Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

The complete nucleotide sequence of prune dwarf ilarvirus RNA1 and virus detection by reverse transcription… Rampitsch, Christof 1996

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1996-148173.pdf [ 6.35MB ]
Metadata
JSON: 831-1.0087819.json
JSON-LD: 831-1.0087819-ld.json
RDF/XML (Pretty): 831-1.0087819-rdf.xml
RDF/JSON: 831-1.0087819-rdf.json
Turtle: 831-1.0087819-turtle.txt
N-Triples: 831-1.0087819-rdf-ntriples.txt
Original Record: 831-1.0087819-source.json
Full Text
831-1.0087819-fulltext.txt
Citation
831-1.0087819.ris

Full Text

THE COMPLETE NUCLEOTIDE SEQUENCE OF PRUNE DWARF ILARVIRUS RNA1 AND VIRUS DETECTION BY REVERSE TRANSCRIPTION PCR AND TRIPLE-ANTIBODY SANDWICH ELISA  by CHRISTOF B.Sc,  RAMPITSCH  U n i v e r s i t y o f the Witwatersrand,  1988  M . S c , U n i v e r s i t y o f the Witwatersrand,  1990  A THESIS SUBMITTED IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF  PHILOSOPHY  in THE FACULTY OF GRADUATE STUDIES Department of Plant  Science  We accept t h i s t h e s i s as conforming t o the r e q u i r e d  THE UNIVERSITY OF BRITISH COLUMBIA September 1996 ®Christof  Rampitsch, 1996  standard  In  presenting this  degree at the  thesis in  University of  partial  fulfilment  of  of  department  this thesis for or  by  his  or  requirements  British Columbia, I agree that the  freely available for reference and study. I further copying  the  representatives.  an advanced  Library shall make it  agree that permission for extensive  scholarly purposes may be granted her  for  It  is  by the  understood  that  head of copying  my or  publication of this thesis for financial gain shall not be allowed without my written permission.  Department of  PL/h^T  S d ^ J c ^ ,  The University of British Columbia Vancouver, Canada  Date  DE-6 (2/88)  ABSTRACT A t r i p l e antibody assay  sandwich enzyme-linked immunosorbent  (TAS-ELISA) with a monoclonal antibody was  and e v a l u a t e d f o r the d e t e c t i o n of prune dwarf (PDV) i n sweet c h e r r y t r e e s  {Prunus  avium).  developed  ilarvirus  A reverse  t r a n s c r i b e d polymerase c h a i n r e a c t i o n t e s t was a l s o  developed  to e s t a b l i s h the i n c i d e n c e of PDV i n 40 sweet c h e r r y t r e e s and t o c o n f i r m the absence of v i r u s i n 15 c o n t r o l t r e e s . Trees with t w o - t h i r d s of t h e i r leaves p o s i t i v e f o r PDV by TAS-ELISA would be i d e n t i f i e d with 99% p r o b a b i l i t y by t e s t i n g f o u r l e a v e s per t r e e . r e a c t w i t h Prunus  The monoclonal antibody d i d not c r o s s -  n e c r o t i c r i n g s p o t i l a r v i r u s i n the TAS-  ELISA. The n u c l e o t i d e sequence of PDV RNA1 RNA  was determined.  The  c o n s i s t s of 3374 n u c l e o t i d e s and encodes a s i n g l e open  r e a d i n g frame of 3168 n u c l e o t i d e s . product  The p u t a t i v e t r a n s l a t i o n  i s 1055 amino a c i d s i n l e n g t h with a c a l c u l a t e d  molecular mass of 118.9 kDa.  Both the n u c l e i c a c i d and the  t r a n s l a t e d amino a c i d sequences show s t r o n g e r homology to RNA1  and the corresponding  a l f a l f a mosaic a l f a m o v i r u s ilarvirus,  t r a n s l a t i o n product (AMV)  (ORF1) of  than' t o c i t r u s l e a f rugose  the o n l y other i l a r v i r u s f o r which RNA1  sequence  data i s a v a i l a b l e .  There i s e x t e n s i v e sequence homology i n  the 3 ' - u n t r a n s l a t e d  r e g i o n s of PDV RNA1  other i l a r v i r u s and AMV  RNAs.  and the 3'-regions  of  The r e p o r t e d sequence and i t s  s i n g l e open r e a d i n g frame conform t o the genomic o r g a n i z a t i o n Page i i  t y p i c a l  of  the  Clones RNA1  were  representing  used  i n t e r f e r i n g  Bromoviridae  to  genus. sequence  construct  p a r t i c l e  and  its  a  from  the  deletion-type a b i l i t y  to  5'-  and  3'-end  of  defective  r e p l i c a t e  in  vivo  was  Page  i i i  assessed.  TABLE OF CONTENTS Abstract Table of Contents L i s t o f Tables L i s t of F i g u r e s L i s t of A b b r e v i a t i o n s Acknowledgements Foreword 1.0  i i iv v i i viii ix xi xii  INTRODUCTION  1  1.1 Diseases and spread of prune dwarf v i r u s 1. 2 D e t e c t i o n of prune dwarf v i r u s 1.3 G e n e t i c s of prune dwarf v i r u s 1. 4 D e f e c t i v e i n t e r f e r i n g RNA 1.5 The n u c l e o t i d e sequence of PDV RNA1 1. 6 O b j e c t i v e s of t h i s study 2 . 0 MATERIALS AND METHODS  1 4 7 11 12 14 15  2.1.0 P u r i f i c a t i o n procedures 2.1.1 V i r u s o r i g i n 2.1.2 V i r u s p u r i f i c a t i o n 2.1.3 Coat p r o t e i n e l e c t r o p h o r e s i s 2.1.4 Genomic RNA i s o l a t i o n 2.1.5 E x t r a c t i o n of dsRNA from i n f e c t e d l e a v e s  15 15 15 17 18 19  2.2.0 Antibody production 21 2.2.1 P r o d u c t i o n of p o l y c l o n a l a n t i b o d i e s i n chickens 21 2.2.2.0 P r o d u c t i o n of monoclonal a n t i b o d i e s ... 23 2.2.2.1 Immunization with a f t e r cyclophosphamide treatment 23 2.2.2.2 Determination of the immune response by TAS-ELISA 24 2.2.2.3 F u s i o n mediated by p o l y e t h y l e n e glycol 25 2.2.3 S i n g l e c e l l c l o n i n g 28 2.2.4 Cryogenic storage of hybridomas 29 2.2.5 I s o l a t i o n of antibody from t i s s u e c u l t u r e supernatant and i s o t y p i n g 29 2.2.6 Western b l o t 31 2.2.7 Conjugation of PDA-3C t o a l k a l i n e phosphatase 32 2.2.8 P r o d u c t i o n of F ( a b ' ) fragments from PDA-3C..34 2.2.9 D e t e c t i o n of PDV by TAS-ELISA, RT-PCR and bioassay i n sweet cherry 35 2  Page i v  2.3.0 cDNA 1 i b r a r y of PDV 37 2.3.1 P r e p a r a t i o n of cDNA: f i r s t - s t r a n d synthesis..37 2.3.2 Second-strand synthesis 38 2.3.3 End p o l i s h i n g r e a c t i o n 38 2.3.4 Blunt-end l i g a t i o n 39 2.3.5 P r e p a r a t i o n o f competent E. coli 40 2.3.6 Screening c o l o n i e s f o r i n s e r t s by PCR 42 2.3.7 I d e n t i f y i n g i n s e r t s u s i n g Northern b l o t s 42 2.3.8 Preparation f o r sequencing 44 2.3.9 Exo III d e l e t i o n s 45 2.3.10 Sequence alignment 47 2.3.11 cDNA c l o n i n g of PDV RNA1 47 2.3.12 The sequence of the 5' end of PDV RNA1 48 2.3.13 C l o n i n g the 3' r e g i o n of PDV RNA1 49 2 . 3 .14 Sequence comparisons and phylogeny 51 2.3.15 RT-PCR assay 52 2.4.0 P r e p a r a t i o n of a d e f e c t i v e i n t e r f e r i n g p a r t i c l e . . . 5 3 2.4.1 P r e p a r a t i o n of a snapback-type DI p a r t i c l e by PCR 53 2.4.2 P r e p a r a t i o n of a snapback-type DI p a r t i c l e with s y n t h e t i c o l i g o n u c l e o t i d e s 56 2.4.3 P r e p a r a t i o n of a d e l e t i o n - t y p e DI p a r t i c l e . . . 5 9 2.4.4 R e p l i c a t i o n of a DI p a r t i c l e in vivo 59 3.0 RESULTS  62  3.1.0 V i r u s p u r i f i c a t i o n 62 3.1.1 V i r a l RNA separation 64 3.2.0 Antibody production 66 3.3.0 Primer p a i r s #1 and #2 i n RT-PCR 68 3.3.1 D e t e c t i o n of PDV by RT-PCR i n sweet cherry...71 3.4.0 R e s u l t s of the f i e l d survey 71 3.4.1 I d e n t i f i c a t i o n of PDV-infected t r e e s 71 3.4.2 D e t e c t i o n of PDV by TAS-ELISA 75 3.5.0 A l t e r n a t e t r a p p i n g a n t i b o d i e s 78 3.6.0 The p a r t i a l n u c l e o t i d e sequence of PDV RNA3 81 3.7.0 The complete n u c l e o t i d e sequence of PDV RNA1 81 3.7.1 P h y l o g e n e t i c r e l a t i o n s h i p s of PDV t o other Bromoviridae, based on RNA1 90 3.8.0 R e p l i c a t i o n of the DI RNA 90  4 . 0 DISCUSSION AND CONCLUSION 4.1.0 V i r u s i s o l a t i o n and n u c l e i c a c i d a n a l y s i s 4.2.0 Monoclonal antibody p r o d u c t i o n 4.3.0 T r i p l e antibody sandwich EL ISA 4.4.0 A l t e r n a t e t r a p p i n g a n t i b o d i e s 4.5.0 The p a r t i a l n u c l e o t i d e sequence of RNA3  94 94 95 96 98 99 Page v  4.6.0 The RT-PCRassay 4.7.0 The complete n u c l e o t i d e sequence o f RNA1 4.8.0 P h y l o g e n e t i c r e l a t i o n s h i p s among Bromoviridae based on RNA1 4.9.0 P r o d u c t i o n and r e p l i c a t i o n of the a r t i f i c i a l DI RNAs 4.10.0 Concluding remarks BIBLIOGRAPHY  99 100 102 103 105 106  Page v i  LIST OF TABLES  Table 1. O l i g o n u c l e o t i d e c a s s e t t e s f o r DI p a r t i c l e s  57  Table 2. TAS-ELISA r e s u l t s u s i n g monoclonal antibody PDA-3C..69 Table 3. Summary of f i e l d i n d e x i n g r e s u l t s  73  Table 4. Summary of RT-PCR, b i o a s s a y TAS-ELISA r e s u l t s  76  Table 5. Summary of PDV TAS-ELISA r e s u l t s  77  Table 6. ELISA w i t h a l t e r n a t e t r a p p i n g a n t i b o d i e s  80  Page v i i  LIST OF FIGURES  F i g u r e 1. Plasmid used t o c o n s t r u c t DI template  GO  F i g u r e 2. V i r u s p u r i f i c a t i o n , SDS PAGE r e s u l t s  63  F i g u r e 3. Agarose g e l e l e c t r o p h o r e s i s of PDV RNA  65  F i g u r e 4 . Western b l o t with PDA-3C  67  F i g u r e 5. RT-PCR t r i a l s with primer p a i r s #1 and #2  70  F i g u r e 6. RT-PCR assay r e s u l t s of sweet c h e r r y t r e e s  72  F i g u r e 7. SDS-PAGE a n a l y s i s of F ( a b ' )  79  2  fragments  F i g u r e 8. Alignment of PDV RNA3 clones w i t h PDV RNA3  82  F i g u r e 9. Alignment of clones used t o sequence RNA1  84  F i g u r e 10. The complete n u c l e o t i d e sequence of PDV RNA1  85  F i g u r e 11. Comparison of the 3' ends of i l a r - and AMV RNA1. . .89 F i g u r e 12. P h y l o g e n e t i c r e l a t i o n s h i p s of PDV & F i g u r e 13. R e p l i c a t i o n of the DI RNA i n pumpkins  Bromoviridae..91 92  Page v i i i  LIST OF ABBREVIATIONS AMV ApMV AP /3ME  BMV bp BSA CiLRV CIP CMV DAS-ELISA DI DMEM DNase DTT dsRNA EDTA EL ISA FCS HAP HAT IgY IPTG kDa kb MEA Me-HgOH NC ORF PAGE PBS PCR PEG PDA-3C  PDA-3C-AP PDV PNRSV Pr RACE RBDV RdRp RNase RT-PCR SDS SSC TAS-ELISA TBS TDT TCS  a l f a l f a mosaic a l f a m o v i r u s apple mosaic i l a r v i r u s a l k a l i n e phosphatase b e t a mercaptoethanol brome mosaic bromovirus base p a i r s bovine serum albumin c i t r u s l e a f rugose i l a r v i r u s c a l f i n t e s t i n a l phosphatase cucumber mosaic cucumovirus double antibody sandwich ELISA defective interfering Dulbecco's m o d i f i e d Eagle medium deoxyribonuclease dithiothreitol double stranded RNA ethylenediaminetetra-acetic acid enzyme-linked immunosorbent assay f o e t a l c a l f serum hydroxylapatite hypoxanthine a m i n o p t e r i n thymidine supplement hen egg y o l k a n t i b o d i e s isopropyl-/3-D- thiogalactoside kilodalton kilobase 2-mercato ethylamine methylmercuric hydroxide nitrocellulose open r e a d i n g frame polyacrylamide g e l electrophoresis Phosphate b u f f e r e d s a l i n e polymerase c h a i n r e a c t i o n , polyethylene g l y c o l a murine anti-PDV monoclonal IgG a n t i b o d y a l k a l i n e phosphatase conjugate o f PDA-3C prune dwarf i l a r v i r u s Prunus n e c r o t i c r i n g s p o t i l a r v i r u s P r o b a b i l i t y of d e t e c t i o n of PDV r a p i d a m p l i f i c a t i o n of cDNA ends r a s p b e r r y bushy dwarf i d a e o v i r u s RNA-dependent RNA polymerase ribonuclease r e v e r s e t r a n s c r i p t i o n PCR sodium dodecyl sulphate standard s a l i n e c i t r a t e t r i p l e antibody sandwich ELISA Tris buffered saline terminal deoxynucleotidyl transferase t i s s u e c u l t u r e supernatant 1  Page i x  TSV UTR X-gal  tobacco s t r e a k i l a r v i r u s untranslated region 5-bromo-4 - c h l o r o - 3 - i n d o l y l - / 3 - D - g a l a c t o s i d e  Page x  ACKNOWLEDGEMENTS  I would l i k e t o extend my s i n c e r e g r a t i t u d e t o my research for  supervisor,  the o p p o r t u n i t y  Dr. Ken E a s t w e l l ,  f o r h i s guidance and  of working i n h i s l a b o r a t o r y .  I would  a l s o l i k e t o thank the d i r e c t o r of the Summerland Research Centre f o r p r o v i d i n g the r e s e a r c h assistance  as was f u r t h e r  Chamber of Commerce was g r e a t l y  (and f a r greater)  f i n a n c i a l help  appreciated from my  F i n a l l y I would l i k e t o thank members of my l a b , my  f r i e n d s a t UBC and my s u p e r v i s o r y advice  Financial  i n the form of a one year s c h o l a r s h i p from the  Austrian Federal  parents.  facilities.  committee  for helpful  and suggestions.  Page x i  FOREWORD  Some of the r e s u l t s i n s e c t i o n 3.3.1 published  i n the  Rampitsch, C ,  following  Eastwell,  to 3.4.2  article:  K.C.  and  Hall, J.  c o n f i d e n c e l i m i t s f o r the d e t e c t i o n  (1995) S e t t i n g  of prune dwarf v i r u s i n  Prunus avium w i t h a monoclonal antibody based antibody-sandwich ELISA.  have been  Annals  of Applied  triple  Biology  126:  485-491  Dr. helping and  K.  Eastwell's  r o l e i n t h i s p u b l i c a t i o n was  to p l a n the o v e r a l l experiment and  c r i t i c i s m during  advice d u r i n g  i t s execution.  results.  laboratory  i n g i v i n g advice  J . H a l l a l s o gave  the p l a n n i n g of the experiment, but  i n v o l v e d p r i n c i p a l l y i n c a r r y i n g out of the  Dr.  My  involvement was  the  f i e l d indexing  the RT-PCR a n a l y s i s and  was  statistical  i n doing a l l of  work, i n c l u d i n g the p r o d u c t i o n of the  antibody, the  in  analysis the  monoclonal  by TAS-ELISA, the b i o a s s a y  i n a s s i s t i n g w i t h the  and  statistical  analysis  Results 3.7.0  and  of the n u c l e o t i d e  sequence of RNA1  3.7.1) have been submitted under the  (sections title:  Page x i i  Rampitsch,  C.  and E a s t w e l l , K.C.  n u c l e o t i d e sequence t o t h e Archives  of  of prune  (1996)  dwarf  The  complete  i l a r v i r u s RNA1.  Submitted  Virology  Dr E a s t w e l l ' s r o l e i n t h i s p u b l i c a t i o n was  i n giving  a d v i c e and s u g g e s t i o n s t h r o u g h o u t t h e d u r a t i o n o f t h e and s e q u e n c i n g . cloning, The  My  i n v o l v e m e n t was  i n c a r r y i n g out  s e q u e n c i n g and t h e a n a l y s i s o f t h e sequence  o f RNA1  cloning  the  sequence.  has b e e n d e p o s i t e d w i t h t h e GenBank  and a s s i g n e d t h e a c c e s s i o n number U57648.  (C.  Rampitsch)  .\K.C. E a s t w e l l )  TJ.  Hall)  Page  xiii  1.0  INTRODUCTION  1.1 D i s e a s e s and spread of prune dwarf v i r u s The i l a r v i r u s d i s e a s e s o f c h e r r y t r e e s are caused by prune dwarf i l a r v i r u s (PNRSV).  (PDV) and Prunus n e c r o t i c r i n g s p o t v i r u s  S t r a i n s and combinations  of these i l a r v i r u s e s are  r e s p o n s i b l e f o r at l e a s t 11 d i s e a s e s i n sweet c h e r r y {Prunus avium L.) and sour c h e r r y (P. cerasus 1996).  L.) (Mink & Jones  T h i s review l i s t s seven d i s e a s e s on c h e r r y c u l t i v a r s  caused by (PNRSV) and s i x caused by (PDV) w i t h two a p p a r e n t l y caused by both. (P. persica plum  Nemeth (1986) l i s t s a f u r t h e r two i n peach  L . ) , three i n a p r i c o t  (P. domestica  (P. armeniaca  L.) and two i n almond  L.), s i x i n  (P. dulcis L . ) .  However, some o f these are caused by c o - i n f e c t i o n o f PDV and PNRSV, and one by c o - i n f e c t i o n of PNRSV w i t h apple leafspot trichovirus  (Nemeth 1986).  Such dual  u s u a l l y cause more severe symptoms than s i n g l e  chlorotic  infections infections.  F r u i t t r e e s i n f e c t e d w i t h PDV o r PNRSV show two phases of symptom e x p r e s s i o n (Gilmer e t al. 1975). symptom appears  i n the f i r s t  An acute, shock  season a f t e r i n f e c t i o n , o r i f  the i n f e c t i o n o c c u r r e d e a r l y i n s p r i n g , shock symptoms may appear i n the same season.  T y p i c a l l y these are seen as l e a f  d i s c o l o u r a t i o n , n e c r o t i c l e s i o n s and may i n c l u d e f r u i t damage.  The second phase occurs i n the next season and w i l l  reappear a n n u a l l y .  These c h r o n i c symptoms may be q u i t e m i l d , Page 1  even absent different distinct  i n some c u l t i v a r s .  Chronic symptoms are  from acute and may i n c l u d e any o r a l l o f s e v e r a l symptoms i n c l u d i n g c h l o r o t i c l e s i o n s ,  t r e e - s i z e , reduced percentage of bud-take, and u s u a l l y a reduced y i e l d .  decreased  delayed ripening  Y i e l d can be reduced by 50% o r  more i n sour c h e r r y y e l l o w s d i s e a s e and t h i s i s one of the most s e r i o u s d i s e a s e s of sour c h e r r y i n North (Davidson & George 1965). quality,  America  Although PDV does not a f f e c t  i t i s a problematic v i r u s f o r f r u i t  fruit  growers s i n c e  Prunus are propagated v e g e t a t i v e l y and the presence o f PDV g r e a t l y reduces the percentage  of bud-take  (Gilmer e t al.  1975) . I l a r v i r u s e s are spread i n three ways. r e a d i l y by g r a f t i n g i n f e c t e d t i s s u e , through seed  some can be spread  (Casper 1977) and a few have been shown t o be  pollen transmissible. spp.)  Western flower t h r i p s  are l i k e l y v e c t o r s f o r the p o l l e n  ilarviruses  A l l are spread  (Frankliniella  transmissible  (Greber e t a 2 . 1991; Sdoode & Teakle 1993).  With  these t h r e e modes of 'transmission, PDV and PNRSV can e a s i l y be i n t r o d u c e d and spread r a p i d l y through orchards c a u s i n g l o s s e s i n f r u i t y i e l d w i t h i n a few years 1992).  (Uyemoto e t al.  The most frequent source of new i n f e c t i o n s i n  orchards i s the i n t r o d u c t i o n of i n f e c t e d m a t e r i a l , s i n c e fruit  t r e e s are v e g e t a t i v e l y propagated.  It i s very  important that a l l bud-wood and s e e d l i n g s d i s t r i b u t e d by n u r s e r i e s are c e r t i f i e d v i r u s - f r e e .  S e e d l i n g s may be Page 2  i n f e c t e d i f a maternal t r e e was pollen not  (Casper 1977).  p o l l i n a t e d with i n f e c t e d  I t i s thought that PDV  i n f e c t the maternal t r e e during  and  PNRSV w i l l  f e r t i l i z a t i o n and i t  remains v i r u s - f r e e u n l e s s there i s p h y s i c a l damage at s i t e where i n f e c t e d p o l l e n lands. transmission  the  By analogy to v i r u s  to herbaceous hosts, f e e d i n g  behaviour by  thrips  appears t o p r o v i d e s u f f i c i e n t damage to a l l o w the v i r u s i n f e c t the t r e e I t has PDV  and  (Greber et al.  still  1992).  not been shown that t h r i p s are v e c t o r s  PNRSV i n Prunus spp.  herbaceous p l a n t s ,  but  Western flower t h r i p s  and  madronii)  virus  raspberries  (Bulger et al.  1991)  abdominalis  spread tobacco streak  evidence i s over-  (Frankliniella  were i m p l i c a t e d  (RBDV, a p o l l e n t r a n s m i t t e d  idaeovirus) and  F. occidentalis  c o t y l e d o n s dusted w i t h PDV et al.  1992).  The  and  occidentalis  i n r a s p b e r r y bushy dwarf transmission  (TSV)  (Greber et al.  are able to i n f e c t  insects.  that  responsible  (Greber was  feeding  the p l a n t through c e l l s damaged by  the  P l a n t s dusted w i t h p o l l e n alone, or caged  w i t h t h r i p s alone f a i l e d to develop symptoms. stressed  1991).  cucumber  PNRSV i n f e c t e d p o l l e n  t r a n s f e r r e d from the p o l l e n to the p l a n t d u r i n g  feeding  through  experiments i n d i c a t e d that v i r u s  presumably e n t e r i n g  in  Microcephalothrips  ilarvirus  tobacco f i e l d s i n Queensland, A u s t r a l i a More i m p o r t a n t l y  for  based on experiments with  the c i r c u m s t a n t i a l  whelming. Thrips  to  i t was  The  authors  u n l i k e l y that the t h r i p s were  for transporting  the  i n f e c t e d p o l l e n from t r e e  to  Page 3  t r e e , because they c l e a n themselves c a r e f u l l y before This transport  r o l e has been assigned  p o l l i n a t e the t r e e s i n s p r i n g  flying.  t o honey bees which  (Uyemoto e t al. 1992).  Greber  et al. (1991) a l s o s t r e s s e d the importance of weed populations  i n tobacco f i e l d s a c t i n g as a r e s e r v o i r and  a l t e r n a t e host  forthrips.  l i n k e d immunosorbent assays  Further  evidence, u s i n g enzyme-  (ELISA),  D i g i a r o e t al. (1992)  found PNRSV and PDV both on the s u r f a c e and w i t h i n p o l l e n g r a i n s although they c o u l d not d e t e c t (ApMV) i n a s s o c i a t i o n with p o l l e n .  apple mosaic  Kryczynski  ilarvirus  e t a l . (1992)  have noted a c o r r e l a t i o n between f l o w e r i n g i n t e n s i t y and the spread o f PNRSV through sour c h e r r y experimental  1.2  D e t e c t i o n of prune dwarf Traditionally,  orchards.  virus  f r u i t t r e e s are t e s t e d f o r PDV and PNRSV  i n the s p r i n g , by budding onto an i n d i c a t o r t r e e .  The most  commonly used i n d i c a t o r f o r these i l a r v i r u s e s i s P. cv. S h i r o f u g e n  (Gilmer  e t al. 1975).  serrulata  T h i s t r e e responds t o  i l a r v i r u s i n f e c t i o n by a h y p e r s e n s i t i v e  gumming response at  the bud union w i t h i n f o u r t o s i x weeks when budded w i t h i n f e c t e d wood. sativus)  Mechanical t r a n s m i s s i o n  and squash  both PDV and PNRSV.  necrosis.  (Cucumis  (Cucurbita maxima) i s a l s o p o s s i b l e w i t h Both v i r u s e s show l o c a l c h l o r o t i c  l e s i o n s on the i n o c u l a t e d cotyledons systemic i n f e c t i o n .  t o cucumber  accompanied by a  PNRSV i n f e c t i o n s o f t e n r e s u l t i n a p i c a l  Some squash c u l t i v a r s ,  such as 'Buttercup', show Page 4  c h l o r o t i c v e i n c l e a r i n g of the t r u e l e a v e s when i n f e c t e d with PDV  and  t h i s c u l t i v a r i s frequently  used as a source of  for p u r i f i c a t i o n .  PNRSV w i l l e l i c i t  Chenopodium  and  quinoa  t h i s plant  d i s t i n g u i s h between the  two  ringspot  symptoms i n  i s sometimes used to  i l a r v i r u s e s i n a bioassay.  S e r o l o g i c a l techniques have been a p p l i e d to plant viruses  (Clarke  & Adams 1977). The  ELISA because of i t s f l e x i b i l i t y and i s quicker rather but  i t does r e q u i r e  v i r u s t o be  and  most p o p u l a r i s the  scale-up p o t e n t i a l .  tested.  i t i s v e r y r e l i a b l e and  PNRSV.  l e s s expensive,  are able  to d i f f e r e n t i a t e between  r e l i a b i l i t y of the assay depends to a  l a r g e degree on the  s e r o l o g i c a l d i v e r s i t y of the v i r u s i n  on the a b i l i t y of the a v a i l a b l e serum to  r e c o g n i z e these serotypes.  Polyclonal  a n t i s e r a can both be used i n ELISA. antibodies  and  monoclonal  In g e n e r a l monoclonal  o f f e r a lower background, but  s p e c i f i c i t y may serotypes.  the  S e r o l o g i c a l assays are a l s o more  The  q u e s t i o n and  It  days  the a v a i l a b i l i t y of antiserum a g a i n s t  s p e c i f i c than b i o a s s a y s and PDV  indexing  than the bioassay, y i e l d i n g r e s u l t s w i t h i n  than weeks and  PDV  t h e i r higher  cause a f a i l u r e to r e a c t w i t h c e r t a i n v i r u s  Polyclonal antibodies  are g e n e r a l l y  better  s u i t e d f o r v i r u s e s w i t h many serotypes, e s p e c i a l l y i f f a l s e n e g a t i v e r e s u l t s are h i g h l y u n d e s i r a b l e . p o l y c l o n a l a n t i s e r a s p e c i f i c f o r PDV (Torrance & Dolby 1984;  and  Both monoPNRSV are  and  available  McMorran & Cameron 1983), and  have  been used i n s e r o l o g i c a l assays to assess the extent of v i r u s Page 5  i n f e c t i o n s i n Washington et al.  1989;  1992)  (Mink 1984)  and  California  by double-antibody sandwich  (DAS)-ELISA.  Perhaps the b i g g e s t drawback to s e r o l o g i c a l applied  (Uyemoto  techniques  to i n d e x i n g i s t h i s problem of serotypes of  which the  a n t i b o d i e s may  not  recognize or r e c o g n i z e p o o r l y .  PNRSV i s s e r o l o g i c a l l y d i v e r s e to ApMV, but based on 1983).  The  is serologically  McMorran & Cameron  problem of s e r o l o g i c a l d i v e r s i t y can i f available,  or polymerase c h a i n r e a c t i o n  recent survey C r o s s l i n et al.  (1992) used  be  overcome  or by r e s o r t i n g  techniques such as b i o a s s a y s , n u c l e i c  hybridization  related  have been found  (Torrance & Dolby 1984;  by u s i n g a p o o l of a n t i s e r a , alternate  and  no d i s t i n c t subgroups of PDV  serology  viruses  acid  (PCR).  In a  radioactively  l a b e l l e d PNRSV r i b o p r o b e s to c o n f i r m ELISA r e s u l t s , s i n c e l a t t e r does not serotype was PCR  d e t e c t the  CH3 0 serotype of PNRSV.  r e a d i l y d e t e c t e d by n u c l e i c  and  immuno-capture PCR,  techniques c u r r e n t l y  available  viruses.  Wetzel et al.  f g of plum pox  p o t y v i r u s RNA  particles)  acid  the  This  hybridization.  r e l a t e d assays such as r e v e r s e t r a n s c r i p t i o n  (RT-PCR) and  plant  to  are  the most  f o r the  PCR  sensitive  routine  detection  of  (1991) were a b l e to d e t e c t  10  (approximately 2000 v i r u s  i n a f i e l d i n d e x i n g t r i a l by RT-PCR.  They found  t h i s technique to be more s e n s i t i v e than n u c l e i c  acid  hybridization  previously  with P 32  l a b e l l e d probes, which had  been the most s e n s i t i v e assay f o r p l a n t vivo.  Another study comparing monoclonal a n t i b o d i e s , » ,  in  virus detection DNA  Page 6  probes and  PCR  to d e t e c t grapevine y e l l o w s d i s e a s e  a phytoplasma, a l s o found that PCR 10 f g of t a r g e t and was techniques t e s t e d obtained  could detect  approximately  the most s e n s i t i v e of the  (Chen et al.  1993).  caused by  three  S i m i l a r r e s u l t s were  from a study w i t h grapevine f a n l e a f nepovirus  d e t e c t i o n i n grapevine  (Rowhani et al.  1993)  where again  the  authors were able t o d e t e c t v i r u s i n the f g range. In a d d i t i o n these s t u d i e s h i g h l i g h t some of the problems encountered w i t h PCR bark and  of woody t i s s u e samples  (leaves,  shoots) because of i n h i b i t o r y substances present  the t i s s u e .  There have been no l a r g e - s c a l e PCR  s t u d i e s i n v o l v i n g i l a r v i r u s e s to date.  e s p e c i a l l y i n tissue preparation  so that  technique can be used to index l a r g e numbers of p l a n t s inexpensively  sensitivity  (eg. Korschineck et al.  Genetics PDV  being  procedure,  and d e t e c t i o n ,  r a p i d l y and  in  indexing  E f f o r t s are now  made to s i m p l i f y and modify the b a s i c PCR  1.3  roots,  as p o s s i b l e without  the as  sacrificing  1991).  of prune dwarf v i r u s  i s a member of the Bromoviridae  (Rybicki 1995).  T h i s genus i n c l u d e s f o u r genera of p l a n t v i r u s e s : bromoviruses, i l a r v i r u s e s ,  cucumoviruses and  alfamoviruses.  A l l members are t r i p a r t i t e with i c o s a h e d r a l or isometric p a r t i c l e s . single-stranded  and  T h e i r genomic RNAs are each RNA  genomic RNAs are 3.2-3.6 kb  the  quasi-  positive-sense,  i s encapsidated s e p a r a t e l y . (RNA1), 2.6-3.0 kb  (RNA2),  The 2.1-  Page 7  2.2 kb (RNA3) w i t h a 0.8-1.0 kb subgenomic RNA. o r g a n i z a t i o n o f the bromovirus, cucumovirus  The genome  and a l f a m o v i r u s  genera i s w e l l e s t a b l i s h e d s i n c e s e v e r a l members have been sequenced  completely (eg. AMV: C o r n e l i s s e n e t a l . 1983a;  1983i>; Barker e t al. 1983; Brederode  e t al. 1980).  genome o r g a n i z a t i o n of a l l Bromoviridae  The  s t u d i e d t o date i s  i d e n t i c a l w i t h analogous genes encoded by analogous  segments.  RNA1 and RNA2 a r e m o n o c i s t r o n i c , encoding p r o t e i n s thought t o be i n v o l v e d i n r e p l i c a t i o n s i n c e RNA1 and RNA2 can r e p l i c a t e independently o f RNA3 i n p r o t o p l a s t s Nassuth e t a l . 1981).  RNA3 i s b i c i s t r o n i c encoding the  movement and coat p r o t e i n s . the subgenomic RNA.  The l a t t e r i s t r a n s l a t e d  from  These p r o t e i n s have been produced i n  c e l l - f r e e t r a n s l a t i o n systems movement p r o t e i n  ( K i b e r s t i s e t al. 1981;  (Dougherty & H i e b e r t 1985); the  (ORF3a) i s r e q u i r e d f o r systemic i n f e c t i o n  of AMV i n tobacco l e a v e s (Huisman e t a l . 1986). The RNA s p e c i e s of a l l known Bromoviridae m G 'ppp 'Gp cap but no 3'-poly (A) t a i l . 7  5  5  s i m i l a r i t i e s a t the genome l e v e l ,  have a 5'-  In s p i t e o f these  there are important  d i f f e r e n c e s i n s t r u c t u r e , s e r o l o g y and mode o f t r a n s m i s s i o n amongst the genera of the TSV  Bromoviridae.  i s the type member of the i l a r v i r u s genus and the  f i r s t member f o r which sequence has been sequenced  data was r e p o r t e d .  I t s RNA3  completely ( C o r n e l i s s e n e t a l . 1984), and  the 180 3'- and 140 3'- n u c l e o t i d e s of RNA1 and RNA2 r e s p e c t i v e l y , have a l s o been sequenced  (Koper-Zwarthoff & B o l Page 8  1980).  The genome o r g a n i z a t i o n of TSV has been i n f e r r e d from  c e l l - f r e e t r a n s l a t i o n assays and i s t y p i c a l of the Bromoviridae  o r g a n i z a t i o n as o u t l i n e d above:  RNA1 and RNA2  encode 120 kDa and 100 kDa p r o t e i n s , r e s p e c t i v e l y .  These  RNAs e x h i b i t sequence homology w i t h RNA r e p l i c a s e s from other p l a n t and animal v i r u s e s as w e l l as phage 1984).  RNA3 of TSV i s b i c i s t r o n i c ,  (Kamer & Argos  encoding a 34 kDa  movement p r o t e i n and a 24 kDa coat p r o t e i n t r a n s l a t e d from a subgenomic  RNA4  (van T o l & van V l o t e n - D o t i n g 1979).  The  f o l l o w i n g i l a r v i r u s sequences are a l s o known: ApMV RNA3 ( A l r e f a i e t al.  1994; Sanchez-Navarro & P a l l a s 1994), PNRSV  RNA3 (Guo e t al.  1995; Hammond & C r o s s l i n 1995), PDV RNA3  (Bachman e t a l . 1994), c i t r u s l e a f rugose v i r u s  (CiLRV) RNA3  and c i t r u s v a r i e g a t i o n v i r u s RNA3 (Scott & Ge 1995b), r i n g m o t t l e RNA3 (Scott & Ge 1995a) CiLRV RNA2 1994)  and CiLRV RNA1 (Scott & Ge 1995c).  genome  There are a t l e a s t two known  exceptions to t h i s organization: Di T e r l i z z i r e p o r t e d an e x t r a subgenomic  (Ge & S c o t t  A l l of these  sequences a r e c o n s i s t e n t w i t h the Bromoviridae o r g a n i z a t i o n t y p i f i e d by AMV.  lilac  e t a l . (1992)  RNA of unknown o r i g i n  associated  w i t h PNRSV and Ding e t a l . (1994) showed that an e x t r a subgenomic  RNA i n cucumber mosaic cucumovirus (CMV)  p r e p a r a t i o n s i s d e r i v e d from RNA2 and c o n t a i n s an ORF o f 100 codons.  The f u n c t i o n of the p o t e n t i a l gene product, ORF 2b,  i s not known and i t i s not known whether e i t h e r of these RNAs are t r a n s l a t e d in  vivo.  Page 9  The  i l a r v i r u s e s and AMV r e q u i r e a l l three genomic RNAs  p l u s e i t h e r a copy of the coat p r o t e i n o r the subgenomic RNA4 to i n i t i a t e i n f e c t i o n .  The coat p r o t e i n has been shown t o  b i n d s t r u c t u r a l h a i r p i n s a t the 3'-ends of the RNAs & Jaspars 1982) and i t i s thought  (Houwing  that the coat p r o t e i n of  AMV i s l o c a t e d i n the r e p l i c a s e complex. The 3 ' - u n t r a n s l a t e d region  (UTR) of a l l known i l a r v i r u s sequences  (and of AMV)  shares these s t r u c t u r a l h a i r p i n m o t i f s which a r e f l a n k e d by AUGC.  Coat p r o t e i n a c t i v a t i o n i s not s p e c i f i c and the coat  p r o t e i n o f TSV can p r o v i d e some e a r l y f u n c t i o n s f o r the r e p l i c a t i o n o f AMV even though the two share l i t t l e homology  (Reusken e t al.  coat p r o t e i n t o i n i t i a t e  1995).  sequence  BMV and CMV do not r e q u i r e  infection.  S p e c i e s of the bromo- and cucumovirus group have a l s o been sequenced and t h e i r genome o r g a n i z a t i o n i s the same as that o f AMV.  However, the 3'-UTRs f o l d i n t o a tRNA-like  s t r u c t u r e and can be charged w i t h t y r o s i n e in al.  1972).  vitro  (Hall et  The f u n c t i o n of t h i s a m i n o a c y l a t i o n i s not known  but t h e r e a r e some t h e o r i e s . has o t h e r tRNA-like  The 3'-end of these v i r a l  f u n c t i o n s : when aminoacylated  RNAs  they a r e  a b l e t o i n t e r a c t w i t h GTP and a host e l o n g a t i o n f a c t o r , and if CCA  s u p p l i e d w i t h ATP can r e p a i r incomplete  o r broken 3' v i r a l  t e r m i n i (the s i t e of a m i n o a c y l a t i o n of host  tRNA).  Analogy t o tRNA i s s t r u c t u r a l o n l y and there i s almost no sequence homology w i t h tRNA (Perret e t al.  1989).  Deletion  a n a l y s i s o f the 3'-region o f BMV RNA and subsequent  Page 10  r e p l i c a t i o n in  vitro  suggests that the tRNA-like vitro  structure  has  a promoter f u n c t i o n , but t h i s in  has  not been p e r f e c t e d and these f i n d i n g s a r e t e n t a t i v e  r e p l i c a t i o n system  (Dreher & H a l l 1988).  I t i s not known whether BMV RNA i s  aminoacylated in  r e p l i c a t i o n o f BMV RNA proceeds i n the  vivo;  absence o f f r e e t y r o s i n e in  vitro.  suggested t h a t aminoacylation strategy to protect against  1.4 D e f e c t i v e Defective  o f the 3'-end o f v i r a l RNA i s a exonuclease  degradation.  I n t e r f e r i n g RNA interfering  d e r i v e d from the s u p p o r t i n g i t s absence.  F i n a l l y i t has been  (DI) p a r t i c l e s a r e RNA s p e c i e s v i r u s and can not r e p l i c a t e i n  DI RNAs may be e i t h e r d e l e t i o n - t y p e ,  type o r snapback-type  ( S c h l e s i n g e r 1988).  mosaic-  D e l e t i o n DIs  g e n e r a l l y c o n t a i n the 5'- and 3'- t e r m i n i o f the s u p p o r t i n g v i r u s genome which a r e e s s e n t i a l f o r r e p l i c a t i o n , but have d e l e t i o n s i n the open r e a d i n g f u n c t i o n a l product.  frame, which y i e l d s no  Mosaic DIs share sequence w i t h non-  contiguous p o r t i o n s o f the s u p p o r t i n g  v i r u s genome and have  the 5'- and 3'- t e r m i n i o f the s u p p o r t i n g There i s no f u n c t i o n a l gene product.  v i r u s genome.  The snapback type DIs  are long palindromes which can form e i t h e r h a i r p i n s o r panhandles and do not encode a f u n c t i o n a l gene product.  Both  t e r m i n i a r e d e r i v e d from one terminus o f the s u p p o r t i n g  virus  genome.  DI p a r t i c l e s a r e b e l i e v e d t o a r i s e by the copy-  c h o i c e mechanism o f the RNA-dependent RNA polymerase  (RdRp) Page 11  i n a scheme proposed by L a z z a r i n i et al.  (1981).  Although DI p a r t i c l e s are q u i t e common i n animal v i r u s e s , they r a r e l y a r i s e from p l a n t v i r u s e s Rochon 1993;  H i l l m a n et al. 1987)  (eg. Finnen &  and t h e r e are o n l y  r e p o r t s of a n a t u r a l DI p a r t i c l e i n Bromoviridae al.  1993; Marsh et al. 1991).  p a r t i c l e s from two Bromoviridae,  v e i n cucumovirus and from cymbidium  Marsh e t al. 1991;  DI  and beet n e c r o t i c y e l l o w ringspot  tombusvirus  r e p l i c a t e in vivo and a t t e n u a t e d i s e a s e symptoms 1994;  (Romero et  However, a r t i f i c i a l BMV  two  (Hehn et al.  K o l l a r et al. 1993). These  p a r t i c l e s are of the d e l e t i o n - t y p e .  DI  A t t e n u a t i o n of d i s e a s e  symptoms and r e d u c t i o n i n the t i t r e of the s u p p o r t i n g v i r u s are f r e q u e n t l y caused by DI p a r t i c l e s although t h e r e are r a r e cases where symptoms are exacerbated by DI p a r t i c l e s et al. 1993) .  (Romero  Because of t h i s p o t e n t i a l symptom a t t e n u a t i o n ,  because they are unable t o r e p l i c a t e i n h e a l t h y t r e e s i n the absence of h e l p e r v i r u s and because they can be s y n t h e s i z e d in vitro  from cDNA c l o n e s , DI p a r t i c l e s have been  i n v e s t i g a t e d f o r c o n t r o l l i n g p l a n t d i s e a s e s (Hull & Davies 1991).  1.5 The n u c l e o t i d e sequence of PDV  RNA1  The complete n u c l e o t i d e sequences of s e v e r a l members of the Bromoviridae  have been determined  ( s e c t i o n 1.3).  Among  the i l a r v i r u s e s , o n l y CiLRV has been sequenced completely (Scott & Ge 1995b; 1995c; Ge & Scott 1994), and the  sequence Page 12  of AMV i s a l s o known (see s e c t i o n 1.3). viruses  Since a l l RNA  (except r e t r o v i r u s e s ) , i r r e s p e c t i v e o f t h e i r host,  must encode an RdRp and s i n c e t h i s gene i s h i g h l y conserved, it  i s used e x t e n s i v e l y  unrelated  viruses  the Bromoviridae and  i n phylogenetic  (Kamer & Argos 1984).  The RNA1 segment of  encodes p a r t of the v i r a l  t h i s RNA, along w i t h RNA2  protein),  a n a l y s i s among  (which a l s o encodes a r e p l i c a s e  should p r o v i d e u s e f u l i n f o r m a t i o n  r e l a t i o n s h i p of PDV w i t h o t h e r Bromoviridae ilar-  r e p l i c a s e complex,  t o e s t a b l i s h the and w i t h other  and i l a r - l i k e v i r u s e s such as AMV, o l i v e l a t e n t v i r u s 2  (0LV2, an a l f a m o - l i k e Phylogenetic t h e i r genetic  v i r u s , Grieco  e t al. 1990) and RBDV.  analyses of the i l a r v i r u s e s and s t u d i e s of  r e l a t i o n s h i p s t o other Bromoviridae  have been  made p o s s i b l e as the RNA3 sequences of e i g h t i l a r v i r u s e s have r e c e n t l y been determined  ( s e c t i o n 1.3).  The i l a r v i r u s e s have  been d i v i d e d i n t o 10 sub-groups based on s e r o l o g i c a l assays. These groupings are s i m i l a r t o p h y l o g e n e t i c  groupings  observed i n some s t u d i e s u s i n g RNA3 sequence, where a c l o s e genetic  r e l a t i o n s h i p has been observed between PNRSV and ApMV  (subgroup I I I : Guo e t al. 1995) and between CiLRV and c i t r u s variegation virus not  (subgroup I I : Scott  However,  a l l i l a r v i r u s RNA3 segments have been sequenced and the  phylogenetic  a n a l y s e s presented i n these s t u d i e s are not  complete and may be i n a c c u r a t e . and  & Ge 1995b).  Sequences of i l a r v i r u s RNA1  RNA2 segments are even s c a r c e r and a r e a l s o r e q u i r e d t o  form a complete phylogeny of the i l a r v i r u s e s .  Closely Page 13  r e l a t e d v i r u s e s such as AMV and 0LV2, w i l l have t o be included i n a f i n a l phylogenetic  1.6 O b j e c t i v e s In order  analysis.  o f t h i s study t o c o n t r o l a p l a n t disease  a reliable  method f o r the c a u s a l agent i s e s s e n t i a l .  detection  The f i r s t  o b j e c t i v e was t o produce a TAS-ELISA assay based on a monoclonal antibody and t o e s t a b l i s h a r o u t i n e  diagnostic  procedure, d e t e r m i n i n g the r e l i a b i l i t y and accuracy of the s e r o l o g i c a l assay t o d e t e c t  PDV i n i n f e c t e d m a t e r i a l .  At the b e g i n n i n g of t h i s study, there was no sequence data a v a i l a b l e f o r PDV and thus there were no means of developing  an RT-PCR assay f o r the d e t e c t i o n o f PDV.  The  second o b j e c t i v e was t o o b t a i n sequence data from RNA3 of PDV to produce a r e l i a b l e RT-PCR t e s t . to e v a l u a t e The  The RT-PCR would be used  the TAS-ELISA r e s u l t s .  t h i r d o b j e c t i v e was t o o b t a i n the complete sequence  of RNA1 of PDV.  Analogy t o other members of t h i s  family  suggest t h a t RNA1 would encode a p u t a t i v e r e p l i c a s e enzyme. T h i s sequence i n f o r m a t i o n  would be used t o c o n s t r u c t  a r t i f i c i a l DI- p a r t i c l e s t o be used as p o t e n t i a l b i o c o n t r o l agents f o r PDV.  The sequence would a l s o be used t o  i n v e s t i g a t e phylogenetic Bromoviridae,  r e l a t i o n s h i p s among the  e s p e c i a l l y between PDV, CiLRV and AMV.  Page 14  2.0  MATERIALS AND  2.1.0  P u r i f i c a t i o n procedures  2.1.1  Virus A PDV  METHODS  origin i s o l a t e was  Salmo i n 1971  o r i g i n a l l y detected  i n P. avium cv.  at the Summerland Research Centre.  Its  i d e n t i t y has been confirmed by ELISA i n the l a b o r a t o r y of G. Mink hosts  (WSU-IAREC Prosser,  ( C u c u r b i t a spp.  i n i c a t o r P. serrulata  and  WA)  and by i n d e x i n g on herbaceous  C. quinoa)  cv. Shirofugen.  and on the woody The  virus  was  t r a n s f e r r e d to P. mahaleb where i t i s maintained. has been shown t o be f r e e of PNRSV by ELISA unpublished  results).  PDV  C. maxima cv. Buttercup,  was  1% n i c o t i n e and  (Eastwell,  i n the s p r i n g of 1991  rubbing  by  grinding  M phosphate b u f f e r , pH  sap onto pumpkin  dusted w i t h carborundum powder.  This tree  t r a n s m i t t e d to pumpkin,  young a p i c a l leaves i n i c e - c o l d 0.05 with  Dr.  7  cotyledons  Male flowers of t h i s pumpkin  p l a n t were used as inoculum f o r f u r t h e r pumpkin p l a n t s . P o l l e n was hours and  a l s o c o l l e c t e d , allowed s t o r e d at -70°C.  i n i t i a t e new  2.1.2  to a i r dry f o r about  T h i s f r o z e n p o l l e n was  i n f e c t i o n s of pumpkin p l a n t s as  used to  required.  Virus purification Approximately 60 pumpkin s e e d l i n g s were i n o c u l a t e d  PDV  24  from the flowers of an i n f e c t e d pumpkin.  days v i r u s was  i s o l a t e d from these p l a n t s by a  After  with  10-14  modified Page 15  procedure o f F u l t o n  (1959).  Leaves were homogenized i n  1.2 ml/g t i s s u e i c e - c o l d 30 mM sodium phosphate; 10 mM EDTA, pH 8.0 and  (PDV b u f f e r )  containing  0.14% /3-mercaptoethanol {(3ME)  7% (w/v) alumina powder, i n a c h i l l e d Waring b l e n d e r .  T h i s homogenate was c l a r i f i e d by c e n t r i f u g a t i o n f o r 10 minutes a t 6000 rpm i n a Beckman JA 14 r o t o r a t 4°C.  The  supernatant was r e t u r n e d t o the blender and homogenized b r i e f l y w i t h c h i l l e d hydrated c a l c i u m phosphate (approximately 5 g ) .  T h i s was c e n t r i f u g e d  minutes i n a Beckman JA 14 r o t o r at 4°C. f i l t e r e d through m i r a c l o t h  The supernatant was  and c e n t r i f u g e d  2.5 hours i n a Beckman 45Ti r o t o r at 4°C. resuspended i n 200 fil  at 8000 rpm f o r 10  a t 42000 rpm f o r P e l l e t s were  c h i l l e d PDV b u f f e r , p o o l e d and l a y e r e d  onto a 25% (w/v) sucrose cushion prepared i n PDV b u f f e r . T h i s was c e n t r i f u g e d 70Ti r o t o r a t 4°G.  f o r 2 hours at 50000 rpm i n a Beckman The p e l l e t s were resuspended and pooled  as b e f o r e and l a y e r e d onto a 10% t o 40% (w/v) l i n e a r sucrose gradient rpm  i n PDV b u f f e r and c e n t r i f u g e d  i n a Beckman SW40Ti r o t o r at 4°C.  f o r 2.5 hours at 38000 The g r a d i e n t  was  scanned a t 340 nm w i t h an ISCO UA-5 scanner and a l a r g e , c e n t r a l l y l o c a t e d band was c o l l e c t e d .  These f r a c t i o n s were  p o o l e d and v i r u s c o l l e c t e d by c e n t r i f u g a t i o n f o r 1.5 hours at 50000 rpm i n a Beckman 70.1Ti r o t o r at 4°C.  The f i n a l  was resuspended i n a minimal volume of PDV b u f f e r 100 ill)  and s t o r e d at 4°C.  pellet  (typically  The amount of v i r u s c o n t a i n e d i n  these f r a c t i o n s was determined by spectrophotometry assuming  Page 16  an e x t i n c t i o n c o e f f i c i e n t of 5.0 at 260  2.1.3  nm  f o r 1 cm of a 0.1%  solution  (Halk & F u l t o n 1978).  Coat p r o t e i n e l e c t r o p h o r e s i s The p r o t e i n content of the f i n a l v i r u s f r a c t i o n  determined 1976)  by a B r a d f o r d dye-binding assay  w i t h bovine serum albumin  Chemical  Co)  used as standard.  v i r u s samples was was  (BioRad: B r a d f o r d  (BSA f r a c t i o n V: Sigma The p r o t e i n content of the  a d j u s t e d to approximately  5 mg/ml and i t  mixed w i t h 4 volumes of l o a d i n g b u f f e r (62.5 mM  pH 6.8; (SDS);  10% 5%  (v/v) g l y c e r o l ; 2%  (v/v) /8ME;  sample was  was  (w/v)  0.001% (w/v)  Tris-HCl  sodium dodecyl  sulphate  bromophenol b l u e ) .  The  heated t o 95°C f o r 2 minutes p r i o r t o l o a d i n g .  For e l e c t r o p h o r e s i s the method d e s c r i b e d by Laemmli u s i n g a d i s c o n t i n u o u s b u f f e r system was Mini-protean II u n i t .  (1970)  used w i t h a BioRad  Samples were e l e c t r o p h o r e s e d on a  12%  p o l y a c r y l a m i d e g e l o v e r l a i d w i t h a 4% s t a c k i n g g e l , at 200 f o r 40 minutes i n 0.1% pH 8.3. markers  The  SDS;  25 mM  T r i s ; 200 mM  glycine;  f o l l o w i n g p r o t e i n s were used as m o l e c u l a r weight  (Dalton VII s e t : Sigma Chemical  ovalbumin  V  (45.0 kDa);  Co.): BSA  glucose-3-phosphate  (36.0 kDa);  trypsinogen  (24.0 kDa);  (20.1 kDa);  ot-lactalbumin (14.2  inhibitor  The p r o t e i n bands were  v i s u a l i z e d by s t a i n i n g the g e l with Coomassie b r i l l i a n t R-250 or s i l v e r n i t r a t e  kDa);  dehydrogenase  trypsin  kDa).  (66.0  blue  ( M e r r i l 1990). Gels were d r i e d under  vacuum and photographed. Page 17  2.1.4  Genomic RNA i s o l a t i o n Genomic PDV RNA was i s o l a t e d from p a r t i a l l y  virus.  purified  P e l l e t e d m a t e r i a l o b t a i n e d a f t e r the f i r s t  u l t r a c e n t r i f u g a t i o n step  ( s e c t i o n 2.1.2) was resuspended i n  100 /xl PDV b u f f e r and e x t r a c t e d twice w i t h an equal volume of water s a t u r a t e d phenol heated t o 8 0°C. phenol:chloroform:isoamyl  alcohol  Two e x t r a c t i o n s u s i n g  (25:24:1) and a f i n a l  e x t r a c t i o n w i t h chloroform:isoamyl a l c o h o l  (24:1) f o l l o w e d .  RNA was p r e c i p i t a t e d from the f i n a l aqueous f r a c t i o n by adding 0.1 volume 3.1 M sodium a c e t a t e , pH 5.2, and 3 volumes of  i c e - c o l d 95% e t h a n o l .  l e a s t 1 hour,  The tube was l e f t a t -70°C f o r a t  then c e n t r i f u g e d a t 13000 rpm f o r 45 minutes at  4°C i n a m i c r o c e n t r i f u g e .  The p e l l e t was washed w i t h 70%  e t h a n o l , d r i e d under vacuum and d i s s o l v e d i n 50 fil p y r o c a r b o n a t e - t r e a t e d water.  diethyl  The sample was immediately  d i v i d e d i n t o 5 u.1 p o r t i o n s which were s t o r e d a t -70°C.  One  a l i q u o t was used t o measure the RNA content by s p e c t r o photometry and t o examine i t s q u a l i t y by e l e c t r o p h o r e s i s i n a 1% agarose g e l c o n t a i n i n g 5 mM methylmercuric (MeHgOH) and borate b u f f e r pH 8.2),  hydroxide  (4 0 mM sodium b o r a t e ; 1 mM EDTA;  as d e s c r i b e d by Sambrook e t a l . (1989).  were denatured temperature  RNA samples  i n 15 mM MeHgOH f o r 5 minutes a t room  p r i o r to loading.  A f t e r e l e c t r o p h o r e s i s the  MeHgOH was i n a c t i v a t e d w i t h 0.1 M ammonium a c e t a t e and the RNA was v i s u a l i z e d by s t a i n i n g with ethidium bromide. stranded RNA molecular s i z e standards  Single  (Sigma) were coPage 18  e l e c t r o p h o r e s e d t o estimate the s i z e s of the genomic  RNA  bands and the g e l was photographed t o a l l o w measurement of band m i g r a t i o n .  2.1.5  E x t r a c t i o n of double-stranded ( r e p l i c a t i v e form)  RNA  from i n f e c t e d l e a v e s Young l e a v e s were c o l l e c t e d from the P.  mahaleb  stock  t r e e as soon as they became a v a i l a b l e i n the s p r i n g and s t o r e d i n batches of 7 g at -70°C where t h e i r dsRNA s t a b l e f o r at l e a s t a year.  was  To e x t r a c t dsRNA, 7 g of leaves  were ground t o a powder i n l i q u i d n i t r o g e n w i t h a p e s t l e and mortar and allowed t o thaw i n a 50 ml tube c o n t a i n i n g 9 ml water s a t u r a t e d phenol, 9 ml GPS b u f f e r sodium phosphate b u f f e r , pH 9.5; On thawing,  0.5 ml 20%  (w/v)  (0.2 M g l y c i n e ; 0.1 M  0.6 M NaCI) and 0.5 ml jSME.  SDS was  added and the tube  p l a c e d on a r o t a r y shaker f o r about 45 minutes.  The  were then c e n t r i f u g e d f o r 5 minutes i n a bench-top at 3 000 rpm.  The aqueous phase was  centrifuge  transferred to a fresh  tube on i c e and the o r g a n i c phase was GPS b u f f e r .  samples  r e - e x t r a c t e d w i t h 5 ml  The two aqueous phases were p o o l e d and one  volume of 10 M L i C l ,  c h i l l e d t o -20°C, was  w h i l s t v o r t e x i n g t o ensure r a p i d mixing.  added  third  dropwise  A precipitate  was  allowed t o form o v e r n i g h t at 4°C. The sample was 10 minutes at f u l l  c e n t r i f u g e d i n a bench-top c e n t r i f u g e f o r speed  (3000 rpm).  The supernatant was  a s p i r a t e d i n t o a f r e s h tube and 95% e t h a n o l was  added t o a Page 19  f i n a l c o n c e n t r a t i o n of 18% along w i t h 1.5 g c e l l u l o s e powder (CC41: Whatman).  The dsRNA was allowed t o b i n d t o the  c e l l u l o s e by shaking the tubes on i c e f o r 3 0 minutes on a r o t a r y shaker.  The c e l l u l o s e was washed 3 times w i t h STE  (100 mM NaCl; 10 mM  T r i s - H C l ; 1 mM  EDTA, pH 8.0)  containing  18% e t h a n o l and samples were loaded i n t o 20 x 1 cm chromatography columns and each colum washed w i t h 3 00 ml STE c o n t a i n i n g 18% e t h a n o l at a flow r a t e of a p p r o x i m a t e l y 2 ml/min.  A f t e r the columns had d r a i n e d completely, they were  purged d r y by f o r c i n g a i r from a s y r i n g e through the column. DsRNA was e l u t e d from the c e l l u l o s e w i t h 3 ml 0.5 mM 8.0,  f o l l o w e d by f o r c e d a i r t o d r y the column.  EDTA, pH  Two more 2 ml  p o r t i o n s were passed through the column and the e l u a n t s p o o l e d i n a 30 ml Corex tube c o n t a i n i n g 700 /xl 3 M sodium a c e t a t e pH 5.2.  Three volumes of i c e c o l d 95% e t h a n o l were  added t o the tubes and they were p l a c e d at -70°C o v e r n i g h t . Samples were c e n t r i f u g e d at 11000  rpm i n a Beckman  JS 13.1 r o t o r at -5°C f o r 45 minutes t o p e l l e t the dsRNA. The supernate was d i s c a r d e d and the p e l l e t d r i e d under vacuum and r e d i s s o l v e d i n 200 /xl DNase b u f f e r 5 mM  (0.1 M sodium a c e t a t e ;  MgCl , pH 5.0), t r a n s f e r r e d to an eppendorf tube and 2  i n c u b a t e d w i t h 10 U deoxyribonuclease I (DNase I: Gibco/BRL) at 37°C f o r 20 minutes.  The samples were c e n t r i f u g e d  briefly  to remove f i n e c e l l u l o s e p a r t i c l e s c a r r i e d over from the chromatography b e f o r e adding 20 til 3 M sodium a c e t a t e , pH and 3 volumes i c e - c o l d 95% e t h a n o l .  DsRNA was  5.2  precipitated Page 20  for several  hours a t -70°C o r f o r 2 0 minutes i n an  i s o p r o p a n o l : d r y i c e bath. centrifugation  a t 13 000  45 minutes a t 4°C.  The p r e c i p i t a t e was c o l l e c t e d by  rpm i n a m i c r o c e n t r i f u g e  for  The supernate was removed and the p e l l e t  washed w i t h 100 /xl 70% e t h a n o l , d r i e d under vacuum and redissolved  i n 20 pi  TE (10 mM T r i s - H C l ;  1 mM EDTA, pH 8.0).  A 4 fil a l i q u o t was analyzed by agarose g e l DsRNA i s o l a t e d from Nicotiana  glauca  electrophoresis.  i n f e c t e d w i t h CMV was  used as a m o l e c u l a r weight marker. To remove s i n g l e stranded RNA (tRNA and rRNA), samples were e i t h e r d i g e s t e d  w i t h 1 u n i t RNase T-L  (Pharmacia) i n STE  f o r 10 minutes a t room temperature p r i o r t o e l e c t r o p h o r e s i s , or the g e l was p l a c e d i n a s o l u t i o n of 2X SSC c o n t a i n i n g 50 /xg/ml RNase A (Pharmacia) f o r 1 hour a t room temperature w i t h shaking a f t e r  electrophoresis.  2.2.0  Antibody p r o d u c t i o n  2.2.1  Production of polyclonal  antibodies  F i f t e e n week o l d l a y i n g hens from Rump & S e n d a l l ,  Vernon, BC.  immunized was l a y i n g r e l i a b l y ,  i n chickens  (Red Sussex) were purchased When the c h i c k e n t o be  i e . l a y i n g a t l e a s t 5 eggs/  week f o r 2 weeks, pre-immune eggs were c o l l e c t e d and the c h i c k e n was g i v e n an i n t r a m u s c u l a r i n j e c t i o n o f approximately 1 mg p u r i f i e d PDV i n Freund's complete adjuvant. days, eggs were c o l l e c t e d i n groups o f s i x . was  After ten  Antibody (IgY)  i s o l a t e d from them u s i n g the f o l l o w i n g procedure (van Page 21  Regenmortel 1982).  Yolks were separated from whites  washed i n a beaker w i t h d i s t i l l e d water. measured and  3 volumes of s a l i n e b u f f e r  phosphate, pH The  7.2,  0.1  (w/v)  the  i c e f o r 30 minutes.  (PEG The  a Beckman JA 14 r o t o r at 10000 rpm The  supernatant was  brought t o 12% minutes.  The  discarded.  saline buffer The and  w i t h PEG  c e n t r i f u g a t i o n was p e l l e t was  antibodies  0.2%  column, and  eluant  was  the  supernatant  dissolved  PEG  in  as b e f o r e .  and  The  saline  s t o r e d at 4°C.  polyacrylamide gel  This  electrophoresis  p u r i f i e d f u r t h e r by  hydroxyl-  i n ELISA.  A 10 ml HAP  phosphate b u f f e r , pH  column 6.8.  d i l u t e d t e n - f o l d w i t h running b u f f e r ,  at pH  wool,  Boehringer Mannheim) chromatography ( c f .  e q u i l i b r a t e d w i t h 10 mM  gradient  w e l l and  sodium azide  a n a l y z e d by SDS  s e c t i o n 2.2.5) f o r use  the  4°C.  s t i r r e d at 4°C f o r 3 0  repeated and  drained  in  c l a r i f i e d by c e n t r i f u g a t i o n as above  (PAGE) ( s e c t i o n 2.1.3) and  sample was  centrifuged  d i s s o l v e d i n a minimal volume of  buffer containing  (HAP:  and  f o r 10 minutes at  r e p r e c i p i t a t e d w i t h 12%  f i n a l p e l l e t was  apatite  sample was  3.5%  overnight.  s o l u t i o n was  sample was  yolks.  brought to  6000: Sigma)  6000 and  was  sodium  f i l t e r e d through moistened c o t t o n  (w/v)  The  (5 mM  s o l u t i o n was  ground p o l y e t h y l e n e g l y c o l  s t i r r e d on  T h e i r volume  M NaCI) were mixed w i t h the  y o l k s were broken and  and  e l u t e d w i t h a 100 6.8  to 500  mM  was  The  IgY  loaded onto  phosphate  at a r a t e of approximately 2 ml/min.  monitored at 280  nm  and  0.5  ml  The  f r a c t i o n s were  Page 22  collected.  Peaks were p o o l e d and IgY p r e c i p i t a t e d by adding  sodium s u l p h a t e t o 14% (w/v).  (w/v)  from a s a t u r a t e d s o l u t i o n  A f t e r 1 hour at room temperature the IgY were  p e l l e t e d by c e n t r i f u g a t i o n at 10000 rpm, Beckman JS 13.1 r o t o r .  10 minutes i n a  The h i g h l y s o l u b l e p e l l e t  was  d i s s o l v e d a minimal volume of s a l i n e b u f f e r c o n t a i n i n g (w/v)  (36%  0.02%  sodium a z i d e and s t o r e d at 4°C.  2.2.2.0 P r o d u c t i o n of monoclonal a n t i b o d i e s 2.2.2.1 Immunization a f t e r cyclophosphamide treatment H e a l t h y pumpkin e x t r a c t was prepared by h a r v e s t i n g 130 g h e a l t h y pumpkin p l a n t s and p r o c e e d i n g w i t h the PDV  isolation  as d e t a i l e d i n s e c t i o n 2.1.2  ultra-  c e n t r i f u g a t i o n step.  u n t i l a f t e r the f i r s t  At t h i s stage, the p e l l e t s were  r e d i s s o l v e d i n phosphate b u f f e r e d s a l i n e  (PBS: Harlow & Lane  1988), c l a r i f i e d by low speed c e n t r i f u g a t i o n and s t o r e d at 4°C.  The p r o t e i n c o n c e n t r a t i o n of the supernate was  determined by the B r a d f o r d assay. Cyclophosphamide  (Sigma) was d i s s o l v e d i n PBS  (1 g/  30 ml) and d i l u t e d t o 16.5 mg/ml s h o r t l y b e f o r e use. h e a l t h y pumpkin e x t r a c t was d i l u t e d w i t h PBS t o 2.5 p r o t e i n / m l and i n j e c t e d i n t r a p e r i t o n e a l l y i n t o two Balb/c mice without adjuvant.  T h i s was  The mg  female  f o l l o w e d by an  i n t r a p e r i t o n e a l i n j e c t i o n of 100 mg cyclophosphamide/kg mouse a f t e r 10 minutes, 24 hours and 48 hours 1987).  (Matthew & Sandrock  A f t e r the drug had been allowed t o c l e a r f o r 2 weeks, Page 23  the mice were g i v e n an i n t r a p e r i t o n e a l i n j e c t i o n of (250 ag)  i n Freund's  scheme was Freund's of  250  complete  adjuvant.  PDV  This i n j e c t i o n  repeated a f t e r a f u r t h e r 2 weeks, but u s i n g  incomplete adjuvant.  pig PDV  was  A final  intraperitoneal  boost  g i v e n without adjuvant 3 days b e f o r e the  fusion.  2.2.2.2 D e t e r m i n a t i o n of the immune response by TAS-ELISA T a i l bleeds were c a r r i e d out a f t e r the f i n a l boost to determine  the immune response of the mice.  100 / i l of b l o o d was tubes  Approximately  collected into heparinized c a p i l l a r y  (Oxford Labware).  Blood c e l l s  were p e l l e t e d  by  c e n t r i f u g a t i o n f o r 5 minutes at 800 g and the c l e a r supernatant serum was The  serum was  mouse.  c a r e f u l l y removed and s t o r e d at 4°C.  t e s t e d by TAS-ELISA u s i n g f o u r w e l l s f o r each  M i c r o t i t r e p l a t e w e l l s (EIA p o l y - s t y r e n e : Nunc) were  coated w i t h r a b b i t serum prepared a g a i n s t PDV  strain  876  (PVAS 290: American Type C u l t u r e C o l l e c t i o n ) d i l u t e d 1:2000 i n PBS  and i n c u b a t e d at room temperature  were washed t h r e e times with PBS subsequent  steps.  Tween 20 i n PBS at  B l o c k i n g was  f o r 2 hours.  Wells  a f t e r t h i s and a l l achieved w i t h 3% BSA,  f o r 1 hour at room temperature.  a c o n c e n t r a t i o n of 300 ng/ml i n PBS w i t h 0.5%  0.05%  Purified BSA  PDV  was  a p p l i e d t o the w e l l s to act as a n t i g e n and pumpkin cotyledons ground i n PBS  served as n e g a t i v e c o n t r o l s .  P l a t e s were  i n c u b a t e d at 4°C o v e r n i g h t w i t h the a n t i g e n . Serum from the Page 24  t e s t - m i c e was d i l u t e d 1:250 t o 1:3000 i n 0.5% BSA i n PBS, a p p l i e d t o the w e l l s and incubated f o r 2 hours a t room temperature. antiserum  A l k a l i n e phosphatase l a b e l l e d goat-anti-mouse  (Gibco/BRL) was added a t the recommended  concentration  (1:3000) i n 0.5% BSA i n PBS and i n c u b a t e d f o r  2 hours a t room temperature. a d d i t i o n o f 0.1% (w/v) 10%  D e t e c t i o n was a c h i e v e d by the  p a r a - n i t r o p h e n o l phosphate i n  (w/v) diethanolamine,  pH 9.5. The m i c r o t i t r e p l a t e was  read i n a m i c r o t i t e r p l a t e reader 405  ( T i t e r t e k MCC/340: ICN)  at  and 620 nm a f t e r 2 and 24 hour i n c u b a t i o n s under subdued  light.  A  S20  readings were s u b t r a c t e d from A  405  readings.  2.2.2.3 F u s i o n mediated by p o l y e t h y l e n e g l y c o l A l l work d e s c r i b e d i n t h i s s e c t i o n was done i n a b i o l o g i c a l containment hood u s i n g s t e r i l e technique. 96-well thymocyte feeder p l a t e s were prepared the f u s i o n .  Twenty  the day before  Ten 6 week o l d Balb/c mice were s a c r i f i c e d t o  p r o v i d e thymocytes.  Thymuses were removed a s e p t i c a l l y from  the mice and pooled together i n a p e t r i - d i s h c o n t a i n i n g 2 0 ml prewarmed DMEM (Dulbecco's  m o d i f i e d Eagle medium: Sigma).  C e l l s were r e l e a s e d by o v e r l a y i n g the organs w i t h s e v e r a l l a y e r s o f s t e r i l e gauze and c r u s h i n g them g e n t l y w i t h a s t e r i l e s y r i n g e plunger.  Thymocytes were t r a n s f e r r e d t o a  c e n t r i f u g e tube w i t h a p i p e t t e and p e l l e t e d by c e n t r i f u g a t i o n at  800 g f o r 2 minutes.  The p e l l e t was washed once w i t h DMEM  and resuspended i n 100 ml DMEM c o n t a i n i n g 20% f o e t a l  calf Page 25  serum  (FCS: Gibco/BRL) and 50 /xg/ml gentamycin  (Sigma).  Thymocytes were p l a t e d i n t o twenty 96-well p l a t e s ,  50 jxl p e r  w e l l , and p l a c e d i n t o a 37°C i n c u b a t o r w i t h a 10% C0  2  atmosphere. NS1 myeloma c e l l s were a l s o prepared b e f o r e the f u s i o n .  a t l e a s t 2 days  These had been s t o r e d i n l i q u i d n i t r o g e n  and were thawed by immersing the s t o r a g e - c r y o v i a l i n t e p i d water u n t i l the c e l l s had j u s t thawed. immediately  C e l l s were  d i l u t e d i n 10 ml DMEM, p e l l e t e d a t 800 g, washed  again and resuspended i n 30 ml DMEM c o n t a i n i n g 10% FCS and 50 /xg/ml gentamycin.  C e l l s were seeded i n t o a 15 cm p e t r i  d i s h and p l a c e d i n the C0 i n c u b a t o r o v e r n i g h t . 2  day,  the NS1 c e l l s were resuspended and h a l f  t r a n s f e r r e d t o a new p e t r i d i s h .  The next  (15 ml)  A f u r t h e r 15 ml DMEM was  added t o each d i s h and the c e l l s were allowed t o grow t o 80% confluency. The  f u s i o n was performed e s s e n t i a l l y as d e s c r i b e d by  Harlow & Lane  (1988).  immune response,  The mouse w i t h the h i g h e r  specific  based on the t a i l - b l e e d TAS-ELISA, was  s a c r i f i c e d and i t s s p l e e n removed under a s e p t i c c o n d i t i o n s . Splenocytes were e x t r a c t e d u s i n g the same procedure f o r thymocytes.  The c e l l s were p e l l e t e d a t 800 g i n a  c l i n i c a l c e n t r i f u g e and washed once w i t h DMEM.  S p e c i a l care  was taken t o remove any b l o o d c l o t s and c o n n e c t i v e present.  described  tissue  The NS1 c e l l s from two p e t r i d i s h e s estimated t o be  80% c o n f l u e n t were h a r v e s t e d and washed twice w i t h DMEM Page 26  t a k i n g care t o remove as much media as p o s s i b l e .  The two  c e l l types, t h e s p l e n o c y t e s and the NS1 myelomas, were then mixed i n DMEM and p e l l e t e d t o g e t h e r .  Care was taken t o  remove as much o f the super-natant as p o s s i b l e . was resuspended  The p e l l e t  by adding 0.9 ml o f a s o l u t i o n o f PEG 3000  (Sigma) p r e v i o u s l y mixed 1:1 w i t h DMEM and warmed t o 37°C, over a p e r i o d o f 1 minute w i t h g e n t l e s t i r r i n g .  The c e l l s  were s t i r r e d f o r a f u r t h e r minute, f o l l o w e d by the a d d i t i o n of  1 ml DMEM over 1 minute and 9 ml DMEM over 2 minutes with  continuous g e n t l e s t i r r i n g .  A f t e r t h i s , t h e c e l l s were  immediately  c e n t r i f u g e d f o r 5 minutes a t 400 g and  resuspended  i n 10 ml DMEM c o n t a i n i n g 2 0% FCS and gentamycin.  T h i s was mixed w i t h a f u r t h e r 100 ml o f the same medium and p l a t e d out onto the feeder p l a t e s a t 50 /xl p e r w e l l .  After  approximately 10 hours a t 37°C i n the C0 i n c u b a t o r , 25 /xl o f 2  5X HAT s e l e c t i o n medium was added t o each w e l l , 100 ixM hypoxanthine,  16 /xM thymidine,  DMEM w i t h 20% FCS and 50 fig/ml was r e p l a c e d by HT medium 16 /xM thymidine)  (IX HAT i s  0.4 /xM aminopterin i n  gentamycin) .  The HAT medium  ( c o n t a i n i n g 100 ixM hypoxanthine and  a f t e r approximately 2 weeks.  The hybridomas were l e f t u n d i s t u r b e d i n the C0 i n c u b a t o r f o r 1 week.  2  A f t e r t h i s p e r i o d , w e l l s were  i n s p e c t e d f o r hybridomas under an i n v e r t e d microscope  and a l l  w e l l s c o n t a i n i n g one o r more hybridomas were marked.  Wells  were screened f o r anti-PDV stage.  a n t i b o d i e s by TAS-ELISA a t t h i s  The assay was the same as d e s c r i b e d f o r t a i l  bleeds Page 27  ( s e c t i o n 2.2.2.2) except that 50 /xl t i s s u e c u l t u r e supernatant  (TCS)  was  be assayed f o r use ELISA.  removed a s e p t i c a l l y from each w e l l  i n the mouse-anti-PDV antibody step  Each w e l l was  assayed u s i n g  cucumber c o t y l e d o n s as antigen.  PDV-infected and  w i t h f r e s h DMEM c o n t a i n i n g  20%  FCS,  immediately  i n the  healthy  A f t e r removal of the  from the t i s s u e c u l t u r e p l a t e s , i t was  to  TCS  replaced  gentamycin and  HAT.  Hybridomas i n w e l l s g i v i n g p o s i t i v e v a l u e s by TAS-ELISA against  PDV-infected m a t e r i a l were t r a n s f e r r e d to 24-well  p l a t e s and were s i n g l e c e l l  cloned  by l i m i t i n g  dilution  (Harlow & Lane 1988).  2.2.3  Single c e l l  cloning  N i n e t y - s i x w e l l m i c r o t i t r e p l a t e s w i t h thymocyte or s p l e e n o c y t e s feeder  c e l l s were prepared f o r s i n g l e  c l o n i n g as d e s c r i b e d  i n s e c t i o n 2.2.2.3.  accommodate two  lines for single c e l l  Hybridomas to be Al  single c e l l  (or E l ) of a p l a t e .  first The  cell  p l a t e s were r e t u r n e d  cloning.  then across  to the i n c u b a t o r The  and  left  plate.  until  numbers of hybridomas  marked on the l i d s of the p l a t e s .  p o s i t i v e w e l l per p l a t e c o n t a i n i n g  were made  the rows of the  p l a t e s were screened by TAS-ELISA as d e s c r i b e d  subjected  could  cloned were p i p e t t e d i n t o w e l l  hybridoma c o l o n i e s became v i s i b l e . per w e l l was  Each p l a t e  S e r i a l d i l u t i o n s (1:1)  down the column and  cell  At t h i s  point  above and  one  a s i n g l e hybridoma  t o another round of s i n g l e c e l l  cloning.  If  was there Page 28  were no w e l l s w i t h s i n g l e , p o s i t i v e hybridomas on a p l a t e , the p o s i t i v e w e l l w i t h the fewest hybridomas was s i n g l e cloned, u n t i l two rounds had been completed  cell  successfully.  C l o n a l hybridomas were grown t o h i g h d e n s i t y  i n 24-well, then  12-well p l a t e s and f i n a l l y i n 50 ml t i s s u e c u l t u r e f l a s k s . At t h i s stage c e l l s were a l s o f r o z e n safe,  long-term storage  i n l i q u i d nitrogen f o r  ( s e c t i o n 2.2.4).  A monoclonal  antibody c a l l e d PDA-3C was i d e n t i f i e d a t t h i s stage.  2.2.4 Cryogenic storage o f hybridomas Hybridomas t o be f r o z e n were grown u n t i l  8 0%  confluent  i n 15-20 ml DMEM supplemented w i t h 20% FCS and 50 ptg/ml gentamycin.  C e l l s were h a r v e s t e d by f l u s h i n g them out o f the  T - f l a s k w i t h a 25 ml p i p e t t e being sure t o wash them o f f the bottom o f the f l a s k .  They were t r a n s f e r r e d t o a c e n t r i f u g e  tube, p e l l e t e d a t 800 g f o r 5 minutes, resuspended i n 1 ml o f p r e c h i l l e d 46% DMEM, 46% FCS, 8% dimethyl sulphoxide and transferred to prechilled cryovials  (Nunc).  These were  placed  i n t o an i n s u l a t e d box a t -70°C t o a l l o w them t o c o o l  slowly  (approximately -l°C/min) o v e r n i g h t .  were s e a l e d w i t h c r y o f l e x t u b i n g l i q u i d nitrogen  A f t e r t h i s they  (Nunc) and t r a n s f e r r e d t o  f o r storage.  2.2.5 I s o l a t i o n o f antibody from t i s s u e c u l t u r e and  supernatant  isotyping Hybridomas were grown i n 15 ml c u l t u r e f l a s k s u n t i l 80% Page 2 9  confluent.  At t h i s stage they were resuspended  w i t h a 25 ml  p i p e t t e and approximately 80% of the volume t r a n s f e r r e d to a c e n t r i f u g e tube.  The remaining hybridomas were r e t u r n e d to  the f l a s k and the media r e p l a c e d .  C e l l s were removed from  the c o l l e c t e d media by c e n t r i f u g a t i o n and the s t o r e d at 4°C u n t i l r e q u i r e d . about  150 ml of TCS  antibody  (Harlow & Lane 1988).  ml/min.  harvested u n t i l  The  monoclonal  i s o l a t e d from the TCS by  e q u i l i b r a t e d w i t h 10 mM r a t e of 2.5  f l a s k was  had been c o l l e c t e d .  (PDA-3C) was  chromatography  The  supernatant  A 10 ml HAP  sodium phosphate,  The TCS was  HAP  pH 6.8  column  was  at a flow  loaded i n 3 batches of 50 ml  onto a s i n g l e column and e l u t e d u n t i l a peak, monitored at 2 80 nm,  had been removed.  the HAP  by e l u t i o n w i t h 200 mM  s i n g l e peak was  Bound antibody was  collected.  removed from  sodium phosphate,  pH 6.8.  A l l antibody c o n t a i n i n g f r a c t i o n s  were pooled, c h i l l e d t o 4°C and the antibody p r e c i p i t a t e d dropwise  A  by  a d d i t i o n of an equal volume of c h i l l e d , s a t u r a t e d  ammonium s u l p h a t e , pH 7.  The sample was  p r e c i p i t a t e d at 4°C  f o r 1 hour and c e n t r i f u g e d i n a Beckman JA 14 r o t o r at 10000 rpm  f o r 10 minutes,  minimal volume  4°C.  The p e l l e t was  (approximately 1 ml)  and s t o r e d at 4°C.  T h i s f r a c t i o n was  redissolved i n a  0.02%  used f o r a l l  s e r o l o g i c a l assays r e q u i r i n g a monoclonal column was  antibody.  The  regenerated by washing w i t h 1 M NaCI and r e -  e q u i l i b r a t i n g w i t h 10 mM The  sodium a z i d e i n PBS  sodium phosphate,  i s o t y p e of PDA-3C was  pH  6.8.  determined u s i n g an Page 3 0  erythrocyte (8 w e l l s )  a g g l u t i n a t i o n assay k i t ( S e r o t e c ) .  One column  of a 96-well p l a t e with U-bottom w e l l s was f i l l e d  w i t h 30 /xl o f the antiserum t o be t e s t e d d i l u t e d 1:50 w i t h PBS.  T h i s was mixed w i t h an equal volume of each s p e c i f i c  i s o t y p i n g reagent t o be t e s t e d -IgG ; -IgA; -IgM,.all 3  control wells.  tapped g e n t l y t o mix and l e f t f o r 1 hour.  w e l l was c o n s i d e r e d  concentrations  2.2.6  2a  2b  as w e l l  The p l a t e s were  covered on a f l a t ,  stable  A small r e d button at the bottom of the negative;  a g g l u t i n a t i o n was c o n s i d e r e d to a g g l u t i n a t e ,  -IgG ; -IgG ;  l i n k e d t o sheep e r y t h r o c y t e s , )  as p o s i t i v e and negative  surface  (anti-IgG-,;  a p a r t i a l o r f u l l carpet of positive.  If a l l wells  the assay was repeated u s i n g  failed  higher  o f the t e s t - s o l u t i o n .  Western b l o t A sample o f PDV coat p r o t e i n was e l e c t r o p h o r e s e d  described  i n s e c t i o n 2.1.3.  was soaked i n t r a n s f e r b u f f e r  A f t e r e l e c t r o p h o r e s i s , the g e l (50 mM T r i s - H C l , pH 7.6; 380 mM  g l y c i n e ; 0.1% SDS; 20% methanol). Schleicher & Schuell)  as  N i t r o c e l l u l o s e (NC:  was cut t o the same s i z e as the g e l ,  wetted i n d i s t i l l e d water and soaked b r i e f l y i n t r a n s f e r buffer.  The NC was o v e r l a i d onto the g e l and sandwiched  between three  l a y e r s of Whatman 3MM paper, t a k i n g care t o  remove a l l a i r bubbles i n the sandwich.  T h i s was p l a c e d  into  an e l e c t r o b l o t t r a n s f e r apparatus and the p r o t e i n s were e l e c t r o p h o r e t i c a l l y t r a n s f e r r e d overnight  t o the NC a t 4°C Page 31  w i t h a constant v o l t a g e s e t t o 60 V.  A f t e r the t r a n s f e r the  g e l was removed and s t a i n e d w i t h Coomassie b r i l l i a n t  blue  R-250 t o v e r i f y t r a n s f e r and the NC was immersed i n i s o p r o p a n o l f o r 1 minute b e f o r e being allowed t o d r y completely. The NC was then rewetted i n d i s t i l l e d water, b l o c k e d i n 3% skim m i l k powder (Carnation) i n PBS w i t h 0.05% Tween-20 f o r 20 minutes and t r a n s f e r r e d t o a p l a s t i c c o n t a i n i n g 2 ml PDA-3C d i l u t e d 1:1000 w i t h 0.5% skim milk powder i n PBS and l e f t a t 3 7°C f o r 1 hour. bag,  The NC was then removed from the  washed i n three changes of PBS and i n c u b a t e d w i t h  a l k a l i n e p h o s p h a t a s e - l i n k e d goat-anti-mouse antibody BRL) d i l u t e d 1:1000 ( s e c t i o n 2.2.2.2).  A f t e r three  (Gibco/ further  washes i n PBS, the NC was washed i n PBS, pH 9.5 and t r a n s f e r r e d t o a s o l u t i o n of 0.033% n i t r o - b l u e 0.017% 5-bromo-4-chloro-3-indolyl w i t h 5 mM MgCl . 2  tetrazolium,  phosphate i n TBS, pH 9.5  Colour development was allowed t o proceed  f o r a t l e a s t 20 minutes i n subdued l i g h t .  The r e a c t i o n was  t e r m i n a t e d by t r a n s f e r r i n g the b l o t t o a s o l u t i o n of 10 mM EDTA, pH 8.0.  R e s u l t s were photographed.  2.2.7 C o n j u g a t i o n o f  PDA-3C  t o a l k a l i n e phosphatase  A maleimide a l k a l i n e phosphatase k i t (Pierce) was used to conjugate monoclonal PDA-3C t o a l k a l i n e phosphatase (AP). PDA-3C, 6.25 mg, was p r e c i p i t a t e d w i t h an equal volume of (NH ) S0 , r e d i s s o l v e d 4  2  4  i n 1 ml TBS and d e s a l t e d over a beaded Page 3 2  p o l y a c r y l a m i d e column (Pierce k i t ) .  One-half ml f r a c t i o n s  were c o l l e c t e d and t h e i r p r o t e i n contents determined B r a d f o r d d y e - b i n d i n g assay.  by the  The two f r a c t i o n s w i t h the  h i g h e s t p r o t e i n contents were pooled t o y i e l d 2 mg protein/ml.  S i x mg 2-mercapto ethylamine  allowed t o r e a c t a t 3 7°C f o r 1 hour.  (MEA) was added and  A c t i v a t e d AP was  prepared by adding 30 / i l 2.9% (w/v) [sulpho s u c c i n i m i d y l 4(N-maleimidomethyl) c y c l o h e x a n e - l - c a r b o x y l a t e ] ) t o 5 mg AP. T h i s was allowed t o r e a c t f o r 3 0 minutes at room  temperature  and then d e s a l t e d over a c r o s s - l i n k e d dextran column (Pierce k i t ) e q u i l i b r a t e d w i t h TBS supplemented w i t h 0.15 M NaCl, 2 mM Z n C l , 4 mM MgCl , pH 7.6. 2  2  One-half ml f r a c t i o n s were  c o l l e c t e d and t h e i r p r o t e i n contents determined M i x i n g 0.5 mg MEA-reduced monoclonal  as b e f o r e .  w i t h 2 mg a c t i v a t e d AP  i n supplemented TBS b u f f e r , i n i t i a t e d c o n j u g a t i o n which proceeded  a t room temperature  f o r 1 hour.  The r e s u l t i n g  conjugate, PDA-3C-AP was s t o r e d at 4°C. PDA-3C-AP was assayed by DAS-ELISA.  Microtiter plates  (Linbro EIA) were coated f o r 2 hours at room temperature PDA-3C i n PBS a t d i l u t i o n s of 1:100 t o 1:3000.  with  P l a t e s were  b l o c k e d and a n t i g e n a p p l i e d as d e s c r i b e d i n s e c t i o n 2.2.2.2. PDA-3C-AP was a p p l i e d i n 0.5% BSA, PBS at d i l u t i o n s of 1:100 to 1:3000 and l e f t  f o r hours at room temperature.  After  three washes w i t h TBS, s u b s t r a t e was a p p l i e d and the p l a t e s read at 405 and 620 nm a f t e r 2 h r s and 24 h r s .  Page 33  2.2.8  Production of F(ab') Approximately  225  2  fragments from PDA-3C  1 mg h y d r o x y l a p a t i t e - p u r i f i e d PDA-3C i n  /xl, was incubated w i t h 2.5 /xl (0.5 /xg) p e p s i n (porcine  mucosa: Sigma) i n 100 mM sodium c i t r a t e b u f f e r , pH 3.5, o v e r n i g h t a t 37°C (Harlow & Lane 1988) .  The r e a c t i o n was  t e r m i n a t e d by the a d d i t i o n of 0.1 volume 3 M T r i s - H C l , pH 8.8.  The sample was then c e n t r i f u g e d t o p e l l e t  p r o t e i n and the supernatant  denatured  analyzed by SDS PAGE.  Native  samples, and samples reduced w i t h (SME b e f o r e l o a d i n g , were loaded s i d e - b y - s i d e on the g e l . performed  E l e c t r o p h o r e s i s was  as d e s c r i b e d i n s e c t i o n 2.1.3 and the g e l s were  stained with s i l v e r n i t r a t e .  The F ( a b ' )  2  fragments were  p u r i f i e d f u r t h e r by d i e t h y l a m i n o e t h y l (DE-52: Whatman) i o n exchange chromatography t o remove F antibodies.  fragments and i n t a c t  A 15 ml column was prepared and e q u i l i b r a t e d  w i t h 10 mM T r i s - H C l , pH 8.5. was  c  The d i g e s t e d antibody  solution  n e u t r a l i z e d w i t h 100 mM T r i s - H C l , pH 8.5, d i l u t e d 1 0 - f o l d  w i t h d i s t i l l e d water and loaded onto the column at 1 ml/min. The  column was washed w i t h 10 mM T r i s - H C l , pH 8.5 and the  e l u a n t monitored  at 280 nm.  When the b a s e l i n e had r e t u r n e d  to zero, a 50 t o 500 mM NaCI g r a d i e n t i n column b u f f e r was a p p l i e d and a l l peaks c o l l e c t e d .  F(ab')  2  fragments were  c o n c e n t r a t e d by ammonium sulphate p r e c i p i t a t i o n . was  The column  regenerated by washing s e q u e n t i a l l y at a flow r a t e of 1  ml/min w i t h 3 0 ml each o f i M NaCI; 0.5 N HCl; 0.5 N NaOH; then 100 ml 150 mM T r i s - H C l , pH 8.5 and f i n a l l y 100 ml 10 mM Page 34  T r i s - H C l , pH  8.5.  The p u r i f i e d F ( a b ' ) w e r e assayed 2  t r a p PDV  for their a b i l i t y  to  by TAS-ELISA by l o a d i n g them onto a m i c r o t i t r e p l a t e  (1:10-1:1000) i n PBS room temperature.  and a l l o w i n g them to b i n d f o r 2 hours at  P l a t e s were blocked and a n t i g e n a p p l i e d as  d e s c r i b e d i n s e c t i o n 2.2.2.2. anti-mouse  PDA-3C, A P - l a b e l l e d sheep-  ( a n t i - F c r e g i o n : K i r k e g a a r d P e r r y Labs)  d i l u t e d as recommended by the manufacturer,  and  antibody,  substrate  were added as set out i n s e c t i o n 2.2.2.2 and the absorbances read at 405  2.2.9  and 620  nm  D e t e c t i o n of PDV  a f t e r 2 and 24  hours.  by TAS-ELISA, RT-PCR and b i o a s s a y i n  sweet c h e r r y To e v a l u a t e the monoclonal PDA-3C f o r r o u t i n e f i e l d i n d e x i n g by TAS-ELISA  ( t r i p l e - a n t i b o d y sandwich ELISA),  40  sweet c h e r r y t r e e s showing symptoms s u g g e s t i n g a v i r a l infection for  (eg. s h o t - h o l e s , l e a f d i s c o l o u r a t i o n ) were s e l e c t e d  analysis.  They were indexed by RT-PCR, TAS-ELISA and  'Shirofugen' b i o a s s a y .  The RT-PCR was  i n s e c t i o n 2.3.15; the b i o a s s a y was buds of each sample-tree i n the s p r i n g .  the  performed as d e s c r i b e d  done by T-budding  two  onto a 'Shirofugen' i n d i c a t o r t r e e  These were i n s p e c t e d a f t e r 4 and  6 weeks f o r  the presence  of gumming at the bud union which would i n d i c a t e  the presence  of i l a r v i r u s .  For the TAS-ELISA, s i x young  r  l e a v e s were taken at random from each t r e e and assayed i n Page 3 5  d u p l i c a t e on separate p l a t e s u s i n g the assay d e s c r i b e d i n s e c t i o n 2.2.2.2.  In a d d i t i o n , 15 symptomless t r e e s were  s e l e c t e d t o a c t as negative  c o n t r o l s f o r the TAS-ELISA.  These t r e e s were a l s o t e s t e d by RT-PCR and by the bioassay. Since the b i o a s s a y all  cannot d i s t i n g u i s h between PDV and PNRSV,  t r e e s which t e s t e d p o s i t i v e on the b i o a s s a y  were a l s o  assayed f o r PNRSV by TAS-ELISA u s i n g PVAS-22 (American Type C u l t u r e C o l l e c t i o n ) r a b b i t serum at a d i l u t i o n 1:500 t o t r a p v i r u s and monoclonal antibody UCB 1332 (a g i f t Opgenorth) d i l u t e d 1:25, and A P - l i n k e d (Gibco/BRL) t o d e t e c t  PNRSV.  were the same as d e s c r i b e d The  from D.  goat anti-mouse serum  B u f f e r s and i n c u b a t i o n  times  f o r the PDV TAS-ELISA.  r e s u l t s o f the RT-PCR and the b i o a s s a y on  'Shirofugen'  e s t a b l i s h e d that the 15 negative  were f r e e from PDV. TAS-ELISA, l e a v e s  To e s t a b l i s h the t h r e s h o l d v a l u e f o r  from these h e a l t h y  each TAS-ELISA f o r the t e s t t r e e s . f o u r standard  control trees  t r e e s were i n c l u d e d i n The sum o f the mean p l u s  d e v i a t i o n s of the h e a l t h y  (x +4S) was used as the t h r e s h o l d value H  r e a c t i o n i n the t e s t p o p u l a t i o n  control  population  for a positive  (Sutula e t a l . 1986).  To  normalize f o r s l i g h t d i f f e r e n c e s between p l a t e s , a l l data were expressed as the r a t i o of the t e s t value t h r e s h o l d value  a s s o c i a t e d w i t h that p l a t e .  t o the The r a t i o s f o r  d u p l i c a t e samples were averaged and the v a l u e s further analysis. 1961)  used f o r  A Chi-squared d i s p e r s i o n t e s t  (Maxwell  was used t o t e s t whether the p r o p o r t i o n o f leaves  that  Page 3 6  would show a p o s i t i v e r e a c t i o n by TAS-ELISA was  the same f o r  a l l positive trees.  2.3.0  cDNA l i b r a r y of  PDV  2.3.1  P r e p a r a t i o n of cDNA: f i r s t S i n g l e - s t r a n d e d genomic RNA  p u r i f i e d PDV sample was hexamers mix  was  strand synthesis was  p a r t i c l e s as d e s c r i b e d i n s e c t i o n 2.1.4.  heated to 65°C i n the presence of 450 (pd(N) ) and c o o l e d on i c e . 6  prepared  MgCl ; 1 mM  dithiothreitol  2  T r i s - H C l , pH (DTT); 0.1  each dNTP i n a f i n a l volume of 25 u.1. room temperature and  transcriptase to  A first  to g i v e  r e a c t i o n was  were added and  KC1;  6  and  0.75  mM  mg/ml BSA  reverse  added, mixed g e n t l y and  t h i s r e a c t i o n was  incubated  f o r 1 hour.  removed immediately and added to 0.5 i l l  reaction.  This p i l o t  the a d d i t i o n of 0.5  first  ixl 0.5  were separated  agarose g e l  U RTase  A 1 txl sample of  (5 ixCi) and run i n p a r a l l e l with the main  products  allowed  extension.  [a P]dCTP 32  s t r a n d r e a c t i o n was M EDTA, pH  8.0.  The  by e l e c t r o p h o r e s i s on an  (Sambrook e t a l . 1989)  terminated first  film  by  strand  alkaline  and autoradiographed  by  wrapping the g e l i n Saran wrap and p l a c i n g i t onto a sheet Kodak X-omat AR  mM  T h i s was e q u i l i b r a t e d  then warmed to 48°C, a f u r t h e r 200  i t ' was  the  40 mM  r e a c t f o r 10 minutes at 25°C to a l l o w primer  The  /xg  strand reaction  8.3;  50 U S u p e r s c r i p t II™  (Gibco/BRL) was  A3  ng random  s e p a r a t e l y and added t o the RNA  f o l l o w i n g c o n d i t i o n s : 50 mM  to  i s o l a t e d from p a r t i a l l y  of  overnight.  Page 3 7  2.3.2 Second-strand  synthesis  A f t e r 1 hour, the main r e a c t i o n was c h i l l e d on i c e and combined w i t h 13 6 /xl of second s t r a n d r e a c t i o n mix t o g i v e the  following  final  10 mM MgCl ; 10 mM 2  conditions:  40 mM T r i s - H C l , pH 7.5;  (NH ) S0 ; 100 mM KCl; 4  2  50 /xg/ml BSA; 0.5 mM  4  dNTPs; 5 mM DTT; 0.15 mM |S-NAD; 40 U E. c o l i DNA polymerase +  I  (Gibco/BRL); 10 U E. c o l i DNA l i g a s e  E. c o l i RNase H (Gibco/BRL) .  (Gibco/BRL) and 5 U  A 10 /xl sample was immediately  removed from the r e a c t i o n and mixed w i t h 1 /xl (10 /xCi) [a P]dCTP. 32  followed The  Both r e a c t i o n s were incubated a t 12°C f o r 1 hour  by 4 hours at 20°C. second s t r a n d r e a c t i o n s were terminated by the  a d d i t i o n o f 0.5 M EDTA, pH 8.0, t o 20 mM.  The p r o d u c t s of  the main r e a c t i o n were p r e c i p i t a t e d i n e t h a n o l and ammonium acetate,  the p i l o t r e a c t i o n products were a n a l y z e d by agarose  gel electrophoresis  and autoradiography.  2.3.3 End p o l i s h i n g  reaction  A f t e r p r e c i p i t a t i o n , the cDNA p e l l e t was washed with 70% ethanol,  d r i e d and r e d i s s o l v e d  Pfu b u f f e r  i n 7.8 /xl water and 1 /xl 10X  (IX Pfu b u f f e r i s 10 mM KCl;  6 mM  (NH ) S0 ; 20 mM 4  2  4  T r i s - H C l , pH 8.0; 2mM MgCl ; 0.1% T r i t o n X-100 and 10 /xg/ml 2  BSA: Stratagene) , 2 /xl 10 mM dNTP mix and 0.2 /xl Pfu polymerase  (0.5 U: S t r a t a g e n e ) .  T h i s was o v e r l a i d w i t h  m i n e r a l o i l and incubated a t 72°C f o r 20 minutes.  The  r e a c t i o n was terminated by the a d d i t i o n of 0.5 M EDTA, Page 3 8  pH 8.0, t o 20 mM and s t o r e d at -20°C u n t i l r e q u i r e d .  The DNA  content of t h i s sample was estimated by measuring the e m i s s i o n o f a 1 /xl sample i n a fluorometer, u s i n g Hoechst Dye 33342 (Hoeffer S c i e n t i f i c molecules,  Instruments).  To s e l e c t l a r g e cDNA  the e n t i r e sample was loaded onto a s i n g l e w e l l i n  a 1% agarose  g e l and e l e c t r o p h o r e s e d f o r 15 minutes at 60 V.  S u i t a b l e m o l e c u l a r weight markers Gibco/BRL) were a l s o run.  (eg. 1 kb l a d d e r :  The g e l was s t a i n e d w i t h ethidium  bromide and the r e g i o n of the g e l c o n t a i n i n g the r e q u i r e d s i z e of cDNA was e x c i s e d from the g e l on a long wavelength UV transilluminator.  The cDNA was e x t r a c t e d from the g e l s l i c e  u s i n g the Qiaex g e l e x t r a c t i o n k i t (Qiagen).  2.3.4  Blunt-end The  second  ligation  r e s u l t s of the autoradiographs of the f i r s t and  s t r a n d products were used t o estimate the average  l e n g t h s o f the cDNA products and the f l u o r o m e t e r r e a d i n g was used t o c a l c u l a t e the c o n c e n t r a t i o n of cDNA.  Using  this  i n f o r m a t i o n , a l i g a t i o n r e a c t i o n c o n t a i n i n g p B l u e s c r i p t SK  +  (Stratagene) o r pGem4Z (Promega) cut w i t h EcoRV o r Smal r e s p e c t i v e l y and dephosphorylated phosphatase  with c a l f  intestinal  (CIP: Gibco/BRL) was prepared u s i n g a 5:1 molar  r a t i o of vector:cDNA.  The r e a c t i o n c o n d i t i o n s were: 50 mM  T r i s - H C l pH 7.6; 10 mM MgCl ; 1 mM ATP; 1 mM DTT; 5% (w/v) 2  PEG  8000 and 10 U T4 DNA l i g a s e  (Gibco/BRL).  The r e a c t i o n  was allowed t o proceed o v e r n i g h t at 16°C. The plasmids were Page 3 9  then transformed  i n t o competent E.  two methods d e s c r i b e d below  coli  DH5a by one o f the  ( s e c t i o n 2.3.5) and p l a t e d onto  2X TY (1.6% b a c t o - t r y p t o n e , 1% yeast e x t r a c t ,  0.5% NaCI, 2%  agar) p l a t e s c o n t a i n i n g 200 /xg/ml a m p i c i l l i n and spread with 800  /xg X-gal  800  /xg IPTG  2.3.5  ( 5 - b r o m o - 4 - c h l o r o - 3 - i n d o l y l - j S - D - g a l a c t o s i d e ) and (isopropylthio-/3-galactoside) .  P r e p a r a t i o n o f competent E. Competent c e l l s  coli  f o r t r a n s f o r m a t i o n by e l e c t r o p o r a t i o n o r  by heat shock were prepared i n bulk and s t o r e d i n s m a l l a l i q u o t s a t -70°C.  C e l l s were prepared as f o l l o w s .  DH5a were i n o c u l a t e d t o 2X TY p l a t e s o v e r n i g h t .  E.  coli  A single  c o l o n y was t r a n s f e r r e d i n t o 5 ml 2X TY media and incubated o v e r n i g h t a t 37°C i n a r o t a r y shaker.  T h i s was used t o  i n o c u l a t e 200 ml 2X TY medium i n a 11 f l a s k and the c e l l s grown u n t i l A  600  o f the c u l t u r e measured 0.6.  The f l a s k s were  immediately  immersed i n t o an ice-water bath and c h i l l e d f o r  15 minutes.  The c e l l s were h a r v e s t e d by c e n t r i f u g a t i o n at  3500 rpm i n a JA14 r o t o r The  (Beckman) f o r 10 minutes a t 4°C.  supernatant was d i s c a r d e d , d r a i n i n g away as much o f i t as  possible.  E l e c t r o p o r a t i o n - c o m p e t e n t c e l l s were  i n 100 ml p r e c h i l l e d d i s t i l l e d , s t e r i l e water; competent c e l l s were resuspended potassium  resuspended heat-shock  i n 40 ml c h i l l e d  3 0 mM  a c e t a t e , 50 mM MnCl , 100 mM KCl, 10 mM C a C l ,  15% g l y c e r o l  2  (filter-sterilized).  2  Both c e l l - t y p e s were  r e c e n t r i f u g e d as b e f o r e and the supernatants a g a i n d r a i n e d Page 40  c a r e f u l l y , keeping them on i c e as much as p o s s i b l e .  Cells  f o r e l e c t r o p o r a t i o n were suspended g e n t l y i n 2 ml d i s t i l l e d , s t e r i l e water and t r a n s f e r r e d i n t o 1.5 ml m i c r o c e n t r i f u g e tubes on i c e i n 60 /xl a l i q u o t s , t o be used immediately o r s t o r e d a t -70°C. resuspended  C e l l s f o r heat s h o c k - t r a n s f o r m a t i o n were  i n 8ml c h i l l e d  10 mM Na-morpholinepropane  sulphonate, pH 7.0; 75 mM C a C l ; 10 mM KCl and 15% g l y c e r o l 2  (filter-sterilized)  a f t e r the second  c e n t r i f u g a t i o n and  d i v i d e d i n t o a l i q u o t s as d e s c r i b e d above.  The t r a n s f o r m a t i o n  e f f i c i e n c y of the e l e c t r o p o r a t i o n - c o m p e t e n t c e l l s determined  was  by c a l c u l a t i n g the number of c o l o n i e s formed a f t e r  e l e c t r o p o r a t i o n of 1 pg, 10 pg and 100 pg p B l u e s c r i p t SK u s i n g a c u v e t t e w i t h a 1 mm gap at 1800 V BioRad).  +  (Genepulser™:  A f t e r e l e c t r o p o r a t i o n the c e l l s were incubated i n 1  ml 2X TY medium supplemented w i t h 10 mM MgCl , 10 mM MgS0 2  and 40 mM g l u c o s e at 37°C i n a r o t a r y shaker.  4  C e l l s were  then spread onto a 2X TY agar p l a t e c o n t a i n i n g 2 00 /xg/ml a m p i c i l l i n and allowed t o form c o l o n i e s o v e r n i g h t . were counted  Colonies  the next day and the t r a n s f o r m a t i o n e f f i c i e n c y  c a l c u l a t e d as the number of c o l o n i e s formed p e r /xg plasmid used.  Heat shock-competent c e l l s were transformed w i t h the  same p l a s m i d by a l l o w i n g a 40 /xl a l i q u o t of the c e l l s t o thaw on i c e i n the presence  of the plasmid f o r 30 minutes w i t h  o c c a s i o n a l g e n t l e mixing. for to  The tubes were then heated t o 3 7°C  1 minute, r e t u r n e d t o i c e f o r 2 minutes and t r a n s f e r r e d 1 ml 2X TY medium and p l a c e d i n a r o t a r y shaker a t 3 7°C  Page 41  f o r 1 hour b e f o r e being p l a t e d as d e s c r i b e d above. were counted  Colonies  the next day and the t r a n s f o r m a t i o n e f f i c i e n c y  determined.  2.3.6 S c r e e n i n g c o l o n i e s f o r i n s e r t s by PCR A f t e r o v e r n i g h t i n c u b a t i o n on IPTG/Xgal p l a t e s , some white c o l o n i e s ( t y p i c a l l y 10) were s e l e c t e d at random from each cDNA p l a t e and screened f o r i n s e r t s u s i n g PCR.  Colonies  were p i c k e d w i t h a s t e r i l e d i s p o s a b l e p i p e t t e - t i p and b r i e f l y immersed i n 20 /xl PCR mix (2 ill 10X Taq b u f f e r (Stratagene) , 2 /xM M13 u n i v e r s a l and r e v e r s e primers, 0.2 mM each dNTP, 0.2 U Taq DNA polymerase mineral o i l ) .  (Stratagene) o v e r l a i d w i t h 20 /xl  These were heated t o 94°C f o r 2 minutes and  then g i v e n 30 c y c l e s of 50°C, 30 sec (annealing) ; 72°C, 1.5 min ( e x t e n s i o n ) ; 94°C, 30 sec ( d e n a t u r a t i o n ) , i n a thermocycler  (Techen:  PHC2).  PCR products were v i s u a l i z e d by  e l e c t r o p h o r e s i s on a 1% agarose g e l run f o r 1 hour at 6 0 V, s t a i n e d w i t h ethidium bromide and photographed.  Molecular  s i z e markers were e i t h e r the 1 kbp ladder, 100 bp l a d d e r o r 3>X 174 RF DNA cut w i t h Hae I I I ( a l l from  Gibco/BRL).  2.3.7 I d e n t i f y i n g i n s e r t s u s i n g n o r t h e r n b l o t s To i d e n t i f y the v i r a l RNA corresponding t o cDNA i n s e r t s , i t was necessary t o h y b r i d i z e the cDNA t o dsRNA i n n o r t h e r n blots.  Northern b l o t s were prepared by e l e c t r o p h o r e s i s of  PDV dsRNA as d e s c r i b e d i n s e c t i o n 2.1.5. A f t e r Page 42  e l e c t r o p h o r e s i s the g e l was NaOH, 1 M NaCl  1 M NaCl f o r 20 minutes and p l a c e d i n an  e l e c t r o b l o t apparatus.  The dsRNA was  t r a n s f e r r e d t o a nylon  (Gene screen™: DuPont) i n 25 mM  b u f f e r , pH 6.5,  o v e r n i g h t at 12 V, 4°C.  sodium phosphate The dsRNA was  l i n k e d t o the membrane by a 5 minute exposure t o UV The b l o t was  (w/v)  SDS  cross-  light.  p r e h y b r i d i z e d i n 5 ml 50% d e i o n i z e d formamide;  IX Denhardt's s o l u t i o n ; 50 mM 1%  N  (two 10 minute washes), n e u t r a l i z e d i n 1 M  T r i s - H C l , pH 7.0;  membrane  denatured by soaking i n 0.4  T r i s - H C l , pH 7.5;  1.0  M NaCl;  and 10% dextran sulphate, at 42°C f o r 1 hour i n  a r o t a r y h y b r i d i z a t i o n oven. To prepare probes,  PCR  products  ( s e c t i o n 2.3.6) were  d i g e s t e d w i t h r e s t r i c t i o n enzymes whose s i t e s c l o s e l y f l a n k e d the i n s e r t cDNA t o be i n v e s t i g a t e d and the i n s e r t was g e l p u r i f i e d u s i n g Qiaex beads fragment was with  (Qiagen).  d i l u t e d t o approximately  The p u r i f i e d cDNA 50 ng//xl and  labelled  [a P] dCTP by random primer l a b e l l i n g w i t h 2 U Klenow 32  fragment  (Sambrook et a l . 1990).  p u r i f i e d w i t h a s p i n column denatured  The  l a b e l l e d cDNA probe  (Sephadex G-10:  was  Pharmacia),  by b o i l i n g and h y b r i d i z e d t o dsRNA immobilized  on  the n y l o n i n the p r e h y b r i d i z a t i o n s o l u t i o n o v e r n i g h t at 42°C i n a r o t a r y h y b r i d i z a t i o n oven. The b l o t was SSC  washed twice at room temperature  (standard s a l i n e c i t r a t e i s 150 mM  c i t r a t e , pH 7.0),  0.1%  (w/v)  SDS  NaCl;  5 mM  with  2X  sodium-  f o r 5 minutes per wash, then  twice more w i t h the same but at 65°C and f i n a l l y twice w i t h Page 43  0.5X SSC, 0.1%  (w/v) SDS at 65°C.  The b l o t was kept damp,  wrapped i n Saran wrap and autoradiographed  o v e r n i g h t a t room  temperature, o r a t -70°C with an i n t e n s i f y i n g s c r e e n i f added s e n s i t i v i t y was r e q u i r e d .  Kodak X-omat AR f i l m was used.  2.3.8 P r e p a r a t i o n f o r sequencing All  c l o n e s which h y b r i d i z e d t o PDV dsRNA were  f o r sequencing  by p r e p a r i n g a high q u a l i t y stock of the cDNA  i n i t s v e c t o r u s i n g commercially kits  (eg. Magic™ M i n i p r e p s :  Qiagen).  prepared  a v a i l a b l e plasmid  Promega; Qiagen  The s m a l l e s t of these c l o n e s , with  miniprep  minipreps: approximately  300 t o 500 bp cDNA i n s e r t s , were sequenced f i r s t u s i n g the dideoxy  c h a i n t e r m i n a t i o n method (Sanger e t a l . 1977) and the  Sequenase™ v e r s i o n 2.0 k i t (Amersham) . plasmid t o be sequenced was denatured  Two /xg of the  with 2 N NaOH and  sequenced from the M13 u n i v e r s a l and r e v e r s e  primers  f o l l o w i n g the recommendations of the k i t , but u s i n g [a P] dCTP i n s t e a d of one of the recommended n u c l e o t i d e s . 32  T h i s n e c e s s i t a t e d s u b s t i t u t i n g dATP f o r dCTP i n the l a b e l l i n g mix s u p p l i e d i n the k i t .  A l l other i n s t r u c t i o n s and  recommendations of the k i t were f o l l o w e d .  Electrophoresis  was c a r r i e d out on the same day as the sequencing  reactions,  s i n c e the P - l a b e l l e d strands of DNA were u n s t a b l e . 3 2  Samples  were e l e c t r o p h o r e s e d on a 0.1 mm t h i c k 8% p o l y a c r y l a m i d e g e l with 8.3 M urea i n IX TBE  (0.89 M T r i s ;  EDTA, pH 8.0) a t 50 W f o r approximately  1.12 M borate; 5 hours  25 mM  (long run)  Page 44  and 2.5 was  hours  (short r u n ) .  A f t e r e l e c t r o p h o r e s i s , the g e l  t r a n s f e r r e d t o Whatman paper,  d r i e d under vacuum and  autoradiographed at room temperature omat AR  2.3.9  film.  Exo I I I d e l e t i o n s cDNA fragments  l o n g e r than about  sequenced e n t i r e l y from the M13 on the p l a s m i d . follows. was  o v e r n i g h t u s i n g Kodak X-  500 bp c o u l d not be  u n i v e r s a l and r e v e r s e primers  A subset of d e l e t i o n c l o n e s was  Approximately  made as  5 tig of the p l a s m i d t o be sequenced  d i g e s t e d w i t h two neighbouring r e s t r i c t i o n enzymes i n the  polylinker.  To ensure u n i d i r e c t i o n a l d e l e t i o n , an enzyme  which c r e a t e s a 3'-overhang was  used adjacent t o the primer  s i t e and an enzyme c r e a t i n g a 5'-overhang was to the insert-cDNA t o be d e l e t e d .  Enzymes which d i d not cut  the cDNA i n s e r t i n t e r n a l l y were used. d i g e s t , the l i n e a r i z e d plasmid was  On completion of the  e x t r a c t e d w i t h phenol,  p r e c i p i t a t e d i n e t h a n o l and r e d i s s o l v e d i n T r i s - H C l , pH 8.0;  6.6  mM  MgCl  2  used adjacent  40 til 66  mM  and allowed t o e q u i l i b r a t e to  25°C.  Meanwhile 15 tubes c o n t a i n i n g 2.5  / i l SI nuclease  (40 mM  potassium a c e t a t e , pH 4.6;  NaCl; 1.4  6.7%  g l y c e r o l and 0.3  c h i l l e d on i c e .  330 mM  U SI nuclease) were prepared  mM  mix  ZnCl ; 2  and  The number of tubes used v a r i e d depending  the s i z e of the i n s e r t ; 15 tubes were enough f o r a 1.5  on  kb  i n s e r t , assuming a d e l e t i o n r a t e of approximately 100 bp/min. The Exo I I I r e a c t i o n was  s t a r t e d by adding 500 U Exo I I I Page 45  (Gibco/BRL) t o the p l a s m i d prep at 25°C. mixed w e l l and a f t e r an i n i t i a l  The r e a c t i o n was  20 second l a g p e r i o d , 2.5 ill  f r a c t i o n s were removed at 1 minute i n t e r v a l s and t r a n s f e r r e d t o the Sl-mix tubes.  When a l l the necessary time p o i n t s had  been taken, the tubes were warmed t o room temperature  and the  SI r e a c t i o n allowed t o proceed f o r 30 minutes. The r e a c t i o n was t e r m i n a t e d by the a d d i t i o n of 1 til 0.05 M EDTA, pH 8.0 and tubes were heated t o 80°C f o r 10 minutes SI n u c l e a s e .  t o denature the  The DNA ends were made f l u s h w i t h Klenow (2 U  per tube i n 20 mM T r i s - H C l , pH 8.0; 100 mM MgCl ; 0.125 mM 2  each dNTP) f o r 5 minutes.  T h i s was f o l l o w e d by the a d d i t i o n  of 40 ill T4 DNA l i g a t i o n mix (prepared u s i n g Gibco/BRL 5X l i g a s e b u f f e r , see s e c t i o n 2.3.4) and 1 U T4 DNA l i g a s e p e r reaction.  Reactions were l e f t at room temperature f o r  4 hours and then transformed i n t o competent E. coli ( s e c t i o n 2.3.5) and p l a t e d onto IPTG/X-gal  plates  DH5a (section  2.3.4) . White c o l o n i e s were screened f o r i n s e r t s i z e by PCR ( s e c t i o n 2.3.6).  C o l o n i e s with i n s e r t s s i z e d approximately  100-200 bp apart were s e l e c t e d so that the s m a l l e s t i n s e r t was <;200 bp i n s i z e and the l a r g e s t was about than the o r i g i n a l cDNA i n s e r t .  150 bp s m a l l e r  These were sequenced as  d e s c r i b e d above u s i n g the primer adjacent t o the r e s t r i c t i o n s i t e used t o i n i t i a t e the Exo I I I d e l e t i o n s .  Exo I I I  d e l e t i o n c l o n e s were made from both ends so t h a t both strands of each c l o n e c o u l d be  sequenced. Page 4 6  2.3.10 S e q u e n c e  alignment  Sequence was V e r s i o n 3.0  programme  programme was  i n t o the computer u s i n g the XESEE  (Cabot & Beckenbach 1989).  This  used to a l i g n o v e r l a p p i n g d e l e t i o n fragments  and clones and was  entered  to check f o r mismatches among c l o n e s .  Care  taken to ensure t h a t a l l r e g i o n s were sequenced at l e a s t  twice  and  that a l l mismatches c o u l d be  satisfactorily.  Sequences were a l s o checked a g a i n s t  database maintained Information  2.3.11  resolved  by the N a t i o n a l Center f o r  the  Biotechnology  (NCBI) u s i n g the BLASTx and BLASTn programmes.  cDNA c l o n i n g o f PDV  RNA1  A short cDNA fragment 353 on a Northern b l o t .  bp  PDV  RNA1  was  used to c o n s t r u c t the f o l l o w i n g cDNA s y n t h e s i s primer  s p e c i f i c f o r RNA1: primers  The  i n l e n g t h , h y b r i d i z e d to.  CGTAATCAACCAAT  sequence of t h i s  ( p o s i t i o n 1244  were s y n t h e s i z e d by the Core DNA  of C a l g a r y ) .  T h i s was  to the one  d e s c r i b e d i n s e c t i o n 2.3.1  s p e c i f i c primer f o r random hexamers. l a r g e clones of cDNA (ca. 1.3 sequenced completely  but  s u b s t i t u t i n g the  as d e s c r i b e d above and  designated  strand  This y i e l d e d several  used to c o n s t r u c t a primer for. RACE PCR  i n l e n g t h was  all  in a reaction similar  kb i n s i z e ) .  of cDNA ends, s e c t i o n 2.3.12).  on RNA1;  Facility, University  used to prime the f i r s t  s y n t h e s i s of cDNA from t o t a l v i r a l RNA  fragment  Two  of these were  the  information  (rapid a m p l i f i c a t i o n  The.larger  of these,  1311  bp  pPDV33. Page 47  2.3.12  The sequence o f the 5' end o f PDV RNA1  A m o d i f i e d procedure of Hirzmann  et a l .  (1993) was used  to determine the sequence of the 5'-terminus o f RNA1 up t o and i n c l u d i n g the cap s t r u c t u r e .  Two primers were  s y n t h e s i z e d : CGGATCCAGTAAGCGGTGAG  ( p o s i t i o n 316) and  CGGGAT(C) . 10  The former i s complementary  t o the r e g i o n  approximately 300 bp from the 5'-end o f the known sequence on pPDV33.  Both primers have a BamHI s i t e  (GGATCC) a t t h e i r 5'  end t o f a c i l i t a t e c l o n i n g o f RACE fragments. The RACE PCR was preceded by a f i r s t - s t r a n d  synthesis  r e a c t i o n u s i n g randomly primed t o t a l v i r a l RNA e x a c t l y as d e s c r i b e d i n s e c t i o n 2.3.1. first  A f t e r the RTase r e a c t i o n the  s t r a n d products were e x t r a c t e d w i t h p h e n o l : c h l o r o f o r m  and p r e c i p i t a t e d i n ethanol from ammonium a c e t a t e . The r e s u l t i n g p e l l e t was resuspended i n 19 til water and 5 til 5X t a i l i n g buffer  (5X t a i l i n g b u f f e r i s 0.5 M potassium  c a c o d y l a t e , pH 7.2; 10 mM C o C l : Stratagene) and i n c u b a t e d at 2  37°C w i t h 0.2 mM dGTP and 5 U t e r m i n a l d e o x y n u c l e o t i d y l transferase 20 minutes.  (TDT from c a l f thymus: Stratagene) f o r The r e a c t i o n was then p l a c e d on i c e and 1 til  added t o a PCR mix c o n t a i n i n g 2 tiM of each RACE primer, 0.2 /xM each dNTP i n Taq b u f f e r Taq DNA polymerase.  (Stratagene) as w e l l as 0.1 U  The DNA was a m p l i f i e d u s i n g 35 c y c l e s of  d e n a t u r a t i o n at 94°C, a n n e a l i n g at 40°C and e x t e n s i o n at 72°C f o r 3 0 seconds each.  The 3 50 bp product was d i g e s t e d w i t h  BamHI and p u r i f i e d a f t e r g e l e l e c t r o p h o r e s i s  (using Qiaex  Page 48  beads).  The fragment was l i g a t e d o v e r n i g h t a t room  temperature i n t o BamHI-cut p B l u e s c r i p t  SK  +  ( s e c t i o n 2.3.4)  which had been t r e a t e d w i t h CIP and transformed i n t o competent E. coli selected  DH5a ( s e c t i o n 2.3.5).  C o l o n i e s were  f o r i n s e r t s on IPTG/X-gal p l a t e s as b e f o r e and white  c o l o n i e s were screened f o r 350-bp i n s e r t s by PCR u s i n g the M13 u n i v e r s a l and r e v e r s e primers  ( s e c t i o n 2.3.6) .  Twelve c l o n e s of the c o r r e c t s i z e were s e l e c t e d and sequenced from the r e v e r s e primer  ( s e c t i o n 2.3.8).  Since the  l i g a t i o n was not d i r e c t i o n a l , some o f these had t o be sequenced again from the M13 u n i v e r s a l primer t o be able t o determine t h e i r 5'-sequence.  2.3.13 C l o n i n g  the 3' r e g i o n o f PDV  RNA1  Another cDNA l i b r a r y was made from random hexamers as described  i n sections  2.3.1 - 2.3.3. White c o l o n i e s  from t h i s  l i b r a r y were t r a n s f e r r e d t o a 15 cm p e t r i d i s h marked with a g r i d w i t h space f o r 150 c o l o n i e s .  These were allowed t o grow  o v e r n i g h t and t r a n s f e r r e d t o nylon  (Genescreen™ Plus:  Pont) as d e s c r i b e d  by Sambrook e t a l . (1989).  Du  The  t r a n s f e r r e d c o l o n i e s were denatured i n 1% (w/v) SDS; 0.5 N NaOH; 1.5 M NaCl, n e u t r a l i z e d i n 1 M T r i s - H C l , pH 8.0; 1.5 M NaCl. light  DNA was bound t o the nylon by i l l u m i n a t i o n w i t h UV f o r 5 minutes.  B a c t e r i a l d e b r i s was removed by washing  the n y l o n i n s e v e r a l changes of 2X SSC; 0.1% SDS. was d r i e d and p r e h y b r i d i z e d  as d e s c r i b e d  The nylon  by Sambrook e t a l . Page 4 9  (1989) .  A probe was prepared from pPDV33  d i g e s t i o n w i t h EcoRV and P s t l .  ( s e c t i o n 2.3.11) by-  This released a  fragment  approximately 360 bp i n l e n g t h from the 3'-end o f the clone, which was p u r i f i e d a f t e r g e l e l e c t r o p h o r e s i s u s i n g Qiaex beads.  The EcoRV fragment  was l a b e l l e d w i t h  [a P]dCTP as 32  d e s c r i b e d i n s e c t i o n 2.3.7, h y b r i d i z e d t o the c o l o n y - l i f t and autoradio-graphed.  C o l o n i e s w i t h cDNA which h y b r i d i z e d t o  the probe were r e s t r e a k e d onto f r e s h p l a t e s and p l a s m i d was p u r i f i e d from them.  Two c l o n e s c o n t a i n i n g cDNA i n s e r t s  1.5  and 2.0 kb were sequenced completely. T h i s s t r a t e g y was repeated u s i n g a P v u l l / H i n d l l l fragment  from the 3'-end of the known sequence t o r e s c r e e n  the cDNA l i b r a r y above.  Clones r e p r e s e n t i n g RNA1 sequence t o  p o s i t i o n 3165 were o b t a i n e d and two RACE primers were c o n s t r u c t e d based on t h i s sequence. was a m p l i f i e d by 5'-RACE PCR dsRNA as a template Couts TTGC  The 3'-terminus  of RNA1  ( s e c t i o n 2.3.12) u s i n g denatured  f o r the f i r s t  strand synthesis (Coffin &  1990) primed with the s p e c i f i c primer CCTATAATGGGAGC ( p o s i t i o n 3044) .  The f i r s t  s t r a n d product was  by PCR u s i n g the nested primer CTGGAGGGGATAATGAATG 3118) and CGGGAGT(C) . 10  ligated into pBluescript  amplified (position  The PCR product was b l u n t - e n d (EcoRV-site) and sequenced.  sequence o f the 5'-terminus  The  of the n e g a t i v e s t r a n d (of the  dsRNA) was taken t o be the complement of the 3'-end o f PDV RNA1.  Ten c l o n e s were sequenced t o ensure that the 3'-end  had been reached.  The RACE PCR was repeated u s i n g the nested  Page 50  primer p a i r s above w i t h (G) first  t o a m p l i f y poly-(C) t a i l e d  12  s t r a n d cDNA, t o c o n f i r m the i d e n t i t y of the t e r m i n a l  nucleotide.  2.3.14  Sequence comparisons and phylogeny  The sequence o b t a i n e d was  compared t o e x i s t i n g  sequences  on the GenBank database u s i n g the BLASTx programme at the N a t i o n a l Center f o r B i o t e c h n o l o g y I n f o r m a t i o n (NCBI). f o l l o w i n g RNA1  sequences were o b t a i n e d from GenBank and used  f o r comparison: (L00163); CMV  The  CiLRV  (D12537);  (accession number U23715); BMV  (X02380) andRBDV  AMV  (S51557).  These were a l i g n e d u s i n g the PILEUP software i n the Wisconsin G e n e t i c s Computer Group package  (GCG: Devereux  RBDV RNA1  ( Z i e g l e r e t a l . 1992)  encodes a p o l y p r o t e i n  o n l y the 5'-region of the RNA  et a l . 1984). and  and the C t e r m i n a l of the  t r a n s l a t i o n product were used f o r f u r t h e r a n a l y s i s .  Since  PILEUP d i d not always y i e l d o p t i m a l alignments, f u r t h e r e d i t i n g was  c a r r i e d out manually w i t h XESEE u s i n g  from p a i r w i s e alignments (BLASTx and GAP) phylogeny was P h y l i p 3.5c  results  as a guide.  A  c r e a t e d from the f i n a l alignment u s i n g the  software ( F e l s e n s t e i n 1989).  N u c l e i c a c i d s and  t h e i r t r a n s l a t i o n products were compared by u s i n g SEQBOOT to generate 100 b o o t s t r a p r e p l i c a t e s which were a n a l y s e d u s i n g DNAPARS (or PROTPARS f o r amino a c i d sequences). used t o generate a consensus phylogeny.  CONSENSE was  This analysis  was  repeated u s i n g the sequence of RNA3 and of ORF3a of the Page 51  f o l l o w i n g v i r u s e s : AMV CiLRV  (U17390);  CMV  (K02703); ApMV (U15608);  (D00385);  BMV  PNRSV (L38823); PDV  (J02042); (L28145).  2.3.15 RT-PCR assay Two data.  primer p a i r s were chosen from the RNA3  sequence  They were: CACGGACTTTCATGGCGTAA and CCCTCCTGCTGGT  TTTCTTA  ( p a i r #1)  as w e l l as ACACCAAAAGCTTTCCTTGTC and  AACTTTGAGATTCCCGATTG  ( p a i r #2).  P a i r #1 was  chosen from a  r e g i o n c o v e r i n g p a r t s of RNA3 and RNA4 and y i e l d e d a product 179 bp i n l e n g t h .  P a i r #2 was  product ca. 295 bp i n l e n g t h .  from RNA3 o n l y y i e l d i n g a The RT-PCR of l e a f t i s s u e  based on the method of Wetzel et a l . (1991).  Tissues  (leaves, buds o r flowers) were ground i n 1 ml  distilled  s t e r i l e water w i t h 0.1%  /3ME i n a p l a s t i c bag l i n e d w i t h  c h e e s e c l o t h u s i n g a t i s s u e - X homogenizer r e s u l t i n g sap was  (Bioreba AG).  leaf  F i f t y /xl supernatant were t r a n s f e r r e d t o 450 /xl 10%  T r i t o n X-100, on i c e .  The  t r a n s f e r r e d t o a m i c r o c e n t r i f u g e tube w i t h  a p a s t e u r p i p e t t e and c e n t r i f u g e d b r i e f l y t o sediment debris.  was  heated t o 65°C f o r 10 minutes and then p l a c e d  A 10 /xl sample was  a d d i t i o n of 2 /xl 4 0 mM  removed and denatured by the  MeHgOH.  Samples were l e f t at room  temperature f o r 10 minutes and then t r e a t e d w i t h 1 /xl 260 /3ME.  A r e v e r s e t r a n s c r i p t i o n c o c k t a i l was  mM  then added, g i v i n g  the same r e a c t i o n c o n d i t i o n s as set out i n s e c t i o n 2.3.1, i n a f i n a l volume of 20 /xl. f o r 1 hour.  The r e a c t i o n was  i n c u b a t e d at 37°C  I t was primed w i t h random hexamers. Page 52  The r e a c t i o n was brought t o 50 /xl by the a d d i t i o n of 17 /xl s t e r i l e water, 2 /xl 10 mM  dNTPs, 2 /xl of each primer  (2 /iM f i n a l c o n c e n t r a t i o n ) , 5 /xl 10X Taq b u f f e r (Stratagene) and 0.5 /xl Taq DNA  polymerase  (Stratagene) .  The sample  was  heated t o 95°C f o r 2 minutes and c y c l e d through 35 c y c l e s o f : d e n a t u r a t i o n , 1 minute at 95°C; primer annealing, 1 minute at 42°C; DNA  s y n t h e s i s , 1 minute at 72°C.  e x t e n s i o n f o r 4 minutes at 72°C.  There was  a final  The p r o d u c t s of the  r e a c t i o n were analyzed by agarose g e l e l e c t r o p h o r e s i s and s t a i n e d w i t h ethidium bromide.  The presence of PDV  was  i n d i c a t e d by the appearance of a r e a c t i o n product c o r r e s p o n d i n g t o i t s s p e c i f i c primer p a i r . sample was  In g e n e r a l , each  assayed at l e a s t twice and every t e n t h sample  was  a template-negative c o n t r o l .  2.4.0  P r e p a r a t i o n of a d e f e c t i v e i n t e r f e r i n g p a r t i c l e  2.4.1  P r o d u c t i o n of a snapback-type DI p a r t i c l e by One of the RACE clones  sequence of RNA1 to pPDV33  PCR  (#18) c o n t a i n i n g the 5' end  and a Pvu I s i t e at p o s i t i o n 267 was  ligated  ( s e c t i o n 2.3.11) u s i n g the Pvul s i t e ; t h i s was done  as f o l l o w s .  Clone #18 was d i g e s t e d w i t h Pvu I and BamHI and  a 265 bp fragment i s o l a t e d from an agarose g e l u s i n g Qiaex beads.  Plasmid pPDV33 was d i g e s t e d w i t h B g l l l  and Pvul and a  1030 bp fragment i s o l a t e d from an agarose g e l .  The  c o n c e n t r a t i o n s of these fragments was determined by spectrophotometry and they were mixed i n a 1:1:3  molar r a t i o Page 53  with p B l u e s c r i p t SK  +  l i n e a r i z e d with BamHI, and incubated  w i t h T4 DNA l i g a s e (Gibco/BRL) i n l i g a s e b u f f e r overnight  at room temperature.  transformed i n t o E. coli  (Gibco/BRL)  The l i g a t i o n p r o d u c t s were  DH5a and s e l e c t i o n was c a r r i e d out  by PCR u s i n g the M13 u n i v e r s a l and r e v e r s e primers 2.3.6) t o search size.  (section  f o r clones c o n t a i n i n g an .insert 1.3 kb i n  T h i s clone would c o n t a i n the 5'-end o f RNA1 and the  sequence up t o p o s i t i o n 1295; i t was c a l l e d pPDV1300. Three primers were s y n t h e s i z e d type DI p a r t i c l e by PCR.  t o c o n s t r u c t a snapback  These had the f o l l o w i n g sequences:  DI1:  TAAGGATCCTAATACGACTCACTATAGGTTTTACGAACGTGGTTGTTC  DI2:  TAAGGATCCGCGGTTTTACGAACGTGGTTGTTC  DI3:  ATGGACAACGGTGGTGAT  DI1  f e a t u r e s a BamHI s i t e  l i n e d ) and the f i r s t  22 bases of PDV RNA1  a l s o has a BamHI s i t e , site  (GGATCC), the T7 promoter  (under-  (on pPDV1300).  t o f a c i l i t a t e c l o n i n g , a unique  (CCGCGG) t o l i n e a r i s e the f i n a l c o n s t r u c t  t r a n s c r i p t i o n and the f i r s t  Sstll  before  22 bases of pPDV1300.  complementary t o a r e g i o n beyond a C l a l  DI2  DI3 i s  (BspDI) s i t e on  pPDV1300 about 1 kb downstream from DI1/2. Primer p a i r s DI1 & DI3 and DI2 & DI3 were used t o a m p l i f y pPDV1300 i n separate  PCR r e a c t i o n s .  The PCR r e a c t i o n  was c a t a l y z e d by Taq DNA polymerase with the b u f f e r c o n d i t i o n s recommended by the manufacturer  (Stratagene)  using Page 54  each primer at a c o n c e n t r a t i o n of 2 0 /xM. a n n e a l i n g temperature was  The o p t i m a l  determined e m p i r i c a l l y t o be 48°C  and the f o l l o w i n g c o n d i t i o n s were used f o r 35 c y c l e s i n a t h e r m o c y c l e r : denature 3 0 seconds at 94°C; anneal 4 0 seconds at 48°C; extend 1 minute at 72°C.  A f t e r PCR,  the products  were p r e c i p i t a t e d i n e t h a n o l , the p e l l e t d i s s o l v e d i n 9 /xl NEB  b u f f e r 3 (New England B i o l a b s ) and d i g e s t e d w i t h 5 U  BspDI and 5 U BamHI (New England B i o l a b s ) f o r 1 hour at 37°C. The e n t i r e d i g e s t was  loaded onto a 1% agarose g e l and the  fragments s e p a r a t e d e l e c t r o p h o r e t i c a l l y . was  The d e s i r e d band  approximately 94 0 bp i n l e n g t h f o r each r e a c t i o n .  The  band generated by DI1 & DI3 i s 15 bases longer, but i n p r a c t i s e t h i s c o u l d not be d i s t i n g u i s h e d from the product of DI2  & DI3. The 94 0 bp bands were e x t r a c t e d from the g e l and  p u r i f i e d w i t h Qiaex beads  (Qiagen).  The DNA c o n c e n t r a t i o n s  were determined s p e c t r o p h o t o m e t r i c a l l y and the fragments were mixed  i n a 1:1:3  molar r a t i o w i t h pUC18 l i n e a r i z e d w i t h BamHI  and t r e a t e d w i t h CIP.  The mixture was  room temperature w i t h 1 U T4 DNA (Gibco/ BRL).  Competent E.coli  ligase i n ligase buffer DH5a were transformed w i t h  the r e a c t i o n on the f o l l o w i n g day. c o l o n i e s was  determined by PCR  The i n s e r t s i z e of white  s c r e e n i n g u s i n g the  u n i v e r s a l and r e v e r s e primers on pUC18. 2.1 kb i n s i z e  i n c u b a t e d o v e r n i g h t at  M13  A band approximately  (1.9 kb i n s e r t p l u s 200 bp p o l y l i n k e r ) on an  agarose g e l would  i n d i c a t e a p o t e n t i a l DI template f o r Page 55  transcription.  Since three d i f f e r e n t l i g a t i o n products would  g i v e an i n s e r t of t h i s s i z e , a l l p o s i t i v e c l o n e s a l s o had t o be screened by d i g e s t i o n with S s t l l . single S s t l l  s i t e would be c o r r e c t .  Only c l o n e s w i t h a There  i s a unique  s i t e i n the DI2 primer; pUC18 i s not cut by t h i s  2.4.2 P r e p a r a t i o n of a snapback-type synthetic  Sstll  enzyme.  DI p a r t i c l e w i t h  oligonucleotides.  An a l t e r n a t e s t r a t e g y f o r the p r o d u c t i o n of DI p a r t i c l e s , which r e q u i r e d no PCR, was a l s o d e v i s e d .  This  s t r a t e g y r e l i e s on the presence of a BspHI s i t e 40 bp i n from the 5' end of pPDV1300.  Four o l i g o n u c l e o t i d e s were  s y n t h e s i z e d u s i n g a Beckman 1000M DNA s y n t h e s i z e r , Table 1. O l i g o n u c l e o t i d e s 1 & 2 are designed so that when they anneal they produce  a H i n d i I I compatible end t o f a c i l i t a t e  and the T7 promoter immediately  cloning  adjacent t o the f i r s t  40  bases of pPDV1300, ending i n a BspHI compatible end. O l i g o n u c l e o t i d e s 3 & 4 are designed so that when they anneal they produce  a Kpnl compatible end f o r c l o n i n g , a unique  Xmal  s i t e t o l i n e a r i z e the c o n s t r u c t before t r a n s c r i p t i o n and the complement of the f i r s t  40 bases of pPDV1300 ending i n a  BspHI compatible end. A f t e r the s y n t h e s i s , these o l i g o n u c l e o t i d e s were d i s s o l v e d i n 100 /xl of d i s t i l l e d water and t h e i r t r a t i o n s determined  by spectrophotometry.  concen-  Equal molar  amounts of o l i g o l & o l i g o 2 and o l i g o 3 & o l i g o 4 were mixed, Page 56  T a b l e 1. O l i g o n u c l e o t i d e s used t o c o n s t r u c t templates f o r snapback and d e l e t i o n - t y p e DI particles. O l i g o s #1 and #2 a l i g n t o form a c a s s e t t e with H i n d i I I and BspHI ends and with the T7 promoter d i r e c t l y adjacent t o the 5' end sequence of PDV RNA1. O l i g o s #3 and #4 a l i g n t o form a c a s s e t t e with Kpnl and BspHI ends and have an Xmal s i t e adjacent t o the Kpnl s i t e . When a p a l i n d r o m i c cDNA fragment, d e r i v e d from the 5' end of RNA1, i s l i g a t e d t o these c a s s e t t e s v i a t h e i r BspHI ends a palindromic sequence r e s u l t s which, when t r a n s c r i b e d with T7 RNA polymerase, g i v e s r i s e t o a snapback DI RNA.  Oligo 1 2 3 4  (D LTl  Sequence AGCTTAATACGACTCACTATAGGTTTTACGAACGTGGTTGTTCGTATTTTAAATCAAT ATTATGCTGAGTGATATCCAAAATGCTTGCACCAACAAGCATAAAATTTAGTTAGTAC C ATGATTGATTTAAAATACGAACAAC CACGTT CGT AAAAC C C CGGGTA TAACTAAATTTTATGCTTGTTGGTGCAAGCATTTTGGGGCC  overlayed with p a r a f i l m o i l ,  heated t o 80°C f o r 10 minutes  and allowed t o c o o l t o room temperature 2 hours.  over a p e r i o d of  These were l i g a t e d onto the ends of pUC18 by mixing  i n a 3:3:1  molar r a t i o w i t h pUC18, p r e v i o u s l y l i n e a r i z e d w i t h  H i n d i I I and Kpnl, and i n c u b a t i n g with 1 U T4 DNA ligase buffer  (Gibco/BRL) f o r 4 hours at room  The l i g a t i o n products were separated from f r e e n u c l e o t i d e s by e l e c t r o p h o r e s i s and the 2.7 e x t r a c t e d from the g e l u s i n g Qiaex beads  ligase in  temperature. oligo-  kb band  was  (Qiagen).  c o n c e n t r a t i o n of the r e s u l t i n g products was  The  determined  by  spectrophotometry. The b u l k of the g e n e t i c m a t e r i a l f o r the DI p a r t i c l e  was  made from pPDV13 00 by d i g e s t i n g the p l a s m i d w i t h Pvul and BspHI.  T h i s r e l e a s e d a 225 bp fragment  p u r i f i e d u s i n g Qiaex beads. was  determined  which was  gel  The c o n c e n t r a t i o n of t h i s  and the fragment  was  mixed i n a 10:1  DNA  molar  r a t i o w i t h the prepared pUC18 (above) and i n c u b a t e d o v e r n i g h t at room temperature (Gibco/BRL).  w i t h 2 U T4 DNA  ligase i n ligase buffer  Although the prepared pUC18 v e c t o r has  compatible BspHI ends, n e i t h e r of these i s p h o s p h o r y l a t e d thus c i r c u l a r i z a t i o n without an i n s e r t i s prevented. the Pvul fragments  and  Also,  can j o i n e i t h e r v i a the Pvul or the BspHI  ends but s i n c e they can o n l y l i g a t e to the v e c t o r i f they have two BspHI ends, and s i n c e e i t h e r o r i e n t a t i o n produce would be  the same clone, almost a l l p o s i t i v e  will  transformants  correct.  Page 58  2.4.3 P r e p a r a t i o n o f a d e l e t i o n type-DI p a r t i c l e A template  f o r t r a n s c r i b i n g a d e l e t i o n - t y p e DI RNA was  assembled from two e x i s t i n g c l o n e s , pPDV33 RACE c l o n e c o n t a i n i n g the 3' end of RNA1 Figure 1).  (2.3.11) and a  (pRACE32) (see  The former was d i g e s t e d w i t h EcoRV and BamHI t o  remove approximately  460 bp from i t s 3' end.  pRACE32 was  d i g e s t e d w i t h H i n d i and BamHI and the 150 bp fragment, r e p r e s e n t i n g the 3'-end of RNA1 was g e l p u r i f i e d and l i g a t e d i n t o prepared pPDV33 d e s c r i b e d above. screened  Transformants  were  f o r i n s e r t s i z e , and a c o r r e c t c l o n e was i d e n t i f i e d  and a m p l i f i e d .  T h i s clone was d i g e s t e d w i t h BamHI and BspHI  and c l o n e d i n t o pUC18-T7. Plasmid pUC18-T7 was prepared by d i g e s t i n g pUC18 w i t h BamHI and H i n d i I I and l i g a t i n g o l i g o n u c l e o t i d e s 1/2 (see Table 1) i n t o the H i n d l l l s i t e .  The r e s u l t i n g  pPDVdil was sequenced t o c o n f i r m i t s s t r u c t u r e .  plasmid A 1 pig  p r e p a r a t i o n was d i g e s t e d with BamHI and t r a n s c r i b e d u s i n g T7 RNA polymerase  (Ribomax k i t : Promega).  A f t e r the r e a c t i o n ,  DNA was removed by d i g e s t i o n w i t h DNase I and the RNA recovered by phenol  e x t r a c t i o n and ethanol  precipitation.  2.4.4 R e p l i c a t i o n o f a DI p a r t i c l e in vivo Two tig o f p u r i f i e d DI RNA i n TE (10 mM T r i s - H C l , pH 8.0; 1 mM EDTA) were m e c h a n i c a l l y i n o c u l a t e d onto pumpkin c o t y l e d o n s dusted w i t h carborundum Sugar).  (C. maxima cv. Small  These had been i n f e c t e d with PDV 1 week e a r l i e r . Page 59  F i g u r e 1. The s t r u c t u r e o f p P D V d i l . The c o n s t r u c t was p r o d u c e d b y d i g e s t i n g pPDV33 ( y e l l o w ) w i t h EcoRV a n d B s p H I a n d a f u l l l e n g t h RACE c l o n e (pRACE32, b l a c k ) c o n t a i n i n g t h e 3'-end o f PDV RNA1, w i t h BamHI a n d H i n d i . T h e s e c l o n e s were l i g a t e d v i a t h e i r b l u n t e n d s a n d l i g a t e d i n t o pUC18, w h i c h c o n t a i n e d t h e T7 p r o m o t e r c a s s e t t e d e s c r i b e d i n T a b l e 1, v i a t h e B s p H I a n d BamHI s i t e s . Page 6 0  Healthy c o n t r o l p l a n t s were a l s o i n o c u l a t e d w i t h DI RNA and some PDV-infected p l a n t s were mock-inoculated w i t h TE b u f f e r . P l a n t s were allowed t o grow f o r a p e r i o d of 3 days and harvested.  T o t a l n u c l e i c a c i d was e x t r a c t e d  s e p a r a t e d by e l e c t r o p h o r e s i s  ( s e c t i o n 2.1.5),  on a nondenaturing  agarose g e l  and t r a n s f e r r e d t o a n y l o n membrane by a c a p i l l a r y b l o t .  The  Northern b l o t was probed with a r a d i o l a b e l l e d cDNA probe, prepared by l a b e l l i n g a Pvul/Ncol fragment 32  P, u s i n g random primer l a b e l l i n g  o f pPDV33 w i t h  ( s e c t i o n 2.3.7).  The  n y l o n membrane was autoradiographed t o v i s u a l i z e bands.  Page 61  3.0  3.1.0  RESULTS  Virus P u r i f i c a t i o n The  v i r u s p u r i f i c a t i o n procedure of F u l t o n  (1959)  y i e l d e d v i r u s of adequate p u r i t y f o r many a p p l i c a t i o n s . procedure was required  used to p r o v i d e a n t i g e n f o r TAS-ELISAs which  p u r i f i e d PDV  and  f o r the d e t e c t i o n  p r o t e i n by western b l o t t i n g . were found by  SDS  PAGE to be  Experiments which r e q u i r e d which had gradient plant  time.  and  F i g u r e 2A  f o r 2 hours.  coat  contaminated by o t h e r  proteins.  purer v i r i o n s were done w i t h v i r u s  (see F i g u r e 2).  l i n e a r sucrose  Fractions  density  most of  the  taken from  a f t e r u l t r a c e n t r i f u g a t i o n were analyzed  PAGE to assess the 2A),  PDV  t h i s method  u l t r a c e n t r i f u g a t i o n , which e l i m i n a t e d  contaminants  (Figure  of the  V i r i o n s prepared by  been p u r i f i e d f u r t h e r by  sucrose g r a d i e n t SDS  This  e f f e c t of t h i s step on v i r u s  to determine the optimal shows the g r a d i e n t  When t h i s time was  v i r u s moved to the  region  centrifugation  ultracentrifugation  increased  to 2.5  c e n t e r of the g r a d i e n t  i n lane 3,  F i g u r e 2B.  p r o t e i n of i l a r v i r u s e s has 25 kDa region,  (Fulton,  1975)  and  and  was  hours,  M  r  of the  run the  separated the  coat  been r e p o r t e d to be t y p i c a l l y the presence of a band i n t h i s  absent i n negative c o n t r o l lanes,  i n d i c a t o r of the presence of The  The  by  purity  from p r o t e i n contaminants, i n d i c a t e d by a s i n g l e band i n 25 kDa  the  was  used as  an  PDV.  y i e l d of p u r i f i e d v i r u s , c o l l e c t e d by u l t r a Page  62  A  B  Figure 2 . Denaturing polyacrylamide electrophoresis gels (SDS PAGE) s h o w i n g v i r u s p u r i t y a f t e r u l t r a c e n t r i f u g a t i o n through a l i n e a r sucrose gradient. The g e l s were s t a i n e d w i t h C o o m a s s i e b r i l l i a n t b l u e R-250, m o l e c u l a r w e i g h t m a r k e r s a r e g i v e n i n kDa. A. Gradient f r a c t i o n analysed a f t e r 2 h o u r s o f u l t r a c e n t r i f u g a t i o n ; l a n e 1: m o l e c u l a r s i z e s t a n d a r d s ( d a l t o n V I I s e t : S i g m a ) ; l a n e 2: s a m p l e l o a d e d o n t o s u c r o s e g r a d i e n t ( p r e - g r a d i e n t f r a c t i o n ) ; l a n e 3: u p p e r p a r t o f g r a d i e n t ; l a n e 4: c e n t r a l b a n d i n g r a d i e n t ; l a n e 5: l o w e r p a r t o f g r a d i e n t ; ( l a n e 6: e m p t y ) ; l a n e 7: p r e p a r a t i o n f r o m uninfected leaves (pre-gradient f r a c t i o n c f . lane 2). B. U l t r a c e n t r i f u g a t i o n ( s u c r o s e g r a d i e n t ) r u n f o r 2.5 h o u r s ; l a n e I : p r e - g r a d i e n t f r a c t i o n ; l a n e 2: u p p e r p a r t o f g r a d i e n t ; l a n e 3: c e n t r a l p e a k i n g r a d i e n t ; ( l a n e 4: e m p t y ) ; l a n e 5: h e a l t h y p r e p a r a t i o n ( c f . l a n e 7 i n A); l a n e 6: m o l e c u l a r s i z e standards ( d a l t o n V I I s e t : Sigma). The M o f i l a r v i r u s c o a t p r o t e i n i s r e p o r t e d t o be t y p i c a l l y 25 kDa. S a m p l e s w e r e n o t f r o m t h e same v i r u s p r e p a r a t i o n and, due v a r i a t i o n s i n t h e p r e p a r a t i o n s , t h e same amount was n o t loaded onto each g e l . r  Page  63  c e n t r i f u g a t i o n of the pooled sucrose g r a d i e n t peaks,  was  determined by spectrophotometry f o r each p r e p a r a t i o n based on the r e p o r t e d e x t i n c t i o n c o e f f i c i e n t f o r PDV (Halk & F u l t o n 1978) .  V i r u s r e c o v e r y was  of 1.57  at 260  nm  found t o be  t y p i c a l l y 25 /xg v i r u s / g f r e s h weight l e a f t i s s u e  (approxi-  mately 2 mg t o t a l per p r e p a r a t i o n ) .  3.1.1  V i r a l RNA  separation  E x t r a c t i o n of genomic ssRNA d i r e c t l y from i s o l a t e d v i r u s p a r t i c l e s u s i n g heated phenol was the v i r a l RNA  was  e f f e c t i v e and ensured that  almost f r e e of contaminating p l a n t rRNAs,  s i n c e ribosomes were mostly e l i m i n a t e d d u r i n g the v i r u s p u r i f i c a t i o n procedure.  Genomic PDV RNA  was  a n a l y z e d by  MeHgOH agarose g e l e l e c t r o p h o r e s i s t o determine the s i z e s of the t h r e e RNA  s p e c i e s (Figure 3A).  kb; RNA2: 2.8  kb; RNA3: 2.2  r e p o r t e d s i z e of 0.88  kb  kb.  The s i z e s were: RNA1:  3.6  The subgenomic RNA4 has a  (Bachman et al. 1994)  and i s c l e a r l y  v i s i b l e i n F i g u r e 3A. R e p l i c a t i v e form dsRNA was  analyzed by non-denaturing  agarose g e l e l e c t r o p h o r e s i s u s i n g CMV marker  (Figure 3B).  dsRNA as m o l e c u l a r s i z e  The dsRNA was used i n Northern b l o t s to  i d e n t i f y the o r i g i n of cDNA fragments.  DsRNA p r e p a r a t i o n s  were f r e q u e n t l y contaminated w i t h rRNA and tRNA but  this  c o u l d be reduced by the a d d i t i o n of RNase TI t o the sample o r electrophoresis. bands.  T h i s s i m p l i f i e d the i d e n t i f i c a t i o n of dsRNA  Contamination by p l a n t DNA  was  e a s i l y e l i m i n a t e d by Page 64  A  E  F i g u r e 3A. D e t e r m i n a t i o n o f t h e s i z e s o f t h e PDV RNA s p e c i e s ( l a n e s 1 & 2) b y d e n a t u r i n g a g a r o s e g e l e l e c t r o p h o r e s i s i n MeHgOH. The g e l was s t a i n e d w i t h e t h i d i u m b r o m i d e . The m o l e c u l a r w e i g h t s t a n d a r d s ( l a n e 3, G i b c o / B R L ) a r e g i v e n i n kb. The s i z e s o f t h e RNAs were d e t e r m i n e d t o b e : RNA1: 3.3 k b ; RNA2: 2.6 k b ; RNA3: 1.9 k b . RNA4 (0.88 kb) i s v i s i b l e a t the bottom o f t h e l a n e . B. C o n f i r m a t i o n o f t h e p r e s e n c e o f r e p l i c a t i v e f o r m dsRNA a f t e r e x t r a c t i o n f r o m i n f e c t e d c h e r r y l e a v e s ( l a n e 2 ) . The m o l e c u l a r s i z e s t a n d a r d i s CMV dsRNA a n d s i z e s a r e shown i n k b ( l a n e 1 ) . The g e l was s t a i n e d w i t h e t h i d i u m b r o m i d e .  Page 65  by a l l o w i n g RNase A t o h y d r o l y s e s i n g l e - s t r a n d e d RNA d i g e s t i o n with  3.2.0  DNasel.  Antibody The  assayed  after  Production  s e r a from the t a i l - b l e e d s of two immunized mice were f o r anti-PDV  antibodies.  The r e s u l t s of a TAS-ELISA,  expressed as PDV/healthy, were 2.246/0.876 and 2.239/0.891 f o r a 1:3000 d i l u t i o n s of the sera, i n d i c a t i n g t h a t both mice had an immune response  a g a i n s t the v i r u s .  a s i n g l e s t a b l e hybridoma l i n e ,  The f u s i o n y i e l d e d  c a l l e d PDA-3C, although two  o t h e r hybridomas were a l s o i d e n t i f i e d that produced antibodies. in vitro  anti-PDV  However, o n l y the PDA-3C hybridoma l i n e s u r v i v e d  and i t was used i n a l l subsequent  serological  assays. S e r o l o g i c a l t e s t i n g r e v e a l e d t h a t t h i s antibody was of the IgG-L s u b c l a s s .  The HAP p u r i f i e d stock had a p r o t e i n  c o n c e n t r a t i o n of 2.5 mg/ml and a d i l u t i o n endpoint by TAS-ELISA.  of 1:15000  Routine assays were c a r r i e d out w i t h the  antibody at a d i l u t i o n of 1:1000 o r 2.5 /xg/ml.  To v e r i f y  that PDA-3C was r e a c t i n g w i t h the coat p r o t e i n of PDV, i t was t e s t e d i n an immunoblot p r o t e i n with a M  r  (Figure 4 ) .  of approximately  The antibody binds t o a  25 kDa, c o r r e s p o n d i n g t o  the s i z e of the coat p r o t e i n t y p i c a l l y r e p o r t e d f o r members of the i l a r v i r u s group. PDA-3C was e v a l u a t e d i n a TAS-ELISA t o d e t e c t PDV i n the f l o w e r s and l e a v e s of a PDV-infected sweet c h e r r y and the Page 66  Figure 4. R e c o g n i t i o n o f a 25 kDa b a n d b y PDA-3C i n a Western b l o t . The SDS-PAGE u s e d t o make t h i s b l o t was l o a d e d w i t h a s i n g l e w i d e - t o o t h comb. M o l e c u l a r w e i g h t m a r k e r s were r u n b u t a r e n o t shown i n t h e f i g u r e ; h o w e v e r t h e i r p o s i t i o n s a n d s i z e s a r e i n d i c a t e d i n kDa. The g e l was l o a d e d w i t h PDV p u r i f i e d a s d e s c r i b e d i n s e c t i o n 2.1.2. Page 67  P. mahaleb stock t r e e  (Table 2 ) . The assay c o u l d r o u t i n e l y  detect  PDV d u r i n g A p r i l and May g i v i n g absorbance  values  above the p o s i t i v e - n e g a t i v e t h r e s h o l d f o r i n f e c t e d  t r e e s , but was no longer  r e l i a b l e by l a t e June.  The  p o s i t i v e - n e g a t i v e t h r e s h o l d i n Table 2 was s e t at x +4S, (the H  mean of the h e a l t h y units  c o n t r o l s p l u s f o u r standard  (Sutula e t al. 1986)).  deviation  When t r e e s i n f e c t e d w i t h PNRSV  were assayed by TAS-ELISA u s i n g PDA-3C, the absorbance were below the t h r e s h o l d e s t a b l i s h e d from u n i n f e c t e d  values  trees  (Table 2 ) . Thus, PDA-3C d i d not c r o s s - r e a c t w i t h PNRSV i n t h i s assay.  There are no other known i l a r v i r u s e s which  n a t u r a l l y i n f e c t sweet c h e r r y  (Nemeth, 1986).  PDA-3C was a l s o t e s t e d i n a TAS-ELISA a g a i n s t two i s o l a t e s o f PDV g i v i n g p a r t i c u l a r l y severe symptoms, obtained from, the v i r u s c o l l e c t i o n i n Wenatchee, WA.  The r e s u l t s of  t h i s assay, i n Table 2, show that the antibody was able t o recognize  these s t r a i n s of PDV.  3.3.0 Primer p a i r s #1 and #2 i n RT-PCR Once a p r o t o c o l f o r the a m p l i f i c a t i o n of p u r i f i e d PDV RNA by RT-PCR had been e s t a b l i s h e d , two primer p a i r s 2.3.15) were t e s t e d f o r t h e i r a b i l i t y t o d e t e c t  (section  PDV i n the  leaves o f the P. mahaleb PDV stock t r e e , a h e a l t h y  control  sweet c h e r r y t r e e and a t r e e i n f e c t e d w i t h PNRSV.  The RT-PCR  procedure gave p o s i t i v e r e s u l t s w i t h both primer p a i r s (Figure 5) f o r the PDV i n f e c t e d t r e e only.  Amplification Page 68  Table 2 . TAS-ELISA r e s u l t s u s i n g monoclonal antibody PDA-3C to d i f f e r e n t i a t e between PDV and PNRSV i n i n f e c t e d sweet c h e r r y and P. mahaleb. Three samples were assayed i n each case. Absorbance measurements were made f o l l o w i n g a 2 hour substrate incubation.  ELISA r e s u l t s Sample  (A  4 0 5  -  A  6 2 0  )  PDV-infected  PNRSVinfected  Healthy  Buffer blank  0.428±0.041  0.073±0.021  0 . 066  0 . 038  0.222±0.024  0.071±0.009  P. avium Summerland  Flower Leaf  P. mahaleb Summerland  Flower Leaf  0.991±0.048  ND  0.460±0.076  0.065±0.003  0.054  0.028  P. avium Wenatchee  Leaf Leaf  0.751±0.027  ND  0.088  0.101  0.666±0.044  ND  2  1  ND = not determined Two i s o l a t e s were assayed  1 2  Page 69  bp U>0-  100 *  TOO-  5. R e s u l t s o f RT-PCR a s s a y o f t h e P. mahaleb p o s i t i v e c o n t r o l t r e e , a h e a l t h y sweet c h e r r y c o n t r o l t r e e a n d a sweet c h e r r y i n f e c t e d w i t h PNRSV. The g e l i s s t a i n e d w i t h e t h i d i u m bromide. L a n e 1: m o l e c u l a r s i z e s t a n d a r d s (100 bp l a d d e r : G i b c o / B R L ) , s i z e s i n d i c a t e d i n b p ; l a n e s 2 & 3: t e m p l a t e n e g a t i v e c o n t r o l f o r p r i m e r p a i r s #1 & #2 r e s p e c t i v e l y ; l a n e 4: t h e P. mahalejb t r e e w i t h p a i r #1; l a n e 5: h e a l t h y c o n t r o l f o r p a i r #1; l a n e 6: t h e P. mahaleb t r e e w i t h p a i r #2; l a n e 7: h e a l t h y c o n t r o l w i t h p a i r #2; l a n e 8: PNRSV i n f e c t e d t r e e w i t h p a i r #1; l a n e 9: PNRSV i n f e c t e d t r e e w i t h p a i r #2. Figure  Page 70  f a i l e d i n the h e a l t h y t r e e and a m p l i f i e d RNA d e t e c t PDV  3.3.1  from PNRSV.  furthermore,  neither pair  Thus, e i t h e r p a i r c o u l d be used to  i n i n f e c t e d cherry.  D e t e c t i o n of PDV  by RT-PCR i n sweet c h e r r y  Since RT-PCR i s c u r r e n t l y one method a v a i l a b l e f o r PDV the P D V - i n f e c t i o n  of the most s e n s i t i v e  d e t e c t i o n , i t was  used t o determine  s t a t u s of sweet c h e r r y t r e e s which were  l a t e r assayed by TAS-ELISA and b i o a s s a y  ( s e c t i o n 3.4.2) .  F i f t y - f i v e t r e e s were o r i g i n a l l y s e l e c t e d f o r a designed  to e s t a b l i s h a r e l i a b l e TAS-ELISA assay, and  were assayed f o r the presence of PDV u s i n g unopened buds and The  survey these  by RT-PCR i n l a t e  i n s p r i n g u s i n g flowers and  winter  leaves.  r e s u l t s of the RT-PCR u s i n g leaves are shown i n F i g u r e  the presence of a 197 in a tree.  I t was  bp band i n d i c a t e s the presence of  found that leaves were the most  R e s u l t s of the f i e l d  3.4.1  I d e n t i f i c a t i o n of PDV-infected  survey trees  Of the 55 t r e e s o r i g i n a l l y t e s t e d by RT-PCR, 40  (Table 3 ) . The  hence  contamination.  3.4.0  were used i n a f i e l d  PDV  convenient  t i s s u e to work w i t h i n terms of ease of p r o c e s s i n g and lower chance of sample c r o s s  6;  trees  survey to e s t a b l i s h a r e l i a b l e TAS-ELISA  r e s u l t s of the RT-PCR assay performed on  symptomatic t r e e s i n d i c a t e d the PDV  i n f e c t i o n s t a t u s of  samples are summarized i n Table 4.  The  the these  15 symptomless t r e e s , Page 71  Figure 6. Agarose g e l , s t a i n e d w i t h e t h i d i u m bromide, s h o w i n g RT-PCR r e s u l t s . L e a v e s were a s s a y e d f o r t h e p r e s e n c e o f PDV i n t h e s p r i n g , s h o r t l y a f t e r p e t a l - d r o p . Some o f t h e s e t r e e s w e r e u s e d t o s e t c o n f i d e n c e l i m i t s f o r t h e TASELISA. T h i s g r o u p was a s s a y e d w i t h p r i m e r p a i r #1, and t h e p r e s e n c e o f a 179 bp b a n d i n d i c a t e s t h e p r e s e n c e o f PDV. The m o l e c u l a r s i z e s t a n d a r d s (100 bp l a d d e r : G i b c o / B R L ) a r e g i v e n i n bp. Lanes are l a b e l l e d w i t h the t r e e l o c a t i o n , each lane r e p r e s e n t s one t r e e . Page  72  T a b l e 3 . R e s u l t s of the PDV TAS-ELISA, RT-PCR and b i o a s s a y and the PNRSV TAS-ELISA performed on f o r t y c h e r r y t r e e s at the Summerland Research Centre. Most of the t r e e s had symptoms i n d i c a t i n g a v i r a l i n f e c t i o n . TAS-ELISA r e s u l t s are i n d i c a t e d by the number of i n f e c t e d l e a v e s out of a p o s s i b l e six.  Tree  Symptoms  TASELISA  Bioassay  RT-PCR  PNRSV  13S  22/8  None  5/6 +  +  +  13S  24/28  None  0/6 -  -  -  -  13S  39/51  None  6/6 +  +  +  -  +  +  2N 36/26  Shot  holes  6/6 +  2N 34/23  Shot  holes  0/6 -  11-14  Shot  holes  0/6 -  SP  4/3  Shot  holes  + •  •  6/6 +  +  •  -  A 2/1  Shot h o l e s , n e c r o s i s  2/6 +  +  +  ND*  A 2/5  Little  5/6 +  +  +  + +  cherry disease  A  9/34  None  0/6 -  +  -  A  9/41  Rugose  6/6 +  +  +  _  A  9/71  Shot  holes  6/6 +  +  +  +  A 11/3  Red  leaves  6/6 +  +  +  A 20/1  Red  leaves  6/6 +  +  +  +  A 20/2  Red  leaves  5/6 +  +  +  +  A 20/3  Red  leaves  6/6 +  +  +  +  A 20/4  Red  leaves  6/6 +  +  +  +  B 4/2  Shot h o l e s , brown p a t c h e s  6/6 +  +  +  _  B 4/3  Twisted  0/6 -  _  B 4/27  Shot h o l e s ,  6/6 +  +  +  •  B 4/52  Twisted  6/6 +  +  +  +  B 5/5  White  0/6 -  -  -  -  B 6/24  M o t t l e , bumpy  6/6 +  +  +  +  B 6/25  Mottle,  6/6 +  +  +  +  B 8/30  Shot  holes  6/6 +  +  +  +  B  Shot  holes  6/6 +  +  +  +  leaves  4/6 +  +  +  -  8/34  leaf,  necrotic  enations  leaf,  dieback,  shoulders  shot  midvein  fruit holes  ringspots  B 8/38  Red  B  9/22  Shot  holes  6/6 +  +  +  -  B  9/30  Shot  holes  4/6 +  +  +  -  Page 73  B 9/45  Shot  holes  0/6 -  +  B 9/47  Shot  holes  6/6 +  B 9/48  None  6/6 + mottle  +  +  •  ND  +  +  ND  0/6 -  +  -  +  B 9/49  Shot h o l e s ,  B 9/50  None  6/6 +  +  +  ND  B 9/51  None  6/6 +  +  +  ND  B 13/12  Short  +  -  B 13/22  Shot h o l e s , m o t t l e ,  +  +  + +  stem  5/6 + yellows  6/6 +  Shot  holes  0/6 -  +  -  B 5/2  Shot  holes  1/6 +  +  +  +  A 16/1  None  0/6 -  +  -  +  SP  *ND  2/18  = not  determined  Page  74  to be  used as n e g a t i v e c o n t r o l s , were determined to be  f r e e by RT-PCR and  i l a r v i r u s - f r e e by  bioassay.  PNRSV are  4  PDV  and  Shirofugen', necessitating  trees that PDV  indistinguishable  These t r e e s were found to be  D e t e c t i o n of PDV r e s u l t s of the  by  by  indexing  f u r t h e r i n v e s t i g a t i o n of  PNRSV i n a separate TAS-ELISA  The  'Shirofugen'  t e s t e d p o s i t i v e by the b i o a s s a y but  by RT-PCR.  3.4.2  the  PDV-  on  five  negative f o r  i n f e c t e d with  (Table 4).  TAS-ELISA  TAS-ELISA on the group of 4 0  symptomatic t r e e s to determine the number of l e a v e s which t e s t e d p o s i t i v e f o r PDV f o r each t r e e are  by TAS-ELISA out (Table 5).  summarized  v a l u e s , as w e l l as maximum and are  expressed r e l a t i v e to the  each p l a t e . not  the  The  proportion  PDV  Average ELISA  threshold  to n o r m a l i z e them f o r  of l e a v e s that were i n f e c t e d (x  d e t e c t e d i n a 4/6  2  = 87.7,  of the  be  i d e n t i f i e d i f the number of l e a v e s to be  infected trees.  df =  was  30,  l e a v e s by TAS-ELISA i n  29  so that  31  was  six  minimum v a l u e s f o r each set,  same f o r every i n f e c t e d t r e e  P<0.001).  of a p o s s i b l e  Thus, most i n f e c t e d t r e e s would t e s t e d was  chosen  t r e e s w i t h t w o - t h i r d s or more of t h e i r l e a v e s  p o s i t i v e by TAS-ELISA had being i d e n t i f i e d .  a h i g h p r o b a b i l i t y , i e . 99%,  U s i n g the  formula n = l o g ( 1 - P ) / l o g ( 1 - P r )  where n i s the number of l e a v e s to be d e s i r e d p r o b a b i l i t y of d e t e c t i o n proportion  of i n f e c t e d l e a v e s  of  tested,  (0.99)  (0.667),  and  P is  Pr i s  i t was  the the  determined  Page  75  Table 4. Summary of the r e s u l t s of the RT-PCR, b i o a s s a y and PNRSV TAS-ELISA c a r r i e d out on 40 symptomatic t e s t - t r e e s and 15 symptomless n e g a t i v e c o n t r o l t r e e s t o e s t a b l i s h the i n c i d e n c e of PDV, i l a r v i r u s e s and PNRSV r e s p e c t i v e l y .  Assay R e s u l t s  Number of trees  RT-PCR  Bioassay  PNRSV ELISA  +  +  ND*  30  -  -  ND*  4  -  +  +  5  +  -  -  1  -  -  -  15  Symptomatic trees  Symptomless trees *ND = not determined  Page 76  Table 5 . Summary o f the TAS-ELISA r e s u l t s of t r e e s i n f e c t e d w i t h PDV; s i x l e a v e s were assayed from each t r e e i n d u p l i c a t e assays. To normalize the data between p l a t e s mean, minimum and maximum v a l u e s are expressed as a r a t i o o f absorbance and t h r e s h o l d f o r each p l a t e .  # Positive leaves per t r e e (out of 6)  # Trees  0  ELISA R e s u l t s (Sample v a l u e / t h r e s h o l d ) Mean  Minimum  Maximum  0  -  -  -  1  1  1. 885  1.885  1. 885  2  1  1.273  1.191  1.283  3  0  -  -  -  4  2  1. 973  1. 620  2 .300  5  4  1.508  1. 093  2 .326  6  23  1. 931  1. 006  4 . 071  Total:  31  Page 77  t h a t f o u r l e a v e s from each t r e e must be t e s t e d i n achieve t h i s l e v e l of accuracy i n the TAS-ELISA.  order to Trees with  more than t w o - t h i r d s of t h e i r l e a v e s i n f e c t e d would have a h i g h e r p r o b a b i l i t y of d e t e c t i o n while t r e e s w i t h fewer i n f e c t e d l e a v e s would have a lower p r o b a b i l i t y of d e t e c t i o n .  3.5.0  Alternate trapping antibodies. The F ( a b ' )  fragments produced  2  PDA-3C were analyzed by SDS  by p e p s i n d i g e s t i o n of  PAGE (Figure 7).  by /3ME and unreduced samples were analysed. a band w i t h an M  r  unreduced F ( a b ' )  2  The presence of  fragments.  These were used i n p l a c e of the i n a TAS-ELISA.  IgY a n t i b o d i e s were a l s o assessed f o r t h e i r i n a TAS-ELISA and monoclonal PDA-3C was  used w i t h a l k a l i n e phosphatase conjugated PDA-3C i n a  Table  The  of  i n d i c a t e d the presence  a b i l i t y t o t r a p PDV  ELISA.  reduced  of 110 kDa,  PVAS-290 r a b b i t serum t o t r a p PDV Chicken  Samples  DAS-  r e s u l t s of these assays are summarised i n  6.  Page 78  Figure 7. R e s u l t s o f SDS PAGE u s e d t o a n a l y s e F ( a b ' ) fragments. D i g e s t i o n o f m o n o c l o n a l PDA-3C w i t h p e p s i n y i e l d e d a b a n d w i t h M o f 1 1 0 kDa, r e s i s t a n t t o d i g e s t i o n a f t e r 1 0 h o u r s ( l a n e 1) a n d 24 h o u r s ( l a n e 3 ) . T h i s b a n d i s e l i m i n a t e d by r e d u c t i o n o f t h e sample w i t h /?ME b e f o r e l o a d i n g ( l a n e 2: 1 0 h s a m p l e ; l a n e 4: 24 h s a m p l e ) . The 1 1 0 kDa b a n d i s a b s e n t i n l a n e 5 ( u n r e d u c e d PDA-3C, I g G j a n d i n l a n e 6 ( r e d u c e d PDA-3C). T h i s b a n d i s t h e c o r r e c t s i z e r e p o r t e d f o r F ( a b ' ) f r a g m e n t s (Harlow & Lane 1 9 8 8 ) . P e p s i n u s e d f o r t h e d i g e s t was r u n i n l a n e 7 . T h i s 7% S D S - p o l y a c r y l a m i d e g e l was stained with silver nitrate. M o l e c u l a r weight markers (High MW s e t : S i g m a , l a n e 8 ) a r e shown i n kDa. 2  r  2  Page 7 9  Table 6 . R e s u l t s of ELISAs u s i n g d i f f e r e n t t r a p p i n g and d e t e c t i n g a n t i b o d i e s . The numbers r e p r e s e n t ELISA v a l u e s (A - A ) o f the optimal d i l u t i o n scheme f o r each assayformat . 405  620  ELSIA v a l u e Detecting PDA-3C-AP  1  Trapping  antibody  (1:200)  2  antibody PDA-3C  (l:1000)with  AP-conjugate 1) PDA-3C  (1:400)  3  ND  PDV : 2.183 Healthy : 1.482  6  4  5  2) F ( a b ' )  2  PDV: 0.621 Healthy: 0.261  (1:800)  3) ATCC PVAS 290, (1:2000)  PDV: 0.672 Healthy: 0.078  ND  4) IgY (1:625)  PDV: Healthy:  0.210 0.089  PDA-3C-AP = a l k a l i n e phosphatase-linked PDA-3C, i n a DAS-ELISA. C o n c e n t r a t i o n g i v i n g optimal r e s u l t s . AP conjugate = sheep anti-mouse (F region) a l k a l i n e p h o s p h a t a s e - l i n k e d p o l y c l o n a l (KPL) f o r d e t e c t i n g Ab 2. PDV sample was a PDV-infected sweet c h e r r y l e a f , except f o r IgY assay, where an i n f e c t e d cucumber c o t y l e d o n was used. H e a l t h y sample was an u n i n f e c t e d sweet c h e r r y l e a f , except f o r IgY assay, where a h e a l t h y cucumber c o t y l e d o n was used. ND = not done. 1  3  c  4  5  6  Page 80  3.6.0  The p a r t i a l sequence o f PDV RNA3 The  p a r t i a l sequence f o r PDV RNA3 (from c l o n e s PDV3a and  PDV3b) and t h e i r alignment t o the r e p o r t e d sequence of RNA3 (Bachman e t al. 1994) i s shown i n F i g u r e 8.  The p o s i t i o n of  the two primer p a i r s used f o r RT-PCR and the ORFs are shown. There are seven d i f f e r e n c e s i n d i c a t e d at the n u c l e o t i d e level.  The p r e d i c t e d ORF1 & ORF2 products  of the p u b l i s h e d  sequence were compared t o the t r a n s l a t i o n products and PDV3b  ( r e s u l t s not shown).  at the amino a c i d l e v e l :  o f PDV3a  There were three d i f f e r e n c e s  l e u c i n e t o v a l i n e ( p o s i t i o n 906 i n  the p u b l i s h e d n u c l e o t i d e sequence o f RNA3, i n the movement p r o t e i n ) ; asparagine proline to arginine  to l y s i n e  ( p o s i t i o n 1584, coat p r o t e i n ) ;  ( p o s i t i o n 1590, coat p r o t e i n ) .  For amino  a c i d comparison, the sequence of the RNA3 c l o n e s was kept i n frame w i t h the p u b l i s h e d sequence i f n u c l e o t i d e i n s e r t i o n s or d e l e t i o n s occurred,  such as at p o s i t i o n 905.  3.7.0 The complete n u c l e o t i d e sequence o f PDV RNA1 A t o t a l o f e i g h t c l o n e s was sequenced i n both d i r e c t i o n s to o b t a i n the complete sequence o f RNA1.  A map o f the  p o s i t i o n s o f these c l o n e s i s shown i n F i g u r e 9.  A f u r t h e r 12  RACE c l o n e s were a l s o sequenced t o o b t a i n the sequence of the ends o f the RNA The  (clones not shown i n F i g u r e 9 ) .  complete n u c l e o t i d e sequence of PDV RNA1 and i t s  p u t a t i v e t r a n s l a t i o n product  are shown i n F i g u r e 10.  The  Page 81  guuuuaauuaaccaagagaacugaauaaauuugagauuuaucucguuuauucgugcuaag cuguggaaguugacagacaugcgguucucuauaaacccucaagaaauugaguuacugcaa gguuucuugcaaagugugaagaagacaaauuugugacguuugagauuuaucucacuaauc agauuuguuccuauucauuaaccucuuugaucucauugagugaaacaauucgguuguaga uuuaucuccugaauugaauAUGGCAUUCUCUGGUGUUUCCAGGACCAUUACCGGACAGAC GUCCGAAGCCAAUGCCAGUUCGGCAUTJUGAAGUUUCCGCUGAAGAUUGGAAUAAAAUACU CAGCGAGGUGGAUGAUUUCUAUUCCCAAACUAUGAUGAAGAACCUUCCAACUAAGAAAUG UTTTJUUCuTJUACAGUUGA AUCUAGAAGUGCUUUAGCAAGAUTrAUCCGCUAAAGCUAAAGGUCAUGUUUAUGUGCAUCA UAGUAUAAUUUACUUGUUGUACAUUCCGACCAUUCUGGAAACAACUAGUGGGGUAUUGAC C  60 12 0 180 24 0 300 360 420 480 540 600  AUUGAAACUTJUTJCAAUGUGAAUACUGGU^  66 0  GAAUGAAGCGGCUAUCUUCGUUGGAAGAUGGCCAAGAGCAGUUCACGCCGAUGACGGUGA  72 0  CGGUAUAUGUTJUATJUAGCAUCAGCCGUAAGUGUAGACGCAAAACAUGCGUCAATJUGUUGG 780 AACUGUUUACCCCUUUUGGGAUGACUCAUUGCAUAAGAAGAAACCAUAUGAGAAAAUGUA  840  CCCAACUUUGAGATJUCCCGATJUGAGAAAUCGGAAGCCCUUGCUGCUGUAGAUGAUGUGAA  90 0  AAUA CUCCAAACAUUCGCCAAAUCGCGUTJUGGUAAUUGGGAGUAGUGGAAAGGUCGAUA . . . . G. . . A  95 9  UCAAUCCCAGACUUAUUGAAAUUAAGUCUGAUGAAUCAAAGAAAGCCUUAACGGUCGAUU  1019  UCAAGAAUGUUGACGUACCUAUAAAAGGUAAAUCUUCCCUUGAGAAAUUCAAGGAAGCCG  107 9  AGUCUGUUCCUCUCAAAGAAGAGAAGUCCGACAAGGAAGCUUUUGGUGUAACGAUUGGUU  113 9  AAcucacuuugugaguuaauagcucguuuuguuuaccaauuuacuuccaacuuucgacug 1199 uuuguucucucaaaAUGUCUGGGAAAGCCAUUAAAUCUGGAAAGCCUACUACCCGAUCAC 1259 AAAGCUTJUGCUUUAGCUCGGAAGAAUAAUAAUACUACCCCUCCUGCUGGUUUUGUUAA  1319  AACAAUUCCCAAGCGGAAGCUCGAAGUCUAUUUCCGAGUGGAUGCUUCACGGACCAAAUG  13 79  UGCCCGUAAAAAGUUUUUCCGGUAUGAUAUCUCGUACCGAGAACCUGACAGUCAAUUCGA  143 9  CUGCUUCCGGUGUAUAUUACACCAUGAAAGUCCGUGAACUGUUUAAGGACUUUGCUGUUG  14 99  (  Page 82  AUACCAAGGUGUACGGAAUUGUCUUCCGUUACUGCCUUGAUGTJUUCUAAUGGUGUCUACG GACUCATJUAAAGGUUUCGAUGUGAAUGCGCCUGUGGCGCCUAAUCCCCUACAACGUAGGA - . .U.G  155 9 1619  AGTJUCACAGCGAAACAAGCCAGUGGGGUGCAAAUUCTJUGCUCCUACUGGUAUGACCGUUG  167 9  GGGAUAUACCAGAUGAUCUCUGGUUUGUCAUAAAAUAUGACAACGCUUUUCAGCCCAACG  173 9  UUCCGGUGUGGUUUUGUACUCAGUACCUCCAACACUCGAUGCCCAAGAGAGUUGAGGUCC 1799 CUGATJUCAGUUTJUAUACGCUGAGAGGGACACUGCCCUUAUGGAUGCGAUGGAUAAAAUAG  1859  UCAGUGGAUGAcuauaugauccaucauuugauugugcuuccacuaugaguauuccuagga 1919 auauucguaguuggaaaugcugcuuuugcaacagaauccaccauucagaguuugucacug 197 9 aauguuaaauccuuuugguuaaccugcacuaagugcguaaaagguuaagaugaaaaugcc 2 03 9 cauuguauccugaauggaugacacuuuucauugccuacaaauuuuguacaugcccucacc 2 099 guaaggugaggaugccccuuuaagggaugc 212 9  F i g u r e 8. The p u b l i s h e d sequence (top) o f PDV RNA3 (Bachman et al. 1994) a l i g n e d w i t h two fragments o f PDV RNA3 sequence o b t a i n e d ( p o s i t i o n 545 t o 1323 and 1444 t o 1819). Mismatches between t h e sequences a r e i n d i c a t e d by (-) o r by the nucleotide. The two open r e a d i n g frames ( p o s i t i o n 260 t o 1141 and 1214 t o 1868) o f the p u b l i s h e d sequence a r e shown i n c a p i t a l s , UTRs a r e i n lowercase l e t t e r s . The p o s i t i o n s o f PCR p r i m e r p a i r s #1 ( p o s i t i o n 844 and 1109) and #2 ( p o s i t i o n 1296 and 1456) a r e u n d e r l i n e d . I n i t i a t i o n and t e r m i n a t i o n codons a r e shown i n b o l d f a c e . Page 83  1 kb  0  25 1 31 I  (pPDV33)  2 kb  3 kb  3374  1336 I  1257 I 921 I 876 1  2773 I 1940 I  2492 I  1371 I  : 1659 I  3244 I 3278 I  2843 i  2088 I 1740 I  2947 I  F i g u r e 9. Map o f RNA1 (1=1) i n d i c a t i n g the r e l a t i v e p o s i t i o n s o f nine c l o n e s , e i g h t o f which were sequenced completely, t o o b t a i n the sequence o f RNA1. The RACE clones are not shown. A l l numbers are i n bp measured from the 5'terminus o f RNA1 u n l e s s otherwise i n d i c a t e d . Page 84  GGTTTTACGAACGTGGTTGTTCGTATTTTAAATCAATCATGACTTCTTCCGAGATCACTG M T S S E I T  6 0 7  CTGCCAATGTCCATGAACTTTTGGTTAAAGTTCTGGAAAAGCAATGCGCTGACGAGACTA A A N V H E L L V K V L E K Q C A D E T  120 27  CTACCGTCGGTAAGGCTTTCTCTGAGAAAGCGAAACAGTCTTTGAATAAGACATTCGGAC T T V G K A F S E K A K Q S L N K T F G  180 47  TAAATGATGAGTCCAAGCAACTGAAGATTTCTTTTGATTTGACGGCTGAACAGCAGACGT L N D E S K Q L K I S F D L T A E Q Q T  240 67  TACTCAAGAGACATTTTCCGGGTCGATCGGTGATTTTTTCAAATTCATCGAGTTCCTCAC L L K R H F P G R S V I F S N S S S S S  3 00 87  ACAGTTTCGCGGCGGCTCACCGCTTACTGGAGACAGACTTTATATACCAGTGTTTTGGTA H S F A A A H R L L E T D F I Y Q C F G  360 107  ACACTGATGAAACAATACTTGATTTGGGTGGAAATTATATTTCTCACCTAAAACAAAGGA N T D E T I L D L G G N Y I S H L K Q R  420 127  GGTACAACGTGCATTGTTGTTGCCCACTTCTTGACGTGAGAGACTGTGCCCGCCATACTG 48 0 R Y N V H C C C P L L D V R D C A R H T 147 AGCGTCTCATGCAGTACACTACCTACAAGACTAGCAGACCTGATGAAGTTCACGAACCAA E R L M Q Y T T Y K T S R P D E V H E P  540 167  ATTTTTGTGAGAACACATTCCAGGACTGCTCCTTGCAAGGTAAGTATGCCATGGCAATCC N F C E N T F Q D C S L Q G K Y A M A I  600 187  ATTCCACTTCGGATTTACCCTTAGGTGAACTCTGTGAGAGTTTAAGGAAGAAAGGAGTGA H S T S D L P L G E L C E S L R K K G V  660 207  TGAAGTTTATATGTTCTGTTATGATCGATCCCGAAATGTACATTAAAGACAGGGGTCACA 72 0 M K F I C S V M I D P E M Y I K D R G H 227 TAGATCATTTCAATCTGGATTGGCATGTGGACAAGGACAAAGACAGAATTTATTTTGACT 78 0 I D H F N L D W H V D K D K D R I Y F D 247 TTGTCGATGCACCCTGTTTAGGGTATGACCATAAGTATTCTACACTTATGGAGTATTTGC F V D A P C L G Y D H K Y S T L M E Y L  840 267  ATTACAATGCTGTTGATCTAGGTGATGCCGCCTTTCGTGTCGAGCGGAAAACCGATTTTC H Y N A V D L G D A A F R V E R K T D F  900 287  ATGGGGTCATGATTATCGATATCACCTATTGCTCCGGGTATAAACCTGGAATTGAGTTGA H G V M I I D I T Y C S G Y . K P G I E L  960 307  ATGCAGGAAGATCCTGTGCCTGGTTGACCAAATTGAAGTCAAAAACTTTGGTCATGGCTA 102 0 N A G R S C A W L T K L K S K T L V M A 327 CTGATATTACGTCAGTAGTACACCCTTCTTTAGAAGCGGTGTCCAGAAGACACATACTGG T D I T S V V H P S L E A V S R R H I L  1080 347  TTGACACGAAGGTCTTATCCAGAGTGTGTGAGGCTTCATTCCGACAGTACAAACCTAATG V D T K V L S R V C E A S F R Q Y K P N  1140 367  TCGATGCGCAAAGTGCTATTCAGAGTATTTGCACGATGCTTTCTTCAGCTACTAACCATT 12 00 V D A Q S A I Q S I C T M L S S A T N H 387 GTATAATCAATGGTGTTACCATGATCGCAGGTACTCCCCTCAAATTGGTTGATTACGTAC C I I N G V T M I A G T P L K L V D Y V  1260 407  Page 85  CTGTTGCCACCACTATTTATTATAGGGTGAAGAAGATCTATGATGCCATTCCAAGGTCAT 132 0 P V A T T I Y Y R V K K I Y D A I P R S 427 TGGGAATGATCAACAATCTGAGAACAACTGGGGAAATGTTGGATTATGCCACCAAACAGA 13 80 L G M I N N L R T T G E M L D Y A T K Q 447 AGGGTGGTATTCCTGATGATAGGAAACTGTTTTCCGACTATGCCTTTGAACCCTTGCGAT 1440 K G G I P D D R K L F S D Y A F E P L R 467 GTTTGCTTTCGTATGTTGGTTCTACTCCCACTCGTGTGGAAACCTACACTCGTGATGATG C L L S Y V G S T P T R V E T Y T R D D  1500 487  GTTCAATTGAGCAATGTGCTCTTTATGAACGTTGGGGCAATTCCTGGAACCTTTTTAAGG 1560 G S I E Q C A L Y E R W G N S W N L F K 507 GTTTTTTGTCGGGATATATGGAAGTCGAAGGGTTTCTTGTCTCCGATCCACAATTCTTCG G F L S G Y M E V E G F L V S D P Q F F  162 0 527  TTCCACTTACTGGAGTTCTTCATATGAAGAAATTGATAAGTGATGCTGGGAAGGTCCTTA 1680 V P L T G V L H M K K L I S D A G K V L 547 GTGTTAAGGAATTGCTCGAGGAACAACGCGCTCTTGTTGCCTTAAAGATGCGCGAGCAGA 174 0 S V K E L L E E Q R A L V A L K M R E Q 567 TTGCTGAAAGAGAAAAAGCTGAAAAGAGTCGCCGAGAGTATGAAAAGGCGATTATTCAAT I A E R E K A E K S R R E Y E K A I I Q  1800 587  TGGCTGCTTGGACCAAAGCACATCCTGATGCTAAGGTTCCAAAGGGACTTTCCGTGGAAG 1860 L A A W T K A H P D A K V P K G L S V E 607 AACCATTGATGCCGGACGTTGTCAAGAAAGTGACGGCCGATGAAGTAGTACCAGATTGCA 1920 E P L M P D V V K K V T A D E V V P D C 627 ACCCTTATTCGGATGCTATATCTGAAGCCATCGACTATTTAAGGTCGACAGCTGAAATTT 1980 N P Y S D A I S E A I D Y L R S T A E I 647 CAAAAAGCAGGTTACAACAACTTGGTGAACATTGCAGGTGGAAGAAATATGGGTTCTCAA 2 040 S K S R L Q Q L G E H C R W K K Y G F S 667 CAGTTTGGGCTGGAGATGAATCCAGAAGAATTTTTCTACCTAAGGAGAATAGATGGGTAG 2100 T V W A G D E S R R I F L P K E N R W V 687 GACCCACATCTACTCGCCAAGTTGGTCCCAAAGCTCAATATGAGAGAGGTTATACCGTTA 2160 G P T S T R Q V G P K A Q Y E R G Y T V 707 ACGGTTATGTGAATTTCACGTGGGATGATGCCGGAAATGTTTCCGATGCCTGCGTACGAT 2220 N G Y V N F T W D D A G N V S D A C V R 727 CTCTCAGAGAATACGAAATCGTCATTGTTGATGATTCCTGTGTTTTCTCATCAGTGGAGA 2280 S L R E Y E I V I V D D S C V F S S V E 747 AGGTAATACCTTCACTGGAAAAAGCTTTGAAGATGAACTGTGATTTTTCAATCACAATTA 2340 K V I P S L E K A L K M N C D F S I T I 767 TGGACGGTGTTGCTGGTTGTGGAAAAACTACCAAGATTAAGTCTATTGCCTCTATGGTTG M D G V A G C G K T T K I K S I A S M V  2400 787  GAGATGATATAGACTTACTCCTAACTTCCAACAGATCCTCAGCAATTGAGTTGAAAGAAG G D D I D L L L T S N R S S A I E L K E  2460 807  CTGTTGAAGGGTCCCAGTTAGTTAAAAGTAGGTTCATTCGAACTTGCGATTCCTATCTGA 2 520 A V E G S Q L V K S R F I R T C D S Y L 827  Page 86  TGACAAACAATGCTCCTAAAGCAAAGAAAATGTTGTTTGATGAGTGTTTCATGCAACATG 2580 M T N N A P K A K K M L F D E C F M Q H 847 CTGGGGTGATATATGCTGCTGCCACAATTGCCGGTGTGTCAGAGGTTATAGCCTTTGGTG A G V I Y A A A T I A G V S E V I A F G  2640 867  ACACTGAACAAATACCATTCATTTCCAGGAATGATATGTTTCTCCTGAAGCACCATGTTT 2 700 D T E Q I P F I S R N D M F L L K H H V 887 TGAAAGGTGACCATGTAAAACAAACAATTACATACCGAAATCCTGCTGATACGGTATATG 276 0 L K G D H V K Q T I T Y R N P A D T V Y 907 CTTTGTCTAAGTTCTTCTATAGAAAGAAGACGCCTGTTAAGACGAAAAGACACATTCTTA 282 0 A L S K F F Y R K K T P V K T K R H I L 927 GGTCTATTAAAGTTAAACCTATAAATGCTCTATCTCAGGTTGAGGTGGATGCCTCCGCTG R S I K V K P I N A L S Q V E V D A S A  2880 947  TGTATGTTACGCATACTCAAGCTGAGAAGGCCAGTTTATTGGCTACTCCGAGTTTCAAAT 2 940 V Y V T H T Q A E K A S L L A T P S F K 967 CTTGTAAGATTTATACAACTCATGAGGTTCAAGGGGGTAGTTTTGACAAAGTTATATTTG 3 000 S C K I Y T T H E V Q G G S F D K V I F 987 TCAGACTTACTAGAACCAGTAATCATTTATACTCTGGTAAGCACCCTATAATGGGAGCTT 3 060 V R L T R T S N H L Y S G K H P I M G A 1007 GCCATGGACTCGTGGCTTTGTCAAGACACAAGTCGGAATTCATTTATTACACCCTAGCTG C H G L V A L S R H K S E F I Y Y T L A  3120 1027  GAGGGGATAATGATGATATTCTTTTGAAAGCCTGTCAATACGCTGAAAGAGCGGATGACA 318 0 G G D N D D I L L K A C Q Y A E R A D D 1047 GTGATATTGTCAAACATTATGTTTGACCGTTCAGATTTTGTCACTGGACGTAAAAATCCT 324 0 S D I V K H Y V * * 1055 TTTGGTTAACTCGTACTGCGTACTTTTTGAGTTAAGATAAAAATGCCCATTGTATCCTGA 33 00  *  ATGGATGACACTTTTTATTGCCTACAAATTTGTAGATGCCCTCACCGTAAGGTGAGGATG  3360  CCCCTTAAGGATGC  33 74  *  F i g u r e 10. The complete n u c l e o t i d e sequence o f PDV RNA1 and i t s p u t a t i v e t r a n s l a t i o n product. Numbers i n d i c a t e n u c l e o t i d e o r amino a c i d p o s i t i o n . * I n d i c a t e s in-frame stop codons i n the 3'-UTR. Page 87  sequence i s 3374 n u c l e o t i d e s  i n l e n g t h and c o u l d encode a  s i n g l e p r o t e i n of 1055 amino a c i d s with a c a l c u l a t e d m o l e c u l a r mass of 118.9 kDa.  The l e n g t h of the RNA sequence  i s i n good agreement w i t h the p r e d i c t e d l e n g t h o f 3.4 kb, estimated by denaturing genomic PDV RNA  agarose g e l e l e c t r o p h o r e s i s o f t o t a l  (Figure 3 ) . The c a l c u l a t e d s i z e o f the  p r o t e i n i s s i m i l a r t o that of AMV 118.3  kDa).  (128 kDa) and CiLRV  The i n i t i a t i o n codon f o r the 118.9 kDa p r o t e i n  i s at p o s i t i o n 3 9 and the f i r s t occurs at 3202.  in-frame t e r m i n a t i o n  There are no other ORFs longer  codon  than 93 amino  a c i d s on the RNA. The extensive  3'-UTR of RNA1 i s 171 bases long and shares sequence homology with other  ilar-  and  alfamovirus  3'-UTRs (Figure 11A), i n c l u d i n g f i v e U/AUGC m o t i f s  which  appear i n the 3'-UTRs of a l l known i l a r v i r u s sequences. each AMV RNA these AUGC m o t i f s can  form stem-loop s t r u c t u r e s  In  f l a n k short sequences which (Houser-Scott e t al. 1994).  Although the i n t e r v e n i n g sequences are not s t r i c t l y  conserved  between PDV and AMV RNA1, the r e l a t i v e p o s i t i o n s of the AUGC m o t i f s a r e i n good agreement, and the 3'-end o f PDV RNA1 can form e s s e n t i a l l y the same s t r u c t u r e as the 3'-end of AMV  RNA1  (Figure 11B).  Page 88  C i L R V l UACAAACGUAGAUGCCUAUAUUUUCUCUCCUGAGAAAAUAUAGAUGCCUCCCAAGGAGAUGC TSV1 CUGAUGCUGUUUAUAUCUAAUGAUAUAAACAAUGCCUCCUUAAAGGAGAXGX AMV1 CGUGCUUAUGCACGUAUAUAAAUGCUCAUGCUAAATJUGCAUGAAUGCCCCUAAGGGAUGC PDV1 UAATJUGCCUACAAAUUUGUAGAUGCCCUCACCGUAAGGUGAGGAUGCCCCUUAAGGAUGC PDV3 UUGCCUACAAAAUUUUGUAGAUGCCCUCACCGUAAGGUTJGAGGAUGCCCCTJUUAAGGGAUGC  U C C U U  A  G  U-A U-A A-U C=G C=G  c  AAG  G  A6  G=C U-A j C A-U A-U A-U A-U A-U U-A A-U  U A G A C=G A U C=G A-U A-U U A C=G C=G U A A-U U-A C A U-A C=G C=G C=G C=G C=G UUGC AUGC AUGC AUGC A U  F i g u r e 1 1 . Comparison of the 3'-ends of some i l a r v i r u s RNAs and AMV RNA1. A. The conserved U/AUGC m o t i f s are u n d e r l i n e d to demonstrate p o t e n t i a l r e l a t i o n s h i p s . These m o t i f s f l a n k conserved sequences which c o u l d form stem-loop s t r u c t u r e s . B The f o l d i n g o f the 3' end o f PDV RNA1 i s v e r y s i m i l a r t o the 3' stem-loop s t r u c t u r e proposed by Koper-Zwartoff & B o l (1980)  for  the  3'  end  of  AMV.  Page 8 9  3.7.1. P h y l o g e n e t i c r e l a t i o n s h i p s Bromoviridae, The  based on  products  to o t h e r  RNA1  p h y l o g e n e t i c r e l a t i o n s h i p of members of  Bromoviridae nucleic  of PDV  and  RBDV i s p r e d i c t e d  on  the b a s i s  a c i d sequence of t h e i r RNAls and (Figure  12A).  The  of a p o s s i b l e  and  o c c u r r e d r e g a r d l e s s of whether the RNA  was  h e l i c a s e - l i k e domain  indicate  occurred  reproducible amino a c i d  c l e a r b l o c k s of  s i x sequences,  (Candresse et al. The  1990)  3.8.0  r e s u l t i n g phylogeny was  Replication  of a DI  polymerase.  was  transcribed  F i g u r e 13B  u s i n g t o t a l RNA  Figure  the same  12B).  The  ( t r a n s c r i p t i o n product) on DI RNA  i s approximately 1  from pPDVdil by T7  a kb  RNA  shows r e s u l t s of a Northern b l o t ,  i s o l a t e d from p l a n t s  i n the presence and  0RF3a  RNA  shows the DI RNA  non-denaturing agarose g e l . i n s i z e and  or  A s i m i l a r phylogeny r e s u l t s from parsimony  movement p r o t e i n ;  F i g u r e 13A  the  b l o c k s of  a n a l y s e s of b o o t s t r a p r e p l i c a t e s made w i t h RNA3 and (the p u t a t i v e  the  repeated u s i n g e i t h e r the N-terminal  homology i n d i v i d u a l l y . as i n F i g u r e 12A.  translation  or the  Since there were two  PILEUP alignments of the  SEQBOOT a n a l y s i s  the  fork  t r e e s . T h i s p a i r i n g was  analysed.  homology i n the  forks  r i g h t of the  out  sequence was  100  of  of t h e i r  numbers at the  number of times the group to the  the  absence of PDV  inoculated  as the  Pvul/Ncol fragment of pPDV33 as the probe.  target  w i t h DI and  RNA  a  Bands which Page  90  B  ,00-Q  •AMV  AMV -85—  —PDV  PDV i—lOO-10 01—100-  1  -99-  CiLRV  H 00A  CMV BMV RBDV  i—lOO-  ApMV PNRSV  oo-Q  CMV BMV CiLRV  F i g u r e 12. P h y l o g e n e t i c r e l a t i o n s h i p s i n f e r r e d by parsinomy a n a l y s i s w i t h P h y l i p 3.4 u s i n g PROTPARS and DNAPARS of 100 B o o t s t r a p r e p l i c a t e s generated by SEQBOOT. N u c l e i c a c i d and p r o t e i n alignments were generated by PILEUP (GCG) and e d i t e d u s i n g XESEE. A. R e l a t i o n s h i p s between RNA1 and ORF1 o f a t l e a s t one member of each genera of the Bromoviridae and RBDV. RBDV RNA1 encodes a p o l y p r o t e i n and o n l y the C-terminal r e g i o n was used i n the a n a l y s e s . Fork numbers i n d i c a t e the number of times the v i r u s group t o the r i g h t of t h a t f o r k occured i n a t o t a l of 100 t r e e s . B. R e l a t i o n s h i p s between RNA3 and movement p r o t e i n s (0RF3a) u s i n g the same analyses as i n A. Page 91  (A)  (B)  F i g u r e 13A. Agarose g e l e l e c t r o p h o r e s i s of the product o f in vitro t r a n s c r i p t i o n o f p D I l . B: N o r t h e r n b l o t a n a l y s i s o f p l a n t t o t a l RNA, p r o b e d w i t h a P v u l / N c o l f r a g m e n t o f pPDV33 ( c o m p l e m e n t a r y t o t h e 5'-end o f RNA1). L a n e 1: DI RNA t r a n s c r i p t ( p o s i t i v e c o n t r o l ) ; l a n e 2: RNA f r o m p l a n t i n o c u l a t e d w i t h PDV and DI RNA; l a n e 3: RNA f r o m p l a n t i n o c u l a t e d w i t h PDV o n l y ; l a n e 4: RNA f r o m p l a n t i n o c u l a t e d w i t h DI o n l y ; l a n e 5: RNA f r o m u n i n o c u l a t e d p l a n t ( n e g a t i v e control). P l a n t s (pumkins) were i n o c u l a t e d w i t h DI RNA 1 week a f t e r t h e y had b e e n i n o c u l a t e d w i t h PDV and l e a v e s were h a r v e s t e d 3 days l a t e r .  Page  92  h y b r i d i z e d are v i r a l RNA1 RNA  r e p l i c a t i n g i n the l e a v e s .  The DI  f a i l e d t o r e p l i c a t e in vivo u s i n g PDV- i n f e c t e d pumpkins  as a herbaceous model system and there were no bands a t approximately 1 kb (the p o s i t i o n expected f o r the DI which h y b r i d i z e d t o the probe.  RNA)  Furthermore the presence of  i n o c u l a t e d DI RNA d i d not appear t o i n f l u e n c e the copy number of PDV  RNA1.  Page 93  4.0 DISCUSSION AND  CONCLUSION  4.1.0 V i r u s i s o l a t i o n and n u c l e i c a c i d a n a l y s i s An e x i s t i n g i s o l a t i o n technique,  developed by F u l t o n  (1959), was m o d i f i e d t o i n c l u d e a sedimentation u l t r a c e n t r i f u g a t i o n step. contaminants present  T h i s removed many of the p r o t e i n  i n e a r l i e r f r a c t i o n s and r e s u l t e d i n a  s i n g l e major band corresponding when analyzed  velocity  by SDS PAGE.  t o the coat p r o t e i n of PDV  T h i s p u r i f i e d v i r u s was used t o  immunize animals t o produce p o l y c l o n a l and monoclonal antibodies.  The v i r u s p r e p a r a t i o n was a l s o found t o be  r e l a t i v e l y f r e e of p l a n t ribosomes and was thus s u i t a b l e f o r i s o l a t i n g s i n g l e - s t r a n d e d genomic v i r a l RNA which was r e l a t i v e l y f r e e of p l a n t rRNA. quality, extent  The v i r a l RNA was of good  s i n c e the v i r u s c a p s i d p r o t e c t s the RNA t o some  a g a i n s t degradation  the p u r i f i c a t i o n .  by RNases i n the e a r l y stages of  T h i s s i n g l e - s t r a n d e d RNA was used f o r  r e v e r s e t r a n s c r i p t i o n and the p r e p a r a t i o n of a cDNA l i b r a r y . I t was a l s o p o s s i b l e t o i s o l a t e dsRNA from i n f e c t e d leaves u s i n g c e l l u l o s e chromatography.  T h i s dsRNA was  contaminated t o some extent by p l a n t rRNA but was used o n l y i n Northern b l o t s and f o r RACE PCR where p l a n t rRNA contamination degradation  posed no problems.  Since dsRNA i s r e s i s t a n t t o  by many RNases under c o n d i t i o n s encountered  during i s o l a t i o n ,  i t was a l s o of good q u a l i t y .  disadvantage of the dsRNA i s evident  A  from F i g u r e 3: whereas Page 94  the s i n g l e stranded RNA bands r e p r e s e n t i n g RNA1 and RNA2 are present i n approximately  equal amounts, there i s  s i g n i f i c a n t l y more RNA3 and RNA4 (Figure 3A).  The reason f o r  t h i s i s t h a t the coat p r o t e i n (on RNA4) and movement p r o t e i n (on RNA3) a r e r e q u i r e d i n h i g h e r q u a n t i t i e s than the r e p l i c a s e components on RNA1 and RNA2.  In c o n t r a c t , i n the  dsRNA p r e p a r a t i o n s RNA1 and RNA2 are not v i s i b l e when s t a i n e d w i t h ethidium bromide, whereas RNA3 i s a c l e a r band (Figure 3b) .  4.2.0 Monoclonal antibody p r o d u c t i o n A s i n g l e hybridoma s e c r e t i n g antibody was o b t a i n e d from the f u s i o n .  T h i s monoclonal antibody  (PDA-3C) does not c r o s s  r e a c t w i t h PNRSV but r e c o g n i z e s a l l s t r a i n s of PDV t e s t e d . PDV i s s e r o l o g i c a l l y conserved  and i t was not a n t i c i p a t e d  that s e r o l o g i c a l v a r i a n t s would be found.  PDA-3C was shown  to r e c o g n i z e the coat p r o t e i n of PDV by an immunoblot. The  hybridoma l i n e producing PDA-3C i s s t a b l e , d i v i d e s  r e a d i l y i n t i s s u e c u l t u r e and adequate amounts of antibody c o u l d be i s o l a t e d d i r e c t l y from spent TCS o b v i a t i n g the need for a s c i t e s f l u i d production.  I t i s not c l e a r from t h i s  study whether the immunization  protocol, using  cyclophosphamide t o manipulate  the immune response,  was  advantageous.  Page 95  4.3.0 T r i p l e antibody sandwich  ELISA  A r e l i a b l e TAS-ELISA u s i n g PDA-3C was developed t o d e t e c t the presence of PDV i n i n f e c t e d sweet c h e r r y l e a v e s . Although the t i t r e of i l a r v i r u s e s i s h i g h i n p o l l e n , most of the assays p r e s e n t e d here were performed u s i n g young, a p i c a l leaves. for  The reason f o r t h i s i s that l e a v e s were a v a i l a b l e  a l o n g e r p e r i o d , they were a v a i l a b l e on a l l t r e e s  r e g a r d l e s s o f age and they g e n e r a l l y gave lower  background  v a l u e s by TAS-ELISA than f l o w e r s . The r e s u l t s of the TAS-ELISA performed on the t e s t were compared t o the r e s u l t s of an independent and t o a b i o a s s a y on 'Shirofugen'.  trees  RT-PCR assay  The RT-PCR r e s u l t s were  taken t o be more r e l i a b l e than the b i o a s s a y r e s u l t s . Although the b i o a s s a y i s s e n s i t i v e t o a l l known s t r a i n s of PDV, the gumming r e a c t i o n i s not always u n e q u i v o c a l . t h i s reason, the RT-PCR alone was used t o i d e n t i f y trees.  For  infected  There was a s i n g l e t r e e i n the sample which was  deemed i n f e c t e d by RT-PCR but f a i l e d t o y i e l d a p o s i t i v e r e s u l t w i t h the b i o a s s a y (see Table 4 ) . A p o s s i b l e reason for  t h i s d i s c r e p a n c y i s that the t i t r e o f PDV may have been  too  low t o e l i c i t  a gumming r e a c t i o n i n the 'Shirofugen'  assay but was n e v e r t h e l e s s h i g h enough t o be d e t e c t e d by the more s e n s i t i v e RT-PCR assay. A common concern of the use of monoclonal  antibody-based  t e s t i n g f o r p l a n t v i r u s e s i s the p o s s i b i l i t y of o b t a i n i n g f a l s e n e g a t i v e s when a s e r o l o g i c a l l y d i s t i n c t  strain i s Page 96  encountered. conserved.  S t r a i n s of PDV  serologically  T h i s i s evident from t h i s work where out of  t r e e s p o s i t i v e f o r PDV by TAS-ELISA, and  Dolby 1984)  who  tested.  by RT-PCR, a l l but one were d e t e c t e d  (McMorran & Cameron 1983;  Torrance  &  were able to d e t e c t by ELISA a l l s t r a i n s of  A l s o , two  severe  s t r a i n s of PDV  the v i r u s c o l l e c t i o n i n Wenatchee, WA  obtained  d e t e c t e d by PDA-3C i n the TAS-ELISA.  from  and u n a v a i l a b l e i n the  v i r u s c o l l e c t i o n of the Summerland Research Centre,  recognize  31  from s i m i l a r f i n d i n g s by o t h e r groups u s i n g  monoclonal s n t i b o d i e s  PDV  appear to be  were  PDA-3C d i d not  PNRSV i n the TAS-ELISA, and t h i s i s the o n l y  other  i l a r v i r u s known to i n f e c t sweet c h e r r y . The of PDV  s t a t i s t i c a l a n a l y s i s i n d i c a t e s t h a t the  distribution  i s i r r e g u l a r w i t h i n the t r e e s used i n t h i s  study.  Although the m a j o r i t y of the i n f e c t e d t r e e s harboured d e t e c t a b l e l e v e l s of PDV  i n at l e a s t two-thirds  l e a v e s , the p r o p o r t i o n v a r i e d . uniform (1984) .  of  T h i s i s c o n t r a r y to the  d i s t r i b u t i o n of v i r u s r e p o r t e d by Torrance T h i s i n c o n g r u i t y may  their  & Dolby  be a r e f l e c t i o n of the number  of growing seasons s i n c e the i n i t i a l v i r u s i n f e c t i o n .  The  consequences of an uneven v i r u s d i s t r i b u t i o n on the TAS-ELISA r e s u l t s can be p a r t i a l l y a l l e v i a t e d by s e l e c t i n g sample leaves from limbs which d i s p l a y c h a r a c t e r i s t i c PDV  symptoms.  Thus, when i n d e x i n g a mature'orchard with a h i s t o r y of  PDV,  where o l d e r i n f e c t i o n s are expected, the value of Pr c o u l d be r a i s e d , and  fewer leaves c o l l e c t e d .  In f o u n d a t i o n  plantings Page 97  of v i r u s - f r e e t r e e s , where recent prevalent,  one  i n f e c t i o n s would be more  would lower the value of Pr and  number of leaves to d e t e c t PDV  more r e l i a b l y .  samples from the same t r e e can be pooled (Torrance  & Dolby 1984), and  loaded  test a greater Since  f o r TAS-ELISA  i n t o the same w e l l i n the  m i c r o t i t r e p l a t e , a s s a y i n g more leaves does not i n c r e a s e the s c a l e of the assay. PDV  with  leaf  The  significantly  TAS-ELISA c o u l d  99% p r o b a b i l i t y i n t r e e s with t w o - t h i r d s  of  detect their  leaves i n f e c t e d , i f f o u r leaves were assayed at random.  4.4.0  Alternate trapping  antibodies  To ensure an i n d e f i n i t e supply of a n t i b o d i e s f o r the ELISA assay, i t was  necessary to attempt to d e s i g n  an assay  which does not r e l y on the a v a i l a b i l i t y of p o l y c l o n a l antibodies. 3C and  A l k a l i n e phosphatase was  t h i s conjugate was  l i n k e d d i r e c t l y to  used i n a DAS-ELISA format.  PDA-  Using  another approach, the r a b b i t p o l y c l o n a l a n t i b o d i e s were r e p l a c e d with c h i c k e n  IgY as t r a p p i n g a n t i b o d i e s .  Although  the IgY a n t i b o d i e s are p o l y c l o n a l and hence i n l i m i t e d supply,  can be produced i n very l a r g e q u a n t i t i e s .  The  most promising  to t r a p PDV  i n a TAS-ELISA.  p e p t i c d i g e s t of PDA-3C. values  assay design used F ( a b ' )  2  fragments  These are the product of a  T h i s assay gave higher  background  than the r a b b i t p o l y c l o n a l a n t i b o d i e s used i n the  ELISA f o r t h i s study  (Table  TAS-  6).  Page 98  4.5.0  The p a r t i a l n u c l e o t i d e sequence of RNA 3 The  p a r t i a l n u c l e o t i d e sequence o b t a i n e d  from PDV  c l o n e s i s i n s t r o n g agreement with the p u b l i s h e d  sequence  with o n l y seven d i f f e r e n c e s at the n u c l e o t i d e and the amino a c i d l e v e l . been due  RNA3  three at  Some of these d i f f e r e n c e s may  have  t o sequencing e r r o r s , e s p e c i a l l y n u c l e o t i d e  i n s e r t i o n s and d e l e t i o n s which would have put the c l o n e s of frame w i t h the p u b l i s h e d sequence. RNA3 were sequenced from o v e r l a p p i n g The  sequence was  Not  a l l r e g i o n s of  clones.  used to o b t a i n primers  of the primer p a i r s was  out  f o r RT-PCR.  One  chosen from w i t h i n ORF3b (the coat  p r o t e i n ) s i n c e t h i s sequence i s a l s o found on RNA4 and i s t h e r e f o r e present  i n a higher copy number which would make  RT-PCR w i t h t h i s p a i r more s e n s i t i v e . p a i r s were capable  of d e t e c t i n g PDV  However, both primer  under a l l t e s t e d  c o n d i t i o n s and the e x t r a copy-number was t h i s study.  The p a r t i a l sequence was  phylogenetic  a n a l y s i s a f t e r the f u l l  not an advantage i n  not used f o r l e n g t h sequence became  available.  4.6.0  The The  RT-PCR assay RT-PCR assay, u s i n g one  of two  primer p a i r s ,  was  found to be more s e n s i t i v e than e i t h e r the TAS-ELISA or the bioassay.  Both primer p a i r s were t e s t e d a g a i n s t PNRSV and  n e i t h e r a m p l i f i e d DNA  from RNA  template from t h i s  T i s s u e p r e p a r a t i o n f o r RT-PCR was  virus.  more complex because Page  99  i t was  more prone to c r o s s - c o n t a m i n a t i o n .  This  was  e s p e c i a l l y p r o b l e m a t i c when a s s a y i n g flower t i s s u e .  It i s  p o s s i b l e t h a t the h i g h t i t r e of v i r u s w i t h i n the p o l l e n r a i s e d the chances o f _ c r o s s - c o n t a m i n a t i o n . buds i n w i n t e r was  A s s a y i n g unopened  a l s o p o s s i b l e but r e q u i r e d even more  e x t e n s i v e t i s s u e p r e p a r a t i o n and was l a r g e numbers of samples.  Again,  not optimal f o r a s s a y i n g  leaves were used f o r most  purposes because of a v a i l a b i l i t y and ease of p r e p a r a t i o n . When h i g h s e n s i t i v i t y was  r e q u i r e d , or when r e s u l t s of  a l t e r n a t e assays were ambiguous, t h i s was  the assay of choice  and RT-PCR r e s u l t s were taken to be more a c c u r a t e than b i o a s s a y or TAS-ELISA r e s u l t s . there i s a concern w i t h PCR  anneal.  i n the t a r g e t might l e a d to  i f they cause the primer to f a i l  Using two primer p a i r s reduces  t h i s r i s k and  n e g a t i v e s from RT-PCR were not encountered  in this  4.7.0  RNA1  The The  complete n u c l e o t i d e sequence of  complete n u c l e o t i d e sequence or RNA1  sequencing  was  to  false  study.  obtained  e i g h t o v e r l a p p i n g clones and 12 RACE PCR  o b t a i n the end The  assays,  based assays t h a t c e r t a i n minor  changes, even p o i n t mutations, f a l s e negative r e s u l t s ,  As w i t h s e r o l o g i c a l  either  by  clones to  sequences.  sequence of RNA1  p u b l i s h e d Bromoviridae  RNA1  i s i n good agreement w i t h sequences and the genome  o r g a n i z a t i o n appears to be the same: RNA1 and the gene product  other  i s monocistronic  shows e x t e n s i v e sequence homology at the Page  100  amino a c i d l e v e l ' to RNA1  products of o t h e r  (viral replicase proteins).  The  Bromoviridae  AUGC m o t i f s  i n the 3'-UTR  are a l s o hallmarks of i l a r v i r u s sequences, although these motifs  are a l s o found i n AMV.  AUGC m o t i f s  are s i m i l a r , and  e s s e n t i a l l y the (Figure l i b ) .  1994).  r e l a t i v e p o s i t i o n s of  the 3'-end of PDV  same s t r u c t u r e as the 3' end In AMV  protein binding l e a s t two  The  these s t r u c t u r e s are  during  binding  RNA1  can  of AMV  involved  genome r e p l i c a t i o n and  s i t e s f o r the coat p r o t e i n .  the form  RNA1 i n coat  contain  at  (Reusken et  The  coat p r o t e i n of the i l a r -  and  alfamovirus  i s required  to i n i t i a t e r e p l i c a t i o n .  The  coat p r o t e i n of  i s able to i n i t i a t e r e p l i c a t i o n of AMV AMV  coat p r o t e i n  (Reusken et al.  RNA  1995).  al.  genera TSV  i n the absence of  This implies  that  the mechanism of r e p l i c a t i o n i n i t i a t i o n i n i l a r v i r u s e s and AMV  i s s i m i l a r and  of PDV  may  a l s o p l a y an important r o l e i n coat  r e c o g n i t i o n and there  that the s t r u c t u r a l elements i n the 3'-UTR  i n the  i n i t i a t i o n of r e p l i c a t i o n .  However,  i s no experimental evidence a v a i l a b l e f o r t h i s . The  bromo- and  cucumoviruses do not  to i n i t i a t e r e p l i c a t i o n and l i k e structure  and  there  i l a r v i r u s e s or w i t h AMV  r e q u i r e coat  protein  t h e i r 3'-UTRs f o l d i n t o a tRNA-  (Perret et al.  have the AUGC m o t i f s the  protein  1989). i s no  These v i r u s e s do  not  sequence s i m i l a r i t y with  i n the 3'-UTR.  Page  101  4.8.0  Phylogenetic  the sequence of The  r e l a t i o n s h i p s among Bromoviridae  based on  RNA1  c l o s e r p a i r i n g of PDV  with AMV  than w i t h CiLRV  was  unexpected, s i n c e the l a t t e r i s an i l a r v i r u s whereas AMV  is  the o n l y member of the A l f a m o v i r u s i n c l u s i o n of AMV  group.  Arguments f o r the  i n the i l a r v i r u s group have appeared  p e r i o d i c a l l y i n the l i t e r a t u r e , but AMV  remains the  only  member of the a l f a m o v i r u s group because of d i f f e r e n c e s i n p a r t i c l e morphology and mode of t r a n s m i s s i o n . The p a i r i n g of AMV  with PDV  was  reproducible  o c c u r r e d r e g a r d l e s s of whether the RNA sequences were analyzed.  or the amino a c i d  This i n d i c a t e s that there i s a  c l o s e r p h y l o g e n e t i c r e l a t i o n s h i p between PDV RNA1  than between the RNA1  r e l a t i o n s h i p was (Guo  e t al.  sequences of PDV  not observed  1995).  The  and  RNA1  and  AMV  and CiLRV.  This  u s i n g sequence data from RNA3  same phylogeny as i n F i g u r e  12A  occurs u s i n g parsimony analyses of b o o t s t r a p r e p l i c a t e s made with RNA3 and ORF3a (the p u t a t i v e movement p r o t e i n ; F i g u r e 12B)  but not with 0RF3b (the coat p r o t e i n ; r e s u l t s  shown).  not  A n a l y s i s with 0RF3b sequences alone y i e l d e d a  s l i g h t l y d i f f e r e n t consensus t r e e , but with the f o r k numbers <50  at some branch p o i n t s .  G r i e c o et al.  (1995) have done a  more comprehensive a n a l y s i s on the p h y l o g e n e t i c r e l a t i o n s h i p s of Bromoviridae include  coat p r o t e i n s but t h e i r a n a l y s i s d i d not  PDV.  I f v i r a l r e p l i c a s e p r o t e i n ( s ) are more r e l i a b l e  than Page  102  coat p r o t e i n ( s )  f o r determining p h y l o g e n e t i c  among p l a n t v i r u s e s , then a c c o r d i n g here, PDV  to the r e s u l t s presented  i s more c l o s e l y r e l a t e d to AMV  than to CiLRV.  should be noted that RNA2 of Bromoviridae p r o t e i n with a r e p l i c a s e function Ge  & S c o t t 1994)  and  contains  conserved amongst a l l RNA sequence of PDV  It  a l s o encodes a  ( C o r n e l i s s e n et al.  a GDD  viruses  relationships  1983£>,  motif which i s h i g h l y (Kamer & Argos 19 84).  RNA2, which i s c u r r e n t l y u n a v a i l a b l e ,  The  will  help to c l a r i f y the phylogeny.  4.9.0  Production I t was  RNA  and  r e p l i c a t i o n of the a r t i f i c i a l DI RNAs  not p o s s i b l e to s y n t h e s i z e  as set out  i n s e c t i o n 2.4.2  designed to i n c o r p o r a t e t r a n s c r i p t i o n was  and  the snapback-type  2.4.3.  Since there was  Even under optimal  r e q u i r e d bands was  low  and  no c h o i c e  i n the  to optimize  sequence the  PCR  c o n d i t i o n s , the y i e l d of  the  there were contaminating bands  which c o u l d not be e l i m i n a t e d . PCR  primer  the T7 promoter i n t o the template f o r  of t h i s primer, the o n l y a l t e r n a t i v e was  the two  PCR  h i g h l y prone to form secondary s t r u c t u r e s  by s e l f - a n n e a l i n g .  conditions.  The  The  subsequent l i g a t i o n of  products i n t o pUC18, to form a template f o r the  t r a n s c r i p t i o n of a snapback-type DI RNA  was  The  i t i s p o s s i b l e to  reasons f o r t h i s are not  speculate was  c l e a r , but  that the p a l i n d r o m i c  unstable  DI  and  c o u l d not be  DNA  not f e a s i b l e .  sequence i n the  plasmid  maintained.  T h i s l i g a t i o n a l s o f a i l e d when i t was  attempted w i t h Page  103  o l i g o n u c l e o t i d e c a s s e t t e s a t t a c h e d to pUC18 ( s e c t i o n s and 2.4.4) .  2.4.3  Since the l i g a t i o n s were v e r y s i m i l a r i t i s  l i k e l y t h a t they f a i l e d f o r the same reason. P r e p a r a t i o n of a d e l e t i o n - t y p e DI RNA simpler, but the DI RNA herbaceous  model system.  The Northern b l o t  proved t o be much  f a i l e d t o r e p l i c a t e in vivo  in a  The reasons f o r t h i s are not known.  (Figure 13b)  shows the absence of a band i n  the 1 kb r e g i o n and shows that l e v e l s of v i r a l genomic were not a f f e c t e d by the presence of the DI The a b i l i t y of v i r a l RNA sequence dependent. important  The  sequence at the 5'-end i s e s p e c i a l l y  The o l i g o n u c l e o t i d e c a s s e t t e at  the 5'-end of the i n s e r t i n pPDVdil was  designed t o b r i n g the  T7 promoter d i r e c t l y adjacent t o the f i r s t RNA1  (reviewed by Boyer  and the presence of any n o n - v i r a l n u c l e o t i d e s  u s u a l l y reduces i n f e c t i v i t y .  PDV  transcript.  to r e p l i c a t e in vivo i s  for infectious v i r a l transcripts  & Haenni 1994)  RNA1  5' n u c l e o t i d e of  so that there would be no n o n v i r a l n u c l e o t i d e s at  the 5'-end.  The  sequence of the template  (pPDVdil)  was  confirmed b e f o r e t r a n s c r i p t i o n t o ensure that the ends were unchanged d u r i n g the plasmid c o n s t r u c t i o n . The t r a n s c r i p t i o n of an RNA by T7 RNA  polymerase  was  molecule of the c o r r e c t  confirmed by d e n a t u r i n g agarose g e l  electrophoresis.  The presence of r e p l i c a t i n g PDV  i n the p l a n t s was  confirmed on the a u t o r a d i o g r a p h by the  presence of an RNA1  genomic  band which h y b r i d i z e d t o the probe.  s i m i l a r study w i t h BMV,  size  Marsh et al.  RNA  In a  (1991) found that the Page  104  l e n g t h o f a r t i f i c i a l BMV DI RNA d i d not g r e a t l y a f f e c t the l e v e l of i t s own r e p l i c a t i o n although they showed t h a t a s m a l l e r DI RNA reduced the s y n t h e s i s of RNA1 and RNA2 more efficiently  than a l a r g e r DI RNA.  It i s therefore u n l i k e l y  that a DI RNA from PDV o f a d i f f e r e n t s i z e  (ie. a deletion  clone of pPDVdil) would r e p l i c a t e i n pumpkins.  4.10.0 Concluding  remarks  Two r e l i a b l e assays t o detect PDV i n i n f e c t e d f r u i t t r e e s have been developed. on a monoclonal antibody  One i s a TAS-ELISA which i s based  and can d e t e c t PDV w i t h 99%  confidence  i n t r e e s which have 2/3 o r more of t h e i r  infected.  The assay i s s u i t a b l e f o r i n d e x i n g  of t r e e s and the monoclonal antibody s t r a i n s of PDV t e s t e d .  leaves  l a r g e numbers  reacts against a l l  An RT-PCR assay was a l s o developed  and  t h i s was found t o be more s e n s i t i v e than the TAS-ELISA  and  c o u l d be used f o r a longer p e r i o d d u r i n g the growing  season.  T h i s assay was more complex than the TAS-ELISA and  not as w e l l s u i t e d t o i n d e x i n g l a r g e numbers o f t r e e s . The  complete n u c l e o t i d e sequence o f PDV RNA1 was a l s o  determined.  T h i s data was used t o i n v e s t i g a t e the  phylogenetic  r e l a t i o n s h i p of PDV t o AMV and CiLRV.  I t was  shown t h a t , based on t h i s sequence, PDV i s more c l o s e l y r e l a t e d t o AMV  than t o CiLRV.  c o n s t r u c t DI RNA.  The sequence was a l s o used t o  A d e l e t i o n - t y p e DI p a r t i c l e was made but  f a i l e d t o r e p l i c a t e in vivo  u s i n g a herbaceous  host. Page 105  BIBLIOGRAPHY A l r e f a i , R.H., S h i e l , P.J., Domier, L.L., D'Arcy, C.J., Berger, P.H. & Korban, S.S. (1994). The n u c l e o t i d e sequence of apple mosaic v i r u s coat p r o t e i n gene has no s i m i l a r i t y . w i t h o t h e r Bromoviridae coat p r o t e i n genes. Journal of General Virology 75: 2847-2850 Bachman, E . J . , S c o t t , S.W., X i n , G. & Vance, V.B. (1994). The complete n u c l e o t i d e sequence of prune dwarf v i r u s RNA 3: i m p l i c a t i o n f o r coat p r o t e i n a c t i v a t i o n of genome r e p l i c a t i o n in ilarviruses. Virology 201: 127-131 Barker, R.F., J a v i s , N.P., Thompson, D.V., L o e s c h - F r i e s , L.S. & H a l l , T.C. (1983). Complete n u c l e o t i d e sequence of a l f a l f a mosaic v i r u s RNA3. Nucleic Acids Research 11: 2881-2991 Boyer, J-C. & Haenni A-L. (1994). Infectious transcripts and cDNA c l o n e s of RNA v i r u s e s . Virology 198: 415-426 Bradford, M. M. the q u a n t i t a t i o n the p r i n c i p l e of Biochemistry 72:  (1976). A r a p i d and s e n s i t i v e method f o r of microgram q u a n t i t i e s of p r o t e i n u t i l i z i n g protein-dye binding. Analytical 248-254  Brederode, F.T., Koper-Zwarthoff, E.C. & B o l , J . (1980). Complete n u c l e o t i d e sequence of a l f a l f a mosaic v i r u s RNA4. Nucleic Acids Research 8: 2213-2223 Bulger, M.A., Stace-Smith, R & M a r t i n , R.R. (1991). T r a n s m i s s i o n and f i e l d spread of r a s p b e r r y bushy dwarf v i r u s . Plant Disease 74: 514-517 Cabot, E.L. & Beckenbach, A.T. (1989). Simultaneous e d i t i n g of m u l t i p l e n u c l e i c a c i d and p r o t e i n sequences w i t h ESEE. Cabios 5: 233-234 Candresse, alignment sequences viruses.  T., Morch, M.D. & Dunez, J . (1990). Multiple and h i e r a r c h i c a l c l u s t e r i n g of conserved amino a c i d i n the r e p l i c a t i o n - a s s o c i a t e d p r o t e i n s o f p l a n t RNA Research in Virology 141: 315-329  Casper, R. (1977). Testung von Prunus avium-Samen auf prune dwarf v i r u s mit dem ELISA V e r f a h r e n . Phytopathologische Zeitschrift 90: 91-94 Chen, K. H., Guo, J.R., Wu, X. Y., L o i , N., C a r r a r o , L., Guo, Y.H., Chen, Y.D., O s i e r , R., Pearson, R. & Chen, T.A. (1993). Comparison of monoclonal a n t i b o d i e s , DNA probes and PCR f o r d e t e c t i o n of the grapevine y e l l o w d i s e a s e agent. Phytopathology 83: 915-922. Page 10 6  C l a r k e , M.F. & Adams, A. N. (1977). C h a r a c t e r i s t i c s of the m i c r o p l a t e method of enzyme-linked immunosorbent assay f o r the d e t e c t i o n of p l a n t v i r u s e s . Journal of General Virology 34: 475-483 C o f f i n , R.S. & Coutts, R.H.A. (1992). DsRNA c l o n i n g and d i a g n o s i s of beet pseudo-yellows v i r u s by PCR and n u c l e i c acid hybridization. Intervirology 23: 197-203 C o r n e l i s s e n , B.J.C., Brederode, F.T., Moorman, R.J.M. & B o l , J.F. (1983a). Complete n u c l e o t i d e sequence of a l f a l f a mosaic v i r u s RNA1. Nucleic Acids Research 11: 1253-1265 C o r n e l i s s e n , B.J.C., Brederode, F.T., Veeneman, G.H., van Boom, J.H. & B o l , J.F. (1983JO) . Complete n u c l e o t i d e sequence of a l f a l f a mosaic v i r u s RNA2. Nucleic Acids Research 12: 2427-2437 C o r n e l i s s e n , B.J.C., Janssen, H., Zuidema, D. & B o l , J.F. (1984) . Complete n u c l e o t i d e sequence of tobacco s t r e a k v i r u s RNA3. Nucleic Acids Research 12: 2427-2437 C r o s s l i n , J.M., Hammond, R.W. & Hammerschlag, F.A. (1992). D e t e c t i o n of Prunus n e c r o t i c r i n g s p o t v i r u s s e r o t y p e s i n herbaceous and prunus hosts w i t h a complementary RNA probe. Plant Disease 76: 1132-1136 Davidson, T. R. & George, J.A. (1965). E f f e c t s of n e c r o t i c r i n g s p o t and sour c h e r r y y e l l o w s on the growth and y i e l d of young sour c h e r r y t r e e s . Canadian Journal of Plant Science 45: 525-535 Devereux, J . , H a e b e r l i , P. & Smithies, 0. (1984). A comprehensive set of sequence a n a l y s i s programs f o r the Nucleic Acids Research 12: 387-395  VAX.  D i g i a r o , M., Savino, V. & D i - T e r l i z z i , B. (1992). Ilarv i r u s e s i n a p r i c o t and plum p o l l e n . Acta Horticulturae, Wageningen, I n t e r n a t i o n a l S o c i e t y f o r H o r t i c u l t u r a l Science, pp 93-98 Ding, S.W., Anderson, B.J., Haase, H.R. & Symons, R.H. (1994) New o v e r l a p p i n g gene encoded by the cucumber mosaic v i r u s genome. Virology 198: 593-601 Di T e r l i z z i , B., Skrzeczkowski, L . J . and Mink, G.I. (1992). A d d i t i o n a l subgenomic RNA of Prunus n e c r o t i c r i n g s p o t v i r u s . Phytopathology 82: 1104 Dougherty, W.G. & H i e b e r t , E. (1985). Genome s t r u c t u r e s and gene e x p r e s s i o n of p l a n t RNA v i r u s e s . In Davies, J.W. (ed) P l a n t m o l e c u l a r b i o l o g y . v o l . 2. CRC Press, FLA, pp. 23-81 Page 10 7  Dreher, T.W. & H a l l , T.C. (1988), M u t a t i o n a l a n a l y s i s of the tRNA mimicry of brome mosaic v i r u s RNA. Sequence and s t r u c t u r a l requirements a m i n o a c y l a t i o n and 3 ' - a d e n y l a t i o n . Journal of Molecular Biology 201: 41-55 F e l s e n s t e i n , J . (1989). ( v e r s i o n 3.4) Cladistics  PHYLIP - phylogeny i n f e r e n c e package 5: 164-166  Finnen, R. L. & Rochon, D. M. (1993). Sequence and s t r u c t u r e of d e f e c t i v e i n t e r f e r i n g RNAs a s s o c i a t e d w i t h cucumber n e c r o s i s v i r u s i n f e c t i o n s . Journal of General Virology 74: 1715-1720 F u l t o n , R.W. (1959) . prune dwarf v i r u s e s .  P u r i f i c a t i o n of sour c h e r r y y e l l o w s and Virology 9: 522-35  Ge, X. & S c o t t , S.W. (1994). The n u c l e o t i d e sequence of c i t r u s l e a f rugose i l a r v i r u s RNA-2. Journal of General Virology 75: 2841-2846 Gilmer, R.M., Moore, J.D., Nyland, G., Welsh, M.F. & Pine T.S. (1975). V i r u s d i s e a s e s and n o n i n f e c t i o s d i s o r d e r s of stone f r u i t s i n North America. USDA Handbook #437, Washington D.C. pp 179-190 G r i e c o , F., M a r t e l l i , G.D. & Savino, V. (1990). The n u c l e o t i d e sequence of RNA3 and RNA4 of o l i v e l a t e n t v i r u s 2. Journal of General Virology 76: 929-937 Greber, R. S., Klose, M.J., Teakle, D.S. & M i l n e , J.R. (1991). High i n c i d e n c e of TSV i n tobacco and i t s t r a n s m i s s i o n by Microcephalothrips abdominalis and p o l l e n from Ageratum houstonianum. Plant Disease 75: 450-452 Greber, R.S., Teakle, D.S. & Mink, G.I. (1992). T h r i p s - f a c i l i t a t e d t r a n s m i s s i o n of prune dwarf and Prunus n e c r o t i c r i n g s p o t v i r u s e s from c h e r r y p o l l e n t o cucumber. Plant Disease 76: 1039-1041 Guo, D., Maiss, E., Adam, G. & Casper, R. (1995). Prunus n e c r o t i c r i n g s p o t i l a r v i r u s : n u c l e o t i d e sequence of RNA3 and the r e l a t i o n s h i p t o o t h e r i l a r v i r u s e s based on coat p r o t e i n comparison. Journal of General Virology 76: 1073-1079 H a l l , T . C , Shih, D.S. & Kaesberg, P. (1972). Enzyme mediated b i n d i n g of t y r o s i n e t o brome mosaic v i r u s ribonucleic acid. Biochemical Journal 129: 696-698 Halk, E. & F u l t o n , R.W. (1978) . morphology of prune dwarf v i r u s .  S t a b i l i z a t i o n and p a r t i c l e Virology 91:434-443  Page 108  Hammond, R.W & C r o s s l i n , J.M. (1995). The complete n u c l e o t i d e sequence of RNA 3 of a peach i s o l a t e o f Prunus necrotic ringspot v i r u s . Virology 208: 349-353 Harlow, E. & Lane, D. (1988) . A n t i b o d i e s : a laboratorymanual. New York: Cold S p r i n g Harbor P u b l i s h i n g Hehn, A., Bouzoubaa, S., Jonard, G., G u i l l e y , H. & Richards, K.E. (1994). A r t i f i c i a l d e f e c t i v e i n t e r f e r i n g RNAs d e r i v e d from RNA2 o f beet n e c r o t i c y e l l o w v e i n v i r u s . Archives of Virology 135: 143-151 Hillman, B. I., C a r r i n g t o n , J.C. & M o r r i s , T . J . (1987). A DI RNA t h a t c o n t a i n s a mosaic of a p l a n t v i r u s genome. Cell 51: 427-433 Hirzmann, J . , Luo, D., Hahnen, J . & Hobom, G. (1993). Determination of messenger RNA 5' ends by r e v e r s e t r a n s c r i p t i o n of the cap s t r u c t u r e . Analytical Biochemistry 21: 3597-3598 Houser-Scott, F., Baer, M.L., Liem., K.F., C a i , J-M. & Gehrke. (1994). N u c l e o t i d e sequence and s t r u c t u r a l determinants of s p e c i f i c b i n d i n g of coat p r o t e i n of coat p r o t e i n p e p t i d e s t o the 3' u n t r a n s l a t e d r e g i o n o f a l f a l f a mosaic v i r u s RNA4. Journal of Virology 68: 2194-2205 Houwing C.J. & Jaspars E.J.M. (1982). P r o t e i n b i n d i n g i n n u c l e a t i o n complexes of a l f a l f a mosaic v i r u s RNA4. Biochemistry 21:3408-3414  sites  H u l l , R. & Davies, J.W. (1991) Nonconventional c o n t r o l of plant v i r u s diseases. Critical Reviews in Plant Science 11: 17-33 Huisman, M.J., Sarachu, A.N., A l b l a s , F., Broxterman, H.G.J., van V l o t e n - D o t i n g , L. & B o l , J . (1986). A l f a l f a mosaic temperature s e n s i t i v e mutants. I I I . Mutants with a p u t a t i v e defect i n c e l l - t o - c e l l transport. Virology 154: 401-404 Kamer, G. & Argos, P. (1984). Primary s t r u c t u r a l comparison of RNA dependent RNA polymerases from p l a n t , animal and b a c t e r i a l v i r u s e s . Nucleic Acids Research 12: 7269-7282 K i b e r s t i s , P.A., L o e s c h - F r i e s , L.S. & H a l l , T.C. (1981). V i r a l p r o t e i n s y n t h e s i s i n b a r l e y p r o t o p l a s t s i n o c u l a t e d with n a t i v e and f r a c t i o n a t e d brome mosaic v i r u s RNA. Virology 112: 804-808 K o l l a r , A., Dalmay, T. & Brgyan, J . (1993). Defective i n t e r f e r i n g RNA mediated r e s i s t a n c e a g a i n s t cymbidium r i n g s p o t v i r u s i n t r a n s g e n i c p l a n t s . Virology 193: 313-318 Page 10 9  Korschineck, I., Himmler, G., Sagl, R., S t e i n k e l l e r , H. & K a t i n g e r , H.W.D. (1991). A PCR membrane spot assay f o r the d e t e c t i o n of plum pox v i r u s RNA i n bark of i n f e c t e d t r e e s . Journal of Virological Methods 31: 139-146 Koper-Zwarthoff, E.C. & B o l , J.F. (1980). N u c l e o t i d e sequence of the p u t a t i v e r e c o g n i t i o n s i t e f o r coat p r o t e i n i n the RNAs of a l f a l f a mosaic v i r u s and tobacco s t r e a k v i r u s . Nucleic Acids Research 8: 3307-3318 K r y c z y n s k i , S., Szyndel, M.S., Stawiszynska, A. & Piskorek, W. (1992) The r a t e and way of Prunus n e c r o t i c r i n g s p o t v i r u s spread i n sour c h e r r y o r c h a r d and i n the r o o t s t o c k p r o d u c t i o n . A c t a Horticulturae, Wageningen, I n t e r n a t i o n a l S o c i e t y f o r H o r t i c u l t u r a l Science, pp 105-110 Laemmli, U.K. (1970). Cleavage of s t r u c t u r a l p r o t e i n s d u r i n g the assembly of the head of bacteriophage T4. Nature 227: 680-687 L a z z a r i n i , R.A., Keene, J.D. & Schubert, M. (1981). The o r i g i n s of d e f e c t i v e i n t e r f e r i n g p a r t i c l e s of the n e g a t i v e stranded RNA v i r u s e s . Cell 26: 145-150 Marsh, L.E., Pogue, G.P., C o n n e l l , J.P. & H a l l , T.C. (1991). A r t i f i c i a l d e f e c t i v e i n t e r f e r i n g RNAs d e r i v e d from brome mosaic v i r u s . Journal of General Virology 72: 1787-1792 Matthew, W.D. & Sandrock, A.W. (1987). Cyclophosphamide treatment used to manipulate the immune response f o r the p r o d u c t i o n of monoclonal a n t i b o d i e s . Journal of Immunological Methods 100: 73-82 Maxwell, A.E. (1961). York: John Wiley & Co.  A n a l y s i n g q u a l i t a t i v e data.  New  McMorran, J.P. & Cameron, H.R. (1983). D e t e c t i o n of 41 i s o l a t e s of n e c r o t i c r i n g s p o t , apple mosaic and prune dwarf v i r u s e s i n Prunus and Malus by enzyme-linked immuno-sorbent assays. Plant Disease 67: 536-568 M e r r i l , C.R. Deutscher, M. 488  (1990). Gel s t a i n i n g techniques. In P., Ed. Methods in Enzymology, V o l 182  pp  477-  Mink, G.I. (1984). Use of enzyme-linked immunosorbent assay r e s u l t s i n e f f o r t s to c o n t r o l o r c h a r d spread of Cherry rugose mosaic d i s e a s e i n Washington. Plant Disease 68: 207-210 Mink, G.I. and Jones, A.L. (1991). Cherry d i s e a s e s : t h e i r p r e v e n t i o n and c o n t r o l . In Webster, A.D. and Looney, N.E. (eds) C h e r r i e s : crop p h y s i o l o g y , p r o d u c t i o n and uses. CAB Page 110  I n t e r n a t i o n a l U n i v e r s i t y Press, Cambridge,  pp 347-366  Nassuth, A., A l b l a s , F. & B o l , J . . F. (1981). Localization of g e n e t i c i n f o r m a t i o n i n v o l v e d i n the r e p l i c a t i o n of a l f a l f a mosaic v i r u s . Journal of General Virology 53: 207-214 Nemeth, M. (1986). V i r u s , mycoplasma and r i c k e t t s i a d i s e a s e s of f r u i t t r e e s . Budapest, Akademiai Kiado. P e r r e t , V., F l o r e n t z , C , Dreher, T. & Giege, R. (1989). S t r u c t u r a l a n a l o g i e s between the 3' tRNA-like s t r u c t u r e of brome mosaic v i r u s RNA and yeast tRNA r e v e a l e d by p r o t e c t i o n s t u d i e s w i t h yeast t y r o s y l - t R N A s y n t h e t a s e . European Journal of Biochemistry 185: 331-339 TYR  Reusken C.B., Neeleman L. & B o l J.F. (1994). The 3' u n t r a n s l a t e d r e g i o n of a l f a l f a mosaic v i r u s RNA3 c o n t a i n s two independent b i n d i n g s i t e s f o r v i r a l coat p r o t e i n . Nucleic Acids Research 22: 1346-1353 Reusken, C.B.E.M., Neeleman, L. & B o l , J.F. (1995). Ability of tobacco s t r e a k v i r u s coat p r o t e i n to s u b s t i t u t e f o r l a t e f u n c t i o n s of a l f a l f a mosaic v i r u s coat p r o t e i n . Journal of Virology 69: 4552-4555 Romero, J . , Huang. Q., Pogany, J . & B u j a r s l i , J . J . (1993). C h a r a c t e r i z a t i o n of d e f e c t i v e i n t e r f e r i n g RNA components that i n c r e a s e symptom s e v e r i t y of broad bean mottle v i r u s infections. Virology 194: 576-584 Rowhani, A., Chay, C , G o l i n o , D.A. & Falk, B.W. (1993). Development of a polymerase c h a i n r e a c t i o n technique f o r the d e t e c t i o n of grapevine f a n l e a f v i r u s i n grapevine t i s s u e . Phytopathology 87: 74 9-753 R y b i c k i E.P. (1995) . Bromoviridae. In: Murhpy F.A., Fauquet CM., Bishop D.H.L., G h a b r i a l S.A., J a r v i s A.W., Martelli G.P., Mayo M.A. & Summers M.D. (eds) V i r u s Taxonomy. Sixth r e p o r t of the i n t e r n a t i o n a l committee on taxonomy of v i r u s e s . S p r i n g e r V e r l a g , Vienna, pp 450-457 Sambrook, J . , F r i t s c h , E.F. & M a n i a t i s , T. (1989). M o l e c u l a r c l o n i n g : a l a b o r a t o r y manual. C o l d S p r i n g Harbour L a b o r a t o r y Press Sanchez-Navarro, J.A. & P a l l a s , V. (1994) N u c l e o t i d e sequence of apple mosaic i l a r v i r u s RNA 4. Journal of General Virology 75: 1441-1445 Sanger, F., N i c k l e n , S. & Coulson, A.R. (1977). DNA sequencing w i t h c h a i n t e r m i n a t i n g i n h i b i t o r s . Proceedings the National Academy of Science USA. 74: 563-568  of  Page 111  S c h l e s i n g e r , S. (1988). The g e n e r a t i o n a n d a m p l i f i c a t i o n o f d e f e c t i v e i n t e r f e r i n g RNAs. I n Domingo, E., H o l l a n d , J . J . a n d A h l q u i s t , E d s . RNA g e n e t i c s , V o l I I p p l 6 7 - 1 8 6 . CRC P r e s s , FL. S c o t t , S.W. & Ge, X. ( 1 9 9 5 a ) . The c o m p l e t e n u c l e o t i d e s e q u e n c e o f t h e RNA 3 o f l i l a c r i n g m o t t l e i l a r v i r u s . Journal of General Virology 76: 1801-1806 S c o t t , S.W. & Ge, X. (1995Jb) . The c o m p l e t e n u c l e o t i d e s e q u e n c e o f RNA 3 o f c i t r u s l e a f r u g o s e a n d c i t r u s variegation ilarviruses. Journal of General Virology 76: 957-963 S c o t t , S.W. & Ge, X. ( 1 9 9 5 c ) . The n u c l e o t i d e s e q u e n c e o f c i t r u s l e a f r u g o s e v i r u s RNA1. Journal of General Virology 76: 3233-3238 Sdoode, R. & T e a k l e , D.S. (1993). S t u d i e s on t h e mechanism of t r a n s m i s s i o n of p o l l e n - a s s o c i a t e d tobacco s t r e a k i l a r v i r u s b y Thrips tabaci. Plant pathology 42: 88-92 S u t u l a , C.L., G i l l e t , J . M., M o r r i s s e y , S.M. & R a m s d e l l , (1986). I n t e r p r e t i n g ELISA d a t a and e s t a b l i s h i n g t h e positive-negative threshold. Plant Disease 70: 722-726  D.C.  T o r r a n c e , L. & D o l b y , C.A. (1984). Sampling c o n d i t i o n s f o r r e l i a b l e r o u t i n e d e t e c t i o n by e n z y m e - l i n k e d immunosorbent assay of three i l a r v i r u s e s i n f r u i t trees. Annals of Applied Biology 104: 267-276 Uyemoto, J.K., L u h n , C.F., A s a i , W., B e e d e , R., B e u t e l , J.A. & F e n t o n , R. (1989). I n c i d e n c e o f i l a r v i r u s e s i n young peach t r e e s i n C a l i f o r n i a . Plant Disease 73: 217-220 Uyemoto, J.K., A s a i , W.K. & L u h n , C F . (1992). Ilarviruses: e v i d e n c e f o r r a p i d s p r e a d a n d e f f e c t s on v e g e t a t i v e g r o w t h and f r u i t y i e l d s o f p e a c h t r e e s . Plant Disease 76: 71-74 Van R e g e n m o r t e l , M. H. V. (1982). S e r o l o g y and immunochemistry of p l a n t v i r u s e s . A c a d e m i c P r e s s , New V a n T o l , R.G.L. a n d v a n V l o t e n - D o t i n g , L. (1979). T r a n s l a t i o n o f a l f a l f a m o s a i c v i r u s RNA1 i n t h e mRNA dependent t r a n s l a t i o n system form r a b b i t r e t i c u l o c y t e European Journal of Biochemistry 93: 461-468  York.  lysate.  W e t z e l , T., C a n d r e s s e , T., R a v e l o n a n d r o , M. & Dunez, J . (1991). A polymerase c h a i n r e a c t i o n assay adapted t o plum pox p o t y v i r u s d e t e c t i o n . Journal of Virological Methods 33: 355-365 Page 112  Z i e g l e r , A., Natsuaki, T., Mayo, M.A. , J o l l y , C A . & Murant, A.F. (1992) . The n u c l e o t i d e sequence of RNA-1 of r a s p b e r r y bushy dwarf v i r u s . Journal of General Virology 73: 3213-3218  Page 113  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0087819/manifest

Comment

Related Items