Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Cis-element absolutely required for HIV-I pathogenesis and purification of its trans-acting factor RBF-2 Establo-Ferrero, Mario Clemente 1998

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1998-271374.pdf [ 21.17MB ]
Metadata
JSON: 831-1.0088705.json
JSON-LD: 831-1.0088705-ld.json
RDF/XML (Pretty): 831-1.0088705-rdf.xml
RDF/JSON: 831-1.0088705-rdf.json
Turtle: 831-1.0088705-turtle.txt
N-Triples: 831-1.0088705-rdf-ntriples.txt
Original Record: 831-1.0088705-source.json
Full Text
831-1.0088705-fulltext.txt
Citation
831-1.0088705.ris

Full Text

ds-element absolutely required for HIV-1 pathogenesis and purification of its trans-acting factor RBF-2 by Mario Clemente Estable-Ferrero B.Sc. (Biology), University of Ottawa, 1985 M.Sc. (Biochemistry), Universite Laval, 1987  A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY THE FACULTY OF GRADUATE STUDIES (Department of Pathology) I I accenMhis thesis as conforming  THE UNIVERSITY OF BRITISH COLUMBIA April, 1998 © Mario Clemente Estable Ferrero, 1998  In presenting this thesis in partial fulfilment  of the requirements for an advanced  degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department  or by his  or  her  representatives.  It is  understood  that  copying or  publication of this thesis for financial gain shall not be allowed without my written permission.  Department The University of British Columbia Vancouver, Canada  DE-6 (2/88)  MCEF  1998  Abstract HIVs are classified into types 1 or 2, groups, subtypes, and specific isolates. They infect C D 4 T-lymphocytes and +  monocyte/ macrophages. Infection and destruction of C D 4 T-lymphocytes occurs at the pace of billions per day. +  This massive HTV and C D 4  +  T-lymphocyte turnover, combined with mutation rate, results in extensive HIV  sequence polymorphism. After an average of 11 years, CD4 decline from unbalanced turnover, leads to AIDS and inexorably death. In this thesis I first determined that HIV-1 in Vancouver are of envelope and L T R group M , subtype B . I then extensively investigated the L T R .  The L T R contains sequences responsible for R N A pol II recognition and  transcription of the HIV-1 genes. I first derived 476 L T R sequences from patients at all stages of HIV-1 infection. I found a surprising number of point and length polymorphisms, predicted to impair binding to targets for dogmatically entrenched transcription factors deemed essential to H I V - l .  Some are novel, others have previously  been described. I further investigated the function for some L T R variants. I found a wide range of transcription activities, and correlate some to specific sequence polymorphisms. I found no obvious correlation with disease stage for any polymorphism. A -121 position  polymorphism, that I termed the Most Frequent Naturally occurring  Length Polymorphism (MFNLP), was further investigated. M F N L P s occurred in 38% of patients I sampled.  I found no phenotype for M F N L P bearing L T R s .  Importantly, I first propose and then prove that M F N L P s all harbor binding sites for the recently characterized transcription factor RBF-2, known to bind the HIV-1 L T R . Thus the M F N L P duplicates an RBF-2 site. Although none of the postulated transcription factor binding sites of the HIV-1 L T R escapes mutation in vivo, only an RBF-2 site is invariably compensated by co-occurrence of it's duplication. Because of M F N L P s , I found an RBF-2 target to be the most conserved site of naturally occurring HIV-1 LTRs.  Using M F N L P deleted isogenic mutants, I found a  repressive phenotype for the M F N L P s , but only in cells with detectable levels of RBF-2.  I further describe the  biochemical purification of RBF-2. Analysis of oligo-affinity purified RBF-2 suggests it is a novel complex. A l l LTRs I have examined, that are derived from patients that progress towards AIDS, have the ability to bind RBF-2. Assuming the current view that viral turnover is itself pathogenic, then by extension, I conclude that the RBF-2 cw-acting element, encompassed in M F N L P s , is required for HIV-1 pathogenesis in vivo.  Abstract  II  MCEF  1998  Table of Contents ABSTRACT  II  TABLE OF CONTENTS  Ill  LIST OF TABLES  V  LIST OF FIGURES  VI  LIST OF ABBREVIATIONS  VIII  ACKNOWLEDGMENTS  XII  DEDICATION  XIII  INTRODUCTION  1  T H E F A M I L Y RETROVIRIDAE RETROVIRIDAE GENETIC POLYMORPHISM T H E GENUS LENTIVIRUS T H E PRIMATE LENTIVIRUS RECEPTOR T H E T CELL-RECEPTOR (TCR)  1 6 8 9 12  FflV  14  T H E HIV-AIDS PANDEMIC  18  HIV-1 AND AIDS  21  HIV-1  26  TRANSCRIPTION  RATIONALE  32  MATERIALS AND METHODS  34  PHYLOGENETIC ANALYSIS DESCRIPTION OF PATIENTS A N D SAMPLES FOR LTR ANALYSIS AMPLIFICATION A N D CLONING OF PROVIRAL HIV-1 5'-LTRs  34 34 36  POLYMORPHISM SCREENING TRANSFECTIONS A N D CAT ASSAYS ELECTROPHORETIC MOBILITY SHIFT ASSAYS  36 40 40  D N A S E I FOOTPRINTING SITE DIRECTED MUTAGENESIS HEPARIN-AGAROSE AFFINITY CHROMATOGRAPHY ION EXCHANGE CHROMATOGRAPHY OLIGO-AFFINITY CHROMATOGRAPHY SDS-PAGE A N D SILVER STAINING  42 42 43 43  41 ;  45  DISTINCT CLUSTERING OF HIV-1 SEQUENCES DERIVED FROM INJECTION DRUG USERS VERSUS NON-INJECTION DRUG USERS IN VANCOUVER, CANADA  46  HIV-1 LTR VARIANTS FROM 42 PATIENTS REPRESENTING ALL STAGES OF INFECTION DISPLAY A WIDE RANGE OF SEQUENCE POLYMORPHISM AND TRANSCRIPTION ACTIVITY  50  INTRODUCTION  50  RESULTS  52  In vivo HIV1 LTRs consist of two uncoupled loci In vivo HIV-1 LTR sequences from -305 to -206. In vivo HIV-1 LTR sequences from -205 to -122 Table of Contents  52 56 56 III  MCEF In vivo HIV-1 LTRsfrom  38% of patients harbor the most frequent  naturally  occurring  length  polymorphism  (MFNLP), absent from the prototype LTR In vivo HIV-1 LTR sequences from -121 to -82 In vivo HIV-1 LTR sequences from -81 to -40 In vivo HIV-1 LTR sequences from -40 to +78 In vivo HTV-1 LTRs displayed differential basal-transcription patterns in U937 and Jurkat cell lines In vivo HIV-1 LTRs, display TAR-dependent and TAR-independent, Tat-unresponsiveness No definitive phenotype could be attributed to MFNLPs RBF-1 and c-Ets I bind to 5'-ATCC-3' but not to 5'-ACCC-3' in LTR variant Ets -1/RBF-l sites TAR independent Tat-unresponsiveness (pMCE16.1) correlates to abrogated binding of nuclear factors to the TATA box DISCUSSION  NATURALLY OCCURRING HIV-1 LTRS HAVE A FREQUENTLY OBSERVED DUPLICATION THAT BINDS RBF-2 AND REPRESSES TRANSCRIPTION INTRODUCTION RESULTS Two different MFNLPs form a specific complex with the same nuclear factor from Jurkat cells The TGA-specific complexes formed with MFNLP-A and B can be competed by oligonucleotides RBF-2 MFNLP-A or -B oligonucleotides compete for binding of RBF-2 to RBE III Most MFNLPs do not bind ETS family members or hLEF MFNLPs inhibit HIV-1 LTR-directed transcription in cells expressing RBF-2  1998 57 57 58 58 58 62 62 63 63 65  69 69 71 71  recognizing  DISCUSSION  75 77 79 82 84  BIOCHEMICAL PURIFICATION OF RBF-2  89  INTRODUCTION  89  RESULTS RBF-2 binds to Heparin-Agarose and elutes at high salt concentration RBF-2 binds to a strong anion exchanger and elutes in low salt concentration RBF-2 does not bind to an RBEIir"" affinity column, but does binds to an Oligo-affinity purified RBF-2 contains at least 5 polypeptides OA-RBF-2 appears to be a novel complex. DISCUSSION  90 90 95 95 100 100 100  CONCLUSIONS  103  REFERENCES  104  APPENDIX  127  Table of Contents  RBEIIF' affinity  column  rv  MCEF L i s t of  1998  Tables  TABLE 1.1 MODIFIED W H O STAGING SYSTEM  19  TABLE 2.1 COHORT DESCRIPTION  35  TABLE 6.1 R B F - 2 PURIFICATION STRATEGY  91  List  of  Tables  V  MCEF  1998  List of Figures FIGURE 1.1. SCHEMATIC REPRESENTATION OF A RETROVIRUS PARTICLE AND PROVIRAL D N A  2  FIGURE 1.2. SCHEMATIC REPRESENTATION OF THE ESTABLISHMENT AND PRODUCTIVE PHASES OF THE RETROVIRIDAE LIFE CYCLE  3  FIGURE 1.3. SCHEMATIC REPRESENTATION OF RETROVIRAL REVERSE TRANSCRIPTION  4  FIGURE 1.4. SCHEMATIC REPRESENTATION COMPARING THE GENOMIC ORGANIZATION OF HIV-1 AND HIV-2  10  FIGURE 1.5. T H E T C R , M H C PRESENTATION AND SIGNAL TRANSDUCTION  11  FIGURE 1.6. TYPICAL TIME-COURSE OF A HIV-1  22  INFECTION  FIGURE 1.7. SCHEMATIC REPRESENTATION OF THE PROTOTYPICAL HIV-1 PROVIRAL 5 ' - L T R  27  FIGURE 2.1. COHORT DESCRIPTION  37  FIGURE 2.2. P M C E CONSTRUCTS  38  FIGURE 2.3. ACCURACY AND STATUS OF SEQUENCING  39  FIGURE 3.1. HIV-1  47  SUBTYPES IN V A N C O U V E R  FIGURE 3.2. CLUSTERING OF IDU-DERIVED SEQUENCES  48  FIGURE 4.1. SCHEMATIC REPRESENTATION OF AMPLIFICATION, CLONING AND SEQUENCING STRATEGIES  53  FIGURE 4.2. ALIGNMENT OF 67 HIV-1 5 ' - L T R SEQUENCES DERIVED FROM THE 42 PATIENTS IN TABLE 1  54-55  FIGURE 4.3. TITRATION OF D N A QUANTITIES USED FOR TRANSFECTIONS  60  FIGURE 4.4. RELATIVE C A T ACTIVITIES FOR 23 CLONES COMPARED TO PMCE36.1  61  FIGURE 4.5. RAS-RESPONSIVENESS IS NOT A DISTINCT M F N L P - B E A R I N G L T R PHENOTYPE  64  FIGURE 4.6. ALIGNMENT OF P M C E CLONES IN THE M F N L P REGION, FROM PATIENT MCE#63 FIGURE 5.1. SCHEMATIC REPRESENTATION OF L T R LENGTH POLMORPHISMS AND OLIGOS USED  67  72-73  FIGURE 5.2. M F N L P - A BINDS A SPECIFIC FACTOR FROM JURKAT NUCLEAR EXTRACTS  74  FIGURE 5.3.  76  M F N L P - B BINDS A SPECIFIC FACTOR FROM JURKAT NUCLEAR EXTRACTS  FIGURE 5.4. THE SPECIFIC COMPLEX FORMED BY M F N L P S AND JURKAT NUCLEAR EXTRACTS IS INDISTINGUISHABLE FROM R B F - 2  78  FIGURE 5.5. RECOMBINANT ETS AND H L E F DO NOT BIND MOST M F N L P S  80-81  FIGURE 5.6. M F N L P s REPRESS TRANSCRIPTION IN JURKAT CELLS  83  FIGURE 5.7. T H E REPRESSIVE EFFECT OF THE M F N L P REQUIRES R B F - 2  85  List of Figures  VI  MCEF  FIGURE 6.1.  TYPICAL R B F - 2 E M S A  1998  92  FIGURE 6.2. THE R B F - 2 E M S A PROFILE BINDS AND ELUTES FROM HEPARIN-AGAROSE IN HIGH SALT  93  FIGURE 6.3. HEPARIN-AGAROSE CHROMATOGRAPHY FRACTION C RETAINS R B F - 2 BINDNG SPECIFICITY  94  FIGURE 6.4. R B F - 2 BINDS TO M O N O - Q AND ELUTES IN LOW SALT  96  FIGURE 6.5. TITRATION OF DI-DC ON M O N O - Q R B F - 2 FRACTION  97  FIGURE 6.6. R B F - 2 DOES NOT BIND TO AN R B E I I I  98  FIGURE 6.7. R B F - 2 DOES BIND TO AN R B E I I I  W T  M U T  AFFINITY COLUMN  AFFINITY COLUMN  FIGURE 6.8. OLIGO-AFFINITY PURIFED R B F - 2 APPEARS TO CONTAIN AT LEAST 5 POLYPEPTIDES  List of Figures  99 101  VH  MCEF  1998  List of abbreviations AIDS -ss +SS  ss agm amp ABI APC APARAM ARV BIV BLV bp bpb BSA c cCA CAEV CAT CC CD CDC Ci CMV CNS COMP cpm cpz CTD CTL Da DAG dd DOI ds DTT EDTA EIAV EM EMSA env ERT f FBS FDC FIV fm g GABP gag Grb GP  Acquired Immunodeficiency Syndrome minus strong stop plus_strong stop single stranded African green monkey ampicillin Applied Bjosystems Antigen Presenting Cell Activating ProteinAntigen Recognition Activation Motifs AIDS-Related Virus Bovine Immunodeficiency Virus Bovine Leukemia Virus base pair bromophenol blue Bovine Serum Albumin cellular carboxy CApsid Caprine Arthritis Encephalitis Virus Chloramphenicol Acetytransferase Chemokine Complex of Differentiation Center for Disease Control Curie Cytomegalo Virus Central Nervous System competitor counts per minute Chimpanzee Carboxy Terminal Domain Cytotoxic T Lymphocyte Dalton Djacyl Glycerol double distilled Duration Of Infection double stranded Di-Thio-Threitol di-sodium ethylenediamine tetraacetate Equine Infectious Anemia Virus Electron Microscopy Electrophoretic Mobility Shift Assay envelope Endogenous Reverse Transcription femto Fetal Bovine Serum Folicular Dendritic Cell Feline Immunodeficiency Virus femtomole gram Guanine Adenine Binding Protein group specific antigen Grouth receptor bound protein glycoprotein List of  Abbreviations  vm  MCEF  gp  GTF h HA HaHFV HHV HIV Holo HSV HTLV hu  IDU IKB  IL In InR IP3  krpm  LANL LAV LBP LC-MS/MS LEF LTR m Ug ~g  (lgm M mM MA mac MAPK MAPKK MCS MFNLP MHC mnd Mo-MLV MMTV MPMV MQ MSV mut n NA NC NE NEN Nef NERT NFAT r  sm  1998  glycoprotein  General Transcription Factor  human  Heparin-Agarose HarveyHuman Foamy Virus Human Herpes Virus Human Immunodeficiency Virus Holoenzvme Herpes Simplex Virus Human T-cell Lymphotropic Virus human  Injection Pjug User Inhibitor of N F K B Interleukin Integrase Initiator Region Inositol 1, 4, 5-Tris-phosphate thoulsand revolutions per minute  Los Alamos National Laboratory Lymphadenopathy Virus Leader Binding Protein  hquid chromatography-microspray/ mass spectrometry  Lymphoid Enhancer Factor Long Terminal Repeat millimicro-  micro gram mutation rate per genome mean mutation rate per genome molar  mUhmolar Matrix macaque  Mitogen Activated Protein Kinase MAPK Kinase multiple purpose cloning site  Most Frequent Naturally Occurring Length Polymorphism Major Histocompatibility Complex Mandrill Moloney Murine Leukemia Virus  Mouse Mammary Tumor Virus Mazon Pfizer Monkey Virus Mono-Q Murine Sarcoma Virus mutant  nano-  not available  Nucleocapsid Nuclear Extract New England Nuclear  Negative regulatory factor  Natural Endogenous Reverse Transcription Nuclear Factor of Activated T-cells List of  Abbreviations  IX  MCEF  NFIL-6 NFKB  NRE NSI nucOA°C E P PAGE PBMC pbs PCR PHA PKC PLC pm PMA pMCE PMSF PNK pol ppt pro PTKR PWGA R RBE RBF RRE RFT RPVT RSV R.T. RT SC SDS Sec SH SI SIV sm SP src SU syk TAF TAR TBE TBP TcR TCF TDA TF TLC TM  1998  Nuclear Factor of Interleukin 6 Nuclear Factor of kappa B immunoglobulin ge Negative Regulatory Element non-syncytium inducing nucleosomeOligo-AffinityDegrees Celsius protein gico poly-acrylamide gel electrophoresis Peripheral Blood Mononuclear Cells pimer binding site Polymerase Chain Reaction Phytohemmaglutinin Protein Kinase C Phoshohpase C gicomole Phorbol Myristate Acid plasmid constructed by Mario Clement Estable para-methy sulfonyl fluoride Poly Nucleotide Kinase polymerase poly purine tract protease protein tyrosine kinase receptor Pair Wise Group Alignment repeated Ras-responsive-region-Binding-Element Ras-responsive-region-Binding-Factor Rev Responsive Element Restriction Fragment Telomere Length Relative Peripheral Viral Titer Rous Sarcoma Virus Room Temperature Reverse Transcriptase sero converter Sodium Dodecyl Sulfate second Src Homology syncytium inducing Simian Immunodeficiency Virus Sootey Mangabey sero prevalent sarcoma causing Surface protein Sykes TBP-Associated Factors trans-activation response region Tris Boric acid EDTA Tata-Binding-Protein T-cell-Receptor T-Cell Factor target detection analysis Transcription Factor Thin Layer Chromatography trans membrane protein List of  Abbreviations  X  TNF U UCSF UN URE USF UVV-  V VIDUS VLAS wt [X]  < >  Tumor Necrosis Factor Unique University of California at S anFrancisco undifferentiated Up-Regulatory Element Upstream Stimulatory Factor Ultraviolet Light viralVolts Vancouver Injection Djug User Study Vancouver Lymphadenopathy Study wild type concentration of X less than more than  List of  Abbreviations  MCEF  1998  Acknowledgments I thank Ivan Sadowski for having provided an environment where ideas, models and experiments define the individual, and where substance is not secondary to form. His enthusiasm for science is contagious. I am grateful  for the contributions from the major co-authors on the papers emanating from the  experiments described in this thesis. Max Arella and Abderrazzack Merzouki were key to the experiments described in chapters 3 and 4. Brendan Bell was key to the experiments described in chapters 4, 5 and 6. Martin Hirst was key to the experiments described in chapters 5 and 6. These four co-authors, along with Ivan Sadowski, were an integral part of the intellectual design of my experiments and the interpretation of my results. I thank them here for this, as well as for their friendship during my years at U B C . Michael O'Shaughnessy ensured the continuation of the fiscal support required for me to finish my doctoral research in the Sadowski laboratory as well as the fiscal incentive to write-up my thesis. I thank him for having assumed a co-supervisor role, maintaining my link to the department of pathology. Sharon Cassol was responsible for my coming to Vancouver and for my joining the Sadowski Laboratory, with hindsight, I thank her here for both. I thank Julio Montaner, Martin Schechter and Kevin Craib for providing access to samples, laboratory and clinical data and statistical analysis. I thank John Rhode and Amy Olson for having read manuscripts at various stages of preparation. The vast majority of the reagents and infrastructure for the experiments described in this thesis were provided by grants to Ivan Sadowski and by the department of Biochemistry. On a personal note, I thank my parents (Dr. Juan Francisco Estable Puig & Dr. Rosita Mercedes Ferrero Mudarra de Estable) both scientists and co-authors on numerous publications with me. They nourished my early interest in science, have followed the trials and tribulations of my doctoral studies, shared the successes and failures of my experiments and never cease to amaze me in the wisdom of their advice. I thank my brothers (Juan Francisco, Jose Antonio, Luis Pablo) and my sisters (Alma Rosa, Cristina Isabel, Adriana Beatriz, Ana Maria), as well as my brothers-in-law (Jan (John), Jean-Marc, Tom) and sisters in-law (Alejandra, Julie, Caroline), my nephews (Daniel, Marco, Nikola, Tomas, Gabriel, Chak, Tom), my nieces (Melissa, Cecilia) my uncles (Clemente (Rayo), Victor, Mario, Norberto), my aunts (Sonia, Dora, Isabel, Racquel, Alba, Sonia, Mercedes) my cousins (Victoria, Giselle, Graciela, Sylvia, Marianela, Monica, Gustavo, Maria-Gabriela) and my grandparents (Clemente Estable & Isabel Puig, Mario Ferrero & Josefina Mudarra) for their encouragement and spiritual presence, particularly during difficult phases of my studies.  Acknowledgements  XII  MCEF 1998  Dedication  MN I STSO t 06 MT tBUCC O lN FUSUCA Y PSEVS IO I.N  SOCIAL  INSTITUTO DE I N V E S T l S A C f b N DE CiENCIAS BtOLOSICAS AV, ITALIA 3310  nmn  J » H  MONE tVO t EO. U8U08AY. A l£  /  /  ,  <?>U e£*Zi*^£*e*&rt ^U^^&^^J  <U(.A"<&*<Z+~a /Sfa^yr&i^  /  6> 7  Vancouver, 28-Avril, 1998  Si, 5t^o entusiasmadb con Cos experimentos. Les mando " noticias de Cos experimentos que Cogras...", en forma de esta tesis, recorddndb en Ca pantaCCa de mi cortex cerebraC, a mi queridisimo akmeCo CCemente, a quien Ce dedico esta tesis. Dedication  XIII  MCEF 1998  Introduction The Family Retroviridae Retroviruses exist as exogenous particles or integrated genomes (Fig. 1.1). Particles have an outer membrane spiked with peplomers serving as ligands to cell surface molecules, exploited as receptors. Binding leads to  membrane  fusion with the host cell, reverse transcription of the retroviral R N A genome into D N A and integration (Fig. 1.2-3). In the integrated form retroviruses are referred to as proviruses. Upon activation, transcription occurs from the 5'L T R . This leads to mRNAs coding for the viral proteins that are structural components of the viral particle (gag), components required for maturation/ reverse transcription/ integration (pro-pol) and components of the outer envelope peplomers (env). Components assemble at the membrane, pack 2 full-length transcripts as the viral genome, and bud from the surface of the cell, thus completing one full cycle (Fig. 1.2). The now classic 5'-LTR-gag/pro/pol-env- L T R - 3 ' proviral genomic configuration and life cycle models are depicted in figures 1.1-3. The path to these models began when Peyton Rous described a filterable agent capable of inducing sarcomas in chickens (Rous, 1910, Rous, 1911). The first classification of retroviruses relied on electron microscopy (EM) ultrastructure (Bernard, et al., 1953, Bernhard, 1960, Haguenau and Croissant, 1994, Sharp, et al., 1952). Early E M of R S V was instrumental to the notion that a virus could be an oncogenic agent.  E M also  revealed cytoplasmic maturation, membrane budding, and provided impetus for development of tissue culture to produce viral particles. Despite the utility of E M , elucidation of the details depicted in figures 1.1-3 had to await the advent of molecular biology techniques. Forty five years after the  in vivo oncogenicity of R S V was shown, the development of an in vitro tissue  culture assay, produced the first discrete R S V induced foci (Manaker and Groupe, 1956). Modification of this assay permitted the first quantitative correspondence between viral titer and number of "transformed" foci (Temin and Rubin, 1958), demonstration that the infected transformed cell produced new virus (Temin and Rubin, 1959) and that viral mutations altering the transforming phenotype occur spontaneously  (Temin, 1960).  I note Peyton Rous states 47 years earlier: "In the case of chicken tumor some of them are undoubtedly the expression of changes in the growths causative agent" (Rous and Murphy, 1913).  Introduction  1  MCEF 1998  A  o O • »• MA  CA  t 5'-  U3  U5  gag  NC  P R O R T IN  t  TM  SU  t env  pro pol  U3  R  U5  -3'  LTR  LTR  Figure 1.1. Schematic representation of a retrovirus particle and proviral DNA. (A) Crosssection of virus. (B) Proviral genomic organization (lower) and genomic products. Gag products: matrix (MA), capsid (CA), nucleocapsid (NC). Pol products: protease (PRO), reversetranscriptase /RNAseH (RT), integrase (IN). Envelope products: transmembrane (TM), surface (SU).  Introduction  2  MCEF  Introduction  1998  3  MCEF  (A) Synthesis of minus strong stop RNase H  DNA  ^  5'- ,R, U5 , pbs 5' 3'- -<• (B) Template switching  |  p  bs  gag  pol  env  pol  env ppt  PPt,U3  |  ,R,, , 3  U3  R  3'-  ,  Pbs  +  R  5'  U5  ^RNase H  (C) Minus strand extension 5'.  1998  gag  pol  env ppt1 ^U3  _  1  y  -5'  3RNase H  (D) Initial synthesis of plus strand pbs  gag  pol  env  R ppt  U5  -••-3' •5' R U5.  U3  RNase H (E) Annealing  5--.| pbs  gag  pol  env ppt  iiiiiniiiif - '. 5  U3  3  R U5  (F) Strand displacement  pbs  jod  (G) Integrated provirus 5'-LTR 5'3'-  U3  milium pbs R U5  3'-LTR  gag  pol  env  ppt  minimi Hill milium U3  R  U5  -3' -5'  Figure 1.3. Schematic representation of retroviral reverse transcription. Note that every step can contribute to proviral polymorphism. (A) t-RNA lysine anneals to the primer binding site (pbs) and is extended to form minus strong stop DNA (-ssDNA), followed by degradation of the annealed RNA by RNase, exposing the R region of -ssDNA. (B) R- region mediated template switch. (C) Minus strand extension, polypurine tract (ppt) RNAse degradation, creating a 3'-end. (D) Plus strand initiation and ppt RNA degradation. (E) Circularization mediated by pbs. (F) Strand displacement. (G) ds full length integrated provirus (see text section on HIV for more details).  Introduction  4  MCEF  1998  With knowledge that the viral genome was R N A , suggestive experiments that viral D N A synthesis was required for  2 infection and the observation that R S V transformed cellular phenotypes were inherited like a cellular gene , Temin proposed the provirus hypothesis: R S V can exist as R N A particles or cell integrated D N A (Fig. 1.2) (Temin, 1976, Temin, 1964). Scientific acceptance of this hypothesis came with the discovery of the reverse transcriptase activity (Baltimore, 1970, Temin and Mizutani, 1970), followed by evidence of a DNA-dependent D N A polymerase activity (Mizutani, et al., 1970, Riman and Beaudreau, 1970) and subsequent demonstration of integrated D N A copies of R S V R N A in R S V infected cells (Neiman, 1972, Varmus, et al., 1973). Subsequent studies found t-RNA was used during reverse transcription (Fig. 1.3) (Faras, et al., 1973) and that like cellular m R N A , retroviral R N A was 3'-polyadenylated (Wang and Duesberg, 1974), 5'-capped (Keith and Fraenkel-Contrat, 1975) and selectively spliced (Weiss, et al., 1977). The power of Southern blotting (Southern, 1975) was unleashed to reveal "direct terminal sequence redundancies" in linear D N A intermediates between reverse transcription and the integrated provirus D N A , absent from the viral R N A (Hsu, et al., 1978). Further work on these intermediates showed linear, circular and integrated forms of retroviral D N A and importantly, lead to the proposal that terminal repeats found in linear retroviral D N A were derived from viral R N A sequences by two "jumps" during reverse transcription (Hughes, et al., 1978) (Fig. 1.3).  Extensive analysis  demonstrated that the terminal sequence redundancies of unintegrated linear viral D N A , were found in integrated proviral D N A (Shank, et al., 1978). The acronym L T R was coined for these terminal sequence redundancies (Taylor, 1979). D N A sequencing and in vitro transcription assays, showed that the L T R contains the necessary sequences for R N A pol II recognition, initiation and termination of retroviral R N A transcription (Ju and Skalka, 1980, Yammamato, et al., 1980). Thus by 1980, the molecular details of retroviral replication were firmly entrenched before the discovery of HIV in 1983 (Barre-Sinoussi, 1983). In addition to the 5'-LTR-gag/pro/pol-env-LTR-3' genomic organization that defines the "simple" retroviruses such as R S V , "complex" retroviruses (such as HIV) have as many as 6 additional virally encoded products (Fig. 1.4). Furthermore, although retroviruses share the underlying molecular details of their replication  The gene responsible for this transformation was v-src, and the discovery of c-src, the lack of retroviral etiologies for most human cancers, the ensuing proto-oncogene view of cancer and the long list of de-regulated components of signal transduction pathways encoded by proto-oncogenes has been brilliantly outlined in a 1989 Nobel lecture (Bishop, 1990) as well as more recently (Bishop, 1996).  Introduction  5  MCEF strategies, they actually represent a diverse group in species specificity and host pathogenicity.  1998  They range from  benign, to etiologic agents of malignancies in birds, and immunodeficiency in primates. Contemporary classification of retroviruses incorporates nucleic acid sequence comparisons into the earlier E M scheme (Bernhard, 1960, Coffin, 1992), and divides this family into seven phylogenetic genera (Coffin, 1992). These are: 1) Avian-Leukosis-Sarcoma (simple, eg. R S V ) , 2) Mammalian C-type (simple, eg. M o - M L V ) , Type (simple, eg. M M T V ) , 4) D-Type (simple, eg. M P M V ) ,  3) B-  5) H T L V - B L V (complex, eg. HTLV-1), 6)  Spumavirus (complex, eg. HFV) and 7) Lentivirus (complex, eg. HIV-1 (see below)) (Coffin, 1992). 3 In humans, the only exogenously replicating retroviruses  known are H T L V , H F V , and HTV (Cullen,  1993). A more detailed review of the Retroviridae is outside the scope of this thesis.  I refer the reader to excellent  recent reviews of retroviruses by Coffin (Coffin, 1996) and of human retroviruses by Cullen (Cullen, 1993).  Retroviridae  genetic  polymorphism  When a provirus replicates along with the host cellular D N A during mitosis, progeny are extremely homogenous. A case in point here is the clonal expansion of HTLV-1 (Wattel, et al., 1995), that leads to little H T L V - 1 genetic variability over centuries (Gessain, et al., 1992, Wain-Hobson, 1996, Wattel, et al., 1995) and variants are more a function of geography than of disease state (Komurian, et al., 1991). This can be attributed to the high fidelity of mammalian cellular D N A replication, mediated by the 3'-5' exonuclease proofreading activity of D N A polymerase (Kunkel, 1992). When a provirus replicates exogenously by infection, progeny can be extremely heterogeneous (Preston and Dougherty, 1996). This can be attributed in part to the lack of 3'-5' exonuclease proof reading activities of R N A 4 polymerase U  and of reverse transcriptase (Skalka and Goff, 1993). In addition to templated mis-incorporations,  non-templated mis-incorporations occur during the jumps of reverse transcription (Patel and Preston, 1994). In particular the mis-incorporations produced by RNA-templated and DNA-templated D N A synthesis (Fig. 1.3) have  It is estimated that up to 10% of the mammalian genome is represented by endogenous retroviral-like sequences (Temin, 1985), including LTR-like transcriptionaly competent elements (Feuchter and Mager, 1990, Smit, 1993). A 3' to 5' exonuclease activity may be associated with R N A polymerase II (Wang and Hawley, 1993) but accuracy data ranges from 1 error per 250 bases to 1 error per 2 X 10 base pairs (DE-Mercoyrol, et al., 1992). s  Introduction  6  MCEF  1998  been proven to be exacerbated by dNTP imbalances both in vitro and in vivo (Cheynier, et al., 1997, Meyerhans, et al., 1994, Vartanian, et al., 1994, Vartanian, et al., 1997). Proof of the existence of these dNTP imbalances in a 5 proportion of retroviral permissive cells (Vartanian, et al., 1997) has divulged a mechanistic explanation for 6 observed retroviral G to A hypermutations in vivo (Cheynier, et al., 1997, Delassus, et al., 1991, Goodenow, et al., 1989, Vartanian, et al., 1991, Vartanian, et al., 1994, Vartanian, et al., 1997). Simply put, a decrease in [dCTP] and an increase in [dTTP] results in dTTP mis-incorporation in place of dCTP, leading to A instead of G on the newly synthesized plus strand after integration and transcription, thus causing G to A hypermutation. A mechanism for observed retroviral A to G hypermutations has also been proposed (Kim, et al., 1996). In vivo sampled retroviruses also frequently harbor deletions and insertions.  Here, among the most probable  mechanistic explanations, in addition to, or in combination with the above mentioned non-templated misincorporations, is forced copy-choice strand switching during reverse transcription, followed by mis-alignment and continued polymerization on the new template (Fig. 1.3) (Allain, et al., 1994, Darlix, et al., 1993, Guo, et al., 1997, Klaver and Berkhout, 1994, Ramsey and Panganiban, 1993, Temin, 1993).  In essence this is a forced  emulation of the "jumps" depicted in figure 1.3 (Panganiban and Fiore, 1988). This mechanism reconciles the fact that retroviruses can synthesize c D N A with only one R N A genomic copy (Jones, et al., 1994) whereas they carry 2. The second would then serve the fail-safe function of providing new template to "jump to" when reverse transcriptase encounters a nick.  Forced copy-choice strand switching  provides a probable mechanistic explanation for  phylogenetic revelations of inter-subtype recombinant HIV isolates (Delassus, et al., 1991, Gao, et al., 1996, Myers, 1995). The implication is that chimeric exogenous retroviruses, containing transcribed genomic R N A from two different proviruses, are produced from doubly or multiply infected cells. The above is a short list of retroviral mutations, however it highlights the diverse means, shared by the larger family of retro-transposons (Preston, 1996), by which retroviruses undergo genetic polymorphism. Retroviral oncogenicity is primarily rooted in their ability to exploit the above mechanisms in combination with the stochastic acquisition and de-regulating mutation of cellular genes (Bishop, 1990). The classic example is the acquisition of c-src by R S V , followed by mutation to v-src. However, retroviruses can also be oncogenic via  5  Estimated to be 1 to 2% of P B M C s . Human genetic disorders, including p53 mutations, also appear to correlate with G to A hypermutations,  expandingthe pathogenic mechanistic impact of dNTP inbalances (Vartanian, et al., 1997).  Introduction  7  MCEF 1998 their ability to drive overexpression of a host gene from their "randomly" integrated 3' L T R . Indeed, even for HTV-l 7 that is not typically considered oncogenic , the 3'-LTR is transcnptionaly competent and becomes further activated if the 5'-LTR is down regulated (Klaver and Berkhout, 1994). A s well, an antisense 5'-LTR promoter, with readthrough potential into the 5'-flanking genomic D N A has also been described (Michael, et al., 1994, Peeters, et al., 1996). Finally, retroviruses can be oncogenic through their ability to cause lesions in genes by integration, or as a result of the direct transforming potential of some viral gene products (such as Tax for H T L V ) . The relative mutation rate of retroviruses as a group, and in particular of HIV-1, in comparison to other micro-organisms is best illustrated by expressing the spontaneous mutation rate as the mean number of base changes per genome per one cycle of replication  (\i ) gm  for a group, or as the relative mutation rate per genome (|i ) for any g  particular virus (Drake, 1991, Drake, 1993). For microbes with D N A genomes u R N A viruses p.  gm  = 3.0, whereas the retrovirus u  = 0.2 and lytic virus u  gra  g m  g m  = 0.0033 (Drake, 1991). For - 4.0 (Drake, 1993).  These  calculations by Drake, further discussed by Wain-Hobson (Preston and Dougherty, 1996, Wain-Hobson, 1996), highlight that a high mutation rate is a common feature of R N A viruses (Preston and Dougherty, 1996, WainHobson, 1996). HIV-1 has been estimated to have a u. = 0.044 (Drake, 1993), and by other means 0.34 (Mansky g  and Temin, 1995) (Drake, 1993, Mansky and Temin, 1995, Wain-Hobson, 1996). The relatively low |X for HTV-l g  suggests that mutation rate is not the major factor responsible for temporal generation of highly genetically variable populations of retroviruses. Indeed, mutation rates of viruses are limited by an "error catastrophe threshold" beyond which their coding information degenerates; this limit is approached more closely by the lytic viruses than by retroviruses, despite more extant intrapatient genetic polymorphism for the latter (Drake, 1993). Rather, for HIV-1, persistent infection combined with rapid viral replication, is responsible for generating heterogeneous populations termed quasispecies (Eigen, et al., 1988, Goodenow, et al., 1989) or swarms (Temin, 1989). This point will be discussed further again.  The  Genus Lentivirus  The lentiviruses phylogeneticaly cluster distinctively from 6 other retrovirus genera. They are complex, coding for as many as 6 additional proteins (eg. HIV).  They can establish persistent infections causing slow progressively  HIV may be evolving towards oncogenic forms (Raineri and Senn, 1992, Shiramizu, et al., 1994, Wain-Hobson, 1996).  Introduction  8  MCEF  1998  degenerative diseases in their hosts, atypical of viral infections. In addition, they are often pathologic when crossing species boundaries or when introduced to previously unexposed populations of the same species. Lentiviruses can be subdivided into primate and non-primate. The non-primate Lentiviruses include V M V (infects sheep), E I A V (infects horses), C A E V (infects goats), BTV (infects cattle) and F I V (infects cats).  Slow  progressive degenerative diseases are caused by all of these, except BIV (Joag, et al., 1996). The subgenus of primate lentiviruses include the species SIV (infects monkeys) and HTV (infects humans). HIV is further divided into subtypes 1 and 2. Specific isolates from this genus are phylogeneticaly distinguished into 4 branches (Hirsch, et al., 1995, Joag, et al., 1996). These are: 1) HIV-1 (Alizon, et al., 1984, Barre-Sinoussi, 1983)/ SIVcpz (Huet, et al., 1990), 2) HJV-2 (Clavel, et al., 1986)/ SIVmac (Benveniste, et al., 1986)/ SIVsm (Fultz, et al., 1986), 3) SIVagm (Kanki, et al., 1985), 4) SIVmnd (Tsujimoto, et al., 1988) and SIVsyk (Hirsch, et al., 1993). Monkeys are speculated to harbor more SIVs (Hirsch and Curran, 1996, Hirsch, et al., 1995). The general genome organizations for 2 of the 5 groups of primate Lentiviruses is shown in figure 1.4. Genetic similarity between HIV-1 and SIVcpz, as well as between HIV-2 and SIVmac/sm suggests that HIV-1 and -2 are derived from a species jump (Hirsch and Curran, 1996, Hirsch, et al., 1995). Indeed, SIV can actively replicate after accidental infection of humans (SIVhu) (Khabaz, et al., 1994). As well, HIV-1 can infect chimpanzee (Fultz, et al., 1986), gibbon (Spertzel, 1989) and pigtail macaques (Agy, et al., 1992) and HJV-2 can infect cynomalgous macaques (Putkonen, et al., 1990). In these "artificial" cross-infections however, there is no clinical disease. Naturally occurring SIVs in wild populations of monkeys are not pathologic although they can cause immunodeficiency when experimentally inoculated into monkeys, or in "natural" infections of captive populations of monkeys (Joag, et al., 1996). HIV-1 and -2 cause immunodeficiency in humans (see below). For a recent review of Lentiviruses see reference (Joag, et al., 1996).  The primate  Lentivirus receptor  Primate Lentiviruses use the CD4 molecule as a receptor (Fig. 1.5) (Joag, et al., 1996). C D 4 cells include the +  monocyte/ macrophage lineage and C D 4 T-Lymphocytes, both inherent to the immune response to pathogens. +  Importantly, the monocyte/ macrophage lineage can cross the blood brain barrier, spreading infection to the CNS.  Introduction  9  MCEF  1998  H I V - 1 / SIVcpz Vif  Rev  Nef  Vpu  Vpr  h  m  3'LTR Env Pol  HIV-2/ SIVmac /SIVsm Rev Nef J  3'LTR Env  Figure 1.4. Schematic representation comparing the genomic organization of HIV-1 and HIV-2. The genome organization of HIV-1 and SIV chimpanzee (cpz) includes the long terminal repeats (LTR), the capsid, nucleocapsid and matrix gene (Gag), the reverse transcriptase, protease and integrase gene (Pol), the envelope gene (Env), the additional gene for Tat, Rev and Nef and the accessory genes Vif, Vpr and Vpu. The general organization of HIV-2/ SIVmac and SIVsm resembles that of HIV-1, however note that it lacks a Vpu gene and has the additional Vpx gene (see text section HIV for more details).  Introduction  10  MCEF  1998  Figure 1.5. The TcR, MHC presentation and signal transduction. Antigen presenting cells present antigen (Ag) in the context of major histocompatability complex II ( M H C II) to C D 4 T- cells. A g - M H C II is recognized via the TcR a and (3 extracellular domain. The CD4 molecule is then drawn towards the TcR complex where the kinase domain (grey) of p561ck can phosphorylate the zeta (£) chain tyrosines, that in turn can attract Zap 70 via SH2 domains, thus propagating a cascade (1), or/ and can be linked to activation of Ras (2) via the adapter protein SHC and the GRB-SOS complex. Similarly, receptor transmembrane protein tyrosine kinases (PTKR) can be linked to Ras activation (3). Both will lead to the M A P K induced translocation of transcription factors (TF) to the nucleus, affecting transcription. The chemokine co-receptors (CR) as well as CD4 without the TcR components, are known to produce signals upon ligation extracellularly. HIV, and/or HIV soluble gpl20 (sgpl20), can therefore interfere with A P C - M H C interaction, or signal independently of the TcR. Also shown on the right is CD4 M H C I presentation to CD8 C T L , that respond with cytolysis acivities. +  Introduction  11  MCEF Circulating C D 4  +  and C D 8  +  1998  T-Lymphocytes result from positive (Gold and Matsuuchi, 1995, Von-  Boehmer, 1994) and negative (Gold and Matsuuchi, 1995, Nossal, 1994) selection during thymic hematopoesis. Their most salient feature is a T-cell-Receptor (TcR), involved in antigen recognition and intracellular signaling (Fig. 1.5) (Gold and Matsuuchi, 1995, Howe and Weiss, 1995, Weiss and Littman, 1994).  The TcR recognizes  foreign antigen only in the context of M H C A P C ' s (Germain, 1994, Gold and Matsuuchi, 1995, Howe and Weiss, 1995, Weiss and Littman, 1994). C D 8  +  cells are M H C I restricted and C D 4  +  are M H C II restricted (Germain,  1994, Gold and Matsuuchi, 1995, Howe and Weiss, 1995, Weiss and Littman, 1994).  CD4  and CD8 are co-  receptors in M H C recognition (Germain, 1994, Gold and Matsuuchi, 1995, Howe and Weiss, 1995, Weiss and Littman, 1994). CD4 is a single transmembrane glycoprotein with 4 extracellular immunoglobulin-like domains (Barclay, et al., 1993) and is intracellularly linked to a tyrosine kinase,  p56  l c k (Gold and Matsuuchi, 1995, Howe and Weiss,  1995, Weiss and Littman, 1994). CD4 not only interacts with M H C / TcR, but can signal independently through p56  l c k (Carrel, et al., 1991, Doyle and Strominger, 1987, Vignali, et al., 1993) (Fig. 1.5).  The T cell-Receptor (TcR) TcR recognition of M H C II, leads to CD4 binding M H C II, juxtaposing CD4-associated src kinase (Q  chain  tyrosines  in  the  antigen-recognition-activation-motifs  (ARAMs:  p56  l c k to the zeta  D/EXXYXXLX6-8YXXL) 8  phosphorylating them (Fig. 1.5).  This in turn attracts a syk kinase, ZAP-70, through src homology 2 domains  (SH2) (Chan, et al., 1994, Gold and Matsuuchi, 1995, Hatada, et al., 1995, Osman, et al., 1995, Vanoers, et al., 1993, Weiss and Littman, 1994). ZAP-70 can then be phosphorylated by  p56  lck, activating it and thus propagating  the extracellular signal, to an intracellular signal (Chan, et al., 1994, Gold and Matsuuchi, 1995, Weiss and Littman, 1994). Regulation of l c k includes a balance of down regulation by p56  p50  csk phosphorylation of  p56  l c k at a negative  regulatory tyrosine 505, versus dephosphorylation activation by CD45 (Chow, et al., 1993, Weil and Veillette, 1994). Although many branch points and intermediates remain unknown, several pathways emanating from these  SH2 domains, are "pocket" motifs that recognize phosphpho-tyrosines permitting signal transduction phosphoprotein interactions, and were discovered by Ivan Sadowski while a graduate student in the laboratory of Tony Pawson while at U B C (Sadowski, et al., 1986).  Introduction  12  MCEF  1998  early events through the TcR have been charted. In one pathway, TcR stimulation results in P L C y activation of the phosphotidyl inositol pathway leading to IP3 and D A G second messengers (Gold and Matsuuchi, 1995, Weiss and Littman, 1994). D A G in turn activates P K C , leading to two branches.  One branch leads to the M A P Kinase  pathway, inducing immediate-early gene products, including the nuclear component of N F A T (Gold and Matsuuchi, 1995, Weiss and Littman, 1994). A second branch of P K C activation leads to K B dissociation from the inhibitor of KB (IKB) and nuclear translocation of N F K B (Gold and Matsuuchi, 1995, Weiss and Littman, 1994). IP3 on the other hand activates release of Ca** from the endoplasmic reticulum, activating calcineurin and resulting in nuclear translocation of the cytoplasmic component of N F A T (Gold and Matsuuchi, 1995, Weiss and Littman, 1994). In particular, N F K B (Molitor, et al., 1990) and N F A T (Jain, et al., 1993, Shaw, 1988) /rans-activate from the control regions of IL-2 and IL-2 receptor genes, required for further events in T-cell activation and proliferation. Ras stimulation can also occur directly through the TcR, independent of P K C (Fig. 1.5). Although it is still unclear if Ras is coupled to the C, chain of the TcR (Osman, et al., 1995), in one model, C, is linked via phosphotyrosines of A R A M ' s to the SH2 domain in She (Pelicci, et al., 1992, Ravichandran, et al., 1993), and She is linked to the SH2 domain of Grb2 (Lowenstein, et al., 1992).  This complex (deVries-Smits, et al., 1994,  Ravichandran, et al., 1995) attaches via the SH3 domains of Grb2 to the proline-rich c-terminal end of the nucleotide exchange factor Sos. Thus the Shc-Grb2-Sos heterotrimeric complex, via £ membrane anchoring, brings Sos to the membrane to activate Ras, that activates Raf, that in turn activates the M A P kinase pathway (Avruch, et al., 1994). Two recently characterized downstream transcription factors of the Ras pathway are RBF-1  and -2, although the  precise pathway remains unexplored (Bell, 1997, Bell and Sadowski, 1996). The importance of the Ras pathway in normal homeostatic regulation of cell activity is highlighted by the neoplastic transforming potential of deregulation in the PTK/Ras/Raf signal transduction components (Moodie and Wolfman, 1994). Indeed, retroviral transduced Ras (eg. Ha-MSV) or Raf (eg. MSF-3611) cause acute sarcomas (Kozak and Ruscetti, 1992). Importantly, the Ras pathway is turned on in HTV-l infected cells (Folguiera, et al., 1996). Therefore Lentiviral and/ or Lentiviral products, have the potential to interfere with T c R - M H C II affinity, intracellular signaling and regulation of gene expression, as well as the potential to mark the infected cell for C T L destruction. This latter event can occur as a result of up-regulating the untimely temporal expression of viral  Introduction  13  MCEF 9 antgens .  In addition, because the C D 4  +  1998  T-cell is involved in orchestrating the activity of other cells via  interleukins, lentiviruses have the theoretical potential to devastate the immune system.  HIV Despite the search for a viral etiology to human cancers that would parallel the aesthetic simplicity of transforming retroviruses, few exogenously replicating human retroviruses have been discovered and only H T L V s are considered oncogenic. However, in 1983 a new human retrovirus, initially mis-classified as H T L V in, now known as HTV, was isolated from lymph nodes of patients with a new immunodeficiency syndrome, AIDS. The first H I V isolates were named L A V and HTLVIJI (Barre-Sinoussi, 1983, Broder and Gallo, 1984, Gallo, et al., 1984) followed by A R V (Levy, et al., 1984).  HTLV-IU however, turned out to be L A V (Wain-  Hobson, et al., 1991) and thus L A V , a HIV-1, was the first H I V isolate. HIVs have been  demonstrated to be transmitted  sexually ,  by injection drug use,  transfusions and  transplants, and vertically from mother to offspring (Hirsch and Curran, 1996). The ultrastructural appearance and biochemical composition of H I V is typical of lentiviral retroviruses (Coffin, 1992) (Fig. 1.1 A ) . However, in addition to the typical 5'-LTR-gag/pro/pol-env-LTR-3' genomic proviral organization, HIV-1 codes for 6 additional proteins (Fig. 1.4). These are Tat, Rev, Nef, Vif, Vpr and Vpu. Tat is a nuclear, cytoplasmic and extracellular multiply spliced 2 exon-encoded protein that interacts with the nascent R N A stem-loop Tar structure and strongly stimulates transcription (Jones, 1993). Tat may also interact with, or indirectly act through, proteins bound to the N F K B binding sites  (Biswas, et al., 1995, Taylor, et al.,  1992). Extracellular Tat can predispose cells to apoptosis (Li, et al., 1995, Westendrop, et al., 1995). Rev is an early multiply spliced nuclear and cytoplasmic "shuttle" protein that can interact with a secondary R N A structure, R R E , facilitating the export of unspliced products (Cullen, 1993). Rev may also be involved in splicing (Kalland, et al., 1994). Nef is a myristilated cytoplasmic and membrane protein with several effects (Cullen, 1993), some of which categorize it as a signal transduction protein. For example, in addition to down-regulating cell-surface C D 4  C D 4 T-Lymphocytes are M H C I presenting cells, and thus when viraly infected, they can present antigen to C D 8 +  +  C T L , that in turn destroy them by cytolysis (see Fig. 1.5).  Introduction  14  MCEF expression (Bandres, et al., 1995), it can directly bind to  p56  1998  lck and M A P K , down-regulating the M A P K pathway  (Greenway, et al., 1996, Saskella, et al., 1995). Indeed, SIV Nef can functionally be replaced with Ras (Alexandrov, et al., 1997). In addition, Nef increases viral infectivity by  stimulating proviral D N A synthesis in assembling  particles (Aiken and Trono, 1995) and can downregulate several key transcription factors including N F K B (Bandres, et al., 1995, Niederman, et al., 1992). Vif, Vpr and Vpu are dispensable for replication in tissue culture and so are dubbed "accessory" proteins (Miller and Sarver, 1997).  V i f is found in the cytoplasm, membrane and viral particles and is implicated in  uncoating and internalization of the infecting particle (Miller and Sarver, 1997). Vpr is a nucleocapsid associated virion protein, involved in nuclear transport of the preintegration complex in non-dividing cells (Miller and Sarver, 1997), and decreases HIVs mutation rate (Mansky, 1996). Vpu is an E R and golgi membrane protein also found in virions and is implicated in C D 4 degradation and enhancement of particle release (Ewart, et al., 1997, Miller and Sarver, 1997). Therefore, the multiple functions attributed to the 6 additional proteins coded by the prototypical HTV-l virus, compared to simple retroviruses, endow it with an impressive arsenal for modulating the cell environment to it's replication advantage. In addition, it must be borne in mind that this arsenal represents only the prototypical armament. For example, in a study where numerous Tat clones were sequenced from the same patient (Vartanian, et al., 1992), novel open reading frames were found including fused Tat-Rev frames. HTV-l clusters phylogenetically with SIVcpz and has been isolated from persons around the world. HJV-2 (CDC, 1988, Clavel, et al., 1986) is less prevalent, is found mostly in isolates from West African origin, and clusters phylogenetically with SIVagm. HIV-2 differs from HIV-1 not only phylogenetically, but in it's genomic organization and encoded products (Fig. 1.4).  HIV-2 has the additional protein Vpx but lacks Vpu (Hirsch and  Curran, 1996). Both are believed to be etiologic of human immunodificiency. Only HTV-l were sampled for this thesis. The initial steps of HTV-l infection leading to reverse transcription begin with recognition of target cells. The HTV-l envelope glycoprotein is composed of gp41 T M and gpl20 S U (Moore, et al., 1994), produced by cleavage of the gpl60 polyprotein (McKeating and Willey, 1989). In addition to the C D 4 receptor, a series of coreceptors serve to enable HIV-1 entrance (Bates, 1996).  Introduction  15  MCEF  1998  Roughly, HIV-1 can be divided into T-cell-tropic or macrophage-cell-tropic variants (Cassol, et al., 1994), with tropism mapping to the V 3 loop sequences of the HTV-l gpl20 peplomer (Bates, 1996, Choe, et al., 1996). The T-cell-tropic variants require fusin (CXCR-4) as a co-receptor (Feng, et al., 1996).  The macrophage-tropic  variants are found earlier during infection and require chemokine co-receptors for entrance  , with the predominant  1 0  receptor being C C - C K R 5 (Alkhatib, et al., 1996, Bates, 1996). Both fusin and the chemokine receptors are G protein-coupled seven transmembrane proteins. The seven transmembrane family of G-proteins have been shown to be intricately involved in a variety of cell signaling pathways for diverse extracellular signals, even olfaction and pheromone responsiveness (Dulac and Axel, 1995).  Recently, ligation of the C C R 5 co-receptor has also been  shown to induce intracellular signaling (Weissman, et al., 1997). chemokines  11  In particular, C D 8 T - cells that express  can block HIV infection (Cocchi, et al., 1995, Cocchi, et al., 1996) and individuals homozygous for  mutations to these receptors appear to be resistant to HIV infection (Bates, 1996, Dean, et al., 1996, Zimmerman, et al., 1997), although more recent reports indicate that at least some of these individuals can nonetheless be HTV-l infected (Biti, et al., 1997). A proposed model for HIV-1 entrance has been dubbed the "mouse trap" and entails binding of gpl20 to the N-terminal extracellular D l domain of CD4, followed by stripping of gpl20 from the virion onto C C R 5 or C X C R 4 co-receptors, exposing a "fusion" domain in gp41 triggering pH-independent fusion and release of the nucleocapsid into the cytoplasm (Binley and Moore, 1997). The first strand synthesized is the minus strand, since the packaged strand is the plus strand.  Synthesis  begins from the co-packaged t-RNA Lysine (Jiang, et al., 1993) molecule that anneals to a short 18 nucleotide stretch on the packaged plus strand, the primer binding site (pbs) (Wakefield, et al., 1994) in the leader region between the gag gene and the U5 region of the L T R (Fig. 1.3a). Incorporation of the cellular t-RNA into the viral particle results from interaction between the t-RNA, N C and RT, before their cleavage from the gag-pro-pol precursor. RT-t-RNA and N C appear to form a "pre-initiation" complex analogous to that formed during eucaryotic transcription (see below) followed by a distinct switch to elongation (Lanchy, et al., 1996). The 3'-OH end of the t-RNA is extended until it reaches the 5'-end of the R region, making what is referred to as -strong stop D N A (-ssDNA). During this synthesis, the R N A is degraded behind the polymerization by the RNAse H activity. D N A synthesis (reverse transcription) can begin before infection of a cell, inside the virion or as  1 0  There are 6 known C C receptors, C C - C K R - 1 , 2, 3, 4, 5 and Duffy blood group antigen (Bates, 1996).  Introduction  16  MCEF 1998 it is being packaged. As' a result, although HIV-1 is thought of as strictly an R N A containing virus, as for other retroviruses (Trono, 1992), D N A can actually be detected in the virion particle (Lori, et al., 1992, Trono, 1992). Experimentally, this phenomenon occurs spontaneously in detergent solubilized particles, with exogenously added elevated [dNTPs] and is called endogenous reverse transcription (ERT) but has recently been shown to occur with non-detergent purified viral particles and has therefore been dubbed natural-ERT (NERT) (Zhang, et al., 1996). It is believed that N E R T increases the efficiency of infecting quiescent cells (Zhang, et al., 1996). The -ssDNA, then "jumps" to the 3'-end of either the other R N A copy or of itself.  It anneals via  complementarity between the R regions (Fig. 1.3b). The -ssDNA is then extended to the end of the pbs, thus creating full length minus strand, while the RNAseH activity degrades the R N A strand, except for 2 polypurine rich regions (ppt) (Fig. 1.3c). The ppt then serves as a primer for the beginning of plus strand synthesis and creates the +ssDNA, with RNAseH degrading the t-RNA (Fig. 1.3d). The exposed pbs sites from the +ssDNA and the - strand then anneal (Fig. 1.3e). This permits the final synthesis of the full length proviral genome via strand displacement (Fig. 1.3f).  The final molecule has a complete U3-R-U5 L T R at both ends (Fig. 1.3g) (Coffin, 1996). M i s -  incorporation, by mechanisms discussed earlier, promotes early strand transfer (Palaniappan, et al., 1996) and Vpr appears to decrease mis-incorporation (Mansky, 1996) thus by extension would indirectly suppress early strand transfers. The events following reverse transcription begin with nuclear transport of the pre-integration complex. This possibly occurs as a result of nuclear localization signals on NC, Vpr, or M A proteins (Gallay, et al., 1995). The termini of the ds HTV-l unintegrated D N A sequence is trimmed to 5'-TG-genome-CA-3' (Kulkosky, et al., 1990, Whitcomb, et al., 1990) as the viral genome is integrated into or near L l and A l u line elements (Stevens and Griffith, 1994) by the integrase protein assisted by a cellular protein, a homologue of the yeast SNF5 transcription factor, (Kalpana, et al., 1994).  Also, 1LTR and 2LTR unintegrated particles have been detected, though in a  complex devoid of integrase protein (Burkinsky, et al., 1993). Pre-integration latency blocked after D N A synthesis in a linear double stranded form can also occur (Huang, et al., 1993). Surprisingly, it has recently been determined that this can be the predominant form of HTV-l in vivo (Chun, et al., 1997). As mentioned above, HTV-l sampled from different geographical locations, different individuals in the same  1 1  MIPlcc, M I P - l p and R A N T E S .  Introduction  17  MCEF  1998  geographical region (Alizon, et al., 1986), different tissues of the same person, the same tissue temporally, or even separate micro-dissected spleenic white pulp germinal centers (Cheynier, et al., 1994, Cheynier, et al., 1995), are genetically polymorphic. In particular, H I V - l isolates appear to have a preponderance for G to A mutations and are referred to as " G to A hypermutated" (Cheynier, et al., 1997, Goodenow, et al., 1989, Vartanian, et al., 1991, Vartanian, et al., 1994). A poignant example of extreme retroviral variability in vivo is that detected for HTV and SIV.  Pedagogically powerful calculations and analogies by Wain-Hobson illustrate best how the extent  variability reflects  immune competence throughout the clinically "latent" period of progression  of this towards  immunodeficiency (Pelletier, et al., 1993, Wain-Hobson, 1995, Wain-Hobson, 1992, Wain-Hobson, 1996). In this 12 argument, the detected sequence polymorphism for HIV or SIV, can accomodate a 10" mutation rate 4  , only if  1,000 rounds of replication have occurred (Wain-Hobson, 1996). From this data, Wain-Hobson calculates that the burst size must be (on average) in the range of 1 infectious replication-competent HTV-l particle produced per infected cell, over the 1,000 cycles. He therefore proposes that the host immune system is severely restricting viral burst. The pathogenic implications of this conclusion will be further discussed in following sections.  The HIV-AIDS  pandemic  Clustered outbreaks of pneumonia (pneumocistis carinii) and mucosal candiasis (CDC, 1981, Gottlieb, et al., 1981) eventually led to frequent isolation of HIV-1 from patients with the clinical symptoms of a new immunodeficiency syndrome in homosexual men (Gallo, et al., 1984, Gottlieb, et al., 1981). apparent anergy of the T-cell helper response to antigens.  A hallmark of this syndrome was  This syndrome is now recognized as AIDS and the  hallmarks of it's occurrence are HIV infection, peripheral blood CD4 count decline, and resulting immunodeficiency, leading to opportunistic infections and death. HTV infection is widely accepted to be the cause of AIDS (see below). Staging of HIV infection is presented in table 1.1 (WHO, 1990). The evidence that HIV is etiologic of AIDS includes epidemiological correlation (Schechter, et al., 1993), accidental H I V infections, a similar immunodeficiency in some SIV infected monkeys, as well as high viral titers in peripheral blood (Piatak, et al., 1993) and in deeper lymph tissues (Cohen, 1993, Embretson, et al., 1993, Pantaleo, et al., 1993, Temin and Bolognesi, 1993) in AIDS patients as well as clinically symptomless patients. Paradox  This is the usually quoted mutation rate, however, as mentioned earlier, the measured rate is actually lower than this. A lower rate strengthens the argument put forth.  Introduction  18  MCEF 1998  U Q U  OH  O  i-l  00  .53  c  cn % 2  -s o o  2  si.2  6  co  60  a  u CN  3  •a5  >> ca fl T3  o  •  -rt  O  00  O  C  Q  el -rt c« X 58 SO CD .2  B o T—I  u °»  A CO  A  o  o  Q U  S3 -a  Is  CD  I-I  m A co  If I T3 e  cn  o<  O  o  .a "8  -t-»  ft m = L o S-l  3  o o  m A  o o  m o o CN  ,CD  > a •g o O H 'g  a  c  1%  CD  o o  CD  43  IS  4>  CU  rt  . rt : g  CN  V cn  PQ  OH  U  3  2  O  Introduction  19  MCEF  1998  apart, the implication is that viral presence during clinical latency, eventually causes immunodeficiency. Reports in 1992  of an idiopathic C D 4 T-lympocytopenia immunodeficiency similar to AIDS (Force, 1992), have been +  dismissed as rare occurrences from an unknown etiology (Smith, et al., 1993). Nonetheless, the exact mechanism(s) by which HIV reduces humans to immunodeficiency are still the object of much debate (see below). 13  HTV infections are a global medical concern  (Murray and Lopez, 1997).  The number of persons  currently living with HIV infection has been estimated to be at 22.5 million ((WHO), 1996). The biggest group is in the sub-Saharan Africa, where 14 million people are estimated to be living with HTV infection (62% of global figure) ((WHO),1996). As of November 20 1996 there have been 1,544,067 reported cumulative AIDS cases worldwide ((WHO), lh  1996). However, estimates considering underreporting place the number of cumulative AIDS cases at 8.4 million (6.7 adult and 1.7 children) with 5 million cases of AIDS estimated to have occurred in sub-Saharan Africa (70% of global figure). In Canada, as of 1997, in total 50-54,000 persons are estimated to have been cumulatively H I V infected and 36-43,000 are estimated to be living with HIV ((Health-Canada), 1997). cumulative cases of AIDS have been reported ((Health-Canada), 1997).  As of March 31 1997, 14,863 st  The number of AIDS cases reported in  Canada for 1979 was one, peaked at 1,714 in 1993 and has declined to 717 in 1996 ((Health-Canada), 1997). In British Columbia a total of 10,697 cumulative HIV infections have occurred (Wong, et al., 1996). Of these, 5,741 (53%) were in metropolitan Vancouver (Wong, et al., 1996). The two major risk groups for HIV-1 infection in Canada ((Health-Canada), 1997) and in B.C. (Wong, et al., 1996) are homosexuals and injection drug users (IDU). Since the original isolations of H T V - l , many different isolates have been reported from around the world. Full length genomic sequences derived from some of these isolates have been compiled by the Los Alamos National Laboratory. Through phylogenetic analysis of these sequences it has become clear that there are several HTV-l subtypes.  HTV sequence variability can be monitored directly from blood spots (Cassol, et al., 1994), however  despite the use of blood spots in Vancouver to type sequences from around the world, information about subtypes circulating in Vancouver has been lacking.  13  Every year 3 million people die from Malaria ((WHO), 1996), ranked 11th in the world as a cause of mortality (Murray and Lopez, 1997). Mortality from HTV is ranked only 30th (Murray and Lopez, 1997). However estimates predict that HTV will rise to 9th rank by the year 2020 (Murray and Lopez, 1997).  Introduction  20  MCEF HIV-1  1998  and AIDS  AIDS has a multifactorial pathology that can be summarized by considering the "typical" events from primary infection to full-blown AIDS (Fig. 1.6). The clinical manifestations from HIV-1 begin at primary infection with an acute self-limiting syndrome that can include maculopapular rash, lymphadenopathy, pharyngitis, mucocutaneous ulcerations, retro-orbital pain, fatigue, fever and nausea, in 70% of patients (Cotran, et al., 1994, Fauci, 1993, Tindall and Cooper, 1991). During this period HIV-1 viremia occurs and the virus has been isolated from lymphoid tissues, cerebrospinal fluid and bone marrow (Tindall and Cooper, 1991), although at this point the predominant high levels are in peripheral blood mononuclear cells (PBMC) and serum (Fauci, 1993, Pantaleo and Fauci, 1996). The severity of this acute phase and the quality of the initial response reflects the extent of seeding of tissues including the lymphatic and central nervous system (Pantaleo, et al., 1997, Pantaleo and Fauci, 1996, Tindall and Cooper, 1991). In particular, during the acute phase, lymph node tissue carries a high proportion of HIV expressing cells shortly after infection and the peripheral blood carries a high viremia (Pantaleo and Fauci, 1996). Concomitant with primary infection, there is a peripheral blood C D 4  +  T-lymphocyte drop and a C D 8  +  T-lymphocyte increase,  inverting the peripheral blood C D 4 / C D 8 T-lymphocyte ratio from approximately 2 to 0.5 (Tindall and Cooper, +  +  1991).  After clearance of the initial viremia by C D 8 CTLs, the peripheral CD4 counts recuperate to a lower level +  than before infection and importantly a period follows that is clinically symptomless, the chronic phase (Cotran, et al., 1994, Fauci, 1993, Pantaleo and Fauci, 1996, Tindall and Cooper, 1991).  During the transition to chronic  infection, in addition to reduced peripheral viremia, the lymph nodes undergo hyperplasia as germinal centers are formed and HIV virions are trapped in follicular dendritic cells (FDC) (Pantaleo and Fauci, 1996). However, there is still active HIV expression in lymphoid tissues (Pantaleo and Fauci, 1996). This period lasts without symptoms for 11 years average; progression occurs at a variety of rates in different individuals (Pantaleo and Fauci, 1996). Finally, there is destruction of lymph node architecture, loss of F D C trapping of virions, C D 4 decline and renewed HIV-1 peripheral blood viremia (Pantaleo and Fauci, 1996).  This is concomitant with a multifactorial  pathology including the appearance of secondary protozoan (Estable-Puig, et al., 1986), fungal, bacterial and viral infections and rare neoplasms (such as Kaposi's sarcoma) and a frequent late stage dementia.  Introduction  Death ensues an  21  MCEF  1250  Primary infection  Death  Acute syndrome + seeding 1000  1998  Oportunistic infections  A  Clinical latency/ high viral and C D 4 turnover  750  A  500  A  250  -  0  V  0  7  3 6 9 12 WEEKS  1  1  1  1  ^1  8 9  10 11  %  —0—  YEARS CD4  RPVT  Figure 1.6. Typical time course of a HIV-1 infection . Y-axis: the CD4 count (cells/ul) and relative peripheral viral titer (RPVT). X-axis: time since infection. Immediately following primary infection is a drop in CD4 count concommitant with a rise in RPVT. The immune response reduces peripheral viral titers for a period of many years. During this period there is however high viral turnover (indicated by the dashed and arrowed oval), though apparent clinical latency. At the point when constitutional symptoms emerge, there is a renewed peripheral viremia, opportunistic infections and eventual death.  Introduction  22  MCEF  1998  average of 11 years after infection (Cotran, et al., 1994, Fauci, 1993, Pantaleo and Fauci, 1996). A paradox of A I D S is that the peripheral CD4 count declines, following HIV-1 infection during the chronic clinically latent period, is a clinically predictive tool (Table 1.1), but is unexplainable by direct cytopathic effects of HIV-1 on peripheral blood C D 4 cells (Brinchmann, et al., 1991). This is because only 0.1 to 13% of cells in the +  periphery are HTV-l infected with 0.01-0.1% productive for HTV-l particles (Bagasra, 1992).  Although several  mechanisms have been proposed to account for either direct or indirect C D 4 T-cell destruction, the genetic data +  supports a model of immune system cannibalization (see below) (Wain-Hobson, 1992). Although figure 1.6 implies low viral replication, this is not the case. This is because up-to billions of CD4  +  T-lymphocytes and viral particles have been estimated to be turning over daily (Coffin, 1995, Ho, et al.,  1995, Wei, et al., 1995). This work in particular, has led to the notion that the C D 4 count decline is actually the sum of high viral replication and de novo infection that is answered by effective clearance of both C D 4  +  infected  cells and free viral particles (Cheynier, et al., 1994, Cheynier, et al., 1995, Pelletier, et al., 1993, Wain-Hobson, 1995, Wain-Hobson, 1992, Wain-Hobson, 1996). This massive viral and C D 4  +  T-lymphocyte turnover has been  proposed to be occurring in lymphoid tissues involved in antigen activated destruction of secondary pathogens, such as the spleen, where  latently infected and un-infected CD4 T-Lymphocytes are recruited and both are activated +  (Cheynier, et al., 1994, Cheynier, et al., 1995, Pelletier, et al., 1993, Wain-Hobson, 1995, Wain-Hobson, 1992, Wain-Hobson, 1996). Consequently, this also activates proviral HTV-l in latently infected cells. This is because the HIV-1 L T R has proviral D N A motifs for transcription factors (see below) such as N F K B (Alcami, et al., 1995, Molitor, et al., 1990, Nabel and Baltimore, 1987), N F A T (Jain, et al., 1993, Lu, et al., 1991, Shaw, 1988) and the recently characterized RBF-1 and RBF-2 (Bell, 1997, Bell and Sadowski, 1996, Estable, et al., 1996) that respond to T-cell activation signals. Indeed, ex vivo T-cell activation induces viral expression in latently infected quiescent cells (Fauci, 1993) and P M A induction is routine in viral isolation procedures.  As a result of HIV-1 L T R similarities to T-cell activation gene promoters, the infected and activated C D 4  +  T-Lymphocytes in germinal centers will produce virus in proximity to very permissive un-infected activated C D 4  +  T-Lymphocytes, that in turn are newly infected (Cheynier, et al., 1994, Cheynier, et al., 1995, Pelletier, et al., 1993, Wain-Hobson, 1995, Wain-Hobson, 1992, Wain-Hobson, 1996). Since they are activated they will rapidly produce non-self HIV-1 antigens on their surfaces and then co-migrating C D 8  Introduction  +  cytotoxic T-Lymphocytes can  23  MCEF  1998  massively destroy them with only a small fraction of infected cells escaping to the periphery (Cheynier, et al., 1994, Cheynier, et al., 1995, Wain-Hobson, 1995, Wain-Hobson, 1996).  In essence the immune system cannibalizes  itself. The above is Wain-Hobsons' explanation for the theoretically low burst size, determined from analysis of in vivo HIV-1/SIV variability (Wain-Hobson, 1996). In support of this model is the fact that 98% of C D 4  +  T-Lymphocytes are in the lymphatic system, as  many as 20-30% of lymph node C D 4 T-Lymphocytes are infected even during the asymptomatic period, and there +  is active replication of HTV-l in lymph tissue during all stages of HTV-l infection (Bagasra, 1992, Fauci, 1993, Pantaleo and Fauci, 1996). The important points in this model are first that the deeper lymphatic tissues such as in the lymph nodes, gut and spleen, rather than in peripheral blood, are the sites of persistent HIV-1 infection, replication and C D 4 T+  lymphocyte destruction.  Secondly, that T-cell activation, while necessary for immune function, is driving viral  turnover and itself becomes pathologic. A prediction of this model could be that splenectomized individuals should progress slower. This is indeed the case (Morlat, et al., 1996). However, the mechanism at play may not be as simple as outlined above. Perhaps the most compelling evidence against the high turnover model is analysis of restriction fragment telomere (RFT) length.  Because D N A  polymerase cannot copy the 5'-end of D N A in telomeres, each successive cycle of mitosis produces a shorter R F T . Thus the above model predicts shortened R F T length in C D 4  +  T-Lymphocytes from HTV-l infected persons  compared to those from uninfected individuals. However, C D 4 T-lymphocyte telomeres appear the same length in +  healthy and HTV-l infected patients (Baiter, 1997).  Indeed, it is the C D 8  +  T-Lymphocytes that have relatively  shortened telomeres (Effros, et al., 1996). As well, if immunodeficiency results from depletion of the capacity to make C D 4  +  T-Lymphocytes, then  intuitively one would expect that de-regulation, as evidenced by signal transduction defects, should not be occurring early but only late in disease progression.  Yet, signal transduction defects occur very early (Bentin, et al., 1989,  Clerici, et al., 1989, Gurley, et al., 1989, Teeuwsen, et al., 1989).  In particular, early anergy of the CD4+ T-  Lymphocytes in vivo in HIV-1 infected patients appears to result at least in part from alterations to l c k (Cayota, et p56  al., 1994). These alterations could be in part attributed to direct HIV-1 infection, since HTV-l in vitro infection can result in dissociation of CD4 from  p56  lck (Kanner and Haffar, 1995). However, as mentioned earlier, there is a low %  Introduction  24  MCEF of  infected cells in vivo, particularly early  1998  after infection. Therefore indirect mechanisms have been invoked.  Indeed, in vitro, gpl20-CD4 interactions or (anti-gpl20)-gpl20-CD4 interactions create a similar defect (Goldman, et al., 1994, Hubert, et al., 1995, Mittler and Hoffmann, 1989). Although intuitively nice, it is still difficult to imagine how the high levels of gp-120 and anti-gpl20 in vivo, necessary for this effect, could be produced so early during infection, when the immune system is just beginning the "titanic battle" that it can sustain for an average of 11 years, before immunodeficiency is established. One possibility would be that C D 4  +  T-Lymphocyte turnover is indeed occurring in the billions per day,  generating the high extant HIV-1 genetic variability, that newly infected cells are indeed eliminated by C D 8 C T L +  resulting in low viral burst, but that this turnover is not abnormal (Hellerstein and McCunes, 1997). This would however imply that something other than turnover is causing immunodeficiency.  A t the extreme of these  implications, several groups have contested that HIV-1 is the etiologic agent of AIDS (Papadopulos-Eleopulos, et al., 1995, Stewart, 1995). However, a more likely scenario is that HIV may be inducing a decrease in thymic C D 4  +  T-Lymphocyte generation, as has been proposed (Hellerstein and McCunes, 1997), and that this may be occurring early after infection. Models invoking a decrease in generative capacity, or high turnover, are not mutually exclusive. However, as a working model for this thesis, I will assume the current view that HTV-l viral turnover drives pathogenesis via C D 4  +  T-Lymphocyte destruction, by marking the cells for C D 8  +  C T L destruction, as  outlined above. This is because of the plethora of data and compelling arguments supporting this view (Coffin, 1995, Ho, et al., 1995, Wain-Hobson, 1995, Wain-Hobson, 1997, Wain-Hobson, 1992, Wain-Hobson, 1996, Wei, et al., 1995) and because the above mentioned R F T length measurements may be biased towards the naive T-cell population rather than the expanding activated population (Hellerstein and McCunes, 1997). Despite adopting this working model, my own personal view is that the above issues will only be resolved by re-assessment of the immunodeficiency in patients, once their HIV-1 has been eradicated by anti-retroviral therapies. For some patients, this day may be close at hand (Wain-Hobson, 1997).  Introduction  25  MCEF HIV-1  1998  Transcription  Mechanisms of eukaryotic class II gene regulation include: 1) chromosomal organization; 2)  recognition of  14 promoter-proximal and -distal sequences by transcription factors (Boulikas, 1994); 3) TFIJD  recognition of the  TATA-box; 4) holoenzyme^ recruitment (Ptashne and Gann, 1997); 5) initiation of transcription with formation of the first phosphodiester bond; 6) promoter clearance with elongation and termination; 7) m R N A processing including splicing (Merzouki, et al., 1994), polyadenylation, capping and editing; 8) cytoplasmic export; 9) translation; and 10) post-translational modifications (Conway and Conway, 1997). The above mechanisms of host cell gene regulation are not simply used by HIV-1 but rather, are exploited explicitly by HTV-l gene products (see below). A  measure of chromatin organization permissive for transcription is the presence of DNAse I  hypersensitive sites reflecting the positioning/ re-positioning of nucleosomes. Histone acetylation and a re-modeling complex known as the SWI7 S N F complex are implicated in this process both in yeast as well as mammalian cells (Pazin and Kadonaga, 1997, Wang, et al., 1996, Wu, 1997). For proviral HIV-1, DNAse I hypersensitive sites have been mapped to the 5'-LTR, 3'-LTR as well as to a putative intragenic enhancer in the pol gene (Verdin, 1991). Two constitutive sites are hypersensitive within the HIV-1 5'-LTR (Verdin, 1991). Two phased  nucleosomes have  been assigned to the HTV-l 5'-LTR (Verdin, et al., 1993). The first termed nuc-0, can be roughly located in the 5'extremity of the 5'-LTR, corresponding approximately with the N F A T region (Fig. 1.7).  The second is placed just  5' of the T A T A A box (Fig. 1.7) in the R region. Two constitutive DNAse I hypersensitive sites correspond to the intra-nucleosomal location between nuc-o/ nuc-1 and 5' of nucl, before 3 additional nucleosome sites, nuc-2, 3, 4, in the gag leader sequence (Verdin, 1991, Verdin, et al., 1993).  Importantly,  nuc-1 is displaced and a third  hypersensitive site appears, upon treatment with either TNF-oc (an inducer of N F K B ) or treatment with specific inhibitors of histone deacetylase,  that do not induce N F K B (Van-Lint, et al., 1996).  Both of these treatments  strongly stimulate transcription from the 5'-LTR. Therefore HIV-1 proviral L T R chromatin positioning, appears to repress HIV-1 transcription, without limiting access to the regulatory sequences between N F A T and the TATA-box,  T F I I D consists of TBP and TBP-associated factors or TAFs (Tansley and Herr, 1997). 1 5  In mammalian cells, the holoenzyme complex can include the  general transcription factors (TFIID), TFTIA,  T F I I B , T F I I F , T F I I E , T F I I H and R N A polymerase II (Ossipow, et al., 1995).  Introduction  26  MCEF 1998  oo  c  >  ON +  Z  c T3  o o c o  Q  <  c  i-daq.. z-dara /dai  IT)  < <  I-dS  1-dS 1-dS i-dun /»davo /i-SIH / a ™ i-dara / »davo /i-sia /a>idN  u o c . 1  i-jaa AJdavsr/i-siH  3  dsn  i  IV-dN  o  111 * o  -dV cn  Introduction  27  MCEF  1998  permitting constitutive and/or inducible invasion of these cw-acting sequences by available transcription factors as well as displacement of nuc-1 by inducible activators and/or histone acetylation. As already noted, integration of the pre-integration complex involves INI1, a homologue to the SWI/ S N F complex (Kalpana, et al., 1994).  Because the SWI/SNF complex co-immunoprecipitates with the holoenzyme  (Wilson, et al., 1996), it is interesting to note that contact with a holoenzyme component and/or the holoenzyme may be occurring for HIV-1 even before integration, because of INI1 (Kalpana, et al., 1994). Despite the self-contained holoenzyme view, transcription is still highly regulated by recruitment of the holoenzyme to a promoter (Ptashne and Gann, 1997). Recruitment occurs primarily via protein-protein contacts between transcription factors anchored (directly or indirectly) to the regulatory sequences for a gene and holoenzyme components (Ptashne and Gann, 1997).  Protein-protein contacts between the holoenzyme components and  transcription factors may also modulate elongation efficiency, for example by stimulating TFIIH phosphorylation of the R N A pol II C T D (Blau, et al., 1996). Therefore the interplay between frans-activators and -repressors with the holoenzyme ultimately determines the level of transcription initiation and promoter clearance (Blau, et al., 1996, Boulikas, 1994, Greenblatt, 1997, Ptashne and Gann, 1997). This interplay is orchestrated by the cw-acting elements of promoter, promoter-proximal and enhancer sequences, that as explained above for HIV-1, are significantly nuleosome-free. It is often unappreciated how important the orchestration of this interplay is to HTV-l and retroviruses in general.  Indeed, the almost  incredible gymnastics of reverse transcription (Fig. 1.3) are principally an adaptation permitting this orchestration by it's own ds-acting promoter sequences. The HTV-l 5'-LTR cw-acting sequences were first determined from early isolates (Alizon, et al., 1984, Barre-Sinoussi, 1983, Hahn, et al., 1984, Levy, et al., 1984, Popovic, et al., 1984, Rosen, et al., 1985, Sodroski, 1985,  Starcich, et al., 1985, Wain-Hobson, et al., 1985) and transcription factor binding sites predicted from the  nucleic acid sequence data. These intensively investigated sequences are now considered the prototype HTV-l 5'-LTR (Cullen, 1991, Cullen and Greene, 1989, Garcia and Gaynor, 1994, Garcia and Gaynor, 1994, Garcia, et al., 1987, Gaynor, 1992, Jeang, 1994, Jones, 1989, Jones and Peterlin, 1994, Kingsman and Kingsman, 1996, L u , et al., 1991, Tong-Starksen and Peterlin, 1990, Waterman, et al., 1991). Most reviews on the HTV-l L T R consider this prototype as consisting of a modulatory, enhancer and promoter regions.  However, the 5'-region of the 3'-LTR  contains sequences that overlap with the Nef open reading frame. Because the 5'-LTR is derived from the 3'-LTR  Introduction  28  MCEF  1998  sequences, I will refer to the L T R sequences as LTR/Nef coding or L T R non-coding sequences, thus recognizing that the selective forces exerted upon these sequences should theoretically be different. The most 5'-half or LTR/Nef coding sequences of the prototypical L T R (-454 to -121) exert positive or negative cw-effects (Rosen, et al., 1985), are more critical to chromatin than plasmid transcription (Kim, et al., 1993, Sheridan, et al., 1995, Verdin, et al., 1993, Zeichner, et al., 1991, Zeichner, et al., 1991), are burdened with a constitutively positioned nucleosome (nuc-0) (Verdin, 1991, Verdin, et al., 1993) and contain recognition motifs for a myriad of D N A binding factors. The cis-sequences include a negative-regulatory-element (NRE) (-340 to -185) (Calvert, et al., 1991, Guy, et al., 1990, L u , et al., 1989, L u , et al., 1990, Rosen, et al., 1985, Tesmer, et al., 1993) and an upstream-regulatory-element  (URE) (-157 to -122) (Nakanishi, et al., 1991).  The N R E contains  binding sites for AP-1 (Canonne-Hergaux, et al., 1995, Franza, et al., 1988), the nuclear-factor-of-activated-T-cells (NFAT) (Jain, et al., 1993, L u , et al., 1991, Markovitz, et al., 1992, Shaw, 1988), NFIL-6 (Tesmer, et al., 1993) and upstream stimulatory factor (USF) (D'Adda DI Fagana, et al., 1995, Giacca, et al., 1992). The U R E includes binding sites for human-lymphoid-enhancer-binding-factor (hLEF, also referred to as TCF-1 a) (Dinter, et al., 1991, Sheridan, et al., 1995, Travis, et al., 1991, Waterman, et al., 1991, Waterman and Jones, 1990), Ets-1 (Fisher, et al., 1992, Holzmeister, et al., 1993, Jones and Peterlin, 1994, Leprince, et al., 1983, Nye, et al., 1992, Wasylyk, et al., 1993) and the Ras-responsive-Binding Factors (RBF) 1 and 2, that bind to R B E I V (-151 to -142) and R B E HI (131 to -122) (Bell, 1997, Bell and Sadowski, 1996, Estable, et al., 1996) (Fig. 1.7). The L T R / non-coding sequences (-120 to +80), exert positive cis-effects, are less dispensable than the LTR/Nef-coding sequences (Garcia and Gaynor, 1994, Rosen, et al., 1985, Zeichner, et al., 1991, Zeichner, et al., 1991), and are divided by a constitutively-placed activation-removable nucleosome, (nuc-1) (Verdin, 1991, Verdin, et al., 1993) (Fig. 1.7).  The cw-acting elements of the L T R / non-coding region (-120 to +80), of the prototypical  HIV-1 L T R include an enhancer (-104 to -81) (Chang, et al., 1993, Chen, et al., 1997, Pazin, et al., 1996, Perkins, et al., 1993, Phares and Herr, 1991, Rosen, et al., 1985, Ruocco, et al., 1996, Wu, et al., 1988), a basal promoter (80 to +40) and the Tat responsive region (TAR) (+1 to +59) that is transcribed into an R N A stem-loop structure involved in 10 to 1,000 fold frans-activation of transcription from the HIV-1 L T R (Colvin and Garcia-Blanco, 1992, Gaynor, 1992, Harrich, et al., 1994, Harrich, et al., 1995, Jones and Peterlin, 1994, Muesing, et al., 1987, Roy, et al., 1990, Sodroski, et al., 1985, Sodroski, 1985), when bound by virally encoded Tat protein (Arya, et al., 1987, Arya, et al., 1985, Feinberg, et al., 1991, Jeang, 1994, L u , et al., 1993, Luo, et al., 1993, Rosen, 1991, Southgate  Introduction  29  MCEF  1998  and Green, 1991) and associated cellular factors (Alonso, et al., 1992, Rothblum, et al., 1995, Shibuya, et al., 1992, Yang, et al., 1996, Zhou and Sharp, 1996). TaWrans-activation acts primarily at elongation (Blair, et al., 1996, Blau, et al., 1996, Kao, et al., 1987).  Transcription factors binding the enhancer region (-104 to -81) include  members of the Rel/ kappa B (NFkB) family (Alcami, et al., 1995, Bielinska, et al., 1989, Chirmule, et al., 1994, Ephrussi, et al., 1985, Gaynor, et al., 1988, Kunsch, et al., 1992, Leonard, et al., 1989, Matthews, et al., 1995, Molitor, et al., 1990, Nabel and Baltimore, 1987, Ross, et al., 1991, Roulston, et al., 1995, Sen and Baltimore, 1986, Zabel, et al., 1991), PRDII-BF1 (Muchardt, et al., 1992, Seeler, et al., 1994), AP-2 (Perkins, et al., 1994), NFBL-6 (Tesmer, et al., 1993), T3R (Desai-Yajnik, et al., 1995), and Ets family members (Flory, et al., 1996, Hodge, et al., 1996, Seth, et al., 1993) including RBF-1 (Bell, 1997, Bell and Sadowski, 1996, Estable, et al., 1996), that bind to Ets sites embedded in the 3'- half sites of the NFkB motifs. For this reason we have termed the -80 to -104 region R B E II, to indicate that it binds RBF-1 as well as other Ets family members (Bell, 1997, Bell and Sadowski, 1996) (Fig. 1.7). Factors which bind to the basal promoter elements include SP-1 family members (Berg, 1992, Dynan and Tjian, 1983, Jones, et al., 1986, Kadonaga, et al., 1987, Majello, et al., 1994, Parrott, et al., 1991, Thiesen and Bach, 1990), TATA-binding protein (TBP) (Garcia and Gaynor, 1994, Kashanchi, et al., 1994), T M F (Garcia, et al., 1992), E-Box factors (Ou, et al., 1994), LBP-1 (Kato, et al., 1991, Yoon, et al., 1994) and RBF-2, which binds to R B E I (-26 to -5) (Bell, 1997, Bell and Sadowski, 1996, Estable, et al., 1996). In addition, the promoter region contains an element that induces non-processive, short, abortive transcripts (IST) (Pendergrast and Hernandez, 1997, Ratnasabapathy, et al., 1990, Sheldon, et al., 1993) and an initiator element (InR). The +1 transcription initiation site defines the R-U5 boundary (Fig. 1.7). Adding further complexity, at least some of the transcription factors interacting with the HTV-l L T R have been shown to be functionally dependent. For example, SP-1 sites are required for Tat-frans-activation (Huang and Jeang, 1993, Jeang, et al., 1993, Kamine and Chinnadurai, 1992, Sune and Garcia-Blanco, 1995), Tat interacts with TFIID (Kashanchi, et al., 1994), frans-activation requires the C-terminal domain of R N A polymerase TI (Okamoto, et al., 1996), the TATA-box is critical for basal and Tat-'rans-activated transcription (Berkhout and Jeang, 1992, Garcia, et al., 1989, Olsen and Rosen, 1992), Ets/NFkB/NFAT proteins interact (Bassuk, et al., 1997) as do AP-1 and Ets (Bassuk and Leiden, 1995), and the RBF-1 and -2 factors are believed to be multiprotein complexes (Bell, 1997, Bell and Sadowski, 1996, Estable, et al., 1996). In addition, transcription factor binding sites have also been detected  Introduction  30  MCEF  1998  outside the prototypical 5'-LTR elements, for example in the env gene (Feriotto, et al., 1992) and in the gag-pol region (Roebuck, et al., 1996). Because many of the elements on the HIV-1 L T R are targets for inducible transcription factors, the L T R is inextricably linked to signal transduction pathways, some of which I have briefly outlined earlier (Fig. 1.5). However, a plethora of reagents, including chemicals, antibodies, viruses, viral products and radiation have been shown either in vivo in transgenic mice, in tissue culture, or in vitro, to impact on the HTV-l L T R . These are by no means limited to action through the TcR. Up-regulatory stimuli include cell stresses such as: epidermal UV-light on HTV-l LTR-reporter gene transgenic mice (Zider, et al., 1993), or heat shock of tissue cultures with a chromosomally integrated HTV-l L T R reporter gene (Stanley, et al., 1990); Chemical treatments such as P M A (Demarchi, et al., 1993, Harrich, et al., 1990, L i , et al., 1991), Na-butyrate (Antoni, et al., 1994, Golub, et al., 1991), 2-AP, adenine, adenosine, caffeine (Brown, et al., 1993) and morphine (Squinto, et al., 1990); mitogens such as P H A ( L i , et al., 1991, Siekevitz, et al., 1987); antibodies to a plethora of extracellular receptors such as anti-CD2 (Bressler, et al., 1991) or anti-TcR components (Tong-Starksen, et al., 1989); cell contact with HIV-1 gp-120-surface-expressing cells (Merzouki, et al., 1994), or autologous activated cells triggering macrophage differentiation (Moses, et al., 1994); viral components, including those from H S V (Schafer, et al., 1996, Schafer, et al., 1996), vaccina virus (Chang, et al., 1994), C M V (Ghazal, et al., 1991, Walker, et al., 1992), H F V (Keller, et al., 1992, Lee, et al., 1992) and extracellular HIV-1 Tat (Conant, et al., 1996). Down-regulatory stimuli include chemicals such as aspirin or sodium salicylate (Kopp and Ghosh, 1994), Procysteine (Lederman, et al., 1995); antibodies to extracellular receptors including C D 4 (Benkirane, et al., 1995); extracellular T-cell secreted products such as the C D 8 T-cell suppressive factor (Copeland, et al., 1996, Chen, et +  al., 1998) ; and viral products such as H H V 6 6Ats (Araujo, et al., 1995). The last two paragraphs are not an exhaustive list. Indeed, just about any reagent that perturbs the cell will affect HIV-1 transcription, so that an exhaustive list is far beyond the scope of this thesis.  Instead, the above are  meant to highlight the difficulties in experimentally determining which L T R transcription factor targets, transcription factors, signal transduction pathways, extracellular receptors and extracellular micro-environments correspond critically to HTV-l persistence in vivo, particularly when considered in light of the extreme extant intrapatient HIV-1 variability. In other words, which L T R are we talking about ?  Introduction  31  MCEF 1998  Rationale L T R genetic polymorphisms have been shown to be pathogenic determinants for some retroviruses. In the case of HIV-1, high viral turnover is considered pathogenic. This turnover has been estimated to be in the billions per day. This, and not an elevated mutation rate, results in high genetic polymorphism throughout the HIV-1 genome. When I began my doctoral studies, most publications on the HIV-1 L T R had relied on data derived from one of the initial isolates. Indeed, few groups had examined HTV-l L T R genetic polymorphism in vivo, and no group had examined this at all stages of infection.  In addition, no phylogenetic data was available for HTV from  Vancouver. M y initial hypothesis was that specific HTV-l L T R polymorphisms accumulate with disease progression, and so I designed experiments to derive, sequence, and examine the HIV-1 LTRs from patients at all stages of infection. The over a hundred thousand bases of sequence data derived, led me to phylogenetic analysis, that in turn resulted in my determining that HTV-l in Vancouver are L T R and envelope subtype B . However, I was unable to find any obvious correlation between L T R polymorphisms and disease parameters.  Some of the polymorphisms I  found were new and others have been previously described. Because of the unexpectedly numerous polymorphisms predicted to impair binding of dogmaticaly entrenched transcription factors, I next selected a subset of LTRs to examine their transcription potential, and was able to correlate some specific polymorphisms to basal or Tattransactivated transcription phenotypes.  However, I was initially unable to find any phenotype for L T R s bearing  what I have called the Most Frequent Naturally occuring Length Polymorphism (MFNLP).  The frequent occurrence  of this polymorphism argued in itself for an important in vivo role in replication, but I found that the M F N L P s shared no identity with any transcription factor binding site published before 1996. Importantly, in 1988 Ivan Sadowski, while in the Ptashne laboratory at Harvard, determined that the HTV-l L T R is activated by the PTK/Ras/Raf pathway. Subsequently while a student in the Sadowski laboratory, Brendan Bell mapped the cis-elements of the L T R that are required for full Ras-responsiveness and characterized RBF-1 and -2 factors interacting with the Ras-responsive c«-elements. As it turns out, the Ras-responsiveness project and my L T R polymorphisms, two independently initiated studies, converged at the M F N L P s , because they harbor a potential RBF-2 binding site.  This observation led to re-examination of my sequence data and revealed that M F N L P s  Introduction  32  MCEF invariably occur when the wild-type RBF-2 site is mutated in vivo.  1998  This led to my second hypothesis: that a  theoretical RBF-2 binding site within this frequent polymorphism, was the in vivo selective force for it's occurrence. In order to test this hypothesis, I first showed that all M F N L P s bind RBF-2 in vitro.  Because the  compensatory M F N L P role we proposed is predicted to mask the M F N L P phenotype, I then constructed isogenic mutants deleted of their M F N L P s , and determined that M F N L P s confer repression in basal and Tat-transactivated transcription to their linked LTRs.  To further strengthen the notion that RBF-2 is responsible for this M F N L P  phenotype, I repeated these experiments in a model system whereby RBF-2 can be induced.  The repressive  phenotype was found only in cells expressing detectable levels of RBF-2. Because RBF-2 appears to be a novel complex of transcription factors, and attempts to clone it's components genetically have been unsuccessful^ I next purified RBF-2 using biochemical methods.  The purified  oligo-affinity RBF-2 (OA-RBF-2) consists of at least 5 polypeptides, supporting the notion that RBF-2 is a complex.  In order to determine if RBF-2 is novel, a collaboration was established with the Ruedi Aebersold  laboratory (University of Washington), where mass-analysis of proteolytic OA-RBF-2 component polypeptides further suggests that it is indeed novel. In conclusion, I have used the argument that if viral turnover is responsible for HIV-1 pathogenesis, then an RBF-2 target is an absolute requirement for HIV-1 pathogenesis in vivo.  Introduction  33  MCEF  1998  Materials and Methods Phylogenetic  analysis  Sequences for the envelope gene or L T R were visually aligned to reference subtype sequences using SeqEd (Applied Biosystems), according to the alignment of the L A N L (Myers, 1995) (Appendix). Sequences were gap-stripped in SeqEd and exported as text. Text sequence files were imported into SeqPup and the alignment exported as Phylogeny Inference Package (PHYLIP) compatible files. DNADIST was used to generate a distance matrix for the alignments. The distance matrix was used to generate a tree using NEIGHBOR and the tree was viewed using TreeView. Tree topologies were supported by bootstrap analysis. For bootstrap analysis, P H Y L I P compatible files were subjected to 100 or 1,000 bootstrap re-samplings using SEQBOOT. The SEQBOOT outfile was imported into D N A D I S T and the resulting output was input to NEIGHBOR, generating the respective number of tree files.  A strict-rule  consensus tree was generated with C O N S E N S E and viewed with TreeView. The bootstrap value from the node of the consensus tree, was overlaid on the nodes of the non-bootstrap trees.  Description of patients and samples for  LTR analysis  Samples were from 42 patients in British Columbia Canada.  Thirty two  were enrolled in the Vancouver  Lymphadenopathy Study ( V L A S ) (Craib and Schechter, 1992) and 10 were from patients at St. Paul's Hospital. The patients are described in Table 2.1. With respect to the 4 parameters; Stage (World Health Organization (Schechter, et al.,1995)) (Table 2.1), C D 4 (absolute/ |il), duration of infection (D.O.I.) (months) and slope (simple curve-fit slope using Cricket Graph Software (Cricket, USA), of C D 4 versus D.O.I.), they represent a discrete distribution with no patients sharing more than 2 parameters (Fig. 2.1). Peripheral blood samples were collected in acid-citratedextrose and processed within 3 hours of phlebotomy.  P B M C were prepared over Ficoll-Hypaque (Pharmacia,  Uppsala Sweden), washed twice (150 m M NaCl; 150 m M sodium phosphate (pH7.4)), resuspended at 10^ cells/ ml (10 m M Tris (pH 8.3); 50 m M KC1; 2.5 m M MgCl2; 1.0% NP40; 1.0% Tween-20) and cryogenically preserved at 80°C.  Materials and Methods  34  MCEF 1998  Table 2.1 Cohort description MCE I.D. # VLAS# Sampling Date 94/02/14 6021 MCE#1 93/10/26 4 MCE#3 93/12/07 7108 MCE#4 8802 94/01/19 MCE#5 94/01/11 3263 MCE#6 94/02/14 114 MCE#7 . 93/11/29 1012 MCE#8 94/01/31 3057 MCE#9 94/01/11 3097 MCE#10 93/04/27 9999 MCE#63 94/02/21 5373 MCE#11 94/02/17 8745 MCE#13 93/12/08 MCE#14 8713 93/11/09 8747 MCE#15 93/09/13 3275 MCE#16 93/09/08 MCE#18 5091 94/02/10 4039 MCE#19 93/12/01 1052 MCE#20 93/04/27 9998 MCE#64 94/01/14 9997 MCE#73 93/05/09 9996 MCE#68 93/11/09 9995 MCE#69 94/02/15 8787 MCE#22 94/01/31 MCE#24 1025 94/02/15 8797 MCE#25 93/10/21 76 MCE#26 94/02/17 4056 MCE#27 94/01/25 1018 MCE#28 94/01/11 5161 MCE#29 93/11/10 8740 MCE#30 93/02/23 9994 MCE#57 93/03/02 9993 MCE#58 9992 93/03/10 MCE#59 93/04/15 MCE#62 9991 93/07/28 9990 MCE#65 94/01/10 4006 MCE#31 93/11/09 5618 MCE#33 93/12/2 1024 MCE#34 93/11/17 4007 MCE#35 93/11/01 3505 MCE#36 94/01/27 4065 MCE#39 93/11/17 5487 MCE#40 a  Age Sex Stage IV 40 M IV 53 M IV 39 M IV 55 M M IV 51 IV 33 M IV 48 M IV 38 M IV 47 M IV 35 M M III 31 III 36 M 49 M III III 37 M III 42 M III 39 M III 38 M III 40 M III 30 M III 54 M F III 49 III 34 M II 48 M II 45 M II 48 M II 58 M II 39 M II 43 M II 36 M II 32 M II 38 M II 30 M M II 41 II 28 M II 31 M I 42 M I 40 M I 57 M 42 M I I 50 M I 47 M I 30 M  CD4  110 10 190 130 370 930 10 60 80 50 240 240 210 250 340 120 200 130 270 140 350 170 640 360 240 200 480 440 340 450 380 310 320 300 300 610 600 930 510 500 700 570  slopes -12.383 -6.6794 -5.5623 -4.9658 -5.6855 -0.49638 -3.6332 -3.6644 -2.661 -11.923 -4.551 -4.574 -8.9718 -5.4079 -0.4053 -4.1855 -2.8134 -4.8487 20.989 -8.4454 -19.943 -8.0526 -6.2008 -9.2537 -111 -5.212 -5.1798 -0.56697 -6.4251 -12.978 -5.3825 -4.7169 -7.4576 -31.429 -9.4527 -4.1076 -0.024757 -5.1984 -8.9568 -12.21 -3.561 -1.6112 3  Entry status'' SP SP, AIDS 6/86 SP SP SP, AIDS 10/93 SP SP, AIDS 1/94 SC, 6/85 SP SP SP SC, 9/86 SP SP SP SC, 8/83, AIDS10/93 SP SP SP SP SP SP SP SC, 7/91 N/A SC, 7/86 SC, 11/88 SP SC, 6/90 SP SP SP SP SP SP SC, 11/83 SP SC, 8/87 SP SP SP SP  D.O.I. 76 121 127 76 109 118 98 103 132 9 83 89 83 76 121 121 135 125 16 42 22 59 78 30 N/A 87 64 131 43 79 11 23 7 3 27 122 84 76 132 83 114 84  0  slope of CD4 versus duration of infection. SP: seroprevalent, SC: seroconverted, NA: not available. duration of infection in months. D  c  Materials and Methods  35  MCEF Amplification  and  cloning of proviral HIV-1  1998  5'-LTRs  The HTV-l 5'-LTR was selectively amplified over the 3'-LTR as outlined in Fig. 4.1.  For each sample, the  equivalent of 1.5x 10 cells was proteinase-K treated (90 ug/ ml for 2 hours, 65°C). Final amplification conditions 6  were 10 m M Tris (pH 7.5), 0.2 m M dNTPs (Pharmacia) 50 m M KC1, 2.5 m M M g C l 2 , 5 units of Taq D N A polymerase (Amplitaq, Perkin Elmer, U S A ) and 25 pmoles each primer. First round amplification was with primers MCE-1 / MCE-2. cycles (94°C,  Nested P C R was with primers M C E - 3 / M C E - 4 .  Cycles were: 1 cycle (95°C,  lmin.); 40  10 sec; 50°C, 10 sec; 72°C, 30 sec); (72°C, hold)(9600, Perkin Elmer). Primer sequences were  M C E - 1 : 5 ' - C A C A C A A G G C T A Y T T C C C T G A - 3 ' ; M C E - 2 : 5 ' - T C C Y C Y T G G C C T T A A C C G A A T - 3 ' ; M C E - 3 : 5'ACTGTCTAGATGGATGGTGCTWCAAGYTAGT-3'; MCE-4:  5'-ACTGCTCGAGTCCTTCTAGCCTCCGCTA  G T C - 3 ' . 150 ng of each 678 bp (based on the HTVXB2 sequence) amplicon was screened for HTV-l 5'-LTR D N A by direct cycle sequencing (Dye-dideoxy, Applied Biosystems (ABI), U S A ) using the primer M C E 3 (Fig. 4.1) and data collected on a D N A sequencer (model 373, ABI). Amplicons were directionally cloned in a three-way equimolar ligation consisting of: a 1,600 bp BamHl-Hind III fragment from the p C A T basic vector (Promega, U S A ) ; a 2,988 bp Xbal- BamHI pBluescript II K S M13(+) vector fragment (Stratagene, U S A ) and the 390-435 bp Xbal to HindM HIV-1 5'-LTR amplicon fragments (Fig. 2.2).  Polymorphism  screening  Four hundred and seventy eight HTV-l 5'-LTR proviral clones were micro-sequenced (1/4 scale, otherwise as recommended by ABI) within a 99.5% accuracy window of 300 bp using primer 5 (-21M13) (Fig. 2.3 and 4.1). Sequences were aligned to HTVXB2 by patient stage using SeqEd (ABI) (Appendix 2) and similarity determined by realignment with Gene Works (Intellegenetics, USA). From branches of a Pair Wise Group Alignment (PWGA) tree, 67 clones with distinct LTRs were chosen and re-sequenced on both strands (Fig. 4.2) (as above) with  primers  M C E - 3 and M C E - 6 (MCE-6: 5 ' - T C T A G A G T C G C C T G C A G G C A T G C - 3 ' ) (Fig. 4.1).  Materials and Methods  36  MCEF  1998  60  S ~ 3  Q C  O  U C  PH  C  <rt  3  a o  m S &  ^ 5 8 J= S oo K <*H y o ° u  g  O  Q ^ S -a c/3 u U u rt *3•rt rt CM X. .22 <+< rt  0  < ^ O . J3  2 «  in  t  CM  H  e3  rtQ  CM  C  a T3  ©  o  2  2  00  o o  VO ^  o o  CN  _ o  CD  —  CM  -  u  a  Q  U  rt .2  S3 2 § SI2 rt•S 13  <rt  O e  2°  o o  O  t/5  DO i/l CM .a H o rt 60 S3 JJ S i 00 . „  7H  0  o o  D  •H  o « (U 3 >c o U a, - S W  w  irt •S •£ U6 -B C3 O  '5 3 o  3  o e £  SP £2 -S '3 B g •  '-3  w  3 »> J=  3  O  « fc!  «^  O  CM  .rt rt  1/3  T3 C  c3  Materials and Methods  U >  37  MCEF  1998  Figure 2.2. p M C E constructs. Cloning of L T R in front of the bacterial chloramphenicol acetyltransferase gene. (A) Vector fragment, V , from pBluescript digestion withHind III and Xba I (lane 2). Reporter fragment, R, from pCATBasic digestion with Hind l U (lane 4). HIV-1 L T R amplicons (an example of the 42 in Appendix) from P C R amplifications from cohort samples (lane 6). Lanes 1, 3 and 5 contain lOObp ladder standards (S). (B) After a equimolar three way ligation with the D N A fragments in A (the L T R is digested with Xba I and Hind III), an uncut miniprep (U) is shown (lane8) and a Hindlll + Xba I cut miniprep (C) is shown (lane 9). Lane 7 contains the 100 bp ladder standard (S). (C) The assembled p M C E constructs, of which 1,600 were banked, is schematically represented and includes the E. Coli origin of replication (Col E l Origin), the ampicillin resistance gene (AmpR), multiple purpose cloning sites (MCS), the bacterial chloramphenicol acetyltransferase gene (CAT), a eukaryotic polyadenylation signal (poly A) and the M l 3 origin (fl+), permiting synthesis of single stranded D N A .  Materials  and  Methods  38  MCEF  89-139  140-190  191-240  241-290  1998  291-313  Window (bases)  B 150  n  • Inserts 11 % Insert •  Sampled  100  t 3  •a o <D  3 CT  1  <D  50  <D  c o U  0  liiJIIml IV  111,111:,,  III II Disease stage  Figure 2.3 Accuracy and status of sequencing.  (A) Accuracy of single pass sequencing calculated from 14 different p G E M sequencing runs, concommitant to the p M C E sequencing. The inaccuracy was calculated comparing the p G E M Z+ sequence published by ABI, to the sequence derived from dye-dideoxy cycle sequencing of p G E M Z + supplied by ABI. No insertions or base deletions were noted.Comparison was after editing N calls. (B) Status of single pass sequencing of the p M C E bank. On the Y-axis are the number of clones sequenced per patient (sampled) or the number of cloned with M F N L P inserts (inserts) or the percentage of clones with M F N L P inserts (% inserts). Disease stage is indicated on the X-axis.  Materials and Methods  39  MCEF Transfections  1998  and CAT assays  Effector plasmids were prepared using Wizard Maxipreps (Promega). The pRSV-Tat (Tat) directs the expression of HIV-1 Tat (Garcia, et al., 1987) and pZVRas (Ras) directs the expression of the oncogenic form of v-Ha-Ras, whereas pZNRas (N-Ras) contains an N17 dominant negative mutation that down regulates the Ras pathway by quenching Ras-guanine-nucleotide-exchange factors (Feig and Cooper, 1988). Cell lines were maintained in 5% CO2 at 37 °C. The human acute T-cell Leukemia lines Jurkat, Jurkat-Tat and the promonocyte U937 cell line have been described elsewhere (NIH, 1995) and were maintained in RPMI (Gibco, USA) with 10% fetal bovine serum and 100 Ug/ ml streptomycin. The HL-60 human promyelocytic leukemia cells were maintained in 80% I M D M and 20% FBS.  Constructs for transfection were prepared using Wizard Maxiprep (Promega), quantitated, verified for the  presence of inserts and re-sequenced (as above). Transfection of Jurkat, Jurkat-Tat, or U937 cells was by the D E A E method (Grosschedl and Baltimore, 1985). Cells were harvested 48 hours post-transfection. Protein concentration of the extracts was quantitated using the Bradford assay (Bio-Rad, USA). 14  C A T assays consisted of extracts, 0.2 u C i  C-Chloramphenicol (MEN, USA), 0.5 m M acetyl co-enzyme A and 0.47 M Tris-HCl (pH 7.9). Incubation was  at 37°C, 2 hours. After 1 hour, 50% more acetyl co-enzyme A was added. T L C was in 25% ethyl acetate; 75% chloroform.  Acetylation was quantitated as the  acetylated-chloramphenicol/ (acetylated- + unacetylated-  chloramphenicol), using a Phosphorlmager (Molecular Dynamics) according to the manufacturers instructions.  Electrophoretic  mobility shift assays  Labeling: Oligonucleotides encompassing both strands of target sites were synthesized to have 5'-extensions (Applied Biosy stems 391 D N A synthesizer), cleaved from the columns, dried in a speed-vac, purified over a SEP A C column, resuspended at 100 pmoles/ u l in ddH 0 and stored at -20 °C. Strands were heat denatured, annealed and 2  stored at -20 °C. 100 pm of annealed oligo was Klenow labeled with a-[ P]-dATP (NEN) ethanol precipitated, 32  washed 3 times with 70 % ethanol and dried in a speed vac. E M S A binding reactions consisted of 100 pm  3 2  P-  labeled double stranded (ds) target oligo, 10 m M HEPES pH 7.9, 5 m M M g C l , 8% glycerol, 100 m M KC1, 6 ug 2  poly dl-dC, 4 ug B S A and the competitor ds D N A (Li, et al., 1991). The radiolabeled probe was always added last, immediately following addition of nuclear extract.  Samples were kept on ice until  the radiolabeled ds  oligonucleotides were added, and were then incubated at room temperature for 20 minutes and resolved on 4.5% acrylamide: Bis-acrylamide (29:1), 0.5 X T B E , 1% glycerol, 0.8 mm thick gels.  Materials and Methods  Jurkat nuclear extracts were  40  MCEF  1998  prepared as previously described (Li, et al., 1991). The gel was pre-run at 200 V for 1 1/2 hours in 0.5 X T B E , 1% glycerol and the buffer was freshly changed before loading and electrophoresis at 150 V for 3 hours. The gel was then fixed in acetic acid: methanol (20:20, V ; V ) , transferred to Whatman 5 mm paper, dried at 80 °C under vacuum for 1 hour and exposed at -80 °C to X - O M A T (Kodak) film with an enhancing screen (Dupont).  DNAse  I  footprinting  DNAse I footprinting was essentialy the same as described (Bernier, et al., 1993). Selected p M C E clones (Estable, et al., 1996) were digested with  Hind HI to linearize, and labeled with Klenow and oc-[ P]-dATP to a specific 32  activity of 2-10,000 cpm /fm. The labeled D N A was then digested with Xba I, and the a-[ P]-labeled 420 base pair 32  L T R - fragments were purified by agarose gel electrophoresis and chromatography on N A C S columns (BRL). Recombinant  c-Ets-1 D N A binding domain (residues 300 to 440, Ets-1 A 301) was a kind gift from Logan  Donaldson and Lawrence Macintosh.  Purified hLEF was a kind gift from Marianne Waterman (UCSF).  Approximately 5-10 fm of radiolabeled L T R fragments were pre-incubated on ice for 30 minutes in 40 u.1 containing 10 m M HEPES p H 7.9, 5 m M M g C l , 8% glycerol, 100 m M KC1, 5 u,g pre-annealed poly dl-dC (Pharmacia) and 2  the respective D N A binding protein.  Five  u l of DNAse I (1 R Q 1 U / u l , Promega), freshly diluted (to the  appropriate concentrations) in 150 m M NaCl, 1 m M C a C l , 50% glycerol, was added to the binding reactions; the 2  tubes were vortexed and incubated at room temperature for 2 minutes. Digestions were terminated by the addition of 60 u l of 200 m M NaCl, 20 m M E D T A , 1% SDS, 250 (Xg/ml yeast t-RNA, 150 |Xg/ml proteinase-K (Boehringer Mannheim). The samples were mixed and incubated at 42 °C for 60 minutes. Template D N A was extracted with phenol/chloroform (50:50 V / V ) and precipitated with ethanol.  Maxam & Gilbert ( M & G ) A + G ladders were  generated by standard protocols. Template D N A samples were suspended at 2 to 10,000 cpm/ u.1, and equal counts were resolved by electrophoresis on denaturing 6% polyacrylamide gels. Gels were dried and exposed to X - O M A T (Kodak) film with an enhancing screen (Dupont).  Materials and Methods  41  MCEF Site directed  1998  mutagenesis  Oligonucleotide-directed mutants were generated by primer extension on uridine-substituted template D N A as per the Kunkel modification (Kunkel, 1985). Synthetic oligonucleotides spanning the p M C E 69.1 ( 5 ' - G A A T A C T A C A A G A A C T GA A C T C A T C GA G C T T T C T A C A A G - 3 ' ) and the p M C E 9.104 (5' G A A T T C T A C A A G A A C T G A T GA C A C T G A G C T A T C T A C A A G G G A C - 3 ' ) MFNLP-flanking sequences were used to create p M C E A 69.1 and p M C E A 9.104, respectively. Oligonucleotides were phosphorylated with T4PNK and stored at -20 "C. Uridine-substituted single stranded p M C E 69.1 and p M C E 9.104 were prepared by passage through CJ236 E. coli using M13K07 helper phage (Pharmacia). For each reaction 3 Ug of single stranded D N A was annealed to the kinased oligo and the final synthesis/ mutagenesis reaction was transformed into DH5oc cells. Colonies were picked and deletion mutant L T R D N A s were identified by sequencing (Applied Biosystems 373 D N A sequencer) as outlined elsewhere (Estable, et al., 1996).  Heparin-agarose  affinity  chromatography  Heparin-agarose chromatography was performed at 4°C. Nuclear extracts were prepared by the method of Dingham et al. as described by Bell (Bell and Sadowski, 1996) or equivalent extracts purchased (Santa Cruz Biotechnology), snap frozen and stored in liquid nitrogen. Portions of 80 or 160 ug were loaded in nuclear extract buffer (NEB) consisting of 20 m M HEPES p H 7.9, 100 m M KC1, 5 m M M g C l , 0.1 m M E D T A , 20% glycerol, 0.5 m M D T T , 2  0.5 m M P M S F . Five 5 ml Heparin-agarose snap columns (Bio-Rad) were hydrated in 50 ml of H A buffer (20 m M HEPES p H 7.9, 100 m M KC1, 5 m M M g C l , 8% glycerol, 0.5 m M DTT, 0.5 m M PMSF) at a flow rate of 1.0 ml 2  per minute, followed by 50 ml 2.0 M H A buffer (HA buffer with 2.0 M NaCl instead of 0.1 M ) . The columns were again washed with 50 ml H A at the same flow rate. Nuclear extracts were thawed in a 16 C water bath for 5 to 10 0  minutes and placed on ice until loading. Ten to 20 ml of thawed extracts were loaded at 1.0 ml per minute. The columns were washed with 50 ml H A buffer followed by a 60 minute gradient from H A to 2.0 M H A . Fractions of 1.0 ml were collected, analyzed by E M S A and kept at 4 ° C until RBF-2 containing fractions were identified for M Q chromatography. The fractions containing RBF-2 activity were dialyzed at 4 C against 500 ml H A buffer for 2 0  hours with one buffer change. Unused fractions were snap frozen and stored in liquid nitrogen. Between uses, the Heparin-agarose columns were washed with 50 ml 2.0 M H A followed by 50 ml H A containing 0.1% Na-azide.  Materials  and  Methods  42  MCEF Ion exchange  1998  chromatography  A Mono-Q strong anion exchange column (Pharmacia) was washed with H A buffer at 1.0 ml per minute for 15 minutes followed by washes with 1.0 M H A buffer (HA with 1.0 M NaCl) and then H A for 15 minutes.  Dialyzed  RBF-2-containing fractions from the Heparin-agarose chromatography were pooled and injected using a 6.0 ml loop. The column was washed for 15 minutes with H A , followed by a gradient of H A to 1.0 M H A in 60 minutes at a flow rate of 1.0 ml per minute. Fractions of 2.0 ml were collected at 4 C and aliquots analyzed by E M S A for 0  RBF-2 activity. For direct oligo-affinity, all Mono-Q fractions were rendered 0.05% NP-40 (Mannheim Boehringer), 20% glycerol, then snap frozen and stored in liquid nitrogen.  Oligo-affinity  chromatography  Oligo-affinity chromatography was essentially as described by Kadonaga (Kadonaga, 1991).  Oligonucleotides  encompassing an R B E III wild type site (RBE niwt) and a mutated R B E III site (RBE Ulmut) were designed to have a  4  base  hangover  when  annealed.  gatcCTTCAAGAACTGCTGACATg-3';  The  RBEIJIwt  oligo's  reverse  were:  primer:  RBEIJIwt  primer:  5'-  5'-gatccATGTCAGCAGTTCTTGAAG;  RBEIJImut forward primer: : 5'-gatcCTTCAA G A A C T G C A C T C A T g - 3 ' ; gatccATGAGTGCAGTTCTTGAAG-3'.  forward  RBEIUmut  reverse  primer: 5'-  250 ug of each oligonucleotide was annealed to its complementary oligo  by incubating at 88 °C for 2 minutes, 65° C for 10 minutes, 37 ° C for 10 minutes, and room temperature for 5 minutes in 66.7 m M Tris-HCl p H 7.6, 13.3 m M M g C l , 16.6 m M DTT, 0.13 m M spermine, 0.13 m M E D T A and 2  then placed on ice. The ds oligonucleotides were labeled by adding A T P to 3 m M A T P (pH 7.0), A T P , 100 units of T4 polynucleotide kinase and the mixture incubated at 37 C for 2 hours. 0  stopped by adding ammonium acetate to 0.4 M and heating at 65 C for 15 minutes. 0  5 u C i [y- p ]32  The reaction was  After heat inactivation of  P N K , the annealed y- p-labeled ds oligonucleotides were precipitated with 3 volumes of ethanol and centrifuged 15 32  minutes at room temperature to pellet the D N A . The pellet was re-suspended in 10 m M Tris, 0.1 m M E D T A and extracted with phenol/chloroform. D N A was precipitated with 0.3 M Na-acetate, and the pellet washed with 70% cold ethanol, and dried in a speed-vac.  The labeled ds oligonucleotides were then ligated to form concatamers.  Ligation was in 66 m M Tris-HCl p H 7.6, 10 m M M g C l , 15 m M DTT, 1 m M spermidine, 4 m M A T P p H 7.0 and 2  30 Weiss units of T4 D N A ligase at 16 °C for 18 hours. After 18 hours, the concatamerized products were analyzed on a denaturing D N A sequencing gel. Products were 15 oligo-lengths on average (not shown). The concatamerized oligo's were then extracted with phenol/ chloroform once, followed by extraction with chloroform then precipitated  Materials and Methods  43  MCEF  1998  with 2.5 M ammonium acetate and 1 volume of isopropanol, followed by precipitation with 0.3 M Na-acetate and 2 volumes of ethanol. The D N A pellet was washed twice with 75% ethanol, dried in a speed-vac, resuspended in 50 u l ddH 0, and stored at -20 °C. 2  The concatamerized oligo's were then coupled to Sepharose CL-2B (Pharmacia). 15 ml of Sepharose C L 2B was washed with 500 ml ddH 0 in a coarse-cintered glass buchner funnel and 10 ml settled bed volume was 2  transferred to a 150 ml beaker with a magnetic stir bar in a 15 °C water bath in a fume hood. 1.2 g of cyanogen bromide was weighed, transferred to an  Erlenmeyer flask and dissolved in 2 ml N,N-dimethylformamide. The  dissolved cyanogen bromide was added dropwise over 1 minute to the Sepharose slurry. Immediately, 1.8 ml of 5 M NaOH was added at 30 ul aliquots every 10 seconds for 10 minutes. 100 ml of ice cold ddH 0 was then added to the 2  mixture which was then poured over a glass cintered buchner funnel, and washed 4 times with 100 ml ice cold ddH 0. Drying was avoided. The mixture was washed 2 times with 100 ml ice-cold 10 m M potassium phosphate, 2  pH 8.0, and 5 ml of the resin was transferred to each of two 15 ml polypropylene conical tubes. 2 ml of 10 m M potassium phosphate p H 8.0 was added until the resin became a thick slurry. The R B E Ulwt concatamerized oligo was added to one tube and the RBEIUmut oligo to the other. The slurries were incubated on a pivoting platform at room temperature for 24 hours. The resins were then transferred to a sintered glass funnel and washed twice with 100 ml water and 100 ml 1M ethanolamine-hydrochloride p H 8.0. A l l radioactivity, as detected with a Geiger counter, was found on the filter. The resins were transferred to 15 ml polypropylene tubes and 1 M ethanolamine was added until a smooth slurry was formed. The mixtures were incubated for 6 hours at room temperature on a pivoting platform to inactivate the cyanogen bromide. The resin was then washed successively with 100 ml 10 m M potassium phosphate p H 8.0, 100 ml 1 M potassium phosphate p H 8.0, 100 ml 1 M KC1, 100 ml ddH 0 and 100 2  ml C S B (10 m M Tris-HCl p H 7.6, 1 m M E D T A , 0.3 M NaCl, 0.04% W / V Na-azide) and stored at 4 °C until use. For oligo-affinity chromatography a 1.0 ml RBEIII  mut  or R B E 111*' oligo-affinity column was first washed  with 15 ml 1.0 M H A buffer modified to 20% glycerol and 0.05% NP-40, followed by a 15 ml wash with H A buffer containing 20% glycerol and 0.05% NP-40 at 4 °C. One fifth of the amount of poly dl-dC required to affect the RBF-2 E M S A shift was estimated to be 70 Ug / ml (Kadonaga, 1991). The Mono-Q fractions containing the RBF-2 activity were thawed at 16 °C and placed on ice. The samples were diluted to bring them to 0.1 M KC1, the poly cUdC was added and the mixture incubated 10 minutes at 4 °C, and then spun at 10 krpm for 10 minutes in an SS-34 rotor. The supernatant (containing RBF-2) was loaded onto the affinity columns at gravity flow (0.25 ml/ minute)  Materials and Methods  44  MCEF and the flow-through was then re-loaded twice. Columns were washed 4 times with 2.0 ml H A buffer  1998 and then  eluted with NaCl step gradients in H A buffer. Fractions were then snap-frozen and stored in liquid nitrogen.  SDS-PAGE  and silver staining  Samples were adjusted to 25 m M Tris-HCl, p H 6.8, 10% glycerol, 5% (3-Mercaptoethanol, 2.3% SDS, 10 pg/ ml bromophenol blue, heated 2 minutes at 90 °C and loaded onto gels.  S D S - P A G E mini-gels were 7.5% 29:1  acrylamide: bis-acrylamide, 375 m M Tris p H 8.8, 0.1% SDS for the running gel and the stacking gel was 100 m M Tris-HCl p H 6.8, 4.5% acrylamide, 0.4% SDS. The running buffer contained 25 m M Tris, 192 m M Glycine, 0.1% SDS. Samples were run at 200 V constant current until the bromophenol blue ran off the gel. Samples were fixed and stained with silver nitrate either with the Bio-Rad kit (Bio-Rad) containing a cross-linker, or with a non-crosslinking protocol provided by the Ruedi Aebersold laboratory (University of Washington) (Blum, et al., 1987). The non-cross-linking protocol consisted of the following: 30 minutes fixing in 50% methanol 10% acetic acid; 15 minutes incubation in 5% methanol, 1% acetic acid; 3 x 5 minute washes in ddH 0; 90 seconds incubation in 2  N a S 0 . 5 H 0 at 0.2 g/ L ; 3 x 30 second ddH 0 washes; 25 minute incubation in 0.2% A g N 0 , 0.0185% H C O H ; 2  2  3  2  2  3 x 60 second washes in ddH 0; 2  3  10 minutes development in 6% N a C 0 , 0.0093% H C O H , 2  3  0.0004%  N a S 0 . 5 H 0 ; 10 minutes stop in 6% acetic acid; and stored at R T in d d H 0 . 2  3  2  2  Materials and Methods  45  MCEF  D i s t i n c t c l u s t e r i n g o f H I V - 1 sequences d e r i v e d f r o m  injection  users versus non-injection d r u g users i n V a n c o u v e r ,  Canada  •  1998  drug  In this section I determine that HIV-1 in Vancouver are of envelope and LTR subtype B and that injection drug  user-derived sequences cluster apart from non-injection drug user sequences.  This section was prepared from the following manuscript: Mario Clemente Estable. A . Merzouki, M . Arella, and I.J. Sadowski. Distinct clustering of HTV-l sequences derived from injection drug users versus non-injection drug users in Vancouver, Canada, (in press, A R H R ) . Data in this section has been presented at the following meeting: Mario Clemente Estable. et. al. and I.J. Sadowski. V I Annual Canadian Conference on HIV/AIDS Research, Ottawa, Ontario. May 1997. Canadian Journal of Infectious Diseases, Volume 8, Supplement A , March/ April, p37A, Abstract 254.  Retroviral genome polymorphism occurs at a relatively high frequency because of infidelity of the polymerases responsible for replication, R N A polymerase II and the viral reverse transcriptase, and through template strandswitching and recombination (Preston and Dougherty, 1996). Sequence polymorphism extends throughout the HTV1 genome and has been used to phylogenetically classify isolates, for which full-length sequence data is available, into subtypes within a major group (M) or the outlier group (O), that have a predominant geographical distribution. The M group currently includes subtypes A (Central Africa), B (Europe, Americas, Australia, Asia), C (East & South Africa, Asia), D (Central Africa), E (East Asia), F (South America, East Europe), G (Central Africa), H (central Africa), J (Central Africa, Europe). The rare group O subtypees are linked to infections in West Africa (Myers, 1996, Myers, 1995). Because of the difficulties in obtaining full-length molecular clones of HTV-l most subtyping of HTV-l has relied on direct amplicon or cloned amplicon sequences of the gag, pol or env regions (Gao, et al., 1996, Myers, 1996, Myers, 1995). I have examined the HTV-l subtype from 50 patients within the Vancouver Injection Drug User Study (VIDUS) cohort (Strathdee, et al., 1997) and 35 non-injection drug users in Vancouver (Craib and Schechter, 1992) by sequence analysis of the env V3 loop region (Myers, 1996, Myers, 1995).  Phylogenetic neighborjoining  analysis demonstrated that all 85 V 3 loop sequences, from both groups, are of envelope subtype B , based on a high bootstrap value of 87/100 (Fig. 3.1).  Since specific amino acids in the V 3 loop are implicated in the syncytium  IDU  vs non-IDU  46  MCEF  CPZGAB 93MW9591 p 92BR025 J ^ 92TH006 l p mn" 92TH022J IUU. 93BR029T p  100  ANT70  1998  ]o  MVP5180  D  C  • LBV217 92UG975.10  ]G  87  Figure 3.1. HIV-1 subtypes in Vancouver. Reference subtype sequences cluster and are indicated by brackets. The tree is rooted with the C P Z G A B . V L A S and A M prefixed sequences are from non-injection drug users,whereas sequences identified with a V in the second position and ending with an asterix are from injection drug users. Sequences from envelope (782 to 1031 w.r.t. to the L A N L consensus B sequence) were aligned over reference subtypes, gap-stripped, imported to SeqPup and exported as P H Y L I P compatible files. A distance matrix was created using D N A D I S T (PHYLIP) set to Kimura's 2 parameter model with a 1.5 transition/ transversion ratio.The tree was built with N E I G H B O U R (PHYLIP) and viewed with TreeView. The topology of the tree is supported at the nodes with values from 100 bootstrap resamplings, overlayed on the tree. Bootstrap analysis was with SEQBOOT (PHYLIP), followed by D N A D I S T and N E I G H B O U R . The strict rule consensus tree bootstrap re-sampling values were used. Note the clustering of sequences derived from injection drug user and that all sequences appear to be subtype B . Only bootstrap values over 70 are shown.  0.1  IDU  vs  non-IDU  47  MCEF  I  1998  6V394  8V444  Figure 3.2. Clustering of IDU-derived sequences. Alignments and analysis was as in figure 3.1, without reference sequences, thus permitting higher bootstrap re-sampling numbers. The topology is supported at the nodes with bootstrap values over 700 out of 1,000, indicated. The tree is unrooted. Note the distinct clusters.  IDU  vs  non-IDU  48  MCEF  1998  inducing (SI) versus non-SI (NSI) phenotype (Fouchier, et al., 1992), the predicted amino acid sequences of the V3 loops for the two groups were examined and both found to be predominantly NSI. In addition, no specific pattern which distinguished sequences from injection drug users and the non-injection drug users was found (Lukashov, et al., 1996). Analysis of L T R products for the non-IDU group was also found to be subtype B (results not shown). Interestingly, the V 3 loop D N A sequences derived from the VIDUS cohort samples (Fig. 3.1, asterisks) cluster within several groups, distinct from sequences derived from the non-injection drug users.  Further analysis of  the 50 V I D U S sequences, presented in an unrooted tree with 1,000 bootstraps, reveals clustering within 7 groups which contain 2 or more sequences with bootstrap values of at least 700/1,000 (Fig. 3.3). Whether this risk-group-specific clustering results from sharing of contaminated needles and/ or a specific injection drug user "founder" HTV-l (Lukashov, et al., 1996), will require further analysis including sequencing of other HTV-l gene loci to confirm the phylogenetic topology.  Nonetheless, this distinct pattern of clustering  suggests to me that V I D U S participants have shared needles, despite a needle exchange program which has been in effect since 1988 and establishment of the VIDUS cohort (Strathdee, et al., 1997).  IDU  vs  non-IDU  49  MCEF  1998  HIV-1 LTR variants from 42 patients representing all stages of infection display a wide range of sequence polymorphism and transcription activity •  In this section I determine that extensive point and length polymorphisms  1 LTRs previously  derived from patients representing all stages of disease. reported. Importantly,  the most frequent  the sampled patients is identified, named MFNLP 1997, Bell and Sadowski, 1996). The MFNLP  naturally  are found  occurring  HIV-  Some of these are novel and others have been  occurring  length polymorphism,  and found to contain a potential  does not correlate  in naturally  binding  occurring  in 38% of  site for RBF-2  with disease stage but occurs in conjunction  lesions to the wild type RBF-2 site. As a result, I propose a compensatory  model for the occurrence  of  (Bell, with  MFNLPs.  This section was prepared from the following manuscript: Mario Clemente Estable. Brendan Bell, Abderrazzak Merzouki, Julio S. Montaner, Michael V . O'Shaughnessy and Ivan J. Sadowski. HIV-1 L T R Variants from 42 patients representing all stages of infection display a wide range of sequence polymorphism and transcription activity. Journal of Virology. Vol.70, No. 6, June 1996, p.4053-4062.  Data in this section has been presented at the following meetings: M . C . Estable. B . Bell, A . Merzouki, J. S. Montaner, M . V . O'Shaughnessy and I. J. Sadowski. HIV-1 LTRs from 42 patients representing all stages of infection, display a wide range of polymorphism in sequence, transcription potential and binding of factors but no clinical correlation. Abstract Mo.A.1023 p59, Abstract volume 1, X I International Conference on AIDS, Vancouver Canada, July 7-12 1996. M . C . Estable. A . Merzouki, C. Ruedy, J.Montaner, M . Arella, et al. Polymorphic proviral Genotypes of HTV-l 5'L T R during the course of HTV-l infection. V U International Conference of Comparative and applied Virology Oct. 12-17, 1994, Montreal, Canada. Program Synopsis p 2-20.  Introduction. HIV-1 clones sequenced to date display significant variation from the prototype described earlier (Fig. 4.1).  These  variations can be found in many L T R motifs implicated in transcription regulation (Myers, 1995). In itself, this is not surprising since HIV-1 quasispecies (Eigen, et al., 1988, Goodenow, et al., 1989) or viral swarms (Temin, 1989) selectively accumulate through successive cycles of replication and originate as mutations transcription (Patel and Preston, 1994, Preston and Dougherty, 1996, Temin, 1993) when  during reverse  L T R sequences are  particularly prone to mutate through templated as well as non-templated mechanisms (Preston and Dougherty, 1996, Ramsey and Panganiban, 1993). However, because L T R sequences are used for transcription, required for replication,  HIV-1  LTR  variants  50  MCEF and viral turnover is itself pathogenic (Coffin, 1995, Connor and Ho, 1994), L T R mutations  1998  could impact the  course of HTV-l disease. In this vein, analysis of cultured HTV-l isolates demonstrated that increased replicative capacity in permissive cell lines (Englund, et al., 1991, Golub, et al., 1990) can be attributed, at least in part, to variant 5'-LTR sequences. In particular, Golub et al. showed that a 24 bp insertion 5' of NF-kB sites (containing a 5 ' - A C T G C - 3 ' motif) at-151 to -128, concomitant with a ' T ' at position -94, was responsible for a three-fold increase in replication and proviral 5'-LTR-driven transcription, between two intrapatient isolates (Golub, et al., 1990).  However, because in vitro  culturing of HTV-l virus does not accurately reflect in vivo  quasispecies  selection (Delassus, et al., 1991, Meyerhans, et al., 1989), only analysis of numerous L T R sequences derived directly (uncultured) from many different HTV-l infected individuals can establish clinical impact of specific L T R variants. Recent analysis of uncultured HTV-l L T R variants, includes work on a single patient over four years from asymptomatic to symptomatic infection, showing no temporal pattern of enrichment of L T R sequence variants or Tat-responsiveness,  but suggesting uncoupled evolution of Nef from L T R sequences (Delassus, et al., 1992,  Delassus, et al., 1991). Koken et al. screened for 5'-LTR length variants from 17 patients and identified a variant with a fourth SP-1 site that could outgrow an isogenic 3 SP-1 site construct, as well as length variants with a 5'C T G - 3 ' motif insertion, 5' of NFkB sites, that could confer a marginal decrease in proviral 5'-LTR transcription and replicative capacity (Koken, et al., 1992).  Similarly, Michael et al. describe deletions, insertions and point  mutations to the core -enhancer, -promoter and - T A R sequences in 4 patients over 3 years, and demonstrate that partial LEF-1 duplication variants (with a 5'-ACTGC-3' motif) had decreased proviral 5'-LTR driven transcription (Michael, et al., 1994). Patterns to L T R variants selected in vivo are suggested by recent papers of Ait-Khaled et al. demonstrating tissue compartmentalized phylogenetic clustering of L T R variants in four and one patient(s) (AitKhaled and Emery, 1994, Ait-Khaled, et al., 1995). Additionally McNearny et al.,  in evaluating L T R and Nef  variability in four patients longitudinally, found increasing numbers of point and length variants with disease progression as well as greater selective constraint for the L T R sequences than for Nef (McNearney, et al., 1995). Furthermore, low viral burden and a benign course of disease may be due to a reduced clinical impact from deletions in L T R / Nef-coding sequences 5' of NFkB sites, concomitant with additional N F K B  and SP-1 sites (Deacon, et al.,  1995). A l l of these papers strengthen the view that conclusions about the importance of specific sequences in the HIV-1 5'-LTR, if based on the prototype, may not necessarily hold true for naturally occurring LTRs.  HIV-1  LTR  variants  51  MCEF Because HIV-1 5'-LTR polymorphisms from  cultured isolates  1998  can confer transcription/ replication  advantages (Englund, et al., 1991, Golub, et al., 1990), and longitudinal studies on a limited number of patients have revealed numerous naturally occurring polymorphisms at discrete D N A binding sites for known regulatory factors (Ait-Khaled and Emery, 1994, Ait-Khaled, et al., 1995, Delassus, et al., 1992, Delassus, et al., 1991, Koken, et al., 1992, McNearney, et al., 1995, Meyerhans, et al., 1989, Michael, et al., 1994), I wished to determine what sites are conserved in vivo and i f polymorphisms in L T R sequences correlate with clinical parameters (stage, C D 4 count, duration of infection, rate of CD4 decline). I therefore examined 5'-LTR proviral sequences from 42 HIV-1 infected patients chosen from a cohort to represent a cross-section of clinical criteria.  P C R was used to obtain  sequence data for nucleotides -305 to +78 (with respect to the cap site of HTVXB2) of L T R s derived from uncultured peripheral blood mononuclear cells (PBMC). These sequences were then analyzed with respect to clinical parmeters as well as their differential abilities for basal and Tat-transactivated transcription in cell lines derived from the two principle HIV-1 in vivo targets (monocyte/ macrophage, T-cells).  These results: 1) define the most  frequent  naturally occurring length polymorphism (MFNLP), 2) report highly conserved naturally occurring Ets/ RBF-1 motifs and 5 ' - A C Y G C T G A - 3 ' / R B F - 2 motifs (Bell, 1997, Bell and Sadowski, 1996), 3) confirm several previously described less frequent polymorphisms, 4) identify novel polymorphisms, 5) suggest that, for these 42 patients, no simple generalized correlation between L T R sequences or their transcription potential and clinical parameters used in this study exists, despite a wide range of polymorphisms and transcriptional activities, and 6) show that some of the novel naturally occurring polymorphisms found, corresponding to altered L T R transcription in vivo, correspond with altered binding of nuclear factors to these sites in vitro.  Results  In vivo HIV1 LTRs consist of two uncoupled loci Alignment of LTRs is presented in figure 4.2 with respect to pMCE36.1 (used as reference in C A T assays, see below).  These LTRs were derived as described earlier and outlined in figure 4.1.  A s expected, the consensus  sequence was closest to Los Alamos National Library ( L A N L ) consensus B (Myers, 1995), the North American and European subtype.  Strikingly, consensus nucleotides -305 to -121 were 13.11% ambiguous (Fig. 4.2D) whereas  nucleotides -122 to +78 were only 5.03% ambiguous (Fig. 4.2E). This nearly 3 fold greater variability in L T R /  HIV-1  LTR variants  52  MCEF  1998  Figure 4.1. Schematic representation of amplification, cloning and sequencing strategies. In A , the HIV-1 proviral genome is shown integrated into the host chromosomal D N A (black) with the primers MCE#1, MCE#2, MCE#3, MCE#4, used to amplify the HIV-1 5'-LTR, designated by an arrow-head and the number of the primer. Abbreviations are Long Terminal Repeat (LTR), Unique 3' (U3), Repeat (R), Unique 5' (U5). In B , the amplified region is depicted with the position of a restriction enzyme linker site Xbal, added during the amplification and the highly conserved internal HindlTJ site. In C, the cloned portion of the amplicon from B is depicted in the constructs p M C E . Primer positions are indicated as arrow-heads with numbers (as above). The relative positions of cw-acting elements are indicated in C, with polygons representing DNA-binding factors with their names above. The transcription start site is designated as +1 with the nascent R N A stem- loop structure T A R caricatured over it. The viral encoded Tat protein is caricatured attached to the bulge of T A R . T A T A A designates the T A T A box, C A T designates the Chloramphenicol acetyl transferase reporter gene of the p M C E constructs. Tata-binding protein (TBP) is depicted binding and interacting with the holoenzyme (Holo). The 3'-LTR Nef in A and it's homologous overlap with the 5'-LTR in C are shaded with nucleotide -121 indicated at the junction of LTR/Nef-coding and L T R / non-coding sequences. The position of the most frequent naturally occurring length polymorphism is indicated at position -121.  HIV-1  LTR  variants  53  MCEF  o  m  "  "  ———— ——  —  e  i„„aa„a„aaaaa  M M M H H > M M 1 - 1 > > > > > > > M > H > > H > > > H M > > > M M H | M M M M H M H M M H H M H M M M M M M H M M H M M H M t H M M M M H H M H H H  1998  aS  - H  .£f>5 c N  £ ft a  aa  ijaaaaaaaaaaac  a. a t h & a a a a a a a a c  HIV-1  LTR  variants  U  "O <n 60  •I  B  fa  £3 a  1  54  MCEF  1998  CD  Wr iflL  42  vv A A A  3  AA  4t  A A  AA  4>  0) 43  X  8 8 8 V  O 42  X  +  < EH  O 42 W I  w  TH  f  i  I I I ! i  .  u o o uA A B V V V Y V B 8 V V 8 V V 8 V 8 8 8 V  VV  8 8 8  Y  VV VVVVVVbb  V V. . 8 B B 8 ' V V V  I  CQ iiaaoiaaaaaQiC  HIV-1  LTR  variants  55  MCEF 1998 Nef-coding sequences compared to L T R / non-coding sequences is consistent with previous reports (McNearney, et al., 1995) and suggests these regions are uncoupled, independently evolving loci.  In vivo H I V - 1 L T R sequences from -305 to -206 The deletions boxed in Fig. 4.2D have not been reported in the L A N L data base (Myers, 1995). For the 4 deletions in-frame to Nef (pMCE 9.3, 9.29, 9.104, 5.37, 4.48, 16.1, 16.2, 30.1) 4 out of the 5 patients with these deletions were advanced in disease (stage UJ or IV, Fig. 4.2 C). However, together they represent less than 10% of the sequences from stage III/ IV (Fig 4.2 B ) and only 3 patients (out of 22 in stage HI or IV, Table 2.1), indicating that this heterogeneous group of deletions is not a generalized event in late stage. Out-of-frame deletions (pMCE58.11, 16.1), predicted to truncate Nef, also occur in this region.  In vivo H I V - 1 L T R sequences from -205 to -122 Fifteen percent of LTRs conserved the U S F site palindrome core 5 ' - C A C G T G - 3 ' (D'Adda DI Fagana et al., 1995).  Eight U S F site variants were found.  (-166 to -161) (Fig. 4.2 D)  The most frequent sequence was 5'-  C A C A T G - 3 ' (47%), identical to L A N L Consensus B . 30% of the variant U S F sites were not represented in the L A N L database (Myers, 1995). This variability is different from a previous  observation that the U S F consensus  is strictly conserved in the HIV-1 5'-LTR in vivo (D'Adda DI Fagana et al., 1995 ) based on a limited longitudinal analysis of 4 patients (Michael, et al., 1994). The Ets-1 motif core 5'-GGA-3' (on the negative strand, -144 to 146) (Holzmeister, et al., 1993) (Fig. 4.2D) is conserved in 87% of the clones. Only the variant 5'-GGG-3' was found. The RBF-1 binding site motif core 5 ' - A T C C G - 3 ' (-147 to -143) (Bell and Sadowski, 1996) contains the Ets core and is itself conserved in 82% of the clones (Fig. 4.2D). The RBF-2 binding site 5 ' - A C Y G C T G A - 3 ' (-121 to -129) (Bell, 1997, Bell and Sadowski, 1996), is conserved in 63% of the clones (Fig. 4.2D). Based on the high affinity LEF-1 core motif 5'-CTNTG-3' (Waterman and Jones, 1990) (on the negative strand, -130 to -134), only 31 % of the clones conserved this site (Fig. 4.2D). Despite heterogeneity, 92% of these variants were represented in the L A N L database (Myers, 1995). The prototypical T G A stop codon for the Nef protein is next to the LEF-1 site (Fig. 4.2D). translational termination was predicted for p M C E 19.1,  Premature  19.4, pMCE16.1, pMCE4.81 and pMCE58.11. However,  95% of clones terminated in T G A / T A G at position -125 (33%) or had a T G C / C G C at this position followed immediately by a T G A ending at position -122 (62%). The use of the -122 stop codon, the most frequent variant,  HIV-1 LTR variants  56  MCEF 1998 adds a Cysteine/ Arginine to the end of Nef. One variant, from a stage II patient, pMCE26.1, had no stop codon in this region.  In vivo HIV-1 LTRs from 38% of patients harbor the most frequent naturally occurring length polymorphism (MFNLP), absent from the prototype LTR The M F N L P was 15-34 base pairs long with a consensus sequence of 5'-  ctacacagctgcctACAAgaACTGCTGA-  3' (Fig. 4.2D) and is located at the end of the L T R / Nef-coding sequence (Fig. 4.1) after the second potential and most frequent T G A stop codon, corresponding precisely to positions -120/ -121 of the H J V X B 2 sequence.  An  unexpectedly high number of patients (38%) have this polymorphism, yet examination of Table 2.1 and statistical analysis (not shown) found no correlation with stage, CD4 count, duration of infection or slope (rate of CD4 decline) for interpatient or intrapatient (8 to 100%) M F N L P accumulation frequency. MFNLP-bearing variants revealed striking features including: i) the  However, sequence analysis of  5 ' - A C Y G C T G A - 3 ' motif/RBF-2 site was  absolutely conserved in all the M F N L P s detected; ii) the M F N L P demarcates the boundary between L T R / Nef-coding and L T R / non-coding sequences; iii) A l l Ets/RBF-1 sequence variants with a disrupted core, except pMCE19.14 (that has a rare SP-1 region length polymorphism, see below), also have an M F N L P ; iv) the M F N L P s comprise a 5'A C Y G C T G A - 3 ' motif/RBF-2 site, in LTRs where these sites, or RBF-1/ Ets sites, are otherwise abrogated.  In vivo HIV-1  LTR sequences from -121  to  -82  For NFKB sites (-104 to -95 and -90 to -81) 85% of LTRs had 5 ' - G G G A C T T T C C - 3 ' sequences in both sites (Fig. 4.2E). This motif is one of those selected by Kunch et al. (Kunsch, et al., 1992) through an unbiased target detection assay (TDA) for ability to bind the p50 or p65 subunits of N F K B .  On the basis of the target-detection  assay sequences, 6% of LTRs (pMCE4.81/19.1/19.14) may fail to bind NFKB at all and 9% (pMCE62.10/ 10.86/ 33.10/34.2/8.23/59.1/9.3) may only bind it at a single site. NFKB vivo.  The Ets binding sites embedded in the  pMCE33.10 and pMCE8.23  NFKB sites were  sites are therefore extremely conserved in  highly conserved,  do not conform to the 5'-GGA-3' core consensus Ets  only clones pMCE59.1,  binding motif (Seth, et al.,  1993) at both sites (Fig. 4.2E, boxed bases).  HIV-1 LTR variants  57  MCEF  1998  In vivo HIV-1 LTR sequences from -81 to -40 Based on unbiased T D A selection (Thiesen and Bach, 1990), each of the 3 individual SP-1 sites (-77 to -68, -66 to 57, -56 to -46) were highly conserved (SP-1.3, SP1.2, SP1.1/ 92, 96, 97% respectively) (Fig. 4.2E). Additionally, 80% of clones had all 3 SP-1 sites conserved. Interestingly, clones pMCE4.81, pMCE19.1 and 19.14, had the sequence SP-1.2 5 ' - T A G G C A G G G A C - 3 ' and SP-1.1 5 ' - A A G G A G T G G C - 3 ' separated by an extra 11 bp 5'T A G G C A A G A C T - 3 ' , imperfect SP-1 site.  In vivo HIV-1 LTR sequences from -40 to +78 Seventy five percent of the sequences had both perfect T A T A box (Wobbe and Struhl, 1990) (-27 to -23) and E box motifs (Ou, et al., 1994) (-38 to - 33, -21 to -16) (Fig. 4.2E). The 5 ' - T A T A A - 3 ' sequence (97%), 3' E box (92%) and 5' E box (85%) were well conserved. Notably, clones pMCE25.5 (5'-TATAG-3'), pMCE16.1 (5'-TCTAA-3') had variant T A T A boxes and only one clone pMCE31.3, had both 5' and 3' E box variants. Unexpectedly, numerous T A R D N A sequence variants were found, particularly in the stem region (Fig. 4.2E).  The 5'-GGG-37 5'-CCC-3' nucleotides for the base of T A R were highly conserved (94%).  Variants  included 3 clones with a ' T ' for ' G ' substitution at position +1 of T A R (boxed bases, Fig. 4.2E) and one clone with a ' C ' missing at position +59 (boxed base, Fig. 4.2E). Bulge sequences were also highly conserved (94%) with absolute conservation of ' T ' at position 23, known to bind Tat in T A R R N A (Jones and Peterlin, 1994, Roy, et al., 1990). T A R loop D N A was also highly conserved (98%), and only two positions, 32 and 33, ('G' to  ' A ' ) were  variable (Fig. 4.2E).  In vivo HIV-1 LTRs displayed  differential basal-transcription patterns in U937 and Jurkat  cell lines The acute human T-cell leukemia Jurkat cell line, and the human histiocytic human U937 (monocyte lineage) cell line, were selected for measuring transcription activity from the p M C E L T R clones, because they represent HJV-1 permissive cell lines (NIH, 1995). From preliminary phylogenetic analysis, the naturally occurring L T R that most closely resembled the prototypical HTVXB2 clone was pMCE36.1 (results not shown).  This clone was therefore  selected as the reference. To ensure a linear range for C A T assays, I first titrated the amount of D N A used for transfections (2 to 64 ug) with three different p M C E clones (Fig. 4.1) and the reference pMCE36.1.  HIV-1  LTR  variants  When using 4  58  MCEF  1998  Ug of plasmid D N A , CAT-activity was found to be in the linear range below the plateau for all the titrated clones, both in basal and Tat-fra/w-activated activities (Fig. 4.3). A l l subsequent transfections were performed with 4 ug of D N A . The lowest basal level of transcription in the Jurkat T-cell line (Fig. 4.4A) was 0.26 for pMCE4.81 and 0.31 for pMCE19.14.  Both clones have an N F K B . 1  variants with an ' A ' for ' C in  position 5 (Fig. 4.2E).  Additionally both have ' A ' for ' G ' in position 6 of SP-1.2 and importantly an 11 bp insertion/ deletion  between  SP-1.2 and SP-1.1, lengthening the distance to the TATA-box, for SP1.3 and SP1.2 sites (Fig. 4.2E).  Clones  pMCE18.6, p M C E 5 8 . l l , pMCE26.3, p M C E l l . l , had the highest fold the reference) (Fig. 4.4A).  basal transcription activity in Jurkat cells (2-  A l l four had perfect consensus sites for N F K B , SP-1, E-box and TATA-box (Fig.  4.2E). The median activities in Jurkat cells for all the transfected clones was 1.37 ranging from 0.26 to 2.64. Therefore, the lowest basal activity (roughly 30% of the reference) remains relatively intact in Jurkat cells, despite a greater than 2-fold range. Clones which displayed the highest  basal activity in Jurkat cells (Fig. 4.4A) did not all  demonstrate the highest basal transcription in the U937 monocyte cell line (Fig. 4.4C).  In particular, clones  pMCE18.6, pMCE24.1, and pMCE65.5, all within approximately two fold of the reference activity in Jurkat basal transcription, were only at 0.5 fold the reference activity in U937 cells, despite a much wider range of activities in the U937 cell line. This cell-type-specific transcriptional difference raises the possibility that some in vivo selected LTRs may confer transcription/ replication advantages in specific cell types. The median activity in U937 cells was 1.37, ranging from 0.10 to 6.24.  HIV-1  LTR variants  59  MCEF  HIV-1  LTR variants  1998  60  MCEF  1998  ~  "5  cn  o  P  X  ca  U « ta ca  ca  ca  H  c• > Td  ta  u  w  +  U CD  CU  B B S  >  rt  "S  CO  0  rt  -a &  rt  CO  ^  e  — u ft  auop H3W  auop 3DlA[d  ^  d  a § ^ a.- g g M (3  Q  o ca  .o ca < U  U  CD >  CD >  ca  to  D.  BS  S g  Ia • §<  V  U (a  1  "3 rt  rt  5  2  H  u *J  ^ £ § !- > ea cn  01  rt  «  o  ca  O, CO  "rt»  ca  rt  •  H  ^ «a "-a Q u o « § £ ca o rt  rt | °  auop HDIMd  auop aopvd  8 • JS a  * £& CU OS  rt  r o "i  LTR variants  61  MCEF In  vivo  HIV-1  1998  LTRs, display TAR-dependent and TAR-independent, Tat-unresponsiveness  The Jurkat-Tat cell line contains a stable integrated copy of a Tat c D N A and constitutively produces Tat protein (NIH, 1995). In Jurkat-Tat cells, transcription from pMCE19.14, pMCE4.81, pMCE59.1 and pMCE16.1 was severely impaired (Fig. 4.4B). The first three are the only clones with ' A ' at positions 26 and 32 in the bulge and loop respectively of T A R (boxed bases, Fig. 4.2E), suggesting TAR-dependent Tat-unresponsiveness.  On the other  hand, the fourth clone, pMCE16.1 had an identical T A R sequence to that of the reference and 4 other Tat-responsive clones ( p M C E l l . l , pMCE16.2, pMCE18.6, pMCE25.4) (Fig. 4.2E). The activity in Jurkat-Tat of all 4, but not pMCE16.1, was comparable to the reference (Fig. 4.4B). A l l four Tat-unresponsive clones had perfect consensus sequences for NFkB, SP-1, and E-boxes except pMCE25.4, which had a deviant 5'-E box sequence (Fig. 4.2E), and all but pMCE16.1 had perfect TATA-boxes (Fig. 4.2E). This clone had a 5'-TCTAA-3' variant TATA-box (Fig. 4.2E). Both in U937 and U937 co-transfected with pRSVTat, this clone pMCE16.1 had higher activity than in Jurkat and Jurkat-Tat (Fig. 4.4A, B , C, D). This suggests that the 5'-TCTAA-3' variation of the TATA-box is responsible for cell-specific, TAR-independent Tat-unresponsiveness. This hypothesis has now been proven (Bell, 1997). The median in Jurkat-Tat cells was 1.01 ranging from 0.02 to 1.34. The clones pMCE31.3, pMCE31.1, pMCE63.19 all had only marginally greater activity in U937 cells cotransfected with pRSVTat (Fig. 4.4D) than in Jurkat-Tat cells (Fig. 3B). The median in U937 co-transfected with pRSVTat was 1.00 ranging from 0.10 to 2.74. Thus, unlike basal activity, the range of Tat-transactivated activity in U937 cells, co-transfected with pRSVTat, was not significantly more than in Jurkat-Tat cells.  No definitive phenotype could be attributed to  MFNLPs  In order to test for an M F N L P phenotype in transient transfections I matched clone pMCE65.5 to clone pMCE63.19 that had the largest M F N L P (34 bp) (Fig. 4.2). These clones do not differ in U S F , N F k B , SP-1.2, SP-1.1, E boxes, T A T A box, or T A R D N A . They did differ in SP-1.3, L E F and M F N L P .  A n approximately two-fold higher  activity was detected for the non-MFNLP clone in Jurkat cells (Fig. 4.4A). A n equivalent activity was detected in Jurkat-Tat cells (not shown) and a nearly 6-fold higher activity for the M F N L P clone was detected in U937 cells (not shown). However, this was not an absolute feature of all the M F N L P containing clones with respect to the non M F N L P clones (not shown). Therefore, higher activity in U937 than Jurkat cells is not a general M F N L P phenotype. Recently we have shown that the 5 ' - A C Y G C T G A - 3 ' motif/ RBF-2 site, duplicated in M F N L P s , is  HIV-1 LTR variants  62  MCEF  1998  required for full stimulation of HIV transcription by the Ras signal transduction pathway (Bell and Sadowski, 1996). I therefore tested for Ras-responsiveness in the matched clones.  I found that the M F N L P confers no perceived  advantage to Ras response of its linked L T R in Jurkat (Fig. 4.5), Jurkat-Tat, U937,  U937 + pRSVTat, HL60  (human promyelocytic leukemia cell line) (NIH, 1995) and HL60 + pRSVTat (not shown).  RBF-1 and c-Ets 1 bind to 5'-ATCC-3' but not to 5'-ACCC-3' in LTR variant Ets -II RBF-1 sites Brendan Bell has shown using electrophoretic mobility shift assays (EMSA), that in Jurkat nuclear extracts, both RBF-1 and c-Ets-1, but not Elf-1 bind to the R B E IV site (TCC) but not to the mutant R B F - l / E t s (CCC) (Bell, 1997). Thus a protein related to Ets family members in D N A binding specificity, distinct from c-Ets 1 and E l f 1, recently characterized as RBF-1 (Bell and Sadowski, 1996), binds to a highly conserved site at -141 to -149 of the HIV-1 L T R , in addition to c-Ets 1 (not shown).  TAR independent Tat-unresponsiveness (pMCE16.1) correlates to abrogated binding of nuclear factors to the TATA box The HIV-1 L T R T A T A box is known to be essential to basal and especially Tat-dependent transcription (Berkhout and Jeang, 1992, L u , et al., 1993, Olsen and Rosen, 1992, Sakaguchi, et al., 1991, Wobbe and Struhl, 1990). Clone pMCE16.1 has a 5 ' - T C T A A - 3 ' at this position and clone pMCE25.5 has a 5'-TATAG-3' variant TATA-box (boxed bases, Fig. 4.2E). Both of these variants are expected to severely impair transcription (Wobbe and Struhl, 1990), yet in transient transfection assays, only the 5'-TCTAA-3' mutation severely impaired Tat-dependent transcription (Fig. 4.4B). Brendan Bell has shown that a Jurkat nuclear complex, termed T B C , forms specifically with wild type L T R TATA-box radiolabeled oligonucleotide wt-(TATA) but not with mut-(TCTA) (Bell, 1997). Although a similar complex has been observed by Sakaguchi et al. (Sakaguchi, et al., 1991), we have not yet been able to demonstrate that this complex corresponds to T B P and associated factors (results not shown). It is of great interest that the binding of this complex correlates with the ability of the L T R to be transactivated by Tat in vivo.  HIV-1  LTR variants  63  +63.19  1  Jurkat cells • v-Ha-Ras • alone  CAT activity (% acetylation)  Figure 4.5. Ras-responsiveness is not a distinct MFNLP-bearing LTR phenotype. Cells were transfected with 4 Ug of the constructs indicated on the y-axis, and co-transfected with 6 ug of the effector indicated in the legends. On the x-axis is indicated the chloramphenicol acetyltransferase activity. Constructs with a + sign indicate presence of an M F N L P .  HIV-1 LTR variants  MCEF  1998  Discussion Several papers now describe longitudinal studies of naturally occurring HIV-1 L T R sequences from a few patients at one stage of disease or one patient throughout a window of disease progression (Ait-Khaled and Emery, 1994, AitKhaled, et al., 1995, Delassus, et al., 1992, Delassus, et al., 1991, Koken, et al., 1992, McNearney, et al., 1995, Meyerhans, et al., 1989, Michael, et al., 1994). In contrast to these studies, I investigated the naturally occurring HIV-1 5'-LTRs from a 42 patient cross-section, representative of all stages of HIV-1 infection. Whereas I have found a wide range of L T R polymorphism and transcription activities, I was unable to make any simple correlation between clinical parameters and sequences. Consistent with previous reports, I found conservation of the T A T A box, SP-1 and N F K B elements. In addition, the ETS motif/ RBF-1 site and the 5 ' - A C Y G C T G A - 3 7 RBF-2 site (Bell and Sadowski, 1996) were shown to be extremely well conserved, suggesting a role for RBFs in in vivo selection of the HIV-1 L T R . U S F and LEF-1 binding consensus sites showed an unexpected number of variants.  In contrast, the  In particular, the high  variability for the U S F binding site, suggests a dispensable role in vivo. Length polymorphism in the SP-1 region was associated with a lower activity, in contrast to increased transcription for a similar polymorphism in this region reported by other groups (Michael, et al., 1994). This may be reconciled by differences in the SP-1 binding site detected by these authors and the imperfect SP-1 sites I detected. In agreement with the importance of the loop and bulge of T A R (Harrich, et al., 1994), I found that polymorphisms to this region can be responsible for lack of Tat-responsiveness.  Other workers have also noted an  unexpectedly large number of LTRs unresponsive to Tat (Meyerhans, et al., 1989, Michael, et al., 1994). Perhaps Tat-unresponsive LTRs play a role at some point in vivo through low level gene expression, hence evading more rapid clearance by the host immune system. It is noteworthy that point mutations in the TATA-box found in vivo in this study have revealed the presence of a nuclear factor whose binding correlates with the ability of the T A T A box to support Tat-transactivation. Further work will be required to identify this factor and determine its role in Tatresponsiveness. Previously, the M F N L P region was considered as two polymorphisms of separate stretches divided by 19 bases (Koken, et al., 1992, Michael, et al., 1994). In the alignment of figure polymorphisms into one.  4.2D, I have combined the two  This approach has the advantage of aligning the maximum number of amino acid  HIV-1  LTR  variants  65  MCEF  1998  sequences uninterrupted up-to their T G A stop codon for the overlapping Nef reading frame and assuming a uniform site of insertion/ deletion between -121 and -122, precisely at the junction of a 3-fold difference in sequence variation between L T R / Nef-coding and L T R / non-coding regions. alignment suggests the occurrence of the M F N L P  For the longest insert detected (pMCE63.19), my  as a perfect duplication of the two  T T T C T A C A A G G G A C A - 3 ' and 5 ' - G A C T G C T G A C A - 3 \ separated by possible mechanism for this occurrence could be through  sequences 5'-  5'-AAG-3' (Fig. 4.2D and F i g . 4.6).  template-switching combined with  A  nontemplated  misincorporation and misalignment after switching, similar to early strand-switching during reverse transcription, as demonstrated for mutated R L T R sequences (Ramsey and Panganiban, 1993). If this is the mechanism at play here (forced copy-choice strand-switching), one possibility is that the -121 position (in the U3 region of the 3'-LTR R N A ) is frequently nicked during or  before cytoplasmic reverse transcription.  Another possibility is that no  preference for nicks exists at the -121 position, with high accumulation rates simply reflecting favorable selection of random events. Further experiments will be required to test these hypothesis. The heterogeneous group of 5 ' - A C T G C - 3 ' motif insertion/ deletions, I call M F N L P s , has been reported to have both positive (Golub, et al., 1990) and negative (Koken, et al., 1992, Michael, et al., 1994) effects on transcription. I have not found any definitive phenotype for all the M F N L P containing clones through correlation with clinical and laboratory parameters, or in transient transcription assays in T-cell or pro-monocyte cell lines (for basal, Tat-mmr-activated or cell activation through the Ras pathway). I postulate two models to explain why the M F N L P is selected for in vivo but does not give a measurable difference in transcription activity in transient transfection assays.  One possibility is that insertion during reverse transcription  generates frequent length  polymorphism in this area that is selected only when mutations to nearby regulatory D N A binding motifs occur that can be compensated for by binding of the same factor(s) to the M F N L P three arguments.  sequences.  8 of the 9 clones bearing mutations in the Ets motif/ RBF-1 site  In support of this model are at -141 to -149 also have  M F N L P s that have two 5 ' - A C Y G C T G A - 3 ' motifs/ RBF-2 sites (Fig. 4.2D). In addition, Brendan Bell initially pointed out that 9 of 9 clones, from the 478 originally screened, which had mutations affecting the Ets binding site in the 5' N F K B site also had similar M F N L P s (Appendix). Finally, many of the clones containing M F N L P s simply have alterations in the 5 ' - A C Y G C T G A - 3 ' motif/ RBF-2 site, and the M F N L P regenerates a 5 ' - A C Y G C T G A - 3 ' motif/ RBF-2 site, as well as less frequently, a L E F site (Fig. 4.2D). This compensatory or rescue role may explain the lack of a definitive phenotype and only marginal  HIV-1  LTR  variants  66  MCEF  EH U CD CJ U EH EH EH  1  < CD CD CD  EH CJ CD CJ CJ EH EH EH CJ  EH CJ CD CJ CJ EH EH EH CJ  EH CJ CD CJ CJ EH EH EH CJ  EH O CD U U EH EH EH CJ  EH CJ CD CJ CJ EH EH EH CJ  EH U CD U U EH EH EH CJ  CD CD  CD  CD CD  CD CD  CD CD CD  CD CD CD1  CD CJ  CJ  <!  %  %  < EH  < EH  u  CJ EH EH EH  < CD <! CD CJ  CJ  < CD CJ  <;  < CD CJ  < EH  < CD % u  <;  CD  EH U EH EH EH EH CD  U EH EH EH EH O  EH CJ EH EH EH EH CD  U  CD EH  CD U  CD CJ  CJ EH EH EH  < < CD  <:  <:  <  <:  <!  a %  & EH  $ EH CJ EH EH EH EH CD <C CD CJ  U EH EH EH EH CD  CD U  1998  EH  CJ CD CJ CJ EH EH EH  CJ  * CS D CD CD  %  CJ EH U EH EH EH  CJ CD CD EH U  < CJ CD EH  CJ CD EH  CJ  <  CD CD CJ  CD CD  Oi EH U EH EH EH  •a  OH  CJ CD CD EH  EH  CJ  CJ  <  EH  CD U  CD  < < CD  CJ CD  U CD  CJ CD  CJ  CJ  << EH  EH  CJ  < CD CJ  ro  EH  EH  <:  CD EH  EH  O  < CD  U  o  <!  <;  00  <!  EH  EH  EH  EH  U EH  U  CJ  U  CJ  CD  CD  CD  CD  CD  U CD  U CD  CJ CD  U CD  CJ  CJ  CJ  CD  CD  CD  CD  u  u  U  U  <! <! EH U  <:  <  < EH  EH  <  <:  < EH  EH  rH  rH  rH  00  00  00 U3  OO  tf/V-/  LTR  EH  EH  CJ  *S  <!  CO ID  <:  <: CD EH  -EH U  CD 3  u  <:  o  •<  CTl  rH  H  00  00  VO  variants  o o  CJ >CD  VO  67  MCEF growth differences  1998  obtained with isogenic constructs (Koken, et al., 1992). The second model to explain why  M F N L P bearing LTRs do not give a measurable effect on transient transfectivity is that it's core 5 ' - A C T G C T G A - 3 ' may bind transcription factors, such as RBF-2,  that regulate transcription only when integrated into chromatin.  Consistent with this notion is the fact that linker scanning mutations in the region of the M F N L P have much more severe affects on proviral replication (Kim, et al., 1993) than on transcription as assayed in transient transfections (Zeichner, et al., 1991). These two models are not mutually exclusive and may both play a role in masking an apparent phenotype of the M F N L P . In conclusion, although viral replication perse may be pathogenic (Coffin, 1995, Connor and Ho, 1994), since specific L T R polymorphisms do not appear to be exploited temporally (Delassus, et al., 1992) nor do they correlate in a generalized manner with disease state (for the 42 patients in this cross sectional study), the wide range of different L T R s and transcriptional activities may be a reflection of the wide range of microenvironments HIV-1 infected cells are subjected to, and that neither a super-transcriptionally active 5'-LTR, transcriptionally active 5'-LTR, represent the pinnacle quasispecies. In this manner, as an ensemble  nor a very weakly-  advantage to all the microenvironments that select  of heterogeneous, transcriptionally competent and less competent  L T R s , the L T R contributes to the pathogenic process through adaptability, highlighted by my findings on the M F N L P , independent of disease state. Indeed, from the point of view of therapeutic intervention targeting the L T R , the high level of plasticity I detected  suggests that, as for anti-retroviral targeting of reverse transcriptase, any  strategies targeting the L T R should include combinations of conserved sites from in vivo sequences as targets, if L T R plasticity is to be thwarted and rapid resistance avoided.  HIV-1  LTR  variants  68  MCEF 1998  Naturally Occurring HIV-1 LTRs have a Frequently Observed Duplication  •  that Binds RBF-2 and Represses Transcription  In this section I address the functional significance of an MFNLP.  generated by site directed mutagenesis and the MFNLP Jurkat nuclear extracts to MFNLPs  Isogenic mutants + or - an MFNLP were  was shown to confer repression. Binding of RBF-2 from  is shown. An argument is made that in vivo selection of MFNLPs  is due to  RBF-2 binding.  Data in this section was prepared from the following manuscript: Mario Clemente Estable. Brendan Bell, Martin Hirst, and Ivan J. Sadowski. Naturally Occurring HTV-l LTRs have a Frequently Observed Duplication that Binds RBF-2 and Represses Transcription, (in press J . V i r o l . 1998)  Data in this section has been presented at the following meeting: Mario Clemente Estable. Brendan Bell, Michael V . O'Shaughnessy and Ivan J. Sadowski. HTV-l 5'-LTR M F N L P s bind RBF-2 and correlate with the loss of RBF-1,2 or N F k B sites. V I Annual Canadian Conference on HTV/ATDS Research, Ottawa, Ontario, May 1997.  Introduction In vivo the only highly conserved transcription factor D N A binding motifs in the L T R / Nef-coding region appear to be R B E III and R B E IV/Ets (Bell, 1997, Bell and Sadowski, 1996, Estable, et al., 1996). Within the L T R / noncoding region, although the enhancer region is highly conserved in vivo  (Delassus, et al., 1991, Estable, et al.,  1996, Koken, et al., 1992, McNearney, et al., 1995, Michael, et al., 1994, Myers, 1996, Myers, 1995), naturally occurring variants with point mutations that are predicted to impair N F K B , Ets, and RBF-1  binding have been  detected (Estable, et al., 1996). Indeed, in at least some assays, mutations to one, or deletion of both, N F K B sites does not abrogate viral replication (Chen, et al., 1997, Englund, et al., 1991, Leonard, et al., 1989, Ross, et al., 1991, Vlach, et al., 1995). Moreover, a pathogenic HIV-1  isolate has recently been described that completely lacks  the prototypical enhancer sequences (Zhang, et al., 1997). predicted to impair binding of SP-1,  In vivo, mutations to the basal promoter which are  T B P and E-box binding proteins, and mutations to T A R and non-TAR D N A ,  that impair Tat-irans-activation, have also been described (Estable, et al., 1996).  MFNLPs  bind RBF-2  69  MCEF Natural HTV-1 LTRs, including those from AIDS patients, also contain length polymorphisms. include the insertions and deletions I found and are summarized in Figure 5.1 A .  1998 These  In particular, a length  polymorphism immediately 5' of the enhancer region, has been detected by several groups (Ait-Khaled, et al., 1995, Estable, et al., 1996, Golub, et al., 1990, Koken, et al., 1992, Koken, et al., 1994, Michael, et al., 1994, Zhang, et al., 1997, Zhang, et al., 1997), in which sequences overlapping the hLEF/ T C F - l a site are duplicated. Several recent publications refer to these insertions as partial T C F - l a sites (Michael, et al., 1994, Zhang, et al., 1997, Zhang, et al., 1997). Golub and co-workers have noted that one such duplication increased viral replication and transcription in the context of an additional mutation between the N F K B motifs (Golub, et al., 1990) and pointed out that sequences within the duplication corresponded to unduplicated prototype L T R sequences (-139 to -119) previously noted to increase phorbol ester responsiveness (Kaufman, et al., 1987). This same region, unduplicated (157 to -122), has been described by Nakanishi and co-workers as the U R E , acting positively in M O L T - 4 or U937 cells but as a negative regulatory element in M T - 4 or Jurkat cells (Nakanishi, et al., 1991).  These authors also  demonstrated three specific complexes (URE-binding factors) formed on this region with nuclear extracts from HeLa cells (Nakanishi, et al., 1991). Koken and co-workers have described this same duplication as the " C T G m o t i f and were the first to note that most of the duplications in this region contained a 5 ' - A C T G C T G A - 3 ' sequence, that is also present in HIV ANT-70 and SIV (Koken, et al., 1992). These authors demonstrated that this motif enhanced the positive effect of the N F - K B sites on LTR-directed transcription in HeLa or Jurkat cells, and suggested that it binds a 68 kDa nuclear protein (Koken, et al., 1994). However, the duplicated C T G motif was observed to have a slight negative effect on transcription and replication in vivo (Koken, et al., 1992, Koken, et al., 1994). In the previous section, I have shown that this polymorphism is the most frequent naturally occurring length polymorphism (MFNLP) of the HIV-1 LTR, present in 38% of sampled patients, and that it's occurrence does not correlate with the clinical laboratory parameters of CD4 count, stage, duration of infection and progression rate (Estable, et al., 1996). Whereas M F N L P s contain partial or full T C F - l a duplications, we have also noted that they invariably duplicate R B E III, representing a binding site for RBF-2, and that some M F N L P s additionally contain potential Ets " G G A " core binding site sequences. Because there is a correlation between M F N L P occurrence and mutations to the R B E sites, I have proposed a compensatory role for this frequent polymorphism (Bell, 1997, Bell and Sadowski, 1996, Estable, et al., 1996).  MFNLPs  bind  RBF-2  70  MCEF  1998  Resolving the function of this duplication and identification of the transcription factor(s) that it binds is important for our understanding of HIV-1 transcription in vivo, particularly in light of a recently described pathogenic HIV-1 isolate which lacks an enhancer but which contains the M F N L P duplication (Zhang, et al., 1997). I demonstrate here that M F N L P s bind a specific complex from Jurkat nuclear extracts, which is indistinguishable from RBF-2. Additionally, I show that hLEF and Ets proteins do not interact with all M F N L P s .  Using isogenic  constructs I demonstrate that the M F N L P has a repressive effect on HIV-1 L T R transcription in Jurkat cells, but not in cells lacking RBF-2. Finally, Brendan Bell has shown for the first time that RBF-1, a factor which binds to sites which may be compensated for by the M F N L P , contains the Ets family transcription factor G A B P (Bell, 1997). Taken together with the previous section and the mentioned work of Brendan Bell, my data argues for in vivo M F N L P selection based on RBF-2 binding and not hLEF ( T C F - l a ) or Ets family proteins.  Results  Two different MFNLPs form a specific complex with the same nuclear factor from Jurkat cells From my collection of HIV-1 LTRs isolated from V L A S samples (Estable, et al., 1996) I selected clones p M C E 69.1 and p M C E 9.104 for further analysis as representative MFNLP-containing LTRs.  These two clones contain  M F N L P duplications of 24 and 31 nucleotides, respectively (see Figure 5.IB), and were chosen because they have potential AP4, hLEF, Ets and R B E III sites, thus representing sequences for all of the putative transcription factor binding sites we have been able to identify within M F N L P s .  Oligonucleotides representing the M F N L P s from  p M C E 9.104, designated M F N L P - A , and p M C E 69.1, designated M F N L P - B , were used as probes in electrophoretic mobility shift assays (EMSA) with Jurkat cell nuclear extracts to determine whether these duplications formed specific complexes with proteins. I found that M F N L P - A formed several complexes with Jurkat nuclear proteins (Figure 5.2). The band labeled S (Fig. 5.2A) was found to represent a specific protein-MFNLP-A complex because this band could be eliminated by inclusion of excess unlabelled M F N L P - A oligo in the binding reaction (Fig 5.2 Panels A & B , compare lane 2 with lanes 3-6), whereas the nonspecific band labeled NS was largely unaffected by excess competitior oligo (Fig. 5.2 Panel A & B , lanes 3-6).  This M F N L P - A complex requires the T G A motifs  within M F N L P - A , because mutations to either the first (Fig. 5.2 Panel B , lanes 7-9) or both T G A motifs (Fig. 5.2 Panel B , lanes 13-15) of the competitor oligo reduced competition. The affinity of this complex for the first T G A  MFNLPs  bind RBF-2  71  MCEF  1998  "±3 n  0)  Z  w  . o .S  sa uL  HP  ss  •2 fc. S  ^ .5 < O g  w  O ^  .5 to to iC o  MFNLPs  bind  RBF-2  W  ! .—I 72  MCEF  B  MFNLPs  AP-4  AP-4 i  1  1  RBE III  ;  1998  • hLEFi  1  RBE III  i  !  5 ' -CTTAAGCATCTACA^^ACTGCTGAfJAAGjfl^CTGCTGA!-3 ' 3 ' -GTAGATGTCJTJrGACGACT^TTdT^  '  5 ' -CTTAAGCATCTACAGAACTGC ACT CAAGAACTGCTGA- 3 ' 3'-GTAGATGTCTTGACG|pS3TTCTTGACGACTGAATTC-5 5'-CTTAAGCATCTACAGAACTGCTGACAAGAACTGC&CS-3' 3 ' - G T A G A T G T C T T G A C G A C T G T T C T T G A C G E6&3AATTC-5 5 ' -CTTAAGCATCTACAGAACTGI 'ACTf lAAGAACTGCpPGERf GTAGATGTCTTGACG(iiiGTTCTTGACG{iS3AATTC - 5 ' 3  A  Mut A1 Mut A2 Mut A1&2  AP-4  < ' \"~RBEm""i | i  I  -- ?-, E  1  i  „, _J !""RBE"irr""i hLEF[ i  i  5 'ACTGJAiACTGCTGAjCAJrCqA-CAACiAJACTGCTGAi-3 ' i J3 ; - C G A C T ^ T i A G G ^ T T d ^ G A C G A C ' l J 3 T A G C T C G - 5 '  B  5 'ACTGAACTGCillOATCCACAAGAACTGCTGA-3 ' 3 ' - C G 3S33S 3TAGGTGTTCTTGACGACTGTAGCTCG- 5 '  Mut B1  5 ' ACTGAACTGCTGACATCCACAIPCC A C T G C T G A - 3 ' 3'-CGACTGTAGGTGT &GCPGACGACTGTAGCTCG-5'  Mut B2  5 'ACTGAACTGCTGACATCCACAAGAACTGCftCI-3 ' 3 ' -CGACTGTAGGTGTTCTTGACG 3J<£ft 3 T A G C T C G - 5 '  Mut B3  RBES  RBE IMS RBE IIISMutl  5-GATCCTTCAAGAACTGCTGACATG-3 ' 3'-GAAGTTCTTGACGACT^TACCTAG-5' 5 -GATCCTTCAAGAACTGC. iCT'p A T G - 3 ' 3 ' -GAAGTTCTTGACGT«A< T A C C T A G - 5 '  5-CTTCAAGA^CTGCTGACATCGAGCTTTCTC-3' 3'-TTCTTGACGACTpTAGCTCGAAAGAGGTC 5 '  RBE MIL  5 - CTTCAAGAACTGC. SaC$i :ATCGAGCTTTCTC - 3 ' 3 ' - T T C T T G A C G ' KS&< 3TAGCTCGAAAGAGGTC- 5 '  RBE IIILMut  5-TCAGATGCTGCATATXAGCAGCTGC-3 j 3'-TCTACGACGTATATTCGTCGACGAAT5'  RBE IS RBE IL  5-CTAGATGCTGCATATAAGCAGCTGCTTTTTGCATG-3 3'-TACGACGTATATTCGTCGACGAAAAAC-5' 5-GATCCCCGAGA|CTGCATCCGGAGTAG-3 ' 3 ' -GGGCTCTGA;CGTAGGCCTCATCCTAG-5 '  RBE IV  5-GATCACCAGCTGTGGAATGTGGTG-3' 3 ' -lTGGTCGACACCTTACACACACTAG-5 ' J  AP-4  Panel B . MFNLP sequences and synthetic oligonucleotides used for EMSA. M F N L P - A and M F N L P - B , double-stranded oligonucleotides representing the 31 nucleotide duplication from p M C E 9.104, and the 24 nucleotide duplication from p M C E 69.1, respectively. RBEs, double-stranded oligos representing the R B E III element (RBE HIS, short version; R B E IIIL, long verson), the R B E I element (RBE IS, short version; R B E IL, long version), and the R B E I V element of wt HIV-1 L T R sequences. Nucleotide substitutions within mutant oligoncleotides (Mut) are shaded. Other, double-stranded  MFNLPs  bind  RBF-2  73  MCEF  naaa C\J  iiiiaay c3 SIN nay CM  3  U  —i  Q  3  C  c so o <  AI39U CM _  &  cu — c -a -o  3  t7 dV  o  E  SI39d i jn|Aj sin 3aa  .™ ^  cu  C in  I  ft C E oBO :  cvi  2  •a °  Z PIAI0 dlNdlAI S°  •6 ™  in|Aj g d l N d l A I  i. m i A i a a  <u -o  s, ©  £I  diNdiAJ diNdiAi  CD  1  Js °°  $2  S  1998  P  =u  CU  ~2  CJ/ CD  X CU  ca  -  6  .2  5,  "O *—<  2 S  5£  C3  zm \m vd~iNdi/\i 1 ^  < C/3  I  a o a  CN  u s  3u © — 00 cj ™  3m|Aj  -  VdlNdlAI  fa >CS 03  "3 3  C  DQ l- m|Aj  V  -M  H S  "o  3 C ~  S  O  2  o.  1  a  3  in  C- — o o -4-t  V  . .  >  s =«-  dlNdlAI  Z  C3 CD  Gfl  8i cu K  CU  !a  =2 S o =J CJ c =3 S CU — IB 2 .5 XJ 6? ™  dlNdlAI  cu bo  is -n CM in  c«  .£  cu c  — 13  VdlNdlAI  CU  CU  m  13  "O § cu  ra  £CO CN  —  z to  -  X Q_  E o O  MFNLPs  11w CO  bind  RBF-2  cn m 13 CU 'S C  0 a  ir>;. cj ca cu <u CU Cci c a • M  o  1 ,o2  to  rH  O  O CN  74  MCEF  1998  motifs appears to be significantly greater than for the second, because mutations to the second T G A alone does not significantly impair competition (Fig. 5.2 Panel B , lanes 10-12). The oligonucleotide derived from p M C E 69.1 (Estable, et al., 1996), designated M F N L P - B (Fig. 5.1 B) was also found to form a specific complex with proteins from Jurkat nuclear extracts, since the band labeled S (Fig. 5.3) could be competed with a 200 fold molar excess of unlabelled M F N L P - B , whereas the nonspecific band labeled NS was unaffected by competitor oligo (Fig. 5.3, compare lanes 2 and 3). This specific M F N L P - B complex was found to require the second T G A motif within M F N L P - B , because mutations to these nucleotides prevented competition (Fig. 5.3, lane 6), whereas mutations to the first T G A (Fig. 5.3, lane 4 ) or a non-TGA motif (Fig. 5.3, lane 5) did not. I also found that the specific complex formed with the oligonucleotide representing M F N L P - A could be competed with excess heterologous oligonucleotide M F N L P - B (Fig. 5.2, Panel C, lane 16 compared to lane 2), suggesting that these duplications from two different patients specifically bind the same nuclear factor. Consistent with this notion, I found that mutation of the second T G A motif of the M F N L P - B oligo inhibited its ability to compete for binding the M F N L P - A specific complex (Fig. 5.2 Panel C, lane 19). In contrast, as we observed with E M S A experiments using an M F N L P - B probe, mutations to the first T G A (Fig.5.2 Panel C lane 17) or a non-TGA motif (Fig. 5.2 Panel C lane 18) of the M F N L P - B competitor had little effect on competition for specific complex formation with M F N L P - A .  Conversely, I also found that the specific complex formed with the oligonucleotide  representing M F N L P - B could compete with unlabeled excess heterologous oligonucleotide M F N L P - A (Fig. 5.3, lane 7). These results demonstrate that two different M F N L P s specifically bind an identical nuclear factor which requires the T G A motifs for DNA-binding.  The TGA-specific complexes formed with MFNLP-A and B can be competed by oligonucleotides recognizing RBF-2 I found that the TGA-specific complex formed with M F N L P - A could be eliminated by competitor oligos containing RBF-2 binding sites. Specifically, oligonucleotides representing R B E I (HIV-1 L T R nucleotides -26 to -5, see F i g . 5.1) (Fig. 5.2 Panel C, lane 26) and R B E III (HIV-1 L T R nucleotides -131 to -122, see Fig. 5.1) (Fig. 5.2 Panel C , lanes 22, 23) could compete with M F N L P - A for binding the TGA-specific complex.  MFNLPs  bind RBF-2  In contrast, neither  75  MCEF 1998  -t—'  OQ Q.  zL L 1 2  OJ  -t—>  00  _l  Comp 200 X  1—  CO -t—'  I> CD  CD  Q_  CL  CL  Z  Z  _l  LL  _l LL  _l LL  < CL  >  CO =  ^ CO  LU LU LU > DC CC DC  3 4 5 6 7 8 9 10  NS Figure. 5.3. MFNLP-B binds a specific factor from Jurkat nuclear extracts. E M S A with radiolabeled synthetic M F N L P - B oligonucleotide (see Fig. IB). Reactions contained no extract (lane 1), or 2.5 |J.g Jurkat nuclear extract (lanes 2-10) and 1 pm radiolabeled oligonucleotide. Unlabeled competitor oligonucleotides were added to the binding reactions, as indicated above each lane, at 200 fold molar excess (lanes 3-10). S, specific complex; NS, non-specific complex.  MFNLPs bind RBF-2  76  MCEF  1998  an R B E III oligo containing a mutation of its T G A motif (Fig. 5.2 Panel C,lane 24), nor an oligo containing only a partial R B E I site (Fig. 5.2 Panel C, lane 25) could compete for binding the M F N L P - A complex.  Also, an  oligonucleotide containing a binding site for RBF-l/Ets (RBE IV, Fig. 5.2 Panel C, lane 21) was unable to compete for M F N L P - A specific complex formation. Similarly, although most M F N L P s contain sequences resembling an A P 4 site, I found that a competitor oligonucleotide containing a strong consensus A P 4 site was unable to compete for the M F N L P - A complex (Fig. 5.2 Panel C, lane 20). Consistent with this result, I found that antibodies against AP-4 protein do not interfere with formation of this complex (results not shown).  Similarly, the TGA-specific  complex formed with M F N L P - B can be competed with an R B E IH site (Fig. 5.3, lane 9) but not an R B E IV site (Fig. 5.3, lane 8) or a shortened R B E I site (Fig. 5.3, lane 10). These results demonstrate that the protein complex which binds the M F N L P from two different patients appears to have similar binding specificity as the previously described factor RBF-2, and is distinct from AP4 or RBF-1/ Ets.  MFNLP-A or -B oligonucleotides compete for binding of RBF-2 to RBE III We have previously defined RBF-2 as a nuclear factor which binds at least two sites within the HIV-1 L T R termed R B E UI and R B E I (Bell and Sadowski, 1996). Therefore, RBF-2 can be observed as a specific complex which forms with labeled R B E m (HTV-l L T R nucleotides -131 to -122, see Fig. 5.4, lane 1, labeled RBF-2) which can be competed with unlabeled R B E III (Fig. 5.4, lane 2) or unlabeled R B E I oligos (HTV-l L T R nucleotides -26 to -5, not shown and see (Bell and Sadowski, 1996)).  The specific RBF-2 complex cannot be competed with  oligonucleotides which bind RBF-1/ Ets (RBE IV, Fig. 5.4, lane 4) or a strong consensus A P 4 binding site (Fig. 5.4, lane 5). RBF-2 is immunologically distinct from hLEF and its DNA-binding component is approximately 100 kDa, as determined by southwestern blotting (Bell and Sadowski, 1996) and U V cross-linking (results not shown). In addition, we have previously observed that every M F N L P within the V L A S contains a predicted duplication of the RBF-2 binding site represented by R B E m (Estable, et al., 1996). Also, 86% of the M F N L P s within the V L A S correlate with the co-occurrence of mutations to R B E sites ((Estable, et al., 1996), and results not shown). Therefore, to confirm that the M F N L P s  bind RBF-2,  I examined whether  MFNLP-A  and  oligonucleotides could compete for binding of RBF-2 to a labeled R B E HI oligonucleotide in E M S A .  MFNLP-B I found that  inclusion of excess M F N L P - A (Fig. 5.4, lane 6) or M F N L P - B (Fig. 5.4, lane 10) oligos in the binding reaction inhibited specific complex formation with R B E III as efficiently as did an unlabeled R B E l U competitor (Fig. 5.4,  MFNLPs  bind RBF-2  77  MCEF  1998  J3  OD  RBE IMS RBE IIIL Mut 1 RBE IV AP-4  MFNLPA MFNLP A Mut 1 MFNLP A Mut 2 MFNLP A Mut 1 & 2 MFNLP B MFNLP B Mut 1 MFNLP B Mut 3 RBE IS  MFNLPs  bind  RBF-2  78  MCEF  1998  lane 2). Mutations to the first or both T G A motifs within M F N L P - A prevent competition for RBF-2 (Fig. 5.4, lanes 7 and 9). Similarly, mutation of the second  T G A motif in the M F N L P - B oligo prevents its ability to  compete for RBF-2 binding (Fig. 5.4, lane 12). Therefore, in combination with the results shown in Figures 2 and 3, these experiments demonstrate that M F N L P s from two different patients bind a factor which is likely identical to RBF-2, a result which is consistent with the fact that these polymorphisms duplicate sequences which overlap R B E  m. Most MFNLPs do not bind ETS family members or hLEF Because some M F N L P s contain a G G A (ATT) sequence, representing a potential Ets-like core binding element (Flory, et al., 1996, Hodge, et al., 1996, Nye, et al., 1992, Seth, et al., 1993), I wished to determine whether these duplications caused the introduction of additional binding sites for an Ets protein family member within the L T R . To examine this possibility, I used recombinant protein representing the DNA-binding domain of c-Ets-1 (Ets-1 A 301) for in vitro footprinting experiments with naturally occurring HrV-1 LTRs (Estable, et al., 1996). For these experiments I used a collection of L T R templates which contain different M F N L P s (pMCE 9.104 ( M F N L P - A ) , p M C E 16.1, p M C E 25.5, p M C E 59.1, and p M C E 69.1 (MFNLP-B)) (Estable, et al., 1996), as well as clones p M C E 4.81 and p M C E 36.1 which lack M F N L P s ((Estable, et al., 1996), see Fig 5.5).  As expected, for most of  the L T R templates I observed binding of recombinant Ets protein to the enhancer region, which contains Ets sites embedded within the N F - kB elements (termed R B E II), and to the upstream RBF-l/Ets site R B E IV.  Note however  that p M C E 9.104 and 59.1 have mutations within R B E IV and R B E II, respectively, and therefore do not bind recombinant Ets at these locations (Fig 5.5, 9.104 and 59.1). The polymorphism to the R B E II site of pMCE59.1 also abolished binding of the p50 subunit of N F K B to the 5'-NFkB motif (results not shown).  Amongst the five  LTRs containing M F N L P s , only p M C E 25.5 and pMCE69.1 (Estable, et al., 1996) were found to bind Ets protein within the duplication (Fig. 5.5, 25.5 and 69.1). This result demonstrates that the M F N L P s are likely not selected in vivo for their ability to bind Ets family members.  It is also interesting to note that several of the naturally  occurring LTRs, including p M C E clones 4.81, 9.104, 16.1 and 25.5 have additional previously unreported Ets binding sites (Fig. 5A), some of which are a direct consequence of a deletion in this region highlighted in figure 5.1A (Estable, et al., 1996).  MFNLPs  bind  RBF-2  79  MCEF  <  AI39U  III39U  MFNLPs  1998  II 3 9 0  bind  RBF-2  80  MCEF  1998  Panel B. DNAse I footprinting analysis of the HIV-1 LTRs from the p M C E clones (22) as indicated (above lanes), and recombinant hLEF. The G+A M & G sequencing reaction (lanes 1), and probe digested with 0.1 U (lanes 2) or 1 U (lanes 2) DNase I in the presence of 0.2 mg recombinant hLEF (lane 4) were analyzed on 6% denaturing gels. The sequences of potential hLEF binding sites are indicated (right); those which are not protected by hLEF are noted with an " X " .  MFNLPs  bind  RBF-2  81  MCEF  1998  Because several recent publications have referred to the MFNLP as a partial TCF-loc (hLEF) duplication (Michael, et al., 1994, Zhang, et al., 1997, Zhang, et al., 1997), I examined whether these duplications were capable of binding recombinant hLEF in vitro. Surprisingly, I could not detect binding of recombinant hLEF to the MFNLPs on LTR clones 59.1, 69.1 or 9.104 (Fig. 5.5B). I did observe binding of hLEF to its predicted element upstream of the MFNLP on LTR clone 59.1 (Fig. 5.5B, 59.1), but not on LTR clones pMCE 36.1, pMCE 69.1, or pMCE 9.104. I believe these results reflect the fact that, although the prototypical HIV-1 LTR represented by the HXB2 clone contains a strong upstream consensus binding site for TCF-loc /hLEF site (CAAAG) (Dinter, et al., 1991, Giese, et al., 1991, Giese, et al., 1992, Love, et al., 1995), most of the LTR sequences I obtained from HTV-l infected and AIDS patients (as well as those in the Los Alamos data base) have the sequence CAAGA (Estable, et al., 1996). Since HMG proteins, such as hLEF, bind to DNA in the minor groove and the AAA bases of the high affinity hLEF site form part of this groove (Love, et al., 1995), the A to G difference could explain the poor binding of hLEF I detected. Therefore, these results suggest that most MFNLPs do not bind hLEF.  In fact, my  analysis of LTR sequences from HTV-l infected as well as AIDS patients, indicates that only  31% of the  prototypical LTR hLEF sites (Estable, et al., 1996) and only rare MFNLP duplications ((Estable, et al., 1996) and results not shown) would be predicted to provide a strong binding site for hLEF, based on its DNA-binding specificity.  MFNLPs inhibit HIV-1 LTR-directed transcription in cells expressing RBF-2 To determine the contribution of the MFNLP to HTV-l LTR-directed transcription, I created variants of the pMCE 9.104 and pMCE 69.1 LTR clones (Estable, et al., 1996) in which the MFNLPs were removed by site directed mutagenesis.  I found that in the Jurkat T-cell line, removal of the MFNLP-A from pMCE 9.104 caused a  significant 75% increase in LTR transcription, while removal of MFNLP-B from pMCE 69.1 caused a 25% increase (Fig. 5.6A). Ras-responsiveness was not impaired by removal of the MFNLP (Fig.  5.6B), but Tat-responsiveness  was significantly augmented (Fig. 5.6C). We have previously demonstrated that Jurkat cells express detectable levels of RBF-2 (Bell and Sadowski, 1996). Because my experiments suggest that the MFNLPs provide an additional binding site for RBF-2, I sought to examine the effect of the MFNLP on HIV-1 transcription in a cell line which does not produce RBF-2.  We have  searched for such cell lines using EMSA and southwestern blotting. From these experiments it was observed that  MFNLPs  bind RBF-2  82  MCEF  1998  Relative activity  B  (- MFNLP B)pMCE 5.1 3A  •  pZV-Ras pZN-Ras  pMCE 69.1  alone 1  2  Relative CAT activity  H (-MFNLP B) p M C E 5 . 1 3 A  pMCE 69.1  0  20  •  pRSV-Tat  B  empty vector  •  alone  40  60  Relative CAT activity  Figure. 5.6. MFNLPs repress transcription in Jurkat cells. Panel A. Jurkat cells were transfected with 4 jig of the indicated pMCE HIV-1 LTR-CAT plasmid . CAT activity was assayed 48 hours post transfection. Solid bars indicate CAT activity generated by the parent pMCE plasmid (+ MFNLP) and the open bars activity of the pMCE derivatives in which the MFNLP has been deleted by oligonucleotide mutagenesis (- MFNLP). Panel B. pMCE 69.1 (+MFNLP) or pMCE 69.1 (-MFNLP), were transfecred into Jurkat cells with the indicated co-transfected plasmid. Panel C. pMCE 69.1 (+ MFNLP) or pMCE 69.1 were transfected into Jurkat cells alone (solid bars), cotransfected with pRSV-TAT expressing HIV-1 TAT protein (open bars), or co-transfected with a corresponding control empty expression plasmid (shaded bars). Relative CAT activity is indicated on the vertical axis. Each experiment was performed at least twice in triplicate. Error bars indicate the standard deviation from the mean.  MFNLPs bind RBF-2  83  MCEF  1998  T (Jurkat and C E M ) , B (Daudi, Ramos) and monocyte (U937) -cell lines contained RBF-1 and 2 (Bell, 1997). However, the HL-60 promonocytic leukemia cell line did not contain detectable levels of either RBF-1 or RBF-2 as demonstrated by southwestern blotting with R B E IV and R B E HI oligos (Bell, 1997).  Importantly, differentiation  of HL-60 cells into macrophages by treatment with phorbol ester was observed to induce the presence of both RBF-1 and RBF-2 (Bell, 1997) as detected by southwestern blotting and E M S A . To examine whether the presence of R B F 2 contributes to the repressive effect of the M F N L P on L T R transcription, I compared expression of the L T R derivatives in differentiated and undifferentiated HL60 cells.  I found that in undifferentiated cells, where RBF-2 is  absent, deletion of the M F N L P s had no effect on transcription of transiently transfected L T R clones p M C E 9.104 and p M C E 69.1 (Fig. 5.7).  However, in contrast, deletion of the M F N L P from both p M C E 9.104 and p M C E  69.1 caused significantly elevated transcription in differentiated HL-60 cells which contain RBF-2 (Fig. 5.7), similar to the effect of the M F N L P in Jurkat cells.  Therefore, these results demonstrate that the M F N L P in L T R s from  two different patients confers a repressive effect on L T R transcription in cells expressing RBF-2 but not in cells lacking RBF-2.  Discussion Retroviral L T R polymorphism can influence the course of disease.  For example, LTRs from murine leukemia  virus are major determinants of replication rate, tropism and pathogenesis (DesGroseillers, et al., 1985, Holland, et al., 1985).  Similarly, a 21 bp triplicated motif insertion of feline leukemia virus LTRs causes non-T cell non-B-  cell spleen lymphomas, increases viral replication, and is postulated to mediate insertional up-regulation of cellular genes from the 3'-LTR (Athas, et al., 1995). For HIV-1 there appears to be no temporal pattern of enrichment for specific L T R polymorphisms (Delassus, et al., 1992, Delassus, et al., 1991, Michael, et al., 1994) or correlation between disease state and specific L T R polymorphisms (Estable, et al., 1996) even though the 3'-LTR is potentially transcriptionally active (Klaver and Berkhout, 1994) and despite the high replication rate of HIV-1  in vivo (Coffin,  1995, Ho, et al., 1995, Wei, et al., 1995). Several groups have reported the occurrence of a "partial T C F - l a duplication", " C T G motif, or " M F N L P " , 5' of theNFKB enhancer elements in HIV-1 LTRs from a significant number of patients, living in geographically distinct areas of the world, sampled over different years (Ait-Khaled, et al., 1995, Estable, et al., 1996, Golub, et al., 1990, Koken, et al., 1992, Koken, et al., 1994, Michael, et al., 1994, Zhang, et al., 1997, Zhang, et al., 1997).  MFNLPs  bind RBF-2  84  MCEF  1998  p M C E 9.104 ( M F N L P A )  H  p M C E 69.1 ( M F N L P B)  - M F N L P (+PMA)  2  3  •  +MFNLP (+PMA)  •  - M F N L P (UN)  •  +MFNLP (UN)  4  5  Relative activity  Figure. 5.7. The repressive effect of the M F N L P requires R B F - 2 . Undifferentiated H L 6 0 cells (UN) or H L 6 0 cells differentiated to monocytes by treatment with P M A ( P M A ) were transfected with 4 (xg of the indicated parent p M C E HIV-1 L T R - C A T plasmid (+ M F N L P ) or p M C E derivative deleted of the M F N L P (- M F N L P ) . C A T activity was assayed 48 hours post-transfection.  MFNLPs  bind  RBF-2  85  MCEF This  polymorphism is also found in the full length ANT-70 molecular clone (Myers, 1995).  1998  The in  vivo  prevalence of this polymorphism argues for an important role in the HIV-1 life cycle, despite a lack of correlation between its occurrence and disease state (Estable, et al., 1996). Interestingly, we have found that the presence of the M F N L P correlates with the occurrence of mutations to the binding sites for RBF-1 MFNLP,  and RBF-2 (Bell and Sadowski, 1996, Estable, et al., 1996).  In L T R s harboring an  86% have mutations to R B E IV, III or U sites ((Estable, et al., 1996), and unpublished data). Thus, I  have previously suggested that the M F N L P may provide a compensatory function rather than a novel pathogenic effect, as has been observed for some onconeogenic retroviral L T R polymorphisms of other viruses (Athas, et al., 1995, DesGroseillers, et al., 1985, Holland, et al., 1985).  The compensatory hypothesis is supported by my analysis of L T R sequences containing M F N L P s reported by other groups.  Specifically, the presence of the " C T G m o t i f duplication reported by Golub and co-workers  occurred in the context of a R B E II site mutation (Golub, et al., 1990).  Furthermore, several of the L T R s  possessing "partial T C F - l a duplications" (3B-5 and 3B-7) reported in a longitudinal study had mutations to the RBEFV site (Michael, et al., 1994), that ablate binding of RBF-1  (Bell and Sadowski, 1996).  A similar "partial  T C F - l a duplication" was reported to be present in a fully pathogenic and replication-competent variant that completely lacked the R B E JJ site and the overlapping NFkB and Ets sites (Zhang, et al., 1997).  The dispensability  of the N F K B binding sites for induction of AIDS by HIV-1 is paralleled by a similar finding for SIV (Ilyinski, et al., 1997).  In contrast to the dispensability of N F - K B for frank progression to AIDS, it is interesting to note that, due  to the occurrence of the M F N L P duplication, the R B E HJ site is 100% conserved in all available HIV-1 L T R sequences, except those reported from a long term non-progressor with stable C D 4 counts (Deacon, et al., 1995).  M y results indicate that the M F N L P s bind a specific nuclear factor that appears to be identical to RBF-2 (Bell and Sadowski, 1996), which is consistent with the fact that these polymorphisms represent a duplication of R B E lU.  Although previous reports have described the M F N L P as a partial T C F - l a (hLEF) duplication (Michael,  et al., 1994, Zhang, et al., 1997, Zhang, et al., 1997), I find that most M F N L P s do not bind h L E F in  vitro.  Furthermore, taken together with my previous analysis of 500 HIV-1 L T R sequences from patients, my results suggest that the high affinity binding site for h L E F which is present within the prototype H X B 2 L T R is not well conserved in vivo (Estable, et al., 1996).  However, I cannot exclude the possibility  that the lower affinity h L E F  sites I observe on many M F N L P s and upstream sites, may be involved in cooperative interactions of h L E F with  MFNLPs  bind RBF-2  86  MCEF  1998  other factors bound to the L T R in vivo , as shown in vitro for hLEF, TFE3, Ets and N F k B (Sheridan, et al., 1995, Waterman, et al., 1991). At least some M F N L P s contain a core G G A (A/T) sequence, which can be bound by recombinant Ets protein in vitro.  However, M F N L P s which contain an Ets binding site appear to be an exception rather than a  conserved feature of these duplications. I have also observed that some naturally occurring LTRs appear to have Ets binding sites within the L T R / nef-coding region and that several of these are a result of deletions which create a novel G G A core sequence. The significance of these novel Ets binding sites on HTV-1 transcription remains to be determined. The identity of RBF-2 also remains to be determined.  Because neither a competitor oligonucleotide  containing a strong consensus AP-4 binding site nor antibodies against AP-4 protein affect RBF-2 binding, I do not believe these factors could be the same. In U V cross-linking experiments Koken and co-workers have detected a 68 kDa band that interacts with the "CTG-motif (Koken, et al., 1994).  By southwestern blotting and U . V .  crosslinking we find that the DNA-binding component of RBF-2 appears to have a molecular weight of 100 kDa ((Bell, 1997, Bell and Sadowski, 1996), and unpublished results).  I note that the CTG-motif-interacting proteins  detected by Koken and co-workers migrates as multiple species between 68 and 100 kDa, indicating that these experiments may also have detected RBF-2 (Koken, et al., 1994). We have previously identified RBF-1 and RBF-2 as factors which bind at least four elements within the HIV-1 L T R that are necessary for full transcriptional responsiveness to v-Ha-Ras (Bell and Sadowski, 1996). RBF-1 binds with similar specificity as Ets family members, but as for RBF-2, appears to be immunologically unrelated to c-Ets-1, Fli-1, E R F or Elf-1 ((Bell and Sadowski, 1996), and unpublished results).  Importantly, binding of RBF-1  to R B E I V can be prevented by antibodies against G A B P a or G A B P p i but not GABP(32 (Bell, 1997), suggesting that the RBF-1 complex contains the G A B P a and |3l subunits (Bell, 1997, Watanabe, et al., 1993).  However, it  was previously shown that RBF-1 contains a DNA-binding subunit of approximately 100 kDa (Bell and Sadowski, 1996), which is larger than the 60 kDa of G A B P a (Watanabe, et al., 1993).  Therefore RBF-1 must contain an  additional subunit, or alternatively may represent a differentialy spliced or modified form of G A B P .  Interestingly,  there are also several physical and biochemical similarities between RBF-1 and RBF-2 including their patterns of expression and the apparent size of their DNA-binding components and similar partial proteolytic digestion patterns (Bell, 1997).  Therefore,  RBF-2, a factor which specifically binds the element duplicated by the M F N L P , is  MFNLPs  bind RBF-2  87  MCEF  1998  unrelated to AP4, G A B P , c-Ets-1, Fli-1, E R F or Elf-1 and is not hLEF, but may share a component in common with RBF-1. M y results, taken together with the fact that the presence of the M F N L P correlates with mutations to R B E sites, suggest that the M F N L P is selected in vivo because it provides a target for RBF-2 binding that is essential to HIV-1 replication.  In cells where RBF-2 DNA-binding activity is detectable, I find that the M F N L P s mediate a  repressive effect, whereas in contrast the M F N L P s have little effect in cells that do not express RBF-2. Therefore, it is possible that the M F N L P is selected in vivo because it down regulates HIV-1 transcription during monocyte to macrophage differentiation or during T cell activation. For example, a small reduction in the temporal expression of HIV specific proteins could drastically influence the survival of a newly infected cell in the face of co-infiltration of HTV-specific cytotoxic T-Lymphocytes into spleenic white pulp (Cheynier, et al., 1994, Cheynier, et al., 1995). A n additional possibility is that a more significant effect of the M F N L P is masked in my experiments because I have used transiently transfected L T R templates.  It is possible that the M F N L P alters an aspect of HIV-1  transcription in the context of chromatin. This would be consistent with linker scanning mutations within the R B E HJ and IV region (without the benefit of the M F N L P ) that have been found to drastically impair HTV-1 viral replication (Zeichner, et al., 1991).  The recent finding that a fully pathogenic HIV-1 isolate, capable of inducing  CD4 decline, clinical deterioration and AIDS, completely lacks NFKB/RBEII/Ets enhancer sites, but has an M F N L P , that only duplicates the R B E IH/ RBF-2 site (Zhang, et al., 1997), also strengthens the notion that the transcriptional effects of the M F N L P may not simply be limited to my experimental system.  I believe these issues  will be more clearly resolved upon determining the molecular composition of RBF-2. M y experiments, demonstrate that this factor is intimately related to the selection of these frequent length polymorphisms of the HIV-1 L T R in vivo.  MFNLPs  bind  RBF-2  88  MCEF Biochemical •  1998  purification of RBF-2  In this section I describe the purification by chromatographic techniques of 5 polypeptides from jur  extracts with RBF-2-specific DNA binding activity.  Data in this section was prepared from the following manuscript: Mario Clemente Estable. Martin Hirst, Brendan Bell, Steve Gygi, Ruedi Aebersold, and Ivan Sadowski. Biochemical purification and mass analysis of RBF-2 suggest it is a novel complex with specificity for the most conserved cw-element of the HIV-1 LTR. (in preparation, 1998).  Introduction Naturally occurring lesions to the HIV-1 L T R R B E HI site, a target for RBF-2 (Bell, 1997, Bell and Sadowski, 1996, Estable, et al., 1998, Estable, et al., 1996), are invariably compensated by an M F N L P that duplicates R B E HI (Previous 2 sections and (Estable, et al., 1998, Estable, et al., 1996)). I have shown that due to this, an R B E HI site is the most conserved element of the HIV-1 L T R in vivo (Previous 2 sections and (Estable, et al., 1998, Estable, et al., 1996)). In addition to being highly conserved, the R B E HI site is important to the prototypical HTV-l 5'-LTR because it is involved in the response to at least one signaling pathway, the protein-tyrosine kinase (PTK)/Ras/Raf signaling pathway (Bell, 1997, Bell and Sadowski, 1996).  Ras-responsive HTV-l transcription requires the two  recently described factors, RBF-1 and -2 (Bell, 1997, Bell and Sadowski, 1996). We have shown that RBF-1 (but not RBF-2) contains the Ets family members G A B P  a  and G A B P p i (Bell, 1997, Estable, et al., 1998) and that  RBF-1 and -2 appear to share a D N A binding subunit of 100 kDa (Bell, 1997, Bell and Sadowski, 1996, Estable, et al., 1998). Mutation of RBF-1 and -2 binding elements in the HIV-1 L T R , prevents Ras stimulated transcription (Bell, 1997, Bell and Sadowski, 1996). The identity of RBF-2 is unknown, but extensive characterization suggests it is novel (Bell, 1997, Bell and Sadowski, 1996). Attempts to clone RBF-2 using the one hybrid strategy library with an R B E III site  1 6  17  17  16  or by screening a A-gtll expression  have been unsuccessful (Bell, 1997). Both of these strategies rely on the assumption  The HOXA10 gene was cloned and deemed an artefact (Bell, 1997). The human Cyr61A gene was cloned, but does not appear to be RBF-2 (Sadowski, et al., 1998).  Purification of RBF-2  89  MCEF  1998  that a single gene product can bind strongly to an R B E HI site. However, RBF-2 appears to be a complex, and therefore may require more than a single gene product for it's D N A binding specificity, as appears to be the case for RBF-1 (Bell, 1997, Estable, et al., 1998). Therefore the molecular cloning of RBF-2 gene(s) is best addressed by purification of the RBF-2 complex, protein sequencing of it's components, and subsequent screening of  libraries  with oligos predicted from the amino acid sequence. In this section I describe the purification of RBF-2.  Results  RBF-2 binds to Heparin-Agarose and elutes  at high salt concentration  A n overview of the strategy used to purify RBF-2 is presented in Table 6.1. The typical RBF-2 E M S A shift, using an R B E Illwt labeled site, in figure 6.1, lane 2, was used to follow RBF-2 purification. During the purification, the specificity of each suspected RBF-2 fraction was verified by competing with either 100 X RBEIUwt as in figure 6.1, lane 3, or RBEIIImut as in figure 6.1, lane 4. The triple T G A to A C T mutation in RBEIIImut has been shown to ablate RBF-2 binding (Previous section and (Bell, 1997, Bell and Sadowski, 1996, Estable, et al., 1998)). Upon heparin-agarose fractionation the nuclear extract (from 50L of Jurkat cells) was resolved into 2 major peaks. The first corresponded to the flow-through (load and wash), and the second broader peak eluted during the salt gradient (Fig. 6.2 A ) . Representative fractions collected throughout the chromatography were analyzed by E M S A with R B E Illwt and pooled according to similarity in their E M S A profiles (Fig. 6.2 B). These were fractions 2 to 10 (A pool), fractions 36 to 41 (B pool), fractions 42 to 50 (C pool) and fractions 54 to 66 (D pool) (Fig. 6.2 B). The specificity of these pooled fractions were tested (Fig. 6.3). Fraction A was non-specific because it could be competed by both RBEIJIwt and RBEIIImut (Fig. 6.3, lanes 4 to 6). Fraction B appears to have some specificity for the T G A motif, since it cannot be totally competed with RBEIIImut (Fig. 6.3, lane 9), but was completely eliminated with RBEIJIwt (Fig. 6.3 lane 8)(see discussion). The typical RBF-2 profile in fraction C was shown to be specific, since it was completely eliminated with R B E Illwt (Fig. 6.3, lane 11) but not RBEIIImut (Fig. 6.3 lane 12). Therefore after H A fractionation, the RBEIH-specific-RBF-2 E M S A profile was found in Fraction C, and eluted between 0.75 and 0.95 M NaCl. A n aliquot of the Jurkat cell nuclear extracts loaded onto the Heparin-agarose column was kept at 4°C for 48 hours, with a loss of RBF-2 binding activity (compare Fig. 6.3 lane 1 to Fig. 6.2 lane 2), but not specificity (Fig. 6.3, lanes 2 and 3). Stability studies have shown that the RBF-2 activity is preserved for up to 14 days at 4°C  Purification  of RBF-2  90  MCEF  1998  T A B L E 6.1  RBF-2 Purification Jurkat cell nuclear extracts  Heparin-agarose  i Mono-Q  DNA Mutant  General Affinity Chromatography for DNA binding proteins  Cation exchange chromatography  Concatamerized mutant binding site Cyanogen Bromide coupled to sepharose  i DNA Wild Type  Concatamerized wild type binding site Cyanogen Bromide coupled to sepharose  Purification  of  RBF-2  91  MCEF 1998  1 2  RBF-2  3 4  £  Figure 6.1. Typical RBF-2 E M S A . 1 pm of radiolabeled wild type R B E III was used wiith 8 ug of Jurkat nuclear extracts in an E M S A reaction as described in Material and Methods. 1) no extract, 2) Jurkat nuclear extracts, 3) 100X WTRBEIII competitor, 4) 100X RBEIIIMut competitor.  Purification of RBF-2  92  MCEF 1998  CO  m  <s B  a  crt — :  o  .g  —1  o  o co  g rt  —  a.  pd  LT,  S  LO I  u  ja  c  u CN  o  X  33  X  o  LO  Ci  o rt  H rt  co  CJ  3  z*2  T3  E  '* o  =3  M "2 rt C L  LO •*  (30 ra  0  rt  1  «  | B  o  co — w u  0 J  « .5  -3LO CO  .s  o  3  « 2  CO  ii B NH rt  LO  •c — I—I  CD  "a "3 rt 2  5 •6 O rt C ac d  co M  o  O  S fi CU o co  C\J  •o c  X  CS  <  LO  H rt ti) rt  CO  -B  rt  CO  •SS "51  raCJ B  rt O  z  » u  o £? .S CL d g s P  EC "C  CU _  •d <u  i§  Q  < o  ea . 9 x> o •3  CO  CN « H  b ao <O s pq »  m  T3  C  E  CO  CM  n 92  I- UJ O u<  LL  CC Z> LL CO  I  LL  00  CQ DC  Purification of RBF-2  LL!  3  —  a rt c £ K c5) rt a*  y. cc  rt  g  s ro -l  W T 3 c5  ^ i rtE VB O u CJ "O o U CO  a ^  GO  B o  rt 93  MCEF  NE  1  2 3  FA  4  5  FB  6  7  8  1998  FC  9  10 11 12  Figure 6.3. Heparin-agarose chromatography fraction C, retains RBF-2 binding specificity. 1pm of radiolabeled RBEIII oligo was used with fractions in E M S A reactions as described in Materials and Methods. Lanes 1, 4, 7, 10: no competitor. Lanes 2, 5, 8, 11: 100X W T R B E HI. Lanes 3, 6, 9, 12: 100X Mut R B E III. nuclear extracts (NE. Heparin-Agarose fraction A (FA), B (FB) and C (FC).  Purification  of RBF-2  94  MCEF  1998  in H A buffer containing 8% glycerol, but is drastically reduced upon repeated freeze-thawing unless 20% glycerol and 0.05% NP-40 are added (results not shown).  RBF-2 binds to a strong anion exchanger and elutes in low salt concentration Fraction C was injected onto a Mono-Q column (see M & M ) and resolved into 2 major peaks in the flow through and at least 7 broader peaks throughout the gradient (Fig. 6.4 A). The RBF-2 activity bound the strong anion exchange matrix and eluted between fractions 44 and 50 (Fig. 6.4 A , B), with a peak of the upper 2 RBF-2 bands eluting at approximately 0.375 M NaCl as seen in fraction 44 (Fig. 6.4 B). The specificity of this fraction was confirmed and is shown in figure 6.4 C. This is the case because a R B E Illwt competition completely eliminates the RBF-2 bands (lane 2) whereas a RBEIIImut does not (lane 3). This fraction was named HAFC-Mono-QF44.  RBF-2 does not bind to an RBEIII""" affinity column, but does binds to an RBEIIF' affinity column Coomassie-blue staining of S D S - P A G E analysis of fraction HAFC-Mono-QF44, containing the RBF-2 activity, revealed that this preparation still contained hundreds of proteins (results not shown). In order to clear the Mono-Q fraction of remaining non-specific D N A binding proteins, I used poly dl-dC binding, as recommended by Kadonaga (Kadonaga, 1991). The lowest amount of dl-dC that did not affect the E M S A profile was estimated to be 1.0 ug (Fig. 6.5, lane 2). One fifth of this was used as a scale up amount. After clearing the non-specific proteins (see M & M ) , the sample was first passed over the RBEIII " affinity column. Essentially all of the binding activity was mL  recuperated in the flow-through and wash (Fig. 6.6, lanes 4 to 6). The flow through and wash from the R B E n i  m u t  affinity column, were then pooled and run over the RBEHT"  affinity column. A n insignificant amount of the RBF-2 binding activity was found in the flow through and wash (Fig. 6.7, lanes 3 to 7), and the majority of the RBF-2 activity was recovered in the 0.4 M fraction (Fig. 6.7, lane ' 9). I will refer to this fraction as HAFC-MQF44-OA-RBF-2 (Oligo Affinity), or OA-RBF-2 for short. The 1.0 ml of OA-RBF-2 was snap frozen and stored under liquid nitrogen.  Purification  of  RBF-2  95  MCEF  Purification  of  RBF-2  1998  96  MCEF  1  2  3  4  5  6  7  8  1998  9  Figure 6.5. Titration of dl-dC on M Q RBF-2 fraction. The RBF-2 preparation from Heparin-agarose-Mono-Q was used in E M S A using RBEIII radiolabeled probe and increasing amounts of dl-dC. Lane 1: no dl-dC. Lane 2 to 9 respectively: 0.5, 1.0, 1.5, 2.0, 3.0,4.0, 5.0, 6.0 ug dl-dC.  Purification  of  RBF-2  97  1 2  3  4 5 6 7 8 91011  12 13 14 15  Figure 6.6. RBF-2 does not bind to an R B E I I I affinity column. Jurkat nuclear extract HA-MQ-dl-dC RBF-2 was passed over an oligo-affinity column containing a mutation to the RBEIIJ binding site, as described in the Materials and Methods. Step fractions were assayed for RBF-2 activity with a R B E III radiolabeled probe. Lane 1: nuclear extracts. Lane 2: M Q Load + 100 ng dl-dC. Lane 3: M Q Load + no di- dC. Lane 4, 5: Flow through. Lanes 6 to 9: Washes. Lanes 10 to 15 respectively: 0.2 M , 0.4 M , 0.6 M , 0.8 M , 1.0 M , 1.0 M . 1T,ul  Purification  of  RBF-2  MCEF  123  1998  4 5 6 7 8 9 10 1112 13  Figure 6.7. RBF-2 does bind to an R B E H I affinity column. Jurkat nuclear extract H A MQ-dl-dC-RBEIII flow through RBF-2, was passed over an oligo-affinity column containing an RBEIII binding site, as described in the Materials and Methods. Lane 1: Load for Mutant chromat-ography. Lane 2: Load for R B E III chromatography. Lane 3: Flow through. Lanes 4 to 7:Washes. Lanes 8 to 13 respectively: 0.2 M , 0.4 M , 0.6 M , 0.8 M , 1.0 M , 1.0 M . u t  Purification  of  RBF-2  99  MCEF 1998 Oligo-affinity purified RBF-2 contains at least 5 polypeptides Coomassie-blue staining, of S D S - P A G E fractionation, of 30 ul of OA-RBF-2, failed to reveal proteins (results not shown). Using the more sensitive silver staining protocol (see M & M ) , analysis of 30 ul revealed polypeptides in the 120 kDa range for the OA-RBF-2 but not the 0.2, 0.6, 0.8 or 1.0 M fractions (results not shown). Using the non-cross-linking silver staining protocol (see M & M ) , S D S - P A G E fractionation of 100 ng of B S A and 30 ul of OA-RBF-2, failed to reveal proteins (results not shown). However, by re-staining the gel a second time (before fixing. See M & M ) , two major polypeptides in the 120 kDa range, as well as a polypeptide in the 110 kDa range and a fourth in the 100 kDa range were evident (results not shown). linking protocol was therefore the most sensitive method.  Re-staining with the non-cross-  Five hundred ul of OA-RBF-2 was then T C A  precipitated, and the entire amount loaded on another SDS-PAGE gel, and silver stained with a re-staining step (Fig. 6.8). In addition to the 4 polypeptides seen with 30 ul, a fifth polypeptide at 116 kDa can be seen in figure 6.8, lane 5.  OA-RBF-2 appears to be a novel complex In a collaboration with the Ruedi Aebersold laboratory (University of Washington), Steve Gygi in-gel trypsinized and excised the 2 upper RBF-2 silver stained polypeptides designated by arrows in figure 6.8, and examined them by tandem L C - M S / M S .  In addition to trypsin and human keratin, he derived 4 good tandem mass spectra.  These 4  were searched against the human database, the O W L database (compilation of 186,000 proteins from all species), and then against the E S T database (1.3 million proteins from human genome sequencing project).  He was unable to  identify these 4 spectra (Estable, et al., 1998).  Discussion Characterization of the RBF-2 complex previously indicated that a 100 kDa component may be a common denominator to both RBF-1 and -2 (Bell, 1997, Bell and Sadowski, 1996, Estable, et al., 1998). The evidence for this included southwestern blotting of crude nuclear extracts, probed with an RBEIII or R B E I V oligo and U V crosslinking of heparin-agarose fractions. Consistent with this, I have found polypeptides in the 100 kDa range in the final OA-RBF-2 preparation.  Purification of RBF-2  100  MCEF  w cc Pi  00  a < G O  a GO  |  1998  < u H  o u CO  O  CO  a  a < oo  g •a  PQ  sj 2  sft i j CU  Jrt  Qt  rt  1 B ^J  CO  CL CN [Lc  ft l7l  -a  CO  .s § CO  3? < £ |H  co  2 _g  &  a -o o 5 ft S i n tn N  .3  pa 2s Oi  .. B  ug ~* o °3 rt  •a S J !S  5  co CQ  ft  r '  .  cu  c- -c  S-  T) <D  ? id  ea 3 a &  CO  O gj, ac "S •3 VD  £  o> rt S  S P S  1  o C  J O  T)  u CD  n, -a  Purification of  RBF-2  101  MCEF 1998 Bearing in mind that the target sites for RBF-1 and -2 are functionally linked in their requirement for full Ras responsiveness of the HTV-1 L T R , yet recognize different D N A sequences, and taking into consideration their shared component, I believe the data is best explained if RBF-2 is a complex, as we have previously shown for R B F 1 (Bell, 1997, Estable, et al., 1998). There is sufficient precedent for complexes of transcription factors containing a common subunit but displaying altered sequence specificity for a target sequence. G A B P , which we have shown to be contained within RBF-1 (Bell, 1997, Estable, et al., 1998), is a case in point. Human G A B P (hGABP) has a D N A binding subunit (hGABPcc) of 60 kDa that contains a C-terminal ETS domain. Alone, hGABPot does not bind efficiently to D N A , but can do so only together with a hGABPfi subunit (Thompson, et al., 1991, Watanabe, et al., 1993, Watanabe, et al., 1990), and in RBF-1 this subunit appears to be GABPpM (Bell, 1997, Estable, et al., 1998).  That 5  polypeptides were present in the final OA-RBF-2 preparation, strengthens the contention that RBF-2 is a complex. The specific band in fraction B , resembles the first non-specific band (below the 2 upper specific bands) detected in a typical RBF-2 E M S A (compare Fig.  6.1, lane 2, or Fig.  6.3 lane 1, with Fig. 6.3 lane 7). One  interpretation of this data is that a proportion of the RBF-2 complex changes mobility upon HA-fractionation, becoming what I detect as fraction B . This would be in agreement with previous work, where HA-fractionation of U937 nuclear extracts resulted in increased mobility of the entire RBF-2 complex (Bell, 1997). The interpretation here would be that the RBF-2 complex has only partially dissociated, into fractions B and C .  A n alternative  explanation is that fraction B is unrelated to fraction C and represents another protein(s) with specificity for RBEHI. Results from further ongoing experiments will be required to untangle the relatedness of fraction B to RBF-2. These include southwestern blotting, uv-crosslinking, footprinting, and methylation interference studies of the H A - , M Q and OA-fractions. Spectra for components of the OA-RBF-2 preparation were unidentifiable, and we have been unable to identify any known transcription factor with specificity for the R B E HI site. Taken together, this data suggest that RBF-2 contains novel components. However, final proof that RBF-2 is a novel factor(s), must await it's cloning and sequencing.  Purification of RBF-2  102  MCEF  1998  Conclusions During HTV-l infection, viral turnover is estimated to occur at 10 per day (Ho, et al., 1995, Wei, et al., 1995). 9  Over 11 years, this would result in the turnover of 10  12  virus particles. If this number along with a corresponding  number of destroyed C D 4 T-Lymphocytes is pathogenic, was not addressed in this thesis. +  However, assuming this  is the case, then as pointed out recently by Meyerhans "What are the factors that influence virus fitness in vivo?" (Meyerhans, 1996). I put it to the reader, that an intact R B E HI binding site and its tamy-acting transcription factor RBF-2 appear to be key to viral fitness. The above contention is supported by genetic, physiologic and biochemical data, brought to light in this thesis. First, an R B E HI site is absolutely conserved in vivo, owing to the co-occurrence of an M F N L P that duplicates an R B E HI site (Estable, et al., 1996). In addition, naturally occurring LTRs with lesions to an R B E TV site (Estable, et al., 1996) or with deletions of an R B E H site (Zhang, et al., 1997, Zhang, et al., 1997) occur only in the context of a co-occurring M F N L P .  Secondly, an R B E HI site is physiologically relevant to at least one  signal transduction pathway, the PTK/Ras/Raf signal transduction pathway (Bell and Sadowski, 1996) and this pathway functionally links the R B E sites. This provides an explanation for M F N L P co-occurrence with lesions to R B E IV, III or II. Thirdly, an apparently novel complex from HTV-l permissive cells, RBF-2, is the only credible candidate for binding R B E III in vivo (Estable, et al., 1998, Estable, et al., 1998). Indeed, I interpret the data in this thesis to mean that without an R B E HJ site, HTV-l cannot replicate at high levels in vivo.  By extension then, the cw-element encompassed in M F N L P s , trans-acted upon by a novel  transcription factor RBF-2, is an absolute requirement for HIV-1 pathogenesis in vivo.  Conclusion  103  MCEF  1998  REFERENCES 1. (Health-Canada). 1997. AIDS in Canada. Quart, surveil. update. May 1997. 2. (WHO), W. H. O. 1996. Acquired Immunodeficiency syndrome (AIDS)-Data as at 20 November, 1996. Weekly Epidem. Report (WHO). 48:361-8. 3. (WHO), W. H. O. 1996. World malaria situation in 1993 (Part 1). Weekly Epidem. Report (WHO). 3:17-24. 4. Agy, M., L. Frumkin, L. Corey, and etal. 1992. Infection of Macaca nemestrina by human immunodeficiency virus type 1. Science. 257:103-106. 5. Aiken, C , and D. Trono. 1995. Nef stimulates human immunodeficiency virus proviral D N A synthesis. J. Virol. 69:5048-5056. 6. Ait-Khaled, M., and V. C. Emery. 1994. Phylogenetic relationship between human immunodeficiency virus type 1 (HIV-1) long terminal repeat natural variants present in the lymph node and peripheral blood of three HIV-1-infected individuals. J. Gen. Virol. 75:1615-21. 7. Ait-Khaled, M., J. E. McLaughlin, M. A. Johnson, and V. V. Emery. 1995. Distinct HIV-1 long terminal repeat quasispecies present in nervous tissues compared to that in lung, blood and lymphoid tissues of an AIDS patient. AIDS. 9:675-83. 8. Alcami, J., T. Lain de Lera, L. Folgueira, M. Pedraza, J. Jacque, F. Bachelerie, A. Noriega, R. Hay, D. Harrich, R. Gaynor, J.-L. Virelizier, and F. Arenzana-Seisdedos. 1995. Absolute dependence on kappa B responsive elements for initiation and Tat-mediated amplification of HIV transcription in blood CD4 T-Lymphocytes. E M B O J. 14:1552-60. 9. Alexandrov, I., L. Shlyakhova, A. Vartanian, M. Zajac-Kaye, and N. Alexandrova. 1997. c-Raf kinase binds to N terminal domain of c-Myc. FEBS Lett. 414:46570.  10. Alizon, M., P. Sonigo, F. BarreSinoussi, J. C. Chermann, P. Tiollais, L. Montagnier, and S. Wain-Hobson. 1984. Molecular cloning of lymphadenopathyassociated virus. Nature. 312:757-60. 11. Alizon, M., S. Wain-Hobson, L. Montagnier, and P. Sonigo. 1986. Genetic variability of the AIDS virus: nucleotide sequence analysis of two isolates from African patients. Cell. 46:63-74. 12. Alkhatib, G., C. Combadiere, C. C. Broder, Y. Feng, P. E. Kennedy, P. M. Murphy, and E. A. Berger. 1996. C C C K R 5 : a R A N T E S , MlP-lalpha, MlP-lbeta receptor as a fusion cofactor for macrophage-tropic HIV-1. Science. 272:1955-8. 13. Allain, B., M. B. LapadatTopolsky, C , and J. L. Darlix. 1 9 9 4 . Transactivation of the minus-strand D N A transfer by nucleocapsid protein during reverse transcription of the retroviral genome. E M B O J. 13:973-981. 14. Alonso, A., D. Derse, and B. M. Peterlin. 1992. Human chromosome 12 is required for optimal interactions between Tat and T A R of human immunodeficiency virus type 1 in rodent cells. J. Virol. 60:4617-4621. 15. Antoni, B. A., A. B. Rabson, A. Kinter, M. Bodkin, and G. Poli. 1994. NF-kappa B-dependent and -independent pathways of HIV activation in a chronically infected T cell line. Virology. 202:684-94. 16. Araujo, J. C , J. Doniger, F. Kashanchi, P. L. Hermonat, J. Thompson, and L. J. Rosenthal. 1995. Human herpesvirus 6 A ts suppresses both transformation by H-ras and transcription by the H-ras and human immunodeficiency virus type 1 promoters. J. Virol. 69:4933-40. 17. Arya, S. K., B. Beaver, L. Jagodzinski, B. Ensoli, P. J. Kanki, J. Albert, E. M. Fenyo, G. Biberfeld, J. F. Zagury, F. Laure, and et al. 1987. New human and simian HIV-related retroviruses possess  References  104  MCEF 1998 functional transactivator (tat) gene. Nature. 328:548-50.  human immunodeficiency virus enhancer in T cells. J. Virol. 71:3563-73.  18. A r y a , S. K . , C . G u o , S. F . Josephs, and F . Wong-Staal. 1985. Transactivator gene of human T-lymphotropic virus type III (HTLV-III). Science. 229:69-73.  28. Bassuk, A . G . , and J . M . Leiden. 1995. A direct physical association between ETS and AP-1 transcription factors in normal human T cells. Immunity. 3:223-37.  19. A t h a s , G . B . , P. Lobelle-Rich, and L . S. Levy. 1995. Function of a unique sequence motif in the long terminal repeat of feline leukemia virus isolated from an unusual set of naturally occurring tumors. J. Virol. 69:3324-32.  29. Bates, P. 1996. Chemokine receptors and HIV-1: an attractive pair? Cell. 86:1-3.  20. A v r u c h , J . , X . - f . Zhang, and J . M . K y r i a k i s . 1994. Raf meets Ras: completing the framework of a signal transduction pathway. Trends Biochem. Sci. 19 july:279-283.  31. B e l l , B . , and I. Sadowski. 1996. Ras-responsiveness of the HIV-1 L T R requires RBF-1 and RBF-2 binding sites. Oncogene. 13:2687-97.  21. Bagasra, O. 1992. Detection of human immunodeficiency virus type 1 in mononuclear cells by in situ polymerase chain reaction. New. Engl. J. Med. 328:327. 22. Baiter, M . 1997. How does H I V overcome the body's T cell bodyguards? Science. 278:1399-1400. 23. Baltimore, D . 1970. RNA-dependent D N A polymerase in virions of R N A tumour viruses. Nature. 226:1209-11. 24. Bandres, J . C . , A . S. Shaw, and L . Ratner. 1995. HIV-1 Nef protein downregulation of CD4 surface expression: Relevance of the lck binding domain of CD4. Virology. 207:338-341. 25. Barclay, A . N . , R . L . B r a d y , S. J . Davis, and G . Lange. 1993. C D 4 and the immunoglobulin superfamily. Phil. Transact. Royal Soci. Lond. 342:7-12. 26. Barre-Sinoussi, F . C . , J . C . Rey, F . , Nugeybe, M . T . Chamaret, S., Gruest, Dauguet, C , A x l e r - B l i n , C , V e z i n e t - B r u n F . , R o u z i o u x , C , Rozenbaum, W . , and Montagnier, L . 1983. Isolation of a T Lymphotropic retrovirus from a patient at risk of Acquired immune deficiency syndrome(AIDS). Science. 220:868-870. 27. Bassuk, A . G . , R . T . Anandappa, and J . M . Leiden. 1997. Physical interactions between Ets and NF-kappa B / N F A T proteins play an important role in their cooperative activation of the  30. Bell, B . 1997. University of British Columbia.  32. Benkirane, M . , H . S c h m i d Antomarchi, D. R. Littman, M . H i m , B . Rossi, and C . Devaux. 1995. The cytoplasmic tail of CD4 is required for inhibition of human immunodeficiency virus type 1 replication by antibodies that bind to the immunoglobulin C D R 3 like region in domain 1 of CD4. J. Virol. 69:6904-10. 33. Bentin, J . , C . D . Tsoukas, J . A . M c C u t c h a n , S. A . Spector, D . D . Richman, and J . H . Vaughan. 1989. Impairment in T-Lymphocyte responses during early infection with human immunodeficiency virus. J. Clin. Immunol. 9:159-168. 34. Benveniste, R . , L . A r t h u r , C . Tsai, R . Sowder, and T. Copeland. 1986. Isolation of a lentivirus from a macaque with lymphoma: comparison with H T L V - H I / L A V and other Lentiviruses. J. Virol. 60:483-490. 35. Berg, J . M . 1992. S p l and the subfamily of zinc finger proteins with guanine-rich binding sites. Proc. Natl. Acad. Sci. U.S.A. 89:11109-11110. 36. Berkhout, B . , and K . T . Jeang. 1992. Functional roles for the T A T A promoter and enhancers in basal and Tat-induced expression of the human immunodeficiency virus type 1 long terminal repeat. J. Virol. 66:139-49. 37. B e r n a r d , W . , A . Dontcheff, C . Oberling, and P. Vigier. 1953. Corpusculesd'aspect virusal dans les cellules du sarcome de Rous. Bulletin Cancer (Paris). 40:311.  References  105  MCEF 38. Bernhard. 1960. The detection and study of tumor viruses with the electron microscope. Cancer Res. 20:712-727. • 39. Bernier, D., H. Thomassin, D. Allard, M. Guertin, D. Hamel, M. Blaquiere, M. Beauchemin, H. LaRue, M . Estable-Puig, and L. Belanger. 1993. Functional analysis of developmentally regulated chromatin-hypersensitive domains carrying the alpha 1-fetoprotein gene promoter and the albumin/alpha 1fetoprotein intergenic enhancer. M o l . Cell. Biol. 13:1619-33. 40. Bielinska, A., S. Krasnow, and G. Nabel. 1989. N F k B - mediated activation of the human immunodeficiency virus enhancer: Site of transcriptional initiation is independent of the T A T A box. J. Virol. 63:4097-4100. 41. Binley, J., and J. P. Moore. 1997. The viral mousetrap. Nature. 387:346-348. 42. Bishop, J. M. 1996. The discovery of proto-oncogenes. F A S E B J. 10:362-364. 43. Bishop, J. M. 1990. Retroviruses and Oncogenes II. Biosci. Reports. 10:473-491. 44. Biswas, D. K., T. R. Salas, F. Wang, C. M. Ahlers, B. J. Dezube, and A. B. Pardee. 1995. A Tat-induced auto-upregulatory loop for superactivation of the Human Immunodeficiency virus type 1 promoter. J. Virol. 69:7437-7444. 45. Biti, R., R. French, J. Young, B. Bennetts, G. Stewart, and T. Liang. 1997. HIV-1 infection in an individual homozygous for the CCR5 deletion allele. Nat. Med. 3:252253. 46. Blair, W. S., R. A. Fridell, and B. R. Cullen. 1996. Synergistic enhancement of both initiation and elongation by acidic transcription activation domains. E M B O J. 15:1658-1655. 47. Blau, J., H. Xiao, S. McCracken, P. O'Hare, J. Greenblatt, and D. Bentley. 1996. Three functional classes of transcriptional activation domains. M o l . Cell. Biol. 16:2044-2055.  1998  proteins, R N A and D N A in polyacrylamide gels. Electrophoresis. 8:93-99. 49. Boulikas. 1994. A compilation and classification of D N A binding sites for protein transcription factors from vertebrates. Critical Reviews in Eukaryotic Gene Expression. 4:117-321. 50. Bressler, P., G. Pantaleo, A. Demaria, and A. S. Fauci. 1991. A n t i - C D 2 receptor antibodies activate the HJV long terminal repeat in T-Lymphocytes. J. Immunol. 147:22904. 51.  Brinchmann, J.  E., J.  Albert, and  F. Vartdal. 1991. Few infected CD4+ T cells but a high proportion of replication-competent provirus copies in asymptomatic human immunodeficiency virus type 1 infection. J. Virol. 65:2019-2023. 52. Broder, S., and R. C. Gallo. 1984. A pathogenic retrovirus (HTLV-III) linked to AIDS. New Engl. J. Med. 311:1292-7. 53. Brown, F. L . , E. Tahaoglu, G. J. Graham, and J. J. Maio. 1993. Inducible transcriptional activation of the human immunodeficiency virus long terminal repeat by protein kinase inhibitors. M o l . Cell. Biol. 13:5245-54. 54. Burkinsky, M., N . Sharova, and M. Stevenson. 1993. Human Immunodeficiency virus type 1 2-LTR circles reside in a nucleoprotein complex which is different from the pre-integration complex. J. Virology. 67:68636865. 55. Calvert, I., Z. Q. Peng, H. F. Kung, and Raziuddin. 1991. Cloning and characterization of a novel sequence-specific D N A binding protein recognizing the negative regulatory element (NRE) region of the HIV-1 long terminal repeat. Gene. 101:171-6. 56. Canonne-Hergaux, F., D. Aunis, and E. Schaeffer. 1995. Interactions of the transcription factor AP-1 with the long terminal repeat of different human immunodeficiency virus type 1 strains in Jurkat, glial, and neuronal cells. J. Virol. 69:6634-42. 57. Carrel, S., S. Salvi, P. Gallay, C. Rapin, and R. P. Sekaly. 1 9 9 1 . Positive signal transduction via surface C D 4  48. Blum, H., H. Beier, and H. J. Gross. 1987. Improved silver staining of plant References  106  MCEF molecules does not need coexpression of the CD3/TcR complex. Res. Immunol. 142:97-108. • 58. Cassol, S., M. Estable. A. Merzouki, J. Montaner, T. SY, S. Read, M. Arella, A. Butcher, S. Kinard, and M. O'Shaughnessy. 1994. Monitoring genetic variation in HIV-1 field strains by direct sequencing of dried blood spot specimens: Implications for vaccine development, p. 75-78. In M. Girard and L. Valette (ed.), Retroviruses of Humans AIDS and Related Animal Diseases, vol. Cent Gardes, 1994. I.D.M.M. press 6957 DARDILLY, Paris, France.., Paris. • 59. Cassol, S., M. Estable. T. MO, Merzouki, N. Vellani, A. Pattulo, T. Sy, J. Edmeston, Strumpfer, and M. O'Shaughnessy. 1994. M . New insights into HIV-1 replication and transmission: implications for therapeutic intervention. Can. Association of Clinical Microbiology and Infectious Disease Newsletter. 60. Cayota, A., F. Vuillier, J. Siciliano, and G. Dighiero. 1994. Defective protein tyrosine phosphorylation and altered levels of p59 fyn and p561ck in CD4 T cells from HIV-1 infected patients. Internat. J. Immunol. 6:611621. 61. CDC, C. f. d. c. 1988. A I D S due to HIV-2 infection. M M W R . 37:33. 62. CDC, C. f. d. c. 1 9 8 1 . Pneumocystis pneumonia-Los Angeles. M M W R . 30:250.  1998  66. Chen, B. K., M. B. Feinberg, and D. Baltimore. 1997. The kappaB sites in the human immunodeficiency virus type 1 long terminal repeat enhance virus replication yet are not absolutely required for viral growth. J. Virol. 71:5495-504. • 67. Chen, Y., Dampf, D., Saha, K., Kulka, K., Volsky, D.J., Estable. M. C. Sadowski, I., Gupta, P. 1998. CD8+ T cell mediated suppression of HIV-1 is dependent on the phenotypes of the virus and such phenotype dependent differential suppression is not due to b-chemokines. (submitted). 68. Cheynier, R., S. Gratton, J. P. Vartanian, A. Meyerhans, and S. WainHobson. 1997. G to A hypermutation does not result from polymerase chain reaction. AIDS Res. Hum. Retroviruses. 3(12):985-6. 69. Cheynier, R., S. Henichwark, F. Hadida, E. Pelletier, E. Oksenhendler, B. Autran, and S. Wain-Hobson. 1994. H I V and T cell Expansion in Splenic White pulps is accompanies by infiltration of HlV-Specific Cytotoxic T-Lymphocytes. Cell. 78:373-387. 70. Cheynier, R., S. Henrichwark, F. Hadida, E. Pelletier, E. Oksenhendler, B. Autran, and S. Wain-Hobson. 1995. Clonal expansion of T cells and HIV genotypes in microdissected splenic white pulps indicates viral replication in situ and infiltration of HIV-specific cytotoxic T-Lymphocytes. [Review]. Advances in Experimental Medicine & Biology. 374:173-82. 71. Chirmule, N., V. S. Kalyanaraman, and S. Pahwa. 1994. Signals transduced through the CD4 molecule on TLymphocytes activate N F k B . Bioch. Bioph. Res. Comm. 203:498-505.  63. Chan, A. C , D. M. Desai, and A. Weiss. 1994. The role of protein tyrosie kinases and protein tyrosine phosphatases in T cell antigen receptor signal transduction. Annu. Rev. Immunol. 12:552-592. 64. Chang, L. J., E. McNulty, and M. Martin. 1993. Human immunodeficiency viruses containing heterologous enhancer/promoters are replication competent and exhibit different lymphocyte tropisms. J. Virol. 67:743-52. 65. Chang, P. Y., K. Stellrecht, S. Melana, and B. G. Pogo. 1994. Elements in the long terminal repeat of HIV-1 that interact with nuclear extracts from JurkaT cells persistently infected with vaccinia virus. Virus Res. 34:127-38.  72. Choe, H., M. Farzan, Y. Sun, N. Sullivan, B. Rollins, P. D. Ponath, L. Wu, C. R. Mackay, G. LaRosa, W. Newman, N. Gerard, C. Gerard, and J. Sodroski. 1996. The beta-chemokine receptors CCR3 and CCR5 facilitate infection by primary HIV1 isolates. Cell. 85:1135-48. 73. Chow, L. M. L., M. Fournel, D. Davidson, and A. Veillette. 1993. Negative regulation of T cell receptor signalling by tyrosine protein kinase p 5 0  References  c s k  . Nature. 365:156-159.  107  MCEF 1A. Chun, T.-W., L. Carruth, D. Finzi, X. Shen, J. A. DiGiuseppe, H. Taylor, M. Hermankova, K. Chadwick, J. Margolick, T. C. Quinn, Y. H. Kuo, R. Brookmeyer, M. A. Zelger, P. BradithCrovo, and R. Siliciano. 1997. Quantification of latent tissue reservoirs and total body viral load in HIV-1 infection. Nature. 387:183-188. 75. Clavel, F., D. Guetard, F. VezinetBrum, S. Chamaret, and M. Rey. 1986. Isolation of a new human retrovirus from West African patients with AIDS. Science. 233:343-346. 76. Clerici, M., N . I. Stocks, R. A. Zajac, R. N . Boswell, D. R. Lucey, C. S. Via, and G. M. Shearer. 1989. Detection of three distinct patterns of T helper cell dysfunction in asymptomatic, human immunodeficiency virusseropositive patients: Independence of CD4+ cell numbers and clinical staging. J. Clin. Invest. 84:1892-1899. 77. Cocchi, F., A. L. DeVico, A. Garzino-Demo, S. K. Arya, R. C. Gallo, and P. Lusso. 1995. Identification of R A N T E S , MIP-1 alpha, and MIP-1 beta as the major HIVsuppressive factors produced by CD8+ T cells [see comments]. Science. 270:1811-5. 78. Cocchi, F., A. L. DeVico, A. Garzino-Demo, A. Cara, R. C. Gallo, and P. Lusso. 1996. The V 3 domain of the HIV-1 gpl20 envelope glycoprotein is critical for chemokine-mediated blockade of infection [see comments]. Nat. Med. 2:1244-7. 79. Coffin, J. 1996. Retroviridae: The viruses and their replication, p. 1767-1846. In B. N . Fields (ed.), Fields Virology, vol. 2. Lippincott-Raven, Philadelphia.  1998  83. Colvin, R. A., and M. A. GarciaBlanco. 1992. Unusual structure of the human immunodeficiency virus type 1 trans-activation response element. J.Virol. 66:930-935. 84. Conant, K., M. Ma, A. Nath, and E. O. Major. 1996. Extracellular human immunodeficiency virus type 1 Tat protein is associated with an increase in both NF-kappa B binding and protein kinase C activity in primary human astrocytes. J. Virol. 70:1384-9. 85. Connor, R. I., and D. D. Ho. 1994. Human Immunodeficiency Virus Type 1 Variants with Increased Replicative Capacity Develop during the Asymptomatic Stage before Disease Progression. J. Virol. 68:4400-4408. 86. Conway, R. C , and J. W. Conway. 1997. General transcription factors for R N A polymerase II. Prog. Nuc. A c . Res. M o l . Biol. 56:327-347. 87. Copeland, K. F., P. J. McKay, and K. L. Rosenthal. 1996. Suppression of the human immunodeficiency virus long terminal repeat by CD8+ T cells is dependent on the NFAT-1 element. AIDS Res. Hum. Retroviruses. 12:143-8. 88. Cotran, R. S., V . Kumar, and S. L. Robbins. 1994. Diseases of Immunity. In F. J. Schoen (ed.), Pathologic Basis of Disease. W . B Saunders, Phyladelphia. 89. Craib, K. J. P., and Schechter. M.T. 1992. The Vancouver Lymphadenopathy-AIDS Study: A n overview of research into HIV/AIDS. B.C. Med. J. 34:162-240. 90. Cullen, B. B. 1993. Human Retroviruses. Oxford University Press, New York. 91. Cullen, B. R. 1991. Regulation of HIV-1 gene expression. F A S E B J. 5:2361-8.  80. Coffin, J. M. 1995. H I V Population Dynamics in vivo: Implications for Genetic Variation, Pathogenesis and Therapy. Science. 267:483-489. 81. Coffin, J. M. 1992. Structure and classification of Retroviruses, p. 19-49. In A . L . Jay (ed.), The Retroviridae, vol. 1. Plenum Press, New York. 82. Cohen, J. 1993. Keystone's blunt message: 'It's the virus, stupid'. Science. 260:29293.  92. Cullen, B. R., and W. C. Greene. 1989. Regulatory pathways governing HIV-1 replication. Cell. 58:423-426. 93. D'Adda DI Fagana, F., G. Marzio, M. I. Gutierrez, L. Kang, A. Falaschi, and M. Giacca. 1995. Molecular and Functional Interactions of transcription factor U S F with the long terminal repeat of Human Immunodeficiency Virus Type 1. J. Virol. 69:2765-2775.  References  108  MCEF 94. Darlix, J. L . , A. Vincent, C. Gabus, H. de Rocquigny, and B. Roques. 1993. Trans-activation of the 5' to 3' viral D N A strand transfer by nucleocapsid protein during reverse transcription of HIV1 R N A . Comptes Rendus de 1 Academie des Sciences - Serie Iii, Sciences de la Vie. 316:763-71. 95. DE-Mercoyrol, L . , Y . Corda, C. Job, and D. Job. 1992. Accuracy of wheat-germ R N A polymerase II. J. Biochem. 206:49-58. 96. Deacon, N . J . , A. Tsykin, A. Solomon, K. Smith, M . Ludford-Menting, D. J. Hooker, D. A. McPhee, A. L. Greenway, A. Ellet, C.Chatfield, V. A. Lawson, S. Crowe, A. Maerz, S. Sonza, J. Learmont, J. S. Sullivan, A. Cunningham, D. Dwyer, D. Dowton, and J. Mills. 1995. Genomic Structure of an Attenuated Quasi Species of HTV-l from blood Transfusion Donor and Recipients. Science. 270:988-991. 97. Dean, M., M . Carrington, C. Winkler, G. A. Huttley, M. W. Smith, R. Allikmets, J. J. Goedert, S. P. Buchbinder, E. Vittinghoff, E. Gomperts, S. Donfield, D. Vlahov, R. Kaslow, A. Saah, C. Rinaldo, R. Detels, and S. J. O'Brien. 1996. Genetic restriction of HIV-1 infection and progression to AIDS by a deletion allele of the C K R 5 structural gene. Hemophilia Growth and Development Study, Multicenter AIDS Cohort Study, Multicenter Hemophilia Cohort Study, San Francisco City Cohort, A L I V E Study [see comments]. Science. 273:1856-62. 98. Delassus, S., A. Meyerhans, R. Cheynier, and S. Wain-Hobson. 1992. Absence of selection of HIV-1 variants in vivo based on transcription/transactivation during progression to AIDS. Virology. 188:811-8. 99. Delassus, S., R.Cheynier, and S.Wain-Hobson. 1991. Evolution of Human Immunodeficiency Virus Type 1 nef and Long Terminal Repeat Sequences over 4 Years In vivo and In vitro. J. Virol. 65:225-231. 100. Demarchi, F., P. D'Agaro, A. Falaschi, and M. Giacca. 1993. In vivo footprinting analysis of constitutive and inducible protein-DNA interactions at the long terminal repeat of human immunodeficiency virus type 1. J. Virol. 67:7450-60.  1998  101. Desai-Yajnik, V., E . Hadzic, P. Modlinger, S. Malhotra, G. Gechlik, and H. H. Samuels. 1995. Interactions of thyroid hormone receptor with the human immunodeficiency virus type 1 (HIV-1) long terminal repeat and the HIV-1 Tat transactivator. J. Virol. 69:5103-12. 102. DesGroseillers, L . , E . Rassart, Y. Robitaille, and P. Jolicoeur. 1985. Retrovirusinduced spongiform encephalopathy: the 3'-end long terminal repeat-containing viral sequences influence the incidence of the disease and the specificity of the neurological syndrome. Proc. Nat. Acad. Sci. U.S.A. 82:8818-22. 103. deVries-Smits, A. M . M . , G. J. Pronk, J. P. Medema, B. M . T. burgering, and J. L. Bos. 1995. She associates with an unphosphorylated form of the p21ras guanine nucleotide exchange factor mSOS. Oncogene. 10(5):919-25. 104. Dinter, H., P. L. Sheridan, M. L. Waterman, and K. Jones. 1991. Properties of NF-kB, L B P - 1 , and TCF-1: Cellular Proteins That Iinteract with the Human Immunodeficiency Virus Type 1 Promoter in T cells. American Society for Microbiology, Washington. 105. Doyle, C , and J. L. Strominger. 1987. Interaction between CD4 and class II M H C molecules mediates cell adhesion. Nature. 330:256259. 106. Drake, J. W. 1991. A constant rate of spontaneous mutation in DNA-based microbes. Genetics. 88:7160-7164. 107. Drake, J. W. 1993. Rates of spontaneous mutation among R N A viruses. Proc. Natl. Acad. Sci. U.S.A. 90:4171-4175. 108. Dulac, C , and R. Axel. 1995. A novel family of genes encoding putative pheromone receptors in mammals. Cell. 83:195-206. 109. Dynan, W. S., and R. Tjian. 1983. Isolation of Transcription Factors That Discriminate between Different Promoters Recognized by R N A Polymerase II. Cell. 32:669-680. 110. Effros, R. B., R. Allsop, C.-P. Chiu, M. N . Hausner, K. Hirji, L . Wang, C. B. Harley, B. Villeponteau, M . D. West, and J. V. Giorgi. 1996. Shortened telomeres in the expanded CD28-CD8+ cell subset in  References  109  MCEF HIV disease implicate replicative senescence in HJV pathogenesis. AIDS. 10:F17-F22. 111. Eigen, M., J. McCaskill, and P. S. Schuster. 1988. Molecular Quasi-Species. J. Phys. Chem. 92:6881-6891. 112. Embretson, J., M. Zupancic, J. L. Ribas, A. Burke, P. Racz, K. Tenner-Racz, and A. T. Haase. 1993. Massive covert infection of T-Lymphocytes and macrophages during the incubation period of AIDS. Nature. 362:359-362. 113. Englund, G., M. D. Hoggan, T. S. Theodore, and M. A. Martin. 1991. A novel HIV-1 isolate containing alterations affecting the NFkappa B element. Virology. 181:150-7. 114. Ephrussi, A., G. M. Church, S. Tonegawa, and W. Gilbert. 1985. B LineageSpecific interactions of an immunoglobulin enhancer with cellular factors in vivo. Science. 227:134-140. • 115. Estable. M. C . B. Bell, M. Hirst, and I. J. Sadowski. 1998. Naturally Occurring HIV-1 LTRs have a Frequently Observed Duplication that Binds RBF-2 and Represses Transcription, (in press, J. Virol.). • 116. Estable. M. C . B. Bell, A. Merzouki, J. S. Montaner, M. V . O'Shaughnessy, and I. J. Sadowski. 1996. Human immunodeficiency virus type 1 long terminal repeat variants from 42 patients representing all stages of infection display a wide range of sequence polymorphism and transcription activity. J. Virol. 70:4053-62. • 117. Estable. M. C . M. Hirst, B. Bell, S. Gygi, R. Aebersold, and I. Sadowski. 1998. Biochemical purification and mass analysis of RBF-2 suggest it is a novel complex with specificity for the most conserved cis-element of the HIV-1 L T R . (in preparation, 1998). • 118. Estable-Puig, R. F. d., J. Thibault, J.F.Estable-Puig, H.Falanga, and M. C. Estable. 1986. Sindrome organico cerebral de evolucion hiperaguda en paciente portadora de toxoplasmosis (Spanish). Patologia. 19:139-142. 119. Ewart, G. D., T. Sutherland, P. W. Gage, and G. B. Cox. 1997. The V p u protein of human immunodeficiency virus type 1 forms cationselective ion channels. J. Virol. 70:7108-7115.  1998  120. Faras, A. J., J. M. Taylor, W. E. Levinson, H. M. Goodman, and J. M. Bishop. 1973. RNA-directed D N A polymerase of Rous sarcoma virus: initiation of synthesis with 70 S viral R N A as template. J. M o l . Biol. 79:163-83. 121. Fauci, A. S. 1993. Multifactorial nature of Human Immunodeficiency virus disease: implications for therapy. Science. 262:1011-1018. 122. Feig, L. A., and G. Cooper. 1988. Inhibition of N I H 3T3 Cell Proliferation by a mutant ras Protein with Preferential Affinity for GDP. M o l . Cell. Biol. 8: 3235-3243. 123. Feinberg, M. B., D. Baltimore, and A. D. Frankel. 1991. The role of Tat in the human immunodeficiency virus life cycle indicates a primary effect on transcriptional elongation. Proc. Natl. Acad. Sci. U.S.A. 88:4045-4049. 124. Feng, Y., C. C. Broder, P. E. Kennedy, and E. A. Berger. 1996. HIV-1 entry cofactor: functional c D N A cloning of a seventransmembrane, G protein-coupled receptor [see comments]. Science. 272:872-7. 125. Feriotto, G., S. Volinia, P. Giacomini, and R. Gambari. 1992. D N A elements Target of transcriptional factors are not restricted to long terminal repeat of human immunodeficiency virus. Anticancer Res. 12:65-72. 126. Feuchter, A., and D. Mager. 1990. Functional heterogeneity of a large family of human LTR-like promoters and enhancers. Nucleic Acids Res. 18:1261-70. 127. Fisher, R. J., S. Koizumi, A. Kondoh, J. M. Mariano, G. Mavrothalassitis, N . K. Bhat, and T. S. Papas. 1992. Human ETS1 Oncoprotein. J. Biol. Chem. 267:17957-17965. 128. Flory, E., A. Hoffmeyer, U . Smola, U . R. Rapp, and J. T. Bruder. 1996. Raf-l kinase targets GA-binding protein in transcriptional regulation of the human immunodeficiency virus type 1 promoter. J. Virol. 70:2260-8. 129. Folguiera, L., A. Algeciras, W. S. McMorran, G. D. Bren, and C. V. Paya. 1996. The Ras-Raf pathway is activated in human immunodeficiency virus infected monocytes and participates in the activation of N F k B . J. Virol. 70:2332-2338.  References  110  MCEF  1998  130. Force, T. 1992. Unexplained CD4+ Tlymphocyte depletion in persons without evident HIV infection-United States. M M W R 41:541-5.  139. Garcia, J. A . , and R. B. Gaynor. 1994. Regulatory mechanisms involved in the control of HIV-1 gene expression. AIDS. 8:S3-S17.  131. Fouchier, R. A., M. Groenink, N. A. Kootstra, M. Tresmette, H. G. Huisman, F. Miedema, and M. Shuitemaker. 1992. Phenotype-associated sequence variation in the third variable domain of the human immunodeficiency virus type 1 gp 120 molecule. J. Virol. 66:3183-7.  140. Garcia, J. A . , D. Harrich, E. Soultanakis, F. Wu, R. Mitsuyasu, and R. B. Gaynor. 1989. Human immunodeficiency virus type 1 L T R T A T A and T A R region sequences required for transcriptional regulation. E M B O J. 8:765-78. 141. Garcia, J. A . , S. H. Ou, F. Wu, A . J. Lusis, R. S. Sparkes, and R. B. Gaynor. 1992. Cloning and chromosomal mapping of a human immunodeficiency virus 1 " T A T A " element modulatory factor. Proc. Natl. Acad. Sci. U.S.A. 89:9372-6.  132. Franza, B. R., Jr., F. J. d. Rauscher, S. F. Josephs, and T. Curran. 1988. The Fos complex and Fos-related antigens recognize sequence elements that contain AP-1 binding sites. Science. 239:1150-3. 133. Fultz, P., H. McClure, D. Anderson, R. Swenson, R. Arnand, and A. Srinivasan. 1986. Isolation of a T-Lymphotropic retrovirus from naturally infected sooty mangabey monkeys. Proc. Natl. Acad. Sci. U.S.A. 83:52865290. 134. Fultz, P., H. McClure, R. Swenson, C. McGrath, and A. Brodie. 1986. Persistant infection of chimpanzees with human TLymphotropic virus type III. J. Virol. 58:116-124. 135. Gallay, P., S. Swingler, J. Song, F. Bushman, and D. Trono. 1995. H I V nuclear import is governed by the phosphotyrosine-mediated binding of matrix to the core domain of integrase. Cell. 83:569-576. 136. Gallo, R. C , S. Z. Salahuddin, M. Popovic, G. M. Shearer, M. Kaplan, B. F. Haynes, T. J. Palker, R. Redfield, J. Oleske, B. Safai, and et al. 1984. Frequent detection and isolation of cytopathic retroviruses (HTLV-III) from patients with AIDS and at risk for AIDS. Science. 224:500-3. 137. Gao, F., D. L. Robertson, S. G. Morrison, H. Hui, S. Craig, J. Decker, P. N. Fultz, M. Girard, G. M. Shaw, B. M. Hahn, and P. M. Sharp. 1996. The heterosexual human immunodeficiency virus type 1 epidemic in Thailand is caused by an intersubtype (A/E) recombinant of African origin. J. Virol. 70:7013-29. 138. Garcia, J., and R. Gaynor. 1994. The human immunodeficiency virus type-1 long terminal repeat and its role in gene expression. [Review]. Progress in Nucleic Acid Res. M o l . Biol. 49:157-96.  142. Garcia, J. A . , F. K. Wu, R. Mitsuyasu, and R. B. Gaynor. 1987. Interactions of cellular proteins involved in the transcriptional regulation of the human immunodeficiency virus. E M B O J. 6:3761-70. 143. Gaynor, R. 1992. Cellular transcription factors involved in the regulation of HIV-1 gene expression [published erratum appears in AIDS 1992 Jun;6(6):following 606]. [Review]. AIDS. 6:347-63. 144. Gaynor, R. b., M. D. Kuwabara, F. K. Wu, J. A . Garcia, D. Harrich, M. Briskin, R. Wall, and D. S. Sigman. 1988. Repeated B motifs in the human immunodeficiency virus type I long terminal repeat enhancer region do not exhibit cooperative factor binding. Proc. Natl. Acad. Sci. U.S.A. 85:9406-10. 145. Germain, R. N. 1994. MHC-Dependent Antigen Processing and peptide presentation: Providing ligands for T Lymphocyte activation. Cell. 76:287-299. 146. Gessain, A . , R. C . Galo, and G. Franchini. 1992. Low degree of human T cell lekemia/Lymphoma virus type 1 genetic drift in vivo as a means of monitoring viral transmission and movement of ancient human populations. J. Virol. 66:2288-2295. 147. Ghazal, P., J. Young, E. Giulietti, C . DeMattei, J. Garcia, R. Gaynor, R. M. Stenberg, and J. A . Nelson. 1991. A discrete cis element in the human immunodeficiency virus long terminal repeat mediates synergistic trans activation by cytomegalovirus immediate-early proteins. J. Virol. 65:6735-42.  References  111  MCEF 148. Giacca, M., M. I. Gutierrez, S. Menzo, F. D. Di Fagagna, and A. Falaschi. 1992. A human binding site for transcription factor U S F / M L T F mimics the negative regulatory element of human immunodeficiency virus type 1. Virology. 186:133-47. 149. Giese, K., A. Amsterdam, and R. Grosschedl. 1991. DNA-binding properties of the H M G domain of the lymphoid-specific transcriptional regulator L E F - 1 . Genes Dev. 5:2567-2578. 150. Giese, K., J. Cox, and R. Grosschedl. 1992. The H M G domain of Lymphoid enhancer factor 1 bends D N A and facilitates assembly of functional nucleoprotein structures. Cell. 69:185195. 151. Gold, M. R., and L. Matsuuchi. 1995. Signal transduction by the antigen receptors of B and T-Lymphocytes. Internat. Rev. Cytol. 157:181-277. 152. Goldman, F., W. A. Jensen, G. L. Johnson, L. Heasley, and J. C. Cambier. 1994. gpl20 ligation of CD4 induces p56Lck activation and T C R desensitization independent of T C R tyrosine phosphorylation. J. Immunol. 153:2905-2917. 153. Golub, E . I., G. Li, and D. J. Volsky. 1990. Differences in the basal activity of the long terminal repeat determine different replicative capacities of two closely related human immunodeficiency virus type 1 isolates. J. Virol. 64:3654-3660. 154. Golub, E . I., G. R. Li, and D. J. Volsky. 1991. Induction of dormant HIV-1 by sodium butyrate: involvement of the T A T A box in the activation of the HIV-1 promoter. AIDS. 5:6638. 155. Goodenow, M., T. Huet, W. Saurin, S. Kwok, J. Shinsky, and S. WainHobson. 1989. HIV-1 Isolates are rapidly evolving Quasispecies: Evidence for Viral mixtures and preferred nucleotide substitutions. J. Acquired Immune. Defic. Syndr. 2:344-352. 156. Gottlieb, M., R. Schroff, H. Schanker, J. Weisman, P . Fan, R. Wolf, and A. Saxon. 1981. Pneumocystis carinii pneumonia and mucosal candiasis in previously healthy homosexual men. New Engl. J. Med. 305:1425-1430.  1998  157. Greenblatt, J. 1997. R N A polymerase II holoenzyma and transcriptional regulation. Current Opin. Cell Biol. 9:310-19. 158. Greenway, A., A. Azad, J. Mills, and D. McPhee. 1996. Human immunodeficiency virus type 1 Nef binds directly to Lck and Mitogenactivated protein kinase inhibiting kinase activity. J. Virol. 70:6701-6708. 159. Grosschedl, R., and D. Baltimore. 1985. Cell-Type Specificity of Immunoglobulin Gene Expression is Regulated by at least three D N A sequence elements. Cell. 41:885-897. 160. Guo, J., L. E . Henderson, J. Bess, B. Kane, and J. G. Levin. 1997. Human Immunodefieciency virus type 1 nucleocapsid protein promotes efficient strand transfer and specific viral D N A synthesis by inhibiting TAR-dependent selfpriming from minus-strand strong-stop D N A . J. Virol. 71:5178-5188. 161. Gurley, R. J., K. Ikeuchi, R. A. Byrn, K. Anderson, and J. E . Groopman. 1989. CD4+ lymphocyte function with early human immunodeficiency virus infection. Proc. Natl. Acad. Sci. U.S.A. 86:1993-1997. 162. Guy, B., B. Acres, M. P. Kieny, and J. P. Lecocq. 1990. D N A binding factors that bind to the negative regulatory element of the human immunodeficiency virus-1: regulation by nef. J. Acquired Immune. Defic. Syndr. 3:797-809. 163. Haguenau, F., and O . Croissant. 1994. Ultrastructural morphology of viruses. French studies. Biology of the Cell. 80:129-38. 164. Hahn, B. H., G. M. Shaw, M. Popovic, A. Lo Monico, R. C. Gallo, and F. Wong-Staal. 1984. Molecular cloning and analysis of a new variant of human T cell leukemia virus (HTLV-ib) from an African patient with adult T cell leukemia-lymphoma. International J. Cancer. 34:613-8. 165. Harrich, D., J. Garcia, R. Mitsuyasu, and R. Gaynor. 1990. T A R independent activation of the human immunodeficiency virus in phorbol ester stimulated T-Lymphocytes. E M B O J. 9:4417-23. 166. Harrich, D., C. Hsu, E . Race, and R. B. Gaynor. 1994. Differential growth kinetics are exhibited by human immunodeficiency virus type 1 T A R mutants. J. Virol. 68:5899-910.  References  112  MCEF 167. Harrich, D., G. Mavankal, A . Mette-Snider, and R. B . Gaynor. 1995. Human immunodeficiency virus type 1 T A R element revertant viruses define R N A structures required for efficient viral gene expression and replication. J. Virol. 69:4906-13. 168. Hatada, M. H., X. Lu, E. R. Laird, J. Green, J. P. Morgenstern, M. Lou, C. S. Marr, T. B . Phillips, M . K. Ram, K. Theriault, M. J. Zoller, and J. L. Karas. 1995. Molecular basis of interaction of the protein tyrosine kinase Zap-70 with the T cell receptor. Nature. 377:32-38. 169. Hellerstein, M . K., and J. M. McCunes. 1997. T cell turnover in HIV-1 disease. Immunity. 7:583-589. 170. Hirsch, M . S., and J. Curran. 1996. Human Immunodeficiency Viruses, p. 1953-1975. In B . N . Fields (ed.), Fields Virology, vol. 2. Lippincott-Raven, Philadelphia. 171. Hirsch, V., G. A . Dapolito, S. Goldstein, H. McClure, P. Emau, P. N. Fultz, M . Isahakia, R. Lenroot, G. Myers, and P. R. Johnson. 1993. A distinct African lentivirus from Sykes' monkeys. J. Virol. 67:151728. 172. Hirsch, V. M . , G. Dapolito, R. Goeken, and B . J. Campbell. 1995. Phylogeny and natural history of the primate lentiviruses, SIV and HIV. Curr. Opin. Genet. Devel. 5:798-806. 173. Ho, D. D., A . U . Neumann, A . S. Perelson, W. Chen, J. M. Leonard, and M . Markowitz. 1995. Rapid turnover of plasma virions and CD4 lymphocytes in HIV-1 infection. Nature. 373:123-126. 174. Hodge, D. R., L. Robinson, D. Watson, J. Lautenberger, X. K. Zhang, M. Venanzoni, and A . Seth. 1996. Interaction of ETS-1 and ERGB/FLI-1 proteins with D N A is modulated by spacing between multiple binding sites as well as phosphorylation. Oncogene. 12:11-8. 175. Holland, C. A . , J. Wozney, P. A . Chatis, N. Hopkins, and J. W. Hartley. 1985. Construction of recombinants between molecular clones of murine retrovirus M C F 247 and Akv: determinant of an in vitro host range property that maps in the long terminal repeat. J. Virol. 53:152-7.  1998  176. Holzmeister, J., B. Ludewig, G. Pauli, and D. Simon. 1993. Sequence specific binding of the transcription factor c-Etsl to the human immunodeficiency virus type I long terminal repeat. Biochem. Biophys. Res. Commun. 197:1229-33. 177. Howe, L. R., and A . Weiss. 1995. Multiple kinases mediate T cell receptor signaling. Trends Bioch. Sci. 20:59-64. 178. Hsu, T. W., J. L. Sabran, G. E . Mark, R. V. Guntaka, and J. M . Taylor. 1978. Analysis of unintegrated avian R N A tumor virus double stranded intermediates. J. Virol. 28:810818. 179. Huang, L. M . , and K. T. Jeang. 1993. Increased spacing between S p l and T A T A A renders human immunodeficiency virus type 1 replication defective: implication for Tat function. J. Virol. 67:6937-44. 180. Huang, Z. B., M . J. Potash, M . Simm, M. Shahabuddin, W. Chao, H. E . Gendelman, E. Eden, and D. J. Volsky. 1993. Infection of macrophages with lymphotropic human immunodeficiency virus type 1 can be arrested after viral D N A synthesis. J. Virol. 67:6893-6896. 181. Hubert, P., G. Bismuth, M . Korner, and P. Debre. 1995. HIV-1 glycoprotein gpl20 disrupts CD4-p561ck/CD3-T cell receptor interactions and inhibits CD3 signaling. Eur. J. Immunol. 25:1417-1425. 182. Huet, T., R. Cheynier, A . Meyerhans, G. Roelants, and S. WainHobson. 1990. Genetic organization of a chimpanzee lentivirus related to HIV-1 [see comments]. Comment in: Nature 1990 May 24;345(6273):288-9. Nature. 345:356-9. 183. Hughes, S. H., P. R. Shank, D. H. Spector, H. J. Kung, J. M . Bishop, H. E . Varmus, P. K. Vogt, and M . L. Breitman. 1978. Proviruses of avian sarcoma virus are terminally redundant, co-extensive with unintegrated linear D N A and integrated at many sites. Cell. 15:1397-410. 184. Ilyinski, P. O., M . A . Simon, S. C. Czajak, A . A . Lackner, and R. C. Desrosiers. 1997. Induction of AIDS by simian immunodeficiency virus lacking NF-kappa B and SP1 binding elements. J. Virol.:1880-7.  References  113  MCEF 185. Jain, J., Z. Miner, and A. Rao. 1993. Analysis of Preexisting and Nuclear Forms of Nuclear Factor of Activated T cells. The Journal of Immunology. 151:837-848. 186. Jeang, K.-T. 1994. H I V and Cellular factors, p. IV-3 - IV-12, Human Retroviruses and AIDS. Los Alamos National Library, Los Alamos, , N . Mex. 1  187. Jeang, K.-T. 1994. HIV-1: Tat: Structure and function, p. (UI-11) - (IH-21), Human Retroviruses and AIDS. Los Alamos National Library, Los Alamos, N . Mex.  188. Jeang, K. T., R. Chun, N. H . Lin, A. Gatignol, C. G. Glabe, and H . Fan. I 1993. In vitro and in vivo binding of human I immunodeficiency virus type 1 Tat protein and S p l ' transcription factor. J. Virol. 67:6224-33.  1  189. Jiang, M., J. Mak, A. Ladha, E. Cohen, M. Klein, B. Rovinski, and L. Kleiman. 1993. Identification of tRNAs incorporated into wild-type and mutant immunodeficiency virus type 1. J. Virol. 67:32463253. 190. Joag, S. V . , E. B. Stephens, and O. Narayan. 1996. Lentiviruses, p. 1977-1997. In B . N . Fields (ed.), Fields Virology, vol. 2. LippincottRaven, Philadelphia. 191. Jones, J. S., R. W. Allan, and H . M. Temin. 1994. One retroviral R N A is sufficient for synthesis of viral D N A . J. Virol. 68:207-16. 192. Jones, K. A. 1989. H I V trans-activation and transcription control mechanisms. New Biol. 1:127-135. 193. Jones, K. A. 1993. Tat and the HIV-1 promoter. Curr. Opin. Cell Biol. 5:461-468. 194. Jones, K. A., J. T. Kadonaga, P. A. Luciw, and R. Tjian. 1986. Activation of the AIDS retrovirus promoter by the cellular transcription factor, S p l . Science. 232:755-9. 195. Jones, K. A., and B. M. Peterlin. 1994. Control of R N A Initiation and Elongation at the HIV-1 Promoter. Annu. Rev. Biochem. 63:71743. 196. Ju, G., and A. M. Skalka. 1980. Nucleotide sequence analysis of the long terminal repeat (LTR) of avian retroviruses: Structural  1998  similarities with transposable elements. Cell. 22:379-386. 197. Kadonaga, J. T. 1991. Purification of Sequence-Specific Binding Proteins by D N A Affinity Chromatography, p. 10-23. In R. T. Sauer (ed.), Methods in Enzymology Protein-DNA interactions, vol. 208. Academic Press Inc., San Diego, California, U S A . 198. Kadonaga, J. T., K. R. Carner, F. R. Masiarz, and R. Tijan. 1987. Isolation of a cDNA Encoding Transcription Factor S p l and Functional Analysis of the D N A Binding Domain. Cell. 51:1079-1090. 199. Kalland, K. H., A. M. S. Vay, E. Langhoff, and G. Haukenes. 1994. Subcellular distribution of human immunodeficiency virus type 1 Rev and colocalization of Rev with R N A splicing factors in a speckled pattern in the nucleoplasm. J. Virol. 68:1475-1485. 200. Kalpana, G. V., S. Marmon, W. Wang, G. R. Crabtree, and S. P. Goff. 1994. Binding and stimulation of HIV-1 integrase by a human homolog of yeast transcription factor SNF5. Science. 266:2002-2006. 201. Kamine, J., and J. Chinnadurai. 1992. Synergistic Activation of the Human Immunodeficiency Virus Type 1 Promoter by Viral Tat Protein and Cellular Transcription Factor S p l . J. Virol. 66:3932-3936. 202. Kanki, P., J. Alroy, and M. Essex. 1985. Isolation of a T-Lymphotropic retrovirusrelated to HTLV-III/LAV from wild-caught African green monkeys. Science. 230:951-954. 203. Kanner, S. B., and O. K. Haffar. 1995. HIV-1 down-regulates C D4 costimulation of TCR/CD3-directed tyrosine phosphorylation through CD4/p56 Lck dissociation. J. Immunol. 154:29963005. 204. Kao, S. Y., A. F. Caiman, P. A. Luciw, and B. M. Peterlin. 1987. Antitermination of transcription within the long terminal repeat of HIV-1 by tat gene product. Nature. 330:489-493. 205. Kashanchi, F., G. Piras, M. F. Radonovich, J. F. Duvall, A. Fattaey, C M. Chiang, R. G. Roeder, and J. N . Brady. 1994. Direct interaction of human TFIID with the HIV-1 transactivator Tat. Nature. 367:295-299.  ces  114  MCEF 206. Kashanchi, F., R. Shibata, E. K. Ross, J. N. Brady, and M . A. Martin. 1994. Second-site long terminal repeat (LTR) revertants of replication-defective human immunodeficiency virus: effects of revertant T A T A box motifs on virus infectivity, LTR-directed expression, in vitro R N A synthesis, and binding of basal transcription factors TFIID and TFIIA. J. Virol. 68:3298-307. 207. Kato, H., M . Horikoshi, and R. G. Roeder. 1991. Repression of HIV-1 transcription by a cellular protein. Science. 251:1476-1479. 208. Kaufman, J. D., G. Valandra, G. Roderiquez, G. Bushar, C. Giri, and M . A. Norcross. 1987. Phorbol ester enhances human immunodeficiency virus-promoted gene expression and acts on a repeated 10-base-pair functional enhancer element. M o l . Cell. Biol. 7:3759-66. 209. Keith, J., and H. Fraenkel-Contrat. 1975. Identification of the 5'-end of Rous sarcoma virus R N A . Proc. Natl. Acad. Sci. U.S.A. 72:33473350. 210. Keller, A., E. D. Garrett, and B. R. Cullen. 1992. The Bel-1 protein of human foamy virus activates human immunodeficiency virus type 1 gene expression via a novel D N A target site. J. Virol. 66:3946-9. 211. Khabaz, R. F., W. Heneine, J. R. George, B. Parekh, T. Rowe, T. Woods, W. M . Switzer, H. M . McClure, M . Murphy-Corb, and T. M . Folks. 1994. Brief report: Infection of a laboratory worker with simian immunodeficiency virus. New Engl. J. Med. 330:172-177. 212. Kim, J. Y. H., F. GonzalesScarano, S. L. Zeicher, and J. C. Alwine. 1993. Replication of type 1 human deficiency viruses containing linker substitution mutations in the -201 to -130 region of the long terminal repeat. J. Virol. 67:1658-1662. 213. Kim, T., R. A. J. Mudry, C. A. Rexrode, and V. Y. K. Pathak. 1996. Retroviral mutation rates and A to G hypermutations during different stages of retroviral replication. J. Virol. 70:7594-7602. 214. Kingsman, S. M . , and A. J. Kingsman. 1996. The regulation of Human Immunodeficiency virus type 1 gene expression. Eur. J. Biochem. 240:491-507.  Ref  1998  215. Klaver, B., and B. Berkhout. 1994. Comparison of 5' and 3' long terminal repeat promoter function in human immunodeficiency virus. J. Virol. 68:3830-40. 216. Klaver, B., and B. Berkhout. 1994. Premature strand transfer by the HIV-1 reverse transcriptase during strong-stop D N A synthesis. Nucleic Acids Res. 22:137-44. 217. Koken, S. E., J. L. van Wamel, J. Goudsmit, B. Berkhout, and J. L. Geelen. 1992. Natural variants of the HIV-1 long terminal repeat: analysis of promoters with duplicated D N A regulatory motifs. Virology. 191:968-72. 218. Koken, S. E., J. L. VanWamel, J. Goudsmit, B. Berkhout, and J. L. Geelen. 1994. Functional analysis of the A C T G C T G A sequence motif in the human immunodeficiency virus type-1 long terminal repeat promoter. J. Biomed. Sci. 1:83-92. 219. Komurian, F., F. Pelloquin, and G. de-The. 1991. In vivo genomic variability of human T-call leukemia virus Type 1 depends more upon geography than upon pathologies. J. Virol. 65:37703778. 220. Kopp, E., and S. Ghosh. 1994. Inhibition of NF-kappa B by sodium salicylate and aspirin [see comments]. Science. 265:956-9. 221. Kozak, C . A . , and S. Ruscetti. 1992. Retroviruses in Rodents, p. 405-481. In J. A . Levy (ed.), The Retroviridae, vol. 1. Plenum Press, New York. 222. Kulkosky, J., R. A . Katz, and A . M . Skalka. 1990. Terminal nucleotides of the preintegrative linear form of HTV-l D N A deduced from sequence of circular D N A junctions. J. Acquired Immune Defic. Syndr. 3:852-858. 223. Kunkel, T. A . 1992. D N A replication fidelity. J. Biol. Chem. 267:18251-4. 224. Kunkel, T. A . 1985. Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc. Natl. Acad. Sci. U.S.A. 82:488-92. 225. Kunsch, C , S. M . Ruben, and C . A . Rosen. 1992. Selection of Optimal kB/Rel DNA-Binding Motifs: Interaction of Both Subunits of NF-kB with D N A Is Required for Transcriptional Activation. M o l . Cell. Biol. 12:4412-4421.  :es  115  MCEF 226. LaMarco, K., C. C. Thompson, B. P. Byers, E. M. Walton, and S. L. McKnight. 1991. Identification of Ets- and notchrelated subunits in G A binding protein. Science. 25:789-792. 227. Lanchy, J. M., C. Isel, C. Ehresmann, R. Marquet, and B. Ehresmann. 1996. Structural and functional evidence that initiation and elongation of HIV-1 reverse transcription are distinct processes. Biochimie. 78:1087-1096. 228. Lederman, M. M., D. Georges, D. Stephen, R. Schmelzer, L. Averill, and D. Goldberg. 1995. L-2-Oxothiazolidine-4-carboxylic A i d (Procysteine) inhibits expression of the human immunodeficiency virus and expression of the Interleukin-2 receptor alpha chain. J. Acquired Immune Defic. Syndr. Hum. Retrovirol. 8:107-115. 229. Lee, A. H., K. J. Lee, S. Kim, and Y. C. Sung. 1992. Transactivation of human immunodeficiency virus type 1 long terminal repeatdirected gene expression by the human foamy virus bell protein requires a specific D N A sequence. J. Virol. 66:3236-40. 230. Leonard, J., C. Parrott, A. J. Buckler-White, W. Turner, E. K. Ross, M. A. Martin, and A. B. Rabson. 1989. The N F kappa B binding sites in the human immunodeficiency virus type 1 long terminal repeat are not required for virus infectivity. J. Virol. 63:4919-24. 231. Leprince, D., A. Gegonne, J. Coll, C. d. Taisne, A. Schneeberger, C. Lagrou, and D. Stehelin. 1983. A putative second cellderived oncogene of the avian leukaemia retrovirus E26. Nature. 306:395-397. 232. Levy, J. A., A. D. Hoffman, S. M. Kramer, J. A. Landis, J. M. Shimabukuro, and L. S. Oshiro. 1984. Isolation of lymphocytopathic retroviruses from San Francisco patients with AIDS. Science. 225:840-2. 233. Li, C. J., D. J. Friedman, C. Wang, V . Metelev, and A. B. Pardee. 1995. Induction of apoptosis in uninfected lymphocytes by HIV-1 Tat protein. Science. 268:429-431. 234. L i , Y., J. Ross, J. A . Scheppler, and J. B. Robert Franza. 1991. A n in vitro transcription analysis of early responses of the human  1998  immunodeficiency virus typel long terminal repeat to different transcriptional activators. M o l . Cell. Biol. 11:1883-1893. 235. Li, Y., J. Ross, J. A. Scheppler, and B. R. J. Franza. 1991. A n in vitro transcription analysis of early responses of the human immunodeficiency virus type 1 long terminal repeat to different transcriptional activators. M o l . Cell. Biol. 11:1883-1893. 236. Lori, F., F. di Marzo Veronese, A. L. de Vico, P. Lusso, M. S. Reitz, Jr., and R. C. Gallo. 1992. Viral D N A carried by human immunodeficiency virus type 1 virions. J. Virol. 66:5067-74. 237. Love, J. J., X. Li, D. A. Case, K. Giese, R. Grosschedl, and P. E. Wright. 1995. Structural basis for D N A bending by the architectural transcription factor L E F - 1 . Nature. 376:791-795. 238. Lowenstein, E. J., R. J. Daly, A. G. Batzer, W. Li, B. Margolis, R. Lammers, A. Ulrich, E. Y. Skolnik, D. Dar-Sagi, and J. Schlessinger. 1992. The SH2 and SH3 domain-containing protein grb2 links receptor tyrosine kinases to ras signaling. Cell. 70:431-442. 239. Lu, X., T. M. Welsh, and B. M. Peterlin. 1993. The human immunodeficiency virus type 1 long terminal repeat specifies two different transcription complexes, only one of which is regulated by Tat. J. Virol. 67:1752-60. 240. Lu, Y., A. Hey, N . Touzjian, M. Stenzel, and W. Haseltine. 1991. Cellular transcription factors which regulate HIV-1 replication, p. 416-435. In W. A . H . a. F. Wong-Staal (ed.), Genetic structure and regulation of HIV. Raven press Ltd., New York. 241. Lu, Y., M. Stenzel, J. G. Sodroski, and W. A. Haseltine. 1989. Effects of long terminal repeat mutations on human immunodeficiency virus type 1 replication. J. Virol. 63:4115-9. 242. Lu, Y. C , N . Touzjian, M. Stenzel, T. Dorfman, J. G. Sodroski, and W. A. Haseltine. 1990. Identification of cisacting repressive sequences within the negative regulatory element of human immunodeficiency virus type 1. J. Virol. 64:5226-9.  References  116  MCEF 243. Lu, Y. C , N. Touzjian, M . Stenzel, T. Dorfman, J. G. Sodroski, and W. A . Haseltine. 1991. The N F kappa B independent cis-acting sequences in HIV-1 L T R responsive to T cell activation. J. Acquired Immune Defic. Syndr. 4:173-7. 244. Lukashov, V. V., C. L. Kuiken, D. Vlahov, R. A . Coutinho, and J. Goudsmit. 1996. Evidence of HIV type 1 strains of US intravenous drug users as founders of A U D S epidemic among intravenous drug users in northern europe. AIDS Res. Hum. Retroviruses. 12:1179-1183. 245. Luo, Y., S. J. Madore, T. G. Parslow, B. R. Cullen, and B. M. Peterlin. 1993. Functional analysis of interactions between Tat and the trans-activation response element of human immunodeficiency virus type 1 in cells. J. Virol. 67:5617-22.  1998  253. McNearney, T., Z. Hornickova, A. Templeton, A. Birdwell, M . Arens, R. Markham, A. Saah, and L. Ratner. 1995. Nef and L T R Sequence Variation from Sequentially Derived Human Immunodeficiency Virus Type 1 isolates. Virology. 208:388-398. • 254. Merzouki, A., T. Mo, N. Vellani, A. Pattullo, M . Estable, M . O'Shaughnessy, C. Tsoukas, and S. Cassol. 1994. Accurate and differential quantitation of HIV-1 tat, rev and nef mRNAs by competitive PCR. J. Virol. Meth. 50:115-28. 255. Merzouki, A., P. Pattel, S. Cassol, M. O'Shaughnessy, J. Gill, and M . Arella. 1994. HIV-gpl20 expressing transfected cell clones to evaluate the antibody-dependenT cellular cytotoxicity (ADCC) during the course of HTV-l infection. J. Virol. Meth. 48:9-22.  246. Majello, B., P. De Luca, G. Hagen, G. Suske, and L. Lania. 1994. Different members of the S p l multigene family exert opposite transcriptional regulation of the long terminal repeat of HIV-1. Nucleic Acids Res. 22:4914-21.  256. Meyerhans, A. 1996. Retrovirus variation: a finger on the pulse. Trends Microbiol. 4:218-219.  247. Manaker, R. A . , and V. Groupe. 1956. Discrete foci of altered chicken embryo cells associated with rous sarcoma virus in tissue culture. Virology. 2:838.  257. Meyerhans, A., R. Cheynier, J. Albert, M. Seth, S. Kwok, J. Sninsky, L. Morfeldt-Manson, B. Asjo, and S. WainHobson. 1989. Temporal fluctuations in H I V Quasispecies in vivo Are Not Reflected by Sequential HIV Isolations. Cell. 58:901-910.  248. Mansky, L. M. 1996. The mutation rate of human immunodeficiency virus type 1 is influenced by the Vpr gene. Virology. 222:391-400. 249. Mansky, L. M., and H. M . Temin. 1995. Lower in vivo mutation rate of human immunodeficiency virus type 1 than that predicted from the fidelity of purified reverse transcriptase. J. Virol. 69:5087-94. 250. Markovitz, D. M . , M . C. Hannibal, M. J. Smith, R. Cossman, and G. J. Nabel. 1992. Activation of the human immunodeficiency virus type 1 enhancer is not dependent on N F A T - 1 . J.Virol. 66:3961-3965. 251. Matthews, J. R., J. Nicholson, E. Jaffray, S. M . Kelly, N. C. Price, and R. T. Hay. 1995. Conformational changes induced by D N A binding of N F k B . Nucleic Acids Res. 23:33933402. 252. McKeating, J. A . , and R. L. Willey. 1989. Structure and function of the H I V envelope. AIDS. 3:S35-S41.  258. Meyerhans, A., J. P. Vartanian, C. Hultgren, U . Plikat, A. Karlsson, L. Wang, S. Eriksson, and S. Wain-Hobson. 1994. Restriction and enhancement of Human Immunodeficiency virus type 1 replication by modulation of intracellular deoxynucleoside triphosphate pools. J. Virol. 68:535-540. 259. Michael, N. L . , L. D'arcy, P. K. Ehrenberg, and R. Redfield. 1994. Naturally Occuring Genotypes of the Human Immunodeficiency Virus Type 1 Long Terminal Repeat Display a Wide Range of Basal abd Tat-Induced Transcriptional Activities. J. Virol. 68:3163-3174. 260. Michael, N. L . , M . T. Vahey, L. D'arcy, P. K. Ehrenberg, J. D. Mosca, J. Rappaport, and R. R. Redfield. 1994. Negative-strand R N A transcripts are produced in human immunodeficiency virus type 1 infected cells and patients by a novel promoter downregulated by Tat. J. Virol. 68:979-987.  117  MCEF 1998 261. Miller, R . H., and N. Sarver. 1997. HIV accessory proteins as therapeutic targets. Nat. Med. 3:389-394. 262. Mittler, R . S., and M. K. Hoffmann. 1989. Synergism between H I V gpl20 and gpl20-specific antibody in blocking human T cell activation. Science. 245:1380-1382. 263. Mizutani, S., D. Boettiger, and H. M. Temin. 1970. A DNA-depenent D N A polymerase and a D N A endonuclease in virions of Rous sarcoma virus. Nature. 228:424-7. 264. Molitor, J . A . , W. H. Walker, S. Doerre, D. W. Ballard, and W. C. Greene. 1990. N F - K B : A family of inducible and differentially expressed enhancer-binding proteins in human T cells. Proc. Nat. Acad. Sci. U.S.A. 87:10028-10032. 265. Moodie, S. A . , and A . Wolfman. 1994. The 3 Rs of life: Ras, Raf and growth regulation. Trends Genet. 10:44-48.  disability by cause 1990-2020: Global Burden of Disease study. Lancet. 349:1498-1504. 272. Myers, G. 1996. Human Retroviruses and AIDS. Los Alamos National Library, Los Alamos, N . Mex. 273. Myers, G. 1995. Human Retroviruses and AIDS. Los Alamos National Library, Los Alamos, N . Mex. 274. Nabel, G., and D. Baltimore. 1987. An inducible transcription factor activates expression of human immunodeficiency virus in T cells. Nature. 326:711-713. 275. Nakanishi, Y., Y. Masamune, and N. Kobayashi. 1991. A novel cis-acting element that controls transcription of human immunodeficiency virus type 1 D N A , depending on cell type. J. Virol. 65:6334-6338. 276. Neiman, P. E . 1972. Rous sarcoma virus nucleotide sequences in cellular D N A : measurement by R N A - D N A hybridization. Science. 178:750-3.  266. Moore, J . P . , Q . J . Sattentau, R . Wyatt, and J . Sodroski. 1994. Probing the structure of the human immunodeficiency virus surface glycoprotein gpl20 with a panel of monoclonal antibodies. J. Virol. 68:469-84. 267. Morlat, P . , L. Dequae-Merchadou, F. Dabis, G. Chene, R . Salamon, and J . Beylot. 1996. Splenectomy and prognosis of H I V infection. AIDS. 10:1170-1172. 268. Moses, A . V . , C. Ibanez, R . Gaynor, P . Ghazal, and J . A . Nelson. 1994. Differential role of long terminal repeat control elements for the regulation of basal and Tat-mediated transcription of the human immunodeficiency virus in stimulated and unstimulated primary human macrophages. J. Virol. 68:298-307. 269. Muchardt, C., J . S. Seeler, A . Nirula, D. L. Shurland, and R . B. Gaynor. 1992. Regulation of human immunodeficiency virus enhancer function by P R D U - B F l and c-rel gene products. J. Virol. 66:244-50. 270. Muesing, M. A . , D. H. Smith, and D. J . Capon. 1987. Regulation of m R N A accumulation by a human immunodeficiency virus trans-activator protein. Cell. 48:691-701. 271. Murray, C. J . L., and A . D. Lopez. 1997. Alternative projections of mortality and Refi  277. Niederman, T . M . J., J. V . Garcia, W. R. Hastings, S. Luria, and L. Ratner. 1992. Human immunodeficiency virus type 1 Nef protein inhibits N F k B induction in human T cells. J. Virol. 66:6213-6219. 278. NIH. 1995. AIDS Research and Reference Reagent Program Catalog. Catlogue N I H publication Number 95-1536. U.S. Department of Health and Human Services National Institutes of Health. 279. Nossal, G. J. 1994. Negative selection of Lymphocytes. Cell. 76:229-239. 280. Nye, J. A . , J. M. Petersen, C. V . Gunther, M. D. Jonsen, and B. J. Graves. 1992. Interaction of murine ets-1 with GGA-binding sites establishes the ETS domain as a new D N A binding motif. Genes Devel. 6:975-90. 281. Okamoto, H., C. T . Sheline, J. L. Corden, K. A . Jones, and B. M . Peterlin. 1996. Trans-activation by human immunodeficiency virus Tat protein requires the C-terminal domain of R N A polymerase II. Proc. Natl. Acad. Sci. U.S.A. 93:11575-11579. 282. Olsen, H. S., and C. A . Rosen. 1992. Contribution of the T A T A motif to Tatmediated transcriptional activation of human :es  118  MCEF  1998  immunodeficiency virus gene expression. J. Virol. 66:5594-7.  A critical analysis of the HIV-T4-cell-AIDS hypothesis. Genetica. 95:5-24.  283. Osman, N., S. C. Lucas, H. Turner, and D. Cantrel. 1995. A comparison of the interaction of She and Tyrosine Kinase Zap-70 with the T cell Antigen receptor Zeta chain tyrosine based activation motif. J. Biol. Chem. 270:13981-13986.  292. Parrott, C , T. Seidner, E. Duh, J. Leonard, T. S. Theodore, A. BucklerWhite, M. A. Martin, and A. B. Rabson. 1991. Variable role of the long terminal repeat S p l binding sites in human immunodeficiency virus replication in T-Lymphocytes. J. Virol. 65:1414-9.  284. Ossipow, V., J. P. Tassan, E. A . Nigg, and U. Schibler. 1995. A mammalian R N A polymerase II holoenzyme containing all components required for promoter-specific transcription initiation. Cell. 83:137-46.  293. Patel, P. H., and B. D. Preston. 1994. Marked infidelity of human immunodeficiency virus type 1 reverse transcriptse at R N A and D N A template ends. Proc. Natl. Acad. Sci. U.S.A. 91:549-553.  285. Ou, S. H., L. F. Garcia-Martinez, E. J. Paulssen, and R . B. Gaynor. 1994. Role of flanking E box motifs in human immunodeficiency virus type 1 T A T A element function. J. Virol. 68:7188-99. 286. Palaniappan, C , M. Wisniewski, W. Wu, P. J. Fay, and R. A . Bambara. 1996. Misincorporation by HIV-1 reverse transcriptase promotes recombination via strand transfer synthesis. J. Biol. Chem. 271:22331-22338. 287. Panganiban, A . T., and D. Fiore. 1988. Ordered interstrand and intrastrand D N A transfer during reverse transcription. Science. 241:1064-9. 288. Pantaleo, G., J. F. Demarest, T. Schacker, M. Vaccarezza, O. J. Cohen, M. Daucher, C. Graziosi, S. S. Schnittman, T. C. Quinn, G. M. Shaw, L. Perrin, G. Tambussi, A . Lazzarin, R . P. Sekaly, H. Soudeyns, L. Corey, and A . S. Fauci. 1997. The qualitative nature of the primary immune response to H I V infection is a prognosticator of disease progression independent of the initial level of plasma viremia. Proc. Natl. Acad. Sci. U.S.A. 94:254-258.  294. Pazin, M. J., and J. T. Kadonaga. 1997. SWI2/SNF2 and related proteins: ATP-Driven motors that disrupt protein-DNA interactions? Cell. 88:737-740. 295. Pazin, M. J., P. L. Sheridan, K. Cannon, Z . Cao, J. G. Keck, J. T. Kadonaga, and K. A. Jones. 1996. N F k B mediated chromatin reconfiguration and transcriptional activation of the HIV-1 enhancer in vitro. Genes Dev. 10:37-49. 296. Peeters, A., P. F. Lambert, and N. J. Deacon. 1996. A fourth SP1 site in the human immunodeficiency virus type 1 long terminal repeat is essential for negative-sense transcription. J. Virol. 70:6665-6672. 297. Pelicci, G., L. Lafrancone, F. Grignani, J. McGlade, F. Cavallo, G. Forni, I. Nicoletti, F. Grignani, T. Pawson, and P. G. Pelicci. 1992. A novel transforming protein (SHC) with an SH2 domain implicated in mitogenic signal transduction. Cell. 70:93-104.  290. Pantaleo, G., C. Graziosi, J. F. Demarest, L. Butini, M. Montroni, C. H. fox, J. M. Orenstein, D. P. Kotler, and A . S. Fauci. 1993. H I V infection is active and progressive in lymphoid tissue during the clinically latent stage of disease. Nature. 362:355-358.  298. Pelletier, E . , R. Cheynier, S. Henrickwark, N. Chenciner, M. Henry, H. A. Martinez, V. Pezo, M. Sala, J. P. Vartanian, E. Oksenhendler, F. Hadida, B. Autran, C. Lord, N. Letvin, and S. WainHobson. 1993. The dynamics of HIV variation, p. 57-60. In M. Girard and L. Valette (ed), Retroviruses of Humans AIDS and Related Animal Diseases: Huitieme colloque des centgardes. I.D.M.M. press 6957 DARDILLY, Paris, France., Paris, France.  291. Papadopulos-Eleopulos, E . , V. F. Turner, J. M. Papadimitriou, D. Causer, B. Hedland-Thomas, and B. A . P. Page. 1995.  299. Pendergrast, P. S., and N. Hernandez. 1997. RNA-targeted activators, but not DNA-targeted activators, repress the synthesis of  289. Pantaleo, G., and A . S. Fauci. 1996. Immunopathogenesis of HIV infection. Annu. Rev. Microbiol. 50:825-53.  References  119  MCEF short transcripts at the human immunodeficiency virus type 1 long terminal repeat. J. Virol. 71:910-7. 300. Perkins, N. D., A. B. Agranoff, C. S. Duckett, and G. J. Nabel. 1994. Transcription factor AP-2 regulates human immunodeficiency virus type 1 gene expression. J. Virol. 68:6820-3. 301. Perkins, N. D., N. L. Edwards, C. S. Duckett, A. B. Agranoff, R. M . Schmid, and G. J. Nabel. 1993. A cooperative interaction between NF-kappa B and S p l is required for HIV-1 enhancer activation. E M B O J. 12:3551-8. 302. Phares, W., and W. Herr. 1991. Functional Similarities between Human Immunodeficiency Virus Type 1 and Simian Virus 40 kB Proto-Enhancers. J. Virol. 65:2200-2210. 303. Piatak, M . J., M . S. Saag, L. C. Yang, S. J. Clark, J. C. Kappes, K.-C. Luk, B. H. Hahn, G. M . Shaw, and J. D. Lifson. 1993. High levels of HIV-1 in plasma during all stages of infection determined by competitive PCR. Science. 259:1749-1753.  1998  310. Ramsey, C. A . , and A . T . Panganiban. 1993. Replication of the Retroviral Terminal Repeat Sequence during In vivo Reverse Transcription. J. Virol. 67:4114-4121. 311. Ratnasabapathy, R., M . Sheldon, L. Johal, and N . Hernandez. 1990. The HIV-1 long terminal repeat contains an unusual element that induces the synthesis of short R N A s from various m R N A and snRNA promoters. Genes Dev. 4:206174. 312. Ravichandran, K. S., K. K. Lee, Z. Songyan, L. Z. Cantley, P. Burn, and S. J. Burakoff. 1993. Interaction of She with the z chain of the T cell receptor upon T cell activation. Science. 262:902-904. 313. Ravichandran, K. S., U . Lorenz, S. E. Shoelson, and S. J. Burakoff. 1995. Interaction of She with Grb2 regulates association of Grb2 with mSOS. M o l . Cell. B i o l . 15:593-600. 314. Riman, J., and G. S. Beaudreau. 1970. Viral DNA-dependent D N A polymerase and the properties of Thymidine labelled material in virions of an oncogenic virus. Nature. 228:427-430.  304. Popovic, M . , M . G. Sarngadharan, E. Read, and R. C. Gallo. 1984. Detection, isolation, and continuous production of cytopathic retroviruses (HTLV-III) from patients with AIDS and pre-AIDS. Science. 224:497-500.  315. Roebuck, K. A . , D. S. Gu, and M . F. Kagnoff. 1996. Activating protein-1 cooperates with phorbol esters activation signals to increase HIV-1 expression. AIDS. 10:819-826.  305. Preston, B. D. 1996. Error-prone retrotransposition: Rime of the ancient mutators. Proc. Natl. Acad. Sci. U S A . 93:7427-7431.  316. Rosen, C. A . 1991. Regulation of H I V gene expression by RNA-protein interactions. Trends Genetics. 7:9-14.  306. Preston, B. D., and J. P. Dougherty. 1996. Mechanisms of retroviral mutation. Trends Microbiol. 4:16-21.  317. Rosen, C. A . , J. G. Sodroski, and W. A . Haseltine. 1985. The Location of CisActing Regulatory Sequences in the Human T cell Lymphotropic Virus Type III (HTLV7LAV) Long Terminal Repeat. Cell. 41:813-823.  307. Ptashne, M . , and A. Gann. 1997. Transcriptional activation by recruitment. Nature. 386:569-577. 308. Putkonen, P., R. Thorstensson, J. Albert, and et.al. 1990. Infection of cynomolgus monkeys with HIV-2 protects against pathogenic consequences of a subsequent simian immunodeficiency virus infection. AIDS. 4:783-789. 309. Raineri, I., and H. P. Senn. 1992. HIV-1 promotor insertion revealed by selective detection of chimeric provirus-host gene transcripts. Nucleic Acids Res. 20:6261-6.  318. Ross, E . K., A . J. Buckler-White, A . B. Rabson, G. Englund, and M . A . Martin. 1991. Contribution of NF-kappa B and S p l binding motifs to the replicative capacity of human immunodeficiency virus type 1: distinct patterns of viral growth are determined by T cell types. J. Virol. 65:4350-8. 319. Rothblum, C. J., J. Jackman, J. Mikovitis, R. R. Shukla, and A . Kumar. 1995. Interaction of nuclear protein pi40 with human immunodeficiency virus type 1 T A R R N A in mitogen-activated primary human T-Lymphocytes. J. Virol. 69:5156-5163.  References  120  MCEF  1998  kinases and are required for enhanced growth of Nef+ viruses but not for down-regulation of CD4. E M B O J. 14:484-491.  320. Roulston, A., R. Lin, P. Beauparlant, M. A. Wainberg, and J. Hiscott. 1995. Regulation of human immunodeficiency virus type 1 and cytokine gene expression in myeloid cells by NF-kappa B/Rel transcription factors. [Review]. Microbiol. Rev. 59:481-505.  330. Schafer, S. L., J. Hiscott, and P. M. Pitha. 1996. Differential regulation of the H I V 1 L T R by specific NF-kappa B subunits in HSV-1infected cells. Virology. 224:214-23.  321. Rous, P. 1910. A transmissable avian neoplasm. J. Exp. Med. 12:696. 322. Rous, P. 1911. Transmission of a malignant new growth by means of a cell-free filtrate. J. A m . Med. Assoc. 56:198. 323. Rous, P., and J. B. Murphy. 1913. Variations in a chicken sarcoma caused by a filterable agent. J. Experimental Med. 17:219-231. 324. Roy, S., U. Delling, C. H. Chen, C. A. Rosen, and N. Sonenberg. 1990. A bulge structure in HTV-l T A R R N A is required for T A T binding and TAT-mediated trans-activation. Genes Devel. 4:1365-1373. 325. Ruocco, M . R., X. Chen, C. Ambrosino, E. Dragonetti, W. Liu, M. Mallardo, G. De Falco, C. Palmieri, G. Franzoso, I. Quinto, S. Venuta, and G. Scala. 1996. Regulation of HIV-1 long terminal repeats by interaction of C/EBP(NF-IL6) and NFkappaB/Rel transcription factors. J. Biol. Chem. 271:22479-86.  331. Schafer, S. L., J. Vlach, and P. M. Pitha. 1996. Cooperation between herpes simplex virus type 1-encoded ICP0 and Tat to support transcription of human immunodeficiency virus type 1 long terminal repeat in vivo can occur in the absence of the T A R binding site. J. Virol. 70:693746. 332. Schechter, M. T., K. J. P. Craib, K. A. Gelmon, J. S. G. Montaner, T. N . Le, and M. V. O'Shaughnessy. 1993. HIV-1 and the aetiology of AIDS. Lancet. 341:658-659. 333. Schechter, M. T., N . Le, K. J. Craib, T. N . Le, M. V. O'Shaughnessy, and J. S. Montaner. 1995. Use of the Markov model to estimate the waiting times in a modified W H O staging system for HIV infection. J. Acquired Immune Defici. Syndr. Hum. Retrovirol. 8:474-9. 334. Seeler, J. S., C. Muchardt, A. Suessle, and R. B. Gaynor. 1994. Transcription factor PRDIJ-BFl activates human immunodeficiency virus type 1 gene expression. J. Virol. 68:1002-9.  • 326. Sadowski, I., M. C. Estable, and E. Leng. 1998. A human Cyr61A homologue is transcriptionally repressed in u.v. irradiated human diploid fibroblasts, (in preparation).  335. Sen, R., and D . Baltimore. 1986. Multiple nuclear factors interact with the immunoglobulin enhancer sequences. Cell. 46:705716.  327. Sadowski, I., J. C. Stone, and T. Pawson. 1986. A noncatalytic domain conserved among cytoplasmic protein-tyrosine kinases modifies the kinase function and transforming activity of Fujinami Sarcoma virus P130gag-fps. M o l . Cell. Biol. 6:4396-4408.  336. Seth, A., D . R. Hodge, D . M. Thompson, L. Robinson, A. Panayiotakis, D . K. Watson, and T. Papas. 1993. ETS Family Proteins Activate Transcription from HIV-1 Long Terminal Repeat. AIDS Res. Hum. Retroviruses. 9:1017-1023.  328. Sakaguchi, M., B. Zenzie-Gregory, J. E. Groopman, S. T. Smale, and S. Y. Kim. 1991. Alternative pathway for induction of human immunodeficiency virus gene expression: involvement of the general transcription machinery. J. Virol. 65:5448-56.  337. Shank, P. R., S. H. Hughes, H. J. Kung, J. E. Majors, N . Quintrell, R. V. Guntaka, J. M. Bishop, and H. E. Varmus. 1978. Mapping unintegrated avian sarcoma virus D N A : termini of linear D N A bear 300 nucleotides present once or twice in two species of circular D N A . Cell. 15:1383-95.  329. Saskella, K., G. Cheng, and D. Baltimore. 1995. Proline-rich (PxxP) motifs in HIV-1 Nef bind to SH3 domains of a subset of Src  Refi  338. Sharp, D . G., E. A. Eckert, D . Beard, and J. W. Beard. 1952. Morphology of  zes  121  MCEF the virus of avian erythromyeloblastic leucosis and a comparison with the agent of Newcastle disease. J. Bacteriol. 63:151-61. 339. Shaw, J. P., P.J.Utz, D.B. Durand, J.J. Toole, E. A . Emmel, and G.R. Crabtree. 1988. Identification of a putative regulator of early T cell activation genes. Science. 241:202-205. 340. Sheldon, M., R. Ratnasabapathy, and N. Hernandez. 1993. Characterization of the inducer of short transcripts, a human immunodeficiency virus type 1 transcriptional element that activates synthesis of short RNAs. M o l . Cell. B i o l . 13:1251-1263. 341. Sheridan, P. L., C. T. Sheline, K. Cannon, M. L. Voz, M. J. Pazin, J. T. Kadonga, and K. A . Jones. 1995. Activation of the HIV-1 enhancer by LEF-1 H M G protein on nucleosome-assembled D N A in vitro. Genes Dev. 9:2090-2104. 342. Shibuya, H., K. Irie, J. NinomiyaTsuji, M. Goebl, T. Taniguchi, and K. Matsumoto. 1992. New human gene encoding a positive modulator of HIV Tat-mediated transactivation. Nature. 357:700-2. 343. Shiramizu, B., B. G. Herndier, and M. S. McGrath. 1994. Identification of a common clonal human immunodeficiency virus integration site in human immunodeficiency virus-associated lymphomas. Cancer Res. 54:2069-72. 344. Siekevitz, M., S. F. Josephs, M. Dukovich, N. Peffer, F. Wong-Staal, and W. C. Greene. 1987. Activation of the HIV-1 L T R by T cell mitogens and the trans-activator protein of H T L V - I [published erratum appears in Science 1988 Jan 29;239(4839):451]. Science. 238:1575-8. 345. Skalka, A . M., and S. P. Goff. 1993. Reverse Transcriptase, p. 492. Cold Spring Harbor laboratory press, Cold Spring Harbour, N Y . 346. Smit, A . f. 1993. Identification of a new, abundant superfamily of mammalian L T R transposons. Nucleic Acids Res. 21:1863-72. 347. Smith, D. K., J. J. Neal, S. D. Holmberg, and C. f. D. c. I. C.-L. T. force. 1993. Unexplained opportunistic infections and CD4+ T-Lymphocytopenia without HIV infection. New Engl. J. Med. 328:373-379.  1998  348. Sodroski, J., R. Patarca, C. Rosen, F. Wong-Staal, and W. Haseltine. 1985. Location of the trans-activating region on the genome of human T cell lymphotropic virus type III. Science. 229:74-7. 349. Sodroski, J. G., Rosen, C.A., Wong-Staal, F., Salahuddin, S.Z., Popovic, M., Arya, S., and Gallo R.C. 1985. Trans acting transcriptional regulation of human T cell leukemia virus type III long terminal repeat. Science. 227:171-173. 350. Southern, E. M. 1975. Detection of specific sequences among D N A fragments separated by gel electrophoresis. J. M o l . Biol. 98:503-517. 351. Southgate, C. D., and M. R. Green. 1991. The HIV-1 Tat protein activates transcription from an upstream DNA-binding site: implications for Tat function. Genes Dev. 5:2496-2507. 352. Spertzel, R. 1989. Animal models of human immunodeficiency virus infection. Public health service Animals model comittee. Antiviral Res. 12:223-230. 353. Squinto, S. P., D. Mondal, A. L . Block, and O. Prakash. 1990. Morphine-induced transactivation of HIV-1 L T R in human neuroblastoma cells. AIDS Res. Hum. Retroviruses. 6:1163-8. 354. Stanley, S. K., P. B. Bressler, G. Poli, and A. S. Fauci. 1990. Heat shock induction of HIV production from chronically infected promonocytic and T cell lines. J. Immunol. 145:1120-6. 355. Starcich, B., L . Ratner, S. F. Josephs, T. Okamoto, R. C. Gallo, and Wong-Staal. 1985. Characterization of long terminal repeat sequences of HTLV-III. Science. 277:538-540.  F.  356. Stevens, S. W., and J.-D. Griffith. 1994. Human immunodeficiency virus type 1 may preferentialy integrate into chromatin occupied by L I H s repetitive elements. Proc. Natl. Acad. Sci. U.S.A. 91:5557-5561. 357. Stewart, G. 1995. The epidemiology and transmission of AIDS: a hypothesis linking behavioural and biological determinants to time, person and place. Genetica. 95:173-93.  Re fere ces  122  MCEF  1998  358. Strathdee, S. A., D. M. Patrick, S. L. Currie, P. G. Cornelisse, M. L. Rekart, J. S. Montaner, M. T. Schechter, and M. V. O'Shaughnessy. 1997. Needle exchange is not enough: lessons from the Vancouver injecting drug use study. AIDS. ll:F59-65.  pararetroviruses, retrotransposons, and retrotranscripts. M o l . Biol. Evolution. 2:455-68.  359. Sune, C , and M. A. Garcia-Blanco. 1995. S p l transcription factor is required for in vitro basal and Tat-activated transcription from the human immunodeficiency virus type 1 long terminal repeat. J. Virol. 69:6572-6.  371. Temin, H. M., and S. Mizutani. 1970. RNA-dependent D N A polymerase in virions of Rous sarcoma virus. Nature. 226:1211-3.  370. Temin, H. M., and D. P. Bolognesi. 1993. AIDS. Where has H I V been hiding? [news; comment]. Nature. 362:292-3.  360. Tansley, W. P., and W. Herr. 1997. TAFs: Guilt by association. Cell. 88:729-732.  372. Temin, H. M . , and H. Rubin. 1958. Characteristics of an assay for Rous sarcoma virus and Rous sarcoma cells in tissue culture. Virology. 6:669.  361. Taylor, J. M. 1979. D N A intermediates of avian R N A tumor viruses. Curr. Topics Microbiol. Immunol. 87:23-41.  373. Temin, H. M., and H. Rubin. 1959. A kinetic study of infection of chick embryo cells in vitro by Rous sarcoma virus. Virology. 8:209-222.  362. Taylor, J. P., R. Pomerantz, O. Bagasra, M. Chodhury, J. Rapapport, K. Khalili, and S. Amini. 1992. TAR-independent transactivation by Tat in cells derived from the CNS: a novel mechanism of HIV-1 gene regulation. E M B O J. 11:3395-3403.  374. Tesmer, V . M., A. Rajadhyaksha, J. Babin, and M. Bina. 1993. NF-IL6-mediated transcriptional activation of the long terminal repeat of the human immunodeficiency virus type 1. Proc. Natl. Acad. Sci. U.S.A. 90:7298-302.  363. Teeuwsen, V. J. P., K. H. J. Siebelink, F. de Wolf, J. Goudsmit, F. J. C. M. Uytdehaag, and D. M. E . Osterhaus. 1989. Impairment of in vitro immune response occurs within 3 months after HIV-1 seroconversion. AIDS. 4:77-81. 364. Temin, H. M. 1960. The control of cellular morphology in embryonic cells infected with rous sarcoma virus in vitro. Virology. 10:182-197. 365. Temin, H. M. 1976. The D N A provirus hypothesis. Science. 192:1075-80. 366. Temin, H. M. 1989. Is H I V unique or merely different? J. Acquired Immune Defic. Syndr. 2:1-9. 367. Temin, H. M. 1964. Nature of the provirus of Rous Sarcoma. Natl. Cancer. Inst. Monogr. 17:557-570. 368. Temin, H. M. 1993. Retrovirus variation and reverse transcription: abnormal strand transfers result in retrovirus genetic variation. Proc. Natl. Acad. Sci. U.S.A. 90:6900-3. 369. Temin, H. M. 1985. Reverse transcription in the eukaryotic genome: retroviruses,  375. Thiesen, H.-J., and C. Bach. 1990. Target Detection Assay (TDA): a versatile procedure to determine D N A binding sites as demonstrated on SP1 protein. Nucleic Acids Res. 18:3203-3209. 376. Thompson, C. C , T. A. Brown, and S. L. McKnight. 1991. Convergence of Etsand Notch-related motifs in a heteromeric D N A binding complex. Science. 253:762-768. 377. Tindall, B., and D. A. Cooper. 1991. Primary HTV infection:Host responses and intervention strategies. AIDS. 5:1-14. 378. Tong-Starksen, S., and B. M. Peterlin. 1990. Mechanisms of retroviral transcriptional activation. Seminars Virol. 1:215227. 379. Tong-Starksen, S. E . , P. A. Luciw, and B. M. Peterlin. 1989. Signaling through T Lymphocyte surface proteins, TcR/CD3 and CD28, activates the HIV-1 long terminal repeat. J. Immunol. 142:702-707. 380. Travis, A., A. Amsterdam, C. Belanger, and R. Grosschedl. 1991. L E F - 1 , a gene encoding a lymphoid specific protein, with a H M G domain, regulates T cell receptor alpha enhancer function. Genes Dev. 5:880-894.  References  123  MCEF 381. Trono, D. 1992. Partial reverse transcripts in virions from human immunodeficiency and murine leukemia viruses. J. Virol. 66:4893-4900. 382. Tsujimoto, H., R . Cooper, T. Kodama, and et.al. 1988. Isolation and characterization of simian immunodeficiency virus from mandrills in Africa and it's relationship to other human and simian immunodeficiency viruses. J. Virol. 62:4044-4050. 383. Van-Lint, C , S. Emiliani, M. Ott, and E. Verdin. 1996. Transcriptional activation and chromatin remodeling of the HIV-1 promoter in response to histone acetylation. E M B O J. 15:11121120. 384. Vanoers, N. S. C , W. Tao, J. D. Watts, P. Johnston, R . Abersold, and H.-s. Teh. 1993. Constitutive Tyrosine phosphorylation of the T cell receptor (TCR) subunit zeta: Regulation of TCR-associated protein tyrosine kinase activity by T C R zeta. M o l . Cell. Biol. 13:5771-5780. 385. Varmus, H. E., P. K. Vogt, and J. M. Bishop. 1973. Integration of deoxyribonucleic acid specific for Rous sarcoma virus after infection of permissive and nonpermissive hosts. Proc. Natl. Acad. Sci. U.S.A. 70:3067-71. 386. Vartanian, J. P., A. Meyerhans, B. Asjo, and S. Wain-Hobson. 1991. Selection, recombination, and G — A hypermutation of human immunodeficiency virus type 1 genomes. J. Virol. 65:1779-88. 387. Vartanian, J. P., A . Meyerhans, M. Henry, and S. Wain-Hobson. 1992. Highresolution structure of an HIV-1 quasispecies: identification of novel coding sequences. AIDS. 6:1095-8. 388. Vartanian, J. P., A . Meyerhans, M. Sala, and S. Wain-Hobson. 1994. G-->A hypermutation of the human immunodeficiency virus type 1 genome: evidence for dCTP pool imbalance during reverse transcription. Proc. Natl. Acad. Sci. U . S . A . 91:3092-6. 389. Vartanian, J. P., U . Plikat, M. Henry, R. Mahieux, L. Guillemont, A . Meyerhans, and S. Wain-Hobson. 1997. H I V Genetic Variation is directed and restricted by D N A precursor availability. J. M o l . Biol. 270(2):: 139151.  1998  390. Verdin, E. 1991. DNAse I-hypersensitive sites are associated with both long terminal repeats and with the intragenic enhancer of integrated human immunodeficiency virus type 1. J. Virol. 65(12):6790-9. 391. Verdin, E., P. J. Paras, and C. Van Lint. 1993. Chromatin disruption in the promoter of human immunodeficiency virus type 1 during transcriptional activation [published erratum appears in E M B O J 1993 Dec;12(12):4900]. E M B O J. 12:3249-59. 392. Vignali, D. A. A., C. Doyle, M . S. Kinch, J. Shin, and J. L. Strominger. 1993. Interactions of CD4 with M H C class II molecules, T cell receptors and p56 lck. Philosophical Transactions Royalal Soci. Lond. 342:13-24. 393. Vlach, J., A. Garcia, J. M . Jacque, M. S. Rodriguez, S. Michelson, and J. L. Virelizier. 1995. Induction of S p l phosphorylation and NF-kappa B-independent HTV promoter domain activity in T-Lymphocytes stimulated by okadaic acid. Virology. 208:753-61. 394. Von-Boehmer, H. 1994. Positive selection of T-Lymphocytes. Cell. 76:219-228. 395. Wain-Hobson, S. 1995. A I D S . Virological mayhem [news; comment]. Comment on: Nature 1995 Jan 12;373(6510): 117-22, Comment on: Nature 1995 Jan 12;373(6510): 123-6. Nature. 373. 396. Wain-Hobson, S. 1997. Down or out in blood and lymph? Nature. 387:123-124. 397. Wain-Hobson, S. 1992. H I V and antigenic stimulation, p. 137-138. In M. Girard and L. Valette (ed.), Retroviruses of Humans AIDS and Related Animal Diseases, vol. Cent Gardes, 1992. I.D.M.M. press 6957 DARDILLY, Paris, France.., Paris, France. 398. Wain-Hobson, S. 1996. Running the gamut of retroviral variation. [Review]. Trends Microbiol. 4:135-41. 399. Wain-Hobson, S., P. Sonigo, O . Danos, S. Cole, and M . Alizon. 1985. Nucleotide sequence of the AIDS virus, L A V . Cell. 40:9-17. 400. Wain-Hobson, S., Vartanian Jp, Henry M , Chenciner N, Cheynier R, Delassus S, Martins Lp, Sala M , Nugeyre Mt, Guetard D, and et al. 1991. LAV revisited:  References  124  MCEF origins of the early HIV-1 isolates from Institut Pasteur. Science. 252:961-5. 401. Wakefield, J. K., H. Rhim, and C. D. Morrow. 1994. Minimal sequence requirements of a functional human immunodeficiency virus type 1 primer binding site. J. Virol. 68:1605-1614. 402. Walker, S., C. Hagemeier, J. G. Sissons, and J. H. Sinclair. 1992. A 10-basepair element of the human immunodeficiency virus type 1 long terminal repeat (LTR) is an absolute requirement for transactivation by the human cytomegalovirus 72-kilodalton D31 protein but can be compensated for by other L T R regions in transactivation by the 80-kilodalton IE2 protein. J. Virol. 66:1543-50. 403. Wang, D., and D. K. Hawley. 1993. Identification of a 3'—>5' exonuclease activity associated with human R N A polymerase II. Proc. Natl. Acad. Sci. U.S.A. 90:843-7. 404. Wang, L. H., and P . Duesberg. 1974. Properties and location of poly (A) in Rous sarcoma virus R N A . J. Virol. 14:1515-1529. 405. Wang, W., J. Cote, Y. Xue, S. Zhou, P . A . Khavari, S. R. Biggar, C. Muchardt, G. V . Kalpana, S. P . Goff, M. Yaniv, J. L. Workman, and G. R. Crabtree. 1996. Purification and biochemical heterogeneity of the mammalian SWI-SNF complex. E M B O J. 15:5370-5382. 406. Wasylyk, B., S. L. Hahn, and A . Giovane. 1993. The Ets family of transcription factors. Eur. J. Biochem. 211:7-18. 407. Watanabe, H., J. I. Sawada, K. I. Yano, K. Yamaguchi, M. Goto, and H. Handa. 1993. c D N A cloning of transcription factor E4TF1 subunits with Ets and Notch motifs. M o l . Cell. Biol. 13:1385-1391. 408. Watanabe, H. T., T. Wada, and H. Handa. 1990. Transcription factor E4TF1 contains two subunits with different functions. E M B O J. 9:841-847. 409. Waterman, M. L., W. H. Fischer, and K. A . Jones. 1991. A thymus-specific member of the H M G protein family regulates the human T cell receptor enhancer. Genes Dev. 5:656669.  1998  410. Waterman, M. L., and K. A. Jones. 1990. Purification of T C F - l a , A T cell-Specific Transcription Factor That Activates the T cell Receptor Gene Enhancer in a Context-Dependent Manner. New Biologist. 2:621-636. 411. Waterman, M. L., P. L. Sheridan, L. H. Milocco, C . T. Sheline, and K. A. Jones. 1991. Nuclear proteins implicated in HIV-1 transcriptional control, p. 391-403. In W . A . H . a. F. Wong-Staal (ed.), Genetic structure and regulation of HIV. Raven press Ltd., New York. 412. Wattel, E., J. P. Vartanian, C . Pannetier, and S. Wain-Hobson. 1995. Clonal expansion of human T cell leukemia virus type Iinfected cells in asymptomatic and symptomatic carriers without malignancy. J. Virol. 69:2863-8. 413. Wei, X., S. K. Ghosh, M. E. Taylor, V. A. Johnson, E. A. Emini, P. Deutsch, J. D. Lifson, S. Bonhoeffer, M. A. Nowak, B. H. Hahn, M. S. Saag, and G. M. Shaw. 1995. Viral dynamics in human immunodeficiency virus type 1 infection. Nature. 373:117-122. 414. Weil, R., and A. Veillette. 1994. Intramolecular and extramolecular mechanisms repress the catalytic function of p56^ ^ in resting tlymphocytes. J. Biol. Chem. 269:22830-22838. c  415. Weiss, A., and D. R. Littman. 1994. Signal transduction by lymphocyte antigen receptors. Cell. 76:263-274. 416. Weiss, S. R., H. E. Varmus, and J. M. Bishop. 1977. The size and genetic composition of virus-specific R N A s in the cytoplasm of cells producing avian sarcoma-leukosis viruses. Cell. 12:983-92. 417. Weissman, D., R. L. Rabin, J. Arthos, A. Rubbert, M. Dybul, R. Swofford, S. Venkatessan, J. M. Farber, and A. S. Fauci. 1997. Macrophage-tropic H I V and SFV envelope proteins induce a signal through the CCR5 chemokine receptor. Nature. 389:981-985. 418. Westendrop, M. O., R. Frank, C . Ochsenbauer, K. Strieker, J. Dheln, H. Walczak, K. M. Dabatin, and P. H. Krammer. 1995. Sensitization of T cells to CD95mediated apoptosis by HIV-1 Tat and gpl20. Nature. 375:497-500.  References  125  MCEF 419. Whitcomb, J. W., R. Kumar, and S. H. Hughes. 1990. Sequence of the circle junction of Human Immunodeficiency type 1: implications for reverse transcription and integration. J. Virol. 64:4903-4906. 420. WHO, W. H. O. 1990. Acquired immune deficiency syndrome (AIDS): Interim proposal for a W H O staging sydtem for HIV infection and disease. Wkly Epidem Rec. 65:221-8. 421. Wilson, C. J., D. M. Chao, A . N. Imbalzano, G. R. Schnitzler, R. £ . Kingston, and R. A . Young. 1996. R N A polymerase II holoenzyme contains SWI/SNF regulators involved in chromatin remodeling. Cell. 84:235-44. 422. Wobbe, C. R., and K. Struhl. 1990. Yeast and Human TATAiBinding Proteins Have Nearly Identical D N A Sequence Requirements for Transcription In vitro. M o l . Cell. Biol. 10:38593867. 423. Wong, E., R. G. MacDougall, D. M. Patrick, and M. L. Rekart. 1996. AIDS update. Quarterly Report (British Columbia, Ministry of Health and Ministry responsible for seniors). Fourth Quarter: 1-45. 424. Wu, C. 1997. Chromatin remodeling and the control of gene expression. J. Biol. Chem. 272:28171-28174. 425. Wu, F., J. Garcia, R. Mitsuyasu, and R. Gaynor. 1988. Alterations in binding characteristics of the human immunodeficiency virus enhancer factor. J. Virol. 62:218-25. 426. Yammamato, T . , B . deCrombrugghe, and I. Pastan. 1980. Identification of a functional promoter in the long terminal repeat of Rous sarcoma virus. Cell. 22:787797. 427. Yang, X., C. H. Herrmann, and A . P. Rice. 1996. The human immunodeficiency virus Tat proteins specifically associate with T A K in vivo and require the carboxyl-terminal domain of R N A polymerase II for function. J.Virol. 70:4576-4584. 428. Yoon, J.-B., G. Li, and R. G. Roeder. 1994. Characterization of a family of related cellular transcription factors which can moculate human immunodeficiency virus type 1 transcription in vitro. M o l . Cell. Biol. 14:1776-1785.  1998  429. Zabel, U., R. Schreck, and P. A. Baeuerle. 1991. D N A Binding of Purified Transcrption Factor NF-kB. J. Biol. Chem. 266:252-260. 430. Zeichner, S. L . , K. J.Y., and J. C. Alwine. 1991. Linker-scanning mutational analysis of the transcriptional activity of the human immunodeficiency virus type 1 long terminal repeat. J. Virol. 65:2436-44. 431. Zeichner, S. L . , J. Y. Kim, and J. C. Alwine. 1991. Analysis of the human immunodeficiency virus long terminal repeat by in vitro transcription competition and linker scanning mutagenesis. Gene Expression. 1:15-27. 432. Zhang, H., G. Dornadula, and R. J. Pomerantz. 1996. Endogenous reverse transcription of human immunodeficiency virus type 1 in physiological microenvironments: an important stage for infection of nondividing cells. J. Virol. 70:28092824. 433. Zhang, L . , Y. Huang, H. Yuan, B. K. Chen, J. Ip, and D. D. Ho. 1997. Genotypic and phenotypic characterization of long terminal repeat sequences from long-term survivors of human immunodeficiency virus type 1 infection. J. Virol. 71:5608-13. 434. Zhang, L . , Y. Huang, H. Yuan, B. K. Chen, J. Ip, and D. D. Ho. 1997. Identification of a replication-competent pathogenic human immunodeficiency virus type 1 with a duplication in the TCF-1 alpha region but lacking N F kappaB binding sites. J. Virol. 71:1651-6. 435. Zhou, Q., and P. A. Sharp. 1996. Tat-SFl: Cofactor for Stimulation of transcriptional elongation by HIV-1 Tat. Science. 274:605-610. 436. Zider, A., B. Mashhour, P. Fergelot, G. Grimber, M. Vernet, U. Hazan, D. Couton, P. Briand, and C. Cavard. 1993. Dispensable role of the NF-kappa B sites in the UV-induction of the HIV-1 L T R in transgenic mice. Nucleic Acids Res. 21:79-86. 437. Zimmerman, P. A., A. BucklerWhite, G. Alkhatib, et. al. 1997. Inherited resistance to HIV-1 conferred by an inactivating mutation in C C chemokine receptor 5: studies in populations with contrasting clinical phenotypes, defined racial background, and quantified risk. Mol. Med. 3:23-36.  References  126  MCEF  1998  Appendix Alignment  of H I V - 1 5 ' - L T R  sequences.  The sequences are named according to the L T R - C A T constructs  (See Materials & Methods). The R B E sites and the M F N L P are indicated at the top of the corresponding pages, in row #2 (motif). Rows 3 to 5, contain the Los Alamos National Laboratory ( L A N L ) consensus sequences for several M subtypes.  Row 6 contains the HIVXB2 reference sequence. Sequences prefixed with a " P " (eg. PI Direct) are  sequences derived from the P C R amplicon prior to cloning. Cloned products for the amplicon are prefixed with MCE#, and aligned immediately below the P C R amplicon sequence. Dashes indicate gaps.  Longer sequences are  presented when both strands were sequenced and correspond to sequences in figure 4.2 (available through Genebank). Shorter sequences were truncated inside the 98% accuracy window as described in M & M . Rows 520 to 522 are from a long term non-progressor from the V L A S , with intact R B E sites (as opposed to the L T N P described by Deacon (Deacon, et al., 1995), (available through GeneBank).  Appendix  127  MCEF  2 3 I 5 6  Motif LANL CON A LANL CON D LANL CON B ACCAGT TGA GCC A HIVXB2  GCTACT GGA GCCACT GAA GCCAAT  J  ! 9 [ 10 11 j 12 | 13 I I 15 i I 17 18 | 19 ) 21 22 23 24 25  PI Direct. MCSI1.3 MCEtl.4 MCEtl.5 MCEI1.6 HCEH.7 HCEI1.8 MCE*1.9 MCEI1.10 MCEIl.ll MCEI1.15 MCEtl.16 MCEI1.17 MCEI1.18 MCEI1.19 KCEI1.20 MCEil-21 MCE*1.22 •KEI1.23  GM  ft GTT AGAAGAA G  CAACTOTrTC/TTACACCCTATATOCCA GCATOGAATCGAGGA C CAACAaCITVTTACACKCTATQ^OCCT GCATGGGATGGATGA C CACCAaCTTaTTACACCCTGTGAGCCT GCATGGAATGaATGA C GI..TTGTTACACCCTATGAGC' : GCATGGGATGGATGA '  T TGA TCC AGA T I ACCAGT TGA T I ACCAGT TGA T ACCACT TGA T I ACC AST TGA ACC A  1998  ft GGAGAGAA CAACAGCTTCTTACACCCTATGAGCXT ft TAACATCTTGTTACACCCTATGAGCCT GCATGGGATGGATGA ft CAGCAGCTTt3TTACACCCTATGAGCCT ACAGCTTGTrACACCCTATGAGCCT ft CAACAQCTTGTTACACCCTATGAGCCT A CAACACX7ITGTTACACCCTATGAGCCT II GGAGAGAA CAACAGCTTCTTACACCCTATGAGCCT QCAT3GGATGGATGA ft CAACAGCTTOTTACACCCTATGAGCCT QCATGGGATGGATGA :A<JCTTCTTACACCCTATGAGCCT GCATGGGATGGATGA * GGAGAGAA C'AALAtJCTTGTTACACCCTATGAGCCT ft CAACA<JCTTinTACACCCTATUAGCCT ft CAACAGCTTGTTACACCCTATGAGCCT K GGAGAGAA TAACAaCTTGTTACACCCTATGAGCCT It GGAGAGAA TAACAOCTTCTTTACACCCTATGAGCCT I AGT AGAAAAG GCCAAC C A GGAGAGAA TAACATCTTOTTACACCCTATaAGCCT ft Q3AGAGAA CAACAGCTTQTTACACCCTATGAQCCT ft GGAGAGAA TAACATCTTGTTACACCCTATGAGCCT A CAACAGCTTOTTACACCCTATGAOCCT  C  C C C C ( C I C (  ;  IAGAAAGAAGTG TTAATOT 3 TTAATI.tr j TTAATGT 3ACAGCCGCCTGCCATT • 3 TTAATGT AGAGAAAGAAACA TTAATGT AGAGAAAGAAGTG TTAATGT :AC<XXXriWKATTTCATCACATOC<XXX7rGAfi OOAGAAAGAAGTG TTAATGT AGAGAAAGAAGTG TTAATOT GGA AGTTTGACAGCCUCCTOGCATTTCATXVtCATGOCCCGAGAG AaAGAAAGAAGTG TTAATGT GGA aGTirGACAaCCGCCTaaCATTTCATCATATGGt^^ GGAGAAAGAAGTa TTAATGT QUA AaTTTOACAaCCaCCTGGCATTTCATCACATGGCC^^ 3 TTAATOT GGA AaTTTGACAGCCTXXTOGCATTTCATCACAT^ 3 TTAATOT G G A AGTTTGACAGCCOlXTOIKATTTCATeACATGGOXGAGAa I J U A AGTTTGACAGCCGCCTGGC LCAGCCGCCTGGCATT ft TTAATOT 3 TTAATOT 3 TTAATOT 3 TTAATOT AGAGAAAGAAGTG TTAATOT 3 TTAATOT OGA AOTTTGACA<*XTXX-IX^ATTTCATCACATGOCCCi3AC3Aa  GAA GGAGAGAA TAACAOrTT'TITACAtxrcTATGAGIJCT 3 GCC AAT GAG 3 GCCAAT GAA ft GAA AUT AGAAGAG GCC AAT GAA ft TAA GOT AGAAAAG GCCAAC GAA ft TAA GCT AGAAAAG GCCAAC GAA ft TAA GOT AGAAAAG GCCAAC GAA ft TAA GOT AGAAAAG GCCAAC GAA ft GAA AOT AGAAGAG GCCAAT GAA J GAA AGT AGAAGAG GCCACT GAA ft ilAA ACT AGAAGAG GCC AAT GAA ft TAA GOT AGAAAAG GCCAAC GAA  ACCACT TGA OCA A(.!A GAA AGT A  I | , |  I j ] | I  1  33 34 35 36 37 3B 39 40 41 42 43 I 45 46 47 48 I 1 51 52 53 54 55 56 57 58 59 ) 61 62 63 64 65 66 67 6B 69 ) . 72 73 74  MCEI1.34 MCEI1.38 MCEI1.39 MCEfl.43 MCEI1.44 MCEil.45 MCEtl.46 MCE#1.47 MCE#1.49 MCE#1.50 P3 D i r e c t HCEI3.27 MCE43.33 MCEI3.34 MCEI3.3 5 MCEt3.43 MCEI3.61 MCE#3.62 MCE#3.63 MCE#3.64 MCEI3.65 MCEI3.66 MCEI3.67 MCE#3.G8 MCEI3.69 HCE*3.BO MCE#3.81 MCE#3.82 MCEI3.B3 MCE*3.84 MCEI3.85 MCEI3.86 MCEI3.87 MCEI3.8B MCEI3.B9 MCEI3.90 MCEI3.91 MCE4 3 . 9 2 MCE#3.93 MCEI3.94 [ 1.95 MCE#3.96  75 MCEI4.2S 76 MCEI4.33 77 MCE#4.34 ) MCE#4.3S 79 MCE#4.36 80 MCE#4.43 81 MCE#4.45 82 MCE#4.47 83 M C E * 4 . 4 8 84 MCEI4.49 85 M C E * 4 . 5 3 86 M C E M . 5 4 | B7 MCEI4.61 BB MCE4 4 . 6 2 B9 MCEI4.63 | 90 MCEI4.64 . MCEI4.65 92 MCEI4.66 93 MCE#4.67 94 MCEI4.6B 95 69 98 IM C E I44 . .82 99 MCEt4. 96 MCEI4.80 LOO MCEI4. 97 KCEI4.1 L01 M C E t 4 . 8 5 L02 N C E I 4 . 8 7 L03 MCEI4.88 L04 M C E I 4 . 9 0 L05 MCEI4.91 L06 M C E * 4 . 9 2 L07 H C E f 4 . 9 3 t MCE44.94 109 P5 D i r e c t 110 M C E I 5 . 2 9 U l MCE*5.30 112 MCEI5.31 113 MCEI5.32 I MCEI5.33 LIS M C E t 5 . 3 5 L16 MCEfS-3 6 L17 MCE#S.37 L18 H C E I 5 . 3 8 L19 K C E I 5 . 8 2 ) MCEI5.83 L MCEI5.84 22 P6 D i r e c t 23 HCE#6.32 1 MCEI6.3 3 L25 MCE#6.34 L26 MCE#6.43 L27 MCE#6.101 L28 MCEI6.102 L29 MZEI6.103 130 hCEI6.104 131 W2EI6.105 132 KKTEt6.106 133 MTEI6.10B L34 MCE#6.109 L3 5 P7 D i r e c t L36 M C E i 7 . 2 7 L37 H C E i 7 . 2 8 L3B M C E I 7 . 2 9 L39 M C E i 7 . 3 0 140 M C E I 7 . 3 1 141 MCE47.33 142 MCEI7.3 4 143 MCEI7.35 144 MCEt7.37 L45 WTE#7.100 L46 MZEI7.101 L47 MCE#7.111 ,48 P8 D i r e c t .49 MCEIB.7  3 TTAATOT TTAATGT TTAATOT TTAATOT 3 OGAGAAGGAAGTG  GGA AGTTTGACAGCCOTCTGGi:ATTTCATCACATCGC'CCGAGAU GGA AGTTTUACACXXXICXTGGCATTTCATCACATGGCVCVMGAU GGA AGTTTGACAGCCXXX.Tt^jCATTTCATCACATQOTCCGAGAG GGA AGTTTGACAGCCGCCTGCXrATTTCATCACATGGCCCGAGAG •AGCCTGCCTGGCATTTCATCACATGGCCCGAGAG  TTAATGT TTAATGT TTAATGT TTAATOT TTACTOT TTAGTOT  GGA AGTTTGACAGCCGCCTGGCATTTCATCACATGGCCCGAGA GGA AGTTTGACA(aCCGCCTlKk:A GGA AUTTTIWCAGCCIICXTOGCATTTCAT GGA AGTTT^GACAGCCGCCTGGCATTTCATCACATQGCCCGAGAG GGA AGTTTGACAGCCACCTAQCATTTCATCACAAGGCCCGAGAG GGA ACTTTGACAGCCACCTAGCGTTTCATCACAAGGCCCGAGAG  TAACAGCTTOTTACACCOTATGAOCCTOTATGGGATGGATGACCC TAACAGCTTOTTACAC^CTATOAGCCT CAACAGCTTCTTACACCCTATGAGCCT CAACAGCTTGTTACACCOTATGAGCCT CATCAGCTTaTTACACCCTATGAGCCT CATCAaCTTGTTACACCCTATGAGCCT TAACATCTTOTTACACCCTATGAGCCT  GCATGGGATGGATGA C GCATlJGGATGGATGA (J CAACAGCTTGTTACACCCTATGAGCCT GCATGGGATGGATGA C CAACAGCTTOTTACACCCTATGAG1.-CT GCATGGGATGGATGA C ft OCA GOT AGAAGAG GCC AAT AAA CAACTGCCTOTTACACCCTATGAGCCA GCATGGGATGGATGA C r AAA GGAGAAAA CAACTGCCTOTTACACCCTATGAGCCA CAAcrroACTIOTTACACCCTATGAaCCA CAACTGCCTGTTACACCCTATGAGCCA OCATOGGATGGATGA CCC GGAGAAAA CAALTGCCTGTTACACCCTATGAaCCA CAACTG1XTOTTACACCCTATGAGCCA CAACTGCCTGTTACACCCTATGAGCCA GGAGAAAA CAACTGCCTGTTACACCCTATGAGCCA CAACTaCCTaTTACACCCTATGAGCCA CAACTGCCTOTTACACCCTATGAGCCA CAACTGCCTOTTACACCCTATGAGCCA GCCAAT AAA CAACTGCCTGTTACACCCTATGAGCCA GCCAAT AAA CAACTGCCTGTTACACCCTATGAGCCA  GCATGGGATGGATGA GCATGGGATGGATGA GCATGGGATGGATGA GCATGGGATGGATGA GCATGGGATGGATGA GCATGGGATGGATGA GCATGGGATGGATGA GCATGGGATGGATGA OCATGGGATGGATGA  CAACTGCCTGTTACACCCTATGAGCCA GCC AAT AAA GGAGAAAA CAACTGCCTOITACACCCTATaAUCCA CAACTOCCTOTTACACCOTATGAGCCA CAACTOCXTTOTTACACCTXTrATGAGCCA CAACTGCCTGTTACACCCTATGAGCCA  (i G C GCATGGGATGGATGA C GCATGGGATGGATGA C  TTAGTGT G  C CCC A CCC AGAGAAAGAAGTG TTAOT3T CCC AGAGAAAGAAGTG TTAGTiJT CCC AGAGAAAGAAGTG TTAGTGT CCC AGAGAAAGAAGTG TTAGTOT CCC AGAGAAAGAAGTG TTAGTGT CCC AGAGAAAGAAGTG TTAGTOT CCC AGAGAAAGAAGTG TTAGTOT  •AGCCACCTAGCATTTCATCACAAGOCCXX3AGAQ  G G G G I AGTTTGACAGCC ACCTAGC ATTTCATCACAAGGCCCGAOAIJ G I AGTTTGACAGCCACCTAGCATTTCAT^rACAAGGCCCGAGAO G t AGTTTGACAGCCACXTrAaCATTTCATCACAAGGCCCGAUM G 3ACAGCCACCTAi^'ATrTCATCACAAGGCCCI»GAa rCATCACAAGGCCCGAGAG  ACCACT TGA GCC A  1 ACCACT  TGA G  ft GOT AGAAGAG G  AGAGAAAGAAGTG AGAGAAAGAAGTG AGAGAAAGAAGTG AGAGAAAGAAGTG AGAGAAAGAAGTG AGAGAAAGAAGTG AGAGAAAGAAGTG  \ GGAGAAAA CAACTCCCTGTTACACCCTATGAGCCA  CAACTGOT CAACTGC"TTGTTACACCCTATGAGCCT TAACAGCTTGTTACACCCTATGAGCCT CAACTGCCTOTTACACCCTATGAGCCA CAACTGCCTGTTACACCCTATGAGCCA CAACTGCTTGCTACACCCTATOGGCCA CAACTGCCTGTTACACCCTATGAGCCA CAACTGCCTGTTACACCCTATGAGCCA  ACCAGT TGA GCC AGA O ACCACT TGA GCC AGA G ACCAGT TGA GCC AGA G  QCATCGGATGGAGGA GCATGGGATGGATGA GCATGGGATGGATGA GCATGGGATGGATGA GCATAGGATGGATGA C C  TAACATCTTCTTACACCCTATI.WIJC'C'T CAACTi^CTiJTTACACCCTATGAI.lCC'A CAACTGCCTOTTACACCCTATGAGCCA  , , , . , ,  E  GGAAG GGAAG-GGAAGGGAAG--  » GAT GGAAG-\ GAT GGAAG ft GAT GGAAG ft GAT GGAAG-ft GAT GGAAG A GOT AGAAGAG  T TTAGTGT TTAGTGT TTAGTGT TTAGTOT TTAGTOT TTAGTGT  G G G G G G  TTAATIJT u GGAGAGAGAAGTG TTACTOT G TTAATOT O TTAGTOT G  C C C C C  3ACAGCCACCTAGCATT1 3ACAGCCACXTAGCATTTCATCACAAGGCCC11AGAG  TAGCCACCTAGCA' ICAGCCACCTAGCATTTCATCACAAGGCCCGAGAG :AGCCACCTAGCATTTCATCACAAGGCCCGAGAG :AGCCACCTAGCATTICATCACAAGGCCCGAGAG  IACTAGCAACCTAGCATTTCGTCACGTGGCCCGAGAG :ATTTCATCACATGGCCCIJAGAG 'ATTTCATCACAAGGCCCAAGAG  . AGTTTGACAGCAGACTAGCATTTCATCACAGW3TCCGAGAG  AGTTTtaACAGCCACCTAGCATTTCAT AGTTTCACAGCCACCTAaCATTTCATCACAAGGC'X AGTTTGACAGCCGCC AirCTAiXATTTCATCACAAGGCCl.  ; AGAGAAAGAAGTG TT-U  3 GCTAAT GAA AGAGAGAA CAACAGCTTCTTACACXX.TATGAGCCA GCATAGGATGGATGA 3 GCC AAT AAA OCAGAAAA CAACTOCCTOTTACACCCTATGAGCCA GCATGGGATGGATGA A CAACTXX^CTOTTACACCCTATGAGCCA QCATGGGATGGATGA A CAACT\JCCTOTTACACCCTATGAGCCA GCATGGGATGGATGA GOT AGAAGAG GCC AAT AAA GGAGAAAA CAACTWCTWTACACCCTATCAGCCA GCATGGGATGGATGA GUT AGAAGAG liCCAAT AAA GGAGAAAA CAACTlXXTCTTACACCCTATGAGI.-CA »3T AGAAiyW Gi.VAAT AAA GGAGAAAA CAAC-TUCITTOTTACACCCTATGAGCCA GiTT AGAGGAC (WX'AAT AAA IMAGAAAA CAACTW.'CTOTTACACCCTATGAGCCA GOT ACAAIIAG GCC AAT AAA GGAGAAAA CAACTGCCTGTTACACCCTATOAOf.-CA GOT AGAGGAG GCCAAT AAA GGAGAAAA CAACT3CCTSTTACACCCTATGAOCCA  ^ GAT ft GAT ft GAT ft GAT  ACCAGT TGA G ACCAGT TGA G ACCACT TGA G  TTAGTGT O TTAGTOT O TTAGTGT O  TTAGTOT AGA AGTTTGACA!XCGCCTAIX.'ATTTC ATC ACXTHSGCCCGAGAG TTAGTOT TTAGTOT GGA AGTTTGACJ TTAOTCT GGA ACTTTGA( AGTTTGACAGCCACCTAG': AGAGAAAGAACTG TTAGTrtT G  TTACTOT \ CAACTGCCTGTTACACCCTATGAGCCA QCATGGGATQ3ATGA TTACTOT -TOCTTOCTACACXXTATWGGCCA GCATGGGATGGATGA TTAATOT ft CAACT3CTTGCTACACCCTATGGaCCA TTAATOT GAGAGAA CAACTGCTTGCTACACCCTATGGGCCA -GAGAGAA CAACToCTAGCTACACCCTATGGGCCA GCATGGGATGGATGA CC<: GGAGAAAGAAGTG T TTAATGT -GAGAGAA CAAi:HV*.TTOCTACACCCTATW#lCCA GCATGGGATGGATGA TTAATGT -GAGAGAA CAAiTRlCTTOCTACACCCTATGGOCCA IWATUOGATGGATGA TTAATGT -GAGAGAA CAACTlXTTIXTACAtXCTATOOGCCA OCATUTOATiaWTCA -GAGAGAA CAACTVXTTOCTACACCCTATGGOCCA GCATGOGATCGATOA C GGAGAAAGAAGTG GAGAGAA CAACTOCTTO^ACACCCTATGOOCCA GCATGGGATGGATGA C GGAGAAAGAAGTG -GAGAGAA CAACTGCTTGCTACACCCTATGGGCCA GCATGGGATGGATGA GAGAGAA CAACTGCTTt3OTACACCCTATGGGCCA C GGAGAAAGAAGTG GirCAAT GCA GGAGAGAA TAACAGCTTC3TTACACCCTATGAGCCA .""AiJCTTGTTACACCCTATAAGCCT  G G I AGTTTGACAGCC ACCTAGCATTTCATCACAAGGCCCGAGAO G I AaTTTGACAGCAGCCTAGCATTTCAT^ACAGGGCCCGAGAG G t AGTTTGACAGCAaCCTAGCATTTCATCACA<3GGCCCGAGAG I AGTTTGACAGCAGCOTAGCATTTCATCACAGGGCCCGAGAG G 11 . C  TAGCAlJCCTAGCATTTCATCACAGGraXi L C A G C A G C C T A G C A T T T C A T C A C A C JJGCCCGAGAG TAGCATTTCATCACAGGGCCCGAGAO LCAGCAGCCTAGCATTTCATCACAGGOCCCXiAGAG AGTTTGACAl AOTTTGAC AtnTTGACAGCCGCCTAGi: TVAC^3aTCGCCTAGCATTTC;  ACCACT TGA G  ACCACT TGA GCC A ACCAGT TGA GCC A ACCACT TGA GCC A  :ATTTCAGCACAAG<KCCGAGAG 3 GCCAAT GAG GGAGAGAA TAACAGCTTACTACACCCCATAAGCCT GCATGGGATGGAGGA FT AGTTTGACAGCCOCCTAGCATTTCAGCACAAGGCCCGAGAA ft OCT AGAAGAG GCCAAT GCA GGAGAGAA TAACAGCTTGTTACACCCTATGAGCCA ft GCT AGAAGAG GCCAAT GCA GGAGAGAA TAACAGCCTGTTACACCCTATGAGCCT FT AGTTTGACAGCCGCCTAUCATTTCAGCACAAGGCCCGAGAG ft TAACAGCTTGTTACACCCTATGAGCCA ft TAACAGCTTGTTACACCCTATGAGCCT CCT GGAGAGAGAAGTG T ft TAACAGCTTCTTACACCCTATGAGCCA ft GGAGAGAA TAACAGf.TTGTTACACCCTATGAGCCA CCC GGAGAAAGAAGTA C CAACAGI.TTC.1CTACACCCTATGAGCCT ACATGGI CAACAGCTTGCTACACCCTATGAGCCT 3ACAGCAAS7TAG';ATTTCAT 1AGAA CAACAGCTTGCTACACCCTATGAGCCT CATTTCATCACCTGGCCCGAGAG ft CAACAGCTTGCTACACCCTATGAGCCT ACATGGGATGGAGGA GCCAAT G A CAACAGCTTGCTACACCCTATGAGCCT A CAACAGC1TGCTACACCCTATGAGCCT LCAGCAAGCTAGCATTTCATCACGTGGCCCGAGAG C GGAGAAAGAAGTG C A CAACAGCTTGCTACACCCTATGAGCCT rAGCAAGCTAGCATTTCATCACGTGGCCCGAGAG C GGAGAAAGAAGTG CTAGTOT G A CAACArXrrTGCTACACCCTATGAQCCT :AGCAAOCTAGCATTTCATCACOT«aCCC<JAGAG C GGAGAAAGAAGTG CTAGTOT G A CAACAGCTTGCTACACCCTATGAGCCT SACAGCAAGCTAGcrATTTC)  ft GAT AGAAGAG G  .CCCTATGAGCCT I I'AGCTTGCTACACCCTATGAGCCT A M GGAGAGAA CAACTGCTTGTTACACCCTATAAACCA GCATGGGATGGATGA C A GGAGAGAA CAACTGCTTOTTACACCCTATAAACCA QCATGGGATGGATGA C  Appendix  TTAlTPrr GGA AGTTTGACAGCCGCI  128  MCEF  OCCACT GGA A  CAACTGCTTGTTACACCCTI OTC ACT GCCACT CAAOTJCTTGTTACACCCTATAAACCA GAA GGAGAGAA CAACTQCTTGTTACACCCTATAAACCA CAACTOCITOTTACACCCTATAAACCA CAACTGCTTGTTACACCCTATAAACCA ^ GAT AGAAGAG G CAACAGTCTCTTACACCCTATAAGCCA \ GOT AGAAAAG G G G A G A G A A CAACAOTCTOTTACACCCTATAAACCA 1GCT GGAAAAG G CAACAGTCTGTTACACCCTATAAGCCA  Q GCATGGGATGGATOA C ; GCATGGGATCGATCA C GCATGGGATO3ATOA C ; GCATGGGATGaATOA C : GCATGGGATGGATGA C ; GCATCWGATCGATGA C  TTCATCACATUGCCCGAGAG :MCAOCCGf^AGCATTACATCACATCGCCTOAGAG AGTTTGACAOC'CXXXTrAGCATITCATCACATCOC^^  TTAOTOT G  151 L52 L53 L54 L55 L56 L57  KCEIS.15 MCEtS.23 MCEI8.2G MCEiB.lOO P9 D i r e c t MCE#9.3 MCEI9.89  L59 160 L61 L62 L63 164 165 LG6 167 168 169 L70 L71 172 173  MTEI9.101 ML"E#9.104 MCEI9.29 MCE#10.89 KEtlO.22 MC£#1Q.23 MCEil0.24 WCEil0.25 MCEilO.28 MCEI10.30 MCEilO.83 MCEtlO.86 MCEilO.88 P63 D i r e c t MCEI63.1  175 176 177 L7S 179 LSO 181 182 L83 L84 185 L86 L87 188 L89 LSO L91 L92 L93 L94 L95 L96 L97 L98 L99 200 201 202 203 204 205 206 207 208 209 210 211  MCE*63.5 MCEI63.6 MCEI63.8 HCEIS3.10 MCEI63.11 MCEI63.12 MCEI63.14 MCE163.16 MCEI63.17 MCEI63.19 P l l Direct MCEill.l MCEtll.2 MCEI11.4 MCE*11.5 MCEI11.6 MCEtll.7 MCEI11-B MCEI11.9 MCEI11.10 MCBI11.11 MCEI11.12 »CE#11.13 P13 D i r e c t WTEI13 .23 H;E#13 .27 hCEfia .32 MCEI13.33 MCEI13.34 MCEI13.35 MCEil3.36 MCE*13.37 MCE#13.38 MCEI13.40 MCE#13.41 MCEI13.42 NCEI13.43  213 214 215 216 217 IIS 219 320 221 222  MCEI13.45 MCEI13.46 P14 D i r e c t MCE#14.9 MCE#14.15 MCE#14.22 MCE#14 .23 MCEI14.24 MCEI14.26 H3Etl4.30  224 225 226 227 228  MCEil4.33 MCEil4.43 MCEI14.44 MCEI14.49 P15 D i r e c t  230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246  MCEI15.5 MCEI15.6 MCEI15.7 MCEI15.9 HCEI15.13 MCEI15.14 MCEI15.16 MCEI15.27 MC.Eil5.2fl M3E115.29 P16 D i r e c t KCEI16.1 KCE(16.2 KCEI16.3 MCEI16.4 MCEI16.5 MCEI1G.6  248 249 250 251 252 253 254 255 256 257 258 259 260 261 2G2 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299  ^AGCAGIXTAGCATTCCGTCACATGl'ICCCG, MCEI1G.B WCE116.9 CAGCAGCTTGCTACACCCTATGAOCCA GCATGGGATGGAGGA C MCEI16.11 I t CAOCAOCTTGCTACACCCTATGAOCCA G C A T G G G A T G G A G O A C ACCAOT TGA GCC AGA G < MCEI16.13 rAGCTTATTACACCCTATOAGCCT GCATGGGATGGATGA C AGAOTCAGA GAA GGT AGAAGAG GCCAAT < PI8 D i r e c t ACCAOT AGA GTC AGA GAA GGT AGAAGAG GCCAAT l A GGAGAGAA CAACAGCTTATTACACCCTATGAGCCT GCATCGGATUGATCA C : GGAGAAAGAAOTG TTACAOT GGA MCEI18.6 TTACAOT GGA ACCAOT AGA OTC AGA GAA GGT AGAAGAG OCCAAT ( A Q3AGAGAA CAAe^GCTTATTACACCCTATGAOCCT GCATCGGATGGATOA C MCEtlS.7 TTACAOT GGA AGTTTGACAGCCGCCTAGCTTATCATCACATQGCCCGAGAG A G G A G A G A A CAACAGCTTATTACACCCTATaAGCCT GCATGGGATOGATO3 C OTC AGA GAA GGT AGAAGAG OCCAAT < MCEtl8.14 TTACAOT GGA AGTTTGACAaCTCGCCTACWlTATCATCACATSGCCCGAGAG A GGAGAGAA CAACAOCTTATTACACCCTATGAGCCT G MCE#18.16 AGTITOACAGCCGCOTAGCTrATCATCACATGGCCCGAGAG A G G A G A G A A l.' A ACAGCTTATTACACCCTATCAGCCT G MCEilB.19 C G G A G A A A G A A O T O MCE#1B.20 S G G A G A A A G A A O T G 3CTTATTACACCCTATGAGCCT TTACAOT G MCE*ie.21 C G G A G A A A G A A G T O 'AACAGCTTATTACACCOTATGAaCCT TTACAOT G GCCANT GAA GGAGAGAA MCEil8.22 CAACAOCTTATTACACCCTATGAGCCT TTACAOT G MCE#ie.27 ACTCTTOACAGCCGCCTAGCTTATCA^ GCATGGGATGGATGA CCC GGAGAAAGAAOTO MCEilB.29 A GCT AGAAGAG G C GGAGAAAGAAOTG TTACAOT GGA AGTTTGAC AGCCGCCTAGCTTATC ATCACATSO^CCGAGAG CAACAGCTTATTACAaXTATGAGCCT MCEtia.31 TTACAOT GG GA A ACTTTCACAG CAACAC7TTTATTACACCCTATGAGCCT MCEil8.33 TTAGCCT AG GA A AOTTTCACAGCCGCCTAGCATTTCAT CAACAGCTTOTTACACCCTATGAGCCA GCATAGGATQGATQA C P19 D i r e c t GA AGTTTV1ACA'>?COCCTAaCAlTTCATCACaTGOCX?CGAGAG CAACAOCTIOTTACACCCTATGAGCCA ; GGAGAAAGAAOTO TTAGCOT AOA MCEil9.1 GA AOTrTGACAOCCGCOTAGCATTTCATCATOTGaCCCGAGAG GCATAGGATGGATGA C MCEI19.13 I3TG TTAGCOT AG; IJAACAaCTTCTTACACCCTATGAai.'CA M3EI19.14 MCEI19.15 I AGTITGACAGCCGCCTAGCATTTCAT'.-AI CAACAGT7ITGTTACACCCTATUAGCCA GCATAGGATGGATGA C MCEil9.16 I AOTTTGACAGCCGCCTAGCATTTCATC CAACAGCTTGTTACACCCTATOAGCCA GCATAGGATOGATGA C MCEil9.17 ; 03AGAAAGAAGTC TTAtXXTT AGA AGTTTOACAGCCGCOTAGCGTTTCATCACGTOGCCCGAGAO OCTAAT G CAACAGCTTGTTACACCCTATGAOCCA MCEil9.18 OCTAAT O CAACAGCTTOTTACACCCTATGAGCCA GCATAGGATGGATGA ( ; GGAGAAAGAAOTG TTAGCOT AGA AGTTTGACA0CCGCOTAGCATTTCATCACt/TO3CCXrGAGAG MCEil9.19 ; GGAGAAAGAAOTO TTAGCOT AGA AGTTrGACAGCCGCCTAGCATTTCATCACGTGGCCCGAGAG GCTAAT G CAACAGCTTGTTACACCCTATGAOCCA MCEil9.26 ; GGAGAAAGAAOTG TTAGCOT AGA AGTTTGACAGCCaCCTAGCATTTCATCACGTGGCCCGAGM CAACAGCTTOTTACACCCTATGAGCCA ML"E#19.2B VCAQCCGCCTAGCATlTCATCACaTGaCCCGAGAG C GGAGAAAGAAGTa TTAGCCT A CAACAGCTTOTTACACCCTATGAGCCA MCE#19.29 rATTrCATCACGTGGCCCGAGAG C GGAGAAAGAAGTO TTAGCCT A CAACAOCTTOTTACACCCTATGAGCCA MCE#19.30 V3 TTAATOT G \ AGTTTGAC IXCTATGAGCCT GCATGGGATGGAGGA ( P20 D i r e c t MCEi20.6 CMCAGCTTGTTACACCCTATGAGCCT GCATGGGATGGAGGA C MCEi20.7 CAACAGCTTGTTACACCCTATOAISCCT GCATGGGATOGAGGA C MCEI20.8 CAACAGCTICTTACACCCTATGAOCCA GCATAGGATOGATGA C MCEI20.9 CAACAGCTTGTrACACCCCATOAOCCT OCATOJGATGO MCEI20.10 CAACAGCTTGTTACACCCTATCAOCCT GCATGGGATOGAOGA C !CEf20.11 r AGAAGAG GCCAAT O CAACAOCTTCTTACACXCTATUAOCCT GCATGGGATGGAOGA C MCE#20.25 CAACAGCTTOTTACACCCTATOAOCCT GCATGGGATOGAGGA C MCEI20.26 CAACAGCTTGTTACACCCTATOAQCCT aCATOGGATOGAGaA C MCE#20.27 MCE*20.28 GCATGGGATGGAGGA C MCEi20.31 P64 D i r e c t CAACAGCCTGCTACACCCTATATOCCA GCATGGGATAGATOA C MCEI64.1 CAACAOCCTGCTACACCCTATATOCCA G : GGAGAAGGAAGTG C T GGA AGTTTCACAGCCGCCTAGCATnCATVACAT^KCAAGAGAG MCEIG4.2 CAACAQCCTGCTACACCCTATATGCCA G : GGAGAAAGAAOTO CTAATOT GGA AGTTTaACAGCCGCCTAGCATITCATCACATGGCAAGAGAG MCEI64.3 CAACAQCTTGCTACACCCTOTATOCCA G : OGGGAAAGAAOTA CTAATOT OGA AGTTTOACAGCCGCCTA»XTTTCATCACATGaCAAGAGAG MCEi64.4 CAACAGCCTGCTACACCCTATATOCCA G : G G A G A A A G A A O T G CTAATGT GGA AGTTTGACAGCCCCCTAGCATTIXrATCACATGGCAAGAGAG ACCACC GAG MCEi64.5 CAACAGC7TTOCTACACCCTCTATOCCA G : GGAGAAAGAAGTACTAATOTGGA AGTTTGAC AO GCCACT GAG MCE#64.6 C'AACAGCTTGCTACACCCTCTATGCCA GCATGGGATGGATGA C ,CTAATGTGGA AaTTTGACAGCtrcCTAGcCTTTCAl MCE#64.7 CAACAGCTTGCTACACCCTATATV1CCA GCATOGGATAGATGA C 'CATVACOTGGCAAGAGAG MCEI64.9 CAACAGCCTGCTACACCCTATATWC/ MCEI64.12  L58 MCE#9IO .O  GCCACT EGA A  ACCAAT GGA A  ^ GAT AGAAGAG  \ GOT AGAAAAG G \ GOT AGAAAAG G H GOT AGAAGAG G  \ GOT AAAAAAG G  174 MCEI63.4  r GAG GGAGAGAA CAACAOCTTOTTACACCCTATAAGCCA P GAA GGAGAGAA CAACAGTCTGTTACACCCTATAAOCCA T GAG GGAGAGAA CAACAGCTTOTTACACCCTATAAGCCA T AAA GGAGAGAA CAACAGCTTATTACACCCTATOAGCCT T AAA GGAGAGAA CAACAOCTrATTACACCCTATCAOCCT T AAA GAAGAGAA CAGCGGCTTATTACACCCTATOAGCCT T GAA GGAGAGAA CAACAGCTTOTTACACCCTATAAGCCA T GAA GGAGAGAA CAACAGTCTOTTACACCCTATAAGCCA T AAA GGAGAGAA CAACAGCCTOTTACACCCTATOAOCCA T GAA GGAGAGAA CAACGTATIOTTACACCCTATGAACCA T AAA GAAGAGAA CAGCAGCTTATTACACCCTATGAGCCT C AAG GGAGAAAA CAACAOCTTATTACACCCTATGAGCCT T GAA GGAGAGAA CAACAOTCTOTTACACCCTATAAACCA T GAA GGAGAGAA CATCRTCTTOTTACACCCCATGAGCCA T GAG GGAGAGAA CAACAGC7ITGCTACACCCTATATGCCA  229 MCE#15.3  2 47 MCE*16.7  I AGTITGACAOCCX^CTAGCLATIT^ATCACAT*>XXX7GAGAG AGAGAGAGAAOTO AGAGAAAGAAOTO TTAATOT G I AGTTTGACAQCC QCCTGGCATTBTATCAC RTAOCCCGA GAG I AGTITaACAaCCGCCTGaCLATTTCATCACCTAOC^^ GGAGAAAGAAOTO TTAATGT G  : GGAGAGAGAAGTA ; : • ;  TTAOTGT G  \ AGTITGACAGTX^GCCTGGCATTTCATCACGTAG'.'CCGAGAG \ AGTITGACAAC«ACOT}^ATTTCATCATOTAACCCGAGAG ^GCCTGGCATTT^TCACOTAQCCCGAGAG KCACXWK.CTGGCATTII^GCACCTAC»M;AGAG  TTAATGT GGA  GGAGAGAGAAGTA GGAGAAAGAAOTG AGAGAAAGAAOTG GGAGAGAGAAGTG  \ aaTnXW^AGCCCKXTACKATITCATCACATGaCCCGAGAG ^ AOTTTC1ACAGCCGCCTAGCATTTCATC GCATGGGATGGA'I^JA C CTAATGT C \ AGTTTaACAaCCGCCTGGCATTTCAGC GCATGGOATGGATGA C GCATAGAATGGATAA C : GGAAAGAAAAOTA TTAATGT C \ AGTITAACAaCCGCCTGG<^TTn^TCACOTAGCCCAAGAA : GGAGAGAGAAGTA TTAATGT C \ AGTITaACACiCCGCCT«GCATrAC»TCACOTAGCCCGAaAA IkCAGCX^aCOTAGCATIT^TCACATaGCCCGAGAG GCATGGGATGGATGA C : AGAGAGAGAAOTG KCTAGCATTTCATCATATCWCAAAAGAG \ AaTTTGACAGCOGCCTAGCATrrcATCATATaGCAAAAGAG ^ AOTiraACAGCOXCTACCATTTCATCACATaaCAAGAGAG CAACAGCCTGCTACACCCTATATOCCA GCATGGGATAGATGA C 3 AGAGAAAGAAOTG T  CCC AGAGAGAGAAGTT.1 CTAGAAT GGA GATTTGACAGCCGCOTAGCATITCATCACATGGCCK.'GAGAG CCC AGAGAGAGAAGTG C CCC GGAGAAAGAAOTO T  A GGAGAGAA CAACTGCTTGTTACACCCTATGAOCCA ACCAGTTCAT  CAACAGCTTCCTACACCCTATATGCCA CAACnSCTTATTACACCCTATQACX'CA CAACTGCCTGTrACACCCTATCAGCCA H GAT AGAAGAG GCCAAT AAA GGAGAGAA CAACT13CTTGTTACACCCTATOAGCCT K GAT AGAAGAG OCCAAT AAA GGAGAGAA CAAOTiX-TTOTTACACCCTATOAGCCT \ GAT AGAAGAG f>CCAAT AAA GGAGAGAA CAACTGCTTGTTACACCCTATGAGCCT GGAGAGAA CAACTGCTTGTTACACCCTATGAGCCT aCCAAT AAA 0 UCCAAT AAA GGAGGGAA CAACTGCTTGTTACACCCTATGAGCCT h GAT AGAAGAG OCCAAT AAA GGAGAGAA CAACTGCTTGTTACACCOTATOAGCCT \ GAT AGAAGAG GCCAAT AAA GGAGAGAA CAACTGCTTGTTACACCCTATC»aCCT h GAT AGAAGAG OCCAAT AAA GGAGAGAA CAACIGCTTOTTACACi^CTATGAGCCT GGAGAGAA CAACKXTtTOTTACACCCTATOAGCCT GCCAAT A GGAGAGAA CAACTGCTP3TTACACCCTATCAGCCT OCCAAT A GGAGAGAA CAACTGCTIOTTACACCCTATOAGCCT CAACTGCTTGTTACACCCTATGACKCT OCCAAT A  C AGAGAAAGAAOTG TTACAOT GGA TTAOTGT GGA GCATGGGATGGAGGA CCC I TTAGTGT G 1 TTAfJIOT G GCATGGGATGGAGGA C : GGAGAGAGAAGTG TTAGTGT G ; GGAGAGAGAAGTG T GCATGGGATGGAGGA C  GCATGGGATGGAGGA C  GCATGGGATGGAGGA C : GGAGAGAGAAGTG TTAGTGT GCATGGGATGOAaGA C : GGAGAGAGAAGTG TTAOTGT GCATGGGATCGAGGA C J GGAGAGAGAAGTG TTAOTOT ; GGAGAGAGAAGTG 1 ; GGAGAGAGAAGTG 1 ; GGAGAGAGAAGTG TTAGTGT  A CAACOTATTCTTACACCCTATGAGCCA G A CAACGTATTaTTACACCCTATGAGCCA GCATGGGATGGATGA A CAACOTATTGTTACACCXTATOAOCCA GCATGGGATGGATOA A AOT AGAAGAG GCCAAT GAA GGAGAGAA CAACCTATTGTTACAKXTATOAGCCA GCATOaGATGGATGA A CAACOTATTGTTACACCCTATGAGCCA GCATGGGATOGATGA r GAA GGAGAGAA C A CAACGTATHJITACACCCTATGAGCCA GCATOOGATGOATGA A CAACOTATTGTTACACCCTATOAGCCA GCATGGGATGGATGA G i UCCAAT GAA GGAGAGAA CAACGTATTGTTACACCCTATGAaCCA C A CAACGTAirGTTACACCCTATGAGGCA Q A CAACGTATTGTTACACCCTATOAOCCA GCAIGGGATGOATGA A CAACOTATTGTTACACCCTATGAGCCA GCATGGGATGGATGA ?. GCCAAT GAA  iACAGCAACCTAGCATTTCGTCAl iACAQCAACCTAGCATTTCGTCACaTGGCCCGACGG ^AQCAACCTAGCATTTCGTCACaCGGCCCGAGAa LCAGCAACCTAGCATTTCX/rcACOT^jGCCCGAGAG G LCAGCAACOTAGC^TTTCGTCAC>OT^>XJCCCGAGAG G G v OGTTTOAC AGCAACCTACSC ATTTCOTCACOT13GCCCGAGAG rCGTCACGTQGCCCGAGAG  Q  A AGTTTGACAG'.VOfOTACCATrTCATCACAT'SGCCCGAGAG A AGTTTCACAGCX^XTGaCATrTCATVACATGGCCCGAGAG A AGTTTCACAGCCGCCTAGCATTTCATC  C C ; AGAGAAAGAAOTG C C J AGAGAAAGAAOTG TTAATOT G C I AGAGAAAGAAGTG CTAATGT G C 1 CTAATGT G C ; AGAGAAAGAAOTG  aACAGCCGCCTAGCATTTW  C C : AGAGAAAGAAOTG TTAATGT G MCAGCCGCXTAGCATTTCATCACATCGCCCGAGAG ; AGAGAGAGAAGTG CTAATOT G lCAGCC«CCTAGCATm:ATCACATOTCXCaAGAG ] TTAATOT G CAACOTATTGTTACACCCTATGAOCCA GCATGGGATO3ATOA q I AGTrTGACAG CAAQJTATTOTTACACCCTATGAGCCA f. CAACOTATTOTTACACCCTATGAGCCA t I AGTrTGACAGCCGCCTAGCATTTCAT ; AGAGAAAGAAGTG CAACOTATTOTTACACCCTATGAOCCA c.  212 MCEI13.44  223 W:E#14 .32  GCATGGGATGGATGA C GCATGGGATGGATGA C GCATGGGATOGATUA C GCATGGGATGGATGA C GCATGGaATGGATOA C GCATGGGATGOGTGA C GCATGGGATGGATGA C aCATOGGATGOATQA C  AGAGAGAGAAGTG  1998  GACAGCAGCOTAGCACTTCGTVJ  Z AGAGAAAGAAGTG ^ GCC AGA CH7A GOT AGAAGAG G \ GCC AGA GCA GCT AGAAGAG G h GCC AGA GCA GOT AGAAGAG G  A GGAGAAAA CAACAGCTIOTTACACCCTATGAGCCA G A GGAGAAAA CAACAGCTTOTTACACCCTATGAGCCA G A GGAGAAAA CAACAGCTTOTTACACCCTATGAGCCA GCATGGGATGGATGA CCC AGAGAAAGAAGTG TTAGTGT G H CAACAGCTrOTOACACCCTATGAOCCA GCATGGGATGGATOA CCC AGAGAAAGAAOTG TTAOTGT Q K CAACAGCTIOTTACACCCTATGAGCCA GCATGGGATGGATGA C A GGAGAAAA CAACAOCTIOTTACACCOTATGAOCCA GCATCGGATO3ATCA C A GGAGAAAA CAACAGOTTGTTACACCCTATOAOCCA OCATGGGATOGATGA CCC AOAGAAAGAAGTO TTAGTGT G  Fl CAACAGCCTCTTACAACCTATAAGCCT CAACAGCCTGTTACACCCTATGAI3CCT CAACAUCCTGTTACACCCTATOAaCCT I GGAGAGAA CAACAGCTIOTTACACCCTATGAOCCT * GAA AGA GCA GOT AGAAAAU OCCAAT 0 CAACAGCCTGTTACACCCTATGAGCCT I GGAGAGAA CAACAGCCTOTTACACCCTATGAGCCT CAACAGCTTGTTACACCCTATiyiaCCT CAACAGGCTGTTACAACCTATGAGCCT A GAA AGA GCA CAACAGCCTGTTACACCCTATGAGCCT  >  TTAATGT G GAATGGATTGGGGGA CCC GGGGGGAGAGOTC TTATTGT G 1 AGTTGIJVAAOCCACOTGaCCTCCCATCACAAGGt'IX GCATGGGATGGAGGA CCC GGAGGGAGAAOTA TTAATGT G 1 AOTTTOACAGCCACOTAGCCTTCCAT 1 AOTTTOOCAGGCACCTAGCCTTCCAT GCATGGGATGGAGUA CCC \ AOnTGOCAG GCATCGGAT^XIAOGA CCC GGAGGGAGAAGTA 1 ^AGCCACOTAGCCTTCCATCACAAGGCCCGAGAG GCATGGGATOGAGGA CCC GGAGGGAGAAOTA CTAATGT C KACKX-ACCTAGCCTTCCATCACAAOGCCCGAGAO GCATOSGATGGAGGA CCC GGAGGGAGAAGTA CTAATOT I. TTAATOT C QCATOCSGATQGAOOA CCC TTAWTOT t GCATOSGATOGAGGA CCC GCATGGGATOGAGGA CCC  A 'KA A'lA GCA GOT AGAAAAi," 'JT"AAT A GCG AGA <JCA GOT AGAAAAG flCi.'AAT  CMCAGCTTGTTACACCCTATOAI3CCT CAGCAGCTPGCTACACCCTAT'iJ\OCCA GCATGGGATGGAGGA CTC CAGCAGCTTCCTACACCCTATGAGCCA GCATGG -ATGGAGGA CTC CAGCAGCTTGCTACACCCTATCAOCCA GCATGGGATGGAGGA CTC GAA GGAGAGAA CAGCAGCTTOCTACACCCTATGAGCCA GCATOGGATGGAGGA CTC GGAGAGAGAAGTG CAGCAOCTTGCTACACCCTATCAGCCA GCATGGGATGGA03A CTC GAA GGAGAGAA CAGCAGCTTGCTACACCCTATGAOCCA  X rH3GCCCGAGAG  AGTTTGACAG'.-A' AGTTTGACAGCAGYOTAGCATITCGYCACOTaOTCCGAGAG AGTTTGACAGCAGCCTAGCATIT^OTCACGTG<KX7CGAGAG AOTTTGACAGCAOCi^AGCATTT>IXITCACOTW>XXXIAGAG  JCCTTCCATCACAAGGCCCGAGAG \ AGTTTGACAGCAGCOTAGCATICCOTCACATGGCCCGAGAG  \ \ ^ \ CTC GGAGAGAGAAGTG TTAAAGT C ^  Appendix  AGTTTGACAaCAUCCTAGCATTCttriVACATGGCCCGAGAG AC71TTGACAGCAGCOTAGCATnXOTCACATGGCCX?GAGAG AGTJTGACAGCAGCOTAGCATTCCGTCACATCGCCCGAGAG AGTTT*5JWAGCAQCCTAGCATIVJCGTCACATGGCCCGAGAG AGTTNGACAGCAGCCTAGCATNCCGTCACATGACCCGAGAG  129  MCEF  irllx B.3A.11L' P6B D i r e c t MCE#fi8.2 MCE#68.3 MCE*68.10 MCE168.11 P69 D i r e c t TCC AGA TAA C MCE#69.1 MCE* 6 9 . 3 MCE169.6 MCEJ69.23 MCE*69.27 ft GOT AGAAGAG G P73 D i r e c t GCCACT HGA C MCEI73.1 MCEI73.2 HCEI73.3 ft GOT AGAAAAG G MCE#73.4 MCEI73.5 MCEI73.6 MCEI73.8 MCEI73.9 KCEI73.11 MCE#73.12 »CE#73.15 ft GOT AGAAAAG G P22 D i r e c t HCEI22.7 MCE#22.12 ACCAGT TGA G MCE*22.13 MCE#22.14 MCEI22.19 MCEi22.27 MCEI22.28 MCEI22.3 0 MCEI22.31 MCEI22.32 MCE#22.33 P24 D i r e c t MCEI24.1 MCEI24.2 MCE#24.3 MCE#24.9 HCEI24.10 MCE*24.12 MCEI24 .17 MCEI24.18 ft GOT AGAAAAG <3 MCEI24.26 P25 D i r e c t MCE#25.5 ft GOT AGAAAAG G MCEI25.4 HCEI25.6 MCE#25.7 MCE*2S.H MCEI25.10 3 GCTAAT MCE*25.12 MCE#26.1 MCE#26.3 MCEi26.4 MCEI26.5 ft GAT AGATGAG GCCAAT MCEI26.6 A GAT AGAAGAG GCCAAT MCEI26.8 ft GAT AGAAGAG GCCAAT MCE*26.10 MCEt26.13 MCEJ2G.20 (CE#26.21 MCEI26.21 KCEI27.3 MCEI27.4 MCE#27.7  « HAGAAAATTOTTAHAi>.'CTATGAGCCT GMATGGATATGGTTG ft(.' ATTCTT ACAi.1 .'c .TATCAI3CCT ftTATTOTTACAI.1 .'CTATGAGCCT ft CAGCACATTGTTACACCtVATGAGCCT ft GGAGAGAA CATCHTCTTlCTTACAlX'iXATGAGCCA ft CAACATCTTGTTACACCCCATGAGCCA ft CAACCTCTTOTTACACCCCATGAGCCA ft CTAACGTCTTCTTACACCCCATGAGCCA A GGAGAGAA CAACGTCTTOTTACACCCCATGAGCCA A GAAGAGAA CATCAGCTTGTTACACCCTATGAGCCA A GGAGAGAA CHAUT^NTGCTACACCCGATGAGCCA ft CAACTGCTTUCTACACCCCATaAGCCA ft CjAACTOSCTGCTACACCCGATGAGCCA ft CAACTOCCTOCTACACCCGATGAGCCA GCATGGGATGGATGA ft CAACTGCCTOCTACAJICCIIATGAGCCA GCATNGGATGGATGA ft CAACTOCCTGCTACAHCCGATGAGCCA GCATOJGATGGATGA ft TAAATGCTMCTACACCCGATGAGCCA ft CAACTQCTTOCTACACOCGATGAGCCA ft CAAACTTCTTaarrrACACCCGATGAGC ft CAACTOCCTOCTACACCCGATGAGCCA ft GGAAAGAA CAAATtXTTOCTACACCCGAT<iWJCCA  GAA tl  A A A  iCCTJGCCCGAGAG  ACC L  CCC AGAGAGAGAAGTG CCC AGAGAAAGAAGTG CCC AGAGAGAGAAUTU CCC AGAGAAAGAAGTG CCC AGAGAGAOAACTG CCC AGAGAAAGAAGTG CCC AGAGAAAGAAGTG CCC AGAGAAAGAAGTG CCC AGAGAAAGAAGTG CCC AGAGAAAGAAGTG CCC AGAGAAAGAAGTG CCC AGAGAAAGAAGTG  CTAGAGT 0 CTGCAGT G T AGTTTGACAGCCGCCTAGCATTTCATCACATGGCCCGAGAG CTGCAGT G I AGTTTGACAGCCGCCTAGCATTTCATCACATGGCCCGAGAG I AGGTTGACAGCCGCCTAGCATTTCATCACATGGCCCGAGAG I AGTTTGACAGCCGCCTAGCATTTCATCACATOACCCGAQAG I GGTTTGACAGCCTGCCTAGCATTTCATCACATUGCCCGAGAG ;ATTTCATCGCATOGCCCGAGAG  TTAGAGT ITTTCATCACATOaCCCGAGAa TTAGAGT -AGGCGCCTAGCATTTCATCACATaGCCCaAaAG TTAGAGT rAGCCGCCTAGCATTTCATCACATOOCCCaAGAG TTAGAGT 'AGCCGCCTAGCATTTCATCACATGOCCCGAGAG TTAGAGT GGA ACTTTGACAGCCGCCTAGCATTTCATCACATGQCCCQAGAG AGT GGAGGTGCAGCt^CCCTAGAATTTCACACATGGCCCCAAAAG ATCACATaGCCCGAGAG C AGAGAAAGAAOTG T S AGAGAAAGAACTG T C AGAGAGAGAAGTG T IZ AGAGAGAGAAGTG T  ft GGAGAGAA CAACTGCTTGTTACACCCCATMGCCT ICCCCATAAGCCT  CAACTGCTTGTTACACCCCATAAGCCT CAACTGCTTOTTACACCCCATAAGCCT CAACTQCTTGTTACACCCCATAAGCCT CAACTGCTTGTTACACCCCATAAGCCT CAACGTCTTGTTACACCCTATGAGCAT CAACCTCTTaTTACACCCTATOAGCAT CAACGTCTTGTTACACCCTATGAGCAT CAACOTCTTOTTACACCCTATGAGCAT CAACGTCTTGTTACACCCTATGAGCAT CAACGTCTTGTTACACCCTATGAGCAT CAACOTCTIOTTACTCCCTATGAGCAT CAACGTCTTGTTACACCCTATGAGCAT CAACGTCTTGTTACACCCTATGAGCAT CAACGTCTTGTTACACCCTATGAGCAT CAACAGCTTaTTACAYCCTHTGAGCCA  GCATGGGATGGATGA CCC GCATGGGATGGATGA CCC GCATGGGATGGATGA CCC GCATGGGATAGACGA  AGTTTGACAGCAGCCTAGCCCGTCACCATAAGGCCCGAGAa AGTTTGACAGCAGCCTAGCCCt.TCACCATAAGGCCCaAGAG AGTTTGACAGCAGCCTAGCCCGTCACCATAAGGCCCGAGAG AGAGAGAGAAGTG GGAGAAAGAACTG GGAGAAAGAAGTG GGAGAAAGAAGTG  TTGCAGT TTAATGT TTAATGT TTAATGT  GCATGGGATAGACGA CCC GGAGAAAGAAGTG TTAATOT GCATGGGATAGACGA CCC GGAGAAAGAAGTa TTAATOT 1AAOTG TTAATGT GCATGGGATAGACGA CCC TTGATCT GCATGGGATAGAAGA CCC TTAATGT GCATGGGATAGACGA CCC  GGA GGA GGA GGA  AGrTrGACAGCAGCCTAGCCCGTCACCATAAGGCCCGAGAG AGTTTGACAGCCGCCTAGCATrTCATCACGTaGCCCGAGAG ACTTT^CAGCCGCCTAGOATTTCATCA CC/IXJGCCCGAGAa AGTTTGACAGCCGCCTAGCATTTCATCACGTGGCCCGAGA^  GGA AGCATTTCATCACGrOGCCCGAGAa GGA GGA rAGCCGCOTAGCATTTCATCACOTGOCCCGAGAG (CA GGA ACTTTGACJ ITTrCATCACATGaCCCGAGAO  A CAACTGC-ITOTTACACCCTATGAOCCA ft C'AACTGCTTGTTAi ft CAACTfJiTlTIiTTACACI CAACTUCTTUTTACACCOTATGAGCCA CAACAGCTTGTTACATCCCATGAGCCA CAACAGCCTGTTACACCCTATGAGCCA CAACAGCCTGTTACACCCTATAAGCCA CAACAGCTTGTTACACCCTATAAGCCT  1998  GCATGGGATGGATGA GCATGGGATGGATGA GCATGGGATGGATGA GCATGGGATGGAGGA  CCC CCC CCC GGAGAAAGAAGTG CCC GGAGAAAGAAGTA  GGAGAAAGAAGTA  •ACAT X1CCCGAGAO TTACTAT GGA TTAGAOT GGA GGTTTGACAGCCGCCTAGCATTTCATCACATIjaCCCGAGAG ATCACATGGCCCGAGAG TTAOTOT GGA TTACAOT GGA TTAGTOT GGA  MCE#27I.I  «:E#27.15 MCE#27.21 MCEI27.22 MCE#27.24 MCE#27.25 MCE#27.30 MCE*27.31 MCEI28.1 MCEI28.2 MCEI28.3 MCEt28.4 MCEI28.5 MCE*28.6 MCEI28.7 MCE*2fi.8 MCE#28.9 MCEI28.10 J85 MCE#28.11 1H6 MCE*28.12 J87 K C E I 2 9 . 2 MCE429.3 ) MCEI29.4 ) MCEI29.5 . MCEI29.6 ! MCEI29.8 I MCE*29.9 1 MCE*29.10 i MCEi29.ll i MCE*29.12 ' MCE#29.13 ! MCEi30.1 ) MCE*30.2 ) MCEI30.3 , MCEI30.5 ! MCEI30.6 I MCE*30.7 I HCE130.8 i MCE»30.11 i MCEI30.16 r MCEI30.17 t MCEI30.18 I 57 D i r e c t > MCEIS7.1 L MCEI57.2 i MCEI57.3 I MCE#57.4 I MCEI57.5 i MCE*57.6 i MCEi57.7 1 MCE* 57. 8 3 MCE* 57. 9 » MCEI57.10 ) MCE*57.12 L MCEI57.13 ! PSS D i r e c t ) MCE#58.1 I MCEI5B.2 5 MCE#58.3 S MCE*58.4 7 MCE* 58. 5 3 MCE*58. 6 ) MCE*59.7 J MCE*58.8 1 MCEI58.9 1 MCE*58.10 ) MCE*58.11 1 MCE*58.12 5 P59 D i r e c t S MCE*59.1 7 MCEI59.2 B MCEI59.4 9 KCEI59.20 0 MCE*59.21  1 MCE*59.22 2 3 4 5 6 7 8  ft GOT AGAAGAG G  ACCACT CGA G  ; AGA GAA GAT ; AGA GAA GAT Z AGA CAA GOT  MCEI59.24 •CCAGT TGA GCC MCEI59.25 MCE*59.26 MCE*59.28 MCE*59.29 P 62 D i r e c t | MCEI62.1  T  •GAGAAGTG TTAATGT TTAATOT TTAATOT TTAATGT TTAATOT  GGAGAAAGAAGTG CAACOTATTGCTACACCCTATGAGCCA GGAGAAAGAAOTG CAACOTATTOCTACACCCTATGAGCCA GGAGAAAGAAGTG CAACOTATTGCTACACCCTATGAGCCA CAACOTATTGCTACACCCTATGAGCCA CAACOTATTGCTACACCCTATGAGCCA GCATGGGATGGATGA CCC CAACCTATTGCTACACCCTATGA(3CCA CAAC<rrATTGCTACACCCTATGAGCCA GCATGGGATGGATGA CCC CAACOTATTGCTACACCCTATCAGCCA CAACCTATTGCTACAOT.TATGAGCCA GCATGGGATGGATGA CCC CAACOTATTGMTACACCCTATGAGCCA CAACOTATTGCTACACCI C AACfiT ATTGCTAI rACCI  ft CAACAGCTTaTTACACt.1 ft CAACAGCTTGTTACACCCTATGAGCCT GCATGGAATGGAGGA c ft CAACAGCTTGTTACACCCTATGAGCCT i A GGAGAGAA CAACAGCTTGTTACACCCTATGAGCCT C A G GAGAGAA CAACAUCTTUTTACACCCTATGAGCCT C A GGAGAGAA CAACAGCTTGTTACACCCTATGAGCCT C AGAAGAG G A GGAGAGAA CAACAGCTTGTTACACCCTATGAGCCT GCATGGAATGGAGGA t ft CAACAGCTTGTTACACCCTATGAGCCT ( AG--GAG G ftCAGCTTOTTACACCCTATGAGCCT t ft GGAGAGAA CAACTGCTTGTTACACCCTATGAACCA 1 AGAAGAG G ft GGAGAGAA CAACTGCTTGTTACACCCTATGAACCA C ft GGAGAGAA CAACTGCTTGTTACACCCTATGAACCA ( ft GGAGAGAA CAACTGCTTGTTACACCCTATGAACCA ( AGAAGAG GCCACT C ft GGAGAGAA CAACAGCTTOITACACCCTATGAGCCT i A CAACTGCTTGTTACACCCTATGAACCA ( A CAACTGCTTGTTACACCCTATGAACCA 1 ft GGAGAGAA CAACT3CTTOTTACACCCTATGAACCA GCATGGGATGGACGA ( CAACTGCTTGTTACACCCTATGAACCA GCATGGGATGGACGA i  G G C AOTTTGACAGCCGCCTAGCATTTCA1 A i AGTTTGACAGCCGCCTAGCATTTCATCACGTtlGCCCGAaAG O i A<7TTTX^CAGCCtX^CTAlX?ATTTC ATCACC7IXXSCCCGAGAa i AGTTTGACAGCCGCCTAGCATTTCATCACGTGGCCCQAGAG TTAATCT GGA AGTTTGAC;  TTAGTOT ( ft AGTTTGAC AGCCGCXTTAGCATTTC ATCAC* rTGGCCCGAGAG IVATCACOTl-lGCCCGArlAG TTAATOT 1 rcATCACGTGGCCCGAGAG TTAATOT r TTAGTOT I  LGI .33AGAAOTG TTAGAGT G AITTTTGACAGCCACCTAGCATT tCGTCACA rCATCACAGGGlXC • TTAJTGT G JATTTCGTCACATa-JCCCaAtJA a TTAGACT G JATTTcaTCACATGGCCCGAGA •• GGAGGGAGAAGTa TTAGAGT G Z GGAGGUAGAAGTa T 3 GGAGGGAGAAGTG T ; GGAGGGAGAAGTG TTAGACT G .* GGAG15GAGAAOTG TTAGAGT Ii Z GGAfKGAGAAGTG 1 Z GGAGGGAGAAGTG T , AGTTTGACAGCACCCTAGCATTTCATCACAGGGCCCGAGAG ; GGAGAGAGAAGTG T 3 GGAGAGAGAAGTG TTAGTOT G I AGTTTGAC AG  ACCCTATGAGCCA  . AGCTTGACAG I AGTTTGACAGCCACCTAGCATTTCOTCACATGGCCCGAGAG  'AGCACCCTAGCATTTCATCACAQG •ATCACAGGGCCCGAGAG rATCACAGGaCCCGAGAG  T GGA GATTTGACAGljrGCCTAlJC  9 MCE#62.2  Appendix  130  MCEF  ..3A.Hl/1 150 MCEI62.3 151 MCEI62.S 152 M C E I 6 2 . 6 153 MCEIG2.7 154 MCEI62.B 155 MCE462.10 156 MCEI62.11 157 P65 D i r e c t i HCEI65.5 159 MCEI65.9 160 P31 D i r e c t 161 M C E I 3 1 . 1 162 MCEI31.3 163 MCEI31.5 I MCEI31.6 165 H C E I 3 1 . 7 166 MCEI31.6 167 MCEI31.10 168 M C E i 3 1 . l l 169 MCEI31.12 ) MCEI31.13 171 M C E i 3 3 . 2 172 MCEI33.4 173 H C E I 3 3 . 5 174 M C E I 3 3 . 6 175 M C E I 3 3 . 8 176 M C E i 3 3 . 1 0 177 K C E i 3 3 . l l 178 » ; E i 3 3 . 1 3 179 MCEI33.14 ) MCEi33.15 ,81 MCEi33.1B [482 P34 D i r e c t |483 H C E I 3 4 . 1 1 MCEi34.2 U85 MCEI34.3 U86 M C E i 3 4 . 4 r»87 M C E I 3 4 . 5 I MCEI34.6 89 M C E i 3 4 . 9 |490 MCE#34.10 L MCE*34.11 192 MCEi34.12 193 MCEi34.13 194 ML*Ei35.16 195 MCE#35.1B 196 H C E i 3 5 . 3 1 197 1*:E#35.32 198 P36 D i r e c t 199 MCE#3 6 . 1 ) KCE13 6 . 2 501 MCEI36.3 502 MCEI36.4 503 M C E i 3 6 . 5 504 M C E i 3 6 . 6 305 M C E i 3 6 . 7 506 MCEi36.10 507 MCEi36.11 508 P39 D i r e c t 509 MCEI39.1 ) MCEi39.10 L MCEI40.3 fel2 MCEI40.4 |513 MCEI40.6 I MCEt40.a 515 MCEi40.14 516 MCEi40.15 517 WCEi40.17 518 MCEi40.18 519 MCEi40.19 520 LTNP1451 521 LTNP1750 522 LTNP2402  A CJ\TTTOACACfcX*JCCTAOCATTIVATX; ACATt^GCCCtlAGAG  \ CAACTWTIOTCACACXXTATGAQCCA  A GATTTGACAG A GATTTGACAGfX^GCCTAGCATTTVATCACATGaCCCGAGAG  GGAGAGAA CAACTGCTT\7ITACACCCTATGAGTCA ACATGGGATGGATGA C  A GATIT>3ACAGtXXKOTAGCATTTCAT>CACATOC<»rcJAGA0 A :^TTTl!ACAOCOXXrrAaCATTTCATrACAU<JU<XWJft[JArJ  CAATTOCTTGTTACACX'CTATGAGCCA GCATGGGATGGATGA C GAGAA CAACTOCTTGTTACACCCTATGAGCCA 0 liAGAA CAACTOCTTOTTACACCX.TATGAGCt.-A G GAGAA CAALTUCTTlJTTACAtX'  ACCAOT 1UA GCC A  1998  A AGTTTGACAC^KCTAGCATTTCATVACAT^ A ATMTOACAGCCGCCTAL^.'TTTCATCACATGGCAAIWGAG A AGTITCACAGCCOCCTAOCATTTCATCACATGCJ.OTGAGAG TCGCCTAOCATTTCATCACATGGCCCGAGAG  3 GGAGAGAGAAGTG  GCCAAC liAA < CCTATAAGCCT (. V AGAAGAG GCCAAT G  IAGAGAGAAGTG T  T AGAGGAG GCCAAC GAA I  GCCAAT GAA 0  'ATL-ACATGG'.'CCGAGAG inTCATCACATGGCCCGAiJAG :ATCACATGGCCCGAGAG 'ATCACATVIGCCCGAGAG  it TTiyTTAC ACCCTATAAGCC A  ACCAOT TGA <•  GCCAAT GAA • GCCAAT GAA f AGAAGAG GCCAAT GAA GCCAAT GAA GCCAAT GAA GCCAAT GAA GCCAAT GAA GCCAAT GAA GCCAAT AAA GCCAAT GAA GCCACT GAA  Z AGAGAAAGAAGTC TTACAGT C \ AGTITXIACACXVCiTCTlS^ATTTVATt'ACATGtKX'CXlAGAG  CAAATGCTTOTTACACCCTATAAGCCA CAAATOITTCTTACACCCTATAAGCCA CAAATGC-TTOTTACACCCTATAAGCCA CAAATOCTTCTTACACCCTATAAGCCA GCTIXTITACACCCTNTMGCCT CAACAGCTTOTTACACC'CTVRAAGCCT CAACAGCTIXJITACACCCTATAAGCCT CAACAOCTTGTTACACCCTOTAAGCCT CAACAGCTIOTTACACCCTATAAOCCT CAACAOCTTOTTACACXXTGTAAGCCT  GCCAAT GAA  ACCAOT TGA CCA A  AGTTTGACAWX'OiJCTAi  "AAATGCTTGTTAi" rAAATGCTTGTTAt. CAAATGCTTiTTTAf CAAATGCTTOTTACAi/CCTATAAGCCA CAAATGCTTOTTACACCCTATAAOCCA  GGAGAGAA GGAGAGAA GGAGAGAA GGAGAGAA GGAGAGAA GGAGAAAA GGAGAGAA GGAGAGAA  Z AGAGAAAGAAGTG TTACAGT C \ AGTTTGACAG a TTACAGT C A TTACAOT C \ AGTTTGACA  \ AGTITGACACXX\»CCTAOCATTTVATVACOTAGCCCGAGAG \ AGTTTGACAGCCOCCTAGCCTTTCATCACGTAG<X^CGAGAG \ AGTICGACAGCCGCOTAGCATTTX7ATCACGTAGCCCGAGAG AtXX^XCTAOCATTTCATCACOT'AOCXrGAGAa  CAACAGCTTGTTACACCCTATAAGCCT GCATGGGATGGAGGA C CAACAGCV11.TTACACCCTGTAAGCCT U CAACAOCTTIJTTACACCCTATAAOCCT G CAACAGCTTGTTACAiXCTWTAAGCCT G CAACAGCTTVTTACACCCTOTAAGCCT GCATGGGATGGAGGA C CAACAGCTTVITACACCCTCTOAGCCA GCATGGGATGGATGA C CAACAACTTOTTACATCCTATGAOCCT G CAACTGCTTOTTACACCCCATAAGCCT G  K AGTTTGACAaCCGCCTAGCATITCATCACATWXXXXJAGAa  A GGAGAGAA CAACAUCTTGTTACACXXTATyAOCCT CAArrAW.TTlJTTACACCCTATGAaCCT GCATVJGAATG'JAGGA C CAACAOCTTGTrACACCCTATaAGI.'CT G CAACAGCTTaTTACAO.VTATCAaCCT G CAACAGCTTGTTACACi. C GGAGGGAGAAGTG T ;CTATGAGCCT .•CTATGAGCCT ;CTAT1AGCCT  ACCAGT T1A II  & GGT AGAAGAG  'CTGTTACAC1. 'CTGTTATACCCTATGAGCCA 'CTGTTATACC CAAi.-AilCTTGTTACACCi GCATGGGATGGAGGA C CAACA*-17WTTACACCCTATGAG1.'I  CAACACSCCTGTTACACCCTATGAGCCA CAACAGCC7I>3TTACACCCTATGAGCCA CAACAGCX.TOTTACACCCTATGAGCCA CAACAGCCTGTTACACCCTATCAGCCA G GCTAAT GAA GGAGAGAA CAACAGCTTGTTACACCCTATGAGCCT ^TTGTTACACXCTATUAGCCT CAACAGCTTGTTACACCCTATOAOCCT  TTAGAGT GGA G  : GGAGAGAGAAGTG T G G C TTAGAGT GGA G GCATGGGATCGGTGA C OCATGGAATQGAAGA C ! ATAGAGAKAAGTG GCATGGAATGGAAGA C : AGAGAAAGAAGTG G ! AGAGAAAGAAGTG  Appendix  raXTOtKATTTCATCACATOlJCI.-CGAGAG RCATCACATQGCCCGAGAG ::ATTTCATCACATGGCCCGAGAG  TTAGAGT GGA G  ITTTCATCACATGGCCCGAGAG JCATTTCATCACATGOCCCGAGAG iCAOCTJOCCTAGCATTICATCACATGGCCCGAGAU 'AOCCXICCTACCATTTCAHCACOTASCCCGAGAG 'AGCCGCCTAGCATTTCACCACGTAOCCCGAGAO ^TTTCACC ACGTAGCCCGAGAG  131  MCEF  U 1 2 Mot l f 3 LAKL CON A 4 LAKL C O B D 5 LAKL C O S B « HIVXB2 7 • PI Direct » KCGI1.3 10 MCE#1.4 11 HCEI1.5 12 H C E I l . i 13 HCEI1.7  14 HCEIl.l  r  'r  4  CkcoskocTTTcTkCkk-ooa kci iia-ucroojOkCTTTCC koocokooiOTOOkCTOOfCflflkkT CkCCOkOCTTTCTkCkk-000 kCI ITCCOCrOOOCkCTTTCC kOOOOkoOCOTOOkCTOOOCOOOkC  TOOOCkOT -aionont ToaackOT-oaccko  ckTTGkGCTCTCTkCkk-«aQ ket rtucoccoattGkCTTTCC kfloo-kaccQTCOkCTOoaceotikC  TCOOCkOT-CGCCkO  CkCCOkOCrTTCTkCkk-aaa kCTTTCCOCTOOOOkCTTTOC kOOOOkOkCOTOOkCTOOOOMakC  '1  J  ¥  'I  1  ckccakOctTTCTkCkk-OM kCTTtccocTOOMkCTTTOC kooofikoocoTookCTwinroookr  toooakOT-oaccko  TOooaaT-oocao  <rroc2Tccoa MTkcrkCik kkkCTGkTOk CTOCkTCCOO CTOekTCCOO CTOCkTCCOO CTOCkTCCOO  MTkCMCkk kOTkCTkCkk kOTkCTkCkk kOTkCTkCkk  CkCCGkOCTTTCTkCkk-OOO kCTTTOCOCTOOOGkCTTTOC kflOOPkOOCOTOOkCTMOCOOakC  kkkCTGkTOk kkkCTGkTOk kkkCTGkTOk kkkCTGkTOk  TOOMkOt-OCTCkO  CkCCOAOCCTTCTkCkk-OOO kCTTTOCOCTMMkCtTTCC kOOOrUrtOTOTCOkCTOOOroOrar .  rpurf^irVf r 1  'i y>k-OOT ki 1111 i*Tir'TBnniafcfTTTTp HMUfikmfrnwnfikrTi Ti**rinki* — — — — . —  CTOCkTCCOO kOTkCTkCkk kkkCTGkTOk CTOCkTCOoa kOTkCTkCkk kkkCTGkTOk CTOCkTCOM kOTkCTkCkk kkkCTCkTOk  ckccGkocTTTCTkCkk-ooa kc*TtccocTOoookCTTTTC kooookMCorookCTOOOOOOOkC  TOOMkOT-aocako TOOOGkOT-oacGkc  CTOCkTCCOO kOTkCTkCkk kGkCTOCTGk  CkTTGkGTTTTCckCkk-oao kcmccocToooGkCTTTCc kaoo-kaoraTaGMcroaocoaakC  TaoOGkOT-oacakO  CTOCkTCCOO CTOCkTCCOO cTockTccoa CTOCkTCCOO CTOCkTCCOO  kOTkCTkCkk kOTkCTkCkk kOTkCTkCkk kOTkCTkCkk kOTkCTkCkk  CkTiakBTTTTCTkCkk-OOO kCTTT«OCTOOOGkCTTTOC kOM-kOOTOTaaCCTOOOCOOGkC  TOaKkGT-OOCGkO  ckTTGkOTTTTCTkCkk-ooo kCTTTCcocTOOOOkCTTTCC kaoo-koaTOTaaccToaocoaakc  TOOOCkOT-OGCGkG  CTOCkTCCOO CTockTccoa cTockTccoo CTOCkTCCOO  kOTkCTkCkk kGkCTOCTOk kOTkCTkCkk kOkcracrak kOTkCTkCkk kOkcracTOk MTkCTkCkk kSkCTOCTOk  kOkCTOCTOk MkCTaCTOk kakCTOCTOk kOkCTflCTSk kGkCTOCTOk  T^oootaT^coto CklTGkGTTTTCrkCkk-OW kCTTTCCOCTOOOakCTTTCC kOOO-kOOTorOOCCTOOOCOOOkC CklTGkOTTTTCTkCkk-OOO kCTTTCCOCTOOOakCTTTflC kflOO-kOOTOTOOCCTOOOCOOakC CkTTGMTTrtCTkCkk-000 kCTTTCCOCTOOOGkCTTTCC kOOO-kOOTOTOOCCTOOOCOOBkC  CTOCkTCCOO CTOCkTCCOO CTOCkTCCOO CTOCkTCCOO CTOCkTCCOO CTOCkTCCOO CTOCkTCCOO CTockTccoo  kOTkCTkCkk kOTkCTkCkk kOTkCTkCkk kOTkCTkCkk kOTkCTkCkk kOTkCTkCkk kOTkCTkCkk kOTkCTkCkk  kACTOCTOk kGkCTOCTGk kGkCTOCTGk kakCTOCTOk kakCTOCTOk kGkCTOCTGk kCkCTOCTOk kakcracTOk  CTOCkTCOM CTOCkTCCOO CTOCkTCCOO CTockTccoo CTOCkTCOM CTOCkTCCOO  kOTkCTkCkk kOTkCTkCkk kOTkCTkCkk kOTkCTkCkk kOtkCTkCkk kOTkCTkCkk  kakCTOCTOk kGkCTOCTOk kOkCtOCTOk kCkcracTOk kakCTOCTOk kGkCTOCTGk  CTOCkTCOM CTOCkTCOM CTOCkTCOM CTOCkTCOM  kOTkCTkCkk kOTkCTkCkk kOTkCTkCkk kOTkCTkCkk  kCkCTOCTOk kakCTOCTOk kakCTOCTOk kGkCTOCTOk  CkTTGkaTTTTCTkCkk-oaa kcmccocroooGkcmcc kaoo-kOGTOTaoccTMOcoaakC CkTTGkOTTTTCTkCkk-OOa kCTTTCCOCTOOOOkCTTTOC JtttM-kOOtOTOOCCTOOOfinOtW'  CkTTGkflTTTTCTkCkk-OOO kCTTTCC OCTOCOCkCT TT CC kflOO-kflCTOTOOCCTOOOCOGOkC C*TTC*CTTTTCTkCkk-GOO kCTTTCCOCTOOOGkCTTTCC kOOO-kOOTOTOOCCTOOOCOOOkC CkTTGkGTTTTCTkCkk-GM kCrTTCCaCTOOOOOCTTTCC kOaO-MtaTOTOOCCTOflnrnOOir CkTTCJOTTTTCTkOkk-OOO kCTTTCCOCTOOOGkCTTTCC kOOO-kOOTOT OO TC IQOOCOOQkC CkTTUkOTTTTCTkCkk-OOO kCTTTOCOCTOOOGkCTTTOC kflOO-kflGTQTOQCCTOOOCOoakC  ckTCkkGkcoacTCk CkCcakorrrTCTkCkk-ooa kCTTTccacroaoGkCTTTcc kooo-kooTOTooTCTooocoookc -OCTTTCTkCkfcOCkCTOCTCk CkTCGMCTTTCTkCkk-OGa kCTTTCCOCTOOOGkCTTTCC kOOnmrtOftOTOOCCTOOOCOOOkC CkCCOkOcTTTCTkCkk-ooa kCTTTCcacTaooGkCTTTCc kooookoocoTookCTOoocoookc CklTGkOTTTTCTkCkk-OOO kCTTTCCOCTOOOOkCTTTOC kOOO-kOOTOTOOCCTOaOCOOOkC CkTTGkGTTTI CTkCkk-OOO kCTTTCCOCTOOOGkCTTTCC kOOO-kflOTOTOOCCTOOOCOaOkC  CiTTGkOCT TTCTMCkk-OOO kCTTTCCOCCB OOGkCTTTCC kooa-koacoToakCTaoacoookc CkTTCkOTTTTCTkCkk-OaO kCTTTCCOCTOOOGkCTTTCC kOOO-kOOTOTOOCCTOOOCOOGkC  CTOCkTCCOO kOTkCTkCkk kkkCTGkTGk CTockTccoo kOTkCTkCkk kokCTeCTak  CTOCkTCCOO kOTkCTkCkk kCkCTOCTOk  CkTTOkCTTTTCTTICfck-OOa kCTTTCCOCTOOOGkCTTTCC kOOO-kOOTOTMTCTOOOCGOGkC  CTOCkTCOM kOTkCTkCkk kakCTOCTOk  CkTTCkCTTTTCTkCkk-OOG kCTTTCCOCTOOOGkCTTTCC kOOa-kOOTOTaOCCTGaOCOOOkC CkTTOkOTTTTCTkCkk-OOO kCTTTOCOCTOOOakCTTTCC kOM-kaorgrOaCCTOOOCOOOkC  1  1 11 111 1 1 11 111 1 1 11 1 1 1 1 1 1 1  I N I Mil  1  aakCTOCTOk QGkCTOCTOk OCkCTOCTSk OGkCTOCTC*  TOOOGkOT -GOCGkO  TOOMkOT-OOCCkO TOOOGkOT-GOCGkO TGOOaOT-OOCClkO TOOOGkOT-OOCGkk TOOGGkOT-oocakO  ckTCkkGkccacTGk ckccckCTTTTCTkCkk-000 kCTTTCcacTOOOSkCTTTCC kaoo-koaTOTaoTCTooocoaakc I I 1  kCTkCTkCkk kOTkCTkCkk kCTkCTkCkk kOTkCTkCkk  ToooakOT-oacoko  CkTCkkOkCCqCTOk CkCCakOTTTTCTkCkk-OaO kCTTTCCOCTOOOGkCTTTCC kOOO-fcOOTOTMTCTOOOCOOtlkg -CkTCkkOkCCaCTGk CkCCGkGTTTTCTkCkk-MO kCTTTOCOCTOOMkCTTTCC kOOO-kOOTOTOOTCTOOOCOOakC  kkkCTOCTOk kkkCTOCTOk kkkCTOCTOk kkkCTOCTOk kkkCTOCTOk  CTOTkTCCOO kTTkCTkCkk kGkCTOCTGk CTOTkTCCOO kTTkCTkCkk kGkCTOCTGk — — — . kTGCkTCOM kTOCkTCOOk kTOCkTCOM kTOCkTCOM  kOOOGkOT-OOCOkO  CkTCkkGkCOOCTCk CkCOCkCTTTTCTkCkk-Oaa kCTTTCCOCTOOOGkCTTTCC kOM-kOOTOTTOrCTKOOCOOGkC CkT TtJkGTCTT CTkCkk -OOO kCTTTCCOCTOOOGkCTTTCC kflOO-kOOTOTOOTCTOOOCOQgkC TGGOGkOT-aQCGkO CkTOakOCTTTCTkTkk-kaa kCTTTCCOCTkkOGkkTTTCC kOOO-MaCOTOkCCTkOOCkaakC TkOaCkkOkC CATTOkOTTTTCTkCkk-OOa kCTTTOCOCTOOOOkCTTTCC kOOO-kOOTOTOOtCTOOOCOOOkC CkTTGkilTTTTCTkCkk-OOO kCTTTCCOCTOOOGkCTTTCC kOM-kOOTOTOOCCTOOOCOOOkC ckTTakarrTTCTkCkk-ooa kCTTTCCOCTOOOGkCTTTCC kooo-kooTOTooccTooocoooke TOOMkaT-OOCGkO  kkkCTOCTGk kCkCTocTO* kakCTOCTOk kakCTOCTOk kakCTOCTOk kCkCTOCTOk  CTOTkTCCOO kTTkCTkCkk kGkCTOCTOk CTOCkTCCOO kTTkCTkCkk kGkCTOCTOk  TaccakOT-ooccka  CkTTGkSTTTTCTkCkk-OOO kCTTTCCOCTOOOakCTTTCC kOOO-kOOTOrKOTCTOOOOOOGkC CkTTGkGTTTTCTkCkk-GOQ kCTTTCCOCTOOOGkCTTTCC kOM-kOOTOTKOOCTOOOCOaakC  CTOCkTCOM kOTkCTkCkk kakCTOCTOk CTOCkTCCOO kOTkCTkCkk kGkCTOCTGk  kCTkCTkCkk kCTkCTkCkk kCTkCTkCkk kCTkCTkCkk kCTkCTkCkk  TOOOCkOT -OOCCkO  CkTTGkGTTTTCTkCkk-OOO kCTTTOCOCTOOMkCTTTCC kOOO-kOOTOTOBCCTOOOCOOGkC  CTOCkTCOM kOTkCTkCkk kkkCTOkTOk CTOCkTCOM kOTkCTkCkk kGkCTOCTGk CTOCkTCCOO kOTkCTkCkk kOkCTOCTOk  CTOCkTCOM CTOCkTCCOO CTOCkTCCOO CTOCkTCCOO CTOCkTCOM  rooockOT-oaccko  TeaoakOT-oaccko  CTOCkTCOM kCtkCTkCkk kkkCTacTOk  CTockTccoa kCTkCTkCkk CTOCkTCOM kOTkCTkCkk CTOCkTCCkO kOTlTTkCkk CTOCkTCCOO kOTkCTkCkk CTOCkTCOM kOTkCTkCkk CTOCkTCOM kOTkCTkCkk  TOOOGkOT-OOTGka  CkTTGkSTTTTCTkCkk-OaO kCTTTOCOCTOOOGkCTTTOC kOOO-kOCTTCTTOOCCTOOOCOOOkC CkTTCkOTCTTCTkCkk-Oaa kCTTTCCOCTOOOGkCTTTCC kOOO-kOOTOfOOCCTOOOCOOOkC CkTTGkGTTTTCIkCkk-OOO kCTTTCCOCTOOOOkCTTTOC kOM-kCqtOTOOCCtOOOCOOOkr  CTOOkTCCOO MTkCTkCMk kCkCTOCTOk CTOCkTCCOO kOTkCTkCkk kOkCTOCTCk  1 1  MCEIl!33 KCEI7.34 MCEI7.35 MCE#7.37 KCCI7.100 MCCI7.101 MCEI7.111 PB D i r e c t MCE 1B . 7  1  1 ;  L41 L42 L41 144 L4S L46 L47 L4B L49  ip  ckccokOCTTTCTkCkk-oaa kcrTTCcacTaaoacmcc  llllll 111  MCE 14! 69 MCE 14.80 MCE 14.81 MCE 14.82 MCE 14.83 MCE 14.84 KCEI4.85 HCEI4.B7 KCCI4.SB MCBI4.90 MCE#4.91 MCEI4.92 MCCI4.93 MCE#4 .94 P5 D i r e c t MCE#5.29 MCE#5.30 NCE#5.31 MCE#5.32 MCEI5 33 MCEIS!3S MCE#5.36 MCE15.37 MCEI5.3I MCE#5.12 MCEI5.I3 MCE 15.14 P6 D i r e c t MCEI6.32 MCE 16.33 MCE 16.34 MCE 16.41 MCEI6.101 NCEIG.102 KCEI6.101 KCCI6.104 MCCie.105 MCCIcilOe KCEie.lOB KCCt6.109 P7 D i r e c t KCEI7.27 MCCt7.2B HCEI7.29 KCEI7.30  rp  TooaokOT-oaccka  kkkCiakTOk kkkcrakTOk kkkCTGkTOk kkkcrckKk kkkCTCktok kkkcmTGk - kkkCTGkTGk kkkCTGkTOk kkkCTGkTOk  111IIIIII III  95 96 97 98 99 LOO LOl L02 103 L04 L05 106 107 LOl L09 L10 111 L12 LI3 L14 LIS L1C L17 HI 119 120 L21 122 123 124 125 126 L27 L2B L29 L10 L31 L32 L33 134 L35 136 L37 L3B L39  rp  1  46 HCEI3.34 47 MCEI3.3S 48 MCEI3.43 49 MCEI3.61 50 MCEI3.C2 51 MCE 13.63 52 MCE 13.64 53 MCEI3.65 54 M C E I 3 . e C 55 MCE 13.67 56 MCE 13.68 57 MCE 11.69 58 MCE 13.IS 59 MCE 13.61 60 MCE 13.82 61 MCEI3.83 62 MCE(3.14 63 MCEI3.85 64 MCE(3.16 65 MCEI3.I7 66 MCEI3.88 67 MCE 13.89 68 MCE 13.90 69 MCE(3.91 70 MCEI3.92 71 MCEI3.93 72 MCEI3.94 7 3 MCE43.95 74 MCEI3.9C 75 KCEI4.2B 76 HCCI4.33 77 MCE#4.34 7B MCE14.35 79 MCE14.36 B0 MCEI4.43 Bl MCE#4.45 82 MCE14 47 83 MCEI4.4B 84 MCE 14.49 85 MCE 14.53 86 MCE 14 .54 87 MCE 14.61 BB MCE 14.62 B9 MCE 14.63 90 MCE 14.64 91 MCE 14.65 92 MCE 14.66 93 MCE14.67  rp M B 11  1  43 P I D i r e c t 44 MCEI3.27  iii  1  MCEIl!27 MCEI1.30 MCE11.11 MCE 11.34 HCEI1.39 MCE 11.43 MCE 11.44 MCE 11.31 MCE #1.45 HCEI1.4C MCEI1.47 MCEI1.49  iji  n  Knur  1 ll 1 1 1 I  30 31 32 33 35 36 37 34 31 39 40 41  kOTkCTkCkk eancncMt HIKIKU ksnnkCkk koTkCTkcck lancnckk kOTkCTkCkk kOTkCTkCkk kOTkCTkCkk  l l l l l l l l l l !  MCEI1.9 HCEI1.10 MCEI1.11 MCEI1.15 MCEfl!l6 HCEI1.17 MCEIl.lB HCEfl.lt HCEI1.20 MCEI1.21 HCEI1.22 HCEI1.23 MCE11.24 MCE 11.25  cracftTcoaa crockrcoM crackTcoM crackTccoo CTockTCcaa CTOCkTCCOO CTOCkTCCOO CTOCkTCOoa CTOCkTCCOO  liiiiiiiif jjjjjljjjjj  15 IC 17 11 1* 20 21 22 23 24 25 24 27 21  ^  J?j  l l t IT M E III CTOcktccoo MTTCTATU i a c r e u u CTOCkTCCOO kOTTCTkCkk kCkCTOCTOk crockTccoo korkcrkckk kokcrocrak --------  1998  CkTCkkCkCCOCTGk CkTCkkakCCaCTGk -ckTCkk&kccGCTGk CkTCkkGkCCGCTGk  CkCCGkOTTTTCTkCkk-OM kCTTTCCOCTOOMkCTTTCC kOOO-kOOTOTOOTCTOOOritlllftfcr CkCCOkOTTTTCTkCkk-OOO kCTTTCCOCTOOOGkCTTTCC koao-koqTqTOOTCTon'Vfimkr ckccoTCTTTTCTkCkk-000 kcrTTCCOCTOOOGkCTTTCc koao-kooTOTogrcrooocoookc CkCCGkOTTTTCTkCkk-OOO kCTTTCCOCTOOOOkCTTTCC kOOO-lflOTOTOOTCTOOOCOOOkC  -CkTCkOGkCCCCTCk CkCCakOTTTTCTkCkk-OOO kCTTTCCOCTOOOGkCTTTCC kOOO-kOOTOTaOTCTOOOCGGikC  kGOSkOTT ~OOCGkS  arckkOkccacTGk ckccGkOTTTTCTkCkk-ooo kCTTTccocToaockCTTTCC kaoak03TOTTOorcroooo»wkr  kOooGkar-aacckO  CkTCGkOCTTTCTkCkk-OOa kCTTTCCOCTOOaCkCTTTCT kOO-kkOOCOTMTCTOOOCOOOkC  kGOGGkOT -OOCGkC  CkTCGkGCTTTCMkCkk-OOa kCTTTCCOCTOOOakCTTTCC kOO• kkgOCOTMTCTOOOTOOCkC CkTCGJkGCTTTCTkCkk-GOO kCTTTCCOCTOOOgkCTTTCC knt) - • kflOCqTCOTCTOOaOOOttkC CkTOGkOCTTTCTkCkk-OOafcCTTTCCOCTOOOGkCTTTCT1 Otl-k knOCOTOOTCTOOOCOOOkC CkTOGkOCTTTCTkCkk-OOO kCTTTCCOCTOOOakCTTTCC kOO-kkflOCOTOOTCTOOOCOOOkC  kCOOGkOT-OOCGkO  CkTCGkOCTTtCTkCkk-OCO kCTTTCCOCTOOOGkCTTTCC kkfikknt^TOOCCT-OOOCOOGkC  kGGGkOTT-GGCGkO kaoGkGTT-*acGkO kOOGkOTT-CGCGkG  ckTcakacmctkCkk-oao CkTCOkOCTTTCTkCkk-GGO CklCGkOCTTTCTkCkk-OaO CkTCQJkOCTWTCTkCkk-OOO CkicakOCTTTCTkCkk-oaa  TOOGGkGT-GGCGkG TOOOCkOT-OOCCkO Tooeakot-aacoko  kcmocacToaoGkCTTTOc kooqkOOTOT-ooccTooocoookc kCTTTCCOCTOOOGkCTTTCC kOaGkOaTOTlCT-CtOOOCOOOkC kCTTTCCOCTaaOGkCTTTCC kOOOkOCTGTOGT -CTOOOCOOOkC kClTICCOCTOOOGkCTTTCC kOOGkOOTOTOO-CCTOOOCOOOkC kcmccocroooGkcmcc kooawTCTOoc-CTooocooakC  kTockTcoM kOTkCTkCkk oakCTocTGk  CkTCOMCTTTCIkCkk-aOO kCTTTCCOCTOOOGkCTTTCC kOOakMTOTOOCC-TOOOOOOOkC CkTCGkOCTTTCTkCkk-GOO kCTTTCCOCTOOOakCTTTOC kOOOkOgTOTOOCC-TOOOCOOakC  kTOCkTCOM kOTkCTkCkk aokCTacTGk KTOCkTCOM kOTkCTkCkk GkkCTGCTGk CTOCkTCCOO kOTkCTkCkk OkkCTOCTCk  CJkTCGkOCTTTCTkCkk-OGO kCTTTCCOCTOOOGkCTTTCC kOOCkOOT^TOO-SCTOOOCOOOkC CkCCGkGCTkTTTkkkO-OGa kTTTCCCTTKOaOGkTTTTCC fcOOOGkOOOOTOOCTTOlkOOOCkC CkCCGkGCTTTCTkCkk-OOO kCTTTCCOCTOOOGkCTTTCC kOOOSkeOCeTOakCTOOOOOOakC  Appendix  ^Sii roaockoi-oacckG TOOiCkOT-oacGka  132  MCEF  1998  193 MCE 111.9 L94 MCEI11.10 L93 MCEI11.11 L9G MCEI11.12 L97 KCEI11.13 L9a P13 D i r e c t 99 KCEI13.23 OO MCEI13.27 :01 KCEI13.32 02 MCEI13.33 b03 MCEI13.34 DO* KCEI13.3S BOS MCEI13.3C b04 HCCfl3.1T 07 NCEI13.3S bOI MCCI13.40 B09 KCEI13.41 10 MCEI13.42 fell MCEI13.43 D U MCEI13.44 B13 MCEI13.4S B14 MCEI13.46 bis P14 D i r e c t B I S HCEI14.9 bll MCEI14.1S BIB HCEI14.22 B l * MCEI14.23 biO MCE 114.24 B21 MCEI14.2C B22 MCEfl4.30 B23 KCEI14.32 B24 KCEI14.33 B25 NCEI14.43 0 2 6 HCEI14.44 MCEI14.4* B2B P15 D i r e c t B 2 9 HCEI15.3 B30 HCEI15.5 B 3 1 HCEI15.S B32 MCEI15.7 0 3 3 MCEI1S.9 34 MCEI15.13 B35 KCEI15.14 B36 MCEI15.lt B37 HCEI1S.27 31 MCEI15.2S b39 MCEI15.29 P16 D i r e c t b41 M C E t l t . l B42 MCE 116.2 B43 KCEI16.3 B44 MCEtl6.4 ^45 HCEflt.5 |Z46 M C E f l t . 4 B47 KCEI1C.T ]46 MCEflt.a 44 MCEI1C.9 150 MCEt16.11 ESI NCEfl6.13 252 P l l D i r e c t 153 MCEflB.G 154 HCEI1B.7 155 MCEI1B.14 [56 HCEI1I.16 [57 KCEflB.19 t 5 l MCEI1B.20 [59 HCEI1B.21 ltd MCEI1B.22 [61 HCCI1B.27 [62 MCEI1B.29 [63 HCEI1B.31 [64 MCEI1B.33 165 P I * D i r e c t , 66 MCE 119.1 167 MCEI19.13 [6B MCEI19.14 [69 HCEI19.15 170 MCEI19.16 71 p72 73 blA b75 B76 TT [Tt [79 [BO [81 [82 183 !B4 [85 [86 17 bBB B89 B90 B91 b92 93  HCEI19.17 MCEI19.1I MCEI19.19 NCEI19.26 HCCI19.21 KCCI19.29 KCCI19.30 P20 D i r e c t MCEI20.6 MCEf20.7 KC£f20.a MCE 120.9 HCEI20.10 MCEI20.11 MCEI20.2S MCEI30.26 MCEI20.27 MCEI20.28 MCEI20.31 P64 D i r e c t MCE f 64.1 MCE 164.2 MCE 164.3  194 !95 196 !9T !98 199  MCEI64.4 MCE f 64.5 MCE 164.6 MCEt64 .7 KCEI64.9 HCEI64.12  Appendix  133  MCEF  1998  101 MCE(61.2 102 MCE 161.3 )03 HCEI68.10 104 MCEI6a.ll 105 P69 D i r e c t JO6 MCE(69.1 JOT MCE 169.3 JOI MCE169.6 109 MCEI69.23 110 MCEI69.27 111 P73 D i r e c t 112 MCEI73.1 113 MCEt73.2 114 MCEI73.3 115 MCE 173.4 (16 MCE 173.5 117 HCEI73.6 111 MCEI73.S )19 HCEI73.9 120 H C E t 7 3 . l l 121 MCEI73.12 122 HCEI73.15 J23 P22 D i r e c t J24 MCE#22.7 125 HCEI22.12 126 MCEI22.13 127 MCEI22.14 121 MCEI22.19 129 MCEI22.2T 130 MCEI22.28 131 MCCI22.30 132 HCEI22.31 133 MCEI22.32 134 MCEI22.33 135 P24 D i r e c t 136 MCE 124,1 137 MCE 124.2 138 MCE 124.3 139 MCE 124.9 MO HCCI24.10 M l MCCI24.12 142 HCEf24.1T 143 MCE#24.18 M4 MCEI24.26 M S P2S D i r e c t M 6 HCEI25.5 147 MCE 125.4 M S MCE#25.6 149 MCE 125.T 150 HCEI2S.8 151 HCEI25.10 152 MCEI25.12 153 MCEI26.1 154 MCEI26.3 155 MCE 126.4 156 MCEI26.5 157 MCE 126.6 158 MCE 126.8 159 MCEI26.10 160 MCEI26.13 161 HCEI26.20 162 HCEI26.21 163 KCCI26.21 )64 MCE127.J 165 HCEI2T.4 166 MCE#27.7 167 HCEI2T.11 16S HCEI2T.1S 169 MCE#27.21 ITO HCEI2T.22 171 HCBI2T.24 172 MCE#27.25 1T3 MCEI27.30 174 MCEI27.31 175 MCEI28.1 176 MCEI28.2 177 MCEI28.3 178 MCE#21.4 179 MCE#28.5 180 MCE#28.6 J81 MCE #21. 7 182 MCE#28.8 183 MCE#28.9 JB4 HCEI2B.10 185 HCEI2B.11 1B6 MCEI2B.12 187 MCE 129.2 188 MCE 129.3 18 9 MCE 129.4 MCE 129.5 191 MCEI29.6 )92 MCE 129.8 193 MCE#29.9 194 MCEI29.10 195 MCE#29.11 J96 KCEI29.12 197 HCEI29.13 198 MCEI30.1 199 HCEI30.2 100 MCEI30.3 01 MCEI30.5 02 MCE#30.6 03 MCEI30.7 |404 MCEI30.B 05 MCEI30.11 06 MCE110.16 07 MCEI30.17 08 MCEI30.1S 09 57 D i r e c t 10 MCE 157.1 11 MCE 157.2 12 MCE 157.3 13 MCE#57.4 14 MCE 157.5 15 MCE#57.6 16 MCE 157.7 17 MCE#57.8 18 MCE#57.9 19 HCBIS7.10 h20 KCE#S7.12 M21 HCEtST.13 |t22 P58 D i r e c t 2 3 MCE#58.1 )I24 MCE#58.2 25 MCE#58.3 126 MCE#58.4 127 MCE#58.5 128 MCE#58.6 129 MCEI5B.7 130 MCE 158.8 131 MCE158.9 132 MCEI58.10 133 MCEI58.U 134 MCEf58.12 135 P59 D i r e c t 36 MCE 159.1 37 MCE#59.2 38 MCE#59.4 39 HCEI59.20 (440 HCEI59.21 41 KCEI59.22 42 HCEI59.24 43 HCEt59.2S 144 HCEI59.26 M 5 HCEI59.28 146 KCEI59.29 14 T P 62 D i r e c t I4B MCE#62.1 14 9 MCE#62.2  S  Appendix  134  MCEF  HS1 52 153 154 155 I5C 157 158 159 160 161 162 163 164 165 166 167 I6S 169 TO Tl T2 ||T3 T4 TS 76 TT 78 79 180 181 182 183 184 105 186 187 188 189 190 191 192 193 194 195 196 197 198 199 >00 >01 >02 >03 >04 >05 >06 >0T >08 >09 510 ill >12 >13 >14 >15 >16 JIT >18 >19 >20 >21 i22  MCCI62.5 ITCCOO MTkCTkCk* MkCTOCTOk MCE 162.6 CMCkTCOM kOTACTfcCJ* kGkCraCTOk MCE 162 .7 CMCkTCcaa » MCEI62.8 CTQCKCCCtt l e i U I K U k MCE162.10 ctackicccM » MCEI62.U CTQCftTCOOa * P65 D i r e c t MCE 165.5 MCE#65.9 MfcCrOCTOk P31 D i r e c t c m a r c o c M kOTkCTfcCM « MCEI31.1 cracHCcaa ftonciKM akkcrkokkc HCEI31.3 NCEI31.5 MCEI31.6 k JtkkCTGHOk MCEI31.7 k U1CTKUC CTGCkCCCOQ' CTQCkTCCOO MCEI31.I akkCtMuutc HCEI31.10 CTGCkTCceo ojkkCTMtkc HCEf31.ll MCEf31.12 MTkCTkCMk OMcikokkc MCE#31.13 kOtkCrkCMt atxctiCMAc MCE#33.2 MTMTHCU u i n a n t MCE#33.4 eSI&CIliCM OUCTttTOk MCE#33.5 cnckTcoaa MTACTkCMt. WkCTGkTOk MCE(33.6 MOtCtkCMr, MCE(33.8 CTOOkTCCOO U I M T K U HCEI33.10 MCEi33.ll MCEI33.13 MCEI33.14 MCEI33.15 MCEI33.1S P34 D i r e c t MCE #34.1 HCEI34.2 MCE(34.3 croak tecoo juJTACTfcc** M k c r o c T u MCE(34.4 MCE 134 . 5 MCE#34.6 CTOCkicceo koxkcikc KCE04.9 MCE#34.10 JMKftCtfcCM MBkCTOClOA MCE#34.11 kBTkCTkCkk kOCTOCTOk MCE#34.12 MTkCTkCkk 1 MCEI34.13 KCEI35.16 KCEI35.18 CTOCftTCOM UTkCTTCkft OMCTQCTOk MCEt35.31 CtOCkTCOaa kkTkCTTCkk 4 MTkCTkCkk k MCEI35.32 P36 D i r e c t kkOCkTCcao MCE#16.1 MCE(36.2 HCEI36.3 konciATu ukcreTTOJL MCE#36.4 kOTkCTkTkk SftkCTOCtOk MCE#36.5 tTceea M t k c r k t k k akkcracTOk MCE#36.6 iMOCivrccM koikCTkTkk akkcracTOk MCE#36.7 Mboatrccoa MTkCTkTkft QkkCTOCTGk MCE#36.10 MOCJtTCCOO MikCTkTkk akkciacTCk MCEf36.11 akkcracTOk P39 D i r e c t MUtCkKooa MtfcCTftTkk wunc HCE(39.1 HCEf39.10 HCE#40.3 MCE(40.4 croatTccoo w n c n c u HCC(40.6 IkkkCftTCcaa u n c i t c u HCEM0.8 kkkCkTCCOa K U C T M U MCE#40.14 HCEt40.15 ckTccaa katkCTACMt okkcracTOk MCEM0.17 HCEf40.18 MCE#40.19 AMkCkTCcaa M n c t k c a k «*»CTOCTG» LTNP1451 LTNP1750 LTNP2402 CTOCiTCCGO kOTTTTkCkk kGkCTGCTGk -  1998  1 fcCTTTCCOCTOOOOlCTTICC - CUCSMTTTTCTkCJUt-OOa kCTTTCCOCTMMtCTTTCC - CKrCUatTTTCTaCM-OOS kCmCCOCNaKkCTTTCC  — • TOCTOfcCkTCCmCTJKMUakkCTaCTGk rocraiXftte<»CTkUMUcTacT« Tocra^TccvTKAiuaacTacra TOCTo»Q\TcqfcCT»r u a ii-TocTta TocracftTcaciMkMBUKTactok cwrcaoocrtcAtacMMaa n c i o u a i c a u i K i M u n w r a carcaaacrrcuACWUHMCj eaecacecTrrcrkCk-cao3 CkCO(WaCTTTCTke*-C«aQ ClCCOOOCTtTCTJtCWt-Oaa  - UTTUocmciicu-aaa »  - CktcoMCtnctMM-MO a - C*TTCUOCtTrCt»C»*-OQO *  - CkCTGkOCTTTCTkCkk-«ao k  Appendix  135  MCEF  3£ 3 LAKL CON A 4 LAKL CON D 5 LAKL CON B HIVXB2 S P I Direct 9 HCEI1.3 10 MCEI1.4 11 MCEI1.S 12 MCEI1.4 13 HCEI1.T 14 MCEI1.I 15 HCEI1.9 16 MCEI1.10 17 HCEI1.11 IB MCEII.15 19 MCEI1.1C 20 MCEII.17 21 MCE I I . I I 22 MCEII. 19 23 MCEI1.20 24 MCEII.21 25 MCE11.22 26 MCEII.21 27 MCEII.24 2B MCEI1.25 29 MCGI1.2C 10 MCEI1.27 31 MCE I I . 1 0 12 MCEI1.11 33 MCE 11.34 15 MCEI1.39 36 MCEII.43 37 MCEI1.44 34 K C E I 1 . 3 I 3B MCE#1.45 19 NCEI1.46 40 MCEII.47 41 MCEI1.49 42 MCEII.50 43 P3 D i r e c t 44 MCE 13.27 45 MCEII.11 46 MCEI1.34 47 MCE13.15 4B MCEII.41 49 MCEII.61 50 MCEI3.C2 51 HCEI1.63 52 MCEI3.64 51 MCEI1.65 54 MCEI3.66 55 MCEI1.47 56 HCEI1.6B 57 MCEI1.69 51 MCEI1.B0 59 HCEI3.I1 60 MCEI3.I2 61 MCEI3.B3 62 MCEI3.B4 63 MCEI3.B5 64 MCEI3.B6 65 MCEI3.B7 66 MCEI3.BB 67 MCEI3.B9 68 KCEI3.90 69 MCEI3.91 70 MCEI3.92 71 MCE13.93 72 MCE 13.94 73 MCEII.95 74 MCEI3.96 75 MCE 14.26 76 MCE 14 .33 77 MCE 14.34 7B MCE 14.35 79 MCE 14.36 B0 MCE14.41 B l MCE 14.45 B2 MCE 14.47 B l MCEI4.4B B4 MCE 14.49 B 5 MCE 14.53 86 MCEI4.54 87 MCE14.61 18 NCE 14 .62 89 HCCI4.63 90 MCE 14.64 91 MCE14.65 92 NCBI4.66 93 MCE#4.67 94 MCE 14.61 95 MCE14.69 96 MCE14.10 97 HCEI4.B1 9B MCE14.12 99 MCEI4.S3 100 MCE14.(4 101 MCE 14.85 102 MCE 14.67 103 MCEI4.66 104 MCE14.90 105 MCE14.91 106 MCE 14.92 107 MCE 14.91 108 MCE 14.94 109 P5 D i r e c t 110 MCEI5.29 U l MCE 15.30 112 MCE IS.11 113 MCE 15.32 114 MCE 15.33 115 MCE15.15 L16 MCE 15.16 L17 MCE 15.37 LIB MCE 15.31 L19 MCE 15.82 L20 MCE 15.13 121 MCE 15.14 122 P6 D i r e c t L23 MCE 16. 32 L24 HCEI6.13 125 MCE I * . 34 126 HCCI6.43 127 MCEIC.101 12B MCEI6.102 129 MCEI6.103 130 MCEI6.104 131 MCEI6.105 132 MCEI6.106 133 MCEIC.10B 134 MCEI6.109 135 P7 D i r e c t 136 MCEI7.27 137 MCE 17.28 138 MCE 17.29 L39 MCE 17.30 L40 MCE 17.31 L41 MCE 17. 31 L42 MCE 17.34 L43 MCE 17. 35 L44 MCE 17. 37 L45 MCEI7.100 L46 MCEI7.101 L47 M C E I 7 . U 1 L4I PB D i r e c t L49 MCE 18.7  1J8  a rcTcrcTooTTenecc»atCTO*occTqoa»OCT  1998  IjT  c  CCCTC*C*TOCTOC*T»T kAQCkOCTOCTT  txactacracTi  cccTCMoftraerocknr CCCTCMttOCIOCttftT MOCAOCTOCTT CCCTCAOUOCTeCkTAT » cccTCAUTocTeckift r u o c M c r o c r r TTT-OCCTOTACT OOC. jcrciciaaTTkvu*xiaawyrGN&TQQG4VttcTCta^ac-t*.Qoai* ccc  jbCTOCtTuoccTCUttufc  CCCTCJkOMOCTOCkTAT fckOCiOCTOCTT ccc-rckQ»TCCTGC»T»T uocMcrgcTT cectceatncrockTkT »AOCAOCTOCTT CCCTCMOftSOCTOCMH kMCftflCTOCTT cccTcadkzoctackTkT MOOWCTOCTT cccTCMikTOCrockCkT *koc*ocTocTT TkaATOCTOCkTkT tkVKttXTOCTt cccrcwiaracxaCkTAT kMUOCTOCTT CCCTC*OATOCTOC»T»T cccrCMiuectoooTkT CCCTCM*?OCTOCH»  cocTcaaftTocreckikT CCCICMUQCTOCHK  r jtMCftOcracn CCCTCMk*TOCTOCk1»T CCCTC*Ok?OCTOC»T»T  MWCfcOCTOCTT  ifcnranctoCTt CCCTCeOKTgCTOCkTftT CCCTCJbCATOCTOOkTiT kAOCiflCTOCTT ccctCAakiocTockTkr uecMctocn Mkeuoctacn cccTC*akTacTacH» cccTceauacnckT»T »*oc*actocTt CCCtCMWaCTOCMM CCCTCkOkTOCMCkTkT cccTCMUTociacknT AMUOCTOCTT kMuaoracTT **oc*o*racrr CCCTCMHTOCTOOLTAT  cccTcefikTOCtocknT AMCftOCTOCTT cccTCMOUOCiocktkT CCCTCAMXOCTOCklkT CCCTCftOfcTOCTOCklkT cocTOiaaTocTackB I MQCMCrOCTt lccctCM*rocT«c»TiT  CCCICMUOCTOCkEkT k\ .cccTCJMUiocTacknT MLOCIOCTOCTT icccTCMjaacTecftTAt MOCMCTOCTT CCCTCkOATOCWCJlTJlT NMCkflCTOCTT cccTCftakracTackT&T j t M u a c r a c T i TTT-OCCTO»CT CCCTCJXUlTOCTOC>lT»T MOCIOCTOCTT TTT-OCCTOTACC TOO TCTCTCTOOTT AOIlCC»fifcTCTa*OCCTOOGAGCT CTCT OOCTJbOC- TkOOGJUk CCC CCCTC*a»T OCTOCkTIT ewcTaKtkTOCTOCH» cccTCftouocTcckikT **cc«actoctt JUGCftCCTOCTT •MCAOCTOCTT MOCfcOCTOCTt CCCTCACATCCTOCftlkT MOCAOCIOCTT cccTC*aftTaCTOCJLTJtT AfcQCftOCTOCTT ccctceaftiocMCkikT 'OCTT CCCTC*lJ»TflCTOC*T*T ccctcftOuacYockiftT t+eaoctam TTT-OCCTOTkCO OOO TCTCTCTMnUaCCiaKTUtGCCTIJlOftCCT ftkOCMCTOCR MOC*OCTOCTT ccCTUfikracTcatnT ftMCkocracrr CCCTOhOUOCTOCkTkT CCCtCkOUOCTOCkTJtT UOCftOCTOCTT MOCAOCTOCTT !cccTC*CJkTacToc»T»T MtGCMtCTOCTT UOCAQCTOCTT MkOCMCTOcn aMcaacracTT c^cTCfteftxacTocKH  CCC  ftucaocTocrr  ccCTCM«racTockT&T i ccctoflkracToaiTftT MOC*OCTOCTT cccTciekTCiTOCftTk? »»OC»OCTQCTT CCCTCiOATOCTOC*T»T kMCkaOTOCTT cccTCkakTflCTackTJLT MonacTOcrr ceeiciaftTociacAieT MocMCTQcrT TTT-OCCTCTUCT O CCCTC*a»TOCTOC»T»T UOCAOCTOCTT TTT-OCCTOnCT o cccTcifikTocToatTAT uackocTocTT cccTceauoctockTkT i ccc-rc*a»TOCTOC»i»i > CCCTC»0*TCCTOC»T»T kkOCftOCTOCR cccTCftaKracTOCknr *  K CCC fcCTOCTTiiOCCTCkiTAA*  cocTCJiouocTacftrftT cocTC*auacTscknT CCCTCMUaTTOCBtKt CCCTCAflUOCTOCklkT CCCICAfiftXOCTOCftTAT ftkOCAacTocrr TCCTCAOATOCTOCftTM CCCTCAOkTOCTOCkTAT  cccTuaftcacTOCktkT AMCASCTOCTT TTT-OCCTOT»CT cccicAaicacTOOkTAT • ccerc»aftcocTockaT > cccTCAoecocrockTkr MociocTocTt CCCTC»OACOCTGT»T»T kkOUOCTOOTT CCCTCaaftCOCTOCHM kkOCMCTOCTt CCCTC*0*CGCTOC»T»T MOCIOCTOCTt CCCTCMACOCTOCHU jutoceocToctT CCCTCAQAC CCTOCJkTAT AAOCKJCTOCTT COCCCAXRCTTGAVTTT MQCfcSTTkTR CCCTCfcg*tOCTOCfcT*T MtOCfcOCTOCTI  CCC ftCTOCTTUOCCTCMltUk  Appendix  136  MCEF  L51 MCE I I . IS 1S2 H C C f l . 2 3 I S ) NCEI8.26 154 KCEI8.100 LSS P9 D i r e c t 156 HCEI9.3 1ST MCE19.89 151 HCEI9.100 159 MCEI9.101 L40 MCBI9.104 1«1 MCEI9.39 162 MCEI10.I9 163 MCEI10.22 L64 MCEI10.23 L65 MCEI10.24 166 MCEI10.25 L67 MCEI10.2B 1.61 MCEI10.30 L69 HCEtlO.13 no MCEiio.ac L71 MCEI10.S8 L72 P63 D i r e c t L73 MCE 163.1 174 MCE163.4 175 KCCI61.5 176 MCE I t 3.6 177 MCEt63.* 178 HCEI63.10 179 H C E f 6 3 . l l 110 MCEI63.12 111 MCEI63.14 152 HCEt63.16 IBS MCEI63.17 1B4 MCE163.19 IBS P l l D i r e c t LBG MCE 111.1 IB 7 MCE 111.2 LBB MCE 111.4 LB 9 MCE#11.5 L90 MCE#11.6 L91 MCEI11.7 L92 M C E I l l . B L93 MCE 111.9 L94 MCEI11.1D L95 H C E f l l . l l L96 MCEI11.12 L97 MCEI11.13 L98 P l l D i r e c t 199 MCEI13.23 tOO MCEI13.27 tOl MCEI13.32 !02 MCE* 13.31 tOl MCE* 11.14 E04 MCEI13.35 EOS MCEI13.3C t06 HCEI13.37 !07 MCEI13.38 EOB MCEI13.40 !09 MCCI13.41 110 MCEI13.42 t i l MCEtll.41 t l 2 HCEt11.44 113 MCEI11.45 tU MCEI13.46 E15 P14 D i r e c t !16 HCEt 14.9 117 MCEI14.15 t i l MCEI14.22 E19 MCCI14.23 (20 HCEI14.24 E21 MCEI14.26 E22 MCEI14.30 123 HCEt 14.32 t24 MCEI14.33 E25 MCEI14.43 t26 MCEI14.44 127 MCEI14.49 E2B P15 D i r e c t (29 MCE 115.3 E30 MCE 115.5 E31 MCE 115.6 E32 MCEI15.7 !33 MCE 115.9 E34 HCEI1S.13 135 MCEI15.14 E36 HCEt15.16 !37 MCEI15.27 I3B MCEtl5.2> E39 HCEt15.24 !40 P16 D i r e c t M l HCEt 16.1 [42 MCEI16.2 [43 MCEI16.3 !44 MCEI16.4 !45 MCE 116.5 !46 MCEI16.6 !47 MCE 116.7 141 MCE l i t . 1 E49 MCE#16.9 !S0 HCEI16.11 !51 HCEI16.13 •52 P1B D i r e c t  CCCtCMtTOCTaCKM • |cCCTC»fcfcTOCTOCMM • CCCTCJttftTOCTOCM&T ft |CCCTC60WOCrOOT*T ft ftftOCMCTOCTT T MOCMCTOCR aMCUC-acTT  a TCTcrcranrjtGfccCfcGMCTOAOCCTOoaMCTCT^  1998  ccc K n e n u a c c K u i i u  ftftOCMCTOCTT •MCMCiacrr TTT-OCCTO*«M T ftftOCMCTOCTT  ftftOCMCTOCTT eccrc»a*TOCTOc»T*T ftftOCMCTOCTT CCCTCMtUOCTOChm ftftOCMCTOCTT CCCTCJtaftTOCTOCftTftT COeTCftOftTOCTOCftTftl cocTCkaftracTacvTkT TftOCMCTOCrT ccccicaauocrackTkT WMaocracTT CCCTCftOTT OCTC*»T»T ftftOCMTTOCTT CCCTC*0*TOCTOC»T»T ftftOCftOCTOCTT CCCTCftOftTOCTOCJlTftT u a o a c r a c n CCCTCMAtOCrCJCiXTAT ftftOCMCTOCTT cccTCftwracrecftTftf CCCTCftSftTaCTOCftTfcl  rcTGoaftGCTCTCTaactftftC-tftaoaft CCC CCCTCMftTftCTOCftTftT «CTCMATftCTOCftTftT cxcTCMukcrecknT ftftOCMCTOCTT cccrcMftiftcrocftTftT cocrckaurkctacKnT cccTuaUMCTOctnt ftftOCMTTOCTT CCC ICCftOTOC lOCftTftT cccTCAuroeiackTki ftcCTC*aftracTOCftT»T CCCTCMftTOCTQCftTAT  Tci-accToncT cat) TcTcTcraarTMikca<%TCTCk<MCTaftaftecTCTCTaacrhoc-T  cccTOOkrocTackTkT CCCTCftOftTOCTOatTftT COCTCftaftTOCTOCftTftT cccTCMATacraakTkr  AftOCftOCTOCTT c c c i u G M o c n a n r ftftOCMCTOCTT ftftOCMCTOCTT TTT-OCCTCTTCT a ftftOCMCTOCTT TTT-GCCTGTftCT O ftftOCftOCTOCTT ftftOCMCTOCTT CCCTCMftXOCTOCftTftT ftftOCMCTOCTT cccTCMftTocrocATftT CCCTCMftTQCTOCftTftT CCCTCftOftTaCTOCftTftT  COCTCftaftTOCTOCftTftT CCCTCftOftTOCTOCftTftT MtackacracTT 153 MCEIU.G cccTCMurociaaim ftftOCMCTOCTT T-CTOOCTOTftCT GOO TCTCTCiaonMWC&UTCTCJtaocraoakacTCTCToacTuc-nooGkA c ftftOCftOCTOCTT E54 HCB118.7 !5S HCEI1B.14 COCTCftaftTOCTOCftTftT ftftOCMCTOCTT ftftOCMCTOCTT 156 HCEI1S.16 !57 HCEt11.19 E58 KCEI18.20 E59 HCEtlB.21 E60 HCEI18.22 E61 HCEt11.27 cccKMtiacncknT E62 HCEI1I.29 cccTCkauocTockTkT E63 HCEt11.31 cccTCkuiacncknr E64 HCEt 11.33 E65 P19 D i r e c t CCCTCMftTOCTOCftTftT cocTCMftTOcrackTftT E66 HCEt14.1 COCTCftaftTOCTOCftTftTftftOCMCTOCTTTTT-aCCTCTftCO CeO TCTCTCTMTTftOftCCanTCraJIOCICnUGftaCTCTCTaOCTCftCt6T MCEI19.13 corrcMWioctoanT ftftOCMCTOCTT •61 HCEt14.14 uecMCTOCtt T !64 HCEI19.15 ftftOCMCTOCTT (TO HCEI19.16 t T l HCEI19.1T CCCTCftOftTOCTOatTftT ftftOCMCTOCTT ftftOCftOCTOCTT [72 KCEI19.11 [73 HCEt19.19 ftftOCMCTOCTT [74 MCEI19.26 175 HCEI19.28 r ftftOCftOCTOCTT [76 HCEI14.29 ETT HCEt19.30 ETI P20 D i r e c t CCCTCftaftTOCTOattftT * ET9 MCE 120.6 E10 MCEI20.7 NCCTCMftrOCTOCftEftT EB1 MCE #20.1 E12 MCE#20.9 ftccTCMftrocTocftT» EB3 MCEI20.10 •KCtcMttacreamT EI4 HCEI20.11 EBS MCEI20.25 kCCTCAOMOCTOCftTftT EB6 MCEI20.26 ftCCTCftOftTOCManT E8T MCEI20.27 ftCCTCMftraCTacftTftT [BB MCEI20.2B ftftocftaeTOCTT [89 MCEI20.31 E90 P64 D i r e c t ftftOCftOCTOCTT E91 MCE 164.1 ftftOCftOCTOCTT E92 MCEI64.2 CCCTCftOftTOCTOCftTftT kkcciaocccct £93 MCEI64.3 I CCCTCMftTOCTOCftTftT :OCTT TTT-OCCTCTiCT O E94 MCEI64.4 CCTCMftTTCTOCftTftT •95 MCE (64.5 (96 MCE 164 .6 E9T MCEI64.7 CCtCMftTOCTOCftTftT E98 MCEI64.9 cccTCftaftTOcroattftT E99 MCEI64.12 CCCTCftgftTOCTQCftTftT CCCTC»0»TaCTOC»T»T cccToakiocTocknT  Appendix  137  MCEF  101 HCEIC8.2 102 HCEt68.3 >03 HCE#68.10 T JUMCAOOCOCTT 104 ItCEfta.ll t TT-COCCTOTXCT OOO JOS P69 D i r e c t 106 MCE #69.1 I kkCCkttCTOCTT TCT-OCTTOtfcCT OOO TCTCTCTO0TT1 JOT MCEI69.3 uacAocroctT rcr-occTotkCT oao JOS MCE#69.6 r-craccTOTkct oao cccTCiatTOcrecHkT ftkocMcrocn 109 MCEI69.23 kkCCkOCTOCTT T-CTOCCTOTkCT OOO TCTCTCTOBTTl J10 MCE#69.27 kMCfcocrocn 111 P73 D i r e c t TOLAuoarrcjjiTTT TMauarraTT 112 MCEI73.1 I CC-ICkakkOCTOkkaT 113 MCE#73.2 cc-TcuatacTSkkikT 114 MCEI73.3 J15 MCEI73.4 116 MCE#73.5 J17 MCEI73.6 ua MCEi73.a 119 HCE173.9 TCTCTCToarTkakcckakTccakaccTaaakacTCTCTaGCTkkc120 MCE#73.11 >21 MCEI73.12 122 KCEI73.15 AMCMCTOCTT 123 P22 D i r e c t CCCTCNOUOCTaCkTAT MtacjtociocTT 124 MCE(22.7 (25 MCEI22.12 cccKAauractecktftT MOCkOCTacn 126 MCEI22.13 CCCkCMkTOCTOCklkT 127 MCCI22.14 128 MCEI22.19 129 MCEI22.2T 130 HCEI22.28 )31 HCEI22.30 132 MCEI22.31 133 MCEI22.32 134 HCEI22.33 135 P24 D i r e c t 136 MCE#24.1 13T MCE#24 .2 cocrcufcT ncmck'ar 138 MCE#24.3 cccrcMftxocTackTJkT 139 MCE#24.9 racTCMuacracknT M0 MCE#24.10 cccTCMiaocTacknT M l MCEI24.12 cociCAauacTocknr M2 MCEf24.1T M 3 MCE#24.1( coctCMUOCTOCknr kkackacracTT M4 HCBf24.26 M S P25 D i r e c t M 6 MCE#25.5 cccTCMWTOCTOcftnt *OOC»OCTOCTC rtT-eccTochCT a M 7 MCE#25.4 CCXTC*a»TOCT«C*T»T I U C H C N C K TTT-acCTGTJkCt OOO TCTCTCTOOTTIM^C^»TTTCMCCTOOOkOCTCTCTOOTOOC-TkO^ MB MCE#25.6 -CCTCkOUlCTOCkTkT 149 MCE(25.7 arTC»GAT<JCTOC»T»T 150 MCE(25.8 151 MCEI25.10 -ccTCMuaKCTKatTkf JtftOCfcoocccTT 152 MCEI25.12 153 MCE 126.1 ftMCMcrocTc «T-OCTCOT»CT a kkockacTOCTT TTT-aocTsraca T 154 MCEI26.3 kkackacnacr 155 MCEI26.4 kkocMcracti 156 MCE 126.5 ftkooacTOCK 157 MCE 126.6 158 MCE 126.8 OCTC iTT-occroifcCT oao TcrctcTOCTTkaMcxciiTTiaftacciaacjkGCTCTCTaacTkac159 MCEI26.10 160 MCEI26.13 CCCTC»OATOCT<JCAT»T 161 MCE#26.20 162 MCEt26.21 racicftakzacTocknr AUCMCioctc 163 MCEI26.21 CCCTCMftTOCtOaLnr kkOCkOCIOCTC TTT-GOCTOTIICT COG TCTCTCTOCTTMMC»C»TTTO>aOCTa<XMaCTCTCTaGCTftaC-Tftaaaft 164 MCE#27.3 TTT-OCCTOTOCT ooo TCtctcTootTkakceke»TeccjbCCCTeGakoercTCToeCTkkc-Tkasckk 165 MCE#27.4 166 MCE#27.7 CCCTOOTTOt W O t t t 167 MCE#27.11 COCTCkakTOCTOCkEkT 168 HCE#27.15 cccicKUkTactacftnT JtkQCkOCTOCTT 169 MCEI2T.21 kkOCkOCTOCK 170 MCE#27.22 CCCTCMeTOCTOCftTAT UQCkacTocTT T-GcaccTGTJLCT GOB tciCTCTTGrTk^e»«TCCG«^TGOcauOTCTCT 171 HCE127.24 cccTCftOMacTacknT 172 MCEI27.25 CC-TCkakTOCTOCkTkT 173 MCEt27.30 CCCTCkaUOCTOCkBT J74 HCEI27.31 CC-TCftOkTOCTOCkTkT 175 MCE#28.1 176 MCEI2B.2 -TckOftTacTocftnT kkQCkOCOCTTT | cccTcaoartcTocknT 177 MCEI2B.3 cccicjtau KcrsCknT MMcaoecern 1TB MCEI2B.4 179 MCEI2B.5 1B0 MCEI28.6 181 MCEI28.7 182 MCEI28.8 i kkockoocacTT IB3 MCEI28.9 1B4 MCEI28.10 185 MCEI2B.11 186 MCEI28.12 187 MCEI29.2 188 MCE(29.3 189 MCE(29.4 190 MCE(29.5 191 MCE 129.6 192 KCEI29.B 193 MCE#24.9 194 MCEI29.10 195 MCEI29.11 196 MCEI29.12 197 MCEI29.13 198 MCEI30.1 ftxaatocTOCTT 199 MCEI30.2 MOCftGCTQCTT 100 MCEI30.3 AMCftOCTOCTT 101 KCEI30.S cccTCftauecTackXkT kkaCkacTacn 102 MCEI30.6 cccTC*c*iocroc»T»r ikacftccTGCTT 103 MCEI30.7 cccrcftOftTOCTOCknT kkackacracTT 104 MCEI30.B cccTCftauocTOCftnT VMCACCTOCTT 105 MCEI30.11 kkockaciccn 106 MCE#30.16 cccTCftouacmoanT kkeckociacrc 107 HCEI30.1T 108 HCE#30.18 109 57 D i r e c t 110 MCE#57.1 111 MCE#57.2 112 MCE#57.3 113 MCE#57.4 114 MCE#57.5 ccKTCjauacTBCftTAT uocxociocrr U S MCE#57.6 116 MCE#57.7 cccicfcatranackikT kkackacracTT 117 MCEIS7.8 U B MCE#57.9 T juociacrecTT 119 MCEI57.10 120 MCEI57.12 121 MCEI57.13 122 P5B D i r e c t cccTCkaaTOcTaarjkT UOCAOCTOCTT 123 MCEI5B.1 124 MCE(58.2 CCTCJUtOCTCCTTCKkT 125 MCE(58.3 126 MCE (51.4 127 MCEI5S.5 t WlOCfcOCTOCTT 128 MCE(58.6 129 HCEIS8.7 ccTCt-aftTacTocMkT 130 HCEI5S.8 CCCTCkOftTOCTaCkTAT u a c i G C T c c n 131 MCE#58.9 cccTCftaftTOCToatftT MOCkOCTOCTT 132 MCEI5B.10 COCTCkOkTOClOakTkT •kOCMCrOCTt 133 M C E t 5 8 . l l cceTCftaftxocTockiM r 134 MCEI58.12 135 PS9 D i r e c t ccc-CKuacTTCknT 136 MCE#59.1 CCCTCkO»TOCTOC»r»T 3 TCTCTCTkOnkOkCCkaTCTJUbGCCTkGCkGCTCTCTkGCTkGC137 MCE 159.2 cc-TC*auacTacknT 138 MCE#59.4 Mocoottatn 139 MCEIS9.20 cccTCMMtToctockaT kkOCkOCTOCTT cc-TCMuaacToatnT kocoo-ctatrt 140 MCEtS9.21 cc-tcMATOCTOCkaT kkacaaTTOKTT 141 MCEtS9.22 ccc —»atocra-*T*T 142 MCEIS9.24 143 MCEI59.2S 144 MCEI59.26 M 5 MCEI59.2S 146 HCEt59.29 147 P 62 D i r e c t ; CCCTCk&kTOCTOCkTkT 145 MCE#62.1 MGCkCCTCCTT TTT-OCCTGTkCT c 149 MCE162.2  1998  O  CCC c  c  •CTOCTTMOCCTCAATAAk  Appendix  138  MCEF  151 152 153 154 155 ISt 157 |45S M59 M60 H61 H62 63 «4 <S  t  k67 M68 Mtt (470 71 72 [473 74 |47S 76 k77 71 k79 MIO k a i 82 kl3 M84 HIS MIC 87 It 119 190 1*1 192 193 194 195 196 97 I9t 199 >00 >01 >02 503 104 >05 >06 >07 >0t 109 >10 >11 >12 ill >14 >15 >16 >17 iU >19 >20 »21 >22  MCCI62.5 MCE 162.6 MCCI42.7 MCE*(2.1 HCEI«2.10 HCEt(2.11 P65 D i r e c t MCE 165.5 MCE145.9 M l Direct MCEI31.1 HCEt31.3 HCEI31.5 MCEI31.C MCE131.7 131.1 MCEI31.10 HCEI31.11 MCEI31.12 MCEI31.13 MCE 133.2 MCE 133.4 MCE 133.5 MCE 133.4 MCE 133.t HCEt33.10 MCEI33.11 MCEI33.13 HCEI33.14 HCEt11.IS MCCI33.lt i?34 D i r e c t MCEI34.1 HCEt 14.2 HCEI34.3 HCEI34.4 HCEI34.5 MCEI34.6 HCEI34.9 HCEI34.10 HCEt 34.11 HCEt34.12 HCEt34.11 MCEI35.lt MCEI35.lt HCEt15.31 HCEt35.32 P i t Direct HCEI3t.l HCEI36.2 MCEI3S.3 MCEI36.4 MCEI36.5 MCEI36.6 MCE 136.7 MCEI36.10 MCEI36.11 P39 D i r e c t MCEI39.1 MCEI39.10 MCEI40.3 HCEI40.4 MCE 140.6 MCEI40.8 MCEI40.14 MCEI40.15 MCEI40.17 HCEI40.18 MCEI40.19 LTHP1451 LTNP1750 LTHP2402  1998  OCCTCMiaoCTOCHkT cGCTCMkXOCToanT CCCTCfcflftTTCTOQ^T TCTCTCUCTT1  ^scaMcrcicroacrchC-noacM ccc ACTOCTTJUkaccrcuTJtXk  TcrcicTeBTrM*cc*c*TCTG»occTOOOW  ccc ccc AcracrrjuwccTCUTMk  aXJAIOCTOOTH I cccTCMJtcecreckiftT CCCrCfcOaTOCTOCftXM  ICCCTOOATOC TOOTAT CCCTC*0*TOCTOC»T»T CCCIC*OATOCT«CU»  COCrCAOATOCrOCkTkT cccicao»ocTocknT TCTCTCte-  CCCtCMftTOCTaCkTkT  irtftOMCkATacaMiocToaakacTCTCTaacTMC-i  CCCTCkOftrOCTOCMftT CCCICMUfJCTOCftTkT eMCMCTOCTT TTT-OCCTGTOCT a jMCaocroctt rncoocTOTOCT a cccTc*a*tacracktftT UQCMCTOCTT cccTCMfttocTaekTAT MOCkacracn cccTCAauanack'nT CCCTCMftXOCTOCftnT  a 7ctctctoatty^ceke*.tcoataecTaoaiuaeicicroaenAe-TAaaatik  cccTCMUonackikT CCCtCMUOCTOCftTftT CCCTCfcOUOCTOCftntT I CCCtCMUOCTOChlJtT  lactcmaacTtac-vunax  ccc KTOcraMCCTCMTkM  ccc kCTocTT»koccTCkki*ik  CCCTCAOiUOCTOCftTfcT CCCtCJtflVOCTOCftlfcT Tn-CCCTOTkCT OOO TCTCTCTC«TTAaMCfcGfcTCTO>OCCTCq(i»CCTCTCrOOCIMC-T MLOCMCTOCTT  :cccic*akxaccocHH CCCTCMMTOCMCAtltT CCCTCMI1 w m c t n t  r AMceactacR cccTcoauecMCftTKr AMCkocracn cocrc*ak?ocTOCH» cccTCAauacToc&nT rT-coccTOT*ct ooo T  Appendix  139  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0088705/manifest

Comment

Related Items