UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Electron transfer properties of flavin-modified and axial ligand variants of cytochrome c Twitchett, Mark Bradley 1998

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1998-27263X.pdf [ 7.25MB ]
Metadata
JSON: 831-1.0088692.json
JSON-LD: 831-1.0088692-ld.json
RDF/XML (Pretty): 831-1.0088692-rdf.xml
RDF/JSON: 831-1.0088692-rdf.json
Turtle: 831-1.0088692-turtle.txt
N-Triples: 831-1.0088692-rdf-ntriples.txt
Original Record: 831-1.0088692-source.json
Full Text
831-1.0088692-fulltext.txt
Citation
831-1.0088692.ris

Full Text

E L E C T R O N TRANSFER PROPERTIES O F FLAVIN-MODIFIED AND A X I A L LIGAND VARIANTS O F C Y T O C H R O M E C by Mark Bradley Twitchett B.Sc., The University of East Anglia, 1992 M . S c , The University of East Anglia, 1993  A THESIS SUBMITTED IN PARTIAL F U L F I L L M E N T OF T H E REQUIREMENTS FOR T H E D E G R E E OF D O C T O R OF PHILOSOPHY in T H E F A C U L T Y OF G R A D U A T E STUDIES T H E D E P A R T M E N T OF BIOCHEMISTRY A N D M O L E C U L A R B I O L O G Y  We accept this thesis as conforming to the required standard  T H E UNIVERSITY OF BRITISH C O L U M B I A February 1998 ©Mark Bradley Twitchett  In  presenting  degree  this  at the  thesis  in  partial fulfilment  of  University of  British Columbia,  I agree  freely available for reference copying  of  department publication  this or  and study.  of this  his  or  her  requirements that the  1 further agree  thesis for scholarly purposes by  the  representatives.  may be It  thesis for financial gain shall not  is  for  BiQCMEMlST^  The University of British Columbia Vancouver, Canada  Date  DE-6  (2/88)  \ S  T  n  FEfefeOAK^  A*»t>  advanced  Library shall make it  that permission for extensive granted  by the  understood be  that  allowed without  permission.  Department of  an  MOLHcULAg.  roiOLOSY  head  of  my  copying  or  my written  ABSTRACT  Electron transfer (ET) reactions of metalloproteins are central to many biological processes. This fact combined with the simplicity of the chemistry involved makes this type of reaction amenable to detailed experimental and theoretical analysis. The current work employs two novel forms of mitochondrial cytochrome c to investigate critical structural factors that dictate the efficiency of intermolecular and intramolecular E T reactions of this protein and that have implications for metalloproteins in general. The first of these approaches involved the use of a new technique to study intramolecular E T reactions in which a combination of site-directed mutagenesis and chemical modification was used to construct a family of syntheticflavocytochromesc. Previous studies by Tollin and Cusanovich have used flavins extensively to investigate intermolecular E T reactions of electron transfer proteins, but flavins have not been used previously as donors in the study of intramolecular E T reactions. In the present work, flash photolysis was used to study the intramolecular E T kinetics of four cytochrome variants bearing a flavin group at position 8, 39, 62, or 85. To complement this work, the theoretical models of Beratan, Betts and Onuchic and of Siddarth and Marcus were used to identify the theoretically optimal E T pathways and donor-acceptor electronic coupling for each of these derivatives. A major finding derived from the kinetic studies of these synthetic flavocytochromes is that the reorganization energy for electron transfer, X, of the flavin center is 0.7(2) eV. In addition, the theoretical models for these reactions demonstrate that the correlation of the rate constants for intramoleculer E T observed can be understood in terms of the nature and length of the E T pathway between the donor and acceptor centers. The second approach described in this thesis involved the study of three cytochrome c variants  ii  in which the Met80 ligand to the heme iron was replaced with an alanyl residue. Analysis of the intermolecular reduction of these variants by Fe(EDTA) ' was undertaken to gain insight into the role 2  of the Met80 ligand and two other active site residues in regulating the electron transfer reactivity of the cytochrome. These variants exhibited a remarkable range in reactivity with this reductant as represented by the apparent electrostatics-corrected self-exchange rate constants, £ this reaction (pH 7, u = 0.1 M , 25 °C): Met80Ala, k  cm n  3.4 x 10 ; and Met80Ala/Phe82Ser, k " = 4.3 * lO M 2  co  -2  n  are discussed.  iii  corr 11  , exhibited in  = 1.1 M" s"; Met80Ala/Tyr67Phe, k^" = 1  - 1  1  s". Possible explanations of these results 1  TABLE OF CONTENTS  ABSTRACT  ii  T A B L E OF CONTENTS  iv  LIST OF T A B L E S  ix  LIST OF FIGURES  xi  ABBREVIATIONS  xv  ACKNOWLEDGMENTS  xvii  1.  INTRODUCTION  1.1  Overview  1  1.2  Structural Aspects of Cytochrome c  1  1.3  Physiological Aspects of Cytochrome c  8  1.4  Factors Influencing Reduction Potential  10  1.5  Flavins and Flavoproteins  12  1.6  Remodeling of Heme Protein Active Sites  16  1.7  Electron Transfer Kinetics  20  1.7.1  Overview  20  1.7.2  Intermolecular Electron Transfer  20  1.7.2.1  Theoretical Studies  20  1.7.2.2  Intermolecular Electron Transfer Reactions of Cytochrome c  25  1.7.3  Intramolecular Electron Transfer  29  1.7.3.1  29  Theoretical Studies  iv  1.7.3.2  Intramolecular Electron Transfer Reactions of Cytochrome c  33  1.8  Objectives of this Dissertation  2.  EXPERIMENTAL  2.1  Yeast Expression System  40  2.1.1  Mutagenesis Techniques  40  2.1.2  Protein Preparation  40  2.2  38  Bacterial Expression System  43  2.2.1  Mutagenesis Techniques  43  2.2.2  Protein Preparation  44  2.3  Flavin Preparation  47  2.4  Thiol Assay & Protein Modification  47  2.5  Tryptic Digestion & HPLC Analysis  49  2.6  Spectroscopic Characterization  50  2.6.1  Electronic Absorption Spectroscopy  50  2.6.1.1  General Analysis  50  2.6.1.2  Ligand Binding  50  2.6.1.3  pH Titrations  51  2.7  2.6.2  Fluorescence Spectroscopy  51  2.6.3  Circular Dichroism Spectroscopy  51  2.6.4  Fourier Transform Infrared Spectroscopy  52  Electrochemical Characterization  52  2.7.1  Cyclic Voltammetry  52  2.7.2  Spectroelectrochemical Techniques  54  v  2.8  Kinetic Experiments  57  2.8.1  Flash Photolysis Techniques  57  2.8.2  Fe(EDTA) " Reduction Kinetics  58  2  2.9  Molecular Modeling & Pathway Calculations  3.  RESULTS  3.1  Cysteine Variants & Flavin Modification  60  3.1.1  Protein Preparation  60  3.1.3  Flavin Synthesis  60  3.1.3  Cysteine Accessibility & Flavin Modification  62  3.1.4  Tryptic Digestion and HPLC Analysis  64  3.1.5  Electronic Absorption Spectroscopy  64  3.1.6  Circular Dichroism Spectroscopy  68  3.1.7  Fluorescence Spectroscopy  68  3.1.8  Electrochemistry  72  3.1.9  Flash Photolysis...  87  3.1.9.1  Intermolecular Electron Transfer Kinetics  87  3.1.9.2  Intramolecular Electron Transfer Kinetics  90  3.2  59  3.1.10 Structure Modeling  94  3.1.11 Electron Transfer Pathway Calculations  94  Axial Ligand Variants  100  3.2.1  Protein Expression and Purification  100  3.2.2  Electronic Absorption Spectroscopy  100  vi  3.2.2.1  Ligand Binding  100  3.2.2.2  pH Titrations  101  3.2.3  Circular Dichroism Spectroscopy  104  3.2.4  Electrochemistry  105  3.2.5  Ligand Binding Kinetics  105  3.2.6  Autoxidation  110  3.2.7  Fourier Transform Infrared Spectroscopy  110  3.2.8  Kinetics of Axial Ligand Variant Reduction by Fe(EDTA) " 2  113  4.  DISCUSSION  4.1  Overview  121  4.2  Cysteine Variants & Flavin Modification  122  4.2.1  Protein Characterization  122  4.2.2  Electron Transfer Kinetics  128  4.2.2.1  Intermolecular Electron Transfer Reactions  128  4.2.2.2  Intramolecular Electron Transfer Reactions  132  4.3  Axial Ligand Variants  138  4.3.1  Protein Characterization  138  4.3.2  Electron Transfer Properties  143  4.4  Concluding Remarks  150  5.  REFERENCES  152  APPENDIX A  165  APPENDIX B  171  vii  APPENDIX C  174  APPENDIX D  176  viii  LIST OF TABLES  2.1  Mutagenic oligonucleotides for yeast expression system  40  2.2  Mutagenic oligonucleotides for E. coli expression system  44  3.3  Bimolecular rate constants for the reaction of cytochrome c Cys variants with 4,4-dithiodipyridine  3.4  62  Electronic absorption maxima and molar absorbances for unmodified & flavin modified cytochrome c variants  3.5  67  Fluorescence emission maxima & relative intensities for free and attached 7-acetyl-10-methylisoalloxazine  68  3.6  Electrochemical thermodynamic properties of wild-type and variant cytochromes  74  3.7  pK values for residue 39 in the oxidized (pK ) & reduced ( p . r Q states  76  3.8  Potentials for 7-acetyl-10-methylisoalloxazine ontained from  t  0  spectroelectrochemical experiments 3.9  78  Thermodynamic parameters of the oxidation-reduction equilibria of the flavin-modified cytochromes  3.10  83  pK values for residue 39 in the oxidized (pK ) & reduced (pK ) states of 3  0  r  theflavin-modifiedcytochromes 3.11  84  Potentials for the flavin redox center of modified proteins calculated from spectroelectrochemical experiments  3.12  84  Rate constants for the reduction of cytochrome c (Fe ) variants by various 3+  flavins 3.13  90  Rate constants and activation parameters for the reduction of cytochrome c (Fe ) 3+  ix  variants by various flavins 3.14  90  Observed rate kinetics, activation parameters & reorganization energies for the intramolecular electron transfer of flavin modified cytochrome c derivative  3.15  Amino acid residues selected by A l search and experimental and theoretical electronic coupling values  3.16  91  95  Absorption maxima and molar absorbances of cytochrome c axial ligand variants  102  3.17  Reduction potential values for the axial variants  105  3.18  Kinetic and thermodynamic parameters for the reduction of the axial variants by Fe(EDTA) "  116  2  x  LIST O F FIGURES  1.1  Amino acid sequence of yeast iso-1 -cytochrome c  1.2  The polypeptide fold of yeast iso-l -cytochrome c  1.3  Schematic drawing of iron protoporphyrin IX  5  1.4  The physiological electron transfer partners of cytochrome c  9  1.5  Structures of the vitamin riboflavin & the derived flavin coenzymes and the oxidation states of the flavin coenzymes  3 4  13  1.6  Model of catalytic cycle offlavocytochromeb  1.7  Structural comparison of the active sites of the cyanide adduct of  2  15  Met80Ala cytochrome c & oxy sperm whale myoglobin  19  1.8  Potential energy curves representing an electron transfer reaction.  23  1.9  The dependence of electron transfer rate on free energy  31  1.10  Electron transfer pathways and correlations of maximum electron transfer rates with distance in Ru(HisX) modified cytochromes c  37  2.11  Physical map of pING4 for the expression of yeast iso-l -cytochrome c in yeast  41  2.12  D N A sequence of the Smal-Hindlll fragment of pING4  42  2.13  Physical map of pBPCYCl(wt)/3 for the expression of yeast wo-1-cytochrome c in bacteria  45  2.14  D N A sequence of the Kpnl-Hindlll fragment of pBPC YC1 (wt)/3  46  2.15  Outline of synthesis of 7a-bromoacetyl-10-methylalloxazine  48  2.16  A schematic diagram of the cyclic voltammetry cell  53  2.17  Schematic representation of the optically-transparent thin layer electrode cell  55  xi  3.18  N M R spectra of 7-acetyl-10-methylalloxazine and 7a-bromoacetyl-10-methylalloxazine  61  3.19  Thiol assay kinetic traces demonstrating solvent accessibility of cysteine residues  63  3.20  FPLC elution profiles monitoring flavin attachment to His39Cys cytochrome c  65  3.21  H P L C analysis of tryptic peptides for wild type cytochrome c, the His39Cys variant, and the flavin modified His39Cys variant  3.22  66  The electronic absorption spectra of free 7-acetyl-10-methylisoalloxazine, reduced Thr8Cys cytochrome c andflavinmodified reduced Thr8Cys cytochrome c  69  3.23  C D spectra of Thr8Cys cytochrome c andflavinmodified Thr8Cys cytcohrome c  70  3.24  Fluorescence emission spectra of the free 7-acetyl-10-methylisoalloxazine and modified F£is39Cys cytochrome c variant  3.25  Cyclic voltammograms for Thr8Cys cytochrome c, 7-acetyl-10-methylisoalloxazine and flavin modified Thr8Cys cytochrome c  3.26  71  73  The temperature dependence of reduction potentials for cytochrome c cysteine variants  75  3.27  The pH dependence of reduction potential for cytochrome c cysteine variants  77  3.28  The pH dependence of the three reduction potentials of 7-acetyl-10-methylisoalloxazine  79  3.29  Spectroelectrochemical titration of 7-acetyl-10-methylisoalloxazine  80  3.30  The temperature dependence of reduction potentials of heme andflavincenters of flavin modified cytochrome c variants and free 7-acetyl-10-methylisoalloxazine  3.31  82  Dependence of the reduction potentials for heme centers of flavin-modified cytochromes on pH  85  xii  3.32  Spectroelectrochernical titration of flavin modified Thr8Cys cytochrome c  3.33  The dependence of k  obs  on [ferricytochrome c] in the reduction of cytochrome c  by flavin derivatives 3.34  86  88  Eyring plots for the bimolecular reduction of horse heart and yeast cytochromes by flavin derivatives  89  3.35  Eyring plots for the intramolecular reactions of flavin modified cytochromes c  92  3.36  Dependence of k  on - A G for the reduction of cytochromes c by the 0  oba  covalently attached flavin 3.37  93  Energy-minimized structure of flavin modified Thr8Cys cytochrome c and proposed electron transfer pathways  3.38  96  Energy-minimized structure of flavin modified His39Cys cytochrome c and proposed electron transfer pathways  3.39  97  Energy-minimized structure of flavin modified Asn62Cys cytochrome c and proposed electron transfer pathways  3.40  98  Energy-minimized structure of flavin modified Leu85Cys cytochrome c and proposed electron transfer pathways  3.41  99  Electronic absorption spectra of oxidized and reduced cytochrome c axial ligand variants  3.42  103  The electronic absorption spectra of Met80Ala ferricytochrome c as a function of pH  106  3.43  Thermal denaturation of cytochrome c axial ligand variants  107  3.44  Spectroelectrochernical titration of Met80Ala/Tyr67Phe cytochrome c  108  3.45  Transient absorption kinetics for the recombination of CO with Met80Ala  xiii  cytochrome c following photodissociation  109  3.46  Absorption spectra following the autoxidation of Met80Ala cytochrome c  Ill  3.47  Infrared spectra (FTIR) of ferrous carbonyl derivatives of cytochrome c axial ligand variants  3.48  112  Absorption spectra monitoring the reduction of Met80Ala cytochrome c by Fe(EDTA) '  117  2  3.49  Absorption spectra monitoring the reduction of Met80Ala/Tyr67Phe cytochrome c by Fe(EDTA) '  118  2  3.50  Dependence of the observed rate constants for reduction of ferricytochrome c axial ligand variants on Fe(EDTA) ' concentration 2  3.51  Eyring plots for the Fe(EDTA) " reduction of ferricyochrome c axial 2  ligand variants 4.52  120  Structural diagrams of the region about the cysteine mutation sites in the Thr8Cys, His39Cys, Asn62Cys and Leu85Cys cytochrome c variants  4.53  129  Correlations of maximum E T rates inflavin(CysX) modified cytochromes c and Ru(HisX) modified cytochromes c with distance  4.55  123  Structures of flavins involved in intermolecular electron transfer reactions with cytochromes c  4.54  119  134  Space filling representations of cytochromes c showing heme solvent accessibility  140  xiv  ABBREVIATIONS A  angstrom  AI  artificial intelligence  bpy  bipyridyl  CD  circular dichroism  DNA  deoxyribonucleic acid  DTT  dithiothreitol  EDTA  Ethylenediaminetetracetate  ESR  electron spin resonance  ET  electron transfer  eV  electron volt  FAD  flavin adenine dinucleotide  FC  Franck-Condon  Fl-  flavin-modified  flox  flavin, oxidized  flred  flavin, reduced  A H-  flavin, semiquinone  FMN  flavin mononucleotide  FPLC  fast protein liquid chromatography  H.S.  high-spin  HPLC  high performance liquid chromatography  L.S.  low-spin  mV  millivolt  sq  NADH  nicotinamide adenine dinucleotide  nm  nanometer  NMR  nuclear magnetic resonance  OTTLE  optically transparent thin-layer electrode  SCE  saturated calomel reference electrode  SHE  standard hydrogen electrode  TFA  trifluoroacetic acid  TLC  thin-layer chromatography  TML  trimethyllysine  TPCK  N-tosyl-L-phenylalanine chloromethyl ketone  UV  ultraviolet  xvi  ACKNOWLEDGMENTS  I would like to acknowledge the many people who have helped and supported me throughout my studies. I would especially like to thank my supervisor Grant Mauk, for his support and guidance. Thank you for everything. Heart warm thanks must also go to all the members of the Mauk lab, both past and present: Brent, Cameron, Christie, Dean, Emma B., Emma L . , Fred, Kimphry, Lianglu, Marcia, Mark, Matt, Ralf, Sue, Susanna, and Tom. Many thanks to my committee members, Gary Brayer and Steve Withers, for reviewing my thesis. I must give a special thank you to Prabha Siddarth, both for her helpful discussions and for her work involving the molecular modeling and the pathway calculations. Thanks also to all those fellow biochemists who have become friends along the way. On a more personal level I would like to thank my family, especially mum, dad, nan and gramps, for their loving support and understanding in my decisions to pursue my goals where ever they took me. I'm sorry this usually meant taking me thousands of miles away from home. Nevertheless, you were always there for me, and it was wonderful to know that. Finally, I wish to thank my wife and best friend Sharon, for her support, patience and above all, love. I just want you to know that I could not have succeeded alone.  xvii  In memory of Lil.  xviii  1. I N T R O D U C T I O N  1.1  Overview Electron transfer reactions are central to many biological processes such as respiration,  photosynthesis and xenobiotic detoxification. As a result, theoretical and experimental studies concerning such reactions have been extensive. The mitochondrial electron transfer protein cytochrome c has frequently been used in this body of work because its structure and functional properties have been well characterized, it is thermodynamically stable and readily available, and it is readily amenable to chemical modification or to site-directed mutagenesis (Pettigrew & Moore, 1987; Moore & Pettigrew, 1990; Scott & Mauk, 1996). While the wealth of literature concerning biological electron transfer reactions has led to a general understanding of the physical factors that dictate electron transfer within proteins such as cytochrome c, our understanding of the relative importance and quantitative contributions of these factors is incomplete. As described later, the work presented in this dissertation addresses some of these issues through investigation of yeast iso-lcytochrome c derivatives that have been produced by site-directed mutagenesis and chemical modification. Before considering this work in detail, however, it is useful to review briefly the literature that provides the basis for the present studies.  1.2  Structural Aspects of Cytochrome c The family of eukaryotic cytochromes c is one of the most extensively examined groups of  proteins. The amino acid sequences of approximately 100 species have been determined (Cutler et al., 1987; Moore & Pettigrew, 1990) and three-dimensional structures of six species of mitochondrial cytochromes c have been elucidated: Saccharomyces cerevisiae iso-\ (Louie & Brayer, 1990;  1  Berghuis& Brayer, 1992) and iso-2 (Murphy etal., 1992), horse heart (Dickerson  al., 1967,1971;  Bushnell et al., 1990), tuna (Takano & Dickerson, 1981a,b), rice (Ochi etal, 1983), and bonito (Tanakaef a/., 1975). In general, mitochondrial cytochromes c are small, soluble, basic proteins composed of a single polypeptide chain of 103 to 113 residues. A relatively high degree of sequence similarity is observed between these cytochromes, with 23 residues being invariant among 96 of the known sequences. Of the remaining residues only 14 are highly variable (variability index >15 (Wu & Kabat, 1970; Moore & Pettigrew, 1990)). The amino acid sequence for yeast iso-l -cytochrome c, the protein studied in this work, is given in Figure 1.1. The positions of the invariant and highly variable residues are indicated in this diagram. All c-type cytochromes possess an iron porphyrin prosthetic group as exemplified by the crystal structure of yeast cytochrome (Louie & Brayer, 1990) (Figure 1.2). The prosthetic group is covalently bound to cysteine residues of the polypeptide chain through two thioether linkages by the post-translational attachment of heme (Thony-Meyer, 1997). The two cysteine residues are located at position 14 and 17 and are part of the characteristic sequence, Cys-X-X-Cys-His. The His 18 residue provides one of the two axial ligands. The heme iron is coordinated to the e2 nitrogen of this residue. The second axial ligand to the iron is provided by the sulfur atom of Met80. The heme group (Figure 1.3) is 'saddle' shaped due to the constraints caused by the two covalent linkages through pyrrole rings B and C. The remaining two pyrrole rings, A and D, each bear a single propionate group and each of these groups is buried within the protein structure. The majority of the heme group is, in fact, buried within the protein matrix, and only five heme atoms (CMD, CHD, C A C , CBC, and CMC) are exposed to the surrounding solvent. These five atoms constitute 9.5% of the heme surface area (Brayer & Murphy, 1996).  2  -5 Thr  Glu  Phe  Lys  Ala 10  1  Gly  Ser  11 Lys  Thr  21 Glu  Lys  31 Asn  Leu  Ala  Lys  Lys  Gly  Ala  Thr  Leu  Phe  Cys  Leu  Gin  Cys  His  Tru-  20 Val  Gly  Gly  Pro  His  Lys  Val  dy  Pro  His  Gly  He  Phe  Gly  Arg  His  40 Ser  Thr  50 Asp  Trp  60 Asp  Arg  30  41  Gly 51 Ala 61 Glu  Gin Asn  Ala lie  Glu Lys  Gly Lys  Tyr Asn  Ser Val  Tyr Leu  Ser  Glu  Tyr  Leu  Thr  70 Asn  Tyr  He  Pro  Gly  Thr  Lys  Met  Gly  Gly  Leu  Lys  Lys  Glu  Lys  90 Asp  Asn  Asp  Leu  He  Thr  Tyr  Leu  Lys  100 Lys  Cys  103 Glu  Asn  Asn  Pro  Lys  Lys  81 Ala  Phe  Arg 101 Ala  Met  80  71  91  Figure 1.1 Amino acid sequence of yeast /so-1-cytochrome c (Narita & Titani, 1969). Residues shown in bold are invariant among 96 known mitochondrial sequences and italicized residues have a variability index of greater than 15 (Moore & Pettigrew, 1990). Lysine 72 is trimethylated. Residue numbering is based on the sequence of tuna and horse cytochrome c.  3  Figure 1.2 The polypeptide fold of yeast iso-l -cytochrome c. The heme and axial ligands Hisl8 and Met80 are shown in bold (Louie & Brayer, 1990).  4  Figure 1.3 Schematic drawing of iron protoporphyrin IX. The atoms and the four pyrrole rings are labelled according to the Protein Data Bank nomenclature (Bernstein et al, 1977). Pyrrole rings C and D define the more exposed heme edge of cytochrome c and the porphyrin ring is covalently bound to the protein through two thioether linkages (CAB to C y s H a n d C A C t o Cysl7).  5  The polypeptide chain is predominantly oc-helical with -45% of the amino acid residues involved in 5 a-helical segments (residues 2-14, 49-55, 60-70, 70-75 & 87-102). Other secondary structural elements include five type II p-turns. These p-turns account for the conservation of 5 glycyl residues (23, 34, 37, 45 & 77) within the cytochrome c family because only a hydrogen atom can be accommodated at residue Rj+2 of each p-turn. The internal residues surrounding the heme group are bulky, hydrophobic groups. Conversely a large proportion of the exposed surface residues are charged. The yeast iso-1cytochrome possesses sixteen lysyl residues, three arginyl residues, four histidyl residues and a pi value of 10 (Kim et al,  1980). The charged residues are distributed around the surface in an  asymmetrical manner with the positive lysyl residues occupying positions around the exposed heme area and on the back and top of the protein (with respect to the protein orientation shown in Figure 1.2). The basic regions are thought to be important for the interaction with other electron transfer proteins and to facilitate electron transfer reactions of the cytochrome c with such proteins. Complexes of this type are discussed in further detail in section 1.3 (Page 8). Experimental evidence that the two oxidation states of cytochrome c have different structural features has been presented for over 40 years. As early as the late 1950s it was demonstrated that ferrocytochrome c is more resistant to proteases, specifically subtilisin and trypsin, than is ferricytochrome c (Nozaki et al,  1958, Yamanaka et al,  1959). Since that time, a variety of  techniques including thermal and chemical denaturation (Butt & Keilin, 1962; Dickerson & Timkovich, 1975) and one-dimensional N M R studies (Moore 1983; Williams etal, 1985) have been used to establish further the existence of conformational structural differences. For a recent review of these studies the reader is referred to Margoliash & Schejter (1996). Information on the oxidation state linked structural changes remained elusive until the  6  publication of the crystal structures of the oxidized and reduced forms of cytochromes c isolated from tuna (Takano & Dickerson, 1980, 1981a,b) and yeast (Berghuis & Brayer, 1992). The latter structures are discussed here since the yeast iso-1 -cytochrome c is the protein studied in this thesis. Only small localized perturbations in the positions of the polypeptide backbone atoms occur with a change in oxidation state. The majority of these differences occur in the polypeptide region which packs against the left side of the heme group (with respect to the protein orientation shown in Figure 1.2). These changes are thought to stabilize the positive charge on the oxidized heme iron (See section 1.4, Page 10). The structural changes that accompany oxidation include the loss of a hydrogen bond between Met80 SD and Tyr67 OH, a large displacement of the internal water Watl66 (1.7A change) and a change in the hydrogen bond network involving Wat 166, Asn52 and the heme propionate on pyrrole A. This latter conformational change is also proposed to be involved in the oxidation state dependence of the His39 pK owing to the proximity of the heme propionate group a  (Moore et al., 1984). Because this His residue contributes to the pH dependence of the reduction potential exhibited by/so-1-cytochrome c, a discussion on this topic is presented in section 1.4 (Page 10). Recently the N M R solution structure of both the oxidized and reduced yeast /so-1cytochromes c have been determined (Baistrocchi etal., 1996; Banci etal., 1997). These structures show that the secondary structure features are similar in both oxidation states. The oxidized protein exhibits greater flexibility in the residue segments 14-26 and 75-82. Thisflexibilityis thought to be responsible for the observed increase in the rate of rotation of the Tyr67 side chain upon oxidation. In addition, the solution structures show a change in the hydrogen bond network between the heme propionate on pyrrole A and residue Gly41. This change is consistent with the corresponding crystal structures. These subtle changes observed in the yeast iso-1 -cytochromes c solution structures differ  7  from those observed in the horse heart cytochromes c. Comparison of the horse heart protein structures reveal relatively large changes upon oxidation. These changes include a disruption of ahelices and a significant difference in the heme solvent accessibility (Qi etal., 1996).  1.3  Physiological Aspects of Cytochrome c The major function of mitochondrial cytochrome c is to transfer electrons along the  respiratory electron-transport chain. In this process, cytochrome c acts as a reversible, single electron carrier which shuttles electrons between ubiquinol-cytochrome c oxidoreductase (complex III) and cytochrome c oxidase (CcO) (complex IV) within the inter-membrane space (Figure 1.4). The ability of cytochrome c to transfer electrons efficiently between these two membrane bound electron transfer partners is dependent upon both a finely tuned reduction potential and the formation of reactive protein-protein complexes. In addition to this central role, cytochrome c also interacts with other mitochondrial electron transfer proteins (Figure 1.4) (See review in Pettigrew & Moore, 1987). These interactions include complex formation with sulphite oxidase (liver) and cytochrome c peroxidase (yeast, bacteria), both of which are involved in detoxification pathways, and flavocytochrome  b  2  (yeast lactate  dehydrogenase) and cytochrome b , which allow cytochrome c to channel electrons from two other 5  pathways to cytochrome c oxidase. As mentioned previously, the surface of the protein surrounding the partially exposed heme edge of cytochrome c contains a large number of positively charged lysyl and arginyl residues. This region of the protein surface has been shown by experimental (e.g. Speck et al, 1979, 1981; Rieder &J3osshard, 1980; Speck & Margoliash, 1984; Pelletier& Kraut, 1992;Northrupe/(3/., 1993; Mauk etal, 1995) and by computational techniques (e.g. Poulos & Kraut, 1980; Mauk etal, 1986;  8  •illil  CcR  CcO  1111111  0 + 4H 2  +  11111111111111  Inner membrane  2H 0 2  Figure 1.4 The physiological electron transfer partners of cytochrome c (Derived from Pettigrew & Moore, 1987). Abbreviations: CcR, ubiquinol cytochrome c oxidoreductase; CcO, cytochrome c oxidase; Cc, cytochrome c; CcP, cytochrome c peroxidase; SO, sulfite oxidase; b , flavocytochrome b ; b , cytochrome b . The arrowheads denote direction of electron transfer. 2  2  5  5  9  Pettigrew & Moore, 1987; Northrup et al, 1988; Tegoni et al, 1993) to be important in the formation of all these protein-protein complexes. The most extensively studied complexes of this type are the cytochrome c-cytochrome c peroxidase (Nocek etal, 1996) and cytochrome c-cytochrome b  (Mauk et al, 1995) complexes. In both these systems, the protein complexes appear to be  5  stabilized by charge complementarity between the interacting protein surfaces (Salemme 1976; Mauk etal, 1986; Eltis etal, 1991; Northrup etal, 1993; Poulos& Kraut 1980; Pelletier& Kraut, 1992). Nevertheless, despite this ability to form closely packed complexes, the heme groups associated with each protein involved are still separated by an appreciable distance (7-18 A heme edge to heme edge distance) that confirms the important involvement of long range electron transfer in such systems.  1.4  Factors Influencing Reduction Potential For optimal transfer of electrons, mitochondrial cytochromes c possess midpoint reduction  potentials which fall approximately midway between the respiratory chains initial electron donor coupling process ( N A D 7 N A D H couple, -320 mV) and final electron acceptor coupling process ( 0 / H 0 couple, +820 mV) (Pettigrew & Moore, 1987). This requirement leads to the conservation 2  2  of the reduction potentials of these cytochromes c such that variations are limited to ~ ± 2 0 mV from an average value of 270 mV. The reduction potentials of heme containing proteins are dependent upon a number of factors that include the nature of the porphyrin, the axial ligands and the dielectric environment surrounding the heme (Moore & Williams, 1977; Moore et al, 1986; Moore & Pettigrew, 1990). The influence ofthe medium surrounding the heme center is substantial. This influence is exemplified by the work of Kassner (1972, 1973) that shows the reduction potential of bipyridine mesoheme methyl ester is 300 mV higher in benzene than in water. Similarly, if mitochondrial cytochrome c is compared to N-  10  acetyl methionine cytochrome c heme octapeptide the reduction potential value for the intact protein is shown to be over 300 mV higher (Harbury et al, 1965). These variations are related to the ability of the surrounding dipoles and charges to accommodate the change in the overall charge on the heme. As such, studies have been carried out comparing the amount of heme exposure with reduction potential values within different proteins (Stellwagen,  1978; Schlauder & Kassner, 1979). Unfortunately, this analysis suffers from  oversimplification because the nature of the porphyrin and the axial ligands are not considered. Although all mitochondrial cytochromes c contain a His and a Met residue as axial ligands, a number of heme proteins are known in which the sixth ligand site, normally occupied by the Met, is either vacant or is occupied by a second His group. Coordination environments of this type are found in such proteins as myoglobin ( E = +61 mV, Lim, 1990), cytochrome c peroxidase ( E = -190 m  mV, Conroy et al,  m  1978), cytochrome b ( E = +5 mV, Reid, 1984) and class III bacterial s  m  cytochromes c ( E = -400 - -100 mV, Moore & Pettigrew, 1990). m  In addition the effect of substituents on the porphyrin ring must be considered. These effects are generally small as shown by the reduction potential differences between proteins containing c-type heme and protoheme IX (20-40 mV difference) (Williams, 1959; Falk, 1964; Barker et al, 1993). Of further note are the factors that dictate the pH dependence of the cytochromes reduction potential. For /so-1-cytochrome c the protein region surrounding the heme propionate on pyrrole A is thought to be responsible for the observed pH dependence (Moore et al, 1984). This region includes residues Arg38 and His39. Arg38 is known to undergo an oxidation-state conformational change (Berghuis & Brayer, 1992) and this change may be responsible for the oxidation-state linkage of the pAT of the nearby His39 residue. The effect of this localized electrostatic change is to reduce a  the reduction potential of the protein by -23 mV as the pH of the aqueous environment passes  11  through the histidine pK value. Indeed, if this His39 residue is modified, the potential of the a  cytochrome in independent of pH (Moore etal., 1984). Thus this pH dependence provides a valuable indicator of perturbations of this region of the cytochrome.  1.5  Flavins and Flavoproteins Flavoproteins are versatile biological electron transfer agents that are involved in catalysis  of a wide variety of reactions that include substrate dehydrogenation and the activation of dioxygen (Massey & Hemmerich, 1982; Massey & Ghisla, 1983; Stankovich, 1989). Flavoproteins usually contain either flavin mononucleotide (FMN) orflavinadenine dinucleotide (FAD) (Figure 1.5), with the flavin generally being bound tightly but non-covalently to the protein. A small number of flavoproteins are found in which the flavin cofactor is covalently bound to the protein (Steenkamp etal, 1978; Mclntire etal, 1985), through a cysteine, histidine or tyrosine residue. Regardless of the binding interactions the reactive center of the F M N or F A D is the isoalloxazine moiety of the flavin prosthetic group (Figure 1.5). This ring system provides the flavin with the ability to transfer either a single electron or to transfer two electrons simultaneously. The protein environment of the flavin group controls the kinetics and thermodynamics of the electron transfer properties of the flavin and, therefore, determines whether the flavin engages in a one or two electron transfer process. The flavin can exist in the oxidized, semiquinone and fully reduced oxidation states (Figure 1.5). These three oxidation states are spectroscopically distinct. The oxidized, semiquinone and fully reduced forms are yellow, blue or red, and colorless, respectively. The existence of two distinct semiquinone forms is related to the protonation state of the flavin radical (pK = ~ 8-9). With flavins a  free in solution, these semiquinone radicals are in fast equilibrium with the oxidized and reduced forms, so only a small proportion of the flavin occurs in the radical form (Massey & Hemmmerich,  12  NHj O  O  -O—P—O—P—O  CH,-  I I  O- CHOH  OH  Isoalloxazine ring  Riboflavin (B ) 2  • Flavin mononucleotide (FMN)Flavin Adenine Dinucleotide (FAD)  R CH  . ^ O  H  + e- C H  L *—  H+ e- C H  3  3  1  CH  Quinone (Oxidized)  CH  Semiquinone  Hydroquinone (Fully reduced)  Figure 1.5 (Top Panel A) Structures of the vitamin riboflavin and the derived flavin coenzymes, flavin mononucleotide (FMN) and flavin adenine dinucleotide (FAD). (Bottom Panel B) Oxidation states of flavin coenzymes; oxidized, semiquinone and fully reduced.  13  1980; Draper & Ingraham,1968). This behavior is a consequence of the thermodynamic instability of the semiquinone as demonstrated by the two half-reaction reduction potentials of flavin mononucleotide (FMN), (E,°, fl -fl H ox  sq  = -238 mV and E °, 2  fl^H-fl H red  = -172 mV) (Draper &  2  Ingraham, 1968). In contrast, when this flavin is bound within a protein environment, the reduction potentials change. This change is due to the ability of the protein to stabilize the radical and fully reduced forms of the flavin. An excellent example of this stabilization is displayed by the enzyme flavocytochrome b . This protein is found in the mitochondrial inter-membrane space and is responsible for the 2  coupling of L-lactate dehydrogenation to the reduction of cytochrome c (Figure  1.3).  Flavocytochrome b contains both a flavin binding domain and a heme binding domain that are linked 2  by a short peptide hinge (Xia & Mathews, 1990). Upon reduction of the F M N group to the fully reduced state by the two electrons generated from the L-lactate dehydrogenation, the reduction potentials associated with the flavin group are shifted to +71 mV (E°, Efl -Efl ') and -133 mV (E °, ox  sq  2  (Tegoni et al, 1986). These values result in the stabilization of the semiquinone form  Efljq'-EflredH)  and ensure that only a single electron is transferred to the heme group ( E = -18 mV) (Figure 1.6). 0  The rate constant of electron transfer from the flavin to the flavocytochrome b heme is >1500 s"  1  2  (Chapman et al., 1994; Hazzard et al, 1994) and reflects the moderate thermodynamic driving force of  this reaction (100 mV). The reduced heme group then rapidly donates this electron to a  cytochrome c molecule. The transfer of the second electron from the flavin semiquinone to the heme group of the flavocytochrome b is impeded because the potentials of the two centers are now +71 2  mV (Efl -Efl ") and -18mV (heme). For the second electron to be transferred, it is believed that the ox  sq  bound pyruvate product must dissociate from the enzyme. The F M N potentials in the pyruvate-free enzyme shifts to -16 mV (Efl -Efl ") and -60 mV (Efl^'-Efl^H), thus allowing the transfer of the ox  sq  14  Lactate F1H  Fl H-Pyruvate Efl /Efl Efl /Efl, red E° heme ox  sq  s  Efi /Efl Efl^/EfU  -16mV -60mV -16mV  ox  heme  F1H Pyruvate ^  sq  =+71mV =-133mV = -18mV  Fl H-Pyruvate  C  c  Figure 1.6 Model of catalytic cycle of flavocytochrome b . Numbers denote order in which steps in cycle proceed. Reduction potential values given are for the flavin and heme redox centers at that particular step in the cycle. Abbreviations: Fl, flavin mononucleotide; H , flavocytochrome Z>-heme; Cc, cytochrome c,electron (Modified from Daff et al, 1996). 2  2  15  second electron to the heme group ( E = -16±5 mV). This second electron transfer reaction is 0  relatively slow (120 s' ) and is thought to be the rate limiting step of the flavocytochrome b catalytic 1  2  cycle (Daff et al., 1996). This process clearly demonstrates the ability of flavocytochrome b to 2  mediate electron transfer between a one electron and a two electron process. Numerous studies have been conducted to probe the active sites of flavoproteins and investigate the factors that regulate the reduction potential of the bound flavin. For a recent review of these studies see Mayhew et al. (1996). In addition to this body of work, flavins have been attached to various proteins that are otherwise devoid of such a cofactor. These synthetic flavoproteins have enabled the investigation of such processes as substrate oxidation/reduction (Levine & Kaiser, 1978; Hilvert et al., 1988; Mihara et al., 1993, Shumyantseva et al., 1996) and D N A repair (Carell & Butenandt, 1997). From studies of this type, it is apparent that flavin modification of proteins can introduce novel and useful functional attributes that may offer theoretical insight into existing flavin mediated processes.  1.6  Remodeling of Heme Protein Active Sites As with flavins, the protoheme IX prosthetic group is found in a large number of proteins  and participates in a wide variety of biological functions. These functions include electron transfer (cytochromes), oxygen storage and transport (myoglobins and hemoglobins), substrate oxidation (peroxidases) and substrate hydroxylation (mono-oxygenases). This functional diversity results from the protein environments in which the heme prosthetic group is located (e.g. Dawson, 1988). Consequently, an understanding of the manner in which these proteins regulate the reactivity of the heme is of fundamental importance. One approach to evaluating the effect of environment on heme reactivity has been to introduce structural features of one heme protein into the active site of another  16  by site-directed mutagenesis. Examples of such studies include the engineering of the active site of myoglobin to mimic the structural attributes of cytochrome b and catalase by replacement of the }  distal residue Val68 with His (Lloyd et al, 1995) and the proximal His93 residue with tyrosine (Hildebrand etal, 1995), respectively. Cytochrome c has also proven to be amenable to studies of this type. Initial studies involving the alteration of the axial ligands to the heme iron produced cytochromes of varying functionality (Hampsey et al, 1986; Sorrell et al, 1989). Replacement of the Hisl8 axial ligand was particularly intriguing but unfortunately these variants could not be obtained in sufficient quantity to permit detailed spectroscopic studies, so the coordination environment of the Hisl8Arg variant remains equivocal. This problem was overcome to an extent by the technique of chemical semi-synthesis. This strategy was pioneered by Offord and Wallace (Rees & Offord, 1976; Wallace, 1993) and allows the production of reasonable quantities of modified protein. Recent studies (Raphael & Gray, 1989; Raphael & Gray, 1991; Wallace & Clark-Lewis, 1992) have concentrated predominantly on the replacement of the axial Met80 ligand with both naturally occurring residues (His, Leu, Cys, and Ala) and with non-coded amino acids (selenomethionine, cyanoalanine and norleucine). Of particular interest among these variants was the Met80Cys cytochrome c. This variant exhibited a shift in reduction potential of well over 600 mV to -390 mV. This value is remarkably similar to the potential of cytochrome P-450 (-360 to -170 mV) (Huang et al, 1986) in which the axial ligands are a Cys residue and a water molecule. A second axial ligand cytochrome variant exhibiting notable characteristics possessed the Met80Ala substitution. This protein displayed spectroscopic properties of a penta-coordinated, highspin heme and displayed the ability to bind oxygen in a manner similar to myoglobin (Wallace and Clark-Lewis, 1992). Interestingly these authors reported a reduction potential of 185mV for this  17  variant. Unfortunately this value was determined by a single point equilibrium technique due to limited quantities of material (Wallace and Clark-Lewis, 1992) and was thus subject to a large experimental error. Further work on this variant was pursued by various groups and led to improved yields from both semisynthetic techniques (horse heart cytochrome c) (Bren and Gray, 1993 a, b) and site-directed mutagenisis (Yeast iso-l-cytochrome c) (Lu et al, 1993). This achievement enabled extensive spectroscopic characterization of this variant (Banci etal, 1995b; Bren etal, 1995; Bren, 1996) and culminated in the elucidation of the three-dimensional solution structure of the cyanide adduct of the protein (Banci et al, 1995a) (Figure 1.7). These studies all demonstrated that the Met80Ala cytochrome c variant could bind many small exogenous ligands. The oxygen and carbon monoxide derivatives of the reduced variant actually possessed greater ligand affinities than myoglobin. Specifically, Met80Ala was observed to bind 0 with an affinity o£K=  2  2.6 ± 1 . 4 uM" , in comparison to Mb which bound with a value ofK= 0.4-1.2 1  uM" (Antonini and Brunori, 1971). Moreover the Met80Ala variant was found to auto-oxidize with 1  a rate constant of k = 0.01 h' (Bren and Gray, 1993a), a value much lower than that observed for 1  ox  Mb (k = 0.08-0.22 h") (Brown and Mebine, 1969). It was suggested that the relatively high affinity 1  ox  for dioxygen is attributable to a hydrogen-bond involving the ligand and a nearby tyrosyl residue (Tyr67) (Figure 1.7). A similar stabilizing interaction is observed in Ascaris hemoglobin (De Baere et al, 1994, Kloek et al, 1994). The involvement of this Tyr residue was also implicated in the reduction of the pK of the coordinated water to a value of 6.5, 3 pK units lower than that for a  myoglobin. Of further note is the suggestion that the residue Phe82 may play a role in the stabilization of the oxygenated derivative. This stabilization may result from favorable interactions between the Phe residue and the heme bound dioxygen group. A stabilizing effect of this type is seen in the  18  Figure 1.7 Structural comparison of the active sites of the cyanide adduct of Met80Ala cytochrome c (Banci et al, 1995b) and oxy sperm whale myoglobin (Phillips, 1980). The hydrogen bond between the ligand and residue Tyr67 in Met80Ala cytochrome c is denoted by the dotted line.  19  myoglobin variant Leu29Phe (Carver et al, 1992). In addition to these active site interactions, the ligand binding site is considered to be protected from the exterior solvent by the surrounding protein matrix. These steric factors decrease the ability of the bound ligand to dissociate from the protein into the surrounding solvent (Bren and Gray, 1993).  1.7  Electron Transfer Kinetics  1.7.1  Overview Electron transfer reactions are the simplest form of chemical reactions. As such they are  amenable to both in depth theoretical description and to detailed mechanistic evaluation. Electron transfer reactions can be divided into two categories, namely intermolecular and intramolecular. Intermolecular reactions involve the transfer of electrons between donor and acceptor sites located in two separate molecules. Intramolecular reactions involve electron transfer between donor and acceptor sites within a single molecule. For the purpose of this thesis, the introduction to the theory and associated experimental work will be organized under these two subheadings.  1.7.2  Intermolecular Electron Transfer  1.7.2.1 Theoretical Studies Intermolecular electron transfer reactions can be classified as either inner-sphere or outersphere. Inner-sphere reactions generally involve the transfer of the electron via an intermediate in which the reactants share a bridging ligand in their inner coordination shells. In contrast, outer-sphere reactions involve electron transfer without modification of the ligands coordinated. Outer-sphere reactions are more biologically relevant since electron transfer between proteins generally occurs through weak through-space interactions.  20  Bimolecular outer-sphere electron transfer reactions can be represented by the following expression (Scott et al, 1985)  D +A  (D--A) — ( D  +  - - A " ) <-^->  D + A" +  [1]  where D and A are the electron donor and acceptor respectively. Initially, the donor and acceptor reagents form the non-covalent precursor complex ( D — A ) . The electron transfer then produces the successor complex (D —A') which then dissociates to generate the separate oxidized and reduced +  products. The rate of electron transfer for these intermolecular reactions is therefore not only dependent upon the factors that dictate k but also on those which affect the formation of the et  precursor complex. These latter factors include diffusion rates, electrostatic interactions and hydrophobic interactions. In many cases, these factors are major determinants of the overall rate of reaction. To aid in understanding the concepts involved in the electron transfer reaction (£ ), the et  potential energy states of the nuclei in the complex can be visualized as two dimensional curves (Figure 1.8). These simplified curves represent the free energy as a function of nuclear coordinates of the precursor and successor complexes. The curves are parabolic because the assumption is made that the participating chemical bonds obey Hooke's law and act as simple harmonic oscillators. To satisfy the Franck-Condon principle, as applied to electron transfer reactions (Libby, 1952), the nuclear coordinates must distort to a conformation that is energetically common to both potential surfaces. This point is the intercept of the two curves. The energy difference at this point (AE) is a measure of the electronic interactions between the donor and acceptor. For strong  21  interactions, the splitting (AE) is large and creates a high probability for the conversion of the precursor to the successor complex. At the limit of this splitting, A E becomes sufficiently large to cause unit probability for electron transfer. This electron transfer reaction is an example of an adiabatic reaction. Although these adiabatic reactions are dominant in small molecule electron transfer reactions, the majority of biological electron transfers are likely to occur via non-adiabatic behavior (Scott et al, 1985). This non-adiabatic dominance in biological systems is attributed to the weak electronic interactions between the donor and the acceptor centers that result from the relatively large distances that separate these two centers. Thus, the electronic coupling energy A E becomes small, and the probability that non cross-over will occur is increased. To reach this transition point for electron transfer (the intercept), the system must have sufficient vibrational energy to overcome the activation barrier (AG*). According to transition-state theory, this energy barrier dictates the rate of cross-reaction (k ), as defined by the following 12  expression:  k  = RT/Nh exp <*  [2]  at/RT)  l2  where the term RT/Nh represents the vibrational frequency of the reactants. The activation free energy (AG*) is dependent upon the reaction free energy ( A G ) and the reorganization free energy 0  (X). This relationship is defined by the following equation (Marcus, 1965):  AG* - W+ (1/4X) x (A + A G ' ) 0  2  [3]  The reorganization free energy (A) is the energy required to bring the nuclear coordinates of the  22  (A—D)  (A —D")  (A—-D)  +  (A —D") +  Figure 1.8 Potential energy curves representing an electron transfer reaction ( A - - D represents the precursor complex, A — D " represents the successor complex, A G is the driving force, A G * is the activation barrier, and A E is the energy gap separating the mixed and split potential energy curves). +  0  23  precursor complex to those of the transition state to accommodate the transfer of the electron. This energy is composed of two components, the inner reorganization energy (X-^ and the outer reorganization energy (X ) (Marcus & Sutin, 1985). The inner reorganization energy is associated a  with changing bond lengths and bond angles, and the outer reorganization energy is associated with surrounding solvent dipole orientation. In Equation 3 A G ' is the free energy difference between the 0  precursor and the successor complex. This energy is dependent upon the free energy difference between the fully separated reactants and products (AG ) (see Figure 1.8). It is also dependent upon 0  the work terms v/ and w which are the energies required to bring together and separate the reactant p  and product molecules, respectively. These latter terms are predominantly associated with the electrostatic interactions between charges species and therefore can generally be neglected when one of the reactants is of neutral charge. The approach outlined above to predict electron transfer rate constants is highly dependent upon the understanding of the structural and dynamic properties of the system. Since this knowledge is often not available, an alternative theoretical model was therefore required. This classical model, developed by Marcus, predicts cross-reaction rate constants for electron transfer reactions between substitutionally-inert coordination complexes using the corresponding parameters for the selfexchange reactions of the individual reactants. This relationship is generally referred to as relative Marcus theory, and it assumes that the activation processes associated with the cross-reaction are the same as for the individual self-exchange reactions. This relationship is defined by Equation 4.  k  n  The parameters k  u  and k  22  = Akn*k xK xf, 22  [4]  n  are the self-exchange rates of the reactants, and K  12  24  is the equilibrium  constant for the cross-reaction. For adiabatic and uniformaly non-adiabatic reactions the term/is equal to unity. This relationship has been used in a somewhat different perspective to study bimolecular electron transfer reactions of metalloproteins and substitutionally-inert metal complexes (Wherland and Gray, 1976). In the Wherland-Gray analysis, the apparent self exchange rate constant exhibited by a protein in a reaction with a small molecule reagent is calculated from the experimentally determined cross reaction rate constant (k ), the self-exchange rate constant of the inorganic reagent u  (k ) and the thermodynamic driving force of the reaction (AG°). The resulting value (k 22  ) is also  eorT u  corrected for electrostatic work terms involved in the precursor complex formation and the successor complex dissociation. This value provides information concerning the mechanism by which the protein and small molecule reagent react.  1.7.2.2  Intermolecular Electron Transfer Reactions of Cytochrome c Cytochrome c, with its well defined structures and chemical properties, has proven to be an  excellent protein for the study of the factors dictating bimolecular electron transfer rates. Extensive research has been carried out in this field utilizing an array of small inorganic and organic molecules acting as electron donors and acceptors. These reactants include Fe(EDTA) " (Hodges etal., 1974), 2  Co(phen)  3+ 3  (McArdle et al., 1977), Ru(NH ) py (Cummins & Gray, 1977), Co(dipic) (Mauk & 3  5  2  Gray, 1979), quinol semiquinones (Rich & Bendall, 1980) and flavin semiquinones (Tollin et al., 1986). Of particular importance to the work in this thesis are the studies involving the flavin semiquinones and the Fe(EDTA) ". 2  The use of flavins in the study of bimolecular electron transfer reactions of metalloproteins has developed primarily through the efforts of Tollin & Cusanovich (Jung and Tollin, 1981; Ahmad  25  etal, 1981, Simondsen and Tollin, 1983). This strategy is based on the fact that the flavin triplet state ( F1) can be populated in a few nanoseconds with a high quantum efficiency by inter-system crossing 3  from the first excited singlet state ('Fl). This triplet state is a strong oxidant with the ability to remove a proton or electron from a donor such as E D T A . This process produces the neutral flavin semiquinone, a kinetically unstable, strong reductant which can transfer an electron to an electron transfer protein. The E D T A radical formed in this process undergoes rapid decarboxylation to generate a second neutral flavin semiquinone with the E D T A fragmenting to produce stable products (Traber et al,  1982). In the absence of an electron acceptor, the flavin semiquinones will  disproportionate to produce the oxidized and fully reduced flavin species. Consequently, for protein reduction to predominate in the reaction kinetics, the protein concentration must be sufficiently high to prevent semiquinone disproportionation. The use of structurally varied flavin derivatives in studies of this type has allowed the investigation of the steric, electrostatic, and electrochemical properties of the flavin on the rate of electron transfer (Tollin et al, 1986; Cusanovich et al, 1987). Similarly, knowing that the flavin semiquinone transfers the electron to the exposed heme edge of the protein (Meyer et al,  1984;  Prysiecki et al, 1985), it has been possible to probe the environment around this heme edge. An excellent example of this approach is the reaction of F M N with the cytochrome c  2  from  Rhodospirillum rubrum (Meyer et al, 1984). Despite this protein having a net charge of zero, the reactivity of this protein with a variety of flavins clearly indicates that the heme edge is located within a positive electrostatic surface. This importance of asymmetrical charge distribution around the protein surface is also apparent with the c-type cytochrome from R. spheroides (Weber & Tollin, 1985). A more subtle study involves the differing steric factors associated with residues that surround the exposed heme edge (Meyer et al, 1984), in which a clear correlation between the experimental  26  rate constants and the distance of the heme to the protein surface was reported. The use of flavins has also been extended to investigation of protein-protein electron transfer reactions. These studies have included analysis of the complexes formed by cytochrome c with cytochrome c oxidase (Ahmad et al, 1982), cytochrome c peroxidase (Hazzard et al, 1987, 1988), flavodoxin (Hazzard etal, 1986) and cytochrome b (Eltis et al, 1988). This work has aided in the 5  understanding of the electrostatic interactions and dynamic motions within these electron transfer complexes. Small, substitutionary inert inorganic reagents have also been used extensively in the study of intermolecular electron transfer reactivity of metalloproteins. Fe(EDTA) " has been used 2  extensively and has proven useful in studying not only cytochrome c (Wherland & Gray, 1976; Cummins & Gray, 1977; Holwerda et al, 1980; Rafferty et al, 1990), but also other heme proteins such as cytochrome b (Reid & Mauk, 1982), cytochrome c 5  551  (Coyle & Gray, 1976) and myoglobin  (Mauk & Gray, 1979; Lim & Mauk, 1985). The use of the relative Marcus formalism to derive the electrostatic-corrected self-exchange rate constants (k ") enables the electron transfer ability of co  n  these various proteins to be compared. In addition, this approach facilitates the comparison of variants of the same protein. The work of this type with cytochrome c and numerous variants has led to the suggestion that electron transfer reactions with Fe(EDTA) * are dependent upon two major factors. These factors 2  are the orientation and proximity of the Fe(EDTA) ' molecule relative to the heme and the 2  reorganization energy of the cytochrome. To understand the importance of the Fe(EDTA) " 2  orientation and proximity, the nature of this reagent must be considered. Fe(EDTA) " has the ability 2  to present two faces towards the cytochrome heme region, a hydrophilic face composed of the E D T A carboxyl groups, and a hydrophobic face consisting of the ethylene backbone. The more favorable  27  orientation for electron transfer would place the hydrophilic face against the protein to allow overlap of the %-n carboxyl orbitals with the corresponding heme orbitals. This orientation is thought not to occur owing to the hydrophobic nature of the heme crevice environment. The hydrophobic nature of this crevice causes the Fe(EDTA) " to present its hydrophobic surface. Electron transfer studies 2  involving cytochrome c variants with mutations at the Phe82 residue have supported this hypothesis in that more polar residues at this position result in enhanced electron transfer reactivity (Rafferty et al., 1990). This work also demonstrates that as the residue at position 82 becomes less bulky the rate of electron transfer increases presumably because Fe(EDTA) "is able to approach the heme in such 2  variants more closely. The reorganization energy of the protein also has an integral role in controlling electron transfer rates. Cytochrome c, unlike myoglobin, does not undergo an oxidation state linked change in coordination environment. Therefore, the reorganization energy of this protein is relatively low because no bonds have to be broken and changes in bond lengths are minimal. These characteristics are reflected in the k  con n  values for cytochrome c and myoglobin that are exhibited in the reactions  of these proteins with Fe(EDTA) '. These values are 6.2 M ' V (Wherland and Gray, 1976) and 0.02 2  1  M ' V (Lim, 1990), respectively. Indeed a recent study of the myoglobin variant Val68His, which is 1  six coordinated in both oxidation states (Lloyd etal., 1995), has demonstrated that the k  cotT n  value  increases by over one order of magnitude (Harris et al., 1997). This observation confirms the importance of the oxidation state linkage of coordination number on electron transfer reactions involving heme proteins. Replacement of several internal amino acids in cytochrome c lead to varying effects on the electron transfer reactivity of the protein with Fe(EDTA) ' (Rafferty, 1992). These variations in 2  reactivity are presumably brought about by changes in the reorganization energy of the protein. The  28  variants exhibiting this type of altered reactivity all possess changes in the hydrogen bond network involving an internal water molecule, Wat 166, which has been implicated in the oxidation state-linked conformational change of cytochrome c. Of particular note is the Tyr67Phe variant which exhibits a ten fold increase in reactivity towards Fe(EDTA) '. This variant contains a second internal water 2  molecule in place of the hydrogen bond between the tyrosyl hydroxide and the axial Met80 sulfur atom (Berghuis et al., 1994). This structural change is thought to lower the reorganization barrier because movement of this water requires less energy than movement of the side chains involved in the hydrogen bond network found in wild-type cytochrome c.  1.7.3  Intramolecular Electron Transfer  1.7.3.1 Theoretical Studies Long-range electron transfer within proteins can be considered to be a weak non-adiabatic interaction. This situation is a consequence of the steric constraint of the donor and acceptor so that they are unable to interact directly. The rate constants associated with this type of non-adiabatic electron transfer process are described by Fermi's golden rule (Equation 5) (Marcus and Sutin, 1985).  ^ = 2u/hxH t  2 AB  x(FC)  [5]  This expression contains both an electronic and a nuclear term, with the nuclear element being the Franck-Condon factor (FC). As with intermolecular electron transfer reactions, the application of the Franck-Condon principle to these reactions is based on the assumption that the nuclei of the donor and acceptor act as simple harmonic oscillators, and can be regarded to be the sum of the overlap of the vibrational wavefunctions of the donor and acceptor centers. The classical  29  expression describing this overlap includes the driving force (-AG ) and the reorganization energy (A) 0  associated with the reaction as shown below (Equation 6):  FC = (4:iAk T)- exp[-(X+AG°) /4Ak T] ,/j  [6]  2  B  B  Examination of this expression reveals a parabolic dependence of In k against driving force (-AG ) 0  et  such that the electron transfer rate constant increases with increasing driving force to a point where X is equal to - A G . The rate constant then decreases as the driving force value increases further. This 0  decrease at higher driving force is referred to as the Marcus inverted region and is visualized in Figure 1.9. The second element of Fermi's golden rule, the electronic factor, states that the rate of electron transfer is proportional to the square of the electronic coupling of the donor and acceptor molecules (H^ ). 2  This coupling is a function of the electronic wavelength of the medium separating the donor  and acceptor and as such decays exponentially with distance, (d-d ) (Equation 7): 0  H  HAH  0  A  B  =  H ^ e x p ^  2  [7]  is the electronic coupling at d=d where the donor and acceptor are in direct contact and P is 0  the exponential decay constant. P is a coefficient that reflects the nature of the medium through which the electron must travel. Typical values for this coefficient for proteins have been suggested to be around 1.4 A(Moser et al, 1 9 9 2 ) although some experimental evidence has shown the existence of variations in P within a protein matrix (See section  1.7.3.2,  Page  33).  Various approaches have been  developed to account for the heterogeneous nature of the protein medium in an attempt to calculate the electronic coupling more accurately (Onuchic & Beratan, 1 9 9 0 ; Christensen etal, 1 9 9 0 , 1 9 9 2 ;  30  Figure 1.9 The dependence of electron transfer rate on free energy. The three sets of potential energy curves demonstrate the effect of varying the driving force on the activation barrier for electron transfer (-AG is the thermodynamic driving force, -AG* is the activation barrier and A is the reorganization energy). 0  31  Kuki, 1991; Goldman, 1991; Siddarth & Marcus, 1990, 1992). These approaches provide strategies to represent the overlap of the molecular orbitals of the donor, acceptor and protein medium. One of the most extensively used model is that developed by Beratan, Betts, and Onuchic. (Beratan etal, 1990, 1991). This approach distinguishes through atom (covalent and hydrogen bond) from through space interactions which could be potentially involved in an electron transfer pathway. A separate P value is assigned to each type of connection and calculates a dominant pathway with a graph-search algorithm based on the overall electronic coupling values. An alternative theoretical approach to describe the heterogeneous nature of the intervening medium has been developed by Siddarth and Marcus (Siddarth & Marcus, 1990,1993a), through use of one-electron extended Huckel theory (Hoffman, 1963; Larsson, 1981) to calculate the electronic coupling between the donor and the acceptor so that any constructive or destructive interference between various orbitals can be accounted for. Unfortunately, even for a small protein such as cytochrome c, calculating the electronic coupling associated with all the atoms would require the use of a huge matrix (Siddarth & Marcus, 1993a, b). To overcome this problem a subset of amino acid residues which are important in mediating the electron transfer are initially selected by an artificial intelligence (AI) search. This computationally more manageable set of residues can then be used to calculate the electronic coupling between the donor and acceptor. Comparison of the two models mentioned above reveals that the latter approach is theoretically more advanced. Firstly, the method of Beratan, Betts, and Onuchic assigns a uniform value for the decay factor across any bond. In the method of Siddarth and Marcus the electronic coupling between pairs of atoms is calculated explicity, therefore accounting for the different nature of each atom. A second difference is that the two methods utilize different search procedures. The method of Siddarth and Marcus uses a broader set of atoms to start the search, while the Beratan,  32  Betts, and Onuchic methodfindsa single path between the donor and acceptor and then searches the region surrounding the acceptor for alternative pathways.  1.7.3.2 Intramolecular Electron Transfer Reactions of Cytochrome c Experiments providing information regarding long-range electron transfer generally involve proteins for which structural information is available to permit determination of the distance between the donor and acceptor centers. It is not surprising that cytochrome c features predominantly in such studies. The major approach employed in these studies is to attach a small pendant molecule to a surface amino acid residue that can act as an electron donor or acceptor. The attached group must be stable and non-labile in both oxidation states, and the attachment procedure should not perturb the structural or functional properties of the protein. With these considerations in mind, tethered coordination complexes have been used extensively in such studies. A comprehensive review concerning this literature is given by Scott (1996). The first work of this type involved tethered ruthenium complexes and was reported independently in 1982 by the groups of Gray and Isied (Isied et al, 1982; Winkler et al, 1982; Yocom et al, 1982). In these studies the imidazole side chain of the residue His33 of horse heart cytochrome c was used to attach a Ru(NH ) group to the protein surface. These early ruthenium 3  5  ammine complexes were devoid of excited-state properties necessary for photo-induced electron transfer. For this reason pulse radiolysis and a separate photogenerated Ru(bpy) ' molecule were 2+  3  used to initiate electron transfer through rapid reaction with the tethered ruthenium complex. A schematic representation of this type of reaction is given in Scheme 1.  33  Ru(bpy)  2+ 3  hv  Ru(bpy) 2+  3  +  Ru(TII)-Fe(m)  > Ru(n)-Fe(IIJ)  Scheme 1  K  f  Ru(m>Fe(II)  Scheme 1 is a simplification of the possible reactions and assumes the presence of a sacrificial donor, such as E D T A , to scavenge the Ru(bpy)  3+ 3  produced in the reaction.  Subsequent studies involved zinc-substituted porphyrin derivatives of heme proteins than can be photoexcited to a reducing triplet state and can donate an electron to the attached ruthenium complex (Peterson-Kennedy et al, 1984; Meade et al, 1989). Later work demonstrated that the attachment of ruthenium complexes containing the bipyridine ligands could lead to direct electron transfer from the attached donor to the protein heme iron following flash photolysis (Chang et al, 1991;  Millett & Durham, 1991). Variations in the ligands of the ruthenium and other metal  complexes of this type led to the development of numerous modification procedures involving a variety of protein surface residues. These strategies included modifications of lysyl residues (Pan et al, 1988; Durham et al, 1989; Scott et al, 1991, Gorren etal, 1992), glutamic and aspartic residues (Conrad & Scott, 1989), cysteinyl residues (Geren etal, 1991) and tyrosyl residues (Lui, 1994). Cytochromes c modified in this manner exhibit electron transfer rate constants ranging from ~1 s (Isied, 1990, Scott et al, 1991) to ~10 s" (Durham et al, 1989, Millett & Durham, 1991). 1  7  1  34  Such a wealth of experimental data has enabled the investigation of the factors theoretically predicted to dictate the rate of electron transfer within proteins (Marcus & Sutin, 1985). As outlined in equations 5, 6, and 7, the rate of electron transfer is dependent upon three major factors: the electronic coupling between the donor and acceptor (H^), the driving force associated with the reaction (-AG ) and the reorganization energy of the system (X). The electronic coupling component, 0  which is a function of the distance and the protein medium intervening between the donor and acceptor has been extensively studied,. Work of this nature has been significantly aided by the advent of site-directed mutagenesis (Zoller & Smith, 1983, 1984). Initial work on this subject involved modified sperm-whale myoglobin with ruthenium complexes attached at histidines 12,48, 81, and 116 (Lieber etal., 1987, 1988) that led to correlation of k with the donor-acceptor distance. From these studies a value of-0.9 A" was derived for the 1  et  exponential decay constant (p) associated with the protein medium. A short time later, similar studies were undertaken with cytochrome c (Bowler et al., 1989; Therienetal., 1990; Change/al., 1991; Wuttkeetal., 1992; Casimiro etal, 1993;Karpishine/a/., 1994). Pendant ruthenium complexes were again attached at surface histidines at positions 33, 39, 54, 58, 62, 66, 72, and 79 (Figure 1.10). A number of these histidines had to be introduced by mutagenesis techniques. Comparison of k  (k when - A G = X) with d-3 (the donor-acceptor 0  max  et  distance minus the van der Waals contact of 3A) showed a definite correlation between the two factors (Figure 1.10). For reference the experimental date was compared to a line which utilized a p value of 1.4 A. This value was derived from studies that suggesting the protein matrix could be treated as a homogenous medium (Moser & Dutton, 1992; Moser et al,  1992). From the  experimental rate constants it was found that the electronic coupling was actually weaker than that corresponding to a purely covalently linked system. This work therefore provided experimental  35  evidence for the necessity of theoretical models to account for the heterogeneity of proteins. Indeed when the model developed by Beratan, Betts, and Onuchic was applied to these experimental systems the calculated 'best-pathways' yielded effective o-tunneling lengths (ol) which correlated well with the maximum electron transfer rates (Figure 1.10) (Beratan et al, 1992; Onuchic et al, 1992). Similarly, the more sophisticated model of Siddarth & Marcus (Figure 1.10) also provided excellent agreement between experimental and calculated electronic coupling energies. (Siddarth & Marcus, 1993a, b). In addition to the dependence of electron transfer rates on electronic coupling, the influence of the driving force (-AG ) on the rate of electron transfer has also received a great deal of attention. 0  Systems have been studied in which the driving force ranges from as low as 0.1 V (Isied et al, 1982) to as high as 1.9 V (Mines et al, 1996) well into the Marcus inverted region. Two particularly noteworthy examples of such studies involve cytochromes c labeled at position His33 (Mines etal, 1996) and a mutated His39Cys (Fairris et al, 1996) site. For the modified His33 cytochrome c the driving force was varied from 0.54 to 1.89 V simply by altering the ligands ofthe ruthenium complex, and the rates of electron transfer exhibited by these proteins clearly demonstrated the parabolic nature of the dependence on driving force (-AG ). The rates associated with the larger - A G 0  0  values  decreased in a manner consistent with the existance of the Marcus inverted region. Studies of this type also enabled estimates of the systems reorganization energy (X) to be made. Early experimental work involving ruthenium-ammine modified cytochromes c gave a reorganization energy value of 1.19 eV (Meade et al. ,1989). Further studies corroborated this value, with a general convergence of opinion on a value of ~1.2 eV for the reorganization energy of ruthenium-ammine modified cytochromes c (Onuchic et al., 1992). Later work involving rutheniumbpy complexes predicted reorganization energy values ranging from 0.8 to 1.0 eV (Mines etal, 1996;  36  Figure 1.10 (Top Panel A) Electron transfer pathways calculated from Beratan, Betts, & Onuchic theoretical model in Ru(HisX) modified cytochromes c (X=33, 39, 62, 72) (Modified from Beratan et al, 1992). Insets a and b show 'best-pathways' as calculated using Siddarth & Marcus model for Ru(His33) and Ru(His72) cyt c respectively (Modified from Siddarth & Marcus, 1993a). (Bottom Panel B) Correlations of maximum E T rates in Ru(HisX) modified cyts c with (d-3) (a) and al (b) (Modified from Wuttke et al, 1992 and Casimiro etal, 1993). 37  Fairris et al, 1996). These values were approximately one third lower than the estimates involving ruthenium-ammine modified cytochromes c. This observation was consistent with the smaller reorganization energy expected for the ruthenium-bpy complexes (Brown & Sutin, 1979).  1.8  Objectives of this Dissertation The objective of this thesis was to investigate the factors that dictate both intermolecular and  intramolecular electron transfer within proteins through the study of two novel types of cytochrome c. The first of these approaches involved the use of a new technique to study intramolecular electron transfer reactions in which a flavin moiety was attached to the protein surface. Previous studies by Tollin, Cusanovich and co-workers have used flavins extensively to investigate intermolecular E T reactions, but the use of flavins as electron donors in intramolecular electron transfer reactions has not been reported. The major advantage of this new technique is that the position of the flavin electron donor at the moment of electron transfer is knownfromthe specificity of the modification chemistry. Flavinmodified cytochromes also permit the assessment of the contributions of the unique properties of the flavin donor to the kinetics of electron transfer. Specifically, these novel cytochrome derivatives provide a means by which the reorganization energy of the flavin can be estimated. In principle, the insight gained from these studies should be of value in understanding the basic features of electron transfer  reactions  associated with  naturally occurring flavocytochromes  such  as yeast  flavocytochrome Z> and cytochrome P450BM3. 2  The kinetic study of four such flavin modified cytochrome c variants, namely Thr8Cys, FIis39Cys, Asn62Cys and Leu85Cys, was undertaken. To complement these results the theoretical  38  models of Beratan, Betts, & Onuchic and Siddarth & Marcus were utilized. These models enabled the calculation of the best pathways and the donor-acceptor electronic coupling. In addition a variety of spectroscopic and electrochemical techniques were used to investigate the structural and functional properties of these synthetic flavocytochromes. The second system described in this thesis involved the study of three axial ligand variants of cytochrome c, namely Met80Ala, Met80Ala/Tyr67Phe and Met80Ala/Phe82Ser. The analysis of the intermolecular electron transfer reactions of these three variants was undertaken by studying their reaction with the reductant Fe(EDTA) '. This work enabled the investigation of the electron transfer 2  reactivity of a ligand-binding coordination environment similar to that of myoglobin at the active site of cytochrome c. Again, to aid in understanding the kinetic results various techniques were employed to study the functional properties of these variants. These studies included analysis of thermal stability, ligand binding, and electrochemical properties. Some of the work described in this thesis has been published (Twitchett et al, 1997). The work involving the energy-minimized structures of the flavin-modified variants and the electron transfer pathway calculations using the Siddarth-Marcus model were done by Dr. P. Siddarth.  39  2. E X P E R I M E N T A L P R O C E D U R E S  2.1  Yeast Expression System  2.1.1  Mutagenesis Techniques The expression of the plasmid (pING4) containing the gene CYC1 for yeast iso-\-  cytochrome c and the oligonucleotide-directed mutagenesis techniques used to construct the Thr8Cys and His39Cys variants have been described previously (Pielak et al, 1985; Inglis et al., 1991: Zoller & Smith, 1984; Kunkel, 1985). A plasmid map of pING4 is given in Figure 2.11, and the sequence of the CYC1 gene is given in Figure 2.12. The oligonucleotides used in preparing these variants (Table 2.1) were synthesized with a modified Applied Biosystems 3 80A D N A synthesizer at the U B C Nucleic Acid and Protein Synthesis laboratory. Each mutant gene was sequenced in its entirety after mutagenesis to confirm that no additional mutations had been introduced. The plasmid encoding the gene for the Leu85Cys variant was prepared previously by G. Guillemette in the laboratory of Prof. M . Smith at the University of British Columbia. All variants also possessed the Cysl02Thr mutation to avoid complications of rapid auto-reduction and protein dimerization (Cutler etal, 1987).  Table 2.1 : Mutagenic oligonucleotides for yeast expression system* Thr8Cys  5'-CT-AGT-CTT-GAA-AAG-ACA-AGC-ACC-TTT-CTT-A-3'  His39Cys  5'-GC-TTG-ACC-AGA-GCA-TCT-GCC-AAA-GAT-A-3'  * The 5' end was phosphorylated. The underlined bases indicate the mutation site  2.1.2  Protein Preparation Mutant CYC1 genes were transformed into yeast strain GM3C-2, and cultures were grown  on a YP medium (bactopeptone 2% w/v, yeast extract 1% w/v, glycerol 3% v/v, and lactate 1% v/v) 40  EcoRI  Figure 2.11 Physical map of pING4 for the expression of yeast /so-1-cytochrome c in yeast. The genes encoding cytochrome c (CYCT), the P-lactamase (Amp ), the leu2 selectable marker and the origin of replication of the yeast '2u* circle are shown. 1  41  Smal UAS 1 CCCGGGAGCAAGATCAAGATGTTTTCACCGATCTTTCCGGTCTCTTTGGCCGGGGTTTACGGACGATGACCGA GGGCCCTCGTTCTAGTTCTACAAAAGTGGCTAGAAAGGCCAGAyAAACCGGCCCCAAA'rGCCTGCTACTGGCT  -380  *  *  *  *  *  *  UAS 2 AGACCAAAGCGCCAGCTCATTTGGCGAGCGTTGGTTGGTGGATCAAGCCCACGCGTAGGCAATCCTCGAGCA TCTGGTTTCGCGGTCGAGTAAACCGCTCGCAACCAACCACCTAGTTCGGGTGCGCATCCGTTAGGAGCTCGT  *  *  *  *  *  *  *  GATCCGCCAGGCGTGTATATAGCGTGGATGGCCAGGCAACTTTAGTGCTGACACATACAGGCATATATATAT CTAGGCGGTCCGCACATATATCGCACCTACCGGTCCGTTGAAATCACGACTGTGTATGTCCGTATATATATA * * * * * * * * GTGTGCGACGACACATGATCATATGGCATGCATGTGCTCTGTATGTATATAAAACTCTTGTTTTCTTCTTTT CACACGCTGCTGTGTACTAGTATACCGTACGTACACGAGACATACATATATTTTGAGAACAAAAGAAGAAAA * * * * * * * CTCTAAATATTCTTTCCTTATACATTAGGTCCTTTGTAGCATAAATTACTATACTTCTATAGACACGCAAAC GAGAT T TATAAGAAAG GAATAT GTAAT C CAG GAAACAT C GTAT TTAAT GATAT GAAGATAT CT GT GC GT T T G * * * * * * *  -5 M  T  10 E  F  K  A  G  S  A  K  K  G  A  T  F_  L  ACAAATACACACACTAAATTAATAATGACTGAATTCAAGGCCGGTTCTGCTAAGAAAGGTGCTACACTTTTC TGTTTATGTGTGTGATTTAATTATTACTGACTTAAGTTCCGGCCAAGACGATTCTTTCCACGATGTGAAAAG  *  *  i  *  *  20  40  20  30  T R C L Q C H T V E K G G P H K V G P JV L H G_ AAGACTAGATGTCTACAATGCCACACCGTGGAAAAGGGTGGCCCACATAAGGTTGGTCCAAACTTGCATGGT TTCTGATCTACAGATGTTACGGTGTGGCACCTTTTCCCACCGGGTGTATTCCAACCAGGTTTGAACGTACCA  _K  *  *  60  *  80  *  100  40  120  50  F G R H S G Q A E G Y S Y T D A N J K K JV V L_ ATCTTTGGCAGACACTCTGGTCAAGCTGAAGGGTATTCGTACACAGATGCCAATATCAAGAAAAACGTGTTG TAGAAACCGTCTGTGAGACCAGTTCGACTTCCCATAAGCATGTGTCTACGGTTATAGTTCTTTTTGCACAAC  _I  *  *  140  60  *  160  *  180  70  80  D E JV JV M_S E Y L T JV P K K Y J P G T K M_ A F_ TGGGACGAAAATAACATGTCAGAGTACTTGACTAACCCAAAGAAATATATTCCTGGTACCAAGATGGCCTTT ACCCTGCTTTTATTGTACAGTCTCATGAACTGATTGGGTTTCTTTATATAAGGACCATGGTTCTACCGGAAA  _W  200  *  220  *  *  240  90  260  100  G L K K E K_D R JV D L I T Y L K K A T E 0_ GGTGGGTTGAAGAAGGAAAAAGACAGAAACGACTTAATTACCTACTTGAAAAAAGCCACTGAGTAAACAGGC CCACCCAACTTCTTCCTTTTTCTGTCTTTGCTGAATTAATGGATGAACTTTTTTCGGTGACTCATTTGTCCG  _G  *  *  280  *  300  320  *  CCCTTTTCCTTTGTCGATATCATGTAATTAGTTATGTCACGCTTACATTCACGCCCTCCCCCCACATCCGCT GGGAAAAGGAAACAGCTATAGTACATTAATCAATACAGTGCGAATGTAAGTGCGGGAGGGGGGTGTAGGCGA * * * * * * * CTAACCGAAAAGGAAGGAGTTAGACAACCTGAAGTCTAGGTCCCTATTTATTTTTTTATAGTTATGTTAGTA GATTGGCTTTTCCTTCCTCAATCTGTTGGACTTCAGATCCAGGGATAAATAAAAAAATATCAATACAATCAT * * * * * * * * TTAAGAACGTTATTTATATTTCAAATTTTTCTTTTTTTTCTGTACAGACGCGTGTACGCATGTAACATTATA AATTCTTGCAATAAATATAAAGTTTAAAAAGAAAAAAAAGACATGTCTGCGCACATGCGTACATTGTAATAT * * * * * * * HindiII CTGAAAACCTTGCTTGAGAAGGTTTTGGGACGCTCGAAGGCTTTAATTTGCAAGCTT GACTTTTGGAACGAACTCTTCCAAAACCCTGCGAGCTTCCGAAATTAAACGTTCGAA  *  *  *  *  600  Figure 2.12 D N A sequence of the Smal-Hindlll fragment of pING4 (Inglis etal., 1991). The CYC1 gene (1-330) encodes yeast iso-1 -cytochrome c (one-letter code symbol for amino acids and sequence number in italics; Smal and Hindlll restriction sites, and the upstream activating sequences (UAS) are indicated and underlined).  42  in a 50 L fermentor as described previously (Rafferty, 1992). Cell lysis and preliminary protein purification were then carried out following established techniques (Cutler et al,  1987). Final  purification was achieved by ion exchange chromatography using an F P L C system fitted with a Mono-S H R 10/10 cation exchange column (Pharmacia). Protein solutions (1 mL, -15 mg/mL) were eluted with 20 mM sodium phosphate buffer (pH 7.2) using a linear salt gradient from 250 to 450 m M N a C l (Rafferty, 1992).  2.2  Bacterial Expression System  2.2.1  Mutagenesis techniques To produce the functional cytochrome c variant Asn62Cys and the three non-functional  variants Met80Ala,  Tyr67Phe/Met80Ala and Tyr67Phe/Met80Ala/Phe82Ser, site directed  mutagenesis techniques (Zoller & Smith, 1984; Kunkel, 1985) were used with anE. coli cytochrome expression system described recently (Pollock et al, 1997). A map of the plasmid pBPCYCl(WT)/3 used for expression is given in Figure 2.13. The sequences of the CYC1 (yeast iso-l-cytochrome c) and CYC3 (cytochrome c heme lyase) genes are given in Figure 2.14. The oligonucleotides used in preparing the four variants, again synthesized at the U B C Nucleic Acid and Protein Synthesis laboratory, are given in Table 2.2. All variants contained the mutation TML72Lys because the bacterial expression system lacks the enzyme that is required to trimethylate Lys72. As with the cytochromes expressed in yeast, all cytochromes expressed in.E. coli also possessed the Cysl02Thr substitution.  43  Table 2.2 : Mutagenic oligonucleotides for E. coli expression system* L62C  5'-A-CTC-TGA-CAT-GTT-ACA-TTC-GTC-CCA-CAA-3'  M80A  5'-CCC-ACC-AAA-GGC-CGC-CTT-GGT-ACC-AGG-3'  Y67F/M80A  5'-TGG-GTT-AGT-CAA-GAA-CTC-TGA-CAT-GT-3'  Y67F/M80A/F82S  5'-CTT-CAA-CCC-ACC-AGA-GGC-CGC-CTT-GG-3'  * The 5' end was phosphorylated. The underlined bases indicate the mutation site  The double variant Met80Ala/Phe82Ser was produced by digestion of the wild type and Tyr67Phe/Met80Ala/Phe82Ser pBPCYCl/3 plasmids with the restriction enzyme  (Gibco BRL),  which cut just upstream of the Met80Ala mutation site. The small fragment containing the mutations Met80Ala/Phe82Ser was then ligated with the larger fragment from the wild-type plasmid digest, as described elsewhere (Maniatis, 1989) to produce the desired variant.  2.2.2  Protein Preparation Freshly transformed E. coli (HB2151) colonies were used to initiate small scale cultures  (3 mL Superbroth (Sambrooke/a/., 1989) and 100 mg/L ampicillin). These cultures were then used to inoculate large scale fermentation growths (Chemap FZ000 fermentor) as outlined in Pollock et al. (1997). The resulting culture was harvested with a Sharpies continuous-flow centrifuge. Cell lysis was performed as described previously (Hildebrand, 1996). The resulting supernatant solution was brought to 35% saturation by the slow addition of solid ammonium sulphate. The pH of the solution was monitored and kept at pH 7 by the addition of small amounts of 1M sodium hydroxide solution. To remove the resulting precipitate, the solution was centrifuged (Sorvall GS-3 rotor, 7000 rpm, 30 mins), and the supernatant was recovered and dialyzed against distilled water (20 L , 4°C). Preliminary protein purification was then carried out following established techniques (Cutler et al., 1987). Final  44  Figure 2.13 Physical map of pBPCYCl(wt)/3 for the expression of yeast iso-1 -cytochrome c in bacteria. The genes encoding cytochrome c (CYC1), cytochrome c heme lyase (CYC3) and the p-lactamase (Amp ) are shown. Promoters are shown as open triangles. r  45  Kpnl GGTACCCATC GTTAACCACC GCAACTCTCT AAGAAAAACC ATTAATGCAG TTAATGTGAG CCAATGCTTC TCACTGCATA GACATCATAA TCGTATAATG GAATTCAAGG TGCCACACCG GGCAGACACT GTGTTGTGGG GGTACCAAGA TACTTGAAAA AGCTAGCTTT TTGCTAACTT TGGGTTGGTT CATCCATGTC AGTGCCCCGT TGGCAGCATC GCATCCCCAA ACAATGCTAT TGGAGTCCAT AATGGGAAAA GGAAACCGGG CGTCCCATTT AGCGCAAAGC ACGGAGGGCC TAGATAGTCT GTCCGTCCTC TAGCCAAGTA ATATTTTTCC TACCTTCAGG AGAGGCTACA AGCCAAGCTT  T C G G T A G T G G GATAGGACGA T A C C G A A G A C A T C A A A C A G G A T T T T C G C C T GCTGGGGCAA CAGGGCCAGG CGGTGAAGGG C A A T C A G C T G ACCCTGGCGC CCAATACGCA AACCGCCTCT CTGGCACGAC AGGTTTCCCG ACTGGAAAGC TTAGCGCGAA TTGATCTGGT TTGACAGCTT TGGCGTCAGG CAGCCATCGG AAGCTGTGGT A T T C G T G T C G CTCAAGGCGC A C T C C C G T T C CGGTTCTGGC AAATATTGTG AAATGAGCTG T G T G G A A T T G TGAGGGGATA A C A A T T T C A C CCGGTTCTGC TAAGAAAGGT G C T A C A C T T T TGGAAAAGGG T G G C C C A C A T A A G G T T G G T C CTGGTCAAGC TGAAGGGTAT TCGTACACAG ACGAAAATAA CATGTCAGAG TACTTGACTA TGGCCTTTGG TGGGTTGAAG AAGGAAAAAG AAGCCACTGA GTAAACAGGC C C C T T T T C C T TCAGTAATTA TCTTTTTAGT AAGCTAGCTA TATAGATTAC AAAACTTAGG AGGGTATCGA T T G G G C A G A T C A A A A A A C T A CGGGCAAAGA AGGGTGCCCA GTCATGCACG AGTCGTCGTC TATGCAGGGA GATAACGATA GAATAAACCC C A A A C A G C C T GGCCAAAAGA T G G A C T T G C C GAGTCCAGAC AGTAACGAGT TCTGGGAGTA G G T T A G A A A G G G C A A G A T T G GCGGTAGCGG GGTGCAGGTC C A C A A C T T T C T A A A T G A A G G ACCGCACACA GATGAAAGCC ACGTGCAGCC CGTATTGAGC CCTCGTGCTC GCTGGATGCA TAGCCAAGAA C T A C C A T T C G ACAGGCACGA GGAACAACAA CCTCCAACCT TCAAGGAAGT CGACGACGAA A A C G G A A T G C C T A C T T T C C A A G A C A A T G C T AAGGACCGGA T G A C C C G T T T TTCGTCCTCC GCCCCTTAAA TGATATACAG AGAAATAATG ATGTCCTAGT GCAGCCACAA A C C T T A T T A T CACAAGGTGC A C C T T T A T C T G G T A C G A T A C A T T C T G T G C T GGCGACCACG T T A C T G A T T T GGGAAATTTC CCAAATTGGA  AGCTCATGTT ATATCCCGCC ACCAGCGTGG ACCGCTTGCT T T G C C C G T C T CACTGGTGAA CCCCGCGCGT TGGCCGATTC GGGCAGTGAG C G C A A C G C A A A T C A T C G A C T GCACGGTGCA ATGGCTGTGC AGGTCGTAAA TGGATAATGT TTTTTGCGCC TTGACAATTA ATCATCCGGC ACAGGAAACA GACCATGACT TCAAGACTAG ATGTCTACAA CAAACTTGCA TGGTATCTTT ATGCCAATAT CAAGAAAAAC ACCCAAAGAA ATATATTCCT ACAGAAACGA CTTAATTACC TTGTCGATCG GATCCGGCCA AGTTTTTACA CTTAGTTAAA TACTATGAAT TCACAAAAAA TATTGGTGGG GCAGCAGTAT GTCGTCGCCA CCATCCTCTG GCTGAACAAT ATGCCGGAGT CGTTGATCGG ACCATCTCCA T C C T T C T C C A CAACAGATGT CGAAGTCGCC GAAGATGCAG GTGCTGGCAG GAAGTGCTCG TAAGTTGCTG AAATTCATGG CCTGTGCGGC C T A C T G T T T C CTGGATTGTA CTCCGAGGCG TAGATACGTC TTGGATTTCT CGTGGATGTC CGTCCTGCCC CTTGGACCGG ATGATCTCGG CCAGCGTAAG TACGTGTAAA TCAATTTCAC TTTTTCATAT GTGCCACGGC GGTAAAAAAC GGGCTGACAG AGACACCCGT AATATCACTC GTCGACCTGC  Hindm  Figure 2.14 D N A sequence of the Ajwil-//i/idni fragment of pBPCYCl(WT)/3. The CYC1 gene encoding yeast iso-1 -cytochrome c is underlined. The CYC3 gene encoding heme lyase is double underlined. The Kpnl and Hindlli restriction sites are also indicated.  46  purification was achieved by ion exchange chromatography with an FPLC systemfittedwith a MonoS H R 10/10 cation exchange column (Pharmacia) as described above. Due to the addition of N a N 0  3  to the growth medium, for the four axial ligand variants, the final purified protein was the N O bound derivative. To remove the axially bound N O and produce the corresponding ferricytochrome derivatives, each of these variants was oxidized with K [Fe(CN) ], placed under vacuum and 3  6  illuminated on ice, with stirring for approximately 6 hours. The light source was a Dyna-Lume 'SunLite' 1 lamp containing a tungsten argon bulb (Scientific Instruments Inc., Skokie, II.). The lamp was placed at a distance of ~2 cm from the sample.  2.3  Flavin Preparation The  synthesis  of  7-acetyl-10-methylisoalloxazine  and  7a-bromoacetyl-10-  methylisoalloxazine was carried out as outlined in Levine & Keiser (1978). A schematic representation of the synthesis procedure is given in Figure 2.15. The final products were analyzed by thin layer chromatography using aluminum oxide pre-coated T L C plastic sheets (F , Type E) 254  (BDH Chemicals, Toronto) and a chloroform/methanol (9:1) eluent. The final products were also analyzed by nuclear magnetic resonance spectroscopy using a Bruker MSL-200 spectrometer ( C F C 0 D used as solvent) to validate purity. 3  2.4  2  Thiol Assay & Protein Modification To determine the relative reactivity of the surface cysteine residues that were introduced  by mutagenesis, thiol assays were carried out. The introduction of the Cysl02Thr mutation to the variants ensured that the only reactive thiol present was that introduced by site-directed mutagenesis. 4,4'-dithiodipyridine (Aldrich) solution (100 uL, 0.5 mM) was added to each protein (1 mL, sodium  47  /?-chloroacetophenone O H S 0 , H N 0 , 0 °C 2  4  3  a  CH,  v  NO,  4-Chloro-3-nitroacetophenone  O C H N H , EtOH, A 3  2  a  CH, H I  NHCH,  NO,  4-Methylamino-3-nitroacetophenone  Jd J  ,H ,Pt0 ,HCl 2  2  II  O (Alloxan)  CH  3  7-Acetyl-10-methylisoalloxazine 0  0  Br ,HOAc 2  o  CH  3  7a-Bromoacetyl-10-methylisoalloxazine  BrCB O  O  Figure 2.15 Outline of synthesis of 7a-bromoacetyl- 10-methylisoalloxazine (Modified from Levine & Kaiser, 1978). The C4A atom in the 7a-bromoacetyl-10-methylisoalloxazine structure is indicated by an asterisk.  48  phosphate buffer, pH 7.0, 0.1 M , 25 °C, protein concentration = 0.01 mM), and the absorbance increase at 324 nm was monitored with a Cary Model 219 spectrophotometer interfaced to a microcomputer (OLIS, Bogart, GA). To accomplish protein modification, Cys containing cytochrome variants (2 mL, ~3mg/mL in sodium phosphate buffer, pH 7.2, 0.02 M) were mixed with a 5-fold molar excess of 7abromoacetyl-10-methylisoalloxazine that was dissolved in Me SO (100 uL), and the reaction mixture 2  was incubated in darkness at room temperature for 18 hrs. A 5-fold molar excess of cysteine solution (50 uL, -30 mM) was then added to remove the Cys thiol C4A adduct (See Figure 2.15) (Levine & Keiser, 1978) prior to addition of a 5-fold molar excess of flavin and incubation for an additional 18 hrs. The modified cytochrome was eluted over a Sephadex G-25 gel filtration column (15.0 x 0.5 cm) to remove excess flavin and oxidized to generate the flavin ferricytochrome c species. Residual unmodified protein (<10%) was removed by ion exchange chromatography (Mono-S H R 10/10 cation exchange column, Pharmacia) using the elution conditions outlined in Section 2.1.2 (Page 43).  2.5  Tryptic Digestion & H P L C Analysis Tryptic digestion of the cytochrome c variants was performed by addition of two separate  12.5 uL samples of trypsin solution (1 mg TPCK-trypsin/mL of 0.001 M hydrochloric acid) to the protein (1 mg protein in 500 uL of 0.2 M ammonium bicarbonate). The reagents were incubated at 37 °C for 24 hrs (the second trpysin sample was after 16 hrs). Hydrochloric acid (100 uL of 1M) was then added to stop hydrolysis, and the sample was taken to dryness with a Savant Speed Vac concentrator (Model SVC-100H). Water (500 uL) was then added and the sample was redried. Each final dried, hydrolysed sample was dissolved in 100 uL 0.05% (v/v) T F A and stored at -20 °C. Peptide maps were prepared by reverse-phase HPLC performed with a Beckman System  49  Gold equipped with a diode array detector. For each peptide map, 20 uL of sample was injected onto a C-18 reversed-phase column (Alltech 4.6 x 250 mm) that was equilibrated with 0.05% TFA. A linear gradient was established from 0 to 60% acetonitrile in 0.05% T F A over 135 minutes with a flow rate of 1 mL/min. The gradient was then increased such that over the next 15 minutes the acetonitrile concentration rose from 60 to 75%. Detection was performed by monitoring the absorbance at 210 and 280 nm.  2.6  Spectroscopic Characterization  2.6.1  Electronic Absorption Spectroscopy  2.6.1.1  General Analysis Electronic spectra were recorded with either a Cary Model 219 spectrophotometer  interfaced to a microcomputer (OLIS, Bogart, GA) or a Cary Model 3E spectrophotometer. Sample temperatures were kept constant at 25 °C with a circulating thermostated water bath connected to a water-jacketed cell holder. Spectra were recorded in 1 cm pathlength quartz cuvettes (1 mL or 3 mL  volume).  Oxidized  cytochrome  derivatives  were  produced  by the  addition of  NH [Co(dipicolinate) ] with subsequent removal with a small Sephadex G-25 (Pharmacia) desalting 4  2  column (0.5 x 15.0 cm). Ferrocytochrome derivatives were produced with the addition of a small amount of solid sodium dithionite (J. T. Baker Chemicals, Phillipsburg, NJ) which was stored under vacuum. Excess sodium dithionite was then removed with the desalting column described above.  2.6.1.2  Ligand binding Reduced forms of the variants possessing the Met80Ala substitution were produced by  the addition of solid sodium dithionite. Exposure of the resulting deoxygenated form of these proteins  50  to air, C O and N O produced the 0 , CO and NO reduced derivatives respectively. The oxidized form 2  of the proteins was produced by the addition of excess K [Fe(CN) ] solution followed by elution over 3  6  a small Sephadex G-25 desalting column (Pharmacia, 0.5 x 10 cm).  2.6.1.3  pH titration The electronic spectra of the oxidized variants with the Met80Ala substitution were  monitored as the pH of the solution was adjusted from pH 4 to 11 by incremental addition of 0.1 M NaOH. Fitting the resulting data to the Henderson-Hasselbach equation for a one-proton process (Scientist, Version 2.0, Micromath, Utah) enabled the determination of the pK of the distal water. 3  2.6.2  Fluorescence Spectroscopy Fluorescence emission spectra were measured with an S L M AMTNCO SPF-500C  spectrofluorometer interfaced to an IBM-AT microcomputer. Samples were prepared in 0.1 M sodium phosphate buffer (pH 7.0 at 25 °C) with a protein concentration of ~4 uM. Samples were excited at 425 nm (2 nm bandwidth), and the emission spectrum was recorded from 450 to 700 nm (2 nm bandwidth).  2.6.3  Circular Dichroism Spectroscopy Protein samples were prepared in sodium phosphate buffer (0.1 M , pH 7.0) and passed  through a 0.22 urn filter prior to recording the CD spectrum to give a final concentration of ~5 uM. Circular dichroism spectra were recorded with a Jasco Model J-720 spectropolarimeter equipped with a Neslab Model RS-2 remote sensor and a Neslab Model RTE-110 circulating water bath (Neslab Instruments Inc., New Hampshire). The spectropolarimeter was calibrated with ammonium-c/-  51  camphor- 10-sulphonate (Aldrich Chem. Co.). Spectra were recorded for samples placed in a cylindrical, water jacketed quartz cell (0.1 cm path length,  volume 200 uL, 25 °C), and the average  of three scans from 190 to 250 nm was collected. Thermal stability studies were carried out by monitoring the ellipticity at 222 nm over the temperature range 30 to 80 °C (heating rate of 50°C/hr). The thermal denaturation curves were smoothed with the Jasco 720 software filter function, and the midpoint melting temperature (TjJ was determined from the first derivative of the curve.  2.6.4  Fourier Transform Infrared (FTIR) Spectroscopy FTIR spectra were recorded with a Perkin-Elmer System 2000 spectrometer equipped  with a liquid nitrogen cooled mercury cadmium telluride detector. Protein samples were concentrated to approximately 3 mM (50 uL volume in 0.1 M sodium phosphate buffer pH 7.0). To obtain the carbonyl derivative, a few grains of sodium dithionite were added, and CO gas was passed over the sample for 10 minutes. The sample was loaded into a cell fitted with CaF windows and placed into 2  a water-jacketed cell holder (Specac Inc.) that was connected to a circulating water bath (Lauda Model RS3). Spectra were recorded at 25 °C between 1900 and 2000 cm" to a resolution of 2 cm' . 1  1  Background correction was achieved by subtracting the spectrum of reduced wild-type cytochrome c of similar concentration.  2.7  Electrochemical Characterization  2.7.1  Cyclic Voltammetry Direct electrochemistry was performed with a three-electrode, two compartment glass  cell at a gold surface modified with 4,4'-dithiodipyridine (Aldrich) (Figure 2.16). The gold disk electrode was polished prior to modification with an alumina (0.3 um)/water slurry on Mastertex®  52  reference electrode  hose barbs for water-jacketed reference electrode compartment  glass support rod  working electrode Pt wire connected to Pt braid counter electrode also, sidearm for A r bubbling tube sample compartment (ca. 400 u L volume)  Luggin capillary  F i g u r e 2.16 A schematic diagram of the cyclic voltammetry cell. The working electrode is a polished gold disk (modified with 4,4'-dithiodipyridine for measurement of protein reduction potentials). The counter electrode is a platinum wire coiled around the sample compartment capillary. The reference electrode is a saturated calomel electrode.  53  polishing cloth (Beuhler, Lake Bluff, JX). The saturated calomel reference electrode (SCE) (Radiometer, REF401) was maintained at 25 °C and connected to the sample compartment by a Luggin capillary (0.1 mm). A platinum wire counter electrode was inserted around the capillary in the sample compartment. Electrochemical measurements were performed on 0.5 mL of 0.4 mM protein solution in buffer (u=0.1 M). The sample temperature was controlled with a thermostated, circulating water bath. Electrode potentials were controlled with an programmable potentiostat (Ursar Electronics, Oxford, U.K.). The current output was recorded with an interfaced microcomputer with software developed with Labview for Windows (National Instruments) by D. Hable (Blue Moon Technical  Services,  Vancouver). Midpoint potentials  were measured  from steady-state  voltammograms recorded at a sweep rate of 20 mVs" . The error in the reduction potentials was 1  estimated to be ± 2 mV (Rafferty, 1992). The calculated reduction potentials were converted to the standard hydrogen electrode (SHE) scale as described by Dutton (1978). Errors associated with the thermodynamic parameters were calculated from weighted linear least squares fits of the data to the Eyring equation (Equation [13], Page 72).  2.7.2  Spectroelectrochernical Techniques Potentiometric titrations were performed with an optically transparent thin-layer electrode  (OTTLE) described by Reid et al, (1982) (Figure 2.17). The working electrode was a semitransparent gold mini-grid (500 lines/inch) (Buckbee-Mears Co., Minneapolis, M N ) . A saturated calomel electrode (Radiometer, REF401) was used as the reference electrode along with a platinum wire counter electrode. The O T T L E cell was machined from Lucite plexiglass. The water-jacketed O T T L E cell holder was thermostated at 25 °C with a Lauda Model RC-3 circulating water bath. The applied potential was controlled by a E G & G Model 173 Potentiostat/Galvanostat. Protein  54 i t  F i g u r e 2.17 Schematic representation of the optically-transparent thin layer electrode (OTTLE) cell. The observation cell is shown in an exploded view. The working electrode a gold minigrid (500 lines/inch) attached to a copper wire. The reference electrode is a saturated calomel electrode. The counter electrode is a platinum/wire electrode.  55  concentrations were ~100 uM (0.1 M sodium phosphate buffer). [Ru(NH ) ]Cl (recrystallized from 3  6  3  commercial material, Alfa), phenosafrinine (Sigma Chemical Co., St Louis, MO) and 2-hydroxy-1,4naphthoquinone (Sigma) were used as mediators at a concentration of 10% of the final protein concentration. Spectra were recorded with a Cary 219 spectrophotometer as described above. Potentials were fitted to the Nernst equation with the program Scientist (Version 2.0, Micromath, Utah). The error associated with each potential was calculated from the linear least squaresfitsof the data to the Nernst equation. To obtain potentials for the flavoquinone / flavosemiquinone couple (Ej ) and the 0  flavosemiquinone / flavohydroquinone couple (E °), the data were fitted to the Michaelis equation [8], 2  and the values for the semiquinone formation constant (K) were calculated from equation [9], as described previously (Clark, 1960; Draper &Ingraham, 1968; Williamson &Edmondson, 1985). The error associated with each semiquinone formation constant was calculated from weighted least squares fits of the data to the equation [8].  E = E + (RT/2F)ln(l + u)/(l-u) h  m  + (RT/2F) In ([1 + y(l V ) ]  K=4Qy  1 / 2  + u / [1 + ( l - u )]  +\  2  Y  1/2  - u)  [8]  [9]  The values for Ej° and E ° could then be calculated (25 °C) from the semiquinone formation constant 2  using E ° - E j = 0.05916 log A". The calculated reduction potentials were converted to the standard 0  2  hydrogen electrode (SHE) scale as described by Dutton (1978).  56  2.8  Kinetic Experiments  2.8.1  Flash Photolysis Techniques Kinetic experiments were performed with a flash photolysis spectrophotometer composed  of an optical bench and optical components obtained from OLIS (Bogart, Georgia) and a Phase-R DL1020 dye laser (Phase-R, New Durham, NH) operated under computer control (Blue Moon Technical Services, Vancouver). The configuration of the flash optics was set up so that the dye laser pulse and axis of the sample beam were nearly coincidental (17°), as outlined by Sawicki & Morris (1981). The laser was operated with a 3 x 10" M ethanol solution of Coumarin 440 dye (Exciton Inc., 4  OH) which has an emission maximum at 440 nm (wavelength range 423-462). All solutions were placed into a modified cuvette (10 mm path, 3 mL volume) and de-aerated thoroughly with a vacuum line. All samples were kept in darkness prior to analysis. For bimolecular reactions, sample solutions consisted of 0.1 mM flavin (riboflavin and lumiflavin were obtainedfromSigma; 7<x-bromoacetyl-10methylisoalloxazine and 7-acetyl-10-methylisoalloxazine were prepared as described above), 5 m M E D T A (disodium salt) and variable concentrations of cytochrome c (5-50 uM) dissolved in 0.1 M sodium phosphate buffer (pH 7.0). Upon illumination, the photo-generated flavin triplet state reacted with the E D T A to form the flavin semiquinone (approximately 0.5% of total flavin initially present). Subsequent electron transfer was monitored as changes in the absorption at 550 and 557 nm. Protein concentrations (> 5 uM) were sufficiently high relative to flavin semiquinone concentrations to ensure that the reactions proceeded under pseudofirst-orderconditions and that flavin disproportionation did not compete with protein reduction. First order rate constants, k , were calculated with the obs  program Scientist (version 2.0, Micromath, Orem, UT). The error associated with eachfirstorder rate constant was calculated from the standard deviation of the fit of the data to a first order rate equation. Second order rate constants, k , were calculated from weighted linear least square fits of 2  57  k  obs  versus protein concentration. For uni-molecular kinetic experiments involving the flavin modified cytochrome c  samples, solutions consisted of 5 mM E D T A and modified protein (50-150 uM) dissolved in 100 mM phosphate buffer (pH 7.0; other pH values were obtained by addition of small amounts of 1 M NaOH or 1 M HC1). The reaction sequence relevant to these measurements is outlined in Scheme 2. Protein reduction was again monitored at 550 and 557 nm, and the first order kinetic data were analyzed using Scientist. The error associated with each first order rate constant was again calculated from the standard deviation of the fit of the data to a first order rate equation.  EDTA  2.8.2  Fe(EDTA)  2  Scheme 2  Reduction Kinetics  Kinetic experiments monitoring the reduction of cytochrome c variants by Fe(EDTA) " 2  were performed with an OLIS stopped-flow mixing system interfaced to an OLIS RSM-1000 rapid scanning monochromator (OLIS, Bogart, GA). Temperature was controlled with a Neslab Model RTE-111 thermostated circulating water bath. Reactant solutions were made anaerobic by bubbling with nitrogen gas which had been passed through two vanadium / amalgamated zinc towers (Meites & Meites, 1948) and through a buffer solution to remove traces of dissolved oxygen and to humidify  58  the purging gas. Fe(EDTA) ' solutions were made up as described previously (Wherland etal, 1975) 2  by anaerobic mixing of sodium phosphate buffer-EDTA solution and ferrous ammonium sulfate solution. Protein solutions (5 uM) were deaerated similarly (sodium phosphate pH 7.0, u = 0.1 M , 25 °C). Reactions were carried out under pseudo-first order conditions with a reductant excess of at least 20-fold. Kinetic data were analysed with the program Specfit (Spectrum Software Associates, Chapel Hill, NC). The error associated with each rate constant was calculated from the standard deviation of the fit of the data to the appropriate rate equation. Second order rate constants, k , were 2  calculated from weighted linear least squaresfitsof k versus Fe(EDTA) ' concentration. The errors 2  obs  associated with the calculated thermodynamic parameters were obtained from the weighted linear least squares fit of the data to the Eyring equation (Equation [22]), page 115).  2.9  Molecular Modeling and Pathway Calculations Energy minimized structural models for the four cysteine containing cytochrome c  variants and the corresponding flavin modified derivatives were calculated. The model structures were calculatedfromthe published structure of yeast iso-\ -cytochrome c (Louie & Brayer, 1990) by sidechain substitution and molecular mechanics energy minimization with INSIGHT (Version 2.2.0; Biosym, San Diego, CA) by Dr. P. Siddarth at the University of British Columbia. Two theoretical models were utilized to calculate the most likely pathway(s) for electron transfer between the flavin and the heme. The first of these methods was that developed of Beratan, Betts, and Onuchic (Greenpath, Version 2.2.0) (utilized by the author). The second method was that developed by Siddarth and Marcus (utilized by Dr. P. Siddarth). The results obtained from the two methods are compared.  59  3. R E S U L T S  3.1  Cysteine Variants and Flavin Modification  3.1.1  Protein Preparation For the Thr8Cys and His39Cys cytochrome c variants expressed in yeast, the yields of  protein varied from 80 to 180 mg per 50 L of culture. Two cytochrome bands were resolved on the CM-Sepharose ion exchange column. The component eluted first was deamidated cytochrome c (Brautigan etal., 1978), and the second component was the native protein. Thefinalpurification step involving the FPLC  Mono S column also resolved two bands, the first of these was residual  deamidated protein. Throughout the purification procedure, no evidence of dimerisation was observed suggesting that the D T T was sufficient to prevent intermolecular disulfide bond formation. For the Asn62Cys variant expressed in the E. coli system, the yield of bacterial cells was usually 4 g/L of culture from which approximately 5 mg/L of cytochrome could be isolated. Although cytochrome expressed in E. coli is not trimethylated at Lys72, the behavior of the protein expressed in bacteria during purification was identical to that of protein expressed in yeast.  3.1.2  Flavin Synthesis NMR  spectra  of the  7-acetyl-10-methylisoalloxazine  and  7a-bromoacetyl- 10-  methylisoalloxazine synthesized in this work are given in Figure 3.18. These spectra confirm the purity of the two compounds, with each spectrum exhibiting the five proton peaks expected. The chemical shifts are similar to those described by Levine & Keiser (1978) and include the characteristic shift of the acetyl protons from 8 3.03 to 5 4.78 upon bromination of the 7-acetyl-10methylisoalloxazine compound.  60  o  o  CH  CH *  3  3  Aromatic H's  I  1  1  1  i  i  10  8  6  4  2  0  l  6 (ppm) Figure 3.18 N M R spectra of 7-acetyl-10-methylisoalloxazine (Panel A) and 7a-bromoacetyl-10- methylisoalloxazine (Panel B). Peaks marked with an asterisk correspond to the reference compound DSS (2,2'-dimethyl-2silapentane- 5-sulfonate).  61  3.1.3  Cysteine Accessibility and Flavin Modification Thiol assays were used to investigate the reactivity of the cysteine residues introduced  into the four variants. The kinetic traces and relative second order rate constants from these assays are given in Figure 3.19 and Table 3.3 respectively. The cysteines of all four variants exfiibit greatly increased reactivity relative to the Cys 102 residue of wild-type cytochrome c. The thiol of the Thr8Cys variant was the most reactive. As the thiol of the His39Cys variant was the least reactive of the four, reaction times for the modification of this variant with the flavin were optimized as outlined below, and these conditions were used for modification of the other variants. Thus the assumption was made that the more accessible cysteines would be completely modified under the conditions known to modify the least reactive thiol quantitatively.  Table 3.3 : Bimolecular rate constants (relative to WT cytochrome c) for reaction of cytochrome c Cys variants with 4,4-dithiodipyridine. Variants  Relative Bimolecular Rate Constant (M^min" )  Thr8Cys  1100(100)  His39Cys  65(5)  Asn62Cys  300(6)  Leu85Cys  200(20)  WT(102Cys)  1  1  Modification ofthe cytochrome c variants with theflavinmoiety was monitored by FPLC. Elution profiles observed after various reaction times for the His39Cys variant modification are shown in Figure 3.20. The initial ferricytochrome sample is slowly converted to flavin modified ferricytochrome which in turn is converted to the flavin modified ferrocytochrome. Complete modification was achieved after approximately 24 hours with quantitative conversion to flavin  62  0.50  0  10  20  30  40  50  Time (min)  Figure 3.19 Thiol assay kinetic traces for wild type (WT) cytochrome c and the Thr8Cys, His39Cys, Asn62Cys, and Leu85Cys variants (sodium phosphate buffer, pH 7.0, u = 0.1 M , 25 °C).  63  modified ferrocytochrome c (elution profile e in Figure 3.20). After modification, thiol assays were repeated to confirm the absence of free cysteine residues. All modified variants showed no absorbance increase over a period of one hour following addition of 4,4'-dithiodipyridine (data not shown), indicating that complete modification had been achieved.  3.1.4  Tryptic Digestion and H P L C Analysis The site of flavin attachment was identified by tryptic digestion of the unmodified and  modified proteins followed by separation of the peptides by reversed-phase HPLC. For each modified protein the position of the peptide containing the cysteine residue was shifted, indicating that modification had been achieved at this site. Representative peptide maps for the His39Cys cytochrome c variant are shown in Figure 3.21 along with the relative positions of the modified peptide peaks for the three other variants. The four peaks marked with an asterisk are associated with flavin degradation products formed during the hydrolysis reactions. This assignment was confirmed by subjecting a sample containing only free flavin to tryptic digestion and separation by the HPLC. These four peaks were observed at the same elution times as those seen with the flavin modified protein samples. The retention time of the fifth additional peak observed for the protein samples, varied for each protein sample and was thus identified as the peptide containing the modified cysteine residue.  3.1.5  Electronic Absorption Spectroscopy The four variants all exhibit electronic adsorption spectra similar to that of wild type iso-  1 -cytochrome c. Absorption maxima and associated extinction coefficients are given in Table 3.4. The spectra of the flavin-modified proteins correspond closely to the sum of the spectra for unmodified  64  a  in o  0  10 20 30 40 Elution volume (ml)  Figure 3.20 FPLC elution profiles monitoring flavin attachment to His39Cys cytochrome c (sodium phosphate buffer pH 7.2, 0.02 M). Reaction times are as follows: (a) 0 hrs, (b) 6 hrs, (c) 12 hrs, (d) 18 hrs, (e) 24 hrs. Free cysteine was added to the reaction after 18 hrs. Peak A corresponds to unmodified Fe(III) cytochrome c, peak B corresponds to modified Fe(III) cytochrome c, and peak C corresponds to modified Fe(II) cytochrome c. Material eluting in the first five minutes corresponds to excess free flavin and free cysteine. 65  T9in£ .co//WT ,  0  20  40  60  80  100  120  140  Retention Time (min) Figure 3.21 H P L C analysis (C-18 reverse phase) of tryptic peptides for wild type cytochrome c, the His39Cys variant and the flavin modified His39Cys variant. Shaded peaks A, B & C correspond to the peptide containing His39, Cys39 and modified Cys39 respectively. Also denoted by arrows are the positions of the mutated and modified residue containing peptides for the variants Thr8Cys (T8C), Asn62Cys (N62C) & Leu85Cys (L85C). The positional change for the T9 peptide in the cytochrome c expressed in Kcoli, which contains the TML72Lys mutation is also indicated. Peaks marked with an asterisk correspond to flavin degradation products. 66  Table 3.4 : Electronic absorption maxima and molar absorbances for unmodified and flavin modified cytochrome c variants.  a  Absorption maxima [nm(mM "'cm"*)] Protein Cys8Thrl02  Visible  Cys39Thrl02  2+  2+  Modified Cys8Thrl02  Modified Cys39Thrl02  2+  Fe  2+  Fe  3+  Fe  2+  520  550 529  520  550 529  520  550  529(12)  2+  2+  529 519  549 529  519  549 529  Fe* 2+  519(17)  549(29)  Fe*  Fe a  529  Fe*  Fe Modified Cys85Thrl02  520  550  Fe*  Fe Modified Cys62Thrl02  529  Fe* Fe  Cysl02  520(16)  550(28)  Fe* Fe  Cys85Thrl02  2+  Fe* Fe  Cys62Thrl02  530(11)  Fe* Fe  Soret  519  549  lOOmM sodium phosphate buffer (pH 7.0)  67  UV  410(106)  361(28)  278(23)  415(129)  315(34)  274(32)  409  361  279  414  315  273  409  361  279  415  315  274  409  360  278  415  315  274  410  361  278  415  315  274  408(125)  358(38)  275(52)  414(149)  310(50)  273(62)  407  358  278  414  312  272  407  359  277  414  313  273  406  358  274  413  313  271  cytochrome c and the unreacted flavin as shown in Figure 3.22.  3.1.6  Circular Dichroism Spectroscopy The circular dichroism spectra of the four unmodified and modified variants are  superimposable in both the visible and far U V regions (200 - 450 nm). Representative spectra for the unmodified and flavin modified Thr8Cys variant are shown in Figure 3.23.  3.1.7  Fluorescence Spectroscopy The intensity of fluorescence emission (X  excitalion  = 425nm) associated with the flavin was  significantly quenched (93-95%) following attachment to the protein variants. The X^ emission for the attached flavins exhibited bathochromic shifts of 5-7 nm relative to the corresponding unattached flavin (Table 3.5). Fluorescence emission spectra of the flavin 7-acetyl-10-methylisoalloxazine (Acflavin) and the modified His39Cys cytochrome c variant are given in Figure 3.24.  Table 3.5 : Fluorescence emission maxima and relative intensities for free and attached 7acetyl-10-methylisoalloxazine (A = 425 nm) excitation  A , ^ emission / nm  Relative intensity  Acflavin  528(1)  100  Fl-Thr8Cys  535(2)  7  Fl-His39Cys  534(2)  6  Fl-Asn62Cys  533(2)  7  Fl-Leu85Cys  534(2)  5  68  300  400 500 Wavelength (nm)  600  Figure 3.22 The electronic absorption spectra o f free 7-acetyl-10-methylisoalloxazine (solid), reduced Thr8Cys cytochrome c (dashed) and flavin modified reduced Thr8Cys cytochrome c (dotted) ( l O O m M sodium phosphate buffer, p H 7.0, 25 °C).  69  Figure 3.23 C D spectra of Thr8Cys cytochrome c (solid) and flavin modified Thr8Cys cytochrome c (dotted) (0.1M sodium phosphate buffer, pH 7.0, 25 °C).  70  Wavelength (nm)  Figure 3.24 Fluorescence emission spectra of the free flavin 7-acetyl-10-methylisoalloxazine (solid) and modified His39Cys cytochrome c variant (dotted) (0.1 M sodium phosphate buffer pH7.0 25 ° C ) ( X = 425nm). excitation  71  3.1.8  Electrochemistry The midpoint potentials for wild type cytochrome c and the four cysteine containing  variants were determined by cyclic voltammetry. All reduction potentials determined for these proteins are given in Appendix A. A typical cyclic voltammogram is illustrated in Figure 3.25a. The midpoint potentials observed at pH 7.0 (25 °C, u = 0.1 M) are shown in Table 3.6. The reduction potential for native yeast iso-l -cytochrome c was 280(2) mV, which is in good agreement with the value of 281(2) mV obtained by Rafferty (1992). Under the same conditions, three of the variants exhibit potentials similar to that of wild type cytochrome (274 - 280 mV). The His39Cys variant, however, was found to have a potential 25 mV lower than that of the wild-type protein. The  thermodynamic parameters for the oxidation-reduction equilibria of these  cytochromes were derived from the temperature dependence of the potentials and the following relationship: A G = A H - TAS° 0  [10]  0  Knowing that A G = - n F E permits the derivation of the relationship for a one electron process: 0  m  E  m  = TAS°/F-AH°/F  [11]  where F is Faraday's constant. As the reaction entropy change associated with the entire electrochemical cell (AS ) 0  includes the reference standard hydrogen electrode (SHE), the entropy associated with the reference electrode must be considered with the expression: AS^ASVASa*  [12]  Knowing the entropic change for the SHE half-cell is 15.6 eu (cal mor'K' ) at 25 °C (Taniguchi et 1  al., 1982), equation 12 can be rewritten: E  m  = T A S ° / F - ( A H ° + 4650)/F r e  72  [13]  a  b 0.1 u A  c  AE=120mV -0.4 -0.3 -0.2 -0.1  0.0  0.1  0.2  0.3  0.4  0.5  0.6  E ( m V vs S H E ) F i g u r e 3.25 C y c l i c v o l t a m m o g r a m s for (a) T h r 8 C y s c y t o c h r o m e c, (b) a c e t y l - 1 0 m e t h y l i s o a l l o x a z i n e , and (c) f l a v i n m o d i f i e d T h r 8 C y s c y t o c h r o m e c. R e d u c t i o n potentials (vs. S H E ) and peak separations are indicated ( 0 . 1 M s o d i u m phosphate buffer p H 7.0 2 5 ° C , sweep rate 2 0 m V s " ) . 1  73  Therefore, the slope of a plot of E vs T represents AS° / F and the y-intercept represents (AH° + m  re  4650) / F. The temperature dependence of the reduction potentials for wild-type cytochrome and the four variants are shown in Figure 3.26, and the associated thermodynamic parameters are given in Table 3.6. All the variants exhibited parameters similar to that of wild-type cytochrome with the exception, again, of His39Cys. This latter variant exhibited a relatively large standard entropy of reduction (-16.3(3) eu, relative to -11.0(2) eu for WT).  Table 3.6 : Electrochemical thermodynamic properties of wild-type and variant cytochromes Em,7  AG  AH  (mV)  (kcal/mol)  (kcal/mol)  (eu)  WT iso-1  280(2)  -6.4(2)  -14.4(7)  -11.0(2)  Thr8Cys  278(2)  -6.4(2)  -14.0(5)  -9.9(2)  His39Cys  255(2)  -5.9(2)  -15.4(9)  -16.3(3)  Asn62Cys  280(2)  -6.4(2)  -13.7(4)  -8.9(2)  Leu85Cys  274(2)  -6.3(2)  -14.4(6)  -11.7(2)  Protein  AS °  0  rc  The pH dependence of the midpoint potentials was also investigated as a further probe of the effects of substituting cysteinyl residues at four locations on the protein surface. This issue was of particular interest in regard to the His39Cys variant because the histidine at position 39 has been identified previously as the single titratable group (Moore et al, 1984) the pK of which is dependent 3  on the oxidation state of the heme iron. This pH dependence of E  m  can be described by the following  relationship: EinnH = E^o + (RT/nF) In (K + [FT]) / (K + [FT]) f  74  0  [14]  300  240 270 i  '  '  1  280  290  300  1  310  1  320  Temperature (Kelvin)  Figure 3.26 The temperature dependence of the reduction potentials of cytochrome c cysteine variants (0.1 M sodium phosphate buffer, pH 7.0): (•), Wild type; (•), Thr8Cys; (A), His39Cys; (o), Asn62Cys; (•), Leu85Cys. For figures 3.26, and 3.27, the error in the measured value of each point (±2 mV) is approximately three times the size of the symbols.  75  The dissociation constants, K and K , represent the oxidation state-linked titratable groups of the t  0  reduced and oxidized proteins respectively. Values for pK , pK and E^,, are obtained by fitting the 0  r  measured potentials to this equation and the resulting values for the wild-type and variant proteins are given in Table 3.7 with the associated data shown in Figure 3.27. The values of pK , and pK for 0  T  the wild-type cytochrome c are in good agreement with those reported previously (pK = 6.6, pK = 0  t  7.2 Cutler et al, 1989). Of the four variants, the His39Cys variant is the only one to deviate appreciably in behavior from the wild-type protein. This variant exhibits pK and pK values of 7.5(2) 0  t  and 7.9(2) respectively, increases of 0.7 - 0.9 pK units.  Table 3.7 : pK values for residue 39 in the oxidised (p^ ) and reduced (piQ states a  0  Protein  E ^ (mV)  pK  pK  WT iso-l  295(2)  6.6(1)  7.0(1)  Thr8Cys  295(2)  6.3(1)  6.7(1)  His39Cys  262(2)  7.5(2)  7.9(2)  Asn62Cys  289(2)  6.8(1)  7.1(1)  Leu85Cys  288(2)  6.7(1)  7.1(1)  The reduction  potential  0  for the 2  electron reduction  t  of  free  7-acetyl-10-  methylisoalloxazine was also studied by cyclic voltammetry. A typical cyclic voltammogram for the flavin is illustrated in Figure 3.25b. The reduction potential of the flavin at pH 7.0 (25 °C, u = 0.1 M) is -113(2) mV. As outlined above, the thermodynamic parameters were calculated from the temperature dependence data, and the resulting values for these parameters were A G = 5.2(2) kcal/mol, A H = -4.9(7) kcal/mol and AS ° = -18.5(4) eu. 0  re  The pH dependence of the reduction potential of 7-acetyl-10-methylisoalloxazine was also studied, and the values for the 2 electron transfer process ( E J are shown in Figure 3.28. The E 76  m  240  7  8  pH  F i g u r e 3.27 T h e p H dependence o f r e d u c t i o n potentials o f c y t o c h r o m e c c y s t e i n e variants (0.1 M s o d i u m phosphate buffer, 25 ° C ) : ( • ) , W i l d t y p e ; ( • ) , T h r 8 C y s ; (A), H i s 3 9 C y s ; ( o ) , A s n 6 2 C y s ; ( • ) , L e u 8 5 C y s . T h e interpolated curves w e r e c a l c u l a t e d u s i n g equation 14.  77  vs pH curve can be divided into three linear sections that cover the pH ranges 5.0 to 7.0, 7.0 to 9.5, and 9.5 to 11.9, respectively. This behavior is expected for a flavin system in which the oxidized and the reduced forms have only one pK value each. This type of system is amenable to manual fitting a  as outlined by Draper & Ingraham (1968). As outlined in the experimental chapter of this thesis, spectroelectrochernical studies were conducted to obtain reduction potentials for the one electron processes associated with the flavoquinone / flavosemiquinone couple (E,) and flavosemiquinone / flavohydroquinone couple (Ej). The results of these measurements were fit to the Michaelis equation. The potential values for the 2 electron process calculated from the spectroelectrochernical data obtained at various values of pH are in excellent agreement with the corresponding data obtained by cyclic voltammetry and are given in Table 3.8. A representative family of spectra obtained from the spectroelectrochernical titration of the flavin is shown in Figure 3.29 along with the corresponding Nernst plot. The semiquinone formation constants and the values obtained for E , and E are also given in Table 3.8 and Figure 3.28. 2  Table 3.8 : Potentials for 7-acetyl-10-methylisoalloxazine obtained from spectroelectrochemcial experiments.  K  pH (mV)  AE (mV)  (mV)  E (mV) 2  5.01  27(1)  0.10(4)  60(10)  -3(5)  57(5)  7.00  -114(1)  0.06(2)  72(10)  -150(5)  -78(5)  9.02  -174(1)  0.05(2)  80(10)  -214(5)  -134(5)  11.04  -284(1)  0.06(2)  74(10)  -321(5)  -247(5)  78  Figure 3.28 The pH dependence of the three reduction potentials of 7-acetyl-10methylisoalloxazine. E (•) is the potential of the oxidized-fully reduced species, and E ! and E (A) are the potentials of the oxidized-semiquinone and fully reduced-semiquinone systems respectively. The solid lines are the fitted curves obtained by the graphical method of Draper & Ingraham (1968). These fits were used to estimate values for pK pK and pK . Reduction potentials are also shown for the flavin component of the modified cytochrome c: (0), Thr8Cys; (•), His39Cys; (o), Asn62Cys; (A), Leu85Cys. The error in the measured value of each point (±2 mV) is contained within the size of the symbols. The error in the calculated E ! and E values (±5 mV) is indicated with error bars. m  2  n  2  79  s  0  350  400  450  500  550  Wavelength (nm)  F i g u r e 3.29 S p e c t r o e l e c t r o c h e m i c a l titration o f 7 - a c e t y l - 1 0 - m e t h y l i s o a l l o x a z i n e (0.1 M s o d i u m phosphate buffer, p H 7.0 25 ° C ) . A p p l i e d potentials, E ( m V vs S H E ) : (a) 0.0, (b) -75.6, (c) 94.5, (d) -100.8, (e) -107.6, (f) -115.3, (g) - 1 2 5 . 1 , (h) -132.6, (i) - 1 4 1 . 2 , Q) - 1 5 1 . 5 , (k) - 3 1 0 . 3 . T h e inset is a N e r n s t plot calculated f r o m the absorbance at 421 n m . a p p  80  The graphical method of Draper & Ingraham (1968) was also employed to estimate the pK , pK & pK, values for the flavin (Figure 3.28). Because E and r  0  x  values were determined at just  four pH values, the assumption was made that the pH dependence of the two single electron coupling processes (E and E ) was similar to that of the two electron process (E.J over the pH range studied. x  2  Previous studies have shown this assumption to be valid for riboflavin, F M N (Draper & Ingraham, 1968), and 8a-imidazolylflavins (Williamson  al., 1985). The values obtained in the current analysis,  pK = 7.00(20), pK = 9.40(20) & pK = 8.20(20), are similar to those reported previously for t  0  s  riboflavin and F M N ( p ^ = 6.25 pK = 10.00 pK = 8.27 & pK, = 6.72 pK = 10.35 pK = 8.55, 0  s  0  s  respectively (Draper & Ingraham 1968)). Reduction potentials for the heme and flavin sites of the modified variants were also investigated with both cyclic voltammetry and spectroelectrochernical techniques. A typical cyclic voltammogram obtained for a flavin modified cytochrome is shown in Figure 3.25c. Potentials of the heme and flavin centers (pH 7.0, 25 °C, u = 0.1 M) of the four modified variants are given in Table 3.9. While no appreciable change was observed in the potentials of the heme iron (±4 mV), a decrease of 5-10 mV was observed for the covalently bound flavin centers. Notably, it was possible to achieve direct electrochemistry of the heme iron centers of the modified proteins without modification of the gold electrode surface with 4,4'-dithiodipyridine. This observation suggests that the attached flavin mediates electron transfer between the protein and the electrode surface. The temperature dependence of the reduction potentials associated with the heme and flavin centers was investigated to obtain the corresponding thermodynamic parameters. The resulting data are shown in Figure 3.30, and the associated parameters are summarized in Table 3.9. From these results, it is clear that flavin-modification causes no appreciable changes in the parameters observed for the heme iron center. In contrast, the enthalpies and entropies of the flavin centers  81  300  240 270  280  290  300  310  320  310  320  Temperature (Kelvin)  W -130  -140 270  280  290  300  Temperature (Kelvin) Figure 3.30 The temperature dependence, of heme and flavin center reduction potentials of flavin-modified cytochrome c variants and of free 7-acetyl-10-methylisoalloxazine (0.1 M sodium phosphate buffer, pH 7.0): (A) Heme centers of (•), Fl-Thr8Cys; (•), Fl-His39Cys; (•), Fl-Asn62Cys; (•), Fl-Leu85Cys. (B) Flavin centers of (•), free flavin; (A), Fl-Thr8Cys (•), Fl-His39Cys; (0), Fl-Asn62Cys; (o), Fl-Leu85Cys. The error in the measured value of each point (±2 mV) is approximately three times the size of the symbols. 82  u n d e r g o a significant change u p o n attachment t o the p r o t e i n ( A H -6.5(7) - -8.2(8) k c a l / m o l a n d A S °  r c  0  changes from -4.9(7) k c a l / m o l t o  changes f r o m -18.5(4) e u t o -25.0(3) - - 2 8 . 9 ( 3 ) eu).  T a b l e 3 . 9 : T h e r m o d y n a m i c parameters o f the o x i d a t i o n - r e d u c t i o n equilibria o f the f l a v i n modified cytochromes heme center  flavin  center  E ,7  AG  AH°  AS °  Em,7  AG  AH°  AS °  (mV)  (kcal/mol)  (kcal/mol)  (eu)  (mV)  (kcal/mol)  (kcal/mol)  (eu)  Fl-Thr8Cys  279(2)  -6.5(2)  -14.1(9)  -10.0(3)  123(2)  5.7(2)  -6.5(7)  -25.0(3)  Fl-His39Cys  257(2)  -5.6(2)  -15.0(6)  -15.9(2)  115(2)  5.3(2)  -8.2(8)  -28.9(3)  Fl-Asn62Cys  279(2)  -6.4(2)  -13.8(5)  -9.3(2)  118(2)  5.4(2)  -7.0(8)  -25.8(3)  Fl-Leu85Cys  272(2)  -6.3(2)  -14.7(5)  -11.9(2)  115(2)  5.3(2)  -7.4(9)  -26.5(4)  m  T h e p H dependent  rc  electrochemical b e h a v i o r o f the m o d i f i e d  rc  proteins w a s also  investigated. T h e pK values for the titratable g r o u p , the p r o t o n a t i o n state o f w h i c h i s l i n k e d t o the a  o x i d a t i o n state o f the heme i r o n (pK and pK ), w e r e determined as d e s c r i b e d a b o v e f o r the t  0  u n m o d i f i e d proteins. T h e resulting data are s h o w n i n F i g u r e 3.31, and the values derived from these data are s u m m a r i z e d i n T a b l e 3.10. A s can be seen f r o m these results, all o f the cytochromes exhibit similar b e h a v i o r i n these experiments w i t h the notable e x c e p t i o n o f the  flavin-modified  His39Cys  variant. T h i s m o d i f i e d variant is unique i n that the potential o f the heme center is independent o f p H . T h e p H dependence o f the m i d p o i n t potentials o f the flavin centers o f the m o d i f i e d variants w a s also studied o v e r the p H range 5.5 t o 8.0. These data are s u m m a r i z e d i n F i g u r e 3.28 ( o p e n s y m b o l s ) t o reveal p H dependent b e h a v i o r w i t h the same general trend as that o f flavin that is not attached t o the protein.  83  Table 3.10 : pA" values for residue 39 in the oxidized (pK ) and reduced (pK ) states of the flavin-modified cytochromes a  0  T  Protein  E^o (mV)  p^  ;  pK  Fl-Thr8Cys  294(2)  6.4(1)  6.8(1)  Fl-His39Cys  260(2)  NA  NA  Fl-Asn62Cys  287(2)  6.8(1)  7.1(1)  Fl-Leu85Cys  287(2)  6.5(1)  6.9(1)  r  To obtain the semiquinone formation constants and the one electron couple potentials of the modified proteins, Ej and E , spectroelectrochernical experiments were carried out. A 2  representative family of spectra obtained for the flavin from such an experiment is shown in Figure 3.32. Reduction potentials (E , E ! and E ) and semiquinone formation constants (K) for the flavin m  2  centers of the four variants obtained from these measurements are given in Table 3.11. The values of K and thus the separation between the E and E potentials are similar to those associated with the t  2  free flavin, indicating that the attachment process does not perturb the relative stability of the semiquinone form.  Table 3.11 : Potentials for flavin redox center of modified proteins calculated from spectroelectrochernical experiments. PH  E (mV)  K  m  AE (mV)  (mV)  E (mV)  Ei  2  Fl-Thr8Cys  7.0  -113(1)  0.04(2)  82(18)  -153(9)  -72(9)  Fl-His39Cys  7.0  -119(1)  0.04(2)  84(18)  -161(9)  -77(9)  Fl-Asn62Cys  7.0  -116(1)  0.06(2)  72(10)  -152(5)  -80(5)  Fl-Leu85Cys  7.0  -116(1)  0.08(3)  64(12)  -148(6)  -84(6)  84  F i g u r e 3.31 D e p e n d e n c e o f the r e d u c t i o n potentials for the heme centers o f f l a v i n - m o d i f i e d c y t o c h r o m e s o n p H (0.1 M s o d i u m phosphate buffer, 25 ° C ) : ( • ) , F l - T h r 8 C y s ; (A), F l H i s 3 9 C y s ; ( • ) , F l - A s n 6 2 C y s ; ( • ) , F l - L e u 8 5 C y s . T h e s o l i d lines represent the fits o f the data to E q 15. T h e error i n the measured v a l u e o f each p o i n t ( ± 2 m V ) is a p p r o x i m a t e l y three t i m e s the size o f the s y m b o l s .  85  500  550  Wavelength (nm)  Figure 3.32 Spectroelectrochernical titration of flavin modified Thr8Cys cytochrome c (0.1 M sodium phosphate buffer, pH 7.0 25 °C). Applied potentials, E (mV vs SHE): (a) +40.0, (b) -25.0, (c) -40.2, (d) -55.1, (e) -70.4, (f) -85.0, (g) -99.9, (h) -115.1, (i) -129.8, 0) -145.0, (k) 160.3, (1) -239.8. Inset A is a Nernst plot calculated from the absorbance at 432 nm. Inset B shows the expanded spectra of the modified protein with a fully reduced (R) and the fully oxidized flavin (O) component. a p p  86  3.1.9  Flash Photolysis  3.1.9.1  Intermolecular Electron Transfer Kinetics The dependences of the observed rate constants (& ) for the reaction of cytochromes obs  with various flavin semiquinone derivatives on protein concentration are shown in Figure 3.33, and the k  obi  values are tabulated in Appendix B. In each case, k  obi  varied linearly with protein  concentration, and the linearfitsto the data extrapolated within the uncertainty of thefitto the origin. The slopes of these plots provide the second order rate constants for these reactions (Equation 15):. *ob = n [Cytochrome c]  [15]  k  S  The k values derived from these data are given in Table 3.12. The rate constant for the reduction 12  of horse heart ferricytochrome c by riboflavin (0.48 x 10 M^s' ) is in good agreement with previously 8  1  reported values (Meyer et al., 1984). Both 7-acetyl-10-methylisoalloxazine and 7a-bromoacetyl-10methylisoalloxazine reduce the cytochrome more rapidly than does riboflavin (k = 0.63 x 10 and 8  12  0.58 x 10 M^s" , respectively). The yeast cytochrome expressed in yeast and in E. coli is more 8  1  rapidly reduced by 7-acetyl-10-methylisoalloxazine than is the horse heart protein. The cytochrome variants exhibit rate constants in these reactions that are within experimental error (~ ±10%) of the values observed for the wild-type protein. The temperature dependence of cytochrome reduction by flavins was measured for three bimolecular reactions. The activation enthalpies (AH*) and entropies (AS*) for these reactions were calculated byfittingthe data to the Eyring equation: Ink /T = A S * / R - A H * / R T + I n & / h l2  B  [16]  The activation parameters derivedfromthese analyses are given in Table 3.13, and the corresponding Eyring plots are shown in Figure 3.34.  87  Figure 3.33 The dependence of k on [ferricytochrome c] in the reduction of horse heart cytochrome c with (—•—•), riboflavin; (• • o - •), 7-acetyl-lO-methylisoalloxazine; and ("•"), 7a-bromoacetyl-10-methylisoalloxazine; and for the reduction of yeast /so-l-cytochrome c (—•-), wild-type; ( - • - ) , Thr8Cys; (••-A--), His39Cys; (~0~), Leu85Cys; E. coli cytochrome c (• • * • •), WT; & (•"•--), Asn62Cys with 7-acetyl-10-methylisoalloxazine (0.1 M sodium phosphate buffer pH 7.0, 25 °C). The error in each point is estimated to be ± 5%. obs  88  F i g u r e 3.34 E y r i n g plots for the b i m o l e c u l a r r e d u c t i o n o f horse heart and yeast c y t o c h r o m e s b y f l a v i n derivatives (0.1 M s o d i u m phosphate buffer, p H 7.0, 25 ° C ) : ( • ) , horse heart c y t o c h r o m e r e d u c t i o n b y r i b o f l a v i n ; (A), horse heart c y t o c h r o m e r e d u c t i o n b y 7 - a c e t y l - 1 0 m e t h y l i s o a l l o x a z i n e ; ( o ) , yeast iso-\-cytochrome reduction by 7-acetyl-10-methylisoalloxazine.  89  Table 3.12 : Rate constants for the reduction of cytochrome c (Fe ) variants by various flavins 3+  protein  flavin  k xlO' (M' s' )  horse heart cytochrome c  riboflavin  0.48(5)  horse heart cytochrome c  7-acetyl-10-methylisoalloxazine  0.63(4)  horse heart cytochrome c  7a-bromoacetyl-10-methylisoalloxazine  0.58(3)  iso-l -cytochrome c  7-acetyl-10-methylisoalloxazine  1.03(7)  iso-1 -cytochrome c Thr8Cys  7-acetyl-10-methylisoalloxazine  1.02(10)  iso-l -cytochrome c His39Cys  7-acetyl-10-methylisoalloxazine  0.99(9)  wo-1-cytochrome c Leu85Cys  7-acetyl-10-methylisoalloxazine  1.10(10)  E. coli cytochrome c  7-acetyl-10-methylisoalloxazine  1.05(8)  E. coli cytochrome c Asn62Cys  7-acetyl-10-methylisoalloxazine  1.12(10)  8  1  1  n  Table 3.13 : Rate constants and activation parameters for the reduction of cytochorme c (Fe ) 3+  by various flavins protein  flavin  k  AH*,  n  AS*,  (M'V x 10' )  (kcal mol' )  (e.u.)  1  8  1  horse heart  riboflavin  0.48(5)  3.9(2)  -10.4(1)  horse heart  7-acetyl-10-methylisoalloxazine  0.63(4)  3.8(2)  -10.5(1)  iso-l -  7-acetyl-10-methylisoalloxazine  1.03(7)  3.3(3)  -10.7(1)  3.1.9.2  Intramolecular Electron Transfer Kinetics The intramolecular electron transfer kinetics of the four flavin modified cytochrome c  variants were also studied by laser flash photolysis techniques. Each variant was studied over a pH range of approximately 5 - 8 and over a temperature range of 284 to 308 K at pH 7.0. The results obtained at pH 7.0 and T = 298 K are given in Table 3.14, and the results obtained under all conditions studied are given in Appendix C. Activation parameters calculated from the temperature dependence data are also given in Table 3.15. If it is assumed that the weak dependence of T on Vl  90  temperature can be neglected (Marcus & Sutin, 1985) and that the protein structure and  are  temperature independent, a plot of In k vs. T" has a slope of -(AG + A) AUK , thus enabling an 1  2  B  estimation of the reorganization energy (X). The corresponding Eyring plots are shown in Figure 3.35, and the values of X derived from this analysis are given in Table 3.14. All four modified proteins exhibit AH* values of approximately 3.0(2) kcal mol' and large negative entropies of activation (AS* 1  = -31 - -38 e.u.). The calculated reorganization energies (A) vary from 1.0(1) to 1.3(1) eV with an overall average value of 1.2(2) eV.  Table 3.14 : Observed rate constants, activation parameters and reorganization energies for the intra-molecular electron transfer of flavin modified cytochrome c derivatives  k  a  "•obs 1  a  AS* (e.u.)  (eV)  1  (s- )  X  AH* (kcal mol' )  Fl-Thr8Cys  4.41(22) x 10  3.2(2)  -31(1)  1.3(1)  Fl-His39Cys  1.29(7) x 10  3.0(2)  -35(1)  1.2(1)  Fl-Asn62Cys  2.46(12) x 10  3.0(2)  -38(1)  1.0(1)  Fl-Leu85Cys  8.51(42) x 10  3.0(2)  -35(1)  1.3(1)  3  3  2  2  pH7.0T=25°C Knowing X for each variant, it is possible to estimate the corresponding electronic  coupling parameters, H ^ by fitting the experimental driving-force dependent electron transfer rate constants for each variant to Eq. 5 by least squares analysis. The resulting plots of In k vs - A G are 0  et  shown in Figure 3.36. From these fits, an experimental estimate for the electronic coupling values (HAB) associated with the electron transfer process can be obtained. Comparison of these values (Table 3.15) and the H ^ values obtained from the pathway calculations is considered below. The value for the reorganization energy of cytochrome c (0.5 eV) has been derived from analysis of the self-exchange reaction of this protein (Marcus & Sutin, 1985). The reorganization energy for the  91  Figure 3.35 Eyring plots for the intra-molecular reactions of flavin modified cytochrome c (0.1 M sodium phosphate buffer, pH 7.0, 25 °C): (A), Fl-Thr8Cys; (o), Fl-His39Cys, (o), F l Asn62Cys; (•), Fl-Leu85Cys. The error for each point is contained within the size of the symbol.  92  Figure 3.36 Dependence of k on - A G for the reduction of cytochromes c by the covalently attached flavin (sodium phosphate buffer, 25 °C): (*), Fl-Thr8Cys; (o) Fl-His39Cys; (o), FlAsn62Cys ;(•), Fl-Leu85Cys. The solid lines are the best fits to equation 5. The shaded area represents the uncertainty in the fit when using the range of values for X obtained from the temperature dependence data. A representative absorption transient and fit are shown in the inset. The error for each point is contained within the size of the symbol. 0  obs  93  flavin attached to the cytochrome can then be determined by simply subtracting the protein reorganization energy from the overall reorganization energy of the system. In this way the reorganization energy of the flavin center is calculated to be 0.7(2) eV.  3.1.10  Structure Modeling To aid interpretation of the kinetic results, energy minimized structural models for the  four variants and their corresponding flavin modified derivatives were calculated using the program INSIGHT (Biosym, CA) (In collaboration with Dr. P. Siddarth) as described in section 2.9 (Page 59). The calculations predict that the four cysteine variants all have structures similar to that of wild type iso-1 -cytochrome c, and upon subsequent modification with 7a-bromoacetyl-10-methylisoalloxazine, the protein structures still remain essentially unperturbed. Only small localized changes around the attachment sites are anticipated (Figures 3.37-3.40). For the modified Cys 8, 39, and 85 variants, the flavin appears to be oriented away from the protein surface into the surrounding solvent, suggesting that electron transfer will only occur through the covalent linkage with the cysteine residue. The model for the modified Cys 62 variant is somewhat different and suggests that the flavin is oriented closer to the protein surface. Aside from the covalent attachment to residue 62, the flavin moiety in his derivative is predicted to be close proximity to two other residues, Glu -4 (d [flav62 N5 - Glu-4 Oel] = 2.7A) and Glu 66 (d [flav62 C9 - Glu66 02] = 2.1 A). This proximity may lead to the possibility of electron transfer through space from the flavin to these two residues. Such a mechanism must be considered in subsequent kinetic analysis and electron transfer pathway modeling.  3.1.11  Electron Transfer Pathway Calculations The best single pathway between the flavin donor and the heme acceptor for each  94  modified variant calculated with the Greenpath program is illustrated in Figures 3.3 7-3.40 (top panel). Artificial intelligence (Al) searches were also carried out to identify the most likely set of residues involved in electron transfer pathways from the donor to acceptor center (In collaboration with Dr. P. Siddarth). These searches produced several pathways for each variant, and the amino acid residues identified in this process are given in Table 3.15. Figures 3.37-3.40 (bottom panel) illustrate these pathways and the positions of the critical residues within each structure. Using only the amino acid residues identified by the A l search, quantum mechanical calculations of the electronic coupling matrix element were performed. Because extended Hiickel theory was used to calculate FL^ (Table 3.15), the uncertainty in the values of  is large. In addition these calculations assume that both the  protein structure and the electronic coupling within this structure are independent of temperature. The theoretical values of FL^ are in good agreement with those calculated from the electron transfer kinetics (section 3.1.8.2; Table 3.15).  Table 3.15 : Amino acids residues selected by A l search and experimental and theoretical electronic coupling values Modified protein  Thr8Cys  His39Cys  Asn62Cys  Leu85Cys  Amino acid pathway set  Cys 14 Phe 10 Lys 11 Ala7 Leu9 Argl3  Ser40 Gly41 Asn52 Val57 Leu58 Trp59  Glu66 Tyr67 Met80 Met64 Asn63  Cysl4 Argl3 Cysl7 Leu 15 Phe 10 Leu9  experimental FL^  0.08(3)  0.04(2)  0.01(1)  0.04(2)  theoretical FL^  0.07  0.03  0.02  0.04  95  F i g u r e 3.37 E n e r g y - m i n i m i z e d structure o f f l a v i n m o d i f i e d T h r 8 C y s c y t o c h r o m e c. (a) E l e c t r o n transfer p a t h w a y p r o p o s e d b y G r e e n p a t h p r o g r a m ( t h i c k l i n e s ; dashed lines denote h y d r o g e n bonds), (b) R e s i d u e s i n v o l v e d i n electron transfer p a t h w a y as selected b y A I superexchange m o d e l (thick lines).  96  F i g u r e 3.38 E n e r g y - m i n i m i z e d structure o f f l a v i n m o d i f i e d H i s 3 9 C y s c y t o c h r o m e c. (a) E l e c t r o n transfer p a t h w a y p r o p o s e d b y G r e e n p a t h p r o g r a m ( t h i c k l i n e s ; dashed l i n e s denote h y d r o g e n bonds), (b) R e s i d u e s i n v o l v e d i n electron transfer p a t h w a y as selected b y A I superexchange m o d e l (thick lines).  97  F i g u r e 3.39 E n e r g y - m i n i m i z e d structure o f f l a v i n m o d i f i e d A s n 6 2 C y s c y t o c h r o m e c. (a) E l e c t r o n transfer p a t h w a y p r o p o s e d b y G r e e n p a t h p r o g r a m ( t h i c k l i n e s ; dashed lines denote h y d r o g e n bonds), ( b ) R e s i d u e s i n v o l v e d i n electron transfer p a t h w a y as selected b y A I superexchange m o d e l (thick lines).  98  Ala81  a  F i g u r e 3.40 E n e r g y - m i n i m i z e d structure o f f l a v i n m o d i f i e d L e u 8 5 C y s c y t o c h r o m e c. (a) E l e c t r o n transfer p a t h w a y p r o p o s e d b y G r e e n p a t h p r o g r a m ( t h i c k l i n e s ; dashed lines denote h y d r o g e n bonds), (b) R e s i d u e s i n v o l v e d i n electron transfer p a t h w a y as selected b y A I superexchange m o d e l (thick lines).  99  3.2  Axial Ligand Variants  3.2.1  Protein Expression and Purification The yield of purified cytochrome c variants obtained from recombinant E. coli varied from  <0.1 mg/L to 3.0 mg/L of culture. The expression of the Met80Ala variant was the most efficient, and expression ofthe Tyr67Phe/Met80Ala/Phe82Ser variant was the least efficient. Expression of the triple variant Tyr67Phe/Met80Ala/Phe82Ser was insufficient to permit spectroscopic characterization of the protein, so this variant will not be considered further. The efficiency of protein expression correlated approximately with the affinity of the protein for binding of N O to the heme iron. Indeed, if no N a N 0 supplement was added to the growth medium, then expression of the axial ligand 3  variants was essentially suppressed, suggesting that the binding of N O to the heme is necessary for expression of variants with the Met80Ala substitution.  3.2.2  Electronic Absorption Spectroscopy  3.2.2.1 Ligand Binding The electronic absorption maxima of several derivatives of Met80Ala, Met80Ala/Tyr67Phe and Met80Ala/Phe82Ser variants are given in Table 3.16. Representative spectra of the Fe(III) and Fe(II) derivatives are shown in Figure 3.41. All three variants exhibit spectra that are consistent with a heme site that can bind an exogenous ligand at the sixth coordination position. As a result, the spectra of these ferricytochrome variants resemble the corresponding spectra of myoglobin. Overall, the maxima of the Fe(III) derivatives all exibit a blue-shift of 5-10 nm relative to myoglobin. This difference can be attributed to the presence of a c-type heme in the cytochrome variants and a 6-type heme in myoglobin. As discussed below (Section 3.2.2.2, page 101) spectra of the ferricytochrome variants at pH 7.0 differ from the corresponding myoglobin spectrum owing to the variation in pK  a  100  of the distally coordinated water molecule. Consequently, the relative amounts of high-spin and lowspin heme iron at pH 7 vary from protein to protein. As expected, replacement of Met80 eliminates the 695 nm band from the spectrum of these ferricytochrome variants. In contrast to the spectra of the ferricytochrome variants, spectra of the ferrocytochrome variants differ markedly from the spectrum of deoxy myoglobin. The Soret bands of the Met80Ala and Met80Ala/Tyr67Phe ferrocytochromes are composed of two components, a major peak with a maximum at -411 nm and a minor peak giving rise to a shoulder at 430 nm. These spectra compare to the spectrum of myoglobin which has a Soret maximum at 434 nm that is characteristic of a high-spin ferrous heme iron center (Makinen et al, 1983). This observation has been reported previously for the yeast cytochrome c His39Asn/Met80Ala/Cysl02Ser variant (Bren, 1996). These authors attributed the two Soret maxima of this variant to five-coordinated, high-spin (430 nm) and six-coordinated, lowspin (-411  nm) components.  The corresponding spectrum  of the Met80Ala/Phe82Ser  ferrocytochrome variant is somewhat different with a sharp Soret band at 41 lnm and that lacks the secondary maximum at ~430nm. This observation that the Met80Ala/Phe82Ser variant heme exists as a low-spin species upon reduction is further indicated by the visible region of the spectrum in which the a (519 nm) and P (549 nm) bands are clearly resolved. The spectra of the Fe(II) C O and 0  2  derivatives of all three variants exhibit features similar to those of the corresponding myoglobin derivatives but with the 5-10nm blue-shift discussed above. This observation suggests that the sixth ligand bound to the reduced variants is sufficiently labile to be replaced easily by either C O or 0 . 2  3.2.2.2 p H Titrations As previously reported (Bren, 1996), the pK of the distal water ligand of the Met80Ala 3  variant is 6.2(1), a value much lower than that for wild type horse heart myoglobin (pAT = 8.9) a  101  T a b l e 3.16 : A b s o r p t i o n m a x i m a (nm) and m o l a r absorbances" ( r n M ^ c m " ) o f c y t o c h r o m e c 1  axial ligand variants ( S o d i u m phosphate buffer, p H 7.0, u = 0 . 1 M , 2 5 ° C ) Protein  Visible/near-TR  Soret  Met80Ala Fe(III) Fe(III) N O Fe(II) d e o x y  406(122)  535(10)  563(7)  415.5  529  562.5  411(87); 435, s h  b  514, sh  548(10)  570, sh 571(9)  Fe(II) o x y  408(113)  537(77)  Fe(II) C O  414(234)  Fe(II) N O  411  538  567  405(107)  527(10)  559(7)  414.5  528  560  4 1 6 ( 8 0 ) ; 4 3 5 , sh  519, sh  Fe(II) o x y  408.5(98)  538(12)  Fe(II) C O  413.5(182)  Fe(II) N O  410  537  401.5  529  414  528  560  411.5  519  549  Fe(II) o x y  404  536  570  Fe(II) C O  412.5  Fe(II) N O  409  533(13)  555, sh  Met80Ala/Tyr67Phe Fe(III) Fe(III) N O Fe(II) d e o x y  548.5(9)  567, sh 570(9)  531(8)  553,sh 566  Met80Ala/Phe82Ser Fe(III) Fe(III) N O Fe(II) d e o x y  a  b  561  531.5 536  M o l a r absorbances c o r r e s p o n d t o horse heart c y t o c h r o m e c variants ( B r e n , 1996). sh = shoulder peak.  102  620  5 5 5 , sh 566  F i g u r e 3.41 E l e c t r o n i c absorption spectra o f o x i d i z e d (dotted) and reduced ( s o l i d ) c y t o c h r o m e c a x i a l l i g a n d variants (100 m M s o d i u m phosphate buffer, p H 7.0, 25 ° C ) . ( A ) M e t 8 0 A l a ; ( B ) Met80Ala/Tyr67Phe; (C) Met80Ala/Phe82Ser.  103  (Antonini & Brunori, 1971). The pH dependence of the spectra for the Met80Ala variant is given in Figure 3.42. The corresponding pK values for the Met80Ala/Tyr67Phe and Met80Ala/Phe82Ser a  variants derived from similar titrations are 5.8(1) and 7.5(1), respectively. These latter results are somewhat surprising because it has been suggested previously that the low pAT observed for the a  Met80Ala variant is probably attributed to stabilization of the coordinated hydroxide ligand through hydrogen bonding to the Tyr67 residue (Bren et al., 1995).  3.2.3  Circular Dichroism Spectroscopy The U V - C D spectra for the three variants (data not shown) are all similar to that of wild-  type /'so-1-ferricytochrome c, which suggests that the secondary structures of the variants are the same as that of wild-type cytochrome c. Thermal denaturation curves for these variants are given in Figure 3.43 along with the calculated first derivatives of these curves. The melting temperatures obtained from these data for the Met80Ala and Met80Ala/Tyr67Phe variants are 53(1) and 50(1) °C, respectively. These values are marginally lower than the value for wild-type iso-1 -ferricytochrome c (54°C). Interestingly the Met80Ala/Phe82Ser variant exhibits a melting curve composed of two transitions at 45(1) and 48(2) °C. This observation is consistent with the hypothesis that the protonation state of the heme-bound water affects the overall thermal stability of this variant. At pH 7.0 the Met80Ala/Phe82Ser variant is composed of both water bound and hydroxide bound species, with the majority of the protein possessing a heme with a bound water molecule. It is conceivable that the transition at 45(1) °C corresponds to the thermal denaturation of the water bound species with the lower melting temperature resulting from the additional charge on the heme core. A similar observation was reported by Bren (1996) for the yeast His39 Asn/Met80Ala/Cys 102Ser variant, albeit to a lesser extent, and a similar explanation was proposed for this result.  104  3.2.4  Electrochemistry The reduction potentials (vs SHE, Sodium phosphate pH 7.0, T = 25 °C) of the Met80Ala,  Met80Ala/Tyr67Phe, and Met80Ala/Phe82Ser variants (u= 0.1 and 0.5 M) determined by spectroelectrochernical methods are given in Table 3.17. These values are all significantly lower than the value for wild-type yeast cytochrome c (290 mV) as expected for variants in which the axial methionine ligand has been removed. A representative spectroelectrochernical titration of the Met80Ala/Tyr67Phe variant is shown in Figure 3.44.  Table 3.17 : Reduction potential values for the axial variants Met80Ala, Met80Ala/Tyr67Phe, and Met80Ala/Phe82Ser (pH 7.0, 25 °C)  3.2.5  p  Met80Ala  Met80Ala/Tyr67Phe  Met80Ala/Phe82Ser  0.1 M  -27(2)  26(2)  -98(5)  0.5 M  -45(2)  11(2)  -109(5)  Ligand Binding Kinetics A representative transient absorption trace obtained for binding of C O to the Met80Ala  variant is shown in Figure 3.45. Rate constants for CO recombination for the three variants derived from such measurements are similar to those observed for wild type horse heart myoglobin (k = 5.0 on  x 10  s  M'V ). 1  These rate constants are 2.2(3) x 10  5  M'V  1  for Met80Ala, 4.7(3) x 10  s  M'V  1  for  Met80Ala/Tyr67Phe and 9.5(4) x 10 M ' V for Met80Ala/Phe82Ser. These results are in contrast s  1  to the observations of Bren & Gray (1993a) for the semisynthetic Met80Ala horse heart cytochrome c variant in which an anomalously slow CO recombination (8.7(8) x 10 M ' V ) was recorded. These 3  1  authors also reported that the His39Asn/Met80Ala/Cysl02Ser yeast cytochrome variant failed to exhibit detectable CO recombination upon photolysis.  105  300  400  500  600  700  Wavelength (nm)  Figure 3.42 The electronic absorption spectra of Met80Ala ferricytochrome c as a function of pH (0.1 M sodium phosphate buffer, 25 °C). The dependence of absorbance at 621 nm on pH was fit to a single deprotonation process (Inset).  106  40 45 50 55 60 Temperature (°C)  F i g u r e 3.43 T h e r m a l denaturation o f c y t o c h r o m e c a x i a l l i g a n d variants (0.1 M s o d i u m phosphate buffer, p H 7.0, heating rate o f 50 ° C / h r ) . ( A ) T h e r m a l denaturation curves. ( B ) F i r s t d e r i v a t i v e s o f denaturation curves.  107  0.3  j  I  300  i__  i  i  400  i  i  i  500  600  i  i  700  Wavelength (nm)  Figure 3.44 Spectroelectrochemical titration of Met80Ala/Tyr67Phe cytochrome c (0.5 M sodium phosphate buffer pH 7.0 25 °C). Applied potentials, E (mV vs SHE): (a) +24.00, (b) +59.8, (c) +45.2, (d) +30.1, (e) +15.0, (f) 0.0, (g) -14.9, (h) -30.0, (i) -44.8, (j) -60.2, (k) -200.0. A Nernst plot calculated from the absorbance values at 405 nm is provided in the inset. a p p  108  -0.015 -0.002  0.000  0.002  0.004  0.006  0.008  Time (s)  F i g u r e 3.45 Transient absorption k i n e t i c s ( m o n i t o r e d at 4 1 4 n m ) for the r e c o m b i n a t i o n o f C O w i t h M e t 8 0 A l a c y t o c h r o m e c f o l l o w i n g p h o t o d i s s o c i a t i o n (0.1 M s o d i u m phosphate buffer p H 7.0, 25 ° C ) . T h e s m o o t h line is the fit to a single e x p o n e n t i a l fit. T h e residuals are s h o w n i n the upper panel.  109  3.2.6  Autoxidation The rate constants for autoxidation of the oxygenated derivatives of the Met80Ala,  Met80Ala/Tyr67Phe, and Met80Ala/Phe82Ser variants are 0.02(1), 0.13(1), and 0.45(1) h'  1  respectively (0.1M sodium phosphate buffer, pH 7.0,25 °C). Representative spectra obtained during autoxidation of the Met80Ala variant are given in Figure 3.46. The rate constant for the autoxidation of the Met80Ala variant is similar to that reported by Bren & Gray (1993 a) for horse heart Met80Ala (k  =  m  0.01-0.04  h" ),  but  1  it  is  greater  than  the  rate  constant  reported  for  the  Fus39AsnMet80Ala/Cysl02Seryeastcytochromecvariant(0.003(l)h- )(Bren, 1996). Both double 1  variants studied in the present work exhibit increased autoxidation rates relative to the Met80Ala variant, indicating that both residues Tyr67 and Phe82 are partially responsible for the slower rate observed with the Met80Ala single variant.  3.2.7  Fourier Transform Infrared (FTIR) Spectroscopy To investigate the effects of replacing Met80 and adjacent residues on ligand binding to the  heme iron further, FTIR spectra of the carbonyl derivatives of these variants were examined (Figure 3.47). For the Met80Ala variant, C O stretching frequencies, u , were observed at 1956 cm'  1  c o  (predominant  peak)  and  1969  cm'  1  (shoulder).  The corresponding spectrum for  the  Met80Ala/Tyr67Phe double variant shows a single peak at 1956 cm" with no evidence of the 1  shoulder. The CO derivative of the Met80Ala/Phe82Ser variant also exhibits a single maximum, but u  is shifted to 1960 cm" . 1  r n  110  300  400  500  600  Wavelength (nm)  Figure 3.46 Absorption spectra following the autoxidation of Met80Ala cytochrome c (0.1 M sodium phosphate buffer pH 7.0, 25 °C). The inset shows a plot of absorbance values at 500 and 540 nm against time with the data fit to a single exponential model.  Ill  F i g u r e 3.47 Infrared spectra ( F T I R ) o f ferrous c a r b o n y l d e r i v a t i v e s o f c y t o c h r o m e c a x i a l l i g a n d variants ( 0 . 1 M s o d i u m phosphate buffer, p H 7.0, 25 ° C ) .  112  3.2.8  Kinetics of Axial Ligand Variant Reduction by Fe(EDTA)  2  The kinetics of reduction of the three axial ligand variants by Fe (EDTA) " were studied to 2  provide initial assessment of the effects of these modifications on the electron transfer reactivity of the cytochrome. A representative family of rapid-scan spectra obtained for reduction ofthe Met80Ala variant by Fe(EDTA) " is shown in Figure 3.48. The fit of the absorbance transient at 434.6 nm to a 2  single exponential function is shown in the inset. The observed rate constants, k , obtained in this obs  manner are tabulated in Appendix D. Unlike the Met80Ala variant, the Met80Ala/Tyr67Phe variant exhibits biphasic reduction kinetics as shown by the set of spectra and inset given in Figure 3.49. From these results, it appears that this protein is initially reduced to an Fe(II) intermediate with the spectroscopic properties of a low-spin heme iron. This fast reduction is followed by a slower, second phase in which the reduced low-spin form converts to a reduced high-spin/low-spin form. The initial phase is dependent upon the concentration of the reducing agent and presumably represents the actual reduction of the heme iron. On the other hand, the slower phase is independent of Fe(EDTA) " concentration and exhibits a rate 2  constant of 0.83(10) s". The rate constants observed for the first phase were, therefore, used in 1  subsequent evaluation of electron transfer behavior of this variant. The observed rate constants obtained in this manner are also tabulated in Appendix D. Whereas both the Met80Ala and Met80Ala/Tyr67Phe cytochrome c variants were reduced to completion, the Met80Ala/Phe82Ser protein was only partially reduced under the experimental conditions employed. This observation is a consequence of the low reduction potential of this variant ( E = -109 mV) and the relatively high reduction potential of Fe(EDTA) " under these conditions 2  m  (+95 mV) (Reid, 1984). Consequently, to obtain values for  the data were fit to a pseudo-first  order reversible rate equation (Cummins & Gray, 1977; Reid etal, 1986) as outlined below (Eq. 17,  113  18, and 19):  A=  AA  <s + exp(fc /3-t) obs  |_l + aexp(fc j3-t)  [17]  -1 + A  ob  a =  [18]  K +l ai  [19] cq  where A is the absorbance at time t, A A is the total absorbance change, and A  M  is the final  absorbance. The equilibrium constant for the reaction (K ) is determined from the following eq  expression:  A. - A A  [20]  -A  where A is the initial absorbance, A„ is the final absorbance and A is the final absorbance had the (  f  reaction gone to completion. A was determined by reducing the protein completely with a small f  amount of solid sodium dithionite. The observed rate constants obtained in this manner are tabulated in Appendix D . The dependence of k  on [Fe(EDTA) "] for all three variants is given in Figure 3.50. A l l 2  obs  three plots are linear over the F e ( E D T A ) " concentration range used. The second order rate constants 2  (k ) were determined from the gradient of these plots as defined by the following expression l2  114  [21]  *obs = *i2 [Fe(EDTA) "] 2  The resulting second order rate constants obtained from these analysis are given in Table 3.18. To account for differences in thermodynamic driving forces and electrostatics on the observed rate constants, the electrostatics corrected self-exchange rate constants exhibited by the proteins in these reactions ( £ a  corr  ) were calculated with the relative Marcus formalism as developed by Wherland and  Gray (1976). These values are also given in Table 3.18. The values of £  c o r r n  obtained in this manner  fortheMet80Ala(l. 11 M ' V ) , Met80Ala/Tyr67Phe(343 M ' V ) and Met80Ala/Phe82Ser (0.04 M ' V 1  l  1  ) variants exhibit remarkable range. The corresponding values reported for wild-type yeast  cytochrome c (10.9 M ' V ; Rafferty etal, 1990) and horse heart myoglobin (0.02 M ' V ; Lim, 1990) 1  1  provide useful points of reference for comparison. The activation parameters for these reactions were also determined from the temperature dependence of the second order rate constants with the Eyring equation:  In (Ar /T) = In (£ /h) + (AS*/R) + (AH*/RT) 12  B  [22]  The resulting Eyring plots are given in Figure 3.51, and the corresponding enthalpies and entropies of activation are summarized in Table 3.18. The low-spin to high-spin interconversion process exhibited by the Met80Ala/Tyr67Phe variant was also dependent on temperature, and the Eyring plot (Fig 3.51) and activation parameters for this process (Table 3.18) are included in this analysis.  115  Table 3.18 : Kinetic and thermodynamic parameters for the reduction of the axial variants Met80Ala, Met80Ala/Tyr67Phe, and Met80Ala/Phe82Ser by Fe(EDTA) ". 2  Protein  k (MV) n  E (mV)  k (M's )  AH* (kcal mol )  AS* (e.u.)  AG* (kcal mol )  3.5(2)  -24.7(8)  -  9.7(4)  -19.5(8)  15(1)  7.5(3)  -18.7(8)  13(1)  12.2(5)  -10.3(6)  15(1)  9.2(5)  -27.3(9)  17(2)  12(l)  -13(5)  -  m  con  u  1  wild-type cytochrome  7.2 x 10  290(2)  l.lxlO  Met80Ala  26(1)  -45(2)  1.1  11(2)  3.4xl0  -  -  4  1  1  1  a  Met80Ala/ Tyr67Phe  reduction  1.4(1) xlO  L.S. H.S.  3  Met80Ala/ Phe82Ser  1.4(2)  109(5)  4.3xl0"  horse heart myoglobin  22.5(5)  61(1)  2 x 10-  b  a  b  c  2  p H 6 . 0 ; Rafferty(1992). Lim(1990). Cassatefa/. (1975).  116  2  2  c  c  Figure 3.48 Absorption spectra monitoring reduction of Met80Ala cytochrome c by Fe (EDTA) "(u = 0.5 M sodium phosphate buffer, pH 7.0, 25 °C). The spectra shown were recorded over the initial 30 s of the reaction. Inset shows the change in absorbance monitored at 434.6 nm. The smooth line represents the non-linear least squares fit to the data. 2  117  400  450  500  550  600  Wavelength (nm) F i g u r e 3.49 A b s o r p t i o n spectra m o n i t o r i n g the r e d u c t i o n o f M e t 8 0 A l a / T y r 6 7 P h e c y t o c h r o m e c b y F e ( E D T A ) " ( u = 0.5 M s o d i u m phosphate buffer p H 7.0, 25 ° C ) . ( A ) T h e spectra s h o w the i n i t i a l r e d u c t i o n and w e r e r e c o r d e d o v e r the first 500 ms o f the reaction. ( B ) T h e spectra s h o w the l o w - s p i n to h i g h - s p i n c o n v e r t i o n and w e r e r e c o r d e d o v e r the r e a c t i o n p e r i o d o f 0.5 to 5 s. ( C ) S i n g u l a r v a l u e d e c o m p o s i t i o n analysis results o f the reaction. T h e c a l c u l a t e d spectra are s h o w n for (I), o x i d i z e d p r o t e i n ; (II) reduced p r o t e i n l o w - s p i n intermediate; ( H I ) r e d u c e d p r o t e i n h i g h - s p i n final species. Inset i n panel A s h o w s the change i n absorbance m o n i t o r e d at 548 n m . T h e s m o o t h l i n e represents a b i - p h a s i c n o n - l i n e a r least squares fit to the data. 2  118  0.5 0.40.3 0.20.1 0 25 20 15 10 5 0 0.025 0.020 0.015 0.010 0.005 -  oL  [Fe(EDTA) ] (mM) F i g u r e 3.50 D e p e n d e n c e o f the o b s e r v e d rate constants for r e d u c t i o n o f f e r r i c y t o c h r o m e c a x i a l l i g a n d variants o n F e ( E D T A ) " concentration ( u = 0.5 M s o d i u m phosphate buffer p H 7.0, 2 5 ° C ) : ( A ) , M e t 8 0 A l a ; ( B ) , M e t 8 0 A l a / T y r 6 7 P h e ; ( C ) , M e t 8 0 A l a / P h e 8 2 S e r . 2  119  Figure 3.51 Eyring plots for the Fe(EDT A) ' reduction of ferricytochrome c axial ligand variants (u = 0.5 M sodium phosphate buffer pH 7.0, 25 °C). (•), Met80Ala; (•), Met80Ala/Tyr67Phe reduction; (o), Met80Ala/Tyr67Phe low-spin to high-spin conversion (•), Met80Ala/Phe82Ser. 2  120  4. DISCUSSION  4.1  Overview The work reported in this dissertation addresses two basic issues concerning the factors that  dictate the electron transfer reactivity o f cytochrome c. The work with flavin-modified cytochromes considers the effect o f electron donor structure on the kinetics o f intramolecular electron transfer. In previous studies o f electron transfer proteins into which additional oxidation-reduction centers have been introduced, the new reactive centers have invariably been coordination complexes. Sites o f this type are usually highly charged in both oxidation states. The use o f flavins as protein modifying reagents in the current work is a significant departure from these other studies. A s such, the synthetic flavocytochromes flavocytochromes  can be regarded  in a simple sense as models for naturally-occurring  that are generally less amenable to detailed studies o f the type undertaken here  owing to their greater structural and functional complexity and, in many cases, owing to limited information concerning their structures. The studies o f cytochrome variants in which the Met80 axial ligand has been replaced with an alanyl residue extend previous studies o f the M e t 8 0 A l a variant to consider the effects o f removing this critical residue on the electron transfer properties o f the cytochrome. In addition, new insight is provided concerning the effects o f the Met80Ala substitution on ligand binding properties o f the protein through characterization o f variants in which additional active site residues believed to be important in controlling the thermodynamics o f ligand binding to the M e t 8 0 A l a variant have been replaced.  121  4.2  Cysteine Variants and Flavin Modification  4.2.1  Protein Characterization Spectroscopic and electrochemical characterization of the cytochrome c variants and the  corresponding modified proteins was essential to interpret the kinetic data. The fact that no appreciable change is observed in either the electronic or CD spectra of the four cysteine variants relative to the corresponding spectra of the wild type cytochrome is indicative that there is little structural change to both the heme environments or the secondary structure of the variants. This observation is further supported by the molecular modeling results which indicate only small localized structural perturbations around the individual mutation sites, as shown in Figure 4.52. The validity of these energy-minimized structures is supported by comparing the calculated structure for Leu85Cys cytochrome c with the crystal structure of the same variant that was elucidated by Lo (1995). This comparison around the mutation site, as shown in Figure 4.52, clearly exhibits a good correlation between the two structures. Modification of the variants with the flavin moiety to the exposed surface cysteinyl residues was shown to be successful by electronic absorption spectroscopy. Results from the peptide mapping analysis confirmed this site of attachment, although the hydrolysis procedure appeared to destroy the majority of the linkage between the flavin and the cysteine residue. The fluorescence data also indicated the attachment of the flavin to a cysteine residue. Flavin fluorescence has been shown to be significantly quenched by coupling to sulfur containing amino acids (Penzer & Radda, 1967) as shown by all the modified proteins. The A  e n m m a x  bathochromic shift is also consistent with substituted flavins  (Falk & McCormick, 1976) and supports the hypothesis that the attached flavin molecule is still within aqueous surroundings and not partially buried within the protein structure. This conclusion further supports the energy-minimized structures of the modified proteins. Further evidence that the  122  Thr8Cys cytochrome c  His39Cys cytochrome c  Asn62Cys cytochrome c  Leu85Cys cytochrome c  F i g u r e 4.52 Structural diagrams of the region about the cysteine mutation site in the Thr8Cys, His39Cys, Asn62Cys & Leu85Cys cytochrome c variants. (A) The structure of the wild-type protein (thin lines) is superimposed on the energy minimized-structure of the of the variants (thick lines). ( B ) The crystal structure of the L85C variant (thin lines) is superimposed on the energy minimized-structure of the Leu85Cys variant (thick lines) (Crystal structure of Leu85Cys cytochrome c taken from Lo et al, 1995). 123  modification process does not cause major alterations to the environments of the flavin or heme is provided by both the electronic and CD spectra of the modified proteins. The C D spectra for the unmodified and flavin modified proteins are superimposed in both the visible and far U V regions, indicating that neither the protein secondary structures nor the heme environments have been altered. Electrochemical analysis of the separate protein and flavin components, and the modified proteins, was carried out for two reasons. First, electrochemical analysis was performed to investigate any alterations to the reduction potentials of the variants and the flavin. Such a change would be indicative of a variation in the surrounding environment of the heme or the flavin centers. Second, electrochemical analysis was performed to calculate the individual driving forces associated with each electron transfer reaction studied. The fact that no appreciable change in the reduction potentials of the variants Thr8Cys and Asn62Cys was observed relative to wild type indicates that the heme environments of these proteins was unperturbed, which is expected since these variants possess surface residue substitutions that are somewhat removed from the heme center. The decrease of 6(2) mV in the reduction potential of the Leu85Cys variant is marginally greater than the change in value reported by Lo (1995) which showed a decrease of 2(3) mV. The crystal structure for this variant indicates that the percentage of heme surface area exposed to solvent (9.1 %) is similar to that in wild-type cytochrome c (9.0 %) and the sulfur atom (7.1 A) and a new water molecule (9.1 A) are distant from the heme. Therefore, it is unlikely that this decrease in reduction potential is caused by a change in the polarity of the heme environment. To investigate this issue further, it is necessary to analyze the thermodynamic parameters associated with the dependence of the reduction potential on temperature, as discussed below. Similarly, to address the factors which produce the large (25 mV) decrease in potential observed for the His39Cys variant, the enthalpic and entropic parameters must be studied (Table 3.6).  124  Consideration of these values for the Leu85Cys variant reveals that the enthalpy of reduction of this variant is the same as that for wild-type cytochrome c ( A H  0  = -14.4(6) kcal/mol). As the  enthalpy for this equilibrium has been associated with the polarity of the heme environment (Kassner, 1973) it may be argued that the Leu85Cys mutation does not perturb the heme environment and that the decrease in reduction potential must result from other factors. These factors include the alteration of side chain packing within the hydrophobic core and changes in the solvent reordering around the polypeptide chain, both of which are associated with the entropy of reduction (Taniguchi et al., 1980; Murphy, 1993). The small negative change in this entropic value for the Leu85Cys variant (AS = 0  11.7(2) eu)  relative to that for wild-type cytochrome (AS = -11.0(2) eu) indicates that these 0  conformational and solvation differences between the two oxidation states of the protein have been increased to favor the oxidized state and lower the reduction potential. Indeed, changes as small as 2 to 3 eu have been shown to lower the reduction potentials of cytochrome variants by as much as 40 mV (Rafferty, 1992), so it is reasonable to assume that a 0.7 eu decrease in the standard entropy is sufficient to produce a decrease of 6 mV in potential. The 25 mV decrease in reduction potential for the His39Cys variant can also be attributed to an entropic origin (AS° = -16.3(3) eu). For such a large decrease in entropy, relative to that for the wild-type cytochrome, a greater change than the observed 25 mV is anticipated, but this entropic change is partially compensated by a decrease in the standard enthalpy ( A H = -15.4(9) kcal/mol for the His39Cys variant; A H = -14.4(7) kcal/mol for 0  0  wild-type cytochrome). As noted earlier, His39 has been previously identified as the single titratable group with an oxidation-state linked pK (Robinson et al., 1983). This identification is consistent with the reduction 3  potential pH dependence of cytochromes c isolated from Rhodapseudomonas viridis and Candida krusei, both of which have a histidine residue at position 39 (Moore et al, 1984). Conversely, horse  125  heart cytochrome c has a lysine residue at position 39 and the potential of this protein is independent of pH between pH 4 and 9. The pK values for the Thr8Cys, Asn62Cys, and Leu85Cys variants a  (Table 3.7) are all similar to that of wild-type cytochrome c, within experimental error, and all show a difference between oxidation state pK s of 0.3-0.4. These results indicate that the mutations do not 3  perturb the His39 environment, and thus the weak interactions between the heme and the histidine residue which are responsible for this oxidation state linked change in the pK (Robinson et al., 1983) 3  are unaffected. This result is expected because these three mutations are all situated at positions distant from the His3 9 region. The pK values associated with the His3 9Cys variant are approximately 3  1 p^ unit higher than those for the wild-type protein, with pK°  x  a  = 7.5(2) and pKp = 7.9(2). This A  finding is consistent with the hypothesis that a Cys residue at position 39 titrates with an oxidationstate linked pK . The fact that the difference between these two pK values remains 0.4 is indicative 3  a  that the weak interactions which exist between the heme and His39 are still present in the cysteine variant. The electrochemical properties of the free 7-acetyl-10-methylisoalloxazine are consistent with a flavin in which the oxidized and reduced forms each exhibit a single pK . The observed 3  reduction potential of -113(2) mV is approximately 90 mV higher than the corresponding values of riboflavin and F M N (Draper & Ingraham, 1968). This increase in reduction potential is indicative of the electron withdrawing nature of the substituted acetyl group at position C-7, which is expected to stabilize the reduced flavin species. The values of the semiquinone formation constants for this flavin are similar to those exhibited by other flavins which have been analyzed in this manner and indicate that the acetyl group at position 7 does not perturb the semiquinone formation in any way. The reduction potential, at pH 7.0, for the heme component of each variant is essentially identical to that of the unmodified variant, indicating that the modification does not perturb the heme  126  environment. Similarly, the thermodynamic parameters ofthe oxidation-reduction equilibrium of each variant are unaffected, providing additional evidence that the flavin attachment does not alter the electrostatic interactions or internal packing properties of the heme environment. On the other hand, the electrochemical behavior of the flavin changes moderately upon modification. The reduction potentials exhibit small decreases upon attachment of the flavin, with the flavin center of modified Thr8Cys cytochrome c having a value of-123(2) mV, 10 mV lower than the value for the free flavin. This result indicates that the oxidized state of the flavin is stabilized, possibly by slight alterations in the electron withdrawing capacity of the position C-7 attachment site. In addition, the thermodynamic parameters for this equilibrium are significantly perturbed upon modification. Both the standard entropy and enthalpy for the reaction decrease relative to those of the free flavin. This finding is probably a consequence of the close proximity of the attached protein. Although it appears that the flavin remains exposed to solvent on the surface of the protein, the oxidation-state linked solvent reorganization around the flavin is undoubtedly affected by attachment to the protein. Another interesting property of the flavin modified variants is the electrochemical behavior of the His39Cys variant. The pH dependence of the reduction potential of this flavin modified protein is abolished over the pH range of 5.5 to 8.0. This behavior is consistent with the fact that the titratable cysteine proton has been removed by the formation of the thioether bond. Similar observations have been reported for the Rhodopseudomonas viridis cytochrome c , in which 2  modification of His39 with diethylpyrocarbonate eliminates the pH-linked titratable group (Moore et al, 1984). These electrochemical results indicate that the donor and acceptor components of flavinmodified cytochromes c are generally quite similar to those of cytochrome c and the unreacted flavin.  127  4.2.2  Electron Transfer Kinetics  4.2.2.1 Intermolecular Electron Transfer Reactions The bimolecular electron transfer kinetics were studied primarily as a control for the analysis of the unimolecular kinetics, namely to investigate whether these intermolecular reactions could interfere with the intramolecular results. Nevertheless, the results of these studies are of interest in their own right in view ofthe use of such information by Tollin, Cuzanovich and their coworkers over the past several years. It has been previously established that the site of electron transfer in bimolecular reactions involving cytochromes c and flavin semiquinones is near the exposed heme edge region of the protein (Miller & Cuzanovich, 1974; Smith et al,  1980). ESR experiments have been interpreted as  indicating that the reactive region of the flavin semiquinone species is between the N-5 and C-8 atoms of the central pyrazine ring and adjacent aromatic ring (See Figure 4.53) (Guzzo & Tollin, 1964). The rate constants for such reactions are controlled not only by the steric and electrostatic factors affecting the rate of diffusion but also by the thermodynamic driving force for the reaction, which is defined by the difference in reduction potentials of the protein and the flavin. Although the reduction potentials of 7-acetyl-10-methylisoalloxazine and 7cc-bromoacetyl10-methylisoalloxazine are -100 mV higher than riboflavin, these flavins reduce horse heart cytochrome c much more rapidly than does riboflavin. This observation reflects the steric effect of the ribose moiety (-[CH (CHOH) CH OH]) of riboflavin which is found at position N-10 (Figure 2  3  2  4.53). The rate constants for the reaction of the two synthetic flavins with ferricytochrome c are comparable to that of lumiflavin (Ahmad et al, 1981) (k = 0.62x10 s"). All three of these flavins 8  1  2  possess a methyl group substituted at position N-10. A second factor which may contribute to the more facile reduction of cytochrome c by the synthetic flavins is the addition of the acetyl group at  128  7-acetyl-10-methylisoalloxazine  7a-bromoacetyl-l O-methylisoalloxazine  F i g u r e 4.53 Structures o f f l a v i n s i n v o l v e d i n i n t e r - m o l e c u l a r electron transfer reactions w i t h c y t o c h r o m e s c.  129  position C-7. Although the size of the acetyl group is greater than that of a methyl group, thus increasing steric restraints, the acetyl group may allow for increased derealization of the electron density from the isoalloxazine ring, thereby increasing the reactive surface of the flavin which is able to interact with the protein. The effect of the change in the pK values for the semiquinones must also be considered. The pK for riboflavin is 8.3 (Draper & Ingraham, 1985) while for 7-acetyl-10a  methylisoalloxazine and 7a-bromoacetyl-lO-methylisoalloxazine the pK values are both 8.2. Thus s  a higher concentration of the more reactive anionic semiquinone form, albeit small, will be present with the synthetic flavins at pH 7.0. The difference in rate constants between 7-acetyl-10methylisoalloxazine and 7a-bromoacetyl-lO-methylisoalloxazine is most likely due to the increased steric hindrance caused by the larger bromine atom. The electronegative properties of the bromine will also alter the charge distribution in the flavin, by increasing electron density within the benzene ring and thus causing a less favorable interaction with the non-polar protein heme region, as has been observed with chlorinatedflavins(Ahmad et al, 1981). From this discussion it is apparent that the factors that contribute to diffusion have a greater influence on the reaction of the flavin and the cytochrome than does the driving force of the reaction. The results of this bimolecular kinetic analysis also show that the rate constant for 7-acetyl1 O-methylisoalloxazine reduction of horse heart cytochrome c is nearly half that of the reaction of the same flavin with yeast iso-l- cytochrome expressed in yeast or E. coli. This result can be correlated with the proportion of the heme group that is exposed to solvent and thus available for direct interaction with the flavin. For horse heart cytochrome c the surface of the heme exposure to solvent is 34.7 A , which constitutes 0.7% of the protein surface, while for yeast /'so-1-cytochrome 2  c these values are 44.4 A and 0.9% respectively (Brayer & Murphy, 1996). To date no crystal 2  structure of the yeast cytochrome expressed in E. coli has been obtained, but the present kinetic  130  results suggest that his feature of the yeast protein structure will be the same regardless of the organism in which it is expressed. Also, as noted by Meyer etal. (1984) the side chains of residues 16, 28, and 81 project into solution from the region around the heme crevice. For horse heart cytochrome, these residues are Gin 16, Thr28 and Ile81 whereas for yeast iso-l-cytochrome c, these residues are Gin 16, Val28 and Ala81. These same residues are found in the yeast Candida krusia cytochrome c, which has been shown previously to react with F M N approximately 1.25 times faster than does horse heart cytochrome c, owing to decreased steric hindrance resulting from substitution of Ile81 with Ala. Therefore, the expected rate constants for yeast wo-1-cytochrome c should be in the region of (0.63 x 10 ) x 1.25 x (0.9/0.7) or 1.01 x 10 M " V . This value is in excellent agreement 8  8  with the experimental data results (iso-l -cytochrome c expressed in yeast, k = 1.03(7) x 10 M ' V ; 8  1  n  /so-1-cytochrome c expressed inE. coli, k = 1.05(8) x 10  8  12  M'V ). 1  Finally, the rate constants for  flavin reduction of the Cys-containing variant are within experimental error of those for the wild type cytochrome. This result is not surprising because the cysteine residues are not near the heme crevice and should not alter the steric characteristics for reaction of the flavin with the active site heme. The activation parameters for the protein reduction by various flavins are consistent with previous reports for the reaction of cytochromes c with small electron transfer reagents (Rafferty et al,  1996) (/so-1-cytochrome c with Fe(EDTA) ' AH* =3.5 kcal mol' , AS* = -24.7 e.u. & iso-l2  1  cytochrome c with Co(phen) AH*= 11.4 kcal mol" , AS* = -5.5 e.u.). The low activation enthalpies 3+  1  3  are indicative of the large driving force for the reaction and the low electrostatic repulsion between reactants that result from the neutrality of the flavin semiquinone. The importance of the flavin orientation for efficient electron transfer givesriseto the low activation entropies because the number of degrees of freedom for the collisional complex formation has been reduced. The activation parameters for the three bimolecular reactions involving the flavins are similar. This similarity  131  indicates that the mechanism for the precursor complex formation involved in these reactions is, as expected, essentially the same.  4.2.2.2 Intramolecular Electron Transfer Reactions The unimolecular electron transfer kinetic studies exhibit a temperature dependence that is consistent with the results observed for ruthenium modified cytochromes. The reorganization energies (A) derived from the temperature dependence  of these reactions are in the range of  RuA L /cytochrome c systems studied previously (0.8-1.3 eV) (Isied et al., 1984; Nocera et al., 4  2  1984). The overall reorganization energy for the flavoproteins (1.2(2) eV) leads to a flavin donor center reorganization energy of 0.7(2) eV when the value of 0.5 eV is used for the reorganization energy of the cytochrome c (Marcus & Sutin, 1985). This seemingly high value for X for the flavin is a combination of both the X and A , for theflavinand the surrounding solvent. The magnitude of m  ou  X for the flavin can be justified by considering the large energetic barrier for distortion of the equilibrium nuclear geometries of organic molecules in aqueous media (Dutton & Moser, 1994). In addition a recent study by Millet and co-workers has estimated the reorganization energy of cytochrome c to be 1.5 eV, thus giving the protein component a value of 0.75 eV (Fairris et al, 1996), which leads to a lower X value of 0.45(20) eV for the flavin component. To investigate the correlation between the intramolecular electron transfer rate constants and the electronic coupling of the donor and acceptor centers the k^ and experimental  values for  each variant were calculated. The energy minimized molecular models for the modified proteins were also utilized to search for possible relationships between coupling factors and electron transfer rates. Numerous theories have been proposed to describe electronic coupling within protein structures. The simplest of these models assumes a homogeneous medium between the donor and acceptor and leads  132  to an exponential decrease in the rate of electron transfer with increasing donor-acceptor separation. As outlined in the introduction, studies have shown that although this hypothesis works well for most systems, it does not account adequately for electron transfer pathways involving non-covalent components. Indeed if the k  max  values for the flavin modified cytochromes c are plotted against the  simple donor-acceptor separation distance (d-3) the experimental data fall below a reference line that is based on the assumption that P is 1.4 A (Figure 4.54). This result, therefore, suggests that any model used to represent the results of this work should account for the heterogeneic nature of the protein medium located between the flavin and the heme centers. If the model of Beratan and Onuchic is used, a better correlation between the calculated atunneling lengths and k  mix  is observed although the flavin-modified His39Cys variant deviates from  this relationship. It is of interest to note that the k^ values for the flavin modified cytochromes studied in this work, with the exception of that for the modified F£is39Cys variant, lie above the line calculated for ruthenium modified cytochromes. This line is calculated using a value of P' = 0.73 A" , 1  and the one bond limit electron transfer rate, the rate when the donor and acceptor orbitals can overlap directly, is 1.7 x 10  12  s" (Figure 4.54). This observation is indicative that the electronic 1  coupling between the flavin donor and the protein heme acceptor is greater than that observed for the ruthenium modified cytochromes. Preliminary comparisons between the flavin- and rutheniummodified proteins, in which the donor is attached to residue 39, suggest that the electronic coupling was actually weaker for the flavocytochrome, even after the consideration of the two additional covalent bonds involved in the flavoprotein pathway resulting from differing modes of attachment (Twitchett et al, 1997). However, analysis of the three other synthetic flavoproteins sheds doubt upon this initial conclusion. Indeed, k  max  for electron transfer from aflavinattached to position 62 is  slightly greater than k^ for the corresponding ruthenium-cytochrome despite the presence of an  133  0  0  5  10  15  10  20  (d- 3) / A  30  40  ol/A  F i g u r e 4.54 C o r r e l a t i o n s o f m a x i m u m E T rates i n f l a v i n ( C y s X ) m o d i f i e d c y t o c h r o m e s c ( o ) & R u ( H i s X ) m o d i f i e d c y t o c h r o m e s c ( • ) w i t h (d-3) (a) and o l (b) ( R u ( H i s X ) m o d i f i e d c y t o c h r o m e s c data t a k e n f r o m W u t t k e et al, 1992 and C a s i m i r o et al, 1993). (a) S o l i d reference l i n e has a slope o f 1.4 A" and intercept o f 1 x 1 0 ( b ) S o l i d reference l i n e (best fit t o R u data) has a slope o f 0.73 A" and intercept o f 3 x 1 0 ; D o t t e d reference l i n e (best fit to f l a v i n data) has a slope o f 0.73 A and intercept o f 1 x 1 0 . 1  13  1  12  -1  13  134  additional covalent bond in the pathway selected for the flavocytochrome. One possible explanation for this result is the likely motion ofthe flavin donor about its attachment site. The energy-minimized structures of the flavoproteins must be considered to be static and as such cannot take into consideration the fact that the flavin donor and the modified protein could conceivably attain a conformation in which electron transfer would be enhanced or retarded. A similar hypothesis was given as a possible explanation for the poor correlation observed between k and donor-acceptor et  distance in cytochromes c containing covalently attached cobalt cage complexes. For these cytochrome derivatives the rate constants varied over the narrow range of 1.0 to 3.2 s' despite 1  distance dependence models that predicted a 200 - 2000 fold variation in k (Conrad et al, 1992). et  In the present case interpretation of the kinetics would be facilitated by availability of information concerning electron transfer kinetics of cytochrome c with ruthenium attached to residues 8 and 85. If the rate constants for the flavocytochrome kinetics are fit to a line calculated with the assumption that P'= 0.73 A" as for ruthenated cytochromes, then the one bond limit electron transfer 1  rate is ~1 x 10 s" (Figure 4.54). This value closely approximates the rate constant assumed for an 13  1  adiabatic electron transfer process and demonstrates a reasonable correlation between donor-acceptor distance and the rate of electron transfer. Furthermore, these rate constants demonstrate that for long distance electron transfer reactions within proteins the electronic coupling factor is dependent on the nature of the donor or acceptor. Nevertheless, discrepancies arise using this pathway model to describe the flavocytochrome c as illustrated by the difficulty of this approach with the behavior of the His39Cys variant. This discrepancy could be a consequence of the fact that although the version of the Beratan-Onuchic model used utilizes multiple pathways it does not consider interferences between these pathways. It should be noted that recent advances concerning the Beratan-Onuchic model have considered the nature of these coupling pathway interferences (Regan et al, 1993).  135  This pathway interference problem is addressed by the method of Siddarth and Marcus as the  values calculated with this model exhibit an excellent correlation between the theoretically  and experimentally derived electronic coupling values. This agreement suggests that the SiddarthMarcus model resolves the discrepancies found in the distance dependence of the rates, thereby suggesting that interactions between pathways need to be considered in calculating electronic couplings as mentioned above. The  values calculated by this method for the flavin modified  cytochromes are greater than those calculated for the corresponding ruthenium-modified cytochromes as least for modifications at positions 39 and 62 (flavocytochrome c Cys39 cytochrome c His39 His62  = 0.01 cm" ; flavocytochrome c Cys62 1  = 0.03 cm' ; Ru 1  = 0.02 cm" ; Ru cytochrome c 1  = 0.002 cm' ) (Siddarth & Marcus, 1993a). This difference is undoubtedly a consequence 1  of the difference in residues through which theflavin(Cys) and ruthenium (His) groups are attached to the cytochrome. If correct this difference in H ^ values betweenflavocytochromesand ruthenium modified cytochromes means that the electronic coupling between the flavin and heme centers is greater than between the ruthenium and heme centers. It must be emphasized, however, that the values obtained by this method are based on extended-Huckel theory and as such the absolute values are not as reliable as the relative values within a particular system. The electron transfer pathways identified for each flavoprotein by the Siddarth-Marcus and Beratan-Onuchic models merit consideration in an effort to understand why the results of the two analyses differ. For the modified Thr8Cys variant, which exhibits the largest k of the four derivatives et  examined, Leu9, PhelO, and Cys 14 are implicated in coupling the flavin and heme centers by both models. The Siddarth-Marcus AI search, however, also indicates a role for Ala7, Lysl 1 and Argl3 in this process. As residues 7, 11, and 13 reside in an alpha helix, it is possible that this secondary structural element may enhance electronic coupling. The ordered structure of a helix combined with  136  the number of strong hydrogen bonds present in such structures may provide the basis for this property of an alpha helix. Similar observations have been made regarding a p-strand secondary structure element (Langen et al, 1995). These studies demonstrated that the ordered structure of Pstrands led to enhanced electronic coupling between the donor-acceptor sites, more so than a-helical segments. Nevertheless, it is reasonable to assume that an alpha helix will provide enhanced coupling relative to a more unstructured portion of the protein structure (Winkler & Gray, 1997). The residues selected for the modified Leu85Cys variant by the AI search procedure do not correspond to those selected by the Beratan-Onuchic model. The residues identified by the AI procedure is a shorter, more direct path ( H ^ = 0.04 cm' ) and results in an electronic coupling similar 1  to that of the modified His39Cys variant ( H ^ = 0.03 cm' ). The Beratan-Onuchic model fails to find 1  a suitable H-bond or through-space interaction between the donor and acceptor sites in this case. Finally, the energy minimized structure oftheflavin-modifiedAsn62Cys variant indicates that the flavin group is adjacent to residues Glu-4 and Glu66. This fact is considered by the AI search, which identifies residue Glu66 as a participant in donor-acceptor coupling. The only other discrepancy between the results of the Siddarth-Marcus and the Beratan-Onuchic analysis is that the Siddarth-Marcus analysis indicates a role for Met64 that is not identified by the Beratan-Onuchic model. Otherwise, both models agree that Asn63, Tyr76, and Met80 are involved in donor-acceptor coupling in thisflavin-modifiedcytochrome derivative. For theflavin-modifiedcytochromes studied here, it is interesting to note that the SiddarthMarcus analyses all identify structural elements as involved in donor-acceptor site coupling that enhances the efficiency of electron transfer relative to the pathways identified by the Beratan-Onuchic model. This observation is presumably the basis for the consistent difference between rate constants observed in the intramolecular electron transfer reactions studied here and those predicted by the  137  Beratan-Onuchic model (Figure 4.54).  4.3  Axial Ligand Variants  4.3.1  Protein Characterization The  spectroscopic  characterization  of  the  Met80Ala, Met80Ala/Tyr67Phe and  Met80Ala/Phe82Ser cytochrome c variants presented in this work expands on the characterization previously reported by the group of H. B. Gray on the Met80Ala and Met80Ala/Tyr67Phe variants. In addition to the elucidation of a number of completely new functional properties for the variants, several experiments were repeated to determine whether the cytochromes c isolated from E. coli exhibited characteristics different from that of the corresponding proteins isolated from yeast. The resulting characterization of these variants was a prerequisite for investigation of the electron transfer reactivity of these proteins that is discussed in the next section (4.3.2). All three axial ligand ferricytochrome variants display electronic absorption spectra that are indicative of a six-coordinate heme iron center in which a water molecule is axially coordinated at an exchangeable ligand binding site that is produced by the replacement of Met80 with an alanyl residue. This coordinated water molecule titrates with a pK of 6.2 as observed by Band etal. (1995a) for the a  Met80Ala variant of horse heart cytochrome c produced by semisynthetic methods. This pK is a  significantly lower in value than the corresponding pK for wild-type horse heart myoglobin (pK a  a  8.93, Antonini & Brunori, 1971) and is lower than the pK of 7.6 reported for free heme (Shack & a  Clark, 1947). Bren and colleagues (1995) speculated that the low pK of the Met80Ala variant may a  result from stabilization of a coordinated hydroxyl group by proximity of the phenolic side chain of Tyr67 through hydrogen bond formation. The pK values observed here for the Met80Ala/Tyr67Phe a  and Met80Ala/Phe82Ser double variants indicate that this hypothesis is incorrect. If the hydroxyl  138  group of Tyr67 stabilizes a coordinated hydroxyl ligand, then removal of this hydroxyl group should increase the pK of the coordinated water molecule. However, the pK of 5.8 exhibited by the a  a  Met80Ala/Tyr67Phe variant is even lower than that of the single variant. This decrease in pK  a  suggests that any interaction between Tyr67 and the bound hydroxide actually has a destabilizing effect, possibly due to steric and/or electrostatic interactions. Thus it is more likely that the decreased pK exhibited by the Met80Ala variant relative to wild type myoglobin results from more general a  differences between the distal heme pockets of the two proteins. On the other hand, the pK of the coordinated water molecule in the Met80Ala/Phe82Ser a  double variant is more than one pK unit greater than that of the Met80Ala variant. The Phe82Ser a  substitution is expected to increase the polarity of the heme binding site by placing a more electronegative residue at position 82 and by introducing a solvent channel that increases the exposure of the heme prosthetic group to solvent (Louie et al, 1988). Indeed, use of the program SURFCV (Sridharan et al, 1995) to estimate the solvent accessibility of the heme prosthetic group in the three variants with the Met80Ala substitution considered in this work leads to the expectation that the heme group in the Met80Ala/Phe82Ser double variant is 35% more exposed to solvent than the heme groups of the Met80Ala or Met80Ala/Tyr67Phe variants. Nevertheless, the heme groups of these latter two proteins are about 50% more exposed to solvent than is the case for the wild-type protein (Figure 4.55). Interestingly, the degree of heme exposure to solvent correlates with the thermal stabilities of these proteins as represented by the melting temperature, T . This correlation m  probably results from the combined destabilizing effects of elimination of the Met80 axial ligand and the decreased hydrophobic character of the heme binding site through increased solvent accessibility and introduction of relatively hydrophilic residues. Further information concerning the effects of these substitutions on the environment of the  139  D  F i g u r e 4.55 S p a c e f i l l i n g representations o f c y t o c h r o m e s c s h o w i n g h e m e solvent a c c e s s i b i l i t y . A ) W i l d - t y p e B ) M e t 8 0 A l a C ) M e t 8 0 A l a / T y r 6 7 P h e D ) M e t 8 0 A l a / P h e 8 2 S e r (Left structures show side-on v i e w ; R i g h t structures show top-side v i e w ) . C o l o r legend: R e d , h e m e ; Y e l l o w , a x i a l residues 18 & 80; O r a n g e , residue 6 7 ; G r e e n , residue 82.  140  heme was sought from considering the stability of the oxygenated derivatives to autoxidation and the kinetics of CO recombination. Bren and Gray (1993 a) have previously reported that the Met80Ala variant of horse heart cytochrome c prepared by semi-synthesis is relatively stable to autoxidation. These authors attributed the stability of the oxygenated form of the variant to stabilizing interactions of the coordinated dioxygen with Tyr67 and Phe82 and to the protection of the ligand binding site by the overall protein fold. The 20-fold increase in the rate constant for autoxidation of the Met80Ala/Phe82Ser variant relative to that for the Met80Ala variant is consistent with this argument in that replacing Phe82 with a seryl residue significantly increases the hydrophilic character of the heme binding site (Louie et al. ,1988). Autoxidation of oxymyoglobin and oxyhemoglobin is generally regarded to occur through formation of the corresponding deoxygenated intermediate prior to oxidation of the heme iron. If this same mechanism operates for cytochrome variants with the Met80Ala substitution, then the solvent channel introduced by replacing Phe82 with Ser may promote autoxidation by providing a facile route for ligand dissociation that reduces the barrier to dissociation of coordinated dioxygen and promotes formation of the deoxygenated intermediate. The Met80Ala/Tyr67Phe double variant exhibits a smaller, six-fold increase in the rate constant for autoxidation relative to that of the Met80Ala variant. The simplest explanation for this observation is destabilization of the oxygenated derivative by the loss of a hydrogen-bond involving Tyr67 and the coordinated dioxygen. The results obtained in the present work concerning the rebinding of CO following flash photolysis are consistent with these conclusions. Most notably, the Met80Ala/Phe82Ser double variant exhibits the fastest rate of CO association of all three variants possessing the Met80Ala substitution as expected if the solvent channel created by the Phe82Ser substitution facilitates ligand diffusion into the ligand binding site of this variant. On the other hand, the current results are  141  distinctly different from those reported by Bren and Gray (1993a). These authors observed a rate constant for C O recombination with the Met80Ala variant that was two orders of magnitude lower than that observed in the present study. In addition, Bren (1996) failed to detect CO recombination with the His39Asn/Met80Ala double variant of yeast cytochrome c, a result for which no explanation is apparent. Although it is clear that much remains to be learned from pursuing thermodynamic studies of ligand binding to variants of this type, the results of the present studies, at least, are internally consistent, albeit of limited scope. FTIR analysis of the carbonyl derivatives of these variants provides another source of information concerning the active sites of these variants. Carbonyl derivatives of heme proteins frequently exhibit complex infrared spectra because the coordinated CO can often assume more than one orientation. As a result, multiple vibrational conformers can arise from a variety of steric and electrostatic interactions between the CO and residues in the distal heme pocket (Ray etal, 1994). In the case of the carbonyl derivative of the Met80Ala variant a major CO stretching band is observed at 1956 cm" . A similar stretching frequency has been observed for carbonyl myoglobin arid 1  interpreted to be characteristic of a CO ligand that is parallel to or slightly tilted from the normal to the heme plane (Ormos et al, 1988; Ray et al, 1994). This binding orientation is consistent with the three-dimensional solution structure of the cyanide derivative of the Met80Ala variant determined by ^ - N M R spectroscopy (Banci et al,  1995a). In this structure, the cyanide ligand is oriented  perpendicular to the heme; the relatively large cavity in the distal heme pocket resulted in significantly reduced steric restraint. A shoulder at 1969 cm' is also observed in the spectrum of the carbonyl 1  derivative of the Met80Ala variant. This conformer may result from a C O conformer in which interaction of the bound CO with the relatively electronegative Tyr67 hydroxyl group increases the C — O bond order. This interpretation is consistent with the absence of this shoulder in the spectrum  142  of the Met80Ala/Tyr57Phe carbonyl derivative. On the other hand, this shoulder is also absent from the spectrum of the Met80Ala/Phe82Ser carbonyl derivative despite the presence of Tyr67 in this protein. Perhaps the removal of the relatively bulky Phe82 residue permits greater mobility of the coordinated CO ligand so that interaction with the Tyr67 hydroxyl group no longer offers sufficient energetic advantage. The 4 cm" shift observed in the principal carbonyl stretchingfrequencyof this 1  variant can be attributed to these structural differences as well as to increased polarity and solvent accessibility of the coordinated CO.  4.3.2  Electron Transfer Properties All three axial ligand variants studied in this work exhibit reduction potentials that are  significantly lower than that of wild-type yeast cytochrome c (290 mV, pH 6.0 (Rafferty, 1992)). This characteristic undoubtedly results at least in part from the loss of the electron accepting character of the axial Met80 ligand which normally contributes to the stability of the reduced form of the protein. In the case of the Met80Ala/Phe82Ser variant, the increased accessibility of the heme to solvent that results from replacement of Phe82 will help stabilize the oxidized cytochrome (Rafferty etal., 1990) as indicated by the fact that the double variant with this substitution exhibits a potential that is -65 mV lower than that of the Met80Ala variant. On the other hand the structural basis for the observation that the potential of the Met80Ala/Tyr67Phe double variant is higher than that of the Met80Ala single variant is more challenging to explain. The internal nature of the Tyr67Phe substitution should not result in any change in exposure of the heme prosthetic group to solvent. However, the removal of the phenolic hydroxyl group of the tyrosyl residue and introduction of the non-polar phenylalanyl residue will decrease the polarity of the heme environment. A decrease in the dielectric of the heme environment should increase the reduction potential of the heme iron, but the  143  anticipated magnitude of this effect is difficult to quantify. Although quantitative rationalization of the electrochemical behavior of the variants with the Met80Ala substitution is a challenging undertaking, knowledge of the reduction potentials of these variants is useful in the interpretation of the kinetics by which they are reduced by Fe(EDTA) ". 2  Application of relative Marcus theory to these results as developed by Wherland and Gray (1976) permits estimation of the apparent self-exchange rate constant exhibited by the variants in their reaction with this reducing agent. In this analysis, the reactivity of the reducing agent is accounted for through knowledge of its self-exchange rate constant, the thermodynamic driving force of the reaction of each variant with Fe(EDTA) " is accounted for through knowledge of the reduction 2  potentials of the reactants, and the electrostatic contribution to precursor complex formation and successor complex dissociation is accounted for by modified Debye-Huckel theory. Note that in the present case, the use of a single reducing reagent and the minimal effect of the mutations on electrostatic properties of the variants should, in any case, make these contributions to the reduction kinetics essentially identical for each variant. In other words, the principal basis for differences in the electrostatics corrected self-exchange rate constant (k  ) for the variants in their reaction with  eon u  Fe(EDTA) ' is expected to be differences in the thermodynamic driving forces for each of the 2  reactions, differences in the manner in which Fe(EDT A) " interacts with the surface of each protein, 2  and mutation-induced differences in the Franck-Condon activation barrier. The k  corr u  value derived from the reduction of the Met80Ala variant by Fe(EDTA) * (1.1 M" 2  1  s") is intermediate between the corresponding values exhibited by wild-type yeast cytochrome c (10.9 1  M-'s^Raffertyera/., 1992;Rafferty, 1992)) and the value for myoglobin (0.02 M" s' (Lim, 1990)). 1  1  The low reactivity of metmyoglobin in reduction by Fe(EDTA) " has been attributed previously to the 2  larger reorganizational energies required for the oxidation state-linked change in coordination number  144  of this protein. This conclusion is supported by the observation that the apparent self-exchange rate constant of the Met80Ala variant in this reaction is about an order of magnitude lower than that of the wild-type protein. The fact that k  con n  for the Met80Ala variant is nonetheless two orders of  magnitude greater than that of myoglobin suggests that other structural or electronic factors contribute significantly to the relative reactivity of these two proteins. A similar conclusion resulted from similar analysis of the Val68His variant of horse heart myoglobin. This variant has been shown to be six-coordinate in both oxidation states (Lloyd et al., 1995) and exhibits a k " of 0.25 M ' s' co  1  1  u  during reduction by Fe(EDTA) " (Harris et al., 1997). Although this value is about an order of 2  magnitude greater than the corresponding value exhibited by wild-type myoglobin, it is significantly lower than that of cytochrome c or cytochrome b (Reid et al., 1986), the heme iron center of which 5  also possesses a bisimidazole coordination environment in both oxidation states. At least two additional contributions to the difference in reactivity between wild-type cytochrome c and the Met80Ala variant should be considered. First, the electronic properties of the two proteins are non equivalent. Although the heme iron of the wild-type protein is low-spin in both oxidation states, the iron center of the oxidized variant is predominantly low-spin while the reduced variant is a combination of low-spin and high-spin species (Bren, 1996). Similar electronic considerations may contribute to the low reactivity of the Val68His variant of horse heart myoglobin relative to cytochromes c and b (Harris etal., 1997). Second, the hydrogen bonding network that 5  involves Tyr67, Met80, and Wat 166 in the wild-type cytochrome (Louie & Brayer, 1990; Berghuis & Brayer, 1992) is clearly disrupted in the Met80Ala variant. Reduction of the wild-type protein involves formation of a hydrogen bond between Tyr67 and Met80 that cannot form in the variant. At present, the only three-dimensional structure available for the Met80Ala variant has been determined by N M R analysis of the cyanide adduct (Banci et al., 1995), so detailed knowledge of the  145  hydrogen-bonding characteristics of the active site of this protein and the oxidation state-linked dependence of these interactions remains to be elucidated. From these considerations, it is apparent that the reorganization barrier to electron transfer of the Met80Ala variant is a critical factor in eventual development of a rigorous understanding of the electron transfer reactivity of this protein and that determination of the structure of the protein in both oxidation states will be required for this achievement. The multiple variants with the Met80Ala substitution will be subject to many of these same considerations, but their behavior will differ from that of the Met80Ala variant insofar as these proteins experience further changes in internal hydrogen-bonding and introduction of internally-bound water molecules. In addition to the reorganizational barrier, the manner of interaction of the wild-type protein and the Met80Ala containing variant with Fe(EDTA) " may differfromone another. The fact that the 2  apparent self-exchange rate constant for the reaction of the Met80 Ala variant with this reducing agent is two orders of magnitude greater than that of myoglobin may indicate that Fe(EDTA) " can interact 2  more effectively with the heme group of the cytochrome variant. This assumption is reasonable considering the Met80Ala mutation increases the solvent exposure of the heme (section 4.3.1). Greater exposure of the heme should lead to more effective interaction of the reducing agent with the protein to result, effectively, in a decreased donor-acceptor separation. Comparison of the activation entropy of the Met80Ala variant in this reaction (AS* = -19.5(8) e.u.) with that of the wild-type protein (AS* = -24.7 e.u. (Rafferty et al, 1990; Rafferty, 1992)) may be interpreted as support for this conclusion. While the difference in activation entropy exhibited by the wild-type and Met80Ala variant may be related to the formation of the precursor complex, the activation enthalpies observed in these reactions are influenced at least in part by the differences in reorganization barrier or oxidation state-  146  linked changes in coordination environment exhibited by the two proteins. The greater activation enthalpy exhibited in this reaction by the Met80Ala variant (AH* = 9.7(4) kcal mol" ) compared to 1  that of the wild-type protein (AH* = 3.5 kcal mol" (Rafferty et al, 1  1990; Rafferty, 1992)) is  consistent with the view that the variant undergoes more extensive structural change upon reduction. Notably, the activation enthalpy for reduction of metmyoglobin by Fe(EDTA) " is even slightly greater 2  (AH* = 12.1 kcal mol" (Lim 1990)). 1  The reduction of the Met80Ala/Tyr67Phe double variant by Fe(EDTA) ' displays biphasic 2  kinetics. The initial, faster phase corresponds to the reduction of the heme iron center to produce a low-spin ferric species that is probably six-coordinate. The rate constant for the second, slower phase is independent of Fe(EDTA) " concentration. This observation combined with the electronic spectra 2  observed in the rapid-scan stopped flow kinetics experiments lead to the conclusion that this phase corresponds to the conversion of the low-spin species to a form of the protein that exhibits a spin equilibrium similar to that observed for the Met80Ala ferricytochrome. The fact that the low-spin ferricytochrome intermediate is not observed during reduction of the Met80Ala variant indicates that some structural feature of the Tyr67Phe substitution in the double variant stabilizes the low-spin ferricytochrome intermediate. Evidence for such stabilization is provided by the lower pAT value a  obtained for titration of the water molecule coordinated to the Met80 Ala/Tyr67Phe ferrocytochrome double variant relative to the value obtained for the Met80Ala single variant. Regardless of the nature of the basis for the formation of the low-spin intermediate, this feature of the protein provides an opportunity to compare the self-exchange rate constants, k  corT n  of cytochrome derivatives with  differing coordination environments and to consider the resulting effects of these differences on the reorganization energies of each protein. The  !  CorT  exhibited by the Met80Ala/Tyr67Phe variant during reduction by Fe(EDTA) ' (343 2  147  M" s") is an order of magnitude greater than the value exhibited by the wild-type protein and two 1  1  orders of magnitude greater than that of the Met80Ala variant. Previous work has established that the Tyr67Phe substitution alone increases k " significantly and concluded that this increase results co  n  primarily from a decrease in the reorganization barrier (Rafferty et al., 1990). The single variant has been shown by X-ray crystallographic structure determination to possess an additional water molecule near the heme in approximately the position occupied by the phenolic hydroxyl group of Tyr67 in the wild-type protein (Berghuis et al., 1994). Although it is possible that a related change occurs at the active site of the Met80Ala/Tyr67Phe variant, it is more likely that further changes occur as the result of the relatively substantial structural change introduced through the Met80Ala substitution. The activation parameters for reduction of the double variant provide some additional insight. The activation enthalpy determined for the fast, electron transfer, phase of the reaction of the double variant (7.5(3) kcal mol ) is somewhat lower than the corresponding value for the Met80Ala -1  single variant (9.7(4) kcal mol" ). This is expected because the enthalpic energy associated with the 1  change in coordination number has been removed. On the other hand, the activation entropy for the fast phase for reduction of the double variant (-18.7(8) e.u.) and the Met80Ala variant (-19.5(8) e.u.) are comparable to each other. This observation indicates that the factors controlling the formation of the precursor complex are similar for both proteins. The apparent self-exchange rate constant of the Met80Ala/Phe82Ser double variant (k  eon n  = 0.04 M ' s' ) is surprisingly low. The greater exposure of the heme prosthetic group of this protein 1  1  to solvent combined with the previous observation that the Phe82Ser substitution increases the apparent self-exchange rate constant (Rafferty et al., 1990) leads to the expectation that the reactivity of the protein with Fe(EDTA) ' should be enhanced relative to that of the wild-type protein. 2  Furthermore, spectroscopic evidence suggests that this protein remains six-coordinate in both  148  oxidation states, a characteristic that is also exhibited by the wild-type cytochrome (k " = 10.9 M ' co  1  n  s") 1  and the Met80Ala/Tyr67Phe variant (k  con n  = 343 M '  1  s' ). The reactivity  of the  1  Met80Ala/Phe82Ser variant is essentially the same as that of myoglobin (k  con n  = 0.02 M" s") in this 1  1  reaction. One possible contribution toward this behavior may be that at pH 7.0, the heme iron atom of the oxidized variant is predominantly high-spin, and the sixth ligand is probably a water molecule rather than the hydroxide ligand proposed for the Met80Ala and Met80Ala/Tyr67Phe variants. The inefficiency of electron transfer exhibited by the Met80Ala/Phe82Ser variant, therefore, could be explained by the combined effects of the change in spin state that occurs upon reduction of the protein and the change in axial ligation from a water molecule in the oxidized protein to an hydroxide group in the reduced protein. This model leads to the expectation of a large reorganization barrier for electron transfer by this protein which is consistent with the activation enthalpy for reduction by Fe(EDTA) " (AH* = 2  9.2(5) kcal mol" ). This value is comparable to the corresponding values exhibited by other proteins 1  that undergo oxidation state-dependent changes in coordination number (e.g., myoglobin, AH* =12.1 kcal mol' ; Met80Ala variant of cytochrome c, AH* = 9.7(4) kcal mol" ). For comparison, the 1  1  activation enthalpy for reduction of wild-type ferricytochrome c, which is six-coordinate and low-spin in both oxidation states, by Fe(EDTA) " is just 3.5 kcal mol' (Rafferty etal., 1992). In principle, this 2  1  hypothesis could be evaluated by studying the kinetics of the reaction at pH 8.0 or greater in an effort to maintain hydroxide as the sixth ligand in both oxidation states. Unfortunately, at alkaline pH, the oxidized cytochrome undergoes a pH-linked conformational change in which one of two lysyl residues can bind to the heme iron (Theorell & Akesson, 1941; Ferrer et al., 1993; Rosell et al., 1997). This property of the protein renders kinetic studies relatively complex under these conditions.  149  4.4  Concluding Remarks The work described in this dissertation uses two novel types of cytochrome c variant to study  some of the structural factors that are known to contribute to the efficiency of inter- and intramolecular electron transfer reactions. The Cys-containing variants permit site-specific chemical modification with flavin residues that provide a useful alternative to the transition metal complexes that have been used widely as protein modifying agents for introduction of new electron transfer centers into proteins. A major result arising from kinetic studies of the synthetic flavocytochromes produced from these variants is that the flavin center has a reorganization energy, A, of 0.7(2) eV. This value is greater than that exhibited by ruthenium centers in similar environments. In addition, the correlation of the rate constants for intramolecular electron transfer observed for the four synthetic flavocytochromes studied can be understood in terms of the nature and the length of the electron transfer pathway between the donor and acceptor centers. From this work the utility of future use of a variety of alternative electron donors (e.g., quinones) as protein modifying reagents for the study of intramolecular electron transfer reactions of proteins is apparent. The variants in which the axial Met80 ligand was replaced with an alanyl residue provided insight concerning the role of the heme iron coordination environment and precursor complex formation in determining the electron transfer reactivity of cytochrome c. In particular, these variants emphasize the influence of heme iron reorganization energy on the efficiency of intermolecular electron transfer reactions. Models are proposed that invoke a role for both changes in spin state and coordination number that may account for significant differences in reactivity observed for these variants. Rigorous evaluation of the validity of these models will require additional spectroscopic analysis and possibly crystallographic studies. However, the present work demonstrates clearly the remarkable potential that these variants offer for understanding the magnitudes of the contributions  150  of these fundamental factors to the efficiency of metalloprotein electron transfer reactions.  151  5.  R E F E R E N C E S  A h m a d , I . , C u s a n o v i c h , M . A . , T o l l i n , G . (1981) Proc. Natl. Acad. Sci. U.S.A. 7 8 , 6 7 2 4 - 6 7 2 8 . A h m a d , I . , C u s a n o v i c h , M . A . , T o l l i n , G . (1982) Biochemistry 2 1 , 3 1 2 2 - 3 1 2 8 . A n t o n i n i , E . , B r u n o r i , M . ( 1 9 7 1 ) Hemoglobin and Myoglobin in their Reactions with Ligands, North-Holland, Amsterdam. B a i s t r o c c h i , P . , B a n c i , L . , B e r t i n i , I., T u r a n o , P . B r e n , K . L . , G r a y , H . B . ( 1 9 9 6 ) Biochemistry 3 5 , 13788-13796. B a n c i , L . , B e r t i n i , I., B r e n , K . L . , G r a y , H . B . , S o m p o r n p i s u t , P . , T u r a n o , P . ( 1 9 9 5 a ) Biochemistry 3 4 , 11385-11398. B a n c i , L . , B e r t i n i , I., B r e n , K . L . , G r a y , H . B . , T u r a n o , P . (1995b) Chemistry and Biology 2 , 3 7 7 383. B a n c i , L . , B e r t i n i , I., B r e n , K . L . , G r a y , H . B . , S o m p o r n p i s u t , P . , T u r a n o , P . ( 1 9 9 7 ) Biochemistry 3 6 , 8992-9001. B a r k e r , P . D . , Ferrer, J . C , M y l r a j a n , M . , L o e h r , T . M . , F e n g , R . , K o n i s h i , Y . , F u n k , W . D . , M a c G i l l i v r a y , R . T . A . , M a u k , A . G . ( 1 9 9 3 ) Proc. Natl. Acad. Sci. USA 90, 6 5 4 2 - 6 5 4 6 . B e r a t a n , D . N . , O n u c h i c , J . N , B e t t s , J . N . , B o w l e r , B . E . , G r a y , H . B . ( 1 9 9 0 ) J. Am. Chem. Soc. 112, 7915-7921. B e r a t a n , D . N . , B e t t s , J . N , O n u c h i c , J . N . (1991) Science 2 5 2 , 1285-1288. B e r a t a n , D . N . , O n u c h i c , J . N . , W i n k l e r , J . R . , G r a y , H . B . ( 1 9 9 2 ) Science 2 5 8 , 1 7 4 0 - 1 7 4 1 . B e r g h u i s , A . M . , B r a y e r , G . D . ( 1 9 9 2 ) J . Mol. Biol. 2 2 3 , 2 5 9 - 2 7 6 . B e r g h u i s , A . M . , Guillemette, J . G . , S m i t h , M . , B r a y e r , G . D . ( 1 9 9 4 ) J . Mol. Biol. 2 3 5 , 1 3 2 6 - 1 3 4 1 . Bernstein, F . C , Koetzle, T . F . , Williams, G . J. B . , Meyer, E . F . , Bruce, M . D . , Rodger, J. R . , K e n n a r d , O . , S h i m a n o u c h i , T . , T a s m u i , M . ( 1 9 7 7 ) 7 . Mol. Biol. 1 1 2 , 5 3 5 - 5 4 2 . B e t t s , J . N . , B e r a t a n , D . N , O n u c h i c , J . N . ( 1 9 9 2 ) 7 . Am. Chem. Soc. 1 1 4 , 4 0 4 3 - 4 0 4 6 . B j e r r u m , M . J . , C a s i m i r o , D . R . , C h a n g , I., D i B i l i o , A . J . , G r a y , H . B . , H i l l , M . G . , L a n g e n , R . , M i n e s , G . A . , S k o v , L . K . , W i n k l e r , J . R . , W u t t k e , D . S. ( 1 9 9 5 ) J. Bioenerg. Biomem. 2 7 , 2 9 5 302. B o w l e r , B . E . , M e a d e , T . J., M a y o , S. L . , R i c h a r d s , J . H . , G r a y , H . B . ( 1 9 8 9 ) J . Am. Chem. Soc. I l l , 152  8757-8759. Brautigan, D. L . , Ferguson-Miller, S., Margoliash, E . (1978) MethodsEnzymol. 5 3 , 130-139. Brayer, G. D.; Murphy, M . E . P. (1996) In Cyochrome c: A Multidisciplinary Approach, Scott, R. A., Mauk, A. G. (Eds), University Science Books: Sausalito, pp. 103-166. Bren, K. L . (1996) Ph.D. Dissertation, California Institute of Technology, Pasadena. Bren, K. L . , Gray, H . B. (1993a) J. Am. Chem. Soc. 1 1 5 , 10382-10383. Bren, K. L., Gray, H . B. (1993b) J. Inorg. Biochem. 5 1 , 111. Bren, K. L., Gray, H. B., Band, L., Bertini, I., Turano, P. (1995)./. Am. Chem. Soc. Ill, 8067-8073. Brown, W. D., Mebine, L . B. (1969) J. Biol. Chem. 2 4 4 , 6696-6701. Brown, G. M . , Sutin, N . (1979) J. Am. Chem. Soc. 1 0 1 , 883-892. Bushnell, G. W., Louie, G. V., Brayer, G. D. (1990) J. Mol. Biol. 2 1 4 , 585-595. Butt, W. D., Keilen, D. (1962) Proc. Royal Soc. Lond. B 1 5 2 , 429-458. Carell, T., Butenandt, J. {\991)Angew. Chem. Int. Ed. Engl. 3 6 , 1461-1464. Carver, T. E., Brantley, R. E . Jr., Singleton, E . W., Arduini, R. M . , Quillin, M . L., Phillips, G. N . Jr., Olson, J. S. (1992) J. Biol. Chem. 2 6 7 , 14443-14450. Casimiro, D. R., Richards, J. H., Winkler, J. R., Gray, H. B. (1993) J. Phys. Chem. 97,13073-13077. Cassat, J. C , Marini, C. P., Bender, J. W. (197'5) Biochemistry, 1 4 , 5470-5475. Chang, I.-J., Gray, H . B., Winkler, J. R. (1991)7. Am. Chem. Soc. 1 1 3 , 7056-7057 Chapman, S. K., Reid, G. A., Daff, S., Sharp, R. E., White, P., Manson, F. D. C , Lederer, F. (1994) Biochem. Soc. Trans. 2 2 , 713-718. Cheddar, G., Meyer, T. E . , Cusanovich, M . A., Stout, C. D., Tollin, G. (1989) Biochemistry 2 8 , 6318-6322. Christensen, H . E . M . , Conrad, L . S., Mikkelson, K. V., Nielsen, M . K., Ulstrup, J. (1990) Inorg. Chem. 29, 2808-2816. Christensen, H . E . M . , Conrad, L . S., Hammerstad-Pedersen, J. M . , Ulstrup, J. (1992) FEBSLett. 2 9 6 , 141-144.  153  C l a r k , W . M . ( 1 9 6 0 ) I n Oxidation-Reduction Potentials of Organic Systems, W i l l i a m s and W i l k i n s , B a l t i m o r e , M D , p p 107-203. C o n r a d , D . W . , Scott, R . A . (1989) J. Am. Chem. Soc. I l l , 3 4 6 1 - 3 4 6 3 . C o n r a d , D . W . , Z h a n g , H . , Stewart, D . E . , Scott, R . A . ( 1 9 9 2 ) 7 . Am. Chem. Soc. 114, 9 9 0 9 - 9 9 1 5 . C o n r o y , C . W . , T y m a , P . , D a u m , P . , E r m a n , J . E . (1978) Biochim. Biophys. Acta. 537, 6 2 - 6 9 . C o y l e , C . L . , G r a y , H . B . (1976) Biochem. Biophys. Res. Commun. 73, 1122-1127. C u m m i n s , D . , G r a y , H . B . (1977) J . Am. Chem. Soc. 99, 5 1 5 8 - 5 1 6 7 . C u s a n o v i c h , M . A . , M e y e r , T . E . , T o l l i n , G . (1987) Adv. Inorg. Chem. 7, 3 7 - 9 1 . C u s a n o v i c h , M . A . , M e y e r , T . E . , T o l l i n , G . (1988) I n Heme Proteins v o l . 7 o f Advances in Inorganic Biochemistry, E i c h o r n , G . L . , M a r z i l l i , J . G . ( E d s ) E l s e v i e r , N e w Y o r k , p p 3 7 - 9 2 . C u s a n o v i c h , M . A . , T o l l i n , G . (1996) I n Cytochrome c: A Multidisciplinary Approach; Scott, R . A . , M a u k , A . G . ( E d s ) , U n i v e r s i t y Science B o o k s : Sausalito, pp. 4 8 9 - 5 1 3 . C u t l e r , R . L . , P i e l a k , G . J . , M a u k , A . G . , S m i t h , M . ( 1 9 8 7 ) Protein Engineering 1, 9 5 - 9 9 . C u t l e r , R . L . , D a v i s , A . M . , C r e i g h t o n , S., W a r s h e l , A . , M o o r e , G . R . , S m i t h , M . , M a u k , A . G . (1989) Biochemistry 28, 3 1 8 8 - 3 1 9 7 . Daff, S., Ingledew, W . J . , R e i d , G . A , C h a p m a n , S. K . ( 1 9 9 6 ) Biochemistry 35, 6 3 4 5 - 6 3 5 0 . D a w s o n , J. H . ( 1 9 8 8 ) Science 240, 4 3 3 - 4 3 9 . D e B a e r e , I., P e r u t z , M . F . , K i g e r , L . , M a r d e n , M . C , Poyart, C . ( 1 9 9 4 ) Z ^ o c . Natl. Acad. Sci. USA 91, 1594-1597. D i c k e r s o n , R . E . , K o p k a , M . L . , B o r d e r s , C . L . , V a m u m , J., W e i n z i e r l , J. E . ( 1 9 6 7 ) 7 . Mol. Biol. 29, 77-95. Dickerson, R . E . , Takano, T., Eisenberg, D . , Kallai, O. B . , Samson, L . , Cooper, A . , Margoliash, E . ( 1 9 7 1 ) 7 . Biol. Chem. 246, 1511-1532. D i c k e r s o n , R . E . , T i m k o v i c h , R . (1975) I n The Enzymes, 3 r d e d n , V o l 11. B o y e r , P . D . ( E d ) , A c a d e m i c Press, L o n d o n , p p 3 9 7 - 5 4 7 . D r a p e r , R . D . , Ingraham, L . L . (1968) Arch. Biochem. Biophys. 125, 8 0 2 - 8 0 8 . D u n f o r d , H . B . (1991) I n CRC Peroxidases in Chemistry and Biology, E v e r s e , J . , E v e r s e , K . E . , G r i s h a m , M . B . ( E d s ) C R C Press, B o s t o n pp 1-24. 154  Durham, B., Pan, L . P., Long, J. E . , Millett, F. (1989) Biochemistry 28, 8659-8665. Dutton, P. L . (1978) Meth. Enzymol. 54, 411-435. Dutton, P. L . , Moser, C. C. (1994) Proc. Natl. Acad. Sci. U.S.A. 91, 10247-10250. Eltis, L . , Mauk, A. G., Hazzard, J. T., Cusanovich, M . A., Tollin, G. (1988) Biochemistry 27, 54555460. Eltis, L . , Herbert, R. G., Braker, P. D., Mauk, A. G., Northrup, S. H . (1991)Biochemistry 30, 36633674. Fairris, J. L., Wang, K., Geren, L., Saunders, A. J., Pielak, G. J., Durham, B., Millett, F. (1996) Adv. in Chemistry Series, In Press. Falk, J. E . (1964) Porphyrins andMetalloporphyrins, Elsevier, New York. Falk, M . C , McCormick, D. B. (1976) Biochemistry 15, 646-653. Ferrer, J. C , Guillemette, J. G., Bogumil, R., Inglis, S. C , Smith, M . , Mauk, A. G. (1993)/. Am. Chem. Soc. 115, 7507-7508. Geren, L . , Hahm, S., Durham, B., Millett, F. (1991) Biochemistry 30, 9450-9457. Goldkorn, T., Schetjer, A. (1976) Arch. Biochem. Biophys. Ill, 39-45. Goldman, C. (1991) Phys. Rev. A43, 4500-4509. Gorren, A. C , Chan, M . L . , Scott, R. A. (1992) Bioconj. Chem. 3, 291-294. Guzzo, A. V., Tollin, G. (1964) Arch. Biochem. Biophys. 105, 380-386. Hampsey, D. M . , Das, G., Sherman, F. (1986)7 Biol. Chem. 261, 3259-3271. Harbury, H . A., Cronin, J. R., Fanger, M . W., Hettinger, T. P., Murphy, A. J., Myer, Y . P., Vinogradov, S. N . (1965) Proc. Natl. Acad. Sci. USA 54, 1658-1664. Harris, T. R., Rosell, F., Hilderbrand, D. P., Mauk, A. G. (1997) In Preparation. Hazzard, J. T., Cusanovich, M . A., Tainer, J. A., Getzoff, E . D., Tollin, G. (1986) Biochemistry 25, 3318-3328. Hazzard, J. T., Poulos, T. L . , Tollin, G. (1987) Biochemistry 26, 2836-2848. Hazzard, J. T., Moench, S. J., Erman, J. E., Satterlee, J. D., Tollin, G. (1988)Biochemistry 21,20022008. 155  Hazzard, J. T., McDonough,, C. A., Tollin, G. (1994) Biochemistry 33, 13445-13454. Hildebrand D. P. (1996) Ph.D. Dissertation, University of British Columbia, Vancouver. Hildebrand, D. P., Burk, D. L . , Maurus, R., Ferrer, J. C , Brayer, G. D., Mauk, A. G. (1995) Biochemistry 34, 1997-2005. Hilvert, D., Hatanaka, Y., Kaiser, E . T., (1988) 7. Am. Chem. Soc. 110, 682-689. Hodges, H . L., Holwerda, R. A., Gray, H. B. (1974)7 Am. Chem. Soc. 96, 3132-3137. Hoffman, R. J. (1963)7. Chem. Phys. 39, 1397-1405. Holwerda, R. A., Knoff, D. B., Gray, H. B., Clemmer, I'D., Crowley, R., Smith, I M . , Mauk, A. G. (1980)7. Am. Chem. Soc. 102, 1142-1146. Huang, Y. Y . , Hara, T., Sliger, S., Coon, M . I , Kimura, T. (\9%6) Biochemistry 25, 1390-1394. Inglis, S. C , Guillemette, I G., Johnson, I A , Smith, M . (1991) Protein Eng. 4, 569-574. Isied, S. S. (1990) In Advances in Chemistry Series. Electron Transfer in Biology and the Solid State, Vol. 226, Johnson, M . K., King, R. B., Kurtz, D. M . , Jr., Kutal, C , Norton, M . L., Scott, R. A. (Eds) ACS, Washigton, D.C. pp 91-100. Isied, S. S., Worosila, G., Atherton, S. J. (1982)7 Am. Chem. Soc. 104, 7659-7661. Isied, S. S., Kuehn, C , Worosila, G. (1984) 7. Am. Chem. Soc. 106, 1722-1726. Jung, J., Tollin, G. (1981) Biochemistry 20, 5124-5131. Karpishin, T. B., Grinstaff, M . W., Jonar-Panicucci, S., McLendon, G., Gray, H. B. (1994) Structure 2,415-422. Kassner, R. J. (1972) Proc. Natl. Acad. Sci. USA 69, 2263-2267. Kassner, R. J. (1973)7. Am. Chem. Soc. 95, 2674-2677. Kim, C-S., Kueppers, F., Dimaria, P., Farooqui, J., Kim, S., Paik, W. K. (1980)Biochim. Biophys. Acta. 622, 144-150. Kloek, A. P., Yang, J., Mathews, F. S., Frieden, C , Goldberg, D. E . (1994) 7. Biol. Chem. 269, 2377-2379. Kuki, A. (1991) Structure and Bonding 75, 49-83. Kunkel, T. A. (1985) Proc. Natl. Acad. Sci. USA 72, 488-492. 156  Langen, R., Chang, I.-J., Germanas, J. P., Richards, J. H., Winkler, J. R., Gray, H . B. (1995) Science 268, 1733-1735. Larsson, S. (1981)7 Am. Chem. Soc. 103, 4034-4040. Levine, H . L., Kaiser, E . T. (1978)7 Am. Chem. Soc. 100, 7670-7677. Libby, W. F. (1952)7. Phys. Chem. 56, 863-868. Lieber, C. M , Karas, J. L . , Mayo, S. L . , Albin, M . , Gray, H . B. (1987) "Long-Range Electron Transfer in Proteins," The Robert A. Welch Foundation Conference on Chemical Research X X X I pp 9-26. Lieber, C. M . , Karas, J. L., Mayo, S. L., Axup, A. W., Albin, M . , Crutchley, R. J., Ellis, W. R., Jr., Gray, H . B. (1988) In Trace Elements in Man and Animals, Vol. 6, Hurley, L . S., Keen, C. L . , Lonnerdal, B., Rucker, R. B. (Eds) Plenum Press, New York pp 23-27. Lim, A. R. (1990) Ph.D. Dissertation, University of British Columbia, Vancouver. Lim, A. R., Mauk, A. G. (1985) Biochem. 7. 229, 765-769. Lloyd, E . , Hilderbrand, D. P., Tu, K. M . , Mauk, A. G. (1995)7. Am. Chem. Soc. Ill, 6434-6348. Lo, T. P. (1995) Ph.D. Dissertation, University of British Columbia, Vancouver. Lo, T. P., Murphy, M . E . P., Guillemette, J. G., Smith, M . , Brayer, G. D. (1995) Protein Sci. 4,198208. Louie, G. V., Brayer, G. D. (1990)7. Mol. Biol. 214, 527-555. Louie, G. V., Pielak, G. J., Smith, M . , Brayer, G. D. (1988) Biochemistry 21, 7870-7876. Lu, Y., Casimro, D. R., Bren, K. L., Richards, J. H . , Gray, H . B. (1993) ProL Natl. Acad. Sci. USA 90,11456-11459. Lui, R.-Q. (1994) Ph.D. Dissertation, University of Arkansas, Little Rock. Makinen, M . W., Churg, A. K . (1983) In Iron Porphyrins, Lever, A. P. B., Gray, H . B. (Eds.) Addison Wesley, London, pp 141-235. Maniatis, T., Fritsch, E . F., Sambrook, J. (1989) Molecular Cloning: a Laboratory Manual, Cold Spring Harbor Laboratory Press, New York. Marcus, R. A. (1965)7. Chem. Phys. 43, 679-701. Marcus, R. A., Sutin, N . (1985) Biochim. Biophys. Acta, 811, 265-322. 157  M a r g o l i a s h , E . Schejter, A . (1996) I n Cytochrome c: A Multidisciplinary Approach; Scott, R . A . , M a u k , A . G . ( E d s ) , U n i v e r s i t y Science B o o k s : Sausalito, p p . 3 - 3 1 . M a s s e y , V . , G h i s l a , S. (1983) In Biological Oxidations, S u n d , H . , U l l r i c h , V . ( E d s ) Springer, B e r l i n pp. 114-139. M a s s e y , V . , H e m m e r i c h , P . (1980) Biochem. Soc. Trans. 8, 2 4 6 - 2 5 0 . M a s s e y , V . , H e m m e r i c h , P . (1982) InFlavin and Flavoproteins, M a s s e y , V . , Williams, C . H . ( E d s ) E l s e v i e r / N o r t h H o l l a n d , N e w Y o r k pp. 83-96. M a t h e w s , F . S. ( 1 9 8 5 ) Prog. Biophys. Mol. Biol. 45, 1-56. M a u k , A . G . , G r a y , H . B . ( 1 9 7 9 ) Biochem. Biophys. Res. Commun. 86, 2 0 6 - 2 1 0 . M a u k , M . R . , M a u k , A . G . , W e b e r , P . C , M a t t h e w s , J . B . ( 1 9 8 6 ) Biochemistry 25, 7 0 8 5 - 7 0 9 1 . M a u k , M . R . , M a u k , A . G . , M o o r e , G . R . , N o r t h r u p , S. H . (1995) Jour. Bioeneg. &Biomembr. 27, 311-330. M a y h e w , S. G . , O ' C o n n e l l , D . P . , O ' F a r r e l l , P . A , Y a l l o w a y , G . N . , G e o g h e g a n , S. M . (1996) Biochem. Soc. Trans. 24, 122-127. M c A r d l e , J . V . , Y o c o m , K . , G r a y , H . B . (1977) J. Am. Chem. Soc. 99, 4 1 4 1 - 4 1 4 5 . M c l n t i r e , W . , Singer, T . P . , A m e y a m a , M . , A d a c h i , O . , M a t s u s h i t a k , K . , S h i n a g a w a , E . (1995) Biochem. J. 231, 6 5 1 - 6 5 4 . M e a d e , T . J . , G r a y , H . B . , W i n k l e r , J . R . (1989) J . Am. Chem. Soc. I l l , 4 3 5 3 - 4 3 5 6 . M e i t e s , L . , M e i t e s , T . ( 1 9 8 4 ) Anal. Chem. 20, 9 8 4 . M e y e r , T . E . , W a t k i n s , J . A . , P r z y s i e c k i , C . T . , T o l l i n , G . , C u s a n o v i c h , M . A . ( 1 9 8 4 ) Biochemistry 23, 4 7 6 1 - 4 7 6 7 . M i h a r a , H . , T o m i z a k i , K . - Y . , N i s h i n o , N , F u g i m o t o , T . (1993) Chem. Lett. 1 5 3 3 - 1 5 3 6 . M i l l e r , W . G . , C u z a n o v i c h , M . A . (1974) Bioelectrochem. Bioenerg. 1, 9 7 - 1 1 1 . M i l l e t t , F . , D u r h a m , B . (1991) In Metal Ions in Biological Systems, V o l . 2 7 , S i g e l , H . , S i g e l , A . ( E d s ) M a r c e l D e k k e r , Inc., N e w Y o r k p p . 2 2 3 - 2 6 4 M i n e s , G . A . , B j e r r u m , M . J . , H i l l , M . G . , C a s i m i r o , D . R . , C h a n g , I., W i n k l e r , J . R . , G r a y , H . B . ( 1 9 9 6 ) / . Am. Chem. Soc. 118,  1961-1965.  M o o r e , G . R . (1983) FEBSLett. 161, 171-175. 158  Moore, G. R., Williams, R. J. P. (1977) FEBSLett. 79, 223-229. Moore, G. R., Pettigrew, G. W. (1990) Cytochromes c: Evolutionary, Structural and Physicochemical Aspects, Springer-Verlag, Heidelberg. Moore, G. R., Harris, D. E . , Leitch, F. A., Pettigrew, G. W. (1984) Biochim. Biophys. Acta 764, 331-342. Moore, G. R., Pettigrew, G. W., Rogers, N. K. (1986) Proc. Natl. Acad. Sci. USA 69, 2263-2267. Moser, C. C , Dutton, P. L . (1992) Biochim. Biophys. Acta 1101, 171-176. Moser, C. C , Keske, J. M . , Warncke, K., Farid, R. S., Dutton, P. L . (1992) Nature 355, 796-801. Murphy, M . E . P. (1993) Ph.D. Dissertation, University of British Columbia, Vancouver. Murphy, M . E . P., Nail, B. T., Brayer, G. D. (1992) 7. Mol. Biol. 227, 160-176. Narita, K., Titani, K. (1969)7. Biochem. 65, 226-241. Nocek, J. M . , Zhou, J. S., Deforest, S., Priyadarshy, S., Beratan, D. N , Onuchic, J. N., Hoffman, B. M . (1996) Chemical Reviews 96, 2459-2489. Nocera, D. G., Winkler, J. R., Yocom, K. M . , Bordignon, E , Gray, H.B. (1984)7. Am. Chem. Soc. 106, 5145-5150. Northrup, S. H . , Boles, J. O., Reynolds, J. C. (1988) Science 241, 67-70. Northrup, S. H . , Thomasson, K. A., Miller, C. M . , Barker, P. D., Eltis, L . D., Guillemette, J. G., Inglis, S. C , Mauk, A. G. (1993) Biochemistry 32, 6613-6623. Nozaki, M . , Mutzushima, H . , Horio, T., Okunuki, K. (1958)7 Biochem. 256, 673-676. Ochi, H., Hata, Y., Tanaka, N., Kakudo, M . , Sakuri, T.,Achara, S., Morita, Y. (1983)7. Mol. Biol. 166, 407-418. Onuchic, J. N , Beratan, D. N . (1990)7. Chem. Phys. 92, 722-733. Onuchic, J. N , Beratan, D. N , Winkler, J. R., Gray, H. B. (1992) Annu. Rev. Biophys. Biomol. Struct. 21, 349-377. Ormos, P., Braunstein, D., Frauenfelder, H . , Hong, M . K., Lin, S.-L., Sauke, T. B., Young, R. D., (1988) Proc. Natl. Acad. Sci. U.S.A. 85, 8492-8496. Pan, L P . , Durham, B., Wolinska, J., Millett, F. (1988)7. Am. Chem. Soc. 110, 7114-7118.  159  Pelletier, H., Kraut, J. (1992) Science, 258, 1748-1755. Penzer, G. R., Radda, G. K. (1967) Q. Rev., Chem. Soc. 21, 43-48. Peterson-Kennedy, S. E . , McGourty, J. L., Hoffman, B. M . (1984) J. Am. Chem. Soc. 106, 50105011 Pettigrew, G. W., Moore, G. R. (1987) Cytochromes c: Biological Aspects, Springer-Verlag, Heidelberg. * Phase-R Corporation, Box G-2 Old Bay Rd., New Durham, N H 03855. Phillips, S. E . (1980) J. Mol. Biol. 142, 531-534. Pielak, G. J., Mauk, A. G., Smith, M . (1985) Nature 313, 152-154. Pollock, W. B. R., Rosell, F. I., Twitchett, M . B., Dumont, M . E . , Mauk, A. G. (1997)Biochemistry, In Preparation. Poulos, T. L., Kraut, J. (1980) J. Biol. Chem. 255, 10322-10330. Prysiecki, C. T., Tollin, G., Meyer, T. E., Staggers, J. E . , Cusanovich, M . A. (1985) Arch. Biochem. Biophys. 238, 334-343. Qi, P. X., Beckman, R. A., Wand, A. J. (1996) Biochemistry, 35, 12275-12286. Rafferty, S. P. (1992) Ph.D. Dissertation, University of British Columbia, Vancouver. Rafferty, S. P., Pearce, L. L., Barker, P. D., Guillemette, J. G., Kay, C. M . , Smith, M . , Mauk, A. G. (1990) Biochemistry, 29, 9365-9369. Rafferty, S. P., Guillemette, J. G., Berghuis, A. M . , Smith, M . , Brayer, G. D., Mauk, A. G. (1996) Biochemistry 35, 10784-10792. Raphael, A. L., Gray, H . B. (1989) Protein, Struct., Fund., Genet. 6, 338-340. Raphael, A. L., Gray, H. B. (1991) J. Am. Chem. Soc. 113, 1038-1040. Ray, G. B., Li, X . - Y . , Ibers, J. A., Sessler, J. L . , Spiro, T. G. (1994)7. Am. Chem. Soc. 116, 162176. Rees, A. R., Offord, R. E . (1976) Biochem. Jour. 159, 467-479. Regan, J. J., Risser, S. M . , Beratan, D. N , Onuchic, J. N . (1993) J. Phys. Chem. 97, 13083-13088. Reid, L . S. (1984) Ph.D. Dissertation, University of British Columbia, Vancouver. 160  R e i d , L . S., M a u k , A . G . ( 1 9 8 2 ) . / . Am. Chem. Soc. 104, 8 4 1 - 8 4 5 . R e i d , L . S., T a n i g u c h i , V . T., G r a y , H . B . , M a u k , A . G . (1982) J. Am. Chem. Soc. 104, 7 5 1 6 - 7 5 1 9 . R e i d , L . S., L i m , A . R . , M a u k , A . G . (1986) J . Am. Chem. Soc. 108, 8 1 9 7 - 8 2 0 1 . R i c h , P . R . , B e n d a l l , D . K . (1980) Biochim. Biophys. Acta. 592, 5 0 6 - 5 1 8 . R i e d e r , R . , B o s s h a r d , H . R . (1980) J. Biol. Chem. 255, 4 7 3 2 - 4 7 3 9 . R o b i n s o n , M . N , B o s w e l l , A . P . , E l e y , C . S. G . , H u a n g , Z . - X . , M o o r e , G . R . ( 1 9 8 3 ) Biochem. J. 213, 6 8 7 - 7 0 0 . R o s e l l , F . I., Ferrer, J . C , M a u k , A . G . (1997) submitted to J. Am. Chem. Soc. Salemme, F . R . (1976) J . Mol. Biol. 102, 5 6 3 - 5 6 8 . S a m b r o o k , J . , F r i t s c h , E . F . , M a n i a t i s , T. ( 1 9 8 9 ) Molecular Cloning: a Laboratory Manual, 2 n d E d . , C o l d S p r i n g H a r b o r L a b o r a t o r y Press, N e w Y o r k . S a w i c k i , C . A . , M o r r i s , R . J . (\9U)Meth. Enzymol. 76, 6 6 7 - 6 8 1 . Schlauder, G . , K a s s n e r , R . J . ( 1 9 7 9 ) 7 . Biol. Chem. 254, 4 1 1 0 - 4 1 1 3 . Scott, R . A . ( 1 9 9 6 ) I n Cytochrome c: A Multidisciplinary Approach, Scott, R . A . ; M a u k , A . G . , E d s . , U n i v e r s i t y Science B o o k s : Sausalito, pp. 5 1 5 - 5 4 1 . Scott, R . A . , M a u k , A . G . (1996) Cytochrome c: A Multidisciplinary Approach, U n i v e r s i t y Science B o o k s : Sausalito. Scott, R . A . , M a u k , A . G . , G r a y , H . B . ( 1 9 8 5 ) J . Chem. Ed. 62, 9 3 2 - 9 3 8 . Scott, R . A . , C o n r a d , D . W . , Eidsness, M . K . , G o r r e n , A . C , W a l l i n , S. A . ( 1 9 9 1 ) InMetallons in Biological Systems, V o l . 2 7 , Sigel, H . , Sigel, A . ( E d s ) M a r c e l D e k k e r , Inc. N e w Y o r k p p 199222. S h a c k , J . , C l a r k , W . M . ( 1 9 4 7 ) / . Biol. Chem. 171, 143-187. Shumyantseva, V . V . , U v a r o v , V . Y . , B y a k o v a , O . E . , A r c h a k o v , A . I. ( 1 9 9 6 ) Biochem. Mol. Biol. Int. 3 8 , 8 2 9 - 8 3 8 . Siddarth, P . , M a r c u s , R . A . (1990) J . Phys. Chem. 94, 8 4 3 0 - 8 4 3 4 . Siddarth, P . , M a r c u s , R . A . (1992) J. Phys. Chem. 96, 3 2 1 3 - 3 2 1 7 . Siddarth, P . , M a r c u s , R . A . (1993a) J . Phys. Chem. 97, 2 4 0 0 - 2 4 0 5 . 161  Siddarth, P . , M a r c u s , R . A . (1993b) J . Phys. Chem. 97, 1 3 0 7 8 - 1 3 0 8 2 . S i m o n d s e n , R . P . , T o l l i n , G . ( 1 9 8 3 ) Biochemistry 22, 3 0 0 8 - 3 0 1 6 . S m i t h , M . B . , Stonehuerner, J . , A h m e d , A . J . ; Staudenmayer, N . , M i l l e t t , F . (1980) Biocheim. Biophys. Acta 592, 3 0 3 - 3 1 3 . S o r r e l l , T . N . , M a r t i n , P . K . , B o w d e n , E . F . ( 1 9 8 9 ) J . Am. Chem. Soc. I l l , 7 6 6 - 7 6 7 . S p e c k , S. H . , M a r g o l i a s h , E . (1984) J . Biol. Chem. 259,  1064-1072.  S p e c k , S. H . , F e r g u s o n - M i l l e r , S., Osheroff, N . , M a r g o l i a s h , E . (1979) Proc. Natl. Acad. Sci. (USA) 76, 155-159. Speck, S. H . , K o p p e n o l , W . H . , Dethmers, J . K . , Osheroff, N . , M a r g o l i a s h , E . , Rajagopalan, K . V . ( 1 9 8 1 ) 7 . Bio. Chem. 256, 7 3 9 4 - 7 4 0 0 . Sridharan, S., N i c h o l l s , A . , Sharp, K . A . (1995) J . Comp. Chem. 16, 1038-1044. S t a n k o v i c h , M . T . , (1989) In Flavoproteins V o l . 1 Redox Properties of Flavins andFlavoproteins, C R C Press, Inc., F l o r i d a pp. 4 0 1 - 4 2 5 . Steenkamp, D . J . , M c l n t i r e , W . , K e n n e y , W . C . (1978) J . Biol. Chem. 253, 2 8 1 8 - 2 8 2 4 . Stellwagen, E . (1978) Nature 275, 73-74. Sun, J . , W i s h a r t , J . F . , Gardineer, M . B . , C h o , M . P . , Isied, S. S. (\99S)Inorg. Chem. 34,3301-3309. T a k a n o , T . , D i c k e r s o n , R . E . (1980) Proc. Natl. Acad. Sci. (USA) 7 7 , 6 3 7 1 - 6 3 7 5 . T a k a n o , T . , D i c k e r s o n , R . E . (1981a) J . Mol. Biol. 153, 79-94. T a k a n o , T . , D i c k e r s o n , R . E . (1981b) J . Mol. Biol. 153, 9 5 - 1 1 5 . T a n a k a , T . , Y a m a n e , T . , T s u k i h a r a , T . , A s h i d a , T . , K a k u d o , M . (1975) J . Biochem. (Tokyo) 11,147162. T a n i g u c h i , V . T . , Sailasuta-Scott, N . , A n s o n , F . C , G r a y , H . B . (1980) Pure & Applied Chem. 52, 2275-2281. T a n i g u c h i , I., T o y o s a w a , K . , Y a m a g u c h i , H . , Y a s u k a u c h i , K . (1982) Electroanal. Chem. 140, 187190. T e g o n i , M . , Janot., J . - M . , L a b e y r i e , F . (1986) Eur. J. Biochem. 155, 4 9 1 - 5 0 3 . T e g o n i , M . , W h i t e , S. A . , R o u s s e l , A . , M a t h e w s , F . S., C a m b i l l a u , C . (1993)Proteins: Struct. Funct. 162  Genet. 16, 4 0 8 - 4 2 2 . Theorell, H ,  Akesson, A. (1941) J. Am. Chem.  Soc.  63,  1804-1820.  Therien, M . J . , S e l m o n , M . , G r a y , H . J3., C h a n g , I. J . , W i n k l e r , J . R . ( 1 9 9 0 ) J . Am. Chem. Soc. 112, 2420-2422. T h o n y - M e y e r , L . (1997)Microbiol. &Mol. Biol. Rev. 61, 3 3 7 - 3 7 6 . T o l l i n , G . , M e y e r , T . E . , C u s a n o v i c h , M . A . (1986) Biochim. Biophys. Acta 853, 2 9 - 4 1 . Traber, R . , K r a m e r , H . E . A . , H e m m e r i c h , P . (1982) Biochemistry 21, 1 6 8 7 - 1 6 9 3 . T w i t c h e t t , M . B . , Ferrer, J . C , Siddarth, P . , M a u k , A . G . ( 1 9 9 7 ) 7 . Am. Chem. Soc. 119, 4 3 5 - 4 3 6 . W a l l a c e , C . J . ( 1 9 9 3 ) FASEB Jour. 7, 5 0 5 - 5 1 5 . W a l l a c e , C . J . A . , C l a r k - L e w i s , I. ( 1 9 9 2 ) 7 . Biol. Chem. 267, 3 8 5 2 - 3 8 6 1 . W e b e r , P . C , T o l l i n , G . ( 1 9 8 5 ) 7 Biol. Chem. 260, 5 5 6 8 - 5 5 7 3 . W h e r l a n d , S, H o l w e r d a , R . A . , R o s e n b e r g , R . C , G r a y , H . B . ( 1 9 7 5 ) 7 . Am. Chem. Soc. 97, 5 2 6 0 5262. W h e r l a n d , S., G r a y , H . B . (1976) Proc. Natl. Acad. Sci. USA 78, 2 9 5 0 - 2 9 5 4 . W i l l i a m s , G . , C l a y d e n , N . J . , M o o r e , G . R . , W i l l i a m s , R . J . P . (1985) 7. Mol. Biol. 183, 4 4 7 - 4 6 0 . W i l l i a m s , R . J . P . ( 1 9 5 9 ) I n The Enzymes 2nd Ed, B o y e r , P . D . , L a r d y , H . , M y r b a c k , K . ( E d s ) A c a d e m i c Press L o n d o n , p p 3 9 1 - 4 4 1 . W i l l i a m s o n , G . , E d m o n d s o n , D . E . (1985) Biochemistry, 24, 7 7 9 0 - 7 7 9 7 . W i n k l e r , J . R . , G r a y , H . B . (1997) 7. Biol. Inorg. Chem. 2, 3 9 9 - 4 0 4 . W i n k l e r , J . R . , N o c e r a , D . G . , Y o c o m , K . B . , B o r d i g n o n , E . , G r a y , H . B . ( 1 9 8 2 ) 7 . Am. Chem. Soc. 104, 5 7 9 8 - 5 8 0 0 . W u , T . T . , K a b a t , E . A . ( 1 9 7 0 ) 7 . Exp. Med., 132, 2 1 1 - 2 5 0 . W u t t k e , D . S., B j e r r u m , J . I , W i n k l e r , J . R . , G r a y , H . B . (1992) Science 256, 1 0 0 7 - 1 0 0 9 . X i a , Z . - X . , M a t h e w s , F . S. ( 1 9 9 0 ) 7 . Mol. Biol. 212, 8 3 7 - 8 6 3 . Y a m a n a k a , T . , M u t z u s h i m a , H . , N o z a k i , M . , H o r i o , T . , O k u n u k i , K . ( 1 9 5 9 ) 7 . Biochem. 46, 1 2 1 132. 163  Y o c o m , K . M . , S h e l t o n , J . B . , Shelton, J . R . , Schroeder, W . A . , W o r o s i l a , G . , Isied, S. S., B o r d i g n o n , E . , G r a y H . B . (1982) Z o l l e r , M . J . , S m i t h , M . (1983)  Proc. Natl. Acad. Sci. USA 7 9 ,  Methods Emymol.  Z o l l e r , M . J . , S m i t h , M . (1984) DNA 3, 4 7 9 - 4 8 8 .  164  100, 4 6 8 - 5 0 0 .  7052-7055.  APPENDIX A -Cyclic voltammetry results (Error in reduction potential values ± 2 mV) Protein  pH  F°  T(K)  Fe 7Fe (mV vs SHE) 2  7-acetyl-10methylisoalloxazine  7a-bromoacetyl-10methylisoalloxazine  AE (mV)  h e m e  heme 3+  ^ flavin  AEflavin  Ox/Red (mV vs SHE)  (mV)  4.93  298  -  -  23  58  5.56  298  -  -  -14  62  6.16  298  -  -  -67  63  6.57  298  -  -  -85  62  7.05  278  -  -  -105  58  283  -  -  -108  56  288  -  -  -110  54  293  -  -  -112  55  298  -  -  -113  53  303  -  -  -116  52  308  -  -  -117  50  313  -  -  -119  50  7.54  298  -  -  -126  56  8.00  298  -  -  -141  56  8.51  298  -  -  -161  55  9.01  298  -  -  -174  54  9.55  298  -  -  -196  56  9.90  298  -  -  -201  52  10.46  298  -  -  -246  54  10.98  298  -  -  -274  50  11.68  298  -  -  -312  50  4.93  298  -  -  -7  56  5.50  298  -  -  -44  57  165  Protein  PH  T(K)  ^ heme  Fe 7Fe 2  3 +  (mV)  ^ flavin  AEflavij,  Ox/Red  (mV)  ( m V vs  ( m V vs  SHE)  SHE)  7 a-bromoacetyl-10methylisoalloxazine  Thr8Cys cytochrome c  298  -  -  -73  55  6.57  298  -  -  -86  54  7.05  277  -  -  -101  56  284  -  -  -105  58  288  -  -  -107  54  293  -  -  -110  54  298  -  -  -113  53  303  -  -  -115  50  308  -  -  -118  50  7.54  298  -  -  -154  56  8.04  298  -  -  -185  55  8.52  298  -  -  -196  57  9.02  298  -  -  -206  52  9.51  298  -  -  -211  53  9.96  298  -  -  -216  54  10.46  298  -  -  -245  54  10.98  298  -  -  -273  54  11.68  298  -  -  -323  53  5.49  298  293  64  -  -  6.04  298  290  63  -  -  6.51  298  284  66  -  -  7.04  278  286  65  -  -  284  285  70  -  -  287  282  69  -  -  6.11  166  Protein  PH  F°  T(K)  ^ heme  Fe 7Fe 2  Thr8Cys cytochrome c  3 +  A E ^ (mV)  v° flavin  Ox/Red  ( m V vs  ( m V vs  SHE)  SHE)  AEjfcvi,,  (mV)  293  280  66  -  -  298  278  70  -  -  304  276  68  -  -  307  274  67  -  -  313  272  67  -  -  7.53  298  276  66  -  -  8.11  298  274  66  -  -  5.59  298  292  62  -57  108  6.01  298  289  60  -77  110  6.56  298  284  60  -96  114  7.00  278  287  62  -113  110  283  286  60  -116  115  288  283  66  -118  112  293  281  63  -121  108  298  279  60  -123  120  302  277  59  -126  122  307  274  62  -129  106  7.73  298  274  62  -155  112  5.80  298  261  62  -  -  6.00  298  262  63  -  -  6.42  298  262  62  -  -  6.53  298  260  60  -  -  7.03  278  272  64  -  -  284  270  64  -  -  7.04  Acflavin modified T h r 8 C y s cytochrome c  His39Cys cytochrome c  167  Protein  pH  F°  T(K)  heme  Fe 7Fe 2  3 +  AE (mV)  h e m e  A E ^  Ox/Red  (mV)  ( m V vs  ( m V vs  SHE)  SHE) H i s 3 9 C y s cytochrome c  ^ flavin  288  265  65  -  -  294  262  63  -  -  298  259  60  -  -  303  255  58  -  -  308  252  58  -  -  7.54  298  255  62  -  -  8.08  298  251  63  -  -  5.49  298  259  60  -19  108  5.77  298  261  60  -55  109  6.01  298  261  62  -63  113  6.54  298  259  63  -91  116  7.04  278  269  64  -102  108  283  265  64  -105  110  288  262  65  -108  107  293  260  63  -110  115  298  257  60  -115  110  303  253  59  -117  108  307  250  60  -120  104  7.86  298  257  62  -140  109  5.73  298  288  63  -  -  6.04  298  287  60  -  -  6.51  298  284  62  -  -  7.00  279  288  64  -  -  283  286  63  -  -  7.03  A c f l a v i n modified H i s 3 9 C y s cytochrome c  A s n 6 2 C y s cytochrome c  168  Protein  pH  F°  T(K)  Fe 7Fe 2  A s n 6 2 C y s cytochrome c  AE  heme 3 +  C O h e m e  (mV)  flavin  Ox/Red  ( m V vs  ( m V vs  SHE)  SHE)  AEfl^ (mV)  288  284  63  -  -  293  281  62  -  -  298  280  60  -  -  303  278  60  -  -  308  276  60  -  -  7.53  298  275  61  -  -  8.05  298  272  62  -  -  5.61  298  286  63  -51  110  5.95  298  286  63  -71  110  6.59  298  282  62  -95  118  7.00  278  288  59  -107  122  283  286  60  -110  108  288  284  59  -113  107  293  282  66  -115  105  298  279  60  -118  110  303  277  58  -121  122  307  275  64  -123  109  7.10  298  278  62  -117  114  7.57  298  274  60  -143  116  5.64  298  287  64  -  -  6.00  298  284  65  -  -  6.42  298  292  63  -  -  7.10  278  284  65  -  -  283  282  66  -  -  7.00  Acflavin modified A s n 6 2 C y s cytochrome c  L e u 8 5 C y s cytochrome c  169  Protein  pH  T(K)  ^ heme  Fe 7Fe 2  L e u 8 5 C y s cytochrome c  3 +  (mV)  ^ flavin  AEfl^  Ox/Red  (mV)  ( m V vs  ( m V vs  SHE)  SHE)  288  280  66  -  -  293  277  64  -  -  298  274  63  -  -  303  272  62  -  -  308  269  63  -  -  7.52  298  268  67  -  -  8.13  298  265  66  -  -  5.66  298  285  66  -59  110  6.06  298  282  65  -74  112  6.50  298  279  63  -91  115  7.00  279  283  59  -104  110  283  281  60  -106  98  288  278  61  -109  110  293  275  62  -112  106  298  272  59  -115  109  304  270  62  -118  111  308  268  62  -121  114  7.01  298  270  64  -115  120  7.67  298  266  60  -153  118  7.10  Acflavin modified L e u 8 5 C y s cytochrome c  170  A P P E N D I X B - Intermolecular rate constants for the reaction of cytochromes c with flavin semiquinones Protein  Flavin  T (K)  [protein] (uM)  horse heart Cytochrome c  Riboflavin  298  10  0.71(3)  20  0.99(3)  30  1.36(4)  40  1.86(4)  50  1.65(5)  283  horse heart Cytochrome c  7-acetyl-10methylisoalloxazine  1.90(4)  293  2.15(6)  298  2.46(6)  303  2.80(8)  308  3.05(9)  298  7cc-bromoacetyl-10methylisoalloxazine  10  0.60(2)  20  1.11(4)  30  2.00(4)  40  2.61(5)  50  2.25(5)  288  2.55(6)  293  2.85(6)  298  3.12(4)  303  3.55(5)  308  4.20(10)  298  171  x 10' (s' ) 3  o b s  288  283  horse heart Cytochrome c  *  10  0.61(5)  20  1.08(9)  30  1.77(8)  40  2.42(6)  1  Protein  Flavin  T(K)  [protein] (uM)  ^xlO-^s- )  horse heart Cytochrome c  7a-bromoacetyl-10methylisoalloxazine  298  50  2.88(6)  Yeast iso-1cytochrome c  7-acetyl-10methyli soall oxazine  298  10  1.01(4)  CC  20  2.06(5)  cc  30  3.08(4)  cc  40  4.11(6)  283  50  3.67(6)  Yeast iso-1cytochrome c Thr8Cys  Yeast iso-1cytochrome c His39Cys  Yeast 750-7cytochrome c Leu85Cys  7-acetyl-10methylisoalloxazine  7-acetyl-10methylisoalloxazine  7-acetyl-10methylisoalloxazine  172  1  288  3.86(7)  293  4.10(12)  298  5.14(16)  303  5.54(19)  308  6.25(18)  298  10  1.22(4)  CC  20  2.03(4)  cc  30  2.96(8)  cc  40  4.04(15)  cc  50  5.13(17)  298  10  0.85(3)  cc  20  1.74(4)  cc  30  3.40(8)  cc  40  4.04(10)  cc  50  4.81(16)  298  10  0.86(6)  cc  20  2.22(6)  Protein  Flavin  T(K)  [protein] (uM)  Yeast iso-1cytochrome c Leu85Cys  7-acetyl-10methylisoalloxazine  298  30  3.25(8)  40  4.30(12)  50  5.60(18)  10  1.06(8)  20  2.04(7)  30  3.14(5)  40  4.11(10)  50  5.29(18)  10  1.16(8)  20  2.19(8)  30  3.40(7)  40  4.45(8)  50  5.57(10)  E. coli cytochrome c  E. coli cytochrome c Asn62Cys  7-acetyl-10methylisoalloxazine  298  7-acetyl-10methylisoalloxazine  298  173  *  x 10" (s ) 3  o b s  1  A P P E N D I X C - Intra-molecular kinetic parameters associated with flavin modified cytochrome c variants. (Experimental error associated with k values ±5%) et  Protein  pH  T(K)  -AG" (eV)  Acflavin modified Thr8Cys cytochrome c  5.16  298  0.337  1.48xl0  5.49  298  0.363  2.03xl0  3  7.62  5.77  298  0.384  2.73xl0  3  7.91  6.56  298  0.403  3.16xl0  3  8.06  7.04  285  0.420  3.34xl0  3  8.11  -  288  -  3.45xl0  3  8.15  -  294  -  3.71xl0  3  8.21  -  298  -  4.41xl0  3  8.39  -  303  -  4.98xl0  3  8.51  -  308  -  5.29xl0  3  8.57  5.56  298  0.302  4.00xl6  6.00  298  0.336  6.94  298  7.00  Acflavin modified His39Cys cytochrome c  Acflavin modified Asn62Cys cytochrome c  3  7.30  2  6.00  6.40xl0  2  6.46  0.382  1.15xl0  3  7.05  284  0.390  8.04xl0  -  288  -  -  293  -  2  6.69  1.16xl0  3  7.05  -  1.18xl0  3  7.07  298  -  1.29xl0  3  7.16  -  304  -  1.32xl0  3  7.18  -  313  -  1.64xl0  3  7.40  7.26  298  0.400  2.17xl0  7.96  298  0.417  5.33  298  5.98  298  174  3  7.68  2.70x10  3  7.90  0.343  1.30xl0  2  4.87  0.384  1.84xl0  2  5.22  Protein  T(K)  pH  -AG  0  In k  M O  et  (eV) Acflavin modified A s n 6 2 C y s cytochrome c  6.98  283  0.411  1.83xl0  2  5.21  6.98  288  0.411  2.00xl0  2  5.30  -  293  -  2.18xl0  2  5.38  -  298  -  2.46xl0  2  5.51  -  303  -  2.71xl0  2  5.60  -  308  -  3.03xl0  2  5.71  7.17  298  0.420  3.61xl0  2  5.89  7.41  298  0.433  2.90xl0  2  5.24  298  0.353  4.40xl0  2  6.08  5.85  298  0.375  5.00xl0  2  6.21  6.69  298  0.401  7.27xl0  2  6.59  7.01  283  0.410  6.11xl0  2  6.42  -  286  -  7.34xl0  2  -  293  -  8.18xl0  2  6.71  -  298  -  8.51xl0  2  6.75  -  303  -  9.55xl0  2  -  308  -  LlOxlO  3  7.38  298  0.425  1.20xl0  3  5.67  Acflavin modified L e u 8 5 C y s cytochrome c  175  6.60  6.86 7.00 7.09  APPENDIX D - Fe(EDTA) 'reduction kinetic data 2  Protein  T(K)  [FefEDTA) -] (mM)  Met80Ala cytochrome c  298  2.9  0.055(21)  a  5.7  0.152(23)  cc  8.6  0.196(10)  cc  11.4  0.259(11)  a  14.3  0.342(22)  a  17.1  0.444(43)  288  20.0  0.281(10)  293  cc  0.402(25)  298  cc  0.512(68)  303  cc  0.670(70)  308  cc  0.937(98)  298  6.4  8.25(8)  CC  8.0  12.5(12)  CC  11.2  14.9(14)  cc  14.4  20.5(18)  cc  17.6  24.6(22)  288  20.0  20.9(20)  293  cc  24.2(24)  298  cc  29.7(27)  303  cc  40.5(30)  308  cc  51.1(34)  298  8.0  0.0128(13)  cc  11.2  0.0162(15)  cc  14.4  0.0215(20)  Met80Ala/Tyr67Phe cytochrome c  Met80Ala/Phe82Ser cytochrome c  2  176  (s ) 1  Protein  T (K)  [Fe(EDTA) "] (mM)  298  17.6  0.0241(25)  288  20.0  0.0128(16)  293  "  0.0200(24)  298  "  0.0272(28)  303  "  0.0310(34)  308  "  0.0406(40)  2  k  (s' ) 1  obs  Met80Ala/Phe82Ser cytochrome c  177  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0088692/manifest

Comment

Related Items