UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The development of the Pseudomonas aeruginosa outer membrane protein OprF as a presentation vector for… Wong, Rebecca Suk Yi 1995

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1995-060845.pdf [ 3.8MB ]
Metadata
JSON: 831-1.0088315.json
JSON-LD: 831-1.0088315-ld.json
RDF/XML (Pretty): 831-1.0088315-rdf.xml
RDF/JSON: 831-1.0088315-rdf.json
Turtle: 831-1.0088315-turtle.txt
N-Triples: 831-1.0088315-rdf-ntriples.txt
Original Record: 831-1.0088315-source.json
Full Text
831-1.0088315-fulltext.txt
Citation
831-1.0088315.ris

Full Text

THE DEVELOPMENT OF THE FSEUDOMONASAERUGINOSA OUTER MEMBRANE PROTEIN OPRF AS A PRESENTATION VECTOR FOR FOREIGN ANTIGENIC DETERMINANTS by REBECCA SUK Yl WONG B.Sc. (Co-op), Simon Fraser University, 1990 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Department of Microbiology and Immunology) We accept this thesis as conforming to tJ required standard  THE UNIVERSITY OF BRITISH COLUMBIA September 1995 © Rebecca Suk Yi Wong, 1995  __________________________  In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department  or  by  his  or  her  representatives.  It  is  understood  that  copying  or  publication of this thesis for financial gain shall not be allowed without my written permission.  (Signature)  Department of  1 c  The University of British Columbia Vancouver, Canada Date  DE-6 (2/88)  ; 2 7 t  ;ft/  (7’7  11  ABSTRACT  A variety of systems have been developed to improve the presentation of foreign antigenic determinants (‘epitopes’) by inserting them in the context of carrier proteins.  The goals of this study were to develop the Pseudomonas  aeruginosa outer membrane protein OprF as a carrier for foreign epitopes and to study the effect of the mode of presentation on the antigenicity of the presented epitope. The model epitope used in this study was the 4-amino acid repeating epitope (NANP) of the circumsporozoite protein of the malaria parasite,  Plasmodium falciparum. Linker-insertion mutagenesis was carried out to create 11 “permissive” sites which allowed the insertion of 4 extra amino acids. Two series of OprF::malarial epitope hybrid proteins, the positional hybrids and the multiplerepeat hybrids, were constructed by inserting oligonucleotides encoding the epitope into the linker-insertion sites of oprF. The effects of the insertion position and the length of the epitope on its antigenicity were studied by ELISA using outer membranes and by whole cell dot blot analysis. It was shown that the antigenicity of the epitope varied when inserted at different positions of OprF, while it increased with the length of the epitope at two of the three insertion positions studied. These data were employed to revise the membrane topology model of OprF and have improved our understanding of the epitopes recognized by the OprF-specific monoclonal antibodies. Generalizations about the influence of surrounding amino acids on the antigenicity of the inserted epitope are proposed. A targeted study of  111  immunogenicity showed that a 19-amino acid malarial epitope was significantly more immunogenic than a 7-amino acid epitope when inserted at an N-terminal insertion site of OprF.  A parallel immunogenicity study of two versions of  glutathione S-transferase (GST) : :malarial epitope fusion proteins demonstrated that neither an 11- nor a 19- amino acid epitope fused to the C-terminus of GST was immunogenic. This study demonstrated for the first time that OprF can be used as a carrier to generate and detect anti-epitope antibodies in immunized  animals and in immunoassays respectively.  iv TABLE OF CONTENTS  ABSTRACT  ii  TABLE OF CONTENTS  iv  LIST OF FIGURES LIST OF TABLES LIST OF ABBREVIATIONS ACKNOWLEDGEMENTS INTRODUCTION 1.  2.  3.  Epitope presentation systems  x xiii xv xvii  1 1  1.1  Introduction  1  1.2  E. coli outer membrane protein presentation systems  1  1.3  Other presentation systems  5  Applications of epitope presentation systems  7  2.1  Vaccines  7  2.2  Immunopurification  8  2.3  Detection and production of anti-peptide antibothes  9  2.4  Construction of random libraries  9  The carrier protein: OprF  10  3.1  Bacterial outer membrane  10  3.2  General structures of porins  11  3.3  OprF  12  V  4.  The model epitope: the malarial epitope 4.1  Life cycle of the malaria causative agent  17  Plasmoclium falciparum  17  The tetrapeptide repeating epitope NANP  17  Factors affecting antigenicity and immunogenicity  20  4.2 5.  6.  17  5.1  Factors affecting antigenicity  20  5.2  Factors affecting immunogenicity  22  Aims of this study  METHODS AND MATERIALS  24 25  1.  Bacterial strains, plasmids and media  25  2.  General recombinant DNA techniques  25  3.  General protein and immunological techniques  28  3.1  SDS-PAGE and immunoblottings  28  3.2  Antibodies  29  3.3  Indirect immunofluorescence labeffing  29  3.4  Trypsin sensitivity assays  31  3.5  Protein assays  32  4.  Construction of pRW3  32  5.  Linker-insertion mutagenesis of oprF  32  5.1  Mutagenesis with kanamycin resistance cassette  32  5.2  Mutagenesis at the Sail site  36  5.3  Determination of linker-insertion sites  36  vi 6.  Construction of OprF::malarial epitope hybrid proteins  .  6.1  Positional hybrids  36  6.2  Multiple-repeat hybrids  39  7.  DNA sequencing  8.  Construction of glutathione S-transferase (GST)::malarial epitope fusion  9.  36  40  proteins  42  Isolation of outer membranes  42  9.1  Triton X-100 extraction  42  9.2  Sucrose gradient centrifugation  42  9.3  Removal of inclusion bodies  44  10. Expression of oprF and oprF derivatives in E. coli  45  10.1  Expression of oprFin different E. coli strains  10.2  Expression of an oprF derivative in different induction conditions  11. Protein purification  45  45 46  11.1  OprF::malanal epitope hybrid proteins  46  11.2  GST::malarial epitope fusion proteins  46  11.3  Extraction from SDS-polyacrylamide gel  47  12. Antigenicity studies  47  12.1  Outer membrane ELISA  47  12.2  Whole cell dot blot analysis  49  12.3  Statistical analyses  49  vii 13. Immunization studies 13.1  Immunization with OprF::MElOaa2l5 and OpF  13.2  Immunization with OprF::MEaa26 multiple-repeat hybrids  50 50  and GST::malarial epitope fusion proteins  50  13.3  Determination of antibody titers  50  13.4  Characterization of antisera by Western immunoblot analysis  51  Chapter one: Construction and characterization of OprF linker mutants  53  RESULTS  1.1  Introduction  53  1.2  Expression of oprF in E. coli  54  1.2.1 Construction of pRW3  54  1.2.2 Expression of oprFin different E. coli host strains  55  1.3  Semi-random linker mutagenesis with a kanamycin cassette  58  1.4  Site-directed mutagenesis at the Sail site  59  1.5  Determination of insertion sites  59  1.6  Expression and cellular localization of linker mutants  61  1.7  Monoclonal antibody reactivities of linker mutants  67  1.8  Membrane configuration of linker mutants in E. coli  69  1.9  1.8.1 Trypsin sensitivity assays  69  1.8.2 Immunofluorescence labeffing  73  Summary  75  viii  Chapter two: Construction, characterization and purification of OprF:: malarial epitope and GST::malarial epitope hybrid proteins  77  2.1  Introduction  77  2.2  Construction of OprF::malarial epitope hybrid proteins  78  2.3  2.4  2.2.1 Positional hybrids  78  2.2.2 Multiple-repeat hybrids  80  Characterization of OprF::malarial epitope hybrid proteins  82  2.3.1 Expression of hybrid proteins  82  2.3.2 Cellular localization of hybrid proteins  84  2.3.3 Surface exposure of the epitope  88  2.3.4 Monoclonal antibody reactivity of hybrid proteins  91  Purification of OprF::malarial epitope hybrid proteins  93  2.4.1 Induction experiments  93  2.4.2 Detergent extractions  95  2.4.3 FPLC purification  98  2.4.4 Purification of inclusion body-contaminated outer membrane preparations 2.5  GST::malarial epitope fusion proteins 2.5.1 Construction and purification of fusion proteins  98 101 101  2.5.2 Binding of fusion proteins with epitope-specific monoclonal antibodies 2.6  Summary  103 103  ix  Chapter three: Study of the effect of mode of presentation on antigenicity and immunogenicity  106  3.1 Introduction  106  3.2 Antigenicity study  107  3.2.1 Approaches  107  3.2.2 Position effect  108  3.2.3 Length effect  113  3.3 Immunogenicity study  119  3.3.1 Immunogenicity of OprF::ME lOaa2 15  121  3.3.2 Immunogenicity of OprF::ME7aa26 and OprF::MEl9aa26..  124  3.3.3 Immunogenicity of GST::ME11 and GST::ME19  128  3.4 Summary  131  DISCUSSION  134  General  134  Linker-insertion mutagenesis  135  Effects of amino acid insertions in OprF  136  Membrane topology of OprF  140  Binding epitopes of OprF-specific monoclonal antibodies  144  Antigenicity and mode of presentation  147  Immunogenicity  151  REFERENCES  159  x LIST OF FIGURES  Figure 1.  Schematic diagram of the p-barrel structure of a porin  13  Figure 2.  Proposed membrane topolopy model of OprF  15  Figure 3.  The life cycle of Plasmodium falciparum  18  Figure 4.  Stereo drawings of two of the predicted structures of the 6 peptide (NANP)  21  Figure 5.  Construction of pRW3  33  Figure 6.  Schematic representation of semi-random linker-mutagenesis with a kanamycin resistance cassette  Figure 7.  34  Nucleotide and encoded amino acid sequences of the oligonucleotides used for the construction of OprF::malarial epitope hybrid protein  37  Figure 8.  Construction of GST::malarial epitope fusion proteins  43  Figure 9.  Expression of oprF in different E. coli host strains  56  Figure 10. Restriction mapping of linker-insertion sites  60  Figure 11. Cellular localization of OprF linker mutants  65  Figure 12. Expression of OprF linker mutants  66  Figure 13. Tryp sin sensitivity of linker mutants in outer membranes  71  Figure 14. Expression of OprF::malarial epitope positional hybrids  83  Figure 15. Cellular localization of OprF::malarial epitope  positional hybrids  85  xi Figure 16. Expression of OprF::malarial epitope multiple-repeat hybrids..  87  Figure 17. Presence of inclusion bodies in outer membrane samples  89  Figure 18. Surface exposure of the malarial epitope  90  Figure 19. Western immunoblots of OprF::malarial epitope multiple-repeat hybrids  94  Figure 20. Expression of an oprF derivative in different induction conditions Figure 21. Purification of OprF::malarial epitope hybrid proteins  96 97  Figure 22. FPLC profile of a MonoQ column separation of the octyl POE/EDTA soluble OprF hybrid expressed by pRW3O7. 1M  99  Figure 23. Removal of inclusion bodies from outer membrane preparations by octyl-POE extraction Figure 24. Purification of GST::malarial epitope fusion proteins  100 102  Figure 25. Binding of GST::malarial epitope fusion proteins with epitope-specffic monoclonal antibodies  104  Figure 26. Binding of an OprF-specffic polyclonal serum and the malarial epitope-specific mAb pf2A.10 with OprF and OprF::malarial epitope hybrid  109  Figure 27. Effect of insertion position on the antigenicity of the malarial epitope  111  Figure 28. Effect of insertion of multiple copies of the malarial epitope on 213 of OprF antigenicity at insertion sites aa 26 and aa  114  xii Figure 29. Effect of the length of the epitope on its antigenicity at insertion site aa 26 of OprF  116  Figure 30. Effect of the length of the epitope on its antigenicity at insertion site aa’ 96 of OprF  117  Figure 31. Effect of the length of the epitope on its antigenicity at insertion site aa 213 of OprF  118  Figure 32. ELISA titrations of anti-OprF and anti-malarial epitope responses induced in BALBIc mice immunized with OprF and OprF::MElOaa2l5 by ELISA  122  Figure 33. ELISA titrations of anti-OprF and anti-malarial epitope  responses induced in C57BL/6J mice immunized with OprF::ME7aa26 and OprF::MEl9aa26 by ELISA  125  Figure 34. Western immunoblot analysis of the sera from mice  immunized with OprF::ME7aa26 and OprF::MEl9aa26  127  Figure 35. ELISA titrations of anti-GST and anti-malarial epitope  responses induced in C57BL/6J mice immunized with GST::ME11 and GST::ME19  129  Figure 36. Western immunoblot analysis of the sera from mice immunized with GST::ME11 and GST::ME19 Figure 37. Proposed membrane topology model of OprF  130  143  xlii  LIST OF TABLES  Table I.  Examples of epitope presentation systems  Table II.  Bacterial strains and plasmids  26  Table III.  OprF epitopes recognized by monoclonal antibodies  30  Table IV.  Summary of insertion sites of 11 linker-insertion mutants and one site-directed insertion mutant  Table V.  2  62  Summary of six of the deletion mutants isolated during linkerinsertion mutagenesis  63  Table VI.  Summary of monoclonal antibody reactivity of linker mutants 68  Table VII.  Summary of trypsin sensitivity assays of linker mutants in E. coli outer membranes, DH5ci and C386 whole cells  Table VIII.  72  Results from indirect immunofluorescence labelling of F. coli C386 cells expressing OprF linker mutants  74  Table IX.  Summary of OprF::malarial epitope positional hybrids  79  Table X.  Summary of OprF::malarial epitope multiple-repeat hybrids..  81  Table XI.  Summary of monoclonal antibody reactivity of OprF::malarial epitope positional hybrids  Table XII.  Summary of antigenicity of the malarial epitope in OprF::mai.arial epitope positional hybrids  Table XIII.  92  112  Summary of antigenicity of the malarial epitope in OprF::malarial epitope multiple-repeat hybrids  120  xiv Table XIV.  Summary of antibody responses induced in mice immunized with wild type OprF or OprF::MElOaa2l5  Table XV.  Summary of antibody responses induced in mice immunized with OprF::ME7aa26 and OprF::MEl9aa26  Table XVI.  123  126  Summary of antibody responses induced in mice immunized with GST::ME11 and GST::ME19  132  Table XVII. Predicted primary and secondary structures at the insertion sites  149  xv LIST OF ABBREVIATIONS  A  optical density  aa  amino acid position ‘n’  amp  ampicillin  bp  base pair  BSA  bovine serum albumin  CSP  circumsporozoite protein  DEAE  diethylaminoethyl  EDTA  ethylenediamine tetraacetic acid  ELISA  enzyme-linked immunosorbent assay  FCS  fetal calf serum  FMDV  foot-and-mouth disease virus  FPLC  fast protein liquid chromatography  GST  glutathione S-transferase  h  hour(s)  HIV- 1  human immunodeficiency virus-i  IgG  immunoglobulin G  IPTG  isopropyl thio- p-D-galactopanoside  kb  kilobase pair  kDa  kilodalton  Km  kanamycin  xvi LPS  lipopolysaccharides  MSP  merozoite surface protein  mAb  monoclonal antibody  mm  minute(s)  Octyl-POE  octyl-polyoxyethelene  OprF  P. aeruginosa major outer membrane protein F  oprF  gene encoding OprF  PBS  phosphate-buffered saline (0.14 M NaC1/2.7mM KC1/1.47 mM 4 P 2 KH / 2OmM O NaHPO 4 pH7.4)  PVDF  polyvinylidene difluoride  s  second(s)  SDS  sodium dodecyl sulfate  SDS-PAGE  SDS polyacrylamide gel electrophoresis  TGEV  transmissible gastroenteritis coronavirus  wt  wild type  xvii ACKNOWLEDGEMENTS  I am grateful to my supervisor Dr. Robert E.W. Hancock for his guidance and support in this project. I would like to thank the members of my supervisory committee, Drs. Finlay, Kilburn and Spiegelinan, for their time and advice. Special thanks to members of the Department, especially members of the Hancock lab, for their technical assistance, moral support and friendship during my study. Last but not least, I would like to acknowledge my friends and family for their warmth, encouragement and understanding. The financial support of the Natural Sciences and Engineering Research Council and the Medical Research Council of Canada is also gratefully acknowledged.  1 INTRODUCTION  1.  Epitope presentation systems  1.1  Introduction Progress in molecular biology has allowed the engineering of heterologous  proteins that carry components from two or more different host proteins. A variety of systems have been developed to improve the presentation of foreign antigenic determinants (‘epitopes’) by inserting them in the context of carrier proteins. Carrier proteins that have been utilized in these systems include bacterial outer membrane proteins, subunits of bacterial cellular appendages such as pili and flagella, bacterial secreted proteins, ifiamentous phage surface structural proteins,  and viral surface coat proteins. Examples of these epitope presentation systems are listed in Table I.  In general, the incorporation of passenger epitopes into  appropriate sites in these carrier proteins does not seriously interrupt the structure and function of the carriers. As a result, the passenger epitopes are usually targeted to the same cellular compartment as the carrier proteins.  1.2  E. coli outer membrane nrotein yresentation systems It has been found that certain regions, identified as “permissive sites”, of  outer membrane proteins are flexible enough to accommodate extra amino acid sequences without affecting the biogenesis, folding and localization of these  2  Table I.  Examples of epitope presentation systems  Carriers  Epitopes  References  E. coli outer membrane proteins LamB  Hepatitis B virus pre S2 epitope  Charbit et al., 1987  Poliovirus C3 epitope  van der Werfet al., 1990  HIV-1 GP11O epitope  Charbit et al., 1990  HIV- 1 V3 loop  Charbit et al., 1993  Chiamydia MOMP epitope  Hayes et al., 1991  VR 1 and VR2 of class 1 OMP of N. meningitidis  McCarvil et al., 1993  Random peptides  Brown, 1992  Foot-and-mouth disease virus (FMDV) VP1 epitope  Agterberg et al.,1990a  Mycobacterial T-cell epitope  Janssen et al., 1994a  Malarial antigen fragments  Schorr et al., 1991  Antibody fragment  Francisco et al., 1993  FhuA  Poliovirus C3 epitope  Moeck et al., 1994  TraT  Poliovirus C3 epitope  Taylor et al., 1990  PhoE  OmpA  Non-outer membrane proteins  E. coli  p  galactosidase  E. coli MalE  FMDV VP 1 epitope  Broekhuijsen et al., 1986  Random peptides  Lenstra et al., 1992  Poliovirus C3 epitope  Leclerc et al., 1990  HIV- 1 V3 loon  Charbit et al., 1993 To be continued  3  Table I.  Examples of epitope presentation systems (continued)  Non-outer membrane uroteins (continued)  E. coli C1pG  TGEV spike protein S epitope  Der Vartanian et at., 1994  E. coli Pap pili  IgG binding domain of protein A  Steidler et at., 1993  E. coli Pffinbriae  FMDV VP1 epitope  Van Die et at., 1990  E. coli Type 1 fimbriae  Hepatitis B surface antigen epitope  Hedegaard et at., 1989  FMDV VP1 epitope  Hedegaard et at., 1989  Poliovirus C3 epitope  Hedegaard et at., 1989  Cholera toxin epitope  Newton et al., 1989  Hepatitis B surface antigen epitope  Wu et at., 1989  Influenza haemagglutinin epitope  McEwen et at., 1992  P. aeruginosa OprF and  von Specht et at., 1995  prepilin  Salmonella flagellin  Glutathione S transferase  OprI fragments Malaria MSP fragments  Ling et at., 1994  Filamentous nhae coat nroteins pill  pVIII  Malaria CSP repeating epitope  Cruz et at., 1988  Antibody variable domains  McCafferty et al., 1990  Antibody Fab fragments  Barbas et at., 1991  HIV-l Gag p24  Tsunetsugu et at., 1991  HIV-l p17 epitope  Minenkova et at., 1993 To be continued  4  Table I.  Examples of epitope presentation systems (continued)  Gram-nositive system M6 protein (S. pyogenes)  E7 protein of human papifiomavirus  Pozzi et al., 1992  Protein A  Malaria blood-stage antigen  Hansson et al., 1992  Streptococcal albumin binding receptor  Hansson et al., 1992  Influenza A virus neuraminidase  Chloramphenicol acetyltransferase  Percy et al., 1994  Hepatitis B surface antigen  HIV-1 antigenic determinant  Michel et al., 1993  Malaria CSP epitope  Rutgers et al., 1988  Adenovirus hexon  Poliovirus VP1 capsid protein epitope  Crompton et al., 1994  Cowpea mosaic virus  FMDV VP1 epitope  Usha et al., 1993  Human rhinovirus 14  HIV-1 V3 loop  Smith et al., 1994  Poliovirus VP1 protein  Human papifiomavirus epitope  Jenkins et al., 1990  HIV-1 gp4l epitope  Evans et al., 1989  (S. aureus) Viral uroteins  5 proteins. Foreign epitopes that are inserted in the “permissive” surface-exposed loop regions of these outer membrane proteins have been shown to be detectable on the cell surface. The system using the Escherichia coli outer membrane protein LamB as the carrier is one of the most developed. LamB is the porin responsible for maltose uptake and the receptor for A phage (Szmelcman and Hofnung, 1975). The poliovirus C3 epitope has been used as a passenger epitope to identify 11 permissive sites in LamB (Charbit et al., 1991).  Other foreign antigenic  determinants such as the hepatitis B virus preS2, HIV-1 gp 110 or V3 loop epitopes, or a Chiamydia Major Outer Membrane Protein (MOMP) epitope have also been inserted into selected permissive sites of this carrier protein (Charbit et al., 1987; Charbit et al., 1990; Hayes et al., 1991). The phosphate-starvation-inducible porin PhoE of E. coli, has been used as a carrier to present the foot-and-mouth disease virus (FMDV) VP1 epitope and a Mycobacterial T cell epitope (Agterberg et al.,1991a; Janssen et al., 1994a). Likewise, the outer membrane protein OmpA has been employed as a carrier to present malarial antigen fragments on the surface of a Salmonella vaccine strain (Schorr et al., 1991). In most of these studies, the foreign epitopes in the context of the carrier proteins have been shown to be immunogenic in test animals.  1.3  Other oresentation systems Subunits of bacterial cellular appendages such as flagella and pu  generally contain variable regions that allow the insertion of foreign amino acid  6 sequences. A number of viral epitopes have been inserted into the subunits of these appendages and are found to be incorporated into the corresponding structures. Epitopes have also been fused to the periplasmic proteins MalE and j3galactosidase, where the immunogenicity of the inserted epitopes has been reported (Leclerc et al., 1990; Charbit et al., 1993; Broekhuijsen et al., 1986). In addition to these E. coli proteins, the Salmonella flagellin has been used to express epitopes from Cholera toxin, hepatitis B surface antigen and influenza haemagglutinin (Newton et al., 1989; Wu et al., 1989; McEwen et al., 1992). The vaccine potential of an attenuated vaccine strain of Salmonella expressing a recombinant flageffin has been demonstrated. A phage display system has also been developed to express foreign genetic information in the context of the bacteriophage structural surface proteins. Both the major coat protein pVIII and the minor coat protein p111 of the filamentous phage have been used to display various foreign epitopes (see Scott and Craig, 1994 for review). Furthermore, the potential of gram-positive bacterial surface proteins as carriers to present foreign epitopes on the surface of gram-positive bacteria has been investigated (Pozzi et al., 1992; Hansson et al., 1992). Another major category of these epitope presentation systems involves the use of viral coat proteins as carriers (Pable I). A similar repertoire of foreign epitopes has been inserted into the antigenic regions of these coat proteins and the vaccine potentials of some of these  systems have been studied. The system using glutathione S-transferase (GST) as the carrier protein  7 deserves a special mention because it was also used in this study. The protein carrier was originally identified in Schistosomajaponicum (Smith et al., 1986) and can be expressed as an active, soluble protein in E. coli (Smith et al., 1988). This protein is a commonly used affinity tag for the purification of fusion proteins. The affinity of GST for reduced glutathione allows the purification of soluble GST fusion proteins by adsorption to glutathione beads and subsequent desorption using free reduced glutathione (Smith and Johnson, 1988). Due to the ease of purification, GST has also been used as a carrier to induce immune response against small peptides or antigenic fragments (e.g., Ling et al., 1994; von Specht et al., 1995).  2.  Applications of epitope presentation systems  2.1  Vaccines  Recombinant live bacterial vaccines consist of attenuated strains of enteric bacteria expressing heterologous peptides derived from pathogenic agents. It has been reported that when intact cells are used as immunogens, the inserted epitope must protrude sufficiently from the outer membrane to stimulate an antibody response (Leclerc et al., 1991). Therefore, the insertion of the peptide within the surface-exposed loop of an outer membrane protein carrier is likely to facilitate the immunogenicity of the peptide. Moreover, the surface exposure of the inserted epitope may be advantageous because most of the strongly antigenic regions of outer membrane proteins reside in the surface-exposed loops; hence, the  8 location of the inserted epitope in these regions may enhance its interaction with B cells. Furthermore, the association of the peptide with surface moieties such as lipopolysaccharides (LPS) may provide an adjuvant effect to promote the immunogenicity of the peptide. The attenuated strains of Salmonella or E. coli can colonize the intestinal tract without causing infection to the host, and hence can provide a refuge for the recombinant protein so that it can persist to elicit a more lasting immune response. In these situations, the surface exposure of the inserted epitope may be beneficial for the targeting of the epitope to the gut-associated lymphoid tissues.  2.2  Immunopurification The affinity purification of antigens or antibodies usually requires one of  the ligands to be in an immobilized form. Traditionally, this involves the large scale purification of these molecules, followed by covalent linkage of the proteins to a solid-phase matrix. If the binding epitopes in these protein antigens have been identified, these epitopes can be inserted into an outer membrane protein carrier  and expressed on the cell surface of bacteria. The resultant recombinant bacteria thus represent a source of readfly available whole cell affinity adsorbent. The use of such a system can not only circumvent the necessity for large scale purification of the protein and the subsequent chemical linkage of the protein to a solid matrix,  and hence provide a more time and cost efficient alternative for the preparation of reagents for affinity purification.  9  2.3  Detection and production of anti-peptide antibodies Some diseases can be diagnosed by the presence of specific antibodies in  the patient’s serum. These antibodies are often directed against peptide antigens associated with the pathogens. If the peptide(s) that are reactive with these antisera are identified, then oligonucleotides encoding the peptide(s) can be genetically inserted into the DNA sequences of the carrier protein so as to express the peptide in the context of the carrier protein. Since chemically-synthesized peptides often do not bind to antibodies efficiently by themselves, this method is likely to improve the presentation of the peptide(s) for interaction with the respective antibodies. On the other hand, the peptide/carrier hybrid can also be used as an immunogen to raise anti-peptide antibodies. In this case the carrier protein is likely to provide a T cell epitope which is required for an effective antibody response, thus circumventing the need to synthesize the peptide chemically and then link it to a carrier protein. Combining these two applications, it has been demonstrated that the LamB and MalE epitope presentation systems can be used in a complementary fashion to induce and detect anti-peptide antibodies without the use of chemically synthesized peptides (Martineau et al., 1991).  2.4  Construction of random libraries Another application of epitope presentation systems is for the  construction of random peptide libraries. These libraries can be used for the  10 identification of epitopes or ‘mimotope& (antigenic sequences that mimic epitopes) that bind to specific antibodies. Random libraries using phage pill protein,  p  galactosidase and rhinovirus as carriers have been constructed. These libraries, expressing 6- to 15- residue random peptides encoded by the inserted degenerate oligonucleotides, have been used to successfully identify linear and conformational epitopes recognized by specific antibodies (Stoute et al., 1995; Lenstra et al., 1992; Smith et al., 1994). Likewise, random peptide libraries can also be used to identify substrate binding or adhesion motifs. For example, the screening of a LamB random peptide library has led to the successful identification of an iron-oxide adhesion domain (Brown, 1992). On the other hand, these vectors can also be used to express combinatorial antibody libraries which have shown potential for the identification of useful antigen binding domains (McCafferty et al., 1990; Barbas  et al., 1991; Francisco et al., 1993). The number of applications of the random library approach is likely to increase upon further study. Future advances in this area may lead to powerful applications in the area of drug design and to the development of diagnostic markers and vaccines.  3.  The carrier protein: OprF  3.1  Bacterial outer membrane The cell envelope of gram-negative bacteria is composed of an inner or  cytoplasmic membrane and an outer membrane, separated by the peptidoglycan  11 layer and periplasm. Unlike the cytoplasmic membrane, the outer membrane is an asymmetric bilayer containing lipopolysaccharides on the outer leaflet and phospholipids or lipids in the inner monolayer. The outer membrane of gramnegative bacteria represents the primary barrier between the cell and its environment.  Proteins associated with or embedded in the outer membrane  perform a variety of cellular functions, including nutrient uptake, receptor activity  and the maintenance of structural integrity. In addition, the outer membrane also functions as a permeability barrier to exclude the entry of harmful substances such as destructive enzymes and detergents, and it limits the passage of antibiotics. The high level of antibiotic resistance in P. aeruginosa, for instance, is attributed in part to the low permeability of the outer membrane (Nakae, 1995).  3.2  General structures of norms Porins are outer membrane proteins that form transmembrane water-  filled channels which allow the uptake of small hydrophilic molecules. According to their substrate specificity, porins can be divided into two functional classes. General or non-specific porins such as OmpF and OmpC in E. coli allow the general diffusion of water-soluble molecules smaller than the exclusion limit of the channels (Nikaido and Vaara, 1987). Specific porins such as the P. aeruginosa OprP and E. coli LamB proteins have specffic binding sites for the uptake of phosphate ions and maltose respectively (Hancock and Benz, 1986; Szmelcman and Hofnung, 1975). Unlike other membrane proteins which have membrane-spanning  12 cc-helical segments, porins have short amphipathic stretches of residues that traverse the outer membrane in p-sheet structure. To date, crystal structures of four porins have been resolved by X-ray diffraction. These porins include the  Rhodobacter capsulatus porin, the E. coli general porin OmpF, the phosphatestarvation-inducible porin PhoE and the maltoporin LamB (Weiss et al., 1991; Cowan et al., 1992; Schirmer et al., 1995). All of these established structures indicate that these proteins have p-barrel structures comprised of transmembrane anti-parallel p-sheet segments of 7-14 amino acids in length. The p-strands fold back and form a barrel structure which constitutes the framework of the channel. The structures of the B. capsulatus porin, OmpF and PhoE contain 16 p-strands while that of LamB contains 18 p-strands. The neighbouring strands are joined by long cell surface loops and small periplasmic turns (Cowan et al. 1992; Fig. 1). A common feature of these porins is that at least one of the surface loops folds back into the centre of the channel to form an eyelet region that constricts the size of the channel.  3.3  OvrF OprF is the major outer membrane protein ofF. aeruginosa and is present  5 copies per cell (Angus et al., 1982). The protein is 325 amino acids in about 2x10 in length and has an apparent molecular mass of 35 kDa. Circular clichroism data revealed that OprF has 62% a-sheet structure, which is consistent with the predominance of n-sheet structure in the other outer membrane proteins (Siehnel  13  L6 L5  v”  L8  \‘  \L3  \\\\\J/ L? j  /5  rwAc  I  T3L)  Q  r 2 T Ti  Figure 1,  Schematic diagram of the -barre1 structure of a porin. Thick arrows represent transmembrane n-strands; L, surface loops; T, periplasmic turns; N, N-terminus; C, 0-terminus. Reproduced with permission from Cowan et aL, 1992.  14  et al., 1990). Heat treatment of OprF increases the apparent molecular mass of the protein as monitored by SDS-PAGE, indicating the presence of a compact p-sheet structure (Siehnel et al., 1990). The amino acid sequence of OprF contains four cysteine residues, and the mobility of the protein on SDS-PAGE is modifiable by treatment with 2-mercaptoethanol (Hancock and Carey, 1979). These findings suggested that the cysteine residues are involved in disulphide bond formation. A number of approaches have been used to study and predict the membrane topology of OprF. These approaches include the prediction of secondary structures by computer programs, the comparison of amino acid sequences with other outer membrane proteins, TnFhOA mutagenesis, oprF gene deletion analysis, and linker- and epitope-insertion mutagenesis (described in this study). The data generated from these studies have proven to be of use in confirming and refining the working model of OprF membrane topology. One of the most recent topology models of OprF is shown in Figure 2. The primary amino acid sequence of OprF is distinct from the classical trimeric porins such as the E. coli OmpF, OmpC and PhoE porins (Duchene et al., 1988). However, OprF shares strong C-terminal homology with the OmpA-related outer membrane proteins (Duchene et al., 1988; Woodruff and Hancock 1989) as well as several proteins from unrelated species including the B. sub tilis MotA (De Mot and Vanderleyden, 1994). The highly conserved C-terminal motif in these proteins has been proposed to share a common role in peptidoglycan association (De Mot and Vanderleyden, 1994).  15  ‘V.. NT. V A P-T.  RT 0 K  ETC N Y K T K G R F1 I HI  1•fl  ri i, jFl[l 1 C  v  Ii  N  0 1 1G1 l H l NI I] E’ I TI Gil SI ‘y’l LI I I L I A’  1Li’  :; : L  C C S I  I  1 E  W u  D T CL ‘(F  Figure 2.  A  H  N T  S 0  N  I N Q H A L C A S v P  R L C T pVC  S Q G R Q Q A T M A N I G AG L K Y Y F  Q-KP N ,N-DV.’.G 0 RN DGD ‘,DP GS K E Hb-S.PF1  v T T s T S  E  C  H T D p 5 V c C Q T F; A GI D E’ iK I E Y I IQIIWIIAIIVIIMIA 1 I VI IF I I V 161 I DI’ Al I EI RvI AD ILl C L ISI N 1 A L’ 1 I A I K K vi AK I D I K I F’ I Fl IA I E N R K I Di F N GG E N 0 T E K K S KV  ru r1 I I  I  W  ri  I I oh  I I I  I  I  I I °I I LfJ  I  Lis  E  R C  I l r—i  çi I Li  I  R IVIIGIIAEI N’ I El Al Al  Y  I  I viiI TAI  IAI A I L.!I L_Xi  I N Ii  Vi DR  I  VA N  VEI  E  s  R P  RLi  Proposed membrane topolopy model of OprF. The top of this model is proposed to face the exterior of the cell. The transmembrane p strands are indicated by rectangular boxes. Reproduced with permission from Siehnel et at. (1990).  16 OprF serves a structural role in maintaining the cell shape and cell wall integrity (Gotoh et al., 1989; Woodruff and Hancock, 1989).  It has been  demonstrated that OprF can complement the cell shape defect in an E. coli OmpA deficient mutant (Woodruff and Hancock, 1989). It has also been reported that OprF is required for the growth of P. aeruginosa in low osmolarity medium (Nicas and Hancock, 1983).  In addition to its structural role, OprF also functions as a  porm which was proposed to be responsible for the molecular mass exclusion limit of 3000 to 9000 daltons through the outer membrane ofF. aeruginosa (Hancock and Nikaido, 1978; Hancock et al., 1979). However, other model membrane studies reported that OprF only forms small channels and that the exclusion limit of the  P. aeruginosa outer membrane is too low for the penetration of disaccharides (342 daltons) (Caulcott et al., 1984, Yoneyama and Nakae, 1986). More recent studies have shown quite conclusively that OprF forms channels that allow the diffusion of substrates of at least the size of tetrasaccharides in both model membrane  (Nikaido et al., 1991) and intact cell (Beffido et al., 1992) experiments. One possible explanation to this paradox is that OprF forms channels of two different pore sizes  (Woodruff et al., 1986). In vivo, only a small portion of OprF form the large pores, and hence contributes to the low outer membrane permeability of P. aeruginosa. Purified OprF has been shown to be a B cell mitogen (Chen et al., 1980). Immunizing animals with purified or partially purified OprF preparations protects the animals from subsequent challenge with P. aeruginosa in various models. These findings suggested that OprF is immunogenic and a potential candidate for  17  a P. aeruginosa vaccine (Gilleland et al., 1984; Matthews-Greer and Gilleland, 1987; Gifieland, et aL, 1988).  4.  The model epitope: the malarial epitope  4.1  The life cycle of the malaria causative aaent: Plasmodium falcivarum Malaria is a parasitic disease that afflicts hundreds of millions of people  in a broad tropical band around the world. The disease is spread by Anopheles mosquitos infected with the protozoan parasite Plasmodium falciparum. The malaria parasite has a complex life cycle involving intracellular and extracellular stages in both the human host and the mosquito vector. The stage that infects man, the sporozoite, is present in the salivary gland of the mosquito and injected into the victim’s bloodstream when the mosquito takes a blood meal. The sporozoite then finds its way to a liver cell, where it undergoes a series of transformations and is released into the blood stream of the victim as merozoite, which is the blood stage of the parasite. Each merozoite then invades a red blood cell and multiplies. Some merozoites become male and female gametocytes, which are then taken up by a mosquito. After further transformations, sporozoites appear in the mosquito’s salivary gland and are ready for another infective cycle (Fig. 3).  4.2  The tetraieptide reneatin etitone NANP The circumsporozoite protein (CSP) is the major surface antigen of the  18  zoites Oocyst Qokinete Zygote Gamete  )  o(  Blood  In mosquito gut  Figure 3.  The life cycle of Plasinodium falciparum. Reproduced with permission from Fig. 83-3, p. 1037. Medical microbiology. S. Baron (ed.), Churchifi Livingstone Publishing Co..  19  sporozoite stage of the parasite. The central portion of the protein contains 37 tandem repeats of the tetrapeptide Asn-Ala-Asn-Pro (NANP), with 4 interspersed Asn-Val-Asp-Pro (NVDP) variants (Dame et aL, 1984). It has been reported that the repetitive sequence encompasses the immunodominant region of the protein and antibodies raised against this region are potent inhibitors of invasion and of the development of sporozoites in cultured hepatocytes (Young et al., 1985; Zavala  et aL, 1985). Thus, the central tandem repeat region of CSP has engendered considerable interest as a potential candidate for a malaria vaccine. Both the whole CSP and the tandem repeat portion of the protein have been presented by carrier  proteins such as the surface antigen of hepatitis B virus (Rutgers et al., 1988) and the pITT protein of ifiamentous phage (Cruz et al., 1988). It has been documented that in mice the repeat (NANP)> 2 can only be recognized as a T cell epitope by animals with a H2b background (Good et al., 1986). In view of this, identified T cell epitopes have been used in conjunction with the NANP repeating epitope in order to stimulate an anti-NANP response (Good et al., 1987). The incorporation of the synthetic NANP peptides as multiple antigen peptide (MAP) has also been shown to be able to overcome the genetic restriction in non-responsive animals (Pessi et al., 1991; Carvo-Calle et al., 1993). Due to the intense medical interest in the use of CSP as a component in a malaria vaccine, knowledge of the conformation of the repeating epitope comprising the immunodominant region of the protein will be useful in the design of an effective molecule. Various methods have been used to predict the three-  20 dimensional structure of the repeating tetrapeptide and different conclusions have been drawn. Theoretical investigation using energy minimization and molecular dynamics methods indicated that a right-handed helical conformation is likely to be adopted in aqueous solutions while a left-handed helical conformation should be favoured in non-polar environment (Gibson and Scheraga, 1986; Fig. 4). A similar study suggested that the most stable structure of the repeating tetrapeptide is a right-handed helix with 12 residues per turn (Brooks et al., 1987). However, the Chou-Fasman predictive algorithm indicates a high p-turn content in the synthetic peptide (NANP) 8 (i.e. NANP repeated eight times).  Circular clichroism  measurements showed that the presence of prolines in these repeats induces an increase in the p-turn content (Fasman et al., 1990). Proton nuclear magnetic resonance revealed that a repeating structural motif is formed by the NPNA (instead of NANP) cadence (Dyson et al., 1990). To date, the X-ray crystallography structure of the CSP or the repeating region has not yet been resolved. The choice of the NANP repeat as the model epitope in this study was based on the simplicity of its repeating pattern, the well-documented immunodoniinance of the epitope, and the availability of epitope-specific antibodies from a collaborator.  5.  Factors affecting antigenicity and immunogenicity  5.1  Factors affecting antieenicitv The antigenicity of a molecule refers to its ability to interact with  21  A  B  Figure 4.  6 Stereo drawings of two of the predicted structures of the (NANP) peptide. A) The left-handed helical conformation. B) The righthanded helical conformation. In both views, the carboxyl terminus is at the top. Reproduced with permission from Gibson and Scheraga, 1986.  22  antibodies. In principle, peptide antigenic determinants can be divided into two structural categories: the continuous epitope, which consists of a contiguous stretch of the amino acid sequence; and the conformational epitope, which is an assembled topographic site consisting of amino acid residues separated in the primary sequence but brought together during the folding of the protein. It is generally believed that the surface accessible regions of a protein usually contain antigenic determinants that can be recognized by the immune system, and thus stimulate the production of specific antibodies (Hopp and Woods, 1981).  Since proteins in  solution tend to fold in a way that exposes the hydrophilic amino acid residues to the surface, amino acid sequences with high local hydrophilicity are quite frequently predicted to have high antibody affinity (Berzofsky, 1985). The overall strength of an antibody-antigen interaction is governed by 3 major factors: the intrinsic affinity of the antibody for the epitope, the valency of the antibody and antigen, and the spatial configuration of the interacting compounds.  With a  monoclonal antibody of defined specificity, it seems logical that the presence of repeating epitopes may increase avidity and hence overall stability. However, the effects of multivalency may also involve spatial configurations that may impose steric constraints on the interactions.  5.2  Factors affecting immunoenicitv Immunogenicity, the ability to elicit an immune response, is determined  by the intrinsic chemical structures of a molecule and by the ability of the host  23 animal to recognize the molecule. The mechanisms of an immune response can be divided into 2 categories: humoral, which mainly involves the production of circulatory antibodies, and cellular, which functions to target specific immune T cells against fungi, intracellular pathogens and cancer cells, etc.. In general, for an antigen to elicit a good antibody response, both a B cell epitope and a T cell epitope are required.  The B cell epitope is recognized by B cell surface receptors to  stimulate the production of antibodies of its own specificity. The T cell epitope, which results from antigen processing, is presented on the surface of an antigen presenting cell or B cell in conjunction with a MHC class II molecule for binding to specific T cell receptor. Clonal expansion of both B cells and T cells can then occur in parallel, leading to the production of specific antibodies by plasma cells. For a small antigen (hapten) which is not likely to encompass a T cell epitope, this epitope can be obtained by conjugating the hapten to a carrier protein. The whole hapten/carrier conjugate can then be used as an immunogen to elicit an anti-hapten antibody response. In addition to the intrinsic properties of a compound, the immunogenicity of the compound also depends on the extrinsic factors such as the processing pathways in antigen presenting cells, the set of MHC molecules available for antigen presentation, the presence of specific T suppressor cells, the delivery system and the route of adminstration, etc. (Gammon et at., 1987; Gregoriadis, 1990; Monaco, 1992).  24 6.  Aims of this study  A number of outer membrane proteins have been developed as carriers for foreign antigenic determinants in different epitope presentation systems. Limited studies have shown that the flanking amino acid residues and the length of the inserted epitope can affect the antigenicity and immunogenicity of the inserted epitope (Agterberg et al., 1990a; Van der Werfet al., 1990; Janssen et al., l994b). In light of these findings, it is conceivable that determining the optimal parameters for epitope presentation would increase the potential utility of these presentation systems. The goals of this study were to develop the F. aeruginosa outer membrane protein OprF as a carrier for foreign antigenic determinants, to employ this protein to study the effect of the mode of presentation on the antigenicity of the presented epitope,  and to perform a limited study correlating antigenicity with  immunogenicity. The “permissiveness” of different regions of OprF to accommodate extra amino acid sequence was first examined by linker-insertion mutagenesis. The feasibility of OprF as a carrier for foreign antigenic determinants was then investigated by using the malarial tetrapeptide repeating epitope NANP as the model epitope. Also, the influence of the insertion position and the length of the inserted epitope on the antigenicity of the epitope was examined by using a series of OprF::malarial epitope hybrid proteins. Finally, this was correlated with the immunogenicity of the epitope presented in different ways in the context of OprF.  25 METHODS AND MATERIALS  1.  Bacterial strains, plasmids and media  The bacterial strains and plasmids used in this study are listed in Table II. Bacterial strains were grown in Luria broth (LB) {1%(w/v) tryptone, 0.5%(wlv) yeast extract, 0.5%(wlv) NaC1} unless otherwise stated.  Strains of C158  background were grown in Luria broth supplemented to a final concentration of 1.7% (w/v) NaC1 and 0.1% (wlv) glucose to suppress the expression of OmpF and LamB respectively. When plasmids were present, media were supplemented with 75 .tg/ml of ampiciilin or with 50 .tg/ml each of ampicillin and kanamycin. All media components were purchased from Difco Laboratories, Detroit, Michigan.  2.  General recombinant DNA techniques  General DNA techniques were performed as described in Ausubel et al.  (1987) and in Sambrook et al. (1989). Competent cells for transformation were prepared using the CaCl 2 method (Hanahan, 1983). DNA fragments were isolated either by elution from preparative agarose gel onto DEAE paper (Schleicher & Schuell) or by using the GENECLEAN kit (BlO 101 Inc. La Jolla, CA). Restriction enzymes and DNA modifying enzymes were purchased from Bethesda Research Laboratories (BRL, Burlington Canada) or Boehringer Mannheim (Mannheim,  aroA ilv met his purE4lpro cyc-l xyll lacY29 rpsL97 tsx63 ompA ompC lpp ompA tsx ara-14 leuB6 azi-6 lacYl proCl4 tsx-67 A(ompTfepC)266 entA4O3, A trpE38 rfbDl rpsL 109 xyl-5 mtl-1 thi-1 F’ 8OdlacZAM15 A(1acZYA-argF)U169 deoR recAl endAl hsdR17(r, mj) supE44 A gyrA96 thi-1 relAl[F’ proAB lacIqZAMl5zzf::Tn5[Km9  C158  C386  C466  C443 (DH5F’IQ)  To be continued  Lightfoot & Lam, 1991  LPS A- B-, same as rd 7513 in reference  11692 ,  Hancock & Carey, 1979  PAO1 Cm’ prototroph  BRL  Elish et al., 1988  Sonntag et al., 1983  Foulds & Chai, 1979  Hanahan, 1983  Source and/or reference  H103  P. aeruginosa  F’ 8OdlacZM15 (lacZYA-argF)U169 deoR recAl endAl hsdR17(r, mK) supE44 A gyrA9G thi-1 relAl  Genotype, phenotype, or relevant properties  DH5F’  E. coli  Strain or plasmid  Table II. Bacterial strains and plasmids  Hancock lab This study  This study Pharmacia  pTZ18R with a 4.5 kb insert carrying 2 separate fragments of oprF. pTZ 19R with a 4.8 kb Hindill IEcoRI insert carrying the entire oprF in one continuous fragment. pTZ19R with a 1.47 kb HindIII/KpnI insert carrying the entire oprF pUC type plasmid with a drug-resistance marker from Th903, jr and flpr glutathione S-transferase fusion protein expression vector  pHJ13  pRW1  pRW3  pUC4KAPA  pGEX- iN  Pharmacia  Pharmacia  Source and]or reference  cloning vector, Ampr  Genotype, phenotype, or relevant properties  pTZ 18R/19R  Plasmids  Strain or plasmid  Table II. Bacterial strains and plasmids (continued)  28 Germany).  Oligonucleotides were synthesized on an Applied Biosystems  Incorporated (ABI, Foster City, CA) 392 DNAIRNA synthesizer according to manufacturer’s instructions. Oligonucleotides were purified by passing through a Sep-Pak C 18 cartridge (Waters, Division of IVliffipore) and eluting with 20% acetonitrile followed by ethanol precipitation. For oligonucleotides used in ligations, the sense and antisense strands of each set were annealed by heating an equal amount of each strand (100 jiM) in 2 mM MgC1 /50 mM NaC1/20 mM Tris-HC1 2 pH7.5 at 90°C for 15 mm, followed by gradual cooling to 23°C.  3.  General protein and immunological techniques  3.1  SDS-PAGE and immunob1ottins SDS-PAGE procedures were performed as described in Hancock and  Carey (1979). Colony and Western immunoblotting procedures were as described in Mutharia and Hancock (1985). The percentage of acrylamide used was 11% unless otherwise stated. The amount of proteins loaded per lane was normalized by protein assays (described in section 3.5). For some Western immunoblots, polyvinylidene difluoride (PVDF) membrane (Millipore Corporation, Bedford, MA) was used and immunodetection was done without blocking (Mansfield, 1994). Briefly, the PVDF membrane was air-dried completely after protein transfer, followed by incubation with primary antibody for 1 h at 37°C. After 2 x 10 s washing in PBS, secondary antibody was added and incubated for 30 mm at 37°C,  29 followed by 2 x 10 s washing in PBS and colour development.  3.2  Antibodies The OprF-specific mAbs and polyclonal serum used in this study were as  described by Finnen et al. (1992). The epitopes recognized by the OprF-specific  mAbs have been delineated by Rawling et al. (1995) and are summarized in Table III. The isolation of the malarial epitope-specific mAbs pf2A. 10 and pf5A4. 1 were described by Wirtz et al. (1987).  3.3  Indirect immunofluorescence labe11in Immunofluorescence labeffing was performed as follows.  Overnight  cultures of strains containing the specified plasmids were harvested and washed twice in PBS. Slides were coated with poly-L-lysine (Sigma Chemical Co., St. Louis, Mo; average MW’—’25,000) by flooding with poly-L-lysine solution (1 mg/ml) in a moist chamber for 15-20 mm and then rinsing thoroughly with distified water. Samples of washed cells were smeared onto the poly-L-lysine coated slides and allowed to air dry briefly. Slides were then incubated with an OprF-specific mAb or a malarial epitope-specific mAb (both at 1/100 dilution) in PBS containing 1% fetal calf serum (FCS) for 30 mm  at 23°C. After washing with excess PBS, slides  were incubated with fluorescein isothiocyanate-conjugated goat anti-mouse IgG (BRL) at 1/20 dilution in PBS/1% FCS for 30 mm at 23°C. Following PBS washing, one drop of mounting medium (Sigma) was added to the slides and the cells were  30  Table III. OprF epitopes recognized by monoclonal antibodiesa. Monoclonal antibody  a  Amino acid positions of epitope  Type of epitope  Surface exposure of epitope<  MA7-1  55-62  linear  +  MA7-2  237-244  linear  +1-  MA7-3  188-230  conformationaib  +  MA7-4  188-2 78  conformational  +  MA7-5  188-2 78  conformational  +  MA7-6  198-240  conformational  +  MA7-7  188-278  conformational  +  MA7-8  152-2 10  conformational  +  MA4-4  152-2 10  conformational  +  1VIA5-8  307-3 14  linear  +  Data are summarized from Rawling et al., 1995 Delined by non-reactivity with overlapping 8-amino acid peptides synthesized on pins. +, surface-exposed; +1-, surface exposure only in an LPS altered rough strain.  b  31  examined under a Zeiss microscope fitted with a halogen lamp, a condenser and filters for fluorescence microscopy at 525 nm for emission of fluorescein isothiocyanate.  3.4  Trvusin sensitivity assays  E. coli C386-derived strains containing different pRW3-derived plasmids were grown in Luria broth supplemented with Amp (75 i.gIml) to an A of 0.8. Samples of 1.5 ml of the cultures were harvested and washed twice with 20 mM Tris-HC1 pH 7.4 containing 5 mM MgC1 , and then resuspended in 500 jil of the 2 same buffer. Trypsin (TPCK treated, Sigma) was added to a final concentration of 0.1 mg/ml of cell resuspension, followed by incubation at 37°C for 60 mm. Un treated samples were incubated in the same conditions, except that trypsin was omitted. Proteolysis was stopped by heating at 88°C for 10 mm in solubilization buffer (2% SDS, 10% glycerol, 62.5mM Tris-HC1 pH6.8). OprF in outer membrane samples was digested at a trypsin concentration of 0.1 mg/ml. The reactions were carried out as described above.  In both cases, the trypsinized samples were  analyzed by SDS-PAGE and Western immunoblotting with the specified monoclonal antibodies. As controls, the cleavage of OprF in P. aeruginosa intact cells to a 28 kDa core fragment and the complete cleavage of bovine serum albumin by trypsin to low molecular weight peptides were demonstrated.  32 3.5  Protein assays The modified Lowry assay was performed as described by Sandermann  and Strominger (1972). The bicinchoniriic acid (BCA) protein assay was performed in 96-well microtiter plates with a sample volume of 10 jt1 and the addition of 200 iil of BCA reagent (Sigma). The plates were then incubated at 37°C for 30 mm and the A 550 was determined with a BioRad model 3550 ELISA microplate reader.  4.  Construction of pRW3  Figure 5 outlines the subcloning of oprF. The 4.5 kb Smal fragment containing the 3’ end of oprF was excised from pHJ13 and re-ligated in the opposite orientation into the vector to construct pRW1, so that the coding region of oprF was in one continuous fragment. The 1.47 kb HindIII/KpnI partial fragment containing the entire oprF gene from pRW1 was then subcloned into the vector pTZ19R to obtain pRW3.  5.  Linker-insertion mutagenesis of oprF  5.1  Mutapenesis with kanamycin resistance cassette Figure 6 shows a schematic diagram of the procedures. The plasmid  pRW3 was linearized separately by partial digestion with restriction enzymes: RsaI, HaeIII, ThaI or AluI (Boehringer Mannheim), all of which leave blunt ends  ___  33 A  pHJI3 KIM  H  pp  s  K  lIE  I  I  I  Smal digeshon and religation  pRWI  KIM H  p  K  ME  p  AiArAi’ subclonmg of 1.47 kb HIK fragment into pTZ19R  pRW3 H  K  \I I—lA7kb  —I  EcoRI Sad KpnI BsmI  B  NaeI fl—on  Miul Sail Asull  \  f  pRW3  oprF BaiI/ NcoI KpnI AatII Eco47—3  —  3000  4274 bps  00Kmp 0 l  2000 P—iac  RindIIJ  00 p 1322-on  4.  Figure 5. Construction of pRW3. A. Schematic diagram of the subcloning of oprF. The thick solid line represents the cloning vector pTZ19R; the hatched box represents the OprF coding region. The arrows under each box indicate the direction of transcription of oprF. H, Hindill; K, KpnI; S, Sail; P, PstI; M, Smal; E, EcoRI. B. Restriction map of pRW3. The position and direction of transcription of oprF and the ampiciliin resistance marker (Amp) are indicated. Abbreviations: fl-on, fi phage origin of replication; pBR322-ori, ColE 1 origin of replication; P-lac, lac promoter; bps,  base pairs.  34  A  H  H  4, GTCGACCTGCAGG  AC )nCCCTGCAGGTC & 4 )nGGGCGTCCAGCTG  CAGCTGGGTC  P  P 1.3kb  B  W OR (OprF .ve)  Linearize with blunt-end enzymes Insert Hind fragment of Km cassette Select for Km resistance —  (OprF +ve) Screen with OprF-specific mAb for loss of OprF reactivity  Cut with PstI and remove Km cassette Religate PstI  Figure 6.  OprF linker mutant with l2bp insert containing PstI site  Schematic representation of semi-random linker-mutagenesis with a kanamycin resistance cassette.  A. The kanamycin resistance cassette used for the linker-insertion mutagenesis. The solid box represents the region that encodes an aminoglycoside 3’phosphotransferase gene conferring kanamycin, neomycin, and G418 resistance. The nucleotide sequences in the flanking regions are specified to indicate the symmetric restriction enzyme sites. H, Hind; P, PstI. B. Procedures for linkerinsertion mutagenesis. The solid and hatched boxes represent the kanamycin resistance cassette and the oprF gene respectively; Km, kanamycin, OprF -ye, non-reactive with OprF-speciflc (C-terminal reactive) mAb MA5-8; OprF +ve, reactive with MA5-8.  35  after digestion. In the cases of AluI and ThaI, partial digestions were performed in the presence of ethidium bromide (20 and 50 jig/mi respectively) to increase the recovery of DNA molecules cleaved at a single site. After partial digestions, the reaction mixtures were resolved by preparative agarose gels and the full sized linear form of the piasmid was isolated by elution onto DEAE paper (Schleicher & Schuell). The four poois of linearized pRW3, each corresponding to a separate restriction enzyme used, were ligated separately with a 1.3 kb HincIl fragment containing the kanamycin resistance cassette from pUC4KAPA. Following ligation  and transformation, cells were plated on Luria agar plates containing 50 jig/mi each of kanamyciri and ampicillin. The doubly resistant colonies were further screened by colony immunoblotting for loss of expression of OprF using the OprF C-terminalspecific mAb MA5-8 (Rawling et al, 1995 and Table III). Piasmid DNA from the clones that did not express OprF were extracted and then digested with PstI, which only recognized sites in the flanking sequences of the kanamycin resistance cassette, and hence cleaved the cassette from the plasmid. Following re-ligation of the PstI digestion mixtures and transformation, recombinants were screened for kanamycin sensitivity and the recovery of immunoreactive OprF by colony immunoblotting using the same OprF-specffic mAb. The OprF expressing (OprF’), kanamycin sensitive (KmS) clones presumably contained mutated forms of pRW3 with a 12 bp insertion at sites originally interrupted by the kanamycin resistance cassette.  36 5.2  Mutaenesis at the Sail site The plasmid pRW3O7 was constructed by inserting a self-hybridizing Sail  adaptor oligonucleotide (5’TCGACCTGCAGG3’) which contained a PstI site into the Sail site corresponding to position 188 (aa’ ) in the mature OprF sequence. As a 88 result, the 4 amino acids DLQV were added after the valine residue at aa’ . 88  5.3  Determination of linker-insertion sites The 12 bp insertion in the linker mutants carried a unique PstI site.  Plasmid DNA was prepared from 100 OprF, Kms clones and the linker-insertion sites were mapped by restriction enzyme digest using double digestions with PstI/HindIII and PstI/SalI, where HindIII and Sail recogiiized unique sites at nucleotide positions -63 and +726 of the oprF gene coding sequence respectively (Duchene et ai., 1988). Clones with the same restriction pattern were grouped and the exact position of insertion was confirmed by DNA sequencing of at least one representative from each group.  6.  Construction of OprF::malarial epitope hybrid proteins  6.1  Positional hybrids Since the linker insertions occurred in different reading frames, three sets  of synthetic oligonucleotides were required to accommodate the three possible reading frames at the PstI sites (Fig. 7A). In the course of cloning, it was realized that  37  A.  Phase 1 A P N N P N N P A N A H G A CCG AAC GCC AAC CCG AAC CCC AAC CCC AAC GCC GGG CAT GCA ACGTGGC TTG CGG TTG GGC TTG CCC TTG GGC TTG CGG CCC GT  Phase 2 N  P  N  A  N  P  N  A  N  P  N  A  C  AC CCG AAC GCC AAC CCG AAC CCC AAC CCG AAC CCA TGC A ACGG CCC TTG CGG TTC CCC TTG CCC TTG GGC TTG CGT  Phase 3 A N N P N A N P N A L V D Q G AAC CCC AAC CCA AAC GCG AAT CCG AAT GCT CTA GAC TTG CA ACGTC TTG CCG TTG GGT TTG CGC TTA CCC TTA CGA CAT CTG A  B.  7-amino acid insert N P N A N P N TCGAAAC CCG AAC GCT AAT CCA AAT TTG GGC TTG CGA TTA GGT TTAGATC  11-amino acid insert N P N A P N A N P N N TCGAAAC CCC AAC GCT AAT CCA AAC CCC AAC CCT AAT TTC GGC TTG CGA TTA GCT TTG CGG TTG CCA TTAGATC  15-amino acid insert N P N P N A A N N P TCGAAAC CCC AAC CCT AAT CCA AAC GCC AAC CCC TTC GGC TTC CGA TTA GGT TTG CGG TTC GGG A N P N N AAT GCA AAT CCC AAT TTA CGT TTA GGC TTAGATC  19-amino acid insert N P P N N A N A N P N TCGAAAT CCA AAC GCC AAC CCG AAC GCA AAC CCC AAT TTA CGT TTC CCC TTG CCC TTG CGT TTG GGG TTA N P N A A N P N CCA AAT CCT AAC CCC AAC CCA AAT CGT TTA GCA TTG CGC TTG CGT TTAGATC  38  Figure 7.  Nucleotide and encoded amino acid sequences of the oligonucleotides used for the construction of OprF::malarial epitope hybrid proteins.  A. The three sets of oligonucleotides used for the construction of the positional hybrids. Each set encodes the malarial epitope sequence in one of the three possible reading frames at the PstI cleavage sites. The PstI compatible ends for the ligation into the PstI sites generated by the linker-insertion mutagenesis procedures are in italics. The unique restriction enzyme sites engineered in the oligonucleotides are underlined (SphI in frames 1 and 2, XbaI in frame 3). B. The four sets of oligonucleotides encoding different lengths of the repeating epitope. All four sets carried XhoI and XbaI sites (in italics) on each end respectively for the ligation into the corresponding sites generated by the PstI adaptors for directional cloning. The amino acid sequences are indicated in one letter code.  39 maintaining the same codon usage in each NANP repeat caused the problem of hairpin loop formation when more than one copy of the insert was ligated in opposite orientation. Therefore, a different codon usage for the NANP repeats was chosen for the Phase 3 oligonucleotides. Each set of the annealed synthetic oligonucleotides encoding the malarial epitope was ligated into the PstI sites of the various oprF linker mutant plasmids. After transformation, the recombinants were screened by colony immunoblotting with the OprF-specific, N-terminus reactive mAb MA7-1 (Rawling et aL, 1995, and Table III) and the malarial epitope-specific mAb pf2A.lO (Wirtz et al., 1987) separately. Plasnnd DNA from transformants that reacted positively with both monoclonal antibothes were extracted and analyzed by restriction analysis and DNA sequencing.  6.2  Multinle-reneat hybrids Three sites of OprF (aa , aa 26 196 and aa ) were chosen for further study of the 213  length effect of the epitope on its antigenicity and immunogenicity.  Hybrid  OprF::malarial epitope plasmid constructs carrying different lengths of the epitope were generated as follows: i) Insertion of PstI adaptors: The three selected sites were of two different reathng frames. To simplify the cloning procedures and the number of oligonucleotides required, two sets of adaptors were synthesized and inserted into the PstI sites of the corresponding linker mutants. The insertion of the adaptors created two unique sites for directional cloning (XbaI and XhoI) and also adjusted the reading frames at the  40  three chosen sites so that only one set of malarial epitope oligonucleotides would be required for all three sites. ii)  Insertion of malarial epitope encoding oligonucleotides: Four sets of  oligonucleotides, representing 7 amino acids (NPNANPN),  11 amino acids  NPN}, 15 amino acids {(NPNA) 2 {(NPNA) NPN} and 19 amino acids {(NPNA) 3 NPN} of 4 the malarial epitope were synthesized (Fig. 7B). The oligonucleotides contained XhoI and XbaI compatible ends and were designed so that the XhoI site would be destroyed after the ligation. Transformants were screened by colony immunoblotting with the malarial epitope-specffic mAb pf2A. 10.  Plasmid DNA from positive clones was  extracted and the incorporation of the oligonucleotides was confirmed by restriction digest analysis. The resultant hybrid proteins were designated as OprF::ME(X)aa(Y), where ME refers to jpa1arial pitope, X refers to the number of amino acids inserted, and Y refers to the amino acid position of the insertion.  7.  DNA sequencing  Automated DNA sequencing was carried out with the Applied Biosystems Incorporated (ART, Foster City, CA.) model 373A DNA sequencing system using the polymerase chain reaction and dye-terminator chemistry as described by the manufacturer’s protocols. Sequence analyses were performed using the ABI 675 DNA sequence editor program. Template DNA was prepared using Qiagen columns  41  (Qiagen Inc., Chatsworth, CA 91311) according to the manufacturer’s protocols. To determine the exact position of the insertion sites of the representative oprF  linker-insertion mutants,  plasmid DNA from the corresponding kanamycin  resistant clones was used as template. The sequencing primers used were 21 mer oligonucleotides  (5’ATGTAACATCAGAGATTTTGA3’  and  5’TATGAGTCAGCAACACCTTCT3’) that hybridized to opposite strands of the kanamycin resistance cassette, approximately 50 bp from the ends of the cassette (Oka et al., 1981). The directions of extension from these primers were outward from the cassette so that the oprF sequences flanking the insertion sites could be identified.  DNA sequencing to determine the number and orientation of the  malarial epitope insert in the oprF::malarial epitope hybrid plasmids was carried out by using primers that hybridized to oprF gene sequences at appropriate  distances upstream of the insertion sites. -  3’)  were:  FP1,  The sequences of the primers(5’  TTAGGCGTTGTCATCGGCTCG 9 ‘ ; 39  FP2,  ; 597 CCGGAACCGGTTGCCGACGTT ; FP3, 577 422 AACATGGCCAACATCGGCGCT 402 FP4,  879  899 ; GAGCGTCGTGCCAACGCCGTT  FP5,  725 (numbers in superscripts indicate the GTCGTACGCGTACAGCTGGACGTG 702 positions of the first and last nucleotides in the oprF gene sequence as described by Duchene et al., 1988).  42 8.  Construction of glutathione S-transferase (GST)::malarial epitope fusion proteins  Two sets of annealed synthetic oligonucleotides, each encoding 11 and 19 amino acids corresponding to the malarial epitope, were ligated into the BainHI and EcoRI sites of the pGEX cloning vector (Fig. 8). Transformants were screened by colony immunoblotting with the malarial epitope-specific mAb pf2A. 10. The resultant fusion proteins, GST: :ME 11 and GST: :ME 19, expressed 11 amino acids NA} and 19 amino acids {P(NANP) 2 {P(NANP) NA} respectively at the C-terminus 4 of glutathione S-transferase (GST).  9.  Isolation of outer membranes  9.1  Triton X- 100 extraction The outer membranes of OprF linker mutants were isolated by selective  Triton X- 100 solubilization of cell envelopes as described by Schnaitman (1971).  9.2  Sucrose gradient centrifuation Overnight cultures (1 L) of C 158-derived strains were harvested and  resuspended in 10 ml of 20% sucrose, 10mM Tris-HC1 pH 8.0. Deoxyribonuclease I (50 jtg/ml) was then added to each cell resuspension, followed by incubation at 23°C for 20 mm.  Cell lysis was achieved by two passages through a French  43  A  EcoRI STOP i’SmaI COdQflSNIfr BamHI Sj26  Ampy- ‘4  /7  tac  Psil j/  ff  pGEX-1 ‘49kb  EcoRV ORI  B  q 1 —i  11 amino acids D P N A N P N A N P N A L Q GAT CCG AAC GCC AAT CCG AAT GCG AAC CCA AAC GCA CAG CTG GC TTG CGG TTA GGC TTA CGC TTG GGT TTG CGT GTC GAC TTAA  19 amino acids D P P P N A N N A N P N A N N GAT CCG AAC GCC AAT CCG AAT GCG AAC CCA AAT GCT AAC CCC AAC GC TTG CGG TTA GGC TTA CGC TTG GGT TTA CGA TTG GGG TTG A N P N A L Q GCA AAT CCT AAC GCA CAG CTG CGT TTA GGA TTG CGT GTC GAC TTAA  Figure 8.  Construction of GST::malarial epitope fusion proteins.  A. Schematic representation of the pGEX-l cloning vector. Abbreviations: Sj26, the gene encoding a 26 kDa glutathione S-transferase (GST); tac, tac promotor; P,irip’ p-lactamase gene; ORI, origin of replication. B. The nucleotide and amino acid sequences of the oligonucleotides encoding the malarial epitope. The oligonucleotides carried BamHI and EcoRI compatible ends (in italics) for threctional cloning into the multiple cloning sites of pGEX- 1. Fig. 8a is reproduced from Smith and Johnson, 1986, with permission.  44 pressure cell at 15,000 psi. The lysed cells were centrifuged at 1,700 x g for 10 mm to remove cell debris. The supernatants were then applied onto a 2-step sucrose gradient {50%/70%(w/v)} and centrifuged at 100,000 x g in a SW28 rotor (Beckman) for at least 6 h at 4°C. The lower band that formed at the interface of the 50% and 70% sucrose layers was collected and the sucrose was diluted with at least two volumes of distilled water, followed by centrifugation at 200,000 x g in a 6OTi rotor (Beckman) for 1 h. The final pellets were resuspended in 1 ml of distilled water. The protein concentration in each sample was determined by a modified Lowry protein assay.  9.3  Removal of inclusion bodies Outer membrane samples containing the series of OprF::malarial epitope  multiple-repeat hybrid proteins at aa 26 were contaminated with inclusion bodies. The membrane bound form of these hybrid proteins was obtained by octyl polyoxyethelene (octyl-POE) extraction. Briefly, the loosely-bound proteins in the preparations were removed by resuspending the outer membrane pellets in 0.5% octyl-POE, followed by incubation at 37°C for 30 mm and centrifugation at 4°C for 15 mm  at 13,000 x g.  The OprF::malarial epitope hybrids were released by  resuspencling the insoluble fractions in 3% octyl-POE, 10mM EDTA, followed by incubation at 37°C for 30 mm and centrifugation in a microfuge at 4°C for 15 mm at 13,000 x g. Extraction with 3% octyl-POE, 10mM EDTA was repeated. The membrane bound form of the proteins was found to be contained in the  45 supernatant.  10.  Expression of oprF and oprF derivatives in E. coil  10.1  Expression of ovrFin different B. coli strains The plasmid pRW3 was transformed into different B. coli host strains by  the CaC1 2 method (Hanahan, 1983). IPTG was added at 1 mM final concentration to mid-log phase cultures and growth was continued at 37°C for another 4 h. Uninduced cells were harvested at the same time as the induced cultures.  Cell  envelopes were prepared by centrifugation of whole cell lysates at 200,000 x g for  1 h. The expression level of oprF was examined by Western immunoblotting of cell envelope samples with the OprF C-terminal-specific mAb MA5-8.  10.2  Exyression of an 0DrF derivative in different induction conditions Fresh LB broth (50 ml in 250 ml flask) was inoculated at 1/100 dilution  with an overnight stationary phase culture of C158 containing pRW3O7. 1M. IPTG, at 0.2 miVi or 1 m]Vl final concentration, was added to cultures either at the time of inoculation or when the cells were at mid-log phase (A “0.5-0.6). IPTG induction was carried out at 30°C or 37°C for 3 h or 16 h as indicated. Outer membranes were prepared using differential Triton X-100 extraction as described in Section 9.1. Expression of OprF: :hybrid protein was examined by Western immunoblotting with an OprF-speciflc mAb.  46  11.  Protein purification  11.1  OyrF::malarial epitone hybrid }Jroteins OprF and OprF::malarial epitope hybrid proteins were purified from  plasmid-containing derivatives of E. coli strain C 158. Outer membrane samples containing OprF or OprF::malarial epitope hybrid proteins were prepared by a 2step sucrose gradient centrifugation as described in Section 9.2. The samples were then extracted sequentially with 0.5% octyl-POE, 3% octyl-POE /50 mM NaC1, and 3% octyl-POE/10 mM EDTA. Extractions were performed by resuspending the insoluble fractions in the detergent solutions, followed by incubation at 37°C for 1 h and centrifugation at 200,000 x g for 1 h. Supernatants from the 3% octyl POE/10 mM EDTA extractions contained predominantly OprF or OprF::malarial epitope hybrid proteins. The detergent-extracted proteins were further purified by FPLC using aji anion exchange column, MonoQ (Pharmacia), and elution with an NaC1 gradient. Column buffer contained 0.5% octyl-POE, 10 mM EDTA, 10 mM Tris-HC1 p118.0. Purified OprF or OprF::malarial epitope hybrid proteins were eluted in the flow through fractions while the contaminants bound to the column.  11.2  GST::malarial enitone fusion uroteins The GST::malarial epitope fusion proteins were purified by affinity  chromatography using glutathione agarose beads as described in Smith and Johnson, 1988. Briefly, the procedures involved breaking of cells using a French-  47 pressure cell, centrifugation to remove cell debris, incubation of the cell supernatant with glutathione agarose beads to allow binding of the GST::malarial epitope fusion protein to the matrix, washing away of non-binding proteins, and elution of the fusion protein with 5-10 mM reduced glutathione. The anti-GST polyclonal serum was kindly provided by Dr. Michael Gold (Department of Microbiology and Immunology, U. of British Columbia).  11.3  Extraction from SDS-uolvacrvlamide gel Protein samples were separated by preparative SDS-PAGE (11%). Bands  of interest were excised and the proteins were eluted into 0.1% SDS, 10mM EDTA, 10mM Tris-HC1 pH8.0 by incubation at 4°C for 16 h. The eluted proteins were quantitated by SDS-PAGE, followed by Coomassie blue staining and measurement of the intensity of the bands by scanning densitometry using a protein  +  dna  Jmageware apparatus (protein + dna Imageware Systems, PDI, NY, U.S.A.). The concentration of the samples was extrapolated from a standard curve obtained from protein samples with known concentrations.  12.  Antigenicity studies  12.1  Outer membrane ELISA Outer membrane samples containing OprF::malarial epitope hybrid  proteins were diluted to various concentrations (from 0.5 to 20 tg/ml) in carbonate  48  buffer (l5iulVl 3 C 2 Na / 35mM O NaHCO /3mM NaN 3 3 pH 9.6). Dilutions of the outer membrane samples (100 jil) were used to coat the bottom of 96 well plates by incubation at 4°C for 16 h. The wells were then washed twice with PBS containing 5 mM MgC1 2 and blocked by incubation with 3% BSAJPBS at 37°C for 1 h. After washing, 100 .tl of primary antibody (1/2000 of rabbit-anti-OprF antiserum or 1/2000 of pfA. 10) was added. After incubation (3 7°C, 1 h) and washing, 100 jil of horseradish peroxidase-conjugated secondary antibody was added to each well (37°C, 1 h). 3,3’5,5’ Tetramethylbenzidine (TMB) (Pierce Chemical Co., USA) was used as a chromogenic substrate and the reactions were stopped after 5-10 mm by the addition of 1 M 4 P0 The A 3 H . 450 readings of the wells were obtained using a BioRad ELISA microplate reader (model 3550) with a 450 nm ifiter. To normalize the expression levels of the hybrid proteins, each index was the ratio of the A 450 readings when pf2A. 10 was used as the primary antibody to the A 450 readings when the OprF-specific polyclonal antibody was used as the primary antibody. For each experiment, a plot of A 450 readings versus the concentrations of coating  antigen was drawn for each antibody, only values that corresponded to the linear portion of the binding curve were used for the calculation of antigenicity indices. Due to the presence of inclusion bodies in the outer membrane samples containing the multiple-repeat hybrids carrying an insertion at aa , the membrane 26 bound protein solubiiized in 3% octyl-POE was used in ELISA. The samples were diluted at least 40 fold in carbonate buffer and the concentration of the detergent in the other samples was adjusted so as to standardize the effect of the detergent  49 on the antigen-antibody interactions in all of the samples.  12.2  Whole cell dot blot analysis lVlid-logarithmic growth phase cells of strain C 158 expressing the hybrid  plasmids were harvested, washed twice with PBS and diluted in PBS to lx 108, , 4x10 7 2x10 , and 8x10 6 5 cells/gl. One t1 of each cell resuspension was spotted onto nitrocellulose filters, and the blotting procedures were performed as described in Mutharia and Hancock (1983). The intensities of the dots were quantitated by densitometry with the protein + dna Imageware (PDI) systems using the Quantity One software. Each antigenicity index was the mean of the ratios of anti-malarial epitope reactivity to anti-OprF reactivity obtained from four sets of dots representing different numbers of cells (8x10 5 to lx 108 cells).  12.3  Statistical analyses The antigenicity indices of the inserted epitope in the positional hybrids  were compared by using F-tests. The differences discussed in the text as significant had p values <0.05. The relationship between the antigenicity and the length of the epitope was analyzed by linear regression. The value of correlation coefficient (r) lies between -1 to +1, where r=0 indicates no linear relationship, r>0 indicates a positive linear relationship (the closer to 1, the stronger the correlation), and r<0 indicates a negative linear relationship.  50  13.  Immunization studies  13.1  Immunization with OnrF::MElOaa2l5 and OprF Two groups of 6-8 week old female BALB/c mice (H2d background) were  immunized subcutaneously with 10 .tg of FPLC-purified OprF or OprF::MElOaa2 15 with TitermaxTM (CytRx Corp., Norcross, Georgia) on days 0 and 14. On day 28, the animals were injected with 2x10 8 cells of heat-killed E. coli expressing the corresponding OprF or OprF::malarial epitope hybrid.  Serum samples were  obtained by tail-bleeding on days 7, 21 and 35. The control group was injected with 100 jil of PBS for all three injections.  13.2  Immunization  with  OirF::MEaa26  multivle-reveat  hybrids  and  GST::malarial eyitoye fusion yroteins Groups of 6-8 week old female C57BL/6J mice  11 ( b 2 ..  background) were  immunized subcutaneously with 20 jig of immunogens on days 0 and 21 and with 10 jig of immunogens on day 35 each suspended with 200 jig of Adjuvax (Alpha Beta Technology, Worcester, MA) as an adjuvant in 200 jil total volume. Serum samples were obtained by tail-bleeding on days 0 and 28 and by whole body bleed on day 45.  13.3  Determination of antibody titers The anti-OprF titer in serum samples was determined by ELISA using  51 FPLC-purifled OprF from P. aeruginosa as the coating antigen (500 ng/mi). The anti-malarial epitope titer was determined by using affinity-purified GST::ME19 (2 jig/mi) or gel-purified OprF::MEl9aa26 (1 jig/mi) as the coating antigens. GST::ME19  and  OprF::MEl9aa26  were  chosen  because  these  proteins  demonstrated highest binding to the malarial epitope-specific mAbs in ELISA as compared to the corresponding proteins carrying the shorter versions of the epitope. In addition, the anti-malarial epitope peptide titer was determined by ELISA using the chemically synthesized peptide NANPNANPNANP (NANP) 3 (API, Edmonton, Alberta) as the coating antigen. The peptide (lOjtg/mi) in PBS was covalently linked to the wells of ReactiBindTM maleic anhydride activated polystyrene plates (Pierce) by incubation at 4°C for 16 h. The secondary antibody used in the assays was horse radish peroxidase-conjugated goat anti-mouse IgG (heavy and light chains) (BioRad).  13.4  Characterization of antisera by Western immunoblot analysis To detect the presence of anti-OprF antibodies in the antisera, FPLC  purified OprF (20 jig per gel) was resolved by SDS-PAGE and was transferred onto PVDF membrane, the filter was then cut into slices and incubated with serum samples from the immunized animals at 1/1000 dilution or with a 1/3000 dilution of MA7-2 as a positive control. The presence of anti-GST antibodies in the antisera was detected in a similar manner using affinity-purified GST (20 jig per gel). The presence of anti-malarial epitope antibodies in the groups immunized with  52  GST::malarial epitope fusion proteins or OprF::malarial epitope hybrid proteins was detected by using outer membrane preparation containing OprF::MElOaal96 (50 g per gel) or affinity-purified GST::ME19 fusion protein (20 ig per gel) respectively. Antisera from immunized animals were diluted 1/100. The malarial epitope-specific mAb pf2A. 10 (1/3000 dilution) was used as a positive control. Subsequent incubations with secondary antibody and enzymatic staining were carried out as described by Mutharia and Hancock (1983).  53 RESULTS  Chapter one: Construction and characterization of OprF linker mutants  1.  Introduction  Linker-insertion mutagenesis, either random or site-directed, has been employed to study the topology of several E. coli outer membrane proteins, including the maltoporin LamB (Boulain et al., 1986), the phosphate-starvationinducible porin PhoE (Bosch and Tommassen, 1987) and the major peptidoglycan associated protein OmpA (Freudi et al., 1986). The mutagenesis introduces extra amino acid residues at specific or non-specific sites of these membrane proteins, while leaving the rest of the proteins intact. As a result, it represents a more subtle modification of the protein in comparison to the other genetic approaches employed to study membrane topology such as alkaline phosphatase and -galactosidase gene fusions Manoil, 1991). In general, the extended surface loop regions are more likely to accommodate extra amino acids without gross perturbation of the protein structure. Indeed, the 3-dimensional structures of PhoE and LamB confirmed that all of the known insertion sites occurred within these ioops (Cowan et at., 1992; Schirmer et at., 1995). This chapter describes the expression of oprF in E. coli, a semi-random linker-insertion mutagenesis of oprF and the results of the characterization of the  54  linker mutants. The data obtained have raised the possibility that certain regions of OprF can be used to express longer foreign amino acid sequences.  1.2  Expression of oprF in E. coli  When attempts to produce recombinant OprF were initiated, plasmid vectors that allowed stable expression of cloned genes in P. aeruginosa were not available; hence, E. coli was chosen as the background strain for the expression of  oprF. Earlier attempts to subclone oprF into high copy number plasmids were unsuccessful, probably due to the efficient expression of oprF from its own promoter in E. coli leading to over-expression lethality (Woodruff et al., 1986). Plasmids that contained P. aeruginosa DNA containing oprF sequence were already available in this laboratory. However, the linker mutagenesis procedure required an OprF encoding plasmid that did not contain a PstI site. Therefore, the subcloning of oprF was necessary to generate a plasmid that would allow the expression and the linker mutagenesis of oprF in E. coli.  1.2.1 Construction of uRW3 The plasmid pHJ13, made by Helen Jost in this laboratory, was used for the initial subcloning of oprF. The plasmid contained two fragments of P. aeruginosa chromosomal DNA containing respectively the 5’ and 3’ portions of the OprF coding sequence inserted in the cloning vector pRK4O4 (Methods and  55 materials section 4, Fig. 5A). The putative -10 site of oprF in pHJ13 was mutated by adding a G:C nucleotide pair between nucleotides -9 and -10 to create a HindIII site. This procedure weakened the oprF promoter, avoiding the over-expression lethality in E. coli. To put the oprF coding region in one continuous reading frame, the Smal fragment in pHJ13 had to be inserted in a reverse orientation (Fig. 5A). Therefore, the plasmid pHJ13 was digested with Smal and the fragments were re ligated. The final plasmid, pRW3, contained a 1.47 kb HindIII/KpnI fragment carrying the entire oprF gene with a mutated promoter in the cloning vector pTZ 19R. The transcription of the gene was in the same direction as the lac promoter (Fig.5B). In addition to the elimination of the PstI sites, the subcloning also removed most of the chromosomal DNA flanking oprF, thus reduced the size of the plasnud by approximately 3 kb and could potentially improve the efficiency of further genetic manipulation.  1.2.2 Expression of ovrFin different E. coli host strains Since a certain genetic background in the host strain might be advantageous for the optimal expression of oprF, the plasmid pRW3 was transformed into different E. coli host strains to examine expression levels. The cell envelope samples of strains carrying pRW3 were analyzed by SDS-PAGE (Fig. 9). In most of the strains examined, the band corresponding to OprF was not readily observed in Coomassie blue stained gel (Fig. 9), indicating that the expression level of oprFin these E. coli strains was modest at best. Western immunoblotting with  56  A DH5  C466  +  --+  --  C443 +OprF  --  B DH5LI --  50  C466  C443  --  --  +  +  —  35.1—  Figure 9.  +  —  —  .-  .4  Expression of pRW3 in different E. coli host strains.  A. SDS-PAGE of cell envelope proteins from strains expressing pRW3. Protein samples (20 jig/lane) were heated at 100°C for 10 mm in solubilization buffer (2% SDS, 10% glycerol, 62.5mM Tris-HC1 pH6.8) before loading. B. Western immunoblot of the same samples with an OprF-specific mAb MA7-1. Symbols: un-induced; +, induced with 1mM IPTG at 37°C for 4 h. Each lane contained 20 jig of proteins. Numbers on the left indicated the positions of the relevant molecular mass standards (kfla). The position of OprF is indicated by an arrow head. --,  57  an OprF-speciflc monoclonal antibody showed that the expression level of oprF varied in different host strains. For instance, the un-induced levels of OprF in DH5a and C443(DH5cIQ) were comparatively higher than that in the membrane protease OmpT-deflcient strain (C466). Similar levels of expression in the DH5 and DH5IQ strains were unanticipated since the presence of the lac repressor was  expected to suppress the expression from the lac promoter under un-induced condition. Although the basal expression level of oprF was lower in C466 (OmpT), it increased more significantly than that in the two DH5cc strains upon IPTO induction. Since C466 is OmpT-deflcient, the lack of this membrane protease might permit tolerance of a higher amount of OprF in the outer membrane of K. coli. In the course of the subcloning, the 1.47 kb HindIII/KpnI fragment containing oprF was also incorporated into the cloning vector pTZ 18R, resulting in the transcription of the gene in the opposite orientation to the lac promoter. Expression of oprF from this plasnud was not observed, implying that the mutated oprF promoter was not functional. Furthermore, when oprF was in the same orientation as the lac promoter, the level of OprF production was increased upon IPTG induction, suggesting that the transcription of the gene was under the control of the lac promoter. Since DH5  is a widely used strain for genetic manipulation  and since the basal level of oprF expression appeared to be sufficient for our purposes, it was used as the background strain for most of the characterization in the later stages of this study.  58  1.3  Semi-random linker mutagenesis with a kanamycin resistance cassette  The kanamycin resistance cassette used for the mutagenesis contained the gene encoding an aminoglycoside 3’-phosphotransferase, which confers kanamycin resistance. The gene was flanked by symmetric restriction enzyme sites. The restriction enzyme sites included PstI, which were flanked by Hincil, a blunt-end cutting enzyme (Methods and materials section 5, Fig. 6A). The plasmid pRW3 was linearized separately by partial digestion with 1 of 4 blunt-end cutting restriction enzymes as described in Methods and materials section 5.1. There were a total of 74 cleavage sites in pRW3 that were recognized by the four enzymes utilized, and 37 of these were within oprF. Low enzyme concentrations andlor ethidium bromide were used to favour the production of singly cut plasmids. After ligation of the restriction enzyme-linearized plasmid pRW3 with the 1.3 kb Hincli fragment of the kanamycin resistance cassette, plasmid DNA from 100 clones that appeared to have the insertions within oprF were digested with PstI. The PstI digestion removed the kanamycin resistance cassette but left behind a residue of 12 nucleotide pairs in length, which was between the Hincli sites and PstI sites flanking both sides of the cassette (Fig. GA). After re-ligation, 44 of the 100 kanamycin sensitive clones had regained the ability to produce OprF, as determined by colony immunoblotting with the OprF C-terminal-specffic mAb MA58.  Presumably, these clones represented insertion sites in OprF that could  59  accommodate the insertion of 4 extra amino acids without affecting the production of the protein. The rest of the kanamycin sensitive clones were unable to produce immunoreactive OprF or produced OprF that reacted only weakly with MA5-8 on colony immunoblots. Restriction enzyme analysis was used to map the insertion sites in each of the 100 plasmids. Sites in the 44 OprF-expressing plasmids could be placed into 10 unique groups (e.g. Fig. 10). The remaining 56 plasmids included those which demonstrated gene rearrangements or deletions, probably due to multiple cleavages of pRW3 by the restriction enzymes prior to ligation with the kanamycin resistance cassette.  1.4  Site-directed mutagenesis at the Sail site  The unique SalT site corresponding to amino acid position 188 (aa’ ) of 88 the mature OprF was a potentially interesting site to study because of its location in the cysteine-containing region. To obtain the same 4-amino acid insertion at the SalT site, a 12 bp adaptor containing a PstI site was inserted. The characterization of this mutant was performed simultaneously with the rest of the linker-insertion mutants.  1.5  Determination of insertion sites  The exact linker-insertion sites in at least one representative from each  60  234  6789  10 11 12  Figure 10, Restriction mapping of linker-insertion sites.  Restriction digest patterns of plasmid DNA from 12 of the kanamycin resistant clones. Each three lanes correspond to plasmid DNA from one clone treated in the following ways (from left to right): i. uncut, ii. PstI digest, iii. PstJiHindIll double digest. Each plasmid had 2 PstI sites, one on each side of the cassette, and 2 HindIII sites, one within the cassette and one at the promotor region of oprF. In the PstI digest lanes, the 1.3 kb and the 4.3 kb fragments represent the kanarnycin cassette and the pRW3 plasmid respectively. In the PstIIHindIII double digest lanes, the 600 bp and 700 bp fragments (marked by open triangles) correspond to the kanamycin cassette while the 4 kb and the fourth fragments (marked by solid circles) correspond to pRW3. The sizes of the fourth fragments indicated the distance of the insertion sites from the Hind.III site, Numbers on the left indicate the positions of molecular size markers (bp).  61  of the 10 groups of mutant plasmids encoding immunoreactive OprF were determined by DNA sequencing. The nucleotide positions of the linker insertions  and the identities of the 4 inserted amino acids for 11 linker-insertion mutants and 1 site-directed insertion mutant (pRW3O7) are summarized in Table IV. Seven of the mutant plasmids that did not express immunoreactive OprF were also analyzed by sequencing CPable V). The results revealed that two of the mutant plasmids had incorporated the 12 bp insert at nucleotide positions +433 and +795 of oprF respectively, but the reading frames at these insertion sites both led to the translation of stop codons from the 12 bp insert. The other four mutant plasmids analyzed represented deletions of part of the oprF sequence, and the study of these mutants was not further pursued in this work. Only one (pRW3O3) of the seven mutant plasmids analyzed showed the incorporation of a 12 bp insert in the OprF coding region without any other genetic alteration or change of reading frame. The inability of this clone to demonstrate an OprF positive phenotype on colony or Western immunoblots suggested the “non-permissiveness” of this insertion site.  1.6  Expression and cellular localization of linker mutants  In addition to the signal peptide, the primary sequence of mature membrane proteins is believed to carry the targeting signal for the export of these proteins across the bacterial membrane (Maclntyre and Henning, 1990). Therefore, it is possible that insertion of extra amino acids in the primary sequence of OprF  62  Table IV. Summary of insertion sites of 11 linker-insertion mutants and one site-directed insertion mutant and the identities of the inserted amino acids.  a  Plasmids  Insertion sites (nucleotides) a  Insertion sites (amino acid) a  Amino acids inserted  Apparent mol. masse (kDa)  pRW3O1  77  Gly-2  TCRS  41  pRW3O2  148  A1a26c  PAGP  36  pRW3O3  198  Glu-42  DLQV  NE  pRW3O5  463  Ala-131°  PAGP  40  pRW3O6  476  Gly-135  TCRS  35  pRW3O7b  636  Val- 188  PAGP  35  pRW3O8  658  A].a-196°  PAGP  35  pRW3O9  710  Arg-213  TCRS  35  pRW31O  717  Gln-215  DLQV  35  pRW311  764  Ser231d  TCRS  36  pRW312  939  Arg-290  TCRS  35  pRW314  1001  G1y310  TCRS  28  .  .  .  Position 1 is the translational start site (Duchene et al., 1988). The amino acid  numbers correspond to the mature native OprF. b  pRW3O7 was generated by inserting a Sail adaptor that contained a PstI site  into the Sail site corresponding to aa’ . 88 The alanine residue at these insertion sites was replaced by a glycine. d  The serine residue at the insertion site was replaced by an arginine. The apparent molecular mass of wild type OprF expressed by pRW3 is 35kDa.  NE, no expression.  63  Table V.  Summary of six of the deletion mutants isolated during linkerinsertion mutagenesis.  Insertion sites  Insertion sites  Amino acids  (nucleotides)a  (amino acid)  inserted or mutations  pRW3O4  433  Tyr-121  pRW313  1001  Gly-310  deletionc  pRW315  795  Tyr-245  stop codonb  pRW316  898  Val-279  TCRS  pRW317  399  AIa-114  pAGp+83aad  pRW318  296  Gly-78  Plasnrids  stop  Codoflb  +  24 aa  DLQV+ 97  a  Position 1 is the translational start site (Duchene et al., 1988).  b  The first codon encoded by the linker is a stop codon.  d  aad  The linearized pRW3 was cleaved at multiple sites so that the rest of the coding region was deleted. d  The linearized pRW3 was cleaved at multiple sites. The extra amino acids  encoded were due to a frame shift and represented the translated sequence before the first stop codon was encountered.  64 might affect its transport to the outer membrane.  To examine the cellular  localization of the OprF linker mutants, the outer membrane of F. coli containing the linker mutant plasmids was isolated by using Triton X-lOO extraction procedure (Schnaitman, 1971).  SDS-PAGE analysis of the outer membrane  fractions demonstrated the presence of OprF and OprF linker mutants, suggesting the association of these proteins in the outer membrane of F. coli (Fig. 11). The electrophoretic mobility of all of the linker mutants was modified by pre-treatment with 2-mercaptoethanol, indicating that the inserted amino acid residues did not perturb the formation of the OprF cysteine disulphide bonds (Fig. 11, lanes 6 & 10). The apparent molecular mass of the OprF linker mutants carrying an insertion at aa 2 and aa’ ’ (encoded by plasmids pRW3O 1 and pRW3O5 respectively) 3 was noticeably greater than that of the wild type (Table IV). The protein expressed by pRW3O5 migrated with a mobility similar to that of the heat-modified (unfolded) form of OprF (Fig. 12, lane 3), suggesting that the incorporation of the 4-amino acid linker may have increased the susceptibility of the protein to denaturation by heating in SDS. Plasmids pRW3O9 (aa ) 231 ) (Fig. 11, lane 9) and pRW311 (aa 213 (data not shown) each directed the expression of an intense band with an apparent molecular mass of 70 kDa, likely corresponding to the trimenc form of OprF Mutharia and Hancock, 1985). After 2-mercaptoethanol treatment, a much more intense monomer band with an apparent molecular mass of 35 kDa was observed in the same samples (e.g. Fig. 11, lane 5), suggesting that insertion of the linker at aa 213 and aa ’ may enhance the association of SDS-stable oligomers. 23  ___ _  __  __  _  65  1  2  3.4.5  495—•  -  .  __---—4.  325  678  4 -4( 4  --  I..  — —  1.•  ?  -  -  I  Figure 11, Cellular localization of OprF linker mutants.  SDS-PAGE of outer membrane samples of E. coli DH5 F’ strains carrying the pRW3-derived. plasmids. Samples were prepared by using Triton X-l00 extraction procedures (Schnaitman, 1971) and were incubated at 37°C for 10 mm in solubilization buffer with (lanes 2-8) or without (lanes 9 and 10) 4% 2mercap-toethanol before loading. The gel was stained with Coomassie blue after electrophoresis. Each lane contained —‘16 jig protein from each sample. Plasmids present in the lanes were: 2, pRW3O2 (aa ); 4, 131 ); 3, pRW3O5 (aa 26 pRW3O6 (aa’ ); 5, pRW3O9 (aa 35 ); 6, pRW31O (aa 213 ); 7, pRW3; 8, pTZ19R; 9, 215 pRW3O9; 10, pRW3 10. The amino acid positions of the insertions are indicated in the brackets. OprF monomer bands are indicated by triangles; the OprF SDS stable trimer is indicated by an arrow head; the position of OmpA is indicated by a solid circle. Positions of relevant molecular mass markers (kDa) are indicated on the left. Due to the low level of expression, protein expressed by pRW3O5 (lane 3) was localized by Western immunoblotting.  66  12345678  49.5-  32.5—  —‘I  Ib1  Figure 12, Expression of OprF linker mutants.  Western immunoblot analysis of outer membrane samples of E. coli DH5F’ strains expressing the pRW3 derived plasmids. The OprF-specffic mAb MA7-5, which recognizes an epitope that is not interrupted by the insertions, was used. Samples were heated at 100°C for 10 mm in solubilization buffer before loading. Each lane contained about 8 ig protein. Plasmids present were, lanes: 2, pRW3O2; 3, pRW3O5; 4, pRW3O6; 5, pRW3O9; 6, pRW31O; 7, pRW3; 8, pTZ19R. Numbers on the left indicate the positions of the relevant molecular mass standards (kDa). OprF monomer bands are indicated by arrow heads. The position of the heatmodifled form of OprF is indicated by a circle. Bands corresponding to oligomeri.c and LPSassociated forms of OprF are visible in some lanes.  67 The level of production of two of the linker mutants, encoded by pRW3O2 and pRW3O6, was noticeably lower than that of the others, as determined by their abundance relative to the other E. coli proteins (Fig. 11, lanes 2 & 4), indicating that insertions at these sites may lead to reduced protein production or unstable products. Mutants with insertion sites at the C-terminal end of the proteins (e.g. those encoded by pRW312 and pRW314) produced OprF variants that were substantially but not completely degraded to smaller fragments, including a predominant 28 kDa fragment (Table IV). This confirmed the results of Finnen et al. (1992), that the C-terminal regions of OprF were required for the resistance of the protein to cellular proteases.  1.7  Monoclonal antibody reactivity of linker mutants  Most of the OprF-specffic mAbs available in the laboratory recognized conformational epitopes and thus can be used as probes to examine the general conformation of the OprF linker mutants. Outer membrane samples containing the linker mutants were analyzed by Western and colony immunoblotting using the series of OprF-specific monoclonal antibodies (Table VI). The results demonstrated that the OprF derivatives expressed by 5 of the plasmids (pRW301, 302, 306, 309 and 310) were reactive with all 10 monoclonal antibodies, indicating the retention of native OprF structure.  In 6 other mutants, specific OprF epitopes were  disrupted by the insertion of the 4-amino acid linker. However, the reactivity of  + + + +  Ala-26 Glu-42 Ala-131 Gly-135 Val-188 Gly- 196 Arg-213 Gln-215 Ser-231 Arg-290 Gly-310  pRW3O2  pRW3O3  pRW3O5  pRW3O6  pRW3O7  pRW3O8  pRW3O9  pRW31O  pRW311  pRW312  pRW314 +  +  +  +  -  -  w  +  +  +  +  +  +  +  +  -  +  +  7-2  -  -  -  +  +  +  +  +  +  -  +  +  7-3  -  -  -  +  +  +  +  +  +  -  +  +  7-4  -  -  -  +  +  +  +  +  +  -  +  +  7-5  w  +  +  +  +  +  +  +  +  -  +  +  7-6  -  -  -  +  +  +  +  +  +  -  +  +  7-7  +  +  +  +  +  -  -  +  +  -  +  +  7-8  +  +  +  +  +  -  +  +  +  -.  +  +  4-4  -  +  +  +  +  +  +  +  +  -  +  +  5-8  Measured by colony immunoblot and Western immunoblot analyses of outer membrane samples. Symbols: +, reactivity equivalent to wild type OprF expressed by pRW3; -, no reactivity; w, weak reactivity.  a  w  Gly-2  pRW3O1 +  7.4  Insertion site (aa position)  Monoclonal antibody reactivitya  Summary of monoclonal antibody reactivity of OprF linker mutants.  Plasmid  Table VI.  00  69 these mutated proteins with the majority of the monoclonal antibodies suggested the retention of substantial native OprF structure in these mutants.  OprF  expressed by pRW3O3 was an exception. Despite the fact that DNA sequencing demonstrated that only 12 bp were inserted and no premature stop codon or change in reading frame occurred, it did not produce any OprF product that could be detected by the OprF-specific monoclonal antibodies on immunoblots or visualized in Coomassie blue stained SDS-PAGE gel of outer membrane samples and whole cell lysates. Thus it was assumed that this site was “non-permissive” for the insertion of 4 amino acids.  1.8  Membrane configuration of linker mutants in E. coil  To permit conclusions regarding the structure of OprF to be drawn based on linker-insertion mutagenesis in E. coli, it was necessary to examine whether the structure of OprF and its linker mutants in E. coli reflected that of OprF in P. aeruginosa. To further examine the configurations of the OprF derivatives in the outer  membrane  of E.  coli,  trypsin  accessibility  assays  and indirect  immunofluorescence labeffing experiments were conducted.  1.8.1 Trvnsin sensitivity assays Outer membrane porins tend to be protease resistant (Paul and Rosenbusch, 1985) by virtue of their extensive n-sheet structure with linking  70  surface loops that are tightly packed or folded in towards the porin channel (Weiss  et al., 1991; Cowan et al., 1992; Schirmer et al., 1995).  It was previously  demonstrated that purified OprF or OprF in outer membrane preparations are partly cleaved by trypsin to a core 28 kDa fragment, and that increasing concentrations of trypsin or increasing length of treatment time fails to cause further proteolysis (Mutharia and Hancock, 1985). Trypsin treatment of outer membranes from E. coli DH5ciF’ expressing the parental plasmid pRW3 resulted in substantial retention of full-sized OprF and partial proteolysis to a 28 kl)a fragment that could be detected by the OprF-speciflc mAb 7-1 (Fig. 13, lanes 8, 9, and 10). Similar results were obtained after trypsin treatment of outer membranes from cells containing plasmids pRW3O2 and pRW3O6 (data not shown), which encoded OprF linker mutants with N-terminal insertions in OprF (Fig. 13, lane 1, Table VII). Mutant proteins with C-terminal insertions in OprF (i.e. those encoded by pRW3O9, pRW31O, pRW311 and pRW312) were completely cleaved to the 28 kDa fragment after trypsin treatment (Fig. 13, lanes 4-7; Table Vil). Proteins encoded by plasmids pRW3O7 and pRW3O8, which carried insertions in the central cysteine clisuiphide region (aa’ 96 88 and aa’ respectively), were cleaved by trypsin to a 24 kDa fragment, instead of (RW307; Fig. 13, lane 2) or in addition to (pRW3O8; Fig. 13, lane 3) the 28 kDa fragment. Based on previous studies (Finnen et al., 1992), such a 24 kDa fragment might be expected if cleavage occurred near aa ° within the cysteine-containing region, 9 suggesting localized modification of OprF by these insertions rendered this region  71  MWstd (kDc  4  495-  3a5 27.5...  Figure 13. Trypsin sensitivity of linker mutants in outer membranes. Western immunoblot analysis of trypsinized outer membrane samples contaimng OprF linker mutants. Samples were treated with trypsin (0.1 mg/mi) at 37°C forGO mm, and then heated at 88°C for 10 mm in solubilization buffer. The plasmids corresponding to the OprF linker mutants contained in each lane are: 1, pRW3O2; 2, pRW3O7; 3, pRW3O8; 4, pRW3O9; 5, pRW31O; 6, pRW311; 7, pRW312; 8, pRW3; 9, pRW3; 10, pRW3 (untreated). OprF monomer band is indicated by an arrow head. The 28 kDa and 24 kDa trypsin-resistant core fragments are indicated by open and solid triangles, respectively. The OprF Nterminal specific inAb MA7- 1 was used for immunodetection. The positions of relevant molecular mass standards (kfla) are indicated on the left.  72  Table VII. Summary of trypsin sensitivity assays of OprF linker mutants in E. coli outer membrane, DH5ii and 0386 whole cells.  Plasmid  a  Apparent mol. massa (kDa)  Apparent mol. mass after trypsin treatmenta (kDa) Outer membrane  DH5ft whole cell  C386 whole cell  pRW3  35  35, 28  35  28  pRW3O1  41  ND  ND  ND  pRW3O2  36  36, 28  36  36, 28  pRW3O5  40b  24, 20,  pRW3O6  35  35, 28  35  ND  pRW3O7  35  24, 35  35  24, 28  pRW3O8  35  35, 24, 28  35  24, 28  pRW3O9  35  28  35  28  pRW31O  35  28  35,28  ND  pRW311  36  28  ND  ND  pRW312  35  28  28  28  pRW314  28C  ND  28  ND  b 18  ND  As estimated on Western immunoblot with MA7-1. Where more than one  band appeared, they are listed in order of abundance. ND, not determined. b  Tested with MA4-4 since this mutant OprF derivative was non-reactive with  MA7- 1. 35 kDa was observed as a minor band.  73 susceptible to trypsin. Plasmid pRW3O5 (aa’ ) expressed an OprF linker mutant 31 that showed unexpected trypsin-cleavage pattern with a predominant 24 kDa product and minor 20 kDa and 18 kDa products (Table VII). This implied a substantial localized disruption of OprF structure, consistent with the observed susceptibility to heat denaturation. Tryp sin treatment of whole cells of E. coli DH5F’ expressing the wild type or mutant oprF plasmids did not result in proteolysis of OprF or its linker mutant derivatives (Table VII), with the exceptions of those C-terminal insertion mutants encoded by plasmids pRW3 10, pRW3 12 and pRW3 14. On the other hand, the proteolysis patterns of OprF and the linker mutants in whole cells of C386  (ompA, lpp) resembled that of these proteins in isolated outer membranes. Since the C-terminal of OmpA is highly homologous to that of OprF, the differences in the results from these two host strains might have been due to the interaction of this region of OmpA and OprF, affecting the accessibility of the trypsin cleavage site in OprF and some of its mutants.  1.8.2 Immunofluorescence labeffin To examine whether the OprF linker mutants had surface-exposed regions, immunofluorescence labeffing was carried out using E. coli strains expressing selected linker mutant plasmids and monoclonal antibodies which bind to surface epitopes in the N-terminus (MA7-1), central region (MA7-8), and C terminus (MA5-8) of OprF (Table VIII). To avoid the presence of OmpA, which  74  Table VIII.  Plasmid  Results from indirect immunofluorescence labelling of intact E. coli C386 cells containing different plasmids.  Immunofluorescence with monoclonai antibothesa MA7-1  MA7-8  1VIA5-8  -  -  -  pRW3  ++  ++  +  pRW3O2  ++  ++  +  pRW3O7  ++  +  +  pRW3O8  +  pRW312  ++  no plasmid  a  ++,positive labeffing;  +,  -  ++  weak labelling; -,negative labelling.  + +  75  might affect the accessibility of OprF epitopes, an OmpA-deficient strain (C386) was used as the background strain for the expression of the plasmids. In each case, regardless of the trypsin susceptibility of the respective OprF mutants in intact cells, immunoreactivity followed precisely the pattern observed in both colony immunoblots and Western immunoblots (Table VI). Taken together, the OprF linker mutants were probably inserted in the outer membrane in the native conformation, as reflected by their trypsin resistance and surface exposure.  1.9  Summary  The results presented here demonstrated the identification of 11 unique “permissive” sites in OprF, which were sites that allowed the insertion of 4 extra amino acids without grossly affecting the production, folding and stability of the protein. The characterization of OprF linker mutants provided compeffing evidence that the general conformation and membrane configuration of these proteins in E. coli were very similar to that of OprF in P. aeruginosa. The evidence included: 1). The presence of the mutant proteins in purified E. coli outer membranes, 2). The apparently correct formation of disulphide bonds as judged by the 2mercaptoethanol modifiability of the OprF mutants, 3). The reactivity of the proteins with at least three of the mAbs MA7-3 through MA7-8 and MA4-4, which apparently recognize conformational epitopes (Finnen et al., 1992; Rawling et al., 1995), 4). The demonstration of a trypsin-resistant core structure in most mutants  76  contained in outer membranes and the general resistance of OprF to trypsin cleavage in intact cells, and 5). The correct surface localization of some of the OprF epitopes as examined by immunofluorescence labeffing of intact cells with OprF specific monoclonal antibodies. The  information  obtained  from  this  study  established  the  “permissiveness” of the characterized linker-insertion sites in OprF, thus opening up the possibility that OprF could be used as a carrier for the presentation of foreign amino acid sequences. The 12 bp insertion in oprF resulted from the linker mutagenesis procedure provided a unique PstI site, which was useful for the cloning of foreign DNA sequences.  77  Chapter two: Construction, characterization and purification of OprF::malarial epitope and GST::malarial epitope hybrid proteins  2.1  Introduction  Epitope-insertion studies have been used to demonstrate the potential of outer membrane proteins as carriers for the expression of foreign antigenic determinants (Charbit et aL, 1991; Agterberg et aL, 1990b). The examination of the surface exposure of the inserted epitope can also provide information about the membrane topology of the carrier protein. To further investigate the flexibility and limitations of OprF as a carrier for epitope presentation, an epitope-insertion study was carried out using the four-amino acid repeating epitope (NANP) of the circumsporozoite protein of the human malarial parasite, Plasmodium falciparum, as a model epitope. In this chapter, the construction and characterization of two series of OprF::malarial epitope hybrid proteins, the positional and multiple-repeat hybrids, will be described. In addition, the construction and characterization of two versions of GST::malarial epitope fusion proteins, which were used to monitor the anti-malarial epitope response in serum samples from immunized animals, will also be described.  78 2.2  Construction of OprF::malarial epitope hybrid proteins  Previous linker-insertion mutagenesis had identified “permissive” sites in OprF that can accommodate 4 extra amino acid residues. To further explore the “permissiveness” of the sites, a 10-amino acid malarial epitope was genetically inserted into these sites to generate a series of OprF::malarial epitope positional hybrids. In addition, 4 different lengths of the malarial epitope were inserted into 3 of the “permissive” sites to generate a series of multiple-repeat hybrids. These two series of OprF::malarial epitope hybrids not only helped to explore the “permissiveness” of the OprF insertion sites, they also provided a tool for the study of the effects of insertion position and length of the epitope on epitope presentation in the OprF system.  2.2.1 Positional hybrids The previous linker-insertion mutagenesis study generated a series of oprF linker mutants that carried a unique PstI site at different positions of the gene. To construct the series of OprF::malarial epitope hybrid proteins expressing the epitope at different positions of OprF, oligonucleotides encoding the malarial epitope sequence (NANPNANPNA) were inserted into the PstI sites of the oprF linker mutants. Three sets of oligonucleotides were required to accommodate the three possible reading frames at the PstI sites. The positions and reading frames of the insertions were confirmed by DNA sequencing. Table IX summarizes the  79  Table IX.  a  Summary of OprF::malarial epitope positional hybrids.  Plasmid  Insertion site  pRW3O2.1M pRW3O2.2M  Ala-26 Ala-26  Amino acids inserte& PAP(ME)GHAGP GP 2 PA{P(ME)GHA}  pRW3O6.2M  Alal35b  TC{NP(ME)C R 2 S  +  pRW3O7.1M  Val-188  DLQ(ME)LDVQV  +  pRW3O8.1M  Ala-196  PAP(ME)GHAGP  +  pRW3O9.1M pRW3O9.3M  Arg-213 Arg-213  TCNP(ME)CRS RS 3 TC{NP(ME)C}  +  pRW31O.1M  Gln-215  DLQ(ME)LDVQV  +  pRW311.1M pRW311.5M  Ser-231 Ser-231  TCNP(ME)CRS RSe 5 TC{NP(ME)C}  +  pRW312.1M pRW312.4M  Arg-290 Arg-290  TCNP(ME)CRS TC{NP(ME)C} R 4 SC  +  pRW314.1M  Gly-310  TCNP(ME)CRS  +  Surface exposure of the epitope’ +  ME=NANPNANPNA.  b  The site at aa’ 35 was also found to be permissive for the expression of two copies of the epitope insert, but a hybrid that carried a single copy of the epitope was not obtained and therefore this site was not included in this study. The numbers of insert in these cases were estimated by 2% agarose gel.  d  the malarial epitope was detectable on the cell surface by indirect immunofluorescence studies using a malarial epitope-specific monoclonal antibody. ,  80 series of OprF::malarial epitope positional hybrids and the identities of the inserted  amino acid residues. The amino acid residues immediately flanking the malarial epitope varied according to the reading frame at the linker-insertion sites. In the course of cloning, hybrids that had incorporated multiple copies of the insert were also isolated. However, due to the volume of work involved and the clarity of presentation, only two of these hybrids were chosen for further characterization.  2.2.2 Multinle-reneat hybrids To study the length effect on epitope presentation in the OprF system, OprF::malarial epitope hybrids with different lengths of the epitope insert were required. Three “permissive” sites in OprF (aa , aa’ 26 96 and aa ) were selected for 213 the construction of such multiple-repeat hybrids. The choice of these sites was based on their positions in the protein (the N-terminus, the middle region and the C-terminus) and the stability of the corresponding positional hybrids. Table X summarizes the multiple-repeat hybrids constructed in this study. These hybrids carried 7, 11, 15 and 19 amino acids corresponding to the malarial epitope, each with an increment of one tetramer repeat. In addition, nine flanking amino acid residues, which were the result of the previous linker-insertion mutagenesis procedures and genetic cloning, were also added.  81 Table X.  Insertion site  Plasmid  Amino acids inserteda  Ala-26  pRW3O2.7  PAARNPNANPNLDAGP  pRW3O2. 11  NPNLDAGP 2 PAAR(NPNA)  pRW3O2. 15  NPNLDAGP 3 PAAR(NPNA)  pRW3O2. 19  NPNLDAGP 1 PAAR(NPNA’)  pRW3O8.7  PAARNPNANPNLDAGP  pRW3O8. 11  NPNLDAGP 2 PAAR(NPNA)  pRW3O8. 15  NPNLDAGP 3 PAAR(NPNA)  pRW3O8. 19  NPNLDAGP 1 PAAR(NPNA)  pRW3O9.7  TCTRNPNANPNLDCRS  pRW3O9. 11  NPNLD CR5 2 TCTR(NPNA)  pRW3O9. 15  NPNLDCRS 3 TCTR(NPNA)  pRW3O9. 19  NPNLDCRS 1 TCTR(NPNA)  Ma- 196  Arg-213  a  Summary of OprF::malarial epitope multiple-repeat hybrids.  The amino acid residues corresponding to the malarial epitope are underlined. The flanking amino acids PA_GP and TC_RS were the results of the previous linker-insertion mutagenesis procedures.  82 2.3  Characterization of OprF::malarial epitope hybrid proteins  To examine if the “permissive” sites previously identified by linkerinsertion mutagenesis were “permissive” for the expression of the longer epitope sequence, the OprF::malarial epitope hybrid proteins were characterized in terms of their expression, cellular localization and reactivity with the series of OprF specific monoclonal antibodies.  2.3.1 Expression of hybrid vroteins The expression of the hybrid proteins was examined by Western immunoblotting of whole cell lysates of strains carrying the hybrid plasmids. The hybrid plasniids containing the epitope-encoding oligonucleotides at eight different sites expressed proteins that were reactive with both OprF-specific and malarial epitope-specific niAbs on Western immunoblots (Fig. 14). The apparent molecular mass of these proteins was slightly higher than that of native OprF, which was consistent with the presence of additional malarial epitope sequences in the hybrid proteins. Plasmids pRW3O2.2M (aa ) and pRW3O9.3M (aa’ 26 ) encoded proteins of 96 higher apparent molecular mass than plasmids carrying a single copy of the insert at the same sites (Fig.14, compare lanes 1 & 2, and lanes 5 & 6). The lanes corresponding to plasmids pRW3O7. 1M (aa’) and pRW3O8. 1M (aa’ ) (lanes 3 and 96 4) showed a more prominent upper band which apparently corresponded to the heat-modified form of the protein. This implied that the presence of extra amino  83 A 1  2 3 4 5 6 7 8 9101112  1  2 3 4 567 8 9 101112  B  kDa  I—.  WI  a  j  -  —  -  —  Figure 14. Expression of OprF::ma].arial epitope positional hybrids.  Western immunoblots of whole cell lysates of E. coli DH5F’ strains expressing various OprF::malarial epitope hybrid proteins after reaction with A) an OprF specific monoclonal antibody MA7- 1 and B) a malarial epitope specific mAb pf2A. 10. Samples were resuspended in solubilization buffer and heated at 100°C for 10 mm before loading. Plasmids expressed in the samples in lanes were: 1, pRW3O2.lM; 2,pRW3O2.2M; 3, pRW3O7.1M; 4, pRW3O8.1M; 5, pRW3O9.1M; 6, pRW3O9.3M; 7, pRW31O.lM; 8, pRW311.1M; 9, pRW312.1M; 10, pRW3l4.1M; 11, pTZ19R; 12, pRW3. The bands corresponding to wild type OprF and the N-terminal degradation product are indicated by a solid and an open triangle, respectively. In some lanes, the bands corresponding to OprF dimers, oligomers and protease degradation products are visible. The positions of relevant molecular mass standards (kDa) are indicated on the left.  84 acids in the cysteine-containing region of OprF might have affected the local conformation, and thus rendered the protein more susceptible to heat denaturation (Hancock and Carey, 1979). Lanes 7 to 10 demonstrated an increase in abundance of the 28 kiJa degradation product, which failed to react with the malarial epitope specific mAb, suggesting that it represented the N-terminal part of these proteins lacking the malarial epitope sequences. This result was consistent with previous findings that C-terminal perturbations rendered these OprF derivatives more susceptible to cellular proteases (Finnen et at., 1992). Oligonucleotides encoding the malarial epitope were also inserted into sites corresponding to aa 2 and aa’ ’ of OprF, but no hybrid proteins were detected 3 on Western immunoblots. These two sites appeared to be either “non-permissive” for the insertion of more than 4 amino acids (encoded by the linker insertion) or “non-permissive” for the expression of the malarial epitope sequence.  2.3.2 Cellular localization of hybrid vroteins The insertion of extra amino acid residues into the mature sequence of a membrane protein affects its primary and possibly secondary structure and therefore might interfere with its transport to the native subcellular compartment. SDS-PAGE analysis of outer membrane preparations from strains carrying the hybrid plasmicis was performed to examine the outer membrane localization of the OprF::malarial epitope hybrid proteins. It was shown that the hybrid proteins were associated with the outer membranes (Fig. 15). Due to the genetic background of  85  A  12345 6 7 8 9101112  B  1234567 8 9101112 .4  —  53.2— 34.9—  —  —  — —  —..z.-.  A  Figure 15. Cellular localization of OprF::malarial epitope positional hybrids. A. Sucrose gradient outer membrane preparations of E. coli C158 (ompA, ompC, phoE) strains expressing OprF::malarial epitope positional hybrid proteins. Samples were heated at 100°C for 10 mm in solubilization buffer before loading. The gel was stained with Coomassie blue after electrophoresis. B. Western immunoblot analysis of the same samples with MA7- 1. Plasmids expressed in the strains were: 1, pTZ19R; 2, pRW3; 3, pRW3O2.1M(aa ) ; 4, 26 7, ); 26 pRW3O2.2M(aa ); 96 5, pRW3O7. 1M(aa’ ); 6, pRW3O8. 1M(aa’ 88 pRW3O9. 1M(aa ); 8, pRW3O9.3M(aa 213 ); 10, 215 ); 9, pRW3 10. 1M(aa 213 pRW3 11. 1M(aa ); 11, pRW3 12. 1M(aa 231 ). The amino 310 ); 12, pRW3 14. 1M(aa 290 acid positions of the insertion sites are in brackets. The positions of relevant molecular mass standards (kDa) are indicated on the left. The positions of the native and heat-modified forms of the proteins are indicated by solid and open triangles respectively. The band corresponding to an E. coli outer membrane protein is indicated by a solid circle. Bands corresponding to OprF oligomers are visible in some lanes.  86  the host strain (ompA, ompC, phoE) and the growth conditions of the bacterial cultures used for the outer membrane preparations (high osmolarity in the presence of 0.1% glucose to suppress the production of OmpF and LamB respectively), the hybrid proteins appeared to be one of the major species present in the preparations (Fig. 15). The slight differences in apparent molecular mass of the hybrids might  have been due to the interactions between the inserted amino acid residues and the local OprF amino acid sequence which affected the electrophoretic mobilities of these proteins.  Western immunoblot analysis of the same outer membrane  preparations revealed minor and comparable levels of protease degradation products in all of the samples, implying that the 28 kDa product observed in the whole cell lysates was not associated with the outer membrane (Fig. 15B). Similar to the positional hybrids, the OprF::malarial epitope multiplerepeat hybrids were also expressed in the outer membrane of E. coli (Fig. 16). The length increment of the inserted epitope in each set of the hybrids was reflected by the stepwise increase in the apparent molecular mass of the hybrid proteins. The series of multiple-repeat hybrid proteins carrying insertions at aa 26 formed inclusion bodies which fractionated with the outer membrane. The bands corresponding to the inclusion body form of the hybrid proteins migrated at higher apparent molecular mass than the membrane bound form. In addition, while the membrane bound form of the proteins was 2-mercaptoethanol modifiable due to the presence of disuiphide bonds, the gel mobility of the inclusion body form of the proteins was not affected by 2-mercaptoethanol, indicating the absence of  87  A  1  2  3  4  5  3  4  5  I  I  53.2-  34.9  —.  %.  1  B  2  —  53.2 -  34.9 -  -4-.--  Figure 16. Expression of OprF::malarial epitope multiple-repeat hybrids.  SDS-7.5%PAGE outer membrane preparations carrying insertions at A). Ala-26 and B). Arg-213 of OprF. Samples were heated at 37°C for 10 mm in solubilization buffer before loading. The gels were stained with Coomassie blue after electrophoresis. Lane 1, OprF with no insert; lanes 2 to 5 represent hybrids carrying 7, 11, 15 and 19 amino acids of the epitope respectively. Samples corresponding to the aa 26 hybrids were obtained by octyl-POE extraction of outer membrane samples. The positions of relevant molecular mass standards (kDa) are indicated on the left. Bands corresponding to OprF or OprF hybrid proteins are marked with solid circles.  88 clisulphide bonds in these proteins (Fig. 17).  2.3.3 Surface exuosure of the evitope According to the membrane topology model of OprF, most of the malarial epitope insertion sites were proposed to be in the surface-exposed loop regions of OprF. In other words, the inserted epitope should have been detectable on the E. coli cell surface. Previous studies have shown that the presence of OmpA, an E. coli outer membrane protein that shares C-terminal, homology with OprF (Duchene et al., 1988; Woodruff and Hancock, 1989), appeared to mask the binding of mAbs to OprF in intact E. coli cells (Martin et al., 1993). Therefore, an OmpA-deficient strain C386 was chosen for the expression of the hybrid plasmids. The surface  exposure of the malarial epitope was examined by indirect immunofluorescence labelling of whole cells containing the hybrid proteins with the malarial epitope specific monoclonal antibody, followed by a secondary antibody that was conjugated to a fluorescent dye (Fig. 18). Due to the limitation of the instruments used in fluorescence microscopy, only the cells that were at the same depth of field appeared fluoresced in Figure 18. However, examination of the slides by varying the depths of field showed that the majority of cells (>90%) were labelled. The malarial epitope expressed at all eight “permissive” sites was detectable on the cell surface (Table IX), which suggested the placement of the insertion sites in the surface-exposed ioop regions in the topology model of OprF. These results were consistent with the general assumption that surface loop regions are more likely to  89  1  2 3 4 5 6  L_  2-ME -—.i  7 8 910111213  L....  2-ME  —J  Figure 17. Presence of inclusion bodies in outer membrane samples. SDS-PAGE of sucrose gradient outer membrane preparations containing both the membrane bound and inclusion body forms of the OprF::malarial . 26 epitope multiple-repeat hybrid proteins carrying the inserted epitope at aa Samples were heated at 100°C for 10 mm in solubilization buffer without (lanes 1 to 6) or with 4% 2-mercaptoethanol (2-ME) (lanes 8-13) before loading. The gel was stained with Coomassie blue after electrophoresis. Samples contained in the lanes: 1 & 8, outer membrane samples from strain expressing pTZ 19R; 2 & 9, OprF; 3 & 10, OprF::lVIE7aa26; 4 & 11, OprF::MEllaa26; 5 & 12, OprF::ME15aa26; 6 & 13, OprF::MEl9aa26; 7, molecular mass standards. Solid and open circles indicate the positions of the inclusion body and membrane bound forms of the proteins respectively. The positions of relevant molecular mass standards (kDa) are marked on the left.  ______________  90 A  B  rj. .  14  .-L) •• 1  1,1  ‘  —s  j_  4 b  ,U..  ‘  ,I  .  t  •  ‘:  i•-  ‘  ‘ -‘-  :•:Ha  4  ,  I  ;(  ‘  r  .,.4_*.4.1 ‘i.;;d’’’ .  .  •  I  ‘  .: .  — I  :  Figure 18. Surface exposure of the malarial epitope. Indirect immunofluorescence labelling of C386 (pRW3O2.1M) with the malarial epitope-specific monoclonal antibody pf2A. 10. A) Labelled cells observed under fluorescence microscopy. B) the same field observed under phase contrast. The scale bar at the bottom left corner indicates 20im. The dark box at the bottom right corner was an artefact from the scale bar slider.  91 be flexible enough to accommodate foreign peptide sequences (Hofnung, 1991).  2.3.4  Monoclonal antibody reactivity of hybrid vroteins The insertion of foreign amino acid residues might affect the local  conformation of the protein and hence disrupt the antibody binding sites of OprF. To examine the effect of epitope insertion in OprF on antibody binding, the outer membrane samples containing the hybrid proteins were analyzed by Western immunoblotting with ten OprF-specific mAbs and two malarial epitope-specific  mAbs (Table XI). In general, the pattern of mAb reactivities of the OprF::malarial epitope hybrid proteins was similar to that of the OprF linker mutants. However, while the linker insertion at aa’ 88 disrupted only the MA7-8 epitope, the epitope insertion at the same site disrupted the MA4-4 epitope in addition to the MA7-8 epitope.  This difference suggested that the insertion of a longer amino acid  sequence caused more extensive disruption of the local secondary structure, thus destroying both the MA4-4 and MA7-8 epitopes. Moreover, while the linker insertion at aa ° (encoded by pRW3 14) disrupted the binding of MA7-3 and MA7-5, 31 epitope insertion at the same sites restored weak reactivities with these two mAbs, suggesting that the insertion of the malarial epitope might have restored the antibody binding site(s) to a conformation that resembled to that of the native OprF environment. This speculation was consistent with previous conclusions that these two monoclonal antibodies recognize conformational epitopes (Rawling et at., 1995). Malarial epitope inserted at all eight sites was recognized by the two malarial  Val-188  Gly-196  Arg-213  Arg-213  Gln-215  Ser-231  Arg-290  Gly-310  pRW3O7.1M  pRW3O8.1M  pRW3O9,1M  pRW3O9.3M  pRW31O.1M  pRW311.1M  pRW312.1M  pRW314.1M +  +  +  +  +  +  +  +  +  +  +  +  +  +  +  +  +  +  IVIA7-2  w  w  w  +  +  +  +  +  +  +  +  MA7-3  -  -  w  +  +  +  +  +  +  +  +  M.A7-4  w  -  w  +  +  +  +  +  +  +  +  MA7-5  +  +  +  +  +  +  +  +  +  +  +  MA7-6  -  -  w  +  +  +  +  +  +  +  +  MA7-7  Monoclonal antibody reactivitya  +  +  +  +  +  +  -  -  +  +  +  MA7-8  Determined by Western immunoblot analyses of outer membrane samples. Symbols: wild type OprF expressed by pRW3; -, no reactivity; w, weak reactivity.  a  +  A1a-26  pRW3O2.2M +  +  +  IVIA7-1  Ala-26  -  position)  Insertion sites (aa  +,  -  +  +  +  +  +  +  +  +  +  +  MA5-8  +  +  +  +  +  +  +  +  +  +  -  pf2A.1O  +  +  +  +  +  +  +  +  +  +  -  pf5A4.1  reactivity equivalent to  +  +  +  +  +  +  -  -  +  +  +  MA4-4  Summary of monoclonal antibody reactivity of OprF::malarial epitope hybrid proteins contained in outer membrane samples  pRW3O2.1M  pRW3  Plasmids  Table XI.  93  epitope-specific mAbs. Western immunoblot analysis of the outer membrane samples containing the multiple-repeat hybrids with an OprF-speciflc polyclonal antiserum demonstrated that the increase in length of the insert did not increase the amount  of degradation products in the outer membrane (Fig. 19A). The hybrid proteins remained reactive with the OprF-specific mAbs MA7-1, MA7-2, MA7-6, 1VIA7-8 (except for the series carrying insertions at aa’ ) and 1VIA5-8, of which 1VIA7-6 and 96 MA7-8 recognized conformational epitopes, indicating that the overall secondary structure of OprF was stifi conserved in these hybrid proteins (Fig. 19B).  2.4  Purification of OprF::malarial epitope hybrid proteins  Purified forms of the hybrid proteins could be useful as antigens for the study of antibody binding and as immunogens for immunogenicity studies. Therefore, efforts were made to establish a protocol for the purification of OprF or OprF: :malarial epitope hybrids from E. coli.  To simplify the purification  procedures, the E. coli strain C158 (ompA, ompC, phoF) was used as the background strain for the purification.  2.4.1 Induction experiments Since the expression of oprF was under the control of the lac promoter from the cloning vector, different IPTG induction conditions were investigated to  94  no. of aa  ins.rt.d  aa26 —  aalS6  aa213  —%  711 1619 7111519 7111519  wt  —  50325.  B  .a26  no. of aa ns.rt.d  aal9S  aa213 —  —‘  71115197It151g7111519  “I, Ilk 50— a.,.  32.5  —  .  Figure 19. Western immunoblots of OprF::malarial epitope multiple-repeat hybrids with A) an OprF-specific polyclonal antibody and B) an OprF-specific mAb MA7-6. Each set of four lanes represented hybrids carrying an insertion at the site indicated; wt, OprF with no insert. Samples carrying the aa 26 hybrids were supernatants from 3% octyl-POE extraction of outer membrane samples, while samples carrying the aa’ and aa 213 hybrids were sucrose gradient outer membrane preparations. The percentages of acrylamide used in the SDS-PAGE prior to Western transfer in A and B are 11% and 9% respectively. Samples were heated at 10000 for 10 mm before loading. Bands corresponding to oligomeric and LPS-assocjated forms of OprF are visible in some lanes. The position of OprF is indicated by a•. The positions of relevant molecular mass standards (kDa) are indicated on the left.,  95  maximize the level of OprF production. Figure 20 shows the amount of OprF hybrid proteins in the outer membrane preparations of cultures grown under different induction conditions. Induction at 30°C for 3 h with 0.2 mM or 1 mM of IPTG did not increase the expression level significantly (lanes 3 and 4). On the other hand, induction with 1 miVi IPTG at 37°C or with 0.2 mM IPTG for 16 h at 30°C increased the expression level considerably (lanes 5 to 7). Prolonged induction appeared to lead to higher levels of protein production and degradation (lane 7).  2.4.2 Detergent extractions The purification protocol for OprF was as described in Methods and materials section 11.1. Outer membrane samples prepared by sucrose gradient method were extracted with detergent in the presence of NaCl and EDTA sequentially. The three detergents tested, Triton X-100, Zwittergent 3-16 and octyl POE, gave similar results. Octyl-POE was chosen because of its mild nature which was hypothesized to preserve the structure of OprF after extraction. Figure 21 shows a Coomassie blue-stained gel of samples from the sequential detergent extraction procedures. The addition of EDTA released the tightly bound outer membrane proteins including OprF or the OprF hybrid proteins (lanes 7&8). The amount of the OprF hybrid protein in the residual insoluble fraction was significantly reduced (lane 9) as compared to that in the initial outer membrane preparations (lane 3).  96  A  1234567  325:1111114 B  34567  49.5 32,5  —l —a  Figure 20. Expression of an oprF derivative in different induction conditions.  A. SDS-PAGE of outer membrane samples containing the hybrid protein OprF::MElOaal88. Samples were heated at 37°C for 10 mm before loading. The gel was stained with Coomassie blue after electrophoresis. B. Western immunoblot of the same samples with the OprF-specific mAb MA5-8. Samples were heated at 100°C for 10 mm before loading. Lanes: 1, molecular mass standards; 2, un-induced; 3, 0.2 mM IPTG at 30°C for 3 h; 4, 1mM IPTG at 30°C for 3 h; 5, 1mM IPTG at 37°C for 3 h; 6, 1mM IPTG at 37°C for 6 h (i. e. added at the time of inoculation); 7, 0.2mM IPTG at 30°C for 16 h. IPTG was added to the cultures during the logarithmic growth phase unless otherwise stated. The position of the hybrid protein is indicated by an arrow head. The positions of relevant molecular mass standards (kDa) are indicated on the left.  _____  97  123  56789 F  -:-  —  ,4  49.50 32.5  —  Figure 21. Purification of OprF::malarial epitope hybrid proteins. SDS-PAGE analysis of samples from different steps of the purification of the OprF hybrid protein from C158 expressing pRW3O7.1M. The gel was stained with Coomassie blue after electrophoresis. Lanes: 1, molecular mass standards; 2, whole cell lysates; 3, sucrose gradient outer membrane fraction; 4, supernatant from 0.5% octyl-POE extraction; 5 & 6, supernatants from two sequential 3% octyl-POE/1M NaC1 extractions; 7 & 8, supernatants from two sequential 3% octyl-POE/lOmM EDTA extractions; 9, insoluble fraction of 3% octyl-POE/lOmM EDTA extraction. The positions of relevant molecular mass standards (kDa) are indicated on the left, The position of the OprF hybrid protein is indicated by an arrow.  98  2.4.3 FPLC nurification Based on our laboratory’s experience of OprF purification from P. aeruginosa, a single chromatography step with an anion exchange column by FPLC was introduced and found to be sufficient to yield purified OprF. Therefore, the OprF hybrids contained in the solubilized fraction after 3% octyl-POE/lOmM EDTA extraction were further purified by FPLC. In these experiments, OprF did not bind to the anion exchange column while the major contaminants in the samples bound and were eluted at a NaCl concentration of 0.3 M and 1 M respectively. Figure 22 shows the FPLC proffle of the samples eluted from MonoQ column, indicating that OprF was the predominant species in the flow through fractions.  2.4.4 Purification of inclusion body-contaminated outer membrane nreparations Attempts to prevent the formation of inclusion bodies in strains expressing the multiple-repeat hybrids at aa 26 by growing the cultures at 30°C and harvesting at early-log growth phase were unsuccessful. Detergent extraction was therefore used to isolate the membrane bound protein from the inclusion bodies (Piers et aL, 1993). It was found that extraction with 3% octyl-POE and 10mM EDTA selectively released the membrane bound protein into the supernatant while leaving the inclusion body form in the insoluble fraction (Fig. 23).  99  A  1.0  P1.2  2 A  .  NaCI(M)  L 0  B  20  12  40  60  F  ra ct) 0 fl $  34  80  0.0 100  56  32.5  -  * L  Figure 22. FPLC profile of a MonoQ column separation of the octyl POE/EDTA soluble OprF hybrid expressed by pRW3O7. 1M. A. Elution proffle with a NaC1 gradient. B. SDS-PAGE of samples corresponding to the peak fractions. Lanes: 1 & 2; 3 & 4; 5 & 6; correspond to samples from the first, second and third peaks (from left to right) respectively. The position of the OprF hybrid protein is indicated by an arrow. The positions of relevant molecular mass standards (kDa) are indicated on the right.  100  12345  .1J•  0  325I  Figure 23. Removal of inclusion bodies from outer membrane preparations by octyl-POE extraction.  SDS-PAGE of OprF::ME 19aa26..contairnng samples from the extraction. The gel was stained with ()oomassie blue after electrophoresis. Lanes: 1, outer membrane sample from a sucrose. gradient separation; 2, supematant from 0.5% octyl-POE extraction; 3 & 4, supernatants from the two sequential 3% octyl POE/lOmM EDTA extractions; 5, insoluble fraction after octyl-POE extractions. Solid and open circles indicate the positions of the inclusion body and membrane bound forms of the protein respectively. The positions of relevant molecular mass standards (kDa) are marked on the left.  101 2.5  GST::malarial epitope fusion proteins  Not only are synthetic peptides costly, they quite often do not interact efficiently with antibodies. Therefore, the genetic construction of 2 versions of GST::malarial epitope fusion proteins was undertaken to provide a source of the epitope for the detection of anti-malarial epitope antibodies in the sera of immunized animals in the later stage of this study.  2.5.1 Construction and purification of fusion proteins The  fusion  proteins  were  constructed  by  cloning  hybridized  oligonucleotides encoding the malarial epitope into the 3’ end of the GST coding region in the cloning vector pGEX-1N (Fig. 8). The resulting fusion proteins, GST::1VIE11 and GST::ME19, expressed 11 {P(NANP) NA and 19 {P(NANP) 2 NA} 4 amino acids respectively corresponding to the epitope at the C-terminus of the carrier protein. The fusion proteins were expressed in E. coli DH5ci and purified  by affinity chromatography using glutathione agarose beads as described by Smith and Johnson (1988).  Figure 24 shows that both fusion proteins had higher  apparent molecular mass than GST, in agreement with the presence of the extra malarial epitope amino acid residues. Both fusion proteins were recognized by an anti-GST polyclonal antiserum and the malarial epitope-specific mAb pf2A. 10 on Western immunoblots (Fig. 24).  102  A  B 123M  123M  —  so  -3” —  ,z S  Figure 24, Purification of QST::malarial epitope fusion proteins A. SDS-PAGE of GST::malarial epitope fusion proteins purified by affinity chromatography. The gel was stained with Coomassie blue after electrophoresis. B. Western immunoblot of the affinity-purified protein with an anti-GST polycional serum. C. the same blot reacted with the malarial epitope specific mAb pf2A.l0. Lanes: 1, GST::ME19; 2, GST::ME11; 3, GST; M, molecular mass standards. Samples were heated at 100°C for 10 mm in solubjjjzatjon buffer before loading. The positions of the relevant molecular mass standards (kDa) are indicated on the right.  103 2.5.2 Binding of fusion uroteins with euitone-snecific monoclonal antibodies Since the GST::malaria]. epitope fusion proteins were constructed for use as coating antigens in ELISA to determine the anti-malarial epitope titers in the sera of immunized anima]s, the level of binding of these proteins with the epitope specific mAbs in ELISA was also examined. As extrapolated from the binding curves, GST::ME11 had Km values of 1.25 jig/mi and 0.5 j.tg/ml for the epitope  specific mAbs pf2A. 10 and pf5A4. 1 respectively, whereas GST::1VIE 19 had Km values of 0.83 jig/ml and 0.35 jig/mi for pf2A.10 and pf5A4.1 respectively (Fig. 25). This suggested that GST::ME 19 had a slightly higher affinity for the malarial epitope specific monoclonal antibodies, which might have been due to the presence of the longer epitope sequence permitting more appropriate folding.  2.6  Summary  In this chapter, it was demonstrated that OprF could be used as a carrier for the expression and surface exposure of a malarial epitope. Two series of OprF::malarial epitope hybrids were constructed genetically. The first series, the positional hybrids, consisted of OprF hybrid proteins that expressed the malarial epitope at different permissive sites within OprF. The second series, the multiplerep eat hybrids, consisted of hybrids that expressed four different lengths of the repeating epitope at one of the three selected sites in OprF. Eight “permissive” sites were identified which could accommodate and express the model malarial  104  2 A  450 A  1  0  ‘ZZZ -  A  -  —  0  -4-  -.-  -  =-r  —  0123456789  0123456789  Conc. of coating antigen (uglmi)  Conc. of coating antigen (ug!mI)  2 D  450 A  1  0  450 A  i—  2 C  450 A  z  2 B  -A  -A-  -  —-  -  --  0  -  rr  ---  4  0123456789  0123456789  Conc. of coating antigen (uglmi)  Conc. of coating antigen (uglmi)  Figure 25. Binding of GST::màlarial epitope fusion proteins with epitope specific monoclonal. antibodies. ELISA of GST::ME11 with pf2A.l0 (A) and pf5A4.1 (B); and ELISA of GST::ME19 with pf2A.10 (C) and pf5A4.1 (D). Curves represent different dilutions of the antibodies: +, 1:1000; , 1:5000; 0, 1:25000; 4, 1:125000; A, 1:625000.  105  epitope sequence. Insertion of the epitope sequence in the cysteine-containing region of OprF increased the heat sensitivity of the hybrid proteins, while insertions in the C-terminus of the protein rendered the hybrid proteins more susceptible to degradation by cellular proteases. All of the hybrids were expressed in the outer membrane and the inserted epitope at each of the “permissive” sites was detectable on the cell surface. Western immunoblot analysis of the hybrid proteins with the series of OprF-specific mAbs indicated that the proteins retained substantial wild type conformation. Furthermore, a protocol for the purification of OprF or OprF hybrid proteins from E. coli was also established. In addition to the OprF::malanal epitope hybrids, two versions of GST::malarial epitope fusion proteins were also constructed. Both fusion proteins were reactive with the two epitope-specific mAbs tested. The availability of the two series of OprF::malarial epitope hybrid proteins provided a set of tools for the study of the effects of insertion position and length of the epitope on epitope presentation in the OprF carrier system, while the GST::malarial epitope fusion proteins represented a source of easily-purified epitope for the analysis of anti-epitope response in serum samples from immunized animals.  106  Chapter three:  Effects  of mode  of presentation on  antigenicity and  immunogenicity.  3.1  Introduction  Limited studies of two of the outer membrane protein epitope presentation systems have shown that the nature of the flanking amino acid sequences and the length of the inserted epitopes could influence the antigenicity (i.e., the ability to interact with antibody) and the immunogenicity (i.e. the ability to stimulate an immune response) of the epitopes (Agterberg et al., 1990b; Van der Werfet al., 1990). These findings suggested that more extensive investigations of the position and length effects of epitope insertion in carrier proteins will help us to exploit the effectiveness of such presentation systems. The potential of OprF as a carrier protein for the presentation of a foreign  malarial epitope was clear from the results described in the previous chapter. To further our understanding of the flexibility and limitations of the OprF system, the two series of OprF::malarial epitope hybrid proteins were used to examine the effects of the insertion position and the length of the epitope on epitope presentation in the OprF system. In this chapter, a broad survey of antigenicity of the inserted epitope is described and this led to a targeted study of immunogenicity of the epitope.  107 3.2  Antigenicity study  The antigenicity of a molecule refers to its ability to interact with antibodies. In the OprF epitope presentation systems, the accessibility of the insertion sites, the nature of flanking amino acid residues and the length of the inserted epitope might affect the interaction of the epitope with its specific antibodies. Therefore, a study was undertaken to compare the antigenicity of the epitope presented in different lengths and at different positions of OprF.  3.2.1 Aunroaches In the process of establishing an assay to evaluate the antigenicity of the epitope, a whole cell ELISA and an antigen competition assay were employed. In the whole cell ELISA, E. coli cells expressing the hybrid proteins were used as the coating antigens to capture a malarial epitope-specific monoclonal antibody. The levels of malarial epitope-specific antibody binding to the various strains of K coli cells were quantified and used as measurements for the antigenicity of the presented epitope. In the antigen competition assay, E. coli cells expressing the hybrids were used to adsorb the malarial epitope-specific antibody. The residual titers of the epitope-specific antibody were then measured by ELISA using the GST::malanal epitope fusion protein, GST::ME19, as the coating antigen. The amount of malarial epitope-specific antibody adsorbed by the various strains of E. coli cells was used as an indication of the antigenicity of the epitope in the  108  corresponding OprF::malarial epitope hybrid proteins. However, neither assay gave consistent results, presumably due to the high backgrounds in control bacteria lacking the malarial epitope. This background could be caused by the non-specific binding of the epitope-specific monoclonal antibodies, pf2A. 10 and pf5A4. 1, to surface components on E. coli cells in these assays. It was found that pf5A4. 1 was more highly reactive with E. coli outer membrane preparations in ELISA than pf2A. 10. Therefore, only pf’2A. 10 was used in the antigenicity assays. The relative antigenicity of the inserted epitope was measured by whole cell dot blot analysis  and outer membrane ELISA using the epitope-specific mAb pf2A. 10 and an OprF specific polyclonal antiserum. These assays were quite reproducible and the background readings were low under the conditions utilized. Binding titration curves of the two antibodies to OprF and an OprF::malarial epitope hybrid protein are shown in Figure 26.  3.2.2 Position effect The antigenicity of single copies of a 10-amino acid malarial epitope (NANPNANPNA) expressed at different positions of OprF was compared by whole cell dot blot analysis and ELISA using outer membranes. To take into account the various expression levels of the hybrid proteins in the outer membrane, the antigenicity index of each inserted epitope was calculated as the ratio of the anti epitope reactivity to the anti-OprF reactivity of the corresponding hybrid protein. Both assays indicated that the epitope had different relative affinities for the  _________________________  109  A —  A  /  450 A  __.  —  —  7’  0.50 //A 1/  A 1  0.00 10  5  0  15  20  Conc. of protein (uglmi)  B  1.00  7’  A 450  -  0.50  7  V V  0.00  I  0  5  I  10  Conc. of protein  20  15  (ugimi)  Figure 26. Binding of an OprF-specffic polyclonal serum (A) and the malarial epitope-specific mAb pf2A. 10 (B) with outer membranes from E. Symbols: •, vector coli expressing the following OprF variants.  control;  A,  OprF; 4, OprF::ME7aal96.  110 malarial epitope-specffic mAb pf2A. 10 when expressed at different positions in OprF (Fig. 27). However, generally siniilar antigenicity patterns were observed for given mutants in the context of both whole cells and isolated outer membranes. For example, the malarial epitope inserted at aa 215 or aa ° consistently demonstrated 31 low relative antigenicity, whereas insertions at aa’ or aa’ 96 were significantly more antigenic in both assays. In contrast, the epitope inserted at aa 26 was more antigenic in whole cell dot blot analysis, while the epitope inserted at aa 213 and ° was significantly more antigenic when assayed by outer membrane ELISA. 29 aa The dissimilarity could conceivably be due to the difference in the presentation of the epitope in whole cells as compared to an outer membrane environment. Although the hybrid proteins were likely to be in their native configuration in the outer membrane preparations, the isolation procedures might have removed part of the surface moieties such as lipopolysaccharides (LPS). The presence of cell surface LPS could promote the presentation of the inserted epitope for antibody binding at aa 26 while reducing the accessibility for antibody binding at aa 213 and . As a result, significant dissimilarities in antigenicity indices were observed 290 aa when assayed in whole cell and outer membrane environments. The antigenicity indices of the epitope in the positional hybrids are summarized in Table XII. Due to the cloning procedures, the flanking sequences of the epitopes inserted at aa , aa 231 ° and aa 29 , aa 213 ° contained cysteine residues, indicating that 31 they might participate in disulphide bond formation.  However, results from  preliminary survey showed that the antigenicity of the epitope inserted at 213 aa was  111  20  x  15  C)  >  :  10  C C) 0, C  5  0 (0 1  m  (0 O  c  C’  10  ‘  CJ  C1  C) CI  0 O CM  u  0 i  C)  Position of insertion Figure 27. Effect of insertion position on the antigenicity of the malarial epitope.  Solid and hatched bars represent results from outer membrane ELISA and whole cell dot blot analyses respectively. To allow comparisons between the two methods, the antigenicity index of the epitope inserted at aa’ 96 was used as an internal standard and arbitrarily set to 10 and the rest of the values were adjusted accordingly. Values were the means and standard deviations from six independent experiments for outer membrane ELISA and three independent experiments for dot blot analyses. The indices that were discussed in the Results section as being significantly different were confirmed by F-tests (P<0 .05).  112  Table XII. Summary of antigenicity of malarial epitope in the OprF: :malarial epitope positional hybrids. Antigenicity index 0 .  Plasmid  pRW3  Insertion site a  -  Amino acids insertedb  wt  Outer membrane  Whole cell  0  0  pRW3O2.1M  26 Ala  PAP(MGHAGP  7.06±0.58  16.49±1.24  pRW3O2.2M  26 Ala  PA{P(MGHA} G 2 P  15.58±1.19  25.60±3.05  pRW3O7.1M  88 VaT’  DLQ(MLDVQV  7.18±1.03  10.28±3.22  pRW3O8.1M  96 Ala’  PAPQ1GHAGP  10  10  pRW3O9.1M  213 Arg  TCNPQf.CRS  16. 14±1.82  5.84±0.32  pRW3O9.3M  213 Arg  TC{NP(MEC} R 3 S  20.23±1.91  12.82±2.44  pRW31O.1M  215 Gin  DLQMLDVQV  3.52±0.63  3.93±0.14  pRW311.1M  ’ 23 Ser  TCNP(MCRS  7.91±0.74  6.57±0.51  pRW312.1M  ° 29 Arg  TCNP(MCRS  10.01±0.67  4.74±0.21  pRW314.1M  ° 31 G1y  TCNPQCRS  4.25±0.31  3.83±1.42  a  Position of the amino acid preceding the insertion. At insertion sites Ala’ 96 and Ser the preceding amino acids were replaced by a glycine and arginine , 231 respectively. b  = NANPNANPNA, the outer two amino acids on both sides of the flanking sequences (i.e. PA_GP, DL_QV or TC_RS) were the results of the previous linker-insertion mutagenesis procedures.  Results are presented as means±standard deviations as described in Figure 27 legend. Antigenicity indices were calculated as described in Methods and materials section 12.  113 not affected by the presence of 2-mercaptoethanol, suggesting that the flanking cysteine residues were likely not be involved in disulphide bonding, andlor that clisuiphide bonding did not affect the presentation of the epitope for antibody binding.  3.2.3 Length effect The antigenicity of insertions containing 2 and 3 copies of the 10-amino acid epitope at aa 26 and aa 213 was also measured. Insertion of multiple copies of the epitope at both sites resulted in a significant increase in antigenicity (Table XII, rows 2&3; 6&7). The hybrid carrying 2 copies of the epitope insert at aa 26 (encoded by pRW3O2.2M) consistently demonstrated an antigenicity index which was approximately two-fold higher than that of the hybrid expressing one copy of the insert at the same site (encoded by pRW3O2. 1M), indicating that the presence of an additional copy of the epitope insert enhanced the ability of the inserted epitope to bind antibodies (Fig. 28). Similarly, the hybrid expressing three copies of the insert at aa 213 (encoded by pRW3O9.3M) also demonstrated higher antigenicity than the hybrid expressing one copy of the insert at the same site (encoded by pRW3O9. 1M) (Fig. 28). The presence of an additional copy of the epitope might have improved the exposure of the epitope and thus its accessibility for antibody binding, or it might have increased the valency of antibody binding. The lesser influence of multiple insertions at aa 213 on the antigenicity might imply that this site is already relatively well-exposed in the OprF protein, or that the effects of multivalency in this case  114  30  -  25 ‘C V >1  :  15  C  a)  0)  10  5 -I  0 C%I  Plasmid expressed in strain Figure 28. Effect of insertion of multiple copies of the malarial epitope on antigenicity at insertion sites aa 26 and aa 213 of OprF.  Plasmids pRW3O2. 1M and pRW3O2.2M encoded hybrid proteins carrying one and two copies of the epitope at aa 26 respectively; plasmids pRW3O9. 1M and pRW3O9.3M encoded hybrid proteins carrying one and three copies of the epitope at aa 213 respectively. Solid and hatched bars represent results from outer membrane ELISA and whole cell dot blot analyses respectively. Values presented are as described in Table XII foot notes (c).  115 might have induced steric hindrance which limited the accessibility of the epitope to antibody. In light of this finding, hybrids with increasing number of repeats of the tetramer unit at three different sites of OprF were constructed to investigate the effect of the length of the epitope on its antigenicity. The three sets of multiple-repeat hybrids were constructed to express 7, 11, 15 or 19 amino acids of the malarial epitope sequence at either aa , aa’ 26 96 or 213 of OprF. At insertion sites aa aa , the antigenicity of the epitope 96 ° and aa’ 2 increased as the length of the epitope increased Figs. 29 & 30). The assays for each set were repeated three times and the r (correlation coefficient) values by linear regression in each independent experiment were between 0.93 14 and 0.9877, and between 0.9453 and 0.9875 for insertion sites aa 26 and aa’ 96 respectively. In linear regression, r lies between -1 and +1, and when r is close to one this indicates a positive linear relationship (Ott, 1988). Therefore, these results demonstrated a significant, positive relationship between the length of the epitope and its antigenicity in these two cases. On the other hand, the antigenicity of the four lengths of the epitope inserted at aa 213 was not significantly different and did not seem to vary with the length of the insert (Fig. 31). According to the results obtained from the antigenicity study of the positional hybrids, the epitope inserted , 96 at aa 213 was comparatively more antigenic than that inserted at aa 26 and aa’ probably due to the better exposure of the epitope at this site. Considering this result, the shortest version of the epitope inserted at aa 213 might already be adequately accessible for antibody binding; hence the increase in length did not  116  2  x a, -o C  C., C  a,  I  0) 4-’  C  0  —  7  11  15  19  10  No. of aa corresponding to the epitope  Figure 29. Effect of the length of the epitope on its antigenicity at insertion site aa 26 of OprF.  The data from one representative experiment is shown. The r value (correlation coefficient) from linear regression analysis in this experiment was 0.9314.  117  2  x a)  C.) a)  1  0  7  11  15  19  10  No. of aa corresponding to the epitope  Figure 30. Effect of the length of the epitope on its antigenicity at insertion site aa’ 96 of OprF. The data from one representative experiment is shown. The r value (correlation coefficient) from linear regression analysis in this experiment was 0.9875.  118  4  x a, .  3  > C.)  a)  0)  2  1  0  —  7  11  15  19  10  No. of aa corresponding to the epitope  Figure 31. Effect of the length of the epitope on its antigenicity at insertion site aa 213 of OprF. The data from one representative experiment is shown. The r value (correlation coefficient) from linear regression analysis in this experiment was 0.0 17 1.  119  lead to a significant improvement in antigenicity. On the other hand, in the case of insertion sites aa 26 and. aa’ , the longer inserted sequence might increase the 96 antigenicity by improving the exposure of the epitope.  This seemed to be  particularly obvious at aa , where a more than two-fold increase in antigenicity 26  was observed as the length of the inserted epitope was increased from 7 to 11 amino acids (Fig. 29). The antigenicity of the inserted malarial epitope in the multiplerep eat hybrids is summarized in Table XIII.  3.3  Immunogenicity study  The immunogenicity of a molecule refers to its ability to elicit an immune response.  This study concentrated on the antibody responses against the  immunogens. In general, to elicit a good antibody response, the immunogen is required to have a B cell epitope which binds to receptors on B cell surface, and a T cell epitope that can be recognized by MHC class II molecules and presented to T helper cells (Guillet et al., 1986; Brown et al., 1988). In an epitope presentation system, the flanking amino acid sequences and length of an epitope might affect its interaction with B cell receptors as well as its processing and presentation by MHC molecules. This section describes the immunogenicity of a 10-amino acid epitope inserted at aa 215 and two different lengths of the epitope inserted at aa 26 of OprF. In addition, the immunogenicity of the two lengths of the malarial epitope fused to the C-terminus of GST was also investigated.  Arg-213  2 TCTR(NPNA N PNLDCRS ) TCTR(NPNA N 3 PNLDCRS ) 1 TCTR(NPNA N PNLDCRS )  pRW3O9.ll pRW3O9.19  pRW3O9.15  TCTRNPNANPNLDCRS  1 PAAR(NPN N PNLDAGP A)  pRW3O8.19  pRW3O9.7  PAARNPNANPNLDAGP PAAR(NPN N 2 PNLDAGP A) PAAR(NPN N 3 PNLDAGP A)  pRW3O8.7 pRW3O8.ll pRW3O8.15  (0.988)  (0.945)  1.54 (-0.096)  (0.415)  1.86  2  1.55  1.37  1.21  1.42  1.17  1.82  1.72  0.73 0.8 1.26  1.27 1.46  (0.959)  (0.931)  0.53  0.94  0.84  0.6  0.16  2nd  1.09  0.94  0.8  0.25  1st  ( r valuesY  (0.017)  3.61  3.65  4.01  3.48  (0.961)  1.71  0.81 0.91 1.52  (0.988)  1.3  1.01  0.48  0.26  3rd  Antigenicity indices from independent experiments  The amino acid residues corresponding to the malarial epitope are underlined. The flanking amino acids PA_OP and TC_RS were the results of the previous linker-insertion mutagenesis procedures. ID r is the correlation coefficient value by linear regression, where r >1 indicates a positive linear relationship.  a  3 PAAR(NPN N PNLDAGP A’ PAAR(NPNA)NPNLDAGP  pRW3O2.15  Ala-196  2 PAAR(NPN N PNLDAGP A)  pRW3O2.l1 pRW3O2.19  PAARNPNANPNLDAGP  pRW3O2.7  Ala-26  Amino acids inserteda  Plasmid  Insertion site  hybrids.  Table XIII. Summary of the antigenicity of the malarial epitope in OprF::malarial epitope multiple-repeat  C  121  3.3.1 Immunogenicitv of OIrF: :ME lOaa2 15 The immunogenicity of the epitope inserted at aa 215 was examined by immunizing BALB/c mice with OprF::MElOaa2l5. The two control groups included animals immunized with wild type OprF or PBS. The animals were immunized on days 0 and 14 with FPLC-purified proteins and on day 28 with 2x10 8 heat-kified  E. coli cells expressing the corresponding proteins. The anti-OprF and anti malarial epitope antibody responses were determined by ELISA using purified OprF and GST::ME19 and (NANP) 3 peptide as coating antigens respectively (Methods and materials 13.3). No significant anti-OprF and anti-malarial epitope titers were detected in antisera after two injections. Significant anti-OprF response was observed in all animals after the third injection, whereas an anti-epitope response was only observed in one of the five animals immunized with OprF::MEaa2 15 (Fig. 32). However, characterization of the antiserum from the responsive animal by Western immunoblotting failed to demonstrate the presence of anti-malarial epitope antibodies in this serum. Therefore, the anti-epitope response detected could have been due to non-specific binding of the antiserum to the coating antigen. No significant anti-OprF or anti-epitope titers was detected in the pre-immune sera or the sera from the PBS control group. These results indicated that despite the fact that the malarial epitope inserted at aa 215 of OprF was antigenic; it was not immunogenic when administered to BALB/c mice. The titers of the antisera are summarized in Table XIV.  122  2 A  2 B OprF  OprF::MElOaa2l5  ‘E’, vc’  655 A  A  4\  655 A  Vi “  isi,  \  0  — —7’?  -  —  —  W  • •  •  —  •  0  —  3 4 6 5 Log, dilutions of antisera 0  2 C  -i,,  3  4  5  6  0 dilutions of antisera Log,  2 D  OprF::ME1 Oaa2l 5  OprF  655 A  “\  4555  0  •LUJ,.  2  3  4  0 dilutions of antisera Log,  LiAIiIE  0  .—  5  2  3  ±  ,A  4  —  5  0 dilutions of antisera Log,  Figure 32. ELISA titrations of anti-OprF and anti-malarial epitope responses induced in BALBIc mice immunized with OprF and OprF::MElOaa2l5 by ELISA. A and B, anti-OprF response; C and D, anti-malarial epitope response. The anti-OprF response and anti-malarial epitope responses were measured using purified OprF and GST::ME19 as coating antigens respectively. The immunogens used in each groups are indicated on the graphs. Symbols: •, pooled pre-immune sera; A, D, 4, A, •; serum samples from five different animals.  123  Table XIV. Summary of antibody responses induced in mice immunized with wild type OprF or OprF::MElOaa2l5. ELISA titersa Immunogens  Animals  OprF::ME1Oaa215  OprF  a  Anti-OprF  AntiGST::ME19  Anti 3 (NANP)  a  5.00±0.61  3.4±0.96  <2  b  4.70±0.37  2.4±0.35  <2  c  4.70  2.8  0.35  <2  d  5.30±0.37  2.8±0.46  <2  e  5.20±0.12  2.4±0.35  <2  a  5.37±0.57  <2  NDb  b  4.37  0.41  <2  ND  c  5.27±0.64  <2  ND  d  4.97±0.71  <2  ND  e  5.57±0.41  <2  ND  ±  ±  0.37  ±  Titers are reported as the log of dilutions of antisera that gave twice of the 655 readings of the pre-immune serum at 100-fold dilutions. Anti-OprF and A anti-GST::ME19 responses were determined using purified OprF and GST::ME19 as coating antigens respectively. Anti-(NANP) 3 was determined using a synthetic peptide NANPNANPNANP as coating antigen. Antisera were taken after three injections. The reported values are mean values ± standard deviations from three independent assays. ND, not determined 1  124  3.3.2 Immunoenicitv of OurF: :ME7aa26 and OurF: :ME 19aa26 To examine the effect of the length of the epitope on its immunogenicity, two OprF::malarial epitope hybrids, OprF::ME7aa26 and OprF::MEl9aa26, carrying a 7- and a 19- amino acid malarial epitope respectively at aa , were used 26 as immunogens in an immunization study. C57BL/6J mice were immunized with 20 .tg of the gel-purffied immunogens on days 0 and 21 and with 10 .tg of the immunogens on day 35. Control groups included animals injected with wild type OprF or PBS. The anti-OprF and anti-malarial epitope antibody responses were determined by ELISA using purified OprF, GST::ME19 and (NANP) 3 peptide as coating antigens (Methods and materials 13.3). The antisera taken after the second injection showed significant anti-OprF titers (>10), but no anti-epitope titers were detected in the same sera. After 3 injections, the anti-OprF titers increased to >i0 in all three groups, while a significant anti-malarial epitope response was only detected in animals immunized with OprF::ME 19aa26 and a weak anti-malarial epitope response was detected in one of the five animals (animal a) immunized with OprF::ME7aa26 (Fig. 33, Table XV). As controls, the anti-OprF titers were similar in all three groups. Characterization of the antisera by Western immunoblotting demonstrated the presence of anti-OprF and anti-malarial epitope antibodies in the antisera that showed the corresponding antibody response in ELISA (Fig. 34). Neither the pre-immune sera nor antisera taken from the PBS control group showed any significant anti-OprF and anti-malarial epitope response. The results suggested that the 19-amino acid epitope inserted at aa 26 was significantly more  125  2—”  A  OprF::ME7aa26  6A 55  2—”  B  OprF::MEl9aa26  5A 55  \  \j  0 3456  3456  10 dilutions of antisera Log  C  2—’  10 dilutions of antisera Log  D  2—”  OprF::ME7aa26  6A 55  OprF::MEl9aa26  6A 55  &  o  0 2 3 4 5 10 dilutions of antisera Log  2 3 4 5 Log dilutions of antisera 10  Figure 33. ELISA titrations of anti-OprF and anti-malarial epitope responses induced in C57BL/6J mice immunized with OprF::ME7aa26 and OprF::MEl9aa26 by ELISA. A and B, anti-OprF response; C and D, anti-malarial epitope response. The anti-OprF and anti-malarial epitope responses were measured using purified OprF and GST::IvlEl9 as coating antigens respectively. The immunogens used in each groups are indicated on the graphs. Symbols: •, pooled pre-immune sera; A, C],+,  A,  B; serum samples from five different animals.  126  Table XV.  Summary of antibody responses induced in mice immunized with OprF::ME7aa26 and OprF::MEl9aa26. ELISA titersa  Immunogens  Animals  Anti-OprF  AntiGST::ME19  Anti 3 (NANP)  OprF  a  5.91±0.17  <2  <2  b  5.61±0.17  <2  <2  c  5.71±0.30  <2  <2  d  5.11±0.60  <2  <2  e  5.11±0.52  <2  <2  a  4.61±0.35  2.30±0.00  <2  b  5.31± 0.62  <2  <2  c  5.31±0.35  <2  <2  d  5.31±0.62  <2  2.00±0.00  e  5.71±0.30  <2  <2  a  5.71±0.30  3.40±0.35  <2  b  5.71±0.30  3.71±0.46  2.20±0.17  c  5.51±0.46  3.20±0.31  <2  d  5.31  0.62  4.21 ± 0.35  2.50 ± 0.17  e  5.71±0.30  3.05±0.26  2.15±0.21  OprF::ME7aa26  OprF::ME19aa26  a  ±  Titers are reported as the log of dilutions of antisera that gave twice of the 4 readings of the pre-immune serum at 100-fold dilutions. Antisera were taken after three injections. The antigens used were as described in Table XIV. The reported values are mean values ± standard deviations from three independent assays.  127  A  OprF::ME7aa2G p.1. a  b  c  d  OprF::MEI 9aa26 e  p.1. a  b  c d  a  7-2  I—i  B  OprF::ME7aa26  OprF::ME19aa26  p.i, a b c d a  p.1. a b Cd •  2A,1O  H Figure 34. Western immunoblot analysis of the sera from mice immunized with OprF: :ME7aa26 and OprF::ME 19aa26, A), Western immunoblot using purified E. coli OprF as the antigen with antisera from individual immunized mice at 1/1000 dilution. B). Western immunoblot using GST::ME19 as the antigen with antisera from individual immunized mice at 1/100 dilution. Lanes: p1, pooled pre-inimune sera; a,b,c,d,e; sera from five mice immunized with the indicated proteins. Arrows represent native OprF (A) and GST::ME19 (B) respectively. Positive controls used were MA7-2 and pf2A. 10 (both at 1/3000 dilution) for (A) and (B) respectively.  128  immunogenic than the 7-amino acid epitope inserted at the same site. The titers of the antisera are summarized in Table XV.  3.3.3 Immunoenicitv of GST::ME11 and GST::ME19 Due to the ease of genetic cloning and the simplicity of the subsequent purification of the fusion proteins, glutathione S-transferase is quite frequently used as a carrier to enhance the immunogenicity of small peptide immunogens (Ling et al., 1994; von Specht et al., 1995). Since two versions of GST::malarial epitope fusion proteins were already available, the immunogenicity of the epitope in these proteins was also studied so as to allow comparison between the GST and OprF carrier systems. The control groups in this experiment were immunized with GST or PBS. The anti-GST and anti-malarial epitope titers were determined by ELISA using gel-purified GST and OprF::MEl9aa26 as coating antigens respectively. Animals immunized with GST or the GST fusion proteins developed a significant anti-GST response after 2 injections. The anti-OST and anti-malarial epitope responses in antisera taken after 3 injections are shown in Figure 35. All three groups immunized with the protein immunogens generated significant anti GST titers (‘4O); however, no anti-malarial epitope response was observed in the groups immunized with the fusion proteins. Figure 36 shows the presence of anti GST antibodies in the antisera by Western immunoblotting. The same antisera did not react with OprF::MEl9aa26 on Western immunoblotting, indicating the absence of malarial epitope-specific antibodies. The inability of the GST fusion  129  A  2  B  —“  2  GST::ME11  655 A  GST::ME19  655 A •‘\  \  0 3456 10 dilutions of antisera Log  2—”  GST::ME11  655 A  3456 Log dilutions of antisera 10  D  2—”  GST::ME19  655  o  ‘,  \  o  C  \\  i  I  :1F. 10 dilutions of antisera Log  10 dilutions of antisera Log  Figure 35. ELISA titrations of anti-GST and anti-malarial epitope responses induced in C57BL/6J mice immunized with GST::ME11 and GST::ME 19. A and B, anti-GST response; C and D, anti-malarial epitope response. The immunogens used in each group are indicated on the graphs. The anti-GST and anti-malarial epitope responses were measured using purified GST and pooled pre OprF::MEl9aa26 as coating antigens respectively. Symbols: A, immune sera; A, E],•, serum samples from five different animals. •,  ,  130  GST::MEI I  p.i.abcde  ;i  GST::MEI9  piabcde  _c+c I  [ I  Figure 36. Western immunoblot analysis of the sera from mice immunized with GST::ME11 and GST::ME19.  Affinitypurffied GST was used as the antigen. Antisera examined were from individual immunized mice at 1/1000 dilution. Lanes: p.i., pooled pre  immune sera; a,b,c,d,e, sera from five mice immunized with the indicated proteins; —C, negative control using pf2A.lO; +0, positive control using an anti GST antiserum. The arrow indicates the position of GST.  131  proteins to elicit an anti-malarial epitope response was unexpected. A possible explanation could be that the folding of the epitope in the GST fusion proteins did not allow the epitope to be readily recognized by the components of the immune system. The titers of the antisera are summarized in Table XVI.  3.4  Summary  In this chapter, the antigenicity of the malarial epitope presented at different positions and in different lengths in the OprF epitope presentation system  was studied. The malarial epitope inserted at different positions of OprF displayed different binding affinities for an epitope-specific mAb. For example, the malarial epitope inserted at aa’ or aa’ 96 was consistently more antigenic than that inserted , while insertions at aa 310 at aa 215 or aa 26 or aa 213 were significantly more antigenic in the whole cell and outer membrane environments respectively.  Insertion of  multiple copies of the epitope at aa and aa 213 resulted in higher levels of antibody binding than with single copy; possibly due to the increase in valency andlor better presentation of the binding epitope. Among the three sets of multiple-repeat hybrids, insertions at aa 26 and aa’ , but not at aa 96 213 demonstrated an increase in antigenicity with the increase in length of the epitope. This suggested that the correlation between length and antigenicity of the epitope was site-dependent in the OprF system. The immunogenicity of the epitope genetically inserted in OprF or fused  132  Table XVI. Summary of antibody responses induced in mice immunized with GST::ME11 amd GST::ME19. ELISA titersa Immunogens  GST  GST::ME11b  GST::ME19b  Animals Anti  Anti-GST  AntiOprF::ME19aa26  a  4.81± 0.53  <2  <2  b  4.10±0.46  <2  <2  c  4.81±0.61  2.15±0.21  <2  d  4.41±0.46  <2  <2  a  4.90±0.76  2.10±0.17  <2  b  4.00±0.76  <2  <2  c  4.20±0.61  <2  <2  d  4.40 ±0.63  <2  <2  e  3.80 ±0.63  <2  <2  a  4.30±0.76  2.35±0.31  <2  b  4.20±0.91  2.00±0.00  <2  c  4.41±0.76  2.00±0.00  <2  d  3.80±0.76  2.20±0.17  <2  e  4.30±0.76  <2  <2  3 (NANP)  a  Titers are reported as described in Table XV footnotes. Antisera were taken after three injections. The anti-GST and anti-OprF::MEl9aa26 responses were determined by using purffied OST and OprF::MEl9aa26 as coating antigens. The anti-(NANP) 3 response was determined by using the synthetic peptide NANPNANPNANP as coating antigen. The reported values are mean values ± standard deviations from three independent assays. The ma]anal epitope sequence fused to the C-terminus of GST were NAQL and DP(NANP) 2 DP(NANP) NAQL for GST::ME11 and GST::ME19 4 respectively.  ‘0  133 to GST was also investigated. Despite its ability to interact with the malarial epitope-speciflc mAb, a 10-amino acid epitope inserted at the C-terminal insertion site aa 215 of OprF was not immunogenic. A 19-amino acid epitope inserted at the N-terminal insertion site aa 26 was able to elicit a significant anti-malarial epitope antibody response, whereas a 7-amino acid epitope inserted at the same site was only weakly immunogenic. For the GST-malarial epitope fusion proteins, it was found that neither an 11- nor a 19-amino acid epitope fused to the C-terminus of GST could stimulate an anti-malarial epitope response in immunized animals.  134  DISCUSSION  General  This study demonstrated the potential of OprF, the major outer membrane protein of P. aeruginosa, as a carrier for the presentation of foreign antigenic determinants. Semi-random linker-insertion mutagenesis was conducted to investigate the “permissiveness” of different regions of OprF to accommodate extra amino acid residues. The repeating epitope (NANP) of the circumsporozoite protein of the malarial parasite, P. falciparum, was used as a model epitope to further explore the usefulness of the insertion sites to express foreign antigenic determinants.  The antigenicity of the malarial epitope inserted at different  positions and in different lengths in OprF was compared. A targeted study was also undertaken to exanune the immunogenicity of the inserted epitope in selected OprF::mal.arial epitope hybrid proteins. The results of the linker-insertion and epitope-insertion studies have generated useful information about the membrane topology of OprF. In addition, the analysis of the reactivities of the OprF linker mutants and the OprF::malarial epitope hybrid proteins with the series of OprF-specffic monoclonal antibodies have improved our understanding of the binding epitopes of these antibodies. This study represents the first attempt to compare the antigenicity of the presented epitope in eight different insertion sites of the carrier protein in an epitope presentation  135  system. Moreover, it is also the ffrst study to systematically investigate the effects of insertion position and length of the epitope on its antigenicity in an epitope presentation system. Furthermore, this study revealed, for the first time, that OprF can be used as a carrier for a foreign epitope to generate and detect anti epitope antibodies in immunized animals and in immunoassays respectively.  Linker-insertion mutagenesis  According to restriction enzyme site analysis, there were 37 sites within oprF that were potential targets for the linker-insertion mutagenesis. However,  only 13 unique sites (including 2 in which the inserted 12 nucleotide pairs were translated to a stop codon) were identified after the screening of 100 clones by restriction enzyme digest analysis. Although attempts were made to identify sites where the insertion of the 4-amino acid linker resulted in no detectable OprF product (i.e. “non-permissive” sites), only one such site was identified. Six of the seven putative “non-permissive” clones analyzed by DNA sequencing showed that the lack of detectable OprF product was the result of deletions or the incorporation of stop codons translated from the 12 bp linker due to the reading frame at the insertion sites. It was possible that insertion sites that were close to each other have been overlooked by the restriction digest analysis. In addition, it was also likely that more unique sites could have been identified by more exhaustive screening.  136 Effects of amino acid insertions in OprF  Although the results of the characterization of the OprF linker mutants and the OprF::malarial epitope hybrid proteins suggested that these OprF variants shared many similarities to the wild type, insertion of extra amino acids at specific sites did alter the wild type properties to a limited extent. For example, the insertion of 4 amino acids at aa 2 of the mature protein directed the expression of a 41 kfla product which was of a higher apparent molecular mass than the wild type OprF (35 kDa) (Table IV). It is noted that one of the inserted amino acids was arginine. A number of studies have reported that the incorporation of positive charges at the N-terminal end of the mature protein impedes the export of membrane proteins (IViaclntyre and Henning, 1990; Geller et at., 1993; Struyvé et at., 1993b). These studies suggested that the positively-charged residues might affect the export of proteins by disrupting membrane potential and interacting with polar head groups of acid phospholipids, thus arresting the transport across the cytoplasmic membrane. On the other hand, it has also been documented that the presence of positive charges at the extreme N-terminus of the mature protein can interfere with signal peptide processing (Li et at., 1988).  Therefore, one can  speculate that this 41 kDa band corresponding to the OprF variant carrying an insertion at aa 2 represented OprF with the signal peptide stifi attached. The presence of this OprF variant in the outer membrane preparation might have been caused by contamination of the preparation with inclusion bodies, which were  137  formed as a consequence of defects in folding and the export pathway (Marston, 1986). The insertion of a 10-amino acid malarial epitope at aa 2 did not lead to any detectable product. If the insertion of 4 amino acids already interfered with the  export pathway, it is conceivable that the insertion of an additional 10 amino acids might lead to a more severe effect, resulting in the degradation of the cytoplasmic intermediate. The series of multiple-repeat hybrids carrying an insertion at site aa 26 also induced incomplete formation of inclusion bodies as indicated by the migration of some of the protein at the expected position on SDS-PAGE (Fig. 17). The inclusion body form of these proteins differed from the membrane associated form in two aspects. First, the apparent molecular mass of the inclusion bodies was higher than that of the membrane associated form of the proteins. As mentioned above, this could be due to the presence of signal peptide as a result of defective signal peptide cleavage.  Second, the inclusion body form was not modified by 2-  mercaptoethanol, indicating the absence of disulphide bond. Since the proteins required for disulphide bond formation in compartments external to the inner membrane, DsbA and DsbB, are located in the periplasm and cytoplasmic membrane respectively (Bardwell, 1994), this observation is consistent with the cytoplasmic localization of the inclusion bodies. The partial defect in export of this series of OprF::malarial epitope multiple-repeat hybrids was apparently not due to the length of the inserted sequence because the corresponding positional hybrid with a 10-amino acid insertion at the same site was completely inserted into the  138 outer membrane.  Comparison of the flanking amino acid sequences of the  positional hybrid and the multiple-repeat hybrids revealed that an arginine residue was introduced at the N-terminal side of the malarial epitope in the multiple-repeat hybrids as a result of the cloning procedures. It has been documented that positive charges introduced at positions up to +20 of the mature protein are able to inhibit export (Kuhn et al., 1994). Therefore, it is possible that the introduction of the arginine residue at aa 26 of the mature OprF might lead to the same effect. It should  be noted that the insertion of arginine residues at other sites (e.g. aa , aa 213 , and 231 multiple-repeat hybrids at aa’ ) did not affect the localization of the protein, 96 indicating that this effect was site-specific. Linker insertion at aa’ ’ directed the production of an OprF variant of 3 molecular mass identical to that of the heat-modified, unfolded form of OprF and with a distinct trypsin-cleavage pattern (Figs. 12 and 13). Thus it can be assumed that this insertion influenced the SDS stability of the protein, probably by inducing a slight change in membrane configuration. This decrease in stability may have explained the result that the insertion of a 10-amino acid epitope at this site did not lead to any detectable product. Taking together the results of the linker-insertion and epitope-insertion studies, this might reflect the inflexibility of this region of OprF to accommodate extra amino acid sequences. Linker insertions at aa’ 96 led to OprF variants with a different 88 and aa’ trypsin-cleavage pattern in outer membranes (Fig. 13), indicating exposure of a trypsin-accessible cleavage site in or adjacent to the cysteine disulphide loop. This  139 suggested that the insertion of 4 amino acids caused alterations in the local conformation, a notion supported by the loss of reactivities of these OprF variants with the OprF disulphide bond-sensitive antibodies MA4-4 and MA5-8, and yet the retention of reactivities with the rest of the OprF-specific antibodies (Table VI). Likewise, the OprF::malarial epitope hybrid proteins with epitope insertions at 88 or aa’ aa’ 96 retained reactivity with most of the OprF-specific mAbs except for MA4-4 and MA7-8 I’able XI). Therefore, by the same token, one can assume that the decrease in heat stability in these OprF variants was due to localized instability, instead of an impact on the general folding of the n-sheet structure (Fig. 14). It has been shown in this study that linker insertions at the C-terminal region of OprF demonstrated enhanced susceptibility to trypsin cleavage in the outer membrane while epitope insertions at the same region increased susceptibility of the hybrid proteins to cellular proteases.  The increase in  susceptibility could be due to the introduction of a new protease cleavage site or the increase in accessibility of existing cleavage site(s). Since the degradation product observed in all the cases had the same apparent molecular mass of 28 kDa and a cleavage product of the same apparent molecular mass was observed in wild type OprF, it seems more likely that the insertion of extra amino acids increased the accessibility of an existing cleavage site. This is reminiscent of the previous finding by Finnen et al. (1992) that C-terminal perturbations render the resulting OprF mutants more prone to protease action.  140 In cases where cysteine residues were present in the linkers translated as TCRS, interactions of these exogenous cysteines with the cysteines in OprF might disrupt the protein structure by forming alternate disuiphide bonds. However, the observations that the OprF variants with 4-amino acid insertion at 35 and aa aa’ 213 migrated with similar mobility on SDS-PAGE, showed similar 2mercaptoethanol modifiability and reacted with MA7-8 and MA4-4, which recognize epitopes sensitive to reduction of the OprF disuiphide bonds, suggested that the cysteine residue present in the linkers of these variants did not participate in disulphide bonding with the endogenous cysteine residues. A recent study has reported on cysteine substitution mutagenesis of LamB and the subsequent examination of the reactivity of the mutated proteins with different monoclonal antibodies before and after thiol treatment (Notley et al., 1994). The data obtained provided new information to extend previous maps of the monoclonal. antibody binding sites. Therefore, using the same approach, the cysteine residues introduced in the linkers might provide similar information to refine the mapping of the OprF epitopes recognized by specific antibodies.  Membrane topology of OprF  Siehnel et al. (1990) previously presented a model for OprF based on the apparent existence of two disulphide bridges between the four cysteines of OprF (Hancock and Carey, 1979), the p-turn prediction rules of Paul and Rosenbusch  141 (1985), and circular dichroism data suggesting that 62% of the secondary structure of OprF is in the form of p-sheet, a value typical for outer membrane proteins (Cowan et al., 1992; Schirmer et al., 1995). This model has been tested in part by ThphoA mutagenesis and deletion analysis of the oprF gene (Finnen et al., 1992). Sequence comparison studies have revealed that the sequences in the surface loop regions of outer membrane proteins are hypervariable. These regions are possibly least spatially constrained because of their surface location. Both of these properties lead to the assumption that these regions are more likely to tolerate extra amino acid insertions (Charbit et al., 1991).  Based on this  assumption, linker- and epitope-insertion studies of other outer membrane proteins have suggested that the “permissive” insertion sites are most likely to be within the loop regions of the proteins. Interestingly, the 3-dimensional structures of PhoE and LamB, which were resolved after the insertion studies, proved this assumption to be correct (Cowan et al., 1992; Schirmer et al., 1995). Therefore, the insertion sites characterized in this study should have similar value in defining OprF topology. With the data presented here, a new topological model of OprF was constructed partly based on the assumption that the “permissive” sites for linker insertion should be in the loop regions of the protein. It was considered that the site at aa 2 was probably periplasmic since all outer membrane proteins studied to date have N-termini that are in the periplasm. The insertion site at aa 42 was considered “non-permissive” since it resulted in no detectable product. Thus this  142  site was placed within the membrane. The remaining 9 sites were placed in surface loops. Linker insertion in five of these sites (aa’, aa’ , aa 96 , aa 231 ° and aa 29 ) 310 interrupted the binding of specific monoclonal antibodies that have been shown to bind to surface-exposed epitopes (Martin et al., 1993), and were thus placed in the surface-exposed loop regions. The placement of aa ° was supported by its location 31  within a flexible protein segment adjacent to a variable sequence (Jeanteur et al., 1991). The location of this site was further confirmed by a subsequent study which showed that the insertion point is within the linear, surface-exposed epitope for IVIA5-8 (Rawling et al., 1995). Insertions in the other 4 sites did not interrupt the binding of specific monoclonal antibodies, but these sites were assigned on the surface in keeping with the precedent in LamB and PhoE that “permissive” insertion sites are usually found in the surface ioop regions. Moreover, the results obtained from the malarial epitope-insertion study showed that the epitope inserted at these sites was detectable on the cell surface (Table IX), which supported the surface localization of these sites. A revised topological model of OprF, which is constructed in part based on the data from this study, is shown in Figure 37. The OprF topology model indicates that the insertion site at aa 215 is at the end of a transmembrane segment.  This segment has high homology to the  transmembrane segment 8 of OprF and to the consensus 16th transmembrane 3strand of the porin superfamily (Jeanteur et al., 1991), and thus appears almost  certain to be in the membrane. However, this site was found to be “permissive” for the incorporation of both the 4-amino acid linker and the 10-amino acid epitope.  143  T E N R  U  K  ri  GL EK V A  K  V  K  T 0  v  I VI 101 I H I I I El 101 li I I I LI  101 ITI IFI  I I II K G F A E  N  V Tv N  AQ N s 0  H  S 0 0 R  rirn  Js  E V S  0  A  D  IN I IL I I TI  0 L  Is I ILl lo I I Al Iii IvI  [JJ H  V  A  G  G  D N 0 H 0 0 E  Li  D S 0 V S C: V 0 A V p E p A p A A K S  C  G  0 A N Du  AA L  K  Q V p S T S T  N K 0 A  A G  23l  0  A  ®:b  N  T  A V  B N OK LS E  Figure 37. Proposed membrane topology of OprF.  The linker-insertion sites are circled and the permissive malarial epitope insertion sites are indicated by solid triangles. The top of this model is proposed to face the exterior of the cell. The transmembrane p-strands are indicated by rectangular boxes.  144 Examination of the inserted sequences suggested the possibility that sufficient  -  strand character was maintained in these sequences, which might have enabled the extension of this strand and hence the exposure of the epitope on the cell surface. Insertions at aa 213 and aa ’ appeared to promote OprF trimer stability in 23 the absence of 2-mercaptoethanol (Fig. 11). In the 3-dimensional structures of PhoE and LamB, it was revealed that the surface loop L2 is responsible for trimer association by extending from one monomer to an adjacent monomer. This leads to the speculation that the two surface loops of OprF where the insertions occurred might also be involved in OprF trimer/oligomer association. Extending these loops by 4 amino acids might enable them to reach farther to the adjacent monomer, thus enhancing trimer stability. On the other hand, the reduction of the disulphide bond by 2-mercaptoethanol might have loosened the secondary structure in a manner that resulted in the dissociation of the trimers.  Binding epitopes of OprF-specific monoclonal antibodies  The examination of the reactivities of the linker-insertion and epitope insertion derivatives of OprF with the series of OprF-specffic monoclonal antibodies also provided information about the binding epitopes of these antibodies. Recently, Rawling et al. (1995) had delineated the OprF epitopes recognized by a series of OprF-speciflc monoclonal antibodies available in our laboratory. The results of this study were based on data generated by monoclonal. antibody reactivities with  145 overlapping synthetic peptides on pins and cyanogen bromide and papain cleavage fragments of OprF. Since the insertions of the 4-amino acid linker and the malarial epitope only disrupted a localized region of the protein while apparently leaving the rest of the protein intact, these approaches represented a more subtle way to define the boundary and nature of the binding epitopes. This study provided new information about the conformational epitopes recognized by the OprF-specffic mAbs MA4-4 and MA7-8. Rawling et al. suggested that epitope(s) recognized by these antibodies are located at the same region from 52 -aa aa’ . According to the linker-insertion study, insertion of 4 amino acids at 210 96 disrupted the epitopes for both MA4-4 and MA7-8, while insertion at aa’ aa’ 88 disrupted only the MA7-8 epitope (Table VI), implying that these antibodies bind to overlapping but distinct epitope(s). Moreover, based on the observation that the presence of 2-mercaptoethanol abolished the binding of these monoclonal antibodies to OprF, the binding of MA4-4 and MA7-8 are believed to require the presence of disuiphide bond(s) (Mutharia and Hancock, 1983). In the present study, most of the OprF variants carrying linker and epitope insertions in the cysteine-containing region (aa’ 88 and aa’ ) resulted in the loss of MA4-4 and IVIA7-8 reactivities. The 96 insertion of extra amino acid residues in this region could potentially have interfered with the formation of disuiphide bond and/or affected the conformation of the disulphide bond-containing region. The observation that these variants still retained similar 2-mercaptoethanol modifiability as wild type OprF, and that the 4-amino acid insertion at aa 188 stifi retained MA4-4 reactivity suggested that the  146  disuiphide bonds were correctly formed. Hence, it is likely that the loss of MA4-4 and MA7-8 reactivity was due to a change in the secondary structure (conformation) of the amino acids in the disuiphide bond-containing region rather than the disruption of disuiphide bond formation. Therefore, it appears likely that the binding of 1VIA4-4 and 1\/1A7-8 requires both the correct formation of the disuiphide bonds and the correct secondary structure in this region. This study also shed new light on the conformational epitopes recognized by the OprF-specific mAbs MA7-3, MA7-4, MA7-5 and MA7-7. The insertion of 4  amino acids at the C-terminus of OprF (aa , aa 231 ° and aa 29 ) abolished the binding 310 of all of these monoclonal antibodies (Table VI).  Interestingly, based on the  reactivity of protease digested peptides carrying 1-2 75 amino acids, Rawling et al. (1995) have delineated the MA7-3 epitope to aa’ ° and the IVIA7-4, MA7-5 and 23 -aa 88 MA7-7 epitopes to 278 -aa The results presented here revealed that although 1 aa .  sites aa° and aa ° do not comprise the epitope(s), changes at these sites could stifi 31 affect the conformation of the epitope(s). Alternatively, the presence of extra amino acids at these sites might have reduced the accessibility of the epitope(s) for antibody binding. A number of studies have reported that changes at sites distant from the epitopes can interfere with the binding of antibodies to the epitopes (McCutcheon et al., 1993; Collawn et al., 1988). Therefore, it is possible that the insertion of the 4-amino acid linker at aa ° induced conformational 31 ° and aa 29 changes in the epitopes recognized by MA7-3, MA7-4, MA7-5 and MA7-7, and consequently interrupted the binding of these antibodies. The insertion of a 10-  147  amino acid epitope at aa ° and aa 29 ° resulted in weak binding of MA7-3, while 31 disrupted binding of MA7-4, MA7-5 and MA7-7 (Table XI). This is consistent with the results from Rawling et al. (1995), which suggested that MA7-3 recognizes a different epitope than MA7-4, MA7-5 and MA7-7. Based on monoclonal antibody reactivities of overlapping synthetic peptides on pins, Rawling et al. concluded that 1VIA7-1, 1VIA7-2 and MA5-8 recognize linear epitopes of OprF. In general, the disruption of the linear binding epitopes by insertions in this study was consistent with the epitope boundaries as defined by this previous study (Rawling et al., 1995 and Table III). The only exception was that the OprF linker mutant carrying an insertion at aa’ ’ was not reactive with 3 1VIA7- 1 (Table VI), whose epitope has been mapped to aa 55 to aa 62 of OprF. Since  insertion at aa’ ’ appeared to cause minimal changes in OprF membrane 3 configuration in that the binding of the majority of mAbs was unaffected, the loss of MA7- 1 reactivity of this mutant might have been due to the masking of the MA71 epitope as a result of the extension of an adjacent ioop.  Antigenicity and mode of presentation  The larger number of sites examined in this study permitted us to attempt to correlate the measured antigenicity of the epitope at the various insertion sites with the primary and secondary structures at these sites. The possible structures of each insertion site were analyzed using various structure  148 prediction methods (Table XVII).  The structures at each insertion site were  analyzed in the context of the entire protein, as well as in a segment of the sequence including the six OprF amino acid residues flanking either side of the insertion. When only the flanking residues were taken into consideration, the Gascuel and Golmard Basic Statistical Methods (GGBSM) analysis (Gascuel and Golmard, 1988) predicted that three or more amino acids were in extended conformation on at least one of the flanking sequences of insertion sites 196 aa 29 , aa ° and aa , where epitope insertion showed medium to high antigenicity (Fig. 27). 213 The antigenic determinant program of Hopp and Woods (1981) predicted that these sites have comparatively low to medium hydrophiiicity on both sides of the flanking regions. When analyzed in the context of the entire amino acid sequence, the insertion sites that exhibited high relative antigenicity were found in regions that were generally predicted to be more flexible in their local secondary structure and to have higher coil propensity (Karplus and Schulz, 1985).  Although the  correlations were not universal, the general trend of extended conformation and high flexibility of the local sequences at insertion sites which resulted in high relative antigenicity of the inserted epitope seemed to suggest that these features might improve the accessibility of the epitope. It is noteworthy that epitope inserted at aa 5 demonstrated 213 and aa’ significantly different antigenicities despite the fact that these insertion sites are only 2 amino acids apart (Fig. 27). The proposed location of aa 215 is at the cell surface end of a transmembrane segment of OprF. Based on the proposed model  149  Table XVII.  No. residues in extended conform ationa Rightb Leftb  Average hydrophilicityc Right  Left  Ala-26  0  0  0.45  Val-188  0  0  Ala- 196  0  Arg-213  Insertion sites  a  Predicted primary and secondary structures at the insertion sites.  Probability of coil conformationa,e  (%)  Flexibility B [normJ  0.33  55  1.09  0.42  1.03  35  0.98  3  0.43  -0.4  72  1.08  3  4  0.34  0.53  25  1.01  Gln-215  0  1  0.28  0.53  27  0.95  Ser-231  0  0  1.78  0.42  30  1.08  Arg-290  0  6  0.77  0.75  47  1.07  Gly-310  0  0  0.3  1.15  35  1.05  as predicted by the GGBSM program (Gascuel and Golmard, 1988). right and left of the flanking sequences respectively. cas predicted by the Antigenic Determinant program (Hopp and Woods, 1981). The highest and lowest hydrophilicity values of the various regions of the entire protein are 2 and -1.5, respectively. d as predicted by the Flexpro program (Karplus and Schulz, 1985), the numbers cited are the B[norm] values. The B[norm] values of the whole protein range from 0.820 to 1.129. analyzed in the context of the entire protein.  b  150 of OprF topology, it can therefore be hypothesized that part of the inserted epitope might be at the membrane interface and/or that the exposure of the epitope was shielded by the protruding surface loops, thus resulting in low antigenicity. The results of antigenicity studies suggested that LPS plays a role in the presentation of epitope for antibody binding at aa , aa 26 . This indicated 290 213 and aa that these regions of OprF are involved in LPS association. Therefore, depending on the type of antigen preparation chosen (i.e. whole cells or outer membranes), the choice of insertion sites for optimal antigenicity may vary. The relatively high  antigenicity of the inserted epitope at aa 213 and aa , and the fact that most OprF 290 specific monoclonal antibodies recognize epitope(s) that are located in this region, suggested the immunodominance of this region of OprF. This notion is supported by a recent report which identified seven B cell epitopes, two of which are surfaceexposed, in the C-terminal region (aa’ ) of OprF, confirming that this part of 350 -aa 90 the protein is rich in B cell epitopes (von Specht et al., 1995). The antigenicity of epitope insertions at aa 96 increased with the 26 and aa’ length of the epitope, while that at aa 213 did not (Table XIII).  This may be  explained by the degree of exposure of the insertion sites. Since the 10-amino acid epitope inserted at aa 213 was comparatively more antigenic, it appears that this site is already well-exposed. On the other hand, the 10-amino acid epitope inserted at 19 only displayed relatively low to medium antigenicity, suggesting 26 and aa aa mediocre exposure at these sites. Therefore, it appears that increasing the length of the epitope at aa 26 and aa’ 96 might have improved its exposure, thus facilitating  151 its presentation for antibody binding. This is reminiscent of the insertion of the FMIV epitope into the third loop of PhoE, which is a loop that is hidden inside the  pore region of the protein. Researchers found that the insertion of one copy of the epitope does not result in the surface exposure of the epitope. However, insertion of multiple copies of the epitope forces this loop out of the pore, leading to exposure of the epitope (Struyvé et al., 1993a). Since the epitope-specific monoclonal antibody pf2A. 10 was used in the antigenicity assays, one should keep in mind that the antigenicity of the epitope discussed in this study should only refer to its binding to this monoclonal antibody. Survey experiments using two other epitope-specific monoclonal antibodies to evaluate the correlation between antigenicity and the length of the epitope at aa’ 96 and aa 213 revealed the same findings as those observed using pf2A. 10 (i.e. positive correlation at aa’ 96 and no correlation at aa ). These results implied that the 213 trend of antigenicity observed using pf2A. 10 may apply to the binding of other antibodies in general.  Immunogenicity  In general, the basic mechanisms of an immune response involve the production of antibodies and the development of cellular immunity. This study concentrated on the examination of antibody (more specifically, IgO) response against the immunogens. Therefore, the scope of immunogenicity discussed in the  152  context of this study is limited to the induction of antibody response.  The  immunogenicity of the inserted malaria]. epitope in five selected proteins, representing two different carriers (OprF and GS’I), was investigated in this study. The inserted epitope in only one of the proteins demonstrated significant immunogenicity.  A number of factors might have caused the lack of  immunogenicity of the inserted epitope. In this section I will attempt to address some of the possibilities. A 19-amino acid epitope inserted at aa 26 of OprF (OprF::MEl9aa26) was significantly more immunogenic than a 7-amino acid epitope inserted at the same site (OprF::ME7aa26) (Table XV). Since no anti-malarial epitope response was detected in the immunized animals after the first injection, it indicated that the response was T cell-dependent. To generate a T cell-dependent response, the immunogen is required to have a B cell epitope which binds to the antigen receptor on B cells, as well as a T cell epitope that can be recognized by MHC class II molecules and presented to T helper cells (Guillet et al., 1986; Brown et al., 1988). The difference in immunogenicity of the 2 versions of malarial epitope inserted at the same position of OprF could be due to a number of factors. For instance, the increase in length of the epitope might have increased the accessibility of the epitope for binding to the B cell antigen receptor, as was indicated by the results of the antigenicity study which demonstrated a positive correlation between length and antigenicity at aa . 26  Alternatively, since B cell activation requires the  crosslinking of B cell antigen receptors, the poor immunogenicity of the shorter  153  version of the epitope might reflect its poor ability to elicit B cell receptor signalling. Nevertheless, it is quite possible that all of the factors mentioned above played a role in determiming the immunogenicity of the epitope in this experiment. The examination of the immunogenicity of the epitope in OprF::MEllaa26 and OprF::MEl5aa26 will further define the minimal length requirement for the immunogenicity of the epitope andlor the relationship between antigenicity and immunogenicity. Using the same logic, the low antigenicity of the epitope inserted at aa 215 could have been indicative of the lack of immunogenicity of this epitope in the context of OprF: :ME lOaa2 15. However, it is not likely that the intrinsic factors such as the antigenicity of the epitope were the sole factors affecting its immunogenicity in this case. Using the filamentous phage pill protein as carrier, Cruz et al., (1988) reported that although the inserted malarial epitope is antigenic  in vitro, it is not necessarily immunogenic when administered to mice. An earlier study had also revealed that the malarial epitope is recognized as a T cell epitope only in mouse strains with  b 112  and H2k backgrounds (Good et al., 1986). Since  significant anti-OprF response was elicited in the BALB/c mice (H-2”) used in this study, it indicates that OprF could recruit the required T cell response for the epitope.  Therefore, the non-responsiveness of the animals immunized with  OprF::MElOaa2l5 was likely due to inadequate B cell activation. Of course, the use of a lower dosage (10 .tg instead of 25 jig as used in the other study) and the use of adjuvant might have also contributed to the non-responsiveness of the  154  immunized animals. However, the impact of these factors could not be easily evaluated by the simple design of the experiment in this study. Successful antigen processing and presentation of the T cell epitope are two essential steps involved in an efficient antibody response.  It has been  documented that sequences outside a minimal epitope can affect the products of processing and thus may determine whether a peptide is selected for presentation (Van der Werfet al., 1990; Del Valet al., 1991; Janssen et al., 1994b). Now that an effective immunization protocol has been established, similar studies using the other 2 series of multiple-repeat hybrids carrying the epitope at aa’ 96 and aa 213 might provide information about the length requirement at these two sites. A comparison of such results should elucidate the position effect (if one exists) on the immunogenicity of the epitope in the OprF presentation system. Moreover, these results might also increase our general understanding of the effect of flanking  amino acid residues on immunogenicity. However, such studies were beyond the scope of the current thesis. The inability of the GST::malarial epitope fusion proteins to generate an anti-malarial epitope response was unexpected (Table XVI). Since the protocol utilized for the immunogenicity study of the GST::malarial epitope fusion proteins was the same as that for the OprF::MEaa26 hybrid proteins, it is not likely that extrinsic factors such as the genetic background of the animals, the use of adjuvant,  and the route of delivery were involved in the non-responsiveness of the immunized animals. The length of the epitope should not be a limiting factor either because  155  the length of the epitope m GST::ME19 is comparable to that in OprF::MEl9aa26. One possible explanation could be that the conformation of the epitope in the GST::malaria]. epitope fusion proteins prevents its interaction with the components of the immune system. Based on the previous experience in this laboratory, attempts made to release a fusion peptide from the GST protein by protease cleavage at an engineered recognition site were unsuccessful, presumably due to the folding of the epitope in the fusion protein which limits the accessibility of the cleavage site (Piers, 1993). Similarly, antigen processing also requires cleavage of the original proteins by proteases. Therefore, one is tempted to speculate that the folding of the epitope in vivo might have rendered the protease cleavage site inaccessible for antigen processing, resulting in its failure to elicit an efficient antibody response. In spite of its inability to stimulate an anti-malarial epitope antibody response, the GST::malarial epitope fusion proteins were useful for the detection of anti-epitope titers in antisera from animals immunized with the OprF::malarial epitope hybrid proteins. ELISA using the fusion protein as coating antigen for the determination of anti-malarial epitope titers was more sensitive than that using the synthetic peptide (NANP) 3 as coating antigen (Table XV). The same difference in sensitivity was also observed in ELISA using OprF::malarial epitope hybrid protein as coating antigen as compared to that using the same synthetic peptide (Table XV1). On the other hand, the synthetic peptide could be recognized by both of the malarial epitope-specific mAbs pf2A. 10 and pf5A4. 1, suggesting that it is antigenic.  156 These findings are consistent with the general knowledge that synthetic peptides alone do not interact effectively with antibodies, probably due to inadequate presentation. Despite the apparent versatility of the OprF epitope presentation system, there were difficulties encountered in the course of this study that can be potential pitfalls of the system. For example, when E. coli cells expressing the OprF hybrid proteins were used as antigens in ELISA, the non-specificity binding of the epitope specific monoclonal antibodies to whole cells was too high to permit any meaningful interpretation of the data. This problem was more prominent with the mAb MA5A4. 1, which appeared to have lower affinity for the inserted epitope. Titration study of this monoclonal antibody with E. coli outer membrane containing OprF or one of the OprF::malarial epitope hybrid proteins showed that the dilution of the antibody that allowed reasonable sensitivity also resulted in significant background reactivity. Therefore, if whole cells containing the OprF hybrid proteins are to be used as antigens for the detection of anti-epitope antibody, the non-specificity of antibody binding should be carefully monitored. The instability of the plasmids encoding OprF::malarial epitope multiplerepeat hybrids in C 158 became a significant concern at the later stage of this study. Recombinant C158 strains had the tendency to lose the plasmids upon subculturing and subsequent growth in liquid medium. The ability of the host strain alone to grow in the presence of ampicillin remains puzzling. Since hydrophilic -lactam antibiotics such as ampiciilin are believed to be taken up by the bacterial cells via  157  the porin pathway, the lack of porins in the strain C158 may increase the ampicillin resistance of the bacteria. An attempt to enhance plasmid stability by  raising the ampicillin concentration in the medium to 200 jig/nil was unsuccessful. Therefore, efforts to improve the stability of the recombinant plasmids in the host strain would be necessary to ensure the efficiency of the OprF epitope presentation  system. Using the malarial epitope as a model epitope, this study has shown that the OprF epitope presentation system can be used to raise and detect malarial epitope-specific antibodies. In addition, it has also been demonstrated that the OprF and GST systems can be used in a complementary fashion as a set of simple  and flexible tools to induce and monitor an anti-peptide response without the use of synthetic peptides. The ability of OprF to promote immunogenicity of a foreign epitope and its potential as a vaccine against P. aeruginosa infections suggested that it has the possibility for the development of a multivalent vaccine. In the course of this study, and using one of the OprF linker mutant plasmid vectors described here, a Pseudomonas pilin epitope was inserted in the context of OprF and shown to be recognized by its specffic antibody in ELISA (B. Finlay, personal communication). Currently, OprF is being used to express random fragments of the ifiamentous haemagluttinin (FHA) gene of Bordetella pertussis and has shown some promising results for the mapping of antibody binding epitope(s) and functional domains of the protein (A. Siebers and B. Finlay, unpublished results). Attempts are also being made to utilize OprF as a carrier for  158  a neutralizing epitope of TSST-1, the Toxic Shock Syndrome Toxin-i of  Staphylococcus aureus (E. Rubinchik and A. Chow, personal communication). The increased use of the OprF epitope presentation system should expand the repertoire  of foreign epitopes that can be presented and further explore the potential applications of this system.  159  REFERENCES Agterberg, M., H. Adriaanse, H. Lankhof, R. Meloen, and J. Tommassen. 1990a. Outer membrane PhoE protein of Escherichia coli as a carrier for foreign antigenic determinants: immunogenicity of epitopes of foot-and-mouth disease virus. Vaccine 8: 85-9 1. Agterberg, M., H. Adriaanse, A. van Bruggen, M. Karperien, and J. Tommassen. 1990b. Outer-membrane PhoE protein of Escherichia coli K- 12 as an exposure vector: possibilities and limitations. Gene 88: 37-45. Angus, B.L., A.M. Carey, D.A. Caron, A.M.B. Kropinski, and R.E.W. Hancock. 1982. Outer membrane permeability in Pseudomonas aeruginosa: comparison of a wild-type with an antibiotic-suspersusceptible mutant. Anti. Agents Chemother. 21: 299-309. Ausubel, F. M., R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith and K. Struhi. 1987. Current Protocols in Molecular Biology. Greene Publishing Associates and Wiley-Interscience, New York, New York. Baflou, W. R., J. Rothbard, R.A. Wirtz, D.M. Gordan, J.S. Williams, R.W. Gore, I. Schneider, M.R. Hoffingdale, R.L. Beaudoin, W.L. Maloy, L.H. lVIiller, W.T. Hockmeyer. 1985. Immunogenicity of synthetic peptides from circumsporozoite protein of Plasmodium falciparum. Science 228: 996-999. Barbas, C.F., A.S. Kang, R.A. Lerner and S.J. Benkovic. 1991. Assembly of combinatorial antibody libraries on phage surfaces: the gene III site. Proc. Nati. Acad. Sci. USA 88: 7978-7982. Bardwell, J.C.A.. 1994. Building bridges: clisulphide bond formation in the cell. Molec. Microbio. 14: 199-205. Beffido, F., N.L. Martin, R.J. Siehnel, and R.E.W. Hancock. 1992. Reevaluation in intact cells of the exclusion limit and role of porin OprF in Pseudo monas aeruginosa outer membrane permeability. J. Bacteriol. 174: 5 196-5203. Berzofsky, J.A. 1985. Intrinsic and extrinsic factors in protein antigenic structure. Science 229: 932-939. Bosch, D. and J. Tommassen. 1987. Effects of linker insertions on the biogenesis and functioning of the Escherichia coli outer membrane pore protein PhoE. Mol. Gen. Genet. 208: 485-489.  160  Boulain, J.C., A. Charbit, and M. Hofnung. 1986. Mutagenesis by random linker insertion into the lamB gene of Escherichia coli K12. Mol. Gen. Genet. 205: 339-348. Broekhuijsen, M.P., T. Blom, J. van Rijn, P.R. Pouwels, E.A. Kiasen, M.J. Fasbender and B.E. Enger-Valk. 1986. Synthesis of fusion proteins with multiple copies of an antigenic determinant of foot-and-mouth disease virus. Gene 49: 189-197. Brooks, B.R., R.W. Pastor, and F.W. Carson. 1987. Theoretically determined threedimensional structure for the repeating tetrapeptide unit of the circumsporozoite coat protein of the malaria parasite Plasmodium falciparum. Proc. Nati. Acad. Sci. USA 84: 4470-4474. Brown, J.H., T. Jardetzky, M.A. Saper, B. Samraoui, P.J. Bjorkman, and D.C. Wiley. 1988. A hypothetical model of the foreign antigen binding site of class II histocompatibility molecules. [Correction in Nature 333: 786]. Nature 332: 845-850. Brown, S. 1992. Engineered iron oxide-adhesion mutants of the Escherichia coli phage A receptor. Proc. Natl. Acad. Sci. USA 89: 865 1-8655. Calvo-Calle, J.M., G.A. de Oliveira, P. Clavijo, M. Maracic, J.P. Tam, Y.A. Lu, E.H. Nardin, R.S. Nussenzweig, and A.H. Cochrane. 1993. Immunogenicity of multiple antigen peptides containing B and non-repeat T cell epitopes of the circumsporozoite protein of Plasmodium falciparum. J. Immunol. 150: 14031412. Caulcott, C.A., M.R.W. Brown, and I. Gonda. 1984. Evidence for small pores in the outer membrane of Pseudomonas aeruginosa. FEMS Microbiol. Lett. 21: 119123. Charbit, A., J. Ronco, V. IVlichel, C. Werts, and M. Hofnung. 1991. Permissive sites and topology of an outer membrane protein with a reporter epitope. J. Bacteriol. 173: 262-275. Charbit, A., E. Sobczak, M. lVlichel, A. Molla, P. Tiollais, and M. Hofnung. 1987. Presentation of two epitopes of the preS2 region of hepatitis B virus on live recombinant bacteria. J. Immunol. 139: 1658-1664. Charbit, A., A. Molla, J. Ronco, J. Clement, V. Favier, E.M. Bahraoui, L. Montagnier, A. Leguern, and M. Hofnung. 1990. Immunogenicity and antigenicity of conserved peptides from the envelope of HIV- 1 expressed at the surface of recombinant bacteria. AIDS 4: 545-551.  161 Charbit, A., P. Martineau, J. Ronco, C. Leclerc, R. Lo-Man, V. Michel, D. O’Callaghan, and M. Hofnung. 1993. Expression and immunogenicity of the V3 loop from the envelope of human immunodeficiency virus type 1 in an attenuated aroA strain of Salmonella typhimurium upon genetic coupling to two Escherichia coli carrier proteins. Vaccine 11: 1221-1228. Chen, Y-H. U., R.E.W. Hancock, and R.I. Mishell. 1980. IVlitogenic effects of purified outer membrane proteins from Pseudomonas aeruginosa. Infect. Immun. 28: 178-184. Collawn, J.F., C.J. Wallace, A.E. Proudfoot, and Y. Paterson. 1988. Monoclonal antibodies as probes of conformational changes in protein-engineered cytochrome c. J. Biol. Chem. 263: 8625-8634. Cowan, S.W., T. Schirmer, G. Rummel, M. Steiert, R. Ghosh, R.A. Pauptit, J.N. Jansonino, and J.P. Rosenbusch. 1992. Crystal structures explain functional properties of two .E. coli porins. Nature 358: 727-733. Crompton, J., C.I.A. Toogood, N. Waffis, and R. T. Hay. 1994. Expression of a foreign epitope on the surface of the adenovirus hexon. J. Gen. Virol. 75: 133139. Cruz, de la. V.F., A.A. Lal, and T.F. McCutchan. 1988. Immunogenicity and epitope mapping of foreign sequences via genetically engineered ifiamentous phage. J. Biol. Chem. 263: 4318-4322. Dame, J. B., J.L. Wiffiams, T.F. McCutchan, J.L. Weber, R.A. Wirtz, W.T. Hockmeyer, W.L. Maloy, J.D. Haynes, I. Schneider, D. Roberts, G.S. Sanders, E. P. Reddy, C.L. Diggs, L.H. Miller. 1984. Structure of the gene encoding the immunodominant surface antigen on the sporozoite of the human malaria parasite Plasmodium falciparum. Science 225: 593-599. De Mot, R. and J. Vanderleyden. 1994. The C-terminal sequence conservation between OmpA-related outer membrane proteins and MotB suggests a common function in both Gram-positive and Gram-negative bacteria, possibly in the interaction of these domains with peptidoglycan. Mol. Microbiol. 12: 333-334. Del Val, M., H.-J., Schlicht, T. Ruppert, M.J. Reddehase, and U.H. Koszinowski. 1991. Efficient processing of an antigenic sequence for presentation to MHC class I molecules depends on its neighbouring residues in the protein. Cell 66: 1145-1153.  162 Der Vartanian, M., M.-C., Méchin, B. Jaffeux, Y. Bertin, I. Felix and B. Gaillard Martinie. 1994. Permissible peptide insertions surrounding the signal peptide-mature protein junction of the Cp1G prepilin: CS3 1A fimbriae of Escherichia coli as carriers of foreign sequences. Gene 148: 23-32. Duchene, M., A. Schweizer, F. Lottspeich, G. Krauss, M. Marget, K. Vogel, B-U. von Specht, and H. Domdey. 1988. Sequence and transcriptional start site of the Pseudomonas aeruginosa outer membrane porin protein F gene. J. Bacteriol. 170: 155-162. Dyson, H.J., A.C. Satterthwait, R.A. Lerner, and P.E. Wright. 1990. Conformational preferences of synthetic peptides derived from the immunodominant site of the circumsporozoite protein of Plasmodium falciparum. Biochemistry. 29: 7828-37. Elish, M.E., J.R. Pierce, and C.F. Earhart. 1988. Biochemical analysis of spontaneous fepA mutants of Escherichia coli. J. Gen. Microbiol. 134: 13551364. Evans, D.J., J. Mckeating, J.M. Meredith, K.L. Burke, K. Katrak, A. John, M. Ferguson, P.D. Minor, R.A. Weiss, J.W. Almond. 1989. An engineered poliovirus chimeara elicits broadly reactive HIV- 1 neutralizing antibodies. Nature 339: 385-388. Fasman, G.D., K. Park, and D.H. Schlesinger. 1990. Conformational analysis of the immuno dominant epitopes of the circumsporozoite protein of Plasmodium falciparum and knowlesi. Biopolymers 29: 123-130. Finnen, R.L., N.L. Martin, R.J. Siehnel, W.A. Woodruff, M. Rosok, and R.E.W. Hancock. 1992. Analysis of the major outer membrane protein OprF from Pseudomonas aeruginosa using truncated OprF derivatives and monoclonal antibodies. J. Bacteriol. 174: 4977-4985. Foulds, J. and T-J. Chai. 1979. Isolation and characterization of isogenic E. coli strains with alterations in the level of one or more major outer membrane proteins. Can. J. Microbiol. 25: 423-427. Francisco, J.A., R. Campbell, B.L. Iverson, and G. Georgiou. 1993. Production and fluorescence-activated cell sorting of Escherichia coli expressing a functional antibody fragment on the external surface. Proc. Natl. Acad. Sci. USA. 90: 10444-10448.  163 Freud, R., S. Maclntyre, M. Degen, and U. Henning. 1986. Cell surface exposure of the outer membrane protein OmpA of Escherichia coli K12. J. Mol. Biol. 188: 491-494. Gammon, G., N. Shastri, J. Cogswell, S. Wilbur, S. Sadegh-Nasseri, U. Krzych, A. Miller, and E. Sercarz. 1987. The choice of T-cell epitopes utilized on a protein antigen depends on multiple factors distant from, as well as at the determinant site. Immunol. Rev. 98: 53-73. Gascuel, 0. and J. L. Golmard. 1988. A simple method for predicting the secondary structure of globular proteins: implications and accuracy. Computer Applications in the Biosciences 4:357-365. Geller, B., H.-Y. Zhu, S. Cheng, A. Kuhn, and R.E. Dalbey. 1993. Charged residues render pro-OmpA potential dependent for initiation of membrane translocation. J. Biol. Chem. 268: 9442-9447. Gibson, K.D. and H.A. Scheraga. 1986. Predicted conformations for the immunodominant region of the circumsporozoite protein of the human malarial parasite Plasmodium falciparum. Proc. Natl. Acad. Sci. USA 83: 5649-56 53. Gifieland, Jr. H.E., M.G. Parker, J.M. Matthews, and R.D. Berg. 1984. Use of a purified outer membrane protein F (porin) preparation of Pseudomonas aeruginosa as a protective vaccine in mice. Infect. Immun. 44: 49-54. Gilleland, Jr., H.E., L.B. Gifieland, and J.M. Matthews-Greer. 1988. Outer membrane protein F preparation of Pseudomonas aeruginosa as a vaccine against chronic pulmonary infection with heterologous immunotype strains in a rat model. Infect. Immun. 56: 10 17-1022. Good, M.F., J.A. Berzofsky, W.L. Maloy, Y. Hayashi, N. Fujii, W.T. Hockmeyer, and L.H. Miller. 1986. Genetic control of the immune response in mice to a Plasmodium falciparum sporozoite vaccine. J. Exp. Med. 164: 655-660. Good, M.F., W.L. Maloy, M.N. Lunde, H. Margalit, J.L. Cornette, G.L. Smith, B. Moss, L.H. Miller, and J.A. Berzofsky. 1987. Construction of synthetic immunogen: use of new T-helper epitope on malaria circumsporozoite protein. Science 235: 1059-1062. Gotoh, N., H. Wakebe, E. Yoshihara, T. Nakae, and T. Nishino. 1989. Role of protein F in maintaining structural integrity of the Pseudomonas aeruginosa outer membrane. J. Bacteriol. 171: 983-990.  164  Gregoriadis, G. 1990. Immunological adjuvants: a role for liposomes. Immunology today 3: 29-39. Guillet, J.G., M.-Z. Lai, T.J. Briner, J.A. Smith, and M.L., Gefter. 1986. Interaction of peptide antigens and classll major histocompatibioity complex antigens. Nature 324: 260-262. Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166: 557-580. Hancock, R.E.W. and H. Nikaido. 1978. Outer membranes of gram-negative bacteria: isolation from Pseudomonas aeruginosa PAO1 and use in reconstitution and definition of the permeability barrier. J. Bacteriol. 136: 38 1-390. Hancock, R. E. W., and A. Carey. 1979. Outer membrane of Pseudomonas aeruginosa: Heat- and 2-mercaptoethanol-modifiable proteins. J. Bacteriol. 140: 902-9 10. Hancock, R.E.W. and R. Benz. 1986. Demonstration and chemical modification of a specific phosphate binding site in the phosphate-starvation-inducible outer membrane porin protein P. Biochimica et Biophysica Acta 860: 699-707. Hancock, R.E.W., G.M. Decad, and H. Nikaido. 1979. Identification of the protein producing transmembrane diffusion pores in the outer membrane of Pseudomonas aeruginosa PAO1. Biochim. Biophys. Acta 554: 323-329. Hansson, M., S. Stahl, T.N. Nguyen, T. Bächi, A. Robert, H. Binz, A. Sjölander, and M. Uhlén. 1992. Expression of recombinant proteins on the surface of the coagulase-negative bacterium Staphylococcus xylosus. J. Bacteriol. 174: 4239-4245. Hayes, L.J., J.W. Conlan, J.S. Everson, M.E. Ward, and I.N. Clarke. 1991. Chlamydia trachomatis major outer membrane protein epitopes expressed as fusions LamB in an attenuated aroA strain of Salmonella typhimurium; their application as potential immunogens. J. Gen. Microbiol. 137: 15571564. Hedegaard, L., and P. Klemm. 1989. Type 1 fimbriae of Escherichia coli as carriers of heterologous antigenic sequences. Gene 85: 115-24. Hopp, T.P., and K.R., Woods. 1981. Prediction of protein antigenic determinants from amino acid sequences. Proc.Natl.Acad.Sci. USA 78: 3824-3828.  165  Janssen, R. and J. Tommassen. 1994. PhoE protein as a carrier for foreign epitopes. Intern. Rev. Immunol. 11: 113-12 1. Janssen, R., M. Wauben, R. van der Zee, and J. Tommassen. 1994a. Immunogenicity of a mycobacterial T-cell epitope expressed in outer membrane protein PhoE of Escherichia coli. Vaccine 12: 406-409. Janssen, R., M. Wauben, R. van der Zee, M. de Gast, and J. Tommassen. 1994b. Influence of amino acids of a carrier protein flanking an inserted T cell determinant on T cell stimulation. Intern. Immunol. 6: 1187-1193. Jeanteur, D., J.H. Lakey, and F. Pattus. 1991. The bacterial porin superfamily: sequence alignment and structure prediction. Molec. lVlicrobiol. 5: 2153-2164. Jenkins, 0., J. Cason, K.L. Burke, D. Lunney, A. Gifien, D. Patel, D.J. McCance and J.W. Almond. 1990. An antigen chimera of poliovirus induces antibodies against human papifiomavirus type 16. J. Virol. 64: 120 1-1206. Karplus, P. A. and G. E. Schulz. 1985. Prediction of chain flexibility in proteins. A tool for the selection of peptide antigens. Naturwissenschaften. 72:2 12213. Kuhn, A., D. Kiefer, C. Köhne, H.-Y. Zhu, W.R. Tschantz, and R. E. Dalbey. 1994. Evidence for a loop-like insertion mechanism of pro-OmpA into the inner membrane of Escherichia coli. Eur. J. Biochem. 226: 89 1-897. Lenstra, J.A., J.H. Erkens, J.G. Langeveld, W.P. Posthumus, R.H. Meloen, F. Gebauer, I. Correa, L. Enjuanes, K.K. Stanley, 1992. Isolation of sequences from a random-sequence expression library that mimic viral epitopes. J. Immunol. Methods. 152: 149-157. Leclerc, C., P. Martineau, S. van der Werf, E. Deriaud, P. Duplay, and M. Hofnung. 1990. Induction of virus-neutralizing antibodies by bacteria expressing the C3 poliovirus epitope in the periplasm. J. Immunol. 144: 3174-3 182. Leclerc, C., A. Charbit, P. Martineau, E. Deriaud, and M. Hofnung. 1991. The cellular location of a foreign B cell epitope expressed by recombinant bacteria determines its T cell-independent or T cell-dependent characteristics. J. Immunol. 147: 3545-3552.  Li, P., J. Beckwith, and H. Inouye. 1988. Alteration of the amino terminus of the mature sequence of a periplasmic protein can severely affect export in Escherjchja coli. Proc. Natl. Acad. Sci. USA 85: 7685-7689.  166 Lightfoot, J., and J.S. Lam. 1991. Molecular cloning of genes involved with expression of A-band lipopolysaccharide, an antigenically conserved form, in  Pseudomonas aeruginosa. J. Bacteriol. 173: 5624-5630. Ling, I.T., S.A. Ogun, and A.A. Holder. 1994. Immunization against malaria with a recombinant protein. Parasite Immunology 16: 63-67. Maclntyre, S. and U. Henning. 1990. The role of the mature part of secretory proteins in translocation across the plasma membrane and in regulation of their synthesis in Escherichia coli. Biochimie 72: 157-167. McCafferty, J., A.D. Griffiths, G. Winter and D.J. Chiswell. 1990. Phage antibodies: ifiamentous phage displaying antibody variable domains. Nature 348: 552554. McCarvil, J., A.J. McKenna, C. Grief, C.S. Hoy, D. Sesarclic, M.C.J. Maiden, and I. M. Feavers. 1993. Expression of meningococcal epitopes in LamB of Escherichia coli and the stimulation of serosubtype-specific antibody responses. Mol. Micro. 10: 203-2 13. McCutcheon J.A., K.D. Smith, A. Valenzuela, K. Aalbers, and C.T. Lutz. 1993. HLAB*0702 antibody epitopes are affected indirectly by distant antigen residues. Human Immunology. 36: 69-75. McEwen, J., R. Levi, R.J. Horwitz, and R. Arnon. 1992. Synthetic recombinant vaccine expressing influenza haemagglutinin epitope in Salmonella flageffin leads to partial protection in mice. Vaccine 10: 405-411.  Manoil, C. 1991. Analysis of membrane protein topology using alkaline phosphatase and -galactosidase gene fusions. Methods in cell biology. 34: 6 1-75. Mansfield, M.A. 1994. Rapid immunodetection on hydrophobic PVDF membranes without blocking. Poster presented at The American Society For Biochemistry And Molecular Biology, Washington, DC, May 1994. Martin, N.L., E.G. Rawling, R.S.Y. Wong, M. Rosok, and R.E.W. Hancock. 1993. Conservation of surface epitopes in Pseudomonas aeruginosa outer membrane porin protein OprF. FEMS Microbiol. Lett. 113: 26 1-266. Martineau, P., A. Charbit, C. Leclerc, C. Werts, D. O’Callaghan, and M. Hofnung. 1991. A genetic system to elicit and monitor anti-peptide antibodies without peptide synthesis. Bio/Technology 9: 170-172.  167 Marston, F. A. 0. 1986. The purification of eukaryotic polypeptides synthesized in Eseherichia coli. Biochem. J. 240: 1-12. Matthews-Greer, J.M. and H.E. Gilleland, Jr. 1987. Outer membrane protein F (porin) preparation of Pseudomonas aeruginosa as a protective vaccine against heterologous immunotype strains in a burned mouse model. J. infect. Dis. 155: 1282-1291. Michel, M.L., M. Mancini, K. Schlienger, and P. Tiollais. 1993. Recombinant hepatitis B surface antigen as a carrier of human immunodeficiency virus epitopes. Research in Virology. 144: 263-26 7. Minenkova 0.0., A.A. llyichev, G.P. Kishchenko, and V.A. Petrenko. 1993. Design of specffic immunogens using filamentous phage as the carrier. Gene 128: 85-88. Moeck, G.S., B.S. Fazly Bazzaz, M.F. Gras, T.S. Ravi, M.J.H. Ratcliffe, and J.W. Coulton. 1994. Genetic insertion and exposure of a reporter epitope in the ferrichrome-iron receptor of Escherichia coli K-12. J. Bacteriol. 176: 42504259. Monaco, J.J. 1992. A molecular model of 1VIIIC class-I-restricted antigen processing. Immunology today. 13: 173-179. Mutharia, L.M. and R.E.W. Hancock. 1983. Surface localization of Pseudomonas aeruginosa outer membrane porin protein F by using monoclonal antibodies. Infect. Immun. 42: 1027-1033. Mutharia, L. M. and R.E.W. Hancock. 1985. Characterization of two surfacelocalized antigenic sites on porin protein F of Pseudomonas aeruginosa. Can. J. Microbiol. 31: 38 1-386. Nakae, T.. 1995. Role of membrane permeability in determining antibiotic resistance in Pseudomonas aeruginosa. Microbiol. Immunol. 39: 221-229. Newton, S. M. C., C. 0. Jacob, and B. A. D. Stocker. 1989. Immune response to cholera toxin epitope inserted in Salmonella flageffin. Science 244: 70-72. Nicas, T.I. and R.E.W. Hancock. 1983. Alteration of susceptibility to EDTA, polymyxin B and Gentan’ucin in Pseudomonas aeruginosa by divalent cation regulation of outer membrane protein Hi. J. Gen. lVlicrobiol. 129: 509-5 17.  168 Nikaido, H. and M. Vaara. 1987. Outer membrane, p. 7-22. In F.C. Neidhardt,  J.L., Ingraham, K.B. Low, B. Magasanik, M. Schaechter, and H.E. Umbarger (ed.), Escherichia coli and Salmonella typhimurium: cellular and molecular biology, vol. I. American Society for Microbiology, Washigton D.C. ,  Nikaido, H., K. Nikaido, and S. Harayama. 1991. Identification and characterization of porins in Pseudomonas aeruginosa. J. Biol. Chem. 266: 770-779. Notley, L., C. Hillier, and T. Ferenci. 1994. Epitope mapping by cysteine mutagenesis: identification of residues involved in recognition by three monoclonal antibodies directed against LamB glycoporin in the outer membrane of Escherichia coli. FEMS Microbio. Lett. 120: 341-348. Oka, A., H. Sugisaki, and M. Takanami. 1981. Nucleotide sequence of the kanamycin resistance transposon Tn903. J. Mol. Biol. 147: 217-226. Ott, L. In An introduction to statistical methods and data analysis, pp300-33l. PWS-KENT publishing Co., Boston. Paul, C., and J.P. Rosenbusch. 1985. Folding patterns of porin and bacteriorhodopsin. EMBO J. 4: 1593-1597. Percy, N., W.S. Barclay, A. Garcia-Sastre, P. Palese. 1994. Expression of a foreign protein by influenza A virus. J. Virol. 68: 4486-92. Pessi, A., D. Valmori, P. Migliorini, C. Tougne, E. Bianchi, P.H. Lambert, G. Corradin, and G. Del Giudice. 1991. Lack of H-2 restriction of the Plasmodium falciparum (NANP) sequence as multiple antigen peptide. Eur. J. Immunol. 21: 2273-2276. Piers, K.L. 1993. Ph.D. thesis. University of British Columbia, Vancouver, Canada. Piers, K.L., M.B. Brown, and R.E.W. Hancock. 1993. Recombinant DNA procedures for producing small antimicrobial cationic peptides in bacteria. Gene 134: 7-13. Pozzi, G., M. Contorni, M. R. Oggioni, R. Manganell, M. Tommasino, F. Cavalieri, and V. A. Fischetti. 1992. Delivery and expression of a heterologous antigen on the surface of Streptococci. Infect. Immun. 60: 1902-1907. Rawling, E.G., N.L. Martin, and R.E.W. Hancock. 1995. Epitope mapping of the Pseudomonas aeruginosa major outer membrane porin protein OprF. Infect. Immun. 63: 1995 38-42.  169 Rickman, L.S. and S.L. Hoffman. 1991. Malaria, p.1037. In S. Baron (ed.), Medical microbiology. Churchifi Livingstone Publishing Co., New York. Rutgers, T., D. Gordon, A.M. Gathoye, M. Hoffingdale, W. Hockmeyer, M. Rosenberg and M. De Wilde. 1988. Hepatitis B surface antigen as carrier matrix for the repetitive epitope of the circumsporozoite protein of Plasmodium falciparum. Bio/technology 6: 1065-1070. Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbour Laboratory, Cold Spring, Harbour, N.Y. Sandermann H. Jr. and J. L. Strominger. 1972. Purification and properties of 55 C isoprenoid alcohol phosphokinase from Staphylococcus aureus. J. Biochem. Chem. 247:5123-5131. ,  Schirmer, T., T. A. Keller, Y.-F. Wang, and J. P. Rosenbusch. 1995. Structural basic for sugar translocation through maltoporin channels at 3.1 A resolution. Science 267: 512-514. Schnaitman, C.A. 1971. Solubilization of the cytoplasmic membrane of Escherichia coli by Triton X-100. J. Bacteriol. 108: 545-552. Schorr, J., B. Knapp, E. Hundt, H. A. Kupper, and E. Amann. 1991. Surface expression of malarial antigens in Salmonella typhimurium: induction of serum antibody response upon oral vaccination of mice. Vaccine 9: 675-681. Scott, J.K. and L. Craig. 1994. Random peptide libraries. Curr. 5: 40-48.  Opin. in Biotechnol.  Siehnel, R. J., N. L. Martin, and R. E. W. Hancock. 1990. Function and Structure of the porin proteins OprF and OprP of Pseudomonas aeruginosa. pp. 328342. In Pseudomonas biotransformations, pathogenesis, and evolving biotechnology. Silver, S. (ed.). Washington, D.C. American Society of Microbiology. Smith, D.B., K.M. Davern, P.G. Board, W.U. Tiu, E.G. Garcia and G.F. Mitchell. 1986. Mr 26,000 antigen of Schistosomajaponicum recognized by resistant WEHI 129/J mice is a parasite glutathione S-transferase. Proc. Natl. Acad. Sci. USA 83: 8703-870 7. Smith, D. B. and K. S. Johnson. 1988. Single-step purification of polypeptides expressed in Escherichia coli as fusions with glutathione S-transferase. Gene 67: 3 1-40.  170  Smith, D.B., M.R. Rubira, R.J. Simpson, K.M. Davern, W.U. Tiu, P.G. Board, and G.F. Mitchell. 1988. Expression of an enzymatically active parasite molecule in Escherichia coli: Schistosoma japonicum glutathione S-transferase. Mol. Biochem. Parasitol. 27: 249-256. Smith, A.D., D.A. Resnick, A. Zhang, S.C. Geisler, E. Arnold, and G.F. Arnold. 1994. Use of random systemic mutagenesis to generate viable human rhinovirus 14 chimeras displaying human immunodeficiency virus type 1 V3 loop sequences. J. Virol. 68: 575-579. Sonntag, I., H. Schwarz, Y. Hirota, and U. Henning. 1978. Cell envelope and shape of Escherichia coli: multiple mutants missing the outer membrane lipoprotein and other major outer membrane proteins. J. Bacteriol. 136: 280285. Steidler, L., E. Remaut, and W. Fiers. 1993. Pap pu as a vector system for surface exposition of an immunoglobulin G-bincling domain of protein A of Staphylococcus aureus in Escherichia coli. J. Bacteriol. 175: 7639-7643. Stoute, J.A., W.R. Ballou, N. Kolodny, C.D. Deal, R.A. Wirtz, and L.E. Lindler. 1995. Induction of humoral immune response against Plasmodium falciparum sporozoites by immunization with a synthetic peptide minotope whose sequence was derived from screening a ifiamentous phage epitope library. Infect. Immun. 63: 934-939. Struyvé, M., D. Bosch, J. Visser, and J. Tommassen. 1993a. Effect of different positively charged amino acids, C-terminally of the signal peptidase cleavage site, on the translocation kinetics of a precursor protein in Escherichia coli K-12. FEMS Microbiol. Lett. 109: 173-178. Struyvé, M., J. Visser, H. Adriaanse, R. Benz, and J. Tommassen. 1993b. Topology of PhoE porin: the ‘eyelet’ region. Molec. Microbiol. 7: 13 1-140. Szmelcman, S. and M. Hofnung. 1975. Maltose transport in Escherichia coli K-12: Involvement of the bacteriophage lambda receptor. J. Bacteriol. 124: 112118. Taylor, I.M., J.L. Harrison, K.N. Timmis, and C.D. O’Connor. 1990. The TraT lipoprotein as a vehicle for the transport of foreign antigenic determinants to the cell surface of Escheichia coli Kl2: structure-function relationships in the TraT protein. Mol. Microbiol. 4: 1259-1268. Tsunetsugu-Yokota, Y., M. Tatsumi, V. Robert, C. Devaux, B. Spire, J-C. Chermann and I. Hirsch. 1991. Expression of an immunogenic region of HIV by a ifiamentous bacteriophage vector. Gene 99: 261-265.  171  Usha, R., J.B. Rohil, V.E. Spall, M. Shanks, A.J. Maule, J.E. Johnson, and G.P. Lomonossoff. 1993. Expression of an animal virus antigenic site on the surface of a plant virus particle. Virology. 197: 366-374. Van der Werf, S., A. Charbit, C. Leclec, V. Mimic, J. Ronco, M. Girard, and M. Hofnung. 1990. Critical role of neighbouring sequences on the immunogenicity of the C3 poliovirus neutralization epitope expressed at the surface of recombinant bacteria. Vaccine 8: 269-2 77.  Van Die, I., J. van Oosterhout, I. van Megen, H. Bergmans, W. Hoekstra, B. Enger Valk, S. Barteling, and F. Mooi. 1990. Expression of foreign epitopes in P fimbriae of Escherichia coli. Mol. Gen. Genet. 222: 297-303. von Specht, B.-H., B. Knapp, G. Muth, M. Broker., K.-D. Hungerer, K.-D. Diehl, K. Massarrat, A. Seemann, and H. Domdey. 1995. Protection of immunocompromised mice against lethal infection with Pseudomonas aeruginosa outer membrane protein F and outer membrane protein I fusion proteins. Infect. Immun. 63: 1855-1862. Weiss, M.S., U. Abele, J. Weckesser, W. Welte, E. Schiltz, and G.E. Schulz. 1991. Molecular architecture and electrostatic properties of a bacterial porin. Science 254: 1627- 1630. Wirtz, R.A., F. Zavala, Y. Charoenvit, G.H. Campbell, T.R. Burkot, I. Schneider, K.M. Esser, R.L. Beaudoin, and R.G. Andre. 1987. Comparative testing of monoclonal antibodies against Plasmodium falciparum sporozoites for ELISA development. Bull. W.H.O. 65: 39-45. Woodruff, W. A., T. R. Parr,Jr., R. E. W. Hancock, L. F. Hanne, T. I. Nicas, and B. H. Iglewski. 1986. Expression in Escherichia coli and function of Pseudomona,s aeruginosa outer membrane porin protein F. J. Bacteriol. 167: 473-479. Woodruff, W. A. and R. E. W. Hancock. 1989. Pseudomonas aeruginosa outer membrane protein F: structural role and relationship to the Escherichia coli OmpA protein. J. Bacteriol. 171: 3304-3309. Wu, J. Y., S. Newton, A. Judd, and W. S. Robinson. 1989. Expression of immunogenic epitopes of hepatits B surface antigen with hybrid flageffin proteins by a vaccine strain of Salmonella. Proc. Nati. Acad. Sci. USA 86: 4726-4730. Yoneyama, H. and T. Nakae. 1986. A small diffusion pore in the outer membrane of Pseudomonas aeruginosa. Eur. J. Biochem. 157: 33-38.  172  Young, J. F., W.T. Hockmeyer, M. Gross, W.R. Ballou, R.A. Wirtz, J.H. Trosper, R.L. Beaudoin, M.R. Hollingdale, L.H. Miller, C.L. Diggs, and M. Rosenberg. 1985. Expression of Plasmodium falciparum circumsporozoite proteins in Escherichia coli for potential use in a human malaria vaccine. Science 228: 958-962. Zavala, F., J.P. Tam, M.R. Hoffingdale, A.H. Cochrane, I. Quakyi, R.S. Nussenzweig, and V. Nussenzweig. 1985. Rationale for development of a synthetic vaccine against Plasmodium falciparum malaria. Science 228: 1436-1440.  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0088315/manifest

Comment

Related Items