UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Analysis of the resistance-nodulation-division and HOP families of cell envelope proteins in helicobacter… Bina, James 1998

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1998-345122.pdf [ 6.02MB ]
Metadata
JSON: 831-1.0089116.json
JSON-LD: 831-1.0089116-ld.json
RDF/XML (Pretty): 831-1.0089116-rdf.xml
RDF/JSON: 831-1.0089116-rdf.json
Turtle: 831-1.0089116-turtle.txt
N-Triples: 831-1.0089116-rdf-ntriples.txt
Original Record: 831-1.0089116-source.json
Full Text
831-1.0089116-fulltext.txt
Citation
831-1.0089116.ris

Full Text

Analysis of the Resistance-Nodulation-Division and Hop families of Cell Envelope Proteins in Helicobacter pylori By JAMES  BINA  B.  Sc. U n i v e r s i t y o f W i s c o n s i n - M a d i s o n , 1992  M.  Sc. University o f W i s c o n s i n - M a d i s o n , 1994  A THESIS SUBMITTED  IN PARTIAL FULFILLMENT OF THE REQUIREMENTS  THE D E G R E E OF D O C T O R OF  PHILOSOPHY  in  THE F A C U L T Y OF G R A D U A T E  STUDIES  (Department of Microbiology and Immunology) W e a c c e p t t h i s t h e s i s as c o n f o r m i n g T o therequired-.standard  T H E UNIVERSITY OF BRITISH August  1998  ©James B i n a ,  1998  COLUMBIA  FOR  In presenting this thesis in partial fulfilment  of the requirements for an advanced  degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department  or by his or her  representatives.  It is understood  that copying or  publication of this thesis for financial gain shall not be allowed without my written permission.  Department The University of British Columbia Vancouver, Canada  DE-6 (2/88)  ABSTRACT T h i s s t u d y w a s i n i t i a t e d t o i d e n t i f y p o t e n t i a l g e n e s t h a t p l a y a f u n c t i o n a l r o l e i n t h e in  vivo a n t i b i o t i c r e s i s t a n c e o f Helicobacter pylori.  Translational fusions o f  H. pylori g e n e s t o  a l k a l i n e p h o s p h a t a s e w e r e m a d e to i d e n t i f y genes w h o s e p r o d u c t s w e r e s e c r e t e d o r e x p o r t e d i n  Escherichia  coli. T h e i n i t i a l s c r e e n i d e n t i f i e d t h r e e p o t e n t i a l H. pylori e f f l u x g e n e s o f t h e  bacterial resistance-nodulation-division family. expressed only  O n e o f the efflux systems w a s f o u n d to b e  in vivo a n d I w a s n o t a b l e t o i d e n t i f y e f f l u x a c t i v i t y i n i n v i t r o - g r o w n H. pylori.  T h e o v e r a l l results o f these e x p e r i m e n t s w e r e c o n s i s t e n t w i t h the s u g g e s t i o n that these e f f l u x systems do not f u n c t i o n i n the  in vitro i n t r i n s i c r e s i s t a n c e o f H. pylori t o a n t i b i o t i c s .  A s e c o n d line o f investigation a n a l y z e d m e m b e r s o f the  H. pylori H o p f a m i l y o f o u t e r  m e m b r a n e / a d h e s i n p r o t e i n s . E x n e r et al. ( I n f e c t i o n & I m m u n i t y 6 3 : 1 5 6 7 - 1 5 7 2 ,  1995)  p r e v i o u s l y described this f a m i l y o f 5 porin proteins based o nextensive N - t e r m i n a l amino acid s i m i l a r i t y . T h i s f a m i l y w a s further e x p a n d e d to i n c l u d e 3 2 p r o t e i n s c o n t a i n i n g e x t e n s i v e C t e r m i n a l a m i n o a c i d s i m i l a r i t y b y T o m b et al. ( N a t u r e 3 8 8 : 5 3 9 - 5 4 7 ,  1997). M y analysis o f the  H. pylori g e n o m e h a s f u r t h e r e x p a n d e d t h i s f a m i l y t o 3 4 m e m b e r s . T h e D N A s e q u e n c e s e n c o d i n g the c o n s e r v e d s e q u e n c e m o t i f s that are f o u n d w i t h i n the H o p f a m i l y h a d b e e n p r o p o s e d to f u n c t i o n i n h o m o l o g o u s r e c o m b i n a t i o n to generate a n t i g e n i c d i v e r s i t y o r i n r e s p o n s e to e n v i r o n m e n t a l changes. H o w e v e r , m y c o m p a r i s o n o f the sequences o f the H o p f a m i l y genes i n t w o recombination.  H. pylori s t r a i n s s u g g e s t e d t h a t t h e c o n s e r v e d s e q u e n c e s d i d n o t f u n c t i o n i n  B a s e d o n m o l e c u l a r m o d e l i n g o fH o p E , I p r o p o s e d and tested, b y l i n k e r  i n s e r t i o n m u t a g e n e s i s , the h y p o t h e s i s that the c o n s e r v e d s e q u e n c e m o t i f s are part o f a c o n s e r v e d structural motif.  T h e o v e r a l l results o f these e x p e r i m e n t s s u p p o r t e d the h y p o t h e s i s that the  c o n s e r v e d s e q u e n c e s e n c o d e a c o n s e r v e d s t r u c t u r a l m o t i f f o r a f a m i l y o f P-barrel p r o t e i n s .  ii  TABLE  OF  CONTENTS i i  ABSTRACT TABLE OF CONTENTS  ii  L I S T OF FIGURES  .v  L I S T OF TABLES  vj_  ACKNOWLEDGEMENTS  vii  CHAPTER 1 - I n t r o d u c t i o n Helicobacter  1  pylori  Functional  1  a s p e c t s o f t h e Gram n e g a t i v e c e l l  envelope i n a n t i b i o t i c  uptake  6  Bacterial  porin proteins  CHAPTER 2 - M a t e r i a l s Strains,  13  and Methods  19  p l a s m i d s and growth c o n d i t i o n s  19  Reagents  22  Genetic manipulations  22  DNA s e q u e n c i n g  22  Protein analysis  23  Construction  o f a Helicobacter  pylori-alkaline  phosphatase  fusion  library  23  Inhibition coli  o f endogenous a l k a l i n e  phosphatase a c t i v i t y i n  Escherichia  ER1793  The e f f e c t alkaline  24 o f 50 mM N a P 0  4  i n XP a g a r on t h e d e t e c t i o n  sensitivity for  phosphatase  24  DNA s e q u e n c i n g a n d a n a l y s i s o f H. p y l o r i - a l k a l i n e  phosphatase  fusion  clones Cloning  25 o f t h e hefABC  operon  DNA s e q u e n c i n g o f t h e hefABC  25 operon  26  i i i  i  Uptake o f H - t e t r a c y c l i n e , 3  ^ - c h l o r a m p h e n i c o l a n d 1-N-  pheny I n a p t h y l amine  27  DNA a n d p r o t e i n  28  Cloning  sequence a n a l y s i s  o f hefBC  a n d hefC  28  C o m p l e m e n t a t i o n o f E. c o l i acrAB Cloning  mutants with  hefBC  a n d hefC  29  o f hopE  29  Protein expression  30  Construction  30  o f hopE i n s e r t i o n m u t a n t s  S t r u c t u r a l p r e d i c t i o n o f HopE  31  CHAPTER 3 - R e s u l t s I.  34  I d e n t i f i c a t i o n of virulence  II.  Characterization  pylori--34  of the resistance-nodulation-division e f f l u x  s y s t e m s i n Helicobacter III.  f a c t o r s i n Helicobacter  pylori  44  I d e n t i f i c a t i o n of a conserved s t r u c t u r a l motif o u t e r membrane p r o t e i n  i n t h e Hop  family  67  CHAPTER 4 - D i s c u s s i o n Identification  82  of potential virulence  Role of e f f l u x i n the i n t r i n s i c  f a c t o r s i n Helicobacter  antibiotic  resistance  of  pylori-81 Helicobacter  pylori  84  I d e n t i f i c a t i o n o f a conserved s c a f f o l d i n g f o r a f a m i l y o f (3-barrel proteins  90  CHAPTER 5 - A p p e n d i x  97  BIBLIOGRAPHY  99  iv  LIST O F FIGURES  Figure 1  Schematic representation of Gram negative cell envelope  8  Figure 2  Cross-section of the Escherichia coli PhoE porin  15  Figure 3  Schematic of plasmids PDJT1-3  25  Figure 4  Protocol for epitope insertion  33  Figure 5  D N A sequence of the Helicobacter pylori 11637 hefABC operon  46  Figure 6  Schematic representation of the Helicobacter pylori R N D efflux operons  51  Figure 7  Phylogenetic tree of the Helicobacter pylori R N D efflux pump proteins  54  Figure 8  Titration of Helicobacter pylori with polymyxin B  56  Figure 9  Mg inhibition of polymyxin B-stimulated 1-N-phenylnapthylamine uptake in Helicobacter pylori  58  Figure 10  M g inhibition of polymyxin B-stimulated 1-N-phenylnapthylamine uptake in Helicobacter pylori  59  Figure 11  Acid inhibition of polymyxin B-stimulated 1-N-phenylnapthylamine uptake in Helicobacter pylori  60  Figure 12  Uptake of 1-N-phenylnapthylamine by Escherichia coli and Helicobacter pylori  61  Figure 13  CCCP inhibition of polymyxin B-stimulated 1-N-phenylnapthylamine uptake in Helicobacter pylori  63  Figure 14  Uptake of ^-chloramphenicol by Helicobacter pylori  65  Figure 15  B L O C K S alignment of Helicobacter pylori family of outer membrane proteins  68  Figure 16  Amino acid sequence of identified B L O C K S in the Helicobacter pylori Hop  69  Figure 17  Structural prediction for Helicobacter pylori HopE  72  Figure 18  Map of PCR oligonucleotides used for the cloning and D N A sequencing of Helicobacter pylori hopE  76  Figure 19  Recombinant expression of Helicobacter pylori hopE in Escherichia coli  76  Figure 20  Map of epitope insertion sites in Helicobacter pylori hopE  79  Figure 21  Westem-immunoblot of Helicobacter pylori hopE insertion mutants  80  2+  2 +  LIST O F T A B L E S Table I  B a c t e r i a l strains  20  Table II  Plasmids  21  Table III  Oligonucleotide primers  32  Table I V  Helicobacter pylori  11637  'phoA  fusion clones with  37  significant s i m i l a r i t y to database genes  Table V  M a p p i n g oi Helicobacter pylori 1 1 6 3 7 'phoA f u s i o n  40  c l o n e s t o t h e g e n o m e o f Helicobacter pylori 2 6 6 9 5 Table V I  S e q u e n c e s i m i l a r i t y a n d i d e n t i t y a m o n g Helicobacter  53  pylori R N D o p e r o n p r o t e i n s  vi  A C K N O W L E D G E M E N T  I thank m y supervisor, B o b H a n c o c k , for his enormous contribution to m y development as a s c i e n t i s t a n d f o r h i s p a t i e n c e , g e n e r o s i t y a n d s u p p o r t t h r o u g h o u t t h e t i m e I s p e n t i n h i s laboratory. possible.  A s p e c i a l thanks to S u s a n F a r m e r w h o s e assistance h e l p e d to m a k e e v e r y t h i n g  I also a c k n o w l e d g e the help a n d support o f the other m e m b e r s o f the H a n c o c k lab a n d  m y supervising committee, D r s . Beatty, Spiegelman and W a r r e n for their advice and help i n a s s e m b l i n g t h i s t h e s i s . I w o u l d l i k e t o t h a n k o u r c o l l a b o r a t o r s at A s t r a R e s e a r c h B o s t o n I n c . , Drs. A i m , D o i g and Trust, for their technical assistance and help. L a s t l y , I thank m y w i f e , R e n e e , f o r her support a n d help during the course o f m y graduate studies.  vii  INTRODUCTION  A. Helicobacter pylori 1. H i s t o r y T h e first report o f s p i r a l shaped b a c t e r i a a s s o c i a t e d w i t h the gastric e p i t h e l i u m w a s p u b l i s h e d i n the 1890s ( r e v i e w e d i n L e e & O ' R o u r k e , 1993). A l t h o u g h there w e r e s e v e r a l subsequent reports o f spiral organisms associated w i t h the h u m a n s t o m a c h , the s i g n i f i c a n c e o f these o b s e r v a t i o n s w e r e not r e a l i z e d u n t i l the 1980s. I n 1982 B a r r y M a r s h a l l a n d R o b i n W a r r e n first p r o p o s e d that there w a s a c o r r e l a t i o n b e t w e e n the p r e s e n c e o f these c u r v e d b a c t e r i a a n d d u o d e n a l ulcers. Subsequently, i n 1983, they w e r e the first to culture the c u r v e d - s h a p e d b a c t e r i u m t h a t e v e n t u a l l y c a m e t o b e k n o w n as  Helicobacter pylori ( M a r s h a l l & W a r r e n , 1 9 8 4 ) .  T h e a s s e r t i o n b y W a r r e n a n d M a s h a l l that  H. pylori w a s t h e c a u s a l a g e n t f o r g a s t r i c  u l c e r s w a s n o t i n i t i a l l y a c c e p t e d ; d o g m a at t h a t t i m e s t a t e d t h a t u l c e r s w e r e c a u s e d b y d i e t a n d stress. H o w e v e r , t h r o u g h a series o f g r o u n d b r e a k i n g e x p e r i m e n t s w h i c h p r o v e d K o c h ' s postulates for  H. j ^ y / o r z ' - i n d u c e d g a s t r i t i s , i n c l u d i n g a d e m o n s t r a t i o n t h a t c u r i n g o f H. pylori  resulted i n curing o f ulcers,  H pylori h a s n o w b e c o m e w i d e l y a c c e p t e d as t h e c a u s a t i v e a g e n t  for n u m e r o u s gastric pathologies i n c l u d i n g gastritis, gastric ulcers and gastric cancers. 2. M i c r o b i o l o g y  H. pylori i s a s l o w - g r o w i n g , c u r v e d G r a m n e g a t i v e r o d , w h i c h i s m o t i l e b y v i r t u e o f a p o l a r tuft o f sheathed f l a g e l l a ( G e i s  et al, 1 9 8 9 ) . H. pylori i s f a s t i d i o u s i n i t s g r o w t h  requirements and is usually grown o n a complex m e d i u m containing 5 - 1 0 % blood product; it does not g r o w w e l l i n liquid broth and isusually maintained o n solid media. T h i s organism r e q u i r e s t h e p r e s e n c e o f e l e v a t e d c o n c e n t r a t i o n s o f CO2 f o r g r o w t h , a n d w i l l n o t g r o w i n a i r o r under anaerobic conditions .  1  G r o w t h studies o f  H. pylori  r e v e a l e d that m o s t strains r e q u i r e 6 to 8 o f the 2 0 e s s e n t i a l  amino acids and grow without added vitamins, purines o r pyrimidines (Hazell & M e n d e z , R e y n o l d s & P e n n , 1994).  H. pylori  1993;  T h e s e observations have b e e n c o n f i r m e d b y sequence analysis o f the  2 6 6 9 5 g e n o m e i n w h i c h m o s t genes r e q u i r e d for the p r e s u m e d b i o s y n t h e t i c p a t h w a y s  have b e e n found, whereas those genes f r o m pathways w h o s e end products m u s t b e s u p p l i e d e x o g e n o u s l y , a r e n o t f o u n d i n t h e g e n o m e s e q u e n c e ( T o m b et al,  1997).  There is also sequence  a n d b i o c h e m i c a l e v i d e n c e f o r t h e p r e s e n c e i n H. pylori o f t h e E n t n e r - D o u d o r o f f p a t h w a y , t h e T C A c y c l e , t h e p e n t o s e p h o s p h a t e c y c l e a n d g l y c o l y s i s ( B e r g et al,  1997; H a z e l l & M e n d e z ,  1993; T o m b e r a / . , 1997).  H. pylori  u n d e r g o e s a p h e n o t y p i c shift d u r i n g its g r o w t h c y c l e ( S o r b e r g  et al,  1996).  A c t i v e l y d i v i d i n g c e l l s a r e r o d - s h a p e d , b u t as t h e c u l t u r e a g e s t h e c e l l m o r p h o l o g y s h i f t s t o w a r d s a c o c c o i d f o r m (at a p p r o x i m a t e l y 4 - 6 d a y s o n s o l i d a g a r ) w h i c h i s n o l o n g e r c u l t u r a b l e . S i m i l a r p h e n o t y p i c shifts have been observed w i t h  Vibrio  s p . ( C o l w e l l & H u q , 1994), i n w h i c h  t h e c o c c o i d c e l l s are b e l i e v e d to b e a n e n v i r o n m e n t a l r e s t i n g state a n d h a v e b e e n t e r m e d " v i a b l e but nonculturable".  W h e t h e r t h e c o c c o i d - s h a p e d H.  pylori  represent a " v i a b l e but  n o n c u l t u r a b l e " s t a t e h a s b e e n a p o i n t o f c o n t e n t i o n i n t h e l i t e r a t u r e . C e l l i n i et al, obtaining viable  H. pylori  reported  f r o m cultures o f the n o n v i a b l e c o c c o i d cells b y passage t h r o u g h the  s t o m a c h o f m i c e ( C e l l i n i et al,  1 9 9 4 ) , w h i c h i s i n c o n t r a s t t o t h e f i n d i n g s o f E a t o n et al.  w h o w e r e n o t a b l e t o o b t a i n v i a b l e c u l t u r e s f o l l o w i n g p a s s a g e t h r o u g h p i g l e t s ( E a t o n et 1995).  (1995) al,  I n c o n t r a s t , K u s t e r s et al. ( 1 9 9 7 ) a n a l y z e d t h e p r o t e i n a n d n u c l e i c a c i d c o n t e n t o f t h e  c o c c o i d c e l l s a n d f o u n d that the p r o t e i n s a n d n u c l e i c a c i d s w e r e d e g r a d e d , a n d c o n c l u d e d that t h e p h e n o t y p i c s h i f t i s a m a n i f e s t a t i o n o f c e l l d e a t h ( K u s t e r s et al,  1997).  3. Helicobacter pylori g e n o m e The genomic sequence o f  H. pylori  strain 26695 was published ( T o m b  f o l l o w i n g the c o m p l e t i o n o f Chapters 1 and 2 o f this thesis. T h e  H. pylori  et al,  26695  1997)  genome  s e q u e n c e c a n b e a c c e s s e d o n l i n e at T h e I n s t i t u t e f o r G e n o m i c R e s e a r c h ( T I G R ) w e b s i t e (www.tigr.org/tdb/mdb/hpdb/hpdb.html). T h e g e n o m e o f H. pylori 2 6 6 9 5 i s 1.67 M b p i n l e n g t h a n d h a s a G C c o n t e n t o f 3 9 % ( T o m b et al,  1997).  The genome contains 1590 predicted opening reading frames ( O R F s ) ,  o f w h i c h are u n i q u e to  H. pylori  databases. Interestingly, m a n y  499  i n that they do not h a v e s i m i l a r i t y to other g e n e s i n the  H. pylori  genes are m o s t c l o s e l y r e l a t e d to genes f o u n d  the G r a m p o s i t i v e bacteria, the archea a n d eukaryote o r g a n i s m s .  Since  H. pylori  among  is naturally  c o m p e t e n t ( N e d e n s k o v - S o r e n s e n et a l . , 1 9 9 0 ) , t h i s o b s e r v a t i o n w a s i n t e r p r e t e d as p o t e n t i a l evidence for horizontal gene transfer i n A large p r o p o r t i o n o f the  H. pylori  H. pylori  (Tomb  et al,  1997).  g e n o m e is p r e d i c t e d to b e i n v o l v e d i n transport  f u n c t i o n s ; s i n c e i t c o n t a i n s 17 A T P - b i n d i n g cassette ( A B C ) transport s y s t e m s , 3 r e s i s t a n c e n o d u l a t i o n - d i v i s i o n f a m i l y transport s y s t e m s ( i d e n t i f i e d b y m e p r i o r to the g e n o m e r e l e a s e ; B i n a et al,  1 9 9 6 ) ; a n d a 4 0 k b p a t h o g e n i c i t y i s l a n d ( P A T ) , the c a g p a t h o g e n i c i t y i s l a n d , that  m a y e n c o d e c o m p o n e n t s o f t y p e I I I a n d t y p e I V s e c r e t i o n s y s t e m s ( T o m b et al,  1997). A l s o  present are 9 5 p a r a l o g o u s gene f a m i l i e s w h i c h c o n s i s t e d o f a total o f 2 6 6 genes ( 1 6 % o f the g e n o m e ) ( T o m b et al,  1997).  T h e largest gene f a m i l y , w h i c h c o n t a i n e d 32 m e m b e r s , w a s the  H o p f a m i l y o f outer m e m b r a n e / a d h e s i n proteins a n d is the subject o f C h a p t e r 3 o f this thesis. 4. P a t h o g e n e s i s  H. pylori  i s a c o m m o n h u m a n p a t h o g e n that has b e e n e s t i m a t e d to c o l o n i z e 5 0 % o f the  world's population.  H. pylori  c o l o n i z a t i o n o f the h u m a n gastric m u c o s a has b e e n a s s o c i a t e d  3  w i t h a n u m b e r o f pathologies, i n c l u d i n g gastritis, ulcers, gastric cancers and e v e n heart disease ( v a n d e r H u l s t et al,  1996).  E p i d e m i o l o g i c a l e v i d e n c e s u g g e s t s that routes.  H. pylori  is spread b y f e c a l - o r a l and o r a l - o r a l  T h e r e are n o k n o w n e n v i r o n m e n t a l r e s e r v o i r s f o r  c u l t u r e d f r o m t h e f e c e s ( T h o m a s et al,  H. pylori,  H. pylori  H. pylori  has been  1992) o f infected individuals and has b e e n detected b y  p o l y m e r a s e c h a i n r e a c t i o n ( P C R ) i n d e n t a l p l a q u e ( N g u y e n et al, When  but  1993).  enters the s t o m a c h , the b a c t e r i a penetrate the gastric m u c o s a a n d  c o l o n i z e the gastric e p i t h e l i u m and m u c o s a . Initial i n f e c t i o n requires the e x p r e s s i o n o f m o t i l i t y a n d t h e u r e a s e e n z y m e ( E a t o n et al,  pylori  1 9 9 6 ; T s u d a et al,  1994).  M o t i l i t y i s r e q u i r e d f o r H.  to penetrate the g a s t r i c m u c u s a n d e s t a b l i s h i n f e c t i o n o n the g a s t r i c e p i t h e l i u m .  Urease  c a t a l y z e s the c o n v e r s i o n o f u r e a into a m m o n i a a n d c a r b o n d i o x i d e , a n d it is b e l i e v e d that the generation o f a m m o n i a b y the  H. pylori  urease e n z y m e functions i n n e u t r a l i z i n g the a c i d i c  e n v i r o n m e n t i n the gastric l u m e n .  H. pylori 1994).  s h o w s t r o p i s m for the h u m a n gastric e p i t h e l i u m ( r e v i e w e d i n B o r e n  et al,  It h a s b e e n s h o w n that the b l o o d g r o u p a n t i g e n s L e w i s b a n d H - 1 m e d i a t e a d h e r e n c e o f  H. pylori  to h u m a n gastric e p i t h e l i a l c e l l s  t h e s e b l o o d g r o u p a n t i g e n s ( l i v e r et al,  in situ  1998).  a n d that B a p A , a  H. pylori  p r o t e i n , b i n d s to  S i g n i f i c a n t l y , B a p A is a m e m b e r o f the  c o n s e r v e d H o p f a m i l y o f o u t e r m e m b r a n e / a d h e s i n p r o t e i n s ( l i v e r et al,  1998).  It h a s a l s o b e e n  s p e c u l a t e d t h a t o t h e r m e m b e r s o f t h e H o p f a m i l y f u n c t i o n as a d h e s i n s .  H. pylori people.  i n f e c t i o n o f the s t o m a c h results i n c h r o n i c gastritis i n the m a j o r i t y o f i n f e c t e d  T h e p r o g r e s s i o n f r o m g a s t r i t i s t o m o r e s e v e r e p a t h o l o g i e s s u c h as u l c e r s a n d g a s t r i c  cancers is a s s o c i a t e d w i t h the p r e s e n c e i n the i n f e c t i n g strain o f the c a g p a t h o g e n i c i t y i s l a n d a n d  the e x p r e s s i o n o f the v a c u o l a t i n g c y t o t o x i n ( B e r g et al, The  1997; C o v a c c i & Rappouli,  H. pylori  (vacA)  a n d the c y t o t o x i n a s s o c i a t e d  (cagA)  genes  1998).  l i p o p o l y s a c c h a r i d e ( L P S ) contains several u n u s u a l features. First, the  L i p i d A ( m e m b r a n e inserted) p o r t i o n is m i s s i n g the 4 ' phosphate g r o u p that is f o u n d o n m o s t b a c t e r i a l L i p i d A m o l e c u l e s ( M o r a n et al,  1 9 9 7 ; M u o t i a l a et al,  1992).  A reduction i n the  charge o fL P S , either through reduced phosphate content o r substitution o f phosphate  groups  w i t h arabanosamine, isassociated w i t h reduced toxicity o f endotoxin and increased resistanceto cationic antimicrobial peptides.  T h i s f i n d i n g is c o n s i s t e n t w i t h the o b s e r v a t i o n that  e n d o t o x i n is r e l a t i v e l y n o n t o x i c ( M u o t i a l a  et al,  1992) a n d that  H. pylori  H. pylori  is reasonably resistant  to c a t i o n i c a n t i m i c r o b i a l peptides ( R . E . W . H a n c o c k , u n p u b l i s h e d observations).  S e c o n d , the  O a n t i g e n o f H. pylori c o n t a i n s L e w i s X a n d L e w i s Y b l o o d g r o u p a n t i g e n s ( S h e r b u r n e et 1 9 9 5 ; A p p e l m e l k et al,  1996).  al,  T h e p r e s e n c e o f these antigens is b e l i e v e d to f u n c t i o n i n e v a s i o n  o f t h e i m m u n e s y s t e m ( t h r o u g h m o l e c u l a r m i m i c r y ) ( A p p e l m e l k et al,  1997).  It has also b e e n  H. pylori  s p e c u l a t e d that the e x p r e s s i o n o f i n c o m p l e t e l y f o r m e d L e w i s antigens b y  m a y be  i n v o l v e d i n the generation o f a u t o i m m u n e antibodies w h i c h contribute to p a t h o g e n e s i s (Appelmelk  et al,  1997).  T h i r d , the l i p i d p o r t i o n o f  H. pylori  L P S contains unusually  s a t u r a t e d f a t t y a c i d s a n d g l y c o s y l a t e d c h o l e s t e r o l e s t e r s ( A s p i n a l l et al, 5.  long  1 9 9 6 ; G e i s et al,  1990).  Treatment. When  carry  H. pylori  H. pylori  b e c o m e s established i n the gastric m u c o s a , i n f e c t e d i n d i v i d u a l s u s u a l l y  for life unless treated w i t h antibiotics. A l t h o u g h  H. pylori  is s u s c e p t i b l e to m o s t  a n t i b i o t i c s in vitro ( R u b i n s t e i n et a l . , 1 9 9 4 ) , t r e a t m e n t o f H. / ? v 7 o r z ' - i n f e c t e d i n d i v i d u a l s h a s p r o v e n difficult. S i n g l e antibiotic therapy has p r o v e n virtually ineffective; successful treatment u s u a l l y requires a m u c h m o r e aggressive therapy u s i n g t w o o r three antibiotics g i v e n i n  5  c o m b i n a t i o n w i t h a p r o t o n p u m p i n h i b i t o r ( v a n d e r H u l s t et al,  1996). T h i s m o r e aggressive  t r e a t m e n t s t r a t e g y r e s u l t s i n a s u c c e s s r a t e o f 8 0 - 9 5 % ( v a n d e r H u l s t et al, S e v e r a l factors c o u l d e x p l a i n the d i f f i c u l t y o f treating  1996).  H. pylori in vivo  including: acid  i n a c t i v a t i o n o f d r u g s ; i n a c c e s s i b i l i t y o f d r u g s to the gastric l u m e n ; too short a treatment t i m e ; v a r i a b l e p a t i e n t c o m p l i a n c e w i t h p h y s i c i a n ' s i n s t r u c t i o n s ; i n a p p r o p r i a t e f o r m u l a t i o n o f d r u g s ; in  vivo  alterations in  H. pylori  p e r m e a b i l i t y (this thesis) a n d a c t i v e e f f l u x m e c h a n i s m s (this thesis).  A l l o f these p o s s i b i l i t i e s have merit i n s o m e instances but they d o not g l o b a l l y e x p l a i n the apparently elevated  in vivo  intrinsic resistance o f  H. pylori  to antibiotics. I p r o p o s e another  h y p o t h e s i s i n C h a p t e r 2 o f this thesis, that the c o n d i t i o n a l e x p r e s s i o n o f m u l t i p l e d r u g e f f l u x systems, i n c o n j u n c t i o n w i t h decreased outer m e m b r a n e permeability, results i n the elevated intrinsic  in vivo  resistance o f  H. pylori  to a n t i b i o t i c s .  B. F u n c t i o n a l a s p e c t s o f t h e G r a m n e g a t i v e c e l l e n v e l o p e i n a n t i b i o t i c u p t a k e T h e cell envelope o fG r a m negative bacteria consists o f t w o membranes, the c y t o p l a s m i c a n d o u t e r m e m b r a n e , w h i c h a r e s e p a r a t e d b y t h e p e r i p l a s m i c s p a c e ( F i g u r e 1). I t has l o n g b e e n a s s u m e d that the outer m e m b r a n e o f G r a m n e g a t i v e b a c t e r i a is the p r i m a r y d e t e r m i n a n t i n the i n t r i n s i c r e s i s t a n c e o f b a c t e r i a to a n t i m i c r o b i a l c o m p o u n d s s u c h as a n t i b i o t i c s a n d detergents. H o w e v e r , r e c e n t l y i t has b e c o m e c l e a r that there are other m e m b r a n e - l o c a l i z e d f a c t o r s , s u c h as c o n s t i t u t i v e l y e x p r e s s e d a c t i v e e f f l u x s y s t e m s , t h a t w o r k i n s y n e r g y w i t h restricted outer m e m b r a n e p e r m e a b i l i t y to b r i n g about the i n t r i n s i c a n d i n s o m e cases h i g h l e v e l r e s i s t a n c e o f b a c t e r i a t o a n t i m i c r o b i a l s ( M a et a l . , 1 9 9 4 ; N i k a i d o , 1 9 9 6 ; H a n c o c k , 1 9 9 7 ) . 1.  Structure o fthe outer m e m b r a n e T h e outer m e m b r a n e o f G r a m negative bacteria plays a role i n e x c l u d i n g n o x i o u s  c o m p o u n d s s u c h as a n t i b i o t i c s , e n z y m e s a n d detergents f r o m the b a c t e r i a l c y t o p l a s m w h i l e  6  f u n c t i o n i n g as a s e l e c t i v e p e r m e a b i l i t y b a r r i e r f o r t h e u p t a k e o r e g r e s s o f o t h e r c o m p o u n d s ( N i k a i d o , 1 9 9 3 ; H a n c o c k , 1997). T h e outer m e m b r a n e is a n a s y m m e t r i c b i l a y e r that c o n t a i n s L P S i n the outer leaflet and p h o s p h o l i p i d s i n the inner leaflet. L P S consists o f three regions, a h y d r o p h o b i c core c o n s i s t i n g o f L i p i d A w h i c h is inserted into the m e m b r a n e , the c o n s e r v e d core o l i g o s a c c h a r i d e and the i m m u n o d o m i n a n t and variable O-antigen.  In m o s t c o m m o n pathogens, L i p i d A is a d i m e r o f d i p h o s p h o r y l a t e d N -  a c e t y l g l u c o s a m i n e that is substituted w i t h 6 to 7 saturated fatty a c i d r e s i d u e s w h i c h a n c h o r the L P S m o l e c u l e i n the m e m b r a n e ( D a r v e a u , 1998).  C o v a l e n t l y attached to the L i p i d A  backbone  a n d e x t e n d i n g t o w a r d s the e x t r a c e l l u l a r e n v i r o n m e n t is the c o r e r e g i o n . T h e c o r e r e g i o n c o n s i s t s o f a h e t e r o g e n e o u s o l i g o s a c c h a r i d e o f 8 to 12 sugar r e s i d u e s i n c l u d i n g the u n i q u e octasaccharide 2-keto-3-deoxyoctulosonate ( K D O ) , L-glycerol-D-mannoheptose, and two or m o r e h e x o s e s or h e x o s a m i n e s ; the i n d i v i d u a l sugar residues i n the core o l i g o s a c c h a r i d e m a y be further m o d i f i e d b y additional sugar residues, amino acids and/or b y phosphorylation ( H a n c o c k , 1997; D a r v e a u , 1998). I m m e d i a t e l y f o l l o w i n g the core m a y be attached the h i g h l y v a r i a b l e O a n t i g e n w h i c h c o n s i s t s o f 3 to 5 s u g a r u n i t s that are r e p e a t e d n u m e r o u s t i m e s . O t h e r p a t h o g e n s m a y have lipooligosaccharide ( L O S ) w i t h a variable core sugar region and no  O-antigen  ( H a n c o c k , 1997; Darveau, 1998).  7  F i g u r e 1.  S c h e m a t i c d i a g r a m o f the c e l l envelope o f G r a m negative bacteria. T h e c e l l  e n v e l o p e o f G r a m negative b a c t e r i a consists o f t w o m e m b r a n e s , the c y t o p l a s m i c a n d outer m e m b r a n e w h i c h are separated b y the p e r i p l a s m . T h e outer m e m b r a n e is a n a s y m m e t r i c b i l a y e r w i t h l i p o p o l y s a c c h a r i d e ( L P S ) i n the outer leaflet a n d p h o s p h o l i p i d s i n the inner leaflet. T h e p e r i p l a s m separates the t w o m e m b r a n e s a n d c o n t a i n s the m e s h like p e p t i d o g l y c a n layer. T h e inner m e m b r a n e (cytoplasmic m e m b r a n e ) is a phospholipid bilayer.  P r o t e i n s s h o w n are: a t h r e e - c o m p o n e n t  resistance-nodulation-  d i v i s i o n e f f l u x s y s t e m c o n s i s t i n g o f the integral outer m e m b r a n e pore proteins, the p e r i p l a s m i c m e m b r a n e f u s i o n proteins ( M F ) and the integral c y t o p l a s m i c resistancen o d u l a t i o n - d i v i s i o n p u m p protein; an outer m e m b r a n e p o r i n protein f o r m i n g a d i f f u s i o n channel and a peripheral periplasmic penicillin binding protein ( P B P ) w h i c h functions in the synthesis o f the p e p t i d o g l y c a n layer.  8  T h e p r e d o m i n a n t features o f the outer m e m b r a n e that i n f l u e n c e a n t i b i o t i c u p t a k e are the large net n e g a t i v e c h a r g e o n L P S a n d the p r e s e n c e o f p o r i n proteins i n the outer m e m b r a n e ( N i k a i d o 1988; N i k a i d o , 1993; H a n c o c k 1987; H a n c o c k , 1997). T h e h i g h negative charge a s s o c i a t e d w i t h p h o s p h a t e a n d K D O r e s i d u e s o n L i p i d A a n d the c o r e o l i g o s a c c h a r i d e are neutralized b y noncovalent crosslinking w i t h divalent cations ( N i k a i d o , 1993; H a n c o c k 1987; H a n c o c k , 1997). T h e effect o f this c r o s s l i n k i n g is to stabilize the outer m e m b r a n e . proteins are r e s p o n s i b l e for the s i e v i n g characteristics o f the outer m e m b r a n e .  The porin  Porins function  as w a t e r f i l l e d d i f f u s i o n c h a n n e l s t h a t a l l o w t h e p a s s a g e o f s m a l l ( e . g . , < 6 0 0 D a l t o n i n  E. coli)  h y d r o p h i l i c m o l e c u l e s ( H a n c o c k 1987; N i k a i d o 1988; N i k a i d o , 1993; H a n c o c k , 1997).  The  e x c l u s i o n l i m i t o f the outer m e m b r a n e is d e t e r m i n e d b y the size o f the c h a n n e l s f o r m e d b y the most predominant non-specific porins. 2.  Mechanisms of antibiotic uptake T h e r e exists three general p a t h w a y s for antibiotic uptake i n G r a m n e g a t i v e bacteria: the  p o r i n p a t h w a y , the h y d r o p h o b i c p a t h w a y a n d the s e l f p r o m o t e d u p t a k e p a t h w a y ( H a n c o c k , 1997). S m a l l h y d r o p h i l i c m o l e c u l e s enter the p e r i p l a s m b y d i f f u s i o n t h r o u g h the p o r i n channels that are p r e s e n t i n the o u t e r m e m b r a n e .  P o r i n p r o t e i n s are c l a s s i f i e d i n t o three c l a s s e s : g e n e r a l  p o r i n s w h i c h h a v e n o substrate s e l e c t i v i t y , s p e c i f i c p o r i n s w h i c h c o n t a i n a b i n d i n g site for a s p e c i f i c substrate a n d g a t e d , s p e c i f i c p o r i n s w h i c h are b e l i e v e d to h a v e o b s t r u c t e d c h a n n e l s that a r e o p e n e d b y t h e b i n d i n g o f a s p e c i f i c s u b s t r a t e ( V a n G e l d e r et al,  1997). U p t a k e o f s m a l l  h y d r o p h i l i c a n t i b i o t i c s u s u a l l y o c c u r s t h r o u g h the general p o r i n s . A n t i b i o t i c u p t a k e t h r o u g h the s p e c i f i c p o r i n s i s n o t w e l l d o c u m e n t e d , b u t it has b e e n s h o w n that the b a s i c a m i n o a c i d - s p e c i f i c  9  O p r D porin of  Pseudomonas aeruginosa m e d i a t e s t h e u p t a k e o f t h e P - l a c t a m a n t i b i o t i c  i m i p e n e m ( S u m i t a et al.., 1 9 9 3 ; Y o n e y a m a et al..,  1993).  L i p o p h i l i c a n d a m p h i p a t h i c antibiotics enter the c e l l t h r o u g h the h y d r o p h o b i c p a t h w a y b y passive p e r m e a t i o n through the outer m e m b r a n e b i l a y e r ( H a n c o c k & B e l l , 1988).  The  m e c h a n i s m o f uptake o f hydrophobic and amphipathic antibiotics is not w e l l understood but p r o b a b l y i n v o l v e s the p a r t i t i o n i n g into the h y d r o c a r b o n core o f the outer m e m b r a n e a n d s i m p l e diffusion.  It h a s b e c o m e c l e a r that the i n t r i n s i c a n d h i g h l e v e l r e s i s t a n c e o f b a c t e r i a to m a n y  h y d r o p h o b i c antimicrobials is mediated b y active efflux m e c h a n i s m s rather than changes i n outer m e m b r a n e permeability. C a t i o n i c a n t i m i c r o b i a l s s u c h as t h e a m i n o g l y c o s i d e s a n d c a t i o n i c a n t i m i c r o b i a l p e p t i d e s enter the c e l l s b y c o m p e t i n g f o r d i v a l e n t c a t i o n b i n d i n g sites o n the surface L P S i n a p r o c e s s that has b e e n t e r m e d s e l f p r o m o t e d u p t a k e ( H a n c o c k , 1997).  It i s b e l i e v e d that the b i n d i n g o f  these c o m p o u n d s to the outer m e m b r a n e d i s p l a c e s the n a t i v e d i v a l e n t c a t i o n s a n d , due to their b u l k i n e s s , they d e s t a b i l i z e ( p e r m e a b i l i z e ) the outer m e m b r a n e a n d thereby facilitate further uptake o f themselves and other molecules (Hancock,  1997).  3. Factors that influence antibiotic accumulation T w o s y n e r g i s t i c m e c h a n i s m s are i n v o l v e d i n the i n t r i n s i c r e s i s t a n c e o f b a c t e r i a to m a n y classes o f a n t i m i c r o b i a l c o m p o u n d s : restricted uptake through the channels o f p o r i n proteins a n d a c t i v e e f f l u x s y s t e m s ( M a et al,  1994; N i k a i d o , 1996; H a n c o c k , 1997).  Thus, factors  i n f l u e n c i n g the e x p r e s s i o n l e v e l o f these systems h a v e b e e n s h o w n to alter antibiotic resistance. C h a n g e s i n the l e v e l s and/or the c o m p l e m e n t o f p o r i n proteins i n the outer m e m b r a n e c a n have large effects o n the p e r m e a t i o n o f h y d r o p h i l i c c o m p o u n d s across the outer m e m b r a n e ( N i k a i d o , 1993).  T h e best characterized e x a m p l e is p r o v i d e d b y the O m p C a n d O m p F p o r i n  10  proteins o f  Escherichia  coli ( S l a u c h a n d S i l h a v y , 1 9 8 9 ; H a n c o c k , 1 9 8 7 ) . W h e n g r o w n u n d e r  c o n d i t i o n s o f l o w o s m o l a r i t y , s u c h as i n a n e n v i r o n m e n t o u t s i d e o f t h e m a m m a l i a n gastrointestinal tract,  E. coli p r e d o m i n a n t l y e x p r e s s e s O m p F , w h i c h h a s a r e l a t i v e l y l a r g e p o r e  s i z e ( N i k a i d o a n d R o s e n b e r g , 1 9 8 3 ; L a k e y et al, when  1985), i n the outer m e m b r a n e .  I n contrast,  E. coli i s g r o w n u n d e r c o n d i t i o n s o f h i g h o s m o l a r i t y , s u c h a s i n t h e m a m m a l i a n  gastrointestinal tract, the e x p r e s s i o n o f O m p F is repressed and the e x p r e s s i o n o f O m p C i s induced. The O m p C porin contains a m u c h smaller diameter pore relative (Nikaido and R o s e n b e r g , 1 9 8 3 ; L a k e y et al, m o l e c u l e s that are present  1985) to O m p F and restricts the p e r m e a t i o n o f n o x i o u s  in vivo. P o r i n l e v e l s c a n a l s o b e a f f e c t e d b y b o t h l a b o r a t o r y a n d  c l i n i c a l l y d e r i v e d m u t a t i o n s , l e a d i n g to i n c r e a s e d l e v e l s o f r e s i s t a n c e t o m a n y o r a f e w antibiotics. T h e loss o f the  P. aeruginosa i m i p e n e m - s p e c i f i c O p r D p o r i n o c c u r s i n  a p p r o x i m a t e l y 5 0 % o f p a t i e n t s t r e a t e d w i t h i m i p e n e m ( S u m i t a et al,  1 9 9 3 ; Y o n e y a m a et  al,  1993). R e c e n t e x p e r i m e n t s h a v e r e v e a l e d that the c o n s t i t u t i v e e x p r e s s i o n i n G r a m n e g a t i v e bacteria o f a c t i v e e f f l u x m e c h a n i s m s w i t h b r o a d substrate s p e c i f i c i t y is r e s p o n s i b l e for the i n t r i n s i c r e s i s t a n c e o f b a c t e r i a t o a m p h i p a t h i c a n t i m i c r o b i a l s ( N i k a i d o , 1 9 9 6 ; P a u l s e n et  al,  1996). T h e r e i s e v i d e n c e that these e f f l u x s y s t e m s a l s o c o n t r i b u t e t o the i n t r i n s i c r e s i s t a n c e t o o t h e r h y d r o p h i l i c a n t i m i c r o b i a l s i n c l u d i n g P-lactams, d i v a l e n t c a t i o n s a n d c a t i o n i c a n t i m i c r o b i a l p e p t i d e s ( P a u l s e n et al,  1 9 9 6 ; S h a f e r et al,  1 9 9 8 ; S r i k u m a r et al,  1998).  T h e r e a r e at l e a s t f o u r c o n s e r v e d f a m i l i e s o f b a c t e r i a l e f f l u x s y s t e m s t h a t h a v e b e e n a s s o c i a t e d w i t h r e s i s t a n c e t o a n t i b i o t i c s ( S a i e r et al, 1 9 9 8 ) . O n e o f t h e s e f a m i l i e s t h a t i s o f particular interest i n the i n t r i n s i c resistance o f G r a m negative b a c t e r i a to a n t i m i c r o b i a l s is the Resistance-Nodulation-Division (RND)  family o f bacterial efflux systems (Nikaido,  1996;  11  P a u l s e n et al,  1997). T h e R N D  f a m i l y e f f l u x s y s t e m s are p r o t o n m o t i v e f o r c e - d e p e n d e n t  efflux  s y s t e m s that are w i d e s p r e a d a m o n g the G r a m n e g a t i v e bacteria. S u c h s y s t e m s , i n c l u d i n g the  acrAB-tolC al,  system in  1995) and the  E. coli  mtrCDE  ( M a et a l . , 1 9 9 3 ) , t h e  system in  mexAB-oprM  Neisseria gonnorhoeae  system in  P. aeruginosa  (Li  et  ( H a g m a n et a l . , 1 9 9 5 ) , h a v e b e e n  i m p l i c a t e d i n the i n t r i n s i c r e s i s t a n c e o f these r e s p e c t i v e b a c t e r i a to a w i d e v a r i e t y o f s t r u c t u r a l l y and c h e m i c a l l y unrelated antibiotics and other antimicrobial c o m p o u n d s , i n c l u d i n g m a n y antibiotics, detergents and dyes. R N D s y s t e m s are 3 c o m p o n e n t e f f l u x s y s t e m s c o n s i s t i n g o f a c o n s e r v e d i n t e g r a l cytoplasmic membrane p u m p protein, a conserved periplasmic membrane fusion o r linker p r o t e i n , a n d a less w e l l c o n s e r v e d i n t e g r a l outer m e m b r a n e p r o t e i n that h a s b e e n p r e s u m e d to b e a p o r e f o r m i n g p r o t e i n ( N i k a i d o , 1996) ( F i g u r e 1). T h e m e m b r a n e f u s i o n p r o t e i n i s l i n k e d to the c y t o p l a s m i c m e m b r a n e b y a s i n g l e t r a n s m e m b r a n e d o m a i n , o r t h r o u g h c o v a l e n t attachment o f a l i p i d , a n d h a s b e e n p r o p o s e d to f u n c t i o n to l i n k the c y t o p l a s m i c p u m p p r o t e i n to the outer membrane pore protein.  T h i s l i n k a g e is b e l i e v e d to result i n the f o r m a t i o n o f a c o n t i n u o u s  c h a n n e l f o r the e x t r u s i o n o f substrates to the e x t r a c e l l u l a r e n v i r o n m e n t . A n t i b i o t i c e f f l u x s y s t e m s f u n c t i o n s y n e r g i s t i c a l l y w i t h c h a n g e s that d e c r e a s e outer m e m b r a n e p e r m e a b i l i t y ( N i k a i d o , 1996; H a n c o c k , 1997). T h i s i s e v i d e n t w h e n c o m p a r i n g the c o n t r i b u t i o n o f the R N D s y s t e m s to the i n t r i n s i c a n t i b i o t i c r e s i s t a n c e i n and  P. aeruginosa  ( L i et a l . , 1 9 9 5 ) .  E. coli  O n l y i n the latter s p e c i e s d o the R N D  ( M a et a l . , 1 9 9 3 )  systems result i n  c l i n i c a l l y s i g n i f i c a n t l e v e l s o f a n t i b i o t i c r e s i s t a n c e . T h i s f i n d i n g i s t h o u g h t t o r e s u l t from t h e relatively l o w e r p o r o s i t y o f the outer m e m b r a n e i n of  E. coli  (Nikaido, 1988; N i k a i d o ,  P. aeruginosa  relative to the outer  membrane  1993).  12  I n g e n e r a l , t h e s t e a d y state c o n c e n t r a t i o n o f m a n y a n t i b i o t i c s i n the c y t o p l a s m ( o r ' p e r i p l a s m ) is d e t e r m i n e d b y the rate o f i n f l u x a n d the rate o f e f f l u x ( N i k a i d o , 1996).  In  E. coli,  s o m e a n t i m i c r o b i a l c o m p o u n d s penetrate the outer m e m b r a n e v e r y r a p i d l y a n d o v e r w h e l m the e f f l u x s y s t e m s a n d r a p i d l y r e a c h t o x i c c o n c e n t r a t i o n s i n t h e c y t o p l a s m ( M a et al, N i k a i d o , 1996); thus the r e l a t i v e l y h i g h m e m b r a n e p e r m e a b i l i t y o f m o d e r a t e i n t r i n s i c r e s i s t a n c e to a n t i m i c r o b i a l c o m p o u n d s .  aeruginosa,  E. coli  1994;  results o n l y i n a  T h e o u t e r m e m b r a n e o f P.  h o w e v e r , is m u c h less p e r m e a b l e than the outer m e m b r a n e o f  E. coli  (Nikaido,  1993; N i k a i d o , 1988), and the penetration o f s m a l l a n t i m i c r o b i a l m o l e c u l e s across the outer membrane in  P. aeruginosa  c o m p e t e s p o o r l y w i t h their e f f l u x ; the net effect o f this l o w  m e m b r a n e p e r m e a b i l i t y i s that  P. aeruginosa  has a far h i g h e r i n t r i n s i c resistance to  a n t i m i c r o b i a l c o m p o u n d s ( M a et al, 1 9 9 4 ; N i k a i d o , 1 9 9 6 ) .  C. Bacterial porin proteins 1. Structure of porins P o r i n s represent a d i s t i n c t class o f m e m b r a n e p r o t e i n s c o m p a r e d to the p r e d o m i n a n t l y a h e l i c a l c y t o p l a s m i c m e m b r a n e proteins i n G r a m negative bacteria. I n contrast to m o s t integral m e m b r a n e p r o t e i n s , p o r i n s d o n o t c o n t a i n stretches o f h y d r o p h o b i c a m i n o a c i d r e s i d u e s that are l o n g e n o u g h t o s p a n t h e o u t e r m e m b r a n e ( J e a n t e u r et al,  1991).  I n fact, hydropathy analyses  i n d i c a t e that m o s t p o r i n s are r e l a t i v e l y h y d r o p h i l i c i n nature . H o w these s e e m i n g l y h y d r o p h i l i c p r o t e i n s are a c c o m m o d a t e d i n the b a c t e r i a l o u t e r m e m b r a n e w a s r e v e a l e d b y a n u m b e r o f p h y s i c a l a n d genetic m e a n s , w h i c h w e r e subsequently validated b y s o l v i n g the crystal structures f o r four general d i f f u s i o n p o r i n s : the P h o E a n d O m p F p o r i n s o f a n d the p o r i n s f r o m  blastica  Rhodobacter capsulatus  (Weiss  et al,  E. coli  1991) and  (Cowan  et al,  1992),  Rhodopseudomonas  (Paul & R o s e n b u s c h , 1985).  13  The P h o E and O m p F porins of  E. coli s h a r e h i g h l e v e l s o f s e q u e n c e s i m i l a r i t y t o e a c h  o t h e r b u t l i t t l e s i m i l a r i t y t o t h e o t h e r t w o p o r i n s w h o s e s t r u c t u r e i s k n o w n ( J e a n t e u r et al,  1991).  Interestingly, e v e n w i t h the p a u c i t y o f a m i n o a c i d s i m i l a r i t y , a l l the c r y s t a l l i z e d p o r i n s h a v e s i m i l a r tertiary and quaternary structures ( S c h u l z , 1996). t h e o u t e r m e m b r a n e ( J e a n t e u r et al,  1991).  E a c h o f these proteins f o r m trimers i n  E a c h m o n o m e r c o n t a i n s a t r a n s m e m b r a n e c o r e that  is c o n s t r u c t e d o f a 1 6 - s t r a n d e d a n t i p a r a l l e l (3-barrel ( F i g u r e 2).  T h e P-strands are a m p h i p a t h i c  w i t h the h y d r o p h o b i c side f a c i n g out a n d interacting w i t h the m e m b r a n e a n d the h y d r o p h i l i c f a c e o r i e n t e d t o w a r d s t h e i n t e r i o r o f t h e b a r r e l ( V a n G e l d e r et al,  1997).  The antiparallel  P-  strands are c o n n e c t e d b y short turns o n the p e r i p l a s m i c side a n d l o n g l o o p s o n the extracellular s i d e ( V a n G e l d e r et al,  1997).  14  Antiparallel (3-strands  Periplasmic loops  Figure 2.  C r o s s - s e c t i o n t h r o u g h the crystal structure o f the  ( C o w e n et al,  Escherichia  coli  P h o E porin  1992). B a c t e r i a l p o r i n s are c o m p o s e d o f a t r a n s m e m b r a n e c o r e o f antiparallel  a m p h i p a t h i c p-sheets that are c o n n e c t e d b y short l o o p s o n the p e r i p l a s m i c side a n d l o n g surface e x p o s e d l o o p s ( V a n G e l d e r et al,  1997). L o o p 3 , i n particular, dips d o w n into the channel t o  create the m o s t c o n s t r i c t e d part o f the c h a n n e l a n d d e t e r m i n e the characteristics (size a n d i o n selectivity) o f this channel ( N i k a i d o , 1993).  15  2. Synthesis and outer membrane insertion of porins P o r i n s are s y n t h e s i z e d i n the c y t o p l a s m as p r e c u r s o r s w i t h N - t e r m i n a l s i g n a l sequences ( V a n G e l d e r et al,  1997). T h e y are t r a n s l o c a t e d across the c y t o p l a s m i c m e m b r a n e a n d i n t o t h e  p e r i p l a s m v i a the g e n e r a l s e c r e t o r y p a t h w a y i n a p r o c e s s that i n v o l v e s c l e a v a g e o f the s i g n a l p e p t i d e ( V a n G e l d e r et al,  1997). T h e p r o c e s s e s that o c c u r f o l l o w i n g s e c r e t i o n i n t o the  p e r i p l a s m are not w e l l u n d e r s t o o d .  T h e current m o d e l suggests that the o n c e the p r o t e i n enters  the p e r i p l a s m , the protein f o r m s a tertiary o r quaternary structure p r i o r to spontaneous insertion i n t o t h e o u t e r m e m b r a n e ( V a n G e l d e r et al,  1 9 9 7 ) . O n e feature o f p o r i n b i o g e n e s i s i s that  m u t a t i o n s , w h i c h a d v e r s e l y affect p o r i n f o l d i n g i n the p e r i p l a s m result i n p r o t e o l y s i s o f the p o r i n protein i n the periplasm. I ngeneral, mutations, i n c l u d i n g large insertions and deletions, are tolerated i n the l o o p r e g i o n s o f p o r i n s a n d d o n o t affect p r o t e i n f o l d i n g o r p r o c e s s i n g , b u t these m u t a t i o n s are n o t tolerated i n the t r a n s m e m b r a n e c o r e a n d the r e s u l t i n g proteins are p r o t e o l y z e d ( V a n G e l d e r et al,  1997).  Correctly assembled porins have several definitive biochemical and i m m u n o l o g i c a l properties.  V i r t u a l l y a l l p o r i n s h a v e a h i g h t h e r m a l stability e v e n i n the presence o f detergent.  In the p r e s e n c e o f 2 % S D S , temperatures e x c e e d i n g 6 0 to 70°C are r e q u i r e d f o r d e n a t u r a t i o n o f t h e p o r i n p r o t e i n s ( V a n G e l d e r et al,  1 9 9 7 ) . T h u s m a n y p o r i n p r o t e i n s t h a t a r e s o l u b i l i z e d at  temperatures b e l o w 60°C p r i o r to electrophoresis m i g r a t e s l o w e r (as f o l d e d trimers) o r faster (as f o l d e d m o n o m e r s ) t h a n p o r i n s that are s o l u b i l i z e d at t e m p e r a t u r e s e x c e e d i n g 6 0 t o 70°C ( V a n G e l d e r et al,  1997). T h i s property, t e r m e d heat m o d i f i a b i l i t y , i s a d e f i n i t i v e characteristic o f  correctly folded p o r i n proteins.  M a n y p o r i n s a r e v e r y r e s i s t a n t t o p r o t e o l y s i s ( V a n G e l d e r et  al,  1997). I n addition, m o n o c l o n a l antibodies raised against native porins often recognize c o n f o r m a t i o n a l e p i t o p e s t h a t a r e n o t p r e s e n t i n t h e d e n a t u r e d p r o t e i n ( V a n G e l d e r et al,  1997).  16  3. Structural analysis of porins B e c a u s e o f their characteristic P-barrel structure, it i s p o s s i b l e to p r e d i c t the t o p o l o g y o f porins based o n their p r i m a r y a m i n o a c i d sequence w i t h greater a c c u r a c y than f o r m o s t proteins ( G r o m i h a et al, J e a n t e u r et al,  1997; G r o m i h a & P o n n u s w a m y , 1993; H a n c o c k , 1987; H a n c o c k , 1997; 1991; V o g e l & Jahnig, 1986). These m o d e l s c a n then b e v e r i f i e d b y a variety o f  g e n e t i c m e t h o d s a i m e d at i d e n t i f y i n g t h e m e m b r a n e s p a n n i n g a n d s u r f a c e e x p o s e d r e g i o n s o f the native p r o t e i n b y epitope insertion, proteolytic degradation studies a n d p r o b i n g w i t h m o n o c l o n a l antibodies. Several methods exist for predicting the structural topology o f p-barrel outer m e m b r a n e proteins. T h e m e t h o d o f P a u l & R o s e n b u s h (1990) is based o n i d e n t i f y i n g the p e r i p l a s m - f a c i n g l o o p r e g i o n s b y s e a r c h i n g f o r P - t u r n p r o m o t i n g a n d P - t u r n i n h i b i t i n g r e s i d u e s . V o g e l et al. (1986) designed amethod for identifying amphipathic transmembrane segments based o n p r i m a r y a m i n o a c i d c o m p o s i t i o n . L a s t l y , t h e m e t h o d o f G r o m i h a et al. ( 1 9 9 3 ) i s b a s e d o n n e i g h b o r i n g h y d r o p h o b i c i t i e s a n d other inferences f r o m a n a l y s i s o f the s o l v e d structures o f the c r y s t a l l i z e d p o r i n p r o t e i n s . N o n e o f the current p r e d i c t i o n m e t h o d s i s perfect, b u t t h e y serve as a g o o d s t a r t i n g p o i n t f o r the a p p l i c a t i o n o f g e n e t i c e x p e r i m e n t s d e s i g n e d t o test the t h e o r e t i c a l models. O n e p r i m a r y strategy used to probe them e m b r a n e t o p o l o g y o f p o r i n proteins is based o n e p i t o p e i n s e r t i o n s i n t o t h e p r o t e i n o f i n t e r e s t ( B o u g e s - B o c q u e t et al, B o s c h a n d T o m m a s s e n , 1 9 8 7 ; W o n g et al,  1 9 8 4 ; B o u l a i n et al, 1 9 8 6 ,  1993). I n general, m o s t epitopes are designed to b e  p e r m i s s i v e f o r the loop regions but n o n p e r m i s s i v e f o r insertion into the transmembrane core o f the p o r i n o f interest. T h u s insertion o f the epitope a l l o w s the d i s c r i m i n a t i o n o f l o o p versus transmembrane segments b a s e d o n whether the p o r i n protein i s p r o d u c e d .  Additionally,  17  specific antibodies ( i f available) directed against the inserted epitope c a n be u s e d to probe p e r m i s s i v e ( i . e . , i n s e r t i o n s that d o not affect p r o t e i n p r o d u c t i o n ) c l o n e s a n d t o i d e n t i f y surface e x p o s e d l o o p r e g i o n s o f t h e p o r i n b y i n d i r e c t i m m u n o f l u o r e s c e n c e ( W o n g et al., 1 9 9 3 ) .  D . Rationale for this w o r k H. pylori  i s d i f f i c u l t to treat w i t h a n t i b i o t i c s i n i n f e c t e d i n d i v i d u a l s w h i c h is i n contrast  to w h a t is o b s e r v e d i n the laboratory w h e r e  H. pylori  is v e r y s u s c e p t i b l e to m o s t a n t i b i o t i c s .  B a s e d o n t h i s o b s e r v a t i o n , I h y p o t h e s i z e d that c h a n g e s i n c e l l p e r m e a b i l i t y , as h a s b e e n observed i n m a n y other bacteria, m a y function i n sought to identify, u s i n g a b r o a d - b a s e d screen,  H. pylori  H. pylori  resistance to antibiotics. Therefore I  g e n e s that c o u l d p o t e n t i a l l y b e  i n v o l v e d i n this p h e n o t y p e (i.e. o u t e r m e m b r a n e p r o t e i n s a n d e f f l u x genes). genes, translational fusions o f  H. pylori  genes to a l k a l i n e p h o s p h a t a s e w e r e m a d e to i d e n t i f y  genes w h o s e products were secreted o r exported i n potential  H. pylori  T o identify such  E. coli.  T h e initial screen i d e n t i f i e d three  e f f l u x genes o f the bacterial r e s i s t a n c e - n o d u l a t i o n - d i v i s i o n f a m i l y . T h e  subsequent characterization o f these three e f f l u x systems b y m e alone a n d i n c o l l a b o r a t i o n w i t h A s t r a R e s e a r c h B o s t o n Inc. ( C a m b r i d g e , M A ) s u g g e s t e d that these e f f l u x s y s t e m s d o not f u n c t i o n i n the  in vitro  intrinsic resistance o f  H. pylori  to a n t i b i o t i c s .  P o r i n p r o t e i n s are i n v o l v e d i n the e x c h a n g e o f s m a l l h y d r o p h i l l i c c o m p o u n d s across the bacterial outer membrane.  A s a consequence o f this property, p o r i n proteins c a n affect cell  s u s c e p t i b i l i t y t o a n t i b i o t i c s . E x n e r et al. ( 1 9 9 5 ) p r e v i o u s l y d e s c r i b e d t h e H o p f a m i l y o f f i v e porin proteins i n  H. pylori  based on extensive N-terminal amino acid similarity. Porins found  a m o n g t h i s f a m i l y w e r e c l a s s i f i e d as g e n e r a l d i f f u s i o n p o r i n s a n d a r e t h e r e f o r e l i k e l y t o b e i n v o l v e d i n t h e u p t a k e o f a n t i b i o t i s b y H. pylori.  18  T h e H o p f a m i l y was further e x p a n d e d to i n c l u d e 3 2 p r o t e i n s c o n t a i n i n g e x t e n s i v e C t e r m i n a l a m i n o a c i d s i m i l a r i t y b y T o m b et al.  (1997). T h e s e q u e n c e c o n s e r v a t i o n a m o n g the  H o p f a m i l y w a s suggested to p o s s i b l y f u n c t i o n i n h o m o l o g o u s r e c o m b i n a t i o n to generate a n t i g e n i c d i v e r s i t y a n d / o r i n r e s p o n s e t o e n v i r o n m e n t a l c h a n g e s ( T o m b et al,  1 9 9 7 ; B e r g et  1997). H o w e v e r , c o m p a r a t i v e sequence a n a l y s i s o f the H o p f a m i l y genes i n t w o  al,  H. pylori  strains s u g g e s t e d that the c o n s e r v e d s e q u e n c e s do not f u n c t i o n i n r e c o m b i n a t i o n ( H a n c o c k , al  et  1998). T h e r e f o r e I p r o p o s e d a n d tested the h y p o t h e s i s that the c o n s e r v e d m o t i f s are part o f a  conserved structural motif.  T h e o v e r a l l r e s u l t s o f these e x p e r i m e n t s s u p p o r t the h y p o t h e s i s that  the c o n s e r v e d s e q u e n c e m o t i f s i n the H o p f a m i l y are part o f a c o n s e r v e d structural m o t i f . M A T E R I A L S I.  AND  M E T H O D S  Strains, plasmids and growth conditions S t r a i n s u s e d i n these studies are l i s t e d i n T a b l e I a n d a l l p l a s m i d s u s e d are l i s t e d i n T a b l e  II.  E. coli s t r a i n s  were routinely grown in L u r i a Bertani ( L B ) broth (1.0% Tryptone,  0.5%  yeast e x t r a c t , 0 . 5 % N a C l ) c o n t a i n i n g 0.5 % g l u c o s e ; f o r s o l i d m e d i a agar w a s a d d e d to (wt/vol).  X P agar w a s L B agar containing 90 p g / m l 5 - b r o m o - 4 - c h l o r o - 3 - i n d o l y l  XP-PO4 agar w a s X P agar containing 50 m M NaP04.  H. pylori s t r a i n s  phosphate;  were grown on  c h o c o l a t e b l o o d a g a r p l a t e s p u r c h a s e d from P r e p a r e d M e d i a L a b s ( R i c h m o n d , B C ) . i n f u s i o n b r o t h c o n t a i n i n g 0 . 1 % c y c l o d e x t r a n w a s u s e d for the g r o w t h o f  H. pylori i n  m e d i a c o m p o n e n t s w e r e p u r c h a s e d from D i f c o L a b o r a t o r i e s ( D e t r o i t , M I ) . used for  E. coli w h e n  1.4%  B r a i n heart broth.  All  Antibiotics were  r e q u i r e d at t h e f o l l o w i n g c o n c e n t r a t i o n s : a m p i c i l l i n , 1 0 0 p g / m l ;  c h l o r a m p h e n i c o l , 2 5 p g / m l ; t e t r a c y c l i n e , 15 p g / m l .  19  Table I  B a c t e r i a l strains.  Strain:  Relevant characteristics:  E. coli: DH5a  supEAA, /act/169 (<> | 80/acZM15), hsdR17, recAl, endAl,  Source/reference: gyrA96,  BRL  thi-1, relAl  DH5a-MCR BL21(DE3) JM110  F" mcrA A(mrr-hsdRMS-mcrBC)  BRL  dam, dcm, supEAA, thi, leu, rpsL, lacY, galK, galT, ara, tonA, thr,  Promega BRL  <(>80d/acZdM15 A{lacZYAargF)Ul69 endAl recAl deoR thil supEAA X-gyrA96 relAl hsdSgal (A,clts857 indl Sam7 nin5 Iacuv5-T7 gene 1) tsx (lac-proAB),  CC118 ER1793 JZMIOO JZM120 JZM130 WC1763 HN818 HN817 H. pylori: 11637 22695 J99 744 754  F'[traD36 proAB+ laclq lacZM15]  phoA  F- mcrA A(mrr-hsdRMS-mcrBC) X-gyrA96 relAl WC1763, AacrBv. Tn903kan WC1763, AacrAB:: Tn903kan  endAl recAl deoR  thil supE44  r  r  WC1763,  acrA::Tn903kan  r  wildtype DH5a AacrAB DH5aacr5::Km Type strain Genome sequenced by TIGR Genome sequence licenced to Astra Metronidizole resistant clinical isolate Gyrase independent ciprofloxicin resistant clinical isolate  (Manoilef a/., 1990) NEB (Okusu etal., 1996) (Okusu etal., 1996)  (Okusu et al, 1996) (Okusu etal, 1996)  H. Nikado H. Nikado NCTC K. Eaton Astra (Moore etal, 1995a) (Moore etal, 1995b)  20  T a b l e II.  List of plasmids.  Plasmid:  Relevant charactistics:  Source/reference:  pGW25  p R K 4 0 4 c o n t a i n i n g the  Pseudomonas syringae p v . syringae oprF:\Tr\phoA  H a n c o c k lab  pLAPR3  Broad-host-range cosmid, tet  strain ( S t a s k a w i c z et  k  al, pBBRlMCS  Broad-host-range cloning vector, C m  pT7-7  T 7 R N A polymerase-promoter expression vector,  1987)  ( K o v a c h et al.,  K  1994) Amp  k  (Studier & Moffatt,  pDJTl-3  U s e d f o r t r a n s l a t i o n a l f u s i o n s to a l k a l i n e p h o s p h a t a s e . T h r e e separate vectors each c o n t a i n i n g a unique  BamHI  1986)  ( M d l u l i et al, 1995)  r e s t r i c t i o n site u p s t r e a m a n d i n a different r e a d i n g f r a m e  'phoA. A m p Helicobacter pylori phoA f u s i o n s ( t a b l e x ) h e f B C c l o n e d i n t o t h e EcoRI-EcoRV s i t e o f p B l u e s c r i p t h e f C c l o n e d i n t o t h e EcoRI-EcoRV s i t e o f p B l u e s c r i p t h e f B C c l o n e d i n t o t h e EcoRI-EcoRV s i t e o f p B B R l M C S h e f C c l o n e d i n t o t h e EcoRI-EcoRY s i t e o f p B B R l M C S relative to  pHPAPl-233 pBSl pBS2 pMCSl pMCS2  R  p200:4  p L A F R 3 l i b r a r y c l o n e c o n t a i n i n g t h e hemE-hefABC o p e r o n  pJl  pBluescript containing  hopE  c l o n e d into the  EcoRV  This study T h i s study T h i s study T h i s study T h i s study T h i s study  site a n d  T h i s study  is c l o n e d i n the reverse o r i e n t a t i o n  This study  i n t h e s a m e o r i e n t a t i o n as t h e lac p r o m o t e r . pJ3  S a m e as p J l e x c e p t  pJ5  p J l w i t h R S K D V inserted into H o p E after a m i n o a c i d 155  pJ6  p J l w i t h R S K D V inserted into H o p E after a m i n o a c i d 2 6 0  pJlO  p J l w i t h R S K D V inserted into H o p E after a m i n o a c i d 89  pJ12  p J l w i t h R S K D V inserted into H o p E after a m i n o a c i d 2 1 7  hopE  r e l a t i v e t o t h e lac p r o m o t e r .  U s e d for a negative control. This study  (between N D i n loop 5) This study  (between K R i n loop 8) T h i s study  (between G L in T M 5) This study  (between W L i n T M 12) pJ14  p J l w i t h a four a m i n o a c i d deletion i n H o p E loop 8 a n d the concomitant insertion o f R S K D V  pJ18  This study  (A262-265::RSKDV)  p J l w i t h R S K D V inserted into H o p E after a m i n o a c i d 2 9  This study  ( b e t w e e n Y I i n T M 1) pJ20  p J l w i t h R S K D V inserted into H o p E after a m i n o a c i d 2 6 5  T h i s study  (between Y L i n loop 8) pJ21  p J l w i t h R S K D V inserted into H o p E after a m i n o a c i d 2 0 2  pJ63  p J l w i t h R S K D V inserted into H o p E after a m i n o a c i d 9 7  T h i s study  (between N A in loop 6 This study  (between F F in loop 3  21  II. Reagents C h e m i c a l r e a g e n t s u s e d i n t h i s s t u d y w e r e p u r c h a s e d from S i g m a C h e m i c a l C o m p a n y (St.  Louis, MO).  R e s t r i c t i o n enzymes, polymerases and other m o l e c u l a r b i o l o g y reagents w e r e  p u r c h a s e d from G i b c o B R L ( B u r l i n g t o n , O N ) .  A l l e n z y m e s w e r e u s e d as d e s c r i b e d i n t h e  m a n u f a c t u r e r ' s i n s t r u c t i o n s . ^ - C h l o r a m p h e n i c o l (1 m C i / m l , 3 0 - 6 0 C i / m m o l ) a n d  3  H-  t e t r a c y c l i n e (1 m C i / m l , 0 . 7 7 C i / m m o l ) w e r e p u r c h a s e d f r o m D u P o n t N E N ( B o s t o n , M A ) ;  3 2  P-  labelled A T P ( l O m C i / m l , - 3 0 0 0 C i / m m o l ) was purchased from A m e r s h a m (Oakville, ON). Rabbit anti-HopE polyclonal antibody (Vac38) was provided by Dr. R. A i m (Astra Research Inc., C a m b r i d g e , M A ) .  A l k a l i n e phosphatase conjugated donkey anti-rabbit antibody was  p u r c h a s e d from P r o m e g a ( M a d i s o n ,  WI).  III. Genetic manipulations G e n e r a l m o l e c u l a r b i o l o g y p r o t o c o l s w e r e p e r f o r m e d a c c o r d i n g to standard m e t h o d s d e s c r i b e d i n S a m b r o o k et al. ( 1 9 8 9 ) . D N A f r a g m e n t s w e r e i s o l a t e d u s i n g t h e G e n e C l e a n k i t ( B i o l O l Inc., V i s t a , C A ) .  S t i c k y e n d l i g a t i o n s w e r e p e r f o r m e d at R T f o r 3 0 - 6 0 m i n ; b l u n t e n d  l i g a t i o n s w e r e d o n e o v e r n i g h t i n a t h e r m o c y c l e r p r o g r a m m e d to c o n t i n u o u s l y c y c l e b e t w e e n 10°C  a n d 3 0 ° C f o r 3 0 s e c at e a c h t e m p e r a t u r e .  IV. DNA sequencing D N A sequencing w a s done o n an A B I 373 automated D N A sequencer ( A p p l i e d B i o s y s t e m s , F o s t e r C i t y , C A ) u s i n g the A B I P r i s m d y e t e r m i n a t o r s e q u e n c i n g k i t a c c o r d i n g to the m a n u f a c t u r e r ' s directions. P l a s m i d D N A w a s prepared for s e q u e n c i n g u s i n g Q i a g e n c o l u m n s (Qiagen, Inc., Chatsworth, C A ) and p l a s m i d D N A w a s quantified using a H o e f e r  TKO  1 0 0 m i n i s p e c t r o f l u o r i m e t e r . O l i g o n u c l e o t i d e s e q u e n c i n g p r i m e r s w e r e s y n t h e s i z e d as n e e d e d o n an A B I 3 9 2 D N A / R N A o l i g o n u c l e o t i d e synthesizer a c c o r d i n g to the m a n u f a c t u r e r ' s  22  directions.  O l i g o n u c l e o t i d e p r i m e r s w e r e p u r i f i e d a s f o l l o w s : f o l l o w i n g d e p r o t e c t i o n f o r 8 h at  5 5 ° C , t h e o l i g o n u c l e o t i d e s w e r e l y o p h i l i z e d a n d r e s u s p e n d e d i n 5 0 0 u.1 d e i o n i z e d w a t e r . T h e r e s u s p e n d e d o l i g o n u c l e o t i d e w a s c e n t r i f u g e d f o r 5 m i n at m a x i m u m s p e e d ( - 1 0 , 0 0 0 x g ) i n a m i c r o c e n t r i f u g e to r e m o v e i n s o l u b l e m a t e r i a l a n d the supernatant w a s retained. T h e c o n c e n t r a t i o n o f o l i g o n u c l e o t i d e w a s d e t e r m i n e d b y m e a s u r i n g the a b s o r b a n c e at 2 6 0 n m .  V. Protein analysis A n a l y s i s o f protein profiles was done b y electrophoresis through S D S 1 2 % p o l y a c r y l a m i d e gels ( P A G E ) ( M u t h a r i a & H a n c o c k , 1983). Proteins were solubilized i n sample b u f f e r ( 0 . 5 M T r i s - H C l b u f f e r , p H 6 . 8 , c o n t a i n i n g 2 % S D S , 1 0 % g l y c e r o l , 5 % Pmercaptoethanol and  0 . 1 % b r o m o p h e n o l b l u e ) f o r e i t h e r 1 0 m i n at 9 8 ° C o r 2 0 m i n a t 3 7 ° C  before b e i n g a p p l i e d t o the gel. F o l l o w i n g electrophoresis proteins w e r e v i s u a l i z e d b y s t a i n i n g with Coomassie Brilliant Blue R250 (Bio-Rad, Richmond, C A ) .  Immunoblotting procedures  were p e r f o r m e d as described p r e v i o u s l y ( M u t h a r i a & H a n c o c k , 1983). V a c 3 8 antibody w a s u s e d at a 1 : 5 0 0 0 d i l u t i o n f o r W e s t e r n  immunoblotting.  P r o t e i n c o n c e n t r a t i o n s w e r e d e t e r m i n e d u s i n g the b i c i n c h o n i n i c assay a c c o r d i n g to the manufacturer's directions (Sigma, St. L o u i s , M O ) .  VI. Construction of a Helicobacterpylorfr ^ ^^ 2  3  B S A w a s used as a standard.  phosphatase fusion library  H. pylori 1 1 6 3 7 c h r o m o s o m a l D N A w a s p a r t i a l l y r e s t r i c t e d w i t h r e s t r i c t i o n e n z y m e Sau3A1  and size fractionated o n a continuous 1 0 - 4 0 % sucrose gradient.  fragments o f approximately 2 k b i n size were ligated into  D N A restriction  BamHI d i g e s t e d a n d p h o s p h a t a s e d  p J D T l , p J D T 2 , and p J D T 3 ( F i g u r e 3). T h el i g a t i o n reactions w e r e u s e d f o r the transformation o f either  E. coli E R 1 7 9 3 o r E. coli C C 1 1 8 . A l k a l i n e p h o s p h a t a s e e x p r e s s i n g t r a n s f o r m a n t s  w e r e i d e n t i f i e d o n X P - P O 4 agar.  T h ealkaline phosphatase expressing clones were screened for  23  D N A inserts b y  BamHI r e s t r i c t i o n e n z y m e  digestion a n d clones c o n t a i n i n g inserts w e r e further  screened b y D N A sequencing.  VII. Inhibition of endogenous alkaline phosphatase activity in Escherichia coli ER1793 T h e c o n c e n t r a t i o n o f p h o s p h a t e i n the g r o w t h m e d i a that w a s r e q u i r e d to c o m p l e t e l y inhibit the b a c k g r o u n d ( c h r o m o s o m a l l y encoded) phosphatase activity i n determined b y plating  E. coli  E. coli  ER1793 was  E R 1 7 9 3 and E R 1 7 9 3 / p G W 2 5 onto X P agar containing 0, 25, 5 0  o r 1 0 0 m M NaPC>4 ( p H 7 . 2 ) . T h e r e s u l t i n g b a c t e r i a l c o l o n i e s w e r e e x a m i n e d f o l l o w i n g i n c u b a t i o n f o r 2 4 h at 37°C f o r t h e e x p r e s s i o n o f p h o s p h a t a s e a c t i v i t y .  VIII. The effect of 50 m M N a P 0 in X P agar on the detection sensitivity for alkaline 4  phosphatase. T h e i n h i b i t o r y effect o f the excess phosphate i n X P agar o n the detection sensitivity f o r alkaline phosphatase i n m y screening method w a s determined i n the f o l l o w i n g w a y . A serial 2 f o l d d i l u t i o n o f bacterial a l k a l i n e phosphatase w a s m a d e i n 5 0 m M T r i s - H C l ( p H 8.5), 1 m M E D T A a n d 2 u.L a l i q u o t s f r o m e a c h d i l u t i o n w a s spotted onto the s u r f a c e o f b o t h X P - P O 4 a n d X P agar.  F o l l o w i n g a n 18 h i n c u b a t i o n at 37°C t h e p l a t e s w e r e e x a m i n e d a n d t h e h i g h e s t  d i l u t i o n o f a l k a l i n e p h o s p h a t a s e that p r o d u c e d a v i s i b l e b l u e c o l o r o n the s u r f a c e o f the agar w a s recorded.  24  F i g u r e 3.  Schematic o f plasmids p D J T l , p D J T 2 and p D J T 3 .  translational f u s i o n o f genes to a s i g n a l sequence-deficient  ('phoA).  E.  T h e s e p l a s m i d vectors a l l o w the  coli  alkaline phosphatase  gene  T h e a l k a l i n e phosphatase e n z y m e is o n l y active w h e n transported across the  c y t o p l a s m i c m e m b r a n e a n d therefore facilitates the i d e n t i f i c a t i o n o f secreted a n d e x p o r t e d proteins.  BamHI r e s t r i c t i o n s i t e u p s t r e a m o f phoA i n e a c h o f t h e t h r e e v e c t o r s . T h e  The vectors contain a unique  different reading  frame  relative to  a  'phoA w h i c h  is i n a  c o n s t r u c t i o n o f these  v e c t o r s i s d e s c r i b e d i n M d l u l i et al. ( 1 9 9 6 ) .  25  IX. DNA sequencing and analysis of //^/^/-alkaline phosphatase fusion clones The  H.  'phoA  ^ v / o n ' - a l k a l i n e phosphatase fusion clones were sequenced u s i n g the  oligonucleotide primer.  T h i s p r i m e r w a s c o m p l e m e n t a r y to the  a p p r o x i m a t e l y 3 0 b p u p s t r e a m o f the u n i q u e a n d d i r e c t e d s e q u e n c i n g across the  BamHI  BamHI  phoA  D N A sequence located  site i n p l a s m i d s p J D T l , p J D T 2 a n d p J D T 3 ,  f u s i o n j u n c t i o n and into the inserted  H. pylori  DNA.  T h e resulting D N A sequences w e r e u s e d for h o m o l o g y searches o f the N a t i o n a l C e n t e r f o r B i o t e c h n o l o g y Investigation ( N C B I ) n o n - r e d u n d a n t database w i t h the B L A S T X p r o g r a m (www.ncbi.nlm.nih.gov/cgi-bin/BLAST/).  T h e default settings f o r the B L A S T X p r o g r a m w e r e  used f o r a l l the searches.  X. Cloning of the hefABC operon T h e D N A insert f r o m  H. pylori  a l k a l i n e phosphatase f u s i o n c l o n e 2 0 0 ( T a b l e I) w a s  u s e d a s a h y b r i d i z a t i o n p r o b e t o s u b c l o n e t h e c o r r e s p o n d i n g l o c u s from a H. g e n o m i c l i b r a r y that w a s c o n s t r u c t e d i n the c o s m i d p L A F R 3 . to the probe. p r o b e from  pylori  11637  Several library clones hybridized  R e s t r i c t i o n m a p p i n g i n c o n j u n c t i o n w i t h h y b r i d i z a t i o n experiments u s i n g the  H. pylori  a l k a l i n e p h o s p h a t a s e f u s i o n c l o n e 2 0 0 i d e n t i f i e d c o s m i d c l o n e p 2 0 0 : 4 as  c o n t a i n i n g the entire  hefABC  D N A sequencing of  hefABC.  locus.  C o s m i d p200:4 was subsequently used for subcloning and  XI. DNA sequencing of the fABC ° P  e r o n  ne  The D N A  sequence o f the  hefABC  operon o f  H. pylori  11637 w a s generated b y shotgun  sequencing o f r a n d o m subclones o f c o s m i d clone 200:4 w h i c h contained the system.  C o s m i d p200:4 was partially restricted w i t h  Sau3A\  hefABC  efflux  r e s t r i c t i o n e n z y m e a n d the  resulting D N A w a s size fractionated o n a n agarose gel. Restriction fragments o f approximately 2-3 k b i n length were purified and ligated into  BamHI  -digested p B l u e s c r i p t . T h e resultant  26  r e c o m b i n a n t c l o n e s w e r e s c r e e n e d i n h y b r i d i z a t i o n e x p e r i m e n t s u s i n g t h e D N A i n s e r t f r o m H.  pylori  a l k a l i n e p h o s p h a t a s e f u s i o n c l o n e 2 0 0 as a p r o b e .  T h e c l o n e s that reacted p o s i t i v e l y w i t h  the probe w e r e sequenced w i t h the u n i v e r s a l reverse and f o r w a r d primers. s e q u e n c e g a p s w e r e f i l l e d i n b y p r i m e r w a l k i n g u s i n g p 2 0 0 : 4 as a t e m p l a t e .  The remaining  DNA  Sequence assembly  w a s f a c i l i t a t e d b y the use o f the C o n t i g A l i g n m e n t P r o g r a m ( H u a n g , 1992). T h e r e s u l t i n g sequences c o v e r e d the o f the  hefABC  hefABC  o p e r o n at l e a s t t w i c e o n e a c h D N A s t r a n d . T h e D N A  DNA  sequence  o p e r o n w a s assigned the G e n B a n k a c c e s s i o n n u m b e r A F 0 5 9 0 4 1 .  XII. Uptake of H-tetracycline, H-chloramphenicol and 1-N-phenylnapthylamine. 3  T w o day cultures  3  ofH. pylori  11637, g r o w n o n chocolate b l o o d agar plates were  r e s u s p e n d e d i n P B S , w a s h e d o n c e i n 5 m M H E P E S buffer p H 7.2 c o n t a i n i n g 10 u M M g C l  2  and  r e s u s p e n d e d at a n OD600 o f 0 . 5 i n 5 m M g l u c o s e , 5 m M H E P E S b u f f e r at e i t h e r p H 4 , p H 7 . 2 o r p H 9 ; the c e l l suspension w a s aliquoted and used i m m e d i a t e l y i n the uptake assays. C a r b o n s o u r c e s w e r e a d d e d w h e n n e e d e d at a f i n a l c o n c e n t r a t i o n o f 0 . 4 % ( a c e t a t e , citrate, ethanol, fructose, gluconate, g l u c o s e , g l y c e r o l , lactose, maltose, m a n n i t o l , mannose, p r o p i o n a t e , s u c c i n a t e a n d sucrose) o r 0 . 2 % (alanine, g l y c i n e , h i s t i d i n e a n d p r o l i n e ) a n d the r e s u l t i n g c e l l s u s p e n s i o n w a s i n c u b a t e d at 3 7 ° C f o r 2 0 m i n p r i o r t o a s s a y i n i t i a t i o n . required carbonylcyanide m-chlorophenylhydrazone  When  ( C C C P ) w a s a d d e d to a f i n a l c o n c e n t r a t i o n  o f 4 0 u . M , 15 m i n p r i o r t o a s s a y i n i t i a t i o n . T h e a n t i b i o t i c u p t a k e assays w e r e i n i t i a t e d b y the a d d i t i o n o f a p p r o x i m a t e l y 3 u.Ci o f r a d i o l a b e l e d a n t i b i o t i c t o a 5 0 0 p.1 s u s p e n s i o n o f t h e c e l l s .  A t various time points, 100 u l  a l i q u o t s w e r e r e m o v e d f r o m the r e a c t i o n a n d a d d e d to 2 m l o f 1 0 0 m M L i C l a n d the c e l l s w e r e v a c u u m - f i l t e r e d onto a 0.2 u m filter. T h e filter w a s w a s h e d t w i c e w i t h 2 m l o f 100 m M  LiCl,  27  dried and the a m o u n t o f r a d i o a c t i v i t y o n the filter w a s determined b y scintillation counting. A n t i b i o t i c u p t a k e a s s a y s w e r e p e r f o r m e d at 2 5 ° C . The 1-N-phenylnapthylamine previously (Loh  et al,  ( N P N ) u p t a k e a s s a y s w e r e p e r f o r m e d as d e s c r i b e d  1984). B r i e f l y , 1 m l o f the  H. pylori  cell suspension was placed in a  quartz c u v e t t e a n d N P N w a s a d d e d to a f i n a l c o n c e n t r a t i o n o f 10 p M .  The cell suspension was  b r i e f l y m i x e d b y i n v e r s i o n a n d p l a c e d into a spectrofluorimeter to determine the b a c k g r o u n d l e v e l o f fluorescence. S u b s e q u e n t l y p o l y m y x i n B w a s added to the cuvette, the contents o f the cuvette w e r e b r i e f l y m i x e d a n d p l a c e d b a c k into the f l u o r i m e t e r a n d the c h a n g e i n f l u o r e s c e n c e over time w a s recorded o n a chart recorder.  The fluorescence measurements were done on a  P e r k i n - E l m e r 6 5 0 - 1 0 S s p e c t r o f l u o r i m e t e r at r o o m t e m p e r a t u r e w i t h a n e x c i t a t i o n w a v e l e n g t h o f 3 5 0 n m , a n e m i s s i o n w a v e l e n g t h o f 4 2 0 n m a n d a s l i t w i d t h o f 5. XIV.  D N A and protein sequence analysis P a i r w i s e s e q u e n c e a l i g n m e n t s w e r e p e r f o r m e d u s i n g t h e A L I G N p r o g r a m at t h e  Genestream Search network server (genome.eerie.fr/bin/align-guess.cgi, Montpellier, France). P h y l o g e n e t i c analysis w a s d o n e w i t h the P H Y L I P p h y l o g e n y inference p a c k a g e (Felsenstein, J . 1993.  D i s t r i b u t e d b y the author.  D e p a r t m e n t o f G e n e t i c s , U n i v e r s i t y o f W a s h i n g t o n , Seattle).  P h y l o g e n e t i c trees w e r e c o n s t r u c t e d u s i n g the nearest n e i g h b o r distance m a t r i x . alignments w e r e d o n e u s i n g the M a c a w c o m p u t e r p r o g r a m (distributed b y N C B I , D C , www.ncbi.nlm.nih.gov).  The  a  n  d  Washington  M u l t i p l e sequence alignments w e r e m a d e w i t h the C l u s t a l W  ( v l . 7 ) p r o g r a m ( T h o m p s o n et al,  X V . C l o n i n g oi hefBC  BLOCKS  1994).  hefC  hefBC a n d hefC g e n e s  w e r e c l o n e d into the h i g h - c o p y - n u m b e r  p B l u e s c r i p t a n d the m e d i u m - c o p y - n u m b e r  vector p B B R l M C S .  phagemid  Primers P I and P 2 were  28  5'-BamHl  designed with a unique pBBRlMCS.  restriction site to facilitate c l o n i n g into p B l u e s c r i p t and  T h e d o w n s t r e a m p r i m e r , P 3 , c o n t a i n e d a u n i q u e . E c o R V r e s t r i c t i o n site. F o r  c l o n i n g into p B l u e s c r i p t and p B B R l M C S the  hefBC a n d hefC g e n e s  were amplified b y P C R  f r o m c o s m i d p 2 0 0 : 4 u s i n g P C R p r i m e r sets P 1 / P 3 a n d P 2 / P 3 r e s p e c t i v e l y .  Following  a m p l i f i c a t i o n t h e p u r i f i e d P C R a m p l i c o n w a s d i g e s t e d u s i n g r e s t r i c t i o n e n d o n u c l e a s e s BamHI and  EcoKV  {hefBC), XVI.  and cloned into similarly digested pBluescript and p B B R l M C S resulting i n p B S l  pBS2  (hefC),  (hefBC)  pMCSl  Complementation of  K  c  o  U a  c  r  B  and p M C S 2 and  a  c  r  A  B  (hefC),  respectively.  mutants with  fBQ  a  n  d  ne  hefC  C o s m i d 200:4 and plasmids B S 1 , B S 2 , M C S 1 and M C S 2 were transformed into the following  E. coli s t r a i n s :  D H 5 a W C 1 7 6 3 , J Z M 1 0 0 , J Z M 1 2 0 , J Z M 1 3 0 , FTN818 and FTN817.  T h e resultant strains w e r e used i n m i n i m u m inhibitory concentration experiments to determine the effect o f the p r e s e n c e o f e a c h o f these p l a s m i d s o n the s u s c e p t i b i l i t y o f the r e s u l t i n g strains to a n t i m i c r o b i a l c o m p o u n d s .  T e s t e d c o m p o u n d s i n c l u d e d the f o l l o w i n g : a m p i c i l l i n ,  a z i t h r o m y c i n , C C C P , c h l o r o a m p h e n i c o l , c i p r o f l o x i c i n , c l a r i t h r o m y c i n , C0CI2, crystal violet, erythromycin, gentamycin, kanamycin, metronidizole, neomycin, M O 2 , S D S , tetracycline and Triton X-100.  T h e M I C s w e r e done i n L B broth plus and m i n u s 100 m M I P T G .  C o n t r o l strains  contained the p l a s m i d and c o s m i d vectors. XVI.  Cloning of  The  hopE  h  o  p  E  gene w a s a m p l i f i e d f r o m the c h r o m o s o m e o f  H. pylori u s i n g  primers F 2 and  F 0 a n d b l u n t e n d c l o n e d into the . E c o R V site o f p B l u e s c r i p t . T h e ends o f the F 2 / F 0 D N A a m p l i c o n were m a d e blunt b y incubation w i t h K l e n o w D N Apolymerase, and this a m p l i c o n w a s t h e n l i g a t e d i n t o t h e . E c o R V s i t e o f p B l u e s c r i p t . T h e l i g a t i o n p r o d u c t s w e r e t r a n s f o r m e d i n t o E.  coli  JM110.  T h e resulting transformants were screened b y restriction analysis. Plasmids J l a n d  29  J 3 w e r e i d e n t i f i e d as c o n t a i n i n g the r e l a t i v e t o t h e lac p r o m o t e r .  hopE  gene i n the s a m e ( p J l ) a n d reverse o r i e n t a t i o n (pJ3)  P l a s m i d J l w a s s e q u e n c e d o n b o t h strands t o c o n f i r m that there  w e r e n o errors i n the D N A sequence. Primers F 3 and F O were used to clone digested w i t h  EcoRI  and  Ndel  hopE  into p T 7 - 7 .  The F3/F0 amplicon was  restriction enzymes and ligated into similarly digested pT7-7.  T h e ligation products were transformed into  E. coli  JM110.  The resulting transformants were  s c r e e n e d b y r e s t r i c t i o n a n a l y s i s . P l a s m i d J 2 6 w a s i d e n t i f i e d as c o n t a i n i n g the the sequence i n t e g r i t y o f  hopE  hopE  gene and  i n this p l a s m i d w a s c o n f i r m e d b y D N A sequencing.  XVII. Protein expression Expression of culture o f  E. coli  hopE  JM110  i n r e c o m b i n a n t c l o n e s w a s p e r f o r m e d as f o l l o w s . A n o v e r n i g h t  (E. coli  B L 2 1 ( D E 3 ) for pJ26) c o n t a i n i n g the s p e c i f i e d p l a s m i d s and  g r o w n at 37°C i n L B b r o t h p l u s 0 . 5 % g l u c o s e w a s u s e d t o i n o c u l a t e a f r e s h c u l t u r e o f L B w i t h o u t g l u c o s e . T h e c u l t u r e w a s i n c u b a t e d o n a r o t a r y s h a k e r at 3 7 ° C . E x p r e s s i o n o f  broth  hopE  w a s i n d u c e d w h e n t h e c u l t u r e r e a c h e d a n OD600 o f a p p r o x i m a t e l y 0 . 6 b y t h e a d d i t i o n o f I P T G t o a final concentration o f 100 u M . T h e cells w e r e u s u a l l y harvested 3 - 4 h after i n d u c t i o n .  XVIII. Construction of p£ nQ  insertion mutants  P C R primers (Table III)w e r e designed to insert i n frame five a m i n o acids a n d t w o u n i q u e r e s t r i c t i o n e n z y m e sites into  hopE  (RSKDV)  ( F i g u r e 4 ) , u s i n g p J l as t h e t e m p l a t e  DNA.  The P C R amplification was performed with Taq D N Apolymerase using a touchdown a m p l i f i c a t i o n procedure as f o l l o w s . T h e P C R thermocycler w a s p r o g r a m m e d f o r a n initial d e n a t u r a t i o n step o f 96°C f o r 4 m i n f o l l o w e d b y 18 c y c l e s u s i n g a n i n i t i a l a n n e a l i n g t e m p e r a t u r e o f 6 5 ° C ( f o r 9 0 s e c ) w h i c h w a s d e c r e a s e d b y 0.5°C e a c h s u c c e s s i v e c y c l e , a n e x t e n s i o n at 72°C f o r 6 m i n a n d d e n a t u r a t i o n at 96°C f o r 1 m i n .  Subsequent to completion o f  30  the first 18 c y c l e s , a n a d d i t i o n a l 14 a m p l i f i c a t i o n c y c l e s w e r e p e r f o r m e d u s i n g 72°C e x t e n s i o n a n d 96°C d e n a t u r a t i o n steps w i t h a constant 55°C a n n e a l i n g temperature.  The resulting  amplicon was extracted w i t h phenol and chloroform, precipitated w i t h ethanol and made blunt b y digestion w i t h the K l e n o w fragment o f D N A polymerase.  Dpnl  with  coli  The P C R products were digested  restriction e n z y m e to r e m o v e the template D N A , religated and transformed into  E.  J M 1 1 0 . R e c o m b i n a n t c l o n e s w e r e i d e n t i f i e d b y u s i n g o l i g o n u c l e o t i d e p r i m e r n u m b e r 10  plus the reverse p r i m e r i n P C R a m p l i f i c a t i o n reactions. Identified c l o n e s w e r e sequenced to v e r i f y t h a t t h e i n s e r t e d a m i n o a c i d s w e r e i n frame a n d t h a t n o e r r o r s w e r e i n t r o d u c e d i n t o t h e  hopE  gene.  XIX.  Structural prediction of H o p E T h e p r o p o s e d structural m o d e l f o r H o p E w a s constructed u s i n g the c o n f o r m a t i o n a l  p a r a m e t e r s a n d a l g o r i t h m o f G r o m i h a et al. ( 1 9 9 7 ) .  31  T a b l e III.  Oligonucleotide primers used.  PRIMER: ' phoA hell hel2 hel3 hel4 E9 FO F2 F3 F4 F5 F6 G2 G3 G4 G5 G6 G7 G8 G9 HO HI H2 H3 H4 H5 H6 H7 H8 H9 10 11 12 PI P2 P3 SK KS UNI REV  DNA Sequence: ATCACCCGTTAAACGGCGAGCAC CTAGCCCTGAAGAAATGGAAAACAACATCG CCTTGCCATGTCATTAAAATCCG TCAAATCCAGCGTGATGTAGTAGCCG ATTTATCCCCCAAATCAATGAAGGGG TTGGATCCACATTAGGCTTACCCACT CCGAATTCTAAAGGCATGAACGCTTGCA AAGGATCCGATAGGAATGTAAAGGAATGG TAAAGGAATGGAACATATGAAAAAG GGACAAGCCCGTTTGAATAG GGCATGCCACTTTAGGCAAG GCACCAAAACTTCAACCGTC GTTCTTTCGCTTATCAGGACCCTTAGCTTCAATGATTTG GCGAATCCGAATGTTTGTACCCCTACTTATTGTAACCCT AGGACGTCGATAACGCTTCTTTTGGTATTTTTGGT T AGAT CT GT T AT C AAT AAT AT C AGCT AAC AAAT C AGGACGTCCGGGATTATTCGCTTTATTTAGGTTAT TAGATCTTTTCAATTGTTAATAAAGATTAGTAGC AGGACGTACTAGGGACTAATTATCAGCTTGGACAA TAGATCTATAAACACCATCACCTTCGGCTAACAA AGGACGTCTTGAATGTGGGTTATAAGAAGTTCTTC TAGATCTCCCAAGACCATTCAAAGCCCCATTAGC AGGACGTCTTGAATTTTGGGGTGAGAGCCAATATT TAGATCTCCATACCTGAAAAGCGACGGTTGAAGT AGGACGTCTATTTAGGGTATAACTACACTTTTTAA TAGATCTCCGTTTCAAATGGTAATAAAGATTAGT AGGACGTCTTCTTCCAGTTCAAGTCTTTTGATATG • TAGATCTCTTCTTATAACCCACATTCAACCCAAG AGGACGTCGCTCCTTATAGCACCAAAACTTCAACC TAGATCTGTTACAATAAGTAGGGGTACAGTTAGG AGATCTAAGGACGTC AGGACGTCAAGCATAATCCAGGAGGCACCAAT TAGATCTATTAGCGGTAAGACCTGGGGGGCA GGAATTCCATATGTGCATTAAGGGAGTGGAAATGAT GGAATTCCATATGTATAAAACAGCGATTAATCGTC AAGATATCAAGCCCGCCCATAAAGCCAA CCGCTCTAGAACTAGTGGATC CCCTCGAGGTCGACGGTATC TGTAAAACGACGGCCAGT CAGGAAACAGCTATGACC  l  hopE  I I  P2*  1. Amplify with Taq DNA polymerase  "pJT  hopE  hopE  2. Treat with Klenow DNA polymerase 3. Religate 4. Digest withOpnl restriction enzyme 5. Electroporate intof. co//JM110 6. Verify insertions by DNA sequencing  RSKDV Bga  pJT  F i g u r e 4. M e t h o d f o r t h e i n s e r t i o n a l m u t a g e n e s i s o f  hopE g e n e i n p l a s m i d J l . B a c k - t o - b a c k  P C R p r i m e r s ( l a b e l l e d P I a n d P 2 a b o v e ) c o n t a i n i n g a 5' t a i l c o d i n g f o r t h e a m i n o a c i d s R S K D V a n d t w o u n i q u e r e s t r i c t i o n sites  (BgRl a n d Aatll) w e r e d e s i g n e d t o s i t e s p e c i f i c a l l y i n s e r t t h e s e hopE g e n e . T h e s e l e c t e d a m i n o a c i d s w e r e  a m i n o acids ( R S K D V ) into v a r i o u s sites i n the  c h o s e n f o r mutagenesis because o f their propensity f o r d i s r u p t i o n o f the transmembrane s p a n n i n g d o m a i n s o f b a c t e r i a l outer m e m b r a n e P-barrel proteins. F o l l o w i n g P C R a m p l i f i c a t i o n and treatment o f the D N A ends w i t h the K l e n o w fragment o f D N A p o l y m e r a s e , the product c o n t a i n i n g the inserted sequence w a s religated to g i v e the r e c o m b i n a n t p l a s m i d .  Contaminating  p J l w a s r e m o v e d b y digestion w i t h the m e t h y l a t e d - D N A specific to t r a n s f o r m a t i o n o f  Dpnl r e s t r i c t i o n e n z y m e p r i o r E. coli J M 1 1 0 w i t h t h e l i g a t i o n p r o d u c t s . T h e r e s u l t i n g r e c o m b i n a n t  c l o n e s w e r e v e r i f i e d b y D N A s e q u e n c i n g to m a k e sure that t h e i n s e r t i o n d i d n o t d i s r u p t t h e reading frame o f  hopE a n d t h a t t h e r e w e r e n o o t h e r m u t a t i o n s i n t r o d u c e d i n t o t h e hopE g e n e .  33  RESULTS Chapter 1. Use of alkaline phosphatase fusions to identify secreted proteins, including potential efflux proteins and virulence factors from Helicobacter pylori 1.0 Introduction C u r r e n t l y s e v e r a l b a c t e r i a l c h r o m o s o m e s h a v e b e e n f u l l y o r s u b s t a n t i a l l y s e q u e n c e d (see www.tigr.org/tdb/mdb/mdb.html).  O n e interest i n a n a l y z i n g the g e n o m e s o f these o r g a n i s m s i s  t o i d e n t i f y g e n e s o f t h e r a p e u t i c i n t e r e s t s u c h as v i r u l e n c e f a c t o r s , v a c c i n e c a n d i d a t e s a n d n o v e l d r u g targets. A c o m p l e m e n t a r y strategy for the i d e n t i f i c a t i o n o f genes o f p o t e n t i a l therapeutic interest is to i d e n t i f y extracellular, surface associated or p e r i p l a s m i c proteins.  Since such  p r o t e i n s are m o r e a c c e s s i b l e to d r u g t h e r a p y t h a n are c y t o p l a s m i c p r o t e i n s . T r a n s l a t i o n a l fusions to a l k a l i n e phosphatase have b e e n s u c c e s s f u l l y u s e d for the identification o f extracellular, surface associated or periplasmic proteins i nseveral bacterial s y s t e m s ( D e r m a n & B e c k w i t h , 1995). H o w e v e r , the a p p l i c a t i o n o f g e n e f u s i o n t e c h n o l o g y to b a c t e r i a l s p e c i e s t h a t c o n t a i n u n d e f i n e d r e s t r i c t i o n a n d m o d i f i c a t i o n s y s t e m s , s u c h as i s m o r e d i f f i c u l t . A t t e m p t s at t r a d i t i o n a l have not been successful. identification o f  H. pylori  TnphoA  mutagenesis ( M a n o i l  et al,  H. pylori,  1990) o f  H. pylori  T h e r e f o r e I sought to adapt a r a p i d a n d s i m p l e s y s t e m for the secreted proteins i n a heterologous system.  a strategy for the identification o f secreted proteins f r o m  H. pylori  I n this chapter I describe  b a s e d o n g e n e f u s i o n s to  b a c t e r i a l a l k a l i n e p h o s p h a t a s e , a n e n z y m e that o n l y b e c o m e s a c t i v e after p a s s a g e a c r o s s the cytoplasmic  membrane.  T h e a p p r o a c h p r e s e n t e d h e r e w a s b a s e d o n a set o f p l a s m i d v e c t o r s t h a t a l l o w t h e translational f u s i o n o f genes to a s i g n a l sequence-deficient  (phoA)  (Mdluli  et al,  E. coli  alkaline phosphatase  gene  1995). E x p r e s s i o n o f alkaline phosphatase i n these vectors is dependent  34  u p o n the c l o n i n g o f an i n frame s i g n a l sequence upstream o f  'phoA.  In these v e c t o r s the  phoA  g e n e i s c l o n e d d o w n s t r e a m a n d i n t h e s a m e o r i e n t a t i o n as t h e lac p r o m o t e r , a l l o w i n g f o r h i g h l e v e l t r a n s c r i p t i o n o f genes that c o n t a i n w e a k p r o m o t e r s o r f o r the e x p r e s s i o n o f i n t e r n a l genes i n polycistronic operons.  E x p r e s s i o n o f alkaline phosphatase activity is detected o n solid  m e d i u m c o n t a i n i n g a c o l o r i m e t r i c i n d i c a t o r . T h i s s t u d y w a s c o m p l e t e d a n d p u b l i s h e d ( B i n a et  al, to  1997) p r i o r to the release o f the  H. pylori  p r i o r to the  H. pylori  H. pylori  genome sequence.  T h e a p p l i c a t i o n o f this strategy  g e n o m e release a l l o w e d the i d e n t i f i c a t i o n o f several n o v e l  t a r g e t s f o r d r u g i n t e r v e n t i o n a n d p o t e n t i a l v i r u l e n c e f a c t o r s . S u b s e q u e n t t o t h e r e l e a s e o f t h e H.  pylori  g e n o m e the results o f these e x p e r i m e n t s a l l o w e d the m a p p i n g a n d i d e n t i f i c a t i o n o f  numerous unique and previously undocumented secreted proteins i n  H. pylori.  1.1 Construction of a Helicobacter /ry/on-alkaline phosphatase fusion library Initial attempts to construct the deficient  E.  coli  pylori DNA; coli C C 1 1 8  ;?y/on'-alkaline phosphatase fusion library in  phoA  C C 118 p r o v e d to b e a p o o r r e c i p i e n t for  H.  r e c o m b i n a n t c l o n e s w e r e o b t a i n e d at l o w e f f i c i e n c y , p r o b a b l y a c o n s e q u e n c e o f  E.  restriction o f / / ,  the c l o n i n g o f  E. coli  C C 118 w e r e u n s u c c e s s f u l .  Subsequently,  the  H.  pylori  E. coli E R 1 7 9 3 , aphoA+  H. pylori DNA  H. pylori-alkaline  D N A (Phadnis  (Phadnis  et al,  NaP04  1994).  s t r a i n that has b e e n s h o w n to b e p e r m i s s i v e f o r  1 9 9 4 ) , w a s u s e d as t h e h o s t f o r t h e c o n s t r u c t i o n o f  phosphatase fusion library.  I f o u n d that the i n c l u s i o n o f 50 m M  et al,  Rather than construct a  phoA  deficient strain,  i n the s e l e c t i o n m e d i u m c o m p l e t e l y i n h i b i t e d the  e x p r e s s i o n o f the endogenous phosphatase activity i n  E. coli E R 1 7 9 3  w h i l e still a l l o w i n g the  detection o f recombinant alkaline phosphatase fusion proteins.  1.2 DNA  sequencing and B L A S T X analysis of Helicobacter /jj'/or/'-alkaline phosphatase  fusion clones  35  A t o t a l o f 1 2 0 H. / ^ / o n - a l k a l i n e p h o s p h a t a s e f u s i o n l i b r a r y c l o n e s w e r e  randomly  selected f o r screening b y D N A sequencing. E a c h clone w a s subjected to a single pass D N A sequencing r u n a n d I obtained an average o f approximately 3 5 0 b p o f D N A sequence f r o m each clone.  T h e s e D N A sequences w e r e u s e d separately f o r B L A S T X h o m o l o g y searches o f the  N C B I n o n - r e d u n d a n t n u c l e o t i d e d a t a b a s e ( A l t s c h u l et al.,  1990). T h e B L A S T X results were  s c r e e n e d f o r u n g a p p e d a n d c o n s i s t e n t l y g a p p e d h i g h - s c o r i n g segment p a i r s that p r o d u c e d P ( N ) scores o f 10" o r l o w e r , s i n c e s u c h p a i r i n g s are generally c o n s i d e r e d to b e significant. 5  Three  additional clones w i t h h i g h high-scoring segment pair scores were also included. Three clones w i t h h o m o l o g y o n l y to c y t o p l a s m i c proteins a n d three c l o n e s w i t h h o m o l o g y to proteins  phoA  e n c o d e d o n the negative strand relative to A m o n g t h e 1 2 0 H. pylori-alkaline  were not included i n Table IV.  phosphatase f u s i o n l i b r a r y c l o n e s that w e r e  s e q u e n c e d , 21 c l o n e s p r o d u c e d h i g h - s c o r i n g s e g m e n t p a i r s o f 10" o r l o w e r ( T a b l e I V ) . T h e 5  i d e n t i f i e d h o m o l o g o u s genes i n c l u d e d several p r i m e targets f o r d r u g i n t e r v e n t i o n o r v a c c i n e construction i n c l u d i n g genes i n v o l v e d i n m o t i l i t y (clones 11, 3 0 a n d 121), efflux (clones 12,3 9 , 61 a n d 2 0 0 ) , i r o n u p t a k e ( c l o n e 10), c e l l w a l l b i o s y n t h e s i s ( c l o n e s 4 4 a n d 162), p e r m e a s e s (clones 199 a n d 2 3 0 ) , c y t o c h r o m e (clone 105), e n z y m e s (clone 3) a n d l i p i d biosynthesis (clone 182). In addition to those clones listed i n T a b l e I V , another 89 clones h a d o n l y w e a k similarity to s e q u e n c e s i n t h e n o n - r e d u n d a n t database.  These clones d i d not have a sufficient amount o f  s i m i l a r i t y to sequences present i n the database to a l l o w a confident p r e d i c t i o n o f their possible function (data n o t shown).  A d d i t i o n a l sequencing i n these clones w o u l d b e required before a  prediction o f their function c o u l d be made.  Lastly, 7 clones d i d not produce alignments with  any sequences i n the N C B I non-redundant database.  W h e t h e r these sequences represent n o v e l  36  Table IV.  H. pylori-alkaline  phosphatase fusion library clones h a v i n g significant similarity to  database sequences. Clone # (accession #):' 3(U61522) 10(U60606) 11 (U60607) 12(U60608) 20 (U61524) 26(U61525) 30 (U60610) 32(U60611) 39(U82393) 44 (U60613) 52 (U60615) 53 (U81608) 57(U82394) 61 (U60617) 70 (U60618) 105 (U60620) 117(U60622) 121 (U60623) 158(U60627) 162 (U60628) 182 (U60630) 199 (U60633) 200 (U60634) 211 (U81609) 230 (U60638)  HSP gene (accession  Organism:  J  Function:  4  AA residues (N): 41(3) 41(1) 101(2) 59(1) 69(2) 64(2) 43(1) 40(1) 62(1) 52(1) 83(3) 46(1) 46(1) 94(2) 53(2) 87(1) 58(1) 43(1) 68(2) 113(2) 89(2) 55(1) 91(2) 38(1) 99(2)  %Id.:  %Sim.:'  HSP:  50 51 31 38 48 39 53 55 26 34 40 34 32 27 43 54 52 53 46 32 66 31 34 37 33  70 80 56 59 56 70 72 60 47 53 62 58 54 48 74 75 76 72 66 52 82 53 57 55 55  68 125 92 102 75 90 118 92 66 86 74 87 65 67 91 261 171 121 88 128 269 97 103 68 114  0  8  P(N):'  5  /o/D(D10588) exbD (U08209) /q/B(L06176) helA (U49498) virB4(U28133) kpnBl (U33094) motB (M77238) yrbJ (U18997) let (Ml6217) vanA (M97297) T3RE (X06287) HI0325 (U00072) yjcO (P32713) mtrC (U14993) HI 1586(U32779) cy«/(X65189) ppsA (D64005) motB (M77238) /eofl(U18997) pbpA (X04516) cdh (Ml 1331) yejA (U00008) yhiV(U00039) rfbA (L34166) HI0325 (U32826)  Table I V legend:  Ec Hi Vp Lp Hp Kp Bsu Ec Sa Ef PI Hi Ec Ng Hi Ws Ssp. Bs Ec Ec Ec Ec Ec Sm Hi  dehydrogenase siderophore uptake motility efflux ? DNA restriction system motility ? tet efflux vancomycin resistance DNA restriction ? ? efflux '? cytochrome kinase motility iron transport penicillin binding protein lipid biosynthesis permease efflux LPS biosynthesis hypothetical permease  H. pylori-a\kaline  identified b yB L A S T X homology  6.5x10-° 5.5x10-' 4.4x10" 2.0x10"' 4.2xl0" 8.8X10 2.2xl0" 2.2xl0.997 9.1xl08.0xl0" 7.2xl0" .996 .94 3.6x10-'° 1.9xl0" ° l.lxlO" 1.0x10"' 8.4x10"'° 9.8xl0"' 9.4xl0" 1.9xl0" 3.6xl0" .90 8.0x10"'"  phosphatase fusion library clones and their h o m o l o g  s e a r c h e s ( B i n a et al,  1997).  5  8  -8  7  s  5  8  5  3  20  4  35  6  7  genes  ( 1 ) H. p y / o n - a l k a l i n e  phosphatase fusion library clone a n d its G e n B a n k accession number.  (2) G e n e name and  a c c e s s i o n n u m b e r o f t h e d a t a b a s e g e n e w h i c h w a s s i m i l a r t o t h e H. j p y / o n ' - a l k a l i n e  phosphatase  f u s i o n l i b r a r y c l o n e l i s t e d i n c o l u m n 1. ( 3 ) O r i g i n o f g e n e l i s t e d i n c o l u m n 2 . A b b r e v i a t i o n s :  Bsu, Bacillus subtilis; Cf, Citrobacter freundii; Ec, Escherichia coli; Ef Enterococcus facium; , Hi, Haemophilus influenzae; Hp, Helicobacter pylori; Kp, Klebsiella pneumoniae; Lp, Legionella pneumophila; Ng, Neisseria gonorrhoeae; PI, bacteriophage PI; Sa, Staphylococcus aureus; Sm, Serratia marcescens; Ssp, Synechocystis species; Vp, Vibrio parahaemolyticus; Ws, Wolinella succinogenes. ( 4 ) F u n c t i o n o f g e n e l i s t e d i n c o l u m n 2 . ( 5 ) T h e n u m b e r o f a m i n o acids a n d H S P s (in parenthesis) i nthe B L A S T X alignment. a m i n o a c i d identity reported i nthe B L A S T X search results. similarity reported i nthe B L A S T X search results.  (6) Percent  (7) Percentage o f a m i n o acid  (8) H S P score reported i nB L A S T X results.  (9) P ( N ) r e p o r t e d i n the B L A S T X s e a r c h results.  37  and unique  H. pylori  genes w a s n o t p o s s i b l e to d e t e r m i n e w i t h o u t further s e q u e n c i n g ( p r i o r to  c o m p l e t i o n o f t h e H. pylori g e n o m e s e q u e n c e ) .  1.3 Confirmation of gene identification for putative Helicobacter pylori efflux clones . T h e m a j o r o b j e c t i v e f o r u n d e r t a k i n g this s t u d y w a s to i d e n t i f y p o t e n t i a l  H. pylori  m u l t i p l e d r u g active efflux systems. I n m y initial screen I identified three potential genes f r o m  H pylori  e f f l u x s y s t e m s i n c l o n e s 12, 61 a n d 2 0 0 w h i c h w e r e s i m i l a r to the r e s i s t a n c e -  nodulation-division ( R N D )  f a m i l y o f bacterial efflux systems. I n general, the R N D  efflux  operons c o n t a i n a c o n s e r v e d m e m b r a n e f u s i o n p r o t e i n u p s t r e a m o f the p u m p p r o t e i n ( N i k a i d o , 1 9 9 6 ; P a u l s e n et al,  1997). T o c o n f i r m the initial gene i d e n t i f i c a t i o n I obtained upstream  DNA  sequence i n f o r m a t i o n for e a c h o f these clones. I n i t i a l s c r e e n i n g s u g g e s t e d that c l o n e 12 c o n t a i n e d s e q u e n c e s i m i l a r i t y to a n R N D  pump  p r o t e i n . T h e r e f o r e , c l o n e 12 w a s s e q u e n c e d w i t h t h e r e v e r s e s e q u e n c i n g p r i m e r to d e t e r m i n e i f there w a s sequence s i m i l a r i t y to a m e m b r a n e f u s i o n p r o t e i n i n the D N A r e g i o n u p s t r e a m  from  the putative e f f l u x p u m p protein. B L A S T X searches u s i n g the r e s u l t i n g D N A s e q u e n c e s h o w e d that there w a s s e q u e n c e s i m i l a r i t y to R N D m e m b r a n e f u s i o n p r o t e i n s u p s t r e a m o f the p u t a t i v e efflux p u m p protein (data not shown).  I n a d d i t i o n , the D N A sequence gap b e t w e e n the putative  B L A S T X i d e n t i f i e d m e m b r a n e f u s i o n and p u m p proteins w a s consistent w i t h the size o f the D N A insert i nclone 12and w i t h other R N D efflux operons. p r e d i c t i o n that c l o n e 12 c o n t a i n e d a p u t a t i v e  H. pylori  T h e s e results support the initial  active efflux pump-phoA fusion protein.  C l o n e 6 1 w a s i n i t i a l l y i d e n t i f i e d as h a v i n g a w e a k s i m i l a r i t y t o a b a c t e r i a l m e m b r a n e fusion protein  (mtrC  from  N. gonorrhoeae).  T o further investigate this c l o n e a D N A  s e q u e n c i n g p r i m e r w a s s y n t h e s i z e d to e x t e n d the o r i g i n a l D N A  sequence. B L A S T X analysis o f  the resulting D N A sequence ( a p p r o x i m a t e l y 9 0 0 bp) w a s consistent w i t h the initial p r e d i c t i o n  38  that this c l o n e e n c o d e d a m e m b r a n e f u s i o n p r o t e i n .  The extended D N A sequence identified  h i g h - s c o r i n g s e g m e n t p a i r s at a m u c h h i g h e r c o n f i d e n c e l e v e l ( P ( N ) o f 9 . 6 x 1 0 " f o r Alcaligenes 5  eutrophus cnrB). C l o n e 2 0 0 w a s s i m i l a r to s e v e r a l R N D  efflux pumps.  the putative a m i n o a c i d sequence o f c l o n e 2 0 0 a n d other R N D  M u l t i p l e sequence alignments o f e f f l u x p u m p s s h o w e d that c l o n e  2 0 0 shared m o s t o f the c o n s e r v e d a m i n o acids w i t h the other e f f l u x p u m p s .  Additional  s e q u e n c i n g o f the u p s t r e a m r e g i o n o f this c l o n e r e v e a l e d the p r e s e n c e o f a putative h o m o l o g u e o f the  E. coli acrAB  (Ma  et al,  D N A  H. pylori  1993) efflux operon i n c l u d i n g the putative p u m p  protein and an upstream membrane fusion protein.  1.4 Analysis of the clones after publication of the Helicobacter pylori 26695 genome sequence. T h e sequenced a l k a l i n e phosphatase f u s i o n clones w e r e m a p p e d to the g e n o m e sequence of  H. pylori  26695.  T h e r e s u l t s o f t h i s are s h o w n i n T a b l e V .  clones ( 4 9 % ) w e r e u n i q u e to  H. pylori  A m o n g the sequenced clones, 59  ( i . e., u n i d e n t i f i e d O R F s ) , 6 5 c l o n e s ( 5 4 % )  contained  t y p i c a l s i g n a l s e q u e n c e s a n d 19 c l o n e s ( 1 6 % ) w e r e p r e d i c t e d to b e c e l l e n v e l o p e - a s s o c i a t e d . Additionally, 44 clones (37%)  o f the s e q u e n c e d c l o n e s w e r e r e d u n d a n t a n d 12 c l o n e s ( 1 0 % )  w e r e p r e d i c t e d to e n c o d e c y t o p l a s m i c proteins.  39  Table  V.  Mapping of  Helicobacter pylori  11637  phoA  gene f u s i o n s to the  Helicobacter pylori  26695 genome.  Clone:  TIGR  3 5 8 9 10 11 12 13 15 16 17 19 20 21 22 23 24 25 26 27 29 31 32 33 34 36 38 39 43 43 44 47 49 50 51 52 53 55 57 60 61 62 63  0577 0817 0817 0931 1446 0752 1329 1517 0817 0248 1098 0817 0544 0298 0898 0547 0289 1429 1402 0187 1402 0529 1569 0366 0764 1517 0931 0594 0488 1116 0738 0078 1457 1272 0018 1521 0758 0725 1098 0144 0970 0922 0403  ORF:  Function:  methylene-tetrahydrofolate dehydrogenase (folD) unidentified ORF unidentified ORF unidentified ORF biopolymer transport protein (exbD) flagellar hook-associated protein 2 (fliD) cation efflux system protein (czcA) type IIS restriction enzyme unidentified ORF conserved hypothetical protein conserved hypothetical secreted protein unidentified ORF cag pathogenicity island protein (cag23) dipeptide ABC transporter, periplasmic dipeptid hydrogenase expression/formation protein cag pathogenicity island protein (cag26) toxin-like outer membrane protein polysialic acid capsule expression protein type I restriction enzyme R protein (hsdR) unidentified ORF type I restriction enzyme R protein (hsdR) cag pathogenicity island protein (cag9) unidentified ORF spore coat polysaccharide biosynthesis unidentified ORF type IIS restriction enzyme unidentified ORF unidentified ORF unidentified ORF unidentified ORF D-alanine:D-alanine ligase A (ddlA) unidentified ORF unidentified ORF NADH-ubiquinone oxidoreductase, NQ013 subunit unidentified ORF type III restriction enzyme R protein conserved hypothetical integral membrane protein outer membrane protein (ompl7) conserved hypothetical secreted protein cytochrome c oxidase, heme b and copper-binding nickel-cobalt-cadmium resistance protein (nccB) toxin-like outer membrane protein phenylalanyl-tRNA synthetase, alpha subunit 40  Clone:  TIGR ORF:  Function:  65 70 71 72 73 77 78 79 80 81 82 83 85 89 90 91 92 93 95 96 97 99 100 102 105 107 111 112 114 115 116 117 118 121 122 123 123 124 125 127 128 129 130 131 132 133 134  0887 0946 0289 0817 0817 0522 0677 0638 0330 1433 0492 0289 0817 0018 0817 1237 1072 0817 0817 0078 0912 0855 1213 0817 0633 0721 1497 0817 0972 1561 0817 0121 0167 0816 1144 0424 1411 0020 0817 0527 1524 1394 1523 1346 1350 0946 0817  vacuolating cytotoxin conserved hypothetical integral membrane protein toxin-like outer membrane protein unidentified ORF unidentified ORF cag pathogenicity island protein (cag3) conserved hypothetical integral membrane protein unidentified ORF ketol-acid reductoisomerase (ilvC) hypothetical protein unidentified ORF toxin-like outer membrane protein unidentified ORF unidentified ORF unidentified ORF carbamoyl-phosphate synthetase copper-transporting ATPase, P-type (copA) unidentified ORF unidentified ORF unidentified ORF unidentified ORP alginate O-acetylation protein (algl) polynucleotide phosphorylase unidentified ORF quinone-reactive Ni/Fe hydrogenase unidentified ORF peptidyl-tRNA hydrolase unidentified ORF glycyl-tRNA synthetase iron(III) A B C transporter unidentified ORF phosphoenolpyruvate synthase unidentified ORF flagellar motor rotation protein unidentified ORF unidentified ORF unidentified ORF carboxynorspermidine decarboxylase unidentified ORF cag pathogenicity island protein (cag7) unidentified ORF conserved hypothetical protein D N A recombinase (recG) glyceraldehyde-3 -phosphate dehydrogenase protease conserved hypothetical integral membrane protein unidentified ORF  Clone:  TIGR ORF:  Function:  136 139 144 145 146 147 149 151 152 155 157 158 159 160 161 162 163 164 165 169 170 171 173 176 178 182 184 189 194 195 199 200 201 209 211 212 214 215 216 222 223 224 225  0689 0257 1524 0036 0531 0447 1157 0817 1524 0254 1527 0687 0817 0758 0273 1565 0868 0019 0020 0019 0019 0376 0522 0273 0576 0871 1092 0207 0668 1524 1252 0607 0719 0271 0378 1212 0272 0595 0532 0149 0287 0273 1116  unidentified ORF conserved hypothetical secreted protein unidentified ORF unidentified ORF cag pathogenicity island protein (cagl 1) conserved hypothetical protein unidentified ORF unidentified ORF unidentified ORF outer membrane protein (omp8) unidentified ORF iron(II) transport protein (feoB) unidentified ORF conserved hypothetical integral membrane protein unidentified ORP penicillin-binding protein 2 (pbp2) unidentified ORF chemotaxis protein (cheV) carboxynorspermidine decarboxylase (nspC) chemotaxis protein (cheV) chemotaxis protein (cheV) ferrochelatase (hemH) cag pathogenicity island protein (cag3) unidentified ORF signal peptidase I CDP-diglyceride hydrolase flagellar basal-body rod protein ATP-binding protein unidentified ORF unidentified ORF oligopeptide A B C transporter acriflavine resistance protein unidentified ORF unidentified ORF cytochrome C biogenesis protein A T P synthase F0 unidentified ORF unidentified ORF cag pathogenicity island protein (cag 12) unidentified ORF unidentified ORF unidentified ORF unidentified ORF  42  CHAPTER 2. Role of efflux in antibiotic resistance oi Helicobacter pylori 2.0 Introduction I p r e v i o u s l y i d e n t i f i e d the presence o f three potential R N D  efflux systems in  H. pylori  1 1 6 3 7 (see C h a p t e r 1). I n t h i s c h a p t e r I tested the h y p o t h e s i s that a c t i v e e f f l u x m e d i a t e d b y these three e f f l u x s y s t e m s f u n c t i o n s i n the i n t r i n s i c resistance o f T h e c h a r a c t e r i z a t i o n o f the R N D  systems in  H. pylori  H. pylori  to antibiotics.  was done in collaboration with Dr.  R . A i m at A s t r a R e s e a r c h B o s t o n I n c . ( s e e A p p e n d i x I ) . F o r t h e s e q u e n c e a n a l y s i s c o n t a i n e d i n this chapter, the s e q u e n c e o f the R N D e f f l u x s y s t e m s f o u n d i n  H. pylori  J99 was made available  to m e b y A s t r a R e s e a r c h B o s t o n , Inc.. T h e results o f this w o r k b y D r . A i m a n d I r e v e a l e d that the R N D e f f l u x s y s t e m s are conserved among  H. pylori  H. pylori,  antibiotic resistance o f that o n e o f the  2.1  strains, that a c t i v e e f f l u x d o e s n o t p l a y a r o l e i n the  H. pylori  that  hefBC  does not c o m p l e m e n t  E. coli acrAB  in vitro  intrinsic  mutants and  R N D efflux systems is differentially regulated.  Cloning and DNA sequencing of the hefABC operon from Helicobacter pylori 11637 I h a d p r e v i o u s l y r e c o v e r e d p a r t i a l genes that s h o w e d h o m o l o g y to the p r o t e i n s o f three  different R N D  family efflux operons in  H. pylori  11637 b y translational f u s i o n to a l k a l i n e  p h o s p h a t a s e ( s e e C h a p t e r 1). T h e D N A i n s e r t f r o m 2 0 0 , w h i c h w a s m o s t s i m i l a r to the  E. coli acrB  t o s u b c l o n e t h e c o r r e s p o n d i n g l o c u s from a the c o s m i d p L A F R 3 .  H. pylori  alkaline phosphatase fusion clone  e f f l u x p u m p , w a s u s e d as a h y b r i d i z a t i o n p r o b e  H. pylori  g e n o m i c l i b r a r y that w a s c o n s t r u c t e d i n  C o s m i d c l o n e p 2 0 0 : 4 w a s i d e n t i f i e d as c o n t a i n i n g t h e e n t i r e l o c u s a n d  was used for subcloning and D N A sequencing o f  hefABC.  contained three o p e n reading frames w h i c h I n a m e d n u m b e r A F 0 5 9 0 4 1 ; F i g u r e s 5 & 6).  The  hefA  and  The resulting D N A  hefABC  hefB  sequence  (Helicobacter e/Flux; accession  genes each contained a t y p i c a l signal  43  sequence.  A homolog of  E. coli  uroporphyrinogen decarboxylase  as p a r t o f t h e s a m e p u t a t i v e o p e r o n as w a s t h e The  H. pylori hefABC  hefABC  (hemE)  w a s present upstream  genes.  genes e n c o d e d p r o t e i n s that w e r e s i m i l a r to those e n c o d e d b y the  A c r A B - T o l C R N D e f f l u x s y s t e m w h i c h mediates the resistance o f variety o f different antibiotics, detergents and dyes (Paulsen  et al,  1996).  The  hefA  E. coli tolC  coli acrA  genes, respectively. T o l C is b e l i e v e d to be the outer m e m b r a n e  and  acrB  and  hefC  (Ma  encoded a putative  h o m o l o g and the  hefB  et al,  E. coli  1993) to a gene  genes w e r e h o m o l o g s o f the  E.  component  o f the A c r A B e f f l u x s y s t e m w h e r e a s A c r A is a m e m b e r o f the c o n s e r v e d f a m i l y o f m e m b r a n e f u s i o n p r o t e i n s , a n d A c r B i s t h e R N D f a m i l y m u l t i p l e d r u g e f f l u x p u m p p r o t e i n ( M a et 1994).  W h e t h e r the upstream u r o p o r p h y r i n o g e n d e c a r b o x y l a s e h o m o l o g has a functional role i n  t h e hefABC o p e r o n i s u n k n o w n .  The association o fa uroporphyrinogen decarboxylase homolog  a n d o f the o t h e r g e n e s as d e s c r i b e d b e l o w , i s u n i q u e to  2.2  al,  Sequence analysis of the "The  H. pylori  H. pylori R N D  H. pylori.  efflux operons  2 6 6 9 5 g e n o m i c sequence, w h i c h w a s p u b l i s h e d after o u r p u b l i c a t i o n  d e s c r i b i n g the existence o f 3 efflux operons i n  H. pylori,  contained o n l y 6 open reading frames  ( O R F s ) t h a t w e r e r e p o r t e d as h a v i n g h o m o l o g y t o R N D e f f l u x c o m p o n e n t s ( O R F s 6 0 6 , 6 0 7 , 969, 970, 1328 and 1329) ( T o m b  et al,  1997).  T h e D N A inserts f r o m  H. pylori  alkaline  p h o s p h a t a s e f u s i o n c l o n e s 1 2 , 6 1 a n d 2 0 0 w e r e u s e d s e p a r a t e l y f o r B l a s t s e a r c h e s ( A l t s c h u l et  al,  1990) o f the g e n o m i c D N A sequences o f  H. pylori  26695 (Tomb  et al,  1997) and  H. pylori  J 9 9 to i d e n t i f y t h e i r c o r r e s p o n d i n g l o c i i n e a c h o f these t w o strains. A l l three genes m a p p e d to putative R N D efflux operons.  T h e gene structures o f e a c h o f the three  H. pylori  RND  operons  a r e s h o w n i n F i g u r e 6 ; t h e r e w e r e n o o t h e r R N D e f f l u x s y s t e m s p r e d i c t e d i n e i t h e r s t r a i n o f H.  pylori  for w h i c h the g e n o m i c sequence has b e e n elucidated  (H. pylori  26695 or J99).  44  The  H. pylori  hemE-hefABC  operon w h i c h I sequenced from  26695 O R F s 604, 605, 606 and 607.  a m o n g the three  H. pylori  The  H. pylori  hemE-hefABC  1 1 6 3 7 w a s h o m o l o g o u s to  operon was highly conserved  strains (strains 11637, 2 6 6 9 5 and J99); e a c h i n d i v i d u a l protein w a s  greater t h a n 9 7 % i d e n t i c a l to e a c h o f its c o r r e s p o n d i n g p r o t e i n s i n the other t w o  H. pylori  strains. T h e D N A insert f r o m  H. pylori  H. pylori  a l k a l i n e p h o s p h a t a s e f u s i o n c l o n e 61 w a s h o m o l o g o u s to  2 6 6 9 5 O R F 970, w h i c h is a m e m b e r o f the s e c o n d  operon also contained four O R F s , n a m e d here 26695 O R F s 971, 970, 969 and 968.  The  hefDEF-or/V68,  hefD  tolC, hefA  membrane fusion protein homolog and  hefF  The  orf968  R N D efflux system.  w h i c h c o r r e s p o n d to  This  H. pylori  gene w a s i d e n t i f i e d b y m e as a p u t a t i v e outer  m e m b r a n e pore p r o t e i n b y s i m i l a r i t y to  V I a n d F i g u r e 6).  H. pylori  and  hefG  (see b e l o w ) ;  hefE  w a s the  e n c o d e d the R N D p u m p p r o t e i n h o m o l o g  (Table  e n c o d e d a p u t a t i v e 21 a m i n o a c i d p e p t i d e that s h o w e d l o w  s i m i l a r i t y b e t w e e n the strains a n d its s i g n i f i c a n c e a n d w h e t h e r it is e x p r e s s e d i s u n k n o w n . T h e  hefD  and  hefE  genes each contained a typical signal sequence.  T h e D N A i n s e r t from  H. pylori  a l k a l i n e p h o s p h a t a s e f u s i o n c l o n e 12 w a s h o m o l o g o u s to  t h e H. pylori 2 6 6 9 5 O R F 1 3 2 9 , w h i c h i s a m e m b e r o f t h e t h i r d H. pylori R N D e f f l u x s y s t e m . T h i s o p e r o n , s i m i l a r to the t w o operons d e s c r i b e d a b o v e c o n t a i n e d f o u r O R F s , n a m e d here  orfl326-hefGHI, hefGHI  w h i c h corresponds to  H. pylori  26695 O R F s 1326, 1327, 1328 and 1329. T h e  genes s e e m to e n c o d e the outer m e m b r a n e pore, m e m b r a n e f u s i o n and R N D  proteins respectively. The  hefG  pump  outer m e m b r a n e protein w a s i d e n t i f i e d b y s i m i l a r i t y to  tolC,  45  Figure 5.  D N A sequence, amino acid sequence and oligonucleotide P C R primer m a p  Helicobacter pylori 1 1 6 3 7 hefABC o p e r o n . 1  ATGAATACTATCATAAGATATGCGAGTTTATGGGGCTTGTGTGCGGCTTTAACTCTAGCG M N T I I R Y A S L W G L C A A L T L A  61  CAAACCCCCTCTAAAACCCCAGAAGAAATCAAGCAAATCGTTAACAATTATAGCCATAAG Q T P S K T P E E I K Q I V N N Y S H K  121  AATTTAATACTCATTGATCCGCCGACAAGTTCTTTAGAAGCAACACCGAGTTTTTTATCC N L I L I D P P T S S L E A T P S F L S  181  TCGCATAAAGAGACAGCGACCACGGTCAATCAAGAGATTGCTAAATACCATGAAAAAAGC S H K E T A T T V N Q E I A K Y H E K S  241  GATAAAGCCGCTTTGGGGCTTTATGAATTGCTAAAAGGGGCTACCACTAATCTCAGTTTG D K A A L G L Y E L L K G A T T N L S L  301  C AAG C G C AAG AAC T CAG TGT C AAG C AAG C G AT G AAAAAC CACACCATCGC C AAAGC G AT G Q A Q E L S V K Q A M K N H T I A K A M  361  TTTTTGCCCACTTTGAACGCGAGTTATAATTTTAAAAATGAAGCTAGGGATACTCCAGAA F L P T L N A S Y N F K N E A R D T P E  421  TATAAGCATTATGACACCCAACAACTCCAAGCTCAAGTCACATTGAATGTGTTTAATGGC Y K H Y D T Q Q L Q A Q V T L N . V F N G  4 81  TTTAGCGATGTGAATAATGTCAAAGAAAAGTCTGCGACTTACCGCTCCAATGTGGCTAAT F S D V N N V K E K S A T Y R S N V A N  541  TTAGAATATAGCCGCCAGAGCGTGTATTTGCAAGTGGTGCAACAATACTACGAGTATTTT L E Y S R Q S V Y L Q V V Q Q Y Y E Y F  601  AACAATCTCGCTCGCATGATCGCTTTGCAAAAGAAATTAGAGCAAATCAAAACAGACATT N N L A R M I A L Q K K L E Q I K T D I  661  AAAAGGGTTACCAAACTCTATGACAAAGGGCTGACCACGATTGATGATTTGCAAAGCTTA K R V T K L Y D K G L T T I D D L Q S L  721  AAAGCGCAAGGGAATTTGAGCGAATACGATATTTTGGACATGCAATTTGCTTTGGAGCAA K A Q G N L S E Y D I L D M Q F A L E Q  7 81  AAC CGCTTGACTT TAGAATAC C T CAC TAAC CTCAGTGT GAAAAAT T T GAAAAAGACCACG N R L T L E Y L T N L S V K N L K K T T  841  ATTGATGCGCCTAATTTGCAATTAAGAGAAAGGCAGGATTTGGTTTCTTTAAGGGAGCAG I D A P N L Q L R E R Q D L V S L R E Q  901  ATTTCTGCAATCAGATACCAAAACAAGCAACTCAATTATTACCCCAAGATAGATGTGTTT I S A I R Y Q N K Q L N Y Y P K I D V F  961  GACTCATGGCTTTTTTGGATCCAAAAACCCGCTTATGCCACAGGGCGTTTTGGGAATTTC D S W L F W I Q K P A Y A T G R F G N F  1021  TACCCAGGTCAGCAAAATACGGCTGGGGTTACTGCGACTTTGAATATTTTTGATGATATA  Y  P  G  Q  Q  N  T  A  G  V  T  A  T  L  N  I  F  D  D  I  1081  GGCTTGAGCTTGCAAAAACAATCCATCATGTTAGGCCAATTAGCGAATGAAAAGAATTTA G L S L Q K Q S I M L G Q L A N E K N L  1141  GCGTATAAAAAGCTAGAGCAAGAAAAAGACGAACAGCTTTACAGAAAGTCGCTTGATATT A Y K K L E Q E K D E Q L Y R K S L D I  1201  GCCAGAGCCAAGATTGAATCTTCAAAGGCTAGTTTGGATGCGGCTAATCTTTCTTTTGCC A R A K ' I E S S K A S L D A A N L S F A  12 61  AATATTAAAAGGAAATACGACGCTAATTTAGTGGATTTCACCACTTATTTAAGGGGCTTA N I K R K Y D A N L V D F T T Y L R G L  1321  ACCACGCGCTTTGATGCAGAAGTGGCTTACAATTTAGCGCTCAACAATTATGAAGTGCAA T T R F D A E V A Y N L A L N N Y E V Q  1381  AAAGCCAATTACATTTTCAACAGCGGGCATAAAATAGACGACTATGTGCATTAAGGGAGT K A N Y I F N S G H K I D D Y V H * M C I K G• V  14 41  GGAAATGATACGAAAAATTTTAATAGGACTTTTTTTGAGTTTTTTGAGCATGGAAGCTGG E M I R K I L I G L F L S F L S M E A G  1501  CGAAAAAGTGTATGCGATTTTTAATGTGAAAGCGATGCAAGATTCCAAACTCACCTTAGA E K V Y A I F N V K A M Q D S K L T L D  1561  CAGCACAGGGATTGTGGATAGCATTAAGGTTACTGAGGGGAGCGTGGTCAAAAAGGGCGA S T G I V D S I K V T E G S V V K K G D  1621  TGTTTTGTTGCTTTTGTATAATCAAGACAAACAGGCTCAAAGCGATTCCACTGAGCAACA V L L L L Y N Q D K Q A Q S D S T E Q Q  1681  ACTCATTTTCGCTAAAAAGCAATACCAACGATACAGCAAAATTGGGGGTGCTGTGGATAA L I F A K K Q Y Q R Y S K I G G A V D K  17 41  AAACACTCTAGAGGGTTATGAGTTCACTTACAGGCGTTTGGAGTCTGATTACGCTTATTC N T L E G Y E F T Y R R L E S D Y A Y S  1801  TATTGCGGTATTGAATAAAACCATTTTAAGAGCCCCTTTTGATGGCGTGATAGCGAGTAA I A V L N K T I L R A P F D G V I A S K  18 61  AAACATTCAAGTGGGCGAAGGGGTGAGCGCGAATAACACCGTGTTATTGAGACTAGTCAG N I Q V G E G V S A N N T V L L R L V S  1921  CCATGCTAGGAAATTGGTTATTGAATTTGATTCTAAATATATTAATGCAGTCAAAGTGGG H A R K L V I E F D S K Y I N A V K V G  1981  GGATACTTACACTTATTCTATAGATGGGGATTCTAATCAGCATGAAGCTAAAATCACTAA D T Y T Y S I D G D S N Q H E A K I T K  2041  GATTTACCCCACGGTTGATGAAAACACCAGAAAAGTGAGTGCTGAAGCCCTTTTGTCTAA I Y P T V D E N T R K V S A E A L L S K  2101  GCCTATGGCAGTGGGGCTTTTTGGCGATGGGTTTATCCAAACAAAATAATAGGATATTTT  ^  •  47  P  M  A  V  G  L  F  G  D  G  F  I  Q  T  K  *  2161  GATGTATAAAACAGCGATTAATCGTCCTATTACGACCTTGATGTTTGCTTTGGCGATTGT M Y K T A I N R P I T T L M F A - L A I V  2221  TTTTTTTGGGACTATGGGGTTTAAAAAATTGAGCGTGGCGCTTTTCCCTAAAATTGATTT F F G T M G F K K L S V A L F P K I D L  2281  GCCTACAGTGGTGGTTACTACGACTTATCCTGGGGCTAGCGCTGAAATCATAGAGAGTAA P T V V V T T T Y P G A S A E I I E S K  2341  GGTAACCGATAAGATTGAAGAAGCGGTGATGGGGATTGATGGGATCAAAAAGGTTACTTC V T D K I E E A V M G I D G I K K V T S  24 01  TACCAGTTCTAAAAATGTGAGTATCGTTGTCATTGAATTTGAGTTAGAAAAGCCTAATGA T S S K N V S I V V I E F E L E K P N E  24 61  AGAAGCCTTAAACGATGTGGTTAATAAAATTTCTTCGGTGCGTTTTGATGACTCTAACAT E A L N D V V N K I S S V R F D D S N I  2521 TAAAAAACCCTCTATCAATAAATTTGATACCGACAGCCAAGCCATTATTTCATTGTTTGT K K P S I N K F D T D S Q A I I S L F V 2581  GAGCAGTTCAAGCGTGCCGGCTACAACCCTTAATGACTACGCTAAAAACACCATTAAACC S S S S V P A T T L N D Y A K N T I K P  2 641  CATGCTCCAAAAAATCAATGGGGTAGGGGGCGTGCAGCTCAACGGCTTTAGGGAGCGCCA M L Q K I N G V G G V Q L N G F R E R Q  27 01  GAT TAGGAT T TAT GCAGATCCCACTTTGATGAATAAATACAACC TGAC TTATGCGGATCT I R I Y A D P T L M N K Y N L T Y A D L  27 61  TTTCAGCACGCTTAAAGCGGAGAATGTGGAAATTGATGGGGGGCGCATTGTCAATAGCCA F S T L K A E N V E I D G G R I V N S Q  2821  AAGGGAATTGTCCATTTTAATCAATGCGAATAGTTATAGCGTTGCGGATGTGGAAAAGAT R E L S I L I N A N S Y S V A D V E K I  2881  CCAAGTGGGTAATCATGTGCGTCTTGGCGATATTGCAAAAATTGAAATCGGTTTGGAAGA Q V G N H V R L G D I A K I E I G L E E  2 941  AGACAACACTTTTGCGAGCTTTAAAGACAAACCCGGTGTGATTTTAGAAATCCAAAAGAT D N T F A S F K D K P G V I L E I Q K I  3001  TGCCGGAGCGAATGAAATTGAAATCGTGGATAGGGTGTATGAAGCTTTAAAACACATTCA A G A N E I E I V D R V Y E A L K H I Q  3061  AGCCATTAGCCCCAGATATGAAATCAGACCCTTTTTAGACACCACGAGCTATATCCGCAC A I S P R Y E I R P F L D T T S Y I R T  3121  CTCTATTGAAGACGTGAAATTTGATCTAATCTTAGGAGCGATTTTAGCGGTTTTAGTGGT S I E D V K F D L I L G A I L A V L V V  3181  GTTTGCGTTCTTGCGTAACGGCACGATCACCCTTGTTTCAGCGATCTCTATCCCTATTTC  48  F  A  F  L  R  N  G  T  I  T  L  V  S  A  I  S  I  P  I  S  3241  TATCATGGGGACTTTTGCGCTCATCCAATGGATGGGCTTTTCATTAAACATGCTCACCAT I M G T F A L I Q W M G F S L N M L T M  3301  GGTGGCTTTAACGCTAGCGATAGGGATTATCATTGATGATGCGATCGTGGTGATTGAAAA V A L T L A I G I I I D D A I V V I E N  3361  CATCCATAAAAAGCTAGAAATGGGCATGAACAAGCGCAAAGCGAGCTATGAAGGGGTGAG I H K K L E M G M N K R K A S Y E G V R  3421  GGAAATTGGCTTTGCTCTAGTGGCGATTTCAGCGATGCTGCTCTCTGTTTTTGTGCCTAT E I G F A L V A I S A M L L S V F V P I  34 81  AGGAAACATGAAAGGCATTATCGGGCGCTTTTTCCAAAGCTTTGGGATCACGGTGGCTTT G N M K G I I G R F F Q S F G I T V A L  3541  AGCGATCGCTCTATCGTATGTGGTGGTCGTTACGATTATCCCCATGGTAAGCTCAGTCGT A I A L S Y V V V V T I I P M V S S V V  3601  GGTCAATCCCAGGCATTCTCGTTTTTATGTGTGGAGTGAGCCTTTTTTTAAAGCTTTAGA V N P R H S R F Y V W S E P F F K A L E  3661  GTCTCGCTATACCAGATTACTCCAATGGGTATTAAACCACAAGCTCATTATCTCTATAGC S R Y T R L L Q W V L N H K L I I S I A  37 21  GGTGGTTTTGGTGTTTGTGGGTTCGCTTTTTGTGGCTTCTAAATTGGGTATGGAGTTCAT V V L V F V G S L F V A S K L G M E F M  37 81  GCTGAAAGAAGATAGGGGGAGGTTTTTGGTGTGGCTTAAGGCTAAACCGGGCGTGAGCAT L K E D R G R F L V W L K A K P G V S I  38 41  AGATTACATGACACAAAAGAGTAAGATCTTTCAAAAAGCGATTGAAAAACATGCTGAAGT D Y M T Q K S K I F Q K A I E K H A E V  3901  GGAATTCACCACCTTGCAAGTGGGTTATGGCACCACGCAAAACCCTTTTAAGGCTAAGAT E F T T L Q V G Y G T T Q N P F K A K I  3961  TTTTGTGCAGCTCAAGCCTTTAAAAGAGCGCAAAAAAGAGAGTGAATTAGGGCAATTTGA F V Q L K P L K E R K K E S E L G Q F E  4 021  GTTGATGAGCGCTTTAAGGAAGGAATTAAAAAGCATGCCTGAAGCTAAAGGTTTAGATAC L M S A L R K E L K S M P E A K G L D T  4 081  TATTAATCTTTCTGAAGTCTCGCTTTTAGGTGGCGGTGGGGATAGTTCGCCTTTCCAAAC I N L S E V S L L G G G G D S S P F Q T  4141  TTTTGTGTTTTCCCATTCTCAAGAAGCGGTGGATAAAAGCGTGGCGAATTTGAAAAAATT F V F S H S Q E A V D K S V A N L K K F  4201  CTTATTGGAAAGCCCTGAGTTAAAAGGCAAGATTGAAGGCTATCATACGAGCACGAGCGA L L E S P E L K G K I E G Y H T S T S E  4 261  ATCGCAACCGCAACTGCAACTGAAAATCTTAAGACAAAACGCCAACAAATACGGCGTGAG S Q P . Q L Q L K I L R Q N A N K Y G V S  4 321  CGCTCAAACCATTGGAGCAGTGGTGAGCTCTGCTTTCTCTGGGACTTCTCAAGCGAGCGT  A  Q  T  I  G  A  V  V  S  S  A  F  S  G  T  S  Q  A  S  V  4 381  GTTCAAAGAAGATGGTAAAGAATACGACATGATCATTAGAGTGCCTGATGACAAACGCGT F K E D G K E Y D M I I R V P D D K R V  4 4 41  TTCTGTAGAAGACATCAAACGCTTGCAAGTGCGTAACAAATACGATAAATTGATGTTTTT S V E D I K R L Q V R N K Y D K L M F L  4501  AGACGCTTTAGTGGAAATCACAGAAACTAAAAGCCCGTCCAGCATTTCTCGTTATAACCG D A L V E I T E T K S P S S I S R Y N R  4 5 61  CCAACGCAGCGTTACGGTGCTCGCTCAACCTAAAGCGGGTATCTCTTTAGGGGAAATTTT Q R S V T V L A Q P K A G I S L G E I L  4 621  AACGCAAGTGAGTAAAAACACTAAAGAATGGCTGGTTGAAGGGGCGAATTACAGATTTAC T Q V S K N T K E W L V E G A N Y R F T  4 681  CGGTGAAGCGGATAACGCTAAAGAGACTAATGGGGAGTTTTTAGTCGCTTTAGCGACAGC G E A D N A K E T N G E F L V A L A T A  4 741  GTTTGTGTTGATTTATATGATTTTAGCGGCGTTGTATGAATCCATTTTAGAGCCTTTTAT F V L I Y M I L A A L Y E S I L E P F I  4 801  CATCATGGTTACCATGCCTTTAAGCTTTTCAGGGGCGTTTTTTGCTCTAGGTTTAGTGCA I M V T M P L S F S G A F F A L G L V H  4 8 61  TCAGCCTTTGAGCATGTTCTCTATGATAGGCTTGATTTTGCTCATTGGTATGGTGGGTAA Q P L S M F S M I G L I L L I G M V G K  4 921  AAACGCCACGCTTTTAATTGATGTGGCGAATGAAGAGCGTAAAAAAGGTTTGAATATCCA N A T L L I D V A N E E R K K G L N I Q  4 981  AGAAGCCATTTTATTTGCCGGCAAAACCCGTCTAAGACCGATTTTAATGACGACCATTGC E A I L F A G K T R L R P I L M T T I A  5041  GATGGTTTGTGGCATGCTGCCTTTAGCGTTGGCGAGTGGGGATGGAGCGGCGATGAAATC M V C G M L P L A L A S G D G A A M K S  5101  CCCTATAGGGATTGCGATGAGTGGGGGCTTGATGATTTCTATGGTGTTAAGCTTACTCAT P I G I A M S G G L M I S M V L S L L I  5161  TGTGCCGGTGTTTTATCGCTTACTCGCTCCAATAGACGACAAAATCAAGCGGTTTTATCA V P V F Y R L L A P I D D K I K R F Y Q  5221  AAACCAAAAAGCTTTAGAATGAAAAAGATTGTTTTCATTTTGGCTTTATGGGCGGGCTTG N Q K A L E *  50  hemE-hefABC OMP hemE ( o r f 604)  he/A ( o r f 605)  he/B ( o r f 606)  hefC (orf 607)  hefDEF-orf968 OMP  »»»»»»_^  MF  hefD ( o r f 971)  PUMP  hefE (orf970)  hefF (orf969)  orf 96S  orfl326-hefGHI OMP  I orf 1326  MF  I he/G (orf1327)  I  hefH (orf1328)  hefl (orf1329) 600b 1-2  Helicobacter pylori R N D H. pylori 6 6 3 9 5 O R F n u m b e r a s s i g n e d b y T h e I n s t i t u t e f o r G e n o m i c R e s e a r c h . hefA, hefD a n d hefG e n c o d e p u t a t i v e o u t e r m e m b r a n e p o r e p r o t e i n s ( O M P ) ; hefB, hefE a n d hefH e n c o d e t h e p u t a t i v e m e m b r a n e f u s i o n ( M F ) p r o t e i n s ; hefC, hefF a n d hefl e n c o d e t h e p u t a t i v e R N D e f f l u x p u m p p r o t e i n s . T h e hemE g e n e i s a n E. coli u r o p o r p h y r i n o g e n d e c a r b o x y l a s e h o m o l o g a n d t h e p u t a t i v e or/961 a n d orf!326 g e n e s a r e u n i q u e t o H. pylori. Figure  6.  1  S c h e m a t i c m a p a n d p r o p o s e d gene n a m e s f o r the three  e f f l u x s y s t e m s . T h e p r o p o s e d n a m e i s l i s t e d b e l o w e a c h gene as i s the c o r r e s p o n d i n g  51  hefA  and  hefD.  orfl326, hefG The  H. pylori The  The and  orfl326  hefH  hefDEF  and  gene e n c o d e d a 125 a m i n o a c i d p r o t e i n o f u n k n o w n f u n c t i o n . T h e  genes all contained t y p i c a l signal sequences.  hefGHI  operons were highly conserved between  H. pylori  26695 and  J 9 9 i n r e s p e c t t o t h e p r e d i c t e d p r o t e i n s e q u e n c e s as w e l l as t h e i r g e n e a r r a n g e m e n t .  hefDEF  and the  hefGHI  genes f r o m  H. pylori  26695 w e r e greater than 9 7 % and 9 1 %  i d e n t i c a l at t h e a m i n o a c i d l e v e l c o m p a r e d t o t h e i r c o r r e s p o n d i n g g e n e s i n  H. pylori  J99. T h e  h i g h l e v e l o f s e q u e n c e c o n s e r v a t i o n a m o n g the R N D e f f l u x o p e r o n s f r o m these three  H. pylori  i s o l a t e s s u g g e s t s a p o s s i b l y c o n s e r v e d f u n c t i o n f o r t h e s e e f f l u x s y s t e m s i n t h e e c o l o g y o f H.  pylori. C o m p a r i s o n o f t h e H. pylori 2 6 6 9 5 a n d H. pylori J 9 9 i n d i v i d u a l R N D e f f l u x o p e r o n s indicated a l o w degree o f similarity (Table VI).  The p u m p proteins were 23.8 to 2 8 . 4 %  i d e n t i c a l a n d 4 4 to 5 9 % s i m i l a r to e a c h other. T h e m e m b r a n e f u s i o n p r o t e i n s w e r e 16 to 2 2 % i d e n t i c a l ( 4 2 t o 5 3 % s i m i l a r ) w h i l e t h e o u t e r m e m b r a n e p o r e p r o t e i n s w e r e 18 t o 2 2 % i d e n t i c a l (45 t o 4 9 % s i m i l a r ) t o e a c h other. P r e v i o u s l y i t has b e e n p r o p o s e d f r o m a n a l y s i s o f the R N D e f f l u x p u m p p r o t e i n s that the p u m p p r o t e i n s c l u s t e r t o g e t h e r a c c o r d i n g t o s u b s t r a t e s p e c i f i c i t y ( S a i e r et al, o f the  H. pylori  1998).  Analysis  e f f l u x p u m p s w i t h other c h a r a c t e r i z e d R N D e f f l u x p u m p s r e v e a l e d that H e f F  and H e f l w e r e m o s t s i m i l a r to those R N D efflux p u m p s i n v o l v e d i n the e f f l u x o f divalent c a t i o n s w h i l e H e f C w a s m o s t s i m i l a r t o R N D e f f l u x p u m p s c h a r a c t e r i z e d as m u l t i p l e d r u g e f f l u x p u m p s ( F i g u r e 7).  H o w e v e r , it is apparent that the  H. pylori  R N D p u m p proteins  d i v e r g e d from t h e R N D p u m p p r o t e i n s from o t h e r b a c t e r i a l s p e c i e s . C o n s i s t e n t w i t h t h e s e f i n d i n g s , s e q u e n c e a n a l y s i s r e v e a l e d that the m e m b r a n e f u s i o n a n d outer m e m b r a n e p r o t e i n s w e r e a l s o d i v e r g e n t from t h e i r o t h e r c h a r a c t e r i z e d h o m o l o g s .  pore  T h e s e results are  52  Table VI.  Percentage o f amino acid similarity and identity a m o n g  Helicobacter  pylori  RND  efflux operon proteins  Pump proteins \^Id. %Sim>HefC HefF Hefl AcrB CzcA  HefC HefF Hefl AcrB CzcA 25.8 43.7 59.3 63.9 58.6  43.7 59.0 68.7  23.8 28.4 57.3 66.3  27.4 23.1 21.6  23.7 35.5 29.7 24.2  58.4  Membrane fusion proteins: \^Id. %Sim>^ HefB HefE HefH AcrA CzcB HefB 20.3 16.3 16.1 14.0 44.2 16.2 HefE 21.8 17.5 41.2 53.4 18.4 HefH 18.7 52.2 49.4 AcrA 39.0 19.2 CzcB 32.8 41.7 40.6 43.7 Outer membrane pore proteins: \^Id. %Sim>- HefA HefD 19.5 HefA HefD 49.1 HefG 51.6 53.5 47.0 TolC 49.6 47.0 50.2 CzcC  HefG TolC CzcC 17.6 22.0 45.8 50.6  18.8 17.8 20.7  18.9 20.3 16.8 19.7  47.7  53  CnrA  NccA HelA  HefF  CzcA  Hefl HefC  MexB MtrD  AcrB  MexD  Figure  7.  P h y l o g e n e t i c tree s h o w i n g the r e l a t i o n s h i p o f the  H. pylori  R N D p u m p proteins to  R N D p u m p p r o t e i n s from o t h e r b a c t e r i a l s p e c i e s . M u l t i p l e s e q u e n c e a n a l y s i s w a s d o n e u s i n g the C l u s t a l W m e t h o d a n d the p h y l o g e n e t i c tree w a s c o n s t r u c t e d u s i n g the nearest n e i g h b o r distance matrix.  T h e three  H. pylori R N D  d i v e r g e n t from t h e c l u s t e r s o f R N D cations ( C n r A ,  pneumophila;  e f f l u x p u m p p r o t e i n s ( H e f D , H e f G a n d H e f L ) are  efflux p u m p proteins i n v o l v e d i nthe e f f l u x o f divalent  Ralstonia eutropha; N c c A , Alcaligenes denitrificans; H e l A , Legionella Ralstonia eutropha) a n d t h o s e p u m p s i n v o l v e d i n m u l t i p l e d r u g e f f l u x  CzcA,  ( A c r A , E. coli; M e x B , P. aeruginosa; M e x D , P. aeruginosa; M t r D , Neisseria gonorrhoeae).  54  consistent w i t h early a c q u i s i t i o n o f these genes and subsequent divergence. T h e divergence o f these systems m a y reflect the e v o l u t i o n o f functional differences i n c l u d i n g differences i n substrate s p e c i f i c i t y a m o n g these three e f f l u x systems.  2.3  1-N-phenylnapthylamine uptake and the interaction of polymyxin B with the outer  membrane oi Helicobacter pylori N P N is a substrate for active efflux systems i n m a n y G r a m negative b a c t e r i a and I d e c i d e d to e x a m i n e w h e t h e r N P N w a s a substrate for active e f f l u x i n  H. pylori.  N P N is a small,  h y d r o p h o b i c f l u o r e s c e n t c o m p o u n d that f l u o r e s c e s w e a k l y i n a q u e o u s e n v i r o n m e n t s b u t s t r o n g l y i n h y d r o p h o b i c e n v i r o n m e n t s s u c h as t h e m e m b r a n e c o m p a r t m e n t o f b a c t e r i a l c e l l s ( L o h et al,  1 9 8 4 ; M o o r e et al,  1986).  I n G r a m n e g a t i v e bacteria, N P N is e x c l u d e d f r o m the  m e m b r a n e c o m p a r t m e n t b y the h i g h l y c h a r g e d , d i v a l e n t c a t i o n - b r i d g e d l i p o p o l y s a c c h a r i d e o f the outer m e m b r a n e and therefore requires the presence o f a m e m b r a n e d e s t a b i l i z i n g agent s u c h as p o l y m y x i n B f o r e n t r y i n t o t h e m e m b r a n e s ( L o h et al,  pylori  1 9 8 4 ; M o o r e et al,  1986).  S i n c e H.  is i n t r i n s i c a l l y resistant to p o l y m y x i n B , I first i n i t i a t e d e x p e r i m e n t s to a n a l y z e the  interaction o f p o l y m y x i n B w i t h the outer m e m b r a n e o f Titration o f  H. pylori  H. pylori  using N P N .  w i t h p o l y m y x i n B r e v e a l e d that the m a x i m u m l e v e l o f N P N u p t a k e  o c c u r r e d at a p p r o x i m a t e l y 6 . 4 p g / m l p o l y m y x i n B ( F i g u r e 8).  Thus  H. pylori  required  a p p r o x i m a t e l y a 1 0 - f o l d h i g h e r c o n c e n t r a t i o n o f p o l y m y x i n B to p e r m e a b i l i z e its outer membrane than w a s required for  pylori  and  E. coli  E. coli  (not s h o w n ) .  T h i s correlated w e l l w i t h the M I C s o f  H.  to p o l y m y x i n B (5-8 p g / m l a n d 0.5 p g / m l , r e s p e c t i v e l y ) . T h e p o l y m y x i n B -  stimulated uptake o f N P N b y  H. pylori  was inhibited by M g  2  +  as i s o b s e r v e d b y u s e o f t h i s  F i g u r e 8.  Titration  oi Helicobacter pylori w i t h  polymyxin B.  H. pylori w a s  H E P E S b u f f e r w i t h o u t M g C f i as d e s c r i b e d i n t h e M a t e r i a l s a n d M e t h o d s .  resuspended in  The cell suspension  w a s i n c u b a t e d w i t h 10 p M N P N a n d i n c r e a s i n g a m o u n t s o f p o l y m y x i n B w e r e a d d e d a n d the m a x i m u m level o f fluorescence was recorded. This experiment was performed once and f l u o r e s c e n c e i s e x p r e s s e d i n a r b i t r a r y u n i t s ( a . u.). B was required for m a x i m a l uptake o f N P N b y  R e s u l t s s u g g e s t e d t h a t 6 . 4 - 1 0 u.g p o l y m y x i n  H. pylori.  Subsequently, 6.4 p.g/ml p o l y m y x i n  B w a s used i n N P N assays.  56  assay w i t h other G r a m n e g a t i v e b a c t e r i a a n d w a s consistent w i t h the p r e s e n c e o f the selfp r o m o t e d u p t a k e p a t h w a y i n H. pylori ( F i g u r e s 9 & 1 0 ) .  Interestingly, the l e v e l o f N P N uptake  w a s d r a s t i c a l l y r e d u c e d u n d e r a c i d i c c o n d i t i o n s ( F i g u r e 11).  T h e s i g n i f i c a n c e o f this latter  f i n d i n g i s u n c l e a r a n d i t i s n o t k n o w i f i t i s t h e r e s u l t o f m e m b r a n e s t a b i l i z a t i o n at a c i d p H , reduced p o l y m y x i n B b i n d i n g , or other nonspecific p H - i n d u c e d alterations i n  H. pylori  physiology. Incubation o f 12A).  E. coli  w i t h N P N produced a basal level o f 20 fluorescence units (Figure  T h e a d d i t i o n o f 0 . 6 4 u.g p o l y m y x i n B t o t h e m i x t u r e r e s u l t e d i n t h e r a p i d u p t a k e o f N P N  w h i c h r a p i d l y r e a c h e d a m a x i m u m l e v e l . U p o n r e a c h i n g the m a x i m u m l e v e l o f N P N a c c u m u l a t i o n b y the c e l l s , the f l u o r e s c e n c e l e v e l b e g a n to g r a d u a l l y d e c r e a s e i n the p r e s e n c e o f a p r o t o n m o t i v e f o r c e ( P M F ) consistent w i t h the active e x t r u s i o n o f N P N b y the cell's e f f l u x systems. D i s s i p a t i o n o f the p r o t o n m o t i v e force b y p r e i n c u b a t i o n o f the c e l l s w i t h the u n c o u p l e r C C C P c o m p l e t e l y a b o l i s h e d the e x t r u s i o n o f N P N b y the cells.  T h e s e r e s u l t s f o r E.  coli  aeruginosa.  w e r e s i m i l a r to those p r e v i o u s l y o b s e r v e d b y L o h  et al.  (1984) for  P.  I n c u b a t i o n o f H. pylori i n t h e p r e s e n c e o f N P N p r o d u c e d a s i g n i f i c a n t l y h i g h e r b a c k g r o u n d l e v e l o f f l u o r e s c e n c e c o m p a r e d to  E. coli  (Figure 12B).  o f f l u o r e s c e n c e i n d i c a t e d that either the outer m e m b r a n e o f  This high background level  in vitro-grown H. pylori  was  p e r m e a b l e t o h y d r o p h o b i c c o m p o u n d s o r t h a t t h e r e w a s a l a c k o f a c t i v e e f f l u x i n in v z Y r o - g r o w n  H. pylori. with  T h e a d d i t i o n o f p o l y m y x i n B r e s u l t e d i n the r a p i d u p t a k e o f N P N s i m i l a r to that seen  E. coli.  I n contrast, o n c e the f l u o r e s c e n c e l e v e l h a d r e a c h e d its m a x i m u m l e v e l it d i d not  d i m i n i s h o v e r the t i m e c o u r s e o f these e x p e r i m e n t s s u g g e s t i n g that NPN.  H. pylori  d i d not efflux  O n e potential e x p l a n a t i o n for the l a c k o f any detectable e f f l u x a c t i v i t y w a s the  d e e n e r g i z a t i o n o f the c e l l m e m b r a n e o v e r the course o f the e x p e r i m e n t s .  However,  examination  57  Figure  9.  M g C L _ inhibition o f p o l y m y x i n B-stimulated N P N uptake in  Helicobacter pylori. H. pylori i n t h e  N P N u p t a k e assays w e r e p e r f o r m e d u s i n g 6.4 p g / m l o f p o l y m y x i n B w i t h p r e s e n c e o f 0, 1, 10, 25 or 5 0 m M M g C F . . T h e p r e s e n c e o f M g C l the l e v e l o f N P N u p t a k e b y the cells.  2  i n the assay b u f f e r r e d u c e d  The experiments were performed 3 times and  r e p r e s e n t a t i v e d a t a from o n e e x p e r i m e n t i s s h o w n .  B a s a l l e v e l o f N P N u p t a k e i s d e f i n e d as 0  f l u o r e s c e n c e u n i t s a n d f l u o r e s c e n c e i s e x p r e s s e d i n a r b i t r a r y u n i t s (a. u.). as t h e c h a n g e s i n f l u o r e s c e n c e r e l a t i v e t o t h e c o n t r o l ( 0 m M Mg  2  +  MgCl2).  is c o m p e t i n g w i t h p o l y m y x i n B f o r b i n d i n g sites o n the L P S o f  R e s u l t s are expressed  T h e s e d a t a suggest that  H. pylori.  58  8 -,  -1 . . -2 -3  -  1  10  100  [Polymyxin B] Ug Figure  10.  membrane.  Mg  2  +  i n h i b i t s p o l y m y x i n B p e r m e a b i l i z a t i o n o f the  H. pylori  Helicobacter pylori  outer  w a s r e s u s p e n d e d i n H E P E S b u f f e r ( p H 7) c o n t a i n i n g 0, 10 o r 5 0  m M  M g C ^ . N P N w a s a d d e d to 10 m M a n d the s p e c i f i e d a m o u n t s o f p o l y m y x i n B w e r e a d d e d to the c e l l s o l u t i o n a n d t h e m a x i m u m l e v e l o f f l u o r e s c e n c e w a s r e c o r d e d on a c h a r t r e c o r d e r . T h e e x p e r i m e n t s w e r e p e r f o r m e d 3 t i m e s a n d r e p r e s e n t a t i v e d a t a f r o m one e x p e r i m e n t i s s h o w n . B a s a l l e v e l o f N P N u p t a k e i s d e f i n e d as 0 f l u o r e s c e n c e u n i t s a n d f l u o r e s c e n c e i s e x p r e s s e d i n a r b i t r a r y u n i t s ( a . u.).  T h e results s h o w that the M g 2 + i n h i b i t s the u p t a k e o f N P N b y the c e l l s  p r e s u m a b l y b y c o m p e t i n g w i t h p o l y m y x i n B f o r b i n d i n g s i t e s o n the c e l l s L P S .  59  120  100  S3 u  a I-  o S  •  PH4  •  PH7  80  60  40  20  10  100  200  [Polymyxin B] ug  Figure  11.  E f f e c t o f p H o n p e r m e a b i l i z a t i o n o f the  polymyxin B.  H. pylori  Helicobacter pylori o u t e r m e m b r a n e 4 or p H 7 w a s used i n N P N  r e s u s p e n d e d i n H E P E S b u f f e r at p H  experiments w i t h the listed concentrations o f p o l y m y x i n B . T h i s experiment w a s  by uptake  performed  o n c e . B a s a l l e v e l o f N P N u p t a k e i s d e f i n e d as 0 f l u o r e s c e n c e u n i t s a n d f l u o r e s c e n c e u n i t s a r e e x p r e s s e d i n a r b i t r a r y u n i t s ( a . u.). U p t a k e o f N P N w a s d r a m a t i c a l l y r e d u c e d at a c i d p H .  60  Figure  12.  Uptake o f 1-N-phenylnapthylamine by  Escherichia  coli  (panel A ) and  Helicobacter  pylori ( p a n e l B ) . I n c u b a t i o n o f t h e c e l l s i n t h e p r e s e n c e o f N P N a l o n e p r o d u c e d a s i g n i f i c a n t l y higher background level of fluorescence in  H. pylori  than in  E. coli  (panel A and B , dashed  line). T h e a d d i t i o n o f N P N a n d p o l y m y x i n B t o the cells resulted i n the r a p i d a c c u m u l a t i o n o f  H. pylori ( p a n e l A a n d B , s o l i d l i n e ) , h o w e v e r , N P N w a s n o t a H. pylori. I n c u b a t i o n o f E. coli w i t h C C C P p r i o r t o t h e a d d i t i o n o f N P N a n d p o l y m y x i n B h a l t s t h e e x t r u s i o n o f N P N b y E. coli ( p a n e l A , d o t t e d l i n e ) . P r e i n c u b a t i o n o f H. pylori w i t h C C C P c o m p l e t e l y a b o l i s h e d t h e u p t a k e t o N P N b y t h e c e l l s NPN  by both  E. coli  and  substrate for e x t r u s i o n i n  (panel B , dotted line). T h i s experiment was performed six time and representative data f r o m o n e e x p e r i m e n t are presented.  61  o f the c e l l s b y p h a s e contrast m i c r o s c o p y s h o w e d that the c e l l s w e r e a c t i v e l y m o t i l e w h i c h suggests that the c e l l s m a i n t a i n e d a p r o t o n m o t i v e force t h r o u g h o u t these e x p e r i m e n t s . Regardless, the  H. pylori  c e l l s w e r e p r e i n c u b a t e d w i t h 18 d i f f e r e n t p o t e n t i a l c a r b o n s o u r c e s ( s e e  M a t e r i a l s a n d M e t h o d s ) to see i f the a d d i t i o n o f these c a r b o n sources c o u l d energize active efflux o f N P N .  T h e e x p e r i m e n t s w e r e a l s o r e p e a t e d at p H 4 a n d p H 9 i n t h e a b s e n c e o f a  carbon source i n a n attempt to induce a n artificial P M F .  H o w e v e r , neither the a d d i t i o n o f these  c a r b o n sources n o r the alteration o f the assay m e d i u m p H w e r e resulted i n the extrusion o f N P N by  H. pylori  s u g g e s t i n g that N P N w a s not a substrate f o r a c t i v e e f f l u x b y  in vitro-grown H.  pylori. Pretreatment o f  H. pylori  w i t h as l i t t l e as 1 u M o f t h e u n c o u p l e r C C C P , f o r u n k n o w n  reasons, c o m p l e t e l y a b o l i s h e d the p o l y m y x i n B - s t i m u l a t e d uptake o f N P N i n these experiments w h e r e a s p r e t r e a t m e n t w i t h a z i d e o r arsenate h a d n o e f f e c t ( F i g u r e 13). C C C P n o r the concentrations generally used i n i n h i b i t e n e r g y d e p e n d e n t e f f l u x ( L o h et al,  E. coli  (5 p M ) a n d  I n contrast, neither 1 u M  P. aeruginosa  (250 u.M) to  1984), h a d any effect o n the b a c k g r o u n d l e v e l o f  N P N u p t a k e b y these c e l l s . T o r u l e o u t the p o s s i b i l i t y that C C C P a f f e c t e d the i n t e r a c t i o n o f p o l y m y x i n B w i t h the outer m e m b r a n e o f polymyxin B with  pylori  H. pylori.  H. pylori,  I analyzed the interaction o f dansyl-labelled  T h e results o f these e x p e r i m e n t s s h o w e d that C C C P - t r e a t e d  b o u n d a n i d e n t i c a l a m o u n t o f d a n s y l p o l y m y x i n B as d i d t h e u n t r e a t e d c o n t r o l .  H.  This  suggests that C C C P treatment d i d n o t affect the i n t e r a c t i o n o f p o l y m y x i n B w i t h the outer membrane of  H. pylori,  but instead prevented uptake o f N P N  b y a m e c h a n i s m that w a s  inhibited b y C C C P .  62  [CCCP] u M  F i g u r e 13. Inhibition o f p o l y m y x i n B-stimulated N P N uptake b y C C C P in  H. pylori  Helicobacter pylori.  11637 w a s preincubated w i t h the s p e c i f i e d c o n c e n t r a t i o n o f C C C P for 5 m i n p r i o r to  the a d d i t i o n o f N P N a n d 6.4 p g / m l o f p o l y m y x i n B . T h e e x p e r i m e n t s w e r e p e r f o r m e d 3 times and representative data f r o m one experiment is s h o w n .  B a s a l l e v e l o f N P N u p t a k e i s d e f i n e d as  0 f l u o r e s c e n c e u n i t s a n d f l u o r e s c e n c e i s e x p r e s s e d i n a r b i t r a r y u n i t s ( a . u.).  C h a n g e s i n the  f l u o r e s c e n c e l e v e l w a s r e c o r d e d o n a chart r e c o r d e r . S t e a d y state l e v e l s o f f l u o r e s c e n c e w e r e r e c o r d e d a n d d a t a p r e s e n t e d is r e l a t i v e to the untreated c o n t r o l (0 p M C C C P ) . C e l l c u l t u r e s w e r e p r e i n c u b a t e d w i t h s o d i u m a r s e n a t e ( A R S ) a n d p o t a s s i u m c y a n i d e ( K C N ) f o r 15 m i n p r i o r to assay initiation.  63  2.4  Accumulation of H-tetracycline and H-chloramphenicol by Helicobacter pylori. 3  3  S i n c e N P N w a s n o t a s u b s t r a t e f o r a c t i v e e f f l u x b y H. pylori, I e x a m i n e d t h e 3  3  accumulation o f H-tetracycline and  3  3  H - c h l o r a m p h e n i c o l b y H. pylori; H - t e t r a c y c l i n e a n d H -  c h l o r a m p h e n i c o l are t y p i c a l l y substrates for a c t i v e e f f l u x b y R N D m u l t i p l e d r u g e f f l u x systems. Incubation o f  H. pylori  26695 separately w i t h H - t e t r a c y c l i n e and H - c h l o r a m p h e n i c o l resulted 3  3  i n the a c c u m u l a t i o n o f r a d i o l a b e l b y the cells. Pretreatment o f  H. pylori w i t h  a n a p p r o x i m a t e l y 5 0 % r e d u c t i o n i n the a c c u m u l a t i o n o f b o t h  H - c h l o r a m p h e n i c o l ( F i g u r e 14)  and  3  C C C P resulted i n  H - t e t r a c y c l i n e (not s h o w n ) r e l a t i v e to the untreated c o n t r o l . T h e s e results w e r e c o n t r a r y to  what w a s expected for asystem i n w h i c h active efflux played a role. I f active efflux were i n v o l v e d , the steady state l e v e l a c c u m u l a t i o n o f a n t i b i o t i c s h o u l d i n c r e a s e f o l l o w i n g treatment w i t h C C C P , s i n c e t h e s t e a d y state l e v e l o f a n t i b i o t i c is d e t e r m i n e d b y the b a l a n c e o f i n f l u x a n d e f f l u x ( M a et al, 1 9 9 6 ) . T r e a t m e n t o f m o s t b a c t e r i a l c e l l s w i t h C C C P n o r m a l l y n e g a t e s p r o t o n dependent e f f l u x ( L e v y , 1992) (by d i s s i p a t i o n o f the P M F w h i c h energizes e f f l u x ) a n d therefore w o u l d r e s u l t i n an i n c r e a s e i n the s t e a d y state l e v e l o f the a n t i b i o t i c . T h e r e s u l t s f o r  H. pylori  were therefore consistent w i t h an active uptake m e c h a n i s m ( L e v y , 1992) for these antibiotics or alternatively the p a r t i t i o n i n g o f the a n t i b i o t i c s across the c e l l m e m b r a n e a c c o r d i n g to a m e m b r a n e p o t e n t i a l ( N i k a i d o & T h a n a s i . 1 9 9 3 ) . It i s i n t e r e s t i n g t o n o t e t h a t t h e s e r e s u l t s a r e s i m i l a r to those o f M o o r e  et al.  for the u p t a k e o f r a d i o l a b e l e d m e t r o n i d a z o l e b y  H. pylori  ( M o o r e etal, 1 9 9 5 a )  64  F i g u r e 14. C C C P i n h i b i t i o n o f H - c h l o r a m p h e n i c o l uptake b y 3  (solid bars) and  H. pylori  Helicobacter pylori. H. pylori  pretreated w i t h 4 0 u M C C C P (open bars), w e r e incubated separately  i n t h e p r e s e n c e o f H - c h l o r a m p h e n i c o l . A l i q u o t s w e r e r e m o v e d at 1, 1 5 , 3 0 a n d 4 5 m i n u t e s 3  f o l l o w i n g t h e a d d i t i o n o f H - c h l o r a m p h e n i c o l a n d p r o c e s s e d as s t a t e d i n t h e M a t e r i a l s a n d 3  M e t h o d s s e c t i o n . T h e a m o u n t o f r a d i o a c t i v i t y o n the filter w a s d e t e r m i n e d b y s c i n t i l l a t i o n counting.  T h e r e l a t i v e u p t a k e i s d e f i n e d as t h e p e r c e n t a g e o f r a d i o a c t i v i t y ( c p m )  b y the cells. T h e e x p e r i m e n t s w e r e p e r f o r m e d 3 t i m e s w i t h 3 different 744 and 754). tested  H. pylori  accumulated isolates (11637,  P r e s e n t e d data is f r o m 1 e x p e r i m e n t a n d is representative o f the data f r o m a l l the  H. pylori  strains. T h e s e results suggest that p r e t r e a t m e n t o f  the u p t a k e o f H - c h l o r a m p h e n i c o l . 3  H. pylori  w i t h C C C P inhibits  S i m i l a r results w e r e observed w i t h H - t e t r a c y c l i n e . 3  65  Chapter 3. Sequence analysis of the Helicobacter pylori Hop protein family: Identification of a conserved structural motif. 3.0 Introduction E x n e r et al. ( 1 9 9 5 ) p r e v i o u s l y p u r i f i e d , c h a r a c t e r i z e d t h e p o r e f o r m i n g a b i l i t y o f a n d obtained the N - t e r m i n a l a m i n o a c i d sequences for f i v e p o r i n proteins f r o m  pylori.  in vitro-grown H.  T h e N - t e r m i n a l a m i n o a c i d sequences o f four o f the f i v e proteins c o n t a i n e d strong  sequence identity and these proteins w e r e subsequently n a m e d the H o p f a m i l y ( H e l i c o b a c t e r outer m e m b r a n e protein) w i t h the i n d i v i d u a l proteins b e i n g n a m e d H o p A - E . o f the  H. pylori  W i t h the release  2 2 6 9 5 g e n o m e sequence b y T I G R this f a m i l y w a s e x p a n d e d to 32  members  ( T o m b et al., 1 9 9 7 ) , a m o n g w h i c h w e r e p r o t e i n s p r e v i o u s l y i d e n t i f i e d as a d h e s i n s ( l i v e r et al., 1998).  M e m b e r s o f the H o p f a m i l y ranged i n size f r o m 85 to 1230 a m i n o acids and contained  e x t e n s i v e a m i n o a c i d s e q u e n c e c o n s e r v a t i o n ( T o m b et al., 1 9 9 7 ) .  T h e role o f the conserved  r e g i o n s a m o n g the H o p proteins is u n k n o w n , but it w a s suggested that the c o n s e r v e d n u c l e o t i d e s e q u e n c e s o f the g e n e s m a y f u n c t i o n i n h o m o l o g o u s r e c o m b i n a t i o n to generate rearrangements a n d antigenic diversity o r i n adaptive response to changes i n the ( B e r g et al., 1 9 9 7 ; T o m b et al., 1 9 9 7 ) . variation among  H. pylori  chromosome environment  Several studies have suggested significant g e n o m i c  isolates ( A k o p y a n z  et al,  1992; G o  et al,  1996; Jiang  et al,  1996).  I n this chapter I d e s c r i b e m y sequence a n a l y s i s o f the H o p f a m i l y w h i c h l e d to the d e v e l o p m e n t o f the h y p o t h e s i s that the c o n s e r v e d m o t i f s a m o n g the H o p f a m i l y p r o t e i n s are a c o n s e r v e d s t r u c t u r a l m o t i f f o r a f a m i l y o f (3-barrel p r o t e i n s . H o p E as a m o d e l p r o t e i n , b y i n s e r t i o n a l m u t a g e n e s i s .  I tested this hypothesis, u s i n g  T h e results o f these studies i n  c o n j u n c t i o n w i t h the sequence a n a l y s i s o f the H o p f a m i l y i n  H. pylori  J 9 9 , s u g g e s t e d that the  66  c o n s e r v e d sequences a m o n g the H o p f a m i l y do not f u n c t i o n i n r e c o m b i n a t i o n but instead serve as a c o n s e r v e d s c a f f o l d i n g s t r u c t u r e f o r a f a m i l y o f P - b a r r e l p r o t e i n s . 3.1  Sequence analysis of the H o p f a m i l y using the B L O C K S M y analysis o f the  method  H. pylori 2 2 6 9 5 g e n o m e r e v e a l e d a n a d d i t i o n a l t w o m e m b e r s o f t h e  H o p f a m i l y ( O R F s 0101 a n d 1066) thus increasing the total n u m b e r o f m e m b e r s o f the H o p f a m i l y to 34.  T h e 34 m e m b e r s o f the H o p f a m i l y w e r e used i n m u l t i p l e sequence alignment  a n a l y s i s u s i n g t h e G i b b s m o t i f s a m p l i n g a l g o r i t h m ( N e u w a l d et al, M A C A W  1995) i m p l e m e n t e d w i t h the  u s e r i n t e r f a c e ( N C B I , W a s h i n g t o n , D . C . ) w i t h a m a x i m u m a l i g n m e n t w i n d o w o f 18  amino acids and a m i n i m u m alignment w i n d o w o f 6 amino acids. T h e results o f this analysis a r e s h o w n i n F i g u r e s 15 a n d 1 6 . F i g u r e 15 s h o w s a g r a p h i c a l v i e w o f t h e a l i g n m e n t w i t h i d e n t i f i e d B L O C K S o f c o n s e r v e d a m i n o a c i d s e q u e n c e i n b l a c k w h i l e F i g u r e 16 s h o w s the a m i n o a c i d s e q u e n c e o f the m a j o r B L O C K S that w e r e i d e n t i f i e d a n d s h o w n i n F i g u r e 15.  The  B L O C K S a l i g n m e n t r e v e a l e d t h a t t h e r e a r e at l e a s t m a j o r 8 c o n s e r v e d m o t i f s a m o n g t h e H o p f a m i l y a n d that these c o n s e r v e d m o t i f s w e r e separated b y v a r y i n g lengths o f n o n - c o n s e r v e d a m i n o a c i d s e q u e n c e s . A d d i t i o n a l l y , these results s u g g e s t e d that the H o p f a m i l y c a n b e b r o k e n d o w n into t w o subfamilies, those w i t h (24 proteins) and those without (10 proteins) sequence c o n s e r v a t i o n at t h e i r N - t e r m i n i .  T h e s i g n i f i c a n c e o f the N - t e r m i n a l B L O C K o r w h e t h e r there is  a structural o r f u n c t i o n a l b a s i s for s u b g r o u p i n g the H o p f a m i l y is not k n o w n .  67  mm  0  1  50  100150 200 250 300 350 400 450 500 550 600 650 700 750 800 850 900 95010001050110011501 200125013001350140014501500 I I I . 1 1 I 1 I I 1 I I I I I l l l l l l l  1  1 l  HP0025  mm  CD  m  HP0079 HP0101  HP0227  •  HP0252  CD  HP0254  »  m  • mm m=>  m> m=D • m= m MD » • n mm m 0B=i  HP0317  CJ  HP0324  LZZZZ2  •=)  HP0472  CD  *D  HP0477  CD  HP0638  a  m=D  HP0671  =  •=>  1  [—j  • •  w=mp wt  • • mmcDm  cn  mm  HP0725  B  HP0796 HP0896  CD  HP0912  CD  HP0913  C=D  1=3  HP0923 HP1086  a  HP1107  =  •  [=i  HP1177  CD  HP1243  CD  HP1342  •  F i g u r e 15.  1 • •  KD  • i •> »  •  E  •=  WD  •  m  K B  •  mDrnz  •  •=1 wmv m ••=1 1=1 •=> r * • (•=> *- •=> • ••=) WD WfD•=>•? • m=D m •=> • • - V •=i  - •  V  HP1113 HP1156  r> •= WDUP m t- •=• u-mi m *D •=> w=m: m WD M' i mm m m Wt>mm m • V I m wt=>  1—  HP0722  pylori  w=m m  m=D  I  =  HP0229  HP0706  WD  •=>  HP0078  HP0127  m=mf m  n  HP0009  •=> • •=> • mmvD m •=> * •=• • • = i WD mzj l = * P • ••=>  ••=!  :  •=>  •=>  m >  m  •-]  m=D  WDW  •  l=i  •=>  S c h e m a t i c o f i d e n t i f i e d B L O C K S o f c o n s e r v e d a m i n o a c i d s e q u e n c e a m o n g t h e H.  H o p / a d h e s i n f a m i l y o f outer m e m b r a n e proteins. C o n s e r v e d B L O C K S were identified  u s i n g the M A C A W  c o m p u t e r p r o g r a m ( N C B I , W a s h i n g t o n D . C . ) a n d are a l i g n e d a n d shaded  b l a c k ; u n c o n s e r v e d a m i n o a c i d s e q u e n c e is represented b y the u n s h a d e d bars. B L O C K S are separated b y v a r y i n g lengths o f unconserved amino acid sequence. H P 1175 w a s omitted f r o m the f i g u r e due t o s i z e constraints.  68  VO  o z M Cu z X  Q Z M Cu z  > Q  HH  > HP  Q  1 1 1 1 1 1 1 1 1  En C O o O  1  O X  1  > O>  1 1  CO  1  >• Cu  1 1 1  z X  HP  1 1 1  >  > o  1  >H  > Q  Q  <:  Q  z z z ec o  o Cd a M O  CO CO  CO CO  cu  HH  z z EH a tu Cu 03 C O In Cu E H o CO a EH > CO CO Z Cu NS  M X  NS  z  az  1  Q Cu o  X  tn  1  CO  HH  1 1 1 1 1  Cn a I—1 z M < CU Cu z z Cu X  o z M Cu z  > < Q  Q  HP  a EH  HP  2  o  o  X  X  < > o  1 a  •3  1 1  03  1 1  o  2  Q  1 1  a z  CO  1 1 1 1 1 1  1 Cd z HP ec 1 < 1 a z 1 z z CO z 1 X X X X Q a CO J >H Cu 1 > Cu Cu o >H 1 1 o o o o 1 >H > H o >H X >H H H C O 1 03 03 1 HH Cu 1 o Cl < o 15 1 s s C O Cu 1 03 03 1 03 1 1 03 NS 1 Ui 1 1 EH Ui z CJ NS 1 Ui z 1 O o O 03 tu Cu Cu H H  EH  a  a; rt fa  1  CO  HH  HP HP CO  o  rt o X  03 03 Q Cd Q 3 Z X Cu H H M Cu > Z Z z X S X  > Cu Cu «: eC HH a Q Q a a EH EH < > oo O O O Cu 13 > fiC o o 13 > O o X X X X X HH  HH  Cu  >  Cu  CO  Z o  z  z>  < < CO  HH  H  ft  > z NS >H Cu H P EH Cu z >H z EH X C O CO Q NS NS NS O X 1—1 HH Cu X X X Z C O ec < <: CO X 33 X < Z Z o Cu X X X z Cu Cu Z  > < CO CO  HH CO  13 HH  o H  Cu O X Q Cu Cu Cu H H Cu Cu Cu Cu Cu Cu o o < o < X X X X X X X X X X 05 03 03 C3 03 HP M HH HH o o O o o Cu s Cu > H a Cu z z 03 NS NS C O NS z NS ui NS NS NS z NS O o EH o Cu Cu Cu Cu Cu  a a a a 2  cu  O HH z a Z a Cu a z Z D Cu M HH E H 1—1 HH Cu HH Cu S > HH z z z z z Q s > X HH X <  ES  Cu a « X o > a  HH  1—1  1 S 1 z z EH C O 13 HH < O HH CO X Z z X Cu O NS NS EH Cu C O CU cc CO X Cd Ui 03 E H HH 13 Cu O CO X C< X O Z z O Cu X s S Q Cu H H HH Cu Cu Cu o o X Cu X X X > 03 0 3 03  l> Q  2  HH  X Q  lC3 —l  HH  a  «:  HH HH  H  HH  CO  CO  X  00  iu H H > C3 Cu 13 HH 13 > HH Z a Q CO Cu O CO EH HH e> Z 13 Cu Z > > tu C O C3 13 Cu > Cu Z 13 > 1  u  X C3 X Q X Cu  O  HJ  a X 13 Cu Cu  O PQ  U  v© 1—1 <U ha  s  ex  fa  z o  CO  <  <  CO  CO CO EH  ft  o  HP  O  CO CO  O  HP  O  <  CO o Cd CO O CO HH HH o HP X O o EH  > CO < 03 > 03 Cu Cu cu Cu z o X z  O  1  i  1 1 1 1 1 1 1 1 1 1 1 1 1  Q '  HP  Cd  O  CN]  O  O  O  1  1  LT> C O O  CU Cu X X  r-  o o Cu  l i l l l i i i I l i  1  |  I t I t I I I I I 1  l i i i l  I I I  I  OP  CO HP  o  < Cd  O  o X Q  o X o  HP  HH  o  HH  o  1  HH  HH  o X o  > >  CO CO EH  EH  o X Q M  > Cu  <-H r -  r-  cn  rH  CM CM O  CM CM O  O  O  HH  o X o  EH  CM O  o  LO CM  H^  Z  CU  HJ  C3 X  > 03  Cu (3  Cu S CO EH  S  a  HP  HH  o HP  ft  ui HH  ft  Z  <  CM r CM r - r CO CO o Oi X  o  o cu  cu X X  03  HP  Cu z Z X, X > X HP  Z  03 03 CO Cu  HH  Hi HP  HH  a  Cu Q  s  03 X  s  HH  HH  O  Hp O  > >  aD  HP  §  X X o o > > o o H O O  HH  o  HH  HP  O  z  Cu  .—1  o  1 1 1 1 1  1  O 1—1  1 1  O  ro  CU cu cu X X X  >  ^3 E H O Cu HH S O Z  HP H  ft  a <  1 1  1 1 1 1 1  1  CM CM ro PJ  X  03 EH  Cu > Cu Cu Cu z z z X X X HP  a< a  (3  <  X z o X  a  < o M  a O  >  z o X  a a  HP  < X  Cu  H  >  CO  O  Cu  > >  o  O  2 EH  1  Pn  1  Q Q  1  ] 1  O  1 1  1  CTi ro eu X  a  X  > X  CO  ooo >  H  Hp  I—II—I  >  o o o o  CU  O o o o z Z z z  co 2 Z z  CO  Z  HP  22  < a < 2  HP HP  ft  CO cC KC CO Cd < < fi! X Z Z Z Cd NS <C H P  22z  Z  i i i i i i  1  o  CU  O  1  2 >  > > o o o o HP  o X o  > EH  1  ] 1 1 1  HP  Cd X  1  tu H  1  t 1  O  1  Cu tu Cu  2  1  O  O  1  O  1 1  O  Q a Q Cd Cd Cd  CM  OS r H CO as O o  cn rH CS o  HP  1 1  1  Cu Cu cu C U X X X X  HP HP  „  os a o  o < cc < «;  2 Cu > EH O  HH  EH  X  HH  HH  z  <  o  CO CO o HP  HH  Cu  HP  Cu Cu  O  o  o  HH  2  HP  HP  >  rt <Cd aCd o CO HP  O  EH  o a a O X X X X CO o o CO CO > H P > CO o o O  2  HH HH  <  a a ro  SD  HH HH I-H  LO  CU X  X  HH  > ft  Cd  O  HH  a aX X o  o  HP  EH  EH  > > > CO CO CO  a  r~ o rH r—\ cx,  O  o X o  X X X Cu Cu X CO C M Cu Cu > Cu HP EH O o O z Z CO a z a Cd P3 03 a ft Cd Cd Cd  CO CD CM CD CTi O O  22 2 Cd  Cu Z NS O  ft  HP  ooo  co O  HP  > o X CO o o  i i i i i i i  1 1  Cu X  X  o z  2  z  i  1  I—II—I HH  X <  2  co  1 1  (4  3 03 03 03 03 03 03  <  1  >H  o cu X  CO < CO  O  Cu  HP  ii  [  CO CO  <;<;<;  H H o o l-H o Cd Cd z NS z z < cC <C  1  1  r-  X  Z Cu  > o  CO En  in CM  O  HP >  HP HP  n  1  CO  > CO CO CO H3 z z z CO CO Cu Cu Cu Cd CO Cu Cu Cu S*3 Cd Z CO Z O < CO CO CO  HP  co  ft  Q  Q  O  H  ft  S  Q  > > >  Odd CO Cu Cu X HH i Cu Cu C u C u C u C u C u C u C u C u HP 13 O O O O X X X X X X X X X X X X 03 03 CO Cu Cu H P H P ft HP > J HP C3 O X o o o o o o > a ft > Cu Cu S 3 S z t s X CC Ui Z z S N3 03 03 M Q Cd z w z > Cd O W Cd y; ft E H « O O O U ^3 EH C U O Cu Cu I H Cd NS Cu Cu Cu Cd O Z > X Cu Cu Cu [u > Cu > Cu O o a o Cd U< S X O N3 N3 N3 NS ts o o X X X X X O O o o o O HP > > > HP > O Ui  Cu  W  SS S  CO  co > a ._ EH  J H <;  > £  a z Cu a O HU* EH Z EH O C3 Z CS o _ > Cu Cu  Ui  2  HP  CO I—I I—I  z  z w  1  H  HH J H5  J  > o  EH  \D  Z  X D  z  co  1  O  S  Q S  eC Cu o o O o z Z  Cd Q < O O ft < X O  o X z  X X s > «; o z Q  J  I—I Hp  Cu Cu Cu  03  Cu X rt X >  2 < a ft o o o  ft  o o  Z  > 2  >  O O Z CO Z O O O  HP  HH HH  x x  Cu Cu O O  O  W  o CO  >  a x cu  «  « a  >  O  CO  Cu 13 < D CO Q Cu Q CO E H E H HH C3 Cu S H s < O o o o 13 C3 13 C3 CJ) 13 Cd X J EH Cu > ft > Cu o P S > > J > O O O o O O o o o C3 C3 X X X X X X X X  < a < C3  rt cC  n  CO r VD VD O  1  « «  < o z  Cd Cd Cd CO  1  rt  Q O rt X  <  X Cu o z  1  > Q Q Q CO C3 CO CO CO Q > CO C O C3 z CO C O C O z z z z > Cu Cu Cu u E H CO Cu Cu Cu CO CO C O z 03 C O CO C O Cu ! * 3 HP C3 HH HH HH Cu > X Cu X Cu CO C3 o C3 < X X X < z Z z < z X X X X Q CO Cu Cu Cu J Cu Cu Cu Cu C O Cu e> o o > U X X X X X X X X Cu X 03 03 03 03 HH Cu H H •4 ID u C3 C3 C3 s s s X l—l 03 y. 03 03 cc Cd CO C O X, « « Cd Cd u C3 C3 C U U Cu Cu Cu Cu Cu HH  H  X CO o o o Cd > HP o Cu X CO HH  a z  — iHH i 0 3  1—1  O z z z HP  >  a  O  2  s  a z  a a a a Cu  z  Cu  HH  cu 0J X  CU CU CU CU CU X X X X X X  cc 13 X  CO Q  a  ro  H3 H  rt <  a a Q ^*  C3  Ui  z a  X X X Cu X Cu Cu H P Cu o o z O o z Q EH > Cd Cd Cd S Cd Cd  CM LO  <  P > > < CO > HZ o > o CO o o  2  Z CU  l—i  CO  X HH X CO ca CO 06 M o o O CO HH EH O X o o O Cd X X X Cu o z o O  rt a  o Cd O CO o  a  CM  o  HP  Cu X Cu Cu Cu > ft o o o z Q Q Q Cd Cd Cd Id Cd  O  o a  > > ft 03 ft  2 O  o  i 03 Q Z  1  CTi ro o  EH  CU  HH  3, z Z HP a <:  HP  HP  a  s <  2 cxo a a < < z z  O a S > rt HH  HP  CD  HP  Cd  a  CD  PI O O  z  HP  o  CO HP O Q  s z  a  Cu Cu Cu o « O !>3 M X X X O O o > > >a EH Z  Cu Cu x o z > X Cu o o E Hi  Q i=C z z cu u:  H-1  < X  rt  2  HP  U  S  H^  rt X rt>a  o  Cu  O  a  Q  z 13 O 1 3 •4 Cu > > u O C3 C3 o o X X X s X  a >  > a o o M  >  HH HH  H H H P Cu o o o z Cu H H I—I H P o o o o Z g Z X M  z  HH H  Q  a cu Cu a feci X o >  HH  HH  o X Q s Cu HH H 5 C3 X CO X X EC X 03 03 03 < H H < HH Cu 13 O o o C3 C3 1—1 Cu H H Cu HH NS H H ts z 03 ui NS 03 s 03 NS a z ^3 Cd EH 1 o X 13 1 HH Cu Cu Cu Cu  a  a z H  a  X Cu  O  Q Q Cd  CO CM •ST  rH  rH  CU  HH CU  HH CU  X  X  X  CM CO .H  CU  CU  X  X  afe fe z a fe fe fe fe o fe c fe fe z fe fe fe fe <;fe fe fe z fe fe fe X X X X X X rf rf rf X X X X XX rf S > > rf rf > < X rf rf rf O S z z c j fe fe fe fe fe fe fe fe fe > fe > fe > > > > X X X X> X> XXX> XX > X> X XX X > X> X> X X XX XX X XX X 0 5z z u z z o a Z z rf z z z z z z z z z z > o C U HH HH HH H i Hi Hi Hi > X XX > X > z > XX > XX X X X XX z > > X > XX XX z X fe Z X HH X fe X fe X fe X i fe > fe fe > fe s fe > HH HH > > > > > > fe HHfe fe rf > fe > > Hfe > > > HH rf z fe < < > > C uX XXH X XX XX Xp X XX X X XX XXX rf > > s fe HH z fe H i H i • J Qfe fe H i fe a HH HH HH c uc u H3 fe X > >Sa zo C U C u O S O S o s O S O S O S S o sO S O S O S S O S O S O S O S O S 2 °5S HH O 2SO 2 rfSO e s N S o S O S hN O N S O S O S N S u O S O S O S O S sS s XO hihiO 2 fe I I XX W XX X X X s X HH X X X XX H z XX XX > a fe o o a aN a t Z S S N S z a N a c Z z N S c j •< H HH HH HH HH H i Hi H i fe fe > N > > > HH a oH S N S< > z o a fe a a HH N S N S rf Q H I HH N S HH Z X o N S z fe rf fe fe fe > < < > U o u XZ Orf HH <: o rf rf Oo «: HH O rf cc a z a rf rf o S c aa Hi s s a z s a w a c *S <: E rf fe > o S Q U z N S N S N S X fe fe rf fe fe fe X X rf X fe X fe X fe XX fe fe X aX X X X X X < HH X X XX HH X X X XX XXXXXXX XX X X XX S XX XX fe z fe fe fe X X fe O a z z z z z S N S z XN z z z a z z z z fe fe Uia Z > > Z H z z c ao z z Zz z Z fe X z Z z Z E n z z z z z z X hiz HH Hz H X X tH X > 5] fe HH H HH s HH fe rf > < > > c uc u C U C uC a u C U c u rt fe HH HH > > > N S N S N S N S N S N S O S N S N S N S O S N S N S N S a S N S fe HH fe fe H i N > hi « > ( > > > ^ O > H i fe fe cj fe fe > O> > > OHH rf > > HH O c j> J O S HH HH HH HH HH HH S J HH s O > < s HH ww wId wQ u w H fe W fe u ww fe B felfe fe Ufe fe fe fe fe HH fe fe fe fe fe fe fe HH >j cj fe c > > > > c j 0 o o w u W a fe fe fe fe fe fe fe «: X a c a ac ao c ac ac a Zc ac z ac as rf X ccz z fe z a a a a x o o S c ae > c ac aa a a z a X a caQa a wO a fe XX N S Z CO l l 3 — CO  2  CO  HH  CO  NS  XX  CO  CO  HH  CO  CO  2  NS  OS OS  OS  OS  1  CJ H! H! CO  HH HH CO  EH  2  1  CO  1 1  1 1  1 1  1  1  1  1  1 1  1 1  1  NS  1  1  1  1  1  1  1  1  1  CO  M  CO EH  CO  CO  EH  i-t  1 1 1  1 1 1  1—1 1—1 M  1  H!  1 1 1  CJ CO  1  z z 2  EH  a ; J j oc j Hi z z  1 1 1 1 1 I 1 (  1 1 1  CO  M  CO  EH OJ  EH OJ  NS  H  OJ  OJ  H  EH  CJ  CO  CO  CO  CJ  HH  EH  CO  2  EH CJ HH  CO  EH EH CJ  CU EH  CJ CJ  CO  M  M  EH  1  EH  1 1  1  1  EH  EH  H  2  M  H  EH  EH  OJ  h  OJ  H  0 J CU HH  M  EH  CU M  EH  HH EH  CU M  EH  ( J  EH 1—1 H !  CU  CU  1—1  EH  1—1  HH  CJ  CO CO  CO  1  2  CO  CO  CO  1  1—I OJ HH  1 1 1  M  M  CJ  CJ  CJ  HH  HH  1—1  CJ  CJ  CJ  CJ  1—1  CJ  CO  EH CO  NS  CO HH  EH  CJ  HH HH  EH  <J  2 CO  CJ  CJ  2  2  CO  CO  CO  X  EH  EH  EH  HH  1—1  1—1 H H  EH  EH  CO  EH  X  EH  OJ  M  H  EH  CU  CU  CU  HH  HH  1—1  1—1 1—1  NS  HH  NS 1—1  CJ  CJ  ( J  CJ  CJ  CJ  HH  2 CJ  CJ  CJ  X  X  X  OJ  CU  CU  H!  1—1  EH  EH  1  HH CO  H  M  CO  EH  fet 1—1 S  CO  CJ  OJ EH  1—1  CJ  CJ  HH  X  I  X  CO  s z z z  1  c jz o Z c az HH O S S z z Xz z z z O z z z 0S CJ C J EH H! EH X 2 EH 2 s EH Hi o s O S O S O S O S O S O S Ctf O S c da OS — i i J •H 1—1 Hi o HH HH X 2 HH c jc jo Oo Ou u o u OC J C J C J C J C J C J C J C J C J c j H H E H i j HH s HH HH HH 2 HH Hi z QZ a Z z z z z N S S N S Z z Z Z z z Qa z N z HH C J HH HH s HH O U H! (-} HH H 3 HH HH C a HH S HH HH 2 HH HH O J H H HH HH HH M HH HH a a a a a a ooa a a a a a a a a a a a h h M i—i z z Z CO z z CO O S S XHi CJ z z z 2 c aN  1  s  3  3 CO EH  3 CO EH  CJ  CJ  CJ  1 1  o  1  fe u fe  CJ  1  CO  HH  t-t  1  o s  CO  1 1  CJ  US  M  1 1  1  CO  CO  1  EH  EH  H  CJ  2  HH  1  z  HH fe fe s fe hh a a a z Z X fe fe s s fe HH  1  M  1  HH  CO  1—1  Z  CO  1 1  EH  CD  EH EH  OJ  M  2  EH  EH  H  1  CO  CJ HH  X  CO  EH  CU  OS  EH  1  CJ  CO  3  US CO  1  1  CO  CO  Q  EH  1  CO  3  i—i  Ctj  CJ  1  1  I 1  CO CO  1  CJ  CO  CO  HH  HUNS  1  HH  l—l  1  CO  EH HH  EH  OJ  M  H!  CO  H-l  CJ  HH  X  3 CO  H CO  X  1  HH  Ul  CO  CO  1—1  CO  X  EH  CO  3  CO  OS-  NS  XXX  CO  i—i  HH  1—1  OJ OJ  OS  X  CO  CO  HH  CO  M  1 1 1  1 > C uf  1 1  «! > 2 2 2 > 2 > > >  H B > fe o CC O S s 2 2 fe > > fe > CH HJ HC Ji C>J HC Ji Hi - 1 2 Hi > fe > fe fe > a z Z Q fe fe fe fe > fe fe fe fe fe fe > > H i H i H i H i fe fe fe fe fe fe fe fe fe fe > fe fe fe fe fe fe fe fe > fe fe fe > fe fe rf fe a fe a fe 2 o fe fe a a  2  < . 2 >  2  2  >  z fe z z fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe rf fe fe fe fe fe fe fe fe fe fe s Xa s s 3 3 s s & s & s B s S fe X H H X a a Z Hz Z z z > a fe wa z Oo U U u <. rf c j U o <; <; <; < «: > HH HH HH HH HH HH HH H i rf H rf a rf e rf <: a o rt rf rf a rf z rf a rf rf rf rf rf rf rfi Hrfi > a wa a <: fe a rf a fe a HH < H i HH rf rf rf rf rf rf rf rf > < > > ju o fe c fej o fe Oo rf fe fe a o j c C jc j o Oo HH X X z fe fe Hfe fe fe rf fe fe Hfe > fe fe fe fe fe fe fe fe fe fe fe fe fe fe i fe n i HH HH fe fe fe HH H i i > c > o> j rfj c fe cj fe Uo fe o tj fe fe fe fe fe fe fe H i HH HH HH HH <; rf > fe z > > > > > O a a rf X S z fe fe z fe fe fe > rf a > > HH HH S HH HH Z fe fe fe > > fe N rf rf rf > fe 1 1 1  CO  CO  H  EH CJ  CJ J  M  M  CJ  CJ  1 1 1 1  CO  1 1  CJ  1 1  1 1  1 1  1  1  1  1  1  1  1  I  1  1  1  1  1  CO CO 1—1 M  1  1  1  1  EH  1  1  CO EH CJ  CO EH CJ  EH EH  CJ  EH  CO  i—i  1—1 H H  HH  1—1 i—i  i—i  CO  CO CO  EH CO  CO  H  H3  M  EH  M  CO  CO  CJ  CO EH  CJ  CJ  EH EH  HH  1—1 H H  M  CJ CJ  CJ CJ  H-l  CO CO  CO CO  CO  CO  CO  CJ CJ  HH CJ  CJ  1—1  CO  EH CJ  2  1—1 HH-  1—1  EH  CO  CO HH  EH  EH  3 CO  3 EH  CO  CJ  1—1  M  H!  EH EH  CJ  CJ  CJ  HH  HH  HH  HH  HH  HH  CJ CO  CJ CJ  CJ  CJ  CO  EH CJ  CJ  HH  X  X  EH CJ  H!  CJ  2 CJ H3 HH  HH EH CJ  CJ  HH  HH  HH  CJ H!  CJ  HH  CJ CJ  CJ CJ  CJ CJ  H!  CJ  CJ  2  CJ  CO  HH  CO  CJ  CJ  CJ  3  2  i—i  nC M c nL O C O c nH H r - r CM r- 0 0H H C D C M i nC D C D C M r oC O C D r oC D ~c r~r nc ni—1 H H C M C D o H H IT) o CN] — r o CM CM CM L O LO r or -o CM CM c CM r CO c nOt-H <-H H c r or nc nc o o o o rH CM CM CM CM r oC O • -r r ~C O c o o o o o OOo OOo Oo o o o o o o o o o o o ,—I H H H H i—1 U C uC U O jC U C uC uO J O J O J O J O J O J O J C OJ OJ C uc uC uc uO u CU c uc uCU CU 0 J O J ac aC ac c ac ac aX X X X X3 5X r ac ac ac ac ac ac Cc ac ac ac ac a ac  ^  3 CO  CJ  CJ  CJ  CO  CO  CO  1—I  H!  CO  tH HH  CM HH  Cu X  CU X  CM •*T CO  r—{ CU X  3.2  Construction of a structural model for HopE H o p E w a s s e l e c t e d f o r m o l e c u l a r m o d e l i n g b e c a u s e it w a s p r e v i o u s l y s h o w n to f u n c t i o n  as a p o r i n w i t h a l a r g e p o r e d i a m e t e r , a n d H o p E w a s the s m a l l e s t m e m b e r o f the H o p f a m i l y to contain the m a j o r i t y o f the c o n s e r v e d sequence m o t i f s described above.  A preliminary  structural m o d e l w a s c o n s t r u c t e d b a s e d o n the c o n f o r m a t i o n a l parameters a n d a l g o r i t h m for the p r e d i c t i o n o f m e m b r a n e s p a n n i n g p - s t r a n d s i n b a c t e r i a l p o r i n s d e v e l o p e d b y G r o m i h a et al. (1997).  T h e r e s u l t o f t h i s a n a l y s i s i s s h o w n i n F i g u r e 17 w i t h t h e c o n s e r v e d s t r u c t u r a l m o t i f s  s h o w n i n b o l d text. It is i n t e r e s t i n g to n o t e that the c o n s e r v e d m o t i f s f e l l a l m o s t e x c l u s i v e l y a m o n g the p r e d i c t e d transmembrane s p a n n i n g d o m a i n s o f H o p E .  This observation supported  t h e h y p o t h e s i s t h a t t h e c o n s e r v e d m o t i f s w e r e a c o n s e r v e d s t r u c t u r a l m o t i f f o r a f a m i l y o f Pbarrel proteins.  3.3 Cloning of hopE into pBluescript and pT7-7 The  hopE  gene w a s a m p l i f i e d b y P C R f r o m the c h r o m o s o m e o f  attempts to d i r e c t i o n a l l y c l o n e  hopE  H. pylori  26695.  Initial  w i t h i t s e n d o g e n o u s p r o m o t e r s e q u e n c e s u s i n g p r i m e r set  P 1 / P 2 w e r e u n s u c c e s s f u l . S u b s e q u e n t l y , p r i m e r sets P 1 / P 3 a n d P 2 / P 3 w e r e u s e d to a m p l i f y  hopE  for the subsequent c l o n i n g o f  hopE  into pBluescript ( p J l and pJ3) and p T 7 - 7 (pJ26)  respectively. T h e D N A s e q u e n c e o f the c l o n e d by D N A sequencing of both D N A  hopE  gene i n p l a s m i d s J l and  ribosomal  verified  strands.  T h e r e w e r e t w o p o t e n t i a l t r a n s l a t i o n start sites i n the upstream  J26 w a s  hopE  g e n e ( F i g u r e 18). T h e  b i n d i n g site w a s the start site p r e d i c t e d b y T I G R .  M ysequence analysis  revealed sequence c o n s e r v a t i o n a m o n g the N - t e r m i n a l a m i n o a c i d and D N A sequences o f the H o p f a m i l y w h i c h s u g g e s t e d that the s e c o n d ( d o w n s t r e a m ) A T G w a s l i k e l y to b e the translational  71  Y C  N P  N K A H T N L P G G P G P T C N  3  1  Y N T G 1 Y V G D G E  C  I  G  N  Q A  V  W  V  H  R  S  A  L  G  K  N  T  Y  S  C  A  N  D  N G  L G  I  Y  G T  N  N A F Q  K  F F K K Y G V N L G L G N L A  /  P S F D M T S K W F  G F R V Y G L F D  Y  S T  K T  DY S L K  S  R  T V A F Q V W L N F G V R A  V R V G F E V G N H K  Y I  L L I  N K  L  H  Y Y L  F L  N  S  T  A G P  N  Y L G Y N Y T F  A N  N  Figure 17.  S t r u c t u r a l m o d e l f o r H o p E b a s e d o n the c o n f o r m a t i o n a l parameters a n d a l g o r i t h m  f o r t h e p r e d i c t i o n o f m e m b r a n e s p a n n i n g P-strands i n b a c t e r i a l p o r i n s d e v e l o p e d b y G r o m i h a et  al.  (1997).  T r a n s m e m b r a n e s p a n n i n g d o m a i n s are i n  the boxes, the  conserved sequence motifs  i n the H o p f a m i l y are i n b o l d  72  start f o r H o p E .  T h i s s t a r t s i t e e x c l u d e s a n e g a t i v e l y c h a r g e d g l u t a m a t e r e s i d u e at t h e N - t e r m i n u s  o f the putative s i g n a l sequence, w h i c h is a l w a y s p o s i t i v e l y charged for other proteins. this site w a s s e l e c t e d f o r the c l o n i n g o f d e s i g n e d to incorporate an  hopE i n t o p T 7 - 7 . P C R o l i g o n u c l e o t i d e p r i m e r P 2 w a s  Ndel r e s t r i c t i o n s i t e at t h e s e c o n d A T G start s i t e i n hopE t o a l l o w  easy s u b c l o n i n g , f o l l o w i n g digestion o f the P C R a m p l i c o n w i t h into  Therefore  Ndel r e s t r i c t i o n e n d o n u c l e a s e ,  Ndel-Smal d i g e s t e d p T 7 - 7 . T h i s r e s u l t e d i n c l o n i n g o f hopE d o w n s t r e a m o f t h e T 7 R N A  p o l y m e r a s e p r o m o t e r w i t h o p t i m a l s p a c i n g b e t w e e n the r i b o s o m a l b i n d i n g site a n d the t r a n s l a t i o n start c o d o n i n p T 7 - 7 .  Downstream of  hopE  hopE a n d p r e s e n t i n p J l a n d p J 2 6 w a s a s t e m -  l o o p s t r u c t u r e t h a t m a y f u n c t i o n a s a r h o - i n d e p e n d e n t t r a n s c r i p t i o n a l t e r m i n a t o r ( F i g u r e 18).  3.4 E x p r e s s i o n o f hopE i n Escherichia coli  E. coli J M 1 1 0 s t r a i n s c a r r y i n g e i t h e r p l a s m i d J l (hopE+) o r J 3 ( n e g a t i v e c o n t r o l ) w e r e u s e d f o r e x p r e s s i o n e x p e r i m e n t s . I n d u c t i o n o f e x p r e s s i o n w i t h I P T G f o r f o u r h o u r s l e d to the p r o d u c t i o n o f H o p E ( i d e n t i f i e d as i m m u n o b l o t b a n d s i n W e s t e r n b l o t s ) w h i c h c o f f a c t i o n a t e d w i t h the outer m e m b r a n e d u r i n g m e m b r a n e f r a c t i o n a t i o n , s u g g e s t i n g that r e c o m b i n a n t l y p r o d u c e d H o p E w a s p r o p e r l y sorted to the outer m e m b r a n e .  Recombinantly expressed H o p E  m i g r a t e d t o t h e s a m e p o s i t i o n o n S D S - P A G E as d i d H o p E c o n t a i n e d i n t h e o u t e r m e m b r a n e s o f  H. pylori, a n d i t s m i g r a t i o n o n S D S - P A G E w a s i d e n t i c a l l y m o d i f i e d b y t h e s o l u b i l i z a t i o n t e m p e r a t u r e as w a s H o p E c o n t a i n e d i n the o u t e r m e m b r a n e s o f  H. pylori ( F i g u r e 1 9 ) . H e a t  m o d i f i c a t i o n o f outer m e m b r a n e proteins is a definitive characteristic o f P-barrel proteins ( V a n G e l d e r et al., 1 9 9 7 ) a n d s u g g e s t s t h a t r e c o m b i n a n t l y e x p r e s s e d H o p E w a s s t r u c t u r a l l y s i m i l a r t o native H o p E in  H. pylori. A l t h o u g h r e c o m b i n a n t l y e x p r e s s e d H o p E w a s e a s i l y v i s i b l e i n  W e s t e r n - i m m u n o b l o t s , H o p E w a s not v i s i b l e i n Coomassie-stained gels. C o n f i r m a t i o n o f  73  surface e x p o s u r e b y i n d i r e c t i m m u n o f l u o r e s c e n c e u s i n g the  Vac38  (anti-HopE) polyclonal  antibody was  74  1  ATCATAAATTTCAGTGATCGTCCCCACAGTGGATCTGGGGTTTTTAGAAGTGGTTTTTTG  P57 61  ^  ATCAATAGCGATCGCAGGGGTTAGGCCTTCAATTTTATCCACATTAGGCTTACCCACTTT  121  GTCTAAAAATTGCCTAGCATAGCTGGACAAACTCTCTA7AATAGCGCCTTTGGCCTTCAGC  181  GTATAAAGTGTCAAACGCTAAAGTGGATTTACCCGAACCGCTCAATCCGGTAAAAACAAC  241  AAACTGGTTTTTAGGGATTTCTAAAAAAATATTTTTGAGATTGTTTTCCCTAGCCCCTTG  301  AATAATGATCTTATCCATAATGGTTTTATGTTGCAAGAGTTTCCTTAAAATAAGAAAATG  361  GATTAAAAGGAGCTATTATACTTCAAAAAAGAATGGTTTTATTATCATTTCTTATTCATA  421  AGAGTTAAAAATATTTGCTTGATTAAGGATAAACATGCTATTATTTTATGAGACAATTTT  4 81  541 181  P62 **** * * * * * * *^f AAAGATAGGAATGTAAAGGAATGGAATTTATGAAAAAGTTTGTAGCTTTAGGGCTTCTAT m e f M K K F V A L G L L S CCGCAGTTTTAAGCTCTTCGTTGTTAGCCGAAGGTGATGGTGTTTATATAGGGACTAATT A V L S S S L L A^E G D G V Y I G T N Y P64  601 201  ATCAGCTTGGACAAGCCCGTTTGAATAGTAATATTTATAATACAGGGGATTGCACAGGGA Q L G Q A R L N S N I Y N T G D C T G S  661 221  GTGTTGTAGGTTGCCCCCCAGGTCTTACCGCTAATAAGCATAATCCAGGAGGCACCAATA V V G C P P G L T A N K H N P G G T N I  721 241  TCAATTGGCATGCTAAATACGCTAATGGGGCTTTGAATGGTCTTGGGTTGAATGTGGGTT N W H A K Y A N G A L N G L G L N V G Y  781 261  ATAAGAAGTTCTTCCAGTTCAAGTCTTTTGATATGACAAGCAAGTGGTTTGGTTTTAGAG K K F F Q F K S F D M T S K W F G F R V  P65 841 281  TGTATGGGCTTTTTGATTATGGGCATGCCACTTTAGGCAAGCAAGTTTATGCACCTAATA Y G L F D Y G H A T L G K Q V Y A P N K  901 301  AAATCCAGTTGGATATGGTCTCTTGGGGTGTGGGGAGCGATTTGTTAGCTGATATTATTG I Q L D M V S W G V G S D L L A D I I D  961 321  ATAACGATAACGCTTCTTTTGGTATTTTTGGTGGGGTCGCTATCGGCGGTAACACTTGGA N D N A S F G I F G G V A I G G N T W K  1021 341  AAAGCTCAGCGGCAAACTATTGGAAAGAGCAAATCATTGAAGCTAAGGGTCCTGATGTTT S S A A N Y W K E Q I I E A K G P D V C  75  P66 1081  GTACCCCTACTTATTGT^CCCTAACGCTCCTTATAGCACCAAAACTTCAACCGTCGCTT  361 1141  T  Q  Y  C  N  P  N  A  P  Y  S  T  K  T  S  T  V  A  F  V  W  L  N  F  G  V  R  A  N  I  Y  K  H  N  G  V  E  F  TTGGCGTGAGAGTGCCGCTACTCATCAACAAGTTTTTGAGTGCGGGTCCTAACGCTACTA  401 12 61  T  TTCAGGTATGGTTGAATTTTGGGGTGAGAGCCAATATTTACAAGCATAATGGCGTAGAGT  381 1201  P  G  V  R  V  P  L  L  I  N  K  F  L  S  A  G  P  N  A  T  N  ATCTTTATTACCATTTGAAACGGGATTATTCGCTTTATTTAGGGTATAACTACACTTTTT  421  L  Y  Y  H  L  K  R  D  Y  S  L  Y  L  G  Y  N  Y  T  F  *  C C T T  T G  A A: T T: A T: A T: A T: A T: A C:G C:G  1321  AAACCCTTTAAAAGGGTGTCTTTAAG-C:G-TTTTAGTTT  1381  GGATTTTCGCATCTTAAAAAGCTAAAATTGATTATAAAGAAACTTTTGGGCGTAACCAAC  14 4 1  -  3'  AAAACCAACACCATTGGGTGGGCGTTTGGAAAATTCATCTAAGGGTTTTAAGGGGATTGT  ^  P60  1501  TTGCAAGAAATAGAGAGTTTGCACCAAAGCGTTTTGTTGCAAGAAGTTTTGCAAGCGTTC  1561  ATGCCTTTAGAAGAAGGGGTTTTGATTGATTGCACTTTAGGGTTAGGGGGGCATTCTAAA  F i g u r e 18.  Helicobacter pylori  22695  hopE  D N A sequence.  hopE  gene contains t w o potential  start sites m a r k e d i n b o l d a n d u n d e r l i n e d e a c h w i t h p u t a t i v e u p s t r e a m r i b o s o m a l b i n d i n g sites ( m a r k e d w i t h astrerisks) a n d a p o t e n t i a l s t e m - l o o p structure that c o u l d f u n c t i o n as a d o w n s t r e a m rho-independent  transcriptional terminator.  T h e experimentally determined signal peptide  c l e a v a g e s i t e i s l o c a t e d b e t w e e n a m i n o a c i d s 23 a n d 24 ( i n d i c a t e d b y t h e s t a r ) . oligonucleotide primers used for the cloning o f  hopE  The P C R  are indicated w i t h arrows a n d their  n u c l e o t i d e s e q u e n c e s a r e l i s t e d i n T a b l e III. P r e d i c t e d m o l e c u l a r w e i g h t o f the H o p E : 2 9 7 4 6 D a .  76  F i g u r e 1 9 . G e l m o b i l i t y o f r e c o m b i n a n t l y p r o d u c e d H o p E c a n be m o d i f i e d b y heat. W e s t e r n i m m u n o b l o t o f outer membranes f r o m cultures o f  E. coli  E. coli  J M 1 1 0 expressing  hopE.  L o g a r i t h m i c phase  J M 1 1 0 h a r b o r i n g the s p e c i f i e d p l a s m i d s w e r e i n d u c e d b y the a d d i t i o n o f  I P T G to a f i n a l concentration o f 100 p M and g r o w n f o r a n additional 4 h p r i o r to c e l l harvest. Outer m e m b r a n e s w e r e prepared b y T r i t o n X - 1 0 0 extraction procedure ( S c h n a i t m a n , 1971). E a c h l a n e c o n t a i n s a p p r o x i m a t e l y 3 0 u g o f o u t e r m e m b r a n e p r o t e i n w h i c h w e r e s o l u b i l i z e d at 3 7 ° C ( l a n e s 1 a n d 4 ) o r 100°C ( l a n e s 2 , 3 a n d 5 ) , r e s o l v e d o n S D S 1 2 % - P A G E g e l s , electrobloted onto P V D F m e m b r a n e and probed w i t h rabbit a n t i - H o p E p o l y c l o n a l antibody. T h e immunoblots were developed w i t h a donkey anti-rabbit antibody conjugated to alkaline phosphatase. T h e l o c a t i o n o f H o p E ( - 2 6 k d ) and heat m o d i f i e d H o p E * ( - 2 9 k d ) i s denoted b y t h e a r r o w s . P l a s m i d s p r e s e n t i n E.  pylori  coli  were lanes: 1 and 2, p J l ; 3, p J 3 ; 4 and 5,  Helicobacter  11637 outer membrane.  77  u n s u c c e s s f u l ; t h i s r e s u l t is p r o b a b l y d u e to c r o s s r e a c t i o n o f this a n t i s e r u m w i t h the outer membrane proteins o f  3.5  E. coli a n d t h e l o w l e v e l o f e x p r e s s i o n o f H o p E .  Insertional mutagenesis of  hopE  T o test t h e s t r u c t u r a l m o d e l o f H o p E , I d e s i g n e d a n o l i g o n u c l e o t i d e that c o d e d f o r the i n s e r t i o n o f f i v e a m i n o a c i d s ( R S K D V ) a n d t w o u n i q u e r e s t r i c t i o n sites. T h i s o l i g o n u c l e o t i d e w a s u s e d f o r site s p e c i f i c i n s e r t i o n a l m u t a g e n e s i s o f H o p E .  This oligonucleotide was designed  to c o d e f o r t w o u n i q u e r e s t r i c t i o n sites a n d three c h a r g e d a m i n o a c i d s that s h o u l d not b e tolerated i n the transmembrane regions o f p-barrel outer m e m b r a n e proteins. T h e t w o u n i q u e restriction sites c o u l d later s e r v e as i n s e r t i o n sites f o r o t h e r a n t i g e n i c epitopes. T h e p r i m a r y f o c u s o f t h e s e e x p e r i m e n t s w a s t o test t h e h y p o t h e s i s t h a t t h e c o n s e r v e d sequence m o t i f s i n the H o p f a m i l y w e r e m e m b r a n e - s p a n n i n g d o m a i n s and thus, potentially part o f a c o n s e r v e d s c a f f o l d i n g f o r a f a m i l y o f P-barrel proteins. Insertions w e r e p l a c e d i n f o u r o f the c o n s e r v e d m e m b r a n e s p a n n i n g s e g m e n t s ( 1 , 5 , 1 2 a n d 16) a n d i n t o f o u r o f t h e p r o p o s e d l o o p regions (loops 3, 5 , 6 and 8) (Figure 20).  E x p r e s s i o n a n a l y s i s o f t h e s e i n s e r t i o n m u t a n t s i n E.  coli ( F i g u r e 2 1 ) r e v e a l e d t h a t i n s e r t i o n s i n t o p u t a t i v e t r a n s m e m b r a n e s e g m e n t s 1 ( p J 1 8 ) , 5 ( p J l O ) a n d 12 ( p J 1 2 ) w e r e n o t p e r m i s s i v e f o r the i n s e r t i o n o f the r e c o m b i n a n t H o p E i n t o the outer membrane.  M u t a n t p J 2 0 , i n w h i c h the m u t a t i o n w a s p l a c e d i n a r e g i o n o f H o p E that w a s  p r e v i o u s l y i d e n t i f i e d as b e i n g p a r t o f a m e m b r a n e s p a n n i n g d o m a i n , w a s i n c o r p o r a t e d i n t o t h e outer membrane. of HopE.  T h i s suggests that this r e g i o n is not part o f the m e m b r a n e s p a n n i n g c o r e r e g i o n  C l o n e s c o d i n g for insertions into loop regions 5 (pJ5), 6 (pJ21) and 8 (pJ6, p J 1 4 and  p J 2 0 ) w e r e i n c o r p o r a t e d into the outer m e m b r a n e , s u p p o r t i n g m y p r o p o s a l that these r e g i o n s o f u n c o n s e r v e d a m i n o a c i d s e q u e n c e are l o o p r e g i o n s o f H o p E .  Another clone coding for an  78  6 T T C  G  NK A H  K F Q  T  C  Y N T G pJ18-  1  Y V G D G E  _ L G Q  A R  L N S N  L G P P C C G V V  s  G T  C D I G Y T N  V D P  pJ23-  F 'F K  K A  S  E  I I  F  D M T  N  p J 5 v  S_ _P K K A Y V  I  D  Q  pJlO-  *. DN N_ A D S  K G L  A L L  T  A H G Y  Q E  F  K W Y  G  N  I  A A S S K W  F G G  V A I G  T N  Y C  N  P  X* pJ21 P Y S  8  T  K 7 T ' S T V A F Q V W L «-pJ12 N F G V R A,  D P  V R V G F E V G N H K Y I  P  J6 ,  . P n V  \ R KL H Y Y N| K| L W  L L| I F  N  L S T Al A N  GJ p  \  « Y L G Y N Y T F  J 1 4  A "RSKDV  pJ20  N  -N-  Figure 20. loop.  Insertion sites for H o p E mutants.  L o o p s (1-8) are d e n o t e d b y n u m b e r s a b o v e e a c h  Insertion o f R S K D V was engineered into  hopE b y P C R .  L i s t e d are the p l a s m i d s a n d the  i n s e r t i o n site o f the 5 a m i n o a c i d s w i t h i n e a c h p l a s m i d . P l a s m i d J 1 4 c o n t a i n e d a d e l e t i o n o f the amino acids D Y S L and their replacement w i t h R S K D V .  T r a n s m e m b r a n e r e g i o n s are i n the  b o x e s a n d the s e q u e n c e s that are c o n s e r v e d a m o n g the H o p f a m i l y are i n b o l d text.  79  Figure 21. Western immunoblot of outer membranes from E. coli JM110 expressing hopE insertion mutants. Logarithmic phase cultures of E. coli JM110 harboring the specified plasmids were induced by the addition of IPTG to a final concentration of 100 p M and grown for an additional 4h prior to cell harvest. Outer membranes were prepared by the Triton X-100 extraction procedure (Schnaitman, 1971). Each lane contains approximately 20 ug of outer membranes which were solubilized at 37°C, resolved on SDS 12%-PAGE gels, electrobloted onto P V D F membrane and probed with rabbit anti-HopE polyclonal antibody. The immunoblots were developed with a donkey anti-rabbit antibody conjugated to alkaline phosphatase. Molecular weights are listed on the left and HopE is marked by the arrow. Plasmids present were lanes: 1, prestained molecular weight markers; 2 . H. pylori 11637 outer membrane; 3, pJ5; 4,pJ6; 5,pJ10; 6, pJ12; 7, pJ14; 8, pJ18;9, pJ20; 10, pJ21; 11 pJ23.  80  insertion into l o o p 3 (pJ23) w a s not f o u n d i n the outer membrane.  T h i s result w a s not surprising  a n d is s i m i l a r to w h a t has b e e n o b s e r v e d i n m a n y other p o r i n proteins. L o o p three has b e e n h y p o t h e s i z e d to f u n c t i o n i n the f o r m a t i o n o f the m o s t c o n s t r i c t e d part o f the c h a n n e l o f p o r i n proteins and p l a y s a critical role i ndetermining p o r i n structure ( N i k a i d o , 1993). Insertions into l o o p s 2, 4 a n d 7 w e r e not constructed due to t e c h n i c a l p r o b l e m s associated w i t h the c o n s t r u c t i o n o f suitable P C R p r i m e r s that d i d not s e l f h y b r i d i z e o r c o n t a i n s i g n i f i c a n t a m o u n t s o f s e c o n d a r y structure.  DISCUSSION 1. Identification  of potential virulence factors in Helicobacter pylori  O n e o f the current difficulties i n in  H. pylori.  Helicobacter  H. pylori  research is the l a c k o f tools f o r genetic a n a l y s i s  W i t h v e r y f e w exceptions, bacterial genes originating f r o m genera other than or  Campylobacter  can be stably maintained in  are not e x p r e s s e d i n  H. pylori  H. pylori.  have not yet been found.  use o f heterologous systems for the analysis o f d e s c r i b e d the a p p l i c a t i o n o f o n e s u c h s y s t e m to  H. pylori  I n a d d i t i o n shuttle v e c t o r s that T h i s o b s e r v a t i o n necessitated the  gene function. I n Chapter One, I  H. pylori - g e n e  fusion technology.  G e n e f u s i o n t e c h n o l o g y b a s e d o n t r a n s l a t i o n a l f u s i o n s to a l k a l i n e p h o s p h a t a s e has b e e n successfully u s e d for the i d e n t i f i c a t i o n o f extracellular, surface associated or p e r i p l a s m i c proteins i n m a n y b a c t e r i a l s y s t e m s ( M a n o i l et al., 1 9 9 0 ) . H o w e v e r , t h e a p p l i c a t i o n o f g e n e f u s i o n t e c h n o l o g y t o b a c t e r i a l s p e c i e s t h a t l a c k s y s t e m s f o r g e n e t i c a n a l y s i s , s u c h as d i f f i c u l t . A t t e m p t s at t r a d i t i o n a l  pylori  TnphoA  H. pylori,  is more  m u t a g e n e s i s (or other t r a n s p o s o n m u t a g e n e s i s ) i n  H.  h a v e b e e n u n s u c c e s s f u l . T h e r e f o r e I s o u g h t to adapt a r a p i d a n d s i m p l e s y s t e m f o r the  identification o f / / ,  pylori  secreted proteins i n a heterologous system.  Initial attempts to construct the  H.  /jy/on'-alkaline phosphatase fusion library i n  phoA  81  deficient  E. coli C C 1 1 8 w e r e u n s u c c e s s f u l . E. coli C C 1 1 8 w a s a p o o r r e c i p i e n t f o r H. pylori  D N A a n d r e c o m b i n a n t c l o n e s w e r e o b t a i n e d at l o w e f f i c i e n c y . T h e s e f i n d i n g s a r e p r o b a b l y a consequence o f  E. coli C C 1 1 8 r e s t r i c t i o n o f H. pylori D N A ( P h a d i s et al, 1 9 9 3 ) .  Subsequently,  E. coli E R 1 7 9 3 , aphoA+ s t r a i n t h a t i s p e r m i s s i v e f o r t h e c l o n i n g o f H. pylori D N A , w a s u s e d a s t h e h o s t f o r t h e c o n s t r u c t i o n o f t h e H. p j / / o n " - a l k a l i n e p h o s p h a t a s e f u s i o n l i b r a r y .  I f o u n d that the  i n c l u s i o n o f 50 m M N a P C u i n the s c r e e n i n g m e d i u m c o m p l e t e l y i n h i b i t e d the e x p r e s s i o n o f the endogenous phosphatase activity in  E. coli E R 1 7 9 3 w h i l e s t i l l a l l o w i n g t h e d e t e c t i o n o f  recombinant alkaline phosphatase fusion proteins. A m o n g the 120  H. pylori-alkaline p h o s p h a t a s e f u s i o n l i b r a r y c l o n e s t h a t w e r e s e q u e n c e d ,  21 c l o n e s p r o d u c e d h i g h - s c o r i n g s e g m e n t p a i r s o f 10" o r l o w e r . 5  The identified h o m o l o g  genes  i n c l u d e d s e v e r a l p o t e n t i a l targets for d r u g intervention or v a c c i n e c o n s t r u c t i o n i n c l u d i n g genes i n v o l v e d i n m o t i l i t y ( c l o n e s 1 1 , 3 0 , 121), e f f l u x ( c l o n e 12, 3 9 , 61 a n d 2 0 0 ) , i r o n u p t a k e ( c l o n e s 10), c e l l w a l l b i o s y n t h e s i s ( c l o n e s 4 4 a n d 162), p e r m e a s e s ( c l o n e s 199 a n d 2 3 0 ) , ( c l o n e 105), e n z y m e s ( c l o n e s 3) a n d l i p i d b i o s y n t h e s i s (clones 182). the  cytochrome  S u b s e q u e n t to the release o f  H. pylori g e n o m e s e q u e n c e , t h e i n i t i a l p r e d i c t i o n f o r t h e s e c l o n e s w a s v e r i f i e d i n a l l b u t o n e  c l o n e ; c l o n e 2 1 1 , w a s i d e n t i f i e d b y m e as b e i n g i n v o l v e d i n c a p s u l e b i o s y n t h e s i s b u t it is t h o u g h t to a c t u a l l y c o d e f o r a h o m o l o g o f a c o m p o n e n t o f a D N A r e s t r i c t i o n s y s t e m . I n a d d i t i o n t o t h o s e c l o n e s l i s t e d i n T a b l e 1, a n o t h e r 8 9 c l o n e s h a d w e a k s i m i l a r i t y t o sequences i n the n o n - r e d u n d a n t database.  T h e s e clones, w h i c h d i d not have a sufficient  s i m i l a r i t y to database s e q u e n c e s to a l l o w p r e d i c t i o n o f their p o s s i b l e f u n c t i o n , w e r e s u b s e q u e n t l y m a p p e d to the g e n o m e sequence o f / / , ( 4 5 % ) w e r e u n i q u e to  pylori 2 6 6 9 5 . A m o n g t h e s e q u e n c e d c l o n e s , 5 9 c l o n e s  H. pylori ( u n i d e n t i f i e d O R F s ) , 6 5 c l o n e s ( 4 9 % ) c o n t a i n e d t y p i c a l s i g n a l  s e q u e n c e s a n d 1 9 c l o n e s ( 1 4 % ) w e r e p r e d i c t e d to b e c e l l e n v e l o p e - a s s o c i a t e d . A d d i t i o n a l l y , 4 4  82  clones (30%)  o f the s e q u e n c e d c l o n e s w e r e r e d u n d a n t a n d 12 c l o n e s ( 9 % ) w e r e p r e d i c t e d to  encode cytoplasmic proteins (discussed below). There w a s a definite bias for identification o f certain proteins i n O R F 0 8 1 7 w e r e o b t a i n e d 17 t i m e s ) .  H. pylori  ( i . e., f u s i o n s t o  S e v e r a l factors l i k e l y contribute to this f i n d i n g .  First and  m o s t i m p o r t a n t i s the s e l e c t i o n f o r r e c o m b i n a n t c l o n e s that h i g h l y e x p r e s s a l k a l i n e p h o s p h a t a s e . S i n c e I c h o s e the c o l o n i e s w h i c h w e r e the m o s t d e e p l y b l u e c o l o r e d o n X P - P O 4 agar, this screen is b i a s e d t o w a r d s genes that are either e x p o r t e d a n d / o r m o r e e f f i c i e n t l y e x p r e s s e d i n  E. coli.  The  s e c o n d s o u r c e o f b i a s is the a s s u m p t i o n that the r e s t r i c t i o n sites f o r the f o u r - b a s e cutter restriction enzyme  SauSAl  not a v a l i d assumption.  are d i s p e r s e d r a n d o m l y t h r o u g h o u t the c h r o m o s o m e .  Although  Sau3Al  T h i s is clearly  c a n b e s t a t i s t i c a l l y e x p e c t e d to c u t D N A  (containing  equal d i s t r i b u t i o n o f d e o x y n u c l e o t i d e residues) o n c e in every 256 base pairs, i n reality there is regional variability i n bacterial D N A i n b o t h nucleotide content and context. F o r example, the overall G C content o f  H. pylori  c o n t e n t o f 3 5 % ( T o m b et al,  w a s 3 9 % , h o w e v e r , the  40  kb cag pathogenicity island had a G C  1997).  A m o n g t h e s e q u e n c e d H. / ? v / o n ' - a l k a l i n e p h o s p h a t a s e f u s i o n c l o n e s , i d e n t i f i e d as b e i n g c y t o p l a s m i c p r o t e i n s . d u r i n g the i n i t i a l s c r e e n i n g o f the library.  12 c l o n e s ( 9 % )  were  T h i s probably resulted f r o m misidentification o f clones It is a l s o p o s s i b l e that e x p r e s s i o n o f these f u s i o n  p r o t e i n s r e s u l t e d i n arrested g r o w t h after c o l o n y f o r m a t i o n s i n c e it w a s s h o w n that cytoplasmically-localized alkaline phosphatase can acquire enzymatic activity u p o n cessation o f c e l l g r o w t h ( D e r m a n et al,  1995).  T h e r e are s e v e r a l l i m i t a t i o n s o f the g e n e f u s i o n strategy; (1) o n l y e x p r e s s e d a n d t r a n s l o c a t e d p r o t e i n s w i l l b e d e t e c t e d ; (2) i d e n t i f i c a t i o n o f a g e n e i s i n f e r r e d f r o m its s i m i l a r i t y to d a t a b a s e s e q u e n c e s a n d t h e r e f o r e , n o v e l g e n e s w i l l be n o t be e a s i l y i d e n t i f i e d ; ( 3 )  gene  83  i d e n t i f i c a t i o n is dependent u p o n the gene f u s i o n o c c u r r i n g i n a r e g i o n c o n t a i n i n g r e l a t i v e l y c o n s e r v e d a m i n o a c i d s i g n a t u r e s o r r e s i d u e s ; (4) s e c r e t e d o r e x p o r t e d p r o t e i n s t h a t a r e d e p e n d e n t o n secretion systems not present i n  E. coli  w i l l n o t be i d e n t i f i e d ;  (5) p o o r l y  expressed proteins  m a y be d i f f i c u l t to detect. T h e gene fusion m e t h o d presented here is arapid, technically simple and relatively i n e x p e n s i v e m e t h o d for i d e n t i f y i n g secreted and exported proteins i n c l u d i n g , but not l i m i t e d to, n o v e l d r u g targets a n d g e n e s o f t h e r a p e u t i c interest. A p p l i c a t i o n o f this s y s t e m to b a c t e r i a l strains w i t h k n o w n g e n o m e s e q u e n c e s p r o v i d e s c o m p l e m e n t a r y a n d n o v e l i n f o r m a t i o n that is not easily inferred f r o m D N A  s e q u e n c e a n a l y s i s . T h e m e t h o d is a p p l i c a b l e to a w i d e v a r i e t y o f  m i c r o b e s a n d genetic systems i n c l u d i n g b a c t e r i a for w h i c h there is n o genetic s y s t e m available. T h e a d d i t i o n o f p h o s p h a t e to the s e l e c t i o n m e d i a is an effective m e t h o d for the i n h i b i t i o n o f the endogenous phosphatase activity in  E. coli  w h i l e still a l l o w i n g for the d e t e c t i o n o f r e c o m b i n a n t  alkaline phosphatase fusion proteins.  2. R o l e  of efflux in the intrinsic antibiotic resistance  Helicobacter pylori vivo  oi Helicobacter pylori  is susceptible to several antibiotics  u s i n g any o f these antibiotics singly.  in vitro,  b u t is d i f f i c u l t to treat  in  A factor i n v o l v e d i n the i n t r i n s i c resistance o f m a n y  b a c t e r i a t o m u l t i p l e a n t i b i o t i c c l a s s e s i s t h e e x p r e s s i o n of s p e c i f i c R N D e f f l u x s y s t e m s ( M a et  ai,  1 9 9 4 ) . T h e r e f o r e I c o n s i d e r e d the p o s s i b i l i t y i n C h a p t e r 2 that the i n t r i n s i c  resistance o f  H. pylori w a s  in vivo  antibiotic  due to e x p r e s s i o n o f s i m i l a r R N D efflux systems.  T h e three R N D s y s t e m h o m o l o g u e s i n  H. pylori  s e e m e d to be s i m i l a r i n o p e r o n s t r u c t u r e  to other b a c t e r i a l R N D e f f l u x systems, b a s e d o n the relative l o c a t i o n a n d t r a n s c r i p t i o n a l p o l a r i t y of individual O R F s .  I n g e n e r a l t h e o p e r o n s t r u c t u r e s of m a n y R N D  e f f l u x s y s t e m s are c o n s e r v e d  and contain three c o m p o n e n t s : an outer m e m b r a n e protein, a m e m b r a n e f u s i o n protein and a  84  pump protein (Paulsen  et al,  1996). Furthermore,  in H. pylori the h o m o l o g u e  for the outer  m e m b r a n e p r o t e i n a p p e a r e d a s t h e f i r s t o f t h e s e t h r e e genes, w h e r e a s t h e o u t e r m e m b r a n e p r o t e i n gene is either spatially separated ( T o l C o f C z c C ) in efflux operons.  E. coli) or the  I n a d d i t i o n to these three  c o n t a i n e d a d d i t i o n a l O R F s that h a v e not p r e v i o u s l y  most distal gene ( O p r M , O p r N , M t r C ,  genes, been  e a c h o f the  H. pylori  associated w i t h R N D  putative operons systems.  W h e t h e r these additional genes p l a y a role i n conjunction w i t h their associated R N D  systems  r e m a i n s to be determined. The individual R N D system homologues  pylori  were  s t r a i n s at b o t h t h e a m i n o a c i d a n d D N A l e v e l s .  h i g h l y c o n s e r v e d a m o n g all three  The  proposed  H. pylori  RND  genes w e r e i n e x c e s s o f 9 0 % i d e n t i c a l to their c o r r e s p o n d i n g O R F s i n the other The phylogenetic and sequence analysis showed  that  H.  system  H. pylori  strains.  R N D efflux p u m p proteins and  m e m b r a n e f u s i o n p r o t e i n s t e n d t o c l u s t e r t o g e t h e r a c c o r d i n g to t h e i r s u b s t r a t e s p e c i f i c i t y (Paulsen  et al,  1996; Saier  proteins r e v e a l e d that the p r o t e i n s ( F i g u r e 7).  et al,  H. pylori  1998).  S i m i l a r a n a l y s i s o f the  H. pylori  R N D efflux pump  proteins h a v e d i v e r g e d f r o m the c h a r a c t e r i z e d R N D  pump  S i m i l a r a n a l y s i s r e v e a l e d t h a t the m e m b r a n e f u s i o n p r o t e i n s w e r e a l s o  divergent f r o m other b a c t e r i a l R N D m e m b r a n e f u s i o n proteins. T h e sequence d i v e r g e n c e o f the  H. pylori  R N D proteins m i g h t reflect the e v o l u t i o n  of H. pylori  i n a n e n v i r o n m e n t a l n i c h e that i s  d e v o i d o f c o m p e t i n g o r g a n i s m s a n d l a c k i n g m a n y o f the n o x i o u s s u b s t a n c e s t h a t t h e e n t e r i c o r s o i l d w e l l i n g o r g a n i s m s are l i k e l y to e n c o u n t e r (i.e., a n t i b i o t i c s , detergents, d i v a l e n t m e t a l c a t i o n s e t c . ) . T h e r e f o r e , i n t h e a b s e n c e o f t h e s e s e l e c t i v e p r e s s u r e s , it i s p o s s i b l e t h a t t h e H.  pylori  R N D systems have e v o l v e d n e w transport or functional roles i n  H. pylori  A l t h o u g h t h e R N D s y s t e m h o m o l o g u e s are h i g h l y c o n s e r v e d a m o n g  ecology.  H. pylori  strains, the  t h r e e p u t a t i v e o p e r o n s w e r e n o t w e l l c o n s e r v e d r e l a t i v e to e a c h o t h e r as s h o w n i n T a b l e V I .  85  T h e s e results w e r e contrary to w h a t is seen i n other bacteria. F o r e x a m p l e , the  E. coli R N D  p u m p proteins ( A c r B , A c r D , A c r F and Y h i V ) are m o r e than 6 0 % i d e n t i c a l a n d 8 5 % s i m i l a r to e a c h other, a n d the e f f l u x p u m p s i n  P. aeruginosa ( M e x B , M e x D a n d M e x F ) a r e m o r e t h a n 3 8 %  i d e n t i c a l a n d 7 2 % s i m i l a r to e a c h other.  T h e h i g h l e v e l o f s e q u e n c e c o n s e r v a t i o n a m o n g t h e E.  coli a n d P. aeruginosa R N D p u m p p r o t e i n s i s a l s o r e f l e c t e d i n p h y l o g e n e t i c a n a l y s i s w h i c h s h o w e d that the  E. coli a n d P. aeruginosa R N D p u m p p r o t e i n s a l l c l u s t e r a m o n g t h e m u l t i p l e  drug efflux pumps.  T h e p r e s e n c e o f d i s s i m i l a r R N D e f f l u x s y s t e m s w i t h i n a b a c t e r i a l s p e c i e s , as  seems to be the case w i t h  H. pylori, h a s n o t p r e v i o u s l y b e e n o b s e r v e d . T h i s m a y r e f l e c t d i f f e r e n t  e v o l u t i o n a r y o r i g i n s f o r e a c h o f t h e s y s t e m s , as s u s p e c t e d f o r g e n e s i n t h e  H. pylori cag  p a t h o g e n i c i t y i s l a n d ( T o m b et al, 1 9 9 7 ) , o r a l t e r n a t i v e l y c o u l d r e f l e c t t h e i n d e p e n d e n t  evolution  o f i n d i v i d u a l e f f l u x s y s t e m s from a c o m m o n a n c e s t o r t o w a r d s d i f f e r e n t s u b s t r a t e s p e c i f i c i t y . T h e p r e s e n c e o f c o s m i d p 2 0 0 : 4 c o n t a i n i n g t h e hemE-hefABC o p e r o n f a i l e d t o complement several  E. coli acrAB m u t a n t s . T h i s r e s u l t is e x p e c t e d s i n c e m o s t o f t h e k n o w n H.  pylori p r o m o t e r s d o n o t f u n c t i o n i n E. coli ( O d e n b r i g h t et al, 1 9 9 6 ) , a n d at l e a s t a m o d e r a t e l e v e l e x p r e s s i o n o f R N D e f f l u x s y s t e m s i s r e q u i r e d in  E. coli t o s e e p h e n o t y p i c c h a n g e s s u c h as  c h a n g e s i n a n t i b i o t i c r e s i s t a n c e ( S r i k u m a r et al, 1998). R e c o m b i n a n t e x p r e s s i o n o f t h e hefBC and  hefC g e n e s b e i n g e x p r e s s e d f r o m t h e lac p r o m o t e r i n p B B R l M C S a n d p B l u e s c r i p t a l s o  failed to c o m p l e m e n t the these results. T h e  E. coli acrAB m u t a n t s . T h e r e are s e v e r a l r e a s o n s t h a t w o u l d e x p l a i n  P. aeruginosa s y s t e m , mexAB-oprM i n c o n t r a s t t o t h e mexCD-oprJ s y s t e m ,  r e q u i r e d the p r e s e n c e o f its outer m e m b r a n e c o m p o n e n t for f u n c t i o n i n 1998).  It i s t h e r e f o r e p o s s i b l e t h a t t h e  hefBC g e n e s m a y r e q u i r e t h e p r e s e n c e o f t h e i r c o g n a t e  o u t e r m e m b r a n e p o r e c o m p o n e n t f o r p r o p e r f u n c t i o n , as s e e n w i t h t h e oprJsystem  ( S r i k u m a r et al, 1 9 9 8 ) .  E. coli ( S r i k u m a r et al,  P. aeruginosa mexCD-  A l t e r n a t i v e l y , t h e hefBC s y s t e m m a y n o t f u n c t i o n  86  efficiently enough i n  E. coli  to result i n a detectable change i n phenotype, o r the  hefABC  operon  m a y not f u n c t i o n i n antibiotic resistance o r m a y transport an unidentified o r untested c o m p o u n d . S t u d i e s h a v e r e v e a l e d that t h e e x p r e s s i o n o f s o m e R N D e f f l u x s y s t e m s i n b a c t e r i a i s r e g u l a t e d b y e n v i r o n m e n t a l s t i m u l i s u c h as t h e p r e s e n c e o f a n t i b i o t i c s , a n t i m i c r o b i a l c o m p o u n d s , g r o w t h s t a g e a n d s t r e s s f a c t o r s ( M a et al,  1 9 9 4 b ; N i k a i d o , 1 9 9 6 ; P a u l s e n et al,  o f R i c h a r d A i m ( A p p e n d i x I) s h o w e d that o n e o f the expressed only  pylori,  in vivo.  H. pylori  1996). T h e data  (hefGHI)  R N D operons  was  T h e m e c h a n i s m f o r r e g u l a t i n g the e x p r e s s i o n o f the R N D s y s t e m s i n  i f it e x i s t s , i s u n k n o w n .  H.  In m a n y R N D systems a divergently transcribed regulatory gene  f o r the e x p r e s s i o n o f the R N D o p e r o n is l o c a t e d u p s t r e a m o f the R N D s y s t e m ( N i k a i d o , 1 9 9 6 ; P a u l s e n et al,  1 9 9 7 ) . H o w e v e r , a c o r r e s p o n d i n g O R F that e n c o d e d a p r o t e i n w i t h a D N A  b i n d i n g m o t i f w a s m i s s i n g f r o m e a c h o f the  H. pylori  R N D operons.  A region of dyad symmetry  i n t h e p u t a t i v e p r o m o t e r r e g i o n o f t h e hefGHI o p e r o n w a s e v i d e n t a n d d i d n o t a p p e a r t o b e p r e s e n t i n t h e p r o p o s e d p r o m o t e r r e g i o n s o f t h e hefABC o r hefDEF T h e m u t a g e n e s i s o f e a c h o f the R N D e f f l u x systems i n the  operons.  H. pylori  chromosome d i d not  affect o n the v i a b i l i t y o r s u s c e p t i b i l i t y o f the resulting strains to a n y o f the tested a n t i b i o t i c s ( A p p e n d i x I). T h i s u n e x p e c t e d result w a s i n contrast to w h a t h a s b e e n o b s e r v e d i n o t h e r b a c t e r i a i n w h i c h mutants l a c k i n g s p e c i f i c efflux systems are d r a m a t i c a l l y m o r e s u s c e p t i b i l i t y to a range o f c h e m i c a l l y u n r e l a t e d a n t i b i o t i c s ( M a et al,  1 9 9 3 ; L i et al,  1 9 9 5 H a g m a n et al,  1995).  P o t e n t i a l reasons f o r t h e o b s e r v e d results i n c l u d e t h e p o s s i b i l i t i e s that e f f l u x d o e s n o t f u n c t i o n i n the intrinsic antibiotic resistance  oiH. pylori  c o u l d b e m e d i a t e d b y t h e hefGHIoperon  to a n t i b i o t i c s o r that the resistance t o a n t i b i o t i c s  w h i c h is not expressed i n cells g r o w n  p o t e n t i a l factor i s that the outer m e m b r a n e o f  in  vzYro-grown  H. pylori  in vitro.  Another  is p e r m e a b l e to  hydrophobic antibiotics, since efflux p u m p s d onot w o r k w e l l i n cells w i t h outer m e m b r a n e  87  alterations l e a d i n g to e n h a n c e d a n t i b i o t i c u p t a k e ( H a n c o c k , 1 9 9 7 ) . L a s t l y , it i s a l s o p o s s i b l e that the  H. pylori  R N D systems d o not function i n antibiotic efflux.  I w a s n o t a b l e t o i d e n t i f y e f f l u x a c t i v i t y i n H. pylori  g r o w n in vitro u s i n g  substrates f o r b a c t e r i a l e f f l u x systems ( N P N , tetracycline a n d c h l o r a m p h e n i c o l ) . identified efflux activity  pylori  to a n t i m i c r o b i a l c o m p o u n d s .  and  H.  in vitro r e s i s t a n c e  T h e high background level o f N P N uptake seen w i t h  is consistent w i t h the absence o f active efflux.  seen w i t h efflux defective  T h e lack o f  p l u s the results f r o m the m u t a g e n e s i s ( A p p e n d i x I) o f the  R N D o p e r o n s s t r o n g l y suggest that e f f l u x d o e s not p l a y a r o l e i n the  H. pylori pylori  in vitro  common  E. coli acrAB  P. aeruginosa mexAB-oprM(Ocaktan  and  tolC  et al.,  of  H.  S i m i l a r l y h i g h levels o f N P N uptake are  (R.E.W. Hancock, unpublished  observations)  1997) mutants w h i c h are h y p e r s u s c e p t i b l e to  a n t i b i o t i c s . A l t e r n a t i v e l y , t h e o u t e r m e m b r a n e o f in v / i r o - g r o w n H. pylori  may be  h y p e r p e r m e a b l e to h y d r o p h o b i c c o m p o u n d s , a l l o w i n g a n t i b i o t i c i n f l u x to o v e r w h e l m t h e contribution o f a n y efflux system(s). Pretreatment o f  H. pylori  w i t h as little as 1 u M C C C P , f o r u n k n o w n r e a s o n s , c o m p l e t e l y  a b o l i s h e d the p o l y m y x i n B - s t i m u l a t e d uptake o f N P N a n d decreased the a c c u m u l a t i o n o f c h l o r a m p h e n i c o l a n d t e t r a c y c l i n e b y H. pylori concentrations generally used in  E. coli  b y 5 0 % . In contrast, neither 1 u M C C C P n o r the  ( 5 u M ) and  P. aeruginosa  ( 2 5 0 p M ) to i n h i b i t energy  d e p e n d e n t e f f l u x , h a d a n y e f f e c t o n t h e b a c k g r o u n d l e v e l o f N P N u p t a k e b y t h e s e c e l l s ( L o h et al., 1 9 8 4 ) . T h e s e c o n t r a r y r e s u l t s a r e c o n s i s t e n t w i t h a n a c t i v e u p t a k e m e c h a n i s m f o r t h e s e compounds in  H. pylori.  A l t e r n a t i v e l y , the findings m a y result f r o m the p a r t i t i o n i n g o f  t e t r a c y c l i n e a c r o s s t h e c y t o p l a s m i c m e m b r a n e a c c o r d i n g to a m e m b r a n e p o t e n t i a l ( N i k a i d o & Thanassi, 1993). H o w e v e r , this does not e x p l a i n the results w i t h N P N where partitioning across the m e m b r a n e a c c o r d i n g to a m e m b r a n e p o t e n t i a l has not b e e n observed.  88  O n e c l a s s o f a n t i m i c r o b i a l s t o w h i c h H.  pylori  are i n t r i n s i c a l l y resistant are the c a t i o n i c  a n t i m i c r o b i a l p e p t i d e s . T h i s p r o p e r t y c o u l d b e a n e v o l u t i o n a r y a d a p t a t i o n to the  in vivo  environment i n the gastric m u c o s a and the c h r o n i c i n f l a m m a t i o n associated w i t h c o l o n i z a t i o n o f t h e g a s t r i c m u c o s a b y H.  pylori.  The mechanism of  H. pylori r e s i s t a n c e t o  these c a t i o n i c  a n t i b i o t i c s i s n o t k n o w n . T h e p r e s e n c e o f t h e s e l f p r o m o t e d u p t a k e p a t h w a y i n H.  pylori  ( H a n c o c k , 1 9 9 7 ) s u g g e s t s t h a t p o l y m y x i n B i n t e r a c t s w i t h o u t e r m e m b r a n e o f H.  pylori b y  m a n n e r s i m i l a r to that o b s e r v e d w i t h  P. aeruginosa  b i n d i n g sites o n the surface o f L P S .  T h e resistance o f  and  E. coli,  by competing for divalent cation  H. pylori t o  high concentrations o f  p o l y m y x i n B m a y b e e x p l a i n e d b y the r e c e n t f i n d i n g that the b a c k b o n e o f u n d e r p h o s p h o r y l a t e d ( A s p i n a l l et al,  in a  H. pylori L P S  1996). R e d u c e d phosphorylation o f L P S  is  r e d u c e s the net  n e g a t i v e surface c h a r g e o n L P S a n d p r e s u m a b l y has an i n h i b i t o r y effect o n the i n t e r a c t i o n o f cationic a n t i m i c r o b i a l s w i t h the outer m e m b r a n e thus resulting i n increased resistance. U n d e r p h o s p h o r y l a t i o n o r c h a r g e n e u t r a l i z a t i o n b y a r a b i n o s a m i n o l a t i o n o f the L i p i d A b a c k b o n e has b e e n associated w i t h resistance to c a t i o n i c a n t i m i c r o b i a l peptides i n 1997),  Pseudomonas  ( M o o r e & H a n c o c k , 1986), and  C o n s i s t e n t w i t h t h e r e s i s t a n c e o f 77.  pylori t o  Vibrio  (Parsot  Salmonella  et al,  (Guo  et al,  1991) species.  r e l a t i v e l y h i g h c o n c e n t r a t i o n s o f p o l y m y x i n B , the  c o n c e n t r a t i o n o f p o l y m y x i n B r e q u i r e d f o r p e r m e a b i l i z a t i o n o f the  H. pylori  the N P N assays w a s a p p r o x i m a t e l y 1 0 - f o l d h i g h e r than w h a t is seen w i t h  outer m e m b r a n e i n  E. coli  or  P.  aeruginosa. I h y p o t h e s i z e that there are p h y s i o l o g i c a l c h a n g e s i n  H. pylori  associated w i t h growth in  t h e s t o m a c h , as o p p o s e d t o g r o w t h i n t h e l a b o r a t o r y t h a t a f f e c t t h e u p t a k e o f a n t i b i o t i c s b y H.  pylori.  T h e R T P C R d a t a o f R i c h a r d A i m ( A p p e n d i x I) s u g g e s t e d t h e p r e s e n c e o f a r e g u l a t o r y  m e c h a n i s m c o n t r o l l i n g the  in vivo  expression of  hefGHI o p e r o n  ( A p p e n d i x I). I n a d d i t i o n , o t h e r  89  genes that are p o t e n t i a l l y i m p o r t a n t i n a n t i b i o t i c s u s c e p t i b i l i t y  ofH. pylori, have b e e n s h o w n t o  b e d i f f e r e n t i a l l y e x p r e s s e d a c c o r d i n g t o t h e c e l l u l a r e n v i r o n m e n t , including s e v e r a l m e m b e r s o f the H o p f a m i l y ( W o r s t (Lee & O'Rourke,  et al, 1 9 9 5 ) a n d t h e p r o d u c t i o n of a c a p s u l e which is p r e s e n t o n l y in vivo  1993). Regulatory systems i n  Salmonella typhmirium (phoP r e g u l o n ) a n d  Vibrio cholerae (toxR r e g u l o n ) h a v e b e e n s h o w n to regulate the in vivo e x p r e s s i o n o f n u m e r o u s virulence factors i n their respective bacteria, i n c l u d i n g 1997; Parsot  cell envelope a l t e r a t i o n s ( G u o et al,  et al, 1 9 9 1 ) w h i c h h a v e b e e n i m p l i c a t e d in cell s u s c e p t i b i l i t y to c a t i o n i c  antimicrobial substances.  Collectively,  these c o n s i d e r a t i o n s s t r o n g l y suggest t h a t t h e r e a r e in  vivo p h y s i o l o g i c a l c h a n g e s i n H. pylori a n d these c h a n g e s are likely affect the in vivo susceptibility o f  H. pylori t o a n t i b i o t i c s . H o w e v e r , the R N D systems c o n t r i b u t i o n t o t h e in vivo  intrinsic resistance o f  H. pylori i s n o t k n o w n p r e s e n t l y .  I n c o n c l u s i o n , I h a v e s h o w n that that are c o n s e r v e d a m o n g three  H. pylori c o n t a i n s three R N D  efflux s y s t e m h o m o l o g u e s  H. pylori s t r a i n s a n d , in c o l l a b o r a t i o n , that the hefGHI s y s t e m i s  d i f f e r e n t i a l l y regulated, a n d that independent m u t a g e n e s i s  of the three R N D  e f f l u x o p e r o n s i n the  c h r o m o s o m e o f H. pylori h a d n o e f f e c t o n t h e s u s c e p t i b i l i t y of H. pylori to a n t i b i o t i c s in vitro. I w a s unable to i d e n t i f y active e f f l u x a c t i v i t y i n  in vitro-gvown H. pylori in c o n t r a s t t o w h a t i s s e e n  i n other G r a m n e g a t i v e b a c t e r i a s t u d i e d to date. e f f l u x does not p l a y a r o l e i n the  3.  Collectively  these results suggest t h a t a c t i v e  in vitro i n t r i n s i c r e s i s t a n c e o f H. pylori to a n t i b i o t i c s .  Identification of a conserved scaffolding  for  P r i o r to the w o r k p r e s e n t e d here, studies the p h y s i c a l genetic m a p s o f several  a family  o f P-barrel proteins  had d i r e c t l y o r i n d i r e c t l y found h e t e r o g e n e i t y i n  H. pylori s t r a i n s (Jiang et al, 1996). These r e s u l t s w e r e  h y p o t h e s i z e d a s i m p l y i n g h e t e r o g e n e i t y at t h e i n d i v i d u a l p r o t e i n release o f the  sequence level. T h e r e c e n t  H. pylori 2 6 6 9 5 g e n o m e s e q u e n c e b y Tomb et al. (1997) seemed t o b e c o n s i s t e n t  90  w i t h these p r e v i o u s f i n d i n g s .  T o m b et al. o b s e r v e d a p a r a l o g o u s f a m i l y o f 32 o u t e r m e m b r a n e  p r o t e i n g e n e s a n d h y p o t h e s i z e d t h e s e w e r e d e r i v e d b y g e n o m e v a r i a t i o n r e s u l t i n g from s l i p p e d strand m i s p a i r i n g a n d r e c o m b i n a t i o n events d u e to the e x i s t e n c e o f r e p e t i t i v e s e q u e n c e s w i t h i n this f a m i l y o f outer m e m b r a n e protein genes. The Hop family of  H. pylori o u t e r m e m b r a n e p r o t e i n s w a s first i n t r o d u c e d ( E x n e r et al.  1995) as a g r o u p i n g o f 5 p o r e - f o r m i n g p r o t e i n s ( p o r i n s H o p A - E ) , f o u r o f w h i c h d i s p l a y e d c o n s i d e r a b l e N - t e r m i n a l s e q u e n c e h o m o l o g y ( H o p A - D ) . T o m b et al. e x p a n d e d t h i s f a m i l y t o 3 2 proteins i n an outer m e m b r a n e protein f a m i l y based on extensive C - t e r m i n a l h o m o l o g y w i t h (22 proteins) o r w i t h o u t (10 proteins) the p r e v i o u s l y i d e n t i f i e d c o n s e r v e d N - t e r m i n u s . M y analysis o f the  H. pylori 2 2 6 9 5 g e n o m e r e v e a l e d a n a d d i t i o n a l t w o m e m b e r s o f t h e  H o p f a m i l y ( O R F s 0 1 0 1 a n d 1066) thus i n c r e a s i n g the total n u m b e r o f the H o p f a m i l y to 3 4 members.  T h e b i o l o g i c a l s i g n i f i c a n c e o f t h e H o p f a m i l y i s e v i d e n t as f a m i l y m e m b e r s h a v e b e e n  s h o w n t o f u n c t i o n a s a d h e s i n s ( l i v e r et al,  1998), a n d p o r i n s h a v e b e e n s h o w n to b e r e g u l a t e d b y  e n v i r o n m e n t a l s t i m u l i ( i r o n d e f i c i e n c y ) ( W o r s t et al,  1995).  H o w e v e r , the b i o l o g i c a l  s i g n i f i c a n c e o f the c o n s e r v e d s e q u e n c e m o t i f s a m o n g the H o p f a m i l y is not k n o w n . I n a d d i t i o n t o t h e H o p f a m i l y , t h e r e a l s o e x i s t s at l e a s t 5 o t h e r o u t e r m e m b r a n e p r o t e i n s , i d e n t i f i e d i n m y a n a l y s i s o f the g e n o m e , that d o not c o n t a i n the c o n s e r v e d s e q u e n c e m o t i f s ( O R F s 0 6 0 5 , 0 8 3 9 , 0 9 7 1 , 1125, a n d 1327; N . B . the  hefA, hep a n d hefG o u t e r m e m b r a n e p o r e  proteins do not c o n t a i n these motifs). M y m u l t i p l e s e q u e n c e a n a l y s i s o f the H o p f a m i l y w a s facilitated b y the a p p l i c a t i o n o f the G i b b s m o t i f s a m p l i n g a l g o r i t h m ( N e u w a l d et al,  1995).  The H o p family contains members  r a n g i n g i n s i z e from 8 6 t o 1 2 3 0 a m i n o a c i d s , m u l t i p l e s e q u e n c e a n a l y s i s m e t h o d s t h a t i n c o r p o r a t e g a p p e n a l t i e s a r e l e s s s e n s i t i v e at i d e n t i f y i n g c o n s e r v e d s e q u e n c e m o t i f s a m o n g  91  s e q u e n c e g r o u p s t h a t c o n t a i n p r o t e i n s w i t h l a r g e s i z e d i s t r i b u t i o n s ( N e u w a l d et al,  1995), than  a r e m o t i f - b a s e d m e t h o d s t h a t d o n o t a s s i g n g a p p e n a l t i e s ( s u c h as t h e G i b b s s a m p l i n g m o t i f method).  A p p l i c a t i o n o f t h e G i b b s m e t h o d to t h e H o p f a m i l y a l l o w e d t h e i d e n t i f i c a t i o n o f at  least 8 c o n s e r v e d s e q u e n c e m o t i f s that w e r e separated b y v a r y i n g lengths o f u n c o n s e r v e d acid sequence.  I n a d d i t i o n , the B L O C K S a n a l y s i s e x p a n d e d the s u b f a m i l y o f H o p  amino  proteins  c o n t a i n i n g the c o n s e r v e d N - t e r m i n a l sequence d o m a i n to 2 4 proteins. C o m p a r a t i v e s e q u e n c e a n a l y s i s o f the  H. pylori J 9 9 a n d H. pylori 2 2 6 9 5 r e v e a l e d t h a t t h e  H o p f a m i l y w a s h i g h l y c o n s e r v e d a m o n g t h e s e t w o s t r a i n s ( H a n c o c k et al, c o m p a r i s o n a l s o a l l o w e d s o m e i n t e r e s t i n g o b s e r v a t i o n s to be m a d e .  1998). T h e  First, in  H. pylori  26695  there w e r e 3 p a i r s o f genes that e n c o d e d s i m i l a r p r o t e i n s ( O R F 0 7 2 2 a n d 0 7 2 5 w e r e 8 5 % identical, O R F 0 4 7 7 and O R F 0923 were 9 9 % identical; and O R F 0227 and O R F  1342 were  1 0 0 % i d e n t i c a l ) . T h e p u t a t i v e p r o t e i n s e n c o d e d i n these last 2 p a i r s w e r e s p a c e d a l m o s t 5 0 0 k b a w a y from t h e i r r e l a t e d p a r t n e r s o n t h e c h r o m o s o m e .  A n a l y s i s o f the  H. pylori  J99 sequence  also revealed the presence o f these 3 pairs o f genes d i s p l a y i n g s i m i l a r h i g h levels o f sequence identity w i t h i n e a c h g r o u p . F i r s t l y , the  H. pylori J 9 9 e q u i v a l e n t s o f t h e O R F 0 4 7 7 a n d O R F  0 9 2 3 p r o t e i n s a l s o d i s p l a y e d 9 9 % i d e n t i t y to e a c h other, yet o n l y 8 9 % i d e n t i t y to the 26695 proteins.  H. pylori  I n b o t h strains there are 3 p a i r s o f genes f r o m the H o p f a m i l y that r e s i d e v e r y  c l o s e together o n the c h r o m o s o m e ; O R F 0 2 5 2 and O R F 0 2 5 4 (135 nt apart); H o p C ( O R F and H o p B ( O R F 0 9 1 3 ) (25 n t apart) and O R F  1156 and O R F  alignments to O R F 0 2 5 2 a n d O R F 0 2 5 4 w e r e O R F  0912)  1157 (26 n t apart). T h e closest  1156 and O R F  1157, respectively, suggesting  that these genes m a y h a v e a r i s e n b y the d u p l i c a t i o n a n d t r a n s p o s i t i o n o f an entire l o c u s . C o m p a r i s o n o f the  H. pylori J 9 9 g e n o m e s e q u e n c e w i t h t h a t o f t h e H. pylori 2 6 6 9 5 a n d  o t h e r s e q u e n c e s i n G e n b a n k s h o w s t h a t s e v e r a l o f t h e a b o v e g e n e s a r e h i g h l y c o n s e r v e d i n H.  92  pylori. F o r e x a m p l e t h e H o p C / H o p B p a i r o f g e n e s , w h i c h a r e 46% i d e n t i c a l t o e a c h o t h e r , b o t h s h a r e > 9 5 % i d e n t i t y t o t h e t w o o t h e r s e q u e n c e s o f e a c h o f t h e s e g e n e s a v a i l a b l e ( H a n c o c k et  al,  1 9 9 8 ) . I n f a c t , m a n y o f t h e m e m b e r s o f t h i s f a m i l y o f p r o t e i n s s h a r e > 9 0 % i d e n t i t y at t h e a m i n o a c i d l e v e l b e t w e e n strains 2 6 6 9 5 a n d J 9 9 . T h i s o b s e r v a t i o n s t r o n g l y suggests that the c o n s e r v e d sequence motifs f o u n d a m o n g the H o p f a m i l y do not function i n h o m o l o g o u s recombination to generate g e n o m i c o r antigenic diversity. I h y p o t h e s i z e that the c o n s e r v e d sequence m o t i f s i n the H o p f a m i l y f u n c t i o n as a c o n s e r v e d s c a f f o l d i n g f o r a f a m i l y o f P-barrel proteins.  T h i s hypothesis is based o n m o d e l i n g o f  the t r a n s m e m b r a n e t o p o l o g y o f m e m b e r s o f the general ( n o n - s p e c i f i c ) p o r i n f a m i l y .  Although  there i s n o apparent p r i m a r y a m i n o a c i d sequence c o n s e r v a t i o n b e t w e e n b a c t e r i a l species f o r s u c h P-strands, a g e n e r a l m o t i f o f alternating h y d r o p h o b i c a n d h y d r o p h i l i c residues i s evident, e s p e c i a l l y i n the N - a n d C - t e r m i n a l P-strands, w h i c h are i n v o l v e d i n s u b u n i t : s u b u n i t interactions. T o m b et al. n o t e d t h a t t h e c o n s e r v e d C - t e r m i n i o f t h e H o p f a m i l y c o n t a i n s a l t e r n a t i n g h y d r o p h o b i c a n d h y d r o p h i l i c r e s i d u e s , a n d m y o w n m o d e l i n g suggests that t h e m o s t c o n s e r v e d stretches o f a m i n o a c i d s c a n b e p r e d i c t e d to b e t r a n s m e m b r a n e P-strands, w h i c h suggests a s t r o n g p o t e n t i a l f o r t h e c o n s e r v e d s e q u e n c e m o t i f s to serve as a c o n s e r v e d s t r u c t u r a l m o t i f f o r a f a m i l y o f P-barrel proteins. H o p E ( O R F 0 7 0 6 ) w a s s e l e c t e d as a m o d e l p r o t e i n f o r the t e s t i n g o f m y h y p o t h e s i s f o r t w o reasons. First, H o p E h a d b e e n p r e v i o u s l y characterized a n d f o u n d to have a large pore d i a m e t e r w h i c h i s c o n s i s t e n t w i t h H o p E f u n c t i o n i n g as a g e n e r a l d i f f u s i o n p o r e ( D o i g et  al,  1995). S e c o n d , H o p E w a s the smallest m e m b e r o f the H o p f a m i l y to c o n t a i n the m a j o r i t y o f the conserved sequence motifs.  93  R e c o m b i n a n t l y p r o d u c e d bacterial outer m e m b r a n e proteins often end up b e i n g incorporated into cytoplasmic inclusion bodies.  S e v e r a l o b s e r v a t i o n s suggest that r e c o m b i n a n t l y  expressed H o p E w a s not i n c o r p o r a t e d into i n c l u s i o n b o d i e s but w a s p r o p e r l y sorted to the outer  m e m b r a n e o f E. coli. R e c o m b i n a n t H o p E w a s not h i g h l y p r o d u c e d and cofractionated w i t h the outer membrane.  T h e m o d e s t l e v e l o f H o p E e x p r e s s i o n is not consistent w i t h w h a t is u s u a l l y observed  w i t h proteins that are f o u n d i n i n c l u s i o n b o d i e s . F u r t h e r m o r e , i f H o p E w e r e i n i n c l u s i o n b o d i e s , the l e v e l o f H o p E o b s e r v e d i n the total m e m b r a n e (particulate) f r a c t i o n a n d w h o l e c e l l lysates s h o u l d b e s i g n i f i c a n t l y h i g h e r t h a n that o b s e r v e d i n the o u t e r m e m b r a n e p r e p a r a t i o n s .  In fact I  saw a r e d u c t i o n (per unit w e i g h t ) i n the a m o u n t o f H o p E i n w h o l e cell lysates and total m e m b r a n e preparations w h i c h is consistent w i t h the presence o f H o p E i n the outer m e m b r a n e . Recombinant H o p E in  E. coli c e l l s w a s i d e n t i c a l o n S D S P A G E t o a u t h e n t i c H o p E  present i n the outer m e m b r a n e o f exported b y the  H. pylori. T h i s o b s e r v a t i o n s u g g e s t e d t h a t H o p E w a s p r o p e r l y  E. coli g e n e r a l s e c r e t o r y s y s t e m a n d h a d i t s s i g n a l p e p t i d e r e m o v e d . It h a s b e e n  p r e v i o u s l y s h o w n that r e c o m b i n a n t l y e x p r e s s e d outer m e m b r a n e p r o t e i n s that are i n c o r p o r a t e d into i n c l u s i o n b o d i e s still r e t a i n their N - t e r m i n a l s i g n a l s e q u e n c e and are v i s u a l i z e d o n S D S P A G E at h i g h e r a p p a r e n t m o l e c u l a r w e i g h t s t h a n t h e n a t i v e p r o t e i n s ( W o n g et al,  1993).  T h e heat m o d i f i c a t i o n o f H o p E o n S D S P A G E s u g g e s t s that r e c o m b i n a n t H o p E  folded  into a P-barrel structure that is c h a r a c t e r i s t i c o f b a c t e r i a l p o r i n p r o t e i n s , s i n c e heat m o d i f i c a t i o n i s o n e d e f i n i n g e x p e r i m e n t a l c h a r a c t e r i s t i c o f p - b a r r e l p r o t e i n s ( V a n G e l d e r et a l . , 1 9 9 7 ) . F u r t h e r m o r e , it w a s p r e v i o u s l y s h o w n that that r e c o m b i n a n t l y e x p r e s s e d o u t e r m e m b r a n e p r o t e i n s i n i n c l u s i o n b o d i e s l o s t the a b i l i t y to b e m o d i f i e d b y heat. T h u s I c o n c l u d e that  94  r e c o m b i n a n t H o p E w a s c o r r e c t l y p r o c e s s e d a n d e x p o r t e d to t h e al,  E. coli  outer m e m b r a n e ( W o n g  et  1993). The  hopE  gene w a s mutagenized b y insertion o f a 5 amino acid peptide ( R S K D V )  that  c o n t a i n e d 3 c h a r g e d a m i n o acids. M u t a n t s w i t h insertion o f the peptide into 3 o f the c o n s e r v e d s e q u e n c e m o t i f s w h i c h w e r e p r e d i c t e d to f o r m m e m b r a n e - s p a n n i n g  P-strands o fH o p E , w e r e not  i n c o r p o r a t e d into the outer m e m b r a n e , w h e r e a s mutants w i t h insertions into the three o f the putative ( n o n c o n s e r v e d ) l o o p r e g i o n s w e r e f o u n d i n the outer m e m b r a n e .  These results support  m y s t r u c t u r a l m o d e l a n d w e r e c o n s i s t e n t w i t h m y h y p o t h e s i s that the c o n s e r v e d m o t i f s are part o f a conserved structural motif. T h e results o f this study represent a significant finding.  T h e outer m e m b r a n e o f  H. pylori  c o n t a i n s a l a r g e n u m b e r o f m o d e r a t e l y e x p r e s s e d p r o t e i n s , i n contrast to that o f m a n y other G r a m negative bacteria w h i c h generally contain a smaller number o fdominant proteins.  Families o f  h i g h l y s i m i l a r outer m e m b r a n e proteins have been identified i n other bacteria i n c l u d i n g  (ompC, ompF  and  phoE), S. typhimurium (ompC, ompF  P I B 2 and P I A 1 ) (reviewed i n Jeanteur  et al,  1991) and  www.interchange.ubc.ca/bobh/genomics.htm).  and  E. coli  phoE), Neisseria gonnorheae  P. aeruginosa  (12 h o m o l o g s  (PIB1,  ofoprD;  see  H o w e v e r , i n these instances the i n d i v i d u a l  p r o t e i n s are h i g h l y h o m o g e n o u s i n s i z e a n d c o n t a i n p r o n o u n c e d a m i n o a c i d identities t h r o u g h o u t their sequences. I n contrast, the  H. pylori  H o p f a m i l y contains m a n y m o r e m e m b e r s and the  i n d i v i d u a l genes v a r y greatly i n size, and i n m o s t cases share little identity outside the conserved motifs.  Future w o r k , i n c l u d i n g functional analyses and expression studies w i l l help to elucidate  the p o t e n t i a l r o l e f o r the H o p f a m i l y i n the e c o l o g y a n d pathogenesis  ofH.  pylori.  I n c o n c l u s i o n , a p p l i c a t i o n o f the G i b b s s a m p l i n g m e t h o d to the H o p f a m i l y has f a c i l i t a t e d t h e i d e n t i f i c a t i o n o f at l e a s t 8 c o n s e r v e d s e q u e n c e m o t i f s a m o n g t h e H o p f a m i l y .  I have  95  c o n s t r u c t e d a structural m o d e l f o r the H o p E p r o t e i n w h i c h w a s s u p p o r t e d b y the results f r o m insertional mutagenesis o f H o p E .  C o l l e c t i v e l y these results s u p p o r t e d m y h y p o t h e s i s that the  c o n s e r v e d sequence m o t i f s a m o n g the H o p f a m i l y proteins represent a c o n s e r v e d structural m o t i f for a f a m i l y o f P-barrel proteins.  Appendix I.  Mutagenesis and expression analysis of the RND efflux M y w o r k o n c h a r a c t e r i z i n g the R N D e f f l u x s y s t e m i n  systems  in Helicobacter pylori.  H. pylori w a s p a r t o f a  c o l l a b o r a t i v e e f f o r t b e t w e e n m e a n d D r . R i c h a r d A i m at A s t r a R e s e a r c h B o s t o n I n c . A s p a r t o f that c o l l a b o r a t i o n , the m u t a g e n e s i s a n d a n a l y s i s o f efflux systems was performed by Dr. A i m .  in vitro a n d in vivo e x p r e s s i o n o f t h e R N D  B e l o w I b r i e f l y present D r . A i m ' s d a t a that are  relevant to the w o r k presented here.  A. Mutagenesis of the efflux operons Mutagenesis of amplified from  H.  pylori J 9 9 a n d c l o n e d i n t o p G E M - T ( B R L ) .  the i n s e r t i o n o f the K m into  hefC, hefF a n d hefl w e r e p e r f o r m e d as f o l l o w s .  R  cassette f r o m p I L L 6 0 0 .  T h e genes were  The genes were inactivated  by  This p l a s m i d construct w a s then introduced  H. pylori J 9 9 b y n a t u r a l t r a n s f o r m a t i o n , a n d t r a n s f o r m a n t s w e r e s e l e c t e d b y p l a t i n g o n  c h o c o l a t e b l o o d a g a r p l a t e s p l u s 10 u g / m l k a n a m y c i n .  Chromosomal D N A was prepared  from  s e v e r a l t r a n s f o r m a n t s , a n d a n a l y z e d b y P C R to ensure that the d o u b l e c r o s s o v e r h a d o c c u r r e d i n the correct p o s i t i o n . T h e r e s u l t i n g mutants w e r e screened for alterations i n g r o w t h and s u s c e p t i b i l i t y to m a n y antibiotics a n d w e r e f o u n d not to be affected i n g r o w t h or s u s c e p t i b i l i t y to any tested antibiotics.  B. Gene expression analysis of the hef operons by reverse transcriptase PCR  96  R N A was isolated from  H. pylori  S S I that h a d b e e n g r o w n  in vitro  (on chocolate blood  agar plates) o r d i r e c t l y f r o m the s t o m a c h s o f C 5 7 B L / 6 m i c e that w e r e c o l o n i z e d w i t h SSI  (in vivo).  T h e R N A w a s prepared u s i n g the S . N . A . P .  Invitrogen (Carlsbad, C A ) .  Total R N A Isolation K i t from  T h e R N A w a s a n a l y z e d b y R T - P C R u s i n g the S u p e r s c r i p t R T - P C R  kit from G i b c o B R L (Gaithersburg, M D ) .  T h e gene s p e c i f i c p r i m e r s f o r the e f f l u x p u m p s u s e d  w e r e d e s i g n e d from t h e s e q u e n c e a l i g n m e n t s o f t h e g e n e s f r o m a n d a r e as f o l l o w s . whereas for  hefl,  For  H. pylori  hefF,  H. pylori  strains 2 6 6 9 5 and J 9 9  H e l l and H e l 2 w e r e predicted to a m p l i f y a 4 1 8 b p a m p l i c o n ,  H e l 3 and H e l 4 were predicted to produce a 515bp a m p l i c o n .  independent reactions were used for each analysis.  Three  Total nucleic acid (before D N A removal)  w a s u s e d a s a p o s i t i v e c o n t r o l t e m p l a t e , w h e r e a s R N A w a s u s e d as a t e m p l a t e i n 2 i d e n t i c a l reactions w h e r e the o n l y d i f f e r e n c e w a s the a d d i t i o n o f the reverse transcriptase e n z y m e .  The  r e a c t i o n s w e r e h e l d a t 3 7 ° C f o r 3 0 m i n p r i o r t o 3 5 c y c l e s o f P C R w i t h p a r a m e t e r s o f 15 s e c a t 9 4 ° C , 1 5 s e c a t 5 5 ° C a n d 1 m i n at 7 2 ° C .  T h e reactions w e r e there e l e c t r o p h o r e s e d o n a 1 %  T A E agarose gel. T h e results o f these e x p e r i m e n t s s h o w e d that the expressed both  in vivo  and  in vitro  w h i l e the  hefGHI  hefABC  and  hefDEF  operons were  operon was only expressed  in vivo.  97  BIBLIOGRAPHY  A K O P Y A N Z , N., B U K A N O V , N.O., W E S T B L O M , T . U . A N D B E R G D.E.: P C R - b a s e d R F L P a n a l y s i s o f D N A s e q u e n c e d i v e r s i t y i n t h e g a s t r i c p a t h o g e n Helicobacter pylori. N u c l e i c Acids Research 20:6221-6225,  1992.  A L T S C H U L , S.F., G I S H , W., M I L L E R , W., M Y E R S , E.W. A N D L I P M A N , D.J.: Basic local alignment search tool. Journal o f M o l e c u l a r Biology. 215: 403-410,  1990.  A P P E L M E L K , B . J . , N E G R I N I , R., M O R A N , A . P . A N D K U I P E R S , E . J . : M o l e c u l a r m i m i c r y b e t w e e n Helicobacter pylori a n d t h e h o s t . T r e n d s i n M i c r o b i o l o g y  5:  70-73,  1997.  A P P E L M E L K , B . J , I. S I M O O N S - S M I T , R . N E G R I N I , A . P . M O R A N , G . O . A S P I N A L L , J . G . F O R T E , T. D E V R I E S , H . Q U A N , T. V E R B O O M , J . J . M A A S K A N T , P. G H I A R A ,  E.  K U I P E R S , E . B L O E M E N A , T. M . T A D E M A , R. R . T O W N S E N D , K . T Y A G A R A J A N , M.CROTHERS,  M . A . M O N T E I R O , A . S A V I O & J . D E G R A A F F . : Potential role o f  m o l e c u l a r m i m i c r y b e t w e e n Helicobacter pylori l i p o p o l y s a c c h a r i d e a n d h o s t L e w i s b l o o d group antigens i n autoimmunity. Infection & I m m u n i t y 64: 2 0 3 1 - 2 0 4 0 ,  1996.  A S P I N A L L , G.O., M O N T E I R O , M.A., P A N G , H., W A L S H , E.J. A N D M O R A N , A.P.: L i p o p o l y s a c c h a r i d e o f t h e Helicobacter pylori t y p e s t r a i n N C T C 1 1 6 3 7 ( A T C C Structure o f the O antigen c h a i n and core oligosaccharide regions. B i o c h e m i s t r y 2489-2497,  43504): 35:  1996.  B E R G , D . E . , H O F F M A N , P . S . , A P P E L M E L K , B . J . A N D K U S T E R S , J . G . : T h e Helicobacter  pylori g e n o m e s e q u e n c e : g e n e t i c f a c t o r s f o r l o n g l i f e i n t h e g a s t r i c m u c o s a . T r e n d s i n M i c r o b i o l o g y 5: 4 6 8 - 4 7 4 ,  1997.  B I N A , J . E . , N A N O , F. A N D H A N C O C K , R . E . : U t i l i z a t i o n o f a l k a l i n e phosphatase fusions to identify secreted proteins, i n c l u d i n g potential efflux proteins and virulence factors  Helicobacter pylori. F E M S M i c r o b i o l o g y L e t t e r s .  148:  63-68,  from  1997.  B o r e n , T . , N o r m a r k , S . a n d F a l k , P . : Helicobacter pylori: m o l e c u l a r b a s i s f o r h o s t r e c o g n i t i o n and bacterial adherence. Trends i n M i c r o b i o l o g y . 2:221-228, 1994. B O S C H D. T O M M A S S E N J . E f f e c t s o f l i n k e r insertions o n the b i o g e n e s i s a n d f u n c t i o n i n g o f t h e Escherichia coli o u t e r m e m b r a n e p o r e p r o t e i n P h o E . M o l e c u l a r & G e n e r a l G e n e t i c s .  208:485-9, 1 9 8 7 . BOUGES-BOCQUET  B . V I L L A R R O Y A H . H O F N U N G M . L i n k e r mutagenesis i n the gene o f  a n o u t e r m e m b r a n e p r o t e i n o f Escherichia coli, lamB. J o u r n a l o f C e l l u l a r B i o c h e m i s t r y .  24:217-28, 1984. B O U L A T N J C . C H A R B I T A . H O F N U N G M . M u t a g e n e s i s b y r a n d o m l i n k e r insertion into the  lamB g e n e oi Escherichia coli K 1 2 . M o l e c u l a r & G e n e r a l G e n e t i c s . 2 0 5 : 3 3 9 - 4 8 , 1 9 8 6 .  98  C E L L I N I , L.,A L L O C A T I , N., A N G E L U C C I , D., L E Z Z I , T., D I , C.E., M A R Z I O , L . A N D D A I N E L L I , B.: Coccoid  Helicobacter pylori  M i c r o b i o l o g y & I m m u n o l o g y 38: 843-850, C O V A C C I , A . A N D R A P P O U L I , R.:  not culturable  in vitro  reverts i n mice.  1994.  Helicobacter pylori:  molecular evolution o f a bacterial  quasi-species. Current O p i n i o n i n M i c r o b i o l o g y 1:96-102, 1998.  Vibrio K.  C O L W E L , R . R . & H U Q , A . : V i b r i o s i n the E n v i r o n m e n t : V i a b l e but N o n c u l t u r a b l e  cholerae.  In:  Vibrio colerae  a n d C h o l e r a : M o l e c u l a r to G l o b a l P e r s p e c t i v e s , ed. b y  W a c h s m u t h , P. B l a k e and Orjan O l s v i k . pp. 117-131, A S M Press, W a s h i n g t o n , COWAN,  S.W., S C H I R M E R ,  1994.  T., R U M M E L , G., S T E I E R T , M . , G H O S H , R., P A U P T I T ,  R.A.,  J A N S O N I U S , J . N . A N D R O S E N B U S C H , J . P . : C r y s t a l structures e x p l a i n f u n c t i o n a l properties o f t w o  Escherichia  coli  porins.  Nature (London) 358: 727-733,  1992.  D A R V E A U , R . P.: L i p i d A d i v e r s i t y a n d the innate host r e s p o n s e t o b a c t e r i a l i n f e c t i o n . C u r r e n t O p i n i o n i n M i c r o b i o l o g y 1:36-42, 1998. D E R M A N , A.I. A N D B E C K W I T H , J.:  Escherichia  coli  a l k a l i n e phosphatase l o c a l i z e d to the  c y t o p l a s m s l o w l y acquires e n z y m a t i c activity i n cells w h o s e g r o w t h has b e e n suspended: a c a u t i o n for gene f u s i o n studies. Journal o f B a c t e r i o l o g y . 177: 3 6 7 4 - 3 7 7 0 ,  1995.  D O I G , P., E X N E R , M . M . , H A N C O C K , R . E . A N D T R U S T , T . J . : Isolation and characterization o f a conserved porin protein from  Helicobacter pylori.  177:  Journal of Bacteriology.  5447.5452, 1 9 9 5 .  E A T O N , K . A . , S U E R B A U M , S., J O S E N H A N S , C , K R A K O W K A , S.: C o l o n i z a t i o n o f gnotobiotic piglets by  Helicobacter pylori  I m m u n i t y . 64: 2 4 4 5 - 2 4 4 8 ,  deficient i n t w o f l a g e l l i n genes.  Infection &  1996.  E A T O N , K . A . , C A T R E N I C H , C . E . , M A K I N , K . M . A N D K R A K O W K A , S.: V i r u l e n c e o f coccoid and bacillary forms of  Helicobacter pylori  I n f e c t i o u s D i s e a s e s 171: 4 5 9 - 4 6 2 ,  in gnotobiotic piglets. Journal o f  1995.  E X N E R , M . M . , D O I G , P., T R U S T , T . J . , A N D H A N C O C K , R . E . : Isolation and characterization o f a f a m i l y o f porin proteins from  Helicobacter pylori.  Infection & I m m u n i t y 63,1567-  1572. G E I S , G., L E Y I N G , H., S U E R B A U M , S. A N D  O P F E R K U C H , W . : U n u s u a l fatty a c i d  substitution i n lipids and lipopolysaccharides M i c r o b i o l o g y 28:  930-932,  oi Helicobacter pylori.  Journal of Clinical  1990.  G O , M . F . , K A P U R , V . , G R A H A M , D.Y., M U S S E R , J . M . : Population genetic analysis o f  Helicobacter pylori  b y multilocus enzyme electrophoresis: extensive allelic diversity and  r e c o m b i n a t i o n a l p o p u l a t i o n structure. J o u r n a l o fB a c t e r i o l o g y 1 7 8 : 3 9 3 4 - 3 9 3 8 , G R O M I H A , M . M . , M A J U M D A R , R. A N D P O N N U S W A M Y , s p a n n i n g beta strands i n bacterial porins.  1996.  P.K.: Identification o f membrane  P r o t e i n E n g i n e e r i n g 10: 4 9 7 - 5 0 0 ,  1997.  99  GROMIHA, M.M. A N D PONNUSWAMY,  P.K.: Prediction of transmembrane  f r o m hydrophobic characteristics o f proteins. R e s e a r c h 42: 4 2 0 - 4 3 1 ,  beta-strands  International Journal o f Peptide & Protein  1993.  G U O , L.,L I M , K . B . , G U N N , J.S., B A J N B R I D G E , B., D A R V E A U , R.P., H A C K E T T , M . A N D M I L L E R , S . L : R e g u l a t i o n o f l i p i d A m o d i f i c a t i o n s b y Salmonella genes  typhimurium v i r u l e n c e  phoP-phoQ. S c i e n c e 276: 2 5 3 1 9 9 7 .  HAGMAN,K.E.; PAN,W.; SPRATT,B.G.; BALTHAZAR,J.T.; JUDD,R.C;  SHAFER,W.M.:  R e s i s t a n c e o f N e i s s e r i a gonorrhoeae to a n t i m i c r o b i a l h y d r o p h o b i c agents is m o d u l a t e d b y t h e mtrRCDE e f f l u x s y s t e m . M i c r o b i o l o g y 1 4 1 : 6 1 1 - 6 2 2 ,  1995.  H A N C O C K , R . E . : R o l e o f porins i n outer m e m b r a n e permeability. 929-933,  J o u r n a l o f B a c t e r i o l o g y 169:  1987.  H A N C O C K , R . E . A N D B E L L , A . : A n t i b i o t i c uptake into gram-negative bacteria. E u r o p e a n Journal o fC l i n i c a l M i c r o b i o l o g y and Infectious Disease 7:713-720,  1988  H A N C O C K , R.E.: Outer m e m b r a n e proteins o f Pseudomonas. M o l e c u l a r M i c r o b i o l o g y 4:10691079,  1990.  H A N C O C K , R . E . : T h e b a c t e r i a l o u t e r m e m b r a n e as a d r u g b a r r i e r . 37-42,  T r e n d s i n M i c r o b i o l o g y 5:  1997.  H A N C O C K , R . E., A L M , R., B L N A , J . A N D T R U S T , T.:  Helicobacter pylori: a s u r p r i s i n g l y  conserved bacterium. Nature Biotechnology 16:216-217,  1998  H A Z E L L , S . L . A N D M E N D E Z , G . : T h e M e t a b o l i s m a n d E n z y m e s oi Helicobacter pylori: F u n c t i o n a n d P o t e n t i a l V i r u l e n c e E f f e c t s . I n Helicobacter  pylori b i o l o g y a n d c l i n i c a l  practice, ed. b y C S . G o o d w i n and B . W . W o r s l e y , pp. 115-142, C R C Press, L o n d o n , 1993. H U A N G , X . : A contig assembly program based o nsensitive detection o f fragment overlaps. G e n o m i c s 14: 1 8 - 2 5 , I L V E R , D., A R N Q V I S T ,  1992.  A . , O G R E N , J . , F R I C K , I . M . , K E R S U L Y T E , D., I N C E C I K ,  B E R G , D.E., C O V A C C I , A., E N G S T R A N D ,  L. A N D B O R E N , T . : Helicobacter pylori  adhesin b i n d i n g fucosylated h i s t o - b l o o d group antigens revealed b y retagging. 279: 3 7 3 - 3 7 7 ,  E.T., Science  1998.  J E A N T E U R , D., L A K E Y , J . H . A N D P A T T U S , F.: The bacterial porin superfamily: a l i g n m e n t a n d s t r u c t u r e p r e d i c t i o n . M o l e c u l a r M i c r o b i o l o g y 5: 2 1 5 3 - 2 1 6 4 ,  sequence 1991.  J I A N G , Q., H I R A T S U K A , K . A N D T A Y L O R , D.E.: V a r i a b i l i t y o f gene order i n different  Helicobacter pylori s t r a i n s c o n t r i b u t e s t o g e n o m e d i v e r s i t y . M o l e c u l a r M i c r o b i o l o g y 20: 833-842,1996.  100  K O H L E R T. M I C H E A - H A M Z E H P O U R  M. H E N Z E U. G O T O H N. C U R T Y L K . P E C H E R E  J C : Characterization o f M e x E - M e x F - O p r N , a positively regulated multidrug efflux  s y s t e m of Pseudomonas aeruginosa. M o l e c u l a r M i c r o b i o l o g y 2 3 : 3 4 5 - 5 4 , 1 9 9 7 K O V A C H , M.E., P H I L L I P S , R.W., E L Z E R , P.H., R O O P , R . M . , P E T E R S O N A N D K M : p B B R l M C S : a broad-host-range c l o n i n g vector. Biotechniques 16: 800-802, 1994. K U S T E R S , J.G., GERRTTS, M . M . , V A N STRIJP, J.A.G. A N D G . C . M . J . : C o c c o i d forms  VANDENBROUCKE,  of Helicobacter pylori a r e t h e m o r p h o l o g i c m a n i f e s t a t i o n o f  cell death. Infection & I m m u n i t y 6 5 : 3672-3679, 1997. L A K E Y , J . H . , W A T T S , J . P. A N D L E A E. J . : Characterisation o f channels i n d u c e d i n planar b i l a y e r m e m b r a n e s b y detergent s o l u b i l i s e d  Escherichia coli p o r i n s . B i o c h i m B i o p h y s  A c t a 817: 208-216, 1985. L E V Y , S . B . : A c t i v e efflux m e c h a n i s m s for antimicrobial resistance. A n t i m i c r o b i a l A g e n t s & Chemotherapy 36:695-703, 1992. L E E , A . A N D O ' R O U R K E , J.: Ultrastructure o f  Helicobacter O r g a n i s m s a n d P o s s i b l e R e l e v a n c e f o r P a t h o g e n e s i s . I n Helicobacter pylori: B i o l o g y a n d C l i n i c a l P r a c t i c e , e d . b y C S . G o o d w i n and B . W . Worsley, pp. 16-32, C R C Press, A n n Arbor, 1993.  LI, X . Z., N I K A I D O , H A N D P O O L E . K . : R o l e o f M e x A - M e x B - O p r M in antibiotic efflux i n  Pseudomonas aeruginosa. A n t i m i c r o b i a l A g e n t s & C h e m o t h e r a p y 3 9 : 1 9 4 8 - 1 9 5 3 , 1 9 9 5 . L O H , B . , G R A N T , C . A N D H A N C O C K , R . E . : U s e o f the fluorescent probe 1 - N phenylnaphthylamine  to study the interactions o f a m i n o g l y c o s i d e antibiotics w i t h the  o u t e r m e m b r a n e o f Pseudomonas aeruginosa. A n t i m i c r o b i a l A g e n t s & C h e m o t h e r a p y 26: 5 4 6 - 5 5 1 , 1 9 8 4 . M A , D . , C O O K , D . N . , A L B E R T I , M . , P O N , N . G . , N I K A I D O , H. A N D H E A R S T , J . E . : M o l e c u l a r cloning and characterization o f  acrA a n d acrE g e n e s o f Escherichia coli.  Journal o f Bacteriology 175:6299-6313, 1993. M A , D., C O O K , D . N . , H E A R S T , J . E . A N D N I K A I D O , H . : E f f l u x p u m p s a n d d r u g resistance i n g r a m - n e g a t i v e b a c t e r i a . T r e n d s i n M i c r o b i o l o g y 2: 4 8 9 - 4 9 3 , 1 9 9 4 . MANOIL,  C , M E K A L A N O S , J.J. A N D B E C K W I T H , J . : A l k a l i n e phosphatase fusions: sensors  o f s u b c e l l u l a r l o c a t i o n . J o u r n a l o f B a c t e r i o l o g y . 172: 5 1 5 - 5 1 8 , 1 9 9 0 . M A R S H A L L , B . J . A N D W A R R E N , J . R . : U n i d e n t i f i e d curved b a c i l l i i n the s t o m a c h o f patients w i t h g a s t r i t i s a n d p e p t i c u l c e r a t i o n . L a n c e t i: 1 3 1 1 , 1 9 8 4 . M D L U L I , K . E . , T R E I T , J . D . , K E R R , V . J . A N D N A N O , F . E . : N e w v e c t o r s f o r t h e in vitro generation o f a l k a l i n e phosphatase fusions to proteins e n c o d e d b y G + C - r i c h D N A .  Gene  155:133-134,1995.  101  M O O R E , R . A . , B A T E S , N . C . A N D H A N C O C K , R.E.: Interaction o f polycationic antibiotics with  Pseudomonas aeruginosa  lipopolysaccharide and lipid A studied b y using dansyl-  p o l y m y x i n . A n t i m i c r o b i a l Agents & Chemotherapy. 29: 496-500,  1986.  M O O R E , R.A., B E C K T H O L D , B. A N D B R Y A N , L.E.: Metronidazole uptake in pylori. C a n a d i a n J o u r n a l o f M i c r o b i o l o g y . 4 1 : 7 4 6 - 7 4 9 ,  Helicobacter  1995.  M O O R E , R . A , A N D H A N C O C K , R . E . : I n v o l v e m e n t o f o u t e r m e m b r a n e of Pseudomonas cepacia i n a m i n o g l y c o s i d e a n d p o l y m y x i n r e s i s t a n c e . A n t i m i c r o b i a l A g e n t s & Chemotherapy 30:923-926,  1986  M O O R E , R . A . , B E C K T H O L D , B . , W O N G , S., K U R E I S H I , A . A N D B R Y A N , L . E . : N u c l e o t i d e s e q u e n c e o f t h e gyrA g e n e a n d c h a r a c t e r i z a t i o n o f c i p r o f l o x a c i n - r e s i s t a n t m u t a n t s Helicobacter pylori. A n t i m i c r o b i a l A g e n t s & C h e m o t h e r a p y . 3 9 : 1 0 7 - 1 1 1 , 1 9 9 5 .  of  M O R A N , A . P . , L I N D N E R , B . A N D W A L S H , E . J . : Structural c h a r a c t e r i z a t i o n o f the l i p i d a component of  Helicobacter pylori  o f Bacteriology 179: 6453-6463, MUOTIALA,  A . , H E L A N D E R , I.M., P Y H A L A , L., K O S U N E N , T . U . A N D M O R A N ,  L o w biological activity of 60: 1714-1716, MUTHARIA,  rough- and smooth-form lipopolysaccharides.  Helicobacter-pylori  1992.  L . M . A N D H A N C O C K , R.E.: Surface localization o f  1027-1033,  A.P.:  lipopolysaccharide. Infection & Immunity  Pseudomonas aeruginosa  outer m e m b r a n e porin protein F b y using m o n o c l o n a l antibodies. 42:  Journal  1997.  Infection & Immunity  1983.  N E D E N S K O V - S O R E N S E N , P. B U K H O L M G . A N D B O V R E , K . N a t u r a l c o m p e t e n c e f o r g e n e t i c t r a n s f o r m a t i o n i n Campylobacter pylori. J o u r n a l o f I n f e c t i o u s D i s e a s e 1 6 1 : 3 6 5 366, NEUWALD,  1990. A . F . , L I U , J.S. A N D L A W E R N C E , C.E.: Gibbs motif sampling: detection o f  bacterial outer m e m b r a n e repeats. P r o t e i n S c i e n c e 4 : 1 6 1 8 - 1 6 3 2 ,  1995.  N G U Y E N , A . M . , E N G S T R A N D , L., G E N T A , R . M . , G R A H A M , D . Y . A N D F.A.: Detection of  Helicobacter pylori  EL-ZAATARI,  i n dental plaque b y reverse transcription-  polymerase chain reaction. Journal o f Clinical M i c r o b i o l o g y . 31: 783-787,  1993.  N I K A I D O , H . : B a c t e r i a l r e s i s t a n c e t o a n t i b i o t i c s as a f u n c t i o n o f o u t e r m e m b r a n e p e r m e a b i l i t y . Journal o f Antimicrobial Chemotherapy 22:17-22,  1988.  N I K A I D O , H : Transport across the bacterial outer membrane. Biomembranes. 25: 581-589,  Journal of Bioenergetics and  1993.  N I K A I D O , H . : M u l t i d r u g efflux p u m p s o f gram-negative bacteria. Journal o f Bacteriology. 178: 5853-5859,  1996.  102  N I K A I D O H . A N D R O S E N B E R G , E . Y . : P o r i n c h a n n e l s i n Escherichia  coli: s t u d i e s w i t h  l i p o s o m e s r e c o n s t i t u t e d f r o m p u r i f i e d p r o t e i n s . J o u r n a l o f B a c t e r i o l o g y 153:  241-252  1983. N I K A I D O H . A N D T H A N A S S I , D . G . : P e n e t r a t i o n o f l i p o p h i l i c agents w i t h m u l t i p l e p r o n a t i o n sites into b a c t e r i a l c e l l s : t e t r a c y c l i n e s a n d f l u o r o q u i n o l o n e s as e x a m p l e s . A n t i m i c r o b i a l A g e n t s & Chemotherapy 37:1393-1399, 1993. O C A K T A N , A . , Y O N E Y A M A , H . A N D N A K A E , T.: U s e o f f l u o r e s c e n c e p r o b e s t o m o n i t o r function o f the subunit proteins o f the M e x A - M e x B - O p r M drug extrusion m a c h i n e r y i n  Pseudomonas aeruginosa. J o u r n a l o f . B i o l o g i c a l C h e m i s t r y . 272: 2 1 9 6 4 - 2 1 9 6 9 , 1 9 9 7 . O K U S U , H . , M A , D .A N D N I K A I D O ,  H . : A c r A B efflux p u m p plays amajor role i n the  antibiotic resistance phenotype o f mutants.  Escherichia coli m u l t i p l e - a n t i b i o t i c - r e s i s t a n c e ( M a r )  J o u r n a l o f B a c t e r i o l o g y . 178: 3 0 6 - 3 0 8 , 1 9 9 6 .  P A R S O T , C , T A X M A N , E . A N D M E K A L A N O S , J.J.: T o x R regulates thep r o d u c t i o n o f lipoproteins and the expression o f serum resistance i n  Vibrio cholerae. P r o c e e d i n g s o f  t h e N a t i o n a l A c a d e m y o f S c i e n c e . U . S . A . 88: 1 6 4 1 - 1 6 4 5 , 1 9 9 1 . P A U L , C . A N D R O S E N B U S C H , J . P . : F o l d i n g patterns o f p o r i n a n d b a c t e r i o r h o d o p s i n .  EMBO  Journal 4:1593-1597, 1985. P A U L S E N , I.T., B R O W N , M . H . A N D S K U R R A Y , R . A . : P r o t o n - d e p e n d e n t m u l t i d r u g e f f l u x s y s t e m s . M i c r o b i o l o g i c a l R e v i e w s . 60: 5 7 5 - 6 0 8 , 1 9 9 6 . P A U L S E N , I.T., P A R K , J . H . , C H O I , P . S . , S A I E R , M . H . : A f a m i l y o f g r a m - n e g a t i v e b a c t e r i a l outer m e m b r a n e factors that f u n c t i o n i n t h e export o f p r o t e i n s , c a r b o h y d r a t e s , d r u g s a n d h e a v y m e t a l s f r o m g r a m - n e g a t i v e b a c t e r i a . F E M S M i c r o b i o l o g y L e t t e r s . 156:1-8, 1 9 9 7 . P H A D I S , S.H., W E S T B L O M ,  T . U . A N D N O R M A R K , N . : M o l e c u l a r c l o n i n g o f Helicobacter  pylori D N A : i m p o r t a n t d i f f e r e n c e s b e t w e e n mcrBC d e l e t i o n h o s t s t r a i n s . M o l e c u l a r M i c r o b i o l o g y . 10: 1 1 5 1 - 1 1 5 1 , 1 9 9 3 . P H A D N I S , S . H . , I L V E R , D., J A N Z O N , L., N O R M A R K ,  S. A N D W E S T B L O M , T . U . :  P a t h o l o g i c a l significance a n d m o l e c u l a r characterization o f the v a c u o l a t i n g t o x i n gene o f  Helicobacter pylori. I n f e c t i o n & I m m u n o l o g y . 62: 1 5 5 7 - 1 5 6 5 , 1 9 9 4 . R U B I N S T E I N , G . D U N K T N , K . , A N D H O W A R D , A . J . : T h e s u s c e p t i b i l i t y o f Helicobacter  pylori t o 1 2 a n t i m i c r o b i a l a g e n t s , o m e p r a z o l e a n d b i s m u t h s a l t s . J o u r n a l o f A n t i m i c r o b i a l C h e m o t h e r a p y . 34:409-413, 1 9 9 4 . Saier M H . Paulsen IT. S l i w i n s k i M K . P a o S S . Skurray R A . N i k a i d o H . : ORIGINS OF M U L T I D R U G  A N DDRUG-SPECIFIC  EVOLUTIONARY  EFFLUX PUMPS IN  B A C T E R I A . F A S E B J o u r n a l . 12:265-274, 1 9 9 8 S C H U L Z G E : Porins: general to specific, native to engineered passive pores.  Current Opinion i n  S t r u c t u r a l B i o l o g y . 6: 4 8 5 - 4 9 0 , 1 9 9 6 .  103  S H A F E R W M . Q U X D . W A R I N G A J . L E H R E R RI.: Modulation  Neisseria gonorrhoeae  s u s c e p t i b i l i t y to vertebrate antibacterial peptides d u e to a m e m b e r o f the r e s i s t a n c e / n o d u l a t i o n / d i v i s i o n efflux p u m p f a m i l y . P r o c e e d i n g s o f the N a t i o n a l A c a d e m y o f S c i e n c e s o f the U n i t e d States o f A m e r i c a 95:1829-1833, 1 9 9 8 S H E R B U R N E R. & T A Y L O R D. E.:  Helicobacter pylori e x p r e s s e s a c o m p l e x s u r f a c e  carbohydrate, L e w i s X . Infection & Immunity 63: 4564-4568, 1995. S L A U C H J M . A N D S I L H A V Y T J . : G e n e t i c a n a l y s i s o f the s w i t c h that c o n t r o l s p o r i n g e n e e x p r e s s i o n i n Escherichia  coli K - 1 2 . J o u r n a l o f M o l e c u l a r B i o l o g y 210:281-292, 1 9 8 9 .  S O R B E R G , M . , N I L S S O N , M . , H A N B E R G E R , H. A N D N I L S S O N , L.E.: conversion  Morphologic  oi Helicobacter pylori from b a c i l l a r y t o c o c c o i d f o r m . E u r o p e a n J o u r n a l o f  C l i n i c a l M i c r o b i o l o g y & I n f e c t i o u s D i s e a s e s 15: 2 1 6 - 2 1 9 , 1 9 9 6 . S R I K U M A R , R , K O N , T . , G O T O H , N . , A N D P O O L E , K . E x p r e s s i o n oi Pseudomonas  aeruginosa m u l t i d r u g e f f l u x p u m p s M e x A - M e x B - O p r M a n d M e x C - M e x D - O p r J i n a multidrug-sensitive E s c h e r i c h i a strain. A n t i m i c r o b i a l A g e n t s & Chemotherapy.  42:65-71,  1998. S T A S K A W I C Z , B . , D A H L B E C K , D., K E E N , N . A N D N A P O L I , C : M o l e c u l a r characterization o f c l o n e d avirulence genes f r o m race 0 and race 1 o f  Pseudomonas syringae p v . g l y c i n e a .  J o u r n a l . o f . B a c t e r i o l o g y . 169: 5 7 8 9 - 5 7 9 4 , 1 9 8 7 . S T U D I E R , F . W . A N D M O F F A T T , B . A . : U s e o f bacteriophage T 7 R N A p o l y m e r a s e to direct selective h i g h - l e v e l e x p r e s s i o n o f c l o n e d genes.  J o u r n a l o f M o l e c u l a r B i o l o g y 189: 1 1 3 -  130, 1986. S U M I T A Y : Transient carbapenem resistance induced b y salicylate i n  Pseudomonas aeruginosa  associated w i t h suppression o f outer m e m b r a n e protein D 2 synthesis. A n t i m i c r o b i a l A g e n t s & C h e m o t h e r a p y . 37: 2 7 4 3 - 2 7 4 6 , 1 9 9 3 . T H O M A S , J . E . , G I B S O N , J.R. A N D D A R B O E , M . K . : Isolation  oi Helicobacter pylori  from  f e c e s . L a n c e t 340: 1 1 9 4 - 1 1 9 5 , 1 9 9 2 . T H O M P S O N , J.D., H I G G I N S , D . G . A N D G I B S O N , T.J.: C L U S T A L W : Improving the sensitivity o f progressive multiple sequence alignment through sequence weighting, p o s i t i o n - s p e c i f i c g a p p e n a l t i e s a n d w e i g h t m a t r i x c h o i c e . N u c l e i c A c i d s R e s e a r c h 22: 4673-4680, 1994. T O M B , J.F., W H I T E , O., K E R L A V A G E , A.R., C L A Y T O N , R . A . , S U T T O N , G . G . , F L E I S C H M A N N , R.D., K E T C H U M , K . A . , K L E N K , H.P.,G I L L , S., D O U G H E R T Y , B.A., N E L S O N , K . , Q U A C K E N B U S H , J., Z H O U , L., K I R K N E S S , E.F., P E T E R S O N , S., L O F T U S , B . , R I C H A R D S O N ,  D., D O D S O N , R., K H A L A K , H . G . , G L O D E K , A . ,  M C K E N N E Y , K., F I T Z E G E R A L D , L.M., L E E , N., A D A M S , M.D. A N D V E N T E R , J . C . : T h e c o m p l e t e g e n o m e sequence o f the gastric p a t h o g e n  Helicobacter pylori. N a t u r e  388: 5 3 9 - 5 4 7 , 1 9 9 7 .  104  T S U D A , M., K A R I T A , M . , M O R S H E D , negative mutant o f  M . G . , O K I T A , K . A N D N A K A Z A W A , T.: A urease-  Helicobacter pylori  constructed by allelic exchange mutagenesis lacks  the a b i l i t y to c o l o n i z e the n u d e m o u s e s t o m a c h . I n f e c t i o n & I m m u n i t y 6 2 : 3 5 8 6 - 3 5 8 9 , 1994. V A N  D E R H U L S T R W , K E L L E R , J.J., R A U W S , E.A. A N D T Y T G A T , G . N . : Treatment o f  Helicobacter pylori  i n f e c t i o n : a r e v i e w o f the w o r l d literature. H e l i c o b a c t e r 1:6-19,  1996. V A N  G E L D E R P . , D E C O C K , H . A N D T A M M A S S E N J: A s s e m b l y o f o u t e r b a c t e r i a l m e m b r a n e proteins. I n M e m b r a n e P r o t e i n A s s e m b l y , ed. b y v o n H e i j n e G , pp. 6 3 - 8 2 , R . G. Landes Company, N e w York,  1997.  V O G E L , H . A N D J A H N I G , F.: M o d e l s for the structure o f o u t e r - m e m b r a n e proteins o f  Escherichia coli  d e r i v e d from r a m a n s p e c t r o s c o p y a n d p r e d i c t i o n m e t h o d s .  Molecular B i o l o g y 190:  191-199,  Journal o f  1986.  W E I S S , M . S . , E T A L . : T h e s t r u c t u r e o f p o r i n from R h o d o b a c t e r c a p s u l a t u s at 1.8  resolution.  F E B S Letters 2 8 0 : 3 7 9 - 3 8 2 , 1991. W O N G , R , J O S T , H , a n d H A N C O C K , R . E . L i n k e r - i n s e r t i o n m u t a g e n e s i s o f Pseudomonas  aeruginosa  outer m e m b r a n e protein O p r F . M o l e c u l a r M i c r o b i o l o g y .  10,  283-292.  1993.  W O R S T , D . J . , O T T O , B . R . A N D D E , G . J . : Iron-repressible outer m e m b r a n e proteins o f  Helicobacter pylori  i n v o l v e d i n heme uptake.  Infection & Immunity  63:  4161-4165,  1995. Y O N E Y A M A H : M e c h a n i s m o f e f f i c i e n t e l i m i n a t i o n o f p r o t e i n D2 i n o u t e r m e m b r a n e o f  i m i p e n e m - r e s i s t a n t Pseudomonas aeruginosa. A n t i m i c r o b i a l A g e n t s a n d C h e m o t h e r a p y . 37: 2 3 8 5 - 2 3 9 0 ,  1993.  105  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0089116/manifest

Comment

Related Items