Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The bisecting N-acetylglucosamine of N-glycans appear dispensable for development and reproduction Priatel, John Jacob 1997

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1997-196402.pdf [ 12.71MB ]
Metadata
JSON: 831-1.0088070.json
JSON-LD: 831-1.0088070-ld.json
RDF/XML (Pretty): 831-1.0088070-rdf.xml
RDF/JSON: 831-1.0088070-rdf.json
Turtle: 831-1.0088070-turtle.txt
N-Triples: 831-1.0088070-rdf-ntriples.txt
Original Record: 831-1.0088070-source.json
Full Text
831-1.0088070-fulltext.txt
Citation
831-1.0088070.ris

Full Text

THE BISECTING N-ACETYLGLUCOSAMINE OF N-GLYCANS APPEARS DISPENSABLE FOR DEVELOPMENT AND REPRODUCTION By:  John Jacob Priatel  B . S c , The University of British Columbia, 1989  A THESIS SUBMITTED IN PARTIAL F U L F I L L M E N T OF THE REQUIREMENTS FOR THE D E G R E E OF DOCTOR OF PHILOSOPHY in THE F A C U L T Y OF G R A D U A T E STUDIES Genetics Programme  We accept this thesis as conforming to the required standard  THE UNIVERSITY OF BRITISH C O L U M B I A March 1997 © John Jacob Priatel, 1997  In  presenting this  degree  at the  thesis  in  University of  partial  fulfilment  of  of  department  this thesis for or  by  his  or  requirements  British Columbia, I agree that the  freely available for reference and study; I further copying  the  representatives.  an advanced  Library shall make it  agree that permission for extensive  scholarly purposes may be her  for  It  is  granted  by the  understood  that  head of my copying  or  publication of this thesis for financial gain shall not be allowed without my written permission.  Department  of  Greyertcs  The University of British Columbia Vancouver, Canada  Date  DE-6 (2/88)  ABSTRACT The  biosynthesis  of complex  asparagine (N)-linked oligosaccharides  in  vertebrates proceeds w i t h the linkage of N-acetylglucosamine (GlcNAc) to the core mannose  residues.  UDP-N-acetylglucosamine:(3-D-mannoside  acetylglucosaminyltransferase of  GlcNAc  to the  acetylglucosamine.  (31-4  N-  HI (GlcNAc-TIII, E.C. 2.4.1.144) catalyzes the addition  mannose  that  is itself  (31-4 linked  to  underlying  N-  GlcNAc-TIII thereby produces what is k n o w n as a "bisecting"  G l c N A c linkage w h i c h can be found o n various hybrid and complex N-glycans. GlcNAc-TIII can also play a regulatory role i n N-glycan biosynthesis as addition of the bisecting G l c N A c eliminates the potential for a-mannosidase-II, G l c N A c - T I I , G l c N A c - T I V , G l c N A c - T V , and core al-6-fucosyltransferase to act. To investigate the physiologic relevance of GlcNAc-TIII function and bisected N-glycans, the m o u s e gene encoding GlcNAc-TIII (Mgat3) was cloned, characterized, and inactivated u s i n g Cre/loxP  site-directed recombination.  comparison to the rat and h u m a n  The Mgat3 gene is highly conserved  in  homologs and is normally expressed at h i g h  levels i n brain and kidney tissue. U s i n g fluorescence i n situ hybridization (FISH), the Mgat3 gene was regionally mapped to chromosome  15E11, near the Scn8a  sodium channel gene at 15F1. F o l l o w i n g homologous recombination i n embryonic stem cells and Cre mediated gene deletion, Mgaf3-deficient mice were produced that lacked GlcNAc-TIII activity and E - P H A 4  oligosaccharides. reproduced  Such GlcNAc-TIII n u l l  normally.  visualized GlcNAc-bisected N - l i n k e d mice were found  to be viable a n d  Moreover, such mice exhibited n o r m a l  morphology among organs including brain and kidney.  cellularity a n d  N o alterations  were  Ill  apparent i n circulating leukocytes, red cells or i n serum metabolite levels that reflect kidney function.  A l t h o u g h we find that GlcNAc-TIII and the bisecting G l c N A c of  N-glycans appear dispensable for n o r m a l development mouse,  it  may  have  a  role  in  physiologic  and reproduction i n  responses  to  pathogenic  the and  environmental stimuli. Moreover, it may be important for some function still to be determined.  iv  TABLE OF CONTENTS ABSTRACT T A B L E O F CONTENTS LIST O F FIGURES LIST OF TABLES ABBREVIATIONS PREFACE Thesis Format List of Publications arising from the work of this thesis Contributions of Co-Authors to the W o r k Presented i n this Thesis ACKNOWLEDGEMENT C H A P T E R 1. Introduction 1.1 Introduction and Thesis Objectives 1.2 Glycoconjugates and Vertebrate Development 1.2.1 The Glycosyltransferase 1.2.2 Roles of Protein Glycosylation (a) Oligosaccharide Function Varies w i t h the Protein (b) Structural and Protective Roles (c) T r a i t o r o u s / M a s k i n g Functions (d) Cell-Cell and Cell-Matrix Interaction 1.2.3 Lectins-Carbohydrate Binding Proteins (a) C-Type Lectins (b) I-Type Lectins (c) P-Type Lectins (d) Galectins 1.2.4 O-Glycans (a) M u c i n Glycoproteins (b) Proteoglycans (c) O-GlcNAc-Type Glycans 1.2.5 N - G l y c a n s (a) N - G l y c a n Biosynthesis (b) Formation of the Dolichol-Linked Precursor Sugar (c) Transfer of the Oligosaccharide to Protein (d) T r i m m i n g of the Protein-Bound Oligosaccharide (e) Formation of H y b r i d and Complex N - G l y c a n s (f) Microheterogeneity 1.2.6 Control of N - L i n k e d Branching (a) Factors Influencing Glycan Formation (b) N-Acetylglucosaminyltransferase I (c) Order of A c t i o n and Competition for Substrate (d) Peptide and Its Influence o n the Oligosaccharide (e) Control b y the Endomembrane (f) Diversity of N-glycans (g) Poly-N-Acetyllactosamines 1.2.7  N-Glycans and Disease  x x xi xii 1 3 4 5 6 7 8 8 10 11 11 12 12 13 13 14 14 15 16 18 19 20 21 23 23 23 24 25 25 27 27 28 30  1.3  1.4  (a) Altered Branching and Malignancy (b) Genetic Diseases Involving N - G l y c a n s (c) Complex N-Glycans are Required for Development 1.2.8 The Bisecting N-Aceytlglucosamine of N - G l y c a n s (a) C l o n i n g of the Rat N-Acetylglucosaminyltransferase III (b) H i g h GlcNAc-TIII Activity is Associated w i t h Some Malignancies (c) The Effects of the Bisecting N-Acetylglucosamine o n Oligosaccharide Structure and Lectin B i n d i n g M a n i p u l a t i n g the Mouse Genome 1.3.1 Introduction 1.3.2 Embryonic Stem Cells 1.3.3 H o m o l o g o u s Recombination 1.3.4 The P I Bacteriophage and Cre Recombinase (a) Cre and the P I phage lifecycle (b) Cre and the loxP site (c) The Use of Cre i n Heterologous Systems (d) Site-Specific Recombination i n Transgenic A n i m a l s (e) C r e and The Induction of Chromosomal Rearrangements (f) C r e and Site-Specific Insertion (g) Other Cre Delivery Systems Thesis Objectives  C H A P T E R 2.  2.1 2.2 2.3 2.4 2.5 2.6 2.7 2.8 2.9 2.10 2.11 2.12 2.13 2.14 2.15  38 39 41 41 41 42 45 46 47 48 49 53 55 57 57  Materials and Methods  Genomic D N A isolation and analysis of the mouse Mgat3 gene D N A Sequencing F I S H Detection and Image Analysis R N A Blot Analysis Targeting Vector Construction Homologous Recombination i n ES Cells Transient C r e Transfection i n ES Cells Generation of Chimaeric and Mutant Mice D N A Isolation In Vitro Differentiation of Embryonic Stem C e l l Clones GlcNAc-TIII Enzyme Assay E - P H A / L - P H A Lectin Blotting Hematology Serum Chemistry F l o w Cytometry 4  30 32 33 35 37  4  58 59 59 60 61 61 62 62 63 63 66 67 68 68 69  vi  CHAPTER 3. 3.1 3.2  3.3  Introduction Results 3.2.1 Genomic Library Screening w i t h a Rat c D N A probe 3.2.2 Mgat3 Genomic Insert is i n the Germline Configuration 3.2.3 Mgat3 is H i g h l y Conserved and H a s a Single Protein Encoding Exon 3.2.4 Chromosomal Localization of Mouse Mgat3 3.2.5 Brain and K i d n e y Show Highest Levels of Expression A m o n g N o r m a l Tissues Examined 3.2.6 The pflox Vector 3.2.7 Construction of the Mgat3 Targeting Vector 3.2.8 P C R Detection of Homologous Recombination 3.2.9 Confirmation of Homlogous Recombination b y Southern Blotting 3.2.10 Three of Eight Recombinants Retained A l l Three loxP sites 3.2.11 Transient Cre Transfection i n Embryonic Stem Cells Results i n T w o Types of Recombination 3.2.12 The Mgat3 Mutation i n Embryonic Stem Cells is Associated w i t h a Loss i n GlcNAc-TIII Activity 3.2.13 The Generation of Chimaeric A n i m a l s and the Transmission of the Mutated Allele Discussion  CHAPTER 4. 4.1 4.2  Mgat3 Cloning and the Generation of a Mgat3 Mutation in Embryonic Stem Cells  72 72 73 75 78 80 81 83 84 86 88 89 92 93 93  Bisecting N-Acetylglucosamine of N-glycans Appears Dispensable For Development and Reproduction  Introduction Results 4.2.1 Mgat3 knockouts are Viable and of N o r m a l Weight 83 4.2.2 N u l l Mice Lack Hybridization to a Mgat3 C o d i n g Sequence Probe 4.2.3 Mutant Mice are Fertile and Transmit the Mutated Allele at a Predicted Mendelian Frequency 4.2.4 Disruption of the Mgat3 gene is Associated w i t h a Deficiency i n GlcNAc-TIII Activity 4.2.5 Lack of GlcNAc-TIII Activity Correlates w i t h a Depletion of Bisected N - G l y c a n s 4.2.6 Serum Metabolite Analyses 4.2.7 Hematological Analyses 4.3 Discussion  BIBLIOGRAPHY  71  96 96 97 97 99 99 102 104 105 106  111  vii  LIST OF FIGURES CHAPTER 1 Figure 1.1 Figure Figure Figure Figure Figure Figure Figure Figure  1.2 1.3 1.4 1.5 1.6 1.7 1.8 1.9  The three major types of asparagine-lined oligosaccharides Branching of mammalian N-glycans The synthesis of the oligosaccharide precursor The antennae formation of N-glycans Synthesis of Lewis blood group antigens Maintenance of P I during lysogeny The loxP site Cre-mediated D N A deletion Site-specific integration  15 17 18 22 29 46 47 50 55  E m b r y o i d body formation  66  Mgat3 insert is i n germline configuration Nucleotide and amino acid sequence of the mouse Mgat3 gene Comparison of putative mouse, rat and h u m a n GlcNAc-TIII sequences Regional chromosomal localization of the mouse Mgat3 gene by F I S H Expression of Mgat3 gene among normal mouse tissues The pflox vector Mouse Mgat3 genomic structure and targeting vector production P C R detection of homologous recombination Southern confirmation of homologous recombination Structure and presence of loxP sites The p M C - C r e Expression Vector Cre-mediated recombination i n embryonic stem cells  74  CHAPTER 2 Figure 2.1 CHAPTER 3 Figure 3.1 Figure 3.2 Figure 3.3 Figure 3.4 Figure 3.5 Figure 3.6 Figure 3.7 Figure 3.8 Figure 3.9 Figure 3.10 Figure 3.11 Figure 3.12  75 78 79 81 82 84 85 87 88 90 91  CHAPTER 4 Figure 4.1 Figure 4.2 Figure 4.3  Heterozygous and homozygous mutations i n the Mgat3 allele i n intact mice Mgat3 mutation is associated w i t h a loss of GlcNAc-TIII activity Loss of GlcNAc-TIII activity correlates w i t h a depletion of E - P H A lectin binding 4  98 101 103  viii  LIST OF TABLES CHAPTER 4 Table 1 Table 2 Table 3  Transmission of the Mgat3 allele Renal panel Peripheral Blood Hematology A  99 104 105  ix  ABBREVIATIONS ARS Asn B H K cells CML-BC ConA C CRD DNA E-PHA ES Cells FACS FISH Fuc Gal GalNAc GlcNAc GlcNAc-T IgSF L-PHA Man MAG MM PAGE PBS PCR PE RER RNA SDS Ser SSEA-1 Thr V  Autonomous replicating sequence Asparagine Baby hamster kidney cells Chronic Myelogenous Leukemia-Blast Crisis Concavalin Agglutinin Immunoglobulin Constant D o m a i n Carbohydrate Recognition Domain Deoxyribonucleic A c i d Erythrocyte-Phytohemagglutinin Embryonic Stem Cells Fluorescence activated cell sorter fluorescence in situ hybridization Fucose Galactose N-acetylgalactosamine N-acetylglucosamine N-acetylglucosaminyltransferase Immunoglobulin Superfamily Leukocyte-Phytohemagglutinin Mannose Myelin Associated Glycoprotein Multiple Myeloma Polyacrylamide gel electrophoresis Phosphate buffered saline polymerase chain reaction Phycoerythrin rough endoplasmic reticulum Ribonucleic A c i d Sodium dodecyl sulphate Serine Stage-Specific Embryonic Antigen-1 Threonine Immunoglobulin Variable D o m a i n  PREFACE  Thesis Format I have chosen to write m y thesis i n the following format. The thesis is organized i n t o four chapters. Chapter One has an overview and thesis objectives section. Chapter One also contains an introduction to the field of glycosylation, review of N - l i n k e d branching, the development of embryonic stem cell technology and applications of Cre recombinase i n transgenic mice. These elements were used to create the Mgat3 mutation. Chapter T w o contains the general materials and methods. Chapters Three and Four include an introduction, a results and discussion sections. Chapter Three discusses the cloning, characterization and the inactivation of the mouse Mgat3 gene. Chapter Four reviews the evidence demonstrating the fidelity of the generated mutation. This chapter also includes some analyses testing for deficits associated w i t h the mutation. The references are listed at the end i n the bibliography section.  Publications Arising From The Work Of This Thesis ABSTRACT: Priatel, J . J . , Sarkar, M., Schachter and Marth, J. D. (1996) Isolation, Characterization of the Mouse Mgat3 Gene: The Bisecting NAcetylglucosamine in Asparagine-linked Oligosaccharides Appears Dispensable for Viability and Reproduction. Glycobiology 6, 750. PEER-REVIEWED: Priatel, J . J . , Sarkar, M., Schachter and Marth, J. D. (1997) Isolation, Characterization of the Mouse Mgat3 Gene: The Bisecting NAcetylglucosamine in Asparagine-linked Oligosaccharides Appears Dispensable for Viability and Reproduction. Glycobiology 7, 45-56.  xi  Contributions of Co-Authors to the Work Presented in this Thesis M u c h thanks is given to A n i t a Gertz-Borowski for lending her great technical expertise.  After  microinjecting the targeted ES cells into  implanted the embryos into pseudo-pregnant mice.  host blastocysts,  she  The chimaeric mice generated  were necessary for introducing the Mgat3 mutation into the germline. I w o u l d like to give special thanks to M o h a n Sarkar and H a r r y Schachter for their w o r k on  the  GlcNAc-TIII enzyme analyses and lectin blotting. I am also indebted to the U C S D M e d i c a l Center (Hillcrest) for performing the peripheral blood hematology (Table 2) and the renal panel (Table 3). C h r o m o s o m a l localization studies were performed by Z o n g M e i Z h a n g and Teresa Scheidl. They labelled the genomic insert, isolated for targeting vector construction, w i t h biotin and utilized F I S H analyses.  Xll  ACKNOWLEDGEMENTS I am very grateful to my supervisor, Dr. Jamey D . M a r t h , for giving me the opportunity of being a graduate student i n his laboratory and for p r o v i d i n g a n excellent scientific environment.  Furthermore, I w i s h to thank Jamey for his advice  and the support he provided during difficult times. I extend m y sincere appreciation to Kenneth Harder, Daniel C h u i and A n i t a Gertz-Borowski for their friendship and support. Michael D u r n i n and K u r t M a r e k for their superb technical assistance. Financial support during these studies was p r o v i d e d by R o m a n Matthew Babicki and H o w a r d Hughes Medical Institute Fellowships. I w o u l d like to thank my family and friends for their support d u r i n g the w o r k of this thesis. N o n e of m y accomplishments w o u l d have been possible without the l o v e , support, guidance and encouragement given to me by my parents, Ivan and A n g e l i n a , and m y brother A n d r e w . I w o u l d also like to express special thanks to m y wife, Erica, for her constant support and encouragement times of the thesis.  and for being there d u r i n g the t o u g h  Introduction  1  CHAPTER 1  Introduction 1.1  Overview and Thesis Objectives The role of N-glycans in m a m m a l i a n development  and physiology has  remained elusive even though many of the enzymes and substrates i n v o l v e d i n this catalysis have been w e l l studied. Knowledge of the biochemistry has allowed many of the steps to be recapitulated in vitro. Rapid changes occur to the repertoire of asparagine (N)-linked oligosaccharides during embryogenesis, differentiation and malignant transformation. The enormous structures  as w e l l as their elaborate  energy investment  to synthesize such  complexity signifies that they  are  vital.  Moreover, comparison of mammalian homologs of a given gene has resulted i n the observation that putative glycosylation sites are often highly conserved, thereby suggesting that oligosaccharides are biologically-active.  Glycosylation  provides  proteins additional structural and functional variation. Furthermore, the v a r i a t i o n i n the type of linkage (a & (3), the carbon atoms involved i n the linkage (1-2, 1-3, 1-4, 1-6, etc.), the monosaccharide residues used, as w e l l as the possibility of branching and additional modifications make carbohydrates suitable information  carriers.  Since carbohydrates extend far from the surface of the cell, scientists have l o n g suspected that these molecules serve as ligands for lectins, mediating functions i n cell-cell adhesion and recognition. Despite many advances i n the understanding of glycoconjugate synthesis, the knowledge of their biology has lagged. The cloning of many glycosyltransferases  Introduction  2  in recent years allows for genetic approaches to be used i n the field of glycosylation. In addition, the discovery of embryonic stem (ES) cells permits the investigation of gene function in vivo.  ES cells have been a boon for two unique talents they  possess, the ability to undergo homologous  recombination at relatively h i g h  frequencies and the potential to give rise to the germline u p o n their re-introduction into a host blastocyst, w h i c h allows one to generate specific gene mutations a n d study the consequences of such losses i n a whole animal. A s glycosyltransferase loss may result i n embryonic lethality a n d / o r pleiotropic changes, it w o u l d be desirable to create a conditional mutation, thereby, granting the ability to disrupt the gene i n a tissue or cell-subset specific manner.  The Cre/loxP  site-specific r e c o m b i n a t i o n  system can be employed for gene targeting to meet the above-mentioned criterion. In this system, expression of the Cre recombinase i n a cell or tissue  determines  whether the /oxP-flanked gene (exon) of interest is erased. Previous  work  has  shown  that  complex  N-linked  oligosaccharide  biosynthesis is required early i n embryonic development (Ioffe and Stanley, 1994; Metzler et al., 1994) although the m i n i m a l structure necessary for ontogeny is not yet defined. structures  This regulated biosynthetic pathway often generates oligosaccharide  bearing multiple antennae,  suggesting the possibility  that  unique  biological information is contained along each branch. The biosynthesis of complex asparagine (N)-linked oligosaccharides i n vertebrates proceeds w i t h the linkage of N-acetylglucosamine  (GlcNAc)  acetylglucosamine:p-D-mannoside  to  the (31-4  core  mannose  residues.  UDP-N-  N-acetylglucosaminyltransf erase  III  (GlcNAc-TIII, E.C. 2.4.1.144) catalyzes the addition of G l c N A c to the mannose that is  Introduction  3  itself (31-4 linked to underlying N-acetylglucosamine. GlcNAc-TIII thereby produces what is k n o w n as a "bisecting" G l c N A c linkage w h i c h can be found on v a r i o u s hybrid and complex N-glycans. GlcNAc-TIII may also play a regulatory role i n N glycan biosynthesis as addition of the bisecting G l c N A c eliminates the potential for cc-mannosidase-II, fucosyltransferase  GlcNAc-TIL  GlcNAc-TIV,  GlcNAc-TV,  and  core  al-6-  to act. A l t h o u g h the bisecting G l c N A c has not been s h o w n to  interact w i t h an animal lectin, its presence is k n o w n to have a marked effect on the binding of exogenous  lectins to oligosaccharide structures.  To investigate  the  physiologic relevance of GlcNAc-TIII function and bisected N-glycans, the m o u s e gene encoding GlcNAc-TIII (Mgat3) was cloned, characterized, and inactivated u s i n g Cre /loxP site-directed recombination.  1.2  Glycoconjugates and Vertebrate Development A myriad of oligosaccharide structures envelops eukaryotic cells forming a  dense covering.  The majority of these structures are covalently linked to some  other macromolecule, either a l i p i d or protein. U n l i k e the linearity of protein and D N A , the branching of these information carriers confers on them an extra degree of variation.  The information encoded by these glycoconjugates is thought to be  important for ontogeny as many glycosyltransferases are expressed i n a tissue- and developmentally-restricted  fashion.  This  regulation  is illustrated  by specific  histochemical staining observed w i t h different lectins and carbohydrate-recognizing  Introduction antibodies.  Furthermore,  4  oligosaccharide complexity is seen to increase  with  vertebrate phylogeny suggesting involvement i n ontogeny and morphogenesis. A l t h o u g h glycosylation appears to be crucial for in vivo, it appears to be inconsequential  for m a m m a l i a n  cell lines.  Cell  lines  defective  in various  glycosyltransferases proliferate normally and exhibit no phenotypic differences f r o m w i l d type cells (Stanley, 1984; Stanley, 1989; Esko, 1991). For instance, the d e r i v a t i o n of a C H O cell line deficient i n G l c N A c - T I (Stanley, 1992), an enzyme required for the formation of complex N-glycans, resulted i n no observable phenotype as compared to the parental cells.  These findings suggest that complex N-glycans are not  important for the housekeeping functions of a single cell but are required for the viability of the multicellular organism.  O n the other hand, embryos lacking this  gene died by embryonic day 10 (Ioffe and Stanley, 1994; Metzler et al, 1994).  These  experiments underlie the importance of studying protein glycosylation in vivo.  1.3  The Glycosyltransferase Since oligosaccharides are non-linear, it is not possible to have a template-  driven system analogous to protein and D N A synthesis. Their complexity demands an assembly line-style of manufacturing. endoplasmic  reticulum  membrane-bound  and Golgi  The endomembrane,  apparatus, fulfills  this  referring to the  criterion  with  its  glycosidases and glycosyltransferases acting i n a sequential a n d  competitive fashion (Schachter, 1991a).  A substantial part of the m a m m a l i a n  genome, greater than 250 genes, codes for enzymes participating i n the biosynthesis of glycans (Varki and Marth, 1995). Furthermore, this number does not include the  Introduction  5  great quantity of proteins (lectins) w h i c h recognize oligosaccharide structures. formation  of oligosaccharides  do not  result  from  the  random  The  action of  glycosyltransferases. Since glycosyltransferases reside to specific sub-regions of the G o l g i apparatus, they act i n a specific order and time during the movement oligosaccharide through the l u m e n of the endomembrane.  of the  In addition, m a n y  glycosyltransferases, except for the enzymes that build the core structures,  are  expressed i n a tissue-specific manner. Glycosyltransferases catalyze the following reaction:  nucleoti de-sugar + R-OH where  R is either  a 'free  •  R-O-sugar + nucleotide  saccharide or linked  to a protein  (or lipid)-bound  oligosaccharide and O H is a free hydroxy 1 group. These enzymes show remarkable specificity for both the acceptor and the nucleotide donor.  A l t h o u g h there are  exceptions, the conventional rule is that there is a single glycosyltransferase for each glycosidic  linkage.  Apart  from  a  few  families  (eg.  sialyltransferases),  glycosyltransferases show virtually no sequence homology to each other (Schachter, 1994). However, they are all type II integral membrane proteins and do share some structural domains. These include a short cytoplasmic amino terminal domain, a transmembrane  (anchor) domain, a proline-rich neck region and the carboxy-  terminal catalytic domain. The neck, also called stem, region resides between the transmembrane and catalytic domains.  Introduction  1.4  6  Roles of Protein Glycosylation The  question  regarding  the  biological  roles  for  protein-bound  oligosaccharides and w h y they display so m u c h complexity have been  baffling.  Realizing their distal position from the cell, scientists have long speculated the involvement adhesion.  of carbohydrate structures  i n arbitrating cell-matrix and cell-cell  M u c h study n o w suggests a broader spectrum of functions for protein  glycosylation (reviewed i n V a r k i , 1993). Some glycoconjugates are critical to the organism w h i l e others appear to be meaningless.  A great deal of this research has  been focused on i n d i v i d u a l proteins and h o w one or more of its characteristics are affected b y these modifications. To date, protein-bound oligosaccharides have been postulated to play the following roles: (1) an important structural role, (2) mediate protein folding and conformation, (3) enhance stability of the protein (ie. protect from proteases), (4) regulate the activity/function of the resident protein, (5) p r o v i d e receptors for i n v a d i n g organisms, (6) mask receptors for i n v a d i n g microorganisms, (7) contribute  ligands for lectin-like receptor  molecules  involved  i n protein  trafficking and (8) provide ligands for either cell-cell or cell-matrix adhesion and recognition.  1.4.1  Oligosaccharide Function Varies with the Protein Asparagine-linked oligosaccharides have been the most widely studied  glycan, at least i n part, due to the ease of manipulating them.  These strategies  include the enzymatic/chemical removal, drugs w h i c h block processing reactions and the elimination of glycosylation sites v i a site-directed mutagenesis.  The results  Introduction  7  of these investigations indicate that the repercussions of altering glycosylation can be highly variable. The effects on some proteins can be undetectable, some can be quite dramatic whereas others may exhibit an intermediate loss of function. example,  glycosylation confers  erythropoietin and interferon y.  different  properties  on  the  two  For  cytokines,  Changes i n erythropoietin's glycosylation h a v e  many effects including failure to secrete, decreased stability and decreased biological activity (Dube et al, 1988; Takeuchi et al, 1989; F u k u d a et al, 1989; Takeuchi et al., 1990; Imai et al, 1990; Fukuda et al, 1990; Tsuda et al, 1990; N a r h i et al, 1991; W a s l e y et al, 1991; Yamaguchi et al, 1991; Delorme et al,  1992).  O n the other  hand,  interferon y s antiviral activity and target cell specificity appear to be unaffected by 7  altered glycosylation (Kelker et al, 1983)  In  addition, in vitro  studies have o n  occasion given opposite results from those observed in vivo.  Therefore,  consequences  the  of the  above-mentioned  studies  illustrate  that  effects  the of  glycosylation on a protein are difficult, if not impossible, to predict.  1.4.2  Structural  and  Protective  Roles  One of the best k n o w n functions of protein-bound oligosaccharides is to mediate  protein  conformation.  folding,  thereby  enabling the  Illustrating this fact, a number  peptide  to  adopt  the  correct  of deglycosylated proteins  are  insoluble, fail to fold properly a n d / o r fail to exit the ER. W h i l e carbohydrates may be important for the structure of some proteins, they can also confer a protective function. For instance, the mucins, carbohydrate-rich proteins found i n abundance on epithelial cells, are thought to blanket vulnerable parts of the polypeptide f r o m  Introduction  8  the attack of proteases, acid and invading pathogens. In an apparent contradiction to the above, many proteins appear to fold and function properly i n the absence of glycosylation.  Thus,  this  brings up a frequently  glycobiology: oligosaccharides attached  encountered  to various proteins  paradox i n  may have  wildly  different functions. It is believed that the structural, protective and stabilizing attributes of oligosaccharides should not have required the amount of complexity that is seen i n mammals.  Nature w o u l d not be expected to devise such complex and energy-  consuming patterns w h e n simple more efficient ones w o u l d have sufficed.  1.4.3  Pathogen/Host  Evolution  and  Oligosaccharide  Variation  In addition to the mediation of many vital processes, oligosaccharides are also widely k n o w n to bear ligands participating i n pathogen/host adhesion.  This  attachment, a critical element of infection, is mediated by receptors o n the surfaces of viruses, bacteria and parasites w h i c h structures.  recognize highly specific carbohydrate  D u e to the specificity of the receptor, the host may protect itself by  masking the treasonous epitope. The mask could include the addition of another monosaccharide residue or modification of an existing one. Likewise, the receptor w o u l d be predicted to evolve as the pathogens w i t h the original receptor are selected against.  Thus,  some  oligosaccharide variation  may have  resulted  from  host/pathogen relations. Hence, such variation may be protective but i n the absence of pathogen have no consequence.  Introduction  1.4.4  9  Cell-Cell and Cell-Matrix Interaction  O n the extracellular surface, a vast array of carbohydrates can be presented. Different carbohydrate structures can be attached to a particular protein.  Each of  these glycosylation variants, or "glycoforms", possesses the identical polypeptide backbone.  Therefore, glycosylation provides proteins additional functional  and  structural variation. The formation of different glycoforms allows a single p r o t e i n to display multiple ligands and each of these ligands could potentially interact w i t h a different lectin receptor.  Alternatively, different proteins harbouring the same  oligosaccharide structure could present ligands to the same receptor.  Additionally,  the temporal and spatial expression of a carbohydrate structure may dictate what potential receptors are available to interact with.  Moreover, the same structure  could have multiple roles and could be solely dependent on the nature of the receptor that it encounters. Oligosaccharide participation i n cell-cell and cell-matrix interaction, either protein-carbohydrate demonstrated.  or  carbohydrate-carbohydrate,  interaction  has  been  A n example of the former, the selectin molecules have been s h o w n  to mediate the adhesion of leukocytes to endothelial cells. The leukocyte-bound L selectin can recognize either sialyl L e w i s or sialyl L e w i s carbohydrate ligands o n x  the endothelial cell.  3  A n example of the latter, stage-specific embryonic antigen 1  (SSEA-1), a L e w i s oligosaccharide, is transiently expressed on embryo cells. A t the x  beginning of the 16-cell stage, the antigen first appears and its homotypic adhesion plays an important role for the compaction of the embryo (Fenderson et al, 1984; Bird and Kimber, 1984; Eggens et al, 1989).  Introduction  10  To decipher m u c h of this three-dimensional oligosaccharide i n f o r m a t i o n , there must exist molecules w h i c h can recognize them.  Lectins can fulfill  this  requirement by b i n d i n g to a unique or select subset of specific structures.  1.5  Lectins-Carbohydrate Binding Proteins Lectins refer to a group of protein molecules w h i c h bind to sugar molecules  on the surface of cells. The plant lectins, phytohemagglutinins, were first studied for their unusual ability to bind and clump red blood cells. Later findings indicated that lectins as a whole can bind to a myriad of carbohydrate motifs as w e l l as m a n y other types of cells i n tissue and develop mentally-restricted  manners.  Genes  encoding these molecules must have evolved quite early d u r i n g phylogeny since they are found i n bacteria, plants, invertebrates and vertebrates.  Some hypotheses  suggest that lectins are the predecessors of antibody molecules and play important roles i n the i m m u n e system of plants and invertebrates by coating a n d / o r causing aggregation of foreign organisms, thereby enhancing phagocytosis.  Furthermore,  lectins sparked the interest of immunologists w h e n they were shown to induce the proliferation  of T and B lymphocytes.  A s many  morphological changes resembled antigen-stimulated  of the immune  biochemical  and  reactions, lectins  were used to study lymphocyte signaling and proliferation. Lectins were favourable over antigen treatment as they induced polyclonal activation. Based on sequence similarity of their carbohydrate recognition d o m a i n s (CRD), there are four main groups of mammalian lectins, the I-Type, the P-Type, the C-Type lectins and the Galectins. Additionally, the discovery of new lectins as w e l l  Introduction  11  as the fact that some lectins remain to be categorized bodes w e l l for the existence of even more groups.  1.5.1  C  Type  Lectins  The C-Type lectins presently represent the largest and most diverse group of m a m m a l i a n lectins (Drickamer, 1988). C o m m o n to a l l members, calcium ions are required for saccharide binding. The best k n o w n example of this class is the endocytotic asialoglycoprotein receptor, a molecule i n v o l v e d  i n the clearance of  serum glycoproteins lacking terminal sialic acid on their complex oligosaccharides (Speiss, 1990). Other well k n o w n members of this group, the selectins, are cell adhesion molecules and have  been w e l l documented  i n leukocyte-endothelia  interaction.  1.5.2  /  Type  Lectins  The established members  of this  new family,  includes  CD22, CD33,  Sialoadhesin and M A G , recognize sialic acid containing structures  (Powell and  V a r k i , 1995). A l l are cell surface glycoproteins and have large cytosolic d o m a i n s w h i c h bear multiple potential and established phosphorylation sites. This family of lectins has recently been named I-type due to the discovery that they are members of the i m m u n o g l o b u l i n superfamily (IgSF). These molecules have a characteristic V j C 2 element i n their extracellular domains. n  The V and C domains are so n a m e d  according to homology to the domains of the i m m u n o g l o b u l i n .  Introduction 1.5.3  P-Type  12  Lectins  This group of lectins is commonly referred to as the mannose-6-phosphate receptors.  The two different  receptors, a cation-independent  and a cation-  dependent, are both Type I membrane proteins (Kornfeld and M e l l m a n n , 1989; M a et al., 1991). These receptors mediate the trafficking of lysosomal enzymes from the fratts-Golgi to the lysosomes. In addition, the cation dependent receptor can target the internalization of extracellular hydrolases from the surrounding m e d i u m .  Galectins  1.5.4  In addition to the homologous C R D , constituents of this group have a n affinity for (3-galactoside sugars although the specificity of each is unique (Barondes et al., 1994).  Originally referred to as S-Type lectins, the nomenclature was  descriptive of the fact that some members were stabilized by the presence of thiols. A l t h o u g h these soluble lectins lack an apparent secretion signal, they are f o u n d extracellularly as w e l l as residing i n the cytoplasm. The biological roles of these molecules are not understood.  Taking into account the b i - and multi-valency of  some family members, they may act by cross-linking carbohydrate moieties o n the surface of cells or i n the extracellular matrix.  Introduction  1.6  13  0-Glycans A major class of protein glycosylation involves the attachment of the  carbohydrate to the hydroxyl groups of a given polypeptide. This class is made up of a number subgroups based on the type of amino acid, the monosaccharide and the linkage m a k i n g up the protein-sugar junction. The mucin-type, O - G l c N A c - t y p e and the proteo-glycans are the three most common subgroups found i n animal cells.  1.6.1  Mucin  Glycoproteins  Tremendous diversity is displayed by the mucin-type glycoproteins w h i c h were first identified on the mucus substance m u c i n and thus deriving the n a m e mucin-type for this subgroup. Mucin-type structures are initiated by the linkage of the reducing end of G a l N A c to serine or threonine of the polypeptide (Sadler, 1984). U n l i k e N-glycans, the mucin-type glycoproteins do not have a c o m m o n  multi-  saccharide core but only share this single monosaccharide unit. Four different core structures are usually observed and each of these can then be extended. The epithelial surfaces of the respiratory and gastrointestinal tract are very rich i n these structures and it is hypothesized that they are critical for p r o v i d i n g a protective barrier against proteases and other irritants. A d d i t i o n a l roles postulated for mucin-type glycans include acting as ligands for endogenous mediating important recognition events.  lectins, thereby,  Likewise, m u c i n b i n d i n g to bacterial  lectins, molecules necessary for bacterial attachment, may stimulate the clearance of these pathogens from the body.  14  Introduction  Proteoglycans  1.6.2  Proteoglycans are k n o w n to play an critical part i n maintaining architecture and integrity (Roden, 1980).  These structures  tissue  show less structural  variation than N- and Mucin-type glycans and are characterized by bearing one or more bound glycosaminoglycan chains. Glycosaminoglycans (GAGs) are a class of polysaccharides w h i c h display h i g h molecular weight and strong negative charge. The core protein of proteoglycans can harbour from one to over a hundred of these highly acidic polysaccharides imparting potent biochemical properties. These G A G s are usually covalently linked to the protein backbone through a xylose-serine linkage.  1.6.3  O-GlcNAc-Type  Glycans  O - G l c N A c modification is simply the addition of a single G l c N A c residue to serine or threonine (Hart et ah, 1989). To date, this modification has only been associated w i t h nuclear and cytoplasmic-based proteins. D u e to its highly dynamic nature, O - G l c N A c - y l a t i o n has prompted comparisons to protein p h o s p h o r y l a t i o n and is hypothesized to play a regulatory role. Recent evidence has indicated that phosphorylation and O-GlcNAc-ylation may occur at the same site w i t h i n identical protein.  the  This occurrence implies that the enzymes mediating these two  events may be i n competition w i t h one another.  Introduction  1.7  15  W-Glycans The oligosaccharides bound to proteins are classified into two groups, N -  glycans and O-glycans, bearing great structural variation.  In O-glycans, sugars are  attached to the hydroxyl groups of serine and threonine, whereas i n N-glycans, N acetylglucosamine (GlcNAc) is linked to amide group of asparagine residues. N linked oligosaccharides can be subdivided into three main types: high hybrid and complex.  mannose,  In c o m m o n among these three types is the pentasaccharide  M a n a l - 6 ( M a n a l - 3 ) M a n ( 3 1 - 4 G l c N A c ( 3 l - 4 G l c N A c - A s n . This structure is often called the "invariant core" a n d / o r "trimannosyl core" and its derivation was revealed once the biosynthetic mechanisms were understood.  Knowledge of the processing is  important because it unifies all the structures to a set of successive enzymatic steps.  Figure 1.1  The three major  types of asparagine-linked  oligosaccharides. The  shaded area indicates the invariant core structure of A/-glycans. The sugars are symbolized as follows: open circles, mannose; black squares, /V-acetylglucosamine (GlcNAc); black circles, galactose; open triangle, fucose; diamonds, sialic acid. The striped black box represents the bisecting GlcNAc and its addition is catalyzed by GlcNAc-TIII. The "±" indicates that this sugar may or may not be incorporated into the structure. The three consecutive arrows signify the processing reactions that separate these structures.  Introduction  16  H i g h mannose-type oligosaccharides refer to structures w h i c h have two to six mannose residues ligated to the internal core mannoses.  O n the other h a n d ,  complex oligosaccharides share the internal core mannoses,  the  outer  two  a-  mannoses of this structure having N-acetyllactosamine (The disaccharide of G l c N A c and galactose) attached. These N-acetyllactosamines can be further elongated by the addition  of  sialic  acid  or  additional  N-acetyllactosamines.  Hybrid-type  oligosaccharides are exactly what the name implies, they have more than three mannose residues and also have N-acetyllactosamine chain bound to the linked  mannose.  H y b r i d molecules  also  usually  contain  a  od-3  "bisecting" N -  acetylglucosamine linked pi-4 to the (3-linked mannose residue.  1.7.1  N-Glycan Biosynthesis In contrast  to O-glycan synthesis  w h i c h initiates  and progresses  one  saccharide moiety at a time, N-glycan formation begins i n the l u m e n of the r o u g h endoplasmic reticulum w i t h the en bloc transfer of a lipid-linked oligosaccharide to asparagine cotranslationally (Kornfeld and Kornfeld, 1985; Fukuda, 1992). The l i p i d functions  as a carrier and is recycled following  asparagine-attached structures.  oligosaccharide transfer.  The  oligosaccharide is then trimmed giving rise to h i g h m a n n o s e  After processing, high mannose structures are modified to yield hybrid  and complex oligosaccharides.  The biosynthesis of complex N - l i n k e d branching  proceeds w i t h the linkage of GlcNAc(s) to the core mannose residues. In turn, these  Introduction bound  GlcNAc  monosaccharides.  branches  are  extended  by  \7 the  sequential  addition  of  The following gives a brief synopsis of this process.  Monoantennary  Biantennary  Triantennary 2,4-branched  Triantennary 2,6-branched  Tetrantennary  Figure 1.2 Branching of mammalian A/-glycans. The shaded area indicates the invariant core structure of /V-glycans. The sugars are symbolized as follows: open circles, mannose; black squares, /v-acetylglucosamine; open triangle, fucose. The "±" indicates that this sugar may or may not be incorporated into the structure. The represents the extension of these branches by monosaccharide additions.  Introduction  Formation  1.7.2  of  the  Dolichol-Linked  18  Precursor  Sugar  Forming of s u g a r / l i p i d precursor begins on the cytosolic side of the r o u g h endoplasmic reticulum (RER) and is completely autonomous from the protein that w i l l be glycosylated subsequently.  Synthesis of the lipid-linked oligosaccharide is  initiated by the transfer of GlcNAc-l-phosphate to dolichol pyrophosphate (Dol-P) yielding G l c N A c - P - P - D o l .  This  opening  step can be blocked by the  drug  tunicamycin. After the attachment of this G l c N A c , the remaining core sugars w h i c h are presented  by the nucleotide  donors, U D P - G l c N A c and G D P - M a n ,  become  fastened b y stepwise addition eventually producing M a n G l c N A c - P - P - D o l . 5  2  A  a2  i  A  o • UDP  • UMP  J  UDP  UDP  p  0  •  o  ^  GDP  •  GDP  p  I  I  dol  dol  o  o  O dol  p I  O  A  ^  dol  • dol  a3  o  p i do!  do  i  poo a3  Or •  dol  p-j^* p i dol  1 |  AAacetylglucosamine  Mannose  Glucose  oligosaccharide transferred from dolichol-PP to growing polypeptide  Figure 1.3 The synthesis of the oligosaccharide precursor. Sugars are added on one at a time to the dolichol carrier molecule. The finished lipid-linked oligosaccharide is transferred en bloc to the nascent peptide by oligosaccharyltransferase. The dolichol product of this reaction is subsequently recycled. This heptasaccharide-lipid intermediate,  M a n G l c N A c - P - P - D o l , is t h e n 5  2  translocated to the l u m e n of the R E R where it is subjected to further processing. Lumen-based additions begin w i t h the transfer of four oc-Mans v i a D o l - P - M a n . T h e  19  Introduction  completed l i p i d oligosaccharide, G l c M a n G l c N A c - P - P - D o l , is synthesized by the 3  9  2  joining of three oc-glucosyl residues from Dol-P-Glc.  Some studies suggest that  glucosylation of the precursor is necessary to protect it from degradation prior to protein attachment (Hoflack, 1981) while others suggest it may be important for transfer to the protein ( M u r p h y and Spiro, 1981). mannoses  The DolP-Man-contributed-  appear to have no effect on protein glycosylation (Spiro et al., 1979;  Staneloni et al., 1981). A l t h o u g h G l c M a n G l c N A c - P - P - D o l is the full g r o w n lipid oligosaccharide 3  9  2  found i n normal cells, a G l c M a n G l c N A c - P - P - D o l structure, a glucosylated v e r s i o n 3  5  2  of the heptasaccharide-lipid mentioned above, is the largest one found i n a Dol-PMan-deficient  l y m p h o m a cell line (Chapman et al., 1979) and glucose  starved  Chinese hamster ovary cells (Rearick, 1981). Taking into account the fact that this lipid-linked decasaccharide can also act as a donor substrate i n protein glycosylation, it may play a role i n the biosynthesis of N-glycans. This surrogate route has been termed the "alternate pathway" albeit its relative prominence is u n k n o w n .  1.7.3  Transfer  The  of  the  assembled  Oligosaccharide  precursor  to  molecule  Protein  is forwarded  cotranslationally  to  asparagine residues w i t h the consensus sequence A s n - X - S e r / T h r where X is any amino acid except proline or aspartic acid (Marshall, 1972). A s not a l l sites sharing this sequence are glycosylated, a number of other factors are thought to influence the enzyme  oligosaccharyltransferase  glycosylation site.  and its transfer  of the sugar moiety  to the  These include the availability of glucosylated precursors, the  Introduction  20  amount of oligosaccharyltransferase activity, the number of consensus sequences i n a protein and their conformational accessibility. This latter factor may prove to be most important as studies have shown the preferential glycosylation of certain sites within  a protein.  Furthermore,  since  the  oligosaccharide  transfer  occurs  cotranslationally, the nascent peptide is i n the process of folding and, thus, it may or may not be i n a favourable conformation for the oligosaccharyltransferase.  1.7.4  Trimming  of  the  Protein-Bound  Oligosaccharide  Initial processing begins w i t h the removal of the three glucose residues by two RER-membrane-bound-glucosidases, cd,2 glucosidase and ocl,3 glucosidase (Grinna and Robbins, 1978; Elting et al., 1980). Prior to transiting to the cis-Golgi, a n R E R mannosidase  cleaves off at least one ot-mannosyl residue  Kornfeld,  Additional  1983).  trimming  results  i n the  (Bischoff a n d  conversion  of the  oligosaccharide to M a n G l c N A c by Golgi a l , 2 mannosidase I (Tabas and K o r n f e l d , 5  2  1979). N-acetylglucosaminyltransferase I (GlcNAc-TI) modifies the h i g h m a n n o s e structure to a hybrid glycan as it traverses the medial-Golgi compartment  (Harpaz  and Schachter, 1980). This is a decisive step as it is required for the synthesis of either h y b r i d or complex N-glycans. Cells deficient i n G l c N A c - T I are blocked i n this pathway and can only generate h i g h mannose  structures ( L i and Kornfeld, 1978;  Robertson et al, 1978; Tabas et al, 1978). Lysosomal enzymes endure identical reactions as plasma membrane and secretory proteins prior to the addition of G l c N A c by G l c N A c - T I .  Subsequently, a  Introduction specific mannose  phosphorylation  21  of these glycoproteins  targets  prelysosome  transport (Varki, 1992). This topic w i l l not be discussed further here.  1.7.5  Formation of Hybrid and Complex N-Glycans After the addition of G l c N A c to the M a n a l , 3 M a n f 3 l , 4 G l c N A c arm, one of  two different reactions can occur. The bisecting G l c N A c can be added by G l c N A c TIII, thereby, shunting the route toward hybrid structures (Narasimhan, 1982; A l l e n et al. 1984) or alternatively, G o l g i oc-mannosidase II can remove the two t e r m i n a l mannoses on the Manal,6Man(31,4GlcNAc arm forming a monoantennary (Gleeson and Schachter, 1983). GlcNAc  can  be  monoantennary  added  After the action of  by GlcNAc-TII  resulting  glycan  a-mannosidase II, a second in  the  conversion  of  the  glycan to a complex biantennary structure (Harpaz and Schachter,  1980; Oppenheimer and H i l l , 1981; Oppenheimer et al., 1981). A d d i t i o n a l branches can be generated by G l c N A c - T I V (Gleeson and Schachter, 1983; A l l e n et al., 1984) and G l c N A c - T V (Cummings et al, 1982; Brockhausen et al, 1988) w h i c h add the (31,4 and (31,6 G l c N A c - l i n k e d medial-Golgi, transf erases.  residues  respectively.  Before the  glycoprotein leaves  its branching has already been decided by the medial-Go\gi  the  GlcNAc-  Introduction  CK), ^  /V-acetylglucosamine  O-O  O Mannose <3 Glucose  22  O-B-B-P-P-doi  QVJ <-<-<-00''' (*2 R3 « 3 r c 2  CK)  ,Q  O-O O-B-B-Asn O <M-<K>d  4 O' O-B-B-Asn O  1 o  Tl  a  TIM  p-B-B-Asn  o, •  •  O  O-B-B-Asn  Q_  p-B-B-Asn -O  Til  i  O-B-B-Asn  te>  l-O  TV ^ •  /  Q  O  «  «  \ T I V ^ p-B-B-Asn ™O B'  A  " p-B-B-Asn B-O  T\\\S  P-B-B-Asn B-O  B  v  w  T I V \  ^ T V  \TIII  I B6  O V  l-O  p-B-B-Asn  O  b-B-B-Asn " " A  s  n  B-O Mi4 v  B . O-B-B-Asn ""O  |TIII -J  4  O-B-B- Asn  Figure 1.4 The antennae formation of A/-glycans. After the transfer of the l i p i d linked oligosaccharide to asparagine cotranslationally, trimming reactions in the Golgi and ER yield a substrate for GlcNAc-TI. The action of GlcNAc-TII-V determined the number of antennae formed. The sugars are symbolized as follows: open circles, mannose; black squares, Nacetylglucosamine; shaded triangles, glucose. The GlcNAc-Transferases I-V are denoted by T l TV.  Introduction  23  After migration to the trans-Golgi, monosaccharides complete the elongation of the antennas.  are added one at a time to  Possible additions include galactose,  fucose, sialic acid, G l c N A c , G a l N A c and others. Moreover, the added sugar residues can undergo modifications such as phosphorylation, sulfation and acetylation.  1.7.6 Microheterogeneity The study of a number of purified proteins has revealed that an identical protein can carry a variety of oligosaccharides even w h e n manufactured i n the same cell (Schachter, 1985). occurrence,  termed  W h i l e this variance is quite restricted, the reason for its "microheterogeneity",  significance is presently u n k n o w n .  and  whether  it  has  functional  Since oligosaccharide synthesis does not follow  a template, microheterogeneity may result from some randomness inherent to such a system.  O n the other hand, variants of a glycoprotein, called "glycoforms",  produced i n two distinct cell types might arise from differential glycosyltransferase gene expression and may be biologically relevant.  1.8  Control of Af-Linked Branching  1.8.1  Factors Influencing Glycan Formation Asparagine-bound oligosaccharides are subdivided into three m a i n groups:  high mannose, hybrid and complex. These differences arise from a variable a m o u n t of processing to the trimannosyl core by downstream-acting  glycosidases and  glycosyltransferases. Some of the factors that influence the formation of branches,  24  Introduction  also called antennae, from this core structure include the relative activity and expression of glycosyltransferases within a cell, the route that is taken by the nascent peptide and the conformation of the protein backbone. which  glycosyltransferases  act is very important  In addition, the order i n  due to their  strict  substrate  specificities (Schachter, 1991). Often, one glycosyltransferase requires the prior action of another for it to function.  1.8.2  N-Acetylglucosaminyltransferase I Since these oligosaccharides are non-linear, it is not possible to have a  template-driven  system analogous to protein and D N A synthesis.  Therefore,  different mechanisms must be regulating the assembly of N-glycans. One of the m a i n checkpoints is controlled by the action N-acetylglucosaminyltransferases I - V ( G l c N A c - T I - TV) w h i c h initiate the construction of branches extending outward from the core. Performing at a pivotal point, G l c N A c - T I executes the transition of high mannose N-glycans to hybrid and complex N-glycans b y forming the i n a u g u r a l branch (Schachter, 1983; Schachter 1991). The addition of this G l c N A c is p i v o t a l due to the fact that GlcNAc-TII - T V as w e l l as oc-mannosidase II cannot act i n its absence. C e l l lines deficient i n G l c N A c - T I are blocked i n N-glycan synthesis resulting i n the b u i l d u p of h i g h mannose structures.  Without this branch initiating step, the c h a i n  elongating reactions inserting Gal, Fuc and sialic acid cannot take place.  Introduction  1.8.3  25  Order of Action and Competition for Substrate After  formation  of a hybrid structure,  biosynthesis of N-glycans is reached.  a second pivotal step i n  the  The decision to make hybrid or complex  oligosaccharides is a fork i n the biosynthetic route. Taking into account that either GlcNAc-TIII or oc-mannosidase II can act at this point i n the pathway, a c o m p e t i t i o n for the c o m m o n substrate occurs. If GlcNAc-TIII works next i n the procession, it transfers the bisecting G l c N A c and thus shifts synthesis towards h y b r i d glycans since both oc-mannosidase II and GlcNAc-TII cannot act on this product.  A l t h o u g h the  presence of the bisecting G l c N A c terminates further branching i n the m e d i a l - G o l g i , it does not prevent the elongation of initiated branches i n the trans-Golgi. O n the other hand, if oc-mannosidase II removes the two terminal mannoses  prior to  GlcNAc-TIII action, then, GlcNAc-TII is capable of transforming the hybrid glycan into a complex structure.  A d d i t i o n a l complexity can be achieved by G l c N A c - T I V  and G l c N A c - T V w h i c h catalyze the attachment of two more  branches  trimannosyl core. G l c N A c - T I V can transfer a G l c N A c to hybrid structures  to  the  whereas  G l c N A c - T V requires the prior action of GlcNAc-TII for it to catalyze its reaction.  1.8.4  Peptide and Its Influence on the Oligosaccharide Another element thought to wield the formation of N-glycans is termed  "site directed processing". This element, the effects the polypeptide backbone exerts on oligosaccharide processing, was first insinuated by the evidence s h o w i n g that i n d i v i d u a l glycosylation sites tend to have characteristic oligosaccharides.  The  Introduction  26  polypeptide could affect either the conformation of the glycan or an interaction w i t h a glycosyltransferase or glycosidase and is demonstrated by the following example. A study on the oligosaccharides of h u m a n  IgG w h i c h epitomizes this term was  carried out b y Savvidou et ah, 1984. These colleagues investigated the carbohydrate makeup at Asn-107 on the Light chain as w e l l as Asn-297 on the H e a v y chain. A l t h o u g h these molecules were manufactured i n the same cell, the oligosaccharide composition on the Light chain was made up of entirely bisected complex N-glycans whereas  the H e a v y chain consisted  of mostly (73%) non-bisected N-glycans.  Moreover, the two glycans could not have been buried inside the i m m u n o g l o b u l i n since they were accessible to the downstream processing enzymes, a galactosyl- and a sialyl-transferase.  Therefore, this outcome raises the query of w h y G l c N A c - T I I I  w o u l d act more efficiently at one site over another. The prevailing interpretation is based o n the subsequent postulates: (i) oligosaccharides are free i n solution and can exist i n multiple conformations,  (ii) processing enzymes (like GlcNAc-TIII) are  capable of acting o n only a subset of these conformations and (iii) the influence of the  polypeptide  on  the  N-glycan  restricts  the  possible  oligosaccharide can occupy (reviewed i n Schachter, 1991).  conformations  the  Consequently, it is  suggested that the oligosaccharide at Asn-297 is held i n such a conformation that it is a poor substrate for GlcNAc-TIII. Other studies have also lent support to abovementioned hypotheses i to i i i (Srivastava et ah, 1988; L i n d h and H i n d s g a u l , 1991).  Introduction  1.8.5  27  Control by the Endomembrane The environment of the endomembrane, the endoplasmic reticulum and  G o l g i apparatus, plays a major role i n N-glycan biosynthesis by controlling the availability of substrates, nucleotide-sugar donors and co-factors (Kornfeld and Kornfeld, 1985; Schachter, 1986; Schachter 1991). Furthermore, the endomembrane system, the assembly line of oligosaccharide synthesis, governs  the access of  processing enzymes to the growing carbohydrate and the length of its resident stay.  1.8.6  Diversity of N-glycans N-glycan diversity is principally generated by two means: (i) the degree of  branching and (ii) the variation i n chain termination  structures.  These two  components of N-glycan diversity are intimately related since certain t e r m i n a l structures are preferentially formed on particular antennae. For example, the a2,6 sialyltransferase shows a strong preference for G a l residues linked to the (31,2 G l c N A c - a l , 3 M a n arm, the G l c N A c - T I catalyzed branch (Joziasse et al., 1987). Therefore,  the  finding,  termed  "branch  specificity",  suggests  that  unique  information is carried along each branch rather than the branches being functionally redundant.  Moreover, the branch initiating GlcNAc-transferases play a large part i n  determining terminal structures. After the number of branches has been settled and the molecule migrates to the frans-Golgi, the first addition is usually a G a l w h i c h is (31,4 linked to the underlying G l c N A c . This disaccharide sequence, G a l linked to G l c N A c , is c o m m o n  Introduction  28  to complex N-glycans is often referred to as an N-acetyllactosamine.  The product  can n o w be either terminated by the addition of sialic acid or be a substrate for further extension.  1.8.7  Poly-N-Acetyllactosamines A l t h o u g h complex N-glycans typically have one N-acetyllactosamine per  antennae, there are notable exceptions w h i c h may have many multiples of this repeating disaccharide unit. The multiple repeating units, termed polylactosamines or polylactosaminoglycans, show branch specificity towards the Manocl,6 a r m , particularly the G l c N A c - T V catalyzed branch.  Customarily, polylactosamines tend  to be modified more often than the single disaccharide N-acetyllactosamine. T h e polymer  is  synthesized  by  the  successive  action  acetylglucosaminyltransferase and the |3l,4 galactosyltransferase.  of  a  (31,3-N-  Polylactosamine  chains can serve as the base architecture for many cell-type specific modifications. Their large size makes them accessible ligands for lectin receptors o n n e i g h b o u r i n g cells. Therefore,  polylactosamines are speculated to be important  for cell-cell  interaction and adhesion. Polyllactosamines, also found on glycolipids and O-glycans, were originally described o n the N-glycans of h u m a n erythrocytes.  Erythrocyte-specific chains are  responsible for the blood group antigen I associated w i t h adult cells.  Progression  through the first year of life converts the red blood cells from harbouring i to I . T h i s conversion is a result of linear chains becoming branched by the expression of a  Introduction  29  pi,6-N-acetylglucosaminytransferase transferring G l c N A c to the G a l residues of the chain.  Further modification of these side branches gives rise to the erythroid-  specific A B O blood group antigens. In contrast to red blood cells w h i c h possess branched polylactosamines, granulocytes have linear chains w h i c h are often fucosylated at their termini by a n ocl,3-N-fucosyltransferase.  The myeloid-restricted reaction produces a structure  termed Lewis X , abbreviated L e . If sialylation takes place prior to fucosylation, the x  structure formed is called sialyl-Le . x  R cc1,3Fucosyltransferase  R  P ^  r  •  LeX  4  •  R -—iPr -m« 3•o 4  D  r  Sialyl-L£  Figure 1.5 The synthesis of the Lewis blood group antigens. The Lewis X structure is formed if fucosylation occurs prior to sialylation. The terminal positions of polylactosamines are preferred substrates for these reactions. The sugars are symbolized as follows: black squares, GlcNAc; black circles, galactose; diamonds, sialic acid. This terminal moiety is of particular hematological interest since it is a ligand for a group of endogenous lectins, the selectins (Springer, 1994; M c E v e r et al, 1995). T h e E (Endothelia)-, L (Leukocyte)- and P (Platelet)-selectins, a family of molecules sharing a highly homologous carbohydrate recognition domain, have been s h o w n to be critical i n leukocyte-endothelial adhesion and extravasation (Mayadas et al, 1993; Arbones et al, 1994; Labow et al, 1994; Frenette et al, 1996). Furthermore, the  Introduction  30  studies of mice deficient i n a l , 3 fucosyltransferase Fuc-TVII, a transferase required for L e and sialyl-Le synthesis, revealed an essential role for this structure i n x  x  neutrophil extravasation and the leukocyte homing (Maly et al., 1996). W o r k o n the Fuc TVII and E - and P- selectin knockouts have demonstrated that polylactosamines and the modifications they carry are necessary for leukocyte recruitment  and  trafficking i n diseased and healthy states.  1.9  iV-Glycans and Disease  1.9.1  Altered Branching and Malignancy One of the most c o m m o n changes associated w i t h malignancy is the  increased  size of A s n - l i n k e d  transforming  agent,  the  oligosaccharides.  three  principal  Regardless  changes,  of the  augmented  type of  branching,  polylactosamine synthesis and sialylation, are frequently observed (Alhadeff, 1989). Studies  looking  at B H K (baby  hamster  kidney)  cells  and their  polyoma  transformants divulged that only G l c N A c - T V activity, among G l c N A c - T I - T V , was elevated following transfection (Yamashita et al., 1984). D u e to the specificity of polylactosamines for this branch, it was thus postulated that increased G l c N A c - T V was the reason for the increase i n polylactosamines present i n the highly metastatic tumour  cells.  Other groups w o r k i n g from another  angle utilized glycosylation  inhibitors to study the role of complex N-glycans i n metastasis.  T w o inhibitors,  tunicamycin and swainsonine, were both shown to retard tumour metastasis w h e n administered to animals (Irimura et al., 1981; H u m p h r i e s et al., 1986). A l t h o u g h  31  Introduction  tunicamycin completely blocks N-glycan synthesis, swainsonine blocks processing of hybrid glycans to complex oligosaccharides.  Therefore, the swainsonine  result  suggests that the terminal structure on the M a n a l , 6 arm enhances metastatic ability. To investigate h o w closely N-glycan structure and malignancy are l i n k e d , Jim Dennis and colleagues selected glycosylation mutants of a metastatic  tumour  cell line (Dennis et al., 1987). They found that an increased amount of tetrantennary N-glycans and poly-N-acetyllactosamines are associated w i t h highly clones whereas decreased amounts  metastatic  correlated w i t h l o w metastatic potential.  In  addition, two of the mutants, both having reduced G l c N A c - T V activity, exhibited a dramatic loss i n metastatic potential.  Hence, the significance of h i g h G l c N A c - T V  activity i n malignancy may be to provide the substrate necessary for increased polylactosamine  synthesis.  This  hypothesis  is  attractive  especially  since  polylactosamines show branch specificity for the G l c N A c - T V - m e d i a t e d antennae. A number of investigations have noticed that G l c N A c - T V activity was elevated i n fibroblast lines w h i c h had been transformed by activated  oncogenes  from the ras-signalling pathway (Yamashita et al., 1985; Dennis et al., 1987, 1989; L u and Chaney, 1993; Palcic et ah, 1990). To further study this (31,6 branch i n cellular transformation, Demetriou et al. transfected a G l c N A c - T V expression vector into a n immortalized l u n g epithelial cell line (Demetriou et al., 1995). A m p l i f i e d G l c N A c TV  expression  characteristics.  resulted  in  the  acquisition  of  transformation-associated  These included a reduction i n cell-stratum adhesion and contact  inhibition, increased susceptibility to apoptosis and increased tumourigenicity i n nude mice.  32  Introduction Collectively  these  investigations  suggest  an  association  between  polylactosamines and metastatic potential but w h y w o u l d such an association exist? One appealing model is based on the fact that tumour leukocyte  adhesion  at  a  site  of  inflammation.  metastasis  As  resembles  mentioned  earlier,  polylactosamines are a suitable backbone for the synthesis of L e and sialyl-Le x  determinants.  D u r i n g circulation i n the blood, tumour  x  cells harbouring these  structures could form large platelet/tumour cell aggregates v i a P-selectin-mediated adhesion and become trapped i n small capillaries. Activation of the s u r r o u n d i n g endothelium w o u l d result i n E-selectin expression, the establishment of steadfast attachment  to the tumour/platelet  mass and ensuing  extravasation.  If this  adherence is found to be selectin-dependent, it may pave the way for sialyl-Le  x  analogues being used pharmaceutically. In tune w i t h this model is the fact that the greater the amount of sialyl-Le structure on the tumour cell surface, the poorer the x  patient's prognosis (Nakamon, S. et al., 1993).  1.9.2  Genetic Diseases Involving N-Glycans In theory, glycosyltransferase gene dysfunction may cause disease either by  inaction (recessive mutation)  or by competing w i t h or interfering w i t h  glycosyltransferases (dominant mutation).  other  A t this point i n time, the number of  k n o w n diseases resulting from defects i n glycosylation is quite small.  The reasons  for this paucity could be many. Firstly, many of the glycosyltransferase genes h a v e only been recently cloned, therefore, the number of associated diseases may grow substantially.  Secondly, many  carbohydrate  determinants  may  be vital  for  Introduction development,  so mutation  33  of a given gly cosy transferase gene may result i n  embryonic lethality. Other explanations include the inability of clinical and research laboratories to diagnose such diseases.  Presently, there are five genetic  diseases  associated w i t h N-glycans: Inclusion Cell (I-Cell) Disease (Varki, 1992), Leukocyte Adhesion  Deficiency  Type  II  (LAD-2)  (Philips  et al., 1995),  Congenital  Dyserythropoiesis Type II ( H E M P A S ) (Fukuda, 1990) and Carbohydrate-Deficient Glycoprotein Syndromes (CDGS) Types I (Powell et al., 1994) and II (Charuk et al., 1995). I-Cell disease resembles most glycosylation disorders i n that it is autosomal recessive.  The G l c N A c phosphotransferase  w h i c h is defective i n I-Cell  disease  catalyzes a modification necessary for proper intracellular trafficking of lysosomal enzymes.  LAD-2  results  from  a  defect  in  the  synthesis  of  fucosylated  oligosaccharides. Patients suffer from developmental defects and recurrent bacterial infections.  HEMPAS  (hereditary  erythroblastic  raultinuclearity  with  positive  acidified serum) is distinguished by a loss of polylactosamines o n erythrocyte band 3 and 4.5 glycoproteins although the primary defect has not been determined.  Patients  suffer from a m i l d life-long anemia. C D G S Types I and II are multisystemic diseases displaying neurological defects. Recent work on C D G S Type II has identified point mutations These  (single amino acid changes) i n Mgatl  results  illustrate  neurological development.  the  importance  from two unrelated  of complex  N-glycans  in  patients. normal  Introduction  1.9.3  34  Complex N-Glycans are Required for Development Due to their terminal position on the exterior of the cell, carbohydrate  moieties are thought to be critical for cell-cell recognition and adhesion. mammalian  development,  cell  variation and are highly dynamic.  surface-bound-oligosaccharides  display  During great  A l t h o u g h this effort by the embryo i m p l i e s  importance, ultimate confirmation d i d not come until a study by A z i m S u r a n i (Surani, 1979). Mouse 2-cell embryos were cultured i n the presence or absence of tunicamycin, a drug w h i c h completely blocks A s n - l i n k e d oligosaccharide synthesis. Control embryos developed to form blastocysts whereas the experimental  group  failed to undergo compaction or form blastocysts. The data demonstrates that these oligosaccharides are required for early development but does not answer what types of structures are important, To further define the structures necessary for ontogeny, two different groups used gene targeting technology to create a mouse mutation i n the Mgatl, the gene coding for G l c N A c - T I (Ioffe and Stanley, 1994; Metzler et al., 1994). Mice homozygous for this mutation die at mid-gestation. A t embryonic day 10 (E10), multiple pathologies are apparent. These include the failure of the n e u r a l tube to close, impaired vascularization and loss of left-right asymmetry.  Since  G l c N A c - T I is obligatory for the conversion of high mannose structures to hybrid and complex N-glycans, this result indicates that either hybrid, complex or both types of structures are required for development. The outcome of this experiment is quite interesting since animals deficient i n G l c N A c - T I were capable of u n d e r g o i n g early organogenesis  i n the apparent absence of hybrid and complex N - l i n k e d  oligosaccharides. Mgatl-mx\\  embryos may carry some residual G l c N A c - T I either  Introduction  35  from oocyte formation or transport from maternal stores. If it can be proven that Mgatl-nu\\  animals never express G l c N A c - T L it w i l l demonstrate that compaction  and blastocyst formation can occur without these oligosaccharides. Moreover, since the systemic knockout of Mgatl results i n embryonic lethality, it is not possible to study the loss of this gene i n the adult animal. Therefore, this result emphasizes the need to use the Cre /loxP system to engineer conditional mutations.  Such a  conditional mutation w o u l d allow one to investigate the effects of Mgatl  loss i n a  particular tissue of an adult animal. Creation of mice deficient i n GlcNAc-TII Campbell et ah, unpublished observations).  has n o w been achieved (R.  Since m a n y M g a £ 2 - n u l l animals die  neonatally and display a heart defect, it implies that complex N-glycans play a key role i n m a m m a l i a n development. from  both  Furthermore, the fact that branches initiated  the M a n a l , 3 and Manocl,6  arms  appear  necessary  for  normal  development suggests that each arm contains unique and important information.  1.10  The Bisecting A/-AcetyIgIucosamine of A^-Glycans A n early step i n complex and hybrid N-glycan biosynthesis may be initiated  by GlcNAc-TIII w h i c h adds a G l c N A c monosaccharide i n (31-4 linkage to the (31-4 linked mannose of the processed mannose core (reviewed i n Schachter et al., 1983). A l t h o u g h the function of the resulting "bisecting" G l c N A c is not presently k n o w n , this modification can inhibit completely the action of other enzymes i n subsequent N-glycan biosynthesis (oc-mannosidase-II, GlcNAc-TII,  GlcNAc-TIV,  GlcNAc-TV,  Introduction  core  al-6-fucosy transferase)  and  inhibit  36  partially  UDP-Gal:GlcNAc  (31-4  galactosyltransferase (Schachter, 1986), suggesting a regulatory role i n the f o r m a t i o n and  function  of complex and hybrid N-glycans.  oligosaccharides have  not thus  far been  shown  While  bisected  to specifically  N-linked  interact  with  endogenous lectin receptors, altered exogenous lectin b i n d i n g has been reported (Cummings and Kornfeld, 1982; Narasimhan et al, 1986) as w e l l as decreased accessibility of cell surface G a l residues to Gal-binding lectins i n a Chinese hamster ovary ( C H O ) glycosylation variant line expressing a dominant mutation i n G l c N A c TIII (Campbell and Stanley, 1984; Stanley et al, 1991). GlcNAc-TIII activity was first described i n the hen oviduct ( N a r a s i m h a n , 1982) and has subsequently been found i n various systems i n c l u d i n g the rat l i v e r during hepatocarcinogenesis  (Narasimhan et al., 1988b; N i s h i k a w a et ah, 1988a;  Pascale, 1989), rat kidney (Nishikawa et al, 1988b), rat brain (Nishikawa et al, 1988b), h u m a n B lymphocytes (Narasimhan et al, 1988a), HL60 cells (Koenderman et al, 1987), N o v i k o f f  ascites tumor cells (Koenderman et al, 1989) and CaCO-2 cells  (Brockhausen et al, 1991). The gene encoding GlcNAc-TIII has been isolated f r o m vertebrate genomes  including the rat, h u m a n  ( M G A T 3 ) , and mouse  (Mgat3)  (Nishikawa et al, 1992; Ihara et al, 1993; B h a u m i k et al, 1995). Expression of Mgat3 R N A appears h i g h i n mouse brain and kidney tissue, w h i l e increased expression following  i n cell lines has been  reported  to suppress  susceptibility to N K cell cytotoxic mechanisms,  promote  spleen c o l o n i z a t i o n ,  suppress  gene transfer  lung metastatic  activity of the B16 mouse  melanoma  cellular  and suppress  expression of hepatitis B virus (Yoshimura et al, 1995a, 1996; M i y o s h i et al, 1995).  Introduction  37  In addition, high levels of GlcNAc-TIII activity and bisecting N-glycans have been reported i n cells derived from patients w i t h chronic myelogenous leukemia i n blast crisis (Yoshimura et ah, 1995b,1995c). metastasis frequently  involve  Alterations i n N-glycans associated w i t h  altered branching  at the trimannosyl  core, for  example b y G l c N A c - T V mediated (31-6 G l c N A c addition (Dennis et al., 1987; Yousefi et ah, 1991; Saitoh et ah, 1992).  A s these enzymes  can compete for c o m m o n  substrates, a functional interplay i n oncogenesis between GlcNAc-TIII and G l c N A c T V thus appears possible and may be further  defined by altering oligosaccharide  production i n the context of tumourigenic physiology.  1.10.1 Cloning of the Rat N-Acetylglucosaminyltransferase III UDP-N-acetylglucosamine:(3-D-mannoside  (3-1,4-N  acetylglucosaminytransferase III (Mgat3), coding for GlcNAc-TIII, was purified f r o m rat kidney b y A t s u s h i N i s h i k a w a et ah ( N i s h i k a w a et ah, 1992). was subjected Amino  The purified protein  to trypsin digestion and the resultant peptides were  acid sequence was used  to design oligonucleotide  sequenced.  primers  for P C R .  Screening of a rat kidney c D N A library w i t h the P C R derived probe succeeded i n the retrieval of 4 positives phage clones. A compilation of the sequencing i n f o r m a t i o n from these clones revealed an open reading frame of 1608 base pairs coding for a 536 amino acid protein. vector  The Mgat3 c D N A was cloned into a m a m m a l i a n  and transfected  into COS-1 cells.  COS-1 cells transfected  expression w i t h Mgat3  Introduction expression vector exhibited 500-3600 fold  38  increase  i n GlcNAc-TIII  activity as  compared to cells containing a control vector alone. The  Mgat3  glycosyltransferases transmembrane  gene  which  has  a  domain  include a short  structure  amino  common  terminal  to  other  cytoplasmic  tail,  domain, a neck region and a long terminal catalytic region.  The  coding sequence has three putative glycosylation sites and shares no homology to other cloned glycosyltransferases.  However, it does share a small motif, 10/12  consecutive amino acids, w i t h h u m a n  integrin P subunit that resides near the 4  catalytic domain of GlcNAc-TIII. The significance of this relation is not k n o w n .  1.10.2 High GlcNAc-TIII Activity is Strongly Associated with Some Malignancies The observation that the glycan attached to y-glutamyltranspeptidase f r o m rat and h u m a n hepatomas contained bisecting G l c N A c while the same glycoprotein derived  from  normal  tissues  acetylglucosaminyltransferase investigate  the  closeness  did  not,  first  suggested  III may be induced by liver  of this  relationship,  that  N-  carcinogenesis.  To  Narasimhan  et al. used  an  experimental model of rat hepatocarcinogenesis (Narasimhan et al., 1988). Fisher rats were administered  a single dose of a carcinogen, followed  by a partial  hepatectomy 18 hours later and then fed a diet supplemented w i t h 1% orotic acid for 32-40 weeks.  Preneoplastic hepatic nodules had a greatly increased G l c N A c - T I I I  activity (0.78-2.18 n m o l / h / m g of protein) as compared to regenerating liver (24 h  Introduction  39  after partial hepatectomy) and control liver (0.02-0.03 n m o l / h / m g of protein) w h i c h had negligible activity. A d d i t i o n a l studies w i t h different rat hepatocarcinogenesis models concurred w i t h this first result (Nishikawa et ah, 1988; Pascale et ah, 1989). Therefore, the increase i n GlcNAc-TIII activity is independent of the type of m o d e l system used and appears to be connected w i t h the hepatic lesions. Recently, levels of  GlcNAc-TIII  activity  were  investigated  in  hematological  malignancies  (Yoshimura et ah, 1995b and 1995c). Patients w i t h chronic myelogenous leukemia i n blast crisis ( C M L - B C ) and patients w i t h multiple myeloma ( M M ) displayed elevated GlcNAc-TIII whereas other hematological malignancies, i n c l u d i n g C M L i n chronic phase, had insignificant activity. A l t h o u g h the connection between high G l c N A c TIII activity and malignancy i n the above examples is not k n o w n , the bisecting G l c N A c has a profound effect on oligosaccharide structure and may alter cell-cell or cell-matrix interaction. Such effects could be responsible for some of the m e m b r a n e changes seen i n oncogenesis.  1.10.4 The Effect of the Bisecting N-Acetylglucosamine on Oligosaccharide Structure and Lectin Binding The effects of the bisecting G l c N A c addition to the trimannosyl core of Nglycans are manifold. The presence of the bisecting G l c N A c is k n o w n to alter the conformation of the core residues (Brisson and Carver, 1983). Such conformational changes to the core can affect its recognition by other glycosyltransferases.  A s the  presence of the bisecting G l c N A c can block the action of oc-mannosidase II, G l c N A c -  Introduction  40  T i l , G l c N A c - T I V and G l c N A c - T V , the addition of this sugar by GlcNAc-TIII can influence  the  type of N - l i n k e d  structure synthesized.  Moreover, changes i n  oligosaccharide structure induced by GlcNAc-TIII addition could modify b i n d i n g to endogenous lectins. A l t h o u g h the bisecting G l c N A c has not been shown to interact w i t h an endogenous lectin yet, it is k n o w n to affect the binding of exogenous lectins. E 4  PHA,  or  erythroid-phytohemagglutinin,  has  oligosaccharides (Cummings and Kornfeld,  a  high  affinity  for  bisected  1982; Green and Baenzinger,  1987;  Kobata and Yamashita, 1989, 1993). This lectin is of great importance for our Mgat3deficient mice as it can be used to probe tissues for bisected structures. Contrary to the effects on E - P H A binding, the bisecting G l c N A c hinders the interaction of N4  glycans w i t h the  lectins Concavalin A  (Narasimhan  et ah, 1986) and Datura  Stramonium Agglutinin (Yamashita etal.,1987).  1.3 Manipulating the Mouse Genome 1.3.1  Introduction It has not been long since the thought of introducing specific gene mutations  into the  mouse  germline  However, a number  w o u l d have been considered  of technical breakthroughs,  discovery and pluripotential maintenance,  only a w i l d  fantasy.  particularly P C R and ES cell  have turned this fantasy into reality  (Palmiter and Brinster, 1986; Capecchi, 1989; Wagner, 1990).  A s some of these  mutations resulted i n complex and/or embryonic lethal phenotypes, gene targeting limitations became apparent. Additionally, a mutation causing embryonic lethality  41  Introduction  makes it impossible to study the consequences of gene loss i n tissues of an adult animal. Secondly, if, for example, a "specialized cell" of a tissue fails to develop i n the gene knockout animal, it may be difficult to determine if the deficit lies w i t h i n the "specialized cell" or its environment  or both.  Such scenarios beckon for the  ability to perform cell- or tissue-specific gene inactivation.  The application of the  Cre/loxP recombination system i n transgenic mice fulfills this desire ( G u et al., 1994a). In this system, the mutation is generated only w h e n the Cre recombinase is applied.  1.3.2  Embryonic Stem Cells The discovery of embryonic stem (ES) cells has revolutionized the field of  mouse genetics by allowing scientists to introduce specific gene mutations into the mouse germline (Robertson et al., 1986; Capecchi, 1989). ES cells, cells derived f r o m the outgrowth of the inner cell mass of a 3-4 day old (most c o m m o n l y "129" strain) blastocyst, are unique w i t h respect to their totipotency, an ability to differentiate i n t o multiple cell types whether this comes about through microinjection into a host blastocyst or induction v i a in vitro culture conditions (Robertson, 1987). These cells have been a boon to scientists since they can be genetically altered and selected for i n vitro and subsequently, their re-introduction into a host blastocyst can produce a mouse strain harbouring the mutation. specific gene mutations animal.  Therefore, ES cells allow one to generate  and study the consequences  Although null  mutations  have  been  of such losses i n a w h o l e  most  commonly  made,  this  Introduction technology could be used to generate virtually  42 any type of desired m u t a t i o n  (Ramirez-Solis et al, 1993).  1.3.3  Homologous Recombination Since ES cells had been shown to be capable of taking up exogenous D N A ,  being microinjected into a host  blastocyst to form  a chimaeric  animal and  subsequently transmitting the incorporated D N A into the mouse germline, there was great interest i n achieving homologous recombination i n these cells.  Gene  targeting, or the homologous recombination of D N A residing on the c h r o m o s o m e w i t h n e w l y transfected D N A sequences, w o u l d enable one to guide i n c o m i n g D N A to specific chromosomal  loci,  thus,  allowing  specific gene mutations  to be  introduced into the mouse germline (Haber, 1992; Capecchi, 1989). K i r k T h o m a s and M a r i o Capecchi were the first to show that such an approach was possible i n ES cells  (Thomas  and Capecchi, 1987).  The altered  locus,  the  hypoxanthine  phosphoribosyl transferase (HPRT), was chosen since the gene resided o n the X chromosome (only one copy to mutate i n male ES cells) and that cells mutated for this gene could be selected for.  A l t h o u g h this experiment demonstrated  that  homologous recombination i n ES cells is possible, it d i d not answer the question of how applicable this technology w o u l d be to other genes where the mutation could not be selected.  Early i n the gene targeting era, scientists battled w i t h l o w  frequencies of homologous recombination and wondered whether some regions of the genome were amenable to targeting.  Additionally, the advent of P C R was of  43  Introduction  great importance as it allowed one to screen pools of ES cell clones for a putative recombination event.  Following many experiments, scientists started to realize the  significance of using isogenic D N A to build their target vectors.  When  the  incoming D N A is derived from the same strain as the ES cell to be transfected, it is said to be isogenic.  A s polymorphisms exist between different mouse  strains  (particularly i n non-coding regions), non-isogenic D N A constructs, vectors derived from different strains as the ES cell line, are thought to homologously recombine less efficiently since they have shorter lengths of perfect homology (Riele et al., 1992; v a n Deursen et al., 1992; v a n Deursen and Wieringa, 1992; Ramirez-Solis et al., 1993). A s nearly all ES cells are derived from the 129 strain of mouse, one w o u l d screen a 129 mouse genomic library for vector construction.  Frequencies of gene  targeting w i t h isogenic D N A are n o w so high that many scientists have abandoned the negative selection strategy (Ramirez-Solis et al., 1993).  These frequencies are  often 1/10 G418 resistant colonies and seldom lower than 1 i n a hundred (Riele et al., 1992; Hasty et al., 1994; laboratory observations).  C o n v e n t i o n a l gene targeting  vectors mutate the gene by either insertion of a selectable marker i n an early or critical exon or by replacement of a genomic fragment containing coding sequence w i t h the selectable marker. Aside from selection, the marker also functions to stop translation of the endogenous message v i a the placement of a stop codon and its poly A signal may also terminate transcription of the locus if it is pointed i n the same direction. The design usually includes flanking the marker cassette w i t h one long arm and a short arm of genomic D N A . The short arm is utilized for P C R screening. The long arm is greater than 2 kilobases whereas the short arm is 0.5 to 2  44  Introduction  kilobases in length (Hasty et ah, 1991; Ramirez-Solis et ah, 1993). If Southern blotting is used for detection, then two long arms of sequence are applied. To use the Cre /loxP recombination system to create a conditional mutation, one selects a critical element of the desired gene to flank with loxP sites which is i n turn placed between flanking genomic D N A (Marth, 1996). Cre action potentiates the mutation by deleting the loxP flanked sequence.  As most genes contain  multiple exons and span large distances, it is not usually practical to flank the entire protein encoding sequence with loxP sites. Therefore, it is necessary to choose the gene (exon) to be flanked wisely. To create a null mutation, it is advantageous to flank a 5' exon.  Alternatively, an exon coding for a domain required for the  protein's function can be used.  Even more desirable, the deletion of this exon  disrupts the reading frame of the gene and, thereby, inserting a nonsense mutation (stop codon) into the downstream message.  1.3.4  The PI Bacteriophage and Cre Recombinase PI is a temperate bacteriophage which has a genome of approximately 90  kilobases of double-stranded D N A (Sternberg and Hoess, 1983). About 7-12% of its terminal D N A is cyclically permuted as it acts as a general transducing phage, snatching up adjacent E. coli D N A . The great majority of the phage's genome is involved in vegetative growth although there are several regions which encode gene products participating in the establishment and maintenance of the prophage. During lysogeny, the PI bacteriophage's vegetative functions are repressed and it exists in E. coli as a single copy plasmid. Interestingly, PI has a linear genetic map  Introduction  45  whereas other viruses w i t h a similar D N A organization have a circular genetic map. This linearity of the P I genetic map suggests either a large segment of D N A is without genetic markers or that the plasmid contains a locus w h i c h undergoes frequent recombination, a so-called "hot spot". The latter hypothesis turns out to be correct: the P I phage contains a recombination recognition sequence, loxP (locus of X-ing-over), and a recombinase enzyme, Cre. Cre (causes recombination)  is a member  recombinases w h i c h includes F L P and R of yeast. remarkable  of the  integrase  These members  family of  demonstrate  similarity w i t h regard to the types of reaction they carry out, the  structure of their recognition sequences and i n mechanism of action (Kilby et al., 1993). Recombination can be intermolecular or intramolecular and can be o n a supercoiled, relaxed circle or linear D N A . W h e n two loxP sites are i n direct repeat on a circular molecule, Cre-mediated recombination removes the intervening D N A and generates two circular molecules. Cre is also capable of negotiating the reverse reaction, i.e. recombining sites on two separate molecules to produce a p l a s m i d dimer. D u r i n g intramolecular recombination on a linear molecule, the i n t e r v e n i n g D N A is excised w h e n two loxP sites are i n direct repeat w i t h one another (head to tail), whereas the D N A is inverted w h e n the loxP sites are i n reverse orientation (head to head; tail to tail) w i t h respect to one another. delete regions  of D N A from  the genome  The proficiency of Cre to  has empowered  geneticists  molecular switch, an ability to turn on or off a gene i n a conditional manner.  with a  46  Introduction  (a) Cre and the PI phage life cycle Single copy replicons such as sex factors, antibiotic resistance elements and plasmid prophage are replicated and partitioned to progeny w i t h h i g h fidelity.  Due  to their single copy nature, a highly efficient mechanism must be i n place to secure its existence among a d i v i d i n g bacterial population. built-in safeguard, the Cre/loxP  The P I bacteriophage has a  system, to ensure its s u r v i v a l .  If recombination  took place after replication of a single copy plasmid, the resulting dimer w o u l d not be partitioned equally to daughter cells at cell division.  The outcome  of the  aforementioned scenario is a high loss of plasmid from a growing population. Pl-encoded Cre recombinase plasmid  by  resolving  functions  dimers  into  to ensure stable maintenance plasmid  monomers,  The  of the P I  thereby  ensuring  transmission to the next generation (Figure 1.6).  Dimer  Cre-mediat ed Recombination  Monomers  Figure 1.6 Maintenance of the P1 during lysogeny. The Cre recombinase functions by resolving plasmid dimers to plasmid monomers.  Introduction  Al  A P I phage w i t h a defective Cre /loxP system is much less stably maintained than the w i l d type P I (Austin et al, 1981).  (b)  Cre and the loxP site A variety of bacterial, yeast and m a m m a l i a n recombinase enzymes exist  w h i c h cleave D N A at specific target sequences and then ligate it to the cleaved D N A at a second site.  The complexity of these D N A rearrangement  reactions differs  substantially w i t h respect to requirements for co-factors, supplementary proteins and  the  recombinase  recognition  sequences.  Three  of  these  site-specific  recombinases have been used to manipulate D N A i n heterologous cellular systems (Kilby et al, 1993).  T w o , F L P and R, are encoded by the yeasts Saccharomyces  cerevisiae and Zygosaccharomyces  rouxii (Broach et al,  1982; A r a k i et flZ.,1985)  whereas the third, Cre, is from the P I bacteriophage. Cre and F L P are attractive to molecular biologists since they have been s h o w n to be sufficient i n themselves to catalyze recombination between specific target sites (Abremski and Hoess, 1984; Senecoff and Fox, 1986). The target sequences of the Cre protein is 34 base pairs i n length (Figure 1.7).  Introduction  48  loxP site ATAACTTCGTATA ATGTATGC TATACGAAGTTAT  |^  1 3bp  —8bp — • l ^  1 3bp  •!  Figure 1.7 The loxP site. This recognition sequence is composed of two 13-mer inverted repeats separated by an 8 base-pair core. Due to the 13-mer inverted repeats, the core element gives the toxP site its directionality. Also, note the "ATG" triplet found in the core as it has relevance with regard to designing a conditional mutation.  The loxP is composed of two inverted 13 base pair repeats separated by the centrally located spacer of 8 base pairs.  This core sequence confers the directionality of the  loxP site (Hoess et al., 1986). O w i n g to the length of this recognition sequence, it is unlikely to occur randomly i n eukaryotic genomes (A - 3 X 10 ). 34  (c)  20  The Use of Cre in Heterologous Systems Brian Sauer performed an experiment i n the yeast Saccharomyces cerevisiae  to determine  whether  the Cre recombinase  of the P I coliphage could enter a  eukaryotic nucleus, recognize histone-associated nucleosomes  D N A w h i c h is packaged  and execute site-specific recombination  (Brain Sauer, 1987).  into The  design included the Cre gene, placed under the regulatory control of the G A L 1 promoter, and the target, the L E U 2 gene flanked by directly repeated loxP sites was used to complement a leu- yeast strain.  G r o w t h on glucose suppresses the G A L 1  promoter and as a consequence, the Cre gene is switched off and no recombination  Introduction  49  takes place. Induction of the G A L 1 promoter by growth o n galactose results i n the specific excision of the L E U 2 gene and loss of the LEU2-containing plasmid product from  the cell (as it  does not include an A R S , an autonomously replicating  sequence), thereby demonstrating that Cre is not impeded by chromatin structure. By 24 hours, 98% of the induced cells required exogenous leucine for g r o w t h indicating that Cre action is highly efficient. T w o of these leu- auxotrophs had the loci of recombination cloned and subjected to sequence analyses. precise recombination event  had taken  place w i t h  In both cases, a  a single intact  loxP  site  remaining. After the successes w i t h the Cre recombinase system i n the yeast, Brian Sauer and N a n c y Henderson went on to address whether mammalian  cell (Sauer and Henderson, 1988).  Cre could function i n a  A stable mouse cell line was  constructed that contains the Cre gene under the control of the C d  2 +  inducible  metallothionein I promoter. W h e n D N A substrates, such as a marker gene flanked by loxP signals, were introduced into these cells, they were shown to undergo Cremediated site-specific recombination. These data suggest many possible uses for the Cre /loxP  system i n manipulating  the m a m m a l i a n  genome,  from  inducing  translocations to m a k i n g conditional mutations i n transgenic mice.  (d)  Site-Specific Recombination in Transgenic Animals After  studies  had shown  Cre capable of mediating  recombination  in  heterologous systems of yeast and a m a m m a l i a n cell line (Sauer, 1987; Sauer and Henderson, 1988), it sparked interest i n whether Cre could act w i t h i n tissues of a n  Introduction animal.  50  T w o groups generated Cre transgenic mice w i t h the aim of performing  chromosomal D N A recombination in vivo.  One group generated a mouse strain  carrying a lens-specific aA-crystallin ( m a A ) promoter separated from the SV40 T antigen (TAg) coding sequence by a stop sequence (Stop) (Lakso et al., 1992). Previous w o r k demonstrated  that mice bearing this transgene without the stop  signal developed malignant eye tumours (Mahon et al., 1987).  A c c o r d i n g to the  experimental design, the silenced SV40 T antigen could only become activated if Cre deleted the loxP flanked stop sequence. Histological analyses of mice harboring both mocA-Stop-TAg  and mocA-cre  transgenes  revealed  morphological  changes  characteristic of proliferating lens tumours. Furthermore, the expected size banding by  P C R and Southern  recombination.  analyses  confirmed  the  genomic  structure  after  Despite p r o v i n g Cre's functioning in vivo, an assessment of its  efficiency could not be made since transformation of a single cell should suffice for oncogenesis.  Introduction  51  Lost  —  •  Figure 1.8 Cre-mediated DNA deletion. The excision reaction is thought to be favoured over re-integration as it is a unimolecular reaction. Excision by Cre causes the circularization of the intervening DNA. This intervening sequence is lost from mammalian cells as it does not contain an origin of replication.  The second group devised an alternative scheme for detecting Cre-mediated recombination.  Instead of using Cre recombination to activate expression of a  silenced transgene, the (3-galactosidase reporter gene was flanked by loxP  signals  Introduction  52  (loxP-$-gal-loxP) and w o u l d be ablated by Cre action (Orban et al, 1992). Once again, two mouse  lines were constructed, one carrying the Cre gene d r i v e n by the  l y m p h o i d cell kinase (lck) thymus-specific promoter and the other bearing the marker, loxP-^-ged-loxP, also under control by lck promoter. Double transgenic mice had undergone tissue-specific recombination as only thymocytes had lost the loxP flanked (3-galactosidase gene.  Moreover, using densitometry, the recombination  event was found to be highly efficient and heritable as >95% of splenic T cells h a d lost hybridization to the (3-galactosidase gene. These  two experiments  have  shown  Cre to be operable  on  all n i n e  independent lines of transgenic mice bearing loxP targets, thereby suggesting that the majority of the m a m m a l i a n genome may be accessible to Cre function.  The  above-mentioned experiments have served as the foundation for many present and future experiments, not only limited to the activation or deletion of specific genes.  (e)  Cre and the Induction of Chromosomal Rearrangements A l t h o u g h homologous recombination i n murine ES cells has n o w made it  possible to introduce desired gene mutations  into the germline at w i l l ,  the  technology to make large scale alterations to the m a m m a l i a n genome has o n l y recently become available.  C h r o m o s o m a l rearrangements,  the major  cause of  inherited h u m a n disease and fetal loss, can have dramatic effects on the expression levels  of  rearranged  loci  (Epstein,  1986).  Such  rearrangements  include  translocations and deletions, events that are often responsible for the loss of  Introduction  53  heterozygosity and are highly associated w i t h neoplasia. A method for r e c o m b i n i n g m a m m a l i a n chromosomes at predetermined sites w o u l d be an extraordinary t o o l for studying the activation of oncogenes by translocations, the relationship between chromosomal position and gene expression and the mechanisms  of genomic  imprinting. Initial work on Cre-mediated chromosomal recombination i n yeast and plants systems boded w e l l for its possible success i n m a m m a l i a n cells (Sauer, 1992; Q i n et al, 1993). T w o groups both w o r k i n g w i t h mouse engineering m a m m a l i a n chromosomes  ES cells have n o w succeeded i n  (Smith et al, 1995; R a m i r e z - S o l i s et  al,  1995). O w i n g to the distance between the loxP sites, the frequency of the desired recombination event selection strategy.  was anticipated to be l o w enough  A selection scheme  to require a positive  was based on the  reconstitution  of a  hypoxanthine phosphoribosyltransferase (HPRT) minigene i n an Hprt' ES cell l i n e . Sequential gene targeting guided the loxP sites to two disparate loci, chromosomes 12 and 15, w i t h i n the genome.  Each of the two targeting constructs contained a  single loxP site w i t h a selectable marker and either the 5' or 3' ends of the minigene.  Due to the reversibility of the reaction, Cre was transiently  Hprt  transfected  into ES cells bearing the inserted loxP sites and selected i n H A T m e d i u m .  Cells  capable of growth i n H A T m e d i u m had undergone the desired recombination event as  a result  of the  recombination. program  reconstruction  of the  Hprt  minigene  by  Cre-mediated  Smith et al, utilized the above-mentioned experimental design to  a translocation  similar  to  one  found  in  human  lymphomas,  a  juxtaposition of the heavy chain i m m u n o g l o b u l i n promoter i n front of the c-myc  Introduction proto-oncogene  (Smith et al., 1995).  54  Such translocations may compromise  the  developmental potential of the ES cell clone, thereby preventing the transmission of the alteration into the mouse germline. In addition, translocations induced i n ES cells w o u l d produce mice w i t h a constitutional genetic abnormality.  This is i n  contrast to rearrangements associated w i t h cancer, where lesions are often somatic and limited to the tumourous tissue. Rather than recapitulating a translocation present i n a h u m a n malignancy, A l a n Bradley's laboratory focused their efforts on engineering a chromosome w i t h a defined deletion (Ramirez et al., 1995). The region eliminated is syntenic to a region on h u m a n chromosome 17q w h i c h is believed to contain tumour suppresser genes from "loss of heterozygosity" studies. T w o sequential gene targetings were carried out to deliver loxP sites to different locations on chromosome 11 giving rise to two types of clones, one i n w h i c h both loxP sites are on one chromosome (Type 1) and the other w h i c h has a loxP site on each chromosome 11 (Type 2). The first clone, bearing the doubly targeted chromosome, and targeted  chromosomes  the second clone w i t h two single  yielded two types of Cre recombination:  intrachromosomal deletion and Type 2, a balanced translocation. harbouring germline,  the either  balanced  translocation  11 w i t h  an  The ES cell  was capable of transmission  passing on a chromosome  duplication for the loxP flanked sequence.  Type 1,  into  a deletion or h a v i n g  the a  The largest deletion spanned a region of  3-4 c M , approximately 10% of chromosome  11.  The aforementioned  deficiency  results i n segmental haploidy at a specified region w i t h i n the genome and can n o w serve as an invaluable tool for the screening of recessive mutations.  Investigators  Introduction  55  can study the phenotypes in mice housing the deletion or in vitro by studying cell lines derived from these mice.  (f)  Cre  and  Site-Specific  Insertion  Another powerful application of the Cre recombinase is to mediate  site-  specific integration, the inverse of loxP flanked D N A excision. It may be particularly useful when trying to introduce D N A into a cell which undergoes non-homologous recombination (random integration) at low frequency. Other potential uses include expression analyses of numerous constructs which have integrated into a single chromosomal  position, thus  eliminating position effects on  expression.  An  additional advantage over gene targeting is that it does not require the cloning of flanking sequence homologous to the destination locus.  O• V  »  »  Figure 1.9 Site-specific i n t e g r a t i o n . Pairing of the loxP (arrowheads) sites precedes the integration reaction. As this reaction results in two intact loxP sites, this reaction is fully reversible.  Introduction  56  W h e n Cre excises loxP flanked D N A , the single loxP site w h i c h remains can serve as a substrate for further recombination (see Figure 1.9). Incoming D N A w h i c h bears a loxP site can be targeted by Cre to the loxP site w h i c h has been previously inserted into the genome.  Due to the reversibility of this reaction, the  presence of Cre must be brief to prevent re-excision.  Temporally limited Cre  expression can be achieved by either lipofection w i t h the purified Cre recombinase protein or by co-transfection of the loxP targeting vector w i t h a C r e expression vector.  W o r k to date has succeeded i n delivering a loxP containing plasmid to  previously inserted loxP sites i n the yeast and m a m m a l i a n genomes (Sauer a n d Henderson, 1990; Baubonis and Sauer, 1993).  Moreover, heterologous D N A has  been inserted into a loxP bearing alphaherpesvirus and the recombinant virus used as a shuttle (Sauer et ah, 1987b).  (g)  Other Cre Delivery Systems Alternative strategies for delivering Cre have been employed. The goal of  these efforts has been to achieve greater control of Cre expression and, thus, increasing the precision of gene inactivation.  Ralf K u h n  and colleagues h a v e  presented a method for the inducible inactivation of a target gene (Kuhn et al., 1995). The  previously  discussed  applications  relied  on  a developmentally-active  endogenous promoter to drive Cre expression. The drawback of such an approach is that the disruption of the target gene occurs early i n development w h i c h may either (1) allow for the animal to compensate or (2) induce secondary effects and, hence,  Introduction make the phenotype difficult to interpret. the Mxl  57  The inducible system takes advantage of  promoter w h i c h is normally silent i n healthy mice (Hug et al,  1988;  Arnheiter et al., 1990). This promoter is activated by viral infections and can direct high  levels of transcription  experiment, Mxl-Cre  via interferon  a  or  (3 administration.  In  this  transgenic mice were crossed w i t h a loxP flanked target bearing  strain. A n i m a l s harbouring both alleles were treated w i t h interferon. days, Cre-mediated D N A deletion was complete  After a few  i n liver, nearly complete  in  lymphocytes and partial i n other tissues examined (Kuhn et al, 1995).  1.4  Thesis Objectives A t present it is clear that complex N - l i n k e d oligosaccharide biosynthesis is  required early i n embryonic development (Ioffe and Stanley, 1994; Metzler et 1994). bearing  al,  This highly regulated pathway often generates oligosaccharide structures multiple  antennae,  suggesting  the  possibility that  unique  biological  information is contained along each branch, information that may be perceived following the ablation of specific branching/diversification steps as controlled by specific glycosyltransferases and glycosidases.  It is also possible that complex N-  glycans may function i n part through multi-valent interactions as a result of m u l t i anntennary structures harboring identically-modified branch termini.  To begin to  investigate these possibilities including the biological role of the bisecting G l c N A c , we have created mice that lack a functional Mgat3 gene and are devoid of G l c N A c -  Introduction  58  T i l l activity and bisecting N-glycans using the Cre-loxP site-directed mutagenesis approach (Marth, 1996).  Materials and Methods  59  CHAPTER 2 Materials  2.1  and  Methods  Genomic DNA Isolation and Analysis of the Mouse Gene  Mgat3 A  1.6 kilobase GlcNAc-TIII-encoding  D N A probe was amplified  from  5  nanograms of rat genomic D N A using primers designed w i t h the rat c D N A sequence (Nishikawa et ah, 1992). The primers were as follows: 5'TCCTATGTCACCTTCCCGAGAGAACTGGCCTCCCTCAGCCCTACCCTCATATCC AGCTTC3'  and  5'GCCCTCCGTTGTATCCAACTTGCC3'.  The  P C R product  was  purified on a 1% agarose gel, verified by restriction analyses and cloned into pUC19. The cloned insert was isolated, P-labeled, and used as a probe for genomic library 32  screening using methods and under conditions previously described (Marth et al., 1985). The genomic library w h i c h had undergone one round of amplification was derived from 129/SvJ female mouse liver D N A (Stratagene,CA). After hybridization, duplicate duralose - U V membranes (Stratagene, C A ) were washed two times at 55° C i n 0.1 X S S C / 0 . 1 % SDS for 10 minutes and autoradiographed for 24 hours on K o d a k X A R - 5 film. Escherichia  T w o positive clones were identified from screening 300,000 plaques o n coli X L l - B l u e M R A ( P 2 ) (Stratagene, C A ) and both were  purified to homogeneity.  subsequently  Phage D N A was purified from plate lysates, digested w i t h  Not I, cloned into Bluescript, and subjected to restriction enzyme analyses.  A 1.8  kilobase Bam H I mouse genomic D N A fragment hybridizing to the rat c D N A probe  Materials and Methods  60  was subcloned into pUC19, producing pMgat3, and propagated i n E. coli DH-5cc for large scale purification.  D N A sequencing was initiated using M 1 3 primers  employing dideoxy fluorescent nucleotides. using  sequence-internal  and  Subsequent sequencing was carried out  oligonucleotides  following  synthesis  and  priming,  approximately every 300 bases on both D N A strands.  2.2  DNA Sequencing Sequencing was carried out using 500 ng of template D N A plus 3.2 pmoles of  relevant primer i n a 12 | i L volume.  8 | i L of A B I P R I S M Dye Terminator  Cycle  Sequencing Ready Reaction K i t (with A m p l i T a q D N A P o l y m e r a s e , FS) was added to give a final v o l u m e of 20 uX. M J Research D N A Engine Peltier Thermal Cycler 200 was operated for the cycle sequencing. The reaction parameters included a hot start at 96° C , denaturation at 96 °C for 10 s, annealing temperature for 5 s and elongation at 60 °C for 4 m i n , repeated for 25 cycles, followed by cooling to 4°C. Dye nucleotide cleanup  was accomplished  by spin column  C o l u m n s from P H A R M A C I A .  purification  using  MicroSpin  G50  Gels were r u n on an A B I 373A autosequencer u n d e r  the following conditions: 6% acrylamide, 8.3 M urea, I X TBE gel. I X T B E as buffer system.  Before loading, samples are given 3-4 u L of loading buffer (lpart 50 m M  E D T A p H 8.0 i n 30 m g / m L Blue Dextran solution to 5 parts deionized formamide).  Materials and Methods  61  2.3 FISH Detection and Image Analysis The regional assignment of the Mgat3 allele was determined by fluorescence in situ hybridization (FISH) to normal mouse lymphocyte chromosomes counterstained w i t h p r o p i d i u m iodide and 4' 6-diamidin-2-phenylindol-dihydrochloride (DAPI) /  following published methods (Lichter et al., 1990; Boyle et al., 1992).  Biotinylated  probe (entire N o t I-Not I mouse genomic Mgat3 clone, see Figure 4) was prepared by nick translation and detected w i t h avidin-fluorescein isothiocyanate (FITC), followed by  biotinylated anti-avidin antibody and avidin-FITC.  Images of metaphase  preparations were captured by a thermoelectrically cooled charge coupled camera (Photometries, Tucson, A Z ) .  Separate images of D A P I banded chromosomes (Heng  and Tsui, 1993) and of FITC targeted chromosomes  were obtained and merged  electronically using image analysis software (courtesy of T i m R a n d and D a v i d W a r d , Yale University, N e w Haven, CT) and pseudo colored blue (DAPI) and yellow (FITC) as described (Boyle et al., 1992). The band assignment was determined by m e a s u r i n g the fractional chromosome length and by analyzing the banding pattern generated by the D A P I counterstained  image (Francke, 1994; I S C N , 1978).  The c h r o m o s o m a l  localization was verified by double color FISH using a gene probe k n o w n to map to chromosome 15 ( K o h r m a n et al., 1995; M o c k et al., 1994) kindly p r o v i d e d by D r . M . Meisler, University of Michigan.  Mgat3 probe was labeled w i t h digoxygenin (DIG)  and detected w i t h mouse anti-DIG antibody followed by DIG-anti-mouse antibody and rhodamine-anti-DIG.  The chromosome 15 probe (med /Scn8a) was biotinylated and  detected w i t h FITC-avidin as described above.  Materials and Methods  2.4  62  RNA Blot Analysis R N A was prepared by the method of C h i r g w i n et al. (1979) and subjected to  formaldehyde denaturing agarose gel electrophoresis.  R N A was transferred  onto  nitrocellulose (Schleicher & Schuell) and hybridized to a random-primed radiolabeled D N A probe w i t h Klenow. fragment  which  The Mgat3 probe consisted of a 1.8 kilobase Bam  encompassed  the  entire  GlcNAc-TIII  protein-coding  HI  sequence.  F o l l o w i n g hybridization and washing conditions as above, the filter was exposed to K o d a k X A R - 5 film at -80° for 72 hours. Methods were as described previously ( M a r t h etal, 1985).  2.5  Targeting Vector Construction F r o m a phage 129/SvJ mouse genomic library, a purified clone containing a  centrally located Mgat3 was used to generate a targeting vector as follows:  A 1.8  kilobase Bam HI/Sma I fragment w h i c h contained the single Mgat3 protein-encoding exon was cloned into the Bam H I site of the pflox vector.  The flanking 2.0 kilobase  Bam H I fragment and an 8.5 kilobase Sma I fragment were subsequently cloned into the Xba I and Xho I sites of pflox, respectively. The targeting D N A construct was made linear by Not I digestion and purified by agarose gel electrophoresis.  2.6  Homologous Recombination in ES Cells Ten micrograms of targeting vector D N A was introduced into the R l ES cell  line v i a electroporation.  ES cells were plated on gelatin-coated culture plates and  Materials and Methods  63  selected for 10 days w i t h m e d i u m containing 150 m g / m L of G418 (Life Technologies, G r a n d Island, N Y ) . Homologous recombinants were initially detected by polymerase chain reaction (PCR) using a thymidine kinase promoter and Mgat3 allele specific primers  Tk303:  5'  TGCAAAACCACACTGCTCGATCCG  CTTCATTTAGAGGGAGAGGGGAGAAATTAACTTGG  3'  and  GnTffl:  3' respectively.  5'  Putative  P C R positive clones were subjected to Southern Blotting as described (Marth et al., 1985) to confirm homologous recombination had occurred. The genomic probe used was a 0.6 kb fragment w h i c h resides adjacent to the targeted Mgat3 sequence and was isolated from the phage clone by Not I (phage cloning site) and Kpn I digestion. The 0.23 kb loxP probe was'derived from pl015-lox by Not I digestion and contains two 2  loxP sites flanked by polylinker sequence, isolated previously from p l o x as a 0.18 kb 2  Hind III-Eco RI fragment (Orban et al., 1992) prior to blunt-end ligation into Bam H I site of pl015-ASph I.  2.7  Transient Cre Transfection in ES Cells In ES cell clone 1H8 bearing the targeted Mgat3 allele and all three loxP sites,  ten micrograms of the Cre expression plasmid was transfected v i a electroporation. Cells were plated at l o w dilution and four days later the transfectants were selected for resistance to ganciclovir (2 x 10-6 M ) for five days. F o l l o w i n g selection, D N A f r o m ganciclovir resistant clones was isolated and tested for recombination by S o u t h e r n blot analyses. Cre-mediated deletion resulted i n two types of recombination w h i c h were initially detected by use of a loxP probe and later verified by using a genomic probe.  Materials and Methods  2.8  64  Generation of Chimaeric and Mutant Mice Chimaeric mice were generated by microinjection of 8-10 ES cells into twenty  3.5 day C 5 7 B L / 6 blastocyst stage embryos and implanted into the uteri of pseudopregnant outbred albino foster mother recipients. N i n e neonates mice were assessed for chimerism by the presence of agouti coat color. A l l nine were male chimaeric mice displaying greater than 90% agouti coat color were mated to C 5 7 B L / 6 females. Tail D N A of agouti progeny, an indicator of germline transmission of the ES cell genotype was analyzed for the presence of the mutate allele. Heterozygous mice were intercrossed to generate mice homozygous for Mgat3 mutation.  2.9  DNA Isolation Cells and tissues were incubated for five hours or overnight i n 50 m M Tris-  H C I , p H 8.0; 50 m M E D T A , p H 8.0; 0.5% SDS, and 100 u g / m L proteinase K (Boehringer Mannheim).  D N A was  purified by one  phenol:chloroform  chloroform extraction and ethanol precipitation.  extraction,  one  The pellet was washed w i t h 70%  ethanol and resuspended i n T E ( l O m M Tris p H 8.0; I m M E D T A p H 8.0) buffer.  2.10 In V i t r o Differentiation of Embryonic Stem Cell Clones In gene targeting experiments, it is possible to produce multiple clones (more than the number that can be desirably micro-injected). In these instances, it w o u l d be beneficial to be able to pre-screen ES cell clones and to select only those capable of  Materials and Methods  65  differentiation for microinjection. This may be of particular importance w h e n using Cre /loxP site-directed recombination w h i c h requires going through an extra round of selection and thereby extending the time of an ES cell clone i n culture. The protocol used for the Teratocarcinomas  in vitro differentiation  is adapted from  Robertson,  and embryonic stem cells: a practical approach. 1987.  Embryonic  stem cells are induced to form simple embryoid bodies by the following  procedure.  The m e d i u m used throughout is D M E M supplemented w i t h either 5 or 10% F C S , 2 m M L-glutamine and I m M 2-mercaptoethanol. 1. G r o w ES cells on gelatinized dishes for one to two passages to remove /reduce the number of fibroblast feeder cells. Plate cells at high density as a single cell suspension (approximately 2 x 10 cells for a 6 cm plate or 6 x 10 for a 10 cm plate. 6  2.  6  Incubate cells for 2-3 days until they are approaching  boundaries between colonies have disappeared.  confluency  and  the  W a s h the cells w i t h PBS prior to  adding 1 m l .25% trypsin I m M E D T A for a 6 cm dish or 3 m l for a 10 cm dish. Gently rock the plate until 20- 30 % of the cells have flaked off the dish. neutralize the trypsin w i t h excess m e d i u m .  Immediately  Gently rock the dish to remove  the  majority of the flaking cells. 3. Use a wide bore pipette to transfer the cellular aggregates to bacteriological dishes at a 1/4 to 1/5 dilution. Great care must be taken not to break up the cell aggregates. A confluent  6cm dish w o u l d be dispensed to 4-5 equal sized bacteriological dishes.  Aggregates w h i c h are not diluted i n this way w i l l adhere to each other forming l o n g chains and result i n poor differentiation.  Materials and Methods  66  4. The majority of cell aggregates formed should not be able to adhere and w i l l m o l d into three-dimensional structures w i t h i n 24 hours.  Medium  should be changed  every two days by collecting the aggregates i n a conical, allowing them to settle, aspirating off the supernatant, resuspending i n fresh m e d i u m and transferring to new bacteriological dishes. After 48-72 hours, the majority of aggregates should have formed an endoderm layer and thus are called simple embryoid bodies. I have observed that G418 selected clones show great variation w i t h respect to the proportion of cell aggregates that f o r m embryoid bodies (Figure 2.1). For example, one clone may form two embryoid bodies out of a hundred aggregates whereas a second clone may form seventy embryoid bodies out of a hundred cell aggregates.  Clones w i t h l o w developmental potential  show many aggregates w h i c h seem never to initiate differentiation a n d / o r die i n suspension culture.  Materials and Methods  67  Figure 2.1 Embryoid body formation. (A) Confluent ES cells are gently lifted from the plate and placed in a bacterial dish for suspension culture. (B) After 36-48 hours post differentiation induction, most aggregates of the parental ES cell line will form simple embryoid bodies. This ability is variable among different clones and appears to dissipate with increasing passage, prior to differentiation.  Materials and Methods  68  Clones w i t h h i g h developmental potential have a h i g h percentage of cell aggregates form simple embryoid bodies w i t h w e l l defined endoderm and ectoderm and go on to form cystic embryoid bodies.  2.11  GlcNAc-TIII Enzyme Assays Tissues were homogenized by 20 strokes using a Dounce homogenizer w i t h 25  m M 2-(N-morpholino) ethanesulphonic Triton  X-100.  acid (MES) buffer p H 6.5 containing  GlcNAc-TIII was assayed  using  a synthetic  acceptor  1%  substrate,  G l c N Ac( pl-2) [6-O-methyl-Man] (al-6) {GlcNAc((3l-2) [4-O-methyl-Man] (ocl-3) }Man(3-0( C H ) C O O ( C H ) (Khan et al., 1994). This substrate cannot be acted on by G l c N A c - T I , 2  8  3  G l c N A c - T I I , G l c N A c - T I V nor G l c N A c - T V  and is a highly specific substrate for  GlcNAc-TIII. The assay was performed i n a total volume of 20 U.L containing 0.3 m M acceptor substrate, 62.5 m M G l c N A c (to inhibit N-acetylglucosaminidases), 3 m M A M P (to inhibit breakdown of U D P - [ H ] G l c N A c by pyrophosphatase), 10 m M MnC12, 3  0.125% Triton X-100, 0.1 M M E S p H 6.5, 1.25 m M U D P 10 m M M n C l , 0.125% Triton X 2  100, 0.1 M M E S p H 6.5, 1.25 m M U D P - [ H ] - G l c N A c (10,000 d p m / n m o l . ) and 2.5 u E 3  crude tissue homogenate.  After incubating the tubes at 37 °C for 2 h , the mixtures  were diluted w i t h 0.5 m L of water and loaded on to Sep-Pak C cartridges were washed w i t h water (40-60 mL) to remove  1 8  cartridges.  unreacted  The  radiolabeled  donor and buffer components. The bound radiolabeled product was eluted w i t h 3 m L of methanol and quantitated by liquid scintillation counting i n L K B 1209 Rackbeta instruments after addition of 15 m L of scintillation fluid.  Materials and Methods  2.12  69  E -PHA/L -PHA Lectin Blotting 4  4  Tissues from wild-type (+/+), heterozygous (+/A), and h o m o z y g o u s - n u l l ( A / A ) mice were homogenized as described above for the GlcNAc-TIII enzyme assays. T h e homogenates were made 0.1 N i n HC1 and heated at 80°C for 60 m i n . followed by neutralization w i t h dilute N a O H to remove terminal sialic acid and fucose residues w h i c h interfere w i t h E - P H A binding (Kobata and Yamashita, 1989, 1993). Aliquots (30 4  jug protein) were subjected to electrophoresis  i n 12% SDS-polyacrylamide m i n i g e l s  (Laemmli, 1970). Proteins were electrophoretically transferred to a P V D F membrane (Towbin et al., 1979) and the membranes were blocked w i t h 0.25% gelatin, 10% ethanolamine, 0.1 M Tris-HCI ( p H 9.0), for 60 m i n . (Olmsted, 1981). The membranes were incubated i n the absence of lectin or w i t h biotinylated lectins at 0.2 u.g/ml (either E -PHA, 4  Phaseolus vulgaris leukoagglutinin  or  L -PHA, 4  Phaseolus vulgaris  erythroagglutinin, Seikagaku, Japan) for 24 hrs at room temperature. Incubations a n d washes were conducted using the buffer system developed by Olmsted (Olmsted, 1981) (0.25% gelatin, 0.15 M NaCI, 5 m M E D T A , 0.05% Nonidet P-40, 0.05 M Tris-HCI ( p H 7.5)). B o u n d lectins and biotinylated molecular-mass standard proteins were detected using Vectastain ABC™ (Vector Labs). Peroxidase activity was visualized using the chemiluminescent ECL™ reagent (Amersham) and X-ray film (Kodak).  2.13  Hematology Mice were anaesthetized w i t h methoxyfluorane  Blood  was collected i n EDTA-coated polypropylene  and bled from the tail v e i n . tubes (Becton  Dickenson).  Materials and Methods A u t o m a t e d differentials were determined  70  by a C E L L - D Y N 3500 ( U C S D M e d i c a l  Center, Hillcrest). Blood cell morphology was visualized by preparing a blood film o n a slide.  After air drying, slides were immersed i n W r i g h t Giemsa stain (Sigma  Diagnostics) for one minute, placed i n phosphate buffer ( p H 7.2) for five  minutes,  rinsed i n deionized water. Smears were examined under o i l immersion.  2.14  Serum Chemistry Mice were anaesthetized w i t h 0.3 m L of 2.5% A v e r t i n , blood was d r a w n v i a a  heart puncture and allowed to clot for 30 minutes at room temperature. were subjected to centrifugation and supernatant was transferred  Samples  to a new  tube.  Serum was examined by a Kodak EktaChem700 Analyzer (UCSD M e d i c a l Center, Hillcrest).  2.15  Flow Cytometry Bone marrow cells were derived from femurs extracted from adult mice and  flushed w i t h 3 m L of fluorescence-activated cell scanner (FACS) buffer (2% fetal bovine serum i n phosphate buffered saline, PBS) using a 25 gauge needle. Splenocytes and thymocytes were harvested as single cell suspensions by mincing splenic and thymic tissue through fine wire-mesh screens respectively (Cooke et al., 1991). Cells were incubated w i t h antibody at a density 5 x 1 0 / m L i n a lOOmL total 6  volume. A l l incubations and washes were performed on ice w i t h F A C S buffer. F A C S analyses was carried out using a F A C S C A N F l o w Cytometer and C E L L Q u e s t  Materials and Methods Software (Becton Dickenson, Mountainview, C A ) . D u a l labeling was performed w i t h phycoerythrin (PE)-conjugated anti-CD4 antibody and fluoresceinated (FITC)conjugated anti-CD8 antibody (Becton Dickenson).  72  CHAPTER 3 Mgat3  C l o n i n g and the G e n e r a t i o n of a Mgat3 in E m b r y o n i c Stem Cells  Mutation  3.1 Introduction GlcNAc-TIII adds the bisecting G l c N A c to the (31,4 linked mannose of the tri-mannose core (Narasimhan, 1982). A s the presence of this residue alters the conformation of other core sugars and blocks the ability of other transferases  to  initiate subsequent branches (Brisson and Carver, 1983; Schachter, 1991), it may play a key regulatory role i n N-glycan biosythesis. A t present the biological significance of this modification is u n k n o w n . The cloning of the rat c D N A coding for G l c N A c TIII (Mgat3) allows genetic approaches towards investigating the in vivo roles of this enzyme (Nishikawa et al., 1992).  Conventional gene targeting techniques result i n  a systemic genetic lesion. Such a deficit may result i n embryonic lethality a n d / o r complex pleiotropic effects, w h i c h can preclude the study of postdevelopment gene function.  Furthermore, observed phenotypes can be difficult to discern whether  they originated from defects in the affected cell or i n the affected cell's e n v i r o n m e n t . To maximize the utility of our work, we employed the Cre/loxP r e c o m b i n a t i o n system to generate an Mgat3 mutation. This system enables one to selectively delete the gene of interest only i n cells where the Cre recombinase is applied. Successful employment of the Cre /loxP system requires one to choose a suitable exon(s) w h i c h w h e n deleted w i l l create a n u l l mutation.  Therefore, it is  desirable to either flank a 5' exon that when excised disrupts the reading frame or a n exon coding for a critical d o m a i n of the protein. A d d i t i o n a l l y , for the c o n d i t i o n a l  73  mutation, it is crucial that the placement of the loxP sequences do not interfere w i t h the normal expression of the gene. After screening a 129 S v / J genomic library, two phage isolates were cloned into Bluescript and subjected to restriction enzyme  mapping.  In addition to  confirming the identity of the hybridizing element, sequence analyses revealed that the entire protein encoding sequence of Mgat3 was enclosed i n a single exon.  To  generate the Mgat3 mutation, we designed a targeting vector w h i c h flanked the single protein encoding exon w i t h transfected  loxP signals.  w i t h the Cre recombinase  Gene-targeted  and selected w i t h  clones  ganciclovir.  were Clones  heterozygous for the mutation were isolated and shown to exhibit approximately 50% of wild-type GlcNAc-TIII activity.  3.2  Results  3.2.1 Genomic Library Screening with a Rat cDNA probe The first step towards making a mutation i n the mouse Mgat3 gene was to create a probe that w o u l d be highly specific. T w o primers based on the rat Mgat3 c D N A were designed to amplify a 1.5 kilobase fragment harbouring greater than 90% of the protein encoding sequence.  To enhance probe specificity, the short leader and  transmembrane domain sequences were not included i n the amplified region. U s i n g P C R and rat genomic D N A as a template, the product was amplified, purified, cloned into p U C 1 9 and verified by restriction enzyme analyses. The fact that it was possible to amplify the predicted size fragment from rat genomic D N A strongly suggested that Mgat3 protein coding sequence was contained w i t h i n a single exon. The insert was  74  liberated from the plasmid via Eco R I / Bam H I (in polylinker) digestion , P-labeled 32  and used as a probe to screen a 129Sv/J genomic library. A m o n g 300,000 plaques, two phage clones were found to hybridize to the probe w i t h h i g h stringency. purification,  phage D N A was prepared, digested w i t h Not  I and  Following  cloned  into  Bluescript and subjected to restriction enzyme analyses. The two clones called ST-13 and ST-20, approximately 16 and 17 kilobases i n size respectively, were s h o w n to overlap and each possessed a single 1.8 kilobase Bam H I fragment  w h i c h cross-  hybridized w i t h the rat probe.  3.2.2 Mgat3 Genomic Insert is in the Germline Configuration Southern analyses of the resulting plasmids revealed that a single 1.8 kilobase Bam H I band hybridized to the rat c D N A probe (Figure 3.1). To identify the m o u s e Mgat3 coding sequence, the fragment  was subcloned into pUC19 and  analyses was initiated using M13 primers.  sequence  The sequence not only confirmed  the  presence of Mgat3 coding D N A but also detected the translational start (ATG) and stop (TAG) signals of the gene (Figure 3.2). In view of the fact that our objective was to use the Mgat3 genomic D N A for construction of a targeting vector, it was necessary to confirm that the insert was i n the germline state. Either the assembly of the phage library or replication and maintenance i n E.coli can result i n deletions and rearrangements of the exogenous serious inhibitory consequences  DNA.  Since such modifications could  on the frequency of homologous  have  recombination  events i n ES cells, it was essential to verify the condition of plasmid-derived Mgat3  75 genomic D N A .  The status of this £. co/f-propagated  D N A was determined  digesting ES cell and plasmid-derived genomic D N A w i t h restriction enzymes  by and  Southern blotting.  G e r m l i n e Configuration  P h a g e Insert  129 G e n o m i c D N A  Figure 3 . 1 . Mgat3 insert is in the germline c o n f i g u r a t i o n . Analyses by Southern blot were used to determine that the isolated phage insert was in the expected 129 configuration. Plasmid and ES cell DNAs were cut with restriction enzymes and hybridized with P - l a b e l e d Mgat3 coding sequence. Both DNAs revealed an identical banding pattern suggesting that the phage insert was in the native configuration. 32  76 C o m p a r i s o n of the banding pattern of these two D N A s after probing w i t h labeled Mgat3 D N A authenticated the germline configuration of the cloned D N A (Fig. 3.1).  is Highly Conserved and Has a Single Protein-Encoding  3.2.3 Mgat3  Exon Since the M13-primed sequencing runs yielded only approximately 400 base pairs of sequence from either end, additional primers for internal sequencing were synthesized.  These  oligonucleotides  were  used  for  priming  at  intervals  approximately every 300 base pairs, on both D N A strands.  1 21 41 61 81 101 121 141 161 181  5 ' -GGATCCTCGGGCTGCTCTCCCTGACTTCTTGTTCTCTCCATCTCCTGCAGG  51  M K M R R Y K L F L M F C M A G L C L I ATGAAGATGAGACGCTACAAGCTCTTTCTCATGTTCTGTATGGCTGGCCTGTGCCTCATA  111  S F L H F F K T L S Y V T F P R E L A S TCCTTCCTGCACTTCTTTAAGACCTTATCCTATGTCACCTTCCCGAGAGAACTGGCCTCC  171  L S P N L V S S F F W N N A P V T P Q A CTCAGCCCTAACCTCGTATCCAGCTTCTTCTGGAACAATGCCCCTGTCACTCCCCAGGCC  231  S P E P G G P D L L R T P L Y S H S P L AGTCCGGAGCCGGGTGGCCCCGACCTATTGCGGACACCCCTCTACTCCCACTCTCCCCTG  291  L Q P L S P S K A T E E L H R V D F V L CTCCAGCCACTGTCCCCGAGCAAGGCCACAGAGGAACTGCACCGGGTGGACTTCGTGTTG  351  P E D T T E Y F V R T K A G G V C F K P CCGGAGGACACCACGGAGTATTTTGTGCGCACCAAAGCTGGTGGTGTGTGCTTCAAACCA  411  G T R M L E K P S P G R T E E K P E V S GGTACCAGGATGCTGGAGAAACCTTCGCCAGGGCGGACAGAGGAGAAGCCCGAAGTGTCT  471  E G S S A R G P A R R P M R H V L S T R GAGGGCTCCTCAGCCCGGGGACCTGCTCGGAGGCCCATGAGGCACGTGTTGAGTACGCGG  531  E R L G S R G T R R K W V E C V C L P G GAGCGCCTGGGCAGCCGGGGCACTAGGCGCAAGTGGGTTGAGTGTGTGTGCCTGCCAGGC  591  W H G P S C G V P T V V Q Y S N L P T K TGGCACGGGCCCAGTTGCGGGGTGCCCACGGTGGTGCAGTATTCCAACCTGCCCACCAAG  651  77 201  E  R  L  V  P  R  E  V  P  R  R  V  I  N  A  I  N  I  N  H  GAACGCCTGGTACCCAGGGAGGTACCGAGGCGGGTTATCAACGCCATCAACATCAACCAC 221  E  F  D  L  L  D  V  R  F  H  E  L  G  D  V  V  D  A  F  V  GAGTTCGACCTGCTGGATGTGCGCTTCCATGAGCTGGGAGATGTTGTGGACGCCTTCGTG 241  V  C  E  S  N  F  T  A  Y  G  E  P  R  P  L  K  F  R  E  L  T  N  G  T  F  E  Y  I  R  H  K  V  L  Y  V  F  L  D  F  P  P  G  G  R  Q  D  G  W  I  A  D  D  Y  L  R  T  F  T  Q  D  G  V  S  R  L  R  N-  L  R  P  D  D  V  F  I  D  A  D  E  I  P  A  R  D  G  V  L  F  L  K  L  Y  D  G  T  E  P  F  A  F  H  M  R  K  S  L  Y  G  F  F  W  K  Q  G  T  L  E  V  V  S  G  C  T  M  D  M  L  Q  A  V  Y  G  D  G  I  R  L  R  R  R  Q  Y  Y  T  M  P  N  F  R  Q  Y  N  R  T  G  H  I  L  V  Q  W  S  L  G  S  P  L  H  F  A  W  H  C  S  W  C  F  T  P  E  G  I  Y  F  K  L  V  S  A  N  G  D  F  P  R  W  G  D  Y  E  D  K  R  D  L  N  Y  I  S  L  I  R  T  G  G  W  F  D  G  T  Q  Q  E  Y  P  P  A  P  S  E  H  M  Y  A  P  K  Y  L  L  K  N  Y  D  Q  F  R  L  L  E  N  P  Y  R  E  P  K  S  T  V  E  G  G  R  Q  N  G  S  D  G  R  P  S  A  V  R  G  K  L  D  T  V  E  G  1551  Q  TTGCTGGAAAATCCCTACCGGGAGCCCAAGAGCACTGTAGAGGGTGGGCGCCAGAACCAG 521  1491  Y  CCCAGTGAGCACATGTATGCTCCTAAATACCTGCTCAAGAACTATGACCAGTTCCGCTAC 501  1431  D  AGCTTGATCCGCACTGGGGGATGGTTCGACGGAACGCAGCAGGAGTACCCTCCTGCGGAC 481  1371  R  AATGGCGACTTCCCCCGCTGGGGTGACTATGAGGACAAGAGGGACCTCAATTACATCCGC 461  1311  Q  TGGCATTGCTCCTGGTGCTTCACACCCGAGGGCATCTACTTTAAACTCGTGTCAGCCCAG 441  1251  G  AACCGCACCGGCCACATCCTAGTGCAGTGGTCTCTCGGCAGCCCCCTGCACTTCGCGGGC 421  1191  E  GATGGCATCCGCCTGCGCCGCCGCCAGTACTACACCATGCCCAACTTCCGGCAGTATGAG 401  1131  L  GGCACACTGGAGGTGGTGTCAGGCTGCACCATGGACATGCTGCAGGCCGTGTATGGGCTG 381  1071  P  ACAGAGCCCTTCGCCTTCCACATGCGGAAGTCCCTGTATGGTTTCTTCTGGAAGCAGCCG 361  1011  W  GATGCGGACGAGATCCCTGCGCGTGATGGTGTGCTGTTCCTCAAACTCTACGATGGCTGG 341  951  I D  ACCCAGGATGGCGTCTCCCGCCTGCGCAACCTGCGGCCCGATGACGTCTTTATCATCGAC 321  891  L  TTCCCACCTGGTGGCCGTCAGGACGGCTGGATTGCGGATGACTACCTGCGCACCTTCCTC 301  831  H  CTGACCAATGGCACCTTCGAGTACATCCGCCACAAGGTGCTCTATGTCTTCCTGGACCAT 281  771  M  GTCTGTGAATCTAATTTCACCGCCTACGGGGAGCCTCGGCCGCTCAAGTTCCGAGAGATG 261  711  1611  *  GGCTCAGATGGAAGGCCATCTGCTGTCAGGGGCAAGTTGGATACAGTGGAGGGCTAGGGC  1668  TGTGCACTTTCACAGGGCTGGGTAGGCTGAAATAATGGCTAAGCCAGTGCTATCTTAGGC  1728  CTCCTCCTTATCCCGGG GCACTTGAGAGAGCCAGGATCC-3'  1771  Figure 3.2. Nucleotide and amino acid sequence of the mouse Mgat3 gene. Single letter symbols are used for the amino acid sequence. The Bam HI sites used to clone the fragment are underlined while the initiating methionine is in bold. The Sma I site used to build the targeting vector is italicized.  78  Previous work has shown that Mgat3 is highly conserved and exists i n the mammalian genome as a single allelic copy (Nishikawa et al., 1992; Ihara et al., 1993). The early indication that the protein encoding sequence was contained w i t h i n a single exon proved to be correct. D N A sequencing revealed that the mouse Mgat3 gene (Genbank: U66844) we cloned encodes an uninterrupted  538 amino  GlcNAc-TIII and displays greater than 90% identity to the rat and h u m a n  acid  homologs  (Figure 3.3). Furthermore, the mouse gene w o u l d be expected to have an additional 2 amino acids i n comparison w i t h the rat since translation by eukaryotic ribosomes would  be expected  to initiate  at the  first 5' A U G i n the  sequence  context  . . . A N N A U G N . . . . Unexpectedly, comparisons between Mgat3 isolated here and that published (Bhaumik et al., 1995) revealed 21 nucleotide differences that generates 7 amino acid changes between the two mouse sequences.  79  mouse rat human mouse rat human mouse rat human mouse rat human mouse rat human mouse rat human mouse rat human  1 I D * 80 MKMRRYKLFL MFCMAGLCLI SFLHFFKTLS YVTFPRELAS LSPNLVSSFF WNNAPVTPQA SPEPGGPDLL RTPLYSHSPL I. . . D 81  161  241  T * * S 160 LQPLSPSKAT EELHRVDFVL PEDTTEYFVR TKAGGVCFKP GTRMLEKPSP GRTEEKPEVS EGSSARGPAR RPMRHVLSTR TK.A . . . .V A. ....P. ...A L K...R.P. ..P GAN... .. ..P.YL..A. ERLGSRGTRR KWVECVCLPG . . . .G ..T.G..A  * 240 WHGPSCGVPT WQYSNLPTK ERLVPREVPR RVINAININH EFDLLDVRFH ELGDWDAFV V  D * 320 VCESNFTAYG EPRPLKFREM LTNGTFEYIR HKVLYVFLDH FPPGGRQDGW IADDYLRTFL TQDGVSRLRN LRPDDVFIID  321* * * DADE I PAR DG VLFLKLYDGW TEPFAFHMRK SLYGFFWKQP GTLEWSGCT MDMLQAVYGL DGIRLRRRQY I T V  400 YTMPNFRQYE  401  * * * * NRTGHILVQW SLGSPLHFAG WHCSWCFTPE GIYFKLVSAQ NGDFPRWGDY EDKRDLNYIR SLIRTGGWFD  480 GTQQEYPPAD  481  * PSEHMYAPKY  G S A 538 LLKNYDQFRY LLENPYREPK STVEGGRQNQ GSDGRPSAVR GKLDTVEG R S T.. R.H. . .D. . .Q. .R . . AA. . WRHR .PE...P.-R ...-EA.V  Figure 3.3. Comparison of putative mouse, rat, and human G l c N A c - T I I I sequences. Identities between mouse and rat or human amino acids are denoted (.). Gaps are present in the human sequence (-). Differences between the mouse GlcNAc-TIII sequence displayed here and that published (Bhaumik et al., 1995) are indicated as amino acid changes or silent substitutions (*) above the mouse sequence.  3.2.4  Chromosomal Localization of Mouse Mgat3 To derive a probe, the 16 kilobase mouse genomic insert, ST-13 (from above),  was released from Bluescript via Not I digestion and purified by agarose gel electrophoresis. W i t h the probe isolated, fluorescence in situ hybridization (FISH) to normal mouse chromosomes was undertaken. Regional assignment of Mgat3 to mouse chromosome 15 at position E l l was determined following analyses of 20 w e l l spread metaphases as presented i n Figure 3.4A.  A  80  * • 41  •  Figure 3.4. Regional chromosomal localization of the Mgat3 gene by fluorescence in situ hybridization. (A) A representative metaphase preparation is shown in which Mgat3 probe hybridization was detected on both homologues of chromosome 1 5 as described in Materials and methods. (B) Double color FISH showing DIG-labeled Mgat3 detected with FITC-avidin (yellow, as in A) and biotinylated chromosome 1 5 marker probe (med/ScnSa) detected with rhodamine-anti-DIG (red) as described in Chapter 2. Mgat3 is localized adjacent and telomeric to med/Scn8a.  81  Positive hybridization signals were noted i n all 20  metaphases and were v i s u a l i z e d  on both homologs i n 85% of these metaphase spreads (17/20). A l t h o u g h the signal was distinctly visualized, some background hybridization was observed, perhaps as a result of repetitive sequence present w i t h i n the 16 kilobase genomic Mgat3 probe. Chromosome  assignment  was initially  determined  by banding  karyotype (see  Chapter 2) and confirmed by a chromosome 15-specific probe m e d /Scn8a that maps to 15F1 (See Figure 3.4B).  3.2.5  Brain and Kidney Show Highest Levels of Expression Among Normal Tissues Examined Normal  expression  of Mgat3 R N A among  various  mouse  tissues was  determined using a mouse 1.8 kilobase Mgat3 probe containing the entire G l c N A c TIII coding sequence.  Results indicated that highest steady-state R N A expression  levels occur i n brain and kidney, followed by colon, small intestine, lung, thymus, stomach, and ovary (Figure 3.5). The size of the transcript is about 4.8 kilobases, o n l y slightly larger than the 28S ribosomal R N A . This expression pattern is consistent w i t h the results of similar studies o n various tissue samples ( N i s h i k a w a et al, 1992; B h a u m i k et al, 1995). Tissues that demonstrate Mgat3 expression and that conserve this expression i n phylogeny may require GlcNAc-TIII during development and i n n o r m a l function.  82  ^28S <18S  Figure 5. Expression of Mgat3 RNA among normal mouse t i s s u e s . Five micrograms of total cellular RNA was analyzed from each tissue sample. A 1.8 kilobase Bam HI Mgat3 genomic fragment containing the entire GlcNAc-TIII protein-encoding region was used as a probe. The bottom panel represents the ethidium-stained profile of RNA levels analyzed.  3.2.6  The pflox Vector Due to the possible pleiotropic nature of effects resulting from the loss of the  gene, the C r e / l o x P recombination system was employed for Mgat3 mutagenesis. This recombination  system enables one to create a conditional mutation: the m u t a t i o n  only occurs i n the presence of the Cre protein.  W o r k i n g towards such a goal, o u r  laboratory produced a new vector, pflox, w h i c h bears three different cloning sites for  83  the integration of adjacent pieces of genomic D N A , only one of w h i c h is flanked by loxP sites. After pflox construction, the fidelity of the loxP sites was investigated by D N A sequencing.  The data confirmed the presence of the three intact loxP sites as  well as sequences necessary for detecting homologous recombination by P C R (Figure 3.6).  pflox Vector  B  N t  X b \  i A  iK  #  l  r  neo  M  r  %  B X i . i i  N t /  Xba I  GTCGAAC TCTAGA GGATCAGCTTGGGCTGCAGGTCGAGGGACCTA GCATACATTATACGAAGTTATATT  ATAACTTCGTATA  AAGGGTTCCGGATCGAGCAGTGTGGTTTTGCA  C TA  ATAACTTCGTATAGCATACATTATACGAAGTTAT  GGAGCTTGGGCTGCAGGTCGAGGGACCTA  ATTAAGGGTTCC  Bam HI GGAICCCC  ATAACTTCGTATAGCATACATTATACGA  AGTTATATT  AAGGGTTCCGGATCGATCCCCGGGCGAGCTCGAATTGATCCCCGGGTAC Xho I CGGGCCCCCC CJCGAG GTCG  Figure 6. The pflox vector.  (A) Diagram of the pflox vector. The unique cloning sites are B: Bam HI, X: Xba I, X: Xho I. The large arrowheads represent the loxP sites (not drawn to scale)and the small half arrow indicates the position of the vector-based primer (tk303) used for PCR detection of homologous recombination. The finished targeted vector can be liberated from the plasmid via the flanking Not I (Nt) sites. Sequencing results shown in (B) and (C) indicate that the loxP sites (dark full arrow) in pflox vector are intact. The light half arrow shows the complementary sequence of primer tk303.  84  U s i n g the pflox backbone for gene targeting, homologous recombination places two selectable markers, thymidine kinase (tk) and neomycin  phosphotransferase  (neo), flanked by loxP signals into the genomic locus. The new allele n o w serves as a substrate for Cre-mediated  deletion  yielding two possible recombinants  when  ganciclovir selection is applied (Cells bearing the tk gene are selected against by the drug ganciclovir). The Type 1 deletion, the systemic mutation, ensues from the recombination between the two outermost loxP sites whereas the Type 2 deletion results i n an allele w i t h the exon being flanked by loxP sequence.  Taking into  account that promoter elements from selectable markers have been k n o w n to alter gene expression of adjacent genes, the Type 2 event, w h i c h has the neo and tk genes removed, is used for the conditional mutation.  The vector also contains flanking  Not I sites w h i c h allows for removal of plasmid sequence prior to transfection.  3.2.7  Construction of the Mgat3 Targeting Vector F r o m a phage 129/SvJ mouse genomic library, an Mgat3 containing clone was  used to generate a targeting vector as follows (also see Figure 3.7). A 1.8 kilobase Bam HI/Sma I fragment w h i c h contained the single Mgat3 protein coding exon was cloned into the Bam H I site of the pflox vector.  The flanking 2.0 kilobase Bam H I  fragment and an 8.5 kilobase Sma I fragment were subsequently cloned into the Xba I and Xho I sites of pflox, respectively. The loxP signals contain an " A T G " w h e n read in the direction of the arrowhead (see Figure 1.7), therefore, the insertion of Mgat3 was purposely directed to be i n the opposite orientation so as to not introduce an  85 upstream translational start signal. This is important for the conditional mutation as upstream " A T G " s have been shown to reduce translation efficiency (Kozak, 1991).  Genomic Clone 129/SvJ Xb  pflox Vector  Figure 3.7.  A  BAX  i—i  tk neo  Mouse Mgat3  1 kb  - PCR Primers  g e n o m i c structure and targeting vector p r o d u c t i o n .  The  mouse genomic Mgat3 gene as isolated is shown with restriction enzyme sites mapped (open arrow depicts position and transcriptional orientation of GlcNAc-TIII protein-encoding sequence). The pflox vector was used as depicted to generate an Mgat3 targeting vector and contains two selectable markers tk and neo (shaded and black arrow, respectively). 34 basepair loxP sites (not to scale) are depicted as black arrowheads. Restriction enzyme sites: A, Apa I; B, Bam HI; K, Kpn I; N, Nde I; No, Not I; S, Sma I.  The finished targeting vector was digested w i t h Not I and purified by agarose gel electrophoresis. Subsequently, the " R l " ES cell line (Nagy et al, 1993) was transfected by electroporation w i t h the isolated vector (see Chapter 2 for Methods). Cells were transferred to plates coated w i t h gelatin and selected w i t h G418 (Life Technologies, G r a n d Island, N Y ) .  3.2.8  PCR Detection of Homologous Recombination Homologous  recombinants  were detected by P C R utilizing  one  internal  primer, Tk303, and an external primer, GnTIII, w h i c h resides outside the targeted sequence. E m p l o y i n g a control vector that had been transfected into ES cells, the P C R reaction was first optimized using buffers w i t h varying p H and M g  2 +  concentrations  86  (Invitrogen). The sensitivity of this assay was determined by m i x i n g transfected cells w i t h parental cells.  Amplification of a 2.0 kilobase fragment was diagnostic of a  positive result. Ten days following the electroporation, ES cell colonies were picked and D N A was prepared for P C R (See Chapter 2). Pools of twelve clones each were screened by P C R . Each of the ten positive pools was shown to harbour a single positive clone. Ten positive clones were detected out of 384 G418 resistant clones screened (See Figure 3.8). Each of these clones was expanded for cryopreservation and large scale  2C12  2C11  2C10  2C8  2C9  2C6  2C7  2C5  2C3  2C4  2C2  2C1  D N A preparation.  l  <-2kb  ttgf  m m 2F12  2F11  2F10  2F9  2F8  2F7  2F5  2F6  2F4  2F3  2F1  2F2  •  i W  m  •  <2kb  m f  I  Figure 3.8. PCR detection of homologous recombination. DNA from clones of positive pools was prepared and subjected to PCR, with primers Tk303 and GnTIII, for the identification of positive clones. Products were run out on a 1% agarose gel, stained with ethidium bromide and photographed. Two positive clones, 2C9 and 2F7, were expanded for Southern analyses.  87  3.2.9  Confirmation of Homologous Recombination by Southern Blotting After D N A preparation, putative targeted clones were analyzed by S o u t h e r n  blotting. Selected restriction digests resulted i n distinct bands being observed for the w i l d type and targeted alleles (see Figure 3.9). The genomic element used for probing the blots resided outside the targeted sequences, resulting i n easy d i s c r i m i n a t i o n between random integration and homologous recombination events.  Furthermore,  an internal probe was used to check for the presence of multiple integration events (data not shown). Eight PCR-positive clones were shown to have recombination by Southern analyses.  undergone  homologous  In each case, one Mgat3 allele exhibited the  expected structural alteration (Mgat3  ) i n comparison to germline  mkneo1  129 D N A  (Figure 3.9B and data not shown). Hybridization w i t h the Mgat3 probe suggested that the G418-resistant clones arose from a single copy of the vector.  88  A  genomic probe  Mgat3WT-129  Targeting Vector  N  K  i  i  Mgat3 B  B A S B N -lr—J—>l—L  (B) A ( S ) A B N L—•—^J-U l_  neo  B  & & # && e # Mga13 [ °] MgatSWTF tkne  129  genomic probe/Nde I Digest  Figure 3.9.  Southern confirmation of homologous recombination.  (A) Homologous recombination with the wild-type (WT) Mgat3 allele in embryonic stem (ES) cells generated the /Wgaf3 ° allele. The position of the probe used to determine homologous recombination of targeted Mgat3 allelic structure is depicted. (B) Homologous recombination at the Mgat3 locus in embryonic stem (ES) cells. PCR positive clones were analyzed by Southern blot. The presence of a targeted Mgat3 allele is observed by Southern blot analyses in seven G 4 1 8 resistant PCR-positive E S cell clones, and in comparison to wild-type 129 DNA. These studies revealed that each clone had one wild type band (8.5 kilobase band) plus an additional 1 2 kilobase band, expected for a homologous recombinant. Restriction enzyme sites: A, Apa I; B, Bam HI; K, Kpn II; N, Nde I; S, Sma I. The bold line in A indicates sequence common to the Mgat3 targeting vector. F[,kne  l  89 3.2.10  Three  of  Eight  Recombinants  Retained  All  Three  loxP  sites  After homologous recombination had been substantiated, it was imperative to determine if all three loxP sites had been maintained, since they were required for producing the systemic and conditional Mgat3 information,  mutations.  To ascertain  this  ES cell D N A was digested w i t h Apa I and analyzed by S o u t h e r n  blotting. Hybridization w i t h a loxP probe allowed for the visualization of each loxP site as a discrete band. <P  s£>  rr> <A x£ <~v>  <?>  0^  12 — 5' loxP site  Internal loxP site  < - 3' loxP site 1 loxPprobe/Apa  I Digest  Figure 3 . 1 0 . Structure and presence of loxP sites. DNA from homologous recombinant ES cell clones was digested with Apa I and analyzed by Southern. Use of a loxPspecific probe indicates that two of seven Mgaretargeted clones retain all three loxP sites. Five of eight clones examined i n this way d i d not contain the 3' loxP site (Figure 3.10 and data not shown), likely the result of homologous recombination w i t h i n the loxP flanked genomic Mgat3 sequence.  Subsequently, clone 1H8 w h i c h preserved all of  the Cre recombination signals was used for deriving the Mgat3 mutation.  90  3.2.11 Transient Cre Transfection in Embryonic Stem Cells Results in Two Types of Recombination The targeted Mgat3 allele (Figure 3.12A, Mgat3  ) was then a substrate for  FItkneo1  Cre recombinase  activity i n producing two types of recombined  Mgat3 alleles.  Recombination between distal loxP sites generated a n u l l allele (Mgat3 ) by deletion A  of a l l intervening D N A , while recombination between loxP sites flanking the tk and neo cistrons generated a conditional mutation (Mgat3 ) w i t h loxP sites flanking the F  GlcNAc-TIII  protein  encoding  sequence  (Figure  3.12A).  This  presumptive  conditional mutation achieved i n ES cells w o u l d then allow the production of mice bearing a functional Mgat3 allele that could be deleted by transgenic Cre recombinase expression; this is significant because inactivation of both Mgat3 alleles might lead to multi-systemic phenotypes and early developmental lethality i n mice ( M a r t h , 1996). Pro • Lys • Lys• Lys • Arg• Lys A/al r- ACCATG CCCAAGAAGAAGAGGAAGGTG TKpr pMC-Cre  Cre  pA 1 Z J  Figure 3 . 1 1 . The PMC-Cre expression vector. The plasmid was a gift from Klaus Rajewsky (University of Cologne). To increase the efficiency of translation in mammalian cells, Cre has an adenine placed at the -3 position. Additionally, the Cre gene in the pMC-Cre vector has been further modified with the addition of a nuclear localization signal from SV40 large T antigen (Gu et al., 1994b). To produce ES cell subclones that contained the Type I (systemic-null) and Type II (conditional-null) Mgat3 mutations, ES clone 1H8 was subjected to transient Cre expression by electroporation of p M C - C r e (Figure 3.11) and subsequent selection in the presence of ganciclovir. Subclones resistant to ganciclovir were isolated and analyzed by genomic Southern blotting.  91  loxP probe  genomic probe  Mgat3 probe  •12kbMgat3 Fpkneo] A  N K I I  B J_  (B)A(S)ABN  A  4tk  S  neo Mgat3  +Cre +Ganciclovir Mgat3  A  Type 2 Deletion  ^_Mgat3F [tkneo]  1  2  ^  ^-Mgat3  F  ^Mgat3  A  /oxPprobe/Nde I Digest  Mgat3 [' °] Mgat3F Mgat3WT-l29 Mgal3 F  kne  A  genomic probe/Nde I Digest  Figure 3 . 1 2 . Cre-mediated recombination in embryonic stem c e l l s . (A) The Mgat3 " allele is used as a substrate for subsequent recombination by Cre recombinase. m  eo]  Using the 1H8 /Wgaf3-targeted ES clone, Cre recombination and ganciclovir selection results in two types of recombination events with subclone 1 exhibiting a Type II recombination and subclones 2-4 bearing a Type I deletion. In each allele, the size of fragments detected by the genomic probe are noted in light gray and flanked by arrows. The Type II deletion produces a genomic fragment similar in size to the wild-type allele (C) but which bears two loxP sites where the wild-type allele does not (B). As compared to wild type, the decrease in size of the Type I band (B & C) corresponds to the loss of Mgat3 coding sequence. Five micrograms of ES cell DNA was analyzed in the above studies. Restriction enzyme sites: A, Apa I; B, Bam HI; K, Kpn I; N, Nde I; S, Sma I. The bold line indicates sequence common to the Mgat3 targeting vector.  92 U s i n g a loxP or genomic probe, sixteen of eighteen  ganciclovir resistant clones  screened were found to have undergone a Type I recombination while the remaining two exhibited the Type II deletion. (Figure 3.12B & C and data not shown), confirming that the targeted Mgat3 allele exhibited the expected structure f o l l o w i n g Cre recombination. The loxP flanked D N A is presumably lost from the cell as it does not contain sequence required for replication and maintenance.  3.2.12 The Mgat3 Mutation in Embryonic Stem Cells is Associated with a Loss in GlcNAc-TIII Activity R l parental ES cells and 1H8 subclones 1 and 2 were analyzed for G l c N A c - T I I I activity in vitro. Comparison of GlcNAc-TIII enzyme activities among extracts of R l ES cells {Mgat3  ), Type I clones (Mgat3  WTmT  ), and Type II clones (Mgat3  WT/A  100%, 37%, and 97% respectively (data not shown). heterozygous  ) yielded  WT/F  The observation  that the  ES cells displayed an approximate 50% loss i n GlcNAc-TIII activity  strongly suggested that there was a single gene associated w i t h this function, at least in the ES cell.  Moreover, the Type II clones closely resembled the parental R l cells i n  GlcNAc-TIII activity, thereby, i m p l y i n g that the loxP sequences are not inhibitory for transcription or translation.  Following these results and cells, w e initiated the  production of mice bearing this n u l l mutation i n the Mgat3 gene, using these cells.  93  3.2.13 The Generation of Chimaeric Animals and the Transmission of the Mutated Allele From the twenty C 5 7 B L / 6 blastocysts injected w i t h the ES cell 1H8 subclone #2 and implanted, nine male agouti mice were produced. The maleness and agouti coat color were indicators of strong chimerism as the R l ES cells are male and confer agouti color. Chimaeric mice were generated initially from Type I (Mgat3 /Mgat3 ) WT  cells to determine  whether  systemic loss of Mgat3 function  would  A  produce  phenotypic results indicating a developmental role for the bisecting G l c N A c i n Nglycans. A m o n g matings w i t h C57BL/6 females, six of the nine chimaeric a n i m a l s transmitted the ES cell genotype to its offspring as judged by agouti coat color.  Tail  DNA  they  was isolated from agouti animals  inherited the w i l d type or Mgat3 allele. A  and used to determine  whether  Mice heterozygous for Mgat3 appeared  normal and were intercrossed to generate embryos and mice that were h o m o z y g o u s for the Mgat3 allele. A  A l l genotypes were determined by Southern  blotting of  genomic D N A derived from tail samples.  3.3  Discussion A s the initial step i n creating a Mgat3 mutation, a 129Sv/J mouse  liver  genomic library was screened w i t h a rat c D N A probe to identify GlcNAc-TIII coding sequence. After the cloning of Mgat3 hybridizing elements and Southern analyses, a single 1.8 kilobase Bam H I fragment was identified to contain the entire p r o t e i n encoding sequence.  Interestingly, Mgatl and Mgat2 harbour their protein encoding  94 sequence w i t h i n a single exon as w e l l (Pownall et al, 1992; C a m p b e l l and M a r t h , unpublished observations). Sequence analyses of both strands revealed the presence of a 1614 base pair open reading frame coding for a 538 amino acid protein w h i c h displays 97.8 % a n d 92.2 % identity w i t h the rat and h u m a n homologs, respectively. A s compared w i t h the previously reported rat protein, Figure 3.3 presents the mouse protein w i t h a n extra t w o amino acids since translation b y eukaryotic ribosomes w o u l d be expected to initiate virtually 100% of the time at the first 5' A U G i n the sequence context . . A N N A U G N . . . Interestingly, these two codons are conserved between a l l three homologs. A l t h o u g h initiation of translation i n the mouse may w e l l provide t w o additional amino acids (M-K-) at the N-terminus (Figure 3.3 and B h a u m i k et al., 1995), this addition may not occur as frequently i n the rat as the first 5' A U G identified is not i n a sequence context that w o u l d be recognized at h i g h frequency by eukaryotic ribosomes (a pyrimidine is present at position -3, Kozak, 1991). Whether a similar situation exists i n h u m a n MGAT3 GlcNAc-TIII is not clear at present as the reported 5' nucleotide sequence does not extend sufficiently into that region (Ihara et al., 1993). Unexpectedly, additional comparisons between the Mgat3 isolated h e r e i n and that published revealed 21 nucleotide differences that generate 7 amino acid changes between the two mouse sequences.  Interestingly, i n a l l but three instances  (positions 159, 243 and 536), the amino acid differences between the two m o u s e sequences nevertheless maintain identity w i t h either the rat or h u m a n G l c N A c - T I I I sequences. This result was quite unexpected since both sequences were derived f r o m a 129 mouse genomic library, so these changes may reflect divergence between Mgat3  95 sequences w i t h i n this outbred mouse strain.  Previous chromosomal localization  studies of mouse and human homologues (Ihara et al, 1993; Bhaumik et ah, 1995) are fully consistent w i t h this study w h i c h maps the Mgat3 gene to mouse c h r o m o s o m e 15 at E l l i n a region likely syntenic w i t h the h u m a n  genome  and h o m o l o g at  chromosome 22q.l3.1. The Mgat3 expression profile at the R N A level is conserved among m u l t i p l e vertebrate cell types w i t h high levels present i n kidney of mouse and rat (Figure 3.5; N i s h i k a w a et al., 1992; B h a u m i k et al, 1995). Additionally, Mgat3 expression was also found at h i g h levels i n mouse brain, and to a lesser amount i n other m o u s e tissues surveyed herein and previously. Like some other glycosyltransferases cloned and characterized to date (Schachter, 1994), the putative GlcNAc-TIII amino acid sequence exists uninterrupted b y introns and w i t h i n an R N A transcript m u c h larger than necessary to encode the enzyme. It is possible that 5' and 3' Mgat3 untranslated sequences may reside i n other exons and may play some role yet to be disclosed i n enzyme production, although regulation of Mgat3 expression and function may be completely  accomplished  by mechanisms  involving  transcriptional  intracellular localization and N-glycan substrate availability.  control,  96  CHAPTER 4 Bisecting N-Acetylglucosamine Dispensable F o r Development  4.1  of  N-glycans and  Appears Reproduction  Introduction The  action of N-acetylglucosaminyltransferases  control  the  branching arising from the trimannosyl core prior to their movement  degree of  to the trans-  Golgi. GlcNAc-TIII catalyzes the addition of G l c N A c to the p-mannosyl residue of the chitobiose core of complex and hybrid N-glycans. A s this addition inhibits other GlcNAc-transferases from acting, it influences  the amount of branching.  initiated branches are then extended by the resident glycosyltransferases expressed by the cell.  Some of these branch-extending  enzymes  show  These that are branch  specificity, therefore, the action of the GlcNAc-transferases impact on the type of terminal structures that are synthesized (Joziasse et al., 1987; v a n den Eijden et al., 1988). To pursue the developmental/physiological  roles of GlcNAc-TIII, mice  deficient i n Mgat3 were generated. These mice are viable, completely lack detectable GlcNAc-TIII activity and are deficient i n E - P H A visualized bisected N-glycans. 4  However, the possibility of a second GlcNAc-TIII isozyme still remains but o u r results do not support such a finding. A l t h o u g h our preliminary studies have not uncovered a phenotype, we believe that a function for GlcNAc-TIII may still exist. Necessary studies w i l l include analyzing the oligosaccharide alterations found i n mice lacking GlcNAc-TIII.  97  4.2  Results  4.2.1  Mgat3 knockouts are Viable and of Normal Weight W i t h a genomic Mgat3 probe and Nde I-digested D N A as used previously,  the presence of all three genotypes was observed among offspring of heterozygous matings (Figure 4.1A).  A n Nde I restriction fragment length p o l y m o r p h i s m was  found between 129 and C57BL/6 mouse strains, thus producing an Mgat3 ' m  BL/6  derived fragment of approximately 4 kilobases (kb) i n comparison to the 8.5 kb fragment observed i n wild-type 129 D N A (compare w i t h results i n Figure 3.9). I n comparison  to litter-mate controls, Mgat3-mx\\ mice were of n o r m a l  size a n d  weight.  4.2.2  Null Mice Lack Hybridization to a Mgat3 Coding Sequence Probe U s i n g the entire GlcNAc-TIII coding region as a probe, Cre recombination  i n ES cells was found to have resulted i n both excision and degradation of Mgat3 > D N A flanked by loxP sites as no hybridization signal was found i n genomic D N A samples from Mgat3 /Mgat3 mice (Figure 4.IB). Offspring from parents bearing the A  A  heterozygous Mgat3 /Mgat3 genotype were analyzed for Mgat3 allelic structure. wr  A  Results indicated that homozygous deletion of the Mgat3 gene was not lethal i n embryonic development (Table 1).  98  1—  Genomic Probe/Nde I Digest  1—  M g a t 3 Probe/Nde I Digest Figure 4 . 1 . Heterozygous and homozygous mutations at the Mgat3 allele i n intact mice. (A) Analyses of tail DNA isolated from animals generated from matings between mice heterozygous for the Mgat3 allele. The wild-type Mgat3 allele is derived from the A  C57BL/6 background and is smaller than the 129-derived Mgat3 allele using A/del in Southern blot analysis, due to a restriction fragment length polymorphism between 129 and C 5 7 B L / 6 strains. (B) Southern blot analyses using the Mgat3 coding sequence as a probe confirms a A A complete absence of hybridization in Mgat3 /Mgat3 DNA samples as a result of Cre recombination and degradation of excised DNA.  99  Furthermore, since n u l l animals display no banding w i t h the Mgat3 probe, it indicates that there are no closely related species.  Therefore, if a second e n z y m e  w i t h GlcNAc-TIII activity exists, it cannot share m u c h D N A identity w i t h Mgat3.  4.2.3  Mutant Mice are Fertile and Transmit the Mutated Allele at a Predicted Mendelian Frequency Moreover, homozygous Mgat3 / Mgat3 mice appeared n o r m a l (see below) A  A  and were subsequently found to be fertile i n crosses w i t h either inbred C 5 7 B L / 6 or Mgat3 IMgat3 mice. From these crosses, offspring were generated of both sexes and A  A  w i t h frequencies of Mgat3 genotypes representing a M e n d e l i a n distribution (Table 1 and data not shown). Table 1.  Transmission of the Mgat3 allele. A  Mgat3 Mouse Production Parental Genotypes  Genotype and number of offspring Mg^/Mg^™ Mgat3 /Mgat3 Mgat3 /Mgat3 100 179 103  A  Mgat3 /Mgat3 i  WT  Cf x  Mgat3"Mgat3 Cff. wr  Mgat3 /Mgat3 & WT  m  7  Mgat3 /Mgat3 Q i  wr  Mgat3 /Mgat3 Q  45  64  Mgat3 /Mgat3 Q  55  57  m  x  i  m  i  m  WT  4.2.4  i  i  i  44  Mgat3 /Mgat3 Cf x Mgat3 /Mgat3 Q i  i  i  Disruption of the Mgat3 gene is Associated with a Deficiency in GlcNAc-TIII Activity To confirm that the Mgat3 allele resulted i n loss of GlcNAc-TIII enzyme A  activity, a synthetic acceptor substrate was used in vitro to measure enzyme activity i n extracts from brain and kidney tissues of mice bearing Mgat3 or Mgat3 alleles WT  A  100  (see Materials and Methods). Approximately 50% loss of GlcNAc-TIII activity was found i n extracts of brain and kidney derived from heterozygous animals w h i l e loss of all significant GlcNAc-TIII activity was observed i n extracts from Mgat3 /Mgat3 A  mice (Figure 4.2).  A  101  These results confirm that the deletion generated i n the Mgat3 allele (Mgat3 ) is a A  n u l l mutation and inactivates all measurable GlcNAc-TIII enzyme activity.  0.6  >  u 0  0.5  X  0.4 • IH N  H  0  0.3  g 0.2  0.1 .02  +/+ + / A  A/A  Brain  +/+ + / A  A/A  Kidney  Figure 4.2. Mgat3 mutation is associated with a reduction of G l c N A c - T I I I activity. Loss of GlcNAc-TIII activity in brain and kidney tissue extracts bearing a mutation in the Mgat3 allele. Heterozygous samples exhibit approximately 50% reduction in GlcNAc-TIII activity towards a synthetic acceptor substrate, while homozygous Mgat3 samples lacked significant GlcNAc-TIII activity. A  In addition, GlcNAc-TIII activities were also determined spleen and liver tissues (data not shown).  for  thymus,  In all cases, tissues derived from  null  102  animals lacked detectable GlcNAc-TIII activities suggesting that the Mgat3 gene h a d been eliminated. A l t h o u g h this lack of activity i n the mutant implies a single gene encoding this function, it could be argued that a second isozyme may not recognize this synthetic substrate. Accordingly, it is imperative to compare the carbohydrate structures present i n the control versus the mutant mice.  4.2.5  Lack of GlcNAc-TIII Activity Correlates with a Depletion of Bisected N-Glycans Whether loss of all GlcNAc-TIII activity w o u l d , as expected, result i n loss of  bisecting G l c N A c residues i n N-glycans was addressed using the lectin E - P H A 4  w h i c h has been found to bind specifically to bisected N-glycans w h e n employed under certain experimental conditions (Kobata and Yamashita, 1989, 1993).  Using  extracts from kidney harboring the three Mgat3 genotypes (Mgat3 /Mgat3 , WT  Mgat3  WT  WT  /Mgat3 , Mgat3 /Mgat3 ), loss of E - P H A binding was observed to correlate A  &  &  4  w i t h the presence of the n u l l genotype (Figure 4.3). In addition, we looked for structural changes w i t h the lectin L - P H A . Though L - P H A b i n d i n g is not affected 4  4  by the bisecting G l c N A c per se, the G l c N A c - T V glycosyltransferase w h i c h adds the L - P H A reactive-pl,6 linked G l c N A c to the trimannosyl core is blocked by the 4  bisecting G l c N A c . Consequently, we might expect to find an elevation of L - P H A 4  reactive oligosaccharides i n Mgat3 mutant mice. However, L - P H A lectin blotting of 4  kidney tissue extracts was not grossly affected by the Mgat3 mutation (Figure 4.3).  103  No Lectin i  II  + E4-PHA  1  A/A +/A +/+ A/A +/A +/+  No Lectin 1  + L4-PHA II  1  A/A +/A +/+ A/A +/A +/+  205  — 97  * f^ lr  ~~~~ ^ 31  Figure 4 . 3 . Depletion of E,-PHA lectin binding correlates with a loss G l c N A c activity. Loss of E - P H A lectin binding in kidney tissue derived from Mgat3  TIII  4  homozygous-null mice. Acid-treated kidney homogenates (30 ug protein) from wild-type (+/+), heterozygous ( + / A ) , and homozygous-null ( A / A ) mice were subjected to electrophoresis in 12% SDS-polyacrylamide minigels followed by transfer to a PVDF membrane. The membranes were blocked and incubated in the absence of lectin (no lectin) or with biotinylated lectins at 0.2 ng/ml (either E - P H A or L -PHA). Bound lectins and biotinylated molecular-mass standard proteins were detected using Vectastain ABC™ and ECL™. The positions of protein standards are in kilodaltons. Proteins detected in the absence of lectin presumably contain biotin which reacts with the avidin reagent (Vectastain ABC™). L - P H A detects glycoproteins containing non-bisected tri- and tetra-antennary A/-glycans (Cummings and Kornfeld, 1982); L -PHA-positive bands are seen between 31 and 66 kDa. E - P H A has a high affinity for bisected oligosaccharides (Kobata and Yamashita, 1989, 1993); E - P H A positive bands are visible in the wild-type extract between 66 and 205 kDa. These are completely absent in the Mgat3-nu\\ mouse extract and are reduced in the heterozygous extract. The band at 43 kDa in the Mgat3-nu\\ mouse extract is probably due to weak reactivity of E PHA with anon-bisected A/-glycan-containing glycoprotein (Kobata and Yamashita, 1 9 8 9 , 1993) detected by L - P H A . 4  4  4  4  4  4  4  4  104  In conclusion, these results suggest that the Mgat3 allele inactivated i n this study appears solely responsible  for the  production  of GlcNAc-TIII activity and  the  formation of bisecting G l c N A c residues i n N-glycans.  4.2.6  Serum Metabolite Analyses A s the kidney appears to have the highest GlcNAc-TIII activity of n o r m a l  tissues, measures of kidney function were sought.  Serum samples were therefore  analyzed at the U C S D Medical Center, w h i c h has a renal panel used to detect kidney dysfunction.  Five samples, derived from animals approximately three months of  age, from control and mutant mice, were analyzed. The values were averaged and the data are presented i n Table 2. A t this age, the kidneys of mutant animals seemed to be performing satisfactorily as determined by this assay. Table 2. Renal Panel Bicarbonate (mM) Chloride (mM) Sodium (mM) Potassium (mM) Glucose (mM) Blood Urea Nitrogen (mM) Phosphate (mM) Calcium (mM) Creatinine (uM) Total Bilirubin (|j.M) Direct Bilirubin (uM) Albumin (g/L) Total Protein (g/L) ALT [alanine aminotransferase] (IU/L) AST [aspartate aminotransferase] (IU/L) Alkaline Phosphatase (IU/L) n=5 for wild type and Mgat3 null mice  Wild Type 14.2 + 2.4 118.5 ± 2 . 3 151.0±2.7 5.4 ± 0 . 7 9.3 + 1.0 .8.6 + 1.4 2.9 ± 0 . 5 2.3 ± 0 . 2 24 + 6 6.8 + 0.7 3.4 ±1.4 12±1.4 44±2 26±5 177 ± 5 9 76±34  Mgat3 / Mgattf A  14.2 ± 2 . 9 118.6 ± 3.7 150.3 ± 4.6 6.2 ± 1 . 0 9.3 ± 1 . 3 9.0 ± 2 . 9 2.8 ± 0 . 3 2.2 ± 0 . 2 29 ± 1 0 8.2 ± 3.8 6.2 ± 3.9 11.±1.0 43.6 ± 1 . 7 27 ± 1 3 188 ± 7 5 65 ±14  105  4.2.7  Hematological Analyses To  investigate  possible  peripheral blood was examined  hematologic  abnormalities  by Wright-Giemsa staining  Neutrophils, lymphocytes and red blood cells from mutant  i n mutant of blood animals  mice, smears.  displayed  normal size and cellular morphology. In addition, automated differentials obtained via a C E L L - D Y N 3500 determined that the number and proportion of circulating leukocytes resembled controls (Table 3).  Table 3. Peripheral Blood Hematology  Wild Type  6500±1900 1000 ± 290 5100 ± 2 2 0 0 8730 + 410 148 + 20 45.8 ± 1.5 52.5 + 1.6 16.9 + 0.8 323 +1.0 16.7 ± 1.1 882±133 4.3 + 0.2  White Blood Cells (cells/uL) Neutrophils Lymphocytes Red Blood Cells (x10 /uL) Hemaglobin (g/L) Hematocrit (%) Mean Cell Volume (fl_) Mean Corpuscular Hemaglobin (pg) Mean Corpuscular Hemaglobin Concentration (g/L) Red Cell Distribution Width (%) Platelets (x 10 /uL) Mean Platelet Volume (fL) n=10 for wild type mice and n=12 for Mgat3 null mice. 3  3  Mqat3 / Mgat^ A  7500 ± 2300 1000 ± 2 3 0 5800 ± 2 2 0 0 8780 ± 370 146 ± 3 9 46.3 ± 2 . 0 52.3 ± 1.4 16.7 ± 0 . 9 319 + 1.1 16±1 871 ± 75 4.5 ± 0.2  Furthermore, w e decided to look at lymphocytes i n our n u l l animals since G l c N A c TIII activity is developmentally regulated i n these cells (Narasimhan et al., 1988). H i g h levels of activity are found i n B lymphocytes whereas undetectable levels are found i n T lymphocytes. For examination of the thymic and splenic compartments, F A C S (fluorescein-activated cell sorter) analyses were employed.  Developmental  profiles of control and mutant mice were judged by C D 4 / C D 8 staining.  The four  thymic subpopulations, CD4/CD8", C D 4 / C D 8 , CD4VCD8" and C D 4 / C D 8 ,  were  comparable w i t h respect to the percentage of cells i n each population.  The  +  +  +  106  colonization of the spleen by CD4+ and CD8+ T cells and the numbers of B cells, distinguished by B220 and surface i m m u n o g l o b u l i n labeling,  present  appeared  hybrid  N-glycan  normal.  4.3  Discussion The  biosynthetic  pathway  leading to  complex  and  production is conserved i n m a m m a l i a n organisms and has recently been found to be necessary for embryonic development  (Ioffe and Stanley, 1994; Metzler et al.,  1994). A d d i t i o n a l experiments to further restrict the ability of m a m m a l i a n  embryos  to generate a diverse repertoire of N-glycans have thus been predicted to  further  illuminate the identity and functions of N - l i n k e d oligosaccharides participating i n normal and aberrant physiology (Marth, 1994). GlcNAc-TIII can act relatively early in the biosynthesis of complex and hybrid N - l i n k e d oligosaccharides, i m m e d i a t e l y after the addition of a G l c N A c residue to the Manocl-3 arm of the core by G l c N A c - T I . The  resulting  mannosidase  bisecting G l c N A c II,  GlcNAc-TII,  residue  prevents  GlcNAc-TIV,  subsequent  GlcNAcTV,  and  action  by oc-  core  od-6-  fucosyltransferase thereby limiting N - l i n k e d oligosaccharide biosynthesis to bisected hybrid forms w i t h a single Manocl-3-linked antenna w h i c h may be extended i n various ways (Schachter et ah, 1983; Schachter, 1986). Therefore, production of a Mga£3-null mouse w i t h loss of GlcNAc-TIII activity and lack of bisecting G l c N A c residues may result i n additional N-glycan branching w i t h multiple  antennae  formation and decreased abundance of hybrid structures i n cells w h i c h express a-  107  mannosidase II.  Regardless of the outcome, we reasoned that a mouse  GlcNAc-TIII w o u l d be useful i n further  determining  lacking  the physiologic roles of  complex and bisected hybrid N - l i n k e d oligosaccharides and may ultimately be a necessary reagent for further studies. Studies accomplished herein have succeeded i n generating mice lacking GlcNAc-TIII activity and bisecting G l c N A c residues i n N-glycans. We suspected that lack of GlcNAc-TIII and the bisecting G l c N A c might promote increased branching of N-linked  oligosaccharides, by G l c N A c - T V for example.  To  investigate  this  possibility, kidney glycoproteins were analyzed v i a L - P H A lectin blotting to detect 4  the L - P H A reactive G l c N A c - T V branched oligosaccharides. O u r results show a very 4  modest elevation i n L - P H A staining associated w i t h the loss of Mgat3. A d d i t i o n a l 4  structural analysis w i l l be needed to confirm that the deficiency observed reflects a total loss of bisecting G l c N A c residues.  The modest increase may reflect a l o w  G l c N A c - T V activity i n normal kidney or that GlcNAc-TIII and G l c N A c - T V may have preferences for different substrates. Our data can not exclude the existence of some remaining bisecting G l c N A c residues resulting from a second G l c N A c - T I I I isoenzyme not encoded by the Mgat3 gene. reveal any Mgat3 cross-hybridizing elements.  Southern genomic blotting d i d not Moreover, the mutation  generated  herein deleted the entire protein encoding sequence w i t h a corresponding loss of GlcNAc-TIII activity and depletion of E - P H A lectin binding among homozygous4  n u l l samples. Therefore, at this time, we do not have sufficient reason to i n v o k e the existence of a second gene encoding GlcNAc-TIII activity.  108  Mice devoid of GlcNAc-TIII appeared normal (Table 1 and data not shown). W h i l e mice lacking a functional Mgat3 allele did not display overt consequences,  additional studies were undertaken  to determine  phenotypic  whether  some  tissues and physiologic systems k n o w n to express GlcNAc-TIII were normal.  They  were similar i n weight to wild-type offspring, matured equally well, and reproduced normally. Additionally, tissues that normally exhibit the highest levels of G l c N A c TIII, including brain and kidney, were similar i n wet-weight mass i n mice lacking a functional Mgat3 allele. Moreover, tissues from mutant mice were histologically analyzed and appeared to lack gross alterations i n structure (data not shown).  The  identity and characteristics of circulating leukocytes and red blood cells were n o r m a l i n the absence of a functional Mgat3 gene.  Additionally, serum metabolite levels  used to assess kidney function were also unaffected.  Therefore, at the present time,  and i n a relatively stress-free environment, mice lacking a functional Mgat3 gene and bisected N-glycans appear to develop, function  and reproduce  normally.  Furthermore, behavioral alterations i n Mgat3-mx\\ mice have not been observed thus far, w i t h the oldest of such animals presently reaching the age of 1 year. Interestingly, another  laboratory has also created an Mgat3 mutation  v i a neo  insertion but have observed different findings. Their mutant animals suffer from a number of abnormalities including being underweight and having a staggered type of locomotion (Bhaumik and Stanley, unpublished observations).  Picking up the  animals results i n unusual behaviour such as leg clasping and curling up into a ball. This apparent contradiction could have multiple explanations i n c l u d i n g the nature of the  mutation  and/or  the  strain background.  Additionally,  an  observed  109  phenotype  could  result  from  disrupting genes  adjacent  to  the  target.  conventional targeting inserts a drug selection cassette w i t h its o w n  As  promoter,  translational start/stop signals and poly A sequence, it is possible that nearby genes could be affected. Such consequences w o u l d necessarily be linked to the target and therefore confound the interpretation of the phenotype (reviewed i n Olson et ah, 1996). A l t h o u g h our results do not indicate a physiologic role for GlcNAc-TIII and bisecting G l c N A c residues in N-linked oligosaccharides, we do not v i e w this data as evidence that a function for the bisecting G l c N A c modification does not exist. A d d i t i o n a l experiments w i t h Mgat3-mx\\ mice can be focused on the potential roles for GlcNAc-TIII action i n other processes, such as cell metastasis,  tumourigenesis,  and h o m i n g (Narasimhan et al., 1988b; N i s h i k a w a et al., 1988a; Pascale et al., 1989; Y o s h i m u r a et al., 1995a,b,c, 1996; M i y o s h i et al., 1995). For instance, h i g h levels of GlcNAc-TIII have  been strongly associated w i t h hepatocarcinogenesis  but  the  significance of this finding is u n k n o w n (Narasimhan et al, 1988b; N i s h i k a w a et al, 1988a; Pascale et al., 1989). Since bisected structures have been s h o w n to confer a protective effect from natural killer cell cytotoxicity (Yoshimura et al, 1996), it may allow proliferating cells to evade immune system attack. To determine the strength of this association, control and Mgat3 n u l l animals could participate i n experimental models of liver carcinogenesis to look at effects on tumour incidence.  Furthermore,  i m m u n o g l o b u l i n structures w h i c h contain the bisecting G l c N A c may depend u p o n that modification for structural stability and functional integrity i n Fc b i n d i n g  110  (Opdenakker et al., 1993). Studies of interest include looking at antibody binding to Fc receptors and ability of these antibodies to activate complement. Hematopoietic reconstitution and analyses of tumourigenesis i n Mgat3-nu\\ mice bearing various oncogenic lesions are also relevant experiments to undertake, and may n o w include the production of cell lines bearing either the Mgat3 /Mgat3 A  A  or Mgat3 /Mgat3 genotype, the latter allowing for the deletion of the Mgat3 gene in F  F  vitro by Cre recombinase  expression systems.  Furthermore,  cell lines derived  fromMgat3 /Mgat3 could be used for studying the role of the bisecting G l c N A c o n F  F  expressed proteins as they could be easily compared before and after Cre application (expression of other glycosyltransferases w o u l d be expected to remain  unchanged).  Even though a significant percentage of genetically-manipulated mice bearing n u l l alleles derived by gene-targeting techniques have been subsequently found to be normal  in  the  laboratory  environment,  the  high  degree  of  evolutionary  conservation of genes such as Mgat3 throughout m a m m a l i a n evolution may w e l l be indicative of yet to be established selective advantages by enabling an appropriate response to a changing stressful environment.  O n the other hand, an apparent  absence of a phenotype may also be attributed to alternative oligosaccharides and biological mechanisms that compensate for the missing enzyme.  Further studies  w i t h this n u l l animal system should provide insight into the biological role(s) of GlcNAc-TIII.  Ill  Bibliography Abremski,K. and Hoess,R. (1984) Bacteriophage P I site-specific recombination. Purification and properties of the Cre recombinase protein. /. Biol. Chem. 259, 15091514. Abremski,K., Hoess,R. and Sternberg,N. (1983) Studies on the properties of P I sitespecific recombination: evidence for topologically unlinked products following recombination. Cell, 32, 1301-1311. A l l e n , S. D . , Tsai, D . and Schachter, H . (1984) Control of glycoprotein synthesis. The in vitro synthesis by hen oviduct membrane preparations of h y b r i d asparaginelinked oligosaccharides containing 5 mannose residues. /. Biol. Chem. 259, 69846990. Alhadeff, J. A . (1989)A1A CRC Crit. Rev. Oncol. Hemat. 9, 37-107. A r a k i , H . , Jearnpipatkul, A . , Tatsumi, H . , Sakurai, T., Ushio, K . , M u t a , T. and Oshima, Y . (1985) Molecular and functional organization of yeast plasmid p S R l . /. Mol. Biol. 182, 191-203. A r a k i , K . , A r a k L M . , Miyazaki,J.-I. and Vassalli,P. (1995) Site-specific recombination of a transgene i n fertilized eggs by transient expression of Cre recombinase. Proc. Natl. Acad. Sci. USA, 92, 160-164. Arbones, M . L . , O r d , D . C , Ley, K., Ratech, H . , Maynard-Curry, C , Often, G . , Capon, D. J., and Tedder, T. F. (1994) Lymphocyte homing and leukocyte rolling and migration are impaired i n L-selectin-deficient mice. Immunity 1, 247-260. Arnheiter, H . , Skuntz, S., Notebom, M . , Chang, S. and Meier, E. (1990) Transgenic mice w i t h intracellular immunity to influenza virus. Cell 62, 51-61. A u s t i n , S., Ziese, M . and Sternberg, N . (1981) A novel role for site-specific recombination i n maintenance of bacterial replicons. Cell, 25, 729-736. Barondes,S.H., Cooper,D.N.W., G i t t , M . A . and Leffler,H. (1994) Galectins. Structure and function of a large family of animal lectins. /. Biol. Chem., 269, 20807-20810.  Baubonis,W. and Sauer,B. (1993) Genomic targeting w i t h purified Cre recombinase. Nucleic Acids Res., 9, 2025-2029.  112  Bhaumik, M . , Seldin, M . F . , and Stanley, P. (1995) C l o n i n g and chromosomal mapping of the mouse Mgat3 gene encoding N-acetylglucosaminyltransferase III. Gene 164, 295-300. B i r d J . M . and Kimber,S.J. (1984) Oligosaccharides containing fucose linked a(l-3) and a(l-4) to N-acetylglucosamine cause decompaction of mouse morulae. Dev. Biol., 104,449-460. Bischoff, J. and Kornfeld, S. (1983) Evidence for an alpha-mannosidase i n endoplasmic reticulum of rat liver. /. Biol. Chem. 258, 7907-7914. Boyle, A . L . , Feltquite, D . M . , Dracopoli, N . C . , Housman, D.E., and W a r d , D . C . (1992) R a p i d physical mapping of cloned D N A on banded mouse chromosomes by fluorescence in situ hybridization. Genomics 12, 106-115. Brisson, J., and Carver, J.P. (1983) The relation of three dimensional structure to biosynthesis i n the N - l i n k e d oligosaccharides. Can. }. Biochem. Cell Biol., 61, 10671078. Broach, J. R., Guarascio, V . R. and Jayaram, M . (1982) Recombination w i t h i n the yeast plasmid 2mu circle is site-specific. Cell 29, 227-234. B r o c k h a u s e n et al. (1988) Biochem. Cell Biol. 66, 1134-1151. Brockhausen, I., Romero, P . A . , and Herscovics, A . (1991) Glycosyltransferase changes u p o n differentiation of CaCo-2 human colonic adenocarcinoma cells. Cancer Res. 51, 3136-3142. Burgess, D . L . , K o h r m a n , D . C , Gait, J., Plummer, N . W . , Jones, J.M., Spear, B., and Meisler, M . H . (1995) Mutation of a new sodium channel gene, Scn8a, i n the mouse mutant 'motor endplate disease'. Nature Genetics 10, 461-465. Campbell, C . and Stanley, P. (1984) A dominant mutation to ricin resistance i n Chinese hamster ovary cells induces UDP-GlcNAc:glycopeptide [3-4-Nacetylglucosaminyltransferase III activity. /. Biol. Chem. 259, 13370-13378. Capecchi,M.R. (1989) Altering the genome by homologous recombination. Science, 244,1288-1292. Chapman, A . , L i , E. and Kornfeld, S. (1979) The biosynthesis of the major l i p i d linked oligosaccharide of Chinese hamster ovary cells occurs by the ordered addition of mannose residues. /. Biol. Chem. 254, 10243-10249. C h a r u k J . H . , T a n J . , Bernardini,M., Haddad,S., Reithmeier,R.A., JaekenJ. and Schachter,H. (1995) Carbohydrate-deficient glycoprotein syndrome type II. A n autosomal recessive N-acetylglucosaminyltransferase II deficiency different from  113  typical hereditary erythroblastic multinuclearity, w i t h a positive acidified-serum lysis test ( H E M P A S ) . Eur. J. Biochem., 230, 797-805. C u m m i n g s , R . D . and Kornfeld,S. (1982) Characterization of the structural determinants required for the h i g h affinity interaction of asparagine-linked oligosaccharides w i t h i m m o b i l i z e d Phaseolus vulgaris leukoagglutinating and erythroagglutinating lectins. /. Biol. Chem., 257, 11230-11234. C u m m i n g s , R.D., and Kornfeld, S. (1982) Characterization of the structural determinants required for the high affinity interaction of asparagine-linked oligosaccharides w i t h i m m o b i l i z e d Phaseolus vulgaris leukoagglutinating and erythroagglutinating lectins. /. Biol. Chem. 257, 11230-11234. Delorme, E., Lorenzini, T., Giffin, J., Martin, F., Jacobsen, F., Boone, T. and Elliot, S. (1992). Role of glycosylation on the secretion and biological activity of erythropoietin. Biochemstry 31, 9871-9876. Demetriou,M., Nabi,I.R., C o p p o l i n o , M . , Dedhar,S. and D e n n i s J . W . (1995) Reduced contact-inhibition and substratum adhesion i n epithelial cells expressing G l c N A c transferase V . /. Cell Biol, 130, 383-392. DennisJ.W., Laferte,S., W a g h o r n e , C , Breitman,M.L. and Kerbel,R.S. (1987) (31-6 branching of Asn-linked oligosaccharides is directly associated w i t h metastasis. Science, 236, 582-585. Dennis, J. W . , Kosh, K . , Bryce, D . M . and Breitman, M . L . (1989) Oncogenes conferring metastatic potential induce increased branching of A s n - l i n k e d oligosaccharides to rat2 fibroblasts.Oncogene 4, 853-860. van Deursen, J. and Wieringa, B. (1992) Targeting of the creatine kinase M gene i n embryonic stem cells using isogenic and non-isogenic vectors. Nucleic Acids Res. 20, 3815-3820. Drickamer, K . (1988) T w o distinct classes of carbohydrate-recognition domains i n animal lectins./ Biol. Chem. 263, 9557-9560. Drickamer,K. (1993) Biology of animal lectins. Ann. Rev. Cell Biol, 9, 237-264. Dube, S., Fisher, J. W . and Powell, J. S. (1988) Glycosylation at specific sites of erythropoietin is essential for the biosynthesis, secretion and biological function. /. Biol. Chem. 263, 17516-17517. Easton, E.W., Bolscher, J.G.M., and van den Eijnden, D . H . (1991) Enzymatic amplification involving glycosyltransferases forms the basis for the increased size of asparagine-linked glycans at the surface of NIH3T3 cells expressing the N ras proto-oncogene. /. Biol. Chem. 266, 21674-21680.  114  Eggens,L, Fenderson,B., ToyokunLT., Dean,B., Stroud,M. and Hakomori,S. (1989) Specific interaction between L e and L e determinants. /. Biol. Chem., 264, 9476-9484. x  x  Elting, J. J., Chen, W . W . and Lennarz, W . J. (1980) Characterization of a glucosidase involved i n an initial step i n the processing of oligosaccharide chains. /. Biol. Chem. 255, 2325-2330. Epstein, C . J. The consequences of chromosomal imbalance: principles, mechanism and models. Cambridge University Press, 1986. E s k o J . D . (1991) Genetic analysis of proteoglycan structure, function and metabolism. Curr. Opinion Cell Biol, 3, 805-816. Feizi,T. and Childs,R.A. (1987) Carbohydrates as antigenic determinants of glycoproteins. Biochem. J., 245, 1-11. Feizi,T. (1985) Demonstration by monoclonal antibodies that carbohydrate structures of glycoproteins and glycolipids are onco-developmental antigens. Nature, 314, 5357. Fenderson,B.A., Sehavi,U. and Hakomori,S. (1984) A multivalent lacto-Nfuropentaose III-lysyllysine conjugate decompacts preimplantation mouse embryos, while the free oligosaccharide is ineffective. /. Exp. Med., 160, 1591-1596. Francke U . (1994) Digitized and differentially shaded h u m a n chromosome ideograms for genomic applications. Cytogenet and Cell Genet 65, 206-219. Frenette, P.S., Mayadas, T. N . , Rayburn, H . , Hynes, R. O. and D . D . (1996) Susceptibility to infection and altered hematopoiesis i n mice deficient i n both P- and E-selectins. Cell, 84, 563-574. F u k u d a , M . N . (1990) H E M P A S disease: genetic defect of glycosylation. Glycobiology, 1, 9-15. Fukuda, M . , Sasaki, H . and Fukuda, M . N . (1989) Structure and role of carbohydrate i n h u m a n erythropoietin. Adv. Exp. Med. Bio. 271, 53-67. Fukuda, M . N . , Sasaki, H . , Lopez, L . and Fukuda, M . (1989) Survival of recombinant erythropoietin i n the circulation: the role of carbohydrates. Blood 73, 84-89. Gleeson, P. A . and Schachter, H . (1983) Control of glycoprotein synthesis. /. Biol. Chem. 258, 6162-6173. Grinna, L . S. and Robbins, P. W . (1978) Glycoprotein synthesis. Rat liver microsomal glucosidases w h i c h process oliogsaccharides. /. Biol. Chem. 254, 8814-8818.  115  G u , H M a r t h J . D . , O r b a n , P . C , Mossmann,H. and Rajewsky,K. (1994a) Deletion of a D N A polymerase p gene segment in T cells using cell type-specific gene targeting. Science, 265, 103-106. v  G u , H . , Z o u , Y-R. and Rajewsky, K . (1994b) Independent control of the i m m u n o g l o b u l i n switch recombination at i n d i v i d u a l switch regions evidenced through Cre-ZoxP-mediated gene targeting. Cell 73, 1155-1164. Haber, J. E. (1992) Exploring pathways of homologous recombination. Cur. Opin. Cell Biol. 4, 401-412. H a r p a z , N . and Schachter,H. (1980) Control of glycoprotein synthesis. Bovine colostrum UDP-N-acetylglucosamine:a-D-mannoside p2-Nacetylglucosaminyltransferase I. Separation from UDP-N-acetylglucosamine:a-Dmannoside p2-N-acetylglucosaminyltransferase II, partial purification, and substrate specificity. /. Biol. Chem., 255, 4885-4893. H a r p a z , N . and Schachter,H. (1980) Control of glycoprotein synthesis. Processing of asparagine-linked oligosaccharides by one or more rat liver golgi a-D-mannosidases dependent on the prior action of UDP-N-acetylglucosamine:a-D-mannoside p2-Nacetylglucosaminyltransferase I. /. Biol. Chem., 255, 4894-4902. Hart,G.W., Haltiwanger,R.S., H o l t , G . D . and K e l l y , W . G . (1989) Glycosylation i n the nucleus and cytoplasm. Annu. Rev. Biochem., 58, 841-874. Hasty, P., Crist, M . , Grompe, M . and Bradley, A . (1994) Efficiency of insertion versus replacement vector targeting varies at different chromosomal loci. Mol. Cell. Biol. 14,8385-8390. Hasty, P., Crist, Rivera-Perez, J. and Bradley, A . (1991) The length of homolgy required for gene targeting i n embryonic stem cells. Mol. Cell. Biol. 11, 5586-5591. Heng, H . and Tsui, L - C . (1993) Modes of D A P I banding and simultaneous i n situ hybridization. Chromosoma, 102, 325-332. Hennet,T., Hagen,F.K., Tabak,L.A. and M a r t h J . D . (1995) T-cell-specific deletion of a polypeptide N-acetylgalactosaminyl- transferase gene by site-directed recombination. Proc. Natl. Acad. Sci. USA., 92, 12070-12074. Hoess, R. H . , Abremski, K., Irwin, S., Kendall, M . and Mack, A . (1990) D N A specificity of the Cre recombinase resides i n the 25 k D a carboxyl domain of the protein. /. Mol. Biol, 216, 873-882. Hoess,R.H., Wierzbicki,A. and Abremski,K. (1986) The role of the loxP spacer region i n P I site-specific recombination. Nucleic Acids Res., 14, 2287-2300.  116  Hoess,R.H. and Abremski,K. (1985) Mechanism of strand cleavage and exhcnage i n the Cxe-lox site-specific recombination system. /. Mol. Biol, 181, 351-362. Hoflack, B., Cacan, R. and Verbert, A . (1981) Dolichol pathway i n lymphocytes from rat spleen. Influence of the glucosylation on the cleavage of dolichyldiphosphate oligosaccharides into phosphooligosaccharides. Eur. }. Biochem. 117, 285-290. Humphries, M . J., Matsumoto, K . , White, S.L. and Olden, K . (1986) Inhibition of experimental metastasis by casanospermine i n mice: blockage of two distinct stages of tumor colonization by oligosaccharide processing inhibitors. Cancer Res. 46, 52155222. H u g , H . , Costas, M . , Staeheli, P., Aebi, M . and Weissmann, C.(1988) Organization of the murine M x gene and characterizatio of its interferon- and virus-inducible promoter. Molecular and Cellular Biology 8 , 3065-3079. Ihara, Y . , N i s h i k a w a , A . , Tohma, T., Soejima, H . , N i i k a w a , N . , and Taniguchi, N . (1993) c D N A cloning, expression, and chromosomal localization of h u m a n N acetylglucosaminyltransferase III (GnT-III). /. Biochem. 113, 692-698. Imai, N . , H i g u c h i , M . , K a w a m u r a , A . , Tomonoh, K . , Oh-Eda, M . , Fujiwara, M . , Shimonaka, Y . and Ochi, N.(1990) Physiochemical and biological characterization of asialoerythropoietin. Suppressive effects of sialic acid i n the expression of biological activity of h u m a n erythropoietin in vitro. Eur. }. Biochem. 194, 457-462. Ioffe,E. and Stanley,P. (1994) Mice lacking N-acetylglucosaminyltransferase I activity die at midgestation, revealing an essential role for complex or h y b r i d N - l i n k e d carbohydrates. Proc. Natl. Acad. Sci. USA, 9 1 , 728-732. Irimura, T., Gonzalez, R. and Nicolson, G.L. (1981) Effects of tunicamycin on B16 metastatic melanoma cell surface glycoproteins and blood-borne arrest and survival properties. Cancer Res. 4 1 , 3411-3418. I S C N (1978) A n International System for H u m a n Cytogenetic Nomenclature. Cytogenet ad Cell Genet 2 1 , 309-404. Jeannotte,L., R u i z J . C . and Robertson,E.J. (1991) L o w level of H o x l . 3 gene expression does not preclude the use of promoterless vectors to generate a targeted gene disruption. Mol. Cell. Biol, 1 1 , 5578-5585. Joziasse, D . H . , Schiphorst, W . E. C . M . , V a n den Eijnden, D . H . , V a n K u i k , J. A . , V a n Halbeek, H . and Vliegenthart, J. F. G . (1987) Branch specificity of bovine colostrom C M P - s i a l i c acid: G a l p i , 4 G l c N A c R a 2 , 6 sialyltransferase. /. Biol. Chem. 262, 2025-2033.  117  Kelker, H . C , Y i p , Y . K . , Anderson, P. and Vilcek, J. (1983) Effects of glycosidase treatment on the physicochemical properties and biological activity of h u m a n interferon-gamma. /. Biol. Chem. 258, 8010-8013. K h a n , S.H., Compston, C . A . , Palcic, M . M . , and Hindesgaul, O . (1994) Synthesis of a di-O-methylated pentasaccharide for use i n the assay of N acetylglucosaminyltransferase III activity. Carbohydrate Res. 262, 283-295. K i l b y , N . J . , Snaith,M.R. and M u r r a y J . A . H . (1993) Site-specific recombinases: tools for genome engineering. Trends Genet., 9, 413-421. Kobata A . and Yamashita, K . (1989) Affinity chromatography of oligosaccharides on E4-phytohemagglutinin-agarose column. Methods Enzymol. 179, 46-54. Kobata, A . and Yamashita, K . (1993) Fractionation of oligosaccharides by serial affinity chromatography w i t h use of immobilized lectin columns. In F u k u d a , M . and Kobara, A . (eds.), Glycobiology - A Practical Approach, Oxford University Press, Oxford, U K , 103-125. Koenderman, A . H . L . , Wijermans, P.W., and v a n den Eijnden, D . H . (1987) Changes i n the expression of N-acetylglucosaminyltransferase III, I V , V associated w i t h the differentiation of HL-60 cells. FEBS Lett. 222:42-46. Koenderman, A . H . L . , K o p p e n , P.L., Koeleman, C . A . M . , and V a n den Eijnden, D . H . (1989) N-acetylglucosaminyltansferase III, IV and V activities i n Novikoff ascites tumour cells, mouse l y m p h o m a cells and hen oviduct. European Journal of Biochemistry 181, 651-655. K o h r m a n , D . C . , Plummer, N . W . , Schuster, T., Jones, J . M . , Jang, W . , Burgess, D . L . , Gait, J., Spear, B.T., Meisler, M . H . (1995) Insertional mutation of the motor endplate disease (med) locus on mouse chromosome 15. Genomics 26, 171-177. Kornfeld,R. and Kornfeld,S. (1985) Assembly of asparagine-linked oligosaccharides. Ann. Rev. Biochem., 54, 631-664. Kornfeld, S. and M e l l m a n n , I. (1989) Ann. Rev. Cell Biol. 5, 483. Kozak, M . (1991) Structural features i n eukaryotic m R N A s that modulate the initiation of translation. /. Biol. Chem. 266, 19867-19870. Kuhn,R., Schwenk,F., A g u e t , M . and Rajewsky,K. (1995) Inducible gene targeting i n mice. Science, 269, 1427-1429. Laemmli, U . K . (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T . Nature 227, 680-685. 4  118  L a k s o , M . , Sauer,B., Mosinger,B.,Jr., Lee,E.J., Manning,R.W., Y u , S . H . , M u l d e r , K . L . and Westphal,H. (1992) Targeted oncogene activation by site-specific recombination in transgenic mice. Proc. Natl. Acad. Sci. U. S. A., 89, 6232-6236. Labow, M . A . , Norton, C . R., Rumberger, J. M . , Lombard-Gillooly, K . M . , Shuster, D . J., H u b b a r d , J., Bertko, R., Knaack, P. A . , Terry, R. W . , Harbison, M . L., Hontgen, F., Stewart, C . L . , Mclntyre, K . W . , W i l l , P. C , Burns, D . K . and Wolitsky, B. A . (1994) Characterization of E-selectin deficient mice: demonstration of overlapping function of the endothelial selectins. Immunity 1, 709-720. Lichter, P., Tang C.J., Call, K., Hermanson, G . , Evans, G.A., et al. (1990) H i g h resolution mapping of human chromosome 11 by i n situ hybridization w i t h cosmid clones. Science 247, 64-69. L i n d h , I. and Hindsgaul, O. (1991) / Am. Chem. Soc, 113,216-223. L i , E . and Kornfeld, S. (1978) Structure of the altered oligosaccharide present i n glycoproteins from a clone of Chinese hamster ovary cells deficient i n N acetylglucosaminyltransferase activity. /. Biol. Chem. 253, 6426-6431. L u , Y . and Chaney, W . (1993) Induction of N-acetylgucosaminyltransferase V by elevated expression of activated or proto-Ha-ras oncogenes. Mol. Cell. Biochem. 122, 85-92. M a , Z . M . , Grubb, J.H. and Sly, W.S. (1991) Cloning, sequencing, and functional characterization of the murine 46-kDa mannose 6-phosphate receptor. /. Biol. Chem. 266, 10589-10595. Mack, A . , Sauer, B., Abremski, K . and Hoess, R. (1992)Stoichiometry of the Cre recombinase bound to the lox recombining site. Nucleic Acids Research, 20, 44514455. M a h o n , K . A . , Chapelinsky, A . B., Khillan, J. S., Overbeek, P. A . , Piatigorsky, J. and Westphal, H . (1987) Oncogenesis of the lens i n transgenic mice. Science 235, 16221628. M a l y , P . , Thall,A., Petryniak,B., Rogers,C.E., Smith,P.L., M a r k s , R . M . , Kelly,R.J., Gersten,K.M., Cheng,G., Saunders,T.L. and et al., (1996) The a (1, 3) fucosyltransferase Fuc-TVII controls leukocyte trafficking through an essential role in L - , E-, and P-selectin ligand biosynthesis. Cell, 86, 643-653. M a r t h J . D . (1994) W i l l the transgenic mouse serve as a Rosetta Stone to glycoconjugate function? Glycoconjugate J., 11, 3-8. M a r t h J . D . (1996) Recent advances i n gene mutagenesis by site-directed recombination. /. Clin. Invest., 97, 1999-2002.  119  M a r t h J . D . , Peet,R., Krebs,E.G. and Perlmutter,R.M. (1985) A lymphocyte-specific protein-tyrosine kinase gene is rearranged and overexpressed i n the murine T cell l y m p h o m a L S T R A . Cell, 43, 393-404. Marshall, R. D . (1972) Glycoproteins. Ann. Rev. Biochem. 41, 673-702. Mayadas, T. N . , Johnson, R. C., Rayburn, H . , Hynes, R. O. and Wagner, D . D . (1993) Leukocyte rolling and extravasation are severely compromised i n P-selectin deficient mice.CeZZ 74, 541-554. McEver,R.P., Moore,K.L. and Cummings,R.D. (1995) Leukocyte trafficking mediated by selectin-carbohydrate interactions. /. Biol. Chem., 270, 11025-11028. M e t z l e r , M . , Gertz,A., Sarkar,M., Schachter,H., SchraderJ.W. and M a r t h J . D . (1994) Complex asparagine-linked oligosaccharides are required for morphogenic events during post-implantation development. EMBO }., 13, 2056-2065. M i y o s h i , E., Ihara, Y . , Hayashi, N . , Fusamoto, H . , Kamada, T., and Taniguchi, N . (1995) Transfection of N-acetylglucosaminyltransferase III gene suppresses expression of hepatitis B virus i n a human hepatoma cell line, HB611. /. Biol. Chem. 270, 28311-28315. Mock, B . A . , E p p i g , J.T., Neumann, P.E., and H u p p i , K . E . (1994) Mouse Chromosome 15 Committee Report. Mammalian Genome 5, S217-S228. M u r p h y , L . A . and Spiro, R. G . (1981) Transfer of glucose to oligosaccharide-lipid intermediates by thyroid microsomal enzymes and its relationship to the N glycosylation of proteins. /. Biol. Chem. 256, 7487-7494. N a g y , A . , RossantJ., Nagy,R., Abramow-Newerly,W. and RoderJ.C. (1993) Derivation of completely cell culture-derived mice from early-passage embryonic stem cells. Proc. Natl. Acad. Sci. USA, 90, 8424-8428. N a k a m o r i , S., Kameyama, M . , Imaoka, S., Furukawa, H . , Ishikawa, O., Sasaki, Y . , Kabuto, T., Iwanaga, T., Matsushita, Y. and Irimura, T. (1993) Increased expression of sialyl Lewisx antigen correlates w i t h poor survival i n patients w i t h colorectal carcinoma: clinicopathological and immunohistochemical study. Cancer Res. 53, 3632-3637. Narasimhan,S. (1982) Control of glycoprotein synthesis. U D P - G l c N A c : g l y c o p e p t i d e (34-N-acetylglucosaminyltransferase II, an enzyme i n hen oviduct w h i c h adds G l c N A c i n pl-4 linkage to the (3-linked mannose of the trimannosyl core of Nglycosyl oligosaccharides. /. Biol. Chem., 257, 10235-10242.  120  Narasimhan, S., Lee, J.W.W., Cheung, R.K., Gelfand, E.W., and Schachter, H . (1988a) (3-1,4-N-acetylglucosaminyltransferase III activity i n human B and T lymphoctye lines and i n tonsillar T and B lymphocytes. Biochem. Cell Biol. 66, 889-900. Narasimhan,S., FreedJ.C. and Schachter,H. (1986) The effect of a "bisecting" N acetylglucosaminyl group on the binding of biantennary, complex oligosaccharides to concanavalin A , Phaseolus vulgaris erythroagglutinin ( E - P H A ) , and Ricinus communis agglutinin (RCA-120) immobilized on agarose. Carbohydr. Res., 149, 6583. Narasimhan, S., Schachter, H . , and Rajalakshmi, S. (1988b) Expression of N acetylglucosaminyltransferase III i n hepatic nodules during rat liver carcinogenesis promoted by orotic acid. Journal of Biological Chemistry , 263, 1273-1281. N a r h i , L . O . , A r a k a w a , T., A o k i , K . H . , Elmore, R., Rohde, M . F . , Boone, T. and Strickland, T.W. (1991) The effect of carbohydrate on the structure and stability of erythropoietin. /. Biol. Chem. 266, 23022-23026. Nicolson, G . L . (1989) Curr. Opin. Cell Biol, 1, 1009. N i s h i k a w a , A . , Fujii, S., Sugiyama, T., Hayashi, N . and Taniguchi, N . (1988a) H i g h expression of an N-acetylglucosaminyltransferase III i n 3'-methyl D A B - i n d u c e d hepatoma and ascites hepatoma. Biochem. Biophys. Res. Commun., 152, 107-112. N i s h i k a w a , A . , Ihara, Y., Hatakeyama, M . , Kangawa, K., and Taniguchi, N . (1992) Purification, c D N A cloning, and expression of UDP-N-acetylglucosamine: (J - D mannoside p-l,4N-acetylglucosaminyltransferase III from rat kidney. /. Biol. Chem. 267, 18199-18204. N i s h i k a w a , A . , Shigeru, F., Toshihiro, S., and Taniguchi, N . (1988b) A method for the determination of N-Acetylglucosaminyltransferase III activity i n rat tissues i n v o l v i n g H P L C . Analytical Biochemistry 170, 349-354. Nishikawa,Y., Pegg,W., Paulsen,H. and Schachter,H. (1988) Control of glycoprotein synthesis. Purification and characterization of rabbit liver U D P - N acetylglucosamine: oc-3-D-mannoside (3-1,2-N- acetylglucosaminyltransferase I. /. Biol. Chem. 263, 8270-8281. 0'Gorman,S., Fox,D.T. and W a h l , G . M . (1991) Recombinase-mediated gene activation and site-specific integration i n mammalian cells. Science 251, 1351-1355. Olmsted, J.B. (1981) Affinity purification of antibodies from diazotized paper blots of heterogenous protein samples. /. Biol Chem. 256, 11955-11957.  121  Olson, E . N . , A r n o l d , H . H . , Rigby, P . W . and W o l d , B.J. (1996) K n o w your neighbours: three phenotypes i n n u l l mutants of the myogenic b H L H gene M R F 4 . Cell 85, 1-4. Opdenakker, G . , R u d d , P. M . , Ponting, C P . and Dwek, R. A . (1993) Concepts and principles of glycobiology. FASEB }. 7, 1330-1337. Oppenheimer, C . L . and H i l l , R. L . (1981) Purification and characterization of a rabbit liver a 1,3 mannoside p 1,2 N-acetylglucosaminyltransferase. /. Biol. Chem. 256, 799804. Oppenheimer,C.L., Eckhardt,A.E. and H i l l , R . L . (1981) The nonidentity of porcine N acetylglucosaminyltransferases I and II. /. Biol. Chem., 256, 11477-11482. O r b a n , P . C , C h u i , D . and M a r t h J . D . (1992) Tissue- and site-specific D N A recombination i n transgenic mice. Proc. Natl. Acad. Sci. U. S. A., 89, 6861-6865. Palcic, M . M . , Ripka, J., Kaur, K . J., Shoreibah, M . , Hindsgaul, O . (1990) Regulation of N-acetylglucosaminyltransferase V activity. Kinetic comparisons of parental, Rous sarcoma virus-transformed B H K and L-phytohemagglutinin-resistant B H K cells using synthetic substrates and an inhibitory substrate analog. /. Biol. Chem. 265, 6759-6769. Pascale, R., Narasimhan, S., and Rajalakshmi, S. (1989) Expression of N acetylglucosaminyltransferase III i n hepatic nodules generated by different models of rat liver carcinogenesis. Carcinogenesis 10, 961-964. Palmiter, R. and Brinster, R. L . (1986) Germline transformation of mice. Ann. Rev. Genet. 20, 465-499. Philips, M . L., Schwartz, B. R., Etzioni, A . , Bayer, R., Ochs, H . D . , Paulson, J. C . and H a r l a n , J. M . (1995) Neutrophil adhesion i n leukocyte adhesion deficiency syndrome type-2. /. Clin. Invest. 96, 2898-2906. Powell, L . D . , Paneerselvam, K . , Vij, R., Diaz, S., M a n z i , A . , Buist, N , Freeze, H . and V a r k i , V . (1994) Carbohydrate-deficient glycoprotein syndrome - not an N - l i n k e d processing defect, but an abnormality i n lipid-linked oligosaccharide biosynthesis? /. Clin. Vest. 94, 1901-1909. P o w e l L L . D . and V a r k L A . (1995) I-type lectins. /. Biol. Chem., 270, 14243-14246. Pownall, S., Kozak, C . A . , Schappert, K . , Sarkar, M . , H u l l , E., Schachter, H . and M a r t h , J. D . (1992) Molecular cloning and characterization of the mouse U D P - N acetylglucosamine:a-3-D-mannoside p-l,2-N-acetylglucosaminyltransferase I gene. Genomics 12, 699-704.  122  Q i n , M . , B a y l e y , C , Stockton,T. and O w , D . W . (1994) Cre recombinase-mediated sitespecific recombination between plant chromosomes. Proc. Natl. Acad. Sci. USA, 91, 1706-1710. Ramirez-Solis,R., Davis, A . C . and Bradley,A. (1993) Gene targeting i n mouse embryonic stem cells. Meth. In. Enzymol. 225, 855-878. Ramirez-Solis,R L i u , P . and Bradley,A. (1995) Chromosome engineering i n mice. Nature, 378, 720-724. v  Rearick, J. I., Chapman, A . and Kornfeld, S. (1981) Glucose starvation alters l i p i d linked oligosaccharide biosynthesis i n Chinese hamster ovary cells. /. Biol. Chem. 256, 6255-6231. Riele, H . T., Maandag, E. R. and Berns, A . (1992) H i g h l y efficient gene targeting i n embryonic stem.cells through homologous recombination w i t h isogenic D N A constructs. Proc. Natl. Acad. Sci. USA 89, 5128-5132. Robertson, M . A . , Etchison, J.R., Robertson, J.S., Summers, D.F. and Stanley, P. (1978) Specific changes i n the oligosaccharide moieties of V S V g r o w n i n different lectinresistant C H O cells. Cell 13, 515-526. Robertson,E. J., Bradley,A., K u e h n , M . and Evans,M. (1986) Germ-line transmission of genes introduced into cultured pluripotential cells by retroviral vector. Nature, 323, 445-448. Robertson, E. J. (1987) Teratocarcinomas and embryonic stem cells: a practical approach. I R L Press Limited, Oxford and Washington, D . C . Roden, L . (1980) The biochemistry of glycoproteins and proteoglycans, 267. P l e n u m Press, N e w York. Sadler, J. E . (1984) Biosynthesis of glycoproteins: formation of O-linked oligosaccharides. In Biology of Carbohydrates, V o l . 2, 199. Wiley, N e w York. Saitoh,O W a n g , W . C , Lotan,R. and F u k u d a , M . (1992) Differential glycosylation and cell surface expression of lysosomal membrane glycoproteins i n sublines of a h u m a n colon cancer exhibiting distinct metastatic potentials. /. Biol. Chem., 267, 5700-5711. v  Sauer,B. (1987) Functional expression of the cre-lox site-specific recombination system i n the yeast Saccharomyces cerevisiae. Mol. Cell. Biol., 7, 2087-2096. Sauer,B. and Henderson,N. (1989) Cre-stimulated recombination at ZoxP-containing D N A sequences placed into the mammalian genome. Nucleic Acids Res., 17, 147161.  123  Sauer,B., W h e a l y , M . , Robbins,A. and Enquist,L. (1987b) Site-specific insertion of D N A into a pseudorabies virus vector. Proc. Natl. Acad. Sci. USA, 84, 9108-9112. Sauer,B. and Henderson,N. (1988) The cyclization of linear D N A i n Escherichia coli by site-specific recombination. Gene, 70, 331-341. Sauer, B., and Henderson, N . (1988) Site-specific D N A recombination i n mammalian cells by Cre recombinase of bacteriphage P I . Proc. Natl. Acad. Sci. USA, 85, 5166-5170. Sauer,B. and Henderson,N. (1990) Targeted insertion of exogenous D N A into the eukaryotic genome by the Cre recombinase. New Biol., 2, 441-449. Sauer, B. (1992) Identification of cryptic lox sites i n the yeast genome by selection for Cre-mediated chromosome translocations that confer multiple drug resistance. /. Mol. Biol. 223, 911-928. Savvidou, G . , K l e i n , M . , Grey, A . A . , Dorrington, K . J. and Carver, J. P. (1984) Possible role for peptide-oligosaccharide processing at asparagine-107 of the light chain and asparagine-297 of the heavy chain i n a monoclonal I g G l kappa. Biochemistry 23, 3736-3740. Schachter,H. (1986) Biosynthetic controls that determine the branching and microheterogeneity of protein-bound oligosaccharides. Biochem. Cell Biol., 64, 163181. Schachter, H . (1991) Enzymes associated w i t h glycosylation.Currenf Opinion in Structural Biology, 1, 755-765. Schachter,H. (1991) The 'yellow brick road' to branched complex N-glycans. Glycobiology, 1, 453-461. Schachter, H . (1994) Molecular cloning of glycosyltransferase genes. In Fukuda, M . and Hindsgaul, O. (eds.), Molecular Glycobiology, Oxford University Press, Oxford, U K , 88-162. Schachter, H . , Narasimhan, S., Gleeson, P., and Vella, G . (1983) Control of branching during the biosynthesis of asparagine-linked oligosaccharides. Can. J. Biochem. Cell Biol. 61, 1049-1066. Schwenk, F., Baron, U . and Rajewsky, K . (1995) A cre-transgenic mouse strain for the ubiquitous deletion of loxP flanked gene segments including deletion i n germ cells. Nucleic Acids Research, 23, 5080-5081.  124  Senecoff, J. F., and Cox, M . M . (1986) Directionality i n F L P protein-promoted sitespecific recombination is mediated by D N A - D N A pairing. /. Biol. Chem. 261, 73807386. Smith,A.J., De Sousa,M.A., Kwabi-Addo,B., Heppell-Parton,A., Impey,H. and Rabbitts,P. (1995) A site-directed chromosomal translocation induced i n embryonic stem cells by Cre-loxP recombination. Nature Genetics, 4, 376-385. Spiro, M . J., Spiro, R . G . and Bhoyroo, V . D . (1979) Glycosylation of proteins by oligosaccharide-lipids. Studies on a thyroid enzyme involved i n oligosaccharide transfer and the role of glucose i n this reaction. /. Biol. Chem. 254, 7668-7674. Springer, T. A . (1994) Traffic signals for lymphocyte recirculation and leucocyte emigration: the multistep paradigm. Cell 76, 301-314. Srivastava, O.P. et al. (1988) Carbohydrate Res., 179, 137-161. Staneloni, R. et al. (1981) Plant Physiol. 68, 1175-1179. Stanley, P. (1984) Glycosylation mutants of animal cells. Ann. Rev. Genet. 18, 525552. Stanley, P. (1989) Chinese hamster ovary cell mutants w i t h multiple glycosylation defects for production of glycoproteins w i t h m i n i m a l carbohydrate heterogeneity. Mol. Cell. Biol. 9, 377-383. Stanley,P. (1992) Glycosylation engineering. Glycobiology, 2, 99-107. Stanley, P., Sundaram, S., and Sallustio, S. (1991) A subclass of cell surface carbohydrates revealed by a C H O mutant w i t h two glycosylation mutations. Glycobiology 1, 307-314. Stanley,P., Narasimhan,S., Siminovitch,L. and Schachter,H. (1975) Chinese hamster ovary cells selected for resistance to the cytotoxicity of phytohemagglutinin are deficient i n a UDP-N-acetylglucosamine— glycoprotein Nacetylglucosaminyltransferase activity. Proc. Natl. Acad. Sci. U. S. A., 72, 3323-3327. Sternberg, N . A n d Hoess, R. (1983) The molecular genetics of the bacteriophage P I . Ann. Rev. Genet., 17, 123-154. Sternberg,N. and Hamilton,D. (1981) Bacteriophage P I site-specific recombination. I. Recombination between loxP and bacterial chromosome. /. Mol. Biol, 150, 487-507. Sternberg,N. and Hamilton,D. (1981) Bacteriophage P I site-specific recombination. I. Recombination between loxP sites. /. Mol. Biol, 150, 467-486.  125  S u r a n L M . A . H . (1979) Glycoprotein synthesis and inhibition of glycosylation by tunicamcyin i n preimplantation mouse embryos: compaction and trophoblast adhesion. Cell, 18, 217-227. Tabas,I. and Kornfeld,S. (1978) The synthesis of complex-type oligosaccharides. III. Identification of an apha-D-mannosidase activity involved i n a late stage of processing of complex-type oligosaccharides. /. Biol. Chem., 253, 7779-7786. Tabas et al. (1978) Processing of high mannose oligosaccharides to form complex type oligosaccharides on the newly synthesizedpolypeptides of the vesicular stomatitus virus G protein and the IgG heavy chain. /. Biol. Chem. 253, 716-722. Tabas, I. and Kornfeld, S. (1979) Purification and characterization of a rat liver G o l g i alpha-mannosidase capable of processing asparagine-linked oligosaccharides. /. Biol. Chem. 254, 11655-11663. Takeuchi, M . , Inoue, N . , Strickland, T.W., Kubota, M . , W a d a , M . , Shimizu, R., H o s h i , S., K o z u t s u m i , H . , Takasaki, S. and Kobata, A . (1989) Relationship between sugar chain structure and biological activity of recombinant h u m a n erythropoietin produced i n Chinese hamster ovary cells. Proc. Natl. Acad. Sci. USA, 86, 7819-7822. Takeuchi, M . , Takasaki, S., Shimada, M . and Kobata, A . (1990) Roles of sugar chains i n the in vitro biological activity of human erythropoietin produced i n recombinant Chinese hamster ovary cells. /. Biol. Chem. 265, 12127-12130. Thomas, K . R. and Capecchi, M . R. (1987) Site-directed mutagenesis by gene targeting i n mouse embryo-derived stem cells. Cell 51, 503-512. Towbin, H . , Staehelin, T., and Gordon, J. (1979) Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedures and some applications. Proc. Natl. Acad. Sci. USA 76, 4350-4354. Tsuda, E., Kawanishi, G . , Ueda, M . , Masuda, S. and Sasaki, R. (1990) The role of carbohydrate i n recombinant h u m a n erythropoietin. Eur. J. Biochem. 188, 405-411. van DeursenJ., Fornerod,M., van Rees,B. and Grosveld,G. (1995) Cre-mediated sitespecific translocation between nonhomologous mouse chromosomes. Proc. Natl. Acad. Sci. USA, 92, 7376-7380. V a n den Eijden, D . N . , Koenderman, A . H . L . and Schiphorst, W . E. C . M . (1988) Partial purification and properties of an UDP-GlcNAc:N-acetyllactosaminide 131,3 Nacetylglucosaminyltransferase from Novikoff tumour cell ascites fluid. /. Biol. Chem. 263, 12461-12647.  126  V a r k i , A . (1992) Role of oligosaccharides i n intracellular trafficking of mammalian glycoproteins. In Cell surface carbohydrates and cell development. C R C Press, Boca Raton, Florida, 25-70. V a r k i , A . (1993) Biological roles of oligosaccharides: all of the theories are correct. Glycobiology, 3, 97-130. V a r k i , A . and M a r t h J . D . (1995) Oligosaccharides i n vertebrate development. Seminars in Developmental Biology, 6, 127-138. Wagner, E . (1990) O n transferring genes into stem cells and mice. EMBO f. 9, 30253032. Wasley, L . C , Timony, G . , Murtha, P., Stoudemire, J., Domer, A . J., Caro, J., Krieger, M . and Kaufman, R. J. (1991) The importance of N- and O-linked oligosaccharides for the biosynthesis and in vitro and in vivo biologic activities of erythropoietin. Blood 77, 2624-2632. Wierzbicki, A . , Kendall, M . , Abremski, K . and Hoess, R. (1987) A mutational analysis of the bacteriophage P I recombinase Cre. /. Mol. Biol., 195, 785-794. Wiles, M . V . (1993) Embryonic stem cell differrentiation in vitro. Methods in Enzymology, 225, 900-918. Yamaguchi, K . , A k a i , K . , Kawanishi, G . , Ueda, M . , and Masuda, S. and Sasaki, R. (1991) Effects of site-directed removal of N-glycosylation sites i n h u m a n erythropoietin on its production and biological properties. /. Biol. Chem. 266, 2043420439. Yamashita, K . , Ohkura, T., Tachibana, Y., Takasaki, S. and Kobata, A . (1984) Comparative study of the oligosaccharides released from baby hamster kidney cells and their polyoma transformant by hydrazinolysis. /. Biol. Chem. 259, 10834-10840. Yamashita, K . , Tachibana, Y , Ohkura, T. and Kobata, A . (1985) Enzymatic basis for the structural changes of asparagine-linked sugar chains of membrane glycoproteins of baby hamster kidney cells induced by polyoma transformation. /. Biol. Chem. 260, 3963-3969. Yamashita, K . , Totani, K . , Ohkura, T., Takasaki, S., Goldstein, J., and Kobata, A . (1987) Carbohydrate binding properties of complex-type oliogsaccharides on i m m o b i l i z e d Datura stramonium lectin. /. Biol. Chem. 262, 1602-1607. Yoshimura, M . , N i s h i k a w a , A . , Ihara, Y . , Taniguchi, S., and Taniguchi, N . (1995a) Suppression of l u n g metastasis of B16 mouse melanoma by Nacetylglucosaminyl-transferase III gene transfection. Proc. Natl. Acad. Sci. USA 92, 8754-8758.  127  Yoshimura, M Ihara, Y., and Taniguchi, N . (1995b) Changes of (3-1,4-Nacetylglucosaminyltransferase III (GnT-III) i n patients w i t h leukemia. Glycoconjugate }. 12, 234-240. v  Yoshimura, M . , Nishikawa, A . , Ihara, Y., Nishiura, T., Nakao, H . , Kanayama, Y . , Matuzawa, Y., and Taniguchi, N . (1995c) H i g h expression of U D P - N acetylglycosamine: (3-D mannoside p-l,4-N-acetylglucosaminyltransferase III (GnT-III) i n chronic myelogenous leukemia i n blast crisis. Int. }. Cancer 60, 443449. Yoshimura, M . , Ihara, Y., Ohnishi, A . , Ijuhin, N . , Nishiura, T., Kanakura, Y . , Matsuzawa, Y . , and Taniguchi, N . (1996) Bisecting N-acetylglucosamine on K562 cells suppresses natural killer cytotoxicity and promotes spleen colonization. Cancer Res. 56, 412-418. Yousefi, S., Higgins, E., Daoling, Z . , Pollex-Kruger, A . , Hindsgaul, O., and Dennis, J. (1991) Increased U D P - G l c N A c : G a l (3l-3GalNAc-R ( G l c N A c to G a l N A c ) p - l , 6 - N acetylglucosaminyltransferase activity i n metastatic murine tumour cell lines. /. Biol. Chem. 266, 1772-1782.  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0088070/manifest

Comment

Related Items