Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Analysis of the internal replication sequence of minute virus of mice Brunstein, John 1998

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1998-271137.pdf [ 9.95MB ]
Metadata
JSON: 831-1.0088742.json
JSON-LD: 831-1.0088742-ld.json
RDF/XML (Pretty): 831-1.0088742-rdf.xml
RDF/JSON: 831-1.0088742-rdf.json
Turtle: 831-1.0088742-turtle.txt
N-Triples: 831-1.0088742-rdf-ntriples.txt
Original Record: 831-1.0088742-source.json
Full Text
831-1.0088742-fulltext.txt
Citation
831-1.0088742.ris

Full Text

A N A L Y S I S OF T H E I N T E R N A L R E P L I C A T I O N S E Q U E N C E OF M I N U T E V I R U S OF M I C E by JOHN BRUNSTEIN B.Sc. (Hon), Simon Fraser University, 1992  A THESIS S U B M I T T E D IN P A R T I A L F U L F I L L M E N T OF T H E R E Q U I R E M E N T S F O R T H E D E G R E E OF D O C T O R OF PHILOSOPHY in T H E F A C U L T Y OF G R A D U A T E STUDIES Department of Biochemistry and Molecular Biology  We accept this thesis as conforming to the required standard  T H E U N I V E R S I T Y OF BRITISH C O L U M B I A December 1997 ©John Brunstein, 1997  In presenting this thesis in partial fulfilment  of the  requirements for an advanced  degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department  or  by his  or  her  representatives.  It  is  understood  that  copying or  publication of this thesis for financial gain shall not be allowed without my written permission.  Department The University of British Columbia Vancouver, Canada Date  DE-6 (2/88)  Abstract Minute Virus o f M i c e ( M V M ) is a member o f the Parvovirinae Parvoviridae  genus o f the  family o f viruses. This family of small, single-stranded D N A viruses infect  a wide range o f eukaryotic hosts ranging from insects to humans. Due to their small size and limited coding capacity parvoviruses may serve as a suitable tool with which to examine elements o f the host cell D N A replication machinery.  Previous studies on  M V M have localized a region o f approximately 200 nucleotides inboard o f the right viral genomic termini, known as the Internal Replication Sequence (IRS), which contributes in cis to viral replication competence. A comprehensive library o f linker scanning mutations across the IRS o f M V M was constructed and assayed in the context o f a minigenomic system for replication competence i n an effort to identify short sequence elements contributing to viral replication. Three elements required for efficient replication were observed. Elements o f the library were also examined for interactions with host cell nuclear factors, and such interactions were localized to four sites with evidence being obtained to suggest positive interactions between the sites. These sites were found to be directly adjacent to two o f the elements required for efficient replication and overlapping the third, suggesting a possible correlation between these functions.  Simultaneous deletion o f two o f these  binding sites was observed to abrogate function o f the I R S , further supporting a functional relationship between factor binding and origin activity.  ii  The sequence element found to both bind, host factors and be required for replication competence was employed as 'bait' in a yeast one-hybrid genetic screen o f a murine c D N A library in an attempt to clone interacting factor(s). A clone recovered from this, while not considered likely to be directly relevant, leads to postulation o f a known origin binding protein RIP60 as a prospective candidate for action at the IRS origin. Preliminary studies conducted to determine whether RIP60 binds at the viral origin were conducted but failed to provide evidence of RIP60 association with the viral genome. A model is proposed whereby a leading-strand only origin o f D N A replication within the region o f the IRS affords a mechanism for the viral rearrangement o f its 5' termini from an extended to a hairpin form during replication. Studies employing the viral IRS and right-hand terminus as an origin driving the replication o f attached unrelated vector sequences are presented in support o f this model.  iii  Table of Contents ABSTRACT  ii  T A B L E OF CONTENTS  iv  LIST OF TABLES  vi  LIST OF FIGURES  vii  ABBREVIATIONS  viii  ACKNOWLEDGMENT  ix  INTRODUCTION  1  The Parvoviruses Taxonomy  2 4  MVM  4  MVM discovery Structural properties Genome Organization Transcripion Viral Proteins D N A REPLICATION Features of Replicons MVM replication PREVIOUS STUDIES AND GOALS OF THE PROJECT  4 6 7 7 11 15 15 23 31  MATERIALS AND METHODS  33  GENERAL METHODS Sources of enzymes etc BACTERIAL CULTURE Cell lines Growth Transformation and electroporation DNA recovery and Hirt extraction C E L L CULTURE  33 33 33 33 33 34 34 35 35 35 36 36 37 37 37 38 38 40 44 44 45 45 46  Cell lines Maintenance Transfection Viral Isolation Plaque Assay CLONING TECHNIQUES Digestions and Ligations Oligonucleotides Plasmid constructs Construction of the Linker-scanning Construction of point mutants Gel isolations DNA End-Labelling Sequencing Polymerase Chain Reaction  library  iv  DNA quantitation  46  REPLICATION A S S A Y COMPETITIVE REPLICATION A S S A Y COMPETITION BANDSHIFT ASSAY SOUTHERN BLOTTING TWO-DIMENSIONAL N E U T R A L - A L K A L I N E AGAROSE ELECTROPHORESIS YEAST  Cell lines One-hybrid screen  :  46 48 49 50 50 51  51 52  RESULTS  53  MINIGENOME REPLICATION STUDIES COMPETITIVE REPLICATION ASSAYS BANDSHIFT STUDIES STUDIES ON A DUAL-MUTANT MINIGENOME STUDIES ON POINT MUTANTS STUDIES ON FULL-LENGTH VIRUS EVIDENCE FOR THE I R S AS A LEADING-STRAND ONLY ORIGIN  53 62 63 74 77 77 81  ONE-HYBRID SCREEN EXAMINATION OF R I P 6 0 INTERACTION WITH THE IRS  96 100  DISCUSSION  104  APPENDIX A  118  REPLICATION A S S A Y 1:  119  REPLICATION A S S A Y 2: REPLICATION A S S A Y 3: REPLICATION A S S A Y 4:  123 127 131  APPENDIX B  135  P J B L R 4 . 3 S 2 0 COMPETITION REPLICATION ASSAYS P J B L R 4 . 3 S 2 1 COMPETITION REPLICATION ASSAYS  136 137  REFERENCES  138  v  List of Tables TABLE 1:PARV0VIRJNAE TABLE 2: OLIGONUCLEOTIDES USED TABLE 3: SCANNER MUTATION SEQUENCES TABLE 4: SCANNER MUTATION SRRE VALUES TABLE 5 : RESULTS OF COMPETITION REPLICATION ASSAYS TABLE 6: DUAL-SITE MUTANT SRRE VALUES TABLE 7: POINT MUTANT SEQUENCES TABLE 8: POINT MUTANT SRRE VALUES TABLE 9: ANTI-RIP60 IMMUNOPRECIPITATION RESULTS  vi  5 39 58 60 64 76 78 79 102  List of Figures FIGURE 1: MVM TRANSCRIPTIONAL MAP FIGURE 2: MECHANISM OF HAIRPIN TRANSFER FIGURE 3: DEPENDOVIRUS REPLICATION FIGURE 4: MVM DNA REPLICATION CYCLE FIGURE 5: SCHEMATIC REPRESENTATION OF MlNIGENOMES FIGURE 6: LINKER-SCANNER MUTANT CONSTRUCTION FIGURE 7: REPLICATION OF PJBLR4 VS. PJBLR4.3 FIGURE 8:REPLICATION ASSAY FIGURE 9:OVERVIEW OF SCANNER MUTATIONS FIGURE 10: SCANNER MUTATION SRRE VALUES FIGURE 11: RELATIVE LOCATION OF BANDSHIFT PROBES FIGURE 12: BS BANDSHIFTS FIGURE 13: 2021 BANDSHIFTS FIGURE 14: SB BANDSHIFTS FIGURE 15: COMPETITOR TITRATION OF BANDSHIFTS FIGURE 16: DUAL-SITE MUTATION COMPETITION BANDSHIFT FIGURE 17: POINT MUTANT COMPETITION BANDSHIFTS FIGURE 18: DIFFERENTIAL CPE OF WILD-TYPE AND SI VIRUS FIGURE 19: LEADING-STRAND ONLY MODEL FOR HAIRPIN REARRANGEMENT FIGURE 20: PJBR1 FIGURE 21: PREDICTED REPLICATION PRODUCTS OF PJBR1 FIGURE 22: PJBR1 REPLICATION PRODUCTS FIGURE 23: 2D NEUTRAL-ALKALINE ANALYSIS OF PJBR1 REPLICATION PRODUCTS FIGURE 24:REPLICATION OF PJBR1 S(X) SCANNER MUTATIONS FIGURE 25: ALIGNMENT OF CLONE 2B1 WITH HOXB-13 FIGURE 26: ANTI-RIP60 SUPERSHIFT OF 2021 PROBE FIGURE 27: HYPOTHETICAL BENT MODEL FOR PROTECTION OF SITES I AND II  vii  9 24 26 29 41 43 55 57 59 61 66 68 69 71 73 76 80 82 84 86 88 89 93 95 99 102 116  Abbreviations ACS ARS bp DEAE DHFR DMEM DUE EP EtBr HEPES m.u. mRF NS nt OBR ORC ori PBS PCNA RE RF-C RPA S R proteins SRE SRRE SSB VP  A R S consensus sequence autonomously replicating sequence base pairs diethyl aminoethyl Dihydrofolate reductase locus Dulbecco's Modified Eagle's M e d i u m D N A Unwinding Element early palindrome Ethidium Bromide N-2-Hydroxyethyl Piperazine N-2-Ethanesulfonic A c i d map unit monomer replicative form non-structural nucleotide Origin of bidirectional replication origin recognition complex origin of replication Phosphate-buffered Saline proliferating cell nuclear antigen Replication Efficiency replication factor C replication protein A Serine-Arginine proteins Scaled Replication Efficiency Scaled Relative Replication Efficiency single-stranded binding protein viral protein (structural)  viii  Acknowledgment In the course o f this study the support, guidance, and input o f a number o f people has been o f great help and deserves recognition.  First and foremost the patient  supervision o f Dr. Caroline Astell, without whose able direction this project would not have come to fruition, warrants my sincere thanks. Dr. Pat Tarn should be recognized not only for his work in uncovering the existence o f the IRS which laid the groundwork for my project, but also for his help and encouragement as I set out upon the project. M a n y late nights at the lab were livened by entertaining discussions with Dr. Wesley Hung; likewise, Glen Coburn earns thanks for his keen insight into many topics (even on occasion scientific in nature) over a pitcher o f beer.  Marcia MacDonald deserves special  thanks for her unassailable good humor which did much to make the lab an entertaining workplace. Chris Houchens and Dr. N . Heintz from the University o f Vermont were kind enough to supply both reagents for the detection and analysis o f RIP60's potential interaction with the I R S , along with unpublished data on the topic. Finally, I would like to extend my appreciation to other members of the Astell lab past and present for assistance in many diverse aspects o f the project: Qingquan, Colin, Jan, Carl, Darren, Rick, and Warren. When I look back on graduate school as having been both a productive and enjoyable experience it is in no small measure due to the input o f all o f these people; I hope that while  inadequate  this acknowledgment serves  appreciation to all o f them.  ix  to express  my  sincere  Introduction In a number o f organisms examined to date, D N A replication is initiated by the specific interaction o f protein factors with sequences at a cw-acting origin o f replication (ori) to form a preinitiation complex. Action o f the protein factors results i n a localized kinking, bending, and/or unwinding of the associated sequences to create a suitable target for the initiation o f D N A synthesis by primase and polymerase functions. Studies on prokaryotic and some simple eukaryotic systems have allowed for the identification o f the basic structure and common components of such origins. Common components consist o f an essential core sequence element containing binding sites for origin recognition proteins and sequence segments predisposed to easily unwind or bend, complemented by associated nonessential enhancer elements which frequently include transcription-factor binding sites ' ' ' . 1  2  3  4  Despite recent advances in these studies, ori nature and function i n  metazoans is as yet poorly understood. Parvoviral systems may act as a model with which to examine aspects o f eukaryotic replication. Minute Virus o f M i c e , fibrotropic strain ( M V M ( p ) , henceforth referred to as M V M ) is a member of the genera Parvovirus  whose members  are  characterized by unenveloped icosahedral capsids containing small single-stranded D N A genomes with long terminal palindromic sequences. Unlike their close relatives i n the Dependovirus  genus, Parvovirus  are capable of replication autonomously o f helper 567  viruses.  Current models o f this replication ' ' propose a strand-extension mechanism  mediated by host-cell replication machinery, with a single viral protein N S - 1 acting to resolve concatamer junctions. That this replication cycle is observed to be dependent on  1  host cell S phase suggests a strong reliance on host cell replication machinery, and not simply a repair synthesis mechanism as might be surmised from the replication model. A n elucidation o f required viral cw-acting sequences and their associated host-cell proteins i n this system may thus serve to better our understanding both o f M V M and eukaryotic replication in general.  The Parvoviruses The Parvoviridae  comprise a large family o f viruses related on the basis o f  structural and genomic similarity. The name comes from the Latin 'parvus' or small, and the virions are among the smallest known consisting o f an unenveloped T = l icosahedral capsid 18-24 nm across which contains a single-stranded D N A genome o f approximately 5000 nucleotides. Generally, one strand is preferentially packaged over the other, with the negative-sense being the most common; there are however exceptions to this both for specific members o f the family, and for specific members i n differing host cell types. L o n g palindromic sequences at the genomic termini allow for the formation o f doublestranded 'hairpin' telomeres by folding back o f the sequence at its axis o f symmetry. Aside from the provision by one o f these hairpin structures o f a free 3' hydroxyl as a primer for D N A synthesis in the replication o f the genome, these telomeres may also serve to sequester the free ends o f the genome from cellular surveillance mechanisms or degradation. The genome encodes two major open reading frames: in the context o f a negativesense genome the first o f these codes for a set of non-structural proteins known as N S or Rep, while the second codes for a set of structural proteins known as V P or Cap. In  2  addition, at least B 1 9 (of the Erythrovirus  subgenera) codes for several smaller expressed  OPvFs whose function(s) are currently unknown . V i r a l ORJFs are driven by either one 9  (i.e., in B19), two (i.e., in M V M ) , or three promoters (i.e., A A V ) and are expressed i n a temporally ordered fashion . 10  N S or Rep proteins serve i n the resolution o f viral  replicative intermediates and in packaging mature genomes into capsids, while the V P or Cap proteins form the capsid. Due in large part to the limited coding capacity of the viral genome, parvoviruses are highly dependent on host cell functions for a productive infection. Replication only occurs i n the nucleus o f permissive cells during S-phase, suggesting the need for specific cellular replication machinery in the viral replication process.  This need for actively  dividing host cells appears as a tropism for tissues such as erythroid precursors i n bone marrow (B19), epithelial cells o f the gastrointestinal tract ( C P V ) , or fetal tissues ( M V M ) . The majority o f pathogenic effects attributable to parvovirus infection reflect this tropism: in the case o f the three examples given above, B 1 9 infection can result i n a transient aplastic crisis in humans, C P V in severe gastrointestinal distress in canids, and M V M can cause teratogenic effects in hamster. Their simplicity and resulting reliance on the host cell have made parvoviruses an attractive model system with which to probe features o f D N A replication and gene expression in the host-cell mileu.  3  Taxonomy The family Parvoviridae range".  The Parvovirinae  infect arthropods. genera Parvovirus  is divided into two subfamilies on the basis o f host  infect a range o f vertebrate species, while the  Each is further subdivided, with the Parvovirinae  Densovirinae  containing the  (whose replication does not require the coinfection o f a helper virus  such as Adenovirus or a Herpesvirus), Dependovirus virus coinfection), and Erythrovirus  (which normally do require helper-  (members o f which infect a limited subset o f  erythroid precursor cells). The Densovirinae also consist o f three genera (although there has been a recent suggestion to split this into four), the Densovirus,  Iteravirus,  and  Contravirus on the basis o f genome organization and host range. Table 1 lists some o f the known parvoviruses and their host species.  MVM  M V M discovery The prototypical fibrotropic strain o f Minute Virus o f M i c e , M V M ( p ) , was first isolated i n 1966 by Crawford as a contaminant in a culture o f mouse adenovirus and 12  polyomavirus grown on monolayers o f secondary mouse embryo cells . A distinct band under  isopycnic ultracentrifugation  in  CsCl  at  1.43  g/cm  was  observed  to  haemagglutinate murine erythrocytes but was found not to produce plaques on mouse embryo cell monolayers. Cultures o f mouse embro cells innoculated with material from this band were found to produce more haemagglutinin, suggesting the band comprised a previously unrecognized virus. Further characterization o f the virus demonstrated it to  4  Parvoviridae Parvovirinae Parvovirus Minute Virus o f M i c e Mouse Parvovirus K i l h a m Rat Virus Aleutian M i n k Disease Virus M i n k Enteritis Virus Canine Parvovirus Minute Virus o f Canines Feline Panleukopenia Virus Goose Parvovirus LuIII Porcine Parvovirus H I Virus Bovine Parvovirus Dependovirus Adeno-Associated Virus (5 serotypes) Bovine Adeno-Associated Virus A v i a n Adeno-Associated Virus Erythrovirus B19 Simian Parvovirus Pig-tailed Macaque Parvovirus  Host species mouse mouse rat mink mink dog dog cat goose (unknown) Pig rodents cattle most mammals cattle birds human monkey monkey  Table 1: Parvovirinae Some of the known members of the Parvovirinae genera of the Parvoviridae family, along with their natural hosts (where known).  5  have an unenveloped icosahedral capsid approximately 19nm across containing a singlestranded D N A genome. Based on these properties, similarity to K i l h a m Rat, H I , H 3 , and X I 4 viruses was suggested; however antigenic properties proved the new isolate to be distinct and it was named as M V M .  Structural properties M V M has an unenveloped icosahedral capsid displaying T = l symmetry.  The  capsid consists o f two proteins, a major component (VP2) and a minor component (VP1), with a proteolytic processing product o f V P 2 (VP3) present at low frequency. Structural determination by X-ray crystallography  has recently been successful at a resolution o f  less than 3A on empty capsids, and at 3.5A on both empty and full capsids o f the allotropic variant M V M ( i ) .  The capsid consists o f 60 asymmetric subunits o f the  structural proteins, each in the form o f an eight-stranded antiparallel P-barrel. Each capsomer holds a loop o f 20 nucleotides in an icosahedrally ordered structure. The capsid surface is irregular, with a distinct spike at each o f the five-fold axes o f symmetry surrounded by a circular cleft or 'canyon'; evidence from the structural differences between M V M ( p ) and M V M ( i ) suggests the viral receptor binding site lies within this canyon. In addition, i n M V M there appears to be a distinct depression along the two-fold axes o f symmetry, a region referred to as the 'dimple'. Current data also suggests the presence o f an open channel through each of the five-fold spikes, the importance o f which is unknown.  6  In culture, the virus is found to produce mainly (by a ratio ranging from 3:1 to 50:l)  1 4  empty capsids (p =1.35 g m / c m ) , with full capsid banding on C s C l at p =1.41 to 3  1.43 g/cm . 3  Genome Organization The M V M genome has been sequenced in its entirety and contains  5149  nucleotides i n the mature v i r u s . The left-end (3') imperfect palindrome consists o f 115 15  nucleotides o f which 104 can arrange in a stable base-paired conformation, while the one at the right (5') end is 206 nucleotides o f which 200 can base-pair.  The genome is  negative-sense, with the complementary strand encoding two large open reading frames . 16  While sequences in the left end are unique, the right end exists in two equally abundant complementary forms known as 'flip' and ' f l o p ' . 15  The significance o f this difference  between the termini on the viral replication strategy w i l l be dealt with in detail i n the section on viral replication. In addition to this variation, the 5' end sequences in doublestranded monomeric replicative-form (mRF) D N A contain an additional 18 nucleotides not found i n packaged mature genomes; these are complementary to genomic nucleotides 4858 through 4876 which lie immediately inboard o f the 5' hairpin.  Transcripion The two major open reading frames give rise to two overlapping transcriptional units which are expressed in a temporally ordered fashion . A canonical eukaryotic P o l 10  II promoter at 4 map units (P ) drives the expression o f two major families o f transcripts, 4  the R l and R 2 families. A second P o l II promoter at m.u. 39 ( P ) drives expression o f 39  R 3 , the third major transcript family. Each o f these families undergoes three alternative  7  patterns o f splicing at a small intron between m.u. 44 and 46, resulting i n at least nine 17  known transcripts  .  A l l transcripts are complementary to the genomic D N A , and  essentially all are polyadenylated at the last o f four canonical A A T A A A sequences at viral nucleotide 4908  18  (see Figure 1).  The common intron at m.u. 44-46 contains two potential splice-donor (D) and two potential splice-acceptor (A) sites, known as D l (nt. 2280), D 2 (nt. 2317), A l ( n t . 2377), and A 2 (nt. 2399), respectively. In all cases the major spliced product is D l - A l , with D 2 - A 2 occuring at lower frequency and the D 1 - A 2 products only being observed rarely. In no case is D 2 - A 1 observed, apparently due to steric constraints as the donor and acceptor sites in this case are only 59 nt. apart. Observations by Haut et. al. support this hypothesis, as insertions between D 2 and A l render this splice v i a b l e . The frequency o f 19  selection o f splice donor-acceptor pairs appears to be influenced by a combination o f spacing and sequence at the donor and acceptor sites, with the first donor site being used preferentially i n all cases; this bias is modulated by the D 2 donor being a closer match to the canonical splice-donor consensus sequence than is D l to allow for its selection at a greater frequency than i f both splice sites had identical sequences. In addition, evidence 20  has been put forth by Gersappe et. al.  to suggest that sequences within either termini o f  the N S - 2 specific exon (discussed below in connection with the R 2 transcript) are required for accurate splicing, suggesting the possible interaction o f S R proteins i n the splicing o f viral transcripts.  8  Reading Frame 1 2 3  0  10  20  30  40  50  60  70  80  90  100 —j  Gene product:  Transcript  A  NS-1 NS-2  R2 R3  Map units  A_  VP-1, VP-2  Figure 1 : M V M Transcriptional M a p  Transcriptional and translational map of M V M . Shaded boxes indicate relative locations of open reading frames. Heavy lines in transcript map indicate regions of mRNA present in mature transcripts, lighter lines indicate introns. Three alternative splicing patterns for the middle intron (m.u. 44 to 46) are not indicated (see text). Adapted from Reference 16.  9  The R l transcript family is approximately 4.8 kb in length and makes up roughly 15% o f the observed viral transcripts during late infection in murine cell culture. None o f the three variant splicing patterns o f the internal small intron affect the coding region o f these transcripts, thus all are translated to a single non-structural protein N S - 1 . This protein carries out a variety o f functions in viral replication and the resolution o f genomic concatamers which w i l l be discussed later. The R 2 transcript family is approximately 3.3 kb i n length, extending from m.u. 4 through to the polyadenylation site but with m.u. 10 through m.u. 39 (viral nucleotides 514 through  1990) spliced out.  This transcript family,  which also makes  up  approximately 15% o f the total viral transcripts, thus results in a protein-coding message whose 5' end corresponds to the 5' end o f the NS-1 coding frame and whose 3' end exists in three unique forms depending on the splicing o f the common small middle intron. The three closely related proteins arising from this message family are known collectively as N S - 2 ; their function(s) are poorly understood as outlined i n the section on viral polypeptides. The R3 transcript makes up the majority (70%) o f viral transcripts. Arising from the P  3 9  promoter, this family of messages requires transactivation by the viral N S - 1 21 22  product o f the R l transcript i n order to be expressed, '  leading to a temporal ordering i n  viral gene expression whereby the R l and R 2 transcripts are expressed immediately upon infection, with R3 not being detectable until several hours later . 10  The R3 transcript  contains the right-hand viral O R F coding for the V P 1 or V P 2 structural proteins, which are differentially expressed based on the choice o f donors and acceptors for the common 10  middle intron (outlined further in the following section on viral polypeptides). Use o f a suboptimal first splice donor site ( D I ) helps to maintain a proper ratio between these two messages as the presence o f a better splice donor in this preferred first position would greatly reduce the levels o f V P 1 message.  V i r a l Proteins M V M encodes four polypeptides in its two O R F s (considering the variant forms o f N S - 2 mentioned above as a single species). The left-hand end o f the genome codes for NS-1 and N S - 2 nonstructural proteins, while the right-hand end codes for V P 1 and V P 2 capsid proteins. NS-1 is an 83 k D a phosphoprotein which is localized to the nucleus o f murine 23  cells i n the course o f natural infections . Coded for in reading frame 3 by the R l transcript, it is 672 amino acids in length; as its stop codon lies upstream o f the small middle intron D I donor, all three o f the R l transcripts encode the same polypeptide. In contrast to other viral proteins, the NS-1 polypeptide is highly conserved across the rodent parvoviruses, with sera from animals infected with C P V , P P V , H - l , H - 3 , or K R V all displaying cross-reactivity to M V M N S - 1 . 2 4  The degree o f highest D N A sequence  homology lies between nt. 1428-1833, with values in the 90% range when compared to other members o f the rodent parvoviruses, 51% to the Dependovirus A A V , and 4 1 % to 15 25 7  the Erythrovirus B 1 9  ' ' . Within this region a purine nucleoside triphosphate binding  fold consensus sequence [ G X G K ( T / S ) X . ( I / L / V ) ] is found . 26  4  5  6  11  While biochemical functions for this protein have been difficult to demonstrate i n crude extracts o f infected cells due to its low abundance, overexpressed and purified protein has been demonstrated to have ATPase, helicase, and site-specific single-stranded 27 28  endonuclease activities ' . The protein has been recently shown to bind directly to the D N A sequence [ A C C A ]  29 2  , with there being evidence that a flanking ( A / T ) on both sides  30  is preferred  .  Helicase activity is thought to be dependent on A T P hydrolysis, as  nonhydrolyzable analogs do not support this activity. Furthermore, mutations i n the A T P binding pocket which uncouple these processes such that A T P binding and hydrolysis can still occur but helicase activity has been abolished suggest that the A T P hydrolysis serves 31  as the energy source for helicase activity . In contrast, D N A binding activity appears 32  normal i n the presence o f nonhydrolyzable analogs  .  These activities o f N S - 1 are  differentially modulated by its phosphorylation state: relative to the phosphorylated state, the dephosphorylated protein shows 300% binding activity, <100% nicking activity, <3% 33  helicase activity, and from 15-30% ATPase activity . Based on these observed activities as well as by the observation that NS-1 is found covalently linked to the 5' ends o f mature unit-length viral genomes  34  , it is predicted that NS-1 acts i n a manner analogous  to the gene-A protein o f (j)X-174 in the resolution o f unit-length single-stranded progeny genomes from double-stranded concatameric replicative intermediates. NS-1 is also responsible for both trans-activation and trans-inhibition o f the viral 21  P and P 4  3 8  promoters  . It is capable o f either up or down-regulating expression o f the R l  transcript by interacting with the P promoter (presumably in a dose-responsive manner) 4  22  and acts to upregulate expression o f the R3 message by approximately 1000-fold . The  12  source o f this transactivation is not as yet completely understood; while N S - 1 itself contains a potent acidic activation domain (on the order o f 30-50% as strong as that o f 35 36  V P 1 6 ) located within the C-terminal 88 amino acids '  it has also been shown to have a  direct interaction with the transcription factor Sp-1 i n transactivation o f the viral P promoter . 36  3 8  Given that Sp-1 acts in a different fashion than the acidic activators to  enhance transcription, there is a distinct possibility that the interaction with N S - 1 is synergistic. This interaction may also conceivably result in an upregulation o f host-cell genes with associated Sp-1 sites during the course o f viral infection. The N S - 2 proteins are a set o f three 25 k D a phosphoproteins coded for by the R 2 37  transcript family.  These species are labile, with half-lives under one hour , and are  found primarily i n the cytoplasm o f infected cells (with phosphorylated forms being 38  found only i n the cytoplasm) . The coding frame is identical to that o f NS-1 for the first 85 amino acids (reading frame 3, viral nt. 260 to 514), however the splice from m.u. 10 to m.u. 39 shifts the remainder o f the message into reading frame 2. In addition the three splicing patterns observed for the small common middle intron result in three isoforms o f N S - 2 which differ at their carboxy termini.  While the functions o f this protein are  somewhat o f a mystery, it has been shown to be required for efficient replication and for 39  production o f infectious virus in some cell types . It has been suggested that N S - 2 may play a specific role in enhancing the translation o f viral m R N A s , in particular V P - 2 . 4 0  More recently, a role for N S - 2 i n capsid assembly in murine cells has been reported . 41  The significance, i f any, o f there being three isoforms of this protein is unknown.  13  Both NS-1 and N S - 2 have cytotoxic effects, which are especially pronounced i n transformed cell lines. Such effects appear to be mediated through the action o f host oncogenes, including c-ras . 42  Studies have shown that the cytotoxic domains o f N S - 1  can be mapped to the same regions as the transactivation functions , suggesting that the 43  roles may be related through the inappropriate regulation o f such host genes by the N S - 1 protein.  In particular, NS-1 has been shown to cause an upregulation o f the human  c-erbA gene which encodes the thyroid hormone (T3) receptor a subunit; this i n turn increases the host cell's sensitivity to parvoviral attack . 44  V P - 1 is the larger o f the two capsid proteins, at 83 k D a ; it accounts for 15-18% o f the capsid mass . This low fraction is due to its being coded for by one form o f the R3 14  transcript in which the small common middle intron is spliced using the D 2 - A 2 (lowfrequency) splice donor-acceptor pair, thus retaining an initiation codon at nt. 2286. V P 1 thus has a unique basic N-terminus while the rest o f the protein is identical with V P - 2 . This N-terminal region has been found to be resistant to protease cleavage i n either full or empty viral particles; furthermore, in the closely related H - l virus chemical cross-linking between V P - 1 molecules can be observed in empty capsids, but not i n full capsids . 45  Taken together with evidence that aggregates o f M V M ' s V P - 1 bind the 3' genomic hairpin internally i n the particles , this suggests that this protein's basic N-terminus is 46  involved in sequestration o f the viral genome within the capsid.  While V P - 1 is not  essential for genome encapsidation, data has been presented which demonstrate requirement for this protein i n allowing viral progeny to be infectious . 47  14  a  V P - 2 is smaller than V P - 1 , at 64 k D a . It is coded for by the most common subfamily o f R3 transcript in which the small common middle intron is spliced out using the D l - A l donor-acceptor pair, and also by the rare third splicing product D 1 - A 2 ; in either case the A U G codon at nt. 2286 is removed, allowing a second A U G in the same reading frame at nt. 2795 to act as an initiation codon. V P - 2 makes up the majority o f the capsid, and i n fact structurally (by electron microscopy) and antigenically 'normal' capsids can be made in systems only expressing V P - 2 ' . V P - 2 is found to be resistant 4 7  4 8  to protease cleavage i n empty capsids, but in full capsids it is sensitive to a specific cleavage  o f its N-terminal domain to  yield  V P - 3 , suggesting  some  structural  rearrangement occurs upon genome encapsidation. V P - 3 is a 61 k D a proteolytic product o f V P - 2 . While V P - 2 to V P - 3 conversion accompanies the infection o f internalized virus in a time-dependent fashion, particles are found to be equally infectious regardless o f their V P - 2 / V P - 3 content.  It has been  suggested that V P - 2 exists as a heterogenous population o f differently phosphorylated species, and that only the most highly-phosphorylated forms are susceptible to this cleavage step in what may be a form o f regulation o f viral particle maturation . 49  DNA  Replication  Features of Replicons The crucial event in the replication of all cells is the duplication o f its genetic material. A s befits so critical a process, it has been extensively studied i n order to gain insights into a number o f aspects central to biology. D N A replication is thought to begin at discrete sites known as origins o f replication or oris. A n ori is postulated to be a D N A  15  sequence or set o f sequences which act to bind cellular replication factors in an organized manner such as to signal for the initiation of synthesis o f a new D N A strand. Techniques for the identification and mapping o f such sequences have identified them successfully i n prokaryotes and their viruses, as well as i n lower eukaryotes (Saccharomyces some viruses o f eukaryotes.  sp.) and  In the case o f higher eukaryotes, while certain specific  instances o f discretely localized sites where replication reliably initiates every cell cycle have been identified, there is still debate as to whether the majority o f genome replication occurs from defined loci or is more o f a stochastic process, with replication initiating on average as frequently as once every 12 kbp o f sequence . 50  A l l o f the well-characterized origins to date appear to share certain similarities both in their basic organization and in their mode o f action. The best studied o f these is the  O r i C responsible  chromosome.  for the  establishment  o f replication forks on the E.  coli  In this system , outlined here as a paradigm for replication initiation in 51  general, multiple copies o f a cellular sequence-specific D N A binding protein (dnaA) bind tightly to four repeats o f a 9-base target sequence (the 'dnaA box') to yield an 'initial complex'.  In this, the D N A is maintained in a double-stranded form tightly wound  around a central core o f from 20-40 copies o f dnaA. Immediately adjacent to this looped complex are four repeats o f a 13-base A T - r i c h sequence element, which are sequentially melted open by an A T P - d r i v e n activity o f the dnaA protein to form an 'open complex' with approximately 45 base pairs o f the A T - r i c h D N A element i n a denatured singlestranded form.  This open complex then recruits a dnaB-dnaC protein complex,  apparently through recognition o f the single-stranded structure o f the 13-mer elements by  16  dnaB.  Binding o f this complex creates the 'prepriming complex', stabilizing the  unwound D N A and localizing a D N A helicase activity (dnaB) at the site for subsequent activity by a primase function and the initiation o f D N A synthesis. Examination o f a large number o f other less well characterized prokaryotic replication origins has revealed the conservation o f an A T - r i c h repeat motif in most cases. Extant footprinting data also suggests that there is some conservation i n the proteinbinding action o f these origins. With this i n mind, and based on the O r i C system, a 52  general model for the initiation o f D N A replication was proposed  whereby an origin-  specific initiator protein binds strongly to a short reiterated sequence motif i n one section of the origin and induces the melting o f an adjacent A T - r i c h sequence motif, to which the initiator protein may demonstrate a weaker binding. The AT-richness o f this second sequence element presumably is important in its propensity to be easily unwound, leading to its being referred to as a D N A Unwinding Element or D U E by some investigators. This general model seems to fit well with the observed organization o f not only the E. coli O r i C , but also O r i C from B. subtilis, the plasmid-born origins o f p S C l O l , F , P I , R l , R K 6 , R K 2 , and P4, as well as the origins o f lambdoid phages X, (b80, and <j>82. In each case, binding o f a sequence-specific protein at or near an A T - r i c h element and subsequent melting o f this element and recruitment o f a D N A helicase function is observed as a prerequisite for priming o f D N A synthesis. Examination o f the initiation o f D N A replication in eukaryotes has lagged behind similar studies in prokaryotes and their viruses due to the increased complexity and size of eukaryotic systems.  However in recent years advances in molecular biological  17  techniques have allowed for studies on a number o f eukaryotic models, most notably the papovavirus S V 4 0 . The successful purification o f all components required to observe in vitro replication o f this virus i n a reconstituted system has allowed for the elucidation o f many o f the components and physical processes which are likely common to all eukaryotic replication. While a number o f aspects o f replication must o f necessity vary between  a small circular sytem such as S V 4 0 and the immensely larger linear  chromosomes o f the host, similarities between the S V 4 0 system and the generalized model derived from prokaryotic systems  and presented  above  suggests that  mechanism o f initiation o f replication may be conserved; a model replication ' 53  54  for  the  SV40  is thus presented here as a paradigm for eukaryotic initiation.  S V 4 0 has a single ori sequence which consists o f an essential 65 bp core containing a 27 bp dyad symmetry element with four 5 ' - G A G G C - 3 ' sequence repeats, flanked on one side (the 'Early' side) by an imperfect palindrome (EP) and on the other (the 'Late' side) by an A T - r i c h sequence motif ( A T ) . A viral protein, the Large Tantigen, binds first to the 27 bp element in the form o f monomers on each o f the 5'G A G G C - 3 ' sequences; additional molecules o f T-antigen then associate through proteinprotein interaction to form two hexamers, each arranged as a ring around the D N A but interacting almost exclusively with the sugar-phosphate backbone on one strand.  This  results in structural deformations in both of the flanking regions, notably the melting o f an 8 bp bubble in the E P which is expanded by an ATPase-dependent helicase activity o f the T-antigen hexamers causing D N A unwinding to proceed bidirectionally outward from the central dyad element. The limitation o f T-antigen contacts to a single strand allows  18  for the other strand to bind S S B proteins (in particular replication protein A ( R P A ) , a trimeric S S B specifically associated with replication forks) in order to stabilize the nascent fork structures.  These nascent forks then attract the P o l a-primase complex,  which is responsible for laying down a short R N A primer followed by a longer D N A segment.  The 3' end o f these growing strands is then bound by replication factor C  ( R F C ) , which acts to recruit proliferating-cell nuclear antigen ( P C N A ) and pol 8 in a replacement o f the P o l a-primase complex. Recent advances have also been made in the understanding o f the initiation o f replication in the budding yeast S. cerevisiae.  Shotgun cloning o f the genome into  replication-incompetent vectors and selection for plasmid maintenance has successfully identified  short  conserved D N A sequences,  known  as  Autonomous Replication  Sequences ( A R S s ) , which act in their native chromosomal loci as bi-directional origins o f replication.  These  ARSs  all  contain  an  11-base  sequence  5 ' - ( A / T ) T T T A ( T / C ) ( A / G ) T T T ( A / T ) - 3 ' known as the A R S consensus sequence ( A C S ) which is essential for origin function. In addition, A R S s contain a discrete second D N A element 3' to the A C S ' s T-rich strand which consists o f an easily-unwound sequence; the exact sequence can vary between loci but often seems to contain two or three distinct elements, known as B l , B 2 , and B 3 . While these elements are individually dispensable, they act in concert with the A C S to achieve full origin function ' . 55  56  A multiprotein  complex (the Origin Recognition Complex, O R C ) has been found to bind specifically to the A C S , and all six subunits i n the complex have been cloned. Although two o f the 57  subunits ( O r c l p and Orc5p) appear to have nucleotide binding folds , and the binding o f  19  the complex to the A C S has been shown to be A T P dependent, no other biochemical functions have been identified to date. In yeast, conditional mutants o f Orc2, Ore 3, and CO  Orc5 have all been demonstrated to have defects i n D N A replication  while in Xenopus,  O r e l and Orc2 have been shown to be essential for the initiation o f semi-conservative D N A replication ' . 59  60  Genomic footprinting experiments have demonstrated that the yeast A C S is bound by a protein complex (or complexes) throughout the cell cycle, which exists i n at least two distinguishable forms. The post-replicative footprint observed closely matches that seen in vitro with purified O R C , suggesting that rather than acting as an activator o f replication it may serve to suppress the origin after a single round o f replication has occured in S phase. The pre-replicative footprint is larger than that o f the post-replicative state, extending from the A C S well into the ' B ' domain, and has been hypothesized to consist o f O R C with a number o f accessory factors associated . A model is arising 61  whereby O R C acts to mark the location o f origins o f replication, while the association and dissociation o f other factors serve to restrict the initiation o f D N A replication to a single occurrence in S phase. 62  In this model , loss o f C y c l i n B activity in anaphase allows for the association o f R L F - B (Replication Licensing Factor B , a putative cell-cycle dependent activity which may be identical with Cdc6 in S. cerevisiae) with O R C on chromatin during G l , followed by the recruitment o f Replication Licensing Factor M ( R L F - M ) . R L F - M appears i n turn to be composed o f some or all of the six M C M (mini-chromosome maintenance) proteins. This entire complex constitutes the pre-replicative complex, and following 20  transient  association with a postulated S-phase promoting factor, (SPF), D N A replication is initiated at the origin. This results in loss o f both R L F factors and inactivation o f R L F - B by cyclin-dependent kinases, leaving O R C in place as the post-replicative complex but incapable o f re-initiating replication until the cell proceeds through M phase again. Evidence for this model has come from a number o f studies indicating a requirement for O R C and M C M proteins for the initiation of D N A replication, as well as genetic and biochemical data suggesting an interaction between these complexes and their epistatic 62  control by cyclin-dependent kinases ( C D K s ) (reviewed in Rowles and B l o w ). A m o n g the origin sequences identified in higher eukarotes the best studied is that found downstream o f the dihydrofolate reductase ( D H F R ) locus in Chinese Hampster Ovary cells, where an Origin o f Bidirectional Replication ( O B R ) has been localized to a 63  450 bp segment o f D N A  . This origin is composed o f a section o f bent D N A containing  an A / T rich sequence motif including an ( 5 ' - A T T - 3 ' ) repeat which is specifically bound by a 60 k D a protein known as RIP60 (for Replication Initiation Protein). While studies to date on this origin have not elucidated a complete model for initiation o f D N A synthesis, several o f the steps in the formation o f a 'prepriming complex' have been observed. Studies indicate that RIP60 binds within this region as dimers and larger concatamers at two copies o f the ( 5 ' - A T T - 3 ' ) motif, one within the O B R and another in inverse orientation approximately 700 bp downstream. Protein-protein interactions between the RIP60 multimers results in a looping o f the intervening D N A sequence and the imposition o f torsional stress . Affinity purification o f RIP60 from nuclear extracts by 64  oligonucleotide  affinity  chromatography  indicate  21  it associates  with  a  100 k D a  ATPase/helicase protein , perhaps in a manner analogous to the dnaA/dnaB-dnaC interaction in formation o f a prepriming complex. In addition to specific protein-binding and associated A T - r i c h sequence elements there is evidence for conservation o f certain higher-order structural motifs at origins o f replication. These motifs can be divided into two categories: in the first, sequences with repeated short oligo(dA) tracts spaced in synchrony with the helical phase o f the D N A result in a predicted aberration o f the local D N A from a linear to a bent conformation; in the second, short oligo(dA) tracts are again found, but in this case arranged such as to avoid  synchrony  with the  helical phase,  thereby  maintaining  the  D N A in  a  macroscopically unperturbed or 'anti-bent' f o r m . In a number o f examples from both 66  prokaryotes (such as O r i C o f B. subtilis or the ori o f p S C l O l ) and eukaryotes ( A R S 1 o f S. cerevisiae) both motifs are present, while in other cases (such as the S V 4 0 ori) only the bent motif is observed. It is proposed that these structural motifs have a functional significance, with the bent region acting to localize the first origin-binding proteins and the unbent region acting as an easily unwound element (a D U E ) or acting as a rigid region which avoids binding of duplex-stabilizing proteins such as histones . 66  In some  cases the structure o f these elements may be o f equal or greater importance than their sequence, as i n the case o f the bent region from A R S 1 ; while deletion o f this element reduces replication activity, replacement o f the original sequence with an unrelated bent 67  element allows activity to be maintained .  22  M V M replication The problem o f replication o f the termini o f a linear genome without sequential and eventually fatal loss o f genomic size has been solved in a number o f different ways by different organisms. A m o n g the Parvoviridae  the first step i n addressing this problem  is the inclusion o f palindromic sequences at both termini, allowing for the formation o f the double-stranded viral 'hairpin' telomeres characteristic o f the family. A method for the replication o f telomeres o f this form was first put forward as the 'Hairpin Transfer' 68  model , whereby the 3' end o f the single-stranded region folds back on itself and primes extension back towards the 5' end o f the parental strand. A site-specific single-stranded endonucleolytic cleavage event on the original parental strand is then postulated to occur just upstream o f the palindromic sequences, thereby simultaneously 'transferring' the hairpin structure to the progeny strand as a template, and providing a new 3' hydroxyl opposite it to prime what is essentially repair synthesis to regenerate the terminal palindrome on the parental strand.  A necessary consequence o f this model is that any  imperfections i n the terminal palindrome sequence w i l l not be copied exactly from progeny to parent, but w i l l be regenerated on the parent as the inverted complement o f the original sequence (see Figure 2). This model can be applied directly to members o f the Dependovirus  subfamily whose  termini contain both direct and inverted repeat sequences, and are identical at both ends. Extension from the genomic 3' hydroxyl allows for copying back all the way to the 5' terminus o f the molecule by displacement o f the 5' hairpin to make a double-stranded monomer replicative form (mRF) in which the 3' end is i n a loop and the 5' end is  23  1  5'  3'  A  B  B'c A '  A'cB'  5'  A  B  A'cB'  3' 5'  A  B  Nick  A'cB' B  A  A c' 3'  A'cB' B  5'  A c'B B '  A A'  Figure 2: Mechanism of Hairpin Transfer  Presence of palindromic sequences (A and A', B and B') at the 3' terminus [1] allows for hairpin formation and replication back along parental strand [2]. Site-specific nicking (shaded arrow,[3]) transfers terminal hairpin onto new strand and provides a template for repair synthesis [4]. End product has completely replicated the terminus, but imperfection within the palindrome {c} is regenerated on parental strand as its complement {c'} [5].  24  extended. The process o f hairpin transfer is then invoked, leading to a linear doublestranded form o f the incoming genome with both termini extended. It is then postulated that the termini dissociate from their linear trans double-stranded conformation and reform i n the cis double-stranded (hairpin) conformers; each strand is thus presenting a suitable 3' primer from which strand extension can remake the m R P form while simultaneously displacing the other strand (see Figure 3). It is suggested this process is concurrent with viral packaging, with one o f the two strands not extending but rather being sequestered by the capsid (possibly through binding o f the genome's 3' end by aggregates o f V P 1 noted above) from further rounds o f replication. This model makes two predictions: firstly,  as hairpin transfer  occurs equally at both termini, any  imperfections i n terminal palindromes w i l l result in two populations for each terminus, each being the complement o f the other; and secondly, positive and negative stranded progeny are produced in an equal ratio.  Support for this model comes from the  observations that in A A V the terminal sequences do in fact exist as an equal ratio o f two complementary forms, and the virus encapsidates both positive and negative strands equally. The packaging-driven generation of single-stranded genomes is also supported by evidence from temperature-sensitive mutants o f H I , where capsid instability at elevated temperatures  does  not interfere  with the  generation  of  double-stranded  intermediates but does limit the production o f single-stranded forms , and from the 69  studies done on M V M minigenomes i n this lab where double-stranded but not single70  stranded viral D N A s are observed i n the absence o f capsid proteins .  25  F i g u r e 3 : Dependovirus replication Incoming genome [1] is extended fromfree3' hydroxyl [2] to generate mRF [3]. Hairpin transfer allows generation of dimeric form with extended termini [4], Rearrangement of terminal palindromes into hairpins regenerates [2], which may either be encapsidated as progeny virus or be used to amplify replication intermediates [5].  26  Studies have been conducted in an effort to determine the minimal m - a c t i n g sequences required for origin function in the Dependovirus  A A V - 2 and indicate a  requirement for sequences derived from the extreme viral termini o n l y ' . 71  72  Three  regions, referred to as ' A ' , ' B ' , and ' C , are all within the terminal palindromes and are 73  essential for genome replication in vitro  . A fourth region, ' D ' , lies immediately inboard  of the terminal palindrome sequences and contains the terminal resolution site ( T R S , the site at which the viral Rep protein nicks the hairpin to commence the process o f hairpin transfer); and is therefore necessary for viral replication. That no other functionality lies within the ' D ' region is strongly suggested by the further observation that linear duplex vector sequences ending in A A V terminal sequences up to but not including the ' D ' 73  region are capable o f replication . In light o f this, it would seem that there is little or no similarity between the roles of the A A V ' D ' region and the M V M IRS which is the subject o f the current study. This relatively simple replication model is not however consistent with the data observed for the replication o f the autonomous parvoviruses including M V M . Parvovirinae  A s the  are far from being unanimous i n the following traits, they w i l l be described  for M V M with major exceptions being noted. Firstly, only negative-strand genomes are packaged to an appreciable extent ( B P V packages roughly 20-30% positive-sense genomes, and LuIII packages equal numbers o f positive and negative-strand genomes i n some hosts) ' . Secondly, while both hairpin palindromes are imperfect, only that at the 74  75  5' end o f mature genomes is found to exist i n two complementary forms (known as 'flip' 15 76  and 'flop'), while the 3' termini exists in a single form ' . (Again, B P V is unusual i n  27  this regard, having up to 10% o f the 3' ends existing in the complementary form). Thirdly, analysis o f viral D N A s in infected cells reveals the presence o f large numbers o f viral concatamers at dimeric and higher multiples o f the genomic length. A n y replication model for the autonomous parvoviruses must take these observations into account. Although likely incorrect in some aspects, the best supported model for M V M replication at present is the Modified Rolling Hairpin ( M R H ) m o d e l ' (see Figure 4). 5  6  This model varies from that for A A V by requiring the m R F form to have the 5' hairpin dissociate from its extended form and re-form as two hairpins without the nicking at the hairpinned 3' termini, thus allowing for the polymerase to extend from a 3' hydroxyl using first the strand it just created and then the original parental strand as templates. The net result is a dimeric Replicative Form (dRF) which is a concatamer o f two viral genomes (parental and progeny) each across from its complement; there are two 5' terminal palindrome sequences, one in an extended form and one i n a hairpinned form, and two 3' terminal palindrome sequences, both in an extended form i n the middle o f the molecule.  This molecule may have its extended 5' hairpin undergo another cycle o f  dissociation, hairpinning, and extension to form longer concatamers, or may undergo resolution as outlined below.  A s resolution o f the longer concatamers is exactly  analogous to that for the d R F species it w i l l not be discussed further.  Resolution occurs through the asymmetric hairpin transfer o f the central extended 3' palindromic sequences (the 'dimer bridge').  While the exact mechanism o f this  process is currently unclear, staggered site-specific nicking by NS-1 occurs on both strands with one end being selectively ligated across to reform a closed 3' hairpin. The  28  F i g u r e 4 : M V M D N A replication cycle MVM replication cycle. Monomeric genome [1] is extended from base-paired 3' terminus [2], displacing and extending the 5' hairpin structure (mRF, [3]). The extended hairpin terminus undergoes rearrangement to self-associate [4], affording a primer for further extension to a dimer-length molecule (dRF, [5]. This may then undergo further rounds of terminal rearrangement as in [4] and extension to higher-order concatamers, or asymmetric resolution by site-specific nicking by NS-1 (shaded arrows) and ligation to generate [6a] and [6b]. [6a] is identical to [3] and may be used to continue the cycle, while [6b] serves as a template to generate viral progeny by site-specific nicking by NS-1 (shaded arrow) and hairpin transfer [7]. A terminal rearrangement [8] identical to that in [4] allows for the lower strand to regenerate [6b], simultaneously displacing the upper strand for encapsidation as a mature genome [1]. Approximate location of the IRS is indicated by a shaded box above one strand of forms [1] through [7].  29  other end is filled in to generate an extended 3' end.  Hairpin transfer is simultaneously  invoked for the 5' termini in the hairpin configuration. The net yield o f these molecular gymnastics is production o f one m R F molecule identical to that arising from the original strand extension o f the infecting genome which may thus go back and repeat this cycle, and a linear double-stranded genome with both termini extended.  Generation o f single-  stranded progeny is achieved from this linear form, by having the right (genomic 5' sequence) end o f the molecule reform in independent hairpins, followed by extension from the 3' hydroxyl o f the complementary strand and hairpin transfer; this re-creates the linear molecule while simultaneously displacing a mature single-stranded genome (again, concurrent packaging is suggested). The linear molecule is capable o f going through this process multiple times, each time generating a mature genome with the same 3' terminal sequence but with alternating complementary 5' termini. It should be noted that this model requires there to be imperfections within the 3' palindromic sequences such that the resolution o f the central dimer bridge can be asymmetric, and similarly requires the two ends o f the genome to be nonidentical. One theoretical concern with both o f these models is the requirement for the extended termini to spontaneously melt from stable double-stranded conformations in order to reform as hairpins that act as primers for further extension, a transition which 77  must have a very appreciable activation energy barrier to overcome  . While models for  an enzymatically assisted transition can be put forth, a certain amount o f credulity is 78  required for their serious adoption. A model put forth by Rhode et. al.  overcomes this  by postulating an origin o f replication somewhat inboard o f the 5' hairpin. This model is 30  essentially identical to the Modified Rolling Hairpin model except that the origin is postulated to function both on the m R F and on the linear double-stranded molecule with both ends extended arising-from resolution of the dimer bridge.  Extension o f nascent  strands outward from this origin displaces the template's complementary strand, thereby eventually releasing one strand of the palindromic terminal sequences into a singlestranded form from which hairpin formation is thermodynamically plausable as a spontaneous event. Similarly to the M R H model, this requires imperfections within the palindromic sequences and non-identical termini. It also predicts that Okazaki fragments should be detectable at the viral origin o f D N A replication. In both cases the models call for the existence o f a site-specific endonuclease to create the nicks required for hairpin transfer; the fact that this endonuclease  must  recognize viral sequences, coupled with the observation that the sequences o f the parvoviruses do not show conservation at their termini, strongly suggests this enzyme is virally encoded. That this is in fact the case, and that the enzyme functions are provided 27  by the N S - 1 polypeptide, is now clear .  Previous studies and goals of the project Previous work from this lab had demonstrated  that an artificial  defective  interfering (DI) genome o f M V M , referred to as a 'minigenome', was replication competent when supplied with the viral NS-1 protein in trans. Deletional analysis o f this minigenome indicated the presence o f cw-acting sequences inboard o f the 5' palindrome which were required for D N A replication in C O S - 7 cells (the Internal Replication 70  Sequence or IRS) . Bandshift studies employing a partially purified H e L a cell extract  31  and restriction fragments from the region o f the IRS indicated the formation o f several specific complexes i n the region, and further fractionation o f the nuclear extract allowed for the footprinting o f one o f these complexes. It was shown to cover a bipartite region 79  between viral nucleotides 4589-4646 . The goals o f this project were to further refine on these studies by examining the IRS sequences in finer detail to determine i f specific short sequence elements were important in replication competence, and to attempt to localize all host-factor binding sites within the region. Furthermore, it was hoped that the identity o f these host factor(s) and their role(s), i f any, i n viral replication could be elucidated.  32  Materials and Methods General  methods  General protocols for routine cloning procedures, growth o f bacteria, composition of bacterial media, and common buffers and solutions have been previously described . 80  Sources of enzymes etc. Restriction and modification enzymes were purchased from N e w England Biolabs or G I B C O / B R L and used according to the supplier's protocols.  Bacterial  culture  C e l l lines Plasmids were propagated and cloning procedures performed exclusively i n S U R E cells (Stratagene), which were chosen for their recombination-deficient phenotype. This strain was previously found in our lab to be capable o f stably maintaining plasmids containing the extended palindromic sequences present in clones containing the M V M terminal sequences. Growth Bacteria were routinely grown on T Y solid media (lOg tryptone, 5g yeast extract, 5g N a C l per litre, 2% agar) or 2 x T Y liquid media (16g tryptone, lOg yeast extract, 5g N a C l per liter). M e d i a was supplemented with ampicillin (Penbritin, Wyeth-Ayerst) to 200 ug/ml when required for the selection o f plasmids.  33  Transformation and electroporation Routine transformations were done with cells made chemically competent by a modified calcium chloride treatment. Briefly, the bacteria were grown to m i d log phase in  2xTY  media  containing  lOmM  MgS0 , 4  chilled,  pelleted  by  centrifugation,  resuspended in sterile Transformation Buffer I (30 m M K O A c , 5 0 m M M n C l , 100 m M 2  K C 1 , 10 m M C a C l , 15% glycerol), recentrifuged, resuspended in Transformation Buffer 2  II ( l O m M N a - M O P S p H 7.0, 75 m M C a C l , 10 m M K C 1 , 15% glycerol), aliquoted, and 2  flash-frozen on dry ice before storage at -70°C. Transformations were done by mixing plasmid or ligation mixture with 50-100 ul thawed competent cells, incubating on ice 30 minutes, heat shocking at 37°C for one minute with gentle agitation, chilling on ice for one minute, followed by addition to 2 m l 2 x T Y media for growth at 37°C for one to two hours prior to plating on selective media. For transformation o f extremely small quantities of plasmid D N A such as that obtained from yeast minipreps, electroporation was employed using a B i o - R a d Gene Pulser.  Electrocompetent  cells were prepared  and used in accordance  with the  manufacturer's supplied protocols.  D N A recovery and Hirt extraction Small scale 'miniprep' isolation o f plasmid D N A s was performed with a rapid 81  modified alkaline lysis protocol .  M i d - and large-scale plasmid isolations  were  performed by alkaline lysis followed by polyethylene glycol precipitation. 82  Hirt extraction  was performed on 10cm dishes o f adherent cells by removal o f  culture media and scraping o f cells into 1 m l o f Hirt lysis buffer (100 m M N a C l , 10 m M  34  E D T A , 1% S D S ) . N a C l was added to 1.1 M final concentration from a 5 M stock, and lysates incubated at 4 ° C for 12-16 hours prior to centrifugation at 12 000 x g, 4 ° C , for 30 minutes. The resulting supernatant was digested with Proteinase K (50 ug/ml) at 37°C for 2 hours, phenol-chloroform extracted, and D N A s precipitated from the aqueous phase by the addition o f an equal volume o f isopropyl alcohol and centrifugation. Recovered D N A s were resuspended i n 60 p i o f sterile water.  For 60mm tissue culture dishes, all  reagent volumes used were 40% that employed for 10cm dishes.  Cell culture  Cell lines C O S - 7 cells  83  were grown in D M E M supplemented with 10% fetal calf serum and r  84  20ug/ml Gentamicin. A 9 oub 11 variant mouse L cells ( L A 9 cells)  were grown i n  D M E M supplemented with 5% fetal calf serum and 20pg/ml Gentamicin.  Maintenance Cells were maintained in culture by growth in complete media in 10 cm tissue culture dishes at 37°C i n 5% C 0 . 2  When cells reached - 9 0 % confluency they were  passaged by trypsinization and dilution 1/10 i n fresh media (approximately once every 3 days).  Cells were maintained in fresh culture for the minimal amount o f time needed,  with fresh stocks from frozen culture being employed i f passaging o f more than a few weeks was anticipated between experiments.  35  Transfection Confluent cells were passaged at 1/5 dilution 24 hours prior to transfection by the D E A E - D e x t r a n method. C e l l monolayers were incubated with 5 ug o f each plasmid to be transfected in 2.5 m l o f D M E M (without serum) containing 400 ug D E A E - D e x t r a n for 8 hours.  Dishes were gently rocked every few hours to ensure even distribution o f the  transfection media. Transfection media was then aspirated and cells shocked with 10% D M S O i n P B S for 5 minutes (COS-7 cells) or 2 minutes ( L A 9 cells). The D M S O shock was aspirated, cells were rinsed twice i n P B S , and recovered in complete media for growth. (Volumes given are for 10 cm culture dishes; for 60 m m dishes 40% o f these volumes were used).  Viral Isolation Virus was grown and isolated in a modification o f the method o f Tattersall et. al. ; briefly, confluent monolayers o f L A 9 cells were split 1/5 in complete media to 10 14  cm dishes and allowed to grow for 24 hours prior to low-efficiency transfection with 1 p,g Smal linearized infectious clone and growth for 72 hours following D M S O  shock.  Monolayers were then scraped and collected, centrifuged at 300 x g for 5 minutes, pellet washed with 5 m l T N E (0.15 M N a C l , 50 m M T r i s - H C l , 0.5 m M E D T A , p H 7.5), centrifuged at 300 x g for 5 minutes, pellet resuspended in T E (50 m M T r i s - H C l , 0.5 m M E D T A , p H 8.7) containing 1 m M P M S F and cells lysed with a Tenbroek homogenizer (15 strokes) followed by centrifugation at 300 x g for 5 minutes at room temperature. The supernatant was then centrifuged at 12 000 x g for 30 minutes, and the supernatant made 25 m M i n C a C l . 2  Virus was allowed to precipitate on ice for 30 minutes, then  36  centrifuged at 12 000 x g for 10 minutes. The pellet was resuspended by vortexing i n 100 p i T E (pH 8.7) containing 20 m M E D T A and centrifuged 12 000 x g for 10 minutes. The supernatant, equivalent to Fraction 3 o f Tattersall et. al. , 14  was used as viral stock for  plaque assays.  P l a q u e Assay L A 9 cells were trypsinized, counted in a haemocytometer, and resuspended at 1.25 x l O cells/ml in complete media. Four-ml aliquots (5x10 cells) were seeded per 60 4  4  m m dish and were allowed to grow for 24 hours prior to having the media removed and viral dilutions i n 300 p i o f D M E M / 1 % F C S / 1 0 m M H E P E S p H 7.3 applied. Virus were allowed to adsorb at 37°C for one hour, with the dish being gently rocked every 30 minutes to ensure even distribution. V i r a l dilutions were removed, and the monolayers were recovered in D M E M / 5% F C S / 20 pg/ml Gentamicin/ 1% tryptose  phosphate/  0.75% agarose equilibrated to 45°C. Cells were left to grow for 5 days before being fixed in 10% formaldehyde and stained with 0.3% Methylene Blue.  Cloning  techniques  Digestions a n d Ligations Digestions and ligations were performed in the supplier's buffer system. Routine digestions were performed at the recommended temperatures for 1-3 hours; ligations were carried out at 16°C for 4 hours (common cohesive-end simple ligations) to overnight (for ligations with more than two fragments or involving blunt ends).  37  Oligonucleotides Synthetic oligonucleotides employed in this study are presented i n Table 2. A l l oligonucleotides were prepared on A B I 371 or 374 D N A synthesizers.  Plasmid constructs Details o f the construction o f p C A 4 . 0 , p P T L R , and p C M V N S - 1 have been 70  previously published . Construct pJB2.0 was made  by cloning a P C R product  corresponding to viral nt. 4484 through 4777 between EcoRI and BamHI tags (obtained using primers M V M A 5 and M V M B 3 on p C A 4 . 0 template) between the E c o R I and B a m H I sites o f p U C 1 9 .  Oligonucleotide M V M A 5 simultaneously introduced a single  T—»C silent nucleotide substitution at viral nt. 4486 to introduce a unique BstEII site. Minigenome p J B L R 4 was constructed from p P T L R by introduction o f a single T—»C silent nucleotide substitution at viral nt. 4486 to introduce a unique BstEII site inboard o f the I R S .  The minigenome used i n replication studies, p J B L R 4 . 3 , was derived from  p J B L R 4 by digesting, filling in, and religating the BamHI linkers flanking the viral minigenome to convert them to C l a l sites and substitution o f the viral sequence T A G G T T A A T at nt. 4780 with C C C T A G G C , thereby introducing a unique B a m H I site (see Figure 5). Clone pJB3.0 was constructed by deleting the Sspl to Smal fragment o f p U C 1 9 followed by inserting the X b a l to Sphl fragment o f p C A 4 . 0 into the same sites i n the polylinker o f the deleted vector. Its derivative p J B 3 . 0 S l was constructed by replacing the BstEII to Sspl fragment o f pJB3.0 with the same fragment from p J B 2 . 0 S l  (see  below), and p C A 4 . 0 S l was constructed by replacing the X b a l to Sphl fragment o f pCA4.0  with  that  from  pJB3.0Sl.  38  Clone  pJBRl  Oligo name MVMA5 MVMB3 S20E S21B S22B S23B S25-2 S26C S26D S822C S822D TIC C2A T3G T4A A6C T8G SIP pGADforward Vecpro JAVA Forward seq. Reverse seq. S1 BE S1BEC  Oligonucleotide sequence GGAATTCCGGTTACCAACTGCTACTGGAA CGGGATCCCGAACCACCCTTCCACCCTTTTA CAGATCTGTTATAACAAGACC CAGATGTGTAAGTACCATATTA CAGATCTGATATGAAGTACAG CAGATGTGAAAGAAAAAGCATG ATTATATTTCTCAGATCTGTCTTTATTAGTCTTAATAATATATG TATGTTGTATCTTTATTAGTCTTAATAATATATG CAGATCGATCTGTACATATAGATTTAAGAAATAG AAGCATGGTTAGTTAG pTTTCTTTCTGTACTTC CCTTTATTAGTCTTAATAATATATG TATTTATTAGTCTTAATAATATATG TCGTTATTAGTCTTAATAATATATG TCTATATTAGTCTTAATAATATATG TCTTTCTTAGTCTTAATAATATATG TCTTTATGAGTCTTAATAATATATG pTACAACATAGAAATATAATATTAC TACCACTACAATGGATG CGCGTTTCGGTGATGAC TTTTGGTCCTTAACATCAAG GTAAAACGACGGCCAGT AACAGCTATGACCATG AATTCCTAATAAAGATACTAATAAAGATACTAATAAAGATACTAATAAAGATA TATCTTTATTAG TATCTTTATTAG TATCTTTATTAG TATCTTTATTAGG Table 2: Oligonucleotides Used  A listing of oligonucleotides referred to in text. Sequences are reported 5' to 3'; a leading 'p' indicates a 5' phosphorylation.  39  was constructed from p J B L R 4 . 3 by digestion with N h e l and X b a l to remove sequences derived from the viral 3' genomic region, gel isolation o f the large fragment retaining vector and viral genomic 5' sequences,  and religation.  Linker-scanning mutant  derivatives o f this were made from the corresponding p J B L R 4 . 3 clone in the same fashion.  Construction of the Linker-scanning library The linker-scanning library constructed and employed in this study is shown in Table 3. Digestion o f pJB2.0 with either EcoRI or BamHI followed by limited digestion with Bal-31 nuclease, blunt-ending with Klenow fragment in the presence o f dNTPs, and religation  in  the  presence  of  excess  synthetic  double-stranded  Bglll  linker  ( p C A G A T C T G ) created pools o f clones with partial deletions o f the cloned viral sequences, known as AEco or  A B a m clones respectively.  Clones were sequenced  (Sequenase 2.0, U S B ) to determine deletion endpoints, and AEco and  A B a m clones  which matched up to re-create the original cloned viral sequence with a central gap o f 8 nt filled by the B g l l l linker were joined together at the linker directly. Clones which were found to together reconstitute the original cloned viral sequence with a gap o f exactly 12 base pairs were treated by digestion with B g l l l , the recessed 3' end filled i n by K l e n o w fragment i n the presence o f all four dNTPs, and ligated together to recreate the original viral sequence with an internal 12 bases replaced with a C l a l linker ( C A G A T C G A T C T G ) (see Figure 6). Clones produced in this fashion are referred to as  40  PstI (411)  Xbal (4342)  5'H  pCA4.0  BamHl A IRS  3' BamHl  5':BamHl BstEII IRS  3' BamHl  pPTLR  A,  5' :—  pJBLR4  BamHl ^ BamHl BstEII IRS pJBLR4.3  Figure 5: Schematic Representation of Minigenomes Schematic diagram of the relationship between full-length viral clone pCA4.0 and the minigenomes discussed in this study. Relevant restriction sites are noted, as is the location of the IRS. pPTLR was the minigenome employed in previous studies; pJBLR4.3 was the primary minigenome employed in this study; and pJBLR4 was a construction intermediate between the two employed in one experiment (see Figure 7). Note that all four of these constructs are in fact double-stranded plasmid clones; for simplicity only one strand of the virally-derived sequence element from each clone is represented here.  41  pJB2.0S(x) where (x) is a number specific to the particular linker-scanning mutation. In some cases where a matching set o f AEco and A B a m clones could not be found, P C R was used to create a suitable match to an existing deletion; specifically clones S20, S21, S22,  and S23 were created this way with the matching clone being made by P C R  between  primer  pairs  S20E/MVMB3,  S21B/MVMA5,  S22B/MVMA5,  and  S 2 3 B / M V M A 5 respectively, using pJB2.0 as template. These products were cloned into p U C 1 9 vector linearized with Smal, and then digested with B g l l l (followed by fill-in with K l e n o w fragment for S23) and either EcoRI (S21, S22, S23) or B a m H l (S20) and used as were the native AEco and A B a m clones. Clones S25 and S26 were made totally by P C R . Mutation S25 was made by P C R using oligos S25-2 (phosphorylated with T4 polynucleotide kinase) and M V M A 5 on pJB2.0 template; the product was ligated to the small Sspl fragment o f pJB2.0, and the resulting mixture o f products used as a template for P C R with primers M V M A 5 and MVMB3.  The resulting product was digested with EcoRI and B a m H I and cloned into  p J B L R 4 . 3 vector digested with the same enzymes, directly yielding p J B L R 4 . 3 S 2 5 . Mutation  S26 was constructed by P C R using primer pairs S 2 6 C / M V M A 5  and  S 2 6 D / M V M B 3 on pJB2.0 template, gel-isolating the products, ligating them together, and then using the ligation m i x as a template for a P C R with primers M V M A 5 and M V M B 3 . The resulting product was digested with EcoRI and B a m H I and cloned into p J B L R 4 . 3 vector digested with the same enzymes, directly yielding p J B L R 4 . 3 S 2 6 .  42  t AEco  XXXXCAGATCTGNNNN XXXXGTCTAGACNNNN NNNNCAGATCTGNNNN "NNNNGTCTAGACNNNN NNNNCAGATCTGXXXX  ABam NNNNGTCTAGACXXXX  AECO  XXXXCAGATCTGNNNN XXXXGTCTAGACNNNN NNNNCAGATCGATCTGNNNN NNNNGTCTAGCTAGACNNNN  A  B  a  m  NNNNCAGATCTGXXXX NNNNGTCTAGACXXXX  Figure 6: Linker-scanner mutant construction Construction of linker scanning mutants was carried out by digesting pJB2.0 clones deleted from BamHI or EcoRI sites and having Bglll linkers either in register (directly ligated to generate 8 bp. scanner mutations; upper part of figure), or four bases out of register (digested, filled in with Klenow fragment in the presence of all four dNTPs, and ligated to generate a 12 bp. scanner mutation; lower part of figure). ' N ' represents a nucleotide of cloned viral sequence, and ' X ' represents a nucleotide of vector; shaded arrows indicate the cut site within the Bglll linker.  43  Dual-mutant S8/22 was made by using p B L R 4 . 3 S 8 as a template for P C R with primers M V M A 5 and S822C, pJBLR4.3S22 as a template for P C R with primers S822D and M V M B 3 and ligation o f the two products together. The ligation product was used as template for P C R o f with M V M A 5 and M V M B 3 , and the resulting product digested with B a m H I and BstEII prior to cloning into p J B L R 4 . 3 vector digested with the same enzymes. Scanner mutant clones in the context o f pJB2.0 were introduced into the p J B L R 4 . 3 context by replacing the equivalent BstEII to BamHI fragment o f p J B L R 4 . 3 with that o f pJB2.0S(x) to yield pJBLR4.3S(x).  A l l clones were sequenced to ensure  proper construction.  Construction of point mutants Mutations T I C , C 2 A , T 3 G , T 4 A , A 6 C , and T 8 G were made by P C R with the respective oligonucleotides and M V M A 5 on pJB2.0 template.  Gel-isolated products  were ligated to isolated P C R product obtained with primers S I P and M V M B 3 on pJB2.0 template.  The resulting ligation products were used as template for P C R with primers  M V M A 5 and M V M B 3 , and the product gel-isolated, digested with BstEII and B a m H I , and cloned into p J B L R 4 . 3 digested with the same enzymes to yield the respective pointmutant minigenomes.  Gel isolations D N A fragments were routinely isolated from agarose gels after electrophoresis by visualization o f E t B r stained bands under longwave ultraviolet light, excision o f desired band from the gel, and centrifugation o f the gel slice through a mesh o f silanized glass wool i n a microfuge tube for 2 minutes at 12 000 x g.  44  The aqueous phase collected  below the wool was used directly i n cloning or precipitated as needed to concentrate the fragment.  D N A End-Labelling Oligonucleotides and double-stranded D N A fragments were routinely 5' endlabelled with  3 2  P by incubating 50-200 ng o f D N A in a 20 ul reaction containing l x T4  Polynucleotide Kinase buffer, 5 ul y - P r A T P (3000 C i / m M o l ) , and 10 units T4 32  Polynucleotide Kinase at 37°C for 30 minutes.  For oligonucleotides to be used for  hybridization probes, the reaction was then stopped by incubation at 65°C for 10 minutes and the probe used directly; for double-stranded fragments to be employed as bandshift probes, the reaction was precipitated by addition o f 2 ul 3.5 M N a O A c p H 5.4 and 60 ul E t O H , incubation on ice for 20 minutes, centrifugation, removal o f supernatant, and washing o f the pellet with 200 ul ice-cold 70% E t O H three times prior to being resuspended at 1 ng/ul final concentration for use.  Sequencing D N A sequencing was carried out by a Sanger dideoxy protocol, using the 32  Sequenase 2.0 kit (United States Biochemicals/Amersham) and a -  P d A T P as label.  Templates, generally consisting o f 10 ul o f miniprep D N A or 2 p,g o f large-scale purified D N A , were denatured in 0 . 2 M N a O H , 0 . 2 m M E D T A for 30 minutes prior to precipitation and annealing in sequencing buffer with 1 pmol o f the desired primer.  45  Polymerase Chain Reaction P C R was routinely carried out using Vent polymerase (New England Biolabs) i n its supplied buffer system, supplemented with B S A to lOOpg/ml.  Standard reactions  were done i n 50 p i volumes and contained 500 u M dNTPs and 25 pmol o f each primer. Thermocycling was done with an M J Research Minicycler. Conditions were individually optimized for each reaction.  D N A quantitation Routine D N A quantitations o f plasmids and oligonucleotides were performed by spectrophotometry.  Replication  Assay  Sets o f 10cm dishes o f confluent C O S - 7 monolayers were rinsed i n phosphatebuffered saline, trypsinized, and evenly resuspended i n a pooled volume o f complete media at 1/5 dilution. Four-ml aliquots o f the resuspended cells were seeded onto 60mm tissue culture dishes and allowed to grow for 24 hours prior to transfection. Cells were transfected by a standard D E A E - D e x t r a n protocol using 2 ug o f each plasmid; minigenomic clones were linearized by digestion with EcoRI prior to transfection. Complete media was then added to the cells and they were allowed to grow for 48 hours. 82  L o w molecular weight D N A s were recovered by Hirt extraction  and used for analysis  by slot-blotting and hybridization. D N A s transfected in each assay consisted o f linearized p J B L R 4 . 3 alone (two samples), linearized p J B L R 4 . 3 with p C M V N S - 1  (two samples), and each o f the  linearized mutants being assayed with p C M V N S - 1 . Replication was quantitated by slot-  46  blotting 5 u l o f Hirt extract from each sample onto Hybond-N+ along with a standard range (concentration determined by spectrophotometry) o f both linearized p J B L R 4 . 3 and p C M V N S - 1 (the latter included as a control for non-specific hybridization). Blots were prehybridized i n 6 x S S P E , 1%SDS, 5x Denhardt's Reagent, and 10 p,g/ml fragmented, denatured salmon sperm D N A at 42°C for 4 hours, followed by hybridization in 6 x S S P E , 1% S D S with 5 ng o f 5' "P end-labeled Vecpro oligonucleotide at 39°C for 10-15 hours. 32  Blots were washed twice at room temperature in 6 x S S P E / l % S D S for 3-5 minutes and once i n 2 x S S P E at 39°C for 3 minutes prior to visualization by phosphorimaging (Molecular Dynamics Phosphorlmager SI; IP Lab G e l Version H (Signal Analytics) was used i n image analysis).  Results o f this exposure provide data on input D N A  (input) present in each sample as Vecpro hybridizes uniquely to the vector backbone. Blots were then stripped (washed in 6 x S S P E , 50% formamide, 65°C, 30 minutes followed by 2 x S S P E , 65°C, 30 minutes) and again visualized to verify removal o f probe. Prehybridization, hybridization, washing, and exposure were then carried out exactly as before,  but with  5'  end-labeled oligonucleotide probe  JAVA  determination o f the amount o f viral sequence present  which  allows for  in each sample (viral) by  hybridizing uniquely to sequences present i n the minigenome.  Analysis o f replication data consisted o f preparing a standard curve from the amount o f signal obtained from the range o f linearized p J B L R 4 . 3 standard applied to each blot, and using this standard curve to determine the quantity o f D N A present i n each of the samples corresponding to each o f the transfections. was calculated as RE = (viral - input) I (input).  47  Replication efficiency (RE)  Samples consisting o f viral minigenome  alone were taken as having no replication and a Scaled Replication Efficiency ( S R E ) was calculated for each sample (n) as SRE(ri) = RE(n) - RE(pJBLR43).  Samples consisting  of wild-type viral minigenome and p C M V N S - 1 were taken as having 100% replication, and a Scaled Relative Replication Efficiency ( S R R E ) was calculated for each sample (n) as  SRRE(ri) = SRE(n) I SRE(pJBLR43  + pCMVNS  -1) .  Individual data sets thus  normalized for 0 and 100% replication were pooled for statistical analysis.  Competitive  Replication  Assay  Competitive replication assays were carried out in the same fashion as were regular replication assays, with the exception that 1 pg o f EcoRI-linearized mutant minigenome was cotransfected with an equal amount o f EcoRI-linearized p J B L R 4 . 3 and 2pg ofpCMVNS-1. Assays o f each mutant were examined by slot-blotting 5 p i o f Hirt extract on Hybond-N+ along  with a set  o f standard dilutions o f EcoRI-linearized mutant  minigenome and one control sample each o f p J B L R 4 . 3 and p C M V N S - 1 .  Blots were  prehybridized as were regular replication assays, and hybridized i n 6x S S P E / 1% S D S with 5ng o f a 5' "P end-labelled oligonucleotide capable o f specific hybridization to the 32  mutant being assayed (generally, such oligonucleotides were designed to include the scanner mutation present in the mutant minigenome  and its flanking sequences).  Washing was performed as for regular replication assay slot-blots, and phosphorimaging used to quantitate the amount o f mutant minigenome present in each sample (mutant). Following this, blots were stripped by the same protocol used i n regular replication  48  assays and examined by phosphorimaging to verify removal o f probe. Prehybridization and hybridization o f the blot was then again carried out, using 5'  "P labelled J A V A as  probe (which hybridizes equally to mutant and wild-type minigenomes present i n the sample). After washing, the blot was quantitated by phosphorimaging, with this value corresponding to the sum o f wild-type and mutant minigenome present i n each sample (total). Replication efficiency o f the mutant relative to the wild-type minigenome was calculated directly from this data as (mutant)/(totat).  Specificity o f the probes employed  was verified by a lack o f hybridization o f either probe to the p C M V N S - 1 control sample, hybridization to the p J B L R 4 . 3 control sample by the J A V A probe only, and hybridization to the mutant minigenome standards by both probes.  Competition  Bandshift  assay  G e l retardation assays were carried out on gel-purified P C R products or restriction fragments prepared from the wild-type or scanner mutant template or clone.  Scanner  mutants S4, S5, S20, S2, and S7 were analyzed with the BstEII-SspI restriction fragment (viral nt. 4484-4626; B S fragment); mutants S8, S14, S3, S23, S22, S I , and S15 were analyzed with a P C R product obtained with primers S20E and S21B (viral nt. 4524-4668, flanked on either side by C A G A T C T G ; 2021 fragment); and mutants S I 6 , S I 7 , S21, S I 2 , S I 3 , and S I 8 were analyzed with a P C R product obtained with primers S I P and M V M B 3 (viral nt. 4610-4781; S B fragment). A l l purified fragments were quantitated by binding o f Hoescht 33258 dye and fluorometry on a Hoeffer T K O - 1 0 0 fluorometer. Assays were performed by incubating 1 ng of end-labeled wild-type fragment i n 5 0 m M N a C l , l O m M  49  Tris, 1 m M D T T , 5% glycerol p H 7.1  containing approximately 3.75 pg LA9 nuclear  extract for 30 minutes. Competition by a given mutant was assayed by including 40 ng o f unlabelled mutant-derived fragment in the binding reaction and allowing a 10-minute preincubation with the nuclear extract before addition of the labeled wild-type probe. Reactions were run on 4% polyacrylamide/1% glycerol vertical gels i n l/2x T B E / 1 % glycerol buffer. Gels were dried and the results visualized by phosphorimaging.  Southern  Blotting  Routine Southern blotting was performed by standard protocols.  D N A species  were separated by agarose gel electrophoresis i n T A E buffer and transferred to nylon membrane by vacuum transfer, using a Pharmacia Vacu-Gene apparatus i n accordance with its supplied protocol.  Membranes  were dried to fix the D N A s prior to  prehybridization for a minimum of one hour in 6 x S S P E / 1% S D S / 50% formamide/ 50 ug/ml sheared, denatured salmon sperm D N A at 42°C. Hybridizations were carried out by  adding  a  denatured  random-primed  probe  directly  to  the  membrane  prehybridization buffer and allowed to proceed at 42°C for 12-18 hours.  and  Blots were  washed twice i n 50 m l of 6 x S S P E / 1 % S D S at 25°C for 15 minutes and then twice more in 50 m l of 2 x S S P E / 1% S D S at 37°C for 15 minutes.  Visualization was by  phosphorimaging.  Two-Dimensional  Neutral-Alkaline  Agarose  Electrophoresis  Two-dimensional neutral-alkaline agarose electrophoresis was carried out i n a 85 86  modification of the method of Nawotka and Huberman ' . Hirt extracts were resolved first on the basis of native size in a 1% T A E agarose gel (approximately 8 V / c m for 2-3  50  hours); an adjacent lane contained a size standard for comparison. The lane containing Hirt extract was then excised from the gel and soaked in 5 0 m M N a O H / 1 m M E D T A for 45 minutes to denature the D N A species. This denatured gel slice was placed at the top o f a support tray and a 1% alkaline agarose gel ( 5 0 m M NaOH/1 m M E D T A ) was poured below the slice and allowed to set. The composite gel was then run (in alkaline running buffer ( 5 0 m M N a O H / 1 m M E D T A ) at 2 V / c m for 7 hours) at right angles to the first electrophoresis, separating individual D N A strands on the basis o f size. Following this, D N A species i n the gel were transferred to Hybond-N nylon membrane by vacuum transfer and treated as a Southern blot.  Yeast C e l l lines Plasmid p L a c Z i / S l was made by annealing oligonucleotides SI B E and S 1 B E C , and ligation o f this product into p L a c Z i vector digested with H i n d l l l and Smal. Plasmid p H i s - i / S l was prepared i n an analogous fashion from vector pHIS-i. Reporter strain Y M L H S 1 was prepared by sequentially integrating plasmids p H I S i - S l and p L a c Z i - S l into the HIS3 and U R A 3 loci o f  strain Y M 4 2 7 1 (his3-200  ura3-52 trpl-903 tyrl-501 leu2-3,l 12 ade2-101 lys2-801 M A T a ade5:hisG gal4A gal80A) supplied with the Clontech One-Hybrid kit in accordance with their supplied protocols. Strain Y M 5 3 B l u e was prepared by integrating p53Blue (Clontech) into the Ura3 locus o f Y M 4 2 7 1 by the supplier's protocol, thereby placing a tandem repeat o f 3 copies o f the p53 consensus binding site upstream o f a p-galactosidase reporter.  Both strains were  tested for leaky expression, and Y M 5 3 B l u e for proper reporting by transformation with  51  p G A D 5 3 m (Clontech). A range o f 3-aminotriazole concentrations was tested for effective inhibition o f uninduced His3 expression by the supplied protocol, with 3 0 m M being found optimal. P-galactosidase assays were performed by filter lift o f colonies according to the supplied protocol.  O n e - h y b r i d screen One-hybrid genetic screens were performed with the Matchmaker One-Hybrid System (Clontech) using the strains and integrants described above.  A Matchmaker  c D N A library (Catalog # M L 4 0 0 5 A B , Lot# 49011) made from whole 11-day Swiss Webster/ N I H mouse embryos was used in screening.  c D N A s for the library were  obtained by oligo(dT)/random priming, ligation o f EcoRI adapters, and cloning into the EcoRI site o f p G A D l O . These clones thus use the A D H 1 promoter to express a fusion o f the S V 4 0 Large-T antigen start codon and nuclear localization signal, followed by the transcriptional activation domain o f G A L 4 , followed by the c D N A . Information supplied with the library indicated it contained 3.0 x 10 independent clones, with an insert size 6  range o f 0.5-3.5 kb and an average size o f 1.3 kb. The frequency o f clone hybridization to a human (3-actin probe was 0.16%. Strain Y M L H S 1 was used to screen this library by transformation and selection on SD/-Leu/-His/30 m M 3-aminotriazole media according to the supplied protocol. Plasmid isolation from positive clones was by yeast miniprep as described in the supplied protocol, and recovered plasmids were transformed electroporation.  into E. coli  S U R E cells by  Strain Y M L H S 1 was used to assay potential positive clones for (3-  galactosidase expression by the filter-lift protocol as supplied by Clontech.  52  Results Minigenome  Replication  studies  Previous studies on M V M indicated the presence o f cw-acting sequences at either genomic termini with characteristics o f replication origins.  Spontaneously occuring  defective interfering (DI) particles are only found to be replication competent when the 87  genomic terminal regions are maintained  and studies on full-length infectious clones  demonstrated that even small deletions within the right-hand hairpin are sufficient to block viral replication . In order to attempt to localize any sequence regions inboard o f 88  the terminal palindromes required for viral D N A replication, an artificial D I genome or 'minigenome' was employed for deletional analysis studies.  Observations with this  system identified the Internal Replication Sequence (IRS) as a region between viral nt. 4489 and 4695, the presence o f which in full or in part was required for efficient minigenome replication . 70  In order to extend these observations the current study aimed to examine the IRS with a linker-scanner library in the context o f the viral minigenome system.  A s the  minigenome construct employed in previous studies ( p P T L R ) contained no convenient restriction sites for replacement of the IRS element with homologs carrying linker scanning mutations, a new minigenomic construct was made to simplify cloning. A s outlined i n more detail in the Materials and Methods section, minigenome p J B L R 4 . 3 contains the same regions as its progenitor p P T L R with two new unique restriction sites introduced to flank the I R S : a BstEII site at viral nt. 4486 and a B a m H I site at viral nt. 4780 (see Figure 5). The mutation to introduce the BstEII site was a single-nucleotide  53  silent substitution already known to exist in some M V M isolates and was thus expected to have no effect on replication levels. Introduction of the BamHI site required more extensive modification o f the viral sequence, with the substitution o f 8 nucleotides directly at the junction between two 65 nt. direct-repeat elements present i n the viral genome.  Conservation o f this repeat element i n a variable number o f copies across  several parvoviral species together with evidence indicating an importance o f these 88  elements i n viral replication  suggested that mutations i n this region might have an  adverse effect on minigenome replication. In order to assess whether the modifications used to create p J B L R 4 . 3 interfered with minigenome replication competence, the replication efficiency o f this minigenome 70  was compared to that o f p J B L R 4 by the replication assay used in prior studies  . A s the  only difference between p P T L R and p J B L R 4 is the presence o f the BstEII site i n p J B L R 4 , this was used as the 'wild-type' minigenome control. Each minigenome (linearized with EcoRI) was cotransfected with p C M V N S - 1 into C O S - 7 cells for 72 hours followed by Hirt extraction. The extract was examined for replicated species by D p n l digestion and Southern blotting for minigenomic sequences. Input plasmid species carry a characteristic bacterial methylation pattern G  ( N 6 M e )  A T C which is efficiently cleaved by  D p n l , while replicated D N A s are either hemimethylated or unmethylated and thus resistant to cleavage. A s is shown in Figure 7, the presence o f D p n l resistant species at m R F and higher concatameric species at approximately equal levels i n samples with  54  F i g u r e 7: Replication of p J B L R 4 vs. p J B L R 4 . 3 EcoRI linearized pJBLR4 or pJBLR4.3 plasmids were transfected into COS-7 cells with or without pCMVNS-1 for 72 hours prior to Hirt extraction. 5 ul samples of Hirt extract from each sample were treated as indicated below and run on a 1% agarose gel at 8 V/cm for 3 hours, followed by vacuum tranfer to Hybond-N membrane. Southern blotting was performed with a random-primed probe made with viral sequences (BamHl insert of pJBLR4) as template and blot visualized by phosphorimaging. Details of protocols are as per Methods and Materials. Lane #:Plasmids transfected. treatment of Hirt extract (Lane I: Marker (BRL lkb ladder))* Lane 2: pJBLR4, undigested. Lane 3: pJBLR4, Dpnl digested. Lane 4: pJBLR4 + p C M V N S - 1 , undigested. Lane 5: pJBLR4 + p C M V N S - 1 , Dpnl digested. Lane 6: pJBLR4.3, undigested. Lane 7: pJBLR4.3, Dpnl digested. Lane 8: pJBLR4.3, Dpnl and BamHl digested. Lane 9: pJBLR4.3 + p C M V N S - 1 , undigested. Lane 10: pJBLR4.3 + p C M V N S - 1 , Dpnl digested. Lane 11: pJBLR4.3 + p C M V N S - 1 , Dpnl and BamHl digested. Similar levels of mRF in lanes 5 and 10 indicate that the changes introduced in making pJBLR4.3 from pJBLR4 do not interfere with replication competence. * Hybridization of the viral minigenomic probe to the 1636 bp D N A size standard used in this and subsequent figures is due to a short region of homology arising from a remnant of pUC19 polylinker present in minigenome clones and thus in the template for random-primed probe.  55  either p J B L R 4 or p J B L R 4 . 3 (compare lanes 5 and 10) indicates that the modifications introduced to create p J B L R 4 . 3 do not have any apparent effect on its replication competence. Having verified that p J B L R 4 . 3 was a suitable construct for testing the linker scanning mutations, a library o f minigenomic constucts based on this vector and containing the linker-scanning mutations shown in Table 3 and Figure 9 was constructed. 70  A s the D p n l resistance replication assay used i n previous studies  was found to be  unsuitable for obtaining quantitative data on replication, a new form o f assay (see Figure 8, and as outlined in Materials and Methods) was carried out i n triplicate on these constructs. The raw data from these assays and the preliminary data analysis (preparation of standard curves, determination o f quantity o f viral and input sequences for each sample, and calculation o f R E , S R E , and S R R E values for all samples in each assay) is presented i n Appendix A . The pooled analyzed data from these assays is given in Table 4, and shown graphically in Figure 10. Results o f this set o f experiments clearly indicate three distinct regions o f the IRS which appear to contribute to replication competence. Mutations S2 and S7, S23, and SI all cause marked reductions in minigenome replication efficiency by replacing short sequence elements with unrelated sequences.  Mutation S7 causes a loss o f more than  50% o f replication competence, while mutations S2, S23, and SI all reduce minigenome replication efficiency by more than 75%. In all four cases the result is highly significant statistically, with p<0.01 o f the observed result being a random  56  Figure 8: Replication Assay  Simplified schematic representation of the replication assay. EcoRI-linearized minigenome attached to vector sequences is cotransfected into permissive cell line with NS-1 expression vector pCMVNS-1. Following growth (routinely for 48 hours) low molecular weight DNAs are isolated by Hirt extraction. If replication has occurred, nicking by NS-1 will have released minigenome sequences from associated vector sequences and minigenomes will outnumber associated pJBLR4.3 vector molecules; thus more sites for hybridization by JAVA probe will exist than for Vecpro probe. If replication has not occurred, minigenome and associated vector sequences will still be attached and will be in a 1:1 ratio; therefore JAVA and Vecpro probes will have an equal number of hybridization sites. Differential quantitation of the hybridization of these two probes thereby allows for a measurement of replication ability of a transfected minigenome. For a detailed description of assay technique and mathematical analysis of data derivedfromthis assay, see Materials and Methods section.  57  Clone pJBLR4.3S4* pJBLR4.3S5 pJBLR4.3S20 pJBLR4.3S2* pJBLR4.3S7 pJBLR4.3S8 pJBLR4.3S14 pJBLR4.3S3 pJBLR4.3S23 pJBLR4.3S22 pJBLR4.3Sl pJBLR4.3S25 pJBLR4.3S26 pJBLR4.3S15 pJBLR4.3S16 pJBLR4.3S17* pJBLR4.3S21 pJBLR4.3S12 pJBLR4.3S13 pJBLR4.3S18  Mutation with flanking sequences (4484 g g t t a c c a a c t g c t a c t g g a ( 4 5 0 3 ) ggttaccCAGATCTG--gga (4504 a a c a t g c a g t c t ( 4 5 1 5 ) CAGATCGATCTG (4514 tgtgccgc(4522) CAGATCTG (4523 t t a t a a c - ( 4 5 2 9 ) CAGATCTG (4530 a a g a c c t g t t g c t ( 4 5 4 2 ) aCAGATCTGtgct (4543 a g a a a t a c t t a c t ( 4 5 5 5 ) CAGATCTGttact (4556 a a c t a a c c a t g c t ( 4 5 6 8 ) CAGATCGATCTGt (4569 t t t t c t t t ( 4 5 7 6 ) CAGATCTG (4577 c t g t a c t t c a t a t ( 4 5 8 9 ) CAGATCGATCTGt (4590 a t t a t t a a g a c t ( 4 6 0 1 ) CAGATCTGgact (4602 aataaaga(4609) CAGATCTG (4610 tacaacata(4618) CAGATCTGa (4619 g a a a t a t a a t a t t ( 4 6 3 1 ) CAGATCGATCTGt (4632 a c a t a t a g a t t t a a g ( 4 6 4 6 ) CAGATCGATCTGaag (4647 a a a t a g a a t a a t (4658) CAGATCGATCTG (4656 a a t a t g g t a c t t a g ( 4 6 6 9 ) -CAGATCGATCTG(4669 g t a a c t g t t a ( 4 6 7 8 ) CAGATCTGta (4679 aaaataatagaacc(4692) CAGATCGAagaacc (4693 t t t g g a a t ( 4 7 0 0 ) CAGATCTG (4699 ataacaagatag(4710) CAGATCGATCTG  T a b l e 3: Scanner M u t a t i o n Sequences Twenty linker-scanning mutations are presented in order of sequence position. For each clone, the associated wild-type sequence is presented with the nt positions relative to full-length M V M of the first and last nt shown in brackets (top line). The same sequence region from the mutant is then presented in alignment, with the mutation indicated in upper-case type (bottom line). Three mutations (*) do not maintain exact spacing; dashes indicate placeholders in sequence to maintain wild-type spacing. The gap indicated in the wild-type sequence associated with mutation S 2 indicates that this inserts a single nucleotide relative to the wild-type sequence.  58  S4  S5  S2  S14  S8  cagatctg-cagatcgatctg cagatctg cagatctg cagatcgatctg ccaactgctactggaaacatgcagtctgtgccgcttataac-aagacctgttgctagaaatacttactaactaaccatgct cagatcc cagatctg S20  S3  S22  S7  SI  S26  S15  cagatctg cagatctg cagatctg cagatcgatctg cagatcgatctg ttttctttctgtacttcatatattattaagactaataaagatacaacatagaaatataatattacatatagattt cagatcgatctg cagatctg S23  S25  S16  S21  S12  S13  cagatcgatctg cagatctg cagatctg cagatctg aagaaatagaataatatggtacttagtaactgttaaaaataatagaacctttggaataacaagatagttagt —cagatcgatctg— cagatcgatctg S17  S18  F i g u r e 9: Overview of Scanner M u t a n t s Sequence of the native and linker-scanner substitution mutants of the IRS. Viral nt 4484 through 4715 are represented by the continuous central line of text, with the sequences modified in each of the linker scanning mutations being noted above or below their corresponding location in the native sequence. Notations in bold (i.e. S4) indicate the designation of the associated scanner mutation. Dashes (-) represent single nt gaps; that indicated in the wild-type sequence under mutant S2 indicates that this particular mutant introduces an extra base pair.  59  Clone pJBLR4.3S4 pJBL.R4.3S5 pJBLR4.3S20 pJBLR4.3S2 pJBLR4.3S7 pJBLR4.3S8 pJBLR4.3S14 pJBLR4.3S3 pJBLR4.3S23 pJBLR4.3S22 pJBLR4.3S1 pJBLR4.3S25 pJBLR4.3S26 pJBLR4.3S15 pJBLR4.3S16 pJBLR4.3S17 pJBLR4.3S21 pJBLR4.3S12 pJBLR4.3S13 pJBLR4.3S18  Assav 1 SRREAssav 2 SRRE/Assav 3 SRRE Averaae Std. Dev. Confidence 115% 132% 92% 11% 22% 109% 60% 140% 14% 77% 7% 101% 123% 63% 79% 84% 73% 121% 129% 106%  138% 99% 113% 12% 71% 107% 137% 132% 26% 146% 28% 120% 104% 152% 126% 130% 139% 172% 112% 198%  182% 161% 108% 26% 37% 111% 112% 195% 29% 173% 22% 98% 115% 108% 115% 111% 180% 131% 120% 118%  145% 131% 104% 16% 43% 109% 103% 156% 23% 132% 19% 107% 114% 108% 107% 108% 131% 141% 121% 141%  34% 31% 11% 9% 25% 2% 39% 34% 8% 49% 10% 12% 10% 45% 25% 23% 54% 27% 9% 50%  3  39% 36% 13% 10% 28% 3% 44% 39% 9% 56% 12% 13% 11% 51% 28% 26% 62% 31% 10% 57%  T a b l e 4: S c a n n e r M u t a t i o n S R R E V a l u e s  Pooled results of replication assays on linker-scanning mutations in Table 3. Mutations are ordered by location of the mutation within the IRS. Scaled Relative Replication Efficiencies (SRRE) values from three independant assays are given, their average, the standard deviation of the assays, and ( ) the 95% confidence interval on the reported average. For individual assay results see Appendix A . a  60  Linker-Scanner Mutation SRRE  S4 S5 S20 S2 S7 S8 S14 S3 S23 S22 S1 S25S26 S15 S16 S17 S21 S12S13 S18  Mutation  F i g u r e 10: Scanner M u t a t i o n S R R E Values Scaled Relative Replication Efficiency (SRRE) values for each of the linker-scanner mutations in the minigenome context. Mutations are arranged in order of location, and each is designated by 'S(x)' to indicate the corresponding linker scanning mutation as listed in Figure 2. Values graphed are the average of triplicate assays, with error bars indicating a 95% confidence interval.  61  observational effect. The fact that these observed replication deficits sum to greater than 100% has possible implications which are examined in the Discussion. Several o f the mutations demonstrate a weakly hypercompetent phenotype which is also statistically significant. The magnitude o f this was appreciably smaller than that of  the  replication-defective  mutations,  and  was  not  studied  further.  This  hypercompetence (and that observed with some point mutations, described below) is considered i n the Discussion.  Competitive  Replication  Assays  In an effort to compare more directly the replication competence o f the linkerscanner mutation containing minigenomes with the wild-type, competitive replication assays as described i n the Materials and Methods section were used. It was. hoped that by simultaneously replication  cotransfecting  competence  might  two be  minigenomic constructs, magnified  by  the  small differences  faster-replicating  in  construct  sequestering required replication machinery from the less efficient construct. While attempts were made to examine several o f the linker-scanning mutants (including both ones found to be replication defective and replication competent by the standard assay) with this technique, unacceptable levels o f cross-hybridization by the mutant-specific probe were encountered in most cases leading to the discontinuation o f this technique. Results with no detectable interference by nonspecific hybridization were however obtained for two constructs (pJBLR4.3S20 and pJBLR4.3S21) and are presented here for comparison with results from the standard assay.  62  R a w data from these assays  and preliminary data analysis is presented in Appendix B ; pooled analyzed data is presented i n Table 5. While the values obtained by this technique for the replication competence o f the mutant minigenomes examined relative to that o f wild-type are not identical with values obtained for the same mutants with the standard assay, the differences observed are not beyond what might be expected by experimental error and are thus not considered significant. The relatively better replication o f pJBLR4.3S21 than p J B L R 4 . 3 S 2 0 noted i n the regular assay is also apparent i n these assays, suggesting that replication trends noted in the standard assay are mirrored i n the competition assay.  Given the technical  difficulties encountered i n the competition assays and the fact that only two mutants were sucessfully examined by this technique, no further conclusions can be based on these assays.  Bandshift  studies  Previous studies to analyze interactions o f host-cell nuclear factors with sequences from the region o f the IRS employed two restriction fragments, known as Rsa ' A ' (viral nt 4431-4579) and Rsa ' B ' (viral nt. 4580-4662) as probes for gel-retardation assays. Results with an L A 9 cell nuclear extract indicated the formation o f several specific complexes on each probe, and cross-competition experiments indicated that at least some o f the complexes formed were identical between the two probes.  One o f these common  complexes was partially purified and footprinting performed, revealing a bipartite area o f 79  protection on both strands .  63  Sample Quantitation, S20 Competition Replication Assay Sample ngS20  1 2 3  44.38 30.90 45.10  ngWT  Ratio S20/WT  59.48 48.48 59.76  75% 64% 75%  Average: Std. Dev: Confidence:  71% 7% 7%  Sample Quantitation, S20 Competition Replication Assay Sample ngS21  1 2 3  73.58 49.42 51.48  ng WT  Ratio S20/WT  42.29 24.22 27.20  174% 204% 189%  Average: Std. Dev: Confidence:  189% 15% 17%  Table 5 : Results of Competitive Replication Assays Pooled analyzed data from competition replication assays on clones pJBLR4.3S20 and pJBLR4.3S21. Total ng of mutant and wild-type plasmid DNA detected are reported, the ratio of them the replication efficiency of the mutant as compared to wild-type minigenome, along with the average, standard deviation, and 95% confidence interval resulting from 3 assays.  64  In order to localize further sites o f protein-DNA interaction within the IRS the elements o f the linker-scanning library were examined by competition bandshift assay as detailed i n the Materials and Methods section.  Bandshift experiments were originally  carried out with a probe corresponding to the entire region o f interest as a BstEII - B a m H l fragment from each o f the respective minigenomic clones. Use o f such a large probe resulted  i n the  formation o f extremely  large complexes  which  failed  to  enter  polyacrylamide gels. Other gel matrices were tested but found to give poor resolution. Tentative results obtained with agarose/glycerol gels indicated the formation o f a single extremely large complex, and indicated that this complex was only interacting with sequences near the middle o f the IRS (data not shown). Based on these experiments the region was divided into three shorter overlapping fragments o f approximately equal size (BS, 2021, and S B probes, see Materials and Methods and Figure 11) whose endpoints were chosen so as to be well away from any suspected interactions.  The smaller size o f  these probes allowed for clear resolution o f the complexes formed on polyacrylamide gels.  Each linker scanning mutation was analyzed in the context o f only one o f these probes such that none o f the mutations were tested near the end o f a probe fragment (see Materials and Methods). Scanner mutants interfering with a host factor binding site are observed by a loss o f ability to compete with a radiolabeled wild-type probe for binding by factors i n a nuclear extract, and thus show a retention o f shifted bands present i n the control sample without competitor.  65  Rsal ' A '  Rsal ' B '  Rsal 4431  Rsal  Rsal  —I—  —I—  4489  4636 S2S7  S23  S8  BamHl 4695  SI  4777 Replication defects  S22S1S25S26  H O  = Complex B = Complex A  Host-factor binding sites  BS Probe 2021 Probe SB Probe  Bandshift probes  Figure 11: Relative Location of Bandshift Probes Schematic representation of the IRS region and location of sequence elements observed in this study. Upper line represents sequence of IRS (Element A is nt. 4489-4636, Element B is nt. 4637-4695) plus nearby flanking regions. Location of Rsal sites delimiting RsaI"A" and " B " fragments are indicated, with the fragments being marked by name. Linker scanning mutations causing loss of minigenome replication competence are indicated by number and shown as shaded boxes at their relative positions along the next line. The third line indicates the location of linker scanning mutations interfering with the binding of host-cell factors; linkers are marked by number and shaded according to whether they interfere with the binding of complex 2021-A ("Complex A " ) or 2021-B ("Complex B"). Bottom section of the diagram indicates the fragments used as bandshift probes (see text).  66  Examination o f the leftward side o f the IRS using the B S fragment (see Figure 12) reveals the formation o f two specific complexes ( B S - A and B S - B ; other smaller complexes are not competed by any o f the competitors and appear to be non-specific interactions). Both o f these complexes are competed equally well by a 40-fold excess o f unlabelled wild-type or mutant B S fragment, indicating that none o f the bands observed arise from interactions i n the sequences mutated in scanners S4, S5, S20, S2, or S7. The central region was examined with the 2021 probe, which also was found to form two distinct specific complexes (2021-A and 2021-B, at approximately the same mobilities as B S - A and B S - B ; see Figure 13).  Both complexes were effectively  competed for by a 40-fold excess o f several o f the mutant competitors examined with this probe. However competitor 2021-S8 failed to compete for the binding o f complex 2021B ; competitors 2021-S22 and 2021-S26 lost ability to compete for the binding o f complex 2021-A, with the S22 mutation having the least competition activity; and adjacent-mutation competitors 2021-SI and 2021-S25 had a reduced ability to compete for binding o f complex 2021-B. The appearance o f a number o f faint, smaller shifted forms i n the presence o f competitors S8, S26, and S15 is most likely due to partial formation o f the disrupted species.  O f note is that i n each case where there is a loss o f competition for one o f the complexes there appears to be a weaker loss o f competition for the other o f the two complexes as well; the implications o f this observation w i l l be considered i n the Discussion.  67  No No N E comp wt  S4  S5 S20 S2 S7  Figure 12: BS Bandshifts Competition bandshift assays performed on BS probes of linker scanner mutations S4, S5, S20, S2, and S7. Lane marked 'No N E ' contains no nuclear extract, lane marked 'No comp' contains no competitor fragment, lane marked 'wt' contains a 40-fold excess of unlabelled wild-type competitior, and lanes marked 'S(x)' contain a 40-fold excess of the respective linker-scanning mutation derived competitor fragment. ' B S - B ' and ' B S - A ' indicate specific complexes ' A ' and ' B ' obtained with this probe, 'ns' indicates a non-specific interaction.  68  No No NE comp wt S8 S14 S3 S23 S22 SI S25 S26 S15  F i g u r e 13: 2021 Bandshifts Competition bandshift assays performed on 2021 probes of linker scanner mutations S8, S14, S3, S23, S22, SI, S25, S26, and S15. Lane marked 'No N E ' contains no nuclear extract, lane marked 'No comp' contains no competitor fragment, lane marked 'wt' contains a 40-fold excess of unlabelled wildtype competitior, and lanes marked 'S(x)' contain a 40-fold excess of the respective linker-scanning mutation derived competitor fragment. '2021-B' and '2021-A' indicate specific complexes ' A ' and ' B ' obtained with this probe, 'ns' indicates a non-specific complex.  69  Examination o f the region towards the 5' viral termini with the S B probe (see Figure 14) reveals the formation o f two specific complexes S B - A and S B - B . The S B - B complex is by far the stronger o f the two complexes formed, with only a small fraction o f probe existing i n the S B - A complex. Both complexes are competed for equally by an excess o f unlabelled wild-type or mutant probe, indicating that none o f the scanner mutants from S I 6 to S18 interfere with host factor binding sites. In the case o f all three probes, a distinct band (indicated as 'ns' in Figure 12, Figure 13, and Figure 14) becomes apparent only i n the presence o f competitor. Based on the observations that this band was not present without competitor, and that none o f the mutations examined as competitors resulted in any apparent variation in this band, it was tentatively assigned as being due to a non-specific interaction.  Presumably,  displacement o f labelled probe from the A and B specific complexes allowed for its lower-affinity interaction with this species.  A t least one other interpretation o f the  observed data was plausible, however; the 'ns' species might be a partially-formed subunit o f either the A or B complex.  In this model, addition o f competitor would  effectively dilute out the proteins contributing to the formation o f the A and B complexes, resulting i n a population o f probes each bearing monomers or small subsets o f the larger complexes. The lack o f variation i n the 'ns' band between competitor samples could be accounted for by its component(s) having a distributed binding over the I R S , such that no one mutation greatly interfered with its capacity to form.  70  No No NE comp wt S16 S17 S21 S12 S13 S18  F i g u r e 14: S B Bandshifts Competition bandshift assays performed on SB probes of linker scanner mutations SI6, SI 7, S21, S12, S13, and S18. Lane marked 'No N E ' contains no nuclear extract, lane marked 'No comp' contains no competitor fragment, lane marked 'wt' contains a 40-fold excess of unlabelled wild-type competitor, and lanes marked 'S(x)' contain a 40-fold excess of the respective linker-scanning mutation derived competitor fragment. ' S B - B ' and ' S B - A ' indicate specific complexes ' A ' and ' B ' obtained with this probe, 'ns' indicates a non-specific interaction.  71  In order to discriminate between these possibilities an experiment was performed in which competitors (both specific and non-specific) were titrated for their ability to compete with the formation o f the A , B , and ns bands across a wide concentration range relative to probe. Shifted species arising from specific interactions should be competed to a greater extent by specific competitor than by non-specific; use o f a wide concentration range ensures that effective levels of competitor are achieved. Specific competitor was the 2021 probe; as non-specific competitor a P C R product o f 93 bp was generated using forward and reverse sequencing primers and p U C 1 9 as template.  For this particular  experiment, competitor fragments were purified by ethanol precipitation i n the presence of ammonium acetate rather than gel isolation in order to minimize loss o f product. Quality o f the purified competitors was verified by agarose gel electrophoresis and ethidium bromide staining. Results o f this experiment (see Figure 15) indicate that the original assignment o f ' A ' and ' B ' as specific complexes, and 'ns' as a nonspecific interaction, are valid. The ' A ' and ' B ' complexes are competed to a much greater extent by specific probe than by non-specific probe, whereas there is no apparent difference in the ability o f the two probes to compete for formation o f the 'ns' species. Examination o f the specific shifted species observed with each o f the three probes shows that there is an apparent comigration o f the B S - A , 2021-A, and S B - A complexes, and o f complexes B S - B , 2021-B, and S B - B . If as is suggested by the data from the 2021 probe the major binding sites lie under S8 and S22 with weaker sites under S I , S25, and S26, consideration o f the endpoints o f the probes used in this assay lends credence to the  72  2021 pUC-NSC No No ^ ^ ^ | N E comp 20 50 400 20 50 400  [fold excess of competitor  F i g u r e 15:Competitor T i t r a t i o n of Bandshifts Titration of shifted species observed with L A 9 nuclear extract and 2021 bandshift probe with varying excess of specific competitor (2021) or non-specific competitor (pUC-NSC). ' A ' and ' B ' species are effectively competed for by a 20-fold excess of specific competitor but not non-specific competitor; 'ns' species is competed for equally by both competitors at all concentrations.  73  supposition that this comigration is not coincidental. Both the B S and 2021 probes contain all o f these sites, and the S B probe's left end is coterminal with the observed weak site under S25 and S26 (see Figure 11, bottom section). Given that all three probes employed are o f approximately the same size one would predict that identical complexes should migrate approximately equally within the resolution o f the employed assay. While the proximity o f these two major binding sites (under S8 and S22) to sequences determined to be important for replication suggested a possible correlation between binding o f host-cell factors and replication competence, the lack o f any apparent replication deficit in either o f these mutations appears to contradict this. A s the bandshift data however suggests a co-operative interaction between the factors binding at these sites, it was hypothesized that each o f the single mutants might still be competent to localize the entire set o f factors necessary in replication and thus not appear replication defective with the assay employed.  Studies on a dual-mutant minigenome Results o f the bandshift experiments indicated the presence o f several distinct binding sites for host factors, and i n all cases these binding sites were directly adjacent to or overlapping with sequences indicated to be important in minigenome replication. This suggested a possible correlation between these activities, despite the fact that neither o f the mutations which caused a major loss in binding o f host-factor activity (mutation S8 for complex 2021-B, mutation S22 for complex 2021-A) apparently compromised minigenome replication. In order to try to address whether the coincidence o f sequences important i n minigenome replication (S2 and S7, S23, and S I ) with those binding host-  74  cell factors (especially S8 and S22).is biologically relevant, a dual-site scanner mutant was constructed in which the major binding sites for complexes 2021-A (under scanner mutation S22) and 2021-B (under scanner mutation S8) were simultaneously substituted. Replication assays carried out on this mutant are summarized i n Table 6. Strikingly, while either o f these linker-scanner mutations individually has no detectable effect on minigenome replication efficiency, the dual-site mutant can only replicate at approximately 20% o f the level o f the unmutated minigenome, approximately the same basal level as observed with the S2, S23, and SI mutations. A s w i l l be further considered in the Discussion, this result strongly suggests a direct role o f the bound host factors i n stimulating replication functions o f the I R S , and furthermore supports a co-operativity o f host factor binding previously suggested by the bandshift results. This dual-site mutation was also examined by competition bandshift assay with the 2021 probe. A s each o f the single mutations alone had demonstrated a distinct loss i n binding activity it was expected that the dual mutation should fail to compete for either the 2021-A or 2021-B complexes; however results with this competitor (see Figure 16) indicate that it is capable o f effectively competing for formation o f the ' B ' complex and retains at least some competition activity towards formation o f the ' A ' complex.  While  there is no obvious explanation for this unexpected observation it is suggestive o f a high degree o f complexity in the interactions controlling factor binding.  75  Clone  Assav 1 SRRE Assav 2 SRRE Assav 3 SRRE Average  pJBLR4.3S8/22  18%  26%  18%  Std. Dev. Confidence "  20%  4%  5%  Table 6: Dual-mutant S R R E Values Pooled results of replication assays on dual-mutant minigenome pJBLR4.3S8/22. Scaled Relative Replication Efficiencies (SRRE) values from 3 independant assays are reported, their average, standard deviation, and ( ) the 95% confidence interval on the average. For individual assay results see Appendix A. a  -(-2021-B <-2021-A  <-ns  <— Free probe  F i g u r e 16:Dual-Site mutant competition bandshift Competition bandshift assays performed on 2021 probe of dual linker scanner S8/22. Lane marked 'No N E ' contains no nuclear extract, lane marked 'No comp' contains no competitor fragment, lane marked 'wt' contain a 40-fold excess of unlabelled wild-type competitior, and lane marked 'S8/22' contain a 40fold excess of the 2021 S8/22 competitor fragment. '2021-A' and '2021-B' indicate specific complexes ' A ' and ' B ' obtained with this probe, 'ns' indicates a non-specific interaction.  76  Studies on point mutants A s scanner mutation S1 was shown to have an effect on minigenome replication competence as well as being the site o f binding o f a host cell factor, it was desirable to identify which nucleotides within this 8 bp segment contribute to these properties.  To  examine this, single nucleotide point mutations were made at each o f the six bases altered in the scanner mutation, converting the wild-type base to that present i n the scanner mutant individually (see Table 7).  These mutations were then assayed both for  replication competence in a minigenome-based assay (summarized in Table 8), and for ability to interact with host-cell nuclear factors by bandshift assay (see Figure 17). While two o f the point mutations ( A 6 C and T8G) appear to lose some competition ability towards the formation o f both the ' A ' and ' B ' complexes and thereby indicate that these nucleotides likely make direct contributions to binding o f the complex, none o f the point mutations display a detectable replication defect. A s with the linker scanning mutations, some o f the point mutations  (notably C 2 A and T8G) demonstrate a replication  hypercompetence; this observation was not further studied.  Studies on Full-length Virus In order to address the question o f whether the replication-defective phenotype exhibited by some o f the linker-scanner mutants in the context o f the minigenomic assay system was relevant i n the context o f whole virus, the S1 mutation was introduced into the full-length infectious clone o f M V M (pCA4.0) to make p C A 4 . 0 S l .  This mutation  was chosen for its observed effect on both replication competence and factor binding. To examine the replication competence o f this construct relative to the wild-type virus, both 77  Clone pJBLR4.3TlC pJBLR4.3C2A pJBLR4.3T3G pJBLR4.3T4A pJBLR4.3A6C pJBLR4.3T8G  Mutation with flanking sequences (4602)aataaaga(4609) aataaagG (4602)aataaaga(4609) aataaaTa (4602)aataaaga(4609) aataaCga (4602)aataaaga(4609) aataTaga (4602)aataaaga(4609) aaGaaaga (4602)aataaaga(4609) Cataaaga  Table 7: Point mutant sequences Six point mutations are presented in order of sequence position. For each clone, the associated wild-type sequence is presented with the nt positions relative to full-length M V M of the first and last nt shown in brackets (top line). The same sequence region from the mutant is then presented in alignment, with the mutation indicated in upper-case type (bottom line).  78  Clone pJBLR4.3TlC pJBLR4.3C2A pJBLR4.3T3G pJBLR4.3T4A pJBLR4.3A6C pJBLR4.3T8G  Assav 1 SRREAssav 2 SRREAssav 3 SRREAverage Std. Dev. Confidence " 100% 166% 105% 97% 112% 136%  92% 123% 125% 109% 87% 137%  94% 135% 129% 109% 166% 131%  95% 141% 120% 105% 122% 135%  4% 22% 13% 7% 41% 3%  5% 25% 14% 8% 46% 3%  T a b l e 8:Point M u t a n t S R R E Values Pooled results of replication assays on linker-scanning mutations in Table 7. Mutations are ordered by location of the mutation within the IRS. Scaled Relative Replication Efficiencies (SRRE) values from three independant assays are given, their average, the standard deviation of the assays, and ( ) the 95%) confidence interval on the reported average. For individual assay results see Appendix A. a  79  F i g u r e 17: P o i n t mutant competition bandshifts Competition bandshift assays performed on 2021 probes of point mutations T I C , C2A, T3G, T4A, A 6 C , and T8G. Lane marked 'No N E ' contains no nuclear extract, lane marked 'No comp' contains no competitor fragment, lane marked 'wt' contains a 40-fold excess of unlabelled wild-type competitior, and lanes marked with a point-mutant designation contain a 40-fold excess of the respective point mutation derived competitor fragment. '2021-A' and '2021-B' indicate specific complexes ' A ' and ' B ' obtained with this probe, 'ns' indicates a non-specific interaction.  80  clones were transfected into L A 9 cells and viral lysates were prepared (see Materials and Methods). Lysates were titred by plaque assay on L A 9 cells. N o reproducible difference in titre between the wild-type and mutant virus was observed i n these studies (data not shown). During these experiments a definite difference in cytopathogenicity o f the w i l d type as compared to the mutant virus was noted.  Examination 24 hours post-shock  revealed dishes transfected with wild-type virus to have fewer live cells than those transfected with SI mutant virus. In addition, the morphology o f the two cell populations appeared different, with many cells in the wild-type samples having an abnormally elongated or sickled shape as compared to cells in the SI mutant virus samples (see Figure 18).  While these observations are only qualitative, this effect was observed  reproducibly and suggests the SI mutation has an effect on viral pathogenesis when introduced into full-length virus.  Evidence for the IRS as a leading-strand only origin The presence o f elements contributing to viral replication in the location o f the IRS on the viral genome lead to a consideration o f what their possible role i n viral replication might be.  Considering the simplified replication model shown in Figure 4,  one possibility was that the elements  in the IRS contribute to the  5' terminal  rearrangements from extended to paired hairpins shown in steps 4 and 8. Given that the length o f the viral 5' palindrome is 206 base pairs o f which 200 can participate i n a stably base-paired hairpin, there exists a prohibitively high thermodynamic barrier to its spontaneous  interconversion  between  81  the  forms  under  F i g u r e 18: Differential C P E of W i l d - T y p e and S I V i r u s Photomicrographs (microscope magnification 200 x, photographic enlargement ~3 x) of dishes of L A 9 cells 24 hours post DMSO-shock after being transfected with either wild type infectious clone pCA4.0 (Panel A ) or S1 mutant infectious clone (Panel B). Dishes were seeded identically and cell density and morphology were indistinguishable between dishes prior to transfection.  82  physiological conditions. N o satisfactory model for this has yet been proposed. A model which incorporates the observed findings in the IRS and simultaneously provides a mechanism for this terminal rearrangement is presented in Figure 19(a). A n origin o f D N A replication inboard o f the 5' palindromic sequences generates two leading strands o f nascent D N A and thereby displaces one strand o f the extended palindrome, thus allowing self-annealing into a hairpin conformation to occur spontaneously.  As  mentioned i n the Introduction, a similar model was proposed by Rhode and Klaassen i n 78  1982 ; however a critical difference between the models is that Rhode and Klaassen proposed both leading and lagging strand synthesis outward from the origin.  The  importance o f this difference becomes apparent when one considers the effect that Okazaki fragments produced between the origin and the extended 5' palindrome termini might have on the proposed terminal rearrangement step. A n y such Okazaki fragments extending into the palindromic region would effectively block the complete formation o f the terminal hairpin and thus not allow the viral m R F ' s free 3' hydroxyl to act as a primer for synthesis to d R F (see Figure 19(b)). In order to test this model it was considered advantageous to examine only the right-hand viral telomeric sequences as an isolated system. A s studies  conducted  70  previously , and up to this point in the current study, all examined the IRS in the context o f either a minigenome or full-length virus they have been complicated by the unknown effect o f the presence o f what appears to be another (albeit weak) origin within the lefthand viral telomere. Furthermore, all evidence for the function o f the IRS as an origin o f  83  Figure 19: Leading-Strand Only Model for Hairpin Rearrangement Unidirectional initiation model for action of the IRS to allow for rearrangement of viral 5' termini from extended to hairpin conformation. Panel (a) represents the model as described in text; panel (b) the Rhode and Klaassen model where presence of a lagging strand would interfere with hairpin formation and lead to incomplete replication of template. Solid lines with arrows indicate nascent leading strands; dashed lines with arrows indicate nascent lagging strands. 72  84  replication has come from studies whereby the replication competence o f the system is compromised by alterations to sequences within the IRS. If the IRS is i n fact a canonical origin of replication it should be possible to isolate it from the putative left-hand viral ori sequences and use it to drive replication o f unrelated D N A sequences. Such a system would allow both for an examination o f the IRS elements uncomplicated by effects from the left-hand viral ori, and allow for a positive demonstration o f the ori function of the IRS. That such a system should be feasible was suggested by prior results with a chimeric minigenome consisting o f two right-hand viral telomeres joined at their inboard ends; when supplied with NS-1 i n trans, 70  this construct  ( p P T R R ) was replication competent  . Interestingly, however,  other  preliminary studies from our lab with the isolation o f the IRS on a circular plasmid lacking a eukaryotic origin o f replication failed to detect any evidence for plasmid 89  maintenance i n L A 9 cells . Construct p J B R l (see Figure 20) was used to examine i f the isolated IRS is able to act as an origin o f replication, and i f so whether it acts in a canonical eukaryotic leading and lagging strand fashion or in the hypothesized leading-strand only manner. Sequences downstream o f the IRS as far as the genome 5' end were maintained on the construct for two reasons: firstly it was considered possible that as-yet uncharacterized sequence elements within this region might be required for the postulated origin function, and secondly the hypothesized leading-strand only model requires a terminal palindrome; retention o f the existing viral sequence was simpler than replacing it with an unrelated palindrome o f similar size.  85  F i g u r e 20: p J B R l Deletion of the Xbal-Nhel fragment of pJBLR4.3 creates pJBRl. Both constructs are shown as 'inserts' in the context of associated vector plasmid; both are linearized at the EcoRI site prior to transfection.  86  Models o f NS-1 function in M V M replication up to this point have only pointed to its having roles i n the resolution o f dimer bridges between viral concatamers, and i n the process o f hairpin transfer; it was not believed to play a direct role in the action o f either viral origin o f replication. It was thus not predicted to be absolutely required for replication o f p J B R l , although the products o f the Leading-Strand Only ( L S O ) model without N S - 1 present should be concatameric.  Figure 21 diagrams what the predicted  replication products o f either the L S O or a leading- and lagging-strand origin, i n the presence o f N S - 1 , should be.  Notably, for a linear replicon such as EcoRI digested  p J B R l , a bidirectional origin with both leading and lagging strands should produce a uniform set o f products starting at the size o f the input plasmid and getting progessively smaller with each successive round o f replication by an inability o f the plasmid termini to replicate fully while a bidirectional L S O origin should lead to the production o f three distinct species ([1], [4a], and [4b] o f Figure 21). The replication competence o f p J B R l in both the presence and absence o f N S - 1 was analyzed by transfection o f EcoRI linearized plasmid into C O S - 7 cells with and without the cotransfection o f p C M V N S - 1 .  The standard D E A E - D e x t r a n protocol was  employed, and transfected cells were allowed to grow for 48 hours post D M S O shock before Hirt extraction.  The extracted D N A s were analyzed by D p n l digestion and  Southern blotting with a random-primed probe for virally-derived sequences (the X b a l E c o R I fragment o f p J B R l was used as template). Figure 22.  87  Results o f this study are shown i n  Leading and lagging strands  Leading strand only (LSO) model  4a  Re-initiation leads to rounds o f terminal loss and subsequent deletion o f IRS and ori function.  4b NS-1 nick  Figure 21:Predicted replication products of pJBRl  Proposed replication products of pJBRl construct for an origin generating both leading and lagging strands (left) or leading strands only (right). Solid lines represent pre-existing or nascent leadingstrand DNA, dashed lines represent nascent Okazaki fragments. Regions indicated in bold are the palindromic terminal sequences. Leading and lagging strand synthesis will block hairpin formation and result in a population of double-stranded linear molecules with incompletely replicated termini ([3], left side). Synthesis of a leading strand only will allow hairpin formation ([3], right) and result in three distinct populations of molecules ([4a], [4b], and [1]) in the presence of NS-1. In the absence of NS-1, [4b] can re-initiate replication to form a dimeric intermediate.  88  F i g u r e 22: p J B R l Replication Products COS-7 cells were transfected with EcoRI linearized pJBRl with or without pCMVNS-1 and grown for 48 hours prior to Hirt extraction. 5 ul aliquots of Hirt extract were treated as listed below and run on a 1% agarose gel, followed by vacuum transfer to Hybond-N and Southern blotting with a randomprimed probe directed against virally-derived sequences (Xbal to BamHI fragment of pJBLR4 corresponding to viral 5' terminus). Lane #:Plasmids transfected. treatment of Hirt extract (Lane 1: B R L lkb ladder.) Lane 2: p J B R l , undigested. Lane 3: p J B R l , Dpnl digested. Lane 4: p J B R l + p C M V N S - 1 , undigested. Lane 5: p J B R l + p C M V N S - 1 , Dpnl digested. In Lane 5, three distinct forms are tentatively identified as Form 1, Form 4b, and Form 4a (see text and Figure 21) based on mobilites relative to size markers (Lane 1).  89  In the absence o f NS-1 (lanes 2 and 3) no replication to full-length species is observed. While lane 2 contains a single band corresponding to linear input plasmid, its disappearance i n lane 3 demonstrates its D p n l sensitivity and thus lack o f replication. (Faint higher molecular weight bands present i n Lane 2 are trace amounts o f incompletely digested plasmid). O f the two bands present in lane 3, the upper is attributable to a D p n l digestion product o f full-length input plasmid; the other however is not readily identifiable and most likely arises from an abortive replication initiation event, the probable cause o f which w i l l be considered in the Discussion. Although not successful in fully replicating the construct, this results in hemimethylation and thus D p n l resistance  90  of an additional region o f the plasmid. In contrast, the presence of NS-1 (lanes 4 and 5) allows for effective replication leading to the formation o f three additional D p n l resistant bands (lane 5) than are not present without N S - 1 . The largest o f these is tentatively assignable as full-length plasmid (Form 1 from Figure 21) based on its equal mobility to input plasmid (lane 2). The next two smaller species, observed only when NS-1 is present, are tentatively assigned as Forms 4b and 4a (Figure 21) based on mobility. single-stranded  regions  may  under  some  (While D N A species with extended  circumstances  demonstrate  decreased  electrophoretic mobility relative to an equal length double-stranded species, previous results with M V M indicate that single-stranded minigenomes migrate more quickly than 70  do the duplex m R F forms  ; thus by analogy form 4a is predicted to exhibit greater  mobility than does form 4b). The two smallest forms present appear to be analogous to those i n lane 3, with one being a fragment o f unreplicated input plasmid and the other  90  being a failed replicative intermediate. There is an apparent loss o f size on the larger o f these two species, which may be attributable to NS-1 catalyzed nicking o f the band. Several observations, some o f them unexpected, can be made from the results o f this experiment. Firstly, the right-hand end of the M V M genome from the IRS through the terminal palindrome appears to be a true origin as under the correct conditions it is capable o f driving the replication of the attached plasmid sequences. Secondly, it appears that the viral NS-1 protein is required in some direct manner at this origin; complete plasmid replication is only observed i f NS-1 is available in trans. A s w i l l be considered in the Discussion however, this particular observation may be an artifact o f the test system. Thirdly, comparison o f the replicated ( p J B R l + p C M V N S - 1 ) samples versus the unreplicated samples ( p J B R l alone) show the formation o f three distinct D N A species, as would be predicted exclusively by the L S O origin model presented here.  Under no  conditions tested did the construct replicate to form a set o f near full-length species with serially decreasing terminal lengths as predicted by a leading and lagging strand model. The L S O model makes predictions regarding the form o f each o f these three D N A species. In order to examine whether the observed products had the predicted forms (1, 4b, and 4a from Figure 21) the Hirt extract from C O S - 7 cells cotransfected with E c o R I linearized p J B R l and p C M V N S - 1 was examined by two-dimensional neutral/alkaline agarose gel electrophoresis, transfer to hybridization membrane, and probing with viral sequences as detailed in the Materials and Methods. presented i n Figure 23.  91  Results o f this experiment are  In this form o f analysis, linear duplex species are resolved as a curving diagonal band; species above the diagonal in the second dimension arise from folded D N A molecules i n which the single strands are longer than the duplex form, while species below the diagonal in the second dimension arise from duplex molecules in which the single strands are o f less then unit length. Form 1 D N A would thus be predicted to run on the diagonal, Form 4b D N A should run above the diagonal, and Form 4a should resolve into two spots, one above the diagonal and one below the diagonal (this assumes that the F o r m 4a species w i l l be retarded under neutral conditions by the single-stranded extension to some point between the duplex mobility o f either o f its two constituent strands).  The Form 2 intermediate would only be expected to be present i n small  amounts, and should form a continuous arc above the duplex diagonal. Examination o f Figure 23 demonstrates the presence o f all o f these forms with the exception o f the small strand o f Form 4a. Form 1 can be distinguished as lying on the duplex diagonal.  The Form 4b band, predicted to be a single large palindrome and  running at something slightly less than full-length plasmid under neutral conditions, is resolved as a continuous set o f species ranging from dimer-length single strands down to sub unit length species; most o f the signal is o f sub unit length. Consideration o f the L S O model suggests that i f the ligation step was slow and a variable degree o f displacement synthesis occurs during F o r m 4b synthesis (see lower strand o f Panel 3, Figure 21) all o f these forms could be expected. The Form 4a band, predicted to be mostly single-stranded unit length with a short double-stranded region at one termini, resolves into a single spot above the duplex diagonal arising from the longer o f its two strands. While the shorter o f  92  4072  Figure 23: 2D Neutral-Alkaline Analysis of p J B R l Replication Products Two-dimensional neutral-alkaline gel analysis of pJBRl + pCMVNS-1 Hirt extract. Hirt extract was run in first dimension in 1% agarose/TAE gel matrix next to a size standard (approximate mobilites as marked) prior to lane excision, soaking in 50mM N a O H / l m M E D T A for 45 minutes, and pouring of a 1% alkaline gel below the excised lane. This gel was then run in 50mM N a O H / l m M E D T A at 2 V/cm for 7 hours, vacuum transfered to Hybond-N membrane, and Southern blotted for viral sequences. As a standard, B R L lkb ladder was denatured in alkaline gel loading buffer and run from a well even with the lower edge of the sample lane; weak cross-hybridization to these sequences allows for size estimation in the second dimension (as marked). Species tentatively identified as Form 1, Form 4b, and the longer strand from Form 4a are indicated (see text).  93  the two bands is not visible here, the l o w abundance o f the longer strand suggests that the signal from the shorter strand may merely be too weak for clear detection above background. Signals arising from discrete species which run at larger than unit length i n the first  dimension probably arise  from  a heterogeneous  population o f replicative  intermediates (Form 3 from Figure 21) which due to their forked nature run anomalously large under nondenaturing conditions. Having demonstrated that the IRS and its associated terminal sequences were capable o f driving plasmid replication i n a system independent o f the viral left-hand origin, it was decided to analyze the linker-scanning mutations which compromised minigenome replication efficiency in the context o f this isolated system.  Accordingly,  constructs p J B R l S l , p J B R l S 2 , p J B R l S 7 , p J B R l S 2 3 , and p J B R l S 8 / 2 2 were all made (from the respective linker-scanner mutant p J B L R 4 . 3 derivatives in a manner analogous to that for p J B R l , see Materials and Methods) and analyzed for replication competence by D p n l resistance assay. Following transfection into C O S - 7 cells either in the presence or absence o f p C M V N S - 1 for 48 hours, Hirt extracts were prepared, digested with D p n l , and analyzed by Southern blotting for virally-derived sequences. The results (see Figure 24) indicate that all o f the mutations render the p J B R l construct replication incompetent. A s further considered i n the Discussion, this has implications on the function o f the sequences replaced by replication-defective mutants.  94  12  3  4  5  6  7  *  m w i$  8  9  10 11 12 13  4072-> 3054-> 1636—>l  «  506-»  F i g u r e 24: Replication of p J B R l S ( x ) Scanner Mutations  COS-7 cells were transfected with pJBRl and its linker scanner derivatives with or without pCMVNS-1 and allowed to grow for 48 hours prior to Hirt extraction. 5 ul aliquots of Hirt extract from each transfection were digested with Dpnl and run on a 1% agarose gel, followed by vacuum transfer to Hybond-N membrane and Southern blotting with a random-primed probe directed against virally-derived sequences (pJBLR4 Xbal-BamHI fragment, viral 5' terminus). Lane #:Plasmids transfected (Lane 1: B R L 1 kb marker) Lane 2: p J B R l Lane 3: p J B R l + pCMVNS-1 Lane 4: p J B R l S l Lane 5: p J B R l S 1 + p C M V N S - 1 Lane 6: pJBRlS2 Lane 7: p J B R l S 2 + p C M V N S - 1 Lane 8: pJBRlS7 Lane 9: p J B R l S 7 + p C M V N S - 1 Lane 10:pJBRlS23 Lane H : p J B R l S 2 3 + pCMVNS-1 Lane 12:pJBRlS8/22 Lane 13:pJBRlS8/22+ pCMVNS-1 Presence of Dpnl resistant forms in Lane 3 (pJBRl + pCMVNS-1 sample) are indicative of replication.  95  One-hybrid screen In an effort to identify some o f the host-cell nuclear factor(s) interacting with the IRS a yeast genetic one-hybrid screen was employed. This technique, as first employed by Wang and R e e d , takes advantage o f the fact that for many transcriptional activators 91  D N A - b i n d i n g and transactivation activities are separable. A reporter gene (generally an auxotrophic marker) is placed downstream o f a minimal promoter such that without transactivation o f the promoter little or no transcription o f the reporter is observed.  A  'bait' sequence consisting o f D N A which is a recognition site for the unknown cellular protein is cloned directly upstream o f this minimal promoter, usually i n the form o f a tandem multimer to improve binding affinity. A library consisting o f c D N A s fused to a nuclear localization signal and a transactivation domain is then transformed into the cell line harboring the reporter, and transformants screened for expression o f the reporter gene. In theory, transactivation and gene expression should arise when a c D N A encoding the bait sequence's cognate D N A binding domain is fused in-frame to the library vector's transactivation domain. The D N A binding activity o f the cDNA-derived portion o f the fusion polypeptide acts to localize the transactivation domain o f the fusion in close proximity to the reporter's minimal promoter and enhances transcription, resulting i n detectable gene expression.  A s employed here, the system uses both auxotrophic  selection (HIS3) and a secondary reporter (P-galactosidase) to minimize the number o f false positive transformants observed. A s linker-scanning mutation S1 was the only one shown to simultaneously affect both replication competence and host-cell factor binding capacity, the sequences replaced  96  in this mutation plus the two flanking nucleotides from each side were chosen as a suitable bait sequence.  A n oligonucleotide duplex containing a tetramer o f this bait  sequence was cloned upstream o f a His3 gene (creating p H i s - i / S l ) and also upstream o f a P-galactosidase gene (creating p L a c Z i / S l ) . These clones were integrated into yeast strain Y M 4 2 7 1 to create Y M L H S 1 as a dual-reporter construct.  (See Methods and Materials  for construction details). A  mouse  11-day  whole embryo  cDNA  fusion library was  screened  by  transformation into Y M L H S 1 and selection for histidine prototrophy. Out o f 2.49 x 10  6  clones, a total o f 11 primary transformants were isolated as being His+ and were restreaked on selective media (SD/-Leu/-His/30 m M 3-aminotriazole). A l l grew following reselection hence attempts were made to isolate plasmid from all.  Plasmid was  successfully obtained from all but two o f the eleven clones. These nine plasmids were retransformed into Y M L H S 1 and selected again on SD/-Leu/-His/30 m M 3-aminotriazole media.  A l l nine yielded viable colonies, and all were tested for  p-galactosidase  expression by filter lift (see Methods and Materials). Only one clone, designated 2 B 1 , demonstrated p-galactosidase expression. This clone exhibited both rapid growth in the absence o f histidine and strong P- galactosidase expression (equal to or greater than that o f the positive control system supplied with the one-hybrid system).  This clone was  selected for further analysis.  Two colonies obtained from the original plasmid recovery into S U R E cells were miniprepped and the resulting D N A analyzed by EcoRI digestion. This should release the c D N A insert and leave a 6.7 kb p G A D I O vector band. Both isolates, 2B1-1 and 2 B 1 -  97  2, were identical and contain a 1.4 kb c D N A insert.  Isolate 2B1-1 was used for  sequencing from the 5' end with primer pGADforward. Initial sequencing efforts yielded 152 bases o f reliable sequence starting from the 92  E c o R I site. Analysis o f this recovered sequence with B L A S T  against a non-redundant  database revealed the clone to have high homology to human and murine Hoxb-13, with 100% identity between the last 62 bases o f sequence obtained and the first 62 bases o f coding sequence reported for murine Hoxb-13. Homologies upstream o f nucleotide 91 o f the obtained sequence were only noted to the putative 5' untranslated region o f the human Hoxb-13 m R N A (the 5 ' U T R for the murine clone was not available for comparison). Translation o f the obtained sequence i n the proper reading frame for expression as a fusion with the G A L 4 and S V 4 0 T-Antigen fragments upstream revealed no stop codons within the obtained sequence.  Comparison o f this translated sequence against a non-  redundant database by B L A S T P revealed no significant homologies within amino acids derived from the first 91 nucleotides, and a 100% identity between the 20 amino acids derived from the last 61 nucleotides and the first 20 amino acids o f both human and murine Hoxb-13 protein (see Figure 25).  The probability o f this homology occuring  g randomly was less than 1 x 1 0 " , strongly suggesting that clone 2B1 encoded the gene for Hoxb-13. A s the reported total m R N A size for human Hoxb-13 message is only 1026 nt, the 1.4 kb insert in clone 2B1 likely contains a full-length c D N A . Hoxb-13 was originally discovered by Zeltser et. a l .  93  by screening o f an  expression library with an oligonucleotide probe carrying a ( 5 ' - T A A - 3 ' ) repeat sequence. G i v e n that the bait sequences employed here include four repeats o f the sequence 5'98  Results of B L A S T search with 2B1 sequence D N A alignment Mus musculus Hoxb-13 mRNA, complete eds P l u s S t r a n d HSPs: Score = 310 (85.7 b i t s ) , Expect = 4.8e-18, P = 4.8e-18 I d e n t i t i e s = 62/62 (100%), P o s i t i v e s = 62/62 (100%), S t r a n d = P l u s / P l u s Query:91 ATGGAGCCCGGCAATTATGCCACCTTGGACGGGGCCAAGGATATCGAAGGCTTGCTGGGAGC  II,:I I!II!I^ Sbjct:  II II I  I I I!!I I  152  !I I II:I Ii i  1 ATGGAGCCCGGCAATTATGCCACCTTGGACGGGGCCAAGGATATCGAAGGCTTGCTGGGAGC  62  Amino acid alignment P r o t e i n alignment (U57051) Hoxb-13 [Mus musculus] Length = 2 86 Score = 105 (47.5 b i t s ) , Expect = 8.3e-08, P = 8.3e-08 I d e n t i t i e s = 20/20 (100%), P o s i t i v e s = 20/20 (100%)  Query:  1 MEPGNYATLDGAKDIEGLLG 2 0  Sbjct:  1 MEPGNYATLDGAKDIEGLLG 20  IIIIIIMIMIIIIIIIII  Figure 25: Alignment of Clone 2B1 with Hoxb-13 Results of BLAST searches (both BLASTN for nucleotide sequence, and BLASTP for putative translation product of the nucleotide sequence) against a non-redundant set of sequence databases returned a single match of very high significance to Hoxb-13. The reported alignmentsfromboth searches are represented here.  99  T A A T A A - 3 ' , the observed interaction is very likely real in the context o f the one-hybrid assay. However, Hoxb-13 is a member o f a transcription factor family which is conserved from nematodes through vertebrates. Members o f the H o x gene family are important i n anterior/posterior patterning in embryogenesis and development and as such show highly restricted expression both spatially and temporally . 94  This has been shown to be  specifically true o f murine Hoxb-13. Given this restricted expression pattern relative to the observed wide permissiveness o f fetal murine tissue for M V M replication, it seems unlikely that this observed interaction bears a functional relationship to M V M replication.  Examination ofRIPBO Interaction with the IRS 93  The original screen which identified Hoxb-13  was intended to clone RIP60  (Replication Initiation Protein 60), the D N A - b i n d i n g protein associated with initiation o f the D H F R O B R . Given that PJP60 is a known origin-binding protein from a murine system and its binding affinity is for a 5 ' - T A A - 3 ' repeat motif  95  which occurs twice  within the M V M IRS region, the possibility that RIP60 was a component o f the observed complexes binding this region suggested itself. In order to examine this possibility, I obtained two polyclonal rabbit antisera from the Heintz lab (Dept. o f Pathology, University of Vermont). The first o f these, cc-Zl, was raised against the bacterially expressed N-terminal zinc-finger domain o f RIP60 fused with Glutathione-S-Transferase (GST); the second, a - Z 2 , was also raised against a fusion between the second zinc-finger domain o f RIP60 and G S T . Both antisera have been found  to  function  in  supershifting  of  100  RIP60-DNA  complexes  and  in  the  immunoprecipitation o f these complexes when using nuclear extracts prepared from cells containing an RIP60 expression vector . 96  A preliminary experiment was conducted in which end-labelled 2021 bandshift probe was incubated with L A 9 nuclear extract under conditions identical to those used for bandshifting, followed by a 30 minute incubation on ice with 2 u l o f antisera, addition o f prepared S A C I immunoprecipitin and incubation on ice for a further 30 minutes. The immunoprecipitate was washed three times in R I P A buffer and precipitated D N A quantitated by scintillation counting. Antisera used i n this experiment were oc-Zl and ocZ 2 . Control prebleed sera from each o f the rabbits used to generate a - Z l and cc-Z2 and a rabbit a - G S T polyclonal antisera (Sadowski lab, Dept. o f Biochemistry, U B C ) were also tested.  A s shown in  Table 9, neither o f the ct-RIP60 antisera allowed for the  immunoprecipitation o f the DNA-nuclear extract complex beyond control levels. A s a more sensitive assay for the presence o f RIP60 in the complexes observed formed on the IRS by an L A 9 nuclear extract, the ability o f the oc-Zl and oc-Z2 antisera to induce a supershift in either o f the complexes observed with the 2021 fragment was tested. A series o f bandshift reactions containing a radiolabelled 2021 probe were set up as for a normal bandshift reaction (see Materials and Methods), but prior to loading reactions on the gel, 2 u l o f antisera were added to samples which were allowed to incubate on ice for a further 30 minutes. Antisera examined i n this experiment were the same as i n the previous immunoprecipitation experiment: oc-Zl, cc-Z2, prebleed sera on  101  Antibody aZl aZl-prebleed aZ2 aZ2-prebleed aGST  Counts 115 85 60 64 190  Immunoprecipitated  Table 9: A n t i - R I P 6 0 Immunoprecipitation Results Results of immunoprecipitation experiment with anti-RIP60 polyclonal antisera and controls. Neither of the RIP60 specific antisera (ctZl or aZ2) demonstrates a capacity to immunoprecipitate more of a radiolabelled 2021 probe following incubation with L A 9 nuclear extract, relative to prebleed or anti-GST controls.  No No Zl Z2 N E sera Z l P B Z2 P B a G S T  <—2021-A  F i g u r e 2 6 : A n t i - R I P 6 0 supershift o f 2 0 2 1 probe Results of supershifting experiment with anti-RIP60 polyclonal antisera and controls. Lane marked 'No N E ' contains no nuclear extract; lane marked 'No sera' contains probe, nuclear extract, but no antisera; lanes marked ' Z l ' and ' Z 2 ' contain each of the indicated specific antisera; lanes marked ' Z l P B ' and 'Z2 P B ' contain prebleed antisera for Z l and Z2 repectively; and lane marked ' a G S T ' contains antiGST antisera. No supershift or disruption of either the ' A ' or ' B ' specific complex is noted with any of the sera.  102  both o f these, and rabbit a - G S T polyclonal.  The results (see Figure 26) indicate no  evidence for either a supershifting or disruption o f either the 2021-A or 2021-B complexes. Taken together, these two experiments indicate that RIP60 is probably not a component o f the complexes observed in the bandshift studies presented here.  Whether  this indicates that RIP60 does not in fact have a role in M V M replication is considered more fully i n the Discussion.  103  Discussion Previous evidence indicated the existence o f an origin o f D N A replication within a region o f the M V M genome known as the IRS. Data presented in the current study supports this and expands on prior data by localizing specific sequence elements involved in origin activity and defining binding sites for nuclear factors within the region. Construction o f a comprehensive library o f linker-scanning mutations across the region o f interest allowed for its analysis in a minigenomic replicon system for sequences directly contributing to replication competence.  A s the method used in earlier studies to  70  analyze replication o f M V M minigenomes  was not found to be suitable for accurate  quantitative analysis, a novel assay method was devised and implemented.  Using this  technique, a set o f mutant viral minigenomes were examined for their capacity to replicate i n the presence o f the viral NS-1 protein. Results o f this analysis (see Figure 10) indicate the presence o f three distinct regions within the IRS contributing to replication competence.  The level o f replication  deficit observed by the substitution o f each o f these three elements with unrelated sequences (S2 and S7, S23, and SI) was approximately equal, suggesting that the elements contribute equally to the function o f the viral right-end origin.  Summation o f  the replication deficits observed in each case yields a value greater than 100% replication, an observation which is most easily explained by a functional interaction between the elements; that is, the net replication competence imparted by all elements together is greater than the sum o f their individual contributions.  104  While the SI mutation was able to reduce minigenome replication efficiency to 23% that o f wild-type levels, individual substitution o f each o f the six nucleotides i n the SI mutation from wild-type sequence did not result in any detectable replication defect (see Table 8). This observation suggests that no single nucleotide within this element is individually responsible for the replication activity associated with the element.  The  small but definite replication hypercompetence exhibited by two o f these point mutations ( C 2 A and T 8 G ) is puzzling, as is the weak hypercompetence observed with several o f the scanner mutations (e.g. S3, Figure 10).  While no wholly satisfactory explanation for  these observations can be put forward at this time, it is interesting to note that similar 97  observations have been made in studies o f other viral origins . Elements o f the linker-scanning library were also analyzed by gel-retardation assay for their capacity to specifically interact with factors present i n a nuclear extract. A l l observed interactions were localized to a central region o f the I R S , between nucleotides 4524 and 4668.  A probe spanning this region was observed to form two  major specific complexes, 2021-A and 2021-B. A probe bearing nucleotide substitutions in the location o f S8 was unable to effectively compete for the formation o f complex 2021-B and thereby defines a sequence element important for the formation o f this complex.  Similarly, a probe with substitutions in the location o f S22 lost capacity to  compete for the formation o f complex 2021-A. Weaker interactions were observed with probes bearing mutations SI and S25 (which lost some competition ability for complex 2021-B) and S6 (which lost some competition ability for complex 2021-A). In all cases, an observed loss o f competition ability towards one o f the complexes was paralleled by a  105  weaker but apparent loss o f competition ability towards the other complex. These data suggest that the binding o f complexes responsible for the shifted species is a cooperative interaction, a hypothesis which is supported by other observations from both this and previous studies. One line o f evidence comes from the previous report that the IRS bound several distinct complexes as analyzed by gel retardation assay and that some o f these complexes were the same on the Rsal ' A ' and ' B ' probes as evidenced by cross-competition . The 79  apparent discrepancy between these findings and the data presented here is clearly explained i f one assumes that the binding o f the 2021-A and 2021-B complexes is cooperative; as the boundary between the Rsal ' A ' and ' B ' fragments lies at viral nt. 4579 the major binding site for complex 2021-B is on one fragment (S8, on Rsal ' A ' ) while the binding sites for complex 2021-A are on the other (see Figure 11). Studies with the R s a l fragments individually would then be expected to detect some shared complexes through protein-protein interactions.  The lack of the major site for the binding o f the other  complex on each probe could readily be expected to result i n a reduction o f complex stability and its potential partial dissociation into constituent subunits resulting i n a number o f smaller shifted forms.  Another line o f evidence for cooperative interaction comes from consideration o f the dual-site mutation. In the present study, the factor binding sites observed are adjacent to (or i n the case o f sequences replaced i n the SI mutation, overlying) sequence elements required for efficient minigenome replication.  This suggests a possible functional  relationship between factor binding and viral origin function, which is strongly supported  106  by the results obtained with the S8/22 dual mutation.  Neither o f these mutations  individually resulted i n an apparent loss o f minigenome replication competence, however the dual mutation reduces minigenome replication to the same basal level observed with the S2 and SI mutations. The simplest interpretation o f these observations would be that the factors responsible for formation of the 2021-A and 2021-B complexes are required for activity o f the origin within the IRS. The already postulated cooperative interaction between the elements o f these two complexes could account for the lack o f a replication deficit in either o f the individual mutations; binding o f either complex and subsequent localization o f the second complex through protein-protein interaction may be sufficient to activate replication to wild-type levels observed in the minigenome assay employed. A t present, the identity of the constituents o f these complexes can not be stated. Evidence from other origins suggests that transcription factors, helicases, and singlestranded binding proteins are all potential candidates.  While the interacting gene found  through a one-hybrid screen (Hoxb-13) can most likely be discounted as being meaningful i n viral replication due to limitations in its expression pattern relative to observed viral tropism, the fact that this gene was also identified by other workers looking for a known murine origin-binding protein (RIP60) may not be coincidental. The recovery o f Hoxb-13 by Heintz et. al. by interaction with a D N A sequence known to bind 93  RIP60  suggests that these two proteins happen to share recognition sequence  specificity; the  preferential identification o f the H o x gene in both studies may merely  indicate that this gene product is better able to work out o f its native context than is RIP60.  107  The reported RIP60 binding element is an ( A T T ) repeat sequence, and while this n  does not seem to be associated with either replication-active or factor-binding sites reported i n this study, the sequence ( T A A T A A ) does occur in both the elements replaced by scanner mutations S22 and SI (in opposite orientations at the two sites). Given that this is simply the inverse complement o f the reported RJP60 binding site, shifted by one nucleotide i n phase, RJP60 would seem to be a likely candidate for a potential I R S binding factor. The observed capacity o f this protein to associate into large aggregates on the D H F R O B R i n association with several other proteins, i f representative o f RIP60's normal mode o f action, could explain both the large apparent size o f the complexes observed by gel-retardation assay and the apparent cooperativity between binding o f the complexes noted in this report.  The fact that both immunoprecipitation and supershift  experiments reported here failed to indicate RIP60 as a component o f the complexes observed in bandshift experiments strongly suggests that this protein is not involved; however the circumstantial evidence seems strong enough to warrant further in vivo studies before RIP60 involvement i n M V M replication is dismissed. The recent cloning o f full-length RIP60 in a mammalian expression vector and the demonstration that cotransfection o f this construct with polyoma virus results in increased viral replication  96  suggests one technique through which this might be examined.  The apparent  lack o f a replication deficit in full-length virus  following  introduction o f the SI mutation is surprising, but perhaps not innately contradictory to data from the minigenome system. Replication capacity in the full-length viral system was analyzed by measurement of final viral titres, as opposed to levels o f viral D N A in  108  the minigenome-based assay. Given that NS-1 is known to be cytotoxic, it is conceivable that i n native infections replication capacity o f an infected cell is limited by N S - 1 level: that is, replication proceeds until such time as NS-1 levels reach a threshold resulting i n cell death and release o f encapsidated viral progeny. A slower-replicating viral genome would result in fewer copies o f the NS-1 gene available for transcription and might thereby allow for a longer period o f effective replication ending at the same N S - 1 threshold, and thus at approximately the same number o f viral particles as the wild-type virus. I f this is indeed the case, careful timecourse analysis o f replicative intermediates i n infected cells should demonstrate an initial lag in mutant viral replication relative to w i l d type.  While a preliminary attempt at such an analysis was made, inconclusive results  were obtained and have not been presented in this study. Further insights into the activity o f the origin o f D N A replication within the IRS are provided by studies reported here in which this origin, in conjunction with one viral telomere, were used sucessfully to drive replication o f a linear construct containing unrelated  sequences.  Replication o f p J B R l  constructs  clearly and unequivocally  demonstrate that the IRS alone functions as an origin o f replication irrespective o f any contributions to replication capacity the viral genome gains from a postulated leftterminal origin.  While prior models o f M V M replication have not included any direct  role for the viral NS-1 protein at the replication origin, the apparent lack o f replication o f these constructs in the absence o f NS-1 suggests that such an interaction could be functionally important. Upon consideration however it seems more likely that the reason for this requirement could lie in the nature o f the p J B R l construct itself. While the viral  109  5' palindromic sequences end at the C l a l site (see Figure 20) the construct is linearized with E c o R I prior to transfection leading to the presence o f a 23 nt. 'tail' which is not capable o f forming a stable duplex when the terminus rearranges from a linear to hairpin conformation. A s this extension is not base-paired across from single-stranded template, it cannot serve as a primer for strand extension back to a double-stranded form (Figure 21, panel 3 o f L S O model). While cellular D N A repair mechanisms might be expected to remove this unpaired segment, it is possible that this does not occur to a large enough extent to yield detectable product in this assay and that NS-1 is needed to nick the terminus and release the extension. Alternatively, NS-1 may be required i n some more cryptic role at the IRS origin; and while the purpose or mechanism o f such interaction is 28  not suggested at this time, the known helicase function o f NS-1  lends itself to at least  one plausible hypothesis i n which it serves a role analogous to that o f dnaB at the E. coli 52  O n C origin . While evidence existed to suggest the presence o f a second origin i n the viral leftend terminus, no data was previously available to accurately measure its contribution to viral replication. Data presented here addresses this by allowing for an upper limit to its activity relative to the origin within the IRS to be estimated at 20%. This conclusion comes from the assumption that i f any o f the linker-scanning mutations examined i n the minigenome based assay completely abolished activity o f the right-hand origin, any residual replication activity must arise from the left-hand origin. A l l o f the replication defective mutants (except S7, which may very well only touch on the edge o f a replication element) reduce minigenome replication efficiency to approximately the same  110  level (20%) suggesting the possibility that each o f these mutations (S2, S23, S I , and the S8/22 dual mutant) completely abrogate function o f the right-hand origin.  This  possibility is supported by observations from the p J B R l based analysis o f these same mutations i n which all o f the mutants lose replication capacity. If this is indeed the case, the simultaneous requirement for all o f these discrete sequence elements for function o f the right-hand origin would indicate there is a functional interaction between the elements. A model is presented in this study to address the question o f how parvoviral genomes effect the rearrangement o f their terminal palindrome(s) (either a specific one i n the case o f M V M and other autonomous parvoviruses, or both for the dependoviruses) from an extended double-stranded linear form to an intramolecularly-hybridized hairpin form.  A t present, no other models exist to address this problem. Experimental results  with the p J B R l construct lend support to the proposed mechanism whereby a leadingstrand only ( L S O ) origin displaces one strand o f the terminal palindrome, allowing the other to spontaneously form into the hairpin structure required by viral replication models. In particular, the L S O model predicts that p J B R l should produce three classes o f replicative intermediates, in contrast to a canonical bidirectional leading and lagging strand origin which would predict a single class o f replicative intermediates.  The  strongest evidence presented here in support of this model is the analysis o f replication products o f p J B R l by one-dimensional neutral agarose gel electrophoresis (Figure 22). This reveals three D N A species produced uniquely under conditions i n which full-length input plasmid is replicated (supply o f N S - 1 in trans being a required condition).  Ill  Examination o f these species by two-dimensional neutral-alkaline electrophoresis (Figure 23), while unfortunately complex due to the heterogeneous nature o f the many replicative intermediate forms involved, suggests  that the observed products contain forms  corresponding to the predicted Forms 1, 4a, and 4b. These results, while not uniquely interpretable with the L S O model, suggest that it should be considered as a possible model for IRS activity. With further refinements this experimental technique may prove useful i n firmly elucidating the IRS's mechanism o f action. There are several attractive features o f this model. First, presence o f an origin would explain the virus' requirement for a host-cell S phase to replicate, a requirement which otherwise is puzzling when one considers that all of the intermediates shown i n Figure 4 would seem to be suitable templates for repair synthesis and should thus be replicated regardless o f host cell cycle. Evidence in support o f the leading-strand only 98  nature o f the proposed origin model comes from studies by Goulian et. al. , which reports that Okazaki fragments cannot be detected in parvoviral replication. The idea o f an exclusively leading-stranded origin brings to mind mitochondrial D N A replication, which proceeds in a P o l y dependent leading-strand only fashion. Intriguingly, studies by K o l l e k et. a l " '  m  employing polymerase inhibitors in the course o f native H I infections  led to an identification o f an early P o l a/Primase dependent step (initiation) followed by a longer P o l y dependent process. Two recent reports in the literature have bearing on this model. Cossons et.  al.  m  observed rearrangement o f the 5' extended palindrome o f M V M from a linear extended form to a hairpin-containing structure in vitro and concluded on the basis o f selective  112  sensitivity o f this process to polymerase inhibitors that pol 8 was required for the rearrangement.  O f particular interest is their observation that while hairpin formation  was observed, extension synthesis to form the d R F did not occur. Current models for the action o f pol 8 indicate it acts to synthesize leading and lagging strands i n a coordinate manner. The replication model presented here would suggest that an in vitro system in which pol 8 is acting at this viral origin would be able to form an incomplete hairpin structure at the 5' terminus but not be able to prime synthesis to the d R F replicative intermediate. It is conceivable that the apparent involvement o f pol 8 in in vitro studies by Cossons et. al. may not reflect the in vivo mechanism. 102  Other in vitro studies by Baldauf et. al.  demonstrated that an L A 9 cellular  extract was capable o f supporting the conversion o f viral genomes into a covalently closed (cRF) monomer form. Only when the extract was supplemented with purified N S 1 was terminal resolution o f the c R F , extension to the m R F , and the appearance o f d R F species observed. The ability o f the supplemented extract to support replication to the level o f d R F was suggested by the authors to result entirely from site-specific nicking by NS-1 as a requirement to open the covalently closed c R F species and allow for subsequent generation o f the linear 5' termini, a prerequisite for terminal rearrangement and elongation to the dimeric species. This explanation is somewhat unsatisfactory given that the system without NS-1 in the Cossons et. al. study  101  achieved both the linear m R F  and some form o f terminal rearrangement. A possibility not previously considered is that NS-1 may play an obligate role in suppressing lagging-strand synthesis from the IRS  113  origin, either by influencing the choice o f polymerase used or through a more direct mechanism. Comparison o f the results reported in this thesis with earlier results from our 70 79  lab '  clarifies some observations but raises new questions. Previously it was observed  that while deletions i n the right side o f minigenomic constructs as far as nt. 4489 had no effect, deletions to nt. 4636 abolished replication competence i n L A 9 cells and resulted i n roughly a 70% loss i n replication competence in C O S - 7 cells (thereby defining Element A as nt. 4489 through 4636), and extension o f the deletion to nt. 4695 cause a complete loss o f replication competence in C O S - 7 cells (thereby defining Element B as nt. 4637 to 70  4695) . In contrast, all o f the elements contributing to replication competence noted i n this study lie within Element A , despite the fact that the studies were done i n C O S - 7 cells. Given that the apparent sensitivity o f the replication assay employed i n the current study is on the order o f 32%, it is possible that the functions within Element B were too weak to be detected. Data presented here agrees well with previously reported results regarding the rescue o f replication deficient minigenomes by the Rsal " A " and " B " fragments.  Given  that R s a F ' A " contains the site under mutants S2 and S7 while R s a F ' B " contains the sequences under mutants S23 and S I , it is not surprising that both fragments were capable o f restoring replication competence.  Similarly, previous results using the  R s a F ' A " (containing the S8 site) and " B " (containing the S22, S I , and S25 sites) fragments as bandshift probes had suggested that at least one common complex was formed by both probes, and that it was in turn composed o f at least two other 114  complexes .  This is born out by observations here which indicate a cooperative  interaction between the two major complexes formed in this region whereby binding o f one o f the two w i l l result in at least some binding o f the other. It is tempting to postulate that the observed greater rescue o f replication capacity by the R s a P A " fragment than the " B " fragment is related to the results shown here which indicate that the site on R s a I " A " for complex 2021-B is a higher-affinity site than that on the " B " fragment, however at the moment this must remain purely speculative. Previous footprinting o f host factors binding in the IRS indicated that the activity 79  referred to as M R F B 5  protected a bipartite region, with 'Site I' overlying scanner  mutations S22 and SI and 'Site IF overlying mutations S26 and S15 o f this study. The observations presented here localize the majority o f binding activity under 'Site I' along with some sequences important for replication, while only weak binding activity and no replication activity is associated with sequences under  'Site I F .  The apparent  cooperativity o f binding between the complexes observed would suggest that the protection o f 'Site IF may arise from factors being strongly bound at 'Site I'. Considering the small gap between Sites I and II (6 bp) a simple model to account for this would have the viral genome bend sharply between the regions o f protection, such that 'Site IF arises from the D N A coming into close proximity with the backside o f the complex localized to 'Site V (see Figure 27). Such dramatic kinking or bending o f D N A has been a common feature o f many origins characterized to date. Notably, RIP60 has been shown to induce D N A distortions in the D H F R O B R  6 4  o f a nature similar to that  proposed here; however, in view o f the lack o f any direct evidence to support either  115  A 4579 S23  S22  SI  S25  S26  S15  S16  4662  GTACTTCATATATTATTAAGACTAATAAAGATACAACATAGAAATATAATATTACATATAGATTTAAGAAATAGAATAATATGGTAC CATGAAGTATATAATAATTCTGATTATTTCTATGTTGTATCTTTATATTATAATGTATATCTAAATTCTTTATCTTATTATACCATG  H  Site I  Site II  B V  Site II  Site I  F i g u r e 27: Hypothetical Bent M o d e l for Protection of Sites I a n d I I Diagram of hypothetical bent-DNA model for origin of Site I and Site II footprints from a single protein complex with sequence specificity conferred by Site I. Panel A diagrams the Rsal ' B ' fragment and associated MRFB5 footprint of Reference 79; heavy overbars and two arrows represent regions of DNAse I protection. The locations of linker scanning mutations within this region are indicated above the sequence along with their designations. Panel B is a representation of a protein complex localized to Site I and inducing a D N A bend such that a second region (Site II) contacts the back side of the complex and is protected from DNAse I cleavage.  116  RIP60 binding to the IRS or the postulated D N A bending in this region this observation must be considered purely conjectural. Taken together, evidence presented here indicates the IRS may function as a multipartite origin o f D N A replication consisting o f a number o f short sequence elements which interact in a cooperative fashion. Some of these elements act through the binding of nuclear factors and some appear to act only as required sequence independent  o f any  observable  protein-binding function.  elements,  Such organization is  reminiscent o f other origins o f replication characterized to date, both from viral systems (human papillomavirus type 11, SV40) and simple eukaryotic systems ( A R S 1 o f S.cerevisiae),  in which several short discreet sequence elements contribute to the  initiation o f replication either through the localization o f protein factors or through intrinsic properties o f the sequence element.  117  Appendix A This appendix contains the original data from the replication assays referred to i n the main body o f the thesis, along with the quantitation and preliminary data analyses which are summarised in Table 4, Table 6, and Table 8. Data is presented in the following manner: a description o f the assay and what clones were examined is followed on the next page by images o f the associated slot-blot following hybridization with Vecpro and J A V A oligonucleotides. A n image o f the blot after stripping between hybridizations is not presented. Numbers above each o f the slots correspond to the sample numbers for the quantitation data, which follows each set o f blot images. The next page presents quantitation data for the p J B L R 4 . 3 standard curve associated with each blot image (samples 1 through 5), with the amount o f standard i n each sample and the associated quantitation value presented in a table. These values are plotted graphically with a least-squares linear regression curvefit displayed. The equation of the calculated curvefit is presented i n each case. Data on this page correspond to the blots on the preceeding page, i.e. the upper data table and graph refer to the upper blot image preceeding. Finally, the fourth page contains the quantitation values for each o f the experimental samples from the two blots, and the R E , S R E , and S R R E values calculated from this data. Note that in Assays 1, 2, and 3, there are two samples on each blot (segments 26 and 27) which are not analyzed. Analysis o f these clones after the assay indicated the presence o f extraneous mutations in these clones and data pertaining to them was discarded.  118  Replication Assay 1: Sample # 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29  Contains pJBLR4.3 104 ng p J B L R 4 . 3 21 ng pJBLR4.3 4.3 ng pJBLR4.3 833 pg p J B L R 4 . 3 167 pg pJBLR4.3 pJBLR4.3 + p C M V N S - l pJBLR4.3Sl + p C M V N S - l pJBLR4.3S2 + p C M V N S - 1 pJBLR4.3S3 + p C M V N S - l pJBLR4.3S4 + p C M V N S - 1 pJBLR4.3S5 + p C M V N S - 1 pJBLR4.3S7 + p C M V N S - 1 pJBLR4.3S8 + p C M V N S - 1 pJBLR4.3S12 + p C M V N S - 1 pJBLR4.3S13 + p C M V N S - 1 pJBLR4.3S14 + p C M V N S - 1 pJBLR4.3S15 + p C M V N S - 1 pJBLR4.3S16 + p C M V N S - 1 pJBLR4.3S17 + p C M V N S - 1 pJBLR4.3S18 + p C M V N S - 1 pJBLR4.3S20 + p C M V N S - 1 pJBLR4.3S21+pCMVNS-l pJBLR4.3S22 + p C M V N S - 1 pJBLR4.3S23 + p C M V N S - l Sample rejected due to mutation i n clone Sample rejected due to mutation i n clone pJBLR4.3 pJBLR4.3+pCMVNS-l  119  pCMVNS-1 standards  pJBLR4.3 standards \T.  I  C:  Samples  Reference mark  51  | 88:32 88/19/97 14  22  15  23  16  24  11  I'  27  12  28  28  13  21  29  m 2 3 4 5  Assay 1: Vecpro probe  pCMVNS-1 standards  Samples  pJBLR4.3 standards  I  [T  i  I  I I  I  1 c: 58  Reference mark , , |88:39 88/19/97  14  22 23  2  7  15  3  8  If  11  19_  27  12  28  28  13  21  29  Assay 1: J A V A probe  120  Quantitation data and standard curves, Assay 1 p J B L R 4 . 3 Standards, Vecpro probe:  Segment # 1 2 3 4 5  Volume ng Std. 69275.3 1 0 4 16473.21 21 3810.85 4.2 1593.14 0.833 1396.27 0.167  Input Std. 120 100  0.0015X-2.2377 R = 0.9994 2  80 4-  < z Q  60  O)  40  c  20 0 60000  80000  p J B L R 4 . 3 standards, J A V A probe:  Segment # 1 2 3 4 5  Volume ng Std. 49109.33 1 0 4 12776.66 21 3237.12 4.3 1362.37 0.833 1103.31 0.167  Virus Std. 120 j 100 -  <  z Q <J> c  y = 0.0022x-3.2338 R = 0.9981 2  80 60 40 20 0 -H 10000  20000  30000  Signal  121  40000  50000  Sample quantitation, Assay 1 Clone 4.3 4.3 + pCMVNSI S1 S2 S3 S4 S5 S7 S8 S12 S13 S14 S15 S16 S17 S18 S20 S21 S22 S23 4.3 4.3+PCMVNS1  Vecpro signalng input JAVA sianal ng out 12196.75 8043.04 10252.15 25301.19 11239.26 9571.79 7675.82 10017.46 9314.96 10993.86 11913.98 35788.61 30666.83 24587.7 8947.37 8233.37 9420.97 10347.32 10498.32 26365.71 10658.85 12421.34  16.06 9.83 13.14 35.71 14.62 12.12 9.28 12.79 11.73 14.25 15.63 51.45 43.76 34.64 11.18 10.11 11.89 13.28 13.51 37.31 13.75 16.39  9305.84 42665.96 11126.45 31617.64 73379.47 51424.86 44738.58 16878.50 47557.20 62847.88 73074.39 125128.90 110258.68 105197.26 36920.45 40294.40 41864.16 38579.58 41249.48 37001.07 8693.15 52703.15  122  17.24 90.63 21.24 66.33 158.20 109.90 95.19 33.90 101.39. 135.03 157.53 272.05 239.34 228.20 77.99 85.41 88.87 81.64 87.52 78.17 15.89 112.71  BE Scaled RE Scaled RRE 0.07 8.22 0.62 0.86 9.82 8.07 9.26 1.65 7.64 8.47 9.08 4.29 4.47 5.59 5.97 7.45 6.47 5.15 5.48 1.10 0.16 5.88  -0.04 8.11 0.50 0.74 9.70 7.95 9.15 1.54 7.53 8.36 8.96 4.17 4.35 5.47 5.86 7.33 6.36 5.03 5.36 0.98 0.04 5.76  -1% 117% 7% 11% 140% 115% 132% 22% 109% 121% 129% 60% 63% • 79% 84% 106% 92% 73% 77% 14% 1% 83%  Replication Assay 2: Sample # 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29  Contains pJBLR4.3 104 ng pJBLR4.3 21 ng pJBLR4.3 4.3 ng pJBLR4.3 833 pg pJBLR4.3 167 pg pJBLR4.3 pJBLR4.3+pCMVNS-l pJBLR4.3Sl + p C M V N S - l pJBLR4.3S2 + p C M V N S - 1 pJBLR4.3S3 + p C M V N S - 1 pJBLR4.3S4 + p C M V N S - 1 pJBLR4.3S5 + p C M V N S - 1 pJBLR4.3S7 + p C M V N S - 1 pJBLR4.3S8 + p C M V N S - 1 pJBLR4.3S12 + p C M V N S - 1 pJBLR4.3S13 + p C M V N S - 1 pJBLR4.3S14 + p C M V N S - 1 pJBLR4.3S15 + p C M V N S - 1 pJBLR4.3S16 + p C M V N S - 1 pJBLR4.3S17 + p C M V N S - 1 pJBLR4.3S18 + p C M V N S - 1 pJBLR4.3S20 + p C M V N S - 1 pJBLR4.3S21 + p C M V N S - l pJBLR4.3S22 + p C M V N S - 1 pJBLR4.3S23 + p C M V N S - 1 Sample rejected due to mutation i n clone Sample rejected due to mutation i n clone pJBLR4.3 pJBLR4.3+pCMVNS-l  123  pCMVNS-1 standards pJBLR4.3 standards I  |T  Samples  Reference mark i  8 C: 58  i~f |17:08 88/27/9?  mm  Assay 2: Vecpro probe  pCMVNS-1  standards  [T  PJBLR4.3 standards I 8 C: 58  Samples  Reference mark 187:88 88/27/97  6  14  22  7  15  23  8 • MM 9  It  24  17  25  18_  18 _  26  11  19  27  12  28  28  13  21  29  Assay 2: J A V A probe  124  Quantitation data and standard curves, Assay 2 p J B L R 4 . 3 Standards, Vecpro probe: Segment  #  Volume 1 132075.09 2 26784.39 5842.47 3 4 2677.78 5 1468.4  ng Std. 104 21 4.2 0.833 0.167  Input Std. 120  y 0.0008x-0.7766  100 -  R = 0.9999 2  <  z aOl c  80 -60 40 20 0 -t  50000  100000  150000  Signal  p J B L R 4 . 3 Standards, J A V A probe Segment  #  Volume 1 87083.16 2 18173.6 4255.07 3 4 1542.38 1121.71 5  ng Std. 104 21 4.3 0.833 0.167  Virus S t d .  < z Q O)  c  20000  40000  60000  Signal  125  80000  100000  Sample quantitation, assay 2: Clone 4.3 4.3 + pCMVNSI S1 S2 S3 S4 S5 S7 S8 S12 S13 S14 S15 S16 S17 S18 S20 S21 S22 S23 4.3 4.3+PCMVNS1  Vecpro signal ng input JAVA sianal ng out BE 11091.62 17848.18 11914.22 19835.21 14669.8 14979.18 20870.48 4408.23 12284.32 12076.08 21772.28 5521.13 11771.59 17449.49 16678.09 7265.87 12149.75 11087.72 15394.35 20302.2 14960.72 13858.72  14.40 24.53 15.63 27.52 19.77 20.23 29.07 4.37 16.19 15.88 30.42 6.04 15.42 23.94 22.78 8.66 15.99 14.39 20.85 28.22 20.20 18.55  8145.05 86226.37 21435.18 24652.60 87262.68 92693.44 99572.12 12093.18 59644.40 88700.34 116229.23 28067.61 77429.59 101138.92 98894.58 55445.55 61855.64 66846.18 100636.55 36947.09 11184.63 63773.15  126  8.78 -0.39 102.48 3.18 24.73 0.58 28.59 0.04 103.72 4.25 110.24 4.45 118.49 3.08 13.52 2.09 70.58 3.36 105.44 5.64 138.48 3.55 32.69 4.41 91.92 4.96 120.37 4.03 117.68 4.17 65.54 6.57 73.23 3.58 79.22 4.50 119.77 4.74 43.34 0.54 12.43 -0.38 75.53 3.07  Scaled RE Scaled RRE -0.01 3.56 0.97 0.42 4.63 4.83 3.46 2.47 3.74 6.03 3.94 4.79 5.35 4.41 4.55 6.95 3.97 4.89 5.13 0.92 0.00 3.46  0% 101% 28% 12% 132% 138% 99% 71% 107% 172% 112% 137% 152% 126% 130% 198% 113% 139% 146% 26% 0% 98%  Replication Assay 3: Sample #  Contains  1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29  pJBLR4.3 104 ng pJBLR4.3 21 ng pJBLR4.3 4.3 ng pJBLR4.3 833 pg pJBLR4.3 167 pg pJBLR4.3 pJBLR4.3 + p C M V N S - 1 pJBLR4.3Sl + p C M V N S - l pJBLR4.3S2 + p C M V N S - 1 pJBLR4.3S3 + p C M V N S - 1 pJBLR4.3S4 + p C M V N S - 1 pJBLR4.3S5 + p C M V N S - 1 pJBLR4.3S7 + p C M V N S - 1 pJBLR4.3S8 + p C M V N S - 1 pJBLR4.3S12 + p C M V N S - 1 pJBLR4.3S13 + p C M V N S - 1 pJBLR4.3S14 + p C M V N S - 1 pJBLR4.3S15 + p C M V N S - 1 pJBLR4.3S16 + p C M V N S - 1 pJBLR4.3S17 + p C M V N S - 1 pJBLR4.3S18 + p C M V N S - 1 pJBLR4.3S20 + p C M V N S - 1 pJBLR4.3S21 + p C M V N S - l pJBLR4.3S22 + p C M V N S - 1 pJBLR4.3S23 + p C M V N S - l Sample rejected due to mutation i n clone Sample rejected due to mutation i n clone pJBLR4.3 pJBLR4.3+pCMVNS-l  127  pCMVNS-1 standards pJBLR4.3 standards ff!  Samples  i  8 c: 58  Reference mark  [ r 08:36 08/19/9? 14  22  7  15  23  8  16  24  9  25  ie  18  26  n  19  27  12  20  28  13  21  29  Assay 3: Vecpro probe  pCMVNS-1 standards pJBLR4.3 standards  Samples  i  Reference mark  I r  0 C: 50  8)8:43 88/19/97 |  14  22  7  15  23  16  24  9  25  Jim  X  W0  mm  12  13  27  20  28  21  29  Assay 3: J A V A probe  128  26  Quantitation data and standard curves, Assay 3 p J B L R 4 . 3 Standards, Vecpro probe: Segment #  Volume  ng Std.  1 193766.25 2 36756.64 3 8484.9 4 2490.2 2302.47 5  120.8 21 4.2 0.833 0.167  Input Std.  < z Q O)  c  50000  100000  150000  200000  Signal  p J B L R 4 . 3 Standards, J A V A probe: Volume  ng Std.  1 116349.04 2 25384.07 6002.69 3 1586.22 4 5 1074.01  104 21 4.3 0.833 0.167  Segment #  Virus Std.  < z Q O)  c  20000  40000  60000 Signal  129  80000 100000 120000  Sample quantitation, assay 3: Clone 4.3 4.3 + pCMVNSI S1 S2 S3 S4 S5 S7 S8 S12 S13 S14 S15 S16 S17 S18 S20 S21 S22 S23 4.3 4.3+PCMVNS1  Vecpro signal ng input JAVA signal 13898.08 18.61 7997.44 24390.4 34.35 58702.22 11357.45 14.80 11000.29 13556.7 18.10 14282.34 18488.11 25.49 75933.70 18059.07 24.85 69871.40 18559.86 25.60 64943.57 14802.05 19.97 18576.77 13741.32 18.37 34892.54 18268.38 25.16 53778.67 32.37 23074.46 64474.59 21021.66 55393.27 29.29 21499.48 30.01 55173.67 27479.13 38.98 74602.29 23792.48 33.45 62398.59 19289.21 26.70 52464.09 16419.62 22.39 41410.89 18240.24 25.12 69960.63 19.34 52263.24 14386.79 22191.96 31.05 24748.40 19821.4 27.49 12136.66 35610.5 51.18 88375.52  130  ng out 6.14 51.78 8.85 11.80 67.29 61.83 57.40 15.67 30.35 47.35 56.97 48.80 48.60 66.09 55.10 46.16 36.22 61.91 45.98 21.22 9.87 78.48  RE Scaled RE Scaled RRE -0.67 -0.01 -1% 0.51 99% 1.16 -0.40 0.25 22% -0.35 0.31 26% 1.64 2.29 195% 1.49 2.14 182% 1.24 1.90 161% -0.22 0.44 37% 0.65 111% 1.31 0.88 1.54 131% 0.76 120% 1.41 0.67 1.32 112% 0.62 1.27 108% 0.70 1.35 115% 0.65 111% 1.30 0.73 1.38 118% 0.62 1.27 108% 1.46 2.12 180% 1.38 2.03 173% -0.32 0.34 29% -0.64 0.01 1% 0.53 1.19 101%  Replication Sample # 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36  Assay  4: Contains p J B L R 4 . 3 104 ng p J B L R 4 . 3 21 ng p J B L R 4 . 3 4.3 ng p J B L R 4 . 3 833 pg p J B L R 4 . 3 167 pg pJBLR4.3 pJBLR4.3 + p C M V N S - l pJBLR4.3S25 + p C M V N S - 1 pJBLR4.3S25 + p C M V N S - 1 pJBLR4.3S25 + p C M V N S - 1 pJBLR4.3S26 + p C M V N S - 1 pJBLR4.3S26 + p C M V N S - 1 pJBLR4.3S26 + p C M V N S - 1 pJBLR4.3S8/22 + p C M V N S - 1 pJBLR4.3S8/22 + p C M V N S - 1 pJBLR4.3S8/22 + p C M V N S - 1 pJBLR4.3TlC + pCMVNS-1 pJBLR4.3TlC + pCMVNS-1 pJBLR4.3TlC + pCMVNS-1 pJBLR4.3C2A + pCMVNS-1 pJBLR4.3C2A + pCMVNS-1 pJBLR4.3C2A + pCMVNS-1 pJBLR4.3T3G + pCMVNS-1 pJBLR4.3T3G + pCMVNS-1 pJBLR4.3T3G + pCMVNS-1 pJBLR4.3T4A + pCMVNS-1 pJBLR4.3T4A + pCMVNS-1 pJBLR4.3T4A + pCMVNS-1 pJBLR4.3A6C + pCMVNS-1 pJBLR4.3A6C + pCMVNS-1 pJBLR4.3A6C + pCMVNS-1 pJBLR4.3T8G + p C M V N S - 1 pJBLR4.3T8G + pCMVNS-1 pJBLR4.3T8G + pCMVNS-1 pJBLR4.3 pJBLR4.3+pCMVNS-l  131  pCMVNS-1 standards  pJBLR4.3  Samples  standards  I  [Bl  II  [  a c: si  I  I  -  | 88:46 88/19/97 14  38  15  23  31  16  24  32  9  17  25  33  18  18  26  34  11  19  27  12  28  28  13  21  36  29  Assay 4: Vecpro probe  pCMVNS-1 standards  pJBLR4.3  Samples  standards  (Ti  8 c: 58  188:51 88/19/97  1  6  2  7 ——  3  8  4  9  5  18  '  •  •  15  M  M  M  M  '.•  —m M  M  M  M  M  M  33  M  26 M  M  32  25  18 M  M  24  17  "•  31  23  mmm 16  •  38  22  14  M  34 M  M  11  19  27  35  12  21  28  36  13  21  ••* in-  Assay 4: J A V A probe  132  29 mmmmm  Quantitation data and standard curves, Assay 4 p J B L R 4 . 3 Standards, Vecpro probe: Segment # Volume 1 2.35.E+06 2 453834.44 3 79097.05 4 16984.6 5201.7 5  ng Std. 104 21 4.3 0.833 0.167  Vector Standard  120 y = 4.41E-05x + 4.22E-01  100 --  R = 1.00E+00 2  80  -  za  60  -  c  40  -  < at  20 --  0.00E+00 5.00E+05 1.00E+06 1.50E+06 2.00E+06 2.50E+06  signal  p J B L R 4 . 3 Standards, J A V A probe: Segment # 1 2 3 4 5  Volume ng Std. 74744.21 104 17239.48 21 3550.33 4.3 1345.93 0.833 1533.75 0.167  Virus Standard  120 100  y= 1.41E-03X- 1.69E+00 R = 9.99E-01 2  80  < z Q o> c  60 40 20 0 60000  133  80000  Sample Q u a n t i t a t i o n , Assay 4: Clone pJBLR4.3 4.3+pCMVNS-l  Vecpro signal  ng input JA VA signal  ng out  RE  325127.78  14.76  10317.36  12.86 -0.13  545875  24.50  29315.48  39.64  Scaled RE  Scaled RRE  0.62  -0.01 0.74  93%  -1%  pJBLR4.3S25  742010.56  33.14  40692.82  55.69  0.68  0.80  101%  pJBLR4.3S25  498765.81  22.42  30283.07  0.83  0.95  pJBLR4.3S25  527322.81  23.68  29017.1  41.01 39.22  0.66  0.78  120% 98%  pJBLR4.3S26  427711.25  19.28  26570.29  35.77  0.86  0.98  123%  pJBLR4.3S26  432726.31  19.51  24729.4  33.18  0.70  0.82  104%  pJBLR4.3S26 pJBLR4.3S8/22  424222.25 754731.88  19.13 33.71  25505.9 25594.54  34.27 34.40  0.79 0.02  0.91 0.14  115% 18%  pJBLR4.3S8/22  713315.88  31.88  25660.43  34.49  0.08  0.20  26%  pJBLR4.3S8/22 PJBLR4.3T1C  616017.69 781041.25  27.59 34.87  21182.63 42430.24  28.18 58.14  0.02 0.67  0.14 0.79  18% 100%  pJBLR4.3TlC  682699.19  30.53  35975.45  49.04  0.61  724139.38  32.36  38425.52  0.62  16.77  1.31  166%  20.68  27290.89 28341.2  1.19  pJBLR4.3C2A  370675.5 459295.88  52.49 36.79  0.73 0.74  92%  PJBLR4.3T1C pJBLR4.3C2A  38.27  123%  523021.84  45.67 47.72  135%  623429.19  33589.07 35041.34  1.06  pJBLR4.3T3G  23.49 27.92  0.85 0.94  0.97  pJBLR4.3C2A  0.71  0.83  105%  pJBLR4.3T3G  451482.03  20.33 21.83  0.90  0.99 1.02  125%  485523.75  37.98 41.41  0.87  pJBLR4.3T3G  28134.71 30565.02  pJBLR4.3T4A pJBLR4.3T4A  672608.06  30.08  36308.58  49.51  0.65  0.77  97%  636161.75  28.48  36370.31  49.59  0.86  pJBLR4.3T4A  535892.19  24.05  30907.01  41.89  0.74 0.74  0.86  109% 109%  pJBLR4.3A6C  485079.84  21.81  28516.16  38.52  0.77 0.57  0.89  112%  1.20  0.69 1.32  166%  94%  129%  pJBLR4.3A6C  574192.62  25.74  29841.53  pJBLR4.3A6C  482930.88  21.72  35014.49  40.39 47.68  pJBLR4.3T8G  638611.69 675706.62  28.58 30.22  40785.86  55.82  0.95  1.07  136%  pJBLR4.3T8G  43196.25  59.22  0.96  1.08  137%  pJBLR4.3T8G  515624.19  23.16  32708.62  44.43  0.92  1.04  131%  334859.5  15.19  10864.7  13.63  -0.10  0.02  2%  532072.88  23.89  30383.78  41.15  0.72  0.84  107%  pJBLR4.3 4.3 + p C M V N S - l  134  87%  Appendix B This appendix contains the raw data and analysis from  two competition  replication assays as summarised i n the Results section, Table 5. Data from each assay is presented on a single page, with each slot-blot hybridization presented next to a table reporting the contents and quantitation values for each o f segments 1 through 8 and a graph displaying the least-squares curvefit for the standards (segments 1 through 5 o f the blot). The equation o f this curvefit was used to determine the amount o f D N A present in each o f the experimental samples (segments 6 through 8). Segments 9 and 10 of each blot are p C M V N S - 1 and p J B L R 4 . 3 hybridization controls, respectively, and are not quantitated. For each mutant, the hybridization and analysis with mutant-specific probe is presented first and that with J A V A probe (for both mutant and wild-type minigenome) second. Mutant-specific probes were S20E oligonucleotide for p J B L R 4 . 3 S 2 0 , and S21B oligonucleotide for p J B L R 4 . 3 S 2 1 . Following the results from the individual assays, the pooled data used to generate Table 5 is presented.  135  pJBLR4.3S20  1  9  2  10  Competition Replication Assays Segment #  Contains  Volume  1 2 3 4 5 6 7 8  pJBLR4.3S20 pJBLR4.3S20 pJBLR4.3S20 pJBLR4.3S20 pJBLR4.3S20 Assay 1 Assay 2 Assay 3  240317.44 55696.29 15678.42 17823.71 10897.33 98308.93 71361.42 99753.62  3 4  5  ngDNA  104 21 4.3 0.833 0.167 44.38 30.90 45.10  Standard Curve, S20-specific 120  j  y=0.0005x- 4.7783 R = 0.9987  100  S20-specific probe  2  80  < zQ  60  D) C  40 20 00  100000  200000  300000  Signal  1 2  9  Segment #  Contains  Volume  1 2 3 4 5 6 7 8  pJBLR4.3S20 pJBLR4.3S20 pJBLR4.3S20 pJBLR4.3S20 pJBLR4.3S20 Assay 1 Assay 2 Assay 3  973893.56 202643.25 48362.76 32162.07 34287.34 1.06E+06 815222.81 1.07E+06  18  3  4 5  i  7 Standard Curve, S 2 0 - J A V A  8  120 100  J A V A probe  < z Q  Ut c  80  y=0.0001x-2.141 R = 0.9994 2  60 40 20 0 500000 signal  136  1000000  ngDNA  104 21 4.3 0.833 0.167 103.86 79.38 104.86  pJBLR4.3S21 Competition Replication Assays Segment §  1 2 3 4 5 6 7 8  Contains  Volume  pJBLR4.3S21 341062.06 pJBLR4.3S21 105871.18 pJBLR4.3S21 68071.81 pJBLR4.3S21 67478.59 pJBLR4.3S21 71762.8 Assay 1 240925.11 Assay 2 180537.38 Assay 3 185691.91  ng DNA  104 21 4.3 0.833 0.167 73.58 49.42 51.48  S t a n d a r d C u rve, S 2 1 -S p ec ific 120  i  ,  S21-specific probe  0  100000  200000  300000  400000  s Igna I  1 2  9 II  Segment #  Contains  Volume  ng DNA  1 2 3 4 5 6 7 8  pJBLR4.3S21 pJBLR4.3S21 pJBLR4.3S21 pJBLR4.3S21 pJBLR4.3S21  953157.38 180199.53 70820.98 45432.23 42311.44 1.19E+06 767760.12 818158.19  104 21 4.3 0.833 0.167 115.87 73.65 78.69  Assay 1 Assay 2 Assay 3  Standard Curve, S21-JAVA  y = C-.0001x-3.1299  J A V A probe  0  500000 Signal 137  1000000  References  Diffley,!, J. Cocker, S. Dowell, and A. Rowley. 1994. Two steps in the assembly of complexes at yeast replication origins in vivo Cell 78:303-316 1  2  Diffley,J. 1994. Eukaryotic DNA replication. Current Opinion in Cell Biology 6:368-372  Bell, S. 1995. Eukaryotic replicators and associated protein complexes. Current Opinion in Genetics and Development 5:162-167 3  Eckdahl, T., and J. Anderson. 1990. Conserved DNA structures in origins of replication. Nucl. Acids Res. 18(6):1609-1612.  4  Astell, C , M.B. Chow, and D.C. Ward. 1985. Sequence analysis of the termini of virion and replicative forms of minute virus of mice DNA suggests a modified rolling hairpin model for autonomous parvovirus dna replication. J. Virol. 54(1): 171-177 5  Astell, C , Q. Liu, C. Harris, J. Brunstein, H. Jindal, and P. Tarn. 1996. Minute virus of mice cw-acting sequences required for genome replication and the role of the trans-acting viral protein, NS-1. Progress in Nucleic Acids Research and Molecular Biology 55:245-285. 6  Cotmore, S., and P. Tattersall. 1987. The autonomously replicating parvoviruses of vertibrates. Adv. Virus Res. 33:91-174.  7  Tennant, R., and R. Hand. 1970. Requirement for cellular synthesis for killham rat virus replication. Virology 42:1054  8  Astell, C , W. Luo, J. Brunstein, and J. St.-Amand. 1997. B19 parvovirus: biochemical and molecular features. In: Monographs in Virology, Volume 20. L.J. Anderson and N. Young, Editors. Karger AG, Switzerland. Pages 16-41.  9  Clemens, K, and D. Pintel. 1988. Two transcriptional units of the autonomous parvovirus minute virus of mice are transcribed in a temporal order. J. Virol. 62(4):1448-1451 10  11  Pringle C. 1993. Arch. Virol.494  12  Crawford, L.V. 1966. A minute virus of mice. Virology 29:605-612  Angbandje-McKenna, M.m R. McKenna, I. Portman, E. Hernando, J. Almendral, A. Llamas-Saiz, C. Foces-Foces, F. Wang, P. Tattersall, and M. Rossman. 1997. The 3D structure of Minute Virus of Mice: implications for parvoviral tissue tropism and encapsidation of parvoviral genomic DNA. Abstract of presentation at the VII International Parvovirus Workshop, Heidelberg Germany. 13  Tattersall, P., P. Cawte, A. Shatkin, and D. Ward. 1976. Three structural polypeptides coded for by minute virus of mice, a parvovirus. J. Virol 20:(1) 273-289. 14  Astell, C , M. Thomson, M. Merchlinsky, and D. Ward. 1983. The complete DNA sequence of minute virus of mice, an autonomous parvovirus. NAR 11(4):999-1018. 15  Pintel, D., D. Dadachanji, C. Astell, and D. Ward. 1983. The genome of minute virus of mice, an autonomous parvovirus, encodes two overlapping transcription units. NAR 11(4): 1019-1038. 16  Morgan, W., and D. Ward. 1986. Three splicing patterns are used to excise the small intron common to all minute virus of mice RNAs. J. Virol. 60(3): 1170-1174. 17  Clemens, K., and D. Pintel. 1987. Minute virus of mice (MVM) mRNAs predominantly polyadenylate at a single site. Virology 160:511-514. 18  138  19  Haut, D., and D. Pintel. 1996. Determinants which influence alternative splicing of parvovirus premRNAs. Presentation at the annual meeting of the American Society for Virology, London Ontario. Gersappe, A., L. Burger, and D. Pintel. 1996. A small bipartite determinant within the MVM NS2specific exon governs its inclusion into mature spliced mRNA. Presentation at the annual meeting of the American Society for Virology, London Ontario. 20  Lorson, C , L. Burger, M. Mouw, and D. Pintel. 1996. Efficient transactivation of the minute virus of mice P38 promoter requires upstream binding of NS-1. J. Virol. 70(2):834-842. 21  Ahn, J., Z. Pitluk, and D. Ward. 1992. The GC box and TATA transcription control elements of the P38 promoter of the minute virus of mice are necessary and sufficient for transactivation by the nonstructural protein NS-1. J. Virol. 66(6):3776-3783. 22  Yeung, D., G. Brown, P. Tarn, R. Russnak, G. Wilson, I. Clark-Lewis, and C. Astell. 1991. Monoclonal antibodies to the major non-structural nuclear protein of minute virus of mice. Virology 181:35-45. 23  Cotmore, S., L. Sturzenbecker, and P. Tattersall. 1983. The autonomous parvovirus MVM encodes two nonstructural proteins in addition to its capsid polypeptides. Virology 129:333-343. 24  Shade, R., M. Blundell, S. Cotmore, P. Tattersall, and C. Astell. 1986. Nucleotide sequence and genome organization of human parvovirus B19 isolated from the serum of a child during aplastic crisis. J. Virol. 58(3):921-936.  25  Astell, C, C. Mol, and W. Anderson. 1987. Structural and functional homology of parvovirus and papovavirus polypeptides. J. Gen. Virol. 68:885-893. 26  Liu, Q., C.B. Yong, and Caroline R. Astell. 1994. In vitro resolution of the dimer bridge of minute virus of mice (MVM) genome supports the modified rolling hairpin model for DNA replication. Virology 201: 251-262. 27  Wilson, Gary M., Hitesh K. Jindal, Douglas E. Yeung, Wei Chen, and Caroline R. Astell. 1991. Expression of minute virus of mice major nonstructural protein in insect cells: purification and identification of ATPase and helicase activities. Virology 185: 90-98 28  Christensen, J., S. Cotmore, and P. Tattersall. 1995. Minute virus of mice transcriptional activation protein NS-1 binds directly to the transactivation region of the viral P38 promoter in a strictly ATPdependent manner. J. Virol. 69(9):5422-5430. 2 9  Gottleib, R., J. Christensen, S. Cotmore, and P. Tattersall. 1996. Characterization of the interaction between MVM NS-1 and its cognate DNA binding site. Presentation at the annual meeting of the American Society for Virology, London Ontario. 30  Jindal, Hitesh K., Carl B. Yong, Gary M. Wilson, Patrick Tarn, and Caroline R. Astell. 1993. Mutations in the NTP-binding motif of minute virus of mice (MVM) NS-1 protein uncouple ATPase and helicase  31  functions. J. Biol. Chem. 269(5):3283-3289.  Mouw, M.B., J.L. Pearson and D.J. Pintel. 1996. Characterization of the biochemical properties of an MVM GST-NS-1 fusion protein. Presentation at the 15th Annual Meeting of the ASV,London Ontario. 32  Nuesch,J., Corbau, R., Tattersall, P., and Rommelaere,J. 1996. Replication activites of MVM NS-1 are regulated through phosphorylation. Presentation at the 15th Annual Meeting of the ASV, London Ontario. 33  Cotmore, Susan F., and Peter Tattersall. 1988. The NS-1 polypeptide of minute virus of mice is covalently attached to the 5' termini of duplex replicative-form DNA and progeny single strands. J. Virol. 62 (3):851-860.  3 4  35  Colin Harris, unpublished data  Krady, J.K., and D.C. Ward. 1995. Transcriptional activation by the parvoviral nonstructural protein NS1 is mediated via a direct interaction with SP-1. Mol. Cell. Biol. 15(l):524-533.  3 6  139  37  Schoborg, R., and D. Pintel. 1991. Accumulation of MVM gene products is differentially regulated by transcription initiation, RNA processing and protein stability. Virology 181:22-34. 38  Cotmore, S., and P. Tattersall. 1990. Alternate splicing in a parvoviral nonstructural gene links a common amino-terminal sequence to downstream domains which confer radically different localization and turnover characteristics. Virology 177:477-487. Naeger,Lisa, Jean Cater, and David J. Pintel. 1990. The small nonstructural protein (NS2) of the parvovirus minute virus of mice is required for efficient DNA replication and infectious virus production in a cell-type-specific manner. J. Virol. 64(12):6166-6175. 39  Naeger,Lisa, Nathalie Salome, and David J. Pintel. 1993. NS2 is required for efficient translation of viral mRNA in minute virus of mice-infected murine cells. J. Virol. 67(2): 1034-1043. 40  Cotmore, S., A. D'Abramo Jr., L. Carbonell, J. Bratton, and P. Tattersall. 1997. The NS2 polypeptide of parvovirus MVM is required for capsid assembly in murine cells. Virology 231(2):267-280. 41  Mousset, Suzanne, Youssef Ouadrhiri, Perrine Caillet-Fauquet, and Jean Rommelaere. 1994. The cytotoxicity of the autonomous parvovirus minute virus of mice nonstructural proteins in FR3T3 rat cells depends on oncogene expression. J. Virol. 68(10):6446-6453.  42  Legendre, D., and J. Rommelaere. 1992. Terminal regions of the NS-1 protein of the parvovirus minute virus of mice are involved in cytotoxicity and promoter frara-inhibition. J. Virol. 66(3):5705-5713.  43  Vanacker, Jean-Marc, V. Laudet, G. Adelmant, D. Stehelin, and J. Rommelaere. 1993. interconnection between thyroid hormone signalling pathways and parvovirus cytotoxic functions. J. Virol. 67(12):76687672. 44  45  Paradiso, Peter R. 1983. Analysis of the protein-protein interactions in the parvovirus H-l capsid. J. 46(1):94-102.  Virol.  Willwand, Kurt, and Bernard Hirt. 1991. The minute virus of mice capsid specifically recognizes the 3'hairpin structure of the viral replicative-form DNA: mapping of the binding site by hydroxyl radical footprinting. J. Virol. 65(9):4629-4635.  46  Tullis, G. L. Burger, and D. Pintel. 1993. The minor capsid protein VP1 of the autonomous parvovirus minute virus of mice is dispensable for encapsidation of progeny single-stranded DNA but is required for infectivity. J. Virol. 67(1): 131-141.  47  Willwand, K., and B. Hirt. 1993. The major capsid protein of mniute virus of mice (MVM) can form particles which bind to the 3' terminal hairpin of MVM replicative form DNA and package single-stranded viral progeny DNA. J. Virol. 67(9):5660-5663.  48  Santaren, Juan F., Juan C. Ramirez, and Jose M. Almendral. 1993. Protein species of the parvovirus minute virus of mice strain MVMp: involvement of phosphorylated VP-2 subtypes in viral morphogenesis.  49  J. Virol. 67(9):5126-5138.  Krysan, P., J. Smith, and M. Calos. 1993. Autonomous replication in human cells of multimers of specific human and bacterial DNA sequences. Mol. Cell. Biol. 13(5):2688-2696. 50  Bramhill, D., A. Kornberg. 1988. Duplex opening by dnaA protein at novel sequences in intitiation of replication at the origin of the E. coli chromosome. Cell 52(5):743-755 51  Bramhill, D., A. Kornberg. 1988. A model for initiation at origins of DNA replication. Cell 54(7):915918 52  53  Waga, S., and B. Stillman. 1994. Anatomy of a DNA replication fork revealed by reconstitution of SV40  replication in vitro. Nature 369:207-212.  140  SenGupta, Dhruba, and James A. Borowiec. 1994. Strand and face: the topography of interactions between the SV40 origin of replication and T-antigen during the initiation of replication. EMBO J. 13(4): 982-992. 54  Toyn, J., W. Toone, B. Morgan, and L. Johnston. 1995. The activation of DNA replication in yeast. TIBS 20:70-73. 55  Almouzni, G. 1994. The origin recognition complex (ORC):the stone that kills two birds. 16(4):233-235.  56  BioEssays  57  Wang, T., and J. Li. 1995. Eukaryotic DNA replication. Curr. Opin. Cell Biol. 7:414-420.  58  Donovan, S., and Diffley J. 1996. Replication origins in eukaryotes. Curr. Opin. Genet. Dev. 6:203-207.  Carpenter, P., P. Mueller, and W. Dunphy. 1996. Role for a Xenopus Orc-2 related protein in controlling DNA replication. Nature 379:357-360. 59  Rowles, A., J. Chong, L. Brown, M. Howell, G. Evan, and J. Blow. 1996. Interaction between the origin recognition complex and the replication licensing system in Xenopus. Cell 87:287-296. 6 0  Diffley, J. J. Cocker, S. Dowell, and A. Rowley. 1994. Two steps in the assembly of complexes at yeast replication origins in vivo. Cell 78:303-316.  61  62  Rowles, A, and J. Blow. 1997. Chromatin proteins involved in the initiation of DNA replication. Curr.  Opin. Genet. Dev.7:152-157.  Burhans, W., L. Vassilev, M. Caddie, N. Heintz, and M. DePamphilis. 1990. Identification of an origin of bidirectional DNA replication in mammalian chromosomes. Cell 62:955-965. 63  Mastrangelo, I, P. Held, L. Dailey, J. Wall, P. Hough, N. Heintz, and N. H. Heintz. 1993. RIP60 dimers and multiples of dimers assemble link structures at an origin of bidirectional replication in the dihydrofolate reductase amplicon of C h i n e s e hamster ovary cells. J. Mol. Biol. 232:766-778. 64  Dailey, L., M. Caddie, N. Heintz, andN.H. Heintz. 1990. Purification of RIP60 and RIP100, mammalian proteins with origin-specific DNA-dinding and ATP-dependent DNA helicase activities. Mol. 65  Cell. Biol. 10(12):6225-6235.  Eckdahl, T., and J. Anderson. 1990. Conserved DNA structures in origins of replication. Nucl. Acids Res 18(6):1609-1612.  6 6  67  Williams, J.S., T. Eckdahl, and J. Anderson. 1988. Bent DNA functions as a replication enhancer in cerevisiae. Mol. Cell. Biol. 8:2763-2769  Saccheromyces 68  Cavalier-Smith, T. 1974. Palindromic base sequences and replication of eukaryotic chromosome ends.  Nature 250:467-470. 6 9  Rhode, S.L. 1976. J. Virol. 17:659-667.  Tarn, P., and C. Astell. 1993. Replication of minute virus of mice minigenomes: novel replication elements required for MVM DNA replication. Virology 193:812-824.  7 0  Samulski, R., A. Srivastava, K. Berns, andN. Muzyczka. 1983. Rescue of adeno-associated virus from recombinant plasmids:gene correction within the terminal repeats of AAV. Cell 33:135-143. 71  Senapathy, P, J. Tratschin, and B. Carter. 1984. Replication of adeno-associated virus DNA. Complementation of naturally occurring rep- mutants by a wild-type genome or an ori- mutant and correction of terminal palindrome deletions. J. Mol. Biol. 179(1): 1-20. 72  73  Ward, P., and K. Berns. 1995. Minimum origin requirements for linear duplex AAV DNA replication in  vitro. Virology 209:692-695.  141  Bates, R., C. Snyder, P. Banerjee, and M. Sankar. 1984. Autonomous parvovirus LuIII encapsidates equal amounts of plus and minus DNA strands. J. Virol. 49:31974  Berns, K. 1991. Parvoviridae and their replication. Fundamental Raven Press Ltd. New York. 75  Virology. Chapter 32, Second edition.  Astell C.R., M. Thomsom, M.B. Chow, and D.C. Ward. 1983. Structure and replication of minute virus of mice DNA. Cold Spring Harbour Symposia on Quantitative Biology, Vol. XL VII: 751-761. 76  7 7  Maniloff, J. 1975. Thermodynamic considerations of the deoxyribonucleic acid helix-cruciform  transition. J. Theor. Biol. 53:497-501.  Rhode, S.L. and Belia Klaassen. 1982. DNA sequence of the 5' terminus containing the replication origin of parvovirus replicative form DNA. J. Virol. 4l(3):990-999. 78  Tarn, P., and C. Astell. 1994. Multiple cellular factors bind to cis-regulatory elements found inboard of the 5' palindrome of minute virus of mice J. l/>o/.68(5):2840-2848. 79  /  Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning. Cold Springs Laboratory Second Edition.  80  Press,  Xiang, C , H. Wang, P. Shiel, P. Berger, and D.J. Guerra. 1994. A modified alkaline lysis miniprep protocol using a single microcentrifuge tube. BioTechniques 17(l):30-32. 81  Hirt, B. 1967. Selective extraction of polyoma DNA from infected mouse cell cultures. J. Mol. Biol. 26:365-369. 82  Gluzman, Y. 1981. SV-40 transformed simian cells support the replication of early SV40 mutants. Cell 23:175-182. 83  84  Littlefield, J. 1964. Three degrees of guanylic acid-inosinic acid pyrophosphorylase deficiency in mouse  fibroblasts. Nature 203:1142-1144. 85  Nawotka, K., and J. Huberman. 1988. Two-dimensional gel electrophoretic method for mapping DNA  replicons. Mol. Cell. Biol. 8(4):1408-1413.  Huberman, J., L. Spotilla, K. Nowatka, S. El-Assouli, and L. Davis. 1987. The in vivo replication origin of the yeast 2 um plasmid. Cell 51:473-481. 86  Faust, E., and D. Ward. 1979. Incomplete genomes of the parvovirus minute virus of mice: selective conservation of genome termini, including the origin for DNA replication. J. Virol. 32:276-292. 87  Salvino, M., M. Skiadopoulos, E. Faust, P. Tarn, R. Shade, and C. Astell. 1991. Two spatially distinct genetic elements constitute a bipartite DNA replication origin in the minute virus of mice genome. J. Virol. 65(3):1352-1363. 88  89  Yong, C. Unpublished data.  Vovis, G. F. and Lacks, S. 1977. Complimentary action of restriction enzymes endo R-Dpnl and endo RDpnll on bacteriophage fl DNA. J. Mol. Biol. 115:525-538 9 0  Wang, M., and R. Reed. 1993. Molecular cloning of the olfactory neuronal transcription factor Olf-1 by genetic selection in yeast. Nature 364:121-126.  91  9 2  Atschul, S., W. Gish, W. Miller, E. Myers, and D. Lipman. 1990. Basic local alignment search tool. J.  Mol. Biol. 215:403-410.  Zeltser, L., C. Desplan, and N. Heintz. 1996. Hoxb-13: a new Hox gene in a distant region of the HOXB cluster maintains colinearity. Development 122:2475-2484.  93  9 4  Colleta, P. L., S. Shimeld, and P. Sharpe. 1994. The molecular anatomy of HOX gene expression. J.  Anat. 184:15-22.  142  Heintz, N . Personal communication. Dept. of Pathology, University of Vermont. 9 6  Houtchens, C . Personal communication. Dept. of Pathology, University of Vermont.  Russel, J. and M . Botchan. 1995. Cw-acting components of human papillomavirus (HPV) D N A replication: linker substitution analysis of the HPV type 11 origin. J. Virol. 69:651-660. 9 7  Goulian, M . , R. Kollek, D. Revie, W. Burhans, C. Carton, and B. Tseng. 1983. Parvovirus D N A replication. In: Mechanisms of DNA replication and recombination, U C L A Symposium on Molecular and Cellular Biology, New Series. 10:367-379. 9 8  Kollek, R., B. Tseng, and M . Goulian. 1982. D N A polymerase requirements for parvovirus H - l D N A replication in vitro. J. Virol. 41:982-989. 9 9  Kollek, R., and M . Goulian. 1981. Synthesis of parvovirus H - l replicative form from viral D N A by D N A polymerase y. Proc. Natl. Acad. Sci. USA. 78:6206-6210. 1 0 0  Cossons, N . , E . Faust, and M . Zannis-Hadjopoulos. 1996. D N A polymerase 5-dependent formation of a hairpin structure at the 5' terminal palindrome of the minute virus of mice genome. Virology 216:258-264. 1 0 1  Baldauf, A . , K . Willwand, E . Mumtsidu, J. Niiesch, and J. Rommelaere. 1997. Specific initiation of replication at the right-end telomere of the closed species of minute virus of mice replicative-form D N A . J. Virol. 71:971-980. 1 0 2  143  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0088742/manifest

Comment

Related Items