UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Characterization of mouse CD43 recombinant proteins secreted by EL4, CTL2c, CTLL and NSF60 cells Yang, Jeanne Chi-Mei 1996

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1997-0087.pdf [ 9.5MB ]
Metadata
JSON: 831-1.0087606.json
JSON-LD: 831-1.0087606-ld.json
RDF/XML (Pretty): 831-1.0087606-rdf.xml
RDF/JSON: 831-1.0087606-rdf.json
Turtle: 831-1.0087606-turtle.txt
N-Triples: 831-1.0087606-rdf-ntriples.txt
Original Record: 831-1.0087606-source.json
Full Text
831-1.0087606-fulltext.txt
Citation
831-1.0087606.ris

Full Text

CHARACTERIZATION  OF MOUSE CD43 RECOMBINANT PROTEINS  SECRETED BY EL4, CTL2c, CTLL AND NSF60 CELLS BY JEANNE CHI-MEI YANG B.Sc, McGILL UNIVERSITY, 1993 A THESIS S U B M I T T E D I N P A R T I A L F U L F I L L M E N T O F THE REQUIREMENT FOR THE DEGREE OF MASTER OF SCIENCE IN" T H E F A C U L T Y O F G R A D U A T E STUDIES (DEPARTMENT OF MEDICINE, M O L E C U L A R BIOLOGY)  ^wpk accept this thesis as conforming to thejeqaircd standard  T H E UNIVERSITY OF BRITISH C O L U M B I A  December 1996 © JEANNE CHI-MEI Y A N G ,  1996  In presenting this thesis in partial fulfilment  of the  requirements for an advanced  degree at the University of British Columbia, I agree that the Library shall make it freely available for reference and study; I further agree that permission for extensive copying of this thesis for scholarly purposes may be granted by the head of my department  or by his  or  her  representatives.  It  is  understood  that  copying or  publication of this thesis for financial gain shall not be allowed without my written permission.  Department of The University of British Columbia Vancouver, Canada Date  DE-6 (2788)  ^st...^€)  r  <f£,  ,:  ABSTRACT Leukosialin (CD43) is a heavily glycosylated mucin-type acidic cell surface protein, carrying 70-80 O-glycans. The molecular weight heterogeneity of both human and murine CD43 glycoforms are due to the variation in their O-linked glycans. There are two major CD43 glycoforms. Resting T cells express predominantly a 115 kDa glycoform of CD43, carrying mainly tetrasaccharide side chains, whereas activated T cells carry mainly hexasaccharide side chains and express CD43 as a 135 kDa glycoform. The activity of (316GlcNAc transferase (C2GnT) has been shown to be correlated with the expression of CD43 135 kDa. Since the function of the two major CD43 glycoforms is not clear, CD43 chimeric proteins have been produced to identify potential ligands of CD43 and to study its role(s) in the immune response.  The recombinant chimeric glycoprotein comprises the extracellular domain of murine CD43 (mCD43) and part of human IgGl (hlgG) including the hinge, CH2 and CH3 domains. The cDNA encoding the mCD43-hIgG chimeric molecule was subcloned into two expression vectors which are driven by either metallothionein or SRa promoter. Both vectors were transfected into three T cell lines: EL4, CTL2c, CTLL and myeloid cell line, NSF60. EL4 cells express exclusively CD43 115 kDa which is specifically recognized by the monoclonal antibody (mAb), S7 whereas CTL2c and CTLL cells express exclusively CD43 135 kDa which is specifically recognized by mAb 1B11. NSF60 cells express CD43 glycoforms which are detected by S7 and IB 11. Western blotting analysis demonstrated that the anti-CD43 antibody reactivity of the chimeras secreted by transfected EL4, CTL2c, CTLL and NSF60 cells was identical to the cell surface CD43. The EL4 chimera was recognized by mAb S7, while the CTL2c and CTLL chimeras were recognized by mAb 1B11. NSF60 cells secreted a chimera which was reactive with both antibodies. These results suggest that the mCD43-hIgG chimera secreted by transfected EL4 cells predominantly carried tetrasaccharide ii  cores whereas the chimeras secreted by transfected CTL2c and CTLL cells predominantly carried hexasaccharide cores. NSF60 chimeric protein had tetrasaccharide and hexasaccharide structures. The four chimeras had a lOkDa higher MW than CD43 expressed on the surface of its corresponding cells. This 10 kDa difference in MW can be fully explained by the replacement of the transmembrane and cytoplasmic domains of CD43 with pools of the human IgG constant domain. This further indicated that chimeras have similar or identical glycosylation as cell surface CD43.  Non-reducing SDS-PAGE showed that all four chimeras were as expected secreted as dimers. Precipitation using Jacalin-sepharose specific for tetrasaccharide cores, demonstrated that CD43 115 kDa expressed on EL4 cells and its corresponding 125 kDa chimera were efficiently precipitated, while the other three chimeric proteins were less reactive with Jacalin sepharose. This result supported that the O-glycans expressed on the chimeric proteins were identical to those expressed on CD43. This study has successfully established novel tools for the search of CD43 glycoforms specific ligands.  iii  Table of Contents Abstract  ii  Table of Contents  iv  List of Figures  vii  List of Abbreviations  viii  Acknowledgments Chapter 1  xi  Introduction  1.1 The structure of CD43  2  1.2 Heterogeneity of CD43 glycosylation  4  1.3 O-glycan synthesis  7  1.4 Core 2 enzyme  10  1.4.1 The structure of C2GnT  12  1.4.2 Role of Core 2 enzyme  12  1.5 Immunodeficiency and malignancy  15  1.5.1 Leukemia and CD43  15  1.5.2 Acquried immunodeficiency diseases (AIDS) and CD43  16  1.5.3 Wiskott-Aldrich syndrome and CD43  17  1.5.4 CD43 and Rheumatoid Arthritis  19  1.5.5 Graft Verse Host Disease and CD43  20  1.6 Roles of CD43  21  1.6.1 Role of CD43 in T cell activation and proliferation  21  1.6.2 CD43 anti-adhesion role  23  1.6.3 Adhesion  23  1.6.4 Induction of monocytes and neutrophils  25  iv  1.6.5 Signal transduction mediated by CD43  25  1.6.6 CD43 role in apoptosis  26  1.6.7 Upregulation of CD43 on differentiating B lymphocytes  27  1.6.8 CD43 knockout mice  28  1.7 Objectives Chapter 2  28  Materials and Methods  2.1 Materials  _  31  2.2 Tissue culture  32  2.3 Preparation of antibodies  32  2.4 Constructions of plasmid pBS.CD43, pBS. IgG, pBS.CD43-IgG, pBMG.CD43-IgG and pBSR.CD43-IgG  33  2.5 Cell transfection  35  2.6 Screening for the transfected cells  36  2.7 Purification of chimeric proteins  37  2.8 Preparation of cell extracts  37  2.9 Characterization of chimeric proteins by western blotting  38  2.10 Jacalin precipitation  39  2.11 Fluorescence activated cell sorting  39  Chapter 3  Results  3.1 Construction of cDNA for CD43-IgG chimeras  40  3.2 Cellular expression of Cd43-IgG chimeras  52  3.3 Biochemical characterization of the chimeric proteins  55  v  3.3.1 Comparison of tetrasaccharide and hexasaccharide carrying chimeric proteins  55  3.3.2 Comparison of chimeras proteins produced by NSF60 and CTLL  59  3.3.3 Comparison of CD43-IgG chimeras run on SDS PAGE under reduced and non-reduced conditions  63  3.3.4 Jacalin preferentially precipitates the low molecular weight form of chimeric proteins secreted by EL4/28 3.4 Preliminary study of CD43 ligands using FACS Chapter 4  66 66  Discussion  4.1 Expression of recombinant CD43  69  4.2 Purification of chimeric protein  71  4.3 Western blotting analysis  73  4.4 Possible ligands of leukosialin  74  Chapter 5  Conclusions  78  References  79  vi  List of Figures  FIG. 1.1  Schematic diagram of endothelial and leukosialin mucins  8  FIG. 1.2  Biosynthesis of leukosialin  9  FIG. 1.3  Biosynthesis of O-glycans  11  FIG. 1.4  Extension of Poly-N-acetyllactosaminyl  14  FIG. 1.5  Mouse CD43-human IgG chimeric protein  30  FIG. 3.1  Schematic representation of mouse CD43 and human IgG PCR fragments  41  Schematic diagram of pBS.mCD43 and pBS.hlgG and the restriction enzyme analysis of the constructs  43  FIG. 3.2  FIG. 3.3  Construction of pBS.mCD43-hIgG and its restiction enzyme analysis  45  FIG. 3.4  Cloning of mCD43-hIgG into the two expression vectors  49  FIG. 3.5  Sandwich ELISA for screening mCD43-hIgG chimeras  54  FIG. 3.6  Western blot analysis of EL4 and CTL-2c chimeras  57  FIG. 3.7  Western blot analysis of NSF60 and CTLL chimeras  61  FIG. 3.8  Comparison of reduced and non-reduced chiemric proteins  64  FIG. 3.9  Jacalin binding studies of chimeras  67  vii  List of Abbreviations AA  Amino acid  ABTS  2,2'-Azino-bis(3' Ethylbenz-Thiazoline-6Sulfonic acid  AIDS  Acquired immunodeficiency disease  amp  Ampicillin  Anti-human IgG  Anti-hlgG  Bluescript  BS  bp  Base pair  CD40 ligand  CD40L  CD43  Leukosialin  C2GnT  (31,6-N-Acetylglycosaminyl transferase  DAG  Diacylglycerol  DTT  Dithiothreitol  DMSO  Dimethyl sulfoxide  DNA  Deoxyribonucleic acid  ELISA  Enzyme-linked immunosorbent assay  FACS  Fluorescence activated cell sorter  FITC  Fluorescein isothiocyanate  Gal  Galactose  GalNAc  N-Acetylgalactosamine  GlcNAc  N-Acetylglucosamine  GVHD  Graft verses host disease  viii  MgG  Human immunoglobulin G  HIV-1  Human immunodeficiency virus type-1  HPC  Hematopoietic progenitor cells  HRP  Harse Radish peroxidase  ICAM-1  Intracellular adhesion molecule-1  IL  Interleukin  kb  Kilo base pairs  LB  Luria-Bertani medium  LEU  Leupeptin protease inhibitor  LFA-1  Lymphocyte associated antigen-1  LPS  Lipopolysaccharide  mAb  Monoclonal antibody  mb  Membrane  MHC  Major histocompatibility complex  mRNA  Messenger ribonucleic acid  MW  Molecular Weight  NeuNAc  Sialic acid residue or N-acetyllactosamine  NK  Natural killer cells  PCR  Polymerase chain reaction  PEP  Pepstatin  PKC  Protein kinase C  PMA  Phorbol myristate acetate  PMN  Polymorphonuclear neutrophils  PMSF  Phenylmethyl sulfonic acid  PSGL-1  P-selectin glycoprotein ligand-1  RA  Rheumatoid arthritis  rpm  Revolution per minute  SBTI  Soybean trypsin inhibitor  SDS  Sodium dodecyl sulfate  SEB  Staphylococcal enterotoxin B  Ser  Serine residue  SLe  x  Sialyl Lewis  sup  Supernatant  TCR  T cell receptor  Thr  Threonine residue  Tm  Melting temperature  TPA  12-O-tetradecanoylphorbol 13-acetate (phorbol ester)  WAS  Wiskott-Aldrich Syndrome  WASP  Wiskott-Aldrich Syndrome protein  WGA  Wheat germ agglutinin  x  Acknowledgments I would like to thank my supervisor, Dr. Hermann Ziltener, for his advice and encouragement for this study. Today I am able to finish this study because of his support and constructive criticism of my work. I would also like to express gratitude to Lesley Ellies, Waltraud Fellinger, Helen Merkens and Michael Williams who have taught me about tissue cultures, Western blots, FACS and other techniques for the past three years. In addition, I also wish to thank Dr. Vince Duronio and Dr. John Schrader for their time and supervision of my study. Last but not least, I am thankful to my classmate, Mohammed Iqbal Hasham for giving me advice for my thesis. Finally I would like to dedicate this paper to my family who has given me enormous support and love throughout the study.  xi  CHAPTER 1  INTRODUCTION  An increasing number of glycoproteins embedded in the cell membrane have been found to have important biological functions. The functional significance of cell surface carbohydrates is exemplified in human immune responses and hematopoiesis where particular glycoproteins mediate cell-cell recognition and cell-matrix interaction. Upon binding to specific carbohydrate binding proteins or counter-receptor molecules, the glycoproteins can trigger downstream processes, such as activation and proliferation of T cells or apoptosis. The functions and biological roles of glycoproteins may become even more diversified, due to the modification of terminal sequences of oligosaccharides (Varki, 1993). Failure of normal oligosaccharide production by any given cell type may result in immunodeficiency, development of tumor cells, or colonization and metastasis of malignant cells. Therefore, it is important to study glycoproteins and define the functional significance of glycosylation.  Leukosialin (CD43) is a heavily sialylated, mucin-type surface antigen on leukocytes, carrying approximately 70-80 O-glycans and covering 20% of the cell surfaces of thymocytes (Fukuda, 1991). Initially, CD43 was found on K562 human erythroleukemic cells but not found on mature erythrocytes (Fukuda, 1980; Fukuda et al, 1980). The same glycoprotein was also identified on myelogenous leukemic cell lines, with apparent molecular weights (MWs) ranging from 95 to 135 kDa. It is expressed in various species, but named differently: CD43 in human, Ly-48 in mouse, W3/13 in rat and LI 1/135 in rabbit (Parkman et al, 1981; Remold-O'Donnell, 1984; Carlsson etal, 1986; Borche etal, 1987; Killeen etal, 1987; Axelsson et al, 1988). Two major isoforms of CD43 were identified: a low MW isoform of CD43 with MW 115 kDa, mainly expressed on circulating T lymphocytes and monocytes, and a high MW isoform of CD43 with MW 135 kDa, mainly expressed on neutrophils, activated T lymphocytes and at low levels on platelets (Remold-O'Donnell et al, 1987a; Piller et al, 1988). The enzyme involved in the synthesis of CD43 135 kDa was found 1  to be pl,6-N-acetylglycosaminyl (pl-6GlcNAc) transferase (C2GnT) (Piller et al, 1988). The activity of C2GnT is directly correlated with the expression level of CD43 135 kDa. RemoldCD' Donnell et al. (1984) found that the expression of CD43 115 kDa was strongly reduced in Wiskott-Aldrich Syndrome (WAS) patients, while that of CD43 135 kDa was drastically increased. The overexpression of CD43 135 kDa is also observed in patients with rheumatoid arthritis (RA), leukemia, acquired immunedeficiency syndrome (AIDS), and graft versus host disease (GVHD) (Fox etal, 1983). The functional significance of the two CD43 glycoforms is presently unknown and little is known about CD43 ligands. Further investigation of CD43 can help to understand pathological conditions of those diseases, and reveal the significance of glycobiology in the immune system.  1.1  T H E STRUCTURE OF CD43 Transmission electron microscopy has revealed that CD43 has a rod-like shape  extending further away from the surface than other cell surface proteins (Cyster etal, 1991). Being a type I transmembrane molecule, its cDNA encodes a cleavable leader peptide followed by an extracellular, a transmembrane and a cytoplasmic domain. The immature polypeptide including the 19 residue cleavable leader peptide is made up of 400 amino acids (AAs) for human, 395 AAs for mouse or 390 AAs for rats. The extracellular domain containing 234 (in human), 228 (in mouse) or 223 (in rat) AAs is rich in threonine and serine at which O-linked glycans are attached (Killeen et al, 1987; Pallant et al, 1989; Shelley et al, 1989; Cyster et al, 1990; Kudo and Fukuda, 1991). Furthermore, the O-glycosylation sites in the extracellular domain of human leukosialin are tandemly arranged as 18 amino acid repeats for five times proximal to the membrane. Other mucin glycoproteins also have similar tandem repeats, perhaps due to the duplication of exons (Timpte et al, 1988; Gum et al, 1989). The significance of tandem repeats is not known. Human CD43 also contains one N-linked 2  carbohydrate structure while mouse has two, and rat has none. In contrast to the extracellular domain, the transmembrane and cytoplasmic domains of CD43 are highly conserved among the three species. The transmembrane domains of all three species consist of 22 residues, and the cytoplasmic tail which may be involved in signal transduction contains 123 AAs for either human or rat, or 124 AAs for mouse (Killeen et al, 1987; Cyster et al, 1990; Dorfmann et al, 1990).  The gene for human leukosialin is localized on chromosome 16pl 1.2 (Pallant et al, 1989) and that of mouse is localized on chromosome 7 (Cyster et al, 1990; Dorfman et al, 1990). It is interesting that the locus for the human leukosialin gene is close to the locus for the alpha subunits of lymphocyte function associated antigen-1 (LFA-1), Mac-1 and pl50/95, all of which are members of the leukocyte adhesion molecule family and have been mapped to 16pl 1-13.1 (Corbi et al, 1988). Similarly, murine chromosome 7 also contains the gene encoding the a chains of LFA-1, Mac-1 and pl50/95 (Morse et al, 1987; Baecher et al, 1990). These observations for both human and rodent CD43 gene linkage with adhesion molecules suggest that several leukocyte adhesion molecules may be associated with CD43 in the regulation of migration and cell adhesion during inflammation.  The human and murine CD43 genes are encoded by two exons, whereas the W3/13 gene is encoded by five different exons (Cyster et al, 1990). The first exon of human and murine leukosialin genes encodes for a 5'-untranslated sequence, while the second exon encodes the entire polypeptide backbone, including the methionine at the translation initiation and the stop codon (Cyster et al, 1990; Shelley et al, 1990; Kudo and Fukuda, 1991). The latter exon of CD43 is 2270 nucleotides apart from the transcriptional start site. Their promoter regions do not contain TATA/CAAT boxes (Hogness box), but are highly enriched in G and C nucleotides (Shelley et al, 1990). Additionally, a novel promoter sequence, 3  5'GGGTGGGTGGAGCC3' found at position -53 to -40, upstream of the CD43 sequence, was shown to enhance the expression of CD43 (Kudo and Fukuda, 1991).  Using Northern blotting techniques, human CD43 was found to be encoded by two mRNA species in lymphoid cell lines: 2.3 kilo base pairs (kb) and 8.0 kb (Pallant et al, 1989) or 1.9 kb and 4.3 kb (Shelley et al, 1989). The single band observed in Southern blotting analysis confirmed that the two RNA products encoded the same human CD43 DNA. The two RNA species were demonstrated to have different polyadenylation signals, and the 4.3 kb mRNA product was found to contain some unstable sequences, such as AUUU, UAUU and AUUUA. The 8.0 kb mRNA included an extra portion of 3'-untranslated sequence. Though a few mRNA species were discovered, they are encoded by the same CD43 exon and translated to a single gene product. Hence, post-translational modifications, and not alternative exon splicing, give rise to the heterogeneity of CD43 isoforms and result in the different MWs and different antigenic determinants (Carlsson and Fukuda, 1986). The significance of having two RNA species while expressing only one form of CD43 polypeptide still remains to be elucidated.  1.2  HETEROGENEITY OF CD43 GLYCOSYLATION Different cell lineages and different stages of cell differentiation may influence  the expression of distinct types of O-glycans attached to CD43. Carlsson et al (1986) have studied the differences in leukosialin derived O-glycans obtained from K562 cells (mature human erythrocytes), HL-60 cells (promyelocytes) and HSB-2 cells (T-lymphocytes). Analysis of CD43 carbohydrates has shown that O-glycans derived from K562 cells are predominantly of the tetrasaccharide form, NeuNAca2-3Gal(3l-3(NeuNAca2-6)GalNAc, whereas those from HL60 cells are exclusively the hexasaccharide form, NeuNAca2-3Gal(3l4  3(NeuNAca2-3Gal(3l-4GlcNAc(3l-6)GalNAc, and those from HSB-2 cells consist of both forms. Consistent with these findings was the observation that the tetrasaccharide form of CD43 expressed on the K562 cells had an apparent MW of 105 kDa which is lower than the hexasaccharide form expressed on HL60 cells (135 kDa), and CD43 from HSB-2 cells (120 kDa).  Different stages of T lymphocyte differentiation correspond to the expression of different forms of CD43. Resting T cells exclusively express the tetrasaccharide form of CD43, NeuNAca2-3Gal(3l-3(NeuNAca2-6)GalNAc (Piller et al, 1988). When T lymphocytes are activated by antigen in mixed lymphocyte cultures or by mitogens, such as concanavalin A, the activated T lymphocytes exclusively express the hexasaccharide form, NeuNAca2-3Gal(3l-3(NeuNAca2-3Galpl-4GlcNAcpl-6)GalNAc (Andersson etal, 1978; Kimura and Wigzell, 1978; Piller et al, 1988). Tomlinson Jones et al (1994) have studied the differences in expression of CD43 in T cell subsets. Most CD4-8-, CD4+8+, and CD4-8+ thymocytes constitutively expressed hexasaccharide branched CD43 whereas less than 20% of CD4+ single positive T cells in both immature and mature populations, expressed the antigen; but the expression of hexasaccharide carrying CD43 was up-regulated dramatically on CD4+ T lymphocytes, when T cells were activated. Furthermore, CD43 is expressed in a unique tissue-specific pattern on mature T-lymphocytes, granulocytes, monocytes, platelets, and precursor cells of T-lymphoid, as well as other hematopoietic cell lineages, including early erythroid lineage, B precursors and antibody-secreting plasma cells (Dyer and Hunt, 1981; Carlsson and Fukuda, 1986; Bettaieb et al, 1988; Gulley et al, 1988). These studies indicate that distinct types of O-glycans of CD43 expressed on cell surfaces depend either on different cell lineages (erythoid and granulocytic cells) or on different stages of cell maturation (Tlymphoid) (Fukuda, 1991).  5  The tetrasaccharide and hexasaccharide branching-CD43 molecules differ in their biochemical properties. The isoelectric point (pi) of tetrasaccharide-carrying CD43 is 4.75.7, and that of hexasaccharide-carrying CD43 is 6.0 (Baecher-Allen etal, 1993). In terms of their apparent molecular weights, the tetrasaccharide form of CD43 is 115 kDa whereas the hexasaccharide form is 130 kDa or higher. These two glycoforms of CD43 can be recognized distinctly by specific monoclonal anti-CD43 antibodies. In human, the mAb T305 specifically recognizes the hexasaccharide core of human leukosialin (Fox et al, 1983; Sportsman et al, 1985). It was generated by immunizing mice with an acute T-lymphocytic leukemia cell line, and was selected by its positive reaction with synovial fluid lymphocytes of arthritis patients (Fox et al, 1985). If cells are pre-treated with neuraminidase, mAb T305 no longer binds to CD43, suggesting that the epitope of T305 could consist of both the hexasaccharides and the polypeptide backbone of the CD43. Of the many other anti-human CD43 antibodies, all react with varying degrees to both major glycoforms of CD43. In the murine system, our laboratory has identified a rat mAb, called IB 11 (IgG2a isotype) which recognizes the murine hexasaccharide-carrying isoform of CD43 with MW 135 kDa (Tomlinson Jones et al, 1994). 1B11 does not bind to the tetrasaccharide form of murine CD43 (115 kDa), which is specifically recognized by the rat anti-mouse CD43 mAb, S7 (IgG2a isotype). S7 was initially found to react with all Thy-1.2-positive cells in the murine spleen (Gulley et al, 1988). Later, S7 was shown to act as a pan-T cell reagent in the murine thymus and all murine granulocytic cells including polymorphonuclear cells, plasmacytomas, and normal plasma cells (Gulley et al, 1988). Monoclonal antibodies S7 and IB 11 are useful tools for studying CD43 functions in the murine immune system as they react exclusively with only one of the two major glycoforms of CD43.  6  1.3  O - G L Y C A N SYNTHESIS Glycoproteins are structurally classified into two groups, referred to as N -  linked or O-linked. N-linked oligosaccharides are attached N-glycosidically to polypeptide chains via N-acetylglucosamine to the amide nitrogen of asparagine whereas O-glycans are attached O-glycosidically via N-acetylgalactosamine to hydroxyl groups of serine (Ser) or threonine (Thr) (Voet and Voet, 1990). Mature CD43 protein carries extensive Oglycosylation, approximately 40% protein and 60% O-glycans in a weight to weight ratio (Remold-O'Donnell et al, 1984, 1986; Axelsson et al, 1985; Carlsson & Fukuda, 1986). Other examples of proteins, which also carry similar O-oligosaccharides and sometimes, are referred to as leukocyte mucins are P-selectin glycoprotein ligand (PSGL-1), CD45 and Tactile (Fig. 1.1).  The post-translational modification of either the tetrasaccharide O-glycan core (the CD43 115 kDa) or the hexasaccharide O-glycan core (the CD43 135 kDa) of CD43 takes place in Golgi apparatus (Fig. 1.2). N-Acetylgalactosamine (GalNAc) residues present in cis Golgi are transferred to a Ser or Thr residue on the CD43 polypeptide by ocGalNAc transferase (Piller et al, 1990). (3l-3Gal transferase then adds a galactose (Gal) to the intermediate compound GalNAccxl-O-Ser/Thr to form a disaccharide, Gaipi -3GalNAcal-0-Ser/Thr. At this point, either of two biosynthesis pathways may be followed. In resting T cells which lack the (3l-6GlcNAc transferase (C2GnT), the disaccharide compound is transferred to trans Golgi where a2,3- sialyl (a2-3NeuNAc) transferase and a2,6-sialyl (a2-6NeuNAc) transferase are located, and the tetrasaccharide branching-CD43 is formed by adding two more sialic acid residues (N-acetyllactosamine or NeuNAc) to the disaccharide. However, if C2GnT is induced in cis Golgi during T cell activation, the disaccharide intermediate will be committed to the hexasaccharide branching pathway by adding GlcNAc to yield (GlcNAcPl-6)Gaipi3GalNAcal-0-Ser/Thr. To this trisaccharide compound, one more Gal molecule is added by 7  FIG. 1.1 SCHEMATIC DIAGRAM OF ENDOTHELIAL AND LEUKOSIALIN MUCINS Solid bars represent high amounts of O-linked glycans attached to serine and threonine residues; open circles represent immunoglobulin molecules. ENDOTHELIAL MUCINS  GlyCAM-1  CD34  MAdCAM-1  LEUKOCYTE MUCINS  PSGL-1  CD43  CD45RA  8  TACTILE  1G.  1.2  Cis  B I O S Y N T H E S I S  O F  L E U K O S I A L I N  Golgi  Sei/Thr ^ ^GalN^C  a G a l N A c transferase Ser/Thr 3Gal transferase  /  V  <GalNAc/C~Sern"hr  ~) (51-6GlcNAc  Medial Golgi  .GICNACA  P I  _  transferase  (C2GnT)  E  f51-4Gal t r a n s f e r a s e  VB1-4 / \.GIcNAcy  Gal  [51-6  a2-3NeuNAc  Trans Golgi  transferase a.2-3NeuNAc transferase(s)  \.  G a l / \ G l c N A c X  P1-6  •^2-3 GalNAcN ^ e u N A ^  ^  Gal a2-3  Resting T  Activated T lymphocytes  lymphocytes  9  the medial Golgi enzyme, (3l-4Gal transferase to form Gaipi-4(GlcNAcPl-6Gaipi3)GalNAcal-0-Ser/Thr. In the trans Golgi, cx2-3NeuNAc transferase continues to expand the hexasaccharide moiety by adding NeuNAc residues. As is the case for myeloid cells, if cells contain both pl-6GlcNAc transferase and a2-6NeuNAc transferase, then hexasaccharide branching is preferred over the tetrasaccharide branching pathway. The preference for the hexasaccharide branching pathway likely occurs because (3l-6GlcNAc transferase has a higher catalytic activity (Vmax/Km) and is present earlier in the Golgi apparatus than a2-6 NeuNAc transferase (Piller et al, 1991). Thus the order and the activity of the different glycosyltransferase enzymes are important factors controlling the glycosylation of CD43.  1.4  CORE 2 ENZYME Based on the sugar residues attached to the GalNAcal-O-Ser/Thr, Schachter  and Brockhausen (1992) proposed a scheme to classify oligosaccharides. The formation of Galpl-3GalNAccxl-0-Ser/Thr from GalNAcal-O-Ser/Thr is known as core 1 structure (Fig. 1.3). Instead of galactose, N-acetylglucosamine (GlcNAc) can also be added to GalNAcal-OSer/Thr to form core III structure, GlcNAcpl-3GalNAcal-0-Ser/Thr. In addition, cc26NeuNAc (cx2,6-sialyl) transferase also can add a sialic acid residue to GalNAcal-O-Ser/Thr to form a side product, NeuNAca2-6GalNAcal-0-Ser/Thr. However, in presence of pi,6N-acetylglucosaminyl (Pi- 6GlcNAc) transferases, the core I is converted to Gaipi3(GlcNAcpi-6)GalNAca-0-Ser/Thr which is defined as core II. Similarly, these enzymes result in the conversion of core III to core IV. Hence, the formation of core II and core IV depend on the presence of galactose and N-acetylglucosamine substrates respectively. The glycosyltransferases for the core II and core IV are cell-type specific, and are highly expressed at specific stages of cell differentiation. Core II specific glycosyltransferase was found in  10  Fig 1.3 BIOSYNTHESIS OF O-GLYCANS  >fleuNAc\  ^GalNi^<  Ser/Thr  a2,6-sialyltransferase ^GalN^<  (31,3-N-acetylglucosaminyl^ transferase.  (31,3-galactosyltransferase  0  G a l N A c / V ^ Ser/Thr IcNAc  P1-3  \GalNAc><  (31-3  Core III  Core I  (31,6-N-acetylglycosaminyltransferases T ^JlcNA^y^  VGIcNAcX  P1-6  j  GalNAc* <  Core IV  y Gal  XsalNAcV  )  A  /  Core II 11  myeloid cells whereas core IV specific transferase was detected in gastrointestinal ducts (Brockhausen, 1991).  1.4.1  T H E STRUCTURE OF C2GnT Human UDP-GlcNAc: Galpl-3GalNAc-R(GlcNAc to GalNAc)pl-6GlcNAc  transferase (C2GnT) cDNA in Chinese hamster cells which stably expressed human CD43 was originally cloned by transfecting (Bierhuizen and Fukuda, 1992). Using the mAb T305, clones which express C2GnT together with CD43 were selected, and cDNA encoding the C2GnT protein was isolated from an HL-60 cDNA library. The 2.1 kb cDNA which encodes a 428 amino acid type II integral protein has homology with blood group I P6-GlcNAc transferase. C2GnT gene encodes a cytoplasmic domain, a single membrane anchoring domain and a long intralumenal domain. It is localized on chromosome 9, band q21 (Bierhuizen et al, 1993) and possibly encoded by one exon. Datti and Dennis (1993) have found that C2GnT is induced by butyrate treatment via de novo gene transcription/translation and activation of protein kinases.  1.4.2  R O L E OF C O R E 2 E N Z Y M E The increased expression of C2GnT has been observed in a variety of biological  processes, such as T cell activation and T cell development. During in vitro activation of human T cells via the T cell receptor complex, the activity of C2GnT is increased by three fold, and in turn, the hexasaccharide branching pathway of CD43 is activated (Piller et al, 1988; Higgins etal, 1991). In the case of T cell development, the expression of both C2GnT and CD43 135 kDa was found to be high in immature cortical thymocytes and low in more  12  medullary thymocytes as determined by immunocytochemistry with mAb T305 binding (Baum et al, 1995). The studies indicate that the hexasaccharides are replaced by the tetrasaccharides at the final stage of T cell maturation (Fox et al, 1983). Ellies et al (1994) have further suggested that the glycosyltransferase pathways may be differentially regulated in the CD4+ and CD8+ T-cell subsets, as they showed that both major CD43 glycoforms are upregulated in CD4+ T cells during activation, while CD43 135kDa is upregulated and CD43 115kJDa is down regulated in CD8+ T cells.  C2GnT activity is abnormally high in tumor cell lines, such as transformed rat 2 fibroblasts, murine mammary carcinoma, human leukemia and (3-all-trans-retinoic acid induced F9 teratocarcinoma cell lines (Piller et al, 1988; Brockhausen et al, 1991; Saitoh et al, 1991a; Yousefi et al, 1991; Heffernan et al, 1993). This drastically increased C2GnT activity in human or rodent transformed and metastatic cells is directly correlated either with the high expression of CD43 135 kDa, or with the increased formation of more poly-N-acetyllactosamines (Yamashita etal, 1984; Pierce and Arango, 1986; Dennis etal, 1987). As indicated in Fig. 1.4, (31-6 linked lactosamines are added preferentially to the side chain, Gal pi-6 linkage of core II structure by pi-3GlcNAc transferase and pl-4Gal transferase to form poly-N-acetyllactosamine (Fukuda et al, 1986). The extension of the poly-N-acetyllactosamine repeats takes place before sialic acid residues are added, which provides a backbone for sialy-Lewis (SLe ) formation. Sialy-Le is formed when one sialic acid residue is added to the terminal of x  x  Gaipi-GalNAccxl-O-Ser/Thr. Malignant transformation is apparently associated with an increase in the activity of C2GnT and the formation of poly-N-acetyllactosamines.  13  FIG. 1.4 EXTENSION OF POLY-N-ACETYLLACTOSAMINYL  14  1.5  I M M U N O D E F I C I E N C Y AND M A L I G N A N C Y The hexasaccharide carrying CD43 normally expressed in activated T cells, was  also found to be overexpressed in some diseases, for example acute lymphocytic leukemia, acquired immunodeficieny syndrome (AIDS), Wiskott-Aldrich Syndrome (WAS), rheumatoid arithritis (RA) and graft-versus-host disease (GVHD). The potential role of CD43 in each of these conditions will be discussed in the following sections.  1.5.1  L E U K E M I A AND CD43 Evidence for a role of the hexasaccharide branching CD43 expression in  various leukemias has been shown. Normal individuals express NeuNAca2-3Gal(3l3(NeuNAca2-3Gaipi-4GlcNAc(3l-6)GalNAc on peripheral T cells in a low amount. However, patients with acute T lymphocytic leukemia over-express the hexasaccharide branching CD43 on their peripheral T lymphocytes (Saitoh et al, 1991b). Patients with chronic T lymphocytic leukemia also show moderately elevated expression of the same hexasaccharide cores on peripheral blood lymphocytes. These studies indicate that in leukemia patients the increase expression of hexasaccharide carrying CD43 in leukemia corresponds to the increased number of immature blastoid T lymphoid cells also seen in leukemic patients (Fukuda, 1991).  The expression of hexasaccharide cores is also associated with increased C2GnT activity, which may result in malignant transformation by poly-N-acetyllactosamine extension. Patients with choriocarcinoma produced more of the core II structure or more of the branched hexasaccharides attached to chorionic gonadotrophin compared to normal individuals (Amano et al, 1988). Another supporting study showed that myelogenous  15  leukemia cells have a high activity of Gal(3l-3GalNAc (NeuNAc to Gal) cc2-3 sialyltransferase compared to normal granulocytes (Kanani et al, 1990). The blasts and granulocytes of myelogenous leukemia patients also showed a high activity of this enzyme, and they are enriched with the monosialylated form of O-glycans such as NeuNAca2-3Gal(3l-3GalNAc and Gal[3l-3(NeuNAca2-6)GalNAc, indicating that the elevation of a2-3NeuNAc transferase activity may correlate to the stages of differentiation of the myelogenous leukemia cells (Fukuda et al, 1986). Thus it is important to elucidate the functions of glycosyltransferases in normal and tumor cells to aid in the study of various hematological disorders.  1.5.2  A C Q U R I E D I M M U N O D E F I C I E N C Y SYNDROMES (AIDS) A N D CD43 Similar results obtained in individuals with leukemias were found in the  leukocytes of human immunodeficiency virus type-1 (HIV-1) positive and AIDS patients,. Many patients infected with HIV-1 make auto-antibodies against CD43 on normal thymic lymphocytes. The epitopes recognized by these CD43-specific antibodies might be similar to those recognized by T305, or the sialo form of hexasaccharide attached to leukosialin (Ardman et al, 1990). Lefebvre et al (1994) showed that CD43 on lymphocytes of HIV-1 infected leukemic T cells, CEM cells, were sulfated and hyposialylated. In fact, hyposialylation and sulfation may impair the CD43-mediated homotypic aggregation and subsequently may generate auto-antibodies against nonsialylated CD43. In addition, CD4+ lymphocytes from many HIV-1 seropositive individuals were found to be depleted. Some AIDS patients infected with human immunodeficiency virus (HIV) shown to express partially sialylated CD43 with the hexasaccharide cores on their normal thymocytes (Saitoh et al, 1991a). An asymptotic patient infected with the AIDS virus expressed leukosialin with a MW close to that of normal resting T lymphocytes. These studies have revealed that as the AIDS symptoms progressed, apparent MW of CD43 also increased (Saitoh et al, 1991b). 16  1.5.3  W I S K O T T - A L D R I C H S Y N D R O M E AND CD43 Wiskott-Aldrich Syndrome (WAS), an X chromosome linked recessive  disorder, is characterized by thrombocytopenia with reduced platelet volume and number, immunological defects affecting both humoral and cellular responses, and eczema (Aldrich et al, 1954; Huntley and Dees, 1957). Clinical studies showed that WAS patients rapidly eliminate platelets which were abnormally small and dysfunctional (Grottum et al, 1969; Perry et al, 1980). Other symptoms include delayed hypersensitivity and allograft rejection, because human antibodies react against polysaccharide antigens and haemagglutinins, and drastically reduced T lymphocyte functions (Cooper et al, 1968; Oppenheim et al, 1970; Spitler et al, 1975; Ochs, et al, 1980). Recurrent infections, hemorrhagic diathesis and unusual susceptibility to lymphoreticular malignancy may also occur and result in the morbidity and mortality associated with the syndrome (Perry etal, 1980).  Numerous studies showed that WAS is associated with altered glycosylation of CD43 115 kDa and morphologic abnormalities detected by scanning electron microscopy (Kenney et al, 1986; Borche et al, 1987; Reisinger and Parkman, 1987; Remold-O'Donnell et al, 1987b; Greer et al, 1989a). The expression of CD43 115 kDa on resting T cells of WAS patients was decreased, and the T cells which express the hexasaccharide carrying CD43 were unable to be activated (Parkman et al, 1981; Carlsson and Fukuda, 1986; Axelsson et al, 1988; Greer et al, 1989b; Piller et al, 1989). WAS patients' T lymphocytes undergo "pseudo activation", resulting in the antigen-independent activation of T cells and the failure of normal lymphocyte maturation. WAS patients appeared to have a high C2GnT activity in unstimulated T cells, B cells and platelets which quickly declined after T cells were activated, or WAS cell lines were transformed by Epstein-Barr virus (Piller et al, 1991). T cells, B cells and platelets are defective in WAS patients, possibly because the regulation of C2GnT is disrupted, and subsequently polylactosamine synthesis in the O-glycans is affected. In 17  addition, WAS patients' B cells fail to generate antibodies since T cell activation mediated by CD43 is impaired. This suggests that the activation cascade involves ligand binding to CD43 which signals the cytoplasmic domain to trigger the T cell activation. In contrast to these results, a few studies have reported that some WAS patients and Epstein-Barr virus transformed B cells lacked C2GnT neccessary for CD43 135 kDa synthesis (Greer et al, 1989b; Higgins et al, 1991).  The primary defect in WAS occurs on the X chromosome, band pi 1-11.3 (Parkman etal, 1981). According to genetic linkage, hereditary X-linked thrombocytopenia and WAS are localized in the same chromosomal region, indicating that incomplete expression of the defective gene may occur (Vestermark and Vestermark, 1964; Canales and Mauer, 1967; Guttenberger et al, 1970; Weiden and Blaese, 1972; Amaya et al, 1973; Spitler et al, 1980; Standen et al, 1986; Peacocke and Siminovitch, 1987; Donner et al, 1988; Greer et al, 1992). Derry et al (1994) have identified a novel gene, WASP, which is localized at Xpll.22-p 11.23 and is expressed in T and B lymphocytes, granulocytes, monocytes and platelets. Approximately 50 different naturally occurring WASP mutations such as missense, nonsense, and splice site mutations have been identified in patients with classic or attenuated forms of the disease (Derry et al, 1995; Kolluri et al, 1995; Kwan et al, 1995; Villa et al, 1995; Wengler et al, 1995; Zhu et al, 1995). WASP encodes a 501 amino acid proline-rich protein which can associate with the SH3 domain of the SH3/SH2 adaptor protein, Nek (Rivero-Lezcano et al, 1995). Under scanning electron microscopy, T cells of WAS patients appeared to have less microvilli on the cell surface than normal T cells. It is believed that the transmembrane structure and the cytoplasmic domain of CD43 may play a role in maintaining normal lymphocyte morphology, through the phosphorylation of cytoplasmic tail of CD43. Recently, Symons et al. (1996) have shown that WASP includes a GTPase-binding site that interacts with the activated GTPase, CDC42Hs, to regulate actin polymerization. Both CD43 18  and WASP may play a role in regulating cytoskeletal architecture, but their functions remain to be elucidated.  1.5.4  CD43 A N D R H E U M A T O I D ARTHRITIS Rheumatoid arthritis (RA), a chronic inflammatory disease, is defined as the  infiltration of T lymphocytes into synovium which normally lines the joint as a two cell layer thick membrane. The synovia of RA patients are hypertrophied, due to the aggregation of anti-IgG antibodies produced by plasma cells, followed by an influx of mononuclear inflammatory cells and the release of protease and free oxygen radicals (Harris, 1989). As an inflammatory response is elicited, three basic steps are involved: 1) leukocytes interact with activated endothelium; 2) activated neutrophils firmly adhere to endothelial cells; and 3) different lymphocytes migrate out of blood vessel into surrounding tissues (Butcher, 1991). The family of selectins are very important in modulating the adhesion events in the first step, whereas integrins CD1 la/CD 18 (LFA-1) and CD1 lp7CD18 (Mac-1, Mo-1) mediate the adhesion during the final step. Interestingly, several members of the mucin family have been identified as ligands for the selectins. However, CD43 itself has not yet been identified as a ligand for these molecules.  Humabria et al. (1994) demonstrated that the adhesion molecule repertoire is expressed on the activated synovial fluid neutrophils from the patients with inflammatory joint diseases. Integrin CD11(3 is upregulated, whereas L-selectin, CD43 and CD44 are downregulated. A similar pattern has been observed in vitro, with activated peripheral blood neutrophils (Jutila et al., 1989; Kishmoto et al., 1989; Abbassi et al., 1991; Alvarez et al., 1991; Campanero etal., 1991). Ardman et al. (1992) noticed that CD43 plays a role in interfering with the adherence of lymphocyte associated antigen-1 (LFA-1 or CD 11 a/CD 18) on 19  leukocytes to CD43+ transfected HeLa cells. In vivo, CD43 also prevents LFA-1 from mediating adhesion of resting neutrophils to endothelium. While the expression of CD43 on activated neutrophils is diminished, their interaction with endothelial cells mediated by LFA-1 is strong. Nathan et al. (1993) found that CD43 is shed by neutrophil elastase which is present at a significant concentration in the RA patients' synovial fluid during polymorphonuclear neutrophils (PMN) migration to the inflammatory site. Even though CD43 plays a regulatory role on the function of leukocyte integrins, the physiologic significance of the variable expression of CD43 and CD44 on synovial fluid neutrophils is unknown.  1.5.5  G R A F T VERSUS HOST DISEASE AND CD43 In GVHD, a major side effect associated with bone marrow transplantation is  characterized by widespread activation of T lymphocytes in response to allo-antigen, resulting in the generation of cytotoxic effector cells and the generation of auto-antibodies to host proteins (Ellies et al, 1994). In contrast to the activated neutrophils in RA patients, activated donor T lymphocytes of GVHD patients show increased expression of CD43 135 kDa (Fox et al, 1983). Our laboratory was able to show that both CD43 glycoforms are differentially expressed in a murine GVHD model. Both 135 kDa and 115 kDa glycoforms of CD43 were upregulated on CD4+ T-cells. However, on CD8+ T cells, CD43 135 kDa was drastically upregulated while CD43 115 kDa was downregulated, implying differential function of CD43 on these T cell subsets. The C2GnT activity was also upregulated consistent with the differential increase in CD43 135 kDa expression. In addition, other activation markers such as interleukin-2R(3 (IL-2RP), IL-2Ra and intracellular adhesion molecule-1 (ICAM-1) are also upregulated, indicating that on T cells, CD43 135 kDa is indeed a marker for cell activation. Analysis of host/donor origin of the CD43 135 kDa positive cells indicated that nearly all CD43 135 kDa positive cells were donor derived. This observation reveals that the upregulation of 20  CD43 135 kDa is likely due to direct T cell receptor stimulation, though some bystander activation of host cells by cytokines may also occur (Ellies et al, 1994).  1.6  ROLES OF CD43  A number of studies have shown that CD43 may play a role in the activation and proliferation of T-lymphocytes, in the negative and positive regulation of cell adhesion, in the induction of monocytes and neutrophils, in enhancement of Natural Killer (NK) cell activity, and in signal transduction (Mentzer etal, 1987; Axelsson etal, 1988; Vargas-Cortes etal, 1988; Nong et al, 1989; Silverman etal, 1989; Remold-O'Donnell and Rosen, 1990; Rosenstein etal, 1991; Ardman et al, 1992; Manjunath et al, 1993). Each role of CD43 is discussed in the following.  1.6.1  ROLE OF CD43 IN T CELL ACTIVATION AND PROLIFERATION The anti-human CD43 mAb, L10, has been shown to stimulate proliferation of  T cells via a T cell receptor (TCR) independent pathway of T cell activation (RemoldO'Donnell, 1990). Moreover, mAbs can activate T cells directly, as demonstrated by previous studies which show that human CD43 acts as an accessory signal molecule to co-stimulate T cells (Mentzer et al, 1987; Axelsson et al, 1988). Park et al. (1991) proposed a role for CD43 in co-expression with the TCR complex, especially when T cells are activated by antigen presenting B cells. Also, Sperling et al. (1995) have recently demonstrated that CD43 delivered a CD28-independent, co-stimulatory signal to antigen specific T cell responses resulting in enhanced T lymphocyte proliferation. To elucidate the role of CD43 in T cell activation, it will be important to identify the ligand(s) of CD43.  21  Recent evidence indicates that CD43 may also play a role in thymic maturation, acting as a co-accessory molecule. Developing thymocytes must interact with thymic epithelial cells to result in the maturation of immunocompetent T cells (Singer and Hayes, 1987; Patel and Hayes, 1993). Cells which recognize self components other than self-major histocompatibility complex (MHC) are deleted by negative selection whereas those which interact with the polymorphic components of self-MHC molecules expressed on the cortical epithelial cells are positively selected and progress in maturation. Thymic epithelial cells are thought to mediate positive selection of thymocytes bearing the appropriate T cell receptor and participate in negative selection (Nossal, 1994; Von Boehmer, 1994). Some known molecules expressed on thymic epithelial cells which bind to thymocytes via receptor-ligand binding, are CD2 and LFA-3, LFA-1, ICAM-1, CD40, CD23 and (32 integrins (Singer and Hayes, 1987; Dalloul et al, 1991; Giunta et al, 1991; Galy and Spits, 1992; Patel and Hayes, 1993; Salomon et al, 1994). Using transgenic mice expressing TCRs specific for antigens presented by class I and class II MHC molecules, Ellies et al. (1996) were able to show that the CD43 135 kDa is found to be downregulated in positive selection of CD4+CD8+ double positive thymocytes expressing a class I but not class II MHC-restricted TCR. The expression of CD43 135 kDa on peripheral CD8 single positive (CD8+) and CD4 single positive cells (CD4+) was not affected by the TCR transgenes. These results indicate that the down-regulation of CD43 135 kDa during positive selection is a transient event. CD43 135 kDa and C2GnT expression may play a role in the maturation of immuno-competent cells. The specific role for CD43 in the positive and negative selection of T-lymphocytes remains to be studied.  22  1.6.2  CD43 ANTI-ADHESION R O L E Binding of LFA-1 to the ICAM-1 on adjacent T cells will elicit an immune  response following homotypic adhesion (Rothlein etal., 1986; Marlin and Springer, 1987). Due to its anionic rod-like mucin structure, CD43 may cause repulsion among lymphocytes and negatively regulate the interaction between LFA-1 and ICAM-1. Thus, CD43 may negatively regulate T cell homotypic adhesion and activation (Brown et al., 1981; Carlsson and Fukuda, 1986; Remold-O'Donnell etal, 1986). Even when the avidity of LFA-1 for ICAM-1 increases, CD43 still persists in its anti-adhesion effect (Marlin and Springer, 1987). Heterotypic adhesion also occurs between target cells and T cells at the beginning of T lymphocyte-mediated cytolysis. While adhesion is blocked, T lymphocytes will not be able to lyse the target cells. McFarland et al (1995) showed that diminished CD43 expression or sialylation on target cells would increase their susceptibility to T lymphocyte-mediated cytolysis, suggesting that CD43 plays a predominant role in anti-adhesion, making target cells more resistant to T lymphocyte cytolysis.  1.6.3  ADHESION To prevent cell to cell repulsion in vivo, some cell surface glycoproteins may  undergo proteolytic cleavage. For example, receptors expressed on leukocytes including CD 14, CD44, CD 16, L-selectin, CD23 and CD32 as well as TNF are cleaved in response to antibody stimulation (Guy and Gordon, 1987; Huizinga et al, 1988; Jung and Daily, 1990; Kishimoto et al, 1989; Porteu and Nathan, 1990; Bazil and Strominger, 1991; Sarmay et al, 1991; Bazil and Horejsi, 1992). It is believed that CD43 can be cleaved by an endogenous protease which could be a serine protease or a metallo-protease. Remold-O' Donnell (1992) determined that the platelet enzyme calpain specifically cleaves CD43 115 kDa from sialidasetreated T lymphoblastoid cells and normal T lymphocytes. Schmid et al. (1992) observed a 23  soluble galactoglycoprotein that was derived by proteolytic cleavage at a transmembrane site from the surface of neutrophils, activated T lymphocytes and platelets. Later, Bazil and Strominger (1993) confirmed that the soluble protein was identical to the extracellular domain of CD43. The existence of soluble CD43 may either inhibit or mediate interactions between membrane-bound receptors and their cell bound ligands or soluble ligands.  Shedding of CD43 from granulocytes was correlated with homotypic aggregation of activated neutrophils (Rieu et al, 1992). Monoclonal antibodies induce homotypic adhesion of T cells, monocytes and neutrophils (Kuijpers et al, 1992). The mAb LCI, which recognizes the sialic acid epitope of human CD43 115 kDa, causes rapid and vigorous aggregation among normal leukocytes and among T and myeloid/monocytic cell lines (De Smet et al, 1993). Cell adhesion induced by LCI can be blocked by CD1 lot/ CD18 mAb, indicating that CD43 promotes homotypic cell adhesion mediated by the CD1 lot/ CD 18dependent pathway. On the other hand, the mAb can also induce homotypic aggregation via CD1 lot/ CD 18-independent pathways in K-562 cells, which do not express CD 1 lot/ CD 18. As ICAM-1 was described as a counter-receptor of CD43, another ligand CD54 which is in ICAM-1 family expressed on opposite cells may also interact with CD43. Three other antiCD43 antibodies, referred to as 6E5, 6F5 and 10G7, can also induce significant homotypic adhesion of human neutrophils involving more than 50% of cells, in the presence of divalent cations (Ca^+/ Mg2+), energy, temperature (37°C) and an intact cytoskeleton (Rosenkranz et al, 1993). The anti-CD43 antibody 10G7 reacts with a CD43 epitope clearly different from the one recognized by the CD43 antibodies 6E5 and 6F5. Cross-linking sialophorin with certain antibodies mimics the effect of natural CD43 ligands in inducing homolytic aggregation.  24  1.6.4  INDUCTION OF M O N O C Y T E S AND NEUTROPHILS Monoclonal antibodies against leukosialin induce monocyte-dependent T-cell  proliferation (Mentzer et al, 1987; Axelsson et al, 1988; Silverman et al, 1989). L10 induces monocyte-dependent activation and proliferation of human peripheral blood T lymphocytes, calcium signaling in Jurkat cells in the absence of the T cell receptor, as well as homotypic aggregation and oxidative burst responses of monocytes (Menzter et al, 1987; Nong et al, 1989; Silverman et al, 1989). To initiate the oxidative burst response, CD43 antibodies may undergo a different activation and signaling mechanism involving Fc receptors.  1.6.5  SIGNAL TRANSDUCTION M E D I A T E D B Y CD43 CD43 115 kDa enhances the antigen-specific activation of T lymphocytes and  its cytoplasmic domain is hyperphosphorylated during T cell activation (Park etal, 1991). It is constitutively phosphorylated and even hyperphosphorylated upon treatment of T-cells with the tumor promoting phorbol esters such as 12-O-tetradecanoyl phorbol-13-acetate (TPA) and PMA, or anti-CD43 agonistic antibodies (Chatila and Geha, 1988; Piller etal, 1989). Increased phosphorylation of CD43 by PMA may reveal an important regulatory mechanism that governs the process of T cell activation (Cantrell etal, 1985, 1987; Samelson etal, 1985, 1987). The initial signal transduction pathway for both anti-CD43-treated T lymphocytes and monocytes involves induction of inositol phospholipid turnover by extracellular signals (Berridge, 1984). Phospholipase C catalyzes the breakdown of inositol phospholipid to yield two second messengers, inositol trisphosphate and diacylglycerol (DAG) (Wolf etal, 1986). These two second messengers then trigger several downstream events, for instance, the release of calcium from intracellular stores such as the endoplasmic reticulum, promoting Ca2+ uptake, and the activation and translocation of protein kinase C (PKC) from cytosol to plasma 25  membrane in presence of phosphatidylserine (Ku et al, 1981; Wolf et al, 1985). Homotypic adhesion via CD43 is independent of inositol phosphates, C a  2 +  and PKC. One  phosphorylation site of CD43 was identified to be serine residue 332 (Piller et al, 1989). Recently, CD43 was shown to regulate a 93 kDa tyrosine phosphorylprotein in the CD43+ T cell line CEM, which may be involved in T-cell activation and adhesion (Manjunath and Ardman, 1995). However, a common signaling cascade of B-lymphocytes via surface antigens, including CD43, involves activation of tyrosine kinases which lead to homotypic adhesion (Kansas and Tedder, 1991). Elucidation of the signaling pathway triggered by CD43 in multiple cell types will be needed for understanding numerous aspects of leukosialin in immune responses.  1.6.6  CD43 R O L E IN APOPTOSIS CD43 on circulating T lymphocytes can prevent T cells from degradation by  binding to the circulating antibodies. As T cells age and CD43 is shed, the circulating antibodies are able to bind to T cells and cause degradation. Remold-O'Donnell and Rosen (1990) have noticed that shedding of CD43 takes place in the T cells of WAS patients, causing the accelerated senescence of WAS T cells. This is consistent with the observation that polymorphonuclear neutrophils (PMN), which adhere to the endothelium, are eliminated by macrophages when their cell surface CD43 is down-regulated (Rieu et al, 1992). Shedding of CD43 is thought to contribute to the apoptosis process of neutrophils. In addition, crosslinking of CD43 by anti-CD43 mAb MEM-59 induces apoptosis of human hematopoietic progenitor cells (HPC), suggesting that it plays a role in the regulation of HPC proliferation at early stages of hematopoiesis (Bazil et al, 1995). It also helps to promote B-cell expansion and development by delivering a signal to prevent programmed cell death of B cells. Dragone et al. (1995) showed that upregulation of CD43 expression on B cell lineage of transgenic mice 26  increases splenic B-cell number and survival. It was believed that CD43 can deliver a signal to stop programmed death of B cells. If CD43 acts as an anti-adhesion molecule, it may interfere with the binding of other receptor-ligand pairs that are involved in initiating apoptosis (Suda et al, 1993). Alternatively, during B cell maturation, sialic acids on CD43 may interact with a lectin-like receptor when early B cell precursors adhere to stromal cells in the bone marrow. Recently, Baum et al. (1995) have found that inhibiting O-glycan elongation resulted in galectin 1 induced in apoptosis of T cells. Whether CD43 inhibits apoptosis by delivering a signal by itself or by ligand-receptor interactions during adhesion is unclear and requires further investigation.  1.6.7  U P R E G U L A T I O N OF CD43 ON DIFFERENTIATING B LYMPHOCYTES Gulley et al. (1988) demonstrated that unstimulated B lymphocytes did not  express CD43 as the rat anti-mouse CD43 mAb, S7 was non-reactive with resting murine splenic B cells. But mouse CD43 became highly reactive upon lipopolysaccharide (LPS)induction of B lymphocytes during the terminal phases of differentiation, indicating that CD43 was induced and upregulated upon B-cell differentiation. In addition, the tetrasaccharidecarrying murine CD43 recognized by S7 is expressed on early B cell precursors, but it is no longer expressed as cells differentiate to pre-B and B cell stages (Hardy etal, 1991). S7 was also able to distinguish B - l cells from follicular, marginal zone, and immature B cells in the unstimulated spleen. B - l cells are defined as a subpopulation of B cell lineages that express CD5+/ I g M g , I g D ni  h  low  , B220  low  , and adult B - l cells can produce at least 50% of natural  serum IgM in normal mice (Manohar et al, 1982; Hayakawa et al, 1983; Waldschmidt et al, 1992). Wells et al. (1994) found that S7 recognized CD43 on a small population of splenic B cells and the majority of peritoneal B - l cells. Further phenotyping of these subsets during B cell differentiation is needed. 27  1.6.8  CD43 K N O C K O U T M I C E CD43 knockout mice have been generated by homologous recombination via  embryonic stem cell chimeras, and are healthy (Manjunath et al, 1995). They had normal haematocrit values, blood leukocytes and platelet counts, and their bone marrow, thymus and lymph nodes appeared normal as well. Flow-cytometric analysis of thymocytes and splenocytes of CD43 knockout mice revealed CD4 and CD8 T cell subset proportions, normal levels of CD3, CD4 and CD8 expression and B cell (B220+, IgM+) numbers in spleens (Manjunath et al., 1995). CD43-deficient T cells from knockout mice, however, showed substantial increases in vitro in proliferative responses to concanavalin A, anti-CD3, the superantigen staphylococcal enterotoxin B (SEB) and allostimulation, indicating that T cell activation was enhanced. Homotypic adhesion of either those T cells or receptor-ligand binding was also enhanced. Furthermore, while CD43-knockout mice were readily infected with vaccinia virus, and anti-vaccinia cytotoxic T cell responses of the knockout mice was increased as compared with normal mice, they were unable to clear the virus. No explanation for this failure has yet been found.  1.7  OBJECTIVES CD43 plays an important role in the immune system but little is known about its  ligands. In this study, we hypothesize that some CD43 ligands may bind to both glycoforms of CD43 while others specifically bind to one of the CD43 glycoforms. The overall objective of this study was to establish human IgG murine CD43 chimera as a tool to identify the ligands of CD43 glycoforms. This approach has been sucessfully used for other cell surface receptors. For example, CD40 ligand (CD40L) was identified by Armitage et al. (1992) using recombinant human CD40. L-selectin which belongs to the selectin family was another example (Watson et al, 1991). Using a L-selectin/ Immunoglubulin G chimeric probe, 28  Baumhueter et al. (1994) found that CD34 acts as one of ligands for L-selectin to mediate leukocyte trafficking at both lymphoid and nonlympoid sites.  Four specific objectives were identified and accomplished in this study. First, construction of two recombinant CD43 cDNA into two different vectors driven by either metallothionein or SRa promoter was carried out. The recombinant cDNA is comprised of the extracellular domain of murine CD43, and the hinge, CH2 and CH3 of human IgG (Fig. 1.5). The second aim was to transfect these vectors into four different cell lines: CTLL, CTL-2c, NSF-60 and EL-4 cell lines. CTLL and CTL-2c cells were shown to express the hexasaccharide form of CD43 and have high C2GnT activity, whereas EL-4 cells was shown to express the tetrasaccharide form of CD43 and have no detectable C2GnT activity. NSF-60 cells express both glycoforms of CD43 and have C2GnT. Therefore, these four transfected cell lines were expected to express the corresponding recombinant glycoforms. The third objective was the purification of recombinant prot ein products by protein A sepharose and Wheat Germ Agglutinin (WGA) columns. And the final objective was the characterization of all soluble CD43-IgG chimeric proteins in terms of their molecular weights, reactivities to specific antibodies and precipitation by Jacalin sepharose.  29  FIG. 1.5 MOUSE CD43-HUMAN IsG CHIMERIC PROTEIN  Polylactosamine  c  c 30  CHAPTER 2  2.1  M A T E R I A L S AND METHODS  MATERIALS Murine genomic CD43 cloned in Bluescript (BS) was kindly provided by F.  Takei (Terry Fox Laboratory, Vancouver, BC). Human IgG in pAG4270, also in Bluescript, was provided by S. Morrison (University of California, Los Angeles, CA). Restriction enzymes: T4 DNA ligase, Sac I, Xho I, Bgl II, Sal I, DNA Ladder (1 kb) and agarose were purchased from GIBCO BRL (Gaithersburg, MD). Sfi I, Stu I, Sma I, Sac II, Apa I and Vent DNA polymerase were from New England BioLabs Inc (Beverly, MA). Sephaglas BandPrep Kid was obtained from Pharmacia Biotech (Vancouver, BC). Gene pulser cuvettes, Western blot apparatus and high molecular weight marker were purchased from Bio Rad (Hercules, CA). Petri dishes were from Fisher Scientific Co (Vancouver, BC). QIAGEN Plasmid Midi kit (25) was purchased from QIAGEN Inc (Chatsworth, CA). Tissue culture materials including RPMI 1640 medium, fetal bovine serum (FBS), L-glutamine were obtained from Gibco (Grand Island, NY). Antibiotics penicillin and streptomycin were from Stem Cell technologies (Vancouver, BC). Tissue culture flasks (175 ml) were from Sarstedt Inc (Newton, NC). The 96 well flat-bottomed plates were obtained from Nunclon Inc (Roskilde, Denmark), and 96 well U-bottom well plates for enzyme-linked immunosorbent assay (ELISA) were purchased from Becton Dickinson (Oxnard, CA). Protease inhibitors: leupeptin protease inhibitor (LEU), soybean trypsin inhibitor (SBTI), phenyl paramethyl sulfonal fluoride protease inhibitor (PMSF), pepstatin (PEP) were from Sigma Chemical Co (Mississauga, ON). 2.2'-Azino-bis(3-Ethylbenz-Thiazoline-6-Sulfonic acid) (ABTS) used in ELISA also purchased from Sigma Chemical Co. Immunobilized Jacalin and WGA were ordered from Pierce (Rockford, Illinois), and anti human IgG conjugated to FITC was from CalibiochemNovabiochem corporation (San Diego, CA). 31  2.2  TISSUE C U L T U R E EL4, CTL2c, CTLL, NSF60 cells were cultured in RPMI 1640 medium  supplemented with 10% FBS, 20 mM glutamine, 10 U/ml penicillin/streptomyocin, and 5 X 10" M 2-p-mercaptoethanol (2-Me) (Fisher Scientific Co., Fair Lawn, NJ) in a 5% C024  95% at 37°C. CTL2c and CTLL are IL2-dependent (20 U/ml) for growth whereas NSF-60 cells are mouse IL3-dependent (20 U/ml). EL4 cells are factor independent. Once a month, CTL2c cells required stimulation by gamma radiated P815 cells in a 1:1 ratio. To count suspension cells, 10 pi of cell samples and 10 pi eosin were mixed and spread on a haemocytometer. Total number of cells were determined by the equation :  Sum of number of cells of corner squares _ Number of corner square counted  X 10 X Total Volume 3  The medium conditions for non-transfected cells were exactly the same as that for transfected cells. Transfected cells were also cultured in 175 ml tissue culture flasks. A freezing stock of transfected cells was made. Cells were spun down at 1500 rpm and were at 5X10^ cells/ml. Supernatants were aspirated and replaced with a mixture of 90% FBS and 10% of dimethylsulfoxide (DMSO) (Aldrich, Milwankee, WI). Cells were transferred to freezing vials (Nunclon, Rosklide, Denmark) and kept on ice for 20 min. Finally, all the vials were transferred to liquid nitrogen.  2.3  P R E P A R A T I O N OF ANTIBODIES Anti-human IgG gamma (Anti-hlgG) was obtained from Calibiochem-  Novabiochem corporation (San Diego, CA). For ELISA, 5 pg/ml of anti-human IgG was  32  used, and for Western blotting, 0.5-1 (J-g/ml was sufficient to detect the chimeric proteins. Mouse absorbed anti-human IgG (Fc specific) (Cedarlane, Hornby, ON) was also used at 10 |ig/ml for ELISA and at 2 (ig/ml for Western blotting. Anti-CD43 antibodies were described by Gulley et al. (1988) and Tomlinson Jones et al. (1994). To produce ascites for rat antimouse CD43 monoclonal antibodies, the corresponding hybridoma cells, SI 1, S7 and 1B11 were injected into BALB/C mice which were pristane primed at least 5 days prior to cell injection, and harvested after 10 days. Antibodies were purified from ascites fluid by affinity column chromatography, followed by dialyzing against three changes of IX phosphate buffered saline (PBS) which contained : 0.137 M NaCl, 0.0027 M KC1, 0.0081 M Na2HP04 and 0.0015 M KH2PO4. The concentration of the antibodies were determined by spectrophotometer at an absorbance wavelength of 280 nm. Portions of the affinity purified antiCD43 antibodies were conjugated with fluorescein-isothiocyanate and some were biotinylated according to the procedure described by Goding (1986).  2.4  C O N S T R U C T I O N OF PLASMIDS pBS.CD43. pBS.IgG. pBS.CD43IgG. pBMG.CD43-IgG A N D pBSR.CD43-IgG Polymerase chain reaction (PCR) was used to amplify the extracellular domain  of mCD43 from pBK.CD43 and the constant domain of human IgG (MgG) from pAG4270. Four oligonucleotide primers were synthesized by John Babcock at the Biomedical Research Center (Vancouver, BC). The sequence of the sense primer of CD43 was 5'CCGTCGACAGATGGCCTTGCACCTTCTC3' and that of the anti-sense primer was 5 'TCGGTTCTT AGTTC ACCGTCT AG A AC3'. A Sal I site was added to the sense primer and a Bgl II site was added to the anti-sense primer. In contrast, a Bgl II site was added to the sense primer of hlgG, 5'GCAGATCTTGTGACAAAACTCACACAT3' and a Sal I site was added to the hlgG anti-sense primer, 5'GACAGAGGCCCATTTACTCAGCTGCC3'. The 33  melting temperature (Tm) for the sense and anti-sense oligonucleotides of CD43 and hlgG primers were calculated to be 68.6, 61.3, and 59.7, 66 °C respectively, according to the equation :  61.6°C + 0.41(G+C)% -  — Total number of bases in the primer  Hence the annealing temperature was chosen to be 55°C. Thirty cycles of 96°C for 1 min (denaturation), 55°C for 1 min (annealing) and 72°C for 3 min (extension) were set on a Perkin-Elmer Thermal cycler for the amplification of the extracellular domain of mCD43 and the constant domain of hlgG.  The final volume of the PCR mixture was 50 pi which included 1 X PCR buffer [lOmM KC1, lOmM (NH4)2SC>4, 20 mM Tris-HCl (pH 8.8, @ 25°C), 2 mM MgS04, 0.1% Triton X-100], 2.5 mM dNTP, 2 pM each sense and anti-sense primers, 10 ng plasmid, 1 pi Vent polymerase and distilled water. Vent polymerase has 3' to 5' exonuclease activity to proofread the sequence. The two amplified products, 758 bp for CD43 and 914 bp for hlgG, were separated on a 1.0% agarose gel and visualized with 5 pg/ml ethidium bromide. The two bands were excised from the agarose gel and all the agarose was removed according to the instructions provided with the Pharmacia gene clean kit. The two fragments were then subcloned into EcoRV linearized Bluescript plasmids by blunt end ligation. Ligation, transformation and mini-preparation of two newly cloned vectors were performed as described by Maniatis et al. (1989). To identify correctly oriented plasmids, the newly subcloned plasmids were digested by various restriction endonucleases (New England Biolabs) and subjected to 1% agarose electrophoresis. QIAGEN plasmid maxi kit was used for purifying all plasmids including the pBS.CD43-IgG, pBMG.CD43-IgG and pBSR.CD43-IgG. We  34  observed that the subcloned Bluescript plasmids grew efficiently in Luria- Bertani (LB) medium, whereas the two expression vectors grew better in 2xYT than in LB medium. Finally, we used the host Escherichia coli strain DH5oc to propagate plasmids as this strain has previously been shown to improve the yields of DNA (Qiagen manual).  2.5  C E L L TRANSFECTION The purified pBMG.CD43-IgG and pBSR.CD43-IgG were not linearized prior  to electroporation. Cells were centrifuged at 1500 rpm and washed twice with I X PBS (free Mg2+ and Ca2+). The cells were then counted and resuspended with PBS to 1.0-2.0 X 10 ^ cells/ml. An aliquot (0.8 ml) of the suspension was mixed with 30-50 ng of purified DNA in cuvettes (BioRad) and kept on ice. Using a BioRad pulse machine, each different cell line was pulsed at a particular voltage and capacitance that have been previously determined: EL4 cells at 500 pF and 350 V; CTL2c cells at 500 pF and 250 V; CTLL cells at 960 uF and 260 V; and NSF60 cells at 250 pF and 350 V. They were washed twice with RPMI medium and diluted to 10 cells/ml with the medium. After 2-3 days, G418 (Gibco) was supplemented and cells 4  were plated in 96 well flat-bottomed plates. Clones which were resistant to G418 were selected between 10 days and 21 days. The final concentration of G418 for transfected EL4 cells was 0.49 mg/ml; for transfected CTL2c cells was 0.21 mg/ml; for transfected CTLL cells was 0.80 mg/ml; and for transfected NSF60 cells was 0.21 mg/ml. However, before G418 was added to transfected CTL2c cells, the cells needed to be stimulated at a 1:1 ratio with P815 cells which were gamma radiated.  All cell lines used, EL4, CTL2c, CTLL and NSF60 cells were transiently transfected with both constructs, namely pBMG.CD43-IgG and pBSR.CD43-IgG.  35  2.6  SCREENING FOR TRANSFECTED C E L L S After 10-21 days of culture in G418 medium, supernatants from wells  containing viable cells were screened for the production of chimera by ELISA. The goat antihuman IgG gamma or mouse absorbed goat anti-human IgG Fc specific antibody was diluted to 5 |0g/ml with 1 X PBS and 50 pi of diluted anti-human IgG was dispensed to each well of 96 well microtitre ELISA plate. To improve sensitivity of ELISA, we found that mouse absorbed anti-human IgG gave less non-specific binding to human IgG and obtained a more accurate measurement of expression of the chimeric proteins. Plates were then washed and blocked once with 1 X PBS and 0.5% skim milk, and filled with 50 ul 1 X PBS/0.5% milk except for the first row/column. Aliquots (100 |ll) of supernatants of clones or 100 ul purified samples of chimeras were added to the first row/column of each plate and titrated down in 1:2 dilution steps. The last row/column of each plate was filled with 50 ul 1 X PBS/0.5% skim milk only. After incubation for at least one hour at 37°C, plates were washed and blocked once with 1 X PBS/0.5% skim milk. 10 (ig/ml anti-CD43 antibodies (SI 1, S7, 1B11) were added to designated plates and incubated for at least another hour. The wash and block steps were repeated three times, followed by addition of goat anti-rat IgG coupled to horse radish peroxidase (HRP) and incubating for another hour. In addition to washing and blocking once, all the plates were washed with distilled water three times. To observe a color change, 50 ul substrate stopping buffer which included citrate buffer: 1.29 g citric acid and 1.1 g anhydrous Na2P04, ABTS (1 mg/ml citrate buffer), and 3% H2O2 (2 uj/lml ABTS-citrate buffer) was added to each well of the plates. Twenty minutes later, the absorbance of each plate was recorded using spectrophotometer designed to read 96-well microtitre plates. To ensure clonality, two wells of positive cells from each cell line which gave high titers were expanded for limiting dilution and were reselected using G418. Three clones were assayed by ELISA and the highest titer clone from each type of cells was expanded for further characterization.  36  The transfected EL4, CTL2c, CTLL and NSF60 cells are herein referred to as EL4/28, CTL2c/Cl, CTLL/2A and NSF60/C9, respectively.  2.7  PURIFICATION OF CHIMERIC PROTEINS The nontransfected or transfected cells were centrifuged at 2000 rpm and 4°C.  Their surpernatants were harvested and filtered through 0.2 m filters. Four different supernatants were run through separate protein A sepharose or columns (Pharmacia Biotech, Baie d'Urfe'). Then 0.1M glycine (pH 2.5) was applied to elute the bound proteins including CD43-IgG, and the eluates were neutralized with saturated Tris base. All eluates were dialyzed overnight with three changes of 1 X PBS. The four 100 X concentrated samples in PBS were purified on individual WGA columns which were pre-washed with WGA loading buffer, composed of: 50 mM Tris-HCl (pH 7.7), 0.2% Triton X-100, 150 mM NaCl, 20 pg/ml LEU, 20 pg/ml SBTI, 80 pg/mg PMSF, 20 pg/ml PEP. The samples were run through the column once and the flow through was reapplied, followed by addition of WGA Elution Buffer [50 mM Tris-HCl (pH 7.7) 0.2% Triton X-100, 0.3 M N-acetylglucosamines (ICA Biochemicals, Cleveland, OH), 20 pg/ml LEU, 20 pg/ml SBTI, 80 pg/ml PMSF, and 20 pg/ml PEP]. A l l samples were stored at -20°C.  2.8  P R E P A R A T I O N OF C E L L E X T R A C T S The cells were washed twice with 1 X PBS (free Ca^+ and Mg2+),  resuspended in homogenization buffer which included: 10 mM HEPES, 2 mM EDTA, 1 mM Dithiothreitol (DTT) (Boehringer Mannheim Inc, Laval, Quebec), 40 pg/ml LEU, 10 pg/ml SBTI, 2 pg/ml PEP, and 40 pg/ml PMSF. Cells were then sonicated three times for 3 sec  37  followed by 30 sec on ice. The lysed cells were spun 15 sec at high speed in a microfuge, and the supernatants were transferred to TL100 polycarbonate tubes (Beckman) and centrifuged at 70,000 rpm for 30 min. The supernatants (cytosolic extracts) were kept at -70°C. The pellets which contained membrane extracts were resuspended in solubilization buffer (10 mM HEPES, 2 mM EDTA, 1 mM DTT, 40 ug/ml LEU, 20 ug/ml SBTI, 2 |ig/ml PEP, 40 u,g/ml PMSF and 1% Nonidet P40), sonicated and centrifuged at 70000 rpm for 30 min at 4°C. The supernatants which were now referred to as membrane extracts were kept at -70°C until used for western blotting.  2.9  C H A R A C T E R I Z A T I O N OF CHIMERIC PROTEINS B Y W E S T E R N BLOTTING SDS-PAGE was carried out using a mini gel apparatus (BioRad). All samples  were boiled at 95 °C for 5 min in either 2-Me added or no 2-Me added SDS sample buffer, before loading on 7.5% acrylamide gels. After electrophoresis, proteins were transferred to nitrocellulose (Schleidier and Schuell Dasell FRG) for one hour. Nitrocellulose membranes were placed in blocking buffer consisting of 5% BSA and 1% ovalabulmin (Sigma) overnight. All blots were rinsed three times with TBSN [0.02 M Tris HC1 (pH 7.5), 0.15 M NaCl, and 0.05% NP-40]. Primary antibody SI 1, S7, IB 11, or goat anti-human IgG in blocking buffer was added at 2 fig/ml and shaken gently for 1-2 hours, following by washing with three times with TBSN. The secondary antibody anti-rat IgG POD or anti-goat IgG POD was added to the blots and shaken gently. After one hour, the blots were washed twice with TBSN and twice with TBS [0.02 M Tris HC1 (pH 7.5) and 0.15 M NaCl]. Finally, the blots were developed using the enhanced chemiluminescence ECL detection system (Amersham Life Science, Buckinghamshire, England), and were exposed to X-OMAT-AR X-ray films (Eastman Kodak, BC). 38  2.10  .TACALIN PRECIPITATION Immobilized Jacalin (600 pi) was washed with PBS three times and  resuspended to 1200 pi PBS. Each purified chimeric protein was taken out 500 pi and added to 200 pi PBS-Jacalin in an eppenforf tube. Similarly, 500 pi membrane extracts of EL4 and CTL-2c cells were added to 200 pi PBS-Jacalin. All tubes were rotated overnight at 4C, and spun at high speed to separate Jacalin bound chimeras from supernatants. Then 2-Me added SDS sample buffer was mixed with the pellets and boiled at 95C for 4 min. To remove all Jacalin agarose, the SDS sample buffer was spun down and SDS-PAGA was followed that was discussed in section 2.9.  2.11  F L U O R E S C E N C E A C T I V A T E D C E L L SORTING BDF mice were injected with EL4 and EL4/28 cells and allowed to grow for ten  days to two weeks. Then their thymus, lymph nodes and spleen were harvested and kept in 1 X PBS. To prepare single cell suspensions, the tissues were minced and sieved through cell screens with 1 X PBS. Cells were washed once using FACS buffer (1 X PBS and 2% FBS), and then filtered through a 0.7 m filter (FALCON). Cells were counted and resuspended in 5 x 10 cells/ml. Thymocytes, splenocytes or lymphocytes (100 pi) were loaded on 96 well plates (round-bottom, Nunclon, Denmark). Appropriate antibodies (S7, S l l , IB 11 and anti hlgG) conjugated to FITC were added and incubated for 20-30 min at 4°C. The stained cells were spun at 2000 rpm for 2 min and blocked. FACS buffer (100 pl/well) were added to wash all stained cells once and spun down again. Finally each well was resuspended in 100 pi FACS buffer and transferred to Falcon tubes which were already put 300 pi FACS buffer. A l l tubes with stained cells were kept on ice and ready for FACScan (Becton-Dickson, Mountain View, CA).  39  CHAPTER 3  3.1  RESULTS  CONSTRUCTION OF cDNA FOR CD43-IgG C H I M E R A S Using a recombinant DNA approach, construction of the mouse CD43-human  IgG cDNA chimera proceeded in several steps. First, the extracellular domain of the murine CD43 cDNA and the constant domain of the human IgGl cDNA which includes the hinge, CH2 and CH3 regions were each amplified using polymerase chain reaction (PCR). The murine CD43 gene was amplified from genomic DNA that was obtained from F. Takei. Since the CD43 genomic sequence does not contain any introns, the amplified CD43 genomic DNA acts as a cDNA which encodes from 30 base pairs (bp) upstream of the initiation codon of mouse CD43 to 30 bp downstream of the termination codon. This segment also possibly contains the ribosomal binding sequence, but excludes the polyadenylation signal. The heavy chain of human IgGl was amplified from the plasmid, encoding the heavy chain enhancer, promotor and exons, and the genomic human IgG gamma 1 constant region. It was obtained from D. Morrison (Coloma et al, 1992).  The 758 bp CD43 fragment was amplified starting from AUG to the end of extracellular domain of CD43, while the 914 bp of IgG fragment was amplified from the hinge domain to the CH3 domain of hlgG (Fig. 3.1a and b). These two amplified 752 bp and 914 bp fragments were separated on 1% agarose gel, as shown in Fig. 3.1c. In order to facilitate the construction of an in-frame functional recombinant mCD43-hIgG DNA, we also designed four specific PCR primers encoding either Sal I or Bgl II DNA sequences. The plasmids initially contained neither Sal I nor Bgl II restriction enzyme sites. We needed to ligate the 3' end of the mCD43 to the 5' end of the hlgG amplified fragment at the Bgl II site and then subclone the entire mCD43-hIgG at the Sal I site into two distinct expression vectors which 40  FIG. 3.1 Schematic representation of mouse CD43 and human IgG PCR fragments. (A) The extracellular domain of mouse CD43 was amplified by PCR and its restriction sites are shown. Sal I and Bgl 11 were generated at 3' and 5' ends respectively. (B) The hinge, CH2 and CH3 domains of human IgG were amplified. Bgl 11 and Sal I sites were introduced to 3' and 5' ends of the amplified human IgG. (C) The two amplified fragments were analyzed on 1% agarose gel, demonstrating that mCD43 was about 700 bp and hlgG was about 900 bp.  A. Mouse CD43 PCR product (758 bp).  Sail  Xhol Pstl Pstl Pstl  Sphl Pstl  Apal  ATG  BstXI  Drall  B. Human IgG PCR product (914 bp). Bqlll  Drall  , Sfil  Smal  Stul Drall  C. Amplified fragments visualized on 1 % agarose gel. M mCD43 hlgG 1018bp 506bp  41  B  9  have unique Sal I site. Therefore, the Sal I and Bgl II sites were introduced at the 5' end and 3' end of mCD43, and at the 3' end and 5' end of hlgG, respectively (Fig. 3.1a and b).  The second step was to subclone individually the two amplified fragments into Bluescript plasmids. Both PCR fragments were inserted into EcoR V linearized Bluescript (pBS) by blunt end ligation, and purified by Qiagen Maxi prep. The two resulting plasmids were selected by ampicillin (amp) antibiotic and were named pBS.mCD43 and pBS.hlgG (Fig. 3.2a and b). To check the orientation of the two inserts, the Bluescript subcloned with murine CD43 was digested by Sal I, Apa I and Xho I while that subcloned with human IgG was cut by Sma I and Sac II (Fig. 3.2c). Digests of the pBS.mCD43 plasmid gave small fragments of CD43: 791bp, 203 bp, or 204 bp respectively, in addition to the rest of the plasmid. The pBS.hlgG digests yielded a small fragments of either 643 bp or 389 bp respectively, plus the rest of plasmid. Thus, mCD43 cDNA and hlgG cDNA were subcloned into pBS.mCD43 and pBS.hlgG respectively in correct orientation.  Next the two vectors pBS.mCD43 and pBS.hlgG were digested by Bgl II and Sea I, and ligated to yield a new Bluescript containing mCD43-hIgG. The digests were run on 1% agarose gel and the 1911 bp and 2729 bp fragments containing CD43 and IgG respectively were excised (Fig. 3.3a). All agarose was removed according to the Pharmacia Sephaglas Band Prep Kit. As the Sea 1 restriction enzyme cuts the amp resistance gene, the amp resistance genes for both vectors were temporarily out of function. When the inframe coding CD43-IgG recombinant sequence was created after joining of the 3' end of the mCD43 to the 5' end of the hlgG at the Bgl II site, the amp resistance gene was restored by joining the other ends at the Seal I site (Fig. 3.3b). In order to check the orientation, the restriction enzymes: Sac II, Xho I, Sal I, Apa I and Sma I were used to cut selected amp-resistant plasmids. The result of restriction analysis is shown in Fig. 3.3c. Plasmids numbered 3 and 19 were 42  Fig. 3.2 Schematic diagram of pBS.mCD43 and pBS.hlgG and the restriction enzyme analysis of the contracts. (A) The extracellular domain of mouse CD43 was subcloned into the BS vector by blunt end ligation at EcoRV site. (B) The constant domain of human IgG was also subcloned into the BS vector by blunt end ligation at EcoRV site. (C) To check the orientaions of the two inserts, the pBS.mCD43 was digested with Sal I, Apa I or Xho I. Each digestion yield a small fragment, 791 bp, 203 bp or 204 bp, respectively, indicating that the amplified CD43 was inserted correctly. The pBS.hlgG was digested with Sma I and Sac II, and gave two corresponding IgG fragments, 643 bp and 389 bp fragments. Hence it was also subcloned with the right orientation.  A. The construct of pBS.mCD43.  Xhol (1498)  43  B. The construct of pBS.hlgG.  Sail  (1648)  C. Restriction enzyme analysis of pBS.mCD43 and pBS.hlgG. S a c II  S pBS X m hlgG h a o I  A p a I  I  S a  pBS M mCD43  I I  3054bp  1018bp 506bp  44  Fig. 3.3 Construction of pBS.mCD43-hIgG and its restriction enzyme analysis. (A) The pBS.mCD43 and pBS.hlgG were cut at Seal I and Bgl II sites and each plasmid gave two fragments. Thel91 lbp band from the digested pBS.mCD43 and 2729 bp band from the digested pBS.hlgG which contained mCD43 and hlgG respectively were excised from 1% agarose gel and purified. Purified samples (2 pi of each) were loaded on 1% agarose gel. (B) The two fragments were then religated at Bgl II and Seal I sites to give a new constuct, called pBS.mCD43-hIgG, as shown in the schematic diagram. (C) To check the insert's orientation and its copy number, four finished constructs were cut by restriction enzymes: Sac II, Xho I, Sal I, Apa I and Sma I. The digested plasmids and uncut plasmids were visualized on 1% agarose gel. The plasmids numbered 3 and 19 show that digestion of Sac II, Xho I and Sal I, Apa I, Sma I, gave 1151 bp, 1107 bp, 1680 bp, 1121 bp and 1405 bp, fragments respectively, confirming that they had correct orientation of the insert and each had only one copy of the insert. Hence, the mCD43hlgG was successfully formed in the conducts 3 and 19. The other two contructs 7 and 12 were not digested by the enyzmes and were possibly religated pBS.mCD43 plasmids, as the digestion of pBS.mCD43 with Sea I and Bgl 11 yielded two similar fragments which were 1911 bp and 1811 bp (Data not shown).  A. Linearized pBS.mCD43 and pBS.hlgG fragments.  M mCD43  2036bp  45  hlgG  B. Diagram of pBS.mCD43-hIgG construct.  C. Amp selection of pBS.mCD43-hIgG.  identified as having inserts in the correct orientation and plasmid 3, renamed pBS.mCD43hlgG was purified for further subcloning.  The final step in constructing the CD43-IgG chimeric vector was to insert the CD43-IgG DNA of the pBS.CD43-IgG construct into two expression vectors, pBMGneo and pBSRocGneo (Karasuyama and Melchers, 1988; Takebe et al, 1988). Both of these expression vectors contain a rabbit (3-globin splice, poly A and human (3-globin, 69% bovine papilloma virus (BPV), and Neo resistance genes. The BPV sequence has been shown to aid in the propagation of cloned DNA sequences as stable extrachromosomal elements in transformed cells (Sarver etal, 1981; Campo, 1985). The promoters in these expression vectors, however, are different: pBMGneo is driven by the metallothionein promoter whereas the pBSRaGneo is driven by SRa (Fig. 3.4a and b). The metallothionein promoter may allow further induction of the expression of proteins in presence of heavy metals such as zinc, while the SRa promoter is comprised of the simian virus 40 (SV40) early promoter as well as the R segment and part of the U5 sequence (R-U5 ) of the long terminal repeat of human T cell 1  leukemia virus type 1 (Takebe et al, 1988). Both promoters have been demonstrated to be capable of promoting a high level of expression of various cytokine cDNAs in eukaryotic lymphoid cells (Karasuyama and Melchers, 1988; Takebe et al, 1988).  Each of the two expression vectors, pBMG and pBSR, was linearized at their unique Sal I restriction site located immediately after the promoters. The mCD43-hIgG cDNA which was 1666 bp was cut out from the pBS.CD43-IgG at the Sal I sites, and was run on 1% agarose gel followed by removal of agarose. The purified mCD43-hIgG cDNA was then ligated to the linearized expression vectors at their Sal I sites. To check the orientation of the insert, the newly cloned vectors were digested with the following restriction enzymes: Apa I, Sma I, Sal I, Xho I, Bgl II, and Nco I (Fig. 3.4c). Apa I digestion gave a 1300 bp and 1600 48  Fig. 3.4 Cloning of mCD43-hIgG into the two expression vectors. (A) The mCD43-hIgG taken out from the bluescript vector was subcloned into the expression vector driven by metallothionein promoter, called pBMGneo. (B) The insert was subcloned into another vector driven by SRa promoter, called pBSRaneo. (C) The two subcloned expression vectors, pBMG.mCD43-hIgG and pBSR.mCD43-hIgG were digested by Apa I, Sma I, Sal I, Xho I, Bgl II and Nco I . The result of each digestion and the uncut plasmids were visualized on 1% agarose gel. Apa I digestion gave a 1300 bp and a 1600 bp fragments while Sma I digestion gave a 2000 bp and a 4000 bp fragments, showing that the orientation of mCD43-hIgG was correct. Further confirming its orientation, the 1700 bp fragment was cut by Xho I digestion and the 1666 bp fragment was cut by Sal I while the two small fragments, a 1636 bp and a 2795 bp bands were yielded by Bgl II cut, Nco I digestion revealed that there was only one insert in each plasmid as a 2480 bp band which contained only one mCD430-hIgG insert was observed.  A. Schematic diagram of pBMG.mCD43-hIgG. Apal (15644) Neo Smal (15360). Ncol (14955)  Ncol(50/  Sail (715) Apal (1305) Xhol(1310)  mCD43-hIgG  Bglll (1467)  Bglll (14360  Smal (209 f)  Sail (2375)  Ncol (2510) Apal (2921) Xhol (3020) " Bglll (3103)  pBR322  Rabbit (3-globin splice & poly A  Bglll (3546) BamHI (3565)  Human (3-globin Ncol (10329) Ncol (10118)  Bovine Papillomas Virus  Smal (6163) Bglll (8755) Smal (8185)  49  B. Diagram of pBSR.mCD43-hIgG.  BamHI(13) Smal (19)  Neo  Apal (1270)  Apal (15609) Smal (15325) Ncol (14920) Bglll (14325)  mCD43-hIgG  Xhol (1275) Bglll (1432) Smal (2056) .Sail (2340) Ncol (2475) Apal (2886) Xhol (2985) Bglll (3068)  pBR322  Rabbit (3-gIobin splice & Poly A  Bglll (3511) BamHI (3530)  Human (3-globin Ncol (10294) Ncol (10083)  Bovine Papillomas  Virus  Smal (6128) B  glll (8720)  \ Smal (8150)  50  C. Restriction analysis of the two expression vectors. pBMG.mCD43-hlgG u n c u t  A P a 1  S S M m a a 1 I I  X h o 1  B g 1 II  » N M c 0 1  3054 bp 2036 bp 1636 bp 1018 bp 506 bp pBSR.mCD43-hlgG u n c u t  A P a 1  S S M m a a 1 I I  X h o 1  B g 1 II  •  N M c 0 1  3054 bp 2036 bp 1636 bp 1018 bp 506 bp  bp fragments while Sma I digestion gave a 2000 bp and a 4000 bp fragments, suggesting that the insert was correctly subcloned into pBMG and pBSR vectors. Further confirming that the orientation was correct, Sal I cut gave the 1666 bp mCD43-hIgG insert, and Xho I also yielded 1700 bp fragment. The digestion of both vectors with Bgl II, yielded four fragments: 1636 bp, 2795 bp, 5209 bp and 5605 bp. To ensure that only one copy of the insert was cloned, the pBMG and pBSR subcloned vectors was digested with Nco I giving five fragments, 210 bp, 760 bp, 2480 bp, 4600 bp and 7600 bp. Thus we confirmed that the two constructs, pBMG.mCD43-hIgG and pBSR.mCD43-hIgG were subcloned with correct orientation and copy number.  3.2  C E L L U L A R EXPRESSION OF CD43-IgG C H I M E R A S Since the carbohydrate moieties of the CD43 glycans may play a role in the  recognition of CD43 ligands, it is important to choose the appropriate types of cells used for the expression of mCD43-hIgG chimeric proteins. Three T cell lines: CTLL, CTL2c and EL4 cells and a myeloid cell line, NSF60 were selected for the expression of the chimeric proteins. CTLL and CTL2c cytotoxic cell lines exclusively express the 135 kDa, hexasaccharide form of CD43, whereas EL4 cells express the 115 kDa tetrasaccharide form (Tomlinson Jones et al, 199A). Supporting this pattern of CD43 glycoform expression, CTLL and CTL2c cells express considerable C2GnT activity whereas EL4 cells do not (Barran et al, in press). NSF cells normally express both forms of CD43 with varying degrees and also express C2GnT activity at medium levels (personal communication).  By means of electroporation, the membranes of the four cell types were transiently permeablized to permit uptake of either one of the two vectors, pBMG.mCD43hlgG or pBSR.mCD43-hIgG. To stabilize cells after transfection, they were maintained in 52  standard culture medium for 48 hours after electropbration. At that time, they were periodically observed under the microscope until approximately 30% recovery. Cells were then plated out into 96-well flat bottomed plates in the presence of G418 at concentrations which we had previously determined to be optimal for G418 selection. Because the transfected CTL2c cells had a very low recovery rate, CTL2c growth was stimulated by co-culturing with y-irradiated P815 cells for 24 hours prior to the addition of G418. Transfected EL4 cells were selected in 0.49 mg/ml active G418; transfected CTL2c cells in 0.221 mg/ml active G418; transfected CTLL in 0.80mg/ml and transfected NSF-60 cells in 0.221mg/ml G418. For EL-4, CTLL and NSF-60 cells, more than 50% of wells of the 96 plates showed cell growth after 2 weeks. However, less than about 1% of wells plated with transfected CTL2c cells showed recovery, even though P815 cells were added to stimulate cell growth. Both pBMG.CD43-IgG and pBSR.CD43-IgG vectors were successfully transfected into EL4, CTLL and NSF60 cells; however, only the latter vector was successfully transfected into CTL2c.  Since immunoglubulin molecules are normally secreted as dimers linked by one or two disulfide bridges in the hinge region, the four transfected cell types were expected to secrete soluble dimerized proteins. The supernatants of viable cells from the 96 well plates were screened by the sandwich ELISA for the production of mCD43-hIgG. The human IgG constant domain of soluble chimeric proteins was captured by anti-human IgG Fc specific antibody and the CD43 domain was then detected specifically by the anti-CD43 antibodies SI 1, S7 and IB 11 (Fig. 3.5). Anti-rat IgG coupled to HRP, followed by enzyme substrate, was added to each plate for visualization of the immunoreactive chimeras. Wells which contained cells actively secreting chimeras, were selected and cloned by limiting dilution, ensuring that a single colony from each cell line was selected. Clones were expanded and high density cultures were tested for chimera titres by titrating with the conditioned media. Clones with the highest titre from each cell line were chosen for further analysis. 53  Fig. 3.5 Sandwich ELISA for screening mCD43-h!gG chimeras  Anti rat-HRP.  Rat anti-CD43 mAb: S11/S7/1B11  mCD43-h!gG  Goat anti-hlgG  54  Transfected EL4 clones carrying pBMG.mCD43-hIgG gave the highest titre of the chimeras among all other EL4 clones having BSR.mCD43-hIgG. Interestingly for the transfected CTL2c, CTLL and NSF60 cells, clones having pBSR.mCD43-hIgG vector had a higher level of chimera production. Further analysis of the secreted mCD43-hIgG chimeras was performed using the following four subclones: 1) EL4/28 having pBMG.mCD43-hIgG, 2) CTL2c/Cl having pBSR.mCD43-hIgG, 3) CTLL/2A having pBSR.mCD43-hIgG, and 4) NSF60/C9 having pBSR.mCD43-hIgG. As EL4/28 cells were transfected with the metallothionein promoter driven expression vector, we attempted to increase the expression of mCD43-hIgG obtained from EL4/28 cells by addition of zinc to induce the pBMG.mCD43hlgG vector. EL4/28 cells were grown in standard medium supplemented with 0-150 flM ZnCl2 for three days. Their supernatants were harvested and levels of mCD43-hIgG chimera were measured by the capture ELISA. However, the addition of ZnCl2 did not noticeably enhance the expression of chimeric protein from EL4/28 cells.  3.3  B I O C H E M I C A L C H A R A C T E R I Z A T I O N OF T H E C H I M E R I C PROTEINS  3.3.1  C O M P A R I S O N OF T E T R A S A C C H A R I D E AND H E X A S A C C H A R I D E C A R R Y I N G C H I M E R I C PROTEINS Supernatants from transfected and nontransfected EL4 and CTL2c cells were  harvested and filtered. As a first step supernatants were purified by a protein A Sepharose column, which is widely used as a tool for the extraction and isolation of a broad variety of IgG molecules (Goding, 1978; Goudswaard et al., 1978; Miller and Stone, 1978). Protein A  55  has at least two binding sites for IgG molecules (Hjelm et al, 1975), via the Fc part of the heavy chain (Kronvall and Frommel, 1970). Mouse CD43-hIgG bound to Protein A was eluted by 0.1 M glycine and was dialyzed against PBS. All fractions of eluates and flow through from each cell type were tested by ELISA for the presence of mCD43-hIgG recombinant protein. The eluate fractions which contained mCD43-hIgG were pooled, and further purified by WGA. Wheat Germ Agglutinin binds to N-acetylglucosamine containing carbohydrate structures, specific for (3-D-GlcNAc-(l-4)-(3-D-GlcNAc(l-4)-GlcNAc, 0-DGlcNAc-(l-4)-p-D-GlcNAc as well as sialic acids. Bound mCD43-hIgG was eluted using 0.3 M N-acetylglucosamine, and column fractions were again tested by ELISA. The purified chimeras were finally analyzed by SDS-PAGE and Western blotting. Meanwhile, for the comparison of the chimeric proteins and naturally occurring CD43 glycoforms, cell membrane preparations of both transfected and non-transfected cells were also prepared as described in Materials and Methods.  Fig. 3.6a shows that cell membranes of both transfected and non-transfected EL4 cells expressed CD43 115 kDa. A soluble protein purified from the supernatant of the transfected EL4 cells, (EL4/28) was recognized by SI 1, but had a slightly higher apparent molecular weight of 125 kDa than that of CD43 expressed on EL4. Fig. 3.6b shows that this protein is also recognized by anti-human IgG specific antibody, suggesting that it represents the mCD43-hIgG protein. In contrast, neither anti-CD43 nor hlgG reactive protein was found in the supernatant of non-transfected EL-4 cells. The mCD43-hIgG 125 kDa band was recognized by either mAb S7 or SI 1, but was not recognized by mAb IB 11 (Fig. 3.6a, c and d). These results suggested that the carbohydrate units of the secreted chimeric protein from EL4/28 were likely similar to the 115 kDa tetrasaccharide carrying CD43 expressed on the cell surface of EL4 cells. Compared with the mCD43-h!gG obtained from EL4/28, CD43 115 kDa  56  Fig. 3.6 Western blot analysis of EL4 and CTL2c chimeras. Cell surface CD43 was extracted from nontransfected EL4 and CTL2c cells, and transfected EL4 (EL4-28) and CTL2c (CTL2c/Cl)cells. Their supernatants were harvested and purified by protein A column and WGA. The membrane extract (Mb) and supernatant (Sup) of each cell line were loaded side by side on 7.5% SDS-PAGE. Each blot was transferred to nitrocellulose and immunoblotted with (A) SI 1, (B) anti-human IgG, (C) S7, and (D) IB 11 antibodies.  A.  EL4 Mb Sup  EL4-28 Mb Sup  CTL2c Mb Sup  CTL2c/C1 Mb Sup  116 kDa_  Sll B  EL4 Mb Sup  EL4-28 Mb Sup  CTL2c CTL2c/C1 Mb Sup Mb Sup  116kDa  Anti-human IgG 57  c.  EL4 Mb Sup  EL4-28 Mb Sup  CTL-2c Mb Sup  CTL-2c/C1 Mb Sup  S7  D.  EL4 Mb Sup  EL4-28 Mb Sup  CTL-2c Mb Sup  116kDa"  1B11 58  CTL-2c/C1 Mb Sup  expressed on the cell surfaces of EL4 and EL4/28 was only weakly detected by S7, which was due to the nature of the antibody.  Non-transfected and transfected CTL2c express CD43 135 kDa (Fig. 3.6a) which was detected by S11. When purified supernatant harvested from transfected CTL2c cells (CTL2c/Cl) was analyzed, a soluble protein which was recognized by SI 1 was present in the supernatant of CTL2c/Cl. This secreted protein was estimated to be 145 kDa and was also recognized by anti-human IgG specific antibody (Fig. 3.6b). Neither anti-CD43 reactive nor anti-hlgG protein was found in the supernatant of non-transfected CTL2c cells. CD43 expressed on CTL2c/Cl cell membrane had an apparent molecular weight of 135 kDa again suggesting that CD43 135 kDa and the 145 kDa mCD43-hIgG chimeric protein carries carbohydrates similar to cell surface CD43 of CTL2c cells. Confirming this further, mCD43hlgG 145 kDa was also strongly detected by IB 11, but only weakly detected by S7 (Fig. 3.6a, c and d). These results demonstrate two points: 1) the chimeric proteins from the transfected EL4/28 and CTL2c/Cl cells are 125 kDa and 145 kDa respectively; 2) they likely carry Olinked carbohydrate side chains of identical composition as the corresponding CD43 glycoforms expressed on the surface of non-transfected cells.  3.3.2  C O M P A R I S O N OF C H I M E R A S PROTEINS PRODUCED B Y NSF-60 AND C T L L Membrane extracts from NSF60 and CTLL cells were prepared the same way  as EL4 and CTL2c, and supernatants were also purified by protein A sepharose which was followed by WGA concentration steps. The purified supernatants and the membrane extracts obtained from both transfected and non-transfected NSF60 and CTLL cells were separated on a 7.5% SDS gel and analyzed by Western blotting. The results indicate that on the cell surface of 59  non-transfected NSF60 cells, the CD43 expressed varies in size from 115 kDa to 135 kDa and is strongly recognized by the mAb SI 1 (Fig. 3.7a). NSF60 cells are myeloid cells which indeed express both tetrasaccharide and hexasaccharide carrying CD43. Chimeric proteins produced by transfected NSF60 cells (NSF60/C9) were recognized by IB 11, SI 1, and antihlgG, and range in size from 125 to 145 kDa. Fig. 3.7c and d show that the chimera was strongly detected by 1B11, but only weakly by mAb S7. The glycoform of CD43 which NSF60 cells express normally was not conclusively determined because neither S7 nor IB 11reactive cell surface proteins were observed in the membrane extracts of NSF60 cells. The membrane fraction of NSF60/C9 showed a low amount of the lBll-reactive hexasaccharide form of CD43 (Fig. 3.7d). Since S l l is more reactive than IB 11 and much more reactive than S7, the NSF60 and NSF60/C9 cells likely express the hexasaccharide glycoform preferentially over the tetrasaccharide glycoform of CD43,but probably express both CD43 glycoforms or intermediates.  Both non-transfected and transfected CTLL express the hexasaccharide carrying CD43, but its molecular weight was about 140 kDa (Fig. 3.7a). The supernatant obtained from transfected cytotoxic T cells, CTLL/2A was shown to contain a 150 kDa protein which is not observed in the supernatant of control CTLL cells. The 150 kDa protein was detected by anti-human IgG (Fig 3.7b), suggesting that the IgG chimeric protein was produced and secreted from CTLL/2A. In addition, both CD43 140 kDa expressed on the CTLL cell surface and CD43-IgG 150 kDa secreted by CTLL/2A were detectable by 1B11 and S l l , but not by S7. This result indicates that both epitopes are similar to those found on CD43 expressed by CTL2c cells.  60  Fig. 3.7 Western blot analysis of NSF60 and CTLL chimeras. The membrane extracts and supernatants of both non-transfected NSF60 and CTLL cells and transfected NSF60/C9 and CTLL-2A cells were prepared in parallel to CTL2c and EL4 cells, as described in Materials and Methods. The membrane fraction of each was run next to its purified supernatant on 7.5% SDS-PAGE, followed by transferring to nitrocellulose blots. Each blot was detected by mAb SI 1(A), by anti-human IgG (B), by by mAb S7 (C), and by mAb 1B11 (D).  A.  NSF60 NSF60/C9 CTLL CTLL-2A Mb Sup Mb Sup Mb Sup Mb Sup  116k Da.  Sll B.  NSF60 Mb Sup  NSF60/C9 CTLL CTLL-2A Mb Sup Mb Sup Mb Sup  116k Da_  Anti-human IgG 61  c.  NSF60 NSF60/C9 CTLL Mb Sup Mb Sup Mb Sup  CTLL-2A Mb Sup  116k Da  S7  D.  NSF60 Mb Sup  NSF60/C9 CTLL Mb Sup Mb Sup  116k Da  1B11  62  CTLL-2A Mb Sup  3.3.3  COMPARISON OF CD43-IgG CHIMERAS R U N O N SDS P A G E UNDER REDUCED A N D NON-REDUCED CONDITIONS Since our chimeric constructs include the hinge region of human IgG, the  mCD43-hIgG chimeras were expected to be secreted as dimers with a disulfide bond at the hinge region. To illustrate that all chimeric proteins are indeed secreted as dimers, samples of purified chimeric proteins obtained from the four transfected cell lines were separated by SDSPAGE under reducing and non-reducing conditions. Reduced and non-reduced chimeric protein from each type of cells were electrophoresed on a 7.5 % acrylamide gel and analyzed by Western blotting. Fig. 3.8 shows that all four transfected cell lines secrete the chimeric proteins as dimers. The chimera produced by the EL4-28 has the lowest molecular weight (125 kDa) which can be detected by S I 1, S7 and anti-human IgG, but not by 1B11, indicating that the chimera is of the tetrasaccharide type. The transfected CTL-2c, CTLL and NSF-60 cells secreted higher molecular weight forms of chimeric proteins which are recognized by S l l , 1B11 and anti-hlgG, but not by mAb S7. As I B 11 reacts specifically with CD43 135 kDa, these results confirm that the three chimeric proteins are of the hexasaccharide type. The MW of mCD43-hIgG protein obtained from CTL2c/Cl is close to the MW of chimeric protein produced by NSF60/C9, and both are slightly lower MW than that of CTLL/2A chimera. We have shown that CTLL and CTL2c cells express the hexasaccharide form of CD43, and have considerable levels of C2GnT activity (Tomlinson Jones et al.., 1994). NSF60 cells were studied less extensively; however, they bind both I B 11 and S7 and express C2GnT activity (preliminary data). The reduced chimeric protein from NSF60 was not detected by S7, suggesting that the hexasaccharide form of chimeric protein is preferentially produced. Alternatively, NSF60 cells may express a glycoform of CD43 which is different from the T cell expressed CD43 glycoforms; this remains to be investigated further. The mAb S7 did not show any reactivity with monomers of mCD43-hIgG obtained from CTL2c, NSF60 and CTLL cell lines, but there was some reactivity with each of the mCD43-hIgG dimers. These results  63  Fig.3.8 Comparison of reduced and non-reduced chimeric proteins. Chimeras secreted by transfected cells: EL4-28, CTL2c/Cl, NSF60/C9 and CTLL-2A were added to SDS sample buffer with the reducing agent, 2-mercaptoethanol, or without it. The reduced and non-reduced forms of each chimera were run next to each other on 7.5 % SDS-PAGE and transferred to nitrocellulose, followed by staining with primary antibodies and second antibodies as described in the materials and methods. (A) SI 1 was added to the blot. (B) Anti-human IgG was added. (C) S7 was added. (D) IB 11 was added. A.  EL4-28 Red  CTL2c/C1 NSF60/C9 CTLL-2A  NR Red NR  Red NR  Red NR i m  200 kDa  116 kDa  Sll  B.  EL4-28 Red  200 kDa  CTL2c/C1 NSF60/C9 CTLL-2A  NR Red NR  Red NR  Red NR  H HMl  116 kDa  Anti-human IgG  64  c.  EL4-28 Red  CTL2C/C1  NR Red NR  NSF60/C9 CTLL-2A Red NR  Red NR  200 kDa  116 kDa  S7  EL4-28 Red  CTL2c/C1 NSF60/C9 CTLL-2A  NR Red NR  Red NR  200 kDa  116 kDa  1B11  65  Red NR  demonstrate that all dimers and monomers of chimeric proteins secreted by the four transfected cells are recognized by anti-human IgG, as either monomers or dimers (Fig. 3.8).  3.3.4  J A C A L I N P R E F E R E N T I A L L Y PRECIPITATES T H E L O W M O L E C U L A R WEIGHT F O R M OF CHIMERIC PROTEIN S E C R E T E D B Y EL4-28 Jacalin, a lectin from the jack fruit Artocarpus integrifolia, has been shown to  bind to NeuNAcoc2-3Gaipi-3(NeuNAcoc2-6)GalNAc expressed on the tetrasaccharide carrying CD43, but not to NeuNAca2-3 Galpl-3(NeuNAca2-3Galpl-4GlcNAcpl-6)GalNAc expressed on the hexasaccharide carrying CD43 (Maemura and Fukuda, 1992). To further characterize the carbohydrate side chains of the chimeric proteins, we carried out precipitation experiments using Jacalin sepharose. Chimeras were precipitated using Jacalin, and separated by SDS-PAGE. Western blotting analysis shows that the chimeric protein secreted by EL4-28 binds strongly to Jacalin (Fig. 3.9a). In addition, Fig. 3.9b shows that CD43 expressed on the EL4 cell surface also binds well to Jacalin. The molecular weight of the Jacalin precipitated chimeric protein was consistently found to be 125 kDa. The chimeric proteins obtained from CTL2c/Cl, NSF60/C9 and CTLL/2A cells were only slightly reactive with Jacalin (Fig. 3.9a and b). Cell surface CD43 extracted from EL4 cells showed an identical Jacalin reactivity as the corresponding chimera, whereas cell surface CD43 from CTL-2c cells could not be precipitate by this lectin (Fig. 3.9a and b, last lane). The Jacalin binding study has further confirmed that the carbohydrate contents of chimeras and cell surface CD43 are likely identical.  Western blot analysis and Jacalin precipitation provide strong evidence that transfected CTL2c cells secrete the hexasaccharide carrying chimeric protein whereas transfected EL4 cells secrete the tetrasaccharide carrying chimeric protein. As we predicted, 66  Fig. 3. 9 Jacalin binding study of chimeras. Each purified chimera (500 pi) and the membrane extracts (500ul) of EL4 and CTL2c cells were precipitated by Jacalin-sepharose. The 5 ui, 10 ui, 15 ui and 20 (il precipitated samples were run on 7.5% SDS-PAGE under reducing conditions. After the gels were transferred to the nitrocellulose, they were incubated with SI 1, followed by anti-rat HRP and visualized by chemiluminescence. A  CTL2c/C1 -i-Jacalin CTL2c Mb 5 10 15 20 Jac  EL4-28 + Jacalin 5  10  15  20  116 kDa  NSF60/C9 + Jacalin CTLL/2A + Jacalin 5  10  15  20  5  116K Da  67  10  15  20  EL4 Mb Jac.  transfected CTL2c cells which contain C2GnT express the hexasaccharide carrying mCD43hlgG protein while transfected EL4 cells which do not have the enzyme express the tetrasaccharide carrying mCD43-hIgG protein. It will be interesting to study the transfected NSF60 cells which express both glycoforms on the cell surface. Transfected NSF60 cells which contain C2GnT, show that they predominantly produce the hexasaccharide cores on CD43.  3.4  P R E L I M I N A R Y STUDY OF CD43 LIGANDS USING FACS We attempted to find CD43 ligands using FACS. Thymus, spleen and lymph  nodes of BDF mice which have injected with either EL4 or EL4/28 cells were harvested and stained with Fluorescein Isothiosyanate (FITC) conjugated anti-CD43 antibodies or hlgGFITC. However, preliminary data was inclusive as we could not determine whether CD43 binds to the ligands (Data not shown). We also could not determine the strength of the interaction between CD43 and its counter-receptors. In this context, different parameters, such as the concentrations of chimeric proteins, should be examined in future studies.  68  CHAPTER 4  DISCUSSION CD43 has been associated with many different functions. Monoclonal  antibodies against human and rodent CD43 can induce activation of T cells, monocytes, neutrophils and NK cells, enhance galectin mediated mitogenesis, enhance NK activity, cause cell aggregation, and stimulate calcium mobilization in monocytes and T lymphocytes (Mentzer et al, 1987; Axelsson et al, 1988; Vargas-Cortes etal., 1988; Nong et al, 1989; Silverman et al, 1989; Wong et al, 1990, Kuijpers et al, 1992). There are two major glycoforms of CD43 which are differentially expressed during T cell ontogeny and immune response. One key to the function of these glycoforms might be the identification of ligands which interact with CD43. We hypothesize that these glycoforms may have different functions. Also, we believe that there may be more than one ligand which interacts with CD43, some of which preferentially interact with the tetrasaccharide form of CD43, while others interact with the hexasaccharide form, and still others binding to both glycoforms.  Human immunoglobulin (hlgG) fusion proteins have widely been applied to the study of the function of cell surface proteins and their ligands. CD40, CD30, L- and Eselectins are successful examples for using this strategy (Fanslow et al, 1992; Fanslow et al., 1993; Smith et al, 1993; Steegmaier et al, 1995). To aid in the search for CD43 glycoform specific ligands, we have constructed a murine CD43-human IgG recombinant protein.  4.1  EXPRESSION OF R E C O M B I N A N T CD43 Murine CD43 DNA and human IgG DNA were amplified by PCR, and  subsequently were subcloned into the pBMGneo and pBSRa neo plasmids. The two expression vectors have many useful restriction sites that facilitate the construction of the  69  mCD43-hIgG chimeras. Both plasmids have been shown in the past to express cDNA encoding cytoplasmic, membrane-bound or secreted proteins efficiently and stably in eukaryotic cell lines (Karasuyama and Melchers., 1988; Takebe et al, 1988). The T cell lines, EL4, CTL2c and CTLL cells and a myeloid cell line, NSF-60 were chosen for expression of chimeras, as they express different glycoforms of CD43, Comparisons of the molecular sizes of secreted mCD43-hIgG chimeras as well as anti-CD43 antibody reactivity to cell surface CD43 have allowed us to demonstrate that the O-glycans in chimeric proteins secreted by these cells correspond to the glycoform(s) found on their respective surface CD43.  EL4 cells have no C2GnT activity and express nearly exclusively the tetrasaccharide form of CD43 on the cell surface (Tomlinson Jones et al, 1994). These glycoform of CD43 is specifically recognized by the rat mAb, S7. On the other hand, CTL2c and CTLL show a high C2GnT activity and cany the hexasaccharide form of CD43 that is specifically recognized by the rat mAb, IB 11. CTLL cells, however, express a 140kDa CD43 which has a higher MW than that of CTL2c cells or activated T cells, whereas CTL2c cells express CD43 135 kDa corresponding exactly to the MW of CD43 found on activated splenocytes (Tomlinson Jones et al, 1994). The NSF60 cells have been known to express both forms of leukosialin, and a constitutive C2GnT enzyme activity (preliminary data). As all four types of cells grow in suspension, transfection was done by electroporation and this method has been widely utilized for cell transfection. Also, the four types of cells are different in the composition of their cell membranes and in cell diameters, and therefore preliminary tests for cell survival, at a range of different voltages and capacitance, were performed to ensure introduction of DNA into the cells. We have observed that both expression vectors had different uptake rates in all four cell lines and the level of expression from each vector is dependent on cell type. EL4, CTLL and NSF60 cells were transfected successfully with both  70  vectors, whereas CTL2c cells could only be transfected successfully with pBSR.mCD43hlgG.  Multiple clones of cells transfected with the BMG or SRoc vectors were compared for the levels of expression of chimeric proteins, using the sandwich ELISA. Clones of EL4 cells transfected with the pBMG.mCD43-hIgG vector had consistently higher titres than EL4 cells transfected with pBSR.mCD43-hIgG vector. Although the metallothionein promoter in the pBMG vector can be induced by zinc chloride, which should increase the expression of chimeric protein, zinc chloride treatment of transfected EL4 cells had no effect of chimera levels secreted. It is possible that zinc chloride was toxic to these cells and the zincinduced toxicity may have been too high at the levels of zinc required for metallothionein induction. In contrast, the remaining three cell lines which were transfected with the pBSR.mCD43-hIgG vector gave a higher titre of secreted chimeric proteins than the cells transfected with pBMG.mCD43-hIgG vector. Among these three cell lines transfected with pBSR.mCD43-hIgG, CTL2c cells had the lowest titre.  4.2  PURIFICATION OF CHIMERIC PROTEIN The clones EL4/28, CTL2c/C 1, CTLL/2A and NSF60/C9 were chosen for  further study as they secreted the highest titres of chimera, among clones representing each of the four cell types. To produce a relatively large quantity of chimeric protein, we attempted to grow the EL4/28 cells in BDF1 mice. However, only a small quantity of ascites and serum could be harvested from the mice. Hence, we decided to grow all four types of transfected cells in 250 ml tissue culture flasks.  71  Protein A sepharose which binds to the Fc portion of various immunoglobulins was found to be an efficient first step for the purification of the chimeras as it has at least two sites accessible to IgG molecules and three highly homologous Fc binding regions (Hjelm et al, 1995). At this step, the chimeras were concentrated about a hundred-fold per litre of supernatant, though purified samples still contained other IgG molecules from the condition media. The second step of purification was to apply protein A purified samples to WGA which specifically binds to dimers and trimers of N-acetylglucosamine-containing carbohydrate structures, and which exhibits a primary specificity for monosaccharides and/or their (3-linked ligomers. WGA efficiently removed IgG molecules and concentrated mCD43-hIgG molecules further. Based on estimation by coomassie staining, approximate 60 ug chimera was obtained for three litre of EL4/28 condition medium.  4.3  W E S T E R N B L O T T I N G ANALYSIS The heterogeneity of leukosialin is due to the differences in glycosylation of  CD43 expressed on different cell types, as a result of various expression levels of C2GnT activity. Comparison of the molecular weight of the chimeras with the molecular weight of CD43 expressed on the surface of the non-transfected cells showed that in all four cell types the chimeras had an approximately 10 kDa higher in MW. This increase in size could be accounted for by the replacement of the CD43 cytoplasmic tail with hlgG hinge-CD2 and CD3 domains. These results indicate that the glycosylation of the chimeras is similar, if not identical, with the glycosylation of cell surface CD43.  Chimeric proteins were readily detected by anti- human IgG antibody, confirming that the newly secreted proteins contained Ig portions. The 125kDa form of mCD43-hIgG secreted by EL4 cells was strongly recognized by S7 but did not react with 72  1B11, which is identical to the reactivity pattern of CD43 expressed on the cell surface. Conversely, the 145 kDa form of chimeric protein secreted by CTL2c was 1B11-reactive but reacted much less with S7. The fact that S7 and IB 11, which distinctly recognize specific CD43 glycoforms, maintained an identical pattern of reactivity with the CD43 chimeras provide additional evidence that the fusion proteins carry the expected O-glycans. S7 slightly crossreacted with the 145 kDa mCD43-hIgG and weakly recognized CD43 115 kDa. The same problem was observed by Baecher-Allan et al.. (1993), suggesting that the inability to detect the S7 epitopes in the CD43 expressing cells was not simply the result of differences in mAb. Since the concentration of S7 used for each blot was 10 fold higher than the concentration of S l l or 1B11, it appears that the affinity of S7 to the tetrasaccharide carrying CD43 or mCD43hlgG is lower than that of S11.  CTLL cells were shown to express IB 11-reactive CD43 140 kDa. Therefore it was expected that the transfected CTLL cells would express the highest molecular weight form of mCD43-hIgG among the four transfected cells. In Figure 3.7, the chimeric protein secreted by CTLL/2A is about 150 kDa, again indicating that glycosylation is conserved on the chimeras. CD43 and mCD43-hIgG purified respectively from non-transfected and transfected NSF60 cells appeared in a broad band ranging from 125 to 145 kDa, suggesting both glycoforms of CD43 are synthesized by these cells. The chimeric proteins secreted by NSF60/C9 and CTLL/2A cells were recognized by 1B11. This demonstrates that the chimeric proteins produced by NSF60 and CTLL/2A cells are carrying the hexasaccharide form of CD43. Regarding NSF60 cells, the synthesis of tetrasaccharide carrying mCD43-hIgG was also possible as there was some immunoreactivity with S7. We have speculated that NSF 60 may express a novel glycoform of CD43 and its epitope may be coincidently shared by 1B11 and S7. However, further characterization of CD43 expressed by this particular cell line is required to confirm this speculation. Comparison of SDS-PAGE run under reducing and non73  reducing conditions demonstrated that all chimeric proteins were secreted as dimers (Fig. 3.8). In addition, the pattern of antibody reactivity of the chimeras was unaltered regardless of whether they were tested under reducing or non-reducing conditions.  Binding studies using the lectin Jacalin were carried out since Fukuda (1991) and Piller etal. (1988) have demonstrated that Jacalin binds preferentially to the tetrasaccharide form of human CD43 and have used this lectin to separate the tetrasaccharide form of CD43 from the hexasaccharide form. To further characterize the four chimeric proteins, we performed Jacalin precipitation experiments. Our study showed that Jacalin preferentially precipitated the low molecular weight form of the 125kDa chimeric protein, secreted by EL4/28 and the CD43 115 kDa, expressed on EL4 cell surface, over the other chimeras or cell surface CD43 glycoforms. Thus, these experiments provide strong support for the idea that the mCD43-hIgG chimera secreted by transfected EL4 cells carries the tetrasaccharide cores whereas the chimera secreted by the other three transfected cell lines carries the hexasaccharides cores. It additionally indicates that glycosylation pattern of murine CD43 is similar to that of human CD43  4.4  POSSIBLE LIGANDS OF L E U K O S I A L I N To facilitate the identification of CD43 ligands, we need to understand the  structures that likely bind to carbohydrates and the cells that most likely would express CD43 ligands. Although several ligands for CD43 have been identified, some of the data are contradictory and at present not firmly established. Poly-N-acetyllactosamines in O-glycans of CD43 can form the basis for expression of SLe carbohydrate synthesis, implying that one x  possible ligand for CD43 135 kDa may be a member of the selectin family (Maemura and Fukuda, 1992). The selectin family comprises three members: L selectin, P-selectin, and E74  selectin (Bevilacqua et al, 1991). They play an important role in mediating inflammation processes and interact with mucin like molecules which carry O-glycans or carbohydrates (Le , x  SLe and SLe ) (Foxall et al., 1992; Hogg and Berlin, 1995). In this regards, a relatively x  a  high concentration (10 |ig/ml) of soluble CD43, which carries hexasaccharide branches, is detected in the plasma as a result of proteolytic cleavage of CD43 from neutrophils or activated T lymphocytes. It has been suggested that soluble CD43 may bind to potential ligands and thereby modulate processes such as inflammation (Schmid etal, 1992).  ICAM-1 on the human lymphoblastoid Daudi cells has been described as a ligand of CD43 (Rosenstein et al, 1991). In contrast, other studies have shown that the negative charge of CD43 may indeed inhibit cell adhesion, particularly if both cells express the molecule. Ardman et al. (1992) demonstrated that CD43 on HeLa cells inhibits cell adhesion. Conversely, Manjunath et al. (1.993) showed that disruption of CD43 enhances adhesion to fibronectin and gpl20. CD43 can also act as an anti-adhesive molecule to prevent LFA-1 binding to ICAM-1. Perhaps, ICAM-J just transiently binds to CD43 before CD43 actually bind to its ligands or CD43 interferes with the binding of ICAM-1 to LFA-1 by binding to ICAM-1. Furthermore, as leukosialin is involved in T-cell and B cell interaction during immune reaction, CD43 may interact with its ligands on antigen-presenting B-cells (Fukuda, 1991).  Other possible CD43 ligands are members of the galectin family which are defined by shared characteristic amino acid sequences and affinity for (3-galactoside sugars. Galectin-1 (also referred to as L14-I, galaptin, and IML-1) is a member of the family of S-type, cation-independent lectins, and is expressed on thymic epithelial cells (Barondes etal, 1994a; Barondes etal, 1994b; Drickamer, 1988; Hirabayashi and Kasai, 1993). Some studies have shown that it preferentially binds to core 2 O-glycans with polylactosamine sequences on CD43 75  and to N-linked polylactosamines on CD45 (Barondes et al, 1994a; Drickamer, 1994; Baum et al, 1995). Interactions between galectin-1 and its ligands are regulated by developmentally restricted expression of oligosaccharide ligands on thymocytes. The expression of hexasaccharide carrying CD43 and the activity of C2GnT coincide with the expression of galectin-1, being high in immature cortical thymocytes and lower in mature medullary thymocytes (Baum et al, 1995). At the double positive stage of thymocyte development, the elongation of O-linked lactosamine side chains on CD43 is inhibited as the C2GnT activity decreases, resulting in galectin-1 induced T cell apoptosis (Perillo et al, 1995). Therefore, cellular signaling may be modulated by the differential expression of CD43 glycoforms interacting with CD43 ligands during the maturation stage of thymocytes.  Galectin 3 molecules are composed of an amino-terminal domain containing a collagen-like sequence and a globular carboxyl-terminal domain which is the galactosidebinding site. To mediate cell-cell and cell-extracellular matrix interactions, galectin-3, which is a galactose specific lectin can act as a receptor for ligands containing poly-N-acetyllactosamine sequences on glycoprotein side chains (Sharon and Lis, 1989). Inohara and Raz (1994) have found that galectin-3 binds to the Mac-2-binding protein that is known as the human lung tumor L3 antigen. We also found that galectin-3 binds at varying degrees to both glycoforms of CD43. By a immunofluorescence assay, we found that galectin-3 bound to immobilized CD43 135 kDa, and at a much lesser degree to immobilized CD43 115 kDa (unpublished data). Further analysis with the chimeric mCD43-h'IgG will be required to confirm this finding.  Preliminary CD43 ligand studies using the CD43-IgG chimeras and FACS analysis of thymocytes, splenocytes and lymphocytes have been inconclusive. One reason for the lack of signal may be that the affinity of CD43-IgG for its ligands is too low. One way we can improve the avidity of IgG fusion protein is to aggregate IgG chimeric molecules using 76  anti-hlgG F(ab)2- As the chimeric molecules can interact with Fc receptors, we may need to block the Fc receptor interaction by mAb 2.4G2. Other factors may also have to be considered, for instance, sulfation of glycoproteins. Sulfation is an energy-requiring posttranslational modification occurring in the late Golgi apparatus and takes places on either tyrosine residues, N-linked or O-linked oligosaccharide of the polypeptide (Roux etal, 1988; Hull and Carraway, 1989; Hille et al, 1990). The endothelial ligand for L-selectin (GlyCAM1) and P-selectin glycoprotein ligand-1 (PSGL-1) have been shown to be sulfated prior to recognition of their corresponding receptors (Imai et al, 1991; Pouyani and Seed, 1995; Sako et al, 1995). Wilson and Rider (1992) have also found that the hexasaccharide carrying murine CD43 is intensely sulfated in the murine T lymphoma line RDM-4, suggesting that the negative charge of (S04)^~ may help to increase the anti-adhesive effects of leukosialin, and may also influence recognition of its ligands. However, sulfation was not observed in resting splenic T lymphocytes. In addition, CD43 is sulfated and is hyposialylated on the surface of human CEM cells, causing impairment of CD43-mediated homotypic aggregation and resulting in generation of auto-antibodies (Lefebvre et al, 1994). It is noteworthy that sulfated CD43 molecules on cell surface may not be recognized by its ligands, because the recognition epitopes of CD43 are blocked, causing the inhibition of T cell activation. The role for sulfation of CD43 is not clear, but it may be crucial for ligand binding studies.  77  CONCLUSIONS In this study, we have been successful in producing mCD43-hIgG chimeric proteins in four different cell lines. Because glycosylation of CD43 varies between different cells, it was important to express the recombinant glycoproteins in different cell lines. The four secreted chimeras of EL4/28, CTL2c/Cl and CTLL/2A cells and NSF60 cells were purified by protein A and WGA affinity columns. Then they were characterized by Western blotting and compared with cell surface CD43 molecules, in terms of their antibody reactivities and molecular weights. The mCD43-hIgG secreted by transfected cells have identical reactivities to SI 1, S7 and IB 11 as the cell surface CD43, suggesting that the carbohydrate glycosylation patterns of four chimeras are identical to those of the cell surface CD43 expressed on the corresponding cells. The difference in MWs between the transmembrane and cytoplasmic domains of CD43 and the constant domain of IgG was predicted to be 10 kDa. Thus the MWs of the EL4, CTL2c, CTLL and NSF60 secreted chimeric proteins were seen to have this 10 kDa increase in MW. Jacalin precipitation studies showed that CD43-IgG secreted by the EL4 cells but not chimeras secreted by the other three cell lines were precipitated by Jacalin, confirming the expression of tetrasaccharide structures on EL4 chimeric protein. Thus, we have accomplished our goal of establishing tools to facilitate the analysis of CD43 glycoform specific ligands.  78  REFERENCES Abbassi O., Lane C.L., Krater S., Kishimoto T.K., Anderson D.C., Mclntire L.V., and Smith C.W. (1991) Canine neutrophil margination mediated by lectin adhesion molecule-1 in vitro. J. Immunol. 147: 2107-2115. Aldrich R.A., Steinberg A.G.I., and Campbell D.C. (1954) Pedigree demonstrating a sexlinked recessive condition characterized by draining ears, eczematoid dermatitis and bloody diarrhaea. Paediatr. 13: 133-138. Alvarez V., Pulido R., Campanero M.R., Paraiso V., de Landazuri M.O., and SanchezMadrid F. (1991) Differentially regulated cell surface expression of leukocyte adhesion receptors on neurophils in hemodialysis. Kidney Int. 40: 899-905. Amano J., Nishimura R., Mochizuki M., and Kobata A. (1988) Comparartive study of the mucin-type sugar chains of human chorionic gonadotropin present in the urine of patients with trophoblastic diseases and healthy pregnant women. J. Biol. Chem. 253: 1157-1165. Amaya C.A., Dorantes S., Toro A.H., Bello A., and Cuellar J. (1973) Attenuated form of Wiskott-Aldrich syndrome. J Paediatr. 82: 175-176. Andersson L.C., and Gahmberg C.G. (1978) Surface glycoproteins of human white blood cells. Analysis by surface labeling. Blood 52: 57-67. Ardman B., Sikorski M.A., Settles M., and Staunton D.E. (1990) Human immunodeficiency virus type 1-infected individual make autoantibodies that bind to CD43 on normal thymic lymphocytes. J. Exp. Med. 172: 1151-1158. Ardman B., Sikorski M.A., and Staunton D.E., (1992) CD43 interferes with T- lymphocyte adhesion. Proc. Natl. Acad. Sci. USA. 89: 5001-5005. Armitage R.J., Fanslow W.C., Strockbine L., Sato T.A., Clifford K.N., Macduff B.M., Anderson D.M., Gimpel S.D., Davis-Smith T., Maliszewski C.R., Clark E.A., Smith C.A., Grabstein K.H., Cosman D., and Spriggs M.K. (1992) Molecular and biological characterization of a murine ligand for CD40. Nature 357: 80-82. Axelsson B., Hammarstrom S., Finne J., and Perlmann P. (1985) The large sialoglycoprotein of human lymphocytes. II. Biochemical features. Eur. J. Immunol. 15: 427-433 Axelsson B., Youseffi-Etemad R., Hammarstrom S., and Perlmann P. (1988) Induction of aggregation and enhancement of proliferation and IL2 secretion in human T cells by antibodies to CD43. J. Immunol. 141: 2912-2917. Baecher-Allan C M . , Kemp J.D., Dorfman K.S., Barth R.K., and Frelinger J.G. (1993) Differential epitope expression of Ly-48 (mouse leukosialin). Immunogenetics 37: 183192.  79  Barondes S.H., V Castronova D.N.W., Cooper R.D., Cummings K., Drickamer T., Feizi M.A., Gitt J., Hirabayashi C , Hughes K., Kasai H., Leffler F.T., Liu R., Lotan A.M., Mercurio M., Monsigny S., Piliai F . , Poirer A., Raz P.W.J., Rigby J., Rini M., and Wang J.L. (1994a) Galectins: a family of animal [3-galactosie-binding lectins. Cell 76: 597-598. Barondes S.H., Cooper D.N., Gitt M.A., and Leffler H. (1994b) Galectins. Structure and function of a large family of animal lectins. J. Biol. Chem. 269: 20807-20810. Barran, P., Fellinger, W., Warren, C , Dennis, J.W., and Ziltener, H.J. (1996)Modification of CD43 and other lymphocyte O-glycoproteins by core 2 N-acetylglycosaminyltransferase. Glycobiology in press. Baum L.G., Pang M., Perillo N.L., Wu T., Delegeane A., Uittenfogaart C.H., Fukuda M., and Seilhamer J.J. (1995) Human thymic epithelial cells express an endogenous lectin, galectin-1, which binds to core 2 O-glycans on thymocytes and T lymphoblastoid cells. J. Exp. Med. 181: 877-887. Baumhueter S., Dybdal Carrie K., and Laurence A.L. (1994) Global vascular expression of murine CD43, a sialomucin-like endothelial ligand for L-selectin. Blood 84: 2554-2565. Bazil V., and Strominger J.L. (1991) Shedding as a mechanism of down-modulation of CD44 on stimulated human monocytes. J. Immunol. 147: 1567-1574. Bazil V., and Horejsi V. (1992) Shedding of the CD44 adhesion molecule from leukocytes induced by anti-CD44 monoclonal antibody stimulating the effect of a natural receptor ligand. J Immunol. 149: 747-753. Bazil V., and Strominger J.L. (1993 ) CD43, the major sialoglycoprotein of human leukocytes, is proteolyticallly cleaved from the surface of stimulated lymphocytes and granulocytes. Proc. Natl. Acad. ScL USA. 90: 3792-3796.  Bazil V., Brandt J., Tsukamoto A., and Hoffman R. (1995) Apoptosis of human hematopoietic progenitor cells induced by crosslinking of surface CD43, the major sialoglycoprotein of leukocytes. Blood 6: 502-511. Berridge M.J. (1984) Inositol triphosphates and diacylglycerol as second messengers. Biochem. J. 220: 345. Bettaieb A., Farace F., Mitjavila M.T., Mishal Z., Dokhelar M.C., Tursz T., Breton-Gorius J., Vainchenker W. and Kieffer N. (1988) Use of a monoclonal antibody (GA3) to demonstrate lineage restricted O-glycosylation on leukosialin during terminal erythroid differentiation. Blood 71: 1226-1233. Bevilacqua M., Butcher E., Furie B., Gallatin M., Gimbrone M., Larlan J., Kishimoto K., Lasky L., McEver R., Paulson J., Rosen S., Seed B., Siegelman M., Springer T., Stoolman L., Tedder T., Varki A., Wagner D., Weissman I., and Zimmerman G. (1991) Selectins: a family of adhesion receptors, [letter] Cell 67: 233.  80  Bierhuizen M.F.A., and Fukuda M . (1992) Expression cloning of a cDNA encoding UDPGlcNAc: Gal(3l-3GalNAc-R(GlcNAc to GalNAc)P 1 -6 GlcNAc transferase by gene transfer into CHO cells expressing polyoma large tumor antigen. Proc. Natl. Acad. Sci. USA. 89: 9326-9330. Bierhuizen M.F.A., Mattei M.G., and Fukuda M. (1993) Expression of the developmental I antigen by a cloned human cDNA encoding a member of a (3-1,6-N-acetylglucosaminyltransferase gene family. Genes Dev. 7: 468-478 . Borche L., Lozano F., Viella R., and Vives J. (1987) CD43 monoclonal antibodies recognize the large sialoglycoprotein of human leukocytes. Eur. J. Immunol. 17: 1523-1526. Brockhausen I., Kuhns W., Schachter H., Matta K.L., Sutherland D.R., and Baker M.A. (1991) Biosynthesis of O-glycan in leukocytes from normal donors and from patients with leukemia: increase in O-glycan core 2 UDP-GicNAc: Gal beta 3GalNAc alpha-R<GlcNAc to GalNAcc>beta(l-6)- acetylglycosaminyl transferase in leukemic cells. Cancer Res. 51: 1257-1263. Brown W.R.A., Barclay A.N., Sunderland C.A. and Williams A. F. (1981) Identification of a glycophorin-like molecule at the cell surface of rat thymocytes. Nature 289: 456-460 Butcher E.C. (1991) Leukocyte endothelial cell recognition: three (or more steps) to specificity and diversity. Cell 67: 1033-1036. Campanero M.R., Pulido R., Alonso J.L., Pivel J.P., Pimentel-Muinos F.X., Fresno M., and Sanchez-Madrid F. (1991) Down-regulation by tumor necrosis factor-a of neutrophil cell surface expression of the sialophrin CD43 and the hyaluronate receptor CD44 through a proteolytic mechanism. Eur. ./. Immunol. 21: 3045-3048. Campo M.S. in Glover, D.M. (Ed), (1985) DNA cloning volume II: a practical approach. IRL Press, London. p213. Canales M.L., and Mauer A.M. (1967) Sex-linked hereditary thrombocytopenia as a variant fo Wiskott-Aldrich syndrome. New Engl, J. Med. 277: 899-901. Cantrell D.A., Davies A.A., and Crumpton M.J. (1985) Activators of protein kinase C down regulate and phospharylate the T3/T cell antigen receptor complex of human T lymphocytes. Proc. Natl. Acad. Sci. USA. 82: 8158-8162.  Cantrell D.A., Davies A.A., Londei M., Feldman M., and Crumpton M.J. (1987) Association of phosphorylation of the T3 antigen with immune activation of T lymphocytes. Nature 325: 540-542. Carlsson S.R., and Fukuda M . (1986) Isolation and characterization of leukosialin, a major sialoglycoprotein on human leukocytes../. Biol. Chem. 261: 12779-12786. Carlsson S.R., Sasaki H., and Fukuda M. (1986) Structural variations of O-linked oligasaccharide present in leukosialin isolated from erythroid myeloid, and Tk lymphoid cell line. J. Biol. Chem. 261: 12787-12795.  81  Chatila T.A., and Geha R.S. (1988) Phosphorylation of T cell membrane proteins by activators of protein kinase C../. Immunol. 140: 4308-4314. Coloma M.J., Hastings A., Wims L.A., and Morrison S.L. (1992) Novel vectors for the expression of antibody molecules using variable regions generatd by polymerase chain reaction. J. Immunol. Meth. 152: 89-104. Cooper M.D., Chase H.P., Lowman J.T., Krivit W., and Good R.A. (1968) The WiskottAldrich syndrome: an immunologic deficiency disease involving the afferent limb of immunity. Am. J. Med. 44: 499-513. Corbi A.L., Larson R.S., Kishimoto T.K., Springer T.A., and Morton C C . (1988) Chromosomal location of the genes encoding the leucocyte adhesion receptros LFA-1, Mac-1 andpl50, 95. J. Exp. Med. 167: 1597-1607. Cyster J., Somoza C , Killeen N., and Williams A.F. (1990) Protein sequence and gene structure for mouse leukosialin (CD43), a T lymphocyte mucin without introns in the coding sequence. Eur. ./. Immunol. 20: 875-881. Cyster J.G., Shotton D.M., and Williams A.F. (1991) The dimenesions of the T Lymphocyte glycoprotein leukosialin and identification of linear proteins epitopes that can be modified by glycosylation. EMBO J. 10: 893-902. Datti A., and Dennis J.W. (1993) Regulation of UDP-GlcNAc:Galpl-3GalNAc-R(3l-6-N Acetylglucosaminyltrasferase (GlcNAc to GalNAc) in Chinese Hamster Ovary cells. J. Biol Chem. 268: 5409-5416.  Dalloul A.H., Fourcade C , Debre P., and Mossalayi M.D. (1991) Thymic epithelial cellderived supernatants sustain the maturation of human prothymocytes: involvement of interleukin-1 and CD34. Eur. J. Immunol. 22: 2533-2636. De Smet W., Walter H., and Van Hove C. (1993) A new CD43 monoclonal antibody induces homotypic aggregation of human leukocytes through a CD1 la/CD 18 dependent and independent mechanism. Immunology 79: 46-54. Dennis J.W., Laferte S., Waghorne C , Breitman M.L. and Kerbel R.S. (1987) (31-6 Branching of Asn-linked oligosaccharides is directly associated with metastasis. Science 236: 582-585. Derry J.M.J., Ochs H.J., and Francke U. (1.994) Isolation of a novel gene mutated in WiskottAldrich syndrome. Cell 78: 638-644. Derry J.M.J., Kerns J.A., Weinberg K.I., Ochs H.D., Volpini V., Estivill X., Walker A.P., and Francke U. (1995) WASP gene mutations in Wiskott-Aldrich syndrome and X-linked thrombocytopenia. Hum. Mol. Genet. 4: 1.127-1135. Donner M., Schwartz M., Carlsson K.U., and Holberg L. (1988) Hereditary X-linked thrombocytopenia maps to the same chromosomal region as the Wiskott-Aldrich syndrome. Blood 72: 1849-1853.  82  Dorfman K.S., Litaker W., Baecher C M . , and Frelinger J. G. (1990) The nucleotide sequence of Ly-48 (mouse leukosialin, sialophorin): the mouse homology of CD43. Nucleic Acids Res. 18: 4932. Dragone L.L., Barth R.K., Sitar K.L., Disbrow G.L., and Frelinger J.G. (1995) Disregulation of leukosialin (CD43, Ly48, sialophorin) expression in the B cell lineage of transgene mice increases spenic B-cell number and survival. Proc. Natl. Acad. Sci. USA. 92(2): 626-630. Drickamer K. (1988) Two distinct classes of carbohydrate-recognition domains in animal lectins. J. Biol. Chem. 263: 9557-9560. Dyer M.J.S., and Hunt S.V. (1981) Committed T-lymphocyte stem cells of rats characterization by surface W3/1.3 antigen and radiosensitivity. J. Exp. Med. 154: 11641177. Ellies L.G., Jones A.T., Williams M.J., and Zilterner H.J. (1994) Differential regulation of CD43 glycoforms on CD4+ and CD8+ T lymphocytes in graft-versus-host disease. Glycobiology 4: 885-893. Ellies L.G., Tao W., Fellinger W., Teh H.S., and Ziltener H.J. (1996) The CD43 130 kDa peripheral T cell activaiton antigen is down regulated in thymic positive selection. Blood 88: 1725-1732. Fanslow W . C , Anderson D.M., Grabstein K.H., Clark E.A., Cosman D., and Armitage R.J. (1992) Soluble forms of CD40 inhibit biologic responses of human B cells. J. Immunol. 149: 655-660. Fanslow W . C , Clifford K.N., Seaman M., Alderson M.R., Spriggs M.K., Armitage R.J., and Ramsdell F. (1994) Recombinant CD40 ligand exerts potent biologic effects on T cells. J. Immunol. 152: 4262-4269. Fox R.I., Hueniken M., Fong S., Behar S., Royston I.., Singhal S.K., and Thompson L. (1983) A novel cell surface antigen (T305) found in increased frequency on acute leukemia cells and in autoimmune disease states../. Immunol. 131: 762-767'. Foxall C , Watson S.R., Dowbenko D., Fennie C , Lasky L.A., Kiso M., Hasegawa A., Asa D., and Brandley B.K. (1992) The three members of the selectin receptor family recognize a common carbohydrate epitope, the sialyl Lewis X oligosaccharide. J. Cell Biol. 117: 895-902. Fukuda M . (1980) K562 human leukemic cells express fetal type (i) antigen on different glycoproteins from circulating erythrocytes. Nature 285: 405-407. Fukuda M., Fukuda M.N., Papayannopoulou T., and Harkomori, S. (1980) Membrane differentiation in human erythroid cell. Unique profiles of cell surface glycoprotein expressed in erythroblasts in vitro from three oncogenic stages. Proc. Natl. Acad. Sci. USA.. 77: 3474-3478. Fukuda M., Carlsson S.R., Klock J.C, and Dell A. (1986) Structures of O-linked oligasaccharides isolated from normal granulocytes, chronic myelogenous leukemia cells and acute myelogenous leukemia cells. J. Biol. Chem. 261: 12796-12806. 83  Fukuda M . (1991) Leukosialin, a major O-glycan-containing sialoglycoprotein defining leukocyte differentiation and malignancy. Glycobiology 1(4): 347-356. Galy A.H.M., and Spits H. (1992) CD40 is functionally expressed on human thymic epithelial cells. 7. Immunol. 149: 775-782. Giunta, M., FavreA., Ramarli D., Grossi C.E., and Corte G. (1991) A novel integrin involved in thymocyte-thymic epithelial cell interactions. 7. Exp. Med. 173: 1537-1548. Goding J.W. (1978) Use of staphylococial protein A as an immunological reagent. 7. Immunol. Methods 20: 241-253. Goding J.W. (1986) Monoclonal Antibodies: Principles and Practice. London, Academic Press. Goudswaard J., Van der Donk J.A., Noordzij A., Van Dam R.H., and Vaerman J.P (1978) Scand. J. Immunol. 8: 21. Greer W.L., Higgins E., and Sutherland D.R., Novogrodsky A., Brockhausen I., Peacocke M., Rubin L.A., Baker M., Dennis J.W., and Siminovitch K.A. (1989a) Altered expression of leucocyte sialoglycoprotein in Wiskott-Aldrich syndrome is associated with a specific defect in O-glycosylation. Biochem. Cell Biol. 67: 503-509. Greer W.L., Kwong P.C., Peacocke M., Ip P., Rubin L.A., and Siminovitch, K.A. (1989b) X chromosome inactivation in the Wiskott-Aldrich syndrome: a marker for detection of the carrier state and identification of cell lineages expressing the gene defect. Genomics 4: 6067. Greer W.L., Peacocke M.and Siminovitch K.A. (1992) The Wiskott-Aldrich syndrome: refinement of the localization on Xp and identification of another closely linked marker locus, OATL1. Hum.Genet. 88: 453-456. Grottum K.A., Hovig T., Holmsen H., Abrahamsen A.F, Jeremic M., and Seip M . (1969) Wiskott-Aldrich syndrome: Qualitative platelet defects and short survival. Br. J. Haemotol. 17: 373-388 Gulley M.L., Ogata L.C., Thorson J.A., Dailey M.O., and Kemp, J.D. (1988) Identification of a murine Pan-T cell antigen which is also expressed during the terminal phases of B cell differentiation. 7. Immunol. 140: 3751-3757. Gum J.R., Byrd J.C., Hicks J.W., Toribara N.W., Lamport D.T.A., and Kim Y.S. (1989) Molecular cloning of human intestinal mucin cDNAs. Sequence analysis and evidence for genetic polymorphism../. Biol. Chem. 264: 6480-6487. Guttenberger J., Trygstad C.W., and Steihm E.R. (1970) Familial thrombocytopenia, elevated serum IgA levels and renal disease. Am. J. Med. 49: 729-741. Guy G.R., and Gordon J. (1987)Prac. Natl. Acad. Sci. USA. 84: 6239-6243. Hardy R.R., Carmack C.E., Shinton S.A., Kemp J.D., and Hayakawa K. (1991) Resolution and characterization of pro B and pre-pro B cell stages in normal mouse born marrow. 7 Exp. Med. 173: 1213-1225. 84  Harris ED Jr : Pathogenesis of Rheumatoid Arthritis, Textbook of Rheumatology. Third Edition, Edited by W M Kelley, ED Harris, S Ruddy, CB Sledge. Philadelphia, WB Saunders, 1989.  Hayakawa K., Hardy R.R., Parks D.R., and Herzenberg L.A. (1983) The "Ly-IB" Cell subpopulation in normal immunodefective and autoimmune mice. J. Exp. Med. 157: 202218. Heffernan M . , Lotan R., Amos B., Palcic M., Takano R., and Dennis J.W. (1993) Branching beta 1-6 N-acetylglucosamine transferases and polylactosamine expression in mouse F9 tetratocarcinoma cells and differentiated../. Biol. Chem. 268: 1242-1251. Higgins E.A., Siminovitch K.A., Zhang D.,.Brock hausen I., and Dennis J.W. (1991) Aberrant O-linked oligosaccharide biosynthesis in lymphocytes and platelets from patients with the Wiskott-Aldrich syndrome. J. Biol. Chem. 266: 6280-6290. Hille A., Braulke T., von Figuta K., and Huttner W.B. (1990) Occurrence of tyrosine sulfate in proteins-balance sheet. 1. Secretory and lysosomal proteins. Eur. J. Biochem. 188: 577-586. Hirabayashi J., and Kasai K.I. (1993) The family of metazoan metal-independent (3 galactosebinding lectins: structure, function and molecualar evolution. Glycobiology 3: 297-304. Hjelm H., Sjodahl J., and Sjoquist J. (1975) Immunologically active and structurally similar fragments of protein A from staphylococus aureus. Eur. J. Biochem. 57: 395-403. Hogg N., and Berlin C. (1995) Structure and function of adhesion receptors in leukocyte trafficking. Immunol. Today 16: 327-330. Huizinga T.W.J., van der Schoot C.E., lost C , Klaassen R., Kleijer M . , von dem Borne A.E.G.K., Roos D., and Tetteroo P.A.T. (1988) The Pi-linked receptor FcRIII is released on stimulation of neutrophils. Nature 333: 667-669 Hull S.R., and Carraway K.L. (1989) Sulfation of the tumor cell surface sialomucin of the 13762 rat mamary adenocarcinoma../. Cell Biochem. 40: 67-81. Humabria A., Diaz-Gonzalez F., Campanero M.R., Arroyo AG., Laffon A., Gonzalez-Amaro R., and Sanchez-Madrid F. (1994) Expression of L-selectin, CD43, and CD44 in synovial fluid neutrophils from patients with inflammatory joint disease. Arthritis and Rheumatism 37(3): 342-348. Huntley C C , and Dees S.C (1957) Eczema assocaited with thrombocytopenci puurpura and purulent otitis media: report of five fatal cases. Paediatr. 19: 251-361. Imai Y., Singer M.S., Fennie C , Lasky L.A., and Rosen S.D. (1991) Identification of a carbohydrate-based endothelial ligand for lymphocyte homing receptor. J. Cell Biol. 113: 1213-1221. Imai Y., Lasky L.A. and Rosen S.D. (1993) Sulfation requirement for GlyCAM-1, and endothelial ligand for L-selectin. Nature 361: 555-557. 85  Inohara H., and Raz A., (1994) Identification of Human Melanoma Cellular and secreted ligands for galectin-3. Biochem. Biophys. Res. Comm. 201: 1366-1375. Jung T.M., and Dailey M.O. (1990) Rapid modulation of homing receptors (gp90 MEL-14 ) induced by activators of protein kinase C . Receptor shedding due to accelerated proteolytic cleavage of the surface../. Immunol. 144: 3130-3 136 Jutila M.A., Rott L., Berg E.L., and Butcher E.C. (1989) Function and regulation of the neutrophil MEL-14 antigen in vivo: comparsion with LFA-1 and MAC-1. J. Immunol. 143: 3318-3324. Kanani A., Sutherland D.R., Fibach E., Matta K.L., Hindenburg A., Brockhausen I.,Kuhus W., Taub R.N., Van den Eijnden D.HL, and Baker M.A. (1990) Human leukemic myeloblasts and myeloblastoid cells contain the enzyme cytidine 5'-monophosphate-Nacetylneuraminic acid: Galp\l-3Gal NAca(2-3)-sialyltransferase. Cancer Res. 50: 50035007. Kansas G.S., and Tedder T.F. (1991 transmembrane signals generated through MHC class II, CD19, CD20 CD39, and CD40 antigens induced LFA-1 dependent and independent human B cells through a tyrosine kinase-dependent pathway. /. Immunol. 147: 4094. Karasuyama H., and Melchers F. (1988) Establishment of mouse cell lines which constitutively secrete large quantities of interleukin 2,3.4 or 5, using modified cDNA expression vectors. Eur. J. Immunol. 18: 97-104. Kenny D., Cairns L., Remold-O'Donnell E., Peterson J., Rosen F.S., and Parkman R. (1986) Morphological abnormalities in the lymphocytes of patients with the WiskottAldrich syndrome. Blood 68: 1329-1332. Killeen N., Barclay A.N., Willis A.C., and Williams A.F. (1987) The sequence of rat leukosialin (W3/13 antigen) reveals a molecule with O-linked glycosylation of one third of its extracellular amino acids. EMBO J. 6: 4029-4034. Kimura A.K., and Wigzell H. (1978) Cell surface glycoproteins of murine cytotoxic T lymphocytes. 1. T145, a new cell surface glycoprotein selectively expressed on Lyl-2+ cytotoxic T lymphocytes. J. Exp. Med. 147: 1418-1434. Kishimoto T.K., Jutila M.A., Berg E.L., and Butcher E.C. (1989) Neutrophil Mac-1 and Mel14 adhesion proteins inversely regulated by chemotactic factors. Science 245: 1238-1241. Kolluri R., Shehabeldin A., Peacocke M., Lamhonwah A.M., Teichert-Kuliszewska K., Weissman S.M. and Siminovitch K.A. (1995) Identification of WASP mutations in patients with Wiskott-Aldrich syndrome and isolated thrombocytopenia reveals allelic heterogeneity at the WAS locus. Hum. Mol. Genet. 4: 1119-1126. Kronvall G., and Frommel D. (1970) Definition of Staphylococcal protein A reactivity for human immunoglobulin G fragments. Immunochemistry 7: 124-127. Ku Y., Kishimoto A., Takai Y., Ogawa Y., Kimura S., and Nishizuka Y. (1981) A new possible regulatory system for protein phospharylation in human peripheral lymphocytes. II. Possible relation to phosphatidyl inositol turnover induced by mitogens. J. Immunol. 127: 1375-1379. 86  Kudo S., and Fukuda M. (199J) A short, novel promoter sequence confers the expression of human leukosialin, a major sialoglycoprotein on leukocytes. /. Biol. Chem. 266: 84838489. Kuijper T.W., Hoogerwerf M., Kuijpers K.C., Schwartz B.R., and Harlan J.M. (1992) Cross-linking of sialophorin (CD43) induces neutrophil aggregation in a CD-18 dependent and a CD18-independent way../. Immunol. 149: 998-1003. Kwan S.P., Hagemann T.L., Radtke B.E., Blaese R.M., and Rosen R.S. (1995) Identification of mutations in theWiskott-Aldrich syndrome gene and characterization of a polymorphic dinucleotide repeat at DXS6940, adjacent to the disease gene. Proc. Natl. Acad. Sci. USA. 92: 4706-4710. Lefebvre J.C., Gilrdanengo V., Limouse M., Doglio A., Cucchiarini M., Monpoux F., Mariani R., and Peyron J.F. (1994) Altered glycosylation of leukosialin, CD43, in HIV-1 infected cells of the CEM line. J. Exp. Med. 180: 1609-1617. Maemura K., and Fukuda M. (1992) Poly-N- acetylactosaminyl O glycans attached to leukosialin. The presence of sialyl Le (x) structures in O- glycans. J. Biol. Chem. 267: 24379-24387. Maniatis T., Fritsch Z.F., and Sambrook J. (1982) In Molecular cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Manjunath N., and Ardman B. (1995) CD43 regulates tyrosine phosphorylation of a 93kD protein in T lymphocytes. Blood 86: 4194-4198. Manjunath N., Johanson R., Staunton D.E., Pasqualini R., and Ardman B. (1993) Targeted disruption of CD43 gene enhances T lymphocyte adhesion. J. Immunol. 151: 1528-1534. Manjunath N., Correa M., Ardman M., and Ardman B. (1995) Negative regulation of T cell adhesion and activation by CD43. Nature 377: 535-538. Manohar V., Brown E., Leiserson W.M., and Chused T.M (1982) Expression of Lyt-1 by a subset of B lymphocytes. ./. Immunol. 129: 532-538. McFarland T.A., Ardman B., Manjunath N., Fabry J.A., and Leiberman J. (1995) CD43 diminishes susceptibilbity to T lymphocyte-mediated cytolysis. /. Immunol. 154: 10971104. Mentzer S.J., Remold-O'Donnell E., Crimmins M.A.V., Bierer B.E., Rosen F.S., and Burakoff SJ. (1987) Sialophorin, a surface sialoglycoprotein defective in the Wiskott Aldrich syndrome, is involved in human T lymphocyte proliferation. J. Exp. Med. 165: 1383-1392. Miller T.J., and Stone H.O. (1978) The rapid isolation of ribonuclease free immunoglobulin G by protein A sepharose affinity chromatography. /. Immunol. Mehtods 24: 111-125. Morse H.C., Shen III, and Hammerling U. (1987) Genetic nomemclature for loci controlling mouse lymphocyte antigens. Immu.no gene tics 25: 71-78.  87  Nathan C , Xie Q.W., Halbwachs-Mecarelli L., and Jin W.W. (1993) Albumin inhibits neutorphil spreading and hydrogen peroxidase release by blocking the shedding of CD43 (Sialophorin, leukosialin). ./. Cell Biol. 122: 243-256. Nong Y.H., Remold-O'Donnell E., LeBien T.W., and Remold H.G. (1989) A monoclonal antibody to sialophorin (CD43) induces homotypic adhesion and activation of human monocytes. J. Exp. Med. 170: 259-267. Nossal G.J.V. (1994) Negative selection of lymphocytes. Cell 76: 229-239. Ochs H.D., Slichter S.J., Harker L.A., von Behrens W.E., Clark R.A. and Wedgwood R.J. (1980) The Wiskott-Aldrich syndrome :studies of lymphocytes, granulocytes and platelets. Blood 55: 243-252. Oppenheim J.J., Blaese R.M., and Waldmann T.A. (1970) Defective lymphocyte transformation and delayed hypersensitivity in Wiskott-Aldrich syndrome. J. Immunol. 104: 835-844. Pallant A., Eskenazi A., Mattei M.G., Founder R.E., Carlsson S.R., Fukuda M., and Frelinger J.G. (1989) Identification of cDNAs encoding human leukosialin and localization of the leukosialin gene to chromosome 16. Proc. Natl. Acad. Sci. USA. 86: 1328-1332. Park J.K., Rosenstein Y.J., Remold-O'Donnell E, Bierer B.E., Rosen F.S., and Burakoff S.J. (1991) Enhancement of T-cell activation by the CD43 molecule whose expression is defective in Wiskott-Aldrich syndrome. Nature 350: 706-709. Parkman R., Remold-O'donnell E., Kenney D.A., Perrine S., and Rosen F.S. (1981) Surface protein abnormalities in lymphocytes and platelets from patients with Wiskott-Aldrich syndrome. Land. 2: 1387-1389. Patel D.D., and Hayes B.F. (1993) Cell adhesion molecules involved in intrathymic T cell development. Sem. Immunol. 5: 282-292. Peacocke M., and Siminovitch K.A. (1992) Linkage of the Wiskott-Aldrich syndrome with polymorphic DNA sequences from the human X chromosome. Proc. Natl. Acad. Sci. USA. 84: 3430-3433. Perillo N.L., Pace K.E., Seilhamer J.J., and Baum L.G. (1995) Apoptosis of T cells mediated by galectin-1. Nature 378: 736-739. Perry G.S., Spector B.D., and Schuman L.'M. (1980) the Wiskott-Aldrich syndrome in the United States and Canada. J. Pediatr. 97: 72-78 Pierce M., and Arngo J. (1986) Rous sarcoma virus-transformed baby hamster kidney cells express higher levels of asparagine-linked tri and tetraantennary glycoproteins containing [GlcNAc-(3(l,6) Man-a(l,6)Man] and poly-N- acetyllactosamine sequences than baby hamster kidney cells. J. Biol. Client. 261: 10772-10777. Piller F., Piller V., Fox R.I., and Fukuda M. (1988) Human T-lymphocyte activation is associated with changes in P-glycan biosynthesis. J. Biol. Chem. 263: 15146-15150.  88  Piller V., Piller F., and Fukuda M. (1989) Phosphorylation of the major leukocyte surface sialoglycoprotein, leukosialin is increased by phorbol-12-myristate-13 acetate. J. Biol. Chem. 264: 18824-18831. Piller V., Piller F., and Fukuda M. (1990) Biosynthesis of truncated O-glycans in the T cell line Jurkat. J. Biol. Chem. 265: 9264-9271. Piller F., Le Deist F., Weinberg K.I., Parkman R., and Fukuda M . (1991) Altered O-glycan synthesis in lymphocytes from patients with Wiskott Aldrich syndrome. J. Exp. Med. 173: 1501-1510. Porteu F., and Nathan C. (1990) Shedding of tumor necrosis factor receptors by activated human neutrophils. J. Exp. Med. 172: 599-607. Pouyani T., and Seed B. (1995) PSGL-1 Recognition of P-Selectin is controlled by a tyrosine sulfation consensus at the PSGL-1 Amino Terminus. Cell 83: 333-343. Reisinger D., and Parkman R. (1987) Molecular heterogeneity of a lymphocyte glycoprotein in immunodeficient patients. J. Clin. Invest, 79: 595-599. Remold-O'Donnell E., Kenney D.M., Parkman R., Cairns L., Savage B., and Rosen F. S. (1984) CharacterizatiorKof a human lymphocyte surface sialoglycoprotein that is defective in Wiskott-Aldrich symdrome. ./. Exp. Med, 159: 1705-1723. Remold-O'Donnell E., Davis A.E., Kenney III D., Bhaskar K.R., and Rosen F.S. (1986) Purification and chemical composition of gpLl 15, the human lymphocyte surface sialoglycoprotein that is defective in Wiskott-Aldrich syndrome. J. Biol.Chem. 261: 75267530. Remold-O'Donnell E., Zimmerman C , Kenney D., and Rosen F.S. (1987) Expression on blood cells of sialophorin, the surface glycoprotein that is defective in Wiskott-Aldrich syndrome. Blood 70: 104-109. Remold-O'Donnell E., Kenney D.M., and Rosen F.S. (1987) Biosynthesis of human sialophorins and analysis of the polypeptide core. Biochemistry 26: 3908-3913. Remold-O'Donnell E., and Rosen F.S. (1990) Sialophorin (CD43) and the Wiskott-Aldrich syndrome. Immunodef. Rev. 2: 151-174. Remold-O'Donnell E., Van Brooklyn J., and Kenney D.M. (1992) Effect of platelet calpain on normal T-lymphocyte CD43: hypothesis of events in the Wiskott-Aldrich syndrome. Blood 79: 1754-1762. Rieu P., Porteu F., Bessou G., Lesavre P., and Halbwachs-Mecarelli L. (1992) Human neutrophils release their major membrane sialoprotein, leukosialin (CD43), during cell activation. Eur. J. Immunol. 22: 3021-3026. Rivero-Lezcano O.M., Marcilla A., Sameshima J.H., and Robbins K.C. (1995) WiskottAldrich syndrome protein physically associates with Nek through Src Homology 3 Domains.Mo/. Cell. Biol. 15 (10): 5725-5731.  89  Rosenstein Y., Park J.K., Hahn W.C., Rosen F.S., Bierer B.E., and Burakoff S.J. (1991) CD43, a molecule defective in Wiskott-Aldrich syndrome, binds ICAM- 1. Nature 354: 233-235. Rosenkranz A.R., Majdic O., Stockl J., Pickl W., Stockinger W., and Knapp W. (1993) Induction of neutrophil of neutrophil homotypic adhesion via sialophorin (CD43), a surface sialoglycoprotein restricted to haemopoietic cells. Immunol. 80: 431-438. Roux L., Holojda S., Sunblad G., Freeze H.H., and Varki A. (1988) Sulfated N-linked oligosaccharides in mammalian cells. 1. Complex-type chains with sialic acids and Osulfate esters. J. Biol. Chem. 263: 8879-8889. Saitoh O., Gallagher R.E., and Fukuda M. (1.991a) Expression of Aberrant O glycans attached to leukosialin in differentiation-deficient HL-60 cells. Cancer Res. 51: 2854-2862. Saitoh O., Piller F., Fox R.I., and Fukuda M. (1991b) T-lymphocytic leukemia express complex, branched O-linked oligosaccharides on a major sialoglycoprotein, leukosialin. Blood 77: 1491-1499. Sako D., Comess K.M., Barone K.M., Camphausen R.T., Cumming D.A., and Shaw G.D. (1995) A sulfated peptide segment at the amino terminus of PSGL-1 is critical for P selectin binding. Cell 83: 323-331. Salomon D., Mojcik C.F., Chang A.C., Wadsworth S., Adams D.H., Coligan J.E., and Shevach E.M. (1994) Constitutive activation of integrin a4(3l defines a unique stage of human thymocyte development../. Exp. Med. 179: 1573-1584. Samelson L., Harford J., Schwartz R.H., and Klausner R.D. (1985) A 20-kDa protein associated with the murine T-cell antigen receptor is phosphorylated in response to activation by antigen or concanavalin A. Proc. Natl. Acad. Sci. USA. 82: 1969-1973. Samelson L., O'Shea J.J., Luong H., Ross P., Urdahl K.B., Klausner R.D., and Bluestone J. (1987) T cell antigen receptor phosphorylation induced by an anti-receptor antibody. J. Immunol. 139: 2708-2714. Sarmay G., Rozsnyay Z., Szabo I., Biro A., and Gergely J. (1991) Modulation of type II Fc gamma receptor expression on activated human B lymphocytes. Eur. J. Immunol. 21: 541-549. Sarver N., Grass P., Law M.F., Khoury G., and Howley P.M. (1981) Bovine papilloma virus deoxyribonucleic acid: a novel eucaryotic cloning vector. Mol. Cell Biol. 1: 486. Schacheter H., and Brockhausen I. (1992) "The biosynthesis of serine (threonine)-Nacetylgalactosamine-linked carbohydrate moieties." In glycoconjugates: composition, structure and function (ed .H.J. Allen and E.C. Kiksailus) Marcel Dekker, New York. Schmid K., Hediger M.A., Brossmer R., Collins J.H., Haupt H., Marti T., Offner G.D., Schaller J., Takagaki K., Walsh M.T., Schwick H.G., Rosen F.S., and RemoldO'Donnell E. (1992) Proc. Natl. Acad. Sci USA. 89: 663-667. Sharon N., and Lis H. (1989) Legume as cell recognition molecules.Sc/enct? 246: 227-234. 90  Shelley C.S., Remold-O'Donnell E., Davis A.E., III Bruns G.A.P., Rosen F.S., Carroll M.C., and Whitehead A.S. (1989) Molecular Characterization of sialophorin (CD43), the lymphocyte surface sialoglycoprotein defective in Wiskott- Aldrich symdrome. Proc. Natl. Acad. Sci. USA. 86: 2819-2823. Shelley C.S., Remold-O'Donnell E.R., Rosen F.S., and Whitehead A.S. (1990) Structure of the human sialophorin (CD43) gene. Identification of features atypical of genes encoding integral membrane proteins. Biochem, J. 270: 569-576. Silverman L.B., Wong R.C.K., Remold-O'Donnell E., Vercelli D., Sancho K., Terhorst D., Rosen F., Geha R., and Chatila T. (1989) Mechamisms of mononuclear cell activation by an anti-CD43 (sialophorin) agonistic antibody. J. Immunol. 142: 4194-4200. Singer K.H., and Hayes B.F. (1987) Epithelial-thymocute interactions in human thymus. Hum. Immunol. 20: 127-144. . . Smith C.A., Gruss H.J., Cabis T., Anderson D., Farrah T., Baker E., Sutherland G.R., Brannan C.I., Copeland N.G., and Jenkins N.G. (1993) CD30 antigen, a marker for Hodgkin's lymphoma, is a receptor whose ligand defines an emerging family of cytokines with homology to TNF. Cell 73: 1349-1360. Sperling A.L, Green J.M., Mosley R.L., Smith P.L., DiPaola R.J., Klein J.R., Bluestone J.A., and Thompson C.B. (1995) CD43 is a murine T cell costimulatory receptor that functions independently of CD28. ./. Exp. Med. 182: 139-146. Spitler L.E., Levin A.S., Stites D.P., Fudenberg H.H., and Huber H. (1975) The WiskottAldrich syndrome: immunologic studies in none patients and selected family members. Cell Immunol. 19: 201-218. Spitler L.E., Wray B.B., Mogerman S., Miller J.J., O'Reilly R.J., and Lagios M . (1980) Nephropathy in the Wiskott-Aldrich syndrome. Pediatr. 66: 391-398. Sportsman J. R., Park M.M., Cheresh D.A., Fukuda M., Elder J.H., and Fox R.I. (1985) Characterization of a membrane surface glycoprotein associated with T- cell activation . J. Immunol. 135: 158-164. Standen G.R., Lillicrap D.P., Matthews N. and Bloom A.L. (1986) Inherited thrombocytopenia, elevated serum IgA and renal disease: identification as a variant of the Wiskott Aldrich syndrome. Quart. ./. Med. 59: 401-408. Steegmaier M., Levinovitz A., Isenmann S., Borges E., Lenter M., Kocher H.P., Kleuser B., and Vestweber D. (1995) The E-selectin-ligand ESL-1 is a variant of a receptor for fibroblast growth factor. Nature 373: 615-620. Suda T., Takahashi T., Golstein P., and Nagata S. (1993) Molecular cloning and expressin of the Fas ligand, a novel member of the tumor necrosis factor family.Cell 75: 1169-1178. Symons M., Derry J.M.J., Karlak B., Jiang S., Lemahieu V., McCormick F., Francke U., and Abo A. (1996) Wiskott-Aldrich syndrome protein, a novel effector for the GTPase CDC43Hs, is implicated in actin polymerization. Cell 84: 723-734.  91  Tabebe Y., Seiki M., Fujisawa J.I., Hoy P., Yokota K., Arai K.I., Yoshida M., and Arai N. (1988) SRa promoter: an efficient and versatile mammalian cDNA expression system composed of the Simian Virus 40 early promoter and the R-U5 segment of human T cell leukemia virus type 1 long terminal repeat. Mol. Cell Biol. 8: 466-472. Timpte C.S., Eckhardt A.E., Abernethy J.L., and Hill R.L. (1988) Porcine submaxillary gland apomucin contains tandemly repeated, identical sequences of 81 residues. J. Biol. Chem. 263: 1081-1088. Tomlinson Jones A., Federsppiel B., Williams M.J., Ellies L.G., Burgener R., Duronia V., Smith C.A., Takei F., and Ziltener H.J. (1994) Characterization of the activation form of CD43 on murine T lymphocyte. J. Immunol. 153: 3426-3439. Vargas-Cortes M., Axelsson B., Larsson A., Berzins T., and Perlmann P. (1988) Enhancement of spontaneous cell mediated cytotoxicity by a monoclonal antibody against the large sialoglycoprotein on peripheral blood lymphocytes. Scand. J. Immunol. 27: 661-671. Varki A.(1993) Biological roles of oligosaccharides: all of the theories are correct. Glycobiology 3: 97-130. Vestermark B., and Vestermark S. (1964) Familial sex-linked thrombocytopenia. Acta Paediat. 53: 365-370. Villa A., Notarangelo L., Macchi P., Mantuano E., Cavagni G., Brugnoni D., Strina D., Patrosso M.C., Ramenghi U., Sacco M.G., Ugazio A., and Vezzoni P. (1995) X-linked thrombocytopenia and Wiskott-Aldrich syndrome are allelic diseases with mutations in theWASP gene. Nature Genet. 9: 414-417. Voet D., and Voet J.G. Biochemistry. Toronto, John Wiley and Sons, 1990 : 260. Von Boehmer H. (1994) Positive selection. Cell 76: 219-228. Waldschmidt T., Snapp K., Foy T., Tygrett L., and Carpenter C. (1992) "B-cell subsets defined by the FceR." In CD5 B cells in Development and Disease. Vol 651. L.A. Herzenberg, K Rawjewsky, and G Haungton eds. Ann. N.Y. Acad. Sci. p84 Watson S.R., Fennie C , and Lasky L.A. (1991) Neutrophil influx into an inflammatory site inhibited by a soluble homing receptor-IgG chimaera. Nature (London) 349: 165-167. Weiden P.L., and Blaese R.M. (1972) Hereditary thrombocytopenia: relation to WiskottAldrich syndrome with special reference to splenectomy. J. Pediatr. 80: 226-234. Wells S.M., Kantor A.B., and Stall A.M. (1994) CD43 (S7) expression identifies peripheral B cell subsets. J. Immunol. 153: 5503-5515. Wengler G.S., Notarangelo L.D., Berardelli S., Pollonni G., Mella P., Fasth A., Ugazio A.G., and Parolini O. (1995) High prevalence of nonsense, frame-shift and splice-site mutations in 16 patients with full-blown Wiskott-Aldrich syndrome. Blood 86: 36843654.  92  Wilson A.P., and Rider C C . (1992) Evidence that leukosialin, CD43, is intensely sulfated in the murine T lymphoma line RDM-4../. Immunol. 148: 1777-1783. Wong R.C.K., Remold-O'Donnell E., Bercelli D., Sancho J., Terhorst C , Rosen F., Geha . R., and Chatila T.(1990) Signal transduction via leukocyte antigen CD43 (siolophorin). J. Immunol. 144: 1455-1460. Wolf M., Levine J., Stratford May W.Jr., Cuatrecasas O., and Sahyoun N. (1985) A model for intracellular translocation of protein kinase C involving synergism between calcium and phorbol esters. Nature 317: 546. Wolf M., Cuatrecasas P., and Sahyoun N. (1986) Interaction of protein kinase C with membranes is regu lated by C a , phorbol esters, and ATP. /. Biol. Chem. 260:16718. 2 +  Woollett G.R., Williams A.F., and Shotton D.M. (1985) Visualisation by low-angle shadowing of the leucocyte-common antigen. A major cell sruface glycoprotein of lymphocytes. EMBO ./. 4: 2827-2830. Yamashita K., Ohkura T., Tachibana Y., Takasaki S., and Kobata A., (1984) Comparative study of the oligosaccharides released from Baby hamster kidney cells and their polyoma transformant by hydrazinolysis. ./. Biol. Chem. 259: 10834-10840. Yousefi S., Higgins E., Daoling Z., Pollex-Kruger A., Hindsgaul O., and Dennis J.W. (1991) Increased UDP-GlcNAc: Galp l-3GalNAC-R (GlcNAc to Gal NAc)(3l-6 N acetylglucosaminyltransfera.se activity in metastatic murine tumor cell lines. Control of polylactosamine synthesis. J. Biol. Chem. 266: 1772-1782. 1  Zhu Q., Zhang M., Blaese R.M., Derry J.M.J., Junker A., Francke U., Chen S.H., and Ochs H.D. (1995) The Wiskott-Aldrich syndrome and X-linked congenital thrombocytopenia are caused by mutations of the same gene. Blood 86: 3797-3804.  93  

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0087606/manifest

Comment

Related Items