Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Longitudinal follow-up of pediatric human immunodeficiency virus infection Baker, Jennie N. 1999

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata


831-ubc_1999-0465.pdf [ 8.82MB ]
JSON: 831-1.0089104.json
JSON-LD: 831-1.0089104-ld.json
RDF/XML (Pretty): 831-1.0089104-rdf.xml
RDF/JSON: 831-1.0089104-rdf.json
Turtle: 831-1.0089104-turtle.txt
N-Triples: 831-1.0089104-rdf-ntriples.txt
Original Record: 831-1.0089104-source.json
Full Text

Full Text

LONGITUDINAL FOLLOW-UP OF PEDIATRIC H U M A N IMMUNODEFICIENCY VIRUS INFECTION  BY J E N N I E N. B A K E R  B . S c , The University o f British Columbia in association with The Okanagan University College, 1996  A THESIS S U B M I T T E D IN P A R T I A L F U L F I L L M E N T OF T H E R E Q U I R E M E N T S FOR T H E D E G R E E OF M A S T E R OF S C I E N C E IN T H E F A C U L T Y OF G R A D U A T E STUDIES (Department of Experimental Medicine, Faculty of Medicine) We accept this thesis as conforming to the required standard  T H E U N I V E R S I T Y OF BRITISH C O L U M B I A October 1999  ©  Jennie N . Baker, 1999  In  presenting  degree freely  at  this  the  available  copying  of  department publication  of  in  partial  fulfilment  University  of  British  Columbia,  for  this or  thesis  reference  thesis by  this  for  his  and  scholarly  or  thesis  study.  for  her  I  of I  further  purposes  gain  shall  of  £ x P £ ^ i M g ^ T A L  T h e U n i v e r s i t y o f British Vancouver, Canada  Date  DE-6  (2/88)  QGfokmr  Columbia  9  1999  that  agree be  It  that  not  'tlEDiQ/is!£  the  be  for  Library  permission  granted  is  permission.  Department  requirements  agree  may  representatives.  financial  the  by  understood allowed  an  advanced  shall for  the that  without  make  it  extensive  head  of  my  copying  or  my  written  ABSTRACT  This longitudinal follow-up study was undertaken to document the clinical history of virologic parameters in HIV-infected children, including the evolution o f resistance to the antiretroviral agents zidovudine and lamivudine. The effect o f differing therapeutic regimens on these parameters was studied. N i n e pediatric patients from the Oak Tree Clinic in Vancouver were evaluated. Serial C D 4 cell counts, plasma viral loads and all combinations o f antiviral therapy were recorded from the time o f diagnosis.  Results showed that eight out o f nine patients  received either single or double drug combinations as initial therapy and the remaining patient was started on a triple combination therapy regimen.  A t last follow-up, the  median viral load was 2,415 copies/mL and the median C D 4 count was 765 cells/pX. The median change i n viral load from baseline was -53,180 copies/mL and C D 4 count was +54 cells/pX.  For the entire observation period, only four cases achieved  undetectable plasma viral loads.  O f these four, there is only one case o f durable  suppression, this being the only patient to start on a triple drug regimen. Sequencing showed that 7/9 patients carried isolates that were A Z T resistant. O f the two patients with susceptible isolates, one is on triple therapy and the other remains on dual therapy (including A Z T ) with a viral load o f 16,000 copies/mL. There were six cases o f 3 T C resistance, with three patients carrying susceptible isolates. O f these three, one is no longer on the drug and another is the maximally suppressed, receiving triple combination therapy as the initial regimen. Studies i n adults have shown that dual combination therapy is inadequate  in  suppressing viral replication and preventing the evolution o f drug resistance and disease progression.  It is during the  developmental stages o f childhood that adequate  antiretroviral therapy w i l l have its greatest impact in minimizing the neurodevelopmental effects o f H I V disease. maximal  virologic  Thus, triple combination regimens must be selected to achieve  containment  and  minimize  resistance.  ii  the  development  o f antiretroviral  T A B L E O F CONTENTS  ABSTRACT  ii  INDEX OF T A B L E S  v  INDEX OF FIGURES  vi  LIST OF ABBREVIATIONS  vii  ACKNOWLEDGEMENTS  vii  I  INTRODUCTION  1  1.1  EPIDEMIOLOGY OF PEDIATRIC H I V  1.2  TRENDS IN PEDIATRIC H I V INFECTION  1 2  1.3  T H E DIAGNOSIS OF H I V INFECTION  4  1.3. 1 Viral Culture 1.3.2 PCR  •  5 6  1.4  MARKERS OF DISEASE PROGRESSION  1.5  T H E PATHOGENESIS OF PEDIATRIC H I V INFECTION  12  1.6  H I V DISEASE PROGRESSION IN CHILDREN  16  1.7  T H E TIMING OF H I V TRANSMISSION  19  1.8  FACTORS AFFECTING THE TRANSMISSION OF H I V  20  1.8.1 1.8.2 /. 8.3 1.8.4 1.8.5 1.8.6 1.8.7 1.9  Maternal Antiretroviral Therapy Rupture of Membranes Maternal Viral Load Viral tropism and Cell Susceptibility Birth Canal Secretions Breast Feeding Caesarian Section  CLINICAL INTERVENTIONS  1.9.1 Nucleoside Reverse Transcriptase Inhibitors 1.9.2 Non-nucleoside Reverse Transcriptase Inhibitors 1.9.3 Protease Inhibitors 1.10 II  ANTIRETROVIRAL RESISTANCE  RESEARCH HYPOTHESIS II. 1  III  SPECIFIC OBJECTIVES MATERIALS AND METHODS  9  •  20 22 22 23 23 24 25 26  27 30 31 32 34 34 35  III. 1  PATIENT POPULATION  35  111.2  SPECIMEN COLLECTION  35  111.3  ISOLATION OF LYMPHOCYTES  36  111.4  PLASMA V I R A L L O A D - ROCHE AMPLICOR MONITOR™TEST  37  111.4.1 IH.4.2 III.4.3 HI.4.4  Specimen Preparation Preparation of Master Mix Reverse Transcription and PCR Amplification Detection  37 38 38 39  111.5  PLASMA V I R A L L O A D - N A S B A A S S A Y  111.6  V I R A L PHENOTYPE  41  111.7  V I R A L RESISTANCE TESTING  41  III. 8  V I R A L GENOMIC SEQUENCING  41  ///. 8.1 111.8.2 111.8.3 IH.8.4 III. 8.5  Plasma collection PCR Reaction Preparation Second Round PCR and Product Detection Product Detection Sequencing Reaction and PCR Product Precipitation  40  41 42 42 43 45  Ul.8.6 III.9  IV V  Gel Construction  CLINICAL P A T E N T D A T A  RESULTS  45 46  47  DISCUSSION  59  VI  CONCLUSION  64  VII  F U T U R E STUDIES  65  VIII  REFERENCES  66  APPENDIX I  PEDIATRIC COHORT R A W D A T A  75  A P P E N D I X II  A M I N O A C I D INFORMATION  76  A P P E N D I X III  H I V ANTIRETROVIRAL MUTATIONS  77  APPENDIX IV  PATIENT SEQUENCES  78  APPENDIX V  SEQUENCER PRINTOUTS  82  I N D E X O F T A B L E S  TABLE 1  DEMOGRAPHICS OF THE PEDIATRIC COHORT  35  TABLE 2  O N E L E T T E R A M I N O A C I D CODES  77  TABLE 3  T H R E E L E T T E R A M I N O A C I D CODES  77  v  I N D E X  FIGURE 1  O F  F I G U R E S  N U M B E R OF PERDMATALLY ACQUIRED A I D S CASES B Y QUARTER Y E A R OF DIAGNOSIS STATES, 1984  - M A R C H 1997  UNITED 3  FIGURE 2  ROCHE AMPLICOR HIV-1  FIGURE 3  T H E N A T U R A L H I S T O R Y O F H I V D I S E A S E IN A D U L T S  11  FIGURE 4  STRUCTURE OF THE H U M A N IMMUNODEFICIENCY VIRUS  13  FIGURE 5  T H E LIFE C Y C L E OF H I V  14  FIGURE 6  P R O T E I N A S E C L E A V A G E IN H I V M A T U R A T I O N  15  FIGURE 7  D R U G TARGETS FOR H I V ANTIRETROVIRAL THERAPY  27  FIGURE  8  MONITOR™ P C R ASSAY  T H E C H A N G E S IN P L A S M A V I R A L L O A D A N D  9  CD4*T C E L L  C O U N T FOR V - 0 0 1  47  FIGURE 9  T H E C H A N G E S IN P L A S M A V I R A L L O A D A N D C D 4 T C E L L C O U N T FOR V - 0 0 3  48  F I G U R E 10  T H E C H A N G E S IN P L A S M A V I R A L L O A D A N D C D 4 * T C E L L C O U N T F O R V - 0 0 4  49  FIGURE  11  +  T H E C H A N G E S IN P L A S M A V I R A L L O A D A N D  €04*7 C E L L C O U N T  FOR V - 0 0 8  50  F I G U R E 12  T H E C H A N G E S IN P L A S M A V I R A L L O A D A N D C D 4 T C E L L C O U N T F O R V - 0 0 9  52  F I G U R E 13  T H E C H A N G E S IN P L A S M A V I R A L L O A D A N D 0 0 4 " ^  C E L L COUNT FOR V - 0 1 0  53  F I G U R E 14  T H E C H A N G E S IN P L A S M A V I R A L L O A D A N D C D 4 T C E L L C O U N T F O R V - 0 1 1  54  F I G U R E 15  T H E C H A N G E S IN P L A S M A V I R A L L O A D A N D C D 4 * T C E L L C O U N T F O R V - 0 1 2  55  F I G U R E 16  T H E C H A N G E S IN P L A S M A V I R A L L O A D A N D C D 4 * T C E L L C O U N T F O R V - 0 1 3  56  +  +  vi  )  L I S T O F  A B B R E V I A T I O N S  3TC  Lamivudine  AIDS  Acquired Immune Deficiency Syndrome  cDNA  Complimentary D N A  d4T  Stavudine  ddC  Zalcitabine  ddl  Didanosine  dNTP  deoxy Nucleotide Tri-Phosphate  dUTP  deoxy Uracil Tri-Phosphate  HAART  Highly Active Antiretroviral Therapy  HIV  Human Immunodeficiency Virus  MAC  Mycobacterium A v i u m Complex  NNRTI  Non-Nucleoside Reverse Transcriptase Inhibitor  OD  Optical Density  PBMCs  Peripheral B l o o d Mononuclear Cells  PCP  Pneumocystis carinii Pneumonia  PCR  Polymerase Chain Reaction  PI  Protease Inhibitor  SI/NSI  Syncytium Inducing/Non-Syncytium Inducing  rTth pol  Thermus thermophilus D N A Polymerase  TMB  3,3', 5,5' -Tetramethylbenzidine  ZDV  Zidovudine  A C K N O W L E D G E M E N T S  I would first like to thank my supervisor, Dr. Brian Conway for his invaluable help and guidance with my studies. H i s direction and optimism has allowed me to see my project to fruition. I greatly appreciate all that you have taught me, both about science and the politics that come with it. M a n y thanks to Dr. Jack Forbes at the Oak Tree Clinic for allowing me to study his patients and a special thanks to Valencia Remple for having the time and patience to assist me i n my chart reviews. I gratefully acknowledge Dr. Richard Harrigan and his laboratory staff at the B C Centre for Excellence i n H I V / A I D S for helping me to generate my sequence data. I am especially indebted to Mark Whaley and Brian Wynhoven for providing me with the answers to my frequent questions. A big thank you to all the staff at Viridae Clinical Sciences. It would not have been possible to attain my goal without such a positive environment or such great people to work w i t h . I thank my parents for their support, encouragement and love, not just throughout this time in my life, but for all my endeavors. I also thank my friends, especially Nicole, for keeping me i n touch with reality. Finally, to B o b , a very special thanks to a very special person. Y o u have constantly been there to listen and to lean on and I can never thank y o u enough for what you have brought into my life.  viii  I  INTRODUCTION  1.1  EPIDEMIOLOGY OF PEDIATRIC H I V  Pediatric A I D S was first reported i n 1982 and by 1987 it had become the ninth 1  leading cause o f death for children between the ages o f 1 and 4 i n the United States. B y 1996, it had progressed to the seventh leading cause o f child mortality i n the same age group . Although children currently constitute only 2 % o f the recognized cases o f A I D S 2  in the U . S . , the incidence o f infection is increasing rapidly.  Indeed, i n the 1990's,  between 10,000 and 20,000 cases o f H I V infection i n children are anticipated . The vast 1  majority o f these cases w i l l have acquired H I V perinatally, most commonly from mothers who were infected as a consequence o f intravenous drug use or sexual contact with an I V drug-using partner.  Pediatric A I D S is a disease affecting children i n minority groups,  often i n cities where there is a high incidence o f I V drug use. A t the same time, children who are H I V infected can be found throughout North America and Europe. In many developing countries, children constitute nearly a quarter o f the cases o f A I D S . 3  Although the number o f adolescents with symptomatic A I D S is relatively small, the rapid increase i n A I D S in young adults means that many o f these individuals became infected as adolescents. In Canada, a total o f 15,935 A I D S cases have been reported, based on recent data. To the end o f 1997, there were 1,113 cases (7.2%) among women. O f these, 7 3 % were among women aged 15-44. There were 181 cases o f pediatric A I D S (among children 014 years o f age), 78% (143/181) o f which were attributed to perinatal transmission . The 4  pediatric population can further be broken down into 4 age categories.  l  There are 82  children < 1 year with A I D S .  There are 58 and 20 cases i n the 1-4 year and 5-9 year  categories, respectively and 21 children age 10-14 with A I D S .  The latest H I V  surveillance report states that a total o f 41,964 cases o f H I V had been reported i n Canada between November 1985 and June 1998 . O f these, 682 were pediatric cases (0-14 years 5  o f age), making up 1.6% o f the national total. Data show that pediatric infection was acquired by two major routes: transfusion o f blood and blood products (23.3%) and perinatal transmission (70%). The remaining 6.7% had either no identified risk factor or did not report the exposure category . 5  Because the major route o f transmission o f H I V to children is through perinatal exposure from an infected mother, the course o f the epidemic i n childbearing women greatly influences the epidemic in children. The incidence o f A I D S i n women and among those acquiring H I V through heterosexual exposure continues to increase despite a decline i n other populations . H I V prevalence studies i n pregnant women indicate an 6  average rate for Canada o f about 3-4/10,000 . 4  1.2  T R E N D S IN P E D I A T R I C H I V I N F E C T I O N  Despite this epidemic i n women, the number o f pediatric A I D S cases is declining. The number o f perinatally acquired cases increased rapidly in the 1980s and early 1990s, peaked i n 1992, and fell thereafter . This dramatic fall i n cases has been widespread 7  throughout North America. In the United States, the most dramatic fall i n the number o f cases diagnosed i n children younger than 5 years o f age, was a 5 1 % decrease between 1992 and 1996 . 7  2  Figure 1  Number o f perinatally acquired A I D S cases by quarter year o f diagnosis United States, 1984 - March 1997  250H  0-  1  1 iii| 1984  i ii | ii i |i ii| i i i | ii i | i  1986  1988  1990  i i | 11 i | i i i | i i i | i i i | i i i | 1992  1994  Year and Quarter of Diagnosis  i i i |i i  11  1996  * Estimates were based on cases reported through September 1997, adjusted for reporting delay and unreported risk but not for incomplete reporting of diagnosed AIDS cases. Points represent estimated quarterly incidence, and the line represents "smoothed" incidence.  (Source: Centers for Disease Control and Prevention. 1997;46(46):1089)  This  Update: Perinatally Acquired HIV/AIDS United States, 1997.  MMWR  is probably linked to several interventions that were developed and  implemented i n the early 1990s.  The most important intervention was the report that  zidovudine ( Z D V ) prophylaxis given to the mother during pregnancy and i n labor and to the newborn i n the first week o f life could reduce the risk o f perinatal transmission by as much as 66% . The Ministry o f Health recommendations for universal H I V counseling and testing o f all pregnant women and for Z D V prophylaxis for pregnant women infected  3  with H I V probably resulted in the dramatic decline i n perinatal cases seen after 1994 i n British Columbia. The leveling i n the number o f cases was probably caused by several other factors in addition to the administration o f Z D V prophylaxis.  These included  changes i n obstetrical management o f pregnant women infected with H I V to reduce maternal blood/secretion exposure to the infant through avoidance o f practices such as fetal scalp monitors and artificial rupture o f amniotic membranes ' . 9 10  Other interventions  that may be contributing to these trends include avoidance o f breast-feeding and declines in the number o f pregnant women infected with H I V giving birth. In addition, screening of blood and tissue donors and heat treatment o f clotting factor products has virtually stopped transmission through blood and blood products. Before 1990, pediatric deaths i n Canada totaled 36 . 5  In the early 1990s, there were approximately 10 deaths per year,  whereas 1997 and 1998 together, have a total o f only 3 deaths due to AIDS-defining illnesses. However, some level o f transmission to children persists. Some women infected with H I V , particularly those who are active drug abusers, do not receive prenatal care and cannot benefit from HIV-prevention services . 11  Even  women who obtain prenatal care may not be counseled and tested for H I V . Some infants may become infected despite adequate recommended therapy by their mothers.  Current  rates o f transmission among treated infants in carefully controlled trials range from 4 to 8% ' . A better understanding o f the mechanisms o f perinatal transmission and the role 8  12  and efficacy o f specific interventions are needed.  4  1.3  T H E D I A G N O S I S O F HIV  I N F E C T I O N  The pace o f investigation and development o f interventional strategies regarding H I V transmission and therapy has sharply increased. In addition, the availability o f new antiretroviral drugs has increased the probability o f long term survival i n children with H I V infection. These new developments have created an urgent need for rapid diagnosis o f infection as early i n life as possible and for accurate markers o f disease progression and response to therapy. Serologic approaches to diagnosis can still be used i n the adult population; however, diagnosis by means o f antibody detection has severe limitations i n the first 18 to 24 months o f life and has not proven useful . This is because o f the 13  effective trans-placental passage o f maternal antibodies, largely during the third trimester o f pregnancy.  Therefore, detection o f antibodies during the neonatal and early infancy  periods principally reflects maternal antibody status.  The mainstay o f laboratory  diagnosis i n infancy has focused on two viral detection assays: peripheral blood mononuclear cell co-culture (viral culture) and polymerase chain reaction.  1.3.1  V i r a l Culture The in vitro co-cultivation o f peripheral blood mononuclear cells ( P B M C s ) from a  person with a known or suspected infection with P B M C s from an uninfected donor to stimulate viral replication was one o f the first assays developed and used for H I V diagnosis i n infancy and is still the gold standard . Uninfected P B M C s isolated from 14  whole blood o f donors by density gradient centrifugation are first stimulated by incubation with phytohemagglutinin ( P H A ) - a priming step that activates the cells and creates optimum intracellular conditions for H I V replication. Equal number o f stimulated  5  donor and fresh patient cells are incubated together i n a tissue culture flask for up to 28 days. Aliquots o f the culture supernatant are harvested approximately twice per week and assayed for H I V (p24 antigen) production. T w o sequential aliquots with detectable p24 antigen levels confirm the presence o f replicating virions.  Quantitative cultures are  performed i n a microtiter format with serial five fold dilutions o f patient mononuclear cells incubated with donor cells for 14 days. This approach allows an estimate o f the number o f infected cells and is reported as "infectious units per million cells" ( I U P M ) .  1.3.2  PCR H I V P C R is a rapid viral diagnostic assay that can be performed within 24 hours  using <1 m L o f anticoagulated whole blood. The assay detects HIV-1 pro virus within circulating mononuclear cells after extensive enzymatic amplification o f target molecules within the sample. Small segments o f H I V D N A are actually targeted for amplification a targeting based on the use o f small D N A primer pairs that bind to complementary sequences within the H I V genome. Since P C R can theoretically amplify a single target molecule, care must be taken to prepare samples with a stringent technique to prevent cross contamination resulting i n false positive results. contamination is carry over from other reactions.  The most frequent source o f  The development o f quality control  procedures are necessary for the generation o f accurate data and this has proven achievable, resulting i n an assay that has become the mainstay o f early pediatric H I V diagnosis. In a large, multicenter cohort study, 483 infant samples were collected and a single P C R assay was performed. For newborn infants less than 2 months o f age, these tests exhibited a sensitivity o f 95% a specificity o f 9 7 % . 15  6  D N A P C R possesses an  additional feature i n that the virus does not have to be replication competent (infectious) for detection. This allows for sample processing with less urgency than that required for an assay such as culture, which is dependent on the preservation o f cell and virus viability. In comparisons o f H I V co-culture to H I V P C R in proficient and quality-assured laboratories, the techniques show similar sensitivity and specificity . 16  The assay used i n this project was the Roche Amplicor HIV-1 Monitor™ Test, version 1.5. The monitor test is based on 5 major processes: 1. Specimen preparation 2. Reverse transcription o f target R N A to generate c D N A 3. P C R amplification o f target c D N A using H I V specific complementary primers 4. Hybridization o f the amplified products to oligonucleotide probes specific to the target 5. Detection o f the probe-bound amplified products by colorimetric determination  H I V R N A is isolated from patient plasma specimens by lysis o f virus particles with a chaotropic agent followed by precipitation o f the R N A with alcohol. A known number o f Q S (internal standard) molecules are introduced into each specimen with the lysis reagent.  The Q S is carried through the specimen preparation, amplification and  detection steps and is used for the quantitation o f H I V R N A i n the test specimen. The Q S compensates for effects o f inhibition and variable amplification efficiency to permit accurate quantitation. The amplification product is 155 bases i n length (as defined by the primers) and is located i n a highly conserved region o f the H I V - 1 gag gene. The process uses the thermostable recombinant enzyme Thermus thermophilus D N A polymerase (rTth pol) which, i n the presence o f manganese and under the appropriate buffer conditions, has  7  both R T and D N A polymerase activity. This allows both the reverse transcription and P C R amplification to occur in the same reaction mixture. In the P C R assay, the reaction mixture is first heated to denature R N A : c D N A hybrids and, as the temperature is reduced, the primer pairs then anneal to target sequences. In the presence o f excess d N T P ' s , rTth pol extends the annealed, biotinylated primer forming a complementary strand.  Adenine binds d U T P so that all amplified  products are biochemically distinct from native D N A target molecules. Cycling continues to generate multiple amplicons o f the target H I V and Q S sequences.  Following  amplification, the amplicons are denatured to form single stranded D N A and these are then added to plates coated with specific H I V and Q S oligonucleotide probes.  The  amplicons specific to the well hybridize to the probe and any unbound material is removed.  Since the amplicons are biotin labeled, a conjugate (avidin horseradish  peroxidase) is added that is capable o f binding to biotin. Following this step, a substrate is added (hydrogen peroxide and T M B ) in order to give colour to the solution. In the presence o f hydrogen peroxide, the bound horseradish peroxidase is able to catalyze the oxidation o f T M B to form colour (Figure 2). The plate is then read at an absorbance o f 450 nm and the number o f copies o f H I V R N A per m L o f plasma can be calculated from the optical density ( O D ) readings and the following formula: Total HIV-1 O D  x  Input QS copies per P C R reaction  Total Q S O D  8  x  40  Figure 2  Roche A m p l i c o r HIV-1 Monitor™ P C R Assay  Wash, Add Avidin-HRP Conjugate Wash, add substrate —  Oxldlzod-TMB  •  Add Stop Solution, Read absorbance  (Source: Amplicor fflV-1 Monitor™ Test, version 1.5 Kit Insert. Roche Diagnostics, Hoffmann-La Roche Ltd., 1998)  1.4  MARKERS OF DISEASE PROGRESSION Quantitation o f HIV RNA within the plasma compartment has become the most  important virologic assay for prediction o f the natural history o f disease and response to therapeutic intervention. Studies were initially reported i n large cohorts o f adults infected with HIV and have been followed by similar analyses i n infants and children . The first 17  9  evaluations o f plasma samples from infants infected with H I V revealed unique insights into viral replication in this population. H i g h levels o f plasma virus were detected early in infection, ranging from 10 to 10 copies o f viral R N A / m L , consistent with levels 5  7  reported for acute infection i n adults . The unique feature, with persistence o f elevated 18  RNA  levels throughout infancy with only gradual reduction, may well reflect an  immature immune system incapable o f controlling viral replication.  Several different  studies show that although absolute R N A levels differ, high peak levels are present i n the first few months o f life followed by a gradual decline until a plateau from 50,000 to 1 0 9(1 9 1  100,000 copies/mL is reached by approximately 5 years o f age ' ' . This is similar to the reported steady state i n adults, although occurring much more slowly.  Recently,  99 93  studies by H o and Perelson '  have provided new insight into the virion life cycle,  revealing high viral replication rates even during clinical latency. However, it is still not known whether viral and host cell dynamics w i l l be similar i n children, especially i n infancy, during the early phases o f infection. Many studies to address these issues are currently underway. In adult populations, viral  load measurements are  independent predictors o f disease progression " . 24  26  one  o f the  strongest,  Studies i n infants and children have  also documented a strong, independent predictive value o f plasma R N A levels for disease 91  .  .  .  progression. In a study by Shearer et al. , in the first two months o f life, infants with rapidly progressive disease had median plasma R N A levels o f 724,000 copies/mL compared with 219,000 for infants with a stable clinical course.  In addition to viral  factors, immunologic variables can also serve as important predictors (Figure 3).  The Natural History o f H I V Disease in Adults  Figure 3  Seroconversion :tion , w Asymptomatic Symptomat  Death  c  HIV-RNA capes per ml plasma  (Source: Nova Online - Surviving AIDS [])  The C D 4 cell count has also proven to be a significant independent predictor o f disease progression. Absolute C D 4 cell counts for healthy infants in the first year o f life are many fold higher than those for older children and adults, progressively decreasing until adult levels are reached by approximately 6 years o f age. The C D C classification o f pediatric H I V infection considers the immune system relatively intact when the C D 4 count is higher than 1500 cells/mm for the first year o f life, higher than 750 cells/mm for the 3  3  second year o f life and higher than 500 subsequently.  Levels lower than 750, 500, and  200 cells/mm for the respective age groups reflect severe immune depletion . In a study 3  27  by Bamji et a l . , infants whose C D 4 cell counts were <1500 cells/mm at 3 to 6 months o f 28  3  age were 16 times more likely to die within the observation period compared to those whose counts were higher than this threshold.  A t 1 year o f age, each 100 cell or 1%  increase in C D 4 count was associated with a 10 to 19% decrease in mortality. From these studies, it is evident that C D 4 cell count and plasma R N A are important predictors o f H I V disease progression. However, the prognostic value o f these measures is enhanced when  ll  when they are used together. A n important study i n adults showed that two year disease progression-free survival rates from 89 to 98% were observed i n the "best" quadrant for each age group - those with the highest C D 4 count and lowest plasma R N A . The contrasting higher risk quadrants demonstrated 2-year progression free survival rates ranging from 34 to 5 7 % . 19  1.5  T H E PATHOGENESIS OF PEDIATRIC H I V INFECTION  The human immunodeficiency virus, type 1 (HIV-1) is a member o f the lentivirus genus o f the Retroviridae family, which includes such viruses as feline immunodeficiency virus and equine infectious anemia virus.  The mature H I V virion is spherical,  approximately 110 nm i n diameter, and is composed o f a cylindrical core surrounded by a lipid bilayer envelope.  The virion core consists o f a structural shell composed o f a  protein (p24) processed from the gag precursor polypeptide (Figure 4).  12  Figure 4  Structure o f the Human Immunodeficiency Virus  lipid bilayer  SU(gp120) TM(gp41)  NC (nucleocapsid protein p9)  tRNA primer  RT (reverse transcriptase)  CA (capsid protein 24)  viral RNA  PR (proteinase)  P  INT(integrase)  MA (matrix p17)  MCH class I surface protein  MCH class II surface protein  (Source: The Big Picture Book of Viruses [^lrnsander/Big_Virology/BVHomePage.html])  Within this shell are two copies o f single-stranded R N A , two t R N A  l y s  primers o f  host cell origin (one bound to each o f the 5' ends o f the viral R N A ) , and multiple copies o f each o f the virally encoded reverse transcriptase, integrase and R N A s e H enzymes . 29  To understand the pathogenesis o f H I V , we must first understand the unique features o f the virus that make it such a formidable pathogen. H I V employs at least four biological tricks that make it successful. First, the viral proteins o f H I V , most notably g p l 2 0 , potently interact with the molecules o f the immune system, upsetting the molecular language o f the immune network . 30  Second, the virus is able to produce numerous  variants, which allow it to adapt to many different biologic situations and evade the immunologic defenses established to protect against viral infection. T h i r d , the virus can integrate in cells and lead a long life in latency.  13  F o u r t h , as C D 4 cell destruction  continues, the host is left not only depleted o f critical cells for immune function, but also o f critical lymphokines that these cells generate to support the entire immune system . 31  Figure 5  The Life Cycle o f fflV  (Source: The Immunodeficiency Clinic: University Health Network [])  In the life cycle o f H I V (Figure 5), the outer envelope protein, g p l 2 0 , uniquely reacts with the C D 4 protein, the principal receptor on the T-helper cell and also on cells o f the monocyte and macrophage lineage. The ability o f g p l 2 0 to bind to C D 4 allows the virus to "dock" on the surface o f the T cell ( l a ) .  After viral attachment, g p l 2 0 further  interacts with the T cell membrane by using the gp41 protein and other sequences o f the envelope protein, resulting in fusion o f the viral envelope with the cellular membrane ( l b ) . This then allows viral R N A entry into the cell without destroying the cellular integrity (2). Cells expressing the C D 4 molecule, once infected, have the potential to enter back into the circulation where infection can readily spread throughout  14  the host . j0  Immediately  following entry, partial uncoating o f the viral core occurs to expose the viral R N A (3) and once in the cytoplasm o f the cell, H I V reverse transcriptase transcribes viral R N A into a complementary D N A ( c D N A ) copy (4).  The viral c D N A is then integrated into the host  cell genome by the viral integrase (5).  The integrated c D N A copy o f the viral R N A  genome is known as the provirus.  T cell activation o f the infected cell results in  transcription o f viral genes into genomic R N A and messenger R N A (6), translated into viral proteins at high levels (7a).  which are  A s a final step, the viral proteins are  cleaved by H I V protease enzyme into new enzymatic and structural H I V proteins (7b), assembled (8) and released by budding to produce a new generation o f infectious virions (9). In order for the virions to be infectious, during or after the budding process, the p i 6 0 viral proteinase becomes active.  This results in p i 6 0 and p56 cleavage to produce  subunits required for a mature virion (10).  Figure 6  The specific clevage steps are shown below.  Proteinase Cleavage in H I V Maturation  Effects o f Proteinase Cleavage: cellular  (Source: The Immunodeficiency Clinic: University Health Network [])  Recently, an important new area o f research has emerged in the field o f H I V involving chemokines and their receptors.  15  Chemokine molecules recognize and bind a  large number o f cellular transmembrane receptors and are involved i n inflammation and cell signaling.  In 1996, it was discovered that the H I V virus required a co-receptor  molecule for binding with C D 4 to facilitate uptake o f the virus into the T c e l l . 31  This  molecule was identified as the chemokine receptor, C X C R - 4 and another receptor, C C R 5, was found to interact specifically with H I V viral isolates infecting monocytes and macrophages  ' . A 32 base pair deletion i n the gene coding for C C R - 5 , when present on  both alleles, was shown to inactivate the co-receptor and render the cell less susceptible to infection by H I V . 3 4  Studies to investigate the effects o f the homozygous deletion on  mother to infant transmission are currently underway. Studies in adults have shown that i f the deletion is present on only one allele, disease progression is slower. Indeed, the mutation is present i n 28% o f the long term survivor population . Research has yet to 35  focus on the effects o f this mutation i n the pediatric population.  1.6  H I V D I S E A S E P R O G R E S S I O N IN C H I L D R E N  Disease manifestations, the tempo o f disease progression, and survival after vertical H I V infection can be variable i n the pediatric population. In general, at least two patterns o f survival were described i n children who were vertically infected before the widespread use o f potent antiretroviral therapies ' . A high (99%) probability o f death by 4 years was observed i n 11 to 16% o f children infected with H I V , with a median age at death o f 5 to 11 months. A high (88%) probability o f survival past 4 years was observed in 84 to 89% o f children who were vertically infected, with a median age at death o f older TO  than 60 months  . In this bimodal pattern o f disease expression, the "fast" progressors  exhibit profound immune deficiency and opportunistic infections i n the first few months 16  o f life, together with severe encephalopathy. The remaining "slow" progressors gradually develop an immune deficiency during a period o f several years and show a pattern o f morbidity and mortality similar to that observed i n adults.  In the absence o f potent  antiretroviral therapy most children who are vertically infected develop HIV-related symptoms o f C D 4 cell depletion early i n life. In a prospectively evaluated cohort o f 200 infants who were vertically infected, the median age o f onset o f any H I V related sign or symptom was 5.2 months; the probability o f remaining asymptomatic was 19% at 12 months and 6.1% at 5 years . In a large prospective cohort study by N e w e l l et al., 39  approximately 2 3 % and 40% o f infants who were perinatally infected developed an AIDS-defining condition by 1 and 4 years o f age, respectively . 40  The outcome o f H I V i n children is profound immunosuppression, rendering the host susceptible to the development o f opportunistic infections and neoplasms. The virus exerts other direct and indirect effects on the host that may be particularly dramatic i n infants and children because o f the ongoing development o f different organ systems such as the central nervous system . 41  Following transmission o f H I V , rapid and widespread  dissemination o f the virus occurs. This process is characterized by a dramatic increase i n viral burden during the weeks after transmission.  A n associated decrease i n C D 4 cell  count occurs, which may be a consequence o f H I V induced cell killing, the redistribution o f circulating C D 4 lymphocytes to lymphoid tissues, or both.  This increase i n viral  burden begins to slow with the development o f a cellular immune response to infection, suggesting that it is the initial primary means o f controlling viral replication. In addition, humoral immunity may contribute to the clearance o f H I V from the circulation. Antibodies generally develop within 6 to 12 weeks, at which time H I V infection can be  17  readily diagnosed  by conventional testing, i f the presence o f persistent  antibodies can be ruled out.  maternal  A s an immune response becomes established, the C D 4  lymphocyte count rebounds but seldom returns to the pre-infection level. H I V infection i n children can result i n a number o f serious infections due to a compromised immune system.  Invasive bacterial infections including bacteremia and  meningitis with encapsulated pathogens such as S. pneumonaie, Haemophilus  influenza  b,  and Neisseria meningitis are known to occur most commonly i n infants i n the first years o f life.  N o r m a l infants are susceptible to these pathogens although most  encountering  these bacteria  do not have invasive infections .  infants  Non-tuberculous  42  mycobacterial infections have also emerged as an important cause o f morbidity i n children with H I V infection.  Disseminated mycobacterium avium complex ( M A C )  infection is one o f the most common opportunistic conditions, reported as the initial AIDS-defining condition i n approximately 5% o f children with A I D S . 4 3  Pneumocystis  carinii pneumonia (PCP) is the most common serious opportunistic infection i n children with H I V infection. The incidence o f P C P among infants with perinatally acquired H I V infection during the first year o f life has been estimated at 12% i n Europe and 13% to 25% i n the United States . 44  The clinical manifestations o f P C P usually include life  threatening hypoxemia and respiratory distress.  Preventing this infection relies on early  recognition o f perinatal H I V exposure, early initiation o f chemoprophylaxis i n infancy, and immunologic monitoring to determine continued need for prophylaxis at older ages. Central nervous system ( C N S ) abnormalities were recognized soon after the initial descriptions o f pediatric A I D S , as a frequent manifestation o f H I V infection i n children. In the first decade o f pediatric A I D S , it was estimated that as many as 50 to 90% o f  18  infected children developed HlV-related encephalopathy.  However, recent evaluations  are much more optimistic due to earlier diagnosis o f H I V infection and interventions with antiretroviral therapy. The prevalence and severity o f C N S disease is variable and related to the stage o f H I V disease, age at first symptoms, rate o f disease progression and the current age o f the c h i l d . Optimal systemic antiretroviral therapy for H I V disease, based 45  on virologic or immunologic markers may not necessarily be optimal therapy for C N S disease. Drugs that do not enter the C N S in sufficient concentration are unlikely to be effective against H I V associated encephalopathy.  These issues have become more  important now that protease inhibitors, which may have only limited penetration into the C N S have become widely accepted as a critical part o f therapy. antiretroviral therapy ( H A A R T ) , which includes protease and reverse  Highly active transcriptase  inhibitors may significantly prolong the lives o f children with H I V . It w i l l be critically important to study the long-term effects o f such therapies that may leave the C N S relatively unprotected . 46  1.7  T H E TIMING OF H I V TRANSMISSION  A n accurate understanding o f the timing o f H I V transmission from mother to fetus is very important for the design o f intervention strategies. Direct evidence for the timing o f vertical transmission o f H I V (in utero, intrapartum or v i a breast feeding) is difficult to obtain.  T w o approaches have been used to assess the timing o f infection: (1) the  determination o f antibody production to viral proteins by the child itself; and (2) detection o f H I V by P C R or virus isolation from the child's blood. A s evidence for infection late i n pregnancy, D e Rossia et al used the timing and pattern o f seroconversion to specific H I V  19  peptides i n children at 4 to 6 weeks o f age .  Comparison o f the antibody pattern  determined by Western blot i n the mother's serum obtained during gestation and at delivery with that o f the newborn baby suggested that at least 65% o f children were infected during the final 6 weeks o f pregnancy and at delivery . Researchers have 48  hypothesized that the detection o f virus by P C R within 48 hours o f age indicates that the infection o f the child took place during gestation whereas delayed ability to detect the virus implies intrapartum transmission. This model does not exclude the possibility that the virus resides i n tissues other than blood, and may become activated at birth. Based on this, 50% or more o f the transmission events probably occur close to delivery. However, these figures apply to live births. If early transmission events lead to the loss o f the fetus, the actual frequency o f in utero transmissions may be higher.  Indirect evidence that  infection can occur during the intrapartum period comes from studies o f twins born to H I V infected women. Results have shown that there is a higher risk o f infection for the first born twin, suggesting that extensive mucocutaneous exposure to maternal blood and vaginal secretions may result i n infection . 49  1.8  FACTORS AFFECTING T H E TRANSMISSION OF H I V  There are a number o f factors that affect the transmission o f H I V from mother to child during pregnancy:  1.8.1  Maternal Antiretroviral Therapy Perinatal antiretroviral therapy protocols have been developed i n an effort to  reduce maternal blood or vaginal H I V load.  20  Zidovudine ( Z D V ) was the  first  antiretroviral to be given to infected pregnant women and their infants to evaluate its effects on vertical transmission (Pediatric A I D S Clinical Trial Group [ A C T G ] 076). Maternal participants were limited to nucleoside-naive women with peripheral blood absolute C D 4 counts greater than 200/mm  who were identified before 34 weeks o f  pregnancy. Z D V or placebo was administered orally antenatally and intravenously during delivery to women and 6 weeks postnatally to their infants. The analysis o f data from this study demonstrated a profound and significant reduction from 25.5% to 8.3% (a reduction o f 67%) i n the vertical transmission o f H I V i n mother-infant pairs treated with Z D V Q  compared with those who received placebo . From these results, it is now recommended that all pregnant women be offered H I V counseling and testing and have access to treatment. More recent studies in the field o f vertical H I V transmission are focusing on the use o f potent combination therapies to treat infected pregnant women and decrease the incidence o f transmission to the infant.  Nevirapine has been evaluated i n phase I/II  studies i n this area o f research and results have shown that it can be safely administered to women i n labor and to the newborn i n the first week o f life.  A study o f infected  women i n Uganda showed that nevirapine was well tolerated and detectable plasma H I V R N A was observed in only 19% o f infants at 6 months o f age . 50  The decrease i n  transmission would have been greater had this population not relied on breastfeeding as the source o f infant nutrition.  A phase III trial is currently underway to determine i f  nevirapine given to the mother during labor and to the neonate at age 48-72 hours can reduce mother to infant H I V transmission.  Women i n the 28  week o f gestation are  randomized to receive either N V P or placebo in addition to the antiretrovirals (excluding 21  N N R T I s ) that they are currently taking. Results so far indicate that 7 1 % o f women were given combination therapy,  whereas  upon enrollment, only 20% were receiving  combination therapy with a protease inhibitor, the standard o f care i n non-pregnant adults . 51  A n additional study involving the use o f N V P i n combination with Z D V and a second nucleoside analog during pregnancy found that 7 out o f 8 newborns had negative H I V D N A P C R results. The final 8 result was undetermined at the time. The regimen th  was well tolerated in pregnancy, led to a sustained undetectable viral load i n 82% o f the cases and resulted i n a low rate o f vertical transmission . 52  1.8.2  Rupture o f Membranes A study i n the N e w England Journal o f Medicine (1996) has shown that H I V -  infected mothers who give birth more that 4 hours after the rupture o f membranes are almost twice as likely to transmit the virus to their newborn babies than are mothers who deliver earlier (25% vs. 14%) . 53  1.8.3  Maternal V i r a l Load In a 1996 study, researchers found that maternal H I V R N A levels were highly  predictive o f perinatal transmission risk and suggested that certain threshold levels o f viral load late in gestation and/or during labor and delivery were associated with the risk o f transmission. It was found that transmitting mothers were more likely to have R N A levels higher than 50,000 copies/ml at delivery than non-transmitting mothers, whereas none o f the women with levels below 20,000 copies/ml transmitted the virus to the  22  fetus  . However, it should be stated that no maternal viral load, however low, has been  shown to provide absolute protection against transmission o f H I V to the fetus.  1.8.4  V i r a l tropism and C e l l Susceptibility A study published in 1995 showed that all viral isolates from transmitting mothers  but only 50% o f those from non-transmitting mothers could infect and replicate i n monocyte-derived macrophages. A l l mothers with monocyte-macrophage tropic isolates transmitted only those variants to their children . Studies have also shown that some 55  uninfected  children were resistant  to H I V infection and/or  replication by their  corresponding mother's major viral isolate i n the circulation, but not by other viruses. This strongly suggests that infection is transmitted by specific types o f isolates and not others.  Thus, mothers not carrying these isolates would be less likely to transmit  infection during pregnancy.  1.8.5  Birth Canal Secretions Data from the International Registry o f H I V Exposed Twins indicate that  exposure to H I V during, or just preceding labor and delivery, might have a role i n H I V transmission. Studies have shown that first-born infants have a least a two-fold risk o f infection i n comparison with second-born infants . 56  However, there are other factors  such as ascending infection prior to delivery and prolonged membrane rupture that may affect the risk o f transmission. Thus, birth canal exposure may not be a major contributor to infection risk.  23  1.8.6  Breast Feeding A m o n g women with chronic H I V infection (i.e. those seropositive at delivery),  breast feeding may double the rate o f mother to child transmission o f H I V .  In a meta-  analysis o f data from 10 published studies, the estimated risk o f transmission through breast m i l k was 29% for postnatally infected women and 14% for those already infected en  at delivery . A s a result, guidelines recommend that women infected with or at risk o f infection with H I V abstain from breast-feeding. However, this only applies to developed nations where local sanitary conditions and access to infant formulas are  good.  Developing nations still encourage breast feeding since factors i n breast m i l k plays an important role i n growth and development and the benefits o f breast feeding far outweigh any potential risk o f H I V transmission. It has been suggested that several substances i n breast m i l k may be protective against transmission o f H I V , including maternal anti-HIV antibodies, vitamin A , CO  lactoferrin, and secretory leukocyte protease inhibitor . However, studies have shown that i n developing countries, exclusive breastfeeding by HIV-infected women does not appear to protect the infant against common childhood illnesses and failure to thrive, nor does it significantly delay progression to A I D S . 5 9  In a cohort i n South Africa, relative  risks o f breastfeeding and the transmission o f H I V versus the development o f bacterial infections and death were calculated. Mother and infant pairs were broken up into three groups: those exclusively breast-fed, those who had mixed feedings and those fed on formula alone.  The relative risk between the exclusive breast and formula only group  was calculated to be 7.39 and there was a stepwise increase i n the transmission rate with the duration o f exclusive breastfeeding o f 1, 2 and 3 months. Mortality was highest i n the 24  exclusive breast fed group (19%) and episodes o f diarrhea and pneumonia were not significantly different between any o f the groups . 59  1.8.7  Caesarian Section There are several obstetrical issues surrounding delivery o f infants to H I V positive  mothers that may affect the vertical transmission o f H I V .  For example, the use o f fetal-  scalp monitors has been eliminated and amniocentesis is no longer performed.  Several  studies have been undertaken to determine whether a caesarian section could reduce the rate o f H I V transmission since it eliminates the prolonged exposure to blood and body fluids present i n the birth canal during a vaginal delivery. In one study researchers found that there were no significant differences between cesarean  deliveries undertaken  undertaken with membranes  following  prior rupture  o f membranes  and those  intact, but numbers for this comparison were  small.  However, singleton caesarian deliveries without concurrent obstetric complications had lower rates o f transmission than did vaginal deliveries (OR, 0.20; 95% C I , 0.04-0.94) . 60  A similar trial focusing on prenatal care and birth outcomes found that the most efficient method for the prevention o f vertical transmission o f H I V was treatment according to the A C T G 076 protocol and caesarian section . Despite these findings, it is unclear due to a 61  number o f confounding variables whether a caesarian section w i l l i n fact reduce the risk of vertical transmission.  W i t h further research, more appropriate guidelines can be  developed and implemented regarding this issue.  1.9  CLINICAL INTERVENTIONS  Over the last 15 years, enormous progress has been made in the treatment and understanding o f H I V infection and A I D S . However, a cure remains elusive, despite the introduction o f H A A R T , which combines a protease inhibitor or a non-nucleoside reverse transcriptase inhibitor with two reverse transcriptase inhibitors. therapeutic  The study o f new  agents is important in children, and especially neonates,  maturational changes that take place during infancy. pharmakokinetic and safety  because  of  In the case o f H I V infection,  studies are also important during gestation and  the  intrapartum period. Efforts have been directed at developing new agents that impact on different stages o f the life cycle o f H I V (Figure 1).  Figure 7  Drug Targets for H I V Antiretroviral therapy  k-*N»  v*"-**  v  CD4 Receptor  HHIVProviral DNA Reverse Transcriptase  V  lntegrase TAT Antagonists  Protease  It has become clear that combination therapy is more likely to provide long-term suppression o f viral replication as compared with monotherapy.  M u c h o f the information  in pediatric treatment has come from the use o f dideoxynucleosides:  26  zidovudine, didanosine, zalcitabine, lamivudine and stavudine.  They are pro-drugs and  have to be converted intracellularly to their active 5'-triphosphate form.  1.9.1  Nucleoside Reverse Transcriptase Inhibitors  Zidovudine Zidovudine (2',3'-azidothymidine [ Z D V , A Z T , Retrovir]) was the first effective  antiviral agent available for the treatment o f H I V . The antiviral activity o f Z D V depends on its intracellular conversion to a triphosphate metabolite by cellular enzymes.  This  active form inhibits H I V reverse transcriptase by competing for utilization with natural substrate and by incorporation into viral D N A , causing termination o f D N A chain elongation . 62  Several beneficial clinical effects o f Z D V therapy i n children have been  identified, including weight gain and improvement in HIV-associated encephalopathy 6 5  . The duration o f clinical, immunologic, and virologic benefit in children treated with  Z D V alone is variable, ranging from only a few months to years. The loss o f beneficial effects o f therapy and H I V disease progression is attributable in some cases to emergence o f viral resistance to Z D V . 6 6  Until 1995, Z D V monotherapy was recommended for the  initial management o f children with HIV-associated symptoms or immunosuppression. Current recommendations  include the use o f a protease inhibitor and two reverse  transcriptase inhibitors along with a third drug. Z D V is effective when combined with ddl or 3 T C , however, it is antagonistic when paired with d4T since it inhibits the intracellular phosphorylation o f this drug .  27  Didanosine Didanosine (ddl, Videx) was approved for use in the treatment of symptomatic CQ  HIV infection in children in 1991 as monotherapy and in combination with other agents . It is generally well tolerated and does not appear to be toxic to the bone marrow. However, a reversible pancreatitis develops in approximately 7% of children . Several 69  studies have had differing results. ACTG 152, a randomized study of ddl, ZDV, and ddl/ZDV combination therapy found that the ddl monotherapy and combination arms 7ft  were equally effective, but ddl alone was less toxic . However, ACTG 300, a trial comparing ddl in children with symptomatic HIV disease was terminated early due to the results of an interim analysis. The risk of disease progression was reduced by 70% and the risk of death by 80% for those receiving combination therapy compared to those receiving ddl alone. At present, ddl is used as one of the cornerstones of combination therapy in children.  Lamivudine Lamivudine (3TC) was approved as combination therapy with ZDV for both  adults and children in 1995.  In a study of children receiving 3TC monotherapy, subjects  reported an increase in both appetite and energy level.  CD4 cell counts remained  relatively stable and serum p24 antigen levels and plasma HIV RNA levels decreased 11  significantly both in treatment naive and experienced patients . A large number of studies have shown 3TC to be most effective in combination with other antiretrovirals. In a pilot study of ZDV-3TC combination therapy in treatment naive children, plasma HIV RNA levels fell below the limit of detection in 6 of 13 patients . In the first six months 72  28  of treatment, there was a mean reduction of viral load from 4.56 logio to 3.64 login copies/mL. In a more recent pediatric study, when 3TC or placebo was added to current nucleoside analogue therapy, the 3TC arm demonstrated an increase in CD4 cell count and a reduction in plasma viral load. However, changes in viral load were greater when the regimen included ZDV . This dual of AZT/3TC has shown to be effective in suppressing HIV-l replication for prolonged periods of time even in the presence of high level 3TC resistance. This is attributable to the fact that the Ml84V mutation that confers 3TC-resistance, suppresses AZT resistance, leading to prolonged activity due to the AZT component of the combination regimen. In addition, the 184V mutation leads to a 7-fold increase in fidelity of the reverse transcriptase enzyme which could potentially lead to decreased generation of viral quasispecies and inability of the virus to escape both drug and immune pressure. A study by Nijhuis and colleagues found that 3TC resistance could prolong drug susceptibility to AZT by requiring the development of additional resistance mutations, resulting in a more durable antiviral effect . 74  Zalcitabine Zalcitabine (2',3'-dideoxycytidine [ddC]) has ten fold more potent antiviral  activity in vitro than ddl and is well tolerated in children . Results of its use in 75  combination therapy in vivo have been somewhat disappointing and its use in clinical practice is fairly limited at present.  29  1.9.2  Non-nucleoside Reverse Transcriptase Inhibitors Non-nucleoside reverse transcriptase inhibitors ( N N R T F s ) achieve a highly  selective suppression o f H I V replication i n cell cultures and have little cytotoxicity . 76  They do not require phosphorylation for intracellular activation. Point mutations confer high-grade resistance, an issue that is problematic i n clinical practice . In vitro, these 77  agents are highly synergistic with nucleoside analogues, thereby expanding our choices for combination therapy.  Nevirapine Nevirapine is an effective antiretroviral agent for children infected with H I V when  used i n combination with other drugs.  In a study involving infants with maternally  acquired H I V , a combination o f zidovudine, didanosine and nevirapine was well tolerated and had sustained efficacy against H I V .  Within four weeks, there were reductions i n  plasma levels o f H I V R N A o f at least 96% i n seven o f the eight study patients receiving no  this combination .  In a second study, the same combination was used i n pediatric  subjects with advanced H I V disease. The maximal viral load reduction was seen at 4 70  weeks and mortality was significantly less than predicted . These same three drugs have also been found to reduce cerebrospinal fluid viral load i n patients with the same advanced state o f disease . 80  Delavirdine  Delavirdine is a B H A P (bis(heteroaryl)piperasine) compound with i n vitro activity comparable to nevirapine.  It has been reported that the development o f high level  30  resistance to delavirdine in vitro may sensitize isolates resistant to nevirapine, a finding that may prove useful in clinical practice. This phenomenon can be primarily attributed to a proline-to-leucine substitution at amino acid 236 (P236L) of HIV-1 RT which results in alterations in the shape of the binding pocket of the drug . 81  1.9.3  Protease Inhibitors Protease inhibitors (Pi's) are active during a late step of viral replication and act  by preventing the maturation of infectious virions. The protease enzyme functions to cleave the viral gag precursor into the four structural proteins of the virion core and to cleave the pi60 gag-pol precursor. There are three protease inhibitors that are most commonly used in pediatric patients: saquinivir, ritonavir and indinavir. In a heavily pretreated cohort of HIV infected children, PI therapy was associated with substantial short-term virologic and immunologic improvement with 25% of patients maintaining a viral load of <400 copies/ml after 6 months of therapy . Many treatment regimens for children include two nucleoside analogues and a protease inhibitor. A number of studies have shown that the addition of a PI, such as ritonavir or saquinivir can be well tolerated and provide significant clinical and immunological improvements in children with advanced infection . In one such study, a triple regimen of ritonavir, 3TC and ZDV or d4T resulted in both a significant decrease in mean viral load, some to undetectable levels OA  (<400 copies/mL) and a significant increase in CD4 cell counts .  31  1.10  ANTIRETROVIRAL RESISTANCE  The development o f resistance to antiretroviral drugs, such as Z D V is an important cause o f treatment failure and limits options for alternative regimens . Based 12  on the understanding o f viral dynamics and the high rate o f viral replication, a single point mutation at each base o f the genome may occur up to 10  5  times per day.  Antiretroviral therapy exerts selection pressure on the virus, resulting i n the emergence o f resistant strains. Once a resistant virus emerges, selection results i n that virus becoming the dominant strain and rendering therapy ineffective. This can have deleterious effects on the viral load and immune status o f the patient and can lead to more rapid disease progression. Resistance is categorized i n terms o f phenotypic and genotypic resistance. U s i n g Z D V as an example, phenotypic resistance refers to the susceptibility o f H I V as determined by the ability o f the drug to inhibit replication i n vitro. Genotypic resistance refers to the presence o f mutations i n a pattern consistent with Z D V resistance. Z D V resistance was first observed i n adults i n 1989, two years after the drug was approved for use i n the treatment o f H I V infection . Resistance is conferred by one o f five mutations at codons 41, 67, 70, 215 and 219 on the reverse transcriptase gene.  However, the  majority o f clinical isolates showing resistance carry the characteristic mutation at codon 215.  The magnitude o f Z D V resistance in Canadian H I V infected children has been  documented i n a cross sectional study with 25% o f children showing phenotypic evidence o f resistance.  A s expected, genotypic resistance (which precedes the development o f  high-grade phenotypic resistance) was more prevalent. A n evaluation o f 52 children from this cohort indicated that 48% had mutations at the codons 215 or 219 on the R T gene .  32  The potential consequences of Z D V resistance in children with H I V infection are profound.  In the case of perinatally acquired infection for example, infants could  potentially become infected by resistant strains acquired from their mothers, who may have developed these strains as a result of previous Z D V usage prior to or during pregnancy. partners.  These women may also have acquired resistant mutants from their sexual Infants infected with resistant H I V would be deprived the benefits of Z D V  during the early stages of growth and development.  The net result would be that the  improved survival rates seen among HIV-infected infants in recent years could revert to the rates observed in the early stages of the pediatric epidemic.  The longitudinal  interaction of virologic parameters as determinants of disease progression (viral load, resistance, and others) have been well studied in adults, but limited data are available in children. W i t h this in mind, our current pilot study was undertaken.  33  II  RESEARCH HYPOTHESIS The clinical history of virologic parameters in H I V infected children is similar to  that already demonstrated in adult studies.  II. 1  SPECIFIC O B J E C T I V E S  1. T o determine the plasma viral load of H I V infected children in Vancouver 2. T o determine the prevalence of genotypic resistance to lamivudine and zidovudine in these same patients. 3. T o identify trends in clinical outcome, virologic parameters and drug resistance in the same cohort from 1994 to 1999.  34  Ill  MATERIALS AND METHODS  III. 1  PATIENT POPULATION  A total of 9 patients were evaluated at the British Columbia Children's Hospital ( B C C H ) in Vancouver. There were over 100 mother-infant pairs seen at the hospital, but only 14 of these infants were infected with HTV. This represents an approximate 10% transmission rate. O f this cohort, three patients have died and two were not available for follow up in Vancouver. The demographics of these patients are shown in table 1. The majority of patients are male children who acquired H I V through perinatal transmission.  Table 1  Demographics of the pediatric cohort n Male Female Mean age Transmission route Perinatal Hemophilia Transfusion  III.2  9 6 3 12 years 3 months 6 2 1  SPECIMEN COLLECTION  For this portion of the study, approximately 5 m L of whole blood was collected in a sodium citrate tube from each patient at their regular clinic visit at B C C H . The samples were then packed in Saf-T-Paks® and transported to our laboratory via hospital courier according to the transportation of dangerous goods regulations.  35  Samples were drawn  between 9am and 1 l a m and sent within 5 hours o f collection to Viridae Clinical Sciences. The samples were processed immediately upon arrival.  III.3  ISOLATION OF L Y M P H O C Y T E S  The isolation o f lymphocytes was performed i n a laminar flow hood i n the viral isolation room o f the laboratory. The specimen was inverted 6 times and transferred to a 50 m L sterile, conical centrifuge tube.  The blood was then diluted with 12 m L warm  (37°C) R P M I - 1 6 4 0 (Gibco Laboratories, Grand Island, N e w York, U S A ) and pipetted up and down to m i x . In a separate 50 m L tube, 7 m L o f cold (4 °C) L y m p h o p r e p ® solution (Nycomed Pharma A S , Oslo, Norway) was measured and the blood mixture was slowly layered on top. The suspension was then centrifuged at 2000 rpm for 20 minutes at room temperature (22 °C) without the brake.  After the spin, the upper layer o f plasma was  stored i n cryovials i n 1.5 m L aliquots and stored at -70 °C for later use. The lymphocyte layer was then carefully removed into a clean 50 m L tube and 2 5 m L o f R P M I - 1 6 4 0 was added. After mixing gently, the tube was centrifuged at 1400 rpm for 10 minutes at room temperature. After the spin, the supernatant was aspirated and the cells re-suspended i n 5 m L R P M I . After 50 u L o f the suspension was removed for the enumeration o f cells using Trypan blue dye exclusion, the remaining fluid was spun at 4 °C for 7 minutes at 1200 rpm. The cells were then counted and the cryo-preservation media was made.  This  consisted o f 5.4 m L cold (4 °C) heat inactivated fetal bovine serum (Gibco Laboratories, Grand Island, N e w Y o r k , U S A ) and 0.6 m L dimethyl sulfoxide, or ( D M S O , Fisher Scientific, Fair L a w n , N e w Jersey, U S A ) . After the spin, the cells were resuspended i n  36  enough cryopreservation media to give a final concentration of 5 x 10 cells/mL. The 6  cells were then distributed into cryovials with no more than 1 mL of solution per tube. The tubes were then placed into a Bicell bio-freezing vessel (Nihon Freezer Co., Ltd. ) and frozen at -70 °C overnight (minimum 3 hours).  Once frozen, the cells were  transferred to storage at -135 °C in liquid nitrogen.  III.4  P L A S M A V I R A L L O A D - R O C H E AMPLICOR M O N I T O R ™ T E S T  III.4.1 Specimen Preparation This procedure is performed in the viral isolation room of the laboratory to eliminate cross contamination of PCR products. First, the lysis buffer is thawed and 100 pL of the QS is added to the bottle and vortexed.  Twenty-four 2.0 mL screw cap  microcentrifuge tubes are labeled (22 samples and 2 controls) and 600 uL of the working lysis reagent is added to each. 200 pL of thawed patient plasma is then added to its respective tube and vortexed. For each negative and positive control, 200 uL of negative human plasma is added to each tube, along with either 50 uL of positive control or negative control. All tubes are then incubated at room temperature for 10 minutes. To each tube, 800 uL 100% isopropanol is then added and the tubes are vortexed. The tubes are then placed in the microcentrifuge, with an orientation mark facing outwards for pellet placement. The specimens are centrifuged at 13,000 x g for 15 minutes at room temperature. After the spin, the supernatant is removed and discarded using a new disposable transfer pipette for each specimen. Then 1.0 mL 70% ethanol is added to each tube and  37  vortexed. The tubes are centrifuged again for 5 minutes at the same speed. After the spin, the pellet should be visible. The supernatant is aspirated as before; with as much ethanol removed as is possible since it can inhibit amplification.  The final pellet is  resuspended in 400 u L o f specimen diluent is added to each tube and vortexed to resuspend the extracted R N A .  The specimens should be amplified within 2 hours or  frozen at - 7 0 °C for up to one week.  111.4.2 Preparation o f Master M i x This is performed i n the reagent preparation area where 100 u L o f manganese solution is added to each o f two tubes o f master m i x (1 tube = 1 2 specimens). The tube is then inverted or vortexed. A total o f 24 M i c r o A m p reaction tubes are then placed i n the appropriate tray (12 per row), locked i n with the tube retainer and 50 u.L o f the master m i x is pipetted into each tube. The tray is placed i n a clean plastic bag and moved to the specimen preparation area where 50 p X o f prepared specimen or control is added to each tube. The location o f each tube is recorded.  111.4.3 Reverse Transcription and P C R Amplification These steps are performed in the amplification-detection area. The thermal cycler must be turned on 30 minutes prior to amplification.  The tray is placed i n the thermal  cycler block and program 50 is activated as follows: H O L D : 2 m i n at 50°C H O L D : 30 m i n at 60 °C C Y C L E (8 cycles): 10 sec at 95 °C, 10 sec at 52 °C & 10 sec at 72 °C  38  CYCLE (23 cycles): 10 sec at 90 °C, 10 sec at 55 °C & 10 sec at 72 °C HOLD : 15minat72°C Once the program is complete (approximate time-1 hour 30 minutes), the tray is removed and the caps removed from the tubes. Care must be taken to avoid creating aerosols of the amplified product. Immediately, 100 uL of denaturation solution is added to each tube and pipetted up and down 5 times.  III.4.4 Detection All reagents must be warmed to room temperature prior to use.  Firstly, the  working wash solution is prepared by adding one volume of the wash concentrate to nine volumes of distilled or de-ionized water. Once the microwell plate (24 wells) is at room temperature, it is removed from the foil pouch and 100 pL of hybridization buffer is added to each well. Rows A through F of the plate are coated with the HIV-1 specific oligonucleotide probe and rows G and H are coated with the QS specific probe. To row A of the plate, 25 pL of denatured amplicons are added and mixed up and down 10 times. Then, serial 5-fold dilutions are created in rows B through F with the final 25 pL being discarded. The same procedure is then followed for rows G and H. The plate is then covered and incubated for 1 hour at 37 °C ± 2 °C. After the incubation, the plate is washed 5 times using an automated plate washer. The program fills each well and allows it to soak for 30 seconds. It then aspirates and repeats the step 4 times. The plate must then be tapped dry to remove any additional moisture. 100 pL of conjugate is added to each well and the plate is incubated as before for 15 minutes. The plate is then washed again and the substrate prepared. For each  39  plate, 12 m L substrate A is mixed with 3 m L substrate B and the solution is distributed i n 100 u,L increments to each well. The colour is allowed to develop i n the dark at room temperature for 10 minutes and then 100 u L o f stop reagent is added to each well. The optical density at 450 nm is then measured using a plate reader and the are values printed out. The wells i n rows A through F represent neat and 1:5, 1:25, 1:125, 1:625 and 1:3125 serial dilutions o f the H I V amplicon.  The absorbance value results should  decrease with serial dilutions, with the highest OD450 for each specimen or control i n row A and the lowest i n row F . The lowest OD450 value between >0.20 and <2.0 O D units is chosen for each row. Each value and its dilution factor are inserted into the appropriate spreadsheet.  The same is done for the Q S rows. Rows G and H represent neat and 1:5  dilutions and the absorbance value i n row G should be greater than H . The well is chosen that has the lowest O D o value between >0.30 and <2.0 O D units. Once all o f the values 45  are entered, the program calculates the HIV-1 R N A copies/mL plasma.  III.5  P L A S M A VIRAL L O A D - N A S B A A S S A Y For samples tested between 1994 and 1996, the Nucleic A c i d Sequence Based  Amplification ( N A S B A ) method o f quantifying plasma R N A  40  was used.  Ill. 6  VIRAL PHENOTYPE For samples tested between 1994 and 1996, the A C T G  Virology Manual  procedures for determining viral phenotype (syncytium inducing or non-syncytium on  inducing)  III.7  were used.  VIRAL RESISTANCE TESTING For samples tested between  1994 and 1996, the A C T G  procedures for assessing viral resistance to Z D V  8 9  Virology Manual  were used. These methods describe  the procedures for determining the viral phenotype in vitro by culturing H I V infected P B M C s i n the presence o f A Z T . Results are given as an IC50 (inhibitory concentration) value and i n the case o f zidovudine, values > 1.0 p L indicate viral resistance.  Ill. 8  VIRAL GENOMIC SEQUENCING Samples were tested using manual sequencing with an A B I sequencer . This was 90  done by the laboratory o f Dr. Richard Harrigan at the B C Centre for Excellence i n H I V / A I D S , St. Paul's Hospital, Vancouver. The procedures are as follows:  III.8.1 Plasma collection Whole blood is collected i n E D T A , C P T , or A C D tubes and spun i n a swing out rotor for 10 m i n at 400g to separate the cells from the plasma. One milliliter aliquots o f plasma are transferred into cryostorage tubes and the plasma is then used for the standard Roche A m p l i c o r Monitor sample preparation procedure to extract the nucleic acid (Refer  41  to section III.4.1 for this procedure). Once completed, the sample is then labeled with an E-number.  111.8.2 P C R Reaction Preparation The master m i x is prepared according the Roche protocol (100 ul manganese to each vial o f master mix) and 50 ul is added to each P C R tube. A wax bead is then added to each tube and the tubes are heated at 80 °C in block heater for 30 s until the wax is melted. The tubes are removed from the block heater and allowed to cool until the wax has solidified (approximately 2 min). During the next steps it is important not to disturb the wax. First, 25 pX Master M i x is added to each P C R tube, followed by 25 p X o f patient sample, resulting i n a 100 u L volume i n each tube. The reaction tubes are then placed i n the thermal cycler and the program is run as follows: 45 m i n @45 °C 5 cycles (20 sec @ 95 °C, 10 sec @ 55 °C, 60 sec @ 72 °C) 30 cycles (lOsec @ 90 °C, 10 sec@55 °C, 60 sec @72 °C) 10 m i n @ 72 °C H o l d @ 4 °C The cycle should be complete in approximately 2.5 hours.  111.8.3 Second Round P C R and Product Detection The master m i x is prepared as before and 50 p X is aliquotted into appropriate P C R tubes.  The tubes must then be moved to a separate transfer location.  When the  cycle is finished, the tubes containing the 1st inner round o f P C R products are removed and the plate is held on a 45 angle while it cools and the wax hardens. Holding the tubes 0  42  in this manner results i n a very thin layer o f wax forming over the solution i n the tube. The products from 1 st round P C R are taken to the transfer room and the wax is broken i n order to remove 2.6 p L o f the 1st round product. This is transferred to the corresponding 2nd round microtube tube and the tube is capped immediately. When manipulating the caps to the microtubes, a fresh piece o f K i m wipe is used for each tube or row o f tubing to prevent cross contamination. The tubes are placed i n the thermal cycler and the run is as follows: 3 m i n @ 95 °C 5 cycles (20 sec @ 95 °C , 10 sec @ 55°C and 60 sec @ 72°C) 30 cycles (10 sec @ 90 °C ,10 sec @ 55 °C and 60 sec @ 72 °C) 10 m i n @ 72 °C H o l d @ 4 °C The program takes about 1.7 hours.  III.8.4 Product Detection The agarose gel is prepared by weighing 0.8 g o f Agarose into a 100 m L flask with a stir bar. T o this, 50 m L o f I X T A E Buffer is added and the mixture is micro waved on high power for 1.5 min. The warm beaker is placed on a magnetic stir plate and set to the lowest stir setting until the agarose powder has completely dissolved. If it does not dissolve, it can be reheated i n the microwave for 1 m i n on H i g h and then stirred again. When the agarose powder has completely dissolved, 30 m L o f I X T A E is added to cool the solution and it is stirred again. Then, 2 p L o f Ethidium Bromide is added and stirred in. W h e n the solution is cool enough to handle the warm solution is poured into flat bed  43  gel retainer and combs are quickly added to the apparatus before the agarose starts to gel. The first comb should be placed approximately 1 cmfromthe taped end and the second comb (if necessary) should be placed half way between the ends. The gel is allowed to cool. When cool, the combs can be removed by gently pulling upward awayfromthe gel. The masking tape is removedfromthe end of the gel retainer and then placed into the electrophoresis chamber. The chamber is filled with lx TAE solution until the gel is completely submerged. If there is any air left in any of the wells, it can be displaced using a pipette tip. Using a pipette, 2 uL of blue loading buffer is measured and combined with 7pL of each sample on a sheet of parafilm. This is done by purging the sample solution into the blue drops and then re-drawing it back up into the pipette several times until a uniform blue solution results. The tips are then filled with the dyed solutions and the samples emptied into the wells of the gel. Approximately 3.5 pX of the standard DNA ladder (100 mb) solution is then loaded into at least one well per comb. A potential of 100 volts is then applied for 20 min. When complete, the gel and retainer are removed and placed on a UV light table. The plexiglas shield is placed in the down position and the UV light turned on in order to examine the gel. When ready for photography, the gel is slid out of the retainer onto the table by gently pushing on one edge of the gel. The gel edges are cut off using a gel cutter so that the camera fits neatly over the gel (approx. 1 cm on each side). The products obtained are then recorded.  44  111.8.5 Sequencing Reaction and P C R Product Precipitation The dideoxy sequencing m i x is removed from the freezer and allowed to thaw at room temperature.  Once thawed, 2 p L o f sequencing m i x is added to each P C R tube,  followed by 2 p L o f sequencing primer (1.0 p M stock kept at 4°C) and 2 p L o f P C R product from second round P C R . The tubes are then placed i n the thermal cycler and reactions should be done i n approximately 2.5 hours. The plate is then removed and 100 p L o f the precipitating mixture ( E T O H : 3 M N a O A c ) (25:1) is added to each tube.  After  vortexing the plate, the microtubes are spun at 5000 rpm for 15 minutes. The supernatant is immediately removed and the sequencing loading buffer is added to the side o f each tube. Samples can then be kept at 4°C for up to a week before loading. One hour prior to loading the gel, the samples are heated at 90 °C for 2 min.  111.8.6 G e l Construction Before the gel is poured, it is necessary to ensure that the inside o f each plate is thoroughly cleaned. Then, 0.75g o f resin is added to the gel and swirled gently to avoid making air bubbles. Using an Erlenmeyer magnetic top vacuum filter, 6 m L o f 10 x T B E is filtered through 0.45 p M pores and added to the gel. It is then left under the vacuum for an additional 10 minutes at 40 cmHg. The 60 m L gel is then transferred into a clean container and 0.3 m L A P S and 33 p L o f T E M E D is added. The solution is aspirated up and down slowly to mix. The gel is poured slowly and allowed to set for 2 hours. Once set, 6 p L is loaded onto the gel (24 well comb) into alternate numbered wells and the samples are left to run for 5 minutes. A visual check is performed to ensure that the samples have entered the gel. Each well is rinsed individually and the even numbered  45  wells are loaded as above. After loading, the sequencer is closed and run for a m i n i m u m o f ten hours, after which the results are recorded and analyzed.  III.9  CLINICAL PATIENT D A T A  Clinical data including CD4 cell count and percentage, mode o f transmission and clinical status was obtained from Valencia Remple and D r . Jack Forbes at the British Columbia Children's Hospital in Vancouver.  46  IV  RESULTS Individual patient results are shown in the graphs below.  Figure 8  The changes in plasma viral load and CD4 T cell count for V-001 +  The therapeutic regimens are shown below the graph and drug resistance is indicated by vertical arrows.  The first patient, V - 0 0 1 , is a six-year-old male who was diagnosed with H I V in July 1993 (Figure 8). H e was started on A Z T monotherapy in February 1994 and a year later ddl was added to the regimen. The ddl was changed to d4T three months later and in January 1996, therapy was switched to an A Z T / 3 T C combination.  Viral load  measurements became available in August 1996 and at this point the viral load was 210,000 copies/mL and the C D 4 count was 640. The double nucleoside regimen o f A Z T and 3 T C was maintained for approximately one year at which point the patient was  47  switched to d4T/3TC for 5 months.  When no response was observed, the regimen was  changed once again to d4T, d d l and the protease inhibitor nelfinavir. This resulted in a significant reduction in viral load from 38,000 copies/mL to 1,800 copies/mL. The C D 4 cell count also increased from 720 to 820 cells/pL.  Since that time point, viral load has  rebounded to the previous level o f approximately 32,000 copies/mL. Resistance testing in March 1993 revealed a wild type virus but repeat testing in September 1999, indicated high level resistance to A Z T and susceptibility to 3 T C . Figure 9  The changes in plasma viral load and CD4 T cell count for V-003 +  & c&  S  1  ^  & cgl^ ^  s  & e£  s  ^  &  s  ;  AZT/3TC Date  Patient V-003, a nine-year-old female, was diagnosed with H I V in February o f 1991 (Figure 9). She was started on A Z T monotherapy in M a y 1991 and took it until M a y o f 1995, at which time she was switched to d d l monotherapy.  48  This therapy was  maintained for a period o f 5 months and was then discontinued in favor o f 3 T C monotherapy. Several weeks later A Z T was added back to the regimen and this therapy has been maintained up to the present time.  Viral load was initially at the limit o f  detection o f the assay (<500 copies/mL) and since then has fluctuated between levels o f 1000 and 9700 copies/mL. The C D 4 cell count has remained high and is currently stable at 1120 cells/uL. Viral phenotype and genotype was wild type at initial testing in January 1994 but sequencing in June 1999 has shown resistance mutations for both A Z T and 3 T C .  Figure 10  The changes in plasma viral load and CD4 T cell count for V-004 +  V-004  AZT* 3TC  R  Q  9  "Log Viral Load 'CD4 Cell Count  >  u  E  f 200 ,* + 100  8  o  s o —  ^  ^ |  ^  ^> ^  AZT/3TC  <f  ^  ^  c£ <f  ^  ^  D4T/3TC Date  V-004 is a seven year old female diagnosed with H I V in January 1992 (Figure 10). A Z T monotherapy was given at birth and the regimen was continued for approximately 2 years at which point d d l was added to the regimen.  49  A year and a half later, d d l was  replaced with ddC for 6 months. The patient then took A Z T alone for another 6 months, at which time 3 T C was added. In June 1997, d4T was added in place o f the A Z T . This is the current therapy. Viral load has been gradually decreasing from a maximum o f 16,000 copies/mL to its current level o f 1,820 copies/mL.  The C D 4 count has varied between  840 and 300 cells/uX and is currently at 490 cells/uL. Phenotypic testing in January 1994 indicated that the virus was sensitive to A Z T but sequencing in April o f this year has shown resistance to both A Z T and 3TC.  Figure 11  The changes in plasma viral load and CD4 T cell count for V-008 +  D 4 T / 3 T C  Date  Patient V-008 is an 11 year old female diagnosed with H I V in 1992 (Figure 11). A t that time, A Z T monotherapy was initiated and continued for a year at which point d d l was added to the regimen. Three years later, 3 T C was substituted for the ddl and taken  50  was added to the regimen. Three years later, 3 T C was substituted for the d d l and taken for nine months during which time the viral load remained high between 280,000 and 100,000 copies/mL and the C D 4 count around 500 cells/pL. In M a r c h 1997, A Z T was changed to d4T, which resulted i n a significant decrease i n viral load to the limit o f detection o f the assay.  The C D 4 cell count also rebounded to levels above  1,100  cells/pL. T w o months, later a protease inhibitor ( N F V ) was added to the regimen and this is the current therapy.  Since the addition o f N F V , viral load has steadily increased to  7,820 copies/mL and C D 4 count remains high at 1220 cells/pL. Testing i n February 1994 revealed a mutation at codon 219 o f the R T gene and an intermediate mutation at codon 215. V i r a l phenotyping also indicated that the virus was resistant to A Z T . Further testing in A p r i l 1999 has identified resistance mutations to both A Z T and 3 T C .  51  Figure 13  The changes in plasma viral load and C D 4 T cell count for V-010 +  Date  Patient V-010 is a seven-year-old male diagnosed with H I V i n August 1992 (Figure 13). Therapy was not initiated until August 1997 at which time dual therapy with A Z T and 3 T C was started and is still being taken at this time.  The first viral load  measurement was at the limit o f detection o f the assay but steadily increased to a maximum o f 30,000 copies/mL.  When therapy began, it decreased slowly to 1000  copies/mL, then increased over 1000 copies/mL before decreasing to the level o f quantitation o f the assay on one occasion i n February 1999. Since then, the viral load has increased to its current value o f 18,900 copies/mL. C D 4 cell counts have ranged from 1,390 to 450 cells/pL over the period o f observation. A t present, it is 720 cells/pL. V i r a l analysis i n February 1994 indicated that the virus was w i l d type and sensitive to A Z T however, testing earlier this year has shown resistance mutations to both A Z T and 3 T C .  53  Figure 14  The changes in plasma viral load and C D 4 T cell count for V-011 +  Jo  I  <h  c(N $  #  c?» #  AZT/3TC  #  *  cP  D4T/3TC/NFV  Date  Patient V-011 is a six-year-old male diagnosed with H I V in 1994 (Figure 14). ddl monotherapy was initiated in M a y 1994 and switched to the A Z T / 3 T C combination therapy two years later. After a year and a half o f this regimen, A Z T was replaced with d4T and a protease inhibitor (nelfinavir) was added.  This is the current therapy.  load was at its maximum during d d l monotherapy at  190,000 copies/mL.  Viral After  combination therapy was initiated, it decreased to 1,800 copies/mL. The C D 4 cell count also increased from 550 to 810 cells/uX. Viral load then steadily increased to 19,000 and upon initiation o f triple therapy, decreased to below 400 copies/mL. The C D 4 count also increased to 1040 cells/uL.  Currently, the plasma viral load has increased to 2,530  copies/mL and the C D 4 count is 830 cells/u.L.  54  Viral phenotyping in January 1995  indicated that the virus was sensitive to A Z T . Sequencing in April 1999 has shown intermediate resistance to A Z T and high level resistance to 3 T C . Figure 15  The changes in plasma viral load and C D 4 T cell count for V-012 +  V-012 is a seventeen-year-old male diagnosed with H I V prior to August 1987 (Figure 15). A Z T monotherapy was initiated in June 1996 and several weeks later, 3 T C was added to the regimen. In February o f 1998, the previous combination was replaced with double nucleoside analog therapy plus a non-nucleoside agent (d4T, d d l and nevirapine).  The nevirapine was replaced with efavirenz two months later.  The initial  viral load measurement was 4,300 copies/mL and over the following year it rose to 27,000 copies/mL. During this period, the C D 4 cell count remained around 250 cells/pL. Upon initiation o f triple combination therapy, the viral load continued to increase to a maximum  55  of 73,000 copies/mL in April 1998. cells/pL.  The C D 4 cell count had also decreased to 100  Therapy was changed to include efavirenz and viral load decreased to 5,400  copies/mL.  Levels continued to fluctuate, with a current viral load measurement o f  15,300 copies/mL and C D 4 count o f 90 cells/pL. In April 1994, viral analysis indicated that the virus was W T and remained susceptible to A Z T .  Testing in M a y o f 1999 has  identified resistance mutations to A Z T but the patient remains susceptible to 3 T C .  Figure 16  The changes in plasma viral load and CD4 T cell count for V-013 +  A Z T 3TC S  |  No therapy  V-013  S  AZT/3TC/IND  AZT/3TC/NFV  Date  Patient V-013 is a twenty-two year old male diagnosed with H I V in August 1987 (Figure 16).  Virologic measurements in August 1996 indicated a viral load o f 5,800  copies/mL which rose to 12,000 copies/mL over the next twelve months. Triple therapy  56  with AZT/3TC/Indinavir was initiated in August 1997 and viral load decreased to the detection limit o f the assay (500 copies/mL).  Samples taken i n M a y o f this year were  tested with the ultrasensitive assay with a limit o f detection o f 50 copies/mL and results show that maximal virologic suppression has been achieved. The C D 4 cell count has fluctuated between 750 and 410 cells/pL and is currently 460 cells/pL.  Phenotypic  testing i n A p r i l 1994 indicated that the virus was susceptible to A Z T and sequencing i n September 1997 revealed that the patient was susceptible to both agents. To summarize our results, eight o f nine patients had either monotherapy or a double drug combination as initial therapy. One patient was started on a triple combination o f zidovudine, lamivudine, and indinavir. A t baseline, the median viral load was 58,000 copies/mL and the median C D 4 count was 600 cells/pL.  The initial dual  therapy was changed to another double combination (d4T and 3 T C ) i n three cases. cases remain on their original therapy.  Two  O f the four remaining cases, three added the  protease inhibitor nelfinavir and one added a non-nucleoside agent (nevirapine). In three out o f the nine patients, a third regimen had to be used.  T w o patients were given  nelfinavir and one efavirenz. O f the entire cohort at last follow-up, the median viral load was 2,415 copies/mL and the median C D 4 count was 765 cells/pL.  The median change i n viral load from  baseline was 53,180 copies/mL and C D 4 count was 54 cells/pL.  For the entire  observation period, only four cases achieved undetectable viral loads. O f these four, only one case is maintained at this level, this being the only patient to start on a triple drug regimen.  57  Resistance testing for A Z T and 3 T C was performed at the latest available time point (October 1998 to September 1999). Seven cases showed A Z T resistance and two remained susceptible to this agent.  O f the patients with susceptible isolates, one is on  triple therapy and the other remains on dual therapy with a viral load o f 16,000 copies/mL. There are six cases o f 3 T C resistance, with three patients carrying susceptible isolates.  O f these three, one is no longer on the drug and another is the maximally  suppressed, receiving triple combination therapy as their initial regimen. When length o f treatment is compared to the development o f resistance, a pattern emerges. For both A Z T and 3 T C , those patients taking either drug for more than 2 years have demonstrated resistance. Interestingly, one patient had taken 3 T C for 3 years but has been off the drug for over two years and is now susceptible to this agent. When drug is taken for less than two years, the patient remains susceptible. However, one patient does show intermediate A Z T resistance after taking the drug for approximately 1.5 years. The only patient i n which this phenomenon is not seen is the triple therapy case (V-013).  58  V  DISCUSSION Over the last 15 years, enormous progress has been made in the treatment and  understanding o f H I V infection and A I D S . Even though the use o f highly active antiretroviral therapy ( H A A R T ) has resulted i n prolonged suppression o f circulating virus load, a truly curative therapy has yet to be found.  H I V infection i n children differs i n  many ways from adults i n both its clinical presentation and rate o f disease progression. However, preliminary data suggest the  success  o f different  antiretroviral  therapy  combinations and the development o f resistance to these agents appear to be following the same patterns. The purpose o f this study was to conduct a longitudinal follow-up o f a cohort o f HIV-infected children to evaluate these trends more systematically. The goal o f antiretroviral therapy is to suppress viral replication as much as possible and ultimately prevent the progression o f H I V to clinical A I D S . This can only be accomplished in most individuals with the use o f three or more agents as the initial therapeutic regimen . A recent population-based study confirmed that patients initially 91  treated with a triple-drug antiretroviral regimen comprising 2 N R T I s plus a PI or nonN R T I had a lower risk o f morbidity and death than patients treated exclusively with two nucleosides. Subjects receiving dual therapy were more than three times as likely to die than those receiving a triple regimen. Furthermore, the likelihood o f progression to A I D S or death was at least twice as high among those i n the double therapy group studies have shown similar results.  . Pediatric  For example, a large U S study ( P A C T G 338)  compared Z D V / 3 T C therapy alone or with the protease inhibitor, ritonavir.  Results  showed that the ritonavir-containing treatment arms achieved significantly lower plasma  59  viral load values at 1 2 weeks .  Studies with the protease inhibitor indinavir have also  shown the same results in a small cohort of HIV-infected children with extensive prior therapy . 94  Aggressive antiretroviral therapy for primary perinatal infection with three drugs is therefore recommended because it provides the best opportunity to preserve immune function and delay disease progression.  A Z T monotherapy is only considered in the  neonatal situation where the H I V status of the infant has yet to be determined, but perinatal transmission is suspected.  Once H I V infection has been confirmed, then the  infant is changed to a more appropriate combination antiretroviral therapy regimen. Less "aggressive" approaches  would likely lead to the development of viral resistance and  treatment failure. In each infected individual, a population of different viruses (known as the different quasispecies) is present The predominant virus in the population (the w i l d type) is thought to be the "fittest" variant, replicating in the most efficient manner. W i t h the introduction of therapy, a selection pressure is exerted and pre-existing resistant variants w i l l be selected and become the dominant strain. A s a result, the emergence of drug resistance is a major cause of treatment failure. In terms of perinatal transmission, this is most relevant when the mother is already resistant to certain drugs and these resistant variants are transmitted to her infant. This leaves fewer treatment options for the infected newborn.  However, i f viral replication is reduced to very low levels in the  mother there is less chance for resistance to develop, and the risk of infection in the newborn is greatly reduced. In this longitudinal follow-up study, nine pediatric patients who had been infected with H I V either as a result of perinatal transmission or through the transfusion of infected  60  blood or blood products were identified and followed in a longitudinal manner.  O f the  initial cohort of 14 patients, three died and two were not available for immediate evaluation. Genotypic analysis was performed on all nine patients to identify mutations conferring resistance to zidovudine and lamivudine. Only one patient carries isolates that remain susceptible to both agents. The high prevalence of resistance in this population is attributable to several factors. Firstly, six of the nine patients were initially treated with A Z T , 3 T C , or ddl monotherapy, at times when the risks of the development of resistance were less well appreciated.  A Z T was the first drug approved for pediatric use and all  patients who received this drug on its own are now resistant to it. O f the two patients that remain susceptible to A Z T , one was initially given dual therapy and the other was started on a triple therapeutic regimen as their initial therapy. Similarly, patients that were given either 3 T C monotherapy or dual therapy with A Z T have carry isolates that are resistant to 3TC.  Interestingly, prolonged virologic suppression is often achieved despite the  presence of the M l 8 4 V mutation (conferring high-grade resistance to 3 T C ) , as this may lead to hypersensitzation of isolates already resistant to A Z T . 9 5  However, it has now  been recognized that isolates may become resistant to both A Z T and 3 T C simultaneously, and that has been observed quite frequently in clinical practice. When switched to triple therapy, patients are more likely to show a favorable immunologic and virologic response. However, i f the patient is not naive to all the drugs in the new regimen, problems may arise. There may already be resistance to one of the agents which would essentially reduce the therapy to the same status as a double combination and reduce the likelihood of maximal virologic suppression.  Resistance  testing prior to therapeutic change would give a more complete picture of the viral  61  population and allow the most effective combination to be selected. In this cohort, o f the six patients who were given triple combination therapy, three regimens contained an agent that had previously been prescribed and two contained drugs that share resistance mutations with drugs the patients had previously received. A t the last observation period, all patients showed increasing viral loads and all but one demonstrated a decreasing C D 4 count.  The only patient receiving triple combination therapy that shows a favorable  response is V-013.  This individual was given triple therapy from initial diagnosis and  retains susceptibility to both A Z T and 3 T C . This level o f reduction i n viral replication is the likely explanation that resistance to any o f the drugs i n the regimen has been avoided to date. It is important out point out that all patients do not necessarily fit this pattern. In one case, the patient has been receiving A Z T / 3 T C combination therapy for three years and testing shows genotypic resistance mutations to both agents. Despite these findings, the C D 4 count is stable at 1100 cells/uL and the viral load is currently declining.  This  indicates that resistance is relative. Evidently, for a number o f reasons, the drugs remain active i n this individual. There are many factors that influence the emergence o f resistance and these should be taken into consideration when considering treatment options. The first is host factors such as a l o w C D 4 count and the presence o f AIDS-related symptoms . 96  These  would indicate a compromised immune system and i n this case, resistance would be more likely to emerge, especially i f maximal virologic suppression is not achieved. factors also play a role.  Viral  If the patient has a high viral load and a pre-existing drug  resistant viral sub-population, the likelihood o f resistance once drug pressure is applied is  62  increased. Finally, pharmacological variables are also important. Antiretrovirals should be selected for their potency and their ability to achieve therapeutic concentrations i n the 09  circulation . When these parameters are considered i n the selection o f an antiretroviral therapy regimen, the likelihood o f resistance emerging can be reduced. It is also important to remember that each patient is unique. This is especially evident i n children since the immune system is not fully developed and each individual may be at a different stage o f maturation. In general terms, the best prognosis for disease progression would occur i f the patient has a l o w viral load, high C D 4 count and carries isolates that remain susceptible to all antiretroviral agents. A s in adults, it would appear that i n this cohort, the best regimen to use i n children is triple combination therapy, allowing for maximal virologic benefit.  This also allows for reconstitution o f the  immune system and w i l l also delay, i f not prevent the development o f viral resistance. Dual therapy has resulted i n a poor virologic outcome i n these children and the high prevalence o f resistance limits future treatment options.  63  VI  CONCLUSION From the results of this study it is evident that the children of this cohort appear to  be following the same clinical history that has been seen in the adult population. This study has served as an excellent "hypothesis generating" exercise and serves as a pilot study for future research in this area.  Due to limitations set by the small size of our  cohort, it is impossible to make any strong conclusions regarding the treatment of pediatric H I V .  However, from the virologic responses demonstrated in our work, triple  therapy should be considered as the preferred regimen in the treatment of pediatric patients infected with H I V as is currently recommended in adults. This corresponds with the current standard of care in the adult population and has been shown give patients the best chance in delaying disease progression and preventing the emergence of viral resistance.  B y suppressing viral load to undetectable levels, the developing immune  system is better able to recover. This approach may delay, i f not prevent, progression to symptomatic A I D S .  64  VII  FUTURE STUDIES Continued follow-up of this cohort should continue in order to gain a better  understanding of H I V disease in children.  Future therapies for these patients should  take into consideration the more extensive use of non-nucleoside reverse transcriptase inhibitors. Those patients that are NNRTI-nai've could potentially be given nevirapine, delavirdine and the newer nucleoside analogue, abacavir ( A B C ) , or another nucleoside analogue to which they are naive. These should be combined with a potent single PI (or combination of Pis) to maximize virologic benefit. New regimens should be followed for the development of drug resistance, the evaluation of compliance and, possibly, the measurement of drug levels to maximize the chances of virologic suppression.  The  hypotheses generated from this study should lead to more extensive research regarding the treatment of pediatric H I V . In order to demonstrate more viable conclusions, a larger sample size and the use of an appropriate population as a control group should be taken into consideration. Through long term follow-up, a better insight into H I V infection in the pediatric population can be achieved.  It is still unknown what effects these kinds of antiviral  treatment w i l l have on these patients in the future.  Studies in both children and adults  need to focus on the long term effects of therapy and how continued treatment over the life span of the individual w i l l affect the host. It is hoped that even though a cure has yet to be found for this disease, H I V can continue to be managed as a chronic infection and allow those who are infected to live a normal life.  65  VIII REFERENCES  1.  Scott G , Buck B E , Leterman J G , et al. Acquired Immunodeficiency Syndrome i n Infants. N E J M 1984; 310: 76-81.  2.  Ventura, SJ et al. Births and deaths: United States, 1996. Monthly vital statistics report. National Centre for Health Statistics, Hyattsville, M D . 1997;46(supp 2):32.  3.  Pediatric A I D S : The Challenge o f H I V Infection i n Infants, Children, and Adolescents. Pizzo, P A & Wilfert, C M (Eds.). 1998 (3rd Ed.). Williams & W i l k i n s , Baltimore.  4.  Health Canada. H I V / A I D S E p i Update. Bureau o f H I V / A I D S , S T D and T B Update Series, Laboratory Centre for Disease Control, H P B , Health Canada, M a y 1998.  5.  Health Canada. H I V and A I D S in Canada. Surveillance report to June 30, 1998. D i v i s i o n o f H I V / A I D S Surveillance, Bureau o f H I V / A I D S , S T D , and T B , L C D C , H P B , Health Canada, November 1998.  6.  Centers for Disease Control and Prevention. Update: Trends in A I D S incidence, deaths and prevalence-United States, 1996. M M W R 1997;46:165-173.  7.  Centers for Disease Control and Prevention. Update: Perinatally acquired H I V / A I D S - United States, 1997. M M W R 1997;46:1086-1092.  8.  Conner E M , Sperling R S , Gelber R, et al. Reduction o f maternal-infant transmission o f human immunodeficiency virus type 1 with zidovudine treatment. N E J M 1994; 31: 1173-1180.  9.  Boyer P J , D i l l o n M , Navaie M , et al. Factors predictive o f maternal-fetal transmission o f H I V - 1 . Preliminary analysis o f zidovudine given during pregnancy and/or delivery. J A M A 1994;271:1925-1930.  10.  Anonymous. Factors involved in mother to child transmission o f H I V . Consensus workshop, Siena, Jan 1992. J A I D S 1992;5:1019-1029.  11.  Turner B J , Markson L , Hauck W , et al. Prenatal care o f HIV-infected women: Analysis o f a large N e w Y o r k state cohort. J Acquir Immune Defic Syndr H u m Retrovirol 1995;9:371-378.  66  12.  Mofenson L , Stiehm E R , Lambert J, et al. Efficacy o f zidovudine i n reducing perinatal H I V transmission i n HIV-1 infected women with advanced disease. 37th I C C A C . Toronto, Canada, September 29, 1997;264. Abstract I-117.  13.  Quinn T C , K l i n e R L , Halsey N , et al. Early diagnosis o f perinatal H I V infection by detection o f viral-specific IgA antibodies. J A M A 1991; 266(24): 3439-3442.  14.  Bremer J W , L e w JF, Cooper E , et al. Diagnosis o f infection with human immunodeficiency virus type 1 by a D N A polymerase chain reaction among infants enrolled i n the Women and Infant's Transmission Study. J Pediatr 1996; 129(2): 198-207.  15.  Borkowsky W , Krasinski K , Pollack H et al. Early diagnosis o f human immunodeficiency virus type 1 infection i n children less than 6 months o f age: Comparison o f polymerase chain reaction, culture and plasma antigen capture techniques. J Infect D i s 1992; 166(3): 616-619.  16.  Alimenti A , O N e i l l M , Sullivan J L et al. Diagnosis o f vertical human immunodeficiency virus type 1 infection by whole blood culture. J Infect D i s 1992; 166(5): 1146-1148.  17.  Mulder J, M c K i n n e y N , Christopherson C et al. Rapid and simple P C R assay for quantitation o f human immunodeficiency virus type 1 infection. J C l i n M i c r o b i o l 1994; 32(2): 292-300.  18.  De Rossi A , Masiero S, Giaquinto C et al. Dynamics o f viral replication i n infants with vertically acquired human immunodeficiency virus type 1 infection. J C l i n Invest 1996; 97(2): 323-330.  19.  Palumbo R E , Raskino C , Fiscus S, et al. Predictive value o f quantitative plasma H I V R N A and C D 4 + lymphocyte count i n H I V infected infants and children. J A M A 1998; 279 (10): 756-761.  20.  Mofenson L M , Korelitz J, Meyer W A , et al. The relationship between serum human immunodeficiency virus type 1 R N A level, C D 4 lymphocyte percent, and long term mortality risk i n HIV-1 infected children. National Institute o f C h i l d Health and Human Development Intravenous Immunoglobulin Clinical Trial Study Group. J Infect D i s 1997; 175(5): 1029-1038.  21.  Shearer W T , Quinn T C , LaRussa P, et al. V i r a l load and disease progression i n infants infected with human immunodeficiency virus type 1. W o m e n and Infants Transmission Study Group. N E J M 1997; 336(19):1337-1342.  22.  Perelson A S , Essunger P, Cao Y , et al. Decay characteristics o f HIV-1 infected compartments during combination therapy. Nature 1997; 387 (6629): 188-191.  67  23.  Perelson A S , Neumann A U , Markowitz M , Leonard J M , H o D D . H I V - 1 dynamics i n vivo: V i r i o n clearance rate, infected cell life span and viral generation time. Science 1996; 271(5255): 1582-1586.  24.  Mellors J W , Kingsley L A , Rinaldo C R Jr, et al. Quantitation o f H I V - 1 R N A i n plasma predicts outcome after seroconversion. A n n Intern M e d 1995; 122(8): 573-579.  25.  Mellors J W , Rinaldo C R Jr, Gupta P, White R M , Todd J A , Kingsley L A . Prognosis i n HIV-1 infection predicted by the quantity o f virus i n plasma. Science 1996;272(5265):1167-1170.  26.  Mellors J W , M u n o z A , Giogi J V , et al. Plasma viral load and C D 4 lymphocytes as prognostic markers o f HIV-1 infection. A n n Intern M e d 1997;126(12):946954.  27.  Centers for Disease Control and Prevention. 1993 Revised classification system for H I V infection and expanded surveillance case definition for A I D S among adolescents and adults. J A M A 1993; 269(4): 460.  28.  Bamji M , Thea D M , Weedon J, et al. Prospective study o f human immunodeficiency virus 1-related disease among 512 infants born to infected women i n N e w Y o r k City. The N e w Y o r k City Perinatal H I V Transmission Collaborative Study Group. Pediatr Infect D i s J 1996; 15(10): 891-898.  29.  L u c i w P. In: Fields B N , Knipe D M , Howley P M , eds. Human Immunodeficiency Viruses and their Replication. Field's Virology. 3 ed. Philadelphia: LippicottRaven, 1996;2. rd  30.  Kaplan M H . In: Glatt A E , ed. Pathogenesis o f H I V . Infectious Disease Clinics o f North America. Philadelphia: W . B . Saunders, 1994.  31.  Feng Y , Broder C C , Kennedy P E , Berger E A . H I V - 1 entry cofactor: Functional c D N A cloning o f a seven transmembrane, G protein-coupled receptor. Science 1996;272(5263):872-877.  32.  Dragic T, L i t w i n V , Allaway G P , et al. H I V - 1 entry into C D 4 + T cells is mediated by the chemokine receptor C C - C K R - 5 . Nature 1996;381(6584):667673.  33.  Alkhatib F , Combadiere C , Broder C C , et al. C C C K R 5 : A macrophage-tropic H I V - 1 . Science 1996; 272(5270): 1955-1958.  68  34.  L i u R , Paxton W A , Choe S, et al. Homozygous defect i n HIV-1 coreceptor accounts for resistance o f some multiply-exposed individuals to H I V - 1 infection. C e l l 1996;86(3):367-377.  35.  Michael N L , Chang G , Louie L G , et al. The role o f viral phenotype and C C R - 5 gene defects in HIV-1 transmission and disease progression. Nat M e d 1997;3(3):338-340.  36.  M c K i n n e y R E , Wilfert C M . Lymphocyte subsets i n children younger than 2 years old: normal values i n a population at risk for human immunodeficiency virus infection and diagnostic and prognostic application to infected children. Pediatr Infect D i s J 1992; 11:639-44.  37.  Blanche S, Tardieu M , Duliege A , et al. Longitudinal study o f 94 symptomatic infants with perinatally acquired human immunodeficiency virus infection: Evidence for a bimodal expression o f clinical and biological symptoms. A J D C 1990; 144:1210-1215.  38.  G a l l i L , de Martino M , Tovo P, et al. Onset o f clinical signs i n children with H I V - 1 perinatal infection. A I D S 1995; 9(5): 455-461.  39.  Byers B , Caldwell B , Oxtoby M . Survival o f children with perinatal H I V infection: Evidence for two distinct populations [abstract]. Presented at International Conference on A I D S . Berlin, 1993, Abstract W S - C 1 0 - 6 .  40.  N e w e l l M - L , Peckham C , Dunn D , Ades T, Giaquinto C . Natural history o f vertically acquired human immunodeficiency virus-1 infection. The European Collaborative Study. Pediatrics 1994;94: 815-819.  41.  Luzuriaga K , Sullivan J L . In: De V i t a V , Hellman S, Rosenbery S, eds. Transmission o f the Human Immunodeficiency Virus from Mother to the Fetus and Infant. A I D S : Biology, Diagnosis, Treatment and Prevention. 4 ed. Philadelphia: Lippincott-Raven Publishers, 1997; 10.2. th  42.  Berstein L J , Krieger B Z , N o v i c k B , Sicklick M J , Rubinstein A . Bacterial infection i n the acquired immunodeficiency syndrome o f children. Pediatr Infect Dis J 1985; 4:472-475.  43.  Hoyt L , Oleske J, Holland B , Connor E . Nontuberculous mycobacteria i n children with acquired immunodeficiency syndrome. Pediatr Infect D i s J 1992; 11: 354360.  44.  Simonds R J , Hughes W E , Feinberg J, N a v i n T R . Preventing Pneumocystis carinii pneumonia i n persons infected with human immunodeficiency virus. C l i n Infect D i s 1995;21 (suppl 1): S44-S48.  69  45.  LesgoId Belman A , Diamond G , Dickson, D , et al. Pediatric acquired immunodeficiency syndrome - Neurologic syndromes. A J D C 1988; 142:29-35.  46.  F i n z i D , Hermankova M , Pierson T, et al. Identification o f a reservoir for H I V - 1 in patients on highly active antiretroviral therapy. Science 1997;278:1295-1300.  47.  De Rossi A , Giaquinto C , Ometto L , et al. Replication and tropism o f human immunodeficiency virus type 1 as predictors o f disease outcome i n infants with vertically acquired infection. J Pediatrics 1993;123(6):929-936.  48.  Ehrnst A , Lindgren S, Dictor M , et al. H I V i n pregnant women and their offspring: evidence for late transmission. Lancet 1991;338:203-207.  49.  Duliege A , A m o s C , Felton S, et al. Birth order, delivery route, and concordance in the transmission o f human immunodeficiency virus type 1 from mothers to twins. J Pediatrics 1995;126:625-632.  50.  Musoke P, Guay L A , Bagenda D , et al. A phase I/II study o f the safety and pharmacokinetics o f nevirapine i n HIV-1-infected pregnant Ugandan women and their neonates ( H I V N E T 006). A I D S 1999; 13(4): 479-486.  51.  Dorenbum-Kracer A , Sullivan J, Gelber R , et al. Antiretroviral use i n pregnancy in P A C T G 316: a phase III randomized, blinded study o f single-dose intrapartum/neonatal nevirapine to reduce mother to infant H I V transmission. Int C o n f A I D S , 1998,12:, 397 (abstract no. 23281).  52.  Kramer F , Stek A , Homans J, et al. Combination therapy with nevirapine, zidovudine and a second nucleoside analog during pregnancy. Int C o n f A I D S , 1998, 12:, 41 (abstract no. 463/12152).  53.  Landesman S H , Kalish L A , Burns D N , et al. Obstetrical factors and the transmission o f human immunodeficiency virus type 1 from mother to child. N E J M 1996;334(25):1617-1623.  54.  Dickover R E , Garratty E M , Herman S A , et al. Identification o f levels o f maternal HIV-1 R N A associated with risk o f perinatal transmission - Effect o f maternal zidovudine treatment on viral load. J A M A 1996;275(8): 599-605.  55.  Ometto L , Zanotto C , Maccabruni A , et al. V i r a l phenotype and host-cell susceptibility to H I V - 1 infection as risk factors for mother-to-child H I V - 1 transmission. A I D S 1995;9:427-434.  56.  Goedert JJ, Duliege A , Amos C , Felton S, Biggar R J and the International Registry o f H I V Exposed Twins. H i g h risk o f H I V - 1 infection for first-born twins. Lancet 1991;338:1471-1475.  70  57.  Dunn D T , N e w e l l M L , Ades A E , Peckham C S . Risk o f immunodeficiency virus type 1 transmission through breastfeeding. 1992;340:585-588.  58.  V a n de Perre P. Transmission o f human immunodeficiency virus type 1 through breast-feeding: how can it be prevented? J Infect D i s 1999; 179 (suppl 3): S405407.  59.  Bobat R , Moodley D , Coutsoudis A , et al. Breastfeeding by H I V - 1 infected women and outcome in their infants: a cohort study from Durban, South Africa. A I D S 1997; 11(13): 1627-1633.  60.  K u h n L , Bobat R , Coutsoudis A , et al. Cesarean deliveries and maternal-infant H I V transmission: results from a prospective study i n South Africa. J A c q u i r Immune Defic Syndr H u m Retrovirol 1996; 11(5): 478-483.  61.  Firlag-Burkacka E , Piasek A , Horban A , et al. Prenatal care and birth outcomes o f H I V positive pregnant women. Int C o n f A I D S 1998; 12: 407 (abstract no. 23327).  62.  Furman P A , Fyfe J A , St Clair M H , et al. Phosphorylation o f 3'-azido-3'deoxythymidine and selective interaction o f the 5' triphosphate with human immunodeficiency virus reverse transcriptase. Proc N a t l A c a d Sci U S A 1986;83:8333-8337.  63.  M c K i n n e y R E , Pizzo P A , Scott G B , et al. Safety and tolerance o f intermittent intravenous and oral zidovudine therapy i n human immunodeficiency virusinfected pediatric patients. J Pediatr 1990;116:640-647. M c K i n n e y R E , Maha M A , Connor E M , et al. A multicenter trial o f oral zidovudine i n children with advanced human immunodeficiency virus disease. N Engl J M e d 1991;324:1018-1025.  64.  human Lancet  65.  K l i n e M W , V a n Dyke R B , Lindsey J C , et al. A randomized comparative trial o f stavudine (d4T) versus zidovudine ( Z D V , A Z T ) i n children with human immunodeficiency virus infection. Pediatrics 1998;101:214-220.  66.  Ogino M T , Dankner W M , Spector S A . Development and significance o f zidovudine resistance i n children infected with human immunodeficiency virus. J Pediatr 1993;123:1-8.  67.  M e r r i l l D P , Moonis M , Chou T - C , Hirsch M S . Lamivudine or stavudine i n twoand three-drug combinations against human immunodeficiency virus type 1 replication i n vitro. J Infect D i s 1996;173:355-364.  71  68.  Mueller B U , Butler K M , Stocker V L , et al. Clinical and pharmakokinetic evaluation o f long term therapy with didanosine in children with H I V infection. Pediatrics 1994;4:724-731.  69.  Butler K M , Venzon D , Henry N , et al. Pancreatitis i n human immunodeficiency virus-infected children receiving dideoxyinosine. Pediatrics 1993;91:747-751.  70.  Englund J A , Baker C J , Raskino C , et al. Zidovudine didanosine, or both as the initial treatment for symptomatic HIV-infected children. N Engl J M e d 1997;336:1704-1712.  71.  Lewis L L , Venzon D , Church J, et al. Lamivudine i n children with human immunodeficiency virus infection: a phase I/II study. J Infect D i s 1996; 174:1625.  72.  Horneff G , Adams O, Wahn V . Pilot study o f zidovudine-lamivudine combination therapy i n vertically HIV-infected antiretroviral naive children. A I D S 1998;12(5):489-94.  73.  Anonymous. A randomized double-blind trial o f the addition o f lamivudine or matching placebo to current nucleoside analogue reverse transcriptase inhibitor therapy in H I V infected children: the P E N T A - 4 trial. Pediatric European Network for the treatment o f A I D S . A I D S 1998;12(14):F151-60.  74.  Nijhuis M , Boucher C A , de Groot T, et al. Lamivudine-resistant human immunodeficiency virus type 1 variants (184V) require multiple amino acid changes to become co-resistant to zidovudine in vivo. J Infect D i s 1997; 176:398405.  75.  Mitsuya H , Broder S. Inhibition o f the i n vitro infectivity and cytopathic effect o f human T-lymphotropic virus type III/lymphadenopathy-associated virus ( H T L V I I I / L A V ) by 2',3'-dideoxynucleosides. Proc Natl A c a d Sci U S A 1986;83:911915.  76.  De Clercq E . Non-nucleoside reverse transcriptase inhibitors ( N N R T I s ) for the treatment o f human immunodeficiency virus type 1 (HIV-1) infections: strategies to overcome drug resistance development. M e d Res Rev 1996;16:125-157.  77.  Richman D D , Havlir D , Corbeil J, et al. Nevirapine resistance mutations o f human immunodeficiency virus type 1 selected during therapy. J Virol 1994;68:1660-1666.  78.  Luzuriaga K , Bryson Y , Krogstad P, et al. Combination treatment with zidovudine, didanosine, and nevirapine i n infants with human immunodeficiency virus type 1 infection. N Engl J M e d 1997;336:1343-9.  72  79.  Burchett S K , Carey V , V o n g F, et al. Virologic activity o f didanosine (ddl), zidovudine ( Z D V ) and nevirapine ( N V P ) combinations i n pediatric subjects with advanced H I V disease ( A C T G 245). 5 C o n f Retrovir Oppor Infect 1998; 130 (abstract no. 271). th  80.  Burchett S K , Sullivan J, Luzuriaga K , et al. Combinations o f didanosine (ddl), zidovudine ( Z D V ) and nevirapine ( N V P ) can reduce C S F H I V - 1 viral load i n pediatric patients with advanced H I V disease. Int C o n f A I D S 1998;12:62 (abstract no. 12253).  81.  Fan N , Evans D B , Rank K B , et al. Mechanism of resistance to U-90152S and sensitization to L-697,661 by a proline to a leucine change at residue 236 o f human immunodeficiency virus type 1 (HIV-1) reverse transcriptase. F E B S Lett 1995;359(2-3):233-238.  82.  Rutstein R M , Feingold A , Meislich D , et al. Protease inhibitor therapy i n children with perinatally acquired H I V infection. A I D S 1997; 12 :F 107-11.  83.  Rubini N P , Leal D W , Arabe J, et al. Combination therapy with a protease inhibitor i n children and adolescents with advanced H I V infection. Int C o n f A I D S 1998;12:64 (abstract no. 12262).  84.  Thuret I, M i c h e l G , Chambost H , et al. Combination antiretroviral therapy including ritonavir in children with H I V - 1 . Int C o n f A I D S 1998;12:64 (abstract no. 12259).  85.  Hirsch M S , Conway B , D ' A q u i l a R T , et al. Antiretroviral drug resistance testing in adults with H I V infection. J A M A 1998;279:1984-1991.  86.  Conway B , A l l e n U D , Cassol S, et al. Evaluation o f novel zidovudine resistance testing methodologies. X I International Conference on A I D S ; Vancouver, 1996.  87.  Romano J W ; Shurtliff R N , Pal R, et al. Application o f N A S B A technology i n the study o f retroviral infection i n vitro and i n vivo. Natl C o n f H u m Retroviruses Relat Infect (2 ) 1995; 119. nd  88.  H I V Syncytium-Inducing (MT-2) Assay. A C T G Virology Manual for H I V Laboratories. Compiled by the A I D S Clinical Trial Group Virology Technical Advisory Committee and the Division o f A I D S , National Institute o f Allergy and Infectious Diseases, National Institutes o f Health, September, 1994; S I A 1 - S I A 3 .  89.  H I V Drug Susceptibility Assay. A C T G Virology Manual for H I V Laboratories. Compiled by the A I D S Clinical Trial Group Virology Technical Advisory  73  Committee and the Division o f A I D S , National Institute o f Allergy and Infectious Diseases, National Institutes o f Health, September, 1994; R E S 1-RES 12. 90.  Alexander C S , Dong W , Schechter M T , et al. Prevalence o f primary H I V drug resistance among seroconverters during an explosive outbreak o f H I V infection among injecting drug users. A I D S 1999;13:981-985.  91.  Centers for Disease Control and Prevention. Guidelines for the used o f antiretroviral agents in pediatric H I V infection. M M W R 1998;47(RR-4):l-44.  92.  Hogg R S , Y i p B , K u l l y C , et al. Improved survival among HIV-infected patients after initiation o f triple-drug antiretroviral regimens. C M A J 1999;160(5):659665.  93.  Pelton S, Stanley K , Mcintosh K et al. First large U S study o f efficacy and tolerability o f ritonavir i n HIV-infected children. Int C o n f A I D S 1998; 12:61 (abstract no. 173/12246)  94.  Wintergerst U , Hoffmann F , Solder B , et al. Comparison o f two antiretroviral triple combinations including the protease inhibitor indinavir i n children infected with human immunodeficiency virus. Pediatr Infect D i s J 1998; 17:495-499.  95.  Mayers D . A Z T co-resistance i n H I V strains harboring the 3 T C M l 8 4 V mutation., February 1, 1998.  96.  Drusano G L , Bilello J A , Stein D S , et al. Factors influencing the emergence o f resistance to indinavir: role o f virologic, immunologic, and pharmacologic variables. J Infect Dis, 1998;178(2):360-367.  74  APPENDIX I  PEDIATRIC COHORT R A W D A T A CO  CO  31 c , ro o  Jo ; :ro.  >  o  s  < CO •<  CD  o <  3  i—.  '  5 1  I—f -%  (T> —t CD •a  ill  Q . O  01 to  3 w  o 3  • l  J3 a  > N -< Z  CO  -<-<-<-<  H  n  m £ ro o  f <1  SS  - w w a w i« SJ  Ul  i  3  ^  It cr  "n a> cr  glz  'O" co co co C D o -J oi ^5  -a .ro ',3.  CD «—t-  ,03  CO vj  Z  CO  S ^ go g S1  m  •< •< Z  Z ro  oo co  H  n  g  3  C O co C O co St;  CD  CO  a H  m ro  -< z •< z  533  CO, co co I !fa>! H —  > °^ a  g  vj  oo  C^  3  T l C O  g  D  CO  C O  rn -r  ro  o  o  <-tCD CO  > N  51 >< CO  CO  Z o  —  -4  co  £0 r *  Co  SS ;H  H  H  CO  V4  —I  < O co <—; o JO  D A H  H  Z: co c  ro  "0  ro  CO CO  *< CO  s ll  -< z z z  CO  H O  m  ~r IO ^ 4* •vl CD  I  o w  CD T3 CO  cn 75  ro I co  > ca I  V-010 12-Jun 92 Perinatal Hemophilia  cn • CO CD  00 IO  V-012  V-011 22-May-93 Perinatal —r  •  ISN  Sensitive  Sensitive  Sensitive  WT/WT  '  V-013 27-Jun-77 Hemophilia  Sensitive  cn  • - • 22-Jul-97 . . .  o  NSI 21/4/94 30-May-99  co  H  18 1 05  F  AZT' 3TC  OS  cn CO  oi  n  CD  z z z z z z f e z  Ol  H  —i  00  m  o  > N H  -z. •<<•<•< <^  2  m  x CO  CO CO  oo co -< Z Z -< Z Z  18/2/94 22-Oct-98 m  :>  ro •co  WT/WT  AZT/3TC/IND (Aug 97) AZT/3TC (Aug 97) DDI (May 94) AZT (Jun 96) AZT/3TC/NFV (Oct 98) D4T/DDI/NVP (Aug 99AZT/3TC (Oct 96) AZT/3TC (Jun 96) D4T/3TC/NFV (Feb 98) D4T/DDI/NEV (Feb 98) D4T/DDI/EFV (Apr 98)  . Z  > N H  O)  o  m •<  Z Z Z Z Z Z  H  Z to  76  z  z 2 k </•  > N H  A P P E N D I X II  Table 2  A M I N O A C I D INFORMATION  One Letter Amino Acid Codes  L  Alanine  A  Leucine  Arginine  k  Lysine  K  Asparagine  N  Methionine  M  Aspartic Acid  D  Phenylalanine  F  Cysteine  C  Proline  P  Glutamic Acid  E  Serine  Glutamine  Q  Threonine  Glycine  G  Tryptophan  W  Histidine  H  Tyrosine  Y  Isoleucine  I  Valine  V  Table 3  S T  Three Letter Amino Acid Codes  Ala  A  Leu  L  Xxx  Asx  B  Met  M  Tyr  N  Cys  C  Asn  Asp  D  Pro  Glu  E  Gin  Phe  F  Arg  Q R  Gly  G  Ser  S  His  H  Thr  T  He  I  Val  V  K  Try  W  Lys  P  The letters J , O and U are not used  77  Glx  x  y  z  APPENDIX III  Compound Amino acid change  HIV A N T I R E T R O V I R A L M U T A T I O N S  Codon In change vitro  In vivo  -Fold Crossresistance resistance (-fold)  Comments  HIV-1 NUCLEOSIDE RT INHIBITORS 4  Y Y  Y Y Y Y  TTG to TGG  Y  Y  Nil  T215Y T215F K219Q  ACC to TAC ACC to TTC AAA to CAA  Y ? ?  Y Y Y  K219E  AAA to GAA  Y  N  AAA to AGA TTA to GTA GTA to ACA ATG to GTG  Y N Y Y  Y Y Y Y  4-10 5-10  AAA to AGA K65R ddC (zalcitabine) T69D • ACT to GAT L74V TTA to GTA V75T GTA to ACA M l 84V ATG to GTG H C to TGC Y215C  Y N Y Y N  Y Y • Y Y Y Y  4-10 5 5-10 5 2-5 4  GTA to ACA  Y  Y  M41L AZT (zidovudine) D67N K70R  ATG to TTG orCTG GAC to AAC AAA to AGA  L210W  K65R ddl (didanosirfe) L74V V75T M184V  d4T (stavudine)  V75  3TC M184V Hamivudine) M184T M184I  ? ?  2-5  7  ATG to GTG Y or GTA Y ATGtoACG Y  Y Y ?  ATG to ATA  Y  Y  > 100  M41I/T215Y: 60-70-fold; K67N/K70R/T215Y/K219Q: 120-fold; M41L/K67N/ K70R/T215Y: 180-fold. Effect of T215Y is reversed by a ddl mutation (L74V), NNRTI mutations (L100I;Y181C) or (-J-FC/3TC mutations (M184I/V) Mutation arises after prolonged AZT therapy in the context of mutations M41L and T215Y. Enhanced resistance (4-fold) with M41L/D67N/K70RfT215Y M41t/D67N/K70R/T215Yor M41t/K70R/L210W/T215Y/K219Q and M41IJD67N/T215Y/K219Q: AZT-resistanceassociated mutations arising on ddl or d4T monotherapy, respectively ddC ddC ddC;d4C ddC; 3TC;(-)-FTC  Infrequently observed in patients receiving ddl or ddC Can reverse effect of T215Y AZT mutation  Observed in patients receiving ddl or ddC  ddl; 3TC; (-)-FTC ddl;ddC;d4C; (-)-FTC ddl; ddC; (-)-FTC  Arises on background of T215Y AZT resistance Observed with d4T selection patients receiving d4T  M184V and M184I can suppress effects of AZT resistance mutations; GTA seen in MT-2 cells in culture Reduced replication capacity and RT activity for all variants  78  in vitro, rarely in  APPENDIX IIII  PATIENT SEQUENCES  E12 4 5 5 BR TGGCCATTGACAGAAGAGAAAATAAAAGCATTAGTAGAAATTTGTACAGAATTG GAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAATATTTGCCATAAAGA ARAAAAACAGTACTAGATGGAGAAAATTAATGGATTTCAGAGAACTTAATAAAAGAACTCAAGACTTYTG GGAAGTTCAATTAGGAATACCACATCCTGCAGGGTTAAAAAAGAAMAAATCAGTAACAGTACTGGATGTG GGTGATGCATATTTTTCAGTTCCYTTAGATAAAGATTTCAGGAAGTATACTGCATTTACCATACCTAGTA TAAACAATGAGACACCAGGAATTAGATAT E12455 RH CAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGT AGTATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGACATAGTTATCTRCCAGTACATGGATG ATCTATATGTAAGTTCTGACTTAGAAATAGAGCAGCATAGGACAAAAATAGAGGAACTGAGACAACATCT GTTGAGGTGGGGATTTTACACACCAGAACAAAAAYATCAGAAAGAACCTCCATTCCTTTGGATGGGTTAT GAAC TC C A T C C T  E12477 BR TGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACCGAAATG GAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAACCCATACAATACTCCAGTATTTGCTATACACA AGAAAAACAGTAACAGATGGAGGAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTG GGAAGTTCAATTAGGAATACCACATCCCGCAGGATTAAAAAAGAAAARATCAATAACAGTACTGGATGTG GGTGATGCATATTTTTCAATTC CCTTAGATAAMGACTTCAGGAAGTATAC TGCATTTAC CATAC C TAGTA TAAATAATG AGACAC CAGGGATTAG ATAT E12477 RH CAGTACAATGTGCTACCACAGGGATGGAAAGGATCACCAGCAATATTCCAGAGT AGCATGACAAAAATCTTAGAGCCTTTTAGAAAACATAATCCAGACATARTTATCTATCAATACGTGGATG ATTTGTATGTAGGATCTGACTTAGAAATAGGGCAACATAGAACAAAGATAGAGGAACTGAGAGAACATCT GTTAAGGTGGGGATTATTCACACCAGAGCAAAAACATCAGAAAGARCCTCCATTTCTTTGGATGGGTTAT GAACTCCATCCT  E12 4 7 6 BR TGGCC ATTGAC AGAAGAAAAAATA7AAAGC A T TAGTAGAAATTTGTAC AG AAATG GAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAGAATCCATACAATACTCCAGTATTTGCCATAAAGA AAAAAGACAGTAC TAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAAC TCAAGAYTTC TG GGAAGTTCAATTAGGAATACCACATCCAGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTRGATGTG GGTGATGCATATTTTTCAGTTCCCTTGGATAAAGACTTTAGGAAGTATACTGCATTTACCATACCTAGTA T AAATAATG AGAC AC C AGGGATTAG ATAT  E12 4 7 6 RH CAGTACAATGTAYTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAATGT AGTATGACAAAAATCTTGGAGCCTTTCAGAAAACAAAATCCAGACATAGTTATCTATCAATACGTGGATG ATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAGCTGAGACAACATTT GTTGAAGTGGGGGTTCTACACACCAGACAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGTTAT GAACTCCATCCT  79  E12420  BR  RH  TGGCCATTGACAGAAGAAAAAATAAAGGCATTAGTAGAAATTTGTR CAGAATTGGAAAAGGAAGGAAAAATTTCRAAAATTGGGCCTGAAA ATCCATACAATACTCCAATATTTGCCATAAAGAAGAAAAACAGTAA TAGATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAAAGAACT CAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCTGCAGGG TTAAAGAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCA TATTTTTCAGTTCCCTTAKATGAAGAMTTCAGGAAGTATACTGCAT TTACCATACCTAGTACAAACAATGAGACACCAGGGATTAGATAT CAGTACAATGTACTCCCACAGGGATGGAAAGGATCACCAGCAATA TTCCAAAGTAGCATGACAAAAATCTTAGARCCTTTTAGAAAACAAA ATCCAGACATAATTATCTATCAATACATGGATGATTTGTATGTAGG ATCTGACTTAGAAATARGGCAGCATAGAACRAARATAGAGGAACT GAG AC AAC ATCTGTTG AG GTG G G G ATTTTTC AC ACC RG AAC AAAA ACATCAGAAAGAACCCCCATTCCTTTGGATGGGTTATGAACTCCA TCCT  E04273+BR TGGCCCTTGACAGAAGAMAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGG AAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAG AAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTTAGAGAGCTTAATAAGAGAACTCA AGACTTCTGGGAAGTTCAATTAGGAATACCACATCCTGCAGGGTTAAAACAGAAAAAATCAG TAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGACAAAGACTTCAGGAAGT ATACTGCATTTACCATACCTAGTGTAAACMATGAGACACCAGGGATTAGATAT E04273+RH CAGTACAATGTGCTTCCACAGGGATGGAAAGGGTCGCCAGCAATATTCCAATGTAGCATGAC AAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGATATAGTTATCTACCAGTACATGGATGA TTTATATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAACTGAGAC AACATCTGTTGAAGTGGGGATTTACCACACCAGACAAAAAACATCAGAAAGAACCCCCATTC CTTTGGATGGGTTATGAACTCCATCCT  E12676  BR  RH  TGGCCATTGACAGAAGAAAAAATTAAAGCATTAGTAGAAATTTGTACAGA AATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAGAATCCATATA ATACTCCAGTATTTGCTATAAAGAAAAAAGACAGTACTAAATGGAGAAAAT TAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTC CAATTAGGAATACCACATCCAGCAGGGTTAAAAAAGAAAAAATCAGTAAC AGTACTGGATGTKGGCGATGCATACTTTTCAGTTCCATTAGATAAAGACT TCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCA GGGATTAGATAT CAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCC AAAGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAACATCCAGAC ATAGTTATCTACCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAA ATAGGGCAACATAGAACAAAAATAGAAGAACTGAGGCAACATCTGTTGAG GTGGGGATTCACCACACCAGACAAGAAACATCAGAAAGAACCTCCATTC CTTTGGATGGGTTATGAACTCCATCCT  80  E12478  BR  RH  E12589  BR  RH  TGGCCATTGACAGAAGAAAAAATAAAGGCCTTAGTAGAAATTTGTGCAGA ATTGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACA ATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAA TTAGTAGATTTCAGAGAGCTTAATAAGAGAACTCAAGACTTCTGGGAAGT TC AATT AGG AATACC AC A C C C G G C AG G GTTAAAA AAG AA AAAATC AGTAA CAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCTTTAGATGAAGAC TTCAGGAAGTATACTGCATTTACCATACCTAGTACAAATAATGAGACACC AGGGGTTAGATAT CAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCC AAAGT AG C ATG ACAA A A ATCTT AG AG CCTTTT AG AAAACAAAA C C C AG AC ATAGTTATYTATCAATACGTGGATGATTTGTATGTAGGATCTGACTTAGAA ATAGGGCAGCATAGAGCAAAAATAGAAGAACTGAGACAACATCTGTTTAG GTGGGGATTTTACACACCAGACAAAAAACATCAGAAAGAACCCCCAWTC CTTTGGATGGGTTATGAACTCCATCCT  TGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGA ACTG G A A A AG G AAG G AAAAATTTC AAAAATTGG G CCTG AAAATCC ATAC A ATACTCCAGTATTTGCCATAAAGAAAAAAGACGGTACTAAATGGAGAAAA TTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGT TC AATT AGG A ATACC AC ATCCCG CAG G GTTAAAAAAG A AAAA ATC AGT AA CAGT ACTAG ATGTG G GTG ATG C ATATTTTTC AGTTCCCTTAG ATAAG G A A TTCAGAAAGTACACTGCATTTACCATACCTAGTATAAACAATGAGADGCC CGGGATTAGGTAT CAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCC AAAGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGAA ATRGTTATCTATCAATACGTGGATGATTTGTATGTGGGATCTGACTTAGAA ATAGGGCAGCATAGAACAAAAATAGAGGAACTAAGACAACATCTGTTGAG GTGGGGATTTTACACACCAGACAAAAAACATCAGAAAGAACCTCCATTCC TTTG G ATG G GTT ATG AACTCC ACCCT  E12831 TGGCCATTGACAGAAGAGAAAATAAAAGCATTAACAGAAATATGTGCAGATATGGAAAAAGA AGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAGGAA AAAAGACAGTACTAGATGGAGAAAATTAGTAGATTTTAGAGAACTTAATAAAAGAACTCAGG ATTTTTGGGAAATTCAATTAGGAATACCACATCCTGCAGGGTTAAAAAAGAAAAAGTCTGTAA CAGTACTGGATGTGGGGGATGCATATTTTTCAGTTCCCTTAGATAAGGAGTTCAGAAAGTACA CTGCATTCACCATACCTAGTCTCAACAATGAGACACCAGGAATCAGATACCAGTACAATGTGC TTCCACAAGGATGGAAAGGATCACCAGCAATATTCCAACATAGCATGACAAAAATCTTAGAGC CCTTTAGAACAAAAAATCCAGACATAGTTATCTACCAATACGTGGATGATTTGTATGTAGGGT CTGACTTAGAACTAGGGCARCACAGGGCAAAAATAGAGGAGTTAAGGGCACATCTACTGAAA TGGGGCTTTACCACACCAGAYCAAAAACATCAGAAAGAACCTCCATTCCTTTGGATGGGGTAT GAACTTCATCCT  81  LOC AAA GCA ACA GAG ATG GGG GAA CAT CCC CCC ATA AAC ATT AAT ATC ATG ACA GAG GAG TTG CTT ACC CCT TTC GAG ATG GGG AGT CTG GAA GAC AGG TAT  WT  AA  L0C1  L0C2  AAG GCC GCA GAA TTG GGA GAG CAC CCG  —i  ACA AAT GTT AAC ATY GTG GCA GAA GAA  TAC CCC WTC GAA CTG GGA GGT CTA AAG GAA AGA TAC  WTE  82  co CO CO CO CO ro  ro ro ro rok ro ro ro ro ro ro o o o 00 oo CO CO CO CO 4*. 4*. —k o - j cn cn co o 4^ o cn ro o CO CO cn cn cn O O —  111  PROTEIN K32 A33 T39 E40 M41 G45 E79 H96 P97 P119 1135 N136 1142 N175 1180 M184 T200 E203 E204 L210 L214 T215 P225 F227 E40 M41 G45 S68 L109 E122 D123 R125 Y127 TJ D  o  ro ro ro ro o CD co ro CO CO Ol  7>  > m H m CD  TJ X TJ  z r~ m m H  <  m r  -  CO CD  m  Tl  TJ  |-  z  > > m -  m CD r  —I TJ TJ X m m  TES1 "CODE BR BR BR BR BR BR BR BR BR BR BR BR  RH RH RH RH RH RH RH RH RH RH BR BR BR BR BR BR BR BR BR  j  z Tl  ENUM 12478 12478 12478 12478 12478 12478 12478 12478 12478 12478 12478 12478 12478 12478 12478 12478 12478 12478 12478 12478 12478 12478 12478 12589 12589 12589 12589 12589 12589 12589 12589 12589  UiOO  oo  < z  > < Tl  < TJ  CD r~ m TJ TJ m  \— CD  <  T.JTJ  ro  m m m m m m m m m m rn m m m m m m m rn m m m m i m m m m m m m m m m  P R I N T O U T S S E Q U E N C E R  APPENDIX V  TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ  LOC  WT K/M/R  T139 CCA  VOV  PROTEIN P140 GAC  AGA  D177 ATG  R143 1178 M184 GAG  GTA  ATA  V189 E204  AA  L0C1  L0C2  ADG  CCC  AGG  GAA  GTG  ATR  GTG GAA  CTA  111  TESTCODE  BR BR RH  BR RH RH RH RH  TAC  OVO  12589  12589  12589  12589  12589  12589  12589  12589 CTG CTT  GCT  E53  Y56 A62  GCC GTT  CCC  V90  P97  GGT  GTG G112  CCC  TAT  V111  P119  Y115  TAT  AAT  GAA  CAG  E122 Y181  GAG  N175  E203  AAA  Q197  R206 L214 K219  4^  RH  L205 L214  cn co  12589 T215  CO  RH RH  ATT GAA GGA  CD O  12589 ACC CAT ATA  H235  GAG GGG  CO -J  G45  ro  cn  12589 RH BR BR BR  cn  GAG TAT  ro ro  GTC  GAA  -vi  TAC  m CD m  cn CT)  12589 12676 12676  12676 BR BR BR BR  < > -<  TAC  GAA  CAA  CAT  AAA  CCA  TAC  GGC  GTK  CCA  ro  12676  12676  12676  12676 BR BR  TJ  CD  12676  12676 BR BR BR  <  CD  12676  12676  CD  cn  12676  <  co  BR  m TJ  CD -J  12676  z  AAG  TTC  AGG  GAA  ro ro ro ro ro o o o co *>. CD  I RH  I RH I RH  E204  GAG AGA  <  CD  12676  12676 12676 RH  RH  CTT  m rn O TJ  12676  12676  12676  RH RH RH  7s  TJ  <  m z c 5  12676  co CO  "vl 4^ 4^ -vl CO O  co  co  cn  < > < 7s TJ  X  j?-  12676  |— -  co CD  cn  X  r m rn D  X  4^  to ro ro ro to —L o o  co cn  co  o  TJ  —\  D  <  r™ m  < < Tl  < X  -< m CD m 7s Tl TJ  <  83  O  m  TJ  co  i  m 33  4^  m  X X  33 X X  33 TJ 33 33 33 33 33 X TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ  \'~  m m m m in m m m m m m m m rn m m m m m m; mi m m rn m m m m m m m m m  m  D/E  AA L0C1  L0C2  \  CCC  I II  LOC  Oil  CCA  GAA GGA  GAG CCT  CAG  GAC AAA GTA MAT  GGG  TCG TGT GAT  TAC CAG TTA GAA  AAG  CCC  111  PROTEIN P25 GAA GAG GGG  ro ro ro ro ro CO CO co vj CD cn cn CO CO ro ro o CO v j •vl 4^ 4^ ro ro L o L ji vj ro CD cn ro vj CO cn ro vj ro cn o CO o r CD  TESTCODE BR E29 E40 G45 GAA  CCC AAG GAT GAA  H/N  GO CO CD  BR BR BR F77 E79  P97 K102 D121 ATA AAT GGA  E122  1135 N137 G155  CCT  |AGG CTT  CAA  TCA  AGT GAC TAT  P225  R211 L214  L187 E204  Q182  S156  S162 D177 Y181  TTG GAG  O -< D  BR BR  |  -  BR BR BR BR  BR BR RH RH  RH RH RH  RH  RH RH RH RH  RH  33 m r -  < TJ Tl  WTE  84  TJ m Tl CD m m TJ  O -< D O CO  m D  TJ -  D O TJ m Tl CD m m r  TJ I  33 33 33 33 33 33 33 33 3D 33 33 3D 33 33 33 33 33 33 3) 33 XJ 33  JJ JJ Jj JJ JJ JJ JJ JJ JJ JJ JJ JJ JJ JJ X X  X X X X X X X X X X X X  CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD CD  JJ JJ JJ JJ JJ JJ JJ JJ JJ JJ JJ JJ JJ JJ JJ JJ JJ H  m O o C HO  a  m Ts D T J H r m T ; ro ro ro ro —ro —ro ro ro —* — ^ — ro C O o -fi. o —*• cn oo cn TJ  -  k  l  L  —\ CD —k <  ro o o  CO CD  co  m  r —  CD CD  J^ CD  —  l  L  <  —  CO  a D  cn ro ro oo co •ti.  Ts  TJ CD  O —  1  T;  00  Ts —1 a Ts  ro o  CD CD  CD  CD  Cn  <  CD O  CO Ji.  00  —i C D fx m ji. ji. cn  o  co co co ro  r~  O O O > CD O > o CD > > CD CD CD O CD > CD CD > o > > > CD > CD —1 CD > CD > > O > O O H > > O CD H > H —\ > > > o > > O > > o CD H > O > —1 > O > > O H CD > > CD —\ CD —1 CD > O > o CD > H O > > > CD CD CD > >  TJ  D m  TJ  Tl  Tl  m  Ts  H CD JJ  m  I  -  < H O D m  Ts  TJ  T>  JJ Z Z  Ts  —  CO  CD r m > -  Ts-  AA cn cn cn cn cn cn cn cn cn cn C J l cn cn cn cn cn cn cn cn cn cn cn cn cn cn en cn cn cn cn cn m —^ —^ —^ —^ —^ k L —^ __L » » k • i —i. — 1 — L 1, j z o o O o o o o O o o o o o o o o O o o o o o o o o o o O o CD o —1 CD CO CD CD CO CO CO CD CD CO CO C D C D C O C O C D C D C D C D CO CO CD m co co co co co co CO CO C D C O C O to CD CO CO CO CO C O C O CO CO CO C O CO C O CD C O CD C O C O C D C O C D C D C O C O to CD CD C D 3D o o o o o o O O o o o o o o o o o o o o o o o o o O o O o O O D ;  CD  CD  CD  CD CD  CD  CD  CD  CD  ji ji  CO  ji CjiO ji ji CjiO ji ji ji ji ji ji ji ji ji ji ji Oji ji Oji Oji Oji Oji Oji ji ji ji ji O O O O  CO CO CO  CO  CD  CD  CD  co co  CD  CD  CD  CD  co co co co co o  CD  CD  o  CD  CD  CD  CD  CD  CD  CD  CD  CD  o  o  o  TJ  Ts T<  H a 7t < co CD  CD  CD  CD  >" H  CD  in nr  o o  >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> TJ  Ts  a  TJ  H r~ m  H CD < m  r  -  D D  <  T;  m H  Ts  L0 *  O  r O o ro ro ro ro — ro rok ro ro ro — —^ — ro C O 00 o o o j ^ —* cn cn o k  l  ro  CO CD  CO  C CD D  CD  CO ro ro o —k co cn CO Ts CD CD  CD  00 • v l  ro o  C D CO  CD  CD  cn  CD O  ji.  ji.  oo cn  Ji.  CO co o C D ro CD X Ji.  O O CD O H H CD > > JJ > CD o H CD H > >o >C >>>>>O O > > O —\ —i> > O CD H > H H O CD H > o > >D o—1 > D > > > > O > > JJ O H > JJ JJ CD H JJ O > > > > C H C D JJ >> o > > CD > > CD  H m  85  PROTEIN E40 G45 M41 D67 V75 F87 K103 E122 P119 V77 L63  G52G16 V3 G141 R199 G196 G190 L187 Q182 Y181 S163 G94 H221 K219 D218 T215 L214 E204 D123  LOC GAA GAG GGG ATG GAC GTA TTC AAA GAA CCC GTA ATC CTC ATA GGT GGG GTC GGG AGA GGG GGA TTG CAA TAT AGC GGT CAT AAA GAC ACC CTT GAG GAC  WT  K/N  AA  L0C1  L0C2  Ji  to  k  GAG |GAA GGA TTG AAC ATG  CO  cn o  -ti  ro o oo vg CD cn CO to CO -vl  AAM AAA CCY ATA ATT TCY GTA GGA GGA ATC GGA AGG GAG AGT CTA CAG TRC AGT GGC YAT CAA GAA TAC TTT GAA GAT  WTE  J  86  All  TESTCODE BR BR BR BR BR BR BR BR BR BR PR PR PR PR PR PR PR BR RH RH RH RH RH RH RH PR RH RH RH RH RH RH BR A/0  ENUM 12455 12455 12455 12455 12455 12455 12455 12455 12455 12455 12455 12455 12455 12455 12455 12455 12455 12455 12455 12455 12455 12455 12455 12455 12455 12455 12455 12455 12455 12455 12455 12455 12455 X CD CO T;  H D -  cn CD CD CD CO CD ro ro CO CD  ro ro ro ro ro to ro o to CD CD 00 00 00 CO CO CO cn oo CD • f i CO L to - J o CD CO CO  CD m m  D  < TJ m 7\ T l  < T~  CD CD  < a m r  -< O i— CD CD X CD  r~ CD m m Tl TJ  CD  ro  CO  < CD CD CO m X CD -  r CD CO  m to CD CD  55  X X X X X X X X X X TJ TJ TJ TJ TJ TJ TJ X X X X X JJ Jj  TJ J j JJ JJ JJ JJ JJ JJ JJ  D D rn T l •< m O  A/H  m rn m m m m m m m m m rn m m m m m m m m m m m m m m m m m rn m m m  12476  12476  12476  12476  12476  12476  12476  12476  12476  12476  12476  12476  12476  12476  12476  12476  12476  12476  12476  12476  12476  12476  12455  12455  12455  RH  RH  RH  RH  RH  RH  PR  PR  RH  RH  RH  RH  RH  RH  PR  PR  PR  PR  iPR  IBR  BR  BR  BR  BR  BR  BR  BR  PROTEIN  D86  E53  E40  V60  K65  K70  K82  P97  CTG  GAC  GAA  GAG  GTA  AAA  AAA  AAG  CCC  LOC  L109  Q18  Q2  ATC  AGT  CAA  CAG  F124  S37  CTC  T96  V148  L149  S162  S163  L168  ACT  GTG  CTT  AGT  AGC  TTA  A71  M184  L209  R211  G213  L214  T215  GTC  GAA  GCT  ATG  CTG  AGG  GGA  CTT  ACC  WT  F/L  E35  F227  ATA  F171  L63  011  12476 RH  111  12476  PR  V3  AA  -  -  >  r- TJ CD I  m  Oil  12476  PR  <  TESTCODE  12476  PR  CD T l -  r  BR  12476  —i< r CO CO  <  BR  12476  TJ Tl  H  < D  L0C1  L0C2  CCT  TTC  CCC  ATA  AAT  CAR  CAA  CTR  GAY  GAG  GAA  ATA  AAR  AGA  AAA  CO ro O 00 cn 4^ CD CD vj oo CO i. CD CD co CD •vi oo ro 4^ co CD co o O cn o ro •vj  TTG  AGT  YTT  TGT  GTA  ATW  ACC  TAC  GGG  TTC  AAG  GTG  TTG  GAC  ACT  ATC  WTE  87  T;  m m a -  CO O O Tl r -  Tl I -  H  r  —\  <  I  L L ro ro ro ro ro ro oo o ro -vl CO 4^ CD CD CD CO cn C T J co CO CO •vj ro ro co oo  co co cn  TJ  <  TJ Z O O Tl r~ O m m O CO r~ T l TJ  n  CD CD  vj ro  c  12455  m m m m m m m m m m m m m rn m m m m m m m m rn m m m m mi m m m m m ro m cn z cn  TJ Tl TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ  TESTCODE BR BR  PROTEIN  GAG  V118 E122  V106  AAC CAG  GTT GAA  AAA AGA GGG AAA GTA  AAG AAA GAC ACT  N136 Q2  GTC  G99 K104  V3  LOC GAA TTA  D30  AGA  AGT  AAG GAT  K14  R41  S37  AAA CTC GGA  CAG  K43 Q58 JL63 G68  WT  AA TJ r  CCC AAC ACA  GCC  GGG AAT  z CD rn —\ z  E122 L120 P97 N136 T39 E40  K64  G45 N54 A62  >  CTC ATA  K65 D67 T69 K70 R72  7s  K/N  K/R  7s  on  12476 12476  BR BR  PR  PR  PR  PR  PR  PR  PR  PR  PR  BR  BR BR  BR  BR BR BR BR BR BR BR  BR BR  BR BR  12476 12476 12477 12477  BR  12477 12477 12477 12477 12477 12477 12477 12477 12477  12477 12477  12477  12477  12477  12477  12477  12477  12477  12477  12477  12477  PR PR PR  L0C1  AAA  TTG CCA AAT  ACC GAA  GGA  AAC GCT  CAC AAG AAC AAC AGA  AGG GGA ARA ATA ATT AAM  CAA  AAT  ATC CTT  GTA  AAA  AAC  AAT  AAA  CAA  AGA  CCC GGG  WTE  1  88  ro ro o ro  CO •vl  CO CD  co co  cn o  CD  cn  ro  cn  CD  CD  CD •vl  ro o  CD CD  vj  •vl  CD CO  co ro o o CD ro 00 CD  H D 7s  CD TJ 7s  < < O z m  < -  r 7s  ro  TJ  TJ 00 D  CO  z CD m H z  7s  co o  •t>.  >  CD r— O  o  cn  CD  m  T.  -  7s 7s  TJ 7s Z  CO  CO  00 co oo co  CD  12477  12477 12477  |  CD i TJj  i—  CD TJ TJ z z  z D r~ 7s  < Z CD TJ D  CO  m z« c 12477 12477 12477  m m m m m m m m m m m m m m m m m m m m m m m m m m m m rn m m m m  TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ TJ  i  ENUM E12477 E12477 E12477 E12477 E12477 E12477 E12477 E12477 E12477 E12477 E12477 E12477 E12477 E12477 E12477 E12477 E12477 E12477 E12477 E12477 E12477 E12477 E12477 E12477 PROTEIN, A71 V75 V77  LOC GCT GTA GTA ATA AAT CAG ATT TGC CTT CAA CAA GTT ATG CAG AAA GAG CAA TTG CTT ACC GAC AAA GAA TTC  WT AA  O Tv  N88 Q92 C95 L149 Q161 Q174 V179 M184 Q197 K201 E204 Q207 L210 L214 T215 D218 K219 E224 F227  Tv  r~ O m D H m  L0C1  L0C2  ACT GTG ATA ATC GAT CAA CTT TGT CTA CAG CAT RTT GTG CAA AAG GAA GAA TTA TTA TTC GAG CAA GAR  89  < < > O O r~  O O r~  <  <  Tl  •f=v  co  O D -  co CO  TJ TJ TJ TJ TJ TJ TJ X X  O i -  r  D  TESTCODE |PR PR PR PR PR PR PR PR RH RH i  O X Ts  < i— i~ m m m O m  Tl Tl  RH RH RH RH RH RH RH RH RH RH RH  j  X X X X X  III  X  X  J j JJ JJ JJ JJ JJ JJ JJ X  X IX  !JJ  ro ro ro ro ro ro ro ro ro ro ro ro o o o co oo •vl vg CD j i CD co CD oo 00 •vl v j v j CD oo cn o vj L vj CD CD cn CO ro 00 4V v j cn  m  Co OJ K> IO IO ro ro ro ro I O ro ro •o 0 0 v i ON cn —' vi O o> Co —• o VI ts IO ON Co 00 —' cn IO t> cn .u Co I O — ' o m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m m CO IO  ro ro CO 00 CO CO  ro l\3 00 CO CO CO  M ro CD 00 CO CO  ro 00 CO  ro CO CO  ro 00 co  ro 00 CO  ro 00 CO  ro 00 CO  ro 00 CO  ro 00 CO  ro 00 co  ro 00 CO  ro 00 CO  ro ro 00 00 CO CO  ro 00 co  ro 00 co  ro ro ro 00 CO 00 CO CO CO  ro 00 CO  ro 00 co  ro 00 co  ro 00 co  ro ro 00 00 CO CO  ro 00 co  ro 00 co  2  3D 33 X X  CO 30  3D X X  TN  TJ  CO  vj co  vi O  0) ro  D< *-  CD 3D  CO CD 3D 30  —  CD  ro  ra ro 3D 3D  CO 30  ro ro ro ro ro ro ro ro 3D 33 3D 3D 3D 3D 33 33  03 3D  <  3D  ro vl  ro cn  Dm  00 cn  —  CO cn  co o  ro co  ro ro  2 L  ro  co o cn  TJ CO vl  TN  O  < to o  Tl 00 vl  ro ro ro ro ro ro ro ro ro ro ro ro 30 3D 3D 3D 3D 3D 3D 3D 33 3D 33 3D  DO CO cn  00 ro  Tl vl vl  TN  vl O  TN  O)  CD cn  TN  m  co  o  H  co CO  c5  < m ro  CO Cn  to  O  o rj > > C D > > —1 —i C D C D H CD CD >  > > >  o o  > o  -H  TJ  I  — 1  o  -j j— i  CD  •<  C D-1 CDO >5> -j-1 -H -1 o > > O O -\ O > CDo  —i > DC > D CD H > C > > > D O > > H CD O H >  -<  3D  m  T> CD co  o  Tl  TJ  TN  OD  TN  n  > > C > C > > DC D D > C > >D O - i C > D > C > > > DCD CDCD> H  33  33  CD D > TN  —1 m  > >  TN  TJ  CO  D  CD  <  Tl  •<  3D  o  m  CD T; CO  T>  <  Tl  o  O  TN  Tl  TN  TN  CD T; m  H  < m  o o  "j o > -1 > > > o o O > C > O> C > O > j-I C > C D O —1 H D H D C D D > >O C o > > > —i > > > > > > > j >D > >DoC -1 o O CD H C D C D O O H C D C D —i > o > o —i > Oo > > > > > > > > C O O O CD H CD H CD H CD D rn  o -J CO  Vl o  o> ro  cn  -  1  ro  CO cn  CO o  ro vl  ro cn  ro co  ro ro  ro  o  o  CO vl  90  to o  00 vl  00  cn  oo cn  00 ro  vl vl  vl O  CD  Ol  CO  o  co to  00 CO ro vl Ol to  Ji. *>. Co Co CO CO Co CO Co c n cn cn cn JS3i . JCoi . vj Co to Co ro o cn o SD CO V J o> cn J i . Co m m m m m m m m m m m m m m m m m m m m m —  —*  1  ro ro CD CO CO CO  ro CO CO  ro CO CO  ro CO CO  ro CO CO  ro CO CO  ro Co CO  ro CO CO  ro CO CO  ro CO CO  ro CO CO  ro CO CO  ro CO CO  ro CO CO  ro ro CO CO CO CO  ro ro ro ro CO CO CO CO CO CO CO CO  33 X  33 X  33 X  3J X  33 X  33 X  33 X  33 X  33 X  33 X  33 X  33 X  33 X  33 X  33 X  33 X  33 X  r- o 7\D ro ro ro ro  rro• —  CO 33  D  33 to o Cf)  I ro o cn  ro o o  33  X  O ~ CO CO CO cn CO vJ  CO  33 X  CO  co  O  O  —.  CO  CO  ro CO  ro  r- r ro —  L  o  -  ro o CO  ro o •vl  -  H  CO CO  33 X  33 X  3) X  <  D  CO CO CO o  vj  O  o > Ci oH CCO > -j O O > OH > > O O > CCO > O CO > > O -1 > > > O > -1 O CCO —i > Ci 1 O H C O —i > > Ci > > Ci > > > > Ci > Ci  r-  Ci D  — 1O  O  •n  r  co  -  r  -  >  33  f~  >  33  X  D  r  -  CO  < < > >  r~CO  7s  D  r  -  a  33  r~r  -  D  33  33 r- —i  X  CO  O  <  D  O O  O -j -i  CO O CO H CO > > —{ CO > -< H  o > co > o >  O H D  > H Ci > O o O H a -1 o CCDO- o> > 33 > > > a > >  O  O O  CO CO CO H > CO CO O  > > > m  ro CO  ro co.  to  ro  CO  Co  —^  —».  ro  -*• 1  ro —^  CO  91  ro —.  ro —L  1°  ro o CO  ro o vj  ro ro o o CO cn  ro o o  CO CO  CO co CO vl  CO cn  CO CO CO o  vj J*.  


Citation Scheme:


Citations by CSL (citeproc-js)

Usage Statistics



Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            async >
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:


Related Items