UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Sodium-divalent cation exchange in erythroleukemia cells Auger, Véronique 1997

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1997-0164.pdf [ 3.42MB ]
Metadata
JSON: 831-1.0087717.json
JSON-LD: 831-1.0087717-ld.json
RDF/XML (Pretty): 831-1.0087717-rdf.xml
RDF/JSON: 831-1.0087717-rdf.json
Turtle: 831-1.0087717-turtle.txt
N-Triples: 831-1.0087717-rdf-ntriples.txt
Original Record: 831-1.0087717-source.json
Full Text
831-1.0087717-fulltext.txt
Citation
831-1.0087717.ris

Full Text

SODIUM-DIVALENT CATION E X C H A N G E IN E R Y T H R O L E U K E M I A C E L L S by VERONIQUE AUGER B.Sc, McGill University, 1995  A THESIS SUBMITTED IN PARTIAL F U L F I L L M E N T OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in THE F A C U L T Y OF GRADUATE STUDIES (Department of Medicine)  We accept this thesis as conforming to the required standard  THE UNIVERSITY OF BRITISH C O L U M B I A March 1997 © Veronique Auger, 1997  In presenting this thesis in partial fulfilment  of the requirements for an advanced  degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study. I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department  or  by his or  her  representatives.  It  is understood that  copying or  publication of this thesis for financial gain shall not be allowed without my written permission.  Department of  H 6HDIGI KJtf"  The University of British Columbia Vancouver, Canada  Date  DE-6 (2/88)  Q p R I L 2-1  J  )W  ABSTRACT Magnesium and calcium are required for many cell functions. Accordingly, it is important that their intracellular levels be closely regulated for normal metabolism. Our understanding of the cellular control of these two cations is not completely clear. In this study we examined two separate transport systems, N a 7 M g  2+  exchange and Na7Ca  2+  exchange, in three erythroleukemia cell lines.  Intracellular free magnesium, [Mg ] is in the order of 0.50 mM, allowing for M g 2+  2 +  i5  passively down an electrochemical gradient. M g  2 +  to enter cells  exit from the cell, however, must be active and  is thought to be mediated by a sodium-dependent mechanism. We developed an expression system to test this notion. Since most studies regarding N a / M g +  blood cells, where M g  2 +  exchange have been performed in red  2+  affects volume regulatory processes, we used mRNA isolated from  erythroleukemia cells for these expression studies. Poly (A) R N A was microinjected into Xenopus +  laevis oocytes and incubated for 36-48 hours prior to assaying transport. N a 7 M g  2+  exchange was  determined either by quantitation of radioisotopic N a or by atomic absorption measurement of 22  magnesium to assess influx and efflux, respectively. The observed transport was dependent on the amount of mRNA injected, with 50 ng resulting in maximal N a influx. Magnesium efflux was 22  dependent on the concentration gradient for magnesium across the oocyte membrane. Sodiumdependence of magnesium efflux was demonstrated by inhibition with amiloride and quinidine. These studies indicate that genetically encoded Na -dependent M g +  2 +  transport can be expressed in  Xenopus oocytes. This approach may be employed to expression clone the cDNA coding the Na /Mg +  2+  exchanger protein.  The Na7Ca exchanger plays an important role in maintaining cytosolic C a concentration. 2+  2+  Reports are inconclusive as to whether erythrocytes express a Na7Ca ii  2+  exchanger. The human (K-  562 and HEL) and mouse (GM979) erythroleukemia cell lines have been extensively used as model systems for studying intracellular C a  2+  involvement in cellular proliferation and differentiation. The  present studies were designed to provide molecular evidence for the presence of Na7Ca  2+  exchanger  in these cells and to identify the molecular isoforms expressed. The cDNA coding the Na7Ca  2+  exchanger contains an alternatively spliced site which determines, in part, tissue specific expression. The cDNA encodes seven different alternatively spliced isoforms containing combinations of exons A-F.  Oligonucleotide primers were designed from conserved regions flanking the alternatively  spliced region of the Na7Ca  exchanger. Homology based RT-PCR was then performed with  2+  mRNA from the three erythroleukemia cell lines. Cloning and sequencing of RT-PCR products from all three cell lines demonstrated the presence of a ~ 280 bp cDNA which represented the NACA3 isoform of the Na7Ca exchanger, consisting of exons B and D. The B and D exons in K2+  562 and H E L cells were identical with those of the human B and D exons whereas the expressed exons identified in GM979 mouse cells shared 98% nucleotide and 95% amino acid sequence identity with the B and D exons of rat kidney cDNA. These results demonstrate the presence of Na7Ca  2+  exchanger transcripts in human and mouse erythroleukemia cell lines and show that the  alternatively spliced isoform expressed in these cells consists of exons B and D. The role of these exchangers in diseases such a sickle cell disease and abnormal erythroid differentiation is unknown but would be better understood by identifying the protein(s) involved with transport.  iii  T A B L E OF CONTENTS  ABSTRACT  ii  T A B L E OF CONTENTS  iv  LIST OF FIGURES  vii  K E Y WORDS AND ABBREVIATIONS  viii  ACKNOWLEDGEMENTS  ix  Chapter One  Introduction  1.1  Renal Handling of Magnesium and Calcium  2  1.2  Magnesium Transport  5  1.3  Na7Mg  5  1.4  Properties of a Putative Na7Mg  1.5  2+  Exchange in Erythrocytes 2+  Exchange  7  1.4.1  Cation Specificity  7  1.4.2  Inhibitors  9  1.4.3  A T P Dependence  10  1.4.4  Reversibility  12  1.4.5  Stoichiometry  13  1.4.6  Objectives and Approach  14  1.4.7  Rationale  15  Na7Ca  2+  Exchange  16  1.5.1  Na7Ca  1.5.2  Molecular Cloning of the Na7Ca  2+  Exchanger in Erythroid Cells 2+  iv  Exchanger  16 17  1.5.3  Cation Specificity and Inhibitors  20  1.5.4  ATP Dependence  21  1.5.5  Reversibilty and Stoichiometry  22  1.5.6  Objectives and Approach  23  1.5.7  Rationale  23  Chapter Two  Materials and Methods  2.1  R N A Isolation  2.2  Expression of Na /Mg Exchange  25  2.2.1  Isolation of oocytes  25  2.2.2  Oocyte injection  26  2.2.3  Determination of N a 7 M g  2.2.4  Inihibition of Transport  2.3  2.4  25 +  2+  2+  Exchange  26 27  Molecular studies of the Putative N a 7 M g  2+  Exchanger  27  2.3.1  Design of PCR Primers  27  2.3.2  Homology based RT-PCR  28  2.3.3  Southern Analysis  28  2.3.4  Cloning and Sequencing of PCR Products  29  2.3.5  Screening of cDNA Libraries  30  Na7Ca  2+  Exchange  30  2.4.1  Design of PCR Primers  30  2.4.2  RT-PCR Amplification  30  2.4.3  Southern Analysis  31 v  2.4.4  Cloning and Sequencing of PCR Products  Chapter Three 3.1  31  Results  Na7Mg Exchange  32  3.1.1  R B C mRNA Expression  32  3.1.2  Effect of Intraoocyte Magnesium  35  3.1.3  Sodium Dependence of the Exchanger  35  3.1.4  Stoichiometry  37  3.2  Na7Ca  2+  3.3  Na7Ca Exchange  2+  Exchange and A B C Homology Based Studies of N a 7 M g  2+  Exchanger  40  2+  3.3.1  Analysis of Na7Ca  Chapter Four  2+  Exchanger Isoforms in Erythroleukemia Cells  40  Discussion  4.1  Na7Mg  4.2  Na7Ca  Chapter Five  37  2+  2+  Exchange  46  Exchange  49  Summary and Conclusions  References  52 53  vi  LIST O F F I G U R E S Fig. 1  Schematic representation of a nephron and the proportions of magnesium and calcium reabsorption in each segment  Fig. 2  3  Model of magnesium and calcium transport in polarized cells of the distal tubule  4  Fig. 3  A model of the Na7Ca  exchanger  Fig. 4  Schematic representation of the Na7Ca  2+  18 exchanger gene and the alternatively  2+  spliced isoforms  19  Fig. 5  mRNA dependence of Mg efflux  33  Fig. 6  mRNA concentration-dependence of M g  Fig. 7  Effect of the membrane concentration gradient for M g  Fig. 8  Sodium-dependence of the N a 7 M g  Fig. 9  Stoichiometry of the N a / M g  Fig. 10  RT-PCR amplification of the alternatively spliced region of K-562, H E L ,  2+  +  2+  2+  2 +  dependent N a influx +  2 +  on ion transport  exchanger  exchanger  and GM979 mRNA  34 36 38 39  42  Fig. 11  Southern blot analysis of RT-PCR products from K-562, H E L , and GM979 mRNA 43  Fig. 12  Nucleotide sequence comparison of the N A C A 3 isoform cloned from H E L , K-562, and GM979 cells  44  vii  Key words:  Xenopus laevis oocytes, expression, transport, N a 7 M g  2+  exchange, Na7Ca exchange, 2+  Southern hybridization, poly (A) RNA, cDNA sequence, alternative splicing, murine +  erythroleukemia (GM979) cells, human leukemia (K-562) cells, human erythroleukemia (HEL) cells, calcium, magnesium, atomic absorption  Abbreviations:  HEL  human erythroleukemia  GM979  mouse erythroleukemia  K-562  human leukemia  RT  reverse transcriptase  PCR  polymerase chain reaction  bp  base pair  [Mg ]i  intracellular ionized magnesium  [Ca*Ji  intracellular ionized calcium  2+  [Mg ]  extracellular ionized magnesium  2+  [Ca ]  0  extracellular ionized calcium  2+  0  RBC  red blood cell  Na7Mg Na7Ca  2+  2+  exchanger exchanger  sodium-magnesium exchanger sodium-calcium exchanger  SCD  sickle cell disease  cTAL  cortical thick ascending limb  CHO  Chinese hamster ovary  viii  ACKNOWLEDGEMENTS I would like to thank my supervisor Dr. Gary A. Quamme for his guidance, time, and support these past two years. I am also grateful to Gordon Ritchie, Brian Bapty, Long-Jun Dai, and Don Huysmans for their helpful discussions and technical assistance.  ix  Chapter One  Introduction  Magnesium and calcium play essential roles within the cell and influence many biological and physiological functions within the body. Intracellular M g  2+  is required for numerous metabolic  functions such as activation of enzymes, especially those involved in phosphorylation and dephosphorylation reactions (e.g. ATPases, phosphatases, and kinases), stabilization of negatively charged substances like D N A or RNA, and protein synthesis (reviewed in 9,35). Furthermore, this divalent cation has been shown to regulate the activity of the Na/K/Cl (37) and K / C l (28,72) cotransport systems which are involved in cell volume regulation, as well as influence flux through Ca , K , CI", and Na channels (66). Likewise, intracellular C a 2+  +  +  2+  also plays an important role in cell  function by acting as an intracellular messenger, affecting many downstream enzymatic processes such as activation of kinases, and controlling channel activity (89,94). Finally, intracellular C a  2+  plays an essential role in erythroid cell proliferation and differentiation (44,59,74,81). The diverse functions of magnesium and calcium are mediated, in part, via changes in the intracellular ionized concentrations of magnesium ([Mg ]j) and calcium ([Ca ]i) which are normally 2+  2+  closely regulated within narrow limits. This regulation is dependent upon 1) the presence of molecules which bind magnesium and calcium in the cytoplasm e.g. Mg-ATP, 2) the movement of magnesium and calcium into and out of intracellular stores, and 3) the transport of these cations across the plasma membrane (9). Specialized transport systems must exist that are sensitive enough to maintain M g  2+  and C a  2+  homeostasis in the cell. These include putative Na7Mg  2+  Na7Ca exchange (11), and Ca -ATPase (17). A Mg -ATPase involved with M g 2+  2+  2+  not yet been demonstrated (31).  1  exchange (54), 2+  transport has  1.1  Renal Handling of Magnesium and Calcium The kidney is the major regulator of both magnesium and calcium homeostasis as it is  responsible for reabsorption and excretion of filtered ions. In the proximal tubule, 20-25% of filtered magnesium is reabsorbed (Fig. 1). This compares with 65% of filtered calcium reabsorbed in the same segment. About 65% of filtered magnesium is reabsorbed (about twice that of calcium) within the thick ascending limb of the loop of Henle. This occurs passively through the paracellular pathway which is dependent on transepithelial voltage. The high degree of reabsorption in this segment reflects, in part, the increased delivery of magnesium to this segment compared with calcium. About 10% of filtered magnesium and calcium is reabsorbed within the distal tubule leaving approximately 1-3% that is excreted into the urine. Magnesium and calcium absorption within the distal tubule is thought to be active and transcellular in nature (29,98). Calcium entry into polarized cells, such as epithelial cells composing the distal tubule, is passive and might be mediated by selective channels which move C a  2+  down a transmembrane  electric gradient (Fig. 2) (98). A similar scenario is postulated for magnesium transport (23,92). [Mg ]j and [Ca ] are about 0.5 mM and 100 nM, respectively, whereas the external concentrations 2+  2+  i5  are in the order of 0.75 and 2.0 m M , respectively (52).  In addition to the existing chemical  difference, the resting cell membrane voltage of -70 mV constitutes a large driving force for divalent cation entry.  If M g  2+  or C a  2+  were allowed to distribute themselves at equilibrium with the  membrane voltage, the intracellular concentration of M g  2+  would be -200 m M with an extracellular  concentration of 0.75 m M and that of calcium would be -500 m M intracellularly and 2.0 m M extracellularly (2,9,114). Values are much lower than would be expected from a passive distribution of M g  2+  or C a  2+  across the cell membrane. Accordingly, specific cellular mechanisms must exist to 2  10" mM 4  1 Ca 2+  a  -o  3 Na  10 mM -30 mV  -70 mV  -70 m V  2.0 mM +  145 mM 0  Fig. 2 Model of magnesium and calcium transport in polarized cells of the distal tubule. Both magnesium and calcium enter the cell through selective channels down an electrochemical gradient. They are then transported to the blood by basolaterally located exchangers. For calcium, a -ATPase exists or electrogenic transport can take place via exchange of 3Na for l C a . The putative Na7Mg exchanger for magnesium transport is electroneutral, transporting two Na for every M g transported out of the cell. Similar scenarios would be expected in non-polarized cells such as cardiomyocytes, smooth muscle cells, neurons, or red blood cells. +  2+  2+  +  4  2+  actively remove M g  2 +  and C a  2+  from the cell. The presence of a sodium-magnesium (Na7Mg )  exchanger has been postulated (54).  2+  A sodium-calcium (Na7Ca  basolateral membrane of epithelial cells transports C a  2+  2+)  exchanger located on the  against its electrochemical gradient (98).  In human and ferret erythrocytes, the membrane potential is approximately -10 mV (39,99), suggesting the electrochemical gradient for magnesium is slightly inward. Therefore, similar systems would be expected in nonpolarized cells such as cardiomyocytes, smooth muscle cells, neurons, or erythrocytes.  1.2  Magnesium Transport Magnesium transport processes have not been well defined due to the unavailability of M g , 28  the only radioactive isotope of magnesium.  Sodium-dependent magnesium transport was first  described in squid axon by Baker and Crawford (7) and, subsequently, by DeWeer (30). Employing radioisotopic M g , when it was available, they detected a transport system in squid axon which 28  catalyzed M g efflux in the presence of cytosolic ATP and external Na . The putative N a / M g 28  +  +  2+  exchanger was later reported in chicken erythrocytes by Gunther et al. (54) and in human red blood cells (RBC) by Feray and Garay (32). These groups employed atomic absorption to measure M g  2+  fluxes. Although many reports have implied the presence of sodium-dependent magnesium transport processes, none to date have provided molecular evidence for a N a 7 M g  1.3  Na /Mg +  2+  2+  exchanger.  Exchange in Erythrocytes  The most studied and apparently most active Na7Mg  2+  exchanger is present in RBCs (36,50),  where it has been detected in many species: birds (46,49,54), rats (33,55), ferrets (38,39), ground 5  squirrels (110), hamsters (110,111), and humans (32,40,78). Regulation of intracellular M g erythrocytes is important, as cytosolic M g  2+  2+  in  affects volume regulatory processes in these cells by  controlling the swelling- and shrinkage-activated cotransporters, K / C l and Na/K/Cl, respectively. Modulation of cell volume by [Mg ]j has been reported in many red cells including those of ferrets 2+  (37), ducks (105), and dogs (91). Increases in [Mg ]j inhibit K / C l cotransport in sheep (28), human 2+  (15), duck (105), dog (91), and rabbit (64) erythrocytes, whereas decreases in [Mg ]j activates K / C l 2+  efflux (28,72). Accordingly, high levels of free cytosolic M g  2+  will activate red cell Na/K/Cl  cotransport. It would therefore be favourable for RBCs to posses an efficient means of tightly regulating [Mg ];. Abnormal control of [Mg ]j may lead to aberrant modulation of R B C volume 2+  2+  and contribute to pathological disorders such as sickle cell disease (SCD) (27). [Mg ]j changes may directly or indirectly affect ionic K / C l and Na/K/Cl cotransport. 2+  Cellular M g  2 +  concentrations affect K -channels, which may in turn be relevant in the modulation +  of volume activated K / C l and Na/K/Cl cotransport.  Magnesium modulation of the K / C l and  Na/K/Cl cotransporters might also be explained in terms of an equilibrium between phosphokinases and phosphatase reactions (63). This would be in keeping with the catalytic role of magnesium in many kinase reactions and some phosphatase reactions. During high [Mg ] phosphorylation may 2+  i5  activate Na/K/Cl cotransport and inhibit K / C l flux. Similarly, the stimulation of K / C l cotransport with M g  2+  depletion might involve an active unphosphorylated state. Further evidence to support  this notion is that phosphatase inhibitors have an inhibitory effect on K / C l cotransport (63). Consonant with these observations, magnesium inhibited K / C l flux by 70% in low-K sheep red blood cells in the presence of A T P and not in ATP-depleted cells.  This would suggest  phosphorylation of a putative component occurs (28,88). On balance, the evidence supports the 6  notion that intracellular M g  2 +  plays an important role in volume regulation of erythrocytes. The  mode by which magnesium affects volume regulatory paths however, remains undefined at the present time.  1.4  Properties of a Putative N a 7 M g Exchanger 2+  Na7Mg  2+  exchange has been functionally characterized in erythrocytes from different species  (32,53,102,106), as well as from ferret cardiac and skeletal muscle (10,12), human platelets (112), neuronal tissue (106), rat thymocytes and HL60 cells (51), rat sublingual acini cells (114), and rat hepatocytes (45).  The exchanger demonstrates somewhat different properties and transport  capacities in the different species and cell types. On balance, the system seems to be an amiloride, quinidine, and imipramine sensitive Na -dependent M g +  2+  antiporter demonstrating ATP dependence,  irreversibility, and electroneutrality. The exchanger is thought to be responsible for maintaining [Mg ]i 2+  below its electrochemical equilibrium in cells which are at physiological external sodium  concentrations (53). We speculate that N a 7 M g  2+  exchange, such as that in the RBC, may also be  present in epithelial cells such as those comprising the distal tubule of the nephron.  1.4.1  Cation specificity All studies reported to date state that the putative Na7Mg exchanger is highly selective for 2+  Na . Experiments were performed by loading R B C with M g +  2 +  and determining M g  buffer solution consisting of either N a or other cations in substitution. +  2 +  efflux into a  In rat or chicken  erythrocytes, replacement of extracellular NaCl by other monovalent cations such as L i , Cs , Rb , +  or choline did not stimulate magnesium efflux (32,46,54,55). +  7  +  +  These cations were unable to  substitute for N a in M g +  2 +  efflux. Further evidence demonstrating the dependence of magnesium  transport on extracellular sodium comes from studies of depolarized chicken red cells placed in high K media. K did not support M g +  +  2+  efflux (54). Additionally, in ferret red cells, extracellular Na  +  replacement by choline or N-methyl-D-glucamine (NMDG) reduced magnesium efflux for 30 min, +  after which transport levels increased as a result of Na leakage from the cell to the surrounding bath +  (38). Acid media also does not support magnesium efflux, thus ruling out a H / M g +  The evidence indicates that external N a is necessary for M g +  Na /Mg +  2+  2 +  2+  antiport (46).  efflux, supporting the postulate of a  exchanger.  The effect of extracellular divalent cations in addition to sodium has also been tested to determine whether magnesium efflux from hamster, human, and chicken red blood cells is inhibited. Extracellularly applied M g  2 +  inhibited N a influx and M g +  chicken erythrocytes (54,111). Net M g  2+  2+  efflux, respectively, in hamster and  efflux was not influenced by the presence or absence of  extracellular C a , up to concentrations of 10 mM, (32,54,111) suggesting that transport is not 2+  associated with C a but is specific for M g . Other extracellularly applied di- and trivalent cations 2+  2+  such as Sr *, Ba , Be , and L a 2  2+  2+  3+  inhibited M g  2 +  efflux in human erythrocytes by only 5-15% (32).  M n , however, caused significant inhibition of M g 2+  chicken M g  2 +  2 +  efflux and N a influx in human, hamster and +  preloaded red cells (32,54,111). At concentrations between 0.4 and 1 mM, M n  2+  inhibited efflux by 50% in human red cells and by approximately 70% at concentrations around 10 mM (32). In human cells, 90% inhibition of Na influx was observed with 1 m M M n +  2 +  included in  the incubation medium (111). In more recent studies in the rat, where conditions were designed to lead to reversed transport, M g  2+  moving in coupled to Na moving out, M n +  2+  was competitively taken  up by the same transporter as M g , whereas C a was unable to substitute for M g 2+  2+  8  2+  (53). In chicken  erythrocytes, subsequent loading of Mg -preloaded cells with M n 2+  Overall, this data suggests that M n  2+  2+  also inhibited M g  can competitively replace or inhibit M g  2+  2+  efflux (54).  in Na7Mg  2+  exchange  both for the internal and external sides and that no other divalent cations are able to do so.  1.4.2  Inhibitors Although there is no specific inhibitor for Na7Mg  2+  exchange, compounds which generally  inhibit N a transport mechanisms are modestly effective. This also provides further evidence for +  Na -dependence of the exchanger. Quinidine and amiloride at concentrations of 2 mM each affected +  sodium-dependent M g  efflux in ferret red cells, inhibiting transport by 60-70% (38). One m M  2 +  amiloride inhibited exchange in human erythrocytes by 60% and reversibly inhibited M g  2+  efflux  in chicken RBCs (46,49,50,78). At concentrations between 0.1 and 1 mM, quinidine inhibited M g  2+  efflux from 60-80% in human erythrocytes (32). In hamster red cells, 5 m M amiloride caused maximal and essentially complete inhibition of Na influx and M g +  (111).  These compounds also were shown to inhibit M g  2 +  2 +  efflux from Mg -loaded cells 2+  uptake in rat R B C under reverse  conditions i.e. magnesium influx and sodium efflux (53). Incomplete inhibition of M g possibly resulted from additional M g or non-specific M g  2 +  2+  2+  efflux  efflux mechanisms, such as a Mg -ATPase, Mg -channels, 2+  2+  leak, or was due to the low affinity of these inhibitors for the exchanger.  Additionally, at these high inhibitor concentrations the lack of selectivity of these drugs permits them to inhibit other N a transport systems, such as N a 7 H exchange and epithelial N a channels +  +  +  (65) perhaps having indirect effects on N a 7 M g antiport. 2+  Characterization of Na7Mg  2+  exchange is hampered by the absence of potent and specific  9  inhibitory compounds. Feray and Garay tested the effects of tricyclic antidepressent drugs on human RBC Na7Mg  2+  antiport (34). These studies were designed with the notion that M g  2+  plays a key role  in depressive states and psychiatric disorders (4). The two most potent drugs were imipramine and dothiepine, with an IC of 25 u M and 40 uM, respectively. Non tricyclic antidepressant drugs such 50  as Nomifensine and Trazodone were less potent in inhibiting exchange, demonstrating an I C of 50  0.4 m M or higher. These authors suggested that imipramine is a useful magnesium transport inhibitor as it appeared to be more selective than quinidine (IC =50 uM) (32), and could be used 50  at concentrations where side effects on other N a transport systems could be avoided (34). +  Other types of inhibitors have also been employed to determine whether additional modes of transport may be responsible for sodium-dependent magnesium efflux. Treatment of human red cells with vanadate did not affect M g  2 +  efflux (40).  Since the concentrations of vanadate used  effectively block other cation pumps, such as ATPases involved with C a concluded that M g  2+  efflux was not due to a M g  2+  2+  or Na transport, it was +  pump. Other drugs active on cation transport, such  as ouabain (Na7K pump inhibitor), furosemide and bumetinide (Na/K/Cl blockers), acetazolamide +  and DIDS (Cl channel blocker and anion exchange blockers) had no effect on M g RBCs (32,38,46). This M g  2+  2+  efflux in human  transport system is therefore different from typical cation pumps, K +  cotransporters, or anion carriers.  1.4.3  A T P Dependence Cellular ATP content has been reported to influence the activity of Na7Mg  cells from a variety of species (32,40,54,78).  2+  exchange in red  Metabolic poisoning with potassium cyanide,  iodoacetate, or dinitrophenol (dNP), as well as ATP depletion, by preincubation with 2 deoxyglucose 10  in place of glucose, have been shown to reduce M g  2+  efflux in magnesium-loaded cells by 20-85%  (32,40,53,54,55,78). In Frenkel et al.'s studies using metabolically starved cells, A T P incorporation when resealing RBCs restored magnesium transport. Non-hydrolysable analogues of ATP had no restituting effect on magnesium extrusion (40). This suggested that sodium-dependent magnesium efflux is somehow dependent on intracellular ATP and that A T P hydrolysis may be necessary to activate transport. Giinther et al. performed preliminary studies which indicated the involvement of membranebound proteins in M g  2+  efflux (54). Accordingly, phosphorylation of these proteins may play a role  in activating exchange (48). Many transport systems, such as the N a 7 H exchanger (13) or the +  Na7Ca exchanger (24), have been found to be controlled by phosphorylation/dephosphorylation 2+  reactions that serve to regulate their activation on a short term basis. DiPolo and Beauge provided evidence in squid axons that ATP may perform a phosphorylative role in activating exchange (31). The ATP analog, ATPyS, which can be used to thiophosphorylate proteins by protein kinases but not by ATPases, was able to replace intracellular ATP. Xu and Willis found that incubation of M g 2+  loaded hamster red cells with the serine/threonine selective protein kinase A (PKA) activator dibutyryl cAMP (db-cAMP), with the protein kinase C (PKC) promoter phorbol ester, or with the ser/thr protein phosphatase inhibitor okadaic acid did not cause any significant effect on the rate of amiloride-sensitive N a influx (111). +  reversible N a 7 M g  2+  However, Giinther and Vormann's recent studies with  exchange in rat RBCs suggests that PKC may play a stimulatory role in M g  transport. They found M g  2+  2+  uptake to be stimulated by phorbol myrystate acetate (PMA) treatment,  as an activator of PKC, and inhibited by staurosporine, a PKC inhibitor. These results are in contrast to those of X u and Willis. Furthermore, db-cAMP was ineffective and okadaic acid had a only small 11  stimulatory effect (53). Overall, these observations suggest that stimulation of N a 7 M g  2+  exchange  by a P K C pathway may be relevant. Phosphorylation/dephosphorylation events may regulate the Na7Mg transporter or a protein involved with uptake, or increase binding or affinity of M g 2+  2+  to a  modified site of the antiporter (53). In summary, the function of A T P with respect to Na7Mg exchange is, as of yet, undefined. It is clear however, that A T P is required for N a 7 M g  2+  2+  exchange  to take place in erythrocytes (32,39,40,54,78). Observations'to date suggest that A T P most likely plays a phosphorylative regulatory role with respect to this transport sysytem. putative N a 7 M g  1.4.4  2+  Cloning of the  exchanger will increase our understanding of how A T P affects this transporter.  Reversibility The N a / M g +  2+  exchanger is not a simple system as it does reverse cation transport in the  presence of altered transmembrane gradients of sodium and magnesium (40,111). Early studies in human, rat, and chicken red cells demonstrated that the magnesium content did not change significantly when cells were incubated in media containing high magnesium concentrations, suggesting the inability to reverse transport (47,55,78). In these experiments [Mg ] was low or not 2+  (  reported. M g of M g  2+  2+  efflux in rat or chicken erythrocytes was increased at higher [Mg ]j, with saturation 2+  efflux occuring at internal concentrations of 5 to 12 mM. No efflux was observed in chicken  red blood cells at normal [Mg ]j (0.5 mM) (54,55). A gating mechanism might exist at the inner 2+  cell surface which is actived only at increased concentrations of internal M g  2 +  (55). Giinther and  Vormann's most recent studies using rat erythrocytes suggested that in order to reverse Na7Mg exchange intracellular M g  2+  2+  was required (53). In the presence of intracellular M g , transport was 2+  dependent on the direction of the N a gradient. This reversibility was also observed in ferret +  12  erythrocytes, but was not detected in human RBCs (53). In summary, N a 7 M g reversible in some species under controlled conditions. Physiologically, M g  2+  2+  antiport may be  uptake possibly does  not play a role in vivo because high [Na ] in combination with low [Na ] would never be observed +  +  f  0  in circulating RBCs or any other cells. The N a 7 M g transport M g  2+  out of the cell to maintain  2+  antiporter is most likely present to actively  [Mg ]j homeostasis rather than oriented to increase M g 2+  2 +  entry (53).  1.4.5  Stoichiometry The stoichiometric relationship of M g  efflux with N a influx is also controversial.  2 +  +  Gunther's work on chicken and rat RBCs suggests that efflux of one M g  2 +  is coupled with uptake  of two N a (53,54,55). They used magnesium-loaded chicken red cells, in which intracellular +  sodium and magnesium were measured within the first 30 min. Cellular magnesium content was reduced by 1.5 m M , and cellular sodium content was increased by 3 mM. This suggested electroneutral transport with a 2:1 N a to M g +  2 +  ratio. It was assumed that other significant sodium  influx paths other than the Mg -dependent one were absent under the experimental conditions. 2+  Dipolo and Beauge employed voltage-clamp studies to demonstrate electroneutral transport in squid axons (31). Magnesium efflux was not affected with changes in membrane potential. Similarly, in hamster red cells, studies comparing Vmax values demonstrated a ratio of 2Na :lMg , with the +  Vmax of M g  2 +  2+  efflux being about half that of Na influx (111). These predictions are lower than +  that of Feray and Garay whose studies on human erythrocytes showed that N a influx and M g +  2+  efflux were coupled in a stoichiometry of about 3:1 (34). Frenkel et al. and Flatmann and Smith suggested transport with a stoichiometry of 1:1 in human and ferret red cells, respectively (38,40).  13  The stoichiometry of N a 7 M g  2+  coupling investigated so far ranges from 1/1 to 3/1 in different  preparations and different species.  Therefore, N a / M g +  2+  exchange may demonstrate different  properties depending on the cell type or tissue origin. Further studies are required to clearly define this parameter.  1.4.6  Objectives and Approach In these studies, we attempted to express Na -dependent M g +  oocytes with the intention of later expression cloning the N a 7 M g  2 +  2+  exchange in Xenopus laevis exchanger. Poly (A) RNA +  (rnRNA) isolated from three erythroleukemia cell lines was injected into Xenopus oocytes prior to assaying for Na -dependent M g +  2 +  transport. Radioisotopic N a measurements were employed in 22  some of the experiments. Additionally, due to the absence of M g , we had to rely on atomic 28  absorption measurements of M g  2 +  efflux from cold magnesium. This method requires that cells  express an abundance of protein in order for detectable amounts of transport to take place. In these studies, oocytes were loaded with magnesium and transport measured in the presence of sodium in the bathing solution. The exchange observed in the mRNA-injected oocytes was characterized to ensure that the transport expressed resulted from Na7Mg  2+  exchange. Amiloride and quinidine were  employed to demonstrate the sodium dependence of this exchanger (5). A second objective in this study was to try to identify and clone the N a / M g +  2+  exchanger  through homology-based studies. Degenerate primers were designed from transmembrane regions of the Na7Ca exchanger and from the Walker A sequence of the ATP-binding cassette (ABC) and 2+  used for RT-PCR. Furthermore, a probe was made from the Na7Ca exchanger clone and employed 2+  to screen erythroleukemia cDNA libraries. 14  1.4.7  Rationale Secondary active transport in the form of a N a / M g +  2+  exchanger has been postulated to  account for [Mg ]; being below its electrochemical equilibrium. Most studies to date have been 2+  performed on erythrocytes because this cell appears to express an abundance of exchanger protein. The Na7Mg exchanger plays an important role in this cell type because changes in [Mg ]j affect 2+  2+  volume regulatory mechanisms, such as K / C l and Na/K/Cl cotransport. Although studies with RBCs strongly suggest the presence of a N a 7 M g  2+  exchanger, the properties of this exchange system  remain to be fully elucidated. On balance, N a 7 M g Mg  2+  2+  exchange demonstrates Na -dependence of +  efflux that is sensitive to amiloride, quinidine, and imipramine. Exchange is specific for M g  with the possible exception of M n  2+  which may replace M g . Finally, N a 7 M g 2+  2+  2+  transport is likely  to be electroneutral, and is regulated by intracellular A T P levels. Some reports have suggested that the N a 7 M g  2+  exchanger may structurally resemble the  Na7Ca exchanger and share some common properties (53). If this is true, one would expect that 2+  these two exchangers may also demonstrate similarity in amino acid sequence. Any similarity would most likely exist in areas of the Na7Ca exchanger which are highly conserved among species, such 2+  as within the transmembrane regions. We also postulated that transport similar to the A T P binding cassette (ABC) family of transporters may account for magnesium translocation.  In A B C  transporters, two short sequences (Walker A and B) constitute a nucleotide binding pocket. The energy from binding and hydrolysis of A T P is used to transport substrates (77).  There is the  possibility that the Na7Mg exchanger also functions in this manner, and that this mode of transport 2+  provides the driving force for the antiport.  15  1.5  Na7Ca Exchange 2+  Calcium transport processes are much better understood relative to magnesium transport. The Na7Ca exchanger has been extensively described at both the functional and molecular levels. 2+  As the Na7Ca exchange system is fairly well understood, only the important features of Na7Ca 2+  transport will be reviewed only as it pertains to N a 7 M g  1.5.1  Na7Ca  2+  2+  2+  exchange.  Exchange in Erythroid Cells  Na7Ca exchange plays a very important role in many cell types including epithelial cells 2+  of the nephron (93). Although somewhat controversial, Na7Ca  2+  exchange is also thought to be  present in erythroid cells. Gardner and Balasubramanyam reported that the human leukemia (K-562) cell line did not possess Na7Ca presence of a Na7Ca  2+  2+  exchange (43). Varecka and Carafoli have also ruled out the  exchanger system in human red blood cells (108). However, others have  clearly shown that Na7Ca significant role in C a  2+  2+  exchange is present in differentiated red blood cells where it plays a  transport (3,80,86,90).  Control of intracellular C a  concentrations in  2+  erythroid cells is important as it is thought to be involved in fundamental changes of red blood cell function, such as growth and differentiation (44,59,74,81). The early studies of Smith et al. showed that a Na7Ca exchanger may function in reverse mode to increase cytosolic Ca , a step which they 2+  2+  postulated is essential for the commitment of erythroleukemia cells to terminal differentiation (102). Others have reported that differentiation results from increases in cytosolic C a intracellular C a cytosolic C a  2+  2+  release and/or influx through C a  is increased, C a  2+  2+  2+  achieved either by  channels (20,44). Whatever the means by which  signalling within erythroleukemia cells, and thus cell differentiation,  will be influenced by expression of a Na7Ca  2+  exchanger. 16  1.5.2  Molecular Cloning of the Na7Ca Exchanger 2+  Sodium-dependent transport of calcium was initially demonstrated in the squid giant axon (6). Following many functional studies, the Na7Ca  2+  exchanger was ultimately cloned from the  canine heart (83) and, subsequently, from other tissues and species (25,41,68,70,75,76,97,113). This exchanger comprises an amino terminal cleaved signal sequence, a short glycosylated extracellular region, a domain of five hydrophobic transmembrane segments, a long cytoplasmic loop, and finally a region of six transmembrane segments at the carboxy-terminal end (83) (Fig. 3). The Na7Ca  2+  family is made up of three different members (NCX1, NCX2, NCX3) with 65-74% amino acid identity among them (84). The commonly expressed member is that related to the cardiac exchanger, NCX1. Although a single gene codes for the common form of the Na7Ca  2+  exchanger found in  diverse species and tissues, it is expressed as a number of different transcripts. This is due to alternative splicing in the coding sequence located within the cytoplasmic loop (69). Kofuji et al. postulated that the various isoforms could result from the presence of two mutually exclusive exons (A and B) in conjunction with four cassette exons (C-F) that together could allow for the generation of up to 32 possible distinct Na /Ca +  2+  exchanger transcripts (69).  To date, restriction-enzyme  protection analysis and sequencing data have revealed the existence of seven major isoforms: NACA1 (82), N A C A 2 and 3 (68,97), N A C A 4 and 5 (41), N A C A 6 (69), N A C A 7 (73) (Fig. 4). Lee et al. suggest the expression of Na7Ca exchanger variants is regulated and influenced by different 2+  promoters in a tissue-specific fashion (73). Na7Ca  2+  exchange is functional in both electrically  excitable cells such as muscle and neuronal tissue, in addition to being present in nonexcitable cells such as the kidney (6,41,68,82,97). The presence of Na7Ca exchange in erythroid cells is not yet 2+  17  18  Transmembrane Domains  1  2  3  4  Cytoplasmic Loop  5  P1  Transmembrane Domains P2  6  7  8  NH,  9  1.0 11  COOH  Genomic Organization H A lH~B~HC>rDHE"r-l F h Heart  (NACA1) ^ ^ K I 1 J C | J D 1 J I 1 J Z E  Kidney (NACA2) Kidney (NACA3) Brain  (NACA4)  Brain  (NACA5)  Brain  (NACA6)  Kidney (NACA7) Erythroleukemia Cells  H f ! [C|jD n f ~ | j D ^ J"T1  |TTL_  ^[7AI]JIZ(JZE l~A~|JC|jDl _ v  J~B~\JD\J | B ^[tJ|^_  Fig. 4 Schematic representation of the Na7Ca exchanger gene and the alternatively spliced isoforms. Transmembrane domains 5 and 6 flank a large cytoplasmic loop containing an alternatively spliced site. Primers, PI and P2, were designed flanking this splice site and used to amplify cDNA from erythroleukemia cells. The variable region may be composed of various patterns of exons A-F to form the given Na7Ca exchanger (NACA) isoforms. The isoforms of N A C A were first isolated in order: NACA1 from dog (82), human (1,70), and rat (73) heart, NACA2 and N A C A 3 from rabbit kidney (68,96), N A C A 4 and N A C A 5 from rat brain (41), N A C A 6 from rabbit brain (69) and N A C A 7 from rat kidney (73). This data is, in part, from ref. 69. The N A C A isoforms for erythroleukemia cells was isolated in the present study. 2+  2+  19  determined. The structural complexity of the single gene allows the Na7Ca  2+  exchanger to respond  independently to the unique demands of different environments. Accordingly, it is important to determine the expression of these isoforms to better understand their regulation and function.  1.5.3  Cation Specificity and Inhibitors Both Na -dependent C a +  2+  efflux and influx demonstrates specificity for Ca .  basolateral membrane vesicles, about 50% inhibition of C a observed when M n , Ba , or 2+  2+  ST * 2  In renal  2+  2+  uptake, as measured with C a , was 45  were applied to the intravesicular medium (62). B a  2+  and Sr  2+  may function by serving as substrates for transport (65). Studies with arterial smooth muscle cells indicate that M g La  3+  2+  competed with C a  2+  for binding to the carrier, but was not itself transported (103).  was the most potent inhibitor of Na -dependent C a transport in a number of systems, including +  2+  the squid giant axon, where micromolar concentrations inhibited exchange (6,62,71). The inhibitors La  3+  and M g , when applied extracellularly to c T A L cells, inhibited calcium movement in a 2+  sustained fashion upon readdition of extracellular Na (25), suggesting irreversible inhibition perhaps +  though a conformational change of the exchange protein. In squid axon, M n , C o , and N i 2+  2+  2 +  are  effective inhibitors of Na7Ca exchange for both calcium uptake and efflux (6). The Na selectivity 2+  +  of the Na7Ca exchanger has also been demonstrated. Different monovalent cations, including Na , 2+  +  L i , K , Rb , and choline* inhibited Na7Ca exchange (65,71). These studies indicate that Na7Ca +  +  +  2+  exchange is specific to both Na and C a +  2+  2+  and is inhibited by cationic substitution of these substrates.  A variety of substances have been shown to inhibit Na7Ca  2+  exchange but their usefulness  is limited because they are only weakly effective or nonspecific (71).  Amiloride or its analog,  bepridil (sodium channel blocker), verapamil (calcium entry blocker), and quinacrine (sodium 20  transport inhibitor) inhibit Na7Ca exchange at high drug concentrations (i.e. at m M concentrations) 2+  at which other sodium transport systems may also be inhibited (65). In spite of the lack of potent inhibitors to Na7Ca exchange, this system has been well characterized, as its protein structure has 2+  been elucidated by cloning techniques.  1.5.4  ATP Dependence Na7Ca  2+  exchange, like N a 7 M g  2+  exchange, demonstrates ATP dependence. Upon ATP  depletion of Chinese hamster ovary (CHO) cells or COS cells transfected with the bovine cardiac Na7Ca exchange, the rate of rise in [Ca ]j with low external sodium was remarkably less than in 2+  2+  ATP repleted cells. C a  2+  efflux was also decreased in these ATP-depleted cells under conditions of  high external sodium (17). Therefore ATP depletion inhibits both C a the Na7Ca  2+  2+  influx and efflux modes of  exchanger. Likewise, in heart myocytes (58) and smooth muscle cells (104), ATP  depletion with metabolic inhibition reduced Na7Ca exchange by more than 80%. This data clearly 2+  shows some A T P dependence of exchange function. Regulation of Na7Ca exchange in cardiovascular cells has received more attention than in 2+  epithelial cells (95). There is evidence that protein kinase-dependent phosphorylation is responsible for stimulation of the exchange activity induced by Mg-ATP in heart sarcolemma (18). Phorbol esters, 8-bromoguanosine 3',5'-cyclic monophosphate, norepinephrine, and platelet-derived growth factor (PDGF) stimulate Na7Ca exchange activity in smooth muscle cells (42,61,95,109). These 2+  findings suggest that phosphorylation of the exchanger or associated ancillary proteins may be involved in activation of Na7Ca  2+  exchange in cardiovascular cells. Recently, Iwamoto et al. (61)  have shown that PDGF activates exchange through phosphorylation of multiple sites of the exchange 21  protein, which supports the notion of a direct action on the exchanger. However, other studies performed in CHO cells or COS cells transfected with the bovine cardiac Na7Ca  2+  exchange failed  to detect changes in phosphorylation or exchange activity with inhibitors of protein kinases or phophatases (22). In cortical thick ascending limb (cTAL) cells, calmidazolium, a Ca -calmodulin 2+  inhibitor, decreased exchange activity whereas okadaic acid, a phophatase inhibitor, increased the activity (24).  Further studies are necessary to implicate phosphorylative mechanisms in the  modulation of Na7Ca  1.5.5  2+  exchange activity.  Reversibility and Stoichiometry Under normal circumstances, extracellular N a enters in exchange for cytosolic Ca , +  2+  however, depending on the prevailing electrochemical gradient for Na , C a +  increasing cytosolic C a  2+  2+  may move into the cell  concentration (100). In renal distal tubule membranes, the activity of  Na7Ca exchange was a function of the sodium gradient such that C a 2+  2+  uptake by vesicles loaded  with 150 m M NaCl decreased progressively as the concentration of Na in the incubation medium +  was increased (62,93,107). Reeves and Hale suggested that electrogenic transport occured with a stoichiometric ratio of 3 N a to 1 C a +  2+  in the exchange process (96). Accordingly, the membrane  potential also acts as a driving force for net C a basolateral Na7Ca potential and C a  2+  2+  2+  exchanger demonstrated C a  2+  movement via the Na7Ca  2+  exchanger. Renal  efflux under conditions of negative membrane  influx with positive membrane potentials (62,107). In c T A L cells of the nephron  transmembrane depolarization also induced a reversible Na -dependent C a +  2+  influx which was  dependent on the transmembrane Na concentration and voltage gradients (25). Therefore, it is the +  coupled movement of sodium ions down their electrochemical gradient that provides the energy 22  required to move C a  2+  out of the cell against its electrochemical gradient.  In summary, Na7Ca exchange is specific for both Na and C a 2+  +  transport inhibitors such as amiloride and quinidine, and C a  2+  2+  and is inhibited by sodium  entry blockers such as verapamil. This  transport system is modulated through phosphorylation by intracellular ATP, and demonstrates 3 Na : 1 Ca  1.5.6  2+  +  transport stoichiometry.  Objectives and Approach The present studies were designed to determine the expression of Na7Ca exchanger in three 2+  commonly used erythroleukemia cell lines and to characterize the isoform coding the exchange protein. To fulfill these two objectives a homology based RT-PCR cloning strategy and D N A sequencing was employed. PCR primers employed were designed to flank the alternatively spliced region of a rat Na7Ca  1.5.7  2+  exchanger cDNA.  Rationale Erythroleukemia cells have been the subject of extensive studies as one of the best models  for terminal differentiation (8,57,60,79,84). Upon exposure to inducing agents which result in increases in cytosolic Ca , these cells exhibit all the characteristics of erythroid cells, including the 2+  loss of growth proficiency (60,84). Na7Ca cytosolic C a  2+  2+  exchange plays a significant role in maintaining  concentrations in many cell types. In cells of erythroid origin, Na7Ca  may either play a role in elevating intracellular C a levels to normal following an increase in C a  2+  2+  2+  exchange  concentrations or returning intracellular C a  prior to differentiation.  Expression of Na7Ca  2+  2+  exchanger in these undifferentiated erythroleukemia cells may also reflect characteristics of mature 23  RBCs. It would therefore be of relevance to determine whether the Na7Ca in these cells.  24  2+  exchanger is present  Chapter Two Materials and Methods 2.1  R N A isolation Human leukemia (K-562) cells were cultured in RPMI 1640 medium (Stem Cell  Technologies Inc.; Vancouver, B.C.) supplemented with 10% fetal calf serum (FCS) (GIBCO/ BRL; Grand Island, N Y ) and an antibiotic mixture (PSN; 50 /^g penicillin, 50 fxg streptomycin, 100 neomycin/100 ml media) (Stem Cell Technologies Inc.; Vancouver, BC) in a humidified atmosphere of 95% 0 /5% C 0 at 37 °C. Human (HEL) and mouse (GM979) erythroleukemia cells were grown 2  2  in D M E M NF-12 medium (Stem Cell Technologies Inc.; Vancouver, B.C.) supplemented with 10% FCS and the above mentioned antibiotics. The cells were washed with phosphate-buffered saline (PBS) and poly (A) R N A extracted using the Poly A Tract System 1000 (Promega; Madison, WI). +  mRNA was stored at -80 °C at a working concentration of 1.5 yUg//J.  2.2  Expression of Na /Mg Exchange  2.2.1  Isolation of oocytes  +  2+  Adult Xenopus laevis were anesthetized with 1.5 gm/1 (5.7 mM) 3-aminobenzoic acidethyl ester (Tricaine) (Sigma; St. Louis, MO) and several lobes of the ovary were removed. Fully grown oocytes (1.2-1.3 mm diameter, stages V and VI) were selected after removal of the follicular cell layer by treatment with collagenase (3 mg/ml, type II, Sigma; St. Louis, MO) in ORII buffer [containing (in mM): NaCl, 82.5; KC1, 2.0; MgCl , 1.0; HEPES/Tris, 10; pH 7.4] for 3 hr at 19 °C 4  with gentle continuous agitation. The oocytes were subsequently washed extensively with ORII buffer and the remaining follicular cells manually stripped off. Oocytes were maintained for 2-5 days in ND96 solution [containing (in mM): NaCl, 96; KC1, 2.0; CaCl , 1.8; MgCl , 1.0; 2  25  2  HEPES/Tris, 5.0; pH 7.4] containing 2.5 mM Na pyruvate and gentamicin (5 Mg/ml) (Sigma; St. Louis, MO) at 18 °C with continuous gentle agitation and daily changes of solution. A l l studies were performed following this equilibration period.  2.2.2  Oocyte injection Microinjection of mRNA into oocytes was performed through the use of micropipettes  controlled by a minipump (Hampel, Frankfurt, Germany). In a typical experiment, oocytes were injected with 50 nl of water containing 30-50 ng of mRNA. Negative controls included oocytes injected with water alone.  Injected oocytes were incubated at 18 °C for 36-48 hr in 24-well  microtiter trays in a total volume of 1 ml. The incubation media was changed daily prior to atomic absorption determinations or radioisotopic N a measurements. 22  2.2.3  Determination of N a 7 M g  2+  Exchange  Following a 36-48 hr incubation period, Xenopus oocytes, immersed in a LiCl bath, were loaded with 10 nl of a 1 M M g  solution to a final cytoplasmic concentration of 15 m M M g  2+  (assuming a volume of 700 nl/ oocyte). Two methods were employed to demonstrate N a / M g  2+  2+  +  exchange:  22  Na  +  influx and M g  2 +  efflux. For N a 22  +  influx, magnesium-loaded oocytes were  reimmersed in a solution of NaCl (96 mM) and incubated for 12 min. Serial washes in ND96 were 22  then performed to dilute NaCl which remained in the bath solution. Oocytes were transferred to 22  scintillation vials and the counts per minute measured using a Beckman LS 6500 multi-purpose scintillation counter (Fullerton, CA). Alternatively, M g  2+  efflux was measured from the bath  solution 10-30 min after immersion of 3-10 magnesium-loaded oocytes into 60 ul of a 96 mM NaCl 26  solution.  Atomic  absorption measurements  (Perkin-Elmer  2380  Atomic Absorption  Spectrophotometer; Norwalk, CT) of the bathing solution were taken at a wavelength of 285.2 nm to determine magnesium extrusion into the bathing solution.  2.2.4  Inhibition of transport Amiloride and quinidine (Sigma; St. Louis, MO) were diluted in dimethyl sulfoxide (DMSO)  (BDH Laboratory Supplies; Poole, England) to final concentrations of 5.0 m M and 4.0 mM, respectively, and used to inhibit transport. They were added directly to the NaCl bath in which oocytes were placed following magnesium loading. to determine N a / M g +  2+  22  N a uptake measurements were then taken +  exchange.  2.3  Molecular Studies of the Putative N a / M g Exchanger  2.3.1  Design of PCR Primers  +  2+  This approach was designed with the notion that a certain degree of homology may exist between the N a / M g +  2+  and Na7Ca  2+  exchangers and that the N a 7 M g  2+  exchanger may contain an  ATP-binding cassette (ABC) which accounts for its A T P dependence.  A n array of degenerate  primer pairs were constructed from several areas of conserved sequence within given transmembrane domains of the N C E . F l cDNA (kindly provided by Dr. J. Lytton; University of Calgary, Alberta, Canada) (73). Primers were also designed from the Walker A sequence of the A B C (77). These primers were synthesized by the Nucleic Acid Service Laboratory (N.A.P.S.), Biotechnology Laboratory, U B C .  27  2.3.2  Homology based RT-PCR PCR amplifications were performed using either mRNA from the three erythroleukemia  cells lines or cDNA from the K-562 library subsets isolated through Qiagen (Qiagen Inc.; Chatsworth, CA). 1.5 fj.g mRNA was reverse transcribed for 50 min at 42 °C in a reaction mixture consisting of 25 mM oligo dT or 1 /A downstream primer, IX first strand buffer, 10 m M DTT, 0.5 mM dNTP mix, and 20 units//J Superscript II (GIBCO/BRL; Grand Island, NY). The reaction was terminated by heating to 99 °C for 5 min. 2 [A of this first strand cDNA or 1 [A of cDNA from the library was added to the PCR reactions. PCR samples contained IX PCR buffer, 0.1 mM dNTP mix, 2.25 m M M g C l , 625 m M of downstream and upstream primers, and 1.25 U Taq D N A 2  polymerase (GIBCO/BRL; Grand Island, NY) in a total volume of 40 (A. Amplification with the primers was performed using a programmable thermal cycler (Perkin Elmer Gene Amp PCR system 2400) as follows: hot start at 94 °C prior to addition of cDNA; 35 cycles of 94 °C 30 s, 42 °C 45 s, and 72 °C lmin 10 s; and then 72 °C 7 min preceeding cool down to 4 °C.  2.3.3  Southern analysis PCR products were separated on a 0.8% agarose gel and visualized by ethidium bromide  staining. They were transferred by downward capillary transfer to Genescreen (NEN Research Products; Boston, M A ) (21), and the blots were crosslinked in a U V Stratalinker (Stratagene; San Diego, CA). A probe was made using the N C E F . l cDNA cloned from rat kidney (73). The probe, consisting of 100 ng ECOR1 cut cDNA, IX Klenow buffer, IX C G T nucleotide mix, 100 pmol random hexamer, 1 U Klenow, and 50 /xCi [ P]-dATP (ICN; Montreal, QUE) in a final reaction 32  volume of 20 /A, was incubated at 37 °C for 30 min and purified with a Sephadex G-50 column. 28  Membranes were prehybridized at 40 °C for 30 min in a solution of 1% bovine serum albumin (BSA), 30% formamide, 7% sodium-dodecyl sulfate (SDS), and 350 m M sodium phosphate (NaP) solution. Labelled probe was added directly to the prehybridization solution and the membranes hybridized at low stringency (40 °C) overnight. The blots were then washed for 10 min in 150 mM NaP/0.1% SDS at 21 °C and exposed on Kodak X - O M A T film for 20 hr at -80 °C.  2.3.4  Cloning and Sequencing of PCR products 1 pi of fresh PCR product was cloned using the T A cloning kit (InVitrogen; San Diego, CA).  Colonies were transferred to Hybond-N (Amersham, UK) nylon membranes. Colony lysis and +  binding of D N A to the membranes was accomplished by placing the membranes, in order, on Whatmann 3 M M paper (Whatmann International Ltd.; Maidstone, England) soaked with 10% SDS for 3 min, denaturing solution (0.5 M NaOH, 1.5 M NaCl) for 5 min, neutralizing solution (1.5 M NaCl, 0.5 M Tris.Cl) for 5 min, and 2 X sodium citrate (SSC) for 5 min. The membranes were then crosslinked in a U V Stratalinker (Stratagene; San Diego, CA). They were subsequently probed, washed, and exposed as previously described in section 2.3.3. Possible positive clones were picked and streaked.  Recombinant colonies were selected by blue white selection on L B plates  (GIBCO/BRL; Grand Island, NY) containing 50 ng/ml ampicillin (Sigma; St. Louis, MO). Plasmids were isolated from seemingly positive recombinants by overnight minipreps with a midi Qiagen kit (Qiagen Inc.; Chatsworth, CA). Alkaline lysis plasmid preparations, followed by digestion with the restriction enzyme ECOR1 (GIBCO/BRL; Grand Island, NY) and electrophoresis on a 0.8% agarose gel, was employed to confirm cDNA insert size. The clones were sequenced with M l 3 forward and reverse primers at the N.A.P.S. Laboratory. 29  2.3.5  Screening of cDNA Libraries K-562 and GM979 erythroleukemia cDNA libraries were kindly supplied by Dr. Keith  Humphries and Dr. Robert Kay, respectively (Terry Fox Lab, B . C . Cancer Research Center; Vancouver, B.C.). These libraries were titrated and plated at appropriate dilutions onto L B plates (Gibco/BRL; Grand Island, NY) containing 50 Mg/ml ampicillin (Sigma; St. Louis, MO), 7.5 ^g/ml tetracyclin (Sigma; St. Louis, MO) for the GM979 library and 25 ^g/ml amp, 10 /zg/ml tet for the K-562 library. Colonies were transferred to Hybond-N (Amersham, UK) nylon membranes. The +  membranes were thereafter handled as in section 2.3.4.  E x c h a n g e  2.4  Na7Ca  2.4.1  Design of PCR primers  2+  Non-degenerate oligonucleotide primers were designed based upon highly conserved domains of the rat kidney N C E F . l cDNA (73). The primers spanned the alternatively spliced region of  the  exchanger  transcript,  with  the  sequence  of  the  external  primers  being  5'  G A G G G G A G G A T T T T G A G G A C A C T 3' and 5' A G G G C C A G G T T T G T C T T C T T A A T 3' and the internal primers for the nested PCR reaction comprised 5' C T C G A A T T C C A G A A T G A T G A A A T 3' and 5' C T C T T G A A T T C G T A A A A T T C T T C 3'.  2.4.2  RT-PCR amplification R T - P C R was carried out as previously described in section 2.3.2. For these experiments  however, external primers were employed in the primary PCR reaction at an annealing temperature of 58 °C. PCR products were reamplified with the internal primers using 1 jA of the initial product 30  in a second 40 /A reaction at an annealing temperature of 47 °C.  2.4.3  Southern analysis PCR products were treated as in section 2.3.3 with the exception being that membranes were  prehybridized and hybridized at 55 °C. Furthermore, the blots were washed for 10 min at 21 °C and 15 min at 55 °C prior to exposure on film.  2.4.4  Cloning and sequencing of PCR products 1 pi of fresh PCR product was cloned using the T A cloning kit (InVitrogen; San Diego, CA).  Recombinant colonies were selected by blue white selection on L B plates (GIBCO/BRL; Grand Island, NY) containing 50 ng/ml ampicillin (Sigma; St. Louis, MO). Plasmids were isolated from overnight minipreps with a midi Qiagen kit (Qiagen Inc.; Chatsworth, CA). Alkaline lysis plasmid preparations, followed by digestion with the restriction enzyme ECOR1 (GIBCO/BRL; Grand Island, NY) and electrophoresis on a 0.8% agarose gel, was employed to confirm cDNA insert size. The clones were sequenced with M l 3 forward and reverse primers at the N.A.P.S. Laboratory.  31  Chapter Three  Results  3.1  Na7Mg  3.1.1  R B C mRNA expression  2+  Exchange  Xenopus laevis oocytes have long been known to efficiently express proteins when injected with exogenous R N A or D N A (101). During oogenesis, oocytes accumulate large quantities of enzymes, storage proteins, and organelles, which form a reserve for use during early embryonic development. In our study, 0-80 ng of mRNA isolated from the human leukemia (K-562) cell line, mouse erythroleukemia (GM979) cell line, or human erythroleukemia (HEL) cell lines were injected into stage V-VI Xenopus laevis oocytes. Oocytes were incubated for 36-48 hours, allowing adequate time for translation of foreign mRNA and expression of protein to take place on the oocyte plasma membrane, prior to assaying for transport. expression Na -dependent M g +  2+  These studies were directed at demonstrating the  transport in oocytes. Oocytes were either magnesium-loaded (15  m M final concentration) or not-loaded (~ 0.5 m M Mg ) and N a influx and magnesium efflux 2+  22  determined. Magnesium efflux, as determined with atomic absorption, was associated with the presence of mRNA with about 3 times more transport taking place in mRNA-injected compared to water-injected oocytes (Fig.5). Using the other approach, maximum N a transport was detected 22  with 50 ng of mRNA injected for which transport was 5.3-times greater compared to control values. Smaller amounts of mRNA were associated with less uptake showing that transport was dependent on the amount of mRNA injected (Fig.6). Injecting 80 ng of mRNA had no additional effects when compared to 50 ng (Fig.6).  N a transport from mRNA injected Mg -loaded oocytes was +  2+  significantly greater than from those not loaded with magnesium (Fig.6), demonstrating the dependence of transport on M g . The high transport in Mg -loaded versus non-loaded oocytes 2+  2+  32  400  j  350 -  water  mRNA  Fig. 5 m R N A dependence of M g ^ efflux. Oocytes injected with water or 50 ng of R B C m R N A were incubated for 36-48 hours. Following magnesium loading to a final intraoocyte concentration of 15 mM, M g efflux was measured. Atomic absorption measurements were recorded at a wavelength of 285.2 nm following a 30 min incubation in sodium-containing medium. N=2 experimental groups of 10 oocytes each for water-injected oocytes. Data is represented as mean +/- S E M , N=5 experimental groups for mRNA-injected oocytes. 2 +  33  500 450 +  mRNA Injected (ng) Fig. 6  m R N A concentration dependence of Mg -dependent N a influx. 2+  ng of m R N A was microinjected into Xenopus transport was concentration dependent.  +  0-80  oocytes to determine whether  mRNA- or water-injected  oocytes  were incubated for 36-48 hours prior to assaying for Mg -dependent  2 2  Na  transport.  2 2  Na  2+  Oocytes were placed in a NaCI bathing solution containing  and the radioisotope measured through scintillation counting. Hatched bars represent  Na  +  transport  in non magnesium-loaded oocytes.  represent  Na  +  transport  in magnesium-loaded (9.5  Solid bars  mM, final) oocytes.  Transport is reported as pmole NaVminute-oocyte. Each bar represents mean +/- S E M , N=10 oocytes. 34  demonstrates that the transport observed is due to N a / M g +  2+  exchange and not a result of other N a  +  influx paths. Interestingly, the high background level in non-magnesium loaded oocytes and nonmRNA injected oocytes might suggest the presence of endogenous transport (Fig.5 and Fig.6). Oocytes may possess endogenous magnesium transport systems such as Mg -channels, a M g 2+  pump, or a Na7Mg  2+  2+  exchanger. Transport may be overexpressed with injection of mRNA isolated  from the erythroleukemia cells. Alternatively, magnesium measured in the efflux bath may be accounted for by non-specific magnesium leak from the oocyte.  3.1.2  Effect of Intraoocyte Magnesium The effect of the intraoocyte magnesium concentration on magnesium-stimulated Na7Mg  2+  exchange was investigated. Oocytes injected with 50 ng mRNA were loaded to differing concentrations of magnesium, from 0.5 m M (not loaded, endogenous [Mg ]j) to 25 m M , to 2+  determine whether the transmembrane magnesium gradient affected transport. In this study, 5-6 oocytes were assayed in a volume of 60 ul. The maximal increase in magnesium-dependent N a  +  transport (stimulated minus background) was observed with about 15 m M intraoocyte magnesium (Fig. 7a).  At this concentration of magnesium, about a 6-fold increase in N a transport was 22  observed in comparison to endogenous values (300 pmol/min»oocyte with 15 m M magnesium versus 50 pmol/min»oocyte in 0.5 m M magnesium). Furthermore, a single experiment demonstrated that magnesium efflux increased 4-fold with 10 m M intraoocyte magnesium, and 2.5 fold with 15 m M compared to endogenous transport values (Fig. 7b).  3.1.3  Sodium Dependence of the Exchanger 35  CD  {5*400  9 350 -<D |  300 --  1  250  CD  o 200 --  JL 150 J  --  100 --  1= CO  50 : : 0 * 0  10  15  Intraoocyte M g  2+  20  25  (mM)  B 250  j  £ 200 c  -  O  Efflux (pm le/m  9  o  150 -100  -  50 ir  + CM  0 --  O)  2  0  Intraoocyte M g Fig.7  10  8 2+  12  14  16  (mM)  Effect of the membrane concentration gradient for M g  2+  on ion transport.  mRNA-injected oocytes were loaded with different concentrations of magnesium (0 25 mM final intraoocyte concentration).  Magnesium and  22  N a transport was  measured as described in Fig. 5 and Fig. 6. A) Values for N a influx represent the +  mean +/- SEM (stimulated minus background), N=10 oocytes for each data point. B) M g  2+  efflux measurements represent one experimental group. 36  We were interested to determine whether transport was inhibited with sodium transport agonists. Amiloride and quinidine at concentrations of 5.0 m M and 4.0 mM, respectively, were added to the oocyte bath solution (ND 96), and incubated for 10 min prior to assaying for  22  Na  uptake. Both compounds inhibited transport by more than 50%, essentially reducing transport to control uptake values (475 pmole/min«oocyte vs 225 and 250 pmole/min»oocyte for quinidine and amiloride, respectively) (Fig. 8). Endogenous transport did not appear to be affected by treatment with these compounds.  3.1.4  Stoichiometry A comparison of sodium influx measurements to those for magnesium efflux from separate  experiments, revealed an approximate transport ratio of 1.65 N a to 1 M g +  2 +  (Fig. 9). This suggested  electroneutral transport; i.e. two N a for one M g . Further electrophysiological studies are required +  2+  to confirm these studies.  3.2  Na7Ca  2+  Exchanger and A B C Homology-Based Studies of the N a 7 M g  2+  Exchanger  Screening the K-562 and GM979 cDNA libraries with a NCE.F1 (69) P-labelled probe was 32  unsuccessful because all the colonies on the membrane hybridized probe, whether they contained an insert or not. This pattern may be the result of vector sequences being recognized by the probe at the low stringency conditions employed. Homology-based PCR employing Na7Ca exchanger and A B C primers with cDNA derived 2+  from the libraries was also unsuccessful. Low stringency conditions were employed; accordingly, many PCR products were amplified and subsequently cloned and sequenced. Most of the clones 37  600  500 --  Uninhibited  Quinidine  Amiloride  Fig. 8 Sodium-dependence of the Na /Mg exchanger. Amiloride and quinidine were added, at concentrations of 5.0 mM and 4.0 mM, respectively, to the oocyte bath solution. N a uptake was measured +  2+  22  from oocytes loaded with 15 mM Mg . Each bar represents mean +/SEM, N=10 oocytes. 2+  38  400  T  350 --  Fig. 9 Stoichiometry of the N a / M g exchanger. Sodium influx measurements were compared to those for magnesium efflux from different experiments to generate an approximate ratio of cation exchange. Results are reported as mean +/S E M . A ratio of 1.65 N a : 1 M g was shown suggesting an electroneutral exchange. +  +  2+  2 +  39  contained vector sequences. Those clones that did not either contained several stop sequences and/or did not provide any useful information as they did not contain transmembrane- or nucleotide binding-like domains. Furthermore, low stringency Southern analysis of PCR products derived from mRNA or library cDNA did not reveal any homologous cDNA to the Na7Ca summary, homology-based studies were unsuccessful in identifying a N a 7 M g observations support the notion that a putative Na7Mg Na7Ca  2+  2+  2+  2+  exchanger. In  exchanger. These  exchanger may be quite different from the  exchanger and from the A B C transporter family.  Of interest, bands which were successfully detected by Southern analysis were of the same size as the positive NCE.F1 control amplified with the appropriate primer pairs. These results indicate of the presence of Na7Ca  2+  exchanger transcript in the erythroleukemia cells.  As is  discussed in greater detail below, these PCR products were cloned and, through sequencing, were found to be almost identical to portions of the Na7Ca  3.3  Na7Ca Exchange  3.3.1  Analysis of Na7Ca  2+  exchanger .  2+  2+  Exchanger Isoforms in Erythroleukemia Cells  The Na7Ca exchanger is composed of five ammo-terminal transmembrane domains, a large 2+  intracellular loop, followed by another six carboxyl transmembrane domains (82). As illustrated in Fig.3, the intracellular loop undergoes alternative splicing to produce multiple isoforms of the Na7Ca exchanger depending upon the tissue in which it is expressed. The portion of the Na7Ca 2+  2+  exchanger transcript which is alternatively spliced is comprised of two mutually exclusive exons, A and B, and four cassette type exons, C-F (Fig. 4). RT-PCR was performed with mRNA isolated from three erythroleukemia cell lines; human 40  (K-562 and HEL) and mouse (GM979). Nested primers were designed from conserved sequences flanking the alternatively spliced region (Fig.4) of NCE.F1 cDNA (73). As predicted, a product of approximately 350 bp was obtained from positive control NCE.F1 cDNA (Fig.lOA and 10B, lanes 2 and 1, respectively).  The other bands that were present probably represent nonspecific PCR  products. Amplified human K-562 mRNA resulted in three bands (Fig.lOA, lane 1) which were smaller than the positive control, with the middle band (- 280 bp) being most prominent. GM979 mouse cells, in which reverse transcription was initiated with a downstream primer rather than oligo dT, showed a single PCR band ~ 280 bp in size (Fig. 1 OB, lane 3). H E L mRNA RT-primed with oligo dT resulted in multiple bands (Fig. 1 OB, lane 4) of which the ~ 280 bp was most abundant. Although these bands were visible prior to the nested amplification reaction, the product was present in very small quantities (results not shown). This may suggest that Na7Ca  2+  exchanger transcript  is not abundant in undifferentiated erythroleukemia cells. No product was observed in the PCR tubes containing reaction mixtures without the cDNA template (Fig. 10A and 10B, lanes 3 and 2, respectively). Furthermore, since our primers spanned the entire splice region, i.e. exons A-F, the products obtained from our test samples did not arise from genomic D N A contamination. Although several products were present following RT-PCR of K-562, GM979, and H E L mRNA, Southern blot analysis showed only one major PCR product (~ 280 bp) that bound to the NCE.F1 probe (Figs. 11A and 1 IB, lanes 1 and 3,4 respectively). Subcloning and sequencing of RT-PCR products revealed only one isoform, N A C A 3 , in both the human and mouse erythroleukemia cell lines (Fig.4). Therefore, the other PCR products most likely represented nonspecific products. Multiple independent cDNA clones were sequenced to account for PCR extension mistakes. As illustrated in Fig. 12, the two human clones, K-562 and H E L , shared 100% 41  Fig. 10 RT-PCR amplification of the alternatively spliced region of K-562, H E L , and GM979 mRNA. NCE.F1 cDNA and reaction buffer were employed as positive (+) and negative (-) controls, respectively. The products were separated on a 0.8% agarose gel and visualized by ethidium bromide staining, (a) lane 1, K-562; lane 2, (+) control; lane 3, (-) control; (B) lane 1, (+) control; lane 2, (-) control; lane 3, GM979; lane 4, H E L . A band of - 350 bp is detected in the positive control lanes. Other bands present represent nonspecific products. Amplification using GM979 cDNA as template yields a single band of ~ 280 bp. The predominant band present in the H E L and K-562 lanes is ~ 280 bp in size. As expected, no product is amplified from the negative controls which are lacking the cDNA template.  42  A  1 2  B  3  1 2  3 4  350 bp 280 b p  Fig. 11 Southern blot analysis of RT-PCR products from K-562, H E L , and GM979 mRNA. RTPCR products were separated on a 0.8% agarose gel and transferred to Genescreen. Membranes were probed with [ P] dATP-labelled NCE.F1 cDNA. (A) lane 1, K-562; lane 2, (+) control; lane 3, (-) control; (B) lane 1, (+) control; lane 2, (-) control; lane 3, GM979; lane 4, H E L . As expected, in the positive control lane a - 350 bp product binds to NCE.F1 probe. A single band of - 280 bp is detected in the three erythroleukemia cell lines. 32  43  EXONB  rat kidney human HEL K-562 GM979  AAGATCATTACCATTAGAATATTTGACCGTGAGGAATATGAGAAAG AAGATCATTACCATTAGAATATTTGACCGTGAGGAATATGAGAAAG AAGATCATTACCATTAGAATATTTGACCGTGAGGAATATGAGAAAG AAGATCATTACCATTAGAATATTTGACCGTGAGGAATATGAGAAAG AAGATCATTACCATTAGAATATTTGACCGTGAGGAATATGAGAAAG  rat kidney human HEL K-562 GM979  AGTGCAGTTTCTCCCTTGTGCTTGAGGAACCAAAATGGATAAGAAG AGTGCAGTTTCTCCCTTGTGCTTGAGGAACCAAAATGGATAAGAAG AGTGCAGTTTCTCCCTTGTGCTTGAGGAACCAAAATGGATAAGAAG AGTGCAGTTTCTCCCTTGTGCTTGAGGAACCAAAATGGATAAGAAG AGTGCAGTTTCTCCCTTGTGCTTGAGGAACCAAAATGGCTAAGAAG  rat kidney human HEL K-562 GM979  AGGAATGAAAJGGTGGCTTCACATTAACA AGGAATGAAAJGGTGGCTTCACAATAACA AGGAATGAAAJGGTGGCTTCACAATAACA AGGAATGAAAJGGTGGCTTCACAATAACA AGGATTGAAAJGGTGGCTTCACATTAACA  EXOND  Fig. 12 Nucleotide sequence comparison of the N A C A 3 isoform cloned from H E L , K-562, and GM979 cells. The two exons comprising the variable region of N A C A 3 are B and D. The human K-562 and H E L cells are identical to the reported human B and D exon sequences (Genbank Accession numbers X91614 and X91214, respectively). Underlined bases denote substitutions between mouse GM979 cells and rat kidney NCE.F1 cDNA (23). The GM979 mouse clone shares 98% nucleotide and 95% amino acid sequence identity with the rat exchanger. Conserved amino acid substitutions are present in GM979 cells, with the two changes being isoleucine to leucine and methionine to leucine, respectively.  44  identity at the nucleotide level to the reported human exon B and D sequences (Genbank Accession numbers X91614 and X91214, respectively). The cDNA sequence of the GM979 mouse cell line shared 98% nucleotide and 95% amino acid homologies to exons B and D of the published rat NCE.F1 cDNA (69). The full-length mouse Na7Ca  45  2+  exchanger cDNA has not been reported.  Chapter Four 4.1  Na7Mg  Discussion 2+  Exchange  Erythrocyte magnesium content is an essential modulator of R B C volume and volume regulatory mechanisms.  This cation acts by modulating the activity of the Na/K/Cl and K / C l  cotransporters (27,37,72). Magnesium's role in the modulation of volume regulatory processes may be relevant to some pathological states. In human sickle cell disease (SCD), RBCs homozygous for abnormal hemoglobin undergo cellular dehydration (16).  Normally, cell maturation and aging  render the K / C l cotransporter silent (56) but in RBCs of patients with sickle cell disease, there are high levels of K/Cl cotransport (14,16), causing low density erythrocytes to quickly dehydrate and become dense and nonfunctional (27). The characteristics of these cells were investigated by Brugnara et al. and were found to be similar to low-K sheep RBCs with respect to volume +  dependency and M g  2+  an increase in cell M g  sensitivity (15). K/Cl cotransport is sensitive to cell M g 2+  2 +  concentration; i.e.  induces marked inhibition of K/Cl cotransport (72). Accordingly, methods  which aim at increasing erythrocyte magnesium content could inhibit sickle cell dehydration by inhibiting K / C l cotransport. In a transgenic mouse model for sickle cell disease (SAD 1) highmagnesium diets increased erythrocyte magnesium and potassium contents and reduced K/Cl cotransport activity. This was associated with lower levels of R B C dehydration, less K loss, and +  decreased cell density and reticulocyte counts, suggesting amelioration of the disease. SAD 1 mice treated with a magnesium deficient diet demonstrated a reduction in erythrocyte M g  2 +  and K  +  contents and increases in K/Cl cotransport, RBC density, reticulocyte count, and R B C dehydration, suggesting a deteriorating disease state (27). These effects were most likely mediated by increased K / C l cotransport.  Therefore, in these mice changes in dietary magnesium modulated K/Cl 46  cotransport and cell volume. There have been other reports implicating changes in [Mg ] in 2+  ;  patients with SCD compared with control individuals (85,87).  Thus, dietary magnesium  supplementation may be a potential therapeutic strategy to prevent cell dehydration and sickling in diseased patients. Although magnesium is an essential intracellular cation, little is known about magnesium transport and regulation of cytosolic magnesium.  Molecular characterization of the involved  protein(s) would provide the basis for a much better understanding of both the mechanisms of M g  2+  transport and the regulation of intracellular M g  2+  2 +  metabolism. To directly demonstrate N a / M g +  exchange we expressed poly (A) R N A of erythroid origin in Xenopus laevis oocytes. Xenopus +  oocytes are widely used to express plasma membrane proteins encoded in exogenously injected RNA or D N A and used to characterize properties of the expressed receptors, transporters, and channels (19,26,100). However, these heterologous expressed transport proteins have to be differentiated from the endogenous ones present in the native oocyte. Through functional studies we were able to detect expression of sodium-dependent magnesium transport in mRNA injected oocytes. The exchange observed was dependent on the amount of mRNA injected in the oocyte. Studies suggest that with mRNA coding for non-secretory proteins, the amounts of protein synthesized increases with the amount of mRNA injected in the oocyte and that at least up to 100 ng may be injected per oocyte. With high concentrations of injected mRNA, however, there can be significant mRNA degradation resulting in non-linear increases in transport (19). This is possibly what was observed in our studies because the maximal N a influx observed was with 50 ng of injected mRNA and no +  further stimulation was observed at 80 ng (Fig. 5). The properties of N a 7 M g  2+  exchange expressed in Xenopus oocytes from erythroleukemia 47  cells were similar to those reported for intact erythrocytes (36). First, the level of transport was dependent on the intraoocyte concentration of M g , with maximal magnesium efflux observed when 2+  oocytes were loaded to a final concentration of about 15 mM M g  2+  (Fig. 7). This result is in keeping  with other studies of red cells where transport was undetectable if intact cells were not loaded with magnesium prior to experimental determinations (54). Interestingly, the maximal [Mg ] required 2+  f  to demonstrate exchange was about 15 mM for both RBCs (54,55) and oocytes (data given here). Another common property was the dependence of magnesium transport on extracellular sodium. Magnesium efflux in oocytes was sensitive to high concentrations of the sodium transport inhibitors amiloride and quinidine (5.0 and 4.0 mM, respectively). The degree of inhibition observed at these concentrations (>50%) was comparable to that observed in RBCs (38,111). In summary, the cardinal features of the Na7Mg exchanger proteins which have been reported for red blood cells also hold 2+  true for the expressed proteins underlying magnesium exchange in the mRNA-injected Xenopus oocytes. The results suggest that the injected poly (A) R N A corresponds to protein(s) which +  provide a basis for magneisum transport at least in RBCs. Our results demonstrate high levels of endogenous transport in water-injected oocytes (Fig. 5). This endogenous transport may be accounted for by non-specific M g  2 +  leak from the oocyte.  Other transport mechanisms, aside from the exchanger, which are specific to magnesium, such as a Mg -specific channel or pump, may also exist. Therefore, it is possible that the poly (A) R N A 2+  +  responsible for expression may act by directing the synthesis of regulatory proteins not directly involved with transport. These proteins may possess a stimulatory effect on endogenous N a 7 M g  2+  transport present in the Xenopus oocyte. While this possibility seems unlikely, it cannot be ruled out at present. Also unknown is whether the expressed protein(s) involved in N a 7 M g 48  2+  exchange is  modulated by endogenous components, such as intracellular ATP, or whether it requires components encoded with the injected RNA. Some reports have suggested there may be similarities between the N a / M g +  2+  and Na7Ca  2+  exchangers (53), and that they may share common features. However, the studies involving homology-based RT-PCR with transmembrane regions of the Na7Ca  2+  exchanger were without  success. This domain would be expected to posses the most similarity between the two exchangers These results suggest that these exchangers may be quite different in nature. This is the first demonstration of magnesium transport elicited via expression studies. The role of this exchanger in magnesium transport and cell metabolism remains to be fully determined. Intracellular magnesium is a highly mobile cation moving in and out of the cell relatively rapidly therefore the exchanger may play a role in cellular magnesium regulation. In erythroid cells, Na7Mg exchange is likely to be involved with cell volume regulation. In the kidney, basolaterally 2+  located N a / M g +  exchange may play a role in transporting magnesium across the basolateral  2+  membrane. Our understanding of how M g  2+  moves across membranes will not be clear until the  transport proteins are identified. The present studies show that it may be possible to expressionclone the N a 7 M g  4.2  2+  exchanger.  Na7Ca Exchange 2+  Multipotent hemopoietic cell lines, that can be induced to mature into stable phenotypes, have been extensively used as model systems for studying the regulation of gene expression during proliferation and differentiation (8,60,84). The undifferentiated K-562, H E L , and GM979 cell lines are pluripotent cells which express specific markers of erythroid, myeloid, and megakaryocyte 49  lineage. Changes in cytosolic C a  2+  concentration have been suggested to play a pivitol role in  committing these progenitor cells to differentiation (44,59). Erythropoietin, a growth factor that controls erythropoiesis, is among the array of promoters which initiate changes in cytosolic C a these cells (20,81). Cytosolic C a  2+  is controlled by a balance of influx through C a  efflux either by an ATP-dependent C a  2+  pump or a Na7Ca  2+  2+  2+  in  channels and  exchanger (20,86). Although there is  some controversy as to the presence of Na7Ca exchange in red blood cells (43,108), it is clear from 2+  the present studies that the exchanger is expressed in the above cell lines. The role of this exchanger in erythroid cells, whether to allow C a  2+  influx or to maintain cytosolic C a  2+  through efflux is not  clear (102). The genes reported to code the Na7Ca  2+  exchanger of various tissues and species  demonstrate a remarkable similarity in cDNA sequence. There appears to be >90% homology among the many species studies so far, i.e., dog (82), rat (76,113), cow (1), rabbit (69), and humans (67,70). Kofuji et al. showed that six different alternatively spliced isoforms accounted for the Na7Ca exchangers found in rabbit tissues including heart, brain, kidney, and skeletal muscle (69). 2+  Cardiac tissue contains the exons A,C,D,E,F; the brain contains A,D,F or A , C , D or A,D; skeletal muscle contains B,D,F or A,C,D,E,F, and the kidney and intestine contain B,D,F or B,D exons (69,73). The kidney may also contain B,C,D (97) (Fig. 4). On balance, the evidence indicates that Na7Ca  2+  exchange is present in red blood cells, but to date no reports have been published on the  characterization of the molecular isoform expressed in these cells (43,108). Southern analysis of PCR products from GM979, H E L , and K-562 cells was used to determine the presence of Na7Ca  2+  exchanger transcripts. One cDNA fragment (~ 280 bp) was  amplified from GM979 cells and detected by Southern analysis. Although several fragments were 50  amplified from the two human cell lines, only one clear product (- 280 bp) was found to bind the Na7Ca exchanger probe. The primers used in PCR were designed from the regions flanking the 2+  alternative splice site. Therefore, products of a different size than the control could be expected if the region amplified represented exons other than those in the positive control (B,D,F). This was the case with the - 280 bp product that, when sequenced, was shown to represent exons B and D which is consistent with the N A C A 3 isoform. In this study, we show that the two human K-562, H E L and one mouse GM979 erythroleukemia cell lines express the N A C A3 isoform consisting of exons B and D. Interestingly, the isoform identified is the same alternatively spliced variant that was found in epithelial cells within the renal nephron (25,68) (Fig. 4). The Na7Ca involved with maintaining cytosolic C a  2+  2+  exchanger expressed in kidney epithelia is  and calcium homeostasis (113). It is likely that the same  isoform of the exchanger plays a role in controlling cytosolic C a associated differentiation of RBCs.  51  2+  levels and C a  2+  signalling in the  Chapter Five  Summary and Conclusions  By employing an oocyte expression system, we were able to advance from conventional studies involving functional assays, methods which are currently employed by others to characterize Na7Mg  2+  exchange. The objective of this research was first to show that the exchanger may be  expressed in Xenopus oocytes. This may allow future studies through which the cDNA coding the Na7Mg exchanger could be identified. Secondly, we were interested to determine if the Na /Mg 2+  +  exchanger was similar to the Na7Ca  2+  2+  exchanger. Our studies with homology based PCR suggest  that these two exchangers are coded by different D N A and are probably different proteins. Employing oocyte expression of exogenous R N A and RT-PCR, we were able to express Na7Mg  2+  exchange from these erythroleukemia cells and demonstrate the presence of Na7Ca  2+  exchanger transcripts in these cells, respectively. RBCs have been shown to possess a functional Na7Mg  2+  exchanger but the presence of Na7Ca  2+  exchanger is controversial.  Our results  demonstrate that both exchangers are present in erythroleukemia cells which may reflect cation transport in mature red blood cells. These two exchangers undoubtedly play essential roles in cells of erythroid origin. N a 7 M g  2+  exchange most likely regulates intracellular M g  2 +  concentrations  which, in turn, modulates other activities such as enzyme activation and cell volume regulation. Na7Ca  2+  exchange is likely to be involved with cytosolic C a  2+  control and signalling during  differentiation of erythroid cells. The role of these exchangers in diseases such as sickle cell disease and abnormal erythroid cell differentiation is unknown but would be better understood by identifying the protein(s) involved with transport.  52  Aceto, J.F., M . Condrescu, C. Kroupis, H. Nelson, N . Nicoll, K.D.Philipson, and J. Reeves. Cloning and expression of the bovine cardiac sodium-calcium exchanger. Arch. Biochem. Biophys. 298:553-560, 1992. Alberts, B., D. Bray, J. Lewis, M . Raff, K. Roberts, and J.D. Watson. Molecular biology of the Cell, Second Edition, Garland Publishing Inc., pp275-340, 1989. Altamirano, A-A., and L . Beauge. Calcium transport mechanism in dog red blood cells studied from measurements of initial flux rates. Cell Calcium 6:503-525, 1985. Anath, J., and R. Yassa. Magnesium in mental illness. Comprehensive Psych. 20:475-482, 1979. Auger, V . , and G.A. Quamme. Expression of sodium-dependent magnesium transport in Xenopus laevis oocytes. J. Am. Soc. Nephrol. 7:1798(abstract), 1996. Baker, P.F., M.P. Blaustein, A . C . Hodgkin, and R. Steinhardt. The influence of calcium on sodium efflux in squid axons. J. Physiol. 200:431-458, 1969. Baker, P.F., and A . C . Crawford. Mobility and transport of magnesium in squid giant axon. J. Physiol. (Lond.) 337:351-371, 1972. Beug, H . , S. Palmieri, C. Freudenstein, H . Zentgraf, and T. Graf: Hormone-dependent terminal differentiation in vitro of erythroleukemic cells transformed by its mutants of anion erythroblastosis virus. Cell 28:907-919, 1982. Beyenbach, K.W. Transport of magnesium across biological membranes. Mag. Trace Elements 9:233-254, 1990. Blatter, L . A . Intracellular free magnesium in frog skeletal muscle studied with a new type of magnesium-selective microelectrode: interactions between magneisum and sodium in the regulation of [Mg];. Pflugers Arch. 416:238-246, 1990. Blaustein, M . , R. Dipolo, and J.P. Reeves. Sodium-calcium exchange. Ann. N. Y. Acad. Sci. 639:1-671, 1991. Blatter, L.A. Estimation of intracellular free magnesium using ion-selective microelectrodes: evidence for an Na/Mg exchange mechanism in skeletal muscle. Magnes. Trace Elem. 92:6779, 1991. Borgese, F., C. Sardet, M . Cappadoro, J. Pouyssegur, and R. Motais. Cloning and expression 53  of a cAMP-activated N a 7 H exchanger: evidence that the cytoplasmic domain mediates hormonal regulation. Proc. Natl. Acad. Sci. USA 89:6765-6769, 1992.. +  14.  Brugnara, C , A.S. Kopin, H.F. Bunn, and D.C. Tosteson. Regulation of cation content and cell volume in hemoglobin erythrocytes from patients with homozygous hemoglobin C disease. J. Clin. Invest. 75:1608-1617, 1985.  15.  Brugnara, C , and D.C. Tosteson. Inhibition of K transport by divalent cations in sickle erythrocytes. Blood 70:1810-1815, 1987.  16.  Canessa, M . , M.E. Fabry, N. Blumenfeld, and R.L. Nagel. Volume-stimulated, Cl-dependent K+ efflux is highly expressed in young human red cells containing normal hemoglobin or HbS. J. Membrane Biol. 97:97-105, 1987.  17.  Carafoli, E. The C a pump of the plasma membrane. J. Biol. Chem. 267:2115-2118,1992.  18.  Caroni, P., and E. Carafoli. The regulation of the Na -Ca Eur. J. Biochem. 132:451-460, 1983.  19.  Ceriotti, A., and A. Colman. mRNA translation in Xenopus oocytes. Methods in Mol. Biol. 37:151-178, 1995.  20.  Cheung, J.Y., M.B. Elensky, U. Brauneis, R.C. Scaduto Jr, L . C . Bell, D.C. Tilloston, and B.A. Miller: Ion channels in human erythroblasts: modulation by erythropoietin. J. Clin. Invest. 90:1850-1856, 1992.  21.  Chomczynski, P. One-hour downward alkaline capillary transfer for blotting of DNA and RNA. Anal. Chem. 201:134-139, 1992.  2+  +  2+  exchanger of heart sarcolemma.  22. Condrescu, M . , J.P. Gardner, G. Chernaya, J.F. Aceto, C. Kroupis, and J.P. Reeves. ATPdependent regulation of sodium-calcium exchange in Chinese hamster ovary cells transfected with the bovine cardiac sodium calcium exchanger. J. Biol Chem. 270:9137-9146, 1995. 23.  Dai, L.-J., and G. A. Quamme. Intracellular M g and magnesium depletion in isolated renal thick ascending limb cells. J. Clin. Invest. 88:1255-1264, 1991.  24.  Dai, L.-J., G. Ritchie, B. Bapty, V . Auger, and G.A. Quamme. Modulation of Na7Ca exchange in epithelial cells of porcine thick ascending limb. Am. J. Physiol. 270 {Renal Fluid Electrolyte Physiol. 39): F953-F959, 1996.  25.  Dai, .L-J., G . Ritchie, B. Bapty, L. Raymond, and G. A . Quamme. Na7Ca exchanger in epithelial cells of the porcine cortical thick ascending limb. Am. J. Physiol. 270(Renal Fluid and Electrolyte Physiol.): F411-F418, 1996.  2+  2+  2+  54  26.  Dascal. N . The use of Xenopus oocytes for the study of ion channels. CRC Critical Rev. in Biochem. 22:317-387, 1987.  27.  De Franceschi, L . , Y . Beuzard, H . Jouault, and C. Brugnara. Modulation of erythrocyte potassium chloride cotransport, potassium content, and density by dietary magnesium intake in transgenic SAD mouse. Blood 88:2738-2744, 1996.  28.  Delpire, E., and P.K. Lauf. Magnesium and A T P dependence of K - C l cotranport in low K sheep red blood cells. J Physiol. (Lond.) 441:219-231, 1991.  29.  De Rouffignac, C , and G.A. Quamme. Renal magnesium handling and its hormonal control. Physiol. Rev. 74:305-322, 1994.  30.  DeWeer, P. Axoplasmic free magnesium levels and magnesium extrusion from squid giant axons. J Gen. Physiol. 68:159-178, 1976.  31.  DiPolo, R., and Beauge. A n ATP-dependent N a 7 M g countertransport is the only mechanism for Mg extrusion in squid axons. Bioch. Biophys. Acta 946:424-428, 1988.  32.  Feray, J.C., and R. Garay. A n Na -stimulated Mg -transport system in human red blood cells. Biochim. Biophys. Acta 856:76-84, 1986.  33.  Feray, J.C., and R. Garay. A one-to-one M n Chem. 262:5763-5768, 1987.  34.  Feray, J.C., and R. Garay. Demonstration of a Na : M g exchange in human red cells by its sensitivity to tricyclic antidepressant drugs. Arch. Pharm. 338:332-337, 1988.  35.  Flatman, P.W. Magnesium transport across cell membranes. J. Membr. Biol. 80:1-14, 1984.  36.  Flatman, P.W. Mechanisms of magnesium transport. Annu. Rev. Physiol. 53:259-271, 1991.  37.  Flatman, P.W. The effects of magnesium on potassium transport in ferret red cells. J. Physiol. (Lond.) 397:471-487, 1988.  38.  Flatman, P.W., and L . M . Smith. Magnesium transport in ferret red cells. J. Physiol. 431:1125, 1990.  39.  Flatman, P.W., and L . M . Smith. Sodium-dependent magnesium uptake by ferret red cells. J. Physiol.(Lond.) 443:217-230, 1991.  40.  Frenkel, E.J., M . Graziani, and H.J. Schatzmann. ATP requirement of the sodium-dependent magnesium extrusion from human red blood cells. J. Physiol. (Lond.) 414:385-397, 1989.  +  2+  +  2+  2+  : Mg  +  55  2+  exchange in rat erythrocytes. J. Biol.  2+  41.  Furman, I., O. Cook, J. Kasir, and H. Rahamimoff. Cloning of two isoforms of the rat brain Na7Ca exchanger gene and their functional expression in HeLa cells. FEBS Lett. 319:105109, 1993. 2+  42.  Furukawa, K.-I., N. Ohshima, Y. Tawada-Iwata, and M . Shigekawa. Cyclic GMP stimulates N a 7 C a exchange in vascular smooth muscle in porcine cell lines. J. Biol. Chem. 266:12337-12341, 1991. 2+  43.  Gardner, J.P., and M . Balasubramanyam. Na-Ca exchange in circulating blood cells. Annals. NY Acad. Sci. 779:502-514, 1996.  44.  Gillo, B., Y.-S. Ma, and A.R. Marks. Calcium influx in induced differentiation of murine erythroleukemia cells. Blood 81:783-792, 1993.  45.  Gunther, T., and V . Hollriegl. Na - and anion- dependent M g hepatocytes. Biochim. Biophys. Acata 1149:49-54, 1993.  46.  Gunther, T., and J. Vormann. M g efflux is accomplished by an amiloride-sensitive N a 7 M g antiport. Biochem. and Biophys. Res. Comm. 130:540-545,1985.  +  2 +  influx in isolated  2 +  2+  47.  Gunther, T., and J. Vormann. Removal and reuptake of intracellular magnesium. Magnesium Bull. 2:66-69, 1985.  48.  Gunther, T., and J. Vormann. Probable role of protein phosphorylation in the regulation of M g efflux via N a 7 M g antiport. Magnesium Bull. 8:307-309, 1986. 2 +  2+  49.  Gunther, T., and J. Vormann. Characterization of Na7Mg antiport by simultaneous M g influx. Biochem. and Biophys. Res. Comm. 148:1069-1074, 1987.  50.  Gunther, T., and J. Vormann. Characterization of M g erythrocytes. FEBS Lett. 250:633-637, 1989.  51.  Gunther, T., and J. Vormann. Na -dependent M g efflux from Mg -loaded rat thymocytes and HL60 cells. Magnes. Trace Elem. 9:279-282, 1990.  52.  Gunther, T., and J. Vormann. Intracellular C a - M g 17:279-286,1994.  53.  Gunther, T., and J. Vormann. Reversibility of Na7Mg Biophys. Acta 1234:105-110, 1995.  54.  Gunther, T., J. Vormann, and R. Forster. Regulation of intracellular magnesium by M g efflux. Biochem. and Biophys. Res. Comm. 119:124-131, 1984.  2+  +  2+  2+  2+  56  2 8  2 +  efflux from human, rat and chicken  2+  2+  interactions. Renal Physiol. Biochem.  2+  antiport in rat erythrocytes. Biochim.  2+  55.  Giinther, T., J. Vormann, and V . HoTlriegl. Characterization of Na -dependent M g from Mg -loaded rat erythrocytes. Biochim. Biophys. Acta 1023:455-461, 1990. +  2+  efflux  2+  56.  Hall, A . C , and J.C. Ellroy. Evidence for the presence of volume-sensitive KC1 transport in 'young' human red cells. Biochim. Biophys. Acta 858:317-320, 1986.  57.  Harrison, P.R. Analysis of erythropoiesis at the molecular level. Nature 262:353-356, 1976.  58.  Haworth, R.A., and A . B . Goknur. A T P dependence of calcium uptake by the Na-Ca exchanger of adult heart cells. Circ. Res. 71:210-217, 1992.  59.  Hensold, J.O., G. Dubyak, and D . E . Housman. Calcium ionophore, A23187, induces commitment to differentiation but inhibits the subsequent expression of erythroid genes in murine erythroleukemia cells. Blood 77:1362-1370, 1991.  60.  Igarashi, K., K. Kataoka, K. Itoh, N. Hayashi, M . Nishizava, and M . Yamamoto. Regulation of transcription by dimerization of erythroid factor NF-E2 p45 with small Maf proteins. Nature 367:568-572, 1994.  61.  Iwamoto, T., S. Wakabayashi, and M . Shigekawa. Growth factor-induced phosphorylation and activation of aortic smooth muscle Na7Ca exchanger. J. Biol. Chem. 270:8996-9001, 1995. 2+  62.  Jayakumar, A., L. Cheng, C.T. Liang, and B. Sacktor. Sodium gradient-dependent calcium uptake in renal basolateral membrane vesicles. J. Biol. Chem. 259:10827-10833, 1984.  63.  Jennings, M . L . , and N . Al-Rohil. Kinetics of activation and inactivation of swellingstimulated K7CT transport. J. Gen. Phyiol. 95:1021-1040, 1990.  64.  Jennings, M.L., and R.K. Schulz. Swelling-activated KC1 cotransport in rabbit red cells:flux is determined mainly by cell volume rather than shape. Am. J. Physiol. 259 (Cell Physiol. 28):C960-C967, 1990.  65.  Kaczorowski, G.J., R.S. Slaughter, V.F. King, and M . L . Garcia. Inhibitors of sodiumcalcium exchange: identification and development of probes of transport activity. Biochim. Biophys. Acta 988:287-302,1989.  66.  Kelepouris, E., R. Kasama, and Z. S. Agus. Effects of intracellular magnesium on calcium, potassium and chloride channels. Miner. Electrolyte Metab. 19:277-281, 1993.  67.  Kofuji, P., R.W. Hadley, R.S. Kieval, W.J. Lederer, and D.H. Schulze. Expression of the NaCa exchanger in diverse tissues: a study using the cloned human cardie Na-Ca exchanger. Am. J. Physiol. 263 (Cell Physiol. 32):C1241-C1249,1992. 57  68.  Kofuji, P., W.J. Lederer, and D.H. Schulze. Na7Ca exchanger isoforms expressed in kidney. Am. J. Physiol. 265 (Renal Fluid Electrolyte Physiol. 34):F598-F603, 1993.  69.  Kofuji, P., W.J. Lederer, and D.H. Schulze. Mutually exclusive cassette exons underline alternatively spliced isoforms of the Na7Ca exchanger. J. Biol. Cham. 269:5145-5149, 1994.  2+  2+  70.  Komuru, I., K . E . Wenninger, K . D . Philipson, and S. Izumo. Molecular cloning and characterization of the human cardiac Na7Ca exchanger cDNA. Proc. Natl. Acad. Sc. USA 89:4769-4773, 1992. 2+  71.  Lagnado, L . , and P.A. McNaughton. Electrogenic properties of the Na:Ca exchange. J. Memb. Biol. 113:177-191, 1990.  72.  Lauf, P.K., J. Bauer, N.C. Adragna, H . Fujise, A . M . M . Zade-Oppen, K . H . Ryu, and E . Deplire. Erythrocyte K - C l cotransport: properties and regulation. Am. J. Physiol. 263 (Cell Physiol. 32):C917-932, 1992.  73.  Lee, S.-L., A.S.L. Yu, and J. Lytton. Tissue-specific expression of Na7Ca isoforms. J. Biol. Chem. 269:14849-14852, 1994.  74.  Levenson, R., D. Housman, and L. Cantley. Amiloride inhibits murine erythroleukemia cell differentiation: evidence for C a requirement. Proc. Natl. Acad. Sci. USA 77:5948-5952, 1980.  2+  exchanger  2+  75.  Loo, T.W., and D . M . Clarke. Functional expression of human renal Na7Ca exchanger in insect cells. Am. J. Physiol. 267 (Renal Fluid Electrolyte Physiol. 36):F70-74, 1994.  76.  Low, W., J. Kasir, and H. Rahamimoff. Cloning of the rat heart N a - C a functional expression in HeLa cells. FEBS Lett. 316:63-67, 1993.  77.  Luciani, M.F., F. Denizot, S. Savary, M . G . Mattei, and G. Chimini. Cloning of two novel A B C transporters mapping on human chromosome 9. Genomics 21:150-159, 1994.  78.  Ludi, H., and H.J. Shatzmann. Some properties of a system for sodium-dependent outward movement of magnesium from metabolizing human red blood cells. J. Physiol. (Lond.) 390:367-382, 1987.  79.  Marks, P., and R. Rifkind. Erythroleukemic differentiation. Annu. Rev. Biochem. 47:419-448, 1978.  80.  Milanick, M.A. Na/Ca exchange in ferret red blood cells. Am. J. Physiol. 256 (Cell Physiol. 25):C390-C398, 1989.  2+  +  58  2+  exchanger and its  81.  Miller, B.A., J.Y. Cheung, D.L. Tillotson, S.M. Hope, and R.C. Scaduto Jr. Erythropoietin stimulates a rise in intracellular-free calcium concentration in single B F U - E derived erythroblasts at specific stages of differentiation. Blood 73:1188-1194, 1989.  82.  Nicoll, D.A., S. Longoni, and K.D. Philipson. Molecular cloning and functional expression of the cardiac sarcolemmal Na7Ca exchanger. Science Wash. D.C. 250:562-565, 1990. 2+  83.  Nicoll, D.A., B.D. Quednau, Z. Qui, Y.-R. Xia, A.J. Lusis, and K.D. Philipson. Cloning of a third mammalian Na -Ca exchanger, NCX3. J. Biol. Chem. 271:24914-24921, 1996. +  2+  84.  Oishi, M . , and T. Watanabe. A mechanism of differentiation. II (Fisher PB ed.) pp 129-141. C R C Press Inc. Boca Raton FL, 1990.  85.  Olukoga, A.O., H.O. Adewoye, R.T. Erasmus, and M.A. Adedoyin. Erythrocyte and plasma magnesium in sickle-cell anemia. East Afr. Med. J. 67:348-354, 1990.  86.  Ortiz, O., and R.A. Sjodin. Sodium and adenosine-triphosphate-dependent calcium movements in membrane vesicles prepared from dog erythrocytes. J. Physiol. (Lond.) 354:287-301, 1984.  87.  Ortiz, O.E., V . L . Lew, and R.M. Bookchin. Deoxygenation permeabilizes sickle cell anemia red cells to magnesium and reverses its gradient in the dense cells. J. Physiol. (Lond.) 427:211-226,1990.  88.  Ortiz-Carranza, O., N . C . Adragna, and P.K. Lauf. Modulation of K - C l cotransport in volume-clamped low-K sheep erythrocytes by pH, magnesium, and ATP. Am. J. Physiol. 271 (Cell P/nwo/. 40):C1049-1058, 1996.  89.  Palmer, L . G . Renal ion channels. In:E.E. Windhager, ed. Renal Physiolgy, Oxford University Press, pp 715-738, 1992.  90.  Parker, J.C. Sodium and calcium movements in dog red cells. J. Gen. Physiol. 71:1-17,1978.  91.  Parker, J . C , T.J. McManus, L.C. Starke, and H.J. Gitelman. Coordinated regulation of Na/H exchange and [K-Cl] cotransport in dog red cells. J. Gen. Phyiol. 95:1141-1152, 1990.  92.  Quamme, G.A., and L.-J. Dai. Presence of a novel influx pathway for M g Am. J. Physiol. 259 (Cell Physiol. 28):C521-C525, 1990.  93.  Ramachandran, C , and M . G . Brunette. The renal Na7Ca exchange system is located exclusively in the distal tubule. Biochem. J. 257:259-264, 1989.  94.  Rasmussen, H. The calcium messenger system. N. Engl. J. Med. 314:1044-1101, 1986.  2 +  in M D C K cells.  2+  59  95.  Reeves, J.P., M . Condrescu, G. Chemaya, and J.P. Gardner. Na7Ca mammalian heart. J. Exp. Biol. 196:375-388, 1994.  96.  Reeves, J.P., and C.C. Hale. The stoichiometry of the cardiac sodium-calcium exchanger system. J. Biol. Chem. 259:7733-7739, 1984.  97.  Reilly, R.F., and C A Shugrue. cDNA cloning of a renal Na -Ca exchanger. Am. J. Physiol. 262(Renal Fluid Electrolyte Physiol. 31):F1105-F1109, 1992.  98.  Rouse, D., and W.N. Suki. Renal handling of calcium. In: S.G. Massry and R.J. Glassock, ed. Textbook of Nephrology, Third Edition, Williams & Wilkins, pp 3390344, 1995.  99.  Schatzmann, H.J. Asymetry of the magnesium sodium exchange across the human red cell membrane. Biochim. Biophys. Acta 1148:15-18, 1993.  100.  Sheu, S.S., V . K . Sharma, and A . Uglesity. Na -Ca exchange contributes to increase of cytosolic C a concentration during depolarization in heart muscle. Am. J. Physiol. 250 (Cell Physiol. 19):C651-656, 1986.  +  +  2+  antiport in the  2+  2+  2+  101.  Sigel, E. Use of Xenopus oocytes for the functional expression of plasma membrane proteins. J. Membr. Biol. 117:201-221, 1990.  102.  Smith, R.L., I.G. Macara, R. Levenson, D. Housman, and L . Cantley. Evidence that a Na7Ca antiport system regulates murine erythroleukemia cell differentiation. J. Biol. Chem. 257:773-780, 1982. 2+  103.  Smith, J.B., E.J. Cragoe, and L. Smith.Na7Ca antiport in cultured arterial smooth muscle cells. Inhibition by magnesium and other divalent cations. J. Biol. Chem. 262:11988-11994, 1987.  104.  Smith, J.B., and L . Smith. Energy dependence of sodium-calcium exchange in vascular smooth muscle cells. Am. J. Physiol. 252 (Cell Physiol. ):C302-C309, 1990.  105.  Starke, L . C . , and T.J. McManus. Intracellular free magnesium determines the volume regulatory set point in duck red cells. FASEB J. 4:A818, 1990.  106.  Stout, A . K . , Y . Li-Smerin, J.W. Johnson, and I.J. Reynolds. Mechanisms of glutamatestimulated M g influx and subesequent M g efflux in rat forebrain neurons in culture. J. Physiol. (Lond.) 492:641-657, 1996.  2+  2 +  107.  2 +  Talor, Z., and J.A.L. Arruda. Partial purification and reconstitution of renal basolateral Na C a exchanger into liposomes. J. Biol. Chem. 260:15473-15476, 1985. +  2+  60  108.  Varecka, L., and E. Carafoli. Vanadate-induced movements of C a blood cells. J. Biol. Chem. 257:7414-7'421, 1982.  109.  Vigne, P., J.-P. Breittmayer, D. Duval, C. Frelin, and M . Lazdunski. The Na/Ca antiporter in aortic in aortic smooth muscle cells. Characterization and demonstration of an activation by phorbol esters. J. Biol. Chem. 263:8078-8083, 1988.  110.  Willis, J.S., W. Xu, Z. Zhao. Diversities of transport of sodium in rodent red cells. Comp. Biochem. Physiol. [A] 102:609-614, 1992.  111.  Xu, W., and J.S. Willis. Sodium transport through the amiloride-sensitive Na-Mg pathway of hamster red cells. J. Memb. Biol. 141:277-287, 1994.  112.  Yoshimura, M . , T. Oshima, H. Matsuura, M . Watanabe, Y . Higashi, N . Ono, H. Hiraga, M . Kambe, and G. Kajiyama. Effect of the transmembrane gradient of magnesium and sodium on the regulation of cytosolic free magnesium concentration in human platelets. Clinical Science 89:293-298, 1995.  113.  Yu, A.S.L., S.C. Hebert, S.-L. Lee, B . M . Brenner, and J. Lytton. Identification and localization of renal Na -Ca exchanger by polymerase chain reaction. Am. J. Physiol. 263 (Renal Fluid Electrolyte Physiol. 32):F680-F685, 1992. +  114.  2+  and K in human red +  2+  Zhang, G . H . , and J.E. Melvin. Regualtion of extracellular N a of cytosolic concentration in Mg -loaded rat sublingual acini. FEBS Lett. 371:52-56, 1995. +  2+  61  Mg  2+  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0087717/manifest

Comment

Related Items