Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Studies on Ribonuclease E of ESCHERICHIA COLI and its association with the enzyme Polynucleotide phosphorylase Niguma, Kenneth 1997

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1997-0453.pdf [ 8.46MB ]
Metadata
JSON: 831-1.0088271.json
JSON-LD: 831-1.0088271-ld.json
RDF/XML (Pretty): 831-1.0088271-rdf.xml
RDF/JSON: 831-1.0088271-rdf.json
Turtle: 831-1.0088271-turtle.txt
N-Triples: 831-1.0088271-rdf-ntriples.txt
Original Record: 831-1.0088271-source.json
Full Text
831-1.0088271-fulltext.txt
Citation
831-1.0088271.ris

Full Text

STUDIES ON RD30NUCLEASE E OF ESCHERICHIA COU AND ITS ASSOCIATION WITH THE ENZYME POLYNUCLEOTIDE PHOSPHORYLASE by KENNETH NIGUMA Hon. B.Sc, Dalhousie University, 1993. A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF MEDICINE Department of Biochemistry and Molecular Biology We accepted this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA August, 1997 © Kenneth Niguma, 1997 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be al lowed without my written permission. Department of g ' ° C - H f ^ i y r ^ V 4"® n&\,<TCMK StQLOM The University of British Columbia Vancouver, Canada Date SerK 1 , [<J7J DE-6 (2/88) ABSTRACT Messenger RNAs (mRNA) in Escherichia coli are highly labile molecules due to the combined action of a number of exo- and endoribonucleases that orchestrate their degradation. Two of these enzymes, ribonuclease E (RNase E) and polynucleotide phosphorylase (PNPase) have been implicated as key components of a purported rnRNA degradation complex, otherwise known as the "degradosome" (Py etai, Nature 381, 169-172 (1996)). The purpose of these studies was to identify the site of interaction of PNPase with RNase E (Rne). Antibodies were generated against PNPase, initially against fusion proteins expressing two highly antigenic sites predicted to exist in PNPase, and later against a His(6)-PNPase fusion protein. These antibodies, along with a previously generated anti-RNase E antibody, were used to detect Rne or PNPase at various stages during the partial purification of RNase E. Rne and PNPase were found to remain in a stable complex, in association with other unidentified proteins, after several purification steps, and in particular after anion exchange chromatography. Over-expression and partial purification of Rne deletion mutants revealed that loss of the N-terminal portions of Rne did not prevent the mutant from binding PNPase independently, highlighting the importance of the C-terminal portion of Rne in associating with PNPase. Co-chromatography experiments could not determine whether the N-terminal region of Rne bound directly or indirectly to PNPase. A Far-Western experiment, which separates partially purified proteins in cell lysates and assesses their binding individually, demonstrated that derivatives of Rne retaining the C-terminal acidic tail of Rne were competent to bind PNPase. These experiments illustrating the binding of PNPase to the C-terminus of Rne complement the findings that PNPase binding is lost when the Rne C-terminus is missing (Kido etai, J. Bact, 178, 3917-3925 (1996)). ii TABLE OF CONTENTS Page Abstract ii Table of contents iii List of Figures v i List of Tables vii List of Appendices viii List of Abbreviations i x Acknowledgments . xi Chapter 1 - Introduction 1 1.1 Overview 1 1.2 A "Consensus" Model for Prokaryotic mRNA Decay 2 1.3 The Enzymes of Prokaryotic mRNA Decay 3 1.3.1 The Endoribonucleases 3 1.3.1.1 RNaselTJ 3 1.3.1.2 RNaseE 4 1.3.2 The Exoribonucleases 10 1.3.2.1 PNPase 10 1.3.2.2 RNaseU 12 1.4 The "Degradosome" complex 13 1.4.1 RNA Helicases 14 1.4.2 Poly(A) Polymerase 15 1.4.3 Other enzymes 16 1.5 New Perspectives on mRNA Decay 17 Chapter 2 - Materials and Methods •• 21 iii 2.1 Reagents 21 2.2 Vectors, Strains and Media 22 2.2.1 Vectors 22 2.2.2 Bacterial Strains 22 2.2.3 Media 23 2.3 Oligonucleotides 24 2.4 Recombinant DNA Methods 24 2.4.1 Isolation of Plasmid DNA 24 2.4.2 Restriction Enzyme Digests 24 2.4.3 Separation of DNA by Gel Electrophoresis 24 2.4.4 In Vitro Amplification of DNA by the Polymerase Chain Reaction 25 2.4.5 Ligations 25 2.4.6 Transformations into E. coli Competent Strains 26 2.4.7 DNA Sequencing 26 2.5 Over-Expression and Purification of Recombinant Proteins 26 2.5.1 Sodium Dodecyl Sulfate Polyacrylamide Gels (SDS-PAGE) 26 2.5.2 Protein Over-Expression Assay 27 2.5.3 Culture and Induction of Recombinant Proteins 28 2.5.4 Cleveland Mapping 28 2.5.5 Anion and cation exchange chromatography on the Pharmacia FPLC System 29 2.5.6 Size Exclusion Chromatography 29 2.5.7 Immobilized Metal Ion Chromatography 30 2.6 Immunological Methods 30 2.6.1 Preparation of Antigenic Protein for Rabbit Immunization 30 2.6.2 Rabbit Bleeds 31 2.6.3 Western Blots 31 2.6.4 Antibody Stripping 32 2.6.5 Far-Western Blotting 32 Chapter 3 - Results 35 3.1 Antibody Generation 35 3.1.1 Generation of Antibodies Against Antigenic Sites in PNPase 35 3.1.2 Generation of Antibodies Against a His(6)-PNPase Fusion Protein 42 3.2 Rne Mutant Proteins 48 3.2.1 Rne N-Terminal Deletion Mutants 48 iv 3.2.2 Rne C-Terminal Deletion Mutants 48 3.3 Native and Mutant Rne-PNPase Interations Assessed by Co-Chromatography 51 3.3.1 Fractionation of Rne-PNPase on an Anion Exchange Column 51 3.3.2 Fractionation by Anion Exchange Chromatography of Rne N-terminal Deletion mutants 55 3.3.3 Rne C-Terminal Deletion Mutant Fractionation by Anion (Mono Q) and Cation (Mono S) Exchange Chromatography 59 3.4 Assessment of Rne-PNPase Interactions by Far-Western Blotting 63 Chapter 4 - Discussion 68 References 76 v LIST OF FIGURES FIGURES Figure Description Page 1 Antigenic site predictions in PNPase from the primary structure 36 2 Over-expression and identification of proteins containing the two antigenic regions of PNPase 38 3 Detection of T7genelO-PNPase fusion proteins by Western blotting 40 4 Purification of over-expressed His(6)-PNPase by metal ion chelate chromatography .... 43 5 Polyclonal antibodies raised against purified His(6)-PNPase detected by Western blotting 45 6 A map of deleted Rne proteins 49 7 Fractionation of enriched extracts of GM402 on an anion exchange column (Resource Q) 52 8 Fractionation of partially purified extracts of RneAN608 on an anion exchange column (Resource Q) 56 9 Fractionation of partially purified RneAC218 by ion exchange chromatography 60 10 Far-Western blotting of native and mutant Rne protein with free PNPase 64 11 Fractionation of partially purified extracts of RneAN208 on an anion exchange column (Resource Q) 99 12 Fractionation of partially purified extracts of RneAN315 on an anion exchange column (Resource Q) 102 13 Fractionation of partially purified extracts of RneAN408 on an anion exchange column (Resource Q) 105 14 Fractionation of partially purified extracts of RneAN813 on an anion exchange column (Resource Q) 108 vi LIST OF TABLES Table Description Page Table 1 Oligonucleotides 34 vii LIST OF APPENDICES APPENDICES Appendix Description Page Appendix 1 pET3xc cloning vector used to construct rneAN208, rneAN315, rneAN408, rneAN608, rneA722 and rneAN813 97 Appendix 2 pET24b cloning vector used to construct rneAC218 98 viii LIST OF ABBREVIATIONS 2D two dimentional 3D three dimentional AS26 26% (w/v) ammonium sulfate fraction ATP adenosine 5'-triphosphate BSA bovine serum albumin °C degrees Celcius C-terminal carboxy terminal CTP cytidine 5'-triphosphate dd dideoxy dATP deoxyadenosine 5'-triphosphate DNase deoxyribonuclease dNTP deoxyribonucleotide triphosphate DTT dithiothreitol ECL enhanced chemoluminescent E. coli Escherichia coli EDTA ethylenediaminetetraacetate FPLC fast protein liquid chromatography g gravity Hepes 4(-2-hydroxyethyl)-1 -pierazineethanesulfonic acid His(6) oligo(6) histidine JPTG isopropyl-P-thiogalactopyranoside kb kilobase kDa kilodalton kg kilogram LB Luria-Bertani M molar mg milligram min minute mL millilitre mm millimetre mRNA messenger RNA MW molecular weight Mg microgram pL microlitre NDP nucleoside diphosphate ng nanogram NMP nucleoside monophosphate NMR nuclear magnetic resonance N-terminal amino terminal PAGE polyacrylamide gel electrophoresis PAP poly(A) polymerase ix PBS phosphate buffered saline PCR polymerase chain reaction pmol picomole PMSF phenylmethylsulfonylfluoride PNPase polynucleotide phosphorylase poly(A) polyadenylate PTBN sodium phosphate-Tween 20-bovine serum albumin-Na azide RBD RNA binding domain REP repetitive extragenic palindrome RNase ribonuclease RNase E ribonuclease E rne rne/ams/hmp gene Rne rne/ams/hmp gene product rRNA ribosomal RNA SI purported antigenic site 1 of PNPase S2 purported antigenic site 2 of PNPase S200 200,000 x g supernatant SDS sodium dodecyl sulfate T A E Tris-sodium acetate-NaEDTA TBE Tris-Boric acid-NaEDTA T E M E D N , N , N ' , N'-tetramethylethylenediamine Tris tri(hydroxymethyl) aminomethane tRNA transfer R N A V volts w/v weight per volume X A C K N O W L E D G M E N T S I would like to thank the numerous people who helped, guided and supported me on my journey towards my graduate degree. First and foremost, I would like to extend my deepest thanks and gratitude to Dr. George A. Mackie. His knowledge, patience and dedication to his research and position are well known to the people who have had the pleasure to meet him. Above all this, I will remember his enthusiasm for science, which is sadly a rarity in any discipline of life. May you someday have dozens of students who thirst for learning as you do. You deserve it. I could not overlook the contributions of Glen Coburn who constantly gave me valuable insight into my project and provided me with the free PNPase that I so desperately needed. His vast knowledge of the putrid pop music of the 70's and 80's were envied by me and no one else. Xin Miao had a huge part in my project by creating the rne N-terminal deletion mutants. Thanks for all the great times that I remember, and you probably don't. Anand Rampersaud: if not for him I would never have know that PMV is a rod-shaped flexious virus. Is it good from far, or far from good? A thank you to Stephanie Masterman, who tirelessly aided me in my day to day lab endeavors and taught me the ways of the new British invasion. May the Canucks win the Cup sometime in the next millenium! I would like to extend a special thanks to Julie G., Michele R., and Rob C. for all their help when I was the rookie in the lab, and to the past members of the Mackie lab for their help and friendship. Thank you to all my friends in Nova Scotia, Ontario and Vancouver who kept me sane through all of these years. I will eventually find the time to come and harrass you all again, and you know that I will! Last, but not least, I must thank my mom, dad and brother Gord for all their love and support from day one. I'll always be there for all of you. With all my gratitude, Ken Niguma xi Chapter 1 INTRODUCTION 1.1 OVERVIEW Much of our understanding of the b i o l o g i c a l processes that constitute c e l l u l a r metabolism has been gleaned from the gram-negative bacterium Escherichia coli (Neidhardt et a l . , 1 9 8 7 ) . The ease of manipulation of E. coli combined with i t s rapid r e p l i c a t i o n has made i t an important model organism for the study of synthesis, maturation, function and decay of RNA (D'Alessio and Riordan, 1 9 9 7 ) . The extensive genetic and biochemical data currently available, combined with the sequencing and analysis of the E. coli genome should provide the f i r s t f u l l description of the enzymes involved i n RNA metabolism, and th e i r functional r o l e s . RNA has long been established as the l i n k between t r a n s c r i p t i o n and tran s l a t i o n i n a l l organisms; therefore, a l l c e l l s are obliged to make a major commitment to RNA synthesis. Approximately 2 0% of the dry c e l l mass i n prokaryotes i s RNA, most of which i s ribosomal RNA (approximately 81%) and transfer RNA (approximately 14%) (Neidhardt et a l . , 1 9 9 0 ) . Both of these classes of RNA are considered 'stable' i n r e l a t i o n to c e l l u l a r growth rates, whereas messenger RNA (mRNA), constituting only 4% of the RNA, i s considered metabolically ' l a b i l e ' . In E. coli, t y p i c a l mRNA h a l f - l i v e s are 60-12 0 seconds, although a few mRNAs (e.g. ompA mRNA) display h a l f - l i v e s of up to 15 minutes (Belasco and Higgins, 1 1988) . The i n s t a b i l i t y of mRNA plays a number of roles i n c e l l u l a r metabolism. F i r s t of a l l , i t has a di r e c t a f f e c t on the maximal steady-state concentration of mRNA i n the c e l l which i s e n t i r e l y independent of the promoter strength at the t r a n s c r i p t i o n a l l e v e l . Secondly, rapid mRNA decay allows the amplification of negative regulatory signals leading to an accelerated repression of gene expression. This has been observed i n a number of instances, including the select i v e decay of some ribosomal protein mRNAs during t r a n s l a t i o n a l repression i n E. coli (Singer and Nomura, 1985) and the rate of degradation of RNAI, an anti-sense repressor that i s a key element of control i n the r e p l i c a t i o n of ColEl-type plasmids (Lin-Chao and Cohen, 1991). Similar findings are found i n eukaryotes i n the down-regulation of c-fos and other eukaryotic "immediate early" mRNAs following induction (Greenberg and Z i f f , 1984), and the eukaryotic autoregulation of ( 3-tubulin synthesis (Yen et al., 1988). Third, d i f f e r e n t i a l expression of d i s t a l gene products i n some p o l y c i s t r o n i c mRNAs can be accounted for by selective decay of the transcript (Newbury et al., 1987). Fourth, recycling of the degraded ribonucleotides within the c e l l serves to conserve metabolic energy. F i n a l l y , antisense nucleic acids often activate mRNA decay to control the levels of gene expression (Inouye, 1988) . 1.2 A "CONSENSUS" MODEL FOR PROKARYOTIC mRNA DECAY In the early 197 0s, the work of Kepes, Apirion and Kennell on the mRNA decay i n E. coli culminated into what i s best described as 2 a "consensus" model p r o p o s e d by D a v i d A p i r i o n ( A p i r i o n , 1973). T h i s model p r e d i c t e d t h a t t h e i n i t i a l s t e p i n mRNA decay was an e n d o n u c l e o l y t i c c l e a v a g e ( s ) i n the t r a n s c r i p t , f o l l o w e d by s c a v e n g i n g of the newly g e n e r a t e d fragments by 3' - e x o n u c l e a s e s . The model s u g g e s t e d the i n v o l v e m e n t of the e x o r i b o n u c l e a s e s RNase I I and PNPase, b u t d i d n o t i d e n t i f y t he s p e c i f i c e n d o n u c l e a s e . Moreover, i t d i d not e x p l a i n i n d i v i d u a l d i f f e r e n c e s i n d e g r a d a t i o n r a t e among mRNA s p e c i e s o r the r o l e o f t r a n s l a t i o n i n i n f l u e n c i n g s t a b i l i t y . However, i t d i d p r o v i d e a framework from w h i c h s t u d i e s o f mRNA decay c o u l d embark. I n the e n s u i n g 20 y e a r s , many endo-and e x o n u c l e o l y t i c enzymes have been i d e n t i f i e d and s t u d i e d i n an at t e m p t t o r e f i n e t he "consensus" model of p r o k a r y o t i c mRNA d e g r a d a t i o n ( B e l a s c o and H i g g i n s , 1988; H i g g i n s e t al., 1992). 1.3 THE ENZYMES OF PROKARYOTIC mRNA DECAY I n E. coli, t h e r e i s an abundance of r i b o n u c l e a s e s t h a t t a r g e t RNA and almost h a l f of th e s e RNases f u n c t i o n i n tRNA m e t a b o l i s m : RNase P b e i n g r e q u i r e d f o r 5' end f o r m a t i o n and RNases D, PH, T, and BN i n 3' end f o r m a t i o n and maintenance (Deutscher, 1993a). The enzymes d i r e c t l y l i n k e d t o mRNA decay may be d i v i d e d i n t o two c a t e g o r i e s , t he endonucleases and the e x o n u c l e a s e s . 1.3.1 THE ENDORIBONUCLEASES: 1.3.1.1. RNase III T h i s enzyme has been c h a r a c t e r i z e d as a d o u b l e - s t r a n d e d , RNA-s p e c i f i c e n d o r i b o n u c l e a s e (Robertson and Dunn, 1975) t h a t e x i s t s as 3 a homodimer of 25 kDa s u b u n i t s . I t s main r o l e i n the c e l l appears t o be i n t h e m a t u r a t i o n of r i b o s o m a l RNA, a l t h o u g h i t has been de m o n s t r a t e d t o a c t on phage, on c e l l u l a r mRNAs, and p l a s m i d t r a n s c r i p t s , i n c l u d i n g s e n s e - a n t i s e n s e RNA d u p l e x e s ( N i c h o l s o n , 1995) . C e l l s t h a t l a c k RNase I I I a r e s t i l l v i a b l e ( B a b i t z k e e t al. , 1993), i n d i c a t i n g t h a t a l t e r n a t e p r o c e s s i n g pathways can p r o v i d e f u n c t i o n a l rRNA, and t h a t RNase I I I c l e a v a g e i s u n l i k e l y t o p l a y a c e n t r a l r o l e i n g e n e r a l mRNA decay. 1 . 3 . 1 . 2 R N a s e E RNase E was o r i g i n a l l y i d e n t i f i e d i n a t e m p e r a t u r e - s e n s i t i v e mutant of E. coli as an a c t i v i t y w h i c h c l e a v e d 9S rRNA in vitro, y i e l d i n g t h e immediate p r e c u r s o r t o 5S rRNA (Ghora and A p i r i o n , 1979). A t e m p e r a t u r e - s e n s i t i v e mutant {rne-3071) t h a t f a i l e d t o produce p5S RNA was d i s c o v e r e d , and e x t r a c t s from t h e s e mutant b a c t e r i a c o n t a i n e d a t h e r m o l a b i l e enzyme t h a t c l e a v e d 9S RNA in vitro a t two s i t e s ( M i s r a and A p i r i o n , 1979) . Independent work on th e ams-1 ( a l t e r e d mRNA s t a b i l i t y ) E. coli mutant s t r a i n showed te m p e r a t u r e s e n s i t i v e growth and i m p a i r e d a b i l i t y t o degrade b u l k RNA a t the n o n - p e r m i s s i v e temperature (Ono and Kuwano, 1979). T h i s m u t a t i o n was l a t e r d i s c o v e r e d t o be a l l e l i c t o rne-3071 (Mudd e t al., 1990b; B a b i t z k e and Kushner, 1991; T a r a s e v i c i e n e e t al., 1991; M e l e f o r s and von Gabain, 1991) . Together, t h e s e r e s u l t s c l e a r l y i n d i c a t e d t h a t RNase E a c t i v i t y p l a y s a c e n t r a l r o l e i n b u l k mRNA decay. The c l o n i n g of the rne/ams gene i n i t i a l l y p r o v e d p r o b l e m a t i c 4 (Chanda et al. , 1 9 8 5 ) . Later, sequencing errors (Chauhan et al., 1991 ; Claverie-Martin et al. , 1991) led to misunderstandings regarding the i d e n t i t y of the endonuclease component and the size of the Rne polypeptide. Ultimately, the rne/ams gene was cloned (Casaregola et al. , 1992) and sequenced c o r r e c t l y (Mackie, 1 9 9 3 ) . The rne/ams gene maps at 2 3 . 5 minutes on the E. coli chromosome (Casaregola et al., 1992) and i t s expression i s autoregulated by RNase E cleavage of the rne/ams transcript (Mudd and Higgins, 1993; Jain and Belasco, 1995 ) . The gene encodes a protein of 1061 amino acids with a predicted molecular mass of 118 kDa (Cormack et al., 1 9 9 3 ) . Mobility of the Rne/Ams protein i n SDS-polyacrylamide gels has been observed to be anomalously slow (equivalent to about 180 kDa) (Casaregola et al. , 1992) due to three p r o l i n e - r i c h regions within the protein (McDowall and Cohen, 1996) . The mobility of the Rne/Ams protein i n 2D gels indicates that the p i of the polypeptide i s 5 .0 (Taraseviciene et al., 1 9 9 4 ) . I n i t i a l attempts to p u r i f y RNase E were also troublesome because of aggregation and i t s extreme s e n s i t i v i t y to proteolysis (Roy and Apirion, 1 9 8 3 ) . This led to the i d e n t i f i c a t i o n of RNase K, once claimed to be a s p e c i f i c endonuclease for ompA mRNA (Lundberg et al. , 1990 ) , but l a t e r found to be a p r o t e o l y t i c fragment of the c a t a l y t i c subunit of RNase E which lacks any physi o l o g i c a l s i g n i f i c a n c e (Mudd and Higgins, 1 9 9 3 ) . The problem of i s o l a t i n g the enzyme responsible for RNase E a c t i v i t y was eventually solved when the over-expressed Rne/Ams protein was 5 r e n a t u r e d a f t e r p a r t i a l p u r i f i c a t i o n and s e p a r a t i o n on an SDS g e l (Cormack et al. , 1993). I t was found t h a t the r e n a t u r e d Rne/Ams r e t a i n e d the a c t i v i t y and s p e c i f i c i t y a t t r i b u t e d to RNase E , d e m o n s t r a t i n g t h a t the rne/ams gene encoded the c a t a l y t i c s u b u n i t of RNase E (Cormack et a l . , 1993). Subsequent ly , the p o s i t i o n s of the ams-1 (G66S) and rne-3071 (L68F) muta t ions were mapped to codons 66 and 68, r e s p e c t i v e l y (McDowall e t a l . , 1993) . Both c r e a t e s u b t l e changes a t the N - t e r m i n a l domain which c o n f e r r e d t h e r m o l a b i l i t y to the RNase E a c t i v i t y (McDowall e t a l . , 1993) . L i k e l y , these mutat ions d i s r u p t the s u b s t r a t e b i n d i n g s i t e a t the N - t e r m i n a l r e g i o n (Carpous i s et a l . , 1994; B y c r o f t et a l . , 1997) . The Rne/Ams p r o t e i n s p e c i f i c a l l y t a r g e t s s i n g l e - s t r a n d e d r e g i o n s of i t s s u b s t r a t e s , and performs i t s e n d o n u c l e o l y t i c a c t i v i t y as a p h o s p h o d i e s t e r a s e , r e q u i r i n g a d i v a l e n t meta l i o n (Mg 2 +, Mn 2 +) to c l eave RNA, l e a v i n g 5 ' -phosphate , 3 ' -hydroxy 1 t e r m i n i ( M i s r a and A p i r i o n , 1979). E a r l y e f f o r t s to de termine RNase E s p e c i f i c i t y focused on i d e n t i f y i n g a s p e c i f i c n u c l e o t i d e r e c o g n i t i o n sequence (Tomcsanyi and A p i r i o n , 1985). T h i s p u t a t i v e consensus r e c o g n i t i o n sequence was not c o n s e r v e d as more c l e a v a g e s i t e s were c h a r a c t e r i z e d . S t u d i e s c o r r e l a t i n g RNA secondary s t r u c t u r e i n known s u b s t r a t e s to the s i t e of c l e a v a g e were a l s o p e r f o r m e d (Mackie , 1991; Cormack and M a c k i e , 1992; M a c k i e , 1992; Mackie and Genereaux, 1993). These exper iments combined w i t h the p r o p e r t i e s of a number o f mutants des igned to s t r a t e g i c a l l y d i s r u p t f o l d i n g (Mackie and Genereaux, 1993) showed t h a t RNase E i s a 6 s i n g l e - s t r a n d s p e c i f i c enzyme l a c k i n g any s t r i c t sequence s p e c i f i c i t y . T h i s was a l s o c o n f i r m e d by s i m i l a r s t u d i e s on RNA I (McDowall , et a l . , 1994; L i n - C h a o , et a l . , 1994) . From the c l e a v a g e s i t e s c h a r a c t e r i z e d thus f a r , i t appears t h a t Rne/Ams p r e f e r s to c l e a v e 5' to AU d i n u c l e o t i d e s i n an A - U -r i c h c o n t e x t . O f t e n these s i t e s are p r e c e d e d o r f o l l o w e d by a s t a b l e s t em- loop s t r u c t u r e . C o n f l i c t i n g ev idence c o n t i n u e s to obscure the r o l e of the s tem-loops i n s i t e i d e n t i f i c a t i o n . D e s p i t e the f a c t t h a t many mRNA c l eavage s i t e s are i n c l o s e p r o x i m i t y to s t em- loop s t r u c t u r e s , s t u d i e s w i t h s y n t h e t i c o l i g o n u c l e o t i d e s u b s t r a t e s (McDowall et al., 1995) and more complex RNAs (Mackie and Genereaux, 1993) suggest tha t these adjacent s tem-loops reduce the e f f i c i e n c y of c l e a v a g e . Thus , i t appears t h a t the s t em- loops c o u l d serve to s t a b i l i z e the l o c a l secondary s t r u c t u r e to ensure an e a s i l y c l e a v a b l e s i n g l e - s t r a n d e d s i t e , or c o u l d cause the h e l i c a l s t a c k i n g of r e s i d u e s i n the c leavage s i t e to i n h i b i t a t t a c k (Mackie and Genereaux, 1993). S ince RNase E can a c c u r a t e l y p r o c e s s s h o r t , s i n g l e - s t r a n d e d RNA o l i g o n u c l e o t i d e s tha t l a c k f l a n k i n g s t em- loops , such secondary s t r u c t u r e s are not s t r i c t l y r e q u i r e d , a t l e a s t f o r in vitro r e a c t i v i t y (McDowall et al., 1995). In vivo RNase E may r e q u i r e a t l e a s t t h r e e u n p a i r e d r e s i d u e s a t the 5 ' - e n d of a s u b s t r a t e f o r e f f i c i e n t i n i t i a t i o n of mRNA decay (Chen et a l . , 1991; Bouvet and B e l a s c o , 1992; Hansen et al. , 1994). T h i s appears to be an e s s e n t i a l element i n RNase E r e c o g n i t i o n , s i n c e a v a r i e t y o f s u b s t r a t e s whose 5 ' -ends have been s e q u e s t e r e d by a secondary s t r u c t u r e are r e s i s t a n t to c l eavage by b o t h crude RNase E and the 7 p u r i f i e d Rne/Ams p r o t e i n , a l t h o u g h the c l e a v a g e s i t e remains s i n g l e - s t r a n d e d (Mackie et a l . , 1997). I t appears t h a t the a c c u r a t e p r e d i c t i o n of RNase E c l eavage s i t e s w i l l depend on a g r e a t e r knowledge o f the RNase E - s u b s t r a t e i n t e r a c t i o n a t the atomic l e v e l . A n a l y s i s of the amino a c i d sequence of Rne/Ams has i d e n t i f i e d s e v e r a l p o t e n t i a l l y impor tant f u n c t i o n a l m o t i f s (see F i g . 6 ) . There are two p u t a t i v e n u c l e o t i d e b i n d i n g domains, two domains r e s e m b l i n g an E. coli p r o t e i n i n v o l v e d i n c e l l d i v i s i o n (McDowall e t a l . , 1993), a r e g i o n r e s e m b l i n g dynamin ( C a s a r e g o l a e t al. , 1992) , and a h i g h a f f i n i t y RNA b i n d i n g domain (RBD) whose r o l e i n RNase E i s debated (Cormack et al., 1993; C a s a r e g o l a et al., 1992; McDowell and Cohen, 1996; T a r a s e v i c i e n e et al., 1995; Miao et a l . , p e r s o n a l communicat ion) . D e l e t i o n a n a l y s i s s t u d i e s have narrowed the RBD to r e s i d u e s 608-622 ( T a r a s e v i c i e n e et al., 1995; Miao e t a l . , p e r s o n a l communicat ion) , which e x h i b i t sequence s i m i l a r i t i e s to a b a s i c r e g i o n i n RNase L , the 2 - 5 - A a c t i v a t e d endonuclease i n d u c e d by i n t e r f e r o n treatment of mammalian c e l l s (Zhou et a l . , 1993) . Some s t u d i e s have demonstrated t h a t d e l e t i o n of the r e g i o n s e v e r e l y hampers RNase E a c t i v i t y ( T a r a s e v i s i e n e e t . al, 1995; Miao e t . al, p e r s o n a l communicat ion) , w h i l e o t h e r s have n o t i c e d no e f f e c t i n c o n d i t i o n s of enzyme excess (McDowell and Cohen, 1995). P a r t o f the a c t i v e s i t e appears to map w i t h i n the f i r s t 150 r e s i d u e s i n the N - t e r m i n a l r e g i o n , a long w i t h a sequence homologous to the SI RNA b i n d i n g domain ( B y c r o f t et a l , 1997) . An a c i d i c C -8 terminal t a i l (residues 8 5 0 - 1 0 6 1 ) does not appear to be important i n c a t a l y t i c function in vitro, but may be necessary for a c t i v i t y in vivo (Wang and Cohen, 1 9 9 4 ) , although some found i t unnecessary in vivo as well (Chanda et. al, 1 9 8 5 ; Kido et al., 1 9 9 6 ) . Overall, i t seems that the Rne/Ams protein i s comprised of a number of d i s t i n c t functional modules. An RNase E - l i k e a c t i v i t y has been i d e n t i f i e d i n the extreme halophile Haloarcula marismortui which has the same substrate s p e c i f i c i t y as E. coli RNase E and cross-reacts with monoclonal antibodies raised against E. coli RNase E (Franzetti et al, 1 9 9 7 ) . There are two reports of RNase E - l i k e a c t i v i t i e s i n mammalian c e l l s . The human ard-1 gene encodes a basic, p r o l i n e - r i c h polypeptide of 1 3 . 3 kDa which has very l i m i t e d sequence s i m i l a r i t i e s to the Rne/Ams protein i n E. coli (Wang and Cohen, 1 9 9 4 ; Claverie-Martin et al., 1 9 9 7 ) . The Ard - 1 protein i s a Mg2+-dependent endoribonuclease that binds and cleaves RNA i n a manner id e n t i c a l to RNase E (Claverie-Martin et al. , 1 9 9 7 ) . . Expression of the ard-1 gene i n E. coli i s able to complement rne mutants: bulk mRNA decay rates are restored to wild-type and the s i t e - s p e c i f i c cleavages produced in vivo and in vitro are e s s e n t i a l l y the same as those of RNase E (Wang and Cohen, 1 9 9 4 ) . Another study described an a c t i v i t y i n human c e l l extracts which cleaves 9 S RNA and ompA mRNA in vitro with the same s p e c i f i c i t y as RNase E (Wennborg et al. , 1 9 9 5 ) . The enzyme responsible has a molecular mass of 6 5 kDa 9 and i s r e c o g n i z e d by a n t i - R N a s e E a n t i b o d i e s (Wennborg, e t al. , 1995). The enzyme c l e a v e s w i t h i n the 5'-AUUUA-3' sequence (Shaw and Kamen, 1986), w h i c h i s r e m i n i s c e n t o f the A , U - r i c h RNase E c l e a v a g e "consensus" sequence (Wennborg e t al., 1995). 1 . 3 . 2 T H E E X O R I B O N U C L E A S E S : 1 . 3 . 2 . 1 P N P a s e A l l t h e e x o r i b o n u c l e a s e s d i s c o v e r e d thus f a r i n E. coli a r e enzymes t h a t a c t i n t h e 3'->5' d i r e c t i o n . Two of them, p o l y n u c l e o t i d e p h o s p h o r y l a s e (PNPase) and RNase P H a r e p h o s p h o r o l y t i c p h o s p h o d i e s t e r a s e s , w h i l e the r e s t a r e h y d r o l y t i c i n a c t i v i t y (Deutscher, 1993b). PNPase (and RNase PH) a r e d i s t i n c t among the e x o r i b o n u c l e a s e s i n u t i l i z i n g i n o r g a n i c phosphate t o c a r r y out p h o s p h o r y l y t i c c l e a v a g e of RNA, c r e a t i n g 5'-r i b o n u c l e o s i d e d i p h o s p h a t e s ( L i t t a u e r and Soreq, 1982). I n c o n t r a s t t o the h y d r o l y t i c r e a c t i o n s , the P N P a s e - c a t a l y z e d r e a c t i o n c o n s e r v e s f r e e energy i n the 5'-rNDP p r o d u c t s , w h i c h may be i m p o r t a n t t o the c e l l under energy-poor c o n d i t i o n s (Deutscher, 1993b). PNPase e f f i c i e n t l y degrades u n s t r u c t u r e d RNAs, i n c l u d i n g homoribopolymers, b u t can be impeded by RNA s e c o n d a r y s t r u c t u r e (Guarneros and P o r t i e r , 1991; Causton e t al. , 1994). PNPase can a l s o c a t a l y z e t h e p o l y m e r i z a t i o n of 5'-rNDPs f o r m i n g RNA c h a i n s w i t h the r e l e a s e of phosphate, and can c a t a l y z e i n o r g a n i c phosphate exchange w i t h 5'-rNDPs ( L i t t a u e r and Soreq, 1982). PNPase c o n s i s t s of t h r e e a - s u b u n i t s of 85 kDa, w h i c h g e n e r a t e the c a t a l y t i c s i t e , and o f t e n t h r e e (3-subunits of 48 kDa ( L i t t a u e r 10 and Soreq, 1982; Py et al., 1996). The a-subunit i s encoded by the pnp gene, mapping at 69 minutes, and i s co-transcribed with rpsO, which encodes ribosomal protein S15 (Regnier et al., 1987). The a-subunit contains a 69 amino acid sequence at i t s carboxyl terminus, s i m i l a r to a sequence motif i n ribosomal protein SI which also binds RNA (Regnier et al., 1987). Biochemical and genetic studies indicate that the RNA binding and c a t a l y t i c functions of the a-subunit are separable (Littauer and Soreq, 1982) as observed i n the Rne/Ams protein. A recent NMR investigation has confirmed the RNA binding domain as the SI domain, a five-stranded a n t i p a r a l l e l 3 b a r r e l which i s present i n RNase E, RNase II and other enzymes (Bycroft et al. , 1997). Conserved residues on one face of the b a r r e l and adjacent loops form the putative RNA binding s i t e (Bycroft et al. , 1997). The (3-subunit has been shown to be i d e n t i c a l to enolase (Py et al., 1996; Miczak et al., 1996) and i s devoid of any RNA binding a b i l i t y (Py et al., 1996) . An (a) 3(3) 2 form of PNPase has also been i s o l a t e d from c e l l s (Littauer and Soreq, 1982), but i t has yet to be determined i f other complexes of PNPase subunits are present and f u n c t i o n a l l y d i s t i n c t . PNPase i s capable of autoregulating the t r a n s l a t i o n of i t s message, i n cooperation with the action of RNase III and RNase E (Hajnsdorf et al., 1994a; Robert-LeMeur and Portier, 1994), and can be isolated i n a complex with RNase E (Carpousis et al., 1994; Py et al., 1994; see below). 11 1 . 3 . 2 . 2 R N a s e I I R i b o n u c l e a s e I I (RNase II) i s the major e x o r i b o n u c l e o l y t i c a c t i v i t y i n c e l l - f r e e e x t r a c t s , and a c t s by h y d r o l y t i c a l l y d e g r a d i n g RNA from the 3' end r e l e a s i n g 5' rNMPs (Shen and S c h l e s s i n g e r , 1982; C a n n i s t r a r o and Kenne l1 , 1994; Coburn and M a c k i e , 1996a) . I t i s encoded by the rnb gene which maps a t 29 minutes on the E. coli chromosome (Donovan and Kushner , 1983; Z i l h a o et a l . , 1995). The rnb gene has been c l o n e d and sequenced, and the RNase I I enzyme o v e r - e x p r e s s e d and p u r i f i e d to near homogeneity (Coburn and Mackie , 1996a). The DNA sequence p r e d i c t s a p r o t e i n of 644 amino a c i d s , and the e l e c t r o p h o r e t i c m o b i l i t y of p u r i f i e d RNase I I i s approx imate ly 70 kDa, which corresponds to the p r e d i c t e d m o l e c u l a r mass of 72.5 kDa (Coburn and M a c k i e , 1996a) . The enzyme i s a c t i v e i n i t s monomeric form, and r e q u i r e s d i v a l e n t meta l i ons (Mg 2 + , Mn 2 +) and monovalent c a t i o n s (K +, NH 4 +) f o r maximal a c t i v i t y (Gupta et al., 1977; Ghosh and Deutscher , 1978; Cudny and D e u t s c h e r , 1980) . The enzyme i s most r e a c t i v e a g a i n s t the homoribopolymer p o l y ( A ) (Shen and S c h l e s s i n g e r , 1 9 8 2 ) . A l t h o u g h mutants i n RNase I I e x h i b i t a m i l d phenotype, double mutants d e f i c i e n t i n PNPase and RNase II are i n v i a b l e (Donovan and Kushner , 1986) . T h i s has been i n t e r p r e t e d to mean t h a t these exonuc leases are f u n c t i o n a l l y redundant . RNase I I has been i m p l i c a t e d a l o n g w i t h PNPase and RNase E as one of the p r i n c i p a l agents o f mRNA decay, a l t h o u g h d i s c r e t e mRNA decay i n t e r m e d i a t e s t h a t accumulate i n the absence of these three enzymes suggest t h a t 12 other degradative enzymes may also exist (Arraiano et al., 1988). Unexpectedly, both RNA-OUT (Pepe et al., 1994) and the rpsO mRNA (Hajnsdorf et al. , 1994b) are s t a b i l i z e d i n strains containing active RNase II r e l a t i v e to otherwise isogenic rnb mutants. This led to the hypothesis that RNase II, or other RNA binding proteins, could act as repressors of degradation by remaining bound to the substrate when they encountered a stable stem-loop structure, as found i n the 3' end of RNA-OUT, rpsO mRNA, and others (Causton et al., 1994). However, recent in vitro studies have shown that RNase II procesively removes mononucleotides from the 3 ' ends of RNAs u n t i l a stem-loop i s encountered; i t then dissociates leaving up to 10 unpaired residues at the 3' end (Coburn and Mackie, 1996b). Such RNAs cannot bind either RNase II or PNPase e f f i c i e n t l y and thus become "resistant" to exonuclease action (Coburn and Mackie, 1996b). It remains to be seen i f RNase II associates with other proteins in vitro or in vivo. 1 . 4 T H E " D E G R A D O S O M E " C O M P L E X Along with the evidence that the Rne/Ams protein i s central i n prokaryotic mRNA decay, several findings have suggested that i t i s part of a larger functional protein complex that has been termed the "degradosome". F i r s t , gel f i l t r a t i o n chromatography of Rne/Ams from crude extracts i n mild conditions has revealed that i t i s part of a protein complex of approximately 2500 kDa molecular weight (Niguma and Mackie, unpublished observations). Secondly, e f f o r t s 13 to p u r i f y RNase E by c o n v e n t i o n a l methods l e d to the f i n d i n g t h a t RNase E a c t i v i t y c o - p u r i f i e d w i t h PNPase (Carpous i s et al. , 1994), which i s commonly thought to scavenge the mRNA fragments a t the t e r m i n a l s tages of mRNA decay . T h i r d , a s tudy a t t e m p t i n g to c h a r a c t e r i z e the p r o t e i n complex bound to the REP m o t i f , a s t a b l e s t e m - l o o p s t r u c t u r e which i s a b a r r i e r to mRNA decay , i d e n t i f i e d b o t h Rne/Ams and PNPase i n the complex (Py et al., 1994). Together these r e s u l t s i m p l i e d a s t r o n g a s s o c i a t i o n between Rne/Ams and PNPase. A d d i t i o n a l components of the complex have been i d e n t i f i e d subsequent ly , i n c l u d i n g the p u t a t i v e "DEAD-box" RNA h e l i c a s e , RhlB (Py et a l . , 1996; M i c z a k et a l . , 1996), eno lase (Py et a l . , 1996; M i c z a k e t a l . , 1996), and the heat shock p r o t e i n , DnaK (Miczak et a l . , 1996) . The f u n c t i o n a l s i g n i f i c a n c e of the l a t t e r components are u n c l e a r , and t h e i r r e l e v a n c e to mRNA decay in vivo i s u n c e r t a i n . The components of the degradosome appear to e x i s t as m u l t i m e r i c p r o t e i n s : d e n s i t o m e t r i c a n a l y s i s of Coomassie B r i l l i a n t B l u e - s t a i n e d SDS-PAGE g e l s r e v e a l tha t the degradosome i s 16% RNase E , 28% PNPase, 11% RhlB and 18% eno lase (Py et a l . , 1996) . 1.4.1 RNA helicases The p r e s e n c e o f an RNA h e l i c a s e i n c o m b i n a t i o n w i t h the e n d o r i b o n u c l e a s e Rne/Ams and the e x o r i b o n u c l e a s e PNPase immediate ly p r e s e n t s the s a t i s f y i n g s c e n a r i o of a p r o t e i n d e g r a d a t i o n complex i n which the RNase E a c t i v i t y c l e a v e s the s u b s t r a t e i n t o s m a l l fragments , and PNPase d i g e s t s the remnants w i t h the a i d of RhlB to unwind i n h i b i t o r y secondary s t r u c t u r e ( s ) . However, t h e r e i s no 14 d i r e c t ev idence tha t RhlB does possess h e l i c a s e a c t i v i t y . E. coli encodes a s u r p r i s i n g l y l a r g e number of p o t e n t i a l RNA h e l i c a s e s , i n c l u d i n g a t l e a s t f i v e i n the "DEAD-box" f a m i l y ( L i n d e r e t al. , 1989; Kalman et al., 1991), a group of RNA h e l i c a s e - l i k e p r o t e i n s c o n t a i n i n g a c o n s e r v e d A s p - G l u - A l a - A s p (DEAD) sequence m o t i f ( L i n d e r et al. , 1989) . Three of these DEAD-box h e l i c a s e s appear to f u n c t i o n i n r i b o s o m a l assembly or f u n c t i o n ( N i c o l and F u l l e r - P a c e , 1995) . S i n c e rRNA p r e c u r s o r s are one o f many s u b s t r a t e s o f the Rne/Ams complex, t h i s may i m p l i c a t e RhlB i n another r o l e . Two o t h e r p u t a t i v e h e l i c a s e s , DeaD and SrmB, have been r e p o r t e d to s t a b i l i z e mRNA decay ( l o s t and D r e y f u s s , 1994), but whether t h i s i s a consequence of an i n h e r e n t h e l i c a s e a c t i v i t y or o t h e r p r o p e r t i e s i s u n c l e a r . 1 . 4 . 2 P o l y ( A ) p o l y m e r a s e E. coli c o n t a i n s a p o l y ( A ) polymerase a c t i v i t y (PAP I) which c a t a l y z e s the t empla te - independent a d d i t i o n of a d e n y l a t e r e s i d u e s to 3' ends of RNA (Deutscher, 1978; Cao and S a r k a r , 1992a,b; He et a l . , 1993; Xu et al., 1993) . PAP I i s a monomeric enzyme, w i t h a m o l e c u l a r weight of a p p r o x i m a t e l y 55 kDa (Cao and S a r k a r , 1992b), and i s encoded by the pcnB gene, mapping a t 3 minutes ( L o p i l a t o et al. , 1986) . PAP I i s a c t i v e in vivo, as mRNAs can be i s o l a t e d w i t h 3 ' - p o l y ( A ) t a i l s (Cao and S a r k a r , 1992a). PAP I has not been shown to a s s o c i a t e w i t h the "degradosome" complex, but may be i n t e g r a l to the r a t e of mRNA decay. M u t a t i o n s i n pcnB cause a r e d u c t i o n i n the p l a s m i d copy number because of the 15 s lower t u r n o v e r of RNA I , the a n t i - s e n s e r e g u l a t o r o f p l a s m i d r e p l i c a t i o n ( L o p i l a t o et al. , 1986). The a d d i t i o n of a p o l y ( A ) t a i l to RNA I s t i m u l a t e s i t s r a t e of d e g r a d a t i o n by PNPase 4-5 f o l d (Xu and Cohen, 1995) . The a t t a c k of RNase I I on o t h e r w i s e r e s i s t a n t mRNAs has a l s o been shown to be a s s i s t e d by p o l y a d e n y l a t i o n of the s u b s t r a t e (Coburn and M a c k i e , 1996b). C u r r e n t l y , t h e r e are no q u a n t i t a t i v e measurements of the a f f i n i t y of e i t h e r exonuclease f o r p o l y a d e n y l a t e d mRNA s u b s t r a t e s because of the l a b i l i t y o f the p o l y ( A ) t a i l . I t has been sugges ted t h a t the p o l y ( A ) t a i l p r o v i d e s an u n s t r u c t u r e d 3' end which a s s i s t s the b i n d i n g of 3' exonuclases to the mRNA (Coburn and M a c k i e , 1996a and 1996b; L i t t a u e r and Soreq , 1982), or i t may a l s o f a c i l i t a t e the b i n d i n g of RNA h e l i c a s e s to the s tem-loops s t r u c t u r e s impeding exo-and e n d o n u c l e o l y t i c d i g e s t i o n . Thus , t h e r e may be a p a r a l l e l between u b i q u i t i n which tags p r o t e i n s f o r d e g r a d a t i o n (Ciechanover , 1994), and p o l y a d e n y l a t i o n which marks mRNA f o r d i s p o s a l . 1 . 4 . 3 O t h e r e n z y m e s Rnase P, which p r o c e s s e s the 5' end of tRNA p r e c u r s o r s , has been shown to a l s o p r o c e s s the his operon mRNA i n Salmonella and s t a b i l i z e i t ( A l i f a n o et a l . , 1994). RNase M has been proposed to produce e n d o n u c l e o l y t i c c l eavages i n A - U r i c h sequences ( C a n n i s t r a r o and K e n n e l l , 1989), a l t h o u g h t h i s enzyme may i n f a c t be RNase I , a n o n - s p e c i f i c p e r i p l a s m i c r i b o n u c l a s e tha t i s known to r e d i s t r i b u t e to the c y t o p l a s m a f t e r c e l l l y s i s (Deutcher , 1985) . C l e a r l y , the r i b o n u c l e o l y t i c enzymes of E. coli need to be 16 haracterized better to understand t h e i r action and in t e r a c t i o n i n RNA metabolism. 1 . 5 N E W P E R S P E C T I V E S O N m R N A D E C A Y Mature mRNAs usually contain a hairpi n or rela t e d secondary structure at th e i r 3' ends, which blocks the digestive a c t i v i t i e s of RNase II and PNPase. Since there are apparently no 5'->3 ' exonucleases i n E. coli, mRNAs are generally stable u n t i l endonucleolytic cleavages upstream from the 3 ' terminus allow access of exonucleases to the body of the mRNA (Higgins et al. , 1993) or u n t i l PAP I polyadenylates the 3' end to f a c i l i t a t e digestion past secondary structure (Xu and Cohen, 1995; Coburn and Mackie, 1996a and 1996b). In prokaryotes, the ef f e c t of tra n s l a t i o n on mRNA must also be considered because b a c t e r i a l t r a n s c r i p t i o n and tra n s l a t i o n are often coupled events. Endonucleolytic cleavage s i t e s can be blocked by tr a n s l a t i n g ribosomes, and mRNA decay rates can be influenced by the frequency of t r a n s l a t i o n a l i n i t i a t i o n (Petersen, 1993). When tr a n s c r i p t i o n and t r a n s l a t i o n are uncoupled, mRNA synthesis may be lar g e l y completed before appreciable translation occurs, leading to reduced s t a b i l i t y presumably since i t would be more exposed to degradative endonucleases (lost and Dreyfus, 1995). The "consensus" model implies that the endonuclease digestions occur i n a random fashion; however, there i s evidence of primary endonucleolytic cleavage s i t e s near the 5' end (Bechhofer, 1993), which triggers a 5'->3' propagated "wave" of endonucleolytic cleavages (Hansen et al. , 17 1994) . Several coli mRNAs with prolonged physical and functional l i f e t i m e s , such as ompA, exhibit stable RNA secondary structures at their 5' ends which confer resistance to degradation (Emory and Belasco, 1990; Emory et al. , 1992; Hansen et al., 1994). Adding a 5' single-stranded extension to the 5' hairpin neutralizes RNase E resistance (Emory et al., 1992), supporting evidence that RNase E dependent degradation at E. coli mRNA 5' ends appears to require a single-stranded region (Hansen et al., 1994). The idea of random endonucleolytic digestion has been d i s p e l l e d further by the observation that longer mRNAs do not necessarily have shorter half l i v e s (Belasco, 1993), which would not be possible i n a random digestion scenario. A "tethering" model for the degradosome (G.A. Mackie, personal communication) explains the current findings as follows: the multi-enzyme degradosome complex i n i t i a t e s mRNA decay by binding at a s i t e proximal to the 5' end i n a r a t e - l i m i t i n g step, i n h i b i t e d by secondary structure at the extreme 5' end (Chen et al. , 1991; Bouvet and Belasco, 1992; Hansen et al., 1994) and by competition from transl a t i o n a l i n i t i a t i o n (Petersen, 1992; Rapaport and Mackie, 1994). The i n i t i a t e d RNase E complex i s tethered to the substrate by the strong RNA binding domain of the Rne protein (Miao, personal communication). The f i r s t single-stranded A+U r i c h mRNA sequence would then migrate, without s i g n i f i c a n t d i s s o c i a t i o n , to a second Rne subunit i n a form of "pseudo-processivity" . Each endonucleolytic cleavage catalyzed by Rne would leave mRNA 18 fragments w i t h 3 1 ends s u i t a b l e f o r PNPase or RNase I I d i g e s t i o n , i n some cases o n l y a f t e r p r i o r o l i g o a d e n y l a t i o n of the new 3' end to f a c i l i t a t e t h e i r b i n d i n g (Coburn and M a c k i e , 1996b; Xu and Cohen, 1995). When the RNase E complex encounters an i n t e r n a l s tem- loop s t r u c t u r e on the s u b s t r a t e , i t may e i t h e r s k i p over i t or unwind i t , p o s s i b l y w i t h the a i d o f the p u t a t i v e RNA h e l i c a s e , R h l B . T i g h t l y f o l d e d s t r u c t u r e s a t the 3' end of mRNA may a l s o be u n f o l d e d by the RhlB a s s o c i a t e d w i t h the degradosome, or p o l y a d e n y l a t i o n o f the 3 ' end may be s u f f i c i e n t to a l l o w PNPase d e g r a d a t i o n . In an a l t e r n a t i v e t h e o r y , S idney Kushner p r o p o s e d t h a t p o l y a d e n y l a t i o n of the 3' end of the mRNA a l l o w e d ' l o a d i n g ' of PNPase i n t o the d e g r a d a t i o n complex which was a l r e a d y p r e s e n t on the s u b s t r a t e (O'Hara et a l . , 1995). PNPase s h o r t e n i n g o f the p o l y ( A ) t a i l would be accompanied by upstream e n d o n u c l e o l y t i c c l e a v a g e by RNase E , g e n e r a t i n g a new 3 ' end which c o u l d be p o l y a d e n y l a t e d , and the c y c l e r epea ted (O'Hara et a l . , 1995). The l a t t e r theory f a i l s to e x p l a i n the extended s t a b i l i t y of s u b s t r a t e s such as ompA, which has a h i g h l y s t r u c t u r e d 5' u n t r a n s l a t e d r e g i o n impeding RNase E-dependent d e g r a d a t i o n (Hansen et a l . , 1994) . An a l t e r n a t i v e pathway may a p p l y to s m a l l e r mRNAs and the fragments d i g e s t e d by RNase E c l e a v a g e , where decay i s l a r g e l y from the 3 ' ->5' d i r e c t i o n , mediated by exonuc leases and PAP I a c t i v i t y . T h i s pathway can be demonstrated in vivo (Mackie , 1989) and in vitro (Coburn and M a c k i e , 1996b) f o r the S20 mRNA and i m p l i e d i n o t h e r s (Meyer and S c h o t t e l , 1992). 19 S i g n i f i c a n t r e c e n t p r o g r e s s has been made i n the u n d e r s t a n d i n g of the mRNA decay proces s i n E. coli, p a r t i c u l a r l y i n d e f i n i n g the macromolecules i n v o l v e d . However, l i t t l e i s known about the i n t e r a c t i o n of the enzymes i n v o l v e d i n the degradosome. The purpose of t h i s s tudy was to i d e n t i f y a b i n d i n g r e g i o n on Rne/Ams f o r the bes t c h a r a c t e r i z e d of the degradosome enzyme i n t e r a c t i o n s , the Rne/Ams and PNPase a s s o c i a t i o n (Carpous i s e t a l . , 1994; Py et a l . , 1994; Py et a l . , 1996; Miczak et a l . , 1996). The temperature s e n s i t i v e mutants a t the 5' end of Rne/Ams have been shown to d i s r u p t i n t e r a c t i o n s w i t h PNPase (Carpous i s e t a l . , 1994), w h i l e o t h e r s have found t h a t C - t e r m i n a l d e l e t i o n s of Rne/Ams a l s o i n t e r f e r e w i t h PNPase b i n d i n g (Kido et a l . , 1996) . In these s t u d i e s , I a t tempted to d e f i n e a s p e c i f i c PNPase b i n d i n g domain w i t h i n the Rne/Ams p r o t e i n by c h a r a c t e r i z i n g a s e r i e s o f Rne/Ams d e l e t i o n mutants , and m o n i t o r i n g t h e i r a b i l i t y to a s s o c i a t e w i t h PNPase under v a r i o u s c o n d i t i o n s in vitro. 20 C h a p t e r 2 M A T E R I A L S A N D M E T H O D S 2 . 1 R E A G E N T S Bacto-tryptone ( bacto-yeast extract and bacto-agar were purchased from Difco Laboratories. A m p i c i l l i n , c a r b e n i c i l l i n , aprotinin, pepstatin A, leupeptin, PMSF and lysozyme were obtained from Sigma. Agarose, acrylamide, bis-acrylamide, ammonium persulfate, TEMED, urea and EDTA were purchased from Bio-Rad Laboratories. (3-mercaptoethanol, DTT and T r i t o n X-100 were obtained from Fisher S c i e n t i f i c . Deoxy and dideoxy-ribonucleotides were bought from Pharmacia. [a-32P]-CTP, [a-32P]-ATP, 35S-dATP and 3H-poly(A) were purchased from Amersham. IPTG was obtained from Promega. A l l other reagents were of reagent grade or higher and were obtained from Fisher, Bio-Rad, BDH, Pharmacia or Sigma. Taq DNA polymerase, T4 DNA ligase, T7 RNA polymerase, Eco RI, Hind III, Hinc II, Bam HI, Nde I, Xho I, and DNase I were purchased from either Pharmacia, Promega, New England Biolabs or Boehringer Mannheim and used according to each manufacturer's ins t r u c t i o n s . Biogel Al.5m (100-200 mesh) and Biogel A15m (100-200 mesh) were obtained from Bio-Rad. Protein molecular weight standards for gel f i l t r a t i o n (Blue dextran, thyroglobulin, f e r r i t i n , catalase, aldolase, and bovine serum albumin) were from Pharmacia. Freund's Incomplete Adjuvant was purchased from Sigma. Immobilon P transfer membrane was bought from M i l l i p o r e , while ECL 21 r e a g e n t s were o b t a i n e d from Amersham. P r o t e i n A a f f i x e d t o Sepharose beads were from Pharmacia. Kodak X-Omat AR f i l m was used f o r a u t o r a d i o g r a p h y . 2 . 2 V E C T O R S , S T R A I N S A N D M E D I A 2 . 2 . 1 V e c t o r s The p l a s m i d pET-3xc (Appendix 1) has an a m p i c i l l i n r e s i s t a n c e gene, a T7 promoter, and f u s e s a 12 amino a c i d T7 gene 10 l e a d e r p e p t i d e t o t h e N-terminus o f the p r o t e i n o f i n t e r e s t ( S t u d i e r , e t al., 1990). pET-24b (Appendix 2) has a kanamycin r e s i s t a n c e gene, a 11 lac promoter, and p e r m i t s a C - t e r m i n a l f u s i o n o f a c l o n e d open r e a d i n g frame t o a C - t e r m i n a l H i s - T a g . The p l a s m i d pEPal8 c o n t a i n s the c o d i n g sequence f o r a H i s - t a g -PNPase f u s i o n p r o t e i n , and was o b t a i n e d from C F . H i g g i n s ' l a b o r a t o r y . I t i s comprised of the f u l l pnp gene c l o n e d i n t o pET-14b, w h i c h c o n t a i n s an a m p i c i l l i n r e s i s t a n c e gene, and a T7 promoter (Py e t al., 1994). A l l pET v e c t o r s a r e d e r i v e d from pBR322 and use t h e T7 RNA polymerase t o d i r e c t e x p r e s s i o n of c l o n e d genes ( S t u d i e r , e t al., 1990) . 2 . 2 . 2 B a c t e r i a l S t r a i n s Immediately a f t e r l i g a t i o n , a l l c l o n e s were t r a n s f o r m e d i n t o the E. coli s t r a i n JM109 (F' traD36, laclq, lacT^ZAMlB, proA+B+Z e l 4 " , A(lac-proAB), thi, gyrA96, (Nal r) , endAl, hsdRl7, relAl, supE44, 22 recAl). T h i s s t r a i n i s capab le of b e i n g t r a n s f o r m e d by n o n -s u p e r c o i l e d DNA e f f i c i e n t l y . A l l p la smids used f o r p r o t e i n o v e r - e x p r e s s i o n were t rans formed i n t o the E. coli s t r a i n BL21(DE3) (F~ ompT, hsdSB, r B ", mB~ (XDE3) ) . BL21(DE3) l a c k s b o t h the Ion and ompT p r o t e a s e s , and i s l y s o g e n i c f o r XDE3, which c a r r i e s the T7 RNA polymerase gene under lacUV5 promoter c o n t r o l . E x p r e s s i o n of T7 RNA polymerase i s i n d u c i b l e by the a d d i t i o n o f IPTG. 2 . 2 . 3 M e d i a M9ZB medium (lOg b a c t o - t r y p t o n e , 6g Na 2 HP0 4 , 3g KH 2 P0 4 , l g NH4CI, 5g N a C l , per 1 l i t r e ; MgCl 2 added to 1 mM a f t e r a u t o c l a v i n g ) was used to suppor t the growth of GM402, an o v e r - e x p r e s s o r of the Rne p r o t e i n (Cormack, et a l . , 1993). LB b r o t h ( lOg b a c t o - t r y p t o n e , 5g b a c t o - y e a s t e x t r a c t and 5g N a C l p e r 1 l i t r e ; supplemented a f t e r s t e r i l i z a t i o n w i t h 0.2% g l u c o s e , 1 mM MgS0 4 , 10 ug/mL t h i a m i n e , and 50 ug/mL of the a p p r o p r i a t e a n t i b i o t i c ( a m p i c i l l i n , c a r b e n i c i l l i n , or kanamycin)) was used to grow o ther c e l l s c o n t a i n i n g a p l a s m i d of i n t e r e s t . LB agar p l a t e s were used to suppor t the growth of t r a n s f o r m e d c e l l s . I t was p r e p a r e d e x a c t l y as the LB b r o t h p r i o r to a u t o c l a v i n g , w i t h the a d d i t i o n of 1 5 g / l i t r e of b a c t o - a g a r . A f t e r a u t o c l a v i n g , the m i x t u r e was c o o l e d to about 50°C, p r i o r to s u p p l e m e n t a t i o n as needed. 23 2 . 3 O L I G O N U C L E O T I D E S The o l i g o n u c l e o t i d e s were s y n t h e s i z e d on an A p p l i e d B i o s y s t e m s 3 91 DNA S y n t h e s i z e r o r e q u i v a l e n t and were resuspended i n dH 20 and s t o r e d a t -20°C. 2 . 4 R E C O M B I N A N T D N A M E T H O D S 2 . 4 . 1 I s o l a t i o n o f p l a s m i d D N A P l a s m i d s were p r e p a r e d from 3 5 mL s a t u r a t e d c u l t u r e s grown i n LB b r o t h u s i n g a m o d i f i c a t i o n of the a l k a l i n e l y s i s method ( B i r n b o i m and Doly , 1979) and p u r i f i e d e i t h e r by cesi u m c h l o r i d e i s o p y c n i c c e n t r i f u g a t i o n o r e t h a n o l p r e c i p i t a t i o n , as o u t l i n e d i n Sambrook e t al. (1989). 10 mL p l a s m i d p u r i f i c a t i o n s were a l s o p e r f o r m e d u s i n g the W i z a r d Plus M i n i p r e p s P u r i f i c a t i o n System by Promega. 2 . 4 . 2 R e s t r i c t i o n e n z y m e d i g e s t i o n s For e v e r y ug of DNA t o be d i g e s t e d , a p p r o x i m a t e l y 10 u n i t s of r e s t r i c t i o n enzyme was added. The DNA and r e s t r i c t i o n enzyme were mixed w i t h a p p r o p r i a t e b u f f e r a c c o r d i n g t o t h e enzyme m a n u f a c t u r e r ' s s p e c i f i c a t i o n s . 2 . 4 . 3 S e p a r a t i o n o f D N A b y g e l e l e c t r o p h o r e s i s S m a l l DNA and RNA fragments (<500 bp o r n u c l e o t i d e s ) were s e p a r a t e d by e l e c t r o p h o r e s i s i n 6% p o l y a c r y l a m i d e g e l s (29:1 r a t i o of a c r y l a m i d e : b i s - a c r y l a m i d e ) , c o n t a i n i n g IX TBE b u f f e r (90mM T r i s , 9 0 mM b o r i c a c i d and 2 mM NaEDTA). 6 x 10"4 % Ammonium p e r s u l f a t e and 2.4 x 10 _ 3% TEMED was added t o c r o s s l i n k t h e a c r y l a m i d e . 24 Electrophoresis was performed at 150 V using a Pharmacia Gene Power Supply (GPS 200/400). Separation of larger DNA fragments was performed i n 0.8% agarose dissolved i n IX TAE buffer (40 mM T r i s , 20 mM sodium acetate and 1 mM NaEDTA). Electrophoresis was performed with a Pharmacia GPS 200/400 set to approximately 0.12 amps. DNA and RNA was vi s u a l i z e d i n both types of electrophoresis by stai n i n g with 1 ug/mL ethidium bromide and viewing under u l t r a v i o l e t l i g h t . 2 . 4 . 4 I n V i t r o a m p l i f i c a t i o n o f D N A b y t h e P o l y m e r a s e C h a i n R e a c t i o n 100 pmol each of forward and reverse primers were combined with approximately 2 0 ng of a linear template, 0.2 mM dNTPs, 1.5 mM MgCl2, Mg-free buffer (500 mM KCl, 100 mM Tris-HCl (pH 8.3), 0.1% gelatin) and 5 units/uL Taq polymerase according to the manufacturer's s p e c i f i c a t i o n s . A Hypercell B i o l o g i c a l s Programmable Thermal Controller was used to perform the following thermal cycle: 5 min @ 94°C, then 3 0 cycles of 1 min & 48°C, 3 min & 72°C and 1 min @ 94°C. Products of PCR were p u r i f i e d by extraction with equal volumes of chloroform/isoamyl alcohol (24:1 ratio) solution and phenol/chloroform/isoamyl alcohol (25:24:1 ratio) solution, followed by an ethanol p r e c i p i t a t i o n . The QIAquick PCR P u r i f i c a t i o n K i t from Qiagen was also used as instructed by the manufacturer. 2 . 4 . 5 L i g a t i o n s 60 ng of pET-3xc was mixed with equimolar amounts of the 25 appropriate DNA fragment, along with 1 mM ATP, IX One-Phor-All buffer and 0.1 Weiss unit of T4 ligase to a volume of 10 uL. The incubation was performed at 15°C overnight. 2 . 4 . 6 T r a n s f o r m a t i o n s i n t o E. coli c o m p e t e n t s t r a i n s E. coli strains were rendered competent by a calcium chloride method described by Bio-Rad Inc. The c e l l s , stored as a 200 uL glycerol stock at -70°C, were thawed and mixed with plasmid DNA and kept on ice for 60 min., followed by a 3 min shock at 42°C. Approximately 1 mL of LB medium was added and the samples were incubated at 37°C for 1 hour. C e l l s were then spread onto 100-mm diameter LB agar plates containing 50 ug/mL of the appropriate a n t i b i o t i c (ampicillin, c a r b e n i c i l l i n , or kanamycin) and incubated at 37°C overnight. 2 . 4 . 7 D N A S e q u e n c i n g A l l clones were sequenced using the dideoxy method developed by Sanger et al. (1977) and Biggin et al. (1983) . Approximately 2-3 ug of plasmid DNA and 2 0 ng of oligonucleotide primer were used i n accordance with the method of the Pharmacia T7 Sequencing K i t . The 3 5S-labelled samples were heat-denatured i n 40% (v/v) formamide and separated i n 8% acrylamide (19:1, acrylamide:bis-acrylamide) sequencing gels containing 8 M urea i n TBE buffer. 2 . 5 O V E R - E X P R E S S I O N A N D P U R I F I C A T I O N O F R E C O M B I N A N T P R O T E I N S 2 . 5 . 1 S o d i u m D o d e c y l S u l f a t e P o l y a c r y l a m i d e G e l s ( S D S - P A G E ) Samples were combined with protein sample buffer (60 mM T r i s -26 HC1 (pH 6 . 8 ) , 1.5% (w/v) SDS, 25 mM DTT, 5% ( v / v ) g l y c e r o l a n d B r o m o p h e n o l B l u e ) t h e n b o i l e d t o d e n a t u r e t h e p r o t e i n s . P r o t e i n p r e p a r a t i o n s w e r e s e p a r a t e d b y e l e c t r o p h o r e s i s i n 10%, 1 2 . 5 % o r 15% p o l y a c r y l a m i d e g e l s ( 36:1 r a t i o o f a c r y l a m i d e : b i s - a c r y l a m i d e ) c o n t a i n i n g 400 mM T r i s - H C l (pH 8.8) a n d 0.1% (w/v) SDS. An u p p e r 4.5% p o l y a c r y l a m i d e (36:1 r a t i o o f a c r y l a m i d e : b i s - a c r y l a m i d e ) s t a c k i n g l a y e r c o n t a i n i n g 125 mM T r i s - H C l (pH 6.8) a n d 0.1% (w/v) SDS was p o u r e d a b o v e t h e s e p a r a t i n g l a y e r . E l e c t r o p h o r e s i s was p e r f o r m e d i n L a e m m l i ' s b u f f e r (25 mM T r i s , 192 mM g l y c i n e , 0.1% (w/v) SDS) a t 70 v o l t s t h r o u g h t h e s t a c k i n g p o r t i o n a n d 150-200 v o l t s t h r o u g h t h e s e p a r a t i n g g e l . P r o t e i n s s e p a r a t e d on SDS-PAGE g e l s w e r e v i s u a l i z e d b y s t a i n i n g w i t h C o o m a s s i e B r i l l i a n t B l u e R250, f o l l o w e d b y d e s t a i n i n g i n a 5% ( v / v ) e t h a n o l , 5% a c e t i c a c i d s o l u t i o n . D i l u t e s a m p l e s w e r e c o n c e n t r a t e d t o a u s a b l e v o l u m e b y p r e c i p i t a t i o n w i t h 5 v o l u m e s o f c o l d a c e t o n e . 2 . 5 . 2 P r o t e i n o v e r - e x p r e s s i o n a s s a y -P r o t e i n o v e r - e x p r e s s i o n f r o m t h e pET p l a s m i d - B L 2 1 ( D E 3 ) s y s t e m was c o n f i r m e d b y g r o w i n g c u l t u r e s o f s i n g l e c l o n e s i n 10 mL o f LB b r o t h , a n d i n d u c i n g them w i t h IPTG a s s t a t e d p r e v i o u s l y . 1 mL a l i q u o t s o f c u l t u r e w e r e t a k e n a t 0, 1, 2 a n d 3 h o u r s a f t e r i n d u c t i o n . The c e l l s w e r e c o l l e c t e d b y c e n t r i f u g a t i o n a n d l y s e d b y b o i l i n g i n 200 uL o f 2X SDS sa m p l e b u f f e r (0.1 M T r i s - H C l , pH 6.8, 3% (w/v) SDS, 0.05 M DTT, 10% (w/v) g l y c e r o l ) . A b r i e f s o n i c a t i o n w i t h a m i c r o p r o b e t i p was p e r f o r m e d t o b r e a k DNA v i s c o s i t y , t h e n t h e p r o t e i n s w e r e s e p a r a t e d on a n SDS-PAGE g e l a s d e s c r i b e d i n 27 2.5.1. 2 . 5 . 3 C u l t u r e a n d i n d u c t i o n o f r e c o m b i n a n t p r o t e i n s A l l target genes were cloned into pET plasmids and placed under the control of T7 tra n s c r i p t i o n and t r a n s l a t i o n signals. Cultures were grown i n 12 5 mL of M9ZB media to an o p t i c a l density of 0.5 at 600 nm. They were then d i l u t e d with an equal volume of M9ZB containing ImM IPTG to achieve induction and growth was continued with vigorous aeration for 3 hr. The c e l l s were colle c t e d by centrifugation and washed i n 25 mL of Buffer A (60 mM T r i s (pH 7.6), 10 mM MgCl2, 60 mM NH4C1, 0.5 mM EDTA, 5% (v/v) gly c e r o l ) . The c e l l s were again collected by centrifugation, then resuspended i n 4 mL Buffer A. After supplementation with protease i n h i b i t o r s and DNase (0.1 mM DTT, 0.2 mM PMSF, 2 ug/mL aprotinin, 0.8 ug/mL leupeptin, 0.8 ug/mL pepstatin A, and 20 ug/mL DNase I), the c e l l s were disrupted by passage through an Aminco French pressure c e l l at 8,000 p . s . i . The lysate was centrifuged at 30,000 x g for 45 min, and the supernatant (S30) was fractionated by pr e c i p i t a t i o n with 26% (w/v) (NH4)2S04 to y i e l d the AS26 fr a c t i o n as described by Mackie (1991) . The . p e l l e t containing the over-expressed protein was resuspended i n 4 mL of Buffer A with the aforementioned protease i n h i b i t o r s , and s t i r r e d with 3% Tr i t o n X-100 and 1.2 M NH4C1, i n a manner sim i l a r to Carpousis et al. (1994). A 200,000 x g centrifugation yielded a supernatant (S200) containing the proteins of inte r e s t . 2 . 5 . 4 C l e v e l a n d M a p p i n g The protein bands of interest were excised from a 10% 28 polyacrylamide gel and inserted into the wells of a 15% polyacrylamide gel. Each s l i c e was overlayed with 1.0, 0.1, or 0.01 ug of crude chyraotrypsin i n protein sample buffer (see section 2.5.1). The sample and protease were electrophoresed through 90% of the stacking gel, followed by a current stoppage for 3 0 min to allow protease digestion. The current was then resumed, and the polyacrylamide gel examined as described i n section 2.5.1. 2 . 5 . 5 A n i o n a n d c a t i o n e x c h a n g e c h r o m a t o g r a p h y o n t h e P h a r m a c i a F P L C s y s t e m Native or deleted Rne protein p u r i f i e d as described i n section 2.5.3, was d i l u t e d 1:10 in.Buffer A (60 mM T r i s , pH 7.6, 10 mM MgCl 2, 60 mM NH4C1, 0.5 mM EDTA, 5% (v/v) gly c e r o l plus protease in h i b i t o r s as described i n section 2.5.3) then loaded onto the FPLC SuperLoop. Chromatography through.the anion exchange Mono Q column and cation exchange on the Mono S column were performed i d e n t i c a l l y , at a flow rate of 1 mL/min. Injection of 10 mL of sample was followed by 13 mL of buffer 1 (10 mM Hepes, 1 mM EDTA, 0.1 mM PMSF, 0.5% (v/v) Genapol X-080, 40 mM NaCl). For the next 2 8 mL, buffer 2 (i d e n t i c a l to Buffer 1 except 1 M NaCl) was injected as an increasing•gradient u n t i l the s a l t concentration ended at 0.75 M NaCl. These conditions are a modification of standard FPLC programs outlined by Pharmacia. 2 . 5 . 6 S i z e E x c l u s i o n C h r o m o t o g r a p h y Two Pharmacia gel f i l t r a t i o n columns (1 cm x 50 cm) were packed with Biogel Al.5m (100-200 mesh) or Biogel Al5m (100-200 mesh), respectively, according to procedures outlined by Bio-Rad. 29 The columns were e q u i l i b r a t e d i n B u f f e r A and a s t a n d a r d c u r v e f o r e l u t i o n was determined u s i n g B l u e D e x tran (2000 kDa), t h y r o g l o b u l i n (669 kDa), f e r r i t i n (440 kDa), c a t a l a s e (232 kDa), a l d o l a s e (158 kDa), and BSA (67 kDa) as markers. 2 . 5 . 7 I m m o b i l i z e d m e t a l i o n c h r o m a t o g r a p h y C u l t u r e s of pEPal8 i n BL21(DE3) were grown i n 125 mL o f LB media, i n d u c e d w i t h IPTG and h a r v e s t e d as o u t l i n e d i n s e c t i o n 2.5.3. C e l l l y s a t e s were t a k e n t o the S3 0 s t a g e as p r e v i o u s l y s t a t e d , then p u r i f i e d on H i s - B i n d r e s i n u s i n g the Novagen H i s - B i n d K i t , f o l l o w i n g a p r o t o c o l d e s c r i b e d by the ma n u f a c t u r e r and Py, e t al. (1994) w i t h a s l i g h t m o d i f i c a t i o n . I n i t i a l a d s o r p t i o n was formed b a t c h w i s e and the bound p r o t e i n c o l l e c t e d by c e n t r i f u g a t i o n o f t he r e s i n - p r o t e i n complex a t 600 x g i n a 50 mL p l a s t i c c e n t r i f u g e tube. The s u p e r n a t a n t c o n t a i n i n g unbound p r o t e i n s was removed w i t h a p i p e t t e . The subsequent washes, e l u t i o n and s t r i p p i n g were p e r f o r m e d i n a 5 mL c a p a c i t y d i s p o s a b l e p l a s i c column as recommended. 2 . 6 I M M U N O L O G I C A L M E T H O D S 2 . 6 . 1 P r e p a r a t i o n o f a n t i g e n i c p r o t e i n f o r r a b b i t i m m u n i z a t i o n Up t o 1 mg of t o t a l p r o t e i n was s e p a r a t e d on a 10% o r 12.5% SDS-PAGE g e l . The p r o t e i n of i n t e r e s t was i d e n t i f i e d by s t a i n i n g w i t h Coomassie B r i l l i a n t B l u e R250 i n water, and t h a t p o r t i o n of the g e l was removed and l y o p h i l i z e d . The d r i e d g e l s l i c e was cr u s h e d i n a m o r t a r and p e s t l e and the e q u i v a l e n t o f 250 ug of 30 protein was suspended i n 1 mL water. An equal volume of Freund's Incomplete Adjuvant was slowly added with a g i t a t i o n on a benchtop shaker u n t i l a smooth emulsion was achieved. 1 mL of this emulsion was injected into 8 week old New Zealand white rabbits (approximately 4-5 kg) for the i n i t i a l immunization, and subsequent boosts were conducted every 3-4 weeks. 2 . 6 . 2 R a b b i t b l e e d s A l l bleeds were performed by the s t a f f at the Animal Care Centre, University of B r i t i s h Columbia. A minimum of 10 mL of rabbit blood was removed p r i o r to the i n i t i a l immunization, and after each boost. After three immunizations, a f u l l body bleed was obtained. A l l bleeds were allowed to cl o t at 37°C for 2 hours. The c l o t was then separated from the sides of the c o l l e c t i o n vessel and the bleed stored at 4°C overnight. The following day, the serum was removed from the cl o t and any remaining insoluble material removed by centrifugation at 10,000 x g for 10 min at 4°C, as described by Harlow & Lane (1988). The serum was prepared for storage by heat i n a c t i v a t i o n at 56°C for 35 min, followed by the addition of an equal volume of gl y c e r o l . The prepared serum was stored at -20°C or -70°C. 2 . 6 . 3 W e s t e r n b l o t s Separation of proteins on 10% or 12.5% SDS-PAGE gels, and wet electrophoretic transfer to n i t r o c e l l u l o s e or Immobilon P i n alk a l i n e carbonate buffer (10 mM NaHC03, 3 mM Na2C03, 20% (v/v) methanol) for 2 hrs was performed i n a manner si m i l a r to that of 31 Harlow & Lane (1988). The membrane was blocked with a solution of 5% casein i n PTBN (0.002 M sodium phosphate (pH 7.0), 5 x 10"4% (v/v) Tween 20, 0.1% (w/v) BSA, 1 mM Na azide, 0.85% (w/v) NaCl). Exposure to primary antibody was a minimum of 1.5 hours, and to the secondary antibody (goat a-rabbit IgG (H+L)-horseradish peroxidase conjugate) a minimum 0.5 hours. A l l washes were done i n Phosphate Buffered Saline (PBS) (Sambrook et al. , 1989). V i s u a l i z a t i o n of antibody binding was performed by ECL using the Western B l o t t i n g Analysis System K i t from Amersham. 2 . 6 . 4 A n t i b o d y s t r i p p i n g Membranes were submerged i n a solution of 62.5 mM Tris-HCl (pH 6.8), 2% (w/v) SDS, and 0.1 M (3-mercaptoethanol warmed to 50°C for 3 0 min, with agitation. The stripped membranes were washed 2 times i n PBS, then reblocked with PTBN + 5% casein for 1 hour. 2 . 6 . 5 F a r - W e s t e r n b l o t t i n g Far-Western b l o t t i n g was performed as i n section 2.6.3, with the following exceptions: aft e r membrane blocking with 5% casein i n PTBN, the membrane was washed twice with PBS, then exposed to highly p u r i f i e d PNPase (approximately 25 ug/mL), supplied by G.A. Coburn, for 1 hour at 37°C. The membrane was again washed twice with PBS, then exposed to antibodies as described for Western bl o t s . In the i n i t i a l Far-Western b l o t t i n g experiment, exposure to the highly p u r i f i e d PNPase was performed i n 2 mL of PTBN + 5% casein (see section 2.6.3), PBS (see Sambrook et al., 1989), Buffer 32 A (see s e c t i o n 2.5.5) or Denhardt's s o l u t i o n (see Sambrook e t al. 1989). Subsequent Far-Westerns were p e r f o r m e d i n 2 mL of PBS. 33 TABLE 1 O l i g o n u c l e o t i d e s O l i g o Name O r i e n t -a t i o n Sequence 1 Co-o r d 2 K N l f F o r -ward 5 ' GGAAACCGGCAGGATCCCTCGTCAGGCT 3' pnp 54 KNlb Rev-e r s e 5 ' TTGTTTGTCGGGGATCCGGTAAGCATCG 3' pnp 792 KN2f F o r -ward 5 ' CGTGCTGGCAGGGATCCCGGATATGGAC 3' pnp 1230 KN2b Rev-e r s e 5 ' TTGAGAGATGTGGATCCGACCTTCTTTAC 3' pnp 1959 T7 Prom. F o r -ward 5 ' TTAATACGAC TCAC TATAGGG 3' Rne C216a Rev-e r s e 5 ' TGAC GTAAGTACTCGAGGAATGC GC GAAC 3' rne 671 Rne C216b Rev-e r s e 5 ' CGTAAGTACTCGAGGAATTCGCGAACGATTACG 3' rne 668 1. The bases marked i n b o l d a r e the e n g i n e e r e d r e s t r i c t i o n s i t e s and t h e bases u n d e r l i n e d d i f f e r from the n a t i v e sequence. 2. The c o - o r d i n a t e s g i v e n a r e complementary t o th e 5' r e s i d u e of the p a r t i c u l a r o l i g o n u c l e o t i d e . 34 C h a p t e r 3 R E S U L T S 3 . 1 A N T I B O D Y G E N E R A T I O N 3 . 1 . 1 G e n e r a t i o n o f a n t i b o d i e s a g a i n s t a n t i g e n i c s i t e s i n P N P a s e The f i r s t objective of these studies was to create polyclonal antibodies directed against s p e c i f i c regions of the PNPase protein. By optimally over-expressing the two most antigenic s i t e s i n PNPase, I attempted to generate high t i t r e s of antibodies that were highly s p e c i f i c . The lack of any three dimensional structure information forced us to predict antigenic s i t e s based on the PeptideStructure and PlotStructure modelling program (Jameson and Wolf, 1988) (Fig. 1) . The f i r s t antigenic s i t e selected (SI) i s close to the amino-terminal end of the protein, and spans amino acids 23 to 260. The second antigenic s i t e (S2) i s towards the carboxy terminal, and covers amino acids 415 to 649. The nucleotide sequences of the pnp gene corresponding to these antigenic s i t e s were amplified by PCR using oligonucleotides that add flanking Bam HI r e s t r i c t i o n s i t e s (Table 1). The amplified sequences were l i g a t e d into the polycloning s i t e of pET-3xc (Novagen; Appendix 1) at i t s Bam HI s i t e , and in s e r t i o n of sequences into the proper orientation was confirmed by DNA sequencing (data not shown) . The clones were named pSl and pS2, respectively. 35 Figure 1. Antigenic site predictions in PNPase from the primary structure. The nucleotide sequence of the a-subunit of PNPase (Regnier etal., 1987) was analysed by the Sequence Analysis Software Package (GCG Package, Version 7) by Genetics Computer Group Inc. The PeptideStructure and PlotStructure programs (Jameson and Wolf, 1988) used the sequence information to predict a secondary structure for the protein. Antigenic sites are predicted based on the hydrophilicity and the secondary structure of the polypeptide chain in a given region, and are shown as a region surrounded by an octagon, a-helix regions are indicated by a sine wave, and P-sheet regions by a sharp, sawtooth wave. Coiled regions are represented as a dull, sawtooth wave, and turns in the polypeptides are shown as a 180° turn in the line. 36 Figure 2 . Over-expression and identification of proteins containing the two antigenic regions of PNPase. (a) 1.0 uL of extracts of BL21(DE3) containing pSl (lane 2) and pS2 (lane 3) were separated on a 10% polyacrylamide gel after induced over-expression of PNPase antigenic site 1 (SI) and site 2 (S2), respectively (see Sec. 2.5.3). The approximate molecular weights of the over-expressed proteins are indicated on the right, based on the migration of the standard proteins in lane 1. (b) Analysis of the components of the SI doublet by Cleveland mapping (See Sec. 2.4.4). Lanes 2-5 contain the upper band of the SI doublet combined with 0, 1.5, 1.0 and 0.1 iig of chymotrypsin, respectively. Lanes 6-9 contain the lower band of the SI doublet exposed to 0, 1.5, 1.0 and 0.1 pg of chymotrypsin, respectively. Products were separated by electrophoresis on a 15 % polyacrylamide gel. A, B and C indicate the common migration point of three polypeptides. 38 (a) 1 2 3 200 kDa 116 kDa 97 kDa 66 kDa 45 kDa 31 kDa 35 kDa 31 kDa 21.5 kDa 14.5 kDa 6.5 kDa (b) 1 2 3 4 5 6 7 8 9 200 kDa ' 39 Figure 3. Detection of T7 genelO-PNPase fusion proteins by Western blotting, (a) An extract of BL21(DE3) (pSl) over-expressing PNPase antigenic site 1 (SI) was separated by SDS-PAGE and blotted onto nitrocellulose (See Sec. 2.5.3). Lane 2 shows an SDS-PAGE separation of the cell extract before blotting onto nitrocellulose. Lanes 4-8 show the chromogenic visualization of the SI protein on the nitrocellulose using a serial dilution of the a-Sl antibody (1:8000, 1:16000, 1:32000, 1:64000 and 1:128000 dilution, respectively), (b) An extract of BL21(DE3) (pS2) over-expressing PNPase antigenic site 2 (S2) was separated by SDS-PAGE and blotted onto nitrocellulose. Lane 2 shows the separated cell extract prior to nitrocellulose blotting, visualized by staining with Coomassie Blue. Lanes 4-8 show the chromogenic visualization of the S2 protein on nitrocellulose by a serial dilution of the a-S2 antibody (1:8000, 1:16000, 1:32000, 1:64000 and 1:128000 dilution, respectively). Lane 3 in (a) and (b) contains extracts of BL21(DE3) that over-express RNase E (i.e. GM402), used as a negative control. Lane 1 in (a) and (b) contains standard protein markers. 4 0 (a) 4 1 Both pSl and pS2 were transformed into BL21(DE3) and cultures derived from in d i v i d u a l clones grown and induced with IPTG (Sec. 2.4.6). Extracts were separated on 10% acrylamide gel (Fig. 2(a)). Fig. 2(a) shows strong bands of the anticipated size of T7 genelO-PNP fusions detected from clones harbouring pSl and pS2. The SI antigenic protein was over-expressed as a doublet, which raised concerns about whether both bands were derivatives of SI. To address t h i s point, a Cleveland mapping experiment using the protease chymotrypsin was performed. As seen i n Fig . 2(b), both the upper band (lanes 2-5) and lower band (lanes 6-9) yielded p a r t i a l digestion products (A, B, C) of low mobility. The common digestion p r o f i l e of both over-expressed bands indicate that they are comprised of e s s e n t i a l l y the same amino acid sequence. The over-expressed antigenic proteins were prepared and used for immunization of rabbits as outlined i n Section 2.6. Fig . 3 shows that the serum from rabbits immunized against SI and S2 contained high t i t r e s of a-Sl and a-S2, respectively, a f t e r two boosts. Other proteins from the c e l l extracts of a Rne over-expressor did not cross react with the antibodies (Fig. 3, lane 3). Data provided l a t e r (e.g. F i g . 8(d)) show that a-Sl recognizes native PNPase. 3 . 1 . 2 G e n e r a t i o n o f a n t i b o d i e s a g a i n s t a H i s ( 6 ) - P N P a s e f u s i o n p r o t e i n During the course of these studies, members of Christopher F. Higgins' laboratory were able to p u r i f y a His(6)-PNPase fusion protein to near homogeneity using Novagen's His-Tag p u r i f i c a t i o n 42 Figure 4. Purification of over-expressed His(6)-PNPase by metal ion chelate chromatography. Extracts of BL21(DE3) (pEPcd8) containing over-expressed His(6)-PNPase were purified to the S30 stage (see Sec. 2.4.3), then exposed to activated N i 2 + His-Bind resin (Sec. 2.4.6). Unbound His(6)-PNPase was removed by gravitational elution from a column (Lane 2), initially with 5 m M imidazole ["Binding Buffer" wash] (Lane 3) and subsequently with 60 m M imidazole ["Wash Buffer" wash] (Lane 4). This was followed by 15 mL of 1M imidazole ["Elution Buffer" wash] (Lanes 5-19), and removal of the N i 2 + by 100 m M E D T A ["Strip Buffer" wash] (Lanes 20-25). The proteins in each lane were precipitated with acetone from 25 uL (Lane 2), 134 uL (Lane 3), 85 uL (Lane 4), 26 uL (Lanes 5-19) and 200 uL (Lanes 20-25) of eluant, then separated on a 10% polyacrylamide gel. 4 3 44 Figure 5. Polyclonal antibodies raised against purified His(6)-PNPase detected by Western blotting. Extracts of strain BL21(DE3) (pEPal8) containing His(6)-PNPase were separated by SDS-PAGE, blotted to Immobilon P, and probed with rabbit pre-immune sera (Lanes 1-3), post-first immunization sera (Lanes 4-6), and post-second immunization sera (Lanes 9-11), as described in Sec. 2.5.3. Lanes 1, 4, 9 were exposed to a 1:500 antibody dilution, lanes 2, 5, 10 were exposed to a 1:1000 dilution, and lanes 3, 6, 11 were exposed to a 1:2000 dilution. Lane 8 shows the extract of BL21(DE3) (pEPal 8) containing over-expressed His(6)-PNPase (arrow) separated by SDS-PAGE and stained with Coomassie Blue, while lane 7 contains protein size standards. 45 46 protocol (Py, et a l . , 1 9 9 4 ) . I attempted to duplicate the p u r i f i c a t i o n , and use this fusion protein to generate s p e c i f i c antibodies directed against the entire PNPase polypeptide. The plasmid coding for the His(6)-PNPase fusion protein, pEPal8, was obtained from Christopher F. Higgins' laboratory (Py, et al., 1994). It includes the f u l l length pnp gene l i g a t e d into the BamHI cloning s i t e of pET-14b (Novagen; Appendix 2), a vector carrying bacteriophage T7 transcription and translation signals as well as an N-terminal His-tag. In these experiments, the pEPal8 was transformed into BL21(DE3) and the fusion protein over-expressed (Sec. 2.5). The His(6)-tag sequence served as an a f f i n i t y tag for p u r i f i c a t i o n of the fusion protein by metal ion (Ni 2 +) chelation chromatography (Novagen). Fi g . 4 depicts the p r o f i l e of e l u t i o n of bound proteins, and t h e i r analysis on a 10% polyacrylamide gel. Most of the His-PNPase had eluted a f t e r approximately 3-5 mL of elution buffer had been passed through the a f f i n i t y column. A number of proteins are associated with His-PNPase and they eluted i n roughly equimolar amounts, including a 85 kDa protein that may be PNPase, a 180 kDa protein that may be Rne and a protein band >2 00 kDa. The f i n a l buffer, containing EDTA, chelates the N i 2 + and removes i t from the column matrix. Fractions 20-25 i n Fig. 4 show that a small portion of the His(6)-PNPase and associated proteins remained bound to the metal a f t e r the e l u t i o n buffer wash. As described i n Sec. 2.6, the p u r i f i e d His (6)-PNPase was separated by SDS-PAGE and 250 ug of protein a f f i x e d to acrylamide 47 was mixed with Freund's Incomplete Adjuvant to form an emulsion. This was used to immunize a rabbit, and the sera obtained af t e r two boosts contained high t i t r e s of a-His-PNPase (Fig. 5). Moreover, these sera lacked antibodies that cross-reacted with other E. coli proteins, since these sera did not detect (or bind to) any other proteins i n the c e l l extracts. 3 . 2 R n e D E L E T I O N M U T A N T P R O T E I N S A c o l l e c t i o n of rne deletion mutant constructs was created i n an attempt to locate important domains, including those capable of binding PNPase, within the Rne polypeptide. 3 . 2 . 1 R n e N - t e r m i n a l d e l e t i o n m u t a n t s Oligonucleotides that introduce an Xho I r e s t r i c t i o n s i t e at the 3' end of the rne gene, and a Nde I s i t e at the 5' end of interes t were used to amplify rne gene deletion mutants by PCR. These were ultimately l i g a t e d into pET 24b, and over-expressed i n BL2KDE3). Fig. 6 depicts the set of N-terminally deleted Rne proteins, constructed by Xin Miao (Miao, personal communication). 3 . 2 . 2 R n e C - t e r m i n a l d e l e t i o n m u t a n t s F i g . 6 also shows the C-terminal deletion RneAC218 that was constructed using an oligonucleotide that introduced an Nde I r e s t r i c t i o n s i t e i n the 5' end of the rne gene at the ATG i n i t i a t i o n codon, and another oligonucleotide that created a Eco RI s i t e i n the rne sequence corresponding to amino acid 218. The oligonucleotides were used i n a PCR reaction to amplify the rne 48 Figure 6. A map of deleted Rne proteins. The complete Rne protein is pictured on top with its postulated functional domains indicated. Xin Miao's N-terminal deletion mutants are denoted as RneANxxx, while the C-terminal deletion mutant discussed in Sec. 3.2.2 is denoted as RneAC218. 4 9 Catalytic — • RNA-Binding Acidic ams rne C404 C407 1 V V 1061 Rne N I I I I I ~ l A A NTP-binding HSR 2 site, HSR 1 RneAN208 208 RneAN315 3 1 5 i RneAN408 4 0 8 I RneAN608 6 0 8 i RneAN722 7 2 2 I RneAN813 8 1 3 R n e A C 2 1 8 218 50 sequence coding for the f i r s t 218 amino acids (Sec. 2.3). This amplified DNA was digested appropriately, li g a t e d into pET 24b, and transformed into E. coli s t r a i n BL21(DE3) (Appendix 2, F i g . 8). The accuracy of thi s construction was confirmed by DNA sequencing (data not shown). 3 . 3 N A T I V E A N D M U T A N T R n e - P N P a s e I N T E R A C T I O N S A S S E S S E D B Y C O -C H R O M A T O G R A P H Y 3 . 3 . 1 F r a c t i o n a t i o n o f R n e - P N P a s e o n a n a n i o n e x c h a n g e c o l u m n . In an e f f o r t to p u r i f y the native Rne protein to near homogeneity, i t was over-expressed i n BL21(DE3) and p r e c i p i t a t e d from c e l l lysates by 26% (w/v) (NH4)2S04 (Sec. 2.5). The Rne was s o l u b i l i z e d by 3% Trit o n X-100 and 1.2 M NH4C1, and ribosomes, membrane fragments and other unwanted proteins sedimented by centrifugation at 200,000 x g. The r e s u l t i n g supernatant (S200) was dil u t e d i n Buffer A supplemented with protease i n h i b i t o r s , then fractionated on an anion exchange matrix (Resource Q, Pharmacia) with a 40 mM to 750 mM-NaCl gradient (Sec. 2.5.5). Fig 7(b) shows an SDS-PAGE separation of the proteins eluted from the anion exchange matrix. A protein migrating at the 180 kDa distance, corresponding to Rne, elutes from the matrix through almost a l l of the s a l t gradient, accompanied by an 85 kDa protein i n approximate equimolar amounts. Fig 7(c) i s a Western blot u t i l i z i n g a-RNase E. The immunoreactive species of approximately 180 kDa i n lanes 32-60 i s c l e a r l y the Rne protein. Fractions 34-46 51 Figure 7. Fractionation of enriched extracts of GM402 on an anion exchange column (Resource Q). The Rne protein was over-expressed in cultures of GM402 and precipitated from cell lysates using 26% (w/v) (NH4)2S04 (Sec. 2.5). The protein was resolubilized by 3% Triton X-100 and 1.2 M NH4C1, centrifuged at 200,000 x g, diluted 10-fold, then fractionated on an anion exchange matrix with a 40 mM to 750 mM NaCl gradient (Sec. 2.5.5). (a) Ultraviolet absorption profile of the anion exchange column fractionation. 1.0 mL fractions were collected from the fractionation, numbered 1-64. The broad band of absorption in fractions 2-15 is largely due to Triton X-100, not protein. (b) Approximately 200 ng of protein from selected fractions was precipitated with 5 volumes of acetone, separated by SDS-PAGE and visualized with Coomassie Blue staining (Sec. 2.4.1). Lane S contains protein size standards used to identify Rne (migrating at the 180 kDa position) and PNPase (migrating at 85 kDa). (c,d) Western blotting using polyclonal antibodies raised against Rne (c) and PNPase SI (d) (Sec. 2.6). The selected fractions from panel (b) were separated by SDS-PAGE and blotted onto Immobilon P. The blot was probed first with a-Rne antibody (c), stripped of bound antibody (Sec. 2.6.4), then reprobed with a-PNPase SI antibody (d). The arrows in panels (c) and (d) indicate the migration point of Rne and PNPase, respectively. 52 53 ( c ) 54 contain a >200 kDa protein that reacts with a-RNase E; this protein may be an oxidation dimer of Rne. In Fig 7(d), a-Sl (which recognizes PNPase) was used to confirm that the 85 kDa protein from Fig 7(b) was PNPase. 3 . 3 . 2 F r a c t i o n a t i o n b y a n i o n e x c h a n g e c h r o m o t o g r a p h y o f R n e N -t e r m i n a l d e l e t i o n m u t a n t s In an attempt to fractionate PNPase and other proteins co-purifying with the Rne protein, N-terminal deletion mutants of Rne were p u r i f i e d as described i n Sec. 2.5 and Sec. 3.3.1. Since the native Rne protein i s normally associated with PNPase after p a r t i a l p u r i f i c a t i o n , a loss of PNPase association by a truncated Rne would suggest that an essential PNPase binding s i t e was deleted. An N-terminal deletion mutant missing the f i r s t 608 amino acids of Rne (RneAN608) was fractionated i n a manner i d e n t i c a l to that of the native protein (Fig.8). In contrast to F i g 7(a), F ig 8(a) shows a sharp absorbance peak i n fractions 34-35, corresponding to an abundant 100 kDa protein. Fraction 39-40 represents a small peak of absorbance, and corresponds to a 85 kDa protein i n the SDS-PAGE gel. Western b l o t t i n g using a-Rne (Fig 8(c)) and a-Sl (Fig 8(d)) confirmed that the 100 kDa protein was the deletion mutant RneAN608, and the 85 kDa protein was PNPase. Fig 8(c) also shows a possible oxidation dimer of RneAN608 that i s >200 kDa and crossreacts with a-Rne, as well as a smaller protein i n fractions 5-10 and 33-3 6 that could be a RneAN608 degradation product. F i g 8(d) reveals a-Sl reacting with an 80 kDa protein i n fractions 42-48 that may be a PNPase digestion product. 55 Figure 8. Fractionation of partially purified extracts of RneAN608 on an anion exchange column (Resource Q). The RneAN608 protein was over-expressed in cultures of BL21 (DE3) and precipitated from cell lysates using 26% (w/v) (NH4)2S04 (Sec. 2.5). The protein was resolubilized in 3% Triton X-100 and 1.2 M NH4C1, centrifuged at 200,000 x g, diluted by 1/10th, then fractionated on an anion exchange matrix with a 40 mM to 750 mM NaCl gradient (Sec. 2.5.5). (a) Ultraviolet absorption profile of the anion exchange column fractionation. 1.0 mL fractions were collected from the fractionation, numbered 1-64. The broad band of absorption in fractions 2-15 is largely due to Triton X-100, not protein. (b) Approximately 200 ug of protein from selected fractions were precipitated with 5 volumes of acetone, separated by SDS-PAGE and visualized with Goomassie Blue staining (Sec. 2.5.1). Lane S contains protein size standards, used to determine the location of Rne (migrating at the 180 kDa position) and PNPase (migrating at 85 kDa). (c,d) Western blotting using polyclonal antibodies raised against Rne (c) and PNPase SI (d) (Sec. 2.6). The selected fractions from panel (b) were separated by SDS-PAGE (10% gel) and blotted onto Immobilon P. The blots were probed first with a-Rne antibody (c), stripped of bound antibody (Sec. 2.6.4), then reprobed with cc-PNPase SI antibody (d). The arrows in panels (c) and (d) indicate the migration point of RneAN608 and PNPase, respectively. 56 (c) 58 These results indicated that, i n contrast to native Rne, the majority of RneAN608 elutes from the anion exchange column i n fractions 34-35, not evenly over the entire s a l t gradient. It i s also apparent that l i t t l e PNPase i s present i n fractions 34-35 (Fig 8(d)); rather, most of the PNPase elutes at fractions 39-40, and a small amount of i t appears from fractions 41 onwards associated with a small amounts of native Rne and RneAN608 (Fig 8(c)). Nearly i d e n t i c a l protein elution patterns were observed for a l l of the N-terminal Rne deletion mutants (RneAN2 08, RneAN315, RneAN408, RneAN608, and RneAN813) as detailed i n Figures 11-14. 3.3.3 R n e C - t e r m i n a l d e l e t i o n m u t a n t f r a c t i o n a t i o n b y a n i o n ( M o n o Q ) a n d c a t i o n ( M o n o S ) e x c h a n g e c h r o m a t o g r a p h y To determine the role of the f i r s t 200 amino acids of the Rne protein i n associating with PNPase, a C-terminal deletion mutant, pRneAC218, was constructed as described i n Sec. 3.2.2. The corresponding protein was over-expressed and p a r t i a l l y p u r i f i e d as i n Sec. 2.5 and Sec. 3.3.1. Passage of the p a r t i a l l y purfied RneAC218 through an anion exchange matrix was i n e f f e c t i v e , since a l l the mutant Rne, along with a number of other proteins, f a i l e d to bind (Fig 9(a)). Fractionation through a cation exchange matrix (Mono S) resulted i n s i g n i f i c a n t retention of RneAC218 i n a highly p u r i f i e d state (Fig 9(b), lanes 32-36). Nonetheless, a large proportion of the RneAC218, along with native Rne and a number of other proteins, did not bind to the matrix. To confirm that RneAC218 i s able to bind cation, but not 59 Figure 9. Fractionation of partially purified RneAC218 by ion exchange chromatography, (a) Anion exchange (Resource Q) fractionation. Approximately 200 ug of protein from selected fractions was precipitated with acetone, separated by SDS-PAGE and visualized with Coomassie Blue staining (Sec. 2.5.1). Lane 0 contains protein size standards, (b) Cation exchange (Resource S) fractionation was conducted as outlined above for (a). (c,d) Western blotting using polyclonal antibodies raised against Rne (c) and PNPase SI (d) (Sec. 2.6). The flow-through fractions from the anion exchange column are indicated in italics and the selected fractions from the cation exchange column are in standard numerals. All fractions were separated by SDS-PAGE and blotted onto Immobilon P. The blots were probed first with a-Rne antibody (c), stripped of bound antibody (Sec. 2.6.4), then reprobed with a-PNPase S1 antibody (d). The arrows in panels (a), (b), (c) and (d) indicate the migration point of RneAC218 and PNPase as denoted. 60 (a) S 3 5 8 10 I S 20 30 32 34 36 38 40 42 44 46 48 50 52 54 56 58 60 62 64 (b) S 3 5 8 10 15 20 30 32 34 36 38 40 42 44 46 48 50 52 54 56 58 60 62 64 1 • •— mm — — § am i m • & — — I 55? ^ ^^p 5z^r ati sr. . J4SS. Mv" 48H -Native Rne -RneAC218 61 (c) Mono S Mono Q C 2 4 6 8 10 12 2 4 6 8 10 12 20 30 31 32 33 34 35 36 37 38 39 40 RneAC218 (d) MonoS Mono Q 2 4 6 8 10 12 2 4 6 8 10 12 20 30 31 32 33 34 35 36 37 38 39 40 anion, exchange matrices, fractions from each column were analysed by Western b l o t t i n g using a-Rne (Fig 9(c)). None of the immunoreactive RneAC218 binds to the Mono Q column, while more than half of the RneAC218 can bind the Mono S column. The flowthrough fractions of the Mono Q and Mono S separation both contain native Rne protein. The same fractions were also probed with a-His(6)-PNPase antisera (Fig 9(d)). No immunoreactive PNPase could be detected i n fractions 32-36 of the Resource S eluate, although i t could be detected i n flowthrough fractions from both matrices. 3 .4 ASSESSMENT OF Rne-PNPase INTERACTIONS BY FAR-WESTERN BLOTTING C o p u r i f i c a t i o n of RNase E and PNPase through several chromatographic steps implies that there i s a PNPase binding domain within the Rne protein (C.arpousis, et al. , 1994; Py et al. , 1996; th i s work). To substantiate t h i s p o s s i b i l i t y further, native and mutant Rne proteins were assessed for t h e i r a b i l i t y to bind free, p u r i f i e d PNPase i n a Far-Western blot experiment. Native, C-terminal and N-terminal deletion mutants of Rne were p a r t i a l l y p u r i f i e d , separated by SDS-PAGE, transferred to an Immobilon P membrane, and exposed to a solution of free, highly p u r i f i e d His(6)-PNPase (Sec. 2.6.5). Unbound PNPase was removed by washing, and any bound PNPase was i d e n t i f i e d by using a-His(6)-PNPase as a primary antibody. F i g 10(a) depicts an SDS-PAGE gel containing over-expressed native and mutant Rne proteins. Lanes 2 and 3 have the native and . 63 Figure 10. Far-Western blotting of native and mutant Rne protein with free PNPase. (a) Extracts of strains over-expressing native and mutant Rne were separated on a 10% SDS -polyacrylamide gel and stained with Coomassie brilliant blue. Lane 1, protein markers; Lane 2, native Rne; Lane 3, Rne-3071 mutant protein; Lane 4, RneAC218; Lane 5, RneAN208; Lane 6, RneAN408; Lane 7, RneAN608. (b) Far-Western blot. The same proteins from panel (a) were transferred from a 10% SDS-polyacrylamide gel to Immobilon P (see Sec. 2.6.3). The immobilized proteins were exposed to free PNPase then washed (Sec. 2.6.5). Physical association between PNPase and the immobilized proteins was detected by reaction with polyclonal a-His(6)-PNPase antibodies and chromogenic detection. The samples in lanes 1-7 are identical to those in panel (a). 64 65 Rne-3071 polypeptides, respectively, while lanes 4 to 7 contain over-expressed RneAC218, RneAN208, RneAN408 and RneAN608 proteins, respectively (See Fig. 6). A l l over-expressed proteins were abundant i n r e l a t i o n to other endogenous proteins, and were approximately equal to each other i n concentration. F i g 10(b) shows the Far-Western blot used to determine the a b i l i t y of native and mutant Rne to bind free PNPase. Wild-type and temperature-sensitive mutant Rne proteins i n lanes 2 and 3, respectively, display s i g n i f i c a n t PNPase binding to a protein of approximately 180 kDa (Rne). RneAN208, RneAN408, RneA608 and RneAN813 also bind s i g n i f i c a n t amounts of PNPase i n lanes 5-8, respectively. Lane 3 shows a small amount of PNPase binding to a 30 kDa protein; however, this i s also seen to a lesser degree i n lanes 2, 3, 5, 6, 7 and 8. A l l of the samples contain PNPase endogenous to BL21(DE3) and this appears as a 85 kDa band i n a l l of the lanes. Other prominent bands reactive with a-His(6)-PNPase are denoted by * i n Fig. 10b. These are l i k e l y degradation products of Rne. Since i d e n t i c a l products are obtained with wild-type Rne (lane 2), Rne-3071 (lane 3) and RneAN208 (lane 5), the degradation i s l i k e l y occuring i n the N-terminal domain of Rne, leaving the C-terminus intact. The a b i l i t y of such p a r t i a l degradation products to bind PNPase would support the idea that the C-terminal domain of Rne contains a PNPase binding s i t e . Their prominence i n the Far-Western blot (Fig. 10b) i s not proportional to the protein v i s i b l e i n Fig. 10a; the e f f i c i e n t protein transfer to Immobilon of smaller 66 Rne d e g r a d a t i o n p r o d u c t s compared t o t h e f u l l l e n g t h Rne p r o t e i n c o u l d e x p l a i n t h i s d i s c r e p a n c y . The N - t e r m i n a l Rne d e l e t i o n mutants showed a s t r o n g a f f i n i t y f o r PNPase based on t h i s a s s a y ; however, RneAC218 bound f a r more weakly. T h i s i s most l i k e l y a n o n - s p e c i f i c i n t e r a c t i o n of PNPase w i t h RneAC218 or a p r o t e i n of s i m i l a r s i z e . The weak b i n d i n g c o u l d a l s o r e f l e c t a weak n o n - s p e c i f i c i n t e r a c t i o n between a - H i s ( 6 ) -PNPase and RneAC218. 67 C h a p t e r 4 D I S C U S S I O N S e v e r a l r e s e a r c h e r s have attempted to p u r i f y the components of the Escherichia coli mRNA degradosome, and a l l have demonstrated t h a t Rne and PNPase c o - p u r i f y w i t h the p r o t e i n complex ( C a r p o u s i s et a l . , 1994; Py et a l . , 1996; M i c z a k et a l . , 1996) . The d a t a i n t h i s work show t h a t t h i s i n t e r a c t i o n can be d i s r u p t e d by d e l e t i n g p o r t i o n s of the Rne p r o t e i n , and suggests tha t the a c i d i c c a r b o x y -t e r m i n a l t a i l o f Rne p l a y s an impor tant r o l e i n PNPase b i n d i n g to the p r o t e i n , and may be n e c e s s a r y f o r s e l f - i n t e r a c t i o n . F i r s t , to i d e n t i f y Rne and PNPase i n these p r o t e i n i n t e r a c t i o n s t u d i e s , a n t i b o d i e s t h a t r e c o g n i z e each p r o t e i n were n e c e s s a r y . A n t i b o d i e s d i r e c t e d a g a i n s t two h i g h l y a n t i g e n i c s i t e s p r e d i c t e d to e x i s t i n PNPase were r a i s e d s u c c e s s f u l l y by c l o n i n g and o v e r -e x p r e s s i n g these p o r t i o n s o f PNPase and u s i n g those p u r i f i e d p r o t e i n s to immunize a r a b b i t and r a i s e a n t i b o d i e s ( i . e . a - S l and a - S 2 ) . D u r i n g the course of these exper iments , a p l a s m i d c a p a b l e o f d i r e c t i n g the o v e r - e x p r e s s i o n of a Hi s (6 ) -PNPase f u s i o n p r o t e i n was d e s c r i b e d (Py et a l . , 1994). T h i s f u s i o n p r o t e i n was p u r i f i e d and used to r a i s e an a - H i s ( 6 ) - P N P a s e a n t i b o d y . The t i t r e s o f p o l y c l o n a l a - H i s ( 6) - P N P a s e were much h i g h e r than those of a - S l and a -S2 a n t i b o d i e s , p o s s i b l y because t h e r e were more a n t i g e n i c s i t e s exposed i n His (6 ) -PNPase a l l o w i n g more p o l y c l o n a l a n t i b o d i e s to be d i r e c t e d a g a i n s t i t . A h i g h t i t r e a -RNase E a n t i s e r u m had been 68 raised previously i n this lab. The i n i t i a l attempt to p u r i f y Rne to near homogeneity was unsuccessful, but did i l l u s t r a t e the strong a f f i n i t y between Rne and PNPase. The native Rne protein was over-expressed i n BL21(DE3) c e l l s and enriched from c e l l lysates. It was hoped that the acidic carboxy region of Rne would bind t i g h t l y to an anion exchange matrix, and that this property could be u t i l i z e d to separate Rne from contaminating proteins. Rather than eluting from the anion exchange res i n at a d i s t i n c t i v e s a l t concentration as expected, Rne eluted over a wide range of s a l t concentrations, but always associated with approximately equimolar amounts of PNPase (Fig. 7). A number of u n i d e n t i f i e d associated proteins were removed at various concentrations of s a l t . The strong association between Rne and PNPase was also observed i n the p u r i f i c a t i o n reported by Carpousis et al. (1994) . Rne and PNPase remained i n a stable complex aft e r successive steps including chromatography on S-Sepharose and hydroxylapatite, and centrifugation through a 10-20% gl y c e r o l gradient (Carpousis et al. , 1994). Immunoprecipitation using a-RNase E also revealed that PNPase co-precipitated with Rne (Carpousis et al. , 1994). A separate study by Py et al. (1994) that attempted to i d e n t i f y an RNA stem-loop binding protein found a stable complex with RNase E and PNPase a c t i v i t y . Their attempts at p r e c i p i t a t i n g PNPase with a-PNPase showed that a 65kDa proteolyt i c fragment of Rne co-precipitated with the PNPase (Py et al., 1994). The fact that the Rne, PNPase and associated proteins were 69 able to associate with the anion exchange matrix at varying concentrations of s a l t would suggest that there are d i f f e r e n t populations of protein complexes that include Rne and PNPase, and a l l of them have d i f f e r i n g charges associated with them. In an attempt to disrupt the association of Rne and PNPase, N-terminal deletion mutants of Rne were constructed, over-expressed, and p u r i f i e d i n an i d e n t i c a l manner as the native protein (Miao, personal communication). As i l l u s t r a t e d i n F i g . 8, there are two d i s t i n c t populations of the RneAN608 deletion mutant: the majority of the RneAN608 elutes from the anion exchange matrix i n fractions 34-3 8 of the s a l t gradient associated with native Rne, presumably i n a mixed oligomer. This suggests that the protein complex involving Rne-RneAN608, but not PNPase, exists as a unit of stable charge. A small portion of the RneAN608 i s present at the higher concentrations of the s a l t gradient, associated with native Rne and PNPase. The fact that the native Rne and PNPase are found together i n equimolar amounts indicates that t h e i r physical i n t e r a c t i o n remains i n t a c t . The SDS-PAGE gels also indicate that multiple populations of protein complexes are present involving native and mutant Rne, PNPase and other unidentified proteins. The i d e n t i c a l anion exchange elut i o n p r o f i l e s were seen for the N-terminal Rne deletion mutants RneAN208, RneAN315, RneAN408 and RneAN813 (see Figures 11-14). This evidence supports the findings of Kido et al. who demonstrated that wild-type Rne i s capable of binding PNPase, while truncated Rne lacking the C-terminal h a l f did not (Kido et al., 1996). The data also imply that the C-terminal 250 amino 70 acids are involved i n oligomerization of the native Rne protein, since the mutant RneAN813 i s s t i l l able to associate with native Rne (Figures 11-14). A recombinant plasmid capable of expressing a C-terminal Rne deletion was created to assess the a b i l i t y of the f i r s t 200 amino acids of Rne to bind PNPase. The mutant RneAC218 was over-expressed and p u r i f i e d as was done for the native Rne and the N-terminal mutants, and separated on the anion exchange matrix. The RneAC218 did not bind this resin at a l l , supporting the assumption that the a c i d i c t a i l of native Rne binds the anion matrix (Fig. 9a). Fractionation of these proteins i n a cation exchange matrix showed that a s i g n i f i c a n t portion of the RneAC218 bound to the matrix, while the rest of the RneAC218 and a l l the PNPase and native Rne did not bind at a l l (Fig. 9b). This appears to suggest that the over-expressed RneAC218 was unable to t i t r a t e PNPase away from the native Rne i n the degradosome complex, although i t appears that a small portion of the RneAC218 interacts either s p e c i f i c a l l y or non-specifically with the complex. This serves to i l l u s t r a t e the problem with co-chromatography as a method of protein-protein interactions: i f a truncated Rne mutant elutes with PNPase, i t i s never clear whether the Rne mutant i s binding d i r e c t l y to PNPase or to another protein that i s bound to PNPase. In an e f f o r t to resolve the direct or indi r e c t binding of Rne deletion mutants to PNPase, a Far-Western blot experiment was performed. In t h i s experiment, t o t a l c e l l u l a r proteins are denatured and separated by size. Free PNPase binding to each 71 p r o t e i n i s a s s e s s e d i n d i v i d u a l l y , t h e r e b y e x c l u d i n g the p o s s i b i l i t y o f i n d i r e c t b i n d i n g between the Rne mutants and PNPase. N a t i v e Rne, a l o n g w i t h the N - t e r m i n a l and C - t e r m i n a l Rne mutants d e s c r i b e d p r e v i o u s l y , were a f f i x e d t o a membrane, and a l l o w e d t o a s s o c i a t e w i t h f r e e PNPase. As i l l u s t r a t e d i n F i g . 10, the n a t i v e Rne and N-t e r m i n a l d e l e t i o n mutants bound PNPase e x t r e m e l y w e l l , w h i l e the 3 0 kDa Rne C - t e r m i n a l mutant appeared t o b i n d PNPase a t a v e r y low l e v e l . However, t h i s a s s o c i a t i o n i s p r o b a b l y n o n - s p e c i f i c s i n c e a f a i n t 3 0 kDa band i s p r e s e n t i n the n a t i v e and N - t e r m i n a l mutant Rne l a n e s as w e l l . P o s s i b l e d e g r a d a t i o n p r o d u c t s o f n a t i v e and mutant Rne (denoted by * i n F i g 10) c o u l d a l s o b i n d PNPase. T h e i r i d e n t i t y c o u l d be c o n f i r m e d i n a c o n t r o l Western b l o t e x p e r i m e n t u s i n g a-RNase E; u n f o r t u n a t e l y , t h i s was not p e rformed. I t i s a l s o i n t e r e s t i n g t o note t h a t the mutant Rne-3071 was a b l e t o b i n d f r e e PNPase, which c o n f l i c t s w i t h the o b s e r v a t i o n s o f C a r p o u s i s e t al. (1994), who found t h a t g l y c e r o l g r a d i e n t s e d i m e n t a t i o n a t the n o n - p e r m i s s i v e t e m p e r a t u r e caused s e p a r a t i o n of Rne-3 071 and PNPase. Perhaps the c o n f o r m a t i o n a l change t h a t the Rne-3 071 p r o t e i n e x p e r i e n c e s a t the n o n - p e r m i s s i v e t e m p e r a t u r e i s n e g a t e d by the way the p r o t e i n i s p r e s e n t e d on the Immobilon b l o t o r by t h e c o n d i t i o n s o f p r o b i n g . T h i s r e a s o n i n g may a l s o e x p l a i n why e n o l a s e , w h i c h c o - p u r i f i e s w i t h PNPase, d i d not appear as a PNPase b i n d i n g p r o t e i n . I n a d d i t i o n , e n o l a s e may n o t r e n a t u r e e f f i c i e n t l y . Co-chromatography combined w i t h the Far-Western experiments on 72 native and mutant Rne-PNPase interactions confirm that the a c i d i c C-terminal of Rne plays a role i n the binding of PNPase. The co-chromatography experiments with the N-terminal deletion mutants cannot d i s t i n g u i s h between s p e c i f i c or non-specific i n t e r a c t i o n between the mutants and PNPase, but do c l e a r l y i l l u s t r a t e that the over-expressed mutant proteins are unable to t i t r a t e PNPase away from an i n t e r a c t i o n with native Rne. It i s also i n t e r e s t i n g to note that small portions of Rne N-terminal deletion mutants missing up to 813 amino acids are s t i l l able to interact with the native Rne-PNPase complex, possibly by binding to native Rne. The co-chromatography experiments with RneAC218 were unclear i n determining a role of the Rne N-terminal end, since anion and cation matrices were unable to separate a RneAC218-PNPase complex from the other proteins present. The Far-Western studies suggest that amino acids 608-1061 of Rne are able to bind free PNPase strongly, which supports past evidence that Rne lacking i t s C-terminus due to p a r t i a l proteolysis (Carpousis et a l . , 1994) or de l i b e r a t e l y deleted (Kido et a l . , 1996) i s unable to associate with PNPase. The Far-Western blot also indicated low l e v e l , non-specific PNPase binding by a 30 kDa protein i n a l l deletion mutants (see F i g . 10b) . Whether the blotted proteins used i n the Far-Western have the same 3D structure in vivo i s unknown, since the experiment disrupts protein structure during the separation and b l o t t i n g phases (See Materials and Methods). Future work on the relationship between Rne and PNPase would 73 l i k e l y involve the bifunctional cross-linking of these degradosome proteins. Chemical cross - l i n k i n g of supramolecular complexes containing several polypeptide chains has been well documented i n ribosomal research, and has been used to locate protein binding domains (Traut et a l . , 1 9 8 0 ) . Bifunctional imido-esters (e.g. 2 -iminothiolane) that introduce a d i s u l f i d e bond as the c r o s s - l i n k are p a r t i c u l a r l y useful i n two-dimensional SDS-PAGE gels, since linked proteins can be cleaved by reduction i n the second dimension to regenerate monomeric proteins with the same electrophoretic m o b i l i t i e s as the native proteins (Traut et a l . , 1 9 8 0 ) . In addition to finding the Rne-PNPase binding s i t e , binding domains for other degradosome components (e.g. RhlB and enolase) w i l l be i d e n t i f i e d . There may be d i f f i c u l t i e s i n the cross-linking of Rne-PNPase because of the lack of lysines (and other basic residues) i n the C-terminus of Rne, but i f i t does work then i d e n t i f i c a t i o n of the exact binding domain w i l l be s i m p l i f i e d . A r a d i o - l a b e l l e d c r o s s - l i n k i n g reagent could be also be used to j o i n proteins i n the degradosome, followed by denaturation of the proteins, t r y p t i c digestion, and HPLC fr a c t i o n a t i o n to locate the s i t e of c r o s s - l i n k i n g (Stone and Williams, 1 9 9 3 ) . Since sequence data on the proteins of the degradosome are already available, a predictable pattern of t r y p t i c digestion would be seen i n the HPLC protein separation, except for the cross-linked species, which would have the additional mass of the c r o s s - l i n k . The p u r i f i e d cross-linked peptides could be microsequenced by conventional methods (Stone and Williams, 1 9 9 3 ) to determine the 74 b i n d i n g d o m a i n . R e c e n t y e a r s h a v e g i v e n us a n a b u n d a n c e o f new i n s i g h t s i n t o t h e c o m p o n e n t s o f t h e d e g r a d o s o m e . T h e s e s t u d i e s d e s c r i b e d h a v e s e r v e d a s a p o i n t o f d e p a r t u r e i n d e t e r m i n i n g t h e PNPase b i n d i n g s i t e i n Rne, a n d h o p e f u l l y w i l l a i d i n t h e f u r t h e r u n d e r s t a n d i n g o f t h e i n t e r a c t i o n a n d f u n c t i o n o f t h e d e g r a d o s o m e enzyme c o m p l e x . 75 R E F E R E N C E S Alifano, P., R i v e l l i n i , F. , P i s c i t e l l i , C , Arraiano, CM., Bruni, C.B., and Carlomagno, M.S. (1994). Ribonuclease E provides substrates for ribonuclease P-dependent processing of a po l y c i s t r o n i c mRNA. Genes & Devel. 8, 3021-3031. Anonymous. (1994). Instructions to authors. JBC. 2 6 9 ( 1 ) , 777-785. Apirion, D. (1973). Degradation of RNA i n Escherichia coli. A hypothesis. Mol. Gen. Genet. 1 2 2 , 313-322. Arraiano, CM., Yancey, S.D., and Kushner, S.R. (1988). S t a b i l i z a t i o n of discrete mRNA breakdown products i n ams, pnp, rnb multiple mutants of Escherichia coli K-12. J. Bact. 1 7 0 , 4625-4633 . Babitzke, P. and Kushner, S.R. (1991) . The ams (altered mRNA s t a b i l i t y ) protein and ribonuclease E are encoded by the same structural gene of Escherichia coli. Proc. Nat. Acad. Sci. USA 88, 1-5. Babitzke, P., Granger, L., Oliszewski, J., and Kushner, S.R. (1993) . Analysis of mRNA decay and rRNA processing i n Escherichia c o l i multiple mutants carrying a deletion i n RNase I I I . J. 76 Bacteriol. 1 7 5 , 229-239. B e c h h o f e r , D. (1993). 5' mRNA s t a b i l i z e r s , i n "Control of Messenger RNA stability" ( J . G . B e l a s c o and G . Brawerman, eds . ) Academic P r e s s , New Y o r k , Pp. 31-52. B e l a s c o , J . G . and H i g g i n s , C . F . (1988). Mechanisms of mRNA decay-i n b a c t e r i a : a p e r s p e c t i v e . Gene 7 2 , 15-23. B e l a s c o , J . G . (1993). mRNA d e g r a d a t i o n i n p r o k a r y o t i c c e l l s : an overview, i n "Control of Messenger RNA Stability" ( J . G . B e l a s c o and G . Brawerman, e d s . ) , Academic P r e s s , New Y o r k , Pp. 3-12. B i g g i n , M . D . , G i b s o n , T . J . , and Hong, G . F . (1983). B u f f e r g r a d i e n t g e l s and 3 5 S l a b e l as an a i d to r a p i d DNA sequence d e t e r m i n a t i o n . Proc. Natl. Acad. Sci. USA. 8 0 , 3963-3965. B i r n b o i m , H . C . , and D o l y , J . (1979). A r a p i d a l k a l i n e e x t r a c t i o n p r o c e d u r e f o r s c r e e n i n g recombinant p l a s m i d DNA. Nucleic Acids Res. 7 , 1513-1523. Bochkarev , A . , P f u e t z n e r , R . A . , Edwards, A . M . , and F r a p p i e r , L . (1997). S t r u c t u r e of the s i n g l e - s t r a n d e d - D N A - b i n d i n g domain of r e p l i c a t i o n p r o t e i n A bound to DNA. Nature 3 8 5 , 176-181. 77 Bouvet, P. and Belasco, J.G. (1992). Control of RNase E-mediated RNA degradation by 5'-terminal base p a i r i n g i n Escherichia coli. Nature 360, 488-491. Bycroft, M. , Hubbard, T.J.P., Proctor, M. , Freund, S.M.V., and Murzin, A.G. (1997) . The solution structure of the SI RNA binding domain: a member of an ancient nucleic acid-binding f o l d . Cell 8 8 , 235-242. Cannistraro, V.J. and Kennell, D. (1989) . P u r i f i c a t i o n and characterization of ribonuclease M and mRNA degradation i n Escherichia coli. Eur. J. Biochem. 1 8 1 , 363-370. Cannistraro, V.J. and Kennell, D. (1994). The processive reaction mechanism of ribonuclease II. J". Mol. Biol. 243, 930-943. Cao, G.J., and Sarkar, N. (1992a). Poly(A) RNA i n Escherichia coli: nucleotide sequence at the junction of the lpp transcript and the polyadenylate moeity. Prol Natl. Acad. Sci. USA 8 9 , 7546-7550. Cao, G.J., and Sarkar, N. (1992b). I d e n t i f i c a t i o n of the gene for an Escherichia coli poly(A) polymerase. Proc. Natl. Acad. Sci. USA 8 9 , 10380-10384. 78 Carpousis, A.J., Van Houwe, G., Ehretsmann, C , and Krisch, H.M. (1994). Copurification of E. coli RNAase E and PNPase: Evidence for a s p e c i f i c association between two enzymes important i n RNA processing and degradation. Cell 7 6 , 889-900. Casaregola, S., Jacq, A., Laoudj, D., McGurk, G., Margarson, S., Tempete, M., Norris, V., and Holland, I.B. (1992). Cloning and analysis of the entire Escherichia coli ams gene. J. Mol. Biol. 228, 30-40. Causton, H., Py, B., McLaren R.S., and Higgins, C F . (1994). mRNA degradation i n Escherichia coli: a novel factor which impedes the exoribonuclytic a c t i v i t y of PNPase at stem-loop structures. Mol. Microbiol. 1 4 , 731-741. Chanda, P.K., Ono, M., Kuwano, M., and Kung, H. (1985). Cloning, sequence analysis, and expression of the a l t e r a t i o n of the mRNA s t a b i l i t y gene (ams+) of Escherichia coli. J. Bacteriol. 1 6 1 , 446-449. Chauhan, A.K., Miczak, A., Taraseviciene, L., and Apirion, D. (1991). Sequencing and expression of the rne gene of Escherichia coli. Nucl. Acids Res. 1 9 , 125-129. Chen, L.-H., Emory, S.A., Bricker, A.L., Bouvet, P., and Belasco, 79 J.G. (1991) . S t r u c t u r e and f u n c t i o n o f a b a c t e r i a l mRNA s t a b i l i z e r : a n a l y s i s of the 5' u n t r a n s l a t e d r e g i o n of ompA mRNA. J. Bacterid. 1 7 3 , 4 5 7 8 - 4 5 8 6 . C i e c h a n o v e r , A. (1994). The u b i q u i t i n proteosome p r o t e o l y t i c pathway. Cell 7 9 , 13-21. C l a v e r i e - M a r t i n , F., D i a z - T o r r e s , M.R., Yancey, S.D., and Kushner, S.R. (1991). A n a l y s i s of t h e a l t e r e d mRNA s t a b i l i t y (ams) gene from Escherichia coli: N u c l e o t i d e sequence, t r a n s c r i p t i o n a l a n a l y s i s , and homology of i t s p r o d u c t t o MRP3, a m i t o c h o n d r i a l r i b o s o m a l p r o t e i n from Neurospora crassa. J. Biol. Chem. 2 6 6 , 2843-2851. C l a v e r i e - M a r t i n , F., Wang, M., and Cohen, S.N. (1997). ARD-1 cDNA from humans c e l l s encodes a s i t e - s p e c i f i c s i n g l e - s t r a n d e n d o r i b o n u c l e a s e t h a t f u n c t i o n a l l y resembles Escherichia coli RNase E. J. Biol. Chem. 2 7 2 , 13823-13828. Coburn, G.A. and Mackie, G.A. (1996) . O v e r e x p r e s s i o n , p u r i f i c a t i o n and p r o p e r t i e s of Escherichia coli r i b o n u c l e a s e I I . J. Biol. Chem. 2 7 1 , 1048-1053. Coburn, G.A. and Mackie, G.A. (1996b). D i f f e r e n t i a l s e n s i t i v i t e s o f p o r t i o n s of t h e mRNA f o r r i b o s o m a l p r o t e i n S20 t o 3'-80 e x o n u c l e a s e s dependant on o l i g o a d e n y l a t i o n and RNA se c o n d a r y s t r u c t u r e . J. Biol. Chem. 2 7 1 , 15776-15781. Cormack, R.S. and Mackie, G.A. (1992). S t r u c t u r a l r e q u i r e m e n t s f o r the p r o c e s s i n g of Escherichia coli 5S robosomal RNA by RNase E in vitro. J. Mol. Biol. 2 2 8 , 1078-1090. Cormack, R.S., Genereaux, J.L., and Mackie, G.A. (1993). RNase E a c t i v i t y i s c o n f e r r e d by a s i n g l e p o l y p e p t i d e : o v e r e x p r e s s i o n , p u r i f i c a t i o n , and p r o p e r t i e s o f the ams/rne/hmpl gene p r o d u c t . Proc. Natl. Acad. Sci. USA 90, 9006-9010. Cudny, H. and Deuts c h e r , M.P. (1980). Apparent i n v o l v e m e n t of r i b o n u c l e a s e D i n the 3' p r o c e s s i n g of tRNA p r e c u r s o r s . Proc. Natl. Acad. Sci. USA 7 7 , 837-841. D ' A l e s s i o , G. and R i o r d a n , J.F. (eds) (1997). Ribonucleases. Academic P r e s s , New York, New York. D e u t s c h e r , M.P. (1978). S y n t h e s i s and d e g r a d a t i o n of p o l y ( A ) i n permeable c e l l s of Escherichia coli. J. Biol. Chem. 253, 5579-5584. Deutscher, M.P. (1985). E. coli RNases: making sense of a l p h a b e t soup. Cell 40, 731-732. 81 Deutscher, M.P. ( 1993a ) . Promiscuous exoribonucleases of Escherichia coli. J. Bacterid. 1 7 5 , 4577-4583. Deutscher, M.P. (1993b). Ribonuclease m u l t i p l i c i t y , d i v e r s i t y and complexity. J. Biol. Chem. 2 6 8 , 13011-13014. Donovan, W.P., and Kushner, S.R. ( 1983 ) . Amplification of ribonuclease II (rnb) a c t i v i t y i n Escherichia coli. Nucl. Acids Res. 1 1 , 265-275. Donovan, W.P., and Kushner, S.R. (1986). Polynucleotide phosphorylase and ribonuclease II are required for c e l l v i a b i l i t y and mRNA turnover i n Escherichia coli K-12. Proc. Natl. Acad. Sci. USA 8 3 , 120-124. Emory, S.A. and Belasco, J.G. (1990). The ompA 5' untranslated RNA segment functions i n Escherichia coli as a growth-rate-regulated mRNA s t a b i l i z e r whose a c t i v i t y i s unrelated to tra n s l a t i o n a l e f f i c i e n c y . J. Bacteriol. 1 7 2 , 4472-4481. Emory, S.A., Bouvet, P., and Belasco, J.G. ( 1992) . A 5'-terminal stem-loop structure can s t a b i l i z e mRNA in Escherichia coli. Genes Devel. 6 , 135-148. Franzetti, B., Sohlberg, B., Zaccai, G. , and von Gabain, A. 82 (1997). Biochemical and serolo g i c a l evidence for an RNase E - l i k e a c t i v i t y i n h a l o p h i l i c Archaea. J. Bacteriol. 1 7 9 , 1180-1185. Ghora, B.K., and Apirion, D. (1979). I d e n t i f i c a t i o n of a novel RNA molecule i n a new RNA processing mutant of Escherichia coli which contains 5S rRNA sequences. J. Biol. Chem. 2 5 4 , 1951-1956. Ghosh, R.K. and Deutscher, M.P. (1978). P u r i f i c a t i o n of potential 3' processing nucleases using synthetic tRNA precursors. Nucleic Acids Res. 5 , 3831-3842. Greenberg, M.E. and Z i f f , E.B. (1984). Stimulation of 3T3 c e l l s induces t r a s c r i p t i o n of the c-fos proto-oncogene. Nature 3 1 1 , 433-438. Guarneros, G. and Portier, C. (1991). Different s p e c i f i c i t i e s of ribonuclease II and polynucleotide phosphorylase i n 3' mRNA decay. Biochimie 7 3 , 543-549. Gupta, R.S., Kasai, T., and Schlessinger, D. (1977). P u r i f i c a t i o n and some novel properties of Escherichia coli RNase I I . J. Biol. Chem. 2 5 2 , 8945-8949. Hansen, M.J., Chen, L.H., Fejzo, M.L., and Belasco, J.G. (1994). The ompA 5' untranslated region impedes a major pathway for mRNA 83 degradation i n Escherichia coli. Mol. Microbiol. 1 2 , 707-716. Harlow, E., and Lane, D. (1988). Antibodies: A Laboratory Manual. Cold Spring Harbour Laboratory Press, Cold Spring Harbour, New York. Hajnsdorf, E., Carpousis, A.J., and Regnier, P. (1994a). Nucleolytic inactivation and degradation of the RNase III processed message encoding polynucleotide phosphorylase of Escherichia coli. J. Mol. Biol. 2 3 9 , 439-454. Hajnsdorf, E., Steier, 0., Coscoy, L., Teysset, L., and Regnier, P. (1994b). Roles of RNase E, RNase II and PNPase i n the degradation of the rpsO transcripts of Escherichia coli: s t a b i l i z i n g function of RNase II and evidence for e f f i c i e n t degradation i n an ams, pnp, rnb mutant. EMBO J. 1 3 , 33 68-3377. Hansen, M.J., Chen, L.-H., Fejzo, M.L.S., and Belasco, J.G. (1994). The ompA 5' untranslated.region impedes a major pathway for mRNA degradation i n Escherichia coli. Mol. Microbiol. 1 2 , 707-716 . He, L., Soderbom, R., Wagner, E.G.H., Binnie, U., Binns, N., and Masters, M. (1993) . PcnB i s required for the rapid degradation of RNA I, the antisense RNA that controls the copy number of C o l E l -84 r e l a t e d p l a s m i d s . Mol. Microbiol. 9, 1131-1142. H i g g i n s , C . F . , P e l t z , S .W. , and Jacobson, A . (1992). Turnover of mRNA i n p r o k a r y o t e s and lower e u k a r y o t e s . Curr. Opin. Genet. Devel. 2 , 739-747. H i g g i n s , C . F . , Caus ton , H . C . , Dance, G . S . C . , and Mudd, E . A . (1993). The r o l e of the 3' end i n mRNA s t a b i l i t y and decay , i n "Control of messenger RNA stability" ( J . G . B e l a s c o and G . Brawerman, e d s ) , Academic P r e s s , New Y o r k , Pp. 13-30. Inouye, M. (1988). A n t i s e n s e RNA: i t s f u n c t i o n s and a p p l i c a t i o n s i n gene r e g u l a t i o n - - a r ev i ew . Gene 7 2 , 25-34. l o s t , I . and D r e y f u s , M. (1994) . mRNAs can be s t a b i l i z e d by DEAD-box p r o t e i n s . Nature 3 7 2 , 193-196. l o s t , I . and D r e y f u s , M. (1995). The s t a b i l i t y o f Escherichia coli lacZ mRNA depends upon the s i m u l t a n e i t y o f i t s s y n t h e s i s and t r a n s l a t i o n . EMBO J. 14, 3252-3261. J a i n , C . , and B e l a s c o , J . G . (1995). RNase E a u t o r e g u l a t e s i t s s y n t h e s i s by c o n t r o l l i n g the d e g r a d a t i o n r a t e of i t s own mRNA i n Escherichia coli: unusua l s e n s i t i v i t y of the rne t r a n s c r i p t to RNase E a c t i v i t y . Genes Devel. 9, 84-96. 85 Jameson, B.A., Wolf, H. ( 1 9 8 8 ) . The antigenic index: a novel algorithm for predicting antigenic determinants. Comput. Appl. Biosci. 4 , 1 8 1 - 1 8 6 . Kalman, M. , Murphy, H. , and Cashel, M. (1991). rhlB, a new Escherichia coli K-12 gene with an RNA h e l i c a s e - l i k e protein sequence motif, one of at least f i v e such genes i n a prokaryote. New Biol. 3, 886-895. Kido, M. , Yamanaka, K. , Mitani, T., N i k i , H., Ogura, T., and Hiraga, S. (1996). RNase E polypeptides lacking a carboxyl-terminal half suppress a mukB mutation i n Escherichia coli. J. Bacteriol. 1 7 8 , 3917-3925. Lin-Chao, S. and Cohen, S.N. (1991). The rate of processing and degradation of antisense RNAI regulates the r e p l i c a t i o n of C o l E l -type plasmids in vivo. Cell. 65, 1233-1242. Lin-Chao, S., Wong, T.T., McDowall, K.J., and.Cohen, S.N. (1994). Eff e c t s of nucletide sequence on the s p e c i f i c i t y of rne-dependant and RNase E-mediated cleavages of RNA I encoded by the pBR322 plasmid. J. Biol. Chem. 269, 10797-10803. Linder, P., Lasko, P.F., Ashburner, M., Leroy, P., Nielsen P.J., Nishi, K., Shnier, J., and Slonimski, P.P. (1989). B i r t h of the 86 DEAD-box. N a t u r e 3 3 7 , 121-122. L i t t a u e r , U . Z . , and Soreq , H . (1982). The Enzymes, Vol. XV: Polynucleotide Phosphorylase. Academic Press I n c . , New Y o r k , New Y o r k . Pg . 517-553. L o p i l a t o , J . , B o r t n e r , S . , and Beckwith , J . (1986). M u t a t i o n s i n a new chromosomal gene o f Escherichia coli K-12 , pcnB, reduce p l a s m i d copy number of pBR322 and i t s d e r i v a t i v e s . Mol. Gen. Genet. 205, 285-290. Lundberg , U . , von Gabain , A . , and M e l e f o r s , 0. (1990). Cleavages i n the 5' r e g i o n of the ompA and bla mRNA c o n t r o l , s t a b i l i t y : s t u d i e s w i t h an Escherichia coli mutant a l t e r i n g mRNA s t a b i l i t y and a n o v e l e n d o r i b o n u c l e a s e . EMBO J. 9, 2731-2741. M a c k i e , G . A . (1989). S t a b i l i z a t i o n of the 3' o n e - t h i r d o f Escherichia coli r i b o s o m a l p r o t e i n S20 mRNA i n mutants l a c k i n g p o l y n u c l e o t i d e p h o s p h o r y l a s e . J. Bacteriol. 1 7 1 , 4112-412 0. Mack ie , G . A . (1991). S p e c i f i c e n d o n u c l e o l y t i c c l eavage of the mRNA f o r r i b o s o m a l p r o t e i n S20 of Escherichia coli r e q u i r e s the p r o d u c t o f the ams gene i n v i v o and i n v i t r o . J. Bacteriol. 1 7 3 , 2488-2497 . 87 M a c k i e , G.A. (1992) . Secondary s t r u c t u r e of t h e mRNA f o r r i b o s o m a l p r o t e i n S2 0: I m p l i c a t i o n s f o r c l e a v a g e by r i b o n u c l e a s e E. J. Biol. Chem. 2 6 7 , 1054-1061. M a c k i e , G.A. (1993). GenBank a c c e s s i o n #L23924 (amsrevis) . M a c k i e , G.A. and Genereaux, J.G. (1993). The r o l e of RNA s t r u c t u r e i n d e t e r m i n i n g RNase E-dependent c l e a v a g e s i t e s i n t h e mRNA f o r r i b o s o m a l p r o t e i n S20 in vitro. J. Mol. Biol. 2 3 4 , 998-1012 . Mackie, G.A. (1996). P e r s o n a l communication. McDowall, K.J., Hernandez, R.G., Lin-Chao, S., and Cohen, S.N. (1993). The ams-1 and rne-3071 temperature s e n s i t i v e m u t a t i o n s i n the ams gene a r e i n c l o s e p r o x i m i t y t o each o t h e r and cause s u b s t i t u t i o n s w i t h i n a domain t h a t resembles a p r o d u c t of t h e E s c h e r i c h i a c o l i mre l o c u s . J". Bacteriol. 1 7 5 , 4245-4249. McDowall, K.J., Lin-Chao, S., and Cohen, S.N. (1994). A+U c o n t e n t r a t h e r t h a n a p a r t i c u l a r n u c l e o t i d e o r d e r d e t e r m i n e s the s p e c i f i c i t y of RNase E c l e a v a g e . J. Biol. Chem. 2 6 9 , 10790-10796. McDowall, K.J. and Cohen, S.N. (1996). The N - t e r m i n a l domain of the rne gene p r o d u c t has RNase E a c t i v i t y and i s n o n - o v e r l a p p i n g 88 with the argi n i n e - r i c h RNA-binding s i t e . J. Mol. Biol. 2 5 5 , 349-355 . McDowall, K.J., Kaberdin, V.R., Wu, S.W., Cohen, S.N., and L i n -Chao, S. (1995). S i t e - s p e c i f i c RNase E cleavage of oligonucleotides and i n h i b i t i o n by stem-loops. Nature 3 7 4 , 287-290 . Melefors, 0. and von Gabain, A. (1991) . Genetic studies of cleavag e - i n i t i a t e d mRNA decay and processing of ribosomal 9S RNA show that the Escherichia c o l i ams and rne l o c i are the same. Mol. Microbiol. 5 , 857-864. Meyer, B.J., and Schottel, J.L. (1992). Characterization of cat messenger RNA decay suggests that turnover occurs by endonucleolytic cleavage i n a 3' to 5' directi o n . Mol. Microbiol. 6, 1095-1104. Miao, X. (1997). Personal communication. Miczak, A., Kaberdin, V.R., Wei, C.-L., and Lin-Chao, S. (1996) Proteins associated with RNase E i n a multicomponent r i b o n u c l e o l y t i c complex. Proc. Natl. Acad. Sci. USA. 9 3 , 3 865-3869. 89 Misra, T.K., and Apirion, D. (1979). RNase E, an RNA processing enzyme from Escherichia coli. J. Biol. Chem. 2 5 4 , 11154-11159. Mudd, E.A., Carpousis, A.J., and Krisch, H.M. (1990a). Escherichia coli RNase E has a role i n the decay of bacteriophage T4 mRNA. Genes and Devel. 4 , 873-881. Mudd, E.A., Krisch, H.M., and Higgins, C.F. (1990b). RNase E, an endoribonuclease, has a general role i n the chemical decay of Escherichia coli mRNA: evidence that rne and ams are the same genetic locus. Mol. Microbiol. 4 , 2127-2135. Mudd, E.A., and Higgins, C.F. (1993). Escherichia coli endoribonuclease RNase E: autoregulation of expression and s i t e s p e c i f i c cleavage of mRNA. Mol. Microbiol. 9, 557-568. Neidhardt, F.C. et a l . , (eds) (1987). Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology. ASM Press, Washington, D.C. Neidhardt, F.C, Ingraham, J.L. and Schaechter, M. (1990) Physiology of the Bacterial Cell. Sinauer Associates, Inc., Masachussetts. Newbury, S.F., Smith, N.H., Robinson, E.C, Hiles, I.D., and 90 H i g g i n s , C F . (1987). S t a b i l i z a t i o n o f t r a n s l a t i o n a l l y a c t i v e mRNA by p r o k a r y o t i c REP sequences. Cell 48, 297-310. N i c h o l s o n , A.W. (1995). The c h e m i s t r y and b i o l o g y of d o u b l e -s t r a n d e d RNA. Prog. Nucleic Acid Res. Mol. Biol. 5 2 , 1-65. N i c o l , S.M. and F u l l e r - P a c e , F.V. (1995). The "DEAD-box" p r o t e i n DbpA i n t e r a c t s s p e c i f i c a l l y w i t h the p e p t i d y l t r a n s f e r a s e c e n t e r i n 23S rRNA. Proc. Nat. Acad. Sci. USA 9 2 , 11681-11685. O'Hara, E.B., Chekanova, J.A., I n g l e , C.A., Kushner, Z.R., P e t e r s , E., and Kushner, S.R. (1995). P o l y a d e n y l a t i o n h e l p s r e g u l a t e mRNA decay i n Escherichia coli. Proc. Natl. Acad. Sci. USA 9 2 , 1807-1811. Ono, M. and Kuwano, M. (1979). A c o n d i t i o n a l l e t h a l m u t a t i o n i n an E s c h e r i c h i a c o l i s t r a i n w i t h a l o n g e r c h e m i c a l l i f e t i m e of mRNA. J. Mol. Biol. 1 2 9 , 343-357. Pepe, CM., M a s l e s a - G a l i c , S., and Simons, R.W. (1994)-. Decay of the IS10 a n t i s e n s e RNA by 3' e x o r i b o n u c l a s e s : e v i d e n c e t h a t RNase I I s t a b i l i z e s RNA-OUT a g a i n s PNPase a t t a c k . Mol. Microbiol. 1 3 , 1133-1142. P e t e r s e n , C. ( 1992 ) . C o n t r o l of f u n c t i o n a l mRNA s t a b i l i t y i n 91 b a c t e r i a : m u l t i p l e mechanisms of n u c l e o l y t i c and n o n - n u c l e o l y t i c i n a c t i v a t i o n . Mol. Microbiol. 6 , 277-282. P e t e r s e n , C . (1993). T r a n s l a t i o n and mRNA s t a b i l i t y i n b a c t e r i a : a complex r e a t i o n s h i p , i n "Control of messenger RNA stability" ( J . G . B e l a s c o and G . Brawerman, eds . ) Academic P r e s s , New Y o r k , Pp. 117-145. P h i z i c k y , E . M . , and F i e l d s , S. (1995). P r o t e i n - p r o t e i n i n t e r a c t i o n s : methods f o r d e t e c t i o n and a n a l y s i s . Microbiological Reviews, 5 9 ( 1 ) , 94-123. Py, B . , C a u s t o n , H . , Mudd, E . A . , and H i g g i n s , C . F . (1994). A p r o t e i n complex m e d i a t i n g mRNA d e g r a d a t i o n i n Escherichia coli. Mol. Micro. 1 4 , 717-729. Py, B . , H i g g i n s , C . F . , K r i s c h , H . M . , and C a r p o u s i s , A . J . (1996) A DEAD-box RNA h e l i c a s e i n the Escherichia coli RNA degradosome. Nature. 3 8 1 , 169-172. R a p a p o r t , L . R . and M a c k i e , G . A . (1994) . I n f l u e n c e of t r a n s l a t i o n a l e f f i c i e n c y on the s t a b i l i t y of the mRNA f o r r i b o s o m a l p r o t e i n S20 i n Escherichia coli. J. Bacteriol. 1 7 6 , 992-998. R e g n i e r , P . , Grunberg-Manago, M. , and P o r t i e r , C . (1987). 92 Nucleotide sequence of the pnp gene of Escherichia coli encoding polynucleotide phosphorylase. J". Biol. Chem. 262, 63-68. Robert-LeMeur, M. and Portier, C. (1994). Polynucleotide phosphorylase of Escherichia coli induces the degradation of i t s RNase III processed messenger by preventing i t s t r a s l a t i o n . Nucl. Acids Res. 22, 397-403. Robertson, H.D. and Dunn, J.J. (1975). Ribonucleic acid processing a c t i v i t y of Escherichia coli ribonuclease I I I . J. Biol. Chem. 3050-3056. Roy, M.K., and Apirion, D. (1983). P u r i f i c a t i o n and properties of ribonuclease E, an RNA processing enzyme, from Escherichia coli. Biochim. Biophys. Acta. 7 4 7 , 200-208. Sambrook, J., F r i t s c h , E.F., and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Sanger, F., Nicklen, S., and Coulson, A.R. (1977). DNA sequencing with chain-terminating i n h i b i t o r s . Proc. Natl. Acad. Sci. USA 7 4 , 5463-5467 . Shaw, G., and Kamen, R. (1986). A conserved AU sequence from the 93 3 ' u n t r a n s l a t e d r e g i o n f o GM-CSF mRNA med i a t e s s e l e c t i v e mRNA d e g r a d a t i o n . Cell. 46, 659-667. Shen, V., and S c h l e s s i n g e r , D. (1982). RNases I , I I and IV o f Escherichia coli, i n "The Enzymes" (P. Boyer, ed.) Academic P r e s s , New York, pp. 501-515. S i n g e r , P. and Nomura, M. (1985). S t a b i l i t y of r i b o s o m a l p r o t e i n mRNA and t r a n s l a t i o n a l feedback r e g u l a t i o n i n Escherichia coli. Mol. Gen. Genet. 199, 543-546. Stone, K.L., and W i l l i a m s , K.R. (1993). E n z y m a t i c d i g e s t i o n of p r o t e i n s and HPLC p e p t i d e i s o l a t i o n , i n "A Practical Guide to Protein and Peptide Purification for Microsequencing, Second Edition." (P. M a t s u d a i r a , ed.) Academic P r e s s , San Diego, pp. 43-69 . S t u d i e r , F.W., Rosenberg, A.H., Dunn, J . J . , and Dubendorff, J.W. (1990). Use of T7 RNA polymerase t o d i r e c t e x p r e s s i o n of c l o n e d genes. Meth. Enzymol. 185, 60-89. T a r a s e v i c i e n e , L., Mi c z a k , A., and A p i r i o n , D. (1991). The gene s p e c i f y i n g RNase E (rne) and a gene a f f e c t i n g mRNA s t a b i l i t y (ams) ar e t h e same gene. Mol. Microbiol. 5, 857-864. 94 T a r a s e v i c i e n e , L . , N a u r e c k i e n e , S . , and U h l i n , B . E . (1994). I m m u n o a f f i n i t y p u r i f i c a t i o n of the Escherichia coli rne gene p r o d u c t . J. Biol. Chem. 269, 12167-12172. T a r a s e v i c i e n e , L . , B j o r k , G . R . , and U h l i n , B . C . (1995). E v i d e n c e f o r an RNA b i n d i n g r e g i o n i n the Escherichia coli p r o c e s s i n g e n d o r i b o n u c l e a s e RNase E . J". Biol. Chem. 270, 26391-26398. Tomcsany i , T . and A p i r i o n , D. (1985). P r o c e s s i n g enzyme r i b o n u c l e a s e E s p e c i f i c a l l y c l e a v e s RNA I , an i n h i b i t o r of p r i m e r f o r m a t i o n i n p l a s m i d DNA s y n t h e s i s . J. Mol. Biol. 185, 713-720. T r a u t , R . R . , Lambert , J . M . , B o i l e a u , G . , and Kenny, J . W . (1980). P r o t e i n topography of Escherichia coli r i b o s o m a l s u b u n i t s as i n f e r r e d from p r o t e i n c r o s s l i n k i n g , i n "Ribosomes: S t r u c t u r e , F u n c t i o n , and Genet ics" (G. C h a m b l i s s , G . R . C r a v e n , J . D a v i e s , K. D a v i s , L . Kahan, and M. Nomura, eds . ) U n i v e r s i t y Park P r e s s , B a l t i m o r e , Pg. 89-110. Wang, M. and Cohen, S . N . (1994). ard-1: a human gene t h a t r e v e r s e s the e f f e c t s of temperature s e n s i t i v e and d e l e t i o n mutants i n the Escherichia coli rne gene and encodes an a c t i v i t y p r o d u c i n g RNase E - l i k e c l e a v a g e s . Proc. Natl. Acad. Sci. USA 91, 10591-10595. 95 Wennborg, A., Sohlberg, B., Angerer, D., Klein, G., and von Gabain, A. (1995) . A human RNase E - l i k e a c t i v i t y which cleaves RNA sequences involved i n mRNA s t a b i l i t y control. Proc. Natl. Acad. Sci. USA 9 2 , 7322-7326. Xu, F., Chao, S.L.-C, and Cohen, S.N. (1993). The Escherichia coli pcnB gene promotes adenylylation of antisense RNA I of C o l E l -type plasmids in vivo and degradation of RNA I decay intermediates. Proc. Natl. Acad. Sci. USA 9 0 , 6756-6760. Xu, F. and Cohen, S.N. (1995) . RNA degradation i n Escherichia coli regulated by 3' adenylation and 5' phosphorylation. Nature 3 7 4 , 180-183. Yen, T.J., Machlin, P.S., and Cleveland, D.W. (1988). Autoregulated i n s t a b i l i t y of B-tubulin mRNAs by recognition of the nascent amino terminus of B-tubulin. Nature 3 3 4 , 580-585. Zhou, A., Hassel, B.A., and Silverman, R.H. (1993). Expression cloning of 2-5-A-dependant RNase: a uniquely regulated stimulator of interferon action. Cell 7 2 , 753-765. Zilhao, R., C a i l l e t , J. , Regnier, P., and Arraiano, CM. (1995). Precise physical mapping of the Escherichia coli rnb gene, encoding ribonuclease II. Mol. Gen. Genet. 2 4 8 , 242-246. 96 Appendix 1. pET3xc cloning vector used to construct rneAN208, rneAN315, rneAN408, rneAN608, rneAN722, and rneAN813. Restriction sites used for cloning are circled in red. 0 Novagen Technical Bulletin ScalptM) P*H*o*> EcoR torn CUIOQ Hhxil l lCS) Ea>R V(I7I) Aflinowi pET-3xa (S384bp) Tihiu lawn' PvuIIOOtV NdeKlSO Xb*I(U32> BgllKlMO) Sph I(UI9» Ea>NKl6»7> Sal 1(1672 XnutntlMO) Nru tCWW) BsoMICD75) ^ Bun IO310) "•AvttCluS) 97 Appendix 2. pET24b cloning vector used to construct rneAC218. Restriction sites used for cloning are circled in red. \ 5 N o v a g e n Cra tit) Siy usn ,8cu Not «•«•» SJCHtWI Eoofl irni Son U M * T7 transcription/ expression region Cu k«o&« SaoS? ta*>3» pET-24a(+) (531 Obp) Ml M<3*-» BaE :it»«u 6COP "'AMI*! Mfl* r.iJT8» ' Sao '<*»») • T9»lt1 10*101 • / ^ N p B t t O J i i i M i ; 89 (OUT) *o«Ainrrii SseO w«» 98 Figure 11: Supplemental Figure - Fractionation of partially purified extracts of RneAN208 on an anion exchange column (Resource Q). For experimental details, see Figure 8 and the results section. 99 100 101 Figure 12: Supplemental Figure - Fractionation of partially purified extracts of RneAN315 on an anion exchange column (Resource Q). For experimental details, see Figure 8 and the results section. 1 0 2 (a) 103 104 Figure 13: Supplemental Figure - Fractionation of partially purified extracts of RneAN408 on an anion exchange column (Resource Q). For experimental details, see Figure 8 and the results section. 1 0 5 1 0 6 1 0 7 Figure 14: Supplemental Figure - Fractionation of partially purified extracts of RneAN813 on an anion exchange column (Resource Q). For experimental details, see Figure 8 and the results section. 1 0 8 109 (d) C 5 8 10 15 20 30 32 34 36 38 40 42 44 46 48 50 52 54 56 58 60 1 1 0 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0088271/manifest

Comment

Related Items