Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Resolution of the dimer bridge of Minute Virus of Mice : roles of the viral NS-1 protein and a host cell… Liu, Qingquan 1996

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1996-147843.pdf [ 7.97MB ]
Metadata
JSON: 831-1.0087850.json
JSON-LD: 831-1.0087850-ld.json
RDF/XML (Pretty): 831-1.0087850-rdf.xml
RDF/JSON: 831-1.0087850-rdf.json
Turtle: 831-1.0087850-turtle.txt
N-Triples: 831-1.0087850-rdf-ntriples.txt
Original Record: 831-1.0087850-source.json
Full Text
831-1.0087850-fulltext.txt
Citation
831-1.0087850.ris

Full Text

R E S O L U T I O N O F T H E D I M E R B R I D G E O F M I N U T E V I R U S O F M I C E : R O L E S O F T H E V I R A L N S - 1 P R O T E I N A N D A H O S T C E L L F A C T O R by Q i n g q u a n L i u B.Sc. ( H o n ) , M . S c , Be i j ing N o r m a l U n i v e r s i t y A T H E S I S S U B M I T T E D I N P A R T I A L F U L F I L M E N T O F T H E R E Q U I R E M E N T S F O R T H E D E G R E E O F Doctor of P h i l o s o p h y i n T H E F A C U L T Y O F G R A D U A T E S T U D I E S D e p a r t m e n t of B iochemis t ry a n d M o l e c u l a r B i o l o g y W e accept this thesis as c o n f o r m i n g to the r e q u i r e d s t a n d a r d T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A September, 1996 © Q i n g q u a n L i u , 1996 In presenting this thesis in partial fufilment of the requirements for an advanced degree at The University of British Columbia, I agree that the library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the Head of my Department or by his or her representatives. It is understood copying or publication of this thesis for financial gain shall not be allowed without my written permission. Department of Biochemistry and Molecular Biology The University of British Columbia 2075 Wesbrook Place Vancouver, Canada V6T 1W5 Date: September 15,1996 11 Abstract Previous characterization of the terminal sequences of the Minute Virus of Mice (MVM) genome demonstrated that the right hand palindrome contains two sequences, each the inverted complement of the other. However, the left hand palindrome was shown to exist as a unique sequence (Astell et al, Virology 54:171-177, 1985). The Modified Rolling Hairpin Model (MRHM) for M V M replication provided an explanation for how the right hand palindrome could undergo hairpin transfer to generate two sequences while the left end palindrome within the dimer bridge could undergo asymmetric resolution and retain the unique left end sequence (Astell et al, ibid). The M R H M proposed that an initiating nick occurs on the parental viral strand of the A-half of the dimer bridge while a subsequent nick cuts the B-half of the dimer bridge (on the progeny viral strand). This thesis describes studies on the in vitro resolution of the wildtype dimer bridge sequence of M V M using recombinant (baculovirus) expressed NS-1, the major nonstructural protein of M V M , and a replication extract from mouse LA9 cells. The resolution products are consistent with those predicted by the M R H M , thus providing support for this replication mechanism. In addition, mutant dimer bridge clones were constructed and used in the resolution assay. The mutant structures included removal of the "bubble" asymmetry of the dimer bridge, inversion of the sequence which was proposed to include the initiating nick site, and a two bp deletion within the A-half between the "bubble" sequence and putative initiating nick site of the dimer bridge. The resolution patterns of these mutant dimer bridge structures suggest that the resolution procedure of the dimer bridge proposed in the M R H M is likely incorrect, although some sequences within the dimer I l l bridge are likely responsible for asymmetric resolution and thus conservation of the unique sequence of the left hand hairpin of the M V M genome (Liu et a/., 1994). In parallel studies described by others, the B-half (but not the A-half) of the dimer bridge was shown to be nicked site-specifically by a HeLa cellular replication extract supplemented with a HeLa cell nuclear extract containing expressed NS-1 (Cotmore and Tattersall, EMBO J. 13:4145-4152, 1994). Furthermore, it was predicted that host factor [possibly the activating transcription factor (ATF)] is required for the NS-1 nicking. One reason for this prediction is that mutation of an important nucleotide (the first C) in the putative ATF binding site (CGTCA) greatly decreased the nicking efficiency of the B-half dimer bridge (Cotmore and Tattersall, ibid). Data presented in this thesis confirm that the B-half (but not the A-half) of the M V M dimer bridge is nicked site-specifically when incubated with crude NS-1 protein (expressed in insect cells) and mouse LA9 cellular replication extract. When highly purified NS-1 is used in this nicking reaction, there is an absolute requirement for the LA9 cellular extract, suggesting a cellular factor (or factors) is (are) required. A series of mutations were created in the putative host factor binding region or HFBR of the B-half dimer bridge. Nicking assays of these B-half mutants showed that two CG motifs displaced by 10 nucleotides are important for nicking. Gel mobility shift assays demonstrate that a host factor(s) can bind to the HFBR and efficient binding depends on the presence of both C G motifs. Competitor D N A containing the wildtype HFBR sequence is able to specifically inhibit nicking of the B-half indicating that the host factor(s) bound to the HFBR is (are) essential for site-specific nicking to occur. These iv data also suggest that it is highly unlikely that ATF is the host factor required for NS-1 nicking (Liu and Astell, Virology, 1996, in press.)-V Table of Contents Page Abstract ii Table of Contents v List of tables xi List of figures xii Abbreviations xv Acknowledgements xvii I. Introduction 1 1.1. The significance of the studies of M V M 1 1.2. Selected model systems for the study of DNA replication: the replicators and associated proteins in eukaryotes. 1 1.2.1. Replication of the Simian virus 40 (SV40) genome 1 1.2.1.1. D N A sequences required for replication initiation 2 1.2.1.2. Viral and host cell proteins required for the initiation of SV40 DNA replication 4 1.2.1.3. The complete SV40 D N A replication system 8 1.2.2. Replication initiation in S. cerevisiae 10 1.2.2.1. Autonomously replicating sequences (ARSs) 10 1.2.2.2. Proteins which bind to the ARS1 sequence 14 1.2.2.2.1. The origin recognition complex (ORC) 14 1.2.2.2.2. ARS binding factor 1 (ABF1) 15 1.2.2.2.3. Other ARS binding proteins 16 1.2.2.2.4. Proteins which bind to ORC 16 v i 1.2.3. Replication initiation in metazoan cells 18 1.3. Introduction to Minute Virus of Mice (MVM), an autonomous parvovirus 22 1.3.1. Molecular biology of MVMp 23 1.3.1.1. The genome of MVMp 23 1.3.1.2. Structures of MVMp terminal hairpins 23 1.3.1.3. Transcripts and primary translation products of MVMp 29 1.3.1.4. Viral proteins 31 1.3.1.4.1. The nonstructural proteins, NS1 and NS2 31 1.3.1.4.2. The structural proteins, VP1, VP2 and VP3 35 1.3.2. A model for MVMp DNA replication: the modified rolling hairpin model 37 1.3.2.1. The hairpin transfer mechanism 38 1.3.2.2. Resolution of the dimer bridge 42 1.3.3. Cis-acting elements for the MVMp genome replication 46 1.3.4. Focus of the present study: resolution of the dimer bridge 47 II. Materials and Methods 49 2.1. Materials 49 2.2. Bacteria 49 2.3. Mammalian cell line, LA9. 49 2.4. Insect cell line, Sf9. 50 vi i 2.5. Standard cloning techniques 50 2.6. D N A sequencing 50 2.7. Plasmid constructions 50 2.7.1. Construction of a molecular clone of the wildtype MVMp dimer bridge 50 2.7.2. Construction of mutant dimer bridge clones 55 2.7.3. D N A sequencing of the wildtype and mutant dimer bridge clones 58 2.7.4. Cloning of each half (the A-half and B-half) of the dimer bridge 58 2.7.5. Construction of B-half clones with mutations in the putative host factor binding region (HFBR) 60 2.7.5.1. Structure and sequence of pQLB, the B-half dimer bridge clone. 60 2.7.5.2. Construction of pQLBDEL (both ATF motifs deleted) 60 2.7.5.3. Construction of pQLBWT13 (one ATF motif deleted) 62 2.7.5.4. Construction of single nucleotide mutations (positions 3 through 13) in pQLBWT13 62 2.7.5.5. Construction of single nucleotide mutations (positions 14 through 20) in pQLBWT13 62 2.7.6. Construction of plasmids containing a wildtype or mutated host factor binding region (HFBR) 65 2.8. Preparation of mouse LA9 replication extracts 67 2.9. Preparation of Sf9 cell extracts containing NS-1 67 2.10. Purification of NS-1 from Sf9 cells 68 V l l l 2.11. The dimer bridge resolution assay 68 2.11.1. Analysis of resolution products on one-dimensional non-denaturing agarose gels 68 2.11.2. Two-dimensional neutral/alkaline agarose gel electrophoresis of the NS-1 resolution products 69 2.11.3. Quantitation of NS-1 resolution products 69 2.11.4. Immunoprecipitation 70 2.12. Nicking assay of A-half or B-half clones of the dimer bridge 71 2.12.1. Analysis of nicked products on alkaline agarose gels 71 2.12.2. Determination of the nicking efficiency of B-half dimer bridge mutants 72 2.13. Binding of a host cell protein(s) to the HFBR: gel mobility shift assays 72 2.14. Competition nicking assay 73 III. Results 74 3.1. Predicted products from in vitro resolution of the cloned wildtype dimer bridge 74 3.2. In vitro resolution of the wildtype dimer bridge clone, pQLDBl, in the presence or absence of recombinant NS-1 74 3.2.1. Analysis of resolution products on one-dimensional agarose gel 74 3.2.2. Quantitation of resolution products by Southern blotting 80 3.2.3. Two-dimensional neutral/alkaline gel electrophoresis to characterize extended and IX turn-around forms 83 3.2.4. Immunoprecipitation to show NS-1 is covalently bound to the extended form resolution product of the dimer bridge 85 3.3. Resolution of mutant dimer bridge clones 88 3.4. The B-half of the dimer bridge is nicked with recombinant NS-1 and replication extract from mouse LA9 cells 92 3.4.1. The B-half (and not the A-half) of the dimer bridge undergoes site-specific nicking in the presence of recombinant NS-1 92 3.4.2. Mouse LA9 replication extract is required for nicking of the B-half of the dimer bridge 96 3.5. Identification of nucleotides important for site-specific nicking: two CG motifs within the B-half of the dimer bridge 97 3.6. Gel mobility shift assays show that host cell factor(s) can bind to HFBR from wildtype DNA and binding to mutant D N A sequences is impaired. 101 3.7. The D N A fragment containing the wildtype HFBR of the B-half of the dimer bridge can inhibit nicking: mutant HFBR sequences are less effective inhibitors. 102 3.8. The resolution assay of the wildtype dimer bridge clone, pQLDBl, using mutant recombinant NS-1 105 IV. Discussion 108 4.1. The resolution products of the wildtype dimer bridge 108 4.2. The resolution procedure of the dimer bridge 110 4.3. The host factor(s) required for nicking 117 X V. References 121 List of tables 1 Sequence of oligonucleotides used to construct the wildtype and mutant dimer bridge molecules. 2. list of synthetic oligodeoxynucleotides for the cloning of B-half dimer bridge mutants and HFBR xii List of figures Page 1 Organization of SV40 origin and nucleotide sequence 3 of the SV40 core origin region 2 The modular structure of ARS1 and the modular 11 structure of ARS121 3 The genome of the MVMp 24 4 The structure of 3'-terminal hairpin of MVMp genome 25 5 The nucleotide sequence and configurations of 28 5'-terminal hairpin of MVMp genome 6 The gene expression pattern of MVMp 30 7 The modified rolling hairpin model for the D N A 39 replication of MVMp 8 The hairpin transfer, mechanism 40 9 The structure of dimer bridge 43 10 The resolution of dimer bridge proposed in the modified 44 rolling hairpin model 11 Schematic diagram of plasmids used for the cloning of 52 the dimer bridge 12 The wildtype dimer bridge clone, pQLDBl 54 13 Schematic diagrams of wildtype and mutant dimer 56 bridge clones 14 The illustration of the A-half, B-half and the GC rich 59 region of the wildtype dimer bridge in pQLDBl 15 The schematic diagram and partial sequence of the 61 X l l l cloned B-half dimer bridge in. pQLB 16 The schematic diagram and partial sequence of the cloned 64 B-half dimer bridge with ATF binding site 1 deleted in pQLBWT13 17 PCR mutagenesis scheme to mutate nucleotides 14 to 20 of 66 pQLBWT13 18 The predicted resolution products of pQLDBl 75 19 In vitro resolution of the wildtype dimer bridge 77 clone, pQLDBl, in the presence of recombinant NS-1 20 Southern blot analysis of pQLDBl resolution products 82 21 Two-dimensional neutral/alkaline agarose gel 84 electrophoresis analysis of resolution products from the wildtype dimer bridge plasmid, pQLDBl 22 The extended form resolution product is covalently bound 86 to NS-1 23 Resolution products of the mutant dimer bridges 90 24 Two-dimensional neutral/alkaline agarose gel 93 electrophoresis analysis of resolution products from the mutant dimer bridge plasmids 25 The B-half of the dimer bridge is nicked by crude 95 recombinant NS-1 but the A-half is not nicked 26 Nicking of pQLB with purified recombinant NS-1 requires 98 LA9 cellular extract 27 Determination of the nicking efficiency of mutants of 100 the B-half dimer bridge 28 Gel mobility shift assay of the HFBR fragment 103 29 Competition nicking assay of pQLBWT13 xiv 30 In vitro resolution of the wildtype dimer bridge 106 clone, pQLDBl, in the presence of mutant NS-1 31 The resolution procedure of the dimer bridge proposed 112 by Cotmore and Tattersall 32 The possible resolution procedures of the dimer bridge 115 Abbreviations aa A A V ABF1 ACS ARS A T F aux BRL CHO DHFR DTT DUE EP HFBR hRPA IR M C M MF1 m.o.i. mRF M R H M M V M M V M i M V M p amino acid adeno-associated virus ARS binding factor 1 ARS consensus sequence autonomously replicating sequence activating transcription factor auxiliary element Bethesda Research Laborotaries Chinese hamster ovary dihydrofolate reductase dithiothreitol D N A unwinding element early palindrome host factor binding region human replication protein A initiation region minichromosome maintenance maturation factor 1 multiplicity of infection monomer replicative form modified rolling hairpin model minute virus of mice minute virus of mice, immunosuppressive strain minute virus of mice, prototypical strain ORC origin recognition complex ori origin PAGE polyacrylamide gel electrophoresis P C N A proliferating cell nuclear antigen Pol polymerase PYR pyrimidine tract N S nonstructural protein nt nucleotide(s) RFC replication factor C RPA replication protein A SAR scaffold attachment region SDP-2 polyclonal antibodies against NS-1 ssDNA single-stranded D N A SV40 simian virus 40 T A g SV40 large tumor antigen VP viral protein wt wildtype xvii Acknowledgements Firstly, I would like to thank Dr. Caroline R. Astell, my supervisor, for the opportunity to work in her lab, all kinds of instruction and help. I am also impressed by her great patience and consideration. I owe thanks to Dr. Peter E. Candido and Michel Roberge, my committee members, for their useful advice and precious time spend on helping me. I also wish to express my deep appreciation for the support from my wife, Shili Duan. It is unfair if here I do not mention my baby daughter, Holly X. Liu, for her keeping quiet when I worked at home. Thanks also go to Carl B. Yong for the preparation of recombinant baculovirus stocks containing either wild type or mutant NS-1 genes and culturing the Sf9 cells, Dr. Hitesh Jindal for AC6 antibody used in the purification of NS-1, Dr. E. A. Faust (McGill) for polyclonal antibodies to NS-1, Dr. R. Molday for antibodies to bovine rhodopsin, Gary Wilson for the stock Sf9 cells, and Dr. John J. Keity (University of Massachusetts Medical Center), Dr. Laurie H . Glimchev (Harvard School of Public Health), and Dr. Gunther Schutz (German Cancer Research Center) for cDNA clones encoding murine ATF proteins. The helpful discussions from Dr. Patrick Tarn, John Brunstein and Colin Harris, and the smiling faces from other members of Dr. Astell's lab will also be remembered. 1 I. Introduction 1.1. The significance of the studies of M V M Studies on different viruses, all obligate intracellular parasites, are strikingly important for the elucidation of various aspects of the biochemistry and molecular biology of their host organisms. It is believed that the examination of each step in the life cycle of minute virus of mice, an autonomous parvovirus, can facilitate understanding the essential cellular processes of mammalian cells such as D N A replication and gene expression. Furthermore, these studies on M V M can contribute to the understanding of the molecular mechanisms of other related parvoviruses, for example, B19 parvovirus, a known human pathogen. Finally, it has been proposed that M V M can be used as a vector for tumor cell-targeted gene therapy (Dupont et al., 1994 and references therein). This is because it has been shown that the prototype strain of M V M , MVMp, has a strong tropism for tumor cells and can inhibit induced tumorigenesis in laboratory animals, M V M p can grow in a variety of transformed human cells, human transformed cells are significantly more sensitive to the killing effect of M V M p than their untransformed precursors, and MVMp infection of the native host (mouse) is apathogenic as is the closely related parvovirus H 1 which can infect humans without apparent clinical consequences. 1.2. Selected model systems for the study of D N A replication: the replicators and associated proteins in eukaryotes 1.2.1. Replication of the Simian virus 40 (SV40) genome 2 1.2.1.1. D N A sequences required for replication initiation Replicators are the cis-acting elements required for the replication of genomes. The replicator of SV40 (reviewed by Borowiec et al, 1990; Depamphilis, 1993; Fanning and Knippers, 1992) consists of a 64 bp core origin from nt 5211 to nt 31 and two auxiliary elements, aux 1 and aux 2 (aux 1 extends 16 bp from nt 5208 to nt 5193 and aux 2 extends 41 bp from nt 32 to 72) (Fig. 1). The core origin is both necessary and sufficient for the initiation of SV40 D N A replication. It has three essential domains: a 17 bp A / T rich domain (from nt 15 to nt 31) referred to as the AT-tract, a 27 bp central domain (from nt 5230 to 13) that is a perfect inverted repeat containing two G A G G C sequences in each arm of the palindrome, and a 10 bp domain (from nt 5211 to 5220) which is strongly biased toward purines on one strand and partially overlaps an imperfect inverted repeat (ie., early palindrome), hence it is referred to as the EP element or EP domain. The function for each domain in the initation of SV40 DNA replication has been elucidated. The central domain serves as the binding site of the SV40-encoded large T antigen (T Ag) through its 4 T Ag recognition sequences (GAGGC). The EP element is the initial site for melting of the core origin and is essential for this opening of the D N A helix. The AT-tract is required for further unwinding of the core origin since a mutant core origin with the AT-tract deleted cannot be unwound beyond the EP element (Parsons et al, 1990). Aux 1 has two G A G G C sequences. Aux 2 has 3 SP1 binding sites (GGGCGG) overlapping with 3 weak T Ag binding sites (GGGGC) and binding sites for other proteins. These two auxiliary elements augment the 3 A : aux 2 A / T H EP aux 1 core origin B : 30 20 1 0 1 5 2 4 0 5230 5220 I I I I I I I TAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTG ATTAAAAAAAATAAATACGTCTCCGGCTCCGGCGGAGCCGGAGACTCGATAAGGTCTTCATCAC I I I I I I A/T rich domain central domain early palindrome I I EP domain Fig. 1 A. Organization of SV40 origin. The origin for DNA replication of SV40 contains the 64 bp core origin from nt 5211 to nt 31 and two auxiliary-elements, aux 1 and aux 2. Aux 1 extends 16 bp from nt 5208 to nt 5193 and aux 2 extends 41 bp from nt 32 to 72. The core origin contains three separate domains. The EP domain is 10 bp long (nt 5211-5220), the central domain is 27 bp (nt 5230-13) and the A / T rich domain is 17 bp long (nt 15 to 31). The four arrows in the central domain of the core origin represent the 4 T Ag binding sites (GAGGG) arranged in an inverted orientation as illustrated. The lines between boxes indicate sequences which are not specifically required for the DNA replication of SV40. Fig. IB. Nucleotide sequence of the SV40 core origin region (see text for details). 4 replication efficiency of the ori core (Guo et al, 1989; Gutierrez et al, 1990). Aux 2 also constitutes part of the promoter for early gene expression. 1.2.1.2. Viral and host cell proteins required for the initiation of SV40 D N A replication As mentioned above, the core origin binding protein is T Ag which recognizes the G A G G C sequences in the central domain (reviewed by Borowiec et al, 1990). At physiological temperature, the binding of T Ag depends on the presence of ATP. DNAase I protection analysis indicates that in the presence of ATP, T Ag surrounds and spans the entire core ori (Deb and Tegtmeyer, 1987; Boroweic and Hurwitz, 1988a). Moreover, electron micrographs have shown that the bound T Ag is a bi-lobed structure (Dean et al, 1987). In addition, by using scanning transmission electron microscopy it was observed that each lobe is a hexamer of T Ag molecules (Mastrangelo et al, 1989). Dimethyl sulfate and potassium permanganate modification assays indicate that the bound T Ag causes untwisting of the AT-tract and melting of approximately 8 bp of D N A within the EP element (Boroweic and Hurwitz, 1988b; Boroweic et al, 1991; Dean and Hurwitz, 1991). In the presence of human single-stranded D N A binding protein (hRPA) and topoisomerase I or II, the double-hexamer complex of T Ag bound to the core origin undergoes a conformational change (Sengupta and Hurwitz, 1994) to form two T Ag hexamers (Wessel et al, 1992; Sengupta and Boroweic, 1992) each of which acts as a helicase and unwinds the D N A outward from the core ori (Dodson et al, 1987). As mentioned above, the AT-tract is required for further unwinding of the origin region (Dean et al, 1987a; Brill and Stillman, 1989; Kenny et al, 1989). This unwinding reaction appears 5 to be a required step in the replication of SV40 D N A based on D N A mutational analysis and pulse-chase experiments (Dean et al, 1987a; Bullock et ah, 1989). Since some but not all non-cognate single-stranded binding proteins can substitute for hRPA, it has been suggested that the binding of hRPA to the unwound ssDNA is required for the unwinding of SV40 D N A , and that hRPA also interacts with T Ag and this interaction is important for the unwinding (Dean et al, 1987b; Wold et al, 1987; Kenny et al, 1989). hRPA was later proven to physically interact with T Ag in the absence of D N A (Dornreiter et al, 1992). The observation that a hRPA mutant can bind to the ssDNA but is limited in its ability to unwind D N A or interact with T Ag provides further evidence that T Ag may interact with hRPA during unwinding and this interaction is necessary (Lee and Kim, 1995). However, it has also been shown that RPA from Saccharomyces cerevisiae can support the unwinding (Brill and Stillman, 1989) but cannot bind to T Ag (Melendy and Stillman, 1993). D N A polymerase cc-primase is responsible for initiating primer synthesis in the unwound region (Ishimi et al, 1988; Tsurimoto et al, 1990; Weinberg et al, 1990). The complex of T Ag, hRPA, D N A polymerase a-primase and the unwound origin region, which is ready for primer synthesis, is called the preinitiation complex. In the absence of DNA, it was shown that T Ag, hRPA and D N A polymerase oc-primase can physically interact with one another (Dornreiter et al, 1992 and references therein; Nasheuer et al, 1992; Collins et al, 1993; Dornreiter et al, 1993) suggesting that in the preinitation complex these three proteins have complicated and delicate physical interactions which may be required for the initation of RNA primer synthesis and subsequently D N A synthesis. The following observations support this proposal: 6 some heterologous SSB proteins which can support the T Ag-catalyzed unwinding of D N A containing SV40 origin cannot substitute for human RPA for the initiation of primer synthesis (Matsumoto et al, 1990); polymerase a-primase can inhibit the rate of the T Ag-dependent D N A unwinding from the SV40 origin in the presence of hRPA (Murakami and Hurwitz, 1993b); a cloned and expressed domain of human D N A polymerase a-primase, which physically interacts with T Ag, inhibits initiation of SV 40 D N A replication (Dornreiter et al, 1993); primer synthesis at the SV40 ori region specifically requires human D N A polymerase a-primase and mouse D N A polymerase a-primase is not functional (Schneider et al, 1994; Stadlbauer et al, 1996); T Ag appears to facilitate the loading of D N A polymerase a-primase on human (but not Saccharomyces cerevisiae and E. coli) SSB-coated single-stranded D N A template through interaction with human RPA bound to the ssDNA (Melendy and Stillman, 1993); Drosophila DNA polymerase a-primase synthesizes D N A in a SV40 T Ag- and origin-dependent fashion in the presence of Drosophila RPA but not human RPA (Kamakaka et al, 1994); T Ag stimulates the synthesis of primer by D N A polymerase a-primase on single-stranded D N A template and the stimulation can be eliminated by monoclonal antibodies that are directed against T Ag and block the binding of T Ag to the polymerase (Collins and Kelly, 1991); several monoclonal antibodies against D N A polymerase a-primase, which disturb the physical interaction of D N A polymerase a-primase with RPA or T Ag but do not inhibit the activity of D N A polymerase a-primase, abolish SV40 D N A replication in vitro (Dornreiter et al, unpublished data). D N A polymerase a-primase can stimulate ATP-7 dependent T Ag binding to the SV40 ori (Murakami and Hurwitz, 1993a). Although these multiple protein:protein interactions have been elucidated, it is still poorly understood how the preinitiation complex is assembled and what its structure is. It has been shown that under in vitro conditions the synthesized primers are exclusively hybridized to the templates for lagging strand DNA synthesis, suggesting that lagging strand synthesis precedes leading strand synthesis (Bullock et al, 1991; Murakami et al., 1992; Denis and Bullock, 1993). The initiation sites for primer synthesis mapped in vitro are found to be located at several specific sites outside of the ori core rather than inside of the ori core (Bullock and Denis, 1995; Bullock et al., 1991; Denis and Bullock, 1993). However, in vivo mapping experiments indicate that the earliest initiation event occurs within the core origin in the leading strand (Hay and Depamphilis, 1982). This contradiction suggests that in vivo factors such as chromatin structure or other unknown proteins can play a role on the initiation patterns of SV40 DNA replication. T Ag likely binds to the aux 1 region as a dimer (Ryder et al, 1986; 1985; Deb and Deb, 1989). Mutations in aux 1 that diminish T Ag binding also diminish activity of aux 1, suggesting that bound T Ag is required for the stimulation of ori core by aux 1 (DiMaio and Nathans, 1982; Myers and Tjian, 1980). Furthermore, the orientation and spacing of aux 1 relative to the ori core are critical, hence it is possible that there is direct protein-protein interaction between T Ag bound to aux 1 and T Ag bound to the ori core (Guo et al, 1991). Spl and T Ag have been shown to bind to aux 2 (Kadonaga et al, 1986; Delucia et al, 1983). A synthetic oligonucleotide that contains 3 Spl sites can provide 75% of aux 2 activity while a synthetic oligonucleotide that contains 3 T Ag binding sites can provide 20% of the aux 2 activity. Therefore, 8 the combined effects of these two proteins can account for the activity of the intact aux 2 sequence (Guo and Depamphilis, 1992). How do the bound proteins at the auxiliary sequences stimulate the ori core activity? Aux 2 is one part of the early gene promoter and initiation sites of the early gene transcripts are located within the ori core. However, a-amanitin, a specific inhibitor of RNA polymerase II and III does not have an effect on the initiation of SV40 DNA replication (reviewed by DePamphilis, 1993). Thus, stimulating transcription does not appear to be the reason aux 2 facilitates ori core activity. Moreover, the activity of auxiliary sequences does not depend on the presence of nucleosomes on the SV40 D N A (Guo et ah, 1989) suggesting the function of the bound proteins at aux sequences is not to impede the formation of nucleosomes at the ori core and make it more accessible to T Ag. Since saturating amounts of T Ag do not reduce the activity of aux 1 and aux 2, it seems that the bound proteins at auxiliary sequences do not facilitate the assembly of T Ag at ori core. Since deletion of the two auxiliary sequences reduces the efficiency of ori unwinding to the same extent that it reduces D N A replication (Gutierrez et al., 1990), it seems probable that the two aux elements facilitate the unwinding of the ori core and that the proteins bound at aux 1 and aux 2 probably interact with T Ag bound at ori core, stimulating the activity of the ori core. 1.2.1.3. The complete SV40 D N A replication system 9 The complete SV40 D N A replication system has been reconstituted with purified proteins: SV40 large T Ag, replication protein A (RPA), D N A topoisomerases I and II, D N A polymerase a-primase, replication factor C (RFC), the proliferating cell nuclear antigen (PCNA), D N A polymerase 8, maturation factor 1 (MF1), and DNA ligase I (Waga et al, 1994). Although RNAase H was not included in this reconstitution system, the D N A ligase I used contained trace amount of RNAase H activity. RNAase H as well as MF1 have been demonstrated to be required for the removal of RNA on a synthetic lagging strand (Turchi and Bambara, 1993). Therefore, it is likely that RNase H is required for SV40 DNA replication. The primers for both leading strand and lagging strand synthesized by D N A polymerase a-primase are ~24 nt long DNA chains covalently linked to oligoribonucleotides ~10 nt long (Bullock et al, 1991; Nethanel et al, 1988; Denis and Bullock, 1993; Bullock et al, 1994; Nethanel and Kaufmann, 1990; Eki et al, 1992). Following synthesis of the primers, RFC, P C N A and D N A polymerase 8 are loaded onto the template-primer junction, replacing D N A polymerase a-primase (Lee et al, 1991; Tsurimoto and Stillman, 1991a and b; Tsurimoto et al, 1990; Weinberg et al,, 1990; Eki et al, 1992). The processive R F C / P C N A / p o l 8 complex then extends the hybrid R N A - D N A primer to yield the continuously synthesized leading strand (Lee et al, 1991; Tsurimoto and Stillman, 1991b; Tsurimoto and Stillman, 1989) and the discontinuously synthesized lagging strand (Okazaki fragments)(Waga and Stillman, 1994; Nethanel and Kaufmann, 1990). Of note is that the synthesis of both leading and lagging strands requires a switch from pol a to pol 8. It is also proposed that a dimer of D N A polymerase 8 couples the D N A synthesis of both the leading strand and lagging strand (Waga and Stillman, 1994). MF1, a 5' to 3' exonuclease involved in the removal of the oligoribonucleotide primers, is 10 found to interact with PCNA and be stimulated by PCNA suggesting that the removal of the RNA primer by MF1 and the gap-filling D N A synthesis by D N A polymerase 5 holoenzyme including P C N A and RFC is coupled through MF1 binding to PCNA (Li et al, 1995). After the R N A primer is removed and gap-filling completed, DNA ligase I can seal the two juxtaposed Okazaki fragments (Waga et al., 1994) 1.2.2. Replication initiation in S. cerevisiae 1.2.2.1. Autonomous replicating sequences (ARSs) In 1979, short genomic D N A sequences of Saccharomyces cerevisiae were identified as autonomously replicating sequences (ARSs) which confer on plasmids the ability to replicate extrachromosomally (Stinchcomb et al, 1979; Hsiao and Carbon, 1979). In 1987, 2-dimensional gel techniques to examine replicative intermediates demonstrated that the ARS from the endogenous 2 micron plasmid as well as a chromosomal ARS1 colocalize with replication origins on plasmids (Brewer and Fangman, 1987; Huberman et al, 1987). Using similar techniques, it has subsequently been shown that a number of other ARSs as well as ARS1 act as replication origins in their normal chromosomal contexts. However, only a subset of the sequences identified as ARSs act as replication origins in the chromosome, suggesting that chromosomal context can play a crucial role in origin function (Umek et al, 1989). Since ARS1 is the ARS studied most extensively, a detailed description of ARS1 will be given below. Through deletion analysis, it was found that the 130-bp ARS1 has 2 important functional domains, A and B (Celniker et al, 1984)(Fig. 2A). 11 A : A B 1 B 2 B 3 B : \ B F ^ ^ \ B p } - / / - A A T r i c h Fig. 2A. The modular structure of ARS1. The 130 bp ARS1 includes the ACS-containing 15 bp domain A, the 13 bp subdomain Bl , the 10 bp subdomain B2 and the 12 bp subdomain B3. Fig. 2B. The modular structure of ARS121. ARS121 contains the 35 bp domain A which contains the ACS, 72 bp AT-rich domain that is 8 bp away from domain A and is at the 3 '-end of the T-rich strand of ACS. In addition, there are two ABF1 (ARS binding factor 1) binding sites with the proximal one 169 bp from domain A . The space between the two ABF1 sites is 45 bp. ARS121 does not contain ARS1 Bl - or B2-like sequences. The domains and subdomains described in A and B are indicated by labelled boxes. The thin lines represent the D N A sequences between the different domains, which are not specifically required for ARS activity. 12 Domain A is essential for ARS1 activity and contains one perfect match (11/11) to the ARS consensus sequence (ACS) , 5'-(A/T)TTTA(T/C)(A/G)TTT(A/T)-3' . However, this 11 bp ACS can not substitute for the ~15 bp domain A for origin function (Marahrens and Stillman, 1992). Domain A is the major part of the recognition site of a protein complex called ORC (see below). Domain B, located on the 3' side of the T-rich strand of the ACS is essential for ARS1 function. It cannot be inverted or moved relative to the ACS (Diffley and Stillman, 1988) and is shown to be divided into 3 subdomains, Bl , B2 and B3, using linker scanning analysis (Marahrens and Stillman, 1992; 1994)(Fig. 2). Bl (-13 bp) is immediately adjacent to and ~12 bp from domain A (Note, the sizes of the A domain and B subdomains have not been accurately determined yet so that the distances described here between different elements are estimations). The efficient binding of ORC to ARS1 required the presence of Bl (although Bl is not essential for low level of binding) in vitro and in vivo (Rowley et al., 1995; Rao and Stillman, 1995). Point mutations in the 6 bp core of the Bl subdomain identify two important adjacent A nucleotides while the other 4 nucleotides seem to be mutable. Furthermore, mutation of the A nucleotide proximal to the ACS in the Bl subdomain decreases both ORC binding affinity and ARS1 origin function. In contrast, mutation of the A nucleotide distal to the ACS decreases the ARS1 origin function but has no effect on ORC binding (Rao and Stillman, 1995). Therefore, it is proposed that Bl may have two functions: stabilizing ORC and providing the binding site for another unknown factor involved in the initiation of D N A replication (Rao and Stillman, 1995). B2 (~10bp) is a 9/11 match to the ACS in domain A and is ~28bp from Bl . It was proposed that ORC might bind to B2 (Bell and Stillman, 1992; 13 Diffley and Cocker, 1992). However, single-point mutations at B2 do not affect ARS function (Rao et al, 1994). Thus B2 probably does not provide a specific binding site for a protein but plays a structural role, such as a D N A unwinding element. Alternatively, B2 may bind a protein with low level of sequence specificity. B3 (~12 bp) which is ~33 bp from B2 is the recognition site for the transcription factor ABF1. B3 can be replaced by the binding sites for other transcription factors (Marahrens and Stillman, 1992). Although domain B as a whole is essential, linker substitutes in any one of the three B subdomains only reduce origin function as detected by plasmid stability assays and do not completely inactivate ARS1 activity (Marahrens and Stillman, 1992; 1994). Analysis of a large number of ARSs has revealed a common underlying architecture, ie., domain A flanked by stimulatory sequences (reviewed by Newlon, 1988; Campbell and Newlon, 1991; Rowley et al, 1994)(Rao et al, 1994; Rashid et al, 1994; Theis and Newlon, 1994). Domain A which is essential for origin function and present in all of the ARSs contains a close or exact match to an 11 bp ARS consensus sequence (ACS). By itself, domain A is usually not sufficient for ARS function and the flanking sequences of domain A are required. The flanking sequences can be located on either the 5*- or 3 - side of the T-rich strand of the ACS. The ARS binding factor 1 (ABF1) binding site is found to be part of the flanking sequences in some but not all of the ARSs and it functions in an orientation- and distance-independent manner to enhance ARS activity (Walker et al, 1990; 1991). Except for the ABF1 binding site, the other stimulatory sequences of ARSs tend to be AT rich but show little or no resemblance in sequence, size and relative location to the ACS. It will be interesting to learn why different ARSs of S. cerevisiae have different stimulatory sequences and how these sequences 14 help the ACS to achieve efficient ARS activity on the chromosomes. The modular structure of ARS121 is shown in Fig. 2B for comparision with ARS1 (Fig. 2A) (Walker et al, 1990; 1991). 1.2.2.2. Proteins which bind to the ARS1 sequence 1.2.2.2.1. The origin recognition complex (ORC) ORC was purified in 1992 (Bell and Stillman, 1992). It consists of six polypeptides of 120, 72, 62, 56, 53 and 50 kDa. The genes for these proteins have now been cloned (Bell et al, 1995; Li and Herskowitz, 1993; Foss et al, 1993; Loo et al, 1995). Footprinting experiments both in vitro and in vivo indicate that ORC can bind to ARS1 and the protection extends across the A and Bl elements with the DNase I cleavage sites within Bl exhibiting a 10 bp periodicity. These data suggest that ORC binds ARS D N A in a bipartite manner with D N A in domain A embedded in ORC (and hence fully protected) and D N A in Bl contacting the protein surface leaving one side of the D N A helix exposed (Bell and Stillman, 1992; Diffley and Cocker, 1992). It has also been shown that the efficient binding of ORC with ARS1 requires the presence of Bl as well as domain A, in vitro and in vivo (Rowley et al, 1995; Rao and Stillman, 1995). ORC is believed to play a role in replication initiation on the basis of several observations. Firstly, ORC binds in vitro to all the ARSs tested, generating similar footprints (Bell et al, 1993). Secondly, mutations in the ACS that disrupt ORC binding in vitro also disrupt origin function in vivo (Bell and Stillman, 1992). Thirdly, in vitro patterns of DNase I protection and hypersensitivity on ARSs are very similar to the genomic footprints (Diffley and Cocker, 1992). Fourthly, mutations in ORC2 15 and ORC5 cause defects in S-phase entry and/or origin function (Bell et al, 1993; Foss et al, 1993; Fox et al, 1995). Finally, 2D gel analysis has been used to demonstrate that orc2 and orc5 temperature-sensitive mutants are defective for the initiation of chromosomal DNA replication (Liang et al, 1995). Another important characteristic of ORC is that its specific D N A binding is dependent upon the addition of ATP (Bell and Stillman, 1992). From the cloned genes of ORC, it is known that two of the ORC subunits, Orel and Orc5, contain nucleotide-binding motifs (Bell et al, 1995). ORC is also involved in transcription silencing at the silent loci, HMLa and HMRa, however the relationship between this role and its role in replication is not yet understood (Fox et al, 1995; Kelly et al, 1994; Dillin and Rine, 1995). 1.2.2.2.2. ARS binding factor 1 (ABF1) ABF1 binds to the B3 element of ARS1 and the related elements of some other ARSs. As discussed above, not all of the ARSs have an ABF1 binding site. There are two major reasons to suggest that ABF1 is involved in the intiation of D N A replication, in vivo. Firstly, the genomic footprint over the B3 element of ARS1 is very similar to the in vitro footprint generated with purified ABF1. Secondly, temperature-sensitive mutants of ABF1 exhibit elevated instability of plasmids containing ARS sequence (reviewed by Rowley et al, 1994). How does ABF1 function at the replication origins? Although this question is not answerable at this time, it is known that the ABF1 binding site at ARS121 can function in a distance- and orientation- independent manner (Walker et al, 1990; 1991), the binding sites of other transcription factors can functionally substitute for the B3 element of ARS1 (Marahrens and Stillman, 16 1992), and B3 of ARS1 is not required for ORC binding in vitro and in vivo (Rao et al, 1994; Bell and Stillman, 1992; Rowley et al, 1995). D N A recognition events by ORC and ABF1 are most likely independent of each other and ORC and ABF1 probably do not interact directly (Rao and Stillman, 1995). It has been suggested that ABF1 may interact with RPA and contribute to the stabilization of the single-stranded DNA in the early stages of D N A replication (Rowley et al, 1994). In addition to their presence at some yeast replication origins, ABF1 binding sites have been identified in silencing elements and in the promoters of many genes where they function as upstream activating sequences. Hence ABF1 is a multifunctional protein (Diffley, 1992; Rowley et al, 1994). 1.2.2.2.3. Other ARS binding proteins Several other proteins as well as ABF1 and ORC have also been shown to bind to ARSs. One of these is termed Core Binding Factor (CBF) (Estes et al, 1992). The relationship between ORC and CBF is not yet clear, but it has been suggested that CBF is the same as ORC (Rao and Stillman, 1995). Another ARS binding factor is the general transcription factor, T A T A binding protein (TBP), which can bind to the B2 element of ARS1 and is possibly involved in the ARS origin function (Lue and Kornberg, 1993). Furthermore, several ACS single-strand binding proteins have been identified, which bind in vitro to the T-rich strand of th AGS, but it is not known whether they play a role in yeast D N A replication (Rowley et al, 1994). 1.2.2.2.4. Proteins which bind to ORC 17 Although ORC can bind to ARS and is believed to be the initiator protein for D N A replication, no biochemical activities expected of an initiator protein besides origin binding have been detected, suggesting that the purified ORC is not sufficient for initiation and must cooperate with additional proteins and/or be modified posttranslationally to be fully active. This is supported by the observation that in vivo, there are two different states for the origins of D N A replication (Diffley et al, 1994). At the end of M phase and throughout the G l phase of the cell cycle, the origins of D N A replication are in a so-called prereplicative state in which the protein footprint at ARS is markedly different from the one generated with purified ORC. In S, G2 and most of the M phases, origins are in the so-called postreplicative state in which the protein footprint at ARS is very similar to the one with purified ORC. Over the past three years, many proteins have been identified genetically to be involved in the initiation of D N A replication (Toyn et al, 1995), but only two of them, Dbf4 and Cdc6, besides ORC, are found to physically interact with the origins or ORC (Dowell et al, 1994; Liang et al, 1995) and they are probably components of the prereplicative complex at ARS. Dbf4 was shown to bind to ARS1 in vivo using a one-hybrid assay. Efficient interaction required ORC binding at ARS1 and the presence of the B2 element. Whether Dbf4 interaction with B2 is direct or indirect is unknown (Dowell et al, 1994). Dbf4 is a positive regulatory protein of a protein kinase, Cdc7, which is required for the initiation of D N A replication (Sclafani and Jackson, 1994). Thus, Cdc7 could be targeted by Dbf4 to phosphorylate and activate the ORC. Preliminary studies indicate that the Cdc7-Dbf4 complex phosphorylates ORC, in vitro, on Orc2 (Wang and Li, 1995). 18 Another protein, Cdc6, has been shown to be important for the initiaton of D N A replication and physically bind to ORC by co-immunoprecipitation (Liang et al, 1995). Some time ago, Cdc6 was implicated in D N A replication (Hartwell, 1976) and in 1994, genetic evidence was provided showing Cdc6 was needed for formation of the prereplicative complex (Diffley et al, 1994). Other candidates bound to ORC or ARS sequence are some of members from the M C M (minichromosome maintenance) family (Maine et al, 1984). These proteins have been genetically proven to interact with ORC (Wang and Li, 1995) although no physical interactions between the M C M proteins and ORC proteins are shown. These MCM, proteins are located inside yeast nuclei immediately after mitosis, but are lost from nuclei once D N A synthesis begins (Huberman, 1995a). It is proposed that M C M proteins are the yeast licensing factors which explain why DNA replication only happens once in S phase (Toyn et al, 1995). 1.2.3. Replication initiation in metazoan cells Over the past 10 to 15 years, a considerable number of studies have been carried out to find out whether there are replicators for the initiation of chromosomal D N A replication in the metazoan cells, and if yes, what they are and how they function. It is clear that in differentiated cells there are cis-acting sequences (ie, replicators) which are needed for the site-specific initiations of D N A replication on the chromosomes. The key experimental evidence is the following: approximately 20 different systems have been exploited in the search for DNA replication origins on the chromosomes in different cell lines and species; putative initiation sites have been mapped to 19 either broad initiation zones or small loci (Huberman, 1995b; Gilbert et al, 1995); that there is a nonrandom distribution of initiation sites on the chromosomes indicates indirectly the existence of replicators; direct evidence for the specific origin sequences are three systems in which the replicators have been identified: 1.), a chromosomal 8 kb deletion which contains the 2 kb initiation region (IR) or a 30 kb deletion about 50 kb 5* to IR in the human beta globin locus eliminates the initiation activity of this IR (Kitsberg et al, 1993; Aladjem et al, 1995); 2.), five short, partially redundant, cis-acting sequences (several hundred base pairs each) located within 8 kb of D N A have been shown to be essential for the amplification of the chorion gene cluster in the third chromosome of Drosophila melanogaster and the preferential 1 kb initiation region encompasses AER-d, one of the five cis-acting sequences; furthermore, one of these five elements, A C E (amplification control element), when placed at the other locations in the Drosophila genome, caused amplification of the adjacent DNA (DePamphilis, 1993; Carminati et al, 1992); 3.), the 16 kb region including ori beta of the dihydrofolate reductase (DHFR) locus can be transplaced to other locations in the C H O genome where it functions as a D N A replication origin (Handeli et al, 1989). In contrast, D N A replication within the chromosomes of rapidly dividing cells in Xenopus and Drosophila early embryos appears to begin at randomly chosen sites (Hyrien and Mechali, 1993; Shinomiya and Ina, 1991). This may suggest that in the early embryos of any species initiation of D N A replication is random and that replicators are not functional despite their existence. What constitutes a replicator in differentiated cells? From computer analysis (Dobbs et al, 1994), it was shown that the 16 kb replicator of the DHFR locus, the 8 kb replicator of the chorion gene.cluster and four other initiation 20 regions (which were not identified as replicators until now) from different gene loci all have D N A unwinding elements (DUE), and clusters of scaffold attachment regions (SARs) and ARS consensus sequences, a degenerate 21 bp consensus sequence, and pyrimidine tracts (PYR). Although the replicator of the human beta globin locus was not included in this analysis, it does contain the 21 bp consensus sequence (Aladjem et al, 1995). However, it remains to be determined whether DUE, ACS, SAR, PYR and the 21 bp consensus sequence are functionally important. It is also very important that more replicators be identified and characterized to see whether they contain these consensus sequences or not. How do the replicators function? One hypothesis is that the replicators in higher eukaryotes function as binding sites of unknown initiator proteins which unwind the D N A double helix. Subsequently, the initiation of D N A replication begins as has been shown to occur at the origin sequences in SV40 (Huberman, 1995b). The presence of DUE in the replicators described above and the identification of homologs of yeast ORC subunits in higher eukaryotes (Gavin et al, 1995; Ehrenhofer-Murray et al, 1995; Gossen et al, 1995) support this hypothesis. Other evidence is that some D N A sequences can preferentially promote the autonomous replication of plasmids over others and these sequences have been shown to correspond to the initiation sites in chromosomes (Berberich et al, 1995; Taira et al, 1994; Virta-Pearlman et al, 1993; Wu et al, 1993; Todd et al, 1995; McWhinney et al, 1995). Furthermore, in many of the mapped initiation zones, preferred initiation sites have been found indicating that in these initiation zones, the initiation frequencies at different sites are different (Gilbert et al, 1995). This hypothesis also suggests that random initiation of D N A replication in early embryos may be due to the high concentration of maternally derived initiator proteins. 21 However, there are conflicting reports that plasmid replication is virtually sequence-independent in transfected human or Drosophila cells, as is the D N A introduced into Xenopus eggs or egg extracts (Coverley and Laskey, 1994; Krysan et al, 1993; Masukata et al, 1993; Smith and Calos, 1995). These conflicting reports and the observations of broad initiation zones in which the initiation of D N A replication seems to occur throughout a large (several kilobasepairs) region (Huberman, 1995b) argue that in higher eukaryotes an initiation site does not need to have a specific sequence and hence replicators function differently than the replicators of simpler organisms. Hence, an alternate hypothesis has been proposed. In this alternate hypothesis, it is suggested that in differentiated cells the replicators somehow play a role in determining chromatin structure which specifies which sites are active and which sites are inactive for initiation of D N A replication, and that the initiation sites of D N A replication have no sequence specificity (Coverley and Laskey, 1994). In early embryos the replicators are not necessary for the initiation of D N A replication because the chromatin structure is less compact than in differentiated cells (Montag et al, 1988; Benavante et al, 1985; Stick and Hauseu, 1985; Gilbert et al, 1995). It has been shown that the human beta globin locus control region (LCR) affects chromatin structure (Grosveld et al, 1987; Forrestor et al, 1987; 1989) and a 30 kb deletion which includes the LCR eliminates initiation at IR (see above). It remains to be proven that the elimination of initiation activity at IR by the deletion of LCR is due to a change in chromatin structure determined by the LCR. Also it is believed that in yeast, chromatin structure can determine origin accessibility since nucleosome positioning affects the activity of ARS in plasmids (Simpson, 1990). 22 Both of the hypotheses described above cannot explain all of the available data. In order to learn how the replicators function, the precise identification and characterization of cis-acting sequences in the replicators and the interacting proteins will be required. Until now no proteins have been identified which bind to the replicators and have been shown to be functionally important for the initiation of D N A replication in metazoan cells. 1.3. Introduction to Minute Virus of- Mice (MVM), an autonomous parvovirus M V M is a helper-independent virus which belongs to the genus parvovirus of the family Parvoviridae. A typical M V M virion contains a linear single-stranded D N A molecule encapsidated in a nonenveloped icosahedral capsid ~25 nm in diameter. M V M exists as two closely related strains, M V M p and M V M i , which share more than 96% of their genomes (Sahli et al, 1985; Astell et al, 1986). MVMp is the prototypical strain first isolated as a contaminant virus in mouse adenovirus stocks (Crawford, 1966). M V M i is an immunosuppressive strain discovered as a factor in the mouse lymphocyte culture fluids which strongly inhibited cell growth (Bonnard et al, 1976). An important difference between these two strains is in their ability to infect cultured cells: M V M p infects only fibroblasts, while M V M i is restricted to T-lymphocytes (McMaster et al, 1981; Tattersall and Bratton, 1983). M V M p does not cause apparent pathology when injected into its normal host, mouse, but it does cause dwarfing and death when injected into newborn hamsters (Kilham and Margolis, 1970; Brownstein et al, 1992). In contrast, M V M i infection can be lethal in mice (Brownstein et al, 1992; 23 Segovia et al, 1995; Kapil, 1995). Since M V M p was studied in my thesis research, a detailed introduction to MVMp is given below. 1.3.1. Molecular biology of MVMp 1.3.1.1. The genome of MVMp By using both physical and enzymatic techniques the M V M p genome was shown to be a single-stranded DNA molecule with hairpin structures at both ends (Bourguignon et al, 1976). The complete sequence of the M V M p genome has been determined (Astell et al, 1979; 1983a and b). From the D N A sequence it is known that the genome is 5149 nt long, and the 115 nt 3'-end and the 206 nt 5'-end have the potential to form hairpin structures. Furthermore, the 206 nt 5'-end region of the genome is not unique and exists as two different sequences (called flip and flop sequences, respectively). This results in two forms of the genome (Fig. 3). However, these two 5'-end sequences are related in that one is the inverted complement of another. In a population of M V M virions, the number of virions with a flip genome is approximately equal to the number of virions with a flop genome (Astell et al, 1983b). For historic reason, the first nucleotide of the 3'-end of the viral genome is numbered as the first nucleotide (nt 1) and the first nucleotide of the 5'-end of the viral genome is numbered as the last nt (nt 5149), the genome is written 3' to 5' (Fig. 3), and the left and right ends of the genome refer to the 3'- and 5'-ends, respectively. 1.3.1.2. Structures of MVMp terminal hairpins Flip 24 Flop: Fig. 3. The genome of the M V M p . The genome of MVMp is a linear single-stranded D N A molecule of 5149 nucleotides with hairpin structures at the two ends. Since the 5'-terminal hairpin can be as either a flip or flop sequence, there are two forms of genomic DNA (Hip or Flop) for MVMp (see text for additional details). 25 A G P 90 G p™ 80 I 100 110 G C % ~ 7 ° ' A A G ' ' 60 — G A G T G T G C A G T G A A T G C A T G T A C C A A C C A G T C A A G A T T T T T A C T A g G T C A T C A C G T C A C T T A C G T A Q A C A T G G T T G G T C A G T T C T A A A A A T - j i CGQ C 4 0 30 20 10 G C — 50 A Fig. 4. The structure of 3'-terminal hairpin of M V M p genome. The 115 nt 3'-terminal hairpin has a Y-like configuration with one long stem and two short arms of different sizes. In the stem there is a bubble formed by the unpaired nucleotides 25, 26,89, 90 and 91. 26 The 3'-terminal hairpin is a stem plus arms or Y-shaped configuration of 115 nt (Fig. 4). Nucleotides 46 to 70 form the two arms with different sizes. In the stem there is a bubble formed by five unpaired nucleotides (nt 25, 26, 89, 90 and 91). This bubble was predicted to play an essential role for the asymmetric resolution of the dimer bridge during D N A replication of M V M p (see below) (Astell et al, 1985). The 3'-end hairpin is not related to the 5'-end hairpin in sequence. Moreover, the D N A sequence of the 3'-hairpin is unique in contrast to the sequence heterogeneity (flip and flop) of the 5'-end hairpin. Although the D N A sequences of the flip and flop forms of the 5'-terminal hairpins are different, both of them can assume a very similar hairpin structure since the flip sequence (also called flip orientatation) is the inverted complement of the flop sequence (also called flop orientation). The 206 nt 5'-terminal hairpin arranged with the maximum number of base pairs is an extended stem with a bubble (Fig. 5). Recently, the mismatched nucleotides in this bubble were shown to be required for efficient viral D N A replication (Costello et al, 1995). It is also possible that the 5'-hairpin can form a stem structure with two major arms plus a smaller one because of the presence of an internal palindrome within the 206 nt sequence. Deletion mutants with the potential "stem plus arms" structure eliminated but the simple hairpin retained are not able to replicate in vivo, indicating the apparent requirement for the formation of the "stem plus arms" hairpin structure (Salvino et al,_ 1991). However, in a in vitro replication system, it has been suggested that it is the extended stem structure not the "stem plus arms" structure which can prime the initiation of D N A replication for the complementary strand of viral DNA (Cossons et al, 1996). F i g . 5A 27 4 9 4 4 4 9 9 3 I 1 3 T T O C T A A T C A T A ^ ^ c ' ATTAGTATTACTATGT^ D I I 5149 5 1 0 0 B : 4 9 9 4 CGATACTCGCTir^ACCATGA A Q G A G T T G G T T Q G T C ^ ^ GCTATGAGCGAACTQG^^^ G<nCAACCAACCAGACCQGC T T I 5 0 9 9 C: 4 9 9 4 l C G A T A C T C G C T T C A C C A T G A C C A A C C ^ G G A G i r a J T C Q ^ ^ \ C l ^ r , GCTATGAGCGAACTQGTACTX^^ T a n C A A C C A A C C A G A C C Q G C A A F L O P I C A 5 0 9 9 28 D: G A A G C I A A T G A T ' ' C G C G A T A T C G 4994 C G I A T C G A T A C T O X T I G A C C A T G C I Q Q C C G T G C T A T G A Q C G A A C I C G T A C G A C C Q Q C M T STEMS PLUS ARMS(FLIP) | T A R 5099 G C G C T A T A G C G C T A . . ... . T A N G C C T G C Fig. 5. The nucleotide sequence and configurations of 5'-terminal hairpin of the M V M p genome. There are two kinds of sequences (flip and flop) for the 206 nt 5'-terminal hairpin. The flip is the inverted complement of the flop. Both flip or flop sequence can assume two kinds of configurations: extended stem or "stems plus arms". The flip form with extended stem configuration is the double-stranded sequence shown in A connected to the double-stranded sequence shown in B. The flop form with the extended stem configuration is the double-stranded sequence shown in A connected to the double-stranded sequence shown in C. The double-stranded sequence in A plus the double-stranded sequence in D is the "stems plus arms" configuration of the flip form. The "stems plus arms" configuration of the flop form is not shown here. 29 1.3.1.3. Transcripts and primary translation products of M V M p All of the transcripts of MVMp are complementary to the M V M p virion strand, hence its definition as a minus strand. Presumably a double-stranded replicative form is the actual template for transcription. M V M p has two promoters, P4 (at map unit 4) and P38 (at map unit 38) driving synthesis of two overlapping transcripts (Fig. 6)(Pintel et al, 1983; Cotmore and Tattersall, 1987). The P4 transripts and P38 transcripts start, respectively, at nucleotides 201 and 2005 (Ben-Asher and Aloni, 1984). Both of them are polyadenlylated and the polyadenylation signal is at nt 4885 (Clemens and Pintel, 1987). Based on the different sizes of spliced transcripts, the transcripts driven by P4 are divided into two major classes, Rl (4.8 kb) and R2 (3.3 kb), and the transcripts from P38 are designated as R3 (3.0 kb). Between map units 46 and 48, there are two potential splicing donor sites (nt 2280 and 2316 in the MVMp genome) and two potential splicing acceptor sites (nt 2377 and 2399). However, sequence analysis of M V M cDNAs indicated that only three splice combinations are found in the viral transcripts and the splice combination, 2316 to 2377, is not detected (Morgan and Ward, 1986; Jongeneel et al, 1986). All of the three splice combinations can be found in R l , R2 and R3. Using an in vitro translation system, Rl was shown to encode the nonstructural protein, NS-1 (Cotmore et al, 1983; Cotmore and Tattersall, 1986). Since the start and termination codons for NS-1 are at nt 261 and 2277, all three spliced forms of the Rl transcript should generate an identical protein. All of the spliced R2 transcripts have an large intron between nt 514 and nt 1990 removed (Jongeneel et al, 1986). R2 encodes the nonstructural protein NS-2 (Cotmore and Tattersall, 1986). The start codon is at nt 261 as is 30 Fig. 6. The gene expression pattern of M V M p . The top line indicates the M V M p genome with the hairpin sequences (black boxes) at the two ends. There are two promoters (P4 and P38) at map units 4 and 38, respectively, of the genome. All of the transcripts share the same polyadenylation signal at nt 4885 and three combinations of splicing between map units 46 and 48. R2 transcripts encoding NS-2 all have a large intron between nt 514 and nt 1990 removed. Open boxes represent the coding region. Rl transcripts encode the same NS-1 protein molecule. R3 transcripts encode VP1 or VP2, depending on the splicing pattern. 31 the case for NS-1, thus NS-1 and NS-2 share the same 84 aa N-terminal sequence. The three splice forms of the R2 transcripts between map units 46 and 48 result in three NS-2 proteins with different C-terminal aa sequences (Cotmore, 1990). One of the three spliced R3 transcripts encodes the minor capsid protein VP1, the start codon for which is at nt 2286 (Labieniec-Pintel and Pintel, 1986). The other two R3 transcripts in which the start codon for VP1 is spliced out encode the major capsid protein VP2. The start codon for VP2 is at nt 2794 (Labieniec-Pintel and Pintel, 1986). VP1 contains the entire aa sequence of VP2 and both of them share the same termination codon at nt 4555 (Labieniec-Pintel and Pintel, 1986). From the above description, it is obvious that differential splicing can determine the proportions between NS-1 and NS-2 molecules and between VP1 and VP2 synthesized in the infected cells. 1.3.1.4. Viral proteins: 1.3.1.4.1. The nonstructural proteins, NS-1 and NS-2. NS-1 is the major nonstructural protein of MVMp. This protein has been shown to be essential for the replication of the M V M p genome since a frameshift mutation in the NS-1 coding region blocked replication (Merchlinsky and Ward, personal communication). It has also been shown that NS-1 can enhance transcription from both the P4 and P38 promoter (Doerig et al, 1988; 1990). Thus, like many nonstructural proteins from other viruses, NS-1 is a multifunctional protein. From the open reading frame of Rl transcripts, it is known that NS-1 consists of 672 aa (Astell et al, 1983b; Cotmore et al, 1983). NS-1 is a nuclear 32 phosphoprotein (Cotmore and Tattersall, 1986). The phosphorylation of the M V M p NS-1 is exclusively on serine residues. Trypsin digestion and peptide analysis of NS-1 from infected mouse cells indicate there are at least 18 phosphopeptides (Jindal and Astell, unpublished results). However, the role of the phosphorylation of NS-1 is unknown. The nuclear localization signal of NS-1 is a bipartite lysine-rich motif from aa 194-216 (KK(X)isKKK) (Nuesch and Tattersall, 1993). Furthermore, NS-1 is found to form oligomers as mutant NS-1 without the nuclear localization signal can be cotransported into the nucleus with wildtype NS-1 or a C-terminal deletion mutant of NS-1 (aa 1-605) (Nuesch and Tattersall, 1993). Computer analysis of parvovirus proteins identified a 135 aa sequence (aa 389-524) in NS-1 of M V M p , which is conserved among the large nonstructural proteins of all vertebrate parvoviruses (Astell et al, 1987). Within this conserved sequence, there is a purine nucleotide binding motif. It was shown that purified NS-1 expressed in insect Sf9 cells is an ATP binding protein, ATPase and an ATP-dependent D N A helicase (Wilson et al, 1991; Jindal et al, 1994). In the modified rolling hairpin model for the M V M genome replication (Astell et al, 1985 and also see below), NS-1 was proposed to nick at specific sites on the D N A replication intermediates and then covalently bind to the resulting phosphate group at the 5'-end of the DNA. Comparison of the sequences of proteins involved in a rolling circle type D N A replication (eg., the gene A protein of phage §x 174) revealed that they share two motifs, YuxK and HuHuuu (x=any aa, u=hydrophobic residues). Furthermore, the Y residue in the YuxK motif is predicted to be the aa residue covalently bound to the 5'-end of the nicked DNA and the two H residues are predicted to be 33 involved in metal binding (Ilyina and Koonin, 1992). In NS-1 of M V M p , the conserved Y residue is predicted to be Y188 and the conserved H residues, H129 and H131, respectively. Prior to the studies reported in this thesis, it was known that the protein bound to the 5'-end of M V M D N A (replication intermediates and single-stranded viral DNA) was NS-1 (Gunther and Tattersall, 1988; Cotmore and Tattersall, 1989; Cotmore and Tattersall, 1988). However, whether Y188 of NS-1 was involved in the covalent linkage and whether the two H residues are important for the NS-1 function were unknown. Analysis of the chemical stability of the bond between the protein and D N A suggested that NS-1 is linked via a phosphotyrosine bond and not a phosphothreonine or phosphoserine bond (Chow et al, 1986; Cotmore and Tattersall, 1988). Moreover, mutations of the tyrosine residues 188, 197, 210, 310 or 422 to phenylalanine in NS-1 resulted in mutant proteins which were unable to support replication, suggesting one (or more) of these residues is the candidate tyrosine involved in the covalent linkage (Skiadopoulos and Faust, 1993). As mentioned above, NS-1 is also a transcriptional activator. Analysis of the ability of various Gal4-NS-l or Lex-NS-1 fusion proteins to stimulate various target promoters in which multiple Gal4 binding sites or LexA operator sequences have been introduced within the promoter sequences has shown that the transactivation domain is the C-terminal 88 residues (Krady and Ward, 1995; Legendre and Rommelaere, 1994; Harris and Astell, 1993). This is supported by the observations that most mutations in the NTP-binding domain of NS-1 yield transcriptionally active NS-1 mutants, although they are inactive for replication (Jindal et al, 1994). Previously, the efforts by different labs to determine whether NS-1 can bind to the double-34 stranded D N A from M V M p failed to detect specific binding. However, recently, using an immunoprecipitation procedure, NS-1 was shown to be a sequence-specific D N A binding protein which can bind to the A C C A A C C A sequence of the duplex 3'-palindrome of MVMp (Cotmore et al, 1995) and to the P38 promoter (Christensen et al, 1995). Binding of NS-1 to the P38 promoter is required for NS-1 transactivation (Lorson et al, 1996). NS-2 proteins are a family of proteins with different C-terminal sequences. The NS-2 proteins seem to be involved in many processes in the M V M p life cycle. However, relatively little is known about how these proteins function. NS-2 is not essential for the life cycle of M V M p in rat, hamster and human cell lines, but seems to be required for efficient D N A replication and virus production in murine cells (Cater and Pintel, 1992; Naeger et al, 1990) in which NS-2 appears to be involved in the folding of capsid proteins and progeny ssDNA synthesis (Naeger et al, 1990; 1993; Cotmore et al, 1995b). NS-2 is also believed to be involved in the translation of viral proteins because it was found that although the levels for both viral proteins and viral mRNA were significantly reduced in the mouse LA9 cells infected with MVMp containing a NS-2 mutation compared with wt MVMp infected LA9 cells, the viral protein levels were reduced more than viral mRNA levels (Naeger et al, 1993). NS-2 of M V M i is also involved in pathogenesis since mice infected with wildtype M V M i die while mice infected with mutant M V M i in which the NS-2 cannot be synthesized are asymptomatic (Brownstein et al, 1992). NS-2 can be phosphorylated and phosphorylated NS-2 is found exclusively in the cytoplasm. Whereas nonphosphorylated NS-2 can be found in both the cytoplasm and nucleus (Cotmore and Tattersall, 1990). The half life of NS-2 is ~1 hr which is significantly shorter than that of NS-1 (>6 hr). All three NS-2 35 proteins have the same stability, phosphorylation and distribution patterns so that there is as yet no indication that different NS-2 proteins have different functions (Cotmore and Tattersall, 1990). 1.3.1.4.2. The structural proteins, VP1, VP2 and VP3 There are three capsid proteins, VP1 (83 KDa), VP2 (64 KDa) and VP3 (61 KDa). In full M V M p virus particles VP1 constitutes -15-18% of the protein mass. The amounts of VP2 and VP3 vary inversely in different preparations of full particles (Tattersall et al, 1976). VP3 is absent in empty particles in which again VP1 is 15-18% of the protein mass (Tattersall et al, 1976). In vitro translation of mRNA isolated from M V M p infected cells yields VP1 and VP2 in addition to NS-1 and NS-2, suggesting that VP1 and VP2 are primary translation products (Cotmore et al, 1983). Pulse-chase experiments suggest that VP3 is the proteolytic product of VP2 following encapsidation (Tattersall et al, 1976; Clinton and Hayashi, 1975). Peptide map analysis of the capsid proteins supports this notion and also indicates that the cleavage site is approximately 30 aa from the N-terminus of VP2 (Tattersall et al, 1977). M V M p productively infects fibroblasts but not T cells while M V M i shows the converse tropism (McMaster et al, 1981; Tattersall and Bratton, 1983). However, transfected fibroblasts yield similar numbers of infectious virus particles regardless of which M V M infectious clone is introduced, suggesting that permissiveness or restriction is mediated by the infecting virus particles (Gardiner and Tattersall, 1988a). The observation that virions of the two strains (p and i) compete for the binding to either cell type indicates that the restriction is not at the level of a cell surface receptor (Spalholz and 36 Tattersall, 1983). Through studies with interstrain recombinant viruses, the host range-specific determinant has.been mapped to a small sequence within the capsid coding region shared by VP1 and VP2 (Antonietti et al, 1988; Gardiner and Tattersall, 1988a; 1988b), and it has also been shown that two aa substitutions of M V M i are sufficient to confer fibrotropism (Ball-Goodrich and Tattersall, 1992). Recently, by using recombinant virions consisting of various combinations of VP1 and VP2 from M V M p and M V M i to infect fibroblasts, it was shown that the presence of VP2 but not VP1 from M V M p is necessary to enable infection of fibroblasts (Maxwell et al, 1995). Based on these observations, it is concluded that the tropism of M V M strains is determined by the interaction of intracellular factors with a VP2 domain. However, it is not known what the intracellular factor is and at which stage of the viral replication cycle it acts. Empty capsids can bind to the 3'-end hairpin structure of M V M viral replicative form D N A (Willwand and Hirt, 1991). Similar observations have been made for the autonomous parvoviruses, Aleutian mink disease virus and bovine parvovirus (Metcalf et al, 1990; Willwand and Kaaden, 1990). It has been suggested that the binding of the parvovirus RF D N A 3'-end to the empty capsid serves for both synthesis of progeny strands and their concomitant encapsidation, and a model for this process has been proposed (Willwand and Kaaden, 1990). Mutation studies with an infectious clone indicate that VP2, by itself, is sufficient and necessary to form capsid structures which can bind to the 3'-end hairpin structure, and accumulate and encapsidate viral ss D N A (Willwand and Hirt, 1993; Tullis et al, 1993). However, the resulting virus particles are not infectious suggesting VP1 is required for infection. Since the VP2 virion can bind to the cell surface as efficiently as wildtype (VP2 and VP1) capsid, no 37 initiation of D N A replication is detected in the cells infected with VP2 virions and capsid protein is not required for the initiation of viral D N A replication, it is believed VP1 plays a role during virus entry, nuclear transport or uncoating subsequent to cell binding and prior to the initiation of D N A replication (Tullis et al, 1993). VP1 contains an additional N-terminal sequence rich in basic residues as well as the entire VP2 protein sequence (Tattersall et al, 1977; Labieniec-Pintel and Pintel, 1986). Since VP1 in the virus particles is resistant to proteolytic digestion, it has been suggested that the N-terminus remains on the interior of the capsid and interacts with the ss genomic D N A in the capsid (Tattersall et al, 1977). As mentioned above, VP3 is derived from the cleavage of VP2 once the particle is assembled. The ratio of VP2 to VP3 depends on the postinfection time: at early times VP2 is predominant, but late in the infection VP3 is the major form (Tattersall et al, 1976). 2-D gel analysis of protein species from empty capsids, the premature full particles and mature particles strongly suggests that posttranslational modification (especially, phosphorylation) of VP2 plays a role in the formation of VP3 (Santaren et al, 1993). From studies with parvovirus HI , it is known that particles are equally infectious regardless of their VP2/VP3 protein content (Paradiso, 1981). Conversion of VP2 to VP3 for M V M p can also take place during virion internalization (Santaren et al, 1993). The function of VP3 in the virus particle remains to be investigated 1.3.2. A model for M V M p D N A replication: the modified rolling hairpin model. 38 Until recently, the most widely accepted model for M V M p replication was the modified rolling hairpin model (MRHM) proposed in 1985 (Astell et al, 1985) (Fig. 7). This model proposed that the initial step for replication is for the 3'-terminal hairpin to initiate synthesis of a monomeric duplex replicative form (mRF). This mRF is amplified by subsequent round of D N A strand displacement synthesis primed by the 3'-end of the viral complementary strand, resulting in the formation of a dimeric RF intermediate. The dimer RF is resolved at the junction fragment (called the dimer bridge) resulting in two momomers. This process requires site-specific nicking, strand displacement D N A synthesis and nicking and ligation. Synthesis of progeny genomes with two alternate sequence orientations at the 5'-terminal and a unique sequence at the 3'-terminal occurs by strand displacement synthesis and hairpin transfer (originating at the 5'-end). As mentioned above, this model contains two important mechanisms: hairpin transfer and resolution of the dimer bridge. The hairpin transfer mechanism can explain the heterogeneity of the 5'-end hairpin of M V M p genomes and was first proposed to explain how double-stranded linear D N A molecule with terminal palindromes can replicate their 5'-ends (Cavalier-Smith, 1974). It was an integral mechanism in the original rolling hairpin model for the D N A replication of parvoviruses (Tattersalland Ward, 1976). The resolution mechanism of the dimer bridge as proposed in the M R H M can explain the unique sequence at the 3'-end hairpin. 1.3.2.1. The hairpin transfer mechanism The hairpin transfer mechanism as proposed in the M R H M is illustrated in Fig. 8. The DNA molecule in line 1 corresponds to the right end 39 nick $z !!!! ^ e ! b b a' Vpar d e d C d' e' d 3 2 Vpar nick a b a l Vpar d e d ' 1 d Vpro 1 i j a b a • C d e d d' C v P a r d e d ' • Vpro b a C d e d nick 5' 3' Vpar n ick i , d e d' C a y s ^ a ' v P a r d & b ^ — 8 7 d e d Vpro a a 5 d >va Vpro d ^ 7*=?°' 8 a b 5 d Fig. 7. The modified rolling hairpin model for the D N A replication of M V M p . a b a' and d e d ' indicate the 3'- and 5'- terminal hairpin sequences, respectively. Vpar and Vpro indicate the parental and progeny viral strands, respectively. The black circles represent the viral protein NS-1. C indicates the complementary strand. The vertical arrows point to the nick sites and the horizontal arrows indicate the direction of 3'-end priming of DNA synthesis. The dashed lines indicate that the monomer replicative form in line 7 can re-enter into the D N A replication cycles. 40 2 3 4 Fig. 8. The hairpin transfer mechanism. The black circles attached to the 5'-ends were proposed to be NS-1. The arrows indicate the 3'-ends to prime D N A synthesis. Vpar denotes the parental viral strand and C indicates the complementary strand. 41 of the dimer replicative form in Fig. 7 (lines 4 and 5). The 5-terminal hairpin sequence of the MVMp parental genome is represented by d e d' (d and d' are complementary sequences; the presence of e is to indicate that the 5'-terminal inverted repeat sequence is not a perfect palindrome). The M R H M proposes that the 3'-end of the complementary lower strand can fold back to prime D N A displacement synthesis yielding the progeny single-stranded genomes. The viral protein NS-1 is assumed to nick at a specific site on the C strand near d' becoming covalently bound to the resulting 5'-end. The resulting 3'-end can subsequently extend the lower strand to complete a double stranded D N A molecule with extended 5'-end. Of note is that the 5'-terminal palindrome sequence of the upper DNA strand (Fig. 8, line 4) in this D N A molecule is the inverted complement of the corresponding sequence in the starting D N A molecule (Fig. 8, line 1), and another round of D N A strand displacement synthesis by using this D N A molecule as the substrate yields a single-stranded progeny genome with 5'-terminal sequence to be the inverted complement of the one from the parental genome. The nicking and displacement DNA synthesis at the closed (left) end of the dimer replicative form (Fig. 7, lines 4 and 5) proposed in M R H M is also a hairpin transfer mechanism inverting the 5'-terminal sequence of the genome (Fig. 7, left side of lines 6 and 7). Although the hairpin transfer mechanism for the D N A replication of MVMp remains to be proven, it has been shown that in vitro, the duplex extended form of 5'-terminal palindrome can be melted and the resulting 3'-end can fold back to prime the D N A displacement synthesis (Cossons et al, 1996). It is also known that the protein bound to the 5'-end of MVMp D N A (replication intermediates and single stranded viral DNA) is NS-1 (Gunther and Tattersall, 1988; Cotmore and Tattersall, 1989; Cotmore and Tattersall, 1988). Furthermore, it was 42 shown that the covalently closed hairpins of adeno-associated virus (AAV) can be resolved into a duplex extended form in extracts derived from AAV/adenovirus infected cells (Snyder et al, 1990) 1.3.2.2. Resolution of the dimer bridge The dimer replicative form (or more simply called the dimer) is the D N A molecule in line 4 of Fig. 7. It is also shown in Fig. 9A in which the bold lines indicate the position of the 115 bp 3'-terminal palindrome. The D N A fragment in the dashed box of Fig. 9A is the dimer bridge of M V M p , which includes the 3'-terminal palindrome. The structural features of the dimer bridge, an imperfect palindrome, are indicated in Fig. 9B. The 3'-end hairpin of the MVMp genome has a "bubble" formed by nts 25, 26, 89, 90 and AG AAG 91 (see Fig. 4), resulting in the to sequence asymmetry within the It/ l i t / dimer bridge. The GC-rich region [nt 46-71 from the 3'-end hairpin (Fig. 4)] at the center of the dimer bridge and the T nucleotide (nt 41, Fig. 4) are two additional asymmetries within the dimer bridge. The resolution mechanism of the dimer bridge proposed in the M R H M is illustrated in Fig. 7 (lines 4 through 6). Fig. 10 shows more clearly resolution of the dimer bridge according to the M R H M . Firstly, NS-1 encoded by MVMp is proposed to give the first nick at a specfic nicking site (site 1). After nicking, NS-1 is covalently bound to the 5'-end of the D N A and at the same time DNA displacement synthesis at the 3'-end by the host cellular D N A polymerase takes place. When this displacement D N A synthesis reaches another specific nicking site (site 2) on the lower D N A strand, NS-1 bound at the 5'-end of the displaced D N A strand 43 A : d B : 3 — 5'—• n ick s i te a b a ' . O i l 4 # 1 Vpar d e d' C: 3 5 Vpro I A G I i T C i B - h a l f ^a ' b a n ick s i te # 2 d' e' d a x i s i T « GC C — C G _ J richp richp • A A G * i T T O — 5 — 3 ' I A - h a l f AG T C AAG T T C 5 i 3 Fig. 9. A. The dimer replicative form of MVMp as shown in line 4 of Fig. 7 is repeated here. The DNA fragment in the dashed box is the dimer bridge. The bold lines indicate the 3' terminal hairpin sequence of the genome and its complementary sequence. B. The dimer bridge region of A is illustrated with further detail. The axis indicated by the dashed vertical line is drawn to emphasize that the dimer bridge is a palindrome sequence. In order to show that the palindrome of the dimer bridge is not perfect, the nucleotides A G and A A G which form the bubble of the stem of the 3'-terminal hairpin of M V M p genome, nucleotide T which forms the bulge, the GC-rich region which forms the two arms, and their complementary nucleotides are indicated. Also the dimer bridge is further demarcated into the B-half dimer bridge, the A-half dimer bridge, and the central GC rich region. In the following figures of this thesis, the dimer bridge is represented by the DNA molecule shown in C. (not drawn to scale) 44 3 ' 5* AG T C NS-1 nick site #1 AAG T T C 5 ' 3 ' AG T C A T C NS-1 nick site #2 AAG T T C AAG T T C AG AAG T C T T C Fig. 10. The resolution of dimer bridge proposed in the modified rolling hairpin model. The D N A molecule in line 1 is the dimer bridge and the two D N A molecules in line 4 are the resolution products of the dimer bridge. The black circles indicate NS-1 protein bound to the 5'-end. The horizontal arrows represent the 3'-end used to prime DNA synthesis. The vertical arrows point to the proposed NS-1 nick sites. 45 gives the second nick at nick site 2. At the same time this NS-1 molecule is bound to the newly formed 5'-end of the DNA and the 5'-end of the displaced D N A strand ligates with the newly formed 3'-end, resulting in the production of two D N A molecules. One molecule has a closed end or turn-around form end and the end for the the other molecule is an extended form. One important characteristic of this resolution mechanism of the dimer bridge is its asymmetry. There are two reasons to say this. One reason is that it is proposed that NS-1 can only give the first nick at nick site 1 but not at site 2. The model suggests the reason for NS-1 nicking at site 1 first is that the sequence near site 1, A A G , is different from the sequence near nick site 2, CT. Another reason the resolution mechanism of the dimer bridge is asymmetric is that the two resolution products are asymmetric: the end for the product on the left is closed but not extended whereas the end for the product on the right is extended but not closed. As mentioned above, this resolution mechanism can explain the unique 3'-end sequence of M V M genome. This is because through such a mechanism the resulting resolution products of the dimer bridge retain the same orientations for the 115 nt 3'-terminal sequences present in the parental genome (see the two resolution products in line 6 and the parental genome in line 1 in Fig. 7 for the comparision). The 3'-terminal hairpin of progeny genomes derived from these two products is unique in sequence (Fig. 7, lines 7 and 8). In 1985 when the M R H M was proposed, it was unknown how the dimer bridge is resolved, what the resolution products are and whether NS-1 is the enzyme involved in the resolution. In 1992, a report appeared showing that the dimer bridge can be resolved by NS-1 in vivo (Cotmore and Tattersall, 1992) although it was unknown whether the resolution products 46 are as suggested in the M R H M . One part of the research for the my PhD thesis was to answer this question by using an in vitro resolution system. 1.3.3. Cis-acting elements for the M V M p genome replication. Analysis of defective interfering MVMp indicated that the terminal sequences of the genome are preferentially retained, suggesting all of the cis-acting sequence required for DNA replication reside at or near termini (Faust and Ward, 1979). This was confirmed with the observation that a minigenome construct with the terminal 140 and 660 nucleotides from the left and right termini, respectively, is replication competent (Tarn and Astell, 1993). Analysis of the terminal deletion mutants of M V M p genome for their replication efficiency has shown that both 3'- and 5'-end hairpins of the genome are required for the replication (Salvino et al, 1991; Tarn, 1994) as are the "bubbles" in the stem portions of the 3'- and 5'-end hairpins (Tarn, 1994; Costello et al, 1995). The removal of one copy of a tandemly arranged 65-bp repeat found 94 nt inboard of the 5'-terminal hairpin also strongly inhibited viral D N A replication (Salvino et al, 1991), although in a minigenome context, the deletion appeared to have no effect on replication (Tarn and Astell, 1993). Although some closely related parvoviruses share these A:T rich tandem direct repeats in their genomes, their function remains to be clarified. In addition, the deletion of DNA sequence from nt 4489-4695 near the 5'-terminal hairpin was found to eliminate replication of the minigenome (Tarn and Astell, 1993). Multiple host cellular proteins have been shown to specifically bind to this region (Tarn and Astell, 1994). However, the function of this region is still unknown. One possibility is that it may be involved in 47 facilitating the folding back of the extended 5'-terminal palindrome during synthesis of the dimer RF (Fig. 7, line 3) and single stranded progeny genomes (Fig. 7, line 6). Currently, linker scanning mutagenesis of this region and the analysis of the replication efficiencies of mutants are ongoing in this laboratory (Brunstein and Astell, unpublished results) and the host proteins which bind to this region will hopefully be identified in order to elucidate the function of this cis-acting sequence. 1.3.4. Focus of the present study: resolution of the dimer bridge The focus of my research has been towards clarifying the resolution products and resolution procedure of the dimer bridge of M V M p . I have shown that the resolution products predicted by the M R H M are observed, in vitro, using a cloned dimer bridge plasmid, LA9 cellular replication extract and recombinant NS-1 (expressed in insect cells). However, when a series of mutant dimer bridge clones which I constructed in order to prevent resolution, were resolved, I concluded that the resolution procedure proposed in the M R H M is likely incorrect (Liu et al, 1994). A report from another lab AG AAG indicated that the half dimer bridge containing the (but not ^ ) sequence, which is the right half of the dimer bridge shown in Fig. 10B, was nicked by extracts containing NS-1 (Cotmore and Tattersall, 1994). This laboratory also suggested the signal for nicking the half dimer bridge containing the ^ sequence was the spacing between sequence and a IC I c putative ATF binding site and implicated the host cell ATF played a role in nicking. 48 I used highly purified recombinant NS-1 and established that nicking is dependent on the presence of a murine host cell factor or factors. I constructed a series of mutations within the host factor binding region (HFBR) and identified two CG motifs displaced by 10 bp which are required for nicking. Evidence for binding of mouse protein(s) to HFBR was also obtained (Liu and Astell, 1996). Further studies with mutant NS-1 proteins (tyrosine residues (188, 197 and 210) that were candidates for covalent linkage to the 5' phosphoryl group at the nick site were changed to phenylalanine) indicated that the tyrosine at 197 does not appear to be involved in the covalent linkage whereas tyrosines at 188 and 210 may be involved(Liu et al, unpublished results). 49 IL Materials and Methods 2.1. Materials Chemicals were purchased from Fisher Scientific, Sigma Chemical Co. BDH, GIBCO/Bethesda Research Laboratories (BRL) or Bio-Rad laboratories unless otherwise specified. All restriction and D N A modification enzymes were purchased from either GIBCO/BRL or New England Biolabs. D N A sequencing kits using Sequenase were from United States Biochemical Company (USB). Tissue culture media and supplies were purchased from GIBCO/BRL. Bacteria medium were supplied by Difco Laboratories. Ampicillin was from Ayerst Laboratories. 2.2. Bacteria The recombination deficient strain of E. coli, SURE (Stratagene), was used to clone plasmids which contain palindrome sequences. DH5a strain was used for routine cloning. 2.3. Mammalian cell line, LA9. Mouse LA9 cells (Littlefield, 1964) used in this study are an ouabain resistant isolate of the HGPRT" cell line A9 and were originally obtained from Peter Tattersall (Yale University). LA9 cells have been shown to be permissive to infection by MVMp (Tattersall, 1972). i 50 2.4. Insect cell line, Sf9. Insect S. frugiperda 9 (Sf9) cells were obtained from Dr. F. L Graham (McMaster University). 2.5. Standard cloning techniques Detailed protocols for many of the molecular cloning procedures have been described i n Sambrook et al. (1989). 2.6. D N A sequencing Sequencing of p lasmid D N A was carried out us ing reagents and Sequenase from D N A sequencing kits supplied by United States Biochemical C o m p a n y (USB). Samples were analyzed on 7" X 14" standard 7 M urea-p o l y a c r y l a m i d e gels. The gels were dr ied and bands detected by autoradiography. 2.7. Plasmid Constructions 2.7.1. Construction of a molecular clone of the wildtype M V M p dimer bridge Plasmid pCA408F was constructed by P. Tarn i n this lab (Tarn and Aste l l , 1993) by inserting the left end (ie., the 3'-end) of M V M p genome from a Smal linker to the A l u l site (nt 408 of the M V M genome) [Note, nucleotide sequence numbers refer to the published sequence (Astell et al, 1983b)] into 51 the Smal site of pUC19 (Fig. 11 A). In order to clone the dimer bridge, pCA408F was digested with Xbal and Pstl. The linearized plasmid was treated with exonuclease III and nuclease SI to delete about 100 bps (ie., nt 1-100 of the left end of M V M p genome) at the Xbal end. The two ends of the linearized, deleted plasmid were ligated and transformed into E. coli DH5a. After selecting a plasmid with the appropriately sized deletion, the plasmid was digested with Hindlll, blunt ended by filling in using T4 D N A polymerase, and digested with EcoRI. The shorter DNA fragment (MVMp DNA) was purified by electrophoresis in an agarose gel, recovered using Geneclean (Bio 101), and ligated to pUC19 (digested with Smal and EcoRI) to generate plasmid pQLl (Fig. 11B). The BamHI/PstI fragment (nt 1-410) of MVMp genome from pMM984 (Fig. 11C), an infectious clone of MVMp (Merchlinsky et al, 1983), was cloned into BamHI/PstI digested pUC19. The unique Ncol site [nt 259 within the M V M p sequence (Astell et al, 1983b)] was destroyed by digestion with Ncol, filling-in with T4 D N A polymerase and re-ligating. This BamHI/PstI fragment was then cloned into the BamHI/PstI site of pQLl . The unique Ncol site in this construct was destroyed as described above and this plasmid, designated pQL2 (Fig. 11D), was digested with Styl to isolate the longer D N A fragment which was used later as a vector. Four synthetic oligonucleotides (oligonucleotides QL1 to QL4 which are two sets of complementary oligos, Table 1) were prepared. The complementary pairs were annealed and ligated to the vector from Styl digestion (see above). The ligation mixture was transformed into E. coli SURE cells by electroporation. The resulting plasmid is the wildtype dimer bridge clone, pQLDBl (Fig. 12). The restriction endonuclease sites used to release the dimer bridge structure in the resolution assay (see below) are the 52 A: pCA408F 0 0 o "3" u> «* CM • o > u z CO _ ( 0 o E 5 S * ro " i ro Z _ X _ n — . o „ ro £ ro ._ J I 1 1 1 I I I I I B: pQLt CO o IO CM ° CO < ° * - 0 . ~ E 5 . O M C J I 1 M_J I I I I C: pMM984 CM E o w E " 1 1 1 0 0 D: pQL2 0 0 ^ o> CM O UJ 2.1 z t o - i t o » co 2 a . U 1 ' U l - u ' i L Fig. 11. Schematic diagram of plasmids used for the cloning of the dimer bridge. The open boxes represent M V M DNA. The thin lines represent the vector sequences. The bracketed restriction sites indicate sites destroyed during cloning procedures. A , B , C and D illustrate pCA408F, pQLl , pMM984 and pQL2, respectively. (Not drawn to scale) 53 Table 1: Sequence of oligonucleotides used to construct the wildtype and mutant dimer bridge molecules. The mutant sequences are presented in lower case. oligo QL1 p T G C C G A A G G C G C G C G C G C A G C G C G C G T C A T C A C G T C A C T T A C G T G 95 mer A A C A T G G T T G G T C A G T T C T A A A A A T G A T A A G C G G T T C A G G G A G T T T A A A C oligo QL2 p C T T G G T T T A A A C T C C C T G A A C C G C T T A T C A I I I I I A G A A C T G A C C 103 mer A A C C A T G T T C A C G T A A G T G A C G T G T G A C G C G C G C T G C G C G C G C G C C T T C G A G C G T C A oligo QL3 p C A C G T C A C T T A C G T T T C A C A T G G T T G G T C A G T T C T A A A A A T G A T A 66 mer A G C G G T T C A G G G A G T T T A A A C oligo QL4 p C T T G G T T T A A A C T C C C T G A A C C G C T T A T C A I I I I I A G A A C T G A C C 74 mer A A C C A T G T G A A A C G T A A G T G A C G T G T G A C oligo QL5 p C A C G T C A C T T A C G T g a A C A T G G T T G G T C A G T T C T A A A A A T G A T A A 65 mer G C G G T T C A G G G A G T T T A A A C oligo QL6 p C T T G G T T T A A A C T C C C T G A A C C G C T T A T C A I I I I I A G A A C T G A C C 73 mer A A C C A T G T t c A C G T A A G T G A C G T G T G A C oligo QL7 p C A C G T C A C T T A C G T T T C A C A T G G T T G G T C A G T T C T A A c t t a t c a t t t 66 mer C G G T T C A G G G A G T T T A A A C oligo QL8 74 mer p C T T G G T T T A A A C T C C C T G A A C C G a a a t g a t a a g T T A G A A C T G A C C A A C C A T G T G A A A C G T A A G T G A C G T G T G A C 54 Fig. 12. The wildtype dimer bridge clone, pQLDBl . The bold lines represent the 3'-terminal palindrome sequence. A G and A A G are the bubble nucleotides. Short bars indicate the positions of the restriction sites. Square brackets around restriction sites indicate that these were destroyed during the cloning procedure. PstI site on the left and PvuII site on the right. Both Ncol sites and the Alul site are surrounded by square brackets indicating these sites were destroyed during the construction. The four synthetic oligonucleotides were used to generate the dimer bridge sequence between the two Styl sites. 2.7.2. Construction of mutant dimer bridge clones Oligonucleotides QL1, 2, 5 and 6 (Table 1) were used to clone a mutant AAG dimer bridge in which nts 89-91, , in the wildtype dimer bridge were I I C C T altered to (Fig- 13B). The rationale for this construct was that we G A predicted that the bubble within the stem of the left hairpin may contribute to the asymmetric resolution process (Astell et al, 1985) and this mutant dimer bridge would make each stem of the dimer bridge identical in sequence. This clone is referred to as pQLDB2. Oligonucleotides QL1, 2, 7 and 8 (Table 1) were used to clone another mutant dimer bridge (pQLDB3) in which the 10 bp sequence spanning the putative nick site #1 (Fig. 10) is inverted (Fig. 13C). During construction of pQLDB2, an unexpected mutant dimer bridge clone, pQLDB4 (Fig. 13D), was also isolated. pQLDB4 is the same in sequence as pQLDB2 except that nts 102 and 103 of MVMp are deleted. In addition, the dimer bridge in pQLDB4 is inserted in the plasmid in the opposite orientation to that of pQLDBl, 2 and 3. All constructed plasmids containing the mutant dimer bridges were isolated and propagated in E. coli SURE cells. 56 Fig. 13. Schematic diagrams of wildtype and mutant dimer bridge clones. The PvuII to PvuII D N A fragment containing the dimer bridge (wildtype or mutant) is illustrated for each clone. A is the wildtype dimer bridge clone, pQLDBl. B is the mutant dimer bridge clone, pQLDB2 in which the A A G sequence is mutated into CT. C is the mutant dimer bridge clone, pQLDB3 in which the 10 bp sequence containing the predicted nick site #1 is inverted. D is the mutant dimer bridge clone, pQLDB4 in which A A G is mutated into CT, and nt 102 and nt 103 are deleted. Of note is that the orientation of the Styl fragment in pQLDB4 is opposite to that in pQLDBl, pQLDB2 and pQLDB4. Bold lines represent the 3-terminal palindrome. The long open box from PstI to [Alul] indicates the wild type or mutant dimer bridge sequences. The vertical bars indicate restriction sites. [Alul] indicates this site was damaged. Arrows point to the specific nick sites # 1 and 2, dotted small boxes indicate the mutated sites and the dotted triangle indicates a deletion. The horizontal thin lines are the vector sequence from pUC19. 57 Fig. 13A: H i n d l l l PvuII ' s t l S t y l 4 BssHII sites A G TC nick site # 2 A A G nick site # 1 S t y l [Alul ] EcoRI PvuII V i l l i TTC B: H i n d l l l PvuII PstI S t y l 4 BssHII sites A G t TC G A nick site # 1 S t y l [Alul ] EcoRI PvuII V i l l i nick site # 2 C: H i n d l l l PvuII PstI S t y l A G ^ TC nick site # 2 4 BssHII sites altered nick site # 1 S t y l [Alul ] EcoRI PvuII A A G TTC D : H i n d l l l PvuII PstI S t y l 4 BssHII sites ntl02, 103 deleted nick site # 1 CT nick site # 2 S t y l [Alul ] EcoRI PvuII V i l l i G A 58 2.7.3. DNA sequencing of the wildtype.and mutant dimer bridge clones Because of the size (~700 bp) of the wildtype dimer bridge in pQLDBl and its inverted repeat nucleotide sequence, a nested set of deleted dimer bridge clones was generated for sequencing. For mutant dimer bridge clones, pQLDB2, pQLDB3 and pQLDB4, each was digested with Styl, and subsequently the shorter Styl fragment blunt ended, inserted into the Smal site of pUC19 and sequenced using the universal primer for pUC19. In order to determine the orientation of the mutant dimer bridge in pQLDB2, 3 and 4 (because the four annealed synthetic D N A oligonucleotides can be inserted in either orientation), each plasmid was digested with EcoRI and BssHII. The longer D N A fragment was blunt ended and religated to generate a plasmid which was then sequenced using the M13 forward primer. 2.7.4. Cloning of each half (the A-half and B-half) of the dimer bridge The wild type dimer bridge sequence (Fig. 13A) can be divided into an A-half dimer bridge, B-half dimer bridge and the central G C rich region containing multiple BssHII sites (Fig. 14). The B-half dimer bridge contains the ^ sequence and the A-half dimer bridge contains the sequence. In order to clone the B-half dimer bridge, plasmid pQLDBl which contains the wildtype dimer bridge sequence was digested with BssHII and Hindlll, blunt ended, and the shorter fragment containing the B-half dimer bridge was inserted into the Smal site of pUC19. The resulting plasmid pQLB contains the B-half dimer bridge oriented with the BssHII end proximal to the 59 Hindlll PvuII PstI Styl 4 BssHII sites AG A TC nick site # 2 AAG nick site # 1 I Styl [Alul] EcoRI PvuII V i l l i TTC A-half JI IL GCrich B-half Fig. 14. The illustration of the A-half, B-half and the G C rich region of the wild type dimer bridge in pQLDBl . See the legend of Fig. 13 for the definitions of the symbols. 60 EcoRI site of pUC19. In a similar procedure, pQLDBl was digested with BssHII and EcoRI, blunt-ended, and the shorter fragment containing the A-half dimer bridge was cloned into the Smal site of pUC19. The resulting plasmid pQLA contains the A-half dimer bridge with the BssHII site proximal to the EcoRI site of pUC19. 2.7.5. Construction of B-half clones with mutations in the putative host factor binding region (HFBR) 2.7.5.1. Structure and sequence of pQLB, the B-half dimer bridge clone The shorter EcoRI/Hindlll fragment of the B-half dimer bridge clone, pQLB, and relevant restriction endonuclease sites are illustrated in Fig. 15A. Fig. 15B shows the sequence of part of the B-half dimer bridge. The putative HFBR is the D N A sequence from the BssHII site (destroyed during the construction of the plasmid) to the nucleotide adjacent to the NS-1 binding site. 2.7.5.2. Construction of pQLBDEL (both ATF motifs deleted) pQLB was digested with BsaAI and Ecll36II, and the larger fragment ligated, deleting the sequences between these two restriction sites. This plasmid, pQLBDEL, has both activating transcription factor (ATF) motifs deleted. 61 A : o o B : PQ _1_ W NH « CL * H H i _ L 2 A T F NS-1 Binding Binding Si tes Si te fi • tm X C/l PQ <J3 cs </> PQ 5' CGCG CGTCA TCA CGTCA CTTACGTGAACA TGGTTGGT 3* 3' GCGC GCAGT AGT GCAGT GAATGCACTTGT ACCAACCA 5' A A T F Binding Site 1 A T F Binding Site 2 NS-1 Binding S i t e Fig. 15. The schematic diagram and partial sequence of the cloned B-half dimer bridge in pQLB. A. The EcoRI/Hindlll fragment of pQLB is shown. The long box represents the B-half. Within this sequence, there are two ATF binding motifs (black boxes) and the NS-1 binding site (dotted box) (Cotmore et al, 1995). The thin lines are vector D N A sequences. Restriction sites used in cloning, [BssHII] and [Hindlll], or subsequent construction of mutants are indicated. The filled triangle indicates the NS-1 nicking site reported in this thesis (see section 3.4.1.) B. The nucleotide sequence from the [BssHII] site to the distal nucleotide of the NS-1 binding site [Cotmore et al, (1995)] is shown. The sequences for the two ATF motifs and the NS-1 binding site are boxed. 62 2.7.5.3. Construction of pQLBWT13 (one ATF motif deleted) pQLB was digested with BsaAI and Ecll36II, and the larger fragment was ligated with a 13 bp DNA fragment obtained by annealing two synthetic oligonucleotides [oligo 1 and oligo lc (Table 2)]. The clone with the correct sequence orientation (pQLBWT13) has the ATF motif (site 1) deleted (Fig. 16A). The nucleotide composition of part of this plasmid is shown (Fig. 16B). For reference, each nucleotide is numbered consecutively. (NB, this numbering system is arbitrary and does not correspond with nucleotide numbers in the M V M p genome) 2.7.5.4. Construction of single nucleotide mutations (Positions 3 through 13) in pQLBWT13 In order to change each nucleotide from 3 to 13 in pQLBWT13, pQLB was digested with BsaAI and Ecll36II, and the larger D N A fragment was ligated, respectively, with eleven 13 bp DNA fragments derived from eleven annealed oligo pairs (oligos 2-12 and oligos 2c-12c, Table 2). The eleven clones are referred to, respectively, as pQLBA3G, pQLBC4A, pQLBG5A, pQLBT6C, pQL13C7T, pQLBA8G, pQLBC9T, pQLBTlOC, pQLBTHC, pQLBA12G, and pQLBC13T. The nucleotide change is indicated by the wildtype nucleotide, its numerical designation (Fig. 16B), and the mutant nucleotide (e.g., A3G). 2.7.5.5. Construction of single nucleotide mutations (positions 14 through 20) in pQLBWT13 63 Table 2: List of synthetic oligodeoxynucleotides for the cloning of B-half dimer bridge mutants and HFBR n a m e s e q u e n c e n a m e s e q u e n c e oligo 1 T C A C G T C A C T T A C oligo 10 T C A C G T C A C T c A C o l i g o l c G T A A G T G A C G T G A oligo 10c G T g A G T G A C G T G A oligo 2 T C g C G T C A C T T A C oligo 11 T C A C G T C A C T T g C oligo 2c G T A A G T G A C G c G A oligo 11c G c A A G T G A C G T G A oligo 3 T C A a G T C A C T T A C -oligo 12 T C A C G T G A C T T A t ol igo3c G T A A G T G A C t T G A oligo 12c a T A A G T G A C G T G A oligo 4 T C A C a T C A C T T A C p r i m e r 1 a T G A A C A T G G T T G G T C A G T T ol igo4c G T A A G T G A t G T G A p r i m e r 2 G c G A A C A T G G T T G G T C A G T T C ol igo5 T C A C G c C A C T T A C p r i m e r 3 G T a A A C A T G G T T G G T C A G T T C T oligo 5c G T A A G T G g C G T G A p r i m e r 4 G T G g A C A T G G T T G G T C A G T T C T A oligo 6 T C A C G T t A C T T A C primerS G T G A g C A T G G T T G G T C A G T T C T A A oligo 6c G T A A G T a A C G T G A p r i m e r 6 G T G A A t A T G G T T G G T C A G T T C T A A A oligo 7 T C A C G T C g C T T A C p r i m e r 7 G T G A A C g T G G T T G G T C A G T T C T A A A A ol igo7c G T A A G c G A C G T G A Q L 1 8 m e r C G C C C A C T T C C T T T T C G C oligo 8 T C A C G T C A t T T A C H F S G T G A A C A T oligo 8c G T A A a T G A C G T G A H F S c G A T C A T G T T C A C oligo 9 T C A C G T C A C c T A C H F S G 1 4 A a T G A A C A T oligo 9c G T A g G T G A C G T G A H F S G 1 4 A c G A T C A T G T T C A t Note: The letters in lower case are the mutant nucleotides. 64 ^ ^ w NH P ^ ^ H - < ' ^ T3 W ^ © u * >^ .s s A i i , , A T F NS-1 Binding Binding NS-1 nick site Site 2 S i te B : 5' TCA 3' AGT 5 • CGTCA GCAGT « 10 i 1 5 2 0 CTTACGTGAACA GAATGCACTTGT TGGTTGGT ACCAACCA 3 ' 5 ' A T F Binding Site 2 NS-1 Binding Si te Fig. 16. The schematic diagram and partial sequence of the cloned B-half dimer bridge with ATF binding site 1 deleted in pQLBWT13. A. The EcoRI/Hindlll fragment of pQLBWT13 is shown. The filled triangle indicates the NS-1 nick site. B. Nucleotide sequence of the fragment from the [Ecll36II] site to the distal nucleotide of the NS-1 binding site. For ease of reference, the nucleotides are numbered (arbitrarily) from the left. 65 In order to change nucleotides 14 to 20 in pQLBWT13, PCR mutagenesis was used. Seven oligonucleotides in which one of the seven nucleotides (14-20) was changed were synthesized and used to prime a PCR reaction on pQLBWT13. The second primer in each case was oligo QL18 mer (Table 2, Fig. 17). The seven amplified fragments were digested with Styl and ligated to the larger D N A fragment from a Styl/BsaAI digestion of pQLBWT13. These clones are referred to as pQLBG14A, pQLBT15C, pQLBG16A, pQLBA17G, pQLBA18G, pQLBC19T, and pQLBA20G. 2.7.6. Construction of plasmids containing a wildtype or mutated host factor binding region (HFBR) pQLBWT13 was digested with BsaAI and BamHI. The larger D N A fragment was ligated with either annealed oligo HFS and oligo HFSc or annealed oligo HFSG14A and oligo HFSG14Ac (Table 2). The clones are referred to as pUCWT which contains the wild-type binding site for host factor(s), and pUCG14A which contains a G-»A mutation at position 14 of the host factor binding site. The NS-1 binding site and nicking site present in pQLBWT13 (Fig. 16A) are not present in these plasmids. Plasmid pQLBC4A was also digested with BsaAI and BamHI, and the larger fragment ligated with annealed oligo HFS and oligo HFSc or annealed oligo HFSG14A and oligo HFSG14Ac. The clones obtained are referred to as pUCC4A which is mutated in the host factor(s) binding site at position 4 (C-»A), and pUCC4AG14A which contains two mutations in the host factor(s) binding site at positions 4 and 14 (C—>A and G—»A, respectively). primer with m u t a t i o n Fig. 17. PCR mutagenesis scheme to mutate nucleotides 14 to 20 of pQLBWT13. The small black box and the small dotted box represent ATF binding site 2 and the NS-1 binding site, respectively. The two horizontal arrows indicate the two primers. A series of PCR products were generated using QL18 mer as a primer and seven different mutation primers (Table 2). Each PCR product was digested with Styl and ligated into the parent plasmid digested with BsaAI and Styl. 67 2.8. Preparation of mouse LA 9 replication extracts LA9 replication extracts were prepared using a procedure adapted from Stillman and Gluzman (1985). Mouse LA9 cells were grown in suspension culture in Joklik's M E M supplemented with 5% FBS (GIBCO). Cells (IL) grown to a density of 5-6 x 105 cells/ml were harvested by centrifugation (1, 200 rpm, Beckman JA14 rotor), and washed once with PBS. The cell pellet was resuspended in 10 ml ice-cold hypotonic buffer (20 mM HEPES, pH 7.5, 5 mM KC1, 1.5 mM MgCi2, 0.1 mM dTT), centrifuged and resuspended in 5 ml of hypotonic buffer. After 10 min on ice, the swollen cells were disrupted using a Dounce homogenizer. The cells were left on ice for a further 30 min and centrifuged at 11 K (Beckman JA17 rotor) for 10 min. The supernatant was removed, aliquoted and stored at -70°. 2.9. Preparation of Sf9 cell extracts containing NS-1 Insect cell extracts containing recombinant NS-1 were prepared by a procedure adapted from Wilson et al.(1991). A recombinant baculovirus containing the M V M NS-1 gene was used to infect a spinner culture of Sf9 cells (Wilson et al, 1991). Approximately 1.2 x 108 Sf9 cells (100 ml) were infected with recombinant virus (AcNS-1) at a m.o.i. of 5. Cells were harvested at 72 hr p.i. by centrifugation (300 xg, 5 min, 4°C), washed three times with cold PBS, resuspended in 2.5 ml of hypotonic buffer (see section 2.8.), and incubated for 15 min on ice. Cells were lysed using a Sonic Dismembrator (Quigley-Rochester, Inc.) until >95% of the cells were disrupted. Nuclear and cellular debris were pelleted by centrifugation (300 xg, 68 10 min, 4°C) and the supernatant transferred to a fresh tube, aliquoted and stored at -70°C 2.10. Purification of NS-1 from Sf9 cells The purification of NS-1 was essentially as described previously (Wilson et al, 1991) with the following modifications introduced to reduce the time and increase the activity. After centrifugation of sonicated infected Sf9 cells, the supernatant was diluted five-fold using buffer 1 containing NaCl (instead of dialyzing the supernatant against this buffer). The diluted crude extract was loaded directly onto an AC6 coupled sepharose column (AC6 is a monoclonal antibody to NS-1 (Yeung et al, 1991)), and after 30 min unbound protein was washed off the column and NS-1 was eluted with buffer 2 containing peptide 1 (incubation with peptide 1 was for 30 min before elution). 2.11. The dimer bridge resolution assay 2.11.1. Analysis of resolution products on one-dimensional non-denaturing agarose gels A standard reaction (25 u.1) contained 30 mM HEPES, pH 7.5, 7 mM M g C l 2 , 0.5 mM dTT, 100 uM of all four dNTPs, 3 mM ATP, 200 uM each of CTP, UTP, and GTP, 40 mM creatine phosphate, 1 u.g creatine phosphokinase, 0.8 |_Lg substrate (plasmid DNA containing dimer bridge), 20 uCi a- 3 2 PdATP, 9 |il of LA9 replication extract and 2-6 |il of cytoplasmic extract from Sf9 cells containing NS-1 or 3 ul of purified NS-1 (~300 ng). The reaction mixture was 69 incubated for 2 hr at 37°C. Following incubation, the mixture was digested with proteinase K (28 ug/ml) in the presence of 0.5% SDS and 5 m M EDTA for 1 hr at 37°C and 3 hr at 60°C. The samples were subsequently extracted with phenol/chloroform/isoamyl alcohol (50:49:1), desalted by centrifugation through 1 ml Sephadex G-50 spin columns to get rid of a - 3 2 P d A T P , and precipitated with ethanol. The DNAs were redissolved, digested with appropriate restriction endonucleases, and separated on 1.4% agarose gels (TAE buffer). The dried gels were exposed to X-ray film (Agfa). This procedure was adapted from that described previously (Stillman and Gluzman, 1985; Cotmore et al, 1992). 2.11.2. Two-dimensional neutral/alkaline agarose gel electrophoresis of the NS-1 resolution products Two identical D N A samples from the in vitro resolution assay were run on the same neutral 1.4% agarose gel as described above (section 2.11.1.). One lane was excised and immersed in alkaline electrophoresis buffer (50 mM NaOH, 1 mM EDTA) for 45 min. The gel lane equilibrated with alkaline buffer was then inserted into a depression in an alkaline 1.4% agarose gel and electrophoresed at 90° to the original direction of electrophoresis. Both the neutral and alkaline agarose gels were dried and exposed to X-ray film. The procedure for alkaline agarose gel electrophoresis is essentially as that described in Sambrook et al (1989). 2.11.3. Quantitation of NS-1 resolution products 70 NS-1 resolution products were separated on a 1.4% agarose gel and transferred to a nylon membrane (Genescreen plus^M^ Dupont) using a vacuum blotter (LKB). A 32P-labeled DNA probe was prepared with random D N A primers (Pharmacia). The DNA probe corresponded to the Styl (nt 140) to PstI (nt 411) sites in the dimer bridge. After hybridization, the membrane was washed at high stringency (O.lxSSPE, 0.1% SDS, 70°C) and exposed to X-ray film. Results were quantitated by densitometry. (A phophorimager was not available when this quantitation was done.) 2.11.4. Immunoprecipitation. pQLDBl was incubated with LA9 extract and Sf9 extract containing NS-1 in a 25 ul standard resolution reaction mixture as described in section 2.11.1. Following incubation, 6 ul of 10% SDS and 1 ul of 0.5M EDTA were added. The mixture was then incubated for 30 min at 60°C to disassociate any proteins not covalently bound to DNA. Subsequently, 200 ul of 50 mM Tris HC1 (pH 8.0) were added to dilute the mixture followed by 9 ul of rabbit polyclonal antibodies against NS-1 (a gift of Dr. E. Faust, McGill University). The resulting mixtures were incubated at 4°C for 3 hrs. Subsequently, 50 ul of formalin-fixed Staphylococcus aureus (10%) (Boehringer-Mannheim, Mannheim, Germany) which had been washed with RIPA buffer (50 mM Tris HC1 pH8.0, 0.1% SDS, 0.5% DOC, 1.0% NP-40 and 150 mM NaCl) were added. The mixture was incubated at 4°C for about 12 hrs. The immunoprecipitates were pelleted and washed three times using 500 ul of RIPA buffer each time. The pellet from the RIPA buffer washing was then washed using 500 pi of 1 X Reaction buffer 2 from BRL, resuspended in 10 JLXI of 1 X Reaction buffer 2 from BRL, digested with Pstl/PvuII and centrifuged. The resulting 71 supernatant which is supposed to contain bands 1, 3, 4, 5 and 6 if NS-1 is covalently bound to bands 2 and 7 was electrophoresed on a 1% neutral agarose gel (Fig. 22, lane 3). The resulting pellet which is supposed to contain bands 2 and 7 if NS-1 is covalently bound to bands 2 and 7 was resuspended in 10 (0.1 of 1 X Reaction buffer 2 from BRL, digested with proteinase K and centrifuged to remove the residual bacteria. The resulting supernatant which is supposed to contain bands 2 and 7 was also electrophoresed (Fig. 22, lane 4). As a control, a mouse monoclonal antibody against bovine rhodopsin (a gift of Dr. Molday, UBC) was also used to do the immunoprecipitation experiment described above. However, only the supernatant after proteinase K digestion and centrifugation was electrophoresed in lane 1 of Fig. 22 and the supernatant after restriction enzyme digestion and centrifugation is not shown. 2.12. Nicking assay of A-half or B-half clones of the dimer bridge 2.12.1. Analysis of nicked products on alkaline agarose gels Two jig of plasmid D N A containing wildtype or mutant half dimer bridge molecules was linearized by digestion with Sspl (one site present in the pUC sequences) and 3'-end labelled by an exchange reaction using a - 3 2 PdATP and T4 D N A polymerase. The linearized and labelled plasmid was incubated for one hour with 9 pi of LA9 cellular extract and 2 pi of purified NS-1(~200 ng) in the same buffer (25 pi) for the resolution assay (section 2.11.1.). The reaction was then digested with proteinase K (28 pg/ml), extracted with p h e n o l / C H C l 3 and precipitated with ethanol. The D N A pellet was redissolved in alkaline loading buffer (50 mM NaOH, 1 mM EDTA and 10% 72 glucose), loaded onto an alkaline agarose gel (1%), and run for 7 hr at 30V (Sambrook et ah, 1989). After electrophoresis, the gel was dried and exposed to X-ray film or analyzed using a phosphorimager (Molecular Dynamics). 2.12.2. Determination of the nicking efficiency of B-half dimer bridge mutants Sspl digested plasmid D N A (2 ug, unlabelled) was used in the nicking assay described above. After electrophoresis, the D N A was transferred to a nylon membrane (Genescreen p l u s ™ , DuPont) and hybridized with the labelled smaller SspI/EcoRI DNA fragment from pUC19. The membrane was washed and the amount of probe hybridized was quantitated using a phosphorimager. 2.13. Binding of a host cell protein(s) to the HFBR: gel mobility shift assays. The substrate for gel mobility shift assays used to detect binding of a host factor(s) to the B-half dimer bridge was a ~60 bp fragment obtained by digesting plasmid pUCWT with EcoRI/Hindlll. The competitor D N A used was obtained by digesting plasmids pUCWT, pUCC4A, pUCG14A or pUCC4AG14A with PvuII. LA9 cellular extract (2 uT) in 25 |il of binding buffer (10 mM Tris HC1, pH 7.5; 50 mM NaCl, 1 mM DTT, 5% glycerol, and 0.2 ug/ul salmon sperm DNA) was incubated at room temperature for 10 min in the presence or absence of competitor DNA followed by the addition of 1 pi (1 ng/ul) end labelled probe. The incubation was continued at room temperature for an additional 30 min, loaded onto a pre-run polyacrylamide 73 gel (4% in 0.5 x TBE and 0.5% glycerol) and electrophoresed for 2.5 hrs at 150V. The running buffer was the same buffer used to cast the gel. The gel was dried and analyzed using a phosphorimager. 2.14. Competition nicking assay The competition nicking assay was performed as described above (section 2.12.1.) except different amounts of competitor D N A fragment were added to the assay tubes before the incubation for nicking. 74 in. Results 3.1. Predicted products from in vitro resolution of the cloned wildtype dimer bridge The plasmid pQLDBl contains the dimer bridge which is the junction fragment of MVMp dimer RF. It comprises the Pst I site (nt 411) on the left of the junction to the Alul site (nt 408) on the right of the junction (see Materials and Methods, section 2.7.1.). The total length of the cloned junction in pQLDBl is ~700 bp. The dimer bridge clone is identical in sequence to the one in the dimer RF except both Ncol sites (nt 259) were destroyed (indicated by square brackets) during construction of the clone. The orientation of the insert in relation to restriction sites used during the cloning is illustrated in Fig. 13A. Resolution of this dimer bridge according to the Modified Rolling Hairpin Model is predicted to result in a D N A molecule illustrated in Fig. 18A. Subsequent restriction with PstI and PvuII should generate four fragments, a 514 bp extended fragment, a 353 bp turn-around fragment, and 193 bp and 2350 bp linear fragments derived from the vector, pUC19 (Fig. 18B). 3.2. In vitro resolution of the wildtype dimer bridge clone, p Q L D B l , in the presence or absence of recombinant NS-1 3.2.1. Analysis of resolution products on one-dimensional agarose gel To test for in vitro resolution of the wildtype dimer bridge, pQLDBl was incubated with Sf9 cytoplasmic extracts containing NS-1, LA9 replication extract, a-32pdATP and other components as described in Materials & 75 A: Styl [Ncol] Styl [Ncol] [Alul] EcoRI PvuII B : A G A A G TC TTC PstI Pvu II Pst I PvuII 353 bp turn-around form 514 bp extended form 193 bp vector fragment Pvu II PvuII 2350 bp vector fragment Fig. 18. The predicted resolution products of p Q L D B l . Relevant restriction sites are illustrated. Restriction sites in square brackets are sites which were destroyed during construction of pQLDBl. The black circle indicates NS-1 covalently bound to the 5'-end of the extended end of the resolved dimer bridge. A. shows the structure of the resolved pQLDBl after incubation with NS-1 and LA9 extracts. B. shows the four DNA fragments from the Pstl/PvuII digestion of the resolved pQLDBl shown in A. The sizes of the fragments are indicated, (not drawn to scale) 76 Methods (section 2.11.). The LA9 replication extract can provide D N A polymerase and some other essential proteins for the resolution of the dimer bridge. It is also believed that pQLDBl can be labelled through random nick translation in the presence of LA9 extracts and oc-32pdATP. As shown in Fig. 19, in the presence of Sf9 cytoplasmic extract containing NS-1, seven labelled fragments were detected (Fig. 19, +NS-1 lane). Fragments 1 to 4 correspond in size to the predicted fragments described in the previous paragraph (Fig. 18B) if resolution is as described in the M R H M (Fig. 10). In order of decreasing size: band 1 corresponds to the 2350 bp vector fragment; band 2 to the 514 bp extended fragment; band 3 to the 353 bp turn-around fragment; and band 4 to the 193 bp fragment from the vector. Fragment 5 is the correct length (810 bp) for the unresolved PstI to PvuII fragment containing the unresolved dimer bridge due to excess input plasmid. However, bands 6 and 7 are not predicted. Since the dimer bridge is a palindrome sequence, it is believed that a cruciform structure (see text illustrated below) can form and subsequently recombination (indicated in the illustration) occurs due to the presence of recombination enzymes in the LA9 or Sf9 cellular extracts. After recombination, pQLDBl becomes a linearized D N A molecule with two turn-around form ends (see text illustration below). Subsequent digestion of this D N A molecule could produce four D N A fragments three of which are the same as bands 1 (vector DNA), 3 (turn-around form) and 4 (vector DNA) (Fig. 19) from the resolution of the dimer bridge. The fourth band would be a turn-around fragment corresponding in size to band 6 (455 bp). 77 Fig. 19. In vitro resolution of the wildtype dimer bridge clone, p Q L D B l , in the presence of recombinant NS-1. Plasmid pQLDBl which contains the wildtype dimer bridge sequence was incubated with mouse LA9 extract plus insect cell extract from cells infected with the wildtype baculovirus or recombinant virus, AcNS-1. The products of the resolution assay were digested with proteinase K, then with PstI and PvuII, and analysed on a 1.4% agarose gel as described in the Methods. The outer lanes (+NS-1, duplicate experiments) display the four bands expected from resolution, labelled 1-4. (See Fig. 18 an for explanation of these bands.) The additional bands are 5 (810 bp) corresponding to the unresolved junction fragment, and bands 6 (455 bp) and 7 (411 bp) which correspond, respectively, to a turn-around form and extended form if initiation of resolution begins at nick site #2 (Fig. 10). The middle lane (minus NS-1) contains band 3 and 6 which can also arise by recombination (see Text for details). £ co 2 Z z + • + m a r k e r s 2370 1600 1000 540 409 235 166 1 (2350 bp) 5 (810 bp) 2 (514 bp] 6 (455 bp 3 (353 bp) - 4 (193 bp) 79 6* recombination Band 7 (detected at a very low level but seen more clearly in Fig. 20) corresponds to the extended fragment of 411 bp if resolution initiates with NS-1 nicking at nick site #2 (NB, I now believe the actual resolution procedure of the dimer bridge is likely not as described in M R H M and the production of band 7 is likely not from NS-1 nicking at nick site # 2; see Discussion part of the thesis), contrary to the procedure described in the M R H M . The corresponding turn-around form is identical to band 6 which also arises from recombination as stated earlier. The relative intensities of the extended forms (Fig. 19, compare bands 2 and 7) is consistent with the hypothesis that resolution of the dimer bridge is asymmetric as predicted by the Modified Rolling Hairpin Model. (NB, this autoradiograph was deliberately overexposed in order to determine whether band 7 can be detected.) In the absence of NS-1, bands 2 and 7 were not detected (Fig. 19, middle lane), indicating that resolution of the dimer bridge requires NS-1. There is a high background in Fig. 19 which appears to include a few discrete weaker bands. This background is likely due to random nicking/cutting of the DNA in the presence of the crude LA9 and Sf9 extracts while the weaker bands may be due to partial restriction enzyme digests as 80 well as intermediates of the NS-1 resolution process which we have not yet characterized. Since the dimer replicative form of MVMp is a linear D N A molecule, linearized pQLDBl was also used in the resolution assay. The same conclusion about the resolution products of the dimer bridge (data not shown) was reached as when the circular pQLDBl was used as the substrate. In the in vitro resolution assays described above and below, crude Sf9 cytoplasmic extracts containing NS-1 instead of purified NS-1 was used. This is because NS-1 purified according to the older lengthier method described by Wilson et al. (1991) is not active in the resolution assay although it does have demonstrable helicase and ATPase activities. Later a modified purification method (see Materials and Methods) was used and highly purified NS-1 was obtained. This highly purified NS-1 is active for the resolution of the dimer bridge and the resolution products (data not shown) were the same as when the crude Sf9 cytoplasmic extracts containing NS-1 were used. 3.2.2. Quantitation of resolution products by Southern blotting When the Sf9 cytoplasmic extract containing no NS-1 is used in the resolution assay, apparent recombination of the dimer bridge occurs (bands 3 and 6 in the middle lane of Fig. 19). As described above, in the +NS-1 lane, band 3 is believed to result from NS-1 resolution as well as from recombination and band 6 is believed to result from a minor NS-1 resolution procedure (initiating nick at site # 2) as well as from recombination. If this is true, the following relationships should be observed: 1) the amount of D N A in band 3 of the +NS-1 lane should be greater than that of band 3 in the -NS-1 lane; 2) the amount of DNA in band 6 subtracted by the amount in band 7 81 (both in the +NS-1 lane) should be equal to the amount of D N A in band 6 in the -NS1 lane; 3) In the +NS-1 lane, the amount of D N A in band 3 should be equal to band 2 plus band 6 minus the amount of DNA in band 7. In the experiments illustrated in Fig. 19, these quantative relationships cannot be determined because the intensity of the bands in the + NS-1 lane is greater than the intensity of the corresponding bands in the -NS-1 lane, probably due to the helicase activity of NS-1 and also because the random nick translation labelling used in the resolution assay results in longer D N A molecules incorporating more radiolabel. Therefore, a Southern blot analysis of the resolution products of the dimer bridge was used for quantitation (Fig. 20). I carried out a resolution assay in the absence of a - 3 2 P d A T P , separated the products by electrophoresis, and probed the gel with a fragment of D N A that detects resolution products (Fig. 20). Quantitation of bands 2, 3, 6 and 7 by densitometry revealed the quantitative relationships described above except that the intensity of band 6 (+NS-1 lane) subtracted by the intensity of band 7 (+NS-1 lane) is significantly greater than that of band 6 in the -NS-1 lane. These observations show that the ratio between the two NS-1 resolution products (the turn-around form and the extended form shown in Fig. 10) is approximately 1 : 1 while the exception noted above suggests that recombination in the presence of Sf9 cytoplasmic extract containing NS-1 is enhanced over that of Sf9 cytoplasmic extract not containing NS-1. It would be interesting if NS-1 does indeed contribute to the recombination event (see the Discussion). Based on the intensity of band 2 relative to the unresolved band 5, the resolution efficiency in this in vitro assay is -5-10%. In this Southern blotting analysis, the Pstl/Styl fragment from the dimer bridge was labelled as the probe. This fragment was not expected to CO Z 2 CO 50 Z Z - 1 (2300 bp) • _ 5 (810 bp) 2 (514 bp] 6 (455 bp 7 (411 bp 3 (353 bp - 4 (193 bp) Fig. 20. Southern blot analysis of pQLDBl resolution products The reso lut ion assay of p Q L D B l was done i n the absence of oc -32pdATP. The P s t l / P v u I I d iges ted r e s o l u t i o n p r o d u c t s w e r e r u n o n a n e u t r a l agarose g e l , t r a n s f e r r e d to a n y l o n m e m b r a n e a n d then p r o b e d w i t h the l a b e l l e d S t y l / P s t I f r a g m e n t f r o m the M V M p d i m e r b r i d g e . The a m o u n t of D N A i n each lane w a s quant i tated b y densitometry. 83 detect band 1 since band 1 is from the pUC19 vector DNA. Computer analysis indicated that the Pstl/Styl fragment from the dimer bridge has no apparent homology to the vector DNA. Since the Pstl/Styl fragment for the probe was isolated from an agarose gel after Pstl/Styl digestion of pQLDBl , it seems possible that the isolated PstI/Styl fragment may be contaminated with a trace amount of vector DNA. However, even if this is the case, the contamination is likely minor and should not interfere with the quantitation of bands 2, 6, 7 and 3 as band 4 (Vector DNA) is not visible and also in the -NS-1 lane band 6 containing vector sequence has the same intensity as band 3 not containing vector DNA. Also the intensity of the unresolved dimer bridge (band 5) is much greater than the vector sequence (band 1). In the +NS-1 lanes (Fig. 20), there is a minor band between band 5 and band 1. This band has not been characterized. In the left -NS-1 lane, the minor band above band 1 or band 5 is likely from partial restriction enzyme digestion. 3.2.3. Two-dimensional neutral/alkaline gel electrophoresis to characterize extended and turn-around forms In order to confirm the structure of the extended and turn-around species, resolution products were separated first under neutral conditions followed by alkaline gel electrophoresis to denature the strands (Fig. 21). The radioactive spots 1, 5 and 2 which are on a diagonal correspond with the 2350 bp band 1, 810 bp band 5 and 514 bp band 2 in Fig. 19. From the sizes of the denatured D N A of these spots on the denaturing gel, it can be concluded that the corresponding bands are extended forms. Spots 3 and 6 which are seen on the lower concave diagonal correspond to the 353 bp band 3 and 455 bp band 6 84 S E C O N D D I M E N S I O N 30 H 2 W z 0 4 I I I I I V O O E Fig. 21. Two-dimensional neutral/alkaline agarose gel electrophoresis analysis of resolution products from the wildtype dimer bridge plasmid, pQLDBl. The products of a standard resolution assay were analyzed on a neutral gel i n the first dimension and on a denaturing gel i n the second dimension as described i n the Methods. The spots which correspond wi th the bands i n Fig. 19 are numbered. The two spots 3 and 6 migrate more s lowly in the second direction confirming that they are turn-around forms. A possible explanation of spot X is provided in the Discussion. 8 5 (Fig. 19) and migrate as ~700 nt and ~910 nt long fragments, respectively. Therefore, bands 3 and 6 are turn-around forms. The continuous line of fragments generated by linear and turnaround forms likely result from random nicking/cutting of the substrate D N A due to nuclease activities in the crude extracts. One spot labelled as " X " migrated faster than expected for a linear single-stranded D N A fragment (see Discussion for possible explanation). 3.2.4. Immunoprecipitation to show that NS-1 is covalently bound to the extended form resolution product of the dimer bridge. The M R H M predicts that NS-1 is covalently bound to the extended form resolution product of the dimer bridge (Fig. 10). In order to confirm this, an immunoprecipitation experiment was done using polyclonal antibodies against NS-1. (These antibodies are called SDP-2.) Lanes 3 and 4 of Fig. 22 are supernatants after RE digestion and proteinase K digestion, respectively, (see section 2.11.4) when SDP-2 was used. Lane 1 of Fig. 22 is the supernatant after proteinase K digestion when a control monoclonal antibody against bovine rhodopsin was used for the immunoprecipitation (the supernatant after RE digestion is not shown in this figure). Lane 2 shows the resolution products of pQLDBl. The presence of band 2 in lane 4 of Fig. 22 indicates that SDP-2 preferentially binds to the extended form resolution product (band 2). It is further believed that the association of NS-1 and band 2 is covalent because the resolution products of the dimer bridge were treated in relatively high concentration (2%) of SDS at 60°C for 30 min before the addition of antibodies. 86 Fig. 22. The extended form resolution product is covalently bound to NS-1. The resolution products of pQLDBl were incubated in 2% SDS at 60°C for 30 min (see section 2.11.4.) and diluted using 50 mM Tris HC1 buffer (pH8.0). Rabbit polyclonal antibody to NS-1, SDP-2, was added. After incubation for 3 hrs, fixed S. aureus bacteria were added and incubated for about 12 hrs to precipitate the antibodies. The pellet was washed and redissolved into 1 X Reaction buffer from BRL in order to digest the D N A with Pstl/PvuII digestion. After the digestion, the reaction mixture was centrifuged. The supernatant was loaded onto a neutral agarose gel (lane 3). The pellet was digested with proteinase K, and centrifuged to remove the residual bacteria. The resulting supernatant was also loaded on the gel (lane 4). As a control, a mouse monoclonal antibody against bovine rhodopsin was used to do the experiment described above and the resulting supernatant after proteinase K digestion and centrifugation was loaded on the gel (lane 1). Standard resolution products of pQLDBl were also electrophoresed (lane 2) to serve as markers. * • if — band 1 — band 5 band 2 band 6 band 7 band 3 — band 4 3 4 Fig. 22 88 That band 5 occurs in lane 3 and very weak band 1 and band 5 occur in lane 4 is probably due to nonspecific binding of D N A with fixed Staphylococcus aureus or/and SDP-2. That bands 3, 4 and 6 do not occur in lane 3 and band 7 does not occur in lane 4 is believed due to their relatively low intensities. I do not think the presence of band 2 in lane 4 is due to nonspecific binding of D N A with fixed bacteria or/and SDP-2 because the intensity of band 2 in lane 4 is apparently higher than the intensities of band 1 and band 5 in the same lane. In lane 2, it is clear that the intensity of band 2 is lower than that of band 1 and is similar to that of band 5. It should be mentioned that a pre-immune serum rather than the monoclonal antibody against bovine rhodopsin is the best control for this immunoprecipitation experiment. Unfortunately, when this experiment was done no pre-immune serum was available. It is known that S. aureus precipitates mouse IgG2A, 2B, 3 and 1 with lower efficiency than rabbit IgG's. 3.3 . Resolution of mutant dimer bridge clones We tested the mutant dimer bridge clones, pQLDB2, pQLDB3 and pQLDB4, for in vitro resolution in order to determine if sequences within the dimer bridge affect the site of initiation of resolution and hence provide information about the resolution procedure of the dimer bridge. Previously it had been predicted that the "bubble" in the stem of 3'-end hairpin (Fig. 4) may provide the sequence asymmetry that is recognized during resolution of the dimer bridge. This asymmetry was predicted to result in initiation of resolution predominantly at nick site # 1 (Fig. 10) and consequently conservation of the unique sequence at the left end of the viral and RF DNAs (Astell et al, 1985). 89 To test these predictions, pQLDB2 was designed to comprise a dimer bridge in which ^ ® is mutated to ^ (Fig. 13B), and assayed for in vitro resolution (Fig. 23, lane 4). Although band 2 is slightly reduced and band 7 increased relative to their intensities generated with pQLDBl (Fig. 23, lane 1), overall pQLDB2 is resolved with approximately the same efficiency as p Q L D B l . (This result was unexpected because according to the M R H M , pQLDB2 does not have the recognition motif ( ^ ® ) required for nicking to occur at site # 1 and was predicted not to be resolved.) In the second mutant dimer bridge clone, pQLDB3, the 10 bp sequence surrounding the putative nick site # 1 was altered by inverting the sequence (Fig. 13C). Relative to the wildtype pQLDBl, resolution products of pQLDB3 (Fig. 23, lane 3) reveal that the intensity of band 2 is decreased slightly and band 7 is increased. This is also a surprising result because according to the M R H M , mutation of nick site # 1 was predicted to block resolution of the dimer bridge, assuming there is sequence specificity for nicking to occur. For the third mutant dimer bridge clone, pQLDB4, which contains the same mutant dimer bridge except a 2 bp deletion as pQLDB2 (Fig. 13D), the orientation of the mutant dimer bridge in the pUC19 vector is reversed from that of pQLDBl , pQLDB2 and pQLDB3: Hence band 7 in lane 2 (Fig. 23) corresponds to the extended form if resolution initiates at nick site #1 and band 2 corresponds to the extended form if resolution initiates at nick site #2. From the results shown in lane 2, it can be concluded that pQLDB4 is also resolved approximately as well as the wildtype dimer bridge clone. Also, comparing lane 2 (pQLDB4) with lane 4 (pQLDB2), it is clear that band 2 of lane 2 is weaker than band 7 of lane 4, suggesting that NS-1 may recognize 90 Fig. 23. Resolution products of the mutant dimer bridges. Plasmids pQLDB2 (lane 4), pQLDB3 (lane 3), and pQLDB4 (lane 2) which contain minor sequence changes within the dimer bridge are all resolved approximately as efficiently as the wildtype dimer bridge, pQLDBl (lane 1). Note that the orientation of dimer bridge in plasmid pQLDB4 is opposite to that of the other plasmids, hence the turn-around and extended form resolution products from resolution initiating at putative nick site #1 of pQLDB4 are, respectively, bands 6 and 7, while the turn-around and extended form products from resolution initiating at nick site #2 are, respectively, bands 3 and 2. 91 1 2 3 4 Fig. 23 92 both the bubble asymmetry and the distance between the bubble and the nick site. According to the MRHM, I predicted that pQLDB4 could not be resolved or at least resolution would be severely impaired. Two dimensional gel electrophoresis of the resolution products from pQLDB2, pQLDB3 and pQLDB4 revealed that bands 2, 7,1 and 4 are extended forms, and bands 3 and 6 are turn-around forms (Fig. 24) as was the case for pQLDBl. The resolution results of these three dimer bridge mutants strongly suggest that the resolution procedure of the dimer bridge as described in the M R H M is likely incorrect (see Discussion). 3.4. The B-half of the dimer bridge is nicked with recombinant NS-1 and replication extract from mouse LA9 cells 3.4.1. The B-half (and not the A-half) of the dimer bridge undergoes site-specific nicking in the presence of recombinant NS-1. It has been reported that NS-1 can nick the B-half but not the A-half (see Fig. 14) of the MVMp dimer bridge (Cotmore and Tattersall, 1994). In order to confirm this observation, I constructed similar half dimer bridge clones and both the B-half and A-half clones were tested in the nicking assay. If the B-half clone, pQLB, is nicked as reported previously, NS-1 should nick the lower strand at a relatively specific site about 50 bp from the [BssHII] site (Fig. 15A) and produce a radioactive fragment corresponding to ~650 nucleotides. In addition, a ~3040 nt labelled fragment should be detected (Fig. 25A). The 3040 nt band consists of the end labelled upper strand (not nicked) and any non-nicked lower strand, while the 650 nt fragment is the labelled fragment from the nicked lower strand. (The ~2390 nt fragment from the 93 Fig. 24. Two-dimensional neutral/alkaline agarose gel electrophoresis analysis of resolution products from the mutant dimer bridge plasmids. The products of standard resolution assays of mutant dimer bridge plasmids were analyzed, respectively, on a neutral gel in the first dimension and on a denaturing gel in the second dimension as described in the Methods. The spots which correspond with the bands in Fig. 23 are numbered. A is pQLDB2. B is pQLDB3 and C is pQLDB4. In B, there are two small arrows which indicate the positions of two weak spots there. These two spots are visible on the X-ray film. See Discussion for a possible explanation of these products. 95 Sspl Fig. 25. The B-half of the dimer bridge is nicked by crude recombinant NS-1 but the A-half is not nicked. A . T h e schemat ic d i a g r a m of the e n d - l a b e l l e d a n d l i n e a r i z e d p Q L B w h i c h is n i c k e d at a specif ic site. B. L a b e l l e d D N A (lanes 1 a n d 2 for p Q L B , lanes 3 a n d 4 for p Q L A ) w a s incubated w i t h L A 9 extract i n the presence (lanes 2 a n d 4) or absence (lanes 1 a n d 3) of crude N S - 1 extract. The D N A samples were d iges ted w i t h proteinase K , prec ip i ta ted , a n d a n a l y z e d o n a d e n a t u r i n g agarose gel . The d r i e d gel was exposed to X - r a y f i l m to detect the p r o d u c t of the n i c k i n g react ion . N B : p Q L B a n d p Q L A were a n a l y z e d o n d i f ferent gels a n d the results c o m b i n e d i n this f igure . Sspl * — nick site B 1 2 3 4 96 lower strand is not labelled, hence, not detected in the assay.) For the A-half clone, pQLA, one band (~3040 nt) should be seen if it is not nicked. The observed products obtained using the B-half (Fig. 25B, lane 2) and A-half (Fig. 25B, lane 4) dimer bridge clones were as predicted, confirming the previous observations (Cotmore and Tattersall, 1994). In addition to the predicted fragments, a larger unexpected band X was also observed in all 4 lanes. This band is not present in input labelled D N A (data not shown) nor is it due to the presence of the NS-l-containing Sf9 extract as it is also seen with just LA9 cellular extract (Fig. 25B, lanes 1 and 3). When LA9 extract is incubated in the nicking reaction mixture in the presence of a-32pdATP but in the absence of plasmid DNA, band X did not appear on the gel, suggesting that it is not from the LA9 extract but from the plasmid. When the nicking assay products were detected by Southern blotting using radiolabeled plasmid DNA as the probe, this band was detected only after extensive overexposure of the phosphoimager screen (data not shown). (In Fig. 27 which is a Southern blot result without overexposure, band X is not detected.) When the plasmid was digested with Sspl and linearized plasmid D N A isolated from a gel and used as the substrate for nicking assay, band X was still apparent. Based on the experiments described in this paragraph, it seems possible that band X may be the ligation product of the linearized plasmid in the presence of LA9 extract. That band X could not be easily detected by Southern blotting is likely due to the very low levels of this molecule generated in the nicking assay. 3.4.2. Mouse LA9 replication extract is required for nicking of the B -half of the dimer bridge 97 In order to determine if host factor(s) is required for nicking of the B-half of the dimer bridge by NS-1, the nicking assay was carried out using immunoaffinity purified NS-1 in the presence or absence of LA9 cellular extract (Fig. 26A). In the absence of LA9 extract, the B-half of the dimer bridge is not nicked by purified NS-1 (Fig. 26A, lane 1) indicating that a host cellular factor(s) is required for nicking. When both purified recombinant NS-1 and LA9 extract are present, the 650 nt product of the nicking assay is readily seen (lanes 2 and 3, duplicate experiments). Using the conditions of this assay, based on the radioactivity in the 650 nt band, approximately 50% of the substrate is nicked. The purified NS-1 used in the nicking assays described above was obtained using a modified purification procedure (see Materials and Methods). SDS-PAGE analysis of this immunoaffinity purified NS-1 revealed a major band of ~83 kDa and a minor band of lower molecular weight (Fig. 26B). Western blot analysis using a monoclonal antibody against NS-1 indicated that the major band is NS-1 and the minor band is not a degradation product of NS-1 (Liu and Astell, data not shown). It is ofcourse better to use purer NS-1 to do the nicking assay described above. But it will be a big effort to get purer NS-1 which is active for nicking since lengthier purification procedure seems to inactivate NS-1 as mentioned in section 3.2.1.. 3.5. Identification of nucleotides important for site-specific nicking: two CG motifs within the B-half of the dimer bridge. Since it has been shown that NS-1 can bind to the A C C A A C C A sequence of the B-half of the dimer bridge and a mutation in the adjacent 1 2 3 3040 nt 650 nt m a r k e r s -97 .4 K d -68 .0 K d -43 .0 K d -29 .0 K d -18.4 K d — -14.3 K d Fig. 26. Nicking of pQLB with purified recombinant NS -1 requires LA9 cellular extract. A . pQLB was linearized by digestion with Sspl and end-labelled with T4 D N A polymerase. The labelled D N A was incubated with immunoaffinity purified recombinant NS-1 in the absence (lane 1) or presence (lanes 2 and 3) of LA9 cellular extract. The samples were analyzed as described in Fig. 25. B. SDS-PAGE analysis of the purified NS-1 using immunoaffinity column (see Methods). 99 region of the CG basepair in position 4 (Fig. 16B) to an A T basepair can significantly decrease the nicking efficiency of the B-half, it was suggested that host cell activating transcription factor (ATF) may be important for nicking (Cotmore et al, 1995a). In order to test this idea, I decided to determine which nucleotides in the region [subsequently referred to as the putative host factor(s) binding region (HFBR)] adjacent to the NS-1 binding site are important in the nicking reaction. Thus, a series of B-half mutants were constructed and the nicking efficiency of each was determined. When the ATF binding site 1 (Fig. 15B) was deleted, the nicking efficiency of this mutant, pQLBWT13 (Fig. 16), increased by 25% compared with pQLB (Fig. 27A, lanes 1 and 2). This observation suggests that the ATF binding site 1 is not required for nicking. Gel mobility shift assays using LA9 extract indicated that murine host factor(s) (possibly ATF) can bind to site 1, although the affinity is relatively weak (data not shown). If host cell ATF does bind to site 1, it may partially block access to the B half of the dimer bridge to other host factor(s) and thus inhibit nicking of pQLB. When both ATF binding sites are deleted from mutant pQLBDEL, the D N A is not nicked (Fig. 27A, lane 10). This observation implies that nucleotides in ATF site 2 are required for nicking. When each of the five nucleotides (CGTCA) of ATF site 2 were mutated, the nicking efficiency was reduced to less than wildtype nicking efficiency: pQLBC4A (5% of wildtype), pQLBG5A (10% of wildtype), pQLBT6C (60% of wildtype), pQLBCTT (80% of wildtype), and pQLBA8G (80% of wild-type). These results suggest that C4 and G5 of ATF site 2 are considerably more important than the other three positions and imply that ATF, which recognizes a CGTCA motif (Nichols et al, 1992), is unlikely the host factor required for nicking. When nucleotides 9 through 20 of the putative HFBR were mutated 100 A B C i t t t t t f f t t t f t t i t t t • • • • • « !!!"M!' HK'Ul.!! -1 2 3 4 5 6 7 8 9 1 0 1 2 3 4 5 6 7 8 1 2 3 4 5 N » e « o © « © vo © e © r~ <*< v> © o e o ' t g - s e » i » o O © oe <s M ~ - >r> ~ o — o d o © o O « o - . © © ^ © © © . J Fig. 27. Determination of the nicking efficiency of mutants of the B-half dimer bridge. E a c h B-hal f clone w a s d iges ted w i t h S s p l (but not l a b e l l e d w i t h 3 2 P ) . T h e l i n e a r i z e d D N A s w e r e i n c u b a t e d w i t h L A 9 ext rac t a n d p u r i f i e d r e c o m b i n a n t N S - 1 . A f t e r p r o t e i n a s e K d i g e s t i o n , p h e n o l / c h l o r o f o r m extract ion a n d E t O H prec ip i ta t ion , the samples were l o a d e d onto a d e n a t u r i n g agarose gel a n d e lectrophoresed. The D N A o n the gel w a s t rans ferred to a n y l o n m e m b r a n e a n d p r o b e d w i t h the l a b e l l e d S s p I / E c o R I f r a g m e n t f r o m p U C 1 9 . The ~650 nt f ragment w a s quanti tated u s i n g a p h o s p h o r i m a g e r . The data at the b o t t o m of each p a n e l ind ica te the n i c k i n g e f f i c i e n c y f o r each p l a s m i d r e l a t i v e to p Q L B W T 1 3 w h i c h is g i v e n a v a l u e of 1.0. In A , the p l a s m i d s a n a l y z e d were p Q L B ( w i l d t y p e ) , p Q L B W T 1 3 , p Q L B A 3 G , p Q L B C 4 A , p Q L B G 5 A , p Q L B T 6 C , p Q L B C 7 T , p Q L B A 8 G , p Q L B C 9 T a n d p Q L B D E L , r e s p e c t i v e l y . I n B, lanes 1 to 8 are p Q L B W T 1 3 , p Q L B T l O C , p Q L B T H C , p Q L B A 1 2 G , p Q L B C 1 3 T , p Q L B G 1 4 A , p Q L B T 1 5 C a n d p Q L B G 1 6 A , respect ively . I n C , lanes 1 to 5 are p Q L B W T 1 3 , p Q L B A 1 7 G , p Q L B A 1 8 G , p Q L B C 1 9 T a n d p Q L B A 2 0 G , respect ively . 101 one by one and tested for nicking efficiency, it was found that nucleotides T i l , C13, G14, A18 and A20 are also important for nicking. Nucleotides 18, 19, and 20 are protected by binding of NS-1 (Cotmore et al, 1995a), hence, the reduction in nicking efficiency due to mutation at nucleotides 18 and 20 is probably not due to impaired binding of host cell factor(s). Also, when nucleotide T i l is changed to C, this creates an E box (CANNTG) (Gu et al, 1995), hence, binding of the E box factor to this region may prevent binding of host cell factor(s) required for nicking. Therefore, only C13 and G14 are important for nicking (and hence binding of host cell factor(s)) within the region of nucleotides 9 through 20. Based on the nicking efficiencies of all the B-half mutants, it appears that two CG motifs (nt 4, 5 and 13, 14, Fig. 16B) are required for nicking and these sequences likely are important in binding of host factor(s). Also, these results suggest that ATF is not the host protein essential for nicking as it binds to the sequence CGTCA. 3.6. Gel mobility shift assays show that host cell factor(s) can bind to HFBR from wildtype DNA and binding to mutant D N A sequences is impaired The putative HFBR region (nucleotides 1 through 17, Fig. 16B) and three mutant HFBR sequences were cloned into pUC19. These plasmids are referred to as pUCWT (wildtype HFBR sequence), pUCC4A (C4 changed to A), pUCG14A (G14 changed to A), and pUCC4AG14A (C4 and G14 were both changed to A). The ~60 bp EcoRI/Hindlll fragment containing the wildtype sequence was the probe used in gel mobility shift assays in which competitor D N A containing the wildtype or mutant HFBR sequences was added at two 102 different levels (10-fold and 40-fold molar excess). In most lanes, three sequence-specific complexes (one major and two minor) were observed (Fig. 28). It is likely that the fastest migrating complex is formed with a proteolytic product of the factor that forms the major complex. The slowest migrating complex is present at a very low level and could be due to binding of additional protein(s) to the complex. When the wildtype competitor is used (lanes 6 and 7), most of the specific complexes do not form. When the single mutant competitor DNAs are used (G14A and C4A), the specific complexes are partially reduced relative to no competitor, while the double mutant (C4AG14A) has very little effect on formation of the complexes. These data support the earlier suggestion that both C G motifs within the HFBR are required for binding of host factor(s). 3.7. The DNA fragment containing the wildtype HFBR of the B-half of the bridge dimer can inhibit nicking: mutant HFBR sequences are less effective inhibitors. When the EcoRI/Hindlll fragments containing the HFBR sequence with wildtype or mutant CG motifs (from plasmids pUCWT, pUCC4A, pUCG14A, and pUCC4AG14A) as well as the EcoRI/Hindlll fragment from pUC19 were added, respectively, to a nicking assay mixture using pQLBWT13, it was observed that the wildtype HFBR strongly inhibits nicking (by 30% to 70%, depending on the concentration of the competitor) (Fig. 29, lanes 7 and 8). The competitor from pUCC4A or pUCG14A reduces nicking efficiency slightly (Fig. 29, lanes 9 to 12); however, the competitor D N A from pUC19 or pUCC4AG14A did not inhibit nicking (Fig. 29, lanes 3 to 6). These results provide further evidence that the unknown host factor(s) which binds to the 103 Fig. 28. Gel mobility shift assay of the HFBR fragment. L A 9 cellular extract was incubated at room temperature for 10 m i n in the absence (lanes 2 and 3) or presence (lanes 4 to 11) of competitor D N A s in 10- and 40-fold molar excess of the probe. The oc32p-labelled H F B R probe was then added and after a further 30 min incubation at room temperature, the samples were loaded onto a 4% polyacrylamide gel and electrophoresed. The gel was dried and analyzed using a phosphorimager. The radioactive probe was the E c o R I / H i n d l l l fragment from p U C W T . The competitor D N A s were the short PvuII fragments contained in p U C C 4 A G 1 4 A (lanes 4 and 5), p U C W T (lanes 6 and 7), p U C G 1 4 A (lanes 8 and 9) and p U C C 4 A (lanes 10 and 11). Lane 1 is the probe without L A 9 cellular extract. 104 p U C 1 9 C 4 A G 1 4 A W T G 1 4 A C 4 A i 1 i 1 i 1 1 1 1 1 0 0 4 2 0 4 2 0 4 2 0 4 2 0 4 20 molar fold excess 3040 nt 650 nt 1 2 3 4 5 6 7 8 9 1 0 1 1 1 2 Fig. 29. Competition nicking assay of pQLBWT13. Plasmid pQLBWT13 was digested w i t h Sspl and 3'-end labelled. The label led D N A was incubated w i t h L A 9 cellular extract and p u r i f i e d recombinant NS-1 i n the absence (lanes 1 and 2) or presence (lanes 3 to 12) of competitor D N A s . After incubation, the samples were analyzed as described i n F ig . 25. The competitor D N A s were the small E c o R I / H i n d l l l fragments from pUC19 (lanes 3 and 4), p U C C 4 A G 1 4 A (lanes 5 and 6), p U C W T (lanes 7 and 8), p U C G 1 4 A (lanes 9 and 10) and p U C C 4 A (lanes 11 and 12). 105 HFBR of the B-half of the dimer bridge is essential for nicking by NS-1. 3.8. The resolution assay of the wildtype dimer bridge clone, pQLDBl, using mutant recombinant NS-1. The plasmid pQLDBl was incubated with mouse LA9 replication extract and insect Sf9 cellular extract containing wildtype NS-1 (Fig. 30, lane 1), Tyrl88Phe mutant NS-1 (lane 2), Tyrl97Phe mutant NS-1 (lane 3), or Tyr210Phe mutant NS-1 (lane 4). Subsequently, DNA samples were treated as described in Methods, digested with PstI and PvuII, and loaded onto a neutral agarose gel. After electrophoresis the gel was dried and autoradiographed. From the results shown in Fig. 30, it appears that the Tyrl97Phe NS-1 mutant (but not Tyrl88Phe NS-1 mutant and Tyr210Phe NS-1 mutant) is active in resolution of the dimer bridge, suggesting that Tyrl88 and/or Tyr210 may be the candidate amino acid residue involved in the covalent linkage with D N A . When these three tyrosine NS-1 mutant proteins were used in the nicking assay of either the A-half dimer bridge or B-half dimer bridge, surprisingly, none was active for nicking (data not shown). See Discussion for the possible explanations. One point which should be mentioned here is that the NS-1 mutant, Tyrl97Phe, expressed in HeLa cells using the vaccinia virus vector was found not to be active for the resolution of the dimer bridge (Nuesch et al., 1995). It is not clear whether or not this is due to the His tag fused to the mutant NS-1 expressed in the HeLa cells inactivating the (His)6-NS-l (Tyrl97Phe) mutant protein. 106 Fig. 30. In vitro resolution of the wildtype dimer bridge clone, p Q L D B l , in the presence of mutant NS-1. Plasmid pQLDBl which contains the wildtype dimer bridge was incubated with mouse LA9 extract plus insect cell extracts containing the wildtype NS-1 (lane 1), Tyrl88Phe NS-1 mutant (lane 2), Tyrl97Phe NS-1 mutant (lane 3), or Tyr210Phe NS-1 mutant (lane 4), respectively. The products of the resolution assay were treated with proteinase K, digested with PstI and PvuII, and analysed on a 1.4% agarose gel as described in the Methods. 1 2 3 4 Fig. 30 108 IV. Discussion 4.1. The resolution products of the wildtype dimer bridge One-dimensional agarose gel electrophoresis of the resolution products of the wildtype dimer bridge has shown that the MVMp dimer bridge can be resolved, in vitro, by recombinant NS-1 (Fig. 19). The resolution products contain the predicted ones (bands 1, 2, 3 and 4) according to the modified rolling hairpin model (MRHM) (Astell et al, 1985) and also two bands not predicted (bands 6 and 7). Band 6 is thought to arise from recombination as well as a minor resolution process with the initiating nick occurring in the B-half (at nick site # 2) yielding band 7 and band 6. Hence, the results in Fig. 19 strongly support the dimer bridge resolution products predicted in the M R H M . Furthermore, characterization of extended form and turn-around form bands by 2-D gel electrophoresis (Fig. 21) proved the configuration of the resolution products. Result from the Southern blotting experiment (Fig. 20) confirmed that the ratio between the two NS-1 resolution products (the turn-around form and the extended form) is approximately 1 to 1. NS-1 has been shown to be covalently bound to the 5'-ends of the replicative form and single-stranded DNA of M V M (Cotmore and Tattersall, 1988). This observation supports the prediction of the M R H M that the extended form resolution product (ie, band 2) is covalently bound to NS-1. Immunoprecipitation with polyclonal antibodies against NS-1 indicated that band 2 can be preferentially precipitated arid the interaction of NS-1 with band 2 is likely covalent as the resolution products were treated at 60°C in a relatively high concentration of SDS (2%) prior to immunoprecipitation (Fig. 22). Therefore, all of these experimental results described above support the 109 predicted resolution products of the dimer bridge described by the M R H M . The same conclusion was reached by Cotmore et al. (1993) from Yale University who used a LA9 or Hela cellular replication extract and LA9 or Hela nuclear extract containing recombinant NS-1 expressed using a Vaccinia Virus expression vector. However, there are differences between the experimental data from this laboratory and that of the Yale group. The turn-around form described by the Yale laboratory corresponding to band 6 from our laboratory is minor in the presence of NS-1. In addition, they did not observe recombination when the dimer bridge was incubated with a cellular replication extract and nuclear extract without NS-1. Thus, the occurrence of a low level of recombination in the absence of NS-1 in our in vitro system is possibly due to enzymatic activities found in Sf9 cells. However, since the incorporation of radiolabel into plasmid D N A in the absence of NS-1 was much lower in the in vitro resolution system used by the other group, it is also possible that a low level of recombination actually occurred during the incubation of dimer bridge with cellular replication extract and nuclear extract without NS-1 but was not detected. This possibility is supported by the earlier observation that palindromic sequences do undergo recombination yielding two turn-around forms when incubated with a cellular replication extract and nuclear extract lacking NS-1 (Cotmore et al, 1992). Hence, in the presence of NS-1, band 6 observed more readily in our resolution system than in theirs is probably due to a higher level of recombination in our resolution system. As illustrated in Fig. 20, the Sf9 cytoplasmic extract containing NS-1 can increase the recombination compared with the Sf9 cytoplasmic extract lacking NS-1. There are two possible reasons for this increase. One is that the expression of NS-1 in Sf9 cells induces the expression of recombination 110 enzymes in Sf9 cells and another possibility is that NS-1 itself can somehow facilitate recombination. Ward and Berns (1991) have studied "rescue" of A A V sequences from AAV/pBR322 plasmids. This phenomenon requires the intact A A V terminal repeat sequences (TRS), in cis. These workers proposed excision occurs due to formation of a cruciform structure (Holliday recombination intermediate) which is resolved by recombination (see section 3.2.1.). The two products are linear duplex A A V D N A and pBR322 D N A with A A V TRS AAV f| (covalently closed) at each end ( P B R 3 2 2 and C ). I presume that a similar event occurs to give our recombinant turn-around products and propose that NS-1 enhances this reaction either directly or indirectly. The A A V rep protein binds preferentially to A A V ends in the hairpin form (Im and Muzyczka, 1990), hence, the rep protein may promote formation of Holliday junctions. To date, MVMp NS-1 has not been shown to bind to the hairpinned forms of either the left or right terminal regions although recently it has been shown to bind to the linear form of the left end (Cotmore et al, 1995). It seems likely that M V M p NS-1 can also bind preferentially to the hairpin form, as the rep protein does, and hence stimulate recombination. However, so far the conditions for this activity have not been observed. Further resolution assays using LA9 replication extract in the presence and absence of purified NS-1 are required to test whether NS-1 does contributes to the recombination event. 4.2. The resolution procedure of the dimer bridge I l l As mentioned in section 3.3., mutant dimer bridge clones pQLDB2, pQLDB3 and pQLDB4 were expected not to be resolved according to the resolution procedure of the dimer bridge proposed in the M R H M . However, they are resolved quite well. Furthermore, a major contradiction of the M R H M developed when it was shown that the B-half dimer bridge but not the A-half dimer bridge can be nicked by NS-1 (Cotmore and Tattersall, 1994; this thesis). Cotmore and Tattersall subsequently proposed a resolution procedure (Fig. 31) (Berns, 1996) different from that described by the M R H M . According to this model, NS-1 first nicks the B-half of the dimer bridge (Fig. 31, line 2) followed by the formation of a cruciform structure and displacement D N A synthesis. Unique about the displacement D N A synthesis is the replication complex is required to switch template strands (Fig. 31, line 3). After the displacement DNA synthesis is completed (Fig. 31, line 4), an asymmetric recombination occurs to yield the resolution products of the dimer bridge predicted by the MRHM (Fig. 31, line 5; Fig. 7, line 6). According to the resolution procedure shown in Fig. 31, the minor band 7 (extended form) observed in Fig. 19 is possibly due to a low level of symmetric recombination of the molecule shown in line 4 of Fig. 31. The D N A of spot" X " that I observed (Fig. 21) comigrates with the D N A of spot 5 in the first dimension (neutral gel) and has the same size as spot 2 in the second dimension (denaturing agarose gel). Hence, spot " X " corresponds in size to the D N A strand from the NS-1 nick site # 2 to the PvuII site if the dimer bridge is nicked at site # 2 but not resolved into the two products. A D N A strand from nick site # 2 to the PstI site is not detected in Fig. 21 probably because the resulting 3'-end after nicking at site # 2 is extended by D N A synthesis to various lengths. 112 3 ' i 5 t 3-| 5 i AG AG ^ A G ^ AAG AG TC 5' 3' 5' 3' AAG TTC Fig. 31. The resolution procedure of the dimer bridge proposed by Cotmore and Tattersall. The D N A molecule in line 1 represents the dimer bridge. In line 2 the dimer bridge is nicked within the B-half by NS-1 as illustrated. The black circle indicates covalently attached NS-1. In line 3 the dimer bridge assumes a cruciform structure and displacement DNA synthesis (indicated by the vertical arrow) occurs. The displacement DNA synthesis requires the polymerase to switch template strands as illustrated (line 3). The slanting dashed thin line indicates asymmetric recombination (line 4). and the two D N A molecules in line 5 are the two resolution products described in the M R H M . 113 The model shown in Fig. 31 can explain the resolution of pQLDB2, pQLDB3 and pQLDB4. Both pQLDB2 and pQLDB3 are resolved symmetrically (Fig. 23, lanes 4 and 3). The mutation of AAG into A G . in pQLDB2 likely T T C T C results in the substrate DNA having two potential nick sites. Both nick site # 2 and the mutated nick site # 1 of pQLDB3 seem to be nicked (This is revealed by the two arrows in panel B of Fig. 24). The symmetric resolution products of these two dimer bridge mutants can be explained by assuming that NS-1 nicks the two sites on the same plasmid, the two resulting 3'-ends are then extended through displacement D N A synthesis to form the two extended form resolution products (bands 2 and 7), and the recombination of the mutant dimer bridge produces the two turn-around form bands (3 and 6). The resolution products of pQLDB2 can also be explained by assuming that NS-1 nicks either one of the two nick sites followed by the formation of the cruciform structure, displacement DNA synthesis as described in Fig. 31 and then a symmetric or asymmetric recombination. The resolution procedure of pQLDB4 is probably the same as described in Fig. 31. NS-1 probably does not efficiently nick the mutant half of the dimer bridge in pQLDB4 because the deletion of nt 102 and 103 in the mutant half mutates the NS-1 binding site (ACCAACCA) (nt 95 -102) (Fig. 4). However, one very interesting observation is that the NS-1 tyrosine mutant, Tyrl97Phe, can resolve the dimer bridge (Fig. 30) but cannot nick both half dimer bridges (data not shown). This result cannot be explained with the resolution procedure shown in Fig. 31 and may suggest that the resolution procedure shown in Fig. 31 is not right. I would like to propose two resolution procedures shown in Fig. 32A and B. F i g . 3 2 B : 3'• 5 i 2 3 4 5 Fig. 32. The possible resolution procedures of the dimer bridge. A. A resolution procedure in which nicking occurs before recombination. The vertical arrows indicate displacement DNA synthesis. B. A resolution procedure in which recombination occurs before nicking. The vertical arrow points to the NS-1 nick site. The horizontal arrow indicates displacement D N A synthesis. For both A and B, the D N A molecule in line 1 is the dimer bridge. The two D N A molecules on the bottom line represent the resolution products predicted in M R H M . The slanting dashed line indicates asymmetric recombination. The filled black circle represents NS-1. 116 In Fig. 32A, the linear form of the dimer bridge (Fig. 32A, line 1) firstly becomes arranged into the cruciform configuration (Fig. 32A, line 2) which can be nicked (Fig. 32A, line 3) followed by displacement D N A synthesis (Fig. 32A, line 3) and asymmetric recombination (Fig. 32A, line 4) to form the two resolution products (Fig. 32A, line 5). In Fig. 32B, the dimer bridge (line 1) can undergo an asymmetric recombination first (Fig. 32B, line 2) to form two turn-around forms (Fig. 32B, line 3) one of which can be nicked by NS-1 followed by displacement D N A synthesis (Fig. 32B, line 4) to yield the extended form resolution product (Fig. 32B> line 5) and another one of which is the turn-around form resolution product. The major difference between the resolution procedures shown in Fig. 32 and Fig. 31 is that in Fig. 32, one hairpin of the cruciform dimer bridge or one turn-around form from the asymmetric recombination instead of the extended form dimer bridge (Fig. 31, line 1) is the substrate for nicking. To test the resolution procedure in Fig. 32, turn-around form DNA substrate needs to be prepared to do the NS-1 nicking assay. Based on Fig. 32, the reason for NS-1 tyrl97 mutant protein to resolve the dimer bridge but not to nick both half dimer bridges may be that NS-1 tyrl97 mutant protein nicks hairpins of the cruciform dimer bridge (Fig. 32A, line 2) or turn-around forms from the asymmetric recombination (Fig. 32B, line 3). Furthermore, the resolution procedures proposed in Fig. 32 are not obviously contradictory to the available data from the resolution experiments of the wildtype and mutant dimer bridges. Although the observation that the B-half dimer bridge can be nicked is not included in Fig. 32, it is possible that nicking of the B-half dimer bridge is not involved in the resolution of the dimer bridge. 117 As mentioned above, the resolution procedure shown in Fig. 31 cannot explain the result that NS-1 tyrl97 mutant protein can resolve the dimer bridge but cannot nick both half dimer bridges. This result is repeatable. However, since the resolution efficiency of NS-1 tyrl97 mutant protein is low (see Fig. 30), the reason for me not to detect the products in the nicking assays using this NS-1 mutant may not be that the half dimer bridges cannot be nicked but may be that the nicking assay conditions are not sensitive enough to reveal low amount of product from nicking. Furthermore, even if NS-1 tyrl97 mutant protein cannot nick both half dimer bridges at all, it does not necessarily mean that the resolution procedure shown in Fig. 31 for wildtype NS-1 is wrong because mutant NS-1 may resolve the dimer bridge through a different resolution procedure from that in Fig. 31. It is possible that resolution assays and nicking assays using more dimer bridge mutants, half dimer bridge mutants and NS-1 mutants would help the elucidation of the resolution procedure. 4.3. The host factor(s) required for nicking The results presented in this paper demonstrate that host cell factor (or factors) is (are) required for nicking of the B-half of the Minute Virus of Mice dimer bridge. This host factor binds to the HFBR of the B-half and the efficiency of binding is highly dependent on the presence of two CG motifs. Although the C G motifs have been identified as the most important nucleotides for the binding of the host factor, it is possible the recognition sequence includes other nucleotides as these CG motifs lie within two four 118 4 5 1314 II II nucleotide repeats, ACGTNNNNNAQ • I observed that the nicking efficiency is reduced from that of wild-type when A3, T6 and T15 are mutated, however, a mutation at A12 appeared to have no effect. Although A20, C19 and A18 can be protected by NS-1 bound to the region adjacent to the HFBR, it has been shown by others that they are not required for NS-1 to bind to the A C C A A C C A sequence (Cotmore et al, 1995). The fact that pQLBA20G cannot be nicked, and.pQLBA18G and pQLBC19T cannot be nicked efficiently was unexpected and may suggest that although A20, C19 and A18 are not important for NS-1 binding, they are important for NS-1 nicking, or that the contex for the NS-1 binding site also plays a significant role for the efficient NS-1 binding. The mutation at T i l to C decreased the nicking efficiency of the B-half of the dimer bridge to 20% of that of wildtype (Fig. 27B). We believe this may be due to the creation of an E-box motif, and cellular E-box binding proteins within the LA9 extract would be expected to bind and compete with the host factor required for nicking. However, for the following reasons it is highly unlikely that the decrease of nicking efficiency of the mutants at the C4, G5, C13 or G14 is due to the creation of binding motifs for other factors. Firstly, no known protein binding sites are generated in these mutants. Secondly, if a new host factor binding site is created, there is likely to be competition for binding between the nicking factor and the new factor; hence, it is unlikely that nicking efficiency would be eliminated or almost eliminated. Thirdly, the deletion of C4 greatly decreases the nicking efficiency (Cotmore and Tattersall, 1994). It is unlikely that both the deletion and mutation of C4 create an unknown protein binding motif. Fourthly, a mutant in which both 119 A12 and C13 are mutated was made and this mutant cannot be nicked (Liu and Astell, unpublished results). Additional mutants (eg., G14 to T or C) can be made to confirm the important role of C4, G5, C13, and G14. It has been suggested that ATF, the recognition sequence of which is T G A C G , may be the host factor required for nicking of the B-half of the dimer bridge (Cotmore et al., 1995). From several of my observations, it is highly unlikely that ATF is the host protein required for nicking. Firstly, efficient nicking of the B-half dimer bridge and binding of the host factor requires the 4 5 1314 II II presence of ACGTNtMt^CGT which is not an ATF binding site. Secondly, in vitro translated ATF protein does not facilitate NS-1 nicking (data not shown). This observation has also been made by Cotmore et al. (personal communication). Furthermore, the bandshift assay with a D N A fragment containing nt 1 to 13 (Fig. 16) does not detect specific binding with the proteins from the LA9 replication extract. Finally, if only the C4 and G5 from the ATF binding site but not C13 and G14 are required for the binding of the host factor, the only explanation for the competitor DNA from pUCC4AG14A to be a poorer competitor than the competitor DNA from pUCC4A is that the mutation of G14 to A in pUCC4AG14A creates an unknown protein binding motif around A14. However, when the EcoRI/Hindlll fragment of pUCC4AG14A was used as a probe to do the bandshift assay, binding of proteins was not detected (data not shown). In order to further identify and characterize the host factor(s) that is/are required for nicking and binding to the HFBR, several approaches may be taken. Since the binding site of this host factor(s) is known, it should be possible to purify it from LA9 cells through D N A affinity chromatography 120 and then using partial aa sequence to clone the gene. It may also be possible to clone its gene directly using the yeast one hybrid system, assuming the host factor binding to the HFBR is a monomer or homo-oligomer. Once the protein(s) required for nicking of the B-half dimer bridge is identified, how this protein(s) assists in NS-1 nicking can be studied. It would also be of interest to learn its function(s) within the host cell. Currently, the purification of this LA9 cell factor(s) required for NS-1 nicking using D N A affinity chromatography is in progress. 121 V. References Aladjem MI. Groudine M. Brody LL. Dieken ES. Fournier RE. Wahl G M . Epner EM. Participation of the human beta-globin locus control region in initiation of D N A replication. Science. 270(5237):815-9, 1995. Antonietti JP. Sahli R. Beard P. Hirt B. Characterization of the cell type-specific determinant in the genome of minute virus of mice. Journal of Virology. 62(2):552-7,1988. Astell CR. Chow MB. Ward DC. Sequence analysis of the termini of virion and replicative forms of minute virus of mice DNA suggests a modified rolling hairpin model for autonomous parvovirus DNA replication. Journal of Virology. 54(l):171-7/1985. Astell CR. Gardiner EM. Tattersall P. DNA sequence of the lymphotropic variant of minute virus of mice, MVM(i), and comparison with the D N A sequence of the fibrotropic prototype strain. Journal of Virology. 57(2):656-69, 1986. Astell CR. Mol CD. Anderson WF. Structural and functional homology of parvovirus and papovavirus polypeptides. Journal of General Virology. 68 ( Pt 3):885-93,1987. Astell CR. Smith M. Chow MB. Ward DC. Structure of the 3' hairpin termini of four rodent parvovirus genomes: nucleotide sequence homology at origins of DNA replication. Cell. 17(3):691-703,1979. Astell CR. Thomson M . Chow MB. Ward DC. Structure and replication of minute virus of mice DNA. Cold Spring Harbor Symposia on Quantitative Biology. 47 Pt 2:751-62,1983a. Astell CR. Thomson M. Merchlinsky M. Ward DC. The complete D N A sequence of minute virus of mice, an autonomous parvovirus. Nucleic Acids Research. 11(4):999-1018,1983b. Ball-Goodrich LJ. Tattersall P. Two amino acid substitutions within the capsid are coordinately required for acquisition of fibrotropism by the lymphotropic strain of minute virus of mice. Journal of Virology. 66(6):3415-23,1992. Bell SP. Kobayashi R. Stillman B. Yeast origin recognition complex functions in transcription silencing and D N A replication [see comments]. Science. 262(5141):1844-9,1993. 122 Bell SP. Mitchell J. Leber J. Kobayashi R. Stillman B. The multidomain structure of Orclp reveals similarity to regulators of D N A replication and transcriptional silencing. Cell. 83(4):563-8, 1995. Bell SP. Stillman B. ATP-dependent recognition of eukaryotic origins of D N A replication by a multiprotein complex [see comments]. Nature. 357(6374):128-34/1992. Ben-Asher E. Aloni Y. Transcription of minute virus of mice, an autonomous parvovirus, may be regulated by attenuation. Journal of Virology. 52(l):266-76,1984. Benavente R. Krohne G. Franke WW. Cell type-specific expression of nuclear lamina proteins during development of Xenopus laevis. Cell. 41(l):177-90,1985. Berberich S. Trivedi A. Daniel DC. Johnson EM. Leffak M . In vitro replication of plasmids containing human c-myc DNA. Journal of Molecular Biology. 245(2):92-109,1995. Berns KI. Parvoviridae: the viruses and their replication in Fields Virology. 3nd edition, eds. Fields BN. Knipe DM. Harley PM et al.. Lippincott-Raven Publishers, Philaddephia. 2173-2197, 1996. Bonnard GD. Manders EK. Campbell DA Jr. Herberman RB. Collins MJ Jr. Immunosuppressive activity of a subline of the mouse EL-4 lymphoma. Evidence for minute virus of mice causing the inhibition. Journal of Experimental Medicine. 143(l):187-205,1976. Borowiec JA. Dean FB. Bullock PA. Hurwitz J. Binding and unwinding--how T antigen engages the SV40 origin of DNA replication. [Review] Cell. 60(2):181-4,1990. Borowiec JA. Dean FB. Hurwitz J. Differential induction of structural changes in the simian virus 40 origin of replication by T antigen. Journal of Virology. 65(3):1228-35, 1991. Borowiec JA. Hurwitz J. ATP stimulates the binding of simian virus 40 (SV40) large tumor antigen to the SV40 origin of replication. Proceedings of the National Academy of Sciences of the United States of America. 85(l):64-8, 1988. Borowiec JA. Hurwitz J. Localized melting and structural changes in the SV40 origin of replication induced by T-antigen. EMBO Journal. 7(10):3149-58,1988. 123 Bourguignon GJ. Tattersall PJ. Ward DC. DNA of minute virus of mice: self-priming, nonpermuted, single-stranded genome with a 5'-terminal hairpin duplex. Journal of Virology. 20(l):290-306, 1976. Brewer BJ. Fangman WL. The localization of replication origins on ARS plasmids in S. cerevisiae. Cell. 51(3):463-71,1987. Brill SJ. Stillman B. Yeast replication factor-A functions in the unwinding of the SV40 origin of D N A replication. Nature. 342(6245):92-5, 1989. Brownstein DG. Smith AL. Johnson EA. Pintel DJ. Naeger LK. Tattersall P. The pathogenesis of infection with minute virus of mice depends on expression of the small nonstructural protein NS2 and on the genotype of the allotropic determinants VP1 and VP2. Journal of Virology. 66(5):3118-24, 1992. Bullock PA. Denis D. DNA synthesis generally initiates outside the simian virus 40 core origin in vitro. Molecular & Cellular Biology. 15(l):173-8, 1995. Bullock PA. Seo YS. Hurwitz J. Initiation of simian virus 40 D N A replication in vitro: pulse-chase experiments identify the first labeled species as topologically unwound. Proceedings of the National Academy of Sciences of the United States of America. 86(ll):3944-8,1989. Bullock PA. Seo YS. Hurwitz J. Initiation of simian virus 40 D N A synthesis in vitro. Molecular & Cellular Biology. 11(5):2350-61, 1991. Bullock PA. Tevosian S. Jones C. Denis D. Mapping initiation sites for simian virus 40 D N A synthesis events in vitro. Molecular & Cellular Biology. 14(8)5043-55,1994. Campbell, J.L. and Newlon, CS . In The Molecular and Cellular Biology of the Yeast Saccharomyces: Genome dynamics, Protein Synthesis and Energetics(Broach, J.R., Pringle, J.R. and Jones, E.R., eds). pp 41-146, Cold Spring Harbor Lab, Cold Spring Harbor, NY. 1991. Carminati JL. Johnston CG. Orr-Weaver TL. The Drosophila ACE3 chorion element autonomously induces amplification. Molecular & Cellular Biology. 12(5):2444-53,1992. Cater JE. Pintel DJ. The small non-structural protein NS2 of the autonomous parvovirus minute virus of mice is required for virus growth in murine cells. Journal of General Virology. 73 ( Pt 7):1839-43, 1992. Cavalier-Smith T. Palindromic base sequences and replication of eukaryote chromosome ends. Nature. 250(5466):467-70, 1974. 124 Celniker SE. Sweder K. Srienc F. Bailey JE. Campbell JL. Deletion mutations affecting autonomously replicating sequence ARS1 of Saccharomyces cerevisiae. Molecular & Cellular Biology. 4(ll):2455-66, 1984. Chow M . Bodnar JW. Polvino-Bodnar M . Ward DC. Identification and characterization of a protein covalently bound to D N A of minute virus of mice. Journal of Virology. 57(3): 1094-104, 1986. Christensen J. Cotmore SF. Tattersall P. Minute virus of mice transcriptional activator protein NS1 binds directly to the transactivation region of the viral P38 promoter in a strictly ATP-dependent manner. Journal of Virology. 69(9)5422-30, 1995. Clemens KE. Pintel D. Minute virus of mice (MVM) mRNAs predominantly polyadenylate at a single site. Virology. 160(2):511-4,1987. Clinton G M . Hayashi M. The parovivirus M V M : particles with altered structural proteins. Virology. 66(1):261-1,1975 Collins KL. Kelly TJ. Effects of T antigen and replication protein A on the initiation of D N A synthesis by DNA polymerase alpha-primase. Molecular & Cellular Biology. 11(4):2108-15,1991. Collins KL. Russo AA. Tseng BY. Kelly TJ. The role of the 70 kDa subunit of human D N A polymerase alpha in DNA replication. EMBO Journal. 12(12):4555-66,1993. Cossons N. Faust EA. Zannis-Hadjopoulos M. DNA polymerase d-dependent formation of a hairpin structure at the 5' terminal palindrome of the minute virus of mice genome. Virology. 216:258-264, 1996. Costello E. Sahli R. Hirt B. Beard P. The mismatched nucleotides in the 5'-terminal hairpin of minute virus of mice are required for efficient viral D N A replication. Journal of Virology. 69(12):7489-96,1995. Cotmore SF. Christensen J. Nuesch JP. Tattersall P. The NS1 polypeptide of the murine parvovirus minute virus of mice binds to D N A sequences containing the motif [ACCA]2-3. Journal of Virology. 69(3):1652-60, 1995a. Cotmore SF. Gene expression in the autonomous parvoviruses. Handbook of parvoviruses. Edited by Tijssen P. Volume 1:141-154,1990. Cotmore SF. Gottlieb R. D'Abramo A. Bratton J. Tattersall P. NS-2 is required for correct folding and/or assembly of the M V M capsid proteins in mouse cells. Vlth parvovirus workshop. LeCorum, Montpellier, France. Page 8, Sept. of 1995b. 1 2 5 Cotmore SF. Nuesch JP. Tattersall P. Asymmetric resolution of a parvovirus palindrome in vitro. Journal of Virology. 67(3): 1579-89, 1993. Cotmore SF. Nuesch JP. Tattersall P. In vitro excision and replication of 5' telomeres of minute virus of mice DNA from cloned palindromic concatemer junctions. Virology. 190(l):365-77, 1992. Cotmore SF. Sturzenbecker LJ. Tattersall P. The autonomous parvovirus M V M encodes two nonstructural proteins in addition to its capsid polypeptides. Virology. 129(2):333-43,1983. Cotmore SF. Tattersall P. The autonomously replicating parvoviruses of vertebrates. Adanced Virus Research. 33:91-174,1987. Cotmore SF. Tattersall P. A genome-linked copy of the NS-1 polypeptide is located on the outside of infectious parvovirus particles. Journal of Virology. 63(9):3902-ll, 1989. Cotmore SF. Tattersall P. Alternate splicing in a parvoviral nonstructural gene links a common amino-terminal sequence to downstream domains which confer radically different localization and turnover characteristics. Virology. 177(2):477-87,1990. Cotmore SF. Tattersall P. An asymmetric nucleotide in the parvoviral 3' hairpin directs segregation of a single active origin of D N A replication. EMBO Journal. 13(17):4145-52, 1994. Cotmore SF. Tattersall P. In vivo resolution of circular plasmids containing concatemer junction fragments from minute virus of mice D N A and their subsequent replication as linear molecules. Journal of Virology. 66(1):420-31, 1992. Cotmore SF. Tattersall P. Organization of nonstructural genes of the autonomous parvovirus minute virus of mice. Journal of Virology. 58(3):724-32,1986. Cotmore SF. Tattersall P. The NS-1 polypeptide of minute virus of mice is covalently attached to the 5' termini of duplex replicative-form D N A and progeny single strands. Journal of Virology. 62(3):851-60,1988. Coverley D. Laskey RA. Regulation of eukaryotic DNA replication. [Review] Annual Review of Biochemistry. 63:745-76, 1994. Crawford LV. A minute virus of mice. Virology. 29(4):605-12,1966. Dean FB. Borowiec JA. Ishimi Y. Deb S. Tegtmeyer P. Hurwitz J. Simian virus 40 large tumor antigen requires three core replication origin domains 126 for D N A unwinding and replication in vitro. Proceedings of the National Academy of Sciences of the United States of America. 84(23):8267-71, 1987a. DeanFB. Bullock P. Murakami Y. Wobbe CR. Weissbach L. Hurwitz J. Simian virus 40 (SV40) D N A replication: SV40 large T antigen unwinds D N A containing the SV40 origin of replication. Proceedings of the National Academy of Sciences of the United States of America. 84(l):16-20,1987b. Dean FB. Dodson M . Echols H. Hurwitz J. ATP-dependent formation of a specialized nucleoprotein structure by simian virus 40 (SV40) large tumor antigen at the SV40 replication origin. Proceedings of the National Academy of Sciences of the United States of America. 84(24):8981-5, 1987c. Dean FB. Hurwitz J. Simian virus 40 large T antigen untwists D N A at the origin of D N A replication. Journal of Biological Chemistry. 266(8):5062-71, 1991. Deb SP. Deb S. Preferential binding of simian virus 40 T-antigen dimers to origin region I. Journal of Virology. 63(7):2901-7,1989. Deb SP. Tegtmeyer P. ATP enhances the binding of simian virus 40 large T antigen to the origin of replication. Journal of Virology. 61(12):3649-54, 1987. DeLucia AL. Lewton BA. Tjian R. Tegtmeyer P. Topography of simian virus 40 A protein-DNA complexes: arrangement of pentnucleotide interaction sites at the origin of replication. Journal of Virology. 46(l):143-50, 1983. Denis D. Bullock PA. Primer-DNA formation during simian virus 40 D N A replication in vitro. Molecular & Cellular Biology. 13(5):2882-90, 1993. DePamphilis ML. Eukaryotic DNA replication: anatomy of an origin. [Review] Annual Review of Biochemistry. 62:29-63, 1993. Diffley JF. Cocker JH. Dowell SJ. Rowley A. Two steps in the assembly of complexes at yeast replication origins in vivo. Cell. 78(2):303-16, 1994. Diffley JF. Cocker JH. Protein-DNA interactions at a yeast replication origin. Nature. 357(6374):169-72,1992. Diffley JF. Eukaryotic DNA replication. [Review] Current Opinion in Cell Biology. 6(3):368-72,1994. Diffley JF. Stillman B. Purification of a yeast protein that binds to origins of D N A replication and a transcriptional silencer. Proceedings of the National Academy of Sciences of the United States of America. 85(7):2120-4, 1988. Diffley, J.F.X. In Molecular Biology of Saccharomyces(Grivell, L.A., ed) pp. 25-33, Kluwer Academic Publishers, London. 1992. 127 Dillin A. Rine J. On the origin of a silencer. [Review] Trends in Biochemical Sciences. 20(6):231-5, 1995. DiMaio D. Nathans D. Regulatory mutants of simian virus 40. Effect of mutations at a T antigen binding site on DNA replication and expression of viral genes. Journal of Molecular Biology. 156(3)531-48, 1982. Dobbs DL. Shaiu WL. Benbow RM. Modular sequence elements associated with origin regions in eukaryotic chromosomal DNA. Nucleic Acids Research. 22(13):2479-89,1994. Dodson M . Dean FB. Bullock P. Echols H. Hurwitz J. Unwinding of duplex D N A from the SV40 origin of replication by T antigen [published erratum appears in Science 1987 Dec 4;238(4832):1341]. Science. 238(4829):964-7, 1987. Doerig C. Hirt B. Antonietti JP. Beard P. Nonstructural protein of parvoviruses B19 and minute virus of mice controls transcription. Journal of Virology. 64(l):387-96, 1990. Doerig C. Hirt B. Beard P. Antonietti JP. Minute virus of mice non-structural protein NS-1 is necessary and sufficient for trans-activation of the viral P39 promoter. Journal of General Virology. 69 ( Pt 10):2563-73,1988. Dornreiter I. Copeland WC. Wang TS. Initiation of simian virus 40 D N A replication requires the interaction of a specific domain of human D N A polymerase alpha with large T antigen. Molecular & Cellular Biology. 13(2):809-20,1993. Dornreiter I. Dehde S. Hauser M. Nasheuer H. -P. Fanning E. Unpublished data Dornreiter I. Erdile LF. Gilbert IU. von Winkler D. Kelly TJ. Fanning E. Interaction of D N A polymerase alpha-primase with cellular replication protein A and SV40 T antigen. EMBO Journal. ll(2):769-76, 1992. Dowell SJ. Romanowski P. Diffley JF. Interaction of Dbf4, the Cdc7 protein kinase regulatory subunit, with yeast replication origins in vivo [see comments]. Science. 265(5176):1243-6, 1994. Dupont F. Tenenbaum L. Guo LP. Spegelaere P. Zeicher M. Rommelaere J. Use of an autonomous parvovirus vector for selective transfer of a foreign gene into transformed human cells of different tissue origins and its expression therein. Journal of Virology. 68(3):1397-406,1994. Ehrenhofer-Murray AE. Gossen M . Pak DT. Botchan MR. Rine J. Separation of origin recognition complex functions by cross-species complementation [see comments]. Science. 270(5242):!671-4, 1995. 128 Eki T. Matsumoto T. Murakami Y. Hurwitz J. The replication of D N A containing the simian virus 40 origin by the monopolymerase and dipolymerase systems. Journal of Biological Chemistry. 267(11):7284-94, 1992. Estes H G . Robinson BS. Eisenberg S. At least three distinct proteins are necessary for the reconstitution of a specific multiprotein complex at a eukaryotic chromosomal origin of replication. Proceedings of the National Academy of Sciences of the United States of America. 89(23):11156-60, 1992. Fanning E. Knippers R. Structure and function of simian virus 40 large tumor antigen. [Review] Annual Review of Biochemistry. 61:55-85, 1992. Faust EA. Ward DC. Incomplete genomes of the parvovirus minute virus of mice: selective conservation of genome termini, including the origin for D N A replication. Journal of Virology. 32(l):276-92, 1979. Forrester WC. Novak U. Gelinas R. Groudine M. Molecular analysis of the human beta-globin locus activation region. Proceedings of the National Academy of Sciences of the United States of America. 86(14)5439-43,1989. Forrester WC. Takegawa S. Papayannopoulou T. Stamatoyannopoulos G. Groudine M . Evidence for a locus activation region: the formation of developmentally stable hypersensitive sites in globin-expressing hybrids. Nucleic Acids Research. 15(24):10159-77, 1987. Foss M . McNally FJ. Laurenson P. Rine J. Origin recognition complex (ORC) in transcriptional silencing and D N A replication in S. cerevisiae [see comments]. Science. 262(5141):1838-44, 1993. Fox CA. Loo S. Dillin A. Rine J. The origin recognition complex has essential functions in transcriptional silencing and chromosomal replication. Genes & Development. 9(8):911-24,1995. Gardiner EM. Tattersall P. Evidence that developmentally regulated control of gene expression by a parvoviral allotropic determinant is particle mediated. Journal of Virology. 62(5): 1713-22,1988a. Gardiner EM. Tattersall P. Mapping of the fibrotropic and lymphotropic host range determinants of the parvovirus minute virus of mice. Journal of Virology. 62(8):2605-13,1988b. Gavin KA. Hidaka M . Stillman B. Conserved initiator proteins in eukaryotes [see comments]. Science. 270(5242):1667-71,1995. Gilbert DM. Miyazawa H . DePamphilis ML. Site-specific initiation of D N A replication in Xenopus egg extract requires nuclear structure. Molecular & Cellular Biology. 15(6):2942-54,1995. 129 Gossen M . Pak DT. Hansen SK. Acharya JK. Botchan MR. A Drosophila homolog of the yeast origin recognition complex [see comments]. Science. 270(5242):1674-7/1995. Grosveld F. van Assendelft GB. Greaves DR. Kollias G. Position-independent, high-level expression of the human beta-globin gene in transgenic mice. Cell. 51(6):975-85,1987. Gu Z. Plaza S. Perros M. Cziepluch C. Rommelaere J. Cornells TJ. NF-Y controls transcription of the minute virus of mice P4 promoter through interaction with an unusual binding site. Journal of Virology. 69:239-246, 1995. Gunther M . Tattersall P. The terminal protein of minute virus of mice is an 83 kilodalton polypeptide linked to specific forms of double-stranded and single-stranded viral DNA. FEBS Letters. 242(1 ):22-6,1988. Guo ZS. DePamphilis ML. Specific transcription factors stimulate simian virus 40 and polyomavirus origins of DNA replication. Molecular & Cellular Biology. 12(6):2514-24,1992. Guo ZS. Gutierrez C. Heine U. Sogo JM. Depamphilis ML. Origin auxiliary sequences can facilitate initiation of simian virus 40 D N A replication in vitro as they do in vivo. Molecular & Cellular Biology. 9(9):3593-602, 1989. Guo ZS. Heine U. DePamphilis ML. T-antigen binding to site I facilitates initiation of SV40 D N A replication but does not affect bidirectionality. Nucleic Acids Research. 19(25):7081-8, 1991. Gutierrez C. Guo ZS. Roberts J. DePamphilis ML. Simian virus 40 origin auxiliary sequences weakly facilitate T-antigen binding but strongly facilitate D N A unwinding. Molecular & Cellular Biology. 10(4):1719-28, 1990. Handeli S. Klar A. Meuth M. Cedar H . Mapping replication units in animal cells. Cell. 57(6):909-20,1.989. Harris C. Astell CR. Transcriptional activation by NS-1, the major nonstructural protein of Minute Virus of Mice. International Symposium on Nucleic Acids and Membranes in Honour of Dr. Har Gobind Khorana. Vancouver, B C , Canada. Page 42, May of 1993. Hartwell L H . Sequential function of gene products relative to D N A synthesis in the yeast cell cycle. Journal of Molecular Biology. 104(4):803-17,1976. Hay RT. DePamphilis ML. Initiation of SV40 DNA replication in vivo: location and structure of 5' ends of DNA synthesized in the ori region. Cell. 28(4):767-79,1982. 130 Hou Z. Umthun AR. Dobbs DL. A single-stranded D N A binding protein that specifically recognizes cis-acting sequences in the replication origin and transcriptional promoter region of Tetrahymena rDNA. Biochemistry. 34(14):4583-92,1995. Hsiao CL. Carbon J. High-frequency transformation of yeast by plasmids containing the cloned yeast ARG4 gene. Proceedings of the National Academy of Sciences of the United States of America. 76(8):3829-33, 1979. Huberman JA. Cell cycle. A licence to replicate [news; comment]. Nature. 375(6530):360-l, 1995a. Huberman JA. Prokaryotic and eukaryotic replicons. Cell. 82(4):535-42, 1995b. Huberman JA. Spotila LD. Nawotka KA. el-Assouli SM. Davis LR. The in vivo replication origin of the yeast 2 microns plasmid. Cell. 51(3):473-81, 1987. Hyrien O. Mechali M . Chromosomal replication initiates and terminates at random sequences but at regular intervals in the ribosomal D N A of Xenopus early embryos. EMBO Journal. 12(12):4511-20,1993. Ilyina TV. Koonin EV. Conserved sequence motifs in the initiator proteins for rolling circle D N A replication encoded by diverse replicons from eubacteria, eucaryotes and archaebacteria. Nucleic Acids Research. 20(13):3279-85,1992. Im DS. Muzyczka N. The A A V origin binding protein Rep68 is an ATP-dependent site-specific endonuclease with DNA helicase activity. Cell. 61(3):447-57,1990. Ishimi Y. Claude A. Bullock P. Hurwitz J. Complete enzymatic synthesis of D N A containing the SV40 origin of replication. Journal of Biological Chemistry. 263(36):19723-33,1988. Jindal HK. Yong CB. Wilson GM. Tarn P. Astell CR. Mutations in the NTP-binding motif of minute virus of mice (MVM) NS-1 protein uncouple ATPase and D N A helicase functions. Journal of Biological Chemistry. 269(5):3283-9,1994. Jongeneel CV. Sahli R. McMaster GK. Hirt B. A precise map of splice junctions in the mRNAs of minute virus of mice, an autonomous parvovirus. Journal of Virology. 59(3):564-73, 1986. Kadonaga JT. Jones KA. Tjian R. Promoter-specific activation of RNA polymerase II transcription by Spl. Trends in Biochemical Science. 11:20-23, 1986. 131 Kamakaka RT. Kaufman PD. Stillman B. Mitsis PG. Kadonaga JT. Simian virus 40 origin- and T-antigen-dependent DNA replication with Drosophila factors in vitro. Molecular & Cellular Biology. 14(8):5114-22,1994. Kapil S. Minute virus of mice (MVM) nucleic acid production in susceptible and resistant strains of mice and F l hybrids. Comparative Immunology, Microbiology & Infectious Diseases. 18(4):245-52, 1995. Kelly TJ. Jallepalli PV. Clyne RK. Replication and transcription. Silence of the ORCs. [Review] Current Biology. 4(3):238-41,1994. Kenny MK. Lee SH. Hurwitz J. Multiple functions of human single-stranded-DNA binding protein in simian virus 40 D N A replication: single-strand stabilization and stimulation of DNA polymerases alpha and delta. Proceedings of the National Academy of Sciences of the United States of America. 86(24):9757-61,1989. Kilham L. Margolis G. Pathology of minute virus of mice (MVM) for rats, mice, and hamsters. Proceedings of the Society for Experimental Biology & Medicine. 133(4):1447-52,1970. Kitsberg D. Selig S. Keshet I. Cedar H. Replication structure of the human beta-globin gene domain [see comments]. Nature. 366(6455):588-90, 1993. Krady JK. Ward DC. Transcriptional activation by the parvoviral nonstructural protein NS-1 is mediated via a direct interaction with Spl. Molecular & Cellular Biology. 15(l):524-33,1995. Krysan PJ. Smith JG. Calos MP. Autonomous replication in human cells of multimers of specific human and bacterial DNA sequences. Molecular & Cellular Biology. 13(5):2688-96,1993. Labieniec-Pintel L. Pintel D. The minute virus of mice P39 transcription unit can encode both capsid proteins. Journal of Virology. 57(3):1163-7, 1986. Lee SH. Kim DK. The role of the 34-kDa subunit of human replication protein A in simian virus 40 DNA replication in vitro. Journal of Biological Chemistry. 270(21):12801-7,1995. Lee SH. Kwong AD. Pan ZQ. Hurwitz J. Studies on the activator 1 protein complex, an accessory factor for proliferating cell nuclear antigen-dependent D N A polymerase delta. Journal of Biological Chemistry. 266(l):594-602, 1991. Legendre D. Rommelaere J. Targeting of promoters for trans activation by a carboxy-terminal domain of the NS-1 protein of the parvovirus minute virus of mice. Journal of Virology. 68(12):7974-85, 1994. 132 Li JJ. Herskowitz I. Isolation of ORC6, a component of the yeast origin recognition complex by a one-hybrid system [see comments]. Science. 262(5141):1870-4/1993. Li X. Li J. Harrington J. Lieber MR. Burgers PM. Lagging strand D N A synthesis at the eukaryotic replication fork involves binding and stimulation of FEN-1 by proliferating cell nuclear antigen. Journal of Biological Chemistry. 270(38):22109-12,1995. Liang C. Weinreich M . Stillman B. ORC and Cdc6p interact and determine the frequency of initiation of DNA replication in the genome. Cell. 81(5):667-76,1995. Littlefield JW. Three degrees of guanylic acid-inosinic acid pyrophosphorylase deficiency in mouse fibroblasts. Nature. 203:1142-1144, 1964. Liu Q. Yong CB. Astell CR. In vitro resolution of the dimer bridge of the minute virus of mice (MVM) genome supports the modified rolling hairpin model for M V M replication. Virology. 201(2):251-62, 1994. Loo S. Fox CA. Rine J. Kobayashi R. Stillman B. Bell S. The origin recognition complex in silencing, cell cycle progression, and D N A replication. Molecular Biology of the Cell. 6(6):741-56, 1995. Lorson C. Burger LR. Mouw M. Pintel DJ. Efficient transactivation of the minute virus of mice P38 promoter requires upstream binding of NS1. Journal of Virology. 70(2):834-42, 1996. Lue NF. Kornberg RD. A possible role for the yeast TATA-element-binding protein in D N A replication. Proceedings of the National Academy of Sciences of the United States of America. 90(17):8018-22, 1993. Maine GT. Sinha P. Tye BK. Mutants of S. cerevisiae defective in the maintenance of minichromosomes. Genetics. 106(3):365-85, 1984. Marahrens Y. Stillman B. A yeast chromosomal origin of D N A replication defined by multiple functional elements. Science. 255(5046):817-23, 1992. Marahrens Y. Stillman B. Replicator dominance in a eukaryotic chromosome. EMBO Journal. 13(14):3395-400, 1994. Mastrangelo IA. Hough PV. WallJS. Dodson M. Dean FB. Hurwitz J. ATP-dependent assembly of double hexamers of SV40 T antigen at the viral origin of D N A replication. Nature. 338(6217):658-62, 1989. 133 Masukata H . Satoh H. Obuse C. Okazaki T. Autonomous replication of human chromosomal DNA fragments in human cells. Molecular Biology of the Cell. 4(ll):1121-32,1993. Matsumoto T. Eki T. Hurwitz J. Studies on the initiation and elongation reactions in the simian virus 40 DNA replication system. Proceedings of the National Academy of Sciences of the United States of America. 87(24):9712-6, 1990. Maxwell IH. Spitzer AL. Maxwell F. Pintel DJ. The capsid determinant of fibrotropism for the MVMp strain of minute virus of mice functions via VP2 and not VP1. Journal of Virology. 69(9)5829-32, 1995. McMaster GK. Beard P. Engers HD. Hirt B. Characterization of an immunosuppressive parvovirus related to the minute virus of mice. Journal of Virology. 38(l):317-26,1981. McWhinney C. Waltz SE. Leffak M. Cis-acting effects of sequences within 2.4-kb upstream of the human c-myc gene on autonomous plasmid replication in HeLa cells. DNA & Cell Biology. 14(7)565-79,1995. Melendy T. Stillman B. An interaction between replication protein A and SV40 T antigen appears essential for primosome assembly during SV40 D N A replication. Journal of Biological Chemistry. 268(5):3389-95, 1993. Merchlinsky MJ. Tattersall PJ. Leary TJ. Cotmore SF. Gardiner EM. Ward DC. Construction of an infectious molecular clone of the autonomous parvovirus minute virus of mice. Journal of Virology. 47(l):227-32, 1983. Metcalf JB. Bates RC. Lederman M. Interaction of virally coded protein and a cell cycle-regulated cellular protein with the bovine parvovirus left terminus ori. Journal of Virology. 64(11)5485-90,1990. Montag M . Spring H. Trendelenburg MF. Structural analysis of the mitotic cycle in pre-gastrula Xenopus embryos. Chromosoma. 96(3):187-96, 1988. Morgan WR. Ward DC. Three splicing patterns are used to excise the small intron common to all minute virus of mice RNAs. Journal of Virology. 60(3):1170-4,1986. Murakami Y. Eki T. Hurwitz J. Studies on the initiation of simian virus 40 replication in vitro: RNA primer synthesis and its elongation. Proceedings of the National Academy of Sciences of the United States of America. 89(3):952-6,1992. 134 Murakami Y. Hurwitz J. DNA polymerase alpha stimulates the ATP-dependent binding of simian virus tumor T antigen to the SV40 origin of replication. Journal of Biological Chemistry. 268(15):11018-27, 1993a. Murakami Y. Hurwitz J. Functional interactions between SV40 T antigen and other replication proteins at the replication fork. Journal of Biological Chemistry. 268(15):11008-17,1993b. Myers RM. Tjian R. Construction and analysis of simian virus 40 origins defective in tumor antigen binding and DNA replication. Proceedings of the National Academy of Sciences of the United States of America. 77(ll):6491-5, 1980. Naeger LK. Cater J. Pintel DJ. The small nonstructural protein (NS2) of the parvovirus minute virus of mice is required for efficient D N A replication and infectious virus production in a cell-type-specific manner. Journal of Virology. 64(12):6166-75,1990. Naeger LK. Salome N. Pintel DJ. NS2 is required for efficient translation of viral mRNA in minute virus of mice-infected murine cells. Journal of Virology. 67(2):1034-43,1993. Nasheuer HP. von Winkler D. Schneider C. Dornreiter I. Gilbert I. Fanning E. Purification and functional characterization of bovine RP-A in an in vitro SV40 D N A replication system. Chromosoma. 102(1 Suppl):S52-9, 1992. Nethanel T. Kaufmann G. Two DNA polymerases may be required for synthesis of the lagging DNA strand of simian virus 40. Journal of Virology. 64(12):5912-8,1990. Nethanel T. Reisfeld S. Dinter-Gottlieb G. Kaufmann G. An Okazaki piece of simian virus 40 may be synthesized by ligation of shorter precursor chains. Journal of Virology. 62(8):2867-73, 1988. Newlon CS. Yeast chromosome replication and segregation. [Review] Microbiological Reviews. 52(4)568-601, 1988. Nichols M . Weil F. Schmid W. Devack C. Kowenz-lentz E. Luckow B. Boshart M . Schtitz G. Phosphorylation of CREB affects its binding to high and low affinity sites: implication for cAMP induced gene transcription. EMBO Journal. 11:3337-3346,1992. Nuesch JP. Cotmore SF. Tattersall P. Sequence motifs in the replicator protein of parvovirus M V M essential for nicking and covalent attachment to the viral origin: identification of the linking tyrosine. Virology. 209(l):122-35, 1995. 135 Nuesch JP. Tattersall P. Nuclear targeting of the parvoviral replicator molecule NS1: evidence for self-association prior to nuclear transport. Virology. 196(2):637-51,1993. Paradiso PR. Infectious process of the parvovirus H - l : correlation of protein content, particle density, and viral infectivity. Journal of Virology. 39(3):800-7,1981. Parsons R. Anderson ME. Tegtmeyer P. Three domains in the simian virus 40 core origin orchestrate the binding, melting, and DNA helicase activities of T antigen. Journal of Virology. 64(2)509-18,1990. Pintel D. Dadachanji D. Astell CR. Ward DC. The genome of minute virus of mice, an autonomous parvovirus, encodes two overlapping transcription units. Nucleic Acids Research. ll(4):1019-38,1983. Rao H . Marahrens Y. Stillman B. Functional conservation of multiple elements in yeast chromosomal replicators. Molecular & Cellular Biology. 14(11):7643-51,1994. Rao H . Stillman B. The origin recognition complex interacts with a bipartite D N A binding site within yeast replicators. Proceedings of the National Academy of Sciences of the United States of America. 92(6):2224-8,1995. Rashid MB. Shirahige K. Ogasawara N. Yoshikawa H . Anatomy of the stimulative sequences flanking the ARS consensus sequence of chromosome VI in Saccharomyces cerevisiae. Gene. 150(2):213-20, 1994. Rowley A. Cocker JH. Harwood J. Diffley JF. Initiation complex assembly at budding yeast replication origins begins with the recognition of a bipartite sequence by limiting amounts of the initiator, ORC. EMBO Journal. 14(11):2631-41,1995. Rowley A. Dowell SJ. Diffley JF. Recent developments in the initiation of chromosomal D N A replication: a complex picture emerges. [Review] Biochimica et Biophysica Acta. 1217(3):239-56,1994. Ryder K. Silver S. DeLucia AL. Fanning E. Tegtmeyer P. An altered D N A conformation in origin region I is a determinant for the binding of SV40 large T antigen. Cell. 44(5):719-25,1986. Ryder K. Vakalopoulou E. Mertz R. Mastrangelo I. Hough P. Tegtmeyer P. Fanning E. Seventeen base pairs of region I encode a novel tripartite binding signal for SV40 T antigen. Cell. 42(2)539-48,1985. 136 Sahli R. McMaster GK. Hirt B. DNA sequence comparison between two tissue-specific variants of the autonomous parvovirus, minute virus of mice. Nucleic Acids Research. 13(10):3617-33,1985. Salvino R. Skiadopoulos M. Faust EA. Tarn P. Shade RO. Astell CR. Two spatially distinct genetic elements constitute a bipartite D N A replication origin in the minute virus of mice genome. Journal of Virology. 65(3):1352-63,1991. Sambrook J. Fritsch EF. Maniatis T. Molecular cloning , a laboratory manual. 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 1989. Santaren JF. Ramirez JC. Almendral JM. Protein species of the parvovirus minute virus of mice strain MVMp: involvement of phosphorylated VP-2 subtypes in viral morphogenesis. Journal of Virology. 67(9)5126-38,1993. Schneider C. Weisshart K. Guarino LA. Dornreiter I. Fanning E. Species-specific functional interactions of DNA polymerase alpha-primase with simian virus 40 (SV40) T antigen require SV40 origin DNA. Molecular & Cellular Biology. 14(5):3176-85,1994. Sclafani RA. Jackson AL. Cdc7 protein kinase for DNA metabolism comes of age. [Review] Molecular Microbiology. 11(5):805-10,1994. Segovia JC. Bueren JA. Almendral JM. Myeloid depression follows infection of susceptible newborn mice with the parvovirus minute virus of mice (strain i). Journal of Virology. 69(5):3229-32, 1995. SenGupta DJ. Borowiec JA. Strand and face: the topography of interactions between the SV40 origin of replication and T-antigen during the initiation of replication. EMBO Journal. 13(4):982-92, 1994. SenGupta DJ. Borowiec JA. Strand-specific recognition of a synthetic D N A replication fork by the SV40 large tumor antigen. Science. 256(5064):1656-61, 1992. Shinomiya T. Ina S. Analysis of chromosomal replicons in early embryos of Drosophila melanogaster by two-dimensional gel electrophoresis. Nucleic Acids Research. 19(14):3935-41,1991. Simpson RT. Nucleosome positioning can affect the function of a cis-acting D N A element in vivo. Nature. 343(6256):387-9, 1990. Skiadopoulos M H . Faust EA. Mutational analysis of conserved tyrosines in the NS-1 protein of the parvovirus minute virus of mice. Virology. 194(2)509-17,1993. 137 Smith JG. Calos MP. Autonomous replication in Drosophila melanogaster tissue culture cells. Chromosoma. 103(9)597-605,1995 Snyder RO. Samulski RJ. Muzyczka N. In vitro resolution of covalently joined A A V chromosome ends. Cell. 60(1):105-13, 1990. Spalholz BA. Tattersall P. Interaction of minute virus of mice with differentiated cells: strain-dependent target cell specificity is mediated by intracellular factors. Journal of Virology. 46(3):937-43, 1983. Stadlbauer F. Voitenleitner C. Bruckner A. Fanning E. Nasheuer HP. Species-specific replication of simian virus 40 DNA in vitro requires the pi 80 subunit of human D N A polymerase alpha-primase. Molecular & Cellular Biology. 16(1):94-104,1996. Stick R. Hausen P. Changes in the nuclear lamina composition during early development of Xenopus laevis. Cell. 41(l):191-200, 1985 Stillman BW. Gluzman Y. Replication and supercoiling of simian virus 40 D N A in cell extracts from human cells. Molecular & Cellular Biology. 5(8):2051-60,1985. Stinchcomb DT. Struhl K. Davis RW. Isolation and characterisation of a yeast chromosomal replicator. Nature. 282(5734):39-43, 1979. Strich R. Woontner M . Scott JF. Mutations in ARS1 increase the rate of simple loss of plasmids in Saccharomyces cerevisiae. Yeast. 2(3):169-78, 1986. Taira T. Iguchi-Ariga SM. Ariga H. A novel DNA replication origin identified in the human heat shock protein 70 gene promoter. Molecular & Cellular Biology. 14(9):6386-97,1994. Tarn P. Astell CR. Multiple cellular factors bind to cis-regulatory elements found inboard of the 5' palindrome of minute virus of mice. Journal of Virology. 68(5):2840-8, 1994. Tarn P. Astell CR. Replication of minute virus of mice minigenomes: novel replication elements required for M V M DNA replication. Virology. 193(2):812-24,1993. Tarn P. Cis-acting sequences found within the M V M genome required for D N A replication. PhD thesis, 1994. Dept. of Biochemistry and Molecular Biology, the University of British Columbia, Vancouver, B C , Canada. Tattersall P. Bratton J. Reciprocal productive and restrictive virus-cell interactions of immunosuppressive and prototype strains of minute virus of mice. Journal of Virology. 46(3):944-55, 1983. 138 Tattersall P. Cawte PJ. Shatkin AJ. Ward DC. Three structural polypeptides coded for by minite virus of mice, a parvovirus. Journal of Virology. 20(l):273-89,1976. Tattersall P. Replication of the parvovirus M V M . I. Dependence of virus multiplication and plaque formation on cell growth. Journal of Virology. 10(4):586-90,1972. Tattersall P. Shatkin AJ. Ward DC. Sequence homology between the structural polypeptides of minute virus of mice. Journal of Molecular Biology. lll(4):375-94,1977. Tattersall P. Ward DC. Rolling hairpin model for replication of parvovirus and linear chromosomal DNA. Nature. 263(5573):106-9, 1976. Theis JF. Newlon CS. Domain B of ARS307 contains two functional elements and contributes to chromosomal replication origin function. Molecular and Cellular Biology. 14:7652-7659, 1994. Todd A. Landry S. Pearson CE. Khoury V. Zannis-Hadjopoulos M . Deletion analysis of minimal sequence requirements for autonomous replication of ors8, a monkey early-replicating DNA sequence [published erratum appears in J Cell Biochem 1995 Apr;57(4):724]. Journal of Cellular Biochemistry. 57(2):280-9,1995. Toyn JH. Toone W M . Morgan BA. Johnston L H . The activation of D N A replication in yeast. [Review] Trends in Biochemical Sciences. 20(2):70-3, 1995. Tsurimoto T. Melendy T. Stillman B. Sequential initiation of lagging and leading strand synthesis by two different polymerase complexes at the SV40 D N A replication origin. Nature. 346(6284):534-9, 1990. Tsurimoto T. Stillman B. Purification of a cellular replication factor, RF-C, that is required for coordinated synthesis of leading and lagging strands during simian virus 40 DNA replication in vitro. Molecular & Cellular Biology. 9(2):609-19,1989. Tsurimoto T. Stillman B. Replication factors required for SV40 D N A replication in vitro. I. DNA structure-specific recognition of a primer-template junction by eukaryotic DNA polymerases and their accessory proteins. Journal of Biological Chemistry. 266(3):1950-60, 1991a. Tsurimoto T. Stillman B. Replication factors required for SV40 D N A replication in vitro. II. Switching of DNA polymerase alpha and delta during initiation of leading and lagging strand synthesis. Journal of Biological Chemistry. 266(3):1961-8,1991b. 139 Tullis GE. Burger LR. Pintel DJ. The minor capsid protein VP1 of the autonomous parvovirus minute virus of mice is dispensable for encapsidation of progeny single-stranded DNA but is required for infectivity. Journal of Virology. 67(1):131-41, 1993. Turchi JJ. Bambara RA. Completion of mammalian lagging strand D N A replication using purified proteins. Journal of Biological Chemistry. 268(20): 15136-41,1993. Umek RM. Linskens M H . Kowalski D. Huberman JA. New beginnings in studies of eukaryotic D N A replication origins. [Review] Biochimica et Biophysica Acta. 1007(1):1-14,1989. Virta-Pearlman VJ. Gunaratne PH. Chinault AC. Analysis of a replication initiation sequence from the adenosine deaminase region of the mouse genome. Molecular & Cellular Biology. 13(10)5931-42,1993. Waga S. Bauer G. Stillman B. Reconstitution of complete SV40 D N A replication with purified replication factors. Journal of Biological Chemistry. 269(14):10923-34,1994. Waga S. Stillman B. Anatomy of a DNA replication fork revealed by reconstitution of SV40 DNA replication in vitro. Nature. 369(6477):207-12, 1994. Walker SS. Francesconi SC. Eisenberg S. A DNA replication enhancer in Saccharomyces cerevisiae. Proceedings of the National Academy of Sciences of the United States of America. 87(12):4665-9, 1990. Walker SS. Malik AK. Eisenberg S. Analysis of the interactions of functional domains of a nuclear origin of replication from Saccharomyces cerevisiae. Nucleic Acids Research. 19(22):6255-62, 1991. Wang TA. Li JJ. Eukaryotic DNA replication. [Review] Current Opinion in Cell Biology. 7(3):414-20,1995. Ward P. Berns KI. In vitro rescue of an integrated hybrid adeno-associated virus/simian virus 40 genome. Journal of Molecular Biology. 218(4):791-804, 1991. Weinberg D H . Collins KL. Simancek P. Russo A. Wold MS. Virshup D M . Kelly TJ. Reconstitution of simian virus 40 DNA replication with purified proteins. Proceedings of the National Academy of Sciences of the United States of America. 87(22):8692-6,1990. 140 Wessel R. Schweizer J. Stahl H . Simian virus 40 T-antigen D N A helicase is a hexamer which forms a binary complex during bidirectional unwinding from the viral origin of DNA replication. Journal of Virology. 66(2):804-15, 1992. Willwand K. Hirt B. The major capsid protein VP2 of minute virus of mice (MVM) can form particles which bind to the 3'-terminal hairpin of M V M replicative-form DNA and package single-stranded viral progeny D N A . Journal of Virology. 67(9)5660-3, 1993. Willwand K. Hirt B. The minute virus of mice capsid specifically recognizes the 3' hairpin structure of the viral replicative-form DNA: mapping of the binding site by hydroxyl radical footprinting. Journal of Virology. 65(9):4629-35,1991. Willwand K. Kaaden OR. Proteins of viral and cellular origin bind to the Aleutian disease virus (ADV) DNA 3'-terminal hairpin: presentation of a scheme for encapsidation of ADV DNA. Journal of Virology. 64(4):1598-605, 1990. Wilson G M . Jindal HK. Yeung DE. Chen W. Astell CR. Expression of minute virus of mice major nonstructural protein in insect cells: purification and identification of ATPase and helicase activities. Virology. 185(l):90-8, 1991. Wold MS. Li JJ. Kelly TJ. Initiation of simian virus 40 D N A replication in vitro: large-tumor-antigen- and origin-dependent unwinding of the template. Proceedings of the National Academy of Sciences of the United States of America. 84(ll):3643-7,1987. Wu C. Zannis-Hadjopoulos M . Price GB. In vivo activity for initiation of D N A replication resides in a transcribed region of the human genome. Biochimica et Biophysica Acta. 1174(3):258-66, 1993. Yeung DE. Brown GW. Tarn P. Russnak RH. Wilson G. Clark-Lewis I. Astell CR. Monoclonal antibodies to the major nonstructural nuclear protein of minute virus of mice. Virology. 181(l):35-45, 1991. 

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
https://iiif.library.ubc.ca/presentation/dsp.831.1-0087850/manifest

Comment

Related Items