O o U U u C J C J C J C J C J C J C J <. C J C J C J C J C J C J rf rf 1 cj 1 C J rf < <; rt <; <; U «: o rf rf rf > rf rf rf rf rf rf rf rf rf rf J 1 1 1—1 H H i—i HH HH H H H 3 HH HH H 1—1 HH HH HH fe HH H H HH H H H H fe H i H ! H i H i rf a 1 e> 1 <: rf <: a o < a w a rf a rf a z a a rf a C J rf a rf rf rf M M 1 fe 1 > fe i—i < 1—1 i—i M > fe 2 rf > H H 1—1 H H 2 HH H H fe H i HH HH HH HH H H fe C J C J 1 o 1 cj u a o O o C J C J C J C J C J C J C J C J C J C J C J C J C J C J Cj cj 1 1 j cj o fe o O o HH M fe C J C J C J H 3 C O C J H H fe fe H ! rf C J C J C J fe 1 fe I fe fe fe fe fe fe fe M X > fe fe fe fe fe H H fe fe X fe fe z fe fe fe fe > rf 1 n i 1 fe H ! M HH > H i > fe HH fe 1—1 HH- HH HH H H fe fe fe fe H i fe fe fe H ! H i cj 1 cj 1 C J cj o U o o C J tj C J E H C J C J C J rf C J C J C J C J C J C J fe fe 1 <; 1 fe > fe 1—1 > HH 1—1 HH > CO fe fe > > > C J 2 rf > 3 HH rf HH > H i > C O C O 1 E H 1 X C O C O E H z C O a C O C O C O C O CO CO CO fe a z C O OS fe fe a CO C O CO 1—1 M 1 z 1 HH > E H HH H-l > fe C O NS rf rf HH HH H H rf > H H CO Z 2 fe i—i 1—I H ! cn L O C O cn H H r- r~ cn C M r- C M r- 00 H H C D C M in C D C D C M ro C O C D r~ ro C D C O C M o CN] r— o C M C M C M L O L O C M r- ro r-o C M C M cn cn i—1 H H C M C D o H H IT) •*T o o o o r H C M C M C M C M ro C O •cr ^ C O co r-r- r~ C O cn cn cn O t-H <-H H t H C M C O o o o o o O O o O O o O o o o o o o o o o o o o ,—I H H H H i—1 H H H H r—{ Oj CU Cu Cu O J O J O J O J O J O J O J CU Cu CU O J O J Cu cu Cu cu Ou CU cu cu CU CU 0 J O J Cu CU CU X X 35 X ra ca ca ca ca ca ca ca C  ca ca ca ca ca ca X ca ca ca ca X X X X X X X 3.2 Construction of a structural model for HopE H o p E w a s s e l e c t e d f o r m o l e c u l a r m o d e l i n g b e c a u s e i t w a s p r e v i o u s l y s h o w n to f u n c t i o n as a p o r i n w i t h a l a r g e p o r e d i a m e t e r , a n d H o p E w a s the s m a l l e s t m e m b e r o f t h e H o p f a m i l y to c o n t a i n t h e m a j o r i t y o f t h e c o n s e r v e d s e q u e n c e m o t i f s d e s c r i b e d a b o v e . A p r e l i m i n a r y s t r u c t u r a l m o d e l w a s c o n s t r u c t e d b a s e d o n the c o n f o r m a t i o n a l p a r a m e t e r s a n d a l g o r i t h m f o r the p r e d i c t i o n o f m e m b r a n e s p a n n i n g p - s t r a n d s i n b a c t e r i a l p o r i n s d e v e l o p e d b y G r o m i h a et al. ( 1 9 9 7 ) . T h e r e s u l t o f t h i s a n a l y s i s i s s h o w n i n F i g u r e 17 w i t h t h e c o n s e r v e d s t r u c t u r a l m o t i f s s h o w n i n b o l d tex t . It i s i n t e r e s t i n g to n o t e that the c o n s e r v e d m o t i f s f e l l a l m o s t e x c l u s i v e l y a m o n g t h e p r e d i c t e d t r a n s m e m b r a n e s p a n n i n g d o m a i n s o f H o p E . T h i s o b s e r v a t i o n s u p p o r t e d t h e h y p o t h e s i s that t h e c o n s e r v e d m o t i f s w e r e a c o n s e r v e d s t r u c t u r a l m o t i f f o r a f a m i l y o f P-b a r r e l p r o t e i n s . 3.3 Cloning of hopE into pBluescript and pT7-7 T h e hopE g e n e w a s a m p l i f i e d b y P C R f r o m the c h r o m o s o m e o f H. pylori 2 6 6 9 5 . I n i t i a l a t t e m p t s to d i r e c t i o n a l l y c l o n e hopE w i t h i ts e n d o g e n o u s p r o m o t e r s e q u e n c e s u s i n g p r i m e r set P 1 / P 2 w e r e u n s u c c e s s f u l . S u b s e q u e n t l y , p r i m e r sets P 1 / P 3 a n d P 2 / P 3 w e r e u s e d to a m p l i f y hopE f o r t h e s u b s e q u e n t c l o n i n g o f hopE i n t o p B l u e s c r i p t ( p J l a n d p J 3 ) a n d p T 7 - 7 ( p J 2 6 ) r e s p e c t i v e l y . T h e D N A s e q u e n c e o f the c l o n e d hopE g e n e i n p l a s m i d s J l a n d J26 w a s v e r i f i e d b y D N A s e q u e n c i n g o f b o t h D N A s t rands . T h e r e w e r e t w o p o t e n t i a l t r a n s l a t i o n start s i tes i n the hopE g e n e ( F i g u r e 18) . T h e u p s t r e a m ribosomal b i n d i n g s i t e w a s t h e start s i te p r e d i c t e d b y T I G R . M y s e q u e n c e a n a l y s i s r e v e a l e d s e q u e n c e c o n s e r v a t i o n a m o n g t h e N - t e r m i n a l a m i n o a c i d a n d D N A s e q u e n c e s o f t h e H o p f a m i l y w h i c h s u g g e s t e d that the s e c o n d ( d o w n s t r e a m ) A T G w a s l i k e l y to b e t h e t r a n s l a t i o n a l 71 N K A H K T N F S L P Q F G G F D P G F M P T K T 1 3 C N K S Y L C I Y K N G G N G W T Q V W V F G A V H N G 1 R S A L F Y L G K G R V N T Y L V G S C A G Y D N D N N G G I G G L L E Y T A F N / D Y C N P N A P Y S T K T S T R K D Y S L V V L L Y A R L H L F V I Y G Q G N Y Y V F K L N W E F N Y L V L N T N G S T F F N A A G H G V K P N R Y A I N Figure 17. S t r u c t u r a l m o d e l f o r H o p E b a s e d o n the c o n f o r m a t i o n a l p a r a m e t e r s a n d a l g o r i t h m f o r t h e p r e d i c t i o n o f m e m b r a n e s p a n n i n g P-strands i n b a c t e r i a l p o r i n s d e v e l o p e d b y G r o m i h a et al. ( 1 9 9 7 ) . T r a n s m e m b r a n e s p a n n i n g d o m a i n s are i n the boxes, the c o n s e r v e d s e q u e n c e m o t i f s i n the H o p f a m i l y a re i n b o l d 72 start f o r H o p E . T h i s start s i te e x c l u d e s a n e g a t i v e l y c h a r g e d g l u t a m a t e r e s i d u e at t h e N - t e r m i n u s o f t h e p u t a t i v e s i g n a l s e q u e n c e , w h i c h i s a l w a y s p o s i t i v e l y c h a r g e d f o r o t h e r p r o t e i n s . T h e r e f o r e t h i s s i te w a s s e l e c t e d f o r t h e c l o n i n g o f hopE i n t o p T 7 - 7 . P C R o l i g o n u c l e o t i d e p r i m e r P 2 w a s d e s i g n e d to i n c o r p o r a t e a n Ndel r e s t r i c t i o n s i te at the s e c o n d A T G start s i te i n hopE to a l l o w e a s y s u b c l o n i n g , f o l l o w i n g d i g e s t i o n o f t h e P C R a m p l i c o n w i t h Ndel r e s t r i c t i o n e n d o n u c l e a s e , i n t o Ndel-Smal d i g e s t e d p T 7 - 7 . T h i s r e s u l t e d i n c l o n i n g o f hopE d o w n s t r e a m o f t h e T 7 R N A p o l y m e r a s e p r o m o t e r w i t h o p t i m a l s p a c i n g b e t w e e n the r i b o s o m a l b i n d i n g s i t e a n d t h e hopE t r a n s l a t i o n start c o d o n i n p T 7 - 7 . D o w n s t r e a m o f hopE a n d p r e s e n t i n p J l a n d p J 2 6 w a s a s t e m -l o o p s t r u c t u r e that m a y f u n c t i o n as a r h o - i n d e p e n d e n t t r a n s c r i p t i o n a l t e r m i n a t o r ( F i g u r e 18) . 3.4 E x p r e s s i o n o f hopE i n Escherichia coli E. coli J M 1 1 0 s t r a i n s c a r r y i n g e i t h e r p l a s m i d J l (hopE+) o r J 3 ( n e g a t i v e c o n t r o l ) w e r e u s e d f o r e x p r e s s i o n e x p e r i m e n t s . I n d u c t i o n o f e x p r e s s i o n w i t h I P T G f o r f o u r h o u r s l e d to the p r o d u c t i o n o f H o p E ( i d e n t i f i e d as i m m u n o b l o t b a n d s i n W e s t e r n b l o t s ) w h i c h c o f f a c t i o n a t e d w i t h t h e o u t e r m e m b r a n e d u r i n g m e m b r a n e f r a c t i o n a t i o n , s u g g e s t i n g that r e c o m b i n a n t l y p r o d u c e d H o p E w a s p r o p e r l y s o r t e d to the o u t e r m e m b r a n e . R e c o m b i n a n t l y e x p r e s s e d H o p E m i g r a t e d to the s a m e p o s i t i o n o n S D S - P A G E as d i d H o p E c o n t a i n e d i n t h e o u t e r m e m b r a n e s o f H. pylori, a n d i t s m i g r a t i o n o n S D S - P A G E w a s i d e n t i c a l l y m o d i f i e d b y t h e s o l u b i l i z a t i o n t e m p e r a t u r e as w a s H o p E c o n t a i n e d i n the o u t e r m e m b r a n e s o f H. pylori ( F i g u r e 19) . H e a t m o d i f i c a t i o n o f o u t e r m e m b r a n e p r o t e i n s i s a d e f i n i t i v e c h a r a c t e r i s t i c o f P - b a r r e l p r o t e i n s ( V a n G e l d e r et al., 1 9 9 7 ) a n d s u g g e s t s that r e c o m b i n a n t l y e x p r e s s e d H o p E w a s s t r u c t u r a l l y s i m i l a r to n a t i v e H o p E i n H. pylori. A l t h o u g h r e c o m b i n a n t l y e x p r e s s e d H o p E w a s e a s i l y v i s i b l e i n W e s t e r n - i m m u n o b l o t s , H o p E w a s n o t v i s i b l e i n C o o m a s s i e - s t a i n e d g e l s . C o n f i r m a t i o n o f 73 s u r f a c e e x p o s u r e b y i n d i r e c t i m m u n o f l u o r e s c e n c e u s i n g the Vac38 ( a n t i - H o p E ) p o l y c l o n a l a n t i b o d y w a s 74 1 ATCATAAATTTCAGTGATCGTCCCCACAGTGGATCTGGGGTTTTTAGAAGTGGTTTTTTG P57 ^ 61 ATCAATAGCGATCGCAGGGGTTAGGCCTTCAATTTTATCCACATTAGGCTTACCCACTTT 121 GTCTAAAAATTGCCTAGCATAGCTGGACAAACTCTCTA7AATAGCGCCTTTGGCCTTCAGC 181 GTATAAAGTGTCAAACGCTAAAGTGGATTTACCCGAACCGCTCAATCCGGTAAAAACAAC 241 AAACTGGTTTTTAGGGATTTCTAAAAAAATATTTTTGAGATTGTTTTCCCTAGCCCCTTG 301 AATAATGATCTTATCCATAATGGTTTTATGTTGCAAGAGTTTCCTTAAAATAAGAAAATG 361 GATTAAAAGGAGCTATTATACTTCAAAAAAGAATGGTTTTATTATCATTTCTTATTCATA 421 AGAGTTAAAAATATTTGCTTGATTAAGGATAAACATGCTATTATTTTATGAGACAATTTT P62 * * * * * * * * * * *^f 4 81 AAAGATAGGAATGTAAAGGAATGGAATTTATGAAAAAGTTTGTAGCTTTAGGGCTTCTAT m e f M K K F V A L G L L S 541 CCGCAGTTTTAAGCTCTTCGTTGTTAGCCGAAGGTGATGGTGTTTATATAGGGACTAATT 181 A V L S S S L L A ^ E G D G V Y I G T N Y P64 601 ATCAGCTTGGACAAGCCCGTTTGAATAGTAATATTTATAATACAGGGGATTGCACAGGGA 201 Q L G Q A R L N S N I Y N T G D C T G S 661 GTGTTGTAGGTTGCCCCCCAGGTCTTACCGCTAATAAGCATAATCCAGGAGGCACCAATA 221 V V G C P P G L T A N K H N P G G T N I 721 TCAATTGGCATGCTAAATACGCTAATGGGGCTTTGAATGGTCTTGGGTTGAATGTGGGTT 241 N W H A K Y A N G A L N G L G L N V G Y 781 ATAAGAAGTTCTTCCAGTTCAAGTCTTTTGATATGACAAGCAAGTGGTTTGGTTTTAGAG 261 K K F F Q F K S F D M T S K W F G F R V P65 841 TGTATGGGCTTTTTGATTATGGGCATGCCACTTTAGGCAAGCAAGTTTATGCACCTAATA 281 Y G L F D Y G H A T L G K Q V Y A P N K 901 AAATCCAGTTGGATATGGTCTCTTGGGGTGTGGGGAGCGATTTGTTAGCTGATATTATTG 301 I Q L D M V S W G V G S D L L A D I I D 961 ATAACGATAACGCTTCTTTTGGTATTTTTGGTGGGGTCGCTATCGGCGGTAACACTTGGA 321 N D N A S F G I F G G V A I G G N T W K 1021 AAAGCTCAGCGGCAAACTATTGGAAAGAGCAAATCATTGAAGCTAAGGGTCCTGATGTTT 341 S S A A N Y W K E Q I I E A K G P D V C 75 P66 1 0 8 1 G T A C C C C T A C T T A T T G T ^ C C C T A A C G C T C C T T A T A G C A C C A A A A C T T C A A C C G T C G C T T 3 6 1 T P T Y C N P N A P Y S T K T S T V A F 1 1 4 1 T T C A G G T A T G G T T G A A T T T T G G G G T G A G A G C C A A T A T T T A C A A G C A T A A T G G C G T A G A G T 3 8 1 Q V W L N F G V R A N I Y K H N G V E F 1 2 0 1 T T G G C G T G A G A G T G C C G C T A C T C A T C A A C A A G T T T T T G A G T G C G G G T C C T A A C G C T A C T A 4 0 1 G V R V P L L I N K F L S A G P N A T N 1 2 6 1 A T C T T T A T T A C C A T T T G A A A C G G G A T T A T T C G C T T T A T T T A G G G T A T A A C T A C A C T T T T T 4 2 1 L Y Y H L K R D Y S L Y L G Y N Y T F * C C T T T G A A : T T : A T : A T : A T : A T : A C : G C : G 1 3 2 1 A A A C C C T T T A A A A G G G T G T C T T T A A G - C : G - T T T T A G T T T - 3' 1 3 8 1 G G A T T T T C G C A T C T T A A A A A G C T A A A A T T G A T T A T A A A G A A A C T T T T G G G C G T A A C C A A C 1 4 4 1 A A A A C C A A C A C C A T T G G G T G G G C G T T T G G A A A A T T C A T C T A A G G G T T T T A A G G G G A T T G T ^ P60 1 5 0 1 T T G C A A G A A A T A G A G A G T T T G C A C C A A A G C G T T T T G T T G C A A G A A G T T T T G C A A G C G T T C 1 5 6 1 A T G C C T T T A G A A G A A G G G G T T T T G A T T G A T T G C A C T T T A G G G T T A G G G G G G C A T T C T A A A F i g u r e 1 8 . Helicobacter pylori 2 2 6 9 5 hopE D N A s e q u e n c e . hopE g e n e c o n t a i n s t w o p o t e n t i a l start s i tes m a r k e d i n b o l d a n d u n d e r l i n e d e a c h w i t h p u t a t i v e u p s t r e a m r i b o s o m a l b i n d i n g s i tes ( m a r k e d w i t h a s t r e r i s k s ) a n d a p o t e n t i a l s t e m - l o o p s t r u c t u r e that c o u l d f u n c t i o n as a d o w n s t r e a m r h o - i n d e p e n d e n t t r a n s c r i p t i o n a l t e r m i n a t o r . T h e e x p e r i m e n t a l l y d e t e r m i n e d s i g n a l p e p t i d e c l e a v a g e s i te i s l o c a t e d b e t w e e n a m i n o a c i d s 23 a n d 24 ( i n d i c a t e d b y the star ) . T h e P C R o l i g o n u c l e o t i d e p r i m e r s u s e d f o r t h e c l o n i n g o f hopE a re i n d i c a t e d w i t h a r r o w s a n d t h e i r n u c l e o t i d e s e q u e n c e s a re l i s t e d i n T a b l e III . P r e d i c t e d m o l e c u l a r w e i g h t o f t h e H o p E : 2 9 7 4 6 D a . 76 F i g u r e 19 . G e l m o b i l i t y o f r e c o m b i n a n t l y p r o d u c e d H o p E c a n be m o d i f i e d b y heat . W e s t e r n i m m u n o b l o t o f o u t e r m e m b r a n e s f r o m E. coli J M 1 1 0 e x p r e s s i n g hopE. L o g a r i t h m i c p h a s e c u l t u r e s o f E. coli J M 1 1 0 h a r b o r i n g the s p e c i f i e d p l a s m i d s w e r e i n d u c e d b y the a d d i t i o n o f I P T G to a f i n a l c o n c e n t r a t i o n o f 1 0 0 p M a n d g r o w n f o r a n a d d i t i o n a l 4 h p r i o r t o c e l l h a r v e s t . O u t e r m e m b r a n e s w e r e p r e p a r e d b y T r i t o n X - 1 0 0 e x t r a c t i o n p r o c e d u r e ( S c h n a i t m a n , 1 9 7 1 ) . E a c h l a n e c o n t a i n s a p p r o x i m a t e l y 3 0 u g o f o u t e r m e m b r a n e p r o t e i n w h i c h w e r e s o l u b i l i z e d at 37°C ( l a n e s 1 a n d 4 ) o r 100°C ( l a n e s 2 , 3 a n d 5 ) , r e s o l v e d o n S D S 1 2 % - P A G E g e l s , e l e c t r o b l o t e d o n t o P V D F m e m b r a n e a n d p r o b e d w i t h r a b b i t a n t i - H o p E p o l y c l o n a l a n t i b o d y . T h e i m m u n o b l o t s w e r e d e v e l o p e d w i t h a d o n k e y a n t i - r a b b i t a n t i b o d y c o n j u g a t e d t o a l k a l i n e p h o s p h a t a s e . T h e l o c a t i o n o f H o p E ( - 2 6 k d ) a n d heat m o d i f i e d H o p E * ( - 2 9 k d ) i s d e n o t e d b y the a r r o w s . P l a s m i d s p r e s e n t i n E. coli w e r e l a n e s : 1 a n d 2 , p J l ; 3 , p J 3 ; 4 a n d 5 , Helicobacter pylori 1 1 6 3 7 o u t e r m e m b r a n e . 77 u n s u c c e s s f u l ; t h i s r e s u l t i s p r o b a b l y d u e to c r o s s r e a c t i o n o f t h i s a n t i s e r u m w i t h t h e o u t e r m e m b r a n e p r o t e i n s o f E. coli a n d the l o w l e v e l o f e x p r e s s i o n o f H o p E . 3.5 I n s e r t i o n a l m u t a g e n e s i s o f hopE T o test t h e s t r u c t u r a l m o d e l o f H o p E , I d e s i g n e d a n o l i g o n u c l e o t i d e that c o d e d f o r the i n s e r t i o n o f f i v e a m i n o a c i d s ( R S K D V ) a n d t w o u n i q u e r e s t r i c t i o n s i tes . T h i s o l i g o n u c l e o t i d e w a s u s e d f o r s i te s p e c i f i c i n s e r t i o n a l m u t a g e n e s i s o f H o p E . T h i s o l i g o n u c l e o t i d e w a s d e s i g n e d to c o d e f o r t w o u n i q u e r e s t r i c t i o n s i tes a n d th ree c h a r g e d a m i n o a c i d s that s h o u l d n o t b e t o l e r a t e d i n t h e t r a n s m e m b r a n e r e g i o n s o f p - b a r r e l o u t e r m e m b r a n e p r o t e i n s . T h e t w o u n i q u e r e s t r i c t i o n s i tes c o u l d l a t e r s e r v e as i n s e r t i o n s i tes f o r o t h e r a n t i g e n i c e p i t o p e s . T h e p r i m a r y f o c u s o f t h e s e e x p e r i m e n t s w a s to test the h y p o t h e s i s that the c o n s e r v e d s e q u e n c e m o t i f s i n t h e H o p f a m i l y w e r e m e m b r a n e - s p a n n i n g d o m a i n s a n d t h u s , p o t e n t i a l l y p a r t o f a c o n s e r v e d s c a f f o l d i n g f o r a f a m i l y o f P -barrel p r o t e i n s . I n s e r t i o n s w e r e p l a c e d i n f o u r o f t h e c o n s e r v e d m e m b r a n e s p a n n i n g s e g m e n t s ( 1 , 5 , 12 a n d 16) a n d i n t o f o u r o f t h e p r o p o s e d l o o p r e g i o n s ( l o o p s 3 , 5 , 6 a n d 8) ( F i g u r e 2 0 ) . E x p r e s s i o n a n a l y s i s o f t h e s e i n s e r t i o n m u t a n t s i n E. coli ( F i g u r e 2 1 ) r e v e a l e d that i n s e r t i o n s i n t o p u t a t i v e t r a n s m e m b r a n e s e g m e n t s 1 ( p J 1 8 ) , 5 ( p J l O ) a n d 12 ( p J 1 2 ) w e r e n o t p e r m i s s i v e f o r t h e i n s e r t i o n o f the r e c o m b i n a n t H o p E i n t o the o u t e r m e m b r a n e . M u t a n t p J 2 0 , i n w h i c h the m u t a t i o n w a s p l a c e d i n a r e g i o n o f H o p E that w a s p r e v i o u s l y i d e n t i f i e d as b e i n g p a r t o f a m e m b r a n e s p a n n i n g d o m a i n , w a s i n c o r p o r a t e d i n t o the o u t e r m e m b r a n e . T h i s s u g g e s t s that t h i s r e g i o n i s n o t p a r t o f the m e m b r a n e s p a n n i n g c o r e r e g i o n o f H o p E . C l o n e s c o d i n g f o r i n s e r t i o n s i n t o l o o p r e g i o n s 5 ( p J 5 ) , 6 ( p J 2 1 ) a n d 8 ( p J 6 , p J 1 4 a n d p J 2 0 ) w e r e i n c o r p o r a t e d i n t o the o u t e r m e m b r a n e , s u p p o r t i n g m y p r o p o s a l that t h e s e r e g i o n s o f u n c o n s e r v e d a m i n o a c i d s e q u e n c e are l o o p r e g i o n s o f H o p E . A n o t h e r c l o n e c o d i n g f o r a n 78 6 N K A H T L G P P pJ18-C _ C Y L C N G G T Q V G 1 A R V s Y L G V N T G S C D N D G I G E Y T pJ23-pJlO-K F S Q F F D 'F M K T S_ K N N _P K A Y V Q K G L T A H G Y T C p J 5 v * . D N N_ D I D A L L V D P G K A E I I Q E A K S W F Y G N I A F A G S G S V K A W I T G N T Y C N P X* P Y S T K T S T pJ21 V V A R F V Q G V F W « - p J 1 2 E L V N G F N G H V K R Y A, I 8 7 D J6 . P J 1 4 ' P , n V \ A "RSKDV \ R « P W K L L | I N | K| F L S Al GJ p N L Y H L Y G Y Y L N N Y N T T F A pJ20 - N -Figure 20. I n s e r t i o n s i tes f o r H o p E m u t a n t s . L o o p s ( 1 - 8 ) are d e n o t e d b y n u m b e r s a b o v e e a c h l o o p . I n s e r t i o n o f R S K D V w a s e n g i n e e r e d i n t o hopE b y P C R . L i s t e d are t h e p l a s m i d s a n d the i n s e r t i o n s i t e o f t h e 5 a m i n o a c i d s w i t h i n e a c h p l a s m i d . P l a s m i d J 1 4 c o n t a i n e d a d e l e t i o n o f the a m i n o a c i d s D Y S L a n d t h e i r r e p l a c e m e n t w i t h R S K D V . T r a n s m e m b r a n e r e g i o n s a re i n t h e b o x e s a n d t h e s e q u e n c e s tha t a re c o n s e r v e d a m o n g the H o p f a m i l y a re i n b o l d tex t . 79 Figure 21. Western immunoblot of outer membranes from E. coli JM110 expressing hopE insertion mutants. Logarithmic phase cultures of E. coli JM110 harboring the specified plasmids were induced by the addition of IPTG to a final concentration of 100 pM and grown for an additional 4h prior to cell harvest. Outer membranes were prepared by the Triton X-100 extraction procedure (Schnaitman, 1971). Each lane contains approximately 20 ug of outer membranes which were solubilized at 37°C, resolved on SDS 12%-PAGE gels, electrobloted onto P V D F membrane and probed with rabbit anti-HopE polyclonal antibody. The immunoblots were developed with a donkey anti-rabbit antibody conjugated to alkaline phosphatase. Molecular weights are listed on the left and HopE is marked by the arrow. Plasmids present were lanes: 1, prestained molecular weight markers; 2 . H. pylori 11637 outer membrane; 3, pJ5; 4,pJ6; 5,pJ10; 6, pJ12; 7, pJ14; 8, pJ18;9, pJ20; 10, pJ21; 11 pJ23. 80 i n s e r t i o n i n t o l o o p 3 ( p J 2 3 ) w a s n o t f o u n d i n t h e o u t e r m e m b r a n e . T h i s r e s u l t w a s n o t s u r p r i s i n g a n d i s s i m i l a r t o w h a t h a s b e e n o b s e r v e d i n m a n y o t h e r p o r i n p r o t e i n s . L o o p t h r e e h a s b e e n h y p o t h e s i z e d to f u n c t i o n i n t h e f o r m a t i o n o f the m o s t c o n s t r i c t e d p a r t o f the c h a n n e l o f p o r i n p r o t e i n s a n d p l a y s a c r i t i c a l r o l e i n d e t e r m i n i n g p o r i n s t r u c t u r e ( N i k a i d o , 1 9 9 3 ) . I n s e r t i o n s i n t o l o o p s 2 , 4 a n d 7 w e r e n o t c o n s t r u c t e d d u e to t e c h n i c a l p r o b l e m s a s s o c i a t e d w i t h t h e c o n s t r u c t i o n o f s u i t a b l e P C R p r i m e r s that d i d n o t s e l f h y b r i d i z e o r c o n t a i n s i g n i f i c a n t a m o u n t s o f s e c o n d a r y s t r u c t u r e . DISCUSSION 1. Identification of potential virulence factors in Helicobacter pylori O n e o f t h e c u r r e n t d i f f i c u l t i e s i n H. pylori r e s e a r c h i s the l a c k o f t o o l s f o r g e n e t i c a n a l y s i s i n H. pylori. W i t h v e r y f e w e x c e p t i o n s , b a c t e r i a l g e n e s o r i g i n a t i n g f r o m g e n e r a o t h e r t h a n Helicobacter o r Campylobacter a re n o t e x p r e s s e d i n H. pylori. I n a d d i t i o n s h u t t l e v e c t o r s that c a n b e s t a b l y m a i n t a i n e d i n H. pylori h a v e n o t y e t b e e n f o u n d . T h i s o b s e r v a t i o n n e c e s s i t a t e d the u s e o f h e t e r o l o g o u s s y s t e m s f o r t h e a n a l y s i s o f H. pylori g e n e f u n c t i o n . I n C h a p t e r O n e , I d e s c r i b e d t h e a p p l i c a t i o n o f o n e s u c h s y s t e m to H. pylori - g e n e f u s i o n t e c h n o l o g y . G e n e f u s i o n t e c h n o l o g y b a s e d o n t r a n s l a t i o n a l f u s i o n s to a l k a l i n e p h o s p h a t a s e h a s b e e n s u c c e s s f u l l y u s e d f o r t h e i d e n t i f i c a t i o n o f e x t r a c e l l u l a r , s u r f a c e a s s o c i a t e d o r p e r i p l a s m i c p r o t e i n s i n m a n y b a c t e r i a l s y s t e m s ( M a n o i l et al., 1 9 9 0 ) . H o w e v e r , the a p p l i c a t i o n o f g e n e f u s i o n t e c h n o l o g y to b a c t e r i a l s p e c i e s that l a c k s y s t e m s f o r g e n e t i c a n a l y s i s , s u c h as H. pylori, i s m o r e d i f f i c u l t . A t t e m p t s at t r a d i t i o n a l TnphoA m u t a g e n e s i s (o r o t h e r t r a n s p o s o n m u t a g e n e s i s ) i n H. pylori h a v e b e e n u n s u c c e s s f u l . T h e r e f o r e I s o u g h t to adapt a r a p i d a n d s i m p l e s y s t e m f o r t h e i d e n t i f i c a t i o n o f / / , pylori s e c r e t e d p r o t e i n s i n a h e t e r o l o g o u s s y s t e m . I n i t i a l a t t e m p t s to c o n s t r u c t the H. / j y / o n ' - a l k a l i n e p h o s p h a t a s e f u s i o n l i b r a r y i n phoA 81 d e f i c i e n t E. coli C C 1 1 8 w e r e u n s u c c e s s f u l . E. coli C C 118 w a s a p o o r r e c i p i e n t f o r H. pylori D N A a n d r e c o m b i n a n t c l o n e s w e r e o b t a i n e d at l o w e f f i c i e n c y . T h e s e f i n d i n g s are p r o b a b l y a c o n s e q u e n c e o f E. coli C C 1 1 8 r e s t r i c t i o n o f H. pylori D N A ( P h a d i s et al, 1 9 9 3 ) . S u b s e q u e n t l y , E. coli E R 1 7 9 3 , aphoA+ s t r a i n that i s p e r m i s s i v e f o r the c l o n i n g o f H. pylori D N A , w a s u s e d as the h o s t f o r t h e c o n s t r u c t i o n o f t h e H. p j / / o n " - a l k a l i n e p h o s p h a t a s e f u s i o n l i b r a r y . I f o u n d that t h e i n c l u s i o n o f 5 0 m M N a P C u i n t h e s c r e e n i n g m e d i u m c o m p l e t e l y i n h i b i t e d t h e e x p r e s s i o n o f the e n d o g e n o u s p h o s p h a t a s e a c t i v i t y i n E. coli E R 1 7 9 3 w h i l e s t i l l a l l o w i n g the d e t e c t i o n o f r e c o m b i n a n t a l k a l i n e p h o s p h a t a s e f u s i o n p r o t e i n s . A m o n g t h e 1 2 0 H. pylori-alkaline p h o s p h a t a s e f u s i o n l i b r a r y c l o n e s that w e r e s e q u e n c e d , 21 c l o n e s p r o d u c e d h i g h - s c o r i n g s e g m e n t p a i r s o f 10" 5 o r l o w e r . T h e i d e n t i f i e d h o m o l o g g e n e s i n c l u d e d s e v e r a l p o t e n t i a l ta rgets f o r d r u g i n t e r v e n t i o n o r v a c c i n e c o n s t r u c t i o n i n c l u d i n g g e n e s i n v o l v e d i n m o t i l i t y ( c l o n e s 1 1 , 3 0 , 1 2 1 ) , e f f l u x ( c l o n e 12 , 3 9 , 61 a n d 2 0 0 ) , i r o n u p t a k e ( c l o n e s 10) , c e l l w a l l b i o s y n t h e s i s ( c l o n e s 4 4 a n d 1 6 2 ) , p e r m e a s e s ( c l o n e s 199 a n d 2 3 0 ) , c y t o c h r o m e ( c l o n e 1 0 5 ) , e n z y m e s ( c l o n e s 3 ) a n d l i p i d b i o s y n t h e s i s ( c l o n e s 182) . S u b s e q u e n t to the r e l e a s e o f the H. pylori g e n o m e s e q u e n c e , t h e i n i t i a l p r e d i c t i o n f o r these c l o n e s w a s v e r i f i e d i n a l l b u t o n e c l o n e ; c l o n e 2 1 1 , w a s i d e n t i f i e d b y m e as b e i n g i n v o l v e d i n c a p s u l e b i o s y n t h e s i s b u t i t i s t h o u g h t to a c t u a l l y c o d e f o r a h o m o l o g o f a c o m p o n e n t o f a D N A r e s t r i c t i o n s y s t e m . I n a d d i t i o n to t h o s e c l o n e s l i s t e d i n T a b l e 1, a n o t h e r 8 9 c l o n e s h a d w e a k s i m i l a r i t y to s e q u e n c e s i n t h e n o n - r e d u n d a n t d a t a b a s e . T h e s e c l o n e s , w h i c h d i d n o t h a v e a s u f f i c i e n t s i m i l a r i t y to d a t a b a s e s e q u e n c e s to a l l o w p r e d i c t i o n o f t h e i r p o s s i b l e f u n c t i o n , w e r e s u b s e q u e n t l y m a p p e d to t h e g e n o m e s e q u e n c e o f / / , pylori 2 6 6 9 5 . A m o n g the s e q u e n c e d c l o n e s , 5 9 c l o n e s ( 4 5 % ) w e r e u n i q u e to H. pylori ( u n i d e n t i f i e d O R F s ) , 6 5 c l o n e s ( 4 9 % ) c o n t a i n e d t y p i c a l s i g n a l s e q u e n c e s a n d 19 c l o n e s ( 1 4 % ) w e r e p r e d i c t e d to b e c e l l e n v e l o p e - a s s o c i a t e d . A d d i t i o n a l l y , 4 4 82 c l o n e s ( 3 0 % ) o f the s e q u e n c e d c l o n e s w e r e r e d u n d a n t a n d 12 c l o n e s ( 9 % ) w e r e p r e d i c t e d to e n c o d e c y t o p l a s m i c p r o t e i n s ( d i s c u s s e d b e l o w ) . T h e r e w a s a d e f i n i t e b i a s f o r i d e n t i f i c a t i o n o f c e r t a i n p r o t e i n s i n H. pylori ( i . e. , f u s i o n s to O R F 0 8 1 7 w e r e o b t a i n e d 17 t i m e s ) . S e v e r a l f a c t o r s l i k e l y c o n t r i b u t e to t h i s f i n d i n g . F i r s t a n d m o s t i m p o r t a n t i s t h e s e l e c t i o n f o r r e c o m b i n a n t c l o n e s that h i g h l y e x p r e s s a l k a l i n e p h o s p h a t a s e . S i n c e I c h o s e t h e c o l o n i e s w h i c h w e r e t h e m o s t d e e p l y b l u e c o l o r e d o n X P - P O 4 aga r , t h i s s c r e e n i s b i a s e d t o w a r d s g e n e s that a re e i t h e r e x p o r t e d a n d / o r m o r e e f f i c i e n t l y e x p r e s s e d i n E. coli. T h e s e c o n d s o u r c e o f b i a s i s t h e a s s u m p t i o n that the r e s t r i c t i o n s i tes f o r the f o u r - b a s e c u t t e r r e s t r i c t i o n e n z y m e SauSAl a re d i s p e r s e d r a n d o m l y t h r o u g h o u t the c h r o m o s o m e . T h i s i s c l e a r l y n o t a v a l i d a s s u m p t i o n . A l t h o u g h Sau3Al c a n b e s t a t i s t i c a l l y e x p e c t e d to c u t D N A ( c o n t a i n i n g e q u a l d i s t r i b u t i o n o f d e o x y n u c l e o t i d e r e s i d u e s ) o n c e i n e v e r y 2 5 6 b a s e p a i r s , i n r e a l i t y t he re i s r e g i o n a l v a r i a b i l i t y i n b a c t e r i a l D N A i n b o t h n u c l e o t i d e c o n t e n t a n d c o n t e x t . F o r e x a m p l e , t h e o v e r a l l G C c o n t e n t o f H. pylori w a s 3 9 % , h o w e v e r , the 40 k b c a g p a t h o g e n i c i t y i s l a n d h a d a G C c o n t e n t o f 3 5 % ( T o m b et al, 1 9 9 7 ) . A m o n g the s e q u e n c e d H. / ? v / o n ' - a l k a l i n e p h o s p h a t a s e f u s i o n c l o n e s , 12 c l o n e s ( 9 % ) w e r e i d e n t i f i e d as b e i n g c y t o p l a s m i c p r o t e i n s . T h i s p r o b a b l y r e s u l t e d f r o m m i s i d e n t i f i c a t i o n o f c l o n e s d u r i n g the i n i t i a l s c r e e n i n g o f the l i b r a r y . It i s a l s o p o s s i b l e that e x p r e s s i o n o f t h e s e f u s i o n p r o t e i n s r e s u l t e d i n a r r e s t e d g r o w t h a f te r c o l o n y f o r m a t i o n s i n c e i t w a s s h o w n that c y t o p l a s m i c a l l y - l o c a l i z e d a l k a l i n e p h o s p h a t a s e c a n a c q u i r e e n z y m a t i c a c t i v i t y u p o n c e s s a t i o n o f c e l l g r o w t h ( D e r m a n et al, 1 9 9 5 ) . T h e r e are s e v e r a l l i m i t a t i o n s o f the g e n e f u s i o n s t r a t e g y ; (1 ) o n l y e x p r e s s e d a n d t r a n s l o c a t e d p r o t e i n s w i l l b e d e t e c t e d ; (2) i d e n t i f i c a t i o n o f a g e n e i s i n f e r r e d f r o m i t s s i m i l a r i t y to d a t a b a s e s e q u e n c e s a n d t h e r e f o r e , n o v e l g e n e s w i l l be not be e a s i l y i d e n t i f i e d ; (3) g e n e 83 i d e n t i f i c a t i o n i s d e p e n d e n t u p o n the g e n e f u s i o n o c c u r r i n g i n a r e g i o n c o n t a i n i n g r e l a t i v e l y c o n s e r v e d a m i n o a c i d s i g n a t u r e s o r r e s i d u e s ; (4) s e c r e t e d o r e x p o r t e d p r o t e i n s that a re d e p e n d e n t o n s e c r e t i o n s y s t e m s n o t p r e s e n t i n E. coli w i l l n o t be i d e n t i f i e d ; (5) p o o r l y e x p r e s s e d p r o t e i n s m a y b e d i f f i c u l t t o de tect . T h e g e n e f u s i o n m e t h o d p r e s e n t e d h e r e i s a r a p i d , t e c h n i c a l l y s i m p l e a n d r e l a t i v e l y i n e x p e n s i v e m e t h o d f o r i d e n t i f y i n g s e c r e t e d a n d e x p o r t e d p r o t e i n s i n c l u d i n g , b u t n o t l i m i t e d t o , n o v e l d r u g ta rge ts a n d g e n e s o f t h e r a p e u t i c in te res t . A p p l i c a t i o n o f t h i s s y s t e m to b a c t e r i a l s t r a i n s w i t h k n o w n g e n o m e s e q u e n c e s p r o v i d e s c o m p l e m e n t a r y a n d n o v e l i n f o r m a t i o n that i s n o t e a s i l y i n f e r r e d f r o m D N A s e q u e n c e a n a l y s i s . T h e m e t h o d i s a p p l i c a b l e to a w i d e v a r i e t y o f m i c r o b e s a n d g e n e t i c s y s t e m s i n c l u d i n g b a c t e r i a f o r w h i c h the re i s n o g e n e t i c s y s t e m a v a i l a b l e . T h e a d d i t i o n o f p h o s p h a t e to t h e s e l e c t i o n m e d i a i s a n e f f e c t i v e m e t h o d f o r the i n h i b i t i o n o f the e n d o g e n o u s p h o s p h a t a s e a c t i v i t y i n E. coli w h i l e s t i l l a l l o w i n g f o r the d e t e c t i o n o f r e c o m b i n a n t a l k a l i n e p h o s p h a t a s e f u s i o n p r o t e i n s . 2. R o l e o f e f f l u x i n t h e i n t r i n s i c a n t i b i o t i c r e s i s t a n c e oi Helicobacter pylori Helicobacter pylori i s s u s c e p t i b l e to s e v e r a l a n t i b i o t i c s in vitro, b u t is d i f f i c u l t t o t reat in vivo u s i n g a n y o f t h e s e a n t i b i o t i c s s i n g l y . A f a c t o r i n v o l v e d i n the i n t r i n s i c r e s i s t a n c e o f m a n y b a c t e r i a to m u l t i p l e a n t i b i o t i c c l a s s e s i s t h e e x p r e s s i o n of s p e c i f i c R N D e f f l u x s y s t e m s ( M a et ai, 1 9 9 4 ) . T h e r e f o r e I c o n s i d e r e d t h e p o s s i b i l i t y i n C h a p t e r 2 that the i n t r i n s i c in vivo a n t i b i o t i c r e s i s t a n c e o f H. pylori w a s d u e to e x p r e s s i o n o f s i m i l a r R N D e f f l u x s y s t e m s . T h e t h r e e R N D s y s t e m h o m o l o g u e s i n H. pylori s e e m e d to be s i m i l a r i n o p e r o n s t r u c t u r e to o t h e r b a c t e r i a l R N D e f f l u x s y s t e m s , b a s e d o n the r e l a t i v e l o c a t i o n a n d t r a n s c r i p t i o n a l p o l a r i t y o f i n d i v i d u a l O R F s . I n g e n e r a l t h e o p e r o n s t r u c t u r e s of m a n y R N D e f f l u x s y s t e m s a re c o n s e r v e d a n d c o n t a i n t h r e e c o m p o n e n t s : a n o u t e r m e m b r a n e p r o t e i n , a m e m b r a n e f u s i o n p r o t e i n a n d a 84 p u m p p r o t e i n ( P a u l s e n et al, 1 9 9 6 ) . F u r t h e r m o r e , in H. pylori the h o m o l o g u e f o r t h e o u t e r m e m b r a n e p r o t e i n a p p e a r e d as the f i r s t o f t h e s e th ree genes, w h e r e a s the o u t e r m e m b r a n e p r o t e i n g e n e i s e i t h e r s p a t i a l l y s e p a r a t e d ( T o l C o f E. coli) or the m o s t d i s t a l g e n e ( O p r M , O p r N , M t r C , C z c C ) i n e f f l u x o p e r o n s . I n a d d i t i o n to these th ree genes, e a c h o f the H. pylori p u t a t i v e o p e r o n s c o n t a i n e d a d d i t i o n a l O R F s that h a v e n o t p r e v i o u s l y been a s s o c i a t e d w i t h R N D s y s t e m s . W h e t h e r t h e s e a d d i t i o n a l g e n e s p l a y a r o l e i n c o n j u n c t i o n w i t h t h e i r a s s o c i a t e d R N D s y s t e m s r e m a i n s to b e d e t e r m i n e d . T h e i n d i v i d u a l R N D s y s t e m h o m o l o g u e s were h i g h l y c o n s e r v e d a m o n g a l l t h ree H. pylori s t r a i n s at b o t h t h e a m i n o a c i d a n d D N A l e v e l s . The p r o p o s e d H. pylori R N D s y s t e m g e n e s w e r e i n e x c e s s o f 9 0 % i d e n t i c a l to t h e i r c o r r e s p o n d i n g O R F s i n the o t h e r H. pylori s t r a i n s . T h e p h y l o g e n e t i c a n d s e q u e n c e a n a l y s i s s h o w e d that R N D e f f l u x p u m p p r o t e i n s a n d m e m b r a n e f u s i o n p r o t e i n s t e n d to c l u s t e r t o g e t h e r a c c o r d i n g to t h e i r s u b s t r a t e s p e c i f i c i t y ( P a u l s e n et al, 1 9 9 6 ; S a i e r et al, 1 9 9 8 ) . S i m i l a r a n a l y s i s o f the H. pylori R N D e f f l u x p u m p p r o t e i n s r e v e a l e d that t h e H. pylori p r o t e i n s h a v e d i v e r g e d f r o m the c h a r a c t e r i z e d R N D p u m p p r o t e i n s ( F i g u r e 7 ) . S i m i l a r a n a l y s i s r e v e a l e d that the m e m b r a n e f u s i o n p r o t e i n s w e r e a l s o d i v e r g e n t f r o m o t h e r b a c t e r i a l R N D m e m b r a n e f u s i o n p r o t e i n s . T h e s e q u e n c e d i v e r g e n c e o f the H. pylori R N D p r o t e i n s m i g h t r e f l e c t the e v o l u t i o n of H. pylori i n a n e n v i r o n m e n t a l n i c h e that i s d e v o i d o f c o m p e t i n g o r g a n i s m s a n d l a c k i n g m a n y of the n o x i o u s s u b s t a n c e s that t h e e n t e r i c o r s o i l d w e l l i n g o r g a n i s m s are l i k e l y to e n c o u n t e r ( i .e . , a n t i b i o t i c s , d e t e r g e n t s , d i v a l e n t m e t a l c a t i o n s e tc . ) . T h e r e f o r e , i n the a b s e n c e o f t h e s e s e l e c t i v e p r e s s u r e s , it i s p o s s i b l e that the H. pylori R N D s y s t e m s h a v e e v o l v e d n e w t r a n s p o r t o r f u n c t i o n a l r o l e s i n H. pylori e c o l o g y . A l t h o u g h t h e R N D s y s t e m h o m o l o g u e s are h i g h l y c o n s e r v e d a m o n g H. pylori s t r a i n s , t h e th ree p u t a t i v e o p e r o n s w e r e n o t w e l l c o n s e r v e d r e l a t i v e to e a c h o t h e r as s h o w n in T a b l e V I . 85 T h e s e r e s u l t s w e r e c o n t r a r y to w h a t i s s e e n i n o t h e r b a c t e r i a . F o r e x a m p l e , the E. coli R N D p u m p p r o t e i n s ( A c r B , A c r D , A c r F a n d Y h i V ) a re m o r e t h a n 6 0 % i d e n t i c a l a n d 8 5 % s i m i l a r t o e a c h o t h e r , a n d t h e e f f l u x p u m p s i n P. aeruginosa ( M e x B , M e x D a n d M e x F ) a re m o r e t h a n 3 8 % i d e n t i c a l a n d 7 2 % s i m i l a r t o e a c h o ther . T h e h i g h l e v e l o f s e q u e n c e c o n s e r v a t i o n a m o n g the E. coli a n d P. aeruginosa R N D p u m p p r o t e i n s i s a l s o r e f l e c t e d i n p h y l o g e n e t i c a n a l y s i s w h i c h s h o w e d that t h e E. coli a n d P. aeruginosa R N D p u m p p r o t e i n s a l l c l u s t e r a m o n g t h e m u l t i p l e d r u g e f f l u x p u m p s . T h e p r e s e n c e o f d i s s i m i l a r R N D e f f l u x s y s t e m s w i t h i n a b a c t e r i a l s p e c i e s , as s e e m s to b e t h e c a s e w i t h H. pylori, h a s n o t p r e v i o u s l y b e e n o b s e r v e d . T h i s m a y r e f l e c t d i f f e r e n t e v o l u t i o n a r y o r i g i n s f o r e a c h o f t h e s y s t e m s , as s u s p e c t e d f o r g e n e s i n the H. pylori cag p a t h o g e n i c i t y i s l a n d ( T o m b et al, 1 9 9 7 ) , o r a l t e r n a t i v e l y c o u l d r e f l e c t t h e i n d e p e n d e n t e v o l u t i o n o f i n d i v i d u a l e f f l u x s y s t e m s from a c o m m o n a n c e s t o r t o w a r d s d i f f e r e n t s u b s t r a t e s p e c i f i c i t y . T h e p r e s e n c e o f c o s m i d p 2 0 0 : 4 c o n t a i n i n g the hemE-hefABC o p e r o n f a i l e d to c o m p l e m e n t s e v e r a l E. coli acrAB m u t a n t s . T h i s r e s u l t is e x p e c t e d s i n c e m o s t o f t h e k n o w n H. pylori p r o m o t e r s d o n o t f u n c t i o n i n E. coli ( O d e n b r i g h t et al, 1996 ) , a n d at l eas t a m o d e r a t e l e v e l e x p r e s s i o n o f R N D e f f l u x s y s t e m s i s r e q u i r e d in E. coli to see p h e n o t y p i c c h a n g e s s u c h as c h a n g e s i n a n t i b i o t i c r e s i s t a n c e ( S r i k u m a r et al, 1998). R e c o m b i n a n t e x p r e s s i o n o f t h e hefBC a n d hefC g e n e s b e i n g e x p r e s s e d f r o m the lac p r o m o t e r in p B B R l M C S a n d p B l u e s c r i p t a l s o f a i l e d to c o m p l e m e n t t h e E. coli acrAB m u t a n t s . T h e r e are s e v e r a l r e a s o n s that w o u l d e x p l a i n these r e s u l t s . T h e P. aeruginosa s y s t e m , mexAB-oprM in c o n t r a s t to t h e mexCD-oprJ s y s t e m , r e q u i r e d the p r e s e n c e o f i t s o u t e r m e m b r a n e c o m p o n e n t f o r f u n c t i o n i n E. coli ( S r i k u m a r et al, 1 9 9 8 ) . It i s t h e r e f o r e p o s s i b l e that the hefBC g e n e s m a y r e q u i r e the p r e s e n c e o f t h e i r c o g n a t e o u t e r m e m b r a n e p o r e c o m p o n e n t f o r p r o p e r f u n c t i o n , as s e e n w i t h the P. aeruginosa mexCD-oprJsystem ( S r i k u m a r et al, 1 9 9 8 ) . A l t e r n a t i v e l y , the hefBC s y s t e m m a y n o t f u n c t i o n 86 e f f i c i e n t l y e n o u g h i n E. coli to r e s u l t i n a d e t e c t a b l e c h a n g e i n p h e n o t y p e , o r the hefABC o p e r o n m a y n o t f u n c t i o n i n a n t i b i o t i c r e s i s t a n c e o r m a y t r a n s p o r t a n u n i d e n t i f i e d o r u n t e s t e d c o m p o u n d . S t u d i e s h a v e r e v e a l e d that t h e e x p r e s s i o n o f s o m e R N D e f f l u x s y s t e m s i n b a c t e r i a i s r e g u l a t e d b y e n v i r o n m e n t a l s t i m u l i s u c h as t h e p r e s e n c e o f a n t i b i o t i c s , a n t i m i c r o b i a l c o m p o u n d s , g r o w t h s tage a n d s t ress f a c t o r s ( M a et al, 1 9 9 4 b ; N i k a i d o , 1 9 9 6 ; P a u l s e n et al, 1 9 9 6 ) . T h e d a t a o f R i c h a r d A i m ( A p p e n d i x I) s h o w e d that o n e o f t h e H. pylori R N D o p e r o n s (hefGHI) w a s e x p r e s s e d o n l y in vivo. T h e m e c h a n i s m f o r r e g u l a t i n g the e x p r e s s i o n o f t h e R N D s y s t e m s i n H. pylori, i f i t e x i s t s , i s u n k n o w n . I n m a n y R N D s y s t e m s a d i v e r g e n t l y t r a n s c r i b e d r e g u l a t o r y g e n e f o r the e x p r e s s i o n o f the R N D o p e r o n is l o c a t e d u p s t r e a m o f the R N D s y s t e m ( N i k a i d o , 1 9 9 6 ; P a u l s e n et al, 1 9 9 7 ) . H o w e v e r , a c o r r e s p o n d i n g O R F that e n c o d e d a p r o t e i n w i t h a D N A b i n d i n g m o t i f w a s m i s s i n g f r o m e a c h o f the H. pylori R N D o p e r o n s . A r e g i o n o f d y a d s y m m e t r y i n t h e p u t a t i v e p r o m o t e r r e g i o n o f t h e hefGHI o p e r o n w a s e v i d e n t a n d d i d n o t a p p e a r t o b e p r e s e n t i n the p r o p o s e d p r o m o t e r r e g i o n s o f t h e hefABC o r hefDEF o p e r o n s . T h e m u t a g e n e s i s o f e a c h o f t h e R N D e f f l u x s y s t e m s i n the H. pylori c h r o m o s o m e d i d n o t a f f e c t o n t h e v i a b i l i t y o r s u s c e p t i b i l i t y o f t h e r e s u l t i n g s t r a i n s to a n y o f the t e s t e d a n t i b i o t i c s ( A p p e n d i x I). T h i s u n e x p e c t e d r e s u l t w a s i n c o n t r a s t to w h a t h a s b e e n o b s e r v e d i n o t h e r b a c t e r i a i n w h i c h m u t a n t s l a c k i n g s p e c i f i c e f f l u x s y s t e m s are d r a m a t i c a l l y m o r e s u s c e p t i b i l i t y to a r a n g e o f c h e m i c a l l y u n r e l a t e d a n t i b i o t i c s ( M a et al, 1 9 9 3 ; L i et al, 1 9 9 5 H a g m a n et al, 1 9 9 5 ) . P o t e n t i a l r e a s o n s f o r t h e o b s e r v e d r e s u l t s i n c l u d e t h e p o s s i b i l i t i e s that e f f l u x d o e s n o t f u n c t i o n i n t h e i n t r i n s i c a n t i b i o t i c r e s i s t a n c e oiH. pylori t o a n t i b i o t i c s o r that t h e r e s i s t a n c e t o a n t i b i o t i c s c o u l d b e m e d i a t e d b y t h e hefGHIoperon w h i c h i s n o t e x p r e s s e d i n c e l l s g r o w n in vitro. A n o t h e r p o t e n t i a l f a c t o r i s that t h e o u t e r m e m b r a n e o f in v z Y r o - g r o w n H. pylori i s p e r m e a b l e t o h y d r o p h o b i c a n t i b i o t i c s , s i n c e e f f l u x p u m p s d o n o t w o r k w e l l i n c e l l s w i t h o u t e r m e m b r a n e 87 a l t e r a t i o n s l e a d i n g to e n h a n c e d a n t i b i o t i c u p t a k e ( H a n c o c k , 1 9 9 7 ) . L a s t l y , i t i s a l s o p o s s i b l e that t h e H. pylori R N D s y s t e m s d o n o t f u n c t i o n i n a n t i b i o t i c e f f l u x . I w a s n o t a b l e t o i d e n t i f y e f f l u x a c t i v i t y i n H. pylori g r o w n in vitro u s i n g c o m m o n subs t ra tes f o r b a c t e r i a l e f f l u x s y s t e m s ( N P N , t e t r a c y c l i n e a n d c h l o r a m p h e n i c o l ) . T h e l a c k o f i d e n t i f i e d e f f l u x a c t i v i t y in vitro p l u s t h e r e s u l t s f r o m the m u t a g e n e s i s ( A p p e n d i x I) o f the H. pylori R N D o p e r o n s s t r o n g l y s u g g e s t that e f f l u x d o e s not p l a y a r o l e i n the in vitro r e s i s t a n c e o f H. pylori to a n t i m i c r o b i a l c o m p o u n d s . T h e h i g h b a c k g r o u n d l e v e l o f N P N u p t a k e s e e n w i t h H. pylori i s c o n s i s t e n t w i t h t h e a b s e n c e o f a c t i v e e f f l u x . S i m i l a r l y h i g h l e v e l s o f N P N u p t a k e are s e e n w i t h e f f l u x d e f e c t i v e E. coli acrAB a n d tolC ( R . E . W . H a n c o c k , u n p u b l i s h e d o b s e r v a t i o n s ) a n d P. aeruginosa mexAB-oprM(Ocaktan et al., 1 9 9 7 ) m u t a n t s w h i c h are h y p e r s u s c e p t i b l e t o a n t i b i o t i c s . A l t e r n a t i v e l y , t h e o u t e r m e m b r a n e o f in v / i r o - g r o w n H. pylori m a y b e h y p e r p e r m e a b l e to h y d r o p h o b i c c o m p o u n d s , a l l o w i n g a n t i b i o t i c i n f l u x to o v e r w h e l m t h e c o n t r i b u t i o n o f a n y e f f l u x s y s t e m ( s ) . P r e t r e a t m e n t o f H. pylori w i t h as l i t t l e as 1 u M C C C P , f o r u n k n o w n r e a s o n s , c o m p l e t e l y a b o l i s h e d t h e p o l y m y x i n B - s t i m u l a t e d u p t a k e o f N P N a n d d e c r e a s e d the a c c u m u l a t i o n o f c h l o r a m p h e n i c o l a n d t e t r a c y c l i n e b y H. pylori b y 5 0 % . I n c o n t r a s t , n e i t h e r 1 u M C C C P n o r the c o n c e n t r a t i o n s g e n e r a l l y u s e d i n E. coli ( 5 u M ) a n d P. aeruginosa ( 2 5 0 p M ) to i n h i b i t e n e r g y d e p e n d e n t e f f l u x , h a d a n y e f f e c t o n the b a c k g r o u n d l e v e l o f N P N u p t a k e b y t h e s e c e l l s ( L o h et al., 1 9 8 4 ) . T h e s e c o n t r a r y r e s u l t s a re c o n s i s t e n t w i t h an a c t i v e u p t a k e m e c h a n i s m f o r t h e s e c o m p o u n d s i n H. pylori. A l t e r n a t i v e l y , the f i n d i n g s m a y r e s u l t f r o m the p a r t i t i o n i n g o f t e t r a c y c l i n e a c r o s s t h e c y t o p l a s m i c m e m b r a n e a c c o r d i n g to a m e m b r a n e p o t e n t i a l ( N i k a i d o & T h a n a s s i , 1 9 9 3 ) . H o w e v e r , t h i s d o e s n o t e x p l a i n t h e r e s u l t s w i t h N P N w h e r e p a r t i t i o n i n g a c r o s s the m e m b r a n e a c c o r d i n g to a m e m b r a n e p o t e n t i a l h a s no t b e e n o b s e r v e d . 88 O n e c l a s s o f a n t i m i c r o b i a l s to w h i c h H. pylori are i n t r i n s i c a l l y r e s i s t a n t a re t h e c a t i o n i c a n t i m i c r o b i a l p e p t i d e s . T h i s p r o p e r t y c o u l d b e a n e v o l u t i o n a r y a d a p t a t i o n to the in vivo e n v i r o n m e n t i n t h e g a s t r i c m u c o s a a n d t h e c h r o n i c i n f l a m m a t i o n a s s o c i a t e d w i t h c o l o n i z a t i o n o f the g a s t r i c m u c o s a b y H. pylori. T h e m e c h a n i s m o f H. pylori r e s i s t a n c e to these c a t i o n i c a n t i b i o t i c s i s n o t k n o w n . T h e p r e s e n c e o f t h e s e l f p r o m o t e d u p t a k e p a t h w a y i n H. pylori ( H a n c o c k , 1 9 9 7 ) s u g g e s t s that p o l y m y x i n B i n t e r a c t s w i t h o u t e r m e m b r a n e o f H. pylori b y i n a m a n n e r s i m i l a r t o that o b s e r v e d w i t h P. aeruginosa a n d E. coli, b y c o m p e t i n g f o r d i v a l e n t c a t i o n b i n d i n g s i tes o n the s u r f a c e o f L P S . T h e r e s i s t a n c e o f H. pylori to h i g h c o n c e n t r a t i o n s o f p o l y m y x i n B m a y b e e x p l a i n e d b y the r e c e n t f i n d i n g that the b a c k b o n e o f H. pylori L P S i s u n d e r p h o s p h o r y l a t e d ( A s p i n a l l et al, 1 9 9 6 ) . R e d u c e d p h o s p h o r y l a t i o n o f LPS r e d u c e s the net n e g a t i v e s u r f a c e c h a r g e o n L P S a n d p r e s u m a b l y h a s a n i n h i b i t o r y e f f e c t o n the i n t e r a c t i o n o f c a t i o n i c a n t i m i c r o b i a l s w i t h t h e o u t e r m e m b r a n e t h u s r e s u l t i n g i n i n c r e a s e d r e s i s t a n c e . U n d e r p h o s p h o r y l a t i o n o r c h a r g e n e u t r a l i z a t i o n b y a r a b i n o s a m i n o l a t i o n o f the L i p i d A b a c k b o n e h a s b e e n a s s o c i a t e d w i t h r e s i s t a n c e to c a t i o n i c a n t i m i c r o b i a l p e p t i d e s i n Salmonella ( G u o et al, 1 9 9 7 ) , Pseudomonas ( M o o r e & H a n c o c k , 1 9 8 6 ) , a n d Vibrio ( P a r s o t et al, 1 9 9 1 ) s p e c i e s . C o n s i s t e n t w i t h t h e r e s i s t a n c e o f 77. pylori to r e l a t i v e l y h i g h c o n c e n t r a t i o n s o f p o l y m y x i n B , the c o n c e n t r a t i o n o f p o l y m y x i n B r e q u i r e d f o r p e r m e a b i l i z a t i o n o f the H. pylori o u t e r m e m b r a n e i n the N P N a s s a y s w a s a p p r o x i m a t e l y 1 0 - f o l d h i g h e r t h a n w h a t i s s e e n w i t h E. coli o r P. aeruginosa. I h y p o t h e s i z e that t h e r e are p h y s i o l o g i c a l c h a n g e s i n H. pylori a s s o c i a t e d w i t h g r o w t h i n t h e s t o m a c h , as o p p o s e d to g r o w t h i n t h e l a b o r a t o r y that a f f e c t the u p t a k e o f a n t i b i o t i c s b y H. pylori. T h e R T P C R d a t a o f R i c h a r d A i m ( A p p e n d i x I) s u g g e s t e d t h e p r e s e n c e o f a r e g u l a t o r y m e c h a n i s m c o n t r o l l i n g t h e in vivo e x p r e s s i o n o f hefGHI o p e r o n ( A p p e n d i x I). I n a d d i t i o n , o t h e r 89 g e n e s that a re p o t e n t i a l l y i m p o r t a n t i n a n t i b i o t i c s u s c e p t i b i l i t y ofH. pylori, have b e e n s h o w n to b e d i f f e r e n t i a l l y e x p r e s s e d a c c o r d i n g to t h e c e l l u l a r e n v i r o n m e n t , including s e v e r a l m e m b e r s o f t h e H o p f a m i l y ( W o r s t et al, 1 9 9 5 ) a n d the p r o d u c t i o n of a c a p s u l e which is p r e s e n t o n l y in vivo ( L e e & O ' R o u r k e , 1 9 9 3 ) . R e g u l a t o r y s y s t e m s i n Salmonella typhmirium (phoP r e g u l o n ) a n d Vibrio cholerae (toxR r e g u l o n ) h a v e b e e n s h o w n to regulate the in vivo e x p r e s s i o n o f n u m e r o u s v i r u l e n c e f a c t o r s i n t h e i r r e s p e c t i v e b a c t e r i a , i n c l u d i n g cell envelope a l t e r a t i o n s ( G u o et al, 1 9 9 7 ; P a r s o t et al, 1 9 9 1 ) w h i c h h a v e b e e n i m p l i c a t e d in cell s u s c e p t i b i l i t y to c a t i o n i c a n t i m i c r o b i a l s u b s t a n c e s . C o l l e c t i v e l y , these c o n s i d e r a t i o n s s t r o n g l y suggest that t he re a re in vivo p h y s i o l o g i c a l c h a n g e s i n H. pylori a n d these c h a n g e s are likely affect the in vivo s u s c e p t i b i l i t y o f H. pylori t o a n t i b i o t i c s . H o w e v e r , the R N D systems c o n t r i b u t i o n to the in vivo i n t r i n s i c r e s i s t a n c e o f H. pylori i s n o t k n o w n p r e s e n t l y . I n c o n c l u s i o n , I h a v e s h o w n that H. pylori c o n t a i n s three R N D efflux s y s t e m h o m o l o g u e s that a re c o n s e r v e d a m o n g th ree H. pylori s t r a i n s a n d , in c o l l a b o r a t i o n , that the hefGHI s y s t e m i s d i f f e r e n t i a l l y r e g u l a t e d , a n d that i n d e p e n d e n t m u t a g e n e s i s of the three R N D e f f l u x o p e r o n s i n the c h r o m o s o m e o f H. pylori h a d n o e f f e c t o n the s u s c e p t i b i l i t y of H. pylori to a n t i b i o t i c s in vitro. I w a s u n a b l e to i d e n t i f y a c t i v e e f f l u x a c t i v i t y i n in vitro-gvown H. pylori in c o n t r a s t to w h a t i s s e e n i n o t h e r G r a m n e g a t i v e b a c t e r i a s t u d i e d to date . C o l l e c t i v e l y these results suggest that a c t i v e e f f l u x d o e s n o t p l a y a r o l e i n the in vitro i n t r i n s i c r e s i s t a n c e o f H. pylori to a n t i b i o t i c s . 3. Identification of a conserved scaffolding f o r a f a m i l y o f P - b a r r e l p r o t e i n s P r i o r to the w o r k p r e s e n t e d h e r e , s t u d i e s had d i r e c t l y o r i n d i r e c t l y found h e t e r o g e n e i t y i n the p h y s i c a l g e n e t i c m a p s o f s e v e r a l H. pylori s t r a i n s (Jiang et al, 1996). These r e s u l t s w e r e h y p o t h e s i z e d as i m p l y i n g h e t e r o g e n e i t y at the i n d i v i d u a l p r o t e i n sequence level. T h e r e c e n t r e l e a s e o f t h e H. pylori 2 6 6 9 5 g e n o m e s e q u e n c e b y Tomb et al. (1997) seemed to b e c o n s i s t e n t 90 w i t h these p r e v i o u s f i n d i n g s . T o m b et al. o b s e r v e d a p a r a l o g o u s f a m i l y o f 32 o u t e r m e m b r a n e p r o t e i n g e n e s a n d h y p o t h e s i z e d t h e s e w e r e d e r i v e d b y g e n o m e v a r i a t i o n r e s u l t i n g from s l i p p e d -s t r a n d m i s p a i r i n g a n d r e c o m b i n a t i o n e v e n t s d u e to the e x i s t e n c e o f r e p e t i t i v e s e q u e n c e s w i t h i n t h i s f a m i l y o f o u t e r m e m b r a n e p r o t e i n g e n e s . T h e H o p f a m i l y o f H. pylori o u t e r m e m b r a n e p r o t e i n s w a s first i n t r o d u c e d ( E x n e r et al. 1 9 9 5 ) as a g r o u p i n g o f 5 p o r e - f o r m i n g p r o t e i n s ( p o r i n s H o p A - E ) , f o u r o f w h i c h d i s p l a y e d c o n s i d e r a b l e N - t e r m i n a l s e q u e n c e h o m o l o g y ( H o p A - D ) . T o m b et al. e x p a n d e d t h i s f a m i l y to 3 2 p r o t e i n s i n a n o u t e r m e m b r a n e p r o t e i n f a m i l y b a s e d o n e x t e n s i v e C - t e r m i n a l h o m o l o g y w i t h ( 2 2 p r o t e i n s ) o r w i t h o u t ( 1 0 p r o t e i n s ) the p r e v i o u s l y i d e n t i f i e d c o n s e r v e d N - t e r m i n u s . M y a n a l y s i s o f t h e H. pylori 2 2 6 9 5 g e n o m e r e v e a l e d a n a d d i t i o n a l t w o m e m b e r s o f the H o p f a m i l y ( O R F s 0 1 0 1 a n d 1 0 6 6 ) t h u s i n c r e a s i n g the t o t a l n u m b e r o f the H o p f a m i l y to 3 4 m e m b e r s . T h e b i o l o g i c a l s i g n i f i c a n c e o f t h e H o p f a m i l y is e v i d e n t as f a m i l y m e m b e r s h a v e b e e n s h o w n to f u n c t i o n as a d h e s i n s ( l i v e r et al, 1 9 9 8 ) , a n d p o r i n s h a v e b e e n s h o w n to b e r e g u l a t e d b y e n v i r o n m e n t a l s t i m u l i ( i r o n d e f i c i e n c y ) ( W o r s t et al, 1 9 9 5 ) . H o w e v e r , the b i o l o g i c a l s i g n i f i c a n c e o f t h e c o n s e r v e d s e q u e n c e m o t i f s a m o n g the H o p f a m i l y is n o t k n o w n . I n a d d i t i o n to t h e H o p f a m i l y , t he re a l s o e x i s t s at least 5 o t h e r o u t e r m e m b r a n e p r o t e i n s , i d e n t i f i e d i n m y a n a l y s i s o f t h e g e n o m e , that d o n o t c o n t a i n the c o n s e r v e d s e q u e n c e m o t i f s ( O R F s 0 6 0 5 , 0 8 3 9 , 0 9 7 1 , 1 1 2 5 , a n d 1 3 2 7 ; N . B . the hefA, hep a n d hefG o u t e r m e m b r a n e p o r e p r o t e i n s d o n o t c o n t a i n t h e s e m o t i f s ) . M y m u l t i p l e s e q u e n c e a n a l y s i s o f the H o p f a m i l y w a s f a c i l i t a t e d b y the a p p l i c a t i o n o f the G i b b s m o t i f s a m p l i n g a l g o r i t h m ( N e u w a l d et al, 1 9 9 5 ) . T h e H o p f a m i l y c o n t a i n s m e m b e r s r a n g i n g i n s i z e from 8 6 to 1 2 3 0 a m i n o a c i d s , m u l t i p l e s e q u e n c e a n a l y s i s m e t h o d s that i n c o r p o r a t e g a p p e n a l t i e s are l e s s s e n s i t i v e at i d e n t i f y i n g c o n s e r v e d s e q u e n c e m o t i f s a m o n g 91 s e q u e n c e g r o u p s that c o n t a i n p r o t e i n s w i t h l a r g e s i z e d i s t r i b u t i o n s ( N e u w a l d et al, 1 9 9 5 ) , t h a n are m o t i f - b a s e d m e t h o d s that d o n o t a s s i g n g a p p e n a l t i e s ( s u c h as the G i b b s s a m p l i n g m o t i f m e t h o d ) . A p p l i c a t i o n o f t h e G i b b s m e t h o d to the H o p f a m i l y a l l o w e d the i d e n t i f i c a t i o n o f at l eas t 8 c o n s e r v e d s e q u e n c e m o t i f s that w e r e s e p a r a t e d b y v a r y i n g l e n g t h s o f u n c o n s e r v e d a m i n o a c i d s e q u e n c e . I n a d d i t i o n , t h e B L O C K S a n a l y s i s e x p a n d e d the s u b f a m i l y o f H o p p r o t e i n s c o n t a i n i n g t h e c o n s e r v e d N - t e r m i n a l s e q u e n c e d o m a i n to 2 4 p r o t e i n s . C o m p a r a t i v e s e q u e n c e a n a l y s i s o f the H. pylori J 9 9 a n d H. pylori 2 2 6 9 5 r e v e a l e d that the H o p f a m i l y w a s h i g h l y c o n s e r v e d a m o n g these t w o s t r a i n s ( H a n c o c k et al, 1 9 9 8 ) . T h e c o m p a r i s o n a l s o a l l o w e d s o m e i n t e r e s t i n g o b s e r v a t i o n s to be m a d e . F i r s t , i n H. pylori 2 6 6 9 5 t h e r e w e r e 3 p a i r s o f g e n e s that e n c o d e d s i m i l a r p r o t e i n s ( O R F 0 7 2 2 a n d 0 7 2 5 w e r e 8 5 % i d e n t i c a l , O R F 0 4 7 7 a n d O R F 0 9 2 3 w e r e 9 9 % i d e n t i c a l ; a n d O R F 0 2 2 7 a n d O R F 1 3 4 2 w e r e 1 0 0 % i d e n t i c a l ) . T h e p u t a t i v e p r o t e i n s e n c o d e d i n t h e s e last 2 p a i r s w e r e s p a c e d a l m o s t 5 0 0 k b a w a y from t h e i r r e l a t e d p a r t n e r s o n the c h r o m o s o m e . A n a l y s i s o f the H. pylori J 9 9 s e q u e n c e a l s o r e v e a l e d t h e p r e s e n c e o f t h e s e 3 p a i r s o f g e n e s d i s p l a y i n g s i m i l a r h i g h l e v e l s o f s e q u e n c e i d e n t i t y w i t h i n e a c h g r o u p . F i r s t l y , the H. pylori J 9 9 e q u i v a l e n t s o f the O R F 0 4 7 7 a n d O R F 0 9 2 3 p r o t e i n s a l s o d i s p l a y e d 9 9 % i d e n t i t y to e a c h o the r , ye t o n l y 8 9 % i d e n t i t y to t h e H. pylori 2 6 6 9 5 p r o t e i n s . I n b o t h s t r a i n s the re are 3 p a i r s o f g e n e s f r o m the H o p f a m i l y that r e s i d e v e r y c l o s e t o g e t h e r o n t h e c h r o m o s o m e ; O R F 0 2 5 2 a n d O R F 0 2 5 4 ( 1 3 5 nt apar t ) ; H o p C ( O R F 0 9 1 2 ) a n d H o p B ( O R F 0 9 1 3 ) ( 2 5 n t apar t ) a n d O R F 1 1 5 6 a n d O R F 1 1 5 7 (26 n t apar t ) . T h e c l o s e s t a l i g n m e n t s to O R F 0 2 5 2 a n d O R F 0 2 5 4 w e r e O R F 1 1 5 6 a n d O R F 1 1 5 7 , r e s p e c t i v e l y , s u g g e s t i n g that t h e s e g e n e s m a y h a v e a r i s e n b y the d u p l i c a t i o n a n d t r a n s p o s i t i o n o f a n e n t i r e l o c u s . C o m p a r i s o n o f t h e H. pylori J 9 9 g e n o m e s e q u e n c e w i t h that o f the H. pylori 2 6 6 9 5 a n d o t h e r s e q u e n c e s i n G e n b a n k s h o w s that s e v e r a l o f the a b o v e g e n e s are h i g h l y c o n s e r v e d i n H. 92 pylori. F o r e x a m p l e t h e H o p C / H o p B p a i r o f g e n e s , w h i c h are 46% i d e n t i c a l t o e a c h o the r , b o t h s h a r e > 9 5 % i d e n t i t y t o t h e t w o o t h e r s e q u e n c e s o f e a c h o f these g e n e s a v a i l a b l e ( H a n c o c k et al, 1 9 9 8 ) . I n f a c t , m a n y o f t h e m e m b e r s o f t h i s f a m i l y o f p r o t e i n s s h a r e > 9 0 % i d e n t i t y at t h e a m i n o a c i d l e v e l b e t w e e n s t r a i n s 2 6 6 9 5 a n d J 9 9 . T h i s o b s e r v a t i o n s t r o n g l y s u g g e s t s that the c o n s e r v e d s e q u e n c e m o t i f s f o u n d a m o n g the H o p f a m i l y d o n o t f u n c t i o n i n h o m o l o g o u s r e c o m b i n a t i o n to g e n e r a t e g e n o m i c o r a n t i g e n i c d i v e r s i t y . I h y p o t h e s i z e that t h e c o n s e r v e d s e q u e n c e m o t i f s i n the H o p f a m i l y f u n c t i o n as a c o n s e r v e d s c a f f o l d i n g f o r a f a m i l y o f P -barrel p r o t e i n s . T h i s h y p o t h e s i s i s b a s e d o n m o d e l i n g o f the t r a n s m e m b r a n e t o p o l o g y o f m e m b e r s o f t h e g e n e r a l ( n o n - s p e c i f i c ) p o r i n f a m i l y . A l t h o u g h the re i s n o a p p a r e n t p r i m a r y a m i n o a c i d s e q u e n c e c o n s e r v a t i o n b e t w e e n b a c t e r i a l s p e c i e s f o r s u c h P -strands, a g e n e r a l m o t i f o f a l t e r n a t i n g h y d r o p h o b i c a n d h y d r o p h i l i c r e s i d u e s i s e v i d e n t , e s p e c i a l l y i n the N - a n d C - t e r m i n a l P -strands, w h i c h are i n v o l v e d i n s u b u n i t : s u b u n i t i n t e r a c t i o n s . T o m b et al. n o t e d that the c o n s e r v e d C - t e r m i n i o f the H o p f a m i l y c o n t a i n s a l t e r n a t i n g h y d r o p h o b i c a n d h y d r o p h i l i c r e s i d u e s , a n d m y o w n m o d e l i n g s u g g e s t s that the m o s t c o n s e r v e d s t r e t c h e s o f a m i n o a c i d s c a n b e p r e d i c t e d to b e t r a n s m e m b r a n e P -strands, w h i c h s u g g e s t s a s t r o n g p o t e n t i a l f o r t h e c o n s e r v e d s e q u e n c e m o t i f s to s e r v e as a c o n s e r v e d s t r u c t u r a l m o t i f f o r a f a m i l y o f P -barre l p r o t e i n s . H o p E ( O R F 0 7 0 6 ) w a s s e l e c t e d as a m o d e l p r o t e i n f o r the t e s t i n g o f m y h y p o t h e s i s f o r t w o r e a s o n s . F i r s t , H o p E h a d b e e n p r e v i o u s l y c h a r a c t e r i z e d a n d f o u n d to h a v e a l a r g e p o r e d i a m e t e r w h i c h i s c o n s i s t e n t w i t h H o p E f u n c t i o n i n g as a g e n e r a l d i f f u s i o n p o r e ( D o i g et al, 1 9 9 5 ) . S e c o n d , H o p E w a s t h e s m a l l e s t m e m b e r o f the H o p f a m i l y to c o n t a i n t h e m a j o r i t y o f the c o n s e r v e d s e q u e n c e m o t i f s . 93 R e c o m b i n a n t l y p r o d u c e d b a c t e r i a l o u t e r m e m b r a n e p r o t e i n s o f t e n e n d u p b e i n g i n c o r p o r a t e d i n t o c y t o p l a s m i c i n c l u s i o n b o d i e s . S e v e r a l o b s e r v a t i o n s s u g g e s t that r e c o m b i n a n t l y e x p r e s s e d H o p E w a s n o t i n c o r p o r a t e d i n t o i n c l u s i o n b o d i e s b u t w a s p r o p e r l y s o r t e d to t h e o u t e r m e m b r a n e o f E. coli. R e c o m b i n a n t H o p E w a s n o t h i g h l y p r o d u c e d a n d c o f r a c t i o n a t e d w i t h t h e o u t e r m e m b r a n e . T h e m o d e s t l e v e l o f H o p E e x p r e s s i o n i s n o t c o n s i s t e n t w i t h w h a t i s u s u a l l y o b s e r v e d w i t h p r o t e i n s that a re f o u n d i n i n c l u s i o n b o d i e s . F u r t h e r m o r e , i f H o p E w e r e i n i n c l u s i o n b o d i e s , the l e v e l o f H o p E o b s e r v e d i n the t o t a l m e m b r a n e ( p a r t i c u l a t e ) f r a c t i o n a n d w h o l e c e l l l y s a t e s s h o u l d b e s i g n i f i c a n t l y h i g h e r t h a n that o b s e r v e d i n the o u t e r m e m b r a n e p r e p a r a t i o n s . I n f a c t I s a w a r e d u c t i o n ( p e r u n i t w e i g h t ) i n t h e a m o u n t o f H o p E i n w h o l e c e l l l y s a t e s a n d t o t a l m e m b r a n e p r e p a r a t i o n s w h i c h i s c o n s i s t e n t w i t h the p r e s e n c e o f H o p E i n t h e o u t e r m e m b r a n e . R e c o m b i n a n t H o p E i n E. coli c e l l s w a s i d e n t i c a l o n S D S P A G E to a u t h e n t i c H o p E p r e s e n t i n t h e o u t e r m e m b r a n e o f H. pylori. T h i s o b s e r v a t i o n s u g g e s t e d that H o p E w a s p r o p e r l y e x p o r t e d b y t h e E. coli g e n e r a l s e c r e t o r y s y s t e m a n d h a d i ts s i g n a l p e p t i d e r e m o v e d . It h a s b e e n p r e v i o u s l y s h o w n that r e c o m b i n a n t l y e x p r e s s e d o u t e r m e m b r a n e p r o t e i n s that a re i n c o r p o r a t e d i n t o i n c l u s i o n b o d i e s s t i l l r e t a i n t h e i r N - t e r m i n a l s i g n a l s e q u e n c e a n d are v i s u a l i z e d o n S D S P A G E at h i g h e r a p p a r e n t m o l e c u l a r w e i g h t s t h a n the n a t i v e p r o t e i n s ( W o n g et al, 1 9 9 3 ) . T h e heat m o d i f i c a t i o n o f H o p E o n S D S P A G E s u g g e s t s that r e c o m b i n a n t H o p E f o l d e d i n t o a P -barre l s t r u c t u r e that i s c h a r a c t e r i s t i c o f b a c t e r i a l p o r i n p r o t e i n s , s i n c e h e a t m o d i f i c a t i o n i s o n e d e f i n i n g e x p e r i m e n t a l c h a r a c t e r i s t i c o f p - b a r r e l p r o t e i n s ( V a n G e l d e r et a l . , 1 9 9 7 ) . F u r t h e r m o r e , i t w a s p r e v i o u s l y s h o w n that that r e c o m b i n a n t l y e x p r e s s e d o u t e r m e m b r a n e p r o t e i n s i n i n c l u s i o n b o d i e s l o s t the a b i l i t y to b e m o d i f i e d b y heat . T h u s I c o n c l u d e that 94 r e c o m b i n a n t H o p E w a s c o r r e c t l y p r o c e s s e d a n d e x p o r t e d to the E. coli o u t e r m e m b r a n e ( W o n g et al, 1 9 9 3 ) . T h e hopE g e n e w a s m u t a g e n i z e d b y i n s e r t i o n o f a 5 a m i n o a c i d p e p t i d e ( R S K D V ) that c o n t a i n e d 3 c h a r g e d a m i n o a c i d s . M u t a n t s w i t h i n s e r t i o n o f the p e p t i d e i n t o 3 o f the c o n s e r v e d s e q u e n c e m o t i f s w h i c h w e r e p r e d i c t e d to f o r m m e m b r a n e - s p a n n i n g P - s t rands o f H o p E , w e r e n o t i n c o r p o r a t e d i n t o t h e o u t e r m e m b r a n e , w h e r e a s m u t a n t s w i t h i n s e r t i o n s i n t o t h e th ree o f the p u t a t i v e ( n o n c o n s e r v e d ) l o o p r e g i o n s w e r e f o u n d i n the o u t e r m e m b r a n e . T h e s e r e s u l t s s u p p o r t m y s t r u c t u r a l m o d e l a n d w e r e c o n s i s t e n t w i t h m y h y p o t h e s i s that the c o n s e r v e d m o t i f s a re p a r t o f a c o n s e r v e d s t r u c t u r a l m o t i f . T h e r e s u l t s o f t h i s s t u d y r e p r e s e n t a s i g n i f i c a n t f i n d i n g . T h e o u t e r m e m b r a n e o f H. pylori c o n t a i n s a l a r g e n u m b e r o f m o d e r a t e l y e x p r e s s e d p r o t e i n s , i n c o n t r a s t to that o f m a n y o t h e r G r a m n e g a t i v e b a c t e r i a w h i c h g e n e r a l l y c o n t a i n a s m a l l e r n u m b e r o f d o m i n a n t p r o t e i n s . F a m i l i e s o f h i g h l y s i m i l a r o u t e r m e m b r a n e p r o t e i n s h a v e b e e n i d e n t i f i e d i n o t h e r b a c t e r i a i n c l u d i n g E. coli (ompC, ompF a n d phoE), S. typhimurium (ompC, ompF a n d phoE), Neisseria gonnorheae ( P I B 1 , P I B 2 a n d P I A 1 ) ( r e v i e w e d i n J e a n t e u r et al, 1 9 9 1 ) a n d P. aeruginosa ( 1 2 h o m o l o g s ofoprD; see w w w . i n t e r c h a n g e . u b c . c a / b o b h / g e n o m i c s . h t m ) . H o w e v e r , i n these i n s t a n c e s t h e i n d i v i d u a l p r o t e i n s are h i g h l y h o m o g e n o u s i n s i z e a n d c o n t a i n p r o n o u n c e d a m i n o a c i d i d e n t i t i e s t h r o u g h o u t t h e i r s e q u e n c e s . I n c o n t r a s t , t h e H. pylori H o p f a m i l y c o n t a i n s m a n y m o r e m e m b e r s a n d t h e i n d i v i d u a l g e n e s v a r y g r e a t l y i n s i z e , a n d i n m o s t c a s e s s h a r e l i t t l e i d e n t i t y o u t s i d e t h e c o n s e r v e d m o t i f s . F u t u r e w o r k , i n c l u d i n g f u n c t i o n a l a n a l y s e s a n d e x p r e s s i o n s t u d i e s w i l l h e l p t o e l u c i d a t e the p o t e n t i a l r o l e f o r t h e H o p f a m i l y i n the e c o l o g y a n d p a t h o g e n e s i s ofH. pylori. I n c o n c l u s i o n , a p p l i c a t i o n o f the G i b b s s a m p l i n g m e t h o d to t h e H o p f a m i l y h a s f a c i l i t a t e d the i d e n t i f i c a t i o n o f at l e a s t 8 c o n s e r v e d s e q u e n c e m o t i f s a m o n g the H o p f a m i l y . I h a v e 95 c o n s t r u c t e d a s t r u c t u r a l m o d e l f o r the H o p E p r o t e i n w h i c h w a s s u p p o r t e d b y t h e r e s u l t s f r o m i n s e r t i o n a l m u t a g e n e s i s o f H o p E . C o l l e c t i v e l y these r e s u l t s s u p p o r t e d m y h y p o t h e s i s that t h e c o n s e r v e d s e q u e n c e m o t i f s a m o n g t h e H o p f a m i l y p r o t e i n s r e p r e s e n t a c o n s e r v e d s t r u c t u r a l m o t i f f o r a f a m i l y o f P -bar re l p r o t e i n s . Appendix I . Mutagenesis and expression analysis of the RND efflux s y s t e m s in Helicobacter pylori. M y w o r k o n c h a r a c t e r i z i n g the R N D e f f l u x s y s t e m i n H. pylori w a s p a r t o f a c o l l a b o r a t i v e e f f o r t b e t w e e n m e a n d D r . R i c h a r d A i m at A s t r a R e s e a r c h B o s t o n I n c . A s p a r t o f that c o l l a b o r a t i o n , the m u t a g e n e s i s a n d a n a l y s i s o f in vitro a n d in vivo e x p r e s s i o n o f the R N D e f f l u x s y s t e m s w a s p e r f o r m e d b y D r . A i m . B e l o w I b r i e f l y p r e s e n t D r . A i m ' s d a t a that a re r e l e v a n t to t h e w o r k p r e s e n t e d h e r e . A. Mutagenesis of the efflux operons M u t a g e n e s i s o f hefC, hefF a n d hefl w e r e p e r f o r m e d as f o l l o w s . T h e g e n e s w e r e a m p l i f i e d f r o m H. pylori J 9 9 a n d c l o n e d i n t o p G E M - T ( B R L ) . T h e g e n e s w e r e i n a c t i v a t e d by the i n s e r t i o n o f t h e K m R c a s s e t t e f r o m p I L L 6 0 0 . T h i s p l a s m i d c o n s t r u c t w a s t h e n i n t r o d u c e d i n t o H. pylori J 9 9 b y n a t u r a l t r a n s f o r m a t i o n , a n d t r a n s f o r m a n t s w e r e s e l e c t e d b y p l a t i n g o n c h o c o l a t e b l o o d a g a r p l a t e s p l u s 10 u g / m l k a n a m y c i n . C h r o m o s o m a l D N A w a s p r e p a r e d from s e v e r a l t r a n s f o r m a n t s , a n d a n a l y z e d b y P C R to e n s u r e that the d o u b l e c r o s s o v e r h a d o c c u r r e d i n t h e c o r r e c t p o s i t i o n . T h e r e s u l t i n g m u t a n t s w e r e s c r e e n e d f o r a l t e r a t i o n s i n g r o w t h a n d s u s c e p t i b i l i t y t o m a n y a n t i b i o t i c s a n d w e r e f o u n d n o t to b e a f f e c t e d i n g r o w t h o r s u s c e p t i b i l i t y t o a n y t e s t e d a n t i b i o t i c s . B. Gene expression analysis of the hef operons by reverse transcriptase PCR 96 R N A w a s i s o l a t e d f r o m H. pylori S S I that h a d b e e n g r o w n in vitro ( o n c h o c o l a t e b l o o d a g a r p l a t e s ) o r d i r e c t l y f r o m the s t o m a c h s o f C 5 7 B L / 6 m i c e that w e r e c o l o n i z e d w i t h H. pylori S S I (in vivo). T h e R N A w a s p r e p a r e d u s i n g t h e S . N . A . P . T o t a l R N A I s o l a t i o n K i t f r o m I n v i t r o g e n ( C a r l s b a d , C A ) . T h e R N A w a s a n a l y z e d b y R T - P C R u s i n g the S u p e r s c r i p t R T - P C R k i t f r o m G i b c o B R L ( G a i t h e r s b u r g , M D ) . T h e g e n e s p e c i f i c p r i m e r s f o r the e f f l u x p u m p s u s e d w e r e d e s i g n e d from t h e s e q u e n c e a l i g n m e n t s o f the g e n e s f r o m H. pylori s t r a i n s 2 6 6 9 5 a n d J 9 9 a n d are as f o l l o w s . F o r hefF, H e l l a n d H e l 2 w e r e p r e d i c t e d to a m p l i f y a 4 1 8 b p a m p l i c o n , w h e r e a s f o r hefl, H e l 3 a n d H e l 4 w e r e p r e d i c t e d to p r o d u c e a 5 1 5 b p a m p l i c o n . T h r e e i n d e p e n d e n t r e a c t i o n s w e r e u s e d f o r e a c h a n a l y s i s . T o t a l n u c l e i c a c i d ( b e f o r e D N A r e m o v a l ) w a s u s e d as a p o s i t i v e c o n t r o l t e m p l a t e , w h e r e a s R N A w a s u s e d as a t e m p l a t e i n 2 i d e n t i c a l r e a c t i o n s w h e r e t h e o n l y d i f f e r e n c e w a s the a d d i t i o n o f the r e v e r s e t r a n s c r i p t a s e e n z y m e . T h e r e a c t i o n s w e r e h e l d at 37°C f o r 3 0 m i n p r i o r to 35 c y c l e s o f P C R w i t h p a r a m e t e r s o f 15 s e c at 94°C, 15 s e c at 55°C a n d 1 m i n at 72°C. T h e r e a c t i o n s w e r e there e l e c t r o p h o r e s e d o n a 1 % T A E a g a r o s e g e l . T h e r e s u l t s o f t h e s e e x p e r i m e n t s s h o w e d that the hefABC a n d hefDEF o p e r o n s w e r e e x p r e s s e d b o t h in vivo a n d in vitro w h i l e the hefGHI o p e r o n w a s o n l y e x p r e s s e d in vivo. 97 B I B L I O G R A P H Y A K O P Y A N Z , N . , B U K A N O V , N . O . , W E S T B L O M , T . U . A N D B E R G D . E . : P C R - b a s e d R F L P a n a l y s i s o f D N A s e q u e n c e d i v e r s i t y i n t h e g a s t r i c p a t h o g e n Helicobacter pylori. N u c l e i c A c i d s R e s e a r c h 2 0 : 6 2 2 1 - 6 2 2 5 , 1 9 9 2 . A L T S C H U L , S . F . , G I S H , W . , M I L L E R , W . , M Y E R S , E . W . A N D L I P M A N , D . J . : B a s i c l o c a l a l i g n m e n t s e a r c h t o o l . J o u r n a l o f M o l e c u l a r B i o l o g y . 2 1 5 : 4 0 3 - 4 1 0 , 1 9 9 0 . A P P E L M E L K , B . J . , N E G R I N I , R . , M O R A N , A . P . A N D K U I P E R S , E . J . : M o l e c u l a r m i m i c r y b e t w e e n Helicobacter pylori a n d the h o s t . T r e n d s i n M i c r o b i o l o g y 5: 7 0 - 7 3 , 1 9 9 7 . A P P E L M E L K , B . J , I. S I M O O N S - S M I T , R . N E G R I N I , A . P . M O R A N , G . O . A S P I N A L L , J . G . F O R T E , T . D E V R I E S , H . Q U A N , T . V E R B O O M , J . J . M A A S K A N T , P . G H I A R A , E . K U I P E R S , E . B L O E M E N A , T . M . T A D E M A , R . R . T O W N S E N D , K . T Y A G A R A J A N , M . C R O T H E R S , M . A . M O N T E I R O , A . S A V I O & J . D E G R A A F F . : P o t e n t i a l r o l e o f m o l e c u l a r m i m i c r y b e t w e e n Helicobacter pylori l i p o p o l y s a c c h a r i d e a n d h o s t L e w i s b l o o d g r o u p a n t i g e n s i n a u t o i m m u n i t y . I n f e c t i o n & I m m u n i t y 6 4 : 2 0 3 1 - 2 0 4 0 , 1 9 9 6 . A S P I N A L L , G . O . , M O N T E I R O , M . A . , P A N G , H . , W A L S H , E . J . A N D M O R A N , A . P . : L i p o p o l y s a c c h a r i d e o f t h e Helicobacter pylori t y p e s t r a i n N C T C 1 1 6 3 7 ( A T C C 4 3 5 0 4 ) : S t r u c t u r e o f t h e O a n t i g e n c h a i n a n d c o r e o l i g o s a c c h a r i d e r e g i o n s . B i o c h e m i s t r y 35: 2 4 8 9 - 2 4 9 7 , 1 9 9 6 . B E R G , D . E . , H O F F M A N , P . S . , A P P E L M E L K , B . J . A N D K U S T E R S , J . G . : T h e Helicobacter pylori g e n o m e s e q u e n c e : g e n e t i c f a c t o r s f o r l o n g l i f e i n the g a s t r i c m u c o s a . T r e n d s i n M i c r o b i o l o g y 5: 4 6 8 - 4 7 4 , 1 9 9 7 . B I N A , J . E . , N A N O , F . A N D H A N C O C K , R . E . : U t i l i z a t i o n o f a l k a l i n e p h o s p h a t a s e f u s i o n s to i d e n t i f y s e c r e t e d p r o t e i n s , i n c l u d i n g p o t e n t i a l e f f l u x p r o t e i n s a n d v i r u l e n c e f a c t o r s from Helicobacter pylori. F E M S M i c r o b i o l o g y L e t t e r s . 1 4 8 : 6 3 - 6 8 , 1 9 9 7 . B o r e n , T . , N o r m a r k , S . a n d F a l k , P . : Helicobacter pylori: m o l e c u l a r b a s i s f o r h o s t r e c o g n i t i o n a n d b a c t e r i a l a d h e r e n c e . T r e n d s i n M i c r o b i o l o g y . 2 : 2 2 1 - 2 2 8 , 1 9 9 4 . B O S C H D . T O M M A S S E N J . E f f e c t s o f l i n k e r i n s e r t i o n s o n the b i o g e n e s i s a n d f u n c t i o n i n g o f t h e Escherichia coli o u t e r m e m b r a n e p o r e p r o t e i n P h o E . M o l e c u l a r & G e n e r a l G e n e t i c s . 208:485-9, 1 9 8 7 . B O U G E S - B O C Q U E T B . V I L L A R R O Y A H . H O F N U N G M . L i n k e r m u t a g e n e s i s i n t h e g e n e o f a n o u t e r m e m b r a n e p r o t e i n o f Escherichia coli, lamB. J o u r n a l o f C e l l u l a r B i o c h e m i s t r y . 24:217-28, 1 9 8 4 . B O U L A T N J C . C H A R B I T A . H O F N U N G M . M u t a g e n e s i s b y r a n d o m l i n k e r i n s e r t i o n i n t o t h e lamB g e n e oi Escherichia coli K 1 2 . M o l e c u l a r & G e n e r a l G e n e t i c s . 205:339-48, 1 9 8 6 . 98 C E L L I N I , L . , A L L O C A T I , N . , A N G E L U C C I , D . , L E Z Z I , T . , D I , C . E . , M A R Z I O , L . A N D D A I N E L L I , B . : C o c c o i d Helicobacter pylori n o t c u l t u r a b l e in vitro r e v e r t s i n m i c e . M i c r o b i o l o g y & I m m u n o l o g y 3 8 : 8 4 3 - 8 5 0 , 1 9 9 4 . C O V A C C I , A . A N D R A P P O U L I , R . : Helicobacter pylori: m o l e c u l a r e v o l u t i o n o f a b a c t e r i a l q u a s i - s p e c i e s . C u r r e n t O p i n i o n i n M i c r o b i o l o g y 1 : 9 6 - 1 0 2 , 1 9 9 8 . C O L W E L , R . R . & H U Q , A . : V i b r i o s i n the E n v i r o n m e n t : V i a b l e b u t N o n c u l t u r a b l e Vibrio cholerae. I n : Vibrio colerae a n d C h o l e r a : M o l e c u l a r to G l o b a l P e r s p e c t i v e s , e d . b y K. W a c h s m u t h , P . B l a k e a n d O r j a n O l s v i k . p p . 1 1 7 - 1 3 1 , A S M P r e s s , W a s h i n g t o n , 1 9 9 4 . C O W A N , S . W . , S C H I R M E R , T . , R U M M E L , G . , S T E I E R T , M . , G H O S H , R . , P A U P T I T , R . A . , J A N S O N I U S , J . N . A N D R O S E N B U S C H , J . P . : C r y s t a l s t r u c t u r e s e x p l a i n f u n c t i o n a l p r o p e r t i e s o f t w o Escherichia coli p o r i n s . N a t u r e ( L o n d o n ) 3 5 8 : 7 2 7 - 7 3 3 , 1 9 9 2 . D A R V E A U , R . P . : L i p i d A d i v e r s i t y a n d the i n n a t e h o s t r e s p o n s e to b a c t e r i a l i n f e c t i o n . C u r r e n t O p i n i o n i n M i c r o b i o l o g y 1 : 3 6 - 4 2 , 1 9 9 8 . D E R M A N , A . I . A N D B E C K W I T H , J . : Escherichia coli a l k a l i n e p h o s p h a t a s e l o c a l i z e d to t h e c y t o p l a s m s l o w l y a c q u i r e s e n z y m a t i c a c t i v i t y i n c e l l s w h o s e g r o w t h h a s b e e n s u s p e n d e d : a c a u t i o n f o r g e n e f u s i o n s t u d i e s . J o u r n a l o f B a c t e r i o l o g y . 1 7 7 : 3 6 7 4 - 3 7 7 0 , 1 9 9 5 . D O I G , P . , E X N E R , M . M . , H A N C O C K , R . E . A N D T R U S T , T . J . : I s o l a t i o n a n d c h a r a c t e r i z a t i o n o f a c o n s e r v e d p o r i n p r o t e i n f r o m Helicobacter pylori. J o u r n a l o f B a c t e r i o l o g y . 177: 5447.5452, 1 9 9 5 . E A T O N , K . A . , S U E R B A U M , S . , J O S E N H A N S , C , K R A K O W K A , S . : C o l o n i z a t i o n o f g n o t o b i o t i c p i g l e t s b y Helicobacter pylori d e f i c i e n t i n t w o f l a g e l l i n g e n e s . I n f e c t i o n & I m m u n i t y . 64: 2 4 4 5 - 2 4 4 8 , 1 9 9 6 . E A T O N , K . A . , C A T R E N I C H , C . E . , M A K I N , K . M . A N D K R A K O W K A , S . : V i r u l e n c e o f c o c c o i d a n d b a c i l l a r y f o r m s o f Helicobacter pylori i n g n o t o b i o t i c p i g l e t s . J o u r n a l o f I n f e c t i o u s D i s e a s e s 171: 4 5 9 - 4 6 2 , 1 9 9 5 . E X N E R , M . M . , D O I G , P . , T R U S T , T . J . , A N D H A N C O C K , R . E . : I s o l a t i o n a n d c h a r a c t e r i z a t i o n o f a f a m i l y o f p o r i n p r o t e i n s f r o m Helicobacter pylori. I n f e c t i o n & I m m u n i t y 63 ,1567-1 5 7 2 . G E I S , G . , L E Y I N G , H . , S U E R B A U M , S . A N D O P F E R K U C H , W . : U n u s u a l f a t t y a c i d s u b s t i t u t i o n i n l i p i d s a n d l i p o p o l y s a c c h a r i d e s oi Helicobacter pylori. J o u r n a l o f C l i n i c a l M i c r o b i o l o g y 28: 9 3 0 - 9 3 2 , 1 9 9 0 . G O , M . F . , K A P U R , V . , G R A H A M , D . Y . , M U S S E R , J . M . : P o p u l a t i o n g e n e t i c a n a l y s i s o f Helicobacter pylori b y m u l t i l o c u s e n z y m e e l e c t r o p h o r e s i s : e x t e n s i v e a l l e l i c d i v e r s i t y a n d r e c o m b i n a t i o n a l p o p u l a t i o n s t r u c t u r e . J o u r n a l o f B a c t e r i o l o g y 1 7 8 : 3 9 3 4 - 3 9 3 8 , 1 9 9 6 . G R O M I H A , M . M . , M A J U M D A R , R . A N D P O N N U S W A M Y , P . K . : I d e n t i f i c a t i o n o f m e m b r a n e s p a n n i n g b e t a s t r a n d s i n b a c t e r i a l p o r i n s . P r o t e i n E n g i n e e r i n g 1 0 : 4 9 7 - 5 0 0 , 1 9 9 7 . 99 G R O M I H A , M . M . A N D P O N N U S W A M Y , P . K . : P r e d i c t i o n o f t r a n s m e m b r a n e b e t a - s t r a n d s f r o m h y d r o p h o b i c c h a r a c t e r i s t i c s o f p r o t e i n s . I n t e r n a t i o n a l J o u r n a l o f P e p t i d e & P r o t e i n R e s e a r c h 42: 4 2 0 - 4 3 1 , 1 9 9 3 . G U O , L . , L I M , K . B . , G U N N , J . S . , B A J N B R I D G E , B . , D A R V E A U , R . P . , H A C K E T T , M . A N D M I L L E R , S . L : R e g u l a t i o n o f l i p i d A m o d i f i c a t i o n s b y Salmonella typhimurium v i r u l e n c e g e n e s phoP-phoQ. S c i e n c e 276: 2 5 3 1 9 9 7 . H A G M A N , K . E . ; P A N , W . ; S P R A T T , B . G . ; B A L T H A Z A R , J . T . ; J U D D , R . C ; S H A F E R , W . M . : R e s i s t a n c e o f N e i s s e r i a g o n o r r h o e a e to a n t i m i c r o b i a l h y d r o p h o b i c a g e n t s i s m o d u l a t e d b y the mtrRCDE e f f l u x s y s t e m . M i c r o b i o l o g y 1 4 1 : 6 1 1 - 6 2 2 , 1 9 9 5 . H A N C O C K , R . E . : R o l e o f p o r i n s i n o u t e r m e m b r a n e p e r m e a b i l i t y . J o u r n a l o f B a c t e r i o l o g y 169: 9 2 9 - 9 3 3 , 1 9 8 7 . H A N C O C K , R . E . A N D B E L L , A . : A n t i b i o t i c u p t a k e i n t o g r a m - n e g a t i v e b a c t e r i a . E u r o p e a n J o u r n a l o f C l i n i c a l M i c r o b i o l o g y a n d I n f e c t i o u s D i s e a s e 7 : 7 1 3 - 7 2 0 , 1 9 8 8 H A N C O C K , R . E . : O u t e r m e m b r a n e p r o t e i n s o f P s e u d o m o n a s . M o l e c u l a r M i c r o b i o l o g y 4 : 1069 -1 0 7 9 , 1 9 9 0 . H A N C O C K , R . E . : T h e b a c t e r i a l o u t e r m e m b r a n e as a d r u g b a r r i e r . T r e n d s i n M i c r o b i o l o g y 5: 3 7 - 4 2 , 1 9 9 7 . H A N C O C K , R . E . , A L M , R . , B L N A , J . A N D T R U S T , T . : Helicobacter pylori: a s u r p r i s i n g l y c o n s e r v e d b a c t e r i u m . N a t u r e B i o t e c h n o l o g y 1 6 : 2 1 6 - 2 1 7 , 1 9 9 8 H A Z E L L , S . L . A N D M E N D E Z , G . : T h e M e t a b o l i s m a n d E n z y m e s oi Helicobacter pylori: F u n c t i o n a n d P o t e n t i a l V i r u l e n c e E f f e c t s . I n Helicobacter pylori b i o l o g y a n d c l i n i c a l p r a c t i c e , e d . b y C S . G o o d w i n a n d B . W . W o r s l e y , p p . 1 1 5 - 1 4 2 , C R C P r e s s , L o n d o n , 1 9 9 3 . H U A N G , X . : A c o n t i g a s s e m b l y p r o g r a m b a s e d o n s e n s i t i v e d e t e c t i o n o f f r a g m e n t o v e r l a p s . G e n o m i c s 14: 1 8 - 2 5 , 1 9 9 2 . I L V E R , D . , A R N Q V I S T , A . , O G R E N , J . , F R I C K , I . M . , K E R S U L Y T E , D., I N C E C I K , E . T . , B E R G , D . E . , C O V A C C I , A . , E N G S T R A N D , L. A N D B O R E N , T . : Helicobacter pylori a d h e s i n b i n d i n g f u c o s y l a t e d h i s t o - b l o o d g r o u p a n t i g e n s r e v e a l e d b y r e t a g g i n g . S c i e n c e 279: 3 7 3 - 3 7 7 , 1 9 9 8 . J E A N T E U R , D . , L A K E Y , J . H . A N D P A T T U S , F . : T h e b a c t e r i a l p o r i n s u p e r f a m i l y : s e q u e n c e a l i g n m e n t a n d s t r u c t u r e p r e d i c t i o n . M o l e c u l a r M i c r o b i o l o g y 5: 2 1 5 3 - 2 1 6 4 , 1 9 9 1 . J I A N G , Q . , H I R A T S U K A , K . A N D T A Y L O R , D . E . : V a r i a b i l i t y o f g e n e o r d e r i n d i f f e r e n t Helicobacter pylori s t r a i n s c o n t r i b u t e s to g e n o m e d i v e r s i t y . M o l e c u l a r M i c r o b i o l o g y 20: 8 3 3 - 8 4 2 , 1 9 9 6 . 100 K O H L E R T . M I C H E A - H A M Z E H P O U R M . H E N Z E U . G O T O H N . C U R T Y L K . P E C H E R E J C : C h a r a c t e r i z a t i o n o f M e x E - M e x F - O p r N , a p o s i t i v e l y r e g u l a t e d m u l t i d r u g e f f l u x s y s t e m of Pseudomonas aeruginosa. M o l e c u l a r M i c r o b i o l o g y 2 3 : 3 4 5 - 5 4 , 1 9 9 7 K O V A C H , M . E . , P H I L L I P S , R . W . , E L Z E R , P . H . , R O O P , R . M . , P E T E R S O N A N D K M : p B B R l M C S : a b r o a d - h o s t - r a n g e c l o n i n g v e c t o r . B i o t e c h n i q u e s 1 6 : 8 0 0 - 8 0 2 , 1 9 9 4 . K U S T E R S , J . G . , G E R R T T S , M . M . , V A N S T R I J P , J . A . G . A N D V A N D E N B R O U C K E , G . C . M . J . : C o c c o i d f o r m s of Helicobacter pylori are the m o r p h o l o g i c m a n i f e s t a t i o n o f c e l l d e a t h . I n f e c t i o n & I m m u n i t y 6 5 : 3 6 7 2 - 3 6 7 9 , 1 9 9 7 . L A K E Y , J . H . , W A T T S , J . P . A N D L E A E . J . : C h a r a c t e r i s a t i o n o f c h a n n e l s i n d u c e d i n p l a n a r b i l a y e r m e m b r a n e s b y d e t e r g e n t s o l u b i l i s e d Escherichia coli p o r i n s . B i o c h i m B i o p h y s A c t a 8 1 7 : 2 0 8 - 2 1 6 , 1 9 8 5 . L E V Y , S . B . : A c t i v e e f f l u x m e c h a n i s m s f o r a n t i m i c r o b i a l r e s i s t a n c e . A n t i m i c r o b i a l A g e n t s & C h e m o t h e r a p y 3 6 : 6 9 5 - 7 0 3 , 1 9 9 2 . L E E , A . A N D O ' R O U R K E , J . : U l t r a s t r u c t u r e o f Helicobacter O r g a n i s m s a n d P o s s i b l e R e l e v a n c e f o r P a t h o g e n e s i s . I n Helicobacter pylori: B i o l o g y a n d C l i n i c a l P r a c t i c e , e d . b y C S . G o o d w i n a n d B . W . W o r s l e y , p p . 1 6 - 3 2 , C R C P r e s s , A n n A r b o r , 1 9 9 3 . L I , X . Z . , N I K A I D O , H A N D P O O L E . K . : R o l e o f M e x A - M e x B - O p r M i n a n t i b i o t i c e f f l u x i n Pseudomonas aeruginosa. A n t i m i c r o b i a l A g e n t s & C h e m o t h e r a p y 3 9 : 1 9 4 8 - 1 9 5 3 , 1 9 9 5 . L O H , B . , G R A N T , C . A N D H A N C O C K , R . E . : U s e o f the f l u o r e s c e n t p r o b e 1 - N -p h e n y l n a p h t h y l a m i n e to s t u d y the i n t e r a c t i o n s o f a m i n o g l y c o s i d e a n t i b i o t i c s w i t h t h e o u t e r m e m b r a n e o f Pseudomonas aeruginosa. A n t i m i c r o b i a l A g e n t s & C h e m o t h e r a p y 26: 5 4 6 - 5 5 1 , 1 9 8 4 . M A , D . , C O O K , D . N . , A L B E R T I , M . , P O N , N . G . , N I K A I D O , H. A N D H E A R S T , J . E . : M o l e c u l a r c l o n i n g a n d c h a r a c t e r i z a t i o n o f acrA a n d acrE g e n e s o f Escherichia coli. J o u r n a l o f B a c t e r i o l o g y 1 7 5 : 6 2 9 9 - 6 3 1 3 , 1 9 9 3 . M A , D . , C O O K , D . N . , H E A R S T , J . E . A N D N I K A I D O , H . : E f f l u x p u m p s a n d d r u g r e s i s t a n c e i n g r a m - n e g a t i v e b a c t e r i a . T r e n d s i n M i c r o b i o l o g y 2: 4 8 9 - 4 9 3 , 1 9 9 4 . M A N O I L , C , M E K A L A N O S , J . J . A N D B E C K W I T H , J . : A l k a l i n e p h o s p h a t a s e f u s i o n s : s e n s o r s o f s u b c e l l u l a r l o c a t i o n . J o u r n a l o f B a c t e r i o l o g y . 172: 5 1 5 - 5 1 8 , 1 9 9 0 . M A R S H A L L , B . J . A N D W A R R E N , J . R . : U n i d e n t i f i e d c u r v e d b a c i l l i i n the s t o m a c h o f p a t i e n t s w i t h g a s t r i t i s a n d p e p t i c u l c e r a t i o n . L a n c e t i: 1 3 1 1 , 1 9 8 4 . M D L U L I , K . E . , T R E I T , J . D . , K E R R , V . J . A N D N A N O , F . E . : N e w v e c t o r s f o r t h e in vitro g e n e r a t i o n o f a l k a l i n e p h o s p h a t a s e f u s i o n s to p r o t e i n s e n c o d e d b y G + C - r i c h D N A . G e n e 1 5 5 : 1 3 3 - 1 3 4 , 1 9 9 5 . 101 M O O R E , R . A . , B A T E S , N . C . A N D H A N C O C K , R . E . : I n t e r a c t i o n o f p o l y c a t i o n i c a n t i b i o t i c s w i t h Pseudomonas aeruginosa l i p o p o l y s a c c h a r i d e a n d l i p i d A s t u d i e d b y u s i n g d a n s y l -p o l y m y x i n . A n t i m i c r o b i a l A g e n t s & C h e m o t h e r a p y . 2 9 : 4 9 6 - 5 0 0 , 1 9 8 6 . M O O R E , R . A . , B E C K T H O L D , B . A N D B R Y A N , L . E . : M e t r o n i d a z o l e u p t a k e i n Helicobacter pylori. C a n a d i a n J o u r n a l o f M i c r o b i o l o g y . 4 1 : 7 4 6 - 7 4 9 , 1 9 9 5 . M O O R E , R . A , A N D H A N C O C K , R . E . : I n v o l v e m e n t o f o u t e r m e m b r a n e of Pseudomonas cepacia i n a m i n o g l y c o s i d e a n d p o l y m y x i n r e s i s t a n c e . A n t i m i c r o b i a l A g e n t s & C h e m o t h e r a p y 3 0 : 9 2 3 - 9 2 6 , 1 9 8 6 M O O R E , R . A . , B E C K T H O L D , B . , W O N G , S . , K U R E I S H I , A . A N D B R Y A N , L . E . : N u c l e o t i d e s e q u e n c e o f the gyrA g e n e a n d c h a r a c t e r i z a t i o n o f c i p r o f l o x a c i n - r e s i s t a n t m u t a n t s o f Helicobacter pylori. A n t i m i c r o b i a l A g e n t s & C h e m o t h e r a p y . 3 9 : 1 0 7 - 1 1 1 , 1 9 9 5 . M O R A N , A . P . , L I N D N E R , B . A N D W A L S H , E . J . : S t r u c t u r a l c h a r a c t e r i z a t i o n o f the l i p i d a c o m p o n e n t o f Helicobacter pylori r o u g h - a n d s m o o t h - f o r m l i p o p o l y s a c c h a r i d e s . J o u r n a l o f B a c t e r i o l o g y 1 7 9 : 6 4 5 3 - 6 4 6 3 , 1 9 9 7 . M U O T I A L A , A . , H E L A N D E R , I . M . , P Y H A L A , L . , K O S U N E N , T . U . A N D M O R A N , A . P . : L o w b i o l o g i c a l a c t i v i t y o f Helicobacter-pylori l i p o p o l y s a c c h a r i d e . I n f e c t i o n & I m m u n i t y 6 0 : 1 7 1 4 - 1 7 1 6 , 1 9 9 2 . M U T H A R I A , L . M . A N D H A N C O C K , R . E . : S u r f a c e l o c a l i z a t i o n o f Pseudomonas aeruginosa o u t e r m e m b r a n e p o r i n p r o t e i n F b y u s i n g m o n o c l o n a l a n t i b o d i e s . I n f e c t i o n & I m m u n i t y 42: 1 0 2 7 - 1 0 3 3 , 1 9 8 3 . N E D E N S K O V - S O R E N S E N , P . B U K H O L M G . A N D B O V R E , K . N a t u r a l c o m p e t e n c e f o r g e n e t i c t r a n s f o r m a t i o n i n Campylobacter pylori. J o u r n a l o f I n f e c t i o u s D i s e a s e 1 6 1 : 3 6 5 -3 6 6 , 1 9 9 0 . N E U W A L D , A . F . , L I U , J . S . A N D L A W E R N C E , C . E . : G i b b s m o t i f s a m p l i n g : d e t e c t i o n o f b a c t e r i a l o u t e r m e m b r a n e repea ts . P r o t e i n S c i e n c e 4 : 1 6 1 8 - 1 6 3 2 , 1 9 9 5 . N G U Y E N , A . M . , E N G S T R A N D , L . , G E N T A , R . M . , G R A H A M , D . Y . A N D E L - Z A A T A R I , F . A . : D e t e c t i o n o f Helicobacter pylori i n d e n t a l p l a q u e b y r e v e r s e t r a n s c r i p t i o n -p o l y m e r a s e c h a i n r e a c t i o n . J o u r n a l o f C l i n i c a l M i c r o b i o l o g y . 3 1 : 7 8 3 - 7 8 7 , 1 9 9 3 . N I K A I D O , H . : B a c t e r i a l r e s i s t a n c e to a n t i b i o t i c s as a f u n c t i o n o f o u t e r m e m b r a n e p e r m e a b i l i t y . J o u r n a l o f A n t i m i c r o b i a l C h e m o t h e r a p y 2 2 : 1 7 - 2 2 , 1 9 8 8 . N I K A I D O , H : T r a n s p o r t a c r o s s t h e b a c t e r i a l o u t e r m e m b r a n e . J o u r n a l o f B i o e n e r g e t i c s a n d B i o m e m b r a n e s . 2 5 : 5 8 1 - 5 8 9 , 1 9 9 3 . N I K A I D O , H . : M u l t i d r u g e f f l u x p u m p s o f g r a m - n e g a t i v e b a c t e r i a . J o u r n a l o f B a c t e r i o l o g y . 1 7 8 : 5 8 5 3 - 5 8 5 9 , 1 9 9 6 . 102 N I K A I D O H . A N D R O S E N B E R G , E . Y . : P o r i n c h a n n e l s i n Escherichia coli: s t u d i e s w i t h l i p o s o m e s r e c o n s t i t u t e d f r o m p u r i f i e d p r o t e i n s . J o u r n a l o f B a c t e r i o l o g y 153: 2 4 1 - 2 5 2 1 9 8 3 . N I K A I D O H . A N D T H A N A S S I , D . G . : P e n e t r a t i o n o f l i p o p h i l i c agents w i t h m u l t i p l e p r o n a t i o n s i tes i n t o b a c t e r i a l c e l l s : t e t r a c y c l i n e s a n d f l u o r o q u i n o l o n e s as e x a m p l e s . A n t i m i c r o b i a l A g e n t s & C h e m o t h e r a p y 3 7 : 1393 -1399 , 1 9 9 3 . O C A K T A N , A . , Y O N E Y A M A , H . A N D N A K A E , T.: U s e o f f l u o r e s c e n c e p r o b e s t o m o n i t o r f u n c t i o n o f t h e s u b u n i t p r o t e i n s o f the M e x A - M e x B - O p r M d r u g e x t r u s i o n m a c h i n e r y i n Pseudomonas aeruginosa. J o u r n a l o f . B i o l o g i c a l C h e m i s t r y . 272: 2 1 9 6 4 - 2 1 9 6 9 , 1 9 9 7 . O K U S U , H . , M A , D . A N D N I K A I D O , H . : A c r A B e f f l u x p u m p p l a y s a m a j o r r o l e i n t h e a n t i b i o t i c r e s i s t a n c e p h e n o t y p e o f Escherichia coli m u l t i p l e - a n t i b i o t i c - r e s i s t a n c e ( M a r ) m u t a n t s . J o u r n a l o f B a c t e r i o l o g y . 178: 3 0 6 - 3 0 8 , 1 9 9 6 . P A R S O T , C , T A X M A N , E . A N D M E K A L A N O S , J . J . : T o x R r e g u l a t e s t h e p r o d u c t i o n o f l i p o p r o t e i n s a n d t h e e x p r e s s i o n o f s e r u m r e s i s t a n c e i n Vibrio cholerae. P r o c e e d i n g s o f the N a t i o n a l A c a d e m y o f S c i e n c e . U . S . A . 88: 1 6 4 1 - 1 6 4 5 , 1 9 9 1 . P A U L , C . A N D R O S E N B U S C H , J . P . : F o l d i n g p a t t e r n s o f p o r i n a n d b a c t e r i o r h o d o p s i n . E M B O J o u r n a l 4 : 1 5 9 3 - 1 5 9 7 , 1 9 8 5 . P A U L S E N , I .T. , B R O W N , M . H . A N D S K U R R A Y , R . A . : P r o t o n - d e p e n d e n t m u l t i d r u g e f f l u x s y s t e m s . M i c r o b i o l o g i c a l R e v i e w s . 60: 5 7 5 - 6 0 8 , 1 9 9 6 . P A U L S E N , I .T., P A R K , J . H . , C H O I , P . S . , S A I E R , M . H . : A f a m i l y o f g r a m - n e g a t i v e b a c t e r i a l o u t e r m e m b r a n e f a c t o r s that f u n c t i o n i n the e x p o r t o f p r o t e i n s , c a r b o h y d r a t e s , d r u g s a n d h e a v y m e t a l s f r o m g r a m - n e g a t i v e b a c t e r i a . F E M S M i c r o b i o l o g y L e t t e r s . 156:1-8, 1 9 9 7 . P H A D I S , S . H . , W E S T B L O M , T . U . A N D N O R M A R K , N . : M o l e c u l a r c l o n i n g o f Helicobacter pylori D N A : i m p o r t a n t d i f f e r e n c e s b e t w e e n mcrBC d e l e t i o n h o s t s t r a i n s . M o l e c u l a r M i c r o b i o l o g y . 10: 1 1 5 1 - 1 1 5 1 , 1 9 9 3 . P H A D N I S , S . H . , I L V E R , D . , J A N Z O N , L . , N O R M A R K , S . A N D W E S T B L O M , T . U . : P a t h o l o g i c a l s i g n i f i c a n c e a n d m o l e c u l a r c h a r a c t e r i z a t i o n o f the v a c u o l a t i n g t o x i n g e n e o f Helicobacter pylori. I n f e c t i o n & I m m u n o l o g y . 62: 1 5 5 7 - 1 5 6 5 , 1 9 9 4 . R U B I N S T E I N , G . D U N K T N , K . , A N D H O W A R D , A . J . : T h e s u s c e p t i b i l i t y o f Helicobacter pylori t o 12 a n t i m i c r o b i a l a g e n t s , o m e p r a z o l e a n d b i s m u t h sa l ts . J o u r n a l o f A n t i m i c r o b i a l C h e m o t h e r a p y . 3 4 :409-413, 1 9 9 4 . S a i e r M H . P a u l s e n I T . S l i w i n s k i M K . P a o S S . S k u r r a y R A . N i k a i d o H . : E V O L U T I O N A R Y O R I G I N S O F M U L T I D R U G A N D D R U G - S P E C I F I C E F F L U X P U M P S I N B A C T E R I A . F A S E B J o u r n a l . 12 :265-274, 1 9 9 8 S C H U L Z G E : P o r i n s : g e n e r a l t o s p e c i f i c , n a t i v e t o e n g i n e e r e d p a s s i v e p o r e s . C u r r e n t O p i n i o n i n S t r u c t u r a l B i o l o g y . 6: 4 8 5 - 4 9 0 , 1 9 9 6 . 103 S H A F E R W M . Q U X D . W A R I N G A J . L E H R E R R I . : M o d u l a t i o n Neisseria gonorrhoeae s u s c e p t i b i l i t y t o v e r t e b r a t e a n t i b a c t e r i a l p e p t i d e s d u e to a m e m b e r o f the r e s i s t a n c e / n o d u l a t i o n / d i v i s i o n e f f l u x p u m p f a m i l y . P r o c e e d i n g s o f t h e N a t i o n a l A c a d e m y o f S c i e n c e s o f the U n i t e d S ta tes o f A m e r i c a 95 :1829-1833, 1 9 9 8 S H E R B U R N E R . & T A Y L O R D . E . : Helicobacter pylori e x p r e s s e s a c o m p l e x s u r f a c e c a r b o h y d r a t e , L e w i s X . I n f e c t i o n & I m m u n i t y 6 3 : 4 5 6 4 - 4 5 6 8 , 1 9 9 5 . S L A U C H J M . A N D S I L H A V Y T J . : G e n e t i c a n a l y s i s o f the s w i t c h that c o n t r o l s p o r i n g e n e e x p r e s s i o n i n Escherichia coli K - 1 2 . J o u r n a l o f M o l e c u l a r B i o l o g y 210:281-292, 1 9 8 9 . S O R B E R G , M . , N I L S S O N , M . , H A N B E R G E R , H . A N D N I L S S O N , L . E . : M o r p h o l o g i c c o n v e r s i o n oi Helicobacter pylori from b a c i l l a r y to c o c c o i d f o r m . E u r o p e a n J o u r n a l o f C l i n i c a l M i c r o b i o l o g y & I n f e c t i o u s D i s e a s e s 15: 2 1 6 - 2 1 9 , 1 9 9 6 . S R I K U M A R , R , K O N , T . , G O T O H , N . , A N D P O O L E , K . E x p r e s s i o n oi Pseudomonas aeruginosa m u l t i d r u g e f f l u x p u m p s M e x A - M e x B - O p r M a n d M e x C - M e x D - O p r J i n a m u l t i d r u g - s e n s i t i v e E s c h e r i c h i a s t r a i n . A n t i m i c r o b i a l A g e n t s & C h e m o t h e r a p y . 4 2 :65 -71 , 1 9 9 8 . S T A S K A W I C Z , B . , D A H L B E C K , D . , K E E N , N . A N D N A P O L I , C : M o l e c u l a r c h a r a c t e r i z a t i o n o f c l o n e d a v i r u l e n c e g e n e s f r o m r a c e 0 a n d r a c e 1 o f Pseudomonas syringae p v . g l y c i n e a . J o u r n a l . o f . B a c t e r i o l o g y . 169: 5 7 8 9 - 5 7 9 4 , 1 9 8 7 . S T U D I E R , F . W . A N D M O F F A T T , B . A . : U s e o f b a c t e r i o p h a g e T 7 R N A p o l y m e r a s e to d i r e c t s e l e c t i v e h i g h - l e v e l e x p r e s s i o n o f c l o n e d g e n e s . J o u r n a l o f M o l e c u l a r B i o l o g y 189: 1 1 3 -1 3 0 , 1 9 8 6 . S U M I T A Y : T r a n s i e n t c a r b a p e n e m r e s i s t a n c e i n d u c e d b y s a l i c y l a t e i n Pseudomonas aeruginosa a s s o c i a t e d w i t h s u p p r e s s i o n o f o u t e r m e m b r a n e p r o t e i n D 2 s y n t h e s i s . A n t i m i c r o b i a l A g e n t s & C h e m o t h e r a p y . 37: 2 7 4 3 - 2 7 4 6 , 1 9 9 3 . T H O M A S , J . E . , G I B S O N , J . R . A N D D A R B O E , M . K . : I s o l a t i o n oi Helicobacter pylori from f e c e s . L a n c e t 340: 1 1 9 4 - 1 1 9 5 , 1 9 9 2 . T H O M P S O N , J . D . , H I G G I N S , D . G . A N D G I B S O N , T . J . : C L U S T A L W : I m p r o v i n g t h e s e n s i t i v i t y o f p r o g r e s s i v e m u l t i p l e s e q u e n c e a l i g n m e n t t h r o u g h s e q u e n c e w e i g h t i n g , p o s i t i o n - s p e c i f i c g a p p e n a l t i e s a n d w e i g h t m a t r i x c h o i c e . N u c l e i c A c i d s R e s e a r c h 22: 4 6 7 3 - 4 6 8 0 , 1 9 9 4 . T O M B , J . F . , W H I T E , O . , K E R L A V A G E , A . R . , C L A Y T O N , R . A . , S U T T O N , G . G . , F L E I S C H M A N N , R . D . , K E T C H U M , K . A . , K L E N K , H . P . , G I L L , S . , D O U G H E R T Y , B . A . , N E L S O N , K . , Q U A C K E N B U S H , J . , Z H O U , L . , K I R K N E S S , E . F . , P E T E R S O N , S . , L O F T U S , B . , R I C H A R D S O N , D . , D O D S O N , R . , K H A L A K , H . G . , G L O D E K , A . , M C K E N N E Y , K . , F I T Z E G E R A L D , L . M . , L E E , N . , A D A M S , M . D . A N D V E N T E R , J . C . : T h e c o m p l e t e g e n o m e s e q u e n c e o f the g a s t r i c p a t h o g e n Helicobacter pylori. N a t u r e 388: 5 3 9 - 5 4 7 , 1 9 9 7 . 104 T S U D A , M., K A R I T A , M . , M O R S H E D , M . G . , O K I T A , K . A N D N A K A Z A W A , T . : A u r e a s e -n e g a t i v e m u t a n t o f Helicobacter pylori c o n s t r u c t e d b y a l l e l i c e x c h a n g e m u t a g e n e s i s l a c k s the a b i l i t y t o c o l o n i z e the n u d e m o u s e s t o m a c h . I n f e c t i o n & I m m u n i t y 6 2 : 3 5 8 6 - 3 5 8 9 , 1 9 9 4 . V A N D E R H U L S T R W , K E L L E R , J . J . , R A U W S , E . A . A N D T Y T G A T , G . N . : T r e a t m e n t o f Helicobacter pylori i n f e c t i o n : a r e v i e w o f the w o r l d l i t e r a t u r e . H e l i c o b a c t e r 1 : 6 - 1 9 , 1 9 9 6 . V A N G E L D E R P . , D E C O C K , H . A N D T A M M A S S E N J: A s s e m b l y o f o u t e r b a c t e r i a l m e m b r a n e p r o t e i n s . I n M e m b r a n e P r o t e i n A s s e m b l y , ed . b y v o n H e i j n e G , p p . 6 3 - 8 2 , R . G . L a n d e s C o m p a n y , N e w Y o r k , 1 9 9 7 . V O G E L , H . A N D J A H N I G , F . : M o d e l s f o r the s t r u c t u r e o f o u t e r - m e m b r a n e p r o t e i n s o f Escherichia coli d e r i v e d from r a m a n s p e c t r o s c o p y a n d p r e d i c t i o n m e t h o d s . J o u r n a l o f M o l e c u l a r B i o l o g y 1 9 0 : 1 9 1 - 1 9 9 , 1 9 8 6 . W E I S S , M . S . , E T A L . : T h e s t r u c t u r e o f p o r i n from R h o d o b a c t e r c a p s u l a t u s at 1.8 r e s o l u t i o n . F E B S L e t t e r s 2 8 0 : 3 7 9 - 3 8 2 , 1 9 9 1 . W O N G , R , J O S T , H , a n d H A N C O C K , R . E . L i n k e r - i n s e r t i o n m u t a g e n e s i s o f Pseudomonas aeruginosa o u t e r m e m b r a n e p r o t e i n O p r F . M o l e c u l a r M i c r o b i o l o g y . 1 0 , 2 8 3 - 2 9 2 . 1 9 9 3 . W O R S T , D . J . , O T T O , B . R . A N D D E , G . J . : I r o n - r e p r e s s i b l e o u t e r m e m b r a n e p r o t e i n s o f Helicobacter pylori i n v o l v e d i n h e m e u p t a k e . I n f e c t i o n & I m m u n i t y 6 3 : 4 1 6 1 - 4 1 6 5 , 1 9 9 5 . Y O N E Y A M A H : M e c h a n i s m o f e f f i c i e n t e l i m i n a t i o n o f p r o t e i n D2 i n o u t e r m e m b r a n e o f i m i p e n e m - r e s i s t a n t Pseudomonas aeruginosa. A n t i m i c r o b i a l A g e n t s a n d C h e m o t h e r a p y . 37: 2 3 8 5 - 2 3 9 0 , 1 9 9 3 . 105 


Citation Scheme:


Citations by CSL (citeproc-js)

Usage Statistics



Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            async >
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:


Related Items