Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Studies on Ribonuclease E of ESCHERICHIA COLI and its association with the enzyme Polynucleotide phosphorylase Niguma, Kenneth 1997

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1997-0453.pdf [ 8.46MB ]
Metadata
JSON: 831-1.0088271.json
JSON-LD: 831-1.0088271-ld.json
RDF/XML (Pretty): 831-1.0088271-rdf.xml
RDF/JSON: 831-1.0088271-rdf.json
Turtle: 831-1.0088271-turtle.txt
N-Triples: 831-1.0088271-rdf-ntriples.txt
Original Record: 831-1.0088271-source.json
Full Text
831-1.0088271-fulltext.txt
Citation
831-1.0088271.ris

Full Text

STUDIES ON RD30NUCLEASE E OF ESCHERICHIA COU AND ITS ASSOCIATION WITH THE ENZYME POLYNUCLEOTIDE PHOSPHORYLASE by KENNETH NIGUMA Hon. B.Sc, Dalhousie University, 1993. A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF MEDICINE Department of Biochemistry and Molecular Biology We accepted this thesis as conforming to the required standard  THE UNIVERSITY OF BRITISH COLUMBIA August, 1997 © Kenneth Niguma, 1997  In  presenting  degree freely  this  thesis  in  partial  fulfilment  at the University  of  British  Columbia, I agree that  available for reference and study.  copying  of  this  department publication  or  thesis by  of this  his  for scholarly or  her  of  I further agree  purposes  requirements  that  It  is  of  g'° C-Hf^iyr^V  The University of British Columbia Vancouver, Canada  Date  DE-6  (2/88)  SerK  1,  [<J J 7  an advanced  by the head  understood  that  gain shall not be allowed without  4"®  n&\,<TCMK  it  permission for extensive  permission.  Department  for  the Library shall make  may be granted  representatives.  thesis for financial  the  StQLOM  of my  copying  or  my written  ABSTRACT Messenger RNAs (mRNA) in Escherichia coli are highly labile molecules due to the combined action of a number of exo- and endoribonucleases that orchestrate their degradation. Two of these enzymes, ribonuclease E (RNase E) and polynucleotide phosphorylase (PNPase) have been implicated as key components of a purported rnRNA degradation complex, otherwise known as the "degradosome" (Py etai, Nature 381, 169-172 (1996)). The purpose of these studies was to identify the site of interaction of PNPase with RNase E (Rne). Antibodies were generated against PNPase, initially against fusion proteins expressing two highly antigenic sites predicted to exist in PNPase, and later against a His(6)-PNPase fusion protein. These antibodies, along with a previously generated anti-RNase E antibody, were used to detect Rne or PNPase at various stages during the partial purification of RNase E. Rne and PNPase were found to remain in a stable complex, in association with other unidentified proteins, after several purification steps, and in particular after anion exchange chromatography. Over-expression and partial purification of Rne deletion mutants revealed that loss of the N-terminal portions of Rne did not prevent the mutant from binding PNPase independently, highlighting the importance of the C-terminal portion of Rne in associating with PNPase. Co-chromatography experiments could not determine whether the N-terminal region of Rne bound directly or indirectly to PNPase. A Far-Western experiment, which separates partially purified proteins in cell lysates and assesses their binding individually, demonstrated that derivatives of Rne retaining the C-terminal acidic tail of Rne were competent to bind PNPase. These experiments illustrating the binding of PNPase to the C-terminus of Rne complement the findings that PNPase binding is lost when the Rne C-terminus is missing (Kido etai, J. Bact, 178, 39173925 (1996)).  ii  TABLE OF CONTENTS Page Abstract  ii  Table of contents  iii  List of Figures  v  i  List of Tables  vii  List of Appendices  viii  List of Abbreviations Acknowledgments  i .  x  xi  Chapter 1 - Introduction  1  1.1 Overview  1  1.2 A "Consensus" Model for Prokaryotic mRNA Decay  2  1.3 The Enzymes of Prokaryotic mRNA Decay  3  1.3.1 The Endoribonucleases 1.3.1.1 RNaselTJ 1.3.1.2 RNaseE 1.3.2 The Exoribonucleases 1.3.2.1 PNPase 1.3.2.2 RNaseU  3 3 4 10 10 12  1.4 The "Degradosome" complex 1.4.1 RNA Helicases 1.4.2 Poly(A) Polymerase 1.4.3 Other enzymes  13 14 15 16  1.5 New Perspectives on mRNA Decay  17  Chapter 2 - Materials and Methods  •• 21  iii  2.1 Reagents  21  2.2 Vectors, Strains and Media 2.2.1 Vectors 2.2.2 Bacterial Strains 2.2.3 Media  22 22 22 23  2.3 Oligonucleotides  24  2.4 Recombinant DNA Methods 2.4.1 Isolation of Plasmid DNA 2.4.2 Restriction Enzyme Digests 2.4.3 Separation of DNA by Gel Electrophoresis 2.4.4 In Vitro Amplification of DNA by the Polymerase Chain Reaction 2.4.5 Ligations 2.4.6 Transformations into E. coli Competent Strains 2.4.7 DNA Sequencing  24 24 24 24 25 25 26 26  2.5 Over-Expression and Purification of Recombinant Proteins 2.5.1 Sodium Dodecyl Sulfate Polyacrylamide Gels (SDS-PAGE) 2.5.2 Protein Over-Expression Assay 2.5.3 Culture and Induction of Recombinant Proteins 2.5.4 Cleveland Mapping 2.5.5 Anion and cation exchange chromatography on the Pharmacia FPLC System 2.5.6 Size Exclusion Chromatography 2.5.7 Immobilized Metal Ion Chromatography  26 26 27 28 28  2.6 Immunological Methods 2.6.1 Preparation of Antigenic Protein for Rabbit Immunization 2.6.2 Rabbit Bleeds 2.6.3 Western Blots 2.6.4 Antibody Stripping 2.6.5 Far-Western Blotting  30 30 31 31 32 32  Chapter 3 - Results  29 29 30  35  3.1 Antibody Generation 3.1.1 Generation of Antibodies Against Antigenic Sites in PNPase 3.1.2 Generation of Antibodies Against a His(6)-PNPase Fusion Protein  35 35 42  3.2 Rne Mutant Proteins 3.2.1 Rne N-Terminal Deletion Mutants  48 48  iv  3.2.2 Rne C-Terminal Deletion Mutants 3.3 Native and Mutant Rne-PNPase Interations Assessed by Co-Chromatography 3.3.1 Fractionation of Rne-PNPase on an Anion Exchange Column 3.3.2 Fractionation by Anion Exchange Chromatography of Rne N-terminal Deletion mutants 3.3.3 Rne C-Terminal Deletion Mutant Fractionation by Anion (Mono Q) and Cation (Mono S) Exchange Chromatography 3.4 Assessment of Rne-PNPase Interactions by Far-Western Blotting  48 51 51 55 59 63  Chapter 4 - Discussion  68  References  76  v  LIST OF FIGURES  FIGURES Figure  Description  Page  1  Antigenic site predictions in PNPase from the primary structure  2  Over-expression and identification of proteins containing the two antigenic regions  36  of PNPase  38  3  Detection of T7genelO-PNPase fusion proteins by Western blotting  40  4  Purification of over-expressed His(6)-PNPase by metal ion chelate chromatography ....  43  5  Polyclonal antibodies raised against purified His(6)-PNPase detected by Western blotting  45  6  A map of deleted Rne proteins  49  7  Fractionation of enriched extracts of GM402 on an anion exchange column (Resource Q)  52  8  Fractionation of partially purified extracts of RneAN608 on an anion exchange column (Resource Q)  56  9  Fractionation of partially purified RneAC218 by ion exchange chromatography  60  10  Far-Western blotting of native and mutant Rne protein with free PNPase  64  11  Fractionation of partially purified extracts of RneAN208 on an anion exchange column (Resource Q) 99  12  Fractionation of partially purified extracts of RneAN315 on an anion exchange column (Resource Q) 102  13  Fractionation of partially purified extracts of RneAN408 on an anion exchange column (Resource Q) 105  14  Fractionation of partially purified extracts of RneAN813 on an anion exchange column (Resource Q) 108  vi  LIST OF TABLES  Table Table 1  Description Oligonucleotides  Page 34  vii  LIST OF APPENDICES  APPENDICES Appendix Appendix 1  Appendix 2  Description  Page  pET3xc cloning vector used to construct rneAN208, rneAN315, rneAN408, rneAN608, rneA722 and rneAN813  97  pET24b cloning vector used to construct rneAC218  98  viii  LIST OF ABBREVIATIONS 2D 3D AS26 ATP BSA °C C-terminal CTP dd dATP DNase dNTP DTT ECL E. coli EDTA FPLC g Hepes His(6) JPTG kb kDa kg LB M mg min mL mm mRNA MW Mg  pL NDP ng NMP NMR N-terminal PAGE PAP  two dimentional three dimentional 26% (w/v) ammonium sulfate fraction adenosine 5'-triphosphate bovine serum albumin degrees Celcius carboxy terminal cytidine 5'-triphosphate dideoxy deoxyadenosine 5'-triphosphate deoxyribonuclease deoxyribonucleotide triphosphate dithiothreitol enhanced chemoluminescent Escherichia coli ethylenediaminetetraacetate fast protein liquid chromatography gravity 4(-2-hydroxyethyl)-1 -pierazineethanesulfonic acid oligo(6) histidine isopropyl-P-thiogalactopyranoside kilobase kilodalton kilogram Luria-Bertani molar milligram minute millilitre millimetre messenger RNA molecular weight microgram microlitre nucleoside diphosphate nanogram nucleoside monophosphate nuclear magnetic resonance amino terminal polyacrylamide gel electrophoresis poly(A) polymerase ix  PBS PCR pmol PMSF PNPase poly(A) PTBN RBD REP RNase RNase E rne Rne rRNA SI S2 S200 SDS TAE TBE TEMED Tris tRNA V w/v  phosphate buffered saline polymerase chain reaction picomole phenylmethylsulfonylfluoride polynucleotide phosphorylase polyadenylate sodium phosphate-Tween 20-bovine serum albumin-Na azide R N A binding domain repetitive extragenic palindrome ribonuclease ribonuclease E rne/ams/hmp gene rne/ams/hmp gene product ribosomal R N A purported antigenic site 1 of PNPase purported antigenic site 2 of PNPase 200,000 x g supernatant sodium dodecyl sulfate Tris-sodium acetate-NaEDTA Tris-Boric acid-NaEDTA N , N , N ' , N'-tetramethylethylenediamine tri(hydroxymethyl) aminomethane transfer R N A volts weight per volume  X  ACKNOWLEDGMENTS  I would like to thank the numerous people who helped, guided and supported me on my journey towards my graduate degree. First and foremost, I would like to extend my deepest thanks and gratitude to Dr. George A. Mackie. His knowledge, patience and dedication to his research and position are well known to the people who have had the pleasure to meet him. Above all this, I will remember his enthusiasm for science, which is sadly a rarity in any discipline of life. May you someday have dozens of students who thirst for learning as you do. You deserve it. I could not overlook the contributions of Glen Coburn who constantly gave me valuable insight into my project and provided me with the free PNPase that I so desperately needed. His vast knowledge of the putrid pop music of the 70's and 80's were envied by me and no one else. Xin Miao had a huge part in my project by creating the rne N-terminal deletion mutants. Thanks for all the great times that I remember, and you probably don't. Anand Rampersaud: if not for him I would never have know that PMV is a rod-shaped flexious virus. Is it good from far, or far from good? A thank you to Stephanie Masterman, who tirelessly aided me in my day to day lab endeavors and taught me the ways of the new British invasion. May the Canucks win the Cup sometime in the next millenium! I would like to extend a special thanks to Julie G., Michele R., and Rob C. for all their help when I was the rookie in the lab, and to the past members of the Mackie lab for their help and friendship. Thank you to all my friends in Nova Scotia, Ontario and Vancouver who kept me sane through all of these years. I will eventually find the time to come and harrass you all again, and you know that I will! Last, but not least, I must thank my mom, dad and brother Gord for all their love and support from day one. I'll always be there for all of you.  With all my gratitude,  Ken Niguma  xi  Chapter 1 INTRODUCTION  1.1  OVERVIEW Much o f our understanding  constitute  cellular  metabolism  negative bacterium Escherichia  of the b i o l o g i c a l  processes  has been gleaned  from  coli  ease of manipulation of E. coli  that  the gram-  (Neidhardt e t a l . , 1 9 8 7 ) .  The  combined with i t s r a p i d r e p l i c a t i o n  has made i t an important model organism f o r the study of s y n t h e s i s , maturation, 1997).  function  and decay  The e x t e n s i v e  of RNA  genetic  ( D ' A l e s s i o and Riordan,  and b i o c h e m i c a l  data  currently  a v a i l a b l e , combined with the sequencing and a n a l y s i s of the E. genome should p r o v i d e the f i r s t i n v o l v e d i n RNA metabolism, RNA  has  transcription cells  long  been  established  which  classes  14%)  RNA  of RNA a r e c o n s i d e r e d  roles. link  between  therefore, a l l  t o RNA s y n t h e s i s .  mass i n prokaryotes i s RNA, most  (approximately  (Neidhardt  of the enzymes  the  t o make a major commitment  i s ribosomal  (approximately  as  i n a l l organisms;  Approximately 2 0% of the dry c e l l of  description  and t h e i r f u n c t i o n a l  and t r a n s l a t i o n  are obliged  full  coli  et a l . , 'stable'  81%) and t r a n s f e r RNA 1990).  Both  i n relation  o f these  to c e l l u l a r  growth r a t e s , whereas messenger RNA (mRNA), c o n s t i t u t i n g o n l y 4% of the RNA, i s considered m e t a b o l i c a l l y ' l a b i l e ' .  In E. coli,  typical  mRNA h a l f - l i v e s are 60-12 0 seconds, although a few mRNAs (e.g. ompA mRNA) d i s p l a y h a l f - l i v e s of up t o 15 minutes (Belasco and H i g g i n s ,  1  1988) . The  instability  of mRNA p l a y s a number of r o l e s i n c e l l u l a r  metabolism.  First  of a l l , i t has a d i r e c t  affect  on the maximal  steady-state  c o n c e n t r a t i o n of mRNA i n the c e l l which i s e n t i r e l y  independent of the promoter s t r e n g t h a t the t r a n s c r i p t i o n a l Secondly,  r a p i d mRNA decay allows  regulatory  including  1985)  the a m p l i f i c a t i o n o f n e g a t i v e  s i g n a l s l e a d i n g t o an a c c e l e r a t e d r e p r e s s i o n of gene  expression.  during  level.  This  has been  the s e l e c t i v e  translational  observed  decay  i n a number  of some i n E.  repression  and the r a t e of degradation  ribosomal coli  of i n s t a n c e s , p r o t e i n mRNAs  (Singer  and Nomura,  of RNAI, an a n t i - s e n s e  repressor  t h a t i s a key element of c o n t r o l i n the r e p l i c a t i o n o f C o l E l - t y p e plasmids  (Lin-Chao and Cohen, 1991).  eukaryotes  S i m i l a r f i n d i n g s are found i n  i n the down-regulation of c - f o s  "immediate e a r l y " mRNAs f o l l o w i n g i n d u c t i o n 1984),  and the e u k a r y o t i c  (Yen e t al., products  1988).  i n some  autoregulation  and other  eukaryotic  (Greenberg and Z i f f ,  of ( 3 - t u b u l i n s y n t h e s i s  T h i r d , d i f f e r e n t i a l e x p r e s s i o n of d i s t a l gene polycistronic  mRNAs can be accounted  s e l e c t i v e decay of the t r a n s c r i p t  (Newbury e t al.,  1987).  for  by  Fourth,  r e c y c l i n g of the degraded r i b o n u c l e o t i d e s w i t h i n the c e l l serves t o conserve metabolic activate  mRNA  energy.  decay  Finally,  to control  antisense n u c l e i c acids often  the l e v e l s  o f gene  expression  (Inouye, 1988) . 1.2  A "CONSENSUS" MODEL FOR PROKARYOTIC mRNA DECAY In the e a r l y 197 0s, the work of Kepes, A p i r i o n and K e n n e l l on  the mRNA decay i n E. coli  culminated 2  i n t o what i s best d e s c r i b e d as  a  "consensus"  This  model  model p r e d i c t e d  endonucleolytic scavenging The II  proposed that  model s u g g e s t e d the a n d PNPase,  and  i n mRNA d e c a y was a n followed  to refine  1.3  (Belasco  by  fragments by 3'-exonucleases.  not identify  the specific  RNase  endonuclease.  explain individual differences i n  degradation  o r the r o l e o f t r a n s l a t i o n i n i n f l u e n c i n g  However, i t d i d p r o v i d e  degradation  embark.  a framework from w h i c h  I n t h e e n s u i n g 20 y e a r s ,  studies  many e n d o -  t h e "consensus" and Higgins,  model  1988;  i n an  of prokaryotic  Higgins  e t al.,  mRNA  1992).  THE ENZYMES OF PROKARYOTIC mRNA DECAY I n E. coli,  t h e r e i s a n abundance o f r i b o n u c l e a s e s  that  target  a n d a l m o s t h a l f o f t h e s e RNases f u n c t i o n i n tRNA m e t a b o l i s m :  RNase P b e i n g and  1973).  e x o n u c l e o l y t i c enzymes h a v e b e e n i d e n t i f i e d a n d s t u d i e d  attempt  RNA  step  (Apirion,  involvement of theexoribonucleases  r a t e among mRNA s p e c i e s  o f mRNA d e c a y c o u l d  Apirion  i n the transcript,  generated  but did  Moreover, i t d i d not  stability.  the i n i t i a l  cleavage(s)  o f t h e newly  by David  required  f o r 5' e n d f o r m a t i o n  BN i n 3' e n d f o r m a t i o n  enzymes  directly  categories,  linked  and maintenance t o mRNA d e c a y  t h e endonucleases and the  1.3.1  THE ENDORIBONUCLEASES:  1.3.1.1.  RNase I I I  This  a n d R N a s e s D, PH, T,  (Deutscher, 1993a).  may b e d i v i d e d  The  i n t o two  exonucleases.  enzyme h a s b e e n c h a r a c t e r i z e d a s a d o u b l e - s t r a n d e d , RNA-  s p e c i f i c e n d o r i b o n u c l e a s e ( R o b e r t s o n a n d Dunn, 1975)  3  that e x i s t s as  a homodimer o f 25 kDa s u b u n i t s . to  be i n t h e m a t u r a t i o n  I t s main r o l e i n t h e c e l l  of ribosomal  RNA, a l t h o u g h  demonstrated  t o a c t on phage,  transcripts,  i n c l u d i n g sense-antisense  1995) . al.  ,  Cells  1993),  that  on c e l l u l a r  that  i t has been  mRNAs,  and plasmid  RNA d u p l e x e s  (Nicholson,  l a c k RNase I I I a r e s t i l l  indicating  appears  v i a b l e (Babitzke e t  alternate processing  pathways c a n  p r o v i d e f u n c t i o n a l rRNA, a n d t h a t RNase I I I c l e a v a g e  i sunlikely to  p l a y a c e n t r a l r o l e i n g e n e r a l mRNA d e c a y . 1 . 3 . 1 . 2  RNase  E  RNase E was o r i g i n a l l y i d e n t i f i e d i n a t e m p e r a t u r e - s e n s i t i v e m u t a n t o f E. yielding  coli  t h e immediate p r e c u r s o r  t o 5S rRNA  1979).  A t e m p e r a t u r e - s e n s i t i v e mutant  produce  p 5 S RNA was d i s c o v e r e d ,  bacteria vitro the  contained  a t two s i t e s ams-1  9S rRNA in  as an a c t i v i t y which c l e a v e d  (Ghora a n d A p i r i o n ,  {rne-3071)  that f a i l e d to  and e x t r a c t s from  a t h e r m o l a b i l e enzyme t h a t ( M i s r a a n d A p i r i o n , 1979) .  ( a l t e r e d mRNA s t a b i l i t y )  E.  coli  mutation al.,  was l a t e r  temperature  discovered  these  cleaved  mutant  9S RNA  mutant  strain  showed  t o degrade  (Ono a n d Kuwano, 1 9 7 9 ) .  t o be a l l e l i c  in  Independent work on  temperature s e n s i t i v e growth and impaired a b i l i t y RNA a t t h e n o n - p e r m i s s i v e  vitro,  t o rne-3071  bulk This  (Mudd e t  1990b; B a b i t z k e a n d K u s h n e r , 1 9 9 1 ; T a r a s e v i c i e n e e t al., 1 9 9 1 ;  Melefors  and von Gabain,  1991) .  Together,  these  results  clearly  i n d i c a t e d t h a t RNase E a c t i v i t y p l a y s a c e n t r a l r o l e i n b u l k mRNA decay. The  c l o n i n g o f t h e rne/ams  gene i n i t i a l l y p r o v e d 4  problematic  (Chanda e t al. , 1 9 8 5 ) .  Later,  1991;  e t al. ,  Claverie-Martin  regarding  1991)  (Casaregola  l e d to misunderstandings  the rne/ams  gene was  cloned  e t al. , 1992) and sequenced c o r r e c t l y (Mackie,  1993).  rne/ams  Ultimately,  gene maps a t 2 3 . 5 minutes on the E. e t al.,  (Casaregola  1992) and i t s e x p r e s s i o n  RNase E cleavage of the rne/ams 1995).  J a i n and Belasco,  coli  chromosome  i s autoregulated  by  t r a n s c r i p t (Mudd and Higgins, 1 9 9 3 ;  The gene encodes a p r o t e i n of 1061 amino mass of 118 kDa (Cormack e t  a c i d s w i t h a p r e d i c t e d molecular 1993).  al.,  (Chauhan e t  the i d e n t i t y of the endonuclease component and the s i z e  of the Rne p o l y p e p t i d e .  The  sequencing e r r o r s  al.,  M o b i l i t y of the Rne/Ams p r o t e i n i n SDS-polyacrylamide g e l s  has been observed to be anomalously slow ( e q u i v a l e n t to about 180 kDa) (Casaregola  e t al. ,  w i t h i n the p r o t e i n the  Rne/Ams  Initial  i n 2D g e l s  attempts  to p u r i f y RNase  claimed e t al. ,  (Lundberg fragment  eventually  that  the p i of the  E were  to be a  specific  1990),  but l a t e r  found  subunit  of RNase  the enzyme  solved  The m o b i l i t y of  also  troublesome  T h i s l e d to the i d e n t i f i c a t i o n of RNase  of the c a t a l y t i c  isolating  .  1994).  endonuclease  p h y s i o l o g i c a l s i g n i f i c a n c e (Mudd and Higgins, of  regions  and i t s extreme s e n s i t i v i t y to p r o t e o l y s i s  (Roy and A p i r i o n , 1 9 8 3 ) . once  proline-rich  indicates  ( T a r a s e v i c i e n e et al.,  because of aggregation  K,  due to three  (McDowall and Cohen, 1996)  protein i s 5.0  polypeptide  1992)  when  responsible  5  mRNA  to be a p r o t e o l y t i c E which 1993).  f o r RNase  the over-expressed  f o r ompA  E  Rne/Ams  l a c k s any The problem  activity  was  protein  was  renatured after (Cormack  et  retained  partial  al.  the  ,  1993).  ams-1  the  (G66S)  codons  66  and  create  subtle  Likely,  al.,  to  the  The  region  (L68F)  the  of  its  activity  as  a phosphodiesterase,  (Mg , 2+  Mn )  (Misra  substrates,  to cleave  2+  1979).  focused  r e c o g n i t i o n sequence  on  Early  were in  performed  (Mackie,  a  Studies  known s u b s t r a t e s 1991;  Mackie and Genereaux,  to  the  conferred 1993). at  al.,  the  1997).  endonucleolytic metal  ion  3 ' -hydroxy 1 t e r m i n i determine  specific 1985).  RNase E  nucleotide This  putative  c o n s e r v e d as more  cleavage  correlating site  of  Cormack and M a c k i e ,  1993).  Both  al. ,  divalent  to  a  to  single-stranded  its  (Tomcsanyi and A p i r i o n ,  characterized.  structure  targets  efforts  identifying  1993).  et  of  mapped  B y c r o f t et  requiring  E,  subunit  binding site  performs  c o n s e n s u s r e c o g n i t i o n s e q u e n c e was n o t sites  (McDowall  RNA, l e a v i n g 5 ' - p h o s p h a t e ,  and A p i r i o n ,  specificity  and  were  domain w h i c h  1994;  specifically  RNase  the p o s i t i o n s  al. ,  substrate  al.,  regions  et  to  catalytic  mutations  (McDowall  d i s r u p t the  protein  attributed  N-terminal  (Carpousis et  Rne/Ams  r e n a t u r e d Rne/Ams  Subsequently,  RNase E a c t i v i t y  these mutations  N-terminal  1993).  respectively at  the  gene e n c o d e d t h e  rne-3071  changes  thermolability  found that  specificity  rne/ams  and  68,  was  and  RNase E (Cormack e t  the  It  activity  demonstrating that of  p u r i f i c a t i o n and s e p a r a t i o n on an SDS g e l  RNA  cleavage 1992;  These experiments  secondary were  Mackie,  also 1992;  combined w i t h  the  p r o p e r t i e s o f a number o f mutants d e s i g n e d t o s t r a t e g i c a l l y  disrupt  folding  E  (Mackie  and  Genereaux,  1993)  6  showed  that  RNase  is  a  single-strand  specific  enzyme  specificity.  T h i s was a l s o  (McDowall,  al.,  et  From  the  1994;  cleavage  that  Rne/Ams p r e f e r s  rich  context.  stable  stem-loop  sites  al.,  5'  to  sites  structure.  are  sites  (McDowall  and G e n e r e a u x , 1993) the  efficiency  of  studies  et  al.,  with  1995)  suggest that  cleavage.  far,  identification. in close  synthetic  Thus,  it  require  at  substrate 1991;  least for  efficient  appears that  the  or c o u l d cause  substrates  structure  1992;  reduce  stem-loops  the h e l i c a l (Mackie  1995).  residues  In at  the  mRNA d e c a y  Hansen e t al.  at  vivo  , 1994).  have b e e n  sequestered  short,  stem-loops, least  for  RNase E may 5'-end  (Chen  et  of  a  al. ,  T h i s appears  i n RNase E r e c o g n i t i o n , s i n c e  5'-ends  are r e s i s t a n t  al.,  i n i t i a t i o n of  element  whose  (Mackie  attack  s t r i c t l y required,  unpaired  Bouvet and B e l a s c o ,  t o be an e s s e n t i a l of  three  et  to  oligonucleotide  S i n c e RNase E c a n a c c u r a t e l y p r o c e s s  (McDowall  to  s e c o n d a r y s t r u c t u r e t o e n s u r e an  such secondary s t r u c t u r e s are not reactivity  a  Despite  proximity  s i n g l e - s t r a n d e d RNA o l i g o n u c l e o t i d e s t h a t l a c k f l a n k i n g  vitro  by  continues  s t a c k i n g of r e s i d u e s i n the cleavage s i t e to i n h i b i t  in  i n an A - U -  followed  evidence  are  appears  a n d more c o m p l e x RNAs  cleavable single-stranded site,  and Genereaux, 1993).  it  these adjacent stem-loops  c o u l d serve to s t a b i l i z e the l o c a l easily  on RNA I  1994).  Conflicting  t h a t many mRNA c l e a v a g e  substrates  studies  preceded or  the  structures,  sequence  AU d i n u c l e o t i d e s  in site  stem-loop  strict  c h a r a c t e r i z e d thus  cleave  these  et  obscure the r o l e of the stem-loops fact  any  confirmed by s i m i l a r  Lin-Chao,  to  Often  lacking  a variety  by a s e c o n d a r y  t o c l e a v a g e b y b o t h c r u d e RNase E a n d t h e 7  purified  Rne/Ams  protein,  single-stranded accurate greater  prediction knowledge  atomic  of  et  several There  RNase  of  the  of  the  are  al. ,  two  putative  an E.  1993),  RNase E i s  coli a  personal  protein  debated  basic  i n d u c e d by 1993) .  1996;  al.,  region  the  depend  the on  at  a  the  interferon  (Taraseviciene  RNase  which e x h i b i t L,  the  treatment  of  2-5-A  of  the  active  of  enzyme  site  excess  appears  i n the N - t e r m i n a l r e g i o n ,  SI RNA b i n d i n g domain  1995;  to  have  et  1995;  al.,  sequence  deletion  8  others  et.  et  al,  1997) .  in  1992; al.,  Miao  et  similarities endonuclease (Zhou e t of  al,  have  within  ,  narrowed  the  noticed  the  al. ,  region  1995;  (McDowell a n d C o h e n , map  al.  Miao e t  a l o n g w i t h a sequence  (Bycroft  et  al.,  studies  mammalian c e l l s  while  (McDowall  (RBD) whose r o l e  activated  that  6).  domains  (Casaregola  (Tarasevisiene  communication),  in conditions  division  al.,  analysis  Fig.  two  C a s a r e g o l a et  et  identified  (see  domains,  in cell  1993;  Deletion  608-622  in  motifs  dynamin  Taraseviciene  communication),  personal  residues to  will  that  Rne/Ams has  binding  Some s t u d i e s have d e m o n s t r a t e d  al,  Part  remains  interaction  RNA b i n d i n g domain  s e v e r e l y hampers RNase E a c t i v i t y  effect  site  appears  sites  functional  involved  (Cormack e t  residues  personal  et.  It  E-substrate  resembling  communication).  RBD t o  a  RNase  nucleotide  region  M c D o w e l l and Cohen,  to  1997).  E cleavage  important  1992) , a n d a h i g h a f f i n i t y  al.,  cleavage  amino a c i d sequence o f  potentially  resembling  the  al. ,  the  level.  Analysis  et  (Mackie  although  Miao no  1995).  first  150  homologous  An a c i d i c C -  terminal t a i l  (residues 8 5 0 - 1 0 6 1 )  i n c a t a l y t i c f u n c t i o n in vitro, in  vivo  in  vivo  it  but may be necessary f o r a c t i v i t y  (Wang and Cohen, 1 9 9 4 ) , as w e l l  seems  that  does not appear t o be important  (Chanda et. al,  although some found i t unnecessary Kido e t al.,  1985;  the Rne/Ams p r o t e i n  Overall,  1996).  i s comprised  o f a number o f  d i s t i n c t f u n c t i o n a l modules. An  RNase E - l i k e a c t i v i t y has been i d e n t i f i e d Haloarcula  halophile  specificity  marismortui  as E. coli  which  a r e two r e p o r t s  cells.  The human  has the same  RNase E and c r o s s - r e a c t s w i t h  a n t i b o d i e s r a i s e d against E. coli There  of RNase E - l i k e  ard-1  gene  1 3 . 3 kDa  a basic,  proline-rich  encodes  which  has  to the Rne/Ams p r o t e i n i n E. coli 1997 ) .  dependent endoribonuclease t h a t binds  very  The A r d - 1  limited  p r o t e i n i s a Mg 2+  and c l e a v e s RNA i n a manner  produced in vivo  and in vitro  activity  mRNA in al.  ,  vitro  1995).  i n human c e l l with  and the  bulk  site-specific  are e s s e n t i a l l y the same as  those o f RNase E (Wang and Cohen, 1 9 9 4 ) . an  Expression of  i s able t o complement rne mutants:  mRNA decay r a t e s are r e s t o r e d to w i l d - t y p e cleavages  sequence  (Wang and Cohen,  i d e n t i c a l to RNase E ( C l a v e r i e - M a r t i n e t al. , 1 9 9 7 ) . . gene i n E. coli  1997).  i n mammalian  similarities  the ard-1  monoclonal  activities  of  C l a v e r i e - M a r t i n et al.,  substrate  RNase E ( F r a n z e t t i e t al,  polypeptide  1994;  i n the extreme  Another study  e x t r a c t s which c l e a v e s  described  9 S RNA and ompA  the same s p e c i f i c i t y as RNase E (Wennborg e t  The enzyme r e s p o n s i b l e has a molecular  9  mass of 6 5 kDa  and  i s r e c o g n i z e d by  1995). and  The  Kamen,  anti-RNase E antibodies  enzyme c l e a v e s w i t h i n 1986),  which  1.3.2  THE  1 . 3 . 2 . 1  t h e 5'-AUUUA-3' s e q u e n c e  i s reminiscent  of  ,  (Shaw  t h e A , U - r i c h RNase  (Wennborg e t al.,  c l e a v a g e "consensus" sequence  e t al.  (Wennborg,  E  1995).  EXORIBONUCLEASES:  PNPase  All  t h u s f a r i n E.  the exoribonucleases discovered  enzymes  that  act  polynucleotide  in  the  3'->5'  phosphorylase  direction.  (PNPase)  coli  Two  and  of  are them,  PH  RNase  are  phosphorolytic phosphodiesterases, while the r e s t are h y d r o l y t i c i n activity among  (Deutscher, 1993b).  the  carry  PNPase  (and RNase PH)  exoribonucleases i n u t i l i z i n g  out  phosphorylytic  ribonucleoside  diphosphates  are  inorganic  cleavage  of  RNA,  (Littauer  and  distinct  phosphate  to  creating  5'-  1982).  In  Soreq,  contrast to the h y d r o l y t i c reactions, the PNPase-catalyzed r e a c t i o n conserves  free  important  to  1993b).  energy  the  in  cell  under  5'-rNDP  energy-poor  products,  which  conditions  but  c a n be  (Guarneros and P o r t i e r , catalyze  1991;  impeded by  RNA  secondary  C a u s t o n e t al. , 1 9 9 4 ) .  the polymerization  of  5'-rNDPs  ( L i t t a u e r and Soreq,  be  including structure PNPase  f o r m i n g RNA  w i t h t h e r e l e a s e o f phosphate, and can c a t a l y z e i n o r g a n i c e x c h a n g e w i t h 5'-rNDPs  may  (Deutscher,  PNPase e f f i c i e n t l y d e g r a d e s u n s t r u c t u r e d RNAs,  homoribopolymers,  also  the  can  chains  phosphate  1982).  PNPase c o n s i s t s o f t h r e e a - s u b u n i t s o f 85 kDa, w h i c h g e n e r a t e the  c a t a l y t i c s i t e , and o f t e n t h r e e ( 3 - s u b u n i t s o f 48 kDa  10  (Littauer  and Soreq, pnp  Py et  1982;  al.,  1996).  The a-subunit i s encoded by the rpsO,  gene, mapping a t 69 minutes, and i s c o - t r a n s c r i b e d w i t h (Regnier et al.,  which encodes ribosomal p r o t e i n S15  1987).  subunit contains a 69 amino a c i d sequence at i t s c a r b o x y l similar  to a  sequence m o t i f  (Regnier et al.,  binds RNA indicate  t h a t the RNA  binding barrel  barrel  and  (Bycroft  ,  1997).  adjacent  et  al.  ,  1997).  d e v o i d of any RNA An  (a) ( 3 )  (Littauer other  3  and  complexes  distinct.  form  the  as observed  RNase I I and  putative  (3-subunit  The  1996;  1982), but  has  one  a-  i n the RNA  RNA  binding  been  shown 1996)  yet  3  enzymes  f a c e of  the site  to  be  and i s  1996) .  a l s o been i s o l a t e d from  i t has  PNPase subunits  other  Miczak et al.,  (Py et al.,  binding a b i l i t y  of  1982)  Conserved r e s i d u e s on  (Py et al.,  Soreq,  f u n c t i o n s of the  i n v e s t i g a t i o n has confirmed the  form of PNPase has  2  p r o t e i n SI which a l s o  catalytic  i n RNase E,  loops  i d e n t i c a l to enolase  terminus,  SI domain, a f i v e - s t r a n d e d a n t i p a r a l l e l  i s present  et al.  (Bycroft  the  a-  Biochemical and g e n e t i c s t u d i e s  ( L i t t a u e r and Soreq,  A recent NMR  domain as which  1987).  b i n d i n g and  subunit are separable Rne/Ams p r o t e i n .  i n ribosomal  The  to be  are p r e s e n t  and  cells  determined  if  functionally  PNPase i s capable of a u t o r e g u l a t i n g the t r a n s l a t i o n of  i t s message, i n cooperation w i t h the a c t i o n of RNase I I I and RNase E  (Hajnsdorf et al.,  1994a; Robert-LeMeur and P o r t i e r ,  can be i s o l a t e d i n a complex with RNase E Py et al.,  1994;  see  below).  11  1994),  (Carpousis et al.,  and 1994;  1 . 3 . 2 . 2  RNase  I I  Ribonuclease activity  in  degrading  RNA  from  1996a) .  minutes  on  and  the  al.,  homogeneity  is  E.  3'  coli  II  644  The rnb  enzyme  is  is  metal  (Mg ,  activity  active  al.,  1980) .  1977; The  homoribopolymer poly(A) A l t h o u g h mutants mutants  deficient  Kushner,  1986).  exonucleases implicated agents that  of  by  by  5' rNMPs  (Shen  and  1994;  Coburn  and  Kennel1,  the  rnb  hydrolytically  gene w h i c h maps  (Donovan  and  1996a). and t h e  and  72.5  purified  electrophoretic  mobility  mRNA d e c a y , i n the  (K , NH )  enzyme  is  most  (Shen and S c h l e s s i n g e r ,  i n RNase I I  exhibit  has  been  redundant.  discrete  absence of  12  divalent  Cudny and  against  to  of  mRNA d e c a y  these three  double  (Donovan and  mean  RNase one  the  1982).  are i n v i a b l e  interpreted  the  1996a).  a m i l d phenotype,  PNPase a n d RNase E as although  1978;  reactive  to  of  f o r maximal  +  4  Ghosh and D e u t s c h e r ,  near  predicts  and r e q u i r e s +  1983;  to  kDa (Coburn a n d M a c k i e ,  cations  29  sequenced,  The DNA s e q u e n c e  monomeric f o r m ,  at  Kushner,  gene has been c l o n e d and  functionally  along with  accumulate  and  i n PNPase and RNase I I This  are  acts  releasing  and m o n o v a l e n t  2+  (Gupta e t  Deutscher,  in its  Mn )  2+  and  exoribonucleolytic  a p p r o x i m a t e l y 70 kDa, w h i c h c o r r e s p o n d s  p r e d i c t e d m o l e c u l a r mass o f The enzyme  major  over-expressed  amino a c i d s ,  p u r i f i e d RNase I I  the  chromosome  (Coburn and M a c k i e ,  a p r o t e i n of  ions  end  encoded  1995).  RNase  is  Cannistraro  It  the  II)  extracts,  the  1982;  Mackie,  et  (RNase  cell-free  Schlessinger,  Zilhao  II  II the  that has  these been  principal  intermediates  enzymes s u g g e s t  that  other d e g r a d a t i v e enzymes may a l s o e x i s t  (Arraiano  Unexpectedly, both RNA-OUT (Pepe e t al.,  1994)  e t al. ,  (Hajnsdorf  1994b) a r e s t a b i l i z e d  e t al.,  1988).  and the rpsO  i n strains  containing  a c t i v e RNase I I r e l a t i v e to otherwise i s o g e n i c rnb mutants. l e d to the hypothesis that RNase I I , or other RNA b i n d i n g could  a c t as r e p r e s s o r s  substrate  II  This  proteins,  of d e g r a d a t i o n by remaining bound t o the  when they encountered a s t a b l e stem-loop s t r u c t u r e , as  found i n the 3' end of RNA-OUT, rpsO mRNA, al.,  mRNA  1994).  However, recent  procesively  in vitro  and others  (Causton e t  s t u d i e s have shown that RNase  removes mononucleotides  from the 3 ' ends of RNAs  u n t i l a stem-loop i s encountered; i t then d i s s o c i a t e s l e a v i n g up to 10  unpaired  residues  a t the 3' end (Coburn and Mackie,  Such RNAs cannot b i n d thus become " r e s i s t a n t "  e i t h e r RNase I I o r PNPase e f f i c i e n t l y and to exonuclease a c t i o n  (Coburn and Mackie,  1996b).  I t remains to be seen i f RNase I I a s s o c i a t e s  proteins  in vitro  1.4  o r in  1996b).  with  other  vivo.  T H E "DEGRADOSOME"  COMPLEX  Along with the evidence that the Rne/Ams p r o t e i n i s c e n t r a l i n p r o k a r y o t i c mRNA decay, s e v e r a l f i n d i n g s have suggested that i t i s part  of a l a r g e r f u n c t i o n a l p r o t e i n complex t h a t has been termed  the "degradosome".  F i r s t , g e l f i l t r a t i o n chromatography of Rne/Ams  from crude e x t r a c t s i n m i l d c o n d i t i o n s has r e v e a l e d that i t i s p a r t of  a protein  complex o f approximately 2500 kDa m o l e c u l a r weight  (Niguma and Mackie, unpublished o b s e r v a t i o n s ) .  13  Secondly,  efforts  to p u r i f y  RNase E b y c o n v e n t i o n a l methods  RNase E a c t i v i t y c o - p u r i f i e d w i t h PNPase which  is  commonly t h o u g h t  terminal  stages  characterize stem-loop  of  to  mRNA  scavenge  decay.  results  PNPase.  implied  Additional  subsequently, (Py e t Miczak  al., et  the  a  a barrier  strong  components  the  i n c l u d i n g the p u t a t i v e 1996;  al.,  al. ,  1996).  are  unclear,  Miczak  1996),  et  uncertain.  and  their  the  to  REP m o t i f ,  al.,  the  between  enolase  to  of  the  mRNA  degradosome  stable  Together  Rne/Ams and identified  (Py e t  RhlB  al.,  DnaK  1996;  (Miczak  latter  et  components  decay  in  vivo  is  appear  to  exist  as  Brilliant  B l u e - s t a i n e d SDS-PAGE g e l s r e v e a l t h a t t h e degradosome i s  16% RNase  28% PNPase,  1.4.1  analysis  to  of Coomassie  E,  densitometric  at  identified  1994).  shock p r o t e i n ,  the  1994),  a  complex have b e e n  significance  of  ,  attempting  mRNA d e c a y ,  (Py e t  1996),  relevance  The components  multimeric proteins:  al.,  al.  that  "DEAD-box" RNA h e l i c a s e ,  and t h e h e a t  The f u n c t i o n a l  study  association  of  finding  mRNA f r a g m e n t s a  t h e p r o t e i n c o m p l e x bound t o  s t r u c t u r e which i s  the  (Carpousis et  Third,  b o t h Rne/Ams and PNPase i n t h e complex these  l e d to  11% R h l B and 18% e n o l a s e  (Py e t  1996).  RNA h e l i c a s e s The  presence  of  an  RNA h e l i c a s e  in  combination  e n d o r i b o n u c l e a s e Rne/Ams and t h e e x o r i b o n u c l e a s e presents in  al.,  the  which  fragments, unwind  the  satisfying RNase  scenario  E activity  and PNPase d i g e s t s  i n h i b i t o r y secondary  of  the  substrate  t h e remnants w i t h t h e structure(s).  the  PNPase i m m e d i a t e l y  a protein degradation  cleaves  14  with  complex  into  small  a i d of RhlB  However,  there  is  to no  direct  evidence  encodes  a  including 1989;  t h a t R h l B does p o s s e s s h e l i c a s e  surprisingly large at  least  Kalman e t  containing  a  al.,  1991),  , 1989) .  Since  Rne/Ams  complex,  putative  a consequence  this  (DEAD)  (Linder  may  implicate DeaD and  of  RhlB SrmB,  ( l o s t and D r e y f u s s ,  o f an i n h e r e n t h e l i c a s e  et  al.  ,  proteins  sequence  T h r e e o f t h e s e DEAD-box h e l i c a s e s  one  coli  RNA h e l i c a s e s ,  RNA h e l i c a s e - l i k e  Asp-Glu-Ala-Asp  helicases,  P o l y ( A )  E.  coli  catalyzes 3'  al. ,  motif  appear  to  ( N i c o l and F u l l e r - P a c e , many s u b s t r a t e s in  another  have  1994),  of  the  role.  been  Two  reported  to  but whether t h i s  is  a c t i v i t y or other  properties  the  ends 1993;  and i s  p o l y m e r a s e  contains  a poly(A)  o f RNA ( D e u t s c h e r , Xu e t  al., of  3'-poly(A)  PAP I i s tails  1978;  1993) .  i n pcnB  adenylate  Cao and S a r k a r ,  PAP I i s  gene,  active  in  vivo,  (Cao and S a r k a r ,  b u t may be i n t e g r a l t o  which  residues  1992a,b;  a monomeric enzyme,  mapping a t  PAP I has n o t b e e n shown t o complex,  a d d i t i o n of  (PAP I)  a p p r o x i m a t e l y 55 kDa (Cao a n d S a r k a r ,  e n c o d e d b y t h e pcnB  , 1986) .  polymerase a c t i v i t y  template-independent  molecular weight  al.  a group of  family  E.  unclear.  1.4.2  to  "DEAD-box"  rRNA p r e c u r s o r s a r e  s t a b i l i z e mRNA d e c a y  is  potential  i n r i b o s o m a l assembly or f u n c t i o n  1995) .  other  i n the  conserved  ( L i n d e r e t al. function  five  number o f  activity.  3 minutes  He  et  with a 1992b),  (Lopilato  as mRNAs c a n be i s o l a t e d  et  with  1992a). associate  the  w i t h the  "degradosome"  r a t e o f mRNA d e c a y .  Mutations  c a u s e a r e d u c t i o n i n t h e p l a s m i d c o p y number b e c a u s e 15  of  the  slower  turnover  replication  of  RNA I ,  (Lopilato  et  the  al.  tail  t o RNA I s t i m u l a t e s i t s  (Xu  and  Cohen,  resistant  1995) .  mRNAs  ,  1986).  rate  The  has  been  of  Currently,  a r e no q u a n t i t a t i v e  of e i t h e r the  tail  b i n d i n g of 1996b;  substrate  of  RNase  II  3'  of  the  poly(A)  provides  shown  to  be  (Coburn  and  an  tail.  It  of  by  1996b).  the  affinity  has b e e n s u g g e s t e d t h a t  unstructured  L i t t a u e r and S o r e q ,  1982),  digestion.  and p o l y a d e n y l a t i o n  1.4.3  O t h e r  3'  end  which  or  it  may a l s o  Thus,  which processes  shown  to  also  process  stabilize  it  ( A l i f a n o et  produce  endonucleolytic  ( C a n n i s t r a r o and K e n n e l l , a non-specific  redistribute the  the  assists  the  1996a and  facilitate  the  impeding  exo-  may  for degradation  be  a  parallel  (Ciechanover,  disposal.  enzymes  P,  be RNase I ,  there  w h i c h marks mRNA f o r  Rnase  Clearly,  fold  assisted  Mackie,  measurements  between u b i q u i t i n w h i c h t a g s p r o t e i n s  been  poly(A)  otherwise  e x o n u c l a s e s t o t h e mRNA (Coburn and M a c k i e ,  endonucleolytic  1994),  a  on  b i n d i n g o f RNA h e l i c a s e s t o t h e s t e m - l o o p s s t r u c t u r e s and  of  plasmid  e x o n u c l e a s e f o r p o l y a d e n y l a t e d mRNA s u b s t r a t e s b e c a u s e o f  lability  poly(A)  of  o f d e g r a d a t i o n b y PNPase 4-5  polyadenylation there  regulator  The a d d i t i o n  attack  also  the  anti-sense  to  the  the  the  al.,  5'  his  end o f  o p e r o n mRNA i n  1994).  in  although  A-U  ribonucleolytic  after  cell  enzymes  16  Salmonella  this  rich  and  lysis of  E.  that  is  (Deutcher, coli  to  sequences  enzyme may i n  periplasmic ribonuclase  cytoplasm  has  RNase M has b e e n p r o p o s e d  cleavages 1989),  tRNA p r e c u r s o r s ,  need  fact  known t o 1985). to  be  h a r a c t e r i z e d b e t t e r to understand  t h e i r a c t i o n and i n t e r a c t i o n i n  RNA metabolism.  1.5  NEW PERSPECTIVES  O N mRNA  DECAY  Mature mRNAs u s u a l l y c o n t a i n a h a i r p i n o r r e l a t e d  secondary  s t r u c t u r e a t t h e i r 3' ends, which b l o c k s the d i g e s t i v e a c t i v i t i e s of  RNase  I I and PNPase. i n E.  exonucleases  endonucleolytic access 1993)  coli,  or u n t i l  are generally  upstream  from  PAP I p o l y a d e n y l a t e s  1996a  on mRNA must and  Endonucleolytic  stable  until  the 3 ' terminus  allow  (Higgins e t al. ,  the 3' end t o f a c i l i t a t e  In prokaryotes,  also  be c o n s i d e r e d  translation  cleavage  no 5'->3 '  s t r u c t u r e (Xu and Cohen, 1995; Coburn and  and 1996b).  transcription  are apparently  t o the body of the mRNA  d i g e s t i o n past secondary  translation  there  mRNAs  cleavages  o f exonucleases  Mackie,  Since  sites  are  the e f f e c t because  often  bacterial  coupled  can be b l o c k e d  by  of  events.  translating  ribosomes, and mRNA decay r a t e s can be i n f l u e n c e d by the frequency of t r a n s l a t i o n a l i n i t i a t i o n and  translation  (Petersen, 1993).  a r e uncoupled,  mRNA  When t r a n s c r i p t i o n  synthesis  may be  largely  completed before a p p r e c i a b l e t r a n s l a t i o n occurs, l e a d i n g t o reduced s t a b i l i t y presumably s i n c e i t would be more exposed t o degradative endonucleases  (lost  and Dreyfus,  1995).  The "consensus"  model  i m p l i e s that the endonuclease d i g e s t i o n s occur i n a random f a s h i o n ; however,  there  i s evidence  of primary  s i t e s near the 5' end (Bechhofer, propagated  "wave"  endonucleolytic  1993), which t r i g g e r s a 5'->3'  of e n d o n u c l e o l y t i c cleavages 17  cleavage  (Hansen  e t al. ,  1994) .  coli  Several  functional  lifetimes,  mRNAs  with  such as ompA,  prolonged  p h y s i c a l and  e x h i b i t s t a b l e RNA secondary  s t r u c t u r e s a t t h e i r 5' ends which confer r e s i s t a n c e t o degradation (Emory and Belasco,  1990;  Emory et al. , 1992;  Hansen e t al.,  1994).  Adding a 5' s i n g l e - s t r a n d e d extension to the 5' h a i r p i n n e u t r a l i z e s RNase E r e s i s t a n c e  (Emory e t al.,  RNase E dependent degradation  1992), s u p p o r t i n g  a t E. coli  require a single-stranded region of random e n d o n u c l e o l y t i c the o b s e r v a t i o n half lives digestion  evidence t h a t  mRNA 5' ends appears t o  (Hansen e t al.,  1994).  The i d e a  d i g e s t i o n has been d i s p e l l e d f u r t h e r by  t h a t longer mRNAs do not n e c e s s a r i l y have s h o r t e r  (Belasco, 1993), which would not be p o s s i b l e i n a random scenario.  A " t e t h e r i n g " model f o r the degradosome (G.A.  Mackie, p e r s o n a l  communication) e x p l a i n s the current f i n d i n g s as f o l l o w s : the m u l t i enzyme degradosome complex i n i t i a t e s mRNA decay by b i n d i n g s i t e proximal secondary  t o the 5' end i n a r a t e - l i m i t i n g step,  structure  Bouvet and Belasco,  a t the extreme  1992; Hansen e t al.,  from t r a n s l a t i o n a l i n i t i a t i o n 1994).  5' end (Chen  (Petersen,  at a  i n h i b i t e d by  e t al. , 1991;  1994) and by c o m p e t i t i o n 1992;  Rapaport and Mackie,  The i n i t i a t e d RNase E complex i s t e t h e r e d t o the s u b s t r a t e  by the strong RNA b i n d i n g domain of the Rne p r o t e i n (Miao, p e r s o n a l communication).  The f i r s t  s i n g l e - s t r a n d e d A+U r i c h mRNA sequence  would then migrate, without s i g n i f i c a n t d i s s o c i a t i o n , t o a second Rne  subunit  endonucleolytic  in  a  form  cleavage  of  "pseudo-processivity" .  catalyzed  18  by  Rne would  leave  Each mRNA  fragments in to  with  3  ends s u i t a b l e  1  some c a s e s o n l y a f t e r facilitate  Cohen,  their  1995).  for  prior  oligoadenylation  binding  When t h e  PNPase o r RNase I I  (Coburn  RNase  E complex  s t e m - l o o p s t r u c t u r e on t h e  substrate,  unwind  the  RhlB.  it,  possibly  with  Tightly folded  unfolded  by  the  polyadenylation degradation.  of In  the an  3'  the  into  the  substrate  poly(A)  tail  cleavage  by  would RNase  polyadenylated, latter s u c h as  E,  and t h e  theory f a i l s ompA,  be  3'  et  complex  direction,  pathway  c a n be  PNPase  to  to  3'  decay  ( C o b u r n and M a c k i e , (Meyer a n d S c h o t t e l ,  1996b)  in for  vivo the  1992).  19  (Mackie,  or  PNPase  proposed  already present  on  shortening  end  of  the  endonucleolytic which al.,  could  1995). of  untranslated al.,  largely  1989)  be The  substrates region  1994).  from the  and  An  fragments  m e d i a t e d b y e x o n u c l e a s e s a n d PAP I a c t i v i t y . demonstrated  be  of  mRNAs and t h e is  or  'loading'  (Hansen e t  smaller  where  allow  Kushner  (O'Hara et  degradation  internal  degradosome,  upstream  a h i g h l y s t r u c t u r e d 5'  d i g e s t e d b y RNase E c l e a v a g e , >5'  the  Sidney  new  and  end o f mRNA may a l s o  w h i c h was  a  Xu  RNA h e l i c a s e ,  t h e mRNA a l l o w e d  repeated  may a p p l y  an  end  s k i p over i t  putative  sufficient  by  new 3'  1996b;  encounters  with  1995).  accompanied  cycle  3'  theory,  generating  Mackie,  to e x p l a i n the extended s t a b i l i t y  w h i c h has  pathway  the  end o f  al. ,  i m p e d i n g RNase E - d e p e n d e n t alternative  the  end may be  degradation (O'Hara  of  at  alternative  the  i t may e i t h e r  associated  t h a t p o l y a d e n y l a t i o n of the PNPase  aid  structures  RhlB  and  of  digestion,  3'This  in  vitro  S20 mRNA and i m p l i e d i n  others  Significant of  recent progress  t h e mRNA d e c a y p r o c e s s  macromolecules interaction purpose  of  i n E.  involved.  of this  the  has been made i n t h e coli,  However,  enzymes  s t u d y was  the b e s t  the  Rne/Ams a n d PNPase a s s o c i a t i o n 1994;  Py e t  sensitive disrupt  al.,  mutants  have  interfere studies,  I  the  deletion  found  with  1996;  at  interactions  others  within  c h a r a c t e r i z e d of  identify  for  al.,  PNPase  attempted  5'  with that  to  end  little  the  in  is  the  C-terminal  binding  al.,  define  a  et  deletions et  specific  al.,  in  20  their  vitro.  on Rne/Ams  1994;  The  Py  been  shown  al.,  1994),  of  Rne/Ams  to  of  to  while  In  PNPase b i n d i n g a series  et  temperature  1996).  ability  The  interactions,  al.,  1996).  by c h a r a c t e r i z i n g  conditions  et  Rne/Ams h a v e  (Kido  about  degradosome.  enzyme  (Carpousis  of  known  a binding region  (Carpousis  and m o n i t o r i n g  PNPase u n d e r v a r i o u s  the  degradosome  PNPase  Rne/Ams p r o t e i n  mutants,  the  Miczak et  the  particularly in defining  involved  to  understanding  also these  domain Rne/Ams  associate  with  C h a p t e r  MATERIALS  2.1  2  AND  METHODS  REAGENTS  Bacto-tryptone purchased  from  bacto-yeast  (  Difco  extract  Laboratories.  and  bacto-agar  Ampicillin,  were  carbenicillin,  a p r o t i n i n , p e p s t a t i n A, l e u p e p t i n , PMSF and lysozyme were o b t a i n e d from  Sigma.  Agarose,  persulfate,  TEMED,  urea  acrylamide, and  EDTA  (3-mercaptoethanol,  Laboratories.  obtained from F i s h e r S c i e n t i f i c . were bought 3  H-poly(A)  Promega.  from Pharmacia.  bis-acrylamide,  were DTT  purchased and  ammonium  from  Triton  Bio-Rad  X-100  Deoxy and d i d e o x y - r i b o n u c l e o t i d e s  [a- P]-CTP, 32  were purchased from Amersham.  [a- P]-ATP, 32  35  S-dATP and  IPTG was o b t a i n e d from  A l l o t h e r reagents were of reagent grade o r h i g h e r and  were o b t a i n e d from F i s h e r , Bio-Rad, BDH,  Pharmacia o r Sigma.  Taq DNA polymerase, T4 DNA l i g a s e , T7 RNA polymerase, Hind  III,  Hinc  II,  Bam HI,  from e i t h e r Pharmacia,  Nde I,  Xho I,  Biogel  Al.5m  (100-200 mesh) and B i o g e l  (Blue dextran, t h y r o g l o b u l i n ,  Incomplete  A15m  instructions. (100-200 mesh)  P r o t e i n molecular weight standards f o r  a l d o l a s e , and bovine serum albumin) were from Freund's  RI,  Promega, New England B i o l a b s or Boehringer  were obtained from Bio-Rad. filtration  Eco  and DNase I were purchased  Mannheim and used a c c o r d i n g to each manufacturer's  gel  were  Adjuvant  was  Immobilon P t r a n s f e r membrane was bought  21  ferritin,  catalase,  Pharmacia.  purchased  from  Sigma.  from M i l l i p o r e , w h i l e ECL  reagents  were  obtained  from  Amersham.  Protein  A  affixed  to  Sepharose beads were from Pharmacia. K o d a k X-Omat AR f i l m was u s e d f o r  2.2  VECTORS,  2 . 2 . 1  STRAINS  AND  autoradiography.  MEDIA  V e c t o r s  The p l a s m i d  pET-3xc (Appendix  1) h a s a n a m p i c i l l i n r e s i s t a n c e  g e n e , a T7 p r o m o t e r , a n d f u s e s a 12 amino a c i d T7 gene peptide t o t h e N-terminus o f t h e p r o t e i n o f i n t e r e s t al.,  1990).  a 11 lac  pET-24b ( A p p e n d i x  10  leader  (Studier, et  2) h a s a k a n a m y c i n r e s i s t a n c e g e n e ,  promoter, a n d p e r m i t s a C - t e r m i n a l f u s i o n o f a c l o n e d open  r e a d i n g frame t o a C - t e r m i n a l  His-Tag.  The p l a s m i d p E P a l 8 c o n t a i n s t h e c o d i n g s e q u e n c e f o r a H i s - t a g PNPase  fusion  laboratory. 14b,  which  promoter All  protein,  a n d was  I t i scomprised contains  ( P y e t al.,  obtained  o f t h e f u l l pnp  an a m p i c i l l i n  from  CF.  Higgins'  gene c l o n e d i n t o p E T -  resistance  gene,  and a  T7  1994).  pET v e c t o r s a r e d e r i v e d f r o m pBR322 a n d u s e t h e T7 RNA  p o l y m e r a s e t o d i r e c t e x p r e s s i o n o f c l o n e d genes  (Studier, et  al.,  1990) .  2.2.2  B a c t e r i a l  Immediately the ,  E.  coli  A(lac-proAB),  S t r a i n s  after ligation,  a l l c l o n e s were t r a n s f o r m e d  s t r a i n JM109 ( F ' traD36, thi,  gyrA96,  lacl , q  ( N a l ) , endAl, r  22  lacT^ZAMlB, hsdRl7,  into  proA+B+Z relAl,  el4"  supE44,  recAl).  This  strain  is  capable  of  being  transformed  by  non-  s u p e r c o i l e d DNA e f f i c i e n t l y . A l l p l a s m i d s u s e d f o r p r o t e i n o v e r - e x p r e s s i o n were t r a n s f o r m e d into  the  E.  coli  s t r a i n BL21(DE3)  (F~ ompT,  hsdS ,  BL21(DE3)  l a c k s b o t h the  Ion  a n d ompT p r o t e a s e s ,  for  which c a r r i e s  the  T7 RNA p o l y m e r a s e  XDE3,  promoter c o n t r o l . the  a d d i t i o n of  2 . 2 . 3  NH4CI,  medium  to  and i s gene  E x p r e s s i o n o f T7 RNA p o l y m e r a s e  protein  per  glucose,  1 1  appropriate  (lOg  bacto-tryptone,  per 1 l i t r e ;  support the (Cormack,  LB b r o t h  MgCl  et  al.,  litre;  is  lysogenic  under  lacUV5  i n d u c i b l e by  GM402,  Na HP0 , 2  3g  4  1 mM a f t e r  KH P0 , 2  lg  4  autoclaving)  an o v e r - e x p r e s s o r  of  the  1993).  supplemented  after  extract  sterilization  cooled  to  c o n t a i n i n g a p l a s m i d of  support the  15g/litre  50  growth of  t h e LB b r o t h p r i o r of  about  bacto-agar. 50°C,  needed.  23  prior  of  interest.  transformed  the  LB  cells.  to a u t o c l a v i n g ,  After to  ug/mL  0.2%  ( a m p i c i l l i n , c a r b e n i c i l l i n , or kanamycin))  as  and  with  5g  antibiotic  a d d i t i o n of  thiamine,  and  10  4  ug/mL  5g b a c t o - y e a s t  mM MgS0 ,  I t was p r e p a r e d e x a c t l y  was  6g  added t o  (lOg b a c t o - t r y p t o n e ,  a g a r p l a t e s were u s e d t o  mixture  2  growth of  was u s e d t o grow o t h e r c e l l s  the  B  IPTG.  5g N a C l ,  was u s e d  NaCl  B  M e d i a  M9ZB  Rne  r " , m ~ (XDE3) ) .  B  autoclaving,  supplementation  with the as  2.3  OLIGONUCLEOTIDES  The o l i g o n u c l e o t i d e s w e r e s y n t h e s i z e d o n a n A p p l i e d B i o s y s t e m s 3 91 DNA S y n t h e s i z e r o r e q u i v a l e n t a n d w e r e r e s u s p e n d e d i n dH 0 a n d 2  s t o r e d a t -20°C.  2.4  RECOMBINANT  2 . 4 . 1  I s o l a t i o n  Plasmids LB  broth  o f  METHODS  p l a s m i d  were p r e p a r e d  using  (Birnboim  DNA  a  and Doly,  DNA  f r o m 3 5 mL s a t u r a t e d c u l t u r e s grown i n  modification  of the alkaline  1979) a n d p u r i f i e d  e t al.  (1989).  10 mL p l a s m i d  t h e W i z a r d Plus  performed using  method  e i t h e r by cesium c h l o r i d e  isopycnic c e n t r i f u g a t i o n o r ethanol p r e c i p i t a t i o n , Sambrook  lysis  Minipreps  as o u t l i n e d i n  purifications  were  Purification  also  System b y  Promega. 2 . 4 . 2  R e s t r i c t i o n  enzyme  d i g e s t i o n s  F o r e v e r y u g o f DNA t o b e d i g e s t e d , a p p r o x i m a t e l y r e s t r i c t i o n enzyme was added. mixed  with  appropriate  manufacturer's 2 . 4 . 3  separated  The DNA a n d r e s t r i c t i o n enzyme  buffer  o f  DNA b y  g e l  DNA a n d RNA f r a g m e n t s  10  the  enzyme  (<500 b p o r n u c l e o t i d e s )  _ 3  % TEMED  gels  were  (29:1 r a t i o  c o n t a i n i n g I X TBE b u f f e r (90mM T r i s ,  9 0 mM b o r i c a c i d a n d 2 mM NaEDTA). 2.4 x  to  e l e c t r o p h o r e s i s  b y e l e c t r o p h o r e s i s i n 6% p o l y a c r y l a m i d e  of a c r y l a m i d e : b i s - a c r y l a m i d e ) ,  and  according  were  specifications.  S e p a r a t i o n  Small  10 u n i t s o f  was a d d e d 24  6 x 10" % Ammonium p e r s u l f a t e 4  t o c r o s s l i n k the acrylamide.  E l e c t r o p h o r e s i s was performed a t 150 V u s i n g a Pharmacia Gene Power Supply  (GPS 200/400).  Separation agarose  of l a r g e r  dissolved  DNA  i n IX TAE b u f f e r  a c e t a t e and 1 mM NaEDTA). Pharmacia  fragments  was performed  (40 mM  Tris,  i n 0.8%  20 mM  sodium  E l e c t r o p h o r e s i s was performed  with a  GPS 200/400 s e t to approximately 0.12 amps.  DNA and RNA was v i s u a l i z e d i n both types of e l e c t r o p h o r e s i s by staining  with  ultraviolet 2 . 4 . 4  1  ug/mL  ethidium  bromide  and  viewing  under  light.  I n  V i t r o  a m p l i f i c a t i o n  o f  DNA  b y  t h e  P o l y m e r a s e  C h a i n  R e a c t i o n  100  pmol each  of forward and r e v e r s e primers were combined  w i t h approximately 2 0 ng of a l i n e a r template, 0.2 mM dNTPs, 1.5 mM MgCl , Mg-free b u f f e r 2  gelatin)  and  5  manufacturer's  (500 mM KCl, 100 mM T r i s - H C l  units/uL  Taq  polymerase  specifications.  Programmable Thermal  A  (pH 8.3), 0.1%  according  Hypercell  t o the  Biologicals  C o n t r o l l e r was used to perform the f o l l o w i n g  thermal c y c l e : 5 min @ 94°C, then 3 0 c y c l e s of 1 min & 48°C, 3 min &  72°C  and 1 min @  94°C.  Products  of PCR were  purified  by  e x t r a c t i o n w i t h equal volumes of chloroform/isoamyl a l c o h o l (24:1 ratio)  solution  ratio)  solution,  QIAquick  PCR  and phenol/chloroform/isoamyl followed  Purification  by  an  ethanol  K i t from  alcohol  (25:24:1  precipitation.  Qiagen  was  also  The  used  as  i n s t r u c t e d by the manufacturer. 2 . 4 . 5  L i g a t i o n s  60  ng of pET-3xc was mixed w i t h 25  equimolar  amounts  of the  appropriate  DNA  fragment,  along w i t h  1 mM  ATP, IX One-Phor-All  b u f f e r and 0.1 Weiss u n i t of T4 l i g a s e to a volume of 10 uL. The i n c u b a t i o n was performed a t 15°C o v e r n i g h t . 2.4.6  T r a n s f o r m a t i o n s  E.  coli  i n t o  E.  coli  c o m p e t e n t  s t r a i n s  s t r a i n s were rendered competent by a c a l c i u m c h l o r i d e  method d e s c r i b e d by Bio-Rad  Inc.  The c e l l s ,  s t o r e d as a 200 uL  g l y c e r o l stock at -70°C, were thawed and mixed with plasmid DNA and kept  on i c e f o r 60 min., f o l l o w e d by a 3 min shock  Approximately  1 mL of LB medium was added and the samples were  i n c u b a t e d a t 37°C f o r 1 hour. diameter  LB agar  antibiotic  a t 42°C.  plates  C e l l s were then spread onto 100-mm  c o n t a i n i n g 50 ug/mL of the a p p r o p r i a t e  (ampicillin, carbenicillin,  or kanamycin) and incubated  at 37°C o v e r n i g h t . 2.4.7  DNA  All  S e q u e n c i n g  c l o n e s were sequenced  by Sanger e t al.  u s i n g the dideoxy method developed  (1977) and B i g g i n et al.  (1983) .  Approximately 2-  3 ug of p l a s m i d DNA and 2 0 ng of o l i g o n u c l e o t i d e primer were used i n accordance w i t h the method of the Pharmacia The  3 5  and  T7 Sequencing K i t .  S - l a b e l l e d samples were heat-denatured i n 40% (v/v) formamide separated i n 8% acrylamide  (19:1, a c r y l a m i d e : b i s - a c r y l a m i d e )  sequencing g e l s c o n t a i n i n g 8 M urea i n TBE b u f f e r .  2.5  OVER-EXPRESSION  2 . 5 . 1  S o d i u m  D o d e c y l  AND PURIFICATION  S u l f a t e  OF  RECOMBINANT  P o l y a c r y l a m i d e  G e l s  Samples were combined with p r o t e i n sample b u f f e r  26  PROTEINS  (SDS-PAGE)  (60 mM  Tris-  HC1  ( p H 6 . 8 ) , 1 . 5 % ( w / v ) S D S , 2 5 mM DTT, 5%  Bromophenol  Blue)  preparations  4.5%  gels  SDS  performed  above  i n Laemmli's  through  buffer  separated  were  concentrated  volumes  of cold  2 . 5 . 2  boiling 3%  the  Electrophoresis  was  1 9 2 mM g l y c i n e , 0 . 1 % portion  gels  acid  were  solution.  volume  a n d 150-200  visualized  Dilute  by  samples  by precipitation with  5  were  assay-  from t h e pET plasmid-BL21(DE3)  cultures  them  with  of single clones  IPTG  taken  as stated  a t 0,  1,  2  system  i n 1 0 mL o f L B  previously. and 3  1 mL  hours  after  The c e l l s were c o l l e c t e d b y c e n t r i f u g a t i o n a n d l y s e d b y  i n 2 0 0 u L o f 2 X SDS s a m p l e b u f f e r  ( w / v ) S D S , 0 . 0 5 M DTT,  with  usable  over-expression  of culture  induction.  (w/v)  B l u e R250, f o l l o w e d b y d e s t a i n i n g  o v e r - e x p r e s s i o n  and inducing  aliquots  ( p H 6.8) a n d 0 . 1 %  layer.  SDS-PAGE  5% a c e t i c  was c o n f i r m e d b y g r o w i n g broth,  acrylamide:bis-acrylamide)  gel.  on  to a  An upper  acetone.  P r o t e i n  Protein  of  thestacking  s t a i n i n g w i t h Coomassie B r i l l i a n t a 5% ( v / v ) e t h a n o l ,  i n 10%, 12.5% o r 1 5 %  (w/v) SDS.  ( 2 5 mM T r i s ,  through  Protein  acrylamide:bis-acrylamide)  1 2 5 mM T r i s - H C l  the separating  Proteins  in  the proteins.  ( p H 8.8) a n d 0 . 1 %  theseparating  SDS) a t 70 v o l t s  volts  of  (36:1r a t i o  layer containing  was p o u r e d  (w/v)  (36:1r a t i o  4 0 0 mM T r i s - H C l  polyacrylamide  stacking  t o denature  were s e p a r a t e d b y e l e c t r o p h o r e s i s  polyacrylamide containing  then b o i l e d  (v/v) g l y c e r o l and  a microprobe proteins  were  (0.1 M T r i s - H C l ,  1 0 % (w/v) g l y c e r o l ) . A b r i e f  t i p was p e r f o r m e d separated  t o break  o n a n SDS-PAGE 27  p H 6.8,  sonication  DNA v i s c o s i t y ,  then  g e l as described i n  2.5.1. 2 . 5 . 3  C u l t u r e  All under  target  a n d  i n d u c t i o n  o f  genes were c l o n e d  the c o n t r o l  r e c o m b i n a n t  into  of T7 t r a n s c r i p t i o n  p r o t e i n s  pET plasmids  and p l a c e d  and t r a n s l a t i o n  signals.  C u l t u r e s were grown i n 12 5 mL of M9ZB media to an o p t i c a l d e n s i t y of 0.5 a t 600 nm. M9ZB  They were then d i l u t e d w i t h an equal volume of  c o n t a i n i n g ImM  continued  with  IPTG  vigorous  to achieve aeration  induction  for 3  hr.  and growth was The c e l l s  were  c o l l e c t e d by c e n t r i f u g a t i o n and washed i n 25 mL of B u f f e r A (60 mM Tris  (pH 7.6), 10 mM MgCl , 60 mM NH C1, 0.5 mM 2  glycerol).  4  EDTA, 5% (v/v)  The c e l l s were again c o l l e c t e d by c e n t r i f u g a t i o n ,  resuspended i n 4 mL B u f f e r A. i n h i b i t o r s and DNase  then  A f t e r supplementation w i t h p r o t e a s e  (0.1 mM DTT, 0.2 mM PMSF, 2 ug/mL a p r o t i n i n ,  0.8 ug/mL l e u p e p t i n , 0.8 ug/mL p e p s t a t i n A, and 20 ug/mL DNase I ) , the  cells  were  d i s r u p t e d by passage  pressure c e l l a t 8,000 p . s . i . x  through  an Aminco  French  The l y s a t e was c e n t r i f u g e d a t 30,000  g f o r 45 min, and the supernatant  (S30) was f r a c t i o n a t e d by  p r e c i p i t a t i o n with 26% (w/v) (NH ) S0 to y i e l d the AS26 f r a c t i o n as 4  described  by Mackie  expressed  p r o t e i n was resuspended  aforementioned 100  (1991) .  2  The . p e l l e t  4  c o n t a i n i n g the over-  i n 4 mL of B u f f e r A w i t h the  protease i n h i b i t o r s ,  and 1.2 M NH C1,  (1994).  4  i n a manner  and s t i r r e d w i t h 3% T r i t o n Xsimilar  to Carpousis  A 200,000 x g c e n t r i f u g a t i o n y i e l d e d a supernatant  et  al.  (S200)  c o n t a i n i n g the p r o t e i n s of i n t e r e s t . 2 . 5 . 4  C l e v e l a n d  The  protein  Mapping  bands  of  interest 28  were  excised  from  a 10%  polyacrylamide  g e l and  polyacrylamide  gel.  inserted  into  the  Each s l i c e was o v e r l a y e d  wells with  of  a  15%  1.0, 0.1, or  0.01 ug of crude chyraotrypsin i n p r o t e i n sample b u f f e r  (see s e c t i o n  2.5.1).  through 90%  The sample and protease were e l e c t r o p h o r e s e d  of the s t a c k i n g g e l , f o l l o w e d by a c u r r e n t allow protease d i g e s t i o n . polyacrylamide 2 . 5 . 5  FPLC  The c u r r e n t was then resumed, and the  g e l examined as d e s c r i b e d  A n i o n  and  stoppage f o r 3 0 min to  c a t i o n  exchange  i n s e c t i o n 2.5.1.  chromatography  on  the  P h a r m a c i a  s y s t e m  Native or d e l e t e d Rne p r o t e i n p u r i f i e d as d e s c r i b e d i n s e c t i o n 2.5.3, was d i l u t e d 1:10 i n . B u f f e r A MgCl , 2  60 mM NH C1, 4  (60 mM  Tris,  pH 7.6, 10 mM  0.5 mM EDTA, 5% (v/v) g l y c e r o l p l u s  protease  i n h i b i t o r s as d e s c r i b e d i n s e c t i o n 2.5.3) then loaded onto the FPLC SuperLoop. and  Chromatography through.the anion exchange Mono Q column  cation  identically,  exchange  on  the  Mono  S  column  a t a flow  r a t e of 1 mL/min.  were  performed  I n j e c t i o n of 10 mL of  sample was f o l l o w e d by 13 mL of b u f f e r 1 (10 mM Hepes, 1 mM EDTA, 0.1 mM PMSF, 0.5% (v/v) Genapol X-080, 40 mM NaCl). 28  mL,  buffer  injected ended  2  (identical  as an i n c r e a s i n g • g r a d i e n t  a t 0.75 M NaCl.  standard 2 . 5 . 6  These  1 except  until  conditions  1 M NaCl)  the s a l t  was  concentration  a r e a m o d i f i c a t i o n of  FPLC programs o u t l i n e d by Pharmacia. S i z e  Two  to B u f f e r  For the next  E x c l u s i o n  Pharmacia  C h r o m o t o g r a p h y  gel filtration  packed w i t h B i o g e l Al.5m  columns  (1 cm x  50 cm) were  (100-200 mesh) or B i o g e l Al5m  mesh), r e s p e c t i v e l y , a c c o r d i n g  (100-200  to procedures o u t l i n e d by Bio-Rad. 29  The c o l u m n s w e r e e q u i l i b r a t e d i n B u f f e r A a n d a s t a n d a r d c u r v e f o r e l u t i o n was d e t e r m i n e d u s i n g B l u e D e x t r a n (2000 k D a ) , t h y r o g l o b u l i n (669  kDa), f e r r i t i n  kDa),  (440 k D a ) , c a t a l a s e  (232 k D a ) , a l d o l a s e (158  a n d BSA (67 kDa) a s m a r k e r s .  2 . 5 . 7  I m m o b i l i z e d  Cultures media,  o f pEPal8  induced  2.5.3.  Cell  stated,  m e t a l  with  c h r o m a t o g r a p h y  i n B L 2 1 ( D E 3 ) w e r e g r o w n i n 125 mL o f L B  IPTG  lysates  i o n  and harvested  were  as o u t l i n e d  i n section  taken  t o t h e S3 0  stage  t h e n p u r i f i e d on H i s - B i n d  r e s i n using  t h e Novagen  Kit,  following a protocol described  al.  (1994) w i t h  a slight  as p r e v i o u s l y His-Bind  b y t h e m a n u f a c t u r e r a n d Py, e t  modification.  Initial  adsorption  was  formed b a t c h w i s e and t h e bound p r o t e i n c o l l e c t e d b y c e n t r i f u g a t i o n of  the resin-protein  centrifuge removed  tube.  with  stripping  were  a  complex  a t 600 x  g  i n a  The s u p e r n a t a n t c o n t a i n i n g pipette. performed  The s u b s e q u e n t  50 mL  plastic  u n b o u n d p r o t e i n s was washes,  i n a 5 mL c a p a c i t y  e l u t i o n and  disposable  plasic  c o l u m n a s recommended.  2.6  IMMUNOLOGICAL  2 . 6 . 1  P r e p a r a t i o n  o f  METHODS  a n t i g e n i c  p r o t e i n  f o r  r a b b i t  i m m u n i z a t i o n  Up t o 1 mg o f t o t a l p r o t e i n was s e p a r a t e d o n a 1 0 % o r 1 2 . 5 % SDS-PAGE g e l . with the  The p r o t e i n o f i n t e r e s t was i d e n t i f i e d b y s t a i n i n g  Coomassie B r i l l i a n t  B l u e R250 i n w a t e r ,  g e l was r e m o v e d a n d l y o p h i l i z e d .  crushed  i n a mortar  and p e s t l e  and that p o r t i o n o f  The d r i e d  and t h e equivalent  30  g e l s l i c e was o f 250 u g o f  p r o t e i n was suspended  i n 1 mL water.  An equal volume o f Freund's  Incomplete Adjuvant was s l o w l y added w i t h a g i t a t i o n on a benchtop shaker u n t i l a smooth emulsion was achieved. was  injected  into  8  week  o l d New  1 mL of t h i s emulsion  Zealand  white  rabbits  (approximately 4-5 kg) f o r the i n i t i a l immunization, and subsequent boosts were conducted every 3-4 weeks. 2 . 6 . 2  R a b b i t  All Centre, rabbit  b l e e d s  bleeds were performed University  of B r i t i s h  b l o o d was removed p r i o r  a f t e r each boost.  by the s t a f f Columbia.  a t the Animal  Care  A minimum o f 10 mL of  t o the i n i t i a l  immunization, and  A f t e r three immunizations, a f u l l body b l e e d was  obtained. A l l bleeds were allowed to c l o t a t 37°C f o r 2 hours. The c l o t was  then separated from the sides of the c o l l e c t i o n v e s s e l and the  b l e e d s t o r e d a t 4°C o v e r n i g h t .  The f o l l o w i n g day,  the serum was  removed from the c l o t and any remaining i n s o l u b l e m a t e r i a l removed by c e n t r i f u g a t i o n a t 10,000 x g f o r 10 min a t 4°C, as d e s c r i b e d by Harlow & Lane (1988). inactivation  The serum was prepared f o r s t o r a g e by heat  a t 56°C f o r 35 min, f o l l o w e d by the a d d i t i o n  equal volume of g l y c e r o l . or  o f an  The prepared serum was s t o r e d a t -20°C  -70°C.  2 . 6 . 3  W e s t e r n  b l o t s  Separation of p r o t e i n s on 10% or 12.5% electrophoretic alkaline  transfer  carbonate b u f f e r  SDS-PAGE g e l s , and wet  to n i t r o c e l l u l o s e (10 mM NaHC0 , 3  methanol) f o r 2 h r s was performed 31  o r Immobilon  3 mM Na C0 , 2  3  i n a manner s i m i l a r  20%  P in (v/v)  t o t h a t of  Harlow & Lane (1988). 5%  c a s e i n i n PTBN  The membrane was blocked w i t h a s o l u t i o n of  (0.002 M sodium phosphate  (pH 7.0), 5 x 10" % 4  (v/v) Tween 20, 0.1% (w/v) BSA, 1 mM Na a z i d e , 0.85% (w/v) N a C l ) . Exposure to primary antibody was a minimum of 1.5 hours, and to the secondary conjugate)  antibody  (goat a - r a b b i t IgG (H+L)-horseradish  a minimum 0.5 hours.  A l l washes were done i n Phosphate  B u f f e r e d S a l i n e (PBS) (Sambrook et al. , 1989). a n t i b o d y b i n d i n g was performed  peroxidase  V i s u a l i z a t i o n of  by ECL u s i n g the Western B l o t t i n g  A n a l y s i s System K i t from Amersham. 2.6.4  A n t i b o d y  s t r i p p i n g  Membranes were submerged i n a s o l u t i o n of 62.5 mM T r i s - H C l (pH 6.8),  2% (w/v) SDS, and 0.1 M (3-mercaptoethanol  3 0 min, with a g i t a t i o n .  warmed to 50°C f o r  The s t r i p p e d membranes were washed 2 times  i n PBS, then r e b l o c k e d w i t h PTBN + 5% c a s e i n f o r 1 hour. 2 . 6 . 5  F a r - W e s t e r n  b l o t t i n g  Far-Western b l o t t i n g was performed the f o l l o w i n g e x c e p t i o n s :  as i n s e c t i o n 2.6.3, w i t h  a f t e r membrane b l o c k i n g w i t h 5% c a s e i n  i n PTBN, the membrane was washed twice w i t h PBS, then exposed to h i g h l y p u r i f i e d PNPase (approximately 25 ug/mL), s u p p l i e d by G.A. Coburn, f o r 1 hour a t 37°C. with  PBS,  then  exposed  The membrane was a g a i n washed twice  to a n t i b o d i e s as d e s c r i b e d  f o r Western  blots. In the i n i t i a l the  highly purified  Far-Western b l o t t i n g PNPase was performed  experiment, i n 2 mL  c a s e i n (see s e c t i o n 2.6.3), PBS (see Sambrook et al.,  32  exposure to o f PTBN + 5% 1989), B u f f e r  A  (see s e c t i o n  1989).  2.5.5) o r D e n h a r d t ' s s o l u t i o n  Subsequent  ( s e e Sambrook e t  F a r - W e s t e r n s w e r e p e r f o r m e d i n 2 mL o f PBS.  33  al.  TABLE 1 O l i g o n u c l e o t i d e s  Coord  Oligo Name  Orien tation  Sequence  KNlf  Forward  5 ' GGAAACCGGCAGGATCCCTCGTCAGGCT 3'  pnp  KNlb  Reverse  5 ' TTGTTTGTCGGGGATCCGGTAAGCATCG 3'  pnp  KN2f  Forward  5 ' CGTGCTGGCAGGGATCCCGGATATGGAC 3'  pnp  KN2b  Reverse  5 ' TTGAGAGATGTGGATCCGACCTTCTTTAC 3'  pnp  T7 Prom.  Forward  5 ' TTAATACGAC TCAC TATAGGG 3'  Rne C216a  Reverse  5 ' TGAC GTAAGTACTCGAGGAATGC GC GAAC 3'  rne  Rne C216b  Reverse  5 ' CGTAAGTACTCGAGGAATTCGCGAACGATTACG 3'  rne  1. and  1  The b a s e s m a r k e d i n b o l d a r e t h e e n g i n e e r e d r e s t r i c t i o n t h e bases u n d e r l i n e d d i f f e r from t h e n a t i v e sequence.  2  54 792 1230 1959  671 668  sites  2. The c o - o r d i n a t e s g i v e n a r e c o m p l e m e n t a r y t o t h e 5' r e s i d u e o f the p a r t i c u l a r o l i g o n u c l e o t i d e .  34  C h a p t e r  3  RESULTS  3.1  ANTIBODY  GENERATION  3 . 1 . 1  G e n e r a t i o n  o f  a n t i b o d i e s  a g a i n s t  a n t i g e n i c  s i t e s  i n  PNPase  The  f i r s t o b j e c t i v e of these s t u d i e s was t o c r e a t e p o l y c l o n a l  a n t i b o d i e s d i r e c t e d against s p e c i f i c regions of the PNPase p r o t e i n . By  optimally  over-expressing  the two most  antigenic  sites i n  PNPase, I attempted to generate high t i t r e s of a n t i b o d i e s that were highly  specific.  The l a c k of any three dimensional s t r u c t u r e i n f o r m a t i o n us  to p r e d i c t antigenic  P l o t S t r u c t u r e modelling The  first  antigenic  forced  s i t e s based on the P e p t i d e S t r u c t u r e  and  program (Jameson and Wolf, 1988) ( F i g . 1) .  site  selected  (SI) i s c l o s e  t o the amino-  t e r m i n a l end of the p r o t e i n , and spans amino a c i d s 23 t o 260. The second a n t i g e n i c  site  (S2) i s towards the carboxy t e r m i n a l , and  covers amino a c i d s 415 to 649. The n u c l e o t i d e sequences of the pnp gene c o r r e s p o n d i n g to these a n t i g e n i c s i t e s were a m p l i f i e d by PCR u s i n g o l i g o n u c l e o t i d e s that add f l a n k i n g Bam HI r e s t r i c t i o n (Table  1).  polycloning site,  The site  amplified  of pET-3xc  sequences  were  ligated  sites  i n t o the  (Novagen; Appendix 1) a t i t s Bam HI  and i n s e r t i o n of sequences i n t o the proper o r i e n t a t i o n was  confirmed by DNA sequencing  (data  named p S l and pS2, r e s p e c t i v e l y . 35  not shown) .  The clones  were  Figure 1. Antigenic site predictions in PNPase from the primary structure. The nucleotide sequence of the a-subunit of PNPase (Regnier etal., 1987) was analysed by the Sequence Analysis Software Package (GCG Package, Version 7) by Genetics Computer Group Inc. The PeptideStructure and PlotStructure programs (Jameson and Wolf, 1988) used the sequence information to predict a secondary structure for the protein. Antigenic sites are predicted based on the hydrophilicity and the secondary structure of the polypeptide chain in a given region, and are shown as a region surrounded by an octagon, a-helix regions are indicated by a sine wave, and P-sheet regions by a sharp, sawtooth wave. Coiled regions are represented as a dull, sawtooth wave, and turns in the polypeptides are shown as a 180° turn in the line.  36  Figure 2 . Over-expression and identification of proteins containing the two antigenic regions of PNPase. (a) 1.0 uL of extracts of BL21(DE3) containing pSl (lane 2) and pS2 (lane 3) were separated on a 10% polyacrylamide gel after induced over-expression of PNPase antigenic site 1 (SI) and site 2 (S2), respectively (see Sec. 2.5.3). The approximate molecular weights of the over-expressed proteins are indicated on the right, based on the migration of the standard proteins in lane 1. (b) Analysis of the components of the SI doublet by Cleveland mapping (See Sec. 2.4.4). Lanes 2-5 contain the upper band of the SI doublet combined with 0, 1.5, 1.0 and 0.1 iig of chymotrypsin, respectively. Lanes 6-9 contain the lower band of the SI doublet exposed to 0, 1.5, 1.0 and 0.1 pg of chymotrypsin, respectively. Products were separated by electrophoresis on a 15 % polyacrylamide gel. A, B and C indicate the common migration point of three polypeptides.  38  (a)  12 3 200 kDa 116 kDa 97 kDa  66 kDa 45 kDa  35 kDa  31 kDa  21.5 kDa 14.5 kDa 6.5 kDa  (b) 1 2 3 4 5 6 7 8 9 200 kDa  '  39  31 kDa  Figure 3. Detection of T7 genelO-PNPase fusion proteins by Western blotting, (a) An extract of BL21(DE3) (pSl) over-expressing PNPase antigenic site 1 (SI) was separated by SDS-PAGE and blotted onto nitrocellulose (See Sec. 2.5.3). Lane 2 shows an SDS-PAGE separation of the cell extract before blotting onto nitrocellulose. Lanes 4-8 show the chromogenic visualization of the SI protein on the nitrocellulose using a serial dilution of the a-Sl antibody (1:8000, 1:16000, 1:32000, 1:64000 and 1:128000 dilution, respectively), (b) An extract of BL21(DE3) (pS2) over-expressing PNPase antigenic site 2 (S2) was separated by SDS-PAGE and blotted onto nitrocellulose. Lane 2 shows the separated cell extract prior to nitrocellulose blotting, visualized by staining with Coomassie Blue. Lanes 4-8 show the chromogenic visualization of the S2 protein on nitrocellulose by a serial dilution of the a-S2 antibody (1:8000, 1:16000, 1:32000, 1:64000 and 1:128000 dilution, respectively). Lane 3 in (a) and (b) contains extracts of BL21(DE3) that over-express RNase E (i.e. GM402), used as a negative control. Lane 1 in (a) and (b) contains standard protein markers.  40  (a)  41  Both p S l and pS2 were transformed i n t o BL21(DE3) and c u l t u r e s d e r i v e d from i n d i v i d u a l c l o n e s grown and induced w i t h IPTG (Sec. 2.4.6).  E x t r a c t s were separated on 10% acrylamide g e l ( F i g . 2 ( a ) ) .  F i g . 2(a) shows strong bands of the a n t i c i p a t e d s i z e of T7 genelOPNP  f u s i o n s d e t e c t e d from c l o n e s h a r b o u r i n g p S l and pS2.  antigenic  p r o t e i n was over-expressed as a doublet, which  concerns address  about this  whether both point,  bands were d e r i v a t i v e s  a C l e v e l a n d mapping  p r o t e a s e chymotrypsin was performed. the  upper  band  raised  of S I .  experiment  To  u s i n g the  As seen i n F i g . 2(b), both  (lanes 2-5) and lower  p a r t i a l d i g e s t i o n products  The SI  band  (lanes 6-9) y i e l d e d  (A, B, C) of low m o b i l i t y .  The common  d i g e s t i o n p r o f i l e of both over-expressed bands i n d i c a t e that they are comprised of e s s e n t i a l l y the same amino a c i d  sequence.  The over-expressed a n t i g e n i c p r o t e i n s were prepared and used for  immunization  shows  that  of r a b b i t s as o u t l i n e d  the serum  from  contained high t i t r e s boosts.  Other  rabbits  i n S e c t i o n 2.6.  immunized  a g a i n s t SI and S2  of a - S l and a-S2, r e s p e c t i v e l y ,  proteins  from  the c e l l  Fig. 3  extracts  a f t e r two  of a Rne over-  expressor d i d not c r o s s r e a c t with the a n t i b o d i e s ( F i g . 3, lane 3 ) . Data  provided l a t e r  (e.g. F i g . 8(d)) show that  a-Sl  recognizes  n a t i v e PNPase. 3 . 1 . 2  G e n e r a t i o n  o f  a n t i b o d i e s  a g a i n s t  a  H i s ( 6 ) - P N P a s e  f u s i o n  p r o t e i n  During the course of these s t u d i e s , members of C h r i s t o p h e r F. Higgins'  laboratory  were a b l e  to p u r i f y  a His(6)-PNPase  fusion  p r o t e i n to near homogeneity u s i n g Novagen's His-Tag p u r i f i c a t i o n 42  Figure 4. Purification of over-expressed His(6)-PNPase by metal ion chelate chromatography. Extracts of BL21(DE3) (pEPcd8) containing over-expressed His(6)-PNPase were purified to the S30 stage (see Sec. 2.4.3), then exposed to activated N i  2 +  His-Bind resin (Sec. 2.4.6). Unbound His(6)-PNPase was  removed by gravitational elution from a column (Lane 2), initially with 5 m M imidazole ["Binding Buffer" wash] (Lane 3) and subsequently with 60 m M imidazole ["Wash Buffer" wash] (Lane 4). This was followed by 15 mL of 1M imidazole ["Elution Buffer" wash] (Lanes 5-19), and removal of the N i by 100 m M E D T A ["Strip Buffer" wash] (Lanes 20-25). The proteins in each lane were precipitated with acetone from 25 u L (Lane 2), 134 u L (Lane 3), 85 u L (Lane 4), 26 u L (Lanes 5-19) and 200 u L (Lanes 20-25) of eluant, then separated on a 10% polyacrylamide gel.  43  2 +  44  Figure 5. Polyclonal antibodies raised against purified His(6)-PNPase detected by Western blotting. Extracts of strain BL21(DE3) (pEPal8) containing His(6)-PNPase were separated by SDS-PAGE, blotted to Immobilon P, and probed with rabbit pre-immune sera (Lanes 1-3), post-first immunization sera (Lanes 4-6), and post-second immunization sera (Lanes 9-11), as described in Sec. 2.5.3. Lanes 1, 4, 9 were exposed to a 1:500 antibody dilution, lanes 2, 5, 10 were exposed to a 1:1000 dilution, and lanes 3, 6, 11 were exposed to a 1:2000 dilution. Lane 8 shows the extract of BL21(DE3) (pEPal 8) containing over-expressed His(6)-PNPase (arrow) separated by SDS-PAGE and stained with Coomassie Blue, while lane 7 contains protein size standards.  45  46  protocol  (Py,  et  purification, antibodies The  and  ,  use  plasmid  I  1994).  this  d i r e c t e d against  pEPal8, was et al.,  al.  coding  fusion  attempted protein  for  It includes  to  the e n t i r e PNPase the  the f u l l  duplicate  generate  specific  fusion  F. H i g g i n s ' l e n g t h pnp  protein,  laboratory  w e l l as an N-terminal H i s - t a g . was  transformed  expressed affinity (Ni )  into  (Sec. tag  2.5).  chromatography  gel.  approximately 3-5 affinity  mL  column.  Most  of  fusion sequence  the  pEPal8  protein  overan  f u s i o n p r o t e i n by metal  ion  and  Fig.  served  as  as  (Novagen).  p r o f i l e of e l u t i o n of bound p r o t e i n s , polyacrylamide  the  His(6)-tag  f o r p u r i f i c a t i o n of the  chelation  2+  The  and  vector  translation signals  In these experiments, the  BL21(DE3)  (Py,  gene l i g a t e d i n t o  the BamHI c l o n i n g s i t e of pET-14b (Novagen; Appendix 2), a c a r r y i n g bacteriophage T7 t r a n s c r i p t i o n and  the  polypeptide.  His(6)-PNPase  obtained from C h r i s t o p h e r  1994).  to  4  depicts  t h e i r a n a l y s i s on a  His-PNPase had  eluted  are  associated  10%  after  of e l u t i o n b u f f e r had been passed through  A number of p r o t e i n s  the  with  the His-  PNPase and they e l u t e d i n roughly equimolar amounts, i n c l u d i n g a 85 kDa  p r o t e i n that may  and  a p r o t e i n band >2 00 kDa.  chelates  the N i  2 +  be PNPase, a 180 The  kDa  p r o t e i n that may  f i n a l buffer,  containing  and removes i t from the column matrix.  be  EDTA,  Fractions  20-25 i n F i g . 4 show that a small p o r t i o n of the His(6)-PNPase associated proteins  Rne  and  remained bound to the metal a f t e r the e l u t i o n  b u f f e r wash. As  described  in  Sec.  separated by SDS-PAGE and  2.6, 250  the  p u r i f i e d His (6)-PNPase  was  ug of p r o t e i n a f f i x e d to acrylamide 47  was  mixed w i t h Freund's Incomplete Adjuvant to form an emulsion.  T h i s was used to immunize a r a b b i t , and the s e r a obtained a f t e r two boosts  c o n t a i n e d h i g h t i t r e s of a-His-PNPase  ( F i g . 5 ) . Moreover,  these sera lacked a n t i b o d i e s that c r o s s - r e a c t e d with other E. proteins,  s i n c e these  s e r a d i d not d e t e c t  coli  (or b i n d to) any other  p r o t e i n s i n the c e l l e x t r a c t s .  3.2  Rne  DELETION  MUTANT  PROTEINS  A c o l l e c t i o n of rne d e l e t i o n mutant c o n s t r u c t s was c r e a t e d i n an attempt to l o c a t e important  domains, i n c l u d i n g those capable of  b i n d i n g PNPase, w i t h i n the Rne p o l y p e p t i d e . 3 . 2 . 1  Rne  N - t e r m i n a l  d e l e t i o n  m u t a n t s  O l i g o n u c l e o t i d e s that introduce an Xho I r e s t r i c t i o n s i t e a t the  3' end of the rne  gene, and a Nde I  i n t e r e s t were used to a m p l i f y  rne  site  a t the 5' end of  gene d e l e t i o n mutants by PCR.  These were u l t i m a t e l y l i g a t e d i n t o pET 24b, and over-expressed i n BL2KDE3).  Fig. 6 depicts  the s e t of N - t e r m i n a l l y  p r o t e i n s , c o n s t r u c t e d by X i n Miao  (Miao, p e r s o n a l  3 . 2 . 2  m u t a n t s  Rne  Fig.  C - t e r m i n a l  d e l e t i o n  6 a l s o shows the C-terminal  constructed  using  restriction  site  an o l i g o n u c l e o t i d e i n the 5'  d e l e t e d Rne  communication).  d e l e t i o n RneAC218 t h a t was that  introduced  end of the rne  gene  an Nde  I  a t the ATG  i n i t i a t i o n codon, and another o l i g o n u c l e o t i d e that c r e a t e d a Eco RI site  i n the rne  sequence corresponding  t o amino a c i d 218.  The  o l i g o n u c l e o t i d e s were used i n a PCR r e a c t i o n t o a m p l i f y the rne 48  Figure 6. A map of deleted Rne proteins. The complete Rne protein is pictured on top with its postulated functional domains indicated. Xin Miao's N-terminal deletion mutants are denoted as RneANxxx, while the C-terminal deletion mutant discussed in Sec. 3.2.2 is denoted as RneAC218.  49  Catalytic ams rne 1 N III  C404  V  Rne  —  V  RNA-Binding  1061 ~l  A  NTP-binding site, HSR 1  HSR 2  208 3 1 5  i 4 0 8  Acidic  C407  I I  A  RneAN208 RneAN315 RneAN408 RneAN608 RneAN722 RneAN813  •  I 6 0 8  i 7 2 2  I 8 1 3  218 RneAC218  50  sequence coding f o r the f i r s t  218 amino a c i d s (Sec. 2.3). T h i s  a m p l i f i e d DNA was d i g e s t e d a p p r o p r i a t e l y , l i g a t e d i n t o pET 24b, and transformed  E.  into  coli  strain  BL21(DE3)  (Appendix  2, F i g . 8 ) .  The accuracy of t h i s c o n s t r u c t i o n was confirmed by DNA  sequencing  (data not shown).  3.3  NATIVE  AND MUTANT  Rne-PNPase  INTERACTIONS  ASSESSED  BY C O -  CHROMATOGRAPHY  3 . 3 . 1  F r a c t i o n a t i o n  In  an  homogeneity, from c e l l  Rne-PNPase  to p u r i f y  on  i t was over-expressed  fragments  a n i o n  Rne  e x c h a n g e  protein  2  4  and  4  c e n t r i f u g a t i o n a t 200,000 x g.  to  near  (Sec. 2.5). The Rne was  X-100 and 1.2 M NH C1,  and other  c o l u m n .  i n BL21(DE3) and p r e c i p i t a t e d 4  by 3% T r i t o n  a n  the n a t i v e  l y s a t e s by 26% (w/v) (NH ) S0  solubilized membrane  effort  o f  unwanted  proteins  The r e s u l t i n g  ribosomes,  sedimented  supernatant  (S200)  was d i l u t e d i n B u f f e r A supplemented with protease i n h i b i t o r s , f r a c t i o n a t e d on an anion exchange m a t r i x  (Resource  by  then  Q, Pharmacia)  w i t h a 40 mM to 750 mM-NaCl g r a d i e n t (Sec. 2.5.5). F i g 7(b) shows an SDS-PAGE s e p a r a t i o n of the p r o t e i n s e l u t e d from the anion exchange matrix. distance,  corresponding  A p r o t e i n m i g r a t i n g a t the 180 kDa  to Rne, e l u t e s  from  the m a t r i x  through  almost a l l of the s a l t g r a d i e n t , accompanied by an 85 kDa p r o t e i n in  approximate  equimolar  u t i l i z i n g a-RNase E.  amounts.  F i g 7(c) i s a Western  The immunoreactive  s p e c i e s of approximately  180 kDa i n lanes 32-60 i s c l e a r l y the Rne p r o t e i n .  51  blot  F r a c t i o n s 34-46  Figure 7. Fractionation of enriched extracts of GM402 on an anion exchange column (Resource Q). The Rne protein was over-expressed in cultures of GM402 and precipitated from cell lysates using 26% (w/v) (NH ) S0 (Sec. 2.5). The protein was resolubilized by 3% Triton X-100 and 1.2 M NH C1, 4  2  4  4  centrifuged at 200,000 x g, diluted 10-fold, then fractionated on an anion exchange matrix with a 40 mM to 750 mM NaCl gradient (Sec. 2.5.5). (a) Ultraviolet absorption profile of the anion exchange column fractionation. 1.0 mL fractions were collected from the fractionation, numbered 1-64. The broad band of absorption in fractions 2-15 is largely due to Triton X-100, not protein. (b) Approximately 200 ng of protein from selected fractions was precipitated with 5 volumes of acetone, separated by SDS-PAGE and visualized with Coomassie Blue staining (Sec. 2.4.1). Lane S contains protein size standards used to identify Rne (migrating at the 180 kDa position) and PNPase (migrating at 85 kDa). (c,d) Western blotting using polyclonal antibodies raised against Rne (c) and PNPase SI (d) (Sec. 2.6). The selected fractions from panel (b) were separated by SDS-PAGE and blotted onto Immobilon P. The blot was probed first with a-Rne antibody (c), stripped of bound antibody (Sec. 2.6.4), then reprobed with a-PNPase SI antibody (d). The arrows in panels (c) and (d) indicate the migration point of Rne and PNPase, respectively.  52  53  (c)  54  c o n t a i n a >200 kDa p r o t e i n that r e a c t s with a-RNase E; t h i s p r o t e i n may be an o x i d a t i o n dimer of Rne. recognizes  In F i g 7(d), a - S l (which  PNPase) was used to confirm that the 85 kDa p r o t e i n from  F i g 7(b) was PNPase. 3.3.2  F r a c t i o n a t i o n  t e r m i n a l  In  an attempt  b y  d e l e t i o n  a n i o n  exchange  c h r o m o t o g r a p h y  o f  Rne  N -  m u t a n t s  to f r a c t i o n a t e PNPase and other  p r o t e i n s co-  p u r i f y i n g w i t h the Rne p r o t e i n , N-terminal d e l e t i o n mutants of Rne were p u r i f i e d as d e s c r i b e d  i n Sec. 2.5 and Sec. 3.3.1.  Since the  n a t i v e Rne p r o t e i n i s normally a s s o c i a t e d w i t h PNPase a f t e r p a r t i a l p u r i f i c a t i o n , a l o s s of PNPase a s s o c i a t i o n by a truncated Rne would suggest that an e s s e n t i a l PNPase b i n d i n g s i t e was An N-terminal a c i d s of Rne  d e l e t i o n mutant m i s s i n g  shows  corresponding represents protein 8(c))  the f i r s t  608  amino  (RneAN608) was f r a c t i o n a t e d i n a manner i d e n t i c a l to  that of the n a t i v e p r o t e i n 8(a)  deleted.  a  sharp  (Fig.8).  absorbance  to an abundant 100  In c o n t r a s t to F i g 7(a), F i g peak  in  kDa p r o t e i n .  fractions  34-35,  Fraction  39-40  a small peak of absorbance, and corresponds to a 85 kDa  i n the SDS-PAGE g e l .  Western b l o t t i n g  using  a-Rne ( F i g  and a - S l ( F i g 8(d)) confirmed that the 100 kDa p r o t e i n was  the d e l e t i o n mutant RneAN608,  and the 85 kDa p r o t e i n was PNPase.  F i g 8(c) a l s o shows a p o s s i b l e o x i d a t i o n dimer of RneAN608 that i s >200 kDa and c r o s s r e a c t s w i t h a-Rne, as w e l l as a s m a l l e r  protein  i n f r a c t i o n s 5-10 and 33-3 6 that c o u l d be a RneAN608 d e g r a d a t i o n product.  F i g 8(d) r e v e a l s a - S l r e a c t i n g with an 80 kDa p r o t e i n i n  f r a c t i o n s 42-48 that may be a PNPase d i g e s t i o n product. 55  Figure 8. Fractionation of partially purified extracts of RneAN608 on an anion exchange column (Resource Q). The RneAN608 protein was over-expressed in cultures of BL21 (DE3) and precipitated from cell lysates using 26% (w/v) (NH ) S0 (Sec. 2.5). The protein was resolubilized in 3% Triton X4  2  4  100 and 1.2 M NH C1, centrifuged at 200,000 x g, diluted by 1/10th, then fractionated on an anion 4  exchange matrix with a 40 mM to 750 mM NaCl gradient (Sec. 2.5.5). (a) Ultraviolet absorption profile of the anion exchange column fractionation. 1.0 mL fractions were collected from the fractionation, numbered 1-64. The broad band of absorption in fractions 2-15 is largely due to Triton X-100, not protein. (b) Approximately 200 ug of protein from selected fractions were precipitated with 5 volumes of acetone, separated by SDS-PAGE and visualized with Goomassie Blue staining (Sec. 2.5.1). Lane S contains protein size standards, used to determine the location of Rne (migrating at the 180 kDa position) and PNPase (migrating at 85 kDa). (c,d) Western blotting using polyclonal antibodies raised against Rne (c) and PNPase SI (d) (Sec. 2.6). The selected fractions from panel (b) were separated by SDS-PAGE (10% gel) and blotted onto Immobilon P. The blots were probed first with a-Rne antibody (c), stripped of bound antibody (Sec. 2.6.4), then reprobed with cc-PNPase SI antibody (d). The arrows in panels (c) and (d) indicate the migration point of RneAN608 and PNPase, respectively.  56  (c)  58  These r e s u l t s i n d i c a t e d that, i n c o n t r a s t to n a t i v e Rne, the majority  of RneAN608 e l u t e s from the anion exchange column i n  f r a c t i o n s 34-35, not evenly  over the e n t i r e s a l t g r a d i e n t .  a l s o apparent that l i t t l e PNPase i s present  Itis  i n f r a c t i o n s 34-35 ( F i g  8(d)); rather, most of the PNPase e l u t e s a t f r a c t i o n s 39-40, and a small  amount of i t appears from f r a c t i o n s 41 onwards  w i t h a small amounts of n a t i v e Rne and RneAN608  associated  (Fig 8 ( c ) ) .  Nearly  i d e n t i c a l p r o t e i n e l u t i o n p a t t e r n s were observed f o r a l l of the Nterminal  Rne  deletion  mutants  RneAN608,  and RneAN813) as d e t a i l e d i n F i g u r e s  3.3.3  Rne  C - t e r m i n a l  (Mono  Q)  and  (RneAN2 08,  d e l e t i o n  c a t i o n  m u t a n t  (Mono  S)  RneAN315,  RneAN408,  11-14.  f r a c t i o n a t i o n  e x c h a n g e  b y  a n i o n  c h r o m a t o g r a p h y  To determine the r o l e of the f i r s t 200 amino a c i d s of the Rne p r o t e i n i n a s s o c i a t i n g w i t h PNPase, a C-terminal pRneAC218,  was  constructed  as  described  d e l e t i o n mutant,  i n Sec.  3.2.2.  The  corresponding p r o t e i n was over-expressed and p a r t i a l l y p u r i f i e d as i n Sec. 2.5 and Sec. 3.3.1. Passage of the p a r t i a l l y  p u r f i e d RneAC218  exchange m a t r i x was i n e f f e c t i v e , with  a  number  of other  through an anion  s i n c e a l l the mutant Rne,  proteins,  failed  to b i n d  along  (Fig 9(a)).  F r a c t i o n a t i o n through a c a t i o n exchange matrix (Mono S) r e s u l t e d i n s i g n i f i c a n t r e t e n t i o n of RneAC218 i n a h i g h l y p u r i f i e d s t a t e ( F i g 9(b),  lanes  32-36).  Nonetheless,  a  large  proportion  of the  RneAC218, along with n a t i v e Rne and a number of other p r o t e i n s , d i d not b i n d to the matrix. To c o n f i r m  that RneAC218 i s able to b i n d c a t i o n , but not 59  Figure 9. Fractionation of partially purified RneAC218 by ion exchange chromatography, (a) Anion exchange (Resource Q) fractionation. Approximately 200 ug of protein from selected fractions was precipitated with acetone, separated by SDS-PAGE and visualized with Coomassie Blue staining (Sec. 2.5.1). Lane 0 contains protein size standards, (b) Cation exchange (Resource S) fractionation was conducted as outlined above for (a). (c,d) Western blotting using polyclonal antibodies raised against Rne (c) and PNPase SI (d) (Sec. 2.6). The flow-through fractions from the anion exchange column are indicated in italics and the selected fractions from the cation exchange column are in standard numerals. All fractions were separated by SDS-PAGE and blotted onto Immobilon P. The blots were probed first with a-Rne antibody (c), stripped of bound antibody (Sec. 2.6.4), then reprobed with a-PNPase S1 antibody (d). The arrows in panels (a), (b), (c) and (d) indicate the migration point of RneAC218 and PNPase as denoted.  60  (a) S  3  5  8  10  3  5  8  10  20  30  32  34  36 38  40  42  44 46 48 50  52  54 56 58  60  62 64  15 20  30  32  34  36 38  40  42  44 46 48 50  52  54 56 58  60  62 64  IS  (b) S  —  —§  1• •— mm  -Native Rne  — —  am • & I i  m  55? ^^^p 5z^r  -RneAC218  ati sr. . J4SS. Mv" 48H  61  Mono S  (c) C  Mono Q  2 4  6  8  10 12 2  4  6  8  10  12  20 30 31 32 33 34 35 36 37 38 39 40  RneAC218  (d)  MonoS Mono Q  2  4  6  8  10  12  2  4  6  8  10  12  20 30 31 32 33 34 35 36 37 38 39 40  anion, by  exchange matrices,  Western  blotting  f r a c t i o n s from each column were  using  a-Rne  (Fig  9(c)).  analysed  None  of  the  immunoreactive RneAC218 binds to the Mono Q column, while more than h a l f of the RneAC218 can b i n d the Mono S column.  The  flowthrough  f r a c t i o n s of the Mono Q and Mono S s e p a r a t i o n both c o n t a i n Rne  protein.  The  PNPase a n t i s e r a detected  same f r a c t i o n s were a l s o probed w i t h (Fig 9(d)).  No  immunoreactive  native  a-His(6)-  PNPase c o u l d  be  i n f r a c t i o n s 32-36 of the Resource S e l u a t e , although i t  c o u l d be d e t e c t e d  3.4  i n flowthrough f r a c t i o n s from both  ASSESSMENT OF  Rne-PNPase INTERACTIONS BY  matrices.  FAR-WESTERN  BLOTTING Copurification  of  RNase  E  and  PNPase  through  several  chromatographic steps i m p l i e s that there i s a PNPase b i n d i n g domain w i t h i n the Rne t h i s work). mutant Rne  protein  (C.arpousis,  p r o t e i n s were assessed PNPase  terminal  and  in a  separated  membrane,  and  by  exposed  any bound PNPase was  blot  experiment.  d e l e t i o n mutants SDS-PAGE, to  His(6)-PNPase (Sec. 2.6.5).  Fig  ,  1996;  a  and  f o r t h e i r a b i l i t y to b i n d f r e e ,  Far-Western  N-terminal  purified,  primary  Py et al.  To s u b s t a n t i a t e t h i s p o s s i b i l i t y f u r t h e r , n a t i v e  purified  and  et al. , 1994;  of  Rne  were  t r a n s f e r r e d to  solution  of  free,  Unbound PNPase was  Native,  an  partially  Immobilon  highly  C-  P  purified  removed by washing,  i d e n t i f i e d by u s i n g a-His(6)-PNPase as a  antibody. 10(a)  d e p i c t s an  n a t i v e and mutant Rne  SDS-PAGE g e l c o n t a i n i n g  proteins.  over-expressed  Lanes 2 and 3 have the n a t i v e  . 63  and  Figure 10. Far-Western blotting of native and mutant Rne protein with free PNPase. (a) Extracts of strains over-expressing native and mutant Rne were separated on a 10% SDS polyacrylamide gel and stained with Coomassie brilliant blue. Lane 1, protein markers; Lane 2, native Rne; Lane 3, Rne-3071 mutant protein; Lane 4, RneAC218; Lane 5, RneAN208; Lane 6, RneAN408; Lane 7, RneAN608. (b) Far-Western blot. The same proteins from panel (a) were transferred from a 10% SDS-polyacrylamide gel to Immobilon P (see Sec. 2.6.3). The immobilized proteins were exposed to free PNPase then washed (Sec. 2.6.5). Physical association between PNPase and the immobilized proteins was detected by reaction with polyclonal a-His(6)-PNPase antibodies and chromogenic detection. The samples in lanes 1-7 are identical to those in panel (a).  64  65  Rne-3071 p o l y p e p t i d e s , over-expressed  (See  in  ability and  Fig.  relation  approximately Fig  while  lanes  4 to 7 c o n t a i n  RneAC218, RneAN208, RneAN408 and RneAN608 p r o t e i n s ,  respectively abundant  respectively,  6). to  A l l over-expressed  other  endogenous  proteins  proteins,  and  were were  equal to each other i n c o n c e n t r a t i o n .  10(b)  shows the Far-Western b l o t  of n a t i v e and mutant Rne  to b i n d f r e e PNPase.  t e m p e r a t u r e - s e n s i t i v e mutant Rne  respectively,  display significant  approximately  180  kDa  RneAN813 a l s o b i n d  (Rne).  the  Wild-type  p r o t e i n s i n lanes  2 and  3,  PNPase b i n d i n g to a p r o t e i n of  RneAN208,  significant  used to determine  RneAN408,  amounts of  PNPase  RneA608  i n lanes  and 5-8,  r e s p e c t i v e l y . Lane 3 shows a small amount of PNPase b i n d i n g to a 30 kDa p r o t e i n ; however, t h i s i s a l s o seen to a l e s s e r degree i n lanes 2, 3, 5, 6, 7 and 8.  A l l of the samples c o n t a i n PNPase endogenous  to BL21(DE3) and t h i s appears as a 85 kDa band i n a l l of the l a n e s .  Other  prominent  bands  denoted by * i n F i g . 10b. Rne.  Since  identical  reactive  with  a-His(6)-PNPase  These are l i k e l y degradation products of  products  are  obtained  with  wild-type  (lane 2), Rne-3071 (lane 3) and RneAN208 (lane 5), the i s l i k e l y o c c u r i n g i n the N-terminal domain of Rne, terminus  intact.  are  Rne  degradation  l e a v i n g the  The a b i l i t y of such p a r t i a l degradation  C-  products  to b i n d PNPase would support the idea that the C-terminal domain of Rne  c o n t a i n s a PNPase b i n d i n g s i t e .  Western b l o t  ( F i g . 10b)  T h e i r prominence i n the Far-  i s not p r o p o r t i o n a l to the p r o t e i n v i s i b l e  i n F i g . 10a; the e f f i c i e n t p r o t e i n t r a n s f e r to Immobilon of s m a l l e r 66  Rne d e g r a d a t i o n  p r o d u c t s compared t o t h e f u l l  could explain this  Rne d e l e t i o n m u t a n t s showed a s t r o n g  PNPase b a s e d on t h i s  weakly.  This  a s s a y ; h o w e v e r , RneAC218  i s most l i k e l y  a non-specific  w i t h RneAC218 o r a p r o t e i n o f s i m i l a r s i z e . also  reflect  Rne  protein  discrepancy.  The N - t e r m i n a l for  length  a weak  non-specific  PNPase a n d RneAC218.  67  affinity  b o u n d f a r more  i n t e r a c t i o n o f PNPase The weak b i n d i n g  i n t e r a c t i o n between  could  a-His(6)-  C h a p t e r  4  DISCUSSION  Several researchers the  Escherichia  that et  coli  have a t t e m p t e d  mRNA degradosome,  al.,  al.,  1996;  t h i s work show t h a t  this  interaction  1994;  portions  of  terminal  tail  t h e Rne p r o t e i n ,  the p r o t e i n , First, studies,  of  Rne p l a y s  exist  have  The d a t a  the  acidic  that  recognize  were  each  immunize a r a b b i t and r a i s e  During the  d i r e c t i n g the  was  described  and  used  to  course  of  of  PNPase  raise  al., an  of  1994).  and  exposed i n His(6)-PNPase against  it.  by  cloning  using  This  necessary.  and  because there  (i.e.  a - S l and  fusion  The  capable protein purified  titres  titre  68  of  t h a n t h o s e o f a - S l and  were more a n t i g e n i c  a l l o w i n g more p o l y c l o n a l a n t i b o d i e s A high  over-  purified  f u s i o n p r o t e i n was antibody.  to  those  a plasmid  a His(6)-PNPase  a-His(6)-PNPase  possibly  to  interaction  were  antibodies  a - H i s ( 6 ) - P N P a s e were much h i g h e r  antibodies,  carboxy-  sites predicted  these experiments,  over-expression  (Py e t  protein  successfully  proteins  to  portions  deleting  i n PNPase b i n d i n g  two h i g h l y a n t i g e n i c  raised  in  self-interaction.  these  directed  (Carpousis  t o i d e n t i f y Rne and PNPase i n t h e s e p r o t e i n  PNPase  polyclonal  1996).  and s u g g e s t s t h a t  expressing  a-S2).  al.,  of  demonstrated  c a n be d i s r u p t e d b y  and may be n e c e s s a r y f o r  antibodies  in  Miczak et  an i m p o r t a n t r o l e  Antibodies directed against  a-S2  and a l l  Rne a n d PNPase c o - p u r i f y w i t h t h e p r o t e i n c o m p l e x Py e t  of  t o p u r i f y t h e components  sites to  be  a-RNase E a n t i s e r u m had been  raised previously i n this lab. The  initial  unsuccessful, and PNPase.  attempt  but  to p u r i f y Rne  did illustrate  the  The n a t i v e Rne p r o t e i n was  region  matrix, and  of  Rne  would b i n d  that t h i s p r o p e r t y  from contaminating p r o t e i n s .  near  strong  c e l l s and enriched from c e l l l y s a t e s . carboxy  to  homogeneity  was  a f f i n i t y between  Rne  over-expressed i n BL21(DE3) I t was  hoped that the  tightly  c o u l d be  to  an  utilized  over  a  wide  range  exchange  to separate  Rather than e l u t i n g from the  exchange r e s i n at a d i s t i n c t i v e s a l t c o n c e n t r a t i o n eluted  anion  acidic  of  salt  Rne  anion  as expected,  concentrations,  but  Rne  always  a s s o c i a t e d with approximately equimolar amounts of PNPase ( F i g . 7). A  number  of  unidentified  associated  proteins  were  removed  at Rne  v a r i o u s concentrations  of s a l t .  The strong a s s o c i a t i o n between  and  observed  in  PNPase  Carpousis complex  was et  after  also  al.  (1994) .  successive  Rne  glycerol  gradient  and  steps  Sepharose and h y d r o x y l a p a t i t e , (Carpousis  the  purification  reported  PNPase remained  including  in a  stable  chromatography  on  et al. , 1994).  et al.  , 1994).  Immunoprecipitation  A separate study by  that attempted to i d e n t i f y an RNA  precipitating  PNPase  with  p r o t e o l y t i c fragment of Rne al.,  Py  et al.  Rne  (1994)  stem-loop b i n d i n g p r o t e i n found  a s t a b l e complex with RNase E and at  S-  and c e n t r i f u g a t i o n through a 10-20%  u s i n g a-RNase E a l s o r e v e a l e d that PNPase c o - p r e c i p i t a t e d w i t h (Carpousis  by  PNPase a c t i v i t y . a-PNPase  showed  T h e i r attempts that  a  65kDa  c o - p r e c i p i t a t e d with the PNPase (Py et  1994). The  fact  that  the  Rne,  PNPase and 69  associated  proteins  were  able  to  associate  concentrations populations  with  of  the  salt  anion  would  exchange  suggest  that  matrix there  of p r o t e i n complexes t h a t i n c l u d e Rne  at  are and  varying different  PNPase,  and  a l l of them have d i f f e r i n g charges a s s o c i a t e d w i t h them. In an attempt to d i s r u p t the a s s o c i a t i o n of Rne t e r m i n a l d e l e t i o n mutants of Rne and  purified  personal  i n an  were constructed,  i d e n t i c a l manner as  communication).  d i s t i n c t populations  As  and PNPase, Nover-expressed,  the n a t i v e p r o t e i n  i l l u s t r a t e d i n F i g . 8,  there are  of the RneAN608 d e l e t i o n mutant: the  of the RneAN608 e l u t e s from the anion exchange matrix  a  mixed  oligomer.  This  suggests  that  the  two  majority  in fractions  34-3 8 of the s a l t g r a d i e n t a s s o c i a t e d w i t h n a t i v e Rne, in  (Miao,  presumably  protein  complex  i n v o l v i n g Rne-RneAN608, but not PNPase, e x i s t s as a u n i t of s t a b l e charge.  A small p o r t i o n of the RneAN608 i s present  concentrations PNPase. in  The  remains  amounts  intact.  The  indicates  and PNPase are found  that  SDS-PAGE g e l s  their also  indicate  of p r o t e i n complexes are present  mutant Rne,  PNPase and other u n i d e n t i f i e d p r o t e i n s .  al.,  multiple  The  truncated 1996).  Rne  The  Rne  Rne  RneAN813  (see  also  imply 70  al.  i s capable of b i n d i n g PNPase,  l a c k i n g the C-terminal  data  and  identical  T h i s evidence supports the f i n d i n g s of Kido et  demonstrated t h a t w i l d - t y p e  while  that  involving native  mutants RneAN208, RneAN315, RneAN408 and  Figures 11-14). who  together  exchange e l u t i o n p r o f i l e s were seen f o r the N-terminal  deletion  and  physical interaction  populations  anion  higher  of the s a l t gradient, a s s o c i a t e d with n a t i v e Rne  f a c t that the n a t i v e Rne  equimolar  at the  that  the  h a l f d i d not C-terminal  (Kido 250  et  amino  a c i d s are  i n v o l v e d i n o l i g o m e r i z a t i o n of the n a t i v e Rne  s i n c e the mutant RneAN813 i s s t i l l Rne  able to a s s o c i a t e w i t h  d e l e t i o n was acids  of  capable of e x p r e s s i n g  c r e a t e d to assess  Rne  to  bind  The  mutant  amino  was  over-  and  the  the assumption  matrix  matrix,  while  n a t i v e Rne  the  rest  of  portion the  of  the  that the over-expressed RneAC218 was  anion  RneAC218 bound  RneAC218 and  d i d not b i n d at a l l ( F i g . 9b).  from the n a t i v e Rne  the  The  F r a c t i o n a t i o n of these p r o t e i n s i n a c a t i o n exchange significant  binds  N-  (Fig.  a  of n a t i v e Rne  supporting  Rne  matrix  showed t h a t  tail  200  on the anion exchange matrix.  RneAC218 d i d not b i n d t h i s r e s i n at a l l , acidic  RneAC218  done f o r the n a t i v e Rne  t e r m i n a l mutants, and separated  the  a C-terminal  the a b i l i t y of the f i r s t  PNPase.  expressed and p u r i f i e d as was  9a).  native  (Figures 11-14). A recombinant plasmid  that  protein,  a l l the  to  the  PNPase  and  T h i s appears to suggest  unable to t i t r a t e PNPase away  i n the degradosome complex, although i t appears  that a small p o r t i o n of the RneAC218 i n t e r a c t s e i t h e r s p e c i f i c a l l y or n o n - s p e c i f i c a l l y with the complex. This serves to i l l u s t r a t e problem  with  co-chromatography  i n t e r a c t i o n s : i f a t r u n c a t e d Rne  as  a  method  of  the  protein-protein  mutant e l u t e s w i t h PNPase, i t i s  never c l e a r whether the Rne mutant i s b i n d i n g d i r e c t l y to PNPase or to another p r o t e i n t h a t i s bound to PNPase. In an e f f o r t to r e s o l v e the d i r e c t or i n d i r e c t b i n d i n g of deletion  mutants  performed. denatured  In and  to this  PNPase,  a  Far-Western  experiment,  separated  by  size. 71  total Free  blot  cellular  Rne  experiment  was  proteins  are  PNPase b i n d i n g  to  each  p r o t e i n i s assessed i n d i v i d u a l l y , thereby e x c l u d i n g the of  indirect  Rne,  b i n d i n g between the  Rne  mutants and  possibility  PNPase.  Native  a l o n g w i t h t h e N - t e r m i n a l and C - t e r m i n a l Rne m u t a n t s d e s c r i b e d  previously,  were a f f i x e d  w i t h f r e e PNPase.  t o a membrane, and  As i l l u s t r a t e d i n F i g . 10,  allowed  to a s s o c i a t e  t h e n a t i v e Rne  and  N-  t e r m i n a l d e l e t i o n m u t a n t s b o u n d PNPase e x t r e m e l y w e l l , w h i l e t h e 3 0 kDa  Rne  C-terminal  level. faint Rne  m u t a n t a p p e a r e d t o b i n d PNPase a t a v e r y  low  However, t h i s a s s o c i a t i o n i s p r o b a b l y n o n - s p e c i f i c s i n c e a 3 0 kDa  lanes  as  m u t a n t Rne identity  band i s p r e s e n t well.  Possible degradation  (denoted by c o u l d be  i n t h e n a t i v e and  * i n F i g 10)  confirmed  i s also interesting  products  mutant  of n a t i v e  c o u l d a l s o b i n d PNPase.  i n a c o n t r o l Western b l o t  u s i n g a-RNase E; u n f o r t u n a t e l y , t h i s was It  N-terminal  to note  not  Their  experiment  performed.  t h a t t h e m u t a n t Rne-3071  a b l e t o b i n d f r e e PNPase, w h i c h c o n f l i c t s w i t h t h e o b s e r v a t i o n s Carpousis  sedimentation o f Rne-3 071 Rne-3 071  why  (1994),  who  found  at the non-permissive  and PNPase.  t h e way  PNPase  the p r o t e i n i s presented  which c o - p u r i f i e s  binding  temperature  protein.  glycerol  of  gradient  caused s e p a r a t i o n  a t the non-permissive  the c o n d i t i o n s of probing.  enolase,  that  was  Perhaps the c o n f o r m a t i o n a l change t h a t the  p r o t e i n experiences  n e g a t e d by o r by  al.  et  and  In  temperature  on t h e I m m o b i l o n b l o t  T h i s r e a s o n i n g may with  PNPase, d i d n o t  addition,  is  enolase  may  also explain a p p e a r as not  a  renature  efficiently.  Co-chromatography combined w i t h the Far-Western experiments 72  on  n a t i v e and mutant Rne-PNPase i n t e r a c t i o n s c o n f i r m C-terminal  of Rne p l a y s a r o l e i n the b i n d i n g of PNPase.  chromatography cannot  t h a t the a c i d i c  experiments w i t h  the N-terminal  d i s t i n g u i s h between s p e c i f i c  The co-  d e l e t i o n mutants  or n o n - s p e c i f i c  interaction  between the mutants and PNPase, but do c l e a r l y i l l u s t r a t e that the over-expressed mutant p r o t e i n s  are unable to t i t r a t e  from an i n t e r a c t i o n w i t h n a t i v e  Rne.  I t i s also  PNPase away  i n t e r e s t i n g to  note that small p o r t i o n s of Rne N-terminal d e l e t i o n mutants missing up to 813 amino a c i d s are s t i l l Rne-PNPase  determining  experiments  a role  c a t i o n matrices  with  to n a t i v e  RneAC218  of the Rne N-terminal  were  Rne.  The co-  unclear  end, s i n c e  anion  in and  were unable to separate a RneAC218-PNPase complex  from the other p r o t e i n s  Rne  to i n t e r a c t w i t h the n a t i v e  complex, p o s s i b l y by b i n d i n g  chromatography  The  able  present.  Far-Western s t u d i e s suggest that amino a c i d s 608-1061 of  are able  to b i n d  free  PNPase s t r o n g l y ,  which  supports  past  evidence that Rne l a c k i n g i t s C-terminus due to p a r t i a l p r o t e o l y s i s (Carpousis  e t a l . , 1994)  or d e l i b e r a t e l y d e l e t e d  1996) i s unable to a s s o c i a t e w i t h PNPase.  (Kido  et a l . ,  The Far-Western b l o t  a l s o i n d i c a t e d low l e v e l , n o n - s p e c i f i c PNPase b i n d i n g by a 30 kDa protein  i n a l l deletion  mutants  (see F i g . 10b) .  Whether the  b l o t t e d p r o t e i n s used i n the Far-Western have the same 3D s t r u c t u r e in  vivo  during  i s unknown, s i n c e the experiment d i s r u p t s p r o t e i n s t r u c t u r e the s e p a r a t i o n  and  b l o t t i n g phases  (See M a t e r i a l s  and  Methods). Future work on the r e l a t i o n s h i p between Rne and PNPase would 73  l i k e l y i n v o l v e the b i f u n c t i o n a l c r o s s - l i n k i n g of these degradosome proteins.  Chemical  containing ribosomal domains  several polypeptide research,  and  has  that  supramolecular  complexes  been w e l l documented i n  been used to  introduce  p a r t i c u l a r l y useful  of  chains has  (Traut et a l . , 1 9 8 0 ) .  iminothiolane) are  cross-linking  locate protein  B i f u n c t i o n a l imido-esters a d i s u l f i d e bond as  i n two-dimensional  the  binding (e.g.  2-  cross-link  SDS-PAGE g e l s ,  since  l i n k e d p r o t e i n s can be cleaved by r e d u c t i o n i n the second dimension to  regenerate  mobilities addition  as  monomeric p r o t e i n s the  native  with  proteins  the  (Traut  to f i n d i n g the Rne-PNPase b i n d i n g  f o r o t h e r degradosome components identified.  There may  same  electrophoretic  al. ,  et  site,  1980) .  binding  (e.g. RhlB and  In  domains  enolase) w i l l  be d i f f i c u l t i e s i n the c r o s s - l i n k i n g of  be Rne-  PNPase because of the l a c k of l y s i n e s (and other b a s i c residues)  in  the C-terminus of Rne,  of  the exact b i n d i n g  but  i f i t does work then i d e n t i f i c a t i o n  domain w i l l be s i m p l i f i e d .  A r a d i o - l a b e l l e d c r o s s - l i n k i n g reagent c o u l d be a l s o be to j o i n p r o t e i n s  i n the degradosome, f o l l o w e d  by  denaturation  the p r o t e i n s ,  t r y p t i c d i g e s t i o n , and HPLC f r a c t i o n a t i o n to  the  cross-linking  site  sequence  of data  on  the  (Stone  proteins  of  and  Williams,  the  used  1993).  degradosome  are  of  locate Since already  a v a i l a b l e , a p r e d i c t a b l e p a t t e r n of t r y p t i c d i g e s t i o n would be seen in  the  species, The  HPLC  protein  separation,  except  for  the  cross-linked  which would have the a d d i t i o n a l mass of the c r o s s - l i n k .  p u r i f i e d cross-linked  conventional  methods  peptides  (Stone and  could  Williams, 74  be 1993)  microsequenced to determine  by the  binding  domain.  Recent y e a r s have g i v e n the  components  served site the  as  o f t h e degradosome.  a point  i n Rne,  us an abundance  of departure  and h o p e f u l l y w i l l  These  o f new  studies  i n determining  insights into described  t h e PNPase  have  binding  a i d i n the further understanding  i n t e r a c t i o n and f u n c t i o n of t h e degradosome  75  enzyme c o m p l e x .  of  REFERENCES  A l i f a n o , P., R i v e l l i n i ,  F. , P i s c i t e l l i ,  C.B.,  M.S.  and Carlomagno,  substrates  Anonymous. (1994).  Apirion,  D.  hypothesis.  Arraiano,  (1994).  f o r ribonuclease Genes  p o l y c i s t r o n i c mRNA.  Ribonuclease  P-dependent  & Devel.  8,  E provides  processing  JBC. 2 6 9 ( 1 ) ,  Yancey,  a  777-785.  Degradation of RNA i n Escherichia  Mol. Gen. Genet.  of  3021-3031.  I n s t r u c t i o n s to authors.  (1973).  CM.,  C , Arraiano, CM., B r u n i ,  coli.  A  1 2 2 , 313-322.  S.D.,  and Kushner,  S.R.  (1988).  S t a b i l i z a t i o n of d i s c r e t e mRNA breakdown products i n ams, pnp, m u l t i p l e mutants of Escherichia  coli  J.  K-12.  Bact.  rnb  1 7 0 , 4625-  4633 .  Babitzke,  P. and Kushner, S.R.  stability)  protein  (1991) .  and r i b o n u c l e a s e  s t r u c t u r a l gene of Escherichia  coli.  The ams ( a l t e r e d mRNA  E a r e encoded by the same Proc.  Nat.  Acad.  Sci.  USA 8 8 ,  1-5.  Babitzke, (1993) . coli  P., Granger,  L., O l i s z e w s k i ,  J . , and Kushner, S.R.  A n a l y s i s of mRNA decay and rRNA p r o c e s s i n g i n E s c h e r i c h i a  multiple  mutants  carrying 76  a deletion  i n RNase  III.  J.  Bacteriol.  1 7 5 , 229-239.  Bechhofer, Messenger  D.  (1993).  RNA  stability"  Academic P r e s s ,  Belasco,  Belasco, overview,  in  gels Proc.  (1993).  "Control  Brawerman,  Biggin,  New Y o r k ,  of  eds.),  35  Natl.  and  G.  S  label  as  Acad.  Sci.  C . F . (1988). Gene  72,  Brawerman,  Mechanisms  an a i d t o  procedure  for  screening  of eds.)  o f mRNA decay-  15-23.  in prokaryotic cells:  RNA Stability"  Academic P r e s s ,  USA.  "Control  31-52.  Messenger  H . C . , and D o l y ,  an  ( J . G . Belasco  New Y o r k ,  Pp.  r a p i d DNA s e q u e n c e  and  3-12.  Buffer  gradient  determination.  8 0 , 3963-3965.  J.  (1979).  recombinant  A rapid alkaline plasmid  DNA.  extraction  Nucleic  Acids  1513-1523.  Bochkarev, (1997).  Belasco  in  M . D . , G i b s o n , T . J . , and Hong, G . F . ( 1 9 8 3 ) .  and  7,  stabilizers,  mRNA d e g r a d a t i o n  Birnboim,  Res.  Pp.  a perspective.  J.G.  mRNA  (J.G.  J . G . and H i g g i n s ,  in bacteria:  G.  5'  A.,  Pfuetzner,  Structure  of  the  R . A . , Edwards,  A . M . , and  Frappier,  single-stranded-DNA-binding  r e p l i c a t i o n p r o t e i n A bound t o  DNA.  77  Nature  domain  3 8 5 , 176-181.  L. of  Bouvet, P. and Belasco, RNA  degradation  Nature  360,  Bycroft,  J.G.  (1992).  C o n t r o l of RNase E-mediated  base p a i r i n g i n Escherichia  by 5'-terminal  coli.  488-491.  M. , Hubbard,  Murzin, A.G.  T.J.P.,  (1997) .  Proctor,  M. , Freund,  S.M.V., and  The s o l u t i o n s t r u c t u r e of the SI RNA b i n d i n g  domain: a member of an ancient n u c l e i c a c i d - b i n d i n g f o l d .  Cell  88,  235-242.  Cannistraro,  V . J . and K e n n e l l ,  characterization Escherichia  coli.  of  D.  ribonuclease  Eur.  J.  (1989) . M  Biochem.  C a n n i s t r a r o , V.J. and Kennell, D.  and mRNA  coli:  G.J., and Sarkar,  N.  (1994).  (1992a).  in  The p r o c e s s i v e r e a c t i o n 243,  930-943.  Poly(A) RNA i n  Escherichia  n u c l e o t i d e sequence a t the j u n c t i o n of the lpp t r a n s c r i p t and  the polyadenylate moeity.  Prol  Cao,  (1992b).  G.J.,  an Escherichia  89,  degradation  1 8 1 , 363-370.  mechanism of r i b o n u c l e a s e I I . J". Mol. Biol.  Cao,  P u r i f i c a t i o n and  and Sarkar, N. coli  Natl.  Acad.  78  USA 8 9 , 7546-7550.  I d e n t i f i c a t i o n o f the gene f o r  poly(A) polymerase.  10380-10384.  Sci.  Proc.  Natl.  Acad.  Sci.  USA  C a r p o u s i s , A.J., Van Houwe, G., Ehretsmann, C , and K r i s c h , C o p u r i f i c a t i o n of E. coli  (1994). for  a specific  association  p r o c e s s i n g and d e g r a d a t i o n .  Casaregola,  228,  RNAase E and PNPase: Evidence  between two enzymes important Cell  i n RNA  7 6 , 889-900.  S., Jacq, A., Laoudj, D., McGurk, G., Margarson, S.,  Tempete, M., N o r r i s , analysis  H.M.  V., and H o l l a n d , I.B.  of the e n t i r e Escherichia  coli  (1992).  ams gene.  C l o n i n g and J.  Mol.  Biol.  30-40.  Causton, H., Py, B., McLaren R.S., d e g r a d a t i o n i n Escherichia exoribonuclytic Microbiol.  coli:  and Higgins, C F .  (1994).  mRNA  a n o v e l f a c t o r which impedes the  a c t i v i t y of PNPase a t stem-loop  structures.  Mol.  1 4 , 731-741.  Chanda, P.K., Ono, M., Kuwano, M., and Kung, H. sequence  analysis,  (1985).  and e x p r e s s i o n of the a l t e r a t i o n  s t a b i l i t y gene (ams+) of Escherichia  coli.  J. Bacteriol.  Cloning,  o f the mRNA 1 6 1 , 446-  449.  Chauhan,  A.K., Miczak,  (1991).  Sequencing and e x p r e s s i o n of the rne gene of  coli.  Nucl.  Acids  Res.  A., T a r a s e v i c i e n e ,  L., and A p i r i o n ,  D.  Escherichia  1 9 , 125-129.  Chen, L.-H., Emory, S.A., B r i c k e r , A.L., 79  Bouvet,  P., and Belasco,  J.G.  (1991) .  stabilizer: J.  Structure  analysis  Bacterid.  173,  Ciechanover,  A.  Cell  pathway.  and f u n c t i o n  o f t h e 5' u n t r a n s l a t e d  of a  bacterial  mRNA  o f ompA mRNA.  region  4578-4586.  (1994).  The u b i q u i t i n p r o t e o s o m e  proteolytic  7 9 , 13-21.  Claverie-Martin, S.R.  (1991).  from  Escherichia  F., D i a z - T o r r e s , Analysis coli:  M.R., Y a n c e y , S.D., a n d K u s h n e r ,  o f t h e a l t e r e d mRNA s t a b i l i t y Nucleotide  sequence,  analysis,  and homology  of i t s product  ribosomal  protein  Neurospora  from  transcriptional  t o MRP3,  crassa.  J.  (ams) gene  a  mitochondrial  Biol.  Chem.  266,  2843-2851.  Claverie-Martin, from  humans  F., Wang, M., a n d Cohen, S.N. cells  encodes  a  (1997).  site-specific  single-strand  e n d o r i b o n u c l e a s e t h a t f u n c t i o n a l l y r e s e m b l e s Escherichia E.  J.  Coburn,  Biol.  G.A.  purification J.  Biol.  Chem.  Chem.  portions  coli  RNase  2 7 2 , 13823-13828.  and  Mackie,  and p r o p e r t i e s  G.A.  (1996) .  o f Escherichia  coli  Overexpression, ribonuclease I I .  2 7 1 , 1048-1053.  C o b u r n , G.A. a n d M a c k i e , G.A. of  ARD-1 cDNA  of  t h e mRNA  (1996b).  Differential  f o r ribosomal 80  protein  sensitivites S20  t o 3'-  exonucleases  dependant J.  structure.  Biol.  on  Chem.  C o r m a c k , R.S. a n d M a c k i e ,  vitro.  J.  Mol.  Biol.  G.A.  (1992). coli  Structural  5S r o b o s o m a l  i s conferred by a single  purification, Proc.  Natl.  Sci.  USA 90,  Cudny, H. a n d D e u t s c h e r , ribonuclease Natl.  Acad.  D'Alessio,  requirements  RNA b y RNase E  G.A. ( 1 9 9 3 ) .  M.P.  RNase E  polypeptide: overexpression,  o f t h e ams/rne/hmpl  and p r o p e r t i e s  Acad.  secondary  2 2 8 , 1078-1090.  Cormack, R.S., G e n e r e a u x , J . L . , a n d M a c k i e , activity  a n d RNA  2 7 1 , 15776-15781.  t h e p r o c e s s i n g o f Escherichia  for in  oligoadenylation  gene  product.  9006-9010.  (1980).  Apparent  involvement of  D i n t h e 3' p r o c e s s i n g o f tRNA p r e c u r s o r s . Sci.  G.  Proc.  USA 7 7 , 8 3 7 - 8 4 1 .  and Riordan,  Ribonucleases.  J . F . (eds) (1997).  A c a d e m i c P r e s s , New Y o r k , New Y o r k .  Deutscher, permeable  M.P. cells  (1978).  S y n t h e s i s and d e g r a d a t i o n o f poly(A) i n  o f Escherichia  coli.  J.  Biol.  Chem.  253, 5579-  5584.  D e u t s c h e r , M.P. soup.  Cell  40,  (1985).  E.  coli  RNases: m a k i n g s e n s e o f a l p h a b e t  731-732. 81  Deutscher,  M.P.  Escherichia  coli.  Deutscher, M.P. J.  complexity.  Donovan,  W.P.,  J.  (1993b). Biol.  Promiscuous  Bacterid.  e x o r i b o n u c l e a s e s of  1 7 5 , 4577-4583.  Ribonuclease m u l t i p l i c i t y , d i v e r s i t y and  Chem.  2 6 8 , 13011-13014.  and Kushner,  I I (rnb)  ribonuclease  Res.  (1993a).  (1983).  S.R.  A m p l i f i c a t i o n of  i n Escherichia  activity  coli.  Nucl.  Acids  1 1 , 265-275.  Donovan,  W.P.,  and Kushner,  S.R.  (1986).  Polynucleotide  phosphorylase and r i b o n u c l e a s e I I are r e q u i r e d f o r c e l l and mRNA turnover i n Escherichia  coli  K-12.  Proc.  Natl.  viability Acad.  Sci.  USA 8 3 , 120-124.  Emory, S.A. and Belasco, J.G. RNA  segment  regulated  functions  mRNA  translational  i n Escherichia  stabilizer  efficiency.  Emory, S.A., Bouvet,  (1990).  J.  whose  The ompA 5' u n t r a n s l a t e d coli  as a  activity  Bacteriol.  i s unrelated  to  1 7 2 , 4472-4481.  P., and Belasco, J.G.  (1992).  stem-loop s t r u c t u r e can s t a b i l i z e mRNA i n Escherichia Devel.  growth-rate-  A 5'-terminal coli.  Genes  6 , 135-148.  Franzetti,  B., Sohlberg,  B., Z a c c a i , 82  G. ,  and von Gabain,  A.  (1997).  B i o c h e m i c a l and s e r o l o g i c a l  activity  i n h a l o p h i l i c Archaea.  Ghora, RNA  B.K., and A p i r i o n ,  molecule  D.  J.  evidence f o r an RNase E - l i k e  Bacteriol.  (1979).  1 7 9 , 1180-1185.  Identification  of a novel  i n a new RNA p r o c e s s i n g mutant of Escherichia  which c o n t a i n s 5S rRNA sequences.  Ghosh, R.K. and Deutscher, M.P.  J.  Biol.  (1978).  Chem.  coli  2 5 4 , 1951-1956.  P u r i f i c a t i o n of p o t e n t i a l Nucleic  3' p r o c e s s i n g nucleases u s i n g s y n t h e t i c tRNA p r e c u r s o r s . Acids  Res.  Greenberg,  5 , 3831-3842.  M.E. and Z i f f ,  E.B.  (1984).  S t i m u l a t i o n of 3T3 c e l l s  induces t r a s c r i p t i o n of the c-fos proto-oncogene.  Nature  3 1 1 , 433-  438.  Guarneros, G. and P o r t i e r ,  C.  (1991).  Different  s p e c i f i c i t i e s of  r i b o n u c l e a s e I I and p o l y n u c l e o t i d e phosphorylase i n 3' mRNA decay. Biochimie  7 3 , 543-549.  Gupta, R.S., Kasai, T., and S c h l e s s i n g e r , D. and some n o v e l p r o p e r t i e s of Escherichia Chem.  Purification  RNase I I .  J.  Biol.  2 5 2 , 8945-8949.  Hansen, M.J., The  coli  (1977).  Chen, L.H., Fejzo, M.L., and Belasco, J.G.  (1994).  ompA 5' u n t r a n s l a t e d r e g i o n impedes a major pathway f o r mRNA 83  d e g r a d a t i o n i n Escherichia  coli.  Harlow, E., and Lane, D. Cold  S p r i n g Harbour  Mol.  Antibodies:  (1988).  Laboratory  Microbiol.  Press,  12,  707-716.  A Laboratory  Cold  Manual.  S p r i n g Harbour,  New  York.  Hajnsdorf,  E.,  Carpousis,  A.J.,  and  Regnier,  P.  (1994a).  N u c l e o l y t i c i n a c t i v a t i o n and degradation of the RNase I I I processed message encoding p o l y n u c l e o t i d e phosphorylase J.  Mol.  Biol.  of Escherichia  coli.  2 3 9 , 439-454.  Hajnsdorf, E., S t e i e r , 0., Coscoy, L., Teysset, L., and Regnier, (1994b).  Roles of RNase E, RNase II and PNPase i n the degradation  of the rpsO  t r a n s c r i p t s of Escherichia  coli:  s t a b i l i z i n g function  of RNase I I and evidence f o r e f f i c i e n t degradation i n an ams, rnb  P.  mutant.  Hansen,  M.J.,  (1994).  The  EMBO J.  Chen,  pnp,  1 3 , 33 68-3377.  L.-H.,  Fejzo,  M.L.S.,  and  Belasco,  J.G.  ompA 5' u n t r a n s l a t e d . r e g i o n impedes a major pathway  f o r mRNA d e g r a d a t i o n i n Escherichia  coli.  Mol.  Microbiol.  12,  707-  716 .  He,  L.,  Soderbom, R.,  Masters, M. RNA  (1993) .  Wagner, E.G.H., B i n n i e , U.,  Binns, N.,  and  PcnB i s r e q u i r e d f o r the r a p i d degradation of  I, the a n t i s e n s e RNA  that c o n t r o l s the copy number of C o l E l 84  related plasmids.  Mol.  Microbiol.  9,  1131-1142.  Higgins,  C . F . , Peltz,  S . W . , and J a c o b s o n ,  mRNA  prokaryotes  and  in  Devel.  2,  C.F.,  (1993).  The r o l e  "Control  of  Brawerman,  in  Causton, the  messenger  eds),  M.  of  I.  coli  M.  Nature  and D r e y f u s ,  lacZ  mRNA depends  C.,  i n mRNA s t a b i l i t y  end  EMBO J.  of  Genet.  RNA: i t s  (1994) .  M.  Pp.  Mudd,  E.A.  and decay,  Belasco  and  in G.  13-30.  functions  and  applications  7 2 , 25-34.  mRNAs c a n be s t a b i l i z e d b y DEAD-  (1995).  upon t h e 14,  J.G.  unusual Genes  The s t a b i l i t y  simultaneity  of  of  its  Escherichia  synthesis  and  3252-3261.  s y n t h e s i s by c o n t r o l l i n g the  RNase E a c t i v i t y .  (J.G.  New Y o r k ,  Gene  and  3 7 2 , 193-196.  and B e l a s c o ,  coli:  G.S.C.,  stability"  review.  I.  Escherichia  Opin.  3'  Antisense  and D r e y f u s ,  translation.  Jain,  Turnover  Curr.  Dance,  Academic P r e s s ,  (1988).  box p r o t e i n s .  lost,  eukaryotes.  H.C.,  RNA  gene r e g u l a t i o n - - a  lost,  (1992).  739-747.  Higgins,  Inouye,  lower  A.  (1995).  RNase E a u t o r e g u l a t e s  degradation rate  sensitivity  Devel.  9, 85  of  84-96.  the  of  its  rne  its  own mRNA i n transcript  to  Jameson, B.A., algorithm  M. , Murphy,  Escherichia  coli  Kido,  H. , and  K-12  3,  S.  (1996).  terminal half Bacteriol.  antigenic  index: a n o v e l Comput.  determinants.  Appl.  gene  Cashel, M. with  an  rhlB,  (1991).  RNA  helicase-like  a  new  protein  f i v e such genes i n a p r o k a r y o t e .  886-895.  M. , Yamanaka,  Hiraga,  antigenic  m o t i f , one of at l e a s t  New Biol.  The  (1988).  181-186.  Kalman,  sequence  H.  for predicting 4,  Biosci.  Wolf,  K. , M i t a n i ,  T.,  Niki,  H.,  Ogura,  RNase E p o l y p e p t i d e s l a c k i n g  suppress a mukB mutation  a  T.,  and  carboxyl-  i n Escherichia  coli.  J.  1 7 8 , 3917-3925.  Lin-Chao,  S. and Cohen, S.N.  (1991).  The r a t e of p r o c e s s i n g and  d e g r a d a t i o n of a n t i s e n s e RNAI r e g u l a t e s the r e p l i c a t i o n of C o l E l type plasmids in  vivo.  Cell.  Lin-Chao, S., Wong, T.T.,  RNase E-mediated J.  plasmid.  Linder,  P.,  N i s h i , K.,  Biol.  Lasko,  1233-1242.  McDowall, K.J., and.Cohen, S.N.  E f f e c t s of n u c l e t i d e sequence and  65,  on the s p e c i f i c i t y of  cleavages of RNA  Chem.  269,  P.F.,  Ashburner,  I encoded  (1994).  rne-dependant by  the pBR322  10797-10803.  M.,  Leroy, P.,  Shnier, J . , and S l o n i m s k i , P.P. 86  (1989).  Nielsen  P.J.,  B i r t h of the  DEAD-box.  N a t u r e 3 3 7 , 121-122.  Littauer,  U . Z . , and  Polynucleotide York.  a  new  Genet.  J . , Bortner,  copy 205,  Lundberg, in  the  The  Academic Press  S.,  gene  number  of  and B e c k w i t h ,  of  Escherichia  pBR322  Enzymes, Inc.,  Vol.  XV:  New Y o r k ,  New  J.  (1986).  coli  and i t s  Mutations  K - 1 2 , pcnB,  derivatives.  in  reduce  Mol.  Gen.  285-290.  U . , von Gabain,  control,  stability:  mutant a l t e r i n g mRNA s t a b i l i t y a n d  a novel  EMBO J.  endoribonuclease.  G.A. coli  polynucleotide  of  (1989).  the  protein  phosphorylase.  ribosomal p r o t e i n ams gene  2731-2741.  Stabilization  ribosomal  G . A . (1991).  9,  Specific  J.  S20  of  the  mRNA  Bacteriol.  and i n v i t r o .  2497 .  87  in  3'  one-third  mutants  of  lacking  1 7 1 , 4112-412 0.  endonucleolytic  S20 o f Escherichia  in vivo  mRNA  Cleavages  coli  for  the  (1990).  s t u d i e s w i t h an Escherichia  Mackie,  of  0.  a n d bla  Escherichia  region  A . , and M e l e f o r s , ompA  Mackie,  5'  (1982).  517-553.  chromosomal  plasmid  H.  Phosphorylase.  Pg.  Lopilato,  Soreq,  coli J.  c l e a v a g e o f t h e mRNA requires  Bacteriol.  the  product  1 7 3 , 2488-  Mackie,  G.A.  (1992) .  Secondary  structure  o f t h e mRNA f o r  r i b o s o m a l p r o t e i n S2 0: I m p l i c a t i o n s f o r c l e a v a g e b y r i b o n u c l e a s e E. J.  Biol.  Mackie,  Mackie,  Chem.  G.A.  G.A.  structure  2 6 7 , 1054-1061.  (1993).  GenBank a c c e s s i o n #L23924 (amsrevis)  and Genereaux,  J.G.  i n d e t e r m i n i n g RNase  (1993).  The r o l e  E-dependent c l e a v a g e  mRNA f o r r i b o s o m a l p r o t e i n S20 in  vitro.  J.  .  Mol.  sites  Biol.  o f RNA i n the  234,  998-  1012 .  Mackie,  G.A.  McDowall, (1993). the  ams  (1996).  Personal  K . J . , H e r n a n d e z , R.G., L i n - C h a o , The ams-1 gene  substitutions  a n d rne-3071  within  a domain  McDowall, K.J., Lin-Chao, than  specificity  temperature  a  that  s e n s i t i v e mutations i n  resembles  J". Bacteriol.  particular  nucleotide J.  o f RNase E c l e a v a g e .  (1994).  Chem.  ofthe  A+U c o n t e n t  determines  the  2 6 9 , 10790-10796.  The N - t e r m i n a l d o m a i n o f  gene p r o d u c t h a s RNase E a c t i v i t y 88  and cause  a product  order  Biol.  (1996).  other  1 7 5 , 4245-4249.  S., a n d Cohen, S.N.  M c D o w a l l , K . J . a n d Cohen, S.N. t h e rne  S., a n d Cohen, S.N.  a r e i n c l o s e p r o x i m i t y t o each  E s c h e r i c h i a c o l i mre l o c u s .  rather  communication.  and i s non-overlapping  w i t h the a r g i n i n e - r i c h RNA-binding s i t e .  J.  Mol.  Biol.  255,  349-  355 .  McDowall, K.J., Kaberdin,  V.R., Wu,  Chao,  Site-specific  S.  (1995).  S.W.,  Cohen, S.N., and L i n RNase  E  cleavage  of  Nature  3 7 4 , 287-  Genetic  s t u d i e s of  o l i g o n u c l e o t i d e s and i n h i b i t i o n by stem-loops. 290 .  Melefors,  0. and von Gabain,  A.  (1991) .  c l e a v a g e - i n i t i a t e d mRNA decay and p r o c e s s i n g of ribosomal 9S RNA Mol.  show that the E s c h e r i c h i a c o l i ams and rne l o c i are the same. Microbiol.  5,  857-864.  Meyer, B.J., and S c h o t t e l , J . L . messenger  RNA  decay  (1992).  suggests  C h a r a c t e r i z a t i o n of c a t  that  turnover  e n d o n u c l e o l y t i c cleavage i n a 3' to 5' d i r e c t i o n . 6,  occurs  Mol.  by  Microbiol.  1095-1104.  Miao, X. (1997).  Miczak, Proteins  Personal communication.  A., Kaberdin, associated  ribonucleolytic  V.R., Wei, C.-L., and Lin-Chao, with  complex.  Proc.  RNase Natl.  3869.  89  E  in  Acad.  a Sci.  S.  (1996)  multicomponent USA.  93,  3 865-  M i s r a , T.K., and A p i r i o n , D. enzyme from Escherichia  coli.  (1979). J.  RNase E, an RNA p r o c e s s i n g  Biol.  Chem.  2 5 4 , 11154-11159.  Escherichia  Mudd, E.A., Carpousis, A.J., and K r i s c h , H.M. (1990a). coli Genes  RNase E has a r o l e and Devel.  i n the decay of bacteriophage  4 , 873-881.  Mudd, E.A., K r i s c h , H.M., and Higgins, C.F. endoribonuclease, Escherichia  coli  i n the chemical  mRNA: evidence  that  rne  Salmonella  an  decay o f  and ams a r e the same  4 , 2127-2135.  C.F.  Escherichia  (1993).  coli  RNase E: a u t o r e g u l a t i o n o f e x p r e s s i o n and s i t e  s p e c i f i c cleavage o f mRNA.  Neidhardt,  RNase E,  role  E.A., and Higgins,  endoribonuclease  (1990b).  has a g e n e r a l  Mol. Microbiol.  genetic locus.  Mudd,  T4 mRNA.  Mol. Microbiol.  9, 557-568.  Escherichia  F.C. e t a l . , (eds) (1987). typhimurium:  Cellular  and Molecular  coli  Biology.  and  ASM Press,  Washington, D.C.  Neidhardt,  F . C , Ingraham,  Physiology  of  the  Bacterial  J . L . and Schaechter, Cell.  Sinauer  M.  (1990)  Associates,  Inc.,  Masachussetts.  Newbury,  S.F., Smith,  N.H., Robinson, 90  E . C , Hiles,  I.D.,  and  Higgins,  CF.  (1987).  Stabilization  mRNA b y p r o k a r y o t i c REP s e q u e n c e s .  Nicholson,  A.W.  Prog.  s t r a n d e d RNA.  Nicol,  (1995).  of translationally  Cell  48,  The c h e m i s t r y  Nucleic  Acid  Res.  S.M. a n d F u l l e r - P a c e , F.V.  297-310.  and b i o l o g y  Mol.  (1995).  active  Biol.  of double-  5 2 , 1-65.  The "DEAD-box" p r o t e i n  DbpA i n t e r a c t s s p e c i f i c a l l y w i t h t h e p e p t i d y l t r a n s f e r a s e c e n t e r i n Proc.  23S rRNA.  Nat.  Acad.  Sci.  USA 9 2 , 1 1 6 8 1 - 1 1 6 8 5 .  O'Hara, E.B., C h e k a n o v a , J.A., I n g l e , C.A., K u s h n e r , Z.R., P e t e r s , E., a n d K u s h n e r , S.R. decay  i n Escherichia  (1995). coli.  P o l y a d e n y l a t i o n h e l p s r e g u l a t e mRNA Proc.  Natl.  Acad.  Sci.  USA 9 2 , 1 8 0 7 -  1811.  Ono, M. a n d Kuwano, M.  (1979).  A conditional l e t h a l mutation i n  an E s c h e r i c h i a c o l i s t r a i n w i t h a l o n g e r c h e m i c a l J.  Mol.  Biol.  1 2 9 , 343-357.  Pepe, C M . , M a s l e s a - G a l i c , the II  IS10 a n t i s e n s e stabilizes  l i f e t i m e o f mRNA.  S., a n d Simons, R.W.  RNA b y 3' e x o r i b o n u c l a s e s :  RNA-OUT a g a i n s PNPase a t t a c k .  (1994)-.  Decay o f  evidence that Mol.  Microbiol.  RNase 13,  1133-1142.  Petersen,  C.  (1992).  Control  o f f u n c t i o n a l mRNA s t a b i l i t y i n 91  bacteria:  multiple  inactivation.  Petersen, a  C.  complex  (J.G. Pp.  Mol.  of  Microbiol.  (1993).  nucleolytic  6,  and  non-nucleolytic  277-282.  T r a n s l a t i o n and mRNA s t a b i l i t y  reationship,  Belasco  in  "Control  a n d G . Brawerman,  of  messenger  eds.)  Academic  in bacteria:  RNA  stability"  Press,  New Y o r k ,  117-145.  Phizicky,  E.M.,  interactions:  5 9 ( 1 ) ,  Py,  Causton,  B.,  protein Mol.  Nature.  S.  (1995).  Protein-protein Microbiological  E . A . , and H i g g i n s ,  mRNA d e g r a d a t i o n  in  C . F . (1994). Escherichia  A coli.  1 4 , 717-729.  C . F . , Krisch, in  H . M . , and C a r p o u s i s ,  the  Escherichia  coli  A . J . (1996)  A  RNA d e g r a d o s o m e .  3 8 1 , 169-172.  L.R.  translational  Regnier,  Mudd,  RNA h e l i c a s e  Rapaport,  protein  H. ,  mediating  B . , Higgins,  DEAD-box  Fields,  94-123.  complex  Micro.  and  methods f o r d e t e c t i o n and a n a l y s i s .  Reviews,  Py,  mechanisms  and  efficiency  S20 i n Escherichia  P.,  Mackie,  G.A.  (1994) .  on t h e s t a b i l i t y coli.  Grunberg-Manago,  J.  M. , 92  of  o f t h e mRNA f o r r i b o s o m a l  Bacteriol.  and  Influence  1 7 6 , 992-998.  Portier,  C.  (1987).  N u c l e o t i d e sequence  of the pnp  gene of Escherichia J". Biol.  p o l y n u c l e o t i d e phosphorylase.  Robert-LeMeur,  M.  and  Portier,  phosphorylase of Escherichia  Chem.  C.  coli  coli  262,  (1994).  encoding  63-68.  Polynucleotide  induces the d e g r a d a t i o n of i t s Nucl.  RNase I I I processed messenger by p r e v e n t i n g i t s t r a s l a t i o n . Acids  Res.  22,  Robertson,  397-403.  H.D.  and  Dunn,  J.J.  p r o c e s s i n g a c t i v i t y of Escherichia Chem.  (1975). coli  r i b o n u c l e a s e I I I . J.  acid Biol.  3050-3056.  Roy, M.K.,  and A p i r i o n , D.  ribonuclease Biochim.  E,  Biophys.  an RNA Acta.  Sambrook, J . , F r i t s c h , Cloning:  A  Laboratory  (1983).  P u r i f i c a t i o n and p r o p e r t i e s of  p r o c e s s i n g enzyme, from Escherichia 747,  E.F.,  F., N i c k l e n , S.,  coli.  200-208.  and M a n i a t i s , T.  Manual,  2nd  ed.,  L a b o r a t o r y Press, C o l d S p r i n g Harbor, New  Sanger,  Ribonucleic  and Coulson, A.R.  with chain-terminating i n h i b i t o r s .  Proc.  Molecular  (1989).  Cold  Spring  Harbor  York.  (1977). Natl.  Acad.  DNA  sequencing  Sci.  USA 7 4 ,  A conserved AU sequence  from the  5463-5467 .  Shaw, G.,  and Kamen, R.  (1986). 93  3 ' untranslated region Cell.  degradation.  fo  46,  GM-CSF mRNA m e d i a t e s  coli,  New Y o r k ,  Stone,  (P. B o y e r , ed.) A c a d e m i c P r e s s ,  Genet.  199,  (1985).  feedback  S t a b i l i t y of ribosomal p r o t e i n r e g u l a t i o n i n Escherichia  Protein  Edition."  a n d HPLC and  peptide  Peptide  coli.  543-546.  K.L., a n d W i l l i a m s , K.R.  proteins  RNases I , I I a n d I V o f  p p . 501-515.  mRNA a n d t r a n s l a t i o n a l Gen.  (1982).  i n "The Enzymes"  S i n g e r , P. a n d Nomura, M.  Mol.  mRNA  659-667.  Shen, V., a n d S c h l e s s i n g e r , D. Escherichia  selective  (1993).  isolation,  Purification  (P. M a t s u d a i r a ,  for  Enzymatic  digestion of  i n "A Practical  Guide  Microsequencing,  ed.) A c a d e m i c P r e s s , S a n D i e g o ,  to Second  pp.  43-  69 .  Studier,  F.W., R o s e n b e r g , A.H., Dunn, J . J . , a n d D u b e n d o r f f ,  (1990).  U s e o f T7 RNA p o l y m e r a s e t o d i r e c t  genes.  Meth.  Taraseviciene,  Enzymol.  185,  L., M i c z a k ,  J.W.  expression of cloned  60-89.  A., a n d A p i r i o n ,  D.  (1991).  The g e n e  s p e c i f y i n g RNase E ( r n e ) a n d a gene a f f e c t i n g mRNA s t a b i l i t y (ams) a r e t h e same g e n e .  Mol.  Microbiol.  5,  94  857-864.  Taraseviciene,  L. ,  Immunoaffinity  purification  product.  J.  Biol.  Taraseviciene, for  an  Chem.  RNA b i n d i n g  Tomcsanyi,  T.  ribonuclease formation  region  E specifically  of  from  Function,  and G e n e t i c s "  L.  Baltimore,  Wang,  M.  reverses i n the RNase  in  the  Kahan, Pg.  Cohen,  effects  Escherichia E-like  rne  gene  B.C.  (1995).  J". Biol.  Chem.  D.  270,  (1985).  c l e a v e s RNA I , J.  coli  Evidence processing  26391-26398.  Processing an i n h i b i t o r  Mol.  Biol.  185,  G . , and Kenny, coli  of  primer  713-720.  J.W.  ribosomal  enzyme  (1980).  subunits  crosslinking,  in  (G. C h a m b l i s s ,  G.R. Craven, J . Davies,  M. Nomura,  eds.)  "Ribosomes:  University  as  Structure,  Park  K.  Press,  89-110.  and the  and  (1994).  coli  Escherichia  Escherichia  protein  B.E.  Escherichia  i n p l a s m i d DNA s y n t h e s i s .  topography  Uhlin,  12167-12172.  Apirion,  inferred  Davis,  the  R . R . , Lambert, J . M . , B o i l e a u ,  Protein  and  G . R . , and U h l i n ,  RNase E .  and  S.,  of  269,  L . , Bjork,  endoribonuclease  Traut,  Naureckiene,  S.N. of  coli  cleavages.  (1994).  temperature rne  ard-1:  a  human  Natl.  10595.  95  that  s e n s i t i v e and d e l e t i o n m u t a n t s  gene and encodes an a c t i v i t y Proc.  gene  Acad.  Sci.  producing  USA 91,  10591-  Wennborg, A., Sohlberg, B., Angerer, D., K l e i n , G., and von Gabain, A.  (1995) .  E-like  activity  sequences i n v o l v e d i n mRNA s t a b i l i t y  control.  Sci.  A human RNase  which c l e a v e s Proc.  Natl.  RNA Acad.  USA 9 2 , 7322-7326.  Xu, F., Chao, S.L.-C, coli  pcnB  (1993).  Escherichia  The  gene promotes a d e n y l y l a t i o n of a n t i s e n s e RNA I of C o l E l -  type plasmids Proc.  and Cohen, S.N.  Natl.  in vivo  Acad.  and degradation of RNA I decay i n t e r m e d i a t e s .  Sci.  USA 9 0 ,  Xu, F. and Cohen, S.N.  6756-6760.  (1995) .  RNA degradation  Escherichia  in  coli  r e g u l a t e d by 3' a d e n y l a t i o n and 5' p h o s p h o r y l a t i o n .  374,  180-183.  Yen,  T . J . , Machlin,  Autoregulated nascent  P.S.,  and  Cleveland,  Nature  D.W.  (1988).  i n s t a b i l i t y of B - t u b u l i n mRNAs by r e c o g n i t i o n of the  amino terminus of B - t u b u l i n .  Zhou, A., Hassel,  Nature  B.A., and Silverman,  3 3 4 , 580-585.  R.H.  (1993).  Expression  c l o n i n g of 2-5-A-dependant RNase: a u n i q u e l y r e g u l a t e d s t i m u l a t o r of  interferon action.  Z i l h a o , R., C a i l l e t ,  Cell  7 2 , 753-765.  J . , Regnier,  P., and A r r a i a n o , C M .  P r e c i s e p h y s i c a l mapping of the Escherichia r i b o n u c l e a s e I I . Mol.  Gen.  Genet. 96  coli  rnb gene,  2 4 8 , 242-246.  (1995). encoding  Appendix 1. pET3xc cloning vector used to construct rneAN208, rneAN315, rneAN408, rneAN608, rneAN722, and rneAN813. Restriction sites used for cloning are circled in red.  0 Novagen  Technical  Bulletin  EcoR torn CUIOQ  HhxilllCS)  Ea>R V(I7I)  ScalptM)  P*H*o*>  NdeKlSO Xb*I(U32>  pET-3xa  BgllKlMO)  (S384bp)  Sph I(UI9» Ea>NKl6»7> Sal 1(1672  Aflinowi  XnutntlMO) Nru tCWW) BsoMICD75)  Tihiu lawn' PvuIIOOtV  ^ Bun IO310) "•AvttCluS)  97  Appendix 2. pET24b cloning vector used to construct rneAC218. Restriction sites used for cloning are circled in red.  \5  N o v a g e n Not «•«•» Siy usn ,8cu  SJCHtWI  Eoofl irni  Cra  tit)  T7 transcription/ expression region  Son U M *  Ml M<3*-»  BaE :it»«u Cu k«o&«  pET-24a(+) (531 Obp)  6COP "'AMI*! Mfl* r.iJT8» '  SaoS? ta*>3»  /^NpBttOJiiiMi; 8 9 (OUT)  Sao '<*»») •  T9»lt1 10*101 • SseO  *o«Ainrrii w«»  98  Figure 11: Supplemental Figure - Fractionation of partially purified extracts of RneAN208 on an anion exchange column (Resource Q). For experimental details, see Figure 8 and the results section.  99  100  101  Figure 12: Supplemental Figure - Fractionation of partially purified extracts of RneAN315 on an anion exchange column (Resource Q). For experimental details, see Figure 8 and the results section.  102  (a)  103  104  Figure 13: Supplemental Figure - Fractionation of partially purified extracts of RneAN408 on an anion exchange column (Resource Q). For experimental details, see Figure 8 and the results section.  105  106  107  Figure 14: Supplemental Figure - Fractionation of partially purified extracts of RneAN813 on an anion exchange column (Resource Q). For experimental details, see Figure 8 and the results section.  108  109  (d) C  5  8  10  15 20 30 32 34 36 38 40 42 44  110  46 48 50 52 54 56  58  60  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0088271/manifest

Comment

Related Items