Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Construction and characterization of tpr and prT single and double mutants of Porphyromonas gingivalis… Wan, Steven 1997

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1997-0492.pdf [ 6.56MB ]
Metadata
JSON: 831-1.0087978.json
JSON-LD: 831-1.0087978-ld.json
RDF/XML (Pretty): 831-1.0087978-rdf.xml
RDF/JSON: 831-1.0087978-rdf.json
Turtle: 831-1.0087978-turtle.txt
N-Triples: 831-1.0087978-rdf-ntriples.txt
Original Record: 831-1.0087978-source.json
Full Text
831-1.0087978-fulltext.txt
Citation
831-1.0087978.ris

Full Text

Construction and Characterization of tpr and prtT single and double mutants of Porphyromonas gingivalis W83 by Steven Wan B.Sc, The University of British Columbia, 1994 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENT FOR THE DEGREE OF MASTER OF SCIENCE in THE FACULTY OF GRADUATE STUDIES (Department of Microbiology & Immunology) We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH COLUMBIA July 1997 © Steven Wan, 1997 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department The University of British Columbia Vancouver, Canada DE-6 (2/88) ABSTRACT D N A and amino acid sequence data show remarkable homologies between many Arg-X active proteases produced by P. gingivalis. Among the proteases sequenced thus far, only the Tpr and PrtT do not exhibit significant homologies to any other Arg-X proteases or with each other. This finding suggested that Tpr and PrtT might play unique roles in the growth and metabolism of P. gingivalis. In this investigation, we analyzed the effects of allelic replacement mutagenesis of prtT, tpr and both prtT and tpr on growth, proteolytic activity and hemagglutination of P. gingivalis in media of varying nutritional composition. Comparison of wild type and mutant strains revealed that the growth rates of prtT'mutants were more significantly reduced in nutritionally rich (BSA-supplemented) media than in nutritionally poor (gelatin-supplemented) media. The growth rates of the tpr mutants were more significantly reduced in poorer media than in richer media. The Arg-X (BAPNA-hydrolyzing) activity of wild type and mutant strains was nutrient- and growth phase-dependent. The prtT mutants produced lower protease activity in all protein-supplemented media during early-log phase, but levels similar to that of wild type during late-log phase. The tpr mutants produced lower protease activity during initial phases of growth in protein supplemented media as well as in nutritionally poor media during late-log phase. The relative magnitude of hemagglutination activity reduction for Tpr- and PrtT-deficient mutants was directly proportional to the relative level of reduction in BAPNA-hydrolyzing activity during initial phases of growth. Quantitative messenger RNA studies showed that prtT mRNA was expressed at a higher level during early-log phase in nutritionally rich media, and that the tpr mRNA was expressed at a higher level in nutritionally poor media in late-log phase. These results suggest that PrtT protease may play an important role during early-log phase growth in nutritionally rich (BSA-supplemented) media and Tpr may be important during late-log phase growth in nutritionally poor (gelatin-supplemented) media. Both may play a direct or indirect roles in hemagglutination. ii TABLE OF CONTENTS Page A B S T R A C T ii LIST OF TABLES vi LIST OF FIGURES vii ABBREVIATIONS, NOMENCLATURE and SYMBOLS viii ACKNOWLEDGMENTS ix INTRODUCTION 1 1. The normal flora 1 2. Oral ecology and the oral flora 1 3. Periodontal disease 6 3.1 Porphyromonas gingivalis 8 3.1.1 Disease mechanisms of P. gingivalis 8 3.1.2. Host factors in periodontal disease 9 3.1.3 P. gingivalis factors in periodontal disease 10 a) Growth and metabolism 10 b) Capsule 12 c) Lipopolysaccharide (LPS) 13 d) Outer membrane vesicles 13 e) Fimbriae 14 f) Hemagglutinin 14 g) Proteases 15 3.2 Molecular genetics of the E. coli-Bacteroides shuttle vector system 21 MATERIALS AND METHODS 23 Strains, DNA and culture conditions 23 iii Cloning of the prtT gene by Polymerase Chain Reaction (PCR) 25 Construction of pSWl expression vector 25 Expression of the T7-tag-PrtT fusion protein 26 Suicide plasmid (pSW3) construction 26 Conjugation 29 Southern (DNA) hybridization 30 Preparation of membrane extracts 30 Arg-X-specific activity assays 31 SDS-PAGE and gelatin-substrate zymography 31 Western blot immunoassay 32 Hemagglutination assay 32 Northern (RNA) analysis 33 RESULTS 34 1. Construction of tpr and prtT single and double mutants 34 1.1 Cloning of the prtT gene by Polymerase Chain Reaction 34 1.2 Identification of the PCR product 34 1.3 Expression of the T7-PrtT fusion protein 37 1.4 Suicide plasmid (pSW3) construction 40 1.5 Conjugation 40 1.6 Isolation of putative single and double mutants 41 1.7 Verification of mutation 42 2. Mutant characterization studies 46 2.1 Growth rates of mutants in different media 46 2.2 Cell surface-associated Arg-X activity 48 2.3 Gelatin-substrate zymography 51 2.4 Cell surface-associated hemagglutinating activity 55 iv 2.5 Survey of cell surface-associated proteins 57 2.6 Northern (RNA) analysis of prtT 57 D I S C U S S I O N 63 1. Wild type characteristics 64 1.1 Growth rate 64 1.2 Arg-X activity 66 1.3 Hemagglutinating activity 67 2. Mutant characteristics 69 2.1 Growth rate 69 2.2 Arg-X activity 71 2.3 Hemagglutinating activity 74 2.2 Summary 78 3.3 Future work 79 R E F E R E N C E S 82 v LIST OF TABLES Table Page 1. Microorganisms associated with gingival health and disease 3 2. Predisposing factors in periodontal disease 5 3. Cloned and sequenced genes of Porphyromonas gingivalis 18 4. Bacterial strains and plasmids 24 5. Growth rates of P. gingivalis strains in selected media 47 6. Effects of growth conditions and growth phase on Arg-X activity 49 7. Effects of growth conditions and growth phase on hem agglutinating activity 5 6 vi LIST OF FIGURES Figures Page 1. The periodontium in health and disease 7 2. Comparison of Arg-X protease genes of P. gingivalis 19 3. Construction of pSWl 27 4. Construction of suicide plasmid (pSW3) 28 5. PCR amplification of p/tTgene 35 6. Comparison between prtT gene sequence and PCR product sequence 36 7. T7-PrtT fusion protein expression... 38 8. Detection of rT7-PrtT by Western blot 39 9. Possible homologous recombination between pSW3 and P. gingivalis chromosome 43 10. Verification of tpr and prtT mutations by Southern analysis 44 11. Arg-X activity of mutants throughout the growth cycle in T Y E media 50 12. Gelatin-substrate zymograms of P. gingivalis strains 53 13. SDS-PAGE gel of reduced and denatured crude membrane samples of P. gingivalis strains 58 14. SDS-PAGE gel of non-reduced and non-denatured crude membrane samples of P. gingivalis strains 59 15. Northern blot analysis of prtT expression 61 16. Arg-X and hemagglutinating activity of prtT single mutant 62 vii ABBREVIATIONS, NOMENCLATURE and SYMBOLS Ap Ampicillin BHI Brain heart infusion broth BSA Bovine serum albumin 0.5BSA 0.2% BSA in 0.5TYE media BCIP 5-bromo-4-chloro-3-indolyl phosphate Em erythromycin 0.5Gelatin 0.2% gelatin into 0.5TYE media G , C guanine and cytosine L B Luria-Bertani medium LPS lipopolysaccharide NBT nitroblue tetrazolium prtT::ATcR prtT gene inserted with tetracycline resistance gene SOD superoxide dismutase SDS sodium docedyl sulphate TBS Tris-buffered saline TSM prtT single mutant T D M tpr prtT double mutant TcR tetracycline resistance gene TYE Trypticase peptone-Yeast extract media 0.5TYE T Y E media with trypticase-peptone reduced to 0.5%(W/V) W83 Wild type P. gingivalis strain used in this study to construct mutants W83/PM tpr single mutant viii ACKNOWLEDGMENTS I would like to thank my supervisor Dr. Barry C. McBride for his support and encouragement. I would also like to thank other members of the laboratory, Pauline Hannam, Dr. Chris Fenno, Grace Wong, Benjamin and Wen Lu for their assistance in completing this project. In addition, I would like to thank Dr. Tony Warren and Dr. Tom Beatty for serving on my thesis committee. ix INTRODUCTION 1. The normal flora: The human body is home to thousands of species of micro-organisms. The skin, respiratory tract and digestive tract are inhabited by large numbers of micro-organisms. These microbial communities are important contributing factors in health and disease. In healthy individuals, the flora lives in harmony with the host and serves as the primary defensive barrier against foreign microbial invaders (35). The indigenous flora that occupy the various habitats of our body have selective advantages over most newcomers in the competition for nutrients and sites of colonization. Intense inter-species competition within these communities also prevents the domination of any potential opportunist pathogen species within the normal flora population. However, if the environmental conditions or the state of immune competence change, the balance of microbial population may be altered such that they may become less likely to fend off invading bacteria or keep opportunistic pathogens at bay (35, 162). Foreign pathogenic microbes may easily gain a greater foothold in sites previously occupied by normal flora or certain members of the normal flora may increase in numbers and develop opportunistic infections. 2. Oral ecology and the oral flora The complex relationship between the normal flora and the host is also evident in the human oral cavity. The mouth is populated with its own characteristic flora. The oral cavity provides one of the most diverse micro-habitats in the body and supports the growth of many microbial communities and hundreds of different microbial species (95). The dental plaque is one of the densest collections of complex microflora in the human body, comprising more than 350 microbial species (162). In healthy individuals, nearly two thirds of total flora consist of Gram-positive and facultative anaerobic species (Table 1). Filamentous forms, small spirochetes, fusiforms and motile rods constitute the remaining fraction (165). The distribution of each type of bacteria in the mouth is determined by the environmental conditions afforded at each anatomic site. Each microbial community establishes itself in sites where the bacteria can satisfy their nutritional 1 requirements and avoid inhibitory or adverse conditions. The composition and properties of oral flora in different habitats is determined by the temperature, pH, oxygen tension, nutrient availability and presence of host defenses at each site (95, 111). The ecological conditions within the mouth, or even within the confined quarters of the gingival sulcus are often very unstable. The oral ecosystem/flora often experience considerable variation due to changes in environmental conditions or host immunocompetence (95). As the oral micro-environment changes, exogenously acquired pathogens or endogenously acquired opportunist pathogens may proliferate and come to dominate ecological niches previously occupied by the normal flora (112). The emergence of specific groups of micro-organisms in the oral flora has been associated with onset of the periodontal disease. The progression of periodontal diseases is associated with a gradual replacement of gram-positive and facultative anaerobic species seen in health to greater proportions of gram-negative, anaerobic, and motile microorganisms (Table 1). Specific members of the gram-negative anaerobic population have been implicated in the destruction of periodontal tissues (20, 22, 29, 88, 90, 165, 166, 167, 198). Currently, it is unclear whether specific members of gram-negative anaerobic population are exogenously acquired pathogens or endogenously derived from the oral flora. Studies on the potential mode of transmission of specific oral species have been performed using serial-dilution culturing techniques, but these studies have been limited by technical difficulties in detecting low levels of bacteria in the midst of vast numbers of other oral flora species. Recent developments in species-specific oligodeoxynucleotide probes for 16S ribosomal R N A gene sequences (28), indirect immunofluorescence (79, 171), ELISA (31), and polymerase chain reaction (PCR) techniques have increased the sensitivity of detecting specific bacterial species from plaque samples by at least 1000-fold compared to anaerobic culturing methods (80). The precise cause for the transition in the composition of the oral flora during the development of periodontal disease is unclear. However, a number of microbial or host-derived factors are 2 Table 1: Microorganisms associated with gingival health and disease Health / Disease Predominant microorganisms Comments Health Streptococcus sanguis Streptoccocus mitis Streptococcus oralis Staphylococcus epidermidis Actinomyces viscosus A. naeslundii Veillonella spp. small spirochetes About 66% Gram-positive cocci with few spirochaetes and motile rods Gingivitis Streptococcus sanguis Streptococcus milleri Actinomyceisraelii A. naeslundii Fusobacterium nucleatum Porphyromonas intermedius Captnocytophaga spp. Veillonella spp. Gram-positve cocci gradually replaced by increasing numbers of filaments, fusiform bacilli, vibrios and spirochaetes Periodontitis Porphyromonas gingivalis Porphyromonas intermedius Treponema spp. Bacteroides forsythus A. actinomycetemcomitans Campylobacter rectus F. nucleatum Eubacerium spp. Eikenella corrodens Wolinella recta About 75% of cells are Gram-negative (90% strict anaerobes). Motile rods and spirochaetes are prominant Adapted from Macfarlane, T.W.1989. Clinical Oral Microbiology, ed. 4 W.B. Saunders, Philidelphia. 3 believed to contribute to environmental changes in the mouth which lead to changes in the oral microbial community. Products of microbial metabolic activity can modify the physical and biochemical properties of the oral environment (95). The development of dental caries, for instance, has been shown to result in changes in nutrient availability, pH and oxidation-reduction potential in localized sites due to the accumulation of bacterial metabolic products (145, 162,171). Similarly, the prolonged accumulation of plaque along the gum margin is believed to result in structural and chemical changes which in turn initiate the selection of the microbial community found in periodontal diseases (95,112). Numerous epidemiological studies around the world have shown that periodontal disease is associated with poor oral hygiene and/or the build up of bacterial plaque (112). Subgingival plaque accumulation inhibits the flushing action of saliva and crevicular fluid. As a result, the concentration of organic acids produced by bacterial metabolism increases and the subgingival micro-environment becomes increasingly anaerobic. Superimposed on this background is the complex array of new sources of endogenously-derived nutrients and growth factors including host immune proteins, tissue proteins and vitamins now available to support nutritionally-demanding bacterial populations. The creation of such unique micro-environments within the gingival sulcus imposes new selection pressures which would favor only those species that can adapt to these conditions. Although plaque accumulation has been associated with periodontal diseases, not all individuals with plaque develop periodontal diseases. In addition, many who do develop certain forms of periodontal diseases do not have excess plaque buildup (95, 111). Thus, a variety other factors are believed to be involved in the development of periodontal diseases. Host factors such as age, diet, stress, hormonal levels and genetics may predispose certain individuals to the development of periodontitis (95, 112). However, due to the preponderant effects of microbial factors in all individuals, the significance of these predisposing factors is unfortunately not clear. Nevertheless, these factors are believed to at least contribute to ecological changes and shaping the proportions of microbial community by altering the integrity of host tissue and/or host defense mechanisms (Table 2). Host factors may specifically effect the production of immunoglobulins 4 Table 2: Predisposing factors to periodontal diseases: Factors Specific factors and effects Age Periodontal disease become more prevalent with increasing age; perhaps due to prolonged exposure and accumulation of plaque. Diet Vitamin A, B and C deficiency associated with abnormalitites in periodontal epithelium, connective tissue and bone. Concurrent systemic AIDS, leukemia, neutropenia and anemias are associated disorders with reduced host immunocompetence. Heavy metal and drug intoxication also believed to reduce host resistance against infection. Mechanical and chemical Mastication of fibrous or coarse foods, vigorous trauma toothbrushing and certain dental procedures breach host epithelial tissues and expose bacterial antigens to host immune response. Excessive smoking. Hormonal imbalance Incidence of gingivitis increases during puberty, pregnancy and menopause, and in diabetic patients. Periodontal lesions are exacerbated by epinephrine and norepinepherine production due to stress. Genetics Certain genetic mutations (Acatalasemia, hypophosphatasia) are believed to alter biochemical composition or anatomical arrangement of periodontal tissues. Down syndrome individuals experience abnormally high incidence of periodontitis. Adapted from Newman, M . G. 1988. Oral Microbiology and Immunology, ed. 4 W. B. Saunders, Philidelphia. 5 and complement factors in gingival crevicular fluid, thereby potentially modulating the types and numbers of microorganisms in the gingival sulcus through inhibition of colonization or lysis (71, 112). Various microbial or host derived factors may also alter the production of the adhesive protein, fibronectin, found on the mucosal surfaces of epithelial cells in the oral cavity (35). The presence of fibronectin may be important in determining the nature of the bacterial flora in the mouth. Fibronectin shows strong attachment predilection for Gram-positive organisms. In patients with poor general health, fibronectin production on mucosal cell surfaces are reduced (35). With low levels of this protein, Gram-positive organisms are displaced in favor of Gram-negatives because fibronectin-deficient mucosal cells now favor the attachment of Gram-negative organisms by revealing receptors for gram-negative adhesins such pili or fimbriae (63). 3. Periodontal Disease: Periodontal disease is a general term used to describe a number of inflammatory diseases associated with the periodontium of the human oral cavity. The periodontium consists of the gingiva, periodontal ligament, root cementum and the alveolar bone (Fig. 1). In healthy individuals, the gingival tissue is pale pink in color, firm and forms a tight margin along the gingival-enamel interface (112). In periodontal disease, however, the gingiva changes in color, form, and position. The most common periodontal diseases are gingivitis and periodontitis. Gingivitis is characterized by the inflammation of gingival tissues with no adverse effects on the underlying alveolar bone and periodontal ligament (12, 112). Clinically, the gingivae of gingivitis patients often appear red, glossy and enlarged locally as polymorphonuclear leukocytes and lymphocytes infiltrate into extravascular spaces of gingival tissue. Gingivitis is usually a readily reversible condition and poses no long term damage to periodontium structure. Adult periodontitis, on the other hand, is a more serious disease that proceeds slowly, usually beginning as gingivitis in early adulthood and culminating in tooth loss (87,112). Periodontitis is clinically characterized by gingival inflammation, progressive loss of connective tissue attachment 6 A. Healthy B. Diseased Figure 1: Periodontium in healthy (A) and diseased (B) state 7 to the cementum, deepening gingival sulcus (pocket formation), bleeding, alveolar bone loss and tooth mobility (59). The concept of periodontal disease as a bacterial infection involving members of the gram-negative anaerobic microflora has been an important advance in the field of periodontal disease research. However, it has not been proven that any specific organism causes periodontal disease, only certain organisms are associated with a given type or severity of disease and are strongly implicated in the etiology of periodontal diseases (87,183). 3.1 Porphyromonas gingivalis One of the numerically dominant members of the Gram-negative anaerobic microflora isolated from subgingival plaque or periodontal lesions of periodontitis patients is Porphyromonas gingivalis. P. gingivalis is believed to be important in the disease process of adult periodontitis, (for a review, see references 99, 169, 172). P. gingivalis is found in large numbers in adult periodontitis patients, but is undetectable in soft tissue pockets of healthy individuals (164, 166, 167). Eradication of P. gingivalis with intensive metronidazole therapy has been correlated with the arrest of periodontal disease progression (89). But the former disease state returned upon re-infection of periodontal sites with P. gingivalis (62). Holt et al. (57) have shown that introduction of P. gingivalis into periodontal microflora of healthy monkeys led to elevated levels of serum antibodies to P. gingivalis and rapid and significant alveolar bone loss, characteristic of periodontitis in humans. The discovery of numerous virulence factors associated with periodontal tissue damage has further implicated P. gingivalis in the etiology of adult periodontitis (168, 170, 173). 3.1.1 Disease mechanisms of Porphyromonas gingivalis: The induction, modulation and progression of periodontal diseases is believed to be a complex process involving interactions between host immune responses and bacteria (87, 112). Both host 8 and bacterial factors are believed to directly and indirectly contribute to periodontal tissue destruction. 3.1.2 Host factors involved in periodontal disease: Host immune responses in periodontal disease may be both protective and at the same time destructive to periodontal tissues. The principle line of defense against P. gingivalis in the mouth is the saliva and the gingival crevicular fluid (95). The saliva contains lysozyme and immunoglobulin IgA. The crevicular fluid contains polymorphonuclear leukocytes (PMNL), complement factors and immunoglobulins IgG and IgA (30). Gram-negative bacteria are lysed via the coordinated efforts of complement and lysozyme. Phagocytosis is enhanced via opsonization of bacteria by complement and antibodies. The cooperative efforts of host defense factors disrupts bacterial colonization and slows rapid proliferation (32-34). The host defenses are normally able to function effectively as long as oral hygiene is satisfactory. However, if plaque accumulates and the oral flora changes, the protective functions of host defenses may become overwhelmed (112). Constant microbial antigenic challenge by Gram-negative anaerobes elicits strong inflammatory responses, leading to lytic changes in gingival tissue and periodontal fibers in periodontal disease (124,129). Periodontal inflammation is triggered by the release of chemical mediators of inflammation such as histamines and bradykinins which promote vasodilation and vascular permeability. Powerful chemotaxins such as cytokines, leukotrienes and prostaglandins are also produced to induce migration of white blood cells from blood vessels into extravascular spaces. Increased vascular permeability facilitates the influx of neutrophils, basophils, and monocytes into infected tissues. But at the same time, it allows penetration of bacterial endotoxins, proteases, hemagglutinins and toxic metabolites such as hydrogen sulphide and organic acids into soft gingival tissues (66). The neutrophils at infected sites are active macrophages that ingest microorganisms, then ki l l them in phagocytic vacuoles containing toxic chemicals and enzymes. Phagocytes tend to be 'sloppy eaters'(147). The contents of phagocytic vacuoles are often leaked into the surrounding fluid and contribute to tissue 9 damage. Neutrophil phagocytic vacuoles/granules are packed with large amounts of powerful hydrolytic enzymes arid toxic metabolites including chymotrypsin-like enzymes, elastase, collagenases and gelatinases, free hydroxide and oxygen radicals, hydrogen peroxide, and hypochlorous acid (35). Thus, the contents of phagocytic granules may be responsible for much of the periodontal tissue damage and ligament fibers (95). Some cytokines may also have direct deleterious effects on gingival tissues. Schenkein et al. (147) have discovered a cytokine produced by lymphocytes that is cytotoxic to cultured human gingival fibroblast. Another cytokine, called the osteoclast activating factor, is believed to induce bone resorption by osteoclasts ( H I ) . 3.1.3 P. gingivalis factors involved in periodontal disease: Porphyromonas gingivalis possesses many putative virulence determinants which collectively help the organism colonize the subgingival plaque micro-environment (195), evade host immune responses (71), and cause damage to periodontal tissue (5, 87). The virulence factors include its ability to grow in anaerobic, nutritionally rich environments, and structural components such as capsules, lipopolysaccharide (LPS), vesicles, fimbriae, hemagglutinins and proteases. a) Growth and metabolism: P. gingivalis is an aerotolerant anaerobe (2). Its apparent tolerance to oxygen can be attributed to the production of superoxide dismutase (SOD). SOD serves to detoxify two toxic compounds (hydrogen peroxide and superoxide radical) generated by the exposure of reduced flavoproteins to oxygen (10). During host inflammatory responses, SOD also protects P. gingivalis from oxygen radicals produced by neutrophils in phagocytic vacuoles. Amano et al. (3, 4) demonstrated that exogenous SOD purified from P. gingivalis could inhibit bacterial killing by polymorphonuclear leukocytes. P. gingivalis is an assacharolytic bacterium that ferments amino acids as its sole energy source (42, 150, 156, 159, 196). Amino acids are provided in the form of proteins mostly derived from 10 the saliva, the gingival crevicular fluid, and the complex array of degradation products from microbial and host immune interactions. Saliva contains lysozyme, lactoferrin and immunoglobulins. The gingival crevicular fluid contains serous proteins such as albumin, immunoglobulins IgG, IgA and IgM and complement factors (95). Large native proteins are degraded by proteases into smaller peptide fragments prior to being assimilated as nutrients (17). Shah and Garbia have demonstrated that peptides containing ten to fourteen residues are preferentially taken up by P. gingivalis for growth (95). P. gingivalis does not favor the uptake of amino acids as substrates for growth, but a few amino acids (aspartate and glutamate) can be catabolized by the organism under peptide limiting conditions (157,158). The metabolic fate of amino acid in the fermentation process has been studied using position labeled [14C] amino acids. [,4C]-aspartate incorporation has revealed that aspartate catabolism occurs via the succinate pathway (151). Cell suspensions of P. gingivalis W83 incubated with [14C]-aspartate yielded [14C]-oxaloacetate, -malate, -fumarate as metabolic intermediates and [1 4C]-succinate as the metabolic product (196). Gas liquid chromatography also revealed the production of several volatile fatty acids (acetic, isobutyric, butyric, propionic and isovaleric acids) and nonvolatile fatty acids (phenylacetic acid, parahydroxyphenylacetic acid) as metabolic end products of amino acid fermentation (163). The buildup of these metabolites in bacterial culture has been shown to have cytotoxic effects on oral mucosal cells (49, 139, 140, 194). However, some of these products may only accumulate temporarily in the oral micro-environment, as the end products of one group of anaerobic organisms often serve as the substrate of another group of organisms in the so-called 'anaerobic food chain'. Nutritional symbiotic relationships between P. gingivalis and several other oral bacterial species have been previously reported (51, 72, 74, 75, 92, 100). Succinate and isobutyric acid have been found to promote the growth of P. gingivalis and Treponema denticola mixed cultures (47). Other metabolic end products produced by P. gingivalis such as volatile sulfur compounds (hydrogen sulfide and methylmercaptans), indole and ammonia have been found to directly contribute to the virulence of the organism by modulating permeability of oral mucosa and reducing collagen synthesis (91,110). 11 In the proposed succinate pathway, electrons are transferred to organic compounds (fumarate) via cytochromes and menaquinone electron carriers of the electron transport pathway (137). Cytochrome and menaguinone are believed to be derived from hemin and menadione (vitamin K), respectively, which are essential growth factors of P. gingivalis (44). Iron binding proteins such as hemoglobin are believed to be the primary source of the iron porphyrin prosthetic group in the subgingival micro-environment (153). Menadione may be salvaged from the surrounding medium as it is produced as a metabolic byproduct by Veillonella and a number of gram positive organisms (87). The acquisition of hemin involves the concerted actions of hemagglutinins, hemolysin, and proteolytic enzymes expressed on the cell surface of P. gingivalis. The initial process of adherence, followed by specific attack of erythrocyte surface structure by P. gingivalis has been monitored using 5 1 Cr labeled red blood cells and electron microscopy (155). Proteases have been shown to degrade erythrocyte cell contents such as hemoglobins resulting in release of free protoheme and hemin moiety (23, 153). Free hemin may be transported into the cell via an energy dependent mechanism proposed by Genco et al. (40, 41), or hemin may be stored as protoheme and protophorphyrinin, which appears as dark brown residues on the P. gingivalis cell surface (152). The storage of hemin on the cell surface during hemin-replete growth conditions may ensure the survival of the organism in hemin-restricted environments (177). Besides being an important growth factor, hemin appears to modulate the expression of numerous P. gingivalis virulence factors such as those described below (96). b) Capsules: Capsules are amorphous layers of exopolysaccharides believed to help protect P. gingivalis against phagocytosis by polymorphonuclear leukocytes (118) and promote adherence to bacteria in the dental plaque (187, 189). Capsular size varies among P. gingivalis strains and its production has been shown to be dependent on growth conditions. Grenier and McBride have found that P. gingivalis recovered from experimental mouse infections possessed thicker and denser extracellular materials than cells grown under laboratory conditions (55). Freshly isolated P. gingivalis strains 12 possessing thicker capsules were found to be more invasive in mouse pathogenicity models than laboratory strains (109). However, a clear correlation between the presence of capsules and virulence of bacteria in mouse pathogenicity models has yet to be established. Sunqvist et al. (189) have shown that among nine strains encapsulated and resistant to phagocytosis, only two produced spreading invasive lesions in mice. c) Lipopolysaccharides (LPS): The LPS of P. gingivalis show very low endotoxic activity, but appears to have high mitogenic activity (190). It has been proposed that different phosphorylation and acylation patterns in the lipid A component of LPS may account for the low endotoxic activity (16, 65). Purified LPS has been shown to stimulate cytokine production, induce bone resorption (60, 106, 191) and inhibit bone (collagen) formation by inhibiting gingival fibroblast proliferation (102). These findings suggested that LPS are important in periodontitis pathogenesis. d) Outer membrane vesicles: P. gingivalis releases extracellular vesicles into its surrounding media. Vesicles may be shed in response to nutrition restriction (177). Vesicle production was highest when cells were grown in nutrient-limiting conditions in continuous culture studies (178). P. gingivalis W50 showed increased vesicle production as growth approached the end of exponential growth in batch cultures (174). Gravimetric studies by Smalley et al. showed that both cell-surface associated and extracellular vesicle were more numerous when cells were grown under hemin-limiting growth conditions (174, 175). Vesicles are believed to be identical in composition to the outer membrane of P. gingivalis (151). Proteases, hemagglutinins, and other surface proteins commonly found on P. gingivalis cell membranes are also present on vesicles (70, 97, 103, 180). Due to their small size, vesicles may enter sites otherwise inaccessible to bacterial cells and serve as transport vehicles for 13 membrane bound proteases, hemagglutinins and other toxins to tissues surrounding the infected site (178, 180). e) Fimbriae: P. gingivalis fimbriae are thin filaments, consisting of repeating fimbrillin monomer subunits with a molecular mass of 43 kDa (27, 83, 197, 203). Fimbriae have been shown to serve as adhesins in the attachment of P. gingivalis to buccal and crevicular epithelial cells and oral gram positive bacteria (64, 84). Furthermore, fimbriae have been implicated in the stimulation of bone resorption (69). McKee et al. (101) demonstrated that P. gingivalis W50 grown under hemin limitation possessed few fimbriae, whereas cells grown under hemin replete conditions were heavily fimbriated. This suggested that bacterial attachment to periodontium may be facilitated at the onset of bleeding during the course of periodontal disease. f) Hemagglutinins: Hemagglutinins represent a class of adhesins believed to play significant roles in the colonization and attachment of P. gingivalis to host target tissues (120-122). P. gingivalis possess multiple cell surface associated hemagglutinin factors (151). Progulske-Fox and coworkers (128) cloned three hemagglutinin genes (hagA, hagB and hagC) from P. gingivalis 381. Restriction fragment length polymorphism analysis using hagB and hagC as probes revealed that several copies of homologous hemagglutinin genes are present in the P. gingivalis chromosome (128). The hagA and hagB gene sequences showed no homology to each other, but hagB and hagC were highly homologous (96%) to each other (85). Although hagB and hagC appeared to be identical, they are believed to play different roles in vivo because their expression levels were both growth phase- and media-dependent (85). Besides the Hag proteins, fimbriae may also be among the P. gingivalis structures that mediate adherence to erythrocytes. In a recent report, Ogawa and Hamada (116) showed that purified fimbriae, as well as synthetic peptides derived from the 14 fimbrillin sequence possessed hemagglutinating activity. The lipopolysaccharide of P. gingivalis 381 has also been shown to exhibit hemagglutinating activity with erythrocytes (119). P. gingivalis hemagglutinins have been found to be closely associated with Arg-X specific proteolytic enzymes. Numerous studies have provided biochemical evidence to suggest that a direct physical and/or functional relationship between proteases and hemagglutinins exist (58, 113, 114). Nishikata and Yoshimura demonstrated from protease-inhibitor studies that a highly purified hemagglutinin possessed proteolytic properties, suggesting that proteases and hemagglutinins were covalently associated with each other (113). However, Shah et al. (154, 155) later showed that hemagglutinins and proteases exist as closely associated but separate entities on the outer membrane. The correlation between hemagglutinating activity with protease activity has been further supported by P. gingivalis protease-deficient mutants showing concomitant reductions in proteolytic and hemagglutinating activities (43, 107). Recently, the genetic evidence for the relationship between protease and hemagglutinin activities has been discovered (202). Protease gene sequence analysis revealed that many P. gingivalis protease genes encode a hemagglutinin domain (132,133). Most P. gingivalis cysteine proteases genes identified thus far consists of a N-terminal prepropeptide and catalytic domain containing the cysteine active site, followed by a C-terminal hemagglutinin domain (Table 1). Cibroski et al. (24) have suggested that the large precursor protein comprising of protease and hemagglutinin domains may undergo proteolytic processing to generate separate and noncovalently associated protease and hemagglutinin moieties that assemble on the outer membrane. g) Proteases: P.' gingivalis depend on proteases to catabolize a variety of host tissue proteins into smaller assimilable peptides for growth (151). Besides their roles in nutrition, proteases may help ensure survival of the bacterium by degrading host defense proteins (144, 146, 248, 185, 186). Cell bound protease activity is believed to play a significant role in the evasion of the inflammatory cell defenses by proteolytic removal of opsonins at the bacterial cell surface (53, 71, 186, 199). 15 Furthermore, proteases may contribute directly to the inflammatory response process through direct complement activation and C5a generation (185, 200), kininogen (56, 61) and prekalikrein activation and bradykinin release (149). P. gingivalis produces many extracellular and /or cell surface bound proteases (Table 1). At the present time, at least three classes of proteases have been identified in P. gingivalis: the collagenase, the glycylprolyl peptidase and the cysteine protease. P. gingivalis is believed to possess several 'true' collagenases, capable of degrading native type I, II, III and IV collagen (11, 13, 14, 81, 98). Only the collagenase gene, prtC has been cloned and characterized (68, 93). Glycylprolyl peptidases are believed to be involved in degrading protein fragments and peptides into smaller more assimilable peptides. Given the high levels of glycine and proline in collagen, glycylprolyl peptidases may be involved in degrading collagen fragments after initial collagen cleavage by collagenases (52). At least four proteases possessing glycylprolyl activity have been identified, but these proteases remain largely uncharacterized (151). The majority of P. gingivalis proteases are thiol-dependent and thus belong to the cysteine protease class (52). Cysteine proteases show enhanced catalytic activity in the presence of mercaptans such as cysteine and 2-mercaptoethanol, and inhibited by reagents such as N -ethylmaleimide, iodoacetate and 2'-2-pyridyl disulfide (45). P. gingivalis cysteine proteases have been inappropriately described as 'trypsin-like' proteases in the past. According to the nomenclature guidelines established by the International Union of Biochemistry, in order for the designation 'trypsin-like' to be appropriate, the protease would have to possess a Serine-Histidine active-site (77). Cysteine proteases have instead, a catalytic dyad of Cysteine and Histidine residues in their active-sites. Most P. gingivalis cysteine proteases exhibit either Arg-X specificity or Lys-X activity (52, 77). The active sites of Arginine- and Lysine-specific proteases can only efficiently accommodate the side chains of Arginine or Lysine residues of substrates respectively, thereby limiting their proteinase activity to either the Arg-Xaa or Lys-Xaa peptide bonds. Some proteases such as PrtP (porphypain) reportedly has both Arg-X and Lys-X activity at different active sites (24). 16 Many P. gingivalis Arg-X proteases have been purified and characterized (151). However, attempts to determine specific pathogenic functions of any single protease have been unsuccessful. Arg-X proteases isolated from different strains or within the same strain under different growth conditions differed in molecular mass, susceptibility to synthetic inhibitors and association with hemagglutinin activity (19, 52). Despite the apparent heterogeneity among cysteine proteases, recent D N A and amino acid sequence data suggest that many protease genes are derived from the same P. gingivalis genomic locus (7, 8, 132, 133). Barkocy-Gallagher et al. (8) showed that most proteases of Arg-X specificity are highly homologous to each other or to either the N - terminal or C-terminal portions of other Arg-X or Lys-X active enzymes. Among the nine genes believed to encode one or more Arg-X specific proteases from different strains, six genes (prtH, agp, rgp-1, prtR, cpgR, and prpRl) have been found to be nearly identical to each other in the N-terminus prepropeptide and catalytic domains (132). The C-terminus hemagglutinin moieties of prtP, rgp-l,prpRl, prtR,prtH and agp were found to be partially homologous to each other (8, 132). Recently, western blotting, specific labeling of active cysteine residues and inhibition studies (133) showed that the large numbers of proteinases with different molecular masses found in different P. gingivalis strains or induced by different methods of cultivation may be variant forms of the same gene product. The larger proteases of over 95-185 kDa in size were noncovalently complexed with a hemagglutinin domain, while the smaller proteases existed as independent catalytic entities (133). These results have led some researchers to suggest that most P. gingivalis proteases are the proteolytically processed products of the same large precursor polyprotein translated from the same gene. Potempa and Travis (132,133) have suggested that only a single cysteine protease gene (rgp) encoded the myriad of proteases, which are responsible for all Arg-X-specific activity in P. gingivalis. However, it remains unclear why different forms of Arg-X proteases varied in their susceptibility to protease inhibitors and showed widely varying substrate specificity (52, 148, 186,188). Different proteases have been shown to specifically degrade different complement factors and different classes of immunoglobulins (37,144, 185). These data suggest that it may be possible that Arg-X proteases exist as distinct proteases encoded by independent but related genes, 17 00 o c 0(5 00 VO O ^ ON 00 in co m vo co C O r-~ ON in co ON co 03 Q M <4-1 ^ , ° . & s § <U _> '-*-» I I 3 O OO co in ON o t — C N 00 C N VO O OO i—i ON vo oo C N co ON o in 00 Q >n oo o c •a GO ON co >n U U H < oo r- H C N < • oo co ^ m co <, o oo ON CO m U U H < co oo C N O in oo co VO VO C N C O C O U U H < o m vo VO <u e a a '5 o <U on 03 a OA "o U on ca C • RH <U •4-* o OH C O U c "3 OH >> & O OH <u on a £ OH <D n ' C •*-» 00 >. I 00 a '53 OH '5b c • PH 00 I 00 e '53 OH '5b c '5b oo tH c3 > •l-H 00 c • l-H O 1 8 <u on cd C • l-H <U H—» o t-l OH 00OH "5b e '5b cd C <u c <o O a. Q a. v. is. So J? 0 on <U on cS e IU 00 ca =L o U £ < 3 OH 3 OH IU IU e " J .5 a (U 4> 4-1 -4-> on o 18 0 1 2 i 1 1 1 r 3 4 i 1 1 — r 6 kb i r 5' 3' rgp-1 —[ prepro j-Catafytie domain-• | Hemagglutinin doaata prpRl - n — r prtR Figure 2: Comparison of Arginine-X-specific genes of Porphyromonas gingivalis. Shaded bars represent the translated regions encoding the putative prepropeptide, catalytic, and hemagglutinin domains. The narrow solid bars represent untranslated regions. The narrow dashed bars mark the part of the agp gene that has not been sequenced. Single nucleotide differences from the rgp-1 sequence with no effects on the encoded amino acid are marked as open circles p). Filled circles represent changes in the encoded amino acid. Nucleotide deletions or insertions are represened by filled squares fi) if they change the reading frame from that of rgp-1, open squares P) if the reading frame return to that of rgp-1. (Adapted from Potempa, J., Pavloff, N . , and Travis, J.; Trends in Microbiology. 3:11,1995) 19 with slight sequence variations being sufficient to change substrate specificity and susceptibility to inhibitors. Interestingly, among the cysteine proteases sequenced thus far, only the Tpr and PrtT do not exhibit significant homologies to any other cysteine proteases or with each other (8, 133). The uniqueness of Tpr and PrtT suggest that they may play different roles from that of other cysteine proteases in P. gingivalis. Little is known of the functions of Tpr and PrtT in the biology of P. gingivalis. The 1.7 Kb tpr gene encoded an approximately 80 kDa cysteine protease putatively localized on the outer membrane (126). Previous studies have revealed that Tpr may be involved in gelatin degradation (125-127). Tpr was found to be responsible for nearly all pZ-peptide-hydrolyzing activity in P. gingivalis via the characterization of the Tpr-deficient mutant (W83/PM). Tpr has not been purified from P. gingivalis in its native 80 kDa form, but an E. coli clone expressing a 64 kDa recombinant Tpr protease has been characterized by Bourgeau et al. (15). The E. coli clone could not hydrolyze the synthetic substrate, B A P N A , but it was able to degrade bovine serum albumin (BSA), gelatin, azocoll and casein (15). PrtT is also a cysteine protease putatively localized on the outer membrane (93, 123). The 2.7 Kb prtT gene encoded a 98 kDa translation product, which encompassed a 53 kDa N-terminus protease and a C-terminus hemagglutinin domain. The PrtT protease has been expressed and purified as a 53 kDa recombinant protease from E. coli (123). The PrtT has not been expressed or purified from E. coli in its 98 kDa form. According to Otogoto et al. (123), the 53 kDa recombinant PrtT possessed Arg-X (BAPNA-hydrolyzing) activity, but it was unable to degrade native proteins such as bovine serum albumin (BSA), laminin, fibronectin, and human immunoglobulin G or M (123). Although many differences exist between Tpr and PrtT, they share the distinction of being the only two proteases identified thus far that cannot be assigned to any of the presently known families of cysteine proteases in P. gingivalis (8, 132, 133). This distinction has prompted an investigation of Tpr and PrtT involvement in P. gingivalis metabolism and pathogenicity. In this investigation, we analyze the effects of allelic replacement mutagenesis of prtT, tpr, and both prtT 20 and tpr on the growth, proteolytic activity and hemagglutination of P. gingivalis in media of specific nutritional composition. This study was carried out in two stages: 1) The construction of prtT single mutant (TSM) and tpr prtT double mutant (TDM) via the E. coli-Bacteroides shuttle vector system (141). 2) The characterization of P. gingivalis W83, tpr and prtT single and double mutants under defined growth conditions. Measurements of protease activity and hemagglutination were carried out by sampling cultures at regular intervals during growth in hopes of attaining a more complete picture of the roles of Tpr and PrtT throughout the growth cycle. The Tpr and PrtT proteases were shown to be important in different growth media and in different stages of the growth cycle. Proteolytic and hemagglutinating activities of tpr and prtT mutants were media- and growth phase-dependent. 3.2 Molecular genetics of E. coli-Bacteroides shuttle vector system. The use of isogenic mutants to identify the functions of specific virulence factors of P. gingivalis has been a recent advance in P. gingivalis. The genetic system used in the construction of isogenic knockout mutants of P. gingivalis is based on the genetic systems developed for colonic Bacteroides species, which are phylogenetically related to Porphyromonas spp. E. coli-Bacteroides shuttle vectors possess specific elements which enable them to replicate and to be mobilized into Bacteroides and E. coli (86). A typical shuttle vector in P. gingivalis, such as pNJR12, contains two independent replicons, each of which can be recognized by the appropriate host organism. It also possesses two selectable markers, each of which is expressed by different host organisms [KanamycinR ( £ c o / () and tetracycline*^. gingivaiis)\- Furthermore, an origin of transfer (Ori1) is provided in pNJR12 that can be recognized by mobilizing elements. Shuttle vector pNJR12 contains two different plasmids (pJRD215 and pB8-51) and a tetracycline-resistance gene (tetQ) from a conjugal Bacteroides element (94). The IncQ RSF1010-based pJRD215 plasmid provides the replicative apparatus (origin of replication) and the basis for plasmid mobility in E. coli (Mob and OriT). The 4.4 kb cryptic plasmid pB8-51 in pNJR12 21 provides the Mob site and the origin of replication for Bacteroides (94, 161). The Mob sites situated in pJRD215 and pB8-51 can both be recognized by the broad host range IncPb plasmid R751(86, 94, 161). The plasmid pR751 contains the Tra operon which encodes conjugative transfer proteins that mediate the mobilization of pNJR12 between E. coli and Bacteroides (94, 160). The pJRD215 vector was used to construct the suicide vector in P. gingivalis in this study since it can be mobilized from E. coli to P. gingivalis by the helper plasmid R751, but cannot replicate in P. gingivalis due to the absence of the origin of replication for Bacteroides. The tetracycline-resistance gene itetQ) was used as the selection marker in P. gingivalis. Plasmid JRD215 provides convenient multiple cloning sites into which specific gene sequences can be inserted to create the suicide plasmid (26). 22 MATERIALS AND METHODS Strains, DNA and growth conditions: Bacterial strains and plasmids used in this study are listed in Table 4. P. gingivalis was grown in brain heart infusion (BHI) broth (Difco lab., Detroit, Mich) supplemented with hemin (5 U-g/ml) and vitamin K (0.5 pg/ml) in an anaerobic chamber (Coy Manufacturing, Ann Arbor, Mich.) at 37 °C, containing an atmosphere of 85% N2, 10% H2, 5% CO2. Human blood (5% V/V) and agar (1.5% W/V) were added to BHI broth to prepare BHI-blood agar plates. Erythromycin (10 p,g/ml), gentamycin (200 pg/ml) and tetracycline (3-5 pg/ml) were used in the selection of P. gingivalis mutant strains. E. coli X L l - B l u e (6) and DH5oc (143) were grown aerobically in Luria-Bertani (LB) broth (143) at 37 °C, containing the appropriate antibiotics: Ampicillin (50 p.g/ml), kanamycin (50ug/ml), trimethroprim (200p,g/ml). Chromosomal D N A from P. gingivalis W83 was prepared as described in Current Protocols in Molecular Biology (143). Plasmid D N A was isolated by alkaline-lysis miniprep method as described by Rodriguez and Tait (138). Plasmids pET17b, pNJR12, pJRD215, pR751 were used for the construction of protease mutants (see Table 4). Plasmids p S W l , pSW2 and pSW3 were constructed in this study. For mutant characterization studies, P. gingivalis strains were grown in four different media: The T Y E media consisted of 1.7% (W/V) trypticase peptone, 0.3% (W/V) yeast extract, 0.5% (W/V) NaCl, 0.25% (W/V) K 2 H P 0 4 , 5 pg/ml hemin, 1 p:g/ml menadione. The 0.5TYE media consisted of all of above components, but trypticase peptone was reduced to 0.5% (W/V). The 0.5Gelatin was identical to 0.5TYE, except for the addition of 0.2% (W/V) of porcine skin gelatin (Bio-Rad, Richmond, CA.) . The 0.5BSA was identical to 0.5TYE, except for the addition of 0.2% (W/V) of unboiled bovine serum albumin (BSA) (Sigma, St. Louis, Mo.). Growth began in each media from 1/100 dilutions of stationary phase cultures from T Y E media. Culture growth ended in each media when the highest culture optical density (OD) was reached at stationary phase. The growth rates of P. gingivalis strains in different media were measured by the formula: Logio 23 Table 4: Bacterial strains and plasmids: Strains or plasmids Relevant phenotype3 Description or source E. coli XLl-Blue DH5a P. gingivalis W83 Plasmids W83/PM TSM TDM 5 pET17b pR751 pNJR12 DJRD215 pSWl pSW2 pSW3 Rec A-RecA" Genr Genr Em r Genr Tc r Genr Em r Tc r Ap r Tr/ Tra+ Rep+ Km r Mob + Rep+ (Tc r Mob + Rep+) Km r Rep+ (Mob+ Tra" Rep") Ap r Ap r (Tcr) Km r Rep+ (Tcr Mob + Tra" Rep") Stratagene cloning systems (La Jolla, CA.) D. Hanahan Wildtype strain; Naturally resistant to gentamycin; From H. Shah. The tpr mutant of W83; From Y. Park (127) The prtT single mutant of W83; From this study. The tpr prtT double mutant of W83; From this study. Expression vector based on the T7 RNA polymerase/promoter expression system; (Novagen, Madison WI.) IncPfi E. coli plasmid. Mobilzes shuttle vectors from E. coli to P. gingivalis (160) Contains a 2.6 kb Tc r gene (tetQ) from the Bacteroides thetaiotamicron conjugal element (94); 4.2kbpB8-51(161), 10.2 kb pJRD215. IncQ RSF1010 based E. coli-Bacteroides shuttle vector (26). The 2.9 kb prtT gene ligated in frame to T7-tag sequence on pET17b vector; From this study. 2.6 kb Sst I Tc r gene fragment blunt-end ligated into Sma I sites of pSWl; From this study. prtT::tetQ cassette cloned into Kpn l-Eco RI site of pJRD215; From this study a Abbreviations for bacterial and plamid phenotypes: RecA", cannot recombine with homologous sequences; Genr, gentamycin resistance; Em r , erythromycin resistance; Tc r, tetracycline resistance; Tp r, trimethoprim resistance; Km r , kanamycin resistance; Ar/, ampicillin resistance; Tra, encodes (+) or does not encode (-) Tra proteins to allow self- transfer; Mob, can (+) or cannot (-) be mobilized by Tra proteins; Rep, can (+) or cannot (-) replicate. Abbreviations within parenthesis are plasmid phenotypes that are expressed in P. gingivalis. 24 (late OD660) - Login (initial OD660) / Ahr. Late OD660 and initial OD660 represented culture optical density values from specific points during late exponential phase and early exponential phase respectively. Ahr is the time period (in hours) the culture took to grow from the initial OD to late OD. Cloning of the prtT gene by Polymerase Chain Reaction (PCR) : The 2.9 Kb prtT gene was cloned by PCR using P. gingivalis W83 chromosomal D N A as the template and primers synthesized by the Oligonucleotide Synthesis Laboratory, University of British Columbia. Primers were designed from the published prtT gene sequence from P gingivalis ATCC53977 (93). The N-terminus prtT primer is 5 ' - G C G G T A C C G G T G A C A C G A T C C A A A G C C - 3 ' (Underlined nucleotides represent theKpnl site). The sequence downstream of Kpnl site corresponds to nucleotides 115-121 of prtT). The C-terminus prtT primer is 5'-GCGAATTCATTCAAGAGAGCTATGAAGGC-3 ' (under l ined nucleotides represent anEcoRI site). The sequence downstream of EcoRl corresponds to nucleotides 3060 to 3089 of prtT. Twenty-five cycles were performed in a model 480 Perkin-Elmer D N A thermocycler (Perkin-Elmer, Norwalk, Conn.), using a denaturing temperature of 94°C for 45 seconds, an annealing temperature of 58°C for 30 seconds, and an annealing temperature of 72°C for 90 seconds. Each PCR reaction mixture (100 pi) consists of 100 pmol of primers, 50 mM KC1, 10 mM Tris-Cl (pH 8.0), 3.0 mM MgCl2, 30 ng of P. gingivalis W83 chromosomal DNA, 0.05 m M deoxynucleotide triphosphates (dNTP) and 3 U of TaqI DNA polymerase (BRL, Mississauga, ON). The 2.9 kb PCR product was purified by chloroform extraction and ethanol precipitation and subsequently visualized on an ethidium bromide stained agarose gel (143). Construction of pSWl expression vector The putative 2.9 kb prtT gene amplified by PCR was double digested with Kpn l-Eco R l , then cloned in frame to the T7-tag sequence on the T7 promoter-based pET17b expression vector (Novagen., Madison WI). The recombinant expression plasmid, named p S W l , was maintained in 25 E. coli X L l - B l u e under ampicilin selection (50 pg/ml). The identity of the 2.9 kb PCR product was verified by sequencing the first 536 bp of the PCR product (University of British Columbia D N A Sequencing Laboratory) and comparing the sequence with the published prtT gene sequence from P. gingivalis A T C C 53977 (Fig. 3). The PCR product was confirmed as the prtT gene by restriction fragment length analysis showing that the restriction site map of prtT was consistent with the published restriction maps of prtT. Expression of the T7-tag-PrtT fusion protein For high level expression, pSWl was transferred into E. coli expression host BL21(DE3) and BL21(DE3)pLysS by the CaCl2 transformation protocol as described in Sambrook et al. (143). E. coli BL21(DE3) and BL21(DE3)pLysS tt'ansformants were grown in L B (143), supplemented with 100 pg/ml ampicillin (to maintain pSWl) and 100 pg/ml ampicillin plus 34 u.g/ml chloramphenicol (to maintain pLys) respectively. The plasmid plysS (chloramphenicol11) in E. coli BL21(DE3)pLys encoded for T7 lysozyme, a natural inhibitor of T7 polymerase intended to help stabilize target plasmids. E. coli BL21(DE3) and BL21(DE3)pLysS expression hosts possess chromosomal copies of the T7 RNA polymerase gene under the control of lacUV5 promoter, which can be induced by the addition of IPTG (isopropyl-(3-D-thiogalactopyranoside). Newly transformed expression hosts were grown to an OD600 of 0-4 to 0.5 at 37°C, then induced by adding IPTG (final concentration of 0.4 mM) into the media. Cells were harvested prior to induction and at every half hour interval after induction for induced and uninduced (negative control) samples. Whole-cell proteins were analyzed by SDS-PAGE. Suicide plasmid (pSW3) construction: A 96 bp Smal fragment was removed from the central portion of the prtT gene in p S W l (Smal sites are located at nucleotides 1698 and 1794 of the 2.9 kb prtT gene), then replaced with a tetracycline-resistance gene by blunt-end ligation to construct the recombinant plasmid pSW2 (Fig. 4). The 2.6 kb fragment containing the tetracycline-resistance gene, tetQ was obtained from 26 ( A ) p ^ 5-ST(115) —I (B) Start (0) AT/?/j I Stem-loop y Smal (1697, 1794) PCR amplification (26P60) 3 " W T ( 3 0 6 0 ) 500 bp £coRI prtT 2.9 kb PCR product Kpn I - EcoRl digestion Ligate with Kpn 1-EcoRI digested > I pET17b expression vector Figure 3: Construction of pSWl . A schematic diagram of the prtT gene (A) shows the positions of the 5' PCR primer (5-ST) and the 3' PCR primer (3-WT) in boldface. Shaded regions are noncoding regions of the prtT gene. The light region is the coding region. The dashed region represents the putative signal peptide sequnece. The numbers within parenthesis are nucleotide sequence numbers relative to the start codon of the prtT gene sequence. (B) Scheme for the construction of p S W l . 27 Clone prtT by PCR ^ Sstl Figure 4: Construction of suicide plasmid pSW3 (please refer to text for further details). Thick shaded bars represent the tetracycline-resistance gene. Thick clear bars represent the prtT gene. Restriction enzyme sites and fragment sizes pertinent to Southern (DNA) analysis are shown. 28 pNJR12 (94) by Sst I digestion, then treated with T4 D N A polymerase (BRL, Mississauga, ON) to remove the protruding 3' termini. The pSWl vector was treated with calf intestinal alkaline phosphatase (BRL, Mississauga, ON) to deposphorylate the Sma I digested 5' termini. Blunt-end ligation was carried out using approximately 10 times more T4 D N A Ligase (BRL, Mississauga, ON) than the standard cohesive ligations (143). To complete construction of the suicide plasmid, pSW3, the 5.5 kb Kpn l-Eco RI fragment of pSW2 containing the prtT::ATcR cassette was subcloned into pJRD215 (26), a mobilizable RSF1010 based E. coli-Bacteroides shuttle vector. The suicide plasmid was introduced into E. coli DH5a, harboring the helper plasmid pR751, by electroporation (6). E. coli DH5a (pR751/pSW3) was grown in L B containing 200 [ig/m\ of uimethroprim and 50 u.g/ml of kanamycin to maintain pR751 and pSW3 respectively. Conjugation: Conjugation was performed with E. coli DH5a (pR751/pSW3) as the donor strain and P. gingivalis W83 and P. gingivalis W83/PM as recipients to create single (prtT) and double (tpr prtT) gene knockouts respectively. Conjugation was performed as described previously by Park and McBride (125). Briefly, donor and recipient strains were grown to early-exponential phase (0.10-0.15 OD660)- A 6 ml aliquot of donor E. coli was mixed with 2 ml of P. gingivalis culture. The combined cells were harvested in a sterile microfuge tube and resuspended in 0.1ml BHI broth. The cell mixture was spotted onto sterilized cellulose membrane filters (HAWP 01300, Millipore, Bedford M A , USA) placed on top of pre-reduced BHI-blood agar. The blood agar plates were incubated aerobically at 37°C for 9 hours, then anaerobically at 37°C for 33 hours. The cell mixture was spun off the filters into 3 ml of pre-reduced BHI broth and grown anerobically for 12 hours. Finally, 0.2ml aliquots of cell suspension were plated onto pre-reduced BHI-blood agar containing specific antibiotics to select for incorporation of the tetracycline resistance gene into the chromosome. 5 Hg/ml of tetracycline was used to select for putative prtT single mutants. 3 u.g/ml of tetracycline and 10 p:g/ml of erythromycin was used to select for putative prtT tpr double 29 mutants. 200 |ig/ml of gentamycin was added into all BHI-blood selection plates to ki l l E. coli. The plates were incubated anaerobically for two weeks and examined for appearance of black pigmented colonies. Southern (DNA) hybridization: Southern hybridization was performed using the non-radioactive B luGENE system as described by the manufacturer (BRL, Mississauga, ON). DNA probes were labeled with biotin -7-dATP using the Random Primed Labeling Kit (BRL, Mississauga, ON.). Plasmid or chromosomal D N A samples were completely digested by appropriate restriction endonucleases, electrophorectically separated in 0.7 % agarose gels and transferred onto supported Nitrocellulose membranes (Bio-Rad, Hercules, CA.) by capillary action. D N A was fixed onto nitrocellulose by baking the nitrocellulose membrane at 80°C under vacuum for 2 hours. Pre-hybridization was carried out using 6X SSC at 65°C for 2 hours, followed by hybridization (6X SSC) at 65°C overnight. The final washes (0.16X SSC) were done twice at 65°C to wash off excess probes. Prior to detection, the membranes were incubated in blocking solution (BRL, Mississauga, ON.) at 65°C for 1.5 hours. Preparation of membrane extracts: Crude membrane extracts were prepared from P. gingivalis cultures at regular intervals during growth in T Y E , 0.5TYE. 0.5Gelatin and 0.5BSA media. Briefly, cultures were harvested and washed once with T M buffer (100 mM Tris -maleate (pH7.5), 10 mM CaCb., 10 mM NaCl). Cells were then resuspended in T M buffer containing 10 mM EDTA, 10 mM MgCl2, 20 p.g/ml RNase A , 20 pig/ml DNase I, and sonicated on ice in an XL2020 Ultrasonic Processor (Heat systems, Farmingdale, N.Y.) at an output setting of 2.2 for a total time of 9 minutes with 30 second intermittent cooling. Whole cells and large cell debris were separated from the broken cell suspension by low speed centrifugation at 6000xg for 10 minutes at 4°C. The supernatant fraction of this suspension was centrifuged further at 100,000xg for 2 hours at 4°C to obtain the crude 30 membrane fraction. The membrane fractions was resuspended in T M buffer to make the crude membrane extract which was stored frozen at -70°C. Arg-X-specific activity assays: Arg-X-specific protease activity was measured using synthetic substrate iV-a-Benzoyl-DL-arginine-p-nitroanilide (BAPNA). Protease assay reactions were performed using 96 well flat bottomed micro-assay plates (Fisher, Coming,NY). 2 pi of crude membrane extract was added to 198 pi of reaction buffer (80 pi of 2.5 mM B A P N A dissolved in 2% DMSO, 118 pi of 0.05M Tris-maleate buffer [pH7.5] with 60 mM cysteine). The total reaction mixture was incubated at room temperature (22°C) and absorbance measured in a plate reader (Bio-Rad, Richmond, CA.) at 405 nm wavelength at five minute intervals. Protease activity units are defined as units of BAPNA-hydrolyzing activity per microgram of total protein in the crude membrane extract sample. The total protein content of crude membrane extract was determined by the Bio-Rad Protein Assay Kit (Bio-Rad Lab Hercules, CA.) SDS -PAGE and gelatin-substrate zymography: SDS-polyacrylamide gel electrophoresis was performed as described by Laemmli (78) using a Min i -PROTEAN II electrophoresis system (Bio-Rad Laboratories, Richmond, CA). The SDS-PAGE gels were made with 10% polyacrylamide (0.075 cm thick) and stained with silver nitrate or Commassie brilliant blue (115). Protein samples were prepared in non-denaturing, non-reducing conditions or in denaturing, reducing conditions. To prepare non-denatured and non-reduced samples, protein samples were solubilized in the solubilzation buffer (4% [W/V] SDS, 20% [V/V] glycerol, 0.125M Tris-HCl [pH 6.8], 0.01% Bromphenol blue) and incubated for 30 min at 37°C. Reduced and denatured samples were prepared by incubating protein samples in the solubilization buffer containing 10% (3-mercaptoethanol for 8 minutes at 100°C. Electrophoresis was conducted at constant 200V. 31 Gelatin-substrate zymograph gels were prepared by adding gelatin to the polyacrylamide mixture to a final concentration of 2 mg/ml. The protein samples were solubilized in non denaturing and non reducing sample buffer as described above. Following electrophoresis at 200V, the gel was gently shaken in 100 mM Tris-HCl (pH7.5) containing 2% Triton X-100 for 30 minutes. The gel was rinsed twice with distilled water, followed by a rinse in 100 mM Tris-Cl (pH7.5) for 30 minutes. Finally, the gel was incubated in development buffer (100 m M Tris-Cl (pH7.5), 2.5 m M CaCl, 50mM cysteine) for 2 h at 37°C and stained with Commassie brilliant blue R-250, then destained. Proteolytic activity was visualized as a clear band against a dark blue background. Western blot immunoassay: Weatern blot immunoassays were done by the method of Renart and Sandoval (136). Briefly, proteins was resolved by SDS-PAGE, then transferred electrophoretically to nitrocellulose membranes. Blots were incubated for 1 hour in blocking buffer (3% BSA in TBS [20 mM Tris-HCl (pH7.5), 0.5M NaCl), then incubated for 2 hours at room temperature with primary antibody solution (T7-Tag monoclonal antibody diluted (1/10000) in 1% BSA-TBS). The blot was washed twice for 20 minutes with 0.05% (Vol/Vol) Tween 20 in TBS, then incubated for 1 hour at room temperature with secondary antibody solution [goat anti-rabbit IgG alkaine phosphatase conjugate (BRL, Mississauga, ON.) dilluted in 1%BSA-TBS]. Immunoreactive bands were visualized by development in a solution containing nitroblue tetrazolium (NBT) and 5-bromo-4-chloro-3-indoyl phosphate (BCIP) (Sigma, St. Louis, Mo.). Hemagglutination Assays: P. gingivalis cells from different phases of growth were harvested, washed twice with phosphate buffered saline (PBS) [137mM NaCl, 2.7mM KC1, lOmM N a 2 H P 0 4 , 1.8 m M KH2PO4 (pH7.2)] and resuspended in PBS at an optical density of 0.30 at 660 nm. Cell suspensions were serially diluted with PBS. 100 | i l aliquots of each dilution were added to equal 32 volumes of 2% (V/V) washed human erythrocytes in PBS and incubated at room temperature for 60 minutes. The hemagglutination titre for a particular sample is the reciprocal of the last dilution showing complete hemagglutination. Northern (RNA) analysis: Total bacterial R N A isolation was performed using the TRIzol™ Reagent according to the manufacturer's direction (Life Technologies, B R L , Mississauga, ON.). Northern (RNA) blotting was carried out using the non-radioactive nucleic acid system (BluGENE™, B R L , Mississauga, ON.) as described by manufacturer. Briefly, RNA was electrophoretically separated in a 0.85% agarose-formaldehyde gel (6), followed by a wash of distilled water to remove formaldehyde. Capillary transfer onto supported nitrocellulose was done overnight. The entire 2.9 Kb biotin labeled prtT gene was used as probe. Conditions of hybridization, washing and detection were performed as in Southern (DNA) hybridization. 33 RESULTS 1. Construction of single and double mutants: 1.1 Cloning of prtT by Polymerase Chain Reaction (PCR) PCR was the method of choice to clone the prtT gene because this technique enabled us to specifically design PCR primers to suit specific criteria and goals in gene cloning and expression. A 2.9 kb PCR product was amplified from P. gingivalis W83 chromosomal D N A using primers designed from the published prtT sequence of P. gingivalis A T C C 53977 (Fig. 5, lane 3). The size of the PCR product corresponded to the size of the prtT gene fragment expected to be generated from the prtT locus using the 5'-terminus prtT primer (5-ST) and the 3'-terminus prtT primer (3-WT) (Fig. 3). The amplification of the 1.2 kb prtC gene from the P. gingivalis W83 chromosome, using primers designed from the W83 prtC gene sequence, served as the positive control for the PCR reaction (Fig. 5, lane 2). The 2.9 kb PCR product, with 5' Kpn I and 3' Eco RI linker sites, was ligated into the multiple cloning site of expression vector pET17b. The Kpn I site was specifically chosen to enable us to create an in-frame fusion between the T7 phage capsid protein sequence from the pET17b expression vector with the 5'-terminus of the PCR product. Ligation between Kpn l-Eco RI digested PCR product with Kpn l-Eco R l digested vector pET17b created the recombinant plasmid pSWl (Fig. 3). 1.2 Identification of the PCR product Recombinant plasmid pSWl was sequenced from the cloning juncture to approximately 500 bp into the 5' end of prtT to verify that the construct was ligated to the T7-tag sequence in the correct reading frame and that the PCR product was indeed prtT. According to the sequence analysis data, the prtT sequence closely matched the published sequence of prtT from P. gingivalis A T C C 53977 and prtT was found to be ligated in frame to the T7-phage capsid protein (Fig. 6). The identity of 34 1 2 3 4.0-3.0-2.0-1.0-kb Figure 5: PCR products. Lanes: 1, molecular weight standards; 2, 1.2 kb PCR positive control; 3, 2.9 kb prtT PCR product. Numbers on the left indicate size in kilobases. 35 A 79 t t a ggg eta t t a eta t t a ctg tgt tec c t t atg cag atg B 60 A T G GCT AGC A T G ACT GGT GGA CAG C A A CGG GAT CGA Start T7-Tag A gga ccg gtg aca cgatccaaagccgaacagacggctaagaactttt 164 I I III III III II I I I I I I I I I I II I I I I I I I I I I I I I I I I I I I I B GTA CCG GTG ACA CGATCCAAAGCCGAACAGACGGCTAAGAACTTTT 151 kpn I 5' PCR primer > A caaacgacaacccacgttgtcttcatcgacagcgagtctccggatggatt 214 II I I II I I I I I I I M I I I I I I I I I I I I I I I I II I I I I I II I I I I I I I I I B CAAACGACAACCCACGCTGTCTTCATCGACAGCGAGTCTCCGGATGGATT 201 A tcgtttacaaagctgcagaaagagaggaggcactattcttcgttttcaat 264 I I I I I I II II II I I I I I I I II I I I I II I I I I I II I I I I I I II I I I I I I I I B TCGTTTACAAAGCTGCAGAAAGAGAGGAGGCACTATTCTTCGTTTTCAAT 251 A cgaggagagaaagacggatttctcctcgtcgcagcggatgatcggttccc 314 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I B CGAGGAGAGAAAGACGGATTTCTCCTCGTCGCAGCGGATGATCGGTTCCC 301 A ggaggtgatcggatatgctttcaaggggcacttcgatgcggcccgtatgc 364 I I II I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I II I I I I I B GGAGGTGATCGGATATGCTTTCAAGGGGCACTTCGATGCGGCCCGTATAC 351 A cggacaatctcagggggtggctcaaaggctatgaacgtgaaatgcttgct 414 I I I I I I I I I I I I I I I I II I I I I I I I I I I I I I I I I I I I I II I I I I I I I I B CGGACAATCTCAGAGGGTGGCTCAAAGGTTATGAACGTGAAATGCTTGCT 401 A gtaatggacggcaaggcagagccgatagatcctatccgtgaagccaagcc 464 I I I I I I I I I I I I I I I I I I I I I I I I I I II II I I I I I I I I I I I II I I I I I I B GTAATGGACGGCAAGGCAGAGCCGATAGATCCTATCCGTGAAGNCAAGCC 451 A tacacgggacctgccatcatccattgcccctatttggaaacgggcgaaca 514 I I I I I I I I I I I I I I I I I I I I I I II I I I I I I I I I I I I I I I I I I I I I I I I I B TACACGGGACCTGCCATCATCCATTGNCCCTATTTGGNAACGGGCGAACA 501 A atgcatcggatccgatcttgtgggatcagggctatccatttaacaccttg 564 I I I I I I I I I I I I I I I I I II I I I I I I I I I I I I I I I I I I I I I III M M B ATGCATCGGATCCGATCTTGTGGGATCANGGCTATCCATTTNACAACTTG 549 A gatcccctgcttccttccgggcagcaggcttataccggttgtgttgccaa 613 II I I II II I I I I I I I I I I I IIII I I II I I I I II II I I I II I I II I I II B GATCCCCTGCTTCCTTCCGGGCAGGAGGCTTATACCGGTNGTGTTGGCAA 599 A ccgccatgggac 625 I I I I I II I I I I B CTGCCATGGGAC 612 Figure 6: Comparison between the P gingivalis ATCC 53977 prtT gene sequence and the PCR product sequence ligated in frame to the T7-tag sequence on pSWl. The 5' end of P gingivalis ATCC 53977 prtT gene sequence from nucleotides 79 to 625 is shown in (A). The 5' end of the T7-prtT gene sequence is shown in (B). The T7-tag sequence is boldfaced. The PCR product sequence starts from the 5' PCR primer as indictated by the arrow (—>) The kpn I linker site on the 5' PCR primer is underlined. Significant sequence homology between (A) and (B) suggested that the prtT gene sequence is conserved in P. gingivalis ATCC 53977 and W83 strains, and that the P. gingivalis W83prtT gene was successfully amplified by PCR. 36 the PCR product was further verified by southern (DNA) analysis. Restriction fragment length analysis of pSWl structure showed restriction fragments consistent with the expected restriction map of pET17b vector with the prtT insert. 1.3 Expression of the T7-PrtT fusion protein Attempts were made to express recombinant PrtT in sufficient quantities to generate anti-PrtT serum for mutant characterization studies. The pET T7 R N A polymerase/promoter-based expression system, developed by Novagen was used in this study (see Methods and Materials). The plasmid pSWl was constructed to facilitate recombinant protein expression. As mentioned earlier, the 2.9 kb prtT PCR product was ligated in frame to the T7-tag sequence provided by the pET17b vector for high level expression. The prtT gene sequence on p S W l begins at the nucleotide 115 of the prtT gene sequence, which is downstream of the putative PrtT signal peptide. The signal peptide was eliminated from the prtT sequence to help increase the chances that E. coli would express PrtT as inclusion bodies instead of being targeted to the E. coli membrane. E. coli BL21 (DE3) and BL21 (DE3)pLysS expression hosts produced low levels of the 98 kDa T7-PrtT fusion protein. According to the SDS-PAGE protein profile analysis, expression hosts induced by IPTG showed no significant difference with expression hosts not induced by IPTG (Fig. 7). Similarly, no significant differences between IPTG induced and uninduced samples were observed in Western blot analysis. Low levels of 98 kDa T7-prtT fusion protein were detected by the T7-tag antibody in both induced and uninduced E. coli whole cell lysate samples (Fig. 8). The E. coli expression hosts showed several characteristics which suggested that the T7-PrtT might be toxic to E. coli. First, E. coli colonies harboring pSWl appeared smaller in size and grew at much lower growth rate than E. coli strains transformed with vector pET17b alone. Second, plasmid pSWl was found to be very unstable in E. coli expression hosts. Plasmid SW1 was lost from E. coli hosts following consecutive culturing in the absence of antibiotic selection. 37 1 2 3 4 5 9 8 k D a • rPrtT + CTRL Figure 8 : Detection of recombinant T7-PrtT protein by Western blot analysis using T7-tag monoclonal antibody. Lanes: 1, uninduced E. coli BL21(DE3/pSWl) at 0.55 OD600; 2* induced E. coli B L 2 1 ( D E 3 / p S W l ) at approximately 0.55 ODgno; 3, uninduced E. coli BL21(DE3/pLysS/pSWl) at 0.55 OD 6qo; 4, induced E. coli BL21(DE3/pLysS/pSWl) at approximately 0.55 OD600; 5, T7-MSP fusion protein as positive control. 39 The production of small amounts of fusion protein in uninduced E. coli hosts suggested that T7 R N A polymerase expression was not controlled sufficiently so as to prevent the expression of potentially toxic T7-PrtT protein. Since the prtT gene was cloned as a relatively intact gene, the slightest leakage in T7 R N A polymerase expression may have led to the expression of proteolytically active enzyme which inflicted deleterious effects on the E. coli host. A number of attempts to optimize protein expression were undertaken by performing expression studies at 30°C, using alternative growth media [Terrific broth (Novagen Madison, WI.)] and using carbenicillin instead of ampicillin to maintain pSWl within expression hosts, but no improvements in T7-PrtT protein yield were observed. Further attempts to over-express recombinant PrtT were not performed. Efforts were focused on the primary objective of this study; the construction and characterization of mutants. 1.4 Suicide plasmid (pSW3) construction: Suicide plasmid construction involved the insertion of the tetracycline-resistance gene, tetQ (13) into the prtT gene via blunt-end ligation, then the incoiporation of the prtT::ATcR cassette into the wide host range cosmid vector pJRD215, as described in Methods and Materials (Fig. 4). Restriction fragment length analysis was performed to verify that correct plasmid constructs were obtained at each stage of the suicide plasmid construction. Restriction fragment analysis showed that the 2.6 kb tetQ gene was inserted into prtT such that prtT and tetQ genes were aligned in the same transcriptional orientation in pSW2 (Fig. 4). Restriction fragment patterns also verified that the prtT::ATcR cassette was subcloned into the Kpn l-Eco RI site of pJRD215 to create pSW3. The pSW3 construction resulted in the confluence of several important features necessary for its role as a suicide plasmid in P. gingivalis. The pJRD215 vector component of pSW3 provided the Mob site (nic, bom) which allowed the suicide plasmid to be mobilized from E. coli into P. gingivalis via the transfer genes encoded by the Tra operons of pR751 helper plasmid. The prtT::ATcR cassette served as the target for homologous recombination between the suicide plasmid and P. gingivalis chromosome. The absence of P. 40 gingivalis-specific replicative apparatus on pJRD215 vector served to promote the incorporation of the tetracycline-resistance gene into P. gingivalis chromosome by tetracycline selection pressure. 1.5 Conjugation Suicide plasmid pSW3 was mobilized from E. coli J53 (pR751/pSW3) into P. gingivalis W83 and P. gingivalis W83/PM via conjugation to create a prtT single mutant (TSM) and a tpr prtT double mutant (TDM) respectively. A l l procedures were performed as described by Park and McBride (125), but some minor modifications were made in this study to increase transfer frequency. Firstly, very young donor and recipient cells were used in conjugative mating experiments, as recommended Dr. N . B. Shoemaker (University of Illinois, Urbana). In this study, only E. coli and P. gingivalis cells grown to an optical density (600 nm) of 0.10 - 0.15 were used. Secondly, the donor (E. coli) to recipient (P. gingivalis) ratio was increased by approximately three-fold. Maley et al. (94) have previously shown that transfer frequency rose when the donor to recipient ratio was increased. The effectiveness of each modification to the standard protocol has not been analyzed independently in this study, but a noticeable increase in the yield of transconjugants was observed after these changes were adopted. 1.6 Isolation of putative single and double mutants Transconjugants were screened for the incorporation of the tetracycline-resistance gene into the chromosome. P. gingivalis W83 transconjugants were grown on BHI-blood agar plates containing 5 u.g/ml of tetracycline to select for putative prtT single mutants. P. gingivalis W83/PM transconjugants were grown on BHI-blood agar plates containing erythromycin (10 p:g/ml) and tetracycline (3 u.g/ml) to select for putative tpr prtT double mutants. Shoemaker et al. (161) have previously found that the tetracycline-resistance gene expression was weak in P. gingivalis, but strong enough for selection purposes. In this study, tetracycline in excess of 7 |!g/ml was found to significantly reduce the growth rates of putative prtT single mutant clones. The growth rates of 41 putative double mutants were significantly reduced when the tetracycline concentration in the selection media was higher than 5 P-g/ml. A total of three putative prtT single mutant clones were isolated from BHI-blood agar plates containing 5 p:g/ml of tetracycline. The yield of three transconjugants in conjugative mating experiments involving the mobilization of the suicide plasmid from E. coli donor into P. gingivalis W83 represented an average transfer frequency of 3.2x 10"7 per P. gingivalis recipient. A total of ten putative tpr prtT double mutant clones were isolated from BHI-blood agar plates containing erythromycin and tetracycline. This represented an average transfer frequency of 3.6 x 10"7 when suicide plasmid was mobilized from E. coli into P. gingivalis W83/PM. A l l transconjugants were screened via Southern analysis to determine whether a double crossover recombination event between the chromosomal prtT gene and the prtT::ATcR fragment on pSW3 had occurred (Fig. 9). 1.7 Verification of mutation: Southern analysis revealed that all three putative prtT single mutant clones and all ten putative double mutant clones have undergone successful prtT mutagenesis, as mediated by the double crossover recombination event. The prtT single knockout clone was designated as T S M . The tpr prtT double knockout clone was designated as TDM. Two Southern analysis experiments were performed to verify that the prtT gene mutagenesis had occurred via a double crossover homologous recombination event. In the first Southern analysis, P. gingivalis chromosomal D N A was digested with Pst II and Hinc II to generate restriction fragments that would encompass nearly the entire length of prtT, then probed with the wild type 2.3 kb Pst ll-Hinc II prtT fragment (result shown in Fig. 10, Panel A). The appearance of the same 2.3 kb Pst ll-Hinc II fragments in W83 and W83/PM suggested that wild type copies of prtT were present in each strain (Fig. 10, Panel A, lane 1.2). The T S M and T D M , on the other hand, possessed the larger 4.9 kb Pst ll-Hinc II fragments which represented the cumulative length of the 2.3 Kb prtT gene and the 2.6 kb tetracycline resistance gene (Panel A . lane 3, 4). The absence of the wild type copies of prtT in T S M and T D M suggested that double crossover had 42 Pstl j 7c R Hindi 1 PrtT 4.9 kb Pstl Tc R prtT Hindi 1 or Pstl L Hindi l_ prtT Pstl Hindi J I prtT Pstl _L PrtT | Tc R 1 PrtT Hindi 2.3 kb 4.9 kb Figure 9: Possible homologous recombinations between pSW3 and the P. gingivalis W83 and W83/PM chromosome. Thick shaded bars represent the tetracycline-resistance gene. Thick clear bars represent the prtT gene. Restriction enzyme sites and fragment sizes pertinent to Southern (DNA) analysis are shown (please refer to text for further details). 43 PQ CM < CN M Os cn Q OO cn u bp •3 CN u •S cn H; as cn i-l cN • D .55-3 £ _g U -° -s P 3 Ch <*> < 00 —-1 C S . 2 £ 5 ° cd og 3 £ 0 S 1 S oo k. bO •g £ C 3 .2 0 0 3 _ ©" " to £• OX)< 3 s £ M OO . • •*-» CN C * I . 3 cd ' I t o 1 E 3 0 cn 1 • a - S on "5 bfi £ A J o O On Si Q 5 ° £ o a, E - 3 44 2 3 4 7.3 kb 3.5 kb 45 occurred in these strains. In the second Southern analysis experiment (Fig. 10, Panel B), the Pst ll-Hinc 11 digested chromosomal DNA was probed with the 2.6 kb tetQ gene to verify the presence of the tetracycline-resistance gene within the larger 4.9 kb Pst ll-Hinc II fragments from T S M and T D M (Fig. 10, Panel B, lane 3, 4). Finally, to reaffirm that the tpr gene was disrupted by the insertion of the 3.8 kb erythromycin -resistance gene in W83/PM and T D M (Fig. 10, Panel C), chromosomal D N A was digested with Bam HI to generate restriction fragments that encompassed the entire tpr gene, then probed with a 2.5 kb Hind lU-Bam HI tpr fragment. As expected, W83 and T S M strains were shown to possess the smaller wild type 3.5 kb Bam HI tpr fragments. The W83/PM and T D M , on the other hand, generated the larger 7.3 kb fragment which represented the cumulative length of the Bam HI cleaved tpr locus and the 3.8 kb erythromycin-resistance gene. The stability of the prtT knock-out mutation was tested by growing T S M and T D M on blood agar without antibiotics. After 10 consecutive transfers, T S M and T D M colony morphologies remained identical to the wild type strain W83, and Southern analysis produced the same fragment patterns as described above. 2. Mutant characterization studies: 2.1 Growth rates of mutants in different media. The effects of trypticase peptone concentration and different protein supplements on growth rates and the final optical density (OD) of batch cultures were assessed by growing W83 in four different media (TYE, 0.5TYE, 0.5Gelatin, 0.5BSA) (Table 5). The growth rates and final OD of W83 appeared to be media-dependent. High trypticase peptone concentration (in TYE) resulted in high growth rates and high final OD. Low trypticase peptone concentration (in 0.5TYE) resulted in lower growth rates and a lower final OD. Cells from gelatin supplemented 0.5TYE grew faster than cells grown in 0.5TYE. Cells from BSA supplemented 0.5TYE grew slower than cells 46 Table 5: Growth rates of P. gingivalis strains in selected media. " ^ N . Strains M e d i a ^ ^ W83 W83/PM TSM T D M T Y E 0.1001 0.004 (1.35)° 0.073 ±0.008 0.073 ±0.004 0.061 ±0.005 0.5TYE 0.063 ±0.005 (0.40) 0.050 ±0.003 0.050 ±0.002 0.042 ±0.006 0.5Gelatin 0.075 ±0.003 (0.55) 0.054 ±0.002 0.075 ±0.003 0.052 ±0.003 0.5BSA 0.051±0.004 (1.00) 0.048 ±0.003 0.030 ±0.003 0.035 ±0.006 a Growth rate was measured as the change in culture optical density (OD^Q ) per hour during logarithmic growth phase. Each value is the mean + SD (p < 0.05) of three independent determinations. b Numbers in parenthesis are the highest optical density values (ODggg) attained by W83 cultures at stationary growth phase. 47 grown in 0.5TYE. Although the growth rate of W83 was slower in 0.5BSA than 0.5Gelatin, higher final OD was attained in 0.5BSA than in 0.5Gelatin. The growth rates of W83 and mutants were compared to determine the effects of tpr and prtT mutations on growth in each media condition. In the presence of high trypticase peptone concentration (TYE), the growth rates of tpr and prtT single mutants were both reduced by approximately 27% compared to the wild type strain, W83. At low trypticase peptone concentration (0.5TYE), both mutant strains again showed similar magnitudes of growth rate reduction (21%). This result suggested that neither Tpr nor PrtT was more important than the other when growing in T Y E and 0.5TYE media. The distinction between tpr and prtT mutants became more apparent in media supplemented with gelatin and B S A protein substrates. In the 0.5Gelatin medium, the growth rates of W83/PM and T D M were much lower than that of TSM. Only P. gingivalis strains possessing the tpr mutation showed significant growth rate reduction in 0.5Gelatin, while the prtT mutation alone did not appear to affect growth rate at all. These data suggested that Tpr played a greater role in P. gingivalis than PrtT when gelatin was used as the protein supplement. On the other hand, when BSA was present in the media, PrtT is believed to play a greater role in P. gingivalis than Tpr. In 0.5BSA, T S M and T D M growth rates were much lower than W83/PM. Only mutants possessing the prtT mutation showed significant growth rate reductions in 0.5BSA. The tpr mutation alone did not significantly affect P. gingivalis growth rate in BSA-supplemented media. 2.2 Cell surface-associated Arg-X activity: The cell surface-associated Arg-X activity (BAPNA-hydrolyzing activity) of P. gingivalis was examined at regular intervals during the growth cycle in different media (Table 6). Arg-X activity was media- and growth phase-dependent. The Arg-X activity of W83 grown in T Y E was highest during early-logarithmic growth phase (0.25 - 0.35 OD 6 6 0), then decreased by about 3 fold as the culture entered late-logarithmic phase (Fig. 11). The protease activity profiles of W83 in other media also showed high Arg-X activity levels during initial phases of growth, but began to 48 Table 6: Effects of growth conditions and growth phase on Arg-X (BAPNA-hydrolyzing) activity 3 ^*^^S trains M e d i a ^ ^ ^ W83 W83/PM TSM TDM T Y E b c 35±4 (12±2) 8±1 (12±2) 7±1 (15±2) 3±1 (15±2) 0.5TYE 13+3 (17±2) 12±2 (13±2) 11+2 (20+4) 15±2 (13±2) 0.5Gelatin 18±2 (14+1) 6±1 (9+2) 8±2 (15±2) 12±2 (11+1) 0.5BSA 10±2 (15±1) 5±2 (20±4) 7±1 (15±2) 6±2 (15±2) a BAPNA-hydrolyzing activity values are expressed in units/mg of total protein. Each value is the mean + SD of three independent experiments. b The first set of numbers in the table are BAPNA-hydrolyzing activity values attained during early-log phase growth (0.25-0.35 OD660). c Numbers in parenthesis are BAPNA-hydrolyzing activity values attained during late-log phase growth. 49 40 Figure 11: Arg-X (BAPNA) activity of mutants throughout the growth cycle in T Y E media 50 decrease slightly at mid-log phase before increasing again as the culture entered late-log phase. The magnitude of Arg-X activity of W83 during early exponential phase growth was dependent on the media. The highest early-log Arg-X activity of W83 was expressed in T Y E , followed by 0.5Gelatin, 0.5TYE, and lastly 0.5BSA. The order of decreasing Arg-X activity for W83 was the same as the order of decreasing growth rates. The effects of prtT and tpr mutations on Arg-X activity in each media was assessed by comparing the activity profiles of protease mutants to those of wild type throughout the growth cycle in each media. According to Table 6, the prtT mutation significantly reduced Arg-X activity during early exponential phase in T Y E , 0.5BSA and 0.5Gelatin media. No significant differencces in Arg-X activity were observed between prtT mutants and the wild type strain during late-logarithmic phase growth in these media (Table 6 and Fig. 11). This result suggested that the PrtT protease contributed to Arg-X activity during early-log phase growth in T Y E , 0.5BSA and 0.5Gelatin. The prtT single mutant apparently did not show reduced Arg-X activity in the 0.5TYE media, indicating that the PrtT protease did not contribute to the majority of Arg-X activity in the 0.5TYE media or that other Arg-X protease(s) may have been induced in 0.5TYE. The tpr mutation resulted in reduced Arg-X activity during late-log phase growth in 0.5TYE and 0.5Gelatin media, suggesting that the Tpr protease contributed to Arg-X activity in 0.5TYE and 0.5Gelatin at late exponential growth. Like the prtT single mutant, the tpr single mutant also showed reduced Arg-X activity during early-log phase in T Y E , 0.5BSA and 0.5Gelatin, indicating that the Tpr was also involved in Arg-X activity in these media at early-log phase. The tpr prtT double mutant showed higher Arg-X activity at early-log phase in 0.5TYE and 0.5Gelatin than in T Y E and 0.5BSA media. This suggested that Arg-X proteases or activities were induced at early-log phase in the presence of nutritionally poor media (0.5TYE and 0.5Gelatin). 2.3 Gelatin-substrate zymography: Gelatin-substrate zymography of tpr and prtT mutants was performed to determine whether tpr and prtT mutations modulated the expression or activity levels of other P. gingivalis proteases 51 (Fig. 12). Gelatin is a general protease substrate that can be degraded by nearly all P. gingivalis proteases (52). Thus, the cell-associated gelatinase activity that appears on gelatin-substrate zymograms may be a good representation of the total cell-associated proteolytic activity expressed by P. gingivalis. According to Fig. 12, the number of proteases expressed by P. gingivalis W83 and their relative level of activity was media dependent. The three most prominent proteolytic bands produced by W83 in the presence of high trypticase peptone concentration (TYE), were approximately 140, 106 and 80 kDa in size. In the presence of low trypticase peptone concentration (0.5TYE), the intensities of all three major bands were reduced. The 140 and 106 kDa bands appeared as multiple thin bands in the 0.5TYE medium, suggesting that each major proteolytic band is derived from many individual proteases. In 0.5Gelatin and 0.5BSA, both the 140 and 106 kDa bands became more pronounced than those produced in T Y E and 0.5TYE. The 80 kDa band, previously identified as the Tpr protease by Park et al. (127), was highly expressed in 0.5Gelatin by W83, especially at late-log phase. P. gingivalis W83 showed reduced Tpr band intensity in the 0.5BSA medium. The proteolytic band corresponding to the Tpr at the 80 kDa size range was most noticeably reduced in T Y E , 0.5Gelatin and 0.5TYE media at late-log phase in W83/PM and T D M . Interestingly, the tpr single and double mutants also showed reduced 140 and 106 kDa band intensities in 0.5Gelatin medium and at early-log phase in 0.5BSA medium. Gelatin zymography showed no significant difference between T S M and W83. Both T S M and W83 appeared to possess the same number of proteolytic bands and each band showed similar proteolytic intensity. It is unclear why T S M showed no significant difference with the wild type strain in gelatin zymography. One likely possibility is that other Arg-X proteases, collagenases, glycylprolyl peptidases, or Lys-X specific proteases with similar molecular weight as PrtT could have accounted for the majority of the hydrolytic activity on zymograms, thereby obscuring the band belonging to the PrtT protease and making differences among strains indistinguishable. So far, we have not been able to identify a substrate that can be specifically degraded by PrtT. Most 52 A W83 W83/PM TSM T D M 140 -106 -80 - M»aM kDa B W83 W83/PM T S M T D M 1 2 1 2 1 2 1 2 140 -106 -80 -kDa Figure 12: Gelatin-substrate zymograms of P. gingivalis strains. P. gingivalis strains were grown in the T Y E (A), 0.5TYE (B), 0.5Gelatin (C) and 0.5BSA media (D). 0.6 | ig of non-reduced and non-denatured crude membrane sample was used in each lane. Lanes: 1, crude membrane sample from early-log phase; 2, crude membrane sample from late-log phase. 53 54 of the commonly used subsuates used in zymography (i.e., BSA, casein, azocoll) can also be degraded by other P. gingivalis proteases with similar size to the PrtT protease. 2.4 Cell surface-associated hemagglutinating activity Cell-associated hemagglutinating activity was measured throughout the growth cycle in different media to examine the effects of tpr and prtT mutations on hemagglutinating activity (Table 7). The hemagglutinating activity of P. gingivalis was growth phase- and media-dependent. In the T Y E media, the hemagglutinating activity of P. gingivalis W83 was highest during late-log phase. Lower hemagglutinating titers were observed during early- to mid-logarithmic phase. P. gingivalis W83 grown in 0.5TYE and 0.5Gelatin reached highest hemagglutinating activity levels during early- to mid-log phase growth, before decreasing to lower levels at late-log phase. W83 produced low hemagglutinating activity throughout the growth cycle in 0.5BSA media. In the T Y E and 0.5BSA media, the prtT single mutant (TSM) showed lower hemagglutinating activity at late-log phase than the wild type strain, while no significant differences between the mutant and wild type was observed during early-log phase in these media. This suggested that the PrtT protease played a significant role in hemagglutination at late-log phase in T Y E and 0.5BSA media. In addition, based on the observation that T S M and wild type hemagglutination titers varied little during early-logarithmic growth, it might be suggested that the PrtT C-terminus hemagglutinin domain did not contribute to the bulk of total hemagglutination capacity during early-log phase growth. The hemagglutinating activity of T S M in 0.5Gelatin was not significantly reduced, suggesting that the PrtT did not play as an important a role in hemagglutination in the 0.5Gelatin media than in T Y E and 0.5BSA. The tpr mutant (W83/PM) also showed reduced hemagglutination in T Y E , 0.5Gelatin and 0.5BSA media as was the case for the prtT single mutant (TSM). The hemagglutinating activity of W83/PM was significantly reduced at late-log phase in T Y E media. The hemagglutinating activity of W83/PM was reduced throughout the growth cycle in 0.5Gelatin and 0.5BSA media. 55 Table 7: Effects of growth conditions and growth phase on hemagglutinating activity a Media^>^ W83 W83/PM TSM TDM TYE b c 8±2 (14±2) 10±2 (6±2) 10±2 (3±1) 3±1 (3±1) 0.5TYE 14±2 (3±1) 14±2 (3±1) 16±4 (3±1) 3±1 (10±2) 0.5Gelatin 14±2 (3±1) 3+1 (3±1) 12+2 (3±1) 3±1 (10±2) 0.5BSA 10±2 (3±1) 6+2 (3±1) 6+2 (3±1) 3±1 (3±1) a Hemagglutination values are reciprocals of the last dilution showing complete hemaggltination. Each value is the mean + SD of four determinations. b The first set of numbers in the table are hemagglutination activity values attained during early-log phase growth (0.25-0.35 OD660). c The numbers in parenthesis are hemagglutintion activity values attained during late-log phase growth. 56 In the 0.5TYE media, the hemagglutinating activities of tpr and prtT single mutants were not reduced. This suggested that the Tpr and PrtT did not account for the majority of the hemagglutinating activity in nutrient deficient 0.5TYE media, or that P. gingivalis hemagglutinin expression was induced by Tpr and PrtT mutants. The tpr prtT double mutant showed higher hemagglutination titers at late-log phase in 0.5TYE and 0.5Gelatin than in T Y E and 0.5BSA media, suggesting that hemagglutination activity was induced at late-log phase in the nutrient poor media (0.5TYE and 0.5Gelatin). 2.5 Survey of membrane-associated proteins: SDS-PAGE analysis of denatured and reduced crude membrane proteins did not reveal any significant differences between wild type and mutant strains (Fig. 13). Distinct differences between wild type and mutant strains, however, were revealed by SDS-P A G E analysis of non-denatured, non-reduced extracts of P. gingivalis strains (Fig. 14). For wild type P. gingivalis W83, the progression of growth from early- to late-log phase in T Y E media was accompanied by the gradual buildup of a distinct series of 120 kDa proteins towards the stationary phase. The W83/PM, T S M and T D M strains, however, showed almost a complete absence of these proteins from the start of the growth cycle. Gelatin zymography was performed using these same extracts to determine if the 120 kDa proteins may represent proteases. Fig. 12 showed that proteolytic activity was observed in proteins of 140 kDa range in each strain. No distinct, progressively increasing gelatinase activity was seen in the 120 kDa range from early- to late-log phase in W83 crude membrane samples 2.6 Northern (RNA) Analysis of prtT P. gingivalis W83 total RNA was isolated at regular intervals during logarithmic growth in T Y E , 0.5Gelatin, 0.5BSA and 0.5TYE media and probed with the biotin-labeled 2.9 kb prtT gene. The prtT gene expression was growth phase-dependent and media-dependent (Fig. 15). The prtT gene was highly transcribed during early-logarithmic growth in 0.5BSA and T Y E media. Lower 57 W83 W83/PM TSM TDM 1 2 3 1 2 3 1 2 3 1 2 3 kDa Figure 13: Silver-stained SDS-PAGE gel of reduced and denatured crude membrane samples of P. gingivalis W83, W83/PM, TSM and T D M . Lanes: 1, crude membrane samples from early-log phase; 2, crude membrane samples from mid-log phase; 3, crude membrane samples from late-log phase. 58 transcriptional activity was observed during late-logarithmic phase in 0.5BSA and T Y E and in 0.5Gelatin and 0.5TYE media. The quantification of mRNA would normally require the use the of an internal control, such as a constitutively expressed gene similar to the use b-actin or hypoxanthine phosphoribosyl-transferase as internal transcriptional control in eucaryotic cells. However, at this point in time, no constitutively expressed gene has been identified for P. gingivalis. In this study, in order to circumvent the problem that the apparent decrease in prtT gene expression at late-log phase might not represent a relative percent decrease in prtT gene expression, twice the quantity of sample RNA from late-log phase was used in Northern analysis than sample R N A from early-log phase. Even though more R N A from late-log phase was used in Northern analysis, the prtT transcript remained undetectable at this growth stage. This confirmed that prtT gene expression was not favored at late-log phase, but favored at early-log phase. The prtT transcript was detected as an 11 kb transcript, which is larger than the predicted prtT transcript size of 3.3 kb (93). We have not been able to detect prtT mRNA as a 3.3 kb transcript at any growth phase or in any media condition, but only as a 11 kb transcript during early-log phase growth in T Y E and 0.5BSA media. The larger than expected prtT transcript size suggest that other genes may be cotranscribed along with prtT. It is currently not known which genes may be cotranscribed with prtT. The tpr transcript has been previously shown to be 1.7 Kb in size, which corresponded to its gene size. The tpr gene expression profile in each media is very different from that of prtT. According to Y . Park et al. (125, 126), tpr gene expression was induced in nutrient-poor media such as 0.5 T Y E and 0.5 Gelatin. Lower gene expression was found in nutrient-rich media such as T Y E and 0.5BSA, but tpr gene expression increased in T Y E as the culture reached late-logarithmic phase growth. 60 pq m o m en (N CM t C3 . — -a a> e 5 < : - H « CQ O &o l O -5 • > <o G o cd O ft, O > . . 'I 0 § I G 2 ^ • - 1 O H - - . C (o =2 .2 -e S •a « ~ S i tti ro g cd 0 0 0 s -a 2^ a"' k. cd ex £ a CO S . 0 0 00 . cd ft, . 3 „ OH <N en _ o o pi •33 OH g o G 2 _ 3 OH _ u 2 o P . . J O - OH 2 3 <u < cn fa H 2 > 61 20 [40 i i i i i r o 0.25 0.5 0.75 1 1.25 1.5 Culture OD 660 W83 Arg-X (BAPNA) activity ™ 0 ™ T S M Arg-X (BAPNA) activity •-B--' W83 Hemagglutination •-•<•••' T S M Hemagglutination Figure 16: Arg-X (BAPNA) and hemagglutinating activity of prrr-single mutant in the T Y E media. 62 DISCUSSION In patients with severe adult periodontitis, the gingival crevice is bathed with serum transudate containing tissue and serum proteins, contents of lysed epithelial cells, amino acids, vitamins and other growth factors. The supply of rich nutrient sources supports a large population of nutritionally fastidious organisms. But as bacterial growth continues and the competition for nutrients intensifies in the gingival crevice, certain essential growth factors may eventually become limiting in the subgingival micro-environment. The growth of P. gingivalis in the gingival sulcus is likely to be irregular as the bacteria periodically experience 'feast' and 'famine' nutritional conditions. In times of bounty, such as during severe gingival pathology, P. gingivalis would thrive as the flow of crevicular transudate and blood would satisfy all nutritional needs. But in time of poverty, growth would slow down as one or more growth limiting nutrient becomes depleted. The various stages of bacterial proliferation in the micro-environment may be mimicked by the growth cycle of P. gingivalis in batch cultures. Early exponential phase growth may resemble the initial stages of P. gingivalis infection in which nutrient sources abound. As the nutrient sources are consumed and metabolic end products accumulate in the batch culture, as they would in the gingival micro-environment, growth would slow down. Late exponential phase growth may resemble the latter stages of gingival infection as essential nutrients become depleted and waste products accumulate. In this investigation, the adaptive responses of P. gingivalis to different protein nutrients was examined using the batch culture technique to simulate the growth dynamics of the confined P. gingivalis community in the gingival pocket. Physiological changes of the bacteria in the continuously changing environment during batch culture growth were closely monitored by sampling the cultures throughout the growth cycle. The roles of Tpr and PrtT in media of different protein substrate composition was analyzed by examining the effects of tpr and prtT knockouts in each growth condition. The effects of trypticase peptone concentration on tpr and prtT mutants 63 was assessed by growing strains in T Y E and 0.5TYE. The effects of different protein supplements in the media was assessed by growing in 0.5Gelatin and 0.5BSA. Gelatin and bovine serum albumin were chosen to represent endogenous protein nutrients commonly available to P. gingivalis as energy sources in vivo. Gelatin represented the denatured fragments of collagen from periodontal ligament fibers and basement membranes. B S A represented serum albumin, which is a prevalent protein found in the crevicular fluid of inflamed periodontal lesions and pockets (95, 112). The amino acid sequence and composition of bovine serum albumin has been found to be nearly identical to the human serum albumin (130). 1. Wild type characteristics: 1.1 Growth rate: In batch culture, P. gingivalis responded differentially to the presence of different protein substrates in the growth media. According to growth rate analysis (Table 5), the growth rate of P. gingivalis W83 varied according to the composition of the growth media. The physical conformations and the nutritional values of protein substrates in the media affected both the growth rates and the final optical densities attained by each culture at stationary phase. The growth rate of wild type P. gingivalis W83 is believed to be determined by the physical conformations of protein substrates and their relative concentrations in the media. The highest growth rate was observed in T Y E media, which contained the highest concentration of protein hydrolysates and small peptides that may be directly assimilable by P. gingivalis. Lower growth rates were observed in media containing lower concentrations of freely available protein hydrolysates/peptides (0.5TYE). The addition of gelatin into 0.5TYE was found to increase the growth rate, while the addition of BSA into 0.5TYE was found to decrease growth rate. Gelatin is believed to enhance growth rate because the gelatin substrate consists of denatured collagen fragments of various sizes that may be easily degraded and then assimilated by P. gingivalis. The B S A supplement, on the other hand, is believed to reduce the growth rate because the 66 kDa BSA 64 moiety exists in cits native conformation. Proteolytic processing and assimilation of B S A is believed to take longer than gelatin, because BSA must first be cleaved by proteolytic enzymes into smaller polypeptide chains before it can be further degraded into small peptides that are readily assimilable by P. gingivalis. Leduc et al. (82) have previously shown that the growth rate of P. gingivalis W83 in BSA supplemented media was responsive to the state of degradation of BSA during culture growth. SDS-PAGE analysis of culture supernatants from BSA-containing media showed that the physical conformation of BSA directly affected bacterial growth rate. According to Leduc at al (82), the growth of P. gingivalis in a medium containing a higher concentration of B S A [1% (W/V)] than used in this study produced a diauxic growth curve. During the early-log phase of the growth curve, when B S A was undegraded, the growth rate was low. But upon further degradation of BSA into low molecular weight fragments in late-log phase, the growth rate increased. Although the growth of P. gingivalis in 0.5BSA medium was the slowest among all media, the highest culture optical density was reached at stationary phase in this medium. High final optical density was also reached by P. gingivalis W83 in T Y E , a complex medium containing a high concentration of trypticase peptone. Lower final optical density was recorded when cultures were grown in 0.5Gelatin and 0.5TYE media, which possessed lower levels of trypticase peptone. These data suggest that the final optical density of the culture may be determined by the overall nutritional values of the protein supplements in the media. Higher culture optical density was attained in media containing higher trypticase peptone or protein substrates of higher nutritional value, whereas lower culture optical density was attained in media of lower nutritional value. The gelatin substrate provided lower nutritional value to P. gingivalis than BSA because it consisted of a limited variety of amino acids. The gelatin polypeptides consists of repetitive amino acid sequences, in which every third residue is Glycine [i.e., (-Gly-Xaa-Yaa)J with a great preponderance of Xaa and Yaa residues being Proline and Lysine (98). In contrast, the B S A protein consists of a greater variety of amino acids than gelatin. Amino acid composition analysis 65 showed that B S A possesses higher proportions of aliphatic, acidic, basic, aromatic and sulfur-containing amino acid residues than gelatin (130). 1.2 Arg-X activity: Besides affecting the growth rate and final optical density, the media also seemed to have affected the level of Arg-X activity produced by P. gingivalis W83 during the initial stages of exponential growth. Higher Arg-X activity was produced by cells growing in media containing higher concentrations of protein hydrolysates or denatured polypeptides (TYE and 0.5Gelatin). Lower Arg-X activity was produced by P. gingivalis W83 during early-logarithmic phase in media containing lower concentrations of freely available protein hydrolysates, such as 0.5TYE and 0.5BSA. The Arg-X activity at early-log phase was highest in T Y E , followed by 0.5Gelatin, 0.5TYE and finally 0.5BSA, which is identical to the order of highest to lowest growth rates attained by W83 in the four different media. On the one hand, the association between Arg-X activity and growth rate raises the possibility that P. gingivalis may have induced Arg-X specific protease activity or expression in response to high concentration of protein hydrolysates during initial stages of growth, which in turn enhanced the growth rate by facilitating the degradation of protein hydrolysates. On the other hand, the presence of high concentrations of freely available protein hydrolysates or denatured polypeptides themselves may have directly resulted in growth rate increases and Arg-X proteases did not play a significant role in enhancing growth rates. The T Y E and 0.5Gelatin media may possess polypeptides or peptides that can be readily made available for assimilation by nonspecific proteases, without the need for aggressive Arg-X proteolytic activity. Currently we do not know whether W83 fully depended on early-log Arg-X activity in T Y E media or whether the high Arg-X activity produced by W83 in T Y E is an adaptive response to higher concentrations of protein hydrolysates present during initial growth conditions. As the growth of W83 proceeded to mid-logarithmic phase, a drop in cell-associated Arg-X activity was observed in all media. The drop in Arg-X protease activity during mid-log phase may be attributed to the release of vesicles and vesicle-associated proteases from P. gingivalis outer 66 membrane into the culture media. Smalley et al. (179) have previously shown that the amount of extracellular vesicles and vesicle-associated Arg-X activity in the media increased when cells reached mid-exponential growth and continued to rise as cells grew to late-exponential growth phase. According to Smalley and Marsh (176), the extracellular vesicles at late-log phase were equivalent to approximately 10 % of the total dry weight of cells yet possessed nearly 80% of the total membrane associated Arg-X activity. Due to the high level of Arg-X activity at early-log phase, followed by the appearance that cells slowed down the production of cell-associated Arg-X protease at mid-log phase and predominance of the Arg-X activity allocated to the vesicle fraction, a sizable fraction of the vesicle associated Arg-X activity at late-log phase is believed to be derived from early-log Arg-X proteases. P. gingivalis cells presumably resumes Arg-X protease production as cells reach late-log phase growth as shown by the increasing Arg-X activity during latter stages of logarithmic growth in 0.5Gelatin and 0.5BSA media. However, the increase in Arg-X activity produced at late exponential growth phase was not associated with a rise in W83 growth rate. The Arg-X activities of W83 produced at late-log phase in different media appear to be unrelated to the growth rates of W83. 1.3 Hemagglutinating activity: Cell-associated hemagglutinating activity was measured to assess the relationship between hemagglutination and Arg-X proteolytic activity in W83. The Arg-X activity of P. gingivalis has been previously shown to be associated with hemagglutination (). Grenier demonstrated that P. gingivalis strains with strains high cell-associated Arg-X protease activity attached in greater numbers to erythrocytes and epithelial cells than strains with low levels of Arg-X activity (46). Hoover et al (58) reported that Arg-X protease-deficient mutants obtained by nitroguanidine mutagenesis exhibited concomitant reduction in cell-associated A r g - X activity and hemagglutination. Furthermore, Chandad et al. (18) showed that three mutants deficient in hemagglutinin showed decreased cell surface-associated Arg-X activity. 67 In this study, the hemagglutinating profile of W83 throughout the growth cycle was very different from the Arg-X activity profile of W83 grown in the same media (Fig. 16). In the T Y E medium, P. gingivalis W83 hemagglutination was lower during early to mid log phase growth and higher at late-log phase. The cell-associated Arg-X activity, in contrast, was highest at early-log phase and lower at late-log phase. The fact that the Arg-X activity of W83 was not directly associated with hemagglutination suggests that a large percentage of the hemagglutinating activity produced by P. gingivalis may be mediated by cell surface components other than Arg-X proteases. A number of different erythrocyte-binding adhesins besides Arg-X proteases are expressed by P. gingivalis and are believed to be responsible for a sizable fraction of the hemagglutinating activity at late-log phase in T Y E media. Progulske-Fox et al. (35) have identified multiple hemagglutinin proteins, HagA, HagB and HagC, on the P. gingivalis cell surface. The hagC gene has been shown to be preferentially expressed at late-log phase in the peptone-rich Todd-Hewitt broth (85). Ogawa et al. (116) has also shown that fimbriae possessed hemagglutinating ability. Furthermore, the lipopolysaccharide of P. gingivalis has been implicated in the adherence to erythrocytes (119). Further evidence that a significant portion of hemagglutinating activity in wild type P. gingivalis may be mediated by factors unrelated to Arg-X proteases is shown by the fact that the total cell-associated Arg-X activity and hemagglutinating activity of P. gingivalis W83 appeared to be influenced by different conditional .parameters of the media. The level of early-log Arg-X activity was found to be directly proportional to the concentration of freely available protein hydrolysates. Hemagglutinating activity levels were inversely proportional to the nutritional value of the media. Hemagglutinating activities of W83 reached their highest levels in nutritionally poor media such as 0.5TYE and 0.5Gelatin. High hemagglutinating activity was also observed in media where nutrients may have been depleted, such as the T Y E media during late-log phase. The hemagglutinating activity of W83 was lowest in 0.5BSA throughout the growth cycle, suggesting diat hemagglutination was repressed in the nutritionally rich media. 68 2. Mutant characteristics: 2.1 Growth rate: The effects of tpr and prtT mutations on growth rates in different media reflected the importance of each protease in different growth condition. The prtT mutation resulted in significant growth rate reduction in 0.5BSA media, but barely noticeable effects in the 0.5Gelatin media. The tpr mutation resulted in significant growth rate reduction in 0.5Gelatin media, but not in 0.5BSA media. These results suggested that the PrtT protease played a more significant role in 0.5BSA than Tpr, while the Tpr protease played a more significant role in 0.5Gelatin than PrtT. Northern analysis supported the concept that specific proteases were involved in the growth of P. gingivalis in specific media. Northern analysis data showed that P. gingivalis W83 favored the expression of certain protease genes in response to the presence of certain protein nutrient. The prtT gene was expressed at a higher level than tpr in 0.5BSA, while the tpr gene was expressed at a higher level than prtT in 0.5Gelatin. Based on the association between protease gene expression levels and effects of prtT and tpr mutation on growth rate in 0.5BSA and 0.5Gelatin media, it may be suggested that PrtT protease was specifically expressed in 0.5BSA, while the Tpr protease was specifically expressed in 0.5Gelatin. However, this assertion is based on the assumption that protease mRNA levels directly reflected the quantity of PrtT and Tpr produced on the cell surface. There exists the possibility that Tpr and PrtT transcripts are subject to translational regulation in the cytosol, but we have no effective means as yet to examine this possibility. Currently, specific antibodies to Tpr and PrtT have not been developed to accurately quantitate the relative levels of Tpr and PrtT in different media conditions. Anti-recombinant Tpr developed by Park et al.. (127) did not show strong affinity to Tpr and has been shown to cross-react with several other P. gingivalis membrane proteins, including membrane proteins with similar size to the Tpr protease. In this study, we have not been able to over-express recombinant PrtT in E. coli to enable us to generate specific anti-prtT serum. Despite our inability to detect the physical presence of Tpr and PrtT, the fact that mutants 69 grown in media favorable to protease gene expression showed greater growth rate reduction than when the same mutants were grown in media unfavorable to protease gene expression suggested that protease mRNA expression level is a good indicator of the importance of a protease in a given media. Differences in the trypticase peptone concentration appeared to have had little influence on the relative importance of Tpr and PrtT in T Y E and 0.5TYE. According to growth rate analysis, both Tpr and PrtT were approximately equally important to growth in T Y E and 0.5TYE media. Table 1 showed that both tpr and prtT mutations reduced growth rates by approximately 27% in T Y E . The growth rates of tpr and prtT mutants were also reduced by approximately the same percent magnitude (21%) in the 0.5TYE media. Northern analysis supported the notion that both tpr and prtT played significant roles in the T Y E medium, as both tpr and prtT mRNA were found to be expressed at approximately equivalent levels in this medium (125, 126). In the 0.5TYE media, however, a clear discrepancy between protease gene expression level and the relative importance of each protease in 0.5TYE was apparent. Northern analysis data did not support growth rate analysis data that Tpr and PrtT were both equally important to growth. According to Northern analysis (15), the tpr transcriptional activity was much higher than prtT in 0.5TYE, yet each protease seemed to have played equally significant roles in this media, according to growth rate analysis. One possible explanation for the discrepancy between protease gene transcriptional activity and the relative significance of Tpr and PrtT in 0.5TYE is that protein substrate deficiency in 0.5TYE media may have rendered the Tpr protease or any other proteases mostly inconsequential to growth. Growth rate differences between wild type and mutant strains was lower in 0.5TYE media than in the T Y E media. The possession of any proteases is not believed to be highly advantageous to P. gingivalis in 0.5TYE since very low concentrations of protein substrates were present in the media. Perhaps because the growth rates of all strains in 0. 5TYE were reduced by approximately the same percent magnitude when compared to their respective growth rates in TYE, it produced the appearance that Tpr and PrtT contributed equally to growth in 0.5TYE. 70 2.2 Arg-X activity: Arg-X protease activities were markedly reduced in single and double tpr and prtT mutants, indicating that the Tpr and PrtT proteases made significant contributions to the Arg-X activities of P. gingivalis. In T Y E and 0.5BSA media, the prtT mutants showed significant Arg-X activity reduction during early-log phase, which was the same growth phase at which wild type W83 showed high prtT gene expression in T Y E and 0.5BSA media. In the 0.5TYE and 0.5Gelatin media, significant Arg-X activity reduction was observed among tpr mutants during late-log phase, which was the growth phase at which W83 expressed high levels of tpr mRNA in 0.5TYE and 0.5Gelatin. The PrtT protease did not play a significant role in Arg-X activity during late-log phase in any media. At late-log phase, most of the PrtT protease may be allocated to the culture supernatant or vesicle fraction, which may explain why the cell-associated Arg-X activity of prtT mutant appeared similar to the wild type. Interestingly, equally significant reductions in Arg-X activity were also observed among mutants when grown in media that did not favor tpr and prtT gene expression. According to Table 6, significant Arg-X activity reduction occurred in specific media and/or growth phases in which tpr or prtT gene expression by W83 was nearly undetectable by Northern analysis. In 0.5BSA and T Y E media, significant Arg-X activity reduction was observed in W83/PM during early-log phase even though very low tpr gene expression by W83 occurred during early-log phase in these media. In 0.5Gelatin, significant Arg-X activity reduction was observed in T S M during early-log phase even though prtT gene expression was not favored throughout the growth cycle in this media. These observations suggested that Arg-X activity reduction may not be the direct result of tpr and prtT mutations alone. The prtT and tpr mutations may have indirectly resulted in Arg-X activity reduction in 0.5Gelatin and 0.5BSA media respectively. It is unclear how the tpr mutation could have resulted in significant Arg-X reduction during early-log phase growth in T Y E and 0.5BSA media when the tpr gene did not appear to be highly expressed in these media conditions. But one likely way tpr mutation could have significantly 71 reduced Arg-X reduction in T Y E and 0.5BSA is by modulating the expression or activity levels of other P. gingivalis Arg-X proteases. Gelatin zymography data showed that the tpr mutation may have adversely affected the expression of other proteases during early-log phase in T Y E and 0.5BSA. In 0.5BSA and T Y E , W83/PM showed reduced gelatinase activity at the 140-106 kDa range during early-log phase. In 0.5Gelatin as well, the intensity of the 140 and 106 kDa proteolytic bands was reduced in W83/PM throughout the growth cycle, in addition to the absence of the 80 kDa Tpr band. Currently, it is not known whether the 140-106 kDa protease bands may represent Arg-X-specific proteases or whether these two prominent bands may represent a collection of different proteases of different substrate specificity with similar molecular weight. Therefore, we cannot as yet determine whether the reduced Arg-X activity of W83/PM observed in various media was specifically due to the tpr gene knockout or the reduced activity of other Arg-X proteases in the 140-106 kDa range. Because we cannot rule out the possibility that the 140-106 kDa proteases included Arg-X proteases, we cannot conclude that Tpr possesses Arg-X activity, even though tpr mutants showed markedly reduced Arg-X activity. The way by which the tpr mutation could have affected the expression or activity levels of proteases in the 140 - 106 kDa range has not been determined. Also, it is not known how prtT mutation resulted in significant Arg-X activity reduction in 0.5Gelatin when prtT gene expression was nearly undetectable by Northern analysis in this media. Several explanations for these phenomena exist. First, the allelic replacement mutagenesis event might have inactivated the transcriptional activity of other Arg-X protease genes located downstream of tpr and prtT genes that would otherwise be expressed in 0.5BSA and 0.5Gelatin respectively. Park and McBride (127) have previously shown that besides the absence of the Tpr protease in W83/PM, a protein of an approximate molecular mass of 27 kDa was also missing in the tpr single mutant. The identity of the 27 kDa protein has not been determined and it is not yet known if the 27 kDa protein played a role in modulating the expression or activity of other proteases. The prtT mutation could have inactivated the expression of the two recently cloned hemR and orfl genes (67) found adjacent to the prtT locus in the chromosome. Both HemR and Orfl may exert direct or indirect effects on 72 Arg-X activity of P. gingivalis in 0.5Gelatin media. At this point in time, all reasons proposed for these observations are hypothetical and are largely unrelated to Tpr and PrtT activities. But if Arg-X reduction is in fact related to Tpr and PrtT, the isogenic protease knockout technique used in this study may be providing us potentially important insights on the subtle roles that Tpr and PrtT might play in media when their expression is low. Although early-log Arg-X activity of T S M was reduced in 0.5Gelatin, the Arg-X activity reduction was not evident in gelatin-substrate zymography. According to the zymography data (Fig. 12), the hydrolytic activity profile of T S M during early-log phase growth in T Y E , 0.5BSA and 0.5Gelatin was comparable to wild type W83. One possible reason for the lack of any distinct differences between wild type and T S M in gelatin zymograms is that PrtT might have been inactivated after exposure to the harsh electrophoretic treatment. However, this is unlikely as the recombinant PrtT protease purified from E. coli by Otogoto et al. (123) has been previously shown as a proteolytically active band in gelatin-substrate zymograms. Another possible explanation for our inability to decipher differences between prtT mutants and the wild type strain is that the close proximity of individual proteolytic bands at the 140-106 kDa range could have obscured the band belonging to the PrtT protease. The PrtT protease has a putative molecular mass of 98 kDa, which is similar in size to most other P. gingivalis proteases. The presence of other proteases in P. gingivalis such as collagenases and Lys-X-specific proteases may have accounted for a large proportion of hydrolytic activity in the same size range as PrtT protease, thereby making Arg-X differences between prtT mutants and W83 indistinguishable. The absence of distinct differences between TSM and W83 strains may suggest that the prtT mutation produced minimal modulating effects on the activity or expression levels of other proteases. Alternatively, the absence of differences may suggest that other proteases of different substrate specificity such as collagenases or Lys-X active proteases with similar molecular weight as PrtT were induced to compensate for the loss of PrtT. The induction of Arg-X and/or non-Arg-X proteases may explain why the significant reduction in Arg-X activity during the initial stages of growth did not affect the growth rate of TSM in 0.5Gelatin media. The 80 kDa Tpr protease is one 73 of the proteases expressed by T S M in 0.5Gelatin according to gelatin zymography. The Tpr protease has been determined to be an important protease to the growth of P. gingivalis in 0.5Gelatin media and the tpr gene has been shown to be highly expressed in 0.5Gelatin. Similarly, the tpr single mutant (W83/PM) could have induced PrtT expression in 0.5BSA and may explain why significant Arg-X activity reduction at early-log phase did not significantly affect the growth rate of W83/PM in 0.5BSA. The PrfT protease has been previously determined to play a significant role in 0.5BSA media and shown to be highly transcribed in 0.5BSA. The proteolytic band corresponding to the PrtT protease, however, could not be detected in W83/PM on gelatin zymograms. 2.3 Hemagglutination: Significant reduction in hemagglutinating activity among Tpr and PrtT mutants suggested that the Tpr and PrtT proteases contributed to the hemagglutinating activity of P. gingivalis. The extent to which each protease were involved in hemagglutination of P. gingivalis depended on the media. The largest percent reduction in hemagglutinating titers among tpr and prtT mutants was observed in media that favored tpr or prtT gene expression, respectively. Table 7 showed that the PrtT protease played a significant role in the hemagglutinating activity of P. gingivalis during late-log phase in T Y E and 0.5BSA media. The Tpr protease appeared to have accounted for the majority of the hemagglutination activity in 0.5Gelatin and nearly 50% of hemagglutinating activity at late-log phase in T Y E media. The hemagglutinating titers of mutants grown in the nutrient-deficient 0.5TYE medium were not reduced, suggesting that neither protease played a significant role in hemagglutination in 0.5TYE, and/or hemagglutinating factors were induced during nutrient deficiency. The induction of hemagglutinating factors during nutrient deficiency seems a likely possibility as the wild type W83 demonstrated higher hemagglutination in 0.5TYE than in 0.5BSA. Furthermore, the tpr and prtT double mutant also showed elevated hemagglutinating activity in the nutrient deficient 0.5TYE and 0.5Gelatin media at late-log phase. Low 74 hemagglutinating activity was observed throughout the entire growth cycle of T D M grown in nutritionally rich T Y E and 0.5BSA media. Despite the apparent significance of PrtT and Tpr in hemagglutination, the Tpr and PrtT proteases are not believed to be directly involved in the hemagglutinating activity of P. gingivalis. The effects of tpr and prtT mutations on hemagglutination appeared very different from proteases such as Arg I, Arg-gingipain and cc-gingivain, which have been previously shown to be directly associated with hemagglutinating activity. Isogenic knockout mutants of Arg I, Arg-gingipain and ct-gingivain proteases showed concomitant reductions in cell associated Arg-X activity and hemagglutination at late-log phase in various peptone-rich media (58, 107, 202). The tpr and prtT mutants, on the other hand, did not show concomitant reductions in Arg-X activity and hemagglutination at late-log phase in the peptone-rich T Y E media. In this study, a comparison of Arg-X activity and hemagglutination profiles throughout the growth cycle in different media showed that the timing of hemagglutination reduction observed in different media did not match the timing of highest Arg-X activity reduction in each media (Fig. 16). Arg-X activity reduction of T S M and W83/PM occurred during early-log phase, whereas hemagglutinating activity was most notably reduced during late-log phase. The differences between the effects of tpr and prtT mutations from other Arg-X protease mutations on hemagglutination suggested that the Tpr and PrtT proteases served very different roles from other Arg-X proteases in P. gingivalis. The difference between Tpr and PrtT proteases from that of other Arg-X proteases may be attributed to differences in gene sequence and gene structure. As mentioned earlier, the tpr and prtT gene sequences are unique among P. gingivalis cysteine proteases in that they showed no homology to any other cysteine proteases or to each other. The Tpr and PrtT also differed from Arg I, Arg-gingipain and a-gingivain proteases by their gene structure. Recently, a genetic basis for the association between Arg-X activity and hemagglutination has been established for Arg I, Arg-gingipain and a-gingivain proteases. These proteases are believed to directly confer hemagglutination because each protease gene encodes for a C-terminus hemagglutinin domain. Allelic replacement mutagenesis of protease genes is believed to have inactivated the expression of 75 these genes, containing both the proteolytically active domain and C-terminus hemagglutinin domains, resulting in the appearance that Arg-X activity is directly associated with hemagglutination. The tpr protease gene, on the other hand, does not encode a hemagglutinin domain. The PrtT protease does encode for a C-terminus hemagglutinin domain, but its nucleotide sequence is different from that of Arg I, Arg-gingipain and a-gingivain. In addition, the prtT gene knockout apparently did not have a significant direct impact on hemagglutinating activity at early-log phase, when prtT gene expression was highest. Perhaps due to absence of an analogous C-terminus domain in Tpr and PrtT, the Arg-X activity reduction due to tpr and prtT mutation was not directly associated with hemagglutination reduction. There exist several ways by which prtT and tpr mutations could have affected hemagglutination of P. gingivalis. First, the tpr and prtT mutations may have altered the expression or activity levels of cell factors that mediate adhesion between P. gingivalis and erythrocytes. Alternatively, the tpr and prtT mutations could have disrupted the proteolytic processing of cell-associated adhesins such as fimbriae or other erythrocyte-binding proteins. The Tpr and PrtT proteases may serve similar roles in P. gingivalis as Arg-gingipain (RGP). Nakayama and Yamamoto (108) have recently identified RGP as a processing proteinase responsible for the maturation of two major P. gingivalis cell surface proteins, fimbrillin and the 75 kDa major surface protein. The Arg-gingipain I-deficient mutant showed reduced capacity to adhere to epithelial cells and gram-positive bacteria, altered fimbriation, and reduced 43 kDa fimbrial subunit expression (76). Furthermore, the Tpr and PrtT proteases may be involved in the post-translational modification of other cysteine proteases with hemagglutinin domains. Recent studies suggests that proteolytic processing of large, precursor cysteine protease-hemagglutinin complexes into smaller independent protease and hemagglutinin moieties is a common event in P. gingivalis (77). Barkocy-Gallagher et al. (8) have identified several putative cleavage sites preceded by Arg or Lys residues within the amino acid sequences of several cysteine proteases with hemagglutinin domains. The multiple forms of Arg-gingipain and Lys-gingipain occurring as 110, 95, 70-90 and 50 kDa proteins in the culture media, 76 vesicles and cell membrane have been shown to be produced by the cleavage of large protease-hemagglutinin preproprotein precursors (133). The proteolytic activities conferred directly or indirectly by Tpr and PrtT may be involved in processing erythrocyte-binding factors that mature and/or accumulate as the cells reach later stages of growth. According to Tables 6 and 7, the extent to which tpr and prtT single mutations affected hemagglutination paralleled the magnitude of early-log Arg-X activity reduction in each media. In T Y E media, a large decrease in early-log protease activity coincided with a large decrease in hemagglutination at late-log phase. Smaller decreases in Arg-X protease activity at early-log phase in 0.5Gelatin and 0.5BSA coincided with smaller reductions in hemagglutination throughout the growth cycle. When early-log Arg-X activities were not reduced, as was the case for tpr and prtT single mutants grown in 0.5TYE, no hemagglutination reduction was observed in this medium. Similarly, when early-log Arg-X activities were induced in T D M grown in 0.5TYE and 0.5Gelatin, no hemagglutination reduction were observed at late-log phase. These results suggested the potential importance of cell-associated Arg-X activity at early-log phase to the hemagglutinating activity of P. gingivalis at later stages of growth. The potential effects of early-log Arg-X activity reduction on membrane associated proteins were shown by SDS-PAGE analysis. According to Fig. 14, a series of 120 kDa membrane-associated proteins, normally present in W83 at late-log phase, were missing among tpr and prtT mutants. The identity of lower molecular weight proteins has not been determined. However, gelatin-substrate zymography has eliminated the possibility that these 120 kDa proteins are proteases. The 120 kDa proteins may be autodegradation products of proteases or quite possibly, hemagglutinins or other adhesins that mature and accumulate at late-log phase. In the future, we will attempt to determine whether the lower molecular weight proteins are hemagglutinins derived from the C-terminus of cysteine protease preproproteins. The potential involvement of Tpr and PrtT in post-translational modification of cysteine proteases with hemagglutinin domains will be investigated via immunoblot analysis using an anti-hemagglutinin antibody. 77 2.4 Summary: In summaiy, our data demonstrate that specific P. gingivalis proteases may be involved in the metabolism of specific target substrates. The prtT gene has been shown to be expressed in response to the presence of BSA, while the tpr gene was expressed in response to the presence of gelatin. PrtT and Tpr proteases made significant contributions to both the growth rates and Arg-X activity of P. gingivalis in BSA and Gelatin-supplemented media, respectively. The involvement of specific proteases in specific growth conditions has important implications on the mechanisms of pathogenesis in periodontitis. Our findings suggest that specific P. gingivalis proteases may participate in the degradation of specific components of the host serum proteins or gingival tissue proteins during specific stages of pathogenesis in the gingival crevice micro-environment. The involvement of PrtT in the metabolism of a native complex substrate such as BSA during early-log phase suggests that it plays an important role during the initial stages of P. gingivalis pathogenesis. The PrtT protease may be one of several cell constituents produced by P. gingivalis in response to the influx of nutrient-rich crevicular fluid at the start of the growth infection cycle and may be involved in the proteolytic degradation of human serum albumin in vivo. However, as of yet, we have no direct evidence of its ability to degrade serum albumin. According to Otogoto et al. (123), a proteolytically active 53 kDa recombinant PrtT expressed from E. coli was unable to degrade BSA. This finding, however, may be challenged as one may speculate that perhaps physical conformation changes to the 53 kDa. PrtT due to improper protein folding in the E. coli cytosol, the absence of the C-terminus hemagglutinin domain or absent cofactors could have contributed to the absence of proteolytic activity against BSA. If the PrtT did not directly participate in the degradation or metabolism of BSA, it may be suggested that the prtT mutation produced non-specific effects in trans that adversely affected the expression of other genes involved in B S A metabolism. The prtT mutation could have also simultaneously inactivate the expression of genes downstream of the prtT gene which are involved in BSA metabolism. According to Northern analysis, prtT may be cotranscribed along with several other genes, some of which may include the recently cloned hemR and orfl genes found adjacent to the prtT locus in the chromosome. The 78 carboxy terminus of the HemR protein has been recently found to display almost a complete identity with the PrtT protease domain, suggesting that it may also confer Arg-X proteolytic activity (67). If the prtT mutation also affected the expression of hemR, much of the observed Arg-X activity reduction observed in T S M may be attributed to the loss of the HemR protein. Future studies will involve the identification of the genes cotranscribed along with prtT and their functions in P. gingivalis metabolism. At late-log phase, when most protein nutrients are depleted and waste products accumulate, the Tpr protease is believed to be induced to salvage remaining small peptides and protein fragments in the media. The tpr gene was not well expressed during early-log phase in peptone-rich T Y E media or in the presence of large native substrates such as BSA (125). High tpr gene expression occurred during nutritionally-poor conditions and in the presence of small protein fragments such as gelatin in the 0.5Gelatin media. The role of Tpr in gelatin metabolism has been supported by data showing that it can degrade the synthetic collagen substrate, the Pz-peptide (127). The Tpr also appeared to possess Arg-X-specific activity according to this study. However, it remains to be determined whether the reduction in Arg-X activity observed in tpr mutants was the direct result of tpr mutation or indirect pleiotropic effects. Bourgeau et al. (15) have previously found that an E. coli clone expressing the 64 kDa recombinant Tpr protease did not possess Arg-X-specific activity. The native Tpr has not been purified from P. gingivalis and tested for Arg-X hydrolyzing activity. Future characterization of tpr regulation will hopefully provide clues for the involvement of Tpr in Arg-X activity and its role during early-log phase in T Y E and 0.5BSA media. Association of Tpr with hemagglutination may be confirmed in the future using purified native Tpr to test its ability to agglutinate erythrocytes 2.5 Future Work Animal infectivity studies will be performed to determine the pathogenicity of single and double tpr and prtT mutants of P. gingivalis. Also, future studies will examine the roles of other P. gingivalis cysteine proteases expressed by tpr and prtT mutants in different media. B A P N A 79 hydrolysis assays revealed high residual Arg-X proteolytic activity among protease mutants, particularly during late-log phase growth in all media. It is not known why P. gingivalis possesses multiple Arg-X proteases. As mentioned earlier, most of these Arg-X proteases are highly homologous to each other and exhibit overlapping substrate specificity. Substrate specificity studies have not provided any distinct functional characteristics which would clearly distinguish these Arg-X proteases from each other. Yet, it may be possible that many of these proteases may serve different roles in vivo. Different Arg-X proteases may be expressed in response to different growth conditions, or the timing of expression of each protease may differ from that of other Arg-X proteases even if they may degrade the same protein substrates. To examine this possibility, we will use the ribonuclease protection assay (Ambion, Austin, Texas) to follow the expression levels of several proteases simultaneously, throughout the growth cycle under defined growth conditions. This assay will help us resolve the confusion surrounding the functions of specific Arg-X-specific proteases in vivo. The ribonuclease protection assay (RPA) will measure protease transcript levels from total RNA samples collected at regular intervals throughout the growth cycle. The RPA is a much faster and more sensitive technique than Northern analysis. It also has the added advantage of being able to detect and quantitate multiple species of target mRNA from a single RNA sample. Besides using the RPA to determine the roles of other Arg-X proteases during various stages of growth of tpr and prtT mutants in different media, it may be extended to examine the roles of Tpr, PrtT and other proteases of interest in degrading other native complex substrates found in the gingival crevicular fluid, such as immunoglobulins and complement factors. Our ability to identify specific proteases expressed under specific environmental conditions will help us to determine their significance in pathogenesis. The significance of any virulence factor in pathogenicity cannot be fully evaluated until the properties of P. gingivalis in different growth conditions have been determined. In conclusion, this investigation has determined the significance of Tpr and PrtT proteases in media of different nutritional composition via the characterization of the single and double tpr and 80 prtT mutants of P. gingivalis. The PrtT protease was found to provide an important role in BSA metabolism during early-log phase in BSA-supplemented media. The Tpr protease was found to play an important role in gelatin metabolism in gelatin-supplemented media. Both the PrtT and Tpr proteases appeared to contribute to the Arg-X-specific protease activity and hemagglutinating activity of P. gingivalis in BSA- and gelatin- supplemented media, respectively. However, it remains undetermined if PrtT and Tpr proteases directly mediate Arg-X and hemagglutination activities. 81 REFERENCES 1. Aduse-Opoku, J., J. Muir, J. S. Slaney, and M. A. Curtis. 1994. Cloning, and characterization of a protease gene of Porphyromonas gingivalis. J. Periodontal Res. 73 (IADR Abstract):247, #1161. 2. Amano, A., T. Is hi mo to, H. Tamagawa, and S. Shizukuishi. 1992. Role of superoxide dismutase in resistance of Porphyromonas gingivalis to killing by polymorphonuclear leukocytes. Infect. Immun. 60:712-714. 3. Amano, A., S. Shizukuishi, H. Tamagawa, K. Iwakura, S. Tsunasawa, and A. Tsunemitsu. 1990. Characterization of superoxide dismutases purified from either anaerobically maintained or aerated Bacteroides gingivalis. J. Bacterid. 172:1457-1463. 4. Amano, A., H. Tamagawa, M. Takagaki, Y. Murakami, S. Shizukuishi, and A. Tsunemitsu. 1988. Relationship between enzyme activities involved in oxygen metabolism and oxygen tolerance in black-pigmented Bacteroides. J. Dent. Res. 67:1196-1199. 5. Ando, K. 1980. Collagenase, dipeptidylpeptidase IV, and cathepsin D activities in gingival fluid and whole saliva from patients with periodontal disease. J. Jpn. Assoc. Periodont. 22:387-402. 6. Ausubel, F. A., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl. 1993. Current protocols in molecular biology. Greene Publishing and Wiley-Interscience, New York. 7. Barenkamp, S. J., and E. Leininger. 1992. Cloning, expression, and D N A sequence analysis of genes encoding nontypeable Haemophilus influenzae high-molecular weight surface-exposed proteins related to filamentous hemagglutinin of Bordetella pertussis. Infect. Immun. 60:1302-1313. 8. Barkocy-Gallagher, G., N. Han, J. Patti, J. Whitiock, A. Progulske-Fox, and M. Lantz. 1996. Analysis of the prtP gene encoding Porphypain, a cysteine proteinse of Porphyromonas gingivalis. J. Bacteriol. 178:2734-2741. 9. Barua, P. K., M. E. Neiders, A. Topolnycky, J. J. Zambon, and H. Birkedal-Hansen. 1989. Purification of an 80,000-M r glycylprolyl peptidase from Bacteroides gingivalis. Infect. Immun. 57:2522-2528. 10. Beaman, L., and B. L. Beaman. 1984. The role of oxygen and its derivatives in microbial pathogenesis and host defense. Ann. Rev. Microbiol. 38:27-48. 11. Bedi, G. S., and T. Williams. 1994. Purification and characterization of a collagen-degrading protease from Porphyromonas gingivalis. J. Biol. Chem. 269:599-606. 12. Berglundl, T., J. Linde, I. Ericsson, and B. Liljenberg. 1992. Enhanced gingivitis in deciduous and permanent dentition. J. Clin. Periodontol. 19:134-142. 82 13. Birkedal-Hansen, H., R. E. Taylor, J. J. Zambon, P. K. Barwa, and M. E. Neiders. 1988. Characterization of collagenolytic activity from strains of Bacteroides gingivalis. J. Periodontal Res. 23:258-264. 14. Birkedal-Hansen, H., B. R. Wells, H. Y. Lin, P. W. Caufield, and R. E. Taylor. 1984. Activation of keratinocyte-mediated collagen (type I) breakdown by a suspected human periodontopathogen. Evidence of a novel mechanism of connective tissue breakdown. J. Periodontal Res. 19:645-650. 15. Bourgeau, G., H. Lapointe, P. Peloquin, and D. Mayrand. 1992. Cloning, expression, and sequencing of a protease gene (tpr) from Porphyromonas gingivalis W83 in Escherichia coli. Infect. Immun. 60:3186-3192. 16. Bramanti, T. E., G. G. Wong, S. T. Weintraub, and S. C. Holt. 1989. Chemical characterization and biologic properties of lipopolysaccharide from Bacteroides gingivalis sttains W50, W83, and A T C C 33277. Oral Microbiol. Immunol. 4:183-92. 17. Carlsson, J., B. F. Herrmann, J. F. Hofling, and G. K. Sundqvist. 1984. Degradation of the human proteinase inhibitors alpha-1-antitrypsin and alpha-2-macroglobulin by Bacteroides gingivalis. Infect. Immun. 43:644-648. 18. Chandad, F., D. Mayrand, D. Grenier, D. Hinode, and C. Mouton. 1996. Selection and phenotypic characterization of nonhemagglutinating mutants of Porphyromonas gingivalis. Infect, and Immunol. 64:952-958. 19. Chen, Z., J. Potempa, A. Polanowski, M. Wikstrom, and J. Travis. 1992. Purification and characterization of a 50-kDa cysteine proteinase (gingipain) from Porphyromonas gingivalis. J. Biol. Chem. 267:18896-18901. 20. Choi, J.-L, T. Nakagawa, S. Yamada, I. Takazoe, and K. Okuda. 1990. Clinical microbiological and immunological studies of recurrent periodontal disease. J. Clin. Periodontol. 17:426-434. 21. Choi, J.-L, N. Takahashi, T. Kato, and H. K. Kuramitsu. 1991. Isolation, expression, and nucleotide sequence of the sod gene from Porphyromonas gingivalis. Infect. Immun. 59:1564-1566. 22. Christersson, L. A., J. J. Zamboh, R. G. Dunford, S. G. Grossi, and R. J. Genco. 1989. Specific subgingival bacteria and diagnosis of gingivitis and periodontitis. I. Dent. Res. 68(Spec. Iss.): 1633-1639. 23 Chu, L., T. E. Bramanti, J. L. Ebersole, and S. C. Holt. 1991. Hemolytic activity in the periodontopathogen Porphyromonas gingivalis: Kinetics of enzyme release and localization. Infect. Immun. 59:1932-1940. 24. Ciborowski, P., M. Nishikata, R. D. Allen, and M. S. Lantz. 1994. Purification and characterization of two forms of high molecular weight cysteine proteinase (porphypain) from Porphyromonas gingivalis. J. Bacteriol. 176:4549-4557. 25. Curtis, M. A., Aduse-Opoku, M. Slaney, M. Ranarajan, V. Booth, J. Grigland, and P. Shepard. 1996. Characterization of an adherence and antigenic determinant of the ArgI protease of Porphyromonas gingivalis which is present on multiple gene products. Infect. Immunol. 64:2532-2539. 83 26. Davison, J., M. Heusterspreute, N. Chevalier, V. Ha-Thi, and F. Brunei. 1987. Vectors with restriction site banks; V . pJRD215, a wide-host-range cosmid vector with multiple cloning sites. Gene. 51:275-280. 27. Dickinson, D. P., M. A. Kubiniec, F. Yoshimura, and R. J. Genco. 1988. Molecular cloning and sequencing of the gene encoding the fimbrial subunit protein of Bacteroides gingivalis. J. Bacteriol. 170:1658-1665. 28. Dix, K., S. M. Watanabe, S. McArdle, D. I. Lee, C. Randolph, B. Moncla, and D. E. Schwartz. 1990. Species-specific oligonucleotide probes for the identification of periodontal bacteria. J. Clin. Microbiol. 28:319-323. 29. Dzink, J. L., S. S. Socransky, and A. D. Haffajee. 1988. The predominant cultivable microbiota of active and inactive lesions of destructive periodontal diseases. J. Clin. Periodontol. 15:316-323. 30. Ebersole, J. L., D. E. Frey, M. A. Taubman, A. D. Haffajee, and S. S. Socransky. 1987. Dynamics of systemic antibody responses in periodontal disease. J. Periodontal Res. 22:184-186. 31. Ebersole, J. L., D. E. Frey, M. A. Taubman, D. J. Smith, S. S. Socransky, and T. A. C. R. 1984. Serological identification of oral Bacteroides spp. by enzyme-linked immunosorbent assay. J. Clin. Microbiol. 18:639-642. 32. Ebersole, J. L., M. A. Taubman, and D. J. Smith. 1985. Gingival crevicular fluid antibody to oral microorganisms. II. Distribution and specificity of local antibody responses. J. Periodontal Res. 20:349-356. 33. Ebersole, J. L., M. A. Taubman, D. J. Smith, and D. E. Frey. 1986. Human immune responses to oral microorganisms; patterns of systemic antibody levels to Bacteroides species. Infect. Immun. 51:507-513. 34. Ebersole, J. L., M . A. Taubman, D. J. Smith, and J. M. Goodson. 1984. Gingival crevicular fluid antibody to oral microorganisms. I. Method of collection and analysis of antibody. J. Periodontal Res. 19:124-132. 35. Eisenstein, B. L., and M. schaechter. 1993. Normal Microbial Flora, p. 16-28. In B. I. Eisenstein and M . Schaecter (ed.), Mechanisms of Microbial Disease, Second ed. Williams and Wilkins, Baltimore, Md. 36. Fletcher, H. M., H. A. Schenkein, and F. L. Macrina. 1994. Cloning and characterization of a new protease gene (prtH) from Porphyromonas gingivalis. Infect. Immun. 62:4279-4286. 37. Frandsen, E. V. G . , J. Reinholdt, and M. Kilian. 1987. Enzymatic and antigenic characterization of immunoglobulin A l proteases from Bacteroides and Capnocytophaga spp. Infect. Immun. 55:631-638. 38. From, S. H., and S. D. Schultz-Hault. 1963. Comparative histological and microchemical evaluations of the collagen of human gingiva. J. Periodontol. 34:216-222. 84 39. Fujimura, S., Y. Shibata, and T. Nakamura. 1993. Purification and partial characterization of a lysine-specific protease of Porphyromonas gingivalis. FEMS Microbiol. Lett. 113:133-138. 40. Genco, C. A . 1995. Regulation of hemin and iron transport in Pophyromonas gingivalis. Adv. Dent. Res. 9:41-47. 41. Genco, C. A . , B. M. Odusanya, and G. Brown. 1994. Binding and accumulation of hemin in Porphyromonas gingivalis are induced by hemin. Infect. Immun. 62(7):2885-2892. 42. Gharbia, S. E., and H. N. Shah. 1991. Utilization of aspartate, glutamate, and their corresponding peptides by Fusoba'cterium nucleatum subspecies and Porphyromonas gingivalis. Curr. Microbiol. 22:159-163. 43. Gharbia, S. E., H. N. Shah, S. Sreedharan, and K. Brocklehurst. 1995. Catalytic site targeted mutagenesis of the a-gingivain gene of Porphyromonas gingivlais using Tn-4351 to generate isogenic mutants. Anaerobe 1:49-54. 44. Gibbons, R. J., and J. B. MacDonald. 1960. Hemin and vitamin K compounds as required factors for the cultivation of certain sttains of Bacteroides melaninogenicus. J. Bacteriol. 80:164-170. 45. Grenier, D. 1992. Effect of protease inhibitors on in vitro growth of Porphyromonas gingivalis. Microbial Ecol. Health Dis. 5:133-137. 46. Grenier, D. 1992. Further evidence for a possible role of trypsin-like activity in the adherence of Porphyromonas gingivalis. Can. J. Microbiol. 38:1189-1192. 47. Grenier, D. 1992. Nutritional interactions between two suspected periodontopathogens, Treponema denticola and Porphyromonas gingivalis. Infect. Immun. 60:5298-5301. 48. Grenier, D., and M. Belanger. 1991. Protective effect of Porphyromonas gingivalis outer membrane vesicles against bactericidal activity of human serum. Infect. Immun. 59:3004-3008. 49. Grenier, D., and D. Mayrand. 1985. Cytotoxic effects of culture supernatants of oral bacteria and various organic acids on vero cells. Can. J. Microbiol. 31:302-304. 50. Grenier, D., and D. Mayrand. 1987. Functional characterization of extracellular vesicles produced by Bacteroides gingivalis. Infect. Immun. 55:111-117. 51. Grenier, D., and D. Mayrand. 1986. Nutritional relationships between oral bacteria. Infect. Immun. 53:616-620. 52. Grenier, D., and D. Mayrand. 1993. Proteinases, p. 227-243. In H . N . Shah, D. Mayrand, and R. J. Genco (ed.), Biology of the species Porphyromonas gingivalis. CRC Press, Inc., Boca Raton. 53. Grenier, D., D. Mayrand, and B. C. McBride. 1989. Further studies on the degradation of immunoglobulins by black-pigmented Bacteroides. Oral Microbiol. Immunol. 4:12-18. 85 54. Grenier, D., and B. C . McBride. 1987. Isolation of a membrane-associated Bacteroides gingivalis glycylprolyl protease. Infect. Immun. 55:3131-3136. 55. Grenier, D., and B. C. McBride. 1991. Preliminary studies on the influence of in vivo growth on selected characteristics of Porphyromonas gingivalis W83. Microbial Ecol. Health Dis. 4:105-111. 56. Hinode, D., A . Nagata, S. Ichimiya, H. Hayashi, M. Morioka, and R. Nakamura. 1992. Generation of plasma kinin by three types of protease isolated from Porphyromonas gingivalis 381. Arch. Oral Biol. 37:859-861. 57. Holt, S. C , J. Ebersole, J. Felton, M. Brunsvold, and K. S. Kornman. 1988. Implantation of Bacteroides gingivalis in nonhuman primates initiates progression of periodontitis. Science. 239:55-57. 58. Hoover, C. I., C . Y. Ng, and J. R. Felton. 1992. Correlation of haemagglutination activity with trypsin-like protease activity of Porphyromonas gingivalis. Arch. Oral Biol. 37:515-520. 59. Hopps, R. M., and H. J. Sismey-Durrant. 1991. Mechanisms of alveolar bone loss in periodontal disease, p. 307-. In S. Hamada, S. C. Holt, and J. R. McGhee (ed.), Periodontal Disease: Pathogens and Host Immune Responses. Quintessence, Tokyo. 60. lino, Y., and R. M. Hopps. 1984. The bone resorbing activities in tissue culture of lipopolysaccharides from the bacteria Actinobacillus actinomycetemcomitans, Bacteroides gingivalis and Capnocytophaga ochracea isolated from human mouths. Arch. Oral Biol. 29:59-63. 61. Imamura, T., R. N. Pike, J. Potempa, and J. Travis. 1994. Pathogenesis of periodontitis: a major arginine-specific cysteine proteinase from Porphyromonas gingivalis induces vascular permeability enhancement through activation of the kallilaein/kinin pathway. Journal of Clinical Investigation. 94:361-367. 62. Ismaiel, M. O., J. Greenman, K. Morgan, M. G. Glover, A . S. Rees, and C. Scully. 1989. Periodontitis in sheep: a model for human periodontal disease. J. Periodontol. 60:279-284. 63. Isogai, E., K. Hirose, N. Fujii, and H. Isogai. 1992. Three types of binding by Porphyromonas gingivalis and oral bacteria to fibronectin, buccal epithelial cells, and erythrocytes. Arch. Oral Biol. 8:667-670. 64. Isogai, H., E. Isogai, F. Yoshimura, T. Suzuki, W. Kagota, and K. Takano. 1988. Specific inhibition of adherence of an oral strain of Bacteroides gingivalis 381 to epithelial cells by monoclonal antibodies against the bacterial fimbriae. Arch. Oral Biol . 33:479-485. 65. Johne, B., I. Olsen, and K. Bryn. 1988. Fatty acids and sugars in lipopolysaccharides from Bacteroides intermedins, Bacteroides gingivalis, and Bacteroides loescheii. Oral Microbiol. Immunol. 3:22-27. 66. Kaminishi, H., T. Cho, T. Itoh, A . Iwata, K. Kawasaki, Y. Hagihara, and ° H. Maeda. 1993. Vascular permeability enhancing activity of Porphyromonas gingivalis protease in guinea pigs. FEMS Microbiol. Lett. 114:109-114. 86 67. Karunakaran , T., T. Madden, and H. Kuramitsu. 1997. Isolation and characterization of a hemin-regulated gene hemR, from Porphyromonas gingivalis. J. Bacteriol. 179:1898-1908. 68. Kato, T., N. Takahashi, and H. K. Kuramitsu. 1992. Sequence analysis and characterization of the Porphyromonas gingivalis prtC gene, which expresses a novel collagease activity. J. Bacteriol. 174:3889-3895. 69. Kawata, Y., S. Hanazawa, S. Amano, Y. Murakami, T. Matsumoto, K. Nishida, and S. Kitano. 1994. Porphyromonas gingivalis fimbriae stimulate bone resorption in vitro. Infect. Immun. 62:3012-3016. 70. Kay, H. M., A. J. Birss, and J. W. Smalley. 1990. Haemagglutinating and haemolytic activity of the extracellular vesicles of Bacteroides gingivalis W50. Oral Microbiol. Immunol. 5:269-274. 71. Kilian, M. 1981. Degradation of immunoglobulins A l , A2, and G by suspected principal periodontal pathogens. Infect. Immun. 34:757-765. 72. Kinder, S. A., and S. C. Holt. 1989. Characterization of coaggregation between Bacteroides gingivalis T22 and Fusobacerium nucleatum T18. Infect. Immun. 57:3425-3433. 73. Kirszbaum, L., C. sortiropoulos, C . Jackson, S. Cleal, N. Slakeski, and E. C. Reynolds. 1995. Complete nucleotide sequence of a gene prtR of Porphyromonas gingivalis W50 encoding a 132 kDa protein that contains an arginine-specific thiol-endopeptidase domain and a hemagglutinin domain . Biochem. Biophys. Res. Commun. 207:424-431. 74. Kolenbrander, P. E. 1988. Intergeneric coaggregation among human oral bacteria and ecology of dental plaque. Ann. Rev. Microbiol. 42:627-656. 75. Kolenbrander, P. E., and R. N. Andersen. 1989. Inhibition of coaggregation between Fusobacterium nucleatum and Porphyromonas (Bacteroides) gingivalis by lactose and related sugars. Infect. Immun. 57:3204-3209. 76. Kuramitsu, H., M. Tokuda, M. Yoneda, M. Duncan, and M.-I. Cho. Multiple colonization defects in a cysteine protease deficient mutant of Porphyromonas gingivalis. J. Periodontal Res. In press. 77. Kuramitsu, H. K., M. Yoneda, and T. Madden. 1995. Proteases and Collagenases of Porphyromonas gingivalis. Adv. Dent. Res. 9:37-40. 78. Laemmli, U . K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London). 277:680-685. ' 79. Lambe, D. W., Jr., K. P. Ferguson, and W. R. May berry. 1982. Characterization of Bacteroides gingivalis by direct fluorescent antibody staining and cellular fatty acid profiles. Can. J. Microbiol. 28:367-374. 80. Laughon, B. E., S. A. Syed, and W. J. Loesche. 1982. Rapid identification of Bacteroides gingivalis. J. Clin. Microbiol. 15:345-346. 87 81. Lawson, D. A . , and T. F. Meyer. 1992. Biochemical characterization of Porphromonas (Bacteroides) gingivalis collagenase. Infect. Immun. 60:1524-1529. 82. Leduc, A . , D. Grenier, and D. Mayrand. 1996. Comparative growth of Porphyromonas gingivalis strains in a defined basal medium. Anaerobe 2:257-261. 83. Lee, J.-Y., H. T. Sojar, G. S. Bedi, and R. J. Genco. 1992. Synthetic peptides analogous to the fimbrillin sequence inhibit adherence of Porphyromonas gingivalis. Infect. Immun. 60:1662-1670. 84. Lee, J.-Y., H. T. Sorja, G. S. Bedi, and R. J. Genco. 1991. Porphyromonas (Bacteroides) gingivalis fimbrillin: size, amino-terminal sequence, and antigenic heterogeneity. Infect. Immun. 59:383-389. 85. Lepine, G., and A . Progulske-Fox. 1996. Duplication and differential expression of hemagglutinin genes in Porphyromonas gingivalis. Oral Microbiol. Immunol. 11:65-78. 86. Lepine, G., and A . Progulske-Fox. 1993. Molecular biology, p. 313-319. In H . N . Shah, D. Mayrand, and R. Genco (ed.), Biology of the species Porphyromonas gingivalis. CRC Press, Inc., Boca Raton, Fl . 87. Listgarten, M. A . 1987. Nature of periodontal diseases: Pathogenic mechanisms. J. Periodontal Res. 22:172-178. 88. Loesche, W., S. A . Syed, E. Schmidt, and E. C. Morrison. 1985. Bacterial profiles of subgingival plaques in periodontitis. J. Periodontol. 56:447-456. 89. Loesche, W. J., S. A . Syed, E. C. Morrison, B. Langhon, and N. S. Grossman. 1981. Treatment of periodontal infections due to anaerobioc bacteria with short term treatment with metronidazole. J. Clin. Periodontol. 8:29-44. 90. Loesche, W. J., S. A . Syed, E. Schmidt, and E. C. Morrison. 1985. Bacterial profiles of subgingival plaques in periodontitis. J. Periodontol. 56:447-456. 91. Loomer, P. M., B. Sigusch, B. Sukhu, R. P. Ellen, and H. C. Tnenbaum. 1994. Direct effects of metabolic products and sonicated extracts of Pophyromonas gingivalis 2561 on osterogenesis in vitro. Infect. Immun. 62:1289-1297. 92. MacDonald, J. B., S. S. Socransky, and R. J. Gibbons. 1963. Aspects of the pathogenesis of mixed anaerobic infections of mucous membranes. J. Dent. Res. 42:529-544. 93. Madden, T. E., V. L. Clark, and H. K. Kuramitsu. 1995. Revised sequence of the Porphyromonas gingivalis PrtT cysteine protease/hemagglutinin gene: Homology with strepotcoccal pyrogenic exotoxin B/streptococcal proteinase. Infect. Immun. 63:238-247. 94. Maley, J., N. B. Shoemaker, and I. S. Roberts. 1992. The introduction of colomc-Bacteroides shuttle plasmids into Porhyromonas gingivalis: Identification of a putative P. gingivalis insertion-sequence element. FEMS Microbiol. Lett. 93:75-82. 95. Marsh, P., and M. Martin. 1984. Oral Microbiology, second ed, vol. 1. American society for Microbiology, Washington, D. C. 88 96. Marsh, P. D., A. S. McKee, and A. S. McDermid. 1988. Effect of haemin on enzyme activity and cytotoxin production by Bacteroides gingivalis W50. FEMS Microbiol. Lett. 55:87-92. 97. Mayrand, D. 1989. Biological activities of outer membrane vesicles. Can. J. Microbiol. 35:607-613. 98. Mayrand, D., and D. Grenier. 1985. Detection of collagenase activity in oral bacteria. Can. J. Microbiol. 31:134-138. 99. Mayrand, D., and S. C. Holt. 1988. Biology of asaccharolytic black-pigmented Bacteroides species. Microbiol. Rev. 52:134-152. 100. Mayrand, D., and B. C. McBride. 1980. Ecological relationships of bacteria involved in a simple, mixed anaerobic infection. Infect. Immun. 270:44-55. 101. McKee, A. S., A. S. McDermid, A. Baskerville, A. B. Dowsett, D. C. Ellwood, and P. D. Marsh. 1986. Effect of hemin on the physiology and virulence of Bacteroides gingivalis W50. Infect. Immun. 52:349-355. 102. Millar, S. J., E. G. Goldstein, M. J. Levine, and E. Hausmann. 1986. Modulation of bone metabolism by two chemically distinct lipopolysaccharide fractions from Bacteroides gingivalis. Infect. Immun. 51:302-306. 103. Minhas, T., and J. Greenman. 1989. Production of cell-bound and vesicle-associated trypsin-like protease, alkaline phosphatase and N-acetyl-(3-glucosaminidase by Bacteroides gingivalis W50. J. Gen. Microbiol. 135:557. 104. Miyauchi, T., M. Hayakawa, and Y. Abiko. 1989. Purification and characterization of glycylprolyl aminopeptidase from Bacteroides gingivalis. Oral Microbiol. Immunol. 4:222-226. 105. Murozuka, T., M. Moriwaka, H. Ito, S. Sekiguchi, M. Naiki, T. K., T. Aoyama, and K. Komuro. 1990. Bovine albumin-like protein in commercial human albumin for clinical use. Vox Sang. 55:1-5. 106. Nair, B. C , W. R. Mayberry, R. Dziak, P. B. Chen, M. J. Levine, and E. Hausmann. 1983. Biological effects of a purified lipopolysaccharide from Bacterides gingivalis. J. Periodontal Res. 18:40-49. 107. Nakayama, K., T. Kadowski, K. Okamoto, and K. Yamamoto. 1995. Construction and characterization of arginine-specific cysteine proteases(arg-gingipain)-deficient mutants of Porphyromonas gingivalis. J. Biol. Chem. 270:23619-23626. 108. Nakayama, K., F. Yoshimura, T. Kadowaki, and K. Yamamoto. 1996. Involvement of Arginine-specific cysteine proteinase (Arg-gingipain) in fimbriation of Porphyromonas gingivalis. J. Bacteriol. 178:2818-2824. 109. Neiders, M. E., P. B. Chen, H. Suido, H. S. Reynolds, J. J. Zambon, M. Shlossman, and R. J. Genco. 1989. Heterogeneity of virulence among strains of Bacteroides gingivalis. J. Periodontal Res. 24:192-198. 89 110. Ng, W., and J. Tonzetich. 1983. Effects of H 2 S on permeability of oral mucosa. J. Dent. Res. 62:275, Abst. No. 953. 111. Nisengard, R. J . , and M. G. Newman (ed.). 1994. Oral Microbiology and Immunology, 2 ed. W. B. Saunders Company, Phillidelphia, PA. 112. Nisengard, R. J., M. G. Newman, and Z. J. J. 1994. Periodontal Diseases, p. 360-384. In N . R. J. and M . G. Newman (ed.), Oral Microbiology and Immunology, second ed. W. B. Sauders Co., Phillidelphia, PA. 113. Nishikata, M., and F. Yoshimura. 1991. Characterization of Porphyromonas (Bacteroides) gingivalis hemagglutinin as a protease. Biochem. Biophys. Res. Commun. 178:336-342. 114. Nishikata, M., J. Yoshimura, and Y. Nodasaka. 1989. Possibility of Bacteroides gingivalis hemagglutinin possessing protease activity revealed by inhibition studies. Microbiol. Immunol. 33:75-80. 115. Oakley, B. R., D. R. Kirsch, and N. R. Morris. 1980. A simplified ultra-sensitive silver stain for detecting proteins in polyacrylamide gels. Anal. Biochem. 105:361-363. 116. Ogawa, T., and S. Hamada. 1994. Hemagglutinating and chemotactic properties of synthetic peptide segments of fimbrial protein from Porphyromonas gingivalis. Infect. Immun. 62:3305-3310. 117. Okamoto, K., Y. Misumi, T. Kadowaki, M. Yoneda, K. Yamamoto, and Y. Ikehara. 1995. Structural characterization of argingipain, a novel arginine-specific cysteine protease as a major periodontal pathogenic factor from Porphyromonas gingivalis. Arch. Biochem. Biophys. 316:917-925. 118. Okuda, K., Y. Fukumoto, I. Takazoe, J. Slots, and R. J. Genco. 1987. Capsular structure of black-pigmented Bacteroides isolated from human. Bulletin Tokyo Dental College. 27:1-12. 119. Okuda, K., and T. Kato. 1987. Hemagglutinating activity of lipopolysaccharides from subgingival plaque. Infect. Immun. 55:3192-3199. 120. Okuda, K., J. Slots, and R. J. Genco. 1981. Bacteroides gingivalis, Bacteroides asaccharolyticus, and. Bacteroides melaninogenicus subspecies: Cell surface morphology and adherence to erythrocytes and human buccal epithelial cells. Curr. Microbiol. 6:7-12. 121. Okuda, K., and J. Takazoe. 1974. Hemagglutinating activity of Bacteroides melaninogenicus. Arch. Oral Biol. 19:415-416. 122. Okuda, K., A . Yamamoto, Y. Naito, I. Takazoe, J. Slots, and R. J. Genco. 1986. Purification and properties of haemagglutinin from culture supernatant of Bacteroides gingivalis. Infect. Immun. 54:659-665. 123. Otogoto, J.-L, and H. K. Kuramitsu. 1993. Isolation and characterization of the Porphyromonas gingivalis prtT gene, coding for protease activity. Infect. Immun. 61:117-123. 90 124. Page, R. C , and H. E. Schroeder. 1973. Biochemical aspects of the connective tissue alterations in inflammatory gingival and periodontal disease. Int. Dent. J. 23:455-469. 125. Park, Y . 1995. Ph.D. thesis. A study of membrane-associated protease of Porphyromonas gingivalis W83 University of British Columbia. 126. Park, Y . , Lu, B., Mazur C. and B. C. McBride. 1997. Inducible expression of Porphyrmonas gingivalis W83 membrane-associated protease . Infect. Immun. 65:1101-1104. 127. Park, Y . , and B. C. McBride. 1993. Characterization of the tpr gene product and isolation of a specific protease-deficient mutant of Porphyromonas gingivalis W83. Infect. Immun. 61:4139-4146. 128. Pavloff, N., J. Potempa, R. N. Pike, V . Prochazka, M. C. Kiefer, J. Travis, and P. J. Barr. 1995. Molecular cloning and structural characterization of the Arg-gingipain proteinase of Porphyromonas gingivalis. J. Biol. Chem. 270:1007-1010. 129. Pekovic, D. D., and E. D. Fillery. 1984. Identification of bacteria in immunopathological mechanisms of human periodontal diseases. J. Periodontal Res. 19:329-351. 130. Peters, T. 1975. Serum albumin, p. 113-181. In F. W. Putnam (ed.), The Plasma proteins: structure, function, and genetic conttol. Academic Press, New York. 131. Pike, R., W. McGraw, J. Potempa, and J. Travis. 1994. Lysine- and arginine-specific proteinases from Porphyromonas gingivalis. Isolation, characterization, and evidence for the existence of complexes with hemagglutinins. J. Biol. Chem. 269:406-411. 132. Potempa, J., N. Pavloff, and J. Travis. 1995. Porphyromonas gingivalis: a proteinase/gene accounting audit. Trends Microbiol. 3:430-434. 133. Potempa, J., R. Pike, and J. Travis. 1995. The mutiple forms of trypsin-like activity present in various strains of Porphyromonas gingivalis are due to the presence of either Arg-gingipain or Lys-gingipain. Infect. Immun. 63:1176-1182. 134. Progulske-Fox, A., A. Oberste, C. Drummond, and W. P. McArthur. 1989. Transfer of plasmid pE5-2 from Escherichia coli to Bacteroides gingivalis and B. intermedius. Oral Microbiol. Immunol. 4:132-134. 135. Progulske-Fox, A., S. Tumwasorn, and S. C. Holt. 1989. The expression and function of a Bacteroides gingivalis hemagglutinin gene in Escherichia coli. Oral Microbiol. Immunol. 4:121-131. 136. Renart, J., and I. V . Sandoval. 1984. Western blots, p. 455-460. In W. B. Jakoby (ed.), Methods in Enzymology, vol. 104. N Y Academic Press, Inc., New York. 137. Rizza, V . , P. R. Sinclair, D. C. White, and P. R. Courant. 1968. Electron transport system of the protoheme-requiring anaerobe Bacteroides melaninogenicus. J. Bacteriol. 96:665-671. 91 138. Rodriguez, R. L., and R. C. Tait. 1983. Recombinant D N A Techniques, An Introduction. Addison-Wesley Publishing Company, Inc., Reading, Massachusetts. 139. Rotstein, O. D., P. E. Nasmitsh, and S. Grinstein. 1987. The Bacteroides by-product succinic acid inhibits neutrophil respiratory burst by reducing intracellular pH. Infect. Immun. 55:864-870. 140. Rotstein, O. D., T. L. Pivett, V. D. Fiegel, R. D. Nelson, and R. L. Simmons. 1985. Succinic acid, a metabolic by-product of Bacteroides species, inhibits polymorphonuclear leukocyte fuction. Infect. Immun. 48:402-408. 141. Sako, K . , I. Takazoe, and K . Okuda. 1988. Isolation and characterization of plasmid D N A from Bacteroides strains isolated from the oral cavity. Oral Microbiol. Immunol. 3: 72-76 142. Salyers, A . A . , N. B. Shoemaker, and E. P. Guthrie. 1987. Recent advance in Bacteroides genetics. CRC Crit. Rev. Microbiol. 14:49-71. 143. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual (2nd Ed.). Cold Spring Harbor Laboratory, Cold Spring Harbor, N .Y. 144. Sato, M., M. Otsuka, R. Maehara, J. Endo, and R. Nakamura. 1987. Degradation of immunoglobulin A by protease isolated from the anaerobic periodontopathogenic bacterium, Bacteroides gingivalis. Arch. Oral Biol . 32:235-238. 145. Schachtele, C. F. 1983. Dental caries, p. 197-230. In G. Schuster (ed.), Oral Microbiology and infectious diseases, second ed. Williams and Wilkins, Baltimore, Md. 146. Schenkein, H. A . 1991. Complement factor D-like activity of Porphyromonas gingivalis W83. Oral Microbiol. Immunol. 6:216-220. 147. Schenkein, H. A . 1982. The complement system in periodontal diseases, p. 299-308. In R. J. Genco and S. E. Mergenhagen (ed.), Host-parasite interactions in periodontal disease. American Society for Microbiology, Washington, DC. 148. Schenkein, H. A . 1988. The effect of periodontal proteolytic Bacteroides species on proteins of the human complement system. I. Periodontal Res. 23:187-192. 149. Scott, C. F., E. J. Whitaker, B. F. Hammond, and R. W. Colman. 1993. Purification and characterization of a potent 70-kDa thiol lysyl-proteinase (Lys-gingivain) from Porphyromonas gingivalis that cleaves kininogens and fibrinogen. J. Biol. Chem. 268:7935-7942. 150. Seddon, S. V., H. N. Shah, J. M. Hardie, and J. P. Robinson. 1988. Chemically defined and minimal media for Bacteroides gingivalis. Curr. Microbiol. 17:147-149. 151. Shah, H. N. 1993. Biology of the species Porphyromonas gingivalis. C R C Press, Inc., Boca Raton. 152. Shah, H. N., R. Bonnet, B. Matteen, and R. A . Williams. 1979. The porphyrin pigmentation of subspecies of Bacteroides melaninogenicus. Biochem. J. 180:45-50. 92 153. Shah, H. N . , and S. E. Gharbia. 1989. Lysis of erythrocytes by the secreted cysteine proteinase of Porphyromonas gingivalis W83. FEMS Microbiol. Lett. 61:213-218. 154. Shah, H. N . , S. E. Gharbia, D. Kowlessur, E. Wilkie, and K. Brocklehurst. 1990. Isolation and characterization of gingivain, a cysteine proteinase from Porphyromonas gingivalis strains W83. Biochem. Soc. Trans. 18:578-579. 155. Shah, H. N . , S. E. Gharbia, A. Progulske-Fox, and K. Brocklehurst. 1992. Evidence for independent molecular identity and functional interaction of the haemagglutinin and cysteine proteinase (gingivain) of Porphyromonas gingivalis. J. Med. Microbiol. 36:239-244. 156. Shah, H. N . , and S. E. Gharbia. 1989. Ecological events in subgingival dental plaque with reference to Bacteroides and Fusobacterium species. Infection. 17:264-268. 157. Shah, H. N., and R. A. D. Williams. 1987. Catabolism of aspartate and asparagine by Bacteroides intermedins and Bacteroides gingivalis. Curr. Microbiol. 15:313-318. 158. Shah, H. N., and R. A. D. Williams. 1987. Utilization of glucose and amino acids by Bacteroides intermedins and Bacteroides gingivalis. Curr. Microbiol. 15:241-246. 159. Shah, H. N., R. A. D. Williams, G. D. Bowden, and J. M . Hardie. 1976. Comparison of the biochemical properties of Bacteroides melaninogenicus from human dental plaque and other sites. J. Appl. Bacterid. 41:473-492. 160. Shoemaker, N. B., C . Getty, J. F. Gardner, and A. A. Salyers. 1986. Tn4351 transposes in Bacteroides spp. and mediates integration of plasmid R751 into the Bacteroides chromosome. J. Bacteriol. 165:929-936. 161. Shoemaker, N. B., C . Getty, E. P. Guthrie, and A. A. Salyers. 1986. Two Bacteroides plasmids, pBFTMlO and pB8-51, contain transfer regions that are recognized by broad-host-range IncP plasmids and by a conjugative Bacteroides tetracycline resistance element. J. Bacteriol. 166:959-965. 162. Shuster, G. S. 1983. Oral Microbiology and Infectious Diseases, second ed. Williams and Wilkins, Baltimore, Md. 163. Singer, R. E., and B. A. Buckner. 1981. Butyrate and propionate: important components of toxic dental plaque extracts. Infect. Immun. 32:458-463. 164. Slots, J. 1982. Importance of black-pigmented Bacteroides in human periodontal disease, p. 27-45. In R. J. Genco and S. E. Mergenhagen (ed.), Host-Parasite Interactions in Periodontal Disease. American Society for Microbiology, Washington, D. C. 165. Slots, J. 1977. Microflora in the healthy gingival sulcus in man. Scand. J. Dent. Res. 85:247-254. 166. Slots, J. 1977. The predominant cultivable microflora of advanced periodontitis. Scand. J. Dent. Res. 85:114-121. 93 167. Slots, J. 1979. Subgingival microflora and periodontal disease. J. Clin. Periodontol. 6:351-382. 168. Slots, J. 1986. Virulence factors of the baceria that cause periodontal disease. Compend. contin. Educ. Dent. 7:665-670. 169. Slots, J., L. Bragd, M. Wilkstrom, and G. Dahlen. 1986. The occurence of Actinobacillus actinomycetemcomitans, Bacteroides gingivalis and Bacteroides intermedius in destructive periodontal disease in adults. J. Clin. Periodontol. 13:570-577. 170. Slots, J., and G. Dahlen. 1985. Subgingival microorganisms and bacterial virulence factors in periodontitis. Scand. J. Dent. Res. 93:119-127. 171. Slots, J., C . Hafstrom, B. Rosling, and G. Dahlen. 1985. Detection of Actinobacillus actinomycetemcomitans and Bacteroides gingivalis in subgingival smears by indirect-fluorescent-antibody technigue. J. Periodontal Res. 20:613-617. 172. Slots, J., and M. A . Listgarten. 1988. Bacteroides gingivalis, Bacteroides intermedius and Actinobacillus actinomycetemcomitans in human periodontal diseases. J. Clin. Periodontol. 15:85-93. 173. Slots, J., and T. E. Rams. 1992. Microbiology of Periodontal Disease, p. 425-443. In J. Slots and M . A. Taubman (ed.), Contemporary Oral Microbiology and Immunology. Mosby-Year Book, Inc., St. Louis. 174. Smalley, J. W., and A . J. Birss. 1991. Extracellular vesicle-associated and soluble trypsin-like enzyme fractions of Porphyromonas gingivalis W50. Oral Microbiol. Immunol. 6:202-208. 175. Smalley, J. W., and A . J. Birss. 1987. Trypsin-like enzyme activity of the extracellular membrane vesicles of Bacteroides gingivalis W50. J. Gen. Microbiol. 133:2883-2894. 176. Smalley, J. W., A . J. Birss, H. M. Kay, A . S. McKee, and P. D. Marsh. 1989. The distribution of trypsin-like enzyme activity in cultures of a virulent and an avirulent strain of Bacteroides gingivalis W50. Oral Microbiol. Immunol. 4:178-181. 177. Smalley, J. W., A . J. Birss, A . S. McKee, and P. D. Marsh. 1991. Haemin-restriction influences haemin-binding, haemagglutination and protease activity of cells and extracellular membrane vesicles of Porphyromonas gingivalis W50. FEMS Microbiol. Lett. 90:63-68. 178. Smalley, J. W., D. Mayrand, and D. Grenier. 1993. Vesicles, p. 259-292. In H. N . Shah, D. Mayrand, and R. J. Genco (ed.), Biology of the species of Porphyromonas gingivalis. CRC Press, Inc., Boca Raton. 179. Smally, J. W., and A . J. Birss. 1991. Extracellular vesicle-associated and soluble trypsin-like enzyme fractions of Porphyromonas gingivalis W50. Oral Microbiol. Immunol. 6:202-208. 180. Smally, J. W., and A . J. Birss. 1987. Trypsin-like enzyme activity of the extracellular membrane vesicles of Bacteroides gingivalis W50. J. Gen. Microbiol. 133:2883-2894. 94 181. Smith, A . J., T. Minhas, J. Greenman, and G. Embery. 1993. The distribution and properties of some hydrolytic enzymes from Porphyromonas gingivalis W50. Microbios. 73:185-197. 182. Socransky, S. S., and A . D. Haffajee. 1991. Microbial mechanisms in the pathogenesis of destructive periodontal diseases: a critical assessment. J. Periodontal Res. 26:195-212. 183. Socransky, S. S., and A . D. Haffajee. 1990. Microbial risk factors for destructive periodontal diseases., p. 79-90. In J. D. Bader (ed.), Risk assessment in dentistry. University of North Carolina Dental Etiology, Chapel Hi l l , N . C. 184. Socransky, S. S., A . C. R. Tanner, A . D. Haffajee, J. D. Hillman, and J. M. Goodson. 1982. Present status of studies on the microbial etiology of periodotal disease, p. 1-12. InR. J. Genco and S. E. Mergenhagen (ed.), Host-Parasite Interations in Periodontal Disease. American Society for Microbiology, Washington D. C. 185. Sundqvist, G., A . Bengtson, and J. Carlsson. 1988. Generation and degradation of the complement fragment C5a in human serum by Bacteroides gingivalis. Oral Microbiol. Immunol. 3:103-107. 186. Sundqvist, G., J. Carlsson, B. Herrmann, and A . Tarnvik. 1985. Degradation of human immunoglobulins G and M and complement factors C3 and C5 by black-pigmented Bacteroides. J. Med. Microbiol. 19:85-94. 187. Sundqvist, G., D. Figdor, L. Hanstrom, S. Sorlin, and G. Sandstrom. 1991. Phagocytosis and virulence of different strains of Porphyromonas gingivalis. Scand. J. Dent. Res. 99:117-129. 188. Sundqvist, G. K., J. Carlsson, B. G. Herrmann, J. F. Hofling, and A . Vaatainen. 1984. Degradation in vivo of the C3 protein of guinea-pig complement by a pathogenic strain of Bacteroides gingivalis. Scand. J. Dent. Res. 92:14-24. 189. Sundqvist, R. J., D. W. Lambe, and D. W. Lambe, Jr. 1993. Glycocalyx, p. 159-169. In H . N . Shah, D. Mayrand, and R. J. Genco (ed.), Biology of the species Porphyromonas gingivalis. CRC Press, Inc., Boca Raton. 190. Sveen, K. 1977. The capacity of lipopolysaccharides from Bacteroides, Fusobacterium and Veillonella to produce skin inflammation and the local and generalized Schwartzman reaction in rabbit. J. Periodontal Res. 12:340-350. 191. Sveen, K., and N . Skaug. 1980. Bone resorption stimulated by lipopolysaccharides from Bacteroides, Fusobacterium, and Veillonella, and by the lipid A and the polysaccharide part of Fusobacterium lipopolysaccharide. Scand. J. Dent. Res. 88:535-542. 192. Takada, H., J. Mihara, I. Morisaki, and S. Hamada. 1991. Induction of interleukin-1 and -6 in human gingival fibroblast cultures stimulated with Bacteroides lipopolysaccharides. Infect. Immun. 59(1):295-301. 193. Takahashi, N . , T. Kato, and H. K. Kuramitsu. 1991. Isolation and preliminary characterization of the Porphyromonas gingivalis prtC gene and expression of collagenase activity. FEMS Microbiol. Lett. 84:135-138. 95 194. Touw, J. J. A . , T. J. M. van Steenbergen, and J. de Graaff. 1982. Butyrate: a cytotoxin for vero cells produced by Bacteroides gingivalis and Bacteroides asaccharolyticus. Antonie van Leeuwenhoek. 48:315-325. 195. van Winkelhoff, A . J., T. J. M. van Steenbergen, and J. de Graaff. 1988. The role of black-pigmented Bacteroides in human oral infections. J. Clin. Periodontol. 15:145-155. 196. Wahren, A . , and R. J. Gibbons. 1970. Amino acid fermentation by Bacteroides melaniogenicus. Antonie van Leeuwenhoek. 36:149-159. 197. Washington, O. R., M. Deslauriers, D. P. Stevens, L. K. Lyford, S. Haque, Y. Yan, and P. M. Flood. 1993. Generation and purification of recombinant fimbrillin from Porphyromonas {Bacteroides) gingivalis 381. Infect. Immun. 61:1040-1047. 198. White, D., and D. Mayrand. 1981. Association of oral Bacteroides with gingivitis and adult periodontitis. J. Periodontal Res. 16:259-265. 199. Wilton, J. M. A . , T. J. Hurst, and E . E . Scott. 1993. Inhibition of polymorphonuclear leucocyte phagocytosis by Porphyromonas gingivalis culture products in patients with adult periodontitis. Arch. Oral Biol. 38:285-289. 200. Wingrove, J. A . , R. G. DiScipio, Z. Chen, J. Potempa, J. Travis, and T. E. Hugli. 1992. Activation of complement components C3 and C5 by a cysteine proteinase (gingipain-1) from Porphyromonas (Bacteroides) gingivalis. J. Biol. Chem. 267:18902-18907. 201. Yanisch-Perron, C , J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mpl8 and pUC19 vectors. Gene. 33:103-119. 202. Yoneda, M., and H. K. Kuramitsu. 1996. Genetic evidence for the relationship of Porphyromonas gingivalis cysteine protease and hemagglutinin activities. Oral Microbiol. Immunol. 11:129-134. 203. Yoshimura, F., K. Takahashi, Y. Nodasaka, and T. Suzuki. 1984. Purification and characterization of a novel type of fimbriae from the oral anaerobie Bacteroides gingivalis. J. Bacteriol. 160:949-957. 96 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0087978/manifest

Comment

Related Items