Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Effects of foetal ethanol exposure on hypothalamic-pituitary adrenal axis function and behaviour on the… Osborn, Jill Alison 1997

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1997-196372.pdf [ 11.62MB ]
Metadata
JSON: 831-1.0088064.json
JSON-LD: 831-1.0088064-ld.json
RDF/XML (Pretty): 831-1.0088064-rdf.xml
RDF/JSON: 831-1.0088064-rdf.json
Turtle: 831-1.0088064-turtle.txt
N-Triples: 831-1.0088064-rdf-ntriples.txt
Original Record: 831-1.0088064-source.json
Full Text
831-1.0088064-fulltext.txt
Citation
831-1.0088064.ris

Full Text

EFFECTS OF FOETAL ETHANOL EXPOSURE ON HYPOTHALAMIC-PITUITARY ADRENAL AXIS FUNCTION AND BEHAVIOUR ON THE ELEVATED PLUS MAZE by Jill Alison Osborn B.Sc. (PT), The University of British Columbia, 1989 A THESIS SUBMITTED IN PARTIAL F U L F I L L M E N T OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE F A C U L T Y OF G R A D U A T E STUDIES (Neuroscience Programme) We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH C O L U M B I A January 17, 1997 ©Jill Alison Osborn In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of G>ccc\ocAe. 'b^ orVxe.'S, *boV\ocA 0 $ VAeoco-bcc^c^ The University of British Columbia Vancouver, Canada Date "Sc-rv, \ ^ / q ?• DE-6 (2/88) ABSTRACT This thesis investigated effects of prenatal ethanol exposure on hypothalamic-pituitary-adrenal (HPA) axis function and on behaviour on the elevated plus maze (+-maze). Male and female Sprague-Dawley rats from prenatal ethanol (E), pair-fed (PF) and ad lib-fed control (C) treatment groups, were tested in adulthood in all studies. The hormonal studies investigated the hypothesis that a deficit in feedback inhibition of the H P A axis may underlie the hormonal hyperresponsiveness seen in E rats. The effects of dexamethasone (DEX) blockade on corticosterone (CORT) levels and adrenocorticotrophin (ACTH) levels were examined over a 36 hour (h) period. Following D E X , E males and females had significantly higher stress CORT levels and/or A C T H than PF and C animals, and showed differential responsiveness following D E X administration depending upon the time of day tested. At the trough of the circadian rhythm, E males did not differ from PF and C males, whereas E females had increased stress CORT levels compared to PF and C females. In contrast, at the peak of the circadian rhythm, E males showed increased stress CORT levels but not A C T H , whereas E females showed increased stress CORT and A C T H levels. These data- support the hypothesis that E animals may exhibit deficits in HPA feedback inhibition. Two other possible mechanisms for HPA hyperresponsiveness were investigated during the trough of the CORT circadian cycle. First, adrenal sensitivity to exogenous A C T H was examined. No significant differences were found among prenatal treatment ii groups in adrenal sensitivity to A C T H . Second, corticotrophin releasing factor (CRF) mRNA expression in the hypothalamus was measured in D E X suppressed animals 1 h after exposure to ether vapor. E males showed a trend toward higher CRF mRNA levels and E females demonstrated significantly higher CRF mRNA levels than their respective controls. These data suggest that H P A hyperresponsiveness seen in E animals is not due to increased adrenal sensitivity to A C T H but may be due to increased synthesis of CRF. The behavioural studies investigated the hypothesis that alterations in behaviour seen in E animals is in part mediated by alterations in the GABA-ergic system or increased sensitivity to central CRF. Both E males and females demonstrated behavioural hyperactivity and alterations in fear on the +-maze. In addition, the hyperactivity seen in E animals appeared to be reduced by prior exposure to the open field. Furthermore, E males and females demonstrated increased sensitivity to the effects of benzodiazepine on the +-maze compared their with respective controls. Due to methodological issues, the studies on central CRF sensitivity were inconclusive. These data suggest that E animals may exhibit differential responses to aversive environments but the underlying dysfunction may be altered by prior experience to aversive stimuli. Further, the data suggest that prenatal ethanol exposure may have long lasting effects on the GABA-ergic system. i i i TABLE OF CONTENTS Abstract i i Table of Contents iv List of Figures ix List of Tables xii List of Abbreviation xiv Acknowledgements xvii Forward xix CHAPTER I: INTRODUCTION 1 A . Foetal Alcohol Syndrome 1 A . l ) Epidemiology 2 A . 2) Pharmacokinetics of Alcohol 4 A . 3) Alcohol Teratogenesis 5 A.4) Clinical Features of FAS 7 A.5) Behavioural Problems 11 A.6) Cognitive Impairment 12 A . 7) Motor Deficits 13 B. Animal Models of FAS 15 B. l ) Rodent Model 16 B.2) Administration of Alcohol and Nutrition 17 B.3) Effects of Ethanol Exposure on Rodents 19 iv C. Psychoneuroendocrinology and Stress 22 C. l ) Hormones and Stress 24 C. 2) Corticotrophin Releasing Factor and Behaviour 30 D. H P A Axis in FAS 33 E. Thesis Objectives 39 CHAPTER II: G E N E R A L METHODS 40 A. Diets 40 B. Breeding and Feeding 40 C. Blood Sampling 43 D. Surgical Procedures 44 D. l ) Modified Indwelling Jugular Cannulae 44 D. 2) Intracerebroventricular (ICV) Cannulae 45 E. Behavioural Tests 46 E. l ) Elevated Plus Maze (+-Maze) 46 E. 2) Open Field (OF) 47 F. Assays 47 F. l ) Blood Ethanol Levels 47 F.2) Plasma Corticosterone Levels 48 F. 3) Plasma A C T H Levels 48 G. Measurements of mRNA 49 G. l ) In situ hybridization 49 G.2) Probes 50 v G.3) Autoradiography and Signal Quantitation 52 CHAPTER III: H Y P O T H A L A M I C - P I T U I T A R Y - A D R E N A L (HPA) AXIS HYPERRESPONSIVENESS 57 A . Effects of Prenatal Ethanol Exposure on A C T H Stimulation of Adrenal Glands 57 A . l ) Introduction 57 A.2) Methods 57 A.3) Statistical Analyses 59 A.4) Results 59 A . 5) Discussion 62 B. Effects of Prenatal Ethanol Exposure on Hypothalamic-Pituitary-Adrenal Sensitivity to Dexamethasone Suppression 76 B. l ) Introduction 76 B.2) Methods 76 B.3) Statistical Analyses 78 B.4) Results 78 B. 5) Discussion 81 C. Foetal Ethanol Exposure Alters Hypothalamic-Pituitary-Adrenal Sensitivity to Dexamethasone 97 C. l ) Introduction 97 C.2) Methods 97 C.3) Statistical Analyses 99 C.4) Results 100 C. 5) Discussion 103 D. Effects of Foetal Ethanol Exposure on Corticotrophin Releasing Factor (CRF), Arginine Vasopressin (AVP), and Glucocorticoid Receptor (GR) mRNA Following Dexamethasone Suppression 142 D. l ) Introduction 142 D.2) Methods 144 D.3) Statistical Analyses 145 D.4) Results 145 D.5) Discussion 148 CHAPTER IV: B E H A V I O U R A L ALTERATIONS IN F O E T A L E T H A N O L EXPOSED RODENTS 178 vi A . Effects of Foetal Ethanol Exposure on Behaviour on the Elevated Plus Maze 178 A . l ) Introduction 178 A.2) Methods 181 A.3) Statistical Analyses 184 A.4) Results 185 A . 5) Discussion 191 B. Foetal Ethanol Effects on CRF Sensitivity Measured by the Elevated Plus Maze. 235 B. l ) Introduction 235 B.2) Methods 236 B.3) Statistical Analyses 238 B.4) Results 239 B. 5) Discussion 242 C. Foetal Ethanol Effects on Benzodiazepine (BZD) Sensitivity Measured by the Elevated Plus Maze. 267 C. l) Introduction 267 C.2) Methods 268 C.3) Statistical Analyses 270 C.4) Results 270 C.5) Discussion 274 CHAPTER V : CONCLUSIONS A N D RECOMMENDATIONS 304 REFERENCES 316 vii TABLE OF FIGURES FIGURE # Figure 1. Corticosterone Levels in Male and Female Rats Following Infusion of Saline 66 Figure 2. Corticosterone Levels in Male Rats Following Infusion of 0.05 and 0.1 Units of A C T H 68 Figure 3. Corticosterone Levels in Male Rats Following Infusion of 0.5 and 1.0 Units of A C T H 70 Figure 4. Corticosterone Levels in Female Rats Following Infusion of 0.05 and 0.1 Units of A C T H 72 Figure 5. Corticosterone Levels in Female Rats Following Infusion of 0.5 and 1.0 Units of A C T H 74 Figure 6. Corticosterone Levels in Dexamethasone Treated Males Following IP Poke. 89 Figure 7. Corticosterone Levels in Dexamethasone Treated Females Following IP Poke. 91 Figure 8. Corticosterone Levels in Dexamethasone Treated Males Following Ether Vapor. 93 Figure 9. Corticosterone Levels in Dexamethasone Treated Females Following Ether Vapor. 95 Figure 10. Stress CORT Levels in Males 3 and 6 h After D E X Injection in the A M . 114 Figure 11. Stress CORT Levels in Males 10 and 26 h After D E X Injection in the A M . 116 Figure 12. Stress CORT Levels in Males 36 h After D E X Injection in the A M . 118 Figure 13. Stress CORT Levels in Females 3 and 6 h After D E X Injection in the A M . 120 Figure 14. Stress CORT Levels in Females 10 and 26 h After D E X Injection in the A M . 122 vii i Figure 15. Stress CORT Levels in Females 36 h After D E X Injection in the A M . Figure 16. Stress A C T H Levels in Males 3 and 6 h After D E X Injection in the A M . Figure 17. Stress A C T H Levels in Males 10 and 26 h After D E X Injection in the A M . Figure 18. Stress A C T H Levels in Males 36 h After D E X Injection in the A M . Figure 19. Stress A C T H Levels in Females 3 and 6 h After D E X Injection in the A M . Figure 20. Stress A C T H Levels in Females 10 and 26 h After D E X Injection in the A M . Figure 21. Stress A C T H Levels in Females 36 h After D E X Injection in the A M . Figure 22. Stress CORT Levels in Males and Females After D E X Injection in the P M . Figure 23. Stress A C T H Levels in Males and Females After D E X Injection in the P M . Figure 24. Stress Corticosterone Levels in Males and Females 3 h After D E X Injection in the A M . Figure 25. Undisturbed CRF mRNA Levels in Males in the A M . Figure 26. Undisturbed CRF mRNA Levels in Females in the A M . Figure 27. Stress CRF mRNA Levels in Males 3 h After D E X Injection in the A M . Figure 28. Stress CRF mRNA Levels in Females 3 h After D E X Injection in the A M . Figure 29. Undisturbed A V P mRNA Levels in Males in the A M . Figure 30. Undisturbed A V P mRNA Levels in Females in the A M . ix Figure 31. Stress A V P mRNA Levels in Males 3 h After D E X Injection in the A M . 170 Figure 32. Stress A V P mRNA Levels in Females 3 h After D E X Injection in the A M . 172 Figure 33. Undisturbed GR mRNA Levels in Males and Females in the A M . 174 Figure 34. Stress GR mRNA Levels in Males and Females 3 h After D E X Injection in the A M . 176 Figure 35. Number of Closed Arm Entries and Time on Centre Area for Males. 201 Figure 36. Number of Closed Arm and Partial Open Arm Entries for Females. 203 Figure 37. Time on Centre Area and on Closed Arms for Females. 205 Figure 38. Time on Open Arms and Number of Closed Arm Rears for Males. 207 Figure 39. Number of Full Open Arm Entries for Males and Females. 209 Figure 40. Time on Open Arms for Females. 211 Figure 41. Ambulation and Turns on Closed Arm for Males 213 Figure 42. Rears on Closed Arm for Males 215 Figure 43. Ambulation and Turns on Closed Arm for Females 217 Figure 44. Rears on Closed Arm for Females 219 Figure 45. Corticosterone Levels for Males and Females Following Open or Closed Arm Exposure. 221 Figure 46. Time on Closed Arms and Rears on Closed Arms for Males. 223 Figure 47. Time on Closed Arms and Entries on Closed Arms for Females. 225 Figure 48. Rears on Closed Arms for Females. 227 Figure 49. Rears on Open Arms and Time on Open Arms. 229 x Figure 50. Number of Open Arm Entries for Females. 231 Figure 51. Corticosterone Levels for Males and Females Following OF and +-Maze Exposure. 233 Figure 52. Ambulation and Rearing on the Open Field for Males and Females 249 Figure 53. Time on Open Arms and Closed Arms for Males and Females. 251 Figure 54. Entries onto Closed Arms and Rears on Closed Arms for Males and Females. 253 Figure 55. Time in Central Area for Males and Females. 255 Figure 56. Number of Open Arm Entries and Time on Closed Arms for Females Given ICV CRF, ICV hCRF, ICV Saline, SC CRF, or SC Saline. 257 Figure 57. Number of Closed Arm Entries for Females Given ICV CRF, ICV hCRF, ICV Saline, SC CRF, or SC Saline. 259 Figure 58. Time in Central Area for Females Given ICV CRF, ICV hCRF, ICV Saline, SC CRF, or SC Saline. 261 Figure 59. Number of Closed Arm Entries and Rears for Females. 263 Figure 60. Time on Closed Arms for Females. 265 Figure 61. Ambulation on Central Area on the Open Field for Males and Females. 282 Figure 62. Ambulation on Outer Area on the Open Field for Males and Females. 284 Figure 63. Ambulation on Rears on the Open Field for Males and Females. 286 Figure 64. Percent Time on Open Arms for Males and Females. 288 Figure 65. Number of Open Arms Entries for Males and Females. 290 Figure 66. Percent Time on Closed Arms for Males and Females. 292 Figure 67. Number of Closed Arm Entries for Males and Females. 294 Figure 68. Time on Central Area for Males and Females. 296 xi Figure 69. Number of Closed Arm Rears for Males and Females. 298 Figure 70. Number of Partial Open Arm Entries for Males and Females. 300 Figure 71. Corticosterone Levels for Males and Females Following +-Maze exposure. 302 xii TABLE OF TABLES T A B L E # Table 1. Liquid Rat Diet 53 Table 2. Synthetic Oligonucleotides 55 Table 3. Undisturbed CORT-Levels 112 / xii i LIST OF ABBREVIATIONS A N O V A - analyses of variance A R B D - alcohol related birth defects A V P - argininee vasopressin B A L - blood alcohol level BDZ - benzodiazepine P-EP - beta endorphin bw - body weight C - control cAMP - adenosine 3' 5'-cyclic monophosphate C B G - corticosterone binding globulin cGMP - guanosine 3',5'-monophosphate CNS - central nervous system CORT - corticosterone CRF - corticotrophin releasing factor d - day D A - dopamine D E X - dexamethasone DTT - dithiothreitol E - ethanol E E G - electroencephalograph ERE - oestrogen responsive elements xiv ETOH - ethanol F A E - fetal alcohol effects FAS - fetal alcohol syndrome FSH - follicular stimulating hormone G A B A - gama aminobutyric acid GR - glucocorticoid receptor h - hour hCRF - a-helical corticotrophin releasing factor HPA - hypothalamic-pituitary-adrenal ICV - intracerebroventricular IP - intraperitoneal L C - locus coeruleus mRNA - messenger R N A N E - norepinephrine OF - open field OT - oxytocin O V X - ovariectomy PBS - phosphate-buffered saline PEA - proenkephalin PF - pair-fed POMC - pro-opiomelanocorticotrophin P V N - paraventricular nucleus XV RIA - radioimmunoassay SC - subcutaneously S E M - standard error of the mean SSC - 300 m M NaCl/30 m M sodium citrate wk - week VP - vasopressin 5-HT - serotonin +-Maze - plusmaze %Topen - (time in open arms / (time in open arms + time in closed arms)) x 100 %Tclosed - (time in closed arms / (time in open arms + time in closed arms)) x 100 xvi ACKNOWLEDGMENTS I would first like to thank my supervisor, Dr. Joanne Weinberg for her patience and unwavering support. Her encouragement and demand for excellence has guided me to through the thick and thin of my graduate education. She has become more than a supervisor; she has become a friend and a part of my family. I would also like to thank my committee members: Dr. Susan Harris, Dr. Joseph Leichter, Dr. John Pinel, and Dr. Athanasios Zis for their guidance and wisdom during the creation of this thesis project and the continued feedback and support throughout my graduate education. In addition, I would like to give special thanks to Dr. Susan Harris who gave me the opportunity to be involved in clinical research which made my animal research all the more relevant. I am also indebted to Prof. E.J. Akesson, Dr. Bernard Bressler, Dr. Bruce Crawford, Dr. Susan Harris, and Dr. Joanne Weinberg for the opportunity to gain valuable teaching experience in both the clinical and basic science fields. My thesis would not have been possible without the help and supportive environment of the U B C Anatomy Department. In particular, I would like to thank the Weinberg Lab consisting of Linda Herbert, Wayne Yu, Catherine Yu , Kathy Keiver, Kara Gabriel, Pam Giberson, Kwon Kim, Glenn Edin and the numerous undergraduate students who passed through the lab, without whom I would have never finished this thesis before the new millennium. Furthermore I would like to thank all the Anatomy graduate students for their friendship and camaraderie throughout the years. Craig Goodmurphy deserves special mention because he had to put up with me both in the Department and at home. His bizarre humour and brotherly love pulled me through the hard times. Finally, I would like to thank my family and in-laws for all their support. Joanne and Chad helped me stay sane and were also a great help xvii with the preparation of this dissertation. Mom and Dad deserve a medal for all their support and patience throughout my education. Ann and Ed have provided a sanctuary for me to run to when the times were rough or when the house was too crowded. Glenn, my dearest friend and husband, has been a pillar of strength and always been there in times of need. This thesis would never have been possible without his kindness and help. This research was funded by N I A A A and a studentship by the Medical Research Council of Canada. xviii FOREWARD Portions of this thesis have been previously published as follows: Osborn, J.A., Harris, S.R. and Weinberg, J. (1993) Fetal alcohol syndrome: review of the literature with implications for physical therapists. [Review]. Phy Ther 73, 599-607. Osborn, J.A., Kim, C.K., Yu, W.K., Herbert, L . and Weinberg, J. (1996) Fetal ethanol exposure alters pituitary-adrenal sensitivity to dexamethasone suppression. Psychoneuroendocrinology 21, 127-143 For all portions of these papers that are reported in this thesis, Jill Osborn was the major contributor involved in conducting the research, analysing the data and writing the papers. xix CHAPTER I: INTRODUCTION A. FOETAL ALCOHOL SYNDROME For more than 250 years, the effect of chronic maternal alcohol consumption on the developing foetus has been a topic of public concern (Warner & Rossett, 1975). However adverse effects of prenatal alcohol exposure were not clinically recognised until Lemoine and colleagues (1968), in France, and Jones and colleagues (1973), in Seattle, independently described a cluster of abnormalities in children whose mothers chronically consumed high doses of alcohol during pregnancy. Jones and Smith termed this cluster of symptoms the Foetal Alcohol Syndrome (FAS) (Jones & Smith, 1973). No single test can positively identify FAS, making it difficult for clinicians to diagnose affected infants. The Foetal Alcohol Study Group of the Research Society on Alcoholism developed criteria to aid in the diagnosis of FAS as well as terminology to be used when discussing the syndrome (Sokol & Clarren, 1989). In accordance with the work of Jones and colleagues (1973), it has been suggested that the minimal diagnostic criteria for FAS include symptoms in each of three categories: prenatal and/or postnatal growth deficiencies, central nervous system (CNS) impairment, and a characteristic facial dysmorphology all associated with high maternal alcohol intake (Sokol & Clarren, 1989). Further, it has been recognised from both clinical experience and epidemiological findings that FAS is only the most extreme end of the spectrum of deficits resulting from 1 prenatal alcohol exposure and that not all infants exposed to alcohol in utero develop full FAS. The term possible Foetal Alcohol Effect(s) (FAE) has been proposed to indicate that alcohol is being considered as one of the possible causes of a patient's birth defects (Sokol & Clarren, 1989). However, the term F A E has frequently been used in the literature to indicate birth defects judged milder than full FAS. Sokol and Clarren (1989) have suggested that the term F A E may be ambiguous since the relationship of the defects to maternal alcohol consumption may not be fully documented. These authors have recommended the term alcohol-related birth defects (ARBD) for describing the more subtle but still disabling symptoms that can result from prenatal exposure to alcohol (Sokol & Clarren, 1989). Children with A R B D exhibit signs/symptoms from one or more of the three diagnostic categories described above and have anatomic or functional deficits that may be attributed to the impact of prenatal alcohol exposure (Sokol & Clarren, 1989). A.1 EPIDEMIOLOGY FAS has been recognised for many years as one of the three most commonly identifiable causes of mental retardation, ranking third behind Down syndrome and neural tube defects (Abel, 1984). Recently, however, Abel and Sokol (1987) have rated it as the leading cause of mental retardation in the Western world. Its reported prevalence varies significantly with the social drinking habits of the population under study and the training of the clinicians working in the area in identifying the disorder. FAS has been identified 2 in children from all ethnic groups and socio-economic classes. However, it appears that specific ethnic groups (Native American and African American) and individuals from lower socio-economic classes have higher rates of alcohol abuse and thus increased numbers of infants diagnosed with FAS. The average number of children diagnosed with FAS in the general population ranges from 0.43 to 3.1 per 1000 live births (Abel, 1984). In some Native American communities, the incidence may be as high as 1 in 100 live births (May et al, 1983). In 23 communities in British Columbia and 14 communities in the Yukon Territories, the rate of FAS/FAE described in children below the age of 16 was 26 and 46 per 1000 respectively (Robinson et al, 1987). Although these findings appear significant, it is believed that they may, in fact, underestimate the actual numbers of affected individuals since the diagnosis relies heavily on trained clinicians to identify the cluster of symptoms, i.e. subtle but characteristic facial features, growth deficiencies, and the presence of CNS problems (Streissguth & LaDue, 1987). The recognition of FAS also relies on communication among members of an interdisciplinary health care team who have provided prenatal, perinatal and postnatal care and are aware of maternal drinking histories. Little and colleagues (1990) examined medical charts of 40 infants born to 38 alcohol abusers. Although there were positive prenatal drinking histories in the obstetricians' reports and the infants showed various signs of FAS, a diagnosis of FAS or A R B D was not mentioned in any of the 40 charts. Early diagnosis, early intervention and systematic follow-up are key components in the management of infants with FAS. Lack 3 of effective communication among professionals can contribute to failure in making an already difficult diagnosis or to making an incorrect diagnosis. A.2 PHARMACOKINETICS OF ALCOHOL Because alcohol readily crosses the placental barrier, the alcohol levels of the foetus and the mother are approximately equivalent when pregnant women drink (Waltman & Iniquez, 1972). The distribution of alcohol is almost uniform throughout the foetus and is proportional to the tissue water content. Therefore, alcohol content is particularly high in the amniotic fluid, placenta, liver, pancreas, kidney, lung, thymus, heart, and brain (Abel, 1980). Furthermore, the foetus' ability to metabolise alcohol is limited due to deficiency of hepatic alcohol dehydrogenase, the primary enzyme in the pathway for alcohol metabolism (Dow & Riopelle, 1987). Thus, the foetus relies on passive diffusion across the placenta and maternal elimination to reduce blood alcohol levels (BAL). In addition, alcohol elimination from the amniotic fluid is approximately twice as slow as that from maternal blood, resulting in high alcohol concentrations in the amniotic fluid even when alcohol in the maternal blood has been completely eliminated (Brien et al, 1983). Therefore the developing foetus is exposed to high levels of alcohol for longer periods of time than is the mother. 4 A.3 ALCOHOL TERATOGENESIS Interestingly, FAS does not occur consistently in all infants exposed to high levels of alcohol in utero. The full syndrome is seen in only about one-third of infants born to women with chronic alcoholism with the remaining two-thirds of infants showing symptoms ranging from severe disabilities to no apparent deficits, suggesting that factors other than alcohol ingestion alone are involved. Factors contributing to the pathogenesis of FAS include: genetic factors which may influence alcohol metabolism, maternal health, nutritional status, drinking pattern, parity, the timing of alcohol exposure, and the use or abuse of other substances (nicotine, caffeine, marijuana, cocaine, and narcotics) (Schenker etal, 1990). The teratogenic effects of in utero exposure to alcohol are closely related to both the timing and level of exposure. The nature of the resulting birth defects reflects the stage of embryonic development when the toxicological insult occurred. Studies have suggested that first trimester exposure is associated with organ and musculoskeletal anomalies, whereas second and third trimester exposures are associated with growth, intellectual and behavioural deficits. Neonates born to women who reduced their alcohol consumption before the third trimester were similar to offspring of rare drinkers in growth parameters, but exhibited more congenital anomalies associated with FAS/ARBDS (Rosett et al, 1983). These findings are supported by animal experiments which demonstrated that alcohol exposure during organogenesis resulted in significant skeletal and visceral anomalies but not significant behavioural abnormalities or growth 5 deficits (Sulik, 1983). Women who consumed large amounts of alcohol during the second and third trimester, after the twelfth week of gestation, had infants with fewer physical anomalies but more growth, mental, and behavioural abnormalities than those who ceased drinking before the twelfth week of gestation (Aronson & Olegard, 1987). Similarly, rodents exposed to alcohol during the period equivalent to the second and third trimester in humans (the period of most rapid brain development) exhibited significant cognitive and behavioural abnormalities (Meyer et al, 1990b). The scientific community has yet to establish "safe" levels of alcohol consumption during pregnancy. Animal research has established that the teratogenic actions of alcohol are dose-dependent (Randall et al., 1977); however, literature on human consumption during pregnancy is less clear. Epidemiological studies have indicated a definite risk for the development of "alcohol related birth defects" in infants of women who had consumed greater than six drinks per day during pregnancy (Ernhart et al., 1989). Data from Streissguth and colleagues (1989 & 1990) suggest that "social" drinking (1 ounce of absolute alcohol per day) could result in intellectual deficits. Three drinks per day during pregnancy were associated with lower IQ's in children at four years of age (Streissguth et al, 1989); two drinks a day during pregnancy were associated with a seven point decrement in IQ at seven years of age (Streissguth et al, 1990). Importantly, it appears that it is not the amount of alcohol consumed but rather the peak blood alcohol level reached that is the key factor in producing deficits (Pierce & West, 1986). Both animal (West et al, 1989) and human studies (Clarren, 1986; Clarren 6 et al, 1990) have demonstrated that binge drinking at high levels may have more devastating effects on the developing foetus than intake of the same dose of alcohol over a longer interval of time. For example, a specific dose of alcohol given to rats, condensed over a few hours as compared to spread over a 24 hour period, resulted in higher blood alcohol concentrations and produced more severe microcephaly, and greater neuronal loss, behavioural hyperactivity and impaired spatial navigation (West et al, 1989). Therefore, when discussing a "safe" level of alcohol, it is probable there is no single dose-response relationship for ethanol teratogenesis but rather that each abnormal outcome in structure, function, morphology or growth has its own dose-response and gestational timing parameter (Clarren, 1986). A.4 CLINICAL FEATURES OF FAS As noted above, the minimal diagnostic criteria for FAS include prenatal and/or postnatal growth deficiencies, CNS abnormalities and a characteristic facial dysmorphology. However alcohol has been shown to have teratogenic effects on almost every system of the body (Schenker et al, 1990). The multiplicity of abnormalities that may be associated with FAS include not only congenital facial malformations and/or mental retardation but also a variety of organ, musculoskeletal, neurologic, and developmental differences. Each individual displays a variable combination and severity of symptoms so that, although commonalities exist clinically, each person with FAS is also unique. 7 Intrauterine growth retardation appears to be directly proportional to the degree of maternal alcohol intake, even with statistical adjustment for other contributing variables such as smoking, parity and gestational age (Streissguth et al, 1980). Children with FAS are usually below the third percentile in weight, height and head circumference. It has been shown that ingestion of one ounce of alcohol per day during the last trimester of pregnancy can result in a decrease in birth weight by 150 grams (Umbreit & Ostrow, 1980). However, i f alcohol consumption is reduced during the last trimester, growth outcome improves (Rosett & Weiner., 1983). Unlike prenatal growth deficiency observed in offspring of smokers, postnatal "catch-up growth" does not usually occur in children with FAS. Whereas infants of smokers demonstrate significant "catch-up growth" and are the same size or just slightly smaller than infants of nonsmokers at 12 months of age, infants with FAS who are on average 700 grams smaller at birth were approximately 4000 grams smaller than infants of non-drinkers at 12 months. For most children, the growth deficiencies persist throughout adolescence into adulthood. Streissguth and colleagues (1991), in a follow-up of 61 adolescents and adults with FAS, demonstrated continued growth deficiencies in height and head circumference for both men and women; the effect of prenatal alcohol exposure on weight was more variable, with weights ranging from extremely thin to very heavy. Alcohol exposure in utero can result in malformations in almost all systems of the body with varying levels of incidence. As previously noted, craniofacial dysmorphology is one of the most characteristic traits and is used in the clinical diagnosis of FAS. The dysmorphic characteristics include: midface hypoplasia, thin upper lip, a long flat . 8 philtrum, low set ears, low anterior hairline, short palpebral fissures, epicanthal folds, upturned nose, ptosis, strabismus and microphthalmia. Cardiac malformations occur in 29-41% of infants with FAS (Sandor et al, 1981), the most common being atrial or ventricular septal defects. Genital and renal malformations occur in almost half of infants with FAS (Clarren & Smith, 1978). These include genital hypospadia, labial hypoplasia, aplastic, dysplastic or hypoplastic kidneys, ureteral duplications, megaloureter, hydronephrosis, cystic diverticulae and vesicovaginal fistulae. Microcephaly occurs in greater than 80% of infants with FAS (Clarren & Smith, 1978). Though generally prenatal in onset, it becomes more evident as the child matures, thus reflecting deficient brain growth. The most common brain anomalies are associated with failure or interruption of neuronal, and glial migration and include cerebellar dysgenesis, cerebral nuclear dysgenesis, agenesis of the corpus callosum and neuroglial heterotopias (Clarren, 1986; Mattson et al, 1992). Neural tube defects including lumbosacral myelomingocele and anencephaly occur at a higher rate in children with FAS than in the normal population (Freidman, 1982). Other clinical neurologic findings include alterations in cerebellar function (Hanson et al, 1978), generalised hypotonicity (Streissguth & LaDue, 1987), increased rates of cerebral palsy and hemiparesis or hemiplegia (Olegard et al., 1979), and an increased incidence of seizure disorders (Burd & Martosolf, 1989). Furthermore, immune dysfunction has been recorded to occur at a higher incidence in children with FAS. Johnson and colleagues (1981) reported that patients 9 with FAS had increased rates of bacterial infections, decreased erythrocyte-antibody complement, rosette forming lymphocytes, and diminished mitogen-induced lymphocyte proliferative responses, suggesting immune system dysfunction. A number of malignancies have been reported to occur in children with FAS including rhabdomyosarcoma, Wilms-tumor, acute lymphocytic leukaemia, adrenal carcinoma, hepatoblastoma, neuroblastoma, and ganglioneuroblastoma (Zaunschirm & Muntean, 1984). Orthopaedic anomalies are found in as many as half of the children diagnosed with FAS (Goldberg, 1987). Many of the abnormalities occur at rates higher than in the general population including congenital hip dislocation, limited supination or synostosis of the elbow, hypoplasia of the terminal phalanges, thoracic cage abnormalities, hypoplasia of the radial head, clinodactyly of the toes, camptodactyly of the fingers, delayed skeletal maturation and club foot (Smith et al, 1981; Spiegel et al, 1979). Other anomalies seen with FAS include spinal stenosis, abnormalities of the cervical spine, scoliosis, ligamentous laxity, flexion contractures of the elbow and Polydactyly (Smith et al, 1981; Spiegel etal, 1979). Upper airway obstruction due to physical anomalies has been reported in a number of infants with FAS (Usowicz et al, 1986). Respiratory complications associated with upper airway obstruction include obstructive apnea, respiratory arrest, chronic hypoxia, and pulmonary hypertension; these complications place these infants at increased risk for sudden infant death syndrome. 10 A.5 BEHAVIOURAL PROBLEMS. Characteristics in early life of infants with FAS include irritability with decreased total body activity, decreased suckling, cerebral excitation, severe tremors, decreased ability to habituate, insecurity, sleeping disorders, decreased alertness and failure to thrive (Hill & Tennyson, 1980; Pierog et al, 1977; Streissguth et al, 1980). In severe cases, alcohol withdrawal symptoms may also occur. Withdrawal symptoms are similar to those of adults with chronic alcoholism: irritability followed by tremors, spontaneous seizures, hypertonia, abdominal distention, opisthotonos, hyperacusis and increased respiratory rate (Pierog et al, 1977). Moreover, other symptoms described in adults with chronic alcoholism, such as hyperactivity, tachycardia, tremors of the body, severe intention tremors and abnormal fears have also been reported in early life in children with FAS (Hill & Tennyson, 1980). These symptoms decrease over the first 18 months of life. Children with FAS tend to be hyperactive, impulsive, emotionally labile, easily distractible and have higher rates of learning disabilities. Landesman-Dwyer and colleagues (1981) found that 3.5-4.5 year old children of moderate drinkers (0.45 oz per day) had decreased attention spans and were inattentive and fidgety. In addition, it has been reported that some children with F A S / A R B D also fulfil the diagnostic criteria of autism (Harris et al, 1995; Nanson, 1992). Many of the behavioural problems seen in children with FAS persist through adolescence and into adulthood, the most common being attention deficits, poor social adaptation, and problems with comprehension and abstraction (Streissguth et al, 1991). Furthermore, adolescents and adults with FAS have 11 been documented to have spatial memory deficits as well as social-behavioural problems such as lying and defiance (Streissguth et al, 1991). Streissguth and colleagues (1991) conducted a follow-up study of 61 adolescents and adults with FAS and found none were independent in terms of either housing or income, due primarily to lifelong behavioural, social and cognitive disabilities. A.6 COGNITIVE IMPAIRMENT. Mental retardation is one of the most devastating effects of alcohol exposure in utero. When tested as adolescents and adults, the average IQ of 82 persons diagnosed with FAS/FAE was 70, which is in the borderline to mildly retarded range (Streissguth et al, 1989). In an earlier study, Streissguth and colleagues (1978) reported that the IQs of 20 children with FAS varied between 16 and 105 with a mean of 65. Research by Conry (1990) supports these findings; evaluation of 19 school age children revealed IQ's ranging between 40 and 101. The number of physical malformations appears to be inversely related to intellectual outcome; the greater the number of anomalies, the lower the IQ (Streissguth et al, 1989). In addition, children with FAS have higher rates of speech and language problems (Autti-Ramo & Granstrom, 1991a; Autti-Ramo & Granstrom, 1991b; Greene et al, 1990), auditory disorders (Church & Gerkin, 1988), visual disorders (Stromland, 1990), and visual perceptual problems (Aronson, et al, 1985). Although some individuals with FAS have IQs within the normal range they still may exhibit learning disabilities, perceptual, behavioural and language disorders and therefore are unable to function at the same level as nonexposed children. 12 A.7 MOTOR DEFICITS. Jones and colleagues (1973) reported poor performance on motor tests, with delayed motor development, in children (ranging from 3 to 57 months of age) with FAS. Even during the neonatal period, infants with FAS showed motor abnormalities such as increased body tremors, abnormally increased hand-to-mouth activity, decreased total body movements, and increased head to the left orientation (Landesman-Dwyer et al, 1978). Recently, Autti-Ramo and Granstrom (1991b) assessed 53 infants ( ages 18-19 months) who were exposed to alcohol prenatally and found motor delay to be more common than cognitive delay. In addition, research has suggested that the neuromotor deficits associated with FAS are not influenced by the postnatal environment. Children who were placed in foster homes did not show improvement in motor testing when compared to matched pairs who remained in the care of their birth mothers (Kyllerman et al, 1985). Thus, the abnormalities and delays in motor development are thought to be prenatal in origin and resulting from in utero alcohol exposure. Motor delay has been reported in infants with FAS at birth (Jones & Smith, 1973), eight months (Harris et al, 1993; Streissguth et al, 1989), twelve months (Golden et al, 1982), four years (Barr et al, 1990; Streissguth et al, 1989), six and seven years (Kyllerman et al, 1985; Streissguth et al, 1985), and six to eighteen years (Conry, 1990) of age. Infants demonstrated below normal scores on the Psychomotor Developmental Index of the Bayley Scales of Infant Development as well as weak grasp, tremulousness and poor eye-hand co-ordination (Jones et al, 1973; Jones & Smith, 1973; Streissguth et 13 al, 1989; Golden et al, 1982; Harris et al, 1993). Four year old children exposed to alcohol in utero scored significantly lower on the Wisconsin Fine Motor Steadiness Battery including time to complete the grooved peg board, errors on the grooved form boards, and latency to self correct (Streissguth et al, 1989). There appeared to be a dose response correlation between the amount of alcohol consumed by the mother and the motor performance scores of the offspring; increased alcohol consumption resulted in decreased motor performance scores. Autti-Ramo and Granstrom's (1991b) research supported these findings; evaluation of 80 children exposed to alcohol in utero was carried out 1-3 times during the first year of life. Exposure throughout pregnancy resulted in increased incidence and severity of developmental delays whereas reduction in maternal alcohol intake by the second trimester resulted in only slight abnormalities in motor development. In addition, Barr and colleagues (1990) reported that 4-year-old children exposed to alcohol in utero scored lower on finger tapping and tactual performance tests, and had lower subjective fine motor scores as rated by examiners blinded to their condition. Six to seven year old children with FAS scored on average 1.5 standard deviations below the mean on the motor age examination (Johnson et al, 1951) and the modified Oseretsky Test (Kyllerman et al, 1985). Although the children could complete all test items, they lacked plasticity, economy and speed of performance. Interestingly six out of 21 children in this study also had noticeable tremors. Finally, Corny (1990) evaluated 19 Native American children with FAS between the ages of six and eighteen years, comparing them to gender and age matched controls in order to control for differences 14 due to cultural isolation. Children in the FAS group received significantly lower scores on sensory-motor tasks such as reaction time, non-dominant finger tapping, grip strength, and motor speed as assessed using the Detroit Test of Learning Aptitude as well as on the Beery Buktenika Test of Visual Motor Integration. Motor development in infants with FAS corresponds more closely to their mental age than to their chronological age (Jones & Smith, 1973). It has been suggested that the deficits in gross motor performance seen in infancy dissipate with age, whereas fine motor deficits persist (Dehaene et al, 1984). However, a number of recent studies have demonstrated that some deficits in gross motor co-ordination persist. Barr et al, (1990) evaluated 449 4-year-old children exposed to various levels of alcohol during gestation, on a battery of gross motor tasks adapted from the gross motor scale developed at the Crippled Children's Division of the University of Oregon Medical School. The assessment consisted of 14 tasks to evaluate control of head, trunk, lower extremities and locomotion. Children exposed to alcohol in utero scored significantly lower than nonexposed children on the majority of tests, specifically those associated with balance. Again, most of the alcohol-related motor deficits were dose-related, reinforcing the concept of no known "safe" level of consumption. B. ANIMAL MODELS OF FAS To identify alcohol as a classic teratogenic agent, animal models have been developed. Human studies are often unable to control for or isolate specific alcohol 15 effects from environmental effects such as pattern and level of exposure, maternal nutritional status, health, age and ability to metabolise alcohol, parity, and the exposure to other substances of abuse (nicotine, caffeine, marijuana, cocaine, and narcotics). Furthermore, the mechanisms for induction of the abnormalities cannot be examined and the length of time required to evaluate late onset problems and developmental abnormalities is very long in humans. Animal models have allowed researchers to conduct controlled studies in which the specific effects of alcohol can be isolated. B.l RODENT MODEL Rodent models have been highly utilised in foetal alcohol research due to the fact that rodents are small, easily handled, have, a short gestation, are relatively inexpensive to purchase, house and feed (Keane & Leonard, 1989). In addition, rat strains have been bred in controlled environments which helps to control for early experience variability. The rat foetus has a similar metabolism and foetal development follows a sequence of stages similar to the human foetus but differs in the timing of stages with respect to birth. For example, in order to understand the impact of alcohol on brain development in rodent models or to compare the results from animal studies to humans, it is important to consider differences in brain development between the two species. For humans, the major brain growth spurt occurs during the third trimester of gestation and growth then continues for about two years postnatally (West, 1987). In contrast, the major brain growth spurt in the rat occurs during the first 10-14 days of postnatal life (this can be called the "third trimester equivalent") (West et al, 1989). Although alcohol can affect 16 the brain at any stage of development, it is probably the most vulnerable period is during the brain growth spurt. Thus rodent models'may use a prenatal exposure paradigm which primarily affects neurogenesis and cell proliferation or may use a postnatal exposure paradigm which covers the brain growth spurt and primarily affects neuronal migration and differentiation and most of the gliogenesis and synaptogenesis (West, 1987). In the present studies the effects of prenatal ethanol exposure on the hypothalamic-pituitary-adrenal (HPA) axis were studied using a prenatal model, as the H P A axis develops and begins to function during prenatal life in the rat. B.2 ADMINISTRATION OF ALCOHOL AND NUTRITION Chronic ingestion of alcohol has profound effects on nutritional status. Primary malnutrition can result from displacement of other nutrients by alcohol because of alcohol's high energy content. Animals have been shown to decrease water and food consumption when given alcohol (Weinberg, 1984) and human studies have demonstrated that chronic consumption of high doses of alcohol results in weight loss even though the calorie intake may be sufficient to maintain body weight (Lieber, 1991a; Pirola & Lieber, 1972; Pirola & Lieber; 1976). Alcohol can also cause secondary malnutrition as a result of maldigestion or malabsorption of nutrients from the gastrointestinal tract, alteration of nutrient activation, utilisation and degradation, and changes in metabolism (Lieber, 1991a; Lieber, 1991b; Lieber, 1988; Lieber, 1986; Lieber, 1983; Weinberg, 1984). Furthermore, the transport of nutrients and oxygen across the placenta may be disrupted by vascular changes in the placenta induced by 17 chronic alcohol intake (Gordon et al, 1982; Jones et al, 1981; Mukherjee & Hodgen, 1982; Pratt, 1980). Malnutrition itself has been demonstrated to be teratogenic and nutritional state can affect alcohol metabolism (Weinberg, 1985). Although malnutrition may have teratogenic effects, it is not the primary cause of developmental abnormalities seen in FAS (Weinberg, 1985). The inclusion of pairfed groups (animals whose caloric intake has been matched to that of alcohol consuming animals) has demonstrated that although poor nutrient (especially low protein (Shorey & Erickson, 1982)) intake can act synergistically with alcohol, alcohol is the main teratogen causing FAS (Weinberg, 1985; Wiener, 1980; Wiener et al, 1981). However, it must be remembered that while pair feeding can control for primary malnutrition it cannot control for secondary malnutrition. In addition, although pair feeding provides an essential nutritional control group, pair feeding itself is an experimental treatment ( Weinberg, 1984). For example, pair feeding can produce shifts in the circadian rhythm of a number of physiologic variables as well as alter body and organ weights and behaviour of both the maternal female and offspring (Gallo & Weinberg, 1981; Weinberg, 1989; Weinberg & Gallo, 1982). Another factor which must be considered when feeding ethanol to rats is the method of administration. There are a number of different methods for administration of ethanol including: injection, intubation, placing ethanol in the drinking fluid, and ethanol in a liquid diet. The method of administration must suit the scientific question being studied. In the present studies, the route of administration had to be non-stressful as it has 18 been demonstrated that perinatal administration of glucocorticoids can result in alterations in cellular growth, neuronal myelination and differentiation, and interfere with normal biochemical, and physiologic processes (Weichsel, 1977). Injection and intubation allow for administration of a controlled dose of ethanol and high blood alcohol levels (B A L ) to be reached; but both require a great deal of handling and involve a fair amount of stress. Placing ethanol in the drinking water is non-stressful but the taste of alcohol is aversive, resulting in the rodents not drinking concentrated solutions; therefore high B A L s are not reached and rodents reduce their liquid and food intake (Wiener, 1980). Addition of ethanol through a liquid diet provides a non-stressful method of administration which allows for high B A L s to be reached and adequate nutritional status to be maintained (Lieber & De Carli, 1989). Therefore, ethanol in a liquid diet was chosen as the method of administration in the present studies. B.3 EFFECTS OF ETHANOL EXPOSURE ON RODENTS Rodents exposed to ethanol (ETOH) in utero develop many abnormalities similar to those seen in children with FAS including: developmental delay, balance deficits, gait abnormalities and behavioural and cognitive deficits. Foetal ethanol exposed (E) rats demonstrate delayed incisor eruption, delays in the ability to elevate the head above the supporting surface and in the ability to elevate the pelvis using hindlimbs, as well as impaired balance and locomotor co-ordination (i.e. ability to traverse two parallel horizontal rods) (Meyer et al, 1990a). E animals show deficits in balance tasks (i.e. they have more difficulty staying on a rotating drum and fall off inclined planes at more 19 gradual angles than unexposed animals) (Abel & Dintcheff, 1978). Furthermore, E animals demonstrate delays in development of certain postural reflexes including righting reflex (ability to return to all four feet after being placed on the dorsum); negative geotaxis (ability to rotate 180 degrees from a head down position on an inclined plane); and reflex suspension (ability to maintain a grip on a cross bar) (Norton et al, 1988). E rats have also been shown to have gait abnormalities similar to those seen in humans exposed to alcohol in utero. Chronic maternal alcohol exposure (Hannigan & Riley, 1988), as well as exposure only during the period corresponding to the growth spurt of the cerebellum (Meyer et al, 1990b), and consumption of alcohol in a "binge-like" fashion (Bonthius & West, 1990; Goodlett et al, 1991), have all been demonstrated to lead to gait and co-ordination difficulties in E offspring. Animals exposed to ethanol prenatally and perinatally demonstrate impairments on several tests of balance and motor ability and have significantly lower whole brain and cerebellar weights when compared to control animals (Goodlett et al, 1991; Hannigan & Riley, 1988; Meyer et al, 1990b; Norton et al, 1988; Pierce & West, 1986; Sulik, 1983; West, 1987; West et al, 1989). Gait differences include shorter stride length, increased angle of placement of hindfeet and decreased symmetry in gait relative to controls (Meyer et al, 1990a; Hannigan & Riley, 1988). The histological evaluation of E animal brains has demonstrated alterations in layer 5 of the cortex and changes in total cortical thickness (Kotkoskie & Norton, 1989), changes in microvasculature in the cerebellum, hippocampus, and dentate gyrus (Kelly et al, 1990), and altered cerebellar morphology (Hannigan & Riley, 1988) suggesting that the motor deficits may be a result of altered brain development. ' 20 Furthermore, behavioural and cognitive deficits have been demonstrated in E rats (Abel, 1979). Behavioural deficits which reflect hyperactivity and hyperresponsiveness have also been seen in E animals. These include increased open field activity, (Bond, 1981; Bond, 1986), increased wheel running (Martin et al, 1978), increased startle reaction (Anandam et al, 1980) and increased exploratory behaviour (Bond & DiGiusto, 1977a; Riley & Meyer, 1984). In addition, E rats appear to have deficits in response inhibition; they demonstrate deficits in passive avoidance learning, (Bond & DiGiusto, 1977b; Bond & DiGiusto, 1978; Gallo & Weinberg, 1982; Riley et al, 1979a; Riley et al, 1986) taste aversion learning (Riley & Meyer., 1984), and reversal learning (Lochry & Riley, 1980) as well as alterations in nose poking behaviour (Riley et al, 1979b). Neurotransmitters and neuropeptide systems have also been shown to be adversely affected by prenatal ETOH exposure and may, in part, play a role in behavioural and cognitive problems seen in FAS (Druse, 1992). Moderate to high doses of ETOH result in significant decreases in whole brain serotonin (5-HT), dopamine (DA), and norepinephrine (NE) levels, decreases in 5-HT and D A synthesis and reuptake, low turnover of N E , and variable change in glutamate, acetylcholine, histamine, and G A B A levels (Druse, 1992). Further, E rodents also demonstrate alteration in physiological responses including decreased ability to thermoregulate following administration of ETOH, pentobarbital, diazepam, or morphine (Nelson et al, 1983b; Taylor et al, 1981; Taylor e/ al, 1987). 21 C. PSYCHONEUROENDOCRINOLGY AND STRESS The survival of an organism in an ever changing world requires the organism to be able to maintain its internal environment within narrow limits. The integration and co-ordination of multiple specialised cells allows the animal to maintain its existence and reproduce. To survive, the animal requires the capacity to adjust and to adapt to hostile conditions in the external environment, and to co-ordinate reproduction with those factors in the internal and external environments that are most conducive to survival of the offspring (Sapolsky, 1992). Selye (1936) defined stress as "an alteration in the body's hormonal and neuronal secretions caused by the central nervous system in response to a perceived threat" and defined a stressor as "a change in an organism's internal or external environment which is perceived by the organism as threatening." The term stress has a very broad usage in the scientific and popular literature. Stress has been used to describe a mental/emotional state, a perceived threat in the external environment, or as the physiologic changes which occur secondary to external threats. Selye's definitions of stress and stressor mentioned above will be used in this dissertation. Selye's work and that of Cannon serve as the foundation for stress research (Mason, 1975a; Mason, 1975b; Selye, 1973). Cannon considered stress as a disturbance in an organism's homeostasis caused by a stressor. Stressors included events such as cold exposure, hypoxemia, hypoglycemia, hemorrhage and emotional stimuli. Cannon's work emphasized the role of the autonomic nervous system in restoring homeostasis. The other pioneer in this field, Selye emphasized the role of the pituitary-adrenal system in 22 the stress response. He proposed that glucocorticoid release was a non-specific stress response to all stressors and was integral to the stress response. In addition, he suggested that acute stress allowed an organism to adapt to the environment while chronic stress exhausted this adaptive response and was potentially harmful to the organism's survival. Selye (1936) first described a stress syndrome produced by 'diverse noxious agents' such as surgical injury, spinal shock, exposure to cold, excessive or sublethal doses of a variety of drugs. He termed the acute phase the 'general alarm reaction' occurring over minutes or hours and the chronic phase the 'general adaptation syndrome', which is the organism's attempt to adapt to stimuli repeatedly presented over days. Overall, the perceived threat (internal or external) sets up a cascade of events that results in a physiologic reaction including endocrine and behavioural changes. Over the past two decades the concept of absolute nonspecificity of bodily responses to all stressors as Selye (1973) described has been modified to reflect differences in the neuroendocrine response to various stressors (Kopin, 1995). The development of new techniques has allowed for more precise measurements of neurotransmitters and hormone responses resulting in the finding that there are different patterns of neuroendocrine responses to different stressors. For example, in a recent study by Kopin (1995) it was demonstrated that the catecholamine and andrenocorticotrophin (ACTH) responses varied with exposure to two different stressors, haemorrhage and formalin. Further, it was shown that exposure to the same stress but at different intensities, haemorrhage of 10% or 25% of blood volume and formalin concentration 1% or 4%, results in a different magnitude of neuroendocrine responses. 23 Furthermore, Cannon's and Selye's concept that the differences in the stress response seen among individuals may be due to genetic variations and that these variations can be modified by experience has stimulated a lot of research in the stress and chronic illness field. It is thought that maladaptive neuroendocrine responses to stressors may be involved in psychiatric, metabolic and/or autoimmune diseases as well as disturbances of growth and development (Stratakis & Chrousos, 1995). C.l HORMONES AND STRESS Stress can affect the release of virtually every hormone in the body, and thus has widespread effects on many physiologic functions. The present discussion will be limited to the endocrinological effects of stress. The body responds to stressors by releasing a number of hormones: corticotrophin releasing factor (CRF) and arginine vasopressin (AVP) from the hypothalamus, A C T H . and P-endorphin (P-EP) from the anterior pituitary, and corticosterone (CORT) from the adrenal cortex (Asterita, 1985). In addition, prolactin, lutenizing hormone, and growth hormone secretion increase with acute stress, thyroid stimulating hormone secretion can be increased (Armario et al, 1984a) or decreased (Armario et al, 1984b) depending upon the stressor, and follicle stimulating hormone tends to be unaffected by stress (Armario et al, 1984c). Furthermore, epinephrine and N E are released from the adrenal medulla and N E from sympathetic nerves (Asterita, 1985). A l l these hormones alter the animal's internal environment in order to help increase the animal's ability to withstand stress by affecting 24 the cardiovascular, energy producing and immune systems (Asterita, 1985; Stratakis & Chrousos, 1995). The control of the HPA axis is through various feedback loops which inhibit further release of hormones (Calogero et al, 1988). The median eminence (ME) can be viewed as an interface between hypothalamic/extrahypothalamic neuronal systems and the pituitary-adrenal system. Approximately 30 neurochemicals can be found in the M E , reinforcing the complexity of the control of the HPA axis (Jacobowitz, 1988). The H P A axis responds to stressors by releasing CRF and A V P . CRF and A V P release can be stimulated by NE, acetylcholine, enkephlins, angiotensin II, histamine, serotonin (5-HT), and P-EP (Calogero, 1995), and can be inhibited by y-aminobutyric acid (GABA) (Calogero, 1995), a-melanocyte stimulating hormone, A C T H , and CORT (Asterita, 1985; Jacobowitz, 1988), CORT not only inhibits the release of CRF but also appears to decrease its synthesis (Uht et al, 1989). A C T H is primarily controlled by CRF secretion from the hypothalamus into the hypothalamic-hypophysial portal system (Asterita, 1985; Goodman, 1988). However, A V P and oxytocin (OT) can modulate the effects of CRF which may be important in the mediation of the stress response (Gibbs, 1986). A V P stimulates the release of A C T H , potentiating the response of CRF (Gibbs, 1986; Gillies et al, 1982; Yates et al, 1971). OT also stimulates secretion of A C T H in rats (Antoni et al, 1983; Lutz-Bucher et al, 1982) but is inhibitory in primates (Antoni et al, 1983; Legros et al, 1982)). CORT 25 feedback is the main inhibitory stimulus controlling A C T H secretion (Jones & Gillham, 1988; Keller-Wood & Dallman, 1984; Wilkinson et al, 1981). Administration of high doses of dexamethasone (DEX), a synthetic glucocorticoid, to normal rats and adrenalectomized rats results in decreased CRF receptors in the rat pituitary in parallel with the decrease in A C T H secretion (Hauger et al, 1987; Hauger et al, 1989; Spinedi et al, 1991; Uht et al, 1989; Wynn et al, 1983). In addition, prolonged restraint stress (more than 12 hours) may also result in a reduction of CRF receptor numbers in the anterior pituitary (Hauger et al., 1988). The final common pathway in the HPA system is the release of CORT by the adrenal cortex. A C T H released from the anterior pituitary reaches the adrenal cortex through the systemic circulation (Goodman, 1988). A C T H stimulates both the synthesis and secretion of CORT (Goodman, 1988; Jones & Gillham, 1988; Keller-Wood & Dallman, 1984). Once released, CORT acts to alter metabolism and utilisation of fats, proteins and carbohydrates, to control electrolyte balance, and to stimulate or suppress the immune system depending upon the length of exposure (Asterita, 1985; Goodman, 1988). In addition, CORT rigidly controls the activity of the HPA axis by feedback to multiple levels of the system further inhibiting the release of "stress hormones" (Keller-Wood & Dallman, 1984). The control of the stress response through multiple feedback loops occurs in at least 3 different time domains and at least 3 different levels (Jones & Gillham, 1988; Keller-Wood & Dallman, 1984). In addition, the stress response varies with the intensity 26 of the stimulus, the length of exposure (chronic vs acute), and prior exposure to that specific stimulus or other stimuli (Keller-Wood & Dallman, 1984). Therefore, the physiological mechanisms controlling hormonal responses to stress, specifically the CORT negative feedback system, are not easily discerned. CORT feedback inhibition of A C T H and CRF occurs within seconds (fast rate sensitive inhibition), over 2-10 hours (h) (intermediate inhibition), and over h to days (slow inhibition) (Jones & Gillham, 1988; Keller-Wood & Dallman, 1984). The fast feedback inhibition appears to be rate sensitive acting during the period of increasing plasma CORT concentration (Abe & Critchlow, 1977; Jones & Tiptaft, 1977; Kaneko et al, 1981). The rate of CORT rise required for inhibition varies between sexes, and is greater in females than males (Critchlow et al, 1963). The sex steriods appear to influence the H P A axis indirectly through inactivation of corticosteroids, through hepatic enzyme systems (Glenister & Yates, 1961; Kitay, 1961) or binding proteins (Sandberg & Slaunwhite, 1959; Slaunwhite et al, 1962) resulting in higher total CORT but proportionately lower free CORT concentration and higher clearance rates of CORT in female rats. Fast feedback inhibits release of A C T H and CRF but does not affect synthesis of A C T H and CRF (Keller-Wood & Dallman, 1984). In vitro studies have demonstrated that perfusion of rat pituitaries with D E X or CORT inhibits CRF-stimulated A C T H secretion without affecting A C T H content (Widmaire & Dallman, 1984; Widmaire & Dallman, 1983a; Widmaire & Dallman, 1983b). In addition, pre-treatment of the pituitary with a protein synthesis inhibitor (cycloheximide) does not alter the response to feedback inhibition (Widmaire & Dallman, 1983b). Interestingly, only 27 steroids with both 21-hydroxyl and 11-P-hydroxyl groups cause fast feedback inhibition while 11-deoxycorticosterone and 11-deoxycortisol antagonise the fast feedback effects of CORT (Jones & Tiptaft, 1977). Delayed feedback inhibition (intermediate and slow) acts independently of circulating CORT levels at the time of the stress and requires 45 min to 120 min to develop (Dallman & Yates, 1969). Delayed inhibition of A C T H and CRF appears to depend on the levels of CORT achieved ( Dallman & Yates, 1969; Sayer & Sayer, 1947), the interval since the administration of the CORT (Dallman et al, 1987; Dallman & Jones, 1973; Dallman & Yates, 1969) and the total dose of the CORT administered (Jones & Tiptaft, 1977; Takebe et al, 1971). Intermediate inhibition can be detected at 30 min with the maximal effect occurring at 2-4 h (Dallman et al, 1987; Dallman & Yates, 1969; Kendall, 1971; Takebe et al, 1971) and an attenuation of the response at 6-12 h after administration of CORT (Dallman & Yates, 1969; Keller-Wood & Dallman, 1984). The latency and duration of the inhibition is dependent upon the total dose and duration of the CORT exposure (Abe & Critchlow, 1980); prolonged periods of inhibition occur with extremely high doses (4 mg CORT) or repeated exposure (Jones et al, 1974). In addition, the receptors for delayed feedback appear to be different from those for fast feedback since either 21-hydroxyl or an 11-P-hydroxyl group are effective (Jones & Tiptaft, 1977). Intermediate inhibition results in decreased release of both A C T H and CRF and a decrease in CRF synthesis, whereas slow inhibition also decreases A C T H synthesis (Keller-Wood & Dallman, 1984). Within 2 h of exposure to CORT there is a 28 decrease in A C T H release (Abou-Samra et al, 1986), a decrease in pituitary sensitivity to CRF (Rochefort et al, 1959; Zatz & Reisine, 1985) and to K + and Ca + + stimulation (Arimura et al, 1969; Fleischer & Vale, 1968; Koch et al, 1974; Kraicer et al, 1973), inhibition of acetylcholine-stimulated CRF release (Edwardson & Bennett, 1974) and CRF synthesis (Hauger et al, 1987; Hauger et al, 1989), and decreased A C T H response to haemorrhage (Plotsky & Vale, 1984). Prolonged exposure to CORT for greater than 12 h results in inhibition of both A C T H release (Engeland et al, 1975) and A C T H synthesis (Schacter et al, 1982). In addition to effects on the pituitary and hypothalamus, CORT also has inhibitory feedback effects on the brain. Two major classes of CORT receptors have been identified within the brain (Funder, 1986; Spencer et al, 1990). Type I receptors which are high affinity, low capacity receptors are located in large concentrations in the hippocampus and lateral septum, with little to none in the hypothalamus (Gerlach & McEwen, 1975; Stumpf & Sar, 1976; Waremboug, 1975). Type I receptors are 90% occupied during the trough of the normal circadian cycle and thus are thought to play a tonic role in circadian rhythms (De Kloet & Reul, 1987; Reul & De Kloet, 1985; Reul & De Kloet, 1986). Type II receptors, which are low affinity high capacity receptors, have a widespread distribution throughout the brain and are located in the highest density in the paraventricular nuclei of the hypothalamus, lateral septum, dentate gyrus, nucleus tractus solitarius and central amygdala (Agnati et al, 1985; Gustafsson et al, 1983; Waremboug, 1975). Type II receptors are 5-50% occupied during normal circadian rhythms and thus 29 thought to be involved with feedback regulation of stress-induced and nocturnal increases of CORT (De Kloet & Reul, 1987; Reul & De Kloet, 1985; Reul & De Kloet, 1986). The complex system of feedback loops controlling the H P A axis gives rise to a malleable but stringent regulatory system. It allows for varied responses in proportion to the magnitude of the stimuli and habituation or sensitisation to repeated exposure to a stimulus or to varied stimuli (Keller-Wood & Dallman, 1984; Pitman et al, 1990). Its rigorous control over the HPA axis allows the animal to cope with environmental stressors (internal and external) and protects against over-stimulation and detrimental effects of continued exposure to "stress hormones". C.2 CORTICOTROPHIN RELEASING FACTOR AND BEHAVIOUR It has been demonstrated that CRF, A C T H , and CORT modulate behaviours during stress (McEwen et al, 1986). CRF neurons have been localised in a number of areas in the CNS other than the hypothalamus including limbic structures, cortex and in close association with the central autonomic system i.e. hypothalamus and locus coeruleus (LC),(Brown, 1986; De Souza & Insel, 1990; Sawchenko & Swason, 1990; Schiper et al, 1983). It has therefore been suggested that CRF's actions extend beyond -that of HPA axis stimulation to involve simultaneous activation and co-ordination of metabolic (Brown et al, 1982a; Brown et al, 1982b), circulatory (Brown & Fisher, 1985; Brown & Fisher, 1986; Brown et al, 1986), and behavioural responses (Britton et al, 1982; Britton et al, 1981; Sutton et al, 1982) to stress. Furthermore, it is now 30 generally accepted that CRF fulfils the requisite criteria to be considered a neurotransmitter (Nemeroff, 1992). Intracerebroventricular (ICV) administration of CRF can activate the HPA axis but can also inhibit luteinizing hormone (Ono et al, 1984; Ono et al, 1985; Rivier & Plotsky, 1986; Rivier & Vale, 1985; Taya & Sasamoto, 1989) and growth hormone release (Rivier & Plotsky, 1986; Rivier & Vale, 1985; Taya & Sasamoto, 1989). ICV-CRF appears to have no effects on follicle stimulating hormone, thyroid stimulating hormone or prolactin (Rivier & Vale, 1985). In addition, ICV-CRF can activate the sympathetic and parasympathetic nervous systems (Brown, 1986; Brown & Fisher, 1985; Brown et al, 1982a; Brown et al, 1982b, Brown et al, 1986) and has widespread effects on the gastrointestinal system (Dunn & Beridge, 1990; Tache et al, 1990) all of which are associated with response to or adaptation to stress. For example, CRF administration results in increased splanchnic nerve activity and increases in plasma N E and E levels (Kurosawa et al, 1986). These neurochemicals in turn cause a number of metabolic and physiologic changes (Brown et al, 1982a). ICV-CRF and ether stress both result in increases in catecholamine levels and are reversed by the administration of a-helical CRF (hCRF, a CRF antagonist) (Brown et al, 1986). In addition, CRF may be involved with parasympathetic stimulation, e.g. ICV injected CRF modifies the baroreflexic control of heart rate (Fisher, 1989). This is prevented by atropinemethylnitrate, a vagal nerve blocker, but not propanolol, a sympathetic nerve blocker. Electroencephalograph (EEG) activity and behavioural arousal are increased by ICV administration of CRF; low doses cause E E G activity characteristic of arousal and high doses also cause arousal followed 31 by seizure activity (Ehlers et al, 1983). Further, ICV-CRF can result in inhibition of gastric acid secretion and gastric emptying and stimulation of large bowel transit and fecal excretion (Tache et al, 1990). Within normal physiologic range, behavioural responses to ICV-CRF but not peripheral doses of CRF resemble stress-induced behaviour or are frequently opposite to the behaviours seen with administration of anxiolytic agents (Dunn & Berridge, 1990; Koob & Britton, 1990). These include decreases in: feeding in both familiar and novel environments (Levine et al, 1983), sexual behaviour (Sirinathsinghji et al, 1983), entry into the open arms of the elevated plus maze (File et al, 1988; File, 1987), social interaction (Dunn & File, 1987), and in high doses, locomotion in an open field environment (Britton et al, 1981; Sutton et al, 1982). Further, CRF increases exploration in familiar surroundings and increases grooming behaviour (Dunn et al, 1987; Morley & Levine, 1982; Sutton et al, 1982; Veldhuis & De Wied, 1984), stress-induced analgesia (Dunn & Berridge, 1990), acoustic startle (Swerdlow et al, 1986; Swerdlow et al, 1989), shock-induced freezing (Sherman & Kalin, 1986), defensive withdrawal (Sherman & Kalin, 1986), and, at low doses, exploration in a novel environment (Britton et al, 1981; Sutton et al, 1982). At low doses, (0.0003 ug) ICV-CRF also impairs passive avoidance behaviour when administered either immediately following training or prior to retention testing (Veldhuis & De Weid, 1984). Many of these CRF-induced responses are attenuated by the administration of benzodiazepines (Dunn & Berridge, 1990; Koob & Britton, 1990). In addition, CRF antagonists (oc-helical 32 CRF and CRF antisera) attenuate or reverse stress induced behaviours (Dunn & Berridge, 1990; Koob & Britton, 1990). Thus, the function of CRF may extend beyond activation of the H P A axis to other physiological functions; further, CRF may be a primary mediator of the behavioural state of stress and behavioural responses to stress. Centrally, CRF appears to increase the "emotionality" of the animal, i.e. increase the sensitivity of the animal to stressful aspects of the environment. In addition, abnormally high levels of cerebrospinal fluid CRF and cortical CRF receptor density as well as a blunting of A C T H response to CRF have been demonstrated in a number of psychiatric illnesses (Nemeroff et al, 1988). Therefore, centrally, CRF may play a role in the abnormal behavioural responses seen in children with FAS including the hyperactivity, decreased attention span, lack of habituation, lack of inhibition, and increases in abnormal fears. D. HPA AXIS IN FAS It is recognised that pre and/or post natal environmental factors can have long lasting neuroendocrine and behavioural effects on the organism's ability to cope with stress. Alcohol exposure during the prenatal and early postnatal periods constitutes an early insult to the organism which could alter the development of foetal endocrine function as well as foetal metabolic or physiological functions. These alterations could occur through direct effects of alcohol or indirect effects of alcohol-induced changes in maternal endocrine function. As previously mentioned, alcohol readily crosses the 33 placental barrier resulting in approximately equivalent foetal and maternal blood alcohol levels (Waltman & Iniquez, 1972). Thus, maternal alcohol consumption may result in a direct stimulation or suppression of foetal endocrine activity. Furthermore, altered maternal endocrine function disrupts the hormonal interactions between maternal and foetal systems, thereby disturbing the normal maternal foetal hormone balance (Anderson, 1981). Although clinical studies have established that alcohol consumption markedly alters HPA function in adults who chronically abuse alcohol, few clinical studies have investigated H P A function in children prenatally exposed to alcohol. The few studies conducted on endocrine systems of children with FAS have found few significant differences but have focused mainly on growth retardation and have only examined basal hormones and thyroid and growth hormone challenge tests (Anderson, 1981). A case study of four children with foetal alcohol syndrome (FAS) indicated that plasma Cortisol levels are within normal limits (Root et al, 1975). However, Binkiewicz and colleagues (1978) reported pseudo-Cushing's syndrome in an infant exposed to alcohol via the breast milk, suggesting that alcohol can have stimulatory effects on the H P A axis of the newborn. Recently, Jacobson and colleagues (1993), reported that children with a history of prenatal alcohol exposure demonstrated elevated salivary Cortisol following an acute stressor (i.e., a routine blood draw). 34 Animal studies provide evidence of altered HPA function of the maternal female, as well as altered H P A and p-EP system function in their offspring. Ethanol consumption in pregnant females results in increased maternal adrenal weights, basal CORT levels, adrenocortical responses to stress and corticoid stress increments without altering the binding capacity of plasma corticosterone binding globulin (CBG) (Weinberg, 1989, Weinberg & Bezio, 1987; Weinberg & Gallo, 1982). The ethanol-induced activation of the maternal H P A axis occurs as early as day 11 of pregnancy and persists throughout pregnancy, even at low concentrations of ethanol in the diet (5.5% w/v). In addition, with continued ethanol exposure, stimulatory effects of ethanol on maternal adrenal weights and basal CORT levels may persist through to parturition (Weinberg & Bezio, 1987). Furthermore, this HPA hyperresponsiveness appears to be independent of nutritional status and is specifically a result of ethanol exposure (Weinberg & Bezio, 1987). Females consuming diets with varied protein levels but consistent alcohol levels all demonstrated increased adrenal weights and adrenocortical hyperactivity. Together, these data suggested that ethanol consumption during pregnancy results in hypersecretion and hyperresponsiveness of the maternal HPA axis. As hormones can freely pass through the placenta, ethanol-induced maternal hormone changes may have negative effects on the developing foetus. It has been suggested that the alterations seen in the E animal's HPA axis may be a result of ethanol acting as a maternal stressor elevating maternal CORT levels and indirectly elevating foetal levels. As mentioned previously, perinatal administration of glucocorticoid can 35 interfere with normal development (Lee et al, 1990; Weichsel, 1977). However, it has been demonstrated that offspring from dams challenged with stressors, A C T H , or adrenalectomy do not display the hyperresponsiveness seen in E animals (Weinberg et al, 1986). Therefore, it appears that ethanol may have direct as well as indirect actions on HPA axis development and function. During the early neonatal period, E animals have elevated basal levels of brain, plasma, and adrenal CORT and decreased C B G binding capacity (Kakihana et al, 1980; Taylor et al, 1983; Weinberg et al, 1986, Weinberg, 1989), as well as elevated plamsa and decreased pituitary (3-EP levels (Angelogianni & Gianoulakis, 1989) compared to control animals. At 21 days of gestation, E animals are found to have greater relative adrenal weights but lower plasma CORT levels than pair-fed (PF) and control (C) animals. By 3-5 days of age, basal CORT levels in E animals return to normal. Furthermore, during the preweaning period (approximately the first three weeks of life), E animals exhibit suppressed or blunted HPA and (3-EP responses to a wide variety of stressors including ether, novelty, saline injection, and cold stress, as well as to drugs such as ethanol and morphine (Angelogianni & Gianoulakis, 1989; Taylor et al, 1986a; Weinberg, 1989; Weinberg et al. 1986). Interestingly, this blunted stress response in E animals is a transient phenomenon and by day 15-21, the HPA response to stress appears to normalise. In adulthood, basal CORT, A C T H , P-EP levels in E offspring do not differ from those in PF and C offspring (Taylor et al, 1982; Weinberg & Gallo, 1982). However, 36 adult E offspring are hyperresponsive to a variety of stressors including cardiac puncture (Taylor et al, 1982), restraint (Taylor et al, 1982; Weinberg, 1988; Weinberg, 1992a), noise and shaking (Taylor et al, 1982), novel environments (Weinberg, 1988), intermittent shock (Nelson et al, 1984; Nelson et al, 1986), ether (Angelogianni & Gianoulakis, 1989; Weinberg & Gallo, 1982) and cold (Angelogianni & Gianoulakis,. 1989). E animals also demonstrate deficits in pituitary-adrenal response inhibition or recovery from stress. For example, E animals show prolonged CORT, A C T H , and P-EP elevations during and following restraint stress (Weinberg, 1988; Weinberg, 1992a) and also show smaller CORT decreases when allowed access to water in a novel environment (Weinberg, 1988) as compared to control animals. Similarly, E offspring show more prolonged A C T H elevations than control animals following 10 min footshock stress (Taylor et al, 1986b). Interestingly, HPA hyperresponsiveness and/or the deficits in response inhibition may be manifested differentially in males and females depending on the nature and intensity of the stressor, the time course measured, and the hormonal endpoint examined. The ability to respond to environmental cues in stressful situations also appears to be deficient in E animals. Unlike PF and C animals, E animals do not respond differentially to predictable versus unpredictable restraint stress (Weinberg, unpublished). In addition, they demonstrate reduced corticosterone responses to a novel environment when allowed access to water, whereas PF and C demonstrate significant attenuation of the corticosterone response when allowed to drink (Weinberg, 1988). Furthermore, intrauterine exposure to ETOH also results in persistent effects on behavioural responses 37 to stressors including increased stress-induced analgesia (Nelson et al, 1985b), increased stress-induced ETOH consumption (Nelson et al, 1983a), and an inability to adapt to a stressful swimming paradigm (Taylor et al, 1983). A possible mechanism underlying the HPA hyperresponsiveness seen in E offspring is a deficit in feedback inhibition of the HPA axis. As the hippocampus is a principal target site for glucocorticoid feedback in the brain (McEwen et al, 1986; Sapolsky et al, 1984), a recent study (Weinberg & Petersen, 1991) investigated the possibility that an ethanol-induced decrease in hippocampal glucocorticoid receptor concentration might, in part, .mediate this altered HPA responsiveness. The data demonstrated that there were no significant differences in specific binding density or binding affinity for either Type I (mineralocorticoid) or Type II (glucocorticoid) receptors in the hippocampus of E animals compared to control animals, indicating that feedback deficits in E animals do not occur at the level of the hippocampal receptors, at least under basal or nonstressed conditions. In contrast, support for a deficit in feedback inhibition in E animals comes from the work of Nelson et al, (1985a) demonstrating that E animals appear to have an accelerated rebound of basal CORT levels following a high dose of the synthetic glucocorticoid, dexamethasone-21 -phosphate (DEX). Clinically, the D E X suppression test has been used to evaluate HPA axis function in a number of psychiatric conditions and it appears that feedback inhibition of CORT is altered in a number of affective disorders (Nemeroff et al, 1988). 38 E. THESIS OBJECTIVES The ability to respond appropriately to the environment is a basic mechanism for survival. Animals must respond to environmental stressors (external and internal) and be able to re-establish homeostasis once the stressor has been overcome. Hyperresponsivness and/or deficits in the capacity to respond differentially to and recover from stress (like those seen in E offspring) can have detrimental affects on health and even survival. Prolonged exposure to glucocorticoids can result in alterations in metabolism and immunosuppression. The mechanism underlying hyperresponsiveness of the HPA and (3-EP system as well as behavioural hyperactivity of E offspring are unknown at the present. The experiments undertaken in this thesis were done to examine two different hypotheses. Hypothesis I: HPA axis hyperresponsiveness and/or delays in recovery from stressors that occur in E animals result from deficits in feedback inhibition of the HPA axis induced by prenatal ethanol exposure. Hypothesis II: behavioural hyperresponsiveness observed in E animals is a result of elevated brain CRF levels and/or an increased CNS sensitivity to CRF which is induced by prenatal exposure to ethanol. 39 CHAPTER II: GENERAL METHODS A. DIETS Liquid diets were used to administer ethanol to pregnant females and restricted caloric intake to pair-fed females. The diets were previously developed by our laboratory to provide adequate nutrition to pregnant females regardless of ethanol intake (Weinberg, 1985) and were prepared by Bio-Serv, Inc., Frenchtown, NJ. This method of feeding has been demonstrated to be reliable in obtaining high blood alcohol levels and results in physical dependence and tolerance. Protein provided 25% and ethanol provided 36% of total calories. Maltose-dextrin were isocalorically substituted for ethanol in the liquid control diet (Table 1). B. BREEDING AND FEEDING Sprague-Dawley rats (Canadian Breeding Farms, St. Constant, PQ) were housed under constant conditions (temperature, lighting, and handling). The males and females were group housed for 1-2 week (wk) prior to breeding to allow recovery from transport and adaptation to the colony room. Males were then singly housed in stainless steel mesh hanging cages (24 x 30 x 18 cm), and were maintained on standard laboratory chow (Ralston Purina of Canada, Woodstock, Ontario) and water. The colony room had controlled temperature (21 ° C) and lighting, with lights on from 0600 to 1800 h. 40 Females were placed singly with males and cage papers were checked daily for vaginal plugs. Day 1 (dl) of gestation was considered the day the plug was found. A l l animal use procedures were in accordance with NIH guidelines and were approved by the University of British Columbia Animal Care Committee. On d l of gestation, females were rehoused in polycarbonate cages (24 x 16 x 46 cm) and randomly assigned to 1 of 3 groups. 1) Ethanol (E) which received liquid ethanol diet (36% ethanol-derived calories), ad libitum, 2) Pair-fed (PF), liquid control diet (maltose-dextrin isocalorically substituted for ethanol) with each animal pair-fed the amount consumed by a female in the ethanol group /kg body weight (bw)) on the same day of gestation or 3) Control (C), laboratory chow and water, ad libitum. The diets were made fresh every 3 days and refrigerated until feeding. The diet was offered in a glass bottle with ball point drinking tubes to prevent spillage and evaporation. Fresh diet was placed on the cages daily just prior to lights off (1700 h) to avoid a shift in the maternal corticosterone (CORT) circadian rhythm. It has been demonstrated that i f animals receive a restricted amount of food (such as that received by the PF group), circadian rhythms will re-entrain to the feeding thus shifting the CORT rhythm (Gallo & Weinberg, 1981). Bottles from the previous day were removed and weighed at this time to determine the amount of diet consumed. Experimental diets were continued until gestation d22 when they were replaced by laboratory chow and water ad libitum, in order to minimize the adverse effects of ETOH on maternal lactation. 41 On dl2-14 of gestation, a subset of females from each breeding were tested for blood alcohol levels (BAL). Blood samples (0.2-0.5 ml) were obtained from the tail of unanaesthized females at 1900 h under red light and B A L s determined by the Sigma Diagnostic Kit 332-UV (based on Bonnischsen & Theorell, 1951). Females were undisturbed except for weighing and cage cleaning on d l , 7, 14, and 21 of gestation. At birth, designated d l of lactation, dams and pups were weighed and all litters culled to 10 (5 males and 5 females). If a litter had less than 5 males and 5 females at birth, pups from another litter born on the same day were cross-fostered to make up the required pup number. Dams and pups were weighed and cages cleaned on d l , 8, 15, and 22 of lactation. On d22 pups were weaned, ear marked and group housed by sex and by litter. They remained group housed until testing in adulthood (greater than 60 days of age). In adulthood, male and female rats from prenatal E, PF, and C groups were selected for testing. Because pups within a litter are not independent subjects, the minimum number of litters bred were 10 per group (E, PF, C). In addition, to control for litter effects, no more than 1 female and 1 male per litter were tested at any 1 sampling time or in any 1 condition within an experiment. One week prior to testing, the animals were singly housed and moved from the breeding colony room to the testing colony room. Both female and male offspring were used in all experiments. Animals were given experiment numbers and studies were run so that the investigators did not have knowledge of the prenatal treatment. 42 C. BLOOD SAMPLING A l l testing was conducted at consistent times within the circadian cycle. The testing colony room was closed off for at least 4 to 6 h prior to testing to prevent artificial elevation in hormone levels due to disturbance. A l l blood sampling was done in the lab immediately adjacent to the colony room. Blood samples for the studies were collected by 1 of 3 methods: cardiac puncture under ether anaesthesia; decapitation; or via indwelling catheters. In the cardiac puncture technique, animals were lightly anaesthetised with diethyl ether or metofane (Janssen Pharmaceutica, Mississauga, ON, Canada) and blood samples drawn using heparinized syringes. The entire sampling procedure was completed within 2 minutes (min) of touching the animal's cage, which is rapid enough to obtain a reliable measure of CORT, without any effect of disturbance or etherization (Davidson et al, 1968). A C T H levels could not be obtained with this procedure as they must be obtained within seconds of touching the animal's cage. The blood was then placed in glass test tubes (10 x 75 mm), centrifuged at 2200g for 10 min at 4°C, and plasma was collected and stored at -20°C until assayed. The decapitation technique was used to collect samples for A C T H levels as they must be drawn within 10-15 sec of touching the animal's cage to obtain true measures of concentration. Trunk blood was collected on ice in plastic test tubes (12x75 mm) containing 7.5 mg EDTA and 1000 KJU aprotinen. The blood was centrifuged at . 43 2200g for 10 min at 4°C and plasma transferred with plastic pipettes to plastic microcentrifuge tubes for storage at -70°C until assayed. The cannula technique was used in experiments requiring multiple samples over time and the administration of various exogenous substances. A modified indwelling jugular cannula was implanted under halothane anaesthesia at least 24 h before testing. It has been demonstrated that catecholamines and other hormones return to basal levels 24 h after implantation. (Wixson et al, 1987). (See section D for surgical procedure) Cold tuberculin syringes coated with EDTA and aprotinen were used for blood collection. The blood was centrifuged at 4°C at 2200 g for 10 min and plasma transferred with plastic pipettes to plastic microcentrifuge tubes for storage at -70°C until assayed. D. SURGICAL PROCEDURES D.l MODIFIED INDWELLING JUGULAR CANNULAE Animals were implanted with indwelling jugular cannulae under halothane anaesthesia 24-48 h prior to testing. The surgical and sampling procedure was in accordance with Rivier et al, (1982a). Cannulae were cold sterilised with the Clindox-S system and implanted under semi-sterile conditions. The incision area on the rat was cleaned with 95 % ETOH prior to surgery. 44 The cannula consisted of PE50 tubing with a bevelled silastic tip. Cannulae were inserted into the left internal jugular vein and secured in place with 4 sutures. The free end of the cannula was then tunnelled subcutaneously to be exteriorized dorsally between the scapulae. The tip of the free end of the cannula was folded over and capped with PE 20 tubing until the testing day. The sampling cannulae consisted of PE50 tubing with a 22G x 1 1/2" blunted needle at one end, which was inserted into the free exteriorized end of the indwelling cannula; a L U E R L O K PRN adapter attached to a needle hub for injection and sampling was attached to the other end of the sampling cannulae. D.2 INTRACEREBROVENTRICULAR (ICV) CANNULAE ICV cannulae were implanted under ketamine/xylazine anaesthesia (0.8mg per kg bw of each ketamine and xylazine). Animals were placed in a stereotaxic apparatus and the skull exposed. Co-ordinates for the lateral ventricles (Paxinos & Watson, 1986) are approximately 0.8 mm posterior and 1 mm lateral to the bregma, and 4.5 mm ventral to the skull surface, with the incisor bar set at 3.3 mm. A hole was drilled into the skull and the guide cannula lowered into place. Four small stainless steel screws were inserted around the cannula, and dental acrylic was applied over the screws and the lower part of the cannula to hold it in place. The skin was sutured and a dummy cannula was inserted into the guide cannula. Cicatrin antibiotic powder (Wellcome Burroughs Inc., Kirkland, PQ, Canada) was sprinkled over the suture site to help prevent infection. Infusion of substances into the ventricle was accomplished with an infusion pump (Harvard Apparatus Syringe Infusion Pump 22, Southatick, Mass, USA) which is capable of 45 delivering small volumes at a controlled rate. The infusion pump was connected via tubing to an internal cannula that was inserted into the guide cannula. After animals were tested, cannulae placements were verified by infusion of toluene blue dye into the cannula followed by corneal brain slicing. Only animals demonstrating dye in both lateral ventricles were included in the data analysis. E. BEHAVIOURAL TESTS E . l ELEVATED PLUS MAZE (+-MAZE) The +-maze was designed according to the specifications of Pellow et al. (1985). It was constructed of black Plexiglass attached to a wooden base for support and, consisted of two open arms (50 x 10 cm) and two closed arms (50 x 10 x 40 cm). The maze was arranged so the two closed arms were opposite each other and the two open arms were opposite to each other. The maze was elevated 50 cm off the floor by four wooden legs. The +-maze behaviour was videotaped. Each videotape was scored by two independent individuals and a mean of the two scores was used; intra and intertester coefficients of variation were 2.6% and 4.2% respectively. The time spent on the open arms, on the closed arms, and on the centre portion were recorded. The number of full entries (all four feet) onto open and closed arms, number of partial (one or two feet) onto the open arms and number of rears on the closed arms were recorded. In one experiment 46 ambulation (number of midline crosses), number of turns and number of rears on both the open and the closed arms were also determined. E. 2 OPEN FIELD (OF) The OF was constructed of a wooden base with an arborite surface. It was 100 x 100 x 40 cm and was divided up into 16 squares. It was illuminated by two 60 watt bulbs suspended 75 cm above the surface. The OF behaviour was scored directly by a single investigator. Ambulation (all four feet crossing into a square) in the central 4 squares and the outer 12 squares and the number of rears were recorded . F. ASSAYS F. l BLOOD ETHANOL LEVELS Blood ethanol levels were determined by the enzymatic method for measuring ethanol at a wave length of 340 nm (Sigma Diagnostic Kit 332-UV) (revised from Bonnischsen & Theorell, 1951). The assay is structured upon the principle that alcohol dehydrogenase catalyses the oxidation of ethanol to acetaldehyde with simultaneous reduction of nicotinamide adenine dinucleotide (NAD) to N A D H resulting in a increased absorbency of 340 nm light (Lundquist, 1957). The consequent increase in absorbency is directly proportional to ethanol concentration in the sample. 47 F.2 PLASMA CORTICOSTERONE LEVELS Total CORT (bound plus free ) was measured by radioimmunoassay (RIA) in plasma extracted in absolute ethanol (1:10 v/v), using an adaptation (Weinberg & Bezio, 1987) of the method of Kaneko et al, (1981). Antiserum was obtained from Immunocorp, Montreal, PQ; tracer, [l,2,6,7-3H]-CORT, was obtained from Dupont, New England Nuclear, Mississauga, ON; unlabelled CORT for standards was obtained from Sigma, St. Louis, M O . Dextran coated charcoal was used to absorb and precipitate free steroids after incubation. Samples were counted in Formula 989, (Dupont, New England Nuclear, Mississauga, ON ). The intra and interassay coefficients of variation were 3% and 3.9%, respectively. F.3 PLASMA A C T H LEVELS Plasma A C T H was assayed by a modified procedure of the Incstar equilibrium RIA (Incstar Inc., Stillwater, Minnesota, USA) with all reagent volumes halved and 50 pi plasma per tube. The antiserum cross reacts 100 % with Porcine A C T H 1-39 and Human A C T H 1-24 but shows less than 0.01% crossreactivity with a-melanocyte stimulating hormone, P-endorphin, P-lipotropin, leucine enkephalin, methionine enkephalin, bombesin, calcitonin, parathyroid hormone, follicular stimulating hormone (FSH), vasopressin, oxytocin, and substance-P (Orth, 1979). The midrange intra and interassay coefficients of variation were 3.9% and 6.5% respectively. 48 G. MEASUREMENTS OF mRNA G.l IN SITU HYBRIDIZATION Brains were quickly collected on dry ice , wrapped in parafilm and aluminum foil, sealed in a plastic bag and stored at -70°C. Brains were transferred to the cryostat 1 h before slicing and warmed to -20°C. Brains were mounted onto the specimen holder with O.C.T. compound (Mile INC., Elkhart, IN, USA). Sections were taken until the paraventricular nucleus (PVN) of the hypothalamus was isolated using a 5% toluidine blue stain. Twelve coronal sections (12 um) were taken through the P V N and mounted onto twice-gelatin coated slides. Slides were stored in a sealed container at -70°C. Prehybridization treatments were performed according to Zoeller & Rudeen, (1992). Sections were briefly warmed to room temperature, immersed in 4% formaldehyde/phosphate-buffered saline (PBS) for 5 min, rinsed in PBS, and soaked for 10 min in 0.25% acetic anhydride in 0.1 M triethanolamine hydrochloride/0.9% NaCI (pH 8.0). Slides for A V P and CRF mRNA were then rinsed in 2X SSC (300 m M NaCl/30 m M sodium citrate); slides for GR mRNA were rinsed in I X SSC. Slides were then dehydrated by a graded series of ethanol baths, delipidated in chloroform, rehydrated in 95% ethanol and air dried. Hybridization buffer (50 ul) was applied to each slide; 49 slides were covered with a parafilm cover slip and incubated at 37°C for 20 h in humid chambers. Hybridization buffer contained 50% formamide, 4X SSC, transfer R N A (250 p g/ml), sheared single stranded salmon sperm D N A (lOOpg/ml), I X Denhardt's solution (0.02% each of BSA, Ficoll, and polyvinylpyrrolidone), 10% (w/v) dextran sulfate (molecular weight 500,000), 100 m M dithiothreitol (DTT), and probe. After hybridization, the coverslips were floated off in I X SSC and slides were washed 2 times in 2X SSC/50% formamide at 40°C for A V P and CRF mRNA slides and 52°C for GR mRNA slides. Following two 30 min washes in I X SSC at room temperature A V P and CRF mRNA, slides were dipped in distilled water, equilibrated in 70% ethanol and air dried. GR mRNA slides were rinsed 2 times in 2X SSC at room temperature and then incubated in 2X S S C / l m M EDTA/50 pg/ml RNAseA at 37°C for 30 min. GR mRNA slides were rinsed 2 times in 2X SSC at room temperature, incubated for 5 min in 50% formamide/2X SSC, washed in a series of ethanol /0.1X SSC baths, dipped in deionized water, washed in 70% ethanol for 3 min and then air dried. G.2 PROBES AVP and CRF mRNA Probes Oligonucleotides (Table 2) were synthesised on an Applied Biosystems Model 30B D N A synthesiser and purified by PCR columns according to manufacturer's . 50 instructions, purified by electrophoresis on an 8% polyacrylamide 8 M urea T B E gel, followed by electrophoresis into 1% L M P agrose, and phenol extracted. These purified oligomers exhibited a single band on a sequencing gel following 3 2P-labelling. Purified oligonucleotides were 3'end labelled by incubating 50 units of terminal oligodeoxynucleotidyl transferase (Boehringer-Mannheim, Indianapolis, IN) in a solution containing 5 pmol oligomer and 50 pmol 3 5 S-dATP (New England Nuclear) in the presence of 200 m M potassium cacodylate, 25 mM-Tris H C L , 0.25 mg/ml BSA, and 1.5 m M CoCl 2 (pH 6.6) for 15 min at 37°C. A phenol/chloroform extraction and ethanol precipitation was completed and the probe was stored at -20°C in lOmM Tris/1 m M EDTA, pH 8.0/50 m M DTT until used. GR mRNA Probe GR mRNA was measured using a cRNA probe. A 700-base-pair Pstl/EcoRI rat cRNA fragment corresponding to the 3' portion of the coding region was isolated from pRM9 (Miesfeld et al, 1986). The probe was then subcloned into pBluescript (+) vectors 33 as described in the transcription kit (Promega Biotec, Madison, Wise, USA). The P-UTP labelled sense and antisense R N A probes were generated by specific polymerase (T7 or SP6) transcription after linearization with restriction enzymes PstI and EcoRI. cRNA probes are dissolved in RNAase-free water containing 0.1% SDS and stored at -80°C. 51 G.3 AUTORADIOGRAPHY AND SIGNAL QUANTITATION Slides were held against film (Kodak Biomax MR) with 35S-standards (American Radiolabeled Chemical, Inc.) in cassettes for 1.5 h for A V P mRNA, 7 days for CRF mRNA, and 2 days 21 h for GR mRNA. Images were scanned on a Studio Scan II colour flatbed SCSI # 6 scanner using Fotolook SA 2.03. Microdensitometry was performed over the P V N using a Macintosh (Iifx)-based image analysis system (Image 1.42, Wayne Rasband, NIMH). Signal density was used as an index of mRNA levels; 35S-standards were used to control for film exposure. The hybridization signal was evaluated for each probe as follows. Using the 35S-standards, a calibration curve was calculated as a percent value. The average area of the P V N was determined and a triangle drawn. The area within the triangle was measured and remained constant between slides. A n average was taken between the 2 consecutive sections for statistical analysis. 52 Table 1. Liquid Rat Diet Theroretical parameters of diet as specified by Bio-Serv. The actual values have a variability of less than or equal to 10 % of the theroetical values due to analytical variability, sampling variability, and moisture levels. 53 Table 1. CONTROL ETHANOL DIET DIET (kcal/1) (kcal/1) PROTEIN 258 258 FAT 255 255 CARBOHYDRATE 486 118 ETHANOL 0 368 TOTAL 999 999 54 Table 2. Synthetic Oligonucleotides * Sequences are listed from 5' to 3' and are complementary to the base number or mRNA-coding region listed in the next column. 55 Table 2. Probe Sequence (5'-3')* Base No. Reference VP TAGACCCGGGGCTTGGCAGAATCCACGGACTCTTGTGTCC Glycopeptide Ivell & CAGCCAGC Richter, 1984 CRF CAGTTTCCTGTTGCTGTGAGCTTGCTGAGCTAACTGCTCT 496-543 Jingami et al, GCCCTGGC 1985 56 CHAPTER III: HYPOTHALAMIC-PITUITARY-ADRENAL (HPA) AXIS HYPERRESPONSIVENESS A. EFFECTS OF PRENATAL ETHANOL EXPOSURE ON A C T H STIMULATION OF ADRENAL GLANDS A.1 INTRODUCTION One possible mechanism for the enhanced HPA response to stress seen in E offspring may be a greater sensitivity of the adrenal gland to A C T H . Previous studies (Lee & Rivier, 1994; Lee et al, 1990; Taylor et al, 1982) report some data suggesting that neither the adrenal nor the pituitary of E animals is hyperresposive to secretagogues. However, these studies did not systematically examine full dose-response curves for either A C T H or CRF and did not use both males and females. In the present study adrenal sensitivity to A C T H was examined in E, PF, and C male and female offspring at 90-110 days of age. A.2 METHODS Sprague-Dawley males (n = 25) and females (n = 53) were obtained from Canadian Breeding Farms, St. Constant, PQ. Animals were bred and fed according to Chapter II: General Methods. On d 12-14 of gestation, blood samples (0.4-0.6 ml) were . 57 obtained from the tail from 3 unanaesthetised females at 1900 h for determination of blood ethanol levels (Sigma Diagnostic Kit 332-UV, based on Bonnischsen & Theorell, 1951). Females were undisturbed except for weighing and cage cleaning on d 1,7, 14, and 21 of gestation. At birth, designated d l of lactation, dam and pups were weighed and all litters culled to 10 (five males and five females). Dams and pups were weighed and cages cleaned on d 1, 8, 15, and 22 of lactation. On d 22, pups were weaned and housed by sex and by litter until testing at 90-110 days of age. One wk prior to testing, animals were singly housed and randomly assigned to postnatal treatment group. Testing order was counterbalanced across prenatal treatment, sex, and dose of A C T H (n = 9-10 for each of E, PF, and C, males and females for each dose of ACTH). Animals were implanted with indwelling jugular cannulae 24 to 48 h prior to testing. On the test day, the animals were removed from their home cage, injected with a dose of dexamethasone-21-phosphate (15 pg / 100 g body weight for males or 30 pg / 100 g body weight for females) (appropriate dose previously determined in a pilot study). Animals were quickly attached to the sampling cannulae and placed in the sampling bucket in the testing room. White noise (40 dB) was used to mask any extraneous room noises. The cannulae were flushed with 0.2 cc of saline to insure patency and left to hang freely over the edge of the bucket so as not to restrict movement. Three hours later, the cannulae were flushed with 0.05 cc of saline and a basal blood sample (0.2 cc) was drawn. Animals were then infused with A C T H (Cortrosyn, Organon, W. Orange, NJ) at doses of 0 (saline), 0.05, 0.1, 0.5, 1.0 units A C T H per rat in an injection volume of 0.3 cc. Another 0.3 cc saline ( approximately the volume of the 58 sampling cannulae) was infused to insure complete administration of the A C T H . Blood samples were drawn (0.2 cc) at 1 h intervals for 4 h. A l l blood samples were centrifuged at 2200 g for 10 min at 4° C. Plasma was stored at -20° C until analysed. Fluid replacement following each sample consisted of physiologic saline of equivalent volumes. Animals were terminated at the end of the 4 h period. A l l testing was completed between 0700 and 1200 h. A.3 STATISTICAL ANALYSES A l l data were analysed by appropriate analyses of variance (ANOVA) for factors of prenatal treatment, sex, dose, and time of sample. Significant main and interaction effects were further analysed by Tukey's paired comparisons. A.4 RESULTS Developmental Data Ethanol intake of pregnant females was consistently high throughout gestation, averaging 9.7 ± 0.3, 11.2 ± 0.3, 10.7 ± 0.2 g/kg bw /day for wk 1, 2, and 3 of gestation, respectively. Blood alcohol levels were consistent with previous levels (Weinberg, 1985), averaging 120.1 ±3 .0 mg/dl. 59 A repeated measures A N O V A on maternal weight gain during pregnancy revealed significant main effects of group (p < 0.001) and days (p < 0.001), as well as a group x days interaction ( p < 0.001). Post-hoc tests indicated that E and PF females weighed significantly less than C females on gestation d 7, 14, and 21 (p's < 0.001). In addition, E females weighed significantly less than PF females on gestation d 22 ( p's < 0.05). Analysis of maternal weights during lactation similarly revealed a group x days interaction (p < 0.001); E and PF females weighed significantly less than C females on lactation d 1 and 8 (p's < 0.01). E dams also weighed significantly less than C dams (p < 0.05) on lactation d 15; PF females showed a similar trend toward lower weight than C females on lactation d l 5 ( p < 0 . 1 0 ) . By lactation d 22 there were no significant differences among groups. There were no significant differences among groups for litter size or number of stillborn pups. Analysis of body weights for pups indicated a significant main effect of group (p < 0.01) and a group x days interaction (p < 0.01). Post hoc tests indicated that E and PF pups weighed significantly less than C pups on d 1, 8, 15, and 22 of age (p's < 0.01). There were no significant differences in offspring weight at the time of testing. Experimental Results There were no significant differences in CORT responses to A C T H among E, PF, and C animals at any dose or time tested (Figs. 1-5). 60 Overall, females had significantly higher CORT responses to A C T H than males (p < 0.0001) although patterns of responses were similar in males and females. In addition, for both males and females, there were significant dose x time interactions (p < 0.001). At 1 and 2 h, both males and females infused with all dosages of A C T H had significantly higher CORT levels than saline infused males and females (p's < 0.001 and p's < 0.05 respectively). In addition, at 2 h both males and females infused with 0.5 and 1.0 IU A C T H had significantly higher CORT levels than males and females infused with 0.05 IU A C T H ( p's < 0.05 and p's < 0.01 respectively). Both males and females infused with 1.0 IU A C T H had higher CORT levels than animals infused with 0.1 and 0.5 IU of A C T H (p's < 0.001). Females infused with 0.5 IU A C T H also had significantly higher CORT levels than females infused with 0.1 IU A C T H (p < 0.05). At 3 h post-infusion, both males and females infused with 1.0 IU A C T H had significantly higher CORT levels than animals infused with saline or any of the other dosages of A C T H (p's < 0.001). Females infused with 0.5 IU of A C T H had higher CORT levels than females infused with saline (p < 0.05); males infused with 0.5 IU of A C T H showed a similar tend toward higher CORT levels than males infused with saline (p < 0.06). At 4 h post infusion, both males and females infused with 1.0 IU A C T H had CORT levels significantly higher than animals infused with saline or any other dosages of A C T H (p's < 0.001). For males, animals infused with 0.5 IU A C T H had significantly higher CORT levels than males infused with saline (p < 0.001) and showed a trend 61 towards higher CORT levels than males infused with 0.05 IU A C T H (p's < 0.07). Males infused with 0.1 IU A C T H also demonstrated a trend towards higher CORT levels than males infused with saline (p < 0.07). For females, animals infused with 0.1 and 0.5 IU A C T H had significantly higher CORT levels than saline infused females (p < 0.001). Females infused with 0.5 IU A C T H had higher CORT levels than females infused with 0.05 and 0.1 IU A C T H (p < 0.001 and p < 0.05 respectively). A.5 DISCUSSION The results from this experiment demonstrate that E animals are not hyperresponsive to exogenous A C T H compared to PF and C animals during the trough of the circadian cycle. Administration of A C T H resulted in a dose response relationship; that is, higher doses resulted in more prolonged CORT responses. The initial peak at 1 h was similar among all doses of A C T H ; however at the later time points CORT levels following the highest doses of A C T H did not return to basal levels as did the CORT levels following lower doses. In addition, a sex difference in adrenal sensitivity was seen, females have higher CORT responses to exogenous A C T H than males at every dose. There were no significant differences in adrenal response to A C T H among E, PF and C animals. These data suggest that the insult of prenatal ethanol exposure does not affect adrenal sensitivity to A C T H at least when measured at the trough of the circadian cycle. Thus they suggest that the HPA hyperresponsiveness and/or delays in recovery from stressors that occur in E offspring are not due to an increased adrenal sensitivity to A C T H . 62 CORT levels in response to the increasing doses of exogenous A C T H in the present study were consistent with those observed in previous experiments (Keller-Wood et al, 1983c; Lake & Gann, 1972; Macchi & Hechter, 1954; Normand et al, 1980). A l l doses of A C T H resulted in elevated CORT, with a peak seen at 1 h and a decline thereafter. Higher doses of A C T H resulted in prolonged elevations in CORT levels. It has been shown that in vivo, normal adrenal glands of dogs (Keller-Wood et al, 1983a) and rats (Kaneko et al, 1981) respond to less than 10 pg/ml A C T H with an elevation in CORT levels. The maximal CORT secretion is seen in both dogs and rats at as little as 200 pg/ml A C T H (Coultron, 1973; Tarn & Greer, 1982). In addition, Keller-Wood and colleagues (1983b) demonstrated that the elevation in CORT levels after administration of exogenous A C T H was proportional to the logarithm of A C T H concentration up to about 300 pg/ml and further increases in amounts of exogenous A C T H prolonged the duration of the maximum CORT secretory rate beyond the period when plasma A C T H levels were elevated. This suggests that another mechanism may be involved in the prolongation of the CORT response. It has been demonstrated that A C T H binding to adrenocortical cells results in a parallel production of adenosine 3' 5'-cyclic monophosphate (cAMP) (Buckley & Ramachandran 1982; Normand et al, 1980). The production of cAMP increases with increasing levels of exogenous A C T H . Although the exact mechanism for the prolongation of the CORT response has yet to be determined, it has been suggested that this prolongation may result from retention of A C T H by adrenal cells and/or the accumulation of a biosynthetic intermediate, such as cAMP, which is activated by A C T H (Macchi & Hechter, 1954). 63 The sex difference observed in adrenal response to exogenous A C T H is also consistent with that observed in previous studies (Kitay 1961; Skelton & Bernardis, 1966). Although the patterns of response were similar in males and females, females demonstrated higher CORT responses to exogenous A C T H than males. It has been demonstrated that female rats have heavier adrenal glands (Kitay, 1961; Skelton & Bernardis, 1966) and have greater CORT response to stress (Kitay, 1961; Weinberg 1992b) than males. The sex difference in adrenal cortex thickness and secretion has been shown to begin at about 40 days of age, is fully manifested at 55 days , and begins to decrease after 360 days of age (Sencar-Cupovic & Milkovic, 1976). Kitay (1961) demonstrated that administration of exogenous A C T H to male rats resulted in a peak plasma CORT level 30 min after infusion with a return to the resting levels by 120 min. In contrast, females reached a peak at 15 min after infusion, maintained the peak level for 30 min and then showed a decline towards basal levels; however females did not reach basal levels by 120 min. In addition, the concentration of CORT in the adrenal vein following anaesthesia, laparotomy and manipulation of abdominal viscera has been demonstrated to be 2.5 times higher in females than males (Kitay, 1961). Furthermore, the increase in adrenal sensitivity in females does not appear to be a direct effect of circulating sex hormones at the time of testing. Females gonadectomized prior to weaning still demonstrate greater stress CORT levels as adults than gonadectomized males (Skelton & Bernardis, 1966). Together these data suggest that adrenal glands of female rats are more sensitive to A C T H than are adrenal glands of male rats. This differential sensitivity does not appear to be completely dependent on gonadal function in adulthood. 64 Consistent with previous studies (Lee & Rivier, 1994; Lee et al, 1990; Taylor et al, 1982 ), the present study demonstrates that HPA hyperresponsiveness seen in E animals is not a result of differential adrenal sensitivity to A C T H at least when measured at the trough of the CORT circadian rhythm. It has been shown that the adrenal gland markedly changes its sensitivity to A C T H during the circadian cycle being maximally sensitive during lights-off and minimally sensitive during lights on (Kaneko et al, 1981). Therefore, it is possible that differential sensitivity to A C T H in E compared to PF and C animals might be observed at the peak of the circadian rhythm. In the present experiment, however, it appears that in the A M , during the trough of the circadian cycle, prenatal ethanol exposure exerts long-term effects on the hypothalamus and/or pituitary and not on the adrenal gland itself. 65 Figure 1. Corticosterone Levels in Male and Female Rats Following Infusion of Saline. Points represent mean ± SEM. There were no significant differences among E, PF, and C males (above) or females (below). 66 CONTROL - - - - PAIR-FED E T H A N O L 1.0 2.0 3.0 4.0 TIME (hour) CONTROL PAIR-FED ETHANOL Figure 2. Corticosterone Levels in Male Rats Following Infusion of 0.05 and 0.1 units of ACTH. Points represent mean + SEM. There were no significant differences among E, PF, and C males infused of 0.05 (above) and 0.1 (below) units of A C T H . 68 CONTROL PAIR-FED E T H A N O L o o o u t o 2.0 TIME (hour) CONTROL PAIR-FED ETHANOL o o T—I o u 03 B 70 60 50 40 30 20 10 0 0 . 1 / / e^j^ -v. • ^ 0 1.0 2.0 TIME (hour) . 69 3.0 4.0 Figure 3. Corticosterone Levels in Male Rats Following Infusion of 0.5 and 1.0 units of ACTH. Points represent mean ± SEM. There were no significant differences among E, PF, and C males infused of 0.5 (above) and 1.0 (below) units of A C T H . 70 CONTROL PAIR-FED ETHANOL o o & O U cd t/3 cd 2.0 TIME (hour) 4.0 CONTROL PAIR-FED ETHANOL o o O U cd CO cd 70 60 50 40 30 20 10 0 -1 . 0 : / = \ \ \ 0 1.0 2.0 TIME (hour) 3.0 4.0 71 Figure 4. Corticosterone Levels in Female Rats Following Infusion of 0.05 and 0.1 units of ACTH. Points represent mean ± SEM. There were no significant differences among E, PF, and C females infused of 0.05 (above) and 0.1 (below) units of A C T H . 72 CONTROL — PAIR-FED E T H A N O L 70 0 1.0 2.0 3.0 4.0 TIME (hour) CONTROL PAIR-FED ETHANOL Figure 5. Corticosterone Levels in Female Rats Following Infusion of 0.5 and 1.0 units of ACTH. Points represent mean + SEM. There were no significant differences among E, PF, and C females infused of 0.5 (above) and 1.0 (below) units of A C T H . 74 CONTROL PAIR-FED ETHANOL 70 0 1.0 2.0 3.0 4.0 TIME (hour) CONTROL PAIR-FED ETHANOL 0 1.0 2.0 3.0 4.0 TIME (hour) B. EFFECTS OF PRENATAL ETHANOL EXPOSURE ON HYPOTHALAMIC-PITUITARY-AD RENAL SENSITIVITY TO DEXAMETHASONE SUPPRESSION. B.l INTRODUCTION The present study utilised dexamethasone (DEX) suppression to explore further the hypothesis that the HPA hyperresponsiveness and/or delays in recovery from stressors that occur in E offspring result from deficits in feedback inhibition of the H P A axis induced by prenatal ethanol exposure. Dexamethasone (DEX), a synthetic glucocorticoid, has been shown to inhibit A C T H release, and consequently leads to marked reduction in plasma CORT levels (Hauger et al, 1987; Hauger et al, 1989; Spinedi et al, 1991; Uht et al, 1989; Wynn et al, 1983). Binding studies have demonstrated that D E X preferentially binds to the pituitary suggesting that D E X suppression indicates pituitary sensitivity to feedback inhibition (DeKloet et al, 1975; Spencer et al, 1995). The effects of low dose D E X blockade on stress CORT levels to a mild and an intense stressor were examined at 3 and 6 h post-DEX injection in E, PF and C males and females. B.2 METHODS Sprague-Dawley males (n = 25) and females (n = 62) were obtained from Canadian Breeding Farms, St. Constant, PQ. Animals were bred and fed according to 76 Chapter II: General Methods. On d 12-14 of gestation, blood samples (0.4-0.6 ml) were obtained from the tail from 3 unanaesthetised females at 1900 h for determination of blood ethanol levels (Sigma Diagnostic Kit 332-UV, based on Bonnischsen & Theorell, 1951). Females were undisturbed except for weighing and cage cleaning on d 1, 7, 14, and 21 of gestation. At birth, designated d l of lactation, dams and pups were weighed and all litters culled to 10 ( five males and five females). Dams and pups were weighed and cages cleaned on d 1, 8, 15, and 22 of lactation. On d 22, pups were weaned and housed by sex and by litter until testing at 90-110 days of age. One wk prior to testing, animals were singly housed and assigned to injection dose and testing time. Test order was counterbalanced across prenatal treatment, sex, and injection dose. Animals (n = 8 each from E, PF, and C, males and females) were assigned to 1 of 4 doses of D E X ( 0 [saline], 0.1, 0.5, or 1.0 pg/100 g bw) and to a testing time of 3 or 6 h post-injection. On the test day, between 0700 h and 0830 h, animals were given an intraperitoneal (IP) injection of approximately 3.0 cc containing the assigned dose of D E X and were then returned to their home cages until testing. Three or 6 h later animals were subjected to an IP injection with a 25G X 5/8" needle. Animals were then placed in a holding room for 15 min after which time blood samples were taken by cardiac puncture under ether anaesthesia. The blood was centrifuged at 4 U C for 10 min at 2200 g and plasma was collected and stored at -20°C until CORT levels were 77 measured using RIA. One week later the procedure was repeated using a more intense stressor, exposure to ether vapours for approximately 45 sec, and blood samples were obtained by decapitation for determination of CORT levels. B.3 STATISTICAL ANALYSES Data were analysed by appropriate analyses of variance (ANOVAs) for factors of group (E, PF, C), sex, dose of D E X , time of stressor, and stressor type. Significant effects were further analysed with Tukey's post-hoc tests. Because of the complexity of the four-way A N O V A s , the data were further analysed separately for males and females for each stressor using three-way A N O V A s for the factors of group, dose, and time, as well as separate 2 way A N O V A s at 3 and 6 h for the factors of group and dose. B.4 RESULTS Developmental Data Ethanol intake of pregnant females was constantly high throughout gestation averaging 9.2 ± 0.2, 11.6 ± 0.2, 11.7 ± 0.2 g/kg bw/day for wk 1,2, and 3 of gestation respectively. A repeated measures A N O V A on maternal weight gain during pregnancy revealed significant main effects of group (p < 0.001) and days (p < 0.001), as well as a group x days interaction ( p < 0.001). Post-hoc tests indicated that E and PF females weighed significantly less than C females on gestation d 7, 14, and 21 (p < 0.001). In 78 addition, E females weighed significantly less than PF females on gestation d 7 and 14 (p's < 0.05). Analysis of maternal weights during lactation similarly revealed a group x days interaction (p < 0.001). E females weighed significantly less than C females on lactation d 1 (p < 0.01). Furthermore, E females weighed significantly less than PF females on lactation d 8 and 15 (p's < 0.05). There were no significant differences among groups for litter size or number of stillborn pups. Analysis of body weights of pups indicated a significant main effect of group (p < 0.01) and a group x days interaction (p < 0.01). Post hoc tests indicated that E and PF pups weighed significantly less than C pups on d 1 and 8 (p's < 0.05). In addition PF pups weighed significantly less than C pups on d 15 and 22 (p's < 0.05). There were no significant differences in pup weight at the time of testing. Experimental Results Four-way A N O V A s (sex x group x dose x stressor) were carried out separately for 3 h and 6 h data . These A N O V A s revealed main effects of sex, dose and stressor at both the 3 and 6 h test times (p's < 0.05). Females in all groups exhibited higher CORT levels than males (p < 0.01) reflecting the typical sex difference in H P A axis activity (Weinberg, 1988). Animals injected with 0.5 or 1.0 pg DEX/100 g bw had lower CORT levels than animals injected with 0 and 0.1 u,g DEX/100 g bw (p < 0.05) (Figs. 6 -9). In addition, animals injected with 0.5 u.g DEX/100 g bw had higher CORT levels than those 79 injected with 1.0 pg DEX/100 g bw (p < 0.05). A l l animals showed higher CORT levels to ether vapours (Figs. 8 and 9)than to IP injection (p < 0.01) regardless of the injection dose of D E X (Figs 6 and 7) The results of the 2-way A N O V A s (group x dose) for each type of stresssor demonstrated some group differences. There were no significant group differences for either males or females among E, PF, and C animals at 3 or 6 h in response to the IP stressor (Figs. 6 and 7). However, males did demonstrate a group x dose interaction at 3 h but not at 6 h in response to the ether stressor, (p < 0.05) reflecting a different pattern of response for the 3 groups across doses of D E X . At 3 h, E and PF males showed a trend towards higher CORT levels than C males at doses of 0.1 and 0.5 pg/100 g bw (p's <0.05). In contrast, there was a marginally significant effect of group (p's < 0.06) for females subjected to the ether stressor at both 3 and 6 h. Post-hoc analysis demonstrated a trend for higher CORT levels in E compared to C females (p's < 0.1); PF females did not differ from either group. In addition, at 6 h a significant group x dose interaction was demonstrated (p < 0.05); E and PF females injected with 1.0 pg/100 g bw of D E X had higher CORT levels than C females injected with 1.0 pg/100 g bw of D E X following ether stress (p's O.05) (Fig. 9). 80 B.5 DISCUSSION The results from this study indicate that administration of D E X to block HPA activity suppressed CORT secretion in a dose dependent manner in all animals regardless of the prenatal treatment. Furthermore, as expected, males and females exhibited differential CORT responses to the same dose of D E X . In addition, the ability of D E X to suppress the CORT response was greater following IP injection as compared with ether. Further, the results demonstrate some differences in the suppressability of the CORT response to ether stress among animals in E, PF, and C groups. At 3 h post-injection, E males showed a trend towards higher CORT levels than C males at doses of 0.1 and 0.5 u.g/100 g bw D E X and E females overall had higher CORT levels than C females. At 6 h post-injection, there were no significant differences among males but E females had higher CORT levels than C females at 1.0 ug/100 g bw D E X . D E X has been shown to be a more potent blocker of the stress-induced A C T H release at the pituitary than CORT (De Koloet et al, 1975). In vivo and in vitro studies have demonstrated that D E X preferentially binds to the pituitary (De Kloet et al, 1975; Spencer et al, 1990). It has been shown that the hippocampus accumulates 3 H -corticosterone to a greater extent than in the hypothalmus and anterior pituitary, while 3 H -D E X accumulates to a greater extent in the anterior pituitary than in the hypothalmus and hippocampus (De Kloet et al, 1975). Administration of D E X (200 u.g/day) for 7 days to adrenalectomized rats has been shown to reduce ACTH/pMipotropin precursor mRNA 81 (19% of intact controls) but to have little effect on prepro-CRF mRNA (102% of intact controls) (Jingami et al, 1985). In addition, subcutaneous injection of D E X at doses of 1-50 pg/kg bw has been shown to produce a selective and time related decrease in available Type II receptors in the pituitary, and to have no effect on Type II receptors in the hippocampus (Spencer et al, 1995). D E X in the drinking water has been demonstrated to activate pituitary Type II receptors at varying doses (0.3 u.g/ml, 0.8 pg/ml, and 10.0 pg/ml), whereas hippocampus and hypothalamus Type II receptors are only activated at an exceedingly high dose of D E X (10 u.g/ml) (Miller et al, 1992). Furthermore, low dose D E X (1.5 u,g/ml) in the drinking water overnight does not affect Type II binding in the hippocampus but 1.0 pg/ml of D E X in the drinking water for 1, 2, and 3 days does significantly reduce Type II activation (Spencer et al, 1990). Binding studies have also indicated that there is a differential time course of 3 H - D E X and 3 H -CORT binding in the hippocampus, hypothalamus and anterior pituitary (De Kloet et al., 1975). 3 H - D E X is taken up more slowly and retained longer by the hippocampus than 3 H -CORT; the hypothalamus takes up 3 H - D E X and 3 H-CORT equally but retains 3 H - D E X for longer; and the anterior pituitary takes up 3 H - D E X more rapidly and retains it longer than 3 H-CORT. Thus, it appears that the ability of D E X to suppress stress-induced A C T H secretion may be a function of dose and time and a single low to moderate doses reflects predominately anterior pituitary suppression. The results of the present study are consistent with previous studies in demonstrating that CORT responses increases as stressor intensity increases. Animals 82 exposed to ether, a more severe stressor, had higher CORT levels following both saline and D E X injection than animals exposed to IP injection, a mild stressor, following both saline and D E X injection. The HPA axis is very sensitive to mild stressors and may show a graded response to increasing intensities of a mild stressor, resulting in increased circulating A C T H and CORT. It has been demonstrated that with increases of volume of arterial haemorrhage there is an increase in plasma A C T H (Plotsky, 1987) and with increasing challenges of low intensity psychological stressors such as handling and novel environment (Armario et al, 1986a; Armario et al, 1986b) or increasing intensity of current-delivered footshock (Kant et al, 1983) there is an incremental increase in plasma CORT. Importantly, however, the graded response to stress occurs only following mild stressors and maximal A C T H and CORT levels are reached rapidly with more severe stressors such as cold, formalin injection, or restraint (Kant et al, 1982). As previously discussed (Chapter Ilia) the maximal CORT response to A C T H is also reached quickly and CORT responses to higher levels of A C T H results in prolonged elevations in CORT. There also appears to be differential activation of components of the H P A axis depending upon the stressor. CRF mRNA in the P V N and POMC mRNA in the anterior pituitary have been shown to increase with some stressors such as IP injection of hypertonic saline, restraint or swim but not others like cold stress (Harbuz & Lightman, 1989b). Physical stressors such as restraint and swim have been shown to activate CRF mRNA in the P V N alone while other physical stressors such as footshock, IP hypertonic saline, and naloxone-induced morphine withdrawal not only increase CRF mRNA but also proenkephalin A (PEA) mRNA in the P V N (Harbuz & Lightman, 1989a; Harbuz et 83 al, 1991; Lightman & Young, 1987a). Ether stress has been shown to increase PEA mRNA but has no effect on CRF mRNA (Harbuz & Lightman., 1992). Further, it has been demonstrated that increases in cAMP and guanosine 3',5'-monophosphate (cGMP) levels following stress vary with the stressor. Increases in pituitary c A M P following cold, running, formalin injection, restraint and shock appears to be highly correlated with the intensity of the stressor while cerebellar cGMP appears to be associated with an increase in motor activity associated with the stressor (Kant et al, 1982). Increases in cerebellar cGMP were only seen with stressors such as running or shock where activity was also increased whereas cold and restraint did not affect cerebellar cGMP levels. The exact mechanism(s) for the variation in stress response in hormone secretion, gene induction, and secondary messenger activation are still under investigation. It can be hypothesised that synergistic hormones such as A V P or OT may be selectively released in response to various stressors and potentiate the release of A C T H stimulated by CRF and/or that varying neurotransmitter systems may be activated in response to stressors. In support of this, Gaillet et al. (1991) demonstrated that ascending noradrenergic pathways to the hypothalamus play a major stimulatory role in ether and restraint stress, have a moderate or biphasic involvement in response to insulin-induced hypoglycaemia and have no significant participation in the HPA response to systemic histamine infusion. Therefore, it is possible that the difference in intensity between ether and IP injection stress may result in different levels of CRF and A V P being released as well as a difference in the pathway of activation of the stress response. 84 As previously mentioned, it has been well-documented that a sex difference exists in basal CORT and stress CORT levels (Critchlow et al, 1963; Kitay, 1961; Weinberg, 1988). The sex difference appears to be related to circulating oestrogen levels as well as perinatal hormone exposure. It has been shown that ovariectomy (OVX) of an adult female results in adrenal atrophy as well as reduction in basal CORT levels while O V X plus oestrogen replacement reinstates the typical sex differences in adrenal weight and basal CORT levels (Kitay, 1963; Le Mevel, 1978; Ramaley, 1976). Further, it has been demonstrated that basal and stress CORT levels vary with the oestrus cycle (Raps et al, 1971; Viau & Meany, 1991). Female rats have the greatest CORT levels during the beginning of proestrus when oestrogen levels are highest and progesterone levels are low as compared to levels during dioestrus and oestrus (Critchlow et al, 1963; Viau & Meany, 1991). Progesterone appears to inhibit the facilitory effects of oestrogen. In women, A C T H and Cortisol levels rise towards the end of the follicular phase of the menstrual cycle (Genazzi, 1975) and women have higher post-DEX Cortisol levels during the middle 2 weeks of the menstrual cycle as compared to the other weeks of the cycle (Roy-Bynre et al, 1986). Likewise oestrogen in rats appears to affect the negative feedback of CORT. O V X rats given oestrogen replacement have higher and more prolonged responses to footshock, ether and restraint stressors than O V X controls (Burgess & Handa, 1992; Viau & Meany, 1991). Furthermore O V X females are more sensitive to D E X suppression (Ramaley, 1976) than intact females and O V X females are more sensitive to R U 28362 (a specific glucocorticoid receptor agonist) (Burgess & Handa, 1992) than O V X and oestrogen treated females. Consistent with these studies, we found that females had higher stress CORT levels. 85 The factors which underlie the effects of oestrogen on the H P A axis remain to be determined. As mentioned above, oestrogen affects adrenal size and secretion. O V X decreases pituitary synthesis of and release of A C T H as well as adrenal synthesis of CORT (Kitay, 1963), and this decrease is reversed by oestrogen replacement (Coyne & Kitay, 1969; Kitay, 1963). Oestrogen has also been demonstrated to influence P V N firing and secretion to stress. Extracellular recordings demonstrate an increase in P V N unit firing rates during proestrous and oestrus, whereas in O V X females, the firing rates are only increased after oestrogen replacement and are reduced by progesterone replacement (Negoro et al, 1973b). Further, the percentage of P V N units firing in response to foot pinching are highest during proestrous and are enhanced in O V X females after oestrogen replacement and inhibited after progesterone treatment (Negoro et al, 1973a). In addition, it has been demonstrated that oestrogen alters CRF immunoreactivity and mRNA levels (Bohler et al, 1990; Haas & George, 1988, Swanson & Simmons, 1989) with the highest levels of CRF content being seen during proestrous and dioestrous (Hiroshige & Wada-Okada, 1973). The AVP/OT ratio in the P V N and supraoptic nuclei are also affected by the oestrus cycle; during proestrus the AVP/OT ratio is highest while during oestrus the OT mRNA in the supraoptic nucleus is highest. Furthermore, N E , which is thought to be involved in H P A regulation, is also influenced by oestrogen; during proestrus N E turnover is rapidly increased (Ranee et al, 1981). Oestrogen appears to up-regulate ©^-adrenergic receptors and down regulate p-adrenergic receptors (Condon et al, 1989, Weiland & Wise, 1989). Low doses of N E enhance CRF release through binding to a,-adrenergic receptors, while high doses inhibit CRF release 86 through binding to P-adrenergic receptors (Plotsky, 1987; Plotsky et al., 1989). Thus, it is possible that as oestrogen levels rise, CRF release is enhanced as a result of an increase in a r adrenergic receptor stimulation and a decrease of p- adrenergic receptor inhibition. The decrease in HPA axis sensitivity to D E X suppression seen in females is also still under investigation although it appears that it is not a result of altered clearance or adrenal function. Viau & Meany (1991) demonstrated that there was no significant difference in the rate of clearance of A C T H or CORT in females which were O V X alone or O V X and received oestrogen replacement. In addition, Ramaley (1976) demonstrated no difference in the clearance of D E X in O V X or intact females. Although the present study only investigated CORT levels, previous studies have demonstrated elevation in stress A C T H levels in the presence of oestrogen (Burgess & Handa, 1992; Viau & Meany 1991). Thus, the elevated and prolonged levels of A C T H and CORT to stress as well as the desensitisation of the HPA axis to inhibitory feedback of glucocorticoids in the presence of oestrogen appear to indicate that prenatal alcohol exposure may affect the HPA axis by altering feedback inhibition of CORT at the level of the pituitary or higher. In summary, stress CORT levels appear to be a function of stress intensity as demonstrated by the differential responses to IP injection as compared to ether vapor. In addition, there appears to be a sexual dimorphism in the stress response. Further, although the doses in this experiment were not sufficient to suppress the H P A axis fully, the experiment supports the hypothesis that HPA hyperresponsiveness and/or delays in 87 recovery from stressors that occur in E animals may result from deficits in feedback inhibition. 88 Figure 6. Corticosterone Levels in Dexamethasone Treated Males Following IP Poke. Points represent mean ± SEM. # Main effect of dose, p < 0.05: 0.5 pg/100 g bw D E X < saline and 0.1 pg/100 g bw D E X at 3 h. A Main effect of dose, p < 0.05: 1.0 pg/100 g bw D E X < saline, 0.1 and 0.5 pg/ 100 g bw D E X at 3 and 6 h. 89 CONTROL V//A PAIR-FED 18888 ETHANOL o o . H O U a 100 90 80 70 60 50 40 30 20 10 0 SALINE 0.1 DEX(ug/100gBW) 3Hr CONTROL PAIR-FED ETHANOL o o H O U 100 90 80 70 60 50 40 30 20 10 0 SALINE 0.1 0.5 DEX(ug/100gBW) 6Hr 1.0 90 Figure 7. Corticosterone Levels in Dexamethasone Treated Females Following IP Poke. Points represent mean ± SEM. # Main effect of dose, p < 0.05: 0.5 and 1.0 jag/100 g bw D E X < saline and 0.1 pg/100 g bw D E X at 3 and 6 h. A Main effect of dose, p < 0.05: 1.0 pg/100 g bw D E X < 0.5 ug/100 g bw D E X at3h. 91 CONTROL PAIR-FED ETHANOL o o o u cd cd SALINE 0.1 . 0.5 DEX(ugAOOgBW) CONTROL V//A PAIR-FED ETHANOL o o o o cd B in SALINE 0.1 0.5 DEX(ug/100gBW) 1.0 92 Figure 8. Corticosterone Levels in Dexamethasone Treated Males Following Ether Vapor. Points represent mean ± SEM. # Main effect of dose, p's < 0.05: 0.5 and 1.0 pg/100 g bw D E X < saline and 0.1 pg/100 gbw D E X at 3 h A Main effect of dose, p < 0.05: 1.0 pg/100 g bw D E X < saline, 0.1 and 0.5 pg/ 100 gbw D E X at 3 and 6 h. 93 CONTROL PAIR-FED ETHANOL Figure 9. Corticosterone Levels in Dexamethasone Treated Females Following Ether Vapor. Points represent mean ± SEM. # Main effect of dose, p's < 0.05: 0.5 and 1.0 pg/100 g bw D E X < saline and 0.1 pg/100 g bw D E X at 3 h (above) and 1.0 pg/ 100 g bw D E X < saline and 0.1 pg/ 100 g bw D E X at 6 h (below) A Main effect of dose, p < 0.05: 1.0 pg/ 100 g bw D E X < 0.5 pg/100 g bw D E X at 3 h. * Group x dose interaction, p < 0.05; following injection of 1.0 pg/ 100 g bw D E X , E = PF > C at 6 h. 95 CONTROL V//A PAIR-FED $$$$$ ETHANOL C. FOETAL ETHANOL EXPOSURE ALTERS PITUITARY-ADRENAL SENSITIVITY TO DEXAMETHASONE C.l INTRODUCTION The present study utilised higher doses of D E X and examined a longer time course than the previous study (Chapter IIIB) to explore further the hypothesis that the HPA hyperresponsiveness and/or delays in recovery from stressors that occur in E offspring result from deficits in feedback inhibition of the H P A axis induced by prenatal ethanol exposure. The effects of D E X blockade on basal and stress CORT levels and stress A C T H levels were examined over a 36 h period. In addition, stress CORT and A C T H levels were examined after administration of D E X , during both the trough (AM) and peak (PM) of the CORT circadian rhythm. C.2 METHODS Sprague-Dawley male (n = 25) and female (n = 145) rats were obtained from Canadian Breeding Farms, St. Constant, PQ. Animals were bred and fed according to Chapter II: General Methods. On d 12-14 of gestation, blood samples (0.4-0.6 ml) were obtained from the tail from nine unanaesthetised females at 1900 h for determination of blood ethanol levels (Sigma Diagnostic Kit 332-UV, based on Bonnischsen & Theorell, 1951). Females were undisturbed except for weighing and cage cleaning on d 1, 7, 14, and 21 of gestation. At birth, designated d 1 of lactation, dam and pups were weighed 97 and all litters culled to 10 ( five males and five females). Dam and pups were weighed and cages cleaned on d 1, 8, 15, and 22 of lactation. On d 22, pups were weaned and housed by sex and by litter until testing at 90-110 days of age. Three replicate breedings, with 48-49 females in each, were done. One wk prior to testing, animals were singly housed, divided into four subsets, and randomly assigned to IP injection dose and test time. Testing order was counterbalanced across prenatal treatment, sex, and injection dose (n = 6-9 for each of E, PF, and C, males and females at each dose and time. D E X injections for the first three subsets of animals occurred at 0730-0900 h on the initial test day ( A M groups). Doses of D E X were based on pilot studies which indicated that females required higher doses of D E X than males to suppress CORT levels in response to stress. Animals in the first subset received one of four doses of D E X [males, 0 (saline), 1.0, 5.0, or 15.0 pg/ 100 g body wt (bw); females, 0, 1.0, 10.0, or 30.0 pg/100 g bw] and were tested at 3 or 6 h post-injection. Animals in the second subset received one of three doses of D E X [males, 0, 5.0, or 15.0 pg/100 g bw; females 0, 10.0, or 30.0 pg/100 g bw] and were tested at 10 or 26 h post-injection. Animals in the third subset received one of two doses of D E X [males, 0 or 15.0 pg/100 g bw; females, 0 or 30.0 pg/100 g bw] and were tested at 36 h post-injection. D E X injections for the fourth subset of animals occurred at 1500-1700 h on the initial test day (PM group). Animals received one of three doses of D E X [males, 0, 5.0, or 15.0 pg/100 g bw; females 0,10.0, or 30.0 pg/100 g bw], and were tested 3 h post-injection under red light. A l l animals were returned to the colony room between injection and blood sampling. 98 At the designated sampling time, animals were taken from the colony room to an adjacent laboratory, quickly and lightly anaesthetised with ethyl ether, and blood samples (0.5cc) obtained by cardiac puncture using heparinized syringes (the fourth subset of animals was exposed to ether only; no basal samples were drawn). • Twenty min later, animals were rapidly decapitated (within 10-15 sec of touching the cage; Rivier et al, 1982b) and trunk blood collected on ice in 12 x 75 mm plastic test tubes containing 7.5 mg E D T A and 1000 K I U aprotinen (0.2 ml/5cc blood). The blood was centrifuged at 2200 x g for 10 min at 4°C and plasma transferred with plastic pipettes to microcentrifuge tubes for storage at -70°C until assayed for CORT and A C T H . Resting A C T H levels could not be determined because the procedure of etherization and cardiac puncture was too slow to obtain undisturbed levels. C.3 S T A T I S T I C A L A N A L Y S E S A l l data were analysed by appropriate analyses of variance (ANOVA) for factors of prenatal treatment, sex, and dose of D E X . Significant main and interaction effects were further analysed by Tukey's paired comparisons. 99 C.4 RESULTS Developmental Data Ethanol intake of the pregnant females was consistently high throughout gestation in all three breedings, averaging 9.7 ± 1.4, 11.15 ± 1.0, 10.7 ± 0.8 g/kg bw/day for wk 1, 2, and 3 of gestation, respectively. Blood alcohol levels were consistent with those reported previously (Weinberg, 1985), averaging 145.4 ± 10.9 mg/dl. Repeated measures A N O V A s on maternal weight gain during pregnancy and pup weight gain during lactation revealed significant main effects of group (p < 0.001 and p < 0.01, respectively) and days (p's < 0.001), as well as group x days interactions (p's <0.01). Body weights of E and PF dams were significantly less than those of C dams on gestation d 7-21 (p's < 0.001). There were no significant differences among groups for litter size. However, E and PF pups weighed significantly less than C pups on all days measured during lactation (p's < 0.001). There were no significant differences in body weight among E, PF, and C offspring at the time of testing. CORT and A C T H Levels (AM Groups) Hormone measures in both male and female offspring tested in adulthood showed dose response relationships for both resting CORT levels and for stress CORT and A C T H 100 levels following D E X blockade; the higher the dose of D E X , the greater the CORT and A C T H suppression and the longer the time to return to basal levels. Undisturbed CORT levels Significant main effects of dose of D E X were obtained at 3, 6, and 10 h post-injection (p's < 0.01). Both males and females injected with all doses of D E X had significantly lower undisturbed CORT levels than their saline-injected counterparts (Table 3). The only exception was at the 6 h sampling time when females injected with the lowest dose of D E X (1.0 pg/100 g body wt) did not differ from saline injected females. By 26 h, there were no significant differences between D E X - and saline-injected animals. There were no significant differences among E, PF, and C animals in undisturbed CORT levels at any sampling time. Stress CORT levels Significant main effects of dose were obtained both for males (Fig. 10-12) and females (Fig. 13-15) at 3, 6, 10, and 26 h post injection (p's < 0.01). At all of these times, males injected with 5.0 or 15.0 pg/100 g bw D E X had lower CORT levels than males injected with saline (p's < 0.01). There were no significant differences in CORT levels among E, PF, and C males at any time tested. At 3, 6, and 26 h post-injection, females injected with 10.0 or 30.0 pg/100 g bw D E X had lower CORT levels than females injected with saline (p's < 0.01). At 10 h post-injection, only females injected with 30.0 pg/100 g bw D E X had lower CORT levels than saline-injected females (p<0.01). 101 Importantly, at 3 h post-injection, analysis of female CORT levels revealed a significant main effect of group (p < 0.05). E females had higher CORT levels than PF and C females (p's < 0.05). At 6 h post-injection, E females injected with 30 u.g/100 g bw D E X also had higher CORT levels than PF and C females (p's < 0.05). There were no significant differences in CORT levels among E, PF, and C females at 10, 26, or 36 h post-injection. Stress A C T H Levels Significant main effects of dose were obtained at 3, 6, and 10 h post-injection for both males (Fig. 17 and Fig. 18) and females (Fig. 19 and Fig. 20) (p's < 0.001). At 3 h post-injection, males and females injected with all doses of D E X had lower A C T H levels than their saline-injected counterparts. At 6 and 10 h post-injection, males injected with the two highest doses and females injected with the highest dose of D E X , had lower A C T H levels than those injected with saline (p's < 0.01). At 26 and 36 h post-injection, there were no significant differences for either males (Fig. 18) or females (Fig. 21) in A C T H levels between D E X - and saline-injected animals. Significant main effects of group were also observed (p's < 0.05). At 26 h post-injection, E and C males had significantly higher A C T H levels than PF males (p's < 0.05), and E and PF females had significantly higher A C T H levels than C females (p's < 0.05). 102 CORT and A C T H Levels (PM Group) Stress CORT Levels Significant main effects of dose were obtained for both males and females (p's < 0.001) (Fig. 22); animals injected with D E X had lower CORT levels than animals injected with saline. For males, there was a significant main effect of group (p < 0.05) and a group x dose interaction (p < 0.01). At 5.0 pg/100 g bw D E X , E males had higher CORT levels than C males; at 15.0 pg/100 g bw D E X , E males had higher CORT levels than PF males (p's < 0.05). Similarly, a significant main effect of group was found for females (p < 0.001). E females injected with 10.0 and 30.0 pg/100 g bw D E X had significantly higher CORT levels than C females (p's < 0.01). Stress A C T H levels Significant main effects of dose were obtained for both males and females (p's < 0.001) (Fig. 23); animals injected with D E X had significantly lower A C T H levels than saline-injected animals. For males, there were no significant differences in A C T H levels among E, PF and C animals. In contrast, there was a significant main effect of group for females; at 30 pg/100 g bw D E X , E females had significantly higher A C T H levels than PF and C females (p < 0.05). C.5 DISCUSSION The results from these experiments support our hypothesis that HPA hyperresponsiveness and/or delays in recovery from stressors that occur in E offspring may result, at least in part, from deficits in feedback inhibition of the H P A axis induced 103 by prenatal ethanol exposure. Administration of D E X to block HPA activity significantly suppressed both resting levels of plasma CORT and stress levels of plasma CORT and A C T H in all animals, regardless of prenatal treatment. Importantly, E animals did not differ from PF and C animals in basal CORT levels but exhibited significantly higher stress levels of CORT and/or A C T H than PF and C animals following D E X blockade. Furthermore, males and females exhibited differential responsiveness depending on the time of day when testing occurred. When tested at the trough of the CORT circadian rhythm, reduced sensitivity to D E X suppression of stress hormone levels was observed only in E females; E males were similar to PF and C males in responsiveness. In contrast, when tested at the peak of the CORT circadian rhythm, both E males and E females exhibited reduced sensitivity to D E X suppression of stress hormone levels. Sex differences in H P A responsiveness following D E X were further demonstrated by the finding that E males showed increased stress levels of CORT but not A C T H , whereas E females showed increased stress levels of both CORT and A C T H compared to their respective controls. These data suggest that the insult of prenatal ethanol exposure affects both male and female offspring, but that there may be a sex specific difference in sensitivity of the mechanism(s) underlying HPA hyperresponsiveness. Moreover, consistent with previous studies (Taylor et al, 1983; Weinberg, 1992a; Weinberg, 1992b), it appears that E offspring may not differ from controls under nonstressed conditions, but exhibit significant deficits and/or alterations in responsiveness when challenged with stressors, hormones or pharmacological agents, or when placed in behaviourally aversive or challenging situations. 104 At this time we cannot rule out the possibility that the pharmacokinetics of D E X were altered in E compared to PF and C animals. However, this appears unlikely as undisturbed levels of CORT following D E X administration did not differ in E, PF, and C animals. Basal levels of A C T H could not be measured in the present study as the method of sampling used was too slow to obtain a reliable measure of undisturbed A C T H . However, previous data from our lab (Weinberg et al, 1996) and others (Lee et al, 1990; Taylor et al, 1986b) have shown that E animals do not differ from PF and C animals in basal A C T H levels. In contrast to previous work from our lab (Weinberg, 1992b; Weinberg, 1988; Weinberg & Gallo, 1982) and others (Lee et al, 1990; Nelson et al, 1986; Taylor et al, 1982), we did not observe increased CORT or A C T H responses to stress in E compared to PF and C animals in the nontreated (i.e. saline-injected) condition. One possible reason is that the potent physiological stressor used in the present study, i.e. ether stress, probably elicited a maximal response in all animals. Our previous data suggests that the parameters of the test situation, the nature and intensity of the stressor, the time course measured, and the level of stress axis examined all play a role in determining whether E animals differ from controls in stress responsiveness and whether differential effects of foetal ethanol exposure are observed in males and females. In addition to prenatal ethanol effects, we also noted prenatal nutritional effects as well as an effect of pair-feeding itself. At 26 h post-DEX injection, PF males showed suppressed A C T H levels compared to E and C males whereas E and PF females both 105 showed increased A C T H levels compared to C females. Previous data demonstrated that although pair-feeding provides an essential nutritional control group, pair-feeding itself is a type of experimental treatment (Weinberg, 1984). For example, pair-feeding can produce a shift in the circadian rhythm of a number of physiologic variables as well as alter body and organ weights and behaviour of both the maternal females and the offspring (Gallo & Weinberg, 1981; Weinberg, 1989; Weinberg & Gallo, 1982). The present data further demonstrate long term effects of pair-feeding and highlight the importance of including an ad libitum fed control group in prenatal alcohol studies. The control of the HPA stress response occurs through multiple feedback loops occurring during three different time domains and at several different levels. CORT feedback inhibition of A C T H and CRF occurs within seconds (fast rate sensitive feedback), over 2-10 h (intermediate feedback), and over hours to days (slow feedback) (Jones & Gillham, 1988; Keller-Wood & Dallman, 1984). Fast rate sensitive feedback is thought to inhibit release of A C T H and CRF but not affect synthesis, whereas intermediate feedback is thought to decrease release of both A C T H and CRF and to v decrease CRF synthesis (Keller-Wood & Dallman, 1984). Slow feedback which occurs only in pathologic conditions where CORT is elevated for days has been shown to decrease not only A C T H release but also A C T H synthesis (Schacter et al, 1982). D E X has been shown to bind preferentially to the anterior pituitary (DeKloet et al, 1975). Thus when D E X is given at high doses (300pg/100 g bw), A C T H content is affected to a much greater extent than CRF content (Carnes et al, 1987). Our finding that E animals show less suppression than controls at 3 and 6 h post-DEX injection, suggests that 106 alterations in H P A responsiveness to stressors in E animals may be mediated through a defect in feedback inhibition at the level of the anterior pituitary during the intermediate feedback time domain. In contrast, Taylor et al.,. (1986b), found that at 10 min post-foot shock stress (during the fast feedback time domain), A C T H levels in E animals remain elevated compared to those in controls. Together, these data suggest that deficits in feedback inhibition may occur during both the fast and intermediate feedback time domains and that it is release and not synthesis of A C T H that contributes to the elevated CORT and A C T H levels seen in E animals. A diurnal variation in both basal and stress-induced H P A hormone release has been demonstrated (Bradbury et al, 1991; Kant et al, 1986). CORT, A C T H , p-EP and p -lipotropin release are greater in the A M than in the P M following a variety of stressors (Bradbury et al, 1991; Kant et al, 1986). The mechanism for this diurnal variation is not clearly understood at present. Recent data from Bradbury et al, (1991) indicate that circadian variations in stress-induced CORT and A C T H release are independent of basal CORT levels. However, a number of other factors may be involved. First, it has been demonstrated that the rate of CORT elevation required for fast feedback inhibition (greater than 1.3 u.g/dl/min) in the P M is much faster (3-15 min) than in the A M (15-30 min). Thus, although maximal CORT levels after restraint stress in the A M and the P M may be similar, maximal CORT levels are reached approximately 12 min earlier in the P M (Bradbury et al, 1991). Second, it has been demonstrated that feedback inhibition in the P M is less sensitive than in the A M ; CORT and A C T H levels are higher in the P M than the A M after the same amount of D E X or CORT is administered (Gibbs, 1970; 107 Wilson et al, 1983). Third, data suggest that there is an increased sensitivity of the adrenal to A C T H in the P M compared to the A M (Dallman, et al, 1976; Haus, 1964; Unger, 1964). CORT release in response to exogenous A C T H is 2.5 times greater in the P M than in the A M (Dallman et al, 1976;). Fourth, there appears to be a decrease in tissue absorption, distribution and/or metabolism of CORT in the P M compared to the A M (Gibbs, 1970; Saba et al, 1963; Wilkinson et al, 1979; Wilson et al, 1983). Plasma CORT concentrations 5 min after a CORT injection in adrenalectomized rats are significantly higher in the P M than the A M (Wilson et al, 1983) and the half-life of CORT is 9% greater in the P M than the A M (Gibbs, 1970). Together these data suggest that the "resetting" of feedback inhibition of the HPA axis in the P M was sufficient to unmask the altered sensitivity in E animals to the inhibitory effects of D E X . That is, in the P M , when the HPA axis is less sensitive to glucocorticoid feedback inhibition, stress CORT levels of both E males and E females as well as stress A C T H levels of E females were not effectively suppressed by D E X . It is possible that the sexual dimorphism of the HPA stress response also underlies the differences in sensitivity to D E X suppression seen in males and females in the A M vs P M . Females have greater diurnal variation in plasma CORT (Ottenweller et al, 1979), higher basal CORT and transcortin levels, and show greater CORT responses to stress than males (Critchlow et al, 1963; Kitay, 1961; Weinberg, 1988) and to A C T H (Osborn et al, 1994), and require higher doses of D E X to produce H P A suppression than males. Furthermore, hippocampal glucocorticoid receptor concentration is higher and binding affinity is lower in females than males (Turner & Weaver, 1985; Weinberg & Petersen, 108 1991). The sex hormones are thought to influence the HPA axis indirectly through effects on hepatic enzyme systems that inactivate CORT (Glenister & Yates, 1961; Kitay, 1961) and binding proteins (Sandberg & Slaunwhite, 1959; Slaunwhite et al, 1962), as well as through noncompetitive binding to glucocorticoid receptors causing destabilisation of the receptor and an increased rate of CORT dissociation (Chou & Luttge, 1988; Suthers et al, 1976; Svec et al, 1980). Burgess and Handa (1992) demonstrated that oestrogen elevates and prolongs activation of the H P A axis after ether and footshock stress and interferes with Type II receptor down-regulation in the hippocampus after 4 days of administration of R U 28362, a Type II receptor-specific agonist. This sexual dimorphism may help to explain the differential responses of E males in the A M vs the P M . First, it is possible that in the present study, peak levels of CORT in males were missed in the A M but not in the P M . As noted, peak CORT levels following stress are reached more quickly in the P M than in the A M . Differences between E and control females, on the other hand, may have been seen in the A M because the rate of rise is faster in females, resulting in the detection of differences even if the peak was missed. Second, the adrenal cortex responds linearly to a log dose of A C T H (Keller-Wood & Dallman, 1984). Thus, differences in A C T H which are not statistically significant could result in significant CORT level differences. As the CORT response to a specific dose of A C T H is greater in females than in males (Osborn et al., 1994), small differences in A C T H release could result in larger differences in CORT levels. Furthermore, in the P M , an increased adrenal sensitivity to A C T H could have resulted in higher stress CORT levels in both E males and E females. This latter 109 possibility is supported by our finding that differences in A C T H levels among E, PF, and C animals were less robust than differences in CORT levels following stress. It is also possible that altered neurotransmitter release may be involved in mediating the H P A hyperresponsiveness of E animals. For example, following restraint stress, cortical and hypothalamic norepinephrine (NE) content is lower in E animals compared to controls (Rudeen & Weinberg, 1993). N E and epinephrine have been shown to stimulate CRF release in a dose dependent manner (Plotsky, 1987). In addition, it has been shown that depletion of hypothalamic N E and serotonin enhances the inhibitory effects of D E X on the CORT response to ether stress (Feldman & Weidenfeld, 1991). If lower hypothalamic N E levels in E animals is indicative of increased N E turnover post-stress, it is possible that prenatal ethanol effects on N E regulation of CRF secretion may play a role in H P A axis hyperactivity in E offspring. Consistent with this hypothesis, Lee at al (1990) demonstrated increased CRF biosynthesis and expression along with an increased A C T H response to stressors in E animals compared to controls. Thus, altered feedback inhibition of neurotransmitter stimulated CRF secretion may also play a role in the stress hyperresponsiveness of E animals. However, the finding that E animals demonstrate altered responses to physiologic, physical, and neurogenic stressors suggest that more that one neural pathway may be affected by prenatal ethanol exposure (Nelson et al, 1984; Taylor et al, 1982; Taylor et al, 1987; Weinberg & Gallo, 1982; Weinberg, 1988; Weinberg, 1992a). 110 Finally, these data may be of clinical importance. Children prenatally exposed to alcohol are hyperactive, uninhibited and impulsive in behaviour, and have attention deficits which may reflect an inability to inhibit responses (Streissguth et al, 1983; Streissguth et al, 1985; Streissguth, 1986). These behavioural deficits are particularly noticeable in stressful situations (Streissguth, 1986). Recently, it has been shown that maternal drinking during pregnancy is associated with higher post-stress Cortisol levels in infants (Jacobson et al, 1993). CRF, A C T H , and glucocorticoids are known to modulate behaviour during stress (McEwen et al, 1986). Thus, it is possible that sustained increases in hormones of the HPA axis could play a role in mediating the increased hyperactivity and behavioural arousal that are observed in foetal alcohol-exposed children. Ill TABLE 3. UNDISTURBED CORT-LEVELS (jig/100 ml; Mean ± SEM) * Main effect of dose, p < 0.01: 0 (saline) > D E X p < 0.01 112 Table 3. DEX Males Time Post-DEX Injection (LLg/lOOg bw) 3_h 6_h 10 h 26 h 36 h 0 1.7 ± 0 . 4 2.8 ± 0,5 13.2 ± 1.8 1.0 ± 0 . 1 11.4 ± 0.7 1.0 5.0 0.7 ± 0.04* 0.9 ± 0 . 2 * 0.7 ± 0 . 0 3 * 0.7 ± 0 . 0 3 * 2.7 ± 0 . 7 * 0.6 ± 0 . 1 15.0 0.7 ± 0.2* 0.7 ± 0.02* 0.7 ± 0 . 1 * 0.8 ± 0.2 10.3 ± 0 . 9 DEX Females Time Post-DEX Injection (Lig/lOOg bw) 3h 6_h 10 h 26 h 36 h 0 3.6 ± 0 . 7 2.8 ± 0 . 6 29.7 ± 3 . 0 3.0 ± 0 . 7 29.2 ± 2 . 6 1.0 0.9 ± 0.04* 1.5 ± 0 . 5 10.0 0.9 ± 0.04* 1.4 ± 0 . 2 * 3.0 ± 1.0* 1.3 ± 0 . 3 30.0 0.9 ± 0 . 0 3 * 1.4 ± 0 . 2 * 1.3 ± 0 . 2 * 1.4 ± 0 . 2 26.9 ± 2 . 5 113 Figure 10. Stress CORT Levels in Males 3 and 6 h After DEX Injection in the A M . Points represent mean ± SEM. * Main Effect of Dose, p < 0.01: 5.0 ,15.0 < 0 pg/100 g bw at 3 and 6 h, p's < 0.01. 114 DEX(ug/100ug bw) 115 Figure 11. Stress CORT Levels in Males 10 and 26 h After DEX Injection in the A M . Points represent mean ± SEM. * Main Effect of Dose, p < 0.01: 5.0 ,15.0 < 0 pg/100 g bw at 10 and 26 h, p's 0.01. 116 0 5.0 15.0 DEX(ug/100g bw) 117 Figure 12. Stress CORT Levels in Males 36 h After DEX Injection in the A M . Points represent mean ± SEM. No significant effects of group or dose. 118 119 Figure 13. Stress CORT Levels in Females 3 and 6 h After DEX Injection in the A M . Points represent mean ± SEM. * Main Effect of Dose, p < 0.01: 10.0, 30.0 < 0 pg/lOOg bw at 3, and 6, p's < 0.01. # Main Effect of Group, p < 0.05: E > PF = C, p's < 0.05 at 3 and 6 h. .120 Figure 14. Stress CORT Levels in Females 10 and 26 h After DEX Injection in the A M . Points represent mean ± S E M . * Main Effect of Dose, p < 0.01: 30.0 < 0 pg/lOOg bw at 10 h; 10.0, 30.0 < 0 pg/ lOOg bwat26 h, p's < 0.01. 122 CONTROL PAIR-FED ETHANOL o o r—i H O O 03 C3 10.0 DEX(ug/100g bw) CONTROL V//A PAIR-FED ETHANOL o o O U s 100 90 80 -70 60 -50 -40 -30 -20 10 0 0 10.0 DEX(ug/100gbw) 30.0 123 Figure 15. Stress CORT Levels in Females 36 h After DEX Injection in the A M . Points represent mean ± SEM. No significant effects of group or dose. 124 Figure 16. Stress A C T H Levels in Males 3 and 6 h After DEX Injection in the A M . Points represent mean ± SEM. * Main Effect of Dose, p < 0.001: 1.0, 5.0, 15.0 < 0 ug/lOOg bw at 3 h, p's < 0.01;5.0, 15.0 < 0 p-g/lOOg bw at 10 h, p's < 0.01. 126 0 1.0 5.0 15.0 DEX(ug/100gbw) Figure 17. Stress A C T H Levels in Males 10 and 26 h After DEX Injection in the AM. Points represent mean ± S E M . * Main Effect of Dose, p< 0.01: 5.0, 15.0 < 0 p.g/100g bw at 10 h, p's < 0.01. # Main Effect of Group, p < 0.05: E - C > PF at 26 h, p's < 0.05. 128 CONTROL V//A PAIR-FED ETHANOL a K H U cd CO • 300 250 200 150 100 r 50 h 0 5.0 DEX(ug/100gbw) 15.0 CONTROL V//A PAIR-FED ETHANOL 300 0 5.0 15.0 DEX(ug/100gbw) 129 Figure 18. Stress A C T H Levels in Males 36 h After DEX Injection in the A M . Points represent mean ± SEM. No significant effects of group or dose. 130 131 Figure 19. Stress A C T H Levels in Females 3 and 6 h After DEX Injection in the A M . Points represent mean ± SEM. * Main Effect of Dose, p < 0.001: 1.0, 10.0, 30.0 < 0 pg/lOOg bw at 3 h, p's < 0.01; 30.0< 0 pg/lOOg bw 10 h, p< 0.01. 132 0 1.0 10.0 30.0 DEX(ug/100gbw) Figure 20. Stress A C T H Levels in Females 10 and 26 h After DEX Injection in the A M . Points represent mean ± SEM. * Main Effect of Dose, p < 0.01: 30.0< 0 pg/lOOg bw at 10 h, p's < 0.01. # Main Effect of Group, p < 0.05: E and PF > C at 26 h, p's < 0.05. 134 0 10.0 30.0 DEX(ug/100gbw) 135 Figure 21. Stress A C T H Levels in Females 36 h After DEX Injection in the A M . Points represent mean ± SEM. No significant effects of group or dose. 136 0 30.0 DEX(ug/100gbw) 137 Figure 22. Stress CORT Levels in Males and Females 3 h After DEX Injection in the PM. Points represent mean ± SEM. * Main Effect of Dose, p < 0.001: D E X < saline, p's < 0.001. # Main Effect Group, p < 0.05: Males E > PF = C, p's < 0.05; Females E > C, p's <0.01. + Group x Dose interaction, p < 0.05: Males at 5.0 u.g/100g bw, E > C p < 0.05; at 15.0 p.g/100g bw, E > PF, p < 0.05. 138 CONTROL Y//A PAIR-FED B888 ETHANOL 139 Figure 23. Stress A C T H Levels in Males and Females 3 h After DEX Injection in the PM. Points represent mean ± S E M . * Main Effect of Dose, p < 0.001: D E X < saline, p's < 0.001. # Main Effect of Group, p < 0.05: Females at 30.0pg/100g bw, E > PF = C, P's < 0.05. 140 0 5.0 15.0 DEX(ug/100gbw) DEX (ug/lOOgbw) 141 D. EFFECTS OF FOETAL ETHANOL EXPOSURE ON CORTICOTROPHIN RELEASING FACTOR (CRF), ARGININE VASOPRESSIN (AVP), AND GLUCOCORTICOID RECEPTOR (GR) mRNA FOLLOWING DEXAMETHASONE SUPPRESSION. D.l INTRODUCTION Corticotropin releasing factor was once thought to have only releasing factor functions . However, recent data suggests that CRF may act to co-ordinate the endocrine, autonomic, and behavioural responses to stress (Nemeroff, 1992). CRF is released into the hypophysial portal vasculature by parvocellular neurosecretory neurons in the paraventricular nucleus (PVN) of the hypothalamus and is the principal driving force in regulation of the pituitary-adrenal axis in response to stress (Antoni, 1986; Sawchenko & Swanson, 1990). In addition, CRF mRNA expression has been found in the cerebral cortex, limbic system, cerebellum and spinal cord (DeSouza et al, 1985) suggesting that CRF may play a substantial role in the stress response beyond that of hormone stimulation. Furthermore, intracerebroventricular administration of CRF at low doses results in behavioural responses associated with stress, including increases in feeding, locomotion in a novel environment and shock-induced fighting, as well as decreases in social interaction. In contrast, administration at high doses results in behavioural responses associated with anxiety and maladaptive behaviour, including decreases in feeding, in sexual activity, locomotion in a novel environment and shock-induced 142 fighting (Dunn & Berridge, 1990). Therefore, CRF may be considered the master hormone in control of the endocrine, autonomic, and behavioural responses to stress. CRF transcription measured by CRF mRNA levels in the P V N is negatively regulated by glucocorticoids (Jingami et al, 1985, Young et al, 1986). Adrenalectomy increases CRF mRNA levels and glucocorticoid replacement effectively reduces elevated CRF mRNA levels to basal levels. Direct placement of glucocorticoid pellets into the P V N results in a decrease in CRF transciption (Harbuz & Lightman, 1989; Kovacs & Mezey, 1987). Furthermore, Lightman and Harbuz (1993) demonstrated that CRF mRNA expression is dependent on glucocorticoids in adrenalectomized rats; the higher the replacement of dexamethasone or CORT the lower the CRF mRNA level. Although prenatal ETOH exposure has been shown to affect both fast feedback inhibition (Talyor et al, 1988) and possibly intermediate feedback inhibition (Osborn et al, 1996), the exact mechanism of H P A hyperresponsiveness has yet to be determined. A n alternative hypothesis for the H P A hyperresponsiveness seen in E animals may be that of altered CRF biosynthesis and/or secretion by the hypothalamus. In support of this hypothesis, Lee et al, (1990) demonstrated an increase in CORT levels in E compared to C animals following inescapable shock, as well as an increase in paraventricular nucleus (PVN) CRF mRNA in nonstressed E animals compared with C animals. To our knowledge no studies to date have investigated P V N CRF mRNA in E, PF, and C animals following exposure to a stressor. The present study utilised in situ 143 hybridization to investigate further the hypothesis that H P A hyperresponsiveness seen in E animals is mediated through alterations in feedback inhibition of glucocorticoids on CRF synthesis in the P V N of the hypothalamus. The effects of D E X blockade on stress CRF, A V P , and GR mRNA levels were examined in E, PF and C males and females. D.2 METHODS Sprague-Dawley males (n=25) and females (n=53) were obtained from Canadian Breeding Farms, St. Constant, PQ. Animals were bred and fed according to Chapter II: General Methods. On d 12-14 of gestation, blood samples (0.4-0.6 ml) were obtained from the tail from 3 unanaesthetised females at 1900 h for determination of blood ethanol levels (Sigma Diagnostic Kit 332-UV, based on Bonnischsen & Theorell ,1951). Females were undisturbed except for weighing and cage cleaning on d 1,7, 14, and 21 of gestation. At birth, designated d l of lactation, dam and pups were weighed and all litters culled to 10 (five males and five females). Dam and pups were weighed and cages cleaned on d 1, 8, 15, and 22 of lactation. On d 22, pups were weaned and housed by sex and by litter until testing at 90-110 days of age. One wk prior to testing, animals (n = 6-9 E, PF, and C males and females for each postnatal treatment) were singly housed. Testing order was counterbalanced across prenatal treatment, sex, and injection dose. Animals were assigned to one of 2 doses of D E X ( 0 (saline) or 15.0 u,g/100 g bw for males or 30.0 for females pg/100 g bw), administrated IP in a volume of 3.0 cc. Animals were placed back into their home cage •144 following D E X injection and 3 h later were exposed to ether vapour for approximately 45 sec. Animals were then placed in a holding room for 60 min after which time blood samples were collected by decapitation for determination of CORT levels and brains were collected for CRF, A V P , and GR mRNA analysis (See Chapter II: General Methods). A separate group of animals (n =5 E, PF, and C males and females) was taken directly from the colony room and decapitated between 0800 - 0830 h or 1200 - 1230 h to determine i f there were changes in mRNA levels over the period of testing. D.3 STATISTICAL ANALYSES Data were analysed by appropriate analyses of variance (ANOVAs) for factors of group (E, PF, C), sex, dose of D E X , and site. Because of the complexity of the 4 way A N O V A , A N O V A s for females and males as well as A N O V A s on undisturbed animals were run separately. Significant effects were further analysed with Tukey's post-hoc tests. D.4 RESULTS Developmental Data Ethanol intake of pregnant females was consistently high throughout gestation averaging 9.2± 0.4, 11.6 ± 0.4, 11.5 ± 0.2 g/kg bw/day for wk 1, 2, and 3 of gestation respectively. Blood alcohol levels were measured in 3 females at 1900 h and were consistent with previous levels (Weinberg, 1985), averaging 159.5 ± 19.6 mg/dl. 145 A repeated measures A N O V A on maternal weight gain during pregnancy revealed significant main effects of group (p < 0.001) and days (p < 0.001), as well as a group x days interaction ( p < 0.001). Post-hoc tests indicated that E and PF females weighed significantly less than C females on d 7, 14, and 21 (p's < 0.01). During lactation, a group x days interaction (p < 0.001) was also seen. E females weighed significantly less than C females on lactation d 1 (p<0.01). There were no significant differences among E, PF and C females on lactation d 8, 15, or 22. There were no significant differences among groups for litter size or number of stillborn pups. Analysis of pup body weights during lactation showed a significant group x days interaction (p < 0.05). Post hoc tests indicated that E and PF pups weighed significantly less than C pups on d 1 and 8 of age (p's < 0.01). There were no significant differences in pup weight on lactation d 15 and 22 and no significant difference in weight at the time of testing. Experimental Results CORT Levels For both males and females there was a main effect of dose (p's < 0.05). Animals injected with D E X had significantly lower CORT levels than animals injected with saline (Fig. 24). There were no significant differences among E, PF, and C males and females. 146 CRF mRNA There were no significant differences in undisturbed males or females at 0800-0830 h compared to undisturbed males (Fig. 25 ) or females (Fig. 26) at 1200-1230 h. There was a significant site x sex interaction (p < 0.01) for undisturbed animals. Undisturbed females demonstrated higher levels of CRF mRNA than undisturbed males in the more anterior section of the P V N (p < 0.05) whereas undisturbed males demonstrated higher mRNA levels at the central section of the P V N (p < 0.01). For stressed males there were significant main effects of dose and site (p's < 0.05) as well as a significant group x site interaction (p < 0.05) (Fig. 27). Males injected with D E X had lower CRF mRNA levels than males injected with saline. Furthermore, the more anterior sections had lower CRF mRNA levels than the more posterior sections. Among groups, there were no significant differences in the more anterior P V N sections; however, in the more posterior sections there was a trend for E males to have higher CRF mRNA levels than PF males (p < 0.1). For stressed females, there were significant main effects of group (p < 0.05) and site (p < 0.001) (Fig. 28). Among groups there were no significant differences in the more anterior P V N sections; however, in the more posterior sections E females had significantly higher CRF mRNA levels than PF females (p < 0.05) and showed a trend toward higher levels than C females (p < 0.1). Again the more anterior sections had lower CRF mRNA levels than the more posterior sections. There were no significant differences between D E X and saline injected animals. A V P mRNA There were no significant differences in undisturbed males (Fig. 29) or females (Fig. 30) at 0800-0830 h compared to those at 1200-1230 h. There was however a significant effect of site (p< 0.001). The more anterior P V N sections had 147 lower A V P mRNA then the more posterior sections. There were no significant effects of D E X or saline injection for either males (Fig. 31) or females (Fig 32). GR mRNA There were no significant differences in undisturbed (Fig. 33) or stressed (Fig. 34) GR mRNA levels among E, PF and C males or females. D.5 DISCUSSION The results of this study demonstrate that overall, males and females injected with D E X had lower CORT levels than males and females injected with saline, and that males injected with D E X had lower CRF mRNA levels than saline injected males. Importantly, there were no significant differences in CRF or A V P mRNA levels measured under undisturbed conditions among'E, PF and C animals, and no significant differences in CRF or A V P mRNA between 0800 and 1200 h in undisturbed groups. There were, however, significant differences in CRF and A V P mRNA levels depending upon the site of section. Sections from the anterior aspect of the P V N had lower CRF and A V P mRNA than more central sections. Females had higher CRF mRNA levels in the more anterior sections as compared to males, whereas males had higher CRF mRNA levels in the more central sections as compared to females. Moreover, a significant prenatal treatment effect was seen in the stressed animals. E males showed a trend toward higher stress CRF mRNA levels than PF males. E females had significantly higher stress CRF mRNA levels than PF females and showed a trend toward higher stress CRF mRNA levels than C females. There were no group differences in A V P or GR mRNA levels in the P V N . 148 These data do not support the hypothesis that HPA hyperresponsiveness and/or delays in recovery from stressors that occur in E animals result from alterations in feedback inhibition at the level of the hypothalamus. Instead the data suggest that the hyperresponsiveness seen in E animals may be due to increased synthesis of CRF. The results of this study were consistent with the two previous studies in this dissertation indicating that post-ether stress animals given D E X had significantly lower CORT levels than animals injected with saline. In contrast to the previous studies, no significant differences in CORT levels among E, PF and C males and females were seen. t A possible reason is that CORT levels were examined 1 h post-stress when the CORT levels were recovering towards basal levels, whereas the previous studies examined CORT levels at 20 min post-stress when the CORT secretion rate is at its peak. This change in sampling time was required in order to examine CRF and A V P mRNA levels. Therefore, the difference in CORT levels may only be present during the peak of the CORT response and not during recovery from stress. Interestingly, D E X suppression of CRF mRNA appears to further demonstrate the sexual dimorphism of the HPA axis. A decrease in CRF mRNA was seen only in males following D E X injection. In vivo studies have demonstrated that D E X preferentially binds to the pituitary (De Kloet et al, 1975; Spencer et al, 1990). Administration of D E X (200 pg/day) for 7 days to adrenalectomized rats has been shown to reduce ACTH/pMipotropin precursor mRNA to a much greater extent (19% of intact controls) 149 than prepro-CRF mRNA (102% of intact controls) (Jingami et al, 1985). In addition, subcutaneous injection of D E X has been shown to produce a selective and time related decrease in available Type II receptors in the pituitary and to have no effect on the Type II receptors in the hippocampus at doses of 1-50 u,g/kg bw (Spencer et al, 1995). D E X in the drinking water has been demonstrated to activate pituitary Type II receptors at varying doses (0.3 u.g/ml, 0.8 |ag/ml, and 10.0 pg/ml), whereas hippocampus and hypothalamus Type II receptors are only activated at an exceedingly high dose of D E X (10 pg/ml) (Miller et al, 1992). Furthermore, low dose D E X (1.5 pg/ml) in the drinking water overnight does not effect Type II binding in the hippocampus but 1.0 pg/ml of D E X in the drinking water for 1,2, and 3 days does significantly reduce Type II activation (Spencer et al, 1990). Thus, it appears that the ability of D E X to cross the blood brain barrier and bind to type II receptors may be a function of dose and time and that in males the increase in sensitivity of the HPA axis to feedback inhibition may be in part due to central effects of glucocorticoids on the hypothalamus. Moreover, in the present study it was demonstrated that the sex difference in CRF mRNA depended upon the site of analysis. Females had higher CRF mRNA levels in the more anterior sections of the P V N whereas males had higher levels in the more central sections. It has been well demonstrated that there is a significant gender difference in the neuroendocrine response to stress which appears to be associated with the presence of sex-specific gonadal steroids (Critchlow et al, 1963; Kant et al, 1983; Kitay, 1963; Turner & Weaver, 1985). In humans, it has been demonstrated that females have higher 150 hypothalamic CRF concentrations than males (Frederiksen et al, 1991). In the rat it has been shown that during the afternoon of proestrous there is an increase in CRF mRNA levels (Bohler et al, 1990) and that oestrogen treatment of overectomized rats increases CRF content (Burgess & Handa, 1992). In contrast, Patchev et al, (1995) demonstrated that males have higher CRF mRNA levels in the hypothalamus than females. A possible explanation for this discrepancy may be that previous studies looked at whole content rather than individual sections. Taken together with the our data, it appears that sex differences in CRF mRNA may vary throughout the P V N and the variation may be site specific. Furthermore, there appears to be a variation in the circadian rhythm in CRF mRNA levels of males and females. Female rats demonstrate higher P V N CRF mRNA levels in the A M whereas males demonstrate higher levels in the P M . A possible mechanism for the sex difference is that oestrogen may alter CRF gene expression. Vamvakopoulas and Chrousos (1993) demonstrated five perfect half palindromic oestrogen responsive elements (ERE) on the CRF gene. Half palindromic EREs have been demonstrated to enhance CRF gene activity (Wilson et al, 1992). In this study it was demonstrated that the anterior section of the P V N contains lower levels of CRF and A V P mRNA than sections taken approximately 40 pm posterior. CRF is synthesised in the parvocellular cells of the P V N , transported to the axon terminals in the external zones of the median eminence, and released into the hypophyseal portal vascular system. A V P coexists with some CRF neurons in the parvocellular cells. A V P also coexists in the magnocellular cells of the P V N which 151 terminate in the posterior pituitary and are involved with fluid balance. Immunohistochemical localisation has demonstrated that the CRF-immunoreactive neurons whose axons project to the median eminence are centred in the dorsal aspect of the medial parvocellular area of the P V N (Kawano et al, 1988; Swanson et al, 1983). It is therefore possible that the lower density of hybridization signal seen in the more anterior section may reflect the fact that this area contains fewer CRF and A V P neurons as compared to the central sections rather than reflecting decreased gene expression. Future research should contain single cell analysis to address this issue. Sample site may also play a role in the variation in response that one may see from study to study or with different stressors. As demonstrated by this study, there are significant differences in the CRF and A V P mRNA levels of sections as close as 40 um apart. Therefore, when comparing studies it is important to have an idea of where in the P V N the section was taken and i f possible to analyse more than one section. Unfortunately, due to technical problems this was not possible for GR mRNA. Timing also plays a key role in transcription analysis. In response to ether stress, c-fos mRNA in the medial parvocellular P V N appears to respond within 15 min, peak at 30 min, diminish at 60 min and fall to control levels within 2-3 h (Kovacs & Sawchenko, 1996). Unfortunately, although measurement of c-fos was an original aim of the present study, c-fos could not be measured due to technical problems with the probe. CRF mRNA levels have been seen to increase at 120-180 min (Lightman et al, 1993); however, the time course has not been fully described. Consistent with our data, other 152 investigators have also failed to detect a reliable up-regulation of CRF mRNA in the P V N following ether stress (Kovacs & Sawchenko, 1996; Watts, 1991). Although statistically significant effects of ether stress on in CRF mRNA levels were seen in E females, it is possible that later sampling or another stressor would better quantify the signal. Further, it appears that ether stress may differential increase CRF and A V P heteronuclear R N A (hnRNA), another measure of neuronal response to stressors, depending on the timing of the sample (Kovacs & Sawchenko, 1996). CRF hnRNA peaks at 5 min whereas A V P hnRNA peaks at 120 min post ether stress (Kovacs & Sawchenko, 1996). Therefore, in future studies measurement of multiple time points following a stressor and measurement of CRF and A V P hnRNA and c-fos as well as CRF and A V P mRNA should be done. Finally, the increase in A V P mRNA following stress is very difficult to quantify because of the the intermingling of the magnocellular neurons; thus single cell analysis would have been a better method to investigate A V P changes (Lightman & Young, 1987b). In contrast with the data of Lee et al, (1990), we did not find differences in basal CRF mRNA levels among E, PF and C animals. However, a significant effect of prenatal treatment was seen in the stressed animals regardless of the injection dose. E males showed a trend toward higher CRF mRNA levels than PF males, and E females had significantly higher CRF mRNA levels than PF females and showed a trend toward higher CRF mRNA levels that C females. A possible mechanism for the altered synthesis may be an alteration in the adrenergic drive to the P V N . Ascending adrenergic fibres from the brainstem have been demonstrated to stimulate CRF neurons (Palkovits, 1987) and microinjection of norepinephrine (NE) has been demonstrated to stimulate both CRF 153 gene expression in the P V N and CRF secretion into the portal circulation (Itoi et al, 1994). In addition, lesion studies in the P V N have indicated that N E pathways are involved in stress induced CRF mRNA expression but are not involved in maintaining basal CRF mRNA (Harbuz et al, 1991) which may explain why increased CRF mRNA was only seen in E animals under stress. It remains to be determined if the increase in gene expression is reflective of an increase in synthesis and/or release. Importantly, the finding of altered CRF synthesis in E animals may have implications beyond those relating to strictly endocrine responses to stressors. The autonomic and CRF neurons of the P V N have been demonstrated to be morphologically and functionally linked suggesting that CRF neurons within the P V N not only mediate endocrine responses but also behavioural responses to stressors. Repeated administration of CRF for 5 days has been shown to increase tyrosine hydroxylase levels in the locus coeruleus (LC) (Melia & Duman, 1991) suggesting bi-directional input of CRF from the P V N to N E in the L C . Injection of CRF into the P V N results in a robust autonomic response (Brown & Fisher, 1985) and an increase in gastric secretion (Gunion & Tache, 1987), as well as, induces locomotor activity similar to that seen under stress conditions (Monnikes et al, 1992). Furthermore, administration of CRF monoclonal antibody targeted-toxin into the P V N reverses the decreased exploration of the elevated plus-maze open arms caused by prior exposure to a social stressor (Menzaghi et al, 1994). CRF injection into the P V N also decreases food intake in a manner similar to that of stress induced anorexia (Krahn et al, 1988); a-helical CRF reverses restraint stress-induced anorexia (Krahn et al, 1986). Thus, CRF synthesised in the P V N may act both as a 154 secretagogue for the anterior pituitary hormones and as an extrapituitary peptide neurotransmitter to co-ordinate the stress response at several body levels. Finally, these data have clinical significance. As mentioned previously, children prenatally exposed to alcohol are hyperactive, impulsive in behaviour, and have deficits which may reflect an inability to inhibit responses particularly in stressful situations (Streissguth et al, 1983; Streissguth et al., 1990). Interestingly, individuals with affective or anxiety disorders also demonstrate altered HPA axis response to stress including elevated CORT and A C T H levels as well as non-suppressibility of the HPA axis to D E X (Nemeroff, 1992). Elevated CRF levels in the cerebrospinal fluid have been found in depressed patients who do not demonstrate suppression of the H P A axis following D E X administrations (Arato et al, 1986; Nemeroff & Evans., 1984; Risch et al, 1987). Moreover, it has been demonstrated in rats that local administration of CRF into the L C results in an increase in unstimulated neuronal discharge and decreased or unchanged firing with exposure to foot-shock (Valentino & Foote, 1987; Valentino & Foote, 1988) suggesting that elevated CRF disrupts the normal pattern of discharge in the L C . Therefore, it is possible that increased CRF release could result in persistently elevated neuronal discharge rates and decreased responses to phasic sensory stimuli, thus producing alterations in behaviour. Such a mechanism could, at least in part, underlie the behavioural changes such as hyperarousal and decreased attention span seen in children prenatally exposed to alcohol as well as in patients with some affective and anxiety disorders (Valentino & Foote, 1987; Valentino & Foote, 1988). 155 Figure 24. Stress Corticosterone Levels in Males and Females 3 h After DEX Injection in the A M . Points represent mean ± SEM. # Main Effect of Dose, p < 0.001: D E X < saline, p's < 0.001. 156 CORTICOSTERONE CONTROL W%\ PAIR-FED r223 ETHANOL # # # 15 DEX(ug/100gBW) CONTROL PAIR-FED £221 ETHANOL 30 D E X (ug/lOOgBW) 157 Figure 25. Undisturbed CRF mRNA Levels in Males in the A M . Points represent mean ± SEM. No significant effects of group or time samples. 158 CONTROL V//A PAIR-FED tS888J ETHANOL PVN1 basal 1 basal 2 Figure 26. Undisturbed CRF mRNA Levels in Females in the A M . Points represent mean + SEM. No significant effects of group or time samples. 160 CONTROL PAIR-FED ETHANOL PVN1 PVN5 basal 1 basal 2 161 Figure 27. Stress CRF mRNA Levels in Males 3 h After DEX Injection in the A M . Points represent mean ± SEM. # Main effect of dose, p's < 0.05: 15.0 pg/100 g bw < vehicle 162 CONTROL V//A PAIR-FED 188881 ETHANOL SALINE 15.0 DOSE(ug/100gBW) CONTROL V//A PAIR-FED $$$$$ ETHANOL SALINE 15.0 DOSE(ug/100gBW) • 163 Figure 28. Stress CRF mRNA Levels in Females 3 h After DEX Injection in the A M . Points represent mean ± SEM. * Main effect of group, p < 0.05: E < PF, p < 0.05. 164 CONTROL V//A PAIR-FED 18888 ETHANOL PVN1 SALINE 30.0 DOSE(ug/100gBW) CONTROL V//A PAIR-FED 18888 ETHANOL SALINE 30.0 DOSE(ug/100gBW) 165 Figure 29. Undisturbed AVP mRNA Levels in Males in the A M . Points represent mean ± SEM. No significant effects of group or time samples. 166 basal 1 basal 2 CONTROL PAIR-FED ETHANOL PVN7 Figure 30. Undisturbed AVP mRNA Levels in Females in the A M . Points represent mean ± SEM. No significant effects of group or time samples. 168 CONTROL V//A PAIR-FED 188881 ETHANOL basal 1 basal 2 169 Figure 31. Stress AVP mRNA Levels in Males 3 h After DEX Injection in the A M . Points represent mean ± SEM. No significant effects of group or dose. 170 CONTROL V//A PAIR-FED 18888 ETHANOL SALINE 30.0 DOSE(ug/100gBW) CONTROL V//A PAIR-FED ETHANOL SALINE 15.0 DOSE(ug/100gBW) 171 Figure 32. Stress AVP mRNA Levels in Females 3 h After DEX Injection in the A M . Points represent mean ± SEM. No significant effects of group or dose. 172 CONTROL PAIR-FED ETHANOL PVN3 SALINE 30.0 DOSE(ug/100gBW) SALINE 30.0 DOSE.(ug/100gBW) 173 Figure 33. Undisturbed GR mRNA Levels in Males and Females in the A M . Points represent mean ± SEM. No significant effects of group or time samples. 174 CONTROL PAIR-FED ETHANOL Male Female basal 1 basal 2 Figure 34. Stress GR mRNA Levels in Males and Females 3 h After DEX Injection in the AM. Points represent mean ± SEM. No significant effects of group or dose. 176 SALINE 15.0 DOSE(ug/100gBW) SALINE 30.0 DOSE(ug/100gBW) .177 CHAPTER IV: BEHAVIOURAL ALTERATIONS IN FOETAL ETHANOL EXPOSED RODENTS. A. EFFECTS OF FOETAL ETHANOL EXPOSURE ON BEHAVIOUR ON THE ELEVATED PLUS M A Z E A.1 INTRODUCTION Rodents prenatally exposed to ethanol (E) demonstrate many of the physical findings seen in children exposed to alcohol in utero, including growth deficiencies (Abel & Dintcheff, 1978; Gallo & Weinberg, 1986), changes in brain morphology (Meyer et al., 1990b; West et al., 1989), and soft tissue and skeletal abnormalities (Abel, 1978; Gallo & Weinberg, 1986; Sulik, 1983). Importantly, as in children exposed to alcohol in utero, cognitive (Abel, 1979) and behavioural deficits have also been seen in E offspring. Many of the behavioural changes observed in E offspring appear to reflect hyperactivity and hyperresponsiveness and/or deficits in response inhibition. Increased open field activity (Bond, 1981; Bond, 1986), increased wheel running (Martin et al., 1978), increased startle reactions (Anandam et al, 1980), and increased exploratory behaviour (Bond & DiGiusto, 1977a; Riley & Meyer, 1984), as well as deficits in passive avoidance learning (Bond & DiGiusto, 1977b; Bond & DiGiusto, 1978; Gallo and Weinberg, 1982; Riley et al, 1979a; Riley et al, 1986), taste aversion learning (Riley et al, 1984), reversal 178 learning (Lochry & Riley, 1980), and nose poking behaviour (Riley et al, 1979b) have all been demonstrated in E offspring. In addition to altered performance and activity, rodents prenatally exposed to ethanol have been shown to have altered behavioural responses to stressors including increased stress-induced analgesia (Nelson et al, 1985b), increased stress-induced alcohol consumption (Nelson et al, 1983a), and an inability to adapt to a stressful swimming paradigm (Taylor et al, 1983). Interestingly, E animals also demonstrate hyperresponsiveness of the hypothalamic-pituitary adrenal (HPA) axis to stressors including increased or prolonged secretion of adrenocorticotrophin (ACTH), p-endorphin (P-EP) and corticosterone (CORT). Increased HPA responsiveness to cardiac puncture (Taylor et al, 1982), restraint (Talyor et al, 1982; Weinberg, 1988; Weinberg et al, 1992b), noise and shaking, (Taylor et al, 1982), novel environments (Weinberg, 1988), intermittent shock (Nelson et al, 1984; Nelson et al, 1986), ether (Angelogianni & Gianoulakis, 1989; Weinberg & Gallo, 1982) and cold stress (Angelogianni & Gianoulakis, 1989) have been demonstrated in E compared to control offspring. Furthermore, E offspring appear to have deficits in using or responding to environmental cues. Unlike control animals, E animals do not show a differential CORT response to predictable and unpredictable restraint stress (Weinberg et al, 1992a), nor do E animals demonstrate reduced CORT responses to a novel environment when allowed access to water (Weinberg, 1988). 179 The present study further investigates behavioural and hormonal responses in E animals on the elevated plus maze (+-maze). The +-maze task provides a valid and reliable measure of anxiety/fear as measured by behavioural, physiological, and pharmacological responses (Lister, 1987; Pellow et al, 1985). The task is based on spontaneous behaviour and does not require training of the animal, exposure to noxious stimuli, or manipulation of appetitive behaviours such as food deprivation. In addition, it is sensitive to the anxiolytic effects of benzodiazepine (BDZ)-like agents after acute administration without the interference of sedative side effects on behaviour (Lister, 1987; Pellow et al, 1985). The +-maze comprises an elevated cross-maze with two open and two closed arms. It can be considered an aversive task in that it generates a conflict situation by simultaneously activating two natural tendencies, exploration of a novel environment and avoidance of open spaces (Falter et al, 1992). It has been shown that control or undrugged animals prefer the closed arms of the maze, demonstrating decreased entries onto the open arms and decreased time spent on the open arms as compared to closed arms (Lister, 1987; Pellow et al, 1985). In addition, animals confined to the open arms exhibit higher CORT levels, an index of stress (Selye, 1973) than animals confined to the closed arms (Pellow et al, 1985) In the present study, we utilised the +-maze as an aversive situation to explore the hypothesis that prenatal ethanol exposure alters behavioural responses to stress. In Experiment 1, animals were exposed to the +-maze on consecutive days to compare behavioural responses of E and control animals and to determine i f behaviour changed differentially with repeated exposure. In addition, both behaviour and CORT levels were 180 measured in animals confined to the open and the closed arms to identify i f behavioural changes and H P A activation occur in parallel. In Experiment 2 of this study, animals were exposed to an open field apparatus prior to being placed on the +-maze. Previous studies have shown that animals placed in a novel environment before exposure to the +-maze tend to increase overall activity in the +-maze and increases the likelihood that the open arms are explored (Pellow et al., 1985). A.2 METHODS Sprague-Dawley males (n=25) and females (n=82) were obtained from Canadian Breeding Farms, St. Constant, PQ. Animals were bred and fed according to Chapter II: General Methods. Two replicate breedings, with 39-43 females in each, were done. Blood samples (0.4-0.6 ml) were obtained from the tail of 3 unanaesthetised females in each breeding at 1900 h on dl4 of gestation for determination of ethanol levels (sigma Diagnostic Kit 332-UV, based on Bonnischsen & Theorell, 1951). Females were undisturbed except for weighing and cage cleaning on d 1, 7, 14, and 21 of gestation. At birth, designated d l of lactation, dams and pups were weighed and all litters culled to 10 ( five males and five females). Dams and pups were weighed and cages cleaned on d 1, 8, 15, and 22 of lactation. On d 22, pups were weaned and housed by sex and by litter until testing at 60-90 days of age. 181 This study was completed in 3 experiments all using behavioural tests (+-maze and open field (OF) described in Chapter II: General Methods Part E). Experiment la One week prior to testing, animals were singly housed. (n=9-10 for each of E, PF, and C males and females). A l l testing was done between 0830 and 1200 h with prenatal treatment groups being counterbalanced for order of testing and run times. Animals were tested on two consecutive days, at the same time each day, and all testing was done blind to the animal's prenatal treatment group. Low level (40 dB) white noise was used to mask any extraneous room noises. At the time of testing on each of the consecutive test days, animals were taken from the colony room to an adjacent test room and placed on the centre of the +-maze facing an open arm. At the end of the 5 min test, animals were placed in a holding room until all testing was completed, at which time all animals were returned to the colony room. The +-maze was washed with 70% ETOH after each animal. Experiment lb Animals tested in experiment l a were retested beginning 2 wk after the conclusion of Experiment la, between 0830 and 1200 h. Animals were removed from the colony room and placed on either an open or a closed arm of the maze. The entrances to the other arms were blocked. Behaviours were recorded for the first and last 5 min of a 20 min test. One wk later, testing was repeated. Groups were counterbalanced so that half the animals of each prenatal treatment group were exposed to the open arm first and the other half exposed to the closed arm first. Immediately after testing on each 182 of the 2 test sessions animals were taken to an adjacent room, quickly and lightly anaesthetised with diethyl ether, and blood samples (0.5 cc) obtained by cardiac puncture using heparinized syringes. The entire sampling procedure was completed within 2 min of removing the animal from the +-maze, which is rapid enough to obtain a reliable measure of CORT at the end of the +-maze testing, without any effects of disturbance or etherization (Davidson et al, 1968). A l l blood samples were centrifuged at 2200 x g for 10 min at 4° C and plasma was stored at -20° C until analysed. Experiment 2. Absolute time on the open arms were relatively low in Experiment la , 7.7 ±1 .6 min for males and 7.5 ±1 .6 min for females. Prior exposure to the open field (OF) has been shown to increase +-maze activity including time on the open arms (Pellow et al. 1985). Therefore, in Experiment 2 animals were exposed to an OF task for 5 min immediately prior to being tested on the +-maze. One week prior to testing, a separate set of animals were singly housed (n=10 for each of E, PF, and C males and females). A l l testing was done between 0830 and 1200 h with prenatal treatment groups being counterbalanced for order of testing and run times. A l l testing was done blind to the animal's prenatal treatment group. White noise (40 dB) was used to mask extraneous noises. At the time of testing, animals were taken from the colony room to an adjacent room containing the open field and the +-maze. Animals were placed in the centre of the open field facing away from the investigator and behaviour was recorded for 5 min. 183 Animals were then immediately placed on the centre of the +-maze facing an open arm for a 5 min test. Following testing, animals were placed in their home cages in a holding room for 10 min. Animals were then quickly and lightly anaesthetised with diethyl ether and blood samples (0.5 cc) taken by cardiac puncture using heparinized syringes for CORT determination. Blood samples were centrifuged at 2200 x g for 10 min at 4° C. Plasma was stored at -20° C until analysed. A separate set of animals (n = 5 for each of E, PF, and C males and females) were taken directly from the colony room and blood samples were drawn by cardiac puncture under light ether anaesthesia to determine basal CORT levels. A.3 STATISTICAL ANALYSES Principal component factor analysis on standardised scores was used to determine which behavioural measures were related. These factors were then analysed by appropriate analyses of variance (ANOVA) for prenatal treatment, sex, and days. Individual behaviours were further analysed separately by appropriate A N O V A s for prenatal treatment and sex. Significant main and interaction effects were analysed by Newman Keul's paired comparisons. 184 A.4 RESULTS Experiment 1 Developmental Data Ethanol intake of the pregnant females was consistently high throughout gestation, averaging 9.7 ± 1.3, 11.1 ± 1.0, 10.7 ± 0.6 g/kg bw/day for wk 1, 2, and 3 of gestation respectively. Blood alcohol levels were consistent with levels previously reported (Weinberg, 1985), averaging 136.6 ± 15.8 mg/dl. A repeated measures A N O V A on maternal weight gain during pregnancy revealed significant main effects of group (p < 0.001) and days (p < 0.001), as well as a group x days interaction (p <0.01). Post-hoc tests indicated that body weights of E and PF females were significantly less than body weights of C females on gestation d 7-21 (p's < 0.001). There were no significant differences among groups for litter size. Analysis of pup body weights indicated a significant group x days interaction; E and PF pups weighed significantly less than C pups on d 8 and d 22 of lactation (p's < 0.01). There were no significant differences among groups in pup weight on the days of testing. Experiment la: Two consecutive days of testing Factor analysis revealed 2 factors accounting for 73 % of the variance in males and 68 % of the variance in females. The first factor comprised time on the closed arms negatively related to full closed arm entries, partial open arm entries, and time in the 185 central area (exploration factor). The second factor comprised time on the open arms, full open arm entries, and number of closed arm rears (fear factor). Time on the open arm and open arm entries have been validated by previous investigators (Lister, 1987; Pellow et al., 1985) as measures of anxiety/fear. For the exploration factor, there was a significant effect of days for both males and females (p < 0.01); animals had lower levels of exploration on d 2 than on d 1. For males, trends for an effect of group and a group x days interaction were seen (p's < 0.10). There were no significant differences among groups on d 1. On d 2, however, E males had significantly higher levels of exploration than PF (p < 0.01) and C (p < 0.05) males. These data were supported by A N O V A s oh the individual behaviours. That is, on d 2, E males made more closed arm entries than PF and C males (p's < 0.05) (Fig. 35), and spent more time on the central area than PF males (p < 0.05) (Fig. 35). There were no significant differences among E, PF and C males in time spent on the closed arms or in number of closed arm entries. For females, a significant group x days interaction was seen for the exploration factor (p < 0.05); E and PF females had higher levels of exploration than C females on d 1 (p's < 0.05) but not on d 2. Individual A N O V A s indicated that E and PF females made more closed arm entries than C females on both d 1 (p's < 0.01) and d 2 (p's O.05) (Fig. 36) and that E females made more partial open arm entries than C females (p < 0.05) on d 1 (Fig. 36). In addition, on d 1, E and PF females spent more time in the central area (p's < 0.05) and less time on the closed arms than C females (p < 0.10 and p < 0.05 respectively) (Fig. 37). 186 For the fear factor, there was a significant effect of days for both males and females (p < 0.01); animals had higher levels of fear on d 2 than on d 1. For males, a significant main effect of group was seen (p < 0.05). E males demonstrated lower levels of fear than C males (p < 0.05). A N O V A s on the individual behaviours indicated that E males spent more time on the open arms than C males (p < 0.05) on d 1 and showed a similar trend on d 2 (p < 0.10). In addition, E animals made more closed arm rears than PF and C males on both days (p's < 0.05) (Fig. 38). There were no significant differences among males in number of open arm entries (Fig. 39). For females, an overall group trend was seen for the fear factor (p < 0.10); E females showed a trend toward higher levels of fear than PF females. Individual A N O V A s revealed that on d 2, E females showed a trend toward spending less time on the open arms than C females (p < 0.10) (Fig. 40). In addition, a pair-feeding effect was seen on d 1; E and C females spent less time on the open arm than PF females (p's < 0.05) (Fig. 40). Experiment lb : Confinement to open and closed arms. Factor analysis revealed 2 main factors accounting for 63% of variance in males and 61 % of variance in females. Factor 1 (open arm activity) consisted of ambulation, turns and rears on the open arm. Factor 2 (closed arm activity) consisted of ambulation, turns, and rears on the closed arm. Overall, there were no significant differences in open arm activity among E, PF, and C males or females. 187 Significant main effects of group were seen in both males and females in closed arm activity (p's < 0.01). E males showed significantly more closed arm activity than C males (p <0.01). Individual A N O V A s indicated that E and PF males showed significantly more ambulation than C males (p < 0.01 and p < 0.05 respectively) (Fig. 41) and E males showed more turns (Fig. 41) and rears than C males (Fig. 42) (p's < 0.01). Similarly, E and PF females demonstrated more closed arm activity than C females (p < 0.01 and p < 0.05 respectively). Individual A N O V A s revealed that E and PF females showed more ambulation (p < 0.01 and p < 0.10, respectively) and turns (p < 0.01 and p < 0.05, respectively) (Fig. 43) and rear more than C females (p < 0.10 and p < 0.05, respectively) (Fig. 44). Corticosterone Levels Significant main effects of exposure to open vs closed arm were seen in CORT levels of both males and females (p's < 0.01) (Fig. 45). CORT levels were significantly higher on the open arm than on the closed arm. There were no significant differences among E, PF, and C animals. 188 Experiment 2: +-Maze behaviour after exposure to the OF Developmental Data Ethanol intake of the pregnant females was consistently high throughout gestation, averaging 9.8 ± 1.4, 11.5 ± 1.0, 10.7 ± 0.8 g/kg bw/day for wk 1, 2, and 3 of gestation respectively. Blood alcohol levels were consistent with levels observed previously (Weinberg, 1985), averaging 120.1 ± 12.6 mg/dl. A repeated measures A N O V A on maternal weight gain during pregnancy revealed significant main effects of group (p < 0.001) and days (p < 0.001), as well as a group x days interaction (p <0.01). Post-hoc tests indicated that body weights of E and PF females were significantly less than body weights of C females on gestation d 7-21 (p's < 0.001). In addition, E females weighed significantly less than PF females on d 21 of gestation (p < 0.05). There were no significant differences among groups for litter size. Body weights for pups showed a significant group x days interaction; E and PF pups weighed significantly less than C pups on d 1, 8, and 22 of lactation (p's < 0.01). There were no significant differences in pup weight on the day of testing. OF Behaviour There were no significant differences among E, PF and C animals on OF activity. 189 +-Maze behaviour Similar to Experiment 1, analysis revealed 2 main factors accounting for 68% of the variance in males and 65% of the variance in females. The first factor consisted of time on the closed arms negatively related to full closed arm entries, partial open arm entries, time in the central area, and closed arm rears (exploration factor). The second factor consisted of time on the open arms, full open arm entries, and rearing on the open arm (fear factor). For the exploration factor, there was a group trend in males (p < 0.10). E males showed a trend towards lower levels of exploration than C males (p < 0.10). These data were supported by A N O V A s on the individual behaviours. E males spent less time on the closed arms than PF (p < 0.05) and C (p < 0.10) males (Fig. 46). E males showed a trend toward fewer rears than PF and C males (p's < 0.10) (Fig. 46). For females, analysis of the exploration factor revealed a significant main effect of group (p < 0.01). Similar to the data on males, E females had lower levels of exploration than PF (p < 0.05) and C females (p < 0.01). Individual A N O V A s revealed that E females spent less time on the closed arms than PF females (p < 0.05) (Fig. 47) and had fewer closed arm entries than C females (p < 0.01) (Fig. 47). In addition, E and PF females reared less than C females on the closed arm (p's < 0.05) (Fig. 48). 190 For the fear factor, there were no significant differences among E, PF and C males. In contrast, analysis of females revealed a main effect of group (p < 0.01); E and PF females showed higher levels of fear than C females (p < 0.05 and p < 0.01 respectively). These data were supported by individual A N O V A s which demonstrated that E and PF females reared less on the open arms than C females (Fig. 49), spent less time on the open arms (Fig. 49) and had fewer open arm entries than C females (p's < 0.05) (Fig. 50). Corticosterone Levels There were no significant differences among E, PF and C males or females in basal CORT levels (data not shown). Similarly, following exposure to the +-maze, CORT levels did not differ among E, PF, and C males (Fig. 51). In contrast, there was a significant main effect of group for CORT levels of females following +-maze exposure (p < 0.05) (Fig. 51); E females had significantly higher CORT levels than PF and C females (p's < 0.05). A.5 DISCUSSION The +-maze was designed (Handely & Mithani, 1984) and validated as a test of anxiety for both rats (Pellow et al, 1985; Pellow & File, 1986) and mice (Lister, 1987). Controversy exists, however, regarding interpretation of the anxiety/fear state generated by the +-maze. Although the +-maze has been demonstrated to be sensitive to anxiolytic 191 compounds which act on the y aminobutyric acid (GABA) system (Lister, 1987; Pellow et ah, 1985; Pellow & File, 1986), novel anxiolytic compounds, which act on the serotonergic or noradrenergic systems, produce variable results (Sanger et al., 1991). For example, buspirone has been demonstrated to have both anxiogenic (Critchley & Handely, 1987; Moser, 1989) and anxiolytic properties (Dunn et al, 1989; Lee & Rodgers, 1990). In addition, prior exposure to stressors can increase (Pellow et al., 1985), decrease (Steenbergen et al., 1991) or not effect the animals' activity level on the +-maze (Falter et al., 1992). Thus, it has been suggested that +-maze behaviour is not an indication of generalised anxiety but is a valid measure of situational-dependent anxiety/ fear (Falter et al., 1992). It was on this basis that the +-maze was chosen for the present study as an aversive task to examine the possible differential effects of prenatal ethanol exposure on stress- related behaviours. In the present study, factor analysis of +-maze behaviour revealed 2 main factors. Importantly, the loading of the variables was relatively consistent between the 2 experiments and with data from previous studies (Lister , 1987; Pellow et al., 1985). The 2 factors were assigned the terms 'exploration' and 'fear' based on the previous literature (Lister, 1987; Pellow et ah, 1985) Data suggest that the open arms of the +-maze are more fear- or stress- provoking than the closed arms (Lister, 1987; Pellow et al., 1985). That is, undrugged animals spend less time on the open arms, make fewer open arm entries (Lister, 1987; Pellow et al, 1985) and demonstrate more anxiety/fear behaviours (freezing, immobility, defecation) on the open arms than on the closed arms 192 (Montgomery, 1958; Pellow et al., 1985). In addition, animals confined to the open arms demonstrate higher CORT levels, an index of stress (Selye, 1973) than those confined to the closed arms (Montgomery, 1958; Pellow et ah, 1985). Moreover, comparison of +-maze behaviour with exploration and locomotor activity in the holeboard task has demonstrated that open arm entries are not correlated with holeboard exploration or locomotion (Pellow et al., 1985). Furthermore, Pellow et al. (1985) demonstrated that anxiolytic agents such as diazepam increase both time on open arms and number of open arm entries on the +-maze while reducing exploration and motor activity on the holeboard. In contrast, sedative agents such as haloperidol have no effect on time spent on the open arms but reduce total arm entries on the +-maze as well as both exploratory and locomotor activity on the hole board. Taken together, these studies suggest that behaviour on the open arms (open arm entries and time spent on the open arms) is likely a measure of fear or situational-dependent anxiety which is independent of exploration, whereas behaviour on the closed arms and in the central area (closed arm entries, time on the closed arms, time on the central area and partial open arm entries) is likely a measure of exploration. The results from the present study indicate that prenatal ethanol exposure differentially alters behavioural and hormonal responses to the elevated +-maze in males and females. Both E males and females demonstrated higher levels of exploration (exploratory behaviours) when placed directly on the +-maze from their home cages without prior exposure to the OF (open field) compared to C males and females. In addition, when confined to the closed arms of the +-maze E males and females 193 demonstrated higher levels of activity (i.e. more turns, rears and midline crosses) compared to C males and females. Following activation of behaviour by prior OF exposure, however, both E males and females demonstrated lower levels of exploration than C males and females. Interestingly, E females but not E males showed an increase in fear-related behaviours on the +-maze compared to controls, regardless of prior OF exposure. Moreover, E females had increased CORT levels following +-maze testing after exposure to the OF but not with +-maze exposure alone. Thus, these data are consistent with other studies (Barron & Riley, 1990; Osborn et al, 1996; Weinberg, 1988) demonstrating that prenatal ethaonl affects both males and females but that there may be a sex difference in the sensitivity of the mechanism(s) underlying the alterations in behaviour. Previous studies have also demonstrated alterations in behavioural and hormonal responses to stressors or aversive test situations in E compared to C animals. E animals have been shown to have increased grooming after a 1 min forced swim (Hannigan et al., 1987) and increased reactivity to acoustic startle (Anandam et al, 1980). E animals also demonstrate H P A hyperresponsiveness to a variety of stressors compared to controls (Nelson et al, 1986; Taylor et al, 1981; Weinberg & Gallo, 1982; Weinberg, 1988; Weinberg, 1992b). Importantly, as previously demonstrated (Osborn et al, 1996; Weinberg, 1988, Weinberg et al, 1996), sex differences in the response of E animals to stressors are observed. That is, HPA hyperresponsiveness may be manifested differentially in E males and females depending on the nature of the stressor, the time course measured and the hormonal endpoint (Weinberg, 1988, Weinberg et al, 1996). .194 Further, it has been shown that altered behavioural response to stress in E animals can be modified by prior exposure to stressors. Hannigan et al. (1987) found that E animals did not demonstrate differences in grooming behaviour in a novel environment but when exposed to a prior stressor such as 1 min forced swim E animals demonstrated increased grooming behaviour in a novel environment. The mechanism(s) for the alterations in behavioural and hormonal responses to stressors is unknown. Under the test conditions of the present study, however, it appears that females may be more sensitive to the effects of in utero alcohol exposure than males as measured by both increased fear and CORT levels following +-maze exposure. Although it has been demonstrated that environmental conditions such as light intensity, maze height, or prior exposure to a stressor such as immobilisation do not alter +-maze behaviour (Falter et al, 1992), prior exposure to an open field apparatus appears to activate the animals and increase time spent on open arms (Pellow et al, 1985). The mechanism for this behavioural activation is unclear at present. The data from this study support and extend this previous work (Pellow et al, 1985) demonstrating that exposure to the OF immediately prior to +-maze testing markedly increases time spent on the open arms. Both males and females, regardless of their prenatal treatment, increased their time spent on the open arms, from 7.7 ±1 .6 min to 38.0 ± 5.0 min for males, and from 7.5 ± 1.6 min to 32.0 + 2.7 min for females. Importantly, however, the data indicated that following OF exposure, E animals demonstrate a decrease in exploration compared to 195 their respective controls suggesting that exposure to an aversive situation prior to testing may differentially affect E animals as compared to controls. The findings in Experiment 1, that E males and females demonstrated increased exploration as well as increased activity levels when confined to the closed arm of the +-maze, are consistent with previous studies which have demonstrated behavioural hyperactivity in a variety of tasks including a novel environment (Shah & West, 1984), open field (Becker & Randall, 1989; Bond & DiGiusto, 1977a; Bronstein et al, 1975; Caul et al, 1979; Fernandez et al, 1983; Means et al, 1984; Melcer et al, 1994; Molina et al, 1984; Riley et al, 1986; Vorhees & Fernandez, 1986), and the holeboard (Riley et al, 1979b). Furthermore, it has been shown that E animals demonstrate facilitated swimming performance in the Biel water maze (Vorhees & Fernandez, 1986). E animals had increased swimming speed but still committed the same number of errors compared to control animals, suggesting that E animals did not better utilise environmental cues to complete the task more quickly, but rather, that an increased swimming speed allowed E animals to finish the task faster. Thus, it is important when examining E animals' behaviour on a task to differentiate hyperactivity from other behaviours. Data from the present study suggest that the behavioural hyperactivity seen in E animals may be situation dependent. When confronted with a more intense stressor (e.g. the open arm) or following activation in the OF, E animals no longer demonstrate hyperactivity and instead show increased fear. These data may provide an explanation for the apparent decrease in fear observed in E males in Experiment la. That is, although E males had 196 increased time on the open arm, they did not show an increase in open arm entries. In addition, they showed increased closed arm entries and rears. Thus it is possible that the increased time on the open arms may in fact reflect a generalised increase in activity level or deficits in response inhibition as suggested by previous authors (Abel, 1982; Barron & Riley, 1990; Becker & Randall, 1989; Caul et al, 1979; Driscoll et al, 1982; Driscoll et al. 1985; Molina et al, 1984; Randall et al, 1986; Riley et al, 1979a; Riley et al, 1979b). Although the mechanism(s) for the alterations in behavioural and H P A responses to stressors seen in E animals have yet to be determined; it is possible that HPA hyperresponsiveness, may at least in part, mediate the increased fear seen in E females in the present study. CRF (Koob & Britton, 1990), A C T H and CORT (File et al, 1979) have all been shown to affect behaviour in aversive situations. CRF (Dunn & Berridge, 1990) and CORT (File et al, 1979) have been shown to have both suppressive and activating effects on behaviour (Dunn & Berridge, 1990; Majewska, 1992). Following exposure to the +-maze, all animals had higher CORT and lower activity levels on the open arms compared to the closed arms. Further, prior exposure to the OF, which would presumably cause an increase in CORT levels, resulted in behavioural activation so that animals spent more time on the open arms. However, the present data indicated that although E females demonstrated increased fear in both Experiments l a and 2, they showed an increase in CORT levels only in Experiment 2. Thus while elevated CORT levels may play some role in mediating fear-related behaviours, clearly other factors must 197 also be involved in the altered behavioural responses to stress seen in foetal ethanol exposed animals. Unlike previous studies (Becker & Randall, 1989; Bond & DiGusto, 1977a; Caul et al, 1979; Fernandez et al, 1983; Means et al, 1984; Melcer et al, 1994; Molina et al, 1984; Riley et al, 1986; Vorhees & Fernandez, 1986), E animals did not differ from PF and C animals in OF activity. The OF has.been used to measure exploration but, because it is an aversive environment, data suggest that it is actually a measure of arousal or emotionality as much as a measure of exploration (Archer, 1975). Thus, it appears in the present study that E animals did not differ from PF and C animals in exploration or arousal as measured by the OF. This, however, does not preclude the possibility that there is an underlying behavioural dysfunction in E animals, as it has been shown that OF activity in E animals varies as a function of age; as E animals mature the increased activity seen at early ages appears to diminish (Bond, 1981). In addition, it appears that increased activity in the OF reappears in E animals i f they are pharmacologically challenged (Means et al, 1984) or i f they are tested at very old ages (Abel & Dintcheff, 1986). Further, Hannigan et al. (1987), demonstrated that exposure to a prior stressor can increase grooming behaviour in a novel environment. In addition, in the present study it was demonstrated that exploration in E animals was differentially affected by prior exposure to the OF; E animals demonstrated increased exploration compared to controls when placed directly on the +-maze but demonstrated decreased exploration compared to controls when placed on the +-maze after exposure to the OF. Together these data suggest that E animals demonstrate altered behaviour in response to aversive 198 environments and that the manifestation of the behaviour may be changed by prior exposure to aversive stimuli. In addition to prenatal ethanol effects, we also noted prenatal nutritional effects as well as an effect of pair-feeding itself. Prenatal nutritional effects were seen in Experiment 1, where both E and PF females had higher exploration levels than C females when confined to the closed arms of the +-maze and in Experiment 2, where both E and PF females demonstrated higher fear levels than C females. These data indicate that alterations in these behaviours were mediated primarily by prenatal nutritional effects rather than specific effects of ethanol. Pair-feeding effects were seen in Experiment 1; PF females spent more time in the open arms than E and C females. Previous data demonstrated that although pair-feeding provides an essential nutritional control group, pair-feeding itself is a type of experimental treatment (Weinberg, 1984). For example, pair-feeding can produce a shift in the circadian rhythm of a number of physiologic variables as well as alter body and organ weights and behaviour of both the maternal females and the offspring (Gallo & Weinberg, 1981; Weinberg, 1989; Weinberg & Gallo, 1982). The present data further demonstrate long term effects of pair-feeding and highlight the importance of including an ad libitum fed control group in prenatal alcohol studies. Finally, these data may have clinical implications. Children prenatally exposed to alcohol also demonstrate behavioural alterations including hyperactivity, as well as impulsivity and attention deficits which may reflect an inability to inhibit responses 199 (Streissguth et al, 1983; Streissguth et al, 1985; Streissguth, 1986). These behavioural deficits are particularly noticeable in stressful situations (Streissguth, 1986). Recently, it has been documented that prenatally exposed children demonstrate irrational fears of objects (e.g. a red ball) or places (e.g. the bathtub) (Harris et al, 1993; Harris et al. 1995) suggesting that behavioural deficits extend beyond hyperactivity and altered attention span commonly reported. These types of behaviours in children may be related to the altered behavioural responses to a stressful environment as observed in the present study. 200 Figure 35. Number of Closed Arm Entries and Time on the Centre for Males. Points represent mean ± SEM. * Main effect of group, p's < 0.05: E > PF = C for closed arm entries on d 2; E > PF for time in centre area on d 2. 201 MALE CONTROL Wflh PAIR-FED ETHANOL -202 Figure 36. Number of Closed Arm and Partial Open Arm Entries for Females. Points represent mean ± S E M . * Main effects of group, p's < 0.05: E = PF > C for closed arm entries on d 1 and d 2; E > C for partial arm entries d 1. 203 FEMALE CONTROL PAIR-FED ETHANOL 204 Figure 37. Time on Centre Area and on Closed Arms for Females. Points represent mean ± SEM. * Main effects of group, p's < 0.05: E = PF > C for time on centre area on d 1; PF < C for time on closed arms on d 1. 205 FEMALE CONTROL PAIR-FED Y//A ETHANOL T3 C o o CD t/3 100 75 50 25 D A Y 1 D A Y 2 CONTROL PAIR-FED V//A ETHANOL D A Y 1 D A Y 2 .206 Figure 38. Time on Open Arms and Number of Closed Arm Rears for Males. Points represent mean ± S E M . * Main effects of group, p's < 0.05: E > C for time on open arms on d 1; E > PF C for rears on closed arms on d 1 and d 2. 207 M A L E CONTROL Wflk PAIR-FED V///\ ETHANOL D A Y 1 D A Y 2 208 Figure 39. Number of Full Open Arm Entries for Males and Females Points represent mean ± SEM. No significant differences among E, PF and C males or females 209 OPEN ARMS D A Y 1 D A Y 2 210 Figure 40. Time on Open Arms for Females. Points represent mean ± S E M . * Main effect of group, p < 0.05: PF > C for time on open arms on d 1 (p < 0.05). 211 FEMALE CONTROL WMh PAIR-FED V/A ETHANOL Open Arms D A Y 1 D A Y 2 212 Figure 41. Ambulation and Turns on Closed Arm for Males Points represent mean ± SEM. * Main effect of group, p's < 0.05: E = PF > C for closed arm ambulation (p 0.01 and p < 0.05 respectively); E > C for closed arm turns (p < 0.01). 213 M A L E CONTROL Wflk PAIR-FED V///\ ETHANOL CONTROL PAIR-FED V//A ETHANOL 0-5 MIN 15-20 TIME 214 Figure 42. Rears on Closed Arm for Males Points represent mean ± S E M . * Main effect of group, p < 0.05: E > C for closed arm rears (p < 0.01). 215 CONTROL MALE PAIR-FED V/A ETHANOL 30 25 20 h 10 5 0 216 Figure 43. Ambulation and Turns on Closed Arm for Females Points represent mean ± SEM. * Main effect of group, p's < 0.05: E > C for closed arm ambulation (p < 0.01); E = PF > C for closed arm turns (p < 0.01 and p < 0.05 respectively). 217 F E M A L E CONTROL PAIR-FED f222 ETHANOL Ambulation on Closed Arm * CONTROL PAIR-FED V//A ETHANOL .218 Figure 44. Rears on Closed Arm for Females Points represent mean + SEM. * Main effect of group, p < 0.05: E = PF > C for closed arm rears (p < 0.01 and p < 0.05 respectively). 219 FEMALE 0-5 MIN 15-20 TIME 220 Figure 45. Corticosterone Levels for Males and Females Following Open or Closed Arm Exposure. Points represent mean ± SEM. * Main effect of arm, p's < 0.01: Closed arm > Open arm (p's < 0.01) 221 CORTICOSTERONE OPEN CLOSED A R M •222 Figure 46. Time on Closed Arms and Rears on Closed Arms for Males. Points represent mean ± SEM. * Main effect of group, p < 0.05: E < PF = C for time on closed arms. 223 MALE CONTROL PAIR-FED V///\ ETHANOL 250 CONTROL Wflh PAIR-FED V//A ETHANOL 224 Figure 47. T i m e on Closed A r m s and Entries on Closed A r m s for Females. Points represent mean ± SEM. * Main effects of group, p < 0.05: E < PF for time on closed arms (p < 0.05); E < C for closed arms entries (p < 0.01) 225 FEMALE 226 Figure 48. Rears'on Closed Arms for Females. Points represent mean ± S E M . * Main effect of group, p < 0.05: E = PF < C for rears on closed arms (p's < 0.05). 227 FEMALE 228 Figure 49. Rears on Open arms and Time on Open Arms for Females. Points represent mean ± SEM. * Main effects of group, p's < 0.05: E = PF < C for rears on open arms (p's < 0.05); E = PF < C for time on open arms (p < 0.05 and p < 0.01). 229 FEMALE CONTROL Wflh PAIR-FED V//A ETHANOL 4 V 3 V Open Arms CONTROL WM PAIR-FED V//A ETHANOL .230 Figure 50. Number of Open Arm Entries for Females. Points represent mean ± S E M . * Main effect of group, p's < 0.05: E = PF < C for number of open arm entries(p < 0.05 and p< 0.01). 231 FEMALE 232 Figure 51. Corticosterone Levels for Male and Females Following OF and +-maze Exposure. Points represent mean ± SEM. * Main effect of group, p< 0.05: E < PF = C (p's < 0.05) for females. 233 234 B. FOETAL ETHANOL EFFECTS ON CRF SENSITIVITY MEASURED BY THE ELEVATED PLUS MAZE. B.l INTRODUCTION Selye (1936) defined the stress response as a non-specific response to any demand on the body which results in various physiological changes including activation of the hypothalamic-pituitary-adrenal axis. Corticotrophin releasing factor (CRF) is the predominant releasing hormone which regulates the pituitary-adrenal axis resulting in adrenocorticotropic hormone (ACTH) secretion from the pituitary which in turn stimulates secretion of corticosterone (CORT) from the adrenal gland, which has many metabolic and immunological effects (Munck & Naray-Fejes-Toth., 1994). Importantly, CRF appears to have behavioural and physiological effects outside those of HPA axis regulation, suggesting that it may have a direct neurotransmitter role in the co-ordination of behavioural, autonomic, and metabolic responses to stressors. During the preweaning period, rodents prenatally exposed to ethanol (E) exhibit suppressed or blunted HPA responses to a variety of stressors (Angelogianni & Gianoulakis, 1989; Taylor et al, 1986a; Weinberg et al, 1986; Weinberg et al, 1989) but, as adults, E animals demonstrate increased HPA responses to stressors (Taylor et al, 1982; Weinberg, 1988; Weinberg, 1992b). In addition, hypothalamic CRF content appears depressed in E neonates (Redei et al, 1989) but in adulthood both basal CRF mRNA (Lee & Rivier, 1993a) and stress CRF mRNA (Osborn et al, 1995) levels are ' 235 elevated in E animals. Further, adult E offspring demonstrate hyperactivity (Bond, 1981; Meyer & Riley, 1986), deficits in response inhibition (Driscoll et al, 1985; Riley et al, 1979a; Riley et al, 1979b), and increased anxiety-like behaviours in stressful environments (Anandam et al, 1980; Hannigan et al, 1987). As discussed previously (Chapter I: C.2) intracerebroventricular (ICV) infusion of CRF results in behaviours resembling stress-induced behaviour (Dunn & Berridge, 1990; Koob & Britton, 1990) and appears to increase the sensitivity of the rat to stressful aspects of the environment. Therefore, central alterations in CRF synthesis and/or sensitivity may play a role in the mechanism(s) underlying HPA and behavioural hyperactivity seen in animals prenatally exposed to ethanol (ETOH). This study utilised the elevated plus maze (+-maze) to examine behavioural responses of E, pair-fed, and control males and females to intracerebroventricularly (ICV) administered CRF, cc-helical CRF, or saline, or subcutaneously (SC) administrated CRF or saline. B.2 METHODS Sprague-Dawley males (n=25) and. females (n=53) were obtained from Canadian Breeding Farms, St. Constant, PQ. Animals were bred and fed as described in Chapter II: General Methods. On d 12-14 of gestation, blood samples (0.4-0.6 ml) were obtained 236 from the tails from 3 unanaesthetised females at 1900 h for determination of blood ethanol levels (Sigma diagnostic Kit 332-UV, based on Bonnischsen & Theorell, 1951). Females were undisturbed except for weighing and cage cleaning on d 1, 7, 14, and 21 of gestation. At birth, designated d l of lactation, dams and pups were weighed and all litters culled to 10 ( five males and five females). Dams and pups were weighed and cages cleaned on d 1, 8, 15, and 22 of lactation. On d 22, pups were weaned and housed by sex and by litter until testing at 90-110 days of age. One wk prior to testing, animals were singly housed and randomly assigned to experimental treatment groups. Testing order was counterbalanced across prenatal treatment, sex, and experimental treatment groups (n=9-10 for each of E, PF, and C, males and females for each experimental treatment). Animals were implanted with ICV cannulae 5-7 d prior to testing as described in the Chapter II: General Methods. A l l testing of animals occurred at 0730-1100 h on the test day. White noise (40 dB) was used to mask any extraneous background noises. \ Animals were taken from the colony room and infused or injected according to 1 of. 5 experimental treatment conditions: 1) 10 Lig/rat ICV CRF; 2) 5.0 pg/rat ICV oc-helical CRF; 3) ICV saline in an injection volume of 5 pi; 4) 10 pg/rat SC CRF; 5) SC saline in an injection volume of 2.0 cc. ICV infusion rate was 2.5 u.l/min. Animals remained in their home cages in the infusion room for 20 min at which time they were taken to an adjacent room containing the open field (OF) and the +-maze. As described 237 in Chapter IVA: Methods, animals were placed in the OF for a 5 min test and then in the +-maze for a 5 min test. As in Chapter IV.A behaviour in the OF was scored immediately and +-maze behaviour was video taped and scored by 2 investigators independently. Behaviour measured on the OF included ambulation in the central 4 squares and the 12 outer squares and number of rears. Behaviour measured on the +-maze included time spent in open arms, in the closed arms and in the central area, full open and closed arm entries, partial open arm entries and number of rears in the open and closed arms. B.3 STATISTICAL ANALYSES Principal component factor analysis on standardised scores was used to determine which behavioural measures were related. These factors were then analysed by appropriate analyses of variance (ANOVA) for prenatal treatment and sex. Individual behaviours were further analysed separately by appropriate A N O V A s for prenatal treatment and sex. Significant main and interaction effects were analysed by Newman Keul's paired comparisons. 238 B.4 RESULTS Developmental Data Ethanol intake of pregnant females was consistently high throughout gestation with 9.2± 0.4, 11.6 ± 0.4, 11.5 ± 0.2 g/kg bw/day for wk 1, 2, and 3 of gestation respectively. Blood alcohol levels were consistent with previous levels (Weinberg, 1985), averaging 159.5 ± 19.6 mg/dl. A repeated measures A N O V A on maternal weight gain during pregnancy revealed significant main effects of group (p < 0.001) and days (p < 0.001), as well as a group x days interaction ( p < 0.001). Post-hoc tests indicated that E and PF females weighed significantly less than C females on d 7, 14, and 21 of gestation (p's < 0.01). During lactation, a group x days interaction (p < 0.001) was also seen. E females weighed significantly less than C females on d 1 of lactation (p < 0.01). There were no significant differences among E, PF and C females on d 8, 15, or 22 of lactation. There were no significant differences among groups for litter size or number of still born pups. Body weights for pups showed a significant group x days interaction (p < 0.05). Post hoc tests indicated that E and PF pups weighed significantly less than C pups on d 1 and 8 of lactation (p's < 0.01). There were no significant differences in pup weight on d 15 and 22 of lactation and no significant differences in weight at the time of testing at 60-90 days of age. 239 Experimental Results Open Field Analysis of ambulation revealed a main effect of sex (p < 0.001): males had lower ambulation scores in both the inner and outer areas and made significantly fewer rears than females (p's < 0.001) (Fig. 52). For both males and females, there were no significant effects of either prenatal or experimental treatment on OF ambulation or rearing. Plus Maze Factor analysis revealed 2 main factors accounting for 61 % of the variance in males and 68 % of the variance in females. Factor 1 (fear factor) consisted of time on open arms, full open arm entries, negatively related to time on closed arms. Factor 2 (exploration factor) consisted of partial open arm entries, full closed arm entries, time on central area, and number of closed arm rears. Overall, a group x sex x treatment A N O V A revealed main effects of sex for both the fear and exploration factors (p's < 0.01). Males had significantly higher fear scores (p < 0.01) and showed a trend towards lower exploration levels than females (p< 0.10). This was supported by A N O V A s on individual behaviours; males spent significantly less time on open arms and more time on closed arms than females (p's< 0.05) (Fig. 53). Males 240 also made less full closed arm entries (p < 0.05), less closed arm rears than females (p < 0.001) (Fig. 54) and spent less time in the central area (p < 0.05) (Fig. 55). For females, there was a significant main effect of experimental treatment for both the fear factor (p < 0.05) and the exploration factor (p < 0.01). Post-hoc analysis indicated that overall, females given ICV CRF had higher fear levels than females given ICV saline (p's < 0.05) and lower exploration levels than females in any other postnatal experimental group (p's < 0.01). This was supported by A N O V A s on individual behaviours. Females given ICV CRF had fewer full open arm entries and spent more time on the closed arms compared to females given ICV saline (p's < 0.05) (Fig. 56). Consistent with these data, ICV CRF also had fewer closed arm entries than females given ICV saline (p < 0.01) and marginally fewer closed arm entries compared to females given SC saline (p < 0.10) (Fig. 57). In addition, females given ICV CRF spent less time on the central area than females given ICV or SC saline or SC CRF (p's < 0.05) (Fig. 58). For females, there was also a significant main effect of prenatal group alone for the exploration factor and a group trend for the fear factor. Post-hoc analysis indicated that overall, exploration levels were lower in E than in C females (p < 0.05) and marginally lower in PF than in C females (p < 0.10). This was supported by A N O V A s on individual behaviours. E and PF females made fewer closed arm entries than C females (p < 0.05 and p < 0.10 respectively) (Fig. 59) and E females made significantly fewer closed arm rears than PF and C females (p's < 0.05) (Fig. 59). Post-hoc analysis of the fear factor indicated that E females showed a trend towards elevated fear scores compared 241 to C females (p < 0.10), supported by the finding that E females spent more time on closed arms than C females (p < 0.05) (Fig. 60). For males, there were no significant effects of either postnatal experimental or prenatal treatment. Further, for both females and males there were no significant prenatal x experimental interactions. B.5 DISCUSSION These data do not support the hypothesis that behavioural hyperactivity seen in E animals is a result of a differential sensitivity to CRF; however, it appears that there may have been a difficulty with the dose of CRF and a-helical CRF chosen. The dose of ICV CRF (10 pg/rat) appeared to only increase fear responses in the females and did not affect the males. In addition, the dose of ICV a-helical CRF (5.0 pg/rat) had no effect on females or males. Previous literature has indicated that the above doses of CRF and cc-helical CRF do result in significant alterations in +-maze behaviour (Koob et al, 1993). There are a number of possible reasons for the lack of behavioural responses to ICV CRF and a-helical CRF in this study. First, it has been recently demonstrated that the behavioural response to exogenously administered CRF and a-helical CRF depends on the baseline state of arousal and stress level of the animal (Heinrichs et al, 1994). At low levels CRF appears to behaviourally activate the animal; e.g. increase ambulation, rearing and grooming in a familiar environment but the same dose in a novel environment appears to suppress activity (Dunn & Berridge, 1990; Koob et al, 1993). Furthermore, it 242 has been shown that although a-helical CRF increases exploration of the open arms on the +-maze (Koob et al, 1993) and is effective in reversing the decreased time on the open arms following swim stress and restraint (Heinrichs et al, 1994), its effectiveness is variable. In a recent study, Heinrichs et al (1994) demonstrated that ICV administered a -helical CRF at a low dose (1 pg) was effective in increasing open arm time but at higher doses (5 pg and 25 pg) was ineffective in altering open arm time following social stress, swim stress, or restraint stress. It is therefore possible that the lack of effect of CRF and a-helical CRF in the present study was a result of incorrect dose selection for the stressor chosen. Second, the lack of response to the exogenous substances may reflect methodological differences. File et al (1992) demonstrated that handling can modify rat's behavioural responses on the +-maze as well as neurochemical responses to anxiolytic agents. Further, it appears housing conditions may also influence behaviour; group housing appears to increase time spent on open arm to about 50% (Heinrichs et al, 1994) which is significantly higher than what we saw in our animals (28%). Our animals were only handled once a week during cage changing, once during the surgery and were singly housed 1 week prior to the study. It is possible that these differences may have altered +-maze activity and sensitivity to CRF and a-helical CRF. Third, there was difficulty in getting the CRF and a-helical CRF into solution and it was necessary to vortex gently. It was later suggested that the vortexing can inactivate CRF and a-helical CRF (communication with Dr. C. Rivier). Thus it is possible that the CRF and a-helical CRF used in this study were partially inactivated. 243 Despite the relative ineffectiveness of the peptides in this study, the data indicated significant effects of both prenatal treatment and postnatal experimental treatment on behaviour on the +-maze. The results of this study support those of previous work (Alonso et al, 1991; Gonzalez & Leret, 1994; Imhof et al, 1993; Leret et al, 1994; Meng & Drugan, 1993; Rodgers & Cole, 1993; Slob et al, 1981; Steenbergen et al, 1991; Zimmerberg & Farley, 1993;) which demonstrated a sexually dimorphic response to the OF and +-maze. In this study, females demonstrated higher levels of activity on the OF and +-maze as well as reduced fear on the +-maze compared to males. In addition, it was demonstrated that ICV CRF altered female but not male behaviour on the +-maze. Overall, females infused with ICV CRF demonstrated increased fear levels compared to ICV saline infused females and decreased exploration levels compared to all other treatment groups. Importantly, as in previous studies in this dissertation, E females also showed increased fear levels and decreased exploration levels compared to control females reinforcing that the behavioural changes observed in prenatally ethanol exposed animals on the +-maze is a robust phenomenon. Further, as with the HPA hyperresponsiveness in E animals, the mechanism(s) underlying differences in +-maze behaviour appears to be differentially sensitive in E males and E females. It has been well documented that in rodents, a sex difference occurs in a variety of nonreproductive behaviours (Beatty, 1979). The results from the present study support previous studies which demonstrated that females have greater ambulatory and rearing activity in the OF (Alonso et al, 1991; Archer, 1975; Beatty & Fessler, 1976; Beatty & Holzer, 1978; Blizard et al, 1975; Masur et al, 1980; Meng & Drugan, 1993; Slob et al, 244 1981) and have decreased fear levels and increased exploration levels on the +-maze compared to males (Gonzalez & Leret, 1994; Imhof et al, 1993; Johnston & File, 1991; Leret et al, 1994; Rodgers & Cole, 1993; Steenbergen et al, 1991; Zimmerberg & Farley, 1993). Further, sex differences in behavioural responses to aversive stimuli have been demonstrated on a number of behavioural tasks. Males demonstrated a larger decrease in locomotion on the OF when tested 1 h after inescapable shock (IS) (Heinsbroek et al, 1988) and 24 h after a single restraint stress as compared to females (Kennett et al, 1986). Males and females demonstrated decreased direct exploration (head-dipping in the hole board) 24 h after IS but only males demonstrated a decrease 72 h after IS and only males demonstrated a decrease in ambulation and rearing on the holeboard 24 h after IS (Steenbergen et al, 1991). Furthermore, it has been shown that on the +-maze, IS reduces rearing in males but not females 24 h later and that males tended to have less open arm entries and spend less time on the open arms than females following IS (Steenbergen et al, 1991). These studies suggest that prior exposure to aversive stimuli may differentially alter behaviour in males and females. Thus it is possible that our experimental manipulations, which include handling during infusion and exposure to a novel environment during the 20 min holding period as well as OF exposure, may have altered +-maze behaviour in males and females differentially. Interestingly, in the first two studies of this dissertation on the +-maze, no sex differences were found. Sex differences in +-maze behaviour appear to be a function of age (Imhof et al, 1993). Imhof et al. (1993) demonstrated that males and females do not differ in +-maze behaviour at 60 days of age but that decreased activity levels and open 245 arm time are seen in males at 90 days of age and in females at 120 days of age. In the first 2 studies, animals were tested at 60 to 90 days of age with a mean age of 71.4 days. In contrast, in the present study animals were tested at 60 to 104 days with a mean age of 89.4 days. This increase in age was due to the number of animals required in the present study; testing was extended over a greater number of days. It is possible that the differences in age of testing between these studies may have influenced the finding of sex differences in +-maze behaviour, suggesting that there is a critical period during which gender related behaviours can be detected on the +-maze. In addition, the +-maze has been behaviourally, physiologically, and pharmacologically validated using only males. Thus, when interpreting results it is possible that the +-maze may not measure the same variables in males and females and that in testing anxiolytic or anxiogenic agents 'false' positives may occur i f testing males and females beyond the critical ages of 90 and 120 days of age, respectively. A possible mechanism for this sexual dimorphism on +-maze behaviour is prenatal and postnatal exposure to gonadal steroids. Oestrogen and progesterone have been shown to have both early neural organisational effects in neonates and activational effects in adults on the +-maze (Leret et al, 1994; Zimmerberg & Farley, 1993), whereas, testosterone appears to be involved with neural organisational effects prenatally (Gonzalez & Leret, 1994) and neonatally (Gray et al, 1965; Pfaff & Keiner, 1973; Pfaff & Zigmond, 1971; Swanson, 1967) but does not appear to have activational effects on adult +-maze behaviour (Zimmerberg & Farely, 1993). Females deprived of oestrogen neonatally (Leret et al, 1994; Zimmerberg & Farley, 1993) and prepubertally 246 (Zimmerberg & Farley, 1993) demonstrated increased anxiety responses on the +-maze and thus appeared more similar to males. Further, females which had been ovariectomised neonatally and received oestrogen replacement as adults demonstrated anxiety responses similar to males but had activity levels similar to females on the +-maze (Leret et al, 1994). Finally, neonatal treatment with the antiandrogen, flutamide, or the aromatase inhibitor, LY43578, or pubertal orchiectomy did not alter male performance on the +-maze (Gonzalez & Leret, 1994; Zimmerberg & Farley, 1993) These data suggest that the sex differences seen in +-maze behaviour may be a result of normal gonadal steroid exposure during development as well as during adulthood. In summary, the results of this study demonstrate a sex difference in OF and +-maze behaviour and suggest that there may be a sex difference in sensitivity to ICV administered CRF. In addition, this study further supports the previous study which demonstrated prenatal ethanol exposure altered adult behaviour on the +-maze. Further, similar to the HPA hyperresponsiveness seen in E animals, behavioural alterations to stress seen in E animals appear to have a sexual dimorphism in the sensitivity of the underlying dysfunction. In the present study, only E females demonstrated increased fear and decreased exploration on the +-maze as compared to control females, whereas in the previous study (Chapter IVA) both E males and females demonstrated alterations in fear and exploration levels compared to control males and females. Finally, the mechanism(s) for the altered behaviours on the +-maze have yet to be determined. The results of this study are inconclusive regarding the hypothesis that alteration in +-maze behaviour seen in E animals is a result of increased sensitivity to CRF. This is possibly due to the fact .247 that only one dose of CRF and a-helical CRF was used in this study with only marginal significance being seen in female behaviour after CRF administration, and that the peptides may have been partially inactivated by vortexing. Presently, a replication of this study is being conducted in Dr. Weinberg's laboratory. Multiple doses of CRF as well as a more potent CRF antagonist, [D-Phe12, N le 2 , ' 3 8 ,C a MeLeu 3 7] h/rCRF 1 2 . 4 1 are being tested to better address the possibility that there is a differential sensitivity in E animals to centrally administered CRF compared to controls. 248 Figure 52. Ambulation and Rearing on the Open Field for Males and Females. Points represent mean ± SEM. *** Main effect of sex, p's < 0.001: Males < Females for ambulation on outer and inner area and for rearing (p's < 0.001). 249 OPEN FIELD 250 Figure 53. Time on Open Arms and Closed Arms for Males and Females. Points represent mean ± SEM. * Main effects of sex, p's < 0.05: Males < Females for time on open arms 0.05); Males > Females for time on closed arms (p < 0.05). 251 PLUS MAZE H I Male Female 252 Figure 54. Entries onto Closed arms and Rears on Closed Arms for Males and Females. Points represent mean ± SEM. * Main effect of sex, p < 0.05: Males < Females for number of closed arm entries (p<0.05). *** Main effect of sex, p < 0.001: Males < Females for number of closed arm rears (p < 0.001). 253 254 Figure 55. Time in Central Area for Males and Females. Points represent mean ± S E M . * Main effect of sex, p < 0.05: Males < Females for time on central area (p < 0.05). 255 256 Figure 56. Number of Open Arm Entries and Time on Closed Arms for Females Given ICV CRF, ICV hCRF, ICV Saline, SC CRF, or SC Saline. Points represent mean ± SEM. * Mains effect of treatment, p's < 0.05: ICV CRF-treated females < ICV saline-treated females for number of open arm entries (p < 0.05); ICV CRF-treated females > ICV saline-treated females for time on closed arms (p < 0.05). 257 FEMALE I C V C R F Y/////// I C V h C R F Y///\ I C V S a l i n e I I S C C R F I I S C S a l i n e 5 h CD W 3 3 2 h Experimental Treatment I C V C R F Y//////A I C V h C R F Y ///\ I C V S a l i n e I 210 S3 o o CD co —^' CD s 180 h 150 h 120 h 90 h 60 30 Closed Arm Entries Experimental Treatment 258 Figure 57. Number of Closed Arm Entries for Females Given ICV CRF, ICV hCRF, ICV Saline, SC CRF, or SC Saline. Points represent mean ± S E M . ** Main effect of treatment, p < 0.01: ICV CRF-treated females < ICV saline-treated females for number of closed arm entries (p < 0.01). -259 FEMALE 260 Figure 58. Time in Central Area for Females Given ICV CRF, ICV hCRF, ICV Saline, SC CRF, or SC Saline. Points represent mean ± SEM. * Main effect of treatment, p < 0.05: ICV CRF-treated females < ICV saline-treated = SC CRF-treated = SC saline-treated females for time on central area (p's < 0.05). 261 FEMALE I C V C R F Y//////A I C V h C R F Y///\ I C V S a l i n e I "I S C C R F 1 <•!-'•-A S C S a l i n e 262 Figure 59. Number of Closed Arm Entries and Rears for Females. Points represent mean ± SEM. * Main effects of group, p's < 0.05: E < C for number of closed arm entries (p < 0.05); E < PF = C for number of closed arm rears (p's < 0.05). 263 FEMALE Control j ^ ^ l Pair-fed Ethanol Closed Arm Entries Rearing Groups 264 Figure 60. Time on Closed Arms for Females. Points represent mean ± SEM. * Main effect of group, p's < 0.05: E > C for time on closed arms (p < 0.05). 265 FEMALE Groups 266 C. FOETAL ETHANOL EFFECTS ON BENZODIAZEPINE (BZD) SENSITIVITY MEASURED BY THE ELEVATED PLUS MAZE. C . l INTRODUCTION The previous elevated plus maze (+-maze) studies in this dissertation have demonstrated that prenatal ethanol exposure (E) differentially alters behavioural responses to aversive environments. Interestingly, the alterations in behavioural responses seen in E animals may be changed by prior stressor exposure. Both E males and females demonstrate an increase in exploratory-related behaviours compared to control (C) males and females when placed directly on the +-maze but following behavioural activation by open field (OF) exposure, E animals demonstrate a decreased in exploratory-related behaviours compared to C animals. In addition, E females but not E males demonstrated increased fear-related behaviours compared to C females regardless of prior OF exposure and an increase in corticosterone (CORT) levels, an index of stress levels (Selye, 1973) compared to pairfed (PF) and C females. Although the mechansim(s) for the alterations in behaviour have yet to be determined, these data suggest that prenatal ethanol exposure affects both males and females but there may be a sex difference in the sensitivity of the mechanism(s) underlying the alterations in behaviour. 267 As discussed previously, the +-maze is used to test anxiolytic and anxiogenic agents and is particularly sensitive to agents that act via the y aminobutyric acid (GABA) system such as the benzodiazepines (BZD). (Pellow et al, 1985). To date no studies have examined B Z D sensitivity in E animals; however, a number of studies (Ledig et al., 1988; Moloney & Leonard 1984; and Rawat, 1977) have demonstrated alterations in the GABA-ergic system in E animals. Therefore, the present study was designed to examine further effects of prenatal ethanol exposure on anxiety/fear-related behaviour and to compare behavioural responses of E, PF and C animals following administration of a BZD. Animals were injected with either saline or B Z D and then tested on the +-maze after prior exposure to the OF. As discussed previously, exposure to the OF prior to +-maze testing increases the time spent on the open arms of the +-maze. This study was run in parallel with the study in Chapter IVB: Foetal Ethanol Effects on CRF Sensitivity Measured by the Elevated Plus Maze using animals from the same breeding. C.2 M E T H O D S Sprague-Dawley males (n=25) and females (n=53) were obtained from Canadian Breeding Farms, St. Constant, PQ. Animals were bred and fed as described in Chapter II: General Methods. On d 12-14 of gestation, blood samples (0.4-0.6 ml) were obtained from the tails from 3 unanaesthetised females at 1900 h for determination of blood ethanol levels (Sigma diagnostic Kit 332-UV, based on Bonnischsen & Theorell, 1951). 268 Females were undisturbed except for weighing and cage cleaning on d 1, 7, 14, and 21 of gestation. At birth, designated d l of lactation, dams and pups were weighed and all litters culled to 10 ( five males and five females). Dams and pups were weighed and cages cleaned on d 1, 8, 15, and 22 of lactation. On d 22, pups were weaned and housed by sex and by litter until testing at 60-90 days of age. One wk prior to testing, animals were singly housed and randomly assigned to experimental treatment groups. Testing order was counterbalanced across prenatal treatment, sex, and experimental treatment (n=5-7 for each of E , PF, and C males and females for each experimental treatment). A l l testing of animals occurred at 0730-1100 h on the test day. White noise (40 dB) was used to mask any extraneous background noises. Animals were taken from the colony room to an adjacent holding room and given either a subcutaneous injection of saline or 0.15 mg/kg body wt Diazemuls (diazepam injectable emulsion, Kabi Pharmacia Inc., PQ, Canada) (BZD) in an injection volume of 2.0 cc. Twenty min later, animals were taken from the holding room to an adjacent room containing the open field (OF) and the +-maze. Animals were placed in the OF for 5 min and then in the +-maze for 5 min and behaviours scored as in Chapter IVA. Following exposure to the OF and +-maze, animals were taken from the testing room and housed in their home cages without water for 10 min in a holding room. Animals were quickly and lightly anaesthetised with Metofane (Janssen Pharmaceutica, 269 Mississauga, ON, Canada) and blood samples (0.5 cc) taken by cardiac puncture using heparinized syringes. The sampling procedure was completed within 2 min of touching the cage, which is rapid enough to obtain a reliable measure of corticosterone (CORT) at the end of the behavioural testing without any effect of disturbance resulting from the blood sampling procedure itself (Davidson et al., 1968). Blood samples were centrifuged at 2200 g for 10 min at 4° C, plasma collected, and stored at -70° C. C.3 STATISTICAL ANALYSES Principal component factor analysis on standardised scores was used to determine which behavioural measures were related. These factors were then analysed by appropriate analyses of variance (ANOVA) for sex, prenatal treatment (i.e. group) and experimental treatment (i.e. treatment). Individual behaviours were further analysed separately by appropriate A N O V A s for sex, prenatal treatment (i.e. group) and experimental treatment. Significant main and interaction effects were analysed by Newman Keul's paired comparisons. C.4 RESULTS Developmental Data See Chapter IVB; Developmental Data 270 Experimental Results Open Field Analysis of OF behaviour revealed a significant main effect of sex (p < 0.001). Overall, females had higher ambulation scores in both the central and outer areas and made significantly more rears than males (p's < 0.001). There were no significant effects of experimental treatment (i.e. saline or B Z D injection) on ambulation for either males or females (Fig. 61 and Fig. 62). There was, however, a main effect of experimental treatment on rearing (p < 0.0001); males and females injected with B Z D reared significantly less than males and females injected with saline (Fig. 63). For males, there was also a main effect of group for ambulation in the central area (p < 0.05); overall, E males showed significantly less central ambulation than PF males (Fig. 61). There were no significant differences among E, PF, and C males in rearing and no significant differences among E, PF and C females in any OF measure. Plus Maze As animals in this study spent more time in the central area than they did in previous studies, time in the open and closed arms are expressed as a percentage of time on the open and closed arms [Percentage of time on the open arms (%Topen) = (time in open arms / (time in open arms + time in closed arms)) x 100; Percentage of time on the .271 closed arms (%Tclosed) = (time in closed arms / (time in open arms + time in closed arms)) x 100]. Factor analysis revealed 2 main factors accounting for 72 % of the variance in males and 84 % of the variance in females. Factor 1 consisted of %Topen and full open arm entries, negatively related to %Tclosed (fear factor). Factor 2 consisted of partial open arm entries, full closed arm entries, time on central area, and number of closed arm rears (exploration factor). A main effect of sex was seen for both the fear and exploration factors (p's < 0.01): females had significantly lower fear levels and higher exploration levels than males. This was supported by A N O V A s on individual behaviours. Females had higher %Topen and made more open arm entries than males (p's < 0.01). Overall, females also made more closed arm entries and more closed arm rears and spent less time in the central area (p's< 0.01) than males. For males, group x treatment A N O V A s revealed significant main effects of experimental treatment for both the fear and exploration factors (p's < 0.001); males given B Z D had lower fear and exploration scores than males given saline (p's < 0.001). This was supported by A N O V A s on individual behaviours. Overall, BZD-treated males had a higher %Topen (p < 0.01) (Fig. 64), more open arm entries (p < 0.05) (Fig. 65) and a lower %Tclosed (p < 0.01) (Fig. 66) than saline treated males. Males given B Z D also 272 had fewer closed arm entries (p < 0.05) (Fig. 67) and fewer closed arm rears than males given saline (p < 0.01) (Fig. 69). There were no significant differences among E, PF, and C male for either the fear or exploration factors; however, A N O V A s on individual behaviours indicated that BZD treatment differentially affected E compared to PF and C males (p's < 0.05). Following BZD, E males had a higher %Topen (p's < 0.05) (Fig. 64) and fewer open arm entries (p's < 0.05) (Fig. 65) as well as lower %Tclosed (p's < 0.05) (Fig. 66) and fewer closed arm entries than BZD-treated PF and C males (p's < 0.05) (Fig. 67). In addition, E males given B Z D also spent more time on the central area than PF and C males given B Z D (p's < 0.01) (Fig. 68). There were no significant differences among saline-treated E, PF and C males on any +-maze measure (Fig. 69 and Fig. 70). For females, group x experimental treatment A N O V A s similarly revealed significant main effects of experimental treatment for both the fear and exploration factors (p's < 0.001). Consistent with data on males, females given B Z D had decreased fear and decreased exploration scores compared to females given saline (p's < 0.01). This was supported by A N O V A s on individual behaviours. BZD-treated females had a higher %Topen (Fig 64), lower %Tclosed (Fig. 66) and made more open arm entries (Fig 65) than saline-treated females (p's < 0.01). In addition, BZD-treated females made fewer closed arm entries (Fig 67), fewer partial arm entries (Fig 70), fewer closed arm rears (Fig 69) and spent less time on the central area compared to saline-treated females (Fig 68) (p's < 0.01). 273 There were no significant differences among E, PF, and C female for either the fear or exploration factors; however, A N O V A s on individual behaviours indicated that BZD treatment differentially affected E compared to PF and C females (p's < 0.05). Following B Z D, E females had a higher %Topen (Fig 64) and lower %Tclosed (Fig 66) than C females (p's < 0.05) and showed a similar trend compared to PF females (p's < 0.10). There were no significant differences among saline treated E, PF and C females on any of the +-maze behaviours. Corticosterone As expected there was a main effect of sex (p < 0.0001); females had higher CORT levels than males. There were no significant differences among E, PF, and C males. However, there was a main effect of experimental treatment (p < 0.05) (Fig. 71); B Z D treated males had lower CORT levels than saline-treated males. For females, there were no significant differences in CORT levels among E, PF, and C females or between B Z D and saline treated females (Fig. 71). C.5 DISCUSSION Consistent with the data from the previous studies (Alonso et al, 1991; Gonzalez & Leret, 1994; Imhof et al, 1993; Leret-er al, 1994; Meng & Drugan, 1993; Rodgers & Cole, 1993; Slob et al, 1981; Steenbergen et al, 1991), a sexually dimorphic response to both the OF and +-maze was demonstrated. Females demonstrated increased exploration 274 on both the OF and +-maze as well as decreased fear on the +-maze compared to males. B Z D decreased fear and exploration behaviours on the +-maze in both males and females regardless of group importantly. B Z D treatment differentially affected E males and females compared to their PF and C counterparts. Both E males and females treated with B Z D had a higher %Topen and lower %Tclosed, reflecting decreased fear, than their PF and C counterparts. Further, BZD-treated E males demonstrated decreased open and closed arm entries, and also spent significantly more time in the central area than B Z D -treated PF and C males. No significant differences in +-maze behaviours were found among E, PF and C males and females injected with saline. These data support previous work demonstrating that the +-maze provided a reliable measure of anxiety/fear. Although E, PF and C males and females did not differ in +-maze behaviour following saline treatment, in this paradigm prenatal ethanol exposure appears to alter B Z D sensitivity as measured by altered behavioural responses on the +-maze. The results of the present study also support previous work demonstrating that B Z D treatment significantly decrease anxiety/fear on the +-maze (Lister, 1987; Pellow et al, 1985; Pellow & File, 1986). .Overall, BZD-treated males and females had an increased %Topen, increased open arm entries and decreased %Tclosed compared to saline-treated males and females regardless of their group. Importantly, these differences were not due to altered activity levels, as B Z D treatment had no affect on total ambulation in the OF. In addition, BZD-treated males demonstrated lower CORT levels, an index of stress, than saline-treated males. B Z D has been shown to bind to a B Z D site 275 on the y aminobutyric acidA (GAB A A ) receptor and to potentiate G A B A inhibitor function (Olsen & Tobin; 1990). G A B A is the major inhibitory neurotransmitter in the central nervous system (CNS), binding to 2 types of receptors; the G A B A A receptor which is coupled to a chloride channel and the G A B A B receptor which is G-protein coupled. Binding of the G A B A A receptor results in opening of the associated chloride channel leading to increased chloride transport and hyperpolarization of the neuronal membrane (Schofield et al, 1987). The G A B A A receptor is found on almost every neuron in the CNS and appears to play an important role in controlling neuronal excitation (Schofield et al, 1987). Thus, in the present experiment, B Z D may have acted by potentiating the inhibitory effects of the GABA-ergic system to reduce fear on the +-maze. As in the previous +-maze study, females demonstrated increased exploration on the OF and +-maze and decreased fear on the +-maze compared to males, supporting and extending the results of studies demonstrating a sexual dimorphism in nonreproductive behaviours (Beatty, 1979). Recently, it has been demonstrated that females are less sensitive to the activity-suppressant effects of the B Z D inverse agonist F G 7142 (FG) suggesting that there may be a sex difference in the response of the GABA-ergic system. The mechanism for this sexual dimorphism is unknown but may be related to gonadal steroids and corticosterone levels. Metabolites of progesterone, deoxycorticosterone and testosterone have all been shown to bind to G A B A A receptors and alter the binding affinity for its' ligand (Majewska, 1992). Bitran et al (1991) demonstrated that 3a-hydroxy-5a(b)-pregnan-20-one, a metabolite of progesterone, has anxiolytic properties on 276 behaviour on the +-maze. In addition, it has been shown that oestrogen and progesterone increase B Z D binding sites and enhance GABA-activated chloride ion flux in vivo (Wilson, 1992). Further, pregnenolone sulphate (PS) and dehydroepiandrosterone sulphate (DHEAS) both act as non-competitive antagonists of the G A B A A receptor and inhibit GABA-induced currents (Majewska, 1990; Majewska, 1988). Interestingly, the desulphated forms of PS and DHEAS act very differently. Pregnenolone does not affect the G A B A A receptor (Harrison et al, 1987) but dehydroepiandrosterone inhibits G A B A -induced currents (Demirgoren et al, 1991) Glucocorticoids also interact with the G A B A A receptor but their interaction appears to be more complex. Glucocorticoids at nanomolar concentrations potentiate G A B A binding to the G A B A A receptor but at micromolar concentrations reduce G A B A binding to the G A B A A receptor (Majewska et al, 1985). In addition, a metabolite of the corticosterone precursor, 3 a-5 a-tetrahydrodeoxycorticosterone, modulates G A B A activity in a manner similar to that of barbiturates (Majewska, 1992) and has been shown to have anxiolytic effects similar to B Z D in rodents (Crawley et al, 1986).. Thus, it is possible that sex differences in behaviour on the OF and +-maze are modulated by differential levels of neurosteroids which result from activity of gonadal steroids and/or glucocorticoids. Unlike the 2 prior +-maze studies in this thesis, prenatal ethanol exposure does not alter +-maze behaviour in undrugged animals. As previously discussed, E animals' behaviour on the +-maze was differentially affected by prior exposure to an aversive environment (i.e. OF); E animals demonstrated increased exploration compared to 277 controls when placed directly on the +-maze but demonstrated decreased exploration compared to controls when placed on the +-maze after exposure to the OF. Further, it has been demonstrated that novelty-induced grooming responses in E animals differ from controls following a swim stress but do not differ with novelty stress alone (Hannigan et al., 1987). In addition, Hannigan et al. (1987) demonstrated that prior exposure to the novelty stress abolished the increased novelty-induced grooming seen in E animals following swim stress. Taken together, these data indicate that alterations in behavioural responses to stress seen in E animals may be very specific, depending upon the nature, intensity, and timing of the stressor. Thus, it is possible that our experimental manipulations including handling during the injection, the injection and the exposure to the novel environment during the 20 min holding period as well as the OF may have abolished the alterations in +-maze behaviour previously seen in E animals. Importantly, E males and females appear to be more sensitive to B Z D than PF and C males and females. Following B Z D but not saline treatment, E males and females had significantly increased time on the open arms and decreased time on the closed arms compared to PF and C males and females. In addition, BZD-treated E males also had decreased open and closed arm entries and spent more time in the central area than B Z D -treated PF and C males. These latter behaviours did not reflect a decrease in activity levels, but rather reflected the increased time spent exploring the open arms and central area. This interpretation is supported by the finding that there were no significant differences in OF ambulation among E, PF and C animals. 278 No other studies to date have examined B Z D sensitivity in E animals. However, a number of studies have demonstrated alterations in the GABA-ergic system and neurosteroid sensitivity following prenatal ethanol exposure. Ledig et al. (1988) found that in 3 wk old pups, prenatal ethanol exposure decreased G A B A levels in the thalamus, pons, cerebellum and hippocampus, increased G A B A levels in the frontal cortex, olfactory bulbs, anterior colliculus and amygdala and caused no changes in G A B A levels in the posterior colliculus, occipital cortex, temporal cortex, hypothalamus, septum or striatum. Rawat (1977) demonstrated increased cerebral G A B A content in neonates suckling on ethanol-consuming mothers. In contrast, Moloney & Leonard (1984) found alterations in G A B A levels of prenatally and postnatally ethanol exposed only pups i f ethanol was still in the pup's system. Furthermore, Ledig et al. (1993) found increased G A B A turnover in the frontal cortex and olfactory bulb and decreased G A B A turnover in the hypothalamus and olfactory tubercles in 2 month old rats born to mothers who consumed 20% (v/v) ethanol during the month before pregnancy only. Together the results from these studies suggest that prenatal alcohol exposure may alter the G A B A content in specific brain sites and appears to have variable effects on the GABA-ergic system depending upon the alcohol exposure regimen, age at testing and the site studied. The increase in B Z D sensitivity in adult E males and females in this study suggest that the alterations in G A B A levels in neonates may have functional implications in adults. Janiri et al. (1994), using microiontophoresis, demonstrated increased somatosensory and frontal cortex responses to G A B A and decreased responses to 279 acetylcholine in adult E animals compared to control animals. In contrast, Zimmerberg et al (1995) found that E neonates were less sensitive to the neuroactive steroid allopregnanolone, a G A B A A agonist, as measured by ultrasonic vocalisation. Neuroactive steroids bind to a site on the G A B A A receptor and affect ligand binding affinity by either increasing or decreasing receptor affinity (Majewska, 1992). Furthermore, Savage et al. (1995) demonstrated that prenatal ethanol exposure enhanced the positive modulatory effects of flunitrazepam and the negative effects of the inhibitory neurosteroid, 5 a-pregnon-3 P-ol-20-one sulphate while attenuating the effect of the benzodiazepine inverse agonist F G on G A B A A receptor-stimulated chloride flux into vesicles prepared from the hippocampus. These changes in GABA-ergic activity may actually reflect alterations in the number of GABA-ergic neurons present in the animals as suggested by data of Lee et al. (1992) who demonstrated that after a single injection of ethanol, chick embryos had decreased cortical cholinergic neurons and increased cortical GABA-ergic neurons. Thus, it is possible that the increased sensitivity to B Z D in E animals may reflect an alteration in the GABA-ergic system induced by prenatal alcohol exposure. Finally, these data may have clinical implications. Prenatal alcohol exposure results in hyperactive, uninhibited and impulsive behaviour, attention deficits, as well as deficits in learning and memory (Streissguth et al., 1983; Streissguth et al, 1985; Streissguth, 1986). B Z D receptor antagonists and inverse agonists have been shown to modulate learning and memory (Izquierdo & Medina, 1991). Anxiolytic agents which 280 enhance G A B A binding impair memory whereas anxiogenic agents which inhibit G A B A binding enhance memory (Izquierdo & Medina, 1991). Recently, it has been shown that B Z D impairs learning and memory in FAS animals to a greater extent than in control animals (Petkov et al, 1991). Thus, it is possible that alterations in the GABA-ergic system either directly or through altered neurosteroid activity may play a role in the behavioural and/or cognitive alterations seen in children prenatally exposed to alcohol. 281 Figure 61. Ambulation on Central Area on the Open Field for Males and Females. Points represent mean ± SEM. * Main effect of group, p < 0.05: E < PF for males. No significant differences among E, PF and C females. 282 OPEN FIELD Control Wflh Pair-fed V///\ Ethanol Male BZD Saline TREATMENT Control ^ Pair-fed vzz< A Ethanol Female BZD Saline TREATMENT .283 Figure 62. Ambulation on Outer Area on the Open Field for Males and Females. Points represent mean ± SEM. No significant differences among E, PF and C males or females. 284 OPEN FIELD Control Wflh Pair-fed V//<\ Ethanol BZD Saline TREATMENT 285 Figure 63. Rears on the Open Field for Males and Females. Points represent mean ± SEM. * Main effect of experimental treatment, p's < 0.0001: BZD-treated males and females < saline-treated males and females (p's < 0.0001). 286 OPEN FIELD BZD Saline TREATMENT BZD Saline TREATMENT 287 Figure 64. Percent Time on Open Arms for Males and Females. Points represent mean ± S E M . # Main effect of experimental treatment, p's < 0.01: BZD-treated males and females > saline-treated males and females (p's < 0.01). * Group x experimental treatment interaction, (p's < 0.05); BZD-treated E males > BZD-treated PF and C males (p's < 0.05); BZD-treated E females > BZD-treated C (p < 0.05) and PF (p < 10) females. 288 OPEN ARMS s B Z D Saline T R E A T M E N T B Z D Saline T R E A T M E N T 289 Figure 65. Number of Open Arms Entries for Males and Females. Points represent mean ± SEM. # Main effects of experimental treatment, p's < 0.05: BZD-treated males and females < saline-treated males and females (p's < 0.05). * Group x experimental treatment interaction, (p's < 0.05); BZD-treated E males < BZD-treated PF and C males (p's < 0.05). 290 OPEN ARMS Control Pair-fed Y//A Ethanol 12 W 6 h BZD Saline T R E A T M E N T Control Pairfed '//A Ethanol 12 9 h W 6 D PL, BZD Saline T R E A T M E N T 291 Figure 66. Percent Time on Closed Arms for Males and Females. Points represent mean ± SEM. # Main effects of experimental treatment, p's < 0.01: BZD-treated males and females < saline-treated males and females (p's < 0.01). * Group x experimental treatment interaction, (p's < 0.05); BZD-treated E males < BZD-treated PF and C males (p's < 0.05); BZD-treated E females < BZD-treated C females (p < 0.05). 292 CLOSED ARMS B Z D Saline T R E A T M E N T B Z D Saline T R E A T M E N T 293 Figure 67. Number of Closed Arm Entries for Males and Females. Points represent mean ± SEM. # Main effects of experimental treatment, p's < 0.01: BZD-treated males and females < saline-treated males and females (p's < 0.01). * Group x experimental treatment interaction, (p's < 0.05); BZD-treated E males < BZD-treated PF and C males (p's < 0.05). 294 CLOSED ARMS BZD Saline TREATMENT 295 Figure 68. Time on Central Area for Males and Females. Points represent mean ± SEM. # Main effect of experimental treatment, p < 0.01: BZD-treated females < saline-treated females (p < 0.01). * Group x experimental treatment interaction, (p's < 0.01); BZD-treated E males > BZD-treated PF and C males (p's < 0.01). 296 CENTRE Control Pair-fed y/A Ethanol T3 C o o IU s 250 200 150 100 50 B Z D Saline T R E A T M E N T Control 3 Pair-fed ZZ3 Ethanol 250 T3 C O o CD t/3 200 \ -150 100 50 Female B Z D Saline T R E A T M E N T 297 Figure 69. Number of Closed Arm Rears for Males and Females. Points represent mean ± SEM. # Main effects of experimental treatment, p's < 0.01: BZD-treated males and females < saline-treated males and females (p's < 0.01). 298 CLOSED ARMS BZD Saline TREATMENT BZD Saline TREATMENT 299 Figure 70. Number of Partial Open Arm Entries for Males and Females. Points represent mean ± S E M . # Main effects of experimental treatment, p's < 0.01: BZD-treated males and females < saline-treated females (p's < 0.01). 300 PARTIAL OPEN A R M Control Pair-fed V//A Ethanol BZD Saline TREATMENT Control Pair-fed VTA Ethanol Female # # BZD Saline TREATMENT 301 Figure 71. Corticosterone Levels for Males and Females Following +-Maze exposure. Points represent mean ± SEM. # Main effects of experimental treatment, p < 0.05: BZD-treated males < saline-treated males (p < 0.05). 302 CORTICOSTERONE Control Pair-fed Ethanol 100 B Z D Saline T R E A T M E N T Control 3 Pair-fed Y/A Ethanol B Z D Saline T R E A T M E N T 303 CHAPTER V: CONCLUSIONS AND RECOMMENDATIONS The studies in this thesis focused on two major areas: 1) possible mechanisms which may mediate the hypothalamic-pituitary-adrenal (HPA) hyperresponsiveness seen in prenatal ethanol exposed (E) animals; and 2) an examination of possible mechanisms which may mediate the alterations in behavioural responses to stressful environments seen in E animals. Specifically, the HPA hyperresponsiveness experiments examined the effects of prenatal ethanol exposure on: a) adrenal responsiveness to adrenocorticotrophin (ACTH); b) the effects of dexamethasone (DEX) blockade on basal and stress corticosterone (CORT) levels and stress A C T H levels over a 36 h period; c) corticotrophin releasing factor (CRF), arginine vasopression (AVP) and glucocorticoid receptor (GR) mRNA expression in the hypothalamus following stress. The behavioural experiments examined the effects of prenatal ethanol exposure on: a) behaviour on the elevated plus maze (+-maze) and b) investigated the possible role of CRF and y aminobutyric acid (GABA) in mediating the altered behavioural responses seen in E animals. The first set of studies focused on investigation of mechanisms underlying HPA hyperresponsiveness seen in E animals. One possible mechanism for the enhanced HPA response to stress seen in E animals may be a greater sensitivity of the adrenal gland to A C T H . Previous studies (Lee et al, 1990; Lee & Rivier., 1994; Taylor et al, 1982) have suggested that in E animals neither the adrenal gland or the pituitary are hyperresponsive 304 to secretagogues but these studies did not evaluate a full dose response curve in both males and females. The present study utilised 5 doses of A C T H and examined the CORT response over a 4 h period. We found that there were no significant differences in CORT levels following A C T H infusion among E, PF and C animals, when sensitivity is tested at the trough of the CORT circadian cycle. The data did, however, demonstrate the expected sex difference (Kitay, 1961; Skelton & Bernardis, 1966) in CORT responses; females have greater CORT responses to the same dose of exogenous A C T H than males regardless of their group. However, the pattern of CORT secretion over time was similar in males and females. Thus, our data suggest that during the trough of the circadian cycle, prenatal ethanol exposure does not exert long-term effect on adrenal sensitivity to A C T H . The second possible mechanism underlying the HPA hyperresponsiveness in E offspring examined in this thesis was a deficit in feedback inhibition of the H P A axis. Nelson et al, (1985b) demonstrated that E animals appear to have an accelerated rebound of basal CORT levels following a high dose of the synthetic glucocorticoid, dexamethasone-21 -phosphate (DEX). Clinically, the D E X suppression test has been used to evaluate H P A axis function in a number of psychiatric conditions and it appears that feedback inhibition of CORT is altered in a number of affective disorders (Nemeroff et al, 1988). Our studies of feedback inhibition of CORT supported the hypothesis that HPA hyperresponsiveness and/or delays in HPA recovery from stressors that occur in E animals may result, in part, from delays in feedback inhibition of the H P A axis induced by prenatal ethanol exposure. However, differential responsiveness was seen in males 305 and females depending on the time of day when testing occurred. During the trough of the CORT circadian cycle, E males had greater CORT responses to ether vapour than C males at 3 h following injection of low doses of dexamethasone (DEX) (0.1 and 0.5 pg/100 g body weight (bw). There were no significant differences among E, PF and C males at 3 or 6 h following injection of high dose D E X and no significant differences in A C T H levels among E, PF, and C males at any time or dose tested. In contrast, at 6 h post-injection, E females given a low dose of D E X (1.0 pg/100 g bw) had higher CORT responses to ether vapour than C females given the same dose of D E X . At high doses of D E X , E females had higher CORT responses to ether vapour than PF and C animals at 3 h following 10.0 or 30.0 pg/100 g bw D E X and at 6 h following 30.0 pg/100 g bw D E X . Importantly, during the peak of the circadian cycle, 3 h post injection of high doses of D E X (5.0 or 15.0 pg/100 g bw D E X for males and 10.0 or 30.0 pg/100 g bw D E X for females) both E males and females demonstrated increased CORT responses to ether vapour compared to C males and females. In addition, E females given 30.0 pg/ 100 g bw D E X had higher A C T H responses to ether vapour than PF and C females. Together these data suggest that in the P M , when the HPA axis is less sensitive to glucocorticoid feedback inhibition, stress CORT levels of both E males and E females as well as stress A C T H levels of E females were not effectively suppressed by D E X . Thus our data suggest that the insult of prenatal ethanol exposure affects both male and female offspring, but that there may be a sex-specific difference in the sensitivity of the mechanism(s) underlying H P A hyperresponsiveness (Osborn et al, 1996). 306 A third possible mechanism examined in this thesis for the HPA hyperresponsiveness seen in E animals may be an alteration in CRF biosynthesis and/or secretion of CRF by the hypothalamus. CRF transcription measured by CRF mRNA expression in the P V N has been shown to be negatively regulated by glucocorticoids (Jingami et al, 1985; Young et al, 1986). Lee et al. (1990) demonstrated increased CORT levels in E animals following inescapable shock, as well as an increase in paraventricular nucleus (PVN) CRF mRNA in nonstressed E animals compared to controls. We examined the effects of prenatal ethanol exposure on CRF, A V P and GR mRNA expression in the hypothalamus following ether stress in DEX-treated animals. There were no significant differences in basal CRF, A V P or GR mRNA levels among E, PF, and C males or females. In addition, there were no significant differences in stressed A V P or GR levels among E, PF and C males or females. D E X had little effect on CRF mRNA expression suggesting D E X does not exert significant feedback inhibition at the levels of the hypothalamus. Importantly, E males showed a trend toward higher stress CRF mRNA levels than PF males and E females had significantly higher stress CRF mRNA levels than PF females and showed a trend toward higher stress CRF mRNA levels than C females. Thus, our data and that of Lee et al. (1990) suggest that prenatal ethanol exposure may have a long-term effect on the HPA axis including alterations in synthesis of CRF mRNA. It remains to be determined if the increase in gene expression is reflective of an increase in synthesis and/or release. The second set of studies focused on mechanisms underlying the behavioural alterations seen in E animals. Adult E animals demonstrate hyperactivity (Bond, 1981; .307 Meyer & Riley, 1986), deficits in response inhibition (Driscoll et al, 1985; Riley et al, 1979a; Riley et al, 1979b), and increased anxiety-like behaviours in stressful environments (Anandam et al, 1980; Hannigan et al, 1987). The initial set of studies utilised the elevated plus maze (+-maze) to investigate behavioural alterations seen in E animals. The +-maze was utilised as it has been demonstrated to be a valid and reliable measure of anxiety/fear as measured by behavioural, physiological, and pharmacological responses (Lister, 1987; Pellow et al, 1985). E males and females both demonstrated increased exploration on the +-maze when placed directly on the maze compared to C males and females. In addition, E males demonstrated decreased fear levels compared to C males while E females demonstrated increased fear levels compared to PF females. In contrast, when exposed to the open field (OF) prior to the +-maze, a procedure which has been shown to behaviourally activate the rodents (Pellow et al, 1985), both E males and females demonstrated decreased exploration. Further, E females continued to demonstrate increased fear compared to C females whereas the decreased fear found in E males compared to C males was no longer apparent. Furthermore, there were no significant differences in CORT levels among E, PF, and C males or females when confined to the open or closed arm but when exposed to both the OF and the +-maze E females had higher CORT levels than PF and C females. Thus these data indicate that E males and females demonstrate behavioural differences on the +-maze compared to PF and C males and females and that these alterations in behaviour can be modified by prior experience. There does, however, appear to be a sexual dimorphism in the mechanisms mediating the behaviour; E males demonstrated no alterations or decreased fear whereas E females demonstrated increased fear. In addition, it appears the altered behaviour seen 308 in E animals can occur in parallel with HPA hyperresponsiveness or in isolation suggesting that the elevated CORT levels in E animals may not be mediating the alterations in +-maze behaviour. The second set of behavioural studies investigated possible mechanisms for altered behaviour seen on the +-maze. Both the GABA-ergic system (Ledig et al, 1988; Ledig et al, 1993; Moloney & Leonard, 1984; Rawat, 1977) and hypothalamic CRF mRNA (Lee et al, 1990; Osborn et al, 1995) has been shown to be altered by prenatal ethanol exposure. In addition, the G A B A agonist benzodiazepine (BZD) (File et al, 1992; Pellow et al, 1985) and CRF agonists/CRF antagonists (Heinrichs et al, 1994; Koob et al, 1993) have been widely tested on the +-maze. The studies in this dissertation investigated the effects of prenatal ethanol exposure on B Z D sensitivity and on central and peripheral CRF sensitivity as measured by the +-maze. The data indicated that E males and females appear to be differentially sensitive to benzodiazapine (BZD) compared to their PF and C counterparts. Both E males and females spent more time on the open arms and less time on the closed arms following B Z D treatment compared to PF and C males and females. These data suggest that the altered behaviour on the +-maze may in part be mediated by alterations in the G A B A -ergic system. In contrast, the study investigating central CRF sensitivity suggested no significant differences in sensitivity among E, PF and C animals. However it appeared that methodological issues may have influenced the results. First, the doses of CRF and 309 a-helical CRF used may have been subthreshold and therefore had no or minimal effect on +-maze behaviour. Second, the method of getting the CRF and a-helical CRF into solution may have partially inactivated it. Furthermore, recent studies have indicated that a-helical CRF may possess anxiogenic-like as well as anxiolytic-like effects depending upon the endogenous level of CRF (Menzaghi et al, 1994). Therefore, it is premature at this time to reject the hypothesis that altered behavioural responses to stress may be mediated by altered sensitivity to central CRF in E animals. This study is currently being replicated in Dr. Weinberg's laboratory. Together, the data presented in this thesis suggest that several physiological mechanisms may interact to produce the HPA hyperresponsiveness and altered behaviour seen in E animals. Alterations both in feedback inhibition of CORT and in CRF synthesis may mediate the H P A hyperresponsiveness. In addition, the altered behaviour in E compared to PF and C animals on the +-maze may in part be mediated by alteration in the G A B A system. Although these studies have revealed several possible mechanisms by which prenatal ethanol exposure may affect HPA function and behaviour later in life, many questions still remain. 1.) Research is required to investigate the possibility that E animals may be differentially sensitive to A C T H . As mentioned previously, the adrenal gland markedly changes its sensitivity to A C T H during the circadian cycle, being maximally sensitive during lights-off and minimally sensitive during lights on (Kaneko et al, 1981). Further, 310 our data indicate that there was a differential responsiveness of the H P A following D E X suppression depending upon the time of day tested. That is, during the trough of the CORT circadian rhythm only, E females demonstrated increased stress CORT levels, whereas in the peak of the circadian cycle, both E males and E females demonstrated elevated CORT levels compared to their respective controls. Therefore, it is possible that differential adrenal sensitivity to A C T H in E compared to PF and C animals might be observed at the peak of the circadian rhythm. An additional study should be conducted in which CORT responses to A C T H are examined during the peak of the CORT circadian cycle. 2.) Although these data support the hypothesis that H P A hyperresponsiveness seen in E animals may result from deficits in feedback inhibition of CORT, it still remains to be determined at what level(s) and during what time frame(s) these deficits occur. The present study suggests that the deficits occur at the level of the pituitary during the intermediate feedback domain, as D E X binds preferentially to the pituitary (DeKloet et al, 1975) and exerts the majority of its effects at the pituitary level (Spencer et al, 1995). In support of this suggestion , a recent study in our lab has demonstrated that during the trough of the CORT circadian cycle, DEX-suppressed E females have increased A C T H responses to exogenously administered CRF compared to D E X -suppressed PF and C females (Yu et al, 1996). As previously discussed, Taylor et al (1986b) found there are deficits in fast feedback inhibition in E animals. Thus, future studies should further investigate the deficits in feedback inhibition using other suppressing agents such as exogenous CORT which has been shown to provide feedback 311 input to both the pituitary and higher brain centres (Dallman et al, 1987). As well, feedback inhibition of CORT should be investigated during all 3 time domains (Keller-Wood & Dallman, 1984). 3. ) It is possible that the HPA hyperresponsiveness seen in E animals is a result of increased synthesis of CRF. As previously mentioned, Lee et al. (1990) demonstrated elevated basal levels of CRF mRNA in E animals and data from the present thesis indicated elevated stress levels of CRF mRNA in E animals compared to controls, even though the sampling time was not optimal. Future studies should evaluate CRF mRNA in both undisturbed and stressed E, PF and C animals. The time of sampling post-stress should be 120-180 min which has been shown to be the time of peak CRF mRNA expression (Lightman et al, 1993). Studies should also evaluate CRF mRNA in both exogenous CORT suppressed and non-suppressed animals to differentiate between CRF mRNA expression in basal conditions and during feedback inhibition of glucocorticoids. 4. ) It still remains to be determined i f increased sensitivity to central CRF plays a role in the altered behavioural responses to stressful environments seen in E animals. Presently, a study is being run in our lab utilising multiple doses of CRF as well as a more specific CRF antagonist, [D-Phe12, N l e 2 1 3 8 , C a MeLeu 3 7] hi r C R F 1 M 1 (D-Phe CRF) (Menzaghi et al, 1994) to address this question more completely. D-Phe CRF, unlike a-helical CRF, does not have any CRF agonistic activity and has an extended duration of 312 action making it a more effective agent with which to examine the role of CRF in behavioural responses to stress. 5.) It is possible that the alteration in behaviour on the +-maze seen in E animals is mediated by the GABA-ergic system. Although the study in this thesis demonstrated a differential sensitivity to B Z D in E animals compared to PF and C animals, the study only evaluated 1 dose in a small number of animals. A more complete investigation utilising a variety of doses should be conducted on a larger number of animals, in order to evaluate better the possibility of altered sensitivity to B Z D in E compared to PF and C animals. Further, other GABA-ergic agents such as neurosteriods should be utilised to test the hypothesis that the alteration in behaviour seen in E animals is a result of deficits in the GABA-ergic system. In addition to these future lines of research, the present data may have clinical implications; however, caution must be used when extrapolating data from animal studies to the human condition. As discussed previously, developmental and biological differences may exist between humans and rodents which may affect the way in which prenatal alcohol exposure affects the developing brain. Nevertheless, a number of similarities have been demonstrated between children prenatally exposed to alcohol and rodents prenatally exposed to ethanol. Children prenatally exposed to alcohol are hyperactive, have uninhibited and impulsive behaviour and have attention deficits which may reflect an inability to inhibit responses (Streissguth et al, 1983; Streissguth et al, 313 1985; Streissguth, 1986). Similarly, rodents prenatally exposed to ethanol demonstrate behavioural hyperactivity and deficits in response inhibition in a variety of tasks (Becker & Randall, 1989; Bond & DiGiusto, 1977b; Caul et al, 1979; Fernandez et al, 1983; Means et al, 1984; Melcer et al, 1994; Molina et al, 1984; Riley et al, 1986; Shah & West, 1984; Vorhees & Fernandez, 1986). Furthermore, both children (Jacbson et al, 1993) and rodents (Lee & Rivier., 1993b; Nelson et al, 1986; Taylor et al, 1982; Weinberg 1992b; Weinberg, 1988; Weinberg & Gallo, 1982) prenatally exposed to alcohol demonstrate elevated CORT levels following stress. Glucocorticoids (McEwen et al, 1986) and CRF (Nemeroff, 1992) are known to modulate behaviour during stress; thus, it is possible that sustained increases in hormones of the H P A axis could play a role in mediating the hyperactivity and behavioural arousal observed in foetal alcohol-exposed children. The studies in this dissertation attempting to investigate this possibility, however, were inconclusive. Further studies must address this issue. Prenatal ethanol exposure not only results in H P A and behavioural hyperactivity, but also produces cognitive deficits in humans (Streissguth et al, 1983; Streissguth et al, 1985; Streissguth, 1986) and rodents (Abel, 1979; Barron et al, 1988; Blanchard et al, 1990). It has been documented that high levels of CORT both acutely (Diamond & Rose, 1994; Kant; 1993) and chronically (Luine et al, 1994) can decrease cognitive function in rodents. Similarly, cold stress has been associated with a decrease in cognitive function in humans (Sharma & Panwar, 1987). Further, major depression, dementia of the Alzheimer type, and Cushing's syndrome all result in increased Cortisol levels along with 314 decreases in cognitive function (Martignoni et dl, 1992). Thus it is possible that sustained increases in hormones of the HPA axis could play a role in mediating the decreased cognitive function observed in foetal alcohol-exposed children. Finally, studies have demonstrated alterations in the cholinergic (Janiri et al., 1994; Rudeen & Weinberg, 1993) as well as GABA-ergic systems (Janiri et al, 1994; Ledig, 1988; Savage et al,. 1995; Zimmerberg et al, 1995) in prenatally alcohol-exposed animals. Cholinergic and B Z D receptor agonists and antagonists have been shown to modulate learning and memory (Izquierdo & Medina, 1991). Anxiolytic agents which enhance G A B A binding impair memory whereas anxiogenic agents which inhibit G A B A binding enhance memory (Izquierdo & Medina, 1995). It has been shown that cholinergic agonists improve learning and memory while B Z D impairs learning and memory in E animals to a greater extent than in control animals (Petkov et al, 1991). Thus, it is possible that alterations in the cholinergic and GABA-ergic systems may play a role in the behavioural and/or cognitive deficits seen in children prenatally exposed to alcohol. In summary, these experiments demonstrate that prenatal ethanol exposure has long term effects on both HPA and behavioural responses to stress. Further, they indicate that both alterations in feedback inhibition of CORT and increased synthesis of CRF may modulate the HPA hyperresponsiveness to stress seen in E animals. In addition, they suggest that the alterations in behavioural responses to stress seen in E animals may be modulated by alterations in the GABA-ergic system. 315 REFERENCES Abe, K. and Critchlow, V (1977) Effects of corticosterone, dexamethasone and surgical isolation of the medical basal hypothalamus on rapid feedback control of stress-induced corticotrophin-secretion in female rats. Endocrinology 101, 498-505. Abe, K . and Critchlow, V (1980) Delayed feedback inhibition of stress-induced activation of pituitary-adrenal function: effects of varying dose rate and duration of corticosterone administration and telencephalon removal. Neuroendocrinology 31, 349-354. Abel, E. (1978) Effects of ethanol on pregnant rats and their offspring. Psychopharmacology 57, 5-11. Abel, E. (1979) Prenatal effects of alcohol on adult learning in rats. Pharmacol Biochem Behav 10, 239-245. Abel, E. (1980) Procedural considerations in evaluating prenatal effect of alcohol in animals. Neurobehav Toxicol Teratol 2, 167-174. Abel, E. (1982) In utero alcohol exposure and developemental delay of response inhibition. Alcohol Clin Exp Res 6, 369-376. Abel, E. (1984) Fetal Alcohol Syndrome and Fetal Alcohol Effects, pp. 73-111. New York: Plenum Press Abel, E. and Dintcheff, B. (1986) Effects of prenatal alcohol exposure on behavior of aged rats. DrugAlcoh Depend 16, 321-330. Abel, E. and Dintcheff, B. (1978) Effects of prenatal alcohol exposure on growth and development in rats. JPharm Exp Ther 207, 916-921. Abel, E. and Sokol, R. (1987) Incidence of Fetal Alcohol Syndrome and Economic Impact of FAS-related Anomalies. Drug Alcohol Depend 19, 51-70. Abou-Samra, A. , Catt, K. and Aguilera, G. (1986) Biphasic inhibition of A C T H in cultured anterior pituitary cells. Endocrinology 119, 927-977. Agnati, L . , Fuxe, K. , Yu , Z. and Hartstrand, A . (1985) Morphometrical analysis of the distribution of corticotrophin-releasing factor, glucocorticoid receptor and phenylethanolamine-N-methyltransferase immunoreactive structure in the paraventricular hypothalamic nucleus of the rat. Acta Paediatr Scand Suppl 54, 147-153. 316 Alonso, S.J., Arevalo, R., Afonso, D. and Rodriguez, M . (1991) Effects of maternal stress during pregnancy on forced swimming test behavior of the offspring. Physiol Behav 50, 511-517. Anandam, N . , Felegi, W. and Stern, J. (1980) In Utero alcohol heightens juvenile reactivity. Pharmacol Biochem Behav 13, 531-535. Anderson, R. (1981) Endocrine balance as a factor in the etiology of the fetal alcohol syndrome. Neurobehav Toxicol Teratol 3, 89-104. Angelogianni, P. and Gianoulakis, C. (1989) Prenatal exposure to ethanol alters the ontogeny of the p-endorphin response to stress. Alcohol Clin Exp Res 13, 564-571. Antoni, F.A. (1986) Hypothalamic control of adrenocorticotrophin secretion: advances since the discovery of 41-residue corticotrophin-releasing factor. [Review]. Endo Rev 7, 351-378. Antoni, F., Holmes, H. and Jones, M . (1983) Oxytocin as well as vasopressin potentiate ovine CRF in vitro. Peptides 4, 411-415. Arato, M . , Banki, C M . , Nemeroff, C.B. and Bissette, G. (1986) Hypothalamic-pituitary-adrenal axis and suicide. Ann N Y Acad Sci 487, 263-270. Archer, J. (1975) Rodent sex differences in emotional and related behavior. Behavior Biol 14, 451-479. Arimura, A. , Schally, A . and Bowers, C. (1969) Corticotrophin-releasing activity of lysine vasopressin analogues. Endocrinology 84, 579-583. Armario, A. , Castellanos, J .M. and Balasch, J. (1984a) Dissociation between corticosterone and growth hormone adaptation to chronic stress in the rat. Horm Met Res 16, 142-145. Armario, A. , Castellanos, J .M. and Balasch, J. (1984b) Adaptation of anterior pituitary hormones to chronic noise stress in male rats. Behav Neural Biol 41, 71-76. Armario, A. , Castellanos, J .M. and Balasch, J. (1984c) Effect of acute and chronic psychogenic stress on corticoadrenal and pituitary-thyroid hormones in male rats. Horm Res 20, 241-245. Armario, A. , Lopez-Calderon, A. , John, T. and Castellanos, J .M. (1986a) Sensitivity of anterior pituitary hormones to graded levels of psychological stress. LifSci 39, 471-475. 317 Armario, A. , Montero, J.L. and Balasch, J. (1986b) Sensitivity of corticosterone and some metabolic variables to graded levels of low intensity stresses in adult male rats. Physiol Behav 37, 559-561. Aronson, M . , Kyllerman, M . , Sabel, K.,Sandin, B. and Olegard, R. (1985) Children of alcoholic mothers: developmental perceptual and behavioral characteristics as compared to matched controls. Acta Paediatr Scand 74, 27-35. Aronson, M . and Olegard, R. (1987) Children of alcoholic mothers. Pediatrician 14, 57-61. Asterita, M . (1985) The Physiology of Stress New York: Human Science Press Inc. Autti-Ramo, I and Granstrom, M . (1991a) The effect of intrauterine alcohol exposure in various durations on early cognitive development. Neuropediatrics 22, 203-210. Autti-Ramo, I and Granstrom, M . (1991b) The psychomotor development during the first year of life of infants exposed to intrauterine alcohol of various duration: fetal alcohol exposure and development. Neuropediatrics 22, 59-64. Barr, H. , Streissguth, A. , Darby, B. and Sampson, P. (1990) Prenatal exposure to alcohol, tobacco, and aspirin: effects on fine and gross motor performance in 4-year-old children. Psychol 26,339-34*. Barron, S., Gagnon, W., Mattson, S., Kotch, L. , Meyer, L . and Riley, E. (1988) The effects of prenatal alcohol exposure on odor associative learning in rats. Neurotoxicol Teratol 10, 333-340. Barron, S. and Riley, E.P. (1990) Passive avoidance performance following neonatal alcohol exposure. Neurotoxicol Teratol 12, 135-138. Beatty, W.W. (1979) Gonadal hormones and sex differences in nonreproductive behaviors in rodents: organizational and activational influences. Horm Behav 12, 112-163. Beatty, W.W. and Fessler, R. (1976) Ontogeny of sex differences in open-field behavior and sensitivity to electric shock in the rat. Physiol Behav 14, 413-417. Beatty, W.W. and Holzer, G.A. (1978) Sex differences in stereotyped behavior in the rat. Pharmacol Biochem Behav 9, 777-783. Becker, H.C. and Randall, C L . (1989) Effects of prenatal ethanol exposure in C57BL mice on locomotor activity and passive avoidance behavior. Psychopharmacology 97, 40-44. 318 Binkiewicz, A. , Robinson, M.J . and Senior, B. (1978) Pseudo-Cushing syndrome caused by alcohol in breast milk. JPediat 93, 965-967. Bitran, D., Hilvers, R.J. and Kellogg, C K . (1991) Anxiolytic effects of 3 alpha-hydroxy-5 alpha[beta]-pregnan-20-one: endogenous metabolites of progesterone that are active at the G A B A A receptor. Brain Res Mol Brain Res 561, 157-161. Blanchard, B.A. , Riley, E. and Hannigan, J. (1990) Deficits on spatial navigation task following prenatal exposure to ethanol. Neurotoxicol Teratol 9, 253-259. Blizard, D.A., Lippman, H.R. and Chen, J.J. (1975) Sex differences in open-field behavior in the rat: the inductive and activational role of gonadal hormones. Physiol Behav 14, 601-608. Bohler, H.C., Jr., Zoeller, R.T., King, J .C , Rubin, B.S., Weber, R. and Merriam, G.R. (1990) Corticotropin releasing hormone mRNA is elevated on the afternoon of proestrus in the parvocellular paraventricular nuclei of the female rat. Brain Res Mol Brain Res 3, 259-262. Bond, N . (1981) Prenatal alcohol exposure in rodents: A review of its effects on offspring activity and learning ability. Austr JPsychol 33, 331-334. Bond, N . (1986) Fetal alcohol exposure and hyperactivity in rats: the role of the neuro transmitter systems involved in arousal and inhibition. In: West, J. (Ed.) Alcohol and Brain Development, pp. 45-70. New York: Oxford University Press Bond, N . and DiGiusto, E. (1977a) Prenatal alcohol consumption and open-field behavior in rats: Effects of age at time of testing. Psychopharmacology 52, 311 -312. Bond, N . and DiGiusto, E. (1977b) Effects of prenatal alcohol consumption on shock avoidance learning in rats. Psychol Rep 41, 1269-1270. Bond, N . and DiGiusto, E. (1978) Avoidance conditioning and Hebb-Williams maze performance in rats treated prenatally with alcohol. Psychopharmacology 58, 69-71. Bonnischsen, R. and Theorell, H. (1951) A n enzymatic method for the micro-determination of ethanol. Scand J Clin Lab Invest 3, 58-62. Bonthius, D. and West, J. (1990) Alcohol-induced neuronal loss in developing rats: increased brain damage with binge exposure. Alcohol Clin Exp Res 14, 107-118. Bradbury, M . , Cascio, C , Scribner, K . and Dallman M.F. (1991) Stress-induced adrenocorticotropin secretion: Diurnal responses and decreases during stress in the evening are not dependant on corticosterone. Endocrinology 128, 680-688. 319 Brien, J., Loomis, C , Tranmer, J. and McGath, M . (1983) Diposition of ethanol in human maternal venous blood and amniotic fluid. AmJObstet Gynecol 146, 181-186. Britton, D., Koob, G., Rivier, J. and Vale, W. (1981) Intraventricular corticotropin-releasing factor enhances behavioral effects of novelty. Pharmacol Biochem Behav 15, 577-582. Britton, D., Koob, G., Rivier, J. and Vale, W. (1982) Intraventricular cortictropin-releasing factor enhances behavioral effects of novelty. LifSci 31, 363-367. Bronstein, P .M. , Wolkoff, F.D. and Levine, W.J. (1975) Sex-related differences in rats open-field activity. Behavior Biol 13, 133-138. Brown, M . (1986) Corticotropin releasing factor: Central nervous system site of action. Brain Res 399, 10-14. Brown, M . and Fisher, L . (1985) Corticotrophin releasing factor: Effects on autonomic nervous system and visceral systems. Fed Proc 44, 243-248. Brown, M . and Fisher, L . (1986) Central nervous system effects of CRF in the dog. Brain Res 280, 75-79. Brown, M . , Fisher, L. , Rivier, J., Spiess, J., Rivier, C. and Vale, W. (1982a) Corticotrophin releasing factor: Effects on sympathetic nervous system and oxygen consumption. LifSci 30, 207-210. Brown, M . , Fisher, L. , Rivier, J., Spiess, J., Rivier, C. and Vale, W. (1982b) Corticotrophin releasing factor: action on sympathetic nervous system and metabolism. Endocrinology 111, 928-931. Brown, M . , Gray, T. and Fisher, L . (1986) Corticotrophin releasing factor receptor antagonist: effects on autonomic nervous and cardiovascular function. Regulat Pept 16, 321-329. Buckley, D.I. and Ramachandran, J. (1981) Characterization of corticotropin receptors on adrenocortical cells. Proc Natl Acad Sci USA 78, 7431-7435. Burd, L . and Martosolf (1989) Fetal alcohol syndrome: diagnosis and syndrome variability. Physiol Behav 46, 39-43. Burgess, L . H . and Handa, R.J. (1992) Chronic estrogen-induced alterations in adrenocorticotropin and corticosterone secretion, and glucocorticoid receptor-mediated functions in female rats. Endocrinology 131, 1261-1269. 320 Calogero, A . (1995) Neurotransmitter regulation of the hypothalamic corticotropin-releasing hormone neuron. Ann N Y Acad Sci 771, 31-40. Calogero, A. , Gallucci, W., Gold, P. and Chrousos, G. (1988) Multiple feedback regulatory loops upon hypothalamic corticotrophin-releasing hormone secretion. J Clin Invest 82,161-11 A. Carnes, M . , Barkdale, C , Kalin, N . , Brownfield, M . and Lent, S. (1987) Effects of dexamethasone on central and peripheral A C T H systems in the rat. Neuroendocrinology 42, 160-164. Caul, W.F., Osborne, G.L., Fernandez, K . and Henderson, G.I. (1979) Open-field and avoidance performance of rats as a function of prenatal ethanol treatment. Addict Behav 4,311-322. Chou,Y.C, Luttge, W.G. (1988) Activated type II receptors in the brain cannot rebind glucocorticoids: relationship to progesterone's antiglucorticoid actions. Brain Res 440, 67-78 Church, M . and Gerkin, M . (1988) Hearing disorders in children with fetal alcohol syndrome: findings from case reports. Pediatrics 82, 147-154. Clarren, S. (1986) Neuropathology in fetal alcohol syndrome. In: West, J. (Ed.) Alcohol and Brain Development, pp. 159-166. New York: Oxford University Press Clarren, S., Astley, S., Bowden, D., Lai, H. , Milam, A. , Rudeen, K . and Shoemaker, W. (1990) Neuroanatomic and neurochemical abnormalities in non-human primate infants exposed to weekly doses of ethanol during gestation. Alcohol Clin Exp Res 14, 674-683. Clarren, S. and Smith, D. (1978) The fetal alcohol syndrome. N Engl J Med 29S, 1063-1067. Condon, T.P., Ronnekleiv, O.K. and Kelly, M.J. (1989) Estrogen modulation of the alpha-1-adrenergic response of hypothalamic neurons. Neuroendocrinology 50, 51-58. Corny, J. (1990) Neuropsychological deficits in fetal alcohol syndrome and fetal alcohol effects. Alcohol Clin Exp Res 14, 650-655. Coultron, L. , Dallman, M . and Ganong, W. (1973) Correlation between plasma A C T H and 17-hydroxycorticoid output in stressed dogs. Endocrinology 93, 79A(Abstract) Coyne, M.D. and Kitay, J.I. (1969) Effect of ovariectomy on pituitary secretion of A C T H . Endocrinology 85, 1097-1102. Crawley, J.N., Glowa, J.R., Majewska, M.D. and Paul, S.M. (1986) Anxiolytic activity of an endogenous adrenal steroid. Brain Res Mol Brain Res 398, 382-385. 321 Critchley, M . & Handley, S. (1987) 5-HT 1 A ligand effects in the X-maze anxiety test. Brit JPharm 92, 660P Critchlow, V , Liebelt, R., Bar-Sela, M . , Mountcastle, W. and Lipscomb, H . (1963) Sex difference in resting pituitary-adrenal function in the rat. Am J Physiol 205, 807-815. Dallman, M . , Engeland, W., Rose, J., Wilkinson, C , Shinsako, J. and Siendenburg, F. (1976) Nycthemeral rhythm in adrenal reponsiveness to A C T H . Am J Physiol 235, R210-R218. Dallman, M . , Akana, S., Cascio, C , Darlington, D., Jacobson, L . and Lavin, N . (1987) Regulation of A C T H secretion: Variations on a theme of B. Recent Prog Horm Res 43, 113-167. Dallman, M . and Jones, M . (1973) Corticosteroid feedback control of A C T H secretion: effects of stress induced corticosterone secretion on subsequent stress responses in the rat. Endocrinology 92(5), 1367-1375. Dallman, M . and Yates, F. (1969) Dynamic asymmetries in the corticosteriod feedback path and distribution-metabolism-binding elements of the adrenocortical system. Ann N Y Acad Sci 156, 696-704. Davidson, J., Jones, L . and Levine, S. (1968) Feedback regulation of adrenocorticotropin secretion in 'basal' and 'stress' conditions: Acute and chronic effects of intrahypothalamic corticoid implantation. Endocrinology 82, 655-663. De Souza, E.B., Insel, T.R., Perrin, M.H. , Rivier, J., Vale, W.W. and Kuhar, M.J . (1985) Corticotropin-releasing factor receptors are widely distributed within the rat central nervous system: an autoradiographic study! JNeurosc 5, 3189-3203. De Souza, E. and Insel, T. (1990) Corticotrophin-releasing factor (CRF) receptors in the cat central nervous system: Autoradiographic localization studies. In: De Souza, E. and Nemeroff, C. (Eds.) Corticotrophin-releasing factor: Basic and clinical studies of a neuropeptide, pp. 68-91. New York: CRC Press Dehaene PH, Titran, M . and Charles, A . (1984) Le Devenir a moyen terme de L'enfant de mere alcoolique. Bulletin de la societe francaise d'Alcoologie 4 DeKloet, E. and Reul, J. (1987) Feedback action and tonic influence of cortcosteroids on brain function: a concept arising from heterogeneity of brain receptor system. Psychoneuroendocrinology 12, 83-105. DeKloet, E., Wallach, G. and McEwen, B. (1975) Differences in corticosterone and dexamethasone binding to rat brain and pituitary. Endocrinology 96, 598-609. 322 Demirgoren, S., Majewska, M.D. , Spivak, C.E. and London, E.D. (1991) Receptor binding and electrophysiological effects of dehydroepiandrosterone sulfate, an antagonist of the G A B A A receptor. Neuroscience 45, 127-135. Diamond, D. and Rose, G. (1994) Stress impairs LTP and hippocampal-dependent memory. Ann N YAcad Sci 743, 411-417. Dow, K . and Riopelle, R. (1987) Neurotoxicity of ethanol during prenatal development. Clin Neuropharmacol 10, 330-341. Driscoll, C D . , Chen, J.S. and Riley, E.P. (1982) Passive avoidance performance in rats prenatally exposed to alcohol during various periods of gestation. Neurobehav Toxicol Teratol 4, 99-103. Driscoll, C D . , Riley, E.P. and Meyer, L.S. (1985) Delayed taste aversion learning in preweanling rats exposed to alcohol prenatally. Alcohol 2, 277-280. Druse, M . (1992) Effects of in utero ethanol exposure on the development of neurotransmitter systems. In: Miller, M . (Ed.) Development of the Central Nervous System: Effects of Alcohol and Opiates, New York: Wiley-Liss, Inc Dunn, A. , Beridge, C , Lai, Y . and Yachabach, T. (1987) CRF-induced excessive grooming behavior in rats and mice. Peptides 8, 841-844. Dunn, A . and Berridge, C. (1990) Physiological and behavioral responses to corticotrophin-releasing factor administration: is CRF a mediator of anxiety or stress responses. Brain Res Rev 15, 71-100. Dunn, A . and File, S. (1987) Corticotrophin-releasing factor has an anxiogenic action in the social interaction test. Horm Behav 21, 193-202. Dunn, R., Corbert, R. and Fielding, S. (1989) Effects of 5-HT,A receptor agonists and N M D A receptor antagonist in the social interaction test and the elevated plus-maze. European J Pharm 169, 1-10 Edwardson, J. and Bennett, G. (1974) Modulation of corticotrophin-releasing factor release from hypothalamic synaptosomes. Nature 251, 425-427. Ehlers, C , Henriken, S., Wang, M . , Rivier, J., Vale, W. and Bloom, F. (1983) Corticotrophin releasing factor produces increases in brain excitability and convulsive seizures in rats. Brain Res 278, 332-336. Engeland, W., Shinsako, J. and Dallman, M . (1975) Corticosteroids and A C T H are not required for compensatory adrenal growth. Am J Physiol 229, 1461-1464. •323 Ernhart, C , Sokol, R., Anger, J., Morrow-Tlucak, M . and Martier, S. (1989) Alcohol related birth defects: assessing the risk. Ann N YAcad Sci 562, 159-172. Falter, A. , Gower, A . and Gobert, J. (1992) Resistance of baseline activity in the elevated plus-maze to exogenous influences. Behav Pharm 3, 123-128. Feldman, S. and Weidenfeld, J. (1991) Depletion of hypothalamic norepinephrine and serotonin enhances the inhibitory effects of dexamethasone on the adrenocortical response to either stress. Psychoneuroendocrinolgy 16, 397-405. Fernandez, K. , Caul, W.F., Haenlein, M . and Vorhees, C.V. (1983) Effects of prenatal alcohol on homing behavior, maternal responding and open-field activity in rats. Neurobehav Toxicol Teratol 5, 351-356. File, S. (1987) The contribution of behavioral studies to the neuropharmacology of anxiety. Neuropharmacol 26, 877-886. Fisher, L . (1989) Central autonomic modulation of cardiac baroreflex by corticotrophin-releasing factor. Am J Physiol 256, H949-955. File, S.E., Andrews, N . , Wu, P.Y., Zharkovsky, A . and Zangrossi, H. , Jr. (1992) Modification of chlordiazepoxide's behavioural and neurochemical effects by handling and plus-maze experience. Eur J Pharmacol 218, 9-14. File, S., Johnson, A . and Baldwin, H. (1988) Anxiolytic and anxiogenic drugs: Changes in behavior and endocrine responses. Stress Med 4, 221-230. File, S.E., Vellucci, S.V. and Wendlandt, S. (1979) Corticosterone ~ an anxiogenic or an anxiolytic agent? J Pharm Pharmacol 31, 300-305. Fleischer, N . and Vale, W. (1968) Inhibition of vasopressin-induced A C T H release from the pituitary by glucocorticoids in vitro. Endocrinology 83, 1232-1236. Frederiksen, S., Ekman R., Gottfries, C , Widerlov, E. and Johnson, S. (1991) Reduced concentrations of galanin, arginine vasopressin, neuropeptide Y and peptide Y Y in the temporal cortex but not in the hypothalmus of brains from schizophrenics. Acta Psychiatr Scand83, 273-277. Friedman, J. (1982) Can maternal alcohol ingestion cause neural tube defects? JPediat 101, 232-234. Funder, J. (1986) Adrenocorticoid receptor in the brain. In: Gianong, W. and Martini, E. (Eds.) Frontiers in Neuroendocrinology, pp. 169-189. New York: Raven Press 324 Gaillet, S., Lachuer, J., Malaval, F., Assenmacher, I. and Szafarczyk, A . (1991) The involvement of noradrenergic ascending pathways in the stress-induced activation of A C T H and corticosterone secretions is dependent on the nature of stressors. Exp Brain Res 87, 173-180. Gallo, P. and Weinberg, J. (1981) Corticosterone rhythmicity in rat: interactive effects of dietary restriction and schedule of feeding. JNutr 111, 208-218. Gallo, P. and Weinberg, J. (1982) Neuromotor development and response inhibition following prenatal ethanol exposure. Neurobehav Toxicol Teratol 4(5), 505-513. Gallo, P. and Weinberg, J. (1986) Organ growth and cellular development in ethanol-exposed rats. Alcohol 3, 261-267. Genazzani, A.R. (1975) Proceedings: Relationship between A C T H variations during the menstrual cycle and the adrenal androgen variations. Horm Res 6, 299-300. Gerlach, J. and McEwen, B. (1975) Rat brain binds steroid radio-autography of hippocampus with corticosterone. Science 175, 1133-1334. Gibbs, D. (1986) Vasopressin and oxytocin: hypothalamic modulators of the stress response: A review. Psychoendocrinology 11(2), 131-140. Gibbs, F. (1970) Ciradian variation of ether-induced corticosterone secretion in the rat. Am J Physiol 219, 288-292. Gillies, G., Linton, E. and Lowry, P. (1982) Corticotrophin releasing activity of the new CRF is potentiated several times by vasopressin. Nature 299, 355-357. Glenister, D. and Yates, F. (1961) Sex difference in the rate of disappearance of corticosterone-4-C14 from plasma of intact rats: Further evidence for influence of hepatic delta-4-steroid hydrogenase activity on adrenalcorticoid function. Endocrinology 68, 747-758. Goldberg, M . (1987) Growing up in a bad enviroment. In: Goldberg, M . (Ed.) The Dysmorphic Child: An Orthopedic Perspective, pp. 358-369. New York, N Y : Raven Press Golden, N . , Sokol, R., Kuhnert, B . and Bottoms, S. (1982) Maternal alcohol use and infant development. Pediatrics 70, 931-934. Gonzalez, M.I. and Leret, M . L . (1994) Injection of an aromatase inhibitor after the critical period of sexual differentiation. Pharmacol Biochem Behav 47, 183-186. 325 Goodlett, C., Thomas, J. and West, J. (1991) Long term deficits in cerebeller growth and rotarod performance of rats following "binge like" alcohol exposure during the neonatal brain growth spurt. Neurotoxicol Teratol 13, 69-74. Goodman, H . (1988) (Ed.) Basic Medical Endocrinology, New York: Raven Press Inc. Gordon, B. , Durandin, R., Rosso, P. and Winick, M . (1982) Placental amino acid transport in alcohol fed rats. Fed Proc 41, 946-950. Gray, J., Levine, A.S. and Broadhurst, P. (1965) Gonadal hormone injection in infancy and adult emotional behavior. Anim Behav 13, 33-45. Green, S. (1991) Benzodiazepines, putative anxiolytics and animal models of anxiety. [Review]. Trends Neurosc 14, 101-104. Greene, T., Ernhart, C., Martier, S., Sokol, R. and Ager, J. (1990) Prenatal alcohol exposure and language development. Alcohol Clin Exp Res 14, 937-945. Gunion, M.W. and Tache, Y . (1987) Intrahypothalamic microinfusion of corticotropin-releasing factor inhibits gastric acid secretion but increases secretion volume in rats. Brain Res Mol Brain Res 411, 156-161. Gustafsson, J., Kret, S., Wikstrom, A. , Andersson, B. and Eriksson, H . (1983) Eriksson, H. and Gustafsson, J. (Eds.) Steroid Hormone Receptors: Structure and Function, pp. 335-385. Amsterdam: Elsevier Haas, D.A. and George, S.R. (1988) Gonadal regulation of corticotropin-releasing factor immunoreactivity in hypothalamus. Brain Research Bulletin 20, 361-367. Hannigan, J.H., Blanchard, B .A. and Riley, E.P. (1987) Altered grooming responses to stress in rats exposed prenatally to ethanol. Behav Neural Biol 47, 173-185. Hannigan, J. and Riley, E. (1988) Prenatal ethanol exposure alters gait in rats. Alcohol 5, 451-459. Hanson, J., Jones, K . and Smith, D. (1978) Fetal alcohol syndrome: experience with 41 patients. JAMA 235, 1458 Handely, S.E., Mithani, S. (1984) Effects of alpha-adrenoceptor agonists and antagonists in a maze-exploration model of 'fear'-motivated behaviour. Naunyn-Schmidebergs Arch Pharmacol 327', 1-5. Harbuz, M.S., Chowdrey, H.S., Jessop, D.S., Biswas, S. and Lightman, S.L. (1991) Role of catecholamines in mediating messenger R N A and hormonal responses to stress. Brain Res Mol Brain Res 551, 52-57. 326 Harbuz, M.S. and Lightman, S.L. (1989a) Glucocorticoid inhibition of stress-induced changes in hypothalamic corticotrophin-releasing factor messenger R N A and proenkephalin A messenger RNA. Neuropeptides 14, 17-20. Harbuz, M.S. and Lightman, S.L. (1989b) Responses of hypothalamic and pituitary mRNA to physical and psychological stress in the rat. J Endocrinol 122, 705-711. Harbuz, M.S. and Lightman, S.L. (1992) Stress and the hypothalamo-pituitary-adrenal axis: acute, chronic and immunological activation. [Review]. J Endocrinol 134, 327-339. Harris, S.R., Osborn, J.A., Weinberg, J., Loock, C. and Junaid, K. (1993) Effects of prenatal alcohol exposure on neuromotor and cognitive development during early childhood: a series of case reports. Phy Ther 73, 608-617. Harris, S.R., MacKay, L . L . and Osborn, J.A. (1995) Autistic behaviors in offspring of mothers abusing alcohol and other drugs: a series of case reports. Alcohol Clin Exp Res 19, 660-665. Harrison, N .L . , Majewska, M.D. , Harrington, J.W. and Barker, J.L. (1987) Structure-activity relationships for steroid interaction with the gamma-aminobutyric acidA receptor complex. JPharm Exp Ther 241, 346-353. Hauger, R., Millan, M . , Catt, K. and Aguilera, G. (1987) Differential regulation of brain and pituitary corticotrophin-releasing factor receptors by corticosterone. Endo Soc 120, 1527-1533. Hauger, R., Millan, M . , Lorang, M . , Harwood, J. and Aguilera, G. (1988) Corticotrophin-releasing factor receptors and pituitary adrenal response during immobilization stress. Endocrinology 123, 396-405. Hauger, R., Millan, M . , Harwood, J., Lorang, M . , Catt, K . and Aguilera, G. (1989) Receptors for corticortrophin releasing factor in the pituitary and brain: Regulator effects of glucocorticoids, CRF, and stress. In: Zinder, O. and Bresnetz, S. (Eds.) pp. 3-17. New York: Alan R Liss Inc. Haus, E. (1964) Periodicity in response and susceptibility to environmental stimuli. Ann NYAcad Sci 117, 293-315. Heinrichs, S .C , Menzaghi, F., Pich, E .M. , Baldwin, H.A., Rassnick, S., Britton, K T and Koob, G.F. (1994) Anti-stress action of a corticotropin-releasing factor antagonist on behavioral reactivity to stressors of varying type and intensity. Neuropsychopharmacol 11, 179-186. 327 Heinsbroek, R.P., van Haaren, F. and Van de Poll, N.E . (1988) Sex differences in passive avoidance behavior of rats: sex-dependent susceptibility to shock-induced behavioral depression. Physiol Behav 43, 201-206. Hi l l , R. and Tennyson, L . (1980) A historical review and longitudinal study of an infant with fetal alcohol syndrome. In: Messiha, F. and Tyner, G. (Eds.) Alcoholism: A Perspective, pp. 177-201. Westbury, N Y : Plenium Press Hiroshige, T. and Wada-Okada, S. (1973) Diurnal changes of hypothalamic content of corticotropin-releasing activity in female rats at various stages of the estrous cycle. Neuroendocrinology 12, 316-319. Imaki, T., Shibasaki, T., Hotta, M . and Demura, H . (1992) Early induction of c-fos precedes increased expression of corticotropin-releasing factor messenger ribonucleic acid in the paraventricular nucleus after immobilization stress. Endocrinology 131, 240-246. Imhof, J.T., Coelho, Z . M . , Schmitt, M.L . , Morato, G.S. and Carobrez, A.P. (1993) Influence of gender and age on performance of rats in the elevated plus maze apparatus. Behav Brain res 56, 177-180. Itoi, K. , Suda, T., Tozawa, F., Dobashi, I., Ohmori, N . , Sakai, Y. , Abe, K . and Demura, H . (1994) Microinjection of norepinephrine into the paraventricular nucleus of the hypothalamus stimulates corticotropin-releasing factor gene expression in conscious rats. Endocrinology 135, 2177-2182. Ivell, R. and Richter, D. (1984) Structure and comparison of the oxytocin and vasopressin genes from rat. Proc Natl Acad Sci USA 81, 2006-2010. Izquierdo, I. and Medina, J.H. (1991) G A B A A receptor modulation of memory: the role of endogenous benzodiazepines. [Review]. Trends Pharmacol Sci 12, 260-265. Izquierdo, I. and Medina, J.H. (1995) Correlation between the pharmacology of long-term potentiation and the pharmacology of memory. [Review]. Neurobiol Learn Mem 63, 19-32. Jacobowitz, D. (1988) Multifactorial control of pituitary hormone secretion: The "wheels" of the brain. Synapse 2, 186-192. Jacobson, S., Jacobson, J., Bihun, J., Chiodo, L . and Sokol, R. (1993) Effects of prenatal alcohol exposure on poststress Cortisol levels in infants. Alcohol Clin Exp Res 17, 456(Abstract) 328 Janiri, L . , Gobbi, G., Persico, A. , Stantarelli, M . , Minciacchi, D. and Tempesta, E. (1994) Alterations of neocortical neuronal responses to acetylcholine and G A B A in rats born to alcohol-dependent mothers. Alcohol Alcohol 29, 611-619. Jingami, H. , Mizuno, N . , Takahashi, H. , Shibahara, S., Furutani, Y . , Imura, H . and Numa, S. (1985) Cloning and sequence analysis of cDNA for rat corticotropin-releasing factor precursor. FEBS Lett 191, 63-66. Johnson, M . , Zuck, F. and Wingate, K . (1951) The motor age test measurement of motor handicaps in children with neuromuscular disorders such as cerebral palsy. J Bone Joint Surg [Am] 33, 698-707. Johnson, S., Knight, R., Manner, D. and Steele, R. (1981) Immune deficiency in fetal alcohol syndrome. Pediatr Res 15, 908-911. Johnston, A . L . and File, S.E. (1991) Sex differences in animal tests of anxiety. Physiol Behav 49, 245-250. Jones, K . and Smith, D. (1973) Recognition of the fetal alcohol syndrome in early infancy. Lancet 2, 999-1001. Jones, K. , Smith, D., Ulleland, C. and Streissguth, A . (1973) Pattern of malformation in offspring of chronic alcoholic mothers. Lancet 1, 1267-1271. Jones, M . and Gillham, B . (1988) Factors involved in the regulation of adrenocorticotropin hormone/pMipotropin hormone. Physiol Rev 68, 743-818. Jones, M . , Tiptaft, E., Brush, F., Furgusson, D. and Neame, R. (1974) Evidence for dual corticosteroid-receptor mechanisms in the control of adrenocorticotropic secretion. J Endocrinol 60, 223-233. Jones, M . and Tiptaft, E. (1977) Structure-activity relationship of various corticosteroids on the feedback control of corticotrophin secretion. Br J Pharmacol 59(1), 35-41. Jones, P., Leichter, J. and Lee, M . (1981) Placental blood flow in rats fed alcohol before and during gestation. LifSci 29, 1153-1159. Kakihana, R., Butte, J. and Moore, J. (1980) Endocrine effects of maternal alcoholization: Plasma and brain testosterone, diydrotestosterone, estradiol, and corticosterone. Alcohol Clin Exp Res 1, 57-61. Kaneko, M . , Kaneko, K. , Shinsako, J. and Dallman, M . (1981) Adrenal sensitivity to adrenocorticotropin varies diurnally. Endocrinology 109, 70-75. 329 Kant, G.J., Meyerhoff, J.L., Bunnell, B .N . and Lenox, R.H. (1982) Cyclic A M P and cyclic GMP response to stress in brain and pituitary: stress elevates pituitary cyclic A M P . Pharmacol Biochem Behav 17, 1067-1072. Kant, G.J., Mougey, E.H., Pennington, L . L . and Meyerhoff, J.L. (1983) Graded footshock stress elevates pituitary cyclic A M P and plasma beta-endorphin, beta-LPH corticosterone and prolactin. LifSci 33, 2657-2663. Kant, G.J. (1993) Effects of psychoactive drugs or stress on learning, memory, and performance as assessed using a novel water task. Pharmacol Biochem Behav 44, 287-293. Kant, G., Mougey, E. and Meyerhoff, J. (1986) Diurnal variation of neuroendocrine response to stress in rats: Plasma A C T H , b-LPH, corticosterone, prolactin, and pituitary cyclic A M P reponses. Neuroendocrinology 43, 383-390. Kawano, H. , Daikoku, S. and Shibasaki, T. (1988) CRF-containing neuron systems in the rat hypothalamus: retrograde tracing and immunohistochemical studies. J Comp Neurol 272, 260-268. Keane, B. and Leonard, B. (1989) Rodent models of alcoholism: A review. Alcohol Alcohol 24(4), 299-309. Keller-Wood, M . and Dallman M.F. (1984) Corticosteroid inhibition of A C T H secretion. EndoRevS, 1-24. Keller-Wood, M.E. , Shinsako, J. and Dallman, M.F. (1983a) Feedback inhibition of adrenocorticotropic hormone by physiological increases in plasma corticosteroids in conscious dogs. J Clin Invest 71, 859-866. Keller-Wood, M.E. , Shinsako, J. and Dallman, M.F. (1983b) Inhibition of the adrenocorticotropin and corticosteroid responses to hypoglycemia after prior stress. Endocrinology 113, 491-496. Keller-Wood, M.E. , Wade, C.E., Shinsako, J., Keil , L .C. , van Loon, G.R., Dallman and MF. (1983c) Insulin-induced hypoglycemia in conscious dogs: effect of maintaining carotid arterial glucose levels on the adrenocorticotropin, epinephrine, and vasopressin responses. Endocrinology 112, 624-632. Kelly, S., Mahoney, J. and West, J. (1990) Changes in brain microvasculature resulting from early postnatal alcohol exposure. Alcohol 7,43-47. Kendall, J. (1971) Feedback control of adrenocorticotropic hormone secretion. Neuroendocrinology 1, 177-201. 330 Kennett, G.A., Chaouloff, F., Marcou, M . and Curzon, G. (1986) Female rats are more vulnerable than males in an animal model of depression: the possible role of serotonin. Brain Res Mol Brain Res 382, 416-421. Kitay, J.I. (1963) Effects of estradiol on pituitary-adrenal function in male and females rats. Endocrinology 72, 947-954. Kitay, J. (1961) Sex differences in adrenal cortical secretion in the rat. Endocrinology 68, 818-824. Koch, B. , Bucher, B. and Mialhe (1974) Pituitary retention of dexamethasone and A C T H biosynthesis. Neuroendocrinology 15(6), 365-375. Koob, G. and Britton, K.T. (1990) Behavioral effects of corticortropin-releasing factor. In: De Souza, E. and Nemeroff, C. (Eds.) Corticotropin-Releasing Factor .Basic and Clinical Studies of a Neuropeptide, pp. 235-264. New York: CRC Press Koob, G.F., Heinrichs, S .C, Pich, E .M. , Menzaghi, F., Baldwin, H. , Miczek, K . and Britton, K.T. (1993) The role of corticotropin-releasing factor in behavioural responses to stress. [Review]. Ciba FoundSymp 172, 277-89; discussion 290-5. Kopin, I (1995) Definitions of stress and sympathetic neuronal responses. Ann N Y Acad Sci 771, 19-30. Kotkoskie, L . and Norton, S. (1989) Cerebral cortical morphology and behavior in rats following acute prenatal alcohol exposure. Alcohol Clin Exp Res 13, 776-781. Kovacs, K.J . and Mezey, E. (1987) Dexamethasone inhibits corticotropin-releasing factor gene expression in the rat paraventricular nucleus. Neuroendocrinology 46, 365-368. Kovacs, K.J . and Swachenko, P.E. (1996) Sequence of stress-induced alterations in indices of synaptic and transcriptional activation in parvocellular neurosecretory neurons. JNeurosci 16, 262-273 Krahn, D.D., Gosnell, B.A. , Grace, M . and Levine, A.S. (1986) CRF antagonist partially reverses CRF- and stress-induced effects on feeding. Brain Research Bulletin 17, 285-289. Krahn, D.D., Gosnell, B.A. , Levine, A.S. and Morley, J.E. (1988) Behavioral effects of corticotropin-releasing factor: localization and characterization of central effects. Brain Res Mol Brain Res 443, 63-69. Kraicer, J., Gosbee, J. and Bencomse, S. (1973) Pars intermedia and pars distalis: two site of A C T H production in the rats hypopysis. Neuroendocrinology 11, 156-176. 331 Kurosawa, M . , Sato, A. , Swenson, R. and Takahashi, Y . (1986) Sympatho-adrenal medullary functions in response to intracerbroventricularly injected corticotrophin-releasing factor in anaesthetized rats. Brain Res 367, 250-257. Kyllerman, M . , Aronson, M . , Sabel, K. , Karlberg, E., Sandin, B . and Olegard, R. (1985) Children of alcoholic mothers: growth and motor performance compared to matched controls. Acta Paediatr Scand 74, 20-26. Lake, R.B. and Gann, D.S. (1972) Dynamic response of the intact canine adrenal to infused A C T H . Ann Biomed Eng 1, 56-68. Landesman-Dwyer, S., Keller, L . and Streissguth, A . (1978) Naturalistic observations of newborns: effects of maternal alcohol intake. Alcohol Clin Exp Res 2, 171-177. Landesman-Dwyer, S., Ragozin, A . and Little, R. (1981) Behavioral correlates of prenatal alcohol exposure: a four-year follow up study. Neurobehav Toxicol Teratol 3, 187-193. Le Mevel, J.C., Abitbol, S., Beraud, G. and Maniey, J. (1978) Dynamic changes in plasma adrenocorticotrophin after neurotropic stress in male and female rats. J Endocrinol 76, 359-360. Ledig, M . , Ciesielski, L . , Simler, S., Lorentz, J. and Mandel, P. (1988) Effect of pre-natal and post-natal alcohol consumption on G A B A levels of various brain regions in the rat offspring. Alcohol Alcohol 23, 63-67. Ledig, M . , Simler, S., Ciesielski, L . and Mandel, P. (1993) Alcohol exposure before pregnancy: Effects on G A B A levels and turnover in rat offspring. Alcohol Alcohol 28, 175-179. Lee, C. and Rodgers, R. (1990) Elevated plus-maze: effects od buspirone on antinociception and behaviour. Brit J Pharm 100 (Suppl.), 412P Lee, K. , Kentroti, S. and Vernadakis, A . (1992) Differential sensitivity of cholinergic and GABAergic neurons in chick embryos treated intracerebrally with ethanol at 8 days of embryonic age. Neurochem Res 17, 565-569. Lee, S., Imaki, T., Vale, W. and Rivier, C. (1990) Effects of prenatal exposure to ethanol on the activity of the hypothalamic-pituitary-adrenal axis of offspring: Importance of the time of exposure to ethanol and possible modulating mechanisms. Mol Cell Neurosci 1, 168-177. Lee, S. and Rivier, C. (1993a) Effect of exposure to an alcohol diet for 10 days on the ability of interleukin-1 beta to release A C T H and corticosterone in the adult ovariectomized female rat. Alcohol Clin Exp Res 17, 1009-1013. 332 Lee, S. and Rivier, C. (1993b) Prenatal alcohol exposure blunts interleukin-1-induced A C T H and beta-endorphin secretion by immature rats. Alcohol Clin Exp Res 17, 940-945. Lee, S. and Rivier, C. (1994) Prenatal alcohol exposure alters the hypothalamic-pituitary-adrenal axis response of immature offspring to interleukin-1: is nitric oxide involved? Alcohol Clin Exp Res 18, 1242-1247. Legros, J., Chiodera, P. and Demey-Ponsart, E. (1982) Inhibitory influence of exogenous oxytocin on adrenocorticotropic secretion in normal human subjects. J Clin Endocrinol Metab 55, 1039-1053. Lemoine, P., Harousseau, H. and Borteyru, J. (1968) Children of alcoholic parents: observed anomalies (127 cases). Quest Med 21, 476-482. Leret, M.L . , Molina-Holgado, F. and Gonzalez, M.I. (1994) The effect of perinatal exposure to estrogens on the sexually dimorphic response to novelty. Physiol Behav 55, 371-373. Levine, A. , Rogers, B. , Kneip, J., Grace, M . and Morely, J. (1983) Effects of centrally administered corticotrophin releasing factor (CRF) on multiple feeding paradigms. Neuropharmacol 22, 337-339. Lieber, C. (1983) Microsomal Ethanol Oxidizing System (MEOS): Interaction with ethanol, drugs and carcinogens. Pharmacol Biochem Behav 18, 181-187. Lieber, C. (1986) Metabolism of ethanol and associated interactions with other drugs, carcinogens, and vitamins. N Y State J Med June, 297-302. Lieber, C. (1988) The influence of alcohol on nutritional status. Nutr Rev 46, 241-254. Lieber, C. (1991a) Hepatic, metabolic and toxic effects of ethanol: 1991 update. Alcohol Clin Exp Res 15, 573-592. Lieber, C. (1991b) Perspectives: do alcohol calories count? Am J Clin Nutr 54, 976-982. Lieber, C. and DeCarli, L . (1989) Liquid diet technique of ethanol administration: 1989 Update. Alcohol Alcohol 25, 197-211. Lightman, S.L., Harbuz, M.S., Knight, R.A. and Chowdrey, H.S. (1993) CRF mRNA in normal and stress conditions. [Review]. Ann N Y Acad Sci 697, 28-38. Lightman, S.L. and Harbuz, M.S. (1993) Expression of corticotropin-releasing factor mRNA in response to stress. [Review]. Ciba FoundSymp 172, 173-87; discussion 187-9. 333 Lightman, S.L. and Young, W.S., 3d. (1987a) Changes in hypothalamic preproenkephalin A mRNA following stress and opiate withdrawal. Nature 328, 643-645. Lightman, S.L. and Young, W.S., 3d. (1987b) Vasopressin, oxytocin, dynorphin, enkephalin and corticotrophin-releasing factor mRNA stimulation in the rat. J Physiol 394, 23-39. Lister, R. (1987) The use of a plus-maze to measure anxiety in the mouse. Psychopharmacology 92, 180-185. Little, B. , Snell, L . and Rosenfeld, C. (1990) Failure to recognize fetal alcohol syndrome in newborn infants. Am JDis Child 144, 1142-1146. Lochry, E. and Riley, E. (1980) Retention of passive avoidance and T-maze escape in rats exposed to alcohol prenatally. Neurobehav Toxicol Teratol 2, 107-115. Luine, V , Villegas, M . , Martinez, C. and McEwen, B. (1994) Repeated stress causes reversible impairments of spatial memory preformance. Brain Res 639, 167-172. Lundquist F (1957) The deterimination of ethyl alcohol in blood and tissues. In: Glick, D. (Ed.) Methods of Biochemical Analysis, pp ; 217-251. New York: Interscience Lutz-Bucher, B. , Kartezi, M . , Koch, B. and Makara, G. (1982) Comparative study of CRF-like activities of vasopressin and oxytocin in the Brattleboro rat. In: Baertschi, A . andDreifuss, J. (Eds.) Neurodocrinology of Vasopressin, Corticolibern, and Opiodmelancortins, pp. 273-279. New York: Academic Press Macchi IA and Hechter, O. (1954) Studies of A C T H action upon perfused bovine adrenals:duration of A C T H action. Endocrinology 55, 434-438. Majewska, M.D. (1988) Interaction of ethanol with the G A B A A receptor in the rat brain: possible involvement of endogenous steroids. Alcohol 5, 269-273. Majewska, M.D. (1990) Steroid regulation of the G A B A A receptor: ligand binding, chloride transport and behaviour. [Review]. Ciba FoundSymp 153, 83-97; discussion 97-110. Majewska, M . (1992) Neurosteroids: Endogenous bimodal modulators to the G A B A A receptor. Mechanism of action and physiological significance. Prog Neurobiol 38, 379-395. Majewska, M.D. , Bisserbe, J.C. and Eskay, R.L. (1985) Glucocorticoids are modulators of G A B A A receptors in the brain. Brain Res Mol Brain Res 339, 178-182. 334 Martignoni, E., Costa, A. , Sinforiani, E., Liuzzi, A. , Chiodini, P., Mauri, M . , Bonno, G. and Nappi, G. (1992) The brain as a target for adrenocortical steriods: Cognitive implications. Psychoneuroendocrinology 17, 343-351. Martin, J., Martin, D., Sigman, G. and Radow, B . (1978) Maternal ethanol consumption and hyperactivity in cross-fostered offspring. Physiol Psychol 6, 362-365. Mason, J. (1975a) A historical view of the stress field: Part I. Human Stress 1, 6-12. Mason, J. (1975b) A historical view of the stress field:Part II. Human Stress 1, 22-36. Masur, J., Schutz, M.T. and Boerngen, R. (1980) Gender differences in open-field behavior as a function of age. Develop Psychobiol 13, 107-110. Mattson, S., Riley, E., Jernigan, T., Ehlers, C , Delis, D., Jones, K. , Stern, C , Johnson, K. , Hesselink, J. and Bellugi, S. (1992) Fetal alcohol syndrome: a case report of neuropsychological, MRI, and E E G assessment of two children. Alcohol Clin Exp Res 16, 1001-1003. May, P., Hymbaugh, K. , Aase, J. and Samet, J. (1983) Epidemiology of fetal alcohol syndrome among American Indians of the Southwest. Soc Biol 30, 347-387. McEwen, B. , DeKloet, E. and Rostene, W. (1986) Adrenal steroid receptors and actions in the nervous system. Physiol Rev 66, 1121-1188. Means, L.W., Medlin, C.W., Hughes, V .D . and Gray, S.L. (1984) Hyperresponsiveness to methylphenidate in rats following prenatal ethanol exposure. Neurobehav Toxicol Teratol 6, 187-192. Melcer, T., Gonzalez, D., Barron, S. and Riley, E.P. (1994) Hyperactivity in preweanling rats following postnatal alcohol exposure. Alcohol 11, 41-45. Melia, K.R. and Duman, R.S. (1991) Involvement of corticotropin-releasing factor in chronic stress regulation of the brain noradrenergic system. Proc Natl Acad Sci US ASS, 8382-8386. Meng, I.D. and Drugan, R.C. (1993) Sex differences in open-field behavior in response to the beta-carboline F G 7142 in rats. Physiol Behav 54, 701 -705. Menzaghi, F., Howard, R.L., Heinrichs, S .C, Vale, W., Rivier, J. and Koob, G.F. (1994) Characterization of a novel and potent corticotropin-releasing factor antagonist in rats. J Pharm Exp Ther 269, 564-572. Meyer, L. , Kotch, L . and Riley, E. (1990a) Alterations in gait following ethanol exposure during the brain growth spurts in rats. Alcohol Clin Exp Res 14, 23-27. .335 Meyer, L. , Kotch, L . and Riley, E. (1990b) Neonatal ethanol exposure: functional alterations associated with cerebellar growth retardation. Neurotoxicol Teratol 12, 15-22. Meyer, L.S. and Riley, E.P. (1986) Social play in juvenile rats prenatally exposed to alcohol. Teratology 34, 1-7. Miesfeld, R., Rusconi, S., Godowski, P.J., Maler, B.A. , Okret, S., Wikstrom, A.C. , Gustafsson, J.A. and Yamamoto, K.R. (1986) Genetic complementation of a glucocorticoid receptor deficiency by expression of cloned receptor cDNA. Cell 46, 389-399. Miller, A . , Spencer, R., Pulera, M . , Kang, S., McEwen, B. and Stein, M . (1992) Adrenal steroid receptor activation in rat brain and pituitary following dexamathesone: Implications for the dexamathesone suppression test. Biol Psychiatry 32, 850-869. Molina, J.C., Moyano, H.F., Spear, L.P. and Spear, N.E. (1984) Acute alcohol exposure during gestational day 8 in the rat: effects upon physical and behavioral parameters. Alcohol 1, 459-464. Moloney, B . and Leonard, B. (1984) Pre-natal and post-natal effects of alcohol in the rat-II. Changes in gamma-aminobutyric acid concentration and adenosine triphosphatase in the brain. Alcohol Alcohol 19, 137-140. Monnikes, H. , Heymann-Monnikes, I. and Tache, Y . (1992) CRF iii the paraventricular nucleus of the hypothalamus induces dose-related behavioral profde in rats. Brain Res Mol Brain Res 574, 70-76. Morley, J. and Levine, A . (1982) Corticotrophin releasing factor, grooming and ingestive behavior. LifSci 31, 1459-1464. Montgomery, K . C . (1958) The relation between fear induced by novel-stimulation and exploratory behavior. J Comp Physiol Psychol 48:254-260 Moser, P.C. (1989) A n evaluation of the elevated plus-maze test using the novel anxiolytic buspirone. Psychopharmacology 99, 48-53. Mukherjee, A . and Hodgen, G. (1982) Maternal ethanol exposure induces transient impairment of umbilical circulation and fetal hypoxia in monkeys. Science 218, 100-102. Munck, A . andNaray-Fejes-Toth, A . (1994) Glucocorticoids and stress: permissive and suppressive actions. [Review]. Ann N YAcad Sci 746, 115-30; discussion 131-3. Nanson, J. (1992) Autism in fetal alcohol syndrome: a report of six cases. Alcohol Clin Exp Res 16, 558-565. 336 Negoro, H. , Visessuwan, S. and Holland, R.C. (1973a) Reflex activation of paraventricular nucleus units during the reproductive cycle and in ovariectomized rats treated with oestrogen or progesterone. J Endocrinol 59, 559-567. Negoro, H. , Visessuwan, S. and Holland, R.C. (1973b) Unit activity in the paraventricular nucleus of female rats at different stages of the reproductive cycle and after ovariectomy, with or without oestrogen or progesterone treatment. J Endocrinol 59, 545-558. Nelson, L. , Lewis, J., Liebeskind, J., Branch, B. and Taylor, A . (1983a) Stress induced changes in ethanol consumption in adult rats exposed to ethanol in utero. Proc West Pharmacol 26, 205-209. Nelson, L. , Lewis, J., Liebeskind, J., Kokka, N . , Randolph, D., Branch, B . and Taylor, A . (1983b) Enhanced resposiveness to morphine in adult rats following fetal ethanol exposure. Abstr Soc Neurosci 9, 1242 Nelson, L. , Taylor, A . , Redei, E., Branch, B. and Lewis, J. (1984) Fetal exposure to ethanol enhances corticosterone release to footshock stress. Alcohol Clin Exp Res 8, 109-114. Nelson, L. , Redei, E., Liebeskind, J., Branch, B. and Taylor, A . (1985a) Corticosterone response to dexamethasone in fetal ethanol exposed rats. Proc West Pharmacol 28, 299-302. Nelson, L. , Taylor, A . , Lewis, J., Branch, B. and Liebeskind, J. (1985b) Opioid but not nonopioid stress-induced analgesia is enhanced following prenatal exposure to ethanol. Psychopharmacolgy 85, 92-96. Nelson, L . , Taylor, A . , Lewis, J., Poland, R., Redei, E. and Branch, B . (1986) Pituitary-adrenal responses to morphine and footshock stress are enhanced following prenatal alcohol exposure. Alcohol Clin Exp Res 10, 397-402. Nemeroff, C.B. (1992) New vistas in neuropeptide research in neuropsychiatry: focus on corticotropin-releasing factor. [Review]. Neuropsychopharmacol 6, 69-75. Nemeroff, C.B. and Evans, D.L. (1984) Correlation between the dexamethasone suppression test in depressed patients and clinical response. American Journal of Psychiatry 141, 247-249. Nemeroff, C , Ottenweller, J., Cook, J., Pittman, D., McCarty, R. and Tapp, W. (1988) The role of corticotropin-releasing factor in the pathogenesis of major depression. Pharmacopsychiatry 21, 76-82. 337 Normand, M . , Lalonde, J., Lavoie, M . and Barden, N . (1980) Adrenocortical responses to adrenocorticotrophin in the rat. Can J Physiol Pharmacol 58, 1279-1285. Norton, S., Terranova, P., Yol Na, J. and Sancho-Tello, M . (1988) Early motor development and cerebral cortical morphology in rats exposed to perinatally to alcohol. Alcohol Clin Exp Res 12, 130-136. Olegard, R., Sabel, K. , Aronson, M . , Sandin, B, Johnsson, P., Carlsson, O., Kyllerman, M.Jversen, K and Herbek, A . (1979) Effects on the child of alcohol abuse during pregnancy. Acta Paediatr Scand Suppl 275, 112-121. Olsen, R.W. and Tobin, A.J . (1990) Molecular biology of G A B A A receptors. [Review]. FASEB Journal 4, 1469-1480. Ono, N . , Lumpkin, M . , Samson, W., McDonald, J. and McCann, S. (1984) Intrahypothalamic action of corticotrophin releasing factor (CRF) to inhibit growth hormone and L H release in the rat. LifSci 35, 1117-1123. Ono, N . , Samson, W., McDonald, J., Lumpkin, M . , Bedran de Castro, J. and McCann, S. (1985) Effects of intravenous and intraventricular injection of antisera directed against corticotrophin-releasing factor on the secretion of anterior pituitary hormones. Proc Natl Acad Sci USAS2, 7787-7790. Orth, D. (1979) Adrenocorticotrophin hormone (ACTH). In: Orth, D. (Ed.) Methods of Hormone Radioimmunoassay, 2nd edn. pp. 245-250. New York: Academic Press Osborn, J.A., Kim, C.K., Yu, W.K., Herbert, L . and Weinberg, J. (1996) Fetal ethanol exposure alters pituitary-adrenal sensitivity to dexamethasone suppression. Psychoneuroendocrinology 21, 127-143 Osborn, J., Stelzl, G. and Weinberg, J. (1994) Fetal ethanol effects on adrenal sensitivity to adrenocorticotropic hormone (ACTH). Alcohol Clin Exp Res 18, 407(Abstract) Osborn, J.A., Herbert L. , Zeoller T., Weinberg J. (1995) Fetal ethanol effects on CRF, A V P , GR mRNA levels in the hypothalmus post ether stress. Soc Neurosci 21, 546 (Abstract) Ottenweller, J., Meir, A . , Russo, A . and Frenzlee, M . (1979) Circadian rhythms of plasma corticosterone binding activity in rat and mouse. Acta Endocrinol 91, 150-157. Palkovits, M . (1987) Anatomy of neural pathways affecting C R H secretion. Ann N Y Acad Sci 512, 139-148. 338 Patchev, V . K . , Hayashi, S., Orikasa, C. and Almeida, O.F. (1995) Implications of estrogen-dependent brain organization for gender differences in hypothalamo-pituitary-adrenal regulation. FASEB Journal 9, 419-423. Paxinos, G. and Watson, C. (1986) The Rat Brain in Stereotaxic Coordinates, N Y : Academic Press. Pellow, S., Chopin, P., File, S. and Briley, M . (1985) Validation of openxlosed arm entries in an elevated plus maze as a measure of anxiety in the rat. JNeurosc Method 14, 149-167. Pellow, S. and File, S. (1986) Anxiolytic and anxiogenic drug effects on exploratory activity in an elevated plus-maze: a novel test of anxiety in the rat. Pharmacol Biochem Behav 24, 525-529. Petkov, V.D. , Konstantinova, E.R., Petkov, V . V . and Vaglenova, J.V. (1991) Learning and memory in rats exposed pre- and postnatally to alcohol. A n attempt at pharmacological control. Method Find Exp Clin Pharmacol 13, 43-50. Pfaff, D. and Keiner, M . (1973) Atlas of estradiol-concentrating cells in the central nervous system of the female rat. JComp Neurology 151: 121-158 Pfaff, D. and Zigmond, R. (1971) Neonatal androgen effects on sexual and non-sexual behavior of adult rats tested under various hormone regimes. Neuroendocrinology 7, 129-145. Pierce, D. and West, J. (1986) Blood alcohol concentration: a critical factor for producing fetal alcohol effects. Alcohol 3, 269-272. Pierog, S., Chandavasu, O. and Wexler, I (1977) Withdrawal symptoms in infants with fetal alcohol syndrome. JPediat 90, 630-633. Pirola, R. and Lieber, C. (1972) The energy cost of metabolism of drugs, including ethanol. Pharmacology 7, 185-196. Pirola, R. and Lieber, C. (1976) Energy wastage in alcoholism and drug abuse: possible role of hepatic microsomal enzymes. Am J Clin Nutr 29, 90-93. Pitman, D., Ottenweller, J. and Natelson, B. (1990) Effects of stressor intensity on habituation and sensitization of glucocorticoid responses in rats. Behav Neurosc 104, 28-36. Plotsky, P. (1987) Regulation of hypophysiotropic factor mediating A C T H secretion. Ann NYAcad Sci 512, 205-217. 339 Plotsky, P .M. , Cunningham, E.T., Jr. and Widmaier, E.P. (1989) Catecholaminergic modulation of corticotropin-releasing factor and adrenocorticotropin secretion. [Review]. EndoRev 10, 437-458. Plotsky, P. and Vale, W. (1984) Hemorrhage-induced secretion of corticotrophin-releasing factor-like immunoreactivity into the rat hypophysial portal circulation and its inhibition by glucocorticoids. Endocrinology 114, 164-169. Pratt, O. (1980) The fetal alcohol syndrome: transport of nutrients and transfer of alcohol and acetaldehyde from mother to fetus. In: Sandler, M . (Ed.) Pscholpharmacy of Alcohol, pp. 229-256. New York: Raven Press Ramaley, J.A. (1976) Effects of ovariectomy on dexamethasone suppression of the adrenal axis in adult rats. Neuroendocrinology 20, 260-269. Ranee, N . , Wise, P .M. , Selmanoff, M . K . and Barraclough, C.A. (1981) Catecholamine turnover rates in discrete hypothalamic areas and associated changes in median eminence luteinizing hormone-releasing hormone and serum gonadotropins on proestrus and diestrous day 1. Endocrinology 108, 1795-1802. Randall, C , Becker, H. , Middaugh L. (1986) Effects of prenatal ethanol exposure on activity and shuttle avoidance behavior in adult C57 mice. Alcohol Drug Res 6, 351-360. Randall, C , Taylor, W. and Walker, D. (1977) Ethanol-induced malformation in mice. Alcohol Clin Exp Res 1, 219-224. Raps, D., Barthe, P.L. and Desaulles, P.A. (1971) Plasma and adrenal corticosterone levels during the different phases of the sexual cycle in normal female rats. Experientia 27, 339-340. Rawat, A . K . (1977) Developmental changes in the brain levels of neurotransmitters as influenced by maternal ethanol consumption in the rat. JNeurochem 28, 1175-1182. Redei, E., Clark, W.R. and McGivern, R.F. (1989) Alcohol exposure in utero results in diminished T-cell function and alterations in brain corticotropin-releasing factor and A C T H content. Alcohol Clin Exp Res 13, 439-443. Reul, J. and DeKloet, E. (1986) Anatomical resolution of two types of corticosterone receptor sites in rat brain with in vitro autoradiography and computer image analysis. J Steroid Biochem 24, 269-272. Reul, J. and DeKloet, E. (1985) Two receptor systems for corticosterone in rat brain: microdistribution and differential occupation. Endocrinology 117, 2505-2511. Riley, E., Barron, S., Driscoll, C. and Chen, J. (1984) Taste aversion learning in preweaning rats exposed to alcohol prenatally. Teratology 29, 325-331. 340 Riley, E., Barron, S. and Hannigan, J. (1986) Response inihibition deficits following prenatal alcohol exposure: A comparison to the effects of hippocampal lesions in rats. In: West, J. (Ed.) Alcohol and Brain Development, pp. 71-102. New York: Oxford University Press Riley, E., Lochry, E. and Shapiro, N . (1979a) Lack of response inhibition in rats prenatally exposed to alcohol. Psychopharmacology 62, 47-57. Riley, E. and Meyer, L . (1984) Considerations for the design, implementation, and interpretation of animal models of fetal alcohol effects. Neurobehav Toxicol Teratol 6, 97-101. Riley, E., Shapiro, N . and Lochry, E. (1979b) Nose-poking and head-dipping behavior in rats prenatally exposed to alcohol. Pharmacol Biochem Behav 11, 513-519. Risch, S .C, Janowsky, D.S., Judd, L .L . , Gillin, J .C , Mott, M.A . , Rausch, J.L. and Huey L. (1987) Measurement of A C T H and prolactin in the dexamethasone suppression test. Acta Psychiatr Scand 76, 535-540. Rivier, C , Brownstein, M . , Spiess, J., Rivier, J. and Vale, W. (1982a) In vivo corticotropin-releasing factor-induced secretion of adrenocotropin, B-endorphin, and corticosterone. Endocrinology 110, 272-278. Rivier, C , Rivier, J. and Vale, W. (1982b) Inhibition of adrenocorticotropic hormone secretion in the rat by immunoneutralization of corticotropin-releasing factor. Science 218, 377-379. Rivier, C. and Vale, W. (1985) Influence of corticotropin releasing factor (CRF) on adenohypophysial hormone secretion. Endocrinology 114, 914-921 Rivier, C. and Plotsky, P. (1986) Mediation by corticotrophin releasing factor (CRF) of adenohypophysial hormone secretion. Ann Rev Physiol 48, 475-494. Robinson, G., Conry, J. and Conry, R. (1987) Clinical profile and prevalence of fetal alcohol syndrome in an isolated community in British Columbia. Can Med Assoc J. 137, 203-207. Rochefort, G., Rosenberger, J. and Saffran, M . (1959) Depletion of pituitary corticotrophin by various stresses and by neurohypophyseal preparation. J Physiol 146, 105 Rodgers, R.J. and Cole, J.C. (1993) Influence of social isolation, gender, strain, and prior novelty on plus-maze behaviour in mice. Physiol Behav 54, 729-736. 341 Root, A.W., Reiter, E.O., Andriola, M . and Duckett, G. (1975) Hypothalamic-pituitary function in the fetal alcohol syndrome. JPediat 87, 585-588. Rosett, H. and Weiner, L . (1983) Alcohol and the Fetus: A Clinical Perspective, New York: Oxford University Press. Rosett, H. , Weiner, L. , Lee, A. , Zuckerman, B., Dooling, E., and Oppenheimer, E. (1983) Patterns of alcohol consumption and fetal development. Obstet Gynecol 61, 539-546. Roy-Byrne, P.P., Rubinow, D.R., Gwirtsman, H. , Hoban, M.C. and Grover, G.N. (1986) Cortisol response to dexamethasone in women with premenstrual syndrome. Neuropsychobiol 16, 61-63. Rudeen, P. and Weinberg, J. (1993) Prenatal ethanol exposure: Changes in regional brain catecholamine content following stress. JNeurochem 61, 1907-1915. Saba, G., Saba, A. , Carnicelli, A . and Marescotti, V . (1963) Diurnal rhythm in the adrenal cortical secretion and the rate of metabolism of the corticosterone in the rat. Acta Endocrinol (Copenh) 44, 409-412. Sandberg, A . and Slaunwhite, W. (1959) Transcortin: A corticosteroid-binding protein of plasma II levels in various conditions and effects of estrogens. J Clin Invest 38, 1290-1307. Sandor, G., Smith, D. and MacLeod, P. (1981) Cardiac malformations in the fetal alcohol syndrome. J Pediat 98, 771-773. Sanger, D., Perrault, G., Morel E., Joly D., and Zivkovic, B. (1991) Animal models and recent developments in the search for novel anxiolytics. In: Oliver, B. , Mos, J. and Slanger, J. (Ed.) Animal Models in Psychopharmacology. Advances in Pharmacological Sciences, pp. 3-13. Basel: Birkhauser Sapolsky, R., Krey, L . and McEwen, B. (1984) Glucocorticoid-sensitive hippocampal neurons are involved in terminating the adrencotical stress response. Proc Natl Acad Sci t / S J 81, 6174-6177. Sapolsky, R. (1992) Stress, the Aging Brain, and the Mechanisms of Neuron Death, Cambridge: MIT Press. Savage, D., Paxton, L. , Wu, H . and Allan, A . (1995) Prenatal alcohol exposure alters modulation of G A B A A receptor-chloride channel complex. Alcohol Clin Exp Res 19, 18a( Abstract) Sawchenko, P. and Swanson, L . (1990) Organization of CRF immunoreactive cells and fibers in the rat brain:immunohistochemical studies. In: De Souza, E. and Nemeroff, C. 342 (Eds.) Corticotrophin-releasing factor: Basic and clinical studies of neuropeptide, pp. 29-51. New York: CRC Press Sayer, G. and Sayer, M . (1947) Regulation of pituitary adrenocorticotropic activity during the response of the rat to acute stress. Endocrinology 40, 265-270. Schacter, B. , Johnson, L. , Baxter, J. and Roberts, J. (1982) Differential regulation by glucocorticoids of proopiomelanocortin mRNA levels in the anterior and intermediate lobes of the rat's pituitary. Endocrinology 110, 1442-1447. Schenker, S., Becker, H. , Randal, C , Phillips, D., Baskin, G. and Henderson, G. (1990) Fetal alcohol syndrome: current status of pathogenesis. Alcohol Clin Exp Res 14, 635-647. Schiper, J., Stienbusch, H. , Vermes, I and Tilders, F. (1983) Mapping of CRF immunoreactive nerve fibers in the medulla oblongata and spinal cord of the rat. Brain Res 267, 145-150. Schofield, P.R., Darlison, M.G. , Fujita, N . , Burt, D.R., Stephenson, F.A., Rodriguez, H. , Rhee, L . M . , Ramachandran, J., Reale, V . , and Glencorse, T.A. (1987) Sequence and functional expression of the G A B A A receptor shows a ligand-gated receptor super-family. Nature 328, 221-227. Sencar-Cupovic, I. and Milkovic, S. (1976) The development of sex differences in the adrenal morphology and responsiveness in stress of rats from birth to the end of life. Mech Age Develop 5, 1-9. Selye, H. (1936) A syndrome produced by diverse noxious agents. Nature 32,138 Selye, H. (1973) The evolution of the stress concept. Am Sci 61, 692-699. Shah, K.R. and West, M . (1984) Behavioral changes in rat following perinatal exposure to ethanol. Neurosc Lett 47, 145-148. Sharma, V . and Panwar, M . (1987) Variations in mental performance under moderate cold stress. Int JBiometeor 31, 85-89. Sherman, J. and Kalin, N . (1986) ICV-CRH potently affects behavior without altering antinociceptive responding. LifSci 39, 433-441. Shorey, R. and Erikson, C. (1982) Interaction of dietary protein and ethanol in rats. Fed Proc 41,946-951. Sirinathsinghji, D., Rees, L . , Rivier, J. and Vale, W. (1983) Corticotrophin-releasing factor is a potent inhibitor of sexual receptivity in the female rat. Nature 305, 232-235. 343 Skelton, F.R. and Bernardis, L . L . (1966) Effect of age, sex, hypophysectomy and gonadectomy on plasma corticosterone levels and adrenal weights following the administration of A C T H and stress. Experientia 22, 551-552. Slaunwhite, W., Lockie, G. and Sandberg, A . (1962) Inactivity in vivo of transcortin-bound Cortisol. Science 135, 1062-1063. Slob, A . K . , Bogers, H . and van Stolk, M . A . (1981) Effects of gonadectomy and exogenous gonadal steroids on sex differences in open field behaviour of adult rats. Behav Brain res 2, 347-362. Smith, D., Sandor, G., MacLeod, P., Tredwell, R., Wood, B. and Newmann, D. (1981) Intrinsic defects in the fetal alcohol syndrome: studies on 76 cases from British Columbia and Yukon Territory. Neurobehav Toxicol Teratol 3, 145-152. Sokol, R. and Clarren, S. (1989) Guidelines for use of terminology describing the impact of prenatal alcohol on the offspring. Alcohol Clin Exp Res 13, 587-598. Spencer, R., Young, E., Choo, P. and McEwen, B. (1990) Adrenal steroid type I and type II receptor binding: estimates of in vivo receptor number, occupancy, and activation with varying levels of steroid. Brain Res 514, 37-48. Spencer, R., Kim, P., Cole, M . and Kalman, B. (1995) Dexamethasone suppression of the HPA axis response to acute stress: relationship to estimates of corticosteriod receptor occupancy in brain and pituitary. Society for Neuroscience 21, 177(Abstract) Spiegel, P., Pekman, W., Rich, B. Versteeg, C , Nelson, V . and Dudnikov, M . (1979) The orthopedic aspects of fetal alcohol syndrome. Clin Orthop 139, 58-63. Spinedi, E., Giacomini, M . , Jacquier, M . and Gaillard, R. (1991) Changes in the hypothalamo-corticotropin axis bilateral adrenalectomy: evidence for a median eminence site of glucocorticoid action. Neuroendocrinology 53, 160-170. Steenbergen, H.L., Farabollini, F., Heinsbroek, R.P. and Van de Poll, N .E . (1991) Sex-dependent effects of aversive stimulation on holeboard and elevated plus-maze behavior. Behav Brain res 43, 159-165. Stratakis, C. and Chrousos, A . (1995) Neuroendocrinology and pathophysiology of the stress system. Ann N Y Acad Sci 771, 1-18. Streissguth, A . (1986) The behavioral teratology of alcohol: Performance, behavioral, and intellectual deficits in prenatally exposed children. In: West, J. (Ed.) Alcohol and Brain Development, West JR edn. pp. 3-44. New York: Oxford University Press 344 Streissguth, A. , Aase, J., Clarren, S., Randels, P., LaDue, R. and Smith, D. (1991) Fetal alcohol syndrome in adolescents and adults. JAMA 265, 1961-1967. Streissguth, A. , Barr, H . and Martin, D. (1983) Maternal alcohol use and neonatal habituation assessed with the Brazelton scale. Child Dev 54, 1109-1118. Streissguth, A. , Barr, H . and Sampson, P. (1990) Moderate prenatal alcohol exposure effects on child IQ and learning problems at age 71/2 years. Alcohol Clin Exp Res 14, 662-669. Streissguth, A. , Clarren, S. and Jones; K . (1985) Natural history of the fetal alcohol syndrome: A 10-year follow up of eleven patients. Lancet 10, 85-92. Streissguth, A. , Herman, C. and Smith, D. (1978) Intelligence, behavior and dysmorphologenesis in the fetal alcohol syndrome: a report on 20 patients. J Pediat 92, 363-367. Streissguth, A. , Landesman-Dwyer, S., Martin, J. and Smith, D. (1980) Teratogenic effects of alcohol in humans and laboratory animals. Science 209, 353-361. Streissguth, A . and Ladue, R. (1987) Fetal alcohol teratogenic causes of developmental disabilities. In: Schroeder, S.R. (Ed.) Toxic substances and Mental Retardation: Neurobehavioral Toxicology and Teratorology, pp. 1-32. Washington, DC: American Association on Mental Deficiency Streissguth, A. , Sampson, P. and Barr, H . (1989) Neurobehavioral dose response effects of prenatal alcohol exposure in humans from infancy to adulthood. Ann N Y Acad Sci 562, 145-158. Stromland, K. (1990) Contribution of ocular examination in the diagnosis of fetal alcohol syndrome in mentally retarded children. JMent Defic Res 34, 429-435. Stumpf, W. and Sar, M . (1976) Steroid hormone target cells in the brain: the differential distribution of estrogen, progestin, androgen and glucocorticoid. J Steroid Biochem 7, 1163-1170. Sulik, J. (1983) Sequence of developmental alterations following exposure in mice: craniofacial features of fetal alcohol syndrome. Am JAnat 166, 257-269. Suthers, M . , Pressley, L . and Funder, J. (1976) Glucocorticoid receptors: Evidence for a second non-glucocorticoid binding site. Endocrinology 99, 260-269. Sutton, R., Koob, G., Le Moal, M . , Rivier, J. and Vale, W. (1982) Corticotrophin releasing factor produces behavioral activation in rats. Nature 297, 331-333. 345 Svec, F., Yeakley, J. and Harrison, R. (1980) Progesterone enhances glucocorticoid dissociation from AtT-20 glucocorticoid receptor. Endocrinology 107, 566-572. Swanson, H . (1967) Alterations of sex-typical behavior of hamsters in open field and emergence tests by neonatal administration of androgen or estrogen. Anim Behav 15, 209-216. Swanson, L.W., Sawchenko, P.E., Rivier, J. and Vale, W.W. (1983) Organization of ovine corticotropin-releasing factor immunoreactive cells and fibers in the rat brain: an immunohistochemical study. Neuroendocrinology 36, 165-186. Swanson, L.W. and Simmons, D . M . (1989) Differential steroid hormone and neural influences on peptide mRNA levels in C R H cells of the paraventricular nucleus: a hybridization histochemical study in the rat. JComp Neurol 285, 413-435. Swerdlow, N . , Geyer, M . , Vale, W. and Koob, G. (1986) Corticotrophin-releasing factor potentiates acoustic startle in rat: Blockade by chloriazpoxide. Psychopharmacology 88, 147-152. Swerdlow, N . , Britton, K. and Koob, G. (1989) Potentiation of acoustic startle by corticotrophin-releasing factor (CRF) and by fear are both reversed by alpha-helical CRF (9-41). Neuropsychopharmacol 2, 285-292. Tache, Y . , Gunion, M . and Stephens, R. (1990) CRF: Central nervous system action to influence gastriointestinal function and role in the gastrointestinal response to stress. In: De Souza, E. and Nemeroff, C. (Eds.) Corticotrophin-Releasing Factor: Basic and Clinical Studies of a Neuropeptide, pp. 299-307. New York: CRC Press Takebe, K. , Kunita, H. , Sanamura, M , Horiuchi, Y . and Machimo, K . (1971) Suppressive effect dexamethasone on the rise of CRF activity in the median eminance induced by stress. Endocrinology 89, 1014-1019. Tarn, B. and Greer, M . (1982) Evidence that episodic A C T H secretion has physiological significance in the regulation of adrenocortical secretion. Endocrinology 110, 278A(Abstract) Taya, K . and Sasamoto, S. (1989) Inhibitory effects of corticotrophin releasing factor and (3-endorphin on L H and FSH secretion in lactating rat. J Endocrinol 120, 509-515. Taylor, A. , Branch, B. , Kokka, N . and Poland, R. (1983) Neonatal and long term neuroendocrine effects of fetal alcohol exposure. Monogr Neural sci 9, 140-152. 346 Taylor, A. , Branch, B., Lui , S., Weichmann, A. , Hi l l , M . and Kokka, N . (1981) Fetal exposure to ethanol enhances pituitary-adrenal and temperature responses to ethanol in adult rats. Alcohol Clin Exp Res 5, 237-246. Taylor, A. , Branch, B., Lui , S. and Kokka, N . (1982) Long term effects of fetal ethanol exposure on pituitary-adrenal response to stress. Pharmacol Biochem Behav 16, 585-589. Taylor, A. , Branch, B., Nelson, L. , Lane, L . and Poland, R. (1986a) Prenatal ethanol and ontogeny of pituitary-adrenal responses to ethanol and morphine. Alcohol 3, 255-259. Taylor, A. , Branch, B. , Randolph, D., Hi l l , M . and Kokka, N . (1987) Prenatal ethanol exposure affects tempurature responses of adult rats to pentobarbital and diazepam alone and in combination with ethanol. Alcohol Clin Exp Res 11, 254-260. Taylor, A. , Branch, B., Van Zuylen, J. and Redei, E. (1986b) Prenatal ethanol exposure alters A C T H stress response in adult rats. Alcohol Clin Exp Res 10, 120-124. Taylor, A. , Branch, B.J., Van Zuylen, J.E. and Redei, E. (1988) Maternal alcohol consumption and stress responsiveness in offspring. [Review]. Adv Exp Med Biol 245, 311-317. Turner, B . and Weaver, D. (1985) Sexual dimorphism of glucocorticoid binding in rat brain. Brain Res 343, 16-23. Uht, R., Thompson, R., Douglass, J. and McKeivy, J. (1989) Changes in CRF mRNA levels following adrenalectomy. In: Anonymous Molecular Biology of Stress, pp. 49-55. New York: Alan R. Liss, Inc Umbreit, J. and Ostrow, L. (1980) The fetal alcohol syndrome. Ment Retard 18, 109-111. Unger, F. (1964) In vitro studies of adrenal-pituitary circadian rhythm in the mouse. Ann NYAcad Sci 117,374-385. Usowicz, A. , Golabi, M . and Curry, C. (1986) Upper airway obstruction in infants with fetal alcohol syndrome. Am JDis Child 140, 1039-1041. Valentino, R.J. and Foote, S.L. (1987) Corticotropin-releasing factor disrupts sensory responses of brain noradrenergic neurons. Neuroendocrinology 45, 28-36. Valentino, R.J. and Foote, S.L. (1988) Corticotropin-releasing hormone increases tonic but not sensory-evoked activity of noradrenergic locus coeruleus neurons in unanesthetized rats. JNeurosc 8, 1016-1025. Vamvakopoulos, N .C . and Chrousos, G.P. (1993) Structural organization of the 5' flanking region of the human corticotropin releasing hormone gene. DNA Seq 4, 197-206. 347 Veldhuis, H . and De Wied, D. (1984) Differential behavioral actions of corticotrophin releasing factor (CRF). Pharmacol Biochem Behav 21, 707-713. Viau, V . and Meaney, M.J. (1991) Variations in the hypothalamic-pituitary-adrenal response to stress during the estrous cycle in the rat. Endocrinology 129, 2503-2511. Vorhees, C.V. and Fernandez, K . (1986) Effects of short-term prenatal alcohol exposure on maze, activity, and olfactory orientation performance in rats. Neurobehav Toxicol Teratol 8, 23-28. Waltman, R. and Iniquez, E. (1972) Placental transfer of ethanol and its elimination at term. Obstet Gynecol 40, 180-185. Waremboug, M . (1975) Radioautographic study of the rat and pituitary after injection of 3 H dexamethasone. Cell Tissue Res 161, 183-191. Warner, R. and Rosett, H . (1975) The effects of drinking on offspring: an historical survey of American and British literature. J Stud Alcohol 36, 1395-1420. Watts, A . G . Ether anesthesia differentially affects the content of prepro-corticotropin-releasing hormones, prepro-neurotensin/neuromedin N and prepro-enkrphalin mRNAs in the hypothalamic paraventricular nucleus of the rat. Brain Res 544: 353-357 Weichsel, M.J . (1977) The therapeutic use of glucocorticoid hormones in the perinatal period: potential neurological hazards. Ann Neurol 2, 364-366. Weiland, N .G. and Wise, P .M. (1989) Diurnal rhythmicity of beta-1- and beta--adrenergic receptors in ovariectomized, estradiol-treated and proestrous rats. Neuroendocrinology 50, 655-662. Weinberg, J. (1984) Nutritional issues in perinatal alcohol exposure. Neurobehav Toxicol Teratol 6, 261-269. Weinberg, J. (1985) Effects of ethanol and maternal nutritional status on fetal development. Alcohol Clin Exp Res 9, 49-55. Weinberg, J. (1988) Hyperresponsiveness to stress: Differential effects of prenatal ethanol on males and females. Alcohol Clin Exp Res 12, 647-652. Weinberg, J. (1989) Prenatal ethanol exposure alters adrenocortical development of offspring. Alcohol Clin Exp Res 13, 73-83. Weinberg, J. (1992a) Prenatal ethanol exposure alters adrenocortical response to predictable and unpredicitable stressors. Alcohol 9, 427-432. 348 Weinberg, J. (1992b) Prenatal ethanol effects: Sex differences in offspring stress responsiveness. Alcohol 9, 219-223. Weinberg, J. and Bezio, S. (1987) Alcohol induced changes in pituitary-adrenal activity during pregnancy. Alcohol Clin Exp Res 11,247-280. Weinberg, J. and Gallo, P. (1982) Prenatal exposure: Pituitary-adrenal activity in pregnant dams and offspring. Neurobehav Toxicol Teratol 4, 515-520. Weinberg, J., Nelson, L . and Taylor, A . (1986) Hormonal effects of fetal alcohol exposure. In: West, J. (Ed.) Alcohol and Brain Development, pp. 310-342. New York: Oxford University Press Weinberg, J. and Petersen, T. (1991) Effects of prenatal ethanol exposure on glucocorticoid receptors in rat hippocampus. Alcohol Clin Exp Res 15, 711-716. Weinberg, J., Taylor, A . and Gianoulakis, A . (1996) Fetal ethanol exposure hypothalamic-pituitary-adrenal and P-endorphin responses to repeated stress. Alcohol Clin Exp Res 20, 122-31 West, J. (1987) Fetal alcohol-induced brain damage and the problem of determining temporal vulnerability: a review. Alcohol 7, 423-441. West, J., Goodlett, C., Bonthius, D. and Pierce, D. (1989) Manipulating peak blood alcohol concentrations in neonatal rats: review of an animal model for alcohol related developmental effects. Neurotoxicology 10, 347-366. Widmaire, E. and Dallman, M . (1983a) Fast inhibition of stimulated A C T H secretion by corticosterone does not require protein synthesis. Endocrinology 112A, 90-96. Widmaire, E. and Dallman, M . (1983b) Rapid inhibition and stimulation of A C T H by glucocorticoids in vitro. Fed Proc 42, 458-464. Widmaire, E. and Dallman, M . (1984) The effects of corticotrophin-releasing factor on adrenocorticotropic secretion from perfused pituitaries in vitro: rapid inhibition by glucocorticoids. Endocrinology 115, 2368-2374. Wiener, S. (1980) Nutritional considerations in the design of animal models of fetal alcohol syndrome. Neurobehav Toxicol Teratol 2, 175-179. Wiener, S., Shoemaker, W., Koda, L. and Bloom, F. (1981) Interaction of ethanol and nutrition during gestation: influence on maternal and offspring development in rats. J Pharm Exp Ther 216, 572-579. 349 Wilkinson, C , Shinsako, J. and Dallman M.F. (1979) Daily rhythms in adrenal responsiveness to adrenocorticotropin are determined primarily by the time of feeding in the rat. Endocrinology 104, 350-359. Wilkinson, C , Engeland, W., Shinsako, J. and Dallman, M . (1981) Nonsteroidal adrenal feedback decracates two types of pathways to C R F - A C T H release. Am Physiol Soc 240, E136-E145. Wilson, M . (1992) Influences of the hormonal milieu on acute and chronic benzodiazepine responses in rats. In: Watson, R. (Ed.) Drugs of abuse and neurobiology, pp. 209-231. Ann arbor: CRC Press Wilson, M . , Greer, S. and Greer, M . (1983) Nycterohemeral difference in inhibition of stress-induced A C T H in adrenalectomized rats. Am J Physiol 244, E l 86-189. Wilson, T., Paulsen, R., Padgett, K . and Mildbrandt, J. (1992) Participation of non-zinc finger residues in D N A binding by two nuclear orphan receptors. Science 256, 107-110. Wixson, S., Murry, K . and Huges, H.J. (1987) A technique for chronic arterial catheterization in the rat. Lab Animal Sci 37, 108-110. Wynn, P., Aguilera, G., Morrell, J. and Catt, K. (1983) Properties and regulation of high affinity pituitary receptors for corticotrophin-releasing factor. Biochem Biophys Res Commun 110, 602-608. Yates, F., Russell, S., Dallman, M . , Hedge, G., McCann, S. and Dhariwal, A . (1971) Potentiation by vasopressin of corticotrophin release induced by corticotrophin-releasing factor. Endocrinology 88, 3-15. Young, W.S., 3d, Mezey, E. and Siegel, R.E. (1986) Quantitative in situ hybridization histochemistry reveals increased levels of corticotropin-releasing factor mRNA after adrenalectomy in rats. Neurosc Lett 70, 198-203. Yu, C , Osborn, J.A., Ellis, L . , Yu, W.K. and Weinberg, J. (1996) Effects of prenatal ethanol exposure on the responsiveness of the anterior pitutiary to CRF stimulation. Alcohol Clin Exp Res 20, 400 Zatz, M . and Reisine, T. (1985) Lithium induces corticotrophin secretion and desensitization in cultured anterior pituitary cells. Proc Natl Acad Sci USAS2, 1286-1290. Zaunschirm, A . and Muntean, W. (1984) Fetal alcohol syndrome and malignant disease. EurJPediatr 141,256 350 Zimmerberg, B. , Drucker, P.C. and Weider, J .M. (1995) Differential behavioral effects of the neuroactive steroid allopregnanolone on neonatal rats prenatally exposed to alcohol. Pharmacol Biochem Behav 51, 463-468. Zimmerberg, B . and Farley, M.J. (1993) Sex differences in anxiety behavior in rats: role of gonadal hormones. Physiol Behav 54, 1119-1124. Zoeller, R.T. and Rudeen, P.K. (1992) Ethanol blocks the cold-induced increase in thyrotropin-releasing hormone mRNA in paraventricular nuclei but not the cold-induced increase in thyrotropin. Brain Res Mol Brain Res 4, 321-330. 351 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0088064/manifest

Comment

Related Items