Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Control of intracelluar Ca²⁺ in epithelial cells of the kidney thick ascending limb Dai, Long-jun 1995

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1995-059421.pdf [ 2.22MB ]
Metadata
JSON: 831-1.0088109.json
JSON-LD: 831-1.0088109-ld.json
RDF/XML (Pretty): 831-1.0088109-rdf.xml
RDF/JSON: 831-1.0088109-rdf.json
Turtle: 831-1.0088109-turtle.txt
N-Triples: 831-1.0088109-rdf-ntriples.txt
Original Record: 831-1.0088109-source.json
Full Text
831-1.0088109-fulltext.txt
Citation
831-1.0088109.ris

Full Text

CONTROL OF INTRACELLULAR Ca2 IN EPITHELIAL CELLSOF THE KIDNEY THICK ASCENDING LIMBbyLONG-JUN DATM.Sc. ,The University of British Columbia, 1992A THESIS SUBMITTED IN PARTIAL FULFILLMENT OFDOCTOR OF PHILOSOPHYinTHE FACULTY OF GRADUATE STUDIES(Experimental Medicine, Department of Medicine)We accept this thesis as conformingto the required standardc2cTHE UNIVERSITY OF BRITISH COLUMBIAAugust 1995© Long-jun Dai, 1995In presenting this thesis in partial fulfillment of therequirements for an advanced degree at the University of BritishColumbia, I agree that the Library shall make it freely availablefor reference and study. I further agree that permission forextensive copying of this thesis for scholarly purposes may begranted by the head of my department or by his or herrepresentatives. It is understood that copying or publication ofthis thesis for financial gain shall not be allowed without mywritten permission.Department of LJCI(Signature)The University of British ColumbiaVancouver, CanadaDate (? S11ABSTRACTThe cortical thick ascending limb of Henle’s loop (cTAL) plays a fundamental role insalt reabsorption and concentration-dilution processes within the nephron. This study wasperformed to characterize the role of intracellular free Ca2 ([Ca291)in hormone-mediatedsignal transduction and to describe the function of NaICa2 exchange in control of [Ca2]1in isolated cTAL cells from porcine kidney. Parathyroid hormone, arginine vasopressin, andatrial natriuretic peptide transiently increased [Ca2], in a dose-dependent manner. Theincrement in [Ca2]1 induced by these hormones was by intracellular release and entrythrough plasma membrane Ca2 channels. These hormone-induced Ca2 transients weremodulated by cAMP, cGMP, and PKC activation. In order for intracellular Ca2 to playa role in signal transduction mechanisms it is necessary to have regulated processes whichmaintain [Ca2] at submicromolar levels. We evaluated the functional role of Na/Ca2exchange in cTAL cells. cTAL cells treated with ouabain had basal [Ca2]1, 86±2 uM.Removal of external Na or voltage depolarization with KC1 resulted in rapid andreversible maximal elevation of [Ca2]1,1023 ±72 nM (n=28), which was dependent on thepresence of external Ca2 and elevated [Na]. The activity of Na/Ca2 exchange wasmodulated by protein phosphorylation as calmodulin inhibition decreased and phosphataseinhibition increased the apparent exchange activity. The presence of a Na/Ca2 exchangerwas confirmed with northern hybridization techniques. A gene transcript which encodesa portion of the intracellular ioop of the renal Na/Ca2 exchanger was amplified fromcortical tissue and cTAL cells by polymerase chain reaction (PCR) using primers flankingthe alternative splicing site. Southern hybridization and DNA sequencing demonstratedthe isoform contained exons B and D characteristic of one isoform (NACA3) of the renal111NaICa2 exchanger. The results provide both functional and molecular evidence for aNaICa2 exchanger in cTAL cells of the porcine kidney. It is likely that NaICa2exchange plays an important role in [Ca2] control and thus hormonal regulation ofelectrolyte reabsorption within the cTAL cells.ivTABLE OF CONTENTSABSTRACT iiTABLE OF CONTENTS ivLIST OF FIGURES viiiABBREVIATION xiACKNOWLEDGEMENT xiiGENERAL INTRODUCTION 1I. Calcium Distribution and Metabolism 1II. Renal Handling of Calcium 211.1. Proximal tubule 211.2. Thick ascending limb of Henle’s loop 211.3. Distal tubule and collecting duct 4III. Ca2 as an Intracellular Messenger 4IV. Objectives of the Present Studies 7CHAPTER 1. HORMONE-MEDIATED Ca2 SIGNALING IN cTAL CELLS 8I. Background 8II. Materials and Methods 1011.1. Materials 1011.2. Methods 1011.2.1. Isolation of cTAL cells from porcine kidneys 1011.2.1.1. Culture dishes coated with rabbit anti-goat IgG antibody 1111.2.1.2. Dispersion of inner cortex tissue 11V11.2.1.3. Isolation of cTAL cells 1111.2.2. Determination of cytosolic free Ca2 1211.2.2.1. Cell loading with fura-2 1311.2.2.2. De-esterification 131L2.2.3.Determination of [Ca29 13III.Results 14111.1. PTH-induced Ca2 transients 17111.2. AVP-induced Ca2 transients 23111.3. cAMP-mediated Ca2 transients 28ffl.4. The effect of PKC on hormone-mediated Ca2 transients 33111.5. ANP-induced Ca2 transients 34IV. Discussion 44IV. 1. PTH- and AVP-induced Ca2 transients 44IV.2. ANP-induced Ca2 transients 48CHAPTER 2. Na/Ca EXCHANGE IN cTAL CELLS 52I. Background 52II. Materials and Methods 5511.1. Materials 5511.2. Methods 5511.2.1. Cytoplasmic Na measurements 5611.2.2. Isolation of total RNA from porcine tissues 5611.2.3. Preparation of riboprobe 57vi11.2.3.1. Fresh competent E. coliprepared using the calcium chloride method 5711.2.3.2. Transformation 57II.2.3.3.Isolation of plasmid DNA from transformed E.coli 58II.2.3.4.Preparation of riboprobe from pcDNAII.RkcNCE1 .F1 5811.2.4. Northern blotting and hybridization 58II.2.4.1.Northern blotting 5811.2.4.2. Hybridization 5911.2.5. Identification of Na/Ca2 exchanger isoform with PCR technique 59II.2.5.1.cDNA synthesis 60II.2.5.2.PCR primer design 6011.2.5.3. Polymerase chain reaction (PCR) 6011.2.5.4. Southern blotting and hybridization 6011.2.5.5. Sequencing PCR product 61III.Results 61111.1. Demonstration of Na/Ca2 exchange in porcine cTAL cells 61111.1.1. Effect of external Na removal on [Ca2]in ouabain treated eTAL cells 61111.1.2. Effect of the putative inhibitors on Na/Ca2 exchange 64111.2. Transmembrane depolarization induces Na-dependent Ca2 influx 67111.2.1. The effect of transmembrane depolarization on [Ca21in ouabain-treated cTAL cells 67vii111.2.2. The effects of inhibitors on voltage-stimulated N&iCa2 exchange 69111.2.3. Dependence of Na/Ca2 exchange on intracellular [Na] 74111.2.4. Modulation of Na/Ca2 exchangeby calmidazolium and okadaic acid 74111.3. Identification of Na/Ca2 exchanger by molecular biology techniques 81111.3.1. The distribution of Nat’Ca2 exchanger in porcine tissues 81111.3.2. Identification of NaICa2 exchanger in isolated cTAL cells 81IV. Discussion 87IV. 1. Functional demonstration of Na/Ca2 exchange 87IV.2. The effect of phosphorylation on Na/Ca2 exchange activity 88IV.3. Molecular biology identification of NaICa2exchanger transcripts in cTAL cell RNA 90GENERAL CONCLUSIONS 93REFFERENCES 95viiiLIST OF FIGURESFig. 1 Agonist-induced intracellular Ca2 elevation in a polarized cell 6Fig.2. Hormone-mediated Ca2 signals in isolated porcinecortical thick ascending limb (cTAL) cells of Henle’s loop 16Fig.3. Dose-dependent increases in [Ca2], with PTH 18Fig.4. Characterization of PTH-induced Ca2 transients in porcine cTAL cells 19Fig.5. Changes in fluorescence emmission at 335 and 385 nm excitationwavelengths with MnC12 21Fig.6. The effect of thapsigargin on PTH-induced Ca2 transients 22Fig.7. Dose-dependent initiation of Ca2 transients with AVP in cTAL cells 24Fig.8. Characterization of AVP-induced Ca2 transients in cTAL cells 25Fig.9. The effect of Mn2 on fluorescence emission 26Fig. 10. Effect of thapsigargin on AVP-induced Ca2 transients 27Fig. 11. cAMP induces Ca2 transients in porcine cTAL cells 29Fig. 12. The effect of Mn2 on fuorescence emission 30Fig. 13. The effect of pretreatment of thapsigargin on the effect of 8-BrcAMP 31Fig. 14. Effect of cAMP-induced depletion of intracellular Ca2 storeson agonist-induced Ca2 transients 32Fig. 15. Effect of protein kinase C activationon agonist-induced Ca2 transients in cTAL cells 35Fig. 16. Dose-dependent initiation of Ca2 transients with ANP in cTAL cells 38FIg. 17. Characterization of ANP-induced Ca2 transients in eTAL cells 39ixFig. 18. Changes in fluorescence at 335 and 385 nm excitationwavelengths with 0.5 mM MnC12 in external buffer solution 41Fig. 19. Effect of thapsigargin on ANP-induced Ca2 transient 42Fig.20. Effect of 8-BrcGMP pretreatment on ANP-mediated Ca2 transients 43Fig.21. A model of cardiac type Na/Ca2 exchanger 54Fig.22. Effect of external Na removal on [Ca2l in ouabain-treated cTAL cells 63Fig.23. Effect of vanadate on Na removal-induced [Ca2l changesin ouabain-treated cTAL cells 65Fig.24. Effect of inorganic inhibitors on Nat-dependent change in [Cal1In ouabain-treated cTAL cells 66Fig.25. Effect of organic inhibitors on Na-dependent change in [Ca2]in ouabain-treated cTAL cells 68Fig.26. Effect of transmembrane voltage on sodium-dependent Ca2 influx 70Fig.27. Dose-dependent response of depolarization-induced change in [Ca21, 71Fig.28. Effect of inorganic inhibitors on voltage-dependent Ca2 influxin ouabain-treated cTAL cells 72Fig.29. Effect of organic inhibitors on voltage-dependent Ca2 influxin ouabain-treated cTAL cells 73Fig. 30. Changes of intracellular [Nal in ouabain-treated cTAL cells 75Fig.31. Association of [Ca21 with [Na] following depolarization 76Fig.32. Alteration of Na/Ca2 exchange with calmidazolium and okadaic acid 78Fig.33. Sodium-dependent increase in [Ca21, in okadaic acid-treated cTAL cells 80xFig.34. Northern blot analysis of NaICa2 exchanger 82Fig.35. PCR amplification of the variable regionof the exchanger mRNA from inner cortex and cTAL cells 83Fig.36. Southern blot analysis of PCR products from inner cortical tissueand isolated cTAL cells 84Fig.37. Nucleotide sequence of PCR product from cTAL cells 86xiABBREVIATIONTAL: Thick ascending limb of Henle’s loopcTAL: Cortical thick ascending limb of Henle’s loop[Ca2] Intracellular free Ca2 concentration[Na]1: Intracellular free Na concentrationPTH: Parathyroid hormoneAVP: Arginine vasopressinANP: Atrial natriuretic peptidecAMP: Adenosine 3’ ,5 ‘-cyclicmonophosphatecGMP: Guanosine 3’ ,5 ‘-cyclicmonophosphate1P3: Inositol triphosphatePIP2: Phosphoinositide 4’ ,5 ‘-bisphosphateDAG: DiacylglycerolTPA: 12-O-tetradecanoyl-phorbol 13-acetatePLC: Phosphoinositide-specific phospholipase CPKA: Protein kinase APKC: Protein kinase CPKG: cGMP-dependent protein kinaseTG: ThapsigarginEGTA: Ethylene glycol-bis(i-aminoethyl ether) N,N,N’ ,N’-tetraacetic acidxiiACKNOWLEDGEMENTI would like to thank Dr. Gary A. Quamme for his guidance and support throughoutthis work. I am grateful to Don Huysmans, Gordon Ritchie, and Brian Bapty for theirtechnical assistance.A special thanks to my wife, Hong-ying Li, and my son, James J. Dai, I could notcomplete my degree study without their understanding and support.1GENERAL INTRODUCTIONCalcium is an important cation in the body, representing about 2% of total bodyweight. It is also the most important structural element, occurring not only in combinationwith phosphate in bone and teeth but also with phospholipids and proteins in cellmembranes where it plays a vital role in the maintenance of membrane integrity and incontrolling the permeability of the membrane to many ions including calcium itself. It iswidely involved in many physiological and biochemical processes throughout the bodyincluding the coagulation of blood, the coupling of muscle excitation and contraction, theregulation of nerve excitability, cell reproduction, the control of many enzyme reactions.More recently, intracellular calcium has been determined to be an important secondmessenger involved in hormonally-mediated signal transduction processes.I. Calcium Distribution and MetabolismAn average adult human contains 1,300 gm of calcium. Most of the body calcium(99%) is located in the bone; the remainder is in the cell of which only a small fraction isin the ionized form, Ca2. Total calcium concentration in extracellular fluid of adult humansis 2.5 mM, or 10 mg/dl. In plasma, 60% is ultrafilterable across the glomerular capillaries.The rest (40%) is bound to plasma proteins, primarily albumin. Of the ultrafilterablecomponent, 10% of the total calcium is complexed to polyvalent anions such as phosphate,citrate, bicarbonate, and sulfate. The remaining unbound fraction is free, ionized Ca2,which has a concentration of about 1.25 mlvi or 5 mg/dl in the ultrafiltrate (1). Precisehomeostatic control of Ca2 level in plasma and extracellular fluid is dependent on sensitive2negative feedback control of the secretion of PTH and calcitonin which in turn acts uponbone, kidney and gut to restore normal calcium levels.II. Renal Handling of CalciumThe kidney is a major regulator of calcium homeostasis. Renal handling of calciumis normally a filtration-reabsorption process. Following its ultrafiltration across theglomerular capillaries, calcium is reabsorbed throughout the length of the nephron.Segmental calcium transport has been described with the aid of micropuncture techniquesin a large number of animal species (2,3,4). In all mammals studied to date, calcium ishandled in different ways along the nephron segments.11.1. Proximal tubule. The majority of the filtered calcium (65%) is reabsorbed inthe proximal convoluted tubule. The ratio of the calcium concentration in tubule fluidrelative to that in plasma ultrafiltrate, TFa/UFa, is reportedly between 1.0 and 1.2 in allspecies studied to date (2,3,4). The consistent observation that TFa/UFa remains close tounity along the proximal tubule suggests that calcium reabsorption parallels sodium and fluidreabsorption in this segment. Calcium reabsorption in the proximal tubule is predominantlypassive through the paracellular pathway. A small amount of calcium reabsorption may betranscellular (2,3,4).11.2. Thick ascending limb of Henle’s loop. The thick ascending limb of the loop(TAL) corresponds to the last segment of the loop of Henle. It extends from the boundarybetween inner and outer medulla up to or just beyond the macula densa in the cortex. Thethick ascending limb, therefore, includes a medullary portion (mTAL) and a cortical portion(cTAL). The general cell organization and ultrastructure as well as the main transport3properties are similar in TAL from all species studied to present. There is a single type ofcell in each TAL portion. These cells are of a relatively small size but contain, on theperitubular cell border, many deep membrane infoldings, surrounded by a large number ofadjacent mitochondria. Junctional complexes are highly permeable to salt but relativelyimpermeable to water. Apical membranes form only few and short microvilli; they containa particular protein, the Tamm-Horsfall protein, which is characteristic of mTAL and cTALcells (5). This protein was employed as a specific marker to isolate cTAL cells in thepresent study.The TAL has been called the “diluting segment” in view of its ability to reabsorbsolutes in excess of water. The fluid delivered by this segment to the distal convolution ishypotonic and contains concentrations of NaC1 that usually range between 30% and 40% ofthat present in plasma ultrafiltrate. Other ion species have also been observed to bepreferentially reabsorbed in TAL. This is the case for potassium and for the divalent cationsCa2 and Mg2. Actually, TAL is the major site for Mg2 reabsorption in the kidney (6,7).TAL may also constitute an important site of fluid acidification and ammonia transport (8).Approximately 25% of the filtered calcium is reabsorbed in TAL. Significantquantities of calcium are reabsorbed in cTAL but not in mTAL (6). The lumen-positivevoltage that normally exists across the epithelial cells of the TAL is an important drivingforce for passive calcium reabsorption in this segment.TAL is one of the nephron segments where some hormones, such as PTH, glucagon,ADH, calcitonin, and isoproterenol, regulate NaC1 and divalent cation reabsorption (9,10,11).The increase in basolateral Cl- conductance and the activity of the apical Na-2Ci-K4cotransporter is thought to be the cellular mechanism accounting for the hormone-mediatedincrease in NaCl and divalent cation transport (12).11.3. Distal tubule and collecting duct. About 8% of the filtered calcium isreabsorbed in distal convoluted tubule and less than 2% in collecting duct. TFa/UFa fallsalong the length of the distal tubule, to about 0.3. This concentration profile, taken togetherwith the lumen-negative transepithelial potential difference, provides direct evidence for anactive Ca2 reabsorptive mechanism that proceeds against both chemical and electricalgradients. BothCa2-ATP se and Na/Ca2exchange transport processes are involved in theactive Ca2 reabsorption in these nepbron segments (13,14).III. Ca as an Intracellular Messenger[Ca2], of any cell is extremely low (— 10 M), whereas its concentration in theextracellular fluid is high (>10M). Thus there is a large chemical gradient tending to driveCa2 into the cytosol across the plasma membrane. Intracellular Ca2 is sequestered inendoplasmic reticulum (ER) and other compartments. When a signal transiently opens Ca2channels in either the plasma membrane or ER membrane, Ca2 rushes into the cytosol,dramatically increasing the local Ca2 concentration and activatingCa2-sensitive responsemechanisms in the cell. For this signaling mechanism to work, the intracellular free Ca2concentration ([Ca291)must be kept at a low concentration. This is achieved by the calciumpump,Ca2-ATP se, and by Na/Ca2 exchangers in their plasma membrane (15,16). A Ca2pump in the membrane of the specialized intracellular compartment also plays an importantrole in maintaining low [Ca2]1 (17).5In recent years it has become clear that Ca2 acts as an intracellular messenger in awide variety of cellular responses. Two pathways of Ca2 signaling have been defined, oneused mainly by electrically active cells and the other used by almost all eucaryotic cells. Thefirst of these pathways has been particularly well studied in nerve cells, in whichdepolarization of the plasma membrane causes an influx of Ca2 into the cell throughvoltage-gated Ca2 channels. In the second, ubiquitous pathway the binding of extracellularsignaling molecules to cell surface receptors cause the release of Ca2 from the calciumsequestering compartment; the events at the cell surface are coupled to the opening of Ca2channels in the internal membrane through yet another intracellular messenger molecule,inositol triphosphate (1P3). Production of this messenger results from the breakdown andsubsequent resynthesis of inositol phospholipids triggered by a receptor protein that activatesan enzyme called phosphoinositide-specific phospholipase C (PLC) in the plasma membrane.PLC cleaves phosphoinositide 4,5-bisphosphate (PIP2) to generate two products: 1P3 anddiacylglycerol (DAG). 1P3 releases Ca2 from the calcium-sequestering compartment through1P3 receptors. DAG has two potential signaling roles. It can be further cleaved to releasearachidonic acid, which can be used in the synthesis of prostaglandins and related lipidsignaling molecules; or , more important, it can activate a specific protein kinase, proteinkinase C (PKC), which can then phosphorylate a number of proteins with different functionsin the target cell.Fig. 1 summarizes the induction and function ofCa2 transients within a polarized cell.A Ca2 transient is a short burst of elevated [Ca2] induced by an extracellular signal. Twomechanisms operate to attenuate the Ca2 transient: 1) some of the 1P3 is rapidly dephosphoLuminalMembrane2+CaFig. 1.Agonist-inducedintracellularCa2elevationinapolarizedcell.Agonist-receptorinteractioninducesgenerationofthesecondmessengers,cAMP,cGMP,DAGand1P3,throughG-protein-mediatedprocesses.1P3isknowntoreleaseintracellularCa2through1P3receptorslocatedinthemembraneofintracellularCa2stores.ItalsoindirectlyactivatesCa2influxthroughCa2channelsbysomeunknownmechanisms.cAMPstimulatesbothCa2entryandCa2releasethroughcAMP-dependentproteinkinase(PKA)(18).Agonist-mediatedphysiologicalresponsescanbeelicitedbyCa2-bindingprotein(CBP),PKA,proteinkinaseC(PKC),cGMPdependentproteinkinase(PKG),andothercalcium-activatedenzymes.Low[Ca2]isachievedbyCa2-ATPaseandNaICa2exchangerintheplasmamembrane.AC:adenylatecyclase;GC:guanylatecyclase;DAG:diacyiglycerol;H:hormone;R:receptor.BasolateralMembraneCa-ATPaseNd-CeexchangerN-KATPase7rylated (and thereby inactivated) by a specific phosphatase, or further phosphorylated toform 1P4; and 2) the Ca2 that enters the cytosol is rapidly removed out of the cell, by bothCa2-ATP se and Na/Ca2 exchange.IV. Objectives of the Present StudiesThe hypotheses of the present study are as follows: Intracellular Ca2 is a part ofPTH-, AVP-, and ANP-induced signal transduction; and NaICa2 exchanger is present andplays an important role in maintaining basal intracellular Ca2 level in cortical thickascending limb (cTAL) cells. It was decided to concentrate on the cTAL segment in thisstudy because of its important role in NaC1 and divalent cation conservation.A number of hormones through their respective receptors control cellular functionwithin cTAL (11,19,20). These receptors generate cAMP (11,19), but to date no evidencehas been given to indicate that other signaling pathways, including PKC, 1P3, and [Ca21,playa role in the hormone-mediated signal transduction mechanisms in cTAL cells. The firstobjective of this study was to determine the presence of Ca2 transients or signals in cTALcells. Second, we wanted to explore some of the interactions of the various hormoneprocesses to find out how the various hormones interact to orchestrate regulatory controlsin these cells. Finally, if [Ca21 is significant in regulating function it was thought importantto determine how cTAL cells control [Ca21 . The evidence to date suggested that Na/Ca2exchange is not present in cTAL cells. Accordingly, we determined that cTAL cells containa Na/Ca2 exchange and that this exchange could be regulated by phosphorylation events.These studies indicated that Ca2 plays an important role in hormone signals.8CHAPTER 1. HORMONE-MEDIATED Ca2 SIGNALING IN cTAL CELLSI. BackgroundTo serve as intracellular messenger, a compound must meet several requirements.Most important, its intracellular concentration must be very low and precisely controlled, sothat short-lived transmembrane fluxes of the messenger would be able to change significantlyits intracellular level and thus modulate the messenger-sensitive cellular processes. Inaddition, it must bind its substrates selectively. Ca2 meets these requirements because ofthe high coordination number and irregular coordination geometry that considerably enhancethe specifity of its binding to biological molecules. It is now established that Ca2 plays animportant role as a messenger and modulator of intracellular processes. It is worth notingthat, when Ca2 is the intracellular messenger of an external stimulus, the actual signal thatinitiates the response is not Ca2 itself, but a member ofCa2-binding proteins. Theseproteins, functionally inert in the absence of bound Ca2, become active upon binding Ca2.An increase in intracellular free Ca2 ([Ca2]) caused by hormonal or electrical signals cantrigger responses such as contraction, secretion, cellular proliferation, metabolic adjustments,and changes in gene expression in addition to the control of electrolyte transport (21,22).The induction, propagation, and termination of the Ca2 signal is highly controlledby various mechanisms. The major entry of cytosolic Ca2 seems to be via calcium channelslocated in both plasma and intracellular organelle membranes. Mechanisms must also existfor the extrusion of Ca2 from cell interior, to avoid the accumulation of cytosolic calcium.The two main mechanisms are efflux of Ca2 through Na/Ca2 exchange and ATPdependent calcium pump in the membrane. In addition, intracellular release, buffering, and9sequestration of intracellular calcium stores are also involved in the dynamic processes of[Ca2] balance. To understand completely the extent of Ca2‘ s role as a second messenger,we need to elucidate how cytosolic Ca2 levels are regulated. This requires an understandingof how influxes from and effluxes to the extracellular space cross the plasma membrane.It also entails knowledge of how Ca2 is sequestered and released from both membrane-bound and nonmembranous intracellular organelles.The cortical thick ascending limb (cTAL) of Henle’s loop plays a fundamental rolein salt reabsorption within the nephron (23,24). Electrolyte transport within the cTAL cellsis sensitively controlled by many regulatory hormones including parathyroid hormone (PTH),argimne vasopressin (AVP), atrial natriuretic peptide (ANP), calcitonin, and glucagon,among others (12,25-27). The physiological concentration of these peptide hormones is lessthan 108 M. Morel et al (19) have shown that PTH, calcitonin, and glucagon stimulate cyclicadenosine monophosphate (cAMP) release in rabbit cTAL cells; accordingly, appropriatereceptors are present for these peptide hormones. In turn, these peptides acting throughcAMP and protein kinase A activation are responsible for control of electrolyte transportin the cTAL (12,23,24). In addition, these hormones may act through alternative pathways.In many cells, hormone binding to receptors activate phospholipase C with the generationof diacylglycerol (DAG) and 1P3 (28). DAG activates protein kinase C leading to specificeffects on receptor and transport function. 1P3 is a second messenger that controls manycellular processes by generating internal Ca2 signals (28). In turn, intracellular Ca2transients often activate various kinases, modify enzyme responses, and alter channel activity(29,30,31). These responses may be involved in control of epithelial NaC1 transport (23,24).10The objective of the initial studies was to establish and characterize hormone-mediated responses of intracellular Ca2 signals in isolated cTAL cells. In addition, thepossible interactions between Ca2 and other second messengers were also explored.II. Materials and Methods11.1. MaterialsDulbecco’s modified Eagles’ medium (DMEM) and Ham’s medium containing Dglucose (5.0 gIL), L-glutamine (5 mM), 10% FCS was from GIBCO (Grand Island, NY).Goat anti-human uromucoid (Tamm-Horsfall glycoprotein) serum was purchased fromOrganon Teknika (Rockville, MD), and affinity-purified rabbit anti-goat immunoglobulinG (IgG) were obtained from Sigma (St. Louis, MO); and fura-2/AM was obtained fromMolecular Probes (Eugene, OR). Parathyroid hormone, arginine vasopressin, calcitonin,glucagon, bradykinin, angiotensin II, atrial natriuretic peptide, and 8-bromo-adenosine-3’ , 5’-cyclic monophosphate (8-BrcAMP) were from Sigma. Collagenase Type V-S and 12-0-tetradecanoylphorbol 1 3-acetate (TPA) were also from Sigma. All other chemicals wereacquired from Sigma or Fisher Scientific (Mississauga, Ont.).11.2. Methods11.2.1. Isolation of cTAL cells from porcine kidneysCortical thick ascending limb cells were isolated by a double antibody techniqueaccording to previously published methods (7). This method is based on the uniquedistribution of Tamm-Horsfall protein along the surface membrane of thick ascending limbof Henle’s loop (5).1111.2.1.1. Culture dishes coated with rabbit anti-goat IgG antibody. All procedureswere performed under sterile conditions. 5 ml of phosphate-buffered saline (PBS;composition in mM: 137 NaC1, 2.7 KC1, 8.1Na2HPO4, pH 7.4) containing 80 g of affinity-purified rabbit anti-goat IgG antibody was added to each of four culture dishes (Coming, 80mm), and the dishes were incubated overnight at 4°C. Immediately before the antibody-coated dishes were to be used for inimunoadsorption, the antibody solution was aspiratedand the dishes were washed four times with 3 ml of 1% bovine serum albumin in PBS.Finally, the dishes were tilted near upright for three minutes and excess liquid was removedby aspiration.11.2.1.2. Dispersion of inner cortex tissue. Young pigs (30 50 days old) were killedwith a lethal dose pentobarbital sodium administered through cardiac puncture. The kidneyswere removed and placed in the ice cold Hepes-buffered Krebs solution (HBK; compositionin mM: 5 KC1, 145 NaC1, 1 Na2HPO4, 5 glucose, 1 CaC12, 0.5 MgCl2,and 10 Hepes; pH 7.4). Tissue from the innermost third stripe of the cortex was dissected and washed three timeswith ice cold HBK. Approximately 40 ml of 0.1 % collagenase in HBK with 1 % BSA wasadded to the cortical tissue (about 6 gm from two kidneys). The tissue was incubated at37°C for about 10 mm in a shaker. An appropriate degree of cell dispersion was evidencedby the appearance of numerous large tubule fragments. The digestion was stopped byadding appropriate amount of ice cold HBK. Cell suspension was collected through a teastrainer and centrifuged at 700 rpm for 2 mm.11.2.1.3. Isolation of cTAL cells. The cell pellet was washed three times with HBK,then, resuspended in 10 ml of DMEM/NF12 medium containing 100 l of primary antibody,12goat anti-human uromucoid serum (50 mg protein/mi). The incubation was continued for30 mm on ice with occasional swirling. The cells were then collected by centrifugation,washed twice with PBS, and resuspended in 4 ml of PBS. One ml of cell suspension wasapplied to each of four antibody-coated dishes in four successive equal aliquots. Eachaliquot was allowed to stand on the plates for 5 mm; nonadherent cells were removed withone wash with 5 ml of PBS. The dishes were washed six times with 5 ml of PBS followingthe fourth incubation. To dislodge freshly isolated eTAL cells from the dishes, 5 ml of PBSwas added to each dish and the dish was tapped sharply on the side several times with ascalpel handle. The suspended cells were then pipetted into a sterile tube and collected bycentrifugation. The cell pellet was resuspended in 3 ml of DMEM/NF12 containing 10%fetal calf serum, 5 mM L-glutamine, 50 units/mi penicillin, and 50 g/ml streptomycin. ThecTAL cell suspension was plated on glass coverslips or plastic multiwell dishes. The cTALcells grew on the appropriate support in 95-5 %, air-CO2. About one week after seeding, thesubconfluent cTAL cells were used for the experiments.11.2.2. Determination of cytosolic free Ca2The fluorescent Ca2 indicator, fura-2, is widely used for direct measurement ofintracellular free Ca2 concentration ([Ca2]1) based on its fluorescent property (32,33).When fura-2 is loaded into the cell, the dye has only two molecular forms, free and Ca2-bound. Both fura-2 and its Ca2 complex fluorescence strongly, but their excitation peaksdiffer in wavelength. Fura-2 shifts its excitation peak from about 385 nm to 335 nm uponbinding Ca2. The extent of the shift between the two wavelengths depends on the amountof intracellular Ca2 concentration. Measurements at two wavelengths suffice in principle13to indicate the ratio of bound to free dye and hence the [Ca2]1.11.2.2.1. Cell loading with fura-2. Isolated cTAL cells were loaded with 10 jM fura2/AM according to previously described techniques (34). The fluorescent dye, dissolved indimethylsulfoxide (DMSO), was added directly to the medium with the aid of Pluromc F-127(0.05%) and incubated for 30 mm at 23°C. The final concentration of DMSO in the mediumdid not exceed 0.2%.11.2.2.2. De-esterification. Fura-2/AM is hydrophobic and thus it passes easily intocells across the plasma membrane. Once inside cells, cytosolic esterases cleave theacetoxymethyl groups from fura-2 molecule rendering a compound which is highly chargedand which cannot cross cellular membranes. Thus, it is theoretically trapped in the cytosol.Since the incomplete de-esterification of the dye in cytoplasm will interfere with the [Ca2]1measurement cells loaded with fura-2 should be de-esterified completely. Loaded cells werewashed 2X with a buffered salt solution (in mlvi): 145 NaCl, 4 KC1, 1 CaC12, 1 KH2PO4, 18glucose, and 20 HEPES/Tris (pH 7.4) with or without Ca2 depending on the differentpurpose of the experiments. The cells were incubated a further 20 mm to ensure completede-esterification and finally washed with fresh buffer solution.11.2.2.3. Determination of [Ca291. Glass coverslips, with cTAL cells loaded with fura2, were mounted in a plexiglass chamber containing 250 l buffer and placed on themechanical stage of a Nikon inverted microscope with a Fluor xlOO objective, andfluorescence was monitored under oil immersion within a single cell over the course of study.The fluorescence signal was recorded at 505 nm with excitation wavelengths alternatingbetween 335 and 385 nm using a spectrofluorometer (Deltascan; Photon Technologies,14Santa Clara, CA). Averaged light intensities over excitation periods at each of the twowavelengths were used to calculate 338/385 ratios after background substraction. At the end,[Ca2]1was calculated as described by Grynkyewicz et al (35) and Malgaroli et a! (36) basedon the equation:[Ca29 = KD(R-R/R,-R)S/Sb2Where KD is the association constant; R is the fluorescence ratio at the excitationwavelengths 335/385 nm for uncomplexed fura-2 (zero calcium); R is the ratio offluorescence at the wavelengths 335/385 nm for fura-2 saturated with Ca2; S and 5b2 arethe fluorescence intensities at 385 nm with zero Ca2 and excess Ca2, respectively; R is theratio of fluorescence at wavelength ratio 335/385 nm of the sample to be measured. Usingratios, dye content and instrumental sensitivity are free to change between one ratio andanother since they cancel out in each ratio. Of course, stability is required within eachindividual ratio measurement; also R, Rmin and Rm, should all be measured on the sameinstrumentation so that any wavelength biases influence all of them equally.The bothing solution was changed by a superfusion-suction system. The givenhonnone concentrations were added to the bathing solution without changing buffer.All results are expressed as mean ± S.E. where indicated. Significance wasdetermined by one-way analysis of variance. A probability of p <0.05 was taken to bestatistically significant.ifi. ResultsThe isolated cTAL cells when grown to confluence have a morphological appearance15of epithelial cells. They had cuboidal structure when grown on filters and developed smalldomes, five to six cells in diameter, when cultured on solid supports for an extended periodof time. The morphological appearance is consistent with the observations of Allen et al(37). The cTAL cells possessed Na/K/Cl cotransport as indicated by bumetamide sensitive86Rb uptake, amounting to 40% of control uptake pmol.mg protein’.min1 (n = 3). Thesecells also possessed sodium-dependent phosphate transport function demonstrated by 32Puptake. 32P uptake in the presence of Na was significantly greater than that in the absenceof Na, 73.7 ± 2.0 and 38.52 ± 3.5 pmol.mg proteinE’.min’ respectively (n = 6, p <0.01).The above assayed characteristics indicate that the cultured cells have retained many of thefunctions typical of thick ascending limb cells.Porcine cTAL cells possess a large number of receptors as illustrated by hormone-induced Ca2 transients (Fig.2). Parathyroid hormone (PTH, basal [Ca2]1, 86±5 nM, tostimulated peak concentrations of 608 ± 99 nM, n= 7), glucagon (74 ± 8 to 690 ±257 nM, n=4),argimne vasopressin (AVP, 78 ± 3 to 766±162 nM, n= 6), calcitonin (97 ± 3 to 973 ± 79 nM,n=3),bradykinin (83±8to 843±89nM, n=3),angiotensin II (Ang.II, 80±6to 923±187nM,n=3), atrial natriuretic peptide (ANP, 104 ± 6 to 653±112 nM, n=4), the truncated analogueof ANP, C-ANP-(4-23) (82±1 to 427 ±41 nM, n=5), and its analogue, C-type natriureticpeptide (CNP, 84±4 to 209±18 nM, n=5) elicited Ca2 transients when applied at maximalhormone concentrations (10 M). The hormones were added where indicated (Fig .2) andnot removed throughout the study. These studies confirm that numerous hormonalreceptors are present in porcine cTAL cells and show for the first time that activation of thereceptors are associated with an increase in [Ca2]. It is likely that these transient increases16800PTH Glucagon AVPCalcitonin sec Bradykinin Mg. II800600- ANP CNP C-ANP-.-(4-23)400 V2OFig.2. Hormone-mediated Ca2 signals in isolated porcine cortical thickascending limb (cTAL) cells of Henle’s loop. Parathyroid hormone (PTH),glucagon, arginine vasopressin (AVP), calcitonin, bradykinin, angiotensin II(Ang.ll), atrial natriuretic peptide (ANP), C-type natriuretic peptide (CNP)and the truncated analogue of ANP (C-ANP-(4-23)) were added, whereindicated, at concentrations of 1O M. Intracellular free Ca2 concentration([Ca2]1)was determined by microfluorescence on single subconfluent cTALcells using fura-2. Illustrations are representative of 3-7 cells for eachhormone.17in [Ca2]1are part of the intracellular signaling processes which may play an important rolein cell function. It would seem important to characterize these Ca2 transients to betterunderstand hormonal controls and interactions among the hormone-mediated signaltransduction processes. In the present study, PTH-, AVP- and ANP-induced Ca2 transientswere further characterized with fluorescent techniques.111.1. PTH-induced Ca2 transientsPTH resulted in a dose-dependent increase in [Ca2]1 with a half-maximal Ca2response using about 10- M hormone concentration (Fig.3). As shown in Fig.2, PTHinduced Ca transient was composed of two phases. The first phase was very fast andmaintained only about 50 sec.; the second phase was slow and sustained for more than 200sec. These two phases might derive from different sources and controlled by differentmechanisms.To verify the contribution of Ca2 entry across the plasma membrane to the PTHmediated Ca2 transient, mfedipine (a Ca2 channel blocker), nominal Ca2-free solution, andcalcium analogue, Mn2, were applied to cTAL cells before or during PTH administration.In normal cTAL cells, 1O M PTH induced elevation of [Ca2], from basal 86±6 nM to607 ±99 uM, n=7. Pretreatment of the cells with mfedipine diminished the increment in[Ca2j (Fig .4). Basal [Ca2]1was 86 ± 4 nM which rose to 218±111 nM following 10 M PTHand rapidly returned to basal levels of 95±9 nM, n=4, within 95 sec. In the absence ofexternal Ca2 (Ca20) and with the addition of 0.5 mM EGTA to the bathing solution, Ca2transient was mitigated (Fig .4, basal 85±5 to 472±121 nM, n = 3, P <0.05). Next, we usedMn2 to define the component of calcium entry versus intracellular Ca2 release. Mn2 is186005004003000200-1000 I I—12 —10 —8 -60 10 10 10 10[PTH] MFig.3. Dose-dependent increases in [Ca2]1with PTH. PTH was added to theperfusion solution bathing the porcine cTAL cells at the concentrationsindicated. A[Ca21is the difference between maximal [Ca2] concentration andthe basal levels of [Ca2] measured in resting cells. Values are mean ± SEand represent responses in 3-7 individual cells.19800 -PTH/ Control600- / fepine400OCa,0.5mM EGTA200 -0- I I I I I0 100 200 300 400TIME secondsFig .4. Characterization of PTH-induced Ca2 transients in porcine cTAL cells.Nifedipine, 10 tM, was added with 10 M PTH where indicated. Also shownis the effect of removal of external Ca2 from bath buffer solution with theaddition of 0.5 mM EGTA 5 mm before treatment with PHT. Fluorescencetracings are representative of 3-4 cells for each manipulation from differentcell preparations.20able to enter the cell through Ca2 channels and quenches fura-2 fluorescence. As shownin Fig.5, Mn2 quenched the dye during the stimulation with PTH, indicating that Ca2channels in the plasma membranes are involved in the PTH-induced Ca2 transients.The above results suggest that PTH releases intracellular Ca2 and initiates Ca2 entryacross the plasma membrane of the eTAL cell. To assess the source of PTH-induced Ca2release, we used thapsigargin, a specific inhibitor of microsomal Ca2 adenosinetriphosphatase (ATPase) which depletes endoplasmic reticulum Ca2 stores (38,39).Thapsigargin (1.5 M) did not by itself alter resting [Ca2]1 levels in the cTAL cells.Thapsigargin added to the buffer solution 30 mm, prior to the addition of iO M PTH,diminished the hormone-mediated increment in [Ca2J1 (basal 86±3 to 220±44 nM, n=7,P < 0.05) (Fig.6). These data suggest that endoplasmic reticulum Ca2 stores are importantin PTH-mediated Ca2 signaling.In summary, PTH administration leads to concentration-dependent transientincrements in [Ca2] which results, in part, from intracellular release from endoplasmicreticulum and, in part, from entry of Ca2 across the plasma membrane.21PTH & Mn214 -385 nM12 -zo 10-C.)w—.Cf)0LU ,zD0020- I0 100 200 300 400TIME secondsFig.5. Changes in fluorescence emission at 335 and 385 nm excitationwavelengths with MnC12. 0.5 mM MnC12 was added into bath solution with10 M PTH where indicated. Fluorescence tracings are representative of 3cells.22800600PTHC400-200TGII100 200 300 400TIME secondsFig.6. The effect of thapsigargin on PTH-induced Ca2 transients. 1.5 mMthapsigargin (TG) was added 30 mm prior to the addition of 10 M PTH.Fluorescence tracing is representative of 3 cells.23111.2. AVP-mduced Ca2 transientsAVP induces an increase in [Ca24] in a dose-dependent fashion (Fig.7). The hormoneconcentration necessary for half-maximal response is in order of 5.0x109M. Next, we usedvarious approaches given above to determine the source of Ca2 in the signaling process.Nifedipine, Ca2-free bath buffer solutions (Fig.8), Mn24 (Fig .9), and thapsigargin (Fig. 10)were used to determine the source ofCa2 transients mediated by AVP. The AVP-mediatedCa2 signal appears to be mainly composed of intracellular Ca2 release followed by Ca2entry into the cytosol. This conclusion is based on the observation that the removal of Ca20from the bath buffer solution and the addition of 0.5 mM EGTA inhibited AVP-inducedCa24 increase by a small amount (395 ± 62 nM, n= 3, P <0.05 ,compared to stimulated controlvalues) (Fig.8). Nifedipine did not significantly diminish the maximal [Ca2] increase (basal,89±4 to stimulated, 538 ±203 nM, n=4, P >0.05)(Fig.8). Thapsigargin completely abolishedthe Ca24 signal ([Ca24j changes: 83±7 to 83±7 nM, n=3) (Fig.10).In summary, AVP-mediated Caz+ transients are dose-dependent and result from bothintracellular Ca24 release and Ca24 entry across the plasma membrane. Compared withPTH-mediated Ca2 transients, intracellular Ca2 release contributes a major part to theAVP-mediated Ca2 signal.24800600C - -c’ic 400-0I -200 -0- I-13 -11 -510 10 10EAVP] MFig.7. Dose-dependent initiation of Ca2 transients with AVP in cTAL cells.AVP was added at the concentrations indicated and A([Ca2]1)represents thechange from basal to peak [Ca29concentrations. Values are mean ± SE for4-7 cells per concentration.25800600-400-c.4ts0200 -00TIME secondsOCa. 0.5mM EGTA300 400Fig.8. Characterization of AVP-induced Ca2 transients in cTAL cells. 10 ILMmfedipme was applied to the cell prior to application of 10 M AVP(representative of 4 cells from different preparations). Also shown is arepresentative experiment, one of three, in which external Ca was removedfrom the bath and 0.5 mM EGTA added 5 mm before treatment with 10 MAVP.AVPControlNifecpineI—100 20026120- AVP & Mn100- V385 nm9 80-0C)w -0- I I I I I I0 100 200 300 400TIME secondsFig.9. The effect of Mn2 on fluorescence emission. 0.5 mM MnC12 wasadded to external buffer solution with 1O M AVP. The fluorescence emissionwas recorded at 335 and 385 rim excitation wavelengths (representative of 3separate experiments).27800-600 -• TG&AVP400-02000- I0 100 200 300 400TIME secondsFig. 10. Effect of thapsigargin on AVP-induced Ca2 transients. Thapsigargin(TO, 1.5 M) was added 30 mm prior to the application of 10 M AVP. Thistracing is representative of 3 individual cells.28111.3. cAMP-mediated Ca2 transientsWe have previously reported that many of the peptide hormones used herestimulated cAMP generation in primary porcine cTAL cells grown in culture (7,20). cAMPis known to elicit elevation in [Ca2], which may be involved with intracellular signaling (18).Accordingly, we tested the effect of cAMP on [Ca2]1 in the porcine cTAL cells. Fig. 11illustrates a representative experiment which shows that 8-BrcAMP induces an increase in[Ca29(basal, 83±3 to stimulated 427 ±48 nM, n=3). In all of the cells studied, the increasein [Ca2]1with 8-BrcAMP returned to basal levels within 60-120 sec following initiation. Therapid return to basal levels suggests that the second phase, in which Ca2 entry is nonnallyobserved, is absent, i.e. cAMP releases intracellular Ca2 but does not activate Ca2 entry.8-BrcAMP-induced Ca2 transients were not affected by either addition of nifedipine ([Ca2]1changes: 86±4 to 390±30 nM, n=4) or the removal of external Ca2 ([Ca2]changes: 84±6to 517±142 nM, n=4) (Fig. 11). Mn2 did not significantly quench fluorescence during 8-BrcAMP administration (Fig. 12) and thapsigargin completely inhibited the cAMP-inducedCa2 signal ([Ca2]1changes: 81±1 to 87±4 nM, n=4) (Fig. 13).We next determined the effect of cAMP on hormone-mediated Ca2 signalling. Wepostulated that pretreatment with cAMP would deplete intracellular Ca2 stores and diminishor abolish the PTH- and AVP-mediated [Ca2] transients. cTAL cells were pretreated with8-BrcAMP for 30 min prior to the addition of maximal concentration of PTH or AVP(Fig. 14A, Fig. 14B). Pretreatment of cTAL cells with 8-BrcAMP abolished the PTHmediated response ([Ca2], changes: 87 ± 1 to 94±8 nM, n=5) and diminished the AVPmediated response ([Ca2], changes: 87±2 to 300±86 nM, n=3). As PTH and AVP induce298008—BcAMP600 IControlII0 100 200 300 400TIME secondsFig. 11. Cyclic adenosine monophosphate (cAMP) induces Ca2 transients inporcine cTAL cells. Where indicated lO M 8-bromo-adenosine-3’,5’-cyclicmonophosphate (8-BrcAMP) was added to cell bath solution. Arepresentative Ca2 transient is shown, as well as the effect on 8-BrcAMP-induced Ca2 transients of 10 M mfedipine prior to 8-BrcAMP applicationand the removal of external Ca2 and addition of 0.5 mM EGTA.Fluorescence tracings are representative of 3-5 cells of each manipulation.30cAMP & Mn280385nma: 160-IHI— 120-D -0o 80-40 -0—. I I I I0 100 200 300 400TIME secondsFig. 12. The effect of Mn2 on fluorescence emission. 0.5 mM MnC12 wasadded to external buffer solution with 1O M 8-BrcAMP. The fluorescenceemission was recorded at 335 nm and 385 rim excitation wavelengths(representative of 3 separate experiments).31800 -600 -- TG & 8—BrcAMP400-0V200 -0- I I I I I0 100 200 300 400TIME secondsFig. 13. The effect of pretreatment of thapsigargin on the effect of 8-BrcAMP.Thapsigargin (TO, 1.5 LM) was added 30 mm prior to the application of 1OM 8-BrcAMP. This tracing is representative of 3 individual cells.32800 A 800 B600 600PTH AVP400 j 400V200 2000 0.0 100 200 300 400 0 100 200 300 400800 c 800 DPTH AVP AVP PTH600 I 600 IV V V Vs____________ ____________0 200 400 600 0 200 400 600TIME secondsFig. 14. Effect of cAMP-induced depletion of intracellular Ca2 stores onagonist-induced Ca2 transients. cTAL cells were pretreated with 8-BrcAMP(10 M) for 30 mm prior to addition of A. PTH (1O M), or B. AVP (10 M).C. Illustration of the results following pretreatment of cTAL cells with PTH(1O M) followed 20 mm later by an AVP (10 M) challenge. D. The effectof pretreating cTAL cells with 10 M AVP followed by the addition of 10 MPTH where indicated. Traces are representative of 3-5 cells for eachexperimental manoeuvre.33receptor-mediated cAMP generation in cTAL cells (7), we tested the effect of PTH andAVP pretreatment on the ability of these agonists to induce changes in [Ca2], (Fig. 14C,Fig. 14D). Pretreatment of cells with maximal concentrations of PTH for 5 —20 mm priorto addition of AVP diminished the AVP response ([Ca2]changes: 88±4 nM prior to AVPand 319±39 nM post-AVP treatment, n=5, P <0.05, compared with control-stimulatedlevels). Pretreatment with AVP for 5 20 mm prior to the addition of PTH inhibited thePTH-induced [Ca2]1response ([Ca2]1changes: 85±4 to 127 ±28 nM, n=5, P <0.01). Thesestudies suggest that receptor-mediated generation of cAMP depletes intracellular Ca2 storesresulting in a refractory cell, which does not respond to a subsequent application ofhormone. Furthermore, these data suggest that PTH and AVP access similar intracellularCa2 stores probably through cAMP mediation. Hormone stimulation of adenylate cyclaseand cAMP generation diminishes intracellular Ca2 pools in the presence of enhanced Ca2entry from extracellular sources. Further studies are warranted to define the specificintracellular Ca2 stores and mechanisms whereby these two hormones access these stores.111.4. The effect of protein kinase C on hormone-mediated Ca2 transientsHormone-receptor coupling generates 1P3 and DAG which activate PKC, and cAMPwhich activates protein kinase A (PKA) (18,20). Accordingly, it was considered essential todetermine the interaction of these two signaling pathways for each of the prototypichormones, PTH and AVP. Activation of protein kinase C with phorbol esters did notinitiate any changes in basal [Ca2] in cTAL cells (data not shown). However, pretreatmentof cTAL cells with the phorbol ester, 12-0-tetradecanoyl-phorbol 13--acetate (TPA), led toan inhibition of PTH-induced rise in [Ca291(85 ± 3 to 85±3 nM, n 5). Similar pre-treatment34abolished AVP-induced and cAMP-induced increases in [Ca2]1 respectively (Fig. 15). Todetermine whether the inhibition with TPA was related in turn to protein kinase Cactivation, we treated eTAL cells for a prolonged period with phorbol esters to down-regulate this enzyme and then challenged the cells with agonists (40). If protein kinase Cactivation inhibited hormone-dependent Ca2 transient, then in the absence of this enzyme,PTH and AVP would be effective. Following treatment of cells for 16 hours with TPA, weapplied maximal concentrations of PTH (10 M), AVP (10 M) and cAMP (10 M). Indown-regulated cells, PTH resulted in an increase in [Ca2] from 91±6 nM to 111±11 nM,n=4(Fig.15A) and AVP, 81±2nM to 206±15 nM, n=5 (Fig.15B) and cAMP, 95±8nM to239±5OnM, n=3 (Fig.15C).These data indicate a partial return of agonist-mediated responses following down-regulation of PKC activity with prolonged phorbol ester treatment. These results furthersupport the notion that PKC interacts in a specific way with agonist-mediated changes inCa2 signaling which may play a physiological role in modulating receptor-mediatedresponses.111.5. ANP-induced Ca2 transientsCortical thick ascending limb plays an important role in salt reabsorption within thenephron. Electrolyte transport within the cTAL cells is sensitively controlled by manyregulatory hormones (11,19,20,41). There is some controversy as to whether ANP is one ofthese regulatory hormones. ANP acts through receptors to cause vasodilation, an increasein urinary flow and sodium excretion, and a reduction in blood volume (42,43,44). Theprincipal renal actions of ANP are localized in the glomerulus and collecting tubule (42,43)35400- A300- m TPAl6hrsTPA3Omin200 VWA - ---0 -400-B300 AVP200TPA100 —‘N---7 - --- -0400 c300 8-&cAv— 200iO0j/0.0 100 200 300 400TIME secondsFig. 15. Effect of protein kinase C activation on agonist-induced Ca2transients in cTAL cells. Where indicated, cTAL cells were pretreated with12-O-tetradecanoylphorbol 13-acetate (TPA, 1O M) for 30 mm prior toexperimentation. A.PTH (10 M); B. AVP (1O M); or C. 8-BrcAMP (10 M)were added where indicated. Fluorescence tracings are representative of 3 5cells for each experiment. In a separate series of experiments the effect ofprolonged phorbol ester treatment on agonist-induced Ca transients in cTALcells were determined. Where indicated, cTAL cells were treated with TPA,10 M, for 16 irs to down-regulate protein kinase C activity. Ca2 transientswere determined with microfluorometry following: A. PTH (10 M); B. AVP(10 M); and C. 8-BrcAMP (10 M) treatment. Fluorescent tracings arerepresentative of 3-5 cells.36but some reports suggest that ANP may have other actions within the kidney (44,45). Firstis the observation that ANP administration results in an increase in urinary magnesiumexcretion in addition to sodium excretion (43). As magnesium is reabsorbed principally inthe thick ascending limb, it would suggest an action for ANP at this site (41). Anotherpossible role for ANP is related to Cl transport. Bailly et al (46) have provided directevidence for cGMP action on chloride transport in the thick ascending limb. However, asANP probably does not stimulate cGMP in rat or rabbit thick ascending limb segments, thelinic between ANP and Cl-transport is tenuous (47,48). Thus, there is some controversyconcerning the presence of ANP receptors, the intracellular signals generated, and thefunction of ANP in the cTAL on the ioop of Henle.The natriuretic peptide family includes the 28-amino acid peptide, called atrialnatriuretic peptide, ANP, which is the major circulatory form of atrial peptide (49) and twoanalogues, C-type natriuretic peptide (CNP) and brain natriuretic peptide (BNP). CNP isthe most abundant natriuretic peptide in the brain and is not present in peripheral tissues(50,5 1). BNP is found in high concentrations in the heart (52). ANP and BNP are thoughtto recognize a common ANPA receptor that possesses guanylyl cyclase activity (53). CNPrecognizes a different receptor subtype called ANPB that is structurally distinct from theANPA receptor, but also possesses a guanylyl cyclase domain (54). The ANPC receptor bindsANP, CNP, and BNP, and is not coupled to guanylyl cyclase (45,55). This receptor wasoriginally proposed to only function in clearing its ligands from the extracellular fluid, sinceit did not mediate the known renal functions of the natriuretic peptides (56). However,ANPC may also mediate biological effects such as inhibition of the adenylyl cyclase system37(44,45,57).Various ANP analogues were used to elicit changes in [Ca2]1 in isolated porcinecTAL cells (Fig .2). Addition of vehicle alone to the perfusion solution did not alter [Ca2]These data suggest the presence of ANP receptors in porcine cTAL cells. The effect ofANP on the change in [Ca291was dose dependent with a half-maximal response in the orderof 5x108M ANP concentration (Fig. 16).The profile of the Ca2 transient suggested that it may be composed of intracellularCa2 release as well as entry across the plasma membrane (Fig .2). The following studiesdemonstrate that ANP-induced Ca2 transients include intracellular Ca2 release , likely fromendoplasmic reticulum, and entry of extracellular Ca2 into the cell through activation ofCa2channels. First, we performed studies in the absence of external Ca2. Fig. 17 summarizesthese results. Removal of Ca20 and the addition of 0.5 mM EGTA to the bathing solutionmitigated the rise in [Ca21([Ca29 changes: 80±6 to 345 ± 120 nM, n3, P <0.05 comparedwith control Ca2 transients) which was induced by 10 M ANP. Second, we used nifedipine,a Ca2 channel blocker, to determine the role of Ca2 channels in the ANP-induced Ca2signaling (Fig. 17). Addition of nifedipine, 10 jIM, 30 mm before the addition of 10 M ANPalso diminished the [Ca2i response ([Ca21, changes: 91±3 to 167±25 nM, n=5, P <0.05compared with control Ca2 transients). Finally, by using other divalent cations, such asMn2,that interact withCa2-sensitive fluorescent dyes, it is possible to determine the relativeimportance of Ca2 release from intracellular stores and Ca2 entry across the plasmamembrane in the signaling system (38). In the presence of extracellular Mn2, agonistinduced intracellular Ca2 release may cause an initial increase (from intracellular38800600 -C400-0I200 -0- // I I I I10_jo io io_6[ANP] MFig. 16. Dose-dependent initiation of Ca2 transients with ANP in cTAL cells.A([Ca2]1)is the change from basal-to-peak [Ca2]. Values are means ± SEfor 3-5 cells.39800 -ANP/ Normal600- // NifedipineOCa, 0.5mM EGTA400- /2/0-- I I0 100 200 300 400TIME secondsFig. 17. Characterization of ANP-induced Ca2 transients in cTAL cells. Arepresentative experiment (1 of 3) in which Ca2 was removed from bath and0.5 mM EGTA added 5 mm before treatment with 10 M ANP; also shownis effect of 10 jM nifedipine applied to cell 30 mm before application of 10M ANP (representative of 5 cells from different preparations).40compartments) in fura-2 fluorescence that is followed by quench of fluorescence as Mn2crosses the plasma membrane into the cell. Fig. 18 illustrates a representative experimentin which 1O M ANP lead to an initial increase in 335 nm and decrease in 385 nmfluorescence, which we interpret to be intracellular Ca2 release followed by a quench offluorescence in both channels due to Mn2 entry. Note that the quench of fluorescence byMn2 entry continues even the [Ca2]1has returned to control levels, indicating that the Ca2channels are still activated when the Ca2 signal has been terminated (Fig. 18).Next, thapsigargin was used to assess the source of ANP-induced Ca2 release. 1.5M thapsigargin added to the buffer solution 30 mm before the addition of 1O M ANPdiminished the hormone-mediated increment in [Ca2]1([Ca21changes: 88±5 to 147 ±37 nM,n=6, P <0.05 compared with control Ca2 transients) (Fig. 19). These data suggest thatendoplasmic reticulum Ca2 stores are important in ANP-mediated Ca2 signaling.One of the second messengers of ANP following binding to ANPA receptors is cGMP.8-Bromo-cGMP (8-BrcGMP), 10 M, does not alter [Ca2]1 (90±6 to 82±5 nM, n=4) inporcine cTAL cells. Moreover, as shown in Fig .20, when the cTAL cells were pretreatedwith 8-BrcGMP, they became refractory to ANP (basal [Ca2]1,83±5 nM, and following 10M ANP, 88±9 nM; n=6). These data indicate that ANP-induced Ca2 changes may beinhibited by prior treatment with cGMP.4112 -ANP & Mn210335nMo 80LUCI): -LU 8-zo 4-02—0- I I I0 100 200 300 400TIME secondsFig. 18. Changes in fluorescence emission at 335 nm and 385 nm excitationwavelengths with 0.5mM MnC12 in external buffer solution. ANP (10 M) wasadded where indicated (representative of 3 separate experiments).&1L42800 -ANP600-/ControlI0 100 200 300 400TIME secondsFig. 19. Effect of thapsigargin on ANP-induced Ca2 transient. Thapsigargin(TG, 1.5 M) was added 30 mm before application of 1O M ANP(representative of 6 cells).43400 —300 -8-BrcGMP ANP200C)V1000-_______//I // I I0 100 2100 2200 2300TIME secondsFig.20. Effect of 8-BrcGMP pretreatment on ANP-mediated Ca2 transients.Primary cTAL cells were pretreated with 8-BrcGMP (l0 M) for 20-30 mmbefore addition of ANP (10 M). Fluorescent tracing is representative of 6cTAL cells.44IV. DiscussionMany hormones interact to orchestrate the regulation of salt transport in the cTALof the loop of Henle (23,24,25,58,59). It is clear that many of these hormones act throughreceptor-activation of adenylate cyclase and the increase in cAMP (22,23). Morel andcolleagues (18,19,60) have shown that the adenylate cyclase is sensitive to PTH, AVP,calcitonin, and glucagon in cTAL segments of rat and rabbit. These hormones also stimulatecAMP elevation in isolated porcine cTAL cells (7). An additional signaling pathway forthese hormones involves receptor-mediated increase in [Ca2]1either through stimulation ofmembrane-bound phospholipase C and the formation of 1P3, or activation of receptor-operated Ca2 channels (28,29). There is also growing evidence that inositol phosphates mayhave direct effects on Ca2 channels within the plasma membrane (28). In turn, theintracellular Ca2 transients may alter transport directly through modification of channelfunction or indirectly through activation ofCa2-dependent kinases (29,61,62). The presentstudies show that a number of hormones, including PTH, AVP, calcitonin, glucagon,bradykinin, angiotensin II, and ANP, initiate Ca2 transients in isolated porcine cTAL cells(Fig.2). In order to understand the hormonal control of salt transport in the cTAL, it isimportant to know the sources and interaction of these Ca2 signals.IV. 1. PTH- and AVP-induced Ca2 transientsThe present data indicate that Ca2 transients induced by PTH and AVP arecomposed, in part, by intracellular Ca2 release and, in part, by movement of Ca2 into thecell across the plasma membrane. The evidence includes the mitigation of hormone-induced45Ca2 transients by removal of external Ca2, and the inhibition ofCa2 release by thapsigargin(Fig4, Fig.6, Fig.8, Fig. 10). Interestingly, mfedipine inhibited the Ca2 entry following PTH,but was not effective in the AVP-induced [Ca21 elevation (Fig.4, Fig.8). The latterobservation was also the conclusion of Nitschke et al (63) in perfused rabbit cTAL segmentsin which these investigators reported that AVP-induced Ca2 transients were partly due tointracellular Ca2 release and partly from Ca2 influx. They were unable to block Ca2 entrywith mfedipine. These studies suggest that PTH and AVP lead to entry of Ca2 into thecytosol by different mechanisms, such as nifedipine-insensitive calcium channels.Our studies indicate that the secondary messenger, cAMP, may release intracellularCa2 which may be important in the receptor-mediated Ca2 transient. This was not detectedin the perfused rabbit cTAL segment (27). The reason for the difference in these findingsis not apparent at the present time. The second messenger, cAMP, has been shown torelease intracellular Ca2 leading to the initiation of Ca2 signals in many different cell typesincluding renal epithelium (17,40,64,65,66). In the present studies, we consistently observedan increase in [Ca29 with 8-BrcAMP (Fig. 11). Interestingly, the increments in cytosolic Ca2appear to be from internal sources rather than entry through activation of Ca2 channels.There is no evidence for the presence of cAMP-activated Ca2 channels in this cell type(29,63). However, the present data do not rule them out as the PTH and AVP signals maybe due, in part, to receptor-mediated or1P3-mediated Ca2 entry (28,29). The present datawould suggest that cytosolic Ca2 activity may be mediated by cAMP and/or IP3 release ofCa2 and Ca2 entry across Ca2 channels. Furthermore, our evidence suggest that cAMPelevates [Ca2]1through an1P3-sensitive pool. Thapsigargin depletes Ca2 from1P3-sensitive46pooi in a variety of cell types by specific inhibition of nonmitochondrial microsomal Ca2-ATPase activity without affecting inositol phosphate levels (67). Thapsigargin inhibited thecAMP-induced increase in [Ca29 (Fig. 13). Thapsigargin also inhibited the Ca2 transientsassociated with PTH and AVP treatments. It is unknown if PTH or AVP releaseintracellular Ca2, possibly by an 1P3-dependent mechanism (40), directly or through thestimulation of cAMP.Treatment of porcine cTAL cells with TPA resulted in diminished PTH-. AVP-, andcAMP-mediated Ca2 signals (Fig. 15). Other studies have reported that activation of proteinkinase C with phorbol esters inhibits agonist-induced Ca2 mobilization in many different celltypes (68-72). The result obtained with phorbol ester treatment suggests that the inhibitoryeffect of hormonal induction of Ca2 release from an internal store is, at least in part,mediated by protein kinase C which may provide a negative feedback control on receptor-mediated Ca2 mobilization. Because phorbol esters also diminish the cAMP response, itis likely that protein kinase C activation inhibits internal Ca2 release. Although theseobservations demonstrate that protein kinase C is responsible for the negative feedback onagonist-induced Ca2 transients, it is not clear if this enzyme is also involved with receptordesensitization as has been shown for other cells (73,74).PTH and AVP, as well as glucagon and calcitonin are thought to act on the samepool of adenylate cyclase (20). Elalouf and colleagues (73,74) have shown thatadministration of AVP to hormone-depleted rats rapidly desensitizes or down-regulatesreceptor density in the TAL. They also report that AVP desensitization is specific asglucagon and calcitonin were not affected by the prolonged presence of pharmacological47doses of AVP. The present studies, using Ca2 signals, suggest that AVP desensitization inporcine cTAL cells may be non-specific with PTH as treatment with large amount of eitherAVP or PTH led to inhibition of both AVP- and PTH-mediated Ca2 signals (Fig. 14).Additionally, the present data suggest that cAMP and DAG, the second messengers, likelythrough protein kinase A and protein kinase C activation, may mediate desensitization.Further studies are required to determine if these second messengers cause desensitizationthrough diminished receptor density or inhibition of intracellular Ca2 release.Based on our experimental results, we propose the following mechanisms wherebyPTH and AVP induce Ca2 signals in cTAL cells. PTH and AVP act on their respectivereceptors to activate a receptor-coupled G-protein. The G-protein transduces the signal tophospholipase C and results in generation of 1P3 and DAG. 1P3 liberates Ca2 from the 1P3-sensitive Ca2 store, which by some unknown mechanism activates Ca2 influx through Ca2channels in order to refill the Ca2 store (31). PTH and AVP, through 1P3 access the sameintracellular Ca2 pooi to elevate [Ca2]. The elevated [Ca2]1together with DAG, activatesprotein kinase C to reduce the elevated [Ca2]1 and limit hormonal action. Activation ofprotein kinase C may also play a role in desensitization or down-regulation of specificreceptors (75). This system is also regulated by cAMP. Again, through hormone-receptormediation, adenylate cyclase is activated and increases cAMP generation which in turnreleases intracellular Ca2 and depletes Ca2 stores. Since TPA also inhibits cAMP-inducedCa2 release, it is likely that cAMP works on the same signal cascade leading to the 1P3receptor of the endoplasmic reticulum, thus initiating Ca2 release or re-uptake. The 1P3-dependent and cAMP-dependent Ca2 pools would appear to be the same in these cells.48However, cAMP does not increase Ca2 entry as do the receptor agonists, PTH and AVP;it is likely that 1P3 somehow leads to the increase in Ca2 influx, probably through 1P3-mediated responses, whereas cAMP only works on intracellular Ca2 release.IV.2. ANP-induced Ca2 transientsAtrial natriuretic peptide is involved in the endocrine regulation of fluid andelectrolyte balance. It links the heart and other organs involved in the control ofcardiovascular function and body water homeostasis through specific receptors on the targetorgans (76). Three distinct receptors have been identified for ANP-derived agonists. Thereceptor ANPA binds ANP and BNP, leading to the stimulation of guanylyl cyclase andcGMP generation (53). The second receptor, ANPB, responds to CNP, again resulting in anincrease in cGMP (54). Finally, ANP and CNP bind the ANPC receptor, which is notassociated with an increase in cGMP (45). This receptor is thought to function as aclearance receptor (56). The evidence for this involves receptor binding of ANP and rapidinternalization into the cell where the ligand is hydrolysed and the receptor is recycled backto the membrane (56). This receptor is responsible for the rapid clearance rate of ANP andits analogues (56). The evidence provided here suggests that porcine cTAL cells possessthese ANPC receptors, since ANP, CNP, and C-ANP-(4-23) elicit Ca2 signals (Fig .2). Ourstudies would support the hypothesis that the ANP receptors in cTAL cells are clearancereceptors that are not directly associated with cGMP stimulation. In earlier studies, Butlenet al (77) failed to detect 131-labeled ANP binding in the loop, and Chabardès et al (47)failed to show an increase in cell cGMP with ANP in rat and rabbit thick ascending limb49segments. These observations are consonant with those of Nonoguchi et al (48) usingmicrodissected thick ascending segments from rats. However, another study from the samelaboratory localized mRNA to guanylyl cyclase-coupled ANP receptor in ascending segmentsusing reverse transcription and polymerase chain reaction (78). These workers concludedthat specific mRNAs encoding ANP receptors are broadly expressed along the nephron,raising the possibility that multiple sites of ANP action are present (78). Further studies arewarranted to define receptor-mediated interaction of salt reabsorption within the loop ofHenle.Similar to PTH and AVP, atrial natriuretic peptides (ANP, CNP, and C-ANP-(4-23))induce receptor-mediated Ca2 transients in porcine cTAL cells (Fig.2). The ANP-inducedCa2 signals are due, in part, to intracellular Ca2 release, likely from endoplasmic reticulum,and in part, to influx of Ca2 into the cytosol across the plasma membrane (Fig. 17, Fig. 18,Fig. 19). As cGMP does not alter [Ca29, in these cells, it is probable that the Ca2 signalsinvolve receptor-mediated 1P3 generation leading to Ca2 release from intracellular stores.Hirate et a! (79) reported that ANP binding to ANPC receptors may lead to phosphoinositidehydrolysis, which would inferentially lead to 1P3-mediated Ca2 release and diacylglycerolactivation of protein kinase C. Studies are needed to determine whether ANP mediates 1P3release in epithelial cells. The above observations are consonant with the earlier findingsof Isales et a! (80) in adrenal glomerulosa cells. These workers reported that a truncatedANP analogue, ANP-(7-23), which is specific for the ANPC receptor, increased cytosolic Ca2in adrenal glomerulosa cells through a cGMP-independent mechanism. They speculated thatthis increase in Ca2, which was inhibited by nitrendipine, was through activation of Ca250channels by the ANPC receptor (80).The present studies demonstrate the presence of ANP-responsive receptors, likelyclearance receptors, in the porcine cTAL that initiate Ca2 signals. The function of theseCa2 signals is not apparent at this time, but they may be involved with initiating receptor-mediated endocytosis. A similar function has been postulated for low-density lipoprotein(LDL) receptor-mediated Ca2 signals in MDCK epithelial cells, vascular smooth musclecells, and cardiomyocytes (81-83). LDL receptor binding rapidly initiates Ca2 transients,membrane endocytosis, and ligand-receptor internalization (81,82,83). Further studies arerequired to test this hypothesis. Other cell functions may be altered with ANP in these cells(44,45,84). It is not clear whether the ANPC receptor has biological functions in addition toits role in peptide clearance (45,79). A number of studies have indicated that ANP throughthe ANPC receptor may inhibit cAMP increments either through enhanced cyclic nucleotidehydrolysis or inhibition of adenylate cyclase (45,57,84,85). These data have lead Levin (45)to speculate that the clearance receptor, ANPC, may modulate the actions of receptor-modulated increases in the second messengers, cGMP and cAMP. In addition, ANP inhibitsthe mobilization of intracellular Ca2 most likely through the guanylate cyclase receptor,either ANPA or ANPB (45,86). Accordingly, the two ANP receptor subtypes appear tointeract to modify hormone signal transduction pathways. The functional responses of ANPin the loop of Henle are unknown. Administration of pharmacological amounts of ANPresults in an increase in urinary magnesium excretion (43). Magnesium is principallyreabsorbed in the cTAL, and urinary magnesium excretion has been used as marker for loopfunction (7,41); accordingly, it is inferred that ANP may alter salt transport in this segment.51However, other studies have shown little effect of ANP on salt transport in the loop(42,43,87,88). More recently, Bailly et al (46) have shown that cGMP diminishes chloridetransport in perfused mouse cTAL. Further studies are required to determine the role, ifany, of ANP within the ioop of Henle.Our experiments showed that pretreatment with cGMP abolished the ANP-inducedCa2 transients (Fig.20). Kato and coworkers (89,90) reported that cGMP selectively down-regulates the clearance receptor, ANPC, in cultured pulmonary artery endothelial cells.These workers concluded that cGMP regulates the circulating levels of ANP by controllingthe density of clearance receptors of vascular endothelial cells. Other studies have furtherestablished that ANPC receptor expression on endothelial cells can be down-regulated byactivation of the guanylyl cyclase receptor resulting from ANP-mediated cGMP generation(91). Although it is clear from the present data that pretreatment of cTAL cells with cGMPinhibits ANP-mediated Ca2 response, it is not known if this involves down-regulation of theANPC receptors or direct inhibition of intracellular Ca2 release. Further studies arerequired to determine at which site along the receptor-mediated signal transduction pathwaythat cGMP acts to mitigate the ANP-induced Ca2 signals in cTAL cells.In summary, we show that the atrial natriuretic peptides, ANP, CNP, and theanalogue, C-ANP-(4-23), elicit Ca2 signals in porcine cTAL cells likely through receptormediated responses. The Ca2 transients are composed of intracellular Ca2 release followedby Ca2 entry across the plasma membrane. Finally. ANP-mediated Ca2 transients aremodulated by cGMP, which may play a regulatory role in these signals. The role of theANP-induced Ca2 signals may have significant physiological actions within this segment.52CHAPTER 2. NaICa EXCHANGE IN cTAL CELLSI. BackgroundCells composing the cortical segment of the thick ascending limb of Henle’s looppossess a large number of peptide hormone receptors, many of which induce largeintracellular Ca2 transients which may be involved with receptor-mediated signaltransduction processes (92). In order for intracellular Ca’ to play a role in signaltransduction mechanisms it is necessary to have regulated processes which maintainintracellular Ca2 concentrations at submicromolar levels. Na/Ca2 exchange across theplasma membrane is an important determinant on intracellular Ca2 levels. The primary roleof Na/Ca2 exchange is Ca2 extrusion. The net direction of the Ca2 movement mediatedby this exchanger depends on the Na electrochemical gradient, the Ca2 electrochemicalgradient, and the stoichiometry. Net efflux of Ca2 is accomplished using the energy of theNa gradient set up by the ATP-dependent Na pump. The Na/Ca2 exchangers areimportant Ca2 transporting proteins present in many different species and cell types (93).The Na/Ca2 exchanger is a high capacity, low Ca2 affinity carrier which transports largequantities of Ca2 at high intracellular Ca2 levels such as occurs following agonist-stimulatedincrease in [Ca2J (92).The Na/Ca2 exchanger was first cloned from canine heart (94) and subsequentlyfrom other species and tissues (95-100). Two kinds of Na/Ca2 exchangers have beenidentified so far, the cardiac type with stoichiometry of 3 Na to 1 Ca2 and the rod outersegment (ROS) type with coupling ratio of 4 Na to 1 Ca2 + 1 K. Both types of theexchanger have similar structure but totally different amino acid composition and potential53amino-linked glycosylation sites (101). The exchanger eDNA encodes a protein with 970amino acids. Hydropathy analysis has indicated that the exchanger fits into the general classof ion transporters, which contain 11 or 12 transmembrane segments and a relatively largehydrophilic domain. The mature exchanger has 11 potential transmembrane segments, witha 520-residue hydrophiic domain between membrane-spanning segments 5 and 6.Recent cloning studies by Kofuji et al (102) and Lee et al (103) showed that thesodium-calcium exchanger is encoded by a single gene. Different isoforms, differing in thecarboxyl end of intracellular loop 5-6, are generated by alternative splicing of exons in atissue-specific manner. Fig.21 shows the location of alternatively spliced site. The unusualintron-exon arrangement of the sodium-calcium exchanger gene encoding this area of theintracellular loop potentially leads to as many as 32 isoforms. Splice variation at this sitecould provide a basis for differences in tissue-specific expression (103). Restriction enzymeanalysis and sequencing data have revealed seven major isofonns specific for differentspecies and tissues (103). Two distinct isoforms have been identified in the rabbit kidney,NACA2 (99) and NACA3 (104); and two in the rat kidney, NACA3 (103,104) and NACA7(103). These transcripts are principally been found in the distal tubule (100). No evidenceto date, either functional or molecular, has been given for Na/Ca2 exchange in thickascending limb cells (12,100). To explain this contradiction, Reilly et al (12) proposedfollowing possibilities: 1) the absence of expression of the Na/Ca2 exchanger in thesesegments; 2) the expression of the exchanger in levels below the threshold of the detection;or 3) the exchanger in these segments is represented by a different isoform.Remarkably little is known about physiological modulation of Na/Ca2 exchange,54Extracellular1 2 3 4 5 6 7 8 9 10 iMembraneIritracellutarAlternative Splicing SiteFig.21. A model of cardiac type Na/Ca2 exchanger. The exchanger iscomposed of 11 transmembrane segments and a intracellular loop. Thelocation of the alternative splicing site is indicated. [Abstracted from Philipsonet a! (101) with slight modification]55except as a result of changes of cytosolic Ca2 and Na concentrations (105). The kineticsand stoichiometry of Na/Ca24 exchange have been well studied but its regulation hasreceived less attention (93,105, 106). Some studies have shown that NaICa2 exchange maybe regulated in renal cells by various factors, such as parathyroid hormone and vitamin D(107-109) which increase Ca2 transport, and by phorbol esters which have been reputed todecrease exchange activity (110). The mechanisms underlying these effects are notunderstood.The specific aims of the present study include: 1) functional demonstration ofNaICa2 exchange in isolated cTAL cells; 2) determination of the modulating effects ofphosphorylation on NaICa2 exchange activity; and fmally 3) the molecular identification ofNa/Ca2 exchanger.II. Materials and Methods11.1. MaterialsTaq DNA polymerase, SP6 RNA polymerase, restriction enzymes (Eco RI, Eco RV,and Taq I) and dsDNA Cycle Sequencing System were purchased from GIBCO/BRL.Original TA Cloning Kit was from Invitrogen (San Diego, CA). UTP-o-32Pand ATP--32Pwere obtained from ICN Pharmaceuticals Inc. (Irvine, CA). All other chemicals were thosegiven in Chapter 1.11.2. MethodsThe isolation of cTAL cells from porcine kidneys and the determination of cytosolicfree Ca2 were performed by the same methods as described in Chapter 1. In all56experiments involving Ca2 analysis, single traces are shown but similar results were obtainedin at least five separate experiments from independent cell preparations.11.2.1. Cytoplasmic Na measurementsCytosolic free Na concentration, [Na]1,was determined with SBFIIAM (MolecularProbes mc) according to previously described techniques (111). cTAL cells were loadedwith SBFI by adding equal volumes 10 jM (final concentration) SBFI/AM dissolved indimethyl sulfoxide (DMSO) and the noniomc detergent Pluromc F-127 (20% wt/vol inDMSO). The cells were incubated for 60 mm at 23°C and subsequently washed 3x withbuffer to remove extracellular dye. Fluorescence was measured using a spectrofluorometerat alternately excited wavelengths of 345 and 385 nm and emission intensities recorded at505 nm were calculated. All measurements were performed at room temperature.Calibration of SBFI fluorescence in terms of [Na]1 was performed by addition of knownextracellular Na concentrations made up in Na-HEPES/K-HEPES buffer. The 345-to-385nm intensity ratio was determined before and 3 mm after the addition of the Na ionophoregramicidin D (1 M, final concentration). The changes in fluorescence ratio were thenplotted as a function of Na concentration. As in a previous report, a linear relationship wasobserved that was then used to calibrate the individual experimental ratios (111).11.2.2. Isolation of total RNA from kidney tissuesModified TRizol technique was used to isolate total RNA from tissues (112,113).About 0.1 gm of tissue was obtained and frozen in liquid nitrogen. Frozen tissue was groundin a mortar and pestle under liquid nitrogen. Ground tissue was transferred into a 1.5 mltube. 1 ml of TRIzol solution was added into the tube to lyse the cells. Lysed tissue was57incubated at room temperature for 5 mm. To extract RNA, 0.2 ml of chloroform was addedinto the tube and it was then mixed by vortexing for 1 mm prior to centrifugation at 14,000xg for 15 mm at 4°C. The aqueous phase was collected into a fresh tube and an equalvolume of isopropanol was added. The mixture was incubated at room temperature for 1hour. The RNA was obtained by centrifugation, 14,000 xg for 15 mm at 4°C. The RNApellet was then washed with 1 ml of 75% ethanol and dissolved in 40 1 of fonnamide.11.2.3. Preparation of riboprobeThe NCE.F1 clone in the pcDNAII vector was from Dr. Jonathan Lytton (HarvardMedical School). The eDNA of this clone was derived from rat kidney transcripts (103).To make a probe, the NCE.F1 containing plasmid was transformed into host cells for thepurpose of obtaining large quantities of plasmid DNA.11.2.3.1. Fresh competent E.coli prepared using the calcium chloride method. Asingle colony of XLI Blue bacteria was inoculated into a 25 ml LB broth medium culturewith tetracycline. The culture was incubated for 2.5-4 hours at 37°C with vigorous shaking(225 rpm) until OD was about 0.4. The culture was chilled to 0°C by placing the tubes onice for 10 min. The cells were then harvested by centrifugation at 3000 rpm for 10 min at4°C. Pellets were resuspended in half the original volume of ice-cold 0.1 M CaCl2, and thenincubated on ice for 15 mm. After centrifugation at 3,000 rpm for 10 mm at 4°C, the pelletswere resuspended in 1/12.5 of the original volume of ice-cold 0.1 M CaCl2. Competent cellswere stored at -70°C following addition of glycerol/DMSO (50/50) to 15% final concentration(V/V).11.2.3.2. Transformation. 10 ng of pcDNAII.RtKcNCE1.F1 was added to 0.2 ml of58competent cells and held on ice for 30 mm. Cells were then heat-shocked at 42°C.Following addition of LB and 1 hour incubation at 37°C, bacteria were plated on LB plates(0.15% agar) with 60 gIm1 ampicillin and 50 jAgIml tetracycline and incubated overnight at37°C.11.2.3.3. Isolation of plasmid DNA from transformed E.coli. Plasmid Midi Kit(QIAGEN) was used to isolate pcDNAII .RtKcNCE1 .Fl plasmid. This method is based ona modified alkaline lysis procedure. Purified plasmid DNA was quantitated byspectrophotometer. To confirm the identity of the plasmid, restriction enzyme analysis wasthen performed.11.2.3.4. Preparation of riboprobe from pcDNAII .RtKcNCE1 . F 1. Prior to synthesisof the riboprobe, pcDNAII.RtKcNCE1 .F1 was digested with Not 1 for 30 mm at 37°C andthen washed with phenol/chloroform. 1 g of Not 1 digested plasmid and DNA-dependentRNA polymerase SP6 were used for RNA synthesis in the presence of 0.4mM ATP, 0.4mMCTP, 0.4 mM GTP, 0.01 mlvi UTP, and UTP-c&32P. The riboprobe was purified using 1 mlG50 resin column. Columns were spun at 2000 rpm for 3 mm. The column was washedonce with 100 Ll of TE (pH 7.5) and then loaded with 100 1 of labelling mixture. 32Plabelled probe was eluted into an eppendorf by centrifugation.11.2.4. Northern blotting and hybridization.11.2.4.1. Northern blotting. RNA samples were loaded into 1 % agaroseformaldehyde (0.4 M) gel. To prepare sample for loading, 20 g RNA was mixed with 5 jil5X formaldehyde gel-running buffer and 1 l EtBr (1 mg/ml), and then added to 3.5 lformaldehyde and 10 l formamide. The mixture was incubated at 65°C waterbath for 1559mm. RNA samples were loaded after the gel was pre-run for 5 mm at 100 V. The gel wasrun at 100 V for 10 mm and then 40 V for 6-8 hours. Running buffer was replaced duringthe middle of the run.Downward alkaline-transfer setup was prepared according to the method describedby Chomczynski (114), with a minor modification. The bottom base was formed by a 4-5cm-high stack of paper towels. The towels were sequentially covered with five sheets ofblotting paper (Whatman), hybridization membrane (Nytran), followed by the agarose gel.The membrane was 2-3 mm larger than the gel. The gel was covered with three sheets ofblotting paper (of the same size as the gel) and two sheets of blotting paper forming aconnection (bridge) across the gel stack and two trays containing the transfer solution(composition: 3 M NaCl, 2 mM sarkosyl and 8 mM NaOH, pH 11.40-11.45). After thetransfer the membrane was incubated in neutralization buffer (0.2 M NaH2PO4,pH 6.7-6.8)for 10 mill and then fixed by UV cross-linking.11.2.4.2. Hybridization. The membrane was pre-hybridized for 1 hr at 42°C. Thecomponents of pre-hybridization solution were: 8 ml of deionized formamide, 4 ml of 20%SDS, and 4 ml of 2 M NaH2PO4 in 4 mM EDTA (pH 7.2), the total volume was 16 ml with1 mg/mi BSA and 100 g/ml denatured salmon sperm DNA. Hybridization was made byadding riboprobe and incubated overnight at 42°C in the hybridization oven. Afterhybridization the membrane was washed six times at 55°C with 2x SSPE/0.3 % SDS 2x 20mm, lx SSPE/0.5% SDS 2x 20 mm, and 0.3x SSPE/1 % SDS 2x 20 mm respectively. TheNytran membrane was exposed a X-ray film for 10 hr at -70°C.11.2.5. Identification of Na/Ca2 exchanger isoform with PCR technique.6011.2.5.1. cDNA synthesis. Total RNA extracted from eTAL and inner cortex tissueusing TRIzol method as described above was utilized as starting material. Both randomhexamer (20 ng/L1) and oligo dT (20 ngId) were used as primers for cDNA synthesis in thepresence of 1g RNA, NTP (1 mM), DTT (10 mM), Reverse Transcriptase (4 UId), andRNasin (0.5 U/1il).11.2.5.2. PCR primer design. Based on the sequence of NCE.F1 and a comparisonbetween different species, including rat (96,98,103), rabbit (102), dog (94), bovine (95) andhuman (104), the most conserved regions flanking the alternatively spliced site were usedin primer design. The sequence of sense primer selected was CTCGAA(G)TTCCAGAAT(C)GATGAAAT (nt 2207-2229 of NCE.F1) (103); the antisense primer was CTCTTGAATTCG(A)TAA(G)AAT(C)TCTTC (nt 2533-2555).11.2.5.3. Polymerase chain reaction (PCR). The composition (final concentration in50 l volume ) of the reaction was: 2.5 mM MgC12,0.4 mM dNTP, 1 mM sense primer, 1mM antisense primer, and 1.5 unit of Taq DNA polymerase. eDNA template was alsoincluded. pcDNAII.RtKcNCE1 .F1 DNA was used as a positive control. Distilled water andthe reaction buffer of eDNA synthesis were used as negative controls. The first 3 cycleswere 94°C 2 mm, 44°C 1.5 mm and 72°C 2 min, and the next 35 cycles were taken at 94°C1 min, 44°C 50 sec and 72°C 1 mm. PCR products were analyzed by agarose gelelectrophoresis.11.2.5.4. Southern blotting and hybridization. To prepare eDNA probe, theamplified PCR product from the positive control was isolated and purified withGENECLEAN Kit (BlO 101). Random primer method was used to construct probes. In61a screw-cap vial, dH2O was added to 20-100 ng of probe DNA to obtain a final volume of9 iil. The sample was boiled for 5 mm. The following were then added: 2.0 i lox Kienowbuffer, 2.0 1 lOX ATG (2.5 mM), 1.0 j.Ll random hexamer (100 pmol/Ll), 1.0 l Kienow, and5.0 l 32P-dCTP, and incubated at 37°C for 50 mm. A G50 column was used for probepurification. The probe was boiled before use in the hybridization reaction.PCR products were separated on 1 % agarose gel and transferred onto Nytranmembrane using downward alkaline blotting technique. The membrane was hybridized witheDNA probe as the same way as in the northern hybridization.11.2.5.5. Sequencing PCR product. dsDNA Cycle Sequencing System was used tosequence PCR product. Cycle sequencing permits direct sequencing of dsDNA. dsDNA isintroduced into a set of dideoxy sequencing reactions, and is then subjected to thermalcycling. The first 20 cycles consist of a denaturation step at 95°C for 30 see, an annealingstep at 52°C for 30 see, and an extension/termination step at 70°C for 60 sec. The next 10cycles contained only two steps; denaturation at 95°C for 30 sec and extension/terminationat 70°C for 60 sec. The sequencing reactions were analyzed on 6% acrylamide sequencinggel.III. Results111.1. Demonstration of Na/Ca2 exchange in porcine cTAL cells111.1.1. Effect of external Na removal on [Ca2] in ouabain-treated cTAL cells.Basal [Ca2]1 is maintained in the range of 74-102 nM with a mean concentration of 86±3nM, n = 183, in normal cTAL cells. The abrupt removal of external Na by replacement62of NaC1 in the bathing solution with equivalent amounts of either choline Cl or NMDG (Nmethyl-D-glucamine) Cl did not alter basal [Ca2] in normal cells (Fig .22). When cTAL cellswere pretreated with ouabain, 10 M, for 60 mm followed by rapid replacement of externalNa in the bathing solution with either NMDG or choline, a marked increase in [Ca291wasobserved in the presence of external Ca2 (Fig.22). During incubation with ouabain, meanbasal [Ca2], was 86 ± 2 nM, n 22, which was similar to control cells over the period ofexperimentation. The increment in [Ca21, was dependent on the presence of external Ca2as no changes were observed in ouabain-treated cells in Ca2-free solutions (Fig .22).Following removal of external Na in ouabain-treated cells the mean increase in [Ca2J1was1023 ± 74 riM, n = 22. In the absence of external Ca2, the [Ca21remained at basal levels,82 ± 3 vs 85±9 nM, n= 5, during the period of external Na removal in ouabain-treated cells(Fig .22). We interpret these changes to indicate that the removal of external Na allowsinternal Na to move out coupled to external Ca2 moving from the bath into the cytosol.These studies suggest that there is a sodium-dependent Ca2 entry into cTAL cells which wasobserved only in ouabain-treated cells, i.e. those cells which we infer have elevated [Na]1.In the absence of external Na but presence of external Ca2, [Ca291 increasedtransiently in ouabain-treated cells (Fig .22). [Ca29 returned to near basal levels despite theabsence of external Na. These results suggest the presence of Na-independentmechanisms of Ca2 fluxes, either by cytosolic Ca2 sequestration or by Ca2 extrusion acrossthe plasma membrane. This removal may involveCa2-ATPases, therefore to determinethe role of the Ca-ATPase pumps in this phenomenon we treated the cTAL cells withvanadate, a general P-type ATPase inhibitor. Vanadate is not a specific inhibitor but proved6320001mM Ca0j —Na01500 —j1 0 Ca,. 0.5mM EGTAIII100 300 500TIME secondsFig.22. Effects of external Na removal on [Ca] in ouabain-treated cTALcells. cTAL cells were pretreated for 60 mm with ouabain, 10 M, in normalbuffer solution containing (in mM): NaC1 145, KC1 4.0,Na2HPO 0.8,KH2PO40.2, CaCl2 1.0, MgCl2 0.6, glucose 10, and HEPES-Tris 20, pH 7.4. For thesodium-free solution the composition was the same but sodium was replacedby NMDG-Cl 145 mM or choline Cl 145 mM (results were the same witheither substitution). In the experiments indicated, CaCl2 was deleted from thebathing solution and 0.5 mM EGTA was added to the bathing solution toprovide a calcium-free solution. These fluorescent tracings are representativeof 5 (0 mlvi Ca0) and 22 (1 mM Ca0) different experiments.64to be useful in isolating Na-dependent effects in the porcine cTAL cells. Fig .23 illustratesa representative experiment. Vanadate added with the Na-free solutions markedlyattenuated the rate of decrease in [Ca29 so that [Ca2]1 levels (607 ±90 nM, n=5) weresustained for 60-180 sec. Fig.23 also showed that if 50 mM NaC1 was added to the cTALcells during this sustained period of elevated [Ca2]1,the cytosolic [Ca21 rapidly returned tobasal levels, 86 ± 9 nM, n= 5. Note that with the addition of external Na, the [Ca21fell tobasal levels whereas it did not in the absence of external sodium. These studies suggest thatboth a vanadate-sensitive sodium-independent Ca2 pump, probably Ca2-ATP se, and asodium—dependent process are important in maintaining [Ca] levels in cultured cTAL cells.Addition of external Na to vanadate-treated cells consistently resulted in a rapid fallin cytosolic Ca2. Addition of another monovalent cation, Li, during the sustained phasewas without effect on [Ca2] (data not shown). The removal of intracellular Ca2 wasselective and dependent on external Na; likely by Na/Ca2 exchange.111.1.2. Effect of the putative inhibitors on NaICa2 exchange. A number of putativeinhibitors were employed to determine if [Ca2], changes were due to influx or efflux acrossthe plasma membrane. First, we applied inorganic inhibitors, LaC13 and MgC12 , at the timeof removal of external Na to determine the effects on the increase in [Ca2]1; i.e. themovement of Ca2 into the cell in exchange for Na moving out of the cell, and with thereaddition of external Na to assess their effects on Ca2 efflux (Fig.24). La and Mg2mitigated the increase in [Ca2]following external Na removal, 810 ± 148 nM, n = 4, and592 ± 157 nM, n 4, versus control maximal levels of 1023 ± 72 nM, n = 22. La andMg2 also inhibited the movement of Ca2 out of the cell when external Na was readded to652000— Na0+ Vanadate1 —1500_]÷Na0-lJ10000500Ouabain0 I I Itoo 300 500TIME secondsFig .23. Effect of vanadate on Na removal-induced [Ca2] changes in ouabaintreated cTAL cells. Ouabain-treated cTAL cells were exposed to sodium-freesolutions with and without the presence of vanadate, 1 mM. Where indicatedsodium-containing buffer was added, containing (in mM): NaC1 50, NMDG-Cl95, KC1 4.0,Na2HPO4 0.8,K112P04 0.2, CaC12 1.0, MgC12 0.6, glucose 10, andHEPES-Tris 20, pH 7.4. Fluorescence tracing is representative of 25 separateexperiments.662000-Na0 ÷Na0] + Inhibitors + Inhibitors1500 4 4Control1::100 300 500TIME secondsFig.24. Effect of inorganic inhibitors on Na-dependent change in [Ca21 inouabain-treated cTAL cells. cTAL cells were pretreated with ouabain, 1O M,and Na0 was removed as given in legend to Fig.22. LaC13, 5.0mM or MgC12,5.0 mlvi, was added to the sodium-free buffer solution and with addition ofbuffer solution containing 50 mM NaC1. Vanadate, 1O M, was present in theNa-free solutions. Figures are representative of 4 different cells for eachinhibitor.67the bathing solution (Fig.24). We did not attempt to quantitate the rate of Ca2 influx andefflux as the changes in [Ca2]1are likely composed of different transport and sequestrationprocesses. Nevertheless, the qualitative data suggested that the increment in [Ca2j withexternal Na removal and subsequent decrease in [Ca2]1following readdition of external Naresulted from Ca2 moving across the plasma membrane, likely through Na/Ca2 exchange.Next, we tested the effect of organic inhibitors, amiloride and its analogue bepridil whichare thought to inhibit Na/Ca2 exchange in addition to other sodium-dependent transportprocesses (115). In this case, the cTAL cells were pretreated with these agents for 10 mmprior to removal of external Na. The Ca2 influx on removal of external Na, and Ca2efflux following readdition of external Na were significantly inhibited by the presence ofamiloride and bepridil (Fig .25).111.2. Transmembrane depolarization induces Na-dependent Ca2 influx111.2.1. The effect of transmembrane depolarization on [Ca2] in ouabain-treated cTALcells. The changes of [Ca2]1resulting from the removal of external Na in ouabain-treatedcells are likely due to Na/Ca2 exchange functioning in reverse, i.e. Na moving out coupledwith Ca2 moving into the cell. In all cells studied to date, the coupling has been reportedto be 3Na for 1Ca2 resulting in a stoichiometrical imbalance in electrical charge (116).Accordingly, depolarization (as with replacement of external Na with K in the presenceof a large outside-to inside Ca2 gradient) would be expected to drive Ca2 in and Na outvia the exchanger. This approach has been used by others (117-120) to investigate Na/Ca2exchange. In the present study the membrane potential was altered by the substitution of682000-Na0 +Na0+ Inhibitors + Inhibitors1500ControlBepridll1000 /AmilorideQuabain500 Inhibitors0 I I I I100 300 500TIME secondsFig.25. Effect of organic inhibitors on Na-dependent change in [Ca2]1 inouabain-treated cTAL cells. cTAL cells were pretreated with ouabain, 10 M,and Na0 was removed as given in legend to Fig.22. Bepridil, 0.25 mM, oramiloride, 1.0mM was added 10 mm prior to and with the sodium-free buffersolutions as indicated. Vanadate, 10 M, was present in the Na-freesolutions. Figures are representative of 4 different cells for each inhibitors.6950 mM KC1 in the external buffer solution in lieu of 50 mM NaC1. Depolarization with highKC1 solutions did not have any effect on basal [Ca2] in normal cTAL cells (Fig.26).However, membrane depolarization of ouabain-treated cells (10 M ouabain for 60 mm)resulted in a rapid increase in [Ca2], which was dependent on the concentration of Ca2 inthe external buffer solution (Fig .26). In the absence of external Ca2 (and presence of 1.0mM EGTA) there was no detectable change in [Ca2]1,whereas the presence of 0.5-to-2.0mM external Ca2 resulted in graded increases in [Ca2]1 dependent on the Ca2concentration in the buffer solution (Fig.27). We interpret these findings to indicate that adecrease in transmembrane voltage induces internal Na to move out of the cell coupled toexternal Ca2 moving into the cell. The increments in [Ca2]1 following a change intransmembrane voltage occurred in the presence of external Na suggesting that the putativeNaICa2 exchange is electrogemc.111.2.2. The effects of inhibitors on voltage-stimulated Na/Ca2 exchange. The nextseries of studies examined the effect of inorganic and organic inhibitors on voltage-stimulatedCa2 influx. First, we tested the effects of a number of multivalent cations. The inhibitorwas added with the KC1 depolarization solution. La3 and Mg2 significantly inhibited theincrease in [Ca21following depolarization, 63±6% and 60±6% of control respectively, n=3-6 (Fig.28). Fig.29 illustrates the effects of the organic inhibitors, amiloride and bepridil, onvoltage-dependent increase in [Ca291. Amiloride inhibited the increase in [Ca29, to 29 ± 8%,n 3, of control and bepridil 8±4%, n = 5, of control values. Unlike the inorganicinhibitors, both drugs were added into the bathing solution 10 mm prior to depolarization.The data from these functional studies support the notion that there is coupling of Na70100050K800 + Ouabain- -OuabainC6004002000 I100 200 300 40C)TIME secondsFig.26. Effect of transmembrane voltage on sodium-dependent Ca2 influx.Cultured cTAL cells were pretreated with and without ouabain, 10 M, for 60mm prior to experimentation. The normal buffer solution contained (in mM):NaC1 145, KC1 4.0,Na2HPO 0.8,KH2PO40.2,CaC1 1.0,MgC120.6,glucose10, and HEPES-Tris 20, pH 7.4. The depolarization solution contained (inmM): NaC1 95, KC1 50, Na2HPO4 0.8, KH2PO4 0.2, CaC12 1.0, MgC1 0.6,glucose 10, and HEPES-Tris 20, pH 7.4. 1.0 mM CaC12 was added todepolarization solution. Fluorescent tracings are representative of 5 differentcTAL cells.711000-800 -600-+-0400 -200 —N 5OKOC N 50K,. 5Ca N 50KlCa N 50K,2CaQuabainI I I I I I200 400 600 800TIME secondsFig. 27. Dose-dependent response of depolarization-induced change in [Ca2]cTAL cells were pretreated with ouabain, i0 M, for 60 mm prior toexperimentation. The composition of normal buffer solution (N) anddepolarization solution (50K) was same as given in Fig.26. Various amountsof CaC12 (0, 0.5, 1.0 and 2.0 mM) were added as indicated. Fluorescenttracing is representative of 5 different cTAL cells.721000 -N 50K, 1 Ca, InhibitorsMg2+100TIME secondsFig.28. Effect of inorganic inhibitors on voltage-dependent Ca2 influx inouabain-treated cTAL cells. Cultured cTAL cells were pretreated withouabain, 10 M, for 60 mm prior to experimentation. The composition ofnormal buffer solution (N) was the same as indicated in Fig.26. Thedepolarization solution contained LaC13, 5.0 mM, or MgC12, 5.0 mM.Fluorescent tracings are representative of 3-6 different cells.C0800 -600 -400 -200 -0-Quabain4200 300 400731000 —N 50K, 1 Ca, InhibitorsFig.29. Effect of organic inhibitors on voltage-dependent Ca2 influx inouabain-treated cTAL cells. cTAL cells were pretreated with ouabain, 10 M,for 60 mm prior to experimentation. The composition of normal buffersolution (N) was the same as indicated in Fig.26. Amiloride, 10 M, orbepridil, 25 M, were added 10 mm prior to depolarization. Fluorescenttracings are representative of 3-6 different cTAL cells.800 —600 -+0 400j- I Ouabain200 -ControlArnilorideBepridI100 200TIME seconds300 40074for Ca2 in the plasma membrane of cTAL cells which is reversible and dependent on thetransmembrane sodium concentration and voltage gradients.111.2.3. Dependence of NaICa2 exchange on intracellular [Na]. The observation thatchanges in [Ca21 with the removal of external Na or the addition of KC1 requiredpretreatment of cTAL cells with ouabain suggested that an elevation of intracellular sodiumconcentration ([Na]1)was necessary to demonstrate NaICa2 exchange. To determine theassociation of NaICa2 exchange with [Na], we varied the [Na9 by treating cells withouabain in the presence of variable external Na concentrations (Fig.30). [Na11 wasdetermined by fluorescence with SBFI and calibrated as previously reported (111). Basal[Na]1,10±2 mM, in normal cells and increased with time following treatment with ouabain.The increase in [Na9, was dependent on the Na concentration in the bathingsolution. [Na] increased 2.5 fold over 60 mm of ouabain treatment with normal bathingsolutions containing 145 mM NaCl whereas there was little rise in [Na]1 when external Naremoved from the bath. Using this approach we were able to reproducibly alter the [Na]1in cTAL cells.With this method, we varied [NaJ, and determined the changes in [Ca2]1following KC1depolarization at various [Na]1. The changes in [Ca2]1,A([Ca21), was associated with basal[Naj1 levels in a sigmoidal fashion, with a maximal change at [Na]1 of 22 mM and a halfmaximal A([Ca2]) at about 16 mM [Na]1 (Fig.31). The changes in [Ca291with [Nal, arein keeping with a model of an imbalance ofNa1-C20coupling.111.2.4. Modulation of NaICa2 exchange by calmidazolium and okadaic acid. Ourstudies provide evidence for a NaICa exchange located on the plasma membrane which755040li10Ou:boin I mTIME minutesFig.30. Changes of intracellular [Nal in ouabain-treated cTAL cells.Subconfluent cTAL cells were treated with ouabain, iO M, for the timeperiods indicated in the presence of buffer solutions (as given in legend toFig.25) but with variable [Na]0. NaC1 was replaced with equivalent amountsof NMDG-Cl to attain the indicated [Na]0. Illustrated tracings are the meansof 3 different determinations for each external sodium concentration in thebuffer solution.761000800 I600—ccp400-I20000[Na) mMFig. 31. Association of [Ca2]1with [Na] following depolarization. cTAL cellswere treated with ouabain, 10 M, for variable times and with variableamounts of Na0 to produce the given [Na]1. Depolarization was performedas given in Fig.26 and the changes in [Ca2]1,A([Ca2]), were plotted as afunction of [Na]1. The depolarization solution contained (in mM): NaC1 95,KC1 50,Na2HPO4 0.2, CaC12 1.0, MgC12 0.6, glucose 10, and HEPES-Tris 20,pH 7.4.77is demonstrable either through alteration in transmembrane Na gradient or by decrease inmembrane voltage, but only in cells with elevated [Na]1. In order for this exchange to bephysiologically meaningful, it should be regulated in the range of normal external andinternal Na and Ca2 concentrations. In the next series of experiments, we provide data toindicate that the Na/Ca2exchange activity is altered throughCa2-calmodulin complex likelythrough phosphorylation events.First, we treated cTAL cells with the compound R24571, a calmodulin inhibitor(calmidazolium, Sigma). Compound R24571 did not alter levels in normal or ouabaintreated cells over the duration of the study. We next determined the effect of compoundR24571 on the control of [Ca21 following KC1 depolarization (Fig.32). The maximal changein [Ca29 from basal levels, A([Ca2]), following KC1 depolarization were determined atvarious [Na]. The association ofMjCa2]) with [Na]1 following depolarization was shiftedto the right of normal maximal Ca2 changes, occurring at about 25 mM and half-maximalconcentration at 20 mlvi [Na] (Fig.31). The maximal A([Ca2]) was similar in both controland compound R2457 1-treated cells, however, it required greater increments in [Na]1 in thetreated cells. The shift of the ([Ca2]1)vs [Na11 curve to the right following depolarizationsuggested that the inhibitor R2457 1 decreased the affinity of the Na/Ca2 exchange for[Na]1 with little effect on the maximal transport rate. Thus, these data suggest that Ca2-calmodulin complex may activate the Na/Ca2 exchange process by increasing Na affinityleading to exchange within the normal [Na9 of the cTAL cells. To test this postulate, weused okadaic acid, an inhibitor of types 1 and 2a protein phosphatases, to test whetherphosphorylation may be involved in controlling exchange activity. Pretreatment of cTAL781000-800-1 At600-3 1 A Control400-I • R24571— • Okadaic acid200 -/o.o 10 20 30[Na] mMFig.32. Alteration of Na/Ca2 exchange with compound R24571 and okadaicacid. cTAL cells were pretreated with ouabain, 10 M, and variable [Na]0 toproduce the given [NaJ1. cTAL cells were pretreated with R24571 (10 M),a calmodulin inhibitor, or okadaic acid (10 M), a phosphatase enzymeinhibitor, for 10 mm prior to depolarization with 50 mM KC1 (as given inlegend to Fig.26. A([Ca2]1)was determined in the presence of depolarizationsolution at various [Na}1 as given in legend to Fig.30. Values represent mean± SE with n = 3-6 experiments (cells) at each [NaJ1.79cells with okadaic acid did not have any effect on basal [Ca2]1in ouabain-treated cTAL cells.Depolarization of okadaic acid-treated cells resulted in a shift of the A([Ca21)vs [Na]1curve to the left again without notable change in maximal transport rates (Fig.32). Oninspection of the relationship of A([Ca2]) with [Na], it appeared that changes in [Ca2]1occurred at near basal [Na]1 concentrations of 8-12 mM following depolarization. If thiswere the case, then treatment of cTAL cells with ouabain and rise in [Na] would not benecessary to elicit a voltage-dependent increase in A([Ca2i) in the presence of okadaic acid.Accordingly, we performed studies on normal cTAL cells which were not treated withouabain but pretreated with the phosphatase inhibitor. Okadaic acid resulted in similarincrease in [Ca2] in normal cells as with those treated with ouabain but possessingcomparable [Na91 (Fig.33). We conclude from these studies that phosphorylation mayincrease Na/Ca2 exchange activity at physiological [Naii.80240 *2c0160+ 120C-)Control Okadaic AcidFig.33. Sodium-dependent increase in [Ca2] in okadaic acid-treated cTALcells. Porcine cTAL cells were not pretreated with ouabain but treated withokadaic acid, 1O M, prior to depolarization. The increase in [Ca2J, wasdetermined with fluorescence according to methods given in legend to Fig.26.Values are mean ± SE for 5 cells.081111.3. Identification of NaICa2 exchanger by molecular biology techniques111.3.1. The distribution of NaICa2 exchanger in porcine tissues. Total RNA wasextracted from various porcine organs including brain, heart, liver, muscle, and kidney.Kidney samples were taken from four different parts, outer cortex, inner cortex, outermedulla and inner medulla.For northern blotting, a riboprobe was made from the NCE.F1 cDNA clone containedwithin pcDNAII.RtKcNCE1 .F1 plasmid. As shown in Fig.34, Na/Ca2exchanger transcriptswere recognized by NCE.F1 riboprobe in northern hybridization. 7.5-Kb hybridizingtranscripts were seen in all tested kidney tissues, including outer cortex, inner cortex, outermedulla and inner medulla. Hybridizing transcripts were also seen in heart and muscle. Onthis total RNA blot, no transcripts were detected in brain and liver.111.3.2. Identification of N&iCa2exchanger in isolated cTAL cells. To demonstrate thepresence ofNaICa2exchanger in cTAL cells, subconfluent cTAL cells were collected fromglass cover slips. These cells were of the same age as the cells used in the functional assays.Total RNA was extracted from cTAL cells and used for cDNA synthesis. This cDNA wasused as a template with primers designed from NCE.F1 clone in a PCR reaction. As shownin Fig.35, one prominent band (—290bp) was obtained from cTAL cell cDNA. This PCRproduct was smaller than the comparable sequence within NCE.F1 (—‘350 bp). Southernblot analysis (Fig.36) also suggested that the amplified cDNA from cTAL cells was afragment of Na/Ca exchanger gene which differed from the NCE.F1 cDNA. There werea number of amplified fragments seen in inner cortex tissue cDNA, but only one fragment(-‘290bp) hybridized to the NCE.F1 probe (Fig.35, Fig.36).82Fig.34. Northern blot analysis of Na/Ca2 exchanger. 20 tg of total RNAfrom each of the indicated tissues was run on 1 % agarose-formaldehyde gelsas detailed in the text. The total RNA was hybridized to UTP-a-32Plabelledriboprobe from NCE Fl. The locations of 28S and 18S are indicated. Arrowpoints the location of 7.5 Kb.c-p28S18S83Fig.35. PCR amplification of the variable region of the exchanger mRNAfrom inner cortex and cTAL cells. cDNAs synthesized from total RNAextracted from inner cortex and isolated cTAL cells were used as templatesfor PCR amplification. The NCE.F1 clone and the reaction buffer for cDNAsynthesis were employed as positive and negative controls, respectively. ThePCR products were separated by acrylamide gel (7%) and stained withethidium bromide.84Fig.36. Southern blot analysis of PCR products from inner cortical tissue andisolated cTAL cells. PCR products from inner cortex and cTAL cells wereseparated by 1 % agarose gel and transferred onto Nytran membrane. Themembrane was hybridized with 32P labelled eDNA probe made from PCRproduct of positive controls. The molecular size markers are indicated.4%, bp30542063101834429822085Fig.37 shows the nucleotide sequence of the PCR product obtained from cTAL cellcDNA. Based on the genomic DNA sequence data of Kofuji et a! (102), this sequencelacked the A,C,E,Fexons but contained exon B and exon D in the alternative splicing regionof the cytoplasmic segment of the exchanger. The sequence obtained was the same as thatof the NACA3 isoform reported by Lee and colleagues (103). Although there were anumber of nucleotide differences between porcine cDNA and those of the rat and rabbit,the encoded amino acid sequences are identical except for n.t. 1210 which encodes a serineinstead of a threonine (Fig.37).00NACA7(rat)NACA2(rabb!t)NACA3(rat)NACA3(pig)NACA7(rat)NACA2(rabbit)NACA3(rat)NACA3(pig)NACA7(rat)NACA2(rabbit)NACA3(rat)NACA3(pig)NACA7(rat)NACA2(rabbit)NACA3(rat)NACA3(pig)NACA7(rat)NACA2(rabbit)NACA3(rat)NACA3(pig)*1174IQ)1253*CrOGAATrCCAGAATGA’IOAAATAGTGAAOATCATrACCATrAGAATATrI’GACCGTGAGGAATATGAGAAAGAGTGCAGTCTGGAATTCCAOAACGATGAAATrGTGAAGATCATrACCATrAGAATAITTGACCOTOAGGAATATGAGAAAGAOTGCAGTCTGGAATTCCAGAATGATGAAATAGTGAAGATCAYrACCATrAGAATATITGACCGTOAGGAATATGAGAAAOAGTGCAGTCrCGAGTrCcAOAACGATGAAATrGTGAAGATA1TICcATTAGAATArnGACCGTGAGGAATATGAGAAAGAGTOAGT*1254.TTCCCCGTGCrrOAGJCCAAATGGATAAGAAGAOGAATOAA4ç3GTOOCTTCACAYIUrCCCTTGTGCITGAOOAACCAAAATGGATAAGAAGAGGAATGAAAGCCCTGYrATrGAATGAGCrr’XITGGCITCACATCrCCCITGTGcTrGAOOAACCAAAATGGATAAGAAGAGc3AATGAA4bGI3GCITCACA:TTCrCCCrFGTOC1TGAGGAACCAATGGATAAGAAGAGGAAA4.GGTGGCITCACA:*1334F1413*TrAACAOCCAACCrGTCrrCAGOAAGGTCCATGUrAGAOATCATCCOAT1CCCIUrACCGTAATCAGCAT1TCAbAGGAG:ATAACA‘GAGGAATrAACAI3AGOAGç3AGOAA*14141492*TACOATGACAAGqGCCAcTGACCAGCAAAGAGGAGGAGOAGAGGCGCATrOCAGAAATOGclGCOCCCCAYrCrAGaCGATAToATGAcAAAcAccCAcToACCAocAAAoAooAAGAooAGAoococAyrGCAGAAATGGoocoCCcCATCrroooAGATACGATGACAAGC4pCCACTGACCAGCAAAGAGOAGGAGGAGAOGCGCAITGCAGAAATGGGOCOCCCCATTCTAGGCOATATOATGACAAGC4flCCAcAACCAGCAGAGGAAGAQGAGAGGCGCATTOCAGAJATGGOOCGCCCCATCCAGGAGA*14931545*ACACACCAAGrGTGATCATrGAAØ4GTCITACGAATrCAAOAGCACACACCAAGTrGG4AGTGATCATrGMTCCrATGAGTrCAAGAGTACACACCAAOCrGGAAcnOATCATGAAGAGTCrrACGAATTCAAGAOCGCACAcCAAcJUrGGAOGTGATCATrGAAGAGTCITACOAATrCAAGAGC,a)L)%Cl).—4_.—c‘.._a.).q°L)a)a)-C.)‘—41-’a..)a.)c’iC)a.)•)Oa.)•‘—c,Jo—-;•—‘D+a)ca)a.)C)tb)ci;UEroC)0a)D+a)a)Q•C)C)—L).0-L)00,87IV. DiscussionPorcine cTAL cells possess a large number of peptide hormone receptors whichstimulate intracellular Ca2 release and extracellular entry (92). The present studies showthat control of [Ca2], is, in part, through Ca2 extrusion via a NaICa2 exchange process.The latter can move Ca2 out of the cytosol across the plasma membrane in exchange forentry of Na. The evidence indicates that the Na/Ca2 exchange is reversible so that Ca2can move into or out of the cytosol across the plasma membrane, the direction dependingon the transmembrane Na chemical and voltage gradients (121).IV. 1. Functional demonstration of NaICa2 exchangeThe evidence for a functional and reversible NaICa2exchange system in porcine cTALcells is persuasive. The removal of external Na or depolarization of the plasma membranein ouabain-treated cTAL cells results in marked increase in [Ca2], which is dependent onthe presence of external Ca2 (Fig.22, Fig.26). This is interpreted as a favourableelectrochemical gradient for Na such that cytosolic Na moves out coupled to entry ofexternal Ca2. The entry may be inhibited by multivalent cations such as La3 and Mg2(Fig.24, Fig.28). Agents like amiloride and bepridil which are known to inhibit Na/Ca2exchange in other cells are also effective (Fig. 25, Fig .29) (115). Although amiloride andbepridil are not specific inhibitors of NaICa2 exchange, their actions are supportive of theobservations with the inorganic blockers. The NaICa2 exchange is specific for Na as Liis unable to drive the exchanger in the forward direction (93,117). The apparentcharacteristics of the NaICa2exchanger in porcine cTAL cells are similar to those reportedfor many other cell-types, i.e. it is altered by the transmembrane voltage suggesting an88electrogenic process (93,106). However, it is of interest that in order to demonstrate theexchange in unstimulated cTAL cells, the intracellular [Na] must be elevated above basallevels. Elevation of intracellular Na is also required to demonstrate Na/Ca2 exchange inintact cells isolated from rat collecting tubules (122), but not rat proximal tubules (123,124),nor rabbit connecting tubules (125). To our knowledge, only one other study has looked atthis exchange in thick ascending limb cells. Nitschke et al were unable to detect changes in[Ca2]1 following removal of bath external Na in perfused rabbit cTAL segments (126).However, these investigators did not pretreat the perfused segments with ouabain and thusprobably did not elevate intracellular [NaJ prior to experimentation. Our data indicate thatNa/Ca2 exchange is present in porcine cTAL cells.IV.2. The effect of phosphorylation on NaICa2 exchange activityAlthough the NaICa2 exchanger appears to be widespread, little is known about theregulation of this transport. Intracellular ligands may regulate activity of the exchanger (suchas Ca2,Mg2,or H). The levels of cytosolic ATP appear to modulate Na/Ca2 exchangein squid axons, barnacle muscles, erythrocytes, and cardiac cells (106,121). There is alsophysiological and biochemical evidence that Na/Ca2 exchange is regulated by receptormediated mechanisms. First, parathyroid hormone and cAMP have been reported toincrease exchange in basolateral membranes isolated from renal cortex (108,109) and thedistal tubule (108). These recent studies are confirmatory of earlier ones by Hanai et al(108). Scoble, Hruska, and coworkers demonstrated a NaICa2 exchange in basolateralmembrane vesicles, probably proximal in origin, from dog cortical tissue (109). PTH, butnot cAMP, increases exchange activity in these studies. The discrepancy in these reports89from rabbit and dog remains to be explained. Calcitomn also increases Na/Ca2 exchangein membrane vesicles isolated from the rabbit distal tubule, but vitamin D, which increasescalcium reabsorption in the distal nephron does not have any effect on NaICa2 exchange(127). Other factors have been reported to increase NaICa2exchange in various cell types.Recently, Zhu et al have shown that angiotensin I increases NaICa2 exchange in vascularsmooth muscle perhaps through alteration in [Na], or phosphorylation (128). The secondmessenger, cGMP, has also been reported to stimulate Na/Ca2 exchange in vascularsmooth muscle cells (129). By contrast, phorbol esters, perhaps through activation of proteinkinase C, decrease Na/Ca2 exchange in human mesangial cells (130) and cotransport inrabbit collecting tubules (110). However, others have shown that phorbol esters increaseNaICa2exchange activity in aortic smooth muscle cells (120). Finally, biochemical evidencesupports the notion that Na/Ca2 exchange may be regulated. Carom and Carafoli reportedthat kinase-mediated phosphorylation activates Na/Ca2 exchange in cardiac plasmamembranes (131). This activation was dependent on Ca2, inhibited by anticalmodulinagents and was not affected by cAMP. The present studies indicate that phosphorylationmay be involved, either directly to the exchange protein or indirectly through some othersteps in regulation.Our results with the calmodulin-inhibitor, R24571, or the phosphatase-inhibitor, okadaicacid, suggest that Na interaction with the Na/Ca2 exchanger may be altered byphosphorylation events. Pretreatment of cTAL cells with calmodulin-inhibitor shifted theNa-dependence curve to the right to a higher half-maximal [Na9, whereas the phosphataseinhibitor shifted it to a lower half-maximal [Na], (Fig.32). Indeed, the latter resulted in90activation of exchange in normal Na, concentrations so that elevation of [Ca2J1could beobserved in normal cTAL cells in the absence of ouabain and elevation of [Na]1 (Fig.33).We postulate that the acute elevation of [Ca2]1, for instance by receptor-mediatedmechanisms, results in the formation ofCa2-calmodulin coupling which in turn stimulatesthe NaICa2 exchanger at normal [Na]1. This would mitigate the increase in [Ca21 andreturn it to normal levels. Our studies with okadaic acid indicate thatCa2-ca1modulin actsthrough phosphorylation events possibly by stimulation ofCa2-calmodulin kinases. Ca2-calmodulin may also modulate the Na/Ca2 exchange protein through allosteric effects. Itis unlikely that these phosphorylative actions directly involve the exchanger as deletion ofalmost all of the intracellular ioop had little effect on exchange activity (93). How theseobservations fit into our understanding of physiological controls remains unknown.IV. 3. Identification of Na/Ca2 exchanger transcripts in cTAL cell RNAThe results of many different studies have suggested that a NaICa2 exchanger mayoperate in proximal (93,123,124) and distal convoluted tubules (122,132), connecting tubules(125,133), and collecting tubules (122). There is some controversy as to the segmentallocation of NaICa2 exchanger. Ramachadran and Brunette have reported that Na/Ca2exchanger is located in the distal tubule (convoluted connecting tubule) and not in theproximal tubule (132). More recently, cDNA and antibody probes have been used todetermine the presence of NaICa2 exchanger transcripts and protein expression,respectively, along the nephron (12). With the exception of ref. 134, these studies havefailed to detect the presence of exchanger transcripts in cells other than the distal tubule andconnecting tubule (99,100,133). The distribution of the NaICa2 exchanger, by91inimunolocalization, was confined to basolateral membranes of connecting tubules, with littleor no exchanger being found in other parts of the nephron (12,133). It should be noted thatthe NaICa2 exchanger is a high capacity system, thus it is possible that only small amountsof the protein are sufficient to account for the present functional results.The Na/Ca2 exchanger is composed of five amino-terminal membrane-spanningsegments, a large intracellular loop, and a carboxy-terminal region containing six additionalmembrane-spanning segments. There appears to be a high degree of similarity (greater than90%) at the amino acid level among the homologs of various species studied so far: dog(94), rat (100), cow (95), rabbit (104), and human (104). The differences among the variousNa/Ca2 exchanger clones appear in the coding sequence for the carboxyl end of the largeputative intracellular loop. Alternative splicing within this sequence region could potentiallyresult in 32 different mRNAs, and therefore in the production of as many isoforms of theexpressed NaICa2 exchanger protein perhaps having different functions (102).The cytoplasmic domain of the NaICa2exchanger is encoded by combinations of exonsdesignated A, B, C, D, E, and F. Cardiac tissue contains the exons ACDEF, the braincontains ADF or AD, skeletal muscle BDF, and kidney and intestine BDF and BD exons(102,103). Two splice variants have been found in the rat kidney (NACA3, with exons BD,and NACA7, exons BDF) (103); and two in the rabbit kidney (NACA2, exons BCD, andNACA3, exons BD) (102,104). The NACA3 isoform appears to be the most abundant inthe kidney and principally localized in the connecting segment of the distal tubule (100).Although there is some controversy as to whether Na/Ca2exchanger is present in proximaltubules, no reports have been given to date for exchanger in the thick ascending limb92(12,122). The fluorescent studies described herein suggest that NaICa2 exchange occursin porcine cTAL cells. In this regard, RNA isolated from cTAL tissue and isolated cellsconfirmed the presence of exchanger expression and also demonstrated the alternativesplicing variant present in porcine cTAL cells.Northern hybridization of total RNA from porcine kidney, brain, liver, heart and skeletalmuscle and Southern hybridization of the PCR product from porcine single cTAL cells wereused to determine the presence of these Na/Ca2 exchanger transcripts. The size of thetranscript of kidney and heart is about 7.5 Kb (Fig.34), which is consistent with theobservation of Lee et al (103) and Komuro et al (104). The failure to detect the transcriptsin brain and liver indicates the possibility that different isoforms of Na/Ca2 exchanger mayexist in these organs which is in keeping with the notions of Kofuji et al (102) and Lee et al(103). Further studies are required to show that this is another isoform of the Na/Ca2exchanger.Several eDNA fragments from inner cortex tissue were amplified by PCR, but only oneclear PCR product (— 290 bp) was found in the cTAL reaction (Fig. 35). Southern blotanalysis exhibited that only the 290 bp product is a part of Na/Ca2 exchanger (Fig.36).Since the primers used in PCR were designed from the regions flanking the alternativesplicing site, 350 bp cDNA was obtained from NCE.F1 positive control which was composedof three exons, B, D, and F. 290 bp PCR products from inner cortex and cTAL cells areshorter than the positive control, suggesting that less than three exons are involved in thisregion. Sequencing of the 290 bp PCR product revealed that the alternative splicingsegment of the Na/Ca2 exchanger in the cTAL cells is composed of exons B and D93(Fig.37). This isoform conforms to NACA3 which is the major Na/Ca2 exchanger foundin rat and rabbit kidneys (102,103).In summary, we have demonstrated functional NaICa2 exchange in single cTAL cellsthrough microspectrophotometry. The exchange activity is sensitive to some inorganic andorganic inhibitors. The present data also suggests that this exchange may be altered throughchanges including calmodulin-dependent and okadaic acid-inhibitable phosphatases. Further,we have shown through biochemical approaches that the Na/Ca2 exchanger message isexpressed in the cTAL cells and that this is the same isoform as that reported for distalconnecting tubules. Under normal conditions, transepithelial calcium reabsorption is thoughtto be passive and through the paracellular pathway in the cTAL (135,136) but active andtranscellular in the distal tubule (97). It is thus of interest to note that the isoform of theNa/Ca2 exchanger reported here in porcine cTAL cells is the same isoform identified inrat connecting tubule cells (100). It would appear that the same isoform may performdifferent functions; maintenance of [Ca29, in cTAL cells and calcium reabsorption in distalconnecting cells. The functional cell-specific differences have yet to be explained.GENERAL CONCLUSIONSThe present studies show that a number of peptide hormones elicit Ca2 signals inporcine cTAL cells likely through receptor-mediated responses. The Ca2 transients elicitedby the prototypical hormones, PTH, AVP, and ANP, are composed of intracellular releasefollowed by Ca2 entry across the plasma membrane. These signals are likely due to 1P3-mediated Ca2 release from the endoplasmic reticulum. PTH- and AVP-mediated Ca294Ca2 transients are modulated by cAMP and protein kinase C activation, which may play arole in regulating the responses to these honnones. ANP-mediated Ca2 transients aremodulated by cGMP, which may play a regulatory role in these signals. Accordingly, thesignaling pathways interact in a complicated way to orchestrate hormonal controls in cTAL.NaICa2 exchange was functionally demonstrated by both removal of external Na andvoltage depolarization in ouabain-treated cTAL cells. The activity of this exchange may bealtered through changes including calmodulin-dependent and okadaic acid-inhibitablephosphatases. The presence of a Na/Ca2 exchanger was confirmed with northernhybridization techniques. Total RNA from inner cortex was probed using a riboprobe madefrom NCE.F1 clone. A gene transcript which encodes a portion of the intracellular loop ofthe renal Na/Ca2 exchanger was amplified from cortical tissue and cTAL cells by PCRusing primers flanking the alternative splicing site. Southern hybridization and DNAsequencing demonstrated the isoform contained exons B and D characteristic of one isoformof the renal Na/Ca2 exchanger in cTAL cells of the porcine kidney. Under physiologicalconditions, it is likely that Na/Ca2 exchange plays an important role in [Ca291control andthus hormonal regulation of electrolyte reabsorption within the cTAL cells of the ioop ofHenle in the kidney.95REFERENCES1. Costanzo L.S., and Wmdhager E.E.: Renal regulation of calcium balance. In: SeldmD.W. and Giebisch 0., ed. The Kidney: Physiology and Pathophysiology, SecondEdition, Raven Press Ltd., New York, PP2375-2393, 1992.2. Lee C.O., Taylor A., and Windhager E.E.: Cytosolic calcium ion activity in epithelialcells of Necturus kidney. Nature 287:859-861, 1980.3. Ulirich K.J. , Rumrich G., and Moss S.: Active Ca2 reabsorption in the proximal tubuleof the rat kidney. Dependence on sodium- and buffer transport. PflUgers Archiv.364:223-228, 1976.4. Rouse D., Ng R.C., and Suki W.N.: Calcium transport in the pars recta and thindescending limb of Henle of the rabbit, perfused in vitro. J. Clin. Invest. 65:37-42,1980.5. Pennica D., Kohr W . J., Kuang W . J., Glaister D., Aggarwal B.B., Chen E.Y., andGoeddel D.V.: Identification of human uromodulin as the Tamm-Horsfall urinaryglycoprotein. Science 236:83-88, 1988.6. De Rouffignac C., and Quamme G.A.: Renal magnesium handling and its hormonalcontrol. Physiol. Rev. 74:305-322, 1994.7. Dai L.J., and Quamme G.A.: Intracellular Mg2 and magnesium depletion in isolatedrenal thick ascending limb cells. J. Clin. Invest. 88:1255-1264, 1991.8. Good D.W., Knepper M.A., and Burg M.B.: Ammonia and bicarbonate transport bythick ascending limb of rat kidney. Am. J. Physiol. 247:F35-F44, 1984.9. Bourdeau J.E., and Burg M.B.: Effect of PTh on calcium transport across the corticalthick ascending limb of Henle’s loop. Am. J. Physiol. 239:F121-F126, 1980.10.Suki W.N.,and Rouse D.: Hormonal regulation of calcium transport in thick ascendinglimb renal tubules. Am. J. Physiol. 241:F171-F174, 1981.11 .Shimizu T., Yoshitomi K., Nakamura M., and Imai M.: Effects of PTH, calcitonin, andcAMP on calcium transport in rabbit distal nepbron segments. Am. J. Physiol. 259:F408-F414, 1990.12.Rouffignac C. de, Di Stefano A., Wittner M., Roinel N., and Elalouf J.M.:Consequences of differential effects of ADH and other peptide hormones on thickascending limbs of mammalian kidney. Am. J. Physiol. 260:R1023-R1035, 1991.9613.Reilly R.F., Shugrue C.A. ,Lattanzi D., and Biemesderfer D.: Immunolocalization of theNa/Ca2 exchanger in rabbit kidney. Am. J. Physiol. 265:F327-F332, 1993.14.Bronner F.: Renal calcium transport: mechanisms and regulation---an overview. Am. J.Physiol. 257:F707-F711, 1989.15.Carafoli E.: The calcium pump of the plasma membrane. J. Biol. Chem. 267:2115-2118,1992.16.Blaustein M., DiPolo R., and Reeves J.P.: Sodium-calcium exchange. Proceedings of thesecond international conference. Ann. N. Y. Acad. Sci. 639:1-671, 1991.17.Pozzan T., Rizzuto R., Volpe P., and Melsolesi J.: Molecular and cellular physiology ofintracellular calcium stores. Physiol. Rev. 74:595-636, 1994.18.Mauger J. -P. and Claret M.: Mobilization of intracellular calcium by glucagon and cyclicAMP analogues in isolated rat hepatocytes. FEBS Let. 195:106-110, 1986.19.Morel F.: Sites of hormone action in the mammalian nephron. Am. J. Physiol.240:F159-F164, 1981.20.Morel F., Chabardès D., Imbert-Teboul M., Le Bouffant F., Hus-Citharel A., andMontégut M.: Multiple hormonal control of adenylatecyclase in distal segments of therat kidney. Kidney Tnt. 21 :555-S62, 1982.21 .Davis T.N.: What’s new with calcium? Cell 71:557-564, 1992.22.Artalejo C.R., Adams M.E., and Fox A.P.: Three types of Ca2 channel triggersecretion with different efficacies in chromaffin cells. Nature 367:72-76, 1994.23.Greger R.: Ion transport mechanisms in thick ascending limb of Henle’s loop ofmammalian nephron. Physiol. Rev. 65:760-797, 1985.24.Herbert S.C. ,and Andreoli T.E.: Control of NaC1 transport in the thick ascending limb.Am. J. Physiol. 246:F745-F756, 1984.25. Di Stefano A., Wittner M., Nitschke R., Braitsch R., Greger R., Bailly C., Amiel C.,Roinel N, and de Rouffignac C.: Effects of parathyroid hormone and clacitonin on Na,C1, K,Mg2 and Ca2 transport in cortical and medullary thick ascending limbs of mousekidney. Pflugers Arch. 417: 161-167, 1990.26.Wittner M., Di Stefano A., Mandon B., Roinel N., and de Rouffignac C.: Stimulation ofNaC1 reabsorption by antidiuretic hormone in the cortical thick ascending limb of Henle’ sloop of the mouse. Pflugers Arch. 419:212-214, 1991.9727.Rouffignac C. de, Elalouf J.M., Roinel N., Bailly C., and Amiel C.: Similarity of theeffects of antidiuretic hormone, parathyroid hormone, clacitonin, and glucagon on ratkidney. In: Robinson R.R. (ed) Nephrology. Springer, Berlin Heidelberg New York, pp340-357, 198428.Berridge M .3.: Inositol triphosphate and calcium signalling. Nature 361:315-325, 1993.29.Hallam T.J., and Rink T.J.: Receptor-mediated Ca2 entry in diversity of function andmechanism. Trends Pharmacol. Sci. 10:8-10, 1989.30.Kuno M. ,and Gardner P.: Ion channels activated by inositol 1 ,4,5-trisphosphate in plasmamembrane of human T-lymphocytes. Nature 326:301-304, 1987.31 .Rosenthal W., Hescheler J., Trautwein W., and Schultz G.: Control of voltage-dependent Ca2 channels by G protein-coupled receptors. FASEB J. 2:1784-1790,1988.32.Roe M.W., Lemasters 3.3., and Herman B.: Assessment of fura-2 for measurement ofcytosolic free calcium. Cell Calcium 11:63-73, 1990.33.Tsien R.Y., Rink T.J. and Poeme M.: Measurement of cytosolic free Ca2 in individualcells using fluorescent microscopy with dual excitation wavelengths. Cell Calcium6: 145-157, 1985.34.Quamme G.A. ,and Dai L.J. : Presence of a novel influx pathway for Mg2 in MDCK cells.Am. J. Physiol. 259:C521-C525, 1990.35.Grynkiewicz G., Poeme M., and Tsien R.Y.: A new generation of Ca2 indicators withgreatly improved fluorescence properties. J. Biol. Chem. 260:3440-3450, 1985.36.Malgaroli A., Milani D., Meldolesi 3., and Pozzan T.: Fura-2 measurement of cytosolicfree Ca2 in monolayers and suspensions of various types of animal cells. 3. Cell. Biol.105:2145-2155, 1987.37.Allen M.L., Nakao A., Sonnenburg W.K., Burnatowska-Hledin M., Spielman W.S.,andSmith W.L. : Immunodissection of cortical and medullary thick ascending limb cells fromrabbit kidney. Am. J. Physiol. 255:F704-F710, 1988.38.Glennon M.C., Bird G.S.J. , Kwan C.-Y. ,and Putney J.Jr: Actions of vasopressin andtheCa2-ATP se inhibitor, thapsigargin, on Ca2 signalling in hepatocytes. J. Biol. Chem.267:8230-8233, 1992.39.Thastrup 0., Cullen P.3., Drobak B., Hanley M.R., and Dawson A.P.: Thapsigargin, atumor promoter, discharges intracellular Ca2 stores by specific inhibition of theendoplasmic reticulumCa2-ATP se. Proc. Nati. Acad. Sci. USA 87:2466-2470, 1990.9840.Hor V.J., Baum B.J., and Ambudkar I.S.: Z-Adrenergic receptor stimulation inducesinositol trisphosphate production and Ca2 mobilization in rat acinar cells. J. Biol. Chem.263:12454-12460, 1988.41 .Rouffignac C. de, Elalouf J.M., and Rome! N.: Physiological control of the urinaryconcentrating mechanisms by peptide hormones. Kidney Tnt. 31:611-620, 1987.42.Cogan M.G.: Renal effects of atrial natriuretic factor. Annu. Rev. Physiol. 52:1255-1264,1991.43.Gunning M.E., and Brenner B.M.: Natriuretic peptides and the kidney: currentconcepts. Kidney mt. 42:S127-S133, 1992.44.Jamison R., Canaan-Kuhl S., and Pratt P.: The netriuretic peptide and their receptors.Am. 3. Kidney Dis. 20:519-530, 1992.45.Levin E.R.: Natriuretic peptide C-receptor more than a clearance receptor. Am. 3.Physiol. 264:E483-E489, 1993.46.Neant F., and Bailly C.: Luminal and intracellular cGMP inhibit the mTAL reabsorptivecapacity through different pathways. Kidney mt. 44:741-746, 1993.47.Chabardès D., Montegut M., Mistaoui M., Butlen D., and Morel F.: Atrial natriureticpeptide effects on cGMP and cAMP contents in microdissected glomeruli and segmentsof the rat and rabbit nephrons. PflUegers Arch. 408:366-372, 1987.48.Nonoguchi H., Knepper M.A.,and Mangamello V.C.: Effects of atrial natriuretic factoron cyclic guanosine monophosphate and cyclic adenosine monophosphate accumulationin microdissected nephron segments from rats. J. Clin. Invest. 79:500-507, 1987.49.Sudoh T., Kangawa K., Minamino N., and Matsuo H.: A new natriuretic peptide inporcine brain. Nature 332:78-81, 1988.50.Furuya M., Takehisa M., Minamitake Y. , Kitajima Y., Hayashi Y., Ohnuma N., IshiharaT., Minamino N., Kangawa K., and Matsuo H.: Novel natriuretic peptide, CNP,potently stimulates cyclic GMP production in rat cultured vascular smooth muscle cells.Biochem. Biophys. Res. Commun. 170:201-208, 1990.51 .Kojima M. , Minamino N. ,Kangawa K., and Matsuo H.: C-type natriuretic peptide (CNP),a new member of natriuretic peptide family identified in porcine brain. Biochem.Biophys. Res. Commun. 168:863-868, 1990.52.Suga S.-I., Nakao K., Mukoyama M., Arai H., Hosoda K., Ogawa Y., and Imura H.:Characterization of natriuretic peptide receptors in cultured cells. Hypertension Dallas9919:762-765, 1992.53.Schulz S., Singh S., Bellet R.A., Singh G., Tubb D.J., Chin H., and Garbers D.L.: Theprimary structure of a plasma membrane guanylate cyclase demonstrates diversity withinthis new receptor family. Cell 58:1155-1162, 1989.54.Koller K.J., Lowe D.G., Bennett G.L., Minamino N., Kangawa K., Matsuo H., andGoeddel D.V.: Selective activation of the B natriuretic peptide receptor by C-typenatriuretic peptide (CNP). Science 252:120-123, 1991.55.Almeida F.A., Suzuki M., Scarborough R.M., Lewicki J.A., and Maack T.: Clearancefunction of type C receptors of atrial natriuretic factor in rats. Am. J. Physiol. 256:R469-R475, 1989.56.Maack T., Suzuki M. , Almeida F.A. ,Nussenzveig D., Scarborough R.M., McEnroe G.A.,and Lewicki J.A.: Physiological role of silent receptors of atrial natriuretic factor.Science 238:675-678, 1989.57.Jolmson B.G., Trachte G.J., and Drewett J.G.: Neuromodulatory effect of the atrialnatriuretic factor clearance receptor binding peptide cANF(4-23)-NH2in rabbit isolatedvasa deferentia. J. Pharmacol. Exp. Ther. 257:720-726, 1991.58.Elalouf J.M., Sari D.C., and de Rouffignac C.: Additive effects of glucagon andvasopressin on renal Mg reabsorption and urine concentrating ability in the rat.PflUgers Arch. 407:S66-S71, 1986.59.Elalouf J.M., Di Stefano A., and de Rouffignac C.: Sensitivities of rat kidney thickascending limbs and collecting ducts to vasopressin (in vitro). Proc. Natl. Acad. Sci. USA83:2276-2280, 1986.60.Chabardès D., Imbert M., Clique A., Montégut M., and Morel F.: PTH sensitive adenylcyclase activity in different segments of the rabbit nepbron. Pflugers Arch. 354:229-239,1975.61 .Kikawa U., and Nishizuka Y.: The role of protein kinase C in transmembranesignalling. Annu. Rev. Cell Biol. 2:149-178, 1986.62.Uneyama H., Uneyama C., and Akaike N.: Intracellular mechanisms of cytoplasmic Ca2oscillation in rat megakaryocyte. J. Biol. Chem. 268:168-174, 1993.63.Nitschke R., FrObe U., and Greger R.: Antidiuretic hormone acts via V1 receptors onintracellular calcium in the isolated perfused rabbit cortical ascending limb. PflugersArch. 417:622-632, 1991.10064.Bourdeau J.E., Eby B.K., and Hu J.: cAMP-stimulated rise of [Ca21, in rabbitconnecting tubules: role of peritubular calcium. Am. J. Physiol. 258:F751-F755, 1990.65.Luim A., Lewis D., Guild S., Corda D., and Axelrod J.: Hormone secretagoguesincrease cytosolic calcium by increasing cAMP in corticotropin-secreting cells. Proc. Nati.Acad. Sci. USA 82: 8034-8038, 1985.66.Schiebinger R.J., Braley L.M., Menachery A., and Williams G.H.: Calcium, a “thirdmessenger” of cAMP-stimulated adrenal steroid secretion. Am. J. Physiol. 248:E89-E94,1985.67.Thastrup 0., Cullen P.J., Drobak B., Hanley M.R., and Dawson A.P.: Thapsigargin, atumor promoter, discharges intracellular Ca2 stores by specific inhibition of theendoplasmic reticulumCa2-ATP se. Proc. Nati. Acad. Sci. USA 87:2466-2470, 1990.68.Ansah T.-A., Dho S., and Case R.M.: Calcium concentration and amylase secretion inguinea pig pancreatic acini: interactions between carbachol, cholecystokinin, octapeptide,and the phorbol ester, 12-O-tetradecanoylphorbol 13-acetate. Biochim. Biophys. Acta889:326-333, 1986.69.Bird G.St J. ,Rossier M.F., Obie J.F., and Putney J.W.Jr: Sinusoidal oscillations inintracellular calcium requiring negative feedback by protein kinase C. J. Biol. Chem.268:8425-8428, 1993.70.Bruzzone R., Regazzi R., and Woltheim C.B.: Caerulin causes translocation of proteinkinase C in rat acini without increasing cytosolic free Ca2. Am. J. Physiol. 255: G33-G39,1988.71 .Willems P.11., Van Den Brock B.A., Van Os C.H., and De Pont J.J.: Inhibition ofinositol 1 ,4,5-triphosphate-induced Ca2 release in permeabilized pancreatic acinar cellsby hormonal and phorbol eater pretreatment. J. Biol. Chem. 264:9762-9767, 1989.72.Woods N.M. ,Cuthbertson K.S.R. ,and Cobbold P.T.S. :Phorbol ester-induced alterationsof free calcium ion transients in single rat hepatocytes. Biochem. J. 246:619-623, 1987.73.Dublineau I., Elalouf J.-M., Pradelles P., and de Rouffignac C.: Independentdesensitization of rat renal thick ascending limbs and collecting ducts to ADH. Am. J.Physiol. 256:F656-F663, 1989.74.Elalouf J.M., Chabane-Sari S., Roinel N., and de Rouffignac C.: Desensitization of ratrenal thick ascending limb to vasopressin. Proc. Natl. Acad. Sci. USA 85:2407-24 16,1988.75.Tan Y.P., and Marty A.: Protein kinase C-mediated desensitization of the muscarinic101response in rat lacrimal gland cells. J. Physiol. 433:357-371, 1991.76.de Zeeuw D., Janssen W.M.T., and de Jong P.: Atrial natriuretic factor: Its (patho)physiological significance in humans. Kidney Tnt. 41:1115-1133, 1992.77.Butlen D., Mistaoui M., and Morel F.: Atrial natriuretic peptide receptor along the ratand rabbit nephrons: [125J] alpha-rat atrial netriuretic peptide binding in microdissectedglomeruli and tubules. PflUgers Arch. 408:356-365, 1987.78.Terada Y., Moriyama T., Martin B.M., Knepper M.A., and Garcia-Perez A.: RT-PCRmicrolocalization of mRNA for guanylyl cyclase-coupled ANF receptor in rat kidney.Am. J. Physiol. F1080-F1087, 1991.79.Hirata M., Chang C.-H. ,and Murad F.: Stimulating effects of atrial natriuretic factor onphosphoinositide hydrolysis in cultured bovine aortic amooth muscle cells. Biochem.Biophys. Acta 1010:346-351, 1989.80.Isales C.M., Lewicki J.A., Nee J.J., and Barrett P.Q.: ANP-(7-23) stimulates a DHPsensitive Ca2 conductance and reduces cellular cAMP via a cGMP-independentmechanism. Am. J. Physiol. 263:C334-C342, 1992.81 .Li C.X., Stifam S., Schneider W.J., and Poznansky M.J.: Low density lipoproteinreceptors in epithelial cell (Madin-Darby canine kidney) monolayers. Asymmetricdistribution correlates with functional difference J. Biol. Chem. 266:9263-9270, 1991.82.Liu K., and Pierce G.N.: The effects of low density lipoprotein on Ca transients inisolated rabbit cardiomyocytes. J. Biol. Chem. 268:3767-3775, 1993.83.Sachimdis A., Locher R., Mengden T., and Vetter W.: Low-density lipoprotein elevatesintracellular calcium and pH in vascular smooth muscle cells and fibroblasts withoutmediation of LDL receptor. Biochem. Biophys. Res. Commun. 67:353-359, 1990.84.Anand-Srivastava M.B. , Butkowska J., and Cantin M.: The presence of atrial natriureticfactor receptors of ANF-R2 subtype in rat platelets. Coupling to the adenylylcyclase/cyclic AMP signal-transduction. Biochem. J. 278:211-221, 1991.85.Hu R.-M., Levin E.R., Pedram A., and Frank J.L.: Atrial natriuretic peptide inhibits theproduction and secretion of endothelin from cultured indothelial cells: mediationthrough the C receptor. J. Biol. Chem. 267:17384-17389, 1992.86.Hassid A.: Atriopeptins decrease resting and hormone-elevated cytosolic Ca in culturedmesangial cells. Am. J. Physiol. 253:F1077-F1082, 1987.87.Kondo Y., Imai M., Kangawa K., and Matsuo H.: Lack of direct action of alpha-human102atrial natriuretic polypeptide on the in vitro perfused segments of Henle’s loopisolated from rabbit kidney. PflUgers Arch. 406:273-278, 1986.88.Peterson L.N. ,de Rouffignac C., Sonnenberg H., and Levine D.Z.: Thick ascending limbresponses to dDAVP and atrial natriuretic factor in vivo. Am. J. Phsiol. 252:F374-F381,1987.89.Kato J., Lamer-Smith K.L., and Currie M.G.: Cyclic GMP downregulates atrialnatriuretic peptide receptors on cultured cascular endothelial cells. J. Biol. Chem.266: 14681-14685, 1991.90.Kato J., Oeblenschlager W.F., Newman W.H., and Currie M.G.: Inhibition ofendothelial cell clearance atrial natriuretic peptide by cyclic GMP treatment. Biochem.Biophys. Res. Commun. 182:420-424, 1992.91 .Cahill P.A., Redmond E.M., and Keenan A.K.: Vascular atrial natriuretic factorreceptor subtypes are not independently regulated by atrial peptides. J. Biol. Chem.265:21896-21906, 1990.92.Dai L.J., and Quamme G.A.: Hormone-mediated Ca2 transients in isolated renalcortical thick ascending limb cells. PflUgers Arch. 427:1-8, 1994.93 .Gmaj P., Murer H., and Kinne R.: Calcium ion transport across plasma membranesisolated from rat kidney cortex. Biochem. J. 178:549-557, 1979.94.Nicoll D.A., Longoni S., and Philipson K.D.: Molecular cloning and functionalexpression of the cardiac sarcolemmal Na-Ca2 exchanger. Science 250:562-565, 1990.95.Aceto J.F.,Condrescu M., Kroupis C., Nelson H., Nelson N., Nicoll D., Philipson K.D.,and Reeves J.: Cloning and expression of the bovine cardiac sodium-calcium exchanger.Arch. Biochem. Biophys. 298:553-560, 1992.96.Furman I., Cook 0., Kasir J., and Rahamimoff H.: Cloning of two isoforms of the ratbrain Na-Ca2 exchanger gene and their functional expression in HeLa cells. FEBS319:105-109, 1993.97.Kofuji P., Lederer W.J., and Schulze D.H.: Na/Ca exchanger isoforms expressed inkidney. Am. J. Physiol. 265:F598-F603, 1993.98.Low W., Kasir J., and Rahamimoff H.: Cloning of the rat heart Na-Ca2 exchanger andits functional expression in HeLa cells. FEBS 3 16:63-67, 1993.99. Reilly R.F., and Shugrue C.A.: cDNA cloning of a renal Na-Ca2 exchanger. Am.J.Physiol. 262:F1105-F1109, 1992.103100.Yu A.S.L.,Hebert S.C.,Lee S.-L.,Brenner B.M.,and Lytton J.: Identification andlocalization of renal Na-Ca2 exchanger by polymerase chain reaction. Am. J. Physiol.263 :F680-F685, 1992.101 .Philipson K.D., and Nicoll D.A.: Molecular and kinetic aspects of sodium-calciumexchange. mt. Rev. Cytol. 137C:199-227, 1993.102.Kofuji P., Lederer W.J., and Schulze D.H.: Mutually exclusive and cassette exonsunderlie alternatively apliced isoforms of the Na/Ca exchanger. J. Biol. Chem.269:5145-5149, 1994.103.Lee S.-L. ,Yu A.S.L. ,and Lytton J.: Tissue-specific expression of Na-Ca2 exchangerisoforms. J. Biol. Chem. 269:14894-14852, 1994.104.Komuro I., Wenninger K.E., Philipson K.D., and Izumo S.: Molecular cloning andcharacterization of the human cardiac Na/Ca2 exchanger cDNA. Proc. Nati. Acad.Sci. USA 89:4769-4773, 1992.105.Smith J.B., Zheng T., and Smith L.: Relationship between cytosolic free Ca2 andNa/Ca2 exchange in aortic smooth muscle cells. Am. J. Physiol. 256:C147-C154, 1989.106.Rasgado-Flores H, Santiago E.M., and Blaustein M.P.: Kinetics and stoichiometry ofcoupled Na efflux and Ca2 influx (Na/Ca2 exchange) in barnacle muscle cells. J.Gen. Physiol. 93:1219-1241, 1989.107.Bouhtiauy I., Lejeunesse D., and Brunette M.G.: The mechanisms of parathyroidhormone action on calcium reabsorption by the distal tubule. Endocrinology 128:251 -258, 1991.108.Hanai H., Ishida M., Liang C.T. ,and Sacktor B.: Parathyroid hormone increasessodium/calcium exchange activity in renal cells and the blunting of the response inaging. J. Biol. Chem. 261:5419-5425, 1986.109.Scoble J.E., Mills S., and Hruska K.A.: Calcium transport in canine renal basolateralmembrane vesicles: effects of parathyroid hormone. J. Clin. Invest. 75:1096-1105,1985.1 1O.Bindels R,J.M., Dempster J.A., Rumakers P.L.M. ,Willems P.H., and Van Os C.H.:Effect of protein kinase C activation and down-regulation on active calcium transport.Kidney mt. 43:295-300, 1993.111. Quamme G.A.: Intracellular free Mg2 and pH changes in cultured epithelial cells.Am. J. Physiol. 264:G383-G389, 1993.104112.Chomczynski P., and Sacchi N.: Single-step of RNA isolation by acid guamdiniumtriocyanate-phenol-chloroform extraction. Anal. Biochem. 162:156-159, 1987.1 13.Chomczynski P.: A reagent for the single-step simultaneous isolation of RNA, DNA,and proteins from cell and tissue samples. BioTeckniques 15:532-535, 1993.114.Chomczynski P.: One-hour downward alkaline capillary transfer for blotting of DNAand RNA. Anal. Biochem. 201:134-139, 1992.1 15.Smith J.B., Cragoe E.J., and Smith L.: NaICa2 antiporter in cultured arterial smoothmuscle cells. J. Biol. Chem. 262:11988-11994, 1987.116. Crespo L.M. , Grantham C. J. ,and Cannell M .B.: Kinetics, stoichiometry and role of theNa/Ca2 exchange mechanism in isolated cardiac myocytes. Nature 345:618-621,1990.1 17.Blaustein M.P.: Effects of internal and external cations and of ATP on sidium-calciumand calcium-calcium exchange in squid axons. Biophys. J. 20:79-111, 1974.1 18.Simchowitz L., and Cragoe E.J.Jr.: Na/Ca2 exchange in human neutrophils. Am. J.Physiol. 254:C150-C164, 1988.1 19.Tornquist K., and Tashjran A.H.Jr.: Dual actions of 1 ,25-dihydroxycholecalciferol onintracellular Ca2 inGH4C1 cells: evidence for effects on voltage-operated Ca2 channelsand Na/Ca2 exchange. Endocrinology 124:2765-2776, 1989.120.Vigne P., Breittmayer J.-P. , Duval D., Frelin C., and Lazdunski M.: The Na/Ca2antiporter in aortic smooth muscle cells. Characterization and demonstration of anactivation by phorbol esters. 3. Biol. Chem. 263:8078-8083, 1988.121 .DiPolo R., and Beauge L.: Characterization of the reverse Na/Ca exchange in squidaxons and its modulation by Ca and ATP. J. Gen. Physiol. 90:505-525, 1987.122. Tamgushi S., Marchetti J., and Morel F.: Na/Ca/ exchangers in collecting cells of ratkidney. A single tubule fura-2 study. PflUgers Arch. 415:191-197, 1989.123.Dominguez J.H., Mann C., Rothrock J.K., and Bhati V.: Na-Ca2 exchange and Ca2depletion in rat proximal tubules. Am. J. Physiol. 261 :F328-F335, 1990.124.Friedman P.A. , Figueiredo J.F. Maack T., and Windhager E.E.: Sodium-calciuminteractions in the renal proximal convoluted tubule of the rabbit. Am. 3. Physiol.240:F558-F568, 1981.125.Bourdeau J.E. ,and Lau K.: Basolateral cell membrane Ca-Na exchange in single rabbitconnecting tubules. Mn. 3. Physiol. 258:F1497-F1503, 1990.105126.Nitschke R., Frobe U., and Greger R.: Antidiuretic hormone acts via V1 receptors onintracellular calcium in the isolated perfused rabbit cortical thick ascending limb.Pflugers Arch. 417:622-632, 1991.127.Bouhtiauy I., Lejeunesse D., and Brunette M.G.: Effect of vitamin D depletion oncalcium transport by the luminal and basolateral membranes of the proximal and distalnephrons. Endocrinology 132:115-120. 1993.128.Zhu Z., Tepel M., Neusser M., and Zidek W.: Role of Na-Ca2 exchange in agonist-induced changes in cytosolic Ca2 in vascular smooth muscle cells. Am. J. Physiol.266:C794-C799, 1994.129.Furukawa K.-I. , Ohshima N., Tawada-Iwata Y., and Shigekawa M.: Cyclic GMPstimulates Na/Ca2 exchange in vascular smooth muscle in porcine cell lines. J. Biol.Chem. 266:12337-12341, 1991.130.Mene P., Pugliese F., and Cinotti G.A.: Regulation of Na-Ca2 exchange in culturedhuman mesangial cells. Am. J. Physiol. 261 :F466-F473, 1991.131 .Caroni P., and Carafoli E.: The regulation of the Na-Ca2 exchanger of heartsarcolemma. Eur. J. Biochem. 132:451-460, 1983.132.Ramachandran C., and Brunette M.G.: The renal Na-Ca2 exchange system is locatedexclusively in the distal tubule. Biochem. J. 257:259-264, 1989.133.Bourdeau J. E., Taylor A.N. , and lacopino A.M.: Immunocytochemical localization ofsodium-calcium exchanger in canine nephron. J. Am. Soc. Nephrol. 4:105-110, 1993.134.Domingues J.H. , Juhaszodu M. , Kleibaeker S.B. ,Hale C.C. ,and Feister H.A.: Na-Ca2exchange of rat proximal tubule: gene expression and subcellular location. Am. J.Physiol. 263:F945-F950, 1992.135. Friedman P.A.: Basal and hormone-activated calcium absorption in mouse renal thickascending limbs. Am. J. Physiol. 254:F62-F70, 1988.136.Wittner M., Mandon B., Roinel N., de Rouffignac C., and Di Stefano A.: Hormonalstimulation on Ca2 and Mg2 transport in the cortical thick ascending limb of Henle’sloop of the mouse: evidence for a change in the paracellular pathway permeability.Pflugers Arch. 423:387-396, 1993.

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0088109/manifest

Comment

Related Items