UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Regulation of HIV-1 transcription by RBF-1 and RBF-2 Bell, Brendan Bernard 1997

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1997-250156.pdf [ 10.05MB ]
Metadata
JSON: 831-1.0088197.json
JSON-LD: 831-1.0088197-ld.json
RDF/XML (Pretty): 831-1.0088197-rdf.xml
RDF/JSON: 831-1.0088197-rdf.json
Turtle: 831-1.0088197-turtle.txt
N-Triples: 831-1.0088197-rdf-ntriples.txt
Original Record: 831-1.0088197-source.json
Full Text
831-1.0088197-fulltext.txt
Citation
831-1.0088197.ris

Full Text

REGULATION OF HIV-1 TRANSCRIPTION BY RBF-1 AND RBF-2 by BRENDAN BERNARD BELL B.Sc. (Chem.), The University of Alberta, 1988 B.Sc. (Hons Biochem.), McGill University, 1990 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Department of Biochemistry and Molecular Biology) I accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA December 1997 © Brendan Bell, 1997 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. 1 further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department The University of British Columbia Vancouver, Canada DE-6 (2/88) A B S T R A C T Lentiviruses, including human immunodeficiency virus type 1 (HIV-1), characteristically form latent integrated proviruses whose transcription can be induced by extracellular signals. The level of HIV-1 gene expression is determined by the 5' long terminal repeat (LTR), which directs the host cell RNA polymerase II machinery to synthesize viral transcripts. The HIV-1 LTR responds to multiple signals, including the protein-tyrosine kinase (PTK)/Ras/Raf signaling pathway. Downstream nuclear targets of PTK/Ras/Raf are of interest because this pathway is implicated in the development of human tumors. This thesis describes experiments designed to determine the czs-acting sequences of the HIV-1 LTR that are necessary for Ras-responsiveness and to characterize the cellular transcription factors that bind to them. Data presented in this thesis demonstrate that Ras-responsive HIV-1 transcription requires two previously undescribed factors, RBF-1 and RBF-2. RBF-1 binds to Ets-like motifs located between nucleotides -151 and -142, and within the N F - K B binding sites. RBF-2 binds the fflV-1 LTR at nucleotides -131 to -121 and immediately 3' of the TATA box. RBF-1, or associated proteins, are phosphorylated in response to the activation of a PTK, v-fps. Moreover, RBF-1 contains the Ets family member GABPa, and an interacting protein, GABPpi. RBF-1 and RBF-2 appear to share similar DNA binding subunits of apparent molecular weight 100 K. Mutation of the RBF-1 and RBF-2 binding elements (RBEs) prevents Ras stimulation of HIV LTR-directed transcription. These data define a mechanism for Ras responsiveness of HIV-l transcription that requires GABP, as a component of RBF-1, and the previously uncharacterized cellular transcription factor, RBF-2. ii T A B L E OF C O N T E N T S A B S T R A C T i i T A B L E OF C O N T E N T S i i i LIST OF T A B L E S v i i i LIST OF FIGURES ix LIST OF A B B R E V I A T I O N S xi A C K N O W L E D G M E N T S xi i i 1. I N T R O D U C T I O N 1 1.1 R A T I O N A L E l 1.2 T H E P T K / R A S / R A F S I G N A L T R A N S D U C T I O N P A T H W A Y 2 1.2.1 Protein -tyrosine kinases 3 2.2.2 Linking Protein-tyrosine kinases to Ras 3 2.2.3 Activation of Raf and the MAP kinase cascade 5 2.2.4 Specificity and cross-talk in the Ras signal transduction pathway 6 1.3. T R A N S C R I P T I O N A L R E G U L A T I O N 7 2.3.2 The RNA polymerase II holoenzyme 7 2.3.2 The general transcription factors (GTFs) 8 2.3.3 TFIID:TBP and TAFs 22 2.3.4 Promoter specific transcription factors 14 1.3.5 The role of chromatin in transcription 25 2.3.6 Mechanisms of activation and repression of transcription 26 2.3.7 Regulation of transcription by extracellular signals 27 1.3.7.1. Ets transcription factors as targets of the P T K / R a s / R a f pathway 18 i i i 1.4 T R A N S C R I P T I O N A L R E G U L A T I O N O F H U M A N I M M U N O D E F I C I E N C Y V I R U S E S 1 8 2.4.2 Gene expression in the lifecycle of HIV type 1 (HIV-1) 18 1.4.2 The 5' long terminal repeat in regulation of HIV-1 transcription 20 1.4.2.1 T A R 21 1.4.2.2 The H I V - 1 T A T A box 2 1 1.4.2.3 S P 1 sites 2 2 1.4.2.4 N F - K B (enhancer region) 2 2 1.4.2.5 Repressors of H I V - 1 transcription 2 3 2.4.3 The role of chromatin in HIV-1 transcription 30 1.4.4 Regulation of HIV-2 transcription 32 2 .4 .5 Signal transduction and HIV-1 transcription 3 2 2. M A T E R I A L S A N D M E T H O D S 34 2.2 P L A S M I D S 3 5 2.4 C A T A S S A Y S 3 7 2.5 O L I G O N U C L E O T I D E S 3 7 2.6 N U C L E A R E X T R A C T S 3 8 2 .7 E L E C T R O P H O R E T I C M O B I L I T Y S H I F T A S S A Y S ( E M S A S ) 3 9 2.8 A N T I B O D I E S A N D R E C O M B I N A N T P R O T E I N S 4 0 2.9 S O U T H W E S T E R N B L O T T I N G 4 0 2 . 1 0 W E S T E R N B L O T T I N G 4 0 2 . 1 1 U V L A S E R C R O S S L I N K I N G . . . 4 1 2 . 1 2 H E P A R I N - A G A R O S E C H R O M A T O G R A P H Y 41 i v 3. R E S U L T S 43 3.1 M A P P I N G O F T H E P R I M A R Y R A S - R E S P O N S I V E E L E M E N T O F T H E H IV -1 L T R 43 3.2.2 Nucleotides 5' of the NF-kB sites, -158 to -118, are necessary for full responsiveness of the HIV-1 LTR to signals from v-fps 43 3.2.2 Nucleotides -158 to -118 of the HIV-1 LTR are necessary for full responsiveness of the HIV-1 LTR to signals from v-Ha-Ras in HIV permissive cells 46 3.2 T w o N U C L E A R F A C T O R S , RBF-1 A N D RBF-2, B I N D S P E C I F I C A L L Y T O T H E P R I M A R Y R A S R E S P O N S I V E R E G I O N O F T H E H IV -1 L T R 49 3.2.2 The nuclear factor RBF-1 specifically binds nucleotides -151 to -142 in the Ras responsive region of the LTR 49 3.2.1.1 RBF-1 contains G A B P , but not Ets-1, Elf-1, Fli-1 or ERF 55 3.2.1.2 Ets binding sites embedded in the N F - K B motifs of the H IV - 1 L T R can compete for the binding of RBF-1 to RBE IV 62 3.2.1.3 RBF-1, or associated factors, are phosphorylated in response to signals from the R A S pathway 66 3.2.2 RBF-2 specifically binds to the primary Ras responsive region 68 3.2.2.1 RBF-2 interacts wi th the H IV -1 L T R at nucleotides -131 to -121 of the Ras responsive region 68 3.2.2.2 RBF-2 from Rat cells must be phosphorylated to bind RBE III 73 3.2.2.3 RBF-2 also binds immediately downstream of the H IV - 1 T A T A box 73 3.2.2.4 RBF-2 is distinct from hLEF 82 3.3 P O I N T M U T A T I O N S T H A T P R E V E N T RBF-1 A N D RBF-2 B I N D I N G IN VITRO I M P A I R R A S R E S P O N S I V E N E S S O F T H E H IV -1 L T R IN VIVO 84 v 3.3.2 Point mutations in the RBEs specifically impair the HIV-1 LTR's response to Ras 89 3.4 C H A R A C T E R I Z A T I O N O F RBF-1 A N D RBF-2 91 3.4.2 UV crosslinking suggests RBF-1 and RBF-2 both contain DNA binding subunits of Mr 100 K 92 3.4.2 Southwestern blotting demonstrates that RBF-1 and RBF-2 both contain DNA binding subunits of Mr 100 K 96 3.4.2.1 RBF-1 and -2 D N A binding activities are induced upon HL-60 differentiation 100 3.4.3 The relationship between RBF-1 and -2 200 3.5 T H E H I V - 1 T A T A B O X F O R M S A U N I Q U E C O M P L E X W I T H P R I M A T E C E L L N U C L E A R P R O T E I N S 106 3.5.2 Is TBC binding important in Tat trans-activation? 206 4. D I S C U S S I O N 117 4.1 T H E R E G I O N I M M E D I A T E L Y U P S T R E A M O F T H E N F - K B SITES IS I M P O R T A N T I N H I V R E P L I C A T I O N 117 4.2 T H E RBEs F U N C T I O N I N A C O N T E X T S P E C I F I C F A S H I O N 118 4.3 A C O M P O N E N T O F RBF-1, G A B P , is A R A S R E S P O N S I V E T R A N S C R I P T I O N F A C T O R 1 2 0 4.4 RBF-2 IS A L S O R E Q U I R E D F O R R A S - R E S P O N S I V E HIV-1 T R A N S C R I P T I O N 121 4.5 RBF-2 B I N D S T O A SITE O V E R L A P P I N G T H E HTF4, AP4 A N D E47 S ITES 122 4.6 T H E P H Y S I O L O G I C A L S I G N I F I C A N C E O F RBF-1 A N D -2 F U N C T I O N 123 4.7 RBE III IS F R E Q U E N T L Y D U P L I C A T E D I N H T V - l I N F E C T E D I N D I V I D U A L S 124 4.8 S T R A T E G I E S T O O B T A I N M O L E C U L A R C L O N E S F O R RBF-1 A N D -2 126 V I 4.9 F U T U R E D I R E C T I O N S 126 4 . 1 0 C O N C L U S I O N 128 R E F E R E N C E S 129 A P P E N D I X 1 155 vii L I S T O F T A B L E S 1. Eukaryotic general transcription factors and holoenzyme components 11 2. Names and properties of the Human TAFs 13 3. Cellular transcription factors that interact with the HIV-1 LTR 27 viii L I S T O F F I G U R E S 1. Schematic diagram of the P T K / R a s / R a f signal transduction pathway 4 2. Mode l for regulation of transcription by R N A polymerase II 9 3. Representation of an integrated HTV-1 genome and the 5' LTR 25 4. Stimulation of HIV-1 LTR-driven transcription by v-fps 44 5. Ras stimulation of the H I V - L T R in Jurkat T and U937 cells 47 6. Nucleotide sequence of the -160 to -2 region of the HIV-1 L T R and positions of oligonucleotide probes 50 7. RBF-1 binds to the Ets-like motif at nucleotides -150 to -142 52 8. RBF-1 is not Ets-1 or Elf-1 56 9. RBF-1 contains G A B P a and G A B P p i 58 10. U937 cell nuclear extracts contain RBF-1 but not Ets-1 D N A binding activity . . . 60 11. N F - K B motifs of the HIV-1 LTR compete specifically for RBF-1 binding 63 12. RBF-1, or associated factors, is phosphorylated in response to oncogenic P T K . . 67 13. RBF-2 specifically recognizes sequences -131 to -121 of the HIV-1 L T R 69 14. Treatment of RBF-2 wi th phosphatase reduces its D N A binding activity 74 15. RBF-2 binds immediately downstream of the HIV-1 T A T A box 76 16. Summary of the binding sites for RBF-1 and RBF-2 on the HIV-1 L T R 80 17. RBF-2 is not L E F (TCF-loc) 83 18. Mutations to RBEs impair Ras-responsiveness of the HIV-1 L T R 85 19. Effects of ras on HIV-1 LTRs bearing mutations in the RBEs 88 20. RBF-1 and RBF-2 are dispensible for frans-activation of the H I V - L T R by Bel-1 . 90 21. RBF-1 and RBF-2 are multi-protein complexes 92 22. RBE IV and RBE III crosslink to DNA-b ind ing subunits of 100 K 94 23. RBF-1 and RBF-2 both contain DNA-b ind ing subunits of M r 100 K 97 24. Specificity of Southwestern blotting experiments 99 25. HL-60 cells express RBF-1 and RBF-2 upon differentiation to macrophages . . . 101 ix 26. Unlabeled RBE IV alters the mobility of RBF-2-RBE III complexes 103 27. RBF-1 and RBF-2 have similar DNA-binding subunits of 100 K 104 28. A low mobility complex binds specifically to the HIV-1 TATA box 107 29. Point mutations that impair TBC binding in vitro prevent Tat fnms-activation in vivo 112 30. TBC binding activity is induced upon differentiation to macrophages 114 x LIST OF A B B R E V I A T I O N S ATP adenosine 5'-triphosphate CAT chloramphenicol acetyl transferase CSF-1 colony stimulating factor 1 CTD carboxy terminal domain (of RNA Pol II) DEAE-Dextran diethylaminoethyl ether modified dextran DMEM Dulbecco's modified Eagle medium DMSO dimethyl sulphoxide DNA deoxyribonucleic acid DTT dithiothrietol EDTA ethylenediamine tetra-acetic acid EMSA electrophoretic mobility shift assay FBS fetal bovine serum GABP GA binding protein GDP guanine 5'-diphosphate GM-CSF granulocyte/macrophage colony stimulating factor GTF general transcription factor HEPES N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid IMDM Iscove's modified Dubelcco's media IL interleukin K units of relative molecular mass kD kilodaltons MEM modified Eagle medium MW molecular weight M r relative molecular mass (units=K) PCV packed cell volume PHA phytohaemagglutinin xi PMA = (TPA) phorbol 12-myristic 13-acetate RBE RBF binding element RBF Ras-responsive region binding factor RNA ribonucleic acid TPA tetradecanoyl phorbol acetate PMSF phenylmethylsulfonyl fluoride SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis mSos mammalian son of Sevenless STAT signal transducer and activator of transcription TAF TBP-associated factor TBC HIV-1 TATA box-binding complex TBP TATA-binding protein TLC thin layer chromatography TNF tumor necrosis factor T3R thyroid hormone (T3) receptor Tris tris(hydroxymethyl)aminomethane v volume xii A C K N O W L E D G E M E N T S I would like to thank, in no particular order, those people who contributed to the completion of this thesis. I thank Ivan Sadowski for providing me with the infrastructure and especially the intellectual freedom that made these experiments possible. I thank the National Cancer Institute of Canada for financial support during most of this work. I thank Dr. Peter Candido for critical reading of this thesis and Dr. Michel Roberge for reading the thesis as well as for his advice throughout the course of my doctoral training. I wish to thank all the former and present members of the lab who have helped me along the way. Special thanks goes to Dr. Wesley Hung who was a source of technical and moral support from start to finish. I gratefully acknowledge Mario Estable for a productive collaboration during the latter part of this work and for many stimulating discussions on HIV-1 biology. Thanks goes also to Logan Donaldson for discussions and recombinant Ets-1 protein. On a more personal note, I thank JRR for the sparring matches that kept me sane near the end and T for making sure I could take a punch. Above all, my sincere thanks to Barb, Kevin, Mom, Dad, Shannon and especially Christie for their support during this endeavor. xiii 1. I N T R O D U C T I O N 1.1 Rationale The regulation of transcription in eukaryotic cells is currently one of the most intensively studied problems in biological research. The prodigious efforts to understand the regulation of protein-encoding genes are due to the fact that changes in their expression are fundamental to normal biological processes, such as growth and development, as wel l as to abnormal conditions, most notably cancer. Most genes are regulated at the level of transcription, where in eukaryotes R N A polymerase II and its associated regulatory machinery transcribe D N A into R N A . Other post-transcriptional regulatory mechanisms, such as control of R N A processing and degradation or translational control, can also play important roles i n the regulation of gene expression. Another area of current interest in biology is the study of oncogenes, w h i c h are aberrant genes that cause cancer. Dominant acting oncogenes invariably encode variant forms of cellular proteins that are involved in regulating cellular growth i n response to extracellular signals. Many of the oncogenes isolated early on from transforming retroviruses have turned out to be part of a signal transduction pathway now known as the P T K (protein-tyrosine kinase)/Ras/Raf axis. These include growth factors (e.g., v-sis), growth factor receptors (v-erbB, v-kit, v-fms), signaling molecules downstream of growth factor receptors (v-src, v-fps, v-ras, v-raf) and finally nuclear transcription factors that respond to growth factors (v-jun, v-fos, v-ets) (Cantley et al, 1991). The work described in this thesis began when the only known downstream target for tyrosine kinases was Ras (Smith et al., 1986). The rationale for this study was therefore two-fold. The first aim was to identify transcriptional targets of the v -fps P T K and the second, to characterize the mechanisms by which P T K signals specifically regulate transcription of a target gene. In 1988 it was observed that 1 oncogenic v-fps PTK activated the HIV-1 long terminal repeat (LTR) 10-12 fold in Rat-2 fibroblasts (I. Sadowski, unpublished). Subsequently several reports were published also demonstrating that the PTK/Ras/Raf pathway stimulates the HIV-1 LTR in various cell types (Arenzana-Seisdedos et al, 1989; Baldari et ah, 1992; Bruder et al, 1993; Dehbi et al, 1994; Eicher et al, 1994; Hohashi et al, 1995). In this thesis I describe experiments that identify novel czs-acting elements of the HIV-1 LTR that are required for response to the PTK/Ras/Raf pathway. Moreover I provide an initial characterization of two specific DNA binding factors that recognize these sequences which I have termed Ras response element binding factors one and two (RBF-1 and RBF-2). 1.2 The PTK/Ras/Raf Signal Transduction Pathway One of the great triumphs in cancer research in the last 10 years has been the delineation of a signal transduction pathway which, when deregulated by the action of retrovirus-encoded oncogenes, results in neoplastic transformation of cells (reviewed by Bishop, 1985; Bishop, 1995; Cantley et al, 1991; Egan & Weinberg, 1993). These studies have not only given us the first understanding of the molecular mechanisms underlying cancer, but have also revealed the basic biochemical pathways by which growth factors impinging on the outside of cells transmit their signals to the nucleus. By 1985 the transforming genes of many oncogenic retroviruses had been isolated and overexpressed. The availability of recombinant oncoproteins led to the discoveries of their intrinsic biochemical properties. Oncogenes with protein-tyrosine kinase, serine/threonine kinase and guanosine triphosphatase enzymatic activity had been discovered (Bishop, 1985). However, the common cellular function that allowed them all to transform cells was a mystery. The achievements of the following decade of research yielded a reasonably complete unifying picture now found in biochemistry text books. This current view links many, though not all, of the once apparently disparate oncoproteins into a pathway 2 known as the growth factor, or PTK/Ras /Raf , signal transduction pathway from outside the cell to nuclear factors that regulate gene expression (Egan & Weinberg, 1993) (see Fig. 1). 2.2.2 Protein -tyrosine kinases V-fps and other tyrosine kinases are known to be the earliest signaling molecules in the pathway. Their tyrosine kinase activity is controlled through multimerization induced by binding of the relevant ligand (Ullr ich & Schlessinger, 1990). Ligands can be peptide growth factors, cytokines, trophic factors, antigen, or molecules expressed on the exterior of neighboring cells. In the case of growth factor receptors, such as epidermal growth factor receptor EGFR, the tyrosine kinase domain is located on the cytoplasmic portion, and the ligand binding doma in resides on the extracellular part of a single polypeptide. In the case of non-receptor PTKs, the kinase activity is regulated by non-covalent interaction w i t h transmembrane molecules that bind ligands. The classic example of this class of P T K is the interaction between the lck P T K and the CD4 coreceptor (Veillette et al., 1988). Once the P T K activity is induced following ligand binding PTKs cross-phosphorylate on tyrosine residues. These phosphotyrosine moieties then become binding targets for src homology 2 (SH2) domain-containing proteins. 1.2.2 Linking Protein-tyro sine kinases to Ras Two pathways involving cytosolic "adapter proteins'are known to l ink PTKs to Ras. One pathway, used by the EGFR, involves the recruitment of Grb2, an SH2 and SH3 domain-containing protein. Phosphotyrosine residues of the activated receptor interact wi th the Grb2 SH2 domain (Egan & Weinberg, 1993). The SH3 domains of Grb2 recruit mSos by binding to its proline rich motifs (Li et al., 1993; Rozakis-Adcock et al., 1992). MSos contains a catalytic nucleotide exchange d o m a i n and, when brought to the cell membrane by association wi th Grb2 (bound to an 3 Receptor Figure 1. Schematic diagram of the protein-tyrosine kinase (PTK)/Ras /Raf signal transduction pathway. Signals transduced by transmembrane receptor PTKs are o n the left, those transduced by cytoplasmic-membrane-associated src-family PTKs are on the right and involve the She adaptor protein. Central to this pathway is the small GTP-binding protein Ras, which is regulated by the guanine nucleotide exchange factor mSOS (son of Sevenless). Grb-2 and She are S H 2 domain containing adapter proteins that bind to tyrosine-phosphorylated PTK, l inking them to mSOS. Raf protein kinase activity is regulated by recruitment to the membrane by association wi th the GTP-bound effector domain of Ras. The mitogen activated protein kinase ( M A P K ) and M A P K / E R K kinase (MEK) are activated downstream of Raf. Activated M A P K can translocate to the nucleus and modulate transcription factor activity by phosphorylation. 4 activated PTK) , stimulates the release of G D P from membrane bound Ras 1 . A s G D P is released Ras can become activated by binding GTP (Bourne et al, 1991). The second pathway to Ras activation used by the non-receptor P T K v-src and v-fps is through the adapter She (Egan et al, 1993; McGlade et al, 1992; Rozakis-Adcock et al, 1992). She is a SH2 domain-containing protein that associates wi th Grb2 when She is phosphorylated by v-src or v-fps. Grb2 then binds to mSos and activates Ras at the plasma membrane as discussed above. 2.2.3 Activation ofRafand the MAP kinase cascade The effector domain of Ras can bind to Raf-1, a serine/threonine kinase, when in the activated GTP bound form. Thus, once Ras has been activated by either of these adapter pathways it recruits Raf-1 to the plasma membrane (Moodie et al, 1993; V a n Aelst et al, 1993; Vojtek et al, 1993). Once at the membrane, Raf becomes activated by an, as yet, ill-defined mechanism (Leevers et al, 1994; Stokoe et al, 1994). Act ivat ion of Raf initiates a kinase cascade where Raf phosphorylates and activates M E K ( M A P K / E R K kinase) (Dent et al, 1992; Kyriakis et al, 1992). M E K i n turn activates M A P kinase by phosphorylation on tyrosine and threonine residues in a T E Y motif (Chen et al, 1992; Rossomando et al, 1992). Finally, M A P kinase can translocate from the cytoplasm to the nucleus and phosphorylate transcription factors (Chen et al, 1992). Phosphorylation of transcription factors such as Ets family members and Jun results in increased expression of immediate early genes (see section 1.3.7 below). Furthermore, M A P kinase can phosphorylate and activate ribosomal S6 kinase (RSK) (Sturgill et al, 1988), which may also lead to changes i n gene expression. 1 The guanine 5' triphosphatase (GTPase) activity of Ras, which hydrolyses GTP to G D P is stimulated by the GTPase activating proteins (GAPs) G A P (Trahey & McCormick, 1987; Trahey et al, 1988) and neurofibroma (NF1) (Xu et al., 1990). It was unclear for sometime whether G A P was a mediator or terminator of P T K / R a s signals (McCormick, 1989). Elegant experiments w i th embryonic cells from G A P knock-out mice have recently demonstrated t ha t G A P is dispensable for mitogenic signaling through PTKs, but instead is necessary for the downregulation of Ras following signalling through receptor PTKs . 5 1.2.4 Specificity and cross-talk in the Ras signal transduction pathway Although this pathway functions in all animal cell types studied, and is very satisfying in its relative simplicity, it is important to view it as the scaffold of a much more complicated network of interconnected pathways (Hunter, 1997). In addition to mSOS and She, activated PTKs can recruit the SH2 domain-containing proteins phosphatidyl inositol 3-kinase (PI3 kinase) and phospholipase C (PLC). PI3 kinase activation leads increased PI3 and protein phosphorylation (Courtneidge & Heber, 1987; Kaplan et al., 1987), and activates the Akt proto-oncogene as a downstream target (Franke et al., 1995). PLC activation generates the second messengers inositol 1.4.5 triphosphate and diacylglycerol, which activates the protein kinase C pathway (Berridge, 1987). The more subtle specificities of the PTK/Raf/Ras pathway and the myriad of points of cross-talk with other pathways remain to be worked out. In its simplest form, signaling specificity can be determined by the receptors and Ras-responsive transcription factors expressed by a given cell type. For example, T cells express the T cell (TcR) and interleukin-2 (IL-2) receptors, both of which impinge on the Ras pathway (Downward et al., 1990; Satoh et al., 1992; Satoh et ah, 1991). T cells express a subset of Ets-family transcription factors, including Ets-1, Ets-2 and Elf-1 (Janknecht & Nordheim, 1993; Wasylyk et al, 1993). In contrast, macrophage cells express granulocyte/macrophage colony stimulating factor (GM-CSF), colony stimulating factor 1 (CSF-1) and interleukin-3 (IL-3) receptors which act through the Ras pathway (Bortner et al, 1991; Satoh et al, 1991), and they express a different subset of Ets-family transcription factors, including PU.l (Janknecht & Nordheim, 1993; Wasylyk et al, 1993). A much less appreciated level of additional specificity likely exists. There are four true Ras genes, N-ms, H-ras, K-rasA and K-rasB, that may have different signaling properties . In addition, there are several families of ras related genes including the Rab, Arf, Ran and Rho families. These ras-related genes regulate signaling pathways distinct from Ras (Huff et al, 1997). Moreover, almost all of 6 components of the PTK/Ras/Raf pathway have multiple genes or alternative gene products. The contribution of these different forms to signaling specificity in vivo is completely unknown but likely represents more than functional redundancy. Another problem with a simple view is that there is likely to be cross-talk between the Ras pathway and other pathways. For example, the cyclic adenosine 3', 5'-monophosphate (cAMP) pathway can inhibit the activation of Raf by Ras (Cook & McCormick, 1993). Finally, it is important to note that new pathways are being discovered. Recently, a pathway influenced directly or indirectly by Ras that uses a JNK/SAP kinase cascade to direct changes in c-fos expression has been described (Vojtek & Cooper, 1995). 1.3. Transcriptional Regulation Like the field of oncogenes, the field of transcriptional regulation has enjoyed rapid progress in recent years. While many questions remain, a coherent framework for understanding the mechanistic details of transcriptional activation is now in place. Transcriptional regulation is primarily dependent on DNA sequences located 5' of the gene that contain cz's-acting DNA elements which bind transcriptional regulatory proteins. The term promoter is used to describe cz's-acting sequences required for transcription that are near the start site of transcription. The term enhancer applies to cz's-acting regulatory sequences that modulate transcription from the promoter and can be thousands of base pairs away from the promoter. Promoters act as nucleation centres for the enzymatic machinery that catalyzes the synthesis of RNA from a DNA template. 1.3.1 The RNA polymerase II holoenzyme The discovery, first in yeast (Koleske & Young, 1995), and later in mammalian cells (Chao et al, 1996; Maldonado et al, 1996; Ossipow et al, 1995), that RNA polymerase II exists in a large complex termed the holoenzyme, has simplified our 7 view of transcriptional regulation. The R N A Pol II holoenzyme contains R N A P o l II together wi th several of the general transcription factors (GTFs) and the suppressor of R N A polymerase B (SRB) proteins. A model whereby the holoenzyme is recruited to a promoter as a pre-formed complex (Fig. 2) is currently favored over an older model of transcriptional regulation that evoked a step-wise addition of the various GTFs and Pol II to TFIID at the T A T A element. 1.3.2 The general transcription factors (GTFs) The GTFs were initially characterized as chromatographic fractions from eukaryotic nuclear extracts required for in vitro transcription reactions. Laborious purifications by several laboratories resulted in the identification of c D N A s for most of the known subunits of the GTFs, including TFIIA, TFIIB, TFIID, TFIIE, TFIIF and TFIIH (Buratowski, 1994; Conaway & Conaway, 1993; Zawel & Reinberg, 1995). The functions of the GTFs and some of the holoenzyme components are listed in Table 1. 8 F igu re 2. A simplified model for regulation of transcription by eukaryotic RNA polmerase II. (A) The repressed or "off" state of a promoter where it may be bound by histones in chromatin. (B) Recruitment of TFIID by promoter bound transcription factors is a rate-limiting step for transcriptional activation and can involve chromatin remodeling. Arrows symbolize known protein-protein interactions between promoter specific transcription factors and the TAFs (C) A second rate limiting step is the recruitment of the RNA Pol II holoenzyme to the promoter. Both yeast and human components are included in this generalized schematic. See text for explanation. The initiator element is indicated by Inr. CTD indicates the carboxy terminal domain of RNA polymerase II. 9 10 Table 1. Names and properties of Eukaryotic General Transcription Factors (GTFs) and Holoenzyme components Factor Composition Function Holoenzyme: R N A polymerase II Srbs TFIIB TFIIF TFIIH S w i / S n f G a l l l , Sin4, R g r l , p50 complex 10 subunits 10 proteins One protein Three subunits: Rap 74, Rap 30, and Tfg3 (non-essential) Mul t ip le subunits About 10 proteins R N A polymerase activity, initiation site selection Interact wi th C T D , suppress C T D truncations Binds TBP, binds activators, acts as bridge between TBP and Pol II Recruits R N A Pol II, Rap 70 binds TAFTT250 D N A repair, helicase and C T D kinase activities Chromatin remodeling, DNA-s t imu la t ed ATPase activity Unknown , interacts wi th activators? Other: TFIIA Heterodimer of a and p subunits Binds TBP and stabilizes T B P - T A T A box interaction, required for activated transcription TFIID TBP plus approximately Sequence specific 12 TBP associated factors ( T A T A box) D N A (TAFs, see Table 2) binding, nucleation of initiation complex formation, binds TFIIA, TFIIB, and some activators 11 2.3.3 TFIID:TBP and TAFs The only GTF with specific D N A binding activity is TFIID. TFIID binds to the T A T A box element present in most, but not all, eukaryotic promoters (Breathnach & Chambon, 1981). TFIID contains the T A T A - b i n d i n g protein (TBP) plus approximately 12 tightly associated polypeptides termed TBP associated factors (TAFs) (Burley & Roeder, 1996; Hernandez, 1993). TBP binds directly to the m i n o r groove of T A T A boxes though its saddle-like D N A binding domain, resulting i n marked bending and unwinding of promoter D N A at the T A T A box (Chasman et al, 1993; K i m et al, 1993a; K i m et al, 1993c; N iko lov et al, 1996). TBP is central to transcription not only at class II promoters but also for transcription by R N A Pol I and Pol III (Hernandez, 1993). In the case of promoters lacking T A T A boxes, an element called the initiator recruits TFIID through interactions wi th initiator binding factors, like Y Y 1 , or through direct interactions wi th TAFs (Gi l l , 1994; Martinez et al, 1995). The properties of the TAFs have been reviewed extensively (Burley & Roeder, 1996; Tjian, 1996) and for brevity are listed in Table 2. 12 Table 2. Names and Properties of the Human T A F s T A F Name Funct ion hTAFn250 Same as cell cycle control gene product C C G 1 , binds and phosphorylates RAP74, histone acetyltransferase activity, contains H M G and Bromo domains hTAFnl35 Binds TFIIA and SP1 hTAFnl05 B cell specific, homologous to hTAFnl35 * h T A F u l O O Binds RAP30, contains W D repeats * hTAFn80 Structural similarity to histone H4, binds TFIIE and TFIIF hTAFn68 Binds to R N A and single stranded D N A , associates wi th Pol II holoenzyme * hTAFn55 Binds to several transcription factors including SP1, Tat, YY1 hTAFn43 h T A F n 3 1 Structural similarity to histone H 3 , binds VP16, p53 and TFIIB hTAFn30 Binds the estrogen receptor hTAFn28 hTAFn20 Structural similarity to histone H2B h T A F n l 8 Homology to yeast SPT3 gene product h T A F n l 5 ? * hTAFIIs 105, 100 and 68 have not been reviewed in the references given in the text. The references for their recent characterizations are (Dikstein et al, 1996), (Dubrovskaya et al, 1996), (Bertolotti et al, 1996), respectively. 13 2.3.4 Promoter specific transcription factors The GTFs, including TFIID, are generally regarded as playing equivalent roles at all class II promoters. There are important exceptions to this idea, since there is evidence of specificity in GTF usage by different promoters (Parvin et al., 1992) and different compositions of TAFs in TFIID at different promoters (Dikstein et al., 1996). Since huge fluctuations in the levels of mRNA of thousands of different genes are required for eukaryotic cells to proceed through the cell cycle, respond to their environment, and undergo orchestrated developmental programmes, promoter specific transcription factors are required for the differential regulation of individual promoters. Promoter specific transcription factors are sequence-specific DNA binding proteins that characteristically contain discrete functional domains. These include DNA binding, dimerization, regulatory and transcriptional activation domains. Sequence specific transcription factors can be grouped into families based on homology of their DNA binding domains. The portions of DNA binding proteins required to contact DNA specifically tend to be small, usually between 60 and 100 amino acids and are therefore readily amenable to structural studies. To date, the structure of one third of the known DNA binding domains of biologically important transcription factor families have been solved. Structures of commonly found DNA binding motifs include the helix-turn-helix motif (e.g., CAP, lambda repressor), the basic leucine zipper (bZIP) (e.g., Jun, Fos), the homeodomain (e.g., engrailed, Hox transcription factors), the zinc finger (e.g., TFIIIA), the zinc cluster (e.g., Gal 4), the winged helix-turn-helix (e.g., Ets), the Rel domain (e.g., p50 of N F - K B ) , steroid receptor family (e.g., glucocorticoid receptor), high mobility group (HMG) domain (e.g., LEF), and the basic helix-loop-helix (bHLH) (e.g., Myc, MyoD, AP4) (for reviews see (McKnight, 1996; Pabo & Sauer, 1992). The potential specificities and affinities of transcription factors are greatly enhanced by combinations of these DNA binding 14 motifs. This can occur within a single transcription factor, for example Oct-1 contains both POU and homeodomain DNA binding domains (Gehring et al, 1994). The versatility of transcription factors can also be increased by interaction between two different DNA binding proteins, as with dimerization of Jun and CREB, which alters the DNA specificity of Jun (Macgregor et al., 1990). The regulatory domains of transcription factors may mediate protein-protein or protein-ligand interactions, be involved in allosteric changes upon DNA, or be sites of post-translational modification (e.g., phosphorylation). The activation domains often fall into the categories of acidic, proline rich or glutamine rich (Mitchell & Tjian, 1989) and act by directly or indirectly contacting components of TFIID or the holoenzyme (see below). 1.3.5 The role of chromatin in transcription Superimposed on the interactions of the GTFs and the promoter specific activators is another level of transcriptional regulation. Eukaryotic genes are tightly packed into chromatin under physiological conditions. A clear mechanistic explanation for the role of chromatin in transcriptional regulation is presently elusive. However, several observations suggest that chromatin "remodeling" may play a role in transcriptional regulation. In yeast, the SWI/SNF gene products have been implicated genetically in the chromatin-dependent regulation of subsets of promoters (Kingston et al, 1996; Pazin & Kadonaga, 1997; Struhl, 1996). These results have also been extended to mammalian cells, where SWI/SNF homologs can also potentiate gene transcription in vitro (Kwon et al, 1994) and in vivo (Muchardt and Yaniv, 1993). Importantly, SWI/SNF-containing complexes have recently been shown to associate with the RNA polymerase II holoenzyme (Wilson et al, 1996). The chromatin field is therefore poised for rapid progress. Nonetheless, at present most studies on the role of chromatin in transcription by mammalian RNA 15 polymerase II rely on the assembly of chromatin templates in vitro (reviewed in (Paranjape et al., 1994). To what extent this system resembles the in vivo physiological situation is presently unclear. 1.3.6 Mechanisms of activation and repression of transcription The transcription cycle involves several steps including initiation of RNA synthesis, promoter clearance of the engaged holoenzyme, elongation of the transcript, termination of mRNA and coupling of transcription with post-transcriptional events like splicing, polyadenylation and mRNA transport. In principle, each of these events can be subject to regulation by gene specific transcription factors. The most studied process in transcription is currently initiation, the rate of which is known to be increased by most transcriptional activators. Many activators also appear to affect transcript elongation (also referred to as processivity) (Yankulov et ah, 1994). Initiation of transcription requires that the chromatin structure of a promoter be altered to allow access of TFIID, that TFIID be recruited to the promoter and that the holoenzyme be recruited by promoter-bound TFIID. A plethora of in vitro interactions between activators, TFIID components and GTFs has been detected (reviewed in Burley & Roeder, 1996; Tjian, 1996), see also Tables 1 and 2). In addition, numerous interactions between activators or TAFs and holoenzyme components have been documented. In contrast to the complexity of these in vitro observations, in vivo experiments suggest a much simpler picture where multiple weak protein-protein interactions act in a concerted fashion to direct large protein complexes to promoters. Indeed, in vivo, it seems there are two rate limiting steps subject to regulation, the recruitment of TBP (Chatterjee & Struhl, 1995; Klages & Stubin, 1995; Klein & Struhl, 1994; Stargell & Struhl, 1996) and recruitment of the holoenzyme (Stargell & Struhl, 1996). Thus, the most clearly defined function for activators is to increase the recruitment of TBP and the holoenzyme through multiple protein-protein interactions. 16 Transcriptional repressors have not been studied to the same extent as activators, but are thought to function in essentially the opposite fashion. Some function by competing for the same czs-acting sequence as activators, recruiting nucleosomes, blocking interaction between activators and their targets, or by inhibiting the transcription apparatus by as yet poorly defined mechanisms (Hanna-Rose & Hansen, 1996). Examples of transcriptional repressors include Motl, which inhibits the binding of TBP to TATA boxes (Auble et al, 1994), and Drl, which binds to TBP and prevents its interaction with TFIIA and TFIIB (Inostroza et al, 1992). In some instances, a single transcription factor may function as a repressor and an activator. For example, GABP can repress or activate transcription depending on its promoter context (Genuario & Perry, 1996). The activator or repressor function of a transcription factor can also be switched by cell signals. For example, the Ets family member Net functions as a repressor in unstimulated cells but becomes an activator upon activation of the Ras signal transduction pathway (Giovane et al., 1994). 1.3.7 Regulation of transcription by extracellular signals The rate of transcription of a given gene is influenced by intracellular signals, defined by the developmental state or the phase of the cell cycle, and by extracellular signals, such as growth factors and cytokines. Extracellular signals regulate transcription factors by several mechanisms. The most direct mechanism is illustrated by steroid hormones that simply diffuse into the target cell and bind to their DNA binding receptors causing their activation (Beato, 1989). Extracellular signals which act through the PTK/Ras/Raf pathway trigger transcriptional responses without having entered the cell. These signals act on transcription factors by altering their phosphorylation status (reviewed in (Bohmann, 1990; Hill & Treisman, 1995; Hunter & Karin, 1992; Jackson, 1992; Karin, 1991). Phosphorylation of a transcription factor can alter its DNA binding function [e.g., c-Jun (Boyle et al., 1991)], its cellular location [e.g., N F - K B (Baeuerle & Baltimore, 1996)], or interaction with protein targets [e.g., Elk (Gille et al, 1992)]. 17 1.3.7.1. Ets transcription factors as targets of the PTKIRas /Raf pathway The Ets family of transcription factors are a common nuclear target of the PTK/Ras/Raf pathway. The ternary complex factor (TCF) subfamily of ETS DNA binding domain proteins, including Elkl and SAP1 (Hill & Treisman, 1995) act together with serum response factor (SRF) to respond to Ras signals. Net (ERP/SAP-2), a recently characterized TCF Ets family member, also responds to Ras, although the mechanism may be distinct from that of Elkl and SAP1 (Giovane et al, 1994; Lopez et ah, 1994; Price et al, 1995). The Drosophila ETS domain proteins encoded by yan and pointed have been shown to be downstream targets of the Ras/MAPK pathway (Brunner et al, 1994; O'Neill et ah, 1994). Transdominant Ets proteins have also been shown to inhibit Ras mediated trans-activation of Ets dependent transcription and transformation of NIH3T3 cells by Ras (Wasylyk et al., 1994). GABP, an ETS domain transcription factor, has also recently been found to respond to the PTK/Ras/Raf pathway (Flory et al., 1996; Ouyang et al, 1996). Other ETS domain proteins shown to be Ras responsive include Etsl, Ets2 (Rabault et al., 1996; Wasylyk et al, 1997; Yang et al, 1996), and ER81 (Janknecht, 1996). Ets family members generally require the cooperation of at least one other transcription factor for regulating transcription in response to oncogenic signals (Galang et al, 1994). For example, activation of the polyoma enhancer by oncogenes requires Fos and Jun, in addition to Etsl or Ets2 (Wasylyk et al, 1990). 1.4 Transcriptional Regulation of Human Immunodeficiency Viruses 1.4.1 Gene expression in the lifecycle of HIV type 1 (HIV-1). Human immunodeficiency viruses, including types 1 and 2 (HIV-1, 2), are pathogenic human retroviruses responsible for the AIDS pandemic. Briefly, the HIV-1 lifecycle involves the binding of virions to their primary receptor, CD4 on target cells (usually T helper cells or macrophages). The newly described chemokine 18 receptors serve a coreceptor function that allows HIV to fuse with host cell (Bates, 1996; Wain-Hobson, 1996). The two copies of positive strand RNA are then released into the host cell cytoplasm where the virally encoded reverse transcriptase and RNAse H activities convert them to double-stranded DNA. The DNA is translocated to the nucleus and integrates into the host chromosome using virally-encoded integrase. The integrated provirus is a hallmark of retroviruses and depends entirely on the host cell RNA polymerase II apparatus for its expression. For a review of the HIV-1 replication cycle, see Vaishnav & Wong-Staal ,1992. HIV viruses share with other primate and ungulate lentiviruses the property of establishing infections where large numbers of lymphocytes and macrophages harbor transcriptionally silent proviruses (Embretson et al, 1993). HIV infected cells in this state of post integration latency2 have been well documented in cell line models (Garcia-Blanco & Cullen, 1991), the peripheral blood mononuclear cells of experimentally infected chimpanzees (Saksela et al., 1993) and, most notably, in the lymph nodes (Embretson et al., 1993) and peripheral blood lymphocytes (PBLs) (Bagnarelli et al, 1992; Michael et al, 1992; Patterson et al, 1993; Saksela et al, 1994) of HIV infected patients during all stages of disease. Cells with actively replicating HIV are also present during all stages of disease in lymphatic tissue and peripheral blood mononuclear cells (Ho et al, 1995; Pantaleo et al, 1993; Wei et al, 1995). Estimates of the number of cells that contain latent proviruses vary and do not address the question of whether or not the cells assayed contain defective or functional viral genomes. However, at least during the asymptomatic phase of disease, the vast majority of infected cells do not express full length viral RNA or 2 The definition of latency has been the subject of much debate, especially in the H I V field. To avoid confusion about phrases like cl inical latency, true latency or pre-integration latency, I define latency as it is used in this thesis. Latency describes the virus-host cell re la t ionship characterized by the presence of a functional (as opposed to defective), integrated provirus that does not express experimentally detectable full length vi ra l m R N A . 19 produce virions (reviewed in (Bednarik & Folks, 1992; Laughlin & Pomerantz, 1994; McCune, 1995). The role of the latently infected cell population in HIV pathogenesis remains enigmatic since the number of these cells, their microenvironment, their life span and the signals that cause them to actively produce virus in vivo are largely unknown (McCune, 1995; Perelson et al., 1996). One critical role for latently infected cells in HIV pathogenesis may be to ensure viral persistence, by providing an inducible reservoir of virus that evades clearance by the immune system. A critical step in understanding the dynamics of cellular latency is the elucidation of the molecular events that activate the expression of HIV RNA from latent pro viruses. 2.4.2 The 5' long terminal repeat in regulation of HIV-1 transcription The level of HIV gene expression is initially determined by cellular transcription factors that interact with the 5' long terminal repeat (LTR) to direct viral RNA synthesis by the host cell RNA polymerase II machinery. Once viral transcription has occurred, the viral trans-activator Tat acts in concert with cellular factors to augment HIV expression by interacting with the nascent TAR RNA stem-loop structure (Cullen, 1993). The HIV-1 LTR is arguably the most intensively studied promoter to date and is saturated with identified and putative binding sites for cellular transcription factors. Because most studies of HIV transcription have involved in vitro binding assays and expression of HIV-1 LTR reporter gene constructs in transient transfection assays, the role of many of these factors remains obscure. However, factors characterized early on like SP1 and N F - K B have been studied in great detail and mutations in their binding sites have been studied in the context of recombinant whole virus (Kim et al, 1993b; Leonard et al, 1989; Parrott et al, 1991). The HIV-1 LTR has been reviewed extensively (Garcia & Gaynor, 1994; Gaynor, 1992; Greene, 1990; Jones, 1993; Jones & Peterlin, 1994; Kingsman & Kingsman, 1996; Nabel, 1993; Roulston et al, 1995). The binding sites of cellular transcription factors that interact with the HIV-1 LTR are diagrammed in Figure 3. 20 1.4.2.1 TAR The best characterized elements of the HIV-1 LTR are TAR, the TATA box, the SP1 sites, and the N F - K B enhancer motifs. TAR is the RNA leader sequence of HIV mRNAs and forms a stable stem-loop structure that binds both the HIV-1 Tat protein and cellular factors (Dingwall et ah, 1990; Gatignol et al., 1996; Roy et ah, 1990). Binding of Tat in combination with an undefined set of cellular proteins to nascent TAR is strictly required for the trans-activation of the LTR by Tat (Peterlin e t ah, 1993). The only cellular RNA binding protein definitively shown to be a Tat cofactor to date is Tat-SFl (Zhou & Sharp, 1995; Zhou & Sharp, 1996), although there are many other candidates (Peterlin et ah, 1993). 1.4.2.2 The HIV-1 TATA box As with all functional TATA box elements, the HIV-1 TATA box binds to TBP in z>zfro(Chiang et ah, 1993; Kashanchi et ah, 1994b). The HIV-1 TATA element is important for both basal and Tat-activated (Berkhout & Jeang, 1992; Garcia et ah, 1989; Zeichner et ah, 1991), but not NF-KB-mediated (Bielinska et ah, 1989) transcription. The HIV-1 TATA box architecture is strictly required for Tat trans-activation since heterologous TATA boxes will not support Tat frans-activation (Berkhout & Jeang, 1992; Kamine et ah, 1993; Lu et ah, 1993; Ou et ah, 1994). The requirement for a TATA box in Tat function can be explained by the functional (Pendergrast et ah, 1996; Veschambre et ah, 1995) and physical (Kashanchi et ah, 1994a; Veschambre et ah, 1995) interactions between Tat and TBP. However, a simple model where the Tat-TBP interaction is necessary and sufficient for Tat activation cannot explain four observations: i) mutations of sequences flanking the TATA box can abrogate Tat trans-activation (Lu et ah, 1993; Ou et ah, 1994), ii) mutations to the HIV-1 TATA motif that increase TBP binding do not increase Tat trans-activation (Kashanchi et ah, 1994b; Olsen & Rosen, 1992), iii) the HIV-1 TATA box is uniquely able to assemble non-processive transcription complexes (Lu et ah, 1993), and iv) 21 truncations or substitutions in TBP affect both these non-processive and Tat trans-activated processive transcripts equivalently (Pendergrast et al., 1996). Thus, the HIV-1 TATA box region binds cellular factors, including TBP (and presumably a subset of the TAFs) that render it particularly capable of setting up transcriptional complexes that are highly responsive to trans-activation by the viral Tat protein. The identity of these factors, however, has not been determined. 1.4.2.3 SP1 sites Immediately upstream of the HIV-1 TATA box are three binding sites for the SP1 transcription factor (Jones et al., 1986). These sites together are important for basal and Tat-activated transcription, although a mutation in any individual site has only a minor effect on HIV-1 transcription (Harrich et al., 1989). Moreover, the SP1 transcription factor itself has been shown to be critical for basal and Tat-activated transcription in vitro (Sune & Garcia-Blanca, 1995). SP1 binding sites are critical for the activity of Tat (Berkhout & Jeang, 1992; Kamine & Chinnadurai, 1992; Kamine et al., 1993; Kamine et al., 1991; Southgate & Green, 1991). However, this requirement is not strict in the sense that binding sites for other factors, such as API or ATF, can substitute functionally for SP1 motifs (Berkhout & Jeang, 1992; Southgate & Green, 1991). 1.4.2.4NF-KB (enhancer region) Further upstream of the TATA box, at positions -104 to -81 with respect to the transcriptional start site, are two N F - K B motifs. These motifs bind to the N F - K B family of transcription factors that can activate HIV-1 transcription in T cells (Nabel & Baltimore, 1987; Nabel, 1993) and monocytes (Griffin et al, 1989; Roulston et al, 1995) in response to stimuli including phorbol esters (Griffin et al, 1989; Nabel & Baltimore, 1987) and tumor necrosis factor (Duh et al, 1989; Kinter et al, 1990). The NF-KB/Rel family of transcription factors are regulated by cytokines such as IL-1, IL-2 and tumor necrosis factor alpha (TNFa), bacterial lipopolysaccaride (LPS) and 22 numerous pharmacological reagents like the tumor promoter PMA. N F - K B / R e l family members are normally sequestered in the cytoplasm of resting non-B cells by the inhibitory IKB family of regulatory proteins. Signals that activate N F - K B act by phosphorylating I K B , which targets it for rapid degradation by the ubiquitin-dependent proteasome pathway, exposing the nuclear localization signal of N F - K B . N F - K B then translocates to the nucleus where it can activate promoters that contain its cognate DNA binding site. The intense study of the N F - K B / R e l family of transcription factors for more than a decade has revealed many of the molecular mechanisms that regulate these transcription factors (reviewed by Baeuerle & Baltimore, 1996; Verma et al, 1995). Recent data suggest that NFATc, which is distantly related to N F - K B in its DNA binding domain, can also bind to the N F - K B motifs of the HIV-1 LTR and activate transcription in T cells (Kinoshita et al., 1997). Importantly, there are Ets binding sites embedded in the HIV-1 N F - K B sites. These bind to a complex of GABPcc and GABPPi (Flory et al, 1996), as well as Ets-1 (Seth et al, 1993), Ets-2 (Hodge et al, 1996) and Fli-1 (Hodge et al, 1996). A very recent report demonstrates that the physical interaction between Ets family members and NF-KB/Rel or NFAT family members are necessary for their synergistic activation of the HIV-1 and HIV-2 LTRs (Bassuk et al, 1997). 1.4.2.5 Repressors of HIV-1 transcription In addition to positive acting transcription factors, there are cellular transcription factors that repress HIV-1 transcription. LBP-1 binds to the LTR near the TATA box and initiator and represses transcription by inhibiting the binding of TFIID to the HIV-1 TATA element (Kato et al, 1991; Parada et al, 1995; Yoon et al, 1994). YY1 can also bind to and inhibit the HIV-1 LTR (Margolis et al, 1994). An ever increasing amount of cellular factors can bind to the LTR and modify its transcription under certain experimental conditions. Since the roles of these factors remain less clear than those of described above, they are summarized in 23 Table 3 and their binding sites are summarized in Figure 3. The myriad of factors that bind to the LTR confers on it a certain plasticity. This plasticity has been documented by the replication of mutant LTR-containing viruses in cell culture systems (Leonard et al., 1989; Ross et al., 1991). Plasticity has also been observed by sequencing LTRs from HIV infected individuals (Estable et al., 1996; Zhang et ah, 1997). Mutations in the HIV-1 TATA box that increase its affinity for TFIID and TFIIA in were found to rescue viral replication in SP1 deleted viruses (Kashanchi et al., 1994b). In addition, viruses that caused disease progression in an infected human were found to lack the N F - K B sites, but instead contained a duplication 5' of the N F -KB sites (Zhang et al, 1997). 24 Figure 3. Schematic representation of an integrated HIV-1 genome and the 5' long terminal repeat (LTR), as well as putative and known binding sites for cellular transcription factors. (A) Diagram of the HIV-1 genome with the long terminal repeats at the 5' and 3' ends and protein-encoding genes shown as boxes. (B) Expanded diagram of the 5'LTR with binding sites for cellular transcription factors indicated within the U3 region. (C) Nucleotide sequence of the proximal region of the HIV-1 5' LTR with binding sites for transcription factors shown as bars or shapes. Descriptions of these cellular transcription factors can be found in Table 3. 25 A. B. 5' LTR gag pol vpu • rev -A I n vpr env 3" LTR COUP USF hLEF N F - K B SP1 T A T A T A R U3 o • S7 V ooo a R U5 -453 -400 A P 1 -300 c. -200 -100 +1 \ +97 -200 o -140 -130 -120 -190 -180 -170 -160 -150 o o o o o o o o AGAGTCWAGGTTTGACAGCOXCT C/EBP r~ NFIL6-? HGATA-3H \ J F E 3 J •4—• UJ hLEF - 2 2 0 - MAR Y GATA-3H -110 o -100 o -90 o -80 o -70 o -60 o -50 o -40 o GACKTTGCTACAAGGGACTTTCC^ SP1 . C / E B P , •"NFILB"1 <LU PRDII-BF1 T3R \— AP2 H -30 -20 -10 +1 +10 +20 +30 +40 o o o o o o o o TCCTGCATAr^ AGCAGCTGCTTTTTGCCTGTACTGGGTCTCTC - S S R — !_ H — 1ST— LBP J CTF/NF1 YY1 I TFII-IH l_AP4/_, ^ E 4 7 / ^ HTF4 I TFII-I H rPRDII-BF11 HIP116 26 Table 3. Cellular transcription factors that interact with the HIV-1 LTR Factor Properties Function or putative role References in HIV-1 transcription. LBP-1 TBP TMF SP1 SP3 SP4 N F - K B A family of DNA Bind to initiator and binding proteins 58-68 represses transcriptional kDa elongation by preventing TFIID binding to the TATA box. TATA-binding protein, 38 kDa protein that associates with TAFs Binds HIV-1 TATA box and is essential for basal and Tat-mediated transcription. 123 kDa, homology to phage Mu Ner gene product 97 kDa zinc finger protein with glutamine-rich activation domain, binds hTAFnl35 Zinc finger protein related to SP1 Zinc finger protein related to SP1 Family of Rel-related factors; c-rel, p50, p65, p49 Binds to HIV-1 TATA box in vitro, can inhibit LTR transcription in vitro. Important for basal and Tat-activated transciption in vitro and in vivo. (Kato et al, 1991; Parada et al, 1995; Yoon et al, 1994) (Berkhout & Jeang, 1992; Chiang et al, 1993; Garcia et al, 1989; Kamine et al, 1993; Kashanchi et al, 1994b; Lu et al, 1993; Olsen & Rosen, 1992; Ou et al, 1994; Pendergrast et al, 1996; Veschambre et al, 1995; Zeichner et al, 1991) (Garcia et al, 1992) (Harrich et al, 1989; Jones et al, 1986; Parrott et al, 1991; Sune & Garcia-Blanca, 1995) Can repress HIV-1 LTR in (Majello et al, 1994) cotransfection assays. Can activate the HIV-1 LTR through the SP1 sites. Critical for response of the HIV-1 LTR to signals from the PKC pathway, TNF, etc., and to monocyte differentiation. (Majello et al, 1994) (Baeuerle & Baltimore, 1996; Griffin et al, 1989; Nabel & Baltimore, 1987; Roulston et al, 1995) 27 Ets-1 Ets-2 Fli-1 GABP (E4TF1) RBF-2 hLEF RBF-1 YY1 PRDII-BF1 T cell enriched transcription factor, ETS domain, 54 and 68kDa forms T cell enriched transcripion factor, ETS domain, 56kDa ETS domain Heterotetramer, a subunit is 60kDa, P1 subunit is 53kDa Subunits of approximately 110K and M r 100K 53kDa HMG box protein, context specific activation domain, bends DNA, T cell specific Contains GABPa, GABPpi and an unknown protein of M r 100K 68 kDa 300 kDa zinc finger protein Binds to Ets sites overlapping 3' portion of N F - K B motifs and a 5' Ets site in vitro. Binds Ets sites overlapping 3' portion of N F - K B motifs site in vitro. Binds Ets sites overlapping 3' portion of N F - K B motifs site in vitro. Required for Ras-induced HIV-1 transcription, binds to Ets sites overlapping 3' portion of N F - K B motifs and a 5' Ets site. Binds to frequently duplicated sequences 5' of KB sites, required for full Ras-responsive HIV-1 transcription. Can activate HIV-1 transcription on in vitro assembled chromatin templates. Intact binding site required for full Ras-induced HIV-1 transcription. Binds to initiator element to repress HIV-1 transcription. (Holxmeister et al. 1993; Seth et al, 1993) (Hodge et al, 1996) (Hodge et al, 1996) (Flory et al, 1996) (Bell & Sadowski, 1996), Estable et al, in preparation. (Sheridan et al, 1995b; Waterman et al, 1991; Waterman & Jones, 1990) (Bell & Sadowski, 1996; Estable et al, 1996), this work (Margolis et al, 1994) Binds the KB motifs, may (Seeler et al, 1994) activate LTR. 28 AP-2 HTF4 E47 AP4 USF A P I N F A T COUP-TF Myb ILF HIP116 Contains proline rich Binds in a mutally activation domain exclusive fashion to the enhancer with N F - K B proteins, may affect basal transcription in T cells. (Perkins et al, 1994) bHLH domain bHLH domain Binds to E box 3' of TATA box in vitro Binds to E box 3' of TATA box in vitro. bHLH domain, 49kDa Binds to E box 3' of TATA box in vitro. bHLH, 43kDa Fos/Jun T cell specific, regulates IL-2 gene NFATc 120kDa Binds to E-box at -172 to -157, positive regulator of HIV-1 transcription?. Predicted site near 5' terminus of some HIV-1 LTRs, probably no real role. Crude preparations can footprint on the HIV-1 LTR, probably no real function in HIV transcription. Binds NF-kB motifs in vitro, can stimulate HIV-1 transcription in cotransfection assays. (Zhang et al, 1992) (Ou et al, 1994; Zhang et al, 1992) (Ou et al, 1994) (Fagagna et al, 1995; Maekawa et al, 1991) (Franza et al, 1988) 46,47 and 68kDa forms, protooncogene Footprints multiple sites on LTR, may activate HIV-1 transcription. 60kDa, fork head Binds to two purine rich DNA binding domain motifs in -283 - -195 region. Related to SNF2/SW12, ATPase activity, 116kDa Binds HIV-1 TATA/initator in vitro. (Markovitz et al, 1992a; Shaw et al, 1988) (Kinoshita et al, 1997) (Cooney et al, 1991) (Dasgupta et al, 1990) (Li et al, 1991a) (Sheridan et al, 1995a) 29 MAR 55-57kDa, nuclear matrix associated TDP-43 43kDa, RNP-binding domains C/EBP Leucine zipper protein NFIL6 Member of C/EBP family, leucine zipper BTEB Homology to SP1 GATA-3 T cell enriched zinc finger protein, TFII-I T3R Binds N R E of HIV-1 L T R , (Hoover et al, 1996) can inhibit N F - K B activity. Binds TAR DNA, represses HIV-1 transcription. Footprints on two sites on the HIV-1 LTR, may contribute to basal LTR activity in monocytes. Footprints on several sites on the HIV-1 LTR but these sites are dispensable for its ability to activate the LTR by cotransfection. (Ou et al, 1995) (Henderson et al, 1995) (Tesmer & Bina, 1996; Tesmer et al, 1993) Can activate HIV-1 LTR in (Imataka et al, 1993) cotransfection assays. CTF/NF I 120 kDa protein not yet cloned Thyroid hormone receptor, member of steroid hormone receptor superfamily CCAAT binding factor TFE-3 bHLH protein Can footprint multiple sites on the LTR in vitro. Binds initiator element, function unkown. Adjacent N F - K B and SP1 sites can form a functional thyroid response element. Can bind leader region of HIV-1 LTR in vitro. Can bind to distal enhancer E-box in vitro, can synergize with p65 on chromatin bound templates. (Yang & Engel, 1993) (Montano et al, 1996; Roy et al, 1991) (Desai-Yajnik & Samuels, 1993) (Jones et al, 1988) (Pazin et al, 1995; Sheridan et al, 1995b) 1.4.3 The role of chromatin in HIV-1 transcription As mentioned above, the role of chromatin in the regulation of transcription is poorly understood. Since retroviruses integrate into the host chromosome, HIV-1 30 provides an excellent system to study the effect of chromatin on mammalian promoters. Studies addressing the impact of chromatin structure on HIV-1 LTR transcription have employed mapping of nuclease sensitive sites in chronically infected cell lines (Kharroubi & Martin, 1996; Lint et al, 1996; Verdin, 1991), and suggest that the core promoter of integrated HIV-1 proviruses is protected by nucleosomes, and that the pattern of nuclease sensitive sites is altered upon activation of the LTR by histone acetylase inhibitors. A more elegant approach using the assembly of chromatin templates in vitro (Sheridan et al, 1995b) demonstrates that hLEF can activate the HIV-1 LTR in a chromatin-dependent fashion. A similar technique was used to demonstrate that specific N F - K B subunits, together with SP1, can induce chromatin rearrangements of assembled templates in vitro (Pazin et al., 1995). 1.4.4 Regulation ofHIV-2 transcription HTV-2 gene regulation parallels that of HIV-1 in several respects. For example, the cellular transcription factors SP1 and N F - K B , as well as the HIV-2 Tat protein activate the HIV-2 LTR (Nabel, 1993). However, HIV-2 has only one binding site for N F - K B and responds to T cell activation pathways differently than the HIV-1 LTR (Hannibal et al, 1993; Markovitz et al, 1990). In addition, cz's-elements other than the N F - K B site are required for response of the HIV-2 LTR to T cell activation (Hannibal et al, 1993; Markovitz et al, 1990; Markovitz et al, 1992b). These sites include PuBl and PuB2 elements that bind the Ets family transcription factor, Elf-1, as well as a pets motif (Leiden et al, 1992; Markovitz et al, 1992b). Recently, a novel czs-acting element, termed peri-KB, was shown to be important in regulation of HIV-2 transcription in monocyte cell lines (Clark et al, 1995). It is not yet clear whether regulation of HIV-2 is actually more complex than that of HIV-1, or whether inducible cellular factors that control HIV-1 transcription remain to be identified. 31 2.4.5 Signal transduction and HIV-1 transcription The switch from proviral latency to expression of viral mRNAs is ultimately controlled by extracellular signals that impinge on transcription factors that bind and activate the dormant LTR. The list of reagents, heterologous viral gene products, cytokines and growth factors that can activate the LTR in cell culture systems has become so expansive it is difficult to catalog (Garcia & Gaynor, 1994; Laughlin & Pomerantz, 1994; Tong-Starksen & Peterlin, 1990). The much more pressing issue is what physiological signals activate viral transcription in HIV infected individuals. This question is difficult to address because of the lack of an animal model and the inherent complexity of studying virus-host cell interactions in an intact organism. Of the factors shown to activate HIV transcription in cell culture systems, plausible candidates for physiologically relevant activators include for lymphocytes: TNFa (Duh et al, 1989; Kinter et al, 1990), signals from the T cell receptor/CD3 (Alcami et al, 1995; Tong et al, 1989), signals through CD28 (Gruters et al, 1991; Tong-Starksen & Peterlin, 1990) and signals through CD4, which may include binding of the HIV-1 virion itself (Benkirane et al, 1995a; Benkirane et al, 1995b; Berube et al, 1996). In the case of monocytes/macrophages, cytokines such as GM-CSF and IL-3 (Folks et al, 1987; Koyanagi et al, 1988) are probable candidates for signals that regulate HIV-1 transcription in vivo. As mentioned above, the role of the N F - K B family of transcription factors has been the focus of most literature dealing with induction of HIV-1 transcription. Indeed, it is often rather dogmatically assumed that N F - K B is the only transcription factor, of the numerous ones that bind the LTR, that is relevant to the LTRs response to extracellular signals. The goals of my thesis research were to delineate the cz's-acting sequences necessary for Ras-responsive HIV-1 transcription and to characterize any cellular transcription factors that bind to these sequences. The data described in this thesis demonstrate that the HIV-1 LTR binds factors other than N F -32 KB that are required for the response of the LTR to the PTK/Ras/Raf signal transduction pathway. 33 2. MATERIALS AND METHODS 2.1 Cell Culture U937 human promonocyte, HL-60 human promyelocytic leukemia, K562 human myelogenous leukemia, Hut-78 human cutaneous T cell lymphoma, THP-1 human monocyte and CHO Chinese hamster ovary cell lines were obtained from the American Type Culture Collection (ATCC). The human CEM and HPB-ALL lymphoma cell lines were a generous gift from J. Ledbetter (Bristol-Myers Squibb Pharmaceutical Research Institute, Seattle, WA). Jurkat human lymphoma, Raji and Daudi Burkitt lymphoma cells were kindly provided by M. Gold (Dept. of Microbiology, UBC, Vancouver, B.C.) Jurkat-Tat cells were obtained from the NIH AIDS Reagent Program. CNA7 is a Rat-2 fibroblast-derived cell line that expresses a temperature sensitive allele of the v-fps oncogene product. The TF-1 erythroleukemia cell line was a gift from J. Schrader (Biomedical Research Centre, Vancouver, B.C.). All cell lines were maintained in a humidified incubator with a 5% CO2 environment at 37 °C. For temperature shift experiments with C N A 7 cells 34 °C was used as the permissive temperature and cells were grown at the non-permissive temperature (39 °C) for at least 16 hours before temperature shifts. Media for all cell lines were supplemented with Penicillin (lOOU/ml) and Streptomycin (100 mg/ml). With the exception of HL-60 cells, growth media contained 10% Fetal Bovine Serum (Gibco BRL). HL-60 cells were maintained in 80% IMDM and 20% FBS. Jurkat, U937, CEM, Hut-78, HPB-ALL, TF-1, Jurkat-Tat, K562, Raji and Daudi cells were grown in RPMI 1640. THP-1 were also grown in RPMI 1640, but the growth media was further supplemented with 50 |iM P-MCE. C N A 7 cells were grown in DMEM and CHO cells in oc-MEM. HL-60 cells were differentiated along the macrophage pathway by the addition of 20 ng/ml TPA for 24 hours and along the granulocytic pathway by the addition of 1.25% (v/v) DMSO for 3 days. 34 2.2 Plasmids Plasmids containing deletions of the HIV-1 LTR were obtained from C. Southgate and M. Green (Southgate & Green, 1991). Expression vectors for Ras alleles were a gift from G. Cooper (Feig & Cooper, 1988). V-fps expression vectors have been described previously (Sadowski et al., 1986). HIV-1 Tat and HFV Bel-1 expression plasmids were a gift from B. Cullen (Keller et ah, 1992; Malim et al., 1988) HIV LTR CAT constructs bearing point mutations were constructed by cloning synthetic oligonucleotides between the Ava 1 and Stna 1 or Sph 1 and Xba 1 sites of pHIVSCAT (Lu et al, 1993) to give the pHIVS series of mutated LTR-CAT plasmids. These mutated LTRs were then subcloned into pEG614 (Golub et ah, 1990) using the unique Kpn 1 and Sst 1 sites yielding the pU3S series of HIV LTR CAT reporter constructs. 2.3. Transient Transfections Cells growing in suspension were transfected using DEAE-dextran as previously described (Grosschedl & Baltimore, 1985) with the following changes. For each transfection, lxlO 7 cells were washed in TS (8 g/1 NaCl, 0.38 g/1 KC1, 0.1 g/1 Na2HP04.7H20, 3.0 g/1 Tris, 0.1 g/1 MgCl2, 0.1 g/1 CaCl2; pH 7.4). TS was prepared fresh from TD (8 g/1 NaCl, 0.38 g/1 KC1, 0.1 g/1 Na2HP04.7H20, 3.0 g/1 Tris; pH 7.4) by adding 1 ml per 100 mis TD of a stock of 10 mg/ml MgCl2/CaCl2. The washed cells were resuspended in 1 ml of TS containing DEAE-dextran (Pharmacia Cat No. 17 0350 01) MW 500,000 at 0.5 mg/ml and DNA at various concentrations. This mixture was kept at room temperature for 15 minutes before the addition of 10 mis of growth media containing FBS and antibiotics. The suspension was further incubated at 37°C in a humidified incubator in a 5% CO2 environment for 30 minutes. Cells were then washed in 5 mis of growth media supplemented with FBS 35 and antibiotics before they were resuspended in 15-30 mis of supplemented growth media. In all cases the addition of chloroquine was omitted, as it was not found to improve transfection efficiency of hematopoetic cell lines. For HL-60 cells, the incubation period in TS/DEAE-dextran/DNA was extended to 45 minutes at room temperature. The cells were then washed in 5 mis of growth media before plating in 5 mis of growth media with FBS/antibiotics. Adherent cells were transiently transfected by a different DEAE-dextran protocol. Cells were split 24 hours before transfection so that the plates were 80 % confluent at transfection. Before transfection the cells were washed by gently rinsing the monolayer in TBS (8 g/1 NaCl, 0.38 g/1 KC1, 019 g/1 Na2HP04.7H20, 1.0 g/1 glucose, 3.0 g/1 Tris; pH 7.4). For each transfection the following reagents were mixed in a 15 ml conical tube: 400 |il 1M tris pH 7.5, 1 |ig of each plasmid, transfection medium (IX a-MEM or DMEM, 0.25 mg/ml DEAE-dextran [Pharmacia Cat No. 17 0350 01], Penicillin [lOOU/ml] and Streptomycin [100 mg/ml]). The transfection mix was added to the monolayer, and the plates were gently rocked so that the medium was well distributed. CHO cells were incubated for 12 hours at 37 °C in 5% CO2 and CNA7 cells were incubated for 8 hours before DMSO shocking. Cells were DMSO shocked by aspirating off the transfection mix and adding DMSO reagent (IX TBS, 10% DMSO). The plates were incubated for 3 minutes at room temperture before removal of the DMSO reagent by aspiration. Chloroquine mix (growth medium supplemented with 10% FBS and antibiotics, 1 ml 0.1M chloroquine stock per 1) was then added and the cells were placed in an incubator for another 2 hours. Finally, the cells were rinsed twice in TBS, and 10 mis of growth medium including FBS and antibiotics were added. After 12 hours of incubation at 37 °C in 5% CO2, the medium was changed and the cells were harvested for CAT assays after 48 hours. 36 2.4 CAT Assays Both suspension and adherent cells were harvested for CAT assays 48 hours post transfection. CAT activity was determined by standard methodology (Gorman et al., 1982). The cells were collected by centrifugation and washed once in suspension buffer (40 mM Tris, 1 mM EDTA, 150 mM NaCl; pH 7.5). The cells were then resuspended in 60 ul of 0.25 M Tris, pH 8.0 and taken through 4 cycles of freeze-thawing in a dry ice-ethanol bath and then in a 42 °C water bath. Extracts were clarified by centrifugation at 13,000 rpm for 5 minutes at 4 °C in a microcentrifuge. 5 ul of extract was used to determine protein concentration by the Bradford assay (Biorad). 30-55 (lis of extract was added to CAT reaction mixtures which contained 70 ul of 1M Tris-HCl (pH 8.0), 20 ul of 4 mM Acetyl Co-A (Pharmacia), and 0.2 uCi of [14c] chloramphenicol (NEN). The reaction was carried out at 37 °C for 2 hours, with an additional 10 ul of Acetyl Co-A added after one hour. Acetylated products were separated from the unacetylated substrate by TLC in 75% chloroform/25% ethyl acetate. CAT activity was quantitated using a Phosphorlmager (Molecular Dynamics), or by excising TLC separated products for scintillation counting. 2.5 Oligonucleotides Oligonucleotides were synthesized on a model 391 Applied Biosystems DNA synthesizer. SEP-PAK columns were used to purify oligonucleotides before annealing in 50 mM Tris-HCL (pH 8.0), 10 mM MgCl2 and use in electrophoretic mobility shift assays (EMSA). The sequences of the annealed oligonucleotides used in this study are shown in Appendix 1. Biotin labeled oligonucleotides were synthesized by incorporating Biotin Amidite onto the 3' end as specified by the manufacturer (Applied Biosystems). 37 2.6 Nuclear extracts Nuclear extracts were prepared from suspension cells according to the microscale procedure of Li et al. (Li et al., 1991b), with the exception that a 27 1/2 gauge needle was used to disrupt cells. Cells were collected by centrifugation and washed with two packed cell volumes (PCV) of chilled phosphate-buffered saline (PBS: 2.68 mM KC1, 136.8 mM NaCl, 8.0 mM Na2P04-7 H20,1.47 mM KH2PO4, pH 7.4). The cells were then washed in two PCVs of cold buffer A (10 mM HEPES; pH 7.9, 1.5 mM MgCl2, 10 mM KC1, 0.5 mM DTT) and resuspended in two PCVs of buffer A. All procedures were carried out on ice and in 4 °C refrigerated microcentrifuges. Cell lysis was accomplished by passing the cell suspension gently 10 times through a 27 1/2 gauge needle. Nuclei were collected in a microcentrifuge by spinning for 8 seconds at full speed in a microcentrifuge. The supernatant was removed and the nuclei were extracted in 0.6 PCV of buffer C (20 mM HEPES; pH 7.9, 25%[v/v] glycerol, 420 mM KC1,1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 0.5 mM PMSF) for 15 minutes on ice. One equivalent volume of buffer D" (20 mM HEPES; pH 7.9, 20%[v/v] glycerol, 0.2 mM EDTA, 0.5 mM DTT, 0.5 mM PMSF) was added to the extract before clarification by spinning at full speed in a microcentrifuge for 15 minutes. The supernatant was assayed for protein concentration using a Bio-Rad protein assay kit (Bio-Rad) and flash frozen in liquid nitrogen before storing at -70 °C. Nuclear extracts were prepared from adherent cell lines by a method based on the lysolecithin protocol of (Zerivitz & Akusjarvi, 1989). Cells were scraped off plates and washed twice in ice cold PBS. Cells were then washed in two PCVs of buffer A-S (0.25 M sucrose, 20 mM HEPES pH 7.9,10 mM KC1, 1.5 mM MgCl2, 0.5 mM DTT, 0.5 mM spermidine, 0.15 mM spermine) before resuspending in two PCVs of buffer A-S. Lysolecithin was then added to a final concentration of 400 pg/ml from a freshly made stock of 10 mg/ml, and the mixture was gently agitated at room for exactly 90 38 seconds. The lysis reaction was quenched by adding three PCVs of cold buffer B-S (buffer A-S containing 3% bovine serum albumin). Nuclei were collected by centrifugation at 1000 G for 30 seconds. The supernatant was discarded and the nuclei were extracted with 0.6 PCV of buffer C (20 mM HEPES; pH 7.9, 25%[v/v] glycerol, 420 mM KC1, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 0.5 mM PMSF) for 20 minutes with gentle rocking. The extract was clarified by spinning at full speed in a microcentrifuge for 15 minutes after diluting with 0.6 PCV of buffer D" (20 mM HEPES; pH 7.9, 20%[v/v] glycerol, 0.2 mM EDTA, 0.5 mM DTT, 0.5 mM PMSF). The supernatant was assayed for protein concentration using a Bio-Rad protein assay kit (Bio-Rad) and flash frozen in liquid nitrogen before storing at -70 °C. 2.7 Electrophoretic Mobility Shift Assays (EMSAs) 5 to 15 ug of Jurkat nuclear extract were preincubated with 6 ug of poly dl-dC, 10 mg of sheared salmon sperm DNA and 4 mg of BSA in binding buffer (20 m M HEPES (pH 7.9), 100 mM KC1 and 5 mM MgCl2) for 5 minutes on ice. 2 pmoles of oligonucleotide probe, radiolabeled by end-filling with the Klenow fragment of E. coli DNA Pol I, were then added. The binding reactions, in a total volume of 20 uls, were performed at room temperature for 20 minutes. DNA-protein complexes were resolved on 4.5% non-denaturing polyacrylamide gels at 160V for 3 hours in 0.5xTBE (Tris borate EDTA) and 1% glycerol. For supershifting experiments, binding reactions were performed as above but on ice. 4-8 ug of antisera were then added to the reaction and incubated for 1 hour on ice. Binding was continued for 10 minutes at room temperature before electrophoresis. 39 2.8 Antibodies and Recombinant Proteins Human LEF and anti-hLEF antibodies were a generous gift from Drs. M. Waterman and K. Jones (Salk Institute, CA). Ets-1, Elf-1 and Fli-1 antisera were purchased from Santa Cruz Biotechnogy (CA). ERF antibodies were a gift from George Mavrothalassitis (Frederick Maryland). GABP a , GABPpi and GABPp2 were a gift from Dr. Steve McKnight (Tularik, Inc., CA). Recombinant TBP and anti-TBP antibodies were purchased from UBI (NY) and Santa Cruz Biotechnology (CA). 2.9 Southwestern blotting Approximately 100 ug of nuclear extract was fractionated per lane on 7.5% SDS-polyacrylamide gels at 150V. Proteins were then transferred to PVDF membrane (Immobilon) by electrophoretic transfer at 400 mA for 1.5 hours at room temperature. Membranes were blocked by incubating for 1 hour with 10% powdered skim milk in lx binding buffer (SWBB: 20 mM HEPES, pH 7.9; 5 mM MgCl2; 100 mM NaCl, 0.5 mM dithiothreitol). Membranes were washed 4 times in lx SWBB for 5 minutes at room temperature. Double stranded biotinylated oligonucleotide was added to a final concentration of 10 pmoles per ml and incubated 1-1.5 hours at room temperature. Membranes were washed again 4 times for 5 minutes in lx SWBB at room temperature. Streptavidin-HRP (BRL, Cat. No. 9534SA) diluted 1:1000 in lx SWBB was then added and incubated 30 minutes at room temperature. Membranes were finally washed 5-8 times in lx SWBB for 5 minutes at room temperature before chemiluminescent detection using the Amersham ECL detection system. 2.10 Western Blotting After fractionation on SDS-PAGE gels (Laemmli, 1970), proteins were transferred to nitrocellulose (NC) filters. Protein transfer was done by electroblotting 40 at 380 milliamps for 1.5 hours at room temperature in IX western transfer buffer (0.192 M glycine, 0.125 M Tris, pH 8.3). After transfer the nitrocellulose filter was blocked in blotto solution (10% low fat skim milk in IX TBS-T (0.9% NaCl, 0.1% Tween 20, 0.1 M Tris, pH 8.3) for one hour at room temperature. All washing and incubation steps were done at room temperature with gentle shaking. The NC filters were washed 3 times for 5 minutes in TBS-T. Next, the primary antibody was diluted 1/5000 to 1/10000 in TBS-T and incubated with the NC filter for 1 hour. The NC membrane wash again washed 3X 5 minutes in TBS-T followed by incubation with the secondary antibody diluted 1/10000 in TBS-T (Goat anti-Rabbit horseradish peroxidase labeled, Gibco BRL) for 1.5 hours. Finally the NC filter was washed 3X 15 minutes in TBS-T before detection of proteins with a ECL kit from Amersham. 2.11 U V Laser Crosslinking Protein DNA binding reactions were carried out exactly as described for EMSAs. The protein-DNA complexes were then subjected to a single pulse of UV light from a Spectra-Physics model GCR14S pulsed Nd:YAG laser, as previously described (Ho et al., 1994). UV crosslinked complexes were resolved by SDS-PAGE (Laemmli, 1970) and visualized by autoradiography. 2.12 Heparin -Agarose Chromatography Nuclear extracts were fractionated on Heparin-agarose columns (Biorad). Columns were prepared by washing first in buffer (HA buffer: 20 mM HEPES, pH 7.9; 5 mM MgCl2; 0.5 mM dithiothreitol; 0.5 mM PMSF; 8% glycerol) with high salt (2M NaCl) at a flow rate of 5 mis/min for 2 minutes using an Econosystem (Biorad). The column was then washed for 10 minutes in HA buffer containing 100 mM NaCl at 1 ml/min. Nuclear extracts were loaded onto the column at the same rate and the column was washed for 10 minutes in HA buffer containing 100 mM NaCl. Bound proteins were eluted with a linear salt gradient from 100 mM to 2000 mM NaCl in 41 HA buffer at 1 ml/min. Fractions of 0.5 to 1 ml were collected and used directly in EMSA, UV crosslinking, or Southwestern blotting experiments. 42 3. RESULTS 3.1 Mapping of the Primary Ras-responsive Element of the HIV-1 LTR 3.1.1 Nucleotides 5' of the NF-kB sites, -158 to -118, are necessary for full responsiveness of the HIV-1 LTR to signals from v-fps In CHO cells, cotransfection of a plasmid expressing a constitutively active v-fps PTK stimulated transcription from the HIV-1 LTR approximately 5 fold, as measured by the amount of CAT activity produced from plasmids containing the 5' HIV-1 LTR controlling the cat gene (Fig. 4). To determine which elements of the HIV-1 LTR were required for stimulation by v-fps, I used a nested set of 5' deletions of the LTR in cotransfection experiments. Initial experiments in CHO cells indicated that a region between nucleotides -158 and -118 with respect to the transcriptional start site were required for a significant fraction of v-fps responsiveness of the LTR (Fig. 4, compare the responses of deletions to -158 versus -118). This result was surprising, since no cz's-acting regulatory elements had been described in this region of the HIV-1 LTR at the time. I found that other PTKs and signaling molecules in the PTK/Ras/Raf pathway, including v-fms, lck (F505), v-Ha-Ras and v-Raf also stimulated the HIV-1 LTR and required the -158 to -118 region (data not shown). For the sake of simplicity I have limited analysis of the HIV-1 LTR response to this pathway by studying Ras, a central signaling molecule of the pathway. I have also examined the effect of v-fps and v-Ras on other promoters and found that many were not effected by constitutive PTK/Ras activity. For example, the LTR of Fujinami Avian Sarcoma virus was actually slightly repressed by v-fps cotransfection (Fig. 4B). This result reinforces the conclusion that the effect of PTK/Ras signaling on the HIV LTR was specific, and not an indirect effect on all transcription. 43 Figure 4. Stimulation of HIV-1 LTR-driven transcription by the v-fps protein-tyrosine kinase requires nucleotides -158 to -118 in CHO cells. (A) CHO cells were transfected with 1 pg of HIVLTR-caf deletion constructs and 1 ug of plasmid expressing oncogenic P13(Fg:frs (solid bars) or a variant bearing a point mutation in the SH2 domain (AX9m), that renders it signaling incompetent (open bars). 48 hours after transfection cells were harvested for CAT assays. CAT activity is given relative to that of the -158 constructcotransfected with a P130SflS~*s(AX9m)-expressing plasmid (CAT actvity = 1). Data are from a single representative experiment that has been repeated at least five times with similar results. (B) V-fps activity does not stimulate transcription from the FSV LTR. Cotransfection of oncogenic P13(P^S in CHO cells does not in stimulate Fujinami sarcoma virus LTR-CAT-driven transcription (lane 1) compared to inactive P130g"s"*s-AX9m cotransfection (lane 2). 44 A 45 3.1.2 Nucleotides -158 to -118 of the HIV-1 LTR are necessary for full responsiveness of the HIV-1 LTR to signals from v-Ha-Ras in HIV permissive cells To examine whether the PTK/Ras/Raf pathway also stimulated the HIV-1 LTR in cell line models of HIV infection, and to confirm that signals from the Ras pathway depend on the -158 to -118 region of the HIV-1 LTR as with v-fps in CHO cells, I used cotransfection experiments in Jurkat T cells and U937 promonocytic leukemia cells. Both of these cell lines can support replication of HIV-1 and are commonly used for the study of HIV-1 transcription (Garcia-Blanco & Cullen, 1991). To examine the effect of constitutive v-Ras activity on HIV-1 LTR transcription, I used cotransfection experiments of HIV-1 LTR-CAT constructs with v-Ha-Ras, and a v-Ha-Ras N17 mutant allele. The N17 mutation results in a dominant negative allele that down regulates the Ras pathway by forming inactive complexes with Ras guanine nucleotide exchange factors like mSOS (Feig & Cooper, 1988; Quilliam et al., 1994; Schweighoffer et ah, 1993). Expression of v-Ha-Ras activates transcription from the HIV-1 LTR in transient transfection of Jurkat T cells relative to Ras N17 (Fig. 5A). Qualitatively similar results were obtained with empty vector controls (not shown and see Fig. 19). In Jurkat cells, plasmids containing a deletion of all nucleotides 5' of position -158 (with respect to the start site of transcription) remained responsive to Ras activation (Fig. 5B, -158). A deletion to -118, however, severely impaired the LTR's ability to respond to signals from Ras (Fig. 5B, -118). Importantly, this latter construct contains intact binding sites for N F - K B and SP1, demonstrating that factors that bind these elements cannot on their own confer full Ras responsive HIV-1 LTR-driven transcription. In U937 promonocyte cells the Ras responsive HPV-l transcription also requires nucleotides -158 to -118, although the basal transcription levels are not identical to those 46 Figure 5. Nucleotides -158 to -118 are required for Ras stimulation of the HIV-1 LTR in Jurkat T and U937 cells. Effect of cotransfection of Ras plasmids on HIV LTR-driven transcription. Jurkat cells were transfected with 4ug of wild type HIV-1 LTR CAT and 5ug of the indicated ras expression plasmid. CAT activity is given relative to that obtained when Ras N17 was present. (A) At the left is a schematic representation of the HIV-1 LTR and deletion constructs. Cz's-acting elements known to regulate HIV transcription are shown by boxes. The nucleotides upstream of the transcriptional start site are given at the right of deletion constructs. (C) Jurkat cells were transfected with 4ug of HIV LTR CAT deletion constructs and 5jxg of ras expression plasmid. The horizontal axis indicates the CAT activity expressed relative to the activity given by the full length LTR in cells co-transfected with a plasmid expressing Ras N17. Black bars indicate HIV LTR activity when cotransfected with a plasmid expressing v-Ha-Ras. White bars indicate HIV LTR activity when cotransfected with a plasmid expressing Ras N17. (C) Exactly as in panel B but the experiments were done with U937 cells. Transfections were repeated at least 6 times with at least two DNA preparations to insure reproducibility. The fold stimulation of each construct varied less than 15% between independent transfections. 47 observed in Jurkat cells (Fig. 5C). Thus, in the HIV permissive cell lines Jurkat and U937, cz's-acting sequences in the -158 to -118 region are necessary for full Ras stimulation of the HIV-1 LTR. I refer to this region as the primary Ras responsive region. 3.2 Two Nuclear Factors, RBF-1 and RBF-2, Bind Specifically to the Primary Ras Responsive Region of the HIV-1 LTR 3.2.1 The nuclear factor RBF-1 specifically binds nucleotides -151 to -142 in the Ras responsive region of the LTR To determine if cellular transcription factors bound to the primary Ras responsive region of the HIV-l LTR, Jurkat cell nuclear extracts were prepared for use in electrophoretic mobility shift assays (EMSAs). Oligonucleotides that span the Ras responsive region were synthesized for use in these EMSAs. The nucleotide sequence of the oligonucleotides and the corresponding sequences of the HIV-1 LTR is given schematically in Figure 6 and in detail in Appendix 1. Several protein-DNA complexes were observed in EMSA reactions with radiolabeled oligonucleotide A (Fig. 6, -159 to -138) and Jurkat nuclear extracts (Fig. 7A). The slowest migrating of these complexes bound specifically to oligonucleotide A since this protein-DNA complex was not eliminated in the presence of a one hundred fold molar excess of unlabeled oligonucleotide B (nucleotides -127 to -144, Fig. 6 & Fig. 7A, lane 15), but was abolished in the presence of excess unlabeled cognate oligonucleotide A (Fig. 7A, lane 2), or a shorter oligonucleotide spanning -154 to -138 (Fig. 7A, lane 3). I term this specific DNA binding factor RBF-1, for Ras responsive region binding factor 1. I employed scanning mutagenesis to precisely map the nucleotides important for binding of RBF-1 to the HIV-1 LTR (Fig. 7A, lanes 4-14). Unlabeled oligonucleotides bearing mutations were added at one hundred fold molar excess to EMSA binding reactions containing radiolabeled oligonucleotide A. Thus, in Figure 49 Figure 6. Nucleotide sequence of the -160 to -2 region of the HIV-1 LTR and positions of oligonucleotide probes used in this study. The nucleotide sequence of the HIV-1 LTR of plasmid pU3S (see Materials and Methods) are shown with the binding sites of well characterized regulatory factors shown in boxes. The names of synthetic oligonucleotides used in gel shift experiments are shown at the left (see also Appendix 1), and the oligonucleotides are represented schematically by bars under the corresponding sequences of the HIV LTR. 50 •159 -150 •140 130 •120 •110 -100 •90 -80 P5: 7 B: C C C G A G A G C T G C A T C C G G A G T A C t r r C A A G A A C T G C T G A C A T C G A G C T T T C T C C A A G G G A C LEF NF-KB II PKB: F C C G C T G 3 G G A C T T T C C 3 NF-KB I P3: -70 -60 •50 •40 •10 -2 G 3 G A G G C G T G G C C T G G G C G G G A C T G G G G A G T G GC G T C C T C T A G A T G C T G C V T A T A A G D A G C T G C I I I I I I G C A T G C A C T SP1 SP1 II SP1 I Figure 7. RBF-1 binds to the Ets-like motif at nucleotides -151 to -142. (A) EMSAs were performed with radiolabeled oligonucleotide A and unstimulated Jurkat cell nuclear extracts. Reactions were carried out in the presence (lanes 1-14), or absence (lane 15), of a one hundred fold molar excess of the unlabeled oligonucleotides diagrammed in panel B. The names of competitor oligonucleotides are indicated at the top of each lane. Arrows indicate the positions of RBF-1, a band caused by a non-specific DNA binding protein (n.s.) and the free probe (free A). (B) Nucleotide alterations in the sequences of competitor oligonucleotides used in scanning mutagenesis are indicated by arrows drawn from the wildtype sequence to the altered bases. The relevant lane from panel A is given at the left of mutated oligonucleotides, along with the names of the mutated oligonucleotides. 52 i - CM CO LO CD A < 100x: CD < L O L O L O L O L O u S L O L O f X l L T l n n Q . Q . Q - Q . D - Q . D Q C Q CD CO • _ LU RBF-1 n.s. free A-1 2 3 4 5 6 7 8 9101112131415 -159 CCCGAGAGC 1: -146- -130 2: A (wt) 3: P5 (wt) 4: P5-M1 5: P5-M2 6: P5-M3 7: P5-M4 8: P5-V1 9: P5-M5 10: P5-M6 11: BBSA (wt) 12: BBMLA 13: PKB 14: Ets 15: -GCA CC t t t t +GGTG lie TA t -138 £CbGAGTA G HIV N F - k B Ets M L V t C t t GC 7 A , RBF-1 complex formation indicates reduced affinity of a mutated competitor binding site for RBF-1, while the absence of RBF-1 complex indicates efficient binding of the mutated competitor oligonucleotide to RBF-1. Base substitutions upstream of position -152 have no measurable effect on RBF-1 binding (Fig. 7 A , lane 5) nor did substitutions downstream of position -142 (Fig. 7 A , lanes 10 and 11). All point mutations between -152 and -143 decreased binding to RBF-1. Mutation of the sequence 5'-CTGC-3' at -151 to -148 to GGTG dramatically reduced RBF-1 binding (Fig. 7 A , lane 4). In addition, single base pair mutations in the 5'-ATCC-3' motif had particularly severe affects on RBF-1 binding (Fig. 7 A , lanes 6-9). This motif represents the opposite strand of a previously noted (Holxmeister et al., 1993; Sheridan et al., 1995b) consensus binding site for Ets-1 and has been shown to bind recombinant Ets-1 in vitro (Sheridan et al., 1995b). I conclude that RBF-1 binds to the HrV-1 LTR at an Ets-like motif located 151 to 142 nucleotides from the transcriptional start site. I term the -151 to -142 RBF-1 binding element RBE IV (see Fig. 9). 3.2.1.1 RBF-1 contains GABP, but not Ets-1, Elf-1, Fli-1 or ERF Because the DNA binding specificity of RBF-1 was found to be similar to that of Ets-1, I wished to determine if RBF-1 is related to Ets-1 or other previously identified Ets family members. I used antibodies directed against the unique carboxy-terminus of Ets-1 to determine if RBF-1 was immunologically related to Ets-1 in EMSA supershifting experiments. Ets-1 antisera did not affect RBF-1-DNA complexes (Fig. 8, lane 4). However, a higher mobility protein-DNA complex was supershifted by anti-Ets-1 antisera (Fig. 8, lane 4, Ets-l+Ab). This suggests that Ets-1 can also bind to the Ets motif located at nucleotides -151 to -142 in accordance with previous reports (Holxmeister et al., 1993; Sheridan et al., 1995b). To confirm that the supershifted species was indeed Ets-1 I determined the DNA binding specificity of the complex supershifted by anti-Ets-1 antisera. The presence of a one hundred fold 55 Antibody: £ £ £ s= LU LU LU LU s a e e Competitor DNA: > L O L O •_ Q_ > L O L O Q_ CL LU Ets-1/ocEts1Ab RBF-1 n.s. Ets-1 1 2 3 4 5 6 7 8 Figure 8. RBF-1 is not Ets-1 or Elf-1. EMSAs were performed with radiolabeled oligonucleotide A and unstimulated Jurkat cell nuclear extracts. Antibodies to Ets-1 or Elf-1 were added to reactions as indicated in the top row (Antibody). Unlabeled competitor oligonucleotides were added at a 100 fold molar excess as indicated in the second row. The ELF oligonucleotide is derived from the Elf-1 binding site of the HIV-2 LTR (see Appendix 1 for sequence). Arrows indicate the mobilities of Ets-1, a non specific DNA binding factor (n.s.), RBF-1 and the complex of Ets-1 with Ets-1 antibody-DNA (Ets-1 /ocEts-lAb). The faint band with mobility slightly less than that of the supershifted complex is likely a higher order protein-DNA complex that includes RBF-1, since it has specificity for the Ets motif (compare lanes 2 and 3). Oligonucleotide P5 represents the wild type RBE IV of the HIV-1 LTR. Oligonucleotide P5-V1 is similar to P5, but bears a single base-pair change that alters the Ets-binding site (ATCC to ACCC). The DNA binding specificity of the Ets-1-antibody complex was demonstrated by competition experiments with unlabelled oligonucleotides (compare lanes 5 and 6). 56 molar excess of unlabeled wildtype oligonucleotide prevented formation of the supershifted complex (Fig. 8, lane 5) but an excess of an oligonucleotide bearing a single base pair change in the Ets motif did not. (Fig. 8, lane 6), confirming that Ets-1 from Jurkat cell nuclear extracts interacts specifically with RBE IV. In addition to being immunologically unrelated to Ets-1, RBF-1 is also distinguishable from Ets-1 by a large difference in molecular weight (see below). Because the Ets family member, Elf-1, has an apparent molecular weight comparable to that of RBF-1 (Wang et al., 1993), I tested whether anti-Elf-1 antisera could recognize RBF-1-DNA complexes. RBF-1 did not react with Elf-1 antibodies in this assay (Fig. 8, lane 7). Moreover, the addition of a one hundred fold molar excess of unlabeled competitor DNA corresponding to the Elf-1 binding site of the HIV-2 LTR to EMSA binding reactions competes poorly for RBF-1 binding to RBE IV (Fig. 8, lane 8). Thus RBF-1 is distinguishable from Elf-1 both in terms of reactivity with Elf-1 antisera and DNA binding specificity. Antibodies against the ERF and Fli-1 members of the Ets family transcription factors also failed to supershift or block the binding of RBF-1 in EMSA (data not shown). I conclude that RBF-1 binds to a site overlapping an Ets-like binding site and is distinct from the previously characterized Ets family members Ets-1, ERF, Fli-1 or Elf-1. Antibodies against the broadly expressed Ets family member, GABP (LaMarco et al, 1991; LaMarco & McKnight, 1989; Thompson et al, 1991), prevented binding of RBF-1 to RBE IV in EMSA (Fig. 9, lanes 2 and 3). Antibodies specific for the a (Fig. 9, lane 2) and 01 (Fig. 9, lane 3), but not the p2 (Fig- 9, lane 4) subunits of GABP prevented the formation of RBF-1-DNA complexes in EMSA. These results demonstrate that the DNA binding complex represented by RBF-1 contains polypeptides immunologically related to both GABPot and GABPPi. Given that 57 O C O . C Q . CL Q. CD CD CD < < < o o o Antibodies: l e s s 1 2 3 4 Figure 9. RBF-1 contains polypeptides related to GABP a and GABPpi but not GABPp2- EMSAs were performed with radiolabelled oligonucleotide A and unstimulated Jurkat cell nuclear extracts. Antibodies to GABPa, GABPpi and GABPp2 were added to reactions as indicated in the top row (Antibodies). RBF-1 binding to RBE IV (indicated by arrow) was blocked by antibodies to GABP a (lane 2) and GABPpi (lane 3) but not by GABPp2 antibodies (lane 4). 58 GABPPi binds uniquely to GABPa, and not other cellular proteins (Charles de la Brousse et al., 1994), these data suggest that RBF-1 contains human GABPpi and GABPa. However, it remains formally possible that RBF-1 is a complex composed of proteins that are immunologically related to human GABPPi and GABPa and interact at RBE IV, and that these proteins happen to interact like GABP Pi and GABPa. Nuclear extracts from U937 cells were also used in EMSAs with radiolabeled RBE IV. U937 nuclear extracts have proteins that give essentially the same pattern of protein binding to oligonucleotide A as Jurkat nuclear extracts (Fig. 10), with the important difference that no detectable Ets-1 was observed in U937 cells. This observation suggests that Ets-1 may not play a critical role in response of the HIV-1 LTR to Ras, since the LTR responds to Ras in U937 cells (Fig. 5, panel C) which do not express detectable Ets-1. In contrast, RBF-1 binding activity is observed in both T cell and monocytic cell lines. 59 Figure 10. U937 cell nuclear extracts contain RBF-1 but not Ets-1 DNA binding activity. EMSAs were performed with radiolabeled oligonucleotide A and unstimulated U937 cell nuclear extracts. Reactions were carried out in the presence (lanes 2-7), or absence (lane 1), of a one hundred fold molar excess of the unlabelled oligonucleotides indicated at the top of each lane. Arrows indicate the positions of RBF-1, a band caused by a non-specifc DNA binding protein (n.s.) and the free probe (free A). Note that a band corresponding to the mobility of Ets-1 (compare with Fig. 8) is not observed. 60 r : CQ z ^ ? C/5 L O C O I— L O Li-Competitor: | ^ Q_ Q_ Q_ Q_ ^ 61 3.2.1.2 Ets binding sites embedded in the NF-kB motifs of the HIV-1 LTR can compete for the binding of RBF-1 to RBEIV Since Ets family members have been shown to interact with the Ets motifs embedded within the HIV-1 N F - K B elements (Flory et ah, 1996; Hodge et al., 1996; Seth et ah, 1993) I wished to test whether or not the N F - K B motifs could compete for RBF-1 binding to RBE IV. A one hundred fold molar excess of unlabeled oligonucleotide containing the tandem N F - K B motifs was added to EMSA reactions containing radiolabeled oligonucleotide A and Jurkat nuclear extracts. Interestingly, RBF-1 binding was specifically competed for by oligonucleotides containing the N F -KB sites (Fig. 11 A, lane 3), although with less apparent affinity than to RBE IV (Fig. 11 A, compare lanes 2 and 3). To determine nucleotides critical for interaction of RBF-1 with the N F - K B motifs, I examined oligonucleotides with point mutations in the N F - K B sites in competition experiments. Importantly, a mutation commonly used to interfere with N F - K B binding (Nabel & Baltimore, 1990), had no effect on RBF-1 binding (Fig. 11, lane 4). A single base pair change in the Ets motif overlapping the 5' N F - K B binding site had very little effect on RBF-1 binding (Fig. 11, lane 5). However, when the same mutation was introduced into both the 5' and 3' Ets motifs, RBF-1 binding was abolished (Fig. 11, lane 6). Finally, a severe mutation of the 5' Ets motif overlapping the 5' N F - K B binding site prevented the ability of this oligonucleotide to compete for RBF-1 binding (Fig. 11, lane 7). I conclude that RBF-1 can interact specifically with Ets-like sequences overlapping the N F - K B binding sites. I have termed the region containing the N F - K B binding sites RBE II to indicate that, in addition to N F - K B family members, RBF-1 can interact specifically with this region of the HIV-1 LTR. 62 Figure 11. The N F - K B motifs of the HIV-1 LTR compete specifically for RBF-1 binding. (A) EMSAs of unstimulated Jurkat cell nuclear extracts with labelled oligonucleotide A. The names of unlabelled competitor oligonucleotides, added to EMSA reactions at a one hundred fold molar excess, are indicated at the top of each lane. Arrows indicate the positions of RBF-1, a band caused by a non-specifc DNA binding protein (n.s.), Ets-1 (see text and Figure 5) and the free probe A. (B) The nucleotide sequences of unlabelled competitor oligonucleotides used in the EMSA reactions of panel A. Lane 1 contains no competitor and lane 2 contains wildtype RBE IV competitor (P5). Nucleotides altered from the wild type N F - K B motifs are indicated by arrows. 63 i - CM > LU 100x: CD OQ CD CO CD L O * ^ ^ i i Q. Q. n i 64 00 I o o o < o o-o-y o o-o o o o o LO o < CD-CD-CD-< O O CD CM _ ^ > LU ^ fi ^ ^ ^ CD CD CD CD CD ^ ^ ^ ^ ^ Q_ Q_ Q_ CL Q_ co LO cb 65 3.2.1.3 RBF-1, or associated factors, are phosphorylated in response to signals from the RAS pathway Given that RBF-1 bound to the region I mapped as being important for Ras responsiveness, I sought to determine if binding of RBF-1 was altered in cells where the Ras pathway was activated. I took advantage of the CNA7 cell line, which expresses a temperature sensitive v-fps mutant allele (McGlade et al., 1992). Nuclear extracts were prepared from CNA7 cells at the nonpermissive temperature and from cells that had been switched to the permissive temperature for 30 minutes. The mobility of the RBF-1 complex was increased in cells where the PTK/Ras/Raf pathway was stimulated (Fig. 12, compare lanes 1 and 2). This altered mobility was reversed when the nuclear extracts were treated with a nonspecific phosphatase (Fig. 12, lane 3). These data suggest that RBF-1, or associated factors, are phosphorylated in response to signals from the Ras pathway. Moreover, since the mobility of the RBF-1-RBE IV complex was increased, these data imply that RBF-1 is comprised of more than one protein. A model consistent with these data would be that the presence of a component of RBF-1 is prevented by phosphorylation(s) stimulated by the PTK/Ras/Raf pathway, resulting in a RBF-1 complex of higher mobility. 66 Figure 12. RBF-1, or associated factors, is phosphorylated in response an oncogenic PTK. EMSAs were performed with radiolabeled oligonucleotide A (RBE IV) and CNA7 cell nuclear extracts. Lane 1 contains nuclear extracts from cells shifted to the temperature permissive for v-fps activity (34 °C) for 30 minutes. Lane 2 contains nuclear extracts from cells grown at the nonpermissive temperature (39 °C). Lane 3 contains nuclear extracts from cells grown at the nonpermissive temperature (39 °C) which had been treated for 30 minutes at 37 °C with 10 units of shrimp alkaline phosphatase (United States Biochemical) before the EMSA reaction. The reaction in lane 4 was exactly like that of lane 2, but included a 30 fold excess of unlabeled oligonucleotide A. 67 3.2.2 RBF-2 specifically binds to the primary Ras responsive region 3.2.2.1 RBF-2 interacts with the HIV-1 LTR at nucleotides -131 to -121 of the Ras responsive region EMSA reactions with radiolabeled oligonucleotide B, from the primary Ras-responsive region (Fig. 2, -147 to - 127), and Jurkat nuclear extracts failed to show specific protein-DNA complexes (not shown). However, oligonucleotide C (Fig. 6. -137 to -119) formed several protein-DNA complexes in EMSA (Fig. 13A). The specificity of the slowest migrating protein-DNA complex was demonstrated by the failure of a one hundred fold molar excess of unlabeled oligonucleotide B to prevent its formation (Fig. 13A, lane 13), and the fact that the oligonucleotide C-protein complex was prevented by unlabeled cognate oligonucleotide C (Fig. 13A, lane 2). This factor, which I term RBF-2, is similar in electrophoretic mobility to RBF-1. To determine nucleotides important for binding of RBF-2 to the LTR I again employed scanning mutagenesis and competition EMSA experiments. Base pair changes upstream of position -131 (Fig. 13A, lane 4) or downstream of nucleotide -121 (Fig. 13A, lanes 10 and 11), did not affect RBF-2 binding. Between positions -131 and -121 the adenine at -122 was clearly important for RBF-2 binding as a cytosine at this position severely impaired RBF-2 binding (Fig. 13A, lane 9).Interestingly, mutations to nucleotides -125, -126 and -127 together had no observable effect on RBF-2 binding (Fig. 13B, lane 3). Thus, RBF-2 binds specifically to the HIV-1 LTR in the -131 to -121 region, but not all base pairs inside this site are essential for binding. I have termed this RBF-2 binding element RBE III (see Fig. 16). 68 Figure 13. RBF-2 specifically recognizes sequences -131 to -121 of the HIV-1 LTR. (A) EMSAs were performed with radiolabeled oligonucleotide C and unstimulated Jurkat cell nuclear extracts. Reactions were carried out in the presence (lanes 2-13), or absence (lane 1), of a one hundred fold molar excess of the unlabelled oligonucleotides diagrammed in panel B. The names of competitor oligonucleotides are indicated at the top of each lane. Arrows indicate the positions of RBF-2, a band caused by a non-specifc DNA binding protein (n.s.) and the free probe (free C). (B) As in panel A with an additional mutated oligonucleotide competitor, mCl (lane 4). The name and fold excess of the competitor oligonucleotides is given above each lane. (C) The nucleotide alterations in sequences of competitor oligonucleotides used in scanning mutagenesis are indicated by arrows drawn from the wildtype sequence to the altered bases. The relevant lane from panel A or B (mCl) is given at the left of mutated oligonucleotides, along with the names of the competitor oligonucleotides. Oligonucleotide HIV2 is derived from a region of the HIV-2 LTR known to bind peri-KB (Clark et al., 1995). 69 A 100x: o CO h- H P CM CO CO E E < O O " LO CO Q_ OvJ O E c\j i I CO CO D_ Q_ CO CO — CD 1 2 3 4 5 6 7 8 9101112 13 70 B O E x x X X o o o o o o , CO CO i - i -RBF-2-* tf H n.s. . u m m m „ free O 71 c -137 CTTCAAGAAC 1: -2: C 3: P3 4: Cm2T 5: Cm3T 6: 5'A3'C 7: P3MF 8: mC2 9: P3-M1 10: P3MA2 11: P3MT3 12: HIV2 13: B B3: mC1 t t TT 771 GG IG CC -119 GCTGACAT t t t ACT C peri-KB of HIV-2 LTR -134 to-120 t t t ATA 3.2.2.2 RBF-2 from Rat cells must be phosphorylated to bind RBE III Since RBF-2, like RBF-1, binds to the primary Ras responsive region of the HIV-1 LTR, I performed experiments designed to determine if RBF-2 was also phosphorylated in response to signals from the PTK/Ras/Raf pathway. I found no compelling evidence of mobility changes due to v-fps activity in CNA7 cells (not shown). However, I found that treatment of nuclear extracts from CNA7 cells with phosphatase ablates RBF-2 binding to RBE III altogether in EMSA (Fig. 14, lanes 1 and 2). Therefore, RBF-2 may contain phospho-proteins, and some of the phosphorylations of these components may be required for efficient DNA-binding. 3.2.2.3 RBF-2 also binds immediately downstream of the HIV-1 TATA box I found that by using a higher ratio of Ras expression plasmid relative to HIV-CAT reporter constructs, a construct truncated to -31 responded marginally but reproducibly to Ras (not shown and see Fig. 4). I therefore reasoned that an additional Ras responsive element resided downstream of -31. I inspected sequences downstream of -31 for similarity to the RBF-l/Ets binding motif or to the 5'-GAACTGCTGAC-3' RBF-2 core motif. I found that sequences surrounding the TATA box contained a 5'-CTGC-3' motif immediately 5' of the TATA box and a palindromic 5-AAGCAGCTGCTT-3' sequence immediately 3' of the TATA box (Fig. 6 and Fig. 15C). Radiolabeled oligonucleotide F (Fig. 6 and 15C) containing these sequences bound to nuclear factors, including one with mobility identical to RBF-2 (Fig. 15A). I mutated the CTGC motifs upstream and downstream of the TATA box 73 Figure 14. Treatment of RBF-2 with phosphatase reduces its DNA binding activity. EMSAs were performed with radiolabeled oligonucleotide C (RBE III) and CNA7 cell nuclear extracts. Lanes 1 and 2 contain nuclear extracts from cells grown at the v-fps nonpermissive temperature (39 °C). Lane 3 contains nuclear extracts from cells grown at the nonpermissive temperature (39 °C) which had been treated for 30 minutes at 37 °C with 10 units of shrimp alkaline phosphatase (United States Biochemical) before the EMSA reaction. 74 to determine whether either of these was important for formation of this specific complex. Mutation of the 5' CTGC had no effect on RBF-2 binding (Fig. 15A, lane 7) but mutation of the 3' CTGC motif abolished the ability of this oligonucleotide to compete for RBF-2 binding (Fig. 15A, lane 8). Interestingly, the formation of this complex was also ablated by the presence of a one hundred fold molar excess of the RBF-2 binding site RBE III (oligonucleotide P3, Fig. 15A, lane 4). I compared the binding specificity of this protein-DNA complex to that of RBF-2. Using EMSA I found that point mutations which prevented binding of RBF-2 to RBE III also blocked binding of the complex of identical mobility to sequences 3' of the TATA box (Fig. 15A and B). Conversely, mutations that blocked binding of this factor to its site downstream of the TATA box prevented binding of RBF-2 to its site at -137 to -119 (Fig. 15, compare panels A and B). I conclude that in addition to binding a site 5' of the N F - K B sites, RBF-2 binds immediately 3' of the TATA box. I have termed this TATA proximal RBF-2 binding element RBE I. The binding sites for RBF-1 and RBF-2 and their nomenclatures are summarized in Figure 16. 75 Figure 15. RBF-2 binds immediately downstream of the HIV-1 TATA box. (A) EMSAs were carried out with Jurkat nuclear extracts and oligonucleotide F. Reactions were carried out in the presence (lanes 2-8), or absence (lane 1), of a one hundred fold molar excess of the unlabelled oligonucleotides, indicated at the top of each lane. The competitor oligonucleotides are diagrammed in panel B and detailed in Appendix 1. Arrows indicate the positions of RBF-2, a band caused by a non-specific DNA binding protein (n.s.) and the free probe (free F). The arrow labeled TBC indicates an unknown protein-DNA complex that binds to the TATA box (see text) (B) Exactly as in panel A, except that radiolabelled oligonucleotide C was use as probe. (C) Schematic diagram of the oligonucleotides used in panels A and B. 76 A T - co i n 100x: ^ LO CO |— CO h-C Q_ CL Q_ Q_ Q_ TBC RBF-2 n.s. n.s. free F u u u u 1 2 3 4 5 6 7 8 77 B C O L O 100x: ^ L O C O I- C O H K C CL Q_ Q_ Q_ Q_ Q_ RBF-2 free C 1 2 3 4 5 6 7 8 78 c -36 -10 ATG CTG C A TAT AAGC AG CTG CTTTTTG 1: none 2: 5'n.s. (non specific) 3: P5 (wildtype RBEIV) 4: P3 (wildtype RBEIII) 5: PT 6: P3-M1 (mutant RBEIII) 7: PT-M3 8: PT-M5 t t t t GGTG t t t t GGTG Figure 16. Summary of the binding sites for RBF-1 and RBF-2 on the HIV-1 LTR. A schematic representation of sequences of the HIV-1 LTR bound by RBF-1 and RBF-2 as determined by scanning mutagenesis (see text). The binding sites for TBP, Spl, N F - K B , LEF, Ets-1, RBF-1 and RBF-2 are indicated by patterned boxes. Note that RBF-1 binds to sequences indistinguishable from the Ets-1 binding motif. N F - K B / RBF-1 is used to indicate that RBF-1 binds sites overlapping the N F - K B motifs. The numbering system for RBF binding elements (RBEs) is given below the relevant patterned boxes. 80 C C C G A G A G •159 P5: NF-KB II C T C C AAlG G G A C T T T C G i G C T G RBE IV -150 -140 NF-KB I u G G A C T T T C C •130 -120 RBE o » e 110 -100 -90 PKB: •80 B: C: P3: SP1 SP1 II SP1 I G 3GAGGCGTGGC C T G G G C G G G A C T G G G G A G T G G C G T C C T C T A G A T G C T G C ^ T A T A A G RBF-2 JAGCTGC7 T T T T G C A T G C A C T -70 -60 -50 •40 F: -30 RBE I—i -20 -10 -2 3.2.2.4 RBF-2 is distinct from hLEF Human LEF (TCF-la) binds to the HIV-1 LTR at -142 to -122 (Waterman et al, 1991; Waterman & Jones, 1990). It seemed unlikely that RBF-2 corresponded to hLEF since LEF is T cell specific whereas RBF-2 is broadly expressed in fibroblast, monocytic, B and Hela cells (not shown). However, it was important to exclude the possibility that RBF-2 was related to LEF because their binding sites partially overlap (see Fig. 16). To address this issue I compared the immunological and DNA binding properties of RBF-2 with LEF. Affinity purified antibodies against LEF prevented the binding of recombinant LEF to oligonucleotide C in EMSA (Fig. 17, lane 8). Under similar conditions, these antibodies did not inhibit the binding of RBF-2 (Fig. 17, lane 4). In addition, the binding specificity of recombinant LEF was different from RBF-2, in that LEF bound to oligonucleotide C was competed for more efficiently by oligonucleotide B than by oligonucleotide C (Fig. 17, compare lanes 6 and 7) In contrast, RBF-2 complex formation is competed for efficiently by C, but is not affected by the addition of unlabeled B (Fig. 17, compare lanes 2 and 3). Taken together with the fact that the electrophoretic mobility of LEF is greater than that of RBF-2, these data demonstrate that RBF-2 is not the previously described transcription factor LEF. 82 LL LU Antibody: - - -Competi tor: K B C B RBF-2 n.s. 1 2 3 4 LU Antibody: - - - g Competi tor: K B C B -rLEF 5 6 7 8 Figure 17. RBF-2 is not LEF (TCF-la). EMSAs performed with unstimulated Jurkat cell nuclear extracts (lanes 1-4) and purified recombinant human LEF (lanes 5-8). Gel shifts were performed as in Materials and Methods except that 8 ug of sheared salmon sperm DNA replaced poly dl-dC as non-specific competitor. Unlabelled competitor oligonuceotides added at a 50 fold molar excess are shown at the top of each lane. K B indicates an oligonuceotide containing the tandem binding sites for N F - K B from the H I V - 1 LTR. Arrows indicate the positions of RBF-2, recombinant LEF and a band caused by non-specific DNA binding proteins present in Jurkat extracts (n.s.). Affinity purified poylclonal antibody against LEF was added to lanes 4 and 8. 83 3.3 Point Mutations that Prevent RBF-1 and RBF-2 Binding in vitro Impair Ras Responsiveness of the HIV-1 LTR in vivo The locations of RBF-1 and RBF-2 binding sites are consistent with the genetically defined Ras responsive elements. To test the model that RBF-1 and RBF-2 play a role in Ras responsiveness of the HIV LTR, I introduced combinations of point mutations that block binding of RBF-1 to RBE IV (Fig. 7, mutation P5-M1), RBF-2 to RBE III (Fig. 13A, mutation P3-M1) and RBF-2 binding to RBE I (Fig. 15A, mutation PT-M3) into full length LTR-CAT constructs. These constructs were then transiently transfected into Jurkat cells and tested for Ras responsiveness by cotransfection with Ras expression vectors. An LTR-CAT construct bearing a mutation in RBE IV gave increased basal HIV LTR activity, but displayed a small but reproducible defect in Ras responsiveness (Fig. 18). Mutation of RBE III also increased basal activity but alone had no significant effect on the fold Ras trans-activation. A mutation of RBE I alone had little effect on basal or Ras trans-activation. Importantly, however, mutation of RBE I and LTI together impaired Ras stimulation and decreased basal transcription. Mutation of RBEs IV and I together or RBEs I, III and IV strongly impaired Ras responsiveness. The fact that constructs containing mutations in only a single RBE retain substantial Ras responsiveness implies that the RBEs are functionally redundant. Note that all of the constructs contain two intact N F - K B sites and at least one functional RBF-1 binding site. This is because I have not yet found mutations within RBE II that ablate RBF-1 binding without also preventing N F - K B binding. Thus, while RBF-1 or N F - K B likely contribute to the residual Ras response of mutated LTRs, the marked reduction in Ras stimulation caused by mutating 3 RBEs demonstrates important roles for RBF-1 and RBF-2 in Ras activation of the HIV-1 LTR. 84 Figure 18. Point mutations that prevent RBF-1 and RBF-2 binding in vitro impair Ras responsiveness of the HIV-1 LTR in vivo. Schematic diagrams of LTR-CAT constructs bearing point mutations of their RBEs are shown at the left. Intact RBEs are indicated by checkered boxes. The absence of checkered boxes plus a large "X" indicates that an RBE has been destroyed by mutagenesis (see text). 8 ug of pU3S was tranfected into Jurkat cells with 12 ug of v-Ha-Ras expression vector (black bars) or 12 ug of plasmid expressing N17 Ras (white bars). CAT activity is shown graphically at the right relative to the activity of pU3S cotransfected with N17 Ras. 85 p U 3 S m R B E I V mRBEIII m R B E l mRBEIII,IV mRBEl,III m R B E l , I V mRBEl,III,IV 0 5 10 15 Rela t ive C A T ac t i v i t y The dominant negative Ras N17 allele used in these experiments can have growth inhibitory affects in some (Feig & Cooper, 1988; Quilliam et ah, 1994), but not all systems (Swan et al., 1995; Terada et ah, 1995). It is unlikely that an inhibition of proliferation could give an artifactual decrease in transcription in this transient assay, where the amount of transcriptionally competent template is independent of cell division. In addition, changing only a few base pairs of the HIV-1 LTR specifically reduced the effect of Ras on the LTR (Fig. 18). However, to be absolutely certain that the stimulatory effect of Ras was not a secondary result of inhibited proliferation, I also compared cotransfection of a vector control, c-Ha-ras, v-Ha-ras and rasN17. As expected, overexpression of c-Ha-Ras stimulated the wildtype LTR but not an LTR with mutations in RBEs I, III and IV (Fig. 19). Also as expected, the dominant negative N17 repressed the wildtype LTR but not an LTR bearing mutations in RBEs I, III and IV (Fig. 19). These results demonstrate a specific effect of Ras activity on HIV-1 LTR transcription and exclude the possibility that RasN17 nonspecifically inhibits the LTR through indirect changes in cell proliferation. 87 Figure 19. Effects of a vector control, ras N17, cellular ras and oncogenic v-Ha-ras on HIV-1 LTRs bearing mutations in the RBEs. HIV-1 LTR-CAT constructs bearing point mutations in RBEs I, III and IV were cotransfected with empty expression vector, or plasmids expressingras N17, cellular ras (c-Ha-ras) or oncogenic ras (v-Ha-ras). 8 ug of pU3S was tranfected into Jurkat cells with 12 ug of Ras expression vector or the vector control. CAT activity is shown graphically relative to the activity of pU3S cotransfected with rasN17. Error bars indicate the standard deviations for triplicate experiments. 88 3.3.1 Point mutations in the RBEs specifically impair the HIV-1 LTR's response to Ras Because mutations to combinations of the RBEs reduce the level of basal transcription from the HIV-1 LTR (Fig.s 18 and 19) up to three fold, it was important to examine the specificity of the RBE response to Ras. The human foamy virus trans-activating gene product, Bel-1, activates transcription from the HIV-1 LTR through sequences that overlap RBE III and IV (Keller et al, 1992; Lee et al, 1992). I therefore asked whether RBF-1 and/or RBF-2 are required for trans-activation by Bel-1. Cotransfection of a plasmid expressing Bel-1 activated the wild type LTR, as well as LTRs bearing mutations in RBEs III and IV or mutations in RBEs I, III and IV (Fig. 20). Thus, RBF-1 and RBF-2 are dispensable for Bel-1 trans-activation of the HIV-1 LTR. More importantly, however, these data also demonstrate that mutations in the RBEs do not simply compromise the LTR's overall capacity to serve as a template for RNA Pol II initiation, but instead selectively impair Ras mediated trans-activation. 89 pU3S mRBEIII.IV mRBEI.III.IV Bel -1: T - p A C - C A M C A M -Figure 20. RBF-1 and RBF-2 are dispensable for rnms-activation of the HIV-1 LTR by human foamy virus Bel-1. 4 ug of pHIVS plasmids with intact or mutated RBEs were transfected with 5ug of Bel-1 expression vector (indicated with +) or empty expression vector (indicated with -). CAT activity was visualized by autoradiography of TLC plates. 90 3.4 Characterization of RBF-1 and RBF-2 3.4.1 UV crosslinking suggests RBF-1 and RBF-2 both contain DNA binding subunits of Mr 100 K Having established that at least one biological function of the RBEs is to confer Ras responsiveness on the HIV-1 LTR, it was of great interest to determine the identities of the RBE binding factors RBF-1 and -2. Heparin-agarose fractionation was used to enrich nuclear extracts for RBF-1 and -2. RBF-1 and -2 binding activities were assayed by EMSA. No separation of RBF-1 and -2 was achieved as they repeatedly eluted in the same peak fraction in a linear salt gradient from heparin-agarose (not shown). The mobility of both RBF-1 and -2 in EMSA was found to increase after heparin-agarose chromatography (Fig. 21A and B). The resulting protein-DNA complexes for both RBE IV and RBE LTI probes had identical mobility, suggesting that RBF-1 and -2 may share a common subunit. The increase in mobility after chromatography further suggests that both RBF-1 and RBF-2 consist of two or more polypeptides, and that at least one of these components becomes dissociated during heparin-agarose chromatography. 91 Figure 21. RBF-1 and -2 eluted from heparin-agarose show of increased mobility relative to nuclear extract proteins. RBFs -1 and -2 upon heparin-agarose chromatography. (A) EMSA reactions were performed with radiolabeled oligonucleotide A (RBE IV). Lane 1 contains crude U937 nuclear extracts. Lane 4 contains a fraction eluted from heparin-agarose. Lanes 2 & 3 contain low salt fractions from heparin-agarose chromatography. (B) EMSA reactions were performed with radiolabeled oligonucleotide C (RBE III). Lane 1 contains crude U937 nuclear extract. Lane 2 contains a fraction after chromatography on heparin-agarose. The specificities of the higher mobility complexes from panels A and B were verified by competition experiments (not shown). 92 To estimate the molecular weights of the DNA-binding components of RBF-1 and -2, I employed UV laser crosslinking experiments. Crosslinking reactions of radiolabeled RBE IV with U937 cell nuclear extracts that had been enriched for RBF-1 and -2 by heparin-agarose chromatography yielded bands of apparent M r 100K, 60K, and a smear of higher mobility products (Fig. 22A & 22B, lane 1). The smaller proteins may represent proteolytic degradation products, or bona fide crosslinked products. To resolve this question, nuclear proteins were crosslinked to RBE IV and a standard EMSA gel was run to resolve protein-DNA complexes. The complex corresponding to RBF-1 was excised from the wet EMSA gel, boiled in SDS-PAGE buffer and resolved by SDS-PAGE. Under these conditions, only a 100K protein was observed (Fig. 22A, lane 6). These results show that RBF-1 contains DNA binding subunits of approximate M rs 100K and 60K. The 60K protein may represent the DNA binding subunit of GABP, GABP a (Thompson et al, 1991; Watanabe et al, 1990). The 100K protein represents the most prominent component of RBF-1. UV laser crosslinking of RBE III with enriched nuclear fractions from U937 cells yielded 100K and 70K products (Fig. 22B). 93 Figure 22. RBE IV and RBE III crosslink to DNA binding subunits of 100K. as judged by UV-laser crosslinking. (A) Fractions enriched for RBF-1 and -2 binding activity by heparin-agarose chromatography were crosslinked to radiolabeled RBE IV before resolution on SDS-PAGE. Lane 1 contains no protein. Lanes 2-4 contain the indicated amounts of protein. Lane 6 contains protein-RBE IV complexes excised from an EMSA gel. (B) Heparin-agarose chromatographic fractions containing RBF-1 and -2 were crosslinked to RBE III (lane 3) or RBE IV (lane 1) and resolved on SDS-PAGE. The reactions in lane 2 contained REB IV crosslinked in the absence of protein. 94 A 1 2 3 4 5 6 B DNA: Protein: R B E IV R B E IV R B E III 20 ng 0 20 Lig - 1 8 0 3.4.2 Southwestern blotting demonstrates that RBF-1 and RBF-2 both contain DNA binding subunits of Mr 100 K To confirm the size of the DNA-binding subunits of RBF-1 and -2 determined determined by UV laser crosslinking experiments, I also performed Southwestern blotting experiments. Nuclear extracts from FIL-60 cells served as a negative control for these experiments since these cells did not express detectable RBF-1 or RBF-2 binding activity by EMSA (not shown). The binding site for RBF-1 recognized a single protein of apparent M r 100 K from CEM and Jurkat nuclear extracts (Fig. 23A, lanes 1 and 2). Both RBF-2 binding sites (RBE m and RBE I) bound to a pair of CEM and Jurkat nuclear proteins of M r 100K and 115K (Fig. 23B and C, lane 1 and 2). It is not yet clear whether these species are two distinct gene products or differentially modified forms of a single protein. The specificity of the Southwestern assay was confirmed by using oligonucleotides for the yeast transcriptional activator Gal 4 which gave no signal (not shown). In addition, in the case of RBE III, a single point mutation that reduced binding of RBF-2 in EMSA was used as a negative control. As expected, the signal generated by the probe with a point mutation was substantially lower than that of the wild type (Fig. 24). It is important to note that this assay is different from the EMSA assay where an oligonucleotide with mutations must compete for the binding of RBF-2 to wildtype oligonucleotides. In contrast, under Southwestern conditions the oligonucleotide with mutations must simply bind to RBF-2. Thus, a cytosine for adenosine at -122 does not completely ablate RBF-2 binding under Southwestern conditions. Taken together, the UV crosslinking and Southwestern blotting data provide compelling evidence that both RBF-1 and RBF-2 have DNA binding subunits of approximate M r 100 K. 96 Figure 23. RBF-1 and RBF-2 both contain DNA binding subunits of M r 100 K. (A) Biotinylated oligonucleotide A was used in Southwestern blotting as described in materials and methods. Lane 3 contains HL-60 cell nuclear extracts which do not contain RBF-1 binding activity as a negative control. Lane 1 and lane 2 contained CEM and Jurkat nuclear extracts, respectively. RBF-1 is indicated by an arrow. (B) Southwestern analysis of CEM, Jurkat and HL-60 nuclear proteins exactly as in panel A, except that biotinylated oligonucleotide C was used as probe. The position of RBF-2 is given by an arrow. (C) Southwestern blotting of CEM, Jurkat and HL-60 nuclear proteins as in A and B using biotinylated probe F from the HIV-1 TATA box region. 97 wtRBE III: mRBE IIl(P3-M1): RBF-2 —190 —108 — 84 — 6 7 — 5 5 RBF-2 —190 —108 — 84 — 6 7 — 5 5 1 2 3 4 Figure 24. Point mutations that impair RBF-2 binding in EMSA also impair RBF-2 binding in Southwestern blotting experiments. HL-60 cell nuclear extracts from undifferentiated (lanes 1 and 3) cells and differentiated (lanes 2 and 4) macrophages were fractionated on SDS-PAGE before Southwestern blotting with wildtype RBE IH oligonucleotide (lanes 1 and 2) or RBE III with a single base pair alteration (corresponding to P3-M1, lanes 3 and 4). 99 3.4.2.1 RBF-1 and -2 DNA binding activities are induced upon HL-60 differentiation Of all the cell lines tested, only HL-60 cells appeared to lack RBF-1 and -2 DNA binding activity as measured by EMSA. Since HIV-1 transcription and replication are induced in HL-60 cells when they are differentiated (Cannon et al., 1993; Kitano et al., 1990), I tested whether RBF-1 and -2 might be induced during differentiation of HL-60 to mature macrophages. Southwestern blotting of untreated HL-60 cell nuclear extracts gave no signal with either RBE IV or RBE III (Fig. 25, lanes 1 and 3). In contrast, HL-60 cells that had been treated for 24 hours with PMA, which is a phorbol ester that induces macrophage differentiation, generated a band of Mr 100K with both the RBE IV and HI probes (Fig. 25, lanes 2 and 4). This data demonstrates that the 100K component of RBF-1 and -2 are induced in HL-60 cells upon differentiation to macrophages. 3.4.3 The relationship between RBF-1 and -2 Given the fact that RBF-1 and -2 both contain DNA binding components of 100K, that these binding activities cannot be separated by heparin-agarose chromatography, that they are both induced upon HL-60 differentiation and that they serve functionally redundant roles in the HIV-1 LTR's response to Ras, it seemed likely that these factors share a common DNA binding subunit of 100K. However, the two factors clearly posses different DNA-binding specificities in EMSA (Fig. 15, lane 3, Fig. 10, lane 4). To help resolve the apparent contradiction between 100 Figure 25. HL-60 cells express RBF-1 and -2 DNA binding activity when differentiated to macrophages. HL-60 cell nuclear extracts from undifferentiated (lanes 1 and 3) cells and differentiated (lanes 2 and 4) macrophages were fractionated on SDS-PAGE before Southwestern blotting with wildtype RBE IV oligonucleotide (lanes 1 and 2) or RBE III (lanes 3 and 4). The positions of pre-stained molecular weight markers are shown at the right. 101 the observation that RBF-1 and -2 share many common properties yet do not bind identical sequences, I performed competition experiments where the amounts of competitor were carefully titrated. Under these conditions, the lower band of the RBF-2/RBE III complex was shifted to a lower mobility by unlabeled RBE IV oligonucleotide (Fig. 26, lane 4). However, the most prominent RBF-2 band was unchanged. I interpret these data as indicating that a component of RBF-2 may bind to the RBE IV oligonucleotide, causing a decrease in the mobility of the RBF-2/RBE III complex. Thus, two DNA binding surfaces may be present in RBF-2. As described above, RBF-1 also appears to have two DNA binding components, one represented by the ETS domain of GABPoc, and the other being an unknown protein of 100K. To further examine the similarities between RBF-1 and -2, I performed Southwestern blotting of nuclear exstracts treated with limited amounts of V8 protease. Hela cell nuclear extracts were treated for various times with V8 protease before fractionation on SDS-PAGE and Southwestern blotting with probes for RBF-1 and -2. Partial proteolysis yielded very similar, but not identical, patterns of binding to RBE IV (Fig. 27A) and RBE III (Fig. 27B). These results strongly suggest that the primary sequences of the 100K components of RBF-1 and -2 are related. Intriguingly, they also suggest that the 100K components of RBF-1 and RBF-2 may themselves be proteolytic products of a larger precursor protein since limited digestion of nuclear extracts reveals a DNA-binding protein of approximate M r 130K for RBE IV (Fig. 27A, lanes 2 and 3) and RBE III (Fig. 27B, lanes 2 and 3). A precursor would presumably be larger than 130K and may be inhibited from binding DNA. Consistent with this notion, a faint band at 145K is observed with untreated nuclear extracts (Fig. 27 A and B, lanes 1). 102 Competitor: 10X 10X 20X 20X RBE IV RBE III RBE IV RBE III RBF-2 Shift Figure 26. Unlabeled RBE IV alters the mobility of RBF-2-RBE III complexes. EMSAs were performed with radiolabelled oligonucleotide C and unstimulated U937 cell nuclear extracts. Reactions were carried out in the presence (lanes 2-5), or absence (lane 1), of excess unlabeled oligonucleotides representing RBE III or RBE IV. The names and relative amounts of competitor oligonucleotides are indicated at the top of each lane. Arrows indicate the positions of RBF-2. The lower band in lane 4 is shifted to a lower mobility by the addition of RBE IV (lane 4, see arrows at right). 103 Figure 27. Limited proteolysis of the 100K subunits of RBF-1 and -2 suggest they are similar proteins. Hela cell nuclear extracts were treated with V8 protease (endoproteinase Glu-C, Boehringer Mannheim) for 10 (lane 2), 20 (lane 3), or 60 (lane 4) minutes before fractionation on SDS-PAGE (10%). Southwestern blotting with RBE IV (panel A) or RBE III (panel B) was used to visualize proteolytic DNA binding fragments. Lane 1 contains untreated Hela nuclear extracts, and lane 5 contains nuclear extracts preepared from CNA7 cells. 104 SOI JJ CD T | > JJ untreated ro 1, < I | I f • I V8-10' CO 1 , 1 V8-20' V8-60' cn I CNA7 M i l l UH CD CO o cn -xi 00 O cn cn CO O CD U i N 4^ 00 O 3.5 The HIV-1 T A T A Box Forms a Unique Complex with Primate Cell Nuclear Proteins The EMSA probe containing RBE I and the HIV TATA box bound specifically to a low mobility complex (Fig. 15A, indicated by TBC). This complex likely contains TATA-binding protein (TBP), and a subset of its associated TAFs. Given that the architecture of the HIV-1 TATA box is critical for Tat responsive transcription (see section 1.4.2.2.), it was of interest to further investigate the properties of TBC. To define the nucleotides important for the formation of this TATA binding complex (TBC), scanning mutagenesis was used. TBC binds specifically to the TATA box, as point mutations in the TATA box motif impair its ability to bind the LTR (Fig. 28A, lanes 4-7). In addition, the TATA box of HIV-2 competes for binding of this factor to the HIV-1 TATA box (Fig. 28A, lane 14). The formation of TBC appears to depend upon sequences flanking the TATAA motif itself (Wong & Bateman, 1994), since oligonucleotides with mutations outside the TATA box compete poorly for TBC (Fig. 28A, lanes 8,11 and 13, and 28B, lanes 3 and 4). 3.5.1 Is TBC binding important in Tat trans-activation? Two observations provide circumstantial evidence that binding of TBC to the HIV-1 TATA-element may be necessary for Tat trans-activation of the HIV-1 LTR. The first is a correlation between TBC binding in vitro and Tat trans-activation in vivo. For example, changing position -26 from thymidine to adenine does not abolish competition for TBC binding (Fig. 28A, lane 5), and does not alter Tat trans-activation (Fig. 29). In contrast, changing the same position to a guanine results in poor competition for TBC binding and severely impaired Tat responsiveness in Jurkat T cells (Fig. 29). 106 Figure 28. A low mobility complex binds specifically to the HIV-1 TATA box. (A) EMSAs were performed with radiolabeled oligonucleotide F which spans the TATA box region (see panel C), and unstimulated Jurkat cell nuclear extracts. Reactions were carried out in the presence (lanes 2-14), or absence (lane 1), of a one hundred fold molar excess of the unlabelled oligonucleotides diagrammed in panel B. The names of competitor oligonucleotides are indicated at the top of each lane. Arrows indicate the positions of RBF-2, a band caused by a non-specifc DNA binding protein (n.s.) and the free probe (free F). The arrow labelled TBC indicates an unknown protein-DNA complex that binds to the TATA box (see text). (B) As in A with competitor oligonucleotides that bear mutations to the sequences flanking the HIV-1 TATA sequence. (C) Nucleotide alterations in sequences of TATA box containing competitor oligonucleotides used in scanning mutagenesis are indicated by arrows drawn from the wildtype sequence to the altered bases. The relevant lane from panel A, along with the names, is given at the left of mutated. (D) The competitor oligonucleotides used in panel C are shown. 107 A ^ > > f > f S ( D ( D ^ C D | -i _ i _ L i _ L i - l i — I— I— C Q C Q C Q ^ ^ J C M 100X: , i r i r i i n Q . Q . I D I D ( D 2 5 I T B C — U u y u u u RBF-2 —" CM O CO 1 2 3 4 5 6 109 c 1: 2: PT (wt) 3: PT-M5 4: PT-V1 5: PT-V2 6: PT-MC 7: PT-V3 8: PT-M3 9: BB62 (wt) 10: BB63 11: BB64 12: MA62 13: M262 14: H2T -36 A T G C -10 G C A | T A T A A G C | A G C T G C T T T T T G tttt GGTG 1 C A G G T tt A A T tttt GGTG It T? GT GT HIV-2 LTR TATA box D -36 -10 ATG CTG C A TATAAG C AG CTG CTTTTTG 1: none 2: PT (wt) 3: PT-M1 4: PT-M2 5: PT-MC 6: PT-M3 T T T T GGTG GGTG CACC GGTG t GGTG G W W GGTG 150 o 100 H CO r-< O CD > J3 50-CD DC I 1 —I—' -TATAA TcTAA TAaAA TAgAA (PT) (PT-V1) (PT-V2) (PT-MC) • no Tat • +RSV-Tat TATAg (PT-V3) Figure 29. Point mutations that impair TBC binding in vitro prevent Tat trans-activation in vivo. CAT activity from Jurkat cells cotransfected with HIV LTR CAT contructs and a Tat-expression plasmid (open bars) or a vector control (solid bars) is shown relative to wildtype LTR in the presence of Tat (100). Point mutations to the TATA box are shown at the bottom, with the corresponding oligonucleotides from Figure 28 shown in brackets. 112 A second observation consistent with a the hypothesis that TBC plays a role in Tat trans-activation is a correlation between TBC binding activity and the ability of a cell line to support Tat trans-activation. HL-60 cells do not have detectable TBC binding activity (Fig. 30A, lane 1) and poorly support Tat trans-activation (Fig. 30B). However, differentiated HL-60 cells do have detectable TBC binding activity (Fig. 30A, lane 2) and give higher levels of Tat trans-activation (Fig. 30B). A final point worth mentioning is that TBC is observed only with human and primate cell line lines, and not with mouse or rat cell lines (not shown), suggesting species specificity. A similar species specificity has been demonstrated for Tat function (Hart et ah, 1989; Newstein et ah, 1990). Taken together, these data suggest that factors that bind to sequences flanking the HIV-1 TATA box, and which are induced upon HL-60 differentiation, may play a role in mediating the response of the LTR to Tat. These observations are preliminary, but clearly warrant further efforts to determine the composition of TBC. 113 Figure 30. TBC binding activity is induced upon differentiation to macrophages and correlates with increased Tat trans-activation. (A) EMSA reactions were performed with radiolabeled oligonucleotide F and nuclear extracts from undifferentiated HL-60 cells (lane 1), HL-60 cells differentiated to macrophages (lane 2) or to granulocytic (lane 3). (B) Macrophage differentiation of HL-60 cells increases the ability of these cells to support Tat trans-activation. CAT activity, (relative to wildtype activity with Tat) in the presence (solid bars) or absence (open bars) of Tat-expressing plasmid 114 A O + + o o o CD CO CD nuclear extract: TBC 115 125 Undifferentiated D i f f e r e n t i a t e d 116 4. DISCUSSION 4.1 The Region Immediately Upstream of the NF-KB Sites is Important in HIV Replication In addition to the data presented in this thesis, accumulating reports suggest that cz's-acting sequences immediately upstream of the N F - K B sites are an important regulatory element governing HIV-1 replication. Several studies have shown, using transient transfection assays, that mutations in the -158 to -118 region of the HIV LTR impair HIV transcription in T cells, particularly PMA/PHA stimulated T cells (Zeichner et al., 1991), and in primary macrophages (Moses et al., 1994). Deletion of this region was also reported to have either negative or positive effects on transcription, depending on the cell line studied (Nakanishi et al., 1991). Moreover, linker scanning mutations overlapping the binding sites of RBF-1 and RBF-2 in HIV-1 proviruses dramatically reduced viral replication in T cell lines as well as primary human T cells (Kim et ah, 1993b). The data in this thesis confirm the importance of this region and explain in part why mutations in this region have more pronounced effects in stimulated cells, where the Ras pathway is activated (Zeichner et al., 1991). Thus, the contribution of cellular transcription factors that bind to the HIV-1 LTR in the -158 to -118 region is seen more clearly when viral replication from integrated proviruses is assayed rather than assaying transient expression of reporter genes. This may reflect a requirement for incorporation of the promoter template into chromatin to observe the full effects of transcription factors that bind this region. Such a requirement has recently been demonstrated in vitro for hLEF (Sheridan et al, 1995b). The identification RBF-1 and RBF-2 and their binding sites will make it possible to clarify the respective contributions of RBF-1, RBF-2, Ets-1 and hLEF, all of which bind to the -158 to -118 region, to HIV-1 transcriptional regulation. Because nucleotides -158 to -118 have cell type specific contributions to HIV transcription (Nakanishi et al., 1991), it is worth noting that 117 RBF-1 and RBF-2 are expressed in T cell, B cell, fibroblast, erythroleukemia and promonocyte cell lines (not shown). In contrast, LEF (Waterman & Jones, 1990) and Ets-1 (Macleod et al., 1992) are considered to be T cell specific. In addition to HIV-1, the other primate lentiviruses, HIV-2 and SIV also have enhancer elements upstream of the N F - K B site that are important for inducible transcription (Clark et ah, 1995; Hannibal et al., 1993; Ilyinskii et ah, 1994; Ilyinskii & Desrosiers, 1996; Leiden et al, 1992; Markovitz et al., 1990; Markovitz et al, 1992b). Remarkably, the activity of this upstream enhancer confers on SIV the ability to replicate and cause AIDS in rhesus monkeys, even in the absence of the N F - K B and SP1 binding elements (Ilyinskii et al., 1997). Whether or not RBF-1 and -2 play roles in the regulation of SIV and HIV-2 transcription is not yet clear. Indirect evidence that RBF-2 may bind to the HIV-2 LTR comes from the fact that an oligonucleotide derived from the region immediately upstream of the N F - K B motif competes for RBF-2 binding in EMSA (Fig. 13A, lane 12). Further work will be required to determine if RBF-2 plays a general role in transcriptional regulation of primate lentiviruses. 4.2 The RBEs Function in a Context Specific Fashion Historically, binding sites of transcription factors have often been multimerized and inserted upstream of heterologous promoters to provide information about the functions of a given DNA binding protein. More recently, the shortcomings of this simplistic approach have been realized. One problem is that many transcription factors do not function when their binding sites are removed from the natural context. These transcription factors have been termed context specific. Context specific transcription factors have been shown to function by several mechanisms (Werner & Burley, 1997). Transcription factors can play architectural roles at promoters where their DNA bending function is critical for the spatial organization of higher-order protein-DNA complexes, as with LEF (Giese & 118 Grosschedl, 1993; Love et al, 1995) and YY1 (Natesan & Gilman, 1993). Context specific transcription factors may also contain an activation domain that functions uniquely in the presence of a specific arrangement of flanking binding motifs, as is the case with LEF (Giese & Grosschedl, 1993; Love et al, 1995). The context specificity of a transcription factor may lie within the DNA binding site itself, as with the glucocorticoid receptor, which undergoes an allosteric change upon binding to different sites that alter its trans-activation function (Starr et al, 1996). Finally, the activity of a context specific transcription factor may be dramatically altered by proteins bound to flanking sequences, as with Dorsal (Lehming et al, 1994). Another complication of transferring elements to heterologous promoters is that an element may contain binding sites for several transcription factors. For example, initial studies using this approach led incorrectly to the conclusion that N F - K B family members alone were responsible for Ras responsiveness of the HIV-1 LTR (Arenzana-Seisdedos et al, 1989; Finco & Baldwin, 1993; Li & Sedivy, 1993). Later on, it became clear that the N F - K B motifs of the HIV-1 LTR contain embedded Ets sites and that the Ets family member GABP is critical for the response of these elements to Ras (Flory et al, 1996; Hodge et al, 1996; Seth et al, 1993). Despite these problems with the transfer of elements to heterologous promoters, useful information can often be gleaned from such experiments. Therefore, I have placed three copies of RBE HI upstream of the adenovirus Ela TATA box but found no measurable transcriptional activity in the presence or absence of activated Ras (data not shown). Thus, RBF-2 is by definition a context specific factor. Interestingly, RBE IE can act as an enhancer when placed adjacent to N F - K B motifs in a synthetic promoter (Koken et al, 1994). An understanding of the mechanistic details that account for context specificity of RBF-2 must await isolation of cDNAs encoding it. I have not transferred RBE IV to a heterologous promoter because Ets-1, GABPa, with GABPPiand the 100K subunit of RBF-1 all bind to this 119 element. Further work will be required to dissect the base pairs in this element are responsible for binding each of these factors. 4.3 A Component of RBF-1, GABP, is a Ras Responsive Transcription Factor GABP was originally identified as a specific DNA-binding activity that recognized a region of herpes simplex virus type 1 immediate early gene promoters that is required for activation by the viral frans-activator, VP16 (LaMarco & McKnight, 1989). These studies led to the isolation of cDNAs encoding the subunits of GABP and its characterization as a heterotetramer (LaMarco et al, 1991; Thompson et al, 1991). Later studies identified GABP because it bound to the rat cytochrome oxidase subunit IV (Virbasius et ah, 1993), as well as the adenovirus E4 (Watanabe et al, 1993; Watanabe et al, 1990) and EI A (Bolwig et al, 1992) promoters. Therefore, GABP has also been termed NRF-2, E4TF1 and EF-1. Human GABP (hGABP) has a DNA binding subunit (hGABPa) of 60K that contains a C-terminal ETS domain. Alone, hGABPa does not bind efficiently to DNA, but can do so only together with a hGABPp subunit (Thompson et al, 1991; Watanabe et al, 1993; Watanabe et al, 1990). There are four homologous "P" subunits termed pi, p2, yl, and y2 (Gugneja et al, 1995). These four proteins share: i) a C-terminal ankyrin repeat region, which contacts the ETS domain of hGABPa, ii) a transcriptional activation domain, and iii) an N-terminal dimerization domain. It was gratifying to discover that RBF-1, as identified by EMSA, contains hGABP subunits, since GABP has recently been implicated in TPK/Ras responsive transcription (Flory et al, 1996; Ouyang et al, 1996). In fact, GABP was recently shown to be a critical factor in HIV-1 LTR responsiveness to Ras by binding to the Ets sites within the N F - K B motifs (Flory et al, 1996). My data suggest that the 5' Ets motif (RBE IV) is also important in the Ras response of the LTR and that GABP is part of a DNA-protein complex that forms at this site. Based on work in the literature on GABPa (Flory et al, 1996; Ouyang et al, 1996), it is reasonable to 120 assume that GABPoc is phosphorylated in response to Ras signaling. Whether this phosphorylation event can account for the increased mobility observed in extracts expressing a constitutively active PTK (Fig. 12) is unclear. The availability of recombinant GABP subunits and specific antibodies should make addressing this question straightforward. These reagents should also facilitate dissection of the functional role of the 100K subunit of RBF-1 in Ras responsive transcription and the nature of any interactions between it and GABP. Although the Ras responsive ETS domain-containing transcription factor Ets-1 (Wasylyk et al, 1997; Yang et al, 1996) binds to RBE IV, I believe RBF-1 plays the predominant role in Ras responsiveness of the LTR for two reasons. First, RBF-1 represents the predominant complex formed with RBE IV in EMSAs and presumably also does so in vivo. Second, RBE IV contributes to the Ras response in U937 (Fig. 5C) and CHO cell lines (Fig. 4) which do not express Ets-1. 4.4 RBF-2 is Also Required for Ras-responsive HIV-1 Transcription Even in the presence of an intact RBF-1 site and the GABP binding elements within the NF-KB sites, the LTR responds very poorly to Ras when its RBEs I and III are disabled (Fig. 18). Thus, binding of RBF-2 is also required for Ras responsive HIV transcription. These data extend earlier studies which also demonstrated Ras responsive HIV-1 transcription, but suggested N F - K B was the critical factor mediating the response (Arenzana-Seisdedos et al, 1989; Baldari et al, 1992; Dehbi et al, 1994; Eicher et al, 1994; Hohashi et al, 1995). Studies from the Rapp laboratory suggested that the NF-KB motifs were indeed important for Ras stimulation but that GABP binding was required in addition to intact N F - K B motifs (Bruder et al, 1993; Flory et al, 1996). My data demonstrate that RBF-2, in addition to GABP and N F - K B , is necessary for full Ras stimulation of the HIV-1 LTR. This functional dependence on several cooperating transcription factors is analogous to the interleukin-2 121 receptor a-chain (IL-2Ra) promoter, which requires Elf-1, HMG-I(Y) and N F - K B family members (John et al, 1995) to respond to T cell activation signals. There is ample precedent for promoters that require an Ets related transcription factor along with additional transcription factors to respond to oncogenic signals, including the now classical example of Etsl cooperating with c-Fos and c-Jun (Wasylyk et al, 1990). Indeed, an oncogene response element is defined by the presence of an Ets binding site along with nearby sites for cooperating transcription factors (Galang et al., 1994). The granulocyte-macrophage colony-stimulating factor (GM-CSF) promoter requires both Elf-1 and API for responsiveness to T cell mitogenic signals (Wang et al., 1994). In addition, the N F - K B family members p50 and c-rel have been shown to physically interact with the ETS domain of Elf-1. Whether or not the ETS domain of GABP a also interacts with N F -KB family members remains to be determined. Clarifying the mechanistic contributions of GABP, RBF-2, and N F - K B to Ras-induced HIV transcription will require the identification of any protein-protein interactions between these transcription factors. 4.5 RBF-2 Binds to a Site Overlapping the HTF4, AP4 and E47 Sites RBF-2 interacts with the HIV-1 LTR at a site that overlaps the previously noted binding sites for the E box transcription factors AP4, E47 (Ou et al., 1994) and HTF4 (Zhang et al, 1992). Although this RBF-2 site (RBE I) contains the palindromic sequence AAGCAGCTGCTT with E boxes (CANNTG) on both the Watson and Crick strands, the RBF-2 binding site RBE III does not contain E box motifs but instead the imperfect palindrome CTGCTG. Since there is no precedent for an E box binding bHLH factor binding to such a site, it cannot be speculated that RBF-2 is a bHLH factor. The sequences flanking the HIV-1 TATA box, including the 3' E boxes, have been shown to be critical for Tat trans-activation of the LTR (Lu et al, 1993; Ou et al, 1994). RBE HI does not appear to be critical in Tat activation since mutations that 122 block RBF-2 binding to RBE III in EMSA do not significantly impair Tat trans-activation in Jurkat cells (not shown). It is not yet clear whether AP4, E47 or HTF4 play important roles in the regulation of HIV-1 transcription, however, if these factors do play such roles it will be interesting to see if they have cooperative or antagonistic interactions with RBF-2. 4.6 The Physiological Significance of RBF-1 and -2 Function It is clear that tyrosine kinase/Ras/Raf responsive HIV transcription requires: I) intact NF-KB motifs (Arenzana-Seisdedos et al, 1989; Baldari et al, 1992; Bruder et al, 1993; Dehbi et al, 1994; Eicher et al, 1994; Hohashi et al, 1995), ii) intact GABP sites both within the KB motifs(Flory et al, 1996) and at -151 to -142 (Bell & Sadowski, 1996), and ii) RBF-2 binding sites 5' of the NF-KB sites and 3' of the TATA box (Bell & Sadowski, 1996). These facts provide a more complex picture of transcription factor-LTR interactions required for inducible HIV-1 transcription than was previously envisaged. However, it is important to bear in mind that the bulk of our understanding of inducible HIV-1 transcription comes from non-physiological systems where oncogenic forms of signaling components are overexpressed, or where pharmacalogical reagents are used to mimic cellular activation. Thus, the signals that activate the LTR through RBF-1 and RBF-2 in vivo remain to be identified. Obvious candidates include cell stimuli that act on CD4+ T cells and cells of the monocyte/macrophage lineage, that act through the tyrosine kinase/Ras/Raf pathway. In this vein, candidate physiological signals that may regulate RBF-1 and RBF-2 include activation of T cells through the T cell receptor, which acts in part through Ras activation (Downward et al, 1990; Swan et al, 1995) and can stimulate HIV-1 transcription (Gruters et al, 1991) and replication (Alcami et al, 1995), as well as cytokines such as GM-CSF and IL-3, which activate Ras in myeloid cells (Satoh e t al, 1991) and can increase HIV replication (Folks et al, 1987; Koyanagi et al, 1988). Thus, the long term goal for studying the role of RBF-1 and -2, GABP and N F - K B 123 must include the use of animal models and freshly isolated human peripheral blood cells to try to understand in what tissue compartments and by what physiological stimuli these factors are activated. There may be signal transduction pathways other than the Ras pathway that control RBF-1 and -2 activity. For example, it has recently been shown that the Ets family member, PEA3, is regulated by both the ERK and JNK (Jun N-terminal kinase) kinase cascades (O'Hagan et al., 1996). In addition, the GTPases RhoA, Racl, and CDC42 activate the serum response factor (SRF) in a signal pathway separate from the Ras/Raf/ERK pathway (Hill et al, 1995). In fact, Rho, CDC42 and Racl were recently shown to stimulate transcription from the HIV-1 LTR, although this study did not address the roles of GABP, RBF-1 or RBF-2 (Perona et al, 1997). 4.7 RBE III is Frequently Duplicated in HIV-1 Infected Individuals A remarkable number of laboratories have observed natural HIV-1 isolates that contain duplications of the ACTGCTGA motif precisely equivalent to RBE III (Ait-Khaled et al, 1995; Blumberg et al, 1992; Estable et al, 1996; Golub et al, 1990; Koken et al, 1992; Leys et al, 1990; McNearney et al, 1995; Michael et al, 1994; Zhang et al, 1997). These duplications occur against a background of point mutations and invariably contain a "core" 12 base sequence that overlaps the binding site of RBF-2. RBF-2 can bind to these duplicated motifs in EMSA (Estable et al, 1997). Moreover point mutations that block binding of RBF-2 to RBE III also block RBF-2 binding when introduced into naturally occuring duplications containing the ACTGCTGA motif (Estable et al, 1997). The role that these duplications may play in HIV-1 transcription and/or replication has remained enigmatic. In some experimental systems they appear to increase transcription from the HIV LTR (Golub et al, 1990), yet in others, a repressive effect on replication has been detected (Koken et al, 1992; Koken et al, 1994). When artificially placed next to N F - K B sites in an enhancerless SV40 promoter, the ACTGCTGA motif can act as an enhancer (Koken et al, 1994). 124 Despite the lack of an easily detectable transcriptional advantage for duplicated RBE III sites in vitro, the frequency with which they are found in vivo suggests that duplication of the binding site for RBF-2 is advantageous for HIV at some point in vivo. Mario Estable has sequenced proviral 5' LTR DNA from 42 patients at all stages of disease to ascertain which cz's-acting motifs of the LTR are selected for in vivo (Estable et al., 1996). Remarkably, this study demonstrated that RBE III is at least as conserved in HIV infected individuals as the N F - K B and SP1 binding sites, highlighting the importance of RBF-2 binding in vivo3 . In agreement with the fact that RBF-1 and RBF-2 are functionally redundant, rare RBE I site mutations, or mutations in the Ets motifs embedded in the N F - K B motifs correlate with tandem duplications of the RBE III element in in vivo selected LTR sequences. Similarly, the only viruses in the Los Alamos National database that have mutations in the Ets core motif of RBE IV (ANT 70 & HIVMVP5180) have duplicated RBE Ills, but these duplications occur between the two N F - K B motifs instead of 5' of them (Myers et al., 1993). We have therefore proposed a model whereby LTRs that cannot bind RBF-1 either through mutation of RBE II or RBE IV, can function normally if an extra RBF-2 binding site is present (Estable et al., 1996). Perhaps the most compelling support of this compensatory model is the recent report of an individual infected by a strain of HIV-1 that lacks N F - K B motifs altogether, but has a duplication of RBE III (Zhang et al., 1997). Surprisingly, this virus was able to replicate and cause pathogenesis as evidenced by CD4 decline. Our compensatory model for duplicated RBE Els remains speculative, but provides a plausible explanation for the lack of a strong transcriptional phenotype for LTRs 3 Of all the naturally occuring HIV-1 sequences known, only one group of related viruses originating from a single blood donor has mutations that are expected to prevent RBF-2 binding to R B E III. Intriguingly, these viruses do not cause disease progression, yet contain intact N F -k B and SP1 sites (Deacon et al., 1995). Whether a defect in RBF-2 binding might play a role in the non-pathogenic pheotype displayed by these viruses is not known. 125 derived from clinical samples that contain duplicated RBE EI sites, since these may also contain defects in RBEs II and IV. 4.8 Strategies to Obtain Molecular Clones for RBF-1 and -2 It is worthwhile, particularly for individuals who will continue this work, to briefly describe the efforts made to obtain cDNAs for RBF-1 and RBF-2 subunits. The screening of A.gtll expression libraries with multimerized RBE IV and RBE III was done by several individuals including Richard Bruskiewich, Ivan Sadowski, Kerry Tedford and Esther Leng. These attempts lead to the cloning of 32bl and EL7, both of which turned out to be nonspecific DNA binding proteins upon closer examination. Joan Kam, Kerry Tedford and I used the yeast one-hybrid system (Li & Herkowitz, 1994; Wang et al, 1993) to screen over 107 yeast colonies for cDNAs from a Hela cell library for proteins that bind to RBE III. The one hybrid screen used was based on two steps, the ability to grow on uracil minus media (multimers of RBE III were placed upstream of the ura3 or lacZ genes), and the ability to turn yeast colonies blue on X-gal plates. One cDNA that was rescued after two steps of screening was sequenced and found to be the human homologue of Hoxa-10 gene, PL (Benson et al, 1995; Lowney et al, 1991). However, recombinant PL protein did not bind RBE III in EMSA or Southwestern blotting experiments, and anti-PL antibodies did not affect the RBF-2-RBE III complex in EMSA. Thus, this clone is not RBF-2 but an artifact. 4.9 Future Directions The direction that studies to further understand the role of RBF-1 and -2 in regulating HIV-1 transcription must take is painfully obvious. The rate limiting step is, without a doubt, the isolation of cDNAs encoding this factor(s). Having essentially exhausted the available molecular genetic approaches for cloning DNA binding proteins, large biochemical purification has become the necessary hurdle to 126 cross towards obtaining cDNAs. Screening ^-gtll libraries and the yeast one-hybrid strategies are based on two assumptions. The first assumption is that only a single polypeptide is required for high affinity binding. This assumption seems valid for the 100K subunit of RBF-1 and -2, which can be detected in Southwestern blotting experiments where protein complexes will have been disrupting by boiling in SDS-PAGE loading buffer. In contrast, GABP a would not be picked up in such screens because GABPp is required for efficient binding (LaMarco et al., 1991; Thompson et al., 1991; Watanabe et al., 1990). The second requirement for these screens is that post-translational modifications that are necessary for DNA binding will likely not occur in the bacterial or yeast strains used in the screen. The latter assumption may not hold for RBF-1 and -2. In fact, in the case of Rat RBF-2, treatment with phosphatase ablates DNA binding in EMSA (Fig. 14). Thus, purification of RBFs-1 and -2, including DNA affinity chromatography is the only method that makes no special assumptions about the nature of the DNA binding factors to be cloned. Importantly, purification to homogeneity should also provide more information about the biochemical properties of RBF-1 and -2, including the number of separate polypeptides of which they are composed. Once cDNAs encoding RBF-1 and -2 subunits are isolated the standard structure-function studies with recombinant protein should allow the molecular details of RBF function to be delineated. DNA binding domains, activation domains and sites of phosphorylation will be mapped and this information will be used to determine how Ras activation modulates HIV-1 expression. In addition recombinant RBFs will allow a more precise definition of RBEs based on footprinting and modification interference studies. Another critical experiment will be placing mutations in the RBEs in the context of whole virus to demonstrate a role for RBEs in a more physiological setting. It will also be of interest to determine the role of RBEs in response to macrophage differentiation, since HL-60 cells express RBF-1 and -2 only upon 127 differentiation. Finally, it will be important to resolve the roles (if any) of RBF-1 and -2 in the formation of TBC at the HIV-1 T A T A box. 4.10 Conclusion In summary, the work described in this thesis identifies for the first time two DNA binding factors, RBF-1 and RBF-2, and defines a mechanism whereby these factors are required for the induction of HIV gene expression in response to the Ras signal transduction pathway. RBF-1 was shown to contain GABPqc and GABPpi as well as a DNA binding subunit of 100K. RBF-2 contains a 100K DNA binding subunit that is similar or identical to that of RBF-1. This information will provide a foundation for molecular cloning of RBF-1 and -2 which will be a critical step in obtaining a complete understanding of the regulation of HIV-1 gene expression. 128 REFERENCES Ait-Khaled, M., McLaughlin, J.E., Johnson, M.A. & Emery, V.C. (1995) Distinct HIV-1 long terminal repeat quasispecies present in nervous tissues compared to that in lung, blood and lymphoid tissue of an AIDS patient. AIDS, 9, 675-683. Alcami, J., Lera, L.D., Folguiera, L., Pedraza, M.A., Jacque, J.M., Bachelerie, F., Noriega, A.R., Hay, R.T., Harrich, D., Gaynor, R.B., Virelizier, J.L. & Arenzana-Seisdedos, F. (1995) Absolute dependence on KB responsive elements for initiation and Tat-mediated amplification of HIV transcription in blood CD4 T lymphocytes. EMBO }., 14, 1552-1560. Arenzana-Seisdedos, F., Israel, N., Bachelerie, F., Hazan, U., Alcami, J., Dauty, F. & Virelizier, J.-L. (1989) c-Ha-ras transfection induces human immunodeficiency virus (HIV) transcription through the HIV-enhancer in human fibroblasts and astrocytes. Oncogene, 4, 1359-1362. Auble, D.T., Hansen, K.E., Mueller, C.G.F., Lane, W.S., Thorner, J. & Hahn, S. (1994) Motl, a global repressor of RNA polymerase II transcription, inhibits TBP binding to DNA by an ATP-dependent mechanism. Genes & Dev., 8, 1920-1934. Baeuerle, P.A. & Baltimore, D. (1996) NF-kB: ten years after. Cell, 87, 13-20. Bagnarelli, P., Menzo, S., Valenza, A., Manzin, A., Giacca, M., Ancarani, F., Scalise, G., Varaldo, P.E. & Clementi, M. (1992) Molecular profile of human immunodeficiency virus type 1 infection in symtomless patients and patients with AIDS. /. Virol, 66, 7328-7335. Baldari, C.T., Macchia, G., Massone, A. & Telford, J.L. (1992) p21ras contributes to HIV-1 activation in T-cells. Febs Lett, 304, 261-4. Bassuk, A.G., Anandappa, R.T. & Leiden, J.M. (1997) Physical interactions between Ets and NF-kB/NFAT proteins play an important role in their cooperative activation of the human immunodeficiency virus enhancer in T cells. /. Virol, 71, 3563-3573. Bates, P. (1996) Chemokine receptors and HIV-1: An attractive pair? Cell, 86,1-3. Beato, M. (1989) Gene regulation by steroid hormones. Cell, 56, 335-344. Bednarik, D.P. & Folks, T.M. (1992) Mechanisms of HIV-1 latency. AIDS, 6, 3-16. Bell, B. & Sadowski, I. (1996) Ras-responsiveness of the HIV-1 LTR requires RBF-1 and RBF-2 binding sites. Oncogene, 13, 2687-2697. 129 Benkirane, M., Hirn, M., Carriere, D. & Devaux, C. (1995a) Functional epitope analysis of the human CD4 molecule: antibodies that inhibit human immunodeficiency virus type 1 gene expression bind to the immunoglobulin CDR3-like region of CD4. /. Virol, 69, 6898-6903. Benkirane, M., Schmid-Antomarchi, H., Littman, D.R., Hirn, M., Rossi, B. & Devaux, C. (1995b) The cytoplasmic tail of CD4 is required for inhibition of human immunodeficiency virus type 1 replication by antibodies that bind to the immunoglobulin CDR3-like region in domain 1 of CD4. /. Virol, 69, 6904-6910. Benson, G.V., Nguyen, T.E. & Maas, R.L. (1995) The expression pattern of the murine Hoxa-10 gene and the sequence recognition of its homeodomain reveal specific properties of Abdominal B-like genes. Mol. Cell Biol, 15, 1591-1601. Berkhout, B. & Jeang, K.-T. (1992) Functional roles for the TATA promoter enhancers in basal and Tat-induced expression of the human immunodeficiency virus type 1 long terminal repeat. /. Virol, 66, 139-149. Berridge, M.J. (1987) Inositol triphosphate and diacylglycerol: two interacting second messengers. Annu. Rev. Biochem., 56, 156-194. Bertolotti, A., Lutz, Y., Heard, D.J., Chambon, P. & Tora, L. (1996) hTAFII68, a novel RNA/ssDNA-binding protein with homology to the pro-oncoproteins TLS/FUS and EWS is associated with both TFIID and RNA polymerase II. EMBOJ., 15, 5022-5031. Berube, P., Barbeau, B., Cantin, R., Sekaly, R. & Tremblay, M. (1996) Repression of human immunodeficiency virus type 1 long terminal repeat-driven expression by binding of the virus to its primary cellular receptor, the CD4 molecule. /. Virol, 70, 4009-4016. Bielinska, A., Krasnow, S. & Nabel, G.J. (1989) NF-KB-mediated activation of the human immunodeficiency virus enhancer: site of transcriptional initiation is independent of the TATA box. /. Virol, 63, 4097-4100. Bishop, J.M. (1985) Viral oncogenes. Cell, 42, 23-38. Bishop, J.M. (1995) Cancer: the rise of the genetic paradigm. Genes & Dev., 9, 1309-1315. Blumberg, B.M., Epstein, L.G., Saito, Y., Chen, D., Sharer, L.R. & Anand, R. (1992) Human immunodeficiency virus type 1 nef quasispecies in pathological tissue. /. Virol, 66, 5256-5264. Bohmann, D. (1990) Transcription factor phosphorylation: a link between signal transduction and the regulation of gene expression. Cancer Cells, 2, 337-344. 130 Bolwig, G.M., Bruder, J.T. & Hearing, P. (1992) Different binding site requirements for binding and activation for the enhancer factor EF-1A. Nucleic Acids Res., 20,6555-6564. Bortner, D.M., Ulivi, M., Roussel, M.F. & Ostrowski, M.C. (1991) The carboxy-terminal catalytic domain of the GTPase-activating protein inhibits nuclear signal transduction and morphological transformation mediated by the CSF-1 receptor. Genes & Dev., 5, 1777-1785. Bourne, H.R., Sanders, D.A. & McCormick, F. (1991) The GTPase superfamily: conserved structure and molecular mechanism. Nature, 349, 117-127. Boyle, W.J., Smeal, T., Defize, L.H.K., Angel, P., Woodgett, J.R., Karin, M. & Hunter, T. (1991) Activation of protein kinase C decrease phosphorylation of c-Jun at sites that negatively regulate its DNA-binding activity. Cell, 64, 573-584. Breathnach, R. & Chambon, P. (1981) Organization and expression of eucaryotic split genes coding for proteins. Annu. Rev. Biochem., 50, 349-383. Bruder, J.T., Heidecker, G., Tan, T.-H., Weske, J.C., Derse, D. & Rapp, U.R. (1993) Oncogene activation of HIV-LTR-driven expression via the NF-kB binding sites. Nucleic Acids Res., 21, 5229-5234. Brunner, D., Ducker, K., Oellers, N., Hafen, E., Scholz, H. & Klambt, C. (1994) The ETS domain protein Pointed-P2 is a target of MAP kinase in the Sevenless signal transduction pathway. Nature, 370, 386-389. Buratowski, S. (1994) The basics of basal transcription by RNA polymerase II. Cell, 77, 1-3. Burley, S.K. & Roeder, R.G. (1996) Biochemistry and structural biology of transcription factor LTD (TFIID). Annu. Rev. Biochem., 65. Cannon, P.M., Tenen, D.G., Feinberg, M.B., Shin, H.S. & Kim, S. (1993) Human immunodeficiency virus-1 infection of the human promyelocytic cell line HL-60: high frequency of low-level infection and effect of subsequent cell differentiation. Blood, 81, 437-445. Cantley, L.C., Auger, K.R., Carpenter, C , Duckworth, B., Graziani, A., Kapeller, R. & Soltoff, S. (1991) Oncogenes and signal transduction. Cell, 64, 281-302. Chao, D.M., Gadbois, E.L., Murray, P.J., Anderson, S.F., Sonu, M.S., Parvin, J.D. & Young, R.A. (1996) A mammalian SRB protein associated with an RNA polymerase II holoenzyme. Nature, 380, 82-85. Charles de la Brousse, F., Birkenmeier, E.H., King, D.S., Rowe, L.B. & McKnight, S.L. (1994) Molecular and genetic characterization of GABPp. Genes & Dev., 8, 1853-1865. 131 Chasman, D.I., Flaherty, K.M., Sharp, P.A. & Romberg, R.D. (1993) Crystal structure of yeast TATA-binding protein and model for interaction with DNA. Proc. Natl. Acad. Sci. USA, 90, 8174-8178. Chatterjee, S. & Struhl, K. (1995) Connecting a promoter-bound protein to TBP bypasses the need for a transcriptional activation domain. Nature, 374, 820-822. Chen, R.-H., Sarnecki, C. & Blenis, J. (1992) Nuclear localization and regulation of erk- and rsk-encoded protein kinases. Mol. Cell. Biol, 12, 915-927. Chiang, C.-M., Ge, H., Wang, Z., Hoffman, A. & Roeder, R.G. (1993) Unique TATA-binding protein-containing complexes and cofactors involved in transcription by RNA polymerases II and HI. EMBO }., 12, 2749-2762. Clark, N.M., Hannibal, M.C. & Markovitz, D.M. (1995) The peri-KB site mediates Human Immunodeficiency Virus Type 2 enhancer activation in monocytes but Not in T Cells. /. Virol, 69, 4854-4862. Conaway, R.C. & Conaway, J.W. (1993) General initiation factors for RNA polymerase II. Annu. Rev. Biochem., 62, 161-190. Cook, S.J. & McCormick, F. (1993) Inhibition by cAMP of Ras-dependent activation of Raf. Science, 262, 1069-1072. Cooney, A.J., Tsai, S.Y., O'Malley, B.W. & Tsai, M.-J. (1991) Chicken ovalbumin upstream promoter transcription factor binds to a negative regulatory region in the human immunodeficiency virus type 1 long terminal repeat. /. Virol, 65,2853-2860. Courtneidge, S.A. & Heber, A. (1987) An 81 kd protein complexed with middle T antigen and pp60 c _ s r c: a possible phosphatidylinositol kinase. Cell, 50, 1031-1037. Cullen, B.R. (1993) Does HIV-1 Tat induce a change in viral initiation rights. Cell, 73, 417-420. Dasgupta, P., Saikumar, P., Reddy, CD. & Reddy, E.P. (1990) Myb protein binds to human immonodeficiency virus 1 long terminal repeat (LTR) sequences and transactivates LTR-mediated transcription. Proc. Natl. Acad. Sci. USA, 87, 8090-8094. Deacon, N.J., Tsykin, A., Solomon, A., Smith, K., Ludford-Menting, M., Hooker, D.J., McPhee, D.A., Greenway, A.L., Ellett, A., Chatfield, C , Lawson, V.A., Crowe, S., Maerz, A., Sonza, S., Learmont, J., Sullivan, J.S., Cunningham, A., Dwyer, D., Dowton, D. & Mills, J. (1995) Genomic structure of an attenuated quasi 132 species of HIV-1 from a blood tranfusion donor recipients. Science, 270, 988-991. Dehbi, M., Beaulieu, S., Cohen, E.A. & Bedard, P.-A. (1994) Activation of human immunodeficiency virus 1 gene expression by the src oncoprotein. Oncogene, 9,2399-2403. Dent, P., Haser, W., Haystead, T.A.J., Vincent, L.A., Roberts, T.M. & Sturgill, T.W. (1992) Activation of mitogen-activated protein kinase kinase by v-Raf in NIH 3T3 cells and in vitro. Science, 257, 1404-1407. Desai-Yajnik, V. & Samuels, H.H. (1993) The NF-kB and Spl motifs of the human immunodeficiency virus type 1 long terminal repeat function as novel throid hormone response elements. Mol. Cell. Biol., 13, 5057-5069. Dikstein, R., Zhou, S. & Tjian, R. (1996) Human TAF105 is a cell type-specific TFIID subunit related to hTAF130. Cell, 87, 137-146. Dingwall, C , Ernberg, I., Gait, M.J., Green, S.M., Heaphy, S., Karn, J., Lowe, A.D., Singh, M. & Skinner, M.A. (1990) HIV-1 Tat protein stimulates transcription by binding to a U-rich bulge in the stem of the TAR RNA structure. EMBO J., 9,4145-4153. Downward, J., Graves, J.D., Warne, P.H., Rayter, S. & Cantrell, D.A. (1990) Stimulation of p21ras upon T-cell activation. Nature, 346, 719-723. Dubrovskaya, V., Lavigne, A.-C, Davidson, I., Acker, J., Staub, A. & Tora, L. (1996) Distinct domains of hTAFjilOO are required for functional interaction with transcription factor TFIIFp (RAP30) and incorporation into the TFIID complex. EMBO }., 15, 3702-3712. Duh, E.J., Maury, W.J., Folks, T.M., Fauci, A.S. & Rabson, A.B. (1989) Tumor necrosis factor a activates human immunodeficiency virus type 1 through induction of nuclear factor binding to the NF-KB sites in the long terminal repeat. Proc. Natl. Acad. Sci. USA, 86, 5974-5978. Egan, S.E., Giddings, B.W., Brooks, M.W., Buday, L., Sizeland, A.M. & Weinberg, R.A. (1993) Association of Sos Ras exchange protein with Grb2 is implicated in tyrosine kinase signal transduction and transformation. Nature, 363, 45-51. Egan, S.E. & Weinberg, R.A. (1993) The pathway to signal achievement. Nature, 365, 781-783. Eicher, D.M., Tan, T.-H., Rice, N.R., O'Shea, J.J. & Kennedy, I.C.S. (1994) Expression of v-src in T Cells Correlates with Nuclear Expression of NF-KB. / . Immunol, 152, 2710-2719. 133 Embretson, J., Zupancic, M., Ribas, J.L., Burke, A., Racz, P., Tenner-Racz, K. & Haase, A.T. (1993) Massive covert infection of T lymphocytes and macrophages during the incubation period of AIDS. Nature, 362, 359-362. Estable, M.C, Bell, B., Merzouki, A., Montaner, J.S., O'Shaughnessy, M.V. & Sadowski, I. (1996) Human immunodeficiency virus type 1 long terminal repeat variants from 42 patients representing all stages of infection display a wide range of sequences polymorphism and transcription activity. /. Virol, 70,4053-4062. Estable, M.C, Bell, B., O'Shaughnessy, M.V. & Sadowski, I. (1997) Naturally occurring HIV-1 LTRs have a frequently observed duplication that binds RBF-2 and represses transcription, submitted. Fagagna, F., Marzio, G., Gutierrez, M.I., Kang, L.Y., Falaschi, A. & Giacca, M. (1995) Molecular and functional interactions of transcription factor USF with the long terminal repeat of human immunodeficiency virus type 1. /. Virol, 69, 2765-2775. Feig, L.A. & Cooper, G.M. (1988) Inhibition of NIH 3T3 cell proliferation by a mutant ras protein with preferential affinity for GDP. Mol. Cell Biol, 8, 3235-3243. Finco, T.S. & Baldwin, A.S. (1993) Kappa B site-dependent induction of gene expression by diverse inducers of nuclear factor kappa B requires Raf-1. /. Biol. Chem., 268, 17676-17679. Flory, E., Hoffmeyer, A., Smola, U., Rapp, U.R. & Bruder, J.T. (1996) Raf-1 kinase targets GA-binding protein in transcriptional regulation of the human immunodeficiency virus type 1 promoter. /. Virol, 70, 2260-2268. Folks, T.M., Justement, J., Kinter, A., Dinarello, C A . & Fauci, A.S. (1987) Cytokine-induced expression of HIV-1 in a chronically infected promonocyte cell line. Science, 238, 800-802. Franke, T.F., Yang, s.-L, Chan, T.O., Datta, K., Kazlauskas, A., Morrison, D.K., Kaplan, D.R. & Tsichlis, P.N. (1995) The protein kinase encoded by the akt proto-oncogene is a target of PDGF-activated phosphatidylinositol 3-kinase. Cell, 81 , 727-736. Franza, B.R., Raucher, F.J., Josephs, S.F. & Curran, T. (1988) The fos complex and fos-related antigens recognize sequence elements that contain AP-1 binding sites. Science, 239, 1150-1153. Galang, C.K., Der, C.J. & Hauser, CA. (1994) Oncogenic Ras can induce transcriptional activation through a variety of prompter elements, including tandem c-Ets-2 sites. Oncogene, 9, 2913-2921. 134 Garcia, J.A. & Gaynor, R.B. (1994) Regulatory mechanisms involved in the control of HIV-1 gene expression. AIDS, 8, S3-S17. Garcia, J.A., Harrich, D., Soultanakis, E., Wu, F., Mitsuyasu, R. & Gaynor, R.B. (1989) Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation. EMBO }., 8, 765-778. Garcia, J.A., Ou, S.-H.L, Wu, F., Lusis, A.J., Sparkes, R.S. & Gaynor, R.B. (1992) Cloning and chromosomal mapping a human immunodeficiency virus l'TATA" element modulatroy factor. Proc. Natl. Acad. Sci. USA, 89, 9372-9376. Garcia-Blanco, M.A. & Cullen, B.R. (1991) Molecular basis of latency in pathogenic human viruses. Science, 254, 815-820. Gatignol, A., Duarte, M., Daviet, L., Chang, Y.-N. & Jeang, K.-T. (1996) Sequential steps in Tat trans activation of HIV-1 mediated through cellular DNA, RNA, and protein binding factors. Gene Expr., 5, 217-228. Gaynor, R. (1992) Cellular transcription factors involved in the regulation of HIV-1 gene expression. AIDS, 6, 347-363. Gehring, W.J., Affolter, M. & Burglin, T. (1994) Homeodomain proteins. Annu. Rev. Biochem., 63, 487-526. Genuario, R.R. & Perry, R.P. (1996) The GA-binding protein can serve as both an activator and repressor of ribosomal protein gene transcription. /. Biol. Chem., 271,4388-4395. Giese, K. & Grosschedl, R. (1993) LEF-1 contains an activation domain that stimulates transcription only in a specific context of factor-binding sites. EMBO J., 12,4667-4676. Gill, G. (1994) Taking the initiative. Curr. Biol, 4, 374-376. Gille, H., Sharrocks, A.D. & Shaw, P.E. (1992) Phosphorylation of transcription factor p62 TCF by MAP kinase stimulates ternary complex formation at the c-/os promoter. Nature, 358, 414-417. Giovane, A., Pintzas, A., Maira, S.-M., Sobieszczuk, P. & Wasylyk, B. (1994) Net, a new ets transcription factor that is activated by Ras. Genes & Dev., 8, 1502-1513. Golub, E.I., Li, G. & Volsky, D.J. (1990) Differences in the basal activity of the long terminal repeat determine different replicative capacities of two closely related human immunodeficiency virus type 1 isolates. /. Virol, 64, 3654-3660. 135 Gorman, C.M., Moffat, L.F. & Howard, B. (1982) Recombinant genomes which express chloramphenicol acetyl transferase in mammalian cells. Mol. Cell. Biol, 2, 1044-1051. Greene, W.C. (1990) Regulation of HIV-1 gene expression. Annu. Rev. Immunol, 8, 453-475. Griffin, G.E., Leung, K., Folks, T.M., Kunkel, S. & Nabel, G.J. (1989) Activation of HIV gene expression during monocyte differentiation by induction of NF-KB. Nature, 339, 70-73. Grosschedl, R. & Baltimore, D. (1985) Cell-Type Specificity of Immunoglobulin Gene Expression is Regulated by at least three DNA sequence elements. Cell, 41, 885-897. Gruters, R.A., Otto, S.A., Al, B.J., Verhoeven, A.J., Verweij, C.L., Lier, R.A.W.V. & Miedema, F. (1991) Non-mitogenic T cell activation signals are sufficient for induction of human immunideficiency virus transcription. Eur. J. Immunol., 21,167-172. Gugneja, S., Virbasius, J.V. & Scarpulla, R.C. (1995) Four structurally distinct, non-DNA-binding subunits of human nuclear respiratoryy factor 2 share a conserved transcriptional activation domain. Mol. Cell. Biol, 15, 102-111. Hanna-Rose, W. & Hansen, U. (1996) Active repression mechanisms of eukaryotic transcription repressors. Trends Genet., 12, 229-234. Hannibal, M.C, Markovitz, D.M., Clark, N. & Nabel, G.J. (1993) Differential activation of human immunodeficiency virus type 1 and 2 transcription by specific T-cell activation signals. /. Virol, 67, 5035-5040. Harrich, D., Garcia, J., Wu, F., Mitsuyasu, R., Gonzalez, J. & Gaynor, R. (1989) Role of SPl-binding domains in in vivo transcriptional regulation of the human immunodeficiency virus type 1 long terminal repeat. /. Virol, 63, 2585-2591. Hart, C.E., Ou, C.-Y., Galphin, J.C, Moore, J., Bacheler, L.T., Wasmuth, J.J., Petteway, S.R. & Schochetman, G. (1989) Human chromosome 12 is required for elevated HIV-1 expression in human-hamster hybrid cells. Science, 246, 488-491. Henderson, A.J., Zou, X. & Calame, K.L. (1995) C/EBP proteins activate transcription the human immunodeficiency virus type 1 long terminal repeat in macrophages/monocytes. /. Virol, 69, 5337-5344. Hernandez, N. (1993) TBP, a universal eukaryotic transcription factor? Genes & Dev., 7, 1291-1308. 136 Hill, C.S. & Treisman, R. (1995) Transcriptional regulation by extracellular signals: mechanisms and specificity. Cell, 80, 199-211. Hill, C.S., Wynne, J. & Treisman, R. (1995) The Rho family GTPases RhoA, Racl, and CDC42Hs regulate transcriptional activation by SRF. Cell, 81, 1159-1170. Ho, D.D., Neumann, A.U., Perelson, A.S., Chen, W., Leonard, J.M. & Markowitz, M. (1995) Rapid turnover of plasma virions and CD4 lymphocytes in HIV-1 infection. Nature, 373, 123-126. Ho, D.T., Sauve, D.M. & Roberge, M. (1994) Detection and isolation of DNA-binding proteins using single-pulse ultraviolet laser crosslinking. Anal. Biochem., 218,248-254. Hodge, D.R., Robinson, L., Watson, D., Lautenberger, J., Zhang, X.K., Venanzoni, M. & Seth, A. (1996) Interaction of ETS-1 and ERGB/FLI-1 proteins with DNA is modulated by spacing between multiple binding sites as well as phosporylation. Oncogene, 12, 11-18. Hohashi, N., Hayashi, T., Fusaki, N., Takeuchi, M., Higurashi, M., Okamoto, T., Semba, K. & Yamamoto, T. (1995) The protein tyrosine kinase Fyn activates transcription from the HIV promoter via activation of NF-KB-like DNA-binding proteins. Int. Immunol, 7, 1851-1859. Holxmeister, J., Ludewig, B., Pauli, G. & Simon, D. (1993) Sequence specific binding of the transcription factor c-etsl to the human immunodeficiency virus type 1 long terminal repeat. Biochem. Biophys. Res. Comm., 197, 1229-1233. Hoover, T., Mikovits, J., Court, D., Liu, Y.-l., Kung, H.-f. & Raziuddin. (1996) A nuclear matrix-specific factor that binds a specific segment of the negative regulatory element (NRE) of HIV-1 LTR inhibits NF-KB activity. Nucl. Acids Res., 24, 1895-1900. Huff, S.Y., quilliam, L.A., Cox, A.D. & Der, C.J. (1997) R-Ras is regulated by activators and effectors distinct from those that control Ras function. Oncogene, 14, 133-143. Hunter, T. (1997) Oncoprotein networks. Cell, 88, 333-346. Hunter, T. & Karin, M. (1992) The Regulation of trancription by Phosphorylation. Cell, 70, 375-387. Ilyinskii, P.O., Daniel, M.D., Simon, M.A., Lackner, A.A. & Desrosiers, R.C. (1994) The role of upstream U3 sequences in the pathogenesis of simian immunodeficiency virus-induced AIDS in rhesus monkeys. /. Virol, 68, 5933-5944. 137 Ilyinskii, P.O. & Desrosiers, R.C. (1996) Efficient transcription and replication of simian immunodeficiency virus in the absence of SP1 and NF-KB binding elements. /. Virol, 70, 3118-3126. Ilyinskii, P.O., Simon, M.A., Czajak, S.C., Lackner, A.A. & Desrosiers, R.C. (1997) Induction of AIDS by simian immunodeficiency virus lacking NF-KB and SP1 binding elements. /. Virol, 71, 1880-1887. Imataka, H., Mizuno, A., Fuji-Kuriyama, Y. & Hayami, M. (1993) Activation of the human immunodeficiency virus type 1 long terminal repeat by BTEB, a GC box-binding transcription factor. AIDS Res. Human Retroviruses, 9, 825-831. Inostroza, J.A., Mermelstein, F.H., Ha, I., Lane, W.S. & Reinberg, D. (1992) Drl, a TATA-binding protein-associated phosphoprotein and inhibitor of class II gene transciption. Cell, 70, 477-489. Jackson, S.P. (1992) Regulating transcription factor activity by phosphorylation. Trends in Cell Biol, 2, 104-108. Janknecht, R. (1996) Analysis of the ERK-stimulated ETS transcription factor ER81. Mol Cell Biol, 16, 1550-1556. Janknecht, R. & Nordheim, A. (1993) Gene regulation by Ets proteins. Biochim. Biophys. Acta, 1155, 346-356. John, S., Reeves, R.B., Lin, J.-X., Child, R., Leiden, J.M., Thompson, C.B. & Leonard, W.J. (1995) Regulation of cell-type-specific Interleukin-2 receptor a-chain gene expression: potential role of physical interactions between Elf-1, HMG-I(Y), and NF-KB family proteins. Mol. Cell. Biol, 15, 1786-1796. Jones, K.A. (1993) Tat and the HIV-1 promoter. Curr. Opin. Cell Biol, 5, 461-468. Jones, K.A., Kadonaga, J.T., Luciw, P.A. & Tjian, R. (1986) Activation of the AIDS retrovirus promoter by the cellular transcription factor, SP1. Science, 232, 755-759. Jones, K.A., Luciw, P.A. & Duchange, N. (1988) Structural arrangements of transcription control domains within the 5'-untranslated leader regions of the HIV-1 and HIV-2 promoters. Genes & Dev., 2, 1104-1114. Jones, K.A. & Peterlin, B.M. (1994) Control of RNA Initiation and Elongation at the HIV-1 Promoter. Annu. Rev. Biochem., 63, 717-43. Kamine, J. & Chinnadurai, G. (1992) Synergistic activation of the human immunodeficiency virus type 1 promoter by the viral Tat protein and cellular transcription factor SP1. /. Virol, 66, 3932-3936. 138 Kamine, J., Subramanian, T. & Chinnadurai, G. (1993) Activation of a heterologous promoter by human immunodeficiency virus type 1 Tat requires Spl and is distinct from the mode of activation by acidic transcriptional activators. /. Virol, 67, 6828-6834. Kamine, J., Subramanian, T. & Chinnaduri, G. (1991) SPl-dependent activation of a synthetic promoter by human immunodeficiency virus type 1 Tat protein. Proc. Natl. Acad. Sci. USA, 88, 8510-8514. Kaplan, D.R., Whitman, M., Schaffhausen, B., Pallas, D.C., White, M., Cantley, L. & Roberts, T.M. (1987) Common elements in growth factor stimulation and oncogenic transformation: 85 kd phosphoprotein and phosphatidylinositol kinase activity. Cell, 50, 1021-1029. Karin, M. (1991) Signal transduction and gene control. Curr. Opin. in Cell Biol, 3, 467-473. Kashanchi, F., Piras, G., Radonovich, M.F., Duvall, J.F., Fattaey, A., Chiang, C.-M., Roeder, R.G. & Brady, J.N. (1994a) Direct interaction of human TFIID with the HIV-1 transactivator Tat. Nature, 367, 295-299. Kashanchi, F., Shibata, R., Ross, E.K., Brady, J.N. & Martin, M.A. (1994b) Second-site long terminal repeat (LTR) revertants of replication-defective human immunodeficiency virus: effects of revertant TATA box motif on ifectivity, LTR-directed expression, in vitro RNA synthesis, and binding of basal transcription factors TFIID and TFIIA. /. Virol, 68, 3298-3307. Kato, H., Horikoshi, M. & Roeder, R.G. (1991) Repression of HIV-1 Transcription by a Cellular Protein. Science, 251, 1476-1470. Keller, A., Garrett, E.D. & Cullen, B. (1992) The Bel-1 protein of human foamy virus activates human immunodeficiency virus type 1 gene expression via a novel DNA target site. /. Virol, 66, 3946-9. Kharroubi, A.E. & Martin, M.A. (1996) cis-acting sequences located downstream of the human immunodeficiency virus type 1 promoter affect its chromatin structure and transcriptional activity. Mol. Cell. Biol, 16, 2958-2966. Kim, J.L., Nikolov, D.B. & Burley, S.K. (1993a) Co-crystal structure of TBP recognizing the minor groove of a TATA element. Nature, 365, 520-527. Kim, J.Y.H., Gonzales-Scarano, F., Zeicher, S.L. & Alwine, J.C. (1993b) Replication of type 1 Human Immunodeficiency Viruses containing linker substitution mutations in the -201 to -130 region of the long terminal repeat. /. Virol, 67, 1658-1662. Kim, Y., Geiger, J.H., Hahn, S. & Sigler, P.B. (1993c) Crystal structure of a yeast TBP/TATA-box complex. Nature, 365, 512-520. 139 Kingsman, S.M. & Kingsman, A.J. (1996) The Regulation of human immunodeficiency virus type-1 gene expression. Eur. J. Biochem., 240, 491-507. Kinoshita, S., Su, L., Amano, M., Timmerman, L.A. & Nolan, G.P. (1997) The T cell activation factor NFATc positively regulates HIV-1 replication and gene expression in T cells. Immunity, 6, 235-244. Kingston, R.E., Bunker, C A . & Imbalzano, A.N. (1996) Repression and activation by multiprotein complexes that alter chromatin structure. Genes & Dev.. 10, 905-920. Kinter, A.L., Poli, G., Maury, W., Folks, T.M. & Fauci, A.S. (1990) Direct and cytokine-mediated actvation of Protein Kinase C induces Human Immunodeficiency Virus expression in chronically infected promonocytic cells. /. Virol, 64, 4306-4312. Kitano, K., Baldwin, G.C, Raines, M.A. & Golde, D.W. (1990) Differentiating agents facilitate infection of myeloid leukemia cell lines by monocytotropic HIV-1 strains. Blood, 76, 1980-1988. Klages, N. & Stubin, M. (1995) Stimulation of RNA polymerase II transcription by recruitment of TBP in vivo. Nature, 374, 822-823. Klein, C. & Struhl, K. (1994) Increased recruitment of TATA-binding protein to the promoter by transcriptional activation domains in vivo. Science, 266, 280-282. Koken, SC., Wamel, J.L.B.v., Goudsmit, J., Berkhout, B. & Geelen, J.L.M.C. (1992) Natural variant of the HIV-1 long terminal repeat: analysis of promoters with duplicated DNA regulatory motifs. Virology, 191, 968-972. Koken, S.E.C, van Wamel, J.L.B., Geelen, J.L.M.C. & Berkout, B. (1994) Functional analysis of the ACTGCTGA sequence motif in the human immunodeficiency virus type-1 long terminal repeat promoter. /. Biomed. Sci., 1, 83-92. Koleske, A.J. & Young, R.A. (1995) The RNA polymerase II holoenzyme and its implications for gene regulation. Trends Biochem. Sci., 20, 113-115. Koyanagi, Y., O'Brien, W.A., Zhao, J.Q., Golde, D.W. & Gasson, J.C. (1988) Cytokines Alter production of HIV-1 from primary mononuclear phagocytes. Science, 241,1673-1675. Kwon, H., Imbalzano, A.N., Khavarl, P.A., Kingston, R.E., Green, M.R. (1994) Nucleosome disruption and enhancement of activator binding by a human Swl/SNF complex. Nature, 370, 477-481. 140 Kyriakis, J.M., App, H., Zhang, X.-F., Banerjee, P., Brautigan, D.L., Rapp, U.R. & Avruch, J. (1992) Raf-1 activates MAP kinase-kinase. Nature, 358, 417-421. Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 277, 680-685. LaMarco, K., Thompson, C C , Byers, B.P., Walton, E.M. & McKnight, S.L. (1991) Identification of Ets- and Notch-related subunits in GA binding protein. Science, 253, 789-792. LaMarco, K.L. & McKnight, S.L. (1989) Purification of a set of cellular polypeptides that bind to the purine-rich cis-regulatory element of herpes simplex immediate early genes. Genes & Dev., 3, 1372-1383. Laughlin, M.A. & Pomerantz, R.J. (1994) Cellular latency in HIV-1 infection. Clinics in Lab. Med., 14, 239-255. Lee, A.H., Lee, K.J., Kim, S. & Sung, Y.C (1992) Transactivation of human immunodeficiency virus type 1 long terminal repeat-directed gene expression by the human foamy virus bell protein requires a specific DNA sequence. /. Virol, 66, 3236-3240. Leevers, S.J., Paterson, H.F. & Marshall, C.J. (1994) Requirement for Ras in Raf activation is overcome by targeting Raf to the plasma membrane. Nature, 369, 411-414. Lehming, N., Thanos, D., Brickman, J.M., Ma, J., Maniatis, T. & Ptashne, M. (1994) An HMG-like protein that can switch a transcriptional activator to a repressor. Nature, 371, 175-179. Leiden, J.M., Wang, C.-Y., Petryniak, B., Markovitz, D.M., Nabel, G.J. & Thompson, C.B. (1992) A novel Ets-related factor, Elf-1, binds to Human Immunodeficiency Virus Type 2 regulatory elements that are required for inducible frans-activation in T cells. /. Virol, 66, 5890-5897. Leonard, J., Parrot, C , Buckler-White, A.J., Turner, W., Ross, E.K., Martin, M.A. & Rabson, A.B. (1989) The Nf-kB binding sites in the human immunodeficiency virus type 1 long terminal repeat are not required for virus infectivity. /. Virol, 63, 4919-4924. Leys, R.d., Vanderborght, B., Haesevelde, M.V., Heyndrickx, L., Geel, A.V., Wauters, C , Bernaerts, R., Saman, E., Nijs, P., Willems, B., Taelman, H., Groen, G.v.d., Piot, P., Tersmette, T., Huisman, J.G. & Heuverswyn, H.V. (1990) Isolation and partial characterization of an unusual human immunodeficiency retrovirus from two persons of West-Central African origin. /. Virol, 64, 1207-1216. Li, C , Lai, C.F., Sigman, D.S. & Gaynor, R.B. (1991a) Cloning of a cellular factor, interleukin binding factor, that binds to NFAT-like motifs in the human 141 immunodeficiency virus long terminal repeat. Proc Natl Acad Sci USA, 88, 7739-43. Li, J.J. & Herkowitz, I. (1994) Isolation of ORC6, a component of the yeast origin recognition complex by a one-hybrid system. Science, 262, 1870-1874. Li, N., Batzer, A., Daly, R., Yajnik, V., Skolnik, E., Chardin, P., Bar-Sagi, D., Margolis, B. & Schlessinger, J. (1993) Guanine-nucleotide-releasing factor hSOSl binds to Grb2 and links receptor tyrosine kinases to Ras signalling. Nature, 363, 85-87. Li, S. & Sedivy, J.M. (1993) Raf-1 protein kinase activates the NF-KB transcription factor by dissociating the cytoplasmic NF-KB-1 KB complex. Proc. Natl. Acad. USA, 90, 9247-9251. Li, Y., Ross, J., Scheppler, J.A. & Franza, B.R. (1991b) An in vitro transcription analysis of early responses of the Human Immunodeficiency Virus Type 1 Long Terminal Repeat to different transcriptional activators. Mol. Cell. Biol, 11,1883-1893. Lint, C.V., Emiliani, S., Ott, M. & Verdin, E. (1996) Transcriptional activation and chromatin remodeling of the HIV-1 promoter in response to histone acetylation. EMBO J., 15,1112-1120. Lopez, M., Oettgen, P., Akbarali, Y., Dendorfer, U. & Libermann, T.A. (1994) ERP, a new member of the ets transcription factor/oncoprotein family: cloning, characterization, and differential expression during B-lymphocyte developement. Mol. Cell. Biol, 14, 3292-3309. Love, J.J., Li, X., Case, D.A., Giese, K., Grosschedl, R. & Wright, P.E. (1995) Structural basis for DNA bending by the architectural transcription factor LEF-1. Nature, 376, 791-795. Lowney, P., Corral, J., Detmer, K., LeBeau, M.M., Deaven, L., Lawrence, H.J. & Largman, C. (1991) A human Hox 1 homeobox gene exhibits myeloid-specific expression of alternative transcripts in human hematopoietic cells. Nucl. Acids Res., 19, 3443-3449. Lu, X., Welsh, T.M. & Peterlin, B.M. (1993) The human immunodeficiency virus type 1 long terminal repeat specific two different transcription complex, only one of which is regulated by Tat. /. Virol, 67, 1752-1760. Macgregor, P.F., Abate, C. & Curran, T. (1990) Direct cloning of leucine zipper proteins: Jun binds cooperatively to the CRE with CRE-BP1. Oncogene, 5, 451-458. Macleod, K., Leprince, D. & Stehelin, D. (1992) The ets gene family. TIBS, 17, 251-257. 142 Maekawa, T., Sudo, T., Kurimoto, M. & Ishii, S. (1991) USF-related transcription factor, HIV-TF1, stimulates transcription of human immunodeficiency virus-1. Nucleic Acids Res., 19, 4689-4694. Majello, B., Luca, P.D., Hagen, G., Suske, G. & Lania, L. (1994) Different members of the Spl multigene family exert opposite transcriptional regulation of the long terminal repeat of HIV-1. Nucleic Acids Res., 22, 4914-4921. Maldonado, E., Shiekhattar, R., Sheldon, M., Cho, H., Drapkin, R., Rickert, P., Lees, E., Anderson, C.W., Linn, S. & Reinberg, D. (1996) A human RNA polymerase complex associated with SRB and DNA-repair proteins. Nature, 381, 86-89. Malim, M.H., Hauber, J., Fenrick, R. & Cullen, B. (1988) Immunodefiency virus rev trans-activator modulates the expression of the viral regulatory genes. Nature, 335, 181-183. Margolis, D.M., Somasundaran, M. & Green, M.R. (1994) Human transcription factor YY1 represses Human Immunodeficiency Virus Type 1 transcription and virion production. /. Virol, 68, 905-910. Markovitz, D.M., Hannibal, M., Perez, V.L., Gauntt, C., Folks, T.M. & Nabel, G.J. (1990) Differential regulation of human immunodeficiency viruses (HIVs): A specific regulatory element in HIV-2 responds to stimulation of the T-cell antigen receptor. Proc. Natl. Acad. Sci. USA, 87, 9098-9102. Markovitz, D.M., Hannibal, M.C., Smith, M.J., Cossman, R. & Nabel, G.J. (1992a) Activation of the human immunodeficiency virus type 1 enhancer is not dependent on NFAT-1. /. Virol, 66, 3961-3965. Markovitz, D.M., Smith, M.J., Hilfinger, J., Hannibal, M.C., Petryniak, B. & Nabel, G.J. (1992b) Activation of the human immunodeficiency virus type 2 enhancer is dependent on purine box and kB regulatory elements. /. Virol, 66,5479-5484. Martinez, E., Zhou, Q., L'Etoile, N.D., Oelgeschlager, T. & Berk, A.J. (1995) Core promoter-specific function of a mutant transcription factor TFIID defective in TATA-box binding. Proc. Natl. Acad. Sci. USA, 92, 11864-11868. McCormick, F. (1989) ras GTPase activating protein: signal transmitter and signal terminator. Cell, 56, 5-8. McCune, J.M. (1995) Viral latency in HIV disease. Cell, 82, 183-188. McGlade, J., Cheng, A., Pelicci, G., Pelicci, P.G. & Pawson, T. (1992) She proteins are phosphorylated and regulated by the v-Src and v-Fps protein-tyrosine kinases. Proc. Natl. Acad. Sci. USA, 89, 8869-8873. 143 McKnight, S.L. (1996) Transcription revisited: a commentary on the 1995 Cold Spring Harbor Laboratory meeting, "Mechanisms of Eukaryotic Transcription". Genes & Dev., 10, 367-381. McNearney, T., Hornickova, Z., Templeton, A., Birdwell, A., Arens, M., Markham, R., Saah, A. & Ratner, L. (1995) Nef and LTR sequence variation from sequentially derived human immunodeficiency virus type 1 isolates. Virology, 208, 388-398. Michael, N.L., D'arcy, L., Ehrenberg, P.K. & Redfield, R. (1994) Naturally occuring genotypes of the Human Immunodeficiency Virus Type 1 Long Terminal Repeat display a wide range of basal and Tat-induced transcriptional activities. /. Virol, 68, 3163-3174. Michael, N.L., Vahey, M., Burke, D.S. & Redfield, R.R. (1992) Viral DNA and mRNA expression correlate with the stage of human immunodeficiency type 1 infection in humans: evidence for viral replication in all stages of HIV disease. /. Virol, 66, 310-316. Mitchell, P.J. & Tjian, R. (1989) Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins. Science, 245, 371-378. Montano, M.A., Kripke, K., Norina, CD., Achacoso, P., Herzenberg, L.A., Roy, A.L. & Polan, G.P. (1996) NF-KB homodimer binding within the HIV-1 initiator region and interactions with TFII-I. Proc. Natl. Acad. Sci. USA, 93, 12376-12381. Moodie, S.A., Willumsen, B.M., Weber, M.J. & wolfman, A. (1993) Complexes of Ras-GTP with Raf-1 and mitogen-activated protein kinase kinase. Science, 260,1658-1661. Moses, A.V., Ibanez, C , Gaynor, R., Ghazal, P. & Nelson, J.A. (1994) Differential role of long terminal repeat control elements for the regulation of basal and Tat-mediated transcription of the human immunodeficiency virus in stumulated and unstimulated primary human macrophages. /. Virol, 68, 298-307. Muchardt, C. & Yaniv, M. (1993) A human homologue of Saccharomyces cerevisiae SNF2/SW12 and Drosophila brm genes potentiates transcriptional activation by the glucocorticoid receptor. EMBO }., 12, 4279-4290. Myers, G., Korber, B., Wain-Hobson, S., Smith, R.F. & Pavlakis, G.N. (1993) Human retroviruses and AIDS 1993. Los Alamos National Laboratory, Los Alamos, N. Mex. Nabel, G. & Baltimore, D. (1987) An inducible transcription factor activates expression of human immunodeficiency virus in T cells. Nature, 326, 711-713. 144 Nabel, G. & Baltimore, D. (1990) An inducible transcription factor activates expression of human immunodeficiency virus in T cells. Nature, 344, 178. Nabel, G.J. (1993) The role of cellular transcription factors in the regulation of human immunodeficiency virus gene expression. mHuman retroviruses, Bryan Cullen, Ed., 49-73, Oxford University Press, Oxford. Nakanishi, Y., Masamune, Y. & Kobayashi, N. (1991) A novel cis-acting element that controls transcription of human immunodeficiency virus type 1 DNA, depending on cell type. /. Virol, 65, 6334-6338. Natesan, S. & Gilman, M.Z. (1993) DNA bending and orientation-dependent function of YY1 in the c-fos promoter. Genes & Dev., 7, 2497-2509. Newstein, M., Stanbridge, E.J., Casey, G. & Shank, P.R. (1990) Human chromosome 12 encodes a species-specific factor which increases human immunodeficiency virus type 1 taf-mediated trans activation in rodent cells. /. Virol, 64, 4565-4567. Nikolov, D.B., Chen, H., Halay, E.D., Hoffman, A., Roeder, R.G. & Burley, S.K. (1996) Crystal structure of a human TATA box-binding protein TATA element complex. Proc. Natl Acad. Sci. USA, 93, 4862-4867. O'Hagan, R.C, Tozer, R.G., Symons, M., McCormick, F. & Hassell, J.A. (1996) The activity of the Ets transcription factor PEA3 is regulated by two distinct MAPK cascades. Oncogene, 13, 1323-1333. O'Neill, E.M., Rebay, I., Tjian, R. & Rubin, G.M. (1994) The activities of two Ets-Related transcription factors required for Drosophila eye development are modulated by the Ras/MAPK pathway. Cell, 78, 137-147. Olsen, H.S. & Rosen, C A . (1992) Contribution of the TATA motif to Tat-mediated transcriptional activation of human immunodeficiency virus gene expression. /. Virol, 66, 5594-5597. Ossipow, V., Tassan, J.-P., Nigg, E.A. & Schibler, U. (1995) A mammalian RNA polymerase II holoenzyme containing all components required for promoter-specific transcription initiation. Cell, 83, 137-146. Ou, S.-H.L, Garcia-Martinez, L.F., Paulssen, E.J. & Gaynor, R. (1994) Role of Flanking E Box Motifs in Human Immunodeficiency Virus Type 1 TATA Element Function. /. Virol, 68, 7188-7199. Ou, S.-H.L, Wu, F., Harrich, D., Garcia-Martinez, L.F. & Gaynor, R.B. (1995) Cloning and characterization of a novel cellular protein, TDP-43, that binds to human immunodeficiency virus type 1 TAR DNA sequence motifs. /. Virol, 69, 3584-3596. 145 Ouyang, L., Jacob, K.K. & Stanley, F.M. (1996) GABP mediates insulin-increased prolactin gene transcription. /. Biol. Chem., 271, 10425-10428. Pabo, C.O. & Sauer, R.T. (1992) Transcription factors: structural families and principles of DNA recognition. Annu. Rev. Biochem., 61, 1053-1095. Pantaleo, G., Graziosi, C., Demarest, J.F., Butini, L., Montroni, M., Fox, C.H., Orenstein, J.M., Kotler, D.P. & Fauci, A.S. (1993) HIV infection is active and progressive in lymphoid tissue during the clinically latent stage of disease. Nature, 362, 355-358. Parada, C.A., Yoon, J.-B. & Roeder, R.G. (1995) A novel LBP-l-mediated restriction of HIV-1 transcription at the level of elongation in vitro. J. Biol. Chem., 270, 2274-2283. Paranjape, S.M., Kamakaka, R.T. & Kadonaga, J.T. (1994) Role chromatin structure in the regulation of transcription by RNA polymerase. Annu. Rev. Biochem., 63, 265-297. Parrott, C., Seidner, T., Duh, E., Leonard, J., Theodore, T.S., Buckler, W.A., Martin, M.A. & Rabson, A.B. (1991) Variable role of the long terminal repeat Spl-binding sites in human immunodeficiency virus replication in T lymphocytes. /. Virol, 65, 1414-1419. Parvin, J.D., Timmers, H.T.M. & Sharp, P.A. (1992) Promoter specificity of basal transcription factors. Cell, 68, 1135-1144. Patterson, B.K., Till, M., Otto, P., Goolsby, C., Furtado, M.R., McBride, L.J. & Wolinsky, S.M. (1993) Detection of HIV-1 DNA and messenger RNA in individual cells by PCR-driven in situ hybridization and flow cytometry. Science, 260, 976-979. Pazin, M.J. & Kadonaga, J.T. (1997) SWI2/SNF2 and related proteins: ATP-driven motors that disrupt protein-DNA interactions. Cell, 88, 737-740. Pazin, M.J., Sheridan, P.L., Cannon, K., Cao, Z., Keck, J.G., Kadonaga, J.T. & Jones, K.A. (1995) NF-kB-mediated chromatin reconfiguration and transcriptional activation of the HIV-1 enhancer in vitro. Genes & Dev., 10, 37-49. Pendergrast, P.S., Morrison, D., Tansey, W.P. & Hernandez, N. (1996) Mutations in the carboxy-terminal domain of TBP affect the sythesis of human immunodefiency virus type 1 full-length and short transcripts similarly. /. Virol, 70, 5025-5034. Perelson, A.S., Neumann, A.U., Markowitz, M., Leonard, J.M. & Ho, D.D. (1996) HIV-1 dynamics in vivo: virion clearance rate, infected cell life-span, and viral generation time. Science, 271, 1582-1586. 146 Perkins, N.D., Agranoff, A.B., Duckett, C.S. & Nabel, G.J. (1994) Transcription factor Ap-2 regulates human immunodeficiency virus type 1 gene expression. /. Virol, 68, 6820-6823. Perona, R., Montaner, S., Saniger, L., Sanchez-Perez, I., Bravo, R. & Lacal, J.C. (1997) Activation of the nuclear factor-KB by Rho, CDC42, and Rac-1 proteins. Genes & Dev., 11, 463-475. Peterlin, B.M., Adams, M., Alonso, A., Baur, A., Ghosh, S., Lu, X. & Luo, Y. (1993) Tat frans-activator. inHuman retroviruses, Bryan Cullen, Ed., 75-100, Oxford University Press, Oxford. Price, M.A., Rogers, A.E. & Treisman, R. (1995) Comparative analysis of the ternary complex factors Elk-1, SAP-la and SAP-2. EMBO /., 14, 2589-2601. Quilliam, L.A., Kato, K., Rabun, K.M., Hisaka, M.M., Huff, S.Y., Campbell-Burk, S. & Der, C.J. (1994) Identification of residues critical for Ras(17N) growth-inhibitory phenotype and for Ras interaction with guanine nucleotide exchange factors. Mol Cell Biol, 14, 1113-1121. Rabault, B., Roussel, M.F., Quang, C.T. & Ghysdael, J. (1996) Phosphorylation of etsl regulates the complementation of a CSF-1 receptor impaired in mitogenesis. Oncogene, 13, 877-881. Ross, E.K., Buckler-White, A.J., Rabson, A.B., Englund, G. & Martin, M.A. (1991) Contribution of NF-KB and Spl binding motifs to the replicative capacity of human immunodeficiency virus type 1: distinct patterns of viral growth are determined by T cell types. /. Virol, 65, 4350-4358. Rossomando, A., Wu, J., Weber, M.J. & Sturgill, T.W. (1992) The phorbol ester-dependent activator of the mitogen-activated protein kinase p42mapk is a kinase with specificity for the threonine and tyrosine regulatory sites. Proc. Natl. Acad. Sci. USA, 89, 5221-5225. Roulston, A., Lin, R., Beauparlant, P., Wainberg, M.A. & Hiscott, J. (1995) Regulation of human immunodeficiency virus type 1 and cytokine gene expression in myeloid cells by NF-KB/Rel transcription factors. Microbiological Reviews, 59, 481-505. Roy, A.L., Meisterernst, M., Pognonec, P. & Roeder, R.G. (1991) Cooperative interaction of an initiator-binding transcription initiation factor and the helix-loop-helix activator USF. Nature, 354, 245-248. Roy, S., Delling, U., Chen, C.-H., Rosen, C. & Sonenberg, N. (1990) A bulge structure in HIV-1 TAR RNA is required for Tat binding and Tat-mediated trans-activation. Genes & Dev., 4, 1365-1373. 147 Rozakis-Adcock, M., McGlade, J., Mbamalu, G., Pelicci, G., Daly, R., Li, W., Batzer, A., Thomas, S., Brugge, J., Pelicci, P.G., Schlessinger, J. & Pawson, T. (1992) Association of the She and Grb2/Sem5 SH2-containing proteins is implicated in activation of the Ras pathway by tyrosine kinases. Nature, 360, 689-692. Sadowski, I., Stone, J.C. & Pawson, T. (1986) A noncatalytic domain conserved among cytoplasmic protein-tyrosine kinases modifies the kinase function and transforming activity of fujinami sarcoma virus. Mol Cell. Biol., 6, 4396-4408. Saksela, K., Muchmore, E., Girard, M., Fultz, P. & Baltimore, D. (1993) High viral load in lymph nodes and latent human immunodeficiency virus (HIV) in peripheral blood cells of HIV-l-infected chimpanzees. /. Virol, 67, 7423-7427. Saksela, K., Stevens, C , Rubinstein, P. & Baltimore, D. (1994) Human immunodeficiency virus type 1 mRNA expression in peripheral blood cells predicts disease progression independly of the numbers of CD4+ lymphocytes. Proc. Natl. Acad. Sci. USA, 91, 1104-1108. Satoh, T., Minami, Y., Kono, T., Yamada, K., Kawahara, A., Taniguchi, T. & Kaziro, Y. (1992) Interleukin 2-induced activation of Ras requires two domains of the interleukin 2 receptor beta subunit, the essential region for growth stimulation and Lck-binding domain. /. Biol. Chem., 267, 25423-25427. Satoh, T., Nakafuka, M., Miyajima, A. & Kaziro, Y. (1991) Involvement of ras p21 protein in signal-transduction pathways from interleukin 2, interleukin 3, and granulocyte/macrophage colony-stimulating factor, but not from interleukin 4. Proc. Natl Acad. Sc. USA, 88, 3314-3318. Schweighoffer, F., Cai, H., Chevalier-Multon, M.C, Fath, I., Cooper, G. & Tocque, B. (1993) The Saccharomyces cerevisiae SDC25 C-domain gene product overcomes the dominant inhibitory activity of Ha-Ras Asn-17. Mol. Cell. Biol, 13, 39-43. Seeler, J.-S., Muchardt, C , Suessle, A. & Gaynor, R.B. (1994) Transcription factor PRDII-BF1 activates human immunodeficiency virus type 1 gene expression. /. Virol, 68, 1002-1009. Seth, A., Hodge, D.R., Thompson, D.M., Robinson, L., Panayiotakis, A., Watson, D.K. & Papas, T. (1993) ETS family proteins activate transcription from HIV-1 Long Terminal Repeat. AIDS Res. Hum. Retroviruses, 9, 1017-1023. Shaw, J.-P., Utz, P.J., Durand, D.B., Toole, J.J., Emmel, E.A. & Crabtree, G.R. (1988) Identification of a putative regulator of early T cell activation genes. Science, 241, 202-205. Sheridan, P.L., Schorpp, M., Voz, M.L. & Jones, K.A. (1995a) Cloning of an SNF2/SW12-related protein that binds specifically to the SPH motifs of the SV40 enhancer and to the HIV-1 promoter. /. Biol. Chem., 270, 4575-4587. 148 Sheridan, P.L., Sheline, C.T., Cannon, K., Voz, M.L., Pazin, M.J., Kadonaga, J.T. & Jones, K.A. (1995b) Activation of the HIV-1 enhancer by the LEF-1 HMG protein on nucleosome-assembled DNA in vitro. Genes & Dev., 9, 2090-2104. Smith, M.R., DeGudicibus, S.J. & Stacey, D.W. (1986) Requirement for c-ras proteins during viral oncogene transformation. Nature, 320, 540-543. Southgate, CD. & Green, M.R. (1991) The HIV-1 Tat protein activates transcription from an upstream DNA-binding site: implications for Tat function. Genes & Dev., 5, 2496-2507. Stargell, L.A. & Struhl, K. (1996) Mechanisms of transcriptional activation in vivo: two steps forward. Trends Genet., 12, 311-315. Starr, D.B., Matsui, W., Thomas, J.R. & Yamamato, K.R. (1996) Intracellular receptors use a common mechanism to interpret signaling information at response elements. Genes & Dev., 10, 1271-1283. Stokoe, D., Macdonald, S.G., Cadwallader, K., Symons, M. & Hancock, J.F. (1994) Activation of Raf as a result of recruitment to the plasma membrane. Science, 264,1463-1467. Struhl, K. (1996) Chromatin structure and RNA polymerase II connection: implications for transcription. Cell, 84, 179-182. Sturgill, T.W., Ray, L.B., Erickson, E. & Mailer, J.L. (1988) Insulin-stimulated MAP-2 kinase phosphorylates and activates ribosomal protein S6 kinase. Nature, 334, 715-718. Sune, C. & Garcia-Blanca, M.A. (1995) Spl transcription factor is required for in vitro basal and Tat-activated transcription from the human immunodeficiency virus type 1 long terminal repeat. /. Virol, 69, 6572-6576. Svaren, J., Schmitz, J. & Horz, W. (1994) The transactivation domain of Pho4 is required for nucleosome disruption at the PH05 promoter. EMBO J., 13, 4856-4862. Swan, K.A., Alberola-Ila, J., Gross, J.A., Appleby, M.W., Forbush, K.A., Thomas, J.F. & Perlmutter, R.M. (1995) Involvemnet of p21ras distinguishes positive and negative selection in thymocytes. EMBO J., 14, 276-285. Terada, K., Kaziro, Y. & Satoh, T. (1995) Ras is not required for the interleukin 3-induced proliferation of a mouse pro-B cell line, BaF3. /. Biol. Chem., 270, 27880-27886. Tesmer, V.M. & Bina, M. (1996) Regulation of HIV-1 gene expression by NF-IL6. /. Mol. Biol. 149 Tesmer, V.M., Rejadhyaksha, A., Babin, J. & Bina, M. (1993) NF-IL6-mediated transcriptional activation of the long terminal repeat of the human immunodeficiency virus type 1. Proc. Natl. Acad. Sci. USA, 90, 7298-7302. Thompson, C.C., Brown, T.A. & McKnight, S.L. (1991) Convergence of Ets- and Notch-related structural motifs in a heteromeric DNA bindng complex. Science, 253, 762-768. Tjian, R. (1996) The biochemistry of transcription in eukaryotes: a paradigm for multisubunit regulatory complexes. Phil. Trans. R. Soc. Lond., 351, 491-499. Tong, S.S., Luciw, P.A. & Peterlin, B.M. (1989) Signaling through T lymphocyte surface proteins, TCR/CD3 and CD28, activates the HIV-1 long terminal repeat. / Immunol, 142, 702-7. Tong-Starksen, S. & Peterlin, B.M. (1990) Mechanisms of retroviral transcriptional activation. Seminars in Virol., 1, 215-227. Trahey, M. & McCormick, F. (1987) A cytoplasmic protein stimulates normal N-ras p21 GTPase, but does not affect oncogenic mutants. Science, 238, 542-545. Trahey, M., Wong, G., Haalenbeck, R., Rubinfeld, B., Martin, G.A., Ladner, M., Long, C M . , Crosier, W.J., Watt, K., Koths, K. & McCormick, F. (1988) Molecular cloning of two types of GAP complementary DNA from human placeenta. Science, 242, 1697-1700. Ullrich, A. & Schlessinger, J. (1990) Signal transduction by receptors with tyrosine kinase activity. Cell, 61, 203-212. Van Aelst, L., Barr, M., Marcus, S., Polverino, A. & Wigler, M. (1993) Complex formation between Ras and Raf and other protein kinases. Proc. Natl. Acad. Sci. USA, 90, 6213-6217. Vaishnav, Y. & Wong-Stall, F. (1992) The biochemistry of AIDS. Annu. Rev. Biochem. , 60, 578-630. Veillette, A., Bookman, M.A., Horak, E.M. & Bolen, J.B. (1988) The CD4 and CD8 T cell surface antigens are associated with the internal membrane protein-tyrosine kinase p561ck. Cell, 55, 301-308. Verdin, E. (1991) DNase I-hypersensitive sites are associated with both long terminal repeats and with the intragenic enhancer of integrated human immunodeficiency virus type 1. /. Virol, 65, 6790-6799. Verma, I.M., Stevenson, J.K., Schwarz, E.M., Antwerp, D.V. & Miyamoto, S. (1995) Rel/Nf-KB/lKB family: intimate tales of association and dissociation. Genes & Dev., 9, 2723-2735. 150 Veschambre, P., Simard, P. & Jalinot, P. (1995) Evidence for functional interaction between the HIV-1 Tat transactivator and the TATA box binding portein in vivo. }. Mol. Biol, 250, 169-180. Virbasius, J.V., Virbasius, C.-m.A. & Scarpulla, R.C. (1993) Identity of GABP with NRF-2, a multisubunit activator of cytochrome oxidase expression, reveals a cellular role for an ETS domain activator or viral promoters. Genes & Dev., 7, 380-392. Vojtek, A.B. & Cooper, J.A. (1995) Rho family members: activators of MAP kinase cascades. Cell, 82, 527-529. Vojtek, A.B., Hollenberg, S.M. & Cooper, J.A. (1993) Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell, 74, 205-214. Wain-Hobson, S. (1996) One on one meets two. Nature, 384, 117. Wang, C.-Y., Bassuk, A.G., Boise, L.H., Thompson, C.B., Bravo, R. & Leiden, J.M. (1994) Activation of the Granulocyte-Macrophage Colony-Stimulating Factor promoter in T cells requires cooperative binding of Elf-1 and API transcription factors. Mol. Cell. Biol, 14, 1153-1159. Wang, C.-Y., Petryniak, B., Thompson, C.B., Kaelin, W.G. & Leiden, J.M. (1993) Regulation of the Ets-related transcription factor Elf-1 by binding to the Retinoblastoma protein. Science, 260, 1330-1335. Wasylyk, Hahn, S.L. & Giovane, A. (1993) The Ets family of transcription factors. Eur. J. Biochem., 211, 7-18. Wasylyk, B., Wasylyk, C , Flores, P., Begue, A., Leprince, D. & Stehelin, D. (1990) The c-ets proto-oncogenes encode transcription factors that cooperate with c-Fos and c-Jun for transcriptional activation. Nature, 346, 191-193. Wasylyk, C , Bradford, A.P., Gutierrez-Hartmann, A. & Wasylyk, B. (1997) Conserved mechanism of Ras regulation of evolutionary related transcription factors, Etsl and Pointed P2. Oncogene, 13, 899-913. Wasylyk, C , Maira, S.-M., Sobieszczuk, P. & Wasylyk, B. (1994) Reversion of Ras transformed cells by Ets transdominant mutants. Oncogene, 9, 3665-3673. Watanabe, H., Sawada, J.-i., Yano, K.-L, Yamaguchi, K., Goto, M. & Handa, H. (1993) cDNA cloning of transcription factor E4TF1 subunits with Ets and Notch motifs. Mol. Cell. Biol, 13, 1385-1391. Watanabe, H., Wada, T. & Handa, H. (1990) Transcription factor E4TF1 contains two subunits with different functions. EMBO }., 9, 841-847. 151 Waterman, M.L., Fischer, W.H. & Jones, K.A. (1991) A thymus-specific member of the HMG protein family regulates the human T cell receptor Coc enhancer. Genes & Dev., 5, 656-669. Waterman, M.L. & Jones, K.A. (1990) Purification of TCF-loc, a T-cell-specific transcription factor that activates the T-Cell Receptor Ccc gene enhancer in a context-dependent manner. The New Biologist, 2, 621-636. Wei, X., Ghosh, S.K., Taylor, M.E., Johnson, V.A., Emini, E.A., Deutsch, P., Lifson, J.D., Bonhoeffer, S., Nowak, M.A., Hahn, B.H., Saag, M.S. & Shaw, G.M. (1995) Viral dynamics in human immunodeficiency virus type 1 infection. Nature, 373,117-122. Werner, M.H. & Burley, S.K. (1997) Architectural transcription factors: proteins that remodel DNA. Cell, 88. Wilson, C.J., Chao, D.M., Schnitzler, A.N.I.R., Kingston, R.E. & Young, R.A. (1996) RNA polymerase II holoenzyme contains SWI/SNF regulators involved in chromatin remodeling. Cell, 84, 235-244. Wong, J.M. & Bateman, E. (1994) TBP-DNA interactions in the minor groove discriminate between A:T and T:A base pairs. Nucl. Acids Res., 22, 1890-1896. Xu, G., O'Connel, P., Viskochil, D., Cawthon, R., Robertson, M., Culver, M., Dunn, D., Stevens, J., Gesteland, R., White, R. & Weiss, R. (1990) The neurofibbromatosis type 1 gene encodes a protein related to GAP. Cell, 62, 599-608. Yang, B.-S., Hauser, C.A., Henkel, G., Colman, M.S., Beveren, C.V., Stacey, K.J., Hume, D.A., Maki, R.A. & Ostrowski, M.C. (1996) Ras-mediated phosphorylation of a conserved threonine residue enhances the transactivation activities of c-Etsl and c-Ets2. Mol. Cell. Biol, 16, 538-547. Yang, Z. & Engel, J.D. (1993) Human T cell transcription factor GATA-3 stimulates HIV-1 expression. Nucleic Acids Res., 21, 2831-2836. Yankulov, K., Blau, J., Purton, T., Roberts, S. & Bentley, D.L. (1994) Transcriptional elongation by RNA polymerase II is stimulated by transactivators. Cell, 77, 749-759. Yoon, J.-B., Li, G. & Roeder, R.G. (1994) Characterization of a family of cellular transcription factors which can modulate human immunodeficiency type 1 transcription in vitro. Mol. Cell. Biol, 14, 1776-1785. Zawel, L. & Reinberg, D. (1995) Common themes in assembly and function of eukaryotic transcription complexes. Annu. Rev. Biochem., 64, 533-561. 152 Zeichner, S.L., Kim, J.H. & Alwine, J. (1991) Linker-scanning mutational analysis of the transcriptional activity of the human immunodeficiency virus type 1 long terminal repeat. /. Virol, 65, 2436-44. Zerivitz, K. & Akusjarvi, G. (1989) An improved nuclear extract preparation method. Gene. Anal Techn., 6, 101-109. Zhang, L., Huang, Y., Yuan, H., Chen, B.K., Ip, J. & Ho, D.D. (1997) Identification of a replication-competent pathogenic human immunodeficiency virus type 1 with a duplication in the TCF-la region but lacking N F - K B binding sites. /. Virol, 71, 1651-1656. Zhang, Y., Doyle, K. & Bina, M. (1992) Interactions of HTF4 with E-box motifs in the long terminal repeat of human immunodeficiency virus typel. /. Virol, 66, 5631-5634. Zhou, Q. & Sharp, P.A. (1995) Novel mechanism and factor for regulation by HIV-1 Tat. EMBO J., 14, 321-328. Zhou, Q. & Sharp, P.A. (1996) Tat-SFl: cofactor for stimulation of transcriptional elongation by HIV-1 Tat. Science, 274, 605-610. 153 Appendix 1: Oligonucleotides used in this study Name of oligonucleotide Sequence of oligonucleotide B gatcCCCGAGACTGCATCCGGAGTAg GGGCTCTGACGTAGGCCTCATc c t ag gATCCGGAGTACTTCAAGAACg GCCTCATGAAGTTCTTGcctag P5 CCGAGAGCTGCATCCGGAGTA CTCGACGTAGGCCTCATGAAG P5M1 C C GAG AGGGTG ATC C GG AGT A CTCCCACTAGGCCTCATGAAG P5M1 CCGAGAGGGTGATCCGGAGTA CTCCCACTAGGCCTCATGAAG P5M3 CCGAGAGCTGCCTCCGGAGTA CTCGACGGAGGCCTCATGAAG P5M4 CCGAGAGCTTACTCCGGAGTA CTCGAATGAGGCCTCATGAAG P5V1 CCGAGAGCTGCACCCGGAGTA CTCGACGTGGGCCTCATGAAG P5M5 CCGAGAGCTGCATCGGGAGTA CTCGACGTAGCCCTCATGAAG P 5 M 6 CCGAGAGCTGCATCCGGCGTA CTCGACGTAGGCCGCATGAAG SA gatcCCCGAGAGCTGCATCCGGAG GGGCTCGACGTAGGCCTCATctag MLA2 CCCGAGAGCTGCATCCGGAGGCCT GGGCTCGACGTAGGCCTCATCGGA PKB CAAGGGACTTTCCGCTGGGGACTTTCCa CCTGAAAGGCGACCCCTGAAAGGt PKBMV1 CAAGGGACTTCCCGCTGGGGACTTTCCa CCTGAAGGGCGACCCCTGAAAGGt PKBM2E CAAGGGACTTCCCGCTGGGGACTTCCCa CCTGAAGGGCGACCCCTGAAGGGt E t s - 1 MSV GCCGGAAGTG CGGCCTTCAC 154 Name of oligonucleotide Sequence of oligonucleotide gatcCTTCAAGAACTGCTGACATg GAAGTTCTTGACGACTGTAcctag P3 CTTCAAGAACTGCTGACATCGAGCTTTCTC TTCTTGACGACTGTAGCTCGAAAGAGGTTC 5 ' A3 ' C gatcCTTCGGGAGCTGCTGACATg GAAGCCCTCGACGACTGTAcc tag 5'1FRE (or ns) gatcTGTGGGGCTGCATGGA ACACCCCGACGTACCTCTctag mC3T gatcCTTCTTTAACTGCTGACATg GAAGAAATTGACGACTGTAcc tag mC2T g a t c C T T C T T G A A C T G C T G A C A T g G A A G A A C T T G A C G A C T G T A c c t a g mC2 TTCAAGAACTGCACTTATCGAGCTT TTCTTGACGTGAATAGCTCGAAC mCl TTCAAGAACATATGATATCGAGCTT TT C T T GTATAC TATAGC T CGAAC P3MF CTTCAAGCCCTGCTGACATCGAGCTTTCTC TTCGGGACGACTGTAGCTCGAAAGAGGTTC P3M1 CTTCAAGAACTGCTGCCATCGAGCTTTCTC TTCTTGACGACGGTAGCTCGAAAGAGGTTC P3MA2 CTTCAAGAACTGCTGACCTCGAGCTTTCTC TTCTTGACGACTGGAGCTCGAAAGAGGTTC P3MT3 CTTCAAGAACTGCTGACACCGAGCTTTCTC TTCTTGACGACTGTGGCTCGAAAGAGGTTC HIV2 ccgaGAACAGCTGAGACTGCAc CTTGTCGACTCTGACGTggttc TCAGATGCTGCATATAAGCAGCTGC TCTACGACGTATATTCGTCGACGAA FmTAT TCAGATGCTGCAGCGAAGCAGCTGC TCTACGACGTCGCTTCGTCGACGAA BB62 TTTCAGATGCTGCATATAAGCAGCTGCTTTTTG GTCTACGACGTATATTCGTCGACGAAAAAC 155 Name of oligonucleotide Sequence of oligonucleotide BB63 TTTCAGATGCTGCTTATATGCAGCTGCTTTTTG GTCTACGACGAATATACGTCGACGAAAAAC BB 6 4 TTTTAGATGCTGCCTATAAAAAGCTGCTTTTTG ATCTACGACGGATATTTTTCGACGAAAAAC MA 6 2 TTTCAGATGCTGCATATAAGCAGCTGCTTTTTG GTCTACGACGTATATTCGTCGACGAAAAAC M2 6 2 TTTCAGATGCGTCATATAAGCAGCGTCTTTTTG GT C T AC GC AGT AT AT T C GT C GC AG AAAAAC PT c tAGATGCTGCATATAAGCAGCTGCTTTTTGCaTG TACGACGTATATTCGTCGACGAAAAAC PTM5 c tAGATGGGTGATATAAGCAGCTGCTTTTTGC aTG TACCCACTATATTCGTCGACGAAAAAC PTM3 ctAGATGCTGCATATAAGCAGGGTGTTTTTGCaTG TACGACGTATATTCGTCCCACAAAAAC PTV1 c tAGATGCTGCATCTAAGCAGCTGCTTTTTGCaTG TACGACGTAGATTCGTCGACGAAAAAC PTV2 c tAGATGCTGCATAAAAGCAGCTGCTTTTTGC aTG TACGACGTATTTTCGTCGACGAAAAAC PTV3 c tAGATGCTGCATATAGGCAGCTGCTTTTTGCaTG TACGACGTATATCCGTCGACGAAAAAC PTMC ctAGATGCTGCATAGAAGCAGCTGCTTTTTGCaTG TACGACGTATCTTCGTCGACGAAAAAC PTM2 c tAGATGGGTGATATAAGCAGGGTGTTTTTGCaTG TACCCACTATATTCGTCCCACAAAAAC PTM1 c tAGATGGGTGATATAACACCGGTGTTTTTGCaTG TACCCACTATATTGTGGCCACAAAAAC 156 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0088197/manifest

Comment

Related Items