Open Collections

UBC Theses and Dissertations

UBC Theses Logo

UBC Theses and Dissertations

Observation of treatment responses to interferon-[alpha] by quantitative analyses of hepatitis C virus… Wu, He 1994

Your browser doesn't seem to have a PDF viewer, please download the PDF to view this item.

Item Metadata

Download

Media
831-ubc_1994-0312.pdf [ 1.49MB ]
Metadata
JSON: 831-1.0087431.json
JSON-LD: 831-1.0087431-ld.json
RDF/XML (Pretty): 831-1.0087431-rdf.xml
RDF/JSON: 831-1.0087431-rdf.json
Turtle: 831-1.0087431-turtle.txt
N-Triples: 831-1.0087431-rdf-ntriples.txt
Original Record: 831-1.0087431-source.json
Full Text
831-1.0087431-fulltext.txt
Citation
831-1.0087431.ris

Full Text

OBSERVATION OF TREATMENT RESPONSES TO INTERFERON-cCBY QUANTITATIVE ANALYSES OF HEPATITIS C VIRUS RNAbyHEWUM.B.(Medicine), Capital Institute of MedicalBeijing, China, 1983.A THESIS SUBMITTED IN PARTIAL FULFILMENT OFTHE REQUIREMENTS FOR THE DEGREE OFMASTER OF SCIENCEinTHE FACULTY OF GRADUATE STUDIESDepartment of Medicine( Experimental Medicine )We accept this thesis as conformingto the required standardUNIVERSITY OF BRITISH COLUMBIA©He Wu, April 1994In presenting this thesis in partial fulfilment of the requirements for an advanceddegree at the University of British Columbia, I agree that the Library shall make itfreely available for reference and study. I further agree that permission for extensivecopying of this thesis for scholarly purposes may be granted by the head of mydepartment or by his or her representatives. It is understood that copying orpublication of this thesis for financial gain shall not be allowed without my writtenpermission.(Signature)Department of Cii’iiLThe University of British ColumbiaVancouver, CanadaDate flt I / 1 qpDE-6 (2)88)ABSTRACTNon-A, non-B (NANB) hepatitis accounts for 90% of cases of transfusionassociated hepatitis and 20-40% of sporadic cases. Most of them become chronicand develop severe consequences such as cirrhosis and primary hepatocellularcarcimona. Recently, hepatitis C virus (HCV), an RNA virus, was identified asthe major etiological agent of NANB hepatitis. Interferon-a (IFNa) has beenshown to be beneficial in treatment of patients with chronic hepatitis C bydecreasing alanine arnino-transferase (ALT) levels and improving liver histology,since IFNa has a wide spectrum of antiviral activities. Unfortunately there is littleinformation about the state of HCV replication during or after IFNa treatment. Itis not clear whether therapy eradicates the presence of the virus or merelysuppresses viral replication. Therefore, the relationship between response to IFNatreatment and suppression of viral activity during therapy requires further study.We hypothesized that: 1) IFNa could inhibit the replication of HCV in thepatient with chronic hepatitis C. 2) HCV-RNA would decrease or disappear inboth serum and liver cells in the responding patients. 3) the changes of HCV-RNAin both serum and liver cell could be measured by the quantitative RT-PCRdetection.11The overall objective of this study was to evaluate therapeutic efficacy ofIFNa for the treatment of chronic hepatitis C. The following specific aims were:1) to reveal the state of HCV replication, as quantitatively measured by serum andliver HCV-RNA, in patients with chronic hepatitis C before and after treatmentwith odFN. 2) to compare quantitative analysis results of HCV-RNA with serumAST levels as a marker of hepatic necroinflammatory changes. 3) to determinewhether apparently favourable changes in disease activity are correlated withsuppression of viral replication.A quantitative reverse transcription polymerase chain reaction (RT-PCR)assay was established for the detection of HCV-RNA. Sensitivity of the RT-PCRassay was quantitatively analyzed by a piece of recombinant HCV-RNA which wasin vitro transcribed from a transcription vector HCV-cDNA. Specificity of the RTPCR assay was verified by Southern Blot and DNA typing methods.Serum HCV-RNA was quantitatively detected by the established RT-PCRassay on 12 patients with chronic hepatitis C and treated with interferon-a. LiverHCV-RNA was also measured in 4 of 12 patients. The therapeutic efficacy ofinterferon was assessed by the correlation between clinical responses andquantitative results for HCV-RNA.The results showed that 7 of 12 (58%) patients had a beneficial response to111IFNx treatment at 3-6 months of therapy as reflected by a decreased titer of HCVRNA. Four of 7 (57%) initial responders relapsed 3 months later. Three (25%)patients’ sera became negative for HCV-RNA after more than 12 months intreatment. Serum HCV-RNA titers had parallel changes with liver function in 7(58%) patients. There was a positive correlation between patients with lower serumHCV-RNA titers prior to initiation of treatment and better therapeutic responses.Although similar trials need to be carried out on large sample size ofpatients, the following conclusions could be drawn from preliminary results:interferon-cx has a beneficial effect on more than half the patients with chronichepatitis C by inhibiting viral replication and improving the liver function withinthe first 6 months of treatment; long term IFNa treatment (6-12 months or more)may increase the probability of eradicating HCV; the results of quantitativeanalysis on HCV-RNA may be used as a valuable mean to predict and monitor thetherapeutic response of IFNc.Topics that further studies should focus on are to monitor the therapeuticresponse by using other means such as measurement of 2’,5’-oligoadenylatesynthetase activity, to reveal the possible reason for poor response such asgenotype variation and anti-IFN antibody, to try other approaches to IFNadministration, and to develop other antiviral agents.ivTABLE OF CONTENTSABSTRACT iiTABLE OF CONTENTS vLIST OF ABBREVIATIONS viiLIST OF FIGURES viiiLIST OF TABLES ixACKNOWLEDGEMENTS xCHAPTER 1 INTRODUCTION1CHAPTER 2 LITERATURE REVIEW2.1 From non-A, non-B to hepatitis C 42.2 Epidemiology of hepatitis C virus infection 42.3 The genomic structure of HCV 52.4 Diversity of HCV genome 82.5 Detection of anti-HCV antibody and HCV-RNA 102.6 Interferon-ce treatment on patientswith chronic hepatitis C 142.7 Results and problems in the previous studies 152.7.1 Predictors of treatment response 152.7.2 Treatment response and suppression of HCVreplication 162.7.3 Limitation of serum HCV-RNA detection . . 16CHAPTER 3 MATERIALS AND METHODS3.1 Collection and preparation of specimens 183.2 Test of liver function 193.3 Test of anti hepatitis C virus antibody 193.4 Detection of hepatitis C virus RNA 193.4.1 Extraction of HCV-RNA 20V3.4.2 Reverse transcription 223.4.3 Polymerase chain reaction 223.4.4 Specificity of RT-PCR system 253.4.5 Sensitivity of RT-PCR system 303.5 Definition of clinical response to treatment 333.5.1 Complete response . . 333.5.2 Partial response 333.5.3 No response 333.5.4 Relapse 33CHAPTER 4 RESULTS4.1 RT-PCR detection assay 344.1.1 Sensitivity analysis . . 344.1.2 Specificity analysis . .. . 424.1.3 Clinical application 434.2 Observation of serum HCV-RNA in IFNo treated patients . . . . 444.2.1 Changes of serum HCV-RNA during and after therapy 444.2.2 Three patterns of HCV-RNA detected in the patients . 464.3 Observation of liver HCV-RNA in IFNc treated patients 494.4 Observation of clinical response to IFNc treatment 504.4.1 Liver function 504.4.2 Correlation between clinical response and HCV-RNA . 524.5 Results in summary 55CHAPTER 5 DISCUSSION5.1 Evaluation of interferon treatment on hepatitis C 565.2 Monitoring the treatment response of IFN 595.3 Reasons for poor response to IFN treatment 645.3.1 Neutralizing antibody against IFN 645.3.2 Sequence variation of HCV during chronic infection . . 655.3.3 Effects of IFN treatment by HCV genotypes 655.4 The future of therapy of HCV 675.4.1 Other approaches to the IFN administration 675.4.2 Other potential agents for the therapy of hepatitis C . . 67REFERENCES 69viLIST OF ABBREVIATIONS2-5A 2’ ,5 ‘-oligoadenylate synthetaseALT Alanine amino-transferaseAST Aspartate aminotransferaseeDNA complimentary deoxyribonucleic acidC-lOU Recombinant antigen for ELISADEPC Diethyl pyrocarbonateELISA Enzyme linked immunosorbent assayHBV Hepatitis B virusHCV Hepatitis C virusIFNo Interferon-aNANB Non-A, non-BNS Non structuralPCR Polymerase chain reactionRNA Ribonucleic acidRT Reverse transcriptionviiLIST OF FIGURESFigure 1. Genomic structure of HCV 7Figure 2. HCV recombinant antigens and genomic location 11Figure 3. Genomic location of PCR amplification 23Figure 4. RsaI digested Nested-PCR products 26Figure 5. Capillary transfer of DNA from gel 28Figure 6. Electrophoresis gel of comparative detection 34Figure 7. Sequence of pBluescript HCV-cDNA 35Figure 8. Sequence of synthesized HCV-RNA 36Figure 9. Electrophoresis gel of quantitative detections 40Figure 10. Correlation of PCR cycles and templet copies 39Figure 11. Results of PCR detection without RT 41Figure 12. Results of Nested-PCR and RsaI digested products 42Figure 13. Electrophoresis gel and Southern Blot 43Figure 14. Pattern of decreased HCV-RNA titer 46Figure 15. Pattern of increased HCV-RNA titer 47Figure 16. Pattern of unchanged HCV-RNA titer 48Figure 17. Observation of serum HCV-RNA and liver function 53viiiLIST OF TABLESTable 1. Prevalence of HCV infectionTable 2. Genotype classification of HCV 8Table 3. Methods of anti-HCV antibody detection . . . . 11Table 4. HCV primer sequence, location andsize of PCR products 23Table 5. 13-actin primer sequence, location andsize of PCR products 24Table 6. Data of synthesized RNA 37Table 7. Genomic copies in serial dilutions 38Table 8. HCV-RNA titers before and after treatment 45Table 9. HCV-RNA in the liver tissue 50Table 10. AST levels before and after treatment 51Table 11. Interferon treatment effects on ALT 57Table 12. Interferon treatment effects on serum HCV-RNA . . . 58Table 13. Potential means for monitoring therapy 59Table 14. Potential agents for therapy of chronic hepatitis C 68ixACKNOWLEDGEMENTSI am deeply grateful toDr.Sean Byrne for his valuable instruction and guidance;Ms.Angela Perry and Mr.Reuben Chen for their plentiful assistancewithout any reservation;Dr.Shirley Gillam for her constructive suggestion and contribution as amember of my supervisory committee;Dr.Zhiyong Qiu and Dr.Decheng Yang for their generous help fromlaboratory technique to thoughtful theory;Dr.Frank H. Anderson for his organization of the clinical trial as well ashis contribution as a member of my supervisory committee;Dr.Steward Zheng for careful collection of specimens and clinical data.I would like to express my special gratitude to my supervisors Dr.HGrantStiver and Dr.Christopher H. Sherlock for their supervision, coordination,comprehension, encouragement, patience and support of my graduate study.xCHAPTER 1INTRODUCTIONNon-A, non-B (NANB) hepatitis accounts for 90% of cases of transfusionassociated hepatitis and 20-40% of sporadic cases of viral hepatitis. Furthermore, posttransfusion NANB hepatitis becomes chronic in as many as 60% of cases and at least20% of patients with chronic hepatitis will eventually develop severe consequences suchas cirrhosis and primary hepatocellular carcimona. Recently, the major etiological agentof NANB hepatitis was identified as an RNA virus, the hepatitis C virus (HCV). Based onthe result from first generation ELISA testing for anti-HCV antibody, HCV is the cause ofapproximately 80% of parenterally acquired NANB hepatitis.Interferon-a (lENa) has been shown to be beneficial in the treatment of patientswith chronic hepatitis C by decreasing alanine amino-transferase (ALT) levels andimproving liver histology, since lENa has a wide spectrum of antiviral activities.Unfortunately there is little information about the state of HCV replication during or afterlFNa treatment. It is not clear whether therapy eradicates the virus or merely suppressesviral replication. Therefore, more studies are needed to clarify the relationship betweenresponse to aIFN treatment and suppression of viral activities during the therapy.Reverse transcription polymerase chain reaction (RT-PCR), a valuable techniquewhich enables the direct detection of HCV-RNA in serum and liver, has provided a viral1INTRODUCTIONreplication marker for the observation of chronic hepatitis C infection. Quantitativedetection by the RT-PCR is capable of detecting the amount of HCV-RNA in serum fromthe patients treated with aIFN. If the serum concentration of HCV-RNA is correlated withthe response to lEN therapy, HCV-RNA detection could play an important role inmonitoring the antiviral effects of lENa.We hypothesized that: 1) lENa could inhibit the replication of HCV in the patientwith chronic hepatitis C. 2) HCV-RNA would decrease or disappear in both serum andliver cells in the responding patients. 3) the changes of HCV-RNA in both serum and livercell could be measured by the quantitative RT-PCR detection.The overall objective of this retrospective study was to determine the utility of RTPCR for monitoring therapeutic efficacy of lENa for treatment of chronic hepatitis C. Thefollowing specific aims were: 1) to determine the degree of HCV replication by quantitativedetection of serum HCV-RNA and both genomic and replicative forms of liver HCV-RNAin patients with chronic hepatitis C infection before, during and after treatment with lENa.2) to compare quantitative analysis results of HCV-RNA with serum ALT levels as amarker of hepatic necroinflammatory changes. 3) to determine whether apparentlyfavourable changes in disease activity correlated with suppression of viral replication.The research plan for this research project was: 1) to collect serum and liverbiopsy specimens from chronic hepatitis C patients who were treated with IFNa2B. 2) toextract HCV-RNA from these serum and hepatic tissues. 3) to establish a reversetranscription-polymerase chain reaction (RT-PCR) assay for the detection of HCV-RNA.2INTRODUCTION4) to quantify the sensitivity of this RT-PCR detection system. 5) to quantitatively detectHCV-RNA from serum and liver by using the established RT-PCR method. 6) to assessthe therapeutic efficacy of interferon by the correlation between clinical responses andquantitative analysis results of HCV-RNA.Interferon is a natural choice as a possible therapeutic agent for chronic hepatitisC due to its wide spectrum of antiviral activities. The treatment responses have beenwidely studied. Some clinical trials have being carried out to observe the therapeuticeffects of IFNa on the chronic hepatitis C while we were performing this research. In orderto evaluate the treatment responses, results from several other reports are reviewed inthe thesis. It appears that there are some dissimilarities in the results obtained fromdifferent groups. Overall, tEN treatment still needs more studies to evaluate efficacy. Fromthis study, we believe: 1) the method of serial quantitative analyses of HCV-RNA shouldbe very useful for evaluation and prediction of lENa treatment responses. 2) the resultswould lead to a deeper understanding of the therapeutic functions of lENa. 3) theconclusion could make useful recommendations for viral monitoring in further clinical trialsin larger groups of patients. 4) the questions raised will provide a basis for further studiesto clarify the true treatment effects of lENa in the future.3CHAPTER 2LITERATURE REVIEW2.1 FROM NON-A, NON-B HEPATITIS TO HEPATITIS COur knowledge of non-A, non-B (NAN B) hepatitis has increased dramatically sincethe historical description of the infectious agent which may contribute to most of thedisease. Although many scientists had made efforts to prove their existence as infectiousentities from clinical, epidemiologic, and experimental investigations, the putative agentsfor NANB hepatitis remained unknown until the exciting discovery in 1989. In this year,investigators from the Chiron Corporation in California, USA, reported that the genomeof an RNA virus was successfully cloned from the plasma of a chimpanzee infected withmaterial from a patient with non-A, non-B hepatitis, and designated as hepatitis C virus(HCV) (Choo QL, 1989). It has become evident from following studies that the hepatitisC virus is responsible for the majority of NANB hepatitis.2.2 EPIDEMIOLOGY OF HEPATITIS C VIRUS INFECTIONAs soon as the isolation and cloning of HCV was accomplished, an enzyme-linkedimmunosorbent assay (ELISA) was developed to detect anti-HCV antibody by usingrecombinant C 100-3 antigen, a translation product of the non-structural (NS) region inHCV genome (Kuo G, 1989), which resulted in worldwide studies on the prevalence of4LITERATURE REVIEWHCV infection. The preliminary evaluation based on the anti-HCV test results showed thatHCV was responsible for the majority of cases of post-transfusion and sporadic NANBhepatitis, as well as most cases of unidentified chronic liver diseases throughout the world(Esteban R, 1993). The results of worldwide studies on HCV prevalence in different riskgroups are reviewed in Table 1 (page 6).2.3 THE GENOMIC STRUCTURE OF HCVUsing sophisticated molecular biological approaches the new termed hepatitis Cvirus was identified as a positive-sense, single-stranded, linear RNA virus with a genomicsize of approximately 10Kb. The sequence of a major portion of the viral genome hasbeen reported, and the virus has been related to members of the flavi- and pestiviruses(Houghton M, 1991).The HCV-RNA genome, comprising approximately 9,400 nucleotides (nt) (ChooQL, 1991; Kato N, 1990), contains a single, large translational open-reading frame (ORE)that spans almost the entire genome and encodes a large viral peptide of either 3,011(Choo QL, 1991.) or 3,010 (Kato N, 1990; Takamizawa A, 1991) amino acids. As shownon the Fig. 1, the HCV genome is composed of 7 regions: C, El, E2/NS1, NS2, NS3,NS4, and NS5, each of which encodes different products (Houghton M, 1991; OkamotoH, 1992; Hayashi N, 1993).5LITERATURE REVIEWTable 1. Prevalence of HCV infection in different risk groups*Parenteral TransmissionTransfusion-associated hepatitisCellular blood products 50-70%Plasma products 50-90%Intravenous drug users 70-92%Haemodialysis and renal transplantation 9-25%Nosocomial and occupational exposure 1-3 %Non-Parenteral TransmissionPerinatal Transmission 50%Sexual and household transmission 5-23%Other Liver DiseasesChronic hepatitis B 17-40%Alcoholic liver disease 25-52%Cryptogenic hepatitis 68-80%Autoimmune hepatitis 40-80%Hepatocarcinoma 34-75%See Esteban R,1993 for references.6LITERATURE REVIEWFigure 1. Genome of heDatitis C virusGenome of Hepatitis C VirusNucleotide 915 2541 5198 9441numbers 342 1491 3370 6392Genes‘_____I E2JNS1 NS2 NS3 NS4 I NS5Protein(Kd) 19 gp33 gp72 -23 -60 52 116putative RNAdependentFunction enveiope RNA-polymerasegi ycopro te insRNA-binding helicase?nucleocapsid proteaseproteinIt should be emphasized that the 5’ terminal region of HCV genome represents themost highly conserved sequence among different viral isolates (Takamizawa A, 1991;Okamoto H, 1991), this suggests that it may play a very important regulatory role duringviral replication, perhaps at the level of translation. Meanwhile, this is also important forthe design of oligonucleotide primers to develop general PCR for HCV-RNA detection, inorder to exclude the possibility of missing viraemia due to sequence heterogeneity(Okamoto H, 1991; Han JH, 1991; Garson JA, 1990).7LITERATURE REVIEW2.4 DIVERSITY OF HCV GENOMEA great deal of information is now appearing in the literature about the nucleotidesequence of different HCV isolates. Comparative sequence analysis of all complete andpartial HCV sequences published to date indicates that they can be broadly subdividedinto at least four basic groups (Table 2).Table 2. Type classification of HCVTYPE-I TYPE-Il TYPE-Ill TYPE-IVHCV-1 HCV-J HC-J6 HC-J8HCV-H HCV-BK HC-J5 HC-J7HCT1 8,23,27. HC-J4 HCV-K2a HCV-K2bHCV-E1 HC-J2 clone AEC1,1O. HCV-K1GM1,2. HCV-JHHCV-J1 HCV-T3HCVPt-1 C8-2HC-J1* From Hayashi N, 1993; Okamoto H, 1992.8LITERATURE REVIEWBased on the comparison of sequence in different HCV isolates, it is revealed thatthey are different in both nucleotide and polypeptide sequences in NS3, NS4, NS5 andenvelope regions (Hayashi N, 1993; Choo Q-L, 1991; Takeuchi K, 1990). Among these,the protein containing an N-terminal hypervariable region of about 30 amino acids showslarge variation between nearly all isolates (Weiner AJ. et al., 1991). The hypervariationmay be a consequence of a strong selection pressure on a protective B cell or T cellepitope(s).The significance of HCV gene diversity is:1. Heterogeneity observed between different HCV isolates deserves close attentionwith respect to virus/host interactions, evolution of chronicity and vaccine development(Houghton M, 1991).2. Multiple infections are caused by different HCV agents, which is proposed bythe important clinical aspects investigated among the patients in United States, Japan andEurope (Weiner AJ, 1991; Simmonds P, 1990; Tsukiyama-Kohara K, 1992).3. The diversity of genome should be considered for the detection of viral RNA asthe primers are designed for PCR. Some research results show it is possible to increasethe sensitivity of PCR detection by using primers designed from both the most conserved5’ terminal region and the diverse region (Hideki H, 1992; Jenes B, 1992).9LITERATURE REVIEW2.5 DETECTION OF ANTI-HCV ANTIBODY AND HCV-RNA2.5.1 Detection of HCV AntibodyInitial development of ELISA by using recombinant 0100-3 as antigen (firstgeneration) has resulted in a large number of reports on the prevalence of HCV infectionand significance of detectable antibodies against HCV. Meanwhile, the unsatisfactorysensitivity of C100-3 ELISA is being reported by more and more investigators (John G,1992; McFarlane IG, 1990). Because heterogeneity of the HCV genome was furtherunderstood by nucleotide and peptide sequence analyses later, the reason for the poorsensitivity of 0100-3 ELISA has been realized. 0100-3 recombinant antigen is theexpression product of nearly all of the NS4 region of pro-isolate HCV-1. However, the NS4region is one of the diverse areas among different HCV genome groups (Choo QL, 1991;Juo G, 1989). It means that ci 00-3 ELISA is not capable of detecting antibodies againstall genotypes of HCV. Therefore, scientists are trying to find antigens expressed frommore conserved regions or combinations of different antigens for a more sensitive HCVantibody test. Now many antigens from different regions are artificially synthesized orrecombinantly expressed in E.coli for the ELISA and Recombinant Immunoblot Assay(RIBA) to monitor the antibody. The antigens and encoded genomic regions are shownin Figure 2. (Prohaska W, 1992; Hosein B, 1991; Nasoff MS, 1991; Okamoto H, 1990).Using the different recombinant antigens above, the following improved methodsare established for HCV antibody detection to increase the sensitivity (Table 3):10LITERATURE REVIEWGenomic location of Recombinant antigenssp75 sp67 8p65— __CP9 5-1-1— —CP1O C200—C22c C33 C100— —5’I I I I IC El E2/NS1 NS2 NS3 NS4 NS5Methods1. First Generation:2. Second Generation:3. Third Generation:4. Putative Core protein:1. First Generation:2. Second Generation:AntigensC100-3, or 5-1-1.ClOO-3, 5-1-1, C22c, C33c.C100, C22c, C200.CP 9, CP1O.C100-3, or 5-1-1.C100-3, 5-1-1, C22-3, C33c.Figure 2. HCV recombinant antigens and genomic location3,Table 3. Methods for anti HCV antibody detectionELISA:RIBA:11LITERATURE REVIEWAmong these methods, the second generation assay (John G, 1992), and putativecore protein ELISA (Okamato H, 1992) showed improved sensitivity and specificity overthe first generation 0100-3 assay as 10-30% additional cases of anti-HCV positiveindividuals were detected in high-risk groups and a larger number of patients with acutehepatitis were found positive during the acute phase (Bonino F,1993). The significantlylower sensitivity of the first-generation assay could be attributed to a prevalence of antiC100 lower than anti-C22 and anti-C33. The second generation RIBA is considered as thesensitive confirmatory test for antibody detection (Chaudhary RK, 1993; Vander Poel CL,1991).Although recent developments of anti-HCV antibody detection have markedlyimproved the sensitivity and specificity of serological tests, it still has several drawbacks:a. Delayed seroconversion in acute infection (around 6-8 weeks on a average);b. HCV infection in seronegative individuals;c. Difficulties in interpreting some indeterminate results;d. Absence of tests detecting HCV antigens and HCV multiplication.These problems can largely circumvented by the development of methods fordirect detection of HCV-RNA.2.5.2 Detection of HCV-RNADirect detection of HCV RNA aids the diagnosis of HCV infection in many ways.After the whole HCV genome had been identified, the method of Reverse TranscriptionPolymerase Chain Reaction (RT-PCR) was widely used to amplify the HCV-RNA in theserum and tissue biopsy specimens from the high risk group patients. Because the result12LITERATURE REVIEWof PCR is to show the existence of viral RNA, it is more valuable than antibody testing toindicate the active HCV infection. The PCR assay has provided valuable informationconcerning the viraemia status and thus may be a powerful tool to monitor therapeuticefficacy.The critical step of PCR assay for HCV-RNA detection is the correct design of theprimers. In order to perform general PCR assays, it is now clear that primers specific forthe 5’-terminus region should be used, since this region is highly conserved among allHCV isolates studied to date. This therefore excludes the possibility of missing viraemiabecause of sequence heterogeneity (as reviewed above). On the other hand, it isadvisable to design either the PCR primers or the hybridization probes in regions that arenot highly conserved to avoid potential misdiagnosis and detect the specific isolates (JeneB,1992).Several reports have described the RT-PCR methods on the serum, liver tissue andmononuclear blood cell specimens to detect the HCV-RNA by careful performance in theprocess of RNA extraction, reverse transcription, and PCR itself (Zaaijer HL, 1993; BrechotC, 1993; Hideki H, 1992). The main clinical applications of RT-PCR detection are indicatedas:a. Diagnosis of acute HCV infection and anti-HCV(-) patient with chronic hepatitis;b. Evaluation of HCV viraemia in asymptomatic blood donors with normal ALT levels;c. Demonstration of reinfection of liver graft after transplantation;d. Analysis of mother to child or sexual HCV transmission;e. Follow-up antiviral therapy.13LITERATURE REVIEW2.6 INTERFERON-a TREATMENT ON PATIENTS WITH CHRONIC HEPATITIS CUnfortunately, a large proportion (at least half) of the patients with acute NANBhepatitis progress to chronic liver disease despite the relatively mild nature of acutedisease (Koretz RL, 1985). Many cases of chronic hepatitis C have severe consequencessuch as cirrhosis, portal hypertension, and primary hepatocellular carcinoma (Alter HJ,1988). At present, only recombinant interferon is considered standard therapy for thetreatment of chronic hepatitis C (Hoofnagle JH, 1993; Hideki H, 1992).Interferons have been widely used in medicine during the past decade for theirwide variety of actions including antitumour, immunoregulatory, cytostatic, and above all,antiviral activity. Although lEN was discovered as an antiviral agent more than 30 yearsago, the biochemical mechanisms leading to the antiviral activity are still not completelyunderstood. In fact, lEN induces the production of several cellular proteins, but only afewhave been clearly correlated with the antiviral action. IFN acts by binding to a cell surfacereceptor which induces 3 proteins that prevent the translation of viral mRNA withoutaffecting the translation of cellular mRNA (Levinson WE, 1992):a. a protein kinase that phosphorylates an initiation factor for cell protein synthesis,thereby inactivating it;b. a 2,5-oligonucleotide synthetase that synthesizes an adenine trinucleotide;c. an endonuclease that is activated by the adenine trinucleotide and that degrades viralbut not cellular mRNA5.14LITERATURE REVIEWAs a natural choice of a possible therapeutic agent for viral infections due to itswide spectrum of antiviral activities, lEN has been used to treat many acute and chronicviral diseases. This agent has already been shown to inhibit replication of several humanhepatitis viruses, including hepatitis A virus (Vallbracht A, 1984), hepatitis B virus(Sherlock S, 1985), and hepatitis D virus (Hoofnagle JH, 1985). Several investigators havereported that recombinant alpha interferon therapy is effective in decreasing serum ALTlevels and improving liver histological findings in chronic hepatitis C (Hideki H, 1992;Michiko S, 1991; Gary L, 1989; Davis GL, 1989; Di Bisceglie AM, 1989).2.7. RESULTS AND PROBLEMS IN THE PREVIOUS STUDIES2.7.1 Predictors of Treatment ResponsePrevious studies show only 50% of patients with chronic hepatitis C respond tointerferon-a therapy. It would be helpful if there were clinical or serologic features thatwould predict which patients were likely to respond to therapy and which were not.Unfortunately, retrospective analyses from the controlled trials of interferon have failed toidentify any clinical, serum biochemical, serological or histological feature of disease thatreliably predicted a response to treatment (Hoofnagle JH, 1993; Saracco G, 1990).Importantly, the presence or titers of anti-H CV in serum did not identify patients who werelikely to have a response to interferon (Shindo M, 1991). These findings were in contrastto hepatitis B, where the decrease of serum aminotransferases and level of HBV-DNAidentified those who were likely to benefit from treatment (Perrillo RP, 1990). In somestudies, patients who lacked anti-HCV and who had cirrhosis histologically were less likelyto benefit from therapy (Marcellin P, 1991).15LITERATURE REVIEW2.7.2 Treatment Response and Suppression of HCV ReplicationThe relationship between response to interferon therapy and suppression of HCVreplication during the treatment of hepatitis C has not been carefully studied. Whether thisis due to the inhibition of HCV or to improved immunologic responses must await theavailability of direct tests for the virus. Hagiwara, H. et aL(Hagiwara H, 1993) evaluatedHCV RNA by an RT-PCR assay in serial serum samples during interferon therapy andfound that HCV RNA disappeared before ALT levels became normal in cases respondingto interferon and this viral marker reappeared before the rise of ALT in patients whorelapsed. In nonresponders, HCV RNA did not disappear. However, the problem in theirstudy is the insufficiently low detection limit of the RT-PCR assay on the serum samples.2.7.3 Limitation of Serum HCV-RNA DetectionThe detection limit of RT-PCR assay is ideally equivalent to a single copy of HCVRNA per sample. However, some loss and degradation of RNA fragments are likely in thesteps of serum preparation, RNA extraction and precipitation, as well as the reversetranscriptase reaction. Furthermore, interferon may shut down HCV RNA replication butnot lead to complete clearance of HCV genome in all liver cells. Therefore, to detect HCVRNA in liver tissue may be more sensitive than serum in characterizing the correlationbetween interferon therapy and viral activities, and predicting the chance of relapse.16LITERATURE REVIEWAll of these factors encouraged us to do further studies to investigate thetherapeutic functions of interferon by directly testing for the presence and quantity of viralRNA in both serum and liver tissue, and revealing the replication status of HCV during thechronic infection treated with interferon. In particular, the serial quantitative analyses ofHCV-RNA should be very useful for retrospective evaluation and prospective predictionof interferon treatment. We hope results from this study will lead to a deeperunderstanding of the therapeutic functions of interferon by the observation of treatmentresponses, and make some recommendation for further clinical trials in large group ofpatients.17CHAPTER 3MATERIALS AND METHODS3.1 COLLECTION AND PREPARATION OF SPECIMENSAll of the specimens were collected from the patients clinically diagnosed withchronic hepatitis C, subcutaneously administered with lENa 2b 3 MU 3 times weekly. Allof these were supervised by Dr.Frank H. Anderson in the division of gastroenterology,department of medicine, UBC, and Vancouver General Hospital.3.1.1 Collection of Specimens3.1.1.1 SerumAccording to protocol for the clinical trial, blood samples were taken from patientsat the time treatment was started and 1, 3, 6, 12, and 24 month later. After centrifugation,serum of each specimen was divided to three parts. Two of them were for liver functionand anti-HCV antibody tests, and the rest was frozen in -30°C for HCV-RNA detection.3.1.1.2 LiverLiver tissue samples were collected by needle biopsy before, and after the end oftreatment. Liver tissues were routinely formalin-fixed, paraffin-embedded, and sliced forpathological diagnosis. The rest of each specimen was chosen for HCV-RNA detection.3.1.2 Preparation of Specimens3.1.2.1 SerumIn order to do the quantitative PCR detection, each of the serum specimens wasserially 10 fold diluted from icY (undiluted serum) to 1010 before the reverse transcription.Briefly, lOOp I of18serum were mixed with 900pl of 0.1% diethyl pyrocarbonate (DEPC) ddH2O and vortexedfor 15 sec.. The same steps were repeated for further dilutions on previously dilutedserum up to the lowest concentration.3.1.2.2 LiverParaffin-embedded liver tissues were sliced and dewaxed before the HCV RNAextraction. Briefly, 5 pieces of tissues were mixed with 500pl of xylene in 1.5 ml Ependorftubes at 55°C for 15 mm.. After centrifugation at 12000 rpm for 5 mm., xylene wasdiscarded, tissue pellets were washed with 70% ethanol and dried at room temperaturefor HCV-RNA extraction.3.2 TEST OF LIVER FUNCTIONAspartate aminotransferase (AST) was tested on each of collected serumspecimens at reference laboratories for the liver function evaluation. Normal value of ASTranged between 19-38 lU/liter.3.3 TEST OF ANTI-HEPATITIS C VIRUS ANTIBODYAnti-HCV antibody was also detected in different reference laboratories by first orsecond generation ELISA assay. The results were recorded as negative or positive.3.4 DETECTION OF HEPATITIS C VIRUS RNAHCV-RNA from both serum and liver was detected by reverse transcriptionpolymerase chain reaction(RT-PCR) assay, which included the following steps: extractionof HCV-RNA, reverse transcription, first and nested-PCR amplification.19MATERIALS AND METHODS3.4.1 Extraction of HCV-RNA3.4.1.1 HCV-RNA extraction from serum specimensIn order to select the most sensitive and practical technique to obtain HCV-RNAfor reverse transcription, two major methods, extraction and non-extracted, weredeveloped. Sensitivities were compared between the two methods on same set of seriallydiluted serum specimens.Procedure:1. Extraction method (Abe K, 1992):1) lOopl of serum specimens were mixed with 4OQul of buffer A including 4.2Mguanidinum thiocyanate, 25 Mm Tris-HCI(pH 8.0), 0.5% sarcosyl, and buffer Bincluding 0.1M Tris-HCI, 10 mM EDTA, and 1% SDS.2) After through mixing, 5OQul of phenol/chloroform (1:1) were added, then the sampleswere heated at 65°C, 30 mm. with agitation.3) The samples were centrifuged at 13000 rpm for 5 mm., then the aqueous phase wastransferred to a fresh tube. The organic phase was extracted withphenol/chloroform once again.4) The two aqueous phases were mixed together, then extracted with chloroform alone.5) Two volumes of isopropanol and 1/10 volume 3M sodium acetate were added, andresulting mixture at -7cYC over 2 h.6) The samples were centrifuged at 15000 rpm for 20 mm., then pellets were washed with70% ethanol and air-dried.7) Finally the extracted RNA was dissolved in 2Qul of 0.1%DEPC ddH2O.20MATERIALS AND METHODS2. Non-extraction method (Ravaggi A, 1992):1) 5pI of serum or diluted serum was added to the bottom of 0.5 ml Ependort tube.2) The tube was heated at 92° C, for 45 sec., then stored at 4°C for reverse transcription.Finally, the non-extraction method was used for the detection of HCV-RNA onserum specimens from aIFN treated patients.3.4.1.2 HCV-RNA extraction from liver tissueHCV-RNA was extracted from the liver tissue according to the acid guanidiniumthiocyanate-phenol/chioroform extraction method with modification (Stanta 1991;Chomczynski 1987).Procedure:1) Dewaxed liver tissue was minced and homogenized with 500 p1 of lysing solutionincluding 4M guanidinum thiocyanate, 25 mM sodium citrate (pH 7.0), 0.5%sarcosyl, 0.1M 2-mercaptoethanol, then left at room temperature for 24 h.2) Sequentially, 5Opl of 2M sodium acetate (pH 4.0), 1 ml of phenol/chloroform/isoamylalcohol (25:24:1) were added to the homogenate, with thorough mixing byinversion after the addition of each reagent.3) After centrifugation at 13000 rpm for 10 mm., the aqueous phase was transferred toa fresh tube, mixed with 1 ml of isopropanol, and then placed at -20°C over nightto precipitate RNA.4) Centrifugation at 13000 rpm for 20 mm. was again performed and the pellet waswashed with 70% ethnol and air-dried.5) Finally the extracted RNA was dissolved in 20 p1 of 0.1%DEPC ddH2O. The21MATERIALS AND METHODSconcentration of extracted nucleotide was determined by spectrophotometerO.D. reading.3.4.2 Reverse TranscriptionUsing heated serum and extracted HCV-RNA from liver tissue as the template,HCV-cDNA was synthesized by reverse transcription assay.Procedure:1) Eiil of serum or extracted HCV-RNA was heated at 92C, 45 sec. for denaturation.2) The template RNA was incubated at 37° C, 60 mm. with 3ul of RT-Mixture containing400U Moloney Murine Leukaemia Virus (M-MLV) Reverse Transcriptase (BRL, MA),1 mM (each) dNTP (dATP, dCTP, dGTP and dTTP), 10 mM dithiothreitol, 400 ngB.S.A., 40U RNade, 1 mM outer anti-sense primer (for genomic form HCV-RNAdetection) or outer sense primer (for replicative form HCV-RNA detection), 3.7pllox Vent Buffer (100 mM KCI, 100 mM [NH4]2S0,200 mM Tris-HCI, 20 mMMgSO4, 1.0% Triton X-l0O).2) After heating the tubes at 95° C, 5 mm., synthesized HCV-cDNA was ready for PCR.3.4.3 Polymerase Chain Reaction3.4.3.1 Design of PrimersBased on sequence analysis of the HCV genome, the most conserved 5’ non-coding region was chosen for PCR amplification. The primer sequence, genome locationand product size are shown on Table 4 and Figure 3. The ratio of GC is 58.8%.22MATERIALS AND METHODSTable 4. HCV Drimer sequence, location and size of PCR ,,roductsPrimers Sequence Location SizeOuter 1. 5’ CTG TGA GGA ACT ACT GTC pos. 33 221 bp.2. 5’ MC ACT ACT CGG CTA GCA “ 253Inner 1. 5’ TTC ACG GAG MA GCG TCT 51 145bp.2. 5’ G1T GAT CCA AGA MG GAG 195Figure 3. Genomic location of PCR aroductsGenomic location of PCR Primers5’ C El E2/NS1 NS2 NS3 NS4 NS5 3’33 51 195 253______4—Hepi Hep2 Hep3 Hep4145 bp221bp —j23MATERIALS AND METHODSAs the internal control, a region of the 1-actin gene was detected on extractednucleotide from liver tissue. The primer sequence, genome location and product size arealso shown on Table 5. The ratio of GC is 58.7%.Table 5. (-actin rrimer sequence, location and size of PCR productsPrimers Sequence Location SizeOuter 1. 5’ GGG AAA TOG TGC GTG ACA pos. 658 477bp.2. 5’ ACT OGT CAT OCT GOT TGC T “ 1113Inner 1. 5’ GTG TGA CGT GGS OST COG CAA 893 208bp.2. 5’ CTG GAA GGT GGA CAG CGA GGC 10803.4.3.2 POR amplificationAfter RT, POR was performed according to the procedure below:Procedure:1) 37p1 of RT solution was added with 3 p1 POR mixure containing 1 mM outer senseprimer, 2U Vent°) DNA Polymerase (BioLabs,MA) in the final reaction condition,then each tube was topped with 2 drops of mineral oil.2) 30 cycles were run as follows: 98°C, 1 mm. for denaturation,45°C, 1 mm. for annealing,72°C, 1 mm. for extension,followed by 72°C, 7 mm. for final extension.24MATERIALS AND METHODS3.4.3.3 Nested-FOR amplificationAfter first POR amplification, the products were not visible on electrophoresis d gel.Therefore, nested-FOR was carried out on each specimen following first PCR to increasethe sensitivity.Procedure:1) 2p1 first FOR products was added with 38pl of nested-FOR mixure using the sameconditions as the first FOR except 1mM each of sense and anti-sense innerprimers.2) 30 cycles were run as follows: 98° 0, 1 mm. for denaturation,45°O, 1 mm. for annealing,72° 0, 1 mm. for extension,followed by 72° 0, 7 mm. for final extension.The products were ready for electrophoresis and endonuclease digestion.3.4.4 Specificity of RT-PCR System3.4.4.1 ElectrophoresisNested-FOR products were analyzed by electrophoresis assay.Procedure:1) 8 p1 of nested-FCR products mixed with 2 p1 of tracking dye were loaded in thewells of 3% NewSieve agarose containing 0.025% ethidium bromide.2) After running at 120V. for 40 mm., the gel was viewed and photographed on thelong wave ultraviolet light box.25MATERIALS AND METHODSlong wave ultraviolet light box.3.4.4.2 DNA typingAccording to genomic analysis, the nested-PCR product was incubated withto confirm the PCR results by distinguishing the pattern of digested products on the gel(Figure 4).Procedure:1)10 p1 of Nested-PCR products was mixed with 1 p1 of RsaI, 2 p1 of lOx buffer, andTpI of dH2O, then incubated at 3C for 60 mm.2) Digested DNA fragments were analyzed by electrophoresis.Figure 4. Rsal digested nested-PCR productsRsaI digested nested-PCR øroducts5’ C El E2INS1 NS2 NS3 N84 NS5 3’7IPCRNested PCR102 bp 43 bp26MATERIALS AND METHODS3.4.4.3 Southern blotThe nested-PCR results were confirmed by Southern Blot assay using cloned HCVcDNA as probe.Procedure:1) PCR products were transferred to nylon membrane.a) After electrophoresis, DNA was denatured by soaking the gel in several volumes of1.5M NaCl, O.5N NaOH solution with constant, gentle agitation for 45 mm..b) Neutralization was performed by soaking the gel in several volumes of 1 M Tris (pH7.4), 1.5M NaCI at room temperature for 30 mm. with constant, gentle agitation, thenrepeated once by changing the neutralization solution.C) The gel was placed on the support in a large baking dish filled with transfer buffer (lOxSSC), then put a nylon membrane, Whatman 3MM paper, paper towels, glass plateand 500 g of weight were placed on the top (Figure 5.).d) The transfer of DNA was allowed to proceed over night.e) The paper towels and 3MM papers were removed. The membrane was peeled off andplaced flat on a paper towel to dry for 30 mm..27500gMATERIALS AND METHODSweightglass platenitcello:efift Whatman 3MM paperWhatman 3MM paper________________________transfer bufferCapillary transfer of DNA from agarose gels. Buffer is drawn from a reservoir and passes throughthe gel into a stack of paper towels. The DNA is eluted from the gel by the moving stream ofbuffer and is deposited on a nitrocellulose filter or nylon membrane. A weight applied to the top ofthe paper towels helps to ensure a tight connection between the layers of material used in thetransfer system.*from Sambrook 1989.2) Nick translation for radioactive labelling probe:To get the template, Bluescript HCV CDNA was linearized by incubation with restrictionenzyme Xba I and Hinc II resulting in a 372bp long HCV cDNA segment of which waslocated in the HCV genome nt.7-378. The radioactive labelling probe was made by usinga Nick Translation Kit(BRL).a) Five p1 of each Solution A2, C, (a-32P)dCTP, 35 p1 of dH2O, and 1 pg templateDNA were added in the 5Opl of final reaction solution. There were 2OpM of eachdATP, dGTP, dTTP and (a-32 P)dCTP, 2 units of DNA polymerase I, 200 pg ofDNase I in the reation.b) The mixture was incubated for 1 h. in 15°C water bath, then 5pl of stop buffer wasadded.c) The probe was purified by passing it through a Spun-column. The probe was thenready to use.Figure 5. CaDillary transfer of DNA from ael28MATERIALS AND METHODS3) Hybridization of radiolabeled probes to immobilized PCR products:a) Wet membrane was put in heat-sealable bag. For each cm2 of membrane, 0.2 ml ofprehybridization solution including 6xSSC, 5x Denhardt’s reagent, 0.5% SDS, 50%formamide was added. The sealed bag was submerged at the 45° and incubatedfor 2 h. b) The bag was opened and added with 5Opl of denatured probe. Afterbeing resealed, the bag was Incubated at 45°C over night with agitation.C) The membrane was removed from the bag and washed 2 times with each of 2x SSCand 0.1% SDS, 0.lx SSC and 0.5% SDS. The membrane was placed on a flatpaper towel to dry for 30 mm.d) The membrane was covered with a sheet of wrap, and exposed to X-ray film at -2YCfor 24 h. After development, the film is ready for analysis.3.4.4.4 Positive, negative and internal controlsBoth positive and negative control samples were tested during the process of RTPCR detection.1) Positive control: a) synthesized HCV-RNA.b) previously HCV-RNA positive serum.2) Negative control: a) extracted RNA from biopsy liver with non-HCV infection.b) previously HCV-RNA negative serum.C) salmon sperm DNA.3) Internal control:The 1-actin gene, a ‘house-keeping” gene, was amplified at the same time with thedetection of extracted HCV-RNA from liver tissue.29MATERIALS AND METHODS3.4.5 Sensitivity of RT-PCR SystemThe goal of this thesis is focused on the study of interferon treatment responsethrough the observation of HCV-RNA viral replication as detected by quantitative RT-PCR,so quantification of the testing system is a very important step in the project. Thesensitivity of the RT-PCR method was determined by the detection of serially dilutedsynthesized HCV-RNA followed by the correlation between genomic numbers of templateRNA and cycles of PCR amplification. The following processes were carried out toquantitate the system. The cell transformation, sequencing, and in vitro transcription wereperformed in Dr.S. Gillam’s laboratory in Research Centre of U.B.C. with generousinstruction and help of Z.Y.Qiu and D.C.Yang.3.4.5.1 Multiplication of HCV-cDNApBluescript-HCV-cDNA which contains part of HCV-cDNA in pBluescript vector,was generously provided by Dr.G. Inchauspe in the New York Blood Center. The clonedHCV-cDNA was multiplied by cell transformation.Steps:1) Transformation of the recombinant plasmid into E.coli strain DH5a.2) Multiplication of E.coli by bacterial culture.3) Isolation and purification of plasmid DNA from transformant.3.4.5.2 Sequencing cloned HCV-cDNABased on the results of PCR detection, the cloned HCV-cDNA was found to be a30MATERIALS AND METHODSrelevant portion which the FOR could amplify. However, the border of inserted HCV-cDNAwas not known, so the sequence of cloned HCV-cDNA was identified by the dideoxysequencing method (Sanger F. 1981) on double strand DNA.Steps:1) Annealing of primer to double-stranded template DNA.2) Sequencing reactions.3) Electrophoresis.4) Autoradiography and analysis.3.4.5.3 In Vitro transcriptionAfter the sequence of cloned HCV-cDNA was identified, negative strand was usedas the template to synthesize the positive strand HCV RNA by in vitro transcription.Procedure:1) gug of plasmid DNA was linearized by/.2) Template DNA was incubated with 40U of T7 RNA polymerase for 90 mm. at 37°C inthe presence of 1mM (each) ribonucleoside triphosphates (GTP, ATP, UTP, andCTP), 100U of RNasin, 10 mM dithiothreitol, 40 mM Tris-HCI (pH 7.5), 6 mMMgCl2, 2 nM spermidine, and 10 mM NaCl in a total reaction volume of 4Qu1.3) After the transcription reaction, the DNA template was degraded by two rounds ofdigestion with RNase-free DNase I (BRL) for 15 mm. at 37°C with lOU and 5Uenzyme respectively.31MATERIALS AND METHODS4) The HCV RNA transcripts were purified by two time phenol/chloroform extraction,precipitated with isopropanol, washed sequentially with 70% and 95% ethanol, andthen analyzed by denatured agarose gel electrophoresis to assess its integrity.5) Finally, HCV RNA was determined spectrophotometrically by UV A260.3.4.5.4 Quantitative analysis of HCV-RNAAs soon as the synthesized HCV-RNA was obtained, it was quantitatively analyzed.Steps:1) The synthesized HCV-RNA was serially 10 fold diluted.2) Component analysis on the RNA: According to the sequence and the O.D. reading, theribonucleic acid composition and molecular weight of the RNA were determined.3) Genomic copies of the RNA were calculated by conversion from weight in differentconcentrations.32MATERIALS AND METHODS3.4.5.5 Correlation of PCR cycles and genomic copiesFinally, the sensitivity of the RT-PCR system was measured by detection of seriallydiluted HCV-RNA as above. Briefly, after RT, there were 30 cycles in the first-PCR,followed by 10, 20, 30, 40, and 50 cycles in the nested-PCR amplification. The positiveresults from the lowest concentration in different cycles were correlated with the numberof genomic copies in each serial dilution.3.5 DEFINITION OF CLINICAL RESPONSE TO TREATMENTThe clinical responses to IFN treatment were classified according to the followingdefinitions:3.5.1 Complete ResponseComplete response was defined as normalization of AST 1 month after receivingtreatment and at the end of treatment.3.5.2 Partial ResponsePartial response was defined as an AST level <1.5 times the upper limit of normaland <50% of the pretreatment value at the end of treatment.3.5.3 No ResponseNo response was defined as not meeting criteria above.3.5.4 RelapseRelapse was defined as AST elevation to at least 1.5 times the upper limit of normalat any testing interval after initial response or during the 6 months of follow-up period.33CHAPTER 4RESULTS4.1 RT-PCR DETECTION ASSAY4.1.1 Sensitivity Analysis4.1 .1 .1 Comparison of sensitivities between extraction and non-extraction methodsIn order to select the most sensitive and practical technique, the HCV-RNAextraction method was compared with the non-extraction method on the same seriallydiluted serum samples followed by RT-PCR. In the final results, after guanidinum lysingfollowed by phenol/chloroform extraction HCV-RNA was detected at a serum dilution of102, compared to a dilution of 106 with the non-extraction method (Figure 6). Thisindicates that the direct method is considerably more sensitive than the routine method,and different concentrations of HCV-RNA are detectable on serially diluted serum. Sincethe direct method is more sensitive and less time consuming, it was used for clinicalserum HCV-RNA detection.Figure 6. ElectroDhoresis gel from the comparative detection methods100 10’ 102 10 10 i0 106 i0 10No extraction100 101 102 i0 10 i0 106 i0 102‘J -1IExtraction34RESULTS4.1 .1.2 Quantitative analysis by standard detection on synthesized HCV-RNAThe RT-PCR detection assay was quantitatively analyzed by the detection ofsynthesized HCV-RNA, which consisted of sequencing HCV-cDNA, synthesis of HCVRNA, and quantitative detection of serially diluted HCV-RNA by RT-PCR.4.1.1.2.1 Sequence of cloned HCV-cDNAFigure 7. Sequence of pBluescriyt HCV-cDNA5’ T3 PromoterGGGAA CAAAA GCTGGA GCTCCA CCGCGGTGGCGGCCGCTCTA GAA CTAGTCCCC#GCGACACTCCACCATAGATCACTCCCCTGAGGAACTACTGTCTTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTC(T)GTGCAGCCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATA (C) A A CCCGCTCAATGCCTGGAGATTTGGGCGTGCCCCCGCA(G)AGACTGCTAGCCGAGTAGATGTTGGGTCGCGAAAGGCCTTGTGGTACTGCCTGATAGGGTGGTTGCGAGTGCCCCGGGAGGTCTCGTAGACCGTGCATCATGAGCACAAATCCTAAACCTCAAAGAAAAACCAAACGTAACACCAACC#7TGCCAGG7TCGA TA TCAA GC7TA TCGA TA CCGTC I GA CCTCGA GGGGGGGCCCHinc II 3’ T7 Promoter#HCV-cDNA: Length: 372bp.HCV genome nt. 7-378.35RESULTSThe sequence of pBluescript HCV-cDNA is shown in Figure 7. This is a 372bp longDNA fragment corresponded to HCV genome nt. 7-378.4.1.1.2.2 Synthesized HCV-RNAFigure 8 shows the sequence of 460nt long synthesized RNA which includes theHCV genomic RNA nt.7-378.Figure 8. Sequence of synthesized HCV-RNA from yBluescript HCV-cDNA5’ T3 PromoterGGGAA CAAAA GCUGGA GCUCCACCGCGGUGGCGGCCGCUCUAGAACUAGUCCCC#GCGACACUCCACCAUAGAUCACUCCCCUGAGGAACUACUGUCUUCACGCAGAAAGCGUCUAGCCAUGGCGUUAGUAUGAGUGUC(U)GUGCAGCCUCCAGGACCCCCCCUCCCGGGAGAGCCAUAGUGGUCUGCGGAACCGGUGAGUACACCGGAAUUGCCAGGACGACCGGGUCCTJITUCUUGGAUA(C)AACCCGCUCAAUGCCUGGAGAUUUGGGCGUGCCCCCGCA(G)AGACUGCUAGCCGAGUAGAUGUUGGGUCGCGAAAGGCCUUGUGGUACUGCCUGAUAGGGUGGUUGCGAGUGCCCCGGGAGGUCUCGUAGACCGUGCAUCAUGAGCACAAAUCCUAAACCUCAAAGAAAAACCAAACGUAACACCAACC# UUGCCA GGUUCGA UA UCAA GCUUA UCGA UA CCGUC#HCV-RNA: Length: 372bp.HCV genome nt. 7-378.Synthesized RNA: Length: 460nt.36RESULTS4.1.1.2.3 Quantitative analysis of serially diluted HCV-RNABased on optical density (O.D.) reading and identified sequence, the synthesizedHCV-RNA was quantitatively analyzed. Table 6. shows the components, molecularweight, and conversion to genomic copies of the RNA. Table 7 shows the correspondinggenomic copies of the template in serial dilutions used in reverse transcription.Table 6. Data of synthesized RNALength: 460nt.Components: A: 109. C: 135. G: 126. U: 90.M.W.: A: 109 x 347.23 = 37848.07C: 135 x 323.20 43632.00: 126 x 363.23 = 45766.98U: 90 x 324.19 = 29177.1Total: 156424.15O.D.: 235nm: 0.066260nm: 0.129280nm: 0.075Conversion of concentration to genomic copies:1) Concentration of synthesized HCV-RNA:0.129 x 40,ug/ml=5.16 x lcT3g/L5.16 x icr3 / 156424.15 = 3.29 x 1G8 M37-I*-J0)014()I\)LU) CD_L.L--G)C0 3G) CD0D:30C.JU)) (0 ><0-0z >cnQ0CDo)<U)o :3—)CDI0CooCDCci0.k0___L....__.I.__k.....i03:3*CII0-CD03o0)CoxCD-:3---o---_L x5. o oQ-o0qqU)RESULTS4.1.1.2.4 Correlation of PCR cycles and templet copiesThe sensitivity of the RT-PCR assay was evaluated by the detection of knownamounts of synthesized HCV-RNA in 10 fold serial dilutions at different cycleamplifications. After 30 cycles in first-PCR amplification, nested-PCR was respectivelyperformed in different cycles. Amplification signals were visible on the electrophoresis gelafter first PCR at 1 O molecules of HCV-RNA template. Typically, the sensitivities wereconsistently increased in proportion to the number of amplification cycles in nested PCR.Single copy of synthesized HCV-RNA became detectable as the amplification time wasincreased to 30 cycles (Figure 9, page 40). It appears that in order to obtain the bestresults by using the most reasonable hours, the optimum amplification cycle numberswere 30 for both first and nested PCR (Figure 10.). Based on the results, all of serum andliver tissue samples were detected by employing this condition.Figure 10. RT-PCT results correlated with nested-PCR cycles and temølate coniesSENSITIVITY OF RT-PCR0 5 10 15 20 25 30 35 40 45 50Cycles of nested-PCR3q6420RESULTSFigure 9. Electroihoresis gel of quantitative detectionsHr I0 IO Hr III III III” III” 10” I0 JO” IL)” JO” IL)” JO” C—)First PCRNested PURIt) ccIes20 cycles30 cycles50 cycles40RESULTSTo ensure that RT-PCR products resulted from amplification of RNA rather thanamplification of residual DNA present in the RNA preparation, reactions in which the RTstep was omitted were performed. As shown in lane 4-8 of Figure it, no products weregenerated from as many as 106 RNA copies in the absence of RT. However, productswere seen at input RNA levels of 108 or higher, which suggested: 1) the presence ofresidual DNA due to uncompleted digestion by DNaseI; or 2) possible low level of reversetranscriptase activity by DNA polymerase during DNA amplification.Figure 11. Results of PCR detection without RTCopies of HCV-RNA(+) 1012 1010 101 10’ 101 102 10°C—)41RESULTS4.1.2 Specificity Analysis4.1.2.1 ElectrophoresisThe fragments of nested PCR products were located at the position of 145bp whichwas the expected size.4.1.2.2 DNA TypingBecause the region amplified by PCR was located in the most conserved 5’ endof the HCV genome, restriction endonuclease was chosen to digest nested PCR productsto confirm the PCR results. According to genomic analysis, restriction endonucleasefiwas chosen to incubate with nested PCR products. As we expected, two pieces ofdigested DNA fragments were located at the position of 102 and 43bp. See Figure 12.Figure 1 2. Results of Nested-PCR and RsaI digested products12345678Lane:1. 8: lOObp Marker.2.4.6: 145bp Nested-PCR145w N products.lO2bp—43bp—’ 3.5.7: 102 & 43bp Rsa Idigested products.42RESULTS4.1.2.3 Southern BlotFigure 13. shows the positive results of southern blot carried out on the nestedPCR products from three patients. Southern Blot was not done on every PCR product,since we have too many PCR products (total 58 benches, and 600 reactions), and it isnot very necessary to do Southern Blot for each of them.Figure 13. Electrorhoresis gel and results of Southern Blot4.1.3 Clinical ApplicationAs soon as the RT-PCR method was established, it was used for clinical diagnosis.32 serum samples, from the patients with chronic hepatitis, liver transplantation donorsor recipients, and other unknown liver disease, have been tested. 25 of them (78%) werepositive for HCV-RNA.123456--ABLane:1: Positive ControlHCV-cDNA.2,3,4: Nested-PCRProducts.5.6: Negative Control.Panel:A: ElectrophoresisGel.B: Southern Blot.43RESULTS4.2 OBSERVATION OF SERUM HCV-RNA IN IFNa TREATED PATIENTSTwelve patients received lENa therapy for more than 6 months and none of themstopped treatment. All 12 were included in the study.4.2.1 Changes of Serum HCV-RNA during TherapyQuantitative RT-PCRs were performed to amplify the HCV-RNA from 5,uI of originalor diluted serum samples serially collected from the 12 patients over periods of 6 to 27months of IFN treatment. HCV-RNA titer for each specimen was recorded as the lowestconcentration of diluted serum as HCV-RNA was positive. HCV-RNA titers prior to, or atdifferent times in the lEN treatment for all patients are given in Table 8. The generalresponses of HCV-RNA were interpreted as follows:1) Prior to treatment, serum HCV-RNA was evident in the sera from all 12 patients. HCVRNA titers ranges between icP-i08,mean2) Initial responses were shown as the HCV-RNA titers fell in 7 of 12 (58%) patients. Thetiters were down between 101 -io, (mean 1026) after 3-6 months of treatment.3) HCV -RNA titers climbed again in 4 of 7 (57%) initial responders still receiving 3 monthslater.4) No patients were negative for HCV-RNA at 6 months into treatment. Eventually HCVRNA became undetectable in 3 patients continuing to receive lEN treatment at 12, 21, and24 months respectively). The patients with lower serum HCV-RNA titer before thetreatment had more chance to become HCV-RNA negative. Clearance of HCV-RNA44RESULTSoccurred in 2/3 patients with initial titers i0 but in only 1/9 with initial titers >102.6) Because none of these 12 patients stopped treatment at the time this thesis waswritten, final results of HCV-RNA status at treatment cessation and post treatment are notyet available.Table 8. HCV-RNA titers before and during treatmentNo. OM 3M 6M 9M 12M 15M 18M 21M 24M 27M 30M1. 102 io io io 1022. 1010 i05 io3. io 102 io id34. 10 102 101 1025. i0 102 -6. iO 102 102 1027. 1Q 102 102 101 1028. 102 102 102 1029. 101 101 101 10110. i02 i02 -10211. io 102 i02 io12. 102 102 10245RESULTS4.2.2 Three Patterns of HCV-RNA Detected in the PatientsAlthough most of the patients were persistently positive for HCV-RNA during thetreatment, three patterns of viraemia could be identified from the analysis of HCV-RNAtiters: decreased, increased and unchanged HCV-RNA levels.4.2.2.1 Decreased HCV-RNA titersEight (#1, 2, 4, 5, 6, 7, 8, and 9) of 12 patients showed constant trend towarddecreased serum HCV-RNA titers. Three patients (#5, 8, and 9) became HCV-RNAnegative in the final. Example for pattern I is shown in Figure 14 from patient #1. Titersof HCV-RNA were 1 5 before the treatment, and 1 o 3 months after treatment presumablydue to an initial response. Although the titer elevated to i07 3 months later, it fell downto 10’ at 15 months into treatment.Figure 14. Pattern of decreased HCV-RNA titerHCV—RNA DETECTIONPatient #1Serial Dilution log.0 2 4 6 8 10 12 14 16Months in treatment46RESULTS)4.2.2.2 Increased HCV-RNA titersOpposite to pattern 1, 2 of 12 patients (#3, 11) showed increased HCV-RNA titersduring the treatment. An example for pattern II is shown in Figure 15 from patient #3. Thetiters of HCV-RNA was lower before the treatment, but rose to peak values 9-12 monthsin the treatment, though initial responses were found in both patients.Figure 15. Pattern of increased HCV-RNA titerHCV-RNA DETECTIONPatient #3)140 2 4 6 8 10 12Months in treatmentJ 47RESULTS4.2.2.3 Unchanged HCV-RNA titersTwo (#10, 12) patients showed static titers of HCV-RNA during the treatment.Example from pattern 3 is shown in Figure 16 from patient #10. No matter how high thetiter was before the treatment, it remained unchanged during the treatment.Figure 16. Pattern of unchanged HCV-RNA titerHCV-RNA DETECTIONPatient #10Serum dilution log.)0.5-.-“-0•0 0 0 0 0-0.5-----------------—--—----—-—--—1— I I I I I I I I I Io 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30Months in treatment) 48RESULTS4.3 OBSERVATION OF LIVER HCV-RNA IN IFN-a TREATED PATIENTSAmong the 12 patients, 4 of them had liver biopsy before and after treatment. Bothgenomic and replicative forms of HCV-RNA were detected on the liver specimens. As theinternal control, B-actin mRNA was also detected by RTPCR among the extracted RNAsamples, to exclude the possibility that a negative result was due to RNA loss anddegradation during the process of preparation and extraction.Because it is difficult to control biopsy liver tissue in same volume, quantitativeanalysis was not available for HCV-RNA detection. The results were recorded as “-“ noband, ± ‘faint band”, “+“ definite band but not dense, and “+ -i-’ dense band, based onthe visually estimated density of band appearance of electrophoresed nested-PCRproducts.The results are shown on the Table 9. Both genomic (positive strand) andreplicative form (negative strand) were detectable in the liver specimens. However, Wecould not correlate liver HCV-RNA results with serum as well liver functions since we donot have enough specimens and the specimens were collected at different times fromsera.49RESULTSTable 9. HCV-RNA in the liver tissueHCV-RNA Patient #1 Patient #2 Patient #4 Patient #10-2M 12M -1M 11M -22M -9M 12M -6M 6MGenomic Form + ±- ± ± ± + + ± ±Replicative Form ± + + ± + + + + ± + + + ±4.4 OBSERVATION OF CLINICAL RESPONSE TO IFN-a TREATMENT4.4.1 Liver FunctionFor the observation of clinical response, all patients were tested for liver functionalmost at the same time as serum samples were collected for the HCV-RNA detection.The results of liver function, measured by aspartate aminotransferase (AST), are listed inTable 10. The general responses to IFNa treatment were described as following:1) Eight patients showed an initial response as determined by a decreased AST at the firsttime HCV-RNA was detected during treatment (3 patients at 3 months, 2 patients at 6months, 3 patients at 12 months). 4 of them (#3, 4, 9, 12) achieved a partial response.2) Seven of the 8 responders had recurrence of AST elevation 3 to 15 months lateralthough they were continuing to receive IFN treatment.3) Two patients were complete responders as demonstrated by normalization of AST504<-o—cDCD-<CDU)30P9’91P00CDj5D •0—-‘--_LIo_.f41U)r\)C))CA)-!0)-D0CO4401--CA)4-ho.-‘-—-‘CDCD1 CD-4CoCl)D-‘CD--CD—‘jCA)38CD0CD:3---IC))C_—DCA)01(0—J(Tic-CDDCDjro0)r\)00)gcD ci:3(Ti--Co(I)rcA)roC -‘rnCD.5ci-‘c)-‘-1CA)CA)0)0)0)—SI.-+—(I)01001-CD4(3)CA)CD3—-iCDo33DCDCA)010)ICD—(0(0-0)-+-0_0roIi3_-0)ci0COU)Q)C0)01CDQ(A)0(00kQ)roC_LIroCD1\)I40)-.—01CDCD3‘<0Ir\)(TiIci.00)I0(A)—Cl):3--1CDCi)RESULTS4.4.2 Correlation between Clinical Response and HCV-RNAThe results of serum HCVRNA and AST from the 12 patients are respectivelyshown in Figure 17. The relationship between clinical responses and serum HCV-RNAwas demonstrated as follows:1) 7 patients (#1,4,6,7,8,10,11) had roughly parallel patterns of both HCV-RNA titer andAST responses.2) AST decreased in 5 of 7 initial responders measured by serum HCV-RNA. In3 HCV-RNA negative converted patients, 1 (#8) had normal AST, 2 (#5, 9) hadslightly abnormal AST value.3) in 2 patients (#3, 11) with the pattern of increased HCV-RNA titers, AST respondedparallel with HCV-RNA in the first 6 months, and decreased later.4) in 2 patients with unchanged HCV-RNA titers. Patient #10 had no remarkable changefor AST, and patient #12 had a normal AST value at 6 month in the treatment.5) Among 4 patients with lower HCV-RNA titer (<1Q) prior to the initiation of treatment,2 (#8,12) of them had normal liver function, and 2 (#9, 11) had slightly abnormalAST levels. None of other 8 patients with HCV-RNA titer prior to treatmenthad normal liver function.6) It is not possible to do statistical analysis on the results above due to the small samplesize.52RESPONSETOIFNTREATMENTPatient#1Serumdilutionlog-ASTUI/literDelia MonthsIntreatmentHCV-RNAA.8.T.RESPONSETOIFNTREATMENTPatient#5SerumdilutionlogASTlu/literC100I14MonthsIntreatment-HCV-RKAA.5T.RESPONSETOIFNTREATMENTPatient#3SerumdilutionlogASTNJ/literRESPONSETOIFNTREATMENTPatient#6leo140120tOOCO Co 40SerumdilutionlogASTNJ/literC.100024CCID1214ICMonthsintreatment—s---UGV-RNA•A.5.T.RESPONSETOIFNTREATMENTPatient#2Serumdilutionlog.ASTlU/liter120tOOto CO 40 20tO C C 4 2200tOO2024CC1012HIC1820MonthsintreatmentHCV-ANA0240C101214MonthsIntreatment•HCV-RNA•A.8.t-I’-C CD -s I, CD -C F.0 0 -h C CD 0 C 3 I C) z 0 0. CD -C + )c)RESPONSETOIFNTREATMENTPatient#4SerumdilutionlogASTUI/liter4 3 2 0024CI101214Monthsintreatment-HCV-RHAA.S.1.Co 50 40 20CO CO 40 20:___oa46I201224*20202224262030MonthsIntreatment-•HCV-A•P.6.7.RESPONSETOIFNTREATMENTPatient#9Serumdilutionlog.ASTIU/Uter200240220\200000\ \40 2000246520U1426IS202224MonthsIntreatmentHCV-flNAAll.RESPONSETOIFNTREATMENTPatient#10Semendilutionlog.ASTlu/liter00 00SS‘•4020RESPONSETOIFNTREATMENTPatient#11SerumdilutionlogASTlU/literRESPONSETOIFNTREATMENTPatient#12SerumdilutionlogASTlU/liter160160200050 0-l02234567MonthsintreatmentHCV-RNA•A.S.T.RESPONSETOIFNTREATMENTPatient#7Serumdilutionlog.ASTlu/liter2-0.2-0.4-0.6-0.lRESPONSETOIFNTREATMENTPatient#8Serumdilutionlog.ASTlU/liter—50I.0 0.6p.IS-0.60240020U241610202224MonthsIntreatmentHGV-I2NAP.5.7.0.54 2024061012241420202224202030MonthsIntreatment—-HCY-RNAAlT.-10I2345675520MonthsIntreatmentHCV-RNA‘All.RESULTS4.5 RESULTS IN SUMMARY1. The specificity of the RT-PCR assay was verified by the Southern blot and DNArestriction digestion analysis performed on nested-PCR products.2. The sensitivity of RT-PCR assay was analyzed by a piece of recombinant HCVRNA which was in vitro transcribed from transcription vector HCV-cDNA. Amplificationfrom single copy of HCV-RNA was detected reproducibly by gel electrophoresis after 30cycles in both first and Nested-PCR amplification.3. HCV-RNA was quantitatively assayed by the RT-PCR method on 53 serumspecimens serially collected from 12 lENa treated patients and 9 paraffin-embedded liverspecimens from 4 of the patients above.4. Interferon-a had a preliminary beneficial effect on 7 of 12 (58%) patients at 3-6months into treatment as assessed by a fall in HCV-RNA titer. Four of 7 (57%) initialresponders relapsed 3 months later. Eventually HCV-RNA became undetectable in 3patients’ sera. Serum HCV-RNA titers showed parallel changes with liver function in 7patients. Two patient had normal AST level at 6 and 12 months in treatment. The patientswith lower serum HCV-RNA titers prior to initiation of treatment had a better therapeuticresponse.55CHAPTER 5DISCUSSIONRecently, interferon has been widely used and proved useful in the therapy ofhepatitis C. However most of the questions dealing with the efficacy of lEN treatment are:How is the rate of response in patients with chronic hepatitis C infection?Which parameter is the best one to monitor the treatment and predict the response?What are the possible reasons for poor response?What should the future studies focus on?5.1 EVALUATION OF INTERFERON TREATMENT ON HEPATITIS CIn order to evaluate the IFN therapeutic function in a larger sample size, 11 reportspublished in 1993 were reviewed to measure the IFN treatment responses. In addition tothe observation on the clinical features, biochemical responses of liver and viral markerswere measured in most cases for the evaluation of lEN treatment effects.5.1.2 IFN Treatment Effects on Liver Function510 patients were included in the 13 trials, and the treatment period rangedbetween 6-12 month. At the time of 3-6 months in the treatment, 325 (63.7%) of themwere normal in the ALT and were considered as initial response cases. However, 180 ofthem relapsed during the posttherapy follow up period. Eventually, 145 (28.4) patientswere normal in ALT and considered as the complete responders (Table 11).56DISCUSSIONThe results from our trial are similar to the results above although we do not havea big enough sample size. In total 12 patients, 8 (66.7%) had initial responses between3 to 12 month in treatment. Seven (87.5%) had relapse as judged by rising AST. At lastfollow-up, 3 (25%) patients had maintained normal liver function.Table 11. Interferon treatment effects on ALTlEN patient Normal Relapse Normal ReferenceNo. 3-6M >6M final 1993No. (%) No. (%) No. (%)1 a2a 234 143 (61.1) 84 (58.7) 59 (25.2) Alberti2 30 20 (66.7) 12 (60.0) 8 (26.6) Bosch3 a R 30 22 (73.0) 11 (50.0) 11(36.7) Yatsuhashi4 a2b 10 6 (60.0) 6 (100.0) 0 (0.0) Weiland5 a 53 28 (52.8) 11 (39.3) 17 (32.1) Hagiwara6 13 9 (69.2) 5 (55.6) 4 (30.7) Shibata7 a2a 13 7 (53.8) 6 (85.7) 1 (7.7) Douglas8 a 20 16 (80.0) 8 (50.0) 8 (40.0) Catilla9 a2b 30 18 (60.0) 7 (38.9) 11(36.7) Picciotto10 a2a 16 5 (31.2) 3 (60.0) 2 (12.5) Liang11 a 61 51(83.6) 27 (52.9) 24 (39.3) De AlavaTotal: 510 325 (63.7) 180 (55.4) 145 (28.4)57DISCUSSION5.1.2 IFN Treatment Effects on Serum HCV-RNAIn a total population of 146 patients from 7 trials, 70 (47.9%) patients becameserum HCV-RNA negative after 3-6 months, but 38 (54.3%) of them reverted to positiveat 6-12 months after the end of treatment. Only 32 (21.9) were still HCV-RNA negative 12months after treatment (Table 12). Our findings are consistent with these results. Seven(58%) patients had an initial response, and 4 (57%) initial responders relapsed 3 monthslater. It is interesting that serum HCV-RNA became undetectable in 3 patients after morethan 12 months of treatment, which indicates that long term treatment may have bettertherapeutic efficacy than the more common 6 month course.Table 12. Interferon treatment effects on serum HCV-RNAlEN Patient HCV RNA Negative ReferenceNo. 3-6M >12M 1993No. (%) No. (%)1 a ( 30 22 (73.3) 13 (43.3) Yatsuhashi2 a2b 10 5 (50.0) 0 (0.0) Weiland3 a 53 19 (35.8) 9 (17.0) Hagiwara4 13 9 (69.2) 5 (38.5) Shibata5 a2a 7 3 (42.9) 1 (14.3) Douglas6 a2b 17 9 (52.9) 3 (17.6) Picciotto7 a2a 16 3 (18.8) 1 (6.3) LiangTotal: 146 70(47.9) 32(21.9)58DISCUSSION5.2 MONITORING THE TREATMENT RESPONSE TO INFThe optimal duration of therapy is not currently known. Different patients mayrequire different lengths of treatment. What is needed is a means of monitoring treatmentthat would correctly identify when HCV has been cleared and a sustained clinicalresponse could be expected. Several clinical, serum biological, serological and histologicalfeatures have been analyzed as possible means of monitoring therapy in chronic hepatitisC (Table 13).Table 13. Potential means for monitoring theraiySerum aminotransferase levelsLiver histologyAntibody to HCV1gM antibody to HCVHCV-RNA in serumHCV-RNA in liverHCV antigen in liver59DISCUSSION5.2.1 Detection of HCV-RNA by RT-PCRTo monitor the therapeutic response to lEN, the virological markers, serum or liverHCV-RNA detected by RT-PCR, is being used in more and more clinical trials at thepresent. The results of RT-PCR directly reveal the status of virus replication. However,more and more concerns appear with the method of RT-PCR itself.5.2.1.1 Reliability of RT-PCRPolymerase chain reaction multiplies minute quantities of genetic material to adetectable level. Therefore, PCR is used to detect HCV-RNA, and the results of this assaymay have a bearing on management of patients. Therefore, the reliability of PCR itself iscritical for the detection of hepatitis C virus.With the aim of standardisation of HCV-RNA detection, a coded test panel of freshfrozen plasma samples were sent to 38 hepatitis C research laboratories in Europe, USA,and Japan (Zaaijer H.L., 1993). The final results showed that one-third of laboratories haderrors determining the status of undiluted samples and half of the laboratories had oneor more errors in the dilution series. Only 5 of 31 laboratories generated perfect results,and even these 5 laboratories reported a hundred-fold difference in sensitivity for thedilution series. This indicates that the results of HCV-RNA detection should be interpretedwith caution, and standardisation of HCV-RNA detection is a first requisite for reliable HCVinfection studies.More advantage of the HCV-RNA detection assay was reported by using therecently developed RT-PCR method which combined step of RT with PCR by using a newTag DNA polymerase with both DNA polymerase and reverse transcriptase functions.60DISCUSSIONImproved reliability of the assay may be beneficial for monitoring patients undergoingantiviral therapy to determine the treatment end point (Young KY, 1993).5.2.1.2 Quality control in this projectIn this study, great care was taken in each process to avoid both contaminationand poor sensitivity during the assay. To avoid the degradation of HCV-RNA, all of thedH2O used in the experiment was treated with O.1%DEPC, which is an inhibitor of RNase.The reliability of the result from each RT-PCR amplification was insured by the detectionof both negative and positive as well as internal controls in the same time. All of thespecimens in which results were considered as indeterminate were tested to confirm theresults. In the RT-PCR assay, the specificity was verified by the Southern blot analysesand restriction endonuclease digestion. In particular, the sensitivity was enhanced byperforming the direct non-extraction method and quantitative measurements on thesynthesized HCV-RNA template by moderate cycles for amplification.1) Direct RT-PCR method for HCV-RNA detectionUsually, the experimental steps are RNA extraction, reverse transcription and PCR.Guanidinum, SDS, or proteinase K are routinely used for serum lysing followed byphenol/chloroform, ethnol extraction. However, these methods are time consuming andRNA is lost during the different steps above. Since it does not need the steps for RNAextraction, the direct RT-PCR method is more sensitive than the conventional method. Inaddition, less manipulation minimizes the possibility of contamination, and reduces thehands-on work required.61DISCUSSION2) Quantitative analysis by synthesized HCV-RNADetermination of the efficiency of RT-PCR assays as applied to the detection ofHCV-RNA has been hampered by the lack of a method for growing large quantities ofvirus. Chimpanzee infectious dose-titered virus stocks are not useful for this purposebecause only infectious virus is measured. While measurement of infectious virus may beclinically relevant, it does not necessarily correlate with virus particle count, asdemonstrated previously (Garson JA, 1990). To obtain a direct measure of the analyticalsensitivity of our RT-PCR assay, we have used a transcription vector from which HCVRNA is in vitro transcribed and the RNA concentration is determined photometrically byUV By using such well-characterized templates, the analytical sensitivity of the RTPCR assay was found to be equal to a single copy of the RNA template when analyzedby gel electrophoresis.5.2.1.3 Significance of quantitative RT-PCRMost patients with chronic hepatitis C have HCV-RNA in serum in titers rangingfrom lO to io. Testing of serum from patients treated with lENa has shown that levelsof this viral marker decrease on treatment and HCV-RNA becomes undetectable in mostpatients with a beneficial response to treatment. Levels decreased only slightly or not atall in patients with no or only a partial response (Hoofnagle JH, 1993; Shindo M, 1991).In this study, 7 of 12 (58%) patients showed parallel change of both HCV-RNA titer andtransaminase. Especially, in 7 initial responders measured by serum HCV-RNA, 5 of themshowed improved transaminase. The patients with lower initial serum HCV-RNA titers (1O)had more likelihood of becoming HCV-RNA seronegative and of developing normal62DISCUSSIONtransaminase. Clearly, there are not enough patients for an adequate sample size in thestudy. Nevertheless, the preliminary results show that the quantitative analysis of HCVRNA has the potential to be used to predict and measure the treatment response fromIFN.HCV-RNA reappears in patients with a relapse after therapy is stopped and lossof HCV-.RNA, while correlating well with a response to lENa treatment, does not predicta sustained response (Hoofnagle JH, 1993). Obviously, in addition to HCV-RNA detection,other better markers are needed to assess and monitor therapy, and to provide guidancein when to initiate and when to stop therapy. Among these may be factors that regulatethe rate of viral replication.5.2.2 Measurement of 2’,5’-Oligoadenylate Synthetase ActivityAlthough the virological parameters in chronic viral hepatitis are seen to be veryimportant in evaluation of the response to IFN therapy, there are other biological aspectsthat could be taken into account for monitoring treatment. As being reviewed in chapter2, 2’,5’-oligoadenylate (2-5A) synthetase is an intracellular enzyme induced by interferon.Measurement of 2-5A levels may serve as a means to monitor the treatment of lEN.Serum ‘evels of this enzyme were evaluated in 25 patients affected by chronic hepatitisC and treated with recombinant IFN-a2b (Giannelli G. 1993). At the end of treatment, 14patients were classified as responders and 11 as nonresponders. Before therapy initiationno significant difference in (2-5A) synthetase levels among the patients were detected,while during therapy responders showed higher mean levels of 2-5A synthetase thannonresponders. An increase in the enzyme activity was observed after 1 month of63DISCUSSIONtherapy, and this trend was maintained in the following 2 months. The peak 2-5Asynthetase activity was found at the end of therapy. 2-5A synthetase levels werenegatively correlated with serum ALT.Although no definitive explanation has been provided for the presence of thistypically intracellular enzyme in the serum, it has been proposed that this may be due todegeneration or cellular lysis of lymphocytes (Sawai H, 1988). Because 25A synthetaseis an enzyme profoundly involved in the induction of the antiviral state induced by lEN, ithas been suggested that 2-5A synthetase levels during lEN therapy correlate with theefficacy of the lEN treatment (Shindo M, 1988). The results above indicate that suchcorrelation does exist also in patients with chronic hepatitis C. This study suggests that2-5A synthetase may be a useful marker to monitor lEN efficacy during lEN treatment andto predict the clinical response. As supplementary data, 2-5A synthetase may need to bedetected in all of the serum specimens in this study to compare with the HCV-RNAdetection results.5.3 REASONS FOR POOR RESPONSE TO IFN TREATMENT.Interferon is commonly used for treatment of type C hepatitis, but the effects arevariable and many factors may be responsible.5.3.1. Neutralizing antibodies against IFNIt is now well established that some patients undergoing treatment with interferon-a(lEN-a) produce antibodies that neutralize the activity of the lEN used (Trown 1983,Antonelli 1991). The clinical significance of these antibodies remains controversial. Some64DISCUSSIONtrials have suggested that the antibodies may have a negative effect on clinical response(Lok 1990). Patients who develop high titers of neutralizing antibodies often relapse andfail to respond again if given a large dose of the same IFN-a2 (Von Wussow 1991). It wasreported recently that anti-IFN antibodies developed in 32% of all lEN treated patients.Fourty percent of nonresponders developed anti-lEN antibodies compared to only 14%of responders (Douglas 1993). Three hepatitis C patients out of 15 who receivedrecombinant IFN-a2a therapy developed high levels of neutralizing antibody coincidentwith clinical relapse (Brand 1993). All of these data suggest that the antibodies may havean adverse effect on clinical response rate. It is necessary to detect the antibody on thesera of patients in our trial.5.3.2.Sequence Variation of HCV during Chronic InfectionRecent reports demonstrate that there is some viral variation during the chronicHCV infection. Sequence analysis demonstrated that the RNA sequence varied in thelarge envelope glycoprotein (E2/NS1) of hepatitis C virus in the interferon treated patientswith relapsing non-A, non-B hepatitis (Kumer U. 1993). These data provide evidence thatviral persistence may be due to the emergence of “escape mutants” in the hypervariableregion.5.3.3. Effects on IFN Treatment by HCV GenotypesThe responses to interferon treatment have been found to vary in patientschronically infected with the different HCV genotypes (Carreno V, 1993, Shino M, 1991).HCV can be classified into 4 types (as reviewed in chapter 2). In patients with type II andtype III virus infection, both liver function and serum HCV-RNA were observed at the end65DISCUSSIONof 8 weeks and 24 weeks in the interferon treatment (Takada N., 1993). The percentageof patients exhibiting a good response was significantly higher in the type Ill group thanin the type II group at both observation periods. During the post-treatment periods,relapse following complete response was found to be higher in type II group than Ill. Thefinal effects of interferon were significantly better in the type Ill than in the type II.Whether or not the typing results will predict the clearance or non-clearance ofHCV-RNA at the end of treatment remains to be proven in future trials, but the HCVgenotype identification before initiation of treatment seems useful to predict a therapeuticresponse.There are very few studies reported in Canada to introduce prevalence of differentHCV genotype infection and possible variation in the process of IFN treatment. In thisclinical trial, further studies should focus on the relationship between the HCV genotypeand lEN treatment efficacy. Especially, we need to know whether there is any genotypevariation in the process of IFN treatment, when the variation happened, and how thegenotype variation is correlated with therapeutic responses. Based on sequence analysis,the method of DNA typing could be used to analyze PCR products from both mostconserved and the hypervariable regions of HCV genome in the different periods of lENtreatment. The result should be very significant for the evaluation of lEN treatment, andmay provide a new sight to explain the possible reason for a poor response to lEN.66DISCUSSION5.4 THE FUTURE OF THERAPY OF HEPATITIS C5.4.1 Other Approaches to the IFN AdministrationIn recent years, it has been demonstrated that recombinant interferon is efficaciousin the treatment of chronic hepatitis C. Thus approximately 50-70% of patients treated with3MU trice weekly over 6 months normalize ALT values and show improvement in theirliver histology. However, the majority of patients suffer a reactivation of the liver diseaseat the end of treatment with an increase in ALT values. To improve the response rate,several following approaches may be tried in the administration of lEN:1) Higher doses of lEN;2) Prolongation of the treatment other period;3) Retreatment;4) Combination with other agents.5.4.2 Other Potential Agents for the Therapy of Hepatitis CAn important task to be carried out in the future is to find new antiviral agents(perhaps with in vitro systems of HCV culture), and to eradicate HCV-RNA from all thecompartments such as serum, peripheral blood mononuclear cells, and liver. Some ofpotential agents are listed in table 14.67DISCUSSIONTable 14. Potential agents for theraiw of chronic heratitis CAntiviralsribavirin acyclovir adenine arabinosidefoscarnet azathymidine dideoxynucleosidesganciclovir suraminBiologic response modifiersalpha-, beta-, and gamma-interferoninterleukins 2, 4, and 6colony-stimulating factorstumour necrosis factorImmunomodulatorsprednisone thymosin levamisoleIn summary, a major goal on the treatment of hepatitis C is the prevention of thehigh relapse rate after cessation of therapy and the improvement of the initial responserate. Thus, future antiviral therapy in chronic hepatitis C will help to fill in the gap inknowledge about the correct use of alpha-interferon but will also focus on newer antiviralagents that alone or in combination with interferon promise to provide a relatively safe buthighly effective therapy for all patients with liver disease due to hepatitis C.68REFERENCESREFERENCESAbe K, Inchauspe G, Shikata T, et al. 1992. Three different patterns of hepatitis C virusinfection in chimpanzees. Hepatology. 4: 690-5.Alberti A, Chemello L, Bonetti P. et al. 1993. Treatment with interferon(s) of community-acquired chronic hepatitis and cirrhosis type C. J Hepatot. 17(S3): Si 23-6.Antonelli G, Currenti M, Turriziani 0, et al. 1991. Neutralizing antibodies to interferonalpha: relative frequency in patients treated with different interferon preparations.J. tnt. 0/s. 163: 882-5.Bonino F, Brunetto MR, Negro F, et al. 1993. Hepatitis C virus infection and diseasediagnostic problems. J Hepatol. 17(S3): S78-82.Bosch 0, Tapia L, Quiroga JA, et al. 1993. An escalating dose regime of recombinantinterferon-alpha 2A in the treatment of chronic hepatitis C. J Hepatol. 17: 146-9.Brand CM, Leadbeater L, Bellati G, et al. 1993. Antibodies developing against asingle recombinant interferon protein may neutralize many other interferon-alphasubtypes. J Intert Res. 13(2): 1 21-5.Brechot C. 1993. Polymerase chain reaction for the diagnosis of hepatitis B and Cviral hepatitis. J Hepatol. 17(S3): S35-41.Carreno V. Marriott E, and Quiroga JA. 1993. Other approaches to the treatment ofchronic viral hepatitis. J Hepatol. 17(S3): S127-9.69REFERENCESCastilla A, Camps-Bansell J, Civeira MP, et a!. 1993. Lymphoblastoid a-interferon forchronic hepatitis C: a randomized controlled study. Am J Gastroen. 88(2): 233-9.Chaudhary RK, Andonov A, and Maclean C. 1992. Detection of hepatitis C virusinfection with recombinant immunoblot assay, synthetic immunoblot assay, andpolymerase chain reaction. J C/in Lab Anal. 7:164-7.Chomczynski P. Sacchi N. 1987. Single-step method of RNA isolation by acidquanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156-9.Choo QL, et al. 1989. Isolation of a cDNA clone derived from a blood-borne non-A,non-B viral hepatitis genome. Science 224: 359-62.Choo QL, et a!. 1991. Genetic organization and diversity of the hepatitis C virus. ProcNat! Acad Sd USA 88: 2451-5.Davis GL, et a!. 1989. Treatment of chronic hepatitis C with recombinant interferonalpha: a multicenter randomized, controlled trial. N Engi J Med 321: 1501-6.De Alava E, Camps J, Par-Mindan J, et al. 1993. Histological outcome of chronichepatitis C treated with a 12-month course of lymphoblastoid alpha interferon.Liver. 13: 73-6.Di Bisceglie AM, et al. 1989. Recombinant interferon alpha therapy for chronichepatitis C: a randomized, double-blind, placebo-controlled trial. NEnglJMed32l:1506-10.Douglas D, Rakela J, and Lin HJ. 1993. Randomized controlled trial of recombinantalpha-2a interferon for chronic hepatitis C.Oiges 0/s & Sd. 38(4): 601-7.70REFERENCESEsteban R. 1993. Epidemiology of hepatitis C virus infection. J Hepatol. 17(S3):S35-41.Garsori JA, et at. 1990. Enhanced detection by PCR of hepatitis C virus RNA. Lancet336: 878-9.Gary L, et a!. 1989. Treatment of chronic hepatitis C with recombinant interferonalpha. Engi J Med 321: 1501-6.Giannelli G, Antonelli G, Fera G, et al. 1993. 2’,5’-Oligoadenylate synthetase activityas a responsive marker during interferon therapy for chronic hepatitis C. J InterfRes. 13(1): 57-60.Hagiwara H, Hayashi N, Mita E. 1993. Quantitative analysis of hepatitis C virus RNAin serum during interferon alpha therapy. Gastroen. 104: 877-83.Han JH, et a!. 1991. Characterization of the terminal region of hepatitis C viral RNA:identification of the conserved sequences in the 5’ untranslated region and poly(A)tails the 3’ end. Proc Nat! Acad Sd USA 88: 1711-15.Hayashi N, Higashi H, Kaminaka K, et al. 1993. Molecular cloning and heterogeneityof the human hepatitis C virus(HCV) genome. J Hepato!. 17(S3): S94-107.Hideki H, et at. 1992. Detection of hepatitis C virus RNA in serum of patients withchronic hepatitis C treated with interferon-a. Hepato!ogy 15: 37-41.Hoofnagle JH, et al. 1985. Treatment of chronic delta hepatitis with recombinanthuman alpha interferon. Gastroenterology 88: 1665.Hoofnagle JH, Bisceglie AMD, and Shindo M, 1993. Antiviral therapy of hepatitis Cpresent and future. J Hepato!. 17(S3): S130-6.71REFERENCESHosein B, et al. 1991. Improved serodiagnosis of hepatitis C virus infection withsynthetic peptide antigen from capsid protein. Proc Nati Acad Sc) USA 88:3647-51.Houghton M, et al. 1991. Molecular biology of the hepatitis C virus: implication fordiagnosis, development and control of viral disease. Hepatology 14(2): 381-8.Jene B, et at. 1992. Importance of primer selection for the detection of hepatitis C virusRNA with the polymerase chain reaction assay. Proc Nat! Acad Sd USA 89: 187-91.John G, et al. 1992. Improved detection of hepatitis C virus antibodies in high-riskpopulations. Hepato!ogy 15: 19-25.Kato N, et al. 1990. Molecular cloning of the human hepatitis C virus genome fromJapanese patients with non-A, non-B hepatitis. Proc NatlAcadSci USA 87: 9524-8.Koretz RL, et at. 1985. Non-A, non-B post-transfusion hepatitis- a decade later.Gastroentero!ogy 88: 1251-4.Kotwal GJ. 1993. Routine laboratory diagnosis of hepatitis C virus infection. J Hepatol.17(S3): S83-9.Kumer U, Brown J, Monjardino J, et al. 1993. Sequence variation in the largeenvelope glycoprotein (E2/NS1) of hepatitis C virus during chronic infection. JInfect Dis. 167(3): 726-30.Kuo G, et at. 1989. An assay for circulating antibodies to a major etiotogic virus ofhuman non-A, non-B hepatitis. Science 224: 362-4.72REFERENCESLevinson WE, Jawetz E. 1992. Interferon. Medical Microbiology & ImmunologyAppleton & Lange 33: 154-5.Liang TJ, Rustgi V. Galun E, et al. 1993. HCV RNA in patients with chronic hepatitisC treated with interferon-a. J Med Virol. 40: 69-75.Liaw YF, Sheen IS, Lin SM, et al. 1993. Effects of prednisolone pretreatment ininterferon-alpha therapy for patients with chronic non-A, non-B (C) hepatitis. Liver.13(1): 57-60.Lok AS-F, Lai CL, Leung EK-Y, et al. 1990. Interferon antibodies may negate theantiviral effects of recombinant alpha interferon in patients with chronic hepatitis Bvirus infection. Hepatology. 12: 1266-70.Marcellin P. Boyer N, Giostra E, et al. 1991. Recombinant human alpha-interferonin patients with chronic non-A, non-B hepatitis: a multicenter randomized controlledtrial from France. Hepatology. 13: 393-7.Nasoft MS. et al. 1991. Identification of an immunodominant epitope within thecapsid protein of hepatitis C virus. Proc NatI Acad Sd USA 88: 5462-66.Mason WS. 1993. The problem of antiviral therapy for chronic hepadnavirus infection.JHepatol. 17(S3): S137-42.McFarlane 1G. et al. 1990. Hepatitis C virus antibodies in chronic active hepatitis:pathogenetic factor or false-positive result? Lancet 335: 754-7.Michiko 5, et al. 1991. Decrease in serum hepatitis C viral RNA duringalpha-interferon therapy for chronic hepatitis C. Ann of lnt Med 115: 700-4.73REFERENCESOkamoto H, et al. 1990. Enzyme-linked immunosorbent assay for antibodies againstthe capsid protein of hepatitis C virus with a synthetic oligopeptide. Jpn J Exp Med60: 223-33.Okamoto H, et a!. 1991. The 5’-terminal sequence of the hepatitis C virus genome.Jpn J Exp Med 60: 167-77.Okaoto H, et al. 1992. Antibodies against synthetic oligopeptides deduced from theputative core gene for the diagnosis of hepatitis C virus infection. Hepatology 15:180-6.Perrillo RP, Schiff ER, Davis GL, et af. 1990. A randomized controlled trial of interferonalpha-2b alone and after prednisone withdrawal for the treatment of chronichepatitis B. N Engi J Med. 323: 295-301.Picciotto A, Varagona G, Valle F, et al. 1993. Interferon therapy in chronic hepatitisC evaluation of a low dose maintenance schedule in responder patients. JHepatol.17: 359-63.Prohaska W, Schroeter E, Kaars-Wiele P. et al. 1992. Enzyme immunoassays for anti-hepatitis C virus antibodies improved specificity and analytical sensitivity bycombination of three different recombinant viral proteins in second generationtests. Eur J Cl/n Chem C/in Biochem 30: 397-404.Ravaggi A, Primi D, and Carini E. 1992. Direst PCR amplification of HCV-RNA fromhuman serum. PCR Methods and Applications. 1:291-2.Sanger F. 1981. Determination of nucleotide sequence in DNA. Science 214: 1205-10.74REFERENCESSaracco G, Rosina F, Torrani C, et at. 1990. A randomized controlled trial ofinterferon alpha-2b as therapy for chronic non-A, non-B hepatitis. J Hepatol.11:543-9.Sambrook J, Fritsh E.F, Maniatis .1989. Molecular Cloning 9.34.CoId Spring HarborLaboratory Press 1989.Sawai H, Taira H, Ishibashi K, et al. 1988. Detection of 2-5-oligoadenylate synthetaseactivity in serum and in supernatant of cultivated lymphocytes: response tointerferons or interferon inducers. Biomed Res. 9: 95-66.Sherlock S, et al. 1985. Treatment of chronic hepatitis due to hepatitis B virus. Lancet2:1343-6.Shibata M, Kumada T, Yamada M, et al. 1993. Effects of interferon-a on serumhepatitis C virus in patients with chronic hepatitis C. Diges Dis & Sci. 38(4); 608-11.Shindo M, Di Bisceglie AM, Cheung L, et al. 1991. Decrease in serum hepatitis Cviral RNA during alpha-interferon therapy for chronic hepatitis C. Ann Intern Med.115: 700-4.Shindo M, Okuno T, Matsumoto M, et al. 1988. Serum 2’-5’ oligoadenylate synthetaseactivity during interferon treatment of chronic hepatitis B. Hepatology. 8: 366-07.Simmonds P. et at. 1990. Hepatitis C quantification and sequencing in blood products,haemophiliacs, and drug users. Lancet 336: 1469-72.Stanta G, Schneider C. 1991. RNA extracted from paraffin-embedded human tissuesis amenable to analysis by PCR amplification. BioTechiques. 11; 3: 304-8.Takada N, Takase S. and Takada A. 1993. Effects of Genotypes of hepatitis C virus75REFERENCESon interferon treatment for chronic type C hepatitis. Gastroen Japonica. 28(2): 268-75.Takamizama A, et al. 1991. Structure and organization of the hepatitis C virusgenome isolated from human carriers. J Virol 65: 1105-13.Takeuchi K, et a!. 1990. Nucleotide sequences of core and envelope genes of thehepatitis C virus genome derived from human healthy carriers. Nucleic Acids Res18: 4626.Trown PW, Kramer MJ, Dennin RA, et al. 1983. Antibodies to human leucocyteinterferon in cancer patients. Lancet. i: 81-4.Vallbracht A, et al. 1985. Elimination of a persistent hepatitis A infection in cellcultures by interferon.The biology of the interferon system 1984. New York:Elsevier, 1985: 339-45.Van der Poe! CL, Cuypers HTM, Reesink HW, et a!. 1991. Confirmation of hepatitisC virus infection by new four-antigen recombinant inmmunoblot assay. Lancet 337:317-9.Von Wussow P. PraIle H, Hochkeppel HK. et a!. 1991. Effective natural interferon-atherapy in recombinant interferon-a-resistant patients with hairy cell !eukaemia.Blood. 78: 210-6.Weiland 0, Zhang YY, Widell A. 1993. Serum HCV RNA levels in patients withchronic hepatitis C given a second course of interferon alpha-2b treatment afterrelapse following initial treatment. Scand J Infect. 25: 25-30.76REFERENCESWeiner AJ, et al. 1991. Variable and hypervariable domains are found in the regionsof HCV corresponding to the flavivirus envelope and NS1 proteins and thepestivirus envelope glycoproteins. Virology 180: 842-8.Yatsuhashi H, Inoue 0, Inokuchi K, et al. 1993. Short and long-term effects ofinterferon on serum markers of hepatitis C virus replication. J Gastroen Hepatol.8: 1-6.Young KY, Resnick RM, and Myers TW. 1993. Detection of hepatitis C virus RNA bya combined reverse transcription-polymerase chain reaction assay. J Clin Micro.31: 882-6.Zaaijer HL, Cuypers HTM, Reesink HW, et al. 1993. Reliability of polymerase chainreaction for detection of hepatitis C virus. Lancet. 341: 722-4.77

Cite

Citation Scheme:

        

Citations by CSL (citeproc-js)

Usage Statistics

Share

Embed

Customize your widget with the following options, then copy and paste the code below into the HTML of your page to embed this item in your website.
                        
                            <div id="ubcOpenCollectionsWidgetDisplay">
                            <script id="ubcOpenCollectionsWidget"
                            src="{[{embed.src}]}"
                            data-item="{[{embed.item}]}"
                            data-collection="{[{embed.collection}]}"
                            data-metadata="{[{embed.showMetadata}]}"
                            data-width="{[{embed.width}]}"
                            async >
                            </script>
                            </div>
                        
                    
IIIF logo Our image viewer uses the IIIF 2.0 standard. To load this item in other compatible viewers, use this url:
http://iiif.library.ubc.ca/presentation/dsp.831.1-0087431/manifest

Comment

Related Items