Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Investigation of the transcription activating properties of Spo0A from Bacillus subtilis Bird, Terry H. 1995

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1995-982578.pdf [ 3.75MB ]
Metadata
JSON: 831-1.0088824.json
JSON-LD: 831-1.0088824-ld.json
RDF/XML (Pretty): 831-1.0088824-rdf.xml
RDF/JSON: 831-1.0088824-rdf.json
Turtle: 831-1.0088824-turtle.txt
N-Triples: 831-1.0088824-rdf-ntriples.txt
Original Record: 831-1.0088824-source.json
Full Text
831-1.0088824-fulltext.txt
Citation
831-1.0088824.ris

Full Text

INVEST[GATION OF THE TRANSCRIPTION ACTIVATINGPROPERTIES OF SPOOA FROM BACILLUS SUBTILISbyTerry H. BirdB.Sc., University of British ColumbiaA THESIS SUBM1’fl’kiD IN PARTIAL FULFILLMENT OF THE REQUIREMENTSFOR THE DEGREE OFDOCTOR OF PHILOSOPHYmTHE FACULTY OF GRADUATE STUDIESDepartment of Microbiology and ImmunologyWe accept this thesis as conformingto the required standardTHE UNIVERSiTY OF BRiTISH COLUMBIAMar. 1995© Terry H. Bird, 1995In presenting this thesis in partial fulfilment of the requirements for an advanceddegree at the University of British Columbia, I agree that the Library shalt make itfreely available for reference and study. I further agree that permission for extensivecopying of this thesis for scholarly purposes may be granted by the head of mydepartment or by his or her representatives. It is understood that copying orpublication of this thesis for financial gain shall not be allowed without my writtenpermission.Department of VLThe University of British CoIumbiaVancouver, CanadaDate____-i /DE$ (2/88)IIAbstractSpoOA is a key regulator of sporulation in Bacillus subtilis. Genetic investigationshave indicated that SpoOA activates or represses transcription of various loci whichultimately commit the cell to spore development under poor nutrient conditions. Thetranscription regulating properties of SpoOA are believed to be controlled by proteinphosphorylation through a signal transduction system termed a ‘phosphorelay’. ThespoIL4 and spoliG operons are two targets for activation by SpoOA-P that are essentialto the induction of a sporulation response because each encodes a sporulation specificsigma factor.An in vitro transcription assay was used to examine the effect of SpoOA and itsphosphorylation on transcription initiation at the spollA and spoliG promoters (PspoIMand PspoIIG). Phosphorylation of SpoOA dramatically enhanced its ability to stimulatethe level of transcription initiation at both promoters. A kinetic analysis of the initiationprocess at PspoIIG demonstrated that the rate of initiation was independent of theconcentration of RNA polymerase and promoter template. In contrast, increasedconcentrations of SpoOA-P accelerated the initiation reaction at PspoiiG by affecting arate limiting step that occurred after RNA polymerase bound to the promoter. Initiationrates at PspoiiG were also stimulated by a truncated form of the SpoOA protein(SpoOABD) which contained the DNA binding domain but not the phospho-acceptorsite. While transcription stimulation by SpoOA or SpoOABD was observed to beextremely salt sensitive, the effect of SpoOA-P was insensitive to salt concentration ifthe predominant anion was acetate.DNaseI protection experiments demonstrated that both SpoOA and SpoOA-Pcatalyzed structural changes in ternary complexes formed between RNA polymerase andPspoiiG. These isomerizations appeared to correlate with the modest and dramaticeffects of SpoOA and SpoOA-P, respectively, on PspoiiG transcription. DNaseI111protection patterns obtained at various temperatures showed that although proteinbinding appeared normal, low temperature prohibited the structural transformationsattributed to SpoOA(-P). Footprinting experiments carried out on a mutant promoterconstruct (Psp011GM94184)indicated that SpoOA binding sites located at -94 and -84relative to the transcription start site, are dispensable to the effect of SpoOA(-P) onternary complex isomerization. However, these sites may function to enhance factorbinding to what seem to be the crucial OA boxes at -50 and -40.The biochemical analysis presented in this thesis supports the hypothesis that thephosphorelay functions as a signal transduction system that can induce a sporulationresponse through activation of the transcription regulating properties of SpoOA.ivTable of contentsAbstract iiList of tables ixList of figures xAbbreviations and symbols xiiAcknowledgments xiiiDedication xivIntroduction 1I. Sporulation in Bacillus subtilis 11. Sporulation as a response to starvation 12. The morphology of sporulation in B. subtilis 23. Sporulation genes 4II. Regulation of gene expression during sporulation 51. Negative and positive regulation of spo genes 5l.a. Negative regulation of sporulation: transition-state regulators 51 .b. Positive regulation of sporulation : the sigma factor cascade 5III. Initiation of the sporulation response 71. Conditions required for sporulation 72. Genes that regulate the initiation of a sporulation response 83. Sensing the sporulation signal(s) 84. The phosphorelay signal transduction system 105. The function of the phosphorelay 116. The regulating properties of SpoOA-P 12IV. Review of transcription initiation 141. Promoter structure 142. The transcription initiation pathway 143. Transcription factors and their influence on the initiation reaction 16V. The spoliG and spollA promoters 171. The spoliG promoter (PspojiG) 172. The spollA promoter (P50jm) 19VI. Main research objectives 191. Investigation into the regulation of PspoiiG and PspoIM 19Materials and methods 22I. Standard molecular biology techniques 221. Plasmid DNA restriction digests 22V2. Ligation reactions and transformation of competent cells 223. Plasmid DNA preparations 224. Agarose and polyacrylamide gel electrophoresis 235. DNA sequencing 24LI. Promoter constructs 241. Subcloning ofP0im 242. The PspoiiG construct 253. The P construct 25Ill. Isolation and purification of RNA polymerase, cyH, and the phosphorelayproteins 251. Purification of EGA 252. Preparation of core RNA polymerase 263. Purification of aH protein 264. Purification of the phosphorelay proteins 26IV. In vitro transcription assay procedures 271. Preparation of the P,oi and P templates 272. Preparation and isolation of the PspoIIG template 273. In vitro transcription assays performed on PspojjG and P 274. P.ypoiiG transcription rate assays 285. Determination of PspoiiG transcription activity 296. PspoHA transcription assays 297. Primer extension analysis of PspoiiG andP0im transcripts 30V. Phosphorelay reactions 311. Typical phosphorelay reaction procedures and quantitation of SpoOAphosphorylation 312. Phosphorelay time-course reactions 32VI. DNaseI protection assays 331. End labeling of PspoIIG DNA fragments 332. DNaseI footprinting of various SpoOA(-P) concentrations 343. Time-course DNaseI protection assays 34VII. Mutagenesis and end labeling of PspoiiG by polymerase chain reaction. ... 351. Generation ofPsp0JJGM94I8 by PCR 352. 32P - labeling ofPspJJGM94184 for DNaseI protection experiments. ... 36Results 37I. In vitro PspoiIG transcription assays 371. Transcription assay procedure 37vi2. Heparin-resistant complex formation at PspoHG.373. Mapping of the PspoiiG transcription start site 39II. Effect of SpoOA-P on the transcriptional activity of PspoIIG 391. In vitro phosphorelay reactions 392. Test of phosphorelay components in PspoiiG transcription assays 413. Effect of SpoOA(-P) concentration on PspoiiG activity 414. The effect of SpoOA-P on P activity 445. Coupling of a phosphorelay time-course reaction to PspojjGtranscription assays 48III. Investigation of reaction conditions affecting PspoiiG transcription 501. Temperature effects on PspoHG transcription 502. The effect of ion concentration of PspoiiG transcription 54lv. Investigation into the mechanism of transcription activation by SpoOA-P 561. PspoiiG transcription rate assays 562. Measurement of rate constants for PspoHG transcription initiation 593. Tau analysis 624. PspojiG tau plot 695. Effect of DNA concentration on rate of initiation at PspoiiG 706. Effect of GTP concentration on initiation rates at PspoiiG 707. Effect of SpoOA(-P) concentration on the rate of initiation a PspoiiG. ... 718. Interpretation of the effect of SpoOA-P on the rate of initiation atPspoIIG 719. The effect of the SpoOA binding domain polypeptide (SpOOABD) onPspoHG transcription 8410. The KAc effect on rates of initiation at PspoHG 8511. Rate of transcription initiation from a mutant form of P spoliG 90V. DNaseI footprinting of SpoOA(-p) to PspoJJG 971. Previous reports of PspoiiG DNaseI protection studies 972. Effect of increased SpoOA(-P) concentration on DNaseI protection ofFspoiiG 983. Kinetic DNaseI protection assays 984. The effect of temperature on kinetic DNaseI footprints 1055. Effect of SpoOA(-p) concentration on RNA polymerase complexes atPspoIIG 1126. DNaseI footprinting ofP5p0jJM94/8 114VI. Investigation ofP50jm transcription stimulation by SpoOA-P 117vil1. P1,0im transcription assays.1172. The effect of SpoOA-P on the extent and rate ofP0im transcriptioninitiation 1173. The combined effect of SpoOA-P and 0H concentration on PspoiiAactivity 124Discussion 125I. Summary of results 1251. Summary of the effect of SpoOA and phosphorylation on in vitrotranscription 1252. Summary of investigation into SpoOA(-P) stimulation of PspoJJG 125II. Interpretation of in vitro transcription assays and DNaseI footprintingexperiments 1261. Correlation between PspoHG transcription assays and DNaseIfootprinting experiments 1262. Interpretation of PspoiiG transcription kinetics and DNaseI footprints... 127III. A model for transcriptional stimulation of PspoiiG 1281. Compensating for the unusual structure of spoiiG 128IV. The role of SpoOA-P phosphorylation 1341. N-terminal inhibition of the DNA binding domain 1342. Possible roles for the OA boxes upstream of PspoiiG 1363. Evidence for protein-protein contact 138V. Temperature and salt effects on ternary complex formation and transcriptionfrom PspoJJG 1391. Temperature effects on ternary complex formation 1392. The effect of ion concentration 141VI. The effect of SpoOA-P on 1441. Stimulation by SpoOA-P and the effect of & concentration 144VII. SpoOA-P as a model for transcription factor activity 1441. Review of prokaryotic transcription activator proteins 144l.a. The X cI protein 1451.b. The catabolite gene activator protein (CAP or CRP) 1461.c. The OmpR activator 1471.d. The NtrC activator 1482. SpoOA-P may stimulate transcription initiation two different ways 149References 151Appendix 1661. Reaction kinetics 1661. The kinetics of transcription initiation 1662. Review of the kinetics of first-order reactions 1663. Kinetics of the overall rate of heparin-resistant complex formation 1674. Interpretation of lit 169vmixList of tablesTable I. ‘cobs values measured for PspoIIG transcription rate assays thatcontained different RNA polymerase concentrations 67Table II. ‘cobs values obtained from transcription assays that contained variousPspojjG template concentrations 74Table III. Rate constants for heparin-resistant complex formation in PspoHGtranscription assays that contained various concentrations ofSpoOA(-P) 79Table IV. Effect of KAc concentration on rates of spoJJG transcriptioninitiation in assays that contained various forms of the SpoOAprotein 90Table V. Initial rates of transcript synthesis from PspoHG +1- 120 mM KAc. ... 94Table VI. Comparison of rate constants from transcription rate assays thatcontained wildtype or Psp0JJGM94I8 promoter templates 96xList of figuresFigure 1. The sporulation cycle of Bacillus subtilis 3Figure 2. The PspoiiG sequence 18Figure 3. The P,oj sequence 20Figure 4. SDS- polyacrylamide gel of RNA polymerase 38Figure 5. Primer extension analysis of RNA produced in PspoiiG transcriptionassays 40Figure 6A. SDS - polyacrylamide gel containing purified phosphorelay proteins. 42Figure 6B. Autoradiogram of 32P - labeled phosphorelay proteins separated bySDS -PAGE 42Figure 7. Phosphorelay component test on PspoHG activity 43Figure 8. Effect of SpoOA(-P) concentration on in vitro transcription fromPspoHG 45Figure 9. Effect of SpoOA(-P) concentration on PspoHG activity 47Figure 10. Effect of increased SpoOA(-P) concentration on in vitro transcriptionfrom P 49Figure 11. Effect of intermediate levels of SpoOA phosphorylation ontranscription from PspoiiG 52Figure 12. Temperature sensitivity of transcription from PspoiiG 53Figure 13. Influence of NaCl concentration on transcription from PspoiiG 55Figure 14. Effect of KC1 concentration on PspoiiG transcription 57Figure 15. Effect of increasing KAc concentration on PspoiiG activity 58Figure 16. Time-course of heparin-resistant complex formation at PspoiiG in thepresence and absence of SpoOA-P 60Figure 17. Effect of SpoOA concentration on PspoJJG transcription rate assays. ... 64Figure 18. Example kobs plots from PspoHG rate assays that contained variousRNA polymerase concentrations 66Figure 19. PspoiiG tau plot 68Figure 20. Effect of PspoiiG template concentration on rates of transcriptioninitiation 73Figure 21. Effect of GTP concentration on the rate of PspoiiG transcriptioninitiation 75Figure 22. Completion levels from spoiiG rate assays that contained variousconcentrations of SpoOA(-V) 76Figure 23. Determination of rate constants for assays containing variousSpoOA(-P) concentrations 78xiFigure 24. Effect of SpoOA(-P) concentration on rates of PspoIIG transcriptioninitiation 83Figure 25. Effect of SpoOABD on completion levels and rate of PspoIIGtranscription initiation 87Figure 26. Tau analysis of the effect of SpoOABD 88Figure 27. Effect of increasing KAc concentration on completion levels ofPspoiiG transcnption 89Figure 28. Kinetics of transcription initiation at PspoiiG at two KACconcentrations 93Figure 29. Comparison of the effect of increased SpoOA(-P) concentration onwildtype and mutant PspoJIG activity 95Figure 30 The effect of SpoOA(-P) concentration on DNaseI footprints in theabsence of RNA polymerase 99Figure 31 Kinetic DNaseI footprints at PspoJjG (non-transcribed strand) 101Figure 32 Kinetic DNaseI footprint at spoIIG (transcribed strand) 102Figure 33 Kinetic DNaseI footprint at 310 C 108Figure 34 Kinetic DNaseI footprint at 250 C 109Figure 35 Kinetic DNaseI footprint at 150 C 111Figure 36 Effect of SpoOA(-P) concentration on oJJG DNaseI footprints 113Figure 37 Effect of increased SpoOA(-P) concentration on DNaseI footprinting atPspoIIGM94h’8 115Figure 38 Effect of SpoOA(-P) concentration on PspoiiG M94184 footprints atconstant RNA polymerase concentration 116Figure 39. In vitro transcription products of PspoJJA 119Figure 40. Primer extension analysis of PoJm transcripts 120Figure 41.A. Stimulation ofP0j.transcnption by increasing SpoOA-Pconcentration 122Figure 41.B. The effect of SpoOA-P on the rate of transcription initiation atPspoIIA 122Figure 42. Effect of increasing & protein concentration on PspoHA activity 124Figure 43. Model for activation of PspoIIG by SpoOA(-P) 133xiiAbbreviations and symbolsAsp aspartate.bp Base pair.C1 RNA polymeraseIP0JIGternary complex.C11 RNA polymeraseISpoOAJPII ternary complex.C RNA polymeraseISpoOA-PIPIjGternary complex.C1 chloride ion.HEPES 4-(2-Hydroxyethyl)- 1 -piperazineethanesulfonic acid.HR heparin-resistant RNA polymerase/promoter complex.HS heparin-sensitive RNA polymerase/promoter complex.kf forward isomerization rate constant.kr reverse isomerization constant.k1 forward rate constant for the formation of apolymerase/promoter complex.k.1 rate constant for the dissociation of a polymerase/promotercomplex.kobs observed overall rate of heparin-resistant complexformation.KAc potassium acetate.KC1 potassium chloride.kDa kilodalton.NaC1 sodium chloride.NTPs nucleotide triphosphates.PAGE polyacrylamide gel electrophoresis.PA2 A2 promoter from the Bacillus phage, 029.PWQJM promoter from the spollA operon of Bacillus subtilis.PspoiiG promoter from the spoliG operon of Bacillussubtilis.SDS sodium dodecyl sulfate.SpoOA-P phosphorylated form of SpoOA protein.(lit) overall (pseudo first-order) rate constant for heparinresistant complex formation.xiilAcknowledgmentsI would like to express my appreciation to Dr. Spiegelman for the opportunity towork in his laboratory and for his thoughtful, patient supervision. I would also like tothank my supervisory committee comprised of Dr. R. A. J. Warren, Dr. J. Benbaset, andDr. J. Kronstad, for their diligent guidance. I must also acknowledge the people in thelaboratory of Dr. J. A. Hoch who contributed to this work by providing me with purifiedSpoOA and phosphorelay proteins. I am especially indebted to Janet Grimsley.I was very fortunate to have had the opportunity to work with several remarkableindividuals during my stay in the ‘Spiegelman lab’. These people include LovemeDuncan, Stephen Wellington, Vera Webb, Dick Pachal, Megan Delahanty, SharonLewis, Valerie Voon, and Anne Green.I would especially like to thank my parents, Richard and Beatrice Bird, for their loveand devotion through the years.Lastly, I must acknowledge the love and support of my wife, Neena. Without herthis thesis would not have been possible.PUVUVIJ1EN‘uaipçqoLwopowoçpapsssaq!LL1IntroductionI. Sporulation in Bacillus subtilis.1. Sporulation as a response to starvation.In the natural environment, microbial growth is often prohibited by the depletion oflimited nutrient resources. For the Gram-positive soil bacterium, Bacillus subtilis,nutrient exhaustion may lead to prolonged periods of starvation. In this event, cellscease to grow vegetatively and differentiate into metabolically inert endospores. Maturespores are characterized by resistance to extremes in temperature, pH and dehydration,and will germinate once they encounter favorable growing conditions. Because eachdifferentiating cell yields a single spore, the sporulation process is not considered to be aform of reproduction but rather a strategy for coping with a barren environment.Sporulation is generally accepted to be one of the most comprehensive examples ofcell differentiation among prokaryotes. The process features a continuum oftransformations in cell physiology, morphology and biochemistry, and is accompaniedby remarkable temporal and spatial coordination of gene expression (for reviews seePiggot et at., 1981; Losick et at., 1984; Errington, 1993). For this reason, sporulationhas attracted the interest of microbiologists and developmental biologists for many years(Keynan et at., 1984). Bacillus subtilis has been the most intensively studied of theendospore forming bacteria as it is particularly amenable to genetic analysis (Youngmanet at., 1989). Genetic and molecular biology techniques have been exploited to isolategenes essential to sporulation (spo genes) and identify the functions of the proteins theyencode. Accordingly, the organism has provided important insights especially intoregulatory mechanisms that govern the expression of developmental genes indifferentiating bacteria.22. The morphology of sporulation in B. subtilis.Sporulation in B. subtilis is characterized by a series of distinctive morphologicalstructures which are depicted in Figure 1. The appearance of specific structures hasbeen used to divide the progression of spore formation into stages of development(Ryter, 1965; Losick et al., 1986; Errington, 1993). While cells growing vegetativelyare defined as stage 0, it was originally thought that stage I began with the cessation ofexponential growth. However, no mutations have been isolated which block sporulationat this point in development. Therefore, stage I is no longer considered to be unique tosporulation (Piggot and Coote, 1976). It is now postulated that B. subtilis enters into astationary phase or ‘transition-state’ where cells may acquire new traits as they attempt toadjust to poor nutrient conditions without initiating a sporulation response. Theseinclude motility, competency and the ability to secrete proteases, nucleases andantibiotics. Given the time and resources devoted to spore formation it is presumed thatinappropriate induction of sporulation would have serious repercussions for B. subtilisby placing the organism at a competitive disadvantage. Only in the event of severe orprolonged starvation will a sporulation response be initiated.The first conspicuous structure uniquely associated with sporogenesis is theformation of an asymmetrically positioned septum that divides the cell laterally into twocompartments of unequal sizes (stage II) (Hitchins and Slepecky, 1969). Completion ofthe septum separates the forespore (small compartment) from the mother cell (largecompartment). Each compartment contains an intact copy of the chromosome and fromthis point patterns of gene expression in the forespore and mother cell begin to diverge(Errington et at., 1990; Margolis et at., 1991). Spore development continues with amigration of the membrane sunounding the cytoplasm of the mother cell, toward thepole of the forespore. Eventually, the forespore is completely engulfed within a doublemembrane of opposite polarities (stage III). The space between the two membranesbecomes the site of cortex synthesis (stage IV). The cortex consists of a cell wall3VII________ ________VI__Figure 1. The sporulation cycle of Bacillus subtilis. aThis cartoon depicts the various morphologies that characterize endosporedevelopment in B. subtilis (Introduction II, 2). Beginning with the vegetative state(defined as stage 0), the sporulation response can only be initiated after DNA replicationhas been completed. The first distinct structure becomes evident with formation of anasymmetric septum (stage II). Following complete engulfment of the forespore (stageIII), the spore cortex (stage IV) and coat (stage V) are synthesized. Once the spore hasundergone maturation (stage VI) it is released through lysis of the mother cell (stageVU).sOV[*)[®ja Adapted from Losick et al., 1986.4material resembling a loosely cross linked form of peptidoglycan (Warth andStrominger, 1972) and is believed to contribute to the heat resistance of matureendospores (Gould, 1984).A tough spore exterior is created with coat proteins that are synthesized within themother cell and deposited on the outside surface of the forespore (stage V) (Jenkinson etal., 1981). At least twelve different spore coat proteins have been identified and sincethe formation of the spore coat occurs in the absence of protein synthesis it has beenproposed that the coat proteins are arranged by self-assembly processes (Jenkinson etal., 1980). Stage VI is associated with maturation of the forespore. It is marked bydormancy and the acquisition of most of the distinguishing properties of an endospore,including resistance to UV radiation, dessication, heat and organic solvents (Dion andMandelstam, 1980; Jenkinson et al., 1980; Gould, 1984). Sporulation culminates withthe release of a mature spore through mother cell lysis (stage VII) approximately 8 - 10hours after the process begins.3. Sporulation genes.Classical genetic techniques have identified over 50 spo genes which are scattered infour loosely defined clusters around the B. subtilis chromosome (Piggot et al., 1990).Mutations within a spo gene arrest spore formation prior to the stage in development thatdepends on the function of its gene product. Consequently, spo gene mutations areeasily classified because their phenotypes are often manifested in developmentalpathways that are blocked at a particular morphology. For instance, stage H mutationsmay permit normal asymmetric septation (stage II) but prevent the subsequentengulfment of the forespore (stage III).Studies which test the expression of spo-lacZ fusions in different spo backgroundshave elucidated dependence patterns and expression times for many spo genes (Zuberand Losick, 1983). Currently, 12 dependence classes of spo genes have beendistinguished based on similarities in time and location of their expression and5comparable patterns of epistasis (Errington, 1993). A major accomplishment of thisstudy has been the identification of various regulatory genes that were discriminated bytheir involvement in the expression of spo genes within a single dependence class.II. Regulation of gene expression during sporulation.1. Negative and positive regulation of spo genes.Although there are several examples of post-transcriptional regulation involvingelaborate mechanisms of proteolytic processing, most of the regulation of spo geneexpression occurs at the level of transcription (Stragier et at., 1988; Healy et at., 1991).l.a. Negative regulation of sporulation: transition-state regulators.During exponential growth, the inappropriate expression of many spo genes isprevented by the transcriptional repressors AbrB, Sm, and Hpr. These proteins are alsoessential for the induction of alternative processes associated with post-exponentialgrowth (Gaur et at. 1986; Perego and Hoch, 1988; Strauch et at., 1989; Kallio et at.,1991). It has been postulated that upon entering the transition-state, AbrB, Sin, and Hpr,function as molecular switches within the cell circuitry to effect the ‘decision’ tosporulate or adopt an alternate strategy in response to nutritional stress. Accordingly,these proteins have been termed ‘transition-state regulators’ (Strauch and Hoch, 1993).1 .b. Positive regulation of sporulation: the sigma factor cascade.Core RNA polymerase from B. subtitis is composed of f3, f3’, o, and ö subunitsand retains the ability to catalyze synthesis of RNA transcripts. However, promoterspecific initiation of transcription is conferred by the a subunit which combines with thecore polymerase to form the holoenzyme (Helman and Chamberlin, 1988). Thus far, 10different sigma factors have been isolated from B. subtilis (Moran, 1989; Debarbuille etat., 1991). The use of alternate sigma factors provides efficient regulation of geneexpression because each a subunit directs the polymerase to transcribe genes that havecommon DNA sequences within their promoters. Usually, these sequences are found at6the —10 and -35 positions with respect to the transcription start-site (Helinan andChamberlin, 1989; Moran, 1988).During spore formation much of the temporal and spatial regulation of spo geneexpression is controlled through an ordered series of a subunit replacements (Losick andPero, 1981; Stragier and Losick, 1990). Each replacement changes the promoterspecificity of RNA polymerase and effectively reorganizes global regulation of geneexpression. At least six different a subunits are involved in the ‘sigma factor cascadet,each directing the transcription of a subset of spo genes at particular times and locations.The first spo genes (the spo0 and spoil genes), are transcribed by RNA polymerasecontaining aA (EGA), the predominant sigma factor in vegetative cells (Kenney andMoran, 1991; Kenney et at., 1991), or aH (EOH), which is encoded by the spoOH geneand is maximally expressed in stationary phase (Carter and Moran, 1986; Dubnau et at,1987; Dubnau et al., 1988; Predich eta!., 1992). Although originally defined assporulation specific, EaH is now recognized to be involved in the transcription of genesnot directly involved in sporogenesis (Albano et at, 1987; Sonenshein, 1989).The first a replacements occur with the appearance of aE and a1, encoded by thespollA and spolIG operons, respectively (Moran, 1989; Stragier and Losick, 1990).They represent the first sporulation specific sigma factors and although both operons areexpressed prior to the completion of septation (Gholamhoseinian and Piggot, 1989), aEactivity is localized to the mother cell while aF directs transcription from within theforespore (Partridge eta!., 1991; Ernngton and illing, 1992). It has been proposed thatmechanisms that control aE and aF activities are somehow linked to engulfment of theforespore (Stragier et at., 1988; Stragier, 1989; Losick and Stragier, 1992). Apparentlyeach a subunit dictates the expression of spo genes in the early development of theirrespective compartments.The last of the developmental sigma factors are, a0 and aK. Like their predecessors,they direct cell-specific transcription. The a0 protein is active in the forespore (Sun et7at., 1989) and aK governs synthesis of the coat proteins from within the cytoplasm ofthe mother cell (Kroos et at., 1989). Therefore, these a subunits are responsible for theexpression of spo genes involved in the final stages of forespore construction andmaturation (Zheng and Losick, 1990).III. Initiation of the sporulation response.1. Conditions required for sporulation.B. subtilis cells sporulate when starved for carbon, phosphate or nitrogen but theresponse is subject to catabolite repression such that an adequate carbon source willprevent sporulation should either of the other two nutrients become limiting (Schaefferet al., 1965; Freese, 1981; Sonenshein, 1989). It is presumed that starvation leads to theaccumulation of a metabolite within the cell that signals the necessity of a sporulationresponse, however, the nature of this molecule has not been determined. It is known thatthe intracellular concentration of GTP falls dramatically at about the time sporulation isinitiated (Lopez et at., 1981; Freese, 1981) and that decoyinine, an antibiotic thatinterferes with GTP synthesis, can be used to induce a B. subtitis culture to sporulateeven in rich media (Mitani et at., 1977).Under natural conditions, efficient sporulation within a B. subtilis population requireshigh cell density (Grossman and Losick, 1988). There is now good evidence that anextracellular factor, apparently an oligopeptide, is secreted and probably functions as apheromone-like substance to communicate a sporulation signal between cells (Perego etaL, 1991a; Rudner etal., 1991). A second precondition for the initiation of sporulationis that it must be coordinated with the cell cycle to ensure that each sporulating cellcontains two copies of the chromosome (Hitchins and Slepecky, 1969; Mandelstam andHiggs, 1974; Dunn et at., 1978), one to be packaged within the spore, and the other toprovide a template for gene expression in the mother cell.82. Genes that regulate the initiation of a sporulation response.The successive expression of alternative sigma factors provides effective temporalregulation of gene activation during development (Introduction II, l.b). However, theinitiation of a sporulation response can not be accommodated by a sigma factor cascadebecause the first inducible spo genes must be transcribed by polymerase alreadytranscriptionally active in vegetative cells. Therefore, some other mechanism mustactivate the early spo genes, including those encoding the first developmental a subunitsthat will commit starving cells to the sporulation pathway.Currently, there are nine loci which have been designated as spoO (spoOA, spoOB,spoOE, spoOF, spoOI-1 spoOf, spoOK spoOL and spoOF) on the basis that mutationswithin these genes block the induction of sponilation (Hoch, 1976; Errington, 1993).All spoO genes are maximally expressed during exponential growth, or become fullyactivated shortly after cells enter stationary phase. Of these genes, spoOA was identifiedas a key regulator of the transition-state because of the highly pleiotropic nature of thespoOA phenotype (Hoch, 1976). No suppressors of spoOA deletion mutations have beenisolated. However, several mutations in spoOA were found to suppress the sporulationdefective phenotypes of other spoO genes including spoOB and spoOF(Hoch et al., 1985;Spiegelman et al., 1990). These observations suggested that SpoOA was indispensableto the induction of sporulation and that its regulating activities were probably modulatedby the products of at least some of the other spoO genes. Elucidation of the exact rolesof each of the spoO genes became possible only after they were cloned and sequenced.3. Sensing the sporulation signal(s).Sequencing of the spoOA gene revealed that its product was homologous to a groupof proteins collectively known as response regulators (Ferrari et al., 1985; Kudoh et al.,1985). Most of these proteins are transcription regulators which control activation ofgenes within a tightly coordinated regulon. All response regulators are paired with asecond type of protein called sensor/kinases to form two component regulatory systems9which are pervasive in bacteria (for reviews see Kofoid and Parkinson, 1988; Stock etal., 1989; Stock et al., 1990; Bourret et aL, 1991). These systems direct appropriatecellular responses to specific environmental changes. Adaptations may be as diverse asthe control of chemotaxis, induction of virulence factors, adjustment to fluctuations inosmolarity, switches in the utilization of alternative nutrient sources, or evenmodifications to cell morphology (Stock et at., 1989). Yet despite this diversity, twocomponent systems share a commonality in the way they sense and direct adaptiveresponse through the use of protein phosphorylation as a mechanism of signaltransduction.All sensor/kinases of two component systems have the ability to perceiveenvironmental change although each is tuned to a separate aspect of the cell’ssurroundings. While some are cytoplasmic proteins, many span the cytoplasmicmembrane to monitor the external environment. Should it detect a significant change, asensor/kinase will catalyse the transfer of a phosphoryl group from ATP to a highlyconserved histidine residue located in its C-terminus (Hess et at., 1988). Thesensor/kinase will then transfer the same phosphate moiety to its cognate responseregulator. This activates the regulatory properties of the reponse regulator and allows itto direct an appropriate cellular response.As a class, response regulators are characterized by significant amino acid identity(typically 20 % or greater) throughout their N-terminus domains (Stock et at., 1989).This portion of the protein interacts with the sensor/kinase and contains the phosphoacceptor site which is invariably an aspartate residue. Similarity between C-terminalregions of response regulators is variable but has permitted many to be grouped intosubfamiies (Ronson et at., 1987; Stock et at., 1989). Response regulators whichmediate an adaptive response by effecting gene expression contain DNA bindingdomains within their C-terminus which allow them to interact with their designatedtargets. However, the DNA binding and transcription modulating properties of these10proteins are activated only after their N-terminal domains have been phosphorylated bytheir sensor/kinase partners (Stock et al., 1989).4. The phosphorelay signal transduction system.Once it had been established that Spo0A was a response regulator, a search for itscognate sensor/kinase was undertaken to identify the two component system believed tocontrol the induction of sporulation. This genetic investigation led to the cloning andsubsequent biochemical analysis of several recombinant spoO proteins resulting in thediscovery of the ‘phosphorelay’. The phosphorelay comprises a signal transductionsystem that is an unprecedented departure from conventional two component regulatorymechanisms (Burbulys eta!., 1991).The transcription regulating activities of Spo0A appear to be controlled by at leasttwo (KInA and KinB) and possibly more sensor/kinases (Perego et a!., 1989;Antoniewski et at., 1990; Trach and Hoch, 1993; Hoch, 1993). Individually, mutationswithin kinA or kinB delay a sporulation response or decrease the level of spore formationin a population of B. subtilis cells. Only double mutations reduce sporulation to zeroleaving cells locked in the vegetative state. While KinA is a soluble protein, it has beendetermined that KinB spans the cytoplasmic membrane with its sensor domainpositioned outside the cell (Trach and Hoch, 1993). Thus, it appears that bothintracellular and external factors are crucial to the induction of a sporulation response(Hoch, 1993).The most remarkable feature of the phosphorelay which thus far is unparalleledamong prokaryotes, is that SpoOA is not directly phosphorylated by sensor/kinaseproteins. Instead, phosphoryl groups are passed from either KinA-P or KinB-P toSpoOA through two intermediate phosphotransferases, SpoOF and SpoOB (Burbulys etat., 1991). Therefore, the phosphorelay comprises an extended signal transductionsystem represented by the following schematic:11KiDA1B SpoOF-P SpoOB SpoOA-PKixAlB -P SpoOF SpoOB -P SpoOAThe entire phosphorelay reaction has been extensively characterized in vitro usingrecombinant KinA, SpoOF, SpoOB and SpoOA proteins. SpoOF appears to be a truncatedversion of a response regulator. It is homologous to the N-terminal half of SpoOA(Trach et at., 1985) and contains an aspartate residue which acts as a phosphoacceptorsite (Burbuyls et at., 1991). SpoOF is a substrate for the kinase activity of KinA andKinB and effectively transfers phosphoryl groups from these proteins to SpoOB. SpoOBdisplays little homology to two component type proteins but is functionally similar tosensor/kinase proteins in that it transmits a signal to a response regulator throughphosphorylation of SpoOA. Like sensor/kinase proteins, the SpoOB-P intermediate isphosphorylated on a histidine residue (Burbulys et at., 1991).5. The function of the phosphorelay.With the onset of starvation, the primary purpose of the phosphorelay is to convert asporulation signal into activation of SpoOA through protein phosphorylation. It shouldbe recognized that because the same phosphate group is passed from KinA or KinB,through SpoOF and SpoOB, to SpoOA, the phosphorelay forms a linear transductionsystem and thus does not amplify a sporulation signal. Therefore, the reason forinserting the two phosphotransferase proteins into the phosphorelay is a matter ofconjecture. SpoOF and SpoOB may simply be required to funnel sensory input into asingle transduction system. This would allow SpoOA to ‘communicate’ with severaldifferent sensor/kinases each monitoring different aspects of the cell’s nutritional state.Alternatively, these proteins may provide additional points of control with which tocoordinate the activation of SpoOA and, ultimately, induction of sporogenesis, with othercellular processes. It is apparent that nutritional, cell density and cell cycle signals are12all integrated into the phosphorelay circuitry (Grossman et at., 1991; Ireton et at., 1993;Hoch, 1993). The mechanisms that accomplish this are still largely undefined althoughthey presumably effect the flux of phosphate through the pathway.Recently, it has been reported that SpoOE, SpoOL and SpoOP are phosphatases thatantagonize signal transduction through the phosphorelay (Perego and Hoch, 1991;Ohlsen et at., 1994; Perego et al., 1994). In vitro experiments have demonstrated thatSpoOA-P and SpoOF-P are targets for SpoOE and SpoOL phosphatase activities,respectively. Because of significant sequence identity between spoOL and spoOP it isexpected that SpoOP will also prove to be a phosphatase of SpoOF-P. The inductionprofiles of spoOE, spoOL and spoOF gene expression suggest that each is controlled by adifferent regulatory system, Therefore, it has been proposed that the products of thesegenes may function to prevent sporulation under various physiological conditions byinfluencing the level of SpoOA phosphorylation (Perego et at., 1994).6. The regulating properties of SpoOA-P.In addition to being sporulation defective, cells that carry spoOA mutations fail tobecome competent, or secrete proteases and antibiotics following entry into stationaryphase (Hoch, 1976). Many aspects of the spoOA phenotype can be attributed to thefailure to repress abrB whose product functions to block the expression of transition-state genes while cells grow exponentially (Introduction II, l.a.) (Zuber and Losick,1987; Perego et al., 1988). However, the repression of abrB can not be the sole functionof SpoOA because cells that contain mutations in both abrB and spoOA are still spo.These cells fail to induce the early spo genes which genetic experiments havedetermined are dependent on SpoOA and the other phosphorelay proteins for activation.Thus SpoOA-P was proposed to be an ‘ambiactive’ regulator of transcription exertingboth negative and positive control over transition-state and early sporulation genes(Perego et al., 1991b).13An in vitro examination demonstrated that purified SpoOA repressed transcriptionfrom the abrB promoter (Strauch et at., 1989; Strauch et al., 1990). Moreover, theprotein was shown to bind two DNA sequences, separated by a single helical turnlocated downstream of the transcription start-site. These sequences, called OA boxes,defmed the canonical SpoOA binding site as 5’-TGNCGAA-3’ (Strauch et al., 1990).Examination of DNA sequences of several spoO and spoil loci believed to be dependenton SpoOA-P for activation, revealed that many of these genes contained putative OAboxes in proximity to their transcription start-sites. The OA boxes were found in bothorientations and in genes transcribed by either EaA or EGH forms of RNA polymerase(Spiegelman et at., 1994). Among those included in the SpoOA regulon were spoIlA,spoliG and its own gene, spoOA. spoOA is transcribed from tandem promoters by EGA(Pv) or E& (Ps) (Yamashita etal., 1986; Chibazakura etal., 1991). It is has beenshown that Pv produces a low constitutive level of SpoOA protein in exponentiallygrowing cells, while Ps provides a substantial increase in spoOA transcription at theonset of sporulation (Strauch et aL, 1992). In the event that sporulation signals aredetected, it appears that the small amount of SpoOA in vegetative cells becomesphosphorylated. This results in a burst of SpoOA synthesis followed by activation of theSpoOA-P dependent genes (Strauch et al., 1992).As noted previously, the spollA and spoliG operons encode aF and aE, the firstsigma factors that are devoted exclusively to the transcription of developmental genes(Introduction II, 1 .b.). Consequently, the activation of these operons represents asignificant step toward cell differentiation. The involvement of SpoOA and the otherphosphorelay proteins in regulating aF and aE synthesis provides potential mechanismfor the initiation of sporulation. The phosphorelay could link the sensing of starvationsignals to the induction of a sigma factor cascade by activating SpoOA. Thus, theprimary objective of the work presented in this thesis was to examine the role ofSpoOA(-P) in regulating transcription initiation at the spollA and spoliG promoters.14IV. Review of transcription initiation.1. Promoter structure.E. coli and B. subtilis promoters are often characterized by conserved hexamencDNA sequences at the -35 and -10 positions relative to the transcription start-site, and anintervening spacer with an optimal length of 16-17 bps (von Hippel et al., 1984;McClure, 1985; Travers, 1987). The spacer effects the linear and angular separation ofthe -35 and -10 hexamers on the DNA axis. Occasionally, flanking DNA sequences areimportant to the transcriptional activity of specific promoters (Ross et al., 1993).Structure/function investigations of several E. coli promoters have determined that the-35 and -10 sequences are essential for promoter recognition by RNA polymerase.Therefore, these two elements and the length of the spacer between them, contribute tothe transcriptional activity of a given promoter (Helman and Chamberlin, 1988; Stefanoand Gralla, 1982b). Generally, there is good correlation between adherence to canonicalpromoter structure and strong promoter activity in vitro (Stefano and Gralla, 1982a;Berg and von Hippel, 1987). Genes and operons that rely on positive regulation foractivation have promoters characterized by weak transcriptional activity when studied invitro. These promoters often have unusual sequences and interact poorly with RNApolymerase in the absence of a specific trans-activating factor (Collado-Vidas et al.,1991).2. The transcription initiation pathway.It is now generally accepted that promoter specific transcription initiation by RNApolymerase is preceded by a minimum of three reaction steps (for reviews oftranscription initiation see Chamberlin, 1974; McClure, 1985; Travers, 1987; Gralla,1990). The transcription initiation pathway is represented in the following model;p + p . C . I 0 —b PNA5ynthe15where R is the polymerase, P is the promoter and C, I, and 0 represent closed,intermediate and open complexes, respectively.Transcription initiation begins as a bimolecular reaction where tight binding of theRNA polymerase to promoter DNA results in the formation of a closed complex. It isbelieved that the polymerase is always in close proximity to the DNA because of its highaffinity for non-specific binding sites. Consequently, the enzyme locates promotersequences by one dimensional diffusion along the surface of the double helix (vonHippel et at., 1984; Mazur and Record, 1989). This allows for rates of association thatare often in excess over those predicted for a diffusion limited process in solution (108M-1 sec-1). The extent of RNA polymeraselDNA contact in closed complexes formed atdifferent promoters is variable. Footprinting experiments have generally shown thatpolymerase covers 50 -70 bps of promoter DNA (Siebenlist et at., 1980; Travers, 1987).Protein/DNA crosslinking studies have demonstrated that the f3 and 13’ subunits of thepolymerase have multiple contacts with promoter DNA in addition to a tight associationbetween the a subunit and the -35 and -10 domains (Chenchick et at., 1981).Evidence for an intermediate step in the initiation pathway has been derived fromkinetic, thermodynamic, and footprinting studies of initiation reactions carried out invitro (Buc and McClure, 1985, Spassky et at., 1985; Roe et at. 1985; Cowing et at.,1989; Schickor et at., 1990). The lack of salt dependency and a large negative change inheat capacity associated with the C — I step has been interpreted as evidence for aconformational change within the polymerase (Ha et at., 1989; Leirmo and Record,1990). It has been postulated that the change in polymerase structure coincides with anucleation of DNA strand separation initially localized to the -10 region of the promoter(Roe et at. 1985). This is followed by an expansion and subsequent migration of themelted region to encompass the transcription start-site resulting in the formation of anopen complex (Leirmo and Record, 1990). Data from experiments which have usedreagents that probe open complex structure indicate that ito 1.5 turns of the DNA helix16are unwound prior to the initiation of RNA synthesis (Wang et al., 1977; Gamper andHearst, 1982; Amouyal and Buc, 1987; Buckle and Buc, 1989). Normally, opencomplexes formed at most E. coli promoters are very stable and initiate RNA synthesisrapidly when provided with nucleoside triphosphates (Spassky et at., 1985; Straney andCrothers, 1985; Levin eta!., 1987).3. Transcription factors and their influence on the initiation reaction.Transcription factors usually bind to discrete DNA sequences located near thepromoters they activate. A survey of positively regulated promoters has established thatbinding sites are usually near the -40 position and often overlap the -35 polymeraserecognition site (Collado-Vidas eta!., 1991). Once bound to the DNA, transcriptionfactors influence the rate of transcription initiation in different ways. The regulatoryfactor can assist in the binding of polymerase to the promoter. This is the case forOmpR which regulates ponn synthesis in Gram-negative bacteria, and PhoB, whichcontrols the phosphate uptake regulon. Both OmpR and PhoB compensate for unusual-35 polymerase recognition sequences in their target promoters by facilitating theformation of a closed complex (Makino et at., 1988; Tsung et al., 1990). Alternatively,a transcription factor may catalyze an isomerization step after polymerase has bound tothe promoter, as predicted for activation of the ) PpJ promoter by the ci protein, orNtrC which controls the glutamine synthetase gene of entenc bacteria. It has beendemonstrated that ci stimulates DNA strand separation in a polymerase/?. Ppji closedcomplex resulting in a transcriptionally active open complex (Hawley and McClure,1982; Li eta!., 1994). NtrC displays ATPase activity and catalyzes open complexformation compensating for the inability of the a54 form of RNA polymerase to meltpromoter DNA (Kustu, et al., 1989; Popham et a!., 1989)17V. The spoliG and spollA promoters.1. The spoliG promoter (PspoiiG).The spolIG operon contains two translational units that are essential to sporulation.The second of these is the structural gene for & (Kenney and Moran, 1987). spoliGtranscription begins approximately 60 minutes after the initiation of sporulation (Kenneyet at., 1991). An analysis of the DNA sequence upstream from the transcription start-site revealed two domains with high identity to the canonical -35 and -10 recognitionsites for a aAtype promoter (Kenney et at., 1989) (Figure 2). Nevertheless, thepositioning of these sites did not conform to a conventional aA promoter because theintervening spacer region was 22 bp long rather than the 16 - 17 bps commonly foundfor B. subtilis promoters. The increased spacer length would alter the rotationalorientation of the -35 and -10 sites drastically. It has been proposed that the unusualstructure of PspoiiG would prohibit appreciable transcription during exponential growthand that an ancillary protein must function to activate the spoliG operon at the onset ofsporulation (Kenney et al., 1989).The interaction of SpoOA and PspoIIG was originally investigated by C. Moran andcoworkers. Using electrophoretic mobility shift and DNaseI protection assays, theydetermined that purified SpoOA protein bound to two regions upstream of PspoHG(Satola et at., 1991). The DNA sequences within these regions contained OA boxes inthe opposite orientation to those found downstream from the abrB promoter. Moreover,point mutations within these sites proved to be deleterious to spoliG transcription in vivo(Satola et at., 1991). Moran and colleagues tested the effect of SpoOA on spoliGtranscription by adding SpoOA protein to in vitro transcription assays that containedpurified EGA and promoter template (Satola et at., 1992). These experimentsdemonstrated that non-phosphorylated SpoOA stimulated transcription from PspojjG. Asan initial investigation into the effect of phosphorylation on SpoOA activity, acetylphosphate was used to obtain a low level of phosphorylated SpoOA. When18CTTCCTcGACAAATrAAGCAGAmCCCTGAAAAAnGTATmCCTCTCAACATTATrGAc4aACI I I I I-100 -90 -80 -70 -60 -50 -40I1TfCCCACAGAGCTFGC ATAC ATGAAGCAAGAAGGGGAACI I I-30 -20 -10 +10Figure 2. The spoIIG sequence.The DNA sequence shown corresponds to the nontranscribed strand of spoIIG andincludes the minimal upstream sequences required for wildtype levels of spoliGexpression in vivo (Satola et al., 1991). Nucleotide positions indicated below thesequence are relative to the transcription start-site (r). The -35 and -10 RNApolymerase recognition sites are boxed while sequences corresponding to SpoOAbinding sites (OA boxes) are underlined. The maximum length of RNA synthesis whenATP and GTP are added to in vitro transcription assays as initiating nucleotides (ResultsI, 2), is designated (.).19phosphorylated protein was added to transcription assays it appeared that stimulation ofspoliG transcription was enhanced. However, relative levels of PspoiiG transcriptionwere never quantitated (Baldus et aL, 1994).2. The spoIlA promoter (PspoIM).The spollA operon contains three loci, with the third being the structural gene for 0F(Fort and Piggot, 1984; Savva and Mandeistam, 1986). The products of the twopromoter proximal genes act synergistically to regulate and process the 0F precursorpolypeptide (Schmidt etal., 1990; Challoner-Courtney and Yudkin, 1993; Mm etal.,1993). Expression of the spollA operon begins approximately 60 minutes after the onsetof sporulation (Savva and Mandelstam, 1986; Errington and Mandelstam, 1986). Wuand collaborators also demonstrated that spollA is transcribed by the E& form of RNApolymerase (Wu et at., 1991).An initial investigation of the regulation of spollA expression involved theconstruction of a series of deletions that extended into the upstream region of thepromoter and corresponded with a graded reduction in transcriptional activity of thepromoter in vivo (Trach et at., 1991). Analysis of DNA sequences revealed severalpotential OA boxes upstream of the spollA transcription start-site (Figure 3) and it wasdetermined through DNaseI footprinting that SpoOA bound to this region of thepromoter (Trach et at., 1991).VI. Main research objectives.1. Investigation into the regulation of PspoiiG and PspoIM.The central aim of this thesis was to undertake a biochemical analysis of thetranscriptional activation of PspoiiG andP0im by SpoOA. This was accomplished byusing recombinant KinA, SpoOF, SpoOB and SpoOA proteins to duplicate thephosphorelay reaction in vitro and thereby obtain high levels of phosphorylated SpoOA2054% 10%(5%GACGATGGGAGACTGGACAAAATTAAGTAATTATGCCGAATGACCACTAI I I I I-90 -80 -70 -60 -50IG1TTGTCACGGTGAAGGAATCATCCGTCGAAATCGAAACACTCATfAI I I I-40 -30 -20 -10Figure 3. The PspoIL4 sequence.The DNA sequence shown corresponds to the non-transcribed strand of PspoIIA.Nucleotide positions indicated below the sequence are relative to the transcription start-site () (Wu et al., 1991). Putative SpoOA binding sites and their relative orientations(5’ -TGNGCAA-3’) are indicated above the sequence The endpoints for threedeletions to upstream regions of the promoter and the in vivo transcription frequenciesassociated with these mutations relative to wildtype promoter constructs, are also shown(Introduction V, 2).21(SpoOA-P). Samples of phosphorelay reactions were added to a transcription assaysystem to quantitatively assess the effect on PspoiiG andP0im activity. Theseexperiments demonstrated that the transcriptional activity of PspoiiG andP0im wasstimulated by SpoOA-P. This provided biochemical evidence to support the hypothesisthat the phosphoretay controls the initiation of a sporulation response by functioning as atransduction system to convert sporulation signals into the activation of SpoOA.Once it had been established that phosphorylation enhanced the ability of SpoOA tostimulate transcription, the mechanism through which SpoOA-P influenced transcriptioninitiation was examined. This investigation was confined to the activation of PspoiiGand involved a kinetic analysis of the effect of SpoOA-P on rates of transcriptioninitiation. These experiments indicated that SpoOA-P accelerated the rate of initiationby effecting an intermediate step in the overall reaction. This interpretation wassupported by DNaseI protection assays which demonstrated that SpoOA and SpoOA-Pinfluenced isomerizations in polymerase/PSOJJG ternary complexes.22Materials and MethodsI. Standard molecular biology techniques.1. Plasmid DNA restriction digests.Except for large scale preparations of PspoJiG template discussed below, reactionvolumes were generally 10 - 20 p.L and the plasmid DNA concentration was 50 - 100nM. Normally, 5 - 10 units of restriction enzyme was added (Bethesda ResearchLaboratories, New England Biolabs, Pharmacia) to digests that contained bufferprovided by the supplier of the enzyme and the reactions were incubated at 370 C forapproximately one hour. Reaction samples were usually analyzed followingelectrophoresis through mini-agarose gels (Materials and Methods I, 4).2. Ligation reactions and transformation of competent cells.The subcloning of promoter DNA fragments was accomplished by mixing insert andvector DNAs in reaction volumes that were generally 20- 50 tL depending on the totalamount of DNA used. Usually, 5 - 10 units of T4 DNA ligase (Bethesda ResearchLaboratories) was added to each reaction. Ligations involving fragments withcompatible ends were incubated at room temperature for 2 -4 hours, while reactions thatcontained blunt ended DNA fragments were incubated at 16° C overnight. Ligationreactions were diluted 1: 5 with TE buffer (10 mM Tris-Cl pH (8.0), 1.0 mM EDTA)prior to being used for the transformation of competent cells. Transformations werecarried out using competent cells (DH5cx strain ; hsdR 17 (rk, mk+), recA 1) purchasedfrom Bethesda Research Laboratories, using the procedure recommended by thesupplier.3. Plasmid DNA preparations.Boiling lysis or cleared lysis procedures were used for small or large scalepreparations of plasmid DNA, respectively, and were carried out as described bySambrook et al. (1989). A CsC1 (SchwarzlMann Biotech optical grade) density gradient23procedure, was used to purify large scale plasmid preparations and was followed byseveral butanol extractions to remove ethidium bromide. The DNA was dialyzed in 3 -4 exchanges of 4 L of TE buffer (Sambrook et al., 1989). DNA concentration and puritywas determined by absorbance readings at 260 and 280 nm. Plasmid DNA was stored inTE buffer at 4° C.4. Agarose and polyacrylamide gel electrophoresis.Electrophoresis of DNA, RNA or proteins, was carried out in agarose orpolyacrylamide gels as described by Sambrook et al. (1989). Mini-agarose gels (0.7 -1.4 %) for analysis of DNA restriction digests, were prepared on 5 x 8 cm glass slidesand contained 1.5 .tg/ml ethidium bromide. DNA was generally electrophoresed in 1/2X TBE buffer (45 mM Trizma Base, 45 mM boric acid and 1 mM EDTA (pH 8.0)) for30 to 45 minutes (8 - 10 volts/cm) after which bands of DNA fragments were observedby placing the gels on a UV transilluminator (Ultra-Violet Products Inc.).Phosphorelay proteins were examined by electrophoresmg purified protein, orsamples from phosphorelay mixtures, through 15 % SDS - polyacrylamide gels. Gelsthat contained samples from radioactive phosphorelay reactions used to quantitate thelevel of SpoOA phosphorylation (Materials and Methods V, 1), were subjected toelectrophoresis at 10 - 15 volts/cm. RNA polymerase was examined at various stages ofpurification after electrophoresis through 14 - 20 % exponential gradient SDS -polyacrylamide gels (Dobinson and Spiegelman, 1987) at 20 - 25 volts/cm. Allnonradioactive proteins were observed after staining gels with Coomassie Brilliant BlueR (Sigma Chemical Co.). 32p - labeled protein bands were detected by autoradiographyafter an overnight exposure to x-ray film (Kodak X-Omat RP) at 4°C.- labeled RNA from transcription assays was separated by electrophoresisthrough 7.0 M urea, polyacrylamide gels (6 - 8 %). These gels were electrophoresed in1/2 X TBE at 40 - 50 volts/cm. RNA bands were detected by autoradiography followingan overnight exposure to x-ray film at -70° C. 32P - labeled Pspoi.iG DNA used for24DNaseI footprinting experiments, was isolated from non-denaturing polyacrylamidegels electrophoresed in 1 X TBE buffer (89 mM Trizma Base, 89 mM boric acid and 2mM EDTA (pH 8.0)) at 10 - 12 volts/cm. Bands containing 32P - labeled PspoJJGfragments were located by autoradiography, excised from the gel, and electroeluted indialysis tubing as described by Sambrook et al. (1989).5. DNA sequencing.DNA sequencing reactions were carried out using a Sequenase version 2.0 kitpurchased from United States Biochemical Corporation and the protocol recommendedby the supplier. Double stranded sequencing reactions were carried out using [cc32PIdATP (3000 Cilmmol; NEN) and the various primers described in Materials andMethods IV, 7 & VI, 1. The reactions were analyzed following electrophoresis through7 M urea, polyacrylamide gels (6 - 8%) in 1/2 X TBE.H. Promoter constructs.1. Subcloning of PspoIL4.Construction of pllA-28 which carried the spollA promoter, began with the cloningof a 1138 bp DNA fragment isolated from the vector pKK232-8 (Brosius, 1984)following a Pvull restriction digest. This fragment contained the rho independenttandem terminators from the rRNA rrnB operon of E. coli, and was cloned into theHincII site of pUC18. The resulting plasmid was called pPS-28 and could be used totest supercoiled forms of promoter template in transcription assays.A 950 bp Hindifi - AvaI DNA fragment, containing DNA sequences correspondingto the -200 to ÷700 region of the spolIA operon was isolated from the plasmid pPP1 15(Wu and Piggot, unpublished observations) and was subcloned into pPS-28 creatingpflA-28. The structure of pIIA-28 was confirmed by DNA sequencing, which showedthat the spollA promoter was oriented such that transcription was directed toward therrnB T12terminators positioned approximately 350 bps downstream.252. The PspoiJG COnStrUCt.The plasmid pUCIIGtrpA which carried the PspoIIG was a generous gift from C.Moran. This plasmid carried a portion of the spoliG operon roughly extending from the-100 to the + 130 position relative to the transcription start site. This fragment had beencloned into the Hindffl - Barn HI sites of pUC19 (Satola et al., 1991). The promoter waspositioned approximately 160 bp upstream from a rho independent transcriptionterminator isolated from the trpA gene of E. coli which had been cloned into the Hindsite of the vector.3. The P construct.The plasmid pKKA2 was constructed by subcloning a 200 bp DNA fragmentobtained from p328-5 (Dobinson and Spiegelman, 1985) and was ligated into a siteupstream from the promoterless chioramphenicol resistance gene of pKK232-8 (Brosius,1984). This template was linearized by a HindIII restriction digest and used to producerun-off transcription products in transcription assays.III. Isolation and purification of RNA polymerase, 0H, and the phosphorelayproteins.1. Purification of EA.RNA polymerase 0A holoenzyme used for PspoJJG andP transcription assays, wasisolated from B. subtilis strain 168S as described by Dobinson and Spiegelman (1985).This procedure was modified to prepare the holoenzyme used in Pspoim transcriptionassays. Following the glycerol gradient step, fractions containing active enzyme werecombined, concentrated, and loaded onto a 5 cc heparin - Sepharose column that hadbeen equilibrated with buffer containing 50 mM sodium chloride, 10 mM Tns-C1 (pH7.9), 10 mM EDTA, 10 mM MgC12, 10 % glycerol, 10 mM f3-2-mercaptoethanol and 60pM phenylmethyl sulfonyl fluoride. The column was washed with 10 mL of the samebuffer except that 0.1 M potassium acetate was substituted for sodium chloride. The26polymerase was then eluted with the above buffer supplemented with 1.2 M potassiumglutamate. The glycerol content of the polymerase preparation was increased to 50 %and the enzyme was stored at -20° C.2. Preparation of core RNA polymerase.Core RNA polymerase used for in vitro transcription ofP0im, was isolated bydiluting purified aA RNA polymerase with P cell buffer (0.05 M Hepes pH (7.9), 10mM EDTA (pH 8.0), 10 mM f-2-mercaptoethano1, 60 pM phenylmethyl sulfonylfluoride and 20 % glycerol). The polymerase was loaded onto a 10 cc phospho-cellulosecolumn that had been equilibrated with P cell buffer containing 0.1 M potassiumglutamate. The column was washed with five column volumes of the same buffer andthe polymerase was eluted with a 100 mL linear gradient of 0.1 - 1.5 M potassiumglutamate in P cell buffer. Core polymerase was observed to elute at potassiumglutamate concentrations between 0.30 and 0.45 M. Fractions containing polymerasewhich had been depleted of the aA subunit, as determined from SDS - PAGE analysis,were pooled and concentrated. Glycerol was added to increase its content to 50 %, andthe polymerase preparation was stored at -70° C.3. Purification of a1 protein.Recombinant & protein used in spollA transcription assays, was provided by J. A.Hoch and colleagues. The method used to purify the protein has been previouslyreported (Trach et al., 1991).4. Purification of the phosphorelay proteins.Recombinant KinA, SpoOF, SpoOB and SpoOA proteins were supplied by the J. A.Hoch laboratory. The procedures used to purify these proteins has been reportedelsewhere (Burbulys et al., 1991). The concentrations of various phosphorelay proteinpreparations was determined from absorbance readings at 280 nM by the Hochlaboratory.27IV. In vitro transcription assay procedures.1. Preparation of theP0iandP templates.Because P.,oIM was assayed in supercoiled fonn, no processing of pIIA-28 wasrequired to prepare the template for transcription assays. For assays that involved P,the plasmid pKKA2 was cleaved with Hindlil. This digest cleaved the DNA at a singlesite approximately 170 bp downstream of the transcription start site so that the templateproduced a runoff product in transcription assays.2. Preparation and isolation of the PspoiiG template.PspoHG was assayed as supercoiled or linearized DNA template. To prepare a largeamount of linearized PspoIIG template, approximately 130 - 150 .tg of pUCllGtrpA wasdigested with PvuII, which released a promoter fragment approximately 600 bp inlength. The entire digestion reaction (300 - 350 IlL) was loaded into the wells a 12 x 12cm agarose gel (1.5 %) and electrophoresed in 1 x ThE buffer (at approximately 8 - 10volts/cm). Bands containing the promoter fragment were located by placing the gel on aUV transilluminator and were recovered using a DEAE membrane isolation procedure(Sambrook et al., 1989). Once the DNA had been eluted from the membrane, it wasbutanol extracted twice, diluted to 0.25 M NaC1 with sterile distilled water, andprecipitated with 3 volumes of 95 % ethanol. The promoter fragment was resuspendedin 0.5 mL of DNA storage buffer (10 mM Hepes pH 8.0, 40 mM KAc and 1 mMEDTA), and its concentration was determined by absortion readings at 260 nm.Typically, the promoter concentration was found to be between 80 - 150 nM. Becausethe promoter fragment also carried the trpA transcription terminator (Materials andMethods II, 2), PSPOHGtranscription assays, whether performed on supercoiled plasmidor DNA fragments, produced a transcript approximately 160 bases in length.3. In vitro transcription assays performed on PspoiiG and P.Transcription assays used to test the effect of SpoOA(-P) onP0JJGand Ptranscriptional activity, were conducted in a total volume of 20 p.L and a DNA28concentration that was normally 2-5nM. The assays were carried out in 0.65 mLmicrofuge tubes by mixing template DNA with lx transcription buffer (40 mM Hepes(pH 8.0), 5 mM magnesium acetate, 0.1 mM EDTA, 0.1 mM dithiothreitol and 0.1mg/mL bovine serum albumin) to a volume of 14 jiL. These mixtures also contained 0.4tM ATP, 0.01 iM GTP and 2-5 pCi of [cc-32P]-GTP (800 Cilmmol; NEN). The tubeswere warmed to the desired assay temperature (usually 370 C) for 2 - 4 minutes beforeadding 2 j.tL of a phosphorelay sample diluted to an appropriate concentration (Materialsand Methods V, 1). SpoOA(-P) and DNA mixtures were incubated 4- 6 minutes beforean initiation reaction was begun with 2 IlL of purified EOA. Reaction tubes wereincubated an additional 4 - 6 minutes before adding 2 IlL of a mixture containing 1.0mg/ml heparin, 4.0 mM CTP and 4.0 mM UTP. The heparinlnucleotide mixtureeffectively stopped initiation reactions but permitted RNA elongation from heparinresistant complexes (Results, section I, 2). After 10 minutes, transcript elongation wasassumed to be complete. Five pL of denaturing gel loading buffer (8.0 M urea, 180mM Trizma base, 180 mM boric acid, 0.004 mM EDTA, 0.02 % bromophenyl blue,0.02 % xylene cyanole) was added to the reactions prior to electrophoresis through 8 %denaturing polyaclyamide gels. Transcript bands were detected by autoradiography andwere excised from the gels. The level of Cerenkov radiation in the gel slices containingtranscripts was measured by scintillation counting and was used to determine promoteractivity (Materials and Methods IV, 5).4. PspoiiG transcription rate assays.Transcription rate assays were performed on purified DNA fragments that carriedPspoiiG. The final DNA concentration was usually 2 nM. The assays were begun bymixing the DNA, 0.4 pM ATP, 0.01 pM GTP and 15-20 pCi of [c&32PJGTP (800Cilmmol; NEN) in lx transcription buffer to a volume of 112 pL. Rate assays thatexamined the effect of salt concentration on transcription initiation rates were conductedby adding the desired amount of NaC1, KC1, or KAc to this mixture. Once the mixture29had been warmed to 370 C, 16 I.tL sample that contained an appropriate dilution of anequilibrated phosphorelay mixture (Materials and Methods IV, 5), was added andincubated with the DNA for 3 minutes. An initiation time-course reaction was begunwith the addition of 18 tL of RNA polymerase (EGA) that had been previously dilutedto obtain the desired concentration of active enzyme. At regular intervals, 18 tLsamples were removed and added to 0.65 mL microfuge tubes containing 2 tL of 1.0mg/mL heparin, 4 pM CTP and 4 pM UTP. This mixture blocked further transcriptioninitiation but allowed transcript elongation from heparin-resistant complexes. Transcriptelongation reactions were stopped with 5 p.L of denaturing gel loading buffer and thereactions were electrophoresed through 8 % SDS - polyacrylamide gels. The extent oftranscription in each sample was quantitated as described in Materials and Methods IV,5.5. Determination of PspoiiG transcription activity.The number of full length transcripts produced in PspoiiG transcription assays wascalculated by measuring the level of Cerenkov radiation in a 2 .tL sample of labelingmix (containing[c-32P]GTP/GTP) that had been added to transcription assays. Thisprovided a measure of the radioactivity (cpm) added to each transcription assay. Thisvalue was divided by the total number of GTP molecules in transcription reactions, andmultiplied by 36, the number of GTPs incorporated into a full length PspoiiG transcript.The final value was taken as a measure of cpm per PspoiiG transcript and was used toquantitate the number of transcripts produced by comparison to the level of Cerenkovradiation in gel slices containing PspoiiG products.6. PspoHA transcription assays.Transcription assays conducted on PspoiiA were initiated by adding 2 tL of RNApolymerase that consisted of recombinant & protein mixed with either core polymeraseor EGA, to a 14 tL mixture of PspolIA template and buffer that contained 40 mM HepespH 8.0, 10 mM MgC12, 0.1 mM dithiothreitol, 0.1 mM EDTA and 100 j.tg/mL bovine30serum albumin. The polymerase and DNA were incubated together for 5 minutes, afterwhich the reactions were subjected to a 5 minute challenge with 2 .tL of 1.0 mglmLheparin. Transcript elongation from heparin-resistant complexes were initiated with theaddition of GTP, ATP and CTP to 0.4iiM, UTP to 0.Olp,M and 2-4 I.tCi of Rz-32P]UTP(800 Cilmmol, Amersham). Elongation reactions were incubated for 10 minutes andthen terminated with 5 tL of denaturing gel loading buffer. The reactions wereelectrophoresed through 5 % urea - polyacrylamide gels. 32P-labeled RNA was detectedby autoradiography and quantitated by measuring Cerenkov radiation levels in gel slices.7. Primer extension analysis of PspoiiG and PspoHA transcripts.To determine the start site for in vitro transcription from PspoJJG and PspoiiApromoters, RNA from transcription assays was recovered from polyacrylamide gels byelectroelution in dialysis tubing (Sambrook et al., 1989). The transcripts were ethanolprecipitated, resuspended in sterile distilled water and used as template for primerextension reactions.Primer extension reactions were carried out using purchased DNA primers that werecomplementary to sequences downstream from either PspoJJA or PspoiiG (spollA, 5’-GGCGAATATCATCCTFCTCC-3’; spoliG, 5’-TCAGAAAATAAATGCCG-Y). Theprimers were 5’ end labeled by mixing 1 iL of primer (40 0D260/mL), approximately300 tCi of [y-32P]ATP (8000 Cilmmol; ICN), and 10 units of T4 polynucleotide kinase(Bethesda Research Laboratories) in 20 IlL of 1 X kinase reaction buffer (50 mM Tris -Cl (pH 7.6), 10 mM MgC12, 5 mM dithiothreitol, 0.1 mM spermidine, 0.1 mM EDTA(pH 8.0)). Labeling reactions were incubated at 37° C for 45 minutes and then at 650 Cfor 10 minutes to inactivate the enzyme. 32P - labeled primer was separated fromunincorporated nucleotide by NAC columns using the procedure recommended by thesupplier (Bethesda Research Laboratories). The efficiency of end labeling wasdetermined by measuring the level of Cerenkov radiation in a diluted sample of elutedprimer.31Primer extension reactions were begun by mixing RNA template with approximately50,000 cpm of the appropriate end labeled primer in 1 X annealing buffer (50 mM TrisCl (pH 8.0), 60 mM NaCl, 0.5 mM dithiothreitol and 1 mM EDTA) to a volume of 5 iiL.The primer and template were incubated at 90° C for 2 minutes. Annealing reactionswere allowed to cool slowly to 450 C before adding 2 p.L of 5 X focus buffer (250 mMTris-Ci (pH 8.3), 375 mM KC1, 50 mM dithiothreitol, 15 mM MgC12), 2 IlL of a mixtureof dATP, dCTP, dTl’P and dGTP (2.5 mM each), 0.5 p.L sterile distilled water and 0.5j.iL of avian myeloblastosis virus reverse transcriptase (Promega). The reaction wasincubated at 45° C for 1 hour after which the extension products were ethanolprecipitated and resuspended in 5 tL of formamide gel loading buffer (2.5 X TBE, 95 %formamide, 0.02 % bromophenyl blue and 0.02 % xylene cyanole). A sample wasloaded onto a 7 M urea, 8 % polyacrylamide gel and electrophoresed next to sequencingreactions carried out on promoter DNA with the same primer as used in the extensionreaction.V. Phosphorelay reactions.1. Typical phosphorelay reaction procedures and quantitation of SpoOAphosphorylation.Phosphorelay reactions were carried out by mixing recombinant KinA, SpoOF,SpoOB and SpoOA proteins in 1 X transcription buffer. Reaction volumes variedaccording to the requirements of different experiments, but were usually 20- 60 jiL.Normally, SpoOA concentration was 4.0 jiM, while KinA, SpoOF and SpoOB wereapproximately 0.4 IIM each. Kinase activity was initiated with the addition ATP to afinal concentration of 1.0 mM and the reactions were incubated for 60 - 90 minutes atroom temperature to allow equilibration of the phosphorelay. Samples from equilibratedphosphorelay reactions were added directly to transcription assays following dilution toan appropriate SpoOA(-P) concentration with 1 X transcription buffer.32The degree of SpoOA phosphorylation was quantitated by adding[32P]ATP (8000Cilmmol; ICN) to phosphorelay incubations. Once the reaction had equilibrated,samples containing a known amount of SpoOA protein were separated by SDS- PAGE(Materials and Methods I, 4) and protein bands were detected by autoradiography. Thelevel of Cerenkov radiation in gel slices containing SpoOA protein was measured byscintillation counting and was compared to the quantity of radioactivity originally addedto the phosphorelay reaction. Normally, 60- 80 % of the SpoOA protein added to aphosphorelay mixture was phosphorylated once the reaction had equilibrated.Mixtures of phosphorelay reactions, which were added to transcription assays toassess the effect of nonphosphorylated SpoOA, contained all the phosphorelay reactioncomponents except KinA and ATP. It was necessary to omit KinA from these mixturesto avoid SpoOA phosphorylation once samples were added to transcription assays whereATP was required to form heparin-resistant complexes (Results I, 2). It had beenobserved that KinA had no direct influence on the level of transcription from eitherPSpoJJG or Pspoim (Results II, 2). Assays that tested PspoiiG transcription in the absenceof SpoOA received either an aliquot of 1 X transcription buffer or a sample from amixture that included all the phosphorelay proteins except SpoOA.2. Phosphorelay time-course reactions.To couple a time-course phosphorelay reaction to PspoiiG transcription assays, twoseparate kinase reactions were conducted by mixing SpoOA, SpoOF and SpoOB to aconcentration of 1.0 jiM, and KinA to a concentration of 0.1 p.M. At time zero, ATPwas added to one reaction to give a final concentration of 50 p.M. At various intervals2.0 jiL samples were removed from this reaction and added directly to transcriptionassays. The second kinase reaction was initiated with an ATP mixture that includedapproximately 100 jiCi of{32PjATP (8000 Cilmmol; ICN). The total ATPconcentration in the radioactive reaction was also 50 p.M. At various times sampleswere removed from the labeled reaction and mixed with protein gel loading buffer (5033mM Tris-Ci (pH 6.8), 100 mM dithiothreitol, 2 % SDS, 0.02 % bromophenol blue and10 % glycerol) to arrest kinase activity. The proteins in these samples were laterseparated on a 15 % SDS - polyacrylamide gel. The level of SpoOA phosphorylationwas calculated following a measurement of the Cerenkov radiation in gel slicescontaining labeled SpoOA protein as described above (Materials and Methods V, 1).VI. DNaseI protection assays.1. End labeling of PspoJJG DNA fragments.Labeling of the 5’ ends of sIIG DNA fragments was carried out by digestingapproximately 20 -25 .tg of pUCIIGtrpA with either HindIll (to label the transcribedstrand) or Barn HI (to label the non-transcribed strand). The ends of digested DNA weredephosphorylated with alkaline calf intestinal phosphorylyase (Pharmacia). Thereactions were then phenol extracted and ethanol precipitated. The DNA wasresuspended in 15 IlL of sterile distilled water and mixed with 2 IlL 10 X kinase buffer,2 EIL [y-32P]ATP (8000 Cilmmol; ICN), and 1 JIL of T4 polynucleotide kinase(Bethesda Research Laboratories). The kinase reaction was incubated at 370 C for 30minutes before the enzyme was inactivated by a 15 minute incubation at 650 C. Thereaction volume was increased to 50 tL with sterile distilled water before adding 4 tLof Pvu II and 6 tL of the appropriate 10 X restriction buffer to release the labeledfragment from the vector. After a 1 hour digestion, the reaction was loaded onto a 5 %polyacrylamide gel and electrophoresed in 1 X TBE buffer. The 32P - labeled promoterfragment was localized by autoradiography and electroeluted from gel slices in dialysistubing (Sambrook et al., 1989). Recovered DNA was ethanol precipitated andresuspended in 100- 200 IlL of DNA storage buffer (10 mM Hepes (pH 8.0), 40 mMKAc and 1 mM EDTA). 32P labeling of the promoter fragment was quantitated bymeasuring Cerenkov radiation in a 2 IlL sample of the resuspended DNA.342. DNaseI footprinting of various SpoOA(-P) concentrations.Individual footprint reactions were carried out by adding 8 - 10 x io cpm of endlabeled PspoiiG fragment to 1.7 mL microfuge tubes that contained 0.2 mM ATP in 1 Xtranscription buffer (Materials and Methods IV, 3). The volume of these mixtures was16 iL if RNA polymerase was to be added, or 18 jiL for SpoOA(-P) footprinting in theabsence of polymerase. Reaction tubes were warmed to the desired assay temperaturefor 2- 5 minutes before adding 2 jiL of phosphorelay reaction sample containing eitherno SpoOA, SpoOA or SpoOA-P (Materials and Methods V, 1). The protein and DNAwere incubated for 5 minutes followed by a second 5 minute incubation after theaddition of a 2 p.L sample of RNA polymerase. A partial DNA digestion was carried outby adding 4 jiL of 4.0 jig/mL DNaseL The DNA was digested for 10 seconds before thereactions were quenched with 75 j.tL of DNaseI stop buffer (Hepes (pH 8.0), 0.1 % SDS,4 mM EDTA, 270 mM NaC1 and 3 jig of sonicated calf thymus DNA). The reactionswere ethanol precipitated, resuspended in 5- 8 p.L of formamide gel loading buffer andthe level of Cerenkov radiation recovered in each sample was determined by scintillationcounting. Equal quantities of radioactivity from each footprint reaction were separatedon a 8 % urea - polyacrylamide gel. The gel was dried and the DNaseI protectionpatterns were analyzed following autoradiography.3. Time-course DNaseI protection assays.Time-course (or kinetic) footprint assays were carried out by incubating 1.7 mLmicrofuge tubes to the desired reaction temperature. Each tube contained a 112 jiLmixture of approximately 8 x iO cpm of end labeled PspoJJG fragment and 0.2 mMATP, in 1 X transcription buffer. A 16 p.L sample was removed and treated as describedbelow to provide a control DNaseI digestion pattern. A 14 j.tL sample of a phosphorelaymixture containing no SpoOA, SpoOA or SpoOA-P (Materials and Methods V. 1) wasadded to the remaining DNA and the reactions were incubated for 1 minute. An 18 jiLsample was then removed and treated with DNaseI to serve as a control reaction that35provided a DNaseI pattern resulting from the binding of SpoOA or SpoOA-P, in theabsence of RNA polymerase. A 12 jIL aliquot of RNA polymerase was then added tothe reaction to begin a time-course binding reaction where samples were removed atregular intervals and treated with DNaseI.DNaseI digestions were conducted by adding samples removed from bindingreactions to microfuge tubes containing 4 j.tL of 4 .tg/mL DNaseI. In the case of controldigestions where DNA samples were 16 or 18 tL, 4 or 2 j.tL of 1 X transcription bufferwas added to the DNaseI solution so that all digestions were carried out in a totalvolume of 24 pL. The samples were digested for 10 seconds before the addition of 75tL of DNaseI stop buffer. The footprint reactions were then precipitated, subjected toelectrophoresis, and analyzed exactly as described above.VII. Mutagenesis and end labeling ofP1,jjG by polymerase chain reaction.1. Generation of PspoHGM94’8 by PCR.To construct the mutant promoter PspoiIGM94I8 , a primer was purchased whichcontained a DNA sequence complementary to the -91 to -71 region of the transcribedstrand of PspoiiG. This primer carried two mismatched G residues corresponding topositions -82 and -81 of the OA box centered at -84 (see Figure 2). A polymerase chainreaction (PCR) utilizing this primer and the universal reverse primer complementary tothe vector portion of pUCflGtrpA, was expected to produce a double stranded PspoIIGconstruct where a portion of the OA box at -94 would be deleted in addition to insertionof the two point mutations into the OA box at -84.PCR reactions contained 25 ng of pUCIIGtrpA plasmid previously digested withPvuII, the four dNTPs (Pharmacia Ultrapure deoxynucleoside 5-triphosphates) at 2.5mM each, 1 pmole each of the mutagenesis primer and universal reverse primer, and 1.tL of Taq polymerase (Boeringer Mannheim) in a final volume of 50 .tL. Reactionswere carried out in buffer provided by the supplier of Taq polymerase enzyme and were36overlaid with mineral oil. The mutant promoter fragment was amplified by 30 cycles ofdenaturation, annealing and extension steps carried out at 95° C for 30 seconds, 54° Cfor 1 minute and 72° C for 1 minute, respectively. This was followed by a final DNAextension reaction at 72° C for 5 minutes. Synthesized DNA fragments were recoveredfrom 1.4 % agarose gels using the DEAE membrane procedure (Sambrook et al., 1989)and following ethanol precipitation the DNA was resuspended in DNA storage bufferand quantitated by absorption readings at 260 nm. Sequencing of the double strandedDNA product confirmed that two mismatches had been incorporated at the -82 and -81positions of the OA box at -84, and that the distal half of the OA box centered at -94 hadbeen deleted.2. 32P - labeling ofPsp0JJGM94I8 for DNaseI protection experiments.End labeling of Psp0JJGM94I8 promoter fragment for DNaseI protection studies wasaccomplished by conducting PCR reactions with the same - labeled primer as usedfor primer extension of PspoiiG transcripts (Materials and Methods IV, 7). ThePspoIIGM94l’8 promoter fragment was mixed with the mutagenesis primer (Materials andMethods VI, 1) and the labeled primer and PCR reactions were carried out exactly asdescribed above. The labeled promoter fragment was electroeluted from apolyacrylamide gel as described for 32p - labeled wildtype promoter (Materials andMethods VI, 1). The DNA was ethanol precipitated, resuspended in DNA storagebuffer and stored at 4° C. The labeled fragment was used in DNaseI footprintingexperiments as described for the wild-type promoter (Materials and Methods VI, 2).37ResultsI. Ii? VtTO PspoiiG transcnption assays.1. Transcription assay procedure.Transcription assays were initiated by incubating RNA polymerase (Figure 4) withpromoter DNA, usually under varying conditions of ionic strength, temperature, orreactant concentrations. Products of these binding reactions were then challenged withheparin, a competitive inhibitor of transcription. Heparin has been shown to bind freepolymerase irreversibly and to cause the rapid dissociation of polymerase bound to nonspecific sites on the DNA (Walter et al., 1967). Only polymerase that is specificallybound to promoter DNA sequences is resistant to heparin inhibition. Elongation ofRNA from heparin-resistant polymerase/promoter complexes was initiated with theaddition of nucleoside triphosphates (NTPs). The number of transcripts produced intranscription assays was measured following gel electrophoresis of reaction mixtures(Methods and Materials IV, 5).Because it rapidly sequesters all polymerase which has not formed resistantcomplexes, heparin ensures that only a single round of transcription can occur at eachpromoter when added either before or simultaneously with NTPs. Consequently,transcript production is proportional to the number of heparin-resistant complexesformed in a binding reaction. A measure of the number of transcripts synthesized in atranscription assay provides a quantitative appraisal of promoter activity in terms ofheparin-resistant complex formation. In this work, in vitro promoter activity isexpressed as the percentage of promoter templates that produced an RNA.2. Heparin-resistant complex formation at PspoHG.PspoiiG transcription assays produced no significant transcription when all four NTPswere added to binding reactions simultaneously with hepann. However, when bothATP and GTP were included in polymerase/P0JJGincubations before the addition of38Figure 4. SDS - polyacrylamide gel of RNA polymerase.To estimate the relative purity of RNA polymerase during large scale preparations ofthe enzyme, samples from glycerol gradient fractions (lanes 1 - 10) containing RNApolymerase were separated by a 14- 20 % exponential gradient SDS - PAGE andstained with Coomassie Blue. (Materials and Methods III, 1). In this example, fractionsrepresented by lanes 1-7 were combined and concentrated by heparin - Sepharosechromatography. Samples of concentrated polymerase were electrophoresed in lanes Aand B. Bands representing the largest subunits of RNA polymerase holoenzyme areindicated to the right.12345678910 AB1pp4.39heparin, CTP, and UTP, promoter activity was substantial. Because ATP and GTP arethe first NTPs incorporated into a nascent transcript, this precondition suggested thatonly RNA polymerase which had initiated transcription at PspoJIG was resistant toheparin inhibition. Initiating nucleotides are a common requirement for the formation ofheparin-resistant complexes at several B. subtilis promoters when assayed in vitro(Dobinson eta!., 1985 & 1987; Whipple and Sonenshein, 1992). In the case of PspoIIG,RNA polymerase can synthesize a pppApA dimer when provided with ATP, or atranscript up to 11 nucleotides in length when supplied with both ATP and GTP (seeFigure 2). The exact step at which initiated complexes became heparin-resistant wasnever investigated. However, it appeared that the polymerase must have proceeded pastthe synthesis of a dinucleotide since the addition of ATP alone did not yield heparinresistant complexes. Heparin-resistant complexes formed at PspoiiG were very stableover time and readily elongated full length transcripts when provided with CTP andUTP.3. Mapping of the PspoiiG transcription start-site.To ensure promoter specificity and define the start-site for in vitro transcription fromPspoiiG, RNA produced in transcription assays was electroeluted from polyacrylamidegel slices and used as template for primer extension analysis (Materials and Methods IV,7). When compared to PspoiiG DNA sequencing reactions (Figure 5), the primerextension product was found to originate from the same transcription start-site as hadbeen identified for spolIG mRNA produced in vivo (Kenney et at., 1989).II. Effect of SpoOA-P on the transcriptional activity of PsponG.1. In vitro phosphorelay reactions.To phosphorylate SpoOA, in vitro kinase reactions were conducted usingrecombinant phosphorelay proteins, KinA, SpoOF, SpoOB, and SpoOA (Figure 6A).Phosphorelay reactions were incubated at room temperature and were initiated by40-‘°EHFigure 5. Primer extension analysis of RNA produced in PspoiiG transcription assays.RNA from PspoiiG transcription assays was isolated from polyacrylamide gel slicesby electroelution and was used as template for primer extension reactions (Materials andMethods IV, 7). The extension product was analyzed by PAGE and compared to DNAsequencing reactions using PspojjG template and the same primer as used in the primerextension reaction. The sequence ladder shown corresponds to the non-transcribedstrand of P spoliG. The -10 RNA polymerase recognition site is indicated to the left. Theprimer extension product, indicated by the arrow, maps to the position proposed to bethe in vivo transcription start-site (Kenney et at., 1989).AGCT41adding ATP to a mixture of the four proteins (Materials and Methods V, 1). Labeling ofphosphorelay proteins with [y-32P]ATP, is demonstrated in Figure 6B. Once thephosphorelay reactions were completed and the components had been separated by SDS- PAGE, the degree of SpoOA phosphorylation was determined by measuring Cerenkovradiation in gel slices containing a known amount of SpoOA protein. Normally, it wasfound that more than 50 % of the SpoOA proteins in equilibrated phosphorelay reactionswere phosphorylated.2. Test of phosphorelay components in PspoiiG transcription assays.To test the effect of SpoOA-P Ofl PspoIIG activity, aliquots taken from equilibratedphosphorelay reactions were added to transcription assays that contained purified DNAfragments that carried PspoiiG (Materials and Methods IV, 2). Because these samplesalso contained ATP and the other phosphorelay proteins, it was important to verify thatnone of the phosphorelay components other than SpoOA, affected PspoiiG activity.Figure 7 shows an autoradiogram of labeled RNA products from transcription assaysthat contained various combinations of phosphorelay components. The transcriptionassay that contained a sample from an equilibrated phosphorelay reaction (lane 6)exhibited increased RNA production indicating that transcription had been stimulated bySpoOA-P. In contrast, no other assay showed an increase in transcription. Therefore, itwas apparent that none of the other kinase reaction components stimulated promoteractivity above the basal level of transcription (lane 1). Because the variouscombinations of phosphorelay proteins were incubated with ATP before they wereadded to transcription assays, it was concluded that KinA-P, SpoOF-P, and SpoOB-P hadno effect on PspoHG transcription.3. Effect of SpoOA(-P) concentration on PspoiiG activity.The effect of phosphorylated or non-phosphorylated SpoOA (SpoOA(-P)) on PspoJJGactivity, was investigated by adding serial dilutions of phosphorelay reactions totranscription assays. These samples were incubated with PspoiiG template prior to the42A12345BFigure 6A. SDS - polyacrylamide gel containing purified phosphorelay proteins.Samples of the recombinant proteins used in phosphorelay reactions wereelectrophoresed through a 15 % SDS - PAGE and stained with Coomassie Blue. Eachlane contains: lane 1, KinA (55 kDa); lane 2, SpoOB (28 kDa); lane 3, SpoOF (15 kDa);lane 4, SpOOABD (17 kDa); and lane 5, SpoOA (30 kDa). SpOOABD is a proteolyticproduct of a trypsin digest of purified SpoOA. It represents the C - terminal half of theintact protein and includes the DNA binding domain. This protein was not added tophosphorelay reactions since it lacks the phospho-acceptor site (Asp56), but was addedto transcription assays to test its effect on spoJJG activity (Results IV, 9 & 10).Figure 6B. Autoradiogram of 32P - labeled phosphorelay proteins separated by SDS -PAGE.Samples removed from various mixtures of phosphorelay proteins that had beenincubated with [y-32P]ATP were separated on a 15 % SDS - polyacrylamide gel. 32P -labeled proteins were detected by autoradiography (Materials and Methods V, 1). Thisautoradiogram demonstrates the autophosphorylation of KinA and 32P - labeling of theother proteins in each reaction. Reactions loaded in each lane contained the followingproteins; lane 1, KinA only; lane 2, KmA and SpoOF; lane 3, KinA, SpoOF and SpoOB;lane 4, KInA, SpoOF, SpoOB and SpoOA.1234-KinAOA013OFATPSpoOFSpoOBSpoOAFigure 7. Phosphorelay component test on PspoJiG activity.Various mixtures of phosphorelay proteins were incubated with ATP and then addedto transcription assays that contained spojiG template. 32P-labeled transcripts wereseparated by electrophoresis through a 6 % SDS - polyacrylamide gel and were detectedby autoradiography. Lanes 1 - 6 show RNA produced in transcription assays thatcontained the mixtures of phosphorelay proteins indicated below each lane.43KinA - - + + + +- + + + + +-- + + +- -- + +- +44addition of RNA polymerase. Kinase reaction samples that contained nonphosphorylated SpoOA were taken from a mixture of phosphorelay components that didnot include either ATP or KinA. It was necessary to omit KinA to avoidphosphorylation of SpoOA once the sample was added to transcription assays whichcontained ATP (Materials and Methods V, 1). Because there is no independent assay todetermine the specific activity of purified recombinant SpoOA, the concentrations ofSpoOA added to transcription assays are given as total protein.Figure 8 shows an autoradiogram of labeled RNA from assays where supercoiledplasmid or purified DNA fragments were used as PspoiiG template. It was observedthat PspoHG transcription from either form of template was stimulated by SpoOA(-P).PspoiiG stimulation reached a maximum when Spo0A-P concentration was 160 nM(Figure 9). This maximum was approximately ten fold higher than the level oftranscription measured in assays that did not contain a phosphorelay sample. Additionof non-phosphorylated SpoOA also stimulated PspoiiG transcription, however, theincrease was slight and occurred only at the highest SpoOA concentrations.Because there was no apparent difference in the relative levels of transcriptionstimulation from supercoiled or relaxed PspoiiG template, it was decided that furtherinvestigations into PspoiiG activation would be carried out with linear DNA templates.These assays produced lower levels of background transcription which significantlyimproved the accuracy of promoter activity measurements.4. The effect of SpoOA-P on P activity.To determine whether transcription activation by SpoOA-P was promoter specific,phosphorelay samples were added to transcription assays that contained P, isolatedfrom the Bacillus subtilis bacteriophage, 029 (Dobinson and Spiegelman, 1985). Anexamination of the DNA sequences in the vicinity ofP revealed no obvious OA boxes.Therefore, SpoOA-P was not expected to affect P transcription. As for PspoiiG , RNApolymerase requires ATP and GTP as initiating NIPs to form heparin-resistantABSpoOA SpoOA-P‘1 2 3 4 5 6 7”l 2 3 4 5 6 1’SpoOA SpoOA-P1 2 3 4 5 6 7”I 2 3 4 5 6L45Figure 8. Effect of SpoOA(-P) concentration on in vitro transcription from PspoiiG.Samples from serial dilutions of phosphorelay reactions that contained nonphosphorylated SpoOA or SpoOA-P (Materials and Methods V, 4), were added totranscription assays carried out with supercoiled (A) or linear (B) PspoiiG. The 32Plabeled transcripts were separated by electrophoresis through a 6 % urea -polyacrylamide gel and were detected by autoradiography. The final concentration ofSpoOA protein added to each assay was: lane 1, no protein; lane 2, 10 nM; lane 3, 20nM; lane 4, 40 nM; lane 5, 80 nM; lane 6, 160 nM and lane 7, 320 nM.7’46Figure 9. Effect of SpoOA(-P) concentration on PspoiiG activity.Bands containing the 32P - labeled spoIIG transcripts from transcription assays thatcontained serial dilutions of nonphosphorylated SpoOA (-.o—) or SpoOA-P (-.-)(described in Figure 8), were excised from polyacrylamide gels. The number oftranscripts was quantitated by measuring Cerenkov radiation (Materials and MethodsIV, 5). The number of transcripts divided by the number of spoJJG templates in eachassay provided a measure of promoter activity and was plotted as a function of totalSpoOA protein concentration in the transcription assay. Transcription assays werecarried out with supercoiled (A) or linearized (B) spoJJG template.0 0 0 >©templatetranscribedw—‘I, 0 o;>© N0/D‘°‘spoIIG0°‘°templatetranscribed0I-fl0N 0N 0N 0.48complexes at P in vitro (Dobinson and Spiegelman, 1987). This indicated that RNApolymerase has similar transcription initiation properties at the two promoters. Ptranscription assays were carried out at various concentrations of SpoOA or SpoOA-P asdescribed for assays carried out with PspoIIG but no influence on promoter wasobserved (Figure 10). Thus, it was concluded that stimulation of PspoiiG transcriptionalactivity was a promoter specific effect and probably required binding of Spo0A-P tospecific binding sites on the DNA.5. Coupling of a phosphorelay time-course reaction to PspoiiG transcription assays.To correlate PspoiiG transcription stimulation with the degree of SpoOAphosphorylation, a series of transcription assays was coupled to a phosphorelay time-course reaction. Trial time-course experiments had demonstrated that the time requiredfor phosphorelay reactions to equilibrate could be controlled by adjusting ATPconcentration. Phosphorelay reactions that contained 50 tM ATP required at least 60minutes to reach maximum SpoOA phosphorylation. Although this maximum wasapproximately 50% lower than in reactions that contained higher ATP concentrations, aslower kinase reaction was necessary to carry out consecutive transcription assays thatcontained phosphorelay samples with intermediate levels of SpoOA phosphorylation.SpoOA phosphorylation was monitored in a second kinase reaction that contained [y32P]ATP. Samples were removed from the radioactive reaction and added to SDSprotein gel loading buffer to denature the proteins thereby terminating kinase activity.The 32P-labeled proteins were separated by SDS-PAGE and the level of SpoOAphosphorylation was determined for each sample (Materials and Methods V, 1).Labeled and non-labeled phosphorelay reactions were initiated simultaneously to a finalATP concentration of 50 jiM. Because they were carried out under nearly identicalconditions, it was assumed that the degree of SpoOA phosphorylation in the tworeactions was similar.49a)cuEa)Figure 10. Effect of increased SpoOA(-P) concentration on in vitro transcription fromPA2•Samples from serial dilutions of phosphorelay reactions that contained SpoOA (-b-)or SpoOA-P (-A-) (Materials and Methods V, 1), were added to transcription assayscarried out on the 029 promoter, P. PA2 transcriptional activity was quantitated as forthe spoiiG transcription assays described in Figure 9 and is plotted as a function of totalSpoOA protein concentration.4V.03Cu2100 80 160 240 320[SpoOAl (nM)50Once kinase activity had been initiated, samples were removed from the non-radioactive reaction at regular intervals and immediately added to PspoHG transcriptionassays to a final SpoOA concentration of 100 nM. Figure 11 shows autoradiograms of32P-labeled of proteins from the radioactive phosphorelay reaction, and PspoiiGtranscripts produced in transcription assays that contained non-radioactive kinasereaction samples. It was apparent that PspoHG transcription increased dramatically asthe phosphorelay progressed (Figure 1 1B). SpoOA phosphorylation measured insamples removed from the labeled phosphorelay reaction, is plotted in Figure 1 1C alongwith the levels of Pspoi.iG transcription. This plot demonstrates that increasedstimulation of PspoHG transcription paralleled SpoOA phosphorylation. The first sampleremoved from the kinase reaction after it had been initiated with ATP appeared tostimulate PspoiiG transcription disproportionately. This was probably because of a rapidphosphorylation of SpoOA protein after the kinase sample was added to the transcriptionassay that contained 400 p.M ATP (Materials and Methods V, 2). Maximum PspoiiGtranscription, obtained with a phosphorelay sample taken 40 minutes after beginning thekinase reaction, was approximately 10 fold higher than in an assay that contained aphosphorelay sample taken prior to initiating kinase activity. This experiment was takenas compelling evidence that SpoOA-P stimulated PspoiiG activity and that the level ofstimulation was dependent on the degree of SpoOA phosphorylation.III. Investigation of reaction conditions affecting PspojiG transcription.1. Temperature effects on PspoiiG transcription.In vitro transcription, particularly from relaxed DNA template, has been shown to bea temperature sensitive process (Travers, 1987; Leirmo and Record, 1990). Toinvestigate the temperature dependency of PspoIIG transcription assays were carried outat temperatures ranging from 12° to 37° C. Figure 12 shows that transcription fromlinearized PspoiiG template was extremely sensitive to temperature change, even in the51Figure 11. Effect of intermediate levels of SpoOA phosphorylation on transcriptionfromPspoiiG.Samples removed from a phosphorelay reaction at various times after kinase activityhad been initiated, were added to PspoiiG transcription assays.(A) The increase in SpoOA phosphorylation over time, was followed by sampling aphosphorelay reaction that contained [y-32P]ATP. The samples were immediatelymixed with protein gel loading buffer to terminate kinase activity and were laterelectrophoresed through a 15% SDS - polyacrylamide gel (Materials and Methods V, 1).The 32P - labeled protein bands were localized by autoradiography.(B) Time-course samples taken from a non-radioactive phosphorelay reaction wereimmediately added to PspoHG transcription assays (Materials and Methods V, 2). The- labeled transcripts produced in these assays were separated by PAGE and detectedby autoradiography.(C) Bands containing 32P - labeled SpoOA protein or PspoiiG transcripts were excisedfrom polyacrylamide gels and level of Cerenkov radiation in the gel slices was measuredto allow quantitation of SpoOA phosphorylation (-0-) or PspoJJG activity (--)(Materials and Methods IV, 5). These values are plotted as a function of time.52Ao 15s 3 W W It I5 1W 2V 24 27 3W 4W 5Wa a 0 0 esea SpoDAa a 0 0 • fl SpoOB• • SpoOFB0 15s r w 9 12 l5 1W zr 25 2T 3W 4W 5W——C4.K/rse/’/Nd///.%a)aC) 00 3. -30C a.Cu Cl)0’IIiOtime (mm)53Figure 12. Temperature sensitivity of transcription from PspoiiG.PspoiiG transcription assays were carried out at various temperatures. Transcriptionwas quantitated by measuring Cerenkov radiation in gel slices containing PspoiiGtranscripts which had been separated by electrophoresis through a 6% ureapolyacrylamide gel and detected by autoradiography (Materials and Methods IV, 5).Promoter activity measured in transcription assays that contained no SpoOA (a), or 200nM SpoOA (0) or Spo0A-P (•), was plotted as a function of temperature.a).00Cl)CCua)CU0.Ea)temp (°C)10 20 30 4054presence of SpoOA-P. PspoiiG activity in transcription assays containing 200 nMSpooAor SpoOA-P, declined sharply at lower temperatures and was essentially zerobelow 27° C.2. The effect of ion concentration on PspoIIG transcription.In vitro transcription is normally very sensitive to salt concentration (Shaner et at.,1983; Roe et at., 1984; Leirmo and Record, 1990). This salt sensitivity results becauseof the high negative charge density of DNA molecules. In an aqueous salt solution,cations accumulate next to DNA molecules forming a steep ion concentration gradientwhen compared to the electrolyte concentration in bulk solution. This phenomenon hasbeen termed the ‘polyelectrolyte effect’ (Lohman, 1985; Leinno and Record, 1990). Theaccumulation of cations (or counterions), is essentially independent of total saltconcentration and in the presence of monovalent cations, 88 % of the charge associatedwith the phosphate groups of the DNA is effectively neutralized (Lohman, 1985). WhenRNA polymerase binds to promoter DNA, or melts the helix, counterions are displacedinto the bulk solution providing a substantial entropic contribution to the transcriptioninitiation reaction (Lohman et at., 1978; Shaner et at., 1983; Lohman, 1985).Transcription is favored under conditions of low salt concentration because the steeperion gradient provides a larger increase in entropy.To examine the salt dependency of PspoJJG. increasing concentrations of NaC1 wereadded to transcription assays. When the salt was added prior to RNA polymerasePspoiiG transcription was abolished at NaC1 concentrations of 100 mM and above(Figure 13A). This effect was observed whether SpoOA-P was added to transcriptionassays or not. When NaC1 was added to assays after RNA polymerase and initiatingnucleotides had been incubated with PspoHG no salt sensitivity was observed at anyNaC1 concentration (Figure 13B). It was concluded that increased NaC1 concentrationadversely affected the process of transcription initiation at and that thestimulatory effect of SpoOA-P could not compensate55Figure 13. Influence of NaC1 concentration on transcription from PspoiiG.To determine whether NaC1 affected the initiation of RNA synthesis, the salt wasadded to mixtures of DNA, ATP, GTP and buffer before beginning an initiation reactionwith the addition of RNA polymerase (A), or by adding the salt simultaneously withinitiating nucleotides after polymerase had been incubated with promoter template (B).Completed transcription reactions were electrophoresed through 6 % polyacrylamidegels and 32P-labeled transcripts were detected by autoradiography. NaCl concentrationsadded to each reaction were; lane 0, no NaC1 added; lane 1, 50mM; lane 2, 100 mM;lane 3, 200 mM; lane 4, 300 mM; lane 5, 400 mM; lane 6, 500 mM. Reactions whichcontained either 200 nM SpoOA or SpoOA-P are indicated.SpoOA SpoOA-PABo 1 2 3 4560 1 2 34 5S6SpoOA01 2 34 5SpoOA-P601 234 5 656for the inhibition. In addition, it appeared that RNA polymerase in its heparin-resistantstate was insensitive to salt inhibition. Similar salt effects were observed when KC1 wassubsthuted for NaC1 (Figure 14). Although it appeared that transcription initiationassays that contained Spo0A-P tolerated small increases in KC1 concentration,transcription still diminished rapidly as the KC1 concentration approached 100 mM. Incontrast, assays that did not contain SpoOA-P exhibited little or no transcription at 20mM KC1 and above.It has been reported that the salt sensitivity of in vitro transcription can be modulatedby the replacement of Cl- with organic anions such as glutamate or acetate (Leirino etat., 1987; Ha et aL, 1992). Transcription assays containing various inputs of potassiumacetate (KAc) were carried out to examine its effect on PspoHG activity (Figure 15).This experiment demonstrated dramatic differences in the salt sensitivity of transcriptionassays that contained either no SpoOA, SpoOA or SpoOA-P. Transcription in assays thatcontained no SpoOA, or non-phosphorylated SpoOA, decreased sharply with increasedconcentrations of KAc. However, promoter activity in assays that contained SpoOA-Pwas only slightly affected. Although the molecular basis for the anion effect ontranscription initiation is not known (Ha et at., 1992), it was concluded that changes inKAc concentration might be used to probe differences in PspoiiG transcriptionstimulation by the various forms of the SpoOA protein (Results IV, 10).IV. Investigation into the mechanism of transcription activation by SpoOA-P.1. PspoiiG transcription rate assays.Once it had been established that SpoOA-P enhanced PspoJJG transcriptional activityin vitro, studies turned to an examination of the stimulation mechanism. The purpose ofthese investigations was to determine whether PspoiiG stimulation was accompanied byan increase in the rate of transcription initiation. Transcription rate assays wereconducted by adding RNA polymerase to a mixture of Pspoi.iG template, ATP and GTP57no SpoOA123450SpoOA-P12345Figure 14. Effect of KC1 concentration on PspoiiG transcription.KC1 was added to transcription assays prior to RNA polymerase. Final saltconcentrations in each assay was; lane 0, no KC1 added; lane 1, 20 mM KC1; lane 2, 40mM KC1; lane 3, 60 mM KC1; lane 4, 80 mM KC1; lane 5, 100 mM KC1. Reactionscarried out in the absence of SpoOA, or with 200 nM SpoOA-P are indicated.SpoOA-P12345Figure 15. Effect of increasing KAc concentration on PspoHG activity.Autoradiogram of a polyacrylamide gel showing PspoiiG transcripts generated intranscription assays that contained various KAc concentrations without SpoOA, or in thepresence of 400 nM SpoOA(-P). KAc was added to individual transcription assays priorto RNA polymerase. Final salt concentrations in each assays was; lane 0, no KAcadded, lane 1, 20mM; lane 2, 40 mM; lane 3, 60 mM; lane 4, 80 mM; lane 5, 100 mM;lane 6, 120 mM. Reactions that contained no SpoOA, SpoOA or Spo0A-P are indicated.58no SpoOA SpoOA012345012345 6‘0 6’59to begin a transcription initiation reaction. At regular intervals, samples were removedand added to a mixture of heparin, CTP, and UTP to block the initiation reaction butallow RNA elongation from heparin-resistant complexes. The production of full lengthtranscripts in each sample was assumed to be proportional to the number of heparinresistant complexes formed at the time the assay was sampled. Therefore, these assaysmeasured the rate of heparin-resistant complex formation. The correlation betweenheparin-resistance and the initiation of RNA synthesis (Results I, 2), indicated that ratesof complex formation were equivalent to rates of transcription initiation.Figure 16 shows a time-course of heparin-resistant complex formation in rate assaysthat contained no SpoOA, or 400 nM SpoOA-P. Two conclusions were derived from thisplot. First, although the maximum levels of transcription were very different in eachassay, heparin-resistant complex formation appeared to be complete within 10 - 15minutes of adding RNA polymerase. Secondly, the rate of approach to maximumtranscription appeared to be significantly faster in the assay that contained SpoOA-P.2. Measurement of rate constants for PspoiiG transcription initiation.Because RNA polymerase required initiating nucleotides to reach the heparin -resistant state, it was apparent that at least one heparin-sensitive intermediate precededits formation. Since the assay used to determine the rate of initiation at PspojiG detectedonly heparin-resistant complexes, the production of these complexes may be describedas a single step isomerization;krHP (Ri)where HS is a heparin-sensitive intermediate that converts to HR, a heparin-resistantcomplex. The observed rate of HR formation (kobs) is a function of the association (kf)and dissociation (kr) rate constants and will follow first-order kinetics if the overallCxE0.C.)>1.1-’.IC.)Cu00..time (mm)60Figure 16. Time-course of heparin-resistant complex formation at PspojjG in thepresence and absence of SpoOA-P.A time-course of heparin-resistant complex formation was begun by adding RNApolymerase to mixtures of PspoiiG template, initiating NTPs (ATP and GTP), and eitherno SpoOA (0) or 400 nM SpoOA-P () (Materials and Methods V, 1). At various timessamples were removed and added to a solution of heparin, CTP, and UTP to stop thereaction while allowing transcript elongation from heparin-resistant complexes. The 32P- labeled RNA was separated by electrophoresis through a 6% urea - polyacrylamide geland promoter activity was quantitated by measuring Cerenkov radiation in transcriptbands localized by autoradiography (Materials and Methods IV, 5).10 5 10 15 2061reaction is dominated by a single slow step, and if all the reaction steps are either true orpseudo first-order.When transcription rate assays are carried out under conditions of excess RNApolymerase concentration, HR formation should follow pseudo first-order kinetics.Thus, the isomerization of HS complexes may be treated as a first-order decay reactionwith the rate of approach to maximum HR formation given by the equation;d[HR]dt = - (k1+ kr)[HP] + kf[PT] (R2)where [PT] is the total concentration of heparin-sensitive and heparin-resistantcomplexes (Appendix I, 3). A general solution to equation (3) is given by theexpression;Ln(1- [HP1QD” = - (--)t (R3)where ‘r (tau) is equivalent to likobs, and [FIR] is the final HR concentration at reactioncompletion (Appendix I, 3). Therefore, a plot of Ln(1 - [HR]i[HR]) versus time (kobsplot) should yield a straight line with a slope equal to the negative of the observed rateconstant ( - (lit)), for the overall process of heparin-resistant complex formation.Two additional aspects of plots should be considered. Rate constants derivedfrom kobs plots are independent of the completion levels of HR formation in differentassays. Therefore, kobs values obtained from assays that contained no SpoOA or SpoOAP could be directly compared to assess how the rate of HR formation was affected.Lastly, if the overall production of HR is dominated by a single slow, or rate limitingstep, thenk plots should produce a straight line regardless of the actual number ofreaction steps involved. Consequently, t measurements did not require a detailedunderstanding of the actual reaction mechanism for HR production.623. Tau analysis.Rates of transcription initiation for many E. coli promoters have been investigated bytau analysis (McClure, 1980; Hawley and McClure, 1980; Stefano and Gralla, 1982;Giladi et al., 1992). The analysis has allowed investigators to probe individual steps ofthe initiation process by observing how changes to various parameters (includingtemperature, ion concentration, or promoter mutations) affect specific rate constants(Stefano and Gralla, 1982; Roe et al., 1984; Roe et al., 1985). A tau analysis of PspoIIGtranscription initiation was undertaken to identify which reaction step was affected bySpoOA-P.The process of heparin-resistant complex formation at PspoiiG appeared to involve atleast two reaction steps. These are represented by the model;k1_____HS HP (R4)krwhere RNA polymerase and PspoiiG combine to form a heparin-sensitive complexfollowed by an isomerization to the heparin-resistant state. Under conditions of excessRNA polymerase concentration the model is reduced to[P]k1_P HS HP (R5)k1 kr(Appendix I, 4). By applying the steady state assumption (that the change in [HSJ isnegligible) it can be shown that the rate of HR formation is described by expression (5);d[HP]= k[Hs]- kr[HP] (R6)63which can be rearranged to;d[HPJ= -(--)[HP] + p (R7)(Appendix I, 3).A solution for lit depends on the reaction mechanism (Strickland et al., 1975).According to the two step reaction in model (R4);k[PJ(k+k)÷k k— 1[PJ+k+kGiven the assumption that kr is negligible compared to kf which is indicated by thestability of heparin-resistant complexes, this expression can be reduced to;k [P1k— k1[P] + k1 + k(or the reciprocal form;= 1 = k1+ k (L’ + _L. (RlO)kfk1 \[P]/ k(Thus a plot of tau versus li[R] should yield a straight line with an ordinate interceptequal to likf and a slope of (k..1 + kf) I kfkl.64A Bseconds>seconds>20 40 60 60 10 2030 40I-——’Figure 17. Effect of Spo0A concentration on PspoiiG transcription rate assays.Transcription rate assays were begun by adding polymerase to mixtures of spoIIGtemplate, ATP, GTP and either no SpoOA (A) or 400 nM SpoOA-P (B). At regularintervals samples were removed and added to a mixture of heparin, CTP and UTP toblock the reaction and facilitate elongation of full length transcripts from heparin -resistant complexes. Two 15 minute time-point samples were taken from each initiationreaction to measure completion levels of transcription. The 32P - labeled RNA in eachsample was separated by PAGE and detected by autoradiography (shown above).Promoter activity in time-point and completion samples were quantitated (Materials andMethods IV, 5) and used to calculate overall rate constants for each transcriptioninitiation reaction (see Figure 18).65Figure 18. Example kobs plots from PspoiiG rate assays that contained various RNApolymerase concentrations.- labeled RNA from transcription rate assays was separated by PAGE andlocalized by autoradiography. RNA levels were quantitated by measuring Cerenkovradiation in transcript bands separated by polyacrylamide gel electrophoresis (Figure 17;Methods and Materials IV, 5). These levels were assumed to be proportional to theconcentration of heparin-resistant complexes present in time-point ([HR]) or completion([HR]) samples. The rate of approach to rate assay completion was determined byexpressing the level of transcription in time-point samples as [HR]/[HR] (HR*), andthe data was plotted as ln(1 - HR*) versus time (RR* = [HR]/[HR],) (Results IV, 2).Rate constants for the overall process of heparin-resistant complex formation (kobs)were calculated from the slopes of lines drawn through data sets using linear least-squares analysis. In general, the coefficient constant for these lines was 0.8 or greater.Thek5 plots shown here are from rate assays that contained polymerase concentrationsof 11 nM (A), 14 nM(), 20 nM (•)and 33 nM(o). These assays contained either noSpoOA (A) or 400 nM SpoOA-P (B).CD C,) CDCD C,,, CDIn(1-HR*)a,C N C0In(1-HR*)C N C— C C- C C67Table I. kobs values measured for PspoiiG transcription rate assays that containeddifferent RNA polymerase concentrations.The k0 and tau (llkobs) values shown below summarize results from separateexperiments. In some cases, measures ofk5 and tau were averaged from multipleassays conducted at a given RNA polymerase concentration. These values are plotted inFigure 19.RNA polymerase averaged kobs tau (sec)concentration (pM) (sec-1 x 102)no SpoOA 0.008 0.376 (1) 266 ± 800.010 0.313 (3) 319 ± 1200.011 0.340 (1) 294 ± 880.013 0.235 (2) 426 ± 300.014 0.326 (1) 306 ± 920.017 0.352 (3) 284 ± 1310.020 0.353 (2) 283 ± 560.025 0.348 (2) 287 ± 221400nM 0.008 1.58(’) 63.3 ± 19SpoOA-P 0.010 2.22 (2) 45.0 ± 40.011 2.66(’) 60.2 ± 180.013 1.74 (2) 57.5 ± 50.014 1.65(’) 60.6 ± 180.0 17 1.44 (2) 69.4 ± 220.020 1.25 (2) 80.0 ± 300.025 1.17 (1) 85.5 ± 26Note: figures in parentheses denote number of times experiment was repeated at thegiven RNA polymerase concentration.6804.0p0 0 0 0 0.1-II • I • I • I •40 60 12) 1401/LRNAP] (jiM1)Figure 19. PspoiiG tau plot.The tau values shown in Table I are plotted as a function of the reciprocal RNApolymerase concentration. Lines for data sets obtained from rate assays that containedno SpoOA (o), or 400 nM SpoOA-P (.), were calculated by linear least-square analysis.694. The PspoiiG taU plot.The mechanism of transcription initiation at PspoiiG was investigated by measuring‘cobs for rate assays that contained various RNA polymerase concentrations that were atleast 5 fold greater than the concentration of PspoiiG template. These assays wereconducted with and without phosphorelay samples to observe the effect of SpoOA-P onthe initiation reaction (Figure 17). Rate constants were determined from kobs plots likethose shown in Figure 18. Because these plots suggested straight lines, it was concludedthat the RNA polymerase concentrations used in these experiments were sufficientlyhigh to allow heparin-resistant complex formation to follow pseudo first-order kinetics.In addition, the steeper slopes of the lines representingk values for transcriptionassays that contained SpoOA-P, indicated that the factor stimulated a rate limiting step inthe production of heparin-resistant complexes at PspoiiG.‘cobs values measured for several transcription assays conducted with and withoutphosphorelay aliquots, were averaged (Table I) and plotted as tau versus the reciprocalof the RNA polymerase concentration (Figure 19). The slopes of the lines calculated forthis plot, appeared to be zero suggesting that the rate of transcription initiation at PspoiiGwas independent of RNA polymerase concentration in the presence or absence ofSpoOA-P. The obvious effect of SpoOA-P was to cause a substantial downward shift ofthe ordinate intercept suggesting a significant increase to kf. Thus, SpoOA-P hadapparently influenced the rate PspoiiG transcription by catalyzing an isomerization steprather than affecting the binding of polymerase to the promoter.In considering equation (RiO) (Results IV, 3), a lack of rate dependence on RNApolymerase concentration indicated that the ratio (k..1 + kf)Iklkf was very small, If it isassumed that k..1 is much greater than kf the slope of a tau plot becomes lIKBkf, whereKB is the equilibrium binding constant for the bimolecular association of the polymeraseand promoter (KB =k11c). A slope 1/KBkf would be expected for a transcriptioninitiation process referred to as a rapid equilibrium mechanism (Roe et al., 1984; Roe et70al., 1985). According to this mechanism, ifk1/k.. >> kf, binding of RNA polymerase toPspoiiG would equilibrate very rapidly relative to a forward isomerization step. Thus,the overall rate of transcription initiation would be dominated by the unimolecularisomerization of HS to HR, and tau would be independent of polymerase concentration.5. Effect of DNA concentration on rate of initiation at PspoiiG.Rate studies of E. coli promoters have revealed that tau values are not affected bychanges in promoter template concentration (Stefano and Gralla, 1980). It has beenproposed that there is no rate dependence on template concentration because virtually allthe RNA polymerase added to transcription assays is quickly bound to promoter andnon-specific sites on the DNA. Stefano and Gralla (1980) proposed that rates ofpolymerase transfer between different sites is not affected by increased templateconcentration because the ratio of promoters to non-specific sites is not altered. Toexamine whether rates of hepann-resistant complex formation at PspoiiG were alsounaffected by promoter concentration, transcription rate assays were carried out atvarious PspoiiG template concentrations. The kobs values obtained from theseexperiments are plotted as a function of PspoIIG concentration in Figure 20. The plotdemonstrates that kobs values did not change with increased concentrations of DNA,therefore, the rate of transcription initiation at PspoiiG was independent of promoterconcentration.6. Effect of GTP concentration on initiation rates at PspoiiG.Normally, a final concentration of 10 jiM GTP was added to PspoiiG transcriptionassays when [y-32P]-GTP was used to label RNA transcripts (Materials and Methods IV,3). However, it became a concern that low GTP concentrations could influence rateassays, particularly when they contained SpoOA-P where high levels of transcriptioninitiation might reduce GTP concentration to the point where heparin-resistant complexformation was affected. To test this possibility, k values were measured for two rateassays containing 400 nM SpoOA-P and either 10 or 40 jiM GTP (Figure 21). Since the71overall rate of initiation in the two assays was essentially identical, it was concluded that10 iM GTP was an adequate concentration for conducting transcription assays withoutaffecting rates of initiation.7. Effect of SpoOA(-P) concentration on the rate of initiation at PspoIIG.Since 400 nM Spo0A-P had been observed to stimulate the rate of transcriptioninitiation at PspoiiG (Figures 16 & 19), various dilutions of phosphorelay samples weretested in rate assays to examine the relationship between the rate of heparin-resistantcomplex formation and SpoOA(-P) concentration. A plot of completion levels ofPspoHG activity versus SpoOA(-P) concentration is shown in Figure 22 and demonstratesthat stimulation of PspoiiG transcription reached a plateau at 200 nM SpoOA-P.Increased concentrations of non-phosphorylated SpoOA affected maximum levels oftranscription only slightly.As evidenced by the increasingly steeper slopes of the kobs plot in Figure 23B, therate of initiation at PspoIIG increased dramatically as SpoOA-P concentration was raised.A plot of kobs versus SpoOA(-P) concentration (Figure 24A) demonstrates that unlikethe effect on completion levels of transcription, stimulation of initiation rates did notplateau over the range of SpoOA-P concentrations tested. Instead rates of transcriptioninitiation at PspoHG continued to accelerate. Increased concentrations of non -phosphorylated SpoOA also stimulated the rate of initiation at PspoJJG , however, itsinfluence was minimal compared to SpoOA-P. When the data from Figure 24A wasconverted to a double reciprocal plot (Figure 24B) it demonstrated a linear relationshipbetween the stimulation to the rate of transcription initiation at PspojjG and theconcentration of SpoOA(-P).8. Interpretation of the effect of SpoOA-P on the rate of initiation at PspoJJG.Since all the lines in the k5 plot of Figure 23B are straight, it appeared SpoOA-Phad stimulated the rate of transcription initiation at sJJG by affecting a rate limitingreaction step. The downward shift in the ordinate intercept of the tau plot (Figure 19)72Figure 20. Effect of PspoiiG template concentration on rates of transcription initiation.(A) To examine whether promoter concentration affected the rate of transcriptioninitiation, rate assays were carried out at four PspoiiG concentrations. The assayscontained no SpoOA (open symbols) or 400 nM SpoOA-P (closed symbols). DNAconcentrations were 2 nM(tI); 4 nM (oI.); 6 nM (oI.); or 8 nM (of.). The slopes oflines through each data set were calculated by linear least squares analysis. In general,the coefficient constant for these lines was 0.8 or greater. The rate values derived fromthese slopes are shown in Table II.(B) Rate constants derived from the kobs plot shown in Figure 20A (shown above)are plotted as a function of PspoiiG template concentration. The data is from rate assaysthat contained no SpoOA (0). or 400 nM SpoOA-P (•).wkobs(sec1x102)N3 CD C,, CDIn(1-0 N 0 0a C74Table II. kobs values obtained from transcription assays that contained various PspoiiGtemplate concentrations.Transcription rate assays were carried out at different PspoiiG templateconcentrations to determine whether the rate of heparin-resistant complex formation wasaffected. Assays were carried out in the absence or presence of 400 nM SpoOA-P. Therate values shown below were derived from the kobs plot shown in panel A of Figure 20.[PspoIIGl (nM) +1- SpoOA-P kobs (sec1 x 102)2 () 0.1814 () 0.1926 () 0.2298 (o) 0.1602 () + 2.014 (•) + 1.716 (.) + 1.748 (•) + 1.7675C40Figure 21. Effect of GTP concentration on the rate of spoIIG transcription initiation.To determine whether the low GTP concentration used in PspoHG transcription assaysaffected the rate of heparin-resistant complex formation, two assays were carried out atGTP concentrations that differed by four fold. Both reactions contained 400 nM SpoOA-P.The overall rate constants derived from the kths plot shown here were 2.28 x 102 and 2.00x102 sec1,for assays that contained 10 and 40 IIM GTP, respectively.0.00-‘no0 10time (sec)7600.Figure 22. Completion levels from spoiIG rate assays that contained variousconcentrations of SpoOA(-P).800Completion levels of PspoiiG promoter activity in rate assays that containedincreasing inputs of SpoOA (-0-) or SpoOA-P (--), are plotted as a function of totalSpoOA protein concentration. Completion levels were determined by averagingpromoter activity measured in two samples taken from rate assays 15 minutes afterinitiating heparin-complex formation with the addition of RNA polymerase (Figure 17).40.D0Co 30CuL.a)120E00 200 400 600[SpoOAJ (nM)77Figure 23. Determination of rate constants for assays containing various SpoOA(-P)concentrations.A series of rate assays that contained increasing concentrations of either SpoOA (A)or SpoOA-P (B), were carried out to determine whether rates of PspoHG tra.flSCriptioflinitiation would be affected. Rate constants for heparin-resistant complex formationwere derived from the slopes of straight lines calculated for the data sets in the kobs plotsshown here. These values and their reciprocals (t), are given in Table Ill.3 CD ‘-I, CD C,-HI?)03In(1-HI?)0F) b03 CD U, CD C,QO79Table III. Rate constants for heparin-resistant complex formation in PspoHGtranscription assays that contained various concentrations of SpoOA(-P).Rate constants derived from the kobs plots shown in Figure 23 are shown belowalong with their conesponding tau values. The tau values are plotted in Figure 24, panelB.[SpoOA(-P)] (nM) kobs (sec-1 x 102) tau (sec)A 0 (.) 0.409 244 ± 7350 () 0.413 242 ± 73100 (.) 0.430 233 ± 70200 (o) 0.567 176 ± 53400 (.) 0.861 116 ± 35800 () 0.601 166 ± 50B 0 (.) 0.409 244 ±7350 () 0.811 123 ±37100 (o) 1.60 62.5 ± 19200 () 2.68 37.3 ± [1400 (.) 3.02 33.1 ± 10800 (.) 3.81 26.2 ± 880for reactions that contained SpoOA-P, indicated that SpoOA-P had catalyzed a step thatoccurred after binding of polymerase to the promoter. This effect was examined byconsidering the reaction model;k1 k2 kfP + P- HS1 + OA(-P) HS HP (Ru)k..1 k,where HS1 and HS2 are different heparin-sensitive intermediates resulting from RNApolymerase binding to PspoJJG (HS1) and interacting with SpoOA(-P) (HS2). The orderof polymerase or SpoOA(-P) binding to the DNA is not specified in this model so thatpolymerase could bind PspoiiG and then interact with SpoOA(-P) bound to specific OAboxes, or visa versa. The model also does not preclude the possibility that there may beadditional heparin-sensitive complexes formed during the isomerization to a heparinresistant state. It appeared that binding of RNA polymerase to spoJIG equilibrated sorapidly that this step did not influence the overall rate of transcription initiation,therefore, a rate dependence on SpoOA(-P) apparently results because a slowisomerization from HS2 to HR is affected.The effect of SpoOA-P concentration on rate of initiation was evaluated using a formof tau analysis derived from equation (8), where HS1 and SpoOA(-P) were treated as thebinding site and ligand, respectively, to give the expression;k+k( f 1 1I 1+— (R12)k2 k \ [OA(-P)1 IIn this case, a plot of tau versus the reciprocal of the SpoOA(-P) concentration wouldyield an ordinate intercept equal to the inverse of the rate constant for isomerization ofHS2. The kf values determined from Figure 24B were 0.06 1 sec1 and 0.007 sec1 for81Figure 24. Effect of SpoOA(-P) concentration on rates of PspoiiG transcription initiation.(A) The kobs values from rate assays that contained various concentrations ofSpoOA(-P) (Figure 23, Table III), are plotted as a function of Spo0A (-0-) or Spo0A-P(-) concentration.(B) Tau values (i/kohs) from transcription rate assays in part A are plotted as afunction of the reciprocal of the total SpoOA concentration. Lines through each data setwere calculated by linear least-squares analysis. Ordinate intercepts, corresponding tothe forward isomerization rate constant, kf, (Results IV, 3) were 0.70 1 x 102 sec-1 forSpoOA (-0-) and 6.10 x 102 sec-1 for SpoOA-P (--).——C,,.0 C >C’,0 C00tau(sec)wN CC00kobs(sec-1x102)0 N C CC N Ca’ C C C C0083reactions that contained SpoOA-P or SpoOA, respectively. Thus, phosphorylation ofSpoOA increased stimulation of the rate of heparm-resistant complex formation nearly10 fold.9. The effect of the SpoOA binding domain polypeptide (Sp0OABD) on PspoIIGtranscription.A trypsin digest of the SpoOA protein produces two polypeptides approximately 13and 17 kDa in size (Grimsley et at., 1994). The larger fragment (Sp0OABD) comprisesthe C-terminal portion of the protein known to include the DNA binding domain, butdoes not contain the aspartate56residue which is the phospho-acceptor site (Burbulys etat., 1991). To determine whether SpoOABD could influence PspoiiG activity in vitro, itwas added to transcription rate assays using the same procedure as for nonphosphorylated SpoOA. Figure 25A shows the completion levels of transcriptionobtained from rate assays conducted at various SpoOABD concentrations. The plotdemonstrates a linear relationship between maximum promoter activity and Sp0OABDconcentration. The magnitude of stimulation by SpOOABD appeared to be less than thestimulation mediated by similar concentrations of SpoOA-P. However, a directcomparison of the effects of SpoOA-P and Sp0OABD is difficult because of the inabilityto determine the specific activity of the proteins. Based on similar concentrations oftotal protein, it appeared that the effect of SpOOABD on PspoiiG transcription wasintermediate to those of intact non-phosphorylated SpoOA and SpoOA-P.Values for the rate of approach to maximum transcription in rate assays thatcontained SpoOABD were calculated and plotted as a function of polypeptideconcentration (Figure 25B). The increase to kobs in reactions that contained 50 nM ormore Sp0OABD, appeared to be directly proportional to SpoOABD concentration. A plotof tau versus 1I[SpOOABD] (Figure 26) indicated that SpoOABD concentrations below 50nM were too low to cause a measurable effect on kobs. However, interpolation of theslope calculated for rates measured at 100 nM SpoOABD and above, corresponded to an84ordinant intercept that indicated a kf value of 0.027 sec-1. This estimate was almost halfthe value determined from experiments with SpoOA-P and implied that removal of theN-terminal portion of the SpoOA protein may have activated its ability to stimulatespoHG transcription. This raises the possibility that one function of the N-terminaldomain is to inhibit the transcription activating property of the DNA binding domain.The role of SpoOA phosphorylation could be to neutralize this inhibition.10. The KAc effect on rates of initiation at PspoHG.Since increased KAc concentration was observed to have an inhibitory effect onspoHG activity except in the presence of SpoOA-P, the effect of KAc concentration onthe rate of initiation at spoiiG was examined. Transcription assays containing noSpoOA, or 400 nM SpoOA, Sp0OABD or SpoOA-P, were carried out at KAcconcentrations that ranged from 0 to 120 mM. Completion levels of transcription fromthis experiment are plotted as a function of [KAc] in Figure 27. This plot shows thatincreased KAc concentrations lowered maximum transcription in all assays except thosecontaining SpoOA-P. The most dramatic inhibition of transcription occurred in assayscontaining Sp0OABD. In this case, promoter activity in the absence of KAc was similarto transcription levels obtained with SpoOA-P. However, raising KAc concentration to80 or 120 mM in assays that contained SpoOABD caused a seven fold decline intranscription to a level that was similar to assays containing no SpoOA. Maximumpromoter activity was also inhibited by elevated KAc concentration in rate assays thatcontained no SpoOA or non-phosphorylated protein but the effect was much lesspronounced.Rate constants from transcription assays that contained various forms of SpoOA atdifferent KAc concentrations, are summarized in Table IV. While the rates measured inassays that had no SpoOA or SpoOA-P were largely unaffected by elevated KAcconcentrations, it is apparent that the ability of either SpoOA or Sp0OABD to stimulatethe rate of initiation at spoiiG , was markedly diminished under this condition.85Figure 25. Effect of SpoOABD on completion levels and rate of PspoliGtranscription initiation.To examine the ability of SpOOABD to stimulate PspoiiG transcription, variousconcentrations of the polypeptide were added to transcription rate assays as describedfor experiments involving the intact protein (Materials and Methods IV, 4). The effectof SpoOABD was examined by plotting completion levels (A), or rate constants (kthvalues) (B), as a function of total SpoOABD protein concentration.C,).0 C DNk0(sec1x102)a’wbN%templatetranscribed0 N 0 0—NriC),.c 0 00 0 000875004000a)U)Cu 20010001/[SpOOA] (iJI-1)Figure 26. Tau analysis of the effect of SpOOABDThe inverse of kobs values (tau) shown in Figure 25B are plotted as a function ofreciprocal SpoOABD concentration. The line drawn was considered to be the best fit tothe data.0 10 20 30 40Figure 27. Effect of increasing KAc concentration on completion levels of PspoHGtranscription.120The effect of KAc on the rate of PspoiiG transcription initiation, was tested by addingvarious concentrations of the salt to rate assays that contained no SpoOA (—D--), or 400nM SpoOA (—0-), Sp0OABD (—h-) or SpoOA-P (-.-). Various concentrations of KAcwere mixed with spoJJG template, ATP and GTP, before beginning an initiation time-course reaction with the addition of RNA polymerase (Materials and Methods IV, 4).The completion levels of transcription represented by the averaged level of transcriptionin two 15 minute time samples, are plotted as a function of KAc concentration.8810a).C.)Cl)CCDa)Co0.E(.50 40 80[potassium acetate] (mM)89Differences in the abilities of the various forms of SpoOA to stimulate PspoJJGtranscription was further illustrated when initial rates of heparin-resistant complexformation were examined. A plot of the number of PspoHG transcripts measured in rateassays that contained 120 mM KAc reveals the combined effects to both the completionlevel and rate of complex formation (Figure 28). In the absence of KAc, SpoOA-Pstimulated a 8 - 10 fold increase in the rate of heparin-complex formation comparedassays that contained no SpoOA or non-phosphorylated protein (Figure 28A). Thereaction that contained SpOOABD exhibited a pronounced lag prior to reaching aconstant rate of complex formation that was approximately half that of SpoOA-P. Thereason for this lag is not known, however, it could reflect differences in the bindingaffinities of SpoOABD and intact protein, or suggest that the polypeptide lacked a portionof the activating domain required for optimum transcription stimulation. In eitherinstance, the lag suggested that two reaction steps contributed significantly to the overalltranscription initiation in rate assays that contained SpoOABD.A plot of transcripts versus time for rate assays containing 120 mM KAc clearlydemonstrates that the ability of SpoOA-P to stimulate PspoHG was far superior comparedto other forms of the protein (Table V, Figure 28B). The initial rate of heparin-resistantcomplex formation in the presence of SpoOA-P was approximately 35 times greater thanin assays containing SpoOA or SpoOABD, and was more than 70 times the rate observedwithout SpoOA protein.11. Rate of transcription initiation from a mutant form of PspoiiG.To examine the role of SpoOA binding sites in region I of PspoiiG , a PCRmutagenesis protocol was used to alter the OA box at -94 and insert two point mutationsinto the OA box at -84 (Materials and Methods VI, 1). The mutant template (PspoJIGM94184) was used in transcription assays to test the effect of SpoOA(-P) concentration onmaximum PspoiiG transcription (Figure 29). A comparison of completion levels oftranscription from PspoiiG M94/84 and the wildtype promoter showed no obvious90Table IV. Effect of KAc concentration on rates of PspoHG transcription initiation inassays that contained various forms of the SpoOA protein.KAc concentration was adjusted by adding various inputs of the salt to mixtures ofPspoIIG template, ATP, GTP and buffer, before incubating the DNA with phosphorelaysamples. Initiation time-course reactions were begun by adding RNA polymerase andrate constants for heparin-resistant complex formation were measured using kobs plOts(described in Figure 18). These value are shown below.‘<obs (sec-1 x 102)no SpoOA SpoOA Sp0OABD SpoOA-P0.469 1.19 1.17 2.950.36 1 0.587 0.545 4.020.344 0.421 0.201 4.31[KAc] (mM)04080120 0.446 0.546 0.291 4.2791Figure 28. Kinetics of transcription initiation at PspoiiG at two KAc concentrations.Numbers of PspoHG transcripts in time samples of rate assays (described in Table II)that contained 0 (A) or 120 mM KAc (B), were calculated and plotted as a function oftime. These assays contained no SpoOA (D), or 400 nM SpoOA (0), SpOOABD (A) orSpoOA-P (•). The lines drawn through each data set (except for A, SpOABD) werecalculated by linear least-squares analysis (coefficient constant > 0.9). Values derivedfrom the slopes of these lines are given in Table VI.CD ‘-I, CD C,wnumberofF01transcripts(x1 O)numberofP01transcripts(x10-9)a 0 0N 0 00CD v-I, CD0 093Table V. Initial rates of transcript synthesis from PspoiiG +I 120 mM KAcThe initial rates of transcript synthesis shown below were derived from the slopes onlines drawn through the data sets plotted in Figure 28. Assays contained either no KAcor 120 mM KAc and either no SpoOA or 400 nM SpoOA, SpoOABD, or SpoOA-P.[KAc] (mM) initial rate(transcripts/sec x l0)noSpooA(D) 0 0.68SpoOA (0) 0 0.91Sp0OABD (A) 0 0.9 1/4.1*Spo0A-P) 0 7.1noSpo0A(D), 120 0.10SpoOA(0) 120 0.20SpoOABD (A) 120 0.24SpoOA-P(•) 120 7.7* estimated from the initial and secondary slopes94Figure 29. Comparison of the effect of increased SpoOA(-P) concentration onwildtype and mutant PspoHG activity.Transcription assays that contained serial dilutions of SpoOA (open symbols) orSpoOA-P (closed symbols) were carried out using either wildtype PspojjG (circles) orPspoiiG M94184 (triangles) as promoter template. To assay for completion levels ofheparin-resistant complex formation, RNA polymerase and promoter template wereincubated for 10 minutes prior to initiating elongation reactions. Promoter activity,defmed as the percentage of PspoiiG template transcribed, is plotted as a function of totalSpoOA(-P) concentration.15a).IC.)C,)CC10a)•1-’Cu0.Eç500.00 100 200 300 400[SpoOA] (nM)95Table VI. Comparison of kobs rate constants from transcription rate assays thatcontained wildtype or Psp011GM94184 promoter templates.The effect of the mutations on the rate of initiation at spoJJG was assessed intranscription rate assays that contained no SpoOA or with 200 nM SpoOA or SpoOA-P.Rate constants from assays performed on mutant and wildtype PspoiiG templates, werederived from kobs plots (not shown) and are shown below.kobs (sec1 x 102)PspoIIGM94 PspoiiGno SpoOA 0.744 0.260SpoOA 0.933 0.467SpoOA-P 1.87 1.4896differences in stimulation by either SpoOA or SpoOA-P, although the mutant promoterappeared to be slightly more responsive to lower SpoOA-P concentrations.PspoIIGM94l’8 was also tested in transcription rate assays that contained SpoOA(-P). The1obs values measured for these assays are presented in Table VI and although slightdifferences were observed between the mutant and wildtype promoter in the absence ofSpoOA or with 200 nMSpoOA, the disparities were within normal variation for rateassay experiments and were not considered to be significant.Transcription experiments carried out on PspoiIG M94/84 revealed that mutations tothe OA boxes of region I did not significantly affect either the completion level or rate oftranscription initiation at PspojjG. This suggests that the functional SpoOA binding sitesin terms of transcription activation, are within region II of the promoter. However,because this hypothesis is based on only two experiments, further experimentation isrequired to eliminate the potential contribution of region I. In addition, the mutantpromoter should be tested in vivo to determine whether the nonnal PspoIIG transcriptionprofile is affected.V. DNaseI footprinting of SpoOA(-P) to P!oIIG.1. Previous reports of PspoiiG DNaseI protection studies.It has been reported that SpoOA protects two regions of PspoiiG from DNaseIdigestion (Satola et al., 1991). Each region contains two sequences with identity tocanonical SpoOA binding sites (OA boxes). Region I contains OA boxes centered atpositions -94 and -84 relative to the transcription start-site, while the OA boxes inregion II are centered at -50 and -40 (Figure 2). Non-phosphorylated SpoOA appearedto bind both regions I and II although very high concentrations of SpoOA protein wererequired for DNaseI protection of region II (Satola et at., 1991). Based on thisobservation, it was proposed that region I contained high affinity SpoOA binding siteswhile region II contained low affinity binding sites. Baldus et at. (1994) used either97acetyl phosphate or the heterologous sensor/kinase protein, NR11 (Ninfa and Magasanik,1986), to obtain a low level of Spo0A phosphorylation (approximately 1.0 % of theprotein). They observed that phosphorylation of SpoOA increased DNaseI protection toall OA boxes at PspoiiG , but appeared to enhance SpoOA binding to region II inparticular.2. Effect of increased SpoOA(-P) concentration on DNaseI protection of PspoiiG.Previous PspoiiG footprinting studies were conducted with SpoOA which had beenphosphorylated to a very low level. Therefore, the effect of phosphorylation on SpoOAfootprinting at PspoIIG was reexamined using the phosphorelay reaction to obtain highlevels of SpoOA-P. Figure 30 shows DNaseI footprints produced by increasingconcentrations of SpoOA(-P). Binding of non-phosphorylated SpoOA to the promoterappeared to be weak. Only slight protection to OA boxes in region I was detected at thehighest concentrations of protein. In contrast, concentrations of 200 - 400 nM SpoOA-Pprotected both regions of the promoter producing footprints that extended from -105 to-80 in region I and from -60 to -35 in region U. This suggested that both OA boxes ineach region were bound by SpoOA-P. The DNA between these two areas of protectionwas naturally resistant to DNaseI cleavage (see control lane), so it is not known whetherSpoOA-P also bound to this region of the promoter.3. Kinetic DNaseI protection assays.The transcription initiation model (Ri 1) (Results IV, 8), suggests there may bemultiple types of heparin-sensitive po1ymerase/PSOJJG complexes on the pathway toheparin-resistant complex formation. Since transcription rate assays containing SpoOAP required approximately one minute to reach maximum heparin-resistant complexformation, and reactions containing SpoOA or no SpoOA took even longer, it wasanticipated that structural changes between different heparm-sensitive complexes mightbe detected by DNaseI protection assays. Therefore, footprinting experiments wereconducted on samples removed from RNA po1ymerase/PS0JJGtime-course binding98-go.-80.-70.-60.-50.-40.-30•-20.SpoOA SpoOA-PCl 23Figure 30 The effect of SpoOA(-P) concentration on DNaseI footprints in the absenceof RNA polymerase.DNaseI footprint reactions were carried out by incubating spoijG fragment (nontranscribed strand labeled) with various concentrations of SpoOA or SpoOA-P (lane 1, 50nM; lane 2, 100 nM; lane 3, 200 nM; lane 4, 400 nM) for five minutes before digestingwith DNaseI. Lane C is a control DNaseI footprint of PspoiiG with no added protein.The nucleotide positions indicated are relative to the transcription start-site.Cl 234 499reactions. GTP was omitted from these reactions to prevent the polymerase fromreaching a heparin-resistant state (Results I, 2). RNA polymerase binding reactionswere initiated by adding polymerase to mixtures of PspoiiG template and either noSpoOA, or 400 nM SpoOA(-P). At various times, samples were removed and digestedwith DNaseI for 10 seconds. Protection patterns resulting from experiments withspoIIG template, labeled on either the non-transcribed or transcribed DNA strands,suggested that distinctly different complexes were formed under the various conditions(Figures 31 and 32).In time-course assays that contained no SpoOA protein, a RNA polymerase footprintwas clearly visible in the first (5 second) sample and did not appear to change insubsequent time-points. This suggested that complex formation between the polymeraseand PspoiiG (designated as Cj) was virtually complete within 15 seconds (5 seconds plus10 second digest). The Cj footprint was characterized by DNaseI protection extendingfrom positions -60 to -24 on the non-transcribed strand (Figure 31) and -65 to -20 on thetranscribed strand (Figure 32). In addition, the region between -20 and +10 on thetranscribed strand appeared to be weakly protected. Conspicuous DNaseIhypersensitive sites were evident at -45 and -23 on the non-transcribed strand. Position-55, which was readily cleaved in control DNaseI digestions, was also unprotected bythe C1 complex. Interestingly, protection of the transcribed strand was less evident inthe two minute time sample, and by 15 minutes there was essentially no protection toeither DNA strand. Therefore, it was assumed that binding of the polymerase to PspoiiGhad been reversible. Our lab has observed that free RNA polymerase in solution isquickly inactivated at 37° C. Thus, the combined effects of a high rate of dissociationand polymerase inactivation may account for loss of the C1 footprint over time.DNaseI footprint experiments carried out on time-course binding reactions thatcontained RNA polymerase and non-phosphorylated SpoOA exhibited two distinctDNaseI protection patterns. The footprint detected in the 5 second sample was very100-1 00•-90.-80.-70.-60.-50.-40.-30.-20.-10.No SpoOA SpoOA SpoOA-P+1 .£‘Figure 31 Kinetic DNaseI footprints at PspoiiG (non-transcribed strand).Influence of SpoOA and SpoOA-P on RNA polymerase complexes formed at PspoiiGTime-course DNaseI protection assays were carried out with reactions that containedRNA polymerase and either no SpoOA, 400 nM SpoOA, or 400 nM SpoOA-P. After theaddition of RNA polymerase (5 sec, lane 1; 30 sec, lane 2; 1 mi lane 3; 2 mm, lane 4;or 5 mi lane 5), samples were removed and subjected to a 10 second DNaseI digestion.Lane C is a control DNaseI digestion of PspoiiG in the absence of protein. Lane 0 in ‘noSpoOK, ‘SpoOA’, and ‘SpoOA-P’ panels contained no protein, SpoOA only, or SpoOA-Ponly, respectively. The indicated nucleotide positions are relative to the transcriptionstart-site (arrow).CO 1 234101No SpoOA SpoOA SpoOA-P-30.-40.*--50.____1“9-80.Figure 32 Kinetic DNaseI footprint at spoIIG (transcribed strand).Time-course DNaseI protection assays were carried out with reactions that containedRNA polymerase (100 nM) and either no SpoOA, 400 nM SpoOA, or 400 nM SpoOA-P,as described in Figure 31. After the addition of RNA polymerase (5 sec, lane 1; 30 seclane 2; 1 mm, lane 3; 1.5 mm, lane 4; 2 mm, lane 5; and 15 mi lane 6). Lane C is acontrol DNaseI digestion of spoIIG fragment in the absence of protein. Lane 0 in ‘noSpoOA’, ‘SpoOA’ and ‘SpoOA-P’ panels contained no protein, SpoOA only, or SpoOA-Ponly, respectively. The nucleotide positions indicated are relative to the transcriptionstart-site (arrow).C012 3456 C 0 1 2345 6 COl 23456-10.-20.-60..--70.102similar to the Cj footprint, based on the appearance of a -45 DNaseI hypersensitive siteon the non-transcribed strand. However, the -45 position was protected in later samplessuggesting that Cj was replaced by a new complex (Cii). C11 was identified by expandedlimits of DNaseI protection. The footprint extended downstream toward -10, andupstream to encompass SpoOA binding sites centered at -84 and -94. In addition, the-45 and -23 DNaseI hypersensitive sites of the Cj footprint were replaced by newhypersensitive sites at positions -28 and -27 on the non-transcribed strand, and positions-28 and -26 on the transcribed strand. A gradual increase in the intensity of thesehypersensitive sites in later time-course samples, indicated that formation of the C11complex occurred slowly compared to Cj. Since the C11 footprint was observed only inDNaseI assays that contained RNA polymerase and SpoOA, it was assumed to resultfrom a SpoOAI polymerase complex.Control samples removed from binding reactions that contained SpoOA only (Figure31), resulted in weak DNaseI protection to the OA boxes of region I. Protection to thisregion became more distinct when RNA polymerase was added to the reaction,indicating that a synergistic interaction occurred between SpoOA and the polymerase. Itappeared that RNA polymerase had bound to the promoter and then facilitated bindingof SpoOA to the OA boxes in region I. It could not be determined with certainty whetherSpoOA had also bound to either of the OA boxes in region II because DNaseI protectionprovided by RNA polymerase alone overlapped this portion of the promoter (Cjfootprint, Figures 31 and 32). It is interesting to note that the -45 hypersensitive site andthe major unprotected site at -55 on the non-transcribed strand of a Cj footprint (Figure31), were protected from DNaseI cleavage in the C footprint. Since thesehypersensitive sites are located on either side of the OA box at -50, it is possible thatprotection may have resulted from SpoOA binding to this site after polymerase hadbound PspollG. Binding of SpoOA to the OA box at -50 may also have caused thegradual transition from Ci to CII coinciding with the appearance of hypersensitivity to103the -28, -27 and -26 positions. It is possible that hypersensitivity within this region ofthe promoter resulted from a distortion of the DNA caused by a SpoOA dependentisomerization in polymerase structure.Despite the apparent cooperative interaction between RNA polymerase and SpoOA,C11 complexes appeared to be only slightly more stable than Cj. Although the C11footprint was distinct in the two minute time-point of Figure 32, it had disappeared fromboth DNA strands by the 15 minute time-point, suggesting that like Cj, C11 had a highrate of dissociation leading to polymerase inactivation.Addition of SpoOA-P to time-course binding reactions resulted in the formation of athird complex (Cm). The C footprint covered essentially the same region of PspoiJGas did Cjj. A loss of the DNaseI hypersensitive sites unique to the C11 footprint was adistinguishing feature of the C protection pattern. Although the -28 hypersensitivesite on the transcribed strand was retained in a C footprint, the -26 site disappeared, asdid both the -28 and -27 sites of the non-transcribed strand. The control lane whichshows the protection pattern resulting from SpoOA-P only, indicated the protein boundto regions I and II of PspoIIG. Unlike the reaction that contained SpoOA, no transient Cjfootprint was observed, suggesting C111 formation was very rapid. As in the case of C11,it was assumed that protection upstream of -80 in the Cjjj footprint resulted fromSpoOA-P binding to region I. While there was no definitive evidence to indicatewhether the protein also bound to the OA boxes of region II, improved DNaseIprotection between positions -62 and -32 of the transcribed strand implied that SpoOA-Pbinding to both OA boxes in this region may have been an integral part of the Ccomplex. It is possible that the loss of hypersensitivity in the -28 to -26 region of bothstrands of the promoter could indicate that the DNA distortion evident in C11 wasresolved in the transition to C111 either because of SpoOA-P binding or anadditionallaltemative isomerization within the polymerase.104An additional difference between Cjjj and the Cj or C11 complexes was the apparentstability of m. The m protection pattern was clearly visible even in the 15 minutetime-point samples from reactions containing SpoOA-P. Thus, C appeared to have areduced rate of dissociation, due either to the influence of SpoOA-P binding to aparticular site, or because SpoOA-P had induced the polymerase to isomerize into acomplex with greater stability.4. The effect of temperature on kinetic DNaseI footprints.In vitro assays showed PspoiiG transcription from linearized template was extremelytemperature sensitive (Results III, 1). To examine the possibility that transitionsbetween Cj, C11 and C might be affected by lower temperature, time-course DNaseIprotection assays carried out on the non-transcribed strand of PspoiiG at 150, 25°, and31° C. The footprints obtained with RNA polymerase and either no SpoOA, SpoOA, orSpoOA-P indicated that lower temperatures had a significant effect on complextransitions (Figures 33 - 35).DNaseI protection patterns obtained at 25° and 31° C with RNA polymerase only,suggested that formation of the Cj complex was no different than at 370 C. Bindingappeared to be complete by the first time sample and the footprint exhibited the samepattern of DNaseI hypersensitivity. Reactions that contained polymerase and SpoOA-Pproduced footprints at 25° and 31° C that were virtually identical to the C111 footprintobtained at 37° C. Therefore, it appeared that C111 formation was also unaffected by thelower temperatures.In contrast, the reaction containing polymerase and non-phosphorylated SpoOAproduced DNaseI protection patterns that indicated C11 formation had been adverselyaffected by lower temperatures. Judging by the relative intensities of the -28 and -27DNaseI hypersensitive sites, both the maximum level and the rate of Cjj formation werereduced, especially at 25° C. Although the first time samples at both temperaturesproduced protection patterns that appeared to be similar to the C j/C composite105obtained at 370 C, the transition to the CII type footprint in later time samples wasslower. However, the rapid disappearance of the -23 and -45 hypersensitive sites andincreased protection extending to the -10 position, did not appear to parallel the delayedemergence of the C11 footprint. This suggested the presence of an additional stepbetween C1 and C11 which was characterized by protection to positions -23 and -45 andextension of the polymerase footprint to the -10 domain, but produced nohypersensitivity to the -28 and -27 positions. The changing DNaseI protection patternsof the SpoOA reaction were interpreted as evidence that the binding of polymerase andSpoOA to the promoter had not been affected by reduced temperature, but that asubsequent isomenzation step had been impaired.Temperature sensitivity of the transition between Cj and C11 was clearly evident inthe DNaseI protection experiment carried out at 15° C (Figure 35). Appearance of the-45 and -23 hypersensitive sites indicated that the polymerase formed a normal CIcomplex in the absence of SpoOA protein. However, the low temperature completelyblocked development of -28 and -27 hypersensitive sites that characterized footprintsobtained from reactions that contained SpoOA. If these sites are indicators for anisomerization in polymerase conformation, it would seem that this step was completelyinhibited at 15° C, even though protection to region I of the promoter showed thatSpoOA protein binding appeared to be unaffected. Because the C111 footprint has nodistinguishing hypersensitive sites on the non-transcribed strand, it is difficult to assesslow temperature effects on its formation. However, similarities between the footprintsobtained with SpoOA and SpoOA-P at 15° C suggested that Cjjj formation was alsoblocked despite a DNaseI protection pattern that showed the binding of polymerase andSpoOA-P to be unchanged.Two additional differences between footprints obtained at 37° C and the lowertemperatures should be noted. First, the stability of the Cj and C11 complexes seemed toincrease substantially at 31° and 25° C, since these footprints were stifi clearly visible in106Figure 33 Kinetic DNaseI footprint at 310 C.Time-course DNaseI protection assays were carried out as described in Figure 31except that the temperature was 310 C. After the addition of 100 nM RNA polymerase(5 sec, lane 1; 30 sec, lane 2; 90 sec, lane 3; and 10 mi lane 4), samples were removedand subjected to a 10 second DNaseI digestion. Lane C is a control DNaseI digestion ofPspoHG fragment (non-transcribed strand labeled) in the absence of protein. Lane 0 in‘SpoOA’, ortSpoOA-P’ panels contained no protein, SpoOA only, or SpoOA-P only,respectively.107No SpoOA SpoOA01234SpoOA-P01234CC1234-30•—10.108-90•-00.-70.-60.-50.-40.No SpoOAsmr. --20•.-10.+SpoOA SpoOA-P01 2 34CFigure 34 Kinetic DNaseI footprint at 250 C.Time-course DNaseI protection assays were carried out as described in Figure 31except that the temperature was 250 C. After the addition of 100 nM RNA polymerase(5 sec, lane 1; 30 sec, lane 2; 90 sec, lane 3; and 10 mm, lane 4), samples were removedand subjected to a 10 second DNaseI digestion. Lane C is a control DNaseI digestion ofPspoiiG fragment (non-transcribed strand labeled) in the absence of protein. Lane 0 in‘SpoOA’, or ‘SpoOA-P’ panels contained no protein, SpoOA only, or SpoOA-P only,respectively. The nucleotide positions indicated are relative to the transcription start-site(arrow).C1234 01234-30’109Figure 35 Kinetic DNaseI footprint at 15° C.Time-course DNaseI protection assays were carried out as described in Figure 31except that the temperature was 15° C. After the addition of 100 nM RNA polymerase(5 sec, lane 1; 30 sec, lane 2; 90 sec, lane 3; and 10 mm, lane 4), samples were removedand subjected to a 10 second DNaseI digestion. Lane C is a control DNaseI digestion ofPspoiiG fragment (non-transcribed strand labeled) in the absence of protein. Lane 0 in‘no SpoOA’, ‘SpoOA’, or ‘SpoOA-P’ panels contained no protein, SpoOA only, or SpoOA-Ponly, respectively. The nucleotide positions indicated are relative to the transcriptionstart-site.<N00.0CflciWiNaU<‘I.0aN(I.)—00CII-00a(en4111the 10 minute time-point samples. Lower temperatures may have reduced thedissociation rate of polymeraseIP0IIG complexes which was believed to contribute toa rapid inactivation of the enzyme. Secondly, a more thorough protection from DNaseIcleavage was observed in the -20 to -10 region of C11 and Cm footprints. This wasparticularly noticeable for positions -17 and -13 which had been poorly protected infootprint assays conducted at 370 C. It is possible that lower temperature stabilized aninteraction between the polymerase and this region of the promoter that may haveoccurred only transiently at the higher temperature.5. Effect of SpoOA(-P) concentration on RNA polymerase complexes at PspoiiG.Kinetic DNaseI protection assays identified at least three distinct hepann-sensitivecomplexes formed between RNA polymerase and PspoiiG. Formation of the Cii and C111complexes was clearly dependent on SpoOA or SpoOA-P. Therefore, it was decided toinvestigate how relative levels of each type of complex, might be affected by changes inSpoOA(-P) concentration. The experiment was carried out by incubating PspoiiGtemplate (labeled on the non-transcribed strand) with serial dilutions of phosphorelaysamples containing SpoOA or SpoOA-P at 37° C (Figure 36).At the lowest input of non-phosphorylated SpoOA (25 nM), a composite of Cj andC11 footprints was indicated by the presence of hypersensitive sites at positions -451-23(Cj) and -28/-27 (C11). As judged by the diminished intensity of the -45 and -23hypersensitive sites, and greater prominence of the -28 and -27 sites, relative levels ofeach complex shifted toward Cjj as the concentration of SpoOA was increased. Noevidence of a Cj footprint was observed at SpoOA concentrations above 200 nM.The DNaseI footprint observed at 25 nM SpoOA-P exhibited a thorough protection ofan extensive portion of the promoter indicative of C111 formation. No DNaseIhypersensitivity was detected at positions -45 or -23. Therefore, none of the complexesappear to have been Cj. However, faint -28 and -27 DNaseI hypersensitive sites weretaken as evidence that a few Cj had been formed. Because the Cm footprint has noSpoOAC012345 6-80.-70.SpoQA—p012 3456C112-20.2L+1—.Figure 36 Effect of SpoOA(-p) Concentration on spoIlG DNaseI footprints.DNaseI footprint reactions were carried out by incubating PsPOJJG fragment (nontranscribed strand labeled) with various concentrations of SpoOA or SpoOA-p (noSpoOA(..p) lane 0; 25 nM, lane 1; 50 nM, lane 2; 100 nM, lane 3; 200 nM, lane 4; 400nM, lane 5; and 800 nM, lane 6) and a fixed concentration of RNA polymerase (25 nM)for five minutes before digesting with DNaseI. Lane C is a control DNaseI footprint ofthe spoIIG fragment with no added protein.-60. =“;-50.-40.-30.IIS113distinguishing sites of DNaseI hypersensitivity, the remainder of the complexes formedat low SpoOA-P concentration were probably C but could not be detected. Loss of the-28 and -27 DNaseI hypersensitive sites with increased concentrations of Spo0A-P,indicated that no C11 complexes were formed at SpoOA-P concentrations of 100 nM andabove.6. DNaseI footpnnting of PspoIIG M94/84•Since the SpoOA binding sites within region I of PspoJJG are approximately 15 - 20bps upstream of DNA sequences that were protected by RNA polymerase alone (see Cjcomplex, Results V, 2 & 3 ) it is not likely that Spo0A(-P) protein bound to these OAboxes would be able to contact the polymerase. Therefore, it was unclear how SpoOA(P) bound to region I of the promoter contributed to PspoIIG transcriptional activity. Toinvestigate a possible role for the SpoOA binding sites of region I, DNaseI protectionexperiments were carried out using the mutant construct, PspoiiG M94/84 (Materials andMethods VI, 1 &IV, 11).Lack of DNaseI protection to the upstream portion of PspoJJG M94/84 suggested themutations had abolished binding of SpoOA(-P) to the OA boxes of region I. In addition,no DNaseI protection of region II of the promoter was detected in the reactions thatcontained SpoOA only (Figure 37). Addition of SpoOA-P resulted in DNaseI protectionto OA boxes at -50 and -40 but the level of protection was reduced compared to similarprotein concentrations on the wildtype promoter. DNaseI protection assays thatcontained SpoOA(-P) and RNA polymerase (Figure 38) resulted in Cj, C11 and C111 typefootprints, however, relative intensities of the -451-23 (CI) and -28/-27 (C11)hypersensitive sites indicated that the transition from Cj to C11 required higherconcentrations of SpoOA than the wildtype promoter. Moreover, binding reactions thatcontained SpoOA-P exhibited DNaseI hypersensitive sites unique to both Cj and C11,suggesting a higher concentration of SpoOA-P was also required to obtain a Cfootprint.SpoOACl 234SpoOA-PC12 34114-70.-60.-50.-40.-30.-20.-10.+ 14_-,.-d.-— ..,— -..Figure 37 Effect of increased SpoOA(-P) concentration on DNaseI footprinting atPspoHGM94/8.Effect of SpoOA(-P) concentration of RNA polymerase complexes formed atPsp0HGM94I’8.DNaseI footprint reactions were carried out by incubating pspoHGM94”84fragment (non-transcribed strand labeled) with various concentrations of SpoOA orSpoOA-P (50 nM, lane 1; 100 nM, lane 2; 200 nM, lane 3; 400 nM, lane 4) and a fixedconcentration of RNA polymerase for five minutes before digesting with DNaseI. LaneC is a control DNaseI footprinting ofPsp0JJGM94I8 with no added protein. Nucleotidepositions indicated are relative to the transcription start-site.-115.a...Figure 38 Effect of SpoOA(-P) concentration on PspoiiG M94/84 footprints at constantRNA polymerase concentration.Effect of SpoOA(-P) concentration of RNA polymerase complexes formed at PspoiiGM94/84 DNaseI footprint reactions were carried out by incubating PspoiiG M94/84fragment (non-transcribed strand labeled) with various concentrations of Spo0A orSpoOA-P (no SpoOA(-P), lane 0; 25 nM, lane 1; 50 nM, lane 2; 100 nM, lane 3; 200 nM,lane 4; and 400 nM, lane 5) and a fixed concentration of RNA polymerase (100 nM) forfive minutes before digesting with DNaseI. Lane C is a control DNaseI footprint of thespoHG M94/84 fragment with no added protein. Nucleotide positions indicated arerelative to the transcription start-site (arrow).SpoOA SpoOA-P6)-30.-20.+1116These results are consistent with the hypothesis that SpoOA(-P) bound to the OAboxes of region I might promote binding of the activator to the OA boxes of region IIthrough a cooperative interaction. More significantly, the footprinting experimentsperformed on PspojJGM94184 demonstrated that the OA boxes in region II were thefunctionally important sites for catalyzing polymerase isomerizations resulting in C11and C formation.VI. Investigation of PspoIIA transcription stimulation by SpoOA-P.1. PspoiiA transcription assays.In vitro experiments had established that expression of the spoIlA operon wasdependent on the alternative sigma factor, aH (Wu et al., 1991). Therefore, PspoIMtranscription assays were carried out with either core RNA polymerase orholoenzyme, mixed with recombinant aH protein. These experiments were carried outwith a plasmid construct obtained by cloning PspoJJA into a pUC18 based plasmid (pPS28) which carried tandem (T1T2)transcription terminators isolated from the rrnB rRNAoperon of E. coli (Materials and Methods II, 1). This resulted in a PspojjA templatewhich could be assayed as either relaxed or supercoiled DNA.Three major RNA products of different sizes were produced in PspoiiA transcriptionassays (Figure 39). Synthesis of the two smaller transcripts (transcripts II and III) wasdependent on while the largest transcript (transcript I) was apparently transcribed byRNA polymerase containing aA. Primer extension analysis of transcripts II and Ill,demonstrated that both originated from PspoJJA and that the in vitro start-site wasidentical to that reported for spollA mRNA produced in vivo (Figure 40). It wasassumed that read through of the T1 transcription terminator accounted for thedifference in size between transcripts II and Ill. Because no RNA products weresynthesized in transcription assays performed on the pPS-28 vector, it appeared thattranscript I originated from the cloned B. subtilis DNA fragment which carried PspoIJA.117However, no primer extension product was obtained when this RNA was used as atemplate for reverse transcriptase and the exact origin of the transcript was notdetermined.Two characteristics of PspoiiA transcriptional activity were found to differ from thoseof PspoiiG. First, significant levels of transcripts were produced by PspoiiA only if thepromoter was assayed as a supercoiled template (Bird et al., 1992). Secondly, theformation of heparin-resistant complexes at PspojjA did not require initiating NTPs.These properties were interpreted as evidence that the mechanisms of transcriptioninitiation at PspoiiA and PspoiiG were different.2. The effect of SpoOA-P on the extent and rate of PspoIIA transcription initiation.To determine whether SpoOA(-P) could affect PspoIM activity, aliquots fromequilibrated phosphorelay reactions were added to transcription assays using the sameprocedure as for PspoJIG (Results I, 1). These experiments indicated that P,oiactivity was stimulated by SpoOA-P (Figure 41). This effect was further examined byadding serial dilutions of kinase reaction samples to transcription assays to determinethe effect of various SpoOA(-P) concentrations on PspoHA activity. While concentrationsof up to 700 nM SpoOA-P continued to enhance transcription from P,oIm, similarinputs of non-phosphorylated SpoOA or mixtures of phosphorelay components whichlacked SpoOA, had no influence on PgpoJm activity.The possibility that SpoOA-P might stimulate the rate of transcription initiation atPspoiiA was investigated by adding phosphorelay samples to time-course transcriptionassays that contained 480 nM SpoOA(-P) (Figure 41B). In each case, maximumtranscription was reached within five minutes, and although SpoOA-P stimulated themaximum level of transcription compared to SpoOA, the rate of approach to therespective maxima appeared to be similar. A preliminary investigation of the initiationprocess at P,oJJA indicated that initiation rates were too fast to measure118no SpoOA SpoOA SpoOA-PIIIII‘1 231145 §7 8 9’Figure 39. In vitro transcription products ofP0im.Radioactive products from in vitro transcription of the plasmid pllA-28 wereseparated on a 5% polyacrylamide gel and detected by autoradiography. Three majortranscript bands were observed and are designated I, II or Ill. The promoter templatewas assayed as supercoiled plasmid (lanes 1, 3, 4, 6, 7 and 9) or as linearized DNAfollowing a HindIII restriction digest (lanes 2, 5 and 8). The assays were carried out byadding both core RNA polymerase and 0H (lanes 1, 2, 4, 5, 7 and 8) or core polymeraseonly (lanes 2, 5 and 8) to each reaction (Materials and Methods IV, 6). No SpoOAprotein was added to reactions shown in lanes 1 - 3. Lanes 4 - 5 contained samples fromphosphorelay protein mixtures that lacked KinA and ATP (SpoOA), while lanes 6 - 9contained samples from equilibrated phosphorelay reactions (SpoOA-P). The finalSpoOA concentration in transcription assays that received phosphorelay samples was480 nM.119.NC/Figure 40. Primer extension analysis of P,oj transcripts.Transcripts II and III generated from spollA transcription assays (see Figure 39)were electroeluted from polyacrylamide gel slices, and the purified RNA was used astemplate for primer extension (Materials and Methods IV, 7). The same primer used forextension reactions was used to produce the DNA sequence of theP1,0jm region. TheDNA sequence in the region of the in vivo transcription start-site (.) is shown to theleft, and the primer extension product is indicated by the arrow.GACTIINI120Figure 41.A. Stimulation of PspoIIA transcription by increasing SpoOA-Pconcentration.Transcription assays contained dilutions of phosphorelay reaction/protein mixtures toyield the indicated SpoOA protein concentrations. The kinase reactions contained allcomponents (-), or all components except SpoOA (—D-), or all components exceptKinA and ATP (-0-). Transcription products were separated by electrophoresis andquantitated by measuring Cerenkov radiation in gel slices containing transcript Ill. Inthe case of transcription reactions containing samples of the phosphorelay mixturewhich did not include SpoOA, the data is plotted according to the dilution of kinasereaction samples that did contain SpoOA protein.Figure 41.B. The effect of SpoOA-P on the rate of transcription initiation at Ps1,0JJA.(B) Time-course reactions were initiated by adding core RNA polymerase to a mixof pllA-28 (4.8 nM) aH protein (480 nM) and either 480 nM SpoOA (-0-) or SpoOA-P(-). At the indicated times, aliquots were removed and transferred to tubes containgheparin (5 pg/mL final concentration). After a five minute incubation in the presence ofheparin, elongation of RNA was permitted by addition of a mix containing all fournucleotide triphosphates. Transcription products were separated by electrophoresis andquantitated by determining the Cerenkov radiation in the gel slices containing labeledtranscript Ill.CDwPspollAactivity(cpmx1O)PspdffAactivity(cpmx1O)0N 00a Lfl—o0 0—N 00 b122Figure 42. Effect of increasing & protein concentration on PspoHA activity.Transcription assays were carried out with various dilutions of 0H protein and aconstant amount of core RNA polymerase. The final 0H concentrations in these assayswere; lane 1, 0.1 jiM; lane 2, 0.2 jiM; lane 3, 0.4 jiM; lane 4, 0.8 jiM; lane 5, 1.6 jiM.Since there is no direct assay to determine the specific activity of recombinant aHprotein, these concentrations reflect the final concentrations of total protein. Reactionswere conducted in the presence or absence of phosphorelay reaction samples (+1- 480nM SpoOA-P). The RNA products from these assays were separated by electrophoresisand visualized by autoradiography (A). PspoiiA activity was quantitated by measuringCerenkov radiation in gel slices containing transcript III and are plotted as a function oftotal aH protein (B) in the absence (-0-) or presence (-) of SpoOA-P.PspoiiAactivity(cpmx10-3)(J)-0 000 0.o 0 > 0 0 0000 0-I N)ci•4•..•N) -b Li‘S124through transcription rate assays, therefore, a kinetic analysis of this promoter was notpursued.3. The combined effect of SpoOA-P and H concentration on PspoJM activity.In vivo levels of active & protein are known to rise at about the same time theexpression of the spollA operon begins. Therefore, the expression of the spollA operonis potentially dependent on both SpoOA phosphorylation and the intracellularconcentration of 0H protein. The effect of aH concentration on transcription fromPspoiiA was examined by adding various dilutions of the protein to PspoiiA transcriptionassays that contained no SpoOA or a constant amount of SpoOA-P (Figure 42). Asexpected, promoter activity was very responsive to increased aH concentration, but thiswas especially true for transcription assays that contained SpoOA-P. It was estimatedthat transcription assays without SpoOA-P required three times the concentration of &to reach the same level of PspoIIA transcription as in reactions containing SpoOA-P.125DiscussionI. Summary of results.1. Summary of the effect of SpoOA and its phosphorylation on in vitro transcription.Transcription assays clearly demonstrated that purified SpoOA stimulated thetranscription from PspoiiG and PspoIIA particularly after the protein had been modifiedby the phosphorelay. Phosphorylation of SpoOA increased maximum promoterstimulation and substantially lowered the concentration of SpoOA required to reachmaximum activity at both PspoiiG (Results II, 3) andP1,0j(Results VI, 2). The effectof phosphorylation on the ability of the SpoOA to stimulate transcription was clearlydemonstrated by coupling several PspoJJG transcription assays to a phosphorelay time-course reaction (Results II, 5). Enhanced stimulation of spoIIG closely paralleledprogression of the kinase reaction and thus demonstrated the potential of thephosphorelay to function as a signal transduction system regulating SpoOA activity.This was taken as corroborative evidence for the hypothesis that SpoOA and thephosphorelay system are directly responsible for activation of the spolIG and spollAoperons in vivo. Activation of these operons which encode the developmental sigmafactors aE and aF, represents a crucial step in the commitment to cellular differentiationand testifies to the central role of SpoOA and the phosphorelay in the induction ofsporogenesis.2. Summary of the investigation of SpoOA(-P) stimulation of PspojjG.Transcription rate assays provided an effective means of investigating the mechanismthrough which SpoOA(-P) stimulated PspoiiG activity. These experiments indicated thatSpoOA-P catalyzed a rate limiting step in a transcription initiation reaction that wasunaffected by the concentrations of the two reactants, RNA polymerase and PspoiiGtemplate (Results IV, 4, 5, & 7). This suggested that SpoOA-P influenced an126isomerization step that followed a rapid equilibration of RNA polymerase binding to thepromoter.DNaseI protection assays showed that phosphorylation of SpoOA significantlyenhanced its ability to bind PspoiiG especially to OA boxes situated at the -50 and -40positions (region II). In addition, these experiments provided compelling visualevidence that RNA polymerase did not require assistance from SpoOA(-P) to bindPspoi.iG. Instead, SpoOA(-P) dependent transitions in po1ymerase/P0IIG footprintsindicated that the transcription factor affected structural transformations in ternarycomplexes formed at the promoter.II. Interpretation of in vitro transcription and DNaseI footpnnting data.1. Correlation between PspoHG transcription assays and DNaseI footprintingexperiments.Collectively, DNaseI footprinting experiments carried out on g’jIIG compared wellwith the kinetic data from transcription rate assays. DNaseI protection patterns indicatedthat relative levels of j, C11 and C complexes were dependent on the amount ofSpoOA or SpoOA-P added to footprint reactions (Results V, 5). Moreover, the formationof each type of complex appeared to correlate with different levels of PspoJjG activity intranscription assays that contained similar SpoOA(-P) concentrations. In the absence ofSpoOA(-P), kinetic footprinting assays indicated that Cj formation was very rapid(Figure 31 & 32). But transcription rate assays that contained no SpoOA suggested thatC1 was equated with a slow rate of initiation and low completion levels of PspoIIGtranscription. A transition from Cj to C was observed footprint assays that containedhigh concentrations of non-phosphorylated SpoOA or very low concentrations of SpoOAP. This was associated with a modest rise in both the rate of initiation and completionlevels of activity in transcription rate assays that contained similar SpoOA(-P)concentration. Maximum stimulation to the rate and completion level of PspoiiG127transcription correlated with the formation of a C footprint, but was observed only intranscription or DNaseI protection assays that contained at least 100 - 200 nM SpoOA-P.2. Interpretation of PspoJJG transcription kinetics and DNaseI footprints.Although transcription rate assays measured the kinetics of heparin-resistant complexformation (Results IV, 1 & 2), DNaseI footpnnting experiments were carried out in theabsence of GTP. Thus, Cj, C11, and CIII must all be heparin-sensitive complexes thatprecede the heparin-resistant state. In reconsidering the reaction model (Ri 1) discussedearlier (Results IV, 8);k k k______2______P + P HS1 + OA(-P) HS2 HRk1 krit is apparent that Ci is equivalent to HS 1. Therefore, C11 and C must represent HSreaction intermediates resulting from isomerization steps toward HR. It is possible thatC11 and C may be intermediates from separate initiation pathways that are dependenton the action of either SpoOA or SpoOA-P, or they may represent consecutiveintermediates of the transcription initiation process at PspoiiG. From the data obtained intranscription and footprinting experiments, it could not be determined which of thesealternatives best describes the reaction pathway through which SpoOA(-P) stimulatedPspoiiG transcription.From the changing patterns of DNaseI hypersensitivity in footprinting assays thatcontained RNA polymerase and various concentrations of SpoOA or SpoOA-P, it wasapparent that heterogeneous populations of ternary complexes were formed at thepromoter. Moreover, the observed transitions between different footprint patterns underthese conditions suggested that SpoOA(-P) influenced equilibrium levels of Cj, C11 andC complexes. Thus, the effect of SpoOA and SpoOA-P on the relative distribution ofvarious ternary complexes provides a rationale for understanding how transcriptionactivation of PspoiiG is achieved. In the absence of SpoOA(-P), RNA polymerase binds128rapidly to PspoIIG indicating the forward rate constant, k1, is very large. But since fewcomplexes are able to isomerize past Cj, transcription levels remain low. Addition ofSpoOA or SpoOA-P drives the initiation reaction in the forward direction because theyaffect individual rate constants causing equilibrium levels of ternary complexes to shifttoward the C11 or C intermediates. Consequently, the maximum level of promoteractivity and rate of productive transcription initiation at PspoHG ,is stimulated. Thekinetic analysis could not distinguish whether SpoOA(-P) functioned to increase aforward rate constant (k2) or decrease a reverse rate constant (k2), however, eitherinfluence would have the effect of raising the concentration of intermediate (C11 or C)complexes.Comparison of the rapid appearance of DNaseI footprints with the slow rates of HRformation in rate assays that contained no SpoOA or non-phosphorylated SpoOA, showedthat Cj formation occurred prior to the rate limiting step in the initiation reaction. Incontrast, the SpoOA-P dependent formation of Cjjj was associated with very high ratesof transcription initiation. Although C111 is not heparin-resistant, it must be capable of avery rapid conversion to HR suggesting that SpoOA-P catalyzes a rate limiting initiationstep by facilitating C111 formation. C111 may be analogous to a transition stateintermediate which has achieved the activation energy required for productivetranscription initiation. SpoOA-P could act as a catalyst for transcription initiation bylowering the activation energy of C111 formation. This would effectively increase theconcentration ofC111 complexes and thus cause the rate of transcription initiation toaccelerate.HI. A model for transcriptional stimulation of P,JJG.1. Compensating for the unusual structure of PspoJJG.The Cj footprints observed in DNaseI protection experiments showed RNApolymerase bound primarily to the -35 hexamer and afforded little or no protection to129the -10 region of PspoiiG. Since RNA polymerase is believed to catalyze DNA meltingat the -10 hexamer (Roe etal., 1985; Travers, 1987; Leirmo and Record, 1990) itiscrucial that the polymerase contact this site to initiate transcription. In the absence ofSpoOA(-P) this is largely prevented, probably because of the unusual length of thePspoiiG spacer.In general, point mutations within the spacer region do not effect promoter strengthsignificantly (Siebenlist, et al., 1980b; Beutel and Record, 1990). However, it has beendemonstrated that changes to the length of the spacer can have a strong influence ontranscriptional activity (Stefano and Gralla, 1982 ; Ayers et al., 1989). Assuming ahelical pitch of 10.5 bps per turn, the rotational positions of the -35 and -10 recognitionelements are offset in a promoter with a normal 17 bp spacer region. Stefano and Gralla(1982b) studied the kinetics of transcription initiation with a series of promoterconstructs that differed only in their spacer lengths. It was concluded that the rotationalorientation of the recognition sites and the rigidity of the spacer DNA could be crucialdeterminants of promoter strength. They postulated that following closed complexformation, RNA polymerase maximizes -35 and -10 contacts by untwisting the spacerDNA and that the torque applied to the spacer creates stress within the DNA that couldfacilitate the nucleation of strand separation. The implications of this model wereinvestigated by deHaseth and coworkers (Auble et al., 1986; Auble and deHaseth, 1988;Ayers et aL, 1989) by testing the effects of structural changes to the spacer region onpromoter activity. Their results are consistent with the notion that 17 bps is the optimalspacer length to permit polymerase binding to both recognition sites while providingenough torsion free energy to favor open complex formation. Stefano and Grallaspeculated that promoters with sub-optimal spacer lengths might require activatingproteins to adjust the helical pitch of the DNA to facilitate transcription initiation(Stefano and Gralla, 1982b).130Compared to the C1 footprint, the DNaseI protection patterns of both C11 and Cindicated that the polymerase had extended its promoter contacts toward the -10hexamer. The elongated footprint was accompanied by conspicuous sites of DNaseIhypersensitivity that were located within the spacer region. This suggested that SpoOAand SpoOA-P may have altered promoter structure or assisted the polymerase indistorting PspojjG so that it was able to contact the -35 and -10 recognition sitessimultaneously.A similar mode of action has been proposed for the MerR protein which regulates thetranscription of a mercury resistance gene encoded by the transposon Tn501. Like thespoliG operon, the iner gene is controlled by a promoter with an extended spacer (19bps). Although RNA polymerase is able to bind the -35 hexamer of the iner promoter,stable contact with the -10 site is prevented by the long spacer (O’Halloran, et at., 1989;Frantz and O’Halloran, 1990). Chemical reagents that detect aberrations in DNAstructure were used to demonstrate that when MerR binds to the spacer region in thepresence of its allosteric effector, Hg(II), it contorts the DNA. The distortion has beeninterpreted as a localized unwinding of DNA which allows polymerase bound to the -35hexamer to contact the -10 site. Experiments with mutant forms of MerR that arecapable of unwinding Pir DNA to varying degrees in the absence of Hg(ll), have usedto correlate increased DNA distortion with enhanced transcription. Therefore, it hasbeen proposed that MerR activates the mer gene by removing a kinetic obstacle totranscription initiation through alignment of the -35 and -10 hexamers (Parkhill et at.,1993).Since no DNaseI hypersensitive sites were evident in SpoOA(-P) (Figure 30)footprints it was apparent that, unlike MerR, neither form of the protein distorted PspojjGthrough DNA binding alone. Instead, the hypersensitive sites observed in C and C111footprints suggest that SpoOA(-P) may have assisted in untwisting the Pspoi.iG spacer sothat RNA polymerase bound to the -35 site was able to contact the -10 hexamer. Since131the effects of SpoOA and SpoOA-P on the completion levels and initiation kinetics atPspoiiG were substantially different, it was assumed that structural differences betweenC11 and C must be significant in terms of promoter activity. Given that the spoIIG 35sequence is situated on the opposite side of the helix compared to normal positioningrelative the -10 element, the degree of spacer distortion required to align these siteswould be considerable. This could account for the strong hypersensitive sites observedin the DNaseI protection pattern produced by the C11 complex. However, most of thehypersensitive sites were absent in the C footprint (Figure 36). Therefore, it isreasonable to assume that the degree of DNA distortion was reduced during thetransition from C jto C. If torsional strain within C11 was significantly higher than inC, it may account for the difference in complex stability that was apparent in thekinetic DNaseI footprinting assays conducted at 37° C. It may also suggest that nonphosphorylated SpoOA was unable to resolve strain within the Cu ternary complex sothat polymerase was prevented from initiating transcription efficiently.The absence of DNaseI hypersensitivity from C footprints and increased stabilityassociated with the transition to C suggested that resolution of the DNA distortionapparent in may be attributed to SpoOA-P. if the DNA in the PspoiiG spacer wasunderwound in order to align the -35 and -10 hexamers, one option to relieve structuraltension in the template would be to induce melting of the DNA helix. However, becauseit was subject to heparin inhibition it does not appear that C111 was equivalent to a“classical” open complex. From the studies of several E. coli promoters, opencomplexes are defined by exceptional stability and resistance to competitive inhibition.In many cases, open complex formation has been considered to be an irreversible step inthe transcription initiation reaction (Buc and McClure, 1985; Straney and Crothers,1987b). However, this is clearly not true for C complexes formed at PspoiiG.A second possibility for resolving DNA distortion at PspoJJG would involve a releaseof polymerase contacts with the -35 hexamer. This would have the effect of relieving132the torsional strain caused by simultaneous contact with both promoter recognition sitesand leave the polymerase free to catalyze strand separation at the -10 hexamer. SpoOAP may compensate for release of the -35 hexamer by stabilizing the polymerase/complexthrough direct protein-protein contact. Freeing the polymerase from the -35 site mayalso contribute to rapid promoter clearance when the polymerase must release allcontacts with promoter sequences as it converts from transcription initiation to RNAelongation. Whipple and Sonenshein (1992) proposed this to be the slow step in theirgeneralized model for transcription initiation by B. subtilis polymerase. Upon closeexamination of the m footprint there appeared to be no indication of weakened DNaseIprotection to the -35 hexamer (Figures 31, 32, & 36). However, it is very likely that the-40 region of a C complex would be inaccessible to DNaseI cleavage due to SpoOA-Pbinding to the OA box which overlaps the -35 sequence. It is possible thathydroxyradical footprinting which can produce high resolution protection patterns, mayhelp to determine whether polymerase within a C complex has released or altered itscontact with the -35 hexamer.A model derived from the data of PspoiiG transcription rate assays and DNaseIfootprinting experiments is presented in Figure 43. It provides a working hypothesis forthe influence of SpoOA(-P) on transcription based on the supposition that RNApolymerase in a closed complex is induced to untwist the spacer DNA (C11) and thenresolve extensive template distortion (Cjjj) prior to the initiation of an RNA.Approximations of relative rates for various reaction steps in the presence or absence ofSpoOA(-P) are given. Rates indicated for the formation of each of the ternary complexesreflects the rate of C1,C11, and C111 complex formation in kinetic footpnntingexperiments. Rates for the conversion of the various complexes to the initiated statewere deduced from the rates of transcription initiation associated with the formation ofthese complexes.133R + P closed untwisted resolved initiatedThis schematic depicts a model for transcription stimulation at PspoHG by the phosphorylated andnonphosphorylated forms of SpoOA. R represents RNA polymerase and P represents PoIIG.Correlation between closed, untwisted, and resolved complexes with C1,C11, and C, respectively,represent interpretations of DNaseI footpnntmg involving SpoOA(-P) and RNA polymerase (DiscussionIII, 1). The velocities indicated for various reaction steps convey relative rates as determined fromkinetic footprinting and transcription experiments. At present it is not known whether Cj, C11, and Care intermediates within a single reaction pathway or result from alternative pathways that depend onthe presence and concentration of SpoOA(-P).inithitedverijrapidR÷PFigure 43. Model for activation of PspoiiG by SpoOA(-P).rapidCIII(SpoOA- P)134IV. The role of SpoOA-P phosphorylation.1. N-terminal inhibition of the DNA binding domain.Results from transcription assays showed that the level of PspoJJG stimulationattributed to SpoOABD was intermediate to the influence of SpoOA and SpoOA-P.Sp0OABD stimulated both completion levels and the rate of initiation, particularly at lowKAc concentration (Results IV, 9 & 10). DNaseI protection studies have shown thatbinding of SpoOABD to OA boxes situated downstream of the abrB promoter producedthe same footprint as the intact protein (Grimsley et at., 1994). Thus the transcriptionand footprinting data suggests that the C-terminal domain of SpoOA is capable ofsequence-specific DNA binding and probably contains the portion of the protein that iscrucial to transcription activation. Mutations that render SpoOA to be defective intranscription activation have been isolated in the C-terminus of the protein. One, calledspoOA9V, is capable of repressing abrB expression in vivo but can not activate spollAtranscription (Perego et at., 1991). It is also known that removal of the last 15 residuesof the SpoOA protein causes a sporulation defective phenotype (Ferrari et at., 1985;Spiegelman et at., 1994). Thus, residues important for contact with RNA polymerasemay reside in the C-terminus.It is conceivable the N-terminal domain of SpoOA functions to negatively regulatetranscription modulation by the C-terminal domain. This hypothesis was tested byplacing a series of mutant spoOA genes that carried various deletions within the N-terminal domain, under the control of an inducible promoter. Under inducingconditions, some of these constructs allowed for the initiation of sporulation and theresponse was shown to be independent of a functional phosphorelay (Ireton et at., 1993).N-terminal deletions have also been implicated in the activation of various othertranscription factors (Menon and Lee, 1990; Kahn and Ditta, 1991) suggesting thatinteractions between separate domains may be a common method of controlling thetranscription regulating properties of these proteins.135A possible explanation for improved DNA binding and transcription stimulation bySpoOA-P is that phosphorylation modifies the structure of the protein thereby activatingits transcription regulating properties. Although this has not yet been demonstrated, ithas been proposed that the free energy change associated with aspartyl-phosphate bonds(-10 to -13 kcallmol) is sufficient to drive a large conformational change in proteinstructure (Tanford, 1984; Stock et at., 1989). In its non-phosphorylated state the N-terminal domain of SpoOA may interfere with DNA binding by the C-terminus throughsteric hindrance or interact with residues in the C-terminal domain to hold it in aninactive conformation. Phosphorylation could induce an adjustment in the spatialorientation of the two domains leaving the C-terminus free to bind DNA and thus effectgene expression.Despite the ability ofSp0OABD to enhance the transcriptional activity of PspoIIG,there were fundamental differences between the stimulatory effects ofSp0OABD andSpoOA-P. In contrast to SpoOA-P, the ability ofSp0OABD to stimulate the rate ofinitiation and completion level of transcription was extremely sensitive to KAcconcentration. In addition, the kinetics of initiation in the presence ofSp0OABD showeda distinct lag, particularly under low salt conditions, that was absent from rate assayscontaining SpoOA-P (Figure 28). The lag indicated that two reaction steps significantlyinfluenced transcription initiation in assays that contained SpOOABD and that DNAbinding and/or interaction with the polymerase was impaired. This would imply thatdespite its apparent inhibition of the function of the C-terminal domain, the N-terminaldomain may also have an active role in the stimulation of PspoiiG transcription. It isconceivable that this portion of the protein may provide a stabilizing influence onSpoOA structure which may become critical at higher salt concentrations. DNaseIprotection experiments that examine the effects of Sp0OABD on ternary complexes atPspoHG at various KAc concentrations should provide clues to differences between thebinding domain and SpoOA-P in terms of mediating transcription stimulation.1362. Possible roles for the OA boxes upstream ofDNaseI footprinting experiments established that binding of SpoOA to PspoiiGparticularly to the low affinity OA boxes in region II, improved dramatically when theprotein was phosphorylated. This finding is in agreement with the report of Baldus et al.(1994). DNA binding by various other response regulators including NtrC (NR1)andOmpR, has been shown to increase substantially following phosphorylation (Ninfa andMagasanik, 1986; Ninfa et al., 1987; Aibe et al., 1989). This raises the possibility thatphosphorylation of SpoOA enhanced its capacity for transcription activation byincreasing its affinity for specific OA box(es) on the PspoiiG template.Mutations within the OA boxes situated at -94 and -84 had very little effect on thetranscriptional activity of PspoIIG even though they abolished SpoOA(-P) binding to thisregion. In addition, DNaseI protection assays carried out with PsponGM94templatedemonstrated that the OA boxes at -94 and -84 were not essential for C11 or Cformation. Although it appeared that higher SpoOA(-P) concentrations were required toobserve isomerizations in ternary structures on the mutated template. DNaseI assayssuggested that the high affinity -94 and -84 OA boxes of region I may have influencedSpoOA-P binding to the low affinity OA boxes of region II. It is conceivable that thebinding sites in region I function as transient binding sites which localize the SpoOAprotein to PspoilG. There has been speculation that multiple binding sites mayeffectively tether DNA binding proteins to their target sites. This could be particularlyimportant when factors are present in a low intra-cellular concentration (Record andMossing, 1987). A similar role has been postulated for NtrC enhancer sites in theactivation of the ginA promoter (Wedel et al., 1990). Alternatively, SpoOA-P bound tothe high affinity sites may promote binding of additional SpoOA-P proteins to the OAboxes in region II through cooperative interactions in a manner analogous to activationof the Ppjj promoter by the ? repressor, ci (Discussion VII, l.a.)137Transcription assays and DNaseI protection experiments identified the OA boxespositioned at -50 and -40 as being the functionally important sites for stimulation ofPspoiiG transcription. However, it is difficult to determine from DNaseI protectionpatterns which sites must be occupied by SpoOA(-P) to catalyze Cjj or Cm formationbecause the -60 to -20 region was protected from DNaseI cleavage by RNA polymerase.Because SpoOA-P appeared to bind equally well to the -50 or -40 OA boxes in theabsence of RNA polymerase, it is reasonable to assume that SpoOA-P binds both sites tofacilitate C formation. Although non-phosphorylated SpoOA bound poorly to the lowaffinity sites in the absence of RNA polymerase it is probable that the protein must bindat least one site to convert C1 into a C11 complex.It is possible that the OA boxes at -50 and -40 contribute separate functions (i.e.promoter distortion versus the resolution of DNA distortion) to the isomerization ofternary complexes formed at PspoHG. SpoOA(-P) may be required to bind one site toinduce the polymerase to untwist the PspoiiG spacer leading to C11 formation. Bindingto a second OA box may be necessary to resolve DNA distortion perhaps through directinteraction with the polymerase, thus leading to CIII formation. Non-phosphorylatedSpoOA may have been unable to accommodate the isomerization to C because it couldonly bind one of the functional OA boxes. This hypothesis is consistent with theobservation that transitions from Cj to Cjj or C were dependent on SpoOA-(P)concentration. Very low concentrations of SpoOA-P produced a mixture of C and Cfootprints which could have resulted if the amount of SpoOA-P was insufficient to bindboth of the OA boxes in all ternary complexes formed in the reaction. Interestingly,DNaseI hypersensitivity that distinguished the 11 complex appeared to be reduced atvery high concentrations of nonphosphorylated SpoOA suggesting that weak binding to asite crucial for the CII to C isomerization was overcome under this condition. Itshould be possible to test the above hypothesis by examining transcription from PspoiiGconstructs with mutations in the -50 and -40 OA boxes. However, mutating the -40 site138has the caveat that the -35 polymerase recognition site would be altered thus making itdifficult to access changes to PspoiiG activity.3. Evidence for protein-protein contact.Even if the two OA boxes of region II contribute separate functions required forisomerization to C and hence stimulation of PspoiiG transcription, it is possible thatSpoOA-P stimulates promoter activity because it is able to assist the polymerase throughspecific protein-protein contacts. SpoOA may be incapable of providing a similarfunction. Kinetic footprinting experiments demonstrated that very little SpoOA bound toPspoiiG in the absence of RNA polymerase (Figures 31 & 32). Once polymerase wasadded to the reaction, binding of SpoOA to the OA boxes at -94 and -84 was enhancedand a relatively slow transition to a C11 DNaseI protection pattern followed. Thistransition was interpreted as evidence that SpoOA bound to at least one of the OA boxesin region II, and indicates that stable binding of SpoOA to this site resulted fromsynergistic interaction with the polymerase.The interaction between SpoOA and the polymerase is similar to that reported for thecatabolite activator protein (CAP) and RNA polymerase at the lac promoter of E. coli.In vitro studies have demonstrated that binding of CAP alone to the lac promoter wassubject to a very high rate of dissociation (Straney et al., 1989). Addition of RNApolymerase to binding reactions stabilized binding of CAP to the DNA and led to theproduction of transcriptionally competent ternary complexes. It was proposed thatsynergy, resulting from direct protein-protein contact, stabilized binding of both CAPand polymerase to the DNA. It was determined that CAP then catalyzed a rapidisomerization to an open complex.In the case of SpoOA(-P), there was no evidence that binding to PspoiiG resulted inDNA distortion in the absence of RNA polymerase (Figure 30). Instead, the strong -28and -26 DNaseI hypersensitive sites of C11 and C footprints which are 10 to 12 bpsdownstream from the nearest OA box (at -40), suggested that SpoOA(-P) induced RNA139polymerase to distort PspoiiG spacer DNA. Given the proximity of the downstream OAboxes to the region of RNA polymerase binding, it is simplest to assume that SpoOA(-P)directed a conformational change in the polymerase through direct protein-proteincontacts and that this resulted in DNA deformation.Evidence for protein-protein contact between RNA polymerase and several differentbacterial transcription factors has been reviewed recently by Ishthama (1993).Mutational analysis of RNA polymerase has shown that transcription factors often fallinto one of two classes. Class I factors such as OmpR and OxyR, contact the C-terminusof an x subunit within the polymerase to affect transcription initiation (Igarashi, et al.,1991; Ishihama, 1993). Whereas class II factors including PhoB and ?cI, interact withthe a subunit (Makino et al., 1993; Li et aL, 1994). There is genetic evidence that hintsat interaction between a4 and at least some spoO gene products (Kawamura et aL,1985). However, there are still a number of transcription factors including MerR and?dll which have not yet been characterized (Ishihama, 1993). These factors may exhibitnew ways of contacting RNA polymerase and SpoOA-P may prove to belong in thiscategory. Protein subunit crosslinking studies have been undertaken in our laboratoryand may determine which portion of the polymerase is touched by SpoOA(-P).V. Temperature and salt effects on ternary complex formation andtranscription from Psp0IIG.1. Temperature effects on ternary complex formation.DNaseI protection assays carried out at 31° and 25° identified the SpoOA dependenttransition from j to C11 as a temperature sensitive step. In contrast, the isomerization toC facilitated by SpoOA-P was unaffected at these temperatures. These observationsappear to be inconsistent with in vitro transcription data which indicated that promoteractivity was dramatically reduced at temperatures below 300 C even in the presence ofSpoOA-P. The reason for this discrepancy is not known. It is possible that the transition140from Cjj or C complexes to the heparin-resistant state which must occur sometimeafter incorporation of the first GTP, may be very sensitive to reduced temperature.Since C is not perceived to be a stable open complex, the transition from C to HRprobably involves opening the DNA helix which is known to be an endothermic process(Leirmo and Record, 1990). Because of the extended PspoiiG spacer, the enthalpic costof opening the helix may be higher than usual.The 310 and 250 C DNaseI experiments produced a second paradox when it wasnoted that the Cj and C11 footprints did not disappear late in the time-course as they hadat 370 C. This implied that lower temperatures stabilized Cj and C11 complexes eventhough the rate and level of C11 formation was inhibited. There is no obviousexplanation for complex stabilization unless the rate of decay in RNA polymeraseactivity was significantly reduced at the lower temperatures.DNaseI protection experiments with RNA polymerase, carried out at 15° C, producedCj footprints that were comparable to those obtained at higher temperatures. In contrast,the SpoOA(-P) dependent formation of C11 or type footprints was completelyinhibited at 15° C. At this temperature, DNaseI protection patterns suggested that RNApolymerase and SpoOA(-P) were able to bind PspoiiG but the ternary complexes couldnot isomerize to Cjj or C. It was concluded that low temperature adversely affectedSpoOA(-P) mediated isomerizations involving changes in the polymerase conformationand/or DNA structure.Footprinting techniques have been used previously to study the effects of lowtemperature on ternary complexes formed at various E. coli promoters. Three distinctlydifferent footprint patterns were obtained at the Al promoter from phage T7 at varioustemperatures (Schickor et al., 1990). The dissimilar footprints were postulated to arisefrom closed (<8° C), intermediate (8° - 21° C), and open complexes (>21° C).Similarly, it was found that RNA polymerase produced different footprints at thelacUV5 and T7-A3 promoters at 0° versus 37° C (Kovacic, 1987). In each case, the141polymerase footprints obtained at the lowest temperatures protected a smaller region ofthe promoter from chemical or nuclease cleavage than at the higher temperatures.Interestingly the low temperature footprints were primarily confined to the -35 regionand thus resembles the Ci footprint observed at PspoIIG. Higher temperatures facilitatedan extension of the polymerase footprint to the -10 region and the start-site fortranscription. The effect was similar to the influence of SpoOA(-P) on polymerasecomplexes formed at PspoIIG (>250 C) which produced the extended C11 and C111footprints.These similarities indicate that the abnormal structure of PspoiiG imposes aconsiderable thermodynamic barrier to transcription initiation. The extended spacerwhich must be untwisted over a very short distance, may exact a high enthalpic cost. Ifso, most RNA polymerase/P0jIGassociations may remain trapped as closed complexesbecause they are unable to attain the activation energy necessary for isomerization.SpoOA and SpoOA-P could function as catalysts to lower the activation energyrequirement to overcome the unfavorable change in enthalpy associated withisomerizations in protein or DNA structure. This possibility is consistent withinterpretations of transcription rates assays discussed above (Discussion II, 2).2 The effect of ion concentration.Thermodynamic studies of three different E. coli promoters have demonstrated thatthe enthalpy of transcription initiation is positive. Consequently, transcription initiationis an entropically driven process. This accounts for the strong salt dependenciesreported for most in vitro promoter studies (Roe et al., 1985; Buc and McClure 1985;Duval-Valentin and Ehrlich 1987). In general, the salt sensitivity of protein/DNAbinding interactions are dominated by the mixing entropy associated with cation releaseresulting in the polyelectrolyte effect discussed earlier (Results ifi, 2). This is likely tobe the basis for the extreme sensitivity of PspoiiG transcription to elevatedconcentrations of NaC1 and KC1. However, the finding that salt sensitivity could be142relieved by the substituting Ac- for C1 showed that anions could also have a stronginfluence on the initiation process at PspoliG. Because this effect was observed only inthe presence of SpoOA-P it appeared that the Ac- effect exposed a fundamentaldifference in the mechanism of transcription stimulation by SpoOA-P as compared toSpoOA or Spo0A.Substitution of glutamate (Gluj or Ac- for C1 has been shown to stabilize DNAbinding by RNA polymerase, the lac repressor, and various restriction enzymes (Leirmoet al., 1987; Leirmo and Record, 1990; Ha et at., 1992). In addition, anion substitutionoften expands the range of salt concentrations over which the enzymatic activities ofDNA binding proteins can occur. Since significant DNA/anion interactions are unlikelyto occur, the anion effect is believed to involve DNA/protein interactions. The influenceof anion type on protein/DNA binding usually follows the Hofmeister series which ranksanions according to their effects on protein solubility (Leirmo and Record, 1990).Record and coworkers have investigated the thennodynamic origins of the anion effectby studying the influence of anion substitution on DNA binding by the lac repressor (Haet at., 1992). They determined that there was no straight forward explanation for theanion effect. However, one hypothesis raises intriguing possibilities for the KAc effecton transcription stimulation at PspoliG.It has been speculated that various types of anions (particularly G1u and Ac-) may bepreferentially excluded from non-polar amino acid residues that are exposed to thesolvent. This would produce a gradient in water concentration in close proximity to thesurface of the protein. The magnitude of the gradient would increase with elevated Acconcentrations and could provide a contribution to the thermodynamics of DNA bindinginteractions and/or conformational changes in protein structure if either results in theburial of hydrophobic surface area. The free energy change associated with “thehydrophobic effect” would depend on the type of anion in solution and the size of the143hydrophobic surface area removed from solvent contact (Leirmo and Record, 1990; Haetal., 1992).If the hydrophobic surface area of SpoOA-P was significantly greater than eitherSpoOA or Sp0OABD it follows that the hydrophobic effect would exert a larger influenceon its activities. Structural modeling of SpoOA by P. Youngman and coworkers ledthem to speculate that phosphorylation could expose a portion of the SpoOA protein thatcontains several hydrophobic residues (Green et al., 1991). If so, it is possible thatphosphorylation of SpoOA could be responsible for driving a protein conformationalchange that would provide for a strong hydrophobic effect. This could translate intoincreased affinity for the functional OA boxes (region II) of PspojjG that would be lesssensitive to Ac- concentration. Alternatively, a hydrophobic effect could influence aconformational change in SpoOA-P after it had bound to target sites on the DNA. Astructural change in SpoOA-P could be coupled to DNA distortion or a conformationalchange in the polymerase which in turn would lead to C formation and stimulation ofPspoiiG transcription.Since all DNaseI protection experiments described in this work were carried out atlow concentrations of KAc it is not known whether high salt concentrations inhibitedDNA binding by non-phosphorylated SpoOA, Sp0OABD and/or RNA polymerase. It isalso possible that higher KAc concentrations might effect the synergistic interaction thatwas apparent between SpoOA and the polymerase and which led to Cii formation. Itshould be informative to carry out DNaseI protection experiments at increased KAcconcentrations to determine whether protein binding or the isomerization from Cj to C11is effected.144VI. The effect of SpoOA-P 011 PspoIIA.1. Stimulation by SpoOA-P and the effect of cvH concentration.In vitro transcription assays demonstrated that SpoOA-P stimulated the transcriptionalactivity of PspoiiA. Although the mechanism of stimulation was not investigated it wasapparent that the difference between basal levels of transcription and the effect ofSpoOA-P was dependent on 0H concentration. Transcription assays that containedvarious amounts of 0H showed that the stimulatory effect of SpoOA was greatest at low0H concentrations. Transcription assays that contained very high aH concentrationsresulted in P,oIIA activity that approached levels obtained from assays that containedSpoOA-P. This result may reflect technical aspects of the in vitro transcription systembut could also have relevance to the way expression of the spollA operon is regulated invivo.There is a potential for SpoOA-P to positively regulate the spollA operon directlythrough stimulation of transcription initiation at PspoJJA and indirectly by influencingexpression of spoOH (the aH gene). During vegetative growth, spoOH expression isrepressed by AbrB which ensures that spollA and the remainder of the 0H regulon issilent. Because SpoOA is a negative regulator of abrB during the transition state it canassist the induction of spollA by facilitating the production of &. Thus, the effect ofSpoOA-P at PspoIm may simply augment spollA expression until the intracellularconcentration of aH is sufficient to direct transcription of the operon.VII. SpoOA-P as a model for transcription factor activity.1. Review of prokaryotic transcription activator proteins.To compare activities of SpoOA to the function of transcription factors in general, itwill be useful to review what is known about some of the more well characterizedtranscriptional activators.145l.a. The ci protein.The repressor, or ci protein, is both an activator and repressor of transcription. cibinds cooperatively to its operator sites OR1 and OR2 that are superimposed overdivergent promoters. In this way, ci represses PR, a promoter for genescrucial to thelytic cycle, and activates its own synthesis through positive regulation of Ppj. Hawleyand McClure examined the kinetics of transcription initiation at RM and concluded thatci did not affect binding of RNA polymerase but did stimulate the conversion of closedto open complexes (Hawley and McClure, 1982). ci was not required to stabilize opencomplexes once they were formed. However, it was observed that binding of ci to theOR2 site that overlaps the -35 sequence of the promoter, was stabilized by opencomplexes at PRM. This was interpreted as evidence for protein-protein contact betweenthe polymerase and ci.Further evidence for contact between the polymerase and ci came frommutationalanalyses of the activator protein. Several mutant forms of ci were isolated that were notimpaired in their ability to bind OR sites or repress transcription from PR,but weredeficient in activating Pp (Guarente et al., 1982; Hawley and McClure, 1983b;Hochschild et al., 1983; Bushman et at., 1989). These alleles were found to containpoint mutations which clustered near a ‘helix-turn-helix’ DNA binding domain indicatingthat this portion of the protein (the activator region) interacted with RNA polymerase toaffect transcription at Ppj. Recently, Susskind and colleagues reported the isolation ofa mutant form of RNA polymerase that restored gene activating properties to a ci aprotein with a mutated activator region (Li et aL, 1994). The suppressor mutation wasfound to be in the C-terminus of the a7° subunit near the helix-turn-helix domain that isbelieved to bind the -35 promoter sequence. Thus, it appears that cibound to OR2contacts the a subunit of RNA polymerase to catalyze the isomerization from a closedto an open complex.1461.b. The catabolite gene activator protein (CAP or CRP).Despite being one of the most intensively studied transcription factors, themechanism through which the catabolite gene activating protein (CAP or CRP) regulatesgene expression in response to carbon utilization is still a matter for conjecture(Reznilcoff, 1992). A survey of genes within the CAP regulon has demonstrated that thepositioning of CAP binding sites positioned near activated promoters varies from -70 to-40 (Collado-Vides et al., 1991). CAP binds to DNA in the form of a dimer which isdependent on the allosteric effector, cyclic AMP (cAMP). It has been reported that theequilibrium constant for site specific binding of CAP to the lac promoter regionincreases by two orders of magnitude over what is considered to be a physiologicalrange of cAMP concentrations (0.5 - 10 IIM) (Fried and Crothers, 1984). However,investigations into the kinetics of transcription initiation at the major tac promoter(lacPl) by different assay techniques has produced contradictory results regardingwhich reaction step is stimulated by CAP (Malan et at., 1984; Straney et al., 1989).The crystal structure of a CAP-DNA complex has been solved (Schultz et at., 1991)and it suggests that CAP causes a 90° bend in the DNA. There has been speculation thatDNA bending is an integral part of the CAP activation mechanism and either orients theprotein with respect to the polymerase to optimize protein-protein contact or allows thepolymerase to contact DNA sites upstream of the CAP binding site (Gartenberg andCrothers, 1991; Schultz et at., 1991). There is general agreement that binding of RNApolymerase to the lac promoter region stabilizes site specific DNA binding by CAPwhich has been interpreted as evidence for direct protein-protein contact. (Ren et at.,1988; Straney et at., 1989). As for ci, CAP mutants have been isolated which bind DNAnormally but are defective in activating transcription (Irwin and Ptashne, 1987;Eschenlauer and Reznikoff, 1991). These mutations were found to lie near the DNAbinding domain. The possibility of contact between CAP and the polymerase has beenexamined by studying cooperative binding between CAP and a mutant form of RNA147polymerase. Interestingly, CAP and the mutant polymerase which contained a truncatedc subunit, bound cooperatively to the galPi promoter but not to lacPl (Koib etal.,1993) indicating that CAP has the potential to affect transcription initiation by twodifferent mechanisms. One involving direct contact with c subunit of the polymeraseand the other through an undefined mechanism.1.c. The OmpR activator.OmpR is a response regulator which controls the reciprocal regulation of the outermembrane porins, ompC and ompF, according to changes in medium osmolarity (Stocketal, 1989). At low osmolarity OmpR stimulates transcription of ompF. At highosmolarity OmpR represses ompF and activates ompC transcription. The activities ofOmpR are controlled by the sensor/kinase, EnvZ, which has both kinase andphosphatase activity. The current view is that the balance between the kinase andphosphotase activities of EnvZ is affected by osmolarity (Russo and Silhavy, 1991;Russo and Silhavy, 1993). Consequently, EnvZ is able to maintain, raise, or lower theintracellular concentration of OmpR-P depending on the conditions of the externalenvironment. Phosphorylation of OmpR has been shown to enhance its ability to bindDNA and it appears that the protein functions to control relative levels of ompF andompC transcription from low and high affinity binding sites upstream of their respectivepromoters (Aiba et at., 1989: Nakashima et at., 1991).The -35 and -10 promoter recognition sites of the ompF and ompC promoters deviateconsiderably from consensus promoter sequences. Therefore, the mechanism throughwhich OmpR-P activates transcription was investigated by fusing its DNA binding siteto 27 synthetic promoter sequences (Tsung et at., 1990). OmpR was observed toactivate in vivo transcription from most promoter constructs although one whichcontained a consensus -35 hexamer was actually repressed by OmpR. The conclusionfrom in vivo footprinting experiments was that OmpR stimulated transcription bystabilizing closed complex formation through protein-protein contact. Evidence for148direct contact between OmpR and RNA polymerase has also resulted from a mutationalanalysis of the polymerase. OmpR was unable to assist RNA polymerase that containsmutations within the C-tenninus of the a subunit in transcribing the ompF promoter(Slauch et at., 1991). This indicated that, like CAP, OmpR functions to activatetranscription through direct contact with the x subunit of the polymerase.1.d. The NtrC activator.NtrC (NRj) of enteric bacteria, activates genes necessary to nitrogen assimilation andis probably the most extensively investigated of all response regulators. Its transcriptionregulating activities are controlled by the sensor/kinase, NtrB (NR11), which sensesnitrogen limitation (Ninfa and Magasanik, 1986). Investigations into gene activation byNtrC have concentrated on the ginA gene (glutamine synthetase). Activation of ginA hasbeen shown to depend on two NtrC binding sites located 140 and 110 upstream of thetranscription start site. These binding sites have been demonstrated to have enhancer-like properties and can be moved a kilobase upstream or downstream from their normalpositions without eliminating NtrC mediated activation of ginA expression (Reitzer andMagasanik, 1986; Ninfa et al., 1987). Kustu and colleagues have demonstrated thatNtrC bound to the enhancer sites contacts RNA polymerase at the ginA promoterthrough DNA looping (Wedel et al., 1990; Weiss et al., 1992b).NtrC interacts with a form of RNA polymerase that contains a sigma subunit calleda54. a54 is unique among sigma subunits because in is incapable of denaturingpromoter DNA without the assistance of an activator protein (Helman and Chamberlin,1988; Kustu et at., 1989). It has been demonstrated that NtrC couples the hydrolysis ofATP to the conversion of closed to open EaM/promoter complexes (Kustu et al., 1991;Weiss et al., 1991; Austin and Dixon, 1992). The ATPase activity of NtrC was found tobe dependent on phosphorylation and DNA binding. It has been postulated thatphosphorylation causes NtrC subunits to oligomerize which facilitates cooperative DNAbinding interactions (Porter eta!., 1993; Porter et al., 1994). Mutational analysis has149identified residues within the central domain of NtrC as being important tooligomerization. Removal of the N-terminal domain which contains the site ofphosphorylation, renders the protein inactive suggesting that it plays an active role intranscription activation. DNA binding is mediated through a helix-turn-helix domain inthe C-terminus of the protein.2. SpoOA-P may stimulation transcription initiation two different ways.SpoOA appears to be the first transcription factor known to activate gene expressionby interacting with different forms of RNA polymerase holoenzme. This uniqueproperty may require that it utilize two different mechanisms to influence transcriptioninitiation. In this regard, SpoOA may be similar to CAP which also appears to affecttranscription initiation through two mechanisms (Discussion VII, lb.). If SpoOA isshown to directly contact the aA subunit of RNA polymerase bound to PspoJJG it seemsunlikely that it would be able to interact with the aH subunit in the same way unlesscontact is made in a region that is highly conserved in both sigma factors. A survey thatcompared all a and &-type promoters known to depend on SpoOA for activation,revealed that their putative OA boxes are usually oriented in opposite directions(Spiegelman et at., 1994). This could indicate that different SpoOA residues are requiredfor protein-protein contacts with either the aA or aH forms of RNA polymerase.The discovery that SpoOA-P catalyzes the conversion ternary complexes at PspoiiGindicates that it is functionally more similar to ci rather than OmpR, which has beenshown to affect polymerase binding (Discussion VII, l.a. & l.c.). Like ci, SpoOA-Pappears to exhibit cooperative binding to multiple binding sites near its target and maycontact the sigma subunit of the polymerase to enhance transcription initiation.However, SpoOA depends on phosphorylation to enhance its DNA binding capability.DNaseI footprinting suggested that phosphorylation may enable SpoOA-P that is boundto the high affinity OA boxes of region I, to facilitate binding of additional subunits tothe low affinity sites of region II (Figure 37). It is possible that phosphorylation may150affect cooperative interaction between monomeric forms of SpoOA in a manneranalogous to the oligomenzation of NtrC (Discussion VII, l.d.). Gel filtrationexperiments carried out with SpoOA and SpoOA-P have determined that there is noevidence that phosphorylation causes SpoOA to oligomerize while in solution (Gnmsleyet aL, 1994). However, this does not exclude the possibility that SpoOA-P is able tooligomerize on the DNA.It is not likely that SpoOA-P has ATPase activity since it lacks an ATP binding motif.This property may be limited to transcription factors like NtrC that activate a54promoters. It appears that SpoOA-P is not required to catalyze the formation of a stableopen complex but rather increases the concentration of an intermediate complex whichis capable of initiating transcription rapidly. Given the constraints imposed by theextended spacer of PspoJJG it is possible that SpoOA-P functions in an analogous mannerto MerR (Discussion III, 1) and stimulates transcription initiation by assisting thepolymerase to untwist or otherwise distort the promoter DNA.Perhaps the most intriguing outcome of investigations into the activities of differenttranscription factors is that rather that revealing similarities, activating systems are moreremarkable for their diversity. This diversity likely reflects differences in the intrinsicproperties of transcription factors, sigma factors, and the promoters they activate. Thetranscription initiation process may be best viewed as a series of reaction steps whichprovides multiple points at which to exert a regulatory influence. Consequently,activating proteins can stimulate the process by influencing the binding of the originalreactants or by interacting with a specific reaction intermediate to drive the reactiontoward productive initiation.151ReferencesAibe, H., Nakasai, F., Mizushima, S., and Mizuno, T. (1989) Phosphorylation of abacterial activator protein, OmpR, by a protein kinase, EnvZ, results in stimulationof its DNA-binding ability. J. Biochem. (Tokyo) 106: 5-7.Albano, M., Hahn, J., and Dubnau, D. (1987) Expression of competence genes inBacillus subtilis. J. Bacteriol 169: 3110-3117.Arnouyal, M., and Buc, H. (1987) Topological unwinding of strong and weak promotersby RNA polymerse. A comparison between the lac wild-type and the UV5 sites ofEscherichia coli. J. Mol. Biol. 195, 795-808.Antoniewslci, C., Savelli, B., and Stragier, P. (1990) The spoIIJ gene which regulatesearly developmental steps in Bacillus subtilis belongs to a class of environmentallyresponsive genes. J. Bacteriol. 172: 86-93.Auble, D. T., Allen, T. L., and deHaseth, P. L. (1986) Promoter recognition byEscherichia coli RNA polymerase. J. Biol. Chem. 261: 11202-11206.Auble, D. T., and deHaseth, P. L. (1988) Promoter Recognition by Escherichia coliRNA polymerase. Influence of DNA structure in the spacer separating the -10 and-35 regions. J. Mol. BioL 202: 47 1-482.Austin, S., and Dixon, R. (1992) The prokaryotic enhancer binding protein NtrC has anATPase activity which is phosphorylation and DNA dependent. EMBO 1 11: 22 19-2228.Ayers, D. G., Auble, D. T., and deHaseth, P. L. (1989) Promoter recognition byEscherichia coli RNA polymerase. J. Mol. Biol. 207:749-756.Baldus, J. M., Green, B. D., Youngman, P., and Moran C. P. Jr. (1994) Phosphorylationof Bacillus subtilis transcription factor SpoOA stimulates transcription from thespoliG promoter by enhancing binding to weak OA boxes. J. Bacteriol. 176: 296-306.Berg, 0. G., von Hippel, P. H. (1987) Selection of DNA binding sites by regulatoryproteins. Statisitcal-mechanical theory and application to operators and promoters.J. Mol Biol. 193: 723-750.Beutel, B. A., and Record, M. T., Jr. (1990) E. coli promoter spacer regions containnonrandom sequences which correlate to spacer length. Nuci. Acids Res. 18: 3597-3603.Bird, T., Burbulys, D., Wu, J.-J., Strauch, M. A., Hoch, J. A., and Spiegelman, G. B.(1992) The effect of supercoiing on the in vitro transcription of the spoIlA operonfrom Bacillus subtilis. Biochemie 74: 627-634.Bourret, R. B., Borkovich, K. A., and Simon, M. I. (1991) Signal transduction pathwaysinvolving protein phosphorylation in prokaryotes. Annu. Rev. Biochem. 60: 401-441.Brosius, J. (1984) Plasmid vectors for the selection of promoters. Gene 27: 15 1-160.152Buc, H., and McClure, W. R. (1985) Kinetics of open complex formation betweenEscherichia coil RNA polymerase and the lac UV5 promoter. Evidence for asequential mechanism involving three steps. Biochemistry 24: 27 12-2723.Buckle, M., and Buc, H. (1989) Fine mapping of DNA single-stranded regions usingbase-specific chemical probes: study of an open complex formed between RNApolymerase and the lac UV5 promoter. Biochemistry 28: 4388-4396.Burbulys, D., Trach, K. A., and Hoch, J. A. (1991) Initiation of sporulation in B. subtilisis controlled by a multicomponent phosphorelay. Cell 64: 545-552.Bushman, F. D., Shang, C., and Ptashne, M. (1989) A single glutamic acid residue playsa key role in the transcriptional activation function of lambda repressor. Cell 58:1163-1171.Carpousis, A. J., and Gralla, J. D. (1980) Cycling of ribonucleic acid polymerase toproduce oligonucleotides during initiation in vitro at the lac UV5 promoter.Biochemistry 19 3245-3253.Carter, H. L., Ill, and Moran, C. P., Jr. (1986) New RNA polymerase a factor underspoO control in Bacillus subtilis. Proc Natl. Acad. Sd. USA 83: 9438-9442.Challoner-Courtney, I. J., and Yudkin, M. (1993) Molecular and phenotypiccharacterization of promoter-proximal mutations in the spollA locus of Bacillussubtilis. J. Bacteriol. 175: 5636-5641.Chamberlin, M. J. (1974) The selectivity of transcription. Annu. Rev. Biochem. 43:721-775.Chenchick, A., Beabealashvilli, R., and Mizabekov, A. (1981) Topography ofinteraction of Escherichia coil RNA polymerase subunits with the lacUV5promoter. FEBS Lett. 128: 46-50.Chibazakura, T., Kawamura, F., Takahashi, H. (1991) Differential regulation of spoOAtranscription in Bacillus subtilis: glucose represses promoter switching at theinitiation of sporulation. J. Bacteriol. 173: 2625-2632.Collado-Vidas, J., Magasanik, B., and Gralla, J. D. (1991) Control site location andtranscriptional regulation in Escherichia coli. Microbiol Rev. 55: 37 1-394.Cowing, D. W., Mecsas, J., Record, M. T., Jr., and Gross, C. A. (1989) Intermediates inthe formation of the open complex by RNA polymerase holoenzyme containing thesigma factor a32 at the groE promoter. J. Mol. Biol. 210: 52 1-530.Debarbuille, M., Martin-Verstraete, I., Kunst, R., and Rapaport, G. (1991) The Bacillussubtilis sigL gene encodes an equivalent of a54 from Gram-negative bacteria. Proc.Nati. Acad. Sci. USA 88: 22 12-2216.Dion, P., and Mandeistam, J. (1980) Germination properties as marker eventscharacterizing later stages of Bacillus subtilis spore formation. J. Bacterial.141: 786-792.153Dobinson, K. F., and Spiegelman, G. B. (1985) Nucleotide sequence and transcriptionof a bacteriophage 029 early promoter. J. Biol. Chem. 260: 5950-5955.Dobinson, K. F., and Spiegelman, G. B. (1987) Effect of the ö subunit of Bacillussubtilis RNA polymerase on initiation of RNA synthesis at two bacteriophage 029promoters. Biochemistry 26: 8206-8213.Dubnau, E. J., Cabane, K., and Smith I. (1987) Regulation of spoOH, an earlysporulation gene in Bacilli. J. Bacteriol. 169: 1187-1191.Dubnau, E., Weir, J., Nair, G., Carter, H. L., Ill, Moran, C. P, Jr., and Smith, I. (1988)Bacillus sporulation gene spoOH codes for a3°(0H). J. Bacteriol. 170: 1054-1062.Dunn, G., Jeffs, P., Mann, N. H., Torgersen, D. M., and Young, M. (1978) Therelationship between DNA replication and the induction of sporulation in Bacillussubtilis. J. Gen. Microbiol. 108: 189-195.Duval-Valentin G., and Ehrlich, R. (1987) Dynamic and structural characterization ofmultiple steps during complex formation between E. coli RNA polymerase and thetetR promoter form pSC 101. Nucleic Acids Res 15: 575-594.Errington, J., and Mandeistam, J. (1986) Use of a lacZ gene fusion to determine thedependece pattern of sporulation operon spollA in spo mutants of Bacillus subtilis.J. Gen. Micro. 132: 2967-2976.Errington, J., Foulger, D., hung, N., Partridge, S. R., and Stevens, S. M. (1990)Regulation of differential gene expression during sporulation in Bacillus subtilis, p.257-267. b M. Zukowski, A. T. Ganesan, and J. A. Hoch (ed.), Genetics andbiotechnology of bacilli, vol. III. Academic Press, Inc., San Diego, Calif.Errington, J., and Illing, N. (1992) Establishment of cell-specific transcription duringsporulation in Bacillus subtilis. Mol. Microbiol. 6: 689-695.Errington, J. (1993) Bacillus subtilis sporulation: Regulation of gene expression.Mircobiol. Rev. 57: 1-33.Eschenlauer, A. C., and Reznilcoff, W. 5. (1991) Escherichia coli catabolite geneacivator protein mutants detective in positive control of lac operon transcription. .LBacteriol. 173: 5024-5029.Frantz, B., and O’Halloran, T. V. (1990) DNA distortion accompanies transcriptionalactivation by the metal-responsive gene-regulatory protein MerR. Biochemistry 29:4747-4751.Ferrari, F. A., Trach, K., LeCoq, D., Spence, J., Rerrari, E., and Hoch J. A. (1985)Characterization of the spoOA locus and its deduced product. Proc. Natl. Acad. Sci.USA 82: 2647-2651.Fort, P., and Piggot, P. J. (1984) Nucleotide sequence of sporulation locus spollA inBacillus subtilis. J. Gen. Microbiol. 130: 2147-2153.Freese, E. (1981) Initiation of bacterial sporulation, p. 1-12. In H. S. Levinson, A. L.154Sonenshein, and D. J. Tipper (ed.), Sporulation and germination. American Societyfor Microbiol., Washington, D. C.Fried, M. G., and Crothers, D. M. (1984) Equilibrium studies of the cyclic AMPreceptor protein-DNA interaction. J. Mat. Biol. 172: 24 1-262.Gamper, H. B., and Hearst, J. E. (1982) A topological model for transcription based onunwinding angle analysis of E. coli RNA polymerase binary initiation and ternarycomplexes. Cell 29: 8 1-90.Gartenberg, M. R., and Crothers, D. M. (1991) Synthetic DNA bending sequencesincrease the rate of in vitro transcription intiation at the Escherichia coli lacpromoter. J. Mat. Biol. 219: 217-230.Gaur, N. K., Dubnau, E., and Smith, I. (1986) Characterization of a clonedBacillus subtilis gene which inhibits sporulation in multiple copies. JBacteriol. 168: 860-869.Gaur, N. K., Oppenheim, J., and Smith, I. (1991) The Bacillus subtilis sin gene, aregulator of alternative developmental processes, codes for a DNA-binding protein.J. Bacteriol. 173: 678-686.Gholamhoseinian, A., and Piggot, P. J. (1989) Timing of spoil gene expression relativeto septum formation during sporulation of Bacillus subtilis. J. Bacterial. 171: 5747-5749.Giladi, H., Koby, S., Gottesman, M. E., and Oppenheim, A. B. (1992) Supercoiling,integration host factor, and a dual promoter system, participate in the control of thebacteriophage ? pL promoter. J. Mol. Biol. 224: 937-948.Gould, G. W. (1984) Mechanisms of resistance and dormancy, p. 173-209. In A.Hurst and G. W. Gould (ed.), The bacterial spore, vol. 2. Academic PressLtd., London.Gralla, J. D., Carpousis, A. J., and Stefano, J. E. (1980) Productive and abortiveinitiation of transcription in vitro at the lac UV5 promoter. Biochemistry 19: 5864-5869.Gralla, J. D. (1990) Promoter recognition and mRNA initiation by Escherichia coliEa70. Methods in Enzymology 185: 37-54.Green, B. D., Bramucci, M. G., and Youngman, P. (1991) Mutant forms of SpoOA thataffect sporulation initiation: a general model for phosphorylation-mediatedactivation of bacterial signal transduction proteins. Semin. Dev. Biol. 2: 2 1-29.Grimsley, J. K., Tjalkens, R. B., Strauch, M. A., Bird, T. H., Spiegelman, G. B.,Hostomsky, Z., Whiteley, J. M., and Hoch, J. A. (1994) Subunit composition anddomain structure of the SpoOA sporulation transcription factor of Bacillus subtilis.J. Biol. Chem. in press.Grossman, A. D., and Losick, R. (1988) Extracellular control of spore formation inBacillus subtilis. Proc. Nati. Acad. Sci. USA 85: 4369-4373.155Grossman, A. D. (1991) Integration of developmental signals and the initiation ofsporulation in B. subtilis. Cell 65: 5-8.Guarente, L., Nye, J. S., Hochschild, A., and Ptashne, M. (1982) Mutant 2. phagerepressor with a specific defect in its positive control function. Biochemistry 79:2236-2239.Ha, J.-H., Spolar, R. S., and Thomas, M. T., Jr. (1989) Role of the hydrophobic effectin stability of site-specific protein-DNA complexes. J. Mol. Biol. 209:801-8 16.Ha, J.-H., Capp, M. W., Hohenwalter, M. D., Baskerville, M., and Record, M. T., Jr.(1992) Thermodynamic stoichiometries of participation of water, cations andanions in specific and non-specific binding of lac repressor to DNA. Possiblethermodynamic origins of the “Glutamate Effect” on protein-DNA interactions. J.Mol. Biol. 228: 252-264.Hawley, D. K., and McClure, W. R. (1980) In vitro comparison of initiation propertiesof bacteriophage ? wild-type R and x3 mutant promoters. Proc. Nati. Acad. Sd.USA 77: 6381-6385.Hawley, K. K., and McClure, W. R. (1982) Mechanism of activation of transcriptioninitiation from the ?PRJ4 promoter. J. Mol. Biol. 157: 493-525.Hawley, D. K., and McClure, W. R. (1983a) Complilation and analysis of Escherichiacoli promoter DNA sequences. Nucleic Acids Res. 11: 1137-2255.Hawley, D. K., and McClure, W. R. (1983b) The effect of a lambda repressor mutationon the activation of trancription initiation from the lambda Ppj promoter. Cell 32:327-333.Healy, J., Weir, J., Smith, I., and Losick, R., (1991) Post-transcriptional control ofsporulation regulatory gene encoding transcription factor aH in Bacillus subtilis.Mol. Microbiol. 5: 477-487.Helman, J. D., and Chamberlin, M. J. (1988) Structure and function of bacterialsigma factors. Annu. Rev. Biochem. 57: 839-879.Hess, J. F., Bourret, R. B., and Simon, M. I. (1988) Histidine phosphorylation andphosphoryl transfer in bacterial chemotaxis. Nature 336, 139-143.Hitchins, A. D., and Slepecky, R. A. (1969) Bacterial spore formation as amodified prokaryotic cell division. Nature (London) 223: 804-807.Hoch, J. A. (1976) Genetics of bacterial sporulation. Adv. Genet. 18: 69-99.Hoch, J. A., Trach, K., Kaqamura, K., Saito, H. (1985) Identification of thetranscriptional suppressor sof-1 as an alteration in the spoOA protein. J. Bacteriol.161: 552-555.Hoch, J. A. (1993) Regulation of the phosphorelay and the initiation of spomlation inBacillus subtilis. Annu. Rev. Microbiol. 74: 441-466.156Hochschild, A., Irwin, N., and Ptashne, M. (1983) Repressor structure and themechanism of positive control. Cell 32: 3 19-325.Igarashi, K., Hanamura, A., Makino, K., Aiba, A., Aiba, A., Mizuno, T., Nakata, A., andIshihama A. (1991) Functional map of the ot subunit of Escherichai coli RNApolymerase: two modes of transcription activation by positive factors. Proc. Nati.Acad. Sci. USA 88: 8958-8962.Ireton, K., Rudner, D. Z., Siranosian, K. J., and Grossman, A. D. (1993) Intergration ofmultiple developmental signals in Bacillus subtilis through the SpoOA transcripionfactor. Genes and Development 7: 283-294.Ishihama, A. (1993) Protein-protein communication within the transcription apparatus.J. Bacteriol. 175: 2483-2489.Irwin, N., and Ptashne, M. (1987) Mutants of the catabolite activator protein ofEscherichia coli that are specifically deficient in gene-activation function. Proc.Natl. Acad. Sci. USA 84: 83 15-8319.Jenkinson, J. F., Kay, D., and Mandeistam, J. (1980) Temporal dissociation of lateevents in Bacillus subtilis sporulation from expression of genes thatdetermine them. J. Bacteriol. 141: 739-805.Jenkinson, H. F., Sawyer, W. D., and Mandelstam, J. (1981) Synthesis and orderof assembly of spore coat proteins in Bacillus subtilis. J. Gen. Microbiol. 123: 1-16.Kahn, D., and Ditta, G. (1991) Molecular structure of FixJ: homology of thetranscription activator domain with the -35 binding domain of sigma factors.Molec. Microbiol. 5: 987-997.Kallio, P. T., Fagelson, J. E., Hoch, 3. A., and Strauch, M. A. (1991) The transition stateregulator Hpr of Bacillus subtilis is a DNA-binding protein. J. Biol. Chem. 266:13411-13477.Kawamura, F., Wang, L.-F., and Doi, R. H. (1985) Catabolite-resistant sporulation(crsA) mutations in the Bacillus subtilis RNA polymerase a43 gene (rpoD) cansuppress and be suppressed by mutations in spoO genes. Proc. Natl. Acad. Sci. USA82: 8124-8128.Kenney, T. J., and Moran, C. P., Jr. (1987) Organization and regulation of an operonthat encodes a sporulation-essential sigma factor in Bacillus subtilis. J. Bacteriol.169: 3329-3339.Kenney, T. J., York, K., Youngman, P., and Moran, C. P., Jr. (1989) Genetic evidencethat RNA polymerase associated with aA factor uses a sporulation-specificpromoter in Bacillus subtilis. Proc. Natl. Acad. Sci. USA 86: 9109-9113.Kenney, T. J., and Moran, C. P., Jr. (1991) Genetic evidence for interaction of aA withtwo promoters in Bacillus subtilis. J. Bacteriol. 173: 3282-3290.Keynan, A., and Sandler, N. (1984) Spore research in historical perspective, p. 1-48. In157A. Hurst and G. W. Gould (ed.), The bacterial spore, vol. 2. Academic Press Ltd.,London.Knaus, R., and Bujard, H. (1990) Principles governing the activity of E. coli promoters,p. 110-122. In R. Eckstein and D. M. J. Lilley (eds.), Nucleic acids and molecularbiology, vol. 4. Springer-Verlag, Berlin, Heidelberg.Kolb, A., Igarashi, K., Ishihama, A., Lavigne, M., Buckle, M., and Buc, H. (1993) E.coli RNA polymerase, deleted in the C-terminal part of its (x-subunit interactsdifferently with the cAMP-CRP complex at the lacPl and at the galPi promoter.Nucleic Acids Res. 21: 3 19-326.Kofoid, E. C., and Parkinson, J. S. (1988) Transmitter and reciever modules in bacterialsignaling proteins. Proc. Natl. Acad. Sd. USA 85: 498 1-4985.Kovacic R. T. (1987) The 0 °C closed complexes between Escherichia coli RNApolymerse and two promoters, T7-A3 and lacUV5*. J. Biol. Chem. 262: 13654-13661.Kroos, L., Kunkel, B., and Losick, R. (1989) Developmental regulatory protein fromBacillus subtilis switching RNA polymerase recognition specificity. Science 243:526-528.Kudoh, J., Ikeuchi, T., and Kurahashi, K. (1985) Nucleotide sequences of thesporulation gene spoOA and its mutant genes of Bacillus subtilis. Proc. Nati. A cad.Sci. USA 82: 2665-2668.Kustu, S., Santero, E., Keener, J., Popham, D., and Weiss, D. (1989) Expression of a54(ntrA)-dependent genes is probably united by a common mechanism. Microbiol.Rev. 53: 367-376.Kustu, S., North, A. K., and Weiss, D. 5. (1991) Prokaryotic transcriptional enhancersand enhancer-binding proteins. TIBS 16: 397-402.Leirmo, S., Harrison, C., Cayley, D. S., Burgess, R. R., and Record, M. T., Jr. (1987)Replacement of potassium chloride by potassium glutamate dramatically enhancesprotein-DNA interactions in vitro. Biochemistry 26: 2095-2 101.Leirmo, S., and Record, M. T., Jr. (1990) Structural, thermodynamic and kinetic studiesof the interaction of Ea70 RNA polymerase with promoter DNA, p. 123-152. In R.Eckstein and D. M. J. Lilley (eds.), Nucleic acids and molecular biology, vol. 4.Springer-Verlag, Berlin, Heidelberg.Levin, J. R., Krummel, B., and Chamberlin, M. J. (1987) Isolation and properties oftranscribing ternary complexes of Escherichia coli RNA polymerase positioned at asingle template base. J. Mol. Biol. 196: 85-100.Li, M., Moyle, M., and Susskind, M. M. (1994) Target of transcriptional activationfunction of phage ci protein. Science 263: 75-77.Lohman, T. M., de Haseth, P. L., Record M. T., Jr. (1978) Analysis of ion concentration158effects on the kinetics of protein-nucleic acid interactions. Application to kicrepressor-operator interactions. Biophys. Chem. 8: 28 1-294.Lohman, T. M. (1985) Kinetics of protein-nucleic acid interactions: use of salt effects toprobe mechanisms of interaction. CRC Crit. Rev. Biochem. 19: 191-245.Lopez, J. M., Dromerick, A., and Freese, E. (1981) Response of guanosine 5’-tnphosphate concentration to nutritional changes and its significance for Bacillussubtilis sporulation. J. Bacteriol. 146: 605-613.Losick, R., and Pero, J. (1981) Cascades of sigma factors. Cell 25: 582-584.Losick, R., Youngman, P., and Piggot P. J. (1986) Genetics of endosporeformation in Bacillus subtilis. Ann. Rev. Genet. 20: 625-669.Losick, R., and Kroos, L. (1989) Dependence pathways for the expression ofgenes involved in endospore formation in Bacillus subtilis, p. 223-241. In I.Smith, R. A. Slepecky and P. Setlow (ed.), Regulation of ProkaryoticDevelopment. American Society for Microbiology, Washington, D. C.Losick, R., and Stragier, P. (1992) Crisscross regulation of cell-type-specific geneexpression during development in B. subtilis. Nature 355: 60 1-604.Makino, K., Shinagawa, H., Amemura, M., Kimura, S., and Nakata, A. (1988)Regulation of the phosphate regulon of Escherichia coli. Activation of pstStranscription by PhoB protein in vitro. J. Mol. Biol. 203: 85-95.Malcino, K., Amemura, M., Kim, S.-K., Nakata, A., and Shinagawa, H. (1993) Role ofthe a70 subunit of RNA polymerase in transcription activation by activator proteinPhoB in Escherichia coli. Genes Dev. 7: 149-160.Malan, T. P., Koib, A., Buc, H., and McClure, W. R. (1984) Mechanism of CRP-cAMPactivation of lac operon transcription initiation activation of the P1 promoter. J.Mol. Biol. 180: 88 1-909.Mandelstam, J., and Higgs, S. A. (1974) Induction of sporulation during synchronizedchromosome replication in Bacillus subtilis. J. Bacteriol. 120: 38-42.Margolis, P., Driks, A., and Losick, R. (1991) Establishment of cell type bycompartmentalized activation of a transcription factor. Science 254: 562-565.Mazur, S. J., and Record, M. T., Jr. (1989) Association kinetics of site-specific protein-DNA interactions: roles of nonspecific DNA sites and of the molecular location ofthe specific site. Biopolymers 28: 929-953.McClure, W. R. (1980) Rate-limiting steps in RNA chain intiation. Proc. Natl. Acad.Sci. USA 77: 5634-5638.McClure, W. R. (1985) Mechanism and control of transcription initiation inprokaryotes. Annu. Rev. Biochem. 54: 171-204.Menon, K. P., and Lee, N. L. (1990) Activation of ara operon by a truncated AraCprotein does not require inducer. Proc. Nati. Acad. Sci. USA 87: 3708-3712.159Mi K.-T., Hilditch, C. M., Diederich, B., Ernngton, J. and Yudkin, M. (1993) aF, thefirst compartment-specific transcription factor of B. subtilis, is regulated by an anti-a factor that is also a protein kinase. Cell 74, 735-742.Mitani, T., Heinze, J. F., and Freese, E. (1977) Induction of sporulation in Bacillussubtilis by decoynine or hadacidin. Biochem. Biophys. Res. Commun. 77: 1118-1125.Moran, C. P., Jr., Lang, N., LeGnce, S. R. J., Stephens, M., Lee, 0., Pero, J.,Sonenshein, A. L., and Losick, R. (1982) Nucleotide sequences that signalinitiation of transcription and translation in Bacillus subtilis. Mol. Gen. Genet. 186:339-346.Moran, C. P., Jr. (1989) Sigma factors and the regulation of transcription, p. 167-184.In I. Smith, R. A. Slepecky and P. Setlow (ed.), Regulation of ProkaryoticDevelopment. American Society for Microbiology, Washington, D. C.Nakashima, K., Kanamaru, K., Aiba, J., and Mizuno, T. (1991) Signal transuction andosmoregulation in Escherichia coil. J. Biol. Chem. 266: 10775-10780.Ninfa, A. J., and Magasanik, B. (1986) Covalent modification of the gInG product, NR1by the glnL product, NR11 regulates the transcription of the g1nALG operon inEscherichia coli. Proc. Natl. Acad. Sci. USA 83: 5909-5913.Ninfa, A. J., Reitzer, L. J., and Magasanik, B. (1987) Initiation of transcription at thebacterial glnAp2 promoter by purfied E. coli components is facilitated by enhancers.Cell 50: 1039-1046.O’Halloran, T. V., Frantz, B., Shin, M. K., Ralston, D. M., and Wright, J. 0. (1989) TheMerR heavy metal receptor mediates positive activation in a topologically noveltranscription complex. Cell 56: 119-129.Parkhill, J., Ansari, A. Z., Wright, J. G., Brown, N. L., and O’Halloran, T. V. (1993)Construction and characterization of a mercury-independent MerR activator(MerRAC): transcriptional activation in the absence of Hg(II) is accompanied byDNA distortion. EMBO J. 12: 413-42 1.Partridge, S. R., Foulger, D., and Errington, J. (1991) The role of aF in presporespecific transcription in Bacillus subtilis. Mol. Microbiol. 5: 757-767.Perego, M., and Hoch, J. A. (1988) Sequence analysis and regulation of the hprlocus, a regulatory gene for protease production and sporulation in Bacillussubtilis. J. Bacteriol. 170: 2560-2567.Perego, M., Spiegelman, 0. B., and Hoch, J. A. (1988) Structure of the gene for thetransition state regulator, abrB: regulator synthesis is controlled by the spoOAsporulation gene in Bacillus subtilis. Mol. Microbiol. 2: 689-699.Perego, M., Cole, S. P., Burbulys, D., Trach, K., and Hoch, J. A. (1989)Characterization of the gene for a protein kinase which phosphorylates thesporulation-regulatory proteins SpoOA and SpoOF of Bacillus subtilis. J. Bacteriol.160171: 6187-6196.Perego, M., and Hoch, J. A. (1991) Negative regulation of Bacillus subtilis sporulationby the spoOE gene product. J. Bacteriol. 173: 25 14-2520.Perego, M., Higgins, C. F., Pearce, S. R., Gallagher, M. P., and Hoch, J. A. (1991a) Theoligopeptide transport system of Bacillus subtilis plays a role in the initiation ofsporulation. Mol. Microbiol. 5: 173-185.Perego, M., Wu, J.-J., Spiegelman, C. B., and Hoch, J. A. (1991b) Mutationaldissociation of the positive and negative regulatory properties of the SpoOAsporulation transcription factor of Bacillus subtilis. Gene 100: 207-212.Perego, M., Hanstein, C., Welsh, K. M., Djavakhishvili, T., Glaser, P., and Hoch, J. A.(1994) Short-circuiting signal transduction with protein phosphatases: howdifferent physiological states prevent sporulation in Bacillus subtilis. submitted.Piggot, P. J., and Coote, J. G. (1976) Genetic aspects of bacterial endosporeformation. Bacteriol. Rev. 40: 908-962.Piggot, P. J., Moir, A., and Smith D. A. (1981) Advances in the genetics ofBacillus subtilis differentiation, p. 29-39. In H. S. Levinson, A. L. Sonenshein,and D. J. Tipper (ed.), Sporulation and germination. American Society forMicrobiology, Washington, D. C.Piggot, P. J., Amjad, M., Wu, J.-J., Sandoval, H., and Castro, J. (1990) Geneticand physical maps of Bacillus subtilis 168, p. 493-543. In C. R. Harwood andS. M. Cutting (ed.), Molecular biological methods for Bacillus. John Wiley &Sons Ltd., Chichester, United Kingdom.Popham, D., Szeto, D., Keener, J., and Kustu, S. (1989) Function of a bacterial activatorprotein that binds to transcriptional enhancers. Science 243: 629-635.Porter, S. C., North, A. K., Wedel, A. B. and Kustu, S. (1993) Oligomerization of NtrCat the gInA enhancer is required for transcriptional activation. Genes and Devel. 7:2258-2273.Porter, S. C., North, A. K., and Kustu, S. (1994) Mechanism of transcriptionalactivation by NtrC (nitrogen regulatory protein C): requirement for oligomerizationand phosphorylation. In J. A. Hoch and T. Silhavy (ed.), Two component signaltransduction. Amer. Soc. Microbiol. In press.Predich, M., Nair, 0., Smith, I. (1992) Bacillus subtilis early sporulation genes KinA,spoOF and spoOA are transcribed by the RNA polymerase containing 0H J•Bacteriol. 174: 2771-2778.Record, M. T., Jr., and Mossing, M. C. (1987) Physical-chemical origins of stability,specificity, and control of protein-DNA interactions, p 6 1-83. In RNA Polymeraseand Regulation of Transcription (eds) W. S. Reznikoff, R. R. Burgess, J. E.Dahlberg, C. A. Gross, M. T. Record Jr., and M. P. Wickens. Elsevier SciencePublishing Co., New York.Reitzer L. J., and Magasanik B. (1986) Transcription of glnA in E. coli is stimulated by161activator bound to sites far from the promoter. Cell 45: 785-792.Ren, Y. L., Garges, S., Adhya, S., and Krakow, J. S. (1988) Cooperative DNA bindingof heterologous proteins: Evidence for contact between the cyclic AMP receptorprotein and RNA polymerase. Proc Natl. Acad. Sd. USA 85: 4138-4142.Reznilcoff, W. S. (1992) Catabolite gene activator protein activation of lac transcription.J. Bacteriology 174: 655-658.Roe, J.-H., Burgess, R. R., and Record, M. T., Jr. (1984) Kinetics and mechanism of theinteraction of Escherichia coli RNA polymerase with the ?PR promoter. J. Mol.Biol. 176: 495-521.Roe, J.-H., Burgess, R. R., and Record, M. T., Jr. (1985) Temperature dependence ofthe rate constants of the E. coli RNA polymerase-PR promoter interaction:assignment of the kinetic steps corresponding to protein conformational change andDNA openning. J. Mol. Biol. 184: 441-453.Ronson, C. W., Nixon, B. T., and Ausubel, R. N. (1987) Conserved domains inbacterial regulatory proteins that respond to environmental stimuli. Cell 49: 579-581.Ross, W., Gosink, K. K., Salomon, J., Igarashi, K., Zou, C., Ishihama, A., Severinov, K.,and Gourse, R. L. (1993) A third recognition element in bacterial promoters: DNAbinding by the a subunit of RNA polymerase. Science 262: 1407-1413.Rudner, D. Z., LeDeaux, J. R., Ireton, K., and Grossman, A. D. (1991) The spoOK locusof Bacillus subtilis is homologous to the oligopeptide permease locus and isrequired for sporulation and competence. J. Bacteriol. 173: 1388-1398.Russo, F. D., and Silhavey, T. J. (1991) EnvZ controls the concentration ofphosphorylated OmpR to mediate osmoregulation of the porin genes. J. Mol. Biol.222: 567-580.Russo, F. D., and Silhavey, T. J. (1993) The essential tension: opposed reactions inbacterial two-component regulatory systems. Trends in Microbiology 1: 306-309.Ryter, A. (1965) Etude morphologique de la sporulation de Bacillus subtilis.Ann. Inst. Pasteur (Paris) 108: 40-60.Saier, M. H., Jr. (1989) Protein phosphorylation and allosteric control of inducerexclusion and catabolite repression by the bacterial phosphoenolpyruvate:sugarphosphotransferase system. Microbiol. Rev. 53: 109-120.Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular cloning: a laboratorymanual. Cold Spring Harbour Laboratory, NY.Satola, S., Kirshman, P. A., and Moran, C. P., Jr. (1991) SpoOA binds to a promoterused by aA RNA polymerase during sporulation in Bacillus subtilis. Proc. NatI.Acad. Sd. USA 88: 4533-4537.Satola, S., Baldus, J. M., and Moran C. P., Jr. (1992) Binding of SpoOA stimulates162spoliG promoter activity in Bacillus subtilis. J. Bacteriol. 174: 1448-1453.Savva, D., and Mandeistam, J. (1986) Synthesis of spollA and spoVA mRNA inBacillus subtilis. J. Gen. Microbiol. 132: 3005-3011.Schaeffer, P., Millet, J., and Aubert, J. (1965) Catabolic repression of bacterialsporulation. Proc. Nat!. Acad. Sci. USA 54, 701-711.Schickor, P., Metzger, W., Werel, W., Lederer, H., and Heumann, H. (1990)Topography of intermediates in transcription initiation of E. coil. EMBO J. 9: 22 15-2220.Schmidt, R., Margolis, P., Duncan, 1., Coppolecchia, R., Moran, C. P., Jr., and Losick,R. (1990) Control of developmental transcription factor aF by sporulationregulatory proteins SpoIIAA and Sp0IIAB in Bacillus subtilis. Proc Nat! Acad SdUSA 87: 922 1-9225.Schultz, S. C., Shields, G. C., and Steitz, T. A. (1991) Crystal structure of a CAP-DNAcomplex: The DNA is bent by 90°. Science 253: 1001-1007.Shaner, S. L., Melancon, P., Lee, K. S., Burgess, R. R., and Record, M. T., Jr. (1983)Ion effects on the aggregation and DNA-binding reactions of Escherichia coil RNApolymerase. Cold Spring Harbor Symp. Quant. Biol. 47: 463-472.Siebenlist, U., Simpson, R. B., and Gilbert, W. (1980) E. coil RNA polymeraseinteraction homologously with two different promoters. Cell 20: 269-28 1.Slauch, J. M., Russo, F. D., and Silhavy, T. J. (1991) Suppressor mutations in rpoAsuggest that OmpR controls transcription by direct interaction with the c subunit ofRNA polymerase. J. Bacteriol. 173: 7501-75 10.Sonenshein, A. L. (1989) Metabolic regulation of sporulation and other stationary-phasephenomena, p. 109-130. In I. Smith, R. A. Slepecky, and P. Setlow (ed.),Regulation of prokaryotic development. American Society for Microbiology,Washington, D. C.Spassky, A., Kirkegaard, K., and Buc, H. (1985) Changes in the DNA structure of thelac UV5 promoter during the formation of an open complex with E. coli RNApolymerase. Biochemistry 24: 2723-2731.Spiegelman, G. B., Van Hoy, B., Perego, M., Day, 3., Trach, K., and Hoch, 3. A. (1990)Structural alterations in the Bacillus subtiiis SpoOA regulatory protein whichsuppress mutations at several spoO loci. J. Bacteriol. 172: 5011-5019.Spiegelman, G. B., Bird, T. H., and Voon, V. (1994) Transcription regulation by theSpoOA protein of Bacillus subtilis. In J. A. Hoch and T. Silhavy (ed.), Twocomponent signal transduction. Amer. Soc. Microbiol. In press.Stefano, 3. E., and Gralla, 3. D. (1980) Kinetic investigation of the mechanism of RNApolymerase binding to mutant lac promoters. J. Biol. Chem. 255: 10423-10430.Stefano, J. E., and Gralla, J. D. (1982a) Mutation-induced changes in RNA polymerase163lac pS promoter interactions. J. Biol. Chem. 257: 13924-13929.Stefano, J. E., and Gralla, J. D. (1982b) Spacer mutations in the lac pS promoter. Proc.Natl. Acad. Sci. USA 79:1069-1072.Stock, J. B., Ninfa, A. J., and Stock, A. M. (1989) Protein phosphorylation andregulation of adaptive responses in bacteria. Microbiol. Rev. 53: 450-490.Stock, J. B., Stock, A. M., and Mottonen, J. M. (1990) Signal transduction in bacteria.Nature 344: 395-400.Stragier, P., Bonamy, C., and Karmazyn-Campelli, C. (1988) Processing ofsporulation sigma factor in Bacillus subtilis: how morphological structurecould control gene expression. Cell 52: 697-704.Stragier, P. (1989) Temporal and spatial control of gene expression during sporulation:from facts to speculations, p. 243-254. In I. Smith, R. A. Slepecky, and P. Setlow(ed.), Regulation of prokaryotic development. American Society for Microbiology,Washington, D. C.Stragier, P., and Losick, R. (1990) Cascades of sigma factors revisted. Mol.Microbiol 4; 1801-1806.Straney, D. C., and Crothers, D. M. (1985) Intennediates in transcription initiation fromthe E. co/i lac UV5 promoter. Cell 43: 449-459.Straney D. C., and Crothers D. M. (1987a) A stressed intermediate in the formation ofstably initiated RNA chains at the Escherichia coli lac UV5 promoter. J. Mol. Biol.193: 267-278.Straney, D. C., and Crothers, D. M. (1987b) Kinetics of the stages of transcriptioninitiation at the Escherichia coli lacUVS promoter. Biochemistry 26: 5063-5070.Straney, D. C., Straney, S. B., and Crothers, D. M. (1989) Synergy between Escherichiacoli CAP protein and RNA polymerase in the lac promoter open complex. J. Mol.Blot. 206: 41-57.Strauch, M. A., Spiegelman, G. B., Perego, M., Johnson, W. C., Burbulys, D., andHoch, J. A. (1989) The transition state transcription regulator abrB of Bacillussubtilis is a DNA binding protein. EMBO J. 8: 1615-1621.Strauch, M., Webb, V., Spiegelman, G., and Hoch, J. A. (1990) The SpoOA protein ofBacillus subtilis is a repressor of the abrB gene. Proc. Nati. Acad. Sd. USA 87:1801-1805.Strauch, M. A., Trach, K., Day, J., and Hoch, J. A. (1992) SpoOA activates andrepresses its own synthesis by binding at its dual promoters. Biochemie 74: 619-626.Strauch, M. A., and Hoch, J. A. (1993) Transition state regulators: sentinels ofBacillus subtilis post-exponential gene expression. Mol. Micro. 7: 337-342.Strickland, S., Palmer, G., and Massey, V. (1975) Determination of dissociation164constants and specific rate constants of enzyme-substrate (or protein-ligand)interactions from rapid reaction kinetic data. J. Biol. Chem. 250: 4048-4052.Sun, D., Stragier, P., and Setlow, P. (1989) Identicication of a new a-factor involved incompartmentalized gene expression during sporulation of Bacillus subtilis. GenesDev. 3: 141-149.Tanford, C. (1984) Twenty questions concerning the reaction cycle of the sarcoplasmicreticulum calcium pump. Crit. Rev. Biochem. 17: 123-151.Trach, K., Chapman, J. W., Piggot, P. J., and Hoch, J. A. (1985) Deduced product of thestage 0 sporulation gene spoOF shares homology with the SpoOA, OmpR and SfrAproteins. Proc. Natl. Acad. Sci. USA 82: 7260-7264.Trach, K., Burbulys, D., Strauch, M., Wu, J.-J., Dhillon N., Jonas R., Hanstein, C., \Kallio, P., Perego, M., Bird, T., Spiegelman, G., Fogher, C., and Hoch, J. A. (1991)Control of the initiation of sporulation in Bacillus subtilis by a phosphorelay. ResMicrobiol. 142: 8 15-823.Trach, K. A., and Hoch, J. A. (1993) Multisensory activation of the phosphorelayinitiating sporulation in Bacillus subtilis: identification and sequence of the proteinkinase of the alternate pathway. Mol. Microbiol. 8:69-79.Travers, A. A. (1987) Structure and function of E. coli promoter DNA. CRC Crit. Rev.inBiochem. 22: 181-219.Tsung, K., Brissette, R. E., and Inouye, M. (1990) Enhancement of RNA polymerasebinding to promoters by a transcriptional activator, OmpR, in Escherichia coli: itspositive and negative effects on trancnption. Proc. Natl. A cad. Sci. USA 87: 5940-5944.von Hippel, P. H., Bear, D. G., Morgan, W. D., and McSwiggen, J. A. (1984) Protein-nucleic acid interactions in transcription: a molecular analysis. Annu. Rev. Biochem.53: 389-446.Walter, G., Willing, W., Palm, P., and Fuchs, E. (1967) Initiation of DNA dependentRNA synthesis and the effect of heparin on RNA polymerase. Eur. J. Biochem. 3:194-201.Wang, J. C., Jacobsen, J. H., and Saucier, J.-M. (1977) Physicochemical studies oninteractions between DNA and RNA polymerase. Unwinding of the DNA helix byEscherichia coli RNA polymerase. Nucleic Acids Res. 4: 1225-1241.Warth, A. D., and Strominger, J. L. (1972) Structure of the peptidoglycan fromspores of Bacillus subtilis. Biochemistry 11: 1389-1396.Wedel, A., Weiss, D. S., Popham, D., Droge, P., and Kustu, S. et al. (1990) A bacterialenhancer functions to tether a transcriptional activator near a promoter. Science248: 486-490.Weiss, D. S., Batut, J., Kiose, K. E., Keener, J., and Kustu, 5. (1991) Thephosphorylated form of the enhancer-binding protein NtrC has an ATPase activitythat is essential for activation of transcription. Cell 67: 155-167.165Weiss, V., Claverie-Martin, F., and Magasanik, B. (1992a) Phosphorylation of nitrogenregulator I of Escherichia coli induces strong cooperative binding to DNA essentialfor activation of transcription. Proc. Nati. AcatL Sci. USA 89: 5088-5092.Weiss, D. S., Kiose, K. E., Hoover, T. R., North, A. K., Porter, S. C., Wedel, A. B., andKustu, S. (1992b) Prokaryotic transcriptional enhancers, p. 667-694. In S. L.McKnight and K. R. Yamamoto (eds.), Transcriptional Regulation. Cold SpringHarbor Laboratory Press, Cold Spring Harbor, NY.Wellington, S. R. (1991) The kinetics of formation of complexes between Escherichiacoli RNA polymerase and the rrnB P1 and P2 promoters of Bacillus subtilis. PhD.thesis, University of British Columbia.Whipple, R. W., and Sonenshein, A. L. (1992) Mechanism of initiation of transcriptionby Bacillus subtilis RNA polymerase at several promoters. J. Bol. Biol. 223: 399-414.Wu, J.-J., Howard, M. G., and Piggot, P. J., (1989) Regulation of transcription of theBacillus subtilis spoIlA locus. J. Bacteriol 171: 692-698.Wu, J.-J., Piggot P. J., Tatti, K. M., Moran, C. P. Jr. (1991) Transcription of the Bacillussubtilis spoIlA locus. Gene 101: 113-115.Yamashita, S., Yoshilcawa, H., Kawamura, F., Takahashi, H., Yamamoto, T.,Kobayashi, Y., and Saito, H. (1986) The effect of spoO mutations on theexpression of spoOA- and spoOF-lacZ fusions. Mol. Gen. Genet. 205: 28-33.Youngman, P., Poth, H., Green, B., York, K., Olmedo, G., and Smith, K. (1989)Methods for genetic manipulation, cloning, and functional analysis of sporulationgenes in Bacillus subtilis, p. 65-87. lii I. Smith, R. A. Slepecky and P. Setlow (ed.),Regulation of Prokaryotic Development. American Society for Microbiology,Washington, D. C.Zheng, L., and Losick, R. (1990) Cascade regulation of spore coat gene expression inBacillus subtilis. J. Mol. Biol. 212: 645-660.Zuber, P., and Losick, R. (1983) Use of a lacZ fusion to study the role of the spoO genesof Bacillus subtilis in developmental regulation. Cell 35: 275-283.Zuber, P., and Losick, R. (1987) Role of AbrB in SpoOA- and SpoOB-dependentutilization of a sporulation promoter in Bacillus subtilis. J. Bacteriol. 169: 2223-2230.166AppendixI. Reaction kinetics.1. The kinetics of transcription initiation.The purpose of this appendix is to show the mathematical treatment of the data fromexperiments measuring heparin-resistant complexes at PspoiiG. This procedure was usedto measure the overall rate of heparin-resistant complex formation and provided for aninvestigation of the effects of SpoOA(-P) on the kinetics of transcription initiation atPspoIIG (tau analysis). The following derivations have been published previously andprovide a method of kinetic analysis that has been widely used to study transcriptioninitiation (McClure, 1980; Hawley and McClure, 1980; Stefano and Gralla, 1980). Thisreview closely follows the mathematical treatment of transcription initiation kinetics asdescribed by Wellington (1991).2. Review of the kinetics of first-order reactions.A first order decay reaction may be represented by;A B (A-i)where the rate of the reaction would be described by the equation;dt = -k[A]. (A-2)Rearrangement of (A2) followed by integration of both sides allows for [A] (or [B]) tobe determined at any t ([A] = [A]0 at t = 0);A ct[A]‘A0 [A] = -k 1 dt. (A-3)167This equation is solved by;Ln[A] - Ln[A]0 -kt (A-4)or the equivalent expression;[A] = [A]0et. (A-5)3. Kinetics of the overall rate of heparin-resistant complex formation.The overall process of heparin-resistant complex formation atP3p0JJG may bereduced to a simple isomerization reactionHS HP. (A-6)As noted previously, this is valid only if all the steps in the overall reaction are eithertrue or pseudo first-order and that one step in A-6 equilibrates slowly relative to theothers (Results IV, 2). Under these conditions;d[HR]=ki[H1krLHP] (A7)and;[PT] = [HS] + [HR] (A-8)168where PT is the total concentration of promoter template, HS is a heparin-sensitivecomplex, and HR is a hepann-resistant complex.Rearrangement of the expression (A-8) followed by substitution into (A-7) gives;d[HR]= (kf+kr)LHP]+kf[PT]. (A-9)This equation has the formd[HP] 1dt = (A-b)which has the same form as d[A]Idt = -k[A] (Appendix I, 2) and is solved by theequation;Ln([HR] - fit) - Ln([HR]0- 13t) =-(.f)t (A-li)or the equivalent expression;[HP]-tf3 1Lft- p) = - (--). (A-12)In considering the reaction model (A-6) it can be seen that after infinite reaction timed[HR]/dt = 0 and 3t will be equal to the final concentration of heparin-resistantcomplexes at reaction completion ([HR]). Given that the initial concentration ofheparin-resistant complexes was zero, substitution of frr and [HR]0 and rearrangementgives;Ln(1- [HP]) = - (A-13)169This expression describes the rate of approach to reaction completion for transcriptionrate assays. A plot of Ln(1 - [HR]/[HR]) versus t should produce a straight line equalto the value for - (lit) (or- kobs), the overall rate constant for the production of hepann-resistant complexes.4. Interpretation of lit.As noted previously, it was assumed that the formation of a heparin-resistantcomplex was preceded by a heparin-sensitive complex which resulted from RNApolymerase binding to PspoiiG (Results IV, 2.). Under conditions of RNA polymeraseexcess, the two step reaction model for heparin-resistant complex formation (Results IV,3.) becomes;[1]k_____P HS HP (A14)k1because the concentration of free polymerase in the assay does not change appreciablyover the duration of the reaction ([RT] constant). Assuming that [P1 + [HS] + [HR] =[PT], then;d[P]=k1[HS]-kP][P] (A15)d[HSJ= ki[P1[P](ki+ki)[HS]+kr[HR] (A16)d[H1= k[HS1kr[HP1 (A17)Applying the steady state assumption to equation (A 16) (the change in [HS] isnegligible) followed by rearrangement gives;170(k1+K)[HS] = ki[P][P]+k.r[HP]. (A18)Since [P] = [PT - HS - HRI, substitution of this expression into (A 18) followed byrearrangement gives;[HS] = kl[P][PT] + (kr -k1[P])[HP]. (A19)k1 [P] + k..1+ kWhen the expression for [HS] above is substituted into equation (A17) it yields;d[HP] = - (kj [1](k +kr) +k1 kr [HR] •,• c iL IL Ti (A20)\ [P] + k..1 + k1 J k1[l] + k + k1This expression has the general form d[HR]/dt = - (lit) [HRJ + 13. As discussed above,this differential equation is solved by Ln (1 - [HR]/[HRJ,= -( 1/t)t. Therefore, litdescribes the rate of approach to reaction completion. From equation (A20) it isapparent that;1 = k1 [P](k1 + kr) + k..1 kr (A21)t [P]+]c +kfHowever, if it is assumed that kf>> kr and that the product k.ikr is extremely smallcompared to kfk1[RI, this expression is reduced to;k [P]k.k1[P]+k1+kfor its reciprocal form;= k4+ + (A23)kk1 \[P]I kfTherefore, a plot of t versus lI[RJ should produce a straight line with an ordinateintercept equal to l/kf.171

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0088824/manifest

Comment

Related Items