Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Characterization of UBC-1, a UBC2/RAD6-like ubiquitin conjugating enzyme from the nematode Caenorhabditis… Leggett, David Scott 1996

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1997-196100.pdf [ 8.11MB ]
Metadata
JSON: 831-1.0088125.json
JSON-LD: 831-1.0088125-ld.json
RDF/XML (Pretty): 831-1.0088125-rdf.xml
RDF/JSON: 831-1.0088125-rdf.json
Turtle: 831-1.0088125-turtle.txt
N-Triples: 831-1.0088125-rdf-ntriples.txt
Original Record: 831-1.0088125-source.json
Full Text
831-1.0088125-fulltext.txt
Citation
831-1.0088125.ris

Full Text

Characterization of UBC-1, a UBC2/RAD6-Iike ubiquitin conjugating enzyme from the nematode Caenorhabditis elegan by David Scott Leggett B.Sc (Maj.), McGill University, 1990 A THESIS SUBMITTED IN PARTIAL F U L F I L L M E N T OF THE REQUIREMENTS FOR THE DEGREE OF Doctor of Philosophy in THE F A C U L T Y OF G R A D U A T E STUDIES Department of Biochemistry and Molecular Biology  We accept this thesis as conforming to the required standard  THE UNIVERSITY OF BRITISH C O L U M B I A November 1996 © David Leggett, 1996  In presenting this thesis in partial fulfilment of the requirements for an advanced degree at The University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the Head of my Department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission.  Department of Biochemistry and Molecular Biology The University of British Columbia 2146 Health Sciences Mall Vancouver, Canada V6T-1Z3 Date: 25/11/96  Abstract  ABSTRACT The Caenorhabditis  elegans gene ubc-1, encoding a homologue of the  cerevisiae ubiquitin conjugating enzyme UBC2/RAD6,  Saccharomyces  was cloned. The biochemical properties  of UBC-1 were examined as well as its expression throughout the development of the organism. The ubc-1 gene encodes a 192 amino acid ubiquitin conjugating enzyme that shows considerable sequence identity with the Saccharomyces cerevisiae UBC2/RAD6 (66%), as well as with homologues from Schizosaccharomyces  pombe (70%), Drosophila  melanogaster (83%)  and human (84%). However, UBC-1 is distinct in being the only R A D 6 homologue, other than R A D 6 itself, with a carboxy-terminal extension. Caenorhabditis  Analysis of ubc-1 homologues from  briggsae and Ascaris suum showed that the carboxy-terminal extension is  conserved, suggesting that it plays an important role in nematodes.  When constitutively  expressed from the yeast promoter ADH1, ubc-1 complements the D N A repair and growth deficiencies in a S. cerevisiae rad6A mutant, demonstrating that ubc-1 is a functional homologue of RAD6.  Northern blot analysis demonstrated that ubc-1 is transcribed as a 1.7 kb mRNA which is constitutively expressed at similar levels, in all life stages. The ubc-1 mRNA transcript is transspliced by SL2, suggesting it may be transcribed as part of a polycistronic message. However, no detectable signal on Northern blots was seen using probes spanning 2 kb upstream of ubc-1. Also, when the upstream 2 kb and first intron of ubc-1 were fused in frame with LacZ and injected into C. elegans, the resultant stable lines showed strong expression in the gut, suggesting the presence of a promoter within this region. Therefore, although ubc-1 mRNA is spliced by SL2, no evidence was found that it is transcribed as part of a polycistronic messager R N A . Biochemical analysis of bacterially expressed recombinant UBC-1 showed that it is capable of forming a thiol ester bond with ubiquitin, demonstrating that it is indeed a ubiquitin conjugating enzyme. Surprisingly, in addition to forming a thiol ester with ubiquitin, UBC-1 also stably monoubiquitinated itself on lysine 162 in its C-terminal tail. Inactive UBC-1 lacking the active site cysteine was not monoubiquitinated at lysine 162, even in the presence of  ii  Abstract equimolar functional U B C - 1 , demonstrating that UBC-1 likely ubiquitinates itself via an intramolecular reaction. Cross-linking experiments using purified recombinant UBC-1 revealed that it self-associates in vitro, forming dimers and probably tetramers. The tail of UBC-1 plays an important role in this interaction, as deletions of this region significantly decreased, but did not abolish the ability of UBC-1 to self-associate. These findings demonstrate that the tail of UBC-1 is important both for its quaternary structure and its post-translational modification.  iii  Table  of  contents  T A B L E OF CONTENTS ABSTRACT  ii  T A B L E OF CONTENTS  iv  LIST OF T A B L E S  ;  ix  LIST OF FIGURES  x  LIST OF A B B R E V I A T I O N S  xi  ACKNOWLEDGMENTS  xiii  INTRODUCTION  1  1. Mechanisms of Intracellular protein degradation - Overview  1  2. Ubiquitin: A historical perspective  2  3. The ubiquitin system  3  3.1. Ubiquitin  3  3.2. Ubiquitin conjugation  4  3.3. Degradation of ubiquitinated proteins  6  3.4. Ubiquitin conjugating enzymes  8  4. Roles of ubiquitin conjugating enzymes  12  4.1. Degradation of abnormal and short lived proteins  13  4.2. Stress response  14  4.3. D N A repair  14  4.4. Protein translocation  15  4.5. Peroxisome biogenesis  15  4.6. Ubiquitination of membrane receptors  16  4.7. Transcription  18  4.8. Cell cycle control  20  4.9. Mammalian cell transformation  22  5. Structure and functions of UBC2/RAD6  23  6. C. elegans  24  as a model system  iv  Table of contents The Present Study  25  M A T E R I A L S A N D METHODS  26  1. Maintenance of C. elegans  26  1.1. Basic culture methods  26  1.2. Long term storage of strains  26  2. General D N A and R N A techniques  26  2.1. Bacterial transformations  26  2.2. Polymerase chain reaction  27  2.3. c D N A systhesis  27  2.4. Preparation of radioactive D N A probes  27  2.4.1. Random primer extension  27  2.4.2. End-labelling of oligonucleotides  27  2.5. Plasmid miniprep from E. coli  28  2.6. Genomic D N A isolation  28  2.7. Genomic Southern blot  29  2.8. Generation of nested ExoIII deletions  29  2.9. Double stranded D N A sequencing  30  2.10. Total C. elegans R N A isolation  30  2.11. Northern blot analysis  30  3 Protein and immunological methods  31  3.1. Plasmid construction for protein expression  31  3.2. Protein expression  32  3.3. Metabolic labelling of bacterially expressed proteins  32  3.4. Purification of bacterially expressed proteins  33  3.4.1. Purification of histidine tagged UBC-1  33  3.4.2. Purification of native UBC-1 and its derivatives  33  3.4.3. Large scale purification of UBC-1 for crystallization  33  v  Table of contents 3.5. UBC-1 cross-linking  34  3.6. Source of ubiquitin activating enzyme  34  3.6.1. Total C. elegans lysate  34  3.6.2. Wheat E l  35  3.7. Ubiquitin conjugation assays  35  3.7.1. Ubiquitin conjugation assay using Wheat E l  35  3.7.2. Ubiquitin conjugation assay using C. elegans extract  36  3.8. [ I]-Labelling of ubiquitin  36  3.9. SDS-polyacrylamide gel electrophoresis  36  3.10. Western blot analysis  36  3.11. Immunostaining of Western blots  37  3.12. Production of anti-UBC-1 antibodies  37  3.13. Crystallization of UBC-1  37  125  4. Yeast techniques  38  4.1. Saccharomyces cerevisiae strains and constructs  38  4.2. Yeast transformation  38  4.3. Complementation of rad6 null yeast by ubc-1  39  4.3.1. U V complementation  39  4.3.2. Growth complementation  39  4.3.3. Sporulation complementation  39  5. Methods for transgenic studies  40  5.1. Construct for U B C - l / L a c Z  40  5.2. Establishment of C. elegans transgenic strains  40  5.3. In situ histochemical staining of transgenic strains  40  5.4 . Identification of P-galactosidase stained cells  .41  RESULTS  42  Section A . Cloning and analysis of ubc-1  vi  42  Table of contents 1. Cloning of ubc-1  42  2. Comparison of UBC-1 and its homologues from other organisms  47  3. Cloning of the ubc-1 homologues from A. suum and C. briggsae  47  4. Complementation of S. cerevisiae rad6A cells by ubc-1  50  4.1. Complementation of U V sensitivity  50  4.2. Complementation of slow growth phenotype  53  4.3. Complementation of sporulation  53  5. Southern and Northern blot analysis of ubc-1  53  6. Temporal expression of ubc-1 mRNA transcripts  56  7. Ubc-1 is trans-spliced by SL2  56  8. Is ubc-1 transcribed in a polycistronic message?  56  8.1. Expression patterns of the UBC-1/LacZ transgene  58  8.1.1. Establishment of transgenic lines  58  8.1.2. Expression patterns of the ubc-l/LacZ fusion  58  Section B . Functional studies of UBC-1  60  1. UBC-1 shows E2 activity  60  2. UBC-1 fails to ubiquitinate histone H2B in vitro  60  3. UBC-1 is stably monoubiquitinated in vitro  60  4. UBC-1 is ubiquitinated in its carboxy-terminal tail  63  5. UBC-1 autoubiquitinates itself in an intramolecular reaction  68  6. UBC-1 self-associates in vitro  70  7. The tail of UBC-1 is involved in self-association  70  8. Crystallization of UBC-1  74  DISCUSSION  77  1. Ubc-1 encodes a RAD6-like ubiquitin conjugating enzyme  77  2. Both cis and trans-splicing are required for ubc-1 mRNA maturation  78  3. Ubc-1 is expressed at all life stages  79  vii  Table of contents 4. UBC-1 self-associates in vitro  79  5. The carboxy-terminal tail of UBC-1 greatly enhances self-association  79  6. Stoichiometry of UBC-1 quaternary structure  80  7. UBC-1 displays unique ubiquitination patterns  81  8. Is ubc-1 part of a polycistronic message?  83  9. Other ubiquitin system genes in C. elegans  85  10. Conclusions  85  11. Future directions  86  REFERENCES  89  APPENDIX  106  C. elegans ubiquitin cosmids  106  viii  List of tables LIST OF TABLES Table 1. Components of the ubiquitin conjugation pathway Table 2. Known ubiquitin conjugating enzymes in S. cerevisiae  9 9  Table 3. Antibody dilutions used in Western blot analysis  37  Table 4. Oligonucleotide sequences  43  Table 5. Net charge of carboxy-terminal tails....  50  ix  List of figures LIST OF FIGURES Figure 1. The ubiquitin dependent proteolytic pathway  5  Figure 2. Mapping of ubc-1 to Chromosome IV  44  Figure 3. The nucleotide and derived amino acid sequences of the ubc-1 gene of C. elegans  46  Figure 4. Protein sequence comparison  49  Figure 5. Complementation of U V sensitivity in the rad6A strain of S. cerevisiae by C. elegans ubc-1  51  Figure 6. Complementation of rad6A slow growth phenotype by ubc-1 Figure 7. Southern and Northern analysis of ubc-1 Figure 8. Expression of ubc-1 mRNA throughout development  52 54 55  Figure 9. Ubc-1 mRNA is trans-spliced to SL2  57  Figure 10. LacZ expression of the p E X P l transgene in C. elegans  59  Figure 11. Recombinant HisUBC-1 forms a thiol ester linkage with ubiquitin  61  Figure 12. UBC-1 forms thiol sensitive and insensitive adducts with ubiquitin  62  Figure 13. UBC-1 derivatives used in this study  64  Figure 14. Mapping of the autoubiquitination site to the tail of UBC-1  65  Figure 15. Lysine 162 is involved in stable ubiquitination of UBC-1  66  Figure 16. The autoubiquitination of UBC-1 occurs intramolecularly  67  figure 17. UBC-1 self-associates in vitro  69  Figure 18. The tail of UBC-1 is involved in self-association  71  Figure 19. Purification of UBC-1 and deleted UBC-1 derivatives  72  figure 20. Concentration effect on the self-association of the E2 core of UBC-1  75  Figure 21. Photomicrograph of a crystal of UBC-1  76  x  List of Abbreviations LIST OF ABBREVIATIONS  o  A  angstrom  ADH  alcohol dehydrogenase  Amp  ampicillin  ATP  adenosine-5'-triphosphate  bp(s)  basepair(s)  BSA  bovine serum albumin  cDNA  complementary deoxyribonucleic acid  cpm  count per minute  Da  dalton  DEAE  diethylaminoethyl  DEPC  diethyl pyrocarbonate  DNA  deoxyribonucleic acid  DTT  dithiothreitol  E. Coli  Escherichia coli  ECL  enhanced chemiluminescence  EDTA  ethylenediaminetetraacetic acid  ER  endoplasmic reticulum  HEPES  N-2-hydroxyethylpiperazine-N-2-ethanesulfonic acid  HPLC  high pressure liquid chromatography  I  inosine  IPTG  isopropyl- P-D-thiogalactopyranoside  kDa  kiloDalton  M9 medium  3% K H P 0 , 6% N a H P 0 , 5% NaCl, 1 m M M g S 0  mRNA  messenger ribonucleic acid  NLS  nuclear localization signal  2  4  2  xi  4  4  List of Abbreviations OD  optical density  PAGE  polyacrylamide gel electrophoresis  PBS  phosphate buffer saline  PCR  polymerase chain reaction  PMSF  phenylmethylsulfonyl fluoride  PVDF  polyvinylidene difluoride  RNA  ribonucleic acid  rpm  revolutions per minute  SDS  sodium dodecyl sulphate  SSPE  180 m M NaCl, 1 m M E D T A , 10 m M N a H P 0 , pH 7.4  Tris  tris(hydroxymethyl)aminomethane  UTR  untranslated region  UV  ultra-violet  X-gal  5-bromo-4-chloro-3-indolyl-f3-D-galactopyranoside  YAC  yeast artificial chromosome  2  xii  4  Acknowledgements ACKNOWLEDGMENTS First and foremost I would like to thank my supervisor Peter Candido for both the guidance and freedom which he provided throughout my studies. I would also like to thank the other members of my supervisory committee, Ross MacGillivray and Ivan Sadowski, for their help and advice throughout the years. To all the members of the Candido lab both past and present, Don, Mei, Michel, Eve, Sandi, Tracy, and Emily, thanks for being my collaborators and friends. You made the my time in here an enjoyable experience. I will miss our morning discussions and brainstorming sessions over coffee, not to mention the cinnamon buns. Completion of my doctoral studies would not have been possible without the support of many dear friends. I would like to extend my thanks to Wendy, Cheryl, Gord, Jane, Rick, Janine, Emma, and Karen for their friendship and many late night 'therapy' sessions at the Gallery. Finally I would like to thank my family for their steadfast support throughout this endeavor. Thanks for believing in me.  Xlll  Introduction INTRODUCTION  1. MECHANISMS OF INTRACELLULAR PROTEIN DEGRADATION - OVERVIEW Most cellular proteins exist in a dynamic state of turnover.  This turnover is highly  selective as different proteins are degraded within the cell at different rates. Protein degradation plays a variety of roles within the cell. Most importantly, the levels of specific proteins are determined by a balance between their rates of synthesis and degradation. Protein degradation also provides amino acids in times of stress; for instance, the total level of protein degradation in cultured cells increases under conditions of hormonal or nutrient deficiency. Damaged or abnormal proteins are also selectively removed from the cell by degradation. Intracellular protein degradation can be separated into lysosomal and non-lysosomal mechanisms (for review see Hershko & Ciechanover, 1982).  Lysosomal degradation is  predominantly responsible for hydrolyzing endocytosed exogenous proteins and internalized receptors.  However, under conditions of hormonal or nutrient deprivation, autophagic  engulfment of cytoplasmic components by the lysosome is greatly increased. The lysosome does not seem to be involved in the basal rate of protein turnover in the cell, as inhibitors of lysosomal proteases inhibit the rate of protein breakdown in nutrient deprived cells, but have a much lower effect on basal protein degradation in nourished cells (Segal & Doyle, 1978). Non-lysosomal mechanisms are therefore likely to be involved in the highly selective protein degradation that occurs under basal metabolic conditions. There exist several non-lysosomal protease complexes within the cell. In recent years, strong evidence has emerged suggesting that ubiquitin mediated protein degradation is the predominant system involved in the selective degradation of damaged, abnormal and short lived proteins as well as regulatory proteins within the cell (Hershko, 1991, Jentsch et al., 1991).  1  Introduction 2. UBIQUITIN: A HISTORICAL PERSPECTIVE Ubiquitin is an interesting case where research done in three separate fields (protein degradation, chromatin structure and isolation of thymic hormones) converged, leading to its isolation and identification as a key component in the ATP-dependent degradation of proteins. Ubiquitin was initially isolated by Goldstein and co-workers as part of a screen to detect bovine thymic hormones. It was named ubiquitin after studies demonstrated that it was found in all tissues (Goldstein et al., 1975). Ubiquitin is a small protein of 9000 Da and is present in all eukaryotes.  The sequence of ubiquitin maintains a remarkable degree of identity between  species. It is completely conserved between humans and cattle (Schlesinger & Goldstein, 1975), and differs at only 3 positions in yeast (Ozkaynak et al., 1984). While this conservation suggested an important and universal function within eukaryotes, its exact role was unknown. While working on an A T P dependent proteolytic system in erythrocytes, Ciechanover and associates isolated a small polypeptide of approximately 9000 Da which was absolutely required for proteolysis (Ciechanover et al., 1980a). This protein was called APF-1 for ATPdependent Proteolysis Factor I. Multiple APF-1 molecules were shown to be bound in an A T P dependent manner to proteins that were then degraded (Ciechanover et al., 1980b). APF-1 is attached to proteins via an isopeptide bond between the e-amino group of a lysine residue of the target protein and the carboxy terminal amino acid of APF-1 (Hershko et al., 1980). Wilkinson and colleagues noted that the linkage between APF-1 and its target proteins was similar to that of the chromosomal protein A24, which is bound to histone H2A. A24, which was shown to be identical to ubiquitin, is bound to lysine 119 of histone H 2 A via an isopeptide bond (Goldknopf & Busch, 1977). Based on this observation, experiments were performed which demonstrated that ubiquitin could functionally substitute for APF-1 in the ATP-dependent degradation of proteins (Wilkinson et al., 1980). Ubiquitin, A24 and APF-1 were thus shown to be the same protein. From this beginning, the field of ubiquitin-mediated degradation of proteins has expanded rapidly. The key to this process is the conjugation of ubiquitin to target proteins,  2  Introduction controlled by a complex cascade of enzymes. This cascade consists of the ubiquitin activating enzyme, a member of the ubiquitin conjugating enzyme family and sometimes a ubiquitin protein ligase which is presumed to aid in target recognition. The final result of this cascade is the formation of  a multiubiquitin chain on the protein destined for degradation.  The  multiubiquitinated protein is then recognized by a large multisubunit protease called the 26S proteasome, which degrades the protein and releases peptides and free ubiquitin.  3. THE UBIQUITIN SYSTEM  3.1. Ubiquitin In all eukaryotes examined to date, ubiquitin is encoded in two forms: either as polyubiquitin in which ubiquitin coding regions are lined up head to tail, or as a fusion of the coding regions of ubiquitin and specific ribosomal proteins of the large and small ribosomal subunits (Finley et al., 1989, Finley & Chau, 1991, Ozkaynak et a l , 1987). The number of polyubiquitin genes varies between species, as does the number of ubiquitin repeats within these genes. S. cerevisiae (Ozkaynak et al., 1984), D. melanogaster (Lee et al., 1988) and C. elegans (Graham et al., 1989) contain a single polyubiquitin gene with 4, 18 and 11 ubiquitin repeats respectively, while humans contain 2 polyubiquitin genes with 3 and 9 repeats (Baker & Board, 1987, Wiborg et al., 1985) and A. thaliana has 5 polyubiquitin genes with 3, 3, 4, 5, and 6 repeats (Callis et al., 1995).  The ubiquitin repeats are translated as a single unit and are  processed by ubiquitin C-terminal hydrolases which cleave at the C-terminal of ubiquitin to release individual ubiquitin moieties (Jonnalagadda et al., 1989, Liu et al., 1989, Ozkaynak et al., 1987). The polyubiquitin precursors are not conjugated to proteins as the last ubiquitin repeat in the series contains additional amino acid residues on its C-terminal. These extra amino acids can also be removed by ubiquitin hydrolases, thus rendering the last ubiquitin repeat functional. In ubiquitin ribosomal fusions, ubiquitin is fused to the amino terminal of either a 52 or a 76-80 amino acid ribosomal protein. These fusions are also processed by ubiquitin hydrolases. It has  3  Introduction been suggested that in the ribosomal fusions, ubiquitin may aid in stabilizing the ribosomal protein or help in its proper assembly into the ribosome (Finley et al., 1989).  3.2. Ubiquitin conjugation The hallmark of ubiquitin-dependent protein degradation is the covalent attachment of ubiquitin to proteins that are destined to be degraded. In this context, ubiquitin acts as a 'tag' which can be recognized by a multisubunit protease called the proteasome which will degrade the proteins. Work done primarily in reticulocytes and yeast has largely defined the basic pathway of ubiquitin conjugation. This pathway requires the presence of ubiquitin, ubiquitin activating enzyme (El), as well as one of a family of ubiquitin conjugating enzymes (E2). A ubiquitin protein ligase (E3) may also be required for target recognition. This pathway is summarized in figure 1. In order to be conjugated to a target protein, free ubiquitin must first interact with E l . In an A T P dependent reaction, a ubiquitin adenylate is first formed and the activated ubiquitin is then transferred to an active site cysteine within the E l , forming a thiolester bond between the carboxy-terminal glycine of ubiquitin and the cysteinyl residue (Haas et al., 1982). This activated ubiquitin is then transferred via a transacylation reaction to one of a family of ubiquitin conjugating enzymes, again forming a thiolester bond with an active site cysteine (Hershko et al., 1983, Pickart & Rose, 1985). The E2 can then, either alone or in concert with an E3, recognize a target protein and ubiquitinate it, forming an isopeptide bond between the carboxy-terminal glycine of ubiquitin and the e-amino group of a lysine side chain in the target protein (Hershko, 1991, Hershko et al., 1983, Pickart & Vella, 1988, Reiss & Hershko, 1990). After the first ubiquitin is added to the target protein, it in turn becomes a target for ubiquitination, resulting in the formation of a multiubiquitin chain (Chau et al., 1989). Many of the 7 lysyl residues of ubiquitin are capable of participating in chain formation.  4  While the most prominent  Introduction  PEPTIDES  Figure 1.  The ubiquitin dependent proteolytic pathway  5  Introduction type of chain found is formed on lysine-48 (van Nocker & Vierstra, 1993), lysines-7,-11,-63, -29 have also been implicated in chain formation (Arnason & Ellison, 1994, Baboshina & Haas, 1996). The type of chain that is formed may be important for function. Studies in yeast have shown that lysine-63 based chains are involved in the stress response as well as D N A repair (Arnason & Ellison, 1994, Spence et al., 1995). The type of chain linkage formed can depend on which E2 and E3 is involved. For example, human E 2 E P F forms lysine-11 chains, while yeast R A D 6 forms a lysine-3 chain on its own, but will form lysine-48 chains when associated with its E3, UBR1 (Baboshina & Haas, 1996).  3.3. Degradation of ubiquitinated proteins Multiubiquitinated proteins are degraded within the cell by a large multisubunit protease called the proteasome. Two forms of proteasome, having sedimentation coefficients of 20S and 26S, can be isolated. 20S proteasomes are 700 kDa protein complexes consisting of a barrelshaped stack of 4 rings each containing 7 subunits, that is conserved in all eukaryotes and in the archaebacterium Thermoplasma acidophilum (Rivett, 1993). The simplest known version of the 20S proteasome is found in T. acidophilum. This 20S proteasome is comprised of a and (3 subunits; the outer rings are comprised of a subunits and the inner rings are (3 subunits, yielding an  067(37(370:7  stoichiometry (Puhler et al., 1992).  Within eukaryotes, the basic  067(37(370:7  stoichiometry is maintained, although the subunits have become diversified. S. cerevisiae contains 14 20S proteasome genes encoding 7 a subunits and 7 |3 subunits (Heinemeyer et al., 1991, Hilt & Wolf, 1995). The (3 subunits contain catalytic sites positioned within the central channel of the proteasome having chymotrypsin-like, trypsin-like and peptidyl-glutamyl-peptide hydrolysing activities based on studies using chromo- and fluorogenic peptides. While the 20S proteasome is able to degrade peptides, it is unable to degrade physiological substrates and its activity is not stimulated by A T P or ubiquitin (Peters, 1994). Recently the crystal structure of the 20S proteasome from T. acidophilum was solved to 3.4A (Lowe et al., 1995). The structure revealed that the a rings on the two ends of the  6  Introduction proteasome form small pores of 13 A in diameter which could presumably allow the passage of unfolded proteins into the inner channel of the P subunits. This may explain why the 20S proteasome does not degrade cellular proteins randomly, as the proteins must presumably be unfolded before they can enter the proteasome. In 1986, a 26S protease with a molecular mass of 1500 kDa which was capable of degrading proteins in an ATP- and ubiquitin-dependent manner was identified in reticulocytes (Hough et al., 1986). Studies showed that this protease contained a 20S proteasome as its catalytic core, and two 19S caps located, one on each end of the proteasome (Driscoll & Goldberg, 1990, Orino et al., 1991, Peters et al., 1991). The 19S cap is composed of approximately 16 polypeptides varying in size from 25 to 110 kDa (Dubiel et al., 1995). Several of these proteins have been identified as novel ATPases which may be involved in the unfolding of proteins before entry into the proteasome. The 19S cap also contains a protein called S5a, which has been shown to have a strong affinity for multiubiquitin chains, suggesting that it is involved in the recognition of ubiquitinated proteins by the proteasome (Beal et al., 1996, Deveraux et al., 1994, van Nocker et al., 1996a). The subunit structure of the proteasome is not static. In mammals there exist nonessential P subunits which are encoded within the M H C class II region. These subunits, L M P 2 and L M P 7 , are inducible by y-interferon and specifically replace the P subunits 8 and M B 1 , respectively (Fruh et al., 1994). This modification of the proteasome causes a change in the type of peptides released, favoring peptides with basic and hydrophobic ends (Gaczynska et al., 1994). These types of peptides are efficiently bound by class I M H C molecules, thus implicating the proteasome in antigen presentation. The proteasome can undergo further changes. Two proteins, PA28oc and PA28P, also induced by y-interferon, assemble into ring shaped particles called PA28 which can bind to the ends of the 20S proteasome and accelerate the rate of peptide production (Gray et al., 1994, Groettrup et al., 1996). The proteasome is therefore a dynamic complex which may change to meet the needs of the cell. The proteasome is also apparently capable of regulating the extent to which it degrades proteins. Most ubiquitinated proteins are degraded into peptides by the catalytic action of the  7  Introduction proteasome. However, in at least one case, the proteasome is involved in the processing of a propeptide: the transcription factor N F - K B is initially translated as a 105kDa propeptide (pi05) which is ubiquitinated and partially degraded by the proteasome to yield the functional p50 (NFK B 1) subunit (Palombella et al., 1994). In S. cerevisiae, two conditional mutants of (3 subunits PRE1 and PRE2 were shown to accumulate ubiquitinated proteins under stress conditions or following treatment with the arginine analogue canavanine (Heinemeyer et al., 1991). Under these conditions a large amount of abnormal and damaged proteins is generated and ubiquitinated.  The fact that such  ubiquitinated proteins are stabilized in the above mutants demonstrates that the proteasome is involved in ubiquitin-dependent degradation.  Chromosomal deletions of individual 20S  proteasome subunits in yeast were lethal in all cases except for the a subunit Y13 (Emori et al., 1991, Enenkel et al., 1994, Fujiwara et al., 1990, Georgatsou et al., 1992, Haffter & Fox, 1991, Heinemeyer et al., 1993, Heinemeyer et al., 1991, Heinemeyer et al., 1994, Hilt et al., 1993, Lee et al., 1992). Similar chromosomal deletions of the known 19S cap genes were also shown to be lethal (Ghislain et al., 1993, Schnall et al., 1994), demonstrating that the proteasome serves an essential role within the cell. It seems there are exceptions to every rule, and the ubiquitin system is no different. Recent studies have shown that while the yeast receptor STE2 is ubiquitinated, it is not targeted to the proteasome for degradation as expected. Instead it is targeted to the lysosome were it is subsequently degraded (Hicke & Riezman, 1996). Thus it appears that ubiquitination within the cell may provide other avenues for degradation than targeting proteins to the 26S proteasome.  3.4. Ubiquitin conjugating enzymes Initially isolated by traditional fractionation and reconstitution analysis of the ubiquitin dependent proteolysis system in reticulocytes, E2s are members of a large enzyme family (Hershko et al., 1983, Pickart & Rose, 1985). More than 10 ubiquitin conjugating enzymes have been isolated in yeast. Research on A . thaliana (Sullivan et al., 1994, van Nocker et al., 1996b)  8  Introduction  Table 1. Components of the ubiquitin conjugation pathway.  Abbreviation  Full name  El  Ubiquitin activating enzyme  E2  Ubiquitin conjugating enzyme  E3  Ubiquitin protein ligase  Table 2. Known ubiquitin conjugating enzymes in 5. cerevisiae.  Yeast Ubiquitin Conjugating Enzymes Genes Function and Regulation UBC1  -Specifically required after sporulation/germination -Mediates vital functions together with UBC4 and U B C 5 -Go induction  UBC2/RAD6  -DNA repair, induced mutagenesis, sporulation -Degradation by the N-end rule pathway -Inducible by DNA-damaging agents  UBC3/CDC34  -Essential for viability, G l - S cell cycle control, D N A replication, spindle pole body separation  UBC4 UBC5  -Bulk degradation of short-lived and abnormal proteins -Mediate vital functions together with UBC1 -Essential under stress conditions -Heat shock inducible, cadmium inducible  UBC6  -Integral membrane protein of the endoplasmic reticulum -Function in the secretory pathway  UBC7  -Confers cadmium resistance -Cadmium inducible  UBC8  -No detectable mutant phenotypes  UBC9  -G2-M Cell cycle control  UBC10  -Peroxisome biogenesis  9  Introduction and humans (Kovalenko et al., 1996, Nuber et al., 1996, Scheffner et al., 1994) suggests that at least that many E2s are present in these organisms as well. Genetic studies have shown that individual E2s are involved in a variety of cell processes including bulk protein degradation (Hershko, 1988), D N A repair (Jentsch et al., 1987), cell cycle regulation (Goebl et al., 1988), the stress response (Seufert & Jentsch, 1990) and peroxisome biogenesis (Wiebel & Kunau, 1992). While they have very diverse functions in the cell, ubiquitin conjugating enzymes share a strong homology with each other at the primary sequence level. This is most striking within a 152 amino acid region called the E2 core which shares approximately 30% identity among all E2s. This core consists of a region surrounding the active site cysteine which is involved in binding of ubiquitin via a thiolester bond. This active site region has a consensus sequence of G X I C L D L which is nearly identical in all E2s. Ubiquitin conjugating enzymes can be divided into four structural classes. Class I E2s are composed solely of the conserved core domain. Examples of this class include U B C 4 , U B C 5 , U B C 7 and UBC9 from yeast. It is commonly believed that these E2s are unable to recognize their target proteins without the aid of an E3. Class II E2s contain the E2 core plus a carboxy-terminal extension. This carboxyterminal tail can vary in size from 23 amino acid residues for yeast UBC2/RAD6, to 98 residues for yeast CDC34. It has been suggested that these tails may aid in target recognition, based on the observation that the acidic tails of U B C 2 and CDC34 confer the ability to recognize and ubiquitinate basic histones H 2 A and H2B in vitro (Goebl et al., 1988, Jentsch et al., 1987). Further evidence for the tail's ability to recognize targets was provided by Silver et al. (1992), who demonstrated that a chimeric E2 with the core of R A D 6 and the tail of CDC34 could functionally complement a CDC34 temperature sensitive mutant. Other roles for the tails of class II E2s have been demonstrated. The tail of yeast UBC6 is responsible for targeting to the endoplasmic reticulum membrane (Sommer & Jentsch, 1993), and the tails of some class II E2s are involved in their self-association to form higher order quaternary structures. The latter has been shown for yeast CDC34 (Ptak et al., 1994) and within this thesis for C. elegans UBC-1.  10  Introduction Class III E2s are made up of the conserved core domain plus an amino-terminal extension. Members of this class of ubiquitin conjugating enzymes include Drosophila UbcD2, Murine UbcM2 and UbcM3 as well as human UbcH8 and UbcH9 (Matuschewski et al., 1996). Surprisingly, no class III E2 has been observed in yeast (Matuschewski et al., 1996), suggesting that these E2s have evolved relatively recently. The exact role of these N-terminal extensions is unclear at this time, but they are likely involved in the interaction of the E2 with some component(s) of the ubiquitin system. The next logical E2 structure (class IV) would contain both amino- and carboxy-terminal extensions.  To date however, no ubiquitin conjugating enzymes of this type have been  identified. While the function of ubiquitin conjugating enzymes is to ubiquitinate proteins, the manner in which they achieve this end can vary. Initially it was believed that an E2 bound a single ubiquitin to its active site cysteine before transferring the ubiquitin moiety to a target protein. By undergoing multiple cycles an E2 could then form the multiubiquitin chains required for recognition by the proteasome. While in vitro assays have shown this to be the case for E2s like R A D 6 and UBC4, some E2s may operate through other mechanisms. Bovine E225K is able to catalyze the formation of multiubiquitin chains directly on its active site cysteine (Chen & Pickart, 1990). A similar activity has been seen with wheat UBC7 (Van Nocker & Vierstra, 1991). Whether these E2s are capable of directly transferring these multiubiquitin chains to target proteins, or whether they create free ubiquitin chains to be used by other E2s remains to be determined. However, a large amount of free polyubiquitin chains can exist within the cell (van Nocker & Vierstra, 1993). This suggests that some E2s may use such preformed polyubiquitin chains. As mentioned previously, the type of lysine linkage within the ubiquitin chain is also dependent on the conjugating enzyme forming the chain. Lysine-48 linked ubiquitin chains were the first type observed and are abundant within the cell (van Nocker & Vierstra, 1993). However, mutagenesis studies indicate that other lysines are also involved in chain formation.  11  Introduction Lysine-63 of ubiquitin is involved in the stress response, and the formation of lysine-63 linked chains seems to be controlled by the UBC4/5 family of conjugating enzymes in yeast (Arnason & Ellison, 1994). Similarly, human E 2 E P F forms lysine-11 linked polyubiquitin chains and R A D 6 from yeast is capable of forming lysine-6 linked chains on its own, and lysine-48 linked chains when combined with its E3, UBR1 (Baboshina & Haas, 1996). While the utilization of different lysyl residues will presumably have a significant impact on the resulting chain structure, the proteasomal ubiquitin-binding subunit S5a is capable of recognizing both lysine-11 and lysine-48 chains (Baboshina & Haas, 1996). This suggests that different chain linkages should still target the ubiquitinated proteins to the proteasome for degradation. Ubiquitin conjugating enzymes themselves have been shown to be targets for ubiquitination.  In these cases however, the E2 autoubiquitinates itself.  Two types of  autoubiquitination have been observed. Both CDC34 and E2EPF multiubiquitinate themselves (Banerjee et al., 1993, L i u et al., 1996). In this manner, they may be targeting their own degradation, thereby regulating their own levels within the cell.  The second type of  autoubiquitination is the attachment of a single ubiquitin moiety onto an E2. This process occurs with yeast U B C 4 (Gwozd et al., 1995) and with as C. elegans U B C - 1 (This work). Monoubiquitinated proteins are recognized and degraded by the proteasome at a very low rate, so it is likely that this modification is required for some function of the E2 rather than to target the E2 for degradation.  Mutation of the acceptor lysine in U B C 4 to an arginine showed no  observable phenotype in a ubc4/ubc5 background, suggesting that the monoubiquitination may not be performing an essential role (Gwozd et al., 1995).  4. ROLES OF UBIQUITIN CONJUGATING ENZYMES The overall importance of the ubiquitin system within cells is demonstrated by the fact that deletion of the single copy of the yeast E l (UBA1) results in cell death (McGrath et al., 1991). A similar situation was observed when a temperature sensitive mutant of the ubiquitin activating enzyme (ts85) was isolated in a mouse cell line (Finley et al., 1984). At the non-  12  Introduction permissive temperature, these cells showed a wide variety of phenotypes and eventually died. Thus the conjugation of ubiquitin to proteins is required for cell viability. The specificity of ubiquitin-dependent protein degradation is mediated by ubiquitin conjugating enzymes as well as their associated ubiquitin protein ligases (E3s). This specificity is involved in a large number of cellular processes as shown by the wide variety of phenotypes associated with mutant E2s. Cellular roles have been assigned to many of the ubiquitin conjugating enzymes isolated to date, and these roles are reviewed in the following sections.  4.1. Degradation of abnormal and short lived proteins The most prominent class of E2s are those which fall into the UBC4/UBC5 and UBC1 family. Originally cloned from S. cerevisiae, UBC4 and UBC5 are class I E2s which share very high identity with each other and are able to functionally complement one another in ubc4ubc5 double mutants in yeast (Seufert & Jentsch, 1990). Ubc4ubc5 mutants show a severe growth defect when grown under stress conditions such as elevated temperatures and in the presence of the arginine analogue canavanine. Both of these conditions cause the formation of damaged or abnormal proteins within the cell, and pulse chase experiments have shown that the level of short-lived and abnormal proteins is stabilized in ubc4ubc5 mutants (Seufert & Jentsch, 1990). UBC1, a class II E2, is also involved in the degradation of short lived and abnormal proteins, as it is able to partially complement the growth defect in ubc4ubc5 cells when overexpressed (Seufert et al., 1990). It shares strong identity with UBC4 and UBC5 within its E2 core. Homologues of the UBC4/UBC5 class of E2s have been isolated from many organisms; examples include Drosophila UbcDl (Treier et al., 1992) human ubcH5, C. elegans ubc-2 (Zhen et al., 1993), and wheat E 2 i  5 K  (Girod & Vierstra, 1993). The ability of the UBC4 homologues  from Drosophila and C. elegans to complement the ubc4ubc5 double mutant fully implies that the UBC4 homologues from higher eukaryotes are targeting similar proteins (Treier et al., 1992, Zhen et al., 1993). Recent work by Zhen et al (1996) has shown that a mutation in the C. elegans UBC4 homologue ubc-2 causes developmental arrest at the fourth larval stage. Therefore, in  13  Introduction contrast to yeast where UBC4 and UBC5 seem to play redundant roles, in C. elegans the corresponding E2s may have evolved to perform distinct functions during development.  4.2. Stress response When cells undergo a heat shock or other stresses, damaged and abnormal proteins are produced, leading to the induction of a stress response. This response includes the induction of heat shock proteins or chaperones such as HSP70 and HSP60/groEL. The role of these proteins seems to be to rescue the damaged proteins by directly interacting with them in an A T P dependent manner, allowing them to refold to their native form (For review see Hartl, 1996). A second aspect of the stress response is the removal of damaged proteins from cells by ubiquitin mediated degradation. In yeast the polyubiquitin gene UBI4 (Finley et al., 1987) as well as the E2s UBC4 and UBC5 (Seufert & Jentsch, 1990) are stress inducible genes. The UBC7 gene in yeast is also inducible by cadmium, which is known to elicit a stress response (Jungmann et al., 1993). As mentioned in section 4.1, ubc4/ubc5 null yeast suffer severe growth arrest when grown under heat shock conditions. Yeast cells deleted for the UBI4 gene also experience growth arrest under stress conditions (Finley et al., 1987). Likewise, ubc7 null yeast grow as wild-type unless exposed to cadmium (Jungmann et al., 1993). The above findings strongly suggest that these genes are involved in the cells ability to deal with stress. Interestingly, Arnason and Ellison (1994) have shown that lysine-63 of ubiquitin is essential to the stress response . They also demonstrated that the formation of the lysine-63 linked chains is a function of UBC4 and UBC5. Whether or not these alternatively linked chains serve to target the ubiquitinated proteins for degradation remains to be seen.  4.3. DNA repair The first ubiquitin conjugating enzyme gene to be cloned was UBC2 from S. cerevisaie. UBC2 was isolated by screening a c D N A library using oligonucleotide probes derived from peptide sequences of purified UBC2 (a class II E2). When the nucleotide sequence of this clone  14  Introduction was determined, it was found to be identical to the yeast RAD6 gene which is involved in D N A repair (Jentsch et al., 1987). Rad6 mutants show a variety of phenotypes including sensitivity to U V and other D N A damaging agents, as well as defects in induced mutagenesis and sporulation (Haynes & Kunz, 1981). Rad6 yeast also show an increase in retrotransposon insertion compared to wild-type cells, and undergo an increased rate of base pair transitions and G C - A T transversions (Kang et a l , 1992, Liebman & Newnam, 1993). The role of R A D 6 in D N A repair may be to activate D N A repair complexes by degradation of a particular component such as a repressor.  4.4. Protein translocation S. cerevisiae UBC6 encodes a class II ubiquitin conjugating enzyme which contains a membrane anchor within its tail (Sommer & Jentsch, 1993), and the protein is localized to the cytoplasmic surface of the endoplasmic reticulum. Deletion mutants of ubc6 are viable and grow at wild-type rates, and ubc6 loss of function mutations suppress the sec61 mutant phenotype involved in the secretory pathway in yeast, demonstrating a role for U B C 6 in protein translocation. ubc6sec61 cells showed no accumulation of precursor proteins, unlike sec61 yeast in which large amounts of precursor protein were observed (Sommer & Jentsch, 1993). This suggests that U B C 6 is involved in the degradation of the mutant sec61 protein. The requirement of an E3 in this process is inferred by the observation that overexpression of wild-type as well as an enzymatically inactive U B C 6 in sec61 cell allows partial complementation of the translocation defect.  This suggest the presence of a titratable component (E3) which is  sequestered by the overproduced UBC6 resulting in a reduced ability to ubiquitinate the relevant proteins (Sommer & Jentsch, 1993).  4.5. Peroxisome biogenesis While attempting to clone the PAS2 gene, one of 18 complementation groups of pas mutants involved in peroxisome biogenesis, Wiebel and Kunau (1992) identified a c D N A  15  Introduction encoding a ubiquitin conjugating enzyme which fully complemented the pas2 mutant. This E2 was named UBC10 and was shown to be a class IIE2 which localized to the peroxisome in yeast. pas2 mutants lack functional peroxisomes and therefore cause a mislocalization of peroxisomal enzymes such as catalase to the cytoplasm. A similar situation occurs in the yeast Pichia pastoris where the PAS4 gene involved in peroxisome biogenesis is also a ubiquitin conjugating enzyme (Crane et al., 1994). PAS4 encodes a 32 kDa class III E2 which is localized to the cytoplasmic surface of the peroxisomal membrane. While PAS4 has been shown to be attached to the peroxisomal membrane, no membrane anchor like that seen in UBC6 has been identified. Although PAS4 shares 48% similarity with S. cerevisiae PAS2, in preliminary complementation tests PAS2 has failed to complement pas4 mutants. The identification of S. cerevisiae PAS2 and P. pastoris PAS4 as E2s provides important evidence for the role of ubiquitin in organelle biogenesis.  4.6. Ubiquitination of membrane receptors While little is known about which E2s are involved in the ubiquitination of receptors, the role ubiquitin plays in association with these receptors is worthy of note. As early as 1986, both the platelet derived growth factor (PDGF) receptor (Yarden et al., 1986) and the lymphocyte homing receptor (Siegelman et al., 1986) had been shown to be ubiquitinated. Since then, many other receptors have been found to be ubiquitinated, including those for epidermal growth factor, colony stimulating factor, tumor necrosis factor and fibroblast factor (Mori et al., 1995a), as well as the c-kit (Miyazawa et al., 1994), and estrogen receptors (Nirmala & Thampan, 1995). The ubiquitination of these various receptors appears to be playing different roles in different cases. For example, the mouse lymphocyte homing receptor, also known as g p 9 0  MEL  ~ , is 14  monoubiquitinated on its extracellular domain (Siegelman et al., 1986, St. John et al., 1986). Blocking this ubiquitin moiety using a specific monoclonal antibody (MEL-14) disrupts the ability of T-cells to interact with their ligand on cells lining the specialized blood vessels called postcapillary high endothelial venules which allow lymphocytes to enter the lymph nodes. Thus  16  Introduction in this case, it appears that ubiquitin is not involved in the degradation of the receptor, but is functioning as a determinant of the receptor. It is difficult to imagine how the lymphocyte homing receptor could be ubiquitinated extracellularly. It has been suggested that the ubiquitination of g p 9 0  MEL  "  14  would likely occur within the endoplasmic reticulum, prior to  translocation to the plasma membrane (Siegelman et al., 1986). The E R associated E2, UBC6, is a possible candidate for the ubiquitination of g p 9 0  MEL  "  14  although this has yet to be proven.  Ubiquitinated receptors involved in transmitting signals across membranes, such as the P D G F or T-cell receptors, are ubiquitinated in a ligand dependent fashion (Cenciarelli et al., 1992, Mori et al., 1992). It has been suggested that the ubiquitination of these receptors may be involved in their subsequent degradation. This is case with the PDGF receptor where mutants which affect ubiquitination of the receptor are degraded at a reduced rate in vivo (Mori et al., 1992). Proteasome inhibitors such as lactacystin also decrease the rate of degradation of the P D G F receptor (Mori et al., 1995b).  In the case of the T-cell receptor, the C, subunit is  ubiquitinated in a ligand dependent fashion, and this ubiquitination is reversible upon removal of the ligand from the receptor (Paolini & Kinet, 1993). The loss of the ubiquitinated C, subunit after ligand removal is not due to degradation, however, as no detectable degradation of the C, subunit was observed (Paolini & Kinet, 1993). The removal of ubiquitin from the C, subunit is therefore likely due to the action of a ubiquitin hydrolase. Thus, the ubiquitination of receptors seems to play diverse roles within the cell, beyond that of protein degradation. Ubiquitin's role with respect to receptors has become even more interesting as a result of the work done on the yeast plasma membrane receptor STE2. Upon binding of a factor, STE2 activates a signal transduction pathway and is internalized along with its ligand. Hicke and Chen (1996) have shown that STE2 is ubiquitinated on its cytoplasmic tail upon binding a-factor. This ubiquitination is required for the receptor to be internalized, since endocytosis of STE2 is greatly inhibited in ubc4ubc5 null yeast.  Mutational analysis of the cytoplasmic tail also  demonstrated that mutants which are unable to be ubiquitinated are not internalized by the cell. Surprisingly, the rate of STE2 degradation in prelpre2 yeast which contain mutations in two  17  Introduction proteasome (3-type subunits required for the chymotrypsin-like activity of the proteasome, was found to be identical to that of wild-type. In contrast STE2 is stabilized in pep4prbl yeast, which lack active vacuolar proteases. Therefore in the case of STE2, ubiquitin seems to target the protein to the vacuole for degradation rather than to the 26S proteasome. A similar situation has been demonstrated for the yeast A B C transporter STE6.  STE6 has been shown to be  ubiquitinated, and is stabilized in ubc4ubc5 null yeast, demonstrating that the ubiquitin system is involved in its degradation (Rolling & Hollenberg, 1994). However, the strongest stabilization of STE6 was found in pep4 yeast, suggesting that like STE2, STE6 is degraded in the vacuole.  4.7. Transcription The ability of the ubiquitin dependent degradation system to remove proteins specifically and rapidly from the cell makes it an ideal system for the regulation of transcription factors. Many transcription factors have indeed been shown to be ubiquitinated, including c-Jun (Treier et al., 1994), c-Fos (Ciechanover et al., 1991), G C N 4 (Kornitzer et al., 1994), N F - K B (Palombella et al., 1994) and the yeast transcriptional repressor M A T a 2 (Hochstrasser et al., 1991). C-Fos is ubiquitinated in vivo, and the ubiquitination and degradation is greatly enhanced by the interaction of c-Fos with c-Jun which interact in vivo to form the heterodimeric transcriptional activator AP-1 (Tsurumi et al., 1995). In vitro reconstitution experiments have shown that the ubiquitination of c-Fos requires the action of the rabbit ubiquitin conjugating enzyme E2-F1 or its human homologue, ubcH5, and a novel E3 of approximately 280kDa (Stancovski et al., 1995). The yeast transcriptional activator GCN4, which is involved in the regulation of the biosynthesis of amino acids and purines, has also been shown to be degraded by the ubiquitin system, and is dependent on the actions of CDC34 and RAD6 for its ubiquitination (Kornitzer et a l , 1994). The yeast mating cell type transcriptional repressor M A T a 2 has been shown to have a short half-life of approximately 4 minutes. Deletion analysis of M A T a 2 has the existence of two distinct degradation signals within the amino- and carboxy- terminals of the protein, designated  18  Introduction D e g l and Deg2 respectively (Hochstrasser & Varshavsky, 1990).  These signals act  independently to regulate the half-life of MAToc2. It has been shown that the degradation of MAToc requires the action of four different E2s, namely UBC4, UBC5, UBC6, and UBC7 (Chen et al., 1993). These can be separated into two separate pathways based on epistatic analysis, with U B C 4 and U B C 5 in one pathway, and UBC6 and UBC7 in the other. A logical assumption is that these two epistatic pathways may each recognize one the two degradation signals within MAToc2. U B C 6 and UBC7 were indeed found to act on the Degl signal, as Degl-LacZ fusion proteins were stabilized in ubc6ubc7 null yeast. Ubc4ubc5 null yeast showed no differences in the stability of either Degl-LacZ or Deg2-LacZ fusions, so these genes must be involved in some other aspect of MAToc2 degradation. Another complex and interesting case is the transcription factor N F - K B , which is involved in the activation of a large variety of genes that respond to immune and inflammatory signals (for review see Verma et al., 1995). NF-kB consists of a heterodimer formed from p50 ( N F - K B I ) and p65 (RelA). p50 is translated as a 105 kDa precursor called pl05. pl05 was shown to be ubiquitinated and partially degraded during its processing to active p50 . Unlike other substrates of the proteasome which are degraded to small peptides, only the C-terminal of pl05 is degraded, leaving the functional p50 (Palombella et al., 1994). The ubiquitination of pl05 requires the presence of rabbit E2-F1 as well as a novel 320 kDa E3 (Orian et al., 1995). As outlined above, in unstimulated cells, N F - K B is held in the cytoplasm by interaction with the inhibitor protein IKBOC, which masks the nuclear localization of N F - K B . Upon exposure of the cell to N F - K B stimulating agents such as tumor necrosis factor (TNF-a), interleukin-1 (IL-1) or 12-0-tetradecanoylphorbol-13-acetate (TPA), IKBOC is rapidly degraded. This degradation is also mediated by ubiquitination. Upon induction, IKBOC is phosphorylated on serines 32 and 36 by an IKBOC  kinase which signals its ubiquitination and subsequent destruction (Alkalay et al., 1995,  Chen et al., 1995, Chen et al., 1996, Roff et al., 1996). Both UBC4 and rabbit E2-F1 have been shown to be capable of ubiquitinating phosphorylated IKBOC (Alkalay et al., 1995, Chen et al., 1996). The kinase responsible for phosphorylating IKBOC has recently been purified, and consists  19  Introduction of a large multisubunit complex with a molecular mass of approximately 700kDa (Chen et al., 1996). Surprisingly, the activity of this kinase requires the activity of both the ubiquitin activating enzyme and an E2 from the UBC4/UBC5 family. The kinase becomes active only after it itself has been ubiquitinated, suggesting that some regulatory subunit of the kinase may require to be degraded to activate the complex. Therefore in the activation of NF-kB, ubiquitin plays important roles at each stage of the pathway.  4.8. Cell cycle control Virtually since its discovery, the ubiquitin dependent degradation pathway has been shown to be involved in aspects of cell cycle control. The mammalian cell lines ts85 and ts20, containing temperature sensitive alleles of the ubiquitin activating enzyme, where shown to arrest at the S/G2 boundary of the cell cycle (Finley et al., 1984, Kulka et al., 1988). The phenotypes of three ubiquitin conjugating enzyme mutants also show effects on the cell cycle. CDC34(UBC3), initially isolated in the study of the cell cycle, was later found to be a class II E2 (Goebl et al., 1988). Cdc34 mutants arrest at the G l / S phase of the cell cycle. UBC9, a class I E2, was initially cloned from yeast in a screen to identify novel E2s (Seufert et al., 1995). Knockout mutants of UBC9 revealed that cells lacking this gene arrest after S phase at the G 2 / M boundary. The UBC9 homologue hus5 from S. pombe has also been shown to be required for +  mitosis (al-Khodairy et al., 1995). Finally, rad6(ubc2) null mutants were also shown to arrest at the S/G2 boundary when grown at elevated temperatures (Ellison et al., 1991). Ubiquitin's role in the cell cycle was further strengthened by the demonstration that the cell cycle regulatory family of proteins called cyclins are ubiquitinated and degraded during the cell cycle (Glotzer et al., 1991). The regulation of the cell cycle is controlled by a family of protein kinases called cyclin-dependent kinases (CDKs) which control the transitions between phases of the cell cycle. Yeast has only a single cell cycle regulated C D K , called while vertebrates have as many as seven. P 3 4  C D C 2 8  p34  ,  CDC28  can combine with different cyclins to form  an active kinase which allows the cell to pass from G l to S and from G2 to M phase. Once the  20  Introduction cell cycle has begun its transition, the cyclins are ubiquitinated and degraded, allowing the cell to exit from M or S phase. In S. cerevisiae, the transition from G l to S is controlled by p34  CDC28  in  a complex with the G l cyclins C L N 1 , C L N 2 and C L N 3 . Recently it was demonstrated that CDC34 is involved in the ubiquitination of CLN2 (Deshaies et al., 1995). CDC34 has also been shown to be required for the degradation of p 4 0 , a potent inhibitor of p 3 4 5/c  C D C 2 S  - C L B (Schwob  et al., 1994). While CLBs are usually associated with the G 2 / M phase transition, C L B 5 and C L B 6 are required for D N A replication. CDC34 is therefore important both for exit from G l and for the initiation of D N A replication. Entrance into mitosis is regulated by p34  CDC28  in association with mitotic cyclins (CLB1,  C L B 2 , C L B 3 , and CLB4); Exit from mitosis requires cyclin B proteolysis, which begins at anaphase. Mitotic cyclins have been shown to contain a short amino-terminal sequence termed the 'destruction box', containing a highly conserved sequence ( R X X L X X I X N ) , which is required for their degradation (Glotzer et al., 1991). By using classical fractionation and reconstitution experiments, Hershko et al. (1994) separated two distinct activities from clam egg extracts which are required for cyclin B degradation. The first of these activities is a ubiquitin conjugating enzyme called E2-C and the second is a 1500 kDa E3 complex termed the cyclosome (Sudakin et al., 1995). While E2-C is apparently active throughout the cell cycle, E2C alone cannot recognize cyclin B without the presence of the cyclosome which itself is only active during M phase. The activation of the cyclosome during M phase requires the presence of active p34  CDC28  kinase. Therefore the kinase which initiates the transition through mitosis also  initiates its own inactivation. Similar work carried out in Xenopus egg extracts have identified two E2s which are required for cyclin B ubiquitination. One is the Xenopus homologue of U B C 4 and the second is unknown, and may be the Xenopus homologue of E2-C (King et al., 1995). Surprisingly, while yeast UBC4 was able to ubiquitinate cyclin B in Xenopus extracts, it was unable to do so in clam extracts (Hershko et al., 1994, King et al., 1995). The reason for this discrepancy is unknown. The researchers also identified a large E3 complex from Xenopus eggs which is required for cyclin B ubiquitination. Termed A P F for Anaphase Promoting Factor, this  21  Introduction complex contains homologues of S. cerevisiae CDC16 and CDC27 (King et al., 1995). Whether A P F is the Xenopus homologue of the cyclosome remains to be determined. As mentioned above, ubc9 null mutants arrest at the G 2 / M boundary of the cell cycle, suggesting that this gene may also be involved in the progression of the cell through mitosis. Ubc9 mutants have been shown to stabilize C L B 2 , an M phase cyclin (Seufert et al., 1995). Thus, several distinct E2s are involved in the progression of the cell through mitosis.  4.9. Mammalian cell transformation The fact that ubiquitin is involved in regulation of the cell cycle suggests that it could also play a role in oncogenesis. This assumption was validated when it was observed that the oncogenic human papillomavirus types 16 and 18 (HPV-16 and HPV-18) produce a protein called E6 which stimulates the degradation of the tumor suppressor protein p53 (Band et al., 1991, Scheffner et al., 1990). Within the cell, E6 associates with a host protein E6-AP, and in coordination with an E2, ubiquitinates p53 leading to its degradation via the proteasome (Scheffner et al., 1993). Several E2 have been shown to efficiently ubiquitinate p53 in the presence of E6 and E6-AP. These include UBC8 from A. thaliana (Scheffner et al., 1994), UbcH5 and hUBC4 from humans (Rolfe et al., 1995, Scheffner et al., 1994), and E2-F1 from rabbits (Ciechanover et al., 1994). A l l these E2's are members of the UBC4/UBC5 family of ubiquitin conjugating enzymes, suggesting that this family of E2s may be involved in the degradation of p53 in most eukaryotes.  Another example of ubiquitin's involvement in  oncogenesis involves the transcription factor Jun. As described earlier, c-Jun is ubiquitinated within the cell. However, it was observed that its transforming form, v-Jun, was unable to be ubiquitinated (Treier et al., 1994). The half life of v-Jun is therefore longer than that of c-Jun. The lack of ubiquitination of v-Jun is attributable a stretch of 27 amino acids called the 8-domain which is present in c-Jun, but absent in v-Jun (Treier et al., 1994). Therefore, v-Jun escapes the degradative fate of c-Jun, leading to its transforming ability.  22  Introduction 5. STRUCTURE AND FUNCTIONS OF UBC2/RAD6 As mentioned in section 4.3, sequencing of the yeast E2 UBC2 showed it to be identical to the previously identified RAD6 gene. The functions of UBC2 include D N A repair, induced mutagenesis, sporulation and the control of retrotransposition. UBC2 is a class II E2 encoding a 172 amino acid protein with a predicted molecular mass of 19.7 kDa. UBC2 contains a carboxyterminal tail of 23 amino acids, of which 20 are acidic residues, including 13 consecutive aspartyl residues, making the tail highly negatively charged (Reynolds et al., 1985). Deletion analysis of U B C 2 has shown that the carboxy-terminal tail is absolutely required for sporulation, but not for D N A repair or induced mutagenesis (Morrison et al., 1988). The acidic tail is also required for the ability of UBC2 to ubiquitinate histones H 2 A and H2B in vitro (Sung et al., 1988). U B C 2 is the E2 responsible for the degradation of proteins via the N-end rule pathway (Dohmen et al., 1991). The N-end rule relates the half-life of a protein to its amino-terminal residue (Varshavsky, 1992). When found at the amino-terminus, certain amino acid residues such as argininine and lysine cause the protein to be unstable with a half life of several minutes, while others such as methionine or valine are stabilizing amino acids which yield half-lives of over 10 hours. U B C 2 is able to recognize N-end rule substrates by interacting with the N-end E3, UBR1 (Bartel et al., 1990). Both the amino- and carboxyl-termini of U B C 2 are required for physical interaction with UBR1 (Raboy & Kulka, 1994, Watkins et al., 1993). While mutants in UBC2 show pleiotrophic phenotypes, deletion of UBR1 from the yeast genome results in only a mild sporulation defect (Bartel et al., 1990). Therefore, the overall importance of the N-end rule pathway in yeast seems minor. To date the yeast  GoOC  protein is the only natural substrate found  to be degraded via the N-end rule pathway (Madura & Varshavsky, 1994). While other proteins such as GCN4 have been shown to require UBC2 for their degradation (Kornitzer et al., 1994), whether these protein are recognized by the N-end rule pathway or by some other mechanism remains to be seen.  23  Introduction Homologues of UBC2/RAD6 have been isolated from several organisms including the isozymes HHR6A and HHR6B from human (Koken et al., 1991b), Dhr6 from D. melanogaster (Koken et al., 1991a), rhp6+ from S. pombe (Reynolds et al., 1990), and AtUBCl from A. thaliana (Sullivan et al., 1994). Surprisingly, unlike UBC2, these homologues are all class I E2s lacking a carboxy-terminal tail. Like truncated UBC2, these homologues are able to complement the D N A repair and induced mutagenesis functions of rad6 null yeast, but are unable to complement sporulation. While much is known of the function(s) of UBC2/RAD6 in yeast, little is known about its role in multicellular eukaryotes.  6. C. E L E G A N S AS A MODEL SYSTEM First proposed by Sydney Brenner in 1965 as a model system for the study of development and the nervous system, C. elegans has emerged as a useful tool in the study of biological processes in higher eukaryotes.  C. elegans is a small free-living soil nematode,  containing fully differentiated muscular, neuronal, reproductive, digestive, excretory and sensory systems. Any studies done in C. elegans are therefore likely to be relevant to higher animals as well. C. elegans offers many powerful molecular, genetic and cell biological tools to the researcher. The life cycle of the organism is very short requiring only 3 1/2 days to develop from the embryo to the adult at 20 °C. C. elegans is easily maintained either on agar plates seeded with a layer of bacteria as a food source, or in liquid culture (Sulston & Brenner, 1974). Its transparency has allowed the complete cell lineage to be determined, and the nervous system has been mapped at the ultrastructural level (Chalfie et al., 1985, Sulston & Horvitz, 1977, Sulston et al., 1983). The transparency of the organism also allows the direct visualization of gene expression either by immunohistochemistry or in transgenic animals carrying promoter/reporter gene fusions such as LacZ or GFP (Mello et al., 1991). While the majority of individuals in a C. elegans population are self-fertilizing hermaphrodites, males arise by non-disjunction of the X chromosome at a low frequency and can mate with the hermaphrodites, allowing genetic crosses  24  Introduction to be carried out. Many mutants have been isolated using a variety of mutagenic agents. Although reverse genetics is difficult in C. elegans, the use of transposon insertion and imprecise excision has been used to generate mutants in specific genes (Plasterk & Groenen, 1992). Of special interest to molecular biologists is the existence of a complete physical map of the genome, in the form of yeast artificial chromosomes and cosmids (Coulson et al., 1991), as well as a rapidly advancing genome sequencing project. At present, the nucleotide sequence of over 50% of the genome has been determined, and the estimated completion time for the genome is late 1998.  THE PRESENT STUDY Ubiquitin conjugating enzymes (E2s) exist as a large gene family within eukaryotes. A large body of research has focused on the roles of these conjugating enzymes, demonstrating that they are involved in regulating a variety of cellular functions. While much has been learned about the roles of E2s, these studies have been done primarily in single cells such as yeast and reticulocytes. In order to address the roles of the ubiquitin system in a multicellular organism, we have initiated studies of a ubiquitin conjugating enzyme in Caenorhabditis elegans  25  Materials and Methods MATERIALS AND METHODS  1. MAINTENANCE OF C. E L E G A N S  1.1. Basic culture methods C. elegans N2 (Bristol) were cultured on N G plates (0.3% NaCl, 0.25% tryptone, 5 mg/ml cholesterol, 1 m M MgS04, 25 m M KH2PO4 pH 6.0, 1.7% agarose) seeded with E. coli OP50 at room temperature (Brenner, 1974). Large scale growth of C. elegans was performed in liquid culture (Sulston & Brenner, 1974) using frozen E. coli MRE-600 (purchased from the Fermentation Facility, University of Alabama at Birmingham) as a food source. Synchronous populations of C. elegans were cultured by inoculating liquid cultures with embryos ( l x l O embryos/L), obtained by dissolving gravid adults in alkaline sodium hypochlorite (Emmons et al., 1979). The hatched embryos were allowed to arrest at the L I stage before E. coli was added to the culture in order to improve the degree of synchrony.  1.2. Long term storage of strains Worms (populations containing a high proportion of L I and L2 larvae) were washed from overgrown plates with M 9 buffer, mixed with an equal volume of freezing buffer (30% glycerol in M 9 buffer), transferred to 1.8ml Nunc cryogenic tubes and placed at -70°C overnight. The tubes were transferred the next day to liquid nitrogen for storage (Wood, 1988).  2. GENERAL DNA AND RNA TECHNIQUES  2.1. Bacterial transformations Ligations and purified plasmid D N A were transformed into competent DH5oc (BRL/GIBCO) following the manufacturer's instructions. Other E. coli strains used were made competent by CaCl2 treatment and transformed by a standard protocol (Sambrook et al., 1989).  26  6  Materials and Methods 2.2. Polymerase chain reaction PCR was performed in 50 uL with 5 m M of each deoxyribonucleotide, 0.5 m M MgCl2, 50 pmol of each primer and 1U of Taq polymerase (Promega) in PCR buffer provided by the manufacturer. In general, the reactions were preincubated at 96 °C for 2 minutes and underwent 30 cycles of 92 °C for 1 minute, 55 °C for 1 minute and 72 °C for 1 minute followed by an incubation of 72 °C for 5 minutes. Any variation from this consisted of raising or lowering the annealing temperature.  2.3. cDNA systhesis Total R N A (10 u,g) was used as template for cDNA synthesis using a standard protocol (Sambrook et a l , 1989).  2.4. Preparation of radioactive DNA probes  2.4.1. Random primer extension Random hexamer extension labeling of D N A probes was carried out using a T7 QuickPrime kit (Pharmacia) following the manufacturer's instructions. The labelled probe was separated from unincorporated label on a 1 ml Sephadex G-50 spin column.  2.4.2. End-labelling of oligonucleotides End labelling of oligonucleotide probes was performed in 25 pi by combining 100 ng of the oligonucleotide with 2.5 pi of lOx kinase buffer (700 m M Tris pH 7.5, 100 m M M g C l , 50 2  m M DTT, 1 m M EDTA), 20 pi [y- P]ATP (10 mCi/ml), and 4U T4 polynucleotide kinase. The 32  reaction mixture was incubated for 30 minutes at 37 °C, and the kinase was inactivated by heating to 65 °C for 5 minutes.  27  Materials and Methods 2.5. Plasmid miniprep from E. coli The plasmid miniprep protocol used was a modification of the alkaline extraction method (Birnboim & Doly, 1979). Briefly, 1 ml of an overnight culture of E. coli was spun down in a microcentrifuge (12,000 rpm, 30 sec) and resuspended in 200 pi G T E (50 m M glucose, 25 m M Tris pH 8.0, 10 m M EDTA). The cells were lysed by the addition of 400 ui of lysis solution (0.2 M NaOH, 1% SDS) and neutralized by the addition of 300 pi of 7.5 M ammonium acetate. The solution was clarified by centrifugation (12,000 rpm, 8 min) and the plasmid D N A was precipitated by the addition of 0.6 volumes of isopropanol and washed with 70% ethanol. The plasmid pellet was dried under vacuum and resuspended in 50 pi of TE with 10 pg/ml RNAse A . Plasmids used for microinjection of C. elegans were prepared using the Magic Minipreps D N A purification system (Promega). The plasmids were resuspended at a concentration of 200 ng/pl in d H 0 . 2  2.6. Genomic DNA isolation C. elegans genomic D N A was isolated as described (Jones et al., 1989). One gram of frozen C. elegans embryos was resuspended in 20 ml of proteinase K buffer (100 m M Tris pH8.5, 50 m M E D T A , 200 m M NaCl, 1% SDS) with 4 mg of proteinase K and incubated at 65 °C for 1 hour. This solution was then extracted 3 times with phenol in a separatory funnel, followed by extraction of the aqueous phase with chloroform. The D N A was wound out of the solution by overlaying the aqueous phase in a glass tube with 2 volumes of cold (-20 °C) 95% ethanol and slowly rotating the tube to disturb the interface, where the D N A precipitates as a white pellet. The ethanol was changed 3 times and the D N A pellet was washed with 70% ethanol and air-dried. The D N A was resuspended in 1 ml T E buffer while still slightly wet. This yielded D N A at a concentration of 1 mg/ml.  28  Materials and Methods 2.7. Genomic Southern blot Genomic D N A (4 ug) was digested with various restriction endonucleases and separated by electrophoresis on a 0.8% agarose gel. The digested D N A was then transferred by Southern blotting to Hybond-N membrane (Amersham Corp.) using standard methods (Sambrook et al., 1989).  3 2  P labelled D N A probes were generated using random primer extension. Hybridizations  were carried out overnight at 42°C in 50% formamide, 5X SSPE, 0.2% SDS and 0.5mg/ml heparin. The blots were then successively washed for 20 minutes with 2X SSPE, 0.2% SDS at 20 °C; 0.2X SSPE, 0.2% SDS at 20 °C; 0.2X SSPE, 0.2% SDS at 50 °C and finally exposed to xray film (Kodak X - O M A T AR).  2.8. Generation of nested ExoIII deletions ExoIII deletions were generated using a modification of the protocol of Henikoff (Henikoff, 1984). Plasmid D N A (10 u.g) was digested with two restriction endonucleases to generate a 3' overhang protecting the sequencing primer binding site and a blunt end next to the sequence to be deleted. The digested plasmid was precipitated, resuspended in 60 ul of ExoIII buffer (66 m M Tris pH 8.0, 0.66 m M M g C l ) and placed at 37 °C. The reaction was started by 2  the addition of 500 units of ExoIII (Promega) and 2.5 ul aliquots were removed at 30 second intervals and placed in 7.5 (ii of SI nuclease mix (30 m M K O A c pH 4.6, 250 m M NaCl, 1 m M ZnS04, 5% glycerol, 2.5 units S1 nuclease) on ice. After all samples were taken, the tubes were incubated for 30 minutes at room temperature and the nuclease was then inactivated by incubation at 70 °C for 5 minutes. The D N A fragments were separated and purified from a 1% agarose gel, resuspended in 10 | i l of Klenow buffer (20 m M Tris pH7.5, 100 m M MgCl2), and blunted by incubation with 1 unit of Klenow D N A polymerase at 37 °C for 3 minutes followed by the addition of 1 ul of 0.125 m M dNTPs for 5 minutes. The Klenow enzyme was inactivated by incubating the tubes at 70 °C for 10 minutes. The deleted plasmids were religated by adding 2 Ul lOx 1-for-all buffer (Pharmacia), 2 ul 10 m M ATP, 1 unit T4 ligase, to a total volume of 20 ul  29  Materials and Methods and incubated overnight at room temperature. The ligated plasmids were subsequently transformed into DH5oc competent cells.  2.9. Double stranded DNA sequencing Sequencing of double stranded D N A by the dideoxy chain termination method (Sanger et al., 1977) was performed using a T7 Sequenase version 2.0 D N A sequencing kit (U.S. Biochemicals) by following the manufacturer's procedure.  2.10. Total C. elegans RNA isolation Total C. elegans R N A was isolated by the method of Antonucci (1985). Two grams of frozen C. elegans were powdered in a mortar chilled with liquid N and the powder resuspended 2  in 3 ml of guanidinium solution (7.5 M guanidinium chloride, 25 m M NaCitrate pH 7.0, 0.1 M pmercaptoethanol). The homogenate was passed 3 times through a 21g needle to reduce viscosity, clarified by centrifugation at 12,000 rpm in a microcentrifuge and the final volume was adjusted to 3 ml with guanidinium solution. The clarified homogenate was then layered over 1 ml of CsCl solution (5.7 M CsCl, 25 m M NaCitrate pH 5.0, which had been treated with 0.5% DEPC for 30 minutes and then autoclaved) in a 5 ml polyallomer ultracentrifuge tube and spun at 42,000 rpm (220,000 g) in an SW 50.1 rotor at 22 °C for 16-24 hours. The supernatant was removed and the pellet was resuspended in 0.3 ml DEPC-treated dH 0 by incubation at 50 °C. 2  The R N A was precipitated by the addition of 0.25 M DEPC-treated NaOAc pH 5.2, and 2.5 volumes of 95% ethanol. After 15 minutes at -70 °C, the R N A was pelleted by centrifugation at 12,000 g for 10 minutes and washed with 70% ethanol. The pellet was then dried under vacuum and resuspended in DEPC-treated dH 0. 2  2.11. Northern blot analysis C. elegans total R N A (10-20 pg) was run on a 1.2% formaldehyde-agarose gel and transferred by Northern blotting to Hybond-N (Amersham Corp.) using standard methods  30  Materials and Methods (Sambrook et al., 1989).  3 2  P labeled D N A probes were generated using random primer  extension. Hybridization and washing of the blots was performed as described in Section 2.7.  3 PROTEIN AND IMMUNOLOGICAL METHODS  3.1. Plasmid construction for protein expression PCR was performed with ubc-1 c D N A as a template to introduce restriction sites to facilitate cloning.  The 5' end of the ubc-1  coding sequence was hybridized to the  oligonucleotide D L 3 5' G A G G A T C C A T G A C G A C G C C C A G C C G T 3'. The BamHI site is shown in bold and the initiator methionine is underlined. The 3' end of the coding sequence hybridized to the oligonucleotide D L 5 5' A A G C T T T T A A G C A T T C G A T C C 3'.  The  termination codon is underlined and the Hindlll site is shown in bold. After amplification, the product was purified by agarose gel electrophoresis, digested with BamRI and Hindlll, and inserted into the BamHI and HindUI sites of the bacterial expression vector pRSET A (Invitrogen) to yield plasmid pHisUBC-1, which expresses an N-terminal histidine tagged U B C 1 (HisUBC-1). This plasmid was then digested with Ndel and BamHI, blunted and religated in order to remove the histidine affinity tag contained in the pRSET A vector, to produce plasmid pUBC-1.  The deletions ubc-1 A169 and ubc-1 A152 were made in the same way, using the 3'  oligonucleotides A152 5' G G A A G C T T T C A G A A A T T G A G C C A G G A C T G C T C 3' and A169 5' G G A A G C T T T C A T T C T T C A A T T T C C A C G T C A T C C 3' to generate pUBC-lA169 and pUBC1A152. The termination codons are underlined and the Hindlll sites are shown in bold. The ubc-1 mutants ubc-lR162 and ubc-lA88 were generated by site directed mutagenesis on wild-type ubc-1 (Kunkel et a l , 1987). The mutations were created using oligonucleotides R162  5'  AATTTCCACGTCATCCC.TGAGCACTGCGTCGCC  C T G T A G A A T A T C C A G A G C A A T T G A T C C G T C C G C 3'.  3'  and  A88  5'  The nucleotides causing the  mutations are underlined. pUBC-lR162 and pUBC-lA88 were created by digesting the mutants  31  Materials and Methods with AccI and Hindill and the fragment was used to replace wild-type ubc-1 in the pUBC-1 expression vector. A l l constructs were verified by D N A sequencing.  3.2. Protein expression A l l expression vectors were transformed into the E. coli strain BL21(DE3). To express unlabelled proteins, cells were grown at 37 °C in L B containing 50 pg/ml ampicillin to an absorbance of 0.6 at 600nm. The cultures were then induced with 1 m M IPTG and allowed to grow for 2 hours. The cells were harvested by centrifugation and stored at -20 °C.  3.3. Metabolic labelling of bacterially expressed proteins [ S]Methionine labelled proteins were produced essentially as described above with the 35  following modifications. Cells were grown at 37 °C in 10 ml of M9 medium with 1 m M MgS04, 0.1 m M CaCl2, 50 pg/ml ampicillin, 18 pg/ml thiamine and 40 pg/ml of each of the amino acids except methionine and cysteine, to an absorbance of 0.6 at 600nm. The cells were induced with 1 m M IPTG for 20 minutes followed by the addition of 300 pg/ml rifampicin. The cells were then shifted to 42 °C for 10 minutes and returned to 37 °C for 1 hour. Trans-[ S]Methionine 35  label (ICN) was added to a final concentration of 25 pCi/ml and the cells were incubated for a further 10 minutes. The cells were harvested by centrifugation and stored at -20 °C until needed. Typical specific activity for purified UBC-1 labelled in this manner was 3000 cpm/pmol. To obtain higher specific activities, the same protocol was followed with the following modifications. After incubation at 42 °C for 20 minutes, the cells were grown at 37 °C for only 30 minutes. Trans-[ S]Methionine label (ICN) was then added to a final concentration of 50 35  pCi/ml and the cells were incubated for a further 30 minutes. Typical specific activity for purified UBC-1 labelled in this manner was 12,000 cpm/pmol.  32  Materials and Methods 3.4. Purification of bacterially expressed proteins  3.4.1. Purification of histidine tagged UBC-1 Cells containing expressed histidine tagged UBC-1 were resuspended in buffer C (50 m M NaH.2P04 pH 8.0, 300 m M NaCl, 10 m M (3-mercaptoethanol). The cells were then lysed by four freeze/thaw cycles, clarified by centrifugation and loaded onto a nickel resin column (Qiagen). The column was washed with buffer C and then with buffer D (50 m M NaH2P04 pH 6.0, 300 m M NaCl, 10% glycine, 10 m M (3-mercaptoethanol). The purified UBC-1 fusion protein was eluted with a pH 6.0 to pH 4.0 gradient in buffer D, dialyzed against 50mM Tris pH 7.5 and stored at -20 °C.  3.4.2. Purification of native UBC-1 and its derivatives E. coli cells containing UBC-1 or its derivatives were lysed by sonication in buffer A (50 m M Tris pH 7.5, 1 m M E D T A , 100 m M NaCl, 2 m M DTT). The lysate was clarified by centrifugation and loaded onto a 1 cm x 2.5 cm DEAE-Sephacel (Pharmacia) column. The column was washed with 3 volumes of buffer A and the expressed protein was eluted using a 0.1 M to 0.8 M NaCl gradient in buffer A. Fractions containing the expressed protein were pooled and concentrated by ultrafiltration (Amicon cell). The concentrated protein was then loaded onto a 1 cm x 30 cm G100 superfine (Pharmacia) gel exclusion column in PBS (10 m M NaH^PC^. pH 7.4, 136 m M NaCl, with 2 m M DTT) and eluted in the same buffer. Fractions containing the expressed protein were pooled and stored at - 70 °C in the presence of 10% glycerol. A l l purification steps were carried out at 4 °C.  3.4.3. Large scale purification of UBC-1 for crystallization UBC-1 was expressed in 4 liters of L B broth as described in section 3.2. The cells were harvested by centrifugation (3000xg) and stored at -20 °C until needed. The cell pellet from each liter was resuspended in 30 ml of buffer A (50 m M Tris pH 7.5, 1 m M E D T A , 100 m M NaCl, 2  33  Materials and Methods m M DTT) and lysed passage through a French press. The resulting lysate was cleared by centrifugation (10,000xg) and loaded onto a 1 cm x 10 cm D E A E cellulose column equilibrated with buffer A . The column was washed with 3 column volumes of buffer A and UBC-1 was eluted using a 0.1 M to 0.8 M gradient in buffer A. The fractions containing UBC-1 were pooled and concentrated by ultrafiltration using a Amicon cell with a molecular weight cut-off of 10,000 MW.  The concentrated UBC-1 was then loaded onto a 2.5 cm x 160 cm G75sf column  equilibrated in buffer A and eluted with the same buffer. The fractions containing UBC-1 were pooled, dialyzed against 50 m M Tris pH 7.5, 1 m M E D T A , 2 m M DTT, and finally concentrated by ultrafiltration (Amicon cell) to 40 mg/ml and stored at -70 °C. This procedure yielded approximately 30 mg of purified UBC-1 per liter of expressed cells.  3.5. UBC-1 cross-linking A l l cross-linking reactions were performed in cross-linking buffer (50 m M HEPES pH 7.5, 150 m M NaCl, 2 m M DTT).  3 5  S labeled proteins to be cross-linked were preincubated in  cross-linking buffer for 3 minutes on ice.  Appropriate volumes of 100 m M B S  3  (bis(sulfosuccinimidyl)suberate (Pierce)) were then added and the reaction was allowed to proceed on ice for 30 minutes. The reactions were terminated by the addition of 1 M Tris pH 6.8 to a final concentration of 60 m M . The reaction products were separated on 12.5% SDS polyacrylamide gels and visualized by autoradiography.  3.6. Source of ubiquitin activating enzyme  3.6.1. Total C. elegans lysate Unless otherwise stated, clarified C. elegans extract was used as the source of ubiquitin activating enzyme (El) in all assays. C. elegans embryos were prepared as described in section 1.1. The embryos were resuspended in lysis buffer (50 m M Tris pH7.5, 0.75 m M E D T A , 1.5 m M D T T , 2.5 m M P M S F , 15 pg/ml each of aprotinin, leupeptin, and pepstatin A) and  34  Materials and Methods homogenized with 30 strokes in a stainless steel Dounce homogenizer. The extract was clarified by centrifugation (10,000xg) and stored at -70 °C.  3.6.2. Wheat El An expression vector containing the wheat E l gene (UBA1) was a gift from Dr. R. Vierstra (Hatfield & Vierstra, 1992). Following induction of BL21 cells containing the U B A 1 vector, the cells were centrifuged and resuspended in 1/50 volume of 50 m M Tris pH 8.0, 1 m M E D T A and 5 m M (3-mercaptoethanol. The cells were lysed by 4 freeze/thaw cycles and the lysate was clarified by centrifugation (10,000xg). The E l lysates were stored at -70 °C.  3.7. Ubiquitin conjugation assays Several assays using different components were used throughout the course of this research. These are summarized below.  3.7.1. Ubiquitin conjugation assay using Wheat El Reaction mixtures containing 8 | l g of recombinant wheat E l lysate, 7 uM purified histidine tagged UBC-1, 1.7 uM bovine ubiquitin (Sigma), 0.1 m M MgCl2, 0.1 m M DTT, 1 m M ATP, and 1U inorganic pyrophosphatase (Sigma) in 30 uL of 50 m M Tris pH 7.5 were incubated at 30 °C for 15 min and the reactions terminated by the addition of 10 uL of 4 X Laemmli loading buffer with or without 150 m M [3-mercaptoethanol as indicated. Samples were subjected to SDS-PAGE on 15% gels and transferred to polyvinylidene difluoride membrane (Immobilon-P, Millipore) by Western blotting. Blotted proteins were probed with anti-ubiquitin polyclonal (IgM) antibody (a gift of Dr. J. Davie, U . of Manitoba) and visualized by enhanced chemiluminescence (Amersham) using protein A-horseradish peroxidase conjugate (Sigma).  35  Materials and Methods 3.7.2. Ubiquitin conjugation assay using C. elegans extract  Reactions were performed in 50 m M Tris pH 7.5, 1.5 m M ATP, 14 p M bovine ubiquitin (Sigma) and 35 pg C. elegans lysate at 20 °C for 15 minutes. Unless otherwise stated, UBC-1 or its derivatives were used at 6 p M in the reaction. Reactions were terminated by the addition of SDS sample buffer with or without 360 m M (3-mercaptoethanol as indicated. The samples were run on a 15% SDS-polyacrylamide gel and either transferred to Immobilon-P (Millipore) membrane for Western blotting or visualized by autoradiography.  3.8. [ I]-Labelling of ubiquitin 125  Bovine ubiquitin (Sigma) was purified on an H P L C monoS column as described previously (Pickart et al., 1992). Purified ubiquitin was labelled with  1 2 5  I by the Chloramine-T  method as described previously (Ciechanover et al., 1980b).  3.9. SDS-polyacrylamide gel electrophoresis Discontinuous SDS-polyacrylamide gel electrophoresis (Laemmli, 1970) was used to separate protein samples in l x SDS sample buffer (15.6 m M Tris p H 6.8, 2% SDS, 0.01% bromophenol blue, 10% glycerol, and either 360 m M p-mercaptoethanol or 200 m M DTT).  3.10. Western blot analysis Proteins separated by SDS-PAGE were electro-blotted onto Immobilon-P membrane (Millipore). The gels to be transferred were soaked in transfer buffer (25 m M Tris p H 8.5, 192 m M glycine, 20% methanol) for 10 minutes. Immobilon-P membranes were first 'wetted' in 100% methanol for 10 seconds and then soaked in transfer buffer for 5 minutes. The gel and Immobilon-P membrane were sandwiched between sheets of filter paper and placed in the transfer aparatus. The transfer was carried out either at 50 mA overnight or 250 mA for 1 hour. Following transfer the membrane was either used immediately for immunodetection or washed with dH20 and dried at room temperature.  36  Materials  and  Methods  3.11. Immunostaining of Western blots Western blots were blocked with 10% milk powder in TBS-0.05% Tween for 1 hour. The blots were incubated with primary antibody for 1 hour followed by peroxidase labelled secondary antibody for 45 minutes. Between each step the blot was washed three times in TBS0.05% Tween for 10 minutes. The protein-antibody complexes were visualized with enhanced chemiluminescence (ECL, Amersham). Dilutions of antibodies used for Westerns are shown in Table 1.  Table 3. Antibody dilutions used in Western blot analysis  1" Antibody  Dilution  2° Antibody  Dilution  mouse anti-UBC-1  1/5000  peroxidase conjugated  1/10000(0.1 ug/ml)  goat anti-mouse rabbit anti-ubiquitin  Protein A-peroxidase  1/3000 •  1/2000 (0.25 ug/ml)  3.12. Production of anti-UBC-1 antibodies Anti-UBC-1 antibody was prepared in Balb/C mice using bacterially expressed UBC-1 as antigen.  U B C - 1 was prepared by SDS-polyacrylamide gel electrophoresis followed by  electroelution.  Mice were injected subcutaneously with 25 ug of the purified UBC-1 in  TitreMax adjuvant (Vaxcel, inc.), and boosted every 2 weeks. Serum obtained after the third boost was the source of the antibodies.  3.13. Crystallization of UBC-1 UBC-1 crystals were grown by Nham Nguyen in Dr. Gary Brayer's laboratory, at room temperature using the hanging drop vapour diffusion technique (McPherson, 1982). The optimum crystallization conditions used a 10 | i l droplet containing 5 mg/ml U B C - 1 , 45-50% ammonium sulfate, 50 m M Tris pH 7.5, 1 m M E D T A , and 2 m M DTT, and suspended over a 1  37  Materials and Methods ml reservoir containing 25% ammonium sulfate, 50 m M Tris pH 7.5, 1 m M E D T A , and 2 m M DTT. Using these conditions, crystals appeared after 6 weeks and attained a size of 0.4 x 0.2 x 0.1 mm over 2 months.  4. YEAST TECHNIQUES  4.1. Saccharomyces cerevisiae strains and constructs Saccharomyces cerevisiae strains used in this study were KM67 (MATa, his3-Al, leu2-3,  leu2-112, trpl-289, ura3-52, rad6A::LEU2), YW062 (MATa, rad6A::HIS3, his3-A200, leu2-3  leu2-112, lys2-801, trpl-l(am), ura3-52), Y W 0 2 (MATa, his3-A200, leu2-3, leu2-112, trpll(am), ura3-52) and YPH2 (MATa, ura3-52, lys2, ade2). The diploid strains DL01 and DL02 were constructed by mating KM67 with YW062 and YW02 with YPH2 respectively. Standard genetic techniques for S. cerevisiae (Sherman et al., 1986) were used. In order to express C. elegans ubc-1 in yeast, the vector pYUBC-1 was created by cloning the ubc-1 PCR product, amplified using the oligonucleotides DL3 and DL5, into the yeast expression vector pVT102-U (Sikorski & Hieter, 1989) digested with BamHI and Hindlll.  4.2. Yeast transformation An. overnight culture of yeast grown in 1.5 ml of Y E D P medium (2% yeast extract, 2% peptone, 2% glucose) was used to inoculate a 15 ml fresh culture of Y E P D . The culture was grown at 30 °C with vigorous shaking at 37 °C to an OD600nm of 0.8. The cells were harvested by centrifugation (5000xg), washed once with T L (10 m M Tris pH 7.5, 1 m M E D T A , 100 m M lithium acetate) and incubated at 30 °C in 10 ml of T L for 1 hour. The cells were then centrifuged and resuspended in 0.5 ml of TL. Plasmid (1 |ig) and sheared salmon sperm carrier D N A (2 ug) were added to 100 | i l of yeast cells and incubated at 30 °C for 30 minutes. The cells were incubated for a further 60 minutes after the addition of 400 uL of T L P (10 m M Tris pH 7.5, 1 m M E D T A , 100 m M lithium acetate, 4.4% PEG 4000). The yeast cells were then heat shocked  38  Materials and Methods at 42 °C for 5 minutes, followed by centrifugation and resuspension in 100 pi of T L . The cells were then plated onto selective agar plates and grown at 30 °C.  4.3. Complementation of rad6 null yeast by ubc-1  4.3.1. UV complementation Yeast rad6A cells containing pYUBC-1 or pVT102-U and wild-type yeast containing pVT102-U were grown overnight in uracil dropout medium and then plated onto uracil dropout agar plates. The cells were irradiated with 0, 5, 10 and 20 J/m of U V light and incubated at 30 2  °C in the dark to avoid photoreactivation.  4.3.2. Growth complementation Yeast rad6A cells containing pYUBC-1 or pVT102-U and wild-type yeast containing pVT102-U were grown overnight in uracil dropout medium and used to inoculate fresh cultures of uracil dropout medium. The cells were grown at 30 °C with vigorous shaking and time points were taken for measurement of absorbance at 600nm.  4.3.3. Sporulation complementation Yeast diploid rad6A cells DL01 containing pYUBC-1 or pVT102-U and wild-type diploid cells DL02 containing pVT102-U were allowed to sporulate by incubation in McClary medium (1% potassium citrate, 0.25% yeast extract, 0.1% glucose) for 5 days. The amount of sporulation was examined each day.  39  Materials and Methods 5. METHODS FOR TRANSGENIC STUDIES  5.1. Construct for UBC-l/LacZ The construct p E X P l is an in-frame translational fusion of the second exon of UBC-1 and P-galactosidase.  Plasmid pC5.0 containing the 5 kb genomic EcoRI clone of UBC-1 was  digested with Pstl and BstYI and this fragment was inserted into the Pstl and BamHl sites of the pPD16.51 vector (Fire et al., 1990). p E X P l contains 2683 bp of sequence upstream from the A T G start codon, the first exon and intron and the first amino acid of the second exon. The 3' U T R and polyadenylation site are provided by the 3' U T R of the Unc-54 gene present in pPD 16.51.  5.2. Establishment of C. elegans transgenic strains Plasmid D N A for microinjections was prepared as described in section 2.5. Plasmid D N A was diluted to 200 ng/pl in dH20. D N A was microinjected into the gonad of C. elegans rol-6 null along with the marker plasmid pRF4 containing the rol-6 dominant allele sul006 by M e i Zhen, as described previously (Mello et al., 1991). The rol-6 allele sul006 encodes a mutant collagen which causes the transgenic worms to form an altered body cuticle. This altered body cuticle forces the animal to roll onto its right side, allowing easy identification of transformed animals. Each transgenic animal was placed onto a separate plate and allowed to propagate.  Transgenic lines were considered established i f the selectable marker was  successfully passed on for at least three generations.  5.3. In situ histochemical staining of transgenic strains Transgenic worms containing the U B C - l / L a c Z fusion were washed with 0.14 M NaCl, placed on glass slides and permeabilized by lyophilization and acetone treatment as described in Fire et al. (1990). The worms were layered with 50 pi of staining solution (500 pi total volume containing 250 m M N a P Q , 0.004% SDS, 1 m M M g C l , 0.1 mg/ml Kanamycin, 50 pi 3  4  2  40  Materials and Methods oxidation buffer (21.1 mg/ml potassium ferrocyanide and 19.6 mg/ml potassium ferricyanide), and 6 pi X - G a l (2% in DMSF)) and incubated for 3 hours to overnight at 37 °C in a moist chamber. After staining, the worms were permanently mounted in 80% glycerol, 20 m M Tris pH 8.0, 200 m M Na azide.  5.4 . Identification of P-galactosidase stained cells. Stained worms were examined by Nomarski microscopy. The identity of stained cell types was determined by the size and shape of the nucleus and its position in the animal relative to other nuclei as defined by Sulston and Horvitz (1977) and Sulston et al., (1983).  41  Results RESULTS  SECTION A. CLONING AND ANALYSIS OF UBC-1  1. Cloning of ubc-1 When this work was initiated, the yeast R A D 6 (Jentsch et al., 1987) and the putative wheat homologue E223K (Sullivan & Vierstra, 1989) were the only RAD6 related sequences available. Wheat E223K has recently been shown to be more closely related to yeast UBC8 than to R A D 6 (Kaiser et al., 1994). Since RAD6 and E223K contain C-terminal extensions consisting of either poly-Asp or poly-Glu repeats, a degenerate oligonucleotide primer, OPC5.C (Table 2) was designed to this region. Two nested degenerate primers were designed to match conserved parts of the coding region of RAD6 (OPC8.r and OPC7.r, Table 2). P C R was performed, using these primers, on a C. elegans genomic X g t l l library and a 350 bp fragment was isolated. D N A sequence analysis showed that this PCR fragment encoded a protein very similar to yeast RAD6. This fragment was then used to probe a gridded array of yeast artificial chromosomes (YACs) containing C. elegans genomic D N A . Two positive signals corresponding to Y A C s containing genomic D N A from the left arm of chromosome 4 were detected (data not shown). Cosmids spanning these Y A C s were subsequently screened using the same probe and a single cosmid (C04E2) was isolated (Fig. 2). A 5 kb EcoRI fragment was subcloned from cosmid C04E2 into pBluescriptll (construct called pC5.0). Sequencing of this clone using nested deletions showed that the 5 kb .EcoRI clone contained the complete genomic sequence of the C. elegans RAD6 homologue named ubc-1. The sequence of ubc-1 is shown in Figure 3. The ubc-1 gene contains 3 exons and two introns, the latter being 606 bp and 656 bp in length. These introns are quite large compared to the average size of approximately 50 bp for C. elegans introns (Thomas et al., 1990), and each contains a repetitive element.  Neither of these repeats match any known  sequence in the Genbank database and their function, if any, is unknown. The upstream region of ubc-1 contains a trans-splicing signal 17 bp from the A T G start site. A full length ubc-1  42  Results  Table 4. Oligonucleotide sequences.  Oligonucleotides used for PCR amplification Primer name  Sequence 5' to 3'  b  Position spanned  c  3  SLl.r  GGTTT7AATTACCC7AAGTTTGAG  Binds splice leader  SL2.r  GTTTT7AACCCAGTTACTCAA  Binds splice leader  OPC7.r  GAGGATCCGAAGAATACCCAAACAAACCACC G G T T G  783-806  OPC8.r  GAGGATCCATGTTCCACCCAAACGTATA T T T C G T  828-848  OPC5.C  GAGGATCCITCITCITCITCITCITCITC  Binds poly-Asp or poly-Glu  DL3.r  GAGGATCCATGACGACGCCCAGCCGT  DL4.C  TCCATCTTCAAACGGGGTTTGTTGTGG  DL5.C  AAGCTTTTAAGCATTCGATCC  DL7.C  CGTCTACGGCTGGGCGTCG  A152.C  GGAAGCTTTCAGAAATTGAGCCAGGACTGCTC  A169.C  GGAAGCTTTCATTCTTCAATTTCCACGTCATCC  1-24 729-756 1823-1838 5-23 1039-1044 and 1700-1714* 1744-1765  Oligonucleotides used for Mutagenesis Primer name  Sequence 5' to 3' b  Position spanned  0  3  R162.C  AATTTCCACGTCATCCCTGAGCACTGCGTCGCC  1727-1759  A88.C  CTGTAGAATATCCAGAGCAATTGATCCGTCCGC  850-882  Primers suffixed with an r are sense stranded, while those suffixed with a c are the complementary strand. Restriction sites are underlined; nucleotides changed for mutation are shown in bold. The position spanned refer to base numbers on the C. elegans sequence shown in Fig. 2. * This oligo spans the 2nd exon of ubc-1 a  D  c  43  Results  Y41B8 ZC67  R07C4  C04E2  Chr IV  -3.0  CO  CL  E w o  i—r  Figure 2. A)  o •a o  1  CO  o 3  •  co •  i c  5  T>  /  i i i I i i i i i i i i i I i i i i i i i i i -2.0  -1.0  i  i r  0.0  Mapping of ubc-1 to Chromosome IV.  Dot blot of DNA from cosmids ZC67, R07C4 and C04E2, spanning the yeast artificial  chromosome Y41B8 which contains the ubc-1 gene. The dot blot was hybridized with the complete ubc-1 cDNA. B) Location of ubc-1 in the left arm of chromosome IV. The adjacent genetic markers are also shown.  44  aaattttcaaagaaaaatttgacatttttggcaattttccagcattttcatttaacataaactgaattttttacgaaaca -321 ttttcgaaagtttccaatttttacggaaattatattccaaatttgcactaaaatacgaatttttttgggaaattccaatt -241 ttctacctaatttttcgatttttgcaggaagcttgctggatcgtcggcagaagttcaacaactcacacaaattgctcaac -161 Hindlll ttttgcattattgtcfaataaa|tgttaaaaaatattttctttaattttttgattttttaaaggttgccgtaccttttttca -81 t a c t t g t t c t a g c a t t t t t c t g c a t t t t t t c g a a t t t t t a a c c t a a t t t t c a c 4 t t t t t t g c a j g a g t t a g g t t a t c a a t -1  ATG ACG ACG CCC AGC CGT AGA CGT TTG ATG AGA GAT TTT AAG AAA CTT CAG gtgagttttgaa 63 M T T P S R R R L M R D F K K L Q 17 atttttggcccgaaaatttggctttctttgaacattagagaacatttgcaacaaaaattggttttttccagaaaaaatta gatatttttgggatttttgataaatttctcgtgaaatttttaaaattaaaattgccaaaaaatcgccgaaaatatccata aaaacggccgaaaatgtccaaaaaatcgccgaaaatttccaaaaaaaaatcgccgagaattttccaaaaaaattgccgaa ttttccaaaaattcgtcgaaattctccgaaaaatcgcctaaaatttcaaaaatatcgctgaaaattaccaaaaaatcatc gaaagtttccttttttcggccgaaaaacacaaaaaaattgcccaaaatttccgaaaaatcgtcgaaaattaccaaaaaat cgtcgaaattaccaaaaaaaaaatcacttaaaattaccaaaaaacggctcaaaatcattaaaagattgctcaaaatttcc aaaaaaaatcgctcaaaatttaaaaaactgaaaattttccaaaagaaaggtttcttttaatttccaaaaaaaatcgctct aaatccccaaaaaaacgaccaaatctttcag  143 223 303 383 463 543 623  GAA GAT CCA CCA GCA GGA GTA TCA GGT GCA CCA ACA 690 E D P P A G V S G A P T 29  GAA GAT AAT ATT CTC ACA TGG GAA GCA ATA ATT TTT GGA CCA CAA GAA ACC CCG TTT GAA I L E D N T W E A I I F G P T P F E Q E  750 49  GAT GGA ACA TTC AAA TTA TCA CTG GAA TTT ACT GAA GAA TAT CCA AAT AAA CCG CCA ACC D G T F K L S L E F E Y P N K P P T T E  810 69  GTC AAA TTT ATT TCC AAA ATG TTC CAT CCA AAT GTG TAT GCG GAC GGA TCA ATT TGT CTG K I S K M V F F H P V Y A D G S I © L N  870 89  GAT ATT CTA CAG AAT CGA TGG TCT CCG ACG TAT GAT GTT GCC GCA ATT CTG ACA TCG ATT D I L R W P I L T S I T Y D V A A Q N s  930 109  CAG TCG TTG CTC GAC GAG CCC AAT CCA AAT TCA CCG GCC AAC TCA CTT GCC GCA CAG CTT L L D E P S N P A N S L A A N S P Q Q L  990 129  TAT CAA GAA AAT CGA CGG GAA TAT GAG AAA CGT GTT CAG CAG ATT GTT GAG CAG gtacacaa 105; N R R Y E E Y E K I V E R V Q Q Q Q 147 cccj;2aattttg2atg_aaaatc3gcgaaattagagctcaaatattgaaaatttggcagtttttgacccgaaatcgagaaa tttcaccccaaaaattgaaatttggctgaaaatcgataacatttaagttgaaatacgaaaattcttaaattttcatctaa tgtatgcaaaatttggctttttgtggttcaaaatcgtaaaattttaccctaaatgtggaaatttagctgaaaatcgatga aaattgagttaaaattaaaaaattttggaatttttatgccaaaactgaaattttgagaaaaattaaacgtttggptgaaa ttcggctgaaaataggcgaaattttttgcgaaatatgaaaaatctgaatttttatgccaaaattgagattttttttccga aaaattgctgaattttggctgaaaatggctgacatttcaagcaaaaataatttttttttttttgaattttgcaaaaaaga accgaaatttgaggctaaaaattaaaaattagaaattttttgcttaggttcaggcttaggcttgggcttagtcattggcc tggacttaagctaggcctagaagcctaggcttcgacgaagctgaaaaaacacaaaaaaagttccaaaaattctataattt  1132 1212 1292 1372 1452 1532 1612 1692  tttccag TCC TGG CTC AAT TTC GGC GAA AAC GAG GGC GAC GCA GTG CTC AAG GAT GAC GTG 1753 S W L N F G E N E G D A V L K D D V 165 GAA ATT GAA GAA ATT GCT GCT CCA GGA GCA AAT GAT GCA GAC GAT GAC CGT ATG GAT GAA 1813 E I E E I A A P G A N D A D D D R M D E 185 GGA GCC AGT GGA TCG AAT GCT TAA attttcaggaatttttctgaaatttttctaccccaaaaatcatctgaa 1885 G A S G S N A * 193 atcaaaagcttttcccatcatccccgtaaaagaaatttcgaaaaaaaatcaattttttttttttgaaatttttcaatttc 1965 Hindlll cccccacatttttctctcaacacaatcgatccctttgaaaattttttcttctcgtttattcattttttttgtattttttc 2045 cggaacactttaagatacggtagtttttttttgtatatatttatacacccagtcatctctctctctctctctctctctct 2125 ctctctgtcttttgttgtttacatagatgaggattttttcccggtgaaaattggctgaaaatcggaaatttttgacctta 2205 aaaactgaaaaaattgtgaaatttcaagaaaaaatcacgatttttgactgaaaaacagctaaattttgcggattttcggc 2285  45  Results  Figure 3. The nucleotide and derived amino acid sequences of the ubc-1 gene of C. elegans. The first nucleotide of the initiator methionine is designated as position 1. Exons are shown in upper case, introns and flanking regions in lower case. The repeated elements found in the introns are underlined. The SL2 splice site and the upstream polyadenylation signal are boxed. The putative active site cysteinyl residue is highlighted. Genbank accession # U08139.  46  Results cDNA, approximately 1.7 kb in length, was isolated as part of the C. elegans genome sequencing project (Wilson et al., 1994), and was a gift from Dr. Bob Waterston. The c D N A contained 20 base pairs of sequence 5' to the A T G start codon of ubc-1. This 5' sequence includes the terminal 4 base pairs of the SL2 splice leader sequence (CAAG) which suggest that the SL2 splice acceptor site in the primary R N A transcript is at base pair -17.  2. Comparison of UBC-1 and its homologues from other organisms Ubc-1 encodes a 192 amino acid protein (calculated M r of 21,500 Da) which shares striking identity with RAD6 (66%) as well as with other RAD6 homologues, including S. pombe rhp6 (70%), Drosophila melanogaster Dhr6 (83%) and the two human homologues H H R 6 A +  and HHR6B (84% and 83% respectively) (Fig. 4a). UBC-1 contains both the highly conserved amino terminal region, necessary for protein degradation via the N-end rule (Watkins et al., 1993), as well as the cysteinyl residue at position 88 which has been shown to be essential for E2 activity (Sung et al., 1990). However, UBC-1 is distinct in being the only known R A D 6 homologue, other than R A D 6 itself, to contain a carboxy-terminal extension. Although the UBC-1 tail is different from that of RAD6, it does contain a large number of acidic amino acid residues (see Table 3). Like the C-terminal tail of R A D 6 (Sung et al., 1988), the UBC-1 tail may be involved in the specific targeting of proteins for ubiquitination.  3. Cloning of the ubc-1 homologues from A. suum and C. briggsae To determine if the C-terminal extension of UBC-1 is unique to C. elegans, P C R using nested oligonucleotide primers OPC7.r and OPC8.r in conjunction with oligo dT or a vector specific oligonucleotide was performed on cDNAs of two other nematode species, Ascaris suum and Caenorhabditis briggsae. The PCR products generated encoded the C-terminal portion of the R A D 6 homologues of both organisms (Fig. 4a). Both the C. briggsae and A. suum UBC-1 homologues contain a C-terminal extension. These proteins are nearly identical to C. elegans UBC-1 within the core of the E2, but the C-terminal tails are quite different. The first 18 amino  47  Results  o  O i  J SC  o  I  I  I  w  a  I  Q  I  I CO I  H >  >  I  I I  o  Pi  i  i  i  Q  I  J  tf I  LD  I  o  I  >> 23 2  a  CO  p-j  «  a  a  EH  CO CO D ft O < CH  Q  [C51  H  o  Q  CN  H  I  I I  H  I  I  I  I  CH I  i i  o co  C 5  H  I  I  rfl O  • s w  I I I I  • co I  Ol  EH  CO  EH W CM  1Q  w CM Pi P  H  o  O CTi  1Q' P i C O  W  w  I  I  rtj <C W CO CO  >H  . o  I H I I H W W I I I " I 2 2  tf  O  to tC CO to bi ,— R R o CU CU R a •H •H <o .—  0.  M  E^  CO cu 0  to to tu  H!  H I  b  <;  PQ  D,  q  tf tf  SC SC  |j  iJ  o  a  to  I  C5(3C3  to  "r<  <u tn SH < D CD U q>  o  +  H  xi u  to  •H  UJ  n; q  ffl tf tf  2 2 2 CJ CJ  to to O  +  <C  VO VO VO VO  tf 0  SC SC Xi Xi SC SC Q U  >H  ft  H  VO Q  1 O  ^  CJ  T-H < H 1  O  •3 -9 tf 3 S3 ^  1  CO  ~ co to to bi R 0  qD C  CD  q  •H  to  (C  (0  CU  IS  ^ q  •H  DH  to to  g  < ffl tf tf  S3  sc sc a  48  JH  SC ffi ^C  UJ  q  cu tn <D  01  ••s  CU •H 3 SH CJ (0 to X5  CO co CJ  ft  ,3  U  CD M >H CU X) O CJ «<J  to b)  CU Is. <d O D<  8. Si  0  to n>  . •H  +  CJ  XI  (0  •H  .  VO Q  <!  o  CU CO tf q to  CD  4J  CU CO  —  to to bi to w CI CI 0 to H R CD CD d CD -i> n — bi *£} & • H ••H. ta cu b> s Q. £^ M fl> 3 ft! 05 cu O CU H 3 >H to to 6 Q< O <D to -Q  1  U XI  WWW  CD  CU  to  EH  >>  H  is  .  CD •U  • •  |Q. P i M  CO to I I  I  tf tf SH  CO to  ft  o  Pi  •  a  l  CD  VO vo VO VO vo P u  sc sc  • C5 ' CJ  Q co Q H  „—  Q) JO  (0  I  CH EH  VD  Q  EH  S  sn < w w  o  i  i i CO CO  ^H  • •  CM co  CO CO I CO CO CO I  O 00  i i  P i  ^5-13  h  i i i i i  «  O O  Pi  tf  i  H  Q cn  Ol  I  I I co cu I p CO I CO CO I I I I I I I I I <!  w  Q «>!  p? Pi <! Q W O to  §§ 8 I i  EH  2 tf  tf  o  s s  CXI  a co  EH  H I I > S I I rij W I Ol H 2 ! 2 I  O  i  i y  I H  I I  i cn i  i  :iE  I  o  En H J  I  i  i  w 15  I I  i  i SC  I Pi  I  I I  vo  I  H  1 u  tf 3  O  rH 1  1  U  U  S3  3  X) X!  ffl  Results  Figure 4. Protein sequence comparison. (A) A comparison of the RAD6 homologues from C. elegans, human, D. melanogaster, S. pombe, S. cerevisiae, C. briggsae and A. suum. Identical amino acids are indicated by dashes. The sequences of the UBC-1 homologues for A. suum and C. briggsae include only the Cterminal portion of the coding region. (B) Alignment of the C-terminal extensions of C. elegans, C. briggsae and A. suum UBC-1. Identical amino acids are boxed and conserved negatively charged amino acids are shaded. Gaps in the alignment are represented by periods.  49  Results acids of the tails are nearly identical among the three homologues (Fig. 3B), suggesting that this region may play some important role. Like the S. cerevisiae RAD6 tail, all three nematode UBC-1 tails are highly negatively charged (see Table 3).  Table 5. Net charge of carboxy-terminal tails  length of tail (aa)  net charge  .V. cerevisiae RAI)6/l,BC2  23  -20  C. elegans UBC-1  40  -12  C. briggsae UBC-1  46  -13  A. suum UBC-1  53  -10  4. Complementation of S. cerevisiae rad6A cells by ubc-1 The structural similarity of UBC-1 to RAD6 suggested that ubc-1 might be able to functionally complement RAD6. We therefore examined the ability of ubc-1 to complement the UV sensitivity and slow growth phenotypes of rad6A yeast, as well as its ability to restore the ability of rad6A diploid yeast to sporulate.  4:1. Complementation of UV sensitivity Ubc-1 is able to complement the UV sensitivity phenotype of rad6A yeast cells. The ubc-1 yeast expression vector pYUBC-1, which expresses ubc-1 from the constitutive ADH1 promoter, was used to transform the rad6A strain KM67. Expression of ubc-1 resulted in increased UV resistance of the rad6A strain (Fig. 5). After irradiation at 20 J/m 2 , the rad6A strain was rendered inviable, while the ubc-1 transformant showed a significant level of survival.  50  Results  Figure 5. Complementation of UV sensitivity in the rad6A strain of S. cerevisiae by C. elegans ubc-1. Wild-type, rad6A, and ubc-1 expressing rad6A cells were irradiated with 0, 5, 10 and 20 J / m of U V light and incubated in the dark to avoid photoreactivation. 2  51  Results  A  T i m e (hrs)  B Doubling lime (h) Wild-type  3.5  rad6A  4.0  rad6A + ubc-1  3.0  Figure 6. Complementation of rad6A slow growth phenotype by ubc-1. A)Wild-type (O), rad6 (•), and rad6 null yeast expressing ubc-1 (0) were grown on uracil deficient media and the growth rate observed by the optical density of the cultures at 600nm. B) Doubling times of wild-type, rad6A, and rad6A yeast expressing ubc-1.  52  Results  4.2. Complementation of slow growth phenotype As shown in Figure 6, ubc-1 is able to complement the slow growth phenotype of rad6A yeast. Rad6A cells expressing ubc-1 under the control of the ADH promoter grew faster than did the rad6A cells alone. Interestingly, the rad6A yeast expressing ubc-1 also grew slightly faster than wild-type yeast. This may be due to a beneficial effect of the overexpression of ubc-1 caused by the strength of the A D H promoter.  4.3. Complementation of sporulation R A D 6 has been shown to be required for diploid cells to undergo sporulation. Sung et al. (1988) demonstrated that the acidic tail of RAD6 is required for sporulation as constructs lacking it failed to sporulate.  Since UBC-1 also has an acidic tail, its ability to complement the  sporulation defect in rad6A diploids was examined. When p Y U B C - 1 was transformed into rad6A diploid yeast, it failed to complement the sporulation defect. Diploid rad6Alrad6A cells transformed with ubc-1 sporulated very poorly (~A%), at a level comparable to that of the parental strain (data not shown).  5. Southern and Northern blot analysis of ubc-1 Radiolabeled ubc-1 c D N A detected a single band of 1.7 kb on Northern blots of C. elegans embryo total R N A (Fig. 7B), suggesting that ubc-1 produces a single mRNA species. In addition, ubc-1 is a single copy gene in C. elegans. Genomic Southern analysis was performed on EcoRI and Hindlll digested C. elegans genomic D N A (Fig. 7A). The 5 kb EcoRI band corresponds to the .EcoRI band detected in the cosmid C04E2. Hindlll digestion gave two bands, consistent with the presence of a Hindlll restriction site in the 3' non-coding region of the ubc-1 gene (at 1891bp, Fig. 3).  53  Results  B Kb  23 . 0  Kb —  9.4 — 6.6  fc^-ji  —'  4.3 2.3 2.0  0.56  — —  9.5 __ 7.5  —  4.4  —  2.4  —  1.4  —  —  0.24  Figure 7. Southern and Northern analysis of ubc-1. (A) Southern blot analysis. Genomic D N A (4 pg) prepared from C. elegans embryos was digested with EcoRI and Hindlll (lanes 1 and 2 respectively). The probe was a 1.7 kb fragment containing a complete ubc-1 cDNA. (B) Northern blot analysis. Total cellular R N A (10 pg) prepared from C. elegans embryos was separated by electrophoresis on a 1.2% formaldehyde gel and probed with a 1.7 kb fragment containing a complete ubc-1 cDNA.  54  Results o  SI £ HI  CM  CO  ^  _l _l _l  5 <  Ubc-1 Actin-1  B 100.00  c  2  'a  CD i—  Q.  50.00  X LU  0.00  Embryo  L1  L3  12  L4  Adult  Life Stage  Figure 8.  Expression of ubc-1 mRNA throughout development.  A) A Northern blot containing 14 ug of total C. elegans R N A from each of the major life stages was probed with c D N A fragments from ubc-1 or the actin-1 gene. B) The relative expression levels of ubc-1 in the life stages when normalized to actin as determined by scanning.  55  Results  6. Temporal expression of ubc-1 mRNA transcripts Northern blot analysis was performed on total C. elegans R N A prepared from embryos, the larval stages L1-L4, and adults. The 1.7 kb ubc-1 c D N A was used as a probe. As seen in Figure 8a, ubc-1 is expressed at all life stages. In order to examine the relative amount of ubc-1 expressed at the various life stages, the blot was stripped and reprobed with the C. elegans actin gene act-1, which is constitutively expressed throughout all life stages (Krause & Hirsh, 1986). Figure 8b shows that when normalized to actin, ubc-1 is expressed constitutively at similar levels in all life stages of C. elegans.  7. Ubc-1 is trans-spliced by SL2 In C. elegans, many gene transcripts undergo both cis and trans-splicing (Blumenthal & Thomas, 1988). Trans-splicing in C. elegans involves transfer of either the SL1 or SL2 splice leader onto a 3' acceptor site at the 5' end of an mRNA. Recent studies indicate that SL1 is added to the 5' end of many mRNAs, while SL2 is used in the processing of polycistronic mRNAs from gene clusters which are co-transcribed and cleaved into individual mRNAs (Spieth et al., 1993). To determine if the ubc-1 transcript is trans-spliced, P C R was performed on c D N A using oligonucleotides corresponding to either the SL1 or SL2 sequence (Table 1). Figure 9 shows that the ubc-1 transcript is trans-spliced to SL2, but not to S L 1 . This suggests that ubc-1 is transcribed as part of a polycistronic unit and raises the possibility that other genes may be cotranscribed with ubc-1.  8. Is ubc-1 transcribed in a polycistronic message? The presence of a SL2 splice leader at the 5' end of the ubc-1 transcript suggests that ubc1 should lie within an operon. While the genomic sequence upstream of ubc-1 does contain a canonical polyadenylation site at -140 bp, examination of the upstream 2600 bp failed to locate any candidates for genes within this region. In addition, Northen blots probed with fragments  56  Results  bp 1053  —  506  —  344  —  220 154  — —  Figure 9. Ubc-1 mRNA is frans-spliced to SL2. PCR was performed on C. elegans c D N A using oligonucleotide DL4.c which is complementary to nucleotides 729 to 756 of ubc-1 and either the oligonucleotide S L l . r or SL2.r as indicated. Control reactions used dH^O instead of cDNA. The products were separated on a 2% agarose gel and blotted as described in Materials and Methods. The blot was hybridized with the end-labeled oligonucleotide DL7.c which is complementary to nucleotides 5 to 23 of ubc-1. Control P C R reactions of C.elegans c D N A using oligonucleotide SL2.r alone did not yield the indicated band.  57  Results spanning -2683 bp to -1699 bp and -1643 bp to -212 bp of the upstream region of ubc-1 failed to detect any mRNA signal (data not shown). This suggested that there may not be a gene present in the upstream region of ubc-1 and therefore that ubc-1 may not be part of an operon.  8.1. Expression patterns of the UBC-l/LacZ transgene As noted above, probes prepared from upstream regions of ubc-1 failed to produce any signals on Northern blots, suggesting that ubc-1 may not be transcribed as a polycistronic message. In order to examine this possibility further, the upstream region was examined for promoter activity. If ubc-1 is indeed transcribed as part of a polycistronic message, it would likely not contain functional promoter elements within its immediate upstream region.  8.1.1. Establishment of transgenic lines The U B C - l / L a c Z fusion construct p E X P l , containing 2683 bp of sequence upstream from the A T G start codon, the first exon and intron and the first amino acid of the second exon (see Fig. 10a), was injected by Mei Zhen into the gonad of rol-6 null C. elegans along with the dominant rol-6(sul006) selectable marker plasmid pRF4. Four stable transgenic lines were isolated by this method and named U B C - l e x i - UBC-lex4.  8.1.2. Expression patterns of the ubc-l/LacZ fusion. The transgenic strains were permeabilized, fixed and stained with X-gal as described in Materials and Methods. Ubc-l/LacZ transgenic lines U B C - l e x i - UBC-lex4 showed strong |3galactosidase staining predominantly in intestinal nuclei, suggesting the presence of a gutspecific promoter element within the ubc-1 sequence (Fig. 10b). The expression of the ubc1/LacZ constructs was visible throughout all larval stages and within adults as well, but no staining of embryos within gravid adults was ever seen. The construct contains a nuclear localization signal which restricts the fusion protein to the nucleus, therefore only the nuclei stain (Fig. 10a).  58  Results  A NLS  Figure 10. LacZ expression of the pEXPl transgene in C. elegans. (A) The p E X P l expression construct consists of an in-frame translational fusion of 2683bp of upstream sequence as well as the first exon, intron and first amino acid of the second exon of ubc-1 with the E. coli LacZ gene. The gray rectangles represent the UBC-1 exons, the white rectangle indicates an intron and the LacZ coding region is shown as a black rectangle. N L S is the SV40 nuclear localization signal.  (B) L 3 larva showing expression of (3-  galactosidase within intestinal cell nuclei. Histochemistry was performed as described in Materials and Methods.  59  Results  SECTION B. FUNCTIONAL STUDIES OF UBC-1  1. UBC-1 shows E2 activity UBC-1 was shown to be an E2 by its ability to form a thiol-ester linkage with ubiquitin. When histidine-tagged UBC-1 (HisUBC-1) was combined in vitro with wheat E l , A T P and bovine ubiquitin, a HisUBC-1-ubiquitin conjugate of 36 kDa was observed (Fig. 11). This molecular mass is consistent with a single ubiquitin bound to HisUBC-1 (26 kDa) This conjugate was disrupted by 150 m M (3-mercaptoethanol (Fig 11, lane 2), indicating that the ubiquitin-UBC-1 attachment was consistent with a thiol ester bond.  2. UBC-1 fails to ubiquitinate histone H2B in vitro Sung et al. (1988) have shown that the acidic C-terminal tail of R A D 6 is essential for the ubiquitination of histones H2A and H2B in vitro. Since C. elegans UBC-1 has a C-terminal tail, the ability of UBC-1 to ubiquitinate histones in vitro was examined. In several attempts using bovine H2B, no ubiquitin-histone conjugates were seen. The recombinant UBC-1 used in this assay contained a polyhistidine tag at the N-terminus. In order to discount the possibility that the histidine tag may have affected the function of HisUBC-1, a similar reaction was performed using non histidine tagged UBC-1. Again, no histone ubiquitination was seen (data not shown). Although such a negative result is of necessity inconclusive, it does suggest that the tail of U B C 1 may not confer targeting specificity to histones.  3. UBC-1 is stably monoubiquitinated in vitro As shown in section 1, in the presence of bacterially expressed wheat E l , HisUBC-1 is capable of forming a thiol ester bond with ubiquitin, which is a prerequisite for E2 function. When this experiment was repeated using non-histidine tagged UBC-1 and C. elegans extract as a source of E l , in addition to the expected ubiquitin thiol ester, UBC-1 also formed a thiol  60  Results  Figure 11. Recombinant HisUBC-1 forms a thiol ester linkage with ubiquitin. Immunoblot of a 12.5% SDS-polyacrylamide gel of ubiquitin conjugation assays. The reactions in lanes 1 and 2 contained 8 pg of recombinant wheat E l lysate, 7 p M HisUBC-1, 1.7 p M bovine ubiquitin, 50mM Tris pH 7.5, 0.1 m M MgCl2, 0.1 m M DTT, 1 m M ATP, and 1U inorganic pyrophosphatase. In lanes 3 and 4, bovine ubiquitin was omitted. The samples were run with (+) or without (-) 360mM (3-mercaptoethanol as indicated. Blotted proteins were probed with anti-ubiquitin polyclonal (IgM) antibody and visualized by enhanced chemiluminescence using protein A-horseradish peroxidase conjugate.  61  Results  p-Merc kDA  97 — 68 — 43 —  29 —  18.4 —  Figure 12. UBC-1 forms thiol sensitive and insensitive adducts with ubiquitin. Ubiquitin conjugation reactions were performed using 6 uM UBC-1, 50 m M Tris pH 7.5, 1.5 m M ATP, 14 uM [ I]ubiquitin and 35 ug C. elegans lysate. Samples were run on a 15% 125  SDS-polyacrylamide gel with or without (3-mercaptoethanol treatment (360 mM) as indicated, and visualized by autoradiography.  62  Results insensitive ubiquitin adduct (Fig. 12). The 30 kDa band was determined to be the thiol-ester adduct based on its sensitivity to (3-mercaptoethanol. The molecular mass of this protein is consistent with that of a single ubiquitin bound to UBC-1. In addition to this 30 kDa band, an additional band with an apparent molecular mass of 34 kDa was seen. The latter was insensitive to (3-mercaptoethanol, suggesting linkage of a ubiquitin moiety to a lysyl residue in U B C - 1 . The relative decrease in intensity of the 34 kDa band upon treatment with reducing agent suggests the presence of an additional thiol-sensitive species at this location. This is likely UBC-1 containing ubiquitin moieties bound both at the active site cysteine and a lysyl residue. The difference in the observed molecular masses of these two types of adducts may be due to steric effects of stable ubiquitin binding on the migration of the protein. Upon re-examination, the histidine tagged UBC-1 assays using wheat E l also revealed the presence of a thiol insensitive ubiquitin adduct, but this was formed much less efficiently (data not shown). A third ubiquitin-conjugated band of 38 kDa was seen in non-reduced samples (Fig. 12). This band had a molecular mass consistent with 2 ubiquitins bound to UBC-1 and was labile to reducing agents, suggesting that it was linked to UBC-1 via its cysteinyl residue. This band as well as a tri-ubiquitin band occurred very infrequently in conjugation assays carried out with C. elegans extract as a source of E l . This suggests that UBC-1 has the ability to form multiubiquitin chains on its active site cysteine. These species are seen at very low frequencies, likely due to cleavage of the chains by ubiquitin hydrolases within the extract. The ability of UBC-1 to form multiubiquitin chains remains to be verified using purified C. elegans E l .  4. UBC-1 is ubiquitinated in its carboxy-terminal tail UBC-1 contains 8 lysyl residues which could potentially form isopeptide bonds with ubiquitin. Seven of these residues lie within the core of UBC-1 and one is located in the tail. Ubiquitination assays performed on UBC-1 constructs UBC-1A169 and UBC-1A152, which contain partial and complete deletions of the carboxy-terminal tail respectively (Fig. 13), showed that while both formed the Ub-UBC-1 thiol-ester, UBC-1A152 did not form the thiol stable  63  Results  88 c  UBC-1  162  K ' 192  c  UBC-1 A169 UBC-1 A152  K  169 ;  C  152  UBC-1 A88  A  K wm ' 192  UBC-1 R162  R mm.  192  Figure 13. UBC-1 derivatives used in this study. The E2 core domain is shown in grey, the tail is shown in Crosshatch. The white box denotes the region of strong identity within the tail between UBC-1 and its homologues from C. briggsae and A. suum. The positions of the active site cysteine and lysine 162 are indicated. UBC-1A88 and UBC-1R162 indicate the positions of residues changed in mutated U B C - 1 .  64  Results  +  -  +  UBC-1 A169  kDa  68  —  43  —  -  +  p-Merc  A152  Figure 14. Mapping of the autoubiquitination site to the tail of UBC-1.  Immunoblot of a 12.5% SDS-polyacrylamide gel of ubiquitin conjugation assays performed using 0.6 p M UBC-1, UBC-1A169 and UBC-1A152. The reactions were run with (+) or without (-) 360mM (3-mercaptoethanol as indicated. The blot was probed with anti-UBC-1 antibodies and visualized by enhanced chemiluminescence using peroxidase conjugated goat anti-mouse secondary antibody.  65  Results  -p Merc CM (D i—  DC  ,1  +F3 Merc CVJ  U ID CQ T D DC  O —  DQ  UBC-1-Ub UBC-1-S~Ub UBC-1  B C . elegans C. briggsae suum  GENEGDAVgjKO. . . DVEIEEI. . . . A A P I G T A N D . . . . A B D ) D I R M D E G | A S G S N A GENEGDAVTKDGGG DVDP EEI P T S N G S S G G|AJE L G C R D D E E R M D E A E P A D R M H K GENEGJEI Sr^fTT^NENEREHDqAJQM. . P S A S G A I A S | G J R A P P S T  Figure 15. Lysine 162 is involved in stable ubiquitination of UBC-1. A)  Immunoblot of a 15% SDS-polyacrylamide gel of ubiquitin conjugation assays  performed on bacterial lysates containing expressed UBC-1 or UBC-1R162. The samples were run with or without 360mM P-mercaptoethanol as indicated. The blot was probed with antiUBC-1 antibody. The positions of UBC-1, as well as the thiol insensitive (UBC-l-Ub) and thiol sensitive (UBC-l-S~Ub) ubiquitin conjugates are shown. B) Protein alignment of the carboxyterminal tails of UBC-1 and its homologues from the nematodes C. briggsae and A. suum. The location of lysine 162 is indicated.  66  Results  -  +  p-Merc  kDa  200 — 68 — 43 —  18.4 —  Figure 16. The autoubiquitination of UBC-1 occurs intramolecularly. Ubiquitin conjugation assays were carried out using 0.5 p M of purified [ S]-labelled 35  U B C - 1 A 8 8 and unlabelled U B C - 1 .  Reaction mixtures were run on a 12.5% SDS-  polyacrylamide gel and developed by autoradiography.  The samples were treated with or  without P-mercaptoethanol as indicated. The upper, major band represents U B C - 1 .  Fainter  lower bands are likely proteolytic fragments of UBC-1. Note that no band corresponding to mono-ubiquitinated UBC-1 is seen.  67  Results ubiquitin adduct (Fig. 14). The failure of UBC-1A152 to form a thiol stable ubiquitin adduct pointed to lysine 162 as the possible site of ubiquitin attachment. Lysine 162 was mutated to arginine and the resulting mutant protein was expressed in E. coli. Ubiquitin conjugation assays on U B C - I R 162 showed that it could form a thiol-ester with ubiquitin, but failed to form a thiol stable adduct (Fig. 15a).  This demonstrated that Lys 162 is the residue which is stably  ubiquitinated in UBC-1. It is interesting to note that the UBC-1 homologues from the nematodes A. suum and C. briggsae also have a conserved lysine at position 162 (Fig. 15b), suggesting that they too may form stable ubiquitin adducts at this location.  5. UBC-1 autoubiquitinates itself in an intramolecular reaction In order to determine if the ubiquitination of UBC-1 proceeds by an intermolecular or intramolecular mechanism, the active site cysteinyl residue of UBC-1 was mutated to alanine. This UBC-1A88 mutant should be incapable of forming a thiol-ester with ubiquitin and therefore should not ubiquitinate itself. This mutant could, however, act as a target for intermolecular ubiquitination by wild-type UBC-1 or other E2s in a C. elegans extract. Fig. 16 shows that UBC-1A88 failed to form a thiol stable ubiquitin adduct, suggesting that UBC-1 is ubiquitinated by an intramolecular reaction and not by other E2s present in the C. elegans extract. However, another possible interpretation of this result is that the autoubiqutination of UBC-1 does proceed via an intermolecular reaction, but that this reaction requires the presence of a thiol-bound ubiquitin on the active site cysteine of the opposite UBC-1 molecule. A possible way of distinguishing between these two mechanisms would be to perform a similar experiment with the active site cysteine mutated to a serine. Sung et al., (1991) have shown that in R A D 6 , this mutation allows the formation of a stable ester conjugate between R A D 6 and ubiquitin which cannot be transferred to other proteins. This experiment has not yet been attempted with UBC-1.  68  Results  figure 17. UBC-1 self-associates in vitro. Cross-linking reactions containing either 0 or 1 m M BS3 cross-linking reagent were performed using 200 n M of radiolabeled UBC-1 (30,000 cpm). The cross-linking of UBC-1 was carried out with or without a 10 fold molar excess of BSA. The reactions were separate on a 12.5% SDS polyacrylamide gel and visualized by autoradiography.  69  Results 6. UBC-1 self-associates in vitro When bacterially expressed UBC-1 was run on a G100 superfine gel exclusion column, it eluted at a molecular size of 42 kDa instead of the expected 21.5 kDa. One possible explanation is that UBC-1 may have an abnormally large Stokes radius due to its 40 amino acid carboxyterminal tail. This seems to be the case with the UBC-1 yeast homologue R A D 6 .  Theyeast  R A D 6 tail extends from a globular core and causes R A D 6 to have an aberrantly large Stokes radius (Morrison et al., 1988). Since the observed molecular weight of the eluted UBC-1 was exactly twice that of the predicted molecular weight, a second possibility was that UBC-1 eluted as a dimer. To test whether UBC-1 forms a dimer, chemical cross-linking was performed using the lysine cross-linker B S on [ S]-labelled UBC-1. The addition of 1 m M B S generated a cross3  35  3  linked dimer of 47 kDa as well as higher molecular weight products (Fig. 17). These persisted even when crosslinking was carried out in the presence of a 10 fold molar excess of B S A (Fig. 17), indicating that the interaction was specific. UBC-1 has a molecular mass of 24 kDa on S D S - P A G E mini-gels. UBC-1 dimer should have a molecular mass of 48 kDa and the crosslinked band at 47 kDa is therefore likely a dimer. The next cross-linked product has an apparent molecular mass of 93 kDa, based on more accurate sizing on a 16 cm SDS-PAGE gel (data not shown), and is likely a tetramer. Although less clear due to a complex banding pattern, yeast CDC34 also displays bands in a molecular mass range consistent with dimers and tetramers after cross-linking (Ptak et al., 1994) suggesting that UBC-1 and CDC34 may form similar quaternary structures. While this demonstrates that UBC-1 self-associates to form at least a dimer, it does not rule out the possibility that its elution on the size exclusion column is due to an abnormal Stokes radius, i.e. that the bulk of the protein under these conditions may be monomeric.  7. The tail of UBC-1 is involved in self-association As mentioned above, studies on the S. cerevisiae ubiquitin conjugating enzyme UBC3 (CDC34) have shown that it also self-associates in vitro. Like U B C - 1 , CDC-34 is a type II  70  Results  Figure 18. The tail of UBC-1 is involved in self-association. Cross-linking reactions of purified radiolabeled UBC-1, UBC-1A169, and UBC-1A152 (30,000 cpm) were separated on 12.5% SDS-polyacrylamide gels and visualized by autoradiography. Reactions contained either 0 or ImM B S 3 cross-linking reagent as indicated.  71  Results  Figure 19. Purification of UBC-1 and deleted UBC-1 derivatives. Purified baterially expressed UBC-1 and the deleted forms UBC-1A169 and UBC-1A152 (10 pg each) were separated on a 15% SDS-polyacrylamide gel and stained with Coomassieblue.  72  Results conjugating enzyme and its carboxy-terminal tail has been shown to affect its ability to selfassociate (Ptak et al., 1994) To determine if the tail of UBC-1 plays a similar role, two deletions of this region were constructed, and tested for their ability to form cross-linked products in vitro (Fig. 18). The UBC-1A152 deletion removed the entire tail of UBC-1, while the UBC-1A169 deletion removed a portion of the tail, leaving the first 18 amino acids which were shown to be strongly conserved between the tails of UBC-1 and its homologues from A . suum and C . briggsae. The homogeneity of purified UBC-1 and of the derivatives used in these experiments is shown in Figure 19. As can be seen in Figure 18, deletion of the tail of UBC-1 severely affected its ability to self-associate.  Complete removal of the tail of U B C - 1 , as seen in the UBC-1A152 deletion,  caused approximately an 8 fold decrease in the ability of UBC-1 to self-associate, whereas U B C 1A169 caused approximately a 2 fold decrease in self-association when compared to wild-type. Therefore, the conserved 18 amino acids of the tail do not seem to play a pivotal role in selfassociation, as progressive deletion of the tail decreased the efficiency of self-association in a roughly linear fashion.  Interestingly, the higher complex generated in the UBC-1A169  crosslinking had a molecular mass of approximately 65 kDa, closer to that of a trimer than a tetramer. This suggests that the tail may affect not only the efficiency of UBC-1 self-association, but also the quaternary structure that it forms. The above data suggest that the E2 core of UBC-1 is able to weakly self-associate on its own, and that the tail enhances this ability approximately 8 fold. This is further demonstrated by the observation that when the concentration of UBC-1A152 is increased, the equilibrium shifts further towards dimer formation (Fig. 20). At 700 nM, UBC-1A152 formed crosslinked products approximately half as efficiently as UBC-1 at 200 nM. Like UBC-1A169, the higher complex generated in the 700 n M UBC-1A152 crosslinking reaction had a molecular mass of approximately 60 kDa which more closely resembles the size of a trimer.  73  Results 8. Crystallization of UBC-1 Purified wild-type UBC-1 expressed in E. coli was succesfully crystallized by Nham Nguyen as described in Materials and Methods. The crystallization of UBC-1 proved to be quite slow, requiring 6 weeks for initial crystal formation. These crystals continued to grow for 2 months and reached a final size of 0.4 x 0.2 x 0.1 mm. A representative example of a UBC-1 crystal is shown in Figure 21. Initial X-ray diffraction analysis conducted on this crystal using a Rigaku R-Axis II area detector and a Rigaku RU300 x-ray generator showed that it diffracted to o  approximately 3 A . This crystal proved to be of space group P2i2i2], with unit cell dimensions of a=54.8 A , b=61.6 A , and c=232.1 A.  74  Results  figure 20. Concentration effect on the self-association of the E2 core of UBC-1. Cross-linking reactions of purified radiolabeled UBC-1A152 performed at concentrations of 350 n M and 700 nM. The reactions were seperated on a 12.5% SDS-polyacrylamide gels and visualized by autoradiography. Reactions contained either 0 or ImM B S 3 cross-linking reagent as indicated.  75  Results  Figure 21. Photomicrograph of a crystal of UBC-1.  76  Discussion DISCUSSION  1. UBC-1 ENCODES A RAD6-LIKE UBIQUITIN CONJUGATING ENZYME C. elegans ubc-1 is a single copy gene encoding a 192 residue polypeptide which shares 66% amino acid identity with the S. cerevisiae D N A repair gene RAD6. Ubc-1 is also similar to other RAD6 homologues, including S. pombe rhp6 + (Reynolds et al., 1990), D. melanogaster Dhr6 (Koken et al., 1991a) and the two human genes HHR6A and HHR6B (Koken et al., 1991b). The highest degree of identity is seen within the core of these proteins (Fig. 4). This core region includes the amino-terminus, which has been shown to be essential for protein degradation via the N-end rule (Watkins et al., 1993), as well as the region surrounding the conserved cysteinyl residue necessary for E2 function (Sung et al., 1990). The most intriguing feature of UBC-1 is its 40 amino acid C-terminal tail. Outside of the nematode proteins described here, the only other known homologue with a similar extension is RAD6. The acidic C-terminal tail of RAD6 is essential for sporulation and for R A D 6 mediated ubiquitination of histones H2A and H2B in vitro, yet removal of the tail does not affect the D N A repair function of the protein (Morrison et al., 1988, Sung et al., 1988). These functional domains are reflected in the homologues as well. A l l R A D 6 homologues which lack a C terminal extension are able to complement D N A repair, but not sporulation (Koken et al., 1991a, Koken et al., 1991b). In agreement with these results, C. elegans UBC-1 is also able to complement the D N A repair defect in a yeast rad6 deletion mutant (Fig. 5). Ubc-1 was unable, however, to complement the sporulation defect of the rad6 null mutant, or to ubiquitinate histones in vitro. The tails of E2s distinct structural domains which encode specific functions. The cell cycle determinant in CDC34 is encoded within the tail and this function is transferable, e.g. a chimeric E2 containing the core of RAD6 and the tail of CDC34 can complement a cdc34A yeast strain (Silver et al., 1992). Other examples include UBC6, whose tail targets it to the plasma  77  Discussion membrane (Sommer & Jentsch, 1993), and RAD6, whose tail is essential for sporulation, as noted above (Morrison et al., 1988). It therefore is likely that the C-terminal tail of UBC-1 is required for some function in C. elegans. This conclusion is further supported by the fact that UBC-1 homologues from closely (C. briggsae) and distantly (A. suum) related nematodes also contain C-terminal extensions. A l l three tails, like that of RAD6, contain a very high ratio of negatively charged amino acid residues.  The R A D 6 tail is, however, considerably more acidic than that of UBC-1 and its  nematode homologues (see Table 3). This may explain the inability of UBC-1 to complement the sporulation defect in rad6 null mutants. It is interesting to note that while the conservation within the core of the nematode RAD6 homologues is nearly complete, the tails vary markedly, with the exception of the first 18 amino acids which share strong identity (Fig. 4B). This region of identity may play an important role in the function of the tail. Previous studies on C-terminal extensions of other E2s have shown that the entire tail is rarely necessary to perform its designated function. A n excellent example of this is S. cerevisiae CDC34, which has a 124 amino acid C-terminal tail. Ptak et. al., (1994) have shown that only the first 38 amino acids of the tail are required for CDC34 function. The C-terminal extensions of E2 proteins have been shown to be involved in target recognition (Sung et al., 1988) and dimerization (Ptak et al., 1994), and the C-terminal extensions of UBC-1 and its homologues in C. briggsae and A. suum may perform similar functions in nematodes.  2. BOTH CIS AND TRANS-SPLICING ARE REQUIRED FOR UBC-1 mRNA MATURATION The gene encoding ubc-1 consists of 3 exons and 2 large introns, therefore cis-splicing is required in order to process a completed ubc-1 mRNA. The ubc-1 genomic sequence contains a splice acceptor site (TTTTTGCAG) 17 bp upstream of its translation start site, suggesting that trans-splicing is also involved. The ubc-1 c D N A isolated contained 4 nucleotides at positions -17 to -20 bp which differed from the genomic sequence and were identical to the final 4 bases of the SL2 splice leader. The fact that ubc-1 is trans-spliced was confirmed by P C R of C. elegans  78  Discussion c D N A using oligonucleotides for SL2 and ubc-1. Thus ubc-1 mRNA maturation involves both cis-splicing and trans-splicing to the SL2 splice leader.  3. UBC-1 IS EXPRESSED AT ALL LIFE STAGES Northern blot analysis of mRNAs isolated from the various life stages of C. elegans indicated that a ubc-1 transcript of the expected size is expressed throughout all stages and at approximately equal levels. This suggests that ubc-1 is required throughout development.  4. UBC-1 SELF-ASSOCIATES IN VITRO Crosslinking experiments performed on purified recombinant U B C - 1 clearly demonstrated that this enzyme self-associates in vitro. These results, together with earlier work, suggest that quaternary structure consisting of both homo- and heterointeractions are an important feature of E2s. Early in vitro work showed that some E2s can be purified as dimers by gel exclusion chromatography (Haas & Bright, 1988, Pickart & Rose, 1985). Other in vivo evidence has shown that yeast CDC34 interacts with both R A D 6 and itself and that its homo interaction is required for yeast viability (Silver et al., 1992). Furthermore, the yeast E2s UBC6 and UBC7 also interact with each other in vivo to mediate the degradation of MAToc2 (Chen et al., 1993).  Due to the high level of similarity between E2s, it seems likely that E2-E2  interactions will prove to be a general structural theme among these enzymes.  5. THE CARBOXY-TERMINAL TAIL OF UBC-1 GREATLY ENHANCES SELF-ASSOCIATION The ability of UBC-1 lacking the carboxy-terminal tail to self-associate suggests that there are at least two separate binding domains involved in this interaction. The first domain is found within the catalytic core of UBC-1. This site is responsible for the self-association seen in UBC-1A152.  The existence of this E2 core interaction domain is also suggested by the  observation that yeast UBC4, a type I E2 lacking a tail, has been shown by crosslinking to selfassociate in vivo (Gwozd et al., 1995). The second binding site is found within the tail. The data  79  Discussion presented here show that this tail domain is able to strengthen the self-association of UBC-1 by approximately 8 fold. The tail of yeast CDC34 has also been shown to strongly influence the ability of this E2 to self-associate (Ptak et al., 1994). While the presence of an E2 tail is not a requirement for interaction (Gwozd et al., 1995, Haas & Bright, 1988, Pickart & Rose, 1985), its presence does facilitate homointeraction. The removal of the tails of both UBC-1 and CDC34 (Ptak et al., 1994) greatly decreases their ability to associate as seen by in vitro cross-linking. The presence of a tail may also play a role in hetero-association. Silver et al. (1992) have shown that R A D 6 lacking its tail can interact with CDC34 in vivo. This interaction is dependent on the tail of CDC34. In an analogous situation, yeast UBC6, which has a tail, interacts in vivo with U B C 7 , which does not (Chen et al., 1993).  6. STOICHIOMETRY OF UBC-1 QUATERNARY STRUCTURE A definitive assignment of the stoichiometry of UBC-1 quaternary structure is difficult based on our crosslinking data alone. The crosslinking of UBC-1 in Figure 17 shows species with molecular masses corresponding to monomer, dimer and tetramer.  No bands with the  molecular mass of a trimer were ever captured during UBC-1 crosslinking, either by lowering the concentration of crosslinker or shortening the time of crosslinking. During the crosslinking of a tetrameric protein, one expects to observe the formation of a ladder of products, from monomer to tetramer. The presence of only three distinct bands is therefore inconsistent with the existence of a tetramer, suggesting that UBC-1 may be a trimer. The fact that the third band has a molecular mass corresponding to that of a tetramer may be due to anomalous migration of the band on the SDS-PAGE gel. UBC-1 trimerization is also suggested by the presence of bands of trimeric molecular mass seen in the crosslinking of UBC-1A169 and UBC-1A152. While these data suggests a possible stoichiometry for UBC-1, they are far from definitive. The successful crystallization of UBC-1 may allow a resolution of this uncertainty. If UBC-1 crystallizes in its oligomeric form, a detailed picture of its quaternary structure will result. If on the other hand the crystals are of the monomer alone, determination of its structure  80  Discussion would be equally valuable as it would constitute the only type II E2 crystal structure to date. This will allow an examination of the effect of an E2 tail on its tertiary structure. Another option for determining the stoichiometry of UBC-1 is to run a combination of two isoforms of the protein on a non-denaturing polyacrylamide gel. This would allow the two isoforms of UBC-1 to assemble at random to produce all possible combinations. Due to the different mobilities of the isoforms, each combination of the two isoforms will migrate differently. Therefore, if UBC-1 forms a tetramer, 5 bands should be present on the gel; if it is a trimer, 4 bands should be present. This technique could be performed using histidine tagged UBC-1 and wild-type UBC-1, and should allow for a better determination of the stoichiometry of UBC-1.  7. UBC-1 DISPLAYS UNIQUE UBIQUITINATION PATTERNS The binding of ubiquitin to an active site cysteinyl residue is characteristic of ubiquitin conjugating enzymes. Both UBC-1 and HisUBC-1 are capable of binding ubiquitin through a thiol ester bond. There is preliminary evidence that UBC-1 is capable of binding multiple ubiquitins on its active site cysteinyl residue. As mentioned previously, thiol-linked multiple ubiquitin bands appear infrequently in UBC-1 ubiquitin conjugating assays, likely due to the presence of ubiquitin hydrolases present in the C. elegans extract used as a source of E l in the assays. Confirmation of the multiubiquitin binding capability of UBC-1 will require ubiquitin conjugation assays using a purified form of C. elegans E l , devoid of ubiquitin hydrolases. Cloning of the C. elegans E l is currently underway and should soon allow this experiment to be carried out. The formation of a polyubiquitin chain on proteins targeted for degradation is believed to occur in two possible ways, depending on which E2s are involved in the process. The classical view of multiubiquitin chain formation involves the sequential addition of ubiquitin monomers onto the target protein. A second model was based on the observation that several E2s including bovine E225k (Chen & Pickart, 1990), and human E2EPF (Baboshina & Haas, 1996) are capable  81  Discussion of forming multiubiquitin chains on their active site cysteinyl residue, suggesting that these E2s may transfer a pre-formed ubiquitin chain directly onto the target protein. Examination of the ability of yeast RAD6 to form multiubiquitin chains has shown that it is able to do this on target proteins such as histone H2B (Baboshina & Haas, 1996): however, it has never been shown to form multiubiquitin chains on its active site cysteine. Thus if UBC-1 is indeed able to form free multiubiquitin chains, it would differ significantly from its yeast homologue. Several E2s have recently been shown to undergo autoubiquitination. These include yeast CDC34 and U B C 4 as well as human E 2  E P F  (Baboshina & Haas, 1996). The function of  this reaction is unknown. Both CDC34 and E2EPF multiubiquitinate themselves, suggesting that they may target their own degradation. UBC4, on the other hand, monoubiquitinates itself on lysine 144 via an intermolecular reaction (Gwozd et al., 1995). Suprisingly, mutation of this residue produces no adverse effects in yeast.  One possible interpretation of the  monoubiquitination of UBC-1 is that the protein is damaged and is being targeted for degradation via the ubiquitin-dependent proteolysis system.  This seems unlikely for the  following reasons: Firstly, no thiol insensitive multiubiquitinated species of UBC-1 have been detected. This clearly differs from other proteins degraded in a ubiquitin dependent manner, which are multiubiquitinated. Secondly, ubiquitinated UBC-1 appears stable in C. elegans extracts even after prolonged incubations (data not shown). The monoubiquitination of UBC-1 requires the presence of lysine 162 within the tail and likely occurs via an intramolecular reaction. The tail of UBC-1 is highly negatively charged and probably adopts a random coil structure based on secondary structure prediction. Since the tail of UBC-1 should protrude from its E2 core domain, as is seen in its homologue R A D 6 (Morrison et al., 1988), it is reasonable to explain the intramolecular nature of its ubiquitination by the tail wrapping around and positioning itself near the active site.  The fact that U B C - 1 is  monoubiquitinated intramolecularly raises interesting questions.  For instance, is  monoubiquitination involved in some form of autoregulation? The localization of the site of ubiquitination to the tail, which is involved in dimerization, suggests a possible role for ubiquitin  82  Discussion in controlling multimerization. Ptak et al. (1994) have suggested that interactions between ubiquitin moieties bound at the active sites of E2s may assist in stabilizing E2 dimers. Perhaps the ubiquitination of the tail of UBC-1 plays a similar role. Monoubiquitinated proteins seem to be extremely rare in vivo: when attached to proteins, ubiquitin is predominantly found in multiubiquitin chains. Ubiquitin itself even serves as a target for multiubiquitination (Chen & Pickart, 1990). The fact that mononubiquitinated UBC-1 is stable in C. elegans extracts suggests a novel role for ubiquitin modification of this protein.  8. IS UBC-1 PART OF A POLYCISTRONIC MESSAGE? In C. elegans, many gene transcripts undergo both cis and trans-splicing (Blumenthal & Thomas, 1988). Trans-splicing in C. elegans involves transfer of either the SL1 or SL2 splice leader onto a 3' acceptor site at the 5' end of an mRNA. Recent studies indicate that SL1 is added to the 5' end of many mRNAs, while SL2 is used in the processing of polycistronic mRNAs from gene clusters which are co-transcribed and cleaved into individual mRNAs (Spieth et al., 1993). As ubc-1 is trans-spliced by SL2, this suggests that it should be located within a polycistronic cluster of genes. Spieth et al. (1993) noted that C. elegans genes co-transcribed on polycistronic RNAs are separated by 96-294 bp. While there is a canonical polyadenylation signal located 140 bp upstream of the initiator methionine of ubc-1, examination of the 2600 bp of sequence upstream of ubc-1 failed to reveal any candidates for another genes. To examine the upstream sequence further, Northern blots were probed with several fragments spanning the upstream 2600 bp of ubc-1, but these failed to detect any mRNA signal. There are two possible explanations for the absence of a detectable upstream mRNA. Firstly, there may be m R N A from an upstream gene, but it may be very unstable. The other possibility is that ubc-1 is not transcribed as part of a polycistronic message. If ubc-1 is not transcribed in a polycistronic message, it would require a promoter to drive its transcription. Ubc-l/LacZ fusions showed that a D N A fragment containing 2600 bp upstream of ubc-1 as well as the first exon and intron is capable of promoting strong gut specific expression in C. elegans. This finding lends weight to the argument that ubc-1 may be  83  Discussion transcribed as a single gene from its own promoter. On the other hand, the gut-specific promoter element(s) may constitute only part of the overall regulatory region. If ubc-1 is not part of a polycistronic message, why then is it rrarcs-spliced by SL2? The signals which determine whether an mRNA will be trans-spliced by SL1 or SL2 are still not completely understood, but some distinctions can be made. SL1 trans-splicing requires only the presence of a 3' splice acceptor site upstream of the initiator methionine (Conrad et al., 1991). SL2 trans-splicing also requires a 3' splice acceptor site, but as noted, it must be located downstream of another gene. This was demonstrated by Spieth et al., (1993) who caused an SL1 trans-spliced gene to be converted to an SL2 Trans-spliced gene by inserting it within a polycistronic cluster. Mutation studies have also shown that an upstream polyadenylation site is required for SL2 trans-splicing, since removing it abolishes SL2 trans-splicing and destroys the m R N A ' s ability to be spliced out of the polycistronic message (Spieth et al., 1993). This suggests that the process of polyadenylation and SL2 trans-splicing are linked in some way. As mentioned above, ubc-1 contains a perfect polyadenylation signal upstream of its A T G . A simple explanation for SL2 rrans-splicing of a monocistronic ubc-1 m R N A would be that the presence of a polyadenylation signal upstream of the 3' splice acceptor site is sufficient to allow the SL2 trans-splicing machinery to recognize the ubc-1 pre-mRNA. This model implies that the upstream polyadenylation signal of ubc-1 is present within the upstream sequence purely by chance. Given that the non-coding regions of C. elegans are extremely A T rich, this is possible. This argument, of course, is based on very preliminary data. Complete sequencing and analysis of the cosmid containing ubc-1 will perhaps reveal other potential genes upstream of ubc-1. Also, although the ubc-1VLacZ fusion p E X P l is capable of driving the expression within the gut of C. elegans, it is still possibile that the observed expression is driven by a cryptic promoter and not the true ubc-1 promoter. If confirmed however, the trans-splicing of a monocistronic ubc-1 by SL2 would be an excellent model in which to study the mechanism of SL2 trans-splicing specificity.  84  Discussion 9. OTHER UBIQUITIN SYSTEM GENES IN C. E L E G A N S The ubiquitin system requires a large number of diverse enzymes to perform its various functions.  To date our laboratory has identified and characterized 3 ubiquitin conjugating  enzymes. In addition to ubc-1, ubc-2, a UBC4/5 like E2 required for larval development in C. elegans, has been identified (Zhen et al., 1993), as well as ubc-3, a UBC7 homologue which is expressed in the hypodermis (Zhen and Leggett, unpublished results). The polyubiquitin gene (Graham et al., 1989) as well as two ubiquitin-like ribosomal fusion proteins (Jones & Candido, 1993, Jones et al., 1995) have also been cloned and studied. The rapid advancement of the C. elegans genome sequencing project has led to the discovery of a large number of additional genes of the ubiquitin system. These include the ubiquitin activating enzyme, several different E2s, as well as various ubiquitin hydrolases and peptidases. A complete list of these putative homologues is given in the appendix. This shows that the diversity of the ubiquitin system is well conserved within C. elegans. Studies on the expression, biochemistry and genetics of these genes will provide valuable and interesting information on the role of the ubiquitin system in a multicellular organism.  10. CONCLUSIONS 1) C. elegans ubc-1 is a single copy gene on chromosome IV encoding a type II ubiquitin conjugating enzyme. This E2 shares significant homology with yeast RAD6 and its homologues and is able to functionally complement the D N A repair and slow growth phenotypes, but not the sporulation defect of yeast rad6 null mutants. UBC-1 is distinct from other R A D 6 homologues in that it contains a 40 amino acid carboxy-terminal extension. This extension is likely to be important in nematodes since a similar tail is found in the ubc-1 homologues of the nematodes C. briggsae and A. suum. 2) The mRNA of ubc-1 is expressed in all stages of development and is trans-spliced by the SL2 splice leader suggesting that ubc-1 is transcribed as part of a polycistronic message. However, experiments designed to show that the ubc-1 gene product is transcribed as part of a  85  Discussion polycistronic message yielded negative results. Thus it is possible that ubc-1 is an exception to the current theory that SL2 spliced transcripts are located within an operon and may lead to a better understanding of the mechanisms of SL2 trans-splicing selectivity. 3) Purified recombinant UBC-1 is able to self-associate based on in vitro cross-linking experiments. Deletion analysis revealed that removal of the 40 amino acid tail of UBC-1 causes an 8 fold decrease in its ability to associate. This suggested the presence of two interaction domains involved in the self-association of UBC-1. The first domain is the E2 core of UBC-1 consisting of the first 152 amino acids and the second is the tail of UBC-1. This suggests that UBC-1 must interact with itself in order to perform its functions in C. elegans. 4) The observation that UBC-1 monoubiquitinates itself intramolecularly at lysine 162 indicates a novel role for ubiquitin modification of this protein. This modification may perform an autoregulatory function or be involved in the interaction of UBC-1 with itself or other proteins involved in the ubiquitin system.  11. FUTURE DIRECTIONS 1) The importance of isolating a C. elegans ubc-1 mutant cannot be over-stressed. In addition to revealing the phenotype of such a mutation which could provide valuable insight into the role of ubc-1 in vivo, such a mutant would allow for interesting experiments. These would include examining the importance of the tail of UBC-1 in vivo by complementation of the ubc-1 mutant with the deletion constructs UBC-1 Al52 and UBC-1A169.  The role of the  monoubiquitination of UBC-1 could also be examined by complementation of a ubc-1 mutant with UBC-1R162. The use of such a mutant in a suppressor screen could also lead to the identification of components of the ubiquitin system which interact with UBC-1 or degradation targets of U B C - 1 . Attempts to isolate a C. elegans ubc-1 mutant using the technique of T e l transposon insertion and inexact excision (Plasterk & Groenen, 1992) proved unsuccessful as no Tel insertions were ever observed within the ubc-1 gene despite several attempts by the Plasterk laboratory. Another method for generating deletion mutations involves treatment of C. elegans  86  Discussion with trimethylpsoralen (TMP) which has been shown to cause small D N A deletions on the average of 0.94kb in length. Screening of pools of T M P treated C. elegans by PCR in a manner similar to the T e l insertion screen should allow isolation of deletions within the ubc-1 gene. 2) Further analysis of the ability of UBC-1 to form a multiubiquitin chain on its active site cysteinyl residue using purified or bacterially expressed C. elegans E l may lead to a better understanding of the mechanism of U B C - 1 . If such a chain is indeed formed, then several questions may be addressed. For example, one could determine which lysine(s) within ubiquitin are used in formation of the chain. Work from several laboratories has shown that different E2s are capable of forming multiubiquitin chains through lysines other than LYS48 (Arnason & Ellison, 1994, Baboshina & Haas, 1996, Baldi et al., 1996). Recently, R A D 6 alone was shown to form a multiubiquitin chain on histone H2B using L Y S 7 linkages, but in the presence of its E3, U B R 1 , the chain formed on a model substrate by R A D 6 was through LYS48 (Baboshina & Haas, 1996). The linkage of the multiubiquitin chain formed by UBC-1 could be addressed by performing ubiquitin conjugation assays in vitro using ubiquitin proteins whose various lysines have been mutated to arginine. 3) Performing a yeast 2-hybrid screen using UBC-1 would provide a useful approach to identifying proteins that interact with U B C - 1 . These might include various E3s such as the homologue of U B R 1 , the R A D 6 E3 involved in the N-end rule, as well as possible targets of UBC-1. 4) In yeast, the levels of RAD6 mRNA increase upon exposure to U V radiation (Madura et al., 1990). Since ubc-1 is a homologue of RAD6 it would be interesting to examine if ubc-1 is also induced by U V . This could be studied both at the level of transcription by performing Northern blots on C. elegans exposed to U V radiation, as well as at the protein level by performing Western blots using anti-UBC-1 antibody on protein extracts of U V exposed C. elegans. 5) The temporal and spatial expression patterns of UBC-1 can be examined by in vivo immunohistochemical staining of C. elegans using the anti-UBC-1 antibody. Identification of  87  Discussion specific expression patterns of UBC-1 may provide clues to the role of ubc-1 in C. elegans. Also, if ubc-1 is indeed induced by U V radiation, examination of the location(s) of UBC-1 induction by immunohistochemical staining may prove interesting.  88  References REFERENCES al-Khodairy, F., Enoch, T., Hagan, I. M . , & Carr, A. M . (1995) The Schizosaccharomyces pombe hus5 gene encodes a ubiquitin conjugating enzyme required for normal mitosis. J Cell Sci 108, 475-486. Alkalay, I., Yaron, A . , Hatzubai, A . , Orian, A . , Ciechanover, A . , & Ben-Neriah, Y . (1995) Stimulation-dependent I kappa B alpha phosphorylation marks the NF- kappa B inhibitor for degradation via the ubiquitin-proteasome pathway. Proc Natl Acad Sci U S A 92, 1059910603. Antonucci, T. K . (1985) Isolation of high M W R N A from mammalian tissues. Recombinant DNA techniques 6, 22-24. Arnason, T., & Ellison, M . J. (1994) Stress resistance in Saccharomyces cerevisiae is strongly correlated with assembly of a novel type of multiubiquitin chain. Mol Cell Biol 14, 7876-7883. Baboshina, O. V., & Haas, A . L . (1996) Novel multiubiquitin chain linkages catalyzed by the conjugating enzymes E2EPF and RAD6 are recognized by 26 S proteasome subunit 5. J Biol Chem 271, 2823-31. Baker, R. T., & Board, P. G. (1987) The human ubiquitin gene family: structure of a gene and pseudogenes from the Ub B subfamily. Nucleic Acids Res 15, 443-63. Baldi, L . , Brown, K., Franzoso, G., & Siebenlist, U . (1996) Critical role for lysines 21 and 22 in signal-induced, ubiquitin-mediated proteolysis of I kappa B-alpha. Journal of Biological Chemistry 271, 376-9. Band, V . , De Caprio, J. A . , Delmolino, L . , Kulesa, V., & Sager, R. (1991) Loss of p53 protein in human papillomavirus type 16 E6-immortalized human mammary epithelial cells. J Virol 65, 6671-6. Banerjee, A . , Gregori, L . , X u , Y . , & Chau, V . (1993) The bacterially expressed yeast CDC34 gene product can undergo autoubiquitination to form a multiubiquitin chain-linked protein. J Biol Chem 268, 5668-75. Bartel, B . , Wunning, I., & Varshavsky, A . (1990) The recognition component of the N end rule pathway. Embo J 9, 3179-89.  89  References Beal, R., Deveraux, Q., X i a , G., Rechsteiner, M . , & Pickart, C. (1996) Surface hydrophobic residues of multiubiquitin chains essential for proteolytic targeting. Proceedings of the National Academy of Sciences of the United States of America 93, 861-6. Birnboim, H . C., & Doly, J. (1979) A rapid alkaline extraction procedure for screening recombinant plasmid D N A . Nucleic Acids Res 7, 1513-23. Blumenthal, T., & Thomas, J. (1988) Cis and trans mRNA splicing in C. elegans. Trends Genet 4, 305-8. Brenner, S. (1974) The genetics of Caenorhabditis elegans. Genetics 77, 71-94. Callis, J., Carpenter, T., Sun, C. W., & Vierstra, R. D. (1995) Structure and evolution of genes encoding polyubiquitin and ubiquitin- like proteins in Arabidopsis thaliana ecotype Columbia. Genetics 139, 921-939. Cenciarelli, C , Hou, D., Hsu, K . C , Rellahan, B . L., Wiest, D. L., Smith, H . T., Fried, V . A., & Weissman, A . M . (1992) Activation-induced ubiquitination of the T cell antigen receptor. Science 257, 795-7. Chalfie, M . , Sulston, J. E., White, J. G., Southgate, E., Thomson, J. N . , & Brenner, S. (1985) The neural circuit for touch sensitivity in Caenorhabditis elegans. J Neurosci 5, 956-64. Chau, V . , Tobias, J. W., Bachmair, A . , Marriott, D., Ecker, D. J., Gonda, D. K . , & Varshavsky, A . (1989) A multiubiquitin chain is confined to specific lysine in a targeted shortlived protein. Science 243, 1576-83. Chen, P., Johnson, P., Sommer, T., Jentsch, S., & Hochstrasser, M . (1993) Multiple ubiquitin-conjugating enzymes participate in the in vivo degradation of the yeast M A T alpha 2 repressor. Cell 74, 357-69. Chen, Z., Hagler, J., Palombella, V . J., Melandri, F., Scherer, D., Ballard, D., & Maniatis, T. (1995) Signal-induced site-specific phosphorylation targets I kappa B alpha to the ubiquitinproteasome pathway. Genes Dev 9, 1586-1597. Chen, Z., & Pickart, C. M . (1990) A 25-kilodalton ubiquitin carrier protein (E2) catalyzes multi- ubiquitin chain synthesis via lysine 48 of ubiquitin. J Biol Chem 265, 21835-42. Chen, Z. J., Parent, L . , & Maniatis, T. (1996) Site-specific phosphorylation of IkappaBalpha by a novel ubiquitination- dependent protein kinase activity. Cell 84, 853-862.  90  References Ciechanover, A., DiGiuseppe, J. A., Bercovich, B., Orian, A., Richter, J. D., Schwartz, A . L., & Brodeur, G. M . (1991) Degradation of nuclear oncoproteins by the ubiquitin system in vitro. Proc Natl Acad Sci USA88,\ 39-43. Ciechanover, A., Elias, S., Heller, H., Ferber, S., & Hershko, A . (1980a) Characterization of the heat-stable polypeptide of the ATP-dependent proteolytic system from reticulocytes. J Biol Chem 255, 7525-8. Ciechanover, A . , Heller, H . , Elias, S., Hass, A . L . , & Hershko, A . (1980b) A T P dependent conjugation of reticulocyte proteins with the polypeptide required for protein degradation. Proc Natl Acad Sci U S A 77, 1365-8. Ciechanover, A., Shkedy, D., Oren, M . , & Bercovich, B. (1994) Degradation of the tumor suppressor protein p53 by the ubiquitin- mediated proteolytic system requires a novel species of ubiquitin- carrier protein, E2. J Biol Chem 269, 9582-9. Conrad, R., Thomas, J., Spieth, J., & Blumenthal, T. (1991) Insertion of part of an intron into the 5' untranslated region of a Caenorhabditis elegans gene converts it into a frans-spliced gene. Mol Cell Biol 11, 1921-6. Coulson, A . , Kozono, Y . , Lutterbach, B . , Shownkeen, R., Sulston, J., & Waterston, R. (1991) Y A C s and the C. elegans genome. Bioessays 13, 413-7. Crane, D. I., Kalish, J. E., & Gould, S. J. (1994) The Pichia pastoris PAS4 gene encodes a ubiquitin-conjugating enzyme required for peroxisome assembly. J Biol Chem 269, 2183521844. Deshaies, R. J., Chau, V., & Kirschner, M . (1995) Ubiquitination of the G l cyclin Cln2p by a Cdc34p-dependent pathway. Embo J14, 303-312. Deveraux, Q., Ustrell, V., Pickart, C , & Rechsteiner, M . (1994) A 26 S protease subunit that binds ubiquitin conjugates. J Biol Chem 269, 7059-61. Dohmen, R. J., Madura, K . , Bartel, B . , & Varshavsky, A . (1991) The N-end rule is mediated by the UBC2(RAD6) ubiquitin-conjugating enzyme. Proc Natl Acad Sci USA 88, 7351-5. Driscoll, J., & Goldberg, A . L . (1990) The proteasome (multicatalytic protease) is a component of the 1500-kDa proteolytic complex which degrades ubiquitin-conjugated proteins. / Biol Chem 265, 4789-92.  91  References Dubiel, W., Ferrell, K., & Rechsteiner, M . (1995) Subunits of the regulatory complex of the 26S protease. Mol Biol Rep 21, 27-34. Ellison, K . S., Gwozd, T., Prendergast, J. A., Paterson, M . C , & Ellison, M . J. (1991) A site-directed approach for constructing temperature-sensitive ubiquitin-conjugating enzymes reveals a cell cycle function and growth function for RAD6. J Biol Chem 266, 24116-20. Emmons, S. W., Klass, M . R., & Hirsh, D. (1979) Analysis of the constancy of D N A sequences during development and evolution of the nematode Caenorhabditis elegans. Proc Natl AcadSciUSA 76, 1333-7. Emori, Y . , Tsukahara, T., Kawasaki, H . , Ishiura, S., Sugita, H . , & Suzuki, K . (1991) Molecular cloning and functional analysis of three subunits of yeast proteasome. Mol Cell Biol 11, 344-53. Enenkel, C , Lehmann, H., Kipper, J., Guckel, R., Hilt, W., & Wolf, D. H . (1994) PRE3, highly homologous to the human major histocompatibility complex- linked L M P 2 (RING 12) gene, codes for a yeast proteasome subunit necessary for the peptidylglutamyl-peptide hydrolyzing activity. FEBS Lett 341, 193-6. Finley, D., Bartel, B . , & Varshavsky, A . (1989) The tails of ubiquitin precursors are ribosomal proteins whose fusion to ubiquitin facilitates ribosome biogenesis. Nature 338, 394401. Finley, D., & Chau, V . (1991) Ubiquitination. Annu Rev Cell Biol 7, 25-69. Finley, D., Ciechanover, A . , & Varshavsky, A . (1984) Thermolability of ubiquitinactivating enzyme from the mammalian cell cycle mutant ts85. Cell 37, 43-55. Finley, D., Ozkaynak, E., & Varshavsky, A . (1987) The yeast polyubiquitin gene is essential for resistance to high temperatures, starvation, and other stresses. Cell 48, 1035-46. Fire, A., Harrison, S. W., & Dixon, D. (1990) A modular set of lacZ fusion vectors for studying gene expression in Caenorhabditis elegans. Gene 93, 189-98. Fruh, K . , Gossen, M . , Wang, K . , Bujard, H . , Peterson, P. A . , & Yang, Y . (1994) Displacement of housekeeping proteasome subunits by MHC-encoded L M P s : a newly discovered mechanism for modulating the multicatalytic proteinase complex. Embo J 13, 32363244.  92  References Fujiwara, T., Tanaka, K., Orino, E., Yoshimura, T., Kumatori, A., Tamura, T., Chung, C. H . , Nakai, T., Yamaguchi, K . , Shin, S., & et al. (1990) Proteasomes are essential for yeast proliferation. c D N A cloning and gene disruption of two major subunits. J Biol Chem 265, 1660413. Gaczynska, M . , Rock, K . L., Spies, T., & Goldberg, A . L . (1994) Peptidase activities of proteasomes are differentially regulated by the major histocompatibility complex-encoded genes for L M P 2 and LMP7. Proc Natl Acad Sci US A 91, 9213-9217. Georgatsou, E., Georgakopoulos, T., & Thireos, G. (1992) Molecular cloning of an essential yeast gene encoding a proteasomal subunit. FEBS Lett 299, 39-43. Ghislain, M . , Udvardy, A., & Mann, C. (1993) S. cerevisiae 26S protease mutants arrest cell division in G2/metaphase. Nature 366, 358-62. Girod, P. A . , & Vierstra, R. D. (1993) A major ubiquitin conjugation system in wheat germ extracts involves a 15-kDa ubiquitin-conjugating enzyme (E2) homologous to the yeast UBC4AJBC5 gene products. J Biol Chem 268, 955-60. Glotzer, M . , Murray, A . W., & Kirschner, M . W. (1991) Cyclin is degraded by the ubiquitin pathway. Nature 349, 132-8. Goebl, M . G., Yochem, J., Jentsch, S., McGrath, J. P., Varshavsky, A . , & Byers, B . (1988) The yeast cell cycle gene CDC34 encodes a ubiquitin-conjugating enzyme. Science 241, 1331-5. Goldknopf, I. L., & Busch, H . (1977) Isopeptide linkage between nonhistone and histone 2A polypeptides of chromosomal conjugate-protein A24. Proc Natl Acad Sci U S A 74, 864-8. Goldstein, G., Scheid, M . , Hammerling, U., Schlesinger, D. H., Niall, H . D., & Boyse, E. A . (1975) Isolation of a polypeptide that has lymphocyte-differentiating properties and is probably represented universally in living cells. Proc Natl Acad Sci U S A 72, 11-5. Graham, R. W., Jones, D., & Candido, E. P. M . (1989) UbiA, the major polyubiquitin locus in Caenorhabditis elegans, has unusual structural features and is constitutively expressed. Mol Cell Biol 9, 268-77. Gray, C. W., Slaughter, C. A., & DeMartino, G. N . (1994) PA28 activator protein forms regulatory caps on proteasome stacked rings. /. Mol. Biol. 236, 7-15.  93  References Groettrup, M . , Soza, A., Eggers, M . , Kuehn, L., Dick, T. P., Schild, H., Rammensee, H . G., Koszinowski, U . H., & Kloetzel, P. M . (1996) A role for the proteasome regulator PA28alpha in antigen presentation. Nature 381, 166-168. Gwozd, C. S., Arnason, T. G., Cook, W. J., Chau, V., & Ellison, M . J. (1995) The yeast U B C 4 ubiquitin conjugating enzyme monoubiquitinates itself in vivo: evidence for an E2-E2 homointeraction. Biochemistry 340, 6296-6302. Haas, A . L . , & Bright, P. M . (1988) The resolution and characterization of putative ubiquitin carrier protein isozymes from rabbit reticulocytes. J Biol Chem 263, 13258-67. Haas, A . L . , Warms, J. V . , Hershko, A . , & Rose, I. A . (1982) Ubiquitin-activating enzyme. Mechanism and role in protein-ubiquitin conjugation. J Biol Chem 257, 2543-8. Haffter, P., & Fox, T. D. (1991) Nucleotide sequence of PUP1 encoding a putative proteasome subunit in Saccharomyces cerevisiae. Nucleic Acids Res 19, 5075. Hartl, F. U . (1996) Molecular chaperones in cellular protein folding. Nature 381, 571381. Hatfield, P. M . , & Vierstra, R. D. (1992) Multiple forms of ubiquitin-activating enzyme E l from wheat. Identification of an essential cysteine by in vitro mutagenesis. J Biol Chem 267, 14799-803. Haynes, R. H . , & Kunz, B . A . (1981) in The Molecular Biology of the Yeast Saccharomyces cerevisiae: Life Cycle and Inheritence pp 371-414, Cold Spring Harbor Laboratory, Cold Spring Harbor, N Y . Heinemeyer, W., Gruhler, A., Mohrle, V., Mahe, Y., & Wolf, D. H . (1993) PRE2, highly homologous to the human major histocompatibility complex- linked RING10 gene, codes for a yeast proteasome subunit necessary for chrymotryptic activity and degradation of ubiquitinated proteins. J Biol Chem 268, 5115-20. Heinemeyer, W., Kleinschmidt, J. A . , Saidowsky, J., Escher, C , & Wolf, D. H . (1991) Proteinase yscE, the yeast proteasome/multicatalytic-multifunctional proteinase: mutants unravel its function in stress induced proteolysis and uncover its necessity for cell survival. Embo J10, 555-62. Heinemeyer, W., Trondle, N . , Albrecht, G., & Wolf, D. H . (1994) PRE5 and PRE6, the last missing genes encoding 20S proteasome subunits from yeast? Indication for a set of 14 different subunits in the eukaryotic proteasome core. Biochemistry 33, 12229-12237.  94  References Henikoff, S. (1984) Unidirectional digestion with exonuclease III creates targeted breakpoints for D N A sequencing. Gene 28, 351-9. Hershko, A . (1988) Ubiquitin-mediated protein degradation. J Biol Chem 263, 15237-40. Hershko, A . (1991) The ubiquitin pathway for protein degradation. Trends Biochem Sci 16, 265-8. Hershko, A . , & Ciechanover, A . (1982) in Ann. rev. Biochem pp 335-364, Annual Reviews Inc. Hershko, A., Ciechanover, A., Heller, H., Haas, A . L . , & Rose, I. A . (1980) Proposed role of A T P in protein breakdown: conjugation of protein with multiple chains of the polypeptide of ATP-dependent proteolysis. Proc Nad Acad Sci USA 77, 1783-6. Hershko, A . , Ganoth, D., Sudakin, V . , Dahan, A., Cohen, L . H . , Luca, F. C , Ruderman, J. V . , & Eytan, E. (1994) Components of a system that ligates cyclin to ubiquitin and their regulation by the protein kinase cdc2. J Biol Chem 269, 4940-6. Hershko, A . , Heller, H . , Elias, S., & Ciechanover, A . (1983) Components of ubiquitinprotein ligase system. Resolution, affinity purification, and role in protein breakdown. J Biol Chem 258, 8206-14. Hicke, L . , & Riezman, H . (1996) Ubiquitination of a yeast plasma membrane receptor signals its ligand-stimulated endocytosis. Cell 84, 211-87. Hilt, W., Enenkel, C , Gruhler, A . , Singer, T., & Wolf, D. H . (1993) The PRE4 gene codes for a subunit of the yeast proteasome necessary for peptidylglutamyl-peptide-hydrolyzing activity. Mutations link the proteasome to stress- and ubiquitin-dependent proteolysis. J Biol Chem 268, 3479-86. Hilt, W., & Wolf, D. H . (1995) Proteasomes of the yeast S. cerevisiae: genes, structure and functions. Mol Biol Rep 21, 3-10. Hochstrasser, M . , Ellison, M . J . , Chau, V . , & Varshavsky, A . (1991) The short-lived M A T alpha 2 transcriptional regulator is ubiquitinated in vivo. Proc Nad Acad Sci USA 88, 4606-10. Hochstrasser, M . , & Varshavsky, A . (1990) In vivo degradation of a transcriptional regulator: The yeast alpha 2 repressor. Cell 61, 697-708.  95  References Hough, R., Pratt, G . , & Rechsteiner, M . (1986) Ubiquitin-lysozyme conjugates. Identification and characterization of an ATP-dependent protease from rabbit reticulocyte lysates. J Biol Chem 261, 2400-8. Jentsch, S., McGrath, J. P., & Varshavsky, A . (1987) The yeast D N A repair gene RAD6 encodes a ubiquitin-conjugating enzyme. Nature 329, 131-4. Jentsch, S., Seufert, W., & Hauser, H . P. (1991) Genetic analysis of the ubiquitin system. Biochim Biophys Acta 1089, 127-39. Jones, D., & Candido, E. P. (1993) Novel ubiquitin-like ribosomal protein fusion genes from the nematodes Caenorhabditis elegans and Caenorhabditis briggsae. J Biol Chem 268, 19545-51. Jones, D., Dixon, D. K., Graham, R. W., & Candido, E. P. (1989) Differential regulation of closely related members of the hspl6 gene family in Caenorhabditis elegans. DNA 8, 481-90. Jones, D., Stringham, E. G., Graham, R. W., & Candido, E. P. (1995) A portable regulatory element directs specific expression of the Caenorhabditis elegans ubiquitin gene ubq-2 in the somatic gonad. Dev Biol 171, 60-72. Jonnalagadda, S., Butt, T. R., Monia, B . P., Mirabelli, C. K., Gotlib, L., Ecker, D. J., & Crooke, S. T. (1989) Multiple (alpha-NH-ubiquitin)protein endoproteases in cells. J Biol Chem 264, 10637-42. Jungmann, J., Reins, H . A . , Schobert, C , & Jentsch, S. (1993) Resistance to cadmium mediated by ubiquitin-dependent proteolysis. Nature 361, 369-71. Kaiser, P., Seufert, W., Hofferer, L., Kofler, B . , Sachsenmaier, C , Herzog, H . , Jentsch, S., Schweiger, M . , & Schneider, R. (1994) A human ubiquitin-conjugating enzyme homologous to yeast UBC8. J Biol Chem 269, 8797-802. Kang, X . L . , Yadao, F., Gietz, R. D., & Kunz, B . A . (1992) Elimination of the yeast R A D 6 ubiquitin conjugase enhances base-pair transitions and G . C — T . A transversions as well as transposition of the Ty element: implications for the control of spontaneous mutation. Genetics 130, 285-94. King, R. W., Peters, J. M . , Tugendreich, S., Rolfe, M . , Hieter, P., & Kirschner, M . W. (1995) A 20S complex containing CDC27 and C D C 16 catalyzes the mitosis-specific conjugation of ubiquitin to cyclin B. Cell 81, 279-288.  96  References Koken, M . , Reynolds, P., Bootsma, D., Hoeijmakers, J., Prakash, S., & Prakash, L . (1991a) Dhr6, a Drosophila homolog of the yeast DNA-repair gene RAD6. Proc Natl Acad Sci U SA88, 3832-6. Koken, M . H., Reynolds, P., Jaspers-Dekker, I., Prakash, L., Prakash, S., Bootsma, D., & Hoeijmakers, J. H . (1991b) Structural and functional conservation of two human homologs of the yeast D N A repair gene RAD6. Proc Natl Acad Sci USA88, 8865-9. Kolling, R., & Hollenberg, C. P. (1994) The ABC-transporter Ste6 accumulates in the plasma membrane in a ubiquitinated form in endocytosis mutants. Embo J13, 3261-3271. Kornitzer, D., Raboy, B . , Kulka, R. G., & Fink, G. R. (1994) Regulated degradation of the transcription factor Gcn4. Embo J 13, 6021-6030. Kovalenko, O. V . , Plug, A . W., Haaf, T., Gonda, D. K . , Ashley, T., Ward, D. C , Radding, C. M . , & Golub, E. I. (1996) Mammalian ubiquitin-conjugating enzyme Ubc9 interacts with Rad51 recombination protein and localizes in synaptonemal complexes. Proc. Natl. Acad. Sci. U.S.A. 93, 2958-2963. Krause, M . , & Hirsh, D. (1986) in Cell and Molecular Biology of the Cytoskeleton. (Shay, J. W., Ed.) pp 151-178, Plenum. Kulka, R. G., Raboy, B . , Schuster, R., Parag, H . A . , Diamond, G., Ciechanover, A . , & Marcus, M . (1988) A Chinese hamster cell cycle mutant arrested at G2 phase has a temperaturesensitive ubiquitin-activating enzyme, E l . J Biol Chem 263, 15726-31. Kunkel, T. A . , Roberts, J. D., & Zakour, R. A . (1987) Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods in Enzymology 154, 367-82. Laemmli, U . K . (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-5. Lee, D. H., Tanaka, K., Tamura, T., Chung, C. H., & Ichihara, A . (1992) PRS3 encoding an essential subunit of yeast proteasomes homologous to mammalian proteasome subunit C5. Biochem Biophys Res Commun 182, 452-60. Lee, H . S., Simon, J. A., & Lis, J. T. (1988) Structure and expression of ubiquitin genes of Drosophila melanogaster. Mol Cell Biol 8, 4727-35.  97  References  Liebman, S. W., & Newnam, G. (1993) A ubiquitin-conjugating enzyme, RAD6, affects the distribution of T y l retrotransposon integration positions. Genetics 133, 499-508. Liu, C. C., Miller, H . I., Kohr, W. J., & Silber, J. I. (1989) Purification of a ubiquitin protein peptidase from yeast with efficient in vitro assays. J Biol Chem 264, 20331-8. Liu, Z., Haas, A. L., Diaz, L. A., Conrad, C. A., & Giudice, G. J. (1996) Characterization of a novel keratinocyte ubiquitin carrier protein. Journal of Biological Chemistry 271, 2817-22. Lowe, J., Stock, D., Jap, B . , Zwickl, P., Baumeister, W., & Huber, R. (1995) Crystal structure of the 20S proteasome from the archaeon T. acidophilum at 3.4 A resolution. Science 268, 533-539. Madura, K . , Prakash, S., & Prakash, L . (1990) Expression of the Saccharomyces cerevisiae D N A repair gene R A D 6 that encodes a ubiquitin conjugating enzyme, increases in response to D N A damage and in meiosis but remains constant during the mitotic cell cycle. Nucleic Acids Res 18, 771-8.  Science  Madura, K., & Varshavsky, A. (1994) Degradation of G alpha by the N-end rule pathway. 265, 1454-1458.  Matuschewski, K . , Hauser, H . P., Treier, M . , & Jentsch, S. (1996) Identification of a novel family of ubiquitin-conjugating enzymes with distinct amino-terminal extensions. Journal of Biological Chemistry 271, 2789-94. McGrath, J. P., Jentsch, S., & Varshavsky, A . (1991) U B A 1: an essential yeast gene encoding ubiquitin-activating enzyme. Embo J10, 227-36. McPherson, A . (1982) Sons, Inc., New York.  Preparation  and  analysis  of protein  crystals,  John Wiley and  Mello, C. C , Kramer, J. M . , Stinchcomb, D., & Ambros, V . (1991) Efficient gene transfer in C.elegans: extrachromosomal maintenance and integration of transforming sequences. Embo J10, 3959-70. Miyazawa, K., Toyama, K., Gotoh, A., Hendrie, P. C , Mantel, C , & Broxmeyer, H . E. (1994) Ligand-dependent polyubiquitination of c-kit gene product: a possible mechanism of receptor down modulation in M07e cells. Blood 83, 137-45. Mori, S., Claesson-Welsh, L . , Okuyama, Y . , & Saito, Y . (1995a) Ligand-induced polyubiquitination of receptor tyrosine kinases. Biochem Biophys Res Commun 213, 32-39.  98  References Mori, S., Heldin, C. H., & Claesson-Welsh, L . (1992) Ligand-induced polyubiquitination of the platelet-derived growth factor beta-receptor. J Biol Chem 267, 6429-34. Mori, S., Tanaka, K . , Omura, S., & Saito, Y . (1995b) Degradation process of ligandstimulated platelet-derived growth factor beta-receptor involves ubiquitin-proteasome proteolytic pathway. J Biol Chem 270, 29447-29452. Morrison, A . , Miller, E . J., & Prakash, L . (1988) Domain structure and functional analysis of the carboxyl-terminal polyacidic sequence of the R A D 6 protein of Saccharomyces cerevisiae. Mol Cell Biol 8, 1179-85. Nirmala, P. B . , & Thampan, R. V . (1995) Ubiquitination of the rat uterine estrogen receptor: dependence on estradiol. Biochem Biophys Res Commun 213, 24-31. Nuber, U . , Schwarz, S., Kaiser, P., Schneider, R., & Scheffner, M . (1996) Cloning of human ubiquitin-conjugating enzymes UbcH6 and UbcH7 (E2-F1) and characterization of their interaction with E6-AP and RSP5. Journal of Biological Chemistry 271, 2795-800. Orian, A., Whiteside, S., Israel, A . , Stancovski, I., Schwartz, A . L . , & Ciechanover, A . (1995) Ubiquitin-mediated processing of NF-kappa B transcriptional activator precursor pi05. Reconstitution of a cell-free system and identification of the ubiquitin-carrier protein, E2, and a novel ubiquitin-protein ligase, E3, involved in conjugation. J Biol Chem 270, 21707-21714. Orino, E., Tanaka, K . , Tamura, T., Sone, S., Ogura, T., & Ichihara, A . (1991) A T P dependent reversible association of proteasomes with multiple protein components to form 26S complexes that degrade ubiquitinated proteins in human HL-60 cells. FEBS Lett 284, 206-10. Ozkaynak, E., Finley, D., Solomon, M . J., & Varshavsky, A . (1987) The yeast ubiquitin genes: a family of natural gene fusions. Embo J 6, 1429-39. Ozkaynak, E., Finley, D., & Varshavsky, A. (1984) The yeast ubiquitin gene: head-to-tail repeats encoding a polyubiquitin precursor protein. Nature 312, 663-6. Palombella, V . J., Rando, O. J., Goldberg, A . L . , & Maniatis, T. (1994) The ubiquitinproteasome pathway is required for processing the N F - kappa B I precursor protein and the activation of NF-kappa B. Cell 78, 773-785. Paolini, R., & Kinet, J. P. (1993) Cell surface control of the multiubiquitination and deubiquitination of high-affinity immunoglobulin E receptors. Embo J12, 779-86.  99  References Peters, J. M . (1994) Proteasomes: protein degradation machines of the cell. Trends Biochem. Sci. 19, 377-382. Peters, J. M . , Harris, J. R., & Kleinschmidt, J. A . (1991) Ultrastructure of the approximately 26S complex containing the approximately 20S cylinder particle (multicatalytic proteinase/proteasome). Eur J Cell Biol 56, 422-32. Pickart, C. M . , Haldeman, M . T., Kasperek, E. M . , & Chen, Z. (1992) Iodination of tyrosine 59 of ubiquitin selectively blocks ubiquitin's acceptor activity in diubiquitin synthesis catalyzed by E2(25K). J Biol Chem 267, 14418-23. Pickart, C. M . , & Rose, I. A . (1985) Functional heterogeneity of ubiquitin carrier proteins. J Biol Chem 260, 1573-81. Pickart, C. M . , & Vella, A . T. (1988) Ubiquitin carrier protein-catalyzed ubiquitin transfer to histones. Mechanism and specificity. J Biol Chem 263, 15076-82. Plasterk, R. H . , & Groenen, J. T. (1992) Targeted alterations of the Caenorhabditis elegans genome by transgene instructed D N A double strand break repair following T e l excision. Embo J11, 287-90. Ptak, C , Prendergast, J. A., Hodgins, R., Kay, C. M . , Chau, V., & Ellison, M . J. (1994) Functional and physical characterization of the cell cycle ubiquitin- conjugating enzyme CDC34 (UBC3). Identification of a functional determinant within the tail that facilitates CDC34 selfassociation. JBiol Chem 269, 26539-26545. Puhler, G., Weinkauf, S., Bachmann, L., Muller, S., Engel, A., Hegerl, R., & Baumeister, W. (1992) Subunit stoichiometry and three-dimensional arrangement in proteasomes from Thermoplasma acidophilum. Embo J11, 1607-16. Raboy, B . , & Kulka, R. G. (1994) Role of the C-terminus of Saccharomyces cerevisiae ubiquitin- conjugating enzyme (Rad6) in substrate and ubiquitin-protein-ligase (E3- R) interactions. Eur J Biochem 221, 247-51. Reiss, Y . , & Hershko, A . (1990) Affinity purification of ubiquitin-protein ligase on immobilized protein substrates. Evidence for the existence of separate NH2-terminal binding sites on a single enzyme. J Biol Chem 265, 3685-90. Reynolds, P., Koken, M . H., Hoeijmakers, J. H., Prakash, S., & Prakash, L . (1990) The rhp6+ gene of Schizosaccharomyces pombt: a structural and functional homolog of the R A D 6 gene from the distantly related yeast Saccharomyces cerevisiae. EMBO J 9, 1423-30.  100  References Reynolds, P., Weber, S., & Prakash, L . (1985) RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates. Proc Natl Acad Sci U S A 82, 168-72. Rivett, A . J. (1993) Proteasomes: multicatalytic proteinase complexes. Biochem J 291, 110. Roff, M . , Thompson, J., Rodriguez, M . S., Jacque, J. M . , Baleux, F., ArenzanaSeisdedos, F., & Hay, R. T. (1996) Role of IkappaBalpha ubiquitination in signal-induced activation of NFkappaB in vivo. J. Biol. Chem. 271, 7844-7850. Rolfe, M . , Beer-Romero, P., Glass, S., Eckstein, J., Berdo, I., Theodoras, A., Pagano, M . , & Draetta, G. (1995) Reconstitution of p53-ubiquitinylation reactions from purified components: the role of human ubiquitin-conjugating enzyme UBC4 and E6- associated protein (E6AP). Proc Natl Acad Sci USA92, 3264-3268. Sambrook, J., Fritsch, E. F., & Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N Y . Sanger, F., Nicklen, S., & Coulson, A. R..(1977) D N A sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74, 5463-7. Scheffner, M . , Huibregtse, J. M . , & Howley, P. M . (1994) Identification of a human ubiquitin-conjugating enzyme that mediates the E6-AP-dependent ubiquitination of p53. Proc Natl Acad Sci USA 97, 8797-8801. Scheffner, M . , Huibregtse, J. M . , Vierstra, R. D., & Howley, P. M . (1993) The HPV-16 E6 and E6-AP complex functions as a ubiquitin-protein ligase in the ubiquitination of p53. Cell 75, 495-505. Scheffner, M . , Werness, B . A., Huibregtse, J. M . , Levine, A . J., & Howley, P. M . (1990) The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53. Cell 63, 1129-36. Schlesinger, D. H . , & Goldstein, G. (1975) Molecular conservation of 74 amino acid sequence of ubiquitin between cattle and man. Nature 255, 42304. Schnall, R., Mannhaupt, G., Stucka, R., Tauer, R., Ehnle, S., Schwarzlose, C , Vetter, I., & Feldmann, H . (1994) Identification of a set of yeast genes coding for a novel family of putative ATPases with high similarity to constituents of the 26S protease complex. Yeast 10, 1141-1155.  101  References Schwob, E., Bohm, T., Mendenhall, M . D., & Nasmyth, K . (1994) The B-type cyclin kinase inhibitor p40SICl controls the G l to S transition in S. cerevisiae. Cell 79, 233-44. Segal, H . L., & Doyle, D. J. (1978) in Protein Turnover and Lysosome Function pp 4358, Academic Press, New York. Seufert, W., Futcher, B., & Jentsch, S. (1995) Role of a ubiquitin-conjugating enzyme in degradation of S- and M-phase cyclins. Nature 373, 78-81. Seufert, W., & Jentsch, S. (1990) Ubiquitin-conjugating enzymes U B C 4 and U B C 5 mediate selective degradation of short-lived and abnormal proteins. Embo J 9, 543-50. Seufert, W., McGrath, J. P., & Jentsch, S. (1990) UBC1 encodes a novel member of an essential subfamily of yeast ubiquitin-conjugating enzymes involved in protein degradation. Embo J 9, 4535-41. Sherman, F., Fink, G. R., & Hicks, J. B . (1986) Methods in Yeast Genetics: Laboratory Course Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N . Y . Siegelman, M . , Bond, M . W., Gallatin, W. M . , St. John, T., Smith, H . T., Fried, V . A., & Weissman, I. L . (1986) Cell surface molecule associated with lymphocyte homing is a ubiquitinated branched-chain glycoprotein. Science 231, 823-9. Sikorski, R. S., & Hieter, P. (1989) A system of shuttle vectors and yeast host strains designed for efficient manipulation of D N A in Saccharomyces cerevisiae. Genetics 122, 19-27. Silver, E. T., Gwozd, T. J., Ptak, C , Goebl, M . , & Ellison, M . J. (1992) A chimeric ubiquitin conjugating enzyme that combines the cell cycle properties of CDC34 (UBC3) and the D N A repair properties of R A D 6 (UBC2): implications for the structure, function and evolution of the E2s. EMBO J11, 3091-8. Sommer, T., & Jentsch, S. (1993) A protein translocation defect linked to ubiquitin conjugation at the endoplasmic reticulum. Nature 365, 176-9. Spence, J., Sadis, S., Haas, A . L., & Finley, D. (1995) A ubiquitin mutant with specific defects in D N A repair and multiubiquitination. Mol Cell Biol 15, 1265-1273. Spieth, J., Brooke, G., Kuersten, S., Lea, K . , & Blumenthal, T. (1993) Operons in C. elegans: polycistronic mRNA precursors are processed by trans-splicing of SL2 to downstream coding regions. Cell 73, 521-32.  102  References St. John, T., Gallatin, W. M . , Siegelman, M . , Smith, H . T., Fried, V . A., & Weissman, I. L. (1986) Expression cloning of a lymphocyte homing receptor cDNA: ubiquitin is the reactive species. Science 231, 845-50. Stancovski, I., Gonen, H . , Orian, A . , Schwartz, A . L . , & Ciechanover, A . (1995) Degradation of the proto-oncogene product c-Fos by the ubiquitin proteolytic system in vivo and in vitro: identification and characterization of the conjugating enzymes. Mol Cell Biol 15, 71067116. Sudakin, V., Ganoth, D., Dahan, A., Heller, H., Hershko, J., Luca, F. C , Ruderman, J. V., & Hershko, A . (1995) The cyclosome, a large complex containing cyclin-selective ubiquitin ligase activity, targets cyclins for destruction at the end of mitosis. Mol Biol Cell 6, 185-197. Sullivan, M . L . , Carpenter, T. B . , & Vierstra, R. D. (1994) Homologues of wheat ubiquitin-conjugating enzymes-TaUBCl and TaUBC4 are encoded by small multigene families in Arabidopsis thaliana. Plant Mol Biol 24, 651-61. Sullivan, M . L., & Vierstra, R. D. (1989) A ubiquitin carrier protein from wheat germ is structurally and functionally similar to the yeast D N A repair enzyme encoded by RAD6. Proc Natl Acad Sci U S A 86, 9861-5. Sulston, J. E., & Brenner, S. (1974) The D N A of Caenorhabditis elegans. Genetics 77, 95-104. Sulston, J. E., & Horvitz, H . R. (1977) Post-embryonic cell lineages of the nematode, Caenorhabditis elegans. Dev Biol 56, 110-56. Sulston, J. E., Schierenberg, E., White, J. G., & Thomson, J. N . (1983) The embryonic cell lineage of the nematode Caenorhabditis elegans. Dev Biol 100, 64-119. Sung, P., Prakash, S., & Prakash, L . (1988) The R A D 6 protein of Saccharomyces cerevisiae polyubiquitinates histones, and its acidic domain mediates this activity. Genes Dev 2, 1476-85. Sung, P., Prakash, S., & Prakash, L . (1990) Mutation of cysteine-88 in the Saccharomyces cerevisiae R A D 6 protein abolishes its ubiquitin-conjugating activity and its various biological functions. Proc Natl Acad Sci U S A 87, 2695-9. Sung, P., Prakash, S., & Prakash, L . (1991) Stable ester conjugate between the Saccharomyces cerevisiae RAD6 protein and ubiquitin has no biological activity. J Mol Biol 221, 745-9.  103  References Thomas, J., Lea, K . , Zucker-Aprison, E., & Blumenthal, T. (1990) The spliceosomal snRNAs of Caenorhabditis elegans. Nucleic Acids Res 18, 2633-42. Treier, M . , Seufert, W., & Jentsch, S. (1992) Drosophila U b c D l encodes a highly conserved ubiquitin-conjugating enzyme involved in selective protein degradation. Embo J 11, 367-72. Treier, M . , Staszewski, L . M . , & Bohmann, D. (1994) Ubiquitin-dependent c-Jun degradation in vivo is mediated by the delta domain. Cell 78, 787-798. Tsurumi, C , Ishida, N . , Tamura, T., Kakizuka, A., Nishida, E., Okumura, E., Kishimoto, T., Inagaki, M . , Okazaki, K . , Sagata, N . , & et al. (1995) Degradation of c-Fos by the 26S proteasome is accelerated by c-Jun and multiple protein kinases. Mol Cell Biol 15, 5682-5687. van Nocker, S., Deveraux, Q., Rechsteiner, M . , & Vierstra, R. D. (1996a) Arabidopsis M B P 1 gene encodes a conserved ubiquitin recognition component of the 26S proteasome. Proceedings of the National Academy of Sciences of the United States of America 93, 856-60. Van Nocker, S., & Vierstra, R. D. (1991) Cloning and characterization of a 20-kDa ubiquitin carrier protein from wheat that catalyzes multiubiquitin chain formation in vitro. Proc Natl Acad Sci U S A 88, 10297-301. van Nocker, S., & Vierstra, R. D. (1993) Multiubiquitin chains linked through lysine 48 are abundant in vivo and are competent intermediates in the ubiquitin proteolytic pathway. J Biol Chem 268, 24766-73. van Nocker, S., Walker, J. M . , & Vierstra, R. D. (1996b) The Arabidopsis thaliana UBC7/13/14 genes encode a family of multiubiquitin chain-forming E2 enzymes. / . Biol. Chem. 271, 12150-12158. Varshavsky, A. (1992) The N-end rule. Cell 69, 725-35. Verma, I. M . , Stevenson, J. K . , Schwarz, E. M . , Van Antwerp, D., & Miyamoto, S. (1995) Rel/NF-kappa B/I kappa B family: intimate tales of association and dissociation. Genes Dev 9, 2723-2735. Watkins, J. F., Sung, P., Prakash, S., & Prakash, L . (1993) The extremely conserved amino terminus of R A D 6 ubiquitin-conjugating enzyme is essential for amino-end ruledependent protein degradation. Genes Dev 7, 250-61.  104  References Wiborg, O., Pedersen, M . S., Wind, A . , Berglund, L . E., Marcker, K . A . , & Vuust, J. (1985) The human ubiquitin multigene family: some genes contain multiple directly repeated ubiquitin coding sequences. Embo J 4, 755-9. Wiebel, F. F., & Kunau, W. H . (1992) The Pas2 protein essential for peroxisome biogenesis is related to ubiquitin-conjugating enzymes. Nature 359, 73-6. Wilkinson, K . D., Urban, M . K., & Haas, A . L . (1980) Ubiquitin is the ATP-dependent proteolysis factor I of rabbit reticulocytes. J Biol Chem 255, 7529-32. Wilson, R., Ainscough, R., Anderson, K., Baynes, C , Berks, M . , Bonfield, J., Burton, J., Connell, M . , Copsey, T., Cooper, J., & et al. (1994) 2.2 M b of contiguous nucleotide sequence from chromosome III of C. elegans. Nature 368, 32-8. Wood, W. B . (1988) The Nematode Caenorhabditis elegans., Cold Spring Harbor Laboratory, Cold Spring Harbor, N . Y . Yarden, Y . , Escobedo, J. A., Kuang, W. J., Yang-Feng, T. L., Daniel, T. O., Tremble, P. M . , Chen, E . Y . , Ando, M . E., Harkins, R. N . , Francke, U . , & et al. (1986) Structure of the receptor for platelet-derived growth factor helps define a family of closely related growth factor receptors. Nature 323, 226-32. Zhen, M . , Heinlein, R., Jones, D., Jentsch, S., & Candido, E. P. (1993) The ubc-2 gene of Caenorhabditis elegans encodes a ubiquitin- conjugating enzyme involved in selective protein degradation. Mol Cell Biol 13, 1371-7.  105  Appendix APPENDIX  C. ELEGANS UBIQUITIN COSMIDS Chromosome B0404.2  Ubiquitin conjugating enzyme (Bad match)  X  C06E2.7+.3  2 tandem Ubiquitin conjugating enzymes  X  (C06E2.3 Dros UBCD4.1 or Bovine UBC1 or Yeast UBC1) (C06E2.7 Dros UBCD4.1 or Bovine UBC1, worse match) F07A11.6  Ubiquitin C-terminal hydrolase (3 cDNA's)  II  F49E12.4  Ubiquitin conjugating enzyme (Bad match)  II  K02C4.3  Ubiquitin C-terminal hydrolase (5 cDNA's)  II  T05H10.1  Ubiquitin C-terminal hydrolase (8 cDNA's)  II  K08A8.3  Ubiquitin C-terminal hydrolase or S.pombeRAD21  in  F11H8.1  Ubiquitin-activating enzyme, short (1 cDNA)  in  F37B12.4  Ubiquitin C-terminal hydrolase (2 cDNA's)  II  C28G1.1  Ubiquitin conjugating enzyme (Bad match)  X  C04E2  Ubc-1  IV  M7.1  Ubc-2  IV  D1022.1  Ubiquitin conjugating enzyme (Yeast UBC6)  II  F25B5.4  C. elegans ubiquitin (Uba-1)  III  F56D2.4  Ubiquitin conjugating enzyme (Bad Match)  in  F34H10.1  UbL pseudogene  X  F58A4.10  Ubiquitin conjugating enzyme  IH  (Wheat and A. thaliana UBC7) K02C4.3  Ubiquitin C-terminal hydrolase  R10E11.3  Ubiquitin-specifc processing protease (1 cDNA)  III  R01H2.6  Ubiquitin conjugating enzyme (UbcH7(E2-Fl)) (1 cDNA)  IH  106  Appendix C28H9  Ubq-2 ribosomal fusion (52aa)  III  C47E12.5  Ubiquitin activating enzyme (17 cDNA's)  IV  ZK328.1  Ubiquitin C-terminal hydrolase ? (6cDNA's)  in  C26F1.4  Fau UbiL-Ribosomal fusion (10 cDNA's)  in  C08B6.9  Ubiquitin activating enzyme (truncation?) (0 cDNA's)  V  F38B7.5  Yeast ubiquitin thioesterase 14 Bad match (0 cDNA's)  V  ZK20  RAD23 homologue (lots of cDNA's)  in  W01A11  Ubiquitin C-terminal hydrolase  F45H11  Nedd-8 ubiquitin like  i  K09A9  Ubiquitin C-terminal hydrolase (lcDNA)  X  107  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0088125/manifest

Comment

Related Items