Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Isolation and characterization of 5’ upstream regulatory region of survival motor neuron gene He, Ming 1999

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1999-0197.pdf [ 3.95MB ]
Metadata
JSON: 831-1.0089095.json
JSON-LD: 831-1.0089095-ld.json
RDF/XML (Pretty): 831-1.0089095-rdf.xml
RDF/JSON: 831-1.0089095-rdf.json
Turtle: 831-1.0089095-turtle.txt
N-Triples: 831-1.0089095-rdf-ntriples.txt
Original Record: 831-1.0089095-source.json
Full Text
831-1.0089095-fulltext.txt
Citation
831-1.0089095.ris

Full Text

I S O L A T I O N A N D C H A R A C T E R I Z A T I O N O F 5' U P S T R E A M R E G U L A T O R Y REGION OF S U R V I V A L M O T O R N E U R O N G E N E by M i n g He, M . D . The Shanghai N o . 2 Medical University, 1989 A THESIS SUBMITTED I N P A R T I A L F U L F I L M E N T OF THE R E Q U I R E M E N T S F O R T H E DEGREE OF M A S T E R OF SCIENCE in THE F A C U L T Y OF MEDICINE Department o f Surgery We accept this thesis as conforming to the required standard  T H E UNIVERSITY OF BRITISH C O L U M B I A A p r i l 1999 © M i n g He, 1999  In presenting this thesis in partial fulfilment  of the  requirements for an advanced  degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department  or by  his  or  her  representatives.  It  is  understood  that  copying or  publication of this thesis for financial gain shall not be allowed without my written permission.  Department of  ./  The University of British Columbia Vancouver, Canada Date  DE-6 (2/88)  Af  " f  /W  <->  ABSTRACT Spinal muscular atrophy ( S M A ) is a common autosomal recessive disorder characterized by loss or degeneration o f lower motor neurons i n the spinal cord, leading to progressive symmetrical limb and trunk paralysis and muscular atrophy. The disease has been classified into three types and mapped to chromosome 5 q l 3 . The telomeric survival motor neuron ( S M N t ) gene has been identified to be the S M A determining gene. The centromeric S M N ( S M N c ) may be related to the S M A phenotype. Five nucleotides differences between S M N t and S M N c do not affect the encoded protein. S M N proteins are distributed widely in all tissues with highest concentration i n C N S and liver. Little is known about the regulatory mechanism o f the S M N gene in cells. To identify the regulatory sequence elements for the expression o f the S M N gene i n both neuronal and non-neuronal cells, we cloned a 3132 bp fragment o f 5' upstream region o f S M N gene isolated from the chromosome 5 library into the luciferase reporter gene system. Serial deletion constructs containing various lengths o f 5-flanking region o f S M N gene were transfected into both S Y 5 Y and Vero cells. The results o f the promoter activity assay showed that 1) The reporter gene could be expressed in both neuronal and non-neuronal cells; 2) 48 potential binding sites for transcription factors were localized in the region from -1530 to +34; 3) The region from -157 to +114 displayed the highest promoter activity while the lowest activity was shown i n the region from - 28 to +114; 4) The 5' upstream region beyond - 899 showed lower promoter activity than that o f more approximal region (-306 to +114); 5) The promoter was more active in the neuronal cells i n general than that i n the non-neuronal cells, especially when the region contained more upstream sequences. The above results suggested that the S M N gene might be well regulated by many potential transcription factors. A negative regulatory element might be located i n the region between - 8 9 9 to -306 and the region between - 1 5 7 to +114 might be critical for the S M N gene expression.  ii  TABLE OF CONTENT  ABSTRACT  ii  LIST OF FIGURES  v  LIST OF T A B L E S  vi  ACKNOWLEDGEMENTS  vii  INTRODUCTION  1  Spinal Muscular Atrophy  1  1) Historical review  1  2) Clinical symptoms and classification o f S M A disease  3  3) Genetics o f S M A disease  4  Upstream Regulatory Region (Promoters)  14  Objectives o f the Present Study  18  MATERIALS AND METHODS  20  1) General chemicals and enzymes  20  2) Chromosome library screening  20  3) Subcloning  21  4) Sequencing  21  5) Search for transcription factor binding sites  22  6) Reporter gene constructs  22  7) C e l l culture and D N A trasnfection  24  8) C e l l extract and reporter gene assays  25  9) Immunocytochemistry  25  10) Data analysis  26  RESULTS  27  1) Sequence o f 5' upstream region o f S M N gene  27  2) Potential binding sites for transcription factors  27  3) Promoter activity o f the 5' flanking region o f S M N gene in transfection assays  28  4) Immunocytochemistry  30  iii  DISCUSSION SUMMARY SIGNIFICANCE FUTURE INVESTIGATIONS FIGURES  1-16  T A B L E S 1-3 REFERENCES APPENDIX 1  LIST OF FIGURES Figure 1.  Schematic illustration of 5 q l 3 region  44  Figure 2  Structure of S M N gene  45  Figure 3  Different scenarios of S M N gene arrangement  46  Figure 4  Diagram of subcloning procedure for sequencing  47  Figure 5  Cloning procedure of reporter gene constructs  48  Figure 6  The two basic reporter gene constructs  49  Figure 7  Diagram of 5' upstream region of S M N gene  50  Figure 8  A comparison between the sequences generated from the present study and i n the 51  Genbank Figure 9  Distribution of potential binding sites for transcription factors i n the 52  5' -upstream region of S M N gene FigureTO  Structure and activity of S M N promoter (-3132/ -306) analysis i n S Y 5 Y 53  neuroblastoma cells Figure 11  Structure and activity of S M N promoter (-306/-28) analysis in S Y 5 Y 54  neuroblastoma cells Figure 12  Structure and activity of S M N promoter (-3132/ -306) analysis i n 55  Vero cells Figure 13  Structure and activity of S M N promoter (-306/-28) analysis i n 56  Vero cells Figure 14  Difference i n expression levels of luciferase driven by S M N promoters containing various upstream regions in neuroblastoma cell line S Y 5 Y and kidney cell line Vero  57  Figure 15  Expression of S M N in S Y 5 Y cells  58  Figure 16  Expression of S M N i n Vero cells  59  v  LIST OF T A B L E S Table 1, Oligonucleotides used to sequence the 5' flanking region o f S M N gene  60  Table 2, Mismatched nucleotides  61  Table 3, Potential binding sites for transcription factors  62  \  vi  ACKNOWLEDGMENT I would like to acknowledge Drs. S. K i m and J.Francis, for providing the SY5Y cells and the antibody against S M N protein, respectively. I would like to thank Dr. Shiv Prasad for his advice in various aspects of this study. I also appreciate committee members for reviewing my thesis. Special thanks are given to my supervisor Dr. William Jia for his guide through the entire M.Sc. program. I would like to express my gratitude to Dr. Zheng Chen, Ms. Rena Chen and other colleagues in the lab for their assistance. I would also like to thank my husband, John Zhang, for his love and support in the past 2 years.  vii  INTRODUCTION SPINAL M U S C U L A R ATROPHY 1) Historical review The spinal muscular atrophies ( S M A s ) are a genetically heterogenous group o f inherited conditions characterized by degeneration o f anterior horn cells or cranial nerve motor nuclei and resultant wasting and weakness o f voluntary muscles (Dubowitz, 1995b). They are classified into two types: the childhood proximal autosomal recessive S M A , and the distal autosomal dominant S M A , or named X-linked forms (see review in Thomas, 1994). This thesis w i l l focus on the childhood S M A , which represents the second most common fatal autosomal recessive disorder after cystic fibrosis (Pearn, 1978a).  The history o f the childhood S M A can be traced back to 1883, when Bennett discussed a chronic atrophic spinal paralysis in children (Bennett, 1883). One case was clearly the first infantile spinal muscular atrophy ( S M A type I), although not recognized as such. In 1891, Guido Werdnig, a neurologist in Graz, Austria, published his classic paper entitled " T w o hereditary cases o f progressive muscular atrophy in early infancy presenting as muscular dystrophy, but on a neural basis" (Werdnig, 1891). He described two brothers who developed a progressive proximal weakness affecting the legs and arms. One child died o f pertussis aged 3 years; an extensive autopsy revealed bilateral symmetrical loss o f anterior horn cells. In the following year, Johann Hoffmann o f Heidelberg first used the term, i n German, spinale Muskelatrophie, (spinal muscular atrophy), in his paper entitled "Ueber chronische spinale Muskelatrophie i m Kindesalter, auf familarer Basis." (Hoffmann, 1892). In 1894, Guido Werdnig gave his further report about six children  1  who were commented on the variability o f severity (Werdnig, 1894). In 1900, Hoffmann reported six cases i n four families, and there were 21 other affected relatives in three families. The milder form o f spinal muscular atrophy were first reported by Kugelberg and Welander in 1956, who described 12 cases with onset between 2 and 17 years and survival into adult life, with continued ambulation (Kugelberg & Welander, 1956). Since then, numerous papers reported many cases o f S M A with various ages o f onset and severity (see review in Thomas, 1994). Meanwhile, classification o f the disease with different severity and localization o f the S M A gene on human chromosomes has attracted much attention.  In 1961, Byers and Banker first classified the S M A according to severity, and this classification was used to facilitate the prognostication o f the disease (Byers & Banker, 1961). In 1964, Dubowitz described the co-relation between age o f onset and severity (Dubowitz, 1964). In 1991, International S M A Collaboration, based on age o f onset and clinical course, subdivided the childhood S M A into three clinical groups, including type I, Wernig-Hoffmann disease; type II, intermediate severity form and type III, KugelbergWelander disease (Munsat, 1991).  In the 1970's, population studies had revealed that all types o f S M A were likely to be inherited in an autosomal recessive manner (see review in Morrison, 1996). Therefore, hard research work on trying to locate the SMA-determining gene was carried out by a concerted international collaboration including researchers from the U . S . A , U . K , Finland and Germany. In 1990, it was concluded that all types o f the S M A mapped to  2  chromosome 5q, which was also confirmed in French population by a French group working on a similar project (Munsat et al, 1990; Brzustowicz et al, 1990; Burghes et al, 1994; Daniels et al, 1992; Francis et al, 1993; G i l l i a m et al, 1990; M a c K e n z i e et al, 1993; M e l k i et al, 1990; Simard et al, 1992; Wirth et al, 1994). In 1995, Suzie Lefebvre and his colleagues identified and characterized a spinal muscular determining gene named survival motor neuron ( S M N ) gene (Lefebvre et al, 1995).  2) Clinical symptoms and classification o f S M A disease The childhood spinal muscular atrophy, or proximal spinal muscular atrophy is a group o f inherited neuromuscular disorders characterized by the degeneration o f motor neurons i n anterior horn o f the spinal cord, leading to progressive symmetrical weakness and wasting i n the proximal muscles (Dubowitz, 1995a). It represents the second common fatal autosomal recessive disease after cystic fibrosis in children, with an estimated incidence o f 1 in 10,000 newborns and a carrier frequency o f 1/40-1/60 (Pearn, 1978b). Clinically, it has been classified into three groups on the basis o f the age o f onset and clinical course (Munsat, 1991): - Type I (Wergnig-Hoffmann disease) is the most severe form, with onset at birth or before 6 months and 90% o f them die within 2 years o f age due to the respiratory failure. Type I patients are never able to sit or walk. - Type II (Intermediate severity form) S M A patients are able to sit but can not achieve the ability to stand or walk without any support. The age o f onset is usually within 6-18 month. Survival o f type II individuals depends on the degree o f respiratory complications. Some o f them can survive to 2nd or 3rd decade.  3  - Type III (Kugelberg-Welander disease) is the mildest form o f all three childhood S M A types. The type III patients show their first symptom after 18 months, usually i n late childhood or adolescence, and are characterized by the ability to walk unaided. M a n y type III patients can survive with a normal life expectancy.  Whatever the variation in the clinical severity, all three forms o f S M A patients are characterized by the following common features (see review i n Thomas, 1994): - Muscular weakness is symmetrical and more proximal than distal. It affects legs more than arms. The trunk is also affected. - Deep reflexes are absent or markedly decreased. - Electromyographic analyses show muscle denervation with neither sign o f sensory denervation nor marked decrease i n conduction velocities o f the motor nerves. - Histopathological examinations show atrophic fibres in all biopsies.  3) Genetics o f S M A disease A l l three types o f S M A have been mapped, by linkage analysis, to chromsome 5 q l 1.213.3 (Munsat et al, 1990; Brzustowicz et al, 1990; Burghes et al, 1994; Daniels et al, 1992; Francis et al, 1993; G i l l i a m et al, 1990; MacKenzie et al, 1993; M e l k i et al, 1990; Simard et al, 1992; Wirth et al, 1994), a region o f complex genomic organization that contains numerous repeated sequences, including polymorphic markers and genes (Burghes etal,  1994; Carpten etal, 1994; DiDonato etal, 1994; Francis etal,  1993;  K l e y n et al, 1993; Lefebvre et al, 1995; M e l k i et al, 1994; R o y et al, 1995; Thompson et al, 1995), suggesting that the S M A are allelic disorders. Further characterization o f  4  S M A locus has revealed a choromsomal region containing a large inverted duplication o f a 500kb-element and several classes o f pseudogenes (Lefebvre et al., 1995). The element contains three genes (Figure 1): the Survival motor neuron ( S M N ) gene (Lefebvre et al., 1995), the neuronal apoptosis inhibitory protein ( N A I P ) gene (Roy et al, 1995; Thompson et al., 1995) and p44 gene, which encodes a subunit o f the basal transcription factor T F I I H (Burglen et al., 1997; Carter et al., 1997). According to the position i n the chromosome 5q, all these three genes have their corresponding telomeric locus and a centromeric locus. It is most likely that the two loci can exist in either orientation, depending on the particular chromosome (Burghes, 1997). Only the telomeric version is related to the large scale deletions in S M A patients (Burglen,et al., 1997; Carter et al., 1997; Lefebvre et al, 1995; Roy et al, 1995).  The N A I P gene shows a similarity with baculoviral genes involved i n inhibition o f apoptosis i n infected insect cells and is present in multiple copies. Only the copy o f N A I P t (telomeric copy) containing exon5, named N A I P 5 , is associated with deletions in S M A patients (Liston et al, 1996; Roy et al, 1995). This copy is deleted i n 4 5 % o f type I S M A patients and 18% o f type II and III S M A patients (Burlet et al, 1996; Cobben et al, 1995; Hahnen et al, 1995; Roy et al, 1995; Simard et al, 1997; Velasco et al, 1996), but also in 2% o f unaffected carrier individuals (Roy et al, 1995; Thompson et al, 1995). Thus, loss of N A I P is not sufficient to cause the S M A disease. However, N A I P deletion may contribute to severity o f the phenotype, by generating an effect additive to that o f S M N t deletion (Simard et al, 1997; Wirth et al, 1995). Another gene p44 also exists as multiple copies, but only one copy, p44t (telomeric copy) is associated with S M A  5  deletions. Deletion or interruption o f p44t gene have been observed in 73% o f type I patients, but also in normal individuals (Burglen et al., 1997; Carter et al., 1997). In addition, the structure and function o f the T F I I H protein appear normal i n the patients homozygously deleted for p44t gene, which suggests that this copy may not play a role in any disease pathology of S M A (Burglen et al, 1997). Deletion o f both N A I P 5 and P44t genes were found in 50% o f type I S M A patients, which may represent the extent o f deletion on severe S M A chromosomes (Roy et al, 1995; Thompson et al, 1995; Wirth et al, 1995).  The S M N gene is about 20kb in length and consists o f nine exons interrupted by eight introns (Burglen et al, 1996) (Figure 2). The two duplicated S M N gene copies are termed to the centromeric S M N ( S M N c ) gene and tolemeric S M N ( S M N t ) gene according to their relative location on chromosome 5q (Figure 1) (Lefebvre et al, 1995). The S M N t and S M N c gene can be distinguished by five nucleotides changes, which do not alter the encoded amino acids. These include one base change in exon 7 which has been the marker for distinguishing S M N t from S M N c , and one base change in exon 8, one base change i n intron 6 and two base changes in intron 7 (Burglen et al, 1996; Lefebvre et al, 1995).  Analysis o f a control population shows that the S M N t gene is present i n all individuals while S M N c gene is absent in 7.5% of individuals (Lefebvre et al, 1995; M c A n d r e w et al, 1997). The copy number o f the S M N t and S M N c gene varies i n different individuals ( M c A n d r e w et al, 1997). A new multicopy marker A g - C A (C272), located at with the  6  upstream 5' end o f the S M N c and S M N t genes (Figure 1), has a highly significant allelic association with S M A in both the American and French Canadian populations and can be used to estimate the copy number o f S M N t and S M N c genes (Burglen et al, 1996; Simard et al, 1997). N A I P 5 gene copy which lies 3' to the S M N t gene can be used as a marker indicating the presence o f the S M N t locus (Figure 1) (Roy et al., 1995). It has been shown that three copies o f S M N t gene exist in nearly 6% o f normal individuals, suggesting that one o f the two chromosome 5 has two copies o f the S M N t , while 94% o f individuals have only one copy on each chromosome 5 (McAndrew et al., 1997). Analysis o f the copy number o f S M N c gene i n normal population showed that 43.4% o f individuals have two copies; 47.2% one copy; 7.5% no copies; and 1.9% three copies ( M c A n d r e w et al, 1997).  It has been well demonstrated that the S M N t gene is the S M A determining gene (Cobben et al, 1995; DiDonato et al, 1997; Hahnen et al, 1995; Lefebvre et al, 1995; Rajcan et al, 1996; Rodrigues et al, 1995; van der Steege et al, 1996; Velasco et al, 1996) and the S M N c gene may be related to the S M A phenotype (Campbell et al, 1997; DiDonato et al, 1997; M c A n d r e w et al, 1997). Using exon 7 as a marker, the S M N t gene is not detectable i n > 90% o f S M A patients, regardless of the severity. The S M N t gene that can be detected i n S M A patients is always with some mutations (Brahe et al, 1996; Bussaglia et al, 1995; Hahnen et al, 1997; Lefebvre et al, 1995; M c A n d r e w et al, 1997; Parsons et al, 1998; Parsons et al, 1996; Talbot et al, 1997). T w o different mechanisms have been implicated for the lack o f SMNt-specific exon 7 in S M A patients (Figure 3): gene deletion or gene conversion from S M N t to S M N c (DiDonato et al, 1997; Hahnen et al,  1  1995; Hahnen et al, 1996; Lefebvre et al, 1995; Rodrigues et al., 1995; van der Steege et al, 1996; Velasco et al, 1996).  In most S M A type I patients, SMNt-specific exon 7 is absent and the number of loci detected by C272 is also reduced, which means that a deletion in SMNt gene exists in this group of patients (DiDonato et al, 1994; Melki et al, 1994; Lefebvre et al, 1995; Wirth et al, 1995). In S M A type II and type III patients, SMNt exon 7 is not detected, but the NAIP5 gene, which is the marker of the existence of the SMNt locus, is still present, and number of the marker C272 is not changed, indicating that the SMNt gene has converted to SMNc gene in type II and type III SMA patients, leading to the increased SMNc copy number (Figure 3) (Campbell et al, 1997; Burghes, 1997). Thus, it seems that SMNt gene deletions are related to the severe phenotype, and gene conversions from SMNt to SMNc may be associated with a milder disease phenotype.  Variable mutations have been detected in 75 % of the SMA patients retaining the SMNt gene copy (<10%) by current methods (McAndrew et al, 1997). These mutations include disrupted splicing of exon 7 (Lefebvre et al, 1995), deletion of 4 base pairs or 5 base pairs in exon 3 (Bussaglia et al, 1995; Brahe et al, 1996), an 11 bp duplication in exon 6 (Parsons et al, 1996), and a five different missence mutations in exon 6 and exon 7 (Hahnen et al, 1997; Lefebvre et al, 1995; McAndrew  al, 1997; Talbot  al, 1997).  Many of these mutations have been found in more than one S M A patient. It has been proposed that a highly conserved tyrosine-glycine (Y-G) dodecapeptide motif in the region of protein encoded by exon 6 and 7 are crucial for the correct functioning of the  8  protein and that mutations affecting this region result in S M A (Talbot et al, 1997). Other mutations may result in premature truncation o f the S M N protein (Brahe & Bertini, 1996; Bussaglia et al., 1995; Parsons et al., 1996). The above findings have provided strong evidence indicating that the S M N t is the primary S M A - determining gene, and the regions encoded by exon 6 and 7 are important for normal functions o f the S M N t gene product.  The S M N c gene was found to be present in all patients and absent in 7.5% healthy individuals (Lefebvre et al, 1995), which indicates that S M N c gene is not the S M A causing gene. However, the correlation between the S M N c copy number and S M A phenotype reveals that the S M N c gene may play an important role in modifying the phenotypes o f the S M A (Campbell et al, 1997; M c A n d r e w et al, 1997). It has been reported that 33% o f unaffected individuals who only have one copy o f S M N t gene (carriers) have three or four copies o f the S M N c gene, as compared to only 1.9% o f three copies (not four copies) i n the rest o f normal population ( M c A n d r e w et al, 1997). U s i n g the C272 marker, a correlation between the number o f copies o f C272 and S M A phenotype has been revealed, which demonstrates that most o f type II/III S M A patients who have milder phenotype have three copies o f S M N c gene (Campbell et al, 1997; DiDonato et al, 1994; Hahnen et al, 1996; M c A n d r e w et al, 1997; van der Steege et al, 1996; Velasco et al, 1996; Wirth et al, 1995). It is apparent that the increased copy number o f S M N c gene may compensate for the lack o f S M N t gene, suggesting that the S M N c gene is translated into an at least partially functional protein (Lefebvre et al, 1998), which also has been demonstrated at R N A and protein levels (Coovert et al,  9  1997; Lefebvre et al, 1997).  Both S M N c gene and S M N t gene are expressed in all normal human tissue (Coovert et al, 1997; Lefebvre et al, 1995; Lefebvre et al, 1997; N o v e l l i et al, 1997). The nucleotide changes in exon 7 and exon 8 between the S M N c and the S M N t gene do not influence the encoded amino acid, which means both S M N c and S M N t encode an identical protein (Lefebvre et al, 1995). However, analysis o f the S M N gene transcripts in lymphoblastoid cell line, human muscle and central nervous system (CNS) tissues shows alternative splicing occurs in both S M N c and S M N t gene copies. The majority o f transcripts (approximately 90%) from the S M N t gene are full-length (1.7kb), thereby encoding a fully functional protein, while the remainder (approximately 10%) is missing exon 5 (Gennarelli et al, 1995; Lefebvre et al, 1995; Parsons et al, 1996). S M N c gene can produce all kinds o f isoforms o f S M N , but only 20-30% o f these are the full-length transcripts. The spliced transcripts from S M N c copy include transcripts without exon 5, or 7 or both. A l l these non-full-length transcripts generate truncated proteins (Gennarelli et al, 1995; Lefebvre et al, 1995; Parsons et al, 1996).  The translated protein from the full-length transcript is a novel protein o f 294 amino acids with a molecular weight o f 38 k D a (Lefebvre et al, 1995). Light and electronmicroscopy studies have demonstrated that S M N protein is localized i n the cytoplasm and the nucleus ( L i u & Dreyfuss, 1996). Nuclear S M N protein is detected by a n t i - S M N antibody in prominent new sub-nuclear bodies called "gems" for 'Gemini o f the coiled bodies' nucleus ( L i u & Dreyfuss, 1996). The S M N protein is ubiquitously expressed in  10  humans; is conserved throughout mammalian species and shows no resemblance to any known protein i n database (Lefebvre et al, 1995). Quantitative western blot analysis has shown that the S M N protein is abundantly expressed in human brain and spinal cord although it is detected at similar levels in non-neural tissues such as kidney, liver as well (Coovert et al., 1997). In human C N S , cell specific expression has been observed by in situ hybridization. The expression o f the S M N gene is mainly located i n specific neuronal populations, including motor neurons, which are the target cells in S M A , central canal, dorsol root ganglia, cerebral pyramidal cells and cerebellum Pukinje cells (Tizzano et al, 1998). Immunohistochemical analysis o f S M N protein shows that motor neurons o f the spinal cord from normal fetuses have a large amount o f cytoplasmic S M N protein and large gems as compared with other cells and tissues (Lefebvre et al., 1997). In situ hybridization analysis also shows the large motor neurons o f the spinal cord are the main cells that express S M N (Tizzano et al, 1998).  The function o f the S M N protein still remains unknown. However, many research results have supported the notion that it may be related to the R N A metabolism. First, the "gems", which are labeled by a n t i - S M N antibodies, appear to be associated with the nuclear coiled bodies, which play a role in p r e - R N A metabolism ( L i u & Dreyfuss, 1996). The "gems" appear to interact directly with the coiled bodies and undergo similar changes in response to enviromrrental and metabolic conditions o f the cell ( L i u & Dreyfuss, 1996). Secondly, the S M N protein was shown to form a complex with a novel protein named SIP1 ( S M N interacting proteinl) (Fischer et al, 1997; L i u et al, 1997) and also interact with small nuclear ribonucleprotein U l and U 5 o f spliceosome, the catalytic core  11  of the splicing reaction. Finally, the region o f amino acids 262 to 279 o f the S M N contains a tyrosine/glycine-rich motif that is present in various R N A binding proteins (Talbot et al., 1997). Interestingly, mutations in this region o f S M N t gene have been frequently found i n S M A patients, which further emphasizes.the functional importance o f this region and suggests that the loss o f function in interacting with R N A s may contribute to the S M A pathology. A recent study also suggested that the ability o f S M N selfassociation through the portion o f the S M N protein encoded by exon 6 and 7 may be important (Lorson et al, 1998). In addition, it has also been reported that S M N protein may have a synergistic anti-apoptotic activity with Bcl-2 protein (Iwahashi et al., 1997).  Since the majority (90%) o f the full-lengh S M N m R N A , which can be translated into a functional protein, are transcribed from S M N t gene (Gennarelli et al., 1995; Lefebvre et al., 1995; Parsons et al, 1996), loss o f S M N t gene results in a decrease i n the functional level o f S M N protein and the severity o f S M A phenotype may directly correlate with the levels o f S M N protein in cells. However, the amount o f full-length transcripts could vary due to the variable copy numbers o f S M N c gene in different individuals ( M c A n d r e w et al., 1997). In human fetal tissues (liver and spinal cord), the relative amount o f the S M N protein is dramatically reduced in all S M A type I, but not in type III, especially in spinal cord (Lefebvre et al., 1997). For type II patients, the protein level is either decreased or normal (Lefebvre et al., 1997). Similar protein levels are observed i n S M A type I patients carrying large-scale deletions (involving S M N t and telomeric versions o f N A I P and P44 on both mutant chromosomes), small deletions or intragenic mutations o f the S M N gene (Coovert et al., 1997). A l l these results suggest that the remarkable reduction o f the S M N  12  protein is related to the type I S M A patients and milder decrease usually occurs i n type II/ type III patients. A s mentioned before, evidence from cytogenetics suggest that the loss of S M N t gene by deletion is related to the severe S M A phenotype while loss o f S M N t gene by gene conversions, resulting in increased S M N c gene copy number, may be associated with a milder phenotype. The coincidence among the copy number o f S M N c , the levels o f S M N protein and the severity o f S M A disease phenotype supports a hypothesis that, despite the low efficiency in the production o f the full-length m R N A by the S M N c , the presence o f higher number o f S M N c copies results in an increased levels o f fully functional protein, leading to a less severe disease phenotype.  However, efforts to demonstrate a correlation between S M N c copy number and disease severity have produced conflicting results. Rare cases o f severe forms are also associated to an increased number o f S M N c , suggesting that other factors may affect the severity o f disease, and a new factor named H4f5 (human 4f5) was reported recently to be a S M A modifying gene (Scharf et al., 1998). It has also been proposed that the S M A phenotype could be modified by different kinds o f conversion extending to a different part o f the S M N t gene (for review see Burghes, 1997). O n the other hand, immunohistochemical analysis o f gems in S M A fibroblats shows the number o f gems in the type II patients is clearly more than that in type I patients even though the copy number o f S M N c genes are identical i n both patients, suggesting that not all S M N c genes i n S M A patients are functionally equivalent (Coovert et al., 1997). The most likely explanation is that the S M N c gene copy converted from the S M N t gene is different from the original S M N c gene. The converted S M N c gene copy in type II patients may produce more functional  13  protein sufficient for the gem formation, even though the amount is reduced, whereas the remaining S M N c gene in type I patients is not capable o f expressing the appropriate amounts o f S M N protein for the formation o f gems (Coovert et al., 1997). According to this point, the increased S M N c gene copies that can modify the phenotype o f S M A (modifying S M N c ) should be distinguishable from the original S M N c gene. A new hypothesis has been proposed that no copies o f modified S M N c genes exist in type I S M A , one modified copy exists in type II and two o f those copies i n type III (Burghes, 1997; Coovert et al, 1997).  The amount o f S M N proteins produced from S M N c copy also appears to be cell-type specific. In S M A patients lacking the S M N t (therefore all o f S M N protein are produced by S M N c copies), the most significant reduction in the levels o f S M N protein was found in the spinal cord (100-fold) while the modest decrease were observed i n fibroblasts and skeletal muscle (Coovert et al, 1997). The apparent unequivalence between the original S M N c and converted S M N c and cellTtype specific levels o f expression o f S M N from the S M N t copy suggest that regulatory factors may play a role at the level o f transcription, which may also contribute to the phenotype o f S M A disease.  U P S T R E A M R E G U L A T O R Y REGION fPROMOTERSI The fundamental dogma o f molecular biology is that D N A carrying the genetic information variable i n each individual produces R N A , which in turn produces proteins that presents the corresponding characteristics o f the individual (the phenotype). The process o f transcription, whereby an R N A product is produced from D N A , therefore  14  plays an essential role in the gene expression. In addition, the expression o f genes i n particular cell types is regulated by a number o f processes, including synthesis o f the primary R N A transcripts, posttranscriptional processing o f m R N A , m R N A degradation, protein synthesis (translation), posttranslational modification o f proteins, and protein degradation. However, much o f this regulation occurs at the level o f transcription and is mediated by regulatory proteins that either inhibit (repressors) or activate (enhancers) transcription from specific region o f a gene.  The promoter region is a D N A specific sequence that the R N A polymerase can bind to. The promoter region is normally located at the 5' end, upstream to a coding region o f the gene. This 5'-upstream regulatory region is essential for either basal or regulated gene expression. The regulation o f transcription initiation is therefore the regulation o f interaction o f R N A polymerase with its promoter. In prokaryotes such sequences are found immediately upstream o f the start site o f transcription, the sequences are not identical for all promoters, but certain nucleotides are found much more often than others at each position. These sequences are called consensus sequence which can be used for distinguishing a promoter region from a non-promoter region on D N A template. For most promoter in prokaryotes, comparative analysis o f promoter sequence has identified two consensus sequence elements located upstream around the - 1 0 and - 3 5 region respectively, which are A T rich sequence. A variety o f proteins called transcription factors bind to a sequence in and around a promoter and either activate transcription by facilitating R N A polymerase binding or repress transcription by blocking the binding activity.  15  In eukaryotic cells, the promoter region is more complex. The promoter elements include two parts: the core elements and the upstream promoter elements. The core elements include initiator element ( Y A Y T C Y Y Y ) and an A T rich sequence ( T A T A A A A ) called T A T A box, supporting basal transcription (Breathnach & Chambon, 1981). The T A T A boxes are commonly found about 25 to 30 bp before the transcription initiation site, used to assemble initiation complex composed by TFIID (Transcription Factor IID), T F I I A (Transcription Factor IIA), R N A polymerase II and other transcription factors. It plays an essential role i n accurately positioning the start site o f transcription (Breathnach & Chambon, 1981). Although T A T A boxes are relatively common, many genes have been found to be expressed without T A T A boxes (Weis & Reinberg, 1992). In these promoters, a sequence known as the initiator element, which is located over the start site of transcription itself appears to play a critical role in determining the initiation point and acts as a minimal promoter capable o f producing basal levels o f transcription (Weis & Reinberg, 1992).  A variety o f other short sequence elements that function in regulation o f a given promoter are often found within hundred base pairs from the transcription start site, usually called upstream promoter elements (UPE). Those elements dramatically increase the low activity o f the promoter itself. Two common elements are found between - 1 1 0 and - 4 0 region: the C C A A T ( G C C A A T ) boxes and G C boxes ( G G G C G G ) , bound by the C T F ( C C A A T transcription factor) and SP1 transcription factor respectively (Dynan & Tjian, 1985).  16  Additional regulatory sequence elements with more complex sequence structure lie i n thousands o f base pairs away from the core promoter elements. These elements are cisacting, orientation independent and position independent. Although they lack promoter activity themselves, these elements act by increasing the activity o f a given promoter and hence referred to as upstream activator sequence or enhancers (Muller et al., 1988). These sequence elements act preferentially on the nearest promoter, and are variable i n sequence. Each sequence is recognized by different transcription factors and therefore believed to be responsible to tissue specific expression. The transcription factors that bind to the upstream promoter elements interact with and facilitate assembly o f the R N A polymerase II initiation complex.  A t least three types o f transcription factors regulate transcription initiation by R N A polymerase: 1) specific factors which alter the specificity o f R N A polymerase for a given promoter or set o f promoters; 2) repressors which bind to a promoter, blocking access o f R N A polymerase to the promoter; and 3) activators which bind near promoter, enhancing the RNA-promoter interaction. Regulation by means o f a repressor protein that binds to D N A and blocks transcription is referred to as negative regulation. In contrast, regulation mediated by an activator is called positive regulation. Most eukaryotic promoters are positively regulated and initiation o f transcription is almost always dependent on the action o f one or, more often, several activator proteins. This may be due to the large size of the eukaryotic genome. Negative regulation appears to be less common, although many eukaryotic regulatory proteins can be either activators or repressors under some circumstances. To date, although a few transcription factors function have been studied,  17  the detailed molecular function o f most transcription factors remains unknown.  OBJECTIVES OF T H E PRESENT S T U D Y Since the S M A determining gene - S M N gene was identified and characterized in 1995, S M A research on revealing the genetic basis o f this devastating neuromuscular disorder has made substantial progress. One of the areas that have not been well studied is the promoter region o f S M N gene. We virtually know nothing about how the gene is controlled by its promoter and cis-acting elements in the upstream region. A s mentioned before, about 95% o f S M A patients have lost their S M N t copy therefore rely on the S M N c copy. Only 30% o f transcripts from the S M N c gene are full length, the patients therefore need more active transcription to compensate. One way is to have more copies of the S M N c gene, which has been implied by the correlation between copy number o f S M N c and phenotype. The other way that could compensate for the loss o f S M N t gene is to have a stronger promoter for the remaining S M N c gene, which has not been demonstrated in S M A patients. However, the fact that type II/III S M A patients with a converted S M N c at the original S M N t locus have milder phenotype compared to type I patients who may have the same copy number o f S M N c but do not have the conversion implies possible differences in promoter activity between the two genes. Understanding the promoter structure o f the S M N gene w i l l help to investigate this possibility and may further benefit to explore new avenues for the treatment o f this disease as new drugs may be developed to enhance the promoter activity for S M N c gene expression. A s a first step towards this goal, the present study was aimed at cloning and partially sequencing the 5' upstream regulatory region o f normal human S M N gene and further characterizing the  18  region using a luciferase reporter gene assay in both neuronal and non-neuronal cells.  19  MATERIALS AND METHODS 1) General chemicals and enzymes P  3 3  labeled d d N T P were purchased from Amersham (Oakville, Ont. Canada), and D N A -  modifying enzymes including restriction endonucleases were from Gibco B R L (Burlington, Ont., Canada), N e w England (Mississauga, Ont. Canada), and Pharmicia (Baie d'Urfe, Que. Canada). Fine chemicals were purchased from Sigma (Mississauge, Ont. Canada). C e l l culture mediums and transfection reagents were also purchased from Gibco B R L (Burlington, Ont., Canada).  2) Chromosome library screening Two primers (upstream: 5' G G G C G A G G C T C T G T C T C A A A 3 ' ; downstream: 5 ' C A G C A C C C T T C T T C C G G C C C 3 ' ) were designed according to the published sequence of S M N gene (Gurglen, et al. 1996) and used to generate a fragment o f 405 bp (from 267 to +138) from human genomic D N A by Polymerase Chain Reaction (PCR). This 32  fragment was subsequently used as the template to generate  P labeled probes with a  random primer labeling kit (Gibco B R L Burlington, Ont., Canada). E.coli (LE392) were infected with the phage Charon 2 1 A library (10,000 pfu, American Type Culture Collection, A T C C , Rockville, M D , U S A ) containing the human chromosome 5 E c o R I fragments and were plated on 150 m m dishes for screening with the above labeled probes. A positive clone harboring the 5' upstream region o f the S M N gene (4370 bp, from -3132 to +1238) was identified and purified more to obtain 100% positives by subsequent screening with the same probes.  20  3) Subcloning The clone obtained from the screening procedure was digested with the restriction endonuclease EcoRI. A 4.4kb S M N upstream fragment was subcloned into the plasmid vector p Z E r O - 1 . 1 (Invitrogen and Corporation, U S A ) named p S M N (Figure 4) for sequence characterization, specifically the region from -1210 to -565 (counting from the A T G translation start codon) using the primers S M N 1 and S M N 2 (Table 1). The primers were designed corresponding to different regions o f the promoter i n an anti-sense orientation (Table 1). The 4370 bp fragment was excised and subcloned from the p S M N using B a m H I and E c o R I restriction enzymes to generate two constructs, S M N a and S M N b (Figure 4). These constructs were eventually found to contain the S M N promoter regions from -3132 to -1580 and from -1580 to +1238, respectively, as these were used for further sequencing with the p Z E r O - l . l / M 1 3 universal reverse primer (Invitrogen Corporation,USA). Q I A G E N mini-preparation K i t (Mississauga, Ont. Canada) was used to purify the above plasmid D N A .  4) Sequencing The sequencing was performed with the Thermo Sequenase radiolabeled terminator cycle sequencing kit (Amersham Life Science, Inc., Oakville, Ont. Canada) as per manufacturer's instructions. Briefly, a set o f four termination reactions, each with a different specific labeled dideoxynucleotids (ddNTP) was produced by the thermal cycling program with perkin Elmer Thermal cycler 9600. The.sequencing reaction products were denatured at 95°C for 5 minutes and electrophoresed on a denaturing 6% acrylamide gel containing 8 M urea. The gels were subsequently transferred onto  21  Whatman blotting paper, dried for 30 min., and exposed to Scientific Imaging F i l m (Kodak, Rochester, N e w Y o r k U S A ) at room temperature for 12-24 hours.  5) Search for transcription factor binding sites Sequences o f the 5'-flanking region obtained from the above procedure and from the Genbank were analyzed for the presence o f the potential transcription factor binding sites using the Matlnspector Release 2.0 (http://www.gsf.de/cgi-bin/matsearch.pl) with a minimum core similarity o f 0.80 and a minimum matrix similarity o f 0.85. Other databases, such as T E S S , v.3.3 (http://www.cbil.upenn.edu/cgi-bin/tess/tess33) and T F S E R C H (http://www.pdapl.trc.rwcp.or.jp/research/db/TFSEARCH.html), were also searched for putative binding sites. Since the results varied between the different database searches, Matlnspector was used as the base o f analysis for the reason that it has been cited by published literature (Berger et al., 1998).  6) Reporter gene constructs A plasmid named p P C D N A 3 (Figure 5) containing the 4370 bp S M N gene fragment (3132 to +1238) was constructed using the p H S V 3 plasmid (5.4kb) construct which was generated previously in the lab. The latter construct was derived from the p c D N A 3 plasmid (Invitrogen Corporation, U S A ) with the following modifications: 1) Insertion o f H S V - 1 packaging sequence ("a" sequence) and a H S V - 1 replication origin (OriS); 2) Removal o f cytomegalovirus ( C M V ) promoter in the p c D N A / H S V 3 . Taking the advantage o f the Eco47 III restriction site at position +114 downstream from the translation start site and a Not I site in the poly linker o f the p P C D N A 3 , 3' to the S M N  22  gene (Figure 5), the +114 to +1238 region o f S M N gene was deleted from the p P C D N A 3 . The Luciferase reporter gene (2.8kb) isolated from the p G L 2 - Basic vector (Promega, Madison, W I , U S A ) was then inserted into the p P C D N A 3 downstream to +114. This construct (11.4kb) containing the - 3132 to +114bp fragment o f S M N gene was named LSH3132.  The first stage o f the isolation and identification o f the upstream o f S M N gene was focused on the segment from - 3132 to - 3 0 6 . Three constructs containing fragments o f - 410 to +114 (LSH1410), -899 to +114 (LSH899), or -306 to +114 (LSH306) (Figure 5) were made by sequential deletions in the upstream region using the restriction sites H i n d i , F o k l , and PstI, respectively (Figure 6 A ) .  To further analyze the sequence elements between the - 306 position and the translation start site, more deletion constructs were made. The - 306 to +114 fragment was transferred into the KpnI/XhoI sites o f the luciferase vector pGL2-basic vector (Promega, Madison, W I , U S A ) (LS306). Four additional constructs were generated by sequential deletions i n this region between the X h o I and B s t X I , Smal, A M I , and A p a l sites, respectively (Figure 6B). The resulting constructs contain the 5' upstream region o f - 1 5 7 to +114 (LS157), -67 to +114 (LS67), -46 to +114 (LS46) and - 2 8 to +114 (LS28), respectively, upstream o f luciferase reporter gene (Figure 5). A construct L S 7 4 was created by inserting a 7 oligonucleotides to L S 6 7 to recover the potential binding site o f neural specific transcription factor A P 2 (activator protein-2) (Figure 5).  23  L a c Z plasmid A similar construct H S V / L a c Z containing a L a c Z reporter gene under the control o f a human cytomegalovirus ( C M V ) immediate early gene promoter was utilized in the present study as an internal control to normalize the variations among transfections.  7) C e l l Culture and D N A transfection African green monkey kidney (Vero) cells were cultured at 37°C in a humidified atmosphere o f 95% air/5% CO2 in Dulbecco's M i n i m a l Essential M e d i u m ( D M E M , Gibco, B R L , Burlington, Ont., Canada), containing 10% fetal bovine serum, 2 m M L glutamine (Gibco B R L , Burlington, Ont., Canada), and 100 units / m l o f penicillin/streptomycin (Gibco B R L , Burlington, Ont., Canada) (complete medium). Human S H - S Y 5 Y neuroblastoma cells were kindly provided by Dr. Seong K i m (Department o f Medicine, U B C ) . The cell culture dishes (Corning, N Y , U S A ) were preincubated with ploy-L-lysine (O.lmg/ml, Sigma, Mississauga, Ont. Canada) for 30 m i n at room temperature followed by 2x15 min washing i n distilled water and air dried. The S H - S Y 5 Y cells were then cultured i n the poly-L-lysine coated dishes under the same condition as the Vero cells. The day before transfection, the cell cultures were split and grown in a penicillin/streptomycin-free D M E M medium in 60 m m culture dishes to reach 80%) confluent for Vero cells and 60% for the S Y 5 Y on the next day. Both cells were transfected with 3 ug D N A purified with Q I A G E N maxi-preparation kit (Mississauga,  Ont. Canada), using L i p o f e c t A M I N E P L U S T M Reagent (Gibco B R L , Burlington, Ont., Canada) in a serum- and antibiotics-free medium according to the manufacturer's instruction. Transfected cells were incubated at 37°C for 3 hours before the medium was  24  replaced by a fresh completed D M E M containing 1 0 % serum and 1 0 0 units/ml of penicillin/streptomycin. Two days after the transfection, the cells were harvested for reporter gene expression assays (see below). A n equal amount of the H S V / L a c Z plasmid D N A was co-transfected with the test promoter constructs in all experiments.  8. Cell Extract and Reporter Gene Assays The cells were washed twice with phosphate-buffered saline (PBS) and lysed in 4 0 0 LLI of  I X Reporter Lysis buffer (Promega, Madison, WI, U S A ) . Five microliters cell extract was mixed with 1 0 0 p i luciferase assay reagent (Promega, Madison, WI, U S A ) and the  luciferase activity was measured with a Lumat luminometer (Berthold, Bad Wildbad, Germany). (3- Galactosidase activity was measured using the L a c Z Assay System  (Promega, Madison, WI, U S A ) according to the manufacturer's instructions with a spectrophotometer ( U - 2 0 0 0 , Hitachi, Japan) at visible light absorbance of 4 2 0 nm.  Standard curves for both the Luciferase and L a c Z enzyme assays were established according to the manufactures' instructions to determine the linear range. A series of sample dilutions were performed to ensure that the results of measurements were in the linear range.  9. Immunocytochemistry For immunocytochemical studies, cells were fixed with 4 % paraformaldehyde for 1 0 min. at room temperature followed by a rinse in P B S , and then were incubated with an anti-SMN rabbit serum, a gift from Dr. J. Francis's Lab, at Harvard University, at 1:1000  25  dilution overnight at 4°C. Following 3 x 5 min wash, the cultures were subsequently incubated with a biotin-labeled anti-rabbit antibody (Vector, Burlingame, C A , U S A , 1:1000) for 1 hour at room temperature followed by 3 x 5min wash in P B S . The cultures were processed with the horseradish peroxidase-based avidin-biotin complex system (Vector, Burlingame, C A , U S A ) for 1 hour at room temperature, and the immunoreaction was detected with 0.01% 3',3'-diaminobenzidine and 0.01% H 0 with 3 minutes 2  2  reaction.  10. Data analysis Purity o f all plasmids used for transfection was ensured by gel electrophresis and spectrophotometry with an A260/280 ratio over 1.8. Levels o f luciferase activity were normalized by measuring the expression levels o f L a c Z gene and the data were expressed as ratios o f luciferase activity to beta-galactosidase activity for each sample. Each construct was trasfected on four individual culture dishes, and average ratios o f luciferase activity to L a c Z activity were calculated based on a minimum o f two independent experiments. Statistical analysis o f all the data in the present study was performed using student t-test and A N O V A with Statview 4.0 (Abacus Concepts Inc., Berkeley, C A , U S A ) on a Macintosh computer.  26  RESULTS 1) Sequence o f 5' upstream region o f S M N gene. A 4370 bp D N A fragment containing the 5' flanking region and a part o f coding region o f S M N gene was isolated from chromosome 5 library and subcloned into p Z E r O plasmid vector ( p S M N ) by Dr. Shiv Prasad (Dept. o f ophthalmology, U B C ) . The primers S M N 1 , S M N 2 , and a universal reverse primer (RP) for pZErO-1.1 vector (see Table 1, p 18) were used to determine a total of 1385 bp sequence (Appendix I) in the 5' upstream region o f S M N gene (Figure 7).  B L A S T (http://www.ncbi.nlm.nih.gov/BLAST/) similarity search i n the Genbank showed that a fragment o f 2550 nucleotides was lacking at the position o f - 1 5 3 0 in the cloned 5'flanking region o f S M N gene in the p S M N construct. In addition, there were 17 nucleotides mismatches in the sequence from -565 to -1950 as shown i n Table 2.  2) Potential binding sites for transcription factors (Table 3) The search o f the potential transcription binding sites for sequence from -1530 to A T G showed that proximal sequence o f the 5' flanking region o f the S M N did not contain T A T A box or G C boxes that are usually required for transcription initiation. However, a putative C A A T box (gataaCCACtcg) was found at -146, which may be an important element for the initiation o f transcription. The 5'flanking region contained numerous putative response elements. Possible binding domains with complete sequence matches were activator protein-1 (AP-1) at - 5 7 (agTGACgactt), at - 9 9 0 (ggTGACagagc), at -1420 (gtTGACcaagt); activator protein-2 (AP-2) at -16 (caCCCGcgggtt), at - 6 7  27  ( c C C C G g g c ) ; activator protein-4 (AP-4) at -400 (ctCAGCtatt), at -1024 (ctCAGCtcac); C R E B a t - 5 8 (agTGACgacttc), at (-690 tcTGACgacaga); basic helix-loop-helix ( b H L H ) transcription factors M y o D / E 4 7 at -927 (caCACCtgta, -1225 caCACCtgta); and N F - 1 at -1164 (cctTGGCttcatatagta). In addition, there were several putative binding sites for P O U domain factors, Oct-1 at -858 (cacaatATGCtccaa), at -910 (cattttgggATGCc), and B R N - 2 (Brain-2) at -206 (gaaatgaaAAATatac), at-1267 (tagatgctTAATaaag). The distribution o f putative binding sites i n the promoter o f S M N gene appeared clustered within a number o f sequenced regions (Fig.9), including from —40 to - 8 0 , -140 to - 1 5 0 , 200 to - 2 5 0 , -450 to - 5 1 0 , -570 to - 5 9 0 , -910 to - 9 3 0 , -1230 to -1240, and -1386 to -1420.  3) Promoter activity o f the 5' flanking region o f S M N gene in transfection assays To characterize the promoter region and identify the important regulatory elements o f S M N gene, a serial deletion strategy was applied by constructing recombinant plasmids containing different 5'-deletions o f upstream region fused to luciferase reporter gene. Sequences derived from the 5'-flanking region were tested for their effects on promoter activity by transient expression in neuroblastoma ( S Y 5 Y ) cells and African green monkey kidney (Vero) cells. To normalize the differences i n transfection efficiency, a H S V / L a c Z reporter plasmid was co-transfected, and the relative promoter activity was calibrated as luciferase activity per unit o f lacZ activity.  Analysis o f the progressive expression indicated that the plasmid L S H 3 1 3 2 , which contained the S M N promoter sequence from —3132 to +114 bp, had a strong luciferase  28  activity in both S Y 5 Y and Vero cells (2568±159.9 fold for S Y 5 Y and 126.7±25.3 fold for Vero, respectively, over background expression levels). Figures 10 and 11 summarize the effects o f deletions o f 5' flanking region from -3132 to -28 luciferase activity in S Y 5 Y cells. The data showed that there was no significant difference in the luciferase activity comparing the constructs containing 5' upstream regions of-3132 to +114 bp, to that o f - 1 4 1 0 to +114 bp (LSH1410, p=0.389), or to that o f - 8 9 9 to +114 bp (LSH899, p=0.241). The luciferase activity was increased by 30% when a deletion was made from -3132 to - 3 0 6 bp (LSH306, p=0.0181). The highest luciferase activity was observed i n the construct LS157 with upstream region o f - 1 5 7 to +114 (38485±2022 fold over the background), which was slightly higher than that in the LS306 construct (46.8%, P O . 0 0 8 ) . Further deletion from - 1 5 7 to - 6 7 bp (LS67) resulted in a 76-fold decrease o f the luciferase activity (pO.OOOl). Another 40-fold decrease (pO.OOOl) was found when the deletion was extended from - 6 7 to - 4 6 bp, which meant a deletion o f 111 base pairs from - 1 5 7 to - 4 6 caused a total o f 2750-fold decrease in the promoter activity (pO.OOOl). The construct L S 4 6 expressed luciferase activity that was 13-fold higher than the promoterless construct (p= 0.02). Further deletion from —46 to - 2 8 bp (LS28) increased the levels o f expression o f luciferase reporter gene by 84% at the statistical significant level o f p= 0.02.  The pattern o f the luciferase activity affected by serial deletions in Vero cells was similar to that in S Y 5 Y cells (Figure 12 and 13). However, the expression levels were different between S Y 5 Y and Vero cells with an elongation o f the promoter region towards 5' upstream (Figure 14). The data showed that there was no significant difference in the  29  expression levels o f luciferase reporter gene between the two types o f cells transfected with the construct containing the 5' flanking region from -28 to + 114 bp. Interestingly, the significant difference in the promoter activity between the two cell types appeared when the 5'-flanking region further extended to more upstream regions. The luciferase activity o f construct containing -157 to +114 was 5-fold higher in S Y 5 Y cells than that in Vero cells (pO.OOOl), and it was 23-fold higher when extended to - 1410 bp (pO.OOOl). A putative A P 2 binding site was located between -71 and - 6 2 , which was partially deleted in construct L S 6 7 . To test the function o f this neural specific transcription factor (Mitchell et al., 1991; Schorle et al., 1996) in the expression o f luciferase gene in both S Y 5 Y and Vero cells, a construct (LS74) based on L S 6 7 but with extra 7 bp ( A A G C C C C ) to recover the putative domain for A P - 2 site was generated and transfected into both cell lines. Comparing to L S 6 7 , in which the putative A P - 2 site was lost, this construct resulted i n a 50% increase (p<0.000l) in luciferase activity for S Y 5 Y cells and a 60% increase (p=0.002) for Vero cells (Figure 11 and 13).  4) Immunocytochemistry To confirm that the S Y 5 Y cells and Vero cells contain adequate levels o f trans-acting factors to support the activation o f the chimeric S M N promoter-reporter gene constructs, we examined the endogenous S M N expression in those two cell lines. Immunocytochemistry labeling using a polyclonal antibody for S M N protein showed high levels o f expression o f S M N in S Y 5 Y cells (Figure 15). The S M N immunoreaction products appeared granulous and distributed in both cytoplasm and nuclei for most S Y 5 Y cells (Figure 15a). The Vero cells expressed moderate levels o f endogenous S M N (Figure  30  16a and 16b), but the distribution o f S M N protein varied from cell to cell. In most Vero cells, the S M N appeared in a few highly localized regions o f cytoplasm and the nuclei were negative to the labeling (Figure 16a), while in cells that seemed undergoing mitosis, the S M N proteins were concentrated in the nuclei and the cytoplasm was not labeled (Figure 16b).  31  DISCUSSION Survival motor neuron ( S M N ) gene has two duplicated copies named S M N t and S M N c , which can be distinguished only by the differences o f 5 nucleotides (Chen et al, 1998; Lefebvre et al, 1995). S M N t is SMA-determining gene (Cobben et al, 1995; DiDonato et al, 1997; Hahnen et al, 1995; Lefebvre et al, 1995; Rajcan et al, 1996; Rodrigues et al, 1995; van der Steeg et al, 1996; Velasco et al, 1996) and S M N c may be related to the S M A phenotype (Campbell et al, 1997; DiDonato et al, 1997; M c A n d r e w et al, 1997). The 5' flanking regions o f both S M N t and S M N c gene are almost identical except 13 nucleotides differences (personal communication, A . Burghes). To identify the functional domains i n the regulatory region o f the S M N gene, a 4370 bp E c o R I D N A fragment containing the 5' flanking region o f S M N gene was isolated from human chromosome 5 library and 3132 bp o f upstream region was subcloned into the p H S V 3 vector upstream o f the luciferase reporter gene. Due to the extreme homology between the S M N t and S M N c genes i n the sequences o f their promoter region and due to the approach by which the 4370 bp fragment was cloned, it was not possible to infer whether the 3132 upstream region in the p H S V 3 was derived from the S M N t gene or the S M N c gene.  A total o f 1385 bp sequence (Figure 7) o f the 3132 bp fragment was determined i n the present study and compared with the published 5' flanking region sequences o f S M N t and S M N c in the Genbank. The sequence showed better identity to the promoter sequence o f S M N c than that o f S M N t gene (Table 2). Furthermore, based on the same sequence i n the Genbank, a fragment o f 2550 nucleotides at -1530 bp from the translation initiation site  32  was found to be absent in the cloned E c o R l / E c o R l D N A fragment isolated from the Chromosome 5 library (Figure 8). Absence of the 2550 bp sequence in this construct was confirmed by digestions o f two restriction enzymes that are unique for that deleted region. Although the possibility that the upstream region o f S M N gene cloned from the chromosome 5 library indeed did not contain the 2550 bp fragment could not be excluded, it is still likely that this fragment o f D N A was deleted by E.coli during the cloning procedure as similar deletions were not uncommon in this type o f procedure. P C R screening o f the human genomic D N A from different sources based on the sequences around the missing region w i l l be helpful in confirming the above explanation. The mismatches o f 17 base pairs in the rest o f 5'- flanking region were likely due to polymorphism.  In order to determine the basic promoter region and putative regulatory elements, serial deletion constructs containing various lengths o f 5'-fianking region o f the S M N gene were constructed and transfected into S Y 5 Y cells. The deletions from -3132 to -1410, and to -899, had little effect on luciferase activity i n S Y 5 Y cells, suggesting that this region did not have either positive or negative regulatory function on the expression o f S M N gene. However, because o f the missing 2550 bp sequence at the -1530 bp, the promoter activity tested with the construct LHS3132 (-3132 to +114) might not truly reflect the entire upstream regulatory region. It remains to be studied whether the region from -1530 to -4080 i n the S M N promoter contains any regulatory elements.  The promoter activity o f further deletion from -899 to - 306 bp resulted i n a significant  33  increase in promoter activity, suggesting a possibility o f the presence o f the negative regulator elements in this region. A putative binding domain for transcription repressor Delta E F I was found at -351. Delta E F I (Sekido et al, 1997; Sekido et al, 1996; Takagi et al, 1998) has been found to counteract basic helix-loop-helix ( b H L H ) activators through binding site competition and fulfill the conditions o f the E 2 box repressor (Sekido et al, 1994). Furthermore, sequence domain for M Z F 1 , a transcription factor which may repress transcription in non-hematopoietic cells (Hui et al, 1995; Morris et al, 1994; Morris et al, 1995; Thiele et al, 1998) was found at four position between 899 to -306. The construct L S I 5 7 with a further deletion from -306 to - 1 5 7 displayed the highest promoter activity. This region thus might be important for the induction o f a high transcription rate in response to the binding by various transcription factors.  A further deletion o f 90 bp from -157 to - 67bp, significantly reduced the promoter activity by 76-fold, indicating that a positive regulator element may be present i n this region. Coincidentally, putative binding sites o f various transcription factors such as G A T A 1 , L M 0 2 C O M , IK-2, C E B P B , G A T A c , TH1E47, N Y F , C A A T , L Y F 1 , AP2, B A R B I E box were clustered in this region (Figure 9 and Table 3). Another 21 bp deletion (from -67 to -46bp) further reduced the promoter activity by 40-fold, suggesting that this region might also positively regulate the S M N gene transcription. A number o f potential transcription binding sites, such as A P - 1 , C R E B , A T F , N R F 2 , C E T S I P 5 4 , T C F 1 1 , are clustered i n this region o f 21 bp, suggesting the importance o f this D N A fragment in the transcriptional activity o f the S M N gene.  34  Transcription o f a given gene depends upon the integrity o f the upstream regulatory region and the initiator element near the proximal region including some part o f the 5' untranslated region. The upstream transcription factors which can moderate the cell specific expression have been shown to interact with the T A T A - b i n d i n g protein T F I I D (Sawadogo & Roeder, 1985a; Sawadogo & Roeder, 1985b) and with the initiator binding factor TFII-I (Roy et al., 1991). Sequence analysis showed that there was no conventional T A T A box element near the A T G start codon, but its 5' untranslated sequence contained a pyrimidine-rich region (-28 to -10), which might be the initiator element for the transcription o f the S M N gene (Roy et al, 1991). The fact that the -28 to +114 5' flanking region did have a basic promoter activity seemed to support the view that an initiator element is present in the untranslated region o f S M N gene, and this element is required for transcription initiation. It is worthwhile pointing out that the m R N A o f the S M N gene starts at least 33 bp upstream (-33) to the A T G translation start codon (Burglen et al, 1996; Chen et al, 1998). Interestingly, the -28 to +114 region alone appeared to have some promoter activity. Thus, the basic promoter activity seemed to be present i n the region after the messenger R N A transcription initiation site, suggesting that a 5' untranslated region o f S M N gene might be important for promoter activity, and might play a role in the initiation o f transcription o f the S M N gene. To further confirm it, comparison o f the promoter activity o f the -306 to +114 region with and without the -28 to + 114 region should be helpful. O n the other hand, it is also necessary to exclude the possibility that the 34 bp o f introns in the -28/+114 fragment may play a role for the promoter activity.  35  It has been well known that both S M N t and S M N c gene copies are expressed widely i n human tissues, and the expression level is highest in spinal cord and liver (Battaglia et al, 1997; Lefebvre et al, 1997). To investigate the expression o f the S M N gene i n both neuronal and non-neuronal cells, the African green monkey kidney cells (Vero) were also used for reporter gene expression assay with serial deletion constructs o f S M N 5' flanking region. The results showed that the luciferase reporter gene was also expressed at high levels i n Vero cells, and the pattern o f the promoter activities resulted from the serial deletions was similar to that in S Y 5 Y cells. These results suggested that there might be no major difference in the regulatory mechanism for the promoter activity o f S M N gene in neuronal and non-neuronal cells in the present experiment settings. However, despite the similarity i n the regulatory pattern of the sequence elements, the promoter activity o f S M N was not necessarily the same between neuronal cells and non-neuronal cells. Expression levels o f luciferase were almost the same in S Y 5 Y and Vero cells for the constructs o f L S 2 8 . But it was 5-fold higher i n S Y 5 Y cells than that i n Vero cells when the 5' flanking region extended to -157 bp. Further extension to -1410 showed greater difference between neuronal cells and non-neuronal cells. These results implied that the basic promoter regulatory mechanism for transcription initiation might be same for neuronal and non-neuronal cells. However, some additional neural specific enhancing factor binding sites might be present i n the more upstream region, resulting in higher levels o f promoter activity in neuronal cells. Sequence analysis for potential transcription factor binding sites revealed that some domains for tissue-specific transcription factors in -1410 to -28 region. A P O U domain transcription factor Brain-2 (BRN-2) at - 2 0 6 and 1267 (Dawson et al, 1996; Fujii & Hamada, 1993; Hagino et al, 1997; Hagino et al,  36  1998; Josephson et al, 1998; Shimazaki et al, 1999), which is mainly expressed i n the output neurons may play a role in the development o f these output neurons (Hagino et al., 1999); The M y o D binding domain at -927 and -1225, is a muscle-specific regulatoy factor (Dias et al., 1994). The transcription factor A P - 2 has been shown to play an important role in the expression of neuronal genes (Mitchell et al., 1991; Schorle et al., 1996). A potential A P - 2 binding site was located between -71 to - 6 2 . To investigate the possible role o f this domain in the S M N gene, promoter activity between the L S 7 4 and L S 67 was compared, since only the former contained the promoter region that was 7 bp longer than the latter to retain the A P - 2 site. Although the luciferase activity o f L S 7 4 was slightly higher than that o f L S 6 7 by 50-60% in both S Y 5 Y and Vero cells, the sequence domain might not have the neural cell-specific function in S M N gene since the effects were similar i n both neuronal and non-neuronal cells.  95% o f S M A patients who lack their S M N t copy therefore rely on the S M N c (Cobben et al, 1995; DiDonato et al, 1997; Hahnen et al, 1995; Lefebvre et al, 1995; Rajcan et al, 1996; Rodrigues et al, 1995; van der Steeg et al, 1996; Velasco et al, 1996). Increased S M N c copy number as a result of gene conversion from S M N t to S M N c are related to the milder phenotype (Campbell et al, 1997; DiDonato et al, 1997; M c A n d r e w et al, 1997). It has been reported that the converted S M N c at the original S M N t locus is different from the original S M N c copy, and the former can produce more functional S M N products, leading to the milder phenotypes (type II/III) (Coovert et al, 1997). This fact implies possible difference in promoter activity between the S M N t and S M N c gene copies. However, no significant difference between the S M N t and S M N c copies has been found  37  in D N A sequence at the 5' flanking upstream regions as far as 6000 bp upstream. Expression o f the reporter gene driven by the promoter from S M N t or S M N c also showed no difference i n C O S - 7 cell line (personal communication, A . Burghes). Thus, difference in the expression levels o f S M N from the two copies in S M A patients may not be simply due to the sequence difference in their promoter regions. However, the role o f promoter activity in the above pathological phenomena o f S M A still can not be ruled out. This is based on some o f the basic findings from the present study: 1) A small change in length of the sequence o f the proximal 5' flanking region o f S M N gene could result i n a dramatic difference i n the promoter activity; and 2) promoter activity o f S M N gene varied in different cell types. The first finding suggested that the proximal region was critical for the expression o f the S M N gene and is therefore potentially vulnerable for any kinds o f alteration, such as polymorphism, which result in a few base pair changes randomly along the genome, including the promoter regions. Polymorphism affecting the promoter activity o f S M N gene has been noticed previously (Parsons et al, 1998). While polymorphism that reduces the promoter activity may not cause any problem i n normal individuals due to multiple copies o f S M N gene and high levels o f expression from S M N t . It may be critical for patients who lack one S M N t copy, since the functional full length m R N A only composes 30% o f total transcripts generated from the S M N c copy (Gennarelli et al., 1995; Lefebvre et al, 1995; Parsons et al, 1996). Given the fact that the S M N c copy might be evolutionarily new comparing to S M N t locus, higher frequency o f polymorphism may occur in this region, which means that the promoter activity o f S M N c may be more variable than that o f S M N t among individuals. To verify whether this is true, sequence analysis among both normal population and patients should be  38  conducted and the effect o f sequence alteration due to polymorphism should be studied. The second finding suggested that the promoter activity was higher in neuronal cells than Vero cells. This was likely due to binding o f certain transcription factors that only exist or highly expressed i n neuronal cells. If the above polymorphism alters the binding affinity o f the D N A sequence to these potential neuron specific transcription factors, lower expression o f S M N gene may be specifically apparent in neuronal cells. O n the other hand, lacking the neuronal specific tanscription factor in motor neurons secondary to the lack o f S M N t gene in S M A patients can also reduce the promoter activity i n neurons. To verify this hypothesis, it is necessary to identify the transcription factors that regulate the S M N promoter activity and their binding domains in the upstream regulatory region i n both neuronal cells and non-neuronal cells.  39  SUMMARY In conclusion, the 5'-upstream regulatory region o f the S M N c gene from human chromosome 5q library was functionally characterized. This study examined the functional domains o f a 3246bp genomic D N A fragment, which contains 3132 5' flanking region, first exon and 34bp first intron o f S M N gene. To identify the gene promoter sequence and the expression level in neural and non-neural cells, transfection of the S Y 5 Y cells and Vero cells were performed with a series o f 5' deletion reporter gene constructs, that extended upstream to - 3132bp relative to +1(ATG). The luciferase activity analysis demonstrated that the -157/+114 construct had the strongest promoter activity i n both cell lines, the -67/+114 and -74/+114 constructs showed a moderate activity; whereas -28/+114 and -46/+114 constructs showed a basic promoter activity. The upstream 5' flanking region (-899/-306) displayed a negative regulatory effect on promoter activity. Within the proximal region o f S M N gene promoter, two blocks o f the sequence, 83bp from -157 to -74 and 21bp from -67 to -46 acted as positive regulators for promoter activity. The region o f -28 to +114 possessed minimal essential promoter activity. Given the fact that the transcription initiation site lies at least -34 bp upstream o f the A T G , the basic promoter activity therefore was possibly located in the 5' untranslated region. A l l these data suggested that the transcription o f S M N gene is tightly regulated in either neural cells or non-neural cells. Although the 5' untranslated region constituted the basic promoter activity, S M N gene transcription may be greatly influenced by regulatory factors such as C A A T , A P I , A P 2 , C R E B . A n y mutations i n the -157/+114 region may dramatically affect the transcription o f S M N gene. Comparison o f the promoter activity of S M N between neural and non-neural cell lines revealed the higher expression o f  40  luciferase reporter gene in neural cells when the promoter region extended to - 7 4 suggesting the presence o f possible domains for the neuronal specific enhancers i n 3132 region.  41  SIGNIFICANCE Promoter function o f S M N gene has been recognized as an important aspect for understanding the pathology o f the disease beside the function o f its proteins. Given the fact that little is known about how the genes is controlled by its promoter and cis-acting elements in the upstream region, our results may provide the information that is potentially important regarding the pathogenesis o f S M A disease. Furthermore, understanding the regulatory mechanisms o f the S M N gene expression may lead to developing new strategies for the treatment o f S M A , such as through up-regulating the S M N promoter activity to increase the expression levels o f the gene in patients who are otherwise lacking the efficient transcription o f S M N gene.  42  FUTURE INVESTIGATIONS Based on the preliminary results, the future studies should be focused on following aims: 1) To verify the missing region o f -4080 to -1530 In order to exclude the possibility that the missing region in cloned construct was not an artifact, P C R and Southern blotting w i l l be utilized to screen human genomic D N A from deferent sources. 2) To investigate the function o f the missing fragment (-4080 to -1530) The above fragment w i l l be inserted back to the promoter-reporter gene construct and the promoter activity w i l l be compared to the one with the deletion in both neuronal and nonneuronal cells. 3) To identify the essential promoter region The preliminary results o f primer extension on the S M N gene showed that the transcription initiate site may located in the region more than hundred bases upstream to the translation start site. It is therefore necessary to verify that the region between - 1 5 7 to +114, which displayed the highest expression levels o f reporter gene is essential for the promoter activity. 4) To confirm the subcellular distribution o f S M N protein i n human non-neuronal cells The immunocytochemistry results for S M N . protein showed difference in subcellular distribution o f the S M N protein between the Vero cells and S Y 5 Y neuroblastoma cells. To further confirm this observation, human non-neuronal cells such as glioma cells and fibroblastoma cells w i l l be used.  43  Fig 1. Schematic illustration o f 5 q l 3 region The two reverse duplicates o f 500kb elements i n 5 q l 3 region are shown.  Telomeric  Centromeric  p44c  NAIP  C272 S M N t  SMNCC272  44  NAIP(5)  p44t  Fig.2, Structure o f S M N gene The S M N gene contains 9 exons (black boxes) and 8 introns.  5'  i  1  2a  2b 3 4 5 6  1  11111  45  7  8  1 I  3'  Fig.3, Different scenarios o f S M N gene arrangement i n normal individuals and S M A patients. Note that the 3'-end o f the S M N t has been replaced by the 3' region o f the S M N c gene in the case o f convertion. S M N c ' , converted S M N c .  SMNC C272 5'  Normal  C272  SMNt  3'  5'  C272  NAIP5  SMNt  5'  NAIP5  3'  V/Deletion  SMNc  C272  3'  5'  C272 SMNc' 5'  Convertion  S M N c C272  3'  5'  46  NAIP5  3'  C272 SMNc' 5'  NAIP5  3'  Fig. 4, Diagram o f subcloning procedure for sequencing. Plasmid p S M N contained the E c o R 1(E) / E c o R 1(E) fragment o f the S M N gene from 3132 to +1238. Nucleotides -1210 to -990 and -990 to -565 were sequenced in the p S M N using primers S M N 1 and S M N 2 , respectively. The E c o R l fragment was digested with B a m H l ( B ) and subcloned into two plasmids ( p S M N a and p S M N b ) for sequencing nucleotides from -1950 to -1580 in p S M N a and from -1580 to -1210 in p S M N b using the universal reverse primer. The arrows point to sequencing orientations.  47  Fig.5 Cloning procedure o f reporter gene constructs. Cloned fragment (-3132 to +1238) was subcloned to plasmid p P C D N A 3 and the region from +115 to +1238 was replaced with a luciferase gene subsequently to generate L S H 3 1 3 2 followed by a series o f deletions. Note that the L S H series and L S series are in different plasmid backbones (see Fig.6).  48  Fig.6 The two basic reporter gene constructs. A , the construct containing the 5' flanking region o f -3132 to +114; B , the construct containing the region of -306 to +114. B y digestion with the restriction enzymes as marked, the constructs L S H 1 4 1 0 , L S H 8 9 9 and L S H 3 0 6 were deducted from L S H 3 1 3 2 , and the constructs L S I 5 7 , L S 6 7 , L S 4 6 , and L S 2 8 were deducted from LS306 (see Fig.5). The L S H series are based on plasmid p C D N A 3 with a H S V - 1 packaging sequence and OriS; the L S series are based on plasmid p G L - 2 basic.  49  Fig.7, Diagram o f 5' upstream region o f S M N gene. Fragments that were investigated in the present study are showed. The fragments o f -3132 to +1238 was.cloned, -3132 to +114 was tested for promoter activity and - 1 9 5 0 to -565 was sequenced.  5' upstream region of S M N gene -3132 5'  -1950 i  -990  -1580  I  I  RP  bp  1385 sequenced Tested region Cloned region  50  SMN2  -565  ATG+114 +1238 '3'  SMN1  Fig.8, A comparison between the sequences generated from the present study and i n the Genbank.  SEQUENCE IN DATABASE 5' -4500  -4080  -1950  -1531  -1530  _ 65 3'  -1530  -565  5  SEQUENCE OF pSMN 5  51  3'  Fig. 9, Distribution o f potential binding sites for transcription factors in the 5'-upstream region o f S M N gene.  Distribution of putative binding sites for transcription factors in the 5'flanking region of SMN gene 27,43,26,7,8,  "U  1.5.9.14,15,16.  6.7.8 2,3,45 \ A 19.10.11  111 -1500  -.5.-4.1516 „ 21 1213 I 9 717 i 19 910 t V »  j ,111111  l l l l l Ml  VV* * '*3?1*  28,29,30  4  III I  -1400 -1300 -1200 -1100 -1000 -900  25 I 9,10 \  I II -800  T 4,5,10%  j l 11  -700  I 32,34,36  3  7  2  1  1,9,10  W'134.5,42, ^„  1111, HI I I 1 , PHI  -600 -500  Note: The numbers represent different transcription factors, see Table 3.  52  l^ifl,  33,34,35  -400  -300  A n  X  '  3 8  \V  \ M  1  l-^lll  -200  -100  9  L //  2  5  II 0  Fig. 10 Structure and activity o f S M N promoter (-3132/ -306) analyzed in S Y 5 Y neuroblastoma cells. Promoter activity is expressed in ratios o f a test construct over the background level after being normalized with levels o f beta-galactosidase (see text p.28-30). Note that expression o f reporter L S H 3 0 6 is significantly higher than L S H 3 1 3 2 .  -1,410 -3,132 0  1000  2000  3000  Promoter activity  53  4000  F i g . l 1, Structure and activity o f S M N promoter (-306/-28) analyzed in S Y 5 Y neuroblastoma cells. The promoter activity is expressed in logarithm o f the ratios o f a test construct over the background level after being normalized with levels o f beta-galactosidase (see text p.2830).  -306  I 0  '  1  1  '  1  2  >  1  •  3  Promoter activity (Log)  54  1  4  1  1  5  Fig. 12, Structure and activity o f S M N promoter (-3132/ -306) analyzed in Vero cells. Promoter activity is expressed in ratios o f a test construct over the background level after being normalized with levels o f beta-galactosidase (see text p29-30). Note that expression o f reporter L S H 3 0 6 is significantly higher than L S H 3 1 3 2 .  I LSH306  -1,410 -3,132  0  100  200  Promoter activity  55  300  Fig. 13 Structure and activity o f S M N promoter (-306/-28) analyzed in Vero cells. The promoter activity is expressed in logarithm o f the ratios o f a test construct over the background level after being normalized with levels o f beta-galactosidase (see text p.2930).  56  Fig. 14 Difference in expression levels o f luciferase driven by S M N promoters containing various upstream regions i n neuroblastoma cell line S Y 5 Y and kidney cell line Vero. The data are expressed as ratios o f average promoter activity i n S Y 5 Y to that i n Vero cells (the activity in Vero cells is set as 1 for any given construct). It is evident that the ratio increases with the extension o f promoter sequences towards the 5' upstream regions, suggesting the promoter becomes more neuron specific.  25  •  SY5Y CELLS  W  VERO CELLS  I  0 4-J -1410  -157  -67  57  -28  Fig. 15 Expression of S M N in SY5Y cells. a) Specific staining o f the antibody for S M N is present in both the cytoplasm and the nuclei; b) The control sample shows negative immunoreaction when the primary antibody was omitted in the procedure.  58  Fig. 16 Expression of SMN protein in Vero cells. a) Immunoreactive products for the antibody against SMN were concentrated in certain regions of cytoplasm in most of cells while the nuclei were not stained; b) SMN immunoreactivity was concentrated in the nuclear region of the cells that were under mitosis, c) Negative control sample as 15b). a)  b)  c)  59  T A B L E 1, Oligonucleotides primers used to sequence the 5'-flanking region o f S M N c gene.  OLIGONUCLEOTIDE  POSITION  SEQUENCE  SMN1  -565  5' A C A A A C A A G G A A G A C A A A C  SMN2  -990  5' - C T G G A A T G C A G T G G C G T G A T  R P (Reverse pZEro-1.1 primer)  60  T A B L E 2. Mismatched nucleotides. Numbers in the bracket are sequence positions o f S M N c gene in the Genbank. The discrepancy in positions was due to the lacking region i n the cloned fragment in p S M N (see Fig.8).  Position  Sequence of S M N c in G e n b a n k  pSMN sequence  -1091 -1099 -1131 -1157 -1158 -1196 -1358 -1535 -1545 -1552 -1553 -1647 -1652 -1695 -1850 -1915 -1932  G  / / C C A A T (-4085) C (-4095) A (-4102) / (-4103) T(-4197) T (-4202) T (-4245) C (-4400) T(-4415) A (-4432)  61  T G C G G  C T G G A C G C  T A B L E 3, Potential binding sites for transcription factors.  1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36. 37 38 39 40 41 42 43 44 45 46 47 48  Transcription factors DELTAEF1 XFD2 HFH1 GATA1 LM02COM NKX25 AP1FJ API IK2 MZF1 STAT CEBPB BRN2 E47 MYOD GFI1 RORA1 NF1 S8 PADS AP4 TCF11MAFG OCT1 LYF1 AH H A R M  ATF CREB HFH8 HNF3B HFH3 HFH2 NFAT TATA FREAC7 CDPCR3HD IK1 RFX1 GKLF SRY CETSIP54 NRF2 GATAC TCF11 TH1E47 NFY CAAT AP2 BARBIE  -157 +34  - 1530 -157 -1506,-1226,-938,-928,-351 -1492 -1491 -1486,-1387,-1386,-887,-635,-496 -1484,-1384,-1226,-928,-885,-633,-494  -151,-150 -148  -1421 -1420,-1181,-990 -1420,-990 -1409,-1346,-1218,1084,-1043,-920, -908,-768,-736,-504,-348,-230,  -57 -57 -83,-106,-46  -1397,-1346,-1070,-643,-510,-504,-361 -1346 -121  -1281 -1267,-206 -1228,-930 -1225,-927 -1224,-1090,-926 -1184 -1164  >  -1120 -1101,-479 -1024,-400 -994 -910,-858 -907,-767 -798 -691  -77 -29 -59 -58,-57,  -690 -663,-250,-246 -663,-250,-248,-223 -663,-591,-577,-250,-246 -662,-249,-245 -583,-518,-229,-224 -574 -572,-501 -562 -504 -458  -44,-43  -237 -861 ,-664,-660,-251 ,-247,-243  -62 -62 -147 -52 -81 -144 -146 -16,-71 -135  62  REFERENCES Battaglia, G . , Princivalle, A . , Forti, F., Lizier, C . & Zeviani, M . (1997). Expression o f the S M N gene, the spinal muscular atrophy determining gene, in the mammalian central nervous system. Hum Mol Genet 6(11), 1961-71. Bennett, A . (1883). O n chronic atrophic spinal paralysis in children. Brain 6, 289-301. Berger, P., K o z l o v , S., Krueger, S. & Sonderegger, P. (1998). Strcture o f the mouse gene for the serine portease inhibitor neuroserpin (PI 12). Gene 214, 25-33. Brahe, C . & Bertini, E . (1996). Spinal muscular atrophies: recent insights and impact on molecular diagnosis. J Mol Med 74(10), 555-62. Brahe, C , Clermont, O., Zappata, S., Tiziano, F., M e l k i , J. & N e r i , G . (1996). Frameshift mutation in the survival motor neuron gene in a severe case o f S M A type I. Hum Mol Genet 5(12), 1971-6. . Breathnach, R. & Chambon, P. (1981). Organization and expression o f eucaryotic split genes coding for proteins. Annu Rev Biochem 50(349), 349-83. Brzustowicz, L . M . , Lehner, T., Castilla, L . H . , Penchaszadeh, G . K . , Wilhelmsen, K . C , Daniels, R., Davies, K . E . , Leppert, M . , Ziter, F., & Wood, D . (1990). Genetic mapping o f chronic childhood-onset spinal muscular atrophy to chromosome 5 q l 1.2-13.3. Nature 344(6266), 540-1. Burghes, A . (1997). When is a deletion not a deletion? When it is converted. Am.J. Hum.Genet. 61, 9-15. Burghes, A . H . , Ingraham, S. E . , Kote, J. Z . , Rosenfeld, S., Herta, N . , Nadkarni, N . , DiDonato, C . J., Carpten, J., Hurko, O., & Florence, J. (1994). Linkage mapping o f the spinal muscular atrophy gene. Hum Genet 93(3), 305-12. Burglen, L . , Lefebvre, S., Clermont, O., Burlet, P., Viollet, L . , Cruaud, C , Munnich, A . & M e l k i , J. (1996). Structure and organization o f the human survival motor neurone ( S M N ) gene. Genomics 32(3), 479-82. Burglen, L . , Seroz, T., M i n i o u , P., Lefebvre, S., Burlet, P., Munnich, A . , Pequignot, E . V . , Egly, J. M . & M e l k i , J. (1997). The gene encoding p44, a subunit o f the transcription factor T F I I H , is involved in large-scale deletions associated with Werdnig-Hoffmann disease. Am J Hum Genet 60(1), 72-9. Burlet, P., Burglen, L . , Clermont, O., Lefebvre, S., Viollet, L . , Munnich, A . & M e l k i , J. (1996). Large scale deletions o f the 5 q l 3 region are specific to Werdnig- Hoffmann disease. J Med Genet 33(4), 281-3.  63  Bussaglia, E . , Clermont, O., Tizzano, E . , Lefebvre, S., Burglen, L . , Cruaud, C , Urtizberea, J. A . , Colomer, J., Munnich, A . , & Baiget, M . (1995). A frame-shift deletion i n the survival motor neuron gene i n Spanish spinal muscular atrophy patients. Nat Genet 11(3), 335-7. Byers, R . & Banker, B . (1961). Infantiel muscular atrophy. Arch. Neurol 5, 140-164. Campbell, L . , Potter, A . , Ignatius, J., Dubowitz, V . & Davies, K . (1997). Genomic variation and gene conversion i n spinal muscular atrophy: implications for disease process and clinical phenotype. Am J Hum Genet 61(1), 40-50. Carpten, J. D . , DiDonato, C . J., Ingraham, S. E . , Wagner, M . C , Nieuwenhuijsen, B . W . , Wasmuth, J. J. & Burghes, A . H . (1994). A Y A C contig of the region containing the spinal muscular atrophy gene ( S M A ) : identification o f an unstable region. Genomics 24(2), 351-6. Carter, T. A . , Bonnemann, C . G . , Wang, C . PL, Obici, S. & Parano, E . (1997). A multicopy transcription-repair gene, BTF2p44, maps to the S M A region and demonstrates S M A associated deletions. Hum Mol Genet 6(2), 229-36. Chen, Q., Baird, S. D . , Mahadevan, M . , Besner, J. A . , Farahani, R., Xuan, J., Kang, X . , Lefebvre, C , Ikeda, J. E . , Korneluk, R. G . & MacKenzie, A . E . (1998). Sequence o f a 131 -kb region o f 5ql3.1 containing the spinal muscular atrophy candidate genes S M N and N A I P . Genomics 48(1), 121-7. Cobben, J. M . , van der Steege, G , Grootscholten, P., de, V . M . , Scheffer, H . & Buys, C . H . (1995). Deletions of the survival motor neuron gene i n unaffected siblings o f patients with spinal muscular atrophy. Am J Hum Genet 57(4), 805-8. Coovert, D . D . , L e , T. T., M c A n d r e w , P. E . , Strasswimmer, J., Crawford, T. O., Mendell, J. R., Coulson, S. E . , Androphy, E . J., Prior, T. W . & Burghes, A . H . . (1997). The survival motor neuron protein i n spinal muscular atrophy. Hum Mol Genet 6(8), 1205-14. Daniels, R . J., Suthers, G . K . , Morrison, K . E . , Thomas, N . H . , Francis, M . J., Mathew, C. G „ Loughlin, S., Heiberg, A . , Wood, D . , & Dubowitz, V . (1992). Prenatal prediction o f spinal muscular atrophy. J Med Genet 29(3), 165-70. Dawson, S. J., L i u , Y . Z . , Rodel, B . , Moroy, T. & Latchman, D . S. (1996). The ability of P O U family transcription factors to activate or repress gene expression is dependent on the spacing and context o f their specific response elements. Biochem J, 439-43. Dias, P., D i l l i n g , M . & Houghton, P. (1994). The molecular basis o f skeletal muscle differentiation. Semin Diagn Pathol 11(1), 3-14.  64  DiDonato, C . J., Chen, X . N . , Noya, D . , Korenberg, J. R., Nadeau, J. H . & Simard, L . R. (1997). Cloning, characterization, and copy number of the murine survival motor neuron gene: homolog o f the spinal muscular atrophy-determining gene. Genome Res 7(4), 339-52. DiDonato, C . J., Morgan, K . , Carpten, J. D . , Fuerst, P., Ingraham, S. E . , Prescott, G . , McPherson, J. D . , Wirth, B . , Zerres, K . , & Hurko, O. (1994). Association between A g l - C A alleles and severity o f autosomal recessive proximal spinal muscular atrophy. Am J Hum Genet 55(6), 1218-29. Dubowitz, V . (1964). Infantile muscular atrophy. A prospective study with particular reference to a slowly progressive variety. Brain 87, 707-718. Dubowitz, V . (1995a). Disorders o f the lower motor neurone: the spinal muscular atrophies. In Muscle Disorders in childhood (Dubowitz,. V . , ed.), pp. 325-369. Saunders, London. Dubowitz, V . (1995b). Chaos in the classification o f S M A : a possible resolution. Neuromuscul Disord 5(1), 3-5. Dynan, W . S. & Tjian, R. (1985). Control o f eukaryotic messenger R N A synthesis by sequence-specific D N A - binding proteins. Nature 316(6031), 774-8. Fischer, U . , L i u , Q. & Dreyfuss, G . (1997). The S M N - S I P 1 complex has an essential role i n spliceosomal snRNP biogenesis. Cell 90(6), 1023-9. Francis, M . J., Morrison, K . E . , Campbell, L . , Grewal, P. K . , Christodoulou, Z . , Daniels, R. J., Monaco, A . P., Frischauf, A . M . , McPherson, J., & Wasmuth, J. (1993). A contig o f non-chimaeric Y A C s containing the spinal muscular atrophy gene in 5 q l 3 . Hum Mol Genet 2(8), 1161-7. Fujii, H . & Hamada, H . (1993). A CNS-specific P O U transcription factor, Brn-2, is required for establishing mammalian neural cell lineages. Neuron 11(6), 1197-206. Gennarelli, M . , Lucarelli, M . , Capon, F., Pizzuti, A . , Merlini, L . , Angelini, C , N o v e l l i , G . & Dallapiccola, B . (1995). Survival motor neuron gene transcript analysis i n muscles from spinal muscular atrophy patients. Biochem Biophys Res Commun 213(1), 342-8. G i l l i a m , T. C , Brzustowicz, L . M . , Castilla, L . H . , Lehner, T., Penchaszadeh, G . K . , Daniels, R. J., Byth, B . C , Knowles, J., Hislop, J. E . , & Shapira, Y . (1990). Genetic homogeneity between acute and chronic forms o f spinal muscular atrophy. Nature 345(6278), 823-5. Hagino, Y . K . , Saijoh, Y . , Ikeda, M . , Ichikawa, M . , Minamikawa, T. R. & Hamada, H . (1997). Predominant expression o f Brn-2 in the postmitotic neurons of the  65  developing mouse neocortex. Brain Res 752(1-2), 261-8. Hagino, Y . K . , Saijoh, Y . , Yamazaki, Y . , Yazaki, K . & Hamada, H . (1998). Transcriptional regulatory region o f Brn-2 required for its expression in developing olfactory epithelial cells. Dev Brain Res 109(1), 77-86. Hagino, Y . K . , Minamikawa, T. R., Ichikawa, M . & Yazaki, K . (1999). Expression o f Brain-2 in the developing olfactory bulb. Dev Brain Res 113(1-2), 133-137. Hahnen, E . , Forkert, R., Marke, C , Rudnik, S. S., Schonling, J., Zerres, K . & Wirth, B . (1995). Molecular analysis o f candidate genes on chromosome 5 q l 3 in autosomal recessive spinal muscular atrophy: evidence o f homozygous deletions o f the S M N gene in unaffected individuals. Hum Mol Genet 4(10), 1927-33. Hahnen, E . , Schonling, J., Rudnik, S. S., Raschke, H . , Zerres, K . & Wirth, B . (1997). Missense mutations in exon 6 o f the survival motor neuron gene i n patients with spinal muscular atrophy ( S M A ) . Hum Mol Genet 6(5), 821-5. Hahnen, E . , Schonling, J., Rudnik, S. S., Zerres, K . & Wirth, B . (1996). Hybrid survival motor neuron genes in patients with autosomal recessive spinal muscular atrophy: new insights into molecular mechanisms responsible for the disease. Am J Hum Genet 59(5), 1057-65. Hoffmann, J. (1892). Ueber familiare progressive spinale Muskelatrophie. Arch Psychiatr (Berlin) 24, 644-646. H u i , P., Guo, X . & Bradford, P. G . (1995). Isolation and functional characterization o f the human gene encoding the myeloid zinc finger protein M Z F - 1 . Biochemistry 34(50), 16493-502. Iwahashi, H . , Eguchi, Y . , Yasuhara, N . , Hanafusa, T., Matsuzawa, Y . & Tsujimoto, Y . (1997). Synergistic anti-apoptotic activity between Bcl-2 and S M N implicated in spinal muscular atrophy. Nature 390(6658), 413-7. Josephson, R., Muller, T., Pickel, J., Okabe, S., Reynolds, K . , Turner, P. A . , Zimmer, A . & M c K a y , R. D . (1998). P O U transcription factors control expression o f C N S stem cell-specific genes. Development 125(16), 3087-100. K l e y n , P. W . , Wang, C . H . , Lien, L . L . , Vitale, E . , Pan, J., Ross, B . M . , Grunn, A . , Palmer, D . A . , Warburton, D . , & Brzustowicz, L . M . (1993). Construction o f a yeast artificial chromosome contig spanning the spinal muscular atrophy disease gene region. Proc Natl Acad Sci USA 90(14), 6801-5. Kugelberg, E . & Welander, L . (1956). Heredofamilial juenile muscular atrophy stimulating muscular dystrophy. Arch Neurol Psychiatry 75, 500-509.  66  Lefebvre, S., Burglen, L . , Reboullet, S., Clermont, O., Burlet, P., Viollet, L . , Benichou, B . , Cruaud, C , Millasseau, P., & Zeviani, M . (1995). Identification and characterization o f a spinal muscular atrophy- determining gene. Cell 80(1), 155-65. Lefebvre, S., Burlet, P., L i u , Q., Bertrandy, S., Clermont, O., Munnich, A . , Dreyfuss, G . & M e l k i , J. (1997). Correlation between severity and S M N protein level in spinal muscular atrophy. Nat Genet 16(3), 265-9. Lefebvre, S., Burglen, L . , Frezal, J., Munnich, A . & M e l k i , J. (1998). The role o f the S M N gene in proximal spinal muscular atrophy. Hum Mol Genet 7(10), 1531-6. Liston, P., R o y , N . , Tamai, K . , Lefebvre, C , Baird, S., Cherton, H . G . , Farahani, R., M c L e a n , M . , Ikeda, J. E . , MacKenzie, A . & Korneluk, R. G . (1996). Suppression o f apoptosis i n mammalian cells by N A I P and a related family o f I A P genes. Nature 379(6563), 349-53. L i u , Q . & Dreyfuss, G . (1996). A novel nuclear structure containing the survival o f motor neurons protein. EMBOJ 15(14), 3555-65. L i u , Q., Fischer, U . , Wang, F. & Dreyfuss, G . (1997). The spinal muscular atrophy disease gene product, S M N , and its associated protein SIP1 are in a complex with spliceosomal snRNP proteins. Cell 90(6), 1013-21. Lorson, C . L . , Strasswimmer, J., Y a o , J. M . , Baleja, J. D . , Hahnen, E . , Wirth, B . , L e , T., Burghes, A . H . & Androphy, E . J. (1998). S M N oligomerization defect correlates with spinal muscular atrophy severity. Nat Genet 19(1), 63-6. MacKenzie, A . , Roy, N . , Besner, A . , Mettler, G . , Jacob, P., Korneluk, R. & Surh, L . (1993). Genetic linkage analysis o f Canadian spinal muscular atrophy kindreds using flanking microsatellite 5 q l 3 polymorphisms. Hum Genet 90(5), 501-4. M c A n d r e w , P. E . , Parsons, D . W . , Simard, L . R., Rochette, C , Ray, P. N . , Mendell, J. R., Prior, T. W . & Burghes, A . H . (1997). Identification o f proximal spinal muscular atrophy carriers and patients by analysis o f S M N T and S M N C gene copy number. Am JHum Genet 60(6), 1411-22. M e l k i , J., Lefebvre, S., Burglen, L . , Burlet, P., Clermont, O., Millasseau, P., Reboullet, - S., Benichou, B . , Zeviani, M . & L e , P. D . (1994). De novo and inherited deletions o f the 5 q l 3 region in spinal muscular atrophies. Science 264(5164), 1474-7. M e l k i , J., Sheth, P., Abdelhak, S., Burlet, P., Bachelot, M . F., Lathrop, M . G . , Frezal, J. & Munnich, A . (1990). Mapping o f acute (type I) spinal muscular atrophy to chromosome 5 q l 2 - q l 4 . The French Spinal Muscular Atrophy Investigators. Lancet 336(8710), 271-3. Mitchell, P. J., Timmons, P. M . , Hebert, J. M . , Rigby, P. W . & Tjian, R . (1991).  67  Transcription factor A P - 2 is expressed in neural crest cell lineages during mouse embryogenesis. Genes Dev 5(1), 105-19. Morris, J. F., Hromas, R. & Rauscher, F . R. (1994). Characterization o f the D N A binding properties o f the myeloid zinc finger protein M Z F 1 : two independent D N A . binding domains recognize two D N A consensus sequences with a common G-rich core. Mol Cell Biol 14(3), 1786-95. Morris, J. F., Rauscher, F. R., Davis, B . , Klemsz, M . , X u , D . , Tenen, D . & Hromas, R. (1995). The myeloid zinc finger gene, M Z F - 1 , regulates the C D 3 4 promoter i n vitro. Blood 86(\0), 3640-7. Morrison, K . E . (1996). Advances in S M A research: review o f gene deletions. Neuromuscul Disord 6(6), 397-408. Muller, M . M . , Ruppert, S., Schaffner, W . & Matthias, P. (1988). A cloned octamer transcription factor stimulates transcription from lymphoid-specific promoters i n non-B cells. Nature 336(6199), 544-51. Munsat, T. (1991). Workshop report: International S M A collaboration. Neuromusc. Disord I, SI. Munsat, T. L . , Skerry, L . , Korf, B . , Pober, B . , Schapira, Y . , Gascon, G . G . , al, R. S., Dubowitz, V . , Davies, K . , Brzustowicz, L . M . (1990). Phenotypic heterogeneity o f spinal muscular atrophy mapping to chromosome 5 q l 1.2-13.3 ( S M A 5q). Neurology 40(12), 1831-6. N o v e l l i , G . , Calza, L . , Amicucci, P., Giardino, L . , Pozza, M . , Silani, V . , Pizzuti, A . , Gennarelli, M . , Piombo, G . , Capon, F. & Dallapiccola, B . (1997). Expression study o f survival motor neuron gene in human fetal tissues. Biochem Mol Med 61(1), 1026. Parsons, D . W . , M c A n d r e w , P. E . , Monani, U . R., Mendell, J. R., Burghes, A . H . & Prior, T. W . (1996). A n 11 base pair duplication in exon 6 o f the S M N gene produces a type I spinal muscular atrophy ( S M A ) phenotype: further evidence for S M N as the primary SMA-determining gene. Hum Mol Genet 5(11), 1727-32. Parsons, D . W . , M c A n d r e w , P. E . , Iannaccone, S. T., Mendell, J. R., Burghes, A . H . & Prior, T. W . (1998). Intragenic t e l S M N mutations: frequency, distribution, evidence o f a founder effect, and modification o f the spinal muscular atrophy phenotype by c e n S M N copy number. Am J Hum Genet 63(6), 1712-23. Pearn, J. (1978a). Genetic studies o f acute infantile spinal muscular atrophy ( S M A type I). A n analysis o f sex ratios, segregation ratios, and sex influence. J Med Genet 15(6), 414-7.  68  Pearn, J. (1978b). Incidence, prevalence, and gene frequency studies o f chronic childhood spinal muscular atrophy. J Med Genet 15(6), 409-13. Rajcan, S. E . , Mahadevan, M . S., Lefebvre, C , Besner, J. A . , Ikeda, J. E . , Korneluk, R . G . & MacKenzie, A . (1996). F I S H detection o f chromosome polymorphism and deletions i n the spinal muscular atrophy ( S M A ) region o f 5 q l 3 . Cytogenet Cell Genet 75(4), 243-7. Rodrigues, N . R., Owen, N . , Talbot, K . , Ignatius, J., Dubowitz, V . & Davies, K . E . (1995). Deletions in the survival motor neuron gene on 5 q l 3 in autosomal recessive spinal muscular atrophy. Hum Mol Genet 4(4), 631-4. Roy, A . L . , Meisterernst, M . , Pognonec, P. & Roeder, R. G . (1991). Cooperative interaction o f an initiator-binding transcription initiation factor and the helix-loophelix activator U S F . Nature 354(6350), 245-8. Roy, N . , Mahadevan, M . S., M c L e a n , M . , Shutler, G . , Yaraghi, Z . , Farahani, R., Baird, S., Besner, J. A . , Lefebvre, C. & Kang, X . (1995). The gene for neuronal apoptosis inhibitory protein is partially deleted in individuals with spinal muscular atrophy. Ce//80(1), 167-78. Sawadogo, M . & Roeder, R. G . (1985a). Factors involved in specific transcription by human R N A polymerase II: analysis by a rapid and quantitative in vitro assay. Proc Natl Acad Sci USA 82(13), 4394-8. Sawadogo, M . & Roeder, R. G . (1985b). Interaction o f a gene-specific transcription factor with the adenovirus major late promoter upstream o f the T A T A box region. Ce//43(1), 165-75. Scharf, J. M . , Endrizzi, M . G . , Wetter, A . , Huang, S., Thompson, T. G . , Zerres, K . , Dietrich, W . F., Wirth, B . & Kunkel, L . M . (1998). Identification o f a candidate modifying gene for spinal muscular atrophy by comparative genomics. Nat Genet 20(1), 83-6. Schorle, H . , Meier, P., Buchert, M . , Jaenisch, R. & Mitchell, P. J. (1996). Transcription factor A P - 2 essential for cranial closure and craniofacial development. Nature 381(6579), 235-8. Sekido, R., Murai, K . , Funahashi, J., Kamachi, Y . , Fujisawa, S. A . , Nabeshima, Y . & Kondoh, H . (1994). The delta-crystallin enhancer-binding protein delta E F I is a repressor o f E2-box-mediated gene activation. Mol Cell Biol 14(9), 5692-700. Sekido, R., Takagi, T., Okanami, M . , Moribe, H . , Yamamura, M . , Higashi, Y . & Kondoh, H . (1996). Organization o f the gene encoding transcriptional repressor deltaEFl and cross-species conservation o f its domains. Gene 173(2), 227-32.  69  Sekido, R., Murai, K . , Kamachi, Y . & Kondoh, H . (1997). Two mechanisms in the action o f repressor d e l t a E F l : binding site competition with an activator and active repression. Genes Cells 2(12), 771-83. Shimazaki, T., Arsenijevic, Y . , Ryan, A . K . , Rosenfeld, M . G . & Weiss, S. (1999). A role for the POU-III transcription factor brn-4 in the regulation o f striatal neuron precursor differentiation. EMBOJ 18(2), 444-56. Simard, L . R., Vanasse, M . , Rochette, C . , Morgan, K . , Lemieux, B . , Melancon, S. B . & Labuda, D . (1992). Linkage study o f chronic childhood-onset spinal muscular atrophy ( S M A ) : confirmation o f close linkage to D5S39 i n French Canadian families. Genomics 14(1), 188-90. Simard, L . R., Rochette, C , Semionov, A . , Morgan, K . & Vanasse, M . (1997). S M N ( T ) and N A I P mutations in Canadian families with spinal muscular atrophy ( S M A ) : genotype/phenotype correlations with disease severity. Am J Med Genet 72(1), 51-8. Takagi, T., Moribe, H . , Kondoh, H . & Higashi, Y . (1998). D e l t a E F l , a zinc finger and homeodomain transcription factor, is required for skeleton patterning i n multiple lineages. Development 125(1), 21-31. Talbot, K . , Ponting, C . P., Theodosiou, A . M . , Rodrigues, N . R., Surtees, R., Mountford, R. & Davies, K . E . (1997). Missense mutation clustering in the survival motor neuron gene: a role for a conserved tyrosine and glycine rich region o f the protein i n R N A metabolism? Hum Mol Genet 6(3), 497-500. Thiele, FL, Berger, M . , Lenzner, C , Kuhn, H . & Thiele, B . J. (1998). Structure o f the promoter and complete sequence o f the gene coding for the rabbit translationally controlled tumor protein (TCTP) P23. Eur J Biochem 257(1), 62-8. Thompson, T. G . , DiDonato, C. J., Simard, L . R., Ingraham, S. E . , Burghes, A . FL, Crawford, T. O., Rochette, C , Mendell, J. R. & Wasmuth, J. J. (1995). A novel c D N A detects homozygous microdeletions in greater than 50% o f type I spinal muscular atrophy patients. Nat Genet 9(1), 56-62. Thomas, N . , Dubowitz, V . (1994). Spinal muscular atrophies, in Motor neuron disease, E d . Williams, A . , Chapman & Hall Medical, London, pp.29-44. Tizzano, E . F., Cabot, C. & Baiget, M . (1998). Cell-specific survival motor neuron gene expression during human development of the central nervous system: implications for the pathogenesis o f spinal muscular atrophy. Am J Pathol 153(2), 355-61. van der Steege, G , Grootscholten, P. M . , Cobben, J. M . , Zappata, S., Scheffer, H . , den, D . J., van, O. G . , Brahe, C. & Buys, C . H . (1996). Apparent gene conversions involving the S M N gene in the region o f the spinal muscular atrophy locus on  70  chromosome 5. Am J Hum Genet 59(4), 834-8. Velasco, E . , Valero, C , Valero, A . , Moreno, F. & Hernandez, C . C . (1996). Molecular analysis o f the S M N and N A I P genes i n Spanish spinal muscular atrophy ( S M A ) families and correlation between number o f copies o f c B C D 5 4 1 and S M A phenotype. Hum Mol Genet 5(2), 257-63. Weis, L . & Reinberg, D . (1992). Transcription by R N A polymerase II: initiatordirected formation o f transcription-competent complexes. FASEB J6(14), 3300-9. Werdnig, G . (1891). Z w e i fruhinfantile hereditare Falle von progressiver Muskelatrophie unter dem Bilde der Dystrophic, aber auf neurotischer Gerundlage. Arch Psychiat Nervenkr 22, 437-81. Werdnig, G . (1894). Die fruhinfantile progressive spinale Amyotrophic. Arch Nervenkr 26, 706-44.  Psychiat  Wirth, B . , Pick, E . , Leutner, A . , Dadze, A . , Voosen, B . , Knapp, M . , Piechaczek, W . B . , Rudnik, S.S., Schonling, J., C o x , S. (1994). Large linkage analysis i n 100 families with autosomal recessive spinal muscular atrophy ( S M A ) and 11 C E P H families using 15 polymorphic loci in the region 5 q l l . 2 - q l 3 . 3 . Genomics 20(1), 84-93. Wirth, B . , Hahnen, E . , Morgan, K . , DiDonato, C . J., Dadze, A . , Rudnik, S. S., Simard, L . R., Zerres, K . & Burghes, A . H . (1995). Allelic association and deletions i n autosomal recessive proximal spinal muscular atrophy: association o f marker genotype with disease severity and candidate c D N A s . Hum Mol Genet 4(8), 127384.  71  APPENDIX Partial sequence of S M N 5' flanking region (-1950 to -565) 5' - A C T C A G G C T G G T C T C A A C T T C T G G C C T C A A G G A A C C T T C C C A C C T T G G C CTCCCAAATTGCTGGGATTACAGGCAtAAGTCATCATGCCTGGCTACAAAGA GATATTTTCAATAAGAGGATAAAAGTTCATTTCCCCATACTTTGCTAACATCA AATGTTATTAATTCCTAATAGTTTTGCCAAACTGAGAGGAAAATGGTATGTTA GTTTTTCTGGGTTTTCTTTCTTTTTAATTTTTTTTCTTTTTTATTCACCGCAACA CTATTCACGATTTTTTTATTTTTTATTTTATTTATTATTTATTTTTTTTTGAGAC AAGGTCTCCCTATGTTGCCCAGGCTGGTCTTGTACCCCTGGGCTCAAAGGATC CTCCTGCCTCAGCCTCCCAAAGTGCTGGGGATTATAGGCATGAGCCACCGTA CCAGACCCCTAAAATTGTATATATTTAAGGTGTACCATTTGATGTTTAGATAT ACATTGTGAAATGATTACATTCCACATATTACCTCTACAGAGTTACCATTTTT GTACACTTGGTCAACATCATCCCATTCTCCCCTTCCTCCACAGATATTTCTTGT ATACTATATGAAGCCAAGGGTATTTTGGGGGAAGAGCTCAAAGTTCCTTTCG TGGAGTTAAAAATATATATATACTATGTACATATAAGCCATTTAGCAACCCTA GATGCTTAATAAAGAATACTGGAGGCCCGGTGTGGTGGCTCACACCTGTAAT CCCAGCACTTTGGGGGCCGAGGCGGTCGGATTACGAGGTCAGGAGTTCAAGA GGAGCCTGGCCAACATGGTGAAACCCCCATCTTTACTAAAAATACAAAAATT AGCCGGGGTGTGGTGTTGGGCGCCTGTAATCCCAGCTACTCGGGGGACTGAG GCAGAATTGCTTGAACCTGGGAGGCAGAGGTTGCAGTGAGCTGAGATCACGC CACTGCATTCCAGCCTGGGTGACAGAGCAATACTCTGTCGCAAAAAAAAAAA AGAATACTGGAGGCTGGGCGAGGTGGCTCACACCTGTAATCCCAGCATTTTG GGATGCCAGAGGCGGGCGGAATATCTTGAGCTCAGGAGTTCGAGACCAGCCT ACACAATATGCTCCAAACGCCGCCTCTACAAAACATACAGAAACTAGCCGGG TGTGGTGGCGTGCCCCTGTGGTCCTAGCTACTTGGGAGGTTGAGGCGGGAGG ATCGCTTGAGCTCGGGAGGTCGAGGCTGCAATGAGCCGAGATGGTGCCACTG CACTCTGACGACAGAGCGAGACTCCGTCTCAAAACAAACAACAAATAAGGTT GGGGGATCAAATATCTTCTAGTGTTTAAGGATCTGCCTTCCTTCCTGCCCCCA  T-3'  72  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0089095/manifest

Comment

Related Items