Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

A puhA gene deletion and plasmid complementation system for facile site directed mutagenesis studies… Chen, Xiaoyi 1997

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1997-0515.pdf [ 3.88MB ]
Metadata
JSON: 831-1.0087974.json
JSON-LD: 831-1.0087974-ld.json
RDF/XML (Pretty): 831-1.0087974-rdf.xml
RDF/JSON: 831-1.0087974-rdf.json
Turtle: 831-1.0087974-turtle.txt
N-Triples: 831-1.0087974-rdf-ntriples.txt
Original Record: 831-1.0087974-source.json
Full Text
831-1.0087974-fulltext.txt
Citation
831-1.0087974.ris

Full Text

A puhA GENE DELETION A N D PLASMID C O M P L E M E N T A T I O N S Y S T E M FOR FACILE SITE DIRECTED MUTAGENESIS STUDIES OF THE REACTION CENTER H PROTEIN OF RHODOBACTER SPHAEROIDES by X I A O Y I C H E N B. Med., Tianjin Medical University, 1993 A THESIS SUBMITTED IN PARTIAL F U L F I L L M E N T OF THE REQUIREMENTS FOR THE DEGREE OF M A S T E R OF SCIENCE in THE F A C U L T Y OF G R A D U A T E STUDIES (Department of Microbiology and Immunology) We accept this thesis as conforming to the required standard THE UNIVERSITY OF BRITISH C O L U M B I A SEPTEMBER 1997 ©Xiaoyi Chen, 1997 In presenting this thesis in partial fulfilment of the requirements for an advanced degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department or by his or her representatives. It is understood that copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of The University of British Columbia Vancouver, Canada Date DE-6 (2/88) 11 ABSTRACT The development of a Rhodobacter sphaeroides deletion/plasmid complementation system of the puhA gene (which encodes the reaction center [RC] heavy [H] subunit) for expression of site directed mutants of the RC H protein is described. The mutant strain APUHA was constructed by introduction of a translationally in-frame deleted puhA allele at the chromosomal puhA gene site, and evaluated in plasmid complementation.experiments. Strain APUHA was unable to grow under photosynthetic conditions. Absorption spectroscopy showed this strain has a reduction in the amount of the light-harvesting I (LHI) complex. SDS-PAGE analysis of chromatophore proteins of strain APUHA confirmed the absence of the RC H protein band. When APUHA was complemented in trans with the wild type puhA gene in plasmids, photosynthetic growth and the RC H protein band in SDS-PAGE were restored. The results of comparisons of the properties of strains with different types of chromosomal puhA gene disruptions in complementation experiments are consistent with the idea that expression of one or more genes located 3' of puhA is required for optimal RC levels and photosynthetic growth. Since the APUHA translationally in-frame deletion does not seem to interfere with transcription through and beyond the residual puhA sequences, this strain allows facile evaluation of the consequences of plasmid-borne RC H mutations in an otherwise wild type genetic background. The role of the RC H subunit in photosynthesis is discussed. i i i TABLE OF CONTENTS Abstract i i Table of Contents i i i List of Tables v List of Figures vi Abbreviation and Symbols ix Acknowledgement xi Introduction 1 Materials and Methods 17 1. Bacterial Strains 17 2. Growth Conditions 19 3. In vitro D N A techniques 20 4. Bacterial Conjugation 21 5. Construction of the plasmids used to create APUHA 22 6. Construction of complementation plasmids 26 7. D N A and protein sequence analyses 33 8. Treatment of cells with ultraviolet (UV) irradiation 33 9. Southern blots 38 10. Spectrophotometric analyses 40 11. Isolation of chromatophores 41 12. Protein concentration determination 42 13. Gel electrophoresis of proteins 42 RESULTS 43 1. Construction of the puhA chromosomal mutant R. sphaeroides APUHA 43 A. D N A sequencing and restriction mapping of puhA and flanking sequences 43 B. Creation of the ApuhA allele in vitro 49 C. Transfer of the ApuhA allele into the R. sphaeroides chromosome to create APUHA 52 2. Analysis of the translationally in-frame puhA deletion mutant APUHA 58 A. Southern blot analyses 58 B. Growth studies 61 C. Absorption spectroscopy 63 D. SDS-PAGE analysis of I C M proteins 63 3. Analysis of the kanamycin resistance cartridge-disrupted puhA mutant PUHA1 68 A. Growth studies 68 B. Absorption spectroscopy 70 C. SDS-PAGE analysis of I C M proteins 76 Discussions 78 Conclusions 86 References 88 LIST OF TABLES Table I: Bacterial strains and plasmids used LIST OF FIGURES vi Figure 1: Representation of the intracytoplasmic membrane and photosynthetic complexes of purple nonsulfur photosynthetic bacteria 3 Figure 2: A two dimensional representation of the amino acids surrounding a RC water chain that are involved in hydrogen bonds or salt bridges 9 Figure 3: Representation of genes and transcripts of the R. capsulatus photosynthesis gene cluster 12 Figure 4: Genetic arrangement of R. sphaeroides puhA wild type and mutant strains 23 Figure 5: Outline of the construction of the translationally in-frame deletion {ApuhA) 24 Figure 6: Outline of the construction of the plasmid pXY4 containing the in-frame deleted puhA {ApuhA) with a larger amount of flanking sequences 27 Figure 7: Outline of the construction of the plasmid pXY5 29 Figure 8: Outline of the construction of the suicide plasmid pXY6 31 Figure 9: Outline of the construction of the complementation plasmid pXY7 used to express the puhA gene alone 34 Figure 10: Outline of the construction of the complementation plasmid p V Y l used to express the puhA gene and flanking sequences 36 Figure 11: Genetic arrangement of the 7 kb puhA EcoR I fragment of R. sphaeroides chromosome 44 Figure 12: 5' and 3' sequences of the 1.3 kb puhA BamH I fragment 45 Figure 13: 5' and 3' D N A sequences of the 7 kb EcoR I fragment that contains the puhA gene 47 Figure 14: Sequence of the R. sphaeroides puhA gene 50 Figure 15: Representation of the two possible ([1] and [2]) products resulting from single homologous recombination of pXY6 into the chromosome of strain PUHA1 after conjugation of plasmid pXY6 into the PUHA1 strain 53 Figure 16: Representation of the two possible ([1] and [2]) second homologous recombinations that would result in resolution of the tandem puhA alleles in strain C O l 56 Figure 17: Southern blot hybridization of chromosomal D N A isolated from R. sphaeroides strains to demonstrate the recovery of strain APUHA 59 Figure 18: Photosynthetic growth of R. sphaeroides APUHA and related strains 62 Figure 19: Intact cell absorption spectra of R. sphaeroides APUHA strains grown under low aeration conditions 64 Figure 20: Absorption spectra of intact cells of R. sphaeroides APUHA and related strains grown under photosynthetic conditions 66 Vll l Figure 21: SDS-PAGE analysis of chromatophore proteins isolated from the wild type strain, APUHA, and related strains grown under low aeration conditions 69 Figure 22: Photosynthetic growth of R. sphaeroides PUHA1 and related Strains 71 Figure 23: Absorption spectra of intact cells of R. sphaeroides PUHA1 and related strains 72 Figure 24: Absorptioon spectra of intact cells of R. sphaeroides strains grown under photosynthetic conditions 74 Figure 25: SDS-PAGE analyses of chromatophore proteins isolated from the wild type strain, mutant PUHA1, PUHAl(pXY7) and P U H A l ( p V Y l ) grown under low aeration conditions 77 ABBREVIATIONS AND SYMBOLS Ap (Ap r) ampicillin (or ampicillin resistant) ATP adenosine 5'-triphosphate ATPase adenosine 5'-triphosphatase bp base pair Bchl bacteriochlrophyll B S A bovine serum albumin cfu colony forming unit C M cytoplasmic membrane Cm (Cm r) chloramphenicol (or chloramphenicol resistant) cyt b/cl complex ubiquinol:cytochrome b/cl oxidoreductase compl dATP 2'-deoxynucleoside adenosine 5'-triphosphate D N A deoxyribonucleic acid EDTA ethylenediaminetetra-acetic acid I C M intracytoplasmic membrane kb kilobases kDa kilodaltons Kn(Kn r ) kanamycin (or kanamycin resistant) L H light-harvesting mRNA messenger R N A ORF open reading frame P A G E polyacrylamide gel electrophoresis X PNS purple nonsulfur psi pounds per square inch PSU photosynthetic unit puc an operon encoding the structural genes of LHII a and p polypeptides and the genes required for normal LHII functions puf an operon encoding the structural gene of LHI a and P polypeptide, the structural genes of the RC L and M subunits and a Bchl biosynthesis gene. pufQ a gene in the puf operon required for Bchl biosynthesis pufX a gene in the puf operon required for electron transfer from the RC to the cyt b/cl complex puhA structural gene of the RC H subunit PS photosynthesis RC reaction center R N A ribonucleic acid R P M revolutions per minute SSC saline sodium citrate SDS sodium dodecyl sulfate Sp (Spr) spectinomycin (or spectinomycin resistant) TBE tris borate EDTA Tc (Tcr) tetracycline (or tetracycline resistant) xi ACKNOWLEDGEMENT I would like to thank my thesis supervisor, Dr. J. T. Beatty, for his guidance throughout this study. I would also like to thank my supervisory committee members, Drs. R. A. J. Warren and G. Weeks, for their helpful suggestions during my research. My thanks goes to past and present Beatty lab members, Farahad Dastoor, Andrea Harmer, Andrew Lang, Romina Reyes and Conan Young, for scientific discussion, advice, support and good conversation. A special thanks goes to Dr. Vladimir Yurkov for his assistance and advice. Lastly, I express my appreciation to my family and friends in China, for their love and emotional help throughout this degree. 1 INTRODUCTION Photosynthesis is the most important bioenergetic process on earth, because the chemical and biological characteristics of the biosphere, including the evolution and continued existence of humans, are dependent on photosynthetically driven C O 2 fixation and O2 production. Photosynthesis produces the oxygen we breathe as well as the oxygen needed to burn fuel. This biological process is the source of almost all of our consumable energy. The best understanding of the biological conversion of light to chemical energy is of the purple photosynthetic bacteria, such as Rhodobacter sphaeroides. R. sphaeroides is a purple nonsulfur (PNS) photosynthetic bacterium that is capable of growth by both aerobic respiration and anaerobic photosynthesis. Although PNS bacteria do not split water, and thus do not produce oxygen during photosynthesis, there are strong structural and functional similarities between the PNS bacterial photosynthetic reaction center (RC) and the reaction center of photosystem II of chloroplasts (Meyer and Donohue, 1995). Unlike plants, non-photosynthetic mutants of R. sphaeroides are viable, so the phenotypic effects of photosynthesis gene mutations can be readily evaluated. In the presence of high levels of oxygen, the cells of PNS photosynthetic bacteria tend to be unpigmented and have an undifferentiated inner (cytoplasmic) membrane. When grown anaerobically, most of the anoxygenic purple photosynthetic bacteria become pigmented and contain differentiated invaginations of the cytoplasmic membrane (CM) called intracytoplasmic membranes (ICM), which have a characteristic organization and function (Drews and Golecki, 1995). The I C M of R. sphaeroides contains two light-harvesting (LH) antenna complexes, the RC complex, and the ubiquinol - cytochrome b/c\ oxidoreductase complex (the cyt b/c\ complex) (Fig. 1) (Wellington, et ai, 1992; Drews and Golecki, 1995). The LHI antenna complex of R. sphaeroides is constructed from a basic unit consisting of two small transmembrane polypeptides (a and p), one molecule of carotenoid and two bacteriolchlorophyll (Bchl) molecules. This basic unit forms an oligomer totaling about 16 a/(3 dimers organized as a ring around the RC. Pigment-protein and Bchl-Bchl interactions shift the long wavelength light absorption peak of Bchl from about 770 nm to 875 nm (Fig. 1) (Drews and Golecki, 1995). The LHI ring together with the RC forms the "core" of the photosynthetic unit (PSU), the size of which appears to be fixed in most species of purple bacteria (Cogdell, et ai, 1996). The LHII antenna complex is made up from a basic unit, which again consists of one a and one (3 polypeptide. It binds carotenoid and three Bchl molecules. After oligomerization, one Bchl absorbs at 800 nm (Bchl 800) and the other two are closely associated and absorb at 850 nm (Bchl 850) (Fig. 1) (Cogdell, et ai, 1996). The LHII rings are thought to be arranged around the periphery of the LHI-RC "core" complex and the ratio of this complex per RC is more variable. In general the lower the light intensity at which the cells are grown the more LHII per RC is synthesized. Thus R. sphaeroides is able to regulate the size of their PSU (Cogdell, et ah, 1996). The model 3 PERIPLASM C Y T c2 CYTOPLASM Figure 1. Representation of the I C M and photosynthetic complexes of PNS photosynthetic bacteria. Designation of components are as follows: B800-850 L H , LHII light-harvesting complex; B87.5 L H , LHI light-harvesting complex; RC, reaction center complex; cyt bc l , cytochrome b/c\ complex; cyt c2, cytochrome c2; ATPase, ATP phosphohydrolase complex. Bacteriochlorophyll or bacteriopheophytin molecules are represented by clusters of four small pentagons, and quinones by hexagons. The wavy arrow indicates incident light energy; bold arrows indicate the movement of excitons, electrons, protons, and adenosine nucleotides (Taken from Wellington, et al, 1992). 4 for the PSU in purple bacteria is very striking in appearance. A RC complex is surround by an LHI complex, which forms a ring, and the LHI-RC core complex is in turn surrounded by variable amounts of LHII complex rings (Papiz, et ai, 1996). The RC complexes from two purple bacteria, R. sphaeroides and Rhodopseudomonas viridis, have been crystallized, and their 3-dimensional structures are very similar (Lancaster and Michel, 1996; Lancaster, et ah, 1995). The RC complex from purple bacteria contains three protein subunits, designated light (L), medium (M) and heavy (H) (Fig. 1), which have highly conserved amino acid sequences (Lancaster and Michel, 1996; Lancaster, et ai, 1995). The cofactors of the RC complex consist of a Bchl dimer (called the 'special pair'), two 'accessory' Bchl molecules, two bacteriopheophytins, a pair of ubiquinones ( Q A and QB) and one non-heme iron. These cofactors are non-covalently bound by RC L and M subunits (Fig. 1). The RC L and M subunits each contain five membrane-spanning helices,.related to each other through a two-fold axis of symmetry, which bind Bchl and other cofactors. The cofactors form two branches each consisting of two Bchls, one bacteriopheophytin and one quinone, which cross the membrane starting from the 'special pair' of two closely associated Bchls near the periplasmic side, followed by the 'accessory' Bchl, one bacteriopheophytin and a quinone (Fig. 1). Only the branch more closely associated with the L subunit (the right- hand one in Fig. 1) is used in the light-driven electron transfer, and it is called the A (active) - branch, the inactive one the B - branch. The active branch ends with Q A , the inactive one ends with Q B (Okamura and Feher, 1995). 5 The remarkable metabolic diversity of R. sphaeroides, its ability to synthesize I C M when grown anaerobically in the dark and the availability of the X-ray crystal structure of the RC make it an excellent model for the study of the relationship of structure to function in the RC. Photosynthetic energy transduction in R. sphaeroides is thought to initiate with the absorption of light energy by LHII pigments, followed by transfer of energy to LHI, which is closely associated with the RC, and then transfer of energy to the RC (Fig. 1) (Woodbury and Allen, 1995). Upon transfer of energy from the L H antennae to the photosynthetic RC, or direct excitation by light of the RC itself, an excited singlet state of the 'primary electron donor', which is the 'special pair' of Bchl molecules, is created. The key reactions that occur in the RC involve the two-electron reduction and concomitant binding of two protons from the cytoplasmic side of the membrane by Q B . The electron transfer starts from the 'special pair', proceeds through one bacteriopheophytin molecule on the A-branch to the quinone Q A , and finally to Q B (Fig. 1) (Okamura and Feher, 1995). During or after a second electron transfer to the Q B , this two-electron accepting quinone picks up two protons, forming a neutral, doubly reduced quinol, which dissociates from the RC and is oxidized by the cyt b/c\ complex, releasing protons on the periplasmic side of the membrane (Fig. 1). The net result of these reactions is the vectorial transport of protons across the membrane, driven by electron transfer. This proton transport produces a pH gradient across the cytoplasmic membrane that is used to perform chemical reactions necessary 6 to the function of the bacterium, such as ATP synthesis (Fig. 1). The electrons removed from quinol by the cyt b/c\ complex are returned to the RC special pair by a cytochrome C complex C2 (cyt ci) (Lancaster and Michel, 1996; Okamura and Feher, 1995). The RC H subunit consists of a globular cytoplasmic domain that caps the cytoplasmic side of the RC M and L proteins, and a single-transmembrane alpha helix that presumably anchors the H protein in close association with the M and L proteins in a 1:1:1 ratio. The L and M subunits directly bind cofactors and are involved in electron transfer within the RC (Chang, et ah, 1991). The role of the RC H subunit, which does not bind pigments or other cofactors, is less clear. In spite of the structural information, little is known about what function(s) the RC H protein provides to cells. A previous study found that, when the RC H subunit was removed, the primary light-driven electron transfer functions of the RC L - M heterodimer were largely unaffected and indistinguishable from native RC. However, major disturbances were observed in the functional characteristics of the two H-proximal quinones and electron transfer from Q A to Q B was impaired by the absence of the H subunit (Debus, et al., 1985). Proton transfer in the RC is determined largely by the protein structure near the Qs-binding site. The X-ray crystal structure from R. sphaeroides revealed that Q B is located in the interior of the protein inside the hydrophobic membrane, out of direct contact with the aqueous solution, and suggested the possibility that protonatable amino acids from the protein were responsible for proton transport to Q B . A RC 7 structure shows two chains of residues that could form proton bridges from Q B to the outside (Stowell, et al., 1997). Site directed mutagenesis of several of these residues to nonprotonatable groups resulted in loss of proton transport to Q B and conclusively demonstrated that the RC proteins play an important role in proton transport. A l l of genes encoding the protein components of the catalysts of photosynthesis have been cloned from several species of photosynthetic bacteria, and many have been used for site directed mutagenesis studies of structural and functional properties of certain amino acids in these proteins (Woodbury and Allen, 1995; Okamura and Feher, 1995). Changes of RC L and M residues, which are located near the Q B site, have been used to formulate the following model: the charge of the first electron transferred to the Q B quinone is neutralized by a proton coming from a pathway involving the Ser L 2 2 3 and L213 Asp side chains, and the second electron is neutralized by a proton coming from a * L212 pathway involving the Glu side chain (Okamura and Feher, 1995; Lancaster and Michel, 1996). The first study of the role of the RC H subunit in Q B function by site directed mutagenesis was reported by Takahashi and Wraight (Takahashi and Wraight, 1996). When G l u H 1 7 3 , the H residue nearest to Q B , was changed to Gin, the kinetics of the first electron transfer, leading to formation of the semiquinone, QB", and the proton-linked second electron transfer, leading to the formation of fully reduced quinol, were both greatly retarded (Takahashi and Wraight, 1996). 8 In the structure of the newly obtained trigonal crystal form of the R. sphaeroides RC, a chain of water molecules was found (Ermler, et al., 1994; Lancaster and Michel, 1996). This structure reveals an extraordinary chain of twelve water molecules extending from the Q B site, via G l u L 2 1 2 through the globular cytoplasmic domain of RC H subunit, to the cytoplasm (Fig. 2). The fixed water molecules, most within hydrogen binding distance of their neighbors, are located in the electron density map from the Q B site to the cytoplasm across the H subunit. The dominance of charged residues along the water chain provides a suitable environment for transporting a positive charge (Fig. 2). There is no experimental evidence at present about the use of this water chain for proton transfer. Recently, Stowell, et al. identified another water channel, which leads from Ser to Asp via the interface between the H and M subunits, parallel to the membrane surface at approximately the depth of the nonheme iron (Stowell, et al., 1997). This pathway traverses the residues Ser , Asp and G l u H 1 7 3 that have been identified by mutational studies to be involved in proton uptake by Q B (Okamura and Feher, 1995; Lancaster and Michel, 1996). The cytoplasmic terminus of this pathway is near the surface of the negatively charged membrane where the proton concentration is expected to be substantially greater than that in bulk water. It was speculated that these chains of water molecules, and associated charged residues from the RC H , M , and L proteins, form networks of hydrogen bonds and salt bridges that are required for proton translocation (Ermler, et al., 1994; Lancaster and Michel, 1996; Stowell, et al., 1997). If some of these charged H residues turn out to be important for proton translocation, it would verify the role of the H protein as an active catalyst, as opposed to just a structural component of RC. It 9 Figure 2. A two dimensional representation of the amino acids surrounding a RC water chain that are involved in hydrogen bonds or salt bridges. The water molecules are shown in oval boxes, the amino acid residues are shown in rectangular boxes (the RC H protein residues shown in shaded boxes). The lines indicate potential hydrogen bonding, with the distances between donors and acceptors given in A units. Two more distant atomic distances (Asp L 2 1 3 to G l u H 1 7 3 and W55 to G lu H 1 7 3 ) are labeled with brackets (Ermler, et ah, 1994). kspH17d' 11 will be interesting to see whether these 'water channels' can be interrupted by site directed mutagenesis, and what the effect of this on protonation of Q B might be. Before the discovery of the water chain in the trigonal crystal, the only H residues that had been suggested as possible being involved in Q B oxidation-reduction reactions (because of their position between the Q B site and the aqueous phase) were G l u H 1 7 3 , A s p H 1 2 4 , H i s " 1 2 6 , H i s " 1 2 8 (Allen, et al, 1988). However test of these residues has been hampered by the lack of a suitable R. sphaeroides puhA gene (which encodes the RC H protein) deletion/complementation system. The D N A sequence of a 46 kb continuous region of photosynthesis gene cluster was completed in the closely related species Rhodobacter capsulatus (Fig. 3) (Alberti, et al. 1995). A similarly arranged photosynthesis gene cluster is found in R. sphaeroides, although not all R. sphaeroides genes equivalent to those discovered in R. capsulatus have been identified (Coomber, et al., 1990). However, the R. sphaeroides photosynthesis genes that have been located seem to lie in approximately the same relative positions as the equivalent genes in R. capsulatus and transcribed similarly to R. capsulatus (Beatty, 1995). As shown in Fig. 3, most of the essential pigment biosynthetic and pigment-protein complex structural genes involved in photosynthesis are located in the photosynthesis gene cluster (Alberti, et al., 1995). The puf operon encodes the structural genes for LHI and the RC L and M subunits, a gene necessary for Bchl biosynthesis (pufQ), and the pufX gene, which is involved in quinone transfer to the cyt b/c\ complex (Fig. 3) (Youvan, et al, 1984; Bauer, et al, 1988; Liburn, et al., 1992). The puc operon, which is not located within the photosynthesis gene 12 Figure 3. Representation of genes and transcripts of the R. capsulatus photosynthesis gene cluster (Alberti, et al., 1995). A similarly arranged photosynthesis gene cluster is found in R. sphaeroides (Coomber, et al., 1990). Bchl biosynthesis genes (bch) are designated by gray shading, carotenoid biosynthesis genes {erf) are shown as cross-hatched boxes, light-harvesting and reaction center genes (puf and puh) are represented by diagonal hatches, and open reading frames of other or uncertain function are shown by spots. Proposed transcripts are designated by arrows, with possible read-through extensions shown as dotted lines (Beatty, 1995). X M L A B pufQ Z Y X bchC F crtE bchF N B H L M orfl696 puhA orf214 162b 55 274 162a A A A A 11111 14 cluster, encodes the LHII polypeptides as well as gene products essential for a wild type level of LHII complex (Youvan, et al, 1985; LeBlanc, et al., 1993; Fonstein and Haselkorn, 1995). The puhA gene, which is located in the photosynthesis gene cluster 39 kb away from the puf operon and transcribed in an opposite direction, encodes the RC H subunit (Alberti, et al., 1995). It was shown in R. capsulatus that the puhA gene has overlapping transcripts, which originate from the bch FNBHLM - orfl696 operon (Fig. 3) (Bauer, 1995). These transcripts include a large 11 kb transcript that encodes puhA as a product of read-through transcription from the bchF Bchl biosynthesis genes, a second 1.1 kb puhA mRNA derived from the 11 kb bchF transcript by mRNA processing, and a third highly expressed 0.95 kb transcript initiated from a promoter located within the gene immediately upstream of the puhA structural gene, namely orfl696 (Fig. 3) (Bauer, 1995). But the transcription of the puhA gene in R. sphaeroides is less clear. In R. capsulatus, there are several open reading frames (orfs) downstream of the puhA gene. These orfs are designated orf214, orfl62b, orf55, orf274, and orfl62a (Fig. 3) (Alberti, et al., 1995). It was discovered in R. capsulatus that expression of orf214 and at least one additional gene beyond orf214 are important for RC formation and, thus, for photosynthetic growth, and are dependent on read-through transcription from the puhA gene for normal expression (Wong, et al., 1996). Site directed mutagenesis has proven to be a powerful tool for the analysis of the purple bacterial photosynthetic RC, especially in R. sphaeroides, which arguably is the system with the best combination of genetic facility and structure information (Lancaster, et al, 1995; Okamura and Feher, 1995; Stowell, et al, 1997; Williams and 15 Taguchi, 1995; Woodbury and Allen, 1995). Although site directed mutagenesis has been used to study the functions of the RC L and M proteins, the study of the role of the RC H subunit has been hampered by the lack of a suitable R. sphaeroides puhA gene deletion/complementation system. Kaplan's group constructed the R. sphaeroides puhA mutant PUHA1 by replacement of segment of the puhA and the 5' flanking orfl696 genes with a kanamycin resistance cartridge (Sockett, et al., 1989). However, the RC deficiency of this mutant could not be complemented with the puhA gene unless large amounts of flanking sequence were also present. Attempts at using this mutant as part of the expression system for engineered RC H protein variants have been blocked by the inability to obtain sufficient quantities of RCs for analysis (M. Okamura, personal communication). The deficiency in RC formation in the R. sphaeroides PUHA1, when complemented with a plasmid copy of the puhA gene (Sockett, et al., 1989), is probably due to a polar effect of the gene disruption on the expression of the genes located 3' of the cartridge insertion, which was shown to be important for maintaining photosynthesis in R. capsulatus (Wong, et al., 1996). A suicide plasmid-directed chromosomal puhA gene replacement approach was described, but this method entails the laborious screening of thousands of exconjugants to obtain the desired puhA mutant (Takahashi and Wraight, 1996). In principle, it would be feasible to use the non-polar (translationally in-frame deleted) R. capsulatus puhA mutant for site directed mutagenesis studies of RC H protein variants (Wong, et al., 1996). However, although the RC proteins of R. sphaeroides and R. capsulatus are greatly homologous (Williams, et al., 1986), it has 16 not been possible to obtain crystals of the R. capsulatus RC. Therefore, it would be very useful to obtain a R. sphaeroides strain with a non-polar disruption of the puhA gene, as part of a system for expression of site directed mutants of RC H proteins, that could eventually lead to X-ray crystallography structure analyses of the mutants. This thesis describes the use of a directed mutagenesis approach with the R. sphaeroides puhA gene to create a translationally in-frame deleted puhA mutant. Presumably, this in-frame deletion would be a non-polar disruption and should not affect the expression of the genes downstream of the puhA gene. After mutagenesis, the mutant strain was characterized to determine i f it grew photosynthetically and had normal levels of pigment-protein complexes. The in-frame deleted puhA mutant was complemented in trans with plasmids expressing puhA to see i f photosynthetic growth or other phenotypic changes were restored. The results were compared with the kanamycin resistance cartridge disrupted puhA mutant PUHA1 (Sockett, et al., 1989), to see which system is better for expression of the site directed mutants of the RC H protein. 17 MATERIALS AND METHODS 1. Bacterial Strains The strains used in this thesis are listed in Table I. R. sphaeroides 2.4.1 is a wild type strain. R. sphaeroides PUHA1, which is a kanamycin resistance cartridge-disrupted puhA mutant of 2.4.1 with simultaneous deletion of segments of the orfl696 and puhA genes, was used as a parental strain to create the translationlly in-frame deleted puhA mutant APUHA. Escherichia coli strains C600 r-m+ and DH5a were host strains used for maintenance of plasmids. E. coli SI7-1 was used as mobilizing strain for conjugation with R. sphaeroides. When necessary, E. coli HB101(pRK2013) was used as a mobilization helper strain for tri-parental conjugation. Table 1. Bacterial strains and plasmids used Strains/Plasmids Genotype/Description Reference/Source A. E. coli C600r"m+ hsdR thr-1 leuB6 thi-1 lacYl supE44 tonA21 mcrB (Bibb and Cohen, 1982) DH5a supE44 AlacUl69(080 lacZAMIS) hsdR17 recAl endAl gyrA96 thi-1 relAl (Hanahan and Meselson, 1986) HB101 F" A(gpt-proA)52 leu supE44 aral4 galK2 lacYl A(mcrC-mrr) rpsL20 (Strr) xyl-5 mtl-1 recA13 (Schmidhauser and Helinski, 1985) 18 S17-1 RZ1032 B. R.sphaeroides 2.4.1 PUHA1 C01 APUHA C. Plasmids pHP45Q pRHBL404 pRK2013 pRK415 pSUP203 Host strain for pRK2013 helper plasmid used in tri-parental matings pro res' mob+ (Simon, et al, 1983) Plasmid mobilizing strain HfrKL16 PO/45 [lysA(6\-62)] dutl (Kunkel, et al, 1987) ungl thil relAl Zbd-279::TnlO supE44 Strain used to prepare uracil-containing D N A Wild type strain Kanamycin resistance cartridge disrupted or/1696 and puhA mutant S. Kaplan Personal communication (Sockett, etal, 1989) PUHA1 derivative with the integration This thesis of pXY6 into the chromosome Translationally in-frame deleted puhA This thesis mutant pBR322 with the 2.0 kb Q cartridge (Prentki and Krisch, insert, Ap r , Sp r, Sm r 1984) pRK404 derivative with 1.34 kb (Donohue, et al, 1986) BamR I puhA insert, Tc r Mobilizing plasmid; K n r (Ditta, et al, 1985) Broad host range vector, Tc r, pRK404 (Keen, et al, 1988) derivative with the pUC19 multiple cloning site, lacZa Suicide plasmid, pBR325 derivative, (Simon, et al, 1983) Mob+, Ap r , Cm r , Tc r 19 pTZ18U pUI804 p X Y l pXY4 pXY5 pXY6 pXY7 p V Y l Ap r , lacZa pBluescriptSK" with the 7.0 kb EcoR I puhA insert, Ap r pTZl 8U with the 0.8 kb BamH I ApuhA insert pBluescriptSK" with 6.4 kb EcoR I ApuhA insert pXY4 with the 2.0 kb Q cartridge inserted into the Sma I site of the 6.4 kb ApuhA fragment pSup203 with the 8.4 kb ApuhAwQ. fragment inserted in between the Pst I (blunt ended) and Hind III sites pRK415 with the 1.3 kb BamH I puhA insert, expression vector for puhA pRK415 with the 7.0 kb EcoR I puhA insert, expression vector for puhA (Yanisch-Perron, et al., 1984) S. Kaplan Personal communication This thesis This thesis This thesis This thesis This thesis V . Yurkov Unpublished data 2. Growth Conditions A l l R. sphaeroides strains were routinely grown in either R C V (a minimal malate/ N H 4 + medium), supplemented with biotin (15 p.g/1) and nicotinic acid (1 p.g/ml), or YPS medium (which contains yeast extract and peptone) at 34°C (Weaver, et al., 1975; Beatty and Gest, 1981). A l l cultures used in photosynthetic growth experiments were inoculated to a turbidity of about 20 Klett units (approximately 8 x 10 cfu/ml) and growth was followed by measuring the turbidity of the cultures using a 20 Klett-Summerson photometer equipped with filter #66 (red). Oxygen-limited cultures were grown in Erlenmeyer flasks filled to 80% of their nominal volumes and shaken at 150 R P M . Photosynthetic cultures were inoculated from oxygen-limited cultures in the stationary phase (about 180 Klett units). Photosynthetically grown cultures were grown in screw-cap tubes filled to capacity and incubated in a glass-sided water bath illuminated with Lumiline 60W tungsten filament incandescent lamps. Light intensity was measured with a Li-Cor photometer equipped with a LI-190SB quantum sensor (Li-Cor, Lincoln, NE). Plate cultures were grown on media supplemented with agar at 15 g/1. Photosynthetically grown plate cultures were incubated in B B L GasPak anaerobic jars (Becton Dickison and Co., Cockeysville, MD) at 34°C. A l l E. coli strains were grown in L B medium (Sambrook, et al., 1989). Media were supplemented with antibiotics at the following concentrations: for R. sphaeroides, spectinomycin: 10 ug/ml, tetracycline-HCL: 1 ug/ml, kanamycin sulfate: 10 |J.g/ml; for E. coli, ampicillin: 200 |ag/ml, spectinomycin: 50 |J.g/ml, tetracycline-HCL: 10 ug/ml, kanamycin sulfate: 50 p,g/ml. 3. In vitro DNA techniques The plasmids used and constructed in this thesis research are listed in Table I. Plasmid D N A was routinely isolated from E. coli cultures by the alkaline lysis method (Sambrook, et al., 1989). For large-scale purification, plasmids were isolated using the 21 QIAGEN DNA-affinity column procedure (QIAGEN Inc., Chatsworth, CA). Purified plasmid D N A used for automated sequencing was prepared using the modified mini alkaline-lysis/PEG precipitation procedure (NAPS unit, UBC). D N A was purified from agarose gel slices by adsorption to silica gel particles, using the QIAEX (QIAGEN Inc., Chatsworth, CA) procedures. Transformation of E. coli was routinely performed using the CaCb competent cell transformation procedure (Sambrook, et al., 1989). When necessary, electro-transformation of E. coli was performed using the Gene Pulser apparatus, and cells were grown, harvested, and electro-transformed according to the manufacturer's instruction manual (Bio-Rad Laboratories, Richmond, CA). 4. Bacterial Conjugation Conjugation of plasmid D N A into R. sphaeroides strains was usually accomplished using E. coli SI7-1 as plasmid donor strain. When other E. coli strains were used as plasmid donors, E. coli HB101(pRK2013) (Table 1) was used as a mobilization helper strain. Equal volumes of overnight stationary phase cultures of donor and recipient cells (and helper cells when necessary) were mixed, pelleted (30 seconds, 15,000 x g in an Eppendorf benchtop microcentrifuge), and resuspended in an equal volume of R C V medium. A 10 ul portion of the suspension was spotted onto a R C V plate. After the spot dried, the plate was incubated at 30°C overnight to allow for conjugation. R. sphaeroides exconjugants were purified from E. coli cells by 22 subsequent spreading onto R C V plates with appropriate antibiotic(s), and their purities were checked by streaking onto YPS plates. 5. Construction of the plasmids used to create APUHA The chromosomal arrangements of the puhA alleles in the wild type and puhA mutant strains are summarized in Fig. 4. The puhA gene was removed from pRHBL404 and subcloned into pTZ18U (Fig. 5 and Table 1), which contains the origin of replication derived from a single-stranded bacteriophage, as a 1.3 kb BamR I fragment to create pPUHA (Fig. 5 and Table 1). The uracil-containing single-stranded plasmid D N A was prepared by transforming the duf ung E. coli strain RZ1032 (Table 1) with pPUHA (Table 1) and infecting with a "helper phage" derivative of the bacteriophage M l 3 (Sambrook, et al. 1989). A 46-mer oligonucleotide, MUTPU2 (5' - C G C T G G C G A T C T A T A G C T T C G A T A T C C T C T C G T C C G A C C T G T T C G C - 3'), was synthesized to contain 5' and 3' sequences perfectly matched with the R. sphaeroides puhA structural gene, and an EcoR V site in the middle (there is no EcoR V site present in the wild type puhA sequence) (Fig. 5). Thus, mutagenesis of the puhA gene (783 bp) in vitro was achieved by substitution of an EcoR V site for a 561 bp segment (extending from 61 bp to 621 bp of the puhA structural gene), which accounts for the central 72% (187 amino acids) of the coding sequence, in a "loop-out" oligonucleotide-directed mutagenesis (Sambrook, et al. 1989). The deletion did not cause a translation frameshift, as confirmed by D N A sequencing. This deletion leaves only 60 bp of the puhA coding sequence upstream and 162 bp downstream of the 23 BamR I Xho I Xho I BamR I 1 1 1 orfl696 puhA BamR I Xho I £coR V BamH I APUHA orfl696 ApuhA [Xho I] [Xfo? I] BamR I PUHA1 — K n r orfl696 puhA: : K n r BamHI Figure 4. Genetic arrangement of /?. sphaeroides puhA wild type and mutant strains. Only the orf!696 and puhA loci are shown. Restriction sites are shown above the genes. Blunted sites which were not regenerated after ligation are shown in square brackets. 24 Figure 5. Outline of the construction of the translationally in-frame deletion (ApuhA). Plasmid sequences are shown as thin lines. Genes in the plasmids are shown as open arrows and as labeled. The R. sphaeroides puhA gene sequences are shown as shaded arrows. The oligonucleotide MUTPU2 used to make the in-frame puhA deletion is shown as a thick line. The dashed circle around pPUHA shows the newly synthesized second strand. The loop inside pPUHA shows the sequences to be deleted from the wild type puhA gene. The restriction sites are abbreviated as follows: E, EcoR. I; B, BamH I; ?,Pstl; H , HindTIL 25 correct mutant 26 deletion site. The resultant plasmid containing the in-frame deleted puhA fragment (ApuhA) was designated p X Y l . Plasmid p X Y l was then digested with Fse I, followed by digestion with Bgl II, and the 450 bp Fse I to Bgl II fragment containing the ApuhA gene was isolated. Plasmid pUI804 (Table 1) contains a 7 kb EcoR I puhA fragment, which includes the puhA gene and flanking sequences (Fig. 6). Plasmid pUI804 was first digested with Bgl II to linearize it, and then partially digested with Fse I. The 9 kb Fse I to Bgl II fragment was isolated and ligated with the 450 bp Fse I to Bgl II fragment containing the ApuhA gene. The resulting construct was named pXY4 (Fig. 6). Plasmid pHP45Q (Table 1) contains spectinomycin and streptomycin resistance genes as an omega (Q) fragment. The 2 kb Sma I Q. fragment was ligated into the Sma I sites of pXY4 to make plasmid pXY5 (Fig. 7). Plasmid pXY5 was then digested with Xba I (ends made blunt with T4 D N A polymerase), followed by digestion with Hind III. The 8.5 kb Xba I (blunt ended) to Hind III fragment, which contains the Q cartridge and the ApuhA fragment, was ligated into the Pst I (end made blunt with T4 D N A polymerase) and Hind III sites of the suicide plasmid pSUP203 (Table 1). The resultant suicide plasmid, named pXY6 (Fig. 8), was mobilized into the R. sphaeroides strain PUHA1 (Sockett, et al. 1989) by conjugation. 6. Construction of complementation plasmids 27 Figure 6. Outline of the construction of the plasmid pXY4 containing the in-frame deleted puhA (ApuhA) with a larger amount of flanking sequences. Plasmid sequences are shown as thin lines. Genes in the plasmids are shown as open arrows. R. sphaeroides sequences are shown as shaded boxes, the puhA and ApuhA gene are shown as darkly shaded arrows. The restriction sites are abbreviated as follows: E, EcoR I; B, BamH I; H , Hind III; P, Pst I; Fs, Fse I;Bg,5g/II . 28 ApuhA i f f B § 29 Figure 7. Outline of the construction of the plasmid pXY5. Plasmid sequences are shown as thin lines. Genes in the plasmids are shown as open arrows. R. sphaeroides sequences are shown as shaded boxes, the ApuhA gene is shown as a darkly shaded arrow, and the Q cartridge is shown in black. The restriction sites are abbreviated as follows: E, EcoR I; H , Hind III; P, Pst I; Xb, Xba I; Sm, Sma I; Fs, Fse I; Bg, Bgl II. 30 31 Figure 8. Outline of the construction of the suicide plasmid pXY6. Plasmid sequences are shown as thin lines. Genes in the plasmids are shown as open arrows. R. sphaeroides sequences are shown as shaded boxes, the ApuhA gene is shown as a darkly shaded arrow, and the Q. cartridge is shown as a black box. The restriction sites are abbreviated as follows: E, EcoR I; H , Hind III; P, Pst I; Xb, Xba I; Sm, Sma I; Fs, Fse I; Bg, Bgl II. 32 Fs 33 Since it was shown in R. capsulatus that either one or both of the two ORFs located immediately downstream of puhA (orf 214 and 162b) are required for the normal RC level and hence optimal photosynthetic growth (Wong, et al. 1996), it was of interest to compare the effect of expressing the R. sphaeroides puhA gene with or without large amounts of flanking sequences in either PUHA1 or APUHA. This would allow me to decide which system is best for expression of site directed mutants of the RC H subunit. The plasmid pXY7 (Fig. 9) was created by insertion of a 1.3 kb BamR I puhA fragment into the broad host-range plasmid pRK415. A 7 kb EcoR I puhA fragment from pUI804 was inserted into pRK415 to make p V Y l (Fig. 10). The plasmids pXY7 and p V Y l were then transformed by conjugation into either PUHA1 or APUHA to test for expression of puhA (which would produce the RC H subunit). 7. DNA and protein sequence analyses The 5' and 3' ends of the 1.3 kb R. sphaeroides puhA BamR I fragment, the ApuhA allele, and the 5' and 3' ends of the 7 kb puhA EcoR I fragment were sequenced in the U B C NAPS facility. The D N A sequence data and protein sequence predicted from the D N A sequence were analyzed with the D N A Strider software package (Commissariat a l'Energie Atomique, France). 8. Treatment of cells with ultraviolet (UV) irradiation 34 Figure 9. Outline of the construction of the complementation plasmid pXY7 used to express the puhA gene alone. Plasmid sequences are shown as thin lines. Genes in the plasmids are shown as open arrows. The R. sphaearoides puhA gene is shown as a shaded arrow. The restriction sites are abbreviated as follows: E, EcoR I; B, BamU I; H , Hind III; P, Pst I. 35 36 Figure 10. Outline of the construction of the complementation plasmid p V Y l used to express the puhA gene and flanking sequences. Plasmid sequences are shown as thin lines. Genes in the plasmids are shown as open arrows. R. sphaeroides sequences (DNA insert) are shown as shaded boxes, the puhA gene is shown as a darkly shaded arrow. The restriction sites are abbreviated as follow: E, EcoR I; B, BamH I; H , Hind III; P, Pst I; Fs, Fse l;Bg,Bglll. 37 38 Cells of a 40 ml stationary phase, oxygen-limited R. sphaeroides strain C O l culture were collected by centrifugation. The cell pellet was resuspended in an equal volume of ice cold 0.1 M MgSC>4 and incubated on ice for 10 min. For each time point 5 ml of the cell suspension was transferred into a sterile glass petri dish, and the cells were exposed to U V irradiation for 0, 20, 30, 40, 50, 60, 75, and 90 seconds by placing the dish (lid removed) on a flat surface under the U V lamp for the prescribed time, occasionally mixing the suspension by rocking the dish back and forth. The lamp used was a 25W U V germicidal lamp, and the distance between the petri dish and the lamp was 37 cm. Each sample was titered for viable cells by plating dilutions of each time point on R C V plates. The majority of the cell suspension from each time point was stored at 4°C. After about two days, colonies on each dilution plate were counted and the survival rate was calculated. The cell suspension of the time point with 40% survival was used to inoculate liquid R C V medium to.allow recombination during overnight growth, and dilutions were spread onto R C V agar plates to obtain colonies. The individual colonies were screened for Kn s/Sp s clones by "toothpicking" individual colonies onto R C V medium, R C V + K n or R C V + Sp. 9. Southern blots Chromosomal D N A was purified from R. sphaeroides cells by a Triton X-100 (octyl phenoxy polyethoxyethanol) lysis and CsCl gradient procedure. Cell pellets from 100 ml of stationary phase cultures were resuspended in 4 ml of a 25% sucrose solution dissolved in 50 m M Tris-HCl (pH 8.0). To these resuspended cells lysozyme 39 was added to a concentration of 1 mg/ml, followed by incubation on ice for 10 min, addition of 1 ml of 0.1 M EDTA and a second 10 min incubation at room temperature. The cells were lysed by addition of 2 ml of Triton X-100 lysis buffer (50 m M Tris-HC1 pH 8.0, 10 m M EDTA, 2% Triton X-100), and the lysate was incubated at 50 °C for 10 min. CsCl (1 g/ml of crude lysate) was dissolved in the lysate after which it was dispensed into 13.5 ml ultracentrifuge tubes, followed by topping off with 200 ul of an ethidium bromide (10 mg/ml) solution. The D N A was recovered after a standard CsCl equilibrium density gradient ultracentrifugation procedure, then extracted with isopropanol (previously equilibrated with 1 g/ml of CsCl in water), and dialyzed against TE buffer (Sambrook, et al., 1989). Five of chromosomal D N A from each R. sphaeroides strain were digested with BamH I and electrophoresed in a 1% agarose gel in 0.5 x TBE buffer (Sambrook, et al., 1989) at room temperature. The D N A was denatured by soaking the gel twice in 20 gel volumes of 1.5 M NaCl, 0.5 M NaOH for 20 min at room temperature. The gel was neutralized by soaking twice in 20 gel volumes of 1.5 M NaCl, 1.0 M Tris (pH 7.5) for 20 min at room temperature. The neutralization step was repeated if the pH of the gel was > 7.8 (pH was checked by laying pH paper on the gel). The gel was then equilibrated in two changes of 0.5 x TBE buffer for 20 min each to reduce the ionic strength of the gel. D N A was transfered to positively charged nylon membranes (Boehringer Mannheim, Mannheim, Germany), wetted in 0.5 x TBE buffer, by electroblotting at 20 V in 0.5 x TBE buffer for about 18 hours in a BIO-RAD Trans-Blot Electrophoretic Transfer Cell (BIO-RAD Laboratories, Richmond, CA). The membranes were then air-dried for 30 min at room 40 temperature. The D N A was fixed to the membranes by irradiation in a U V Stratalinker (Stratagene, La Jolla, CA) for 12 seconds. Hybridization was performed using the digoxigenin (DIG) Labelling and Detection Kit (Boehringer Mannheim, Mannheim, Germany). Membranes (about 12 x 8 cm) were prehybridized for 30 min at 40 °C in 20 ml of 5 x SSC (10 x SSC: 0.15 M NaCitrate, 1.5 M NaCl, PH 7.0), 0.1% N-lauroylsarcosine, 0.02% SDS, 50% formamide and 2% blocking agent. The prehybridization buffer was then supplemented with approximately 25 u.g of denatured probe, which had been DIG-labelled by the random oligonucleotide primer method using DIG- l l -dUTP and 500 ng of template D N A (Boehringer Mannheim, Mannheim, Germany). Hybridization occurred overnight at 40°C, after which the membrane was washed twice for 5 min in 200 ml of a solution of 2 x SSC, 0.1% SDS at room temperature. The membrane was further washed twice for 15 min in 2 ml/cm 2 of 0.1 x SSC, 0.1% SDS at 68°C. The non-radioactive Immunological Detection System (Boehringer Mannheim, Mannheim, Germany) was used. The suggested protocol was followed and the membranes were air-dried and stored after color development. 10. Spectrophotometric analyses Absorption spectra of oxygen-limited and photosynthetically grown intact cells (about 1.8 x 109 cells resuspended in 22.5% B S A in YPS medium) were obtained 41 using a Hitachi U-2000 spectrophotometer, and data were collected with the Spectra Calc software package (Galactic Industries Corporation, Salem, NH). The spectra were normalized by multiplying the spectra by a factor to adjust the absorbance at 650 nm to 0.2 and analyzed with the Grams/32 software package (Galactic Industries Corporation, Salem, NH). 11. Isolation of chromatophores Chromatophores (ICM vesicles containing the photosynthetic apparatus) were prepared from a suspension in 50 m M Tris-HCl (pH8.0) of cells grown under reduced aeration and disrupted by passing twice through a French pressure cell with a pressure of approximately 15,000 psi. The disrupted cells were centrifugated (25,800 x g, 8 min) to pellet intact cells and large cell debris, followed by centrifugation of this supernatant fluid (412,000 x g, 15 min) to pellet chromatophores. The pellet was resuspended in 50 m M Tris-HCl, pH 8.0) and the chromatophores were further purified using a 3-layered (20-40-60%) sucrose step gradient in 50 m M Tris-HCl (pH 8.0) as the buffer. After centrifugation at 100,000 x g for 7 hours, purified chromatophores were collected from the 20%-40% interphase. The chromatophores were then diluted in 50 mM Tris-HCl (pH 8.0), pelleted by centrifugation at 171,000 x g for 30 minutes and resuspended in 50 mM Tris-HCl (pH 8.0) to a concentration of about 10-20 mg protein/ml. Typically, 100 ml of cell culture (at about 300 Klett units) were used to prepare about 0.5 ml of purified chromatophores. 42 12. Protein concentration determination Chromatophore protein concentration was measured using a modified Lowry method (Peterson, 1983). 13. Gel electrophoresis of proteins A Tricine-SDS polyacrylamide gel system was used for electrophoresis of purified chromatophores (Schagger, et al. 1987). Chromatophore proteins were solubilized by heating in a boiling-water bath for 60 seconds before loading on the gel (Broglie and Niederman, 1979). About 50 jig (Lowry protein value) of each of the purified chromatophores were loaded in each lane. The gel was stained with Coomassie blue after electrophoresis at 18 mA for 19 hours. RESULTS 43 1. Construction of the puhA chromosomal mutant R. sphaeroides APUHA A . D N A sequencing and restriction mapping of puhA and flanking sequences. Plasmid pUI804 contains a 7 kb EcoR I fragment, which includes the puhA gene and flanking sequences (Fig. 11). The sequence of this 7 kb EcoR I puhA fragment was unknown except for the puhA structural gene and a small amount of flanking sequences (Donohue, et al., 1986; Williams, et al., 1986). To use it for the later cloning steps, it was of interest to obtain at least part of the sequence information and restriction map of this fragment. The 3' and 5' ends of the 1.3 kb BamR I fragment that contains the puhA gene were sequenced, since the published sequence did not extend to the BamR I sites (Fig. 12). The sequence data revealed that the BamH I sites are located 475 bp 5' and 83 bp 3' of the puhA start and stop codons, respectively (Fig. 12). The 5' end of the 1.3 kb puhA BamR I fragment was found to be homologous to R. capsulatus or/1696 by sending the translated amino acid sequence to the B L A S T email server (NCBI). There was no sequence found to be significantly similar to the 3' end of the puhA BamR I fragment. Plasmid pUI804 was also sequenced by using the reverse and forward primers of plasmid pBluescript to sequence into the 7 kb EcoR I fragment. The sequences of the 5' and 3' ends of the 7 kb EcoR I fragment were obtained (Fig. 13). The sequences 44 E Fs B B F s Bg B E 'bchH L M . orfl696 puhA Figure 11. Genetic arrangement of the 7 kb puhA EcoR I fragment of R. sphaeroides chromosome (Hunter, et al, 1990). The bchHLM, orf1696 and puhA loci are shown. Restriction sites on the fragment are shown approximately to scale above the genes: E, EcoR I; B, BamH I; Fs, Fse I; Bg, Bgl II. 45 Figure 12. 5' and 3' sequences of the 1.3 kb puhA BamH I fragment. A . The sequence of the 5' end of the 1.3 kb BamH I fragment. The D N A sequence from the 5' BamH I site to the start codon (atg) of the puhA structural gene is shown. This sequence was found to be homologous to the 3' end of the orfl696 gene of R. capsulatus. The translated amino acid sequence of part of gene product of orfl696 is shown. B. The sequence of the 3' end of the 1.3 kb BamH I fragment. The D N A sequence from the stop codon (tga) of the puhA structural gene to the 3' BamH I site is shown. 46 A 1/1 32/11 G GAT CCT GAT CCA GGG CTT GGC GTC TTC CTG CTC GTG CTT TTC GCC TGG CCT GCC GCG TCG asp pro asp pro gly leu gly v a l phe leu leu v a l leu phe ala trp pro ala ala ser 62/21 92/31 AAG GCG ATG TTC TTC GCC GGT GCG GGC CTG ATC GGG ATG GGC GGC GGG CTC TTT TCC GTC lys ala met phe phe ala gly ala gly leu i l e gly met gly gly gly leu phe ser val 122/41 152/51 GCC ACC CTC ACG ATG GCG ATG GCC ATC CCG GTG GCG GGT CTG GCC GGC CGC GGC CTC GCG ala thr leu thr met ala met ala i l e pro v a l ala gly leu ala gly arg gly leu ala 182/61 . 212/71 CTC GGC GCC TGG GGG GCT GCG CAG GCG ACC GCC GCG GGC CTC GCC ATC CTC ATG GGT GGC leu gly ala trp gly ala ala gin ala thr ala ala gly leu ala i l e leu met gly gly 242/81 272/91 GCA CTG CGC GAC GTC ATC GGT CAC TGG GCC AAG GCG GGG GAT CTC GGT GCC GCG CTG CAG ala leu arg asp val i l e gly his trp ala lys ala gly asp leu gly ala ala leu gin 302/101 332/111 GAC GCG GCC ATC GGC TAC AGC TCC GTG TAC CTC CTC GAG ATC GGG CTG CTG TTC GCC ACA asp ala ala i l e gly tyr ser ser v a l tyr leu leu glu i l e gly leu leu phe ala thr 362/121 392/131 CTG ATC GTG CTG GGG CCT CTG GTC CGA ACC ACG ATC CTC TCA TCT GAA CGA CCG GCC GGC leu i l e v a l leu gly pro leu v a l arg thr thr i l e leu ser ser glu arg pro ala gly 422/141 452/151 GGG ACC CGC GTG GGA CTC GCC GAC TTC CCC ACC TGA CACCGGAGGACCCCTTAA atg gly thr arg val gly leu ala asp phe pro thr * met B 1 31 tga TCC CCG CAT GGC GCG GCC CCC GCG GGC TGC TCC GCA TCC TTC CCG GAC CCG ATC CGG * 61 ATC AGA TCC CTC CCC CAC CCG GAT CC 47 Figure 13. 5' and 3' D N A sequences of the 7 kb EcoR I fragment that contains the puhA gene. The nucleotide sequences that were unclear are shown as N . A , D N A sequence of the 5' end of the 7 kb EcoR I fragment. B, D N A sequence of the 3' end of the 7 kb EcoR I fragment. 48 A GAATTCATGCCCGGCAANCANGCCGGCATGTCCGGCGCCTGCNGGCCCGACCGGCTGATC 6 0 GGCGCCCTGCCGAACGTCTATCTCTATGCGGCGAACAACCCGTCCGANGCCTCGCTCGCC 120 AAGCGCCGCTCNAACNCGATCANGGTNACNCNCCTGACCCCGCCGCTGGGCAAGGCCGGG 180 CTCTACCGCGGGCTGCACGATCTCAAAGAACANCCTCACCCGCTACTNGCAGCTCNCCCC 240 CGACNCGCCCNAAACGCNAAGGAACCTCCNCGCTCCCTGATCNGAANANCNNGGCCCGGG 300 GCCNTTGAAACCNTCCNACATTGGTCCAATGTTTGGAANACNAATGTNGGCTTGNAACNC 3 60 TCCCCCTAANNANCGAANGGGCTCNCTCCTTTCTACCCNANCGGGGCTNNNCTNTTCTTT 42 0 NGGCCCTGGCCCCTTNNACCCNAAGGANCNTTATNTTCCNNAACAANTNTCNNCCTCTCA 480 TTNCCCCNAANNATTTTTTNTCCCTAAACGGCTCGGGGCCCAAGT 52 5 B ACAAGGATTGGGAAAGGCAATTCCCCCCCCGAGGGGGGTTTGGTGGAANGTAAAGAGGAA 6 0 ACGGNAAGANTTTTNCNCCCTGGCAGGGAAAGAANGGCAAACNGGCANGGAGGCGACNGG 120 AAGATTCCCAGGNATTTNGGACCCCNAACNNANGAGGCCGCCTTGNGAGGCGGGATGNTG 180 TCCGAAANGACGCCAAGAGAAGGGGAACCCCCATGGGTGNGTTCACGAAACAAGCGGNAG 240 AGGTGCCCTGCACNGTTGAAGTGAGTCACCAGTTCGAGTCTCTCCACGCGCATGTGCGCT 300 TGGACAACGGGGCCATCGTCCATCCGGGNGATGAGGTTATGGTTCACGGCGCGCCGGTCC 3 60 TGGCGGCCTTTGGCGAGGTGGTGGTCGAGGAACGCACCGCCACCATCACGCGCGCCTCGG 420 GCCTCGAGCGGNTCTGGACGCGCCTCACGGGCGATCTCGGTGCGATGGAACTGTGCGAAT 480 TC 482 49 were sent to the B L A S T email server (NCBI) to search for similar sequences. The 5' end of the EcoR I fragment was found to match with the 3' end of the R. capsulatus bchH gene, which encodes a Bchl biosynthetic enzyme. No sequence in the database was found to be significantly similar to the 3' end of the puhA EcoR I fragment. Restriction endonuclease mapping was done on the 7 kb EcoR I fragment. A partial physical and genetic map of the photosynthesis gene cluster in R. sphaeroides has been obtained and shown to be similar to that in R. capsulatus (Coomber, et ah, 1990). Putting these available data together, the arrangement of genes in the 7 kb puhA EcoR I fragment is as shown in Fig. 11. B. Creation of the ApuhA allele in vitro The coding sequence of the puhA structural gene is shown in Fig. 14. Mutagenesis of the puhA gene (783 bp) in vitro was achieved by substitution of an EcoR V site for a 561 bp segment (extending from 61 bp to 621 bp of the puhA structural gene) (Fig. 14), which accounts for the central 72% (187 amino acids) (Fig. 11) of the coding sequence, in a "loop-out" oligonucleotide-directed mutagenesis (see Materials and Methods). The deletion did not cause a translation frameshift, as confirmed by D N A sequencing, and the deleted puhA was named ApuhA. This deletion leaves only 60 bp of the puhA gene coding sequence upstream and 162 bp downstream of the deletion site (Fig. 14). 50 Figure 14. Sequence of R. sphaeroides puhA gene. The D N A sequence of wild type puhA structural gene is shown, with the amino acid sequence of the RC H protein shown as single letters (the stop codon is shown as *) underneath the D N A sequence (Williams, et al., 1996). The 5' and 3' sequences of the oligonucleotide MUTPU2 used to create ApuhA are shown as thick black lines on top of the D N A sequence. The sequence that was deleted in ApuhA is shown in the box. 51 5' end of deletion in ApuhA atg gtt ggt gtg act get ttt gga aac ttc gat ctg gcg teg ctg gcg ate tat age ttc 60 M V G V T A F G N F D L A S L A I Y S F 2 0 tgg ate ttc etc gcg ggc ctg ate tac tac etc cag acc gag aac atg cgc gag ggc tat W I F L A G L I Y Y L Q T E N M R E G Y ccg ctg gag aac gag gac ggc acc ccg gec gcg aac cag ggc ccg ttc ccg ctg ccg aa£ P L E N E D G T P A A N Q G P F P L P K ccc aag acc ttc ate ctg ccc cac ggc cgc ggc acg ctg acc gtg ccc ggc ccg gaa age 240 P K T F I L P H G R G T L T V P G P E S gaa gac egg ccg ate gcg etc gcg egg acg gec gtc teg gaa ggc ttc ccg cat gcg ccc E D R P I A L A R T A V S E G F P H A P acg ggc gac ccg atg aag gac ggc gtc ggc ccg gec teg tgg gtt gcg cgc cgt gac ctg 360 T G D P M K D G V G P A S W V A R R D 80 £00 100 ccc gaa etc gac ggg cac ggc cac aac aag ate aag ccg atg aag gec get gec ggc ttc 420 P E L D G H G H N K I K P M K A A A G cac gtc teg gec ggc aag aac ccg ate ggc ctg ccc gtc cgc ggc tgc gat etc gag ate 480 H V S A G K N P I G L P V R G C D L E I gcg ggc aag gtc gtg gac ate tgg gtc gac ate ccc gag cag atg gec cgc ttc etc gag A G K V V D I W V D I P E Q M A R F L E gtc gaa etc aag gac ggc teg acc cgc etc ctg ccg atg cag atg gtc aag gtc cag teg V E L K D G S T R L L P M Q M V K V Q S aac cgc gtt cat gtg aac gcg N R V H V N A 120 40 180 60 120 140 160 540 180 600 200 3' end of deletion in ApuhA etc teg tec gac ctg ttc gcg ggc ate ccg acg ate aag 660 L S S D L F A G I P T I K 220 tec ccg acc gag gtc acg etc etc gaa gag gac aag ate tgc ggc tac gtc gec ggc ggc 7 2 0 S P T E V T L L E E D K I C G Y V A G G 240 ctg atg tat gec gcg ccg aag cgc aag teg gtc gtg gcg gcg atg ctg gec gaa tac gec 780 L M Y A A P K R K S V V A A M L A E Y A 260 tga 783 52 C. Transfer of the ApuhA allele into the R. sphaeroides chromosome to create APUHA. The ApuhA fragment was subcloned into a suicide vector pSUP203 (Table 1) along with the Q cartridge (see Materials and Methods), which encodes spectinomycin and streptomycin resistance genes. The resultant suicide plasmid, named pXY6, was mobilized into the R. sphaeroides kanamycin resistance cartridge-disrupted puhA mutant PUHA1 (Sockett, et al. 1989) by conjugation (Fig. 15). Exconjugants were selected by spectinomycin resistance, which is encoded by the Q cartridge. Since this suicide plasmid is unable to replicate in R. sphaeroides, the most likely way for the host to acquire spectinomycin resistance is by a single homologous recombination between either the upstream or the downstream R. sphaeroides sequences on the plasmid with the homologous sequence on the host chromosome (Fig. 15). Since the upstream homologous sequence is about 4.3 kb and the downstream homologous sequence is only about 1.4 kb, theoretically the frequencies of getting the single homologous recombination in the upstream region would be higher than that in the downstream region, and this is what I found. Chromosomal D N A of several exconjugants was isolated and evaluated by Southern blot hybridization using the ApuhA fragment as a probe (data not shown; but see Fig. 17 and section 2. A). A recombinant strain that indicated the result of a single crossover was named C O l (designated [1] in Fig. 15). Strain C O l contains the translationally in-frame deleted puhA located upstream of the kanamycin resistance cartridge-disrupted puhA. 53 Figure 15. Representation of the two possible ([1] and [2]) products resulting from single homologous recombination of pXY6 into the chromosome of strain PUHA1 after conjugation of plasmid pXY6 into the PUHA1 strain. Sp r/Kn r transconjugants were selected. Product (1) would contain the translationally in-frame deleted puhA located upstream of the kanamycin resistance cartridge-disrupted puhA. Product (2) would contain the translationally in-frame deleted puhA located downstream of kanamycin resistance cartridge-disrupted puhA. Product (1) was obtained and designated as strain C O l . 54 55 Strain C01 was grown in a liquid medium without antibiotics to allow survival of cells that would have undergone a second homologous recombination, and cells were plated on a solid medium. Colonies were screened for the loss of antibiotic resistance by picking individual colonies. Clones that were sensitive to both kanamycin and spectinomycin should have undergone a second homologous recombination, and should contain the ApuhA allele in place of the kanamycin resistance cartridge-disrupted puhA allele (Fig. 16). Of the approximately 6,500 colonies screened, about 0.7% of them were spectinomycin sensitive and kanamycin resistant (Sp s/Kn r), indicating that strain PUHA1 was recovered [(1) in Fig. 16]. No isolates were found to be sensitive to both spectinomycin and kanamycin (Sp s/Kn s). To increase the frequency of recombination by inducing the recA gene, U V irradiation was used (see Materials and Methods). After U V treatment, of the approximately 3,000 colonies screened about 2.8% of them were spectinomycin sensitive (Sps). Among these Sps colonies, four were found to be kanamycin sensitive (Kn s). The physical arrangement of two of these Kn s /Sp s isolates was confirmed by Southern blot hybridization (see below; section 2. A). One of these ApuhA strains was named APUHA (Fig. 16), and contains a puhA allele that differs from the wild type gene in that amino acids 21 to 207 were replaced by Asp and Ile, such that the sequence in the vicinity of the deletion is Phe H 2 0 Asp Ile L e u H 2 0 8 (see Fig. 14). 56 Figure 16. Representation of the two possible ([1] and [2]) second homologous recombination that would result in resolution of the tandem puhA alleles in strain C O l . The clones were screened for loss of spectinomycin resistance, which would have resulted from a second homologous recombination. Product (1) would contain only the kanamycin cartridge-disrupted puhA locus and would be Kn r/Sp s. Product (2) would contain only the in-frame deleted puhA locus and would be Kn s/Sp s . Product (2) was obtained and designated as strain APUHA. 57 i EcoR I EcoR I (i) — / / - K n r PUHA1 EcoR I EcoR I (2) -it ApuhA -II- APUHA 58 2. Analysis of the translationally in-frame puhA deletion mutant APUHA. A . Southern blot analyses Chromosomal D N A prepared from the wild type strain 2.4.1, strains C O l , PUHA1 and APUHA was digested with BamH I and used for Southern blot analyses (Fig. 17). A 0.8 kb BamH I restriction endonuclease fragment from p X Y l containing ApuhA sequences was used to construct the DIG-labelled probe (see Materials and Methods). A strong hybridization signal at 0.8 kb was seen in the control lane that contains the BamH I digested plasmid p X Y l (Fig. 17, lane 2). When a BamH I digest of the control plasmid pPUHA was subjected to hybridization, a 1.3 kb signal was detected (Fig. 17, lane 1). This 1.3 kb band corresponds to the length of the BamH I chromosomal D N A fragment containing the wild type puhA gene and a very small amount of flanking sequences, and it was observed in the BamH I digest of wild type 2.4.1 D N A as well (Fig. 17, lane 3). A 2.0 kb hybridization band was seen in the BamH I digest of PUHA1 chromosomal D N A (Fig. 17, lane 4). This 2.0 kb band corresponds to the length of the BamH I chromosomal D N A fragment containing the kanamycin resistance cartridge-disrupted puhA gene and flanking sequences. When a BamH I digest of D N A from strain C O l was subjected to hybridization, both the 2.0 kb and the 0.8 kb signals were detected (Fig. 17, lane 5). This means that strain C O l contains both the 2.0 kb kanamycin resistance cartridge-disrupted puhA fragment and the 0.8 kb translationally in-frame deleted puhA fragment on the chromosome, which 59 Figure 17. Southern blot hybridization of chromosomal D N A isolated from R. sphaeroides strains to demonstrate the recovery of strain APUHA. Plasmids and chromosomal D N A were digested with BamR I and the resultant D N A fragments were separated on an agarose gel prior to blotting. A . Restriction maps of R. sphaeroides wild type 2.4.1, APUHA and PUHA1, showing the restriction sites used in the construction of the in-frame puhA deletion and the probe used for Southern blotting. The corresponding sizes of the BamR I fragments in the strains are shown. B. Southern blot result, using a 0.8 kb BamR I ApuhA fragment as the probe. Lane 1 contains the plasmid pPUHA and shows the 1.3 kb wild type puhA fragment. Lane 2 contains the plasmid p X Y l and shows the 0.8 kb in-frame deleted puhA fragment. Lane 3 contains chromosomal D N A from the wild type strain, 1.3 kb fragment was hybridized. Lane 4 contains chromosomal D N A from strain PUHA1, 2.0 kb fragment was hybridized. Lane 5 contains chromosomal D N A from strain C O l , 0.8 and 2.0 kb fragments were hybridized. Lanes 6 and 7 contain chromosomal D N A from two isolates of strain APUHA, 0.8 kb fragment was hybridized. 60 A 2.4.1 BamH I orfl696 ^ puhA BamR I A P U H A -LWWWWW^ orfl696 1.3 kb ^ ^ b j r o b e ^ BamH I f ^ ^ f l f l m l H ApuhA [Xho I] BamH I 1 PUHA1 K n r [Xho I] BamH I orfl696 puhA::KnT 2.0 kb B k b 1 2 3 4 5 6 7 4.4 — 0.6 — 61 was due to integration by homologous recombination of the suicide plasmid pXY6 into the chromosome of strain PUHA1 (Fig. 15). A 0.8 kb hybridization band was observed in the BamR I digested D N A of two isolates of strain APUHA (Fig. 17, lanes 6 and 7), showing that these two APUHA strains contain only the translationally in-frame deleted copy of puhA gene. Thus, the 0.8 kb hybridization signal seen with BamR I digested APUHA chromosomal D N A indicates that the in-frame deleted copy of puhA replaced the kanamycin resistance cartridge-disrupted copy of puhA by a second homologous recombination in strain C O l , to yield APUHA [Fig. 16 (2)]. B. Growth studies A l l the strains (both wild type and mutants) discussed in this thesis grew at similar rates under either high O2 or low O2 respiratory growth conditions in the dark (data not shown). This means that neither in-frame deletion of puhA nor kanamycin resistance cartridge disruption of puhA affected growth under aerobic dark conditions. However, under photosynthetic conditions (anaerobic and a light intensity of 100 to 2 1 150 uE m" s" ), the growth properties of the puhA mutants were different from the wild type. The photosynthetic growth properties of the puhA in-frame deletion mutant APUHA are shown in Fig. 18, and show that APUHA is incapable of photosynthetic growth. However, when either pXY7 or p V Y l , the plasmids that contain the puhA gene, was present in APUHA, photosynthetic growth was restored, with exponential growth rates and final yields comparable to the wild type strain (Fig. 18). This means 62 JO L—i—I—I—I—I—I—I—I—I—I—I—I—I—I—I—I—I—I—I—I—I—I—I—1—1—I—I—I I I 0 10 20 30 40 50 60 Time (hours) Figure 18. Photosynthetic growth of R. sphaeroides APUHA and related strains. A, wild type 2.4.1; B , APUHA(pVYl ) ; C, APUHA(pXY7); D, APUHA. 63 that the PS growth phenotype of the puhA in-frame deletion was due to loss of production of the protein product of the puhA gene, which could be complemented in trans by either the 1.3 kb BamH I or the 7 kb EcoR I puhA fragments (Fig. 18). C. Absorption spectroscopy Strain APUHA showed a reduction in the amount of the LHI complex, as evidenced by a decrease in the LHI complex 875 nm shoulder (Fig. 19). When APUHA was complemented with pXY7 or p V Y l , the LHI complex absorption of cells grown with low aeration was not greatly increased. There were no major changes in the LHII 800 or 850 nm peaks. When APUHA(pXY7) and APUHA(pVYl) were grown under photosynthetic conditions, the LHII absorption in these strains were about 70-80% of that in wild type (Fig. 20). It is difficult to say anything about possible changes in LHI and RC peaks because of the interference of LHII peaks, although the LHI shoulder of APUHA(pXY7) seemed to be reduced compared to APUHA(pVYl) , which in turn seemed to be slightly reduced compared to the wild type strain. This partial restoration of LHI and LHII absorption may be due to a reduced level of expression of the plasmid copy of the puhA gene compared to the expression of the chromosomal copy of the puhA gene in the wild type when grown under photosynthetic conditions. D. SDS-polyacrylamide gel electrophoresis (SDS-PAGE) analysis of I C M proteins 64 Figure 19. Intact cell absorption spectra of R. sphaeroides APUHA strains grown under low aeration conditions. APUHA in black; wild type strain 2.4.1 in blue; APUHA(pVYl) in green; APUHA(pXY7) in red. 65 1.54 OH ~i 1 I i 700 800 900 1000 Wavelength (nm) 66 Figure 20. Absorption spectra of intact cells of R. sphaeroides APUHA and related strains grown under photosynthetic conditions. Wild type 2.4.1 in blue; APUHA(pVYl) in green; APUHA(pXY7) in red. 67 2H o - H 1 1 1 700 800 900 1000 Wavelength (nm) 68 To evaluate the presence or absence of protein subunits of the RC in membranes of the APUHA strain, SDS-PAGE analyses were done on chromatophores purified from cells (see Materials and Methods). As shown in Fig. 21, a purified RC preparation of R. sphaeroides contained RC H, M and L protein bands as indicated (Fig. 21, lane 1). A l l three RC subunit bands were present in chromatophores from the wild type strain (Fig. 21, lane 2). The RC H subunit band was absent from the in-frame deleted puhA mutant APUHA (Fig. 21, lane 3). This indicates that the RC H subunit was not in the I C M of APUHA, evidently because the puhA gene was deleted. Bands for the other two RC subunits, the M and L proteins were present at levels equivalent to, or perhaps slightly less than the wild type 2.4.1. Interestingly, a great increase in the band at approximately 30 to 35 kDa was seen in APUHA compared to the wild type. The identity of this band is not known. When these mutants were complemented with pXY7 or p V Y l , the RC H subunit bands were restored (Fig. 21, lanes 4 and 5), although the intensities of the RC bands were lower in the complemented APUHA strains than in the wild type strain. An extra band of unknown identity below the RC H band was seen in both complemented strains. 3. Analysis of the kanamycin resistance cartridge-disrupted puhA mutant PUHA1 A . Growth studies 69 Figure 21. SDS-PAGE analysis of chromatophore proteins isolated from wild type strain, APUHA, and related strains grown under low aeration conditions. The positions of molecular weight standards are shown in kDa on the right. Lane 1, a pure RC preparation of R. sphaeroides (courtesy of M . L. Paddock), which shows the RC H, M and L subunits; lane 2, wild type 2.4.1; lane 3, APUHA; lane 4, APUHA(pXY7); lane 5, APUHA(pVYl) . 70 When cells of PUHA 1 were placed under photosynthetic conditions, they were incapable of growth. When PUHA1 contained the same puhA plasmids as used for complementation of APUHA, normal photosynthetic growth was obtained only with p V Y l (contains 7 kb EcoR I puhA fragment) but not with pXY7 (contains 1.3 kb BamH I puhA fragment) (Fig. 22). The poor photosynthetic growth of PUHAl(pXY7) suggests that the kanamycin cartridge disruption in strain PUHA1 has a polar effect on genes downstream of puhA, which were shown to be important for photosynthesis in the closely related R. capsulatus (Wong, et al., 1996). B. Absorption spectroscopy The LHI shoulder was reduced in PUHA1, was visible present when complemented with p V Y l , but there was no obvious LHI complex shoulder when PUHA1 was complemented with pXY7 (Fig. 23). There are several possibilities that may account for these changes. One of them is that there is a polar effect of the kanamycin disruption on the expression of other genes located downstream of puhA gene, which are required for maximal levels of RC and LHI complexes. It is also possibly due to a small amount of deletion of orf1696, caused by the kanamycin resistance cartridge insertion during the process of construction of PUHA1 (Sockett, et al., 1989), which is shown to be required for normal LHI level in R. capsulatus (Young and Beatty, unpublished results). When P U H A l ( p V Y l ) was grown under photosynthetic conditions, the LHII absorption in this strain was about 60% of that in the wild type (Fig. 24). This partial restoration of LHII absorption may be due to a 71 j 0 I i i • • i i i i i I i i i i I i i i i I i i i i I i i i i I 0 10 2 0 - 3 0 40 50 60 Time (hours) Figure 22. Photosynthetic growth of R. sphaeroides PUHA1 and related strains. A, wild type 2.4.1; B , P U H A l ( p V Y l ) ; C, PUHAl(pXY7) ; D, PUHA1. 72 Figure 23. Absorption spectra of intact cells of R. sphaeroides PUHA1 and related strains grown under low aeration conditions. A , wild type 2.4.1; B. PUHA1; C, PUHAl(pXY7) ; D, P U H A l ( p V Y l ) . 73 700 800 9 ( S o lODO Wavelength (nm) 74 Figure 24. Absoption spectra of intact cells of R. sphaeroides strains grown under photosynthetic conditions. Wild type strain 2.4.1 in blue and P U H A l ( p V Y l ) in violet. 75 76 reduced level of expression of the plasmid copy of the puhA and/or 3' flanking genes, compared to the expression of the chromosomal copy of the puhA gene in the wild type. C. SDS-PAGE analysis of I C M proteins Chromatophore proteins were isolated from PUHA1 and its pXY7 or p V Y l complemented derivatives and analyzed by SDS-PAGE, as shown in Fig. 25. The RC H subunit band was absent from PUHA1, which indicates that the RC H protein was not formed in the I C M of PUHA1 (Fig. 25, lane 3). Surprisingly, the intensity of the RC M band of PUHA 1 seemed to be greatly reduced (this is different from what was seen with APUHA; see Fig. 21). The intensity of the RC L band was similar to that of the wild type. A great increase of a band at approximately 30 to 35 kDa was seen in PUHA1 (Fig. 25, lane 3), similar to APUHA (Fig. 21). When PUHA1 was complemented with pXY7, the intensity of the RC H and M bands were increased (Fig. 25, lane 4). When PUHA1 was complemented with p V Y l , the RC H band was restored, with an extra band of unknown identity present below the RC H band (Fig. 25, lane 5). The intensities of the RC H band in the complementation strains were lower than that in the wild type strain. Thus, the impaired photosynthetic growth of strain PUHAl(pXY7) (Fig. 22) is not due to the absence of the RC H protein, but instead may stem from the reduced expression of one or more genes located 3' of puhA, which were present in p V Y l (and which grew photosynthetically similarly to the wild type strain, see Fig. 22). 77 Figure 25. SDS-PAGE analysis of chromatophore proteins isolated from the wild type strain, mutant PUHA1, PUHAl(pXY7) and P U H A l ( p V Y l ) grown under low aeration conditions. The molecular weight standard is shown in kDa on the right. Lane 1, a pure RC preparation of R. sphaeroides (courtesy of M . L. Paddock), which shows the RC H, M and L subunits; lane 2, wild type 2.4.1; lane 3, PUHA1; lane 4, PUHAl(pXY7) ; lane 5, P U H A l ( p V Y l ) . 78 DISCUSSION I have reported here the construction of a puhA mutant derivative of R. sphaeroides 2.4A, designated R. sphaeroides strain APUHA. APUHA was constructed with a translationally in-frame deletion of the puhA gene, in which the central 72% of the puhA coding sequence was deleted and replaced by an EcoR V site. The allele replacement in strain APUHA was confirmed by Southern blot analysis (see Results section 2. A), and the SDS-PAGE analysis demonstrated the absence of the RC H subunit band in strain APUHA (Fig. 21). The RC H subunit contains 260 amino acids and is encoded by the puhA gene, which is located 3' of the orfl696 gene in a 1.3 kb BamH I and a 7 kb EcoR I fragment within the photosynthesis gene cluster of R. sphaeroides (Figs. 4 and 11). Prior to my work, the 7 kb EcoR I fragment had not been sequenced other than the sequence of the puhA gene and a small amount of 5' flanking (Donohue, et al., 1986; Williams, et al, 1986). If it is assumed that the photosynthesis genes of R. sphaeroides in this region are located in approximately the same relative positions as the equivalent genes in R. capsulatus (Alberti, et al., 1995; Coomber, et al., 1990), the 7 kb EcoR I fragment would contain part of bchH, bchL, bchM, orfl696, puhA, and maybe orf214 and/or orfl62b (Fig. 11). My sequence analyses showed that the 5' EcoR I site is located within the bchH gene, and the 5' BamH I site is located within the orfl696 gene. The 3' end of the EcoR I fragment was not found to be significantly similar to any of the 79 sequences in the GenBank database. The sequence of the 3' end of the 1.3 kb BamH I fragment was not homologous to any sequences in the database, and so on the basis of the sequence data alone it is not clear if there are ORFs such as orf214 and orf 162b located downstream of the puhA gene in the R. sphaeroides puhA EcoR I fragment. APUHA was photosynthetically incompetent, which I attribute to the lack of the RC H polypeptide. Photosynthetic growth was restored by complementation in trans with a wild type copy of the puhA gene with (pVYl) or without (pXY7) a large amount of flanking sequences (Fig. 18). Although the H subunit of the RC does not bind Bchl and hence is not directly involved in capturing light energy, my results show that the RC H subunit plays an essential role in photosynthesis in vivo. One of the possible roles of the RC H subunit suggested by Sockett, et al. (1989) is that it is vital for correct and stable assembly of a functional RC in the I C M of R. sphaeroides. It was found that in PUHA1, a kanamycin resistance cartridge-disrupted orfl696 and puhA double mutant, the amount of the RC M polypeptide was reduced (on the basis of Western blotting), and this was attributed, at least in part, to a decrease in the stability of the RC M subunit (Varga and Kaplan, 1993). I found that the amount of the RC M protein band in SDS-PAGE was greatly reduced in PUHA1 (Fig. 25), whereas in APUHA, the amount of the M subunit appeared to be slightly reduced compared to wild type level (Fig. 21), but not as much as in PUHA1. This difference between PUHA1 and APUHA indicates that the PUHA1 mutation has pleiotropic 80 effects. Although it might seem that mutation of orfl696 in PUHA1 accounts for the reduction in the amount of the RC M protein, in R. capsulatus orfl696 mutants, the amount of the RC appears to be equivalent to the or/1696* parental strain (Young and Beatty, unpublished data). The puhA gene in the 1.3 kb BamH I fragment of pXY7 was expressed sufficiently to allow APUHA(pXY7) to grow photosynthetically (Fig. 18), and so the impaired photosynthetic growth of PUHAl(pXY7) relative to the growth of P U H A l ( p V Y l ) (Fig. 22) cannot be explained solely by an absence of puhA expression. I attribute this impaired photosynthetic growth of PUHAl(pXY7) to be due to the presence of the kanamycin resistance cartridge within the puhA gene of PUHA1, which interferes with read-through transcription from the puhA promoter into the puhA 3' region. These puhA downstream sequences are present in the 7 kb EcoR I fragment of p V Y l . Although the puhA 3' region of R. sphaeroides has not been completely D N A sequenced, R. capsulatus (Alberti, et al., 1995) and Rhodospirillum rubrum (Berard and Gingras, 1991) were found to contain homologous genes (orf214 followed by orfl62b) located within 70 bases 3' of puhA, the expression of which was shown in R. capsulatus to be required for optimal photosynthetic growth (Wong, et al., 1996). My experimental findings with the R. sphaeroides puhA mutants are analogous to results obtained with the R. capsulatus puhA mutants. Disruption of the R. capsulatus puhA gene with an antibiotic resistance cartridge resulted in a mutant with impaired photosynthetic growth when trans complemented with a plasmid that contains the puhA gene, like PUHA1, whereas a translationally in-frame deleted 81 mutant of puhA was capable of normal photosynthetic growth when complemented with the same plasmid, like APUHA (Wong, et al., 1996). Therefore, I speculate that R. sphaeroides also contains orf214 and/or orfl62b homologues located 3' of puhA that are similarly dependent on transcription read-through from the puhA promoter, which explains why the results obtained with APUHA and PUHA1 were different. The absence of the RC H protein in APUHA caused a reduced level of LHI, as shown in spectra by the decrease of the 875 nm LHI shoulder, which was not greatly increased when APUHA was complemented with puhA plasmids (pXY7 or p V Y l ) (Fig. 19). However, it is not known whether this LHI level decrease is a result of the impairment at the level of puf operon transcription or translation, puf mRNA stability, LHI complex a and p polypeptide stability or their insertion into the ICM. There were no detectable LHI spectral complexes in PUHA1 and PUHAl(pXY7) (Fig. 23), nor was any immunoreactive LHI a polypeptide detected in the I C M of PUHA1 by western blotting with specific antiserum (Sockett, et al., 1989). It was found in PUHA1 that the amount of the pufBA mRNA transcript, which encodes the LHI a and P polypeptides, was comparable to that of wild type R. sphaeroides 2.4.1 (Sockett, et al., 1989). If it is assumed that the decrease in LHI complex level in APUHA and PUHA1 is not due to a decrease in the amount of the pufBA transcript, then a translational or post-translational process must be affected by these mutations of the puhA gene. 82 Varga and Kaplan attributed the L H F phenotype of PUHA 1 to be due to the loss of the upstream orfl696 gene (Varga and Kaplan, 1993). It was shown in R. capsulatus that the gene product of orf1696 helps assemble the LHI complex in the I C M (Young and Beatty, unpublished results). However, other results from R. capsulatus showed that the RC H subunit itself plays a role in the formation of the LHI complex (Wong, et al., 1996). The LHI complex in PUHA1 was undetectable in spectra (Fig. 23), whereas the LHI level in APUHA was just slightly reduced compared to wild type strain (Fig. 19). In APUHA, the genes flanking the puhA gene should not be affected. It is likely that, in addition to the direct effects of simultaneous replacement of parts of the orfl696 and puhA genes with the antibiotic resistance cartridge in PUHA1, this cartridge could interfere with transcription of genes 3' of puhA that are required for LHI formation (a polar effect) (Wong, et al., 1996). It is known that the puhA gene in R. capsulatus is transcribed as part of a large superoperon that includes Bchl biosynthesis genes and orfl696 (Bauer, et al., 1991; Wong, et al., 1996), and it was suggested that this transcriptional organization also exists in R. sphaeroides (Beatty, 1995). The decrease in LHI was not completely restored when p V Y l , which contains the puhA 3' region of the EcoR I fragment, was present in APUHA and PUHA1 (Figs. 19 and 23). This finding is consistent with the results of a previous study in which it was reported that only a relatively large cosmid (with a 21.7 kb insert containing puhA and its flanking sequences) restored both photosynthetic competence and the wild type level of LHI in R. sphaeroides strain PUHA1 (Sockett, et ai, 1989). Therefore, the different effects of puhA deletion on the 83 LHI complex in strains APUHA and PUHA1 could be indirect. Sockett, et al. (1989) also suggested that there is a complex interaction between the products of photosynthesis genes at different loci in the assembly of functional PSUs. Another possibility is that the decrease in LHI level in APUHA and PUHA1 is a consequence of the loss of the entire RC-LHI "core" complex due to the absence of the H subunit. However, it has been reported that both LHI and LHII were still present when the RC structural polypeptides L and M were absent in R. sphaeroides (Jones, et al., 1992). Therefore, it is possible that the RC H subunit, but not the L and M subunits, plays a special role in the maintenance of the LHI complex. Crystallographic studies of RCs showed that the N-terminal oc-helical segment of the H protein spans the cytoplasmic membrane (Lancaster, et al, 1995). This RC H a helix would be approximately parallel to the transmembrane cc-helical segments of the two LHI peptides in a ring surrounding the RC (Karrasch, et al., 1995), and could contribute to proper assembly or stability of the LHI complex through helix-helix interactions. Although the translationally in-frame mutation of the puhA gene in APUHA and the kanamycin resistance cartridge disruption of the puhA gene in PUHA1 reduced the amount of the LHI complex, they did not reduce the level of the LHII complex. This can be seen by comparison of absorbence spectra of puhA mutants with the spectrum of the wild type strain obtained from oxygen-limited grown cells; in fact, there seemed to be a slight increase in LHII absorbence (Figs. 19 and 23). Sockett, et al. (1989) 84 attributed this increase to the derepression of synthesis of LHII complexes as a response by cells to the decrease of LHI complexes and functional RCs. The amount of LHII in the complemented APUHA strains and P U H A l ( p V Y l ) was equivalent to that in the wild type strain (Figs. 19 and 23). However, when these complemented strains were placed under photosynthetic conditions, they showed a reduced level of the LHII and/or LHI complex (Figs. 20 and 24). The reduction in the amount of LHII under photosynthetic conditions is difficult to explain, although it must relate to the differential expression of puhA and flanking genes in APUHA and PUHA1 mutants, as well as their complementation with different amount of sequences flanking puhA. One reason that might account for the partial restoration of the LHI and LHII complexes observed in the complemented APUHA strains grown photosynthetically is that the puhA gene may not be expressed as strongly from the complementation plasmids under these growth conditions as it is expressed from its chromosomal location in the wild type strain. Regardless of the uncertainties about L H complex expression, the R. sphaeroides strain APUHA seems to be appropriate for trans expression of site directed puhA mutants, using the powerful genetic selection of antibiotic resistance to obtain strains expressing plasmid-borne mutant puhA genes. The amount of RC purified from APUHA(pVYl) approached the amount obtained from the wild type strain (M. L . Paddock, personal communication). The RC H protein contains several amino acid residues with side chains that interact with water molecules in channels hypothesized 85 to be part of proton transport pathways connecting the aqueous cytoplasm to the membrane-integral RC Q B site (Fig. 2; Introduction section). One of the most interesting RC H residues to study is G l u H 1 7 3 , which is the H residue closest to the Q B site. G l u H I 7 3 was found to be located along the second water channel proposed by Stowell, et al. (1997), and was shown to be disordered in crystals that were illuminated, in contrast to a fixed position in the dark structure. Also, the G l u H 1 7 3 —» Gin mutant studied by Takahashi and Wraight (1996) indicates that this mutation affected the kinetics and thermodynamics of Q B reduction in purified RC preparations. The ability to complement strain APUHA with plasmid-borne alleles of puhA allows rapid evaluation of site directed mutations in puhA by simple photosynthetic growth experiments. Thus, other substitutions at G l u H 1 7 3 , and substitutions of other H residues can be readily created and expressed in APUHA. Subsequently, spectroscopic measurements could be made to dissect the specific functions impaired in these mutants (Okamura and Feher, 1992). Eventually, it might be possible to determine the 3-D structure of mutant H proteins as part of RC complex crystals. Thus, this puhA deletion/plasmid complementation system has great promise for functional and structural studies of RC H mutants, and the role(s) that the H protein plays in photosynthetic energy transduction and assembly of the R C / L H PSU. 86 CONCLUSIONS I have reported the development of a R. sphaeroides puhA gene (which encodes the RC H subunit) deletion/plasmid complementation system for expression of site directed mutants of the RC H protein. The mutant strain APUHA was constructed by replacing a chromosomal puhA allele with a translationally in-frame deleted puhA allele. Strain APUHA was incapable of photosynthetic growth, indicating that the RC H subunit is essential for photosynthesis. Spectral analyses showed this strain has a reduction in the amount of the LHI complex. SDS-PAGE analyses of chromatophore proteins of strain APUHA confirmed the absence of the RC H protein band. Complementation experiments showed that the photosynthetic growth and the RC H protein band in SDS-PAGE were restored when strain APUHA was complemented in trans with the wild type puhA gene on plasmids. The results from APUHA were compared with those from the kanamycin resistance cartridge-disrupted puhA mutant PUHA1, and the experimental findings substantiated the idea that expression of one or more genes located 3' of puhA is required for optimal RC levels and photosynthetic growth. This translationally in-frame deletion in APUHA did not seem to interfere with transcription through and beyond the residual puhA sequences, this strain should allow facile evaluation of the consequences of plasmid-borne RC H mutations in an otherwise wild type genetic background, and so the functions of individual domains and amino acids of the RC H subunit can be evaluated. 87 However, the locations and functions of the genes downstream of the puhA gene in R. sphaeroides are not clear. Detailed physical and genetic mapping and deletion/complementation studies would allow more understanding of the genetics and functions of these ORFs. And, it is not known how the RC H protein and the gene products of these putative ORFs located 3' of puhA affect the amounts of the LHI and LHII complexes. Further structural and functional studies may solve these questions. 88 REFERENCES Alberti, M . D. H. Burke and J. E. Hearst (1995) Structure and sequence of the photosynthesis gene cluster. In, Blankenship, R. E., M . T. Madigan and C. E. Bauer (eds.), Advances in Photosynthesis: Anoxygenic Photosynthetic Bacteria. The Netherlands, Kluwer Academic Publisher, p. 1083-1106. Allen, J. P., G. Feher, R. O. Yeates, H . Komiya and D. C. Rees (1988) Structure of the reaction center from Rhodobacter sphaeroides R-26: protein-cofactor (quinones and Fe 2 +) interactions. Proc. Nad. Acad. Sci. USA 85: 8487-8491. Bauer, C. E. (1995) Regulation of photosynthesis gene expression. In, Blankenship, R. E., M . T. Madigan and C. E. Bauer (eds.), Advances in Photosynthesis: Anoxygenic Photosynthetic Bacteria. The Netherlands, Kluwer Academic Publisher, p. 1221-1234. Bauer, C. E., J. J. Buggy, Z. Yang and B. L . Marrs (1991) The superoperonal organization of genes for pigment biosynthesis and reaction center proteins is a conserved feature in Rhodobacter capsulatus: analysis of overlapping bchB and puhA transcripts. Mol. Gen. Genet. 228: 438-444. Bauer, C. E., D. A . Young and B. L . Marrs (1988) Analysis of the Rhodobacter capsulatus puf operon. J. Biol. Chem. 263: 4820-4827. 89 Beatty, J. T. (1995) Organization of photosynthesis gene transcripts. In, Blankenship, R. E., M . T. Madigan and C. E. Bauer (eds.), Advances in Photosynthesis: Anoxygenic Photosynthetic Bacteria. The Netherlands, Kluwer Academic Publisher, p. 1209-1219. Beatty, J. T. and H. Gest (1981) Generation of succinyl-coenzyme A in photosynthetic bacteria. Arch. Microbiol. 129: 335-340. Berard, J. and G. Gingras (1991) The puh structural gene coding for the H subunit of the Rhodospirillum rubrum photoreaction center. Biochem. Cell Biol. 69: 122-131. Bibb, M . J. and S. N . Cohen (1982) Gene expression in Streptomyces: construction and application of promoter-probe plasmid vectors in Streptomyces lividans. Mol. Gen. Genet. 187: 265-277. Chang, C.-FL, O. El-Kabbani, D. Tiede, J. Norris and M . Schiffer (1991) Structure of the membrane-bound protein photosynthetic reaction center from Rhodobacter sphaeroides. Biochemistry 30: 5352-5360. Cogdell, R. J., P. K. Fyfe, S. J. Barrett, S. M . Prince and A. A . Freer (1996) The purple bacterial photosynthetic unit. Photosynthesis Research 48: 55-63. 90 Coomber, S. A. , M . Chaudhri, A . Connor, G. Britton and N . Hunter (1990) Localized transposon Tn5 mutagenesis of the photosynthetic gene cluster of Rhodobacter sphaeroides. Mol. Microbiol. 4: 977-989. Debus, R. J., G. Feher and M . Y . Okamura (1985) L M complex of reaction centers from Rhodopseudomonas sphaeroides R-26: characterization and reconstitution with the H subunit. Biochemistry 24: 2488-2500. Ditta, G., T. Schmidhauser, E. Yakobsen, P. Lu, X. -W. Liang, D. R. Finlay, D. Guiney and D. R. Helinski (1985) Plasmids related to the broad host range vector, pRK290, useful for gene cloning and for monitoring gene expression. Plasmid 13: 149-153. Donohue, T. J., J. H . Hoger and S. Kaplan (1986) Cloning and expression of the Rhodobacter sphaeroides reaction center H gene. J. Bacteriol. 168: 953-961. Drews, G. and J. R. Golecki (1995) Structure, molecular organization, and biosynthesis of membranes of purple bacteria. In, Blankenship, R. E., M . T. Madigan and C. E. Bauer (eds.), Advances in Photosynthesis: Anoxygenic Photosynthetic Bacteria. The Netherlands, Kluwer Academic Publisher, p. 231-257. 91 Ermler, U . , G. Fritzsch, S. K. Buchanan and H . Michel (1994) Structure of the photosynthetic reaction centre from Rhodobacter sphaeroides at 2.65 A resolution: cofactors and protein-cofactor interaction. Structure 2: 925-936. Fonstein, M . and R. Haselkorn (1995) Physical Mapping of Rhodobacter capsulatus: cosmid encyclopedia and high resolution genetic map. In, Blankenship, R. E., M . T. Madigan and C. E. Bauer (eds.), Advances in Photosynthesis: Anoxygenic Photosynthetic Bacteria. The Netherlands, Kluwer Academic Publisher, p. 1067-1081. Hanahan, D. and M . Meselson (1983) Plasmid screening at high colony density. Methods Enzymol. 100:333-339. Jones, M . R., G. J. S. Fowler, L . C. D. Gibson, G. G. Grief, J. D. Olsen, W. Crielaard and C. N . Hunter (1992) Mutants of Rhodobacter sphaeroides lacking one or more pigment-protein complexes and complementation with reaction-center, L H I , and LH2 genes. Mol. Microbiol. 6: 1173-1184. Karrasch, S., P. A . Bullough and R. Ghosh (1995) The 8.5 A projection map of the light-harvesting complex I from Rhodospirillum rubrum reveals a ring composed of 16 subunits. EMBOJ. 14: 631-638. 92 Keen, N . T., S. Tamaki, D. Kobayashi and D. Trollinger (1988) Improved broad-host range plasmids for D N A cloning in Gram-negative bacteria. Gene 70: 191-197. Kunkel, T. A. , J. D. Roberts and R. A . Zakour (1987) Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods Enzymol. 154: 367-382. Lancaster, C. R. D. and H. Michel (1996) Three-dimensional structures of photosynthetic reaction centers. Photosynthesis Research 48: 65-74. Lancaster, C. R. D., U . Ermler and H . Michel (1995) The structure of photosynthetic reaction centers from purple bacteria as revealed by X-ray crystallography. In, Blankenship, R. E., M . T. Madigan and C. E. Bauer (eds.), Advances in Photosynthesis: Anoxygenic Photosynthetic Bacteria. The Netherlands, Kluwer Academic Publisher, p. 503-526. LeBlanc, H. N . and J. T. Beatty (1993) Rhodobacter capsulatus puc operon promoter location, transcript sizes and effects of deletions on photosynthetic growth. J. Gen. Microbiol. 139: 101-109. Lilburn, T. G., C. E. Haith, R. C. Prince and J. T. Beatty (1992) Pleiotropic effects of pufX gene deletion on the structure and function of the photosynthetic apparatus of Rhodobacter capsulatus. Biochim. Biophys. Acta 1100: 160-170. 93 Meyer, R. E. and T. J. Donohue (1995) Cytochromes, iron-sulfur, and copper proteins mediating electron transfer from the cyt bci complex to photosynthetic reaction center complex. In, Blankenship, R. E., M . T. Madigan and C. E. Bauer (eds.), Advances in Photosynthesis: Anoxygenic Photosynthetic Bacteria. The Netherlands, Kluwer Academic Publisher, p. 725-745. Okamura, M . Y . and G. Feher (1995) Proton-coupled electron transfer reactions of QB in reaction center from photosynthetic bacteria. In, Blankenship, R. E., M . T. Madigan and C. E. Bauer (eds.), Advances in Photosynthesis: Anoxygenic Photosynthetic Bacteria. The Netherlands, Kluwer Academic Publisher, p. 577-594. Okamura, M . Y . and G. Feher (1992) Proton transfer in reaction centers from photosynthetic bacteria. Annu. Rev. Biochem. 61: 861-896. Papiz, M . Z., S. M . Prince, A . M . Hawthornthwaite-Lawless, G. McDermott, A . A . Freer, N . W. Issacs and R. J. Cogdell (1996) A model for the photosynthetic apparatus of purple bacteria. Trends in plant science 1: 198-206. Peterson, G. (1983) Determination of total protein. Meth. Enzymol. 91: 95-119. Prentki, P. and H. M . Krisch (1984) In vitro insertional mutagenesis with a selectable D N A fragment. Gene 29: 303-313. 94 Sambrook, J., E. F. Fritsch and T. Maniatis (1989) Molecular Cloning: a laboratory manual. Plainview, New York: Cold Spring Harbor Laboratory Press. Schagger, H. and G. von Jagow (1987) Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range form 1 to 100 kDa. Analyt. Biochem. 166: 368-379. Schmidhauser, T. J. and D. K . Helinski (1985) Regions of broad host range plasmid RK2 involved in replication and stable maintenance in nine species of gram-negative bacteria J. Bacteriol. 164: 446-455. Simon, R., U . Priefer and A. Piihler (1983) A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram-negative bacteria. Bio/Technology 1:784-790. Sockett, R. E., T. J. Donohue, A . R. Varga and S. Kaplan (1989) Control of photosynthetic membrane assembly in Rhodobacter sphaeroides mediated by puhA and flanking sequences. J. Bacteriol. 171: 436-446. Stowell, M . H . B., T. M . McPhillips, D. C. Rees, S. M . Soltis, E. Abresch and G. Feher (1997) Light-induced structural changes in photosynthetic reaction center: implications for mechanism of electron-proton transfer. Science 276: 812-816. 95 Takahashi, E. and C. A . Wraight (1996) Potentiation of proton transfer function by electrostatic interactions in photosynthetic reaction centers from Rhodobacter sphaeroides: first results from site-directed mutation of the H subunit. Proc. Nad. Acad. Sci. USA 93: 2640-2645 Varga, A . R. and S. Kaplan (1993) Synthesis and stability of reaction center polypeptides and implications for reaction center assembly in Rhodobacter sphaeroides. J. Biol. Chem. 268: 19842-19850. Weaver, P.F., J. D. Wall and H. Gest (1975) Characterization of Rhodopseudomonas capsulata. Arch. Microbiol. 105: 207-216. Wellington, C. L. , Bauer, C. E. and J. T. Beatty (1992) Photosynthesis gene superoperons in purple nonsulfur bacteria: the tip of the iceberg? Can. J. Microbiol. 38: 20-27. Williams, J. C , L . A . Steiner and G. Feher (1986) Primary structure of the reaction center from Rhodopseudomonas sphaeroides. Proteins: Struct. Funct. Genet. 1: 312-325. Wong, D. K . -H . , W. J. Collins, A . Harmer, T. G. Lilburn and J. T. Beatty (1996) Directed mutagenesis of the Rhodobacter capsulatus puhA gene and orf214: 96 pleiotropic effects on photosynthetic reaction center and light-harvesting 1 complexes. J. Bacteriol. 178: 2334-2342. Woodbury, N . W. and J. P. Allen (1995) The pathway, kinetics and thermodynamics of electron transfer in wild type and mutant reaction centers of purple nonsulfur bacteria. In, Blankenship, R. E., M . T. Madigan and C. E. Bauer (eds.), Advances in Photosynthesis: Anoxygenic Photosynthetic Bacteria. The Netherlands, Kluwer Academic Publisher, p. 527-557. Yanisch-Perron, C , J. Vieira and J. Messing (1985) Improved M13 phage cloning vectors and host strains: nucleotide sequences of M l 3 and pUC vectors. Gene 33: 103-119. Youvan, D. C , E. J. Bylina, M . Alberti, H . Begusch and J. E. Hearst (1984) Nucleotide and deduced polypeptide sequences of the photosynthetic reaction-center, B870 antenna and flanking polypeptides from R. capsulata. Cell 37: 949-957. Youvan, D. C. and S. Ismail (1985) Light harvesting II (B800-850 complex) structural genes from Rhodopseudomonas capsulata. Proc. Natl. Acad. Sci. USA 82: 58-62. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0087974/manifest

Comment

Related Items